Citation
Expression of genes involved in prostanoid synthesis in the endometrium and chorioallantois cow

Material Information

Title:
Expression of genes involved in prostanoid synthesis in the endometrium and chorioallantois cow
Creator:
Binta, Hilary
Publication Date:
Language:
English
Physical Description:
xi, 185 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Cattle ( jstor )
Endometrium ( jstor )
Estrus cycle ( jstor )
Luteolysis ( jstor )
Messenger RNA ( jstor )
Plasmas ( jstor )
Pregnancy ( jstor )
Prostaglandins ( jstor )
Secretion ( jstor )
Sheep ( jstor )
Animal Sciences thesis, Ph.D ( lcsh )
Dissertations, Academic -- Animal Sciences -- UF ( lcsh )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 2003.
Bibliography:
Includes bibliographical references.
General Note:
Printout.
General Note:
Vita.
Statement of Responsibility:
by Hilary Binta.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
030586753 ( ALEPH )
78276789 ( OCLC )

Downloads

This item has the following downloads:


Full Text










EXPRESSION OF GENES INVOLVED IN PROSTANOID SYNTHESIS IN THE
ENDOMETRIUM AND CHORIOALLANTOIS OF THE COW














By

HILARY BINTA


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE
UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE
REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA














ACKNOWLEDGMENTS

I would like to thank Dr. M. J. Fields for being my graduate advisor and chairman

of my supervisory committee. Without his constant encouragement and support it would

have not been possible to finish my dissertation. My thanks go to all of my committee

members (Drs. William Thatcher, Peter Hansen, Nancy Denslow and Maarten Drost) for

their valuable input and advice regarding my research. I would like to thank Dr. Shou-

Mei Chang for introducing me to most of the laboratory techniques that I used to conduct

my research. My thanks also go to Drs. Lokenga Badinga and Rosalia Simmen for

allowing me to use the facilities in their labs. I would also like to thank Allan Eldred and

the graduate students in our lab (Nicole Nichols and Elizabeth Johnson) for their

assistance and friendship during my stay in the lab.

I am grateful to the Institute for International Education for having offered me a

Fulbright Fellowship; and to Makerere University for granting me study leave to pursue

my graduate studies at the University of Florida. My gratitude also goes to University of

Florida for granting me an assistantship to complete my studies. I would like to thank my

family for their support throughout my education. My thanks also go to all of the

graduate students, faculty, and staff in the Department of Animal Sciences for their

friendship and assistance during my studies. I thank all of my friends especially Dr.

Edmond Kabagambe, Jurjen Luykx, Justin Sobota, and Eric Hiers for their constant

encouragement and support.








I would like to thank my wife Angela for all of the love, understanding, and

support that she gave me during my graduate studies. Last but not least, I would like to

thank my son Jeffrey for all of the happiness and love that he brings to my life.















TABLE OF CONTENTS

Page

ACKNOWLEDGEMENTS................. ..................... ............. ii

L IST O F T A B L E S .......................................................................... ............................ vii

LIST O F FIG U R ES ........................................................................... .................... ix

A B STR A C T ...................... ........ ......................................................................... xii

CHAPTER

S IN TR O D U C T IO N .................................................................... .... ................... 1

2 LITERATURE REVIEW ............................................................ .......................4
L uteolysis..................................................................... .......................................... 4
Functional Luteolysis...................................................... ........ ............... 7
Structural Luteolysis ................................................................. ......................8
Regulation of Prostaglandin Synthesis .................................................. 10
Inhibition of Luteolysis by the Embryo.......................................................................... 16
Resumption of Prostaglandin Synthesis after Maternal Recognition of Pregnancy.....21
Properties of the Key Elements Involved in Luteolysis.................................. .........22
Bovine O xytocin Receptor......................................................... ....................... 22
Oxytocin Receptor Signaling.......................... .................... ....................... 23
Regulation of Oxytocin Receptor ............................. .. ....................... 23
Prostaglandin H-Synthase-2....................... ..............................26
Structure of Bovine PGHS-2 Gene................... ... .............................26
Signal Transduction through PGHS-2 ........................................ ............ ....... 27
Regulation of PGHS-2 Gene Expression............................. ....................28
Prostaglandin F Synthase................................ .................................................. 30
Regulation of Prostaglandin F Synthase.............................. .....................32
Prostaglandin E Synthase............................................................. ..................... 33
Regulation of Prostaglandin E Synthase........................... ....................35
B ovine Luteal O T ..................................................... .................................... ......35








iv









3 RELEASE OF OXYTOCIN FROM OVARIAN VERSUS PITUITARY
TISSUES IN RESPONSE TO PGF2, IN OVARIECTOMIZED AND SHAM-
OVARIECTOMIZED COWS DURING THE PERI-IMPLANTATION PERIOD...40

In production ........................................................................ ....................................4 0
M materials and M ethods.............................................................. .......................42
R esu lts............................................................................... .....................................4 6
D iscu ssio n ...................................................... ................................... ....................5 1

4 EXPRESSION OF OXYTOCIN RECEPTOR, PROSTAGLANDIN G/H
SYNTHASE-2, E AND F SYNTHASES IN THE BOVINE ENDOMETRIUM AND
CHORIOALLANTOIS DURING THE ESTROUS CYCLE AND PERI-
IMPLANTATION PERIOD.................... .......... ......................57

Introduction ........................................................................ ....................................57
M materials and M ethods.............................................................. ....... ..............61
R esu lts............................................................................... .....................................89
D discussion .................................................................. ............................... .......... 112

5 GENERAL DISCUSSION AND CONCLUSIONS..................... .....................132

APPENDIX

A CONTRASTS FOR TREATMENT, PERIOD, TIME AND INTERACTIONS ......149

B DATA FOR OTR mRNA EXPRESSION.......................................................151

C DATA FOR 18S rRNA EXPRESSION.................... .... ...........................152

D DATA FOR PGHS-2 mRNA EXPRESSION ................... .....................153

E DATA FOR PGES mRNA EXPRESSION......................... .....................154

F DATA FOR PGFS mRNA EXPRESSION...................... ..........................155

R E F E R E N C E S ............................................................................. .............................156

BIOGRAPHICAL SKETCH ..................... ...............................185














LIST OF TABLES


Table page

2-1 Prostaglandin synthase enzymes that belong to the aldoketoreductase
superfam ily ................................ .... .................................. ...................... 32

2-2 Membrane associated proteins in eicosanoids and glutathione metabolism
superfam ily ................................................ .. ................ ... .............34

3-1 Experimental design for in vivo study to ascertain response of PGF2 or saline
on luteal OT release in peri-implantation cows ........................................43

4-1 Sequences of primers and probes used for RT-PCR................................... ..64

4-2 Least squares means for OTR, PGHS-2, PGES and PGFS mRNA in
intercaruncular endometrium of beef cows from day 7 to 18 of the estrous
cycle or pregnancy ............................................................. ... .....................90

4-3 Least squares means for OTR, PGHS-2, PGES and PGFS mRNA in inter-
caruncular endometrium of beef cows from days 0 to 18 of the estrous cycle......92

4-4 Least squares means for OTR, PGHS-2, PGES and PGFS mRNA in
intercaruncular endometrium of beef cows from days 7 to 50 of pregnancy ........93

4-5 Least squares means for OTR, PGHS-2, PGES and PGFS mRNA in the
chorioallantois of beef cows from days 30 to 50 of pregnancy..................... 95

4-6 Least squares means for OTR and PGHS-2 mRNA in caruncular endometrium
of beef cows from days 7 to 18 of the estrous cycle or pregnancy......................96

4-7 Least squares means for OTR and PGHS-2 mRNA in caruncular endometrium
of beef cows from days 7 to 18 of the estrous cycle............................................96

4-8 Least squares means for OTR, PGHS-2, PGES and PGFS mRNA in caruncular
endometrium of beef cows from days 7 to 50 of pregnancy................................98

4-9 Correlations between mRNAs for OTR, PGES, PGHS-2 and PGFS in
intercaruncular endometrium of beef cows on days 0, 3, 7, 14 and 18
of the estrous cycle.................................. ....... ..... ..............................101








4-10 Correlations between mRNAs for OTR, PGES, PGHS-2 and PGFS in
intercaruncular endometrium of beef cows on days 7, 14 and 18 of the estrous
cycle or pregnancy ................................... ........................ ......................101














LIST OF FIGURES


Figure pge

3-1 Experimental protocol for response of PGF2a or saline on luteal OT release
in peri-im plantation cow s .................................................. ........... .... 43

3-2 Least squares means ( SEM) plasma concentrations ofoxytocin in
ovariectomized and sham-ovariectomized PGF2a-treated cows, day 22
pregnant..................... ........................ ..............47

3-3 Least squares means ( SEM) plasma concentrations of oxytocin in
sham-ovariectomized PGF2a and saline-treated cows, day 22 pregnant................48

3-4 Least squares means ( SEM) plasma concentrations ofoxytocin in
sham-ovariectomized PGF2a and saline-treated cows, day 40 pregnant................49

3-5 Treatment by day of pregnancy by period interaction for oxytocin in
sham-ovariectomized cows, receiving PGF2a or saline on day 22 or 40 of
pregnancy ........................... ... ..... ......................... ................................ 50

4-1 Amplification plot showing serial dilutions of total RNA used in the validation
to quantitate O TR m RN A ............................................... .................... ... 70

4-2 Amplification plot showing serial dilutions of total RNA used in the validation
to quantitate 18S rRNA.................... ........... ...................... 72

4-3 Standard curve for estimation of efficiency of amplification of OTR gene for
validation of A CT m ethod......................................................74

4-4 Standard curve for estimation of efficiency of amplification of 18S rRNA
gene for validation of A A CT method............................. ......................76

4-5 Amplification plot showing serial dilutions of total RNA used in the
validation to quantitate PGHS-2 mRNA .................... ......................78

4-6 Standard curve for estimation of efficiency of amplification of PGHS-2
gene for validation of A ACT method................................................80

4-7 Amplification plot showing serial dilutions of total RNA used in validation to
quantitate PGES mRNA expression .................... .........................82









4-8 Standard curve for estimation of efficiency of amplification of PGES
gene for validation of A A CT method.............................. .................... 84

4-9 Amplification plot showing serial dilutions of total RNA used in
the validation to quantitate PGFS mRNA expression............................. ....86

4-10 Standard curve for estimation of efficiency of amplification of PGFS
gene for validation of A ACT method............................ .....................88

4-11 Oxytocin receptor concentrations in intercaruncular endometrium of beef cows:
cyclic-pregnant interaction by day 14-18. .................... .....................90

4-12 Prostaglandin G/H Synthase-2 mRNA concentrations in intercaruncular
endometrium of beef cows: cyclic-pregnant interaction by day 7 vs D14, 18......91

4-13 Regression curves for OTR, PGFS, PGHS-2 and PGES mRNA expression in
intercaruncular endometrium of beef cows from days 7 to 50 of pregnancy ........94

4-14 Oxytocin receptor and PGHS-2 mRNA concentrations in caruncular endometrium
of beef cows, cyclic-pregnant by day 14-18 interaction for OTR and day 7-14
for PG H S-2 ......................... .................. ...................................................97

4-15 Regression curves for OTR and PGHS-2 mRNA expression in caruncular
endometrium of beef cows from days 0 (estrus) to 18 of the estrous cycle...........99

4-16 Regression curves for OTR and PGHS-2 mRNA expression in caruncular
endometrium of beef cows from days 7 to 50 of pregnancy..............................100

4-17 Immunohistochemical staining of bovine OTR in representative sections of the
intercaruncular endometrium during the estrous cycle......................................105

4-18 Immunohistochemical staining of bovine OTR in representative sections
of the intercaruncular endometrium during the peri-implantation period ...........107

4-19 Immunohistochemical staining of bovine PGHS-2 in representative
sections of the intercaruncular endometrium during the estrous cycle................109

4-20 Immunohistochemical staining of bovine PGHS-2 in representative sections
of the intercaruncular endometrium during the peri-implantation period ...........1 11

5-1 Hypothetical model for the regulation of OTR, PGHS-2, PGES and PGFS
expression during the bovine estrous cycle ... .................................................146

5-2 Hypothetical model for the regulation of OTR, PGHS-2, PGES and PGFS
expression during the peri-implantation period .....................................148














Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

EXPRESSION OF GENES INVOLVED IN PROSTANOID SYNTHESIS IN THE
ENDOMETRIUM AND CHORIOALLANTOIS OF THE COW

By

Hilary Binta

December 2003

Chairman: Michael J. Fields
Major Department: Animal Sciences

Oxytocin (OT) produced by the corpus luteum (CL) and the neurohypophysis

augments pulsatile prostaglandin F2 (PGF2.) that ultimately leads to luteolysis. Enzymes

involved in the pathway for prostaglandin synthesis have a role in luteolysis and may

have important functions during the implantation period that influence embryo survival

or loss. Our objectives were:

1) To determine the effect of PGF2a on plasma OT in peri-implantation cows.

2) To determine how the expression of oxytocin receptor (OTR), prostaglandin G/H

synthase-2 (PGHS-2), and E and F synthases (PGES and PGFS) changes in the

endometrium of cyclic cows.

3) To ascertain the effect of the concepts on expression of prostaglandin synthesis

enzymes and OTR during the period of maternal recognition of pregnancy.








4) To determine whether OTR and prostaglandin synthesis system are re-established after

maternal recognition of pregnancy. To evaluate the role of OT during the peri-

implantation period, ovariectomized (Day 22) or ovarian intact (Days 22 and 40)

pregnant cows were challenged with either PGF2 or saline. A dose of 25 mg PGF2.

resulted in significant release ofluteal OT in Day 22 but not Day 40 cows. Expression of

OTR and PGES was high at estrus and low during the luteal phase. The PGHS-2 was

highly expressed during the late luteal phase, proestrus and from days 14 to 22 of

pregnancy. Expression of PGES decreased during the peri-implantation period. The

PGFS was expressed highly on Days 7 and 18 of the cycle and comparable days of

pregnancy, but was down-regulated later. Positive correlations were observed for

OTR/PGES, PGES/PGFS and OTR/PGFS.

It is concluded that the CL is capable of secreting OT in response to PGF2a during

the early peri-implantation period. The neurohypophysis is a source of plasma OT during

peri-implantation period. The low expression of OTR mRNA and protein during peri-

implantation and low luteal OT may not be adequate to initiate pulsatile PGF2a synthesis.

Increased expression of PGES at estrus may be involved in ovulation. Increased PGHS-2

may be beneficial during implantation. The low luteal OT, decreased expression of OTR,

PGFS and PGES during the peri-implantation period may enhance maintenance of

pregnancy.














CHAPTER 1
INTRODUCTION

During the estrous cycle in cattle, prostaglandin F2a secreted from the

endometrium plays an important role in luteolysis whereby it causes regression of the

corpus luteum and enables ovulation of a new follicle (Milvae et al., 1996). Prostaglandin

F2a also plays an important role during parturition through its actions to cause contraction

of the uterus. Prostaglandin E2, on the other hand, is involved in cervical relaxation during

estrus and parturition (Mizrachi and Shemesh, 1999; Fuchs et al., 2002). Prostaglandins

are synthesized by hydrolysis of membrane phospholipids by phospholipases to

arachidonic acid. Arachidonic acid is converted to PGH2 by cyclooxygenases

(Prostaglandin G/H synthases). The PGH2 is converted to either PGF2. or PGE2 by

prostaglandin F synthase (PGFS) or prostaglandin E2 synthase (PGES) respectively.

Prostaglandin E synthase stimulates PGE2 which is implicated in the implantation process

(Emond et al., 1998; Leung et al., 2000).

During early stages of pregnancy, a change in the pattern of synthesis of

prostaglandin synthesizing enzymes is necessary to enable the embryo to inhibit the

luteolyic PGF2a pulses that occur towards the end of the cycle. Failure of this to occur

may lead to luteolysis and pregnancy loss and could be a potential cause for infertility in

cattle. For the embryo to survive, it must secrete adequate interferon-tau (IFN-i), the

signal for maternal recognition of pregnancy, to depress the pulses of PGF2. and sustain

pregnancy (Thatcher et al., 1995; Robinson et al., 1999; Mann and Lamming, 2001).








Oxytocin is produced by the large luteal cells from the corpus luteum (CL) as well

as the neurohypophysis (McCracken et al., 1995; Fields and Fields, 1996). Studies have

indicated that OT plays a modulatory role in the luteolytic process (Kotwica et al., 1997).

During pregnancy, OT-containing luteal granules are released at about the time

when implantation is taking place (Melton et al., 1951; King et al., 1982; Fields et al.,

1987; Wooding and Flint, 1994). A possibility exists that during the release of these OT-

containing granules, luteolytic pulses of PGF2a could be initiated. An active OT/OTR

system may be functionally coupled to the prostanoid system during this period and in

circumstances where the luteotrophic signals are not strong there could be the possibility

of failure to establish and maintain pregnancy (Mann and Lamming, 2001). Exogenous

OT has been shown to interfere with embryonic development and resulted in reduced

pregnancy rates when administered to cows during 5 to 8 days of pregnancy (Lemaster et

al., 1999). Furthermore, premature uterine secretion of PGF2a has been shown to lead to

short luteal phases and early embryo loss in cattle (Copelin et al., 1987; 1989). Bridges et

al. (2000) suggested that PGF2a secreted by the endometrium or embryo may be

beneficial for maintenance of pregnancy but concentrations beyond some threshold can

lead to luteal regression and loss of pregnancy. It is important to know whether PGF2Q

causes release of these granules since OT could augment luteolytic pulses in case an

embryo does not produce sufficient interferon-T (IFN-t) or if the CL does not produce

sufficient progesterone to sustain pregnancy. The luteolytic machinery becomes

reestablished after maternal recognition of pregnancy, since neither temporary presence

of the concepts or IFN-T infusion into the uterus extends the CL lifespan more than a

few days (Northey and French, 1980). Thus post-implantation synthesis of PGF2z








synthesis is important since activation of PGF2a after maternal recognition of pregnancy

may lead to pregnancy loss.

Although the expression of endometrial PGHS-2 and OTR have been well

described during the estrous cycle and early pregnancy in cattle, no comprehensive study

has looked at the change in expression patterns of PGHS-2, PGES, PGFS and OTR

before, during and after maternal recognition of pregnancy using comparisons between

cyclic and pregnant cows on similar days. The results from this study will increase our

understanding about peri-implantation events and may prove useful in strategies to

minimize embryo losses during this period.

The first objective of this dissertation was to determine the effect of PGF2a on

plasma OT in beef cows during the early (day 22) and late (day 40) peri-implantation

period. The second objective was to determine how OTR and the prostaglandin

synthesizing enzymes change during the process of luteolyis. The third objective was to

ascertain the effect of the concepts on PGF2a synthesis during early stages of pregnancy.

The final objective was to determine whether the OTR and the prostaglandin synthesis

system are re-established after maternal recognition of pregnancy.














CHAPTER 2
LITERATURE REVIEW


Luteolysis

Luteolysis is the process by which a functional CL is converted into a non-

functional corpus albicans. It occurs at the end of the estrous cycle or at the end of

pregnancy. Prostaglandin F2, is the luteolytic agent that is released from the uterus and

transported to the CL where it induces luteolysis. It is usually released in a series of

pulses (Nancarrow et al., 1973). Transfer of PGF2. to the uterus involves a

countercurrent mechanism (Thatcher et al., 1984) as well as systemic delivery (Ward et

al., 1976). The fact that both systemic and local transfer of PGF2. occur in cows is further

supported by the finding that only 65% of [ H] PGF2, is metabolized in one passage

through the lungs of cows (Davis et al., 1985).

Luteolysis involves changes in expression of many genes in the small and large

luteal steroidogenic cells and the endothelial cells within the CL (Mamluk et al., 1998;

Ivell et al., 1999; Meidan et al., 1999). Endothelin-1 (ET-1) plays an essential role in

PGF2,-induced luteal regression (Meidan et al., 1999) and lack of ET-1 in early bovine

CL has been attributed to their refractoriness to exogenously administered PGF2,. The

mechanism of refractoriness is not well understood but has been attributed to several

factors. Endothelins (ET) are initially synthesized as precursor proteins called preproETs

(ppT) that are first cleaved to generate big ETs and then processed to active peptides by








endothelin converting enzyme (ECE). Endothelin converting enzyme-1 (ECE-1) cleaves

inactive big ET-1 to active ET-1 peptide (Levy et al., 2003). Prostaglandin F2a regulates

the amount of mRNA encoding ECE-1 in a cycle-phase specific manner, being

constitutively expressed in CL at days 4 and 10 of the estrous cycle (Wright et al., 2001).

The pulsatile release of OT by the neurohypophysis and CL stimulates the production of

pulsatile uterine PGF2a (Goff, 1991). Oxytocin stimulation of PGF2a increases at

luteolysis (Lafrance and Goff, 1985). Increase in response to OT is due to the increase in

number of OTR (McCracken et al., 1999). Oxytocin binds to endometrial OTR to

stimulate PGF2a production (Roberts et al., 1976, Silvia et al., 1991). The initial release

of PGF2a triggers release of additional OT from the CL by a positive feedback loop (Flint

et al., 1990). Whereas PGF2, is luteolytic, PGE2 is luteotrophic (Pratt et al., 1977; Bazer

et al., 1991).

In vitro, PGF2a is synthesized in greater quantity in epithelial cells than in

stromal cells, whereas stromal cells synthesize more PGE2 than epithelial cells (Fortier et

al., 1988; Desnoyers et al., 1994). Recombinant ovine IFN-T and recombinant bovine

IFN-T preferentially stimulate PGE2 in epithelial cells and both prostaglandins in stromal

cells (Asselin et al., 1997a). Asselin et al. (1997a) suggested a role for PGE2-9-

ketoreductase (9K-PGR) which converts PGE2 to PGF2a. The presence of 9K-PGR in the

endometrial epithelial cells could lead to synthesis of more PGF2a whereas its absence in

the stromal cells would lead to a net accumulation of PGE2. Alternatively IFN-T may

inhibit or downregulate 9K-PGR activity in epithelial cells so that PGHS-2 is upregulated

resulting in an accumulation of PGEz (Asselin et al., 1997a). However, there are now

doubts that 9K-PGR exists in the bovine endometrium. There exists a positive feedback









pathway in the CL of cattle whereby a small amount of PGF2a stimulates intraluteal

production of PGF2, due to induction of PGHS-2. Critical regulation of this positive

feedback pathway is mediated by protein kinase C (PKC)-mediated activation of

transcriptional factors that interact with the E-box in the 5'- flanking region of the PGHS-

2 gene (Diaz et al., 2002).

Corpus luteum growth necessitates increased vasculature and several factors have

been implicated in this vascular growth (Webb et al., 2002). The angiogenic factors,

fibroblast growth factor and vascular endothelial growth factor are involved in regulation

of luteal function (Redmer and Reynolds, 1996). The major histocompatibility complex

(MHC) proteins may also play a role during luteolysis. Changes in MHC expression on

luteal cells have been implicated in T lymphocyte-mediated immune response during

luteolysis (Penny et al., 1999). Insulin-like growth factors (IGF-I and IGF-II) are intra-

ovarian factors that have been reported to modulate luteal function and luteal

steroidogenesis by changing LH receptor stability in granulosa cells (McArdle and

Holtorf, 1989; Hirakawa et al., 1999).

Controversy still exists on the role of OT during luteolysis although numerous

studies have demonstrated that OT is crucial for luteolysis in cattle (Lamming and Mann,

1995; Bums et al., 1998). However, other studies suggest that luteolysis can be initiated

without OT. Kotwica et al. (1997) showed that continuous blockade of OTR using a

specific OT antagonist from day 15 until estrus did not affect luteolysis. This led to the

suggestion that OT may play a permissive role or may contribute to the completion of

luteolysis once it has begun (Kotwica et al., 1997).








Schams et al. (1985) observed a decrease in OT secretion after midluteal phase of

the estrous cycle in hysterectomized cows, suggesting that the PGF2a synthesized in the

uterus stimulates release of OT during luteolysis. Blair et al. (1997) showed that luteal

and plasma concentrations of OT during spontaneous and induced luteolysis in heifers

remained unaltered when measured using an in vivo microdialysis system.

Oxytocin from the neurohypophysis appears to be released in a pulsatile way to

initiate PGF2, secretion from the uterus (Silvia et al., 1991). Responsiveness of the uterus

to OT increases at luteolysis when endogenous pulsatile secretion of PGF2a has begun.

Progesterone promotes accumulation of arachidonic acid and PGHS-2 in the uterus, thus

ensuring that luteolysis occurs at the appropriate time (Silvia et al., 1991).

Functional Luteolysis

Functional luteolysis is the reduction in progesterone concentration associated

with the luteolytic process caused by PGF2a (McCracken et al., 1999). It has been

attributed to several factors, namely a change in luteal membrane composition and

decreased fluidity which may prevent luteinizing hormone (LH) receptor aggregation and

blocking LH function. This could prevent coupling to adenylate cyclase and cause a

decline in cyclic adenosine monosphosphate (cAMP) and progesterone synthesis

(Henderson and McNatty, 1975). In addition, PGF2I activates the phospholipase C

(PLC) pathway leading to an increase in calcium ions in the large luteal cells which is

associated with luteolysis (McCracken et al., 1999). The PGF2a exerts antisteroidogenic

effects that involve synthesis of progesterone from cholesterol. It may also affect

luteolysis by altering luteal blood flow to the ovary with the CL. Decreased ovarian blood

flow has been suggested as one of the mechanisms by which PGF2, leads to luteolysis








(Niswender et al., 2000). It has recently been shown that there is increased blood flow

which parallels increased CL volume and plasma concentration of progesterone from

days 4 to 6 of the estrous cycle (Acosta et al., 2002). It was further observed that mid-

cycle CL have decreased blood flow suggesting that the lack of intraluteal vascular

response to PGF2a may be one of the reasons for early cycle CL failure to respond to

PGF2a (Acosta et al., 2002).

Structural Luteolysis

Structural luteolysis involves involution of the CL. Several factors have been

implicated in structural luteolysis including tumor necrosis factor at (TNFa) that has been

shown to inhibit LH-induced progesterone production in bovine luteal cells (Benyo and

Pate, 1992). Monocyte chemoattractant protein expressed in the CL acts as a mediator of

invasion of immune cells that are involved in phagocytosis as well as production of

cytokines which play a role in structural luteolysis (Tsai et al., 1997).

Matrix metalloproteinase-2 (MMP-2) is localized in the bovine luteal endothelial

cells and is involved in angiogenesis in the CL (Zhang and Tsang, 2001). Membrane type

1 matrix metalloproteinase (MT1-MMP) activates pro-MMP2 to MMP-2. Active MTI-

MMP and MMP-2 are increased coordinately in mid to late stage bovine CL and may be

involved in digestion of extracellular matrix and structural regression of the CL (Zhang et

al., 2002). Tissue inhibitors of metalloproteinases (TIMP) are produced by the CL to

inhibit the actions of tissue metalloproteinases that are involved in tissue remodeling of

the extracellular matrix. In particular TIMP-I in the bovine CL increases tremendously

24 h after PGF2,-induced luteolysis (Smith et al., 1996).








During structural luteolysis, cells of the CL undergo apoptosis (Juengel et al.,

1993; Rueda et al., 1997). Immune cells (macrophages and T-lymphocytes) have been

reported to play a role in structural luteolysis (Penny et al., 1999). It is seems that this

mechanism is mediated by the Fas-Fas ligand system. T-lymphocytes express the Fas

ligand and TNFa whereas macrophages are the main source of the TNFa. The Fas

antigen is a member of the TNFu family of receptors that interacts with its ligand to

induce apoptosis (Nagata and Goldstein, 1995). Structural luteolysis is enhanced by the T

cells sending apoptotic signals to the luteal cells where Fas expression is induced by

leukocyte-stimulated cytokines such as TNFu and interferon gamma (IFN-y). It has been

shown that IFN-y by itself reduces the viability of bovine luteal cells and its cytotoxic

effect is augmented when combined with TNFa (Taniguchi et al., 2002). However, TNFa

has no effect on bovine luteal cell death until day 5 oft uliurc i Ben ., and Pate, 1992).

The Fas mRNA is expressed highly in bovine luteal cells about the time of luteolysis

implicating its role in apoptosis-mediated structural luteolysis (Taniguchi et al., 2002).

The TNFa is secreted by macrophages in response to PGF2. in the CL (Wuttke et al.,

1997). Its effects are mediated via the tumor necrosis a receptor 1 (TNFR1) whose

mRNA was shown to be expressed in endothelial and steroidogenic cells of the bovine

CL with highest expression in endothelial cells (Friedman et al., 2000). Furthermore,

TNFR1 was expressed highest on days 18 21 during the time of luteal regression

(Friedman et al., 2000).

Luteal endothelial cells also express progesterone receptor which protects against

programmed cell death. Endothelial cell-derived ET-I causes a decline in steroidogenic

activity thus leading to functional luteolysis (Meidan et al., 1999). However, ET-1 may








also lead to structural luteolysis via a mechanism where it regulates apoptosis. Friedman

et al. (2000) proposed that, during luteolysis, PGF2a stimulates secretion of ET-1 and

macrophages secrete TNFa. There is a synergistic effect between TNFa and ET-1 to

inhibit steroidogenesis and reduce progesterone secretion. This leads to increased

expression of TNFR1 and thus facilitates TNFa induced apoptosis and structural

luteolysis (Meidan et al., 1999).

Regulation of Prostaglandin Synthesis

Prostaglandin is the luteolytic agent in cows and its regulation is dependent on

several pathways that involve OT, steroids and cytokines (Okuda et al., 2002). The

production of PGF2a in the bovine endometrium is regulated by estrogens and

progesterone at two levels, basal and OT-stimulated (Skarzynski et al., 1999).

Progesterone has been shown to stimulate basal production of PGF2a in endometrial cells

(Xiao et al., 1998). The stimulatory effect may be associated with post-translational

events since it has been shown that progesterone stimulated basal PGF2a synthesis in

bovine endometrial cells but did not increase expression of either PGHS-2 or PGFS

mRNA (Asselin et al., 1996; Xiao et al., 1998; Skarzynski et al., 1999; Okuda et al.,

2002).

Progesterone is the principal regulator of endometrial PGF2a secretion during the

intraluteal phase (Skarzynski et al., 1999). Both OT and progesterone increased PGF2,

synthesis from bovine endometrium in vitro. Estrogen alone had no effect but augmented

that of progesterone (Skarzynski et al., 1999). Further evidence of progesterone

regulation comes from studies which have shown that PGF2. and PGE2 concentrations








are higher in bovine endometrium from the uterine horn ipsilateral to the active CL and

are positively correlated with progesterone concentrations (Cerbito et al., 1997).

A positive feedback pathway exists in large luteal cells in the CL, such that PGF2,

stimulation induces intraluteal PGF2. as a result of induction of PGHS-2. The effect of

progesterone on uterine sensitivity to OT involves a non genomic action (Zinng et al.,

1998). Progesterone binds to the OTR with high affinity and inhibits binding of OT to its

receptor. Intact cows in the mid-luteal phase and ovariectomized progesterone-primed

cows secrete PGF2, after treatment with estrogen (Thatcher et al., 1984), suggesting that

progesterone priming is necessary to induce PGF2a secretion by the bovine uterus and

that estrogen may just be acting as a modulator of this process (Okuda et al., 2002).

Mann et al. (2001) suggested that the most likely mechanism by which progesterone

treatment induces responsiveness to oxytocin may be through the upregulation of post

receptor signaling pathways and/or enzymes involved in prostaglandin synthesis.

Progesterone appears to promote uterine accumulation of arachidonic acid, PGHS-2 and

other substances needed for synthesis of PGF2. and also exerts a suppressive effect on

secretion that is decreased after prolonged exposure (Silvia et al., 1991).

Estradiol on the other hand has both stimulatory and inhibitory effects on PGF2a

secretion from the endometrium (Wathes and Lamming, 1995). Estradiol has been shown

to have no effect on PGF2a secretion from the endometrium alone whereas, in

combination with progesterone, it amplified the stimulatory effects of progesterone

(Skarzynski et al., 1999). Oxytocin stimulation of prostaglandin secretion is induced in

ovariectomized animals by treatment with progesterone alone, suggesting that estrogen is

not essential for increase in response to OT (Goff and Kombe, 2003). However, estrogen









may play a role of completion of luteolysis by stimulating the increase in OTR. Estradiol

induces PGF2a production in vivo (Thatcher et al., 1984) and increases OTR expression

after priming with progesterone (Lamming and Mann, 1995).

Under in vitro conditions, OTR upregulates spontaneously in endometrial tissues

taken from any stage of the estrous cycle (Sheldrick et al., 1993), suggesting a form of

constitutive upregulation of OTR. In vivo, OTR and its mRNA are upregulated within a

short window of 2 to 3 days around the day of estrus, are undetectable between days 6

and 15, and start to develop in the luminal epithelium of the endometrium between 15

and 17 days after estrus (Fuchs et al., 1990; Jenner et al., 1991; Mann and Lamming,

1995; Robinson et al., 1999). They become apparent later in the superficial glands of the

endometrium (Robinson et al., 2001). Oxytocin receptors were shown to appear before

changes in plasma concentrations of progesterone or estradiol (Robinson et al., 2001)

indicating that upregulation of OTR is not a result of changes in plasma steroid

concentrations.

In the bovine endometrium, the highest number of OTR are expressed in the

luminal epithelium and it is this layer of cells that is most responsive to exogenous OT in

terms of PGF2, secretion (Robinson et al., 2001). Development of OTR in the luminal

epithelium alone is probably sufficient to elicit full luteolytic secretion ofPGF2z (Wathes

and Lamming, 1995). Development of OTR in the caruncular stroma and deep glands at

estrus is dependent on estrogen (Wathes and Lamming, 1995). The decreased expression

of OTR after estrus is reportedly due to decreased plasma estradiol concentrations and the

further decline in the luteal phase is due to progesterone acting via high concentrations of

progesterone receptors present in the stroma (Lamming and Mann, 1995). This action is








probably indirect since no progesterone response element has been identified in the

bovine OTR gene promoter (Bathgate et al., 1995).

In most cells and tissues, PGHS-2 is an inducible enzyme that is not expressed

under normal or resting conditions (Smith et al., 1996; Kniss, 1999; Smith et al., 2000).

Both the PGHS-2 mRNA and protein are expressed in the endometrium at low levels

between days I and 12 and at high levels between days 13 and 21 of the estrous cycle

(Arosh et al., 2002). The PGHS-2 mRNA and protein are highly correlated, suggesting

that PGHS-2 expression is regulated at both the mRNA and protein levels. Maximal

expression of PGHS-2 occurs at the expected time of luteolysis (days 16 to 17) in the

cow. The PGHS-I mRNA and protein are not expressed in the bovine endometrium on

any day of the cycle (Arosh et al., 2002). Prostaglandin H synthase-2 and PGES may be

responsible for PGE2 production during the estrous cycle. The PGES and PGHS-2 are

functionally coupled in the preovulatory follicle (Filion et al., 2001) and in the

endometrium (Arosh et al., 2002). This functional coupling appears to be an efficient

mechanism for regulation of the conversion of arachidonic acid into PGE2.

Prostaglandin H synthase-2 is expressed in preovulatory follicles during the

estrous cycle, with levels low at onset of estrus and 18 h after estrus but high levels 24 h

after estrus (18 h post-LH surge). This result suggests that induction of PGHS-2 in bovine

preovulatory follicles is physiological and dependent on the LH surge (Liu et al., 1997).

Exogenous, PGF2 probably acts through protein kinase C and calcium-dependent

pathways to stimulate large luteal cells to express PGHS-2 which then leads to luteal

production of PGF2, (Tsai et al., 1996; Tsai and Wiltbank, 1997). Thus the PGF2, creates








an autocrine/paracrine loop that augments the luteolytic effect of PGF2a produced by the

uterus.

Oxytocin stimulates PGF2, secretion from the endometrium during the follicular

phase, estrus, early luteal and mid to late luteal stages of the estrous cycle (Silvia and

Taylor, 1989; Meidan et al., 1993; Mirando et al., 1993; Wolfenson et al., 1993; Xiao et

al., 1999; Miyamoto et al., 2000). Oxytocin may play a supportive role to regulate PGF2a

synthesis since it has been reported that OT is not necessary for luteolysis in cows

(Kotwica et al., 1998b). It has been reported that the concentrations of OT in intact and

microdialyzed CL are low during spontaneous luteolysis (Parkinson et al., 1992; Douglas

and Britt, 2000). Furthermore, Kotwica et al. (1997) showed that administration of OT

antagonist at the time of luteolysis did not stop the luteolytic process nor did it affect the

duration of the estrous cycle in heifers.

Several studies have shown that OT binding to its receptor stimulates uterine

production of PGF2, (Newcomb et al., 1977; Silvia and Taylor, 1979; Lafrance and Goff,

1990). This effect is also affected by ovarian steroids which influence the responsiveness

of the uterus to OT (Lafrance and Goff, 1985; Lamming and Mann, 1995). Oxytocin

stimulates PGF2a synthesis by endometrial cells via increased intracellular calcium ions

(Bums et at., 1998). The increase in calcium ions is due to stimulation of PLC and

inositol triphosphate (IP3) in the PKC signaling pathway (Bums et al., 1998). Treatment

of endometrial epithelial cells with OT followed by progesterone inhibits the increase of

calcium ions, suggesting that progesterone blocks the synthesis of PGF2, by disrupting

this intracellular pathway. It appears that this effect is mediated through the direct

interference of the interaction of OT with its own receptor (Bogacki et al., 2002).








Luteinizing hormone has been implicated in the synthesis and regulation of PGF2,

production (Freidman et al., 1995; Shemesh et al., 2000), its effect being restricted to mid

to late luteal phases of the cycle (Shemesh, 2001). Prostaglandin F2a acting via the PKC

pathway, may activate an increase in intracellular calcium which in turn stimulates PGF2,

synthesis from the endometrium to form an autoamplification system of its own

production (Bums et al., 1997; Skarzynski et al., 1999).

Norepinephrine stimulates PGF2, release during the follicular phase and early

luteal phase, time periods when the influence of progesterone is minimal (Skarzynski et

al., 2001). It has been demonstrated that TNFa receptors are present in the bovine

endometrium (Skarzynski et al., 2000a). Furthermore TNFa can stimulate release of

PGF2, from bovine endometrial stromal cells but not in epithelial cells (Skarzynski et al.,

2000a). Moreover, TNFa stimulates synthesis of PGF2, during both luteal and follicular

phases of the cycle. This effect is in contrast to the effects of OT which only stimulates

PGF2, synthesis during the follicular phase. The fact that the bulk of PGF2, is produced

by the epithelial cells (Asselin et al., 1996; Skarzynski et al., 2000a) whereas TNFa

stimulation is directed to the stromal cells may suggest that an auto-amplification loop of

PGF2, synthesis may exist early in luteolysis. Tumor necrosis factor a may play an active

role in the initiation of luteolysis and later, OT-induced PGF2, plays a role in the

completion of luteolysis (Okuda et al., 2002).

Arosh et al. (2002) showed co-expression of PGHS-2 and PGES mRNA in bovine

endometrium during the estrous cycle. The PGES was co-expressed at high level with

PGHS-2 between days 13 and 21 of the estrous cycle, suggesting that the mechanism for

the synthesis of PGE2 is already present by day 13 of the cycle. Prostaglandin E synthase








was expressed at moderate, low and high levels on days 1 3, 4 12 and 13 21 of the

estrous cycle, respectively (Arosh et al., 2002).

Inhibition of Luteolvsis by the Embryo

Expansion and cell division of the embryo is controlled by factors secreted by the

endometrium, but the complete nature of these factors is still unknown (Goff, 2002). It is

necessary that the concepts elongates rapidly so as to attach to as much area of the

endometrium as possible in order to reduce the secretion of PGF2, (Goff, 2002).

Interferon-r is produced by the trophoblast between days 15 to 24 of gestation (Bartol et

al., 1985) and prevents luteolysis by suppressing endometrial PGF2a secretion via

downregulation of expression of estrogen and OTR (Spencer et al., 1995b). Evidence

that the embryo or IFN-T inhibits luteolysis is provided from studies by Knickerbocker et

al. (1986) where they showed that administration of whole concepts secretary proteins

into the uterus reduced pulsatile PGF2a pulses from the uterus and extended the estrous

cycle from 23 24 days to 30 39 days in cyclic cows. Intrauterine administration of

recombinant bovine interferon-T (rbIFN-t) increased the interestrous interval, extended

the life of the CL and abolished OT-induced PGF2, synthesis (Meyer et al., 1995).

Presence of an intracellular endometrial inhibitor of PGF2, in the endometrium of

pregnant cows was shown by the inhibition of PGF2a synthesis by cotyledonary

microsomes from parturient cattle, whereby, synthesis was reduced by 51% when

incubation was done in endometrial cytosolic supematants from pregnant cows but only

by 17% when incubated with endometrial cytosolic supernatant from cyclic cows day 17

post-estrus (Gross et al., 1988a).








Using a perifusion device, Gross et al. (1988b) showed that the secretion rates of

PGE2 were not affected by pregnancy status whereas PGF2a secretion was decreased.

However, the rates were increased in cyclic and bred cows that were not pregnant. They

further demonstrated that prostaglandin secretion was not stimulated by OT in day 17

pregnant cows. This is in contrast to results from in vitro studies that have shown that

IFN-T increases synthesis of PGE2 (Asselin et al., 1997a). This effect however may be a

dose response since low doses of IFN-T, there is inhibition whereas at high doses there is

stimulation.

Spencer et al. (1996) proposed that IFN-r may block estrogen receptor synthesis

and thus OTR synthesis by (1) indirectly stabilizing or preventing the down-regulation of

progesterone receptor gene expression by progesterone and (2) directly inhibiting

estrogen receptor gene expression and thus allowing the maintenance of the CL and

successful maternal recognition of pregnancy. However, it has recently been reported that

IFN-z prevents luteolysis in sheep by directly inhibiting and silencing transcription of

ERa gene which prevents the ability of activated estrogen receptor a (ERa) to increase

OTR gene transcription (Bazer et al., 2003). Increased output of IFN-T is due to increased

size of the embryo rather than increased synthesis, suggesting that embryo elongation is

important in preventing luteolysis since smaller embryos will produce less IFN-T and lead

to embryo loss. Interferon-r also stimulates protein secretion from the endometrium

(Emond et al., 2000).

Endometrial proteins and granulocyte macrophage colony stimulating factor

(GM-CSF) have been shown to increase IFN-T production in ovine embryos (Imakawa et

al., 1997). The GM-CSF is a cytokine that promotes concepts growth and survival,








however, it had no effect on IFN-T in the cow (de Moraes and Hansen, 1997). Interferon-

T produced by the trophoblast may be further stimulated by GM-CSF from the

endometrial epithelium (Imakawa et al., 1997). The stromal cells in the uterus respond

by increasing GM-CSF leading to an auto amplification loop (Emond et al., 2000).

Recombinant ovine interferon-z (roIFN-T) has been shown to upregulate PGHS-2

expression in both epithelial and stromal cells, followed by increased production of PGE2

in epithelial and PGF2, in stromal cells of bovine endometrium in vitro (Asselin et al.,

1997c). Upregulation of PGHS-2 was greater in stromal than epithelial cells.

Under in vitro conditions, natural bovine IFN-T significantly diminished basal

PGF2c but not PGE2 secretion from bovine endometrial explants (Godkin et al., 1997).

However, rbIFN-T was found to inhibit both PGF2, and PGE2 in bovine epithelial but

had no effect on stromal cells (Smith and Godkin, 1992; Smith et al., 1993; Desnoyers et

al., 1994; Godkin et al., 1997).

During early pregnancy in cows (days 12 to 25) there is suppression of OTR and

estrogen receptors (Farin et al., 1990; Robinson et al., 2001). Bazer et al. (1997)

hypothesized that IFN-t downregulates OTR by inhibition of upregulation of OTR.

Decreased expression of estrogen receptors occurs in the pregnant horn of unilaterally

pregnant ewes (Lamming et al., 1995), and intrauterine infusion of roIFN-T during the

luteal phase inhibits estrogen and OTR expression in the endometrium (Spencer et al.,

1995c). Recombinant oIFN-T prevents upregulation of estrogen and OTR mRNA and

protein expression after exogenous estradiol administration on day 12 (Spencer et al.,

1995c). Robinson et al. (1999) failed to detect OTR mRNA and protein in the luminal








epithelium of cows at day 16 of pregnancy but was able to detect it in non pregnant cows

indicating that presence of the embryo suppressed expression of OTR.

The efficiency of inhibition of the luteolytic mechanism during pregnancy

depends on IFN-T (Mann and Lamming, 2001). They showed that day 16 pregnant dairy

cows produced less PGF2~ metabolite, 13,14-dihydro-15-ketoPGF2. (PGFM ) after an

OT (50 i.u) challenge, compared to uninseminated control cows. They further showed

that cows with an embryo and measurable quantities of IFN-- attenuated the PGF2a

response to OT than those without an embryo. Consequently, successful establishment of

pregnancy appears to depend on the presence of a well developed embryo that produces

enough IFN-r.

In both cows and sheep, expression of PGHS-2 is modulated in response to

various stimuli and is correlated with production of prostaglandins during maternal

recognition of pregnancy (Asselin et al., 1997b; Charpigny et al., 1997). The PGHS-2

protein is expressed for extended periods in pregnant animals, suggesting that increased

production of prostaglandins may be involved in recognition of pregnancy (Charpigny et

al., 1997). Binelli et al. (2000) showed that IFN-T directly inhibits PKC-regulated PGF2.

production and expression of PGHS-2 and phospholipase A2 (PLA2). Interferon-t also

was shown to suppress PGF2, production and PGHS-2 independent of OT-induced early

signaling events (PLC-IP3/DAG-PKC) in immortalized bovine endometrial (BEND) cells

(Pru et al., 2001). Interferon-t may inhibit luteolysis by shifting the primary

prostaglandin produced in the endometrium from luteolytic PGF2c to luteotrophic PGE2

(Okuda et al., 2002). The TNFa stimulates PGF2a synthesis in stromal cells but not in

epithelial cells of the bovine endometrium (ISkf j', ,n et al., 2000b). It has been








suggested that it may induce local autoamplification of PGF2a in the endometrium

(Skarzynski et al., 1999) and thus initiate a positive loop between pituitary and ovarian

OT and uterine PGF2O to complete luteolysis (Skarzynski et al., 1999; Okuda et al.,

2002). It was recently shown that suppression of TNFa induced-PGF2, secretion by IFN-

r is via downregulation of PGHS-2 expression, stimulated by TNFa (Okuda et al., 2003).

Interferon-T inhibits production of PGF2a in bovine endometrial epithelial cells by

downregulating the expression of PGHS-2 (Xiao et al., 1998). However, it enhances

PGHS-2 mRNA and PGF2; synthesis in stromal cells which are the principal site for

PGE2 synthesis. The expression of PGHS-2 in bovine embryos appears to be transient

and is associated with the first cleavages, with a decrease occurring at the morula stage

(Guverich and Shemesh, 1994). Large amounts of the enzyme have been reported to be

produced between hatching and implantation in ovine (Lewis and Waterman, 1985) and

bovine conceptuses (Shemesh et al., 1979; Lewis et al., 1982).

Elongation of the concepts may be due to stimulation by several mitogens and

growth factors some of which stimulate PGHS-2 expression. The expression of PGHS-2

in ovine embryos is developmentally related and occurs at a time when the embryo turns

into a filamentous type. The pattern is also similar to that ofIFN-t which begins on day

10 and ends about day 21 of pregnancy in sheep (Charpigny et al., 1988; Guillomot et al.,

1990).

High levels of progesterone during pregnancy also have an inhibitory effect on

upregulation of estradiol and OTR. The embryo may further prevent luteolysis by

secreting a protein that blocks the effect of prostaglandins on the large luteal cells in the

CL to maintain a constant source of progesterone (Wiltbank et al., 1992).








Concentrations of linolenic acid are increased in the endometrium of cattle during

pregnancy and linolenic acid is a competitive inhibitor of arachidonic acid metabolism

(Thatcher et al., 1995). Linolenic acid has an effect on limiting the amount of

arachidonic acid that can be converted to PGF2Z and its synthesis is increased by IFN-t.

Resumption of the Prostaglandin Synthesis System after Maternal Recognition of

Pregnancy

Termination of IFN-t expression is dependent on implantation, since cessation of

olFN-r expression occurs in the regions of the trophoblast that have established cellular

contacts with the uterine epithelium during the implantation process (Demmers et al.,

2001). Intrauterine infusion of IFN-T into cyclic Jersey cows from days 15.5 to 21

increased the cycle length to 26 days (Helmer et al., 1989), whereas when the concepts

was left in the uterus and then removed on days 17 or 19, luteal life span was extended,

but only for a few days (Northey and French, 1980) which suggests that PGF2, synthesis

becomes re-established after maternal recognition of pregnancy. In the intercaruncular

bovine endometrium, OTR were low on day 20 and became upregulated by more than ten

fold on day 50 (Fuchs et al., 1992). Endometrial OTR has been shown to change as a

function of gestational age in pregnant beef cattle from days 50 to 250 (Fuchs et al.,

1996b). There was also a parallel increase in plasma PGFM after challenge with 100 i.u

of OT suggesting that at day 50 of pregnancy, the OTR is functionally coupled to PGF2,

release and their concentration determines the magnitude of OT-induced PGF2, during

gestation. Balaguer et al. (2000) challenged beef pregnant cows with OT (100 i.u) from

days 20 to 50 of pregnancy and reported increased PGFM in plasma. The response of








PGFM after OT increased from days 20 to 50 of pregnancy. This result suggests that the

OT-prostanoid system may be active during this peri-implantation period (days 20 to 50).

Maternal plasma progesterone concentrations were correlated with IFN-T

production in bovine conceptuses suggesting that higher maternal progesterone provides

a more suitable environment for the developing concepts (Kerbler, et al., 1997). This

means that in the absence of IFN-T, after maternal recognition of pregnancy, the high

concentrations of progesterone are enough to maintain pregnancy.

Properties of the Key Elements Involved in Luteolysis

Bovine Oxvtocin Receptor

The bovine OTR is a member of the rhodopsin-type (class ) G protein coupled

receptor family (GPCR). The seven transmembrane a helixes are highly conserved

(Gimpl and Fahrenholz, 2001). The OTR encodes a protein of 391 amino acids. It

consists of two introns, one in the 5' noncoding region that appears to be differentially

spliced in the bovine uterus and a conserved intron within the open reading frame

between the regions encoding the transmembrane domains VI and VII. The bovine OTR

consists of three major transcripts at 6.5 kb, 3.5 kb and 2.0 kb (Bathgate et al., 1995). The

OTR gene promoter lacks an estrogen response element (ERE) (Horn et al., 1998).

Similarly, the human OTR gene does not have ERE in its sequence, upstream of the

transcription start site and none of its ERE half-sites respond to increased estrogen

activity when co-transfected with estrogen receptor (Ivell et al., 1998; Telgmann et al.,

2003). However, the lack of ERE does not exclude potential effects of estrogen on gene

expression, since there are half palindromic ERE motifs that could act synergistically to

mediate estrogen activation as has been shown in the ovalbumin gene (Kato et al., 1992).








In sheep, however, it has recently been shown that liganded ERa stimulates OTR

promoter through both DNA and protein-protein interactions with the promoter elements,

activator protein 1 (Ap-1) and Spl despite the lack of consensus binding sites for ERa on

ovine OTR (Bazer, et al., 2003).

Oxvtocin Receptor Signaling

Oxytocin binds to a cell-surface membrane receptor and activates an intracellular

signaling pathway that leads to activation of PLC (Gimpl and Fahrenholz, 2001). Once

activated, PLC cleaves phosphatidylinositol bisphosphate into the second messengers,

diacylglycerol (DAG) and IP3. The DAG increases PGF2a synthesis by activating protein

kinase C activity. Protein kinase C then activates a number of intracellular enzymes that

lead to activation ofphospholipase A2 (PLA2) (Bums et al., 2001). The PKC activates

Ras or Raf-1 which phosphorylates and activates mitogen activated protein kinase

(MAPK kinase) (MEK1/2) (Lewis et al., 1998). The cytosolic form of PLA2 mobilizes

arachidonic acid from phospholipids (Kramer and Sharp, 1997). The arachidonic acid is

converted to prostaglandin H2 (PGH2) by prostaglandin H synthase-2 (PGHS-2) (Smith,

1989). The PGH2 is then converted to PGF2. by the enzyme prostaglandin F synthase

(PGFS).

Regulation of Oxvtocin Receptor

Although administration of estradiol in vivo stimulates an increase in uterine

OTR (Beard and Lamming, 1994; Wathes et al., 1996), OTR upregulation in vitro occurs

spontaneously in the absence of estrogens (Sheldrick et al., 1993; Horn et al., 1998;

Leung and Wathes, 2000). In vitro and in vivo, OT causes short-term upregulation of








OTR expression, but this effect is not maintained for more than I to 2 days (Leung and

Wathes, 2000).

Estrogens also may initiate non-genomic reactions in the absence of estradiol

receptor (Ignar-Trowbridge et al., 1996). There seem to be species differences between

cattle and sheep in the way OTR are regulated (Leung and Wathes, 2000). Duririg early

pregnancy in cows, the embryo is able to suppress development of OTR around day 16

despite the presence of a high number of estrogen receptors (Robinson et al., 1999). It has

been suggested that in sheep, however, that the inhibition of OTR expression by IFN-T

may be mediated initially by inhibition of uterine estradiol receptors (Spencer et al.,

1995a).

Progesterone has an inhibitory effect on OTR expression, but this effect is lost

after 10 days because progesterone downregulates its own receptor (McCracken et al.,

1999; Kombe et al., 2003). Inhibitory effects of progesterone on endometrial tissue are

not mediated through genomic mechanisms such as activation or suppression of specific

genes like OTR or PGHS-2 since the effects can be seen under very short term culture

conditions (Bogacki et al., 2002). Progesterone was able to suppress the ability of

oxytocin to induce endometrial secretion of PGF2, at concentrations as low as 2 nM (0.6

ng/ml) which is in the physiological range. Further evidence from non-genomic effects

was the finding that progesterone inhibits OT binding to OTR-containing membranes in

vitro and suppresses OT-induced inositol phosphate production and calcium mobilization

which are highly steroid and receptor specific effects (Grazzini et al., 1998; Bogacki et

al., 2002). Picard (1998) suggested that progesterone binds to the OTR at an allosteric

receptor site to induce conformational change and thus prevents OT binding to its








receptor. In vitro studies have shown that stimulation of PGF2, by OT is mediated by

calcium ions (Bums et al., 1998). This OT-induced intracellular calcium release is

inhibited in bovine endometrial cells that have been pre-incubated with progesterone,

suggesting that the inhibitory effects of progesterone may be via disruption of the

calcium signaling pathway (Bogacki et al., 2002). Development of OTR in the luminal

epithelium is not directly preceded by changes in the concentration of progesterone or its

receptors; an indication that a time dependent mechanism may mediate the inhibitory

effect of progesterone on OTR function (Wathes and Lamming, 1995; Robinson et al.,

1999).

During the luteal phase in non-pregnant cows, pro-inflammatory interleukins may

form part of the inhibitory mechanism by which progesterone inhibits OTR, while at the

same time enhancing basal prostaglandin synthesis (Leung et al., 2001). An increase in

basal prostaglandin synthesis does not activate luteolysis in the absence of OTR, since

pulses of PGF2a are required (McCracken et al., 1999). Lipopolysaccharide stimulates

PGF2a without altering OTR mRNA, whereas IL-la, 2, and 6 suppress OTR in the late

luteal phase (Leung et al., 2001).

During pregnancy, the upregulation of OTR and luteolysis is inhibited by

secretion of IFN-T from the trophoectoderm from days 12 to 25 in cattle (Bartol et al.,

1985; Fari et al., 1990). Administration of recombinant IFN-T during pregnancy inhibits

OT-induced PGF2, secretion by down-regulation of OTR in the endometrium and by

decreasing PGHS-2 and PGFS via a mechanism independent of changes in OTR (Xiao et

al., 1999). Possibly increased basal secretion of PGHS-2 occurs during pregnancy. The

antiluteolytic effects of IFN-r are to directly inhibit and silence estrogen receptor a gene








transcription that in turn inhibit the ability of activated ERa to increase OTR gene

transcription (Bazer et al., 2003).

Caruncles are differentiated sites of the endometrium in which placentation occurs

in ruminants. Intercaruncular areas are privileged sites for regulation of PGF,2 production

by OT, a process that results in luteolysis (Asselin et al., 1998). Endometrial cells from

intercaruncular areas are more responsive to OT and those from caruncular regions are

more responsive to IFN-T (Asselin et al., 1998).

Prostaglandin H Svnthase-2 (PGHS-2)

Structure of the Bovine PGHS-2 Gene

There are two isoforms of PGHS called variously as PGHS-1 and PGHS-2 or

COX-1 and COX-2. The two isoforms have molecular weights of 70,000 and 72,000,

respectively, and their amino acids are 60% identical but their structural and functional

domains are conserved (Hla and Nielson, 1992). These enzymes are derived from genes

located on different chromosomes that encode different sizes ofmRNA, 2.8 kb for

PGHS-1 and 4.8 kb for PGHS-2. Whereas PGHS-2 is inducible (Hershmann, 1996),

PGHS-1 is constitutively expressed (Williams and Dubois, 1996).

The bovine PGHS-2 mRNA consists of a 5'-untranslated region of 128 bp, an

open reading frame of 1815 bp and a 3'-untranslated region of 1565 bp containing

multiple repeats of the Shaw-Kamen sequence 5'-ATTTA-3' (Liu et al., 2001). It is

undetectable in most tissues but can be induced by agonists and is generally referred to as

the inducible isoform. The gene consists of 10 exons and 9 introns. The transcription

start site is a guanidine residue. The gene consists of several cis-acting elements 600 bp

upstream of the cap site, including cyclic adenosine monophosphate binding protein








(C/EBP), AP-1, AP-2, nuclear factor kappa B (NF-KB), activator transcription

factor/cyclic AMP response element (ATF/CRE) and E-box binding proteins. It does not

contain TATA box motifs (Liu et al., 1999). Mutation of the C/EBP results in reduction

of forskolin activity, whereas deletion of ATF/CRE abolishes TPA-stimulated

transcription of PGHS-2 in human endothelial cells (Subbaramaiah et al., 1998). The

protein encoded by the bovine PGHS-2 gene is similar to other mammalian homologs,

being 89% and 97% identical to human (Hla and Wielson, 1992) and ovine (Zhang et al.,

1996) protein sequences, respectively.

Signal Transduction Through PGHS-2

Prostaglandin H synthase-2 is present in both the endoplasmic reticulum and the

nuclear envelope, but appears twice as much in the nuclear envelope, whereas PGHS-1 is

equally distributed in the endoplasmic reticulum and nuclear envelope (Morita et al.,

1995). Swinney et al. (1997) reported that negative regulation of PGHS-1 permits PGHS-

2 to oxygenate low concentrations of arachidonic acid (AA) (1 lM) up to four times

more efficiently than PGHS-1. Limiting intracellular concentrations of AA leads to the

PGHS-2 pathway and higher concentrations (10 iM) leads to PGHS-1 synthesis

(Murakami et al., 2000). Three phospholipase A2 (PLA2) forms are involved in agonist-

stimulated AA release but there is no general coupling of specific lipases to PGHS-2 or

PGHS-1 (Murakami et al., 2000). Prostaglandin H synthase-2 selectively couples to

other terminal isomerases, especially PGE2 synthase and PGI2 synthase (Smith et al.,

2000). A number of inflammatory agents such as IL-1, lipopolysaccharide (LPS) and

other growth factors share convergent pathways that regulate transcription of PGHS-2.

These include NFKB and C/EBP, signaling pathways common in inflammatory








responses. The others are one or more of the mitogen activated protein kinase (MAPK)

cascades: extracellular regulated 1,.,1. I K I i, Janus kinase (JNK/SAPK) and

p38/RK/Mpk2. Each of these pathways has been shown to contribute or be solely

required for increased expression of PGHS-2 in different cell culture systems (Smith et

al., 2000).

Regulation of PGHS-2 Gene Expression

Prostaglandin G/H synthase-2 gene is elevated by growth factors and mediators of

inflammation such as IL-1, TNFa, LPS and 12-O-tetradecanoylphorbol 13-acetate

(TPA). However, glucocorticoids and anti-inflammatory cytokines suppress PGHS-2

expression (Smith et al., 2000).

Several cis-responsive elements act as key regulatory elements that mediate

PGHS-2 transcription in various cell types. The DNA elements are utilized in a cell-

specific and activator-specific manner. In bovine granulosa cells and ovine large luteal

cells, E-box are essential elements (Liu et al., 1999; Wu and Wiltbank, 2001). In rat

granulosa cells, C/EBP or E box have been reported to be the essential elements for

regulation of PGHS-2 (Sirois and Richards, 1993), whereas in bovine granulosa cells it is

only the E box that is important for transcription of PGHS-2 by LH or protein kinase A

(PKA) activators (Liu et al., 1999). In ovine large luteal cells, the E-box, C/EBP and CRE

in combination are involved in the induction of PGHS-2 by PGF2, as well as PKC

activators (Wu and Wiltbank, 2001). The PGHS-2 promoter has been shown to be

inducible by 8-bromo cAMP but not phorbol esters in fresh granulosa cells. However,

after luteinization of granulosa cells by day 8 of treatment with forskolin, the PGHS-2

promoter was immediately inducible by phorbol esters but not by forskolin (Wu and








Wiltbank, 2002). This change in responsiveness has led to the suggestion that

luteinization changes transcriptional regulation of PGHS-2 from PKA to PKC

dependence, with the E-box being the crucial element in transcriptional activation and

remaining conserved (Wu and Wiltbank, 2002). The intracellular effector systems

involved in induction of PGHS-2 are via PKC directly regulating transcription of PGHS-

2 gene in large luteal cells by acting through DNA elements (CRE and C/EBP) close to a

putative transcriptional start point, and particularly an E-box region (-CACGTG-) at -50

bp (Wu and Wiltbank, 2001).

Bovine uterine stromal cells stimulated with phorbol 12-myristate 13-acetate

(PMA) an activator of PKC exhibit a marked expression of PGHS-2 mRNA and protein

after 3 tol2 h of stimulation (Liu et al., 2001). However, this stimulation is transient and

the PGHS-2 transcript is very unstable whereas the protein is more stable. Waning of

PGHS-2 expression by 24 h is accompanied by increased PGE2 synthesis, suggesting that

a temporal association exists between induction of PGHS-2 mRNA, PGHS-2 protein and

PGE2. There seems to be a difference in the mechanism of regulation of PGHS-2 gene

between uterine stromal cells and granulosa cells. In uterine stromal cells there is a

promoter region located at -1574/- 492 that does not play a role in granulosa cells (Liu et

al., 1999). This may account for the differences in stimulation, PMA stimulation in

uterine stromal cells and forskolin in granulosa cells (Liu et al., 2001). Mutation of CRE

and C/EBP leads to reduced PKC-mediated transcription (Wu and Wiltbank, 2001). In

the CL, PGF2a acts by stimulating protein kinase C and calcium ions to stimulate large

luteal cells which express PGHS-2 and then produce PGF2 (Tsai and Wiltbank, 1997).








The luteal PGF2a functions in an autocrine/paracrine way to increase the luteolytic effects

caused by PGF2. of endometrial origin.

Tumor necrosis factor a is a potent stimulator of PGF2a secretion from the bovine

endometrium. Whereas the target for TNFa are the endometrial stromal cells via

activation of PLA2 and arachidonic acid conversion, the target for OT to stimulate PGF2,

are the epithelial cells (Skarzynski et al., 2000b). It has further been suggested that TNFa

may stimulate PGF2a synthesis by inducing nitric oxide synthase. Evidence of this

process comes from experiments showing increased production of PGF2a after incubation

of endometrial cells with a nitric oxide donor, S-nitroso-N-acetylpenicillamine

(Skarzynski et al., 2000a).

Recombinant bovine interferon T induces activation of the Janus kinase-signal

transducer and activator of transcription and p38 MAPK pathways in bovine myometrial

cells. Inhibition of p38 MAPK pathway by a specific inhibitor (SB203580) has been

shown in vitro to decrease mRNA and protein for PGHS-2 in myometrial cells (Doualla-

Bell and Koromilas, 2001). This result suggests that p38 pathway upregulates PGHS-2

expression at the post-transcriptional level because inhibition destabilizes IFN-T induced

PGHS-2 mRNA. The increased sensitivity suggests that MAP kinase and PI3 kinase

pathways are both stimulated by PGE2 and both are involved in PGHS-2 expression, and

that PKA is upstream of PGE2-induced activation of MAP kinase in these cells (Munir et

al., 2000).

Prostaglandin F Svnthase

Arachidonic acid that is produced by hydrolysis of phospholipids is the precursor

for PGF2. synthesis. It is converted to PGH2 by PGHS-2. Evidence that PGH2 is the








direct precursor for PGF2, was first presented by Hamberg and Samuelson (1967). It was

later demonstrated that the enzyme catalyzing the conversion has glutathione S-

transferase (GST) peroxidase activity and does not have a PGD 11- ketoreductase activity

(Burgess et al., 1987). The PGH2 can be converted to PGF2, via three pathways. In the

first, PGH2 is converted to PGF2, by PGFS, also known as 9, 11 endoperoxide

dehydrogenase. The second pathway involves conversion of PGH2 to PGD2 by PGD

synthase and then PGD2 conversion to PGF2, by PGD 11-ketoreductase. The third

pathway involves conversion of PGH2 to PGE2 by PGES and then PGE2 to PGF2a by

PGE 9-ketoreductase (Watanabe, 2002).

Prostaglandin F synthases belong to the aldoketoreductase (AKR) superfamily

(Table 2-1). Six different forms of PGFS have been reported in literature, three of which

were identified in cows. Lung type prostaglandin F synthase (PGFS1) (Watanabe et al.,

1985, 1988) catalyzes the reduction of PGH2 to PGF2, and PGD2 to a stereoisomer of

PGF2a (9a, 11 P-PGF2). The other two are lung type PGFS found in the liver, also known

as PGFS2 (Kuchinke et al., 1992; Watanabe et al., 2002) and the liver type PGFS, also

known as dihydrodiol dehydrogenase 3 (DDBX) (Suzuki et al., 1999a). The others are

human PGFS (Suzuki et al., 1999b), sheep PGFS (Wu et al., 2001) and a PGFS isolated

from Trypanosoma brucei (Kubata et al., 2000). The PGFS1 and PGFS2 are 99%

identical, whereas DDBX is 86% identical to PGFS1 and PGFS2.

Among the above family members, only PGFS is also classified as AKR1C3 and

catalyzes the reduction of PGD2 and PGH2 and the oxidation of 9a, 11 P-PGF2 despite

very high homology within the family (Suzuki et al., 1999a).









Regulation of Prostaglandin F Synthase

Asselin and Fortier (2000) reported expression of a 9-keto prostaglandin reductase

enzyme (9K-PGR) also known as PGFSL1 in the bovine endometrium. This enzyme is

92% homologous to bovine lung PGFS. The PGFSL1 is downregulated by recombinant

ovine IFN-T, whereas lung type PGFS is reduced by high and low doses of roIFN-i.

However, OT did not have any effect on the mRNA expression ofPGFSL1 and PGFS in

bovine endometrial epithelial cells (Asselin and Fortier, 2000). Oxytocin upregulates

PGFS mRNA in bovine endometrial epithelial cells but rbIFN-T inhibits OT-induced

PGFS as well as PGHS-2 (Xiao et al., 1999).

Table 2-1. Prostaglandin synthase enzymes that belong to the aldoketoreductase
superfamily.
Enzyme Source Intracellular Reference
Location
PGE 9-ketoreductase


Human placenta

Rabbit CL
Bovine placenta


Cytosol

Cytosol
Cytosol


PGD 11-ketoreductase


Lung-type
Liver-type

PGH 9-11-endoperox
reductase





PGFS


Human lung
Bovine lung
Bovine liver

ide

Bovine lung
Sheep seminal
vesicle
Trypanosoma brucei

Bovine endometrium


Cytosol
Cytosol
Cytosol



Cytosol
Microsomes

Cytosol


Westbrook and
Jarabak (1975)
Wintergalen et al. (1995)
Kankofer and
Wiercinski (1999)


Suzuki et al. (1999b)
Watanabe et al. (1988)
Suzuki et al. (1999a)



Watanabe et al. (1988)
Burgess and Reddy (1997)

Kubata et al. (2000)

Madore et al. (2003)


After Watanabe et al. (2002) with modifications.








Regulation of PGFS in endometrial cells in vitro is dependent on the steroid

present and the cell type. In stromal cells, neither estrogen nor progesterone had any

effect on PGFS mRNA levels (Xiao et al., 1998). However, the presence of both steroids

upregulated PGFS mRNA compared to progesterone alone. Furthermore rblFN-r alone or

in the presence of both steroids decreased PGFS mRNA expression (Xiao et a., 1998).

The decreased expression of PGFS mRNA in both the epithelial and stromal cells by

rbIFN-T could be the cause of the observed increase in the PGE2/PGF2a ratio.

Madore et al. (2003) reported expression in the bovine endometrium of an

aldoketoreductase with 20-aHSD activity known as AKR1B5. The AKR1B5 has 45%

homology with PGFS of the AKRI family. Unlike the other PGFS, the mRNA for

AKR1B5 was expressed in the endometrium from days 10 to 21 of the estrous cycle and

in endometrial cell cultures, suggesting that AKRIB5 is the main isoform that is present

in the bovine endometrium.

Prostaglandin E Svnthase (PGES)

In cows, IFN-T is the embryonic signal that is responsible for maternal

recognition of pregnancy. Prostaglandin E synthase (PGES) is a downstream enzyme that

catalyzes the conversion of PGH2 to PGE2. Bovine PGES was cloned recently (Filion et

al., 2001) and is a member of a protein superfamily consisting of membrane-associated

proteins involved in eicosanoid and glutathione metabolism (MPEG family) (Jakobsson

et al., 1999a, Table 2-2). The activity of PGES is dependent on glutathione which may

act as a coenzyme (Ogino et al., 1977; Jakobsson et al., 1999b; Murakami et al., 2000).

The bovine PGES cDNA consists of a 5'-untranslated region of 8 bp, an open reading

frame of 462 bp and a 3'-untranslated region of 406 bp, GenBank accession number








AY032727 (Filion, et al., 2001). The coding region of the PGES cDNA encodes a 153

amino acid protein. Two isoforms of PGES have been reported, nuclear membrane

associated PGES (mPGES) and cytosolic PGES (cPGES). The mPGES was partially

purified from microsomal fractions of bovine (Ogino et al., 1977) and ovine seminal

vesicular glands and has been shown to require glutathione (Moonen et al., 1982). The

mPGES is glutathione-dependent, inducible and functionally linked to PGHS-2. It has

been proposed to be a regulator of inflammatory processes (Murakami et al., 2000). The

isoform expressed in ovarian follicles is the mPGES (Filion et al., 2001). The cPGES is

constitutively expressed and is functionally coupled to PGHS-1 and is thought to be

involved in the synthesis of PGE2 needed to maintain tissue homeostatic functions

(Tanioka et al., 2000).

Table 2-2. Membrane associated proteins in eicosanoids and glutathione metabolism
superfamily.

Subfamily Protein Function

I 5-lipooxygenase activating protein Mediators in inflammation
Leukotriene synthase Mediators in airway
obstruction
Microsomal glutathione S-transferase 2 Protect against metabolites
from oxidative stress
II Microsomal glutathione S-transferase 3

III E. coli
V. cholera

IV Microsomal glutathione S-transferase 1 Catalyzes glutathione
dependent reduction of lipid
hydroperoxides
Microsomal glutathione S-transferase Involved in redox regulation
1-like


After Jakobsson et al. (1999a).








Regulation ofProstaglandin E Synthase

Expression of PGES in follicular cells is not constitutive but is induced by

gonadotropins prior to follicular rupture, and induction of PGES parallels that of PGHS-2

(Filion et al., 2001). The PGES is also regulated by pro-inflammatory agonists including

IL- 13, LPS, TNFa and PMA. Thoren and Jakobsson (2000) used a human lung cancer

adenocarcinoma cell line and demonstrated that PGES activity was stimulated by IL-1P

and TNFu but inhibited by dexamethasone. Cyclic AMP-dependent protein kinase is the

primary second messenger involved in signal transduction by gonadotropins (Richards et

al., 1998). Several agonists that effect transduction via this pathway may also be involved

in regulation ofPGES gene expression. In vitro studies involving the use of bovine

epithelial and stromal endometrial cells have shown that PGES expression is increased in

the presence of LPS, TNFcx and IFN-T in stromal cells and IFN-T in epithelial cells

(Parent et al., 2002). In stromal cells, IFN-t induces a rapid increase of PGES and PGHS-

2 mRNA expression. In BEND cells, PMA increased PGES mRNA, PGHS-2 mRNA

PGF2a and PGE2 suggesting that there is a correlation between PGES and PGHS-2

expression as regards the synthesis of PGE2 (Parent et al., 2002).

Bovine Luteal OT

The ruminant CL synthesizes and secretes OT besides producing progesterone

(Wathes et al., 1983; Ivell and Richter, 1984). Oxytocin is also produced by granulosa

cells of the preovulatory follicle (Salli et al., 2000). Concentrations of luteal OT and

vasopressin increase during the early luteal phase (days 1 to 4), are maximal during the

mid-luteal phase (days 5 to 10) and decline afterwards (Wathes et al., 1984; Abdelgadir et

al., 1987; Parkinson et al., 1992). However, mRNA concentrations of OT reach a peak








much earlier at day 3 of the cycle (Ivell, et al., 1985; Salli et al., 2000). The high

concentrations of OT and neurophysin I within the CL suggests that OT is synthesized

locally. Flint and Sheldrick (1982) administered PGF2a (125 pg i.m) to cows during the

luteal phase and observed release of luteal OT within 5 min that reached a maximum in

10 20 min. Similarly, norepinephrine causes secretion of luteal OT when administered

to heifers during the mid luteal phase (Skarzynski and Kotwica, 1993). The mechanism

of action for release of OT is via sympathetic activation of P-adrenergic receptors of

luteal cells and through cAMP mediation (Skarzynski and Kotwica, 1993). The bovine

CL contains both large and small luteal steroidogenic cells and it is the former that

predominantly produce OT (Fields and Fields, 1996).

The OT-neurophysin-I mRNA increases after luteinization and reaches a peak by

day 3 of the cycle, then declines to low concentrations during the mid-luteal phase (Ivell

et al., 1985). The OT concentrations in the CL are maintained by stimulation of the post-

translational OT-neurophysin process (Wathes et al., 1984; Abdelgadir et al., 1987;

Fuchs, 1987; Wathes and Denning-Kendall, 1992). Peptidyl glycine a-amidating

mono-oxygenase is the terminal enzyme responsible for post-translational processing of

OT-neurophysin (Abdelgadir et al., 1987; Furuya et al., 1990) and has been reported to be

highest in the ovaries of ruminants during the mid-luteal phase (Sheldrick and Flint,

1989; Bogacki et al., 1999). This coincides with the time of highest levels of luteal OT

(Skarzynski et al., 2001).

Prostaglandins act on the CL to induce the release of OT which is facilitated by

the high number of PGF2, receptors in the large luteal cells (Niswender et al., 1985). In

ruminants during the luteal phase, OT and progesterone are secreted concomitantly from








the ovary. However, progesterone secretion is inhibited and OT secretion stimulated by

exogenous PGF2, (Walters et al., 1983). It has been postulated that a central OT pulse

generator functions as the pacemaker for luteolysis (McCracken et al. 1999). The uterus

transduces hypothalamic signals in the form of OT secretion into luteolytic pulses of

uterine PGF2I (Gimpl and Fahrenholz, 2001). A positive feedback loop exists that

amplifies neural and luteal OT signals. Prostaglandin F2. has been shown to induce

release of OT from luteal slices in vitro (Abdelgadir et al., 1987).

Luteal cells contain vesicles which carry OT-neurophysin granules. Oxytocin is

secreted as a prohormone (Ivell and Richter, 1984), packaged and stored in secretary

granules, and released at the cell surface by exocytosis (Fields et al., 1992). The

production of the granules is restricted to the large luteal cells (Guldenar et al., 1984).

During the estrous cycle, the highest number of granules occurs about day 11 and are

progressively depleted beginning at about day 14 after estrus (Fields et al., 1992). In

pregnant animals, however, the granules are maintained at high levels beyond day 20 of

pregnancy but become depleted by day 30 (Fields and Fields, 1996). It is not known

exactly why this difference exists between pregnant and cyclic cows, although it has been

suggested that the presence of the embryo may play a major role (Salli et al., 2000). From

day 45 and onwards in pregnant cattle, a second population of granules emerges and

increases until maximal numbers are detected about day 180 and day 210 of pregnancy.

The content of these granules is not known (Fields et al., 1992).

In vitro, PGF2 treatment has been shown to deplete the large luteal cells of their

secretary granules within 1 h of treatment in cyclic (Heath et al., 1983) and pregnant

cows (Fields et al., 1987; 1989). Corteel (1975) reported that depletion of granules in








sheep CL occurred within 30 min of treatment, whereas Chegini and Rao (1987) reported

in vitro depletion after 2 h of treatment in 3 to 4 mo pregnant cows. Using a microdialysis

system in the CL, Shaw and Britt (2000) showed that administration of a luteolytic dose

of 25 mg PGF2, i.m. led to release of luteal OT in cows 13 to 15 days of the cycle.

However, no OT was detected in animals which were undergoing spontaneous luteolysis

which suggests that luteal OT may contribute less to luteolysis in cows than has been

proposed in sheep (McCracken et al., 1995). Stimulation of bovine luteal cells with

PGF2, on day 8 of cycle was shown to promote phosphorylation of a protein that is

phosphorylated by protein kinase, called myristoylated alanine-rich C kinase substrate

(MARKS) (Salli et al., 2000). After phosphorylation, MARKS translocates to the plasma

membrane and dissociates actin cortex which enhances exocytosis of OT containing

granules.

Exocytosis involves transport of the granules via an actin complex that is usually

associated with the plasma membrane (Salli et al., 2000). Fuchs et al. (2001) observed

low amplitude spurts of OT which were intermittent during pregnancy in cows. Towards

term there was an increase in both frequency and amplitude, and during labor a dramatic

increase was observed. Individual peaks of OT observed in the utero-ovarian vein during

late gestation could be due to OT from the CL as well as the posterior pituitary (Fuchs et

al., 2001). Maternal caruncles have been suggested as another putative source of OT

(Ivell et al., 1995; Fuchs et al., 2001).

The presence of OT-containing luteal granules followed by their delayed release

during the early peri-implantation period suggests that luteal OT may be involved in

OT-driven prostaglandin synthesis. The presence of the respective OTR in the






39

endometrium in the peri-implantation period as well as increased expression of enzymes

involved in prostaglandin synthesis would increase chances of embryo loss. In this

dissertation, the effect of PGF2r on release of luteal OT on representative days during

early (day 22) and late (day 40) peri-implantation period will be examined. The other

major objectives will be to determine the changes in expression of prostaglandin

synthesis enzymes (PGHS-2, PGES and PGFS) and OTR that occur during luteolysis,

how their expression is affected by the presence of a concepts and whether the

prostaglandin synthesis system is re-established after the period of maternal recognition

of pregnancy.














CHAPTER 3
RELEASE OF OXYTOCIN FROM OVARIAN VERSUS PITUITARY TISSUES IN
RESPONSE TO PGF2a IN OVARIECTOMIZED AND SHAM-OVARIECTOMIZED
COWS DURING THE PERI-IMPLANTATION PERIOD


Introduction


The major source ofluteal OT are the large luteal cells that are derived from

granulosa cells after ovulation (Abdelgadir et al., 1987; Parkinson et al., 1992). Luteal

OT is maximal during the mid-luteal phase whereas the OT mRNA is maximal on day 3

of the cycle (Ivell et al., 1985). Luteal OT is stored in secretary granules. During the

estrous cycle, exocytosis results in a decline in the number of secretary granules between

days 11 to 14 whereas OT containing secretary granules in pregnant cows are maintained

at a high level beyond day 20 (Fields and Fields, 1996). In pregnant animals, exocytosis

of OT-containing luteal secretary granules coincides with the decline in IFN-T secretion

(Fields and Fields, 1996). One secretogogue that releases luteal OT in vitro (Abdelgadir

et al., 1987; Chegini and Rao, 1987; Jarry et al., 1992) and in vivo (Flint and Sheldrick,

1982; Fields et al., 1987, 1989; Orwig et al., 1994) is PGF2a. Norepinephrine has also

been shown to stimulate synthesis and release of OT from the CL by stimulation of

P-adrenergic receptors as well as post-translational modification of the OT precursor

(Skarzynski and Kotwica, 1993). McCracken et al. (1999) hypothesized that OT from the

neurohypophysis stimulates secretion of uterine PGF2,. Subsequently, uterine PGF2~

stimulates release of OT from the CL.








Although this seems to be the situation in sheep, the contribution of luteal OT in

cattle to luteolysis is questionable since depletion of luteal OT by 75% using

norepinephrine failed to extend the luteal phase in cyclic cows (Kotwica and Skarzynski,

1993; Skarzynski and Kotwica, 1993). Similar results have been reported in sheep where

exogenous PGF2a induced luteolysis in hysterectomized ewes possessing less than 5% of

mid-luteal OT stores as rapidly as for intact animals (Sheldrick and Flint, 1983a).

Moreover, Shaw et al. (2000), using microdialysis, observed a rapid decline in luteal OT

secretion after day 14 of the cycle. The absence of any measurable OT in the CL during

luteolysis led the authors to suggest that the contribution of luteal OT to the luteolytic

process in cows may be minimal. Luteal OT concentrations do not differ between

pregnant and cyclic cows from day 0 to 19 of the cycle (Parkinson et al., 1992). In

pregnant animals, concentrations decrease after day 19 and remain at significantly lower

levels than in the luteal phase of non-pregnant animals (Parkinson et al., 1992).

Most studies on luteal OT have been conducted in cows during the estrous cycle.

Scant information has been published regarding luteal OT during the peri-implantation

period. There is a possibility that the OT-prostanoid system may be functional after day

21 during the peri-implantation period in instances where the concepts fails to initiate a

strong antiluteolytic signal. It is important, therefore, to determine whether at this stage

the CL is capable of responding to PGF2a by release of OT from the granules that still

remain in the CL. This could be one of the mechanisms that lead to luteolysis and

consequently embryo loss during the peri-implantation period.

The objectives of this study were to determine the source of OT that serves to

drive the OTR-prostanoid system of the endometrium and concepts during the peri-








implantation period. It is hypothesized that OT-containing secretary granules in the CL of

pregnant animals between days 22 and 40 release their contents in response to

sub-luteolytic doses of PGF2,. Alternatively, the source of OT at this time may be the

posterior pituitary. The specific objectives were to test whether PGF2, increases

circulating OT during the peri-implantation period and whether the source of OT is luteal

or of pituitary origin. Another goal was to determine whether there was a difference in

OT response between the early (day 22) and late (day 40) peri-implantation period to

PGF2,.

Materials and Methods

Brahman-Angus crossbred cows at day 22 of pregnancy were divided into two

groups. One group was bilaterally ovariectomized (OVX, n = 4) and the other sham-

ovariectomized (Sham-OVX, n = 9, Table 3-1). Ovariectomy was conducted as

described by Drost et al. (1992). Briefly, animals were restrained in a chute. The perineal

region and vulva were washed and disinfected. The status of the ovaries and uterus were

determined by rectal examination. Animals were given epidural anesthesia using 5 ml 2%

Lidocaine HCI. A vaginoscope was used to confirm the absence of infections and a stab

incision was made and enlarged in the fomix to gain access to the ovaries. An ecraseur

was then used to remove the ovaries. All the animals in the sham-ovariectomized group

underwent the same procedures as those ovariectomized including the stab incision and

manipulation of the ovaries. Cows were then injected (i.v.) at I h intervals with two 25

ug sub-luteolytic doses of PGF2, (Lutalyse Pharmacia & Upjohn, Kalamazoo, MI) or

saline (Periods 1 and 2, Fig 3-1). One hour after the second injection (Period 3), the cows

received a luteolytic dose of PGF2c (25 mg) (i.v.) or saline.









An additional group of nine, day 40 pregnant cows were sham-ovariectomized

and divided into two groups to receive either PGF2, (n = 6) or saline (n = 3). Blood

samples were collected from the jugular vein every 5 min starting 15 min before

ovariectomy or sham-ovariectomy until the first PGF2, /saline injection, every 5 min for

the first 15 min following each PGF2a /saline injection and then every 15 min until 60

min following each injection (Fig. 3-1). Blood samples were kept on ice, transported to

the laboratory and plasma harvested and stored at -200C until assayed for OT.

Table 3-1. Experimental design for in vivo study to ascertain response of PGF2, or saline
on luteal OT release in peri-implantation cows.

Day of Pregnancy


Day 22


Day 40


Treatments PGF2a Saline PGF2a Saline

Sham-Ovariectomized n=6 n=3 n = 6 n= 3

Ovariectomized n= 4



Fig. 3-1. Experimental protocol for response of PGF2a or saline on luteal OT release in
peri-implantation cows. Crossbars represent times at which blood samples were taken.

OVX PGF2a (25 gg)/saline PGF2a (25 pg)/saline PGF2a (25 mg)/saline
Sham-OVX

4 4 4 4


Period 1


Period 2


Period 3


-30 0 60 120 180

Time (min)


--


-------~








Oxvtocin Radioimmunoassav

Extraction of Plasma Samples

The method used for OT extraction from plasma samples was adapted from

Wathes et al. (1986) with modifications. Each SEP-PAK C18 cartridge (Waters

Associates, Milford, MA, USA) was pre-wetted with 10 ml of 0.1% trifluoroacetic acid

in 80% acetonitrile. The columns were then eluted with 20 ml deionized-distilled water.

Plasma samples (0.5 2.0 ml) were diluted (1:1) with phosphate buffer (0.05 M, pH 7.5).

Following application of the plasma, 25 ml 0.1% trifluoroacetic acid was added, and the

extract eluted with 3 ml of 0.1% trifluoroacetic acid in 80% acetonitrile into 13 x 100 mm

tubes. Elution solvent was dried under an air stream apparatus in a water bath set at 370C

and extract redissolved in 0.5 ml assay buffer (0.05 M phosphate buffer, pH 7.5 with 0.05

M EDTA, 0.15 M NaCI and 0.2% BSA).

Each extraction batch included the following controls:

1) Phosphate buffer (2.0 ml).

2) 1.0 ml bovine plasma + 1.0 ml phosphate buffer.

3) 1.0 ml bovine plasma spiked with low amount (0.2 ml) of OT (3.9 pg) in 0.8 ml

phosphate buffer.

4) 1.0 ml bovine plasma spiked with high amount (0.2 ml) of OT (31.25 pg) in 0.8

ml phosphate buffer.

The mean extraction efficiency was 65.7 5.5%.

Assay procedure

Duplicates from each extracted sample (200 pl) and triplicates of OT standards

(0.195 pg 100 pg/200 pl) were used for the assay. The OT antibody was from rabbit # 8








and was kindly donated by Dr. D. Dieter Schams, Technical University of Munich,

Freising, Germany. The working dilution of the antibody was 1:16000. Assay buffer

was added to glass assay tubes (12 x 75 mm), followed by 200 il extract. The tubes were

kept on ice throughout the procedure. The antiserum (100 p1) was added to all plasma

extracts, mixed thoroughly and incubated at 40C for 24 h. The tracer, [125I-OT] (Cat #

NEX-187, 10 piCi stock solution) from Perkin-Elmer Life Sciences, Boston, MA, was

added to 2 ml assay buffer and aliquoted into 100 il in 0.5 ml centrifuge tubes and stored

at -200C. Approximately 3500 cpm/100 (pl [125I-OT] was added to all tubes and

incubation continued at 40C for another 48 h. Pansorbin cell suspension (40 1l)

(Calbiochem, San Diego, CA) was prepared by adding 400 Pl phosphate buffer, vortexed

and centrifuged at 3000 x g for 5 min. The supernatant was aspirated and discarded, and

the pellet resuspended in phosphate buffer. Washing was repeated as above and the final

pellet resuspended in 4 ml phosphate buffer. To separate the bound and free OT within

the assay, 100 pl protein cell suspension was added to each assay tube (except the total

count tubes), mixed well and incubated at 40C for 1 h.

Following incubation, tubes were centrifuged at 30, 978 x g using a Sorvall RC-

5B centrifuge with an HS-4 rotor (Du Pont Instruments, Newtown, CT), the supernatant

discarded and the tubes with pellets (i.e., bound OT) counted in a gamma counter. The

concentrations of OT were expressed as pg/ml. The sensitivity of the assay was 1 pg/ml.

The inter and intra assay coefficients of variation were 10 and 11 %.








Statistical Analysis

Data were analyzed using the Statistical Analysis System (SAS) software version

8 (SAS Institute, Cary, NC). Oxytocin concentrations were analyzed by least squares

analysis of variance using the Mixed Model system of SAS (PROC MIXED) for repeated

measures analysis. The mathematical model included the independent effects of

treatment, time, period, treatment x time, treatment x period, period x time and treatment

x period x time. Cow was considered as a random variable nested within treatment. A

series of orthogonal contrasts were conducted to examine differences between treatments

(see Appendix A) ( T :day 22-PGF2,-Sham-ovariectomized ; T2:day 22-Saline-Sham-

ovariectomized; T3:day 40-PGF2,-Sham-ovariectomized; T4:day 40-Saline-Sham-

ovariectomized; T5:day 22-PGF,,-ovariectomized) and Periods: Period 1 from 5 to 60

min, Period 2 from 65 to 120 min and Period 3 from 125 to 180 min. Time within each

period was from 5 to 60 min (Fig. 3-1). Data are presented as least squares means

SEM. The covariance structure used was autoregressive of order 1 (Littell et al., 1998).

Results

Effect of PGF2, on OT response in sham-ovariectomized and ovariectomized day

22 pregnant cows is shown in Fig. 3-2. There was no major increase in plasma OT from

the time of ovariectomy to the time of first injection of PGF2a. In two of the four

ovariectomized cows, plasma OT increased 45 min following the first injection of PGF2,.

No additional increase in OT was observed following the second and third injection of

PGF2a (Fig. 3-2). Ovarian intact cows showed no response to the first two injections of

PGF2. probably because the concentration of PGF2, used was too low. The third injection

ofPGF2, (25 mg) resulted in a significant increase in plasma OT in all cows.









Day 22 Pregnancy

-- Sham-OVX, PGF (n = 6)
-- OVX, PGF (n =4)
250

OVX
Sham OVX
200 PGF:. (25 gg) PGF2. (25 gg) PGF2. (25 mg)



150


100


50


0
-50 0 50 100 150 200
Time (min)

Fig. 3-2. Least squares means ( SEM) plasma concentrations of oxytocin in
ovariectomized and sham-ovariectomized PGF2,-treated cows, day 22
pregnant. Arrows indicate time (0, 60 and 120 min) at which PGF2, injection
was given (i.v.).


The response to PGF2a or saline in sham-ovariectomized cows on day 22 of

pregnancy is shown in Fig. 3-3. No difference was observed in OT response to PGF2~ or

saline after the first and second injections (P > 0.05). However, in saline-treated cows

there was a numerical increase after the second injection. Subsequently, plasma OT

declined to concentrations observed prior to treatment. In cows treated with PGF2., there

was a significant increase in plasma OT 5 min after the third injection (25 mg). There

was no treatment by time interaction in any of the time periods.









Day 22 Pregnancy

-- Sham-OVX, PGF (n = 6)
-0-- Sham-OVX, Saline (n = 3)

250


Sham PGF2, (25 tg) PGF2, (25 pg) PGF2 (25 g)
20 OVX Saline Saline Saine


150


0
x 100-



50 -


0

-50 0 50 100 150 200

Time (min)

Fig. 3-3. Least squares means ( SEM) plasma concentrations ofoxytocin in sham-
ovariectomized PGF2, and saline-treated cows, day 22 pregnant. Arrows
indicate time (0, 60 and 120 min) at which PGF2 or saline was injected
(i.v.).


Plasma concentrations of OT in sham-ovariectomized day 40 pregnant cows

following PGF2a or saline treatment are shown in Fig. 3-4. Little variation was observed

in plasma OT following the first and second injections of either PGF2a or saline.

However, a temporal acute response of OT to PGF2a or saline was observed after the

third injection. This was not a sustained increase as observed in sham-ovariectomized

animals response to PGF2a at day 22 of pregnancy (Fig. 3-3).This indicates that in day 40

pregnant cows neither PGF2, nor saline had any appreciable effect in increasing plasma

OT concentrations.











Day 40 Pregnancy


E
- 150
ac
C
0
' 100
0


-0- Sham-OVX, PGF (n = 6)
-0- Sham-OVX, Saline (n = 3)


Sham PGF, (25 Wg) PGFo, (25 pg)
OVX Saline Saline

I I I


-50 0 50 100 150 200
Time (min)

Fig. 3-4. Least squares means ( SEM) plasma concentrations ofoxytocin in sham-
ovariectomized PGF2. and saline-treated cows, day 40 pregnant. Arrows
indicate time (0, 60 and 120 min) at which either PGF2, or saline was injected
(i.v.).


The OT response to PGF2, versus saline was different on day 22 versus day 40 of

pregnancy. Orthogonal contrasts showed a treatment by day of pregnancy by period of

interaction (Fig. 3-5A). On day 22 of pregnancy there was a significant (P < 0.03)

treatment by period interaction, indicative of an increase in plasma OT in period 3 in

PGF2z treated cows, whereas for saline treated cows there was no increase in plasma OT.

However, on day 40 cows there was no substantial increase in plasma OT in either PGF2,

or saline treated cows for any of the periods. (Fig 3-5 B).















-- PGF, day 22
-o- Saline, day 22


0.5 1.0 1.5 2.0 2.5 3.0 3.5

Period





--- PGF, day 40
-o- Saline, day 40


0.5 1.0 1.5 2.0 2.5 3.0
Period


Fig 3-5. Treatment by day of pregnancy by period interaction for oxytocin in sham-
ovariectomized cows receiving either PGF2a or saline on day 22 or 40 of
pregnancy (P < 0.03). Data represent least squares means SEM.








Discussion

Administration of sub-luteolytic doses of 25 tg PGF2 (i.v.) failed to cause a

significant increase in OT secretion in day 22 ovariectomized or ovarian-intact pregnant

cows. However, a luteolytic dose of 25 mg (i.v.) did increase plasma OT concentrations

in ovarian-intact cows. This suggests that most of the increase in plasma OT

concentrations measured in ovarian-intact cows at day 22 of pregnancy was secreted from

the CL in response to PGF2a. Intact cows at day 22 or 40 of pregnancy failed to respond

to sub-luteolytic PGF2, doses of 25 lsg. The failure of an OT response to the sub-

luteolytic dose of PGF2a is likely a result of an inadequate dose of PGF2a. This is in

contrast to the higher dose of 25 mg of PGF2a that was administered in the third period of

day 22 pregnant cows.

The increase in plasma OT concentrations at day 22 in pregnant cows was

observed within 5 min after injection of 25 mg of PGF2,, reached a peak within 25 min,

and declined thereafter. These results are similar to those reported in cyclic beef heifers

by Salli et al. (2000) where there was an increase in plasma OT concentrations within 5

min of treatment with PGF2a which remained elevated for 20 min and then declined to

basal concentrations by 40 min. Fields et al. (1989) reported that only 0.5% of large

luteal cells had secretary granules at 60 min after administration of 25 mg, PGF2a in

pregnant cows one to two weeks prior to parturition. Salli et al. (2000) reported that the

mechanism by which PGF2a induces release of OT from OT containing granules in the

CL is a PKC mediated event that activates MARKS protein which translocates the OT

granules to the membrane and disrupts the actin complex in the secretary process. They

determined the location of MARKS protein in cytosolic and membrane fractions of








sections from CL of day 17 pregnant cows that had been treated with PGF2,.

Translocation of MARKS causes movement of secretary granules to the membrane

where they release OT.

A dose dependent effect of PGF2~ (20 to 50 jg) on OT secretion was reported by

Skarzynski et al. (1997) who showed that CL sensitivity to PGF2a increased in the late

luteal phase. To evoke a similar OT response on days 12 and 18 of the cycle, PGF2a on

day 18 could be reduced 10 fold. The lack of response with 25 jg PGF2, in the present

experiment indicates the concentration was too low to effect a change in plasma OT

concentration. Skarzynski et al. (1997) failed to achieve luteal regression using 50 pg

PGF2, although the plasma OT concentration increase was comparable to that observed

during spontaneous luteolysis (50 70 pg/ml). A 30 gg dose of PGF2a released 67 pg/ml

whereas 20 gg had no effect on luteal OT release. We used 25 gg in this experiment not

knowing the results by Skarzynski et al. (1997).

Orwig et al. (1994) investigated the effect of 500 jg PGF2a on OT release from

the CL of day 8 cyclic beef cows and activation of PKC. Peak plasma concentrations of

OT occurred 1.5 to 10 min after injection of PGF2. In addition, there was a high

correlation (r = 0.82) between membrane PKC and OT release suggesting a role for PKC

in OT release from luteal cells. In their study, the CL was removed at different times after

PGF2a injection. A smaller peak in OT was observed in animals in which the CL was

removed at 0 min relative to the PGF2, injection than in those animals in which it was

removed later suggesting that most of the OT was of luteal origin.

In the present study, an increase in plasma OT concentrations occurred in

ovariectomized PGF2a-treated animals at 25 to 30 min after the first PGF2a injection. The








cause of this single elevation in plasma OT concentration is not clear. One possible

source of plasma OT is the neurohypophsis (McCracken et al., 1999). However, Schams

et al. (1985) reported that its contribution is minimal. The sampling in the present study

was in the jugular vein which would be an indication of possible secretion from the head

or neurohypophysis. Prostaglandins have been shown to stimulate release of several

hormones from both the posterior (oxytocin) and anterior pituitary gland (prolactin,

adrenocorticotrophic, growth and luteinizing hormone) (Haynes et al., 1978; Renegar et

al., 1978; Collier et al., 1979). The release of pituitary hormones modulated by

exogenous PGF2, is either direct or via the hypothalamus (Hedge, 1972; Ojeda et al.,

1975).

Unexpectedly, we observed increased OT release in sham-ovariectomized cows

treated with saline. It has been suggested that OT can be released as result of manual

manipulation of the ovary or the uterus (Williams et al., 2001). No increase in plasma OT

was observed immediately following ovariectomy. All animals in the group that was

sham-ovariectomized underwent the same procedures as those ovariectomized including

incision and manipulation of the ovaries.

It has been shown that norepinephrine also induces release of OT from the CL and

is involved in post-translational processing of OT. Oxytocin may also autoregulate its

own concentration in the CL although the mechanism is not clear (Bogacki and Kotwica,

1999). Norepinephrine affects luteal synthesis of OT by stimulating p-adrenergic

receptors. Similar effects as those due to norepinephrine may have occurred in this study

brought about by the stress animals experienced during the experiment (Kotwica et al.,

2002). This could lead to secretion of norepinephrine into circulation resulting in release








of luteal OT. This may be the case in those instances where there was an increase in

plasma OT following saline injection. However, since no major OT increase was

observed in periods 1 and 2, the supposed effect from norepinephrine may be minimal.

Alternatively the increase in OT may have been from the posterior pituitary as a neural

afferent reflex from handling the cervix, fomix and vagina e.g. Ferguson's reflex.

Norepinephrine stimulates concomitant progesterone synthesis and post-

translational processing of OT synthesis by activating 3p-hydroxysteroid dehydrogenase

in the bovine CL. It has been shown that stress mimicked by norepinephrine infusion may

increase progesterone synthesis, ovarian OT and P-adrenergic receptors (Kotwica et al.,

1991; 1994). No progesterone measurements were done in this study.

Skarzynski and Kotwica (1993) reported that administration of repeated 5 mg

doses of norepinephrine at 30 min intervals to cyclic cows resulted in a decrease in the

quantity of OT released each time from the CL indicating a depletion of OT. In the

present study, no responsiveness was seen following PGF2, until after the third injection

of a large PGF2, dose of 25 mg. This indicates that the sub-luteolytic 25 tg doses

administered were not capable of eliciting an observable response.

Ivell et al. (1985) reported that there was no de novo synthesis of OT pro-

hormone in the mid-luteal CL. This suggests that once OT is depleted there is no

replenishment of stored OT. Ovariectomized cows at 22 days of pregnancy treated with

PGF2u had a slight but nonsignificant increase in OT concentrations of about 10 to 15

pg/ml following the second and third injections. This minimal increase in OT

concentrations indicates an OT contribution ofneurohypophyseal origin in

ovariectomized cows in the absence ofa CL. The OT response to PGF2. in sham-








ovariectomized cows on days 22 was greater than at day 40 of pregnancy (Fig. 3-5A and

B). In both groups of animals, a significant release of OT was observed after the

luteolytic dose of OT. Day 40 CL, believed to be depleted of OT, were expected to give a

minimal response to PGF2a. The response observed may indicate an alternative source of

OT since Nichols et al. (2003) showed no luteal OT or OT mRNA in day 40 CL. Indeed a

similar elevation in plasma OT concentrations was observed in the saline treated cows at

day 40 indicating neurohypophyseal release. Sheldrick and Flint (1983b) reported

decreased concentration of OT in ovine CL during pregnancy from 373 ng/g wet weight

at day 14 to less than 5 ng/g at day 50 of pregnancy. A decrease in luteal OT therefore

reduces the likelihood of luteal regression and uterine contractility which would further

assist in the establishment of pregnancy. One known cause for failure of PGF2a to

stimulate further release of OT may be PGF2a receptor desensitization (Skarzynski and

Okuda, 1999). In the ovary, this has been attributed to prostaglandins produced locally in

the CL (Denning-Kendall et al., 1994). Lamsa et al. (1992) showed that low level

infusion of PGF2a into the ovarian artery led to desensitization of the CL in releasing OT

in ewes. However, in this study we observed release of OT after the third injection

suggesting that desensitization was not the cause of failure to release high amounts of OT

on the first and second injections of PGF2a in the sham-ovariectomized cows. In periods

one and two doses of PGF2, were too low.

Flint and Sheldrick (1983) and Schallenberger et al. (1989) reported an increase in

plasma OT in pregnant cows between days 14 to 16. Higher concentrations of OT were

found in the aorta than in the cauda vena cava suggesting a non-luteal source. Hooper et

al. (1986) reported higher OT concentrations in the jugular vein than in the carotid artery








of late luteal phase sheep, an indication that the neurohypophysis could be contributing to

the plasma OT. Parkinson et al. (1992) suggested a possibility of OT release from the

neurohypophysis in cows after the levels of OT from the CL declined around the time of

maternal recognition of pregnancy. Schams et al. (1983), Wathes et al. (1984) and

Meidan et al. (1993) reported that follicles could also be a source of OT. In the present

study, however, both ovaries were removed.

The conclusions from this study are that PGF2a induces release of OT from the

CL of day 22 but not day 40 pregnant cows and that the dose of PGFz2 has to be

luteolytic in order for a substantial amount of OT to be released. These two groups of

cows represent cows in the early (i.e. day 22) and late (i.e. day 40) peri-implantation

periods. Failure for release of OT at day 40 means cows at this stage have very little OT

in the CL and that OT from the CL at this stage is unlikely to initiate pulsatile secretion

of PGF2,.














CHAPTER 4
EXPRESSION OF OXYTOCIN RECEPTOR, PROSTAGLANDIN G/H, F AND E
SYNTHASES IN THE BOVINE ENDOMETRIUM AND CHORIOALLANTOIS
DURING THE ESTROUS CYCLE AND PERI-IMPLANTATION PERIOD

Introduction


Oxytocin and the OTR play important roles in reproductive processes including

luteolysis, establishment of pregnancy, milk-let down and parturition in females and

ejaculation in males (Ivell and Russel, 1995; Assinder et al., 2000). Inhibition of the

OTR plays an important role in the establishment of pregnancy (Wathes and Lamming,

1995); and the induction of OTR during labor facilitates delivery of the fetus (Fuchs et

al., 1996).

Blockade of endometrial OTR with an OT antagonist from days 15 to 22 of the

cycle affects neither the duration of luteolysis nor the duration of the estrous cycle in

heifers (Kotwica et al., 1997). However, Kotwica et al. (1998b) reported that blockade of

OTR decreases the magnitude of PGF2, release indicating that OT has a supportive and

modulatory role of the amplitude of PGF2a that initiates luteolysis in cattle. Using ligand

binding assays, Fuchs et al. (1990) reported that OTR concentrations on days 7 and 14 of

pregnancy were similar to those in cyclic cows. On days 17 and 21, receptor

concentrations in pregnant cows remained low and were lower than in cyclic cows.

Oxytocin administered to pregnant cows leads to increased production of PGFM in a








dose-dependent fashion that occurs later in pregnancy at approximately day 50 (Fuchs et

al., 1996b). Prostaglandin F2.is a luteolysin released by the endometrium at the end of a

normal estrous cycle in response to OT when no concepts is present. However, in the

presence of a viable embryo there is suppression of pulsatile PGF2a secretion (Silvia et

al., 1991; Flint et al., 1992). It is now well established that OTR is suppressed by IFN-T

during the period of maternal recognition of pregnancy (Telgmann et al., 2003). In cases

where the concepts secretes inadequate interferon-T (IFN-T) there may be a possibility of

OTR stimulation and PGF2a secretion that could augment the luteolytic process and lead

to embryo loss.

Oxytocin binds to its receptor and couples to Gi and Gq proteins leading to

activation of PKC and PLC pathways (Sanborn et al., 1995; Copland et al., 1999).

Eventually PGHS-2 and PGF2a synthesis occur which leads to luteolysis during the

estrous cycle. Although these events occur in an estrogen dominated environment, the

bovine OTR does not respond to activated estradiol receptors (Ivell et al., 1998). It was

recently shown that the ovine OTR promoter is stimulated by liganded ERa through

protein-protein and protein DNA interactions (Bazer et al., 2003). A progesterone-primed

endometrium seems to be necessary for OT-induced activation of PGHS-2 since it has

been shown that prepubertal heifers fail to respond to OT unless they are primed by

progesterone (Fuchs et al., 1997). Although several studies on the expression of OTR

have been conducted during the estrous cycle and early pregnancy, expression of OTR

mRNA during most of the peri-implantation has not been investigated. The importance of

understanding the pattern of expression of OTR dJuri, The peri-implantation period arises

because if OTR are actively expressed and coupled to the prostaglandin synthesis








pathway, this may initiate luteolytic pulses of PGF2, during early pregnancy. This may be

one of the mechanisms that lead to high embryo loss during early pregnancy in cattle.

Particularly in high producing dairy cows.

Prostaglandin G/H synthase (PGHS), also known as cyclooxygenase, is a key rate

limiting enzyme in the prostaglandin biosynthetic pathway which converts arachidonic

acid to PGH2. The PGH2 is converted to PGF2a by PGFS (Watanabe et al., 1985). The

PGHS-2 is present at low concentrations in most tissues but is usually induced by a

variety ofmitogens (Kujubu et al., 1991; Xie et al., 1991), interleukin-l (Habib et al.,

1993) and growth factors (Wong et al., 1989; Herschmann, 1996). Within the bovine

endometrium, two types of cells play an important role in the synthesis of prostaglandins.

The epithelial cells predominantly secrete PGF2a whereas the stromal cells secrete PGE2

(Schatz et al., 1987; Fortier et al., 1988; Desnoyers et al., 1994; Parent et al., 2003b).

During early pregnancy, the loss of uterine responsiveness to OT causes the

suppression of the pulsatile pattern of PGF2a secretion leading to maintenance of the CL.

In vivo studies have revealed the expression and regulation of PGHS-2 in uterine tissues

during the estrous cycle (Arosh et al., 2002) and later stages of pregnancy (Fuchs et al.,

1999). Arosh et al. (2002) reported high expression of PGHS-2 mRNA in endometrium

of cows between days 13 21 of the estrous cycle and low expression between days 1 -

12. Although Guzeloglu et al. (2003) reported high expression of PGHS-2 mRNA in

endometrium of day 17 pregnant dairy cows, no extensive studies have been conducted

on the expression in the endometrium and chorioallantois during the peri-implantation

period. Evaluation of the pattern of expression of PGHS-2 during the entire peri-

implantation period is necessary since it would enhance our understanding of its probable








role in establishment of pregnancy. Depending upon the relative amounts of each, the

downstream enzymes PGFS and PGES may lead to predominantly conversion of PGH2 to

PGF2a, which is luteolytic, or to PGE2, which may be luteotrophic in ruminants (Pratt et

al., 1977).

In a situation where there is increased endometrial expression of PGHS-2 in

cyclic or pregnant cows around the time of luteolysis or maternal recognition of

pregnancy, there would probably be increased synthesis of PGES in pregnancy. This

could be in anticipation for successful pregnancy to maintain a PGE2:PGF2. ratio that is

favorable for maintaining pregnancy. Studies on the expression of PGES and PGFS in the

bovine endometrium and chorioallantois will increase our understanding of the

physiological functions of these enzymes in cyclic and peri-implantation cows.

Prostaglandin E and F synthases are key enzymes in the pathway to prostaglandin

synthesis that are involved in conversion of PGH2 to PGE2 and PGF2, respectively

(Watanabe et al., 1985). Despite the importance of PGFS in prostanoid synthesis and

reproduction, little information exists about its mRNA expression and regulation during

the estrous cycle and the peri-implantation period. Increased expression of PGFS during

the peri-implantation period could lead to increased synthesis of PGF2, which may lead

to high PGF2,:PGE2 ratio not favoring implantation. Understanding the mechanisms that

control the maintenance of pregnancy and viability of the concepts during the peri-

implantation period should provide insight into causes of embryo loss that occur during

this time.

It is hypothesized that OTR, PGHS-2 and PGFS mRNA are downregulated

whereas PGES is upregulated in the endometrium and chorioallantois during the peri-








implantation period. Such a response should lead to less chances of luteolysis and

increase embryo survival. The objectives of this study were to characterize the expression

of OTR, PGHS-2, PGES and PGFS in bovine caruncular and intercaruncular

endometrium as well as the chorioallantois during the estrous cycle and the peri-

implantation period.

Materials and Methods

Animals

Tissues were collected from multiparous Brahman-Angus crossbred cows (n = 4

each day) on day 0 (estrus), 3, 7, 14 and 18 of the estrous cycle and at days 7, 14, 18, 22,

30, 40 and 50 of pregnancy (n = 4 to 5 cows each day). Estrus was induced with PGF2a

(25 mg, i.m, Lutalyse, Pharmacia & Upjohn, Kalamazoo, MI). Cows were exposed to a

fertile bull with a chin ball marker, and also bred at estrus by artificial insemination to

enhance pregnancy rates. Cows were slaughtered and tissues collected from animals

processed through the University of Florida Animal Science abattoir. For cows less than

30 days of pregnancy, pregnancy was confirmed by observation of a concepts or embryo

after flushing the uterine horns with physiological saline. For cows at 40 or 50 days,

pregnancy was confirmed using ultrasound. Endometrial samples were collected from

the uterine horn ipsilateral to the CL and care was taken to separate the caruncular from

the intercaruncular endometrium. The chorioallantois was collected from cows which

were at least 30 days pregnant. Tissues were snap-frozen in liquid nitrogen and then

stored at -80C until RNA extraction.








RNA Extraction

Total RNA was isolated from the caruncular and intercaruncular endometrium as

well as the chorioallantois using Trizol reagent (InVitrogen, Carlsbad, CA) following the

manufacturers instructions. After extraction, the RNA pellet was re-suspended in 75 P1

pre-warmed (600C) RNAsecure M Resuspension solution (Ambion, Austin, TX), and the

resultant RNA suspension heated at 600C for 10 min to remove contaminating RNAse. A

DNA-free TM kit (Ambion) was used to remove contaminating genomic DNA from the

RNA samples. Briefly, 0.1 volume of 10X DNase I buffer (100 mM Tris-Cl, pH 7.5, 25

mM MgC12, 1 mM CaCl2 ) and 1 p1 DNAse I, RNAse free (2 units/pl) were added to the

RNA suspension. The RNA samples were then mixed gently and incubated at 370C for

30 min. At end of incubation, 0.1 volume (7.5 pl) of DNase Inactivation Reagent from

the DNA-free kit was added and the contents were mixed and incubated at 240C for 2

min. The mixture was centrifuged at 10,000 x g for 1 min to pellet the DNase

Inactivation Reagent. Treated RNA samples were recovered and their concentrations

determined using a spectrophotometer at 260 nm. The quality of the RNA samples was

assessed by the integrity of 28S and 18S ribosomal RNA after electrophoresis of 10 pg

total RNA. The RNA samples were stored at -800C until analysis.

Validation of the Relative Ouantitation of OTR. PGES. PGFS mRNA and 18S rRNA

The A ACT method for relative gene quantitation is based on the following

principle. The threshold cycle CT indicates the fractional cycle number at which the

amount of amplified target reaches a fixed threshold. The mean CT (Threshold) values of

replicate runs for the target gene are determined. The difference (ACT) between the mean

CT values of the target gene and the endogenous control (18S rRNA) is calculated. Then








A ACT is the difference between ACT and the CT value of the calibrator. The amount of

target (OTR, PGHS-2, PGES, PGFS) normalized to endogenous reference (18S rRNA)

and relative to the calibrator is determined by the formula, relative concentration of target

mRNA = 2-acT. Intercaruncular endometrial RNA sample from a cow in estrus was

chosen in which the OTR and PGHS-2 transcripts were believed to be highly expressed

calibratorr sample). For PGES and PGFS, the calibrator was total RNA from

intercaruncular endometrium from a cow at day 15 of pregnancy.

In order to use the A A CT method for relative quantitation of mRNA expression

for the respective genes, a validation study was conducted to demonstrate that the

efficiencies of amplification for the OTR, PGHS-2, PGES and PGFS genes (target

amplification) and 18S rRNA (reference amplification) are approximately equal. In order

for the efficiencies of amplification for the two genes to be equal, the absolute value of

the slope of log input amount of RNA versus ACT should be less than 0.1 (Applied

Biosystems user Bulletin #2) or the slopes of the dilution curves for the specific target

gene and that for 18S rRNA should be approximately equal. The validation study also

provided information on the concentration of total RNA to be used during PCR for all the

genes and 18S rRNA. For OTR gene expression, serial dilutions of total RNA were

conducted from 200 ng to 1.56 ng (Appendix B), 200 pg to 1.56 pg for 18S rRNA

(Appendix C), 800 ng to 1.56 ng for PGHS-2 (Appendix D), and 400 ng to 1.56 ng for

PGES and PGFS (Appendices E and F). Amplification plots for OTR (Fig. 4-1), 18S

rRNA (Fig. 4-2), PGHS-2 (Fig. 4-5), PGES (Fig. 4-7) and PGFS (Fig 4-9) were

constructed. Threshold cycle (CT) values were plotted against log concentration and the

slope was determined. The slope (-3.4) for the standard curve of the OTR gene (Fig. 4-3),








-3.3 for PGHS-2 (Fig. 4-6), -3.1 for PGES (Fig. 4-8) and -3.3 for PGFS (Fig. 4-10) were

comparable to that of 18S rRNA (-3.5, Fig. 4-4). The values obtained confirmed the

validity of the A A CT method for determining relative abundance of the genes studied.

PCR Primers and Probes

Primers were designed by Assay by Design, Applied Biosystems (Foster City, CA) and

are shown in Table 4-1.

Table 4-1. Sequences of primers and probes used for RT-PCR.

mRNA Primer sequence/Probe (P) Amplicon Reference
Forward (F) Reverse (R) size (bases)
OTR GGCCTACATCACGTGGATCAC (F) Bathgate et al.
(1995)
AGCAGGTGGCAAGGACGAT (R) 66

ACGGGCACAATGTA (P)

PGHS-2 CGTGAAGCCCTATGAATCATTTG (F) Liu et al. (1999)
CTTCTAACTCTGCAGCCATTTCCT (R) 66

TCTCTCCTGTAAGTTCC (P)

PGES GGAACGACCCAGATGTGGAA (F) 85 Filion et al.
ACAAAGCCCAGGAACAGGAA (R) (2001)

6FAMCCTCAGAGCCCACCGGMGBNF (P)

PGFS CAAGCCTGGGAAGGACTTCTT (F) 78 Suzuki et al.
CAGGTATCCACGAAATCTTTCTCA (R) (1999)

6FAMAGGACGGCAACGTGATMGBNFQ (P)


PCR Protocol
The PCR mastermix consisted of 25 pl of2X ThermoScript Reaction mix

Platinum Quantitative RT-PCR ThemoScript One-Step system (InVitrogen). Primers,

20X (2.5 il, 900 nM) and probes (2.5 pil, 250 nM) were obtained from Applied








Biosystems, Customer Set ID OTR-cDNA-OTR1, COX-2-cDNA-COXa, PGES-cDNA-

GESd, PGFS-cDNA-GFSb, TaqMan probes (antisense sequence) used FAM as reporter

dye and a minor groove binding non-fluorescent quencher dye (MGB-NFQ). Primers for

18S rRNA (2.5 pl, 900 nM each) and TaqMan probe (2.5 t1, 250 nM, eukaryotic 18S

rRNA MGB endogenous control) were obtained from Applied Biosystems. The probe

uses VIC as reporter dye and MGB-NFQ as a quencher. ThermoScript plus/Platinum Taq

enzyme mix (1 pl, Platinum Quantitative, RT-PCR ThermoScript One-Step System) was

obtained from InVitrogen. Autoclaved distilled water (11.5 pl) was added to the above

components to give a final volume of 50 il per reaction tube. Total RNA (200 ng) was

used for OTR, PGHS-2, PGES and PGFS gene expression analysis, and 200 pg total

RNA per reaction for thel8S rRNA gene. For inter and intra-assay control, total RNA

from caruncular endometrium from a cow in estrus was used for OTR and PGHS-2

genes, whereas intercaruncular endometrium from a cow at day 15 of pregnancy was

used for PGES and PGFS. All samples were run in triplicate. A set of two reactions for

no-template controls (NTC) for both the target gene and 18S rRNA were included. The

NTC consisted of 10 pl water. The individual genes (OTR, PGHS-2, PGES, and PGFS)

and 18S rRNA gene expression RT-PCR were conducted on the same sample plate.

Procedure

All reagents were kept on ice. In each assay, the master mixture for either OTR,

PGHS-2 and 18S rRNA or, PGES, PGFS and 18S rRNA were added to the wells first,

followed by deionized double-distilled water, primers and probe. The Taq polymerase

was added last. Autoclaved double distilled water was then added to the NTC wells and

these wells capped with optical caps (Applied Biosystems) prior to addition of RNA to








the rest of the wells. The well contents were vortexed briefly and transported on ice to

the Interdisciplinary Center for Biotechnology Research (ICBR) Protein Core Laboratory.

The plate was centrifuged briefly to bring down the well contents before it was loaded

into a GeneAmp 5700 for one-step Real Time PCR.

Thermal Cycler Protocol

Reverse transcription reaction for first strand cDNA synthesis was conducted at

500C for 30 min. Inactivation of reverse transcriptase, denaturation of RNA/DNA and

activation ofTaq DNA polymerase were conducted at 950C for 5 min. Amplification was

achieved with 40 cycles at 950C for 15 sec (extension) and 600C for 1 min (annealing).

Run time was 2 h 19 min.

Analysis of Results From Gene AMP 5700

Data from the GeneAmp 5700 runs were entered into the GeneAmp 5700 SDS

software program to determine CT values (threshold cycle) and amplification plots. The

data for CT values for OTR, PGHS-2, PGES, PGFS and 18S rRNA and calibrator sample

were used to determine the relative quantity of the individual genes using the AA ACT

method. Results were expressed as arbitrary units relative to the calibrator sample and

normalized against 18S rRNA.


Immunohistochemical Localization for OTR and PGHS-2

Caruncular and intercaruncular endometrium were dissected separately. Tissues

were fixed in 4% (w/v) paraformaldehyde in phosphate buffered saline (pH 7.5) for 24 h.

Following fixation, tissues were dehydrated in ethanol and embedded in paraffin. Tissue

sections were cut at 4 pm thickness and mounted onto Superfrost charged microscopic

slides (Fisher, Pittsburg, PA). Sections were deparaffinized and hydrated in a series of








graded alcohols: xylene 1 (5 min), xylene 2 (5 min), 100% ethanol for 2 min (x 2), 3%

hydrogen peroxide in methanol to block endogenous peroxidases (10 min), 95% ethanol

(2 min), 70% ethanol (1 min), and water (2 min).

Antigen retrieval was used to unmask antigenic OTR and PGHS-2 sites. Briefly,

slides were boiled at 1000 C for 20 min in EDTA buffer (pH 8.0) for OTR and 0.01 M

citric acid buffer for PGHS-2 (Richard Allan Scientific, Kalamazoo, MI). Slides were

kept in Tris buffer (IX) until blocking serum was added. Sections were incubated at 24C

for 20 min in Avidin-Biotin blocking reagent containing goat serum to block nonspecific

binding. The primary mouse monoclonal antibody against human OTR (anti-OTR 2F8,

was a kind donation from Dr. T. Kimura, Osaka University Medical School, Osaka,

Japan) (Takemura et al., 1994), was shown to react with bovine OTR (Fuchs et al.,

1996a). Antiserum was added to the sections at a dilution of 1:50 and incubation

conducted at room temperature (24C) for 1 h.

For PGHS-2 immunostaining, the primary polyclonal antibody (PG 27b human

anti-PGHS-2, Oxford Biomedical Research, Oxford, MI) was used at a dilution of 1:100.

Secondary biotinylated antibody in the ABC Vectastain kit (Vector Laboratories Inc,

Burlingame, CA) was added and sections incubated at 24C for 30 min followed by

Vectastain ABC reagent for 30 min. Diaminobenzidine-tetrahydrochloride (DAB)

reagent was then applied to the tissue sections for 3 min. Excess DAB was washed away

by placing the slides in distilled water. Counterstaining was conducted for 1.5 min using

hematoxylin (Richard Allan Scientific). Sections were rinsed in running water for 30 sec

and clarified with a clarifier (Richard Allan Scientific). Sections were then dehydrated

using a series of graded ethanol from 70%, 95%, 100% (x 2) and xylene (15 dips in each








solution). Sections were sealed with Richard Allan Scientific mounting medium and

cover slips. Sections were viewed under a Zeiss Axioplan II microscope to detect for

specific immunostaining for OTR or PGHS-2 antigen. Photomicrographs were taken at

200X magnification. For OTR, negative controls included sections from the same tissue

with antibody dilution buffer substituting for the primary antibody; whereas for PGHS-2

preimmune rabbit serum (PG 27c, Oxford Biochemical Research) at a dilution of 1:100

was substituted for primary antibody.

Statistical Analysis

Data were analyzed using the Statistical Analysis System (SAS) software version

8 (SAS Institute, Cary, NC). Group means of OTR, PGHS-2, PGES and PGFS mRNA

by tissue and day of pregnancy or cycle were computed. Data with unequal error

variances were log-transformed for data analysis. The model consisted of concentration

of OTR, PGHS-2, PGES and PGFS mRNA as the dependent variables and status (cyclic

or pregnant), tissue (caruncular, intercaruncular endometrium and chorioallantois), day of

cycle/pregnancy, status x tissue, status x day, tissue x day, status x tissue x day as

independent variables. Significance of differences between group means by status, type

of tissue and day of pregnancy or cycle were tested using ANOVA. Orthogonal contrasts

were conducted for the effects of status, day and tissue. Differences in means were

considered statistically significant at P < 0.05. Simple and partial correlations were

conducted to determine the relationships between the different genes. Transformed data

are presented as least squares means SEM.

























Fig. 4-1. Amplification plot showing serial dilutions of total RNA used in the validation to quantitate OTR mRNA.
Rn (normalized reporter) = fluorescent emission intensity of the reporter dye divided by the fluorescent
emission intensity of the passive reference dye.






















0.01 -- --




0.001
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39
Cycle Number

























Fig. 4-2. Amplification plot showing serial dilutions of total RNA used in the validation to quantitate 18S rRNA.





























1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39
Cycle Number


0.01




0.001

























Fig 4-3. Standard curve for estimation of efficiency of amplification of the OTR gene for validation of AA CT method.





Standard Curve






IM

4,

$





_ ______


1.2
Log CO


Slope: -3.485842
Intercept: 28.359133
Correlation: -0.996098


0.4


0.8


2.4





















Fig. 4-4. Standard curve for estimation of efficiency of amplification of 18S rRNA gene for validation of AA C-r method.






29

28

27

26

25

24

23

22

21

20


Standard Curve


-1------------




-,


=^^===


1.2
Log CO


Slope: -3.485842
Intercept: 28.359133
Correlation: -0.996098


0.4


0.8


2.4

























Fig. 4-5. Amplification plot showing serial dilutions of total RNA used in the validation to quantitate PGHS-2 mRNA.
















1 -i -- -t--- -u t a- -- -- -u--uN -- N




0.01




0.001 --
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39
Cycle Number

























Fig. 4-6. Standard curve for estimation of efficiency of amplification of PGHS-2 gene for validation of A A CT method.
























0 0.4


Standard Curve

*
*





*


0.8


1.2 1.6
Log CO


2 2.4


2.8


Slope: -3.216199
Intercept: 33.979012
Correlation: -0.997429


3.2

























Fig. 4-7. Amplification plot showing serial dilutions of total RNA used in the validation to quantitate PGES mRNA.






10





1 ------_ -



0.001 *N ---J ----I--N---N----N-- --N--M------N--K--N N-------------------

n




0 .0 1 .





0.001 ".""
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39
Cycle Number

























Fig. 4-8. Standard curve for estimation of efficiency of amplification of PGES gene for validation of AA CT method.





Standard Curve


0.4


0.8 1.2 1.6 2 2.4
Log CO


Slope: -3.107788
Intercept: 35.300079
Correlation: -0.998248


2.8

























Fig. 4-9. Amplification plot showing serial dilutions of total RNA used in the validation to quantitate PGFS mRNA.
















-01 --^- --- I- -- ---- -- -

n /,




0.01 -




0.001
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39
Cycle Number
























Fig. 4-10. Standard curve for estimation of efficiency of amplification of PGFS gene for validation of A A CT method.

























0.4


Standard Curve







4,

*I


0.8


1.2
Log CO


1.6


2.4


Slope: -3.300591
Intercept: 26.870775
Correlation: -0.999276


2.8








Results

Expression of OTR, PGHS-2, PGES and PGFS mRNA in Intercaruncular Endometrium

of Cyclic-Pregnant Cows from Days 7 to18.

A significant difference was observed between day 14 and 18 for OTR mRNA as

shown by orthogonal contrasts (P < 0.05) (Table 4-2). There was a significant status

(cyclic-pregnant) by day 14 versus day 18 interaction (P < 0.05). The mRNA for OTR

increased from day 14 to day 18 in cyclic cows but remained low in pregnant cows. The

status by day 14-18 interaction is shown in Fig. 4-11.

A status by day interaction (P < 0.01) was detected for PGHS-2 mRNA (Table 4-

2). In both cyclic and pregnant cows, PGHS-2 mRNA increased on days 14 and 18, but

the increase was appreciably greater in pregnant cows (Table 4-2 and Fig. 4-12). For

PGES mRNA significant status by day interactions (P < 0.05 and P < 0.01) were detected

(Table 4-2). In particular, PGES mRNA increased appreciably on day 18 for cyclic cows

but did not change for pregnant cows (Table 4-2). The change in PGES mRNA

associated with pregnancy reflects an attenuation in contrast to a stimulation for PGHS-2

mRNA. A more complex pattern of change was detected for PGFS mRNA (Table 4-2).

The mean expression of PGFS mRNA on day 7 was higher than for days 14-18 for both

cyclic and pregnant cows (P < 0.01). The expression declined by day 14 in cyclic cows

but was more sustained in pregnant cows at day 14 followed by a decrease on day 18

(Table 4-2).




Full Text
EXPRESSION OF GENES INVOLVED IN PROSTANOID SYNTHESIS IN THE
ENDOMETRIUM AND CHORIOALLANTOIS OF THE COW
By
HILARY BINTA
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE
UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE
REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2003

ACKNOWLEDGMENTS
I would like to thank Dr. M. J. Fields for being my graduate advisor and chairman
of my supervisory committee. Without his constant encouragement and support it would
have not been possible to finish my dissertation. My thanks go to all of my committee
members (Drs. William Thatcher, Peter Hansen, Nancy Denslow and Maarten Drost) for
their valuable input and advice regarding my research. I would like to thank Dr. Shou-
Mei Chang for introducing me to most of the laboratory techniques that I used to conduct
my research. My thanks also go to Drs. Lokenga Badinga and Rosalia Simmen for
allowing me to use the facilities in their labs. I would also like to thank Allan Eldred and
the graduate students in our lab (Nicole Nichols and Elizabeth Johnson) for their
assistance and friendship during my stay in the lab.
I am grateful to the Institute for International Education for having offered me a
Fulbright Fellowship; and to Makerere University for granting me study leave to pursue
my graduate studies at the University of Florida. My gratitude also goes to University of
Florida for granting me an assistantship to complete my studies. I would like to thank my
family for their support throughout my education. My thanks also go to all of the
graduate students, faculty, and staff in the Department of Animal Sciences for their
friendship and assistance during my studies. I thank all of my friends especially Dr.
Edmond Kabagambe, Jurjen Luykx, Justin Sobota, and Eric Hiers for their constant
ii
encouragement and support.

I would like to thank my wife Angela for all of the love, understanding, and
support that she gave me during my graduate studies. Last but not least, I would like to
thank my son Jeffrey for all of the happiness and love that he brings to my life.

TABLE OF CONTENTS
Page
ACKNOWLEDGEMENTS ii
LIST OF TABLES vii
LIST OF FIGURES ix
ABSTRACT xii
CHAPTER
1 INTRODUCTION 1
2 LITERATURE REVIEW 4
Luteolysis 4
Functional Luteolysis 7
Structural Luteolysis 8
Regulation of Prostaglandin Synthesis 10
Inhibition of Luteolysis by the Embryo 16
Resumption of Prostaglandin Synthesis after Maternal Recognition of Pregnancy 21
Properties of the Key Elements Involved in Luteolysis 22
Bovine Oxytocin Receptor 22
Oxytocin Receptor Signaling 23
Regulation of Oxytocin Receptor 23
Prostaglandin H-Synthase-2 26
Structure of Bovine PGHS-2 Gene 26
Signal Transduction through PGHS-2 27
Regulation of PGHS-2 Gene Expression 28
Prostaglandin F Synthase 30
Regulation of Prostaglandin F Synthase 32
Prostaglandin E Synthase 33
Regulation of Prostaglandin E Synthase 35
Bovine Luteal OT 35
iv

3 RELEASE OF OXYTOCIN FROM OVARIAN VERSUS PITUITARY
TISSUES IN RESPONSE TO PGF2a IN OVARIECTOMIZED AND SHAM-
OVARIECTOMIZED COWS DURING THE PERI-IMPLANTATION PERIOD ...40
Introduction 40
Materials and Methods 42
Results 46
Discussion 51
4 EXPRESSION OF OXYTOCIN RECEPTOR, PROSTAGLANDIN G/H
SYNTHASE-2, E AND F SYNTHASES IN THE BOVINE ENDOMETRIUM AND
CHORIOALLANTOIS DURING THE ESTROUS CYCLE AND PERI-
IMPLANTATION PERIOD 57
Introduction 57
Materials and Methods 61
Results 89
Discussion 112
5 GENERAL DISCUSSION AND CONCLUSIONS 132
APPENDIX
A CONTRASTS FOR TREATMENT, PERIOD, TIME AND INTERACTIONS 149
B DATA FOR OTR mRNA EXPRESSION 151
C DATA FOR 18S rRNA EXPRESSION 152
D DATA FOR PGHS-2 rnRNA EXPRESSION 153
E DATA FOR PGES mRNA EXPRESSION 154
F DATA FOR PGFS mRNA EXPRESSION 155
REFERENCES 156
BIOGRAPHICAL SKETCH
185

LIST OF TABLES
Table Edge
2-1 Prostaglandin synthase enzymes that belong to the aldoketoreductase
superfamily 32
2-2 Membrane associated proteins in eicosanoids and glutathione metabolism
superfamily 34
3-1 Experimental design for in vivo study to ascertain response of PGFíaOr saline
on luteal OT release in peri-implantation cows 43
4-1 Sequences of primers and probes used for RT-PCR 64
4-2 Least squares means for OTR, PGF1S-2, PGES and PGFS mRNA in
intercaruncular endometrium of beef cows from day 7 to 18 of the estrous
cycle or pregnancy 90
4-3 Least squares means for OTR, PGHS-2, PGES and PGFS mRNA in inter¬
caruncular endometrium of beef cows from days 0 to 18 of the estrous cycle 92
4-4 Least squares means for OTR, PGHS-2, PGES and PGFS mRNA in
intercaruncular endometrium of beef cows from days 7 to 50 of pregnancy 93
4-5 Least squares means for OTR, PGHS-2, PGES and PGFS mRNA in the
chorioallantois of beef cows from days 30 to 50 of pregnancy 95
4-6 Least squares means for OTR and PGHS-2 mRNA in caruncular endometrium
of beef cows from days 7 to 18 of the estrous cycle or pregnancy 96
4-7 Least squares means for OTR and PGHS-2 mRNA in caruncular endometrium
of beef cows from days 7 to 18 of the estrous cycle 96
4-8 Least squares means for OTR, PGHS-2, PGES and PGFS mRNA in caruncular
endometrium of beef cows from days 7 to 50 of pregnancy 98
4-9 Correlations between mRNAs for OTR, PGES, PGHS-2 and PGFS in
intercaruncular endometrium of beef cows on days 0, 3, 7, 14 and 18
of the estrous cycle 101
vi

4-10
Correlations between mRNAs for OTR, PGES, PGHS-2 and PGFS in
intercaruncular endometrium of beef cows on days 7,14 and 18 of the estrous
cycle or pregnancy
101

LIST OF FIGURES
Figure
page
3-1 Experimental protocol for response of PGF2a or saline on luteal OT release
in peri-implantation cows 43
3-2 Least squares means (± SEM) plasma concentrations of oxytocin in
ovariectomized and sham-ovariectomized PGF2a-treated cows, day 22
pregnant 47
3-3 Least squares means (± SEM) plasma concentrations of oxytocin in
sham-ovariectomized PGF2a and saline-treated cows, day 22 pregnant 48
3-4 Least squares means (± SEM) plasma concentrations of oxytocin in
sham-ovariectomized PGF20 and saline-treated cows, day 40 pregnant 49
3-5 Treatment by day of pregnancy by period interaction for oxytocin in
sham-ovariectomized cows, receiving PGF201 or saline on day 22 or 40 of
pregnancy 50
4-1 Amplification plot showing serial dilutions of total RNA used in the validation
to quantitate OTR mRNA 70
4-2 Amplification plot showing serial dilutions of total RNA used in the validation
to quantitate 18S rRNA 72
4-3 Standard curve for estimation of efficiency of amplification of OTR gene for
validation of A A Cr method 74
4-4 Standard curve for estimation of efficiency of amplification of 18S rRNA
gene for validation of A A Cr method 76
4-5 Amplification plot showing serial dilutions of total RNA used in the
validation to quantitate PGHS-2 mRNA 78
4-6 Standard curve for estimation of efficiency of amplification of PGHS-2
gene for validation of A A Ct method 80
4-7 Amplification plot showing serial dilutions of total RNA used in validation to
quantitate PGES mRNA expression 82
viii

4-8 Standard curve for estimation of efficiency of amplification of PGES
gene for validation of A A Ct method 84
4-9 Amplification plot showing serial dilutions of total RNA used in
the validation to quantitate PGFS mRNA expression 86
4-10 Standard curve for estimation of efficiency of amplification of PGFS
gene for validation of A ACx method 88
4-11 Oxytocin receptor concentrations in intercaruncular endometrium of beef cows:
cyclic-pregnant interaction by day 14-18 90
4-12 Prostaglandin G/H Synthase-2 mRNA concentrations in intercaruncular
endometrium of beef cows: cyclic-pregnant interaction by day 7 vs D14, 18 91
4-13 Regression curves for OTR, PGFS, PGHS-2 and PGES mRNA expression in
intercaruncular endometrium of beef cows from days 7 to 50 of pregnancy 94
4-14 Oxytocin receptor and PGHS-2 mRNA concentrations in caruncular endometrium
of beef cows, cyclic-pregnant by day 14-18 interaction for OTR and day 7-14
for PGHS-2 97
4-15 Regression curves for OTR and PGHS-2 mRNA expression in caruncular
endometrium of beef cows from days 0 (estrus) to 18 of the estrous cycle 99
4-16 Regression curves for OTR and PGHS-2 mRNA expression in caruncular
endometrium of beef cows from days 7 to 50 of pregnancy 100
4-17 Immunohistochemical staining of bovine OTR in representative sections of the
intercaruncular endometrium during the estrous cycle 105
4-18 Immunohistochemical staining of bovine OTR in representative sections
of the intercaruncular endometrium during the peri-implantation period 107
4-19 Immunohistochemical staining of bovine PGHS-2 in representative
sections of the intercaruncular endometrium during the estrous cycle 109
4-20 Immunohistochemical staining of bovine PGHS-2 in representative sections
of the intercaruncular endometrium during the peri-implantation period Ill
5-1 Hypothetical model for the regulation of OTR, PGHS-2, PGES and PGFS
expression during the bovine estrous cycle 146
5-2 Hypothetical model for the regulation of OTR, PGHS-2, PGES and PGFS
expression during the peri-implantation period 148
ix

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
EXPRESSION OF GENES INVOLVED IN PROSTANOID SYNTHESIS IN THE
ENDOMETRIUM AND CHORIOALLANTOIS OF THE COW
By
Hilary Binta
December 2003
Chairman: Michael J. Fields
Major Department: Animal Sciences
Oxytocin (OT) produced by the corpus luteum (CL) and the neurohypophysis
augments pulsatile prostaglandin F2„(PGF2,,) that ultimately leads to luteolysis. Enzymes
involved in the pathway for prostaglandin synthesis have a role in luteolysis and may
have important functions during the implantation period that influence embryo survival
or loss. Our objectives were:
1) To determine the effect of PGF2a on plasma OT in peri-implantation cows.
2) To determine how the expression of oxytocin receptor (OTR), prostaglandin G/H
synthase-2 (PGHS-2), and E and F synthases (PGES and PGFS) changes in the
endometrium of cyclic cows.
3) To ascertain the effect of the conceptas on expression of prostaglandin synthesis
enzymes and OTR during the period of maternal recognition of pregnancy.
x

4) To determine whether OTR and prostaglandin synthesis system are re-established after
maternal recognition of pregnancy. To evaluate the role of OT during the peri-
implantation period, ovariectomized (Day 22) or ovarian intact (Days 22 and 40)
pregnant cows were challenged with either PGF2,i or saline. A dose of 25 mg PGF2a
resulted in significant release of luteal OT in Day 22 but not Day 40 cows. Expression of
OTR and PGES was high at estrus and low during the luteal phase. The PGHS-2 was
highly expressed during the late luteal phase, proestrus and from days 14 to 22 of
pregnancy. Expression of PGES decreased during the peri-implantation period. The
PGFS was expressed highly on Days 7 and 18 of the cycle and comparable days of
pregnancy, but was down-regulated later. Positive correlations were observed for
OTR/PGES, PGES/PGFS and OTR/PGFS.
It is concluded that the CL is capable of secreting OT in response to PGF2a during
the early peri-implantation period. The neurohypophysis is a source of plasma OT during
peri-implantation period. The low expression of OTR mRNA and protein during peri-
implantation and low luteal OT may not be adequate to initiate pulsatile PGF2a synthesis.
Increased expression of PGES at estrus may be involved in ovulation. Increased PGHS-2
may be beneficial during implantation. The low luteal OT, decreased expression of OTR,
PGFS and PGES during the peri-implantation period may enhance maintenance of
pregnancy.
xi

CHAPTER 1
INTRODUCTION
During the estrous cycle in cattle, prostaglandin F2ol secreted from the
endometrium plays an important role in luteolysis whereby it causes regression of the
corpus luteum and enables ovulation of a new follicle (Milvae et al., 1996). Prostaglandin
F2a also plays an important role during parturition through its actions to cause contraction
of the uterus. Prostaglandin E2, on the other hand, is involved in cervical relaxation during
estrus and parturition (Mizrachi and Shemesh, 1999; Fuchs et al., 2002). Prostaglandins
are synthesized by hydrolysis of membrane phospholipids by phospholipases to
arachidonic acid. Arachidonic acid is converted to PGH2 by cyclooxygenases
(Prostaglandin G/H synthases). The PGH2 is converted to either PGF2a or PGE2 by
prostaglandin F synthase (PGFS) or prostaglandin E2 synthase (PGES) respectively.
Prostaglandin E synthase stimulates PGE2 which is implicated in the implantation process
(Emond et al., 1998; Leung et al., 2000).
During early stages of pregnancy, a change in the pattern of synthesis of
prostaglandin synthesizing enzymes is necessary to enable the embryo to inhibit the
luteolyic PGF2n pulses that occur towards the end of the cycle. Failure of this to occur
may lead to luteolysis and pregnancy loss and could be a potential cause for infertility in
cattle. For the embryo to survive, it must secrete adequate interferon-tau (IFN-t), the
signal for maternal recognition of pregnancy, to depress the pulses of PGF2a and sustain
pregnancy (Thatcher et al., 1995; Robinson et al., 1999; Mann and Lamming, 2001).
1

2
Oxytocin is produced by the large luteal cells from the corpus luteum (CL) as well
as the neurohypophysis (McCracken et al., 1995; Fields and Fields, 1996). Studies have
indicated that OT plays a modulatory role in the luteolytic process (Kotwica et al., 1997).
During pregnancy, OT-containing luteal granules are released at about the time
when implantation is taking place (Melton et al., 1951; King et al., 1982; Fields et al.,
1987; Wooding and Flint, 1994). A possibility exists that during the release of these OT-
containing granules, luteolytic pulses of PGF20 could be initiated. An active OT/OTR
system may be functionally coupled to the prostanoid system during this period and in
circumstances where the luteotrophic signals are not strong there could be the possibility
of failure to establish and maintain pregnancy (Mann and Lamming, 2001). Exogenous
OT has been shown to interfere with embryonic development and resulted in reduced
pregnancy rates when administered to cows during 5 to 8 days of pregnancy (Lemaster et
al., 1999). Furthermore, premature uterine secretion of PGF2a has been shown to lead to
short luteal phases and early embryo loss in cattle (Copelin et al., 1987; 1989). Bridges et
al. (2000) suggested that PGF2a secreted by the endometrium or embryo may be
beneficial for maintenance of pregnancy but concentrations beyond some threshold can
lead to luteal regression and loss of pregnancy. It is important to know whether PGF2a
causes release of these granules since OT could augment luteolytic pulses in case an
embryo does not produce sufficient interferon-r (IFN-x) or if the CL does not produce
sufficient progesterone to sustain pregnancy. The luteolytic machinery becomes
reestablished after maternal recognition of pregnancy, since neither temporary presence
of the conceptus or IFN-r infusion into the uterus extends the CL lifespan more than a
few days (Northey and French, 1980). Thus post-implantation synthesis of PGF2a

3
synthesis is important since activation of PGF2a after maternal recognition of pregnancy
may lead to pregnancy loss.
Although the expression of endometrial PGHS-2 and OTR have been well
described during the estrous cycle and early pregnancy in cattle, no comprehensive study
has looked at the change in expression patterns of PGHS-2, PGES, PGFS and OTR
before, during and after maternal recognition of pregnancy using comparisons between
cyclic and pregnant cows on similar days. The results from this study will increase our
understanding about peri-implantation events and may prove useful in strategies to
minimize embryo losses during this period.
The first objective of this dissertation was to determine the effect of PGF2a on
plasma OT in beef cows during the early (day 22) and late (day 40) peri-implantation
period. The second objective was to determine how OTR and the prostaglandin
synthesizing enzymes change during the process of luteolyis. The third objective was to
ascertain the effect of the conceptas on PGF2,, synthesis during early stages of pregnancy.
The final objective was to determine whether the OTR and the prostaglandin synthesis
system are re-established after maternal recognition of pregnancy.

CHAPTER 2
LITERATURE REVIEW
Luteolvsis
Luteolysis is the process by which a functional CL is converted into a non¬
functional corpus albicans. It occurs at the end of the estrous cycle or at the end of
pregnancy. Prostaglandin F2a is the luteolytic agent that is released from the uterus and
transported to the CL where it induces luteolysis. It is usually released in a series of
pulses (Nancarrow et al., 1973). Transfer of PGF2a to the uterus involves a
countercurrent mechanism (Thatcher et al., 1984) as well as systemic deli very (Ward et
al., 1976). The fact that both systemic and local transfer of PGF2[1 occur in cows is further
supported by the finding that only 65% of [3H] PGF2a is metabolized in one passage
through the lungs of cows (Davis et al., 1985).
Luteolysis involves changes in expression of many genes in the small and large
luteal steroidogenic cells and the endothelial cells within the CL (Mamluk et al., 1998;
Ivell et al., 1999; Meidan et al., 1999). Endothelin-1 (ET-1) plays an essential role in
PGF2a-induced luteal regression (Meidan et al., 1999) and lack of ET-1 in early bovine
CL has been attributed to their refractoriness to exogenously administered PGF2c(. The
mechanism of refractoriness is not well understood but has been attributed to several
factors. Endothelins (ET) are initially synthesized as precursor proteins called preproETs
(ppT) that are first cleaved to generate big ETs and then processed to active peptides by
4

5
endothelin converting enzyme (ECE). Endothelin converting enzyme-1 (ECE-1) cleaves
inactive big ET-1 to active ET-1 peptide (Levy et al., 2003). Prostaglandin F2a regulates
the amount of mRNA encoding ECE-1 in a cycle-phase specific manner, being
constitutively expressed in CL at days 4 and 10 of the estrous cycle (Wright et al., 2001).
The pulsatile release of OT by the neurohypophysis and CL stimulates the production of
pulsatile uterine PGF2a (Goff, 1991). Oxytocin stimulation of PGF2a increases at
luteolysis (Lafrance and Goff, 1985). Increase in response to OT is due to the increase in
number of OTR (McCracken et al., 1999). Oxytocin binds to endometrial OTR to
stimulate PGF2a production (Roberts et al., 1976, Silvia et al., 1991). The initial release
of PGF2a triggers release of additional OT from the CL by a positive feedback loop (Flint
et al., 1990). Whereas PGF2ais iuteolytic, PGE2 is luteotrophic (Pratt et al., 1977; Bazer
et al., 1991).
In vitro, PGF2oi is synthesized in greater quantity in epithelial cells than in
stromal cells, whereas stromal cells synthesize more PGE2 than epithelial cells (Fortier et
al., 1988; Desnoyers et al., 1994). Recombinant ovine IFN-r and recombinant bovine
IFN-r preferentially stimulate PGE2 in epithelial cells and both prostaglandins in stromal
cells (Asselin et al., 1997a). Asselin et al. (1997a) suggested a role for PGE2-9-
ketoreductase (9K-PGR) which converts PGE2 to PGF2a. The presence of 9K-PGR in the
endometrial epithelial cells could lead to synthesis of more PGF2ot whereas its absence in
the stromal cells would lead to a net accumulation of PGE2. Alternatively IFN-r may
inhibit or downregulate 9K-PGR activity in epithelial cells so that PGHS-2 is upregulated
resulting in an accumulation of PGE2 (Asselin et al., 1997a). However, there are now
doubts that 9K-PGR exists in the bovine endometrium. There exists a positive feedback

6
pathway in the CL of cattle whereby a small amount of PGF2a stimulates intraluteal
production of PGF2a due to induction of PGHS-2. Critical regulation of this positive
feedback pathway is mediated by protein kinase C (PKC)-mediated activation of
transcriptional factors that interact with the E-box in the 5’- flanking region of the PGHS-
2 gene (Diaz et al., 2002).
Corpus luteum growth necessitates increased vasculature and several factors have
been implicated in this vascular growth (Webb et ah, 2002). The angiogenic factors,
fibroblast growth factor and vascular endothelial growth factor are involved in regulation
of luteal function (Redmer and Reynolds, 1996). The major histocompatibility complex
(MHC) proteins may also play a role during luteolysis. Changes in MHC expression on
luteal cells have been implicated in T lymphocyte-mediated immune response during
luteolysis (Penny et ah, 1999). Insulin-like growth factors (IGF-I and IGF-II) are intra-
ovarian factors that have been reported to modulate luteal function and luteal
steroidogenesis by changing LH receptor stability in granulosa cells (McArdle and
Holtorf, 1989; Hirakawa et ah, 1999).
Controversy still exists on the role of OT during luteolysis although numerous
studies have demonstrated that OT is crucial for luteolysis in cattle (Lamming and Mann,
1995; Bums et ah, 1998). However, other studies suggest that luteolysis can be initiated
without OT. Kotwica et ah (1997) showed that continuous blockade of OTR using a
specific OT antagonist from day 15 until estrus did not affect luteolysis. This led to the
suggestion that OT may play a permissive role or may contribute to the completion of
luteolysis once it has begun (Kotwica et ah, 1997).

7
Schams et al. (1985) observed a decrease in OT secretion after midluteal phase of
the estrous cycle in hysterectomized cows, suggesting that the PGF^ synthesized in the
uterus stimulates release of OT during luteolysis. Blair et al. (1997) showed that luteal
and plasma concentrations of OT during spontaneous and induced luteolysis in heifers
remained unaltered when measured using an in vivo microdialysis system.
Oxytocin from the neurohypophysis appears to be released in a pulsatile way to
initiate PGF2a secretion from the uterus (Silvia et al., 1991). Responsiveness of the uterus
to OT increases at luteolysis when endogenous pulsatile secretion of PGF2a has begun.
Progesterone promotes accumulation of arachidonic acid and PGHS-2 in the uterus, thus
ensuring that luteolysis occurs at the appropriate time (Silvia et al., 1991).
Functional Luteolysis
Functional luteolysis is the reduction in progesterone concentration associated
with the luteolytic process caused by PGF2a (McCracken et al., 1999). It has been
attributed to several factors, namely a change in luteal membrane composition and
decreased fluidity which may prevent luteinizing hormone (LH) receptor aggregation and
blocking LF1 function. This could prevent coupling to adenylate cyclase and cause a
decline in cyclic adenosine monosphosphate (cAMP) and progesterone synthesis
(Henderson and McNatty, 1975). In addition, PGF2a activates the phospholipase C
(PLC) pathway leading to an increase in calcium ions in the large luteal cells which is
associated with luteolysis (McCracken et al., 1999). The PGF2a exerts antisteroidogenic
effects that involve synthesis of progesterone from cholesterol. It may also affect
luteolysis by altering luteal blood flow to the ovary with the CL. Decreased ovarian blood
flow has been suggested as one of the mechanisms by which PGF2a leads to luteolysis

(Niswender et al., 2000). It has recently been shown that there is increased blood flow
which parallels increased CL volume and plasma concentration of progesterone from
days 4 to 6 of the estrous cycle (Acosta et al., 2002). It was further observed that mid¬
cycle CL have decreased blood flow suggesting that the lack of intraluteal vascular
response to PGF2a may be one of the reasons for early cycle CL failure to respond to
PGF20 (Acosta et al., 2002).
Structural Luteolvsis
Structural luteolysis involves involution of the CL. Several factors have been
implicated in structural luteolysis including tumor necrosis factor a (TNFa) that has been
shown to inhibit LH-induced progesterone production in bovine luteal cells (Benyo and
Pate, 1992). Monocyte chemoattractant protein expressed in the CL acts as a mediator of
invasion of immune cells that are involved in phagocytosis as well as production of
cytokines which play a role in structural luteolysis (Tsai et al., 1997).
Matrix metalloproteinase-2 (MMP-2) is localized in the bovine luteal endothelial
cells and is involved in angiogenesis in the CL (Zhang and Tsang, 2001). Membrane type
1 matrix metalloproteinase (MT1-MMP) activates pro-MMP2 to MMP-2. Active MT1-
MMP and MMP-2 are increased coordinately in mid to late stage bovine CL and may be
involved in digestion of extracellular matrix and structural regression of the CL (Zhang et
al., 2002). Tissue inhibitors of metalloproteinases (TIMP) are produced by the CL to
inhibit the actions of tissue metalloproteinases that are involved in tissue remodeling of
the extracellular matrix. In particular TIMP-1 in the bovine CL increases tremendously
24 h after PGF2tt-induced luteolysis (Smith et al., 1996).

9
During structural luteolysis, cells of the CL undergo apoptosis (Juengel et al.,
1993; Rueda et al., 1997). Immune cells (macrophages and T-lymphocytes) have been
reported to play a role in structural luteolysis (Penny et al., 1999). It is seems that this
mechanism is mediated by the Fas-Fas ligand system. T-lymphocytes express the Fas
ligand and TNFa whereas macrophages are the main source of the TNFa. The Fas
antigen is a member of the TNFa family of receptors that interacts with its ligand to
induce apoptosis (Nagata and Goldstein, 1995). Structural luteolysis is enhanced by the T
cells sending apoptotic signals to the luteal cells where Fas expression is induced by
leukocyte-stimulated cytokines such as TNFa and interferon gamma (IFN-y). It has been
shown that IFN-y by itself reduces the viability of bovine luteal cells and its cytotoxic
effect is augmented when combined with TNFa (Taniguchi et al., 2002). However, TNFa
has no effect on bovine luteal cell death until day 5 of culture (Benyo and Pate, 1992).
The Fas mRNA is expressed highly in bovine luteal cells about the time of luteolysis
implicating its role in apoptosis-mediated structural luteolysis (Taniguchi et al., 2002).
The TNFa is secreted by macrophages in response to PGF2a in the CL (Wuttke et al.,
1997). Its effects are mediated via the tumor necrosis a receptor 1 (TNFR1) whose
mRNA was shown to be expressed in endothelial and steroidogenic cells of the bovine
CL with highest expression in endothelial cells (Friedman et al., 2000). Furthermore,
TNFR1 was expressed highest on days 18 - 21 during the time of luteal regression
(Friedman et al., 2000).
Luteal endothelial cells also express progesterone receptor which protects against
programmed cell death. Endothelial cell-derived ET-1 causes a decline in steroidogenic
activity thus leading to functional luteolysis (Meidan et al., 1999). However, ET-1 may

10
also lead to structural luteolysis via a mechanism where it regulates apoptosis. Friedman
et al. (2000) proposed that, during luteolysis, PGF2a stimulates secretion of ET-1 and
macrophages secrete TNFa. There is a synergistic effect between TNFa and ET-1 to
inhibit steroidogenesis and reduce progesterone secretion. This leads to increased
expression of TNFR1 and thus facilitates TNFa induced apoptosis and structural
luteolysis (Meidan et al., 1999).
Regulation of Prostaglandin Synthesis
Prostaglandin is the luteolytic agent in cows and its regulation is dependent on
several pathways that involve OT, steroids and cytokines (Okuda et al., 2002). The
production of PGF2a in the bovine endometrium is regulated by estrogens and
progesterone at two levels, basal and OT-stimulated (Skarzynski et al., 1999).
Progesterone has been shown to stimulate basal production of PGF2a in endometrial cells
(Xiao et al., 1998). The stimulatory effect may be associated with post-translational
events since it has been shown that progesterone stimulated basal PGF2a synthesis in
bovine endometrial cells but did not increase expression of either PGHS-2 or PGFS
mRNA (Asselin et al., 1996; Xiao et al., 1998; Skarzynski et al., 1999; Okuda et al.,
2002).
Progesterone is the principal regulator of endometrial PGF2a secretion during the
intraluteal phase (Skarzynski et al., 1999). Both OT and progesterone increased PGF2a
synthesis from bovine endometrium in vitro. Estrogen alone had no effect but augmented
that of progesterone (Skarzynski et al., 1999). Further evidence of progesterone
regulation comes from studies which have shown that PGF2a and PGE2 concentrations

11
are higher in bovine endometrium from the uterine hom ipsilateral to the active CL and
are positively correlated with progesterone concentrations (Cerbito et ah, 1997).
A positive feedback pathway exists in large luteal cells in the CL, such that PGF2a
stimulation induces intraluteal PGF2a as a result of induction of PGHS-2. The effect of
progesterone on uterine sensitivity to OT involves a non genomic action (Zinng et ah,
1998). Progesterone binds to the OTR with high affinity and inhibits binding of OT to its
receptor. Intact cows in the mid-luteal phase and ovariectomized progesterone-primed
cows secrete PGF2a after treatment with estrogen (Thatcher et ah, 1984), suggesting that
progesterone priming is necessary to induce PGF2a secretion by the bovine uterus and
that estrogen may just be acting as a modulator of this process (Okuda et ah, 2002).
Mann et ah (2001) suggested that the most likely mechanism by which progesterone
treatment induces responsiveness to oxytocin may be through the upregulation of post
receptor signaling pathways and/or enzymes involved in prostaglandin synthesis.
Progesterone appears to promote uterine accumulation of arachidonic acid, PGHS-2 and
other substances needed for synthesis of PGF2a and also exerts a suppressive effect on
secretion that is decreased after prolonged exposure (Silvia et ah, 1991).
Estradiol on the other hand has both stimulatory and inhibitory effects on PGF2a
secretion from the endometrium (Wathes and Lamming, 1995). Estradiol has been shown
to have no effect on PGF2a secretion from the endometrium alone whereas, in
combination with progesterone, it amplified the stimulatory effects of progesterone
(Skarzynski et ah, 1999). Oxytocin stimulation of prostaglandin secretion is induced in
ovariectomized animals by treatment with progesterone alone, suggesting that estrogen is
not essential for increase in response to OT (Goff and Kombe, 2003). However, estrogen

12
may play a role of completion of luteolysis by stimulating the increase in OTR. Estradiol
induces PGF2a production in vivo (Thatcher et al., 1984) and increases OTR expression
after priming with progesterone (Lamming and Mann, 1995).
Under in vitro conditions, OTR upregulates spontaneously in endometrial tissues
taken from any stage of the estrous cycle (Sheldrick et al., 1993), suggesting a form of
constitutive upregulation of OTR. In vivo, OTR and its mRNA are upregulated within a
short window of 2 to 3 days around the day of estrus, are undetectable between days 6
and 15, and start to develop in the luminal epithelium of the endometrium between 15
and 17 days after estrus (Fuchs et al., 1990; Jenner et al., 1991; Mann and Lamming,
1995; Robinson et al., 1999). They become apparent later in the superficial glands of the
endometrium (Robinson et al., 2001). Oxytocin receptors were shown to appear before
changes in plasma concentrations of progesterone or estradiol (Robinson et al., 2001)
indicating that upregulation of OTR is not a result of changes in plasma steroid
concentrations.
In the bovine endometrium, the highest number of OTR are expressed in the
luminal epithelium and it is this layer of cells that is most responsive to exogenous OT in
terms of PGF2ct secretion (Robinson et al., 2001). Development of OTR in the luminal
epithelium alone is probably sufficient to elicit full luteolytic secretion of PGF2cl (Wathes
and Lamming, 1995). Development of OTR in the caruncular stroma and deep glands at
estrus is dependent on estrogen (Wathes and Lamming, 1995). The decreased expression
of OTR after estrus is reportedly due to decreased plasma estradiol concentrations and the
further decline in the luteal phase is due to progesterone acting via high concentrations of
progesterone receptors present in the stroma (Lamming and Mann, 1995). This action is

13
probably indirect since no progesterone response element has been identified in the
bovine OTR gene promoter (Bathgate et al., 1995).
In most cells and tissues, PGHS-2 is an inducible enzyme that is not expressed
under normal or resting conditions (Smith et al., 1996; Kniss, 1999; Smith et al., 2000).
Both the PGHS-2 mRNA and protein are expressed in the endometrium at low levels
between days 1 and 12 and at high levels between days 13 and 21 of the estrous cycle
(Arosh et al., 2002). The PGHS-2 mRNA and protein are highly correlated, suggesting
that PGHS-2 expression is regulated at both the mRNA and protein levels. Maximal
expression of PGHS-2 occurs at the expected time of luteolysis (days 16 to 17) in the
cow. The PGHS-1 mRNA and protein are not expressed in the bovine endometrium on
any day of the cycle (Arosh et al., 2002). Prostaglandin H synthase-2 and PGES may be
responsible for PGE2 production during the estrous cycle. The PGES and PGHS-2 are
functionally coupled in the preovulatory follicle (Filion et al., 2001) and in the
endometrium (Arosh et al., 2002). This functional coupling appears to be an efficient
mechanism for regulation of the conversion of arachidonic acid into PGE2,
Prostaglandin H synthase-2 is expressed in preovulatory follicles during the
estrous cycle, with levels low at onset of estrus and 18 h after estrus but high levels 24 h
after estrus (18 h post-LH surge). This result suggests that induction of PGHS-2 in bovine
preovulatory follicles is physiological and dependent on the LH surge (Liu et al., 1997).
Exogenous, PGF2a probably acts through protein kinase C and calcium-dependent
pathways to stimulate large luteal cells to express PGHS-2 which then leads to luteal
production of PGF2a (Tsai et al., 1996; Tsai and Wiltbank, 1997). Thus the PGF2c, creates

14
an autocrine/paracrine loop that augments the luteolytic effect of PGF2a produced by the
uterus.
Oxytocin stimulates PGF2a secretion from the endometrium during the follicular
phase, estrus, early luteal and mid to late luteal stages of the estrous cycle (Silvia and
Taylor, 1989; Meidan et al., 1993; Mirando et al., 1993; Wolfenson et al., 1993; Xiao et
al., 1999; Miyamoto et ah, 2000). Oxytocin may play a supportive role to regulate PGF2a
synthesis since it has been reported that OT is not necessary for luteolysis in cows
(Kotwica et ah, 1998b). It has been reported that the concentrations of OT in intact and
microdialyzed CL are low during spontaneous luteolysis (Parkinson et ah, 1992; Douglas
and Britt, 2000). Furthermore, Kotwica et ah (1997) showed that administration of OT
antagonist at the time of luteolysis did not stop the luteolytic process nor did it affect the
duration of the estrous cycle in heifers.
Several studies have shown that OT binding to its receptor stimulates uterine
production of PGF2a (Newcomb et ah, 1977; Silvia and Taylor, 1979; Lafrance and Goff,
1990). This effect is also affected by ovarian steroids which influence the responsiveness
of the uterus to OT (Lafrance and Goff, 1985; Lamming and Mann, 1995). Oxytocin
stimulates PGF2a synthesis by endometrial cells via increased intracellular calcium ions
(Burns et at., 1998). The increase in calcium ions is due to stimulation of PLC and
inositol triphosphate (IP3) in the PKC signaling pathway (Bums et ah, 1998). Treatment
of endometrial epithelial cells with OT followed by progesterone inhibits the increase of
calcium ions, suggesting that progesterone blocks the synthesis of PGF2cl by disrupting
this intracellular pathway. It appears that this effect is mediated through the direct
interference of the interaction of OT with its own receptor (Bogacki et ah, 2002).

15
Luteinizing hormone has been implicated in the synthesis and regulation of PGF2a
production (Freidman et al., 1995; Shemesh et al., 2000), its effect being restricted to mid
to late luteal phases of the cycle (Shemesh, 2001). Prostaglandin F2a acting via the PKC
pathway, may activate an increase in intracellular calcium which in turn stimulates PGF2a
synthesis from the endometrium to form an autoamplification system of its own
production (Bums et al., 1997; Skarzynski et al., 1999).
Norepinephrine stimulates PGF2a release during the follicular phase and early
luteal phase, time periods when the influence of progesterone is minimal (Skarzynski et
al., 2001). It has been demonstrated that TNFa receptors are present in the bovine
endometrium (Skarzynski et al., 2000a). Furthermore TNFa can stimulate release of
PGF2a from bovine endometrial stromal cells but not in epithelial cells (Skarzynski et al.,
2000a). Moreover, TNFa stimulates synthesis of PGF2a during both luteal and follicular
phases of the cycle. This effect is in contrast to the effects of OT which only stimulates
PGF2ci synthesis during the follicular phase. The fact that the bulk of PGF2a is produced
by the epithelial cells (Asselin et al., 1996; Skarzynski et al., 2000a) whereas TNFa
stimulation is directed to the stromal cells may suggest that an auto-amplification loop of
PGF2a synthesis may exist early in luteolysis. Tumor necrosis factor a may play an active
role in the initiation of luteolysis and later, OT-induced PGF2a plays a role in the
completion of luteolysis (Okuda et al., 2002).
Arosh et al. (2002) showed co-expression of PGF1S-2 and PGES mRNA in bovine
endometrium during the estrous cycle. The PGES was co-expressed at high level with
PGHS-2 between days 13 and 21 of the estrous cycle, suggesting that the mechanism for
the synthesis of PGE2 is already present by day 13 of the cycle. Prostaglandin E synthase

16
was expressed at moderate, low and high levels on days 1 - 3, 4 - 12 and 13 - 21 of the
estrous cycle, respectively (Arosh et al., 2002).
Inhibition of Luteolvsis by the Embryo
Expansion and cell division of the embryo is controlled by factors secreted by the
endometrium, but the complete nature of these factors is still unknown (Goff, 2002). It is
necessary that the conceptus elongates rapidly so as to attach to as much area of the
endometrium as possible in order to reduce the secretion of PGF2a (Goff, 2002).
Interferon-x is produced by the trophoblast between days 15 to 24 of gestation (Bartol et
al., 1985) and prevents luteolysis by suppressing endometrial PGF2a secretion via
downregulation of expression of estrogen and OTR (Spencer et al., 1995b). Evidence
that the embryo or IFN-x inhibits luteolysis is provided from studies by Knickerbocker et
al. (1986) where they showed that administration of whole conceptus secretory proteins
into the uterus reduced pulsatile PGF2a pulses from the uterus and extended the estrous
cycle from 23 - 24 days to 30 - 39 days in cyclic cows. Intrauterine administration of
recombinant bovine interferon-x (rbIFN-x) increased the interestrous interval, extended
the life of the CL and abolished OT-induced PGF2a synthesis (Meyer et al., 1995).
Presence of an intracellular endometrial inhibitor of PGF2a in the endometrium of
pregnant cows was shown by the inhibition of PGF2,, synthesis by cotyledonary
microsomes from parturient cattle, whereby, synthesis was reduced by 51% when
incubation was done in endometrial cytosolic supernatants from pregnant cows but only
by 17% when incubated with endometrial cytosolic supernatant from cyclic cows day 17
post-estrus (Gross et al., 1988a).

17
Using a perifusion device, Gross et al. (1988b) showed that the secretion rates of
PGE2 were not affected by pregnancy status whereas PGF2,, secretion was decreased.
However, the rates were increased in cyclic and bred cows that were not pregnant. They
further demonstrated that prostaglandin secretion was not stimulated by OT in day 17
pregnant cows. This is in contrast to results from in vitro studies that have shown that
IFN-x increases synthesis of PGE2 (Asselin et al., 1997a). This effect however may be a
dose response since low doses of IFN-x, there is inhibition whereas at high doses there is
stimulation.
Spencer et al. (1996) proposed that IFN-x may block estrogen receptor synthesis
and thus OTR synthesis by (1) indirectly stabilizing or preventing the down-regulation of
progesterone receptor gene expression by progesterone and (2) directly inhibiting
estrogen receptor gene expression and thus allowing the maintenance of the CL and
successful maternal recognition of pregnancy. However, it has recently been reported that
IFN-x prevents luteolysis in sheep by directly inhibiting and silencing transcription of
ERa gene which prevents the ability of activated estrogen receptor a (ERa) to increase
OTR gene transcription (Bazer et al., 2003). Increased output of IFN-x is due to increased
size of the embryo rather than increased synthesis, suggesting that embryo elongation is
important in preventing luteolysis since smaller embryos will produce less IFN-x and lead
to embryo loss. Interferon-x also stimulates protein secretion from the endometrium
(Emond et al., 2000).
Endometrial proteins and granulocyte macrophage colony stimulating factor
(GM-CSF) have been shown to increase IFN-x production in ovine embryos (Imakawa et
al., 1997). The GM-CSF is a cytokine that promotes conceptas growth and survival,

however, it had no effect on IFN-x in the cow (de Moraes and Hansen, 1997). Interferon-
x produced by the trophoblast may be further stimulated by GM-CSF from the
endometrial epithelium (Imakawa et al., 1997). The stromal cells in the uterus respond
by increasing GM-CSF leading to an auto amplification loop (Emond et al., 2000).
Recombinant ovine interferon-x (roIFN-x) has been shown to upregulate PGHS-2
expression in both epithelial and stromal cells, followed by increased production of PGE2
in epithelial and PGF2a in stromal cells of bovine endometrium in vitro (Asselin et al.,
1997c). Upregulation of PGHS-2 was greater in stromal than epithelial cells.
Under in vitro conditions, natural bovine IFN-x significantly diminished basal
PGF2a but not PGE2 secretion from bovine endometrial explants (Godkin et al., 1997).
However, rbIFN-x was found to inhibit both PGF2a and PGE2 in bovine epithelial but
had no effect on stromal cells (Smith and Godkin, 1992; Smith et al., 1993; Desnoyers et
al., 1994; Godkin et al., 1997).
During early pregnancy in cows (days 12 to 25) there is suppression of OTR and
estrogen receptors (Farin et al., 1990; Robinson et al., 2001). Bazer et al. (1997)
hypothesized that IFN-x downregulates OTR by inhibition of upregulation of OTR.
Decreased expression of estrogen receptors occurs in the pregnant horn of unilaterally
pregnant ewes (Lamming et al., 1995), and intrauterine infusion of roIFN-x during the
luteal phase inhibits estrogen and OTR expression in the endometrium (Spencer et al.,
1995c). Recombinant oIFN-x prevents upregulation of estrogen and OTR niRNA and
protein expression after exogenous estradiol administration on day 12 (Spencer et al.,
1995c). Robinson et al. (1999) failed to detect OTR mRNA and protein in the luminal

19
epithelium of cows at day 16 of pregnancy but was able to detect it in non pregnant cows
indicating that presence of the embryo suppressed expression of OTR.
The efficiency of inhibition of the luteolytic mechanism during pregnancy
depends on IFN-t (Mann and Lamming, 2001). They showed that day 16 pregnant dairy
cows produced less PGF2a metabolite, 13,14-dihydro-15-keto PGF2,, (PGFM ) after an
OT (50 i.u) challenge, compared to uninseminated control cows. They further showed
that cows with an embryo and measurable quantities of IFN-t attenuated the PGF2a
response to OT than those without an embryo. Consequently, successful establishment of
pregnancy appears to depend on the presence of a well developed embryo that produces
enough IFN-t.
In both cows and sheep, expression of PGHS-2 is modulated in response to
various stimuli and is correlated with production of prostaglandins during maternal
recognition of pregnancy (Asselin et al., 1997b; Charpigny et al., 1997). The PGHS-2
protein is expressed for extended periods in pregnant animals, suggesting that increased
production of prostaglandins may be involved in recognition of pregnancy (Charpigny et
al., 1997). Binelli et al. (2000) showed that IFN-t directly inhibits PKC-regulated PGF2cl
production and expression of PGHS-2 and phospholipase A2 (PLA2). Interferon-T also
was shown to suppress PGF2a production and PGHS-2 independent of OT-induced early
signaling events (PLC-IP3/DAG-PKC) in immortalized bovine endometrial (BEND) cells
(Pru et al., 2001). Interferon-T may inhibit luteolysis by shifting the primary
prostaglandin produced in the endometrium from luteolytic PGF2oi to luteotrophic PGE2
(Okuda et al., 2002). The TNFa stimulates PGF2a synthesis in stromal cells but not in
epithelial cells of the bovine endometrium (Skarzynski et al., 2000b). It has been

suggested that it may induce local autoamplification of PGF201 in the endometrium
(Skarzynski et al., 1999) and thus initiate a positive loop between pituitary and ovarian
OT and uterine PGF2Q to complete luteolysis (Skarzynski et al., 1999; Okuda et al.,
2002). It was recently shown that suppression of TNFa induced-PGF2a secretion by IFN-
T is via downregulation of PGHS-2 expression, stimulated by TNFa (Okuda et al., 2003).
Interferon-x inhibits production of PGF2a in bovine endometrial epithelial cells by
downregulating the expression of PGHS-2 (Xiao et al., 1998). However, it enhances
PGHS-2 mRNA and PGF2oi synthesis in stromal cells which are the principal site for
PGE2 synthesis. The expression of PGHS-2 in bovine embryos appears to be transient
and is associated with the first cleavages, with a decrease occurring at the morula stage
(Guverich and Shemesh, 1994). Large amounts of the enzyme have been reported to be
produced between hatching and implantation in ovine (Lewis and Waterman, 1985) and
bovine conceptuses (Shemesh et al., 1979; Lewis et al., 1982).
Elongation of the conceptus may be due to stimulation by several mitogens and
growth factors some of which stimulate PGHS-2 expression. The expression of PGHS-2
in ovine embryos is developmentally related and occurs at a time when the embryo turns
into a filamentous type. The pattern is also similar to that of IFN-t which begins on day
10 and ends about day 21 of pregnancy in sheep (Charpigny et al., 1988; Guillomot et al.,
1990).
High levels of progesterone during pregnancy also have an inhibitory effect on
upregulation of estradiol and OTR. The embryo may further prevent luteolysis by
secreting a protein that blocks the effect of prostaglandins on the large luteal cells in the
CL to maintain a constant source of progesterone (Wiltbank et al., 1992).

21
Concentrations of linolenic acid are increased in the endometrium of cattle during
pregnancy and linolenic acid is a competitive inhibitor of arachidonic acid metabolism
(Thatcher et al., 1995). Linolenic acid has an effect on limiting the amount of
arachidonic acid that can be converted to PGF2a and its synthesis is increased by IFN-x.
Resumption of the Prostaglandin Synthesis System after Maternal Recognition of
Pregnancy
Termination of IFN-x expression is dependent on implantation, since cessation of
oIFN-x expression occurs in the regions of the trophoblast that have established cellular
contacts with the uterine epithelium during the implantation process (Demmers et al.,
2001). Intrauterine infusion of IFN-x into cyclic Jersey cows from days 15.5 to 21
increased the cycle length to 26 days (Helmer et al., 1989), whereas when the conceptos
was left in the uterus and then removed on days 17 or 19, luteal life span was extended,
but only for a few days (Northey and French, 1980) which suggests that PGF2,, synthesis
becomes re-established after maternal recognition of pregnancy. In the intercaruncular
bovine endometrium, OTR were low on day 20 and became upregulated by more than ten
fold on day 50 (Fuchs et al., 1992). Endometrial OTR has been shown to change as a
function of gestational age in pregnant beef cattle from days 50 to 250 (Fuchs et al.,
1996b). There was also a parallel increase in plasma PGFM after challenge with 100 i.u
of OT suggesting that at day 50 of pregnancy, the OTR is functionally coupled to PGF2cl
release and their concentration determines the magnitude of OT-induced PGF2a during
gestation. Balaguer et al. (2000) challenged beef pregnant cows with OT (100 i.u) from
days 20 to 50 of pregnancy and reported increased PGFM in plasma. The response of

22
PGFM after OT increased from days 20 to 50 of pregnancy. This result suggests that the
OT-prostanoid system may be active during this peri-implantation period (days 20 to 50).
Maternal plasma progesterone concentrations were correlated with IFN-x
production in bovine conceptuses suggesting that higher maternal progesterone provides
a more suitable environment for the developing conceptas (Kerbler, et al., 1997). This
means that in the absence of IFN-r, after maternal recognition of pregnancy, the high
concentrations of progesterone are enough to maintain pregnancy.
Properties of the Key Elements Involved in Luteolvsis
Bovine Oxytocin Receptor
The bovine OTR is a member of the rhodopsin-type (class 1) G protein coupled
receptor family (GPCR). The seven transmembrane a helixes are highly conserved
(Gimpl and Fahrenholz, 2001). The OTR encodes a protein of 391 amino acids. It
consists of two introns, one in the 5’ noncoding region that appears to be differentially
spliced in the bovine uterus and a conserved intron within the open reading frame
between the regions encoding the transmembrane domains VI and VII. The bovine OTR
consists of three major transcripts at 6.5 kb, 3.5 kb and 2.0 kb (Bathgate et al., 1995). The
OTR gene promoter lacks an estrogen response element (ERE) (Horn et al., 1998).
Similarly, the human OTR gene does not have ERE in its sequence, upstream of the
transcription start site and none of its ERE half-sites respond to increased estrogen
activity when co-transfected with estrogen receptor (Ivell et al., 1998; Telgmann et al.,
2003). However, the lack of ERE does not exclude potential effects of estrogen on gene
expression, since there are half palindromic ERE motifs that could act synergistically to
mediate estrogen activation as has been shown in the ovalbumin gene (Kato et al., 1992).

23
In sheep, however, it has recently been shown that liganded ERa stimulates OTR
promoter through both DNA and protein-protein interactions with the promoter elements,
activator protein 1 (Ap-1) and Spl despite the lack of consensus binding sites for ERa on
ovine OTR (Bazer, et al., 2003).
Oxytocin Receptor Signaling
Oxytocin binds to a cell-surface membrane receptor and activates an intracellular
signaling pathway that leads to activation of PLC (Gimpl and Fahrenholz, 2001). Once
activated, PLC cleaves phosphatidylinositol bisphosphate into the second messengers,
diacylglycerol (DAG) and IP3. The DAG increases PGF2a synthesis by activating protein
kinase C activity. Protein kinase C then activates a number of intracellular enzymes that
lead to activation of phospholipase A2 (PLA2) (Bums et al., 2001). The PKC activates
Ras or Raf-1 which phosphorylates and activates mitogen activated protein kinase
(MAPK kinase) (MEK.1/2) (Lewis et al., 1998). The cytosolic form of PLA2 mobilizes
arachidonic acid from phospholipids (Kramer and Sharp, 1997). The arachidonic acid is
converted to prostaglandin H2 (PGH2) by prostaglandin H synthase-2 (PGHS-2) (Smith,
1989). The PGH2 is then converted to PGF2a by the enzyme prostaglandin F synthase
(PGFS).
Regulation of Oxytocin Receptor
Although administration of estradiol in vivo stimulates an increase in uterine
OTR (Beard and Lamming, 1994; Wathes et al., 1996), OTR upregulation in vitro occurs
spontaneously in the absence of estrogens (Sheldrick et al., 1993; Horn et al., 1998;
Leung and Wathes, 2000). In vitro and in vivo, OT causes short-term upregulation of

OTR expression, but this effect is not maintained for more than 1 to 2 days (Leung and
Wathes, 2000).
24
Estrogens also may initiate non-genomic reactions in the absence of estradiol
receptor (Ignar-Trowbridge et al., 1996). There seem to be species differences between
cattle and sheep in the way OTR are regulated (Leung and Wathes, 2000). During early
pregnancy in cows, the embryo is able to suppress development of OTR around day 16
despite the presence of a high number of estrogen receptors (Robinson et al., 1999). It has
been suggested that in sheep, however, that the inhibition of OTR expression by IFN-x
may be mediated initially by inhibition of uterine estradiol receptors (Spencer et al.,
1995a).
Progesterone has an inhibitory effect on OTR expression, but this effect is lost
after 10 days because progesterone downregulates its own receptor (McCracken et al.,
1999; Kombé et al., 2003). Inhibitory effects of progesterone on endometrial tissue are
not mediated through genomic mechanisms such as activation or suppression of specific
genes like OTR or PGHS-2 since the effects can be seen under very short term culture
conditions (Bogacki et al., 2002). Progesterone was able to suppress the ability of
oxytocin to induce endometrial secretion of PGF2„ at concentrations as low as 2 nM (0.6
ng/ml) which is in the physiological range. Further evidence from non-genomic effects
was the finding that progesterone inhibits OT binding to OTR-containing membranes in
vitro and suppresses OT-induced inositol phosphate production and calcium mobilization
which are highly steroid and receptor specific effects (Grazzini et al., 1998; Bogacki et
al., 2002). Picard (1998) suggested that progesterone binds to the OTR at an allosteric
receptor site to induce conformational change and thus prevents OT binding to its

receptor. In vitro studies have shown that stimulation of PGF2a by OT is mediated by
calcium ions (Bums et al., 1998). This OT-induced intracellular calcium release is
inhibited in bovine endometrial cells that have been pre-incubated with progesterone,
suggesting that the inhibitory effects of progesterone may be via disruption of the
calcium signaling pathway (Bogacki et al., 2002). Development of OTR in the luminal
epithelium is not directly preceded by changes in the concentration of progesterone or its
receptors; an indication that a time dependent mechanism may mediate the inhibitory
effect of progesterone on OTR function (Wathes and Lamming, 1995; Robinson et al.,
1999).
During the luteal phase in non-pregnant cows, pro-inflammatory interleukins may
form part of the inhibitory mechanism by which progesterone inhibits OTR, while at the
same time enhancing basal prostaglandin synthesis (Leung et al., 2001). An increase in
basal prostaglandin synthesis does not activate luteolysis in the absence of OTR, since
pulses of PGF2a are required (McCracken et al., 1999). Lipopolysaccharide stimulates
PGF2d without altering OTR mRNA, whereas IL-la, 2, and 6 suppress OTR in the late
luteal phase (Leung et al., 2001).
During pregnancy, the upregulation of OTR and luteolysis is inhibited by
secretion of IFN-x from the trophoectoderm from days 12 to 25 in cattle (Bartol et al.,
1985; Farin et al., 1990). Administration of recombinant IFN-r during pregnancy inhibits
OT-induced PGF2a secretion by down-regulation of OTR in the endometrium and by
decreasing PGHS-2 and PGFS via a mechanism independent of changes in OTR (Xiao et
al., 1999). Possibly increased basal secretion of PGHS-2 occurs during pregnancy. The
antiluteolytic effects of IFN-x are to directly inhibit and silence estrogen receptor a gene

26
transcription that in turn inhibit the ability of activated ERa to increase OTR gene
transcription (Bazer et al., 2003).
Caruncles are differentiated sites of the endometrium in which placentation occurs
in ruminants. Intercaruncular areas are privileged sites for regulation of PGF2a production
by OT, a process that results in luteolysis (Asselin et al., 1998). Endometrial cells from
intercaruncular areas are more responsive to OT and those from caruncular regions are
more responsive to IFN-r (Asselin et al., 1998).
Prostaglandin H Svnthase-2 tPGHS-21
Structure of the Bovine PGHS-2 Gene
There are two iso forms of PGHS called variously as PGHS-1 and PGHS-2 or
COX-1 and COX-2. The two isoforms have molecular weights of 70,000 and 72,000,
respectively, and their amino acids are 60% identical but their structural and functional
domains are conserved (Hla and Nielson, 1992). These enzymes are derived from genes
located on different chromosomes that encode different sizes of mRNA, 2.8 kb for
PGHS-1 and 4.8 kb for PGHS-2. Whereas PGHS-2 is inducible (Hershmann, 1996),
PGHS-1 is constitutively expressed (Williams and Dubois, 1996).
The bovine PGHS-2 mRNA consists of a 5’-untranslated region of 128 bp, an
open reading frame of 1815 bp and a 3’-untranslated region of 1565 bp containing
multiple repeats of the Shaw-Kamen sequence 5’-ATTTA-3’ (Liu et al., 2001). It is
undetectable in most tissues but can be induced by agonists and is generally referred to as
the inducible iso form. The gene consists of 10 exons and 9 introns. The transcription
start site is a guanidine residue. The gene consists of several cis-acting elements 600 bp
upstream of the cap site, including cyclic adenosine monophosphate binding protein

27
(C/EBP), AP-1, AP-2, nuclear factor kappa B (NF-kB), activator transcription
factor/cyclic AMP response element (ATF/CRE) and E-box binding proteins. It does not
contain TATA box motifs (Liu et al., 1999). Mutation of the C/EBP results in reduction
of forskolin activity, whereas deletion of ATF/CRE abolishes TPA-stimulated
transcription of PGHS-2 in human endothelial cells (Subbaramaiah et al., 1998). The
protein encoded by the bovine PGHS-2 gene is similar to other mammalian homologs,
being 89% and 97% identical to human (Hla and Wielson, 1992) and ovine (Zhang et al.,
1996) protein sequences, respectively.
Signal Transduction Through PGHS-2
Prostaglandin H synthase-2 is present in both the endoplasmic reticulum and the
nuclear envelope, but appears twice as much in the nuclear envelope, whereas PGHS-1 is
equally distributed in the endoplasmic reticulum and nuclear envelope (Morita et al.,
1995). Swinney et al. (1997) reported that negative regulation of PGHS-1 permits PGHS-
2 to oxygenate low concentrations of arachidonic acid (AA) (1 pM) up to four times
more efficiently than PGHS-1. Limiting intracellular concentrations of AA leads to the
PGHS-2 pathway and higher concentrations (10 pM) leads to PGHS-1 synthesis
(Murakami et al., 2000). Three phospholipase A2 (PLA2) forms are involved in agonist-
stimulated AA release but there is no general coupling of specific lipases to PGHS-2 or
PGHS-1 (Murakami et al., 2000). Prostaglandin H synthase-2 selectively couples to
other terminal isomerases, especially PGE2 synthase and PGI2 synthase (Smith et al.,
2000). A number of inflammatory agents such as IL-1, lipopolysaccharide (LPS) and
other growth factors share convergent pathways that regulate transcription of PGHS-2.
These include NFkB and C/EBP, signaling pathways common in inflammatory

28
responses. The others are one or more of the mitogen activated protein kinase (MAPK)
cascades: extracellular regulated kinase (ERK1/2), Janus kinase (JNK/SAPK) and
p38/RK/Mpk2. Each of these pathways has been shown to contribute or be solely
required for increased expression of PGHS-2 in different cell culture systems (Smith et
al., 2000).
Regulation of PGHS-2 Gene Expression
Prostaglandin G/H synthase-2 gene is elevated by growth factors and mediators of
inflammation such as IL-1, TNFa, LPS and 12-O-tetradecanoylphorbol 13-acetate
(TPA). However, glucocorticoids and anti-inflammatory cytokines suppress PGHS-2
expression (Smith et ah, 2000).
Several cis-responsive elements act as key regulatory elements that mediate
PGHS-2 transcription in various cell types. The DNA elements are utilized in a cell-
specific and activator-specific manner. In bovine granulosa cells and ovine large luteal
cells, E-box are essential elements (Liu et ah, 1999; Wu and Wiltbank, 2001). In rat
granulosa cells, C/EBP or E box have been reported to be the essential elements for
regulation of PGHS-2 (Sirois and Richards, 1993), whereas in bovine granulosa cells it is
only the E box that is important for transcription of PGHS-2 by LH or protein kinase A
(PKA) activators (Liu et ah, 1999). In ovine large luteal cells, the E-box, C/EBP and CRE
in combination are involved in the induction of PGHS-2 by PGF2a as well as PKC
activators (Wu and Wiltbank, 2001). The PGHS-2 promoter has been shown to be
inducible by 8-bromo cAMP but not phorbol esters in fresh granulosa cells. However,
after luteinization of granulosa cells by day 8 of treatment with forskolin, the PGHS-2
promoter was immediately inducible by phorbol esters but not by forskolin (Wu and

29
Wiltbank, 2002). This change in responsiveness has led to the suggestion that
luteinization changes transcriptional regulation of PGHS-2 from PKA to PKC
dependence, with the E-box being the crucial element in transcriptional activation and
remaining conserved (Wu and Wiltbank, 2002). The intracellular effector systems
involved in induction of PGHS-2 are via PKC directly regulating transcription of PGHS-
2 gene in large luteal cells by acting through DNA elements (CRE and C/EBP) close to a
putative transcriptional start point, and particularly an E-box region (-CACGTG-) at -50
bp (Wu and Wiltbank, 2001).
Bovine uterine stromal cells stimulated with phorbol 12-myristate 13-acetate
(PMA) an activator of PKC exhibit a marked expression of PGHS-2 mRNA and protein
after 3 tol2 h of stimulation (Liu et al., 2001). However, this stimulation is transient and
the PGHS-2 transcript is very unstable whereas the protein is more stable. Waning of
PGHS-2 expression by 24 h is accompanied by increased PGE2 synthesis, suggesting that
a temporal association exists between induction of PGHS-2 mRNA, PGHS-2 protein and
PGE2. There seems to be a difference in the mechanism of regulation of PGHS-2 gene
between uterine stromal cells and granulosa cells. In uterine stromal cells there is a
promoter region located at -1574/- 492 that does not play a role in granulosa cells (Liu et
ah, 1999). This may account for the differences in stimulation, PMA stimulation in
uterine stromal cells and forskolin in granulosa cells (Liu et ah, 2001). Mutation of CRE
and C/EBP leads to reduced PKC-mediated transcription (Wu and Wiltbank, 2001). In
the CL, PGF2a acts by stimulating protein kinase C and calcium ions to stimulate large
luteal cells which express PGHS-2 and then produce PGF2„ (Tsai and Wiltbank, 1997).

30
The luteal PGF2a functions in an autocrine/paracrine way to increase the luteolytic effects
caused by PGF2a of endometrial origin.
Tumor necrosis factor a is a potent stimulator of PGF2a secretion from the bovine
endometrium. Whereas the target for TNFa are the endometrial stromal cells via
activation of PLA2 and arachidonic acid conversion, the target for OT to stimulate PGF20.
are the epithelial cells (Skarzynski et al., 2000b). It has further been suggested that TNFa
may stimulate PGF2C, synthesis by inducing nitric oxide synthase. Evidence of this
process comes from experiments showing increased production of PGF2a after incubation
of endometrial cells with a nitric oxide donor, S-nitroso-A-acetylpenicillamine
(Skarzynski et ah, 2000a).
Recombinant bovine interferon r induces activation of the Janus kinase-signal
transducer and activator of transcription and p38 MAPK pathways in bovine myometrial
cells. Inhibition of p38 MAPK pathway by a specific inhibitor (SB203580) has been
shown in vitro to decrease mRNA and protein for PGHS-2 in myometrial cells (Doualla-
Bell and Koromilas, 2001). This result suggests that p38 pathway upregulates PGHS-2
expression at the post-transcriptional level because inhibition destabilizes IFN-r induced
PGHS-2 mRNA. The increased sensitivity suggests that MAP kinase and PI3 kinase
pathways are both stimulated by PGE2 and both are involved in PGHS-2 expression, and
that PKA is upstream of PGE2-induced activation of MAP kinase in these cells (Munir et
ah, 2000).
Prostaglandin F Synthase
Arachidonic acid that is produced by hydrolysis of phospholipids is the precursor
for PGF2a synthesis. It is converted to PGH2 by PGHS-2. Evidence that PGH2 is the

31
direct precursor for PGF2a was first presented by Hamberg and Samuelson (1967). It was
later demonstrated that the enzyme catalyzing the conversion has glutathione S-
transferase (GST) peroxidase activity and does not have a PGD 11 - ketoreductase activity
(Burgess et al., 1987). The PGH2 can be converted to PGF2ct via three pathways. In the
first, PGH2 is converted to PGF2a by PGFS, also known as 9, 11 endoperoxide
dehydrogenase. The second pathway involves conversion of PGH2 to PGD2 by PGD
synthase and then PGD2 conversion to PGF2a by PGD 11-ketoreductase. The third
pathway involves conversion of PGH2 to PGE2 by PGES and then PGE2 to PGF2„ by
PGE 9-ketoreductase (Watanabe, 2002).
Prostaglandin F synthases belong to the aldoketoreductase (AKR) superfamily
(Table 2-1). Six different forms of PGFS have been reported in literature, three of which
were identified in cows. Lung type prostaglandin F synthase (PGFS1) (Watanabe et al.,
1985, 1988) catalyzes the reduction of PGH2 to PGF2a and PGD2 to a stereoisomer of
PGF2c, (9a, 11(5-PGF2). The other two are lung type PGFS found in the liver, also known
as PGFS2 (Kuchinke et al., 1992; Watanabe et al., 2002) and the liver type PGFS, also
known as dihydrodiol dehydrogenase 3 (DDBX) (Suzuki et al., 1999a). The others are
human PGFS (Suzuki et al., 1999b), sheep PGFS (Wu et al., 2001) and a PGFS isolated
from Trypanosoma brucei (Kubata et al., 2000). The PGFS1 and PGFS2 are 99%
identical, whereas DDBX is 86% identical to PGFS1 and PGFS2.
Among the above family members, only PGFS is also classified as AKR1C3 and
catalyzes the reduction of PGD2 and PGH2 and the oxidation of 9a, 11 (1-PGF2 despite
very high homology within the family (Suzuki et al., 1999a).

32
Regulation of Prostaglandin F Synthase
Asselin and Fortier (2000) reported expression of a 9-keto prostaglandin reductase
enzyme (9K-PGR) also known as PGFSL1 in the bovine endometrium. This enzyme is
92% homologous to bovine lung PGFS. The PGFSL1 is downregulated by recombinant
ovine IFN-t, whereas lung type PGFS is reduced by high and low doses of roIFN-x.
However, OT did not have any effect on the mRNA expression of PGFSL1 and PGFS in
bovine endometrial epithelial cells (Asselin and Fortier, 2000). Oxytocin upregulates
PGFS mRNA in bovine endometrial epithelial cells but rblFN-x inhibits OT-induced
PGFS as well as PGHS-2 (Xiao et al., 1999).
Table 2-1. Prostaglandin synthase enzymes that belong to the aldoketoreductase
superfamily.
Enzyme
Source
Intracellular
Location
Reference
PGE 9-ketoreductase
Human placenta
Cytosol
Westbrook and
Jarabak (1975)
Rabbit CL
Cytosol
Wintergalen et al. (1995)
Bovine placenta
Cytosol
Kankofer and
Wiercinski (1999)
PGD 11 -ketoreductase
Human lung
Cytosol
Suzuki et al. (1999b)
Lung-type
Bovine lung
Cytosol
Watanabe et al. (1988)
Liver-type
Bovine liver
Cytosol
Suzuki et al. (1999a)
PGH 9-11-endoperoxide
reductase
Bovine lung
Cytosol
Watanabe et al. (1988)
Sheep seminal
vesicle
Microsomes
Burgess and Reddy (1997)
Trypanosoma brucei
Cytosol
Kubata et al. (2000)
PGFS
Bovine endometrium
Madore et al. (2003)
After Watanabe et al. (2002) with modifications.

33
Regulation of PGFS in endometrial cells in vitro is dependent on the steroid
present and the cell type. In stromal cells, neither estrogen nor progesterone had any
effect on PGFS mRNA levels (Xiao et al., 1998). However, the presence of both steroids
upregulated PGFS mRNA compared to progesterone alone. Furthermore rblFN-r alone or
in the presence of both steroids decreased PGFS mRNA expression (Xiao et a., 1998).
The decreased expression of PGFS mRNA in both the epithelial and stromal cells by
rbIFN-x could be the cause of the observed increase in the PGE2/PGF2a ratio.
Madore et al. (2003) reported expression in the bovine endometrium of an
aldoketoreductase with 20-aHSD activity known as AKR1B5. The AKR1B5 has 45%
homology with PGFS of the AKR1 family. Unlike the other PGFS, the mRNA for
AKR1B5 was expressed in the endometrium from days 10 to 21 of the estrous cycle and
in endometrial cell cultures, suggesting that AKR1B5 is the main isoform that is present
in the bovine endometrium.
Prostaglandin E Synthase (PGES!
In cows, IFN-t is the embryonic signal that is responsible for maternal
recognition of pregnancy. Prostaglandin E synthase (PGES) is a downstream enzyme that
catalyzes the conversion of PGH2 to PGE2. Bovine PGES was cloned recently (Filion et
al., 2001) and is a member of a protein superfamily consisting of membrane-associated
proteins involved in eicosanoid and glutathione metabolism (MPEG family) (Jakobsson
et al., 1999a, Table 2-2). The activity of PGES is dependent on glutathione which may
act as a coenzyme (Ogino et al., 1977; Jakobsson et al., 1999b; Murakami et al., 2000).
The bovine PGES cDNA consists of a 5’-untranslated region of 8 bp, an open reading
frame of 462 bp and a 3 ’-untranslated region of 406 bp, GenBank accession number

34
AY032727 (Filion, et al., 2001). The coding region of the PGES cDNA encodes a 153
amino acid protein. Two isoforms of PGES have been reported, nuclear membrane
associated PGES (mPGES) and cytosolic PGES (cPGES). The mPGES was partially
purified from microsomal fractions of bovine (Ogino et al., 1977) and ovine seminal
vesicular glands and has been shown to require glutathione (Moonen et al., 1982). The
mPGES is glutathione-dependent, inducible and functionally linked to PGHS-2. It has
been proposed to be a regulator of inflammatory processes (Murakami et al., 2000). The
isoform expressed in ovarian follicles is the mPGES (Filion et al., 2001). The cPGES is
constitutively expressed and is functionally coupled to PGF1S-1 and is thought to be
involved in the synthesis of PGE2 needed to maintain tissue homeostatic functions
(Tanioka et al., 2000).
Table 2-2. Membrane associated proteins in eicosanoids and glutathione metabolism
superfamily.
Subfamily
Protein
Function
I
5-lipooxygenase activating protein
Mediators in inflammation
Leukotriene synthase
Mediators in airway
obstruction
Microsomal glutathione S-transferase 2
Protect against metabolites
from oxidative stress
11
Microsomal glutathione S-transferase 3
Ill
E. coli
V. cholerae
IV
Microsomal glutathione S-transferase 1
Catalyzes glutathione
dependent reduction of lipid
hydroperoxides
Microsomal glutathione S-transferase
1-like
Involved in redox regulation
After Jakobsson et al. (1999a).

35
Regulation of Prostaglandin E Synthase
Expression of PGES in follicular cells is not constitutive but is induced by
gonadotropins prior to follicular rupture, and induction of PGES parallels that of PGHS-2
(Filion et al., 2001). The PGES is also regulated by pro-inflammatory agonists including
IL-1 (5, LPS, TNFa and PMA. Thoren and Jakobsson (2000) used a human lung cancer
adenocarcinoma cell line and demonstrated that PGES activity was stimulated by IL-1 p
and TNFa but inhibited by dexamethasone. Cyclic AMP-dependent protein kinase is the
primary second messenger involved in signal transduction by gonadotropins (Richards et
al., 1998). Several agonists that effect transduction via this pathway may also be involved
in regulation of PGES gene expression. In vitro studies involving the use of bovine
epithelial and stromal endometrial cells have shown that PGES expression is increased in
the presence of LPS, TNFa and IFN-t in stromal cells and IFN-t in epithelial cells
(Parent et al., 2002). In stromal cells, IFN-t induces a rapid increase of PGES and PGHS-
2 mRNA expression. In BEND cells, PMA increased PGES mRNA, PGHS-2 mRNA
PGF2a and PGE2 suggesting that there is a correlation between PGES and PGHS-2
expression as regards the synthesis of PGE2 (Parent et al., 2002).
Bovine Luteal OT
The ruminant CL synthesizes and secretes OT besides producing progesterone
(Wathes et al., 1983; Ivell and Richter, 1984). Oxytocin is also produced by granulosa
cells of the preovulatory follicle (Salli et al., 2000). Concentrations of luteal OT and
vasopressin increase during the early luteal phase (days 1 to 4), are maximal during the
mid-luteal phase (days 5 to 10) and decline afterwards (Wathes et al., 1984; Abdelgadir et
al., 1987; Parkinson et al., 1992). However, mRNA concentrations of OT reach a peak

much earlier at day 3 of the cycle (Ivell, et al., 1985; Salli et ah, 2000). The high
concentrations of OT and neurophysin I within the CL suggests that OT is synthesized
36
locally. Flint and Sheldrick (1982) administered PGF2„ (125 pg i.m) to cows during the
luteal phase and observed release of luteal OT within 5 min that reached a maximum in
10-20 min. Similarly, norepinephrine causes secretion of luteal OT when administered
to heifers during the mid luteal phase (Skarzynski and Kotwica, 1993). The mechanism
of action for release of OT is via sympathetic activation of p-adrenergic receptors of
luteal cells and through cAMP mediation (Skarzynski and Kotwica, 1993). The bovine
CL contains both large and small luteal steroidogenic cells and it is the former that
predominantly produce OT (Fields and Fields, 1996).
The OT-neurophysin-1 mRNA increases after luteinization and reaches a peak by
day 3 of the cycle, then declines to low concentrations during the mid-luteal phase (Ivell
et al., 1985). The OT concentrations in the CL are maintained by stimulation of the post-
translational OT-neurophysin process (Wathes et al., 1984; Abdelgadir et al., 1987;
Fuchs, 1987; Wathes and Denning-Kendall, 1992). Peptidyl glycine a-amidating
mono-oxygenase is the terminal enzyme responsible for post-translational processing of
OT-neurophysin (Abdelgadir et al., 1987; Furuya et al., 1990) and has been reported to be
highest in the ovaries of ruminants during the mid-luteal phase (Sheldrick and Flint,
1989; Bogacki et al., 1999). This coincides with the time of highest levels of luteal OT
(Skarzynski et al., 2001).
Prostaglandins act on the CL to induce the release of OT which is facilitated by
the high number of PGF2a receptors in the large luteal cells (Niswender et al., 1985). In
ruminants during the luteal phase, OT and progesterone are secreted concomitantly from

37
the ovary. However, progesterone secretion is inhibited and OT secretion stimulated by
exogenous PGF20 (Walters et al., 1983). It has been postulated that a central OT pulse
generator functions as the pacemaker for luteolysis (McCracken et al. 1999). The uterus
transduces hypothalamic signals in the form of OT secretion into luteolytic pulses of
uterine PGF2a (Gimpl and Fahrenholz, 2001). A positive feedback loop exists that
amplifies neural and luteal OT signals. Prostaglandin F2a has been shown to induce
release of OT from luteal slices in vitro (Abdelgadir et al., 1987).
Luteal cells contain vesicles which carry OT-neurophysin granules. Oxytocin is
secreted as a prohormone (Ivell and Richter, 1984), packaged and stored in secretory
granules, and released at the cell surface by exocytosis (Fields et al., 1992). The
production of the granules is restricted to the large luteal cells (Guldenar et al., 1984).
During the estrous cycle, the highest number of granules occurs about day 11 and are
progressively depleted beginning at about day 14 after estrus (Fields et al., 1992). In
pregnant animals, however, the granules are maintained at high levels beyond day 20 of
pregnancy but become depleted by day 30 (Fields and Fields, 1996). It is not known
exactly why this difference exists between pregnant and cyclic cows, although it has been
suggested that the presence of the embryo may play a major role (Salli et al., 2000). From
day 45 and onwards in pregnant cattle, a second population of granules emerges and
increases until maximal numbers are detected about day 180 and day 210 of pregnancy.
The content of these granules is not known (Fields et al., 1992).
In vitro, PGF2a treatment has been shown to deplete the large luteal cells of their
secretory granules within 1 h of treatment in cyclic (Heath et al., 1983) and pregnant
cows (Fields et al., 1987; 1989). Corteel (1975) reported that depletion of granules in

38
sheep CL occurred within 30 min of treatment, whereas Chegini and Rao (1987) reported
in vitro depletion after 2 h of treatment in 3 to 4 mo pregnant cows, Using a microdialysis
system in the CL, Shaw and Britt (2000) showed that administration of a luteolytic dose
of 25 mg PGF2a i,m. led to release of luteal OT in cows 13 to 15 days of the cycle.
However, no OT was detected in animals which were undergoing spontaneous luteolysis
which suggests that luteal OT may contribute less to luteolysis in cows than has been
proposed in sheep (McCracken et al., 1995). Stimulation of bovine luteal cells with
PGF2a on day 8 of cycle was shown to promote phosphorylation of a protein that is
phosphorylated by protein kinase, called myristoylated alanine-rich C kinase substrate
(MARKS) (Salli et al., 2000). After phosphorylation, MARKS translocates to the plasma
membrane and dissociates actin cortex which enhances exocytosis of OT containing
granules.
Exocytosis involves transport of the granules via an actin complex that is usually
associated with the plasma membrane (Salli et al., 2000). Fuchs et al. (2001) observed
low amplitude spurts of OT which were intermittent during pregnancy in cows. Towards
term there was an increase in both frequency and amplitude, and during labor a dramatic
increase was observed. Individual peaks of OT observed in the utero-ovarian vein during
late gestation could be due to OT from the CL as well as the posterior pituitary (Fuchs et
al., 2001). Maternal caruncles have been suggested as another putative source of OT
(Ivell et al., 1995; Fuchs et al., 2001).
The presence of OT-containing luteal granules followed by their delayed release
during the early peri-implantation period suggests that luteal OT may be involved in
OT-driven prostaglandin synthesis. The presence of the respective OTR in the

39
endometrium in the peri-implantation period as well as increased expression of enzymes
involved in prostaglandin synthesis would increase chances of embryo loss. In this
dissertation, the effect of PGFja on release of luteal OT on representative days during
early (day 22) and late (day 40) peri-implantation period will be examined. The other
major objectives will be to determine the changes in expression of prostaglandin
synthesis enzymes (PGHS-2, PGES and PGFS) and OTR that occur during luteolysis,
how their expression is affected by the presence of a conceptus and whether the
prostaglandin synthesis system is re-established after the period of maternal recognition
of pregnancy.

CHAPTER 3
RELEASE OF OXYTOCIN FROM OVARIAN VERSUS PITUITARY TISSUES IN
RESPONSE TO PGF2„ IN OVARIECTOMIZED AND SHAM-OVARIECTOMIZED
COWS DURING THE PERI-IMPLANTATION PERIOD
Introduction
The major source of luteal OT are the large luteal cells that are derived from
granulosa cells after ovulation (Abdelgadir et al., 1987; Parkinson et al., 1992). Luteal
OT is maximal during the mid-luteal phase whereas the OT mRNA is maximal on day 3
of the cycle (Ivell et al., 1985). Luteal OT is stored in secretory granules. During the
estrous cycle, exocytosis results in a decline in the number of secretory granules between
days 11 to 14 whereas OT containing secretory granules in pregnant cows are maintained
at a high level beyond day 20 (Fields and Fields, 1996). In pregnant animals, exocytosis
of OT-containing luteal secretory granules coincides with the decline in IFN-r secretion
(Fields and Fields, 1996). One secretogogue that releases luteal OT in vitro (Abdelgadir
et al., 1987; Chegini and Rao, 1987; Jarry et al., 1992) and in vivo (Flint and Sheldrick,
1982; Fields et al., 1987, 1989; Orwig et al., 1994) is PGF2a. Norepinephrine has also
been shown to stimulate synthesis and release of OT from the CL by stimulation of
p-adrenergic receptors as well as post-translational modification of the OT precursor
(Skarzynski and Kotwica, 1993). McCracken et al. (1999) hypothesized that OT from the
neurohypophysis stimulates secretion of uterine PGF2a. Subsequently, uterine PGF2cl
stimulates release of OT from the CL.
40

41
Although this seems to be the situation in sheep, the contribution of luteal OT in
cattle to luteolysis is questionable since depletion of luteal OT by 75% using
norepinephrine failed to extend the luteal phase in cyclic cows (Kotwica and Skarzynski,
1993; Skarzynski and Kotwica, 1993). Similar results have been reported in sheep where
exogenous PGF2a induced luteolysis in hysterectomized ewes possessing less than 5% of
mid-luteal OT stores as rapidly as for intact animals (Sheldrick and Flint, 1983a).
Moreover, Shaw et al. (2000), using microdialysis, observed a rapid decline in luteal OT
secretion after day 14 of the cycle. The absence of any measurable OT in the CL during
luteolysis led the authors to suggest that the contribution of luteal OT to the luteolytic
process in cows may be minimal. Luteal OT concentrations do not differ between
pregnant and cyclic cows from day 0 to 19 of the cycle (Parkinson et al., 1992). In
pregnant animals, concentrations decrease after day 19 and remain at significantly lower
levels than in the luteal phase of non-pregnant animals (Parkinson et al., 1992).
Most studies on luteal OT have been conducted in cows during the estrous cycle.
Scant information has been published regarding luteal OT during the peri-implantation
period. There is a possibility that the OT-prostanoid system may be functional after day
21 during the peri-implantation period in instances where the conceptas fails to initiate a
strong antiluteolytic signal. It is important, therefore, to determine whether at this stage
the CL is capable of responding to PGF2aby release of OT from the granules that still
remain in the CL. This could be one of the mechanisms that lead to luteolysis and
consequently embryo loss during the peri-implantation period.
The objectives of this study were to determine the source of OT that serves to
drive the OTR-prostanoid system of the endometrium and conceptas during the peri-

42
implantation period. It is hypothesized that OT-containing secretory granules in the CL of
pregnant animals between days 22 and 40 release their contents in response to
sub-luteolytic doses of PGF2a. Alternatively, the source of OT at this time may be the
posterior pituitary. The specific objectives were to test whether PGF2(1 increases
circulating OT during the peri-implantation period and whether the source of OT is luteal
or of pituitary origin. Another goal was to determine whether there was a difference in
OT response between the early (day 22) and late (day 40) peri-implantation period to
PGF2a.
Materials and Methods
Brahman-Angus crossbred cows at day 22 of pregnancy were divided into two
groups. One group was bilaterally ovariectomized (OVX, n = 4) and the other sham-
ovariectomized (Sham-OVX, n = 9, Table 3-1). Ovariectomy was conducted as
described by Drost et al. (1992). Briefly, animals were restrained in a chute. The perineal
region and vulva were washed and disinfected. The status of the ovaries and uterus were
determined by rectal examination. Animals were given epidural anesthesia using 5 ml 2%
Lidocaine HC1. A vaginoscope was used to confirm the absence of infections and a stab
incision was made and enlarged in the fornix to gain access to the ovaries. An ecraseur
was then used to remove the ovaries. All the animals in the sham-ovariectomized group
underwent the same procedures as those ovariectomized including the stab incision and
manipulation of the ovaries. Cows were then injected (i.v.) at 1 h intervals with two 25
pg sub-luteolytic doses of PGF2a (Lutalyse ®, Pharmacia & Upjohn, Kalamazoo, MI) or
saline (Periods 1 and 2, Fig 3-1). One hour after the second injection (Period 3), the cows
received a luteolytic dose of PGF2a (25 mg) (i.v.) or saline.

43
An additional group of nine, day 40 pregnant cows were sham-ovariectomized
and divided into two groups to receive either PGF20: (n = 6) or saline (n = 3). Blood
samples were collected from the jugular vein every 5 min starting 15 min before
ovariectomy or sham-ovariectomy until the first PGF2a /saline injection, every 5 min for
the first 15 min following each PGF2a /saline injection and then every 15 min until 60
min following each injection (Fig. 3-1). Blood samples were kept on ice, transported to
the laboratory and plasma harvested and stored at -20°C until assayed for OT.
Table 3-1. Experimental design for in vivo study to ascertain response of PGF2a or saline
on luteal OT release in peri-implantation cows.
Day of Pregnancy
Day 22
Day 40
Treatments
PGF2a
Saline
PGF2a Saline
Sham-Ovariectomized
n = 6
n = 3
n = 6 n = 3
Ovariectomized
n = 4
-
-
Fig. 3-1. Experimental protocol for response of PGF2a or saline on luteal OT release in
peri-implantation cows. Crossbars represent times at which blood samples were taken.
OVX PGF2C, (25 pg)/saline PGF211 (25 pg)/saline PGF20. (25 mg)/saline
Sham-OVX
i i
l
l
Period 1
Period 2
Period 3
-30 0
60
120 180
Time (min)

44
Oxytocin Radioimmunoassay
Extraction of Plasma Samples
The method used for OT extraction from plasma samples was adapted from
Wathes et al. (1986) with modifications. Each SEP-PAK Cl8 cartridge (Waters
Associates, Milford, MA, USA) was pre-wetted with 10 ml of 0.1 % trifluoroacetic acid
in 80% acetonitrile. The columns were then eluted with 20 ml deionized-distilled water.
Plasma samples (0.5 - 2.0 ml) were diluted (1:1) with phosphate buffer (0.05 M, pH 7.5).
Following application of the plasma, 25 ml 0.1 % trifluoroacetic acid was added, and the
extract eluted with 3 ml of 0.1% trifluoroacetic acid in 80% acetonitrile into 13 x 100 mm
tubes. Elution solvent was dried under an air stream apparatus in a water bath set at 37°C
and extract redissolved in 0.5 ml assay buffer (0.05 M phosphate buffer, pH 7.5 with 0.05
M EDTA, 0.15 M NaCl and 0.2% BSA).
Each extraction batch included the following controls:
1) Phosphate buffer (2.0 ml).
2) 1.0 ml bovine plasma + 1.0 ml phosphate buffer.
3) 1.0 ml bovine plasma spiked with low amount (0.2 ml) of OT (3.9 pg) in 0.8 ml
phosphate buffer.
4) 1.0 ml bovine plasma spiked with high amount (0.2 ml) of OT (31.25 pg) in 0.8
ml phosphate buffer.
The mean extraction efficiency was 65.7 ± 5.5%.
Assay procedure
Duplicates from each extracted sample (200 pi) and triplicates of OT standards
(0.195 pg - 100 pg/200 pi) were used for the assay. The OT antibody was from rabbit # 8

45
and was kindly donated by Dr. D. Dieter Schams, Technical University of Munich,
Freising, Germany. The working dilution of the antibody was 1:16000. Assay buffer
was added to glass assay tubes (12 x 75 mm), followed by 200 jj.1 extract. The tubes were
kept on ice throughout the procedure. The antiserum (100 pi) was added to all plasma
extracts, mixed thoroughly and incubated at 4°C for 24 h. The tracer, [l25I-OT] (Cat #
NEX-187, 10 pCi stock solution) from Perkin-Elmer Life Sciences, Boston, MA, was
added to 2 ml assay buffer and aliquoted into 100 pi in 0.5 ml centrifuge tubes and stored
at -20°C. Approximately 3500 cpm/100 pi [l25I-OT] was added to all tubes and
incubation continued at 4°C for another 48 h. Pansorbin cell suspension (40 pi)
(Calbiochem, San Diego, CA) was prepared by adding 400 pi phosphate buffer, vortexed
and centrifuged at 3000 x g for 5 min. The supernatant was aspirated and discarded, and
the pellet resuspended in phosphate buffer. Washing was repeated as above and the final
pellet resuspended in 4 ml phosphate buffer. To separate the bound and free OT within
the assay, 100 pi protein cell suspension was added to each assay tube (except the total
count tubes), mixed well and incubated at 4°C for 1 h.
Following incubation, tubes were centrifuged at 30, 978 x g using a Sorvall RC-
5B centrifuge with an HS-4 rotor (Du Pont Instruments, Newtown, CT), the supernatant
discarded and the tubes with pellets (i.e., bound OT) counted in a gamma counter. The
concentrations of OT were expressed as pg/ml. The sensitivity of the assay was 1 pg/ml.
The inter and intra assay coefficients of variation were 10 and 11 %.

46
Statistical Analysis
Data were analyzed using the Statistical Analysis System (SAS) software version
8 (SAS Institute, Cary, NC). Oxytocin concentrations were analyzed by least squares
analysis of variance using the Mixed Model system of SAS (PROC MIXED) for repeated
measures analysis. The mathematical model included the independent effects of
treatment, time, period, treatment x time, treatment x period, period x time and treatment
x period x time. Cow was considered as a random variable nested within treatment. A
series of orthogonal contrasts were conducted to examine differences between treatments
(see Appendix A) ( T1 :day 22-PGF2o-Sham-ovariectomized ; T2:day 22-Saline-Sham-
ovariectomized; T3:day 40-PGF2o-Sham-ovariectomized; T4:day 40-Saline-Sham-
ovariectomized; T5:day 22-PGF2a-ovariectomized) and Periods: Period 1 from 5 to 60
min, Period 2 from 65 to 120 min and Period 3 from 125 to 180 min. Time within each
period was from 5 to 60 min (Fig. 3-1). Data are presented as least squares means ±
SEM. The covariance structure used was autoregressive of order 1 (Littell et al., 1998).
Results
Effect of PGF211 on OT response in sham-ovariectomized and ovariectomized day
22 pregnant cows is shown in Fig. 3-2. There was no major increase in plasma OT from
the time of ovariectomy to the time of first injection of PGF20. In two of the four
ovariectomized cows, plasma OT increased 45 min following the first injection of PGF2a.
No additional increase in OT was observed following the second and third injection of
PGF2C (Fig. 3-2). Ovarian intact cows showed no response to the first two injections of
PGF2„ probably because the concentration of PGF2„ used was too low. The third injection
ofPGF2„(25 mg) resulted in a significant increase in plasma OT in all cows.

47
Day 22 Pregnancy
—•— Sham-OVX, PGF (n = 6)
—o- OVX, PGF (n = 4)
Fig. 3-2. Least squares means (± SEM) plasma concentrations of oxytocin in
ovariectomized and sham-ovariectomized PGF2a-treated cows, day 22
pregnant. Arrows indicate time (0, 60 and 120 min) at which PGF2o injection
was given (i.v.).
The response to PGF2„ or saline in sham-ovariectomized cows on day 22 of
pregnancy is shown in Fig. 3-3. No difference was observed in OT response to PGF2a or
saline after the first and second injections (P > 0.05). However, in saline-treated cows
there was a numerical increase after the second injection. Subsequently, plasma OT
declined to concentrations observed prior to treatment. In cows treated with PGF2o, there
was a significant increase in plasma OT 5 min after the third injection (25 mg). There
was no treatment by time interaction in any of the time periods.

48
Day 22 Pregnancy
Sham-OVX, PGF (n = 6)
Sham-OVX, Saline (n = 3)
Fig. 3-3. Least squares means (± SEM) plasma concentrations of oxytocin in sham-
ovariectomized PGF20 and saline-treated cows, day 22 pregnant. Arrows
indicate time (0, 60 and 120 min) at which PGF21, or saline was injected
(i.v.).
Plasma concentrations of OT in sham-ovariectomized day 40 pregnant cows
following PGF201 or saline treatment are shown in Fig. 3-4. Little variation was observed
in plasma OT following the first and second injections of either PGF2a or saline.
However, a temporal acute response of OT to PGFia or saline was observed after the
third injection. This was not a sustained increase as observed in sham-ovariectomized
animals response to PGF2a at day 22 of pregnancy (Fig. 3-3).This indicates that in day 40
pregnant cows neither PGF2a nor saline had any appreciable effect in increasing plasma
OT concentrations.

49
Day 40 Pregnancy
Fig. 3-4. Least squares means (± SEM) plasma concentrations of oxytocin in sham-
ovariectomized PGFia and saline-treated cows, day 40 pregnant. Arrows
indicate time (0, 60 and 120 min) at which either PGF2a or saline was injected
(i-v.).
The OT response to PGF2a versus saline was different on day 22 versus day 40 of
pregnancy. Orthogonal contrasts showed a treatment by day of pregnancy by period of
interaction (Fig. 3-5A). On day 22 of pregnancy there was a significant (P < 0.03)
treatment by period interaction, indicative of an increase in plasma OT in period 3 in
PGF2a treated cows, whereas for saline treated cows there was no increase in plasma OT.
However, on day 40 cows there was no substantial increase in plasma OT in either PGF20
or saline treated cows for any of the periods. (Fig 3-5 B).

50
120
-20 J , , , , , ,
0.5 1.0 1.5 2.0 2.5 3.0 3.5
Period
Fig 3-5. Treatment by day of pregnancy by period interaction for oxytocin in sham-
ovariectomized cows receiving either PGF2a or saline on day 22 or 40 of
pregnancy (P < 0.03). Data represent least squares means ± SEM.

51
Discussion
Administration of sub-luteolytic doses of 25 pg PGF2a(i.v.) failed to cause a
significant increase in OT secretion in day 22 ovariectomized or ovarian-intact pregnant
cows. However, a luteolytic dose of 25 mg (i.v.) did increase plasma OT concentrations
in ovarian-intact cows. This suggests that most of the increase in plasma OT
concentrations measured in ovarian-intact cows at day 22 of pregnancy was secreted from
the CL in response to PGF2n. Intact cows at day 22 or 40 of pregnancy failed to respond
to sub-luteolytic PGF2a doses of 25 pg. The failure of an OT response to the sub-
luteolytic dose of PGF2a is likely a result of an inadequate dose of PGF2a. This is in
contrast to the higher dose of 25 mg of PGF20 that was administered in the third period of
day 22 pregnant cows.
The increase in plasma OT concentrations at day 22 in pregnant cows was
observed within 5 min after injection of 25 mg of PGF2a, reached a peak within 25 min,
and declined thereafter. These results are similar to those reported in cyclic beef heifers
by Salli et al. (2000) where there was an increase in plasma OT concentrations within 5
min of treatment with PGF2a which remained elevated for 20 min and then declined to
basal concentrations by 40 min. Fields et al. (1989) reported that only 0.5% of large
luteal cells had secretory granules at 60 min after administration of 25 mg, PGF2a in
pregnant cows one to two weeks prior to parturition. Salli et al. (2000) reported that the
mechanism by which PGF2a induces release of OT from OT containing granules in the
CL is a PKC mediated event that activates MARKS protein which translocates the OT
granules to the membrane and disrupts the actin complex in the secretory process. They
determined the location of MARKS protein in cytosolic and membrane fractions of

52
sections from CL of day 17 pregnant cows that had been treated with PGF2a.
Translocation of MARKS causes movement of secretory granules to the membrane
where they release OT.
A dose dependent effect of PGF2a (20 to 50 pg) on OT secretion was reported by
Skarzynski et al. (1997) who showed that CL sensitivity to PGFju increased in the late
luteal phase. To evoke a similar OT response on days 12 and 18 of the cycle, PGF2a on
day 18 could be reduced 10 fold. The lack of response with 25 pg PGF2c, in the present
experiment indicates the concentration was too low to effect a change in plasma OT
concentration. Skarzynski et al. (1997) failed to achieve luteal regression using 50 pg
PGF2o, although the plasma OT concentration increase was comparable to that observed
during spontaneous luteolysis (50 - 70 pg/ml). A 30 pg dose of PGF2ot released 67 pg/ml
whereas 20 pg had no effect on luteal OT release. We used 25 pg in this experiment not
knowing the results by Skarzynski et al. (1997).
Orwig et al. (1994) investigated the effect of 500 pg PGF2a on OT release from
the CL of day 8 cyclic beef cows and activation of PKC. Peak plasma concentrations of
OT occurred 1.5 to 10 min after injection of PGF2a. hi addition, there was a high
correlation (r = 0.82) between membrane PKC and OT release suggesting a role for PKC
in OT release from luteal cells. In their study, the CL was removed at different times after
PGF2a injection. A smaller peak in OT was observed in animals in which the CL was
removed at 0 min relative to the PGF2„ injection than in those animals in which it was
removed later suggesting that most of the OT was of luteal origin.
In the present study, an increase in plasma OT concentrations occurred in
ovariectomized PGF2a-treated animals at 25 to 30 min after the first PGF2a injection. The

53
cause of this single elevation in plasma OT concentration is not clear. One possible
source of plasma OT is the neurohypophsis (McCracken et al., 1999). However, Schams
et al. (1985) reported that its contribution is minimal. The sampling in the present study
was in the jugular vein which would be an indication of possible secretion from the head
or neurohypophysis. Prostaglandins have been shown to stimulate release of several
hormones from both the posterior (oxytocin) and anterior pituitary gland (prolactin,
adrenocorticotrophic, growth and luteinizing hormone) (Haynes et al., 1978; Renegar et
al., 1978; Collier et al., 1979). The release of pituitary hormones modulated by
exogenous PGF2Q is either direct or via the hypothalamus (Hedge, 1972; Ojeda et al.,
1975).
Unexpectedly, we observed increased OT release in sham-ovariectomized cows
treated with saline. It has been suggested that OT can be released as result of manual
manipulation of the ovary or the uterus (Williams et al., 2001). No increase in plasma OT
was observed immediately following ovariectomy. All animals in the group that was
sham-ovariectomized underwent the same procedures as those ovariectomized including
incision and manipulation of the ovaries.
It has been shown that norepinephrine also induces release of OT from the CL and
is involved in post-translational processing of OT. Oxytocin may also autoregulate its
own concentration in the CL although the mechanism is not clear (Bogacki and Kotwica,
1999). Norepinephrine affects luteal synthesis of OT by stimulating (3-adrenergic
receptors. Similar effects as those due to norepinephrine may have occurred in this study
brought about by the stress animals experienced during the experiment (Kotwica et al.,
2002). This could lead to secretion of norepinephrine into circulation resulting in release

54
of luteal OT. This may be the case in those instances where there was an increase in
plasma OT following saline injection. However, since no major OT increase was
observed in periods 1 and 2, the supposed effect from norepinephrine may be minimal.
Alternatively the increase in OT may have been from the posterior pituitary as a neural
afferent reflex from handling the cervix, fomix and vagina e.g. Ferguson’s reflex.
Norepinephrine stimulates concomitant progesterone synthesis and post-
translational processing of OT synthesis by activating 3(3-hydroxysteroid dehydrogenase
in the bovine CL. It has been shown that stress mimicked by norepinephrine infusion may
increase progesterone synthesis, ovarian OT and p-adrenergic receptors (Kotwica et al.,
1991; 1994). No progesterone measurements were done in this study.
Skarzynski and Kotwica (1993) reported that administration of repeated 5 mg
doses of norepinephrine at 30 min intervals to cyclic cows resulted in a decrease in the
quantity of OT released each time from the CL indicating a depletion of OT. In the
present study, no responsiveness was seen following PGF2a until after the third injection
of a large PGF2a dose of 25 mg. This indicates that the sub-luteolytic 25 pg doses
administered were not capable of eliciting an observable response.
Ivell et al. (1985) reported that there was no de novo synthesis of OT pro¬
hormone in the mid-luteal CL. This suggests that once OT is depleted there is no
replenishment of stored OT. Ovariectomized cows at 22 days of pregnancy treated with
PGF2a had a slight but nonsignificant increase in OT concentrations of about 10 to 15
pg/ml following the second and third injections. This minimal increase in OT
concentrations indicates an OT contribution of neurohypophyseal origin in
ovariectomized cows in the absence of a CL. The OT response to PGF2a in sham-

55
ovariectomized cows on days 22 was greater than at day 40 of pregnancy (Fig. 3-5A and
B). In both groups of animals, a significant release of OT was observed after the
luteolytic dose of OT. Day 40 CL, believed to be depleted of OT, were expected to give a
minimal response to PGF2a. The response observed may indicate an alternative source of
OT since Nichols et al. (2003) showed no luteal OT or OT mRNA in day 40 CL. Indeed a
similar elevation in plasma OT concentrations was observed in the saline treated cows at
day 40 indicating neurohypophyseal release. Sheldrick and Flint (1983b) reported
decreased concentration of OT in ovine CL during pregnancy from 373 ng/g wet weight
at day 14 to less than 5 ng/g at day 50 of pregnancy. A decrease in luteal OT therefore
reduces the likelihood of luteal regression and uterine contractility which would further
assist in the establishment of pregnancy. One known cause for failure of PGF2,, to
stimulate further release of OT may be PGF2a receptor desensitization (Skarzynski and
Okuda, 1999). In the ovary, this has been attributed to prostaglandins produced locally in
the CL (Denning-Kendall et al., 1994). Lamsa et al. (1992) showed that low level
infusion of PGFja into the ovarian artery led to desensitization of the CL in releasing OT
in ewes. However, in this study we observed release of OT after the third injection
suggesting that desensitization was not the cause of failure to release high amounts of OT
on the first and second injections of PGF20 in the sham-ovariectomized cows. In periods
one and two doses of PGF2„ were too low.
Flint and Sheldrick (1983) and Schallenberger et al. (1989) reported an increase in
plasma OT in pregnant cows between days 14 to 16. Higher concentrations of OT were
found in the aorta than in the cauda vena cava suggesting a non-luteal source. Hooper et
al. (1986) reported higher OT concentrations in the jugular vein than in the carotid artery

56
of late luteal phase sheep, an indication that the neurohypophysis could be contributing to
the plasma OT. Parkinson et al, (1992) suggested a possibility of OT release from the
neurohypophysis in cows after the levels of OT from the CL declined around the time of
maternal recognition of pregnancy. Schams et al. (1983), Wathes et al. (1984) and
Meidan et al. (1993) reported that follicles could also be a source of OT. In the present
study, however, both ovaries were removed.
The conclusions from this study are that PGF2a induces release of OT from the
CL of day 22 but not day 40 pregnant cows and that the dose of PGF2a has to be
luteolytic in order for a substantial amount of OT to be released. These two groups of
cows represent cows in the early (i.e. day 22) and late (i.e. day 40) peri-implantation
periods. Failure for release of OT at day 40 means cows at this stage have very little OT
in the CL and that OT from the CL at this stage is unlikely to initiate pulsatile secretion
of PGF2cl.

CHAPTER 4
EXPRESSION OF OXYTOCIN RECEPTOR, PROSTAGLANDIN G/H, F AND E
SYNTHASES IN THE BOVINE ENDOMETRIUM AND CHORIOALLANTOIS
DURING THE ESTROUS CYCLE AND PERI-IMPLANTATION PERIOD
Introduction
Oxytocin and the OTR play important roles in reproductive processes including
luteolysis, establishment of pregnancy, milk-let down and parturition in females and
ejaculation in males (Ivell and Russel, 1995; Assinder et al., 2000). Inhibition of the
OTR plays an important role in the establishment of pregnancy (Wathes and Lamming,
1995); and the induction of OTR during labor facilitates delivery of the fetus (Fuchs et
al., 1996).
Blockade of endometrial OTR with an OT antagonist from days 15 to 22 of the
cycle affects neither the duration of luteolysis nor the duration of the estrous cycle in
heifers (Kotwica et al., 1997). However, Kotwica et al. (1998b) reported that blockade of
OTR decreases the magnitude of PGF2a release indicating that OT has a supportive and
modulatory role of the amplitude of PGFia that initiates luteolysis in cattle. Using ligand
binding assays, Fuchs et al. (1990) reported that OTR concentrations on days 7 and 14 of
pregnancy were similar to those in cyclic cows. On days 17 and 21, receptor
concentrations in pregnant cows remained low and were lower than in cyclic cows.
Oxytocin administered to pregnant cows leads to increased production of PGFM in a
57

58
dose-dependent fashion that occurs later in pregnancy at approximately day 50 (Fuchs et
al., 1996b). Prostaglandin F21, is a luteolysin released by the endometrium at the end of a
normal estrous cycle in response to OT when no conceptus is present. However, in the
presence of a viable embryo there is suppression of pulsatile PGF2,, secretion (Silvia et
al., 1991; Flint et al., 1992). It is now well established that OTR is suppressed by IFN-r
during the period of maternal recognition of pregnancy (Telgmann et al., 2003). In cases
where the conceptus secretes inadequate interferon-r (IFN-r) there may be a possibility of
OTR stimulation and PGF2a secretion that could augment the luteolytic process and lead
to embryo loss.
Oxytocin binds to its receptor and couples to G¡ and Gq proteins leading to
activation of PKC and PLC pathways (Sanborn et al., 1995; Copland et al., 1999).
Eventually PGHS-2 and PGF201 synthesis occur which leads to luteolysis during the
estrous cycle. Although these events occur in an estrogen dominated environment, the
bovine OTR does not respond to activated estradiol receptors (Ivell et al., 1998). It was
recently shown that the ovine OTR promoter is stimulated by liganded ERa through
protein-protein and protein DNA interactions (Bazer et al., 2003). A progesterone-primed
endometrium seems to be necessary for OT-induced activation of PGHS-2 since it has
been shown that prepubertal heifers fail to respond to OT unless they are primed by
progesterone (Fuchs et al., 1997). Although several studies on the expression of OTR
have been conducted during the estrous cycle and early pregnancy, expression of OTR
mRNA during most of the peri-implantation has not been investigated. The importance of
understanding the pattern of expression of OTR during the peri-implantation period arises
because if OTR are actively expressed and coupled to the prostaglandin synthesis

59
pathway, this may initiate luteolytic pulses of PGF2a during early pregnancy. This may be
one of the mechanisms that lead to high embryo loss during early pregnancy in cattle.
Particularly in high producing dairy cows.
Prostaglandin G/H synthase (PGHS), also known as cyclooxygenase, is a key rate
limiting enzyme in the prostaglandin biosynthetic pathway which converts arachidonic
acid to PGH2. The PGH2 is converted to PGF2a by PGFS (Watanabe et al., 1985). The
PGHS-2 is present at low concentrations in most tissues but is usually induced by a
variety of mitogens (Kujubu et al., 1991; Xie et al., 1991), interleukin-1 (Habib et al.,
1993) and growth factors (Wong et al., 1989; Herschmann, 1996). Within the bovine
endometrium, two types of cells play an important role in the synthesis of prostaglandins.
The epithelial cells predominantly secrete PGF2a whereas the stromal cells secrete PGE2
(Schatz et al., 1987; Fortier et al., 1988; Desnoyers et al., 1994; Parent et al., 2003b).
During early pregnancy, the loss of uterine responsiveness to OT causes the
suppression of the pulsatile pattern of PGF2tI secretion leading to maintenance of the CL.
In vivo studies have revealed the expression and regulation of PGHS-2 in uterine tissues
during the estrous cycle (Arosh et al., 2002) and later stages of pregnancy (Fuchs et al.,
1999). Arosh et al. (2002) reported high expression of PGHS-2 mRNA in endometrium
of cows between days 13 - 21 of the estrous cycle and low expression between days 1 -
12. Although Guzeloglu et al. (2003) reported high expression of PGHS-2 mRNA in
endometrium of day 17 pregnant dairy cows, no extensive studies have been conducted
on the expression in the endometrium and chorioallantois during the peri-implantation
period. Evaluation of the pattern of expression of PGHS-2 during the entire peri-
implantation period is necessary since it would enhance our understanding of its probable

60
role in establishment of pregnancy. Depending upon the relative amounts of each, the
downstream enzymes PGFS and PGES may lead to predominantly conversion of PGH2 to
PGF2a, which is luteolytic, or to PGE2, which may be luteotrophic in ruminants (Pratt et
al., 1977).
In a situation where there is increased endometrial expression of PGHS-2 in
cyclic or pregnant cows around the time of luteolysis or maternal recognition of
pregnancy, there would probably be increased synthesis of PGES in pregnancy. This
could be in anticipation for successful pregnancy to maintain a PGE2:PGF2a ratio that is
favorable for maintaining pregnancy. Studies on the expression of PGES and PGFS in the
bovine endometrium and chorioallantois will increase our understanding of the
physiological functions of these enzymes in cyclic and peri-implantation cows.
Prostaglandin E and F synthases are key enzymes in the pathway to prostaglandin
synthesis that are involved in conversion of PGH2 to PGE2 and PGF2a, respectively
(Watanabe et al., 1985). Despite the importance of PGFS in prostanoid synthesis and
reproduction, little information exists about its mRNA expression and regulation during
the estrous cycle and the peri-implantation period. Increased expression of PGFS during
the peri-implantation period could lead to increased synthesis of PGF2a which may lead
to high PGF2o:PGE2 ratio not favoring implantation. Understanding the mechanisms that
control the maintenance of pregnancy and viability of the conceptus during the peri-
implantation period should provide insight into causes of embryo loss that occur during
this time.
It is hypothesized that OTR, PGHS-2 and PGFS mRNA are downregulated
whereas PGES is upregulated in the endometrium and chorioallantois during the peri-

61
implantation period. Such a response should lead to less chances of luteolysis and
increase embryo survival. The objectives of this study were to characterize the expression
of OTR, PGHS-2, PGES and PGFS in bovine caruncular and intercaruncular
endometrium as well as the chorioallantois during the estrous cycle and the peri-
implantation period.
Materials and Methods
Animals
Tissues were collected from multiparous Brahman-Angus crossbred cows (n = 4
each day) on day 0 (estrus), 3, 7, 14 and 18 of the estrous cycle and at days 7, 14, 18,22,
30,40 and 50 of pregnancy (n = 4 to 5 cows each day). Estrus was induced with PGF2a
(25 mg, i.m, Lutalyse®, Pharmacia & Upjohn, Kalamazoo, MI). Cows were exposed to a
fertile bull with a chin ball marker, and also bred at estrus by artificial insemination to
enhance pregnancy rates. Cows were slaughtered and tissues collected from animals
processed through the University of Florida Animal Science abattoir. For cows less than
30 days of pregnancy, pregnancy was confirmed by observation of a conceptus or embryo
after flushing the uterine horns with physiological saline. For cows at 40 or 50 days,
pregnancy was confirmed using ultrasound. Endometrial samples were collected from
the uterine horn ipsilateral to the CL and care was taken to separate the caruncular from
the intercaruncular endometrium. The chorioallantois was collected from cows which
were at least 30 days pregnant. Tissues were snap-frozen in liquid nitrogen and then
stored at -80°C until RNA extraction.

62
RNA Extraction
Total RNA was isolated from the caruncular and intercaruncular endometrium as
well as the chorioallantois using Trizol reagent (InVitrogen, Carlsbad, CA) following the
manufacturers instructions. After extraction, the RNA pellet was re-suspended in 75 pi
pre-warmed (60°C) RNAsecure ™ Resuspension solution (Ambion, Austin, TX), and the
resultant RNA suspension heated at 60°C for 10 min to remove contaminating RNAse. A
DNA-free1M kit (Ambion) was used to remove contaminating genomic DNA from the
RNA samples. Briefly, 0.1 volume of 10X DNase I buffer (100 mM Tris-Cl, pH 7.5, 25
mM MgCh, 1 mM CaCli ) and 1 pi DNAse I, RNAse free (2 units/pl) were added to the
RNA suspension. The RNA samples were then mixed gently and incubated at 37°C for
30 min. At end of incubation, 0.1 volume (7.5 pi) of DNase Inactivation Reagent from
the DNA-free kit was added and the contents were mixed and incubated at 24°C for 2
min. The mixture was centrifuged at 10,000 x g for 1 min to pellet the DNase
Inactivation Reagent. Treated RNA samples were recovered and their concentrations
determined using a spectrophotometer at 260 nm. The quality of the RNA samples was
assessed by the integrity of 28S and 18S ribosomal RNA after electrophoresis of 10 pg
total RNA. The RNA samples were stored at -80°C until analysis.
Validation of the Relative Quantitation of OTR. PGES. PGFS mRNA and 18S rRNA
The A ACt method for relative gene quantitation is based on the following
principle. The threshold cycle Cj indicates the fractional cycle number at which the
amount of amplified target reaches a fixed threshold. The mean Cr (Threshold) values of
replicate runs for the target gene are determined. The difference (ACT) between the mean
Ct values of the target gene and the endogenous control (18S rRNA) is calculated. Then

63
A ACt is the difference between ACT and the Ct value of the calibrator. The amount of
target (OTR, PGHS-2, PGES, PGFS) normalized to endogenous reference (18S rRNA)
and relative to the calibrator is determined by the formula, relative concentration of target
mRNA = 2"aact. Intercaruncular endometrial RNA sample from a cow in estrus was
chosen in which the OTR and PGHS-2 transcripts were believed to be highly expressed
(calibrator sample). For PGES and PGFS, the calibrator was total RNA from
intercaruncular endometrium from a cow at day 15 of pregnancy.
In order to use the A A Ct method for relative quantitation of mRNA expression
for the respective genes, a validation study was conducted to demonstrate that the
efficiencies of amplification for the OTR, PGHS-2, PGES and PGFS genes (target
amplification) and 18S rRNA (reference amplification) are approximately equal. In order
for the efficiencies of amplification for the two genes to be equal, the absolute value of
the slope of log input amount of RNA versus ACt should be less than 0.1 (Applied
Biosystems user Bulletin #2) or the slopes of the dilution curves for the specific target
gene and that for 18S rRNA should be approximately equal. The validation study also
provided information on the concentration of total RNA to be used during PCR for all the
genes and 18S rRNA. For OTR gene expression, serial dilutions of total RNA were
conducted from 200 ng to 1.56 ng (Appendix B), 200 pg to 1.56 pg for 18S rRNA
(Appendix C), 800 ng to 1.56 ng for PGHS-2 (Appendix D), and 400 ng to 1.56 ng for
PGES and PGFS (Appendices E and F). Amplification plots for OTR (Fig. 4-1), 18S
rRNA (Fig. 4-2), PGHS-2 (Fig. 4-5), PGES (Fig. 4-7) and PGFS (Fig 4-9) were
constructed. Threshold cycle (Ct) values were plotted against log concentration and the
slope was determined. The slope (-3.4) for the standard curve of the OTR gene (Fig. 4-3),

64
-3.3 for PGHS-2 (Fig. 4-6), -3.1 for PGES (Fig. 4-8) and -3.3 for PGFS (Fig. 4-10) were
comparable to that of 18S rRNA (-3.5, Fig. 4-4). The values obtained confirmed the
validity of the A A Or method for determining relative abundance of the genes studied.
PCR Primers and Probes
Primers were designed by Assay by Design, Applied Biosystems (Foster City, CA) and
are shown in Table 4-1.
Table 4-1. Sequences of primers and probes used for RT-PCR.
mRNA
Primer sequence/Probe (P)
Forward (F) Reverse (R)
Amplicon
size (bases)
Reference
OTR
GGCCTACATCACGTGGATCAC (F)
66
Bathgate et al.
(1995)
AGCAGGTGGCAAGGACGAT (R)
ACGGGCACAATGTA (P)
PGHS-2
CGTGAAGCCCTATGAATCATTTG (F)
66
Liu et al. (1999)
CTTCTAACTCTGCAGCCATTTCCT (R)
TCTCTCCTGTAAGTTCC (P)
PGES
GGAACGACCCAGATGTGGAA (F)
85
Filion et al.
(2001)
ACAAAGCCCAGGAACAGGAA (R)
6FAMCCTCAGAGCCCACCGGMGBNF (P)
PGFS
CAAGCCTGGGAAGGACTTCTT (F)
78
Suzuki et al.
(1999)
CAGGTATCCACGAAATCTTTCTCA (R)
6FAMAGGACGGCAACGTGATMGBNFQ (P)
PCR Protocol
The PCR mastermix consisted of 25 pi of 2X ThermoScript Reaction mix
Platinum Quantitative RT-PCR ThemoScript One-Step system (InVitrogen). Primers,
20X (2.5 pi, 900 nM) and probes (2.5 pi, 250 nM) were obtained from Applied

65
Biosystems, Customer Set ID OTR-cDNA-OTRl, COX-2-cDNA-COXa, PGES-cDNA-
GESd, PGFS-cDNA-GFSb, TaqMan probes (antisense sequence) used FAM as reporter
dye and a minor groove binding non-fluorescent quencher dye (MGB-NFQ). Primers for
18S rRNA (2.5 pi, 900 nM each) and TaqMan probe (2.5 pi, 250 nM, eukaryotic 18S
rRNA MGB endogenous control) were obtained from Applied Biosystems. The probe
uses VIC as reporter dye and MGB-NFQ as a quencher. ThermoScript plus/Platinum Taq
enzyme mix (1 pi, Platinum Quantitative, RT-PCR ThermoScript One-Step System) was
obtained from InVitrogen. Autoclaved distilled water (11.5 pi) was added to the above
components to give a final volume of 50 pi per reaction tube. Total RNA (200 ng) was
used for OTR, PGHS-2, PGES and PGFS gene expression analysis, and 200 pg total
RNA per reaction for thel8S rRNA gene. For inter and intra-assay control, total RNA
from caruncular endometrium from a cow in estrus was used for OTR and PGHS-2
genes, whereas intercaruncular endometrium from a cow at day 15 of pregnancy was
used for PGES and PGFS. All samples were run in triplicate. A set of two reactions for
no-template controls (NTC) for both the target gene and 18S rRNA were included. The
NTC consisted of 10 pi water. The individual genes (OTR, PGHS-2, PGES, and PGFS)
and 18S rRNA gene expression RT-PCR were conducted on the same sample plate.
Procedure
All reagents were kept on ice. In each assay, the master mixture for either OTR,
PGHS-2 and 18S rRNA or, PGES, PGFS and 18S rRNA were added to the wells first,
followed by deionized double-distilled water, primers and probe. The Taq polymerase
was added last. Autoclaved double distilled water was then added to the NTC wells and
these wells capped with optical caps (Applied Biosystems) prior to addition of RNA to

66
the rest of the wells. The well contents were vortexed briefly and transported on ice to
the Interdisciplinary Center for Biotechnology Research (ICBR) Protein Core Laboratory.
The plate was centrifuged briefly to bring down the well contents before it was loaded
into a GeneAmp 5700 for one-step Real Time PCR.
Thermal Cycler Protocol
Reverse transcription reaction for first strand cDNA synthesis was conducted at
50°C for 30 min. Inactivation of reverse transcriptase, denaturation of RNA/DNA and
activation of Taq DNA polymerase were conducted at 95°C for 5 min. Amplification was
achieved with 40 cycles at 95°C for 15 sec (extension) and 60°C for 1 min (annealing).
Run time was 2 h 19 min.
Analysis of Results From Gene AMP 5700
Data from the GeneAmp 5700 runs were entered into the GeneAmp 5700 SDS
software program to determine Ct values (threshold cycle) and amplification plots. The
data for Cy values for OTR, PGHS-2, PGES, PGFS and 18S rRNA and calibrator sample
were used to determine the relative quantity of the individual genes using the A A Cr
method. Results were expressed as arbitrary units relative to the calibrator sample and
normalized against 18S rRNA.
Immunohistochemical Localization for OTR and PGHS-2
Caruncular and intercaruncular endometrium were dissected separately. Tissues
were fixed in 4% (w/v) paraformaldehyde in phosphate buffered saline (pH 7.5) for 24 h.
Following fixation, tissues were dehydrated in ethanol and embedded in paraffin. Tissue
sections were cut at 4 pm thickness and mounted onto Superfrost charged microscopic
slides (Fisher, Pittsburg, PA). Sections were deparaffinized and hydrated in a series of

67
graded alcohols: xylene 1 (5 rain), xylene 2 (5 min), 100% ethanol for 2 min (x 2), 3%
hydrogen peroxide in methanol to block endogenous peroxidases (10 rain), 95% ethanol
(2 min), 70% ethanol (1 min), and water (2 min).
Antigen retrieval was used to unmask antigenic OTR and PGHS-2 sites. Briefly,
slides were boiled at 100° C for 20 min in EDTA buffer (pH 8.0) for OTR and 0.01 M
citric acid buffer for PGHS-2 (Richard Allan Scientific, Kalamazoo, MI). Slides were
kept in Tris buffer (IX) until blocking serum was added. Sections were incubated at 24°C
for 20 min in Avidin-Biotin blocking reagent containing goat serum to block nonspecific
binding. The primary mouse monoclonal antibody against human OTR (anti-OTR 2F8,
was a kind donation from Dr. T. Kimura, Osaka University Medical School, Osaka,
Japan) (Takemura et al., 1994), was shown to react with bovine OTR (Fuchs et al.,
1996a). Antiserum was added to the sections at a dilution of 1:50 and incubation
conducted at room temperature (24°C) for 1 h.
For PGHS-2 immunostaining, the primary polyclonal antibody (PG 27b human
anti-PGHS-2, Oxford Biomedical Research, Oxford, MI) was used at a dilution of 1:100.
Secondary biotinylated antibody in the ABC Vectastain kit (Vector Laboratories Inc,
Burlingame, CA) was added and sections incubated at 24°C for 30 min followed by
Vectastain ABC reagent for 30 min. Diaminobenzidine-tetrahydrochloride (DAB)
reagent was then applied to the tissue sections for 3 min. Excess DAB was washed away
by placing the slides in distilled water. Counterstaining was conducted for 1.5 min using
hematoxylin (Richard Allan Scientific). Sections were rinsed in running water for 30 sec
and clarified with a clarifier (Richard Allan Scientific). Sections were then dehydrated
using a series of graded ethanol from 70%, 95%, 100% (x 2) and xylene (15 dips in each

68
solution). Sections were sealed with Richard Allan Scientific mounting medium and
cover slips. Sections were viewed under a Zeiss Axioplan II microscope to detect for
specific immunostaining for OTR or PGHS-2 antigen. Photomicrographs were taken at
200X magnification. For OTR, negative controls included sections from the same tissue
with antibody dilution buffer substituting for the primary antibody; whereas for PGHS-2
preimmune rabbit serum (PG 27c, Oxford Biochemical Research) at a dilution of 1:100
was substituted for primary antibody.
Statistical Analysis
Data were analyzed using the Statistical Analysis System (SAS) software version
8 (SAS Institute, Cary, NC). Group means of OTR, PGHS-2, PGES and PGFS mRNA
by tissue and day of pregnancy or cycle were computed. Data with unequal error
variances were log-transformed for data analysis. The model consisted of concentration
of OTR, PGHS-2, PGES and PGFS mRNA as the dependent variables and status (cyclic
or pregnant), tissue (caruncular, intercaruncular endometrium and chorioallantois), day of
cycle/pregnancy, status x tissue, status x day, tissue x day, status x tissue x day as
independent variables. Significance of differences between group means by status, type
of tissue and day of pregnancy or cycle were tested using ANOVA. Orthogonal contrasts
were conducted for the effects of status, day and tissue. Differences in means were
considered statistically significant at P < 0.05. Simple and partial correlations were
conducted to determine the relationships between the different genes. Transformed data
are presented as least squares means ± SEM.

Fig. 4-1. Amplification plot showing serial dilutions of total RNA used in the validation to quantitate OTR mRNA.
Rn (normalized reporter) = fluorescent emission intensity of the reporter dye divided by the fluorescent
emission intensity of the passive reference dye.

0.001
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39
Cycle Number

Fig. 4-2. Amplification plot showing serial dilutions of total RNA used in the validation to quantitate 18S rRNA.

0.001
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39
Cycle Number

Fig 4-3. Standard curve for estimation of efficiency of amplification of the OTR gene for validation of A A Ct method.

29
28
27
26
25
24
23
22
21
20
35842
8.3591c
-0.996I
Standard Curve
0.8 1.2 1.6 2 2.4
Log CO
-J
4^

Fig. 4-4. Standard curve for estimation of efficiency of amplification of 18S rRNA gene for validation of A A Ct method.

29
28
27
26
25
24
23
22
21
20
J5842
B.35913
-0.996C
Standard Curve
Í
§
Í
K *
+
t
*
*
0.4 0.8 1.2 1.6 2 2.4
Log CO
-J
ON

Fig. 4-5. Amplification plot showing serial dilutions of total RNA used in the validation to quantitate PGHS-2 mRNA.

10
0.01
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39
Cycle Number
0.001

Fig. 4-6. Standard curve for estimation of efficiency of amplification of PGHS-2 gene for validation of A A Cj method.

c
t
34
32
30
28
26
24
0 0.4 0.8 1.2 1.6 2 2.4 2.8 3.2
Log CO
Standard Curve
$
Í
l
1
*
*
H
*
*
Slope: -3.216199
Intercept: 33.979012
Correlation: -0.997429

Fig. 4-7. Amplification plot showing serial dilutions of total RNA used in the validation to quantitate PGES rnRNA.

10
0.01
0.001
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39
Cycle Number

Fig. 4-8. Standard curve for estimation of efficiency of amplification of PGES gene for validation of A A Cj method.

35
34
33
32
31
30
29
28
27
)7788
5.30007
-0.9982
Standard Curve
i
0.4 0.8
1.2 1.6
Log CO
2.4 2.8
oo

Fig. 4-9. Amplification plot showing serial dilutions of total RNA used in the validation to quantitate PGFS mRNA.

10
1
%.1
n
0.01
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39
Cycle Number
oo
ON
0.001

Fig. 4-10. Standard curve for estimation of efficiency of amplification of PGFS gene for validation of A A Cj method.

27
26
25
24
23
22
21
20
19
18
X)591
6.87077
-0.9991
Standard Curve
*
£
i
'
+
*
*
*
£
0.4 0.8 1.2 1.6 2 2.4 2.8
Log CO
oo
oo

89
Results
Expression of OTR. PGHS-2. PGES and PGFS mRNA in Intercaruncular Endometrium
of Cvciic-Pregnant Cows from Days 7 tol8.
A significant difference was observed between day 14 and 18 for OTR mRNA as
shown by orthogonal contrasts (P < 0.05) (Table 4-2). There was a significant status
(cyclic-pregnant) by day 14 versus day 18 interaction (P < 0.05). The mRNA for OTR
increased from day 14 to day 18 in cyclic cows but remained low in pregnant cows. The
status by day 14-18 interaction is shown in Fig. 4-11.
A status by day interaction (P < 0.01) was detected for PGHS-2 mRNA (Table 4-
2). In both cyclic and pregnant cows, PGHS-2 mRNA increased on days 14 and 18, but
the increase was appreciably greater in pregnant cows (Table 4-2 and Fig. 4-12). For
PGES mRNA significant status by day interactions (P < 0.05 and P < 0.01) were detected
(Table 4-2). In particular, PGES mRNA increased appreciably on day 18 for cyclic cows
but did not change for pregnant cows (Table 4-2). The change in PGES mRNA
associated with pregnancy reflects an attenuation in contrast to a stimulation for PGHS-2
mRNA. A more complex pattern of change was detected for PGFS mRNA (Table 4-2).
The mean expression of PGFS mRNA on day 7 was higher than for days 14-18 for both
cyclic and pregnant cows (P < 0.01). The expression declined by day 14 in cyclic cows
but was more sustained in pregnant cows at day 14 followed by a decrease on day 18
(Table 4-2).

90
Table 4-2. Least squares means for OTR, PGHS-2, PGES and PGFS mRNA in
intercarancular endometrium of beef cows from day (D) 7 to D18 of the
estrous cycle or pregnancy.
Cyclic Pregnant Contrasts
Response
D7
D14
D18
D7
D14
D18
SEM
Cl
C2
C3
Clx
C2
Clx
C3
OTR
0.07
0.02
0.80
0.04
0.04
0.06
0.24
NS
NS
*
NS
*
PGHS-2
0.82
8.89
6.94
0.53
11.14
15.66
3.05
NS
**
NS
**
NS
PGES
0.75
0.93
6.30
1.51
1.72
2.87
1.59
NS
*
**
*
**
PGFS
2.41
1.16
1.83
2.37
1.98
1.06
0.47
NS
**
NS
.»
NS
** P < 0.01, * P < 0.05,t P < 0.1, NS = not significant.
“Cl = Cycle vs Pregnant; C2 =D7 vsD 14,18; C3 = D 14 vs D 18
Fig. 4-11. Oxytocin receptor mRNA concentrations in intercaruncular endometrium of
beef cows: cyclic-pregnant interaction by Day 14 - 18 (P < 0.05); Data
represent least squares means ± SEM.

91
Day of Cycle or Pregnancy
Fig. 4-12. Prostaglandin G/H Synthase-2 mRNA concentrations in intercaruncular
endometrium of beef cows: cyclic-pregnant interaction by Day 7 vs D14,18
(P < 0.01); Data represent least squares means ± SEM.
Expression of OTR. PGHS-2, PGES and PGFS in Intercaruncular Endometrium during
the Estrous Cycle and Pregnancy
The mean expression of OTR mRNA during estrus (DO) was significantly higher
than that on days 3, 7, 14 and 18 (P < 0.01) (Table 4-3). Similarly, expression at D3 was
decreased but higher than the average of D 7 and 14 (P < 0.01). Expression of OTR
mRNA increased again at proestrus on D18 (P < 0.05).
The PGHS-2 mRNA increased in the intercaruncular endometrium on days 14
and 18 compared to the earlier stages of the cycle (P < 0.01; Table 4-3). Expression of
PGES mRNA was highest during estrus (DO) and proestrus (D18) compared to the early

92
and mid-luteal stages of the estrous cycle (i.e. days 3, 7 and 14; Table 4-3). In contrast,
PGFS mRNA was low at estrus and increased in the mid-luteal (i.e. days 7 and 14) and
proestrus (day 18) stages of the estrous cycle (P < 0.01; Table 4-3).
Table 4-3. Least squares means for OTR, PGHS-2, PGES and PGFS mRNA in
intercaruncular endometrium of beef cows from days 0 to 18 of the estrous
cycle.
Response
Days of the Estrous Cycle
SEM
Contrasts a
DO
D3
D7
D14
D18
Cl
C2
C3
C4
OTR
1.07
0.33
0.05
0.03
0.47
0.2
♦♦
NS
*
PGHS-2
0.73
0.50
0.67
10.0
10.8
2.2
*
*,
**
NS
PGES
7.01
2.49
1.13
1.27
4.59
1.1
**
NS
*
**
PGFS
0.56
0.40
2.39
1.51
1.44
0.33
*
**
**
NS
** P < 0.01, * P < 0.05,1P < 0.1, NS = not significant.
aCl= D 0 vs 3, 7,14 and 18;C2 = D3 vsD7, 14, 18; C3 =D7 vs D14 and 18;C4 = D 14
vs D18.
The regression curves for OTR expression in the intercaruncular endometrium in
pregnant cows showed an initial low expression which steadily increased from days 30 to
50 of pregnancy (Fig. 4-13 A). There was an increase in PGHS-2 expression on days 14
to 18 followed by a decrease as pregnancy advanced to day 50, whereas for PGES there
was a slight increase from days 18 to 50 of pregnancy (Fig. 4-13B). The temporal
expression of OTR mRNA in intercaruncular endometrium from days 7 to 50 of
pregnancy showed an increase in expression after day 30 (Table 4-4). Expression of
PGHS-2 mRNA increased from days 14 to 22 followed by a decrease from days 30 to 50
of pregnancy (Table 4-4).

93
The concentration for PGES mRNA was highest on day 22 and then decreased
from day 30 to 40. An increase was observed on day 50. Expression of PGFS mRNA was
highest on day 7 and was followed by a decrease until day 50 of pregnancy (Table 4-4)
Table 4-4. Least squares means for OTR, PGHS-2, PGES and PGFS mRNA in
intercaruncular endometrium of beef cows from days 7 to 50 of pregnancy.
Response
Days of Pregnancy
SEM
Contrasts a
D7
D14
D18
D22
D30
D40
D50
Cl
C2
C3
C4
C5
C6
OTR
0.04
0.04
0.06
0.06
0.24
0.48
0.39
0.05
**
**
**
*
NS
NS
PGHS-2
0.53
11.1
15.6
13.2
8.83
6.13
2.79
2.97
**
NS
NS
t
NS
NS
PGES
1.51
1.72
2.87
4.64
3.93
3.77
4.71
0.88
**
**
NS
NS
NS
NS
PGFS
2.36
1.98
1.06
0.98
0.86
0.58
0.48
0.24
**
t
NS
NS
NS
NS
** P < 0.01, * P < 0.05, ^ P < 0.1, NS = not significant.
aCl=D7 vs D 14-50; C2 = D 14 vs D 18 - 50; C3 = D 18 vs D 22 - 50; C4 = D22 vs
D 30 - 50; C5 = D 30 vs D 40 - 50; C6 = D 40 vs D 50.
In the chorioallantois, expression of OTR, PGHS-2, PGES and PGFS did not
differ between days 30, 40 and 50 (Table 4-5). A slight difference in OTR mRNA
expression was detected with average expression being greater for day 40 than day 30.
However, this is rather a subtle difference and overall expression was low.

mRNA (Arbitrary units)
94
A
Fig. 4-13. Regression curves for OTR (• mRNA x 101), PGFS (■) (Panel A); and
PGHS-2 (■), PGES (•) (Panel B) mRNA expression in intercaruncular
endometrium of beef cows from days 7 to 50 of pregnancy. Data represent
least squares means.

95
Table 4-5. Least squares means for OTR, PGHS-2, PGES and PGFS mRNA in
chorioallantois of beef cows from days 30 to 50 of pregnancy.
Response
Days of Pregnancy
SEM
Contrasts a
D30
D40
D50
Cl
C2
OTR
0.003
0.009
0.001
0.003
♦
NS
PGHS-2
31.4
45.4
25.3
18.1
NS
NS
PGES
5.46
3.68
3.50
1.85
NS
NS
PGFS
1.28
1.08
2.61
0.81
NS
NS
** P < 0.01, * P < 0.05,f P < 0.1, NS = not significant. “ Cl= D 30 vs 40, 50; C2 = D 40
vs D 50.
Expression of OTR and PGHS-2 mRNA in Caruncular Endometrium
Results comparing cyclic and pregnant cows from days 7 to 18 are shown in
Table 4-6. In cyclic animals, OTR mRNA was expressed highly on day 18 of the cycle
but this amplification in expression was blocked or did not occur in pregnant cows (P <
0.1). Presence of the conceptas had an inhibitory effect on the expression of OTR mRNA
in the caruncular endometrium. This lead to the observed status by D14 versus D18
interaction (P < 0.05), that is depicted in Fig. 4-14 A.
Expression of PGHS-2 mRNA increased from day 7 to days 14-18 (P < 0.01) for
both cyclic and pregnant cows. However, the average increase for days 14 and 18 was
greater for pregnant cows than for cyclic cows (P < 0.01). These changes are depicted in
Figure 4-14 B and are due to a sustained increase in PGHS-2 mRNA expression in
pregnancy. However, the status x day 14-18 interaction was not significant.

96
Table 4-6. Least squares means for OTR and PGHS-2 mRNA in caruncular endometrium
of beef cows from days 7 to 18 of the estrous cycle or pregnancy.
Cyclic Pregnant Contrasts “
Response D7 D14 D18 D7 D14 D18 SEM Cl C2 C3 Clx
C2
OTR
0.12
0.06
1.18
0.03
0.04
0.10
0.26
t
NS
*
NS
*
PGHS-2
2.64
17.5
11.0
0.62
14.1
23.6
4.4
NS
**
NS
**
NS
** P < 0.01, * P < 0.05,+ P < 0.1, NS = not significant.
aCl = Cycle vs Pregnant; C2 = D 7 vs D 14, 18; C3 = D 14 vs D 18.
In the caruncular endometrium of cyclic cows, OTR mRNA was significantly
higher on DO and D 18 versus the early luteal and mid-luteal days of the estrous cycle
(days 3, 7 and 14; Table 4-7). No differences were observed between D7 versus D14 and
18. These changes paralleled the response for intercaruncular endometrium (Table 4-3).
As reported for intercaruncular endometrium (Table 4-3), PGHS-2 mRNA increased
dramatically on days 14 and 18 (P < 0.01) and was low at estrus (Table 4-7).
Table 4-7. Least squares means for OTR and PGHS-2 mRNA in caruncular
endometrium of beef cows from days 7 to 18 of the estrous cycle.
Days of the Estrous Cycle
Contrasts
:a
Response
DO D3
D7
D14
D18
SEM
Cl
C2
C3
C4
OTR
1.24 0.30
0.07
0.05
0.64
0.23
**
t
NS
*
PGHS-2
0.77 1.77
1.52
15.8
17.3
4.0
**
**
**
NS
** P < 0.01, * P < 0.05,f P < 0.1, NS = not significant.
aCl= D 0 vs 3, 7 and 18; C2 = D 3 vs D 7, 14, 18;C3 = D 7 vsD 14 and 18; C4 = D 14
vsD18.
p n

PGHS-2 mRNA OTR mRNA
(Arbitrary units relative to 18S rNA) (Arbitrary units relative to1 8S rRNA)
97
Day of Cycle or Pregnancy
Fig. 4-14. OTR and PGHS-2 mRNA concentrations in caruncular endometrium of beef
cows: A) Cyclic-Pregnant by Day 14-18 interaction (P < 0.05) for OTR and
(B) Day 7-14 (P < 0.01) for PGHS-2; Data represents least squares means ±
SEM relative concentration to 18S rRNA.

98
When examining the temporal expression of OTR mRNA of caruncular
endometrium throughout pregnancy from day 7 to day 50, OTR mRNA expression
increased after day 18 (P < 0.01; Table 4-8). The dynamic but distinct changes in OTR
mRNA and PGHS-2 mRNA expression are reflected by regression curves during the
estrous cycle (Fig. 4-15A and B).
A transitional pattern (P < 0.01) in PGHS-2 mRNA expression was detected with
an increase in caruncular expression from day 7 to day 14 -22, followed by a decrease in
expression during the period of 30 to 50 days of pregnancy (Table 4-8). This temporal
pattern is reflected by the curvilinear regression depicted in Fig. 4-16 for PGHS-2. There
was an increase in PGHS-2 mRNA from days 7 to 18 and followed later by a decrease as
pregnancy advanced.
Table 4-8. Least squares means for OTR, PGHS-2, PGES and PGFS mRNA in
caruncular endometrium of beef cows from days 7 to 50 of pregnancy.
Days of Pregnancy
Contrastsa
Response
D7
D14
D18
D22
D30
D40
D50
SEM Cl
C2 C3
C4
C5
C6
OTR
0.03
0.04
0.10
0.15
0.24
0.50
0.27
0.04 **
** **
t
NS
NS
PGHS-2
0.62
14.1
23.6
15.0
9.6
8.0
2.0
4.3 **
** **
t
NS
NS
** P < 0.01, * P < 0.05,+ P < 0.1, NS = not significant.
aCl=D7 vs D 14-50; C2=D 14vsD 18-50; C3=D 18 vs D 22 -50; C4 = D22 vs
D 30 - 50; C5 = D 30 vs D 40 - 50; C6 = D 40 vs D 50.

PGHS-2 mRNA OTR mRNA
(Arbitrary units) (Arbitrary units)
99
25
20
15
10
5
0
0 3 7 14 18
Day of Cycle
Fig. 4-15. (A) Regression curve for OTR and B) PGHS-2 mRNA
expression in caruncular endometrium of beef cows from days 0
(estrus) to 18 of the estrous cycle. Data represent least squares
means.

100
£
60
E
3
50
(0
40
i—
!q
30
i—
<
20
<
10
z
a:
0
Fig. 4-16. Regression curves for OTR (•; mRNA x 10 2) and PGHS-2 (■)
mRNA in caruncular endometrium of beef cows from days 7 to 50 of
pregnancy. Data represent least squares means.
Correlations between the different mRNAs
During the estrous cycle OTR mRNA and PGES mRNA in intercaruncular
endometrium were positively correlated and this relationship was evident after adjusting
for days of the estrous cycle (Table 4-9). Thus they are positively associated during
periods of elevated expression or reduced expression. In contrast, positive correlations for
OTR/PGFS and PGES/PGFS were only detected after adjusting for day of the estrous
cycle (Table 4-9). This indicates a co-regulated expression that does not appear to be
responsive to stages of the estrous cycle where expression of one or the other is
amplified.
Across days (7, 14 and 18) of pregnancy or the estrous cycle, a positive
correlation was observed between OTR and PGES whether calculated as a simple
correlation (Table 4-10) or as a partial correlation (Table 4-10). This result is indicative
of joint co-expression of OTR mRNA and PGES mRNA and co-regulation in response to
physiological and/or hormone function associated with day and pregnancy status (cycle
versus pregnancy). Partial correlations, but not simple correlations, were significant for

101
OTR/PGFS and PGES/PGFS (Table 4-10). These responses imply a co-regulated
expression that is only dependent on day of cycle or pregnancy.
Table 4-9. Correlations between mRNAs for OTR, PGES, PGHS-2 and PGFS in
intercaruncular endometrium of beef cows on days 0, 3, 7, 14 and 18 of the
estrous cycle.
Simple Correlations
Partial Correlations a
r
P
r
P
OTR/PGES
0.81
<0.0001
0.78
0.0003
OTR/PGFS
-0.08
0.73
0.46
0.069
OTR/PGHS-2
-0.17
0.46
-0.03
0.92
PGHS-2/PGES
-0.03
0.89
-0.03
0.91
PGHS-2/PGFS
0.04
0.86
-0.30
0.25
PGES/PGFS
0.13
0.58
0.58
0.02
a Correlations adjusted for day of cycle.
Table 4-10. Correlations between mRNAs for OTR, PGES, PGHS-2 and PGFS in
intercaruncular endometrium of beef cows on days 7, 14 and 18 of the
estrous cycle or pregnancy.
Simnle Correlations
Partial Correlations a
r P
r P
OTR/PGES
0.94
<0.0001
0.96
<0.0001
OTR/PGFS
0.36
0.09
0.47
0.05
OTR/PGHS-2
-0.06
0.78
0.01
0.96
PGHS-2/PGES
0.16
0.44
0.02
0.93
PGHS-2/PGFS
-0.29
0.17
0.23
0.35
PGES/PGFS
0.25
0.24
0.44
0.06
Correlations adjusted for both day and pregnancy status.

102
Immunohistochemical Localization of OTR and PGHS-2 During the Estrous Cycle and
Pregnancy
Immunohistochemistry was used to identify the expression of OTR protein (Fig.
4-17 and 4-18) and PGHS-2 protein (Fig. 4-19 and 4-20) in the intercaruncular
endometrium of cyclic (days 0, 3, 7, 14 and 18) and pregnant cows (days 7, 14, 18,40
and 50). Uterine sections from day 0 (estrus cows) showed intense positive
immunostaining for OTR protein (Fig. 4-17A) compared to control sections where no
primary antibody had been added (Fig. 4-17B). Intense staining for immunoreactive
OTR was localized primarily in the luminal epithelium (LE) with less staining in the
epithelium of superficial glands (GE). No staining was observed in the stroma. The little
staining that was observed on days 3 and 7 was localized in the LE (Fig. 4-17 C and D).
Intense positive staining was observed in the LE on day 14 (Fig. 4-17E). In day 18 cyclic
cows, immunoreactive OTR was observed in the LE and GE although the intensity of
staining was less than that observed at estrus. During pregnancy, no positive
immunostaining for OTR protein was observed on days 7, 14,18,40 and 50 (Fig. 4-18).
For PGHS-2, uterine sections from cows on days 0 (estrus), 14 and 18 showed
intense positive staining for immunoreactive PGHS-2 protein, and the staining was
localized in the luminal epithelial cells and superficial glandular epithelium (Fig. 4-19 A).
The intensity of positive staining for PGHS-2 protein was low in the luminal epithelium
of cows on days 3 and 7 (Fig. 4-19 C and D) with no positive staining observed in the
glandular epithelium as well as the stroma. During pregnancy, no positive staining for
PGHS-2 protein was seen in the luminal epithelium on days 7 (Fig. 4-20 A) and 14 (Fig.
4-20 B) whereas there was increased positive staining for PGHS-2 protein on days 18

103
(Fig. 4-20C) and 22 (Fig. 4-20 D). Positive immunostaining was also observed in day 40
cows but in this case it was predominantly in the luminal epithelium (Fig. 4-20 D).
Positive staining observed in day 50 cows (Fig. 4-20 E) was less intense than that seen on
days 14,18 and 22.
There was not sufficient replication of the immunohistochemical responses (i.e.
one cow per physiological stage) to quantify temporal and spatial differences in OTR and
PGHS-2 protein associated with pregnancy status or days characterized. Flowever, the
responses depicted for expression support the quantitative changes determined for
expression of OTR mRNA and PGHS-2 mRNA.

Fig. 4-17. Immunohistochemical staining of bovine OTR in representative sections of the intercaruncular endometrium during the
estrous cycle. Tissues were collected, fixed, sectioned and stained as described in Materials and Methods. A (day 0 = estrus), B = day
0 negative control, C (day 3), D (day 7), E (day 14) and F (day 18). LE = luminal epithelium, GE = glandular epithelium, SE = stroma.
Arrows indicate positive (brown) immunostaining for the OTR protein. Photomicrographs were taken at 200X magnification.

105

Fig. 4-18. Immunohistochemical staining of bovine OTR in representative sections of the intercaruncular endometrium during the
peri-implantation period. Tissues were collected, fixed and stained as described in Materials and Methods. A (day 7), B (day 14),
C (day 18), D (day 40) and E (day 50). LE = luminal epithelium, GE = glandular epithelium, SE = stroma. Arrows indicate
positive (brown) immunostaining for the OTR protein. Photomicrographs were taken at 200X magnification.

107

Fig. 4-19. Immunohistochemical staining of bovine PGHS-2 in representative sections of the intercaruncular endometrium during the
estrous cycle. Tissues were collected, fixed, sectioned and stained as described in Materials and Methods. A (day 0 = estrus), B = day
0 negative control, C (day 3), D (day 7), E (day 14) and F (day 18). LE = luminal epithelium, GE = glandular epithelium, SE = stroma
Arrows indicate positive (brown) immunostaining for the PGHS-2 protein. Photomicrographs were taken at 200X magnification.

109

Fig. 4-20. Immunohistochemical staining of bovine PGHS-2 in representative sections of the intercaruncular endometrium during the
peri-implantation period. Tissues were collected, fixed, sectioned and stained as described in Materials and Methods. A (day 7), B
(day 14), C (day 18), D (day 22), E (day 40) and F (day 50). LE = luminal epithelium, GE = glandular epithelium, SE = stroma.
Arrows indicate positive (brown) immunostaining for the PGHS-2 protein. Photomicrographs were taken at 200X magnification.

Ill

112
Discussion
Oxytocin receptor mRNA is relatively sparse in bovine tissues but has been
measured by RNAse protection assays (RPA) and RT-PCR (Ivell et al., 1995; Fuchs et
al., 1996a). Using RPA, Ivell et al. (1995) observed high expression of OTR in
endometrium at estrus and low expression on day 7 of the cycle in cows. In the present
study the highest expression of OTR mRNA was observed at estrus and day 18 of the
estrous cycle. No significant difference was observed in the expression of OTR mRNA
between these intervening days of the luteal phase. Animals in the day 18 group were in
proestrus and would account for expression being the same as day of estrus. Oxytocin
receptors were highly expressed during estrus at a time when there are high
concentrations of plasma estradiol and endometrial estrogen receptors. Oxytocin
receptors seem to be constitutively expressed in the bovine endometrium and become
upregulated especially during estrus and at parturition (Fuchs et al., 1990; Horn et al.,
1998).
However, the role of estradiol in stimulating OTR upregulation in cattle has not
been proven. Although there are half-estrogen response elements in the bovine OTR, they
are not responsive to estrogen (Bale and Dorsa, 1997). Indirect effects of estradiol on the
OTR may be a possibility, via protein-protein interactions with transcription factors and
modulation of the activity of upstream signaling components on the OTR (Sanchez et al.,
2002). It has been shown in vitro that liganded ERa binds the ovine OTR via Spl and
AP-1 transcription factors (Bazer et al., 2003). For the bovine OTR, the cofactors, steroid
receptor coactivator activator (SRC) and CREB binding protein (CBP) were shown to

113
induce OTR reporter activity in vitro when stimulated by estradiol (Telgmann et al.,
2003).
The lowest expression for OTR mRNA was observed during the luteal phase,
especially on days 7 and 14 of the estrous cycle which is in agreement with those of
Robinson et al. (2001) for OTR mRNA and with others who used OT binding (i.e. protein
binding) studies to evaluate OTR expression in the bovine endometrium (Meyer et al.,
1988; Fuchs et al., 1990; Jenner et al., 1991; Mann and Lamming, 1994; Cerbito et al.,
1997). Oxytocin receptor mRNA concentrations were lowest on days 7 and 14 and
highest on days 17 and 21. Similarly, a study conducted in sheep showed that OTR
mRNA expression was highest in the endometrium at estrus compared to days 2, 7 and 12
of the cycle (Feng et al., 2000).
Our results differ from those of Robinson et al. (2001) in that they detected no
OTR mRNA between days 6 and 16 of the estrous cycle and early pregnancy. The
difference may be due to the sensitivity of Real Time RT-PCR which is more sensitive
than the in situ hybridization used by Robinson et al. (2001). Oxytocin receptor mRNA
became upregulated after day 15 of the cycle. This is the day concentrations of
progesterone start to decline in cyclic cows and may act as a signal for upregulation of
OTR (Robinson et al., 2001). Mann et al. (1996) reported that OTR upregulation occurs
at 16 days after estrus at a time when a fall in progesterone and a rise in estradiol have
not yet occurred.
Expression of OTR mRNA was low from days 7 to 18 of pregnancy, which may
be due to suppression by progesterone acting via progesterone receptors that are in high
concentrations in the stroma at this time (Robinson et al., 1999). Progesterone has been

114
shown to suppress OTR in ovariectomized cows (Lamming and Mann, 1995) and sheep
(Vallet et al, 1990; Wathes et al., 1996). However, these actions may be non-genomic
since there is no progesterone response element on the bovine OTR (Bathgate et al.,
1995). The inhibition of OTR mRNA expression may also be due to the action of IFN-t
(Lamming et al., 1995). The present study also revealed that by day 30 of pregnancy, the
OTR mRNA expression had started to increase which may be due to decreased secretion
of IFN-t. This means that the OTR begins to be re-established after the period of
maternal recognition of pregnancy. Upregulation of OTR mRNA in both the caruncular
and intercaruncular endometrium was detected earlier than day 50 whereas as others have
reported that OTR mRNA and OT-binding in intercaruncular endometrium begin to be
upregulated by day 50 of pregnancy (Fuchs et al. 1990,1992; Ivell et al., 1995). This early
detection of the OTR mRNA may be due to the sensitivity of the Real Time RT PCR
technique used for quantitation. However, these results differ from those of Fuchs et al.
(2003) who reported that OTR were not expressed in the caruncular endometrium of peri-
implantation cows. Oxytocin also preferentially stimulates synthesis of PGF2a in
epithelial cells from intercaruncular rather than caruncular areas both in vitro (Asselin et
al., 1998) and in vivo (Pexton et al., 1975). In the present study, no difference was
observed in the expression of OTR mRNA between the caruncular and intercaruncular
endometrium.
Balaguer et al. (2000) reported an increased response to OT-induced PGF2a with
resultant increases in PGFM from days 20 to 50 of pregnancy. However, Gross et al.
(1988b) did not observe increased PGF2„ in endometrium from day 17 pregnant cows
when they were treated with OT. The difference in these results may be due to the fact

115
that they were done on different days and under different conditions (in vivo vs in vitro).
However, the relatively low expression of OTR mRNA observed in the present study
would tend to suggest that the OTR may not be functionally coupled to the prostaglandin
synthesis in early pregnancy through day 50. The low levels of OTR mRNA in the
caruncular and intercaruncular endometrium from days 14 to 22 of pregnancy are
believed to be due to the suppressive effect of IFN-x that is produced by the conceptos.
Interferon-T has been shown to inhibit expression of OTR in vivo (Spencer and
Bazer, 1996) and in vitro (Horn et al., 1998; Leung et al., 2001). Interferon-T
downregulates endometrial OTR mRNA by interfering with the endocrine loop by which
OT stimulates PGF2„ secretion from the endometrium (Ivell et ah, 2000). Interferon-T is
believed to act via the interferon type 1 receptor to suppress OTR expression (Robinson
et ah, 2001). Bovine OTR has interferon response elements which can bind IFN-t
(Bathgate et ah, 1998). A putative interferon responsive element (IRE) approximately -
2400 from the transcription site of the bovine OTR has been shown to bind mouse
interferon response factor 1 (IRF1) and IRF2. Bovine IRF1 and IRF2 are also expressed
in a temporal pattern suggesting the role of IFN-t in the regulation of OTR expression
during the peri-implantation period (Telgmann et ah, 2003). Oxytocin receptor mRNA
expression in pregnant animals is suppressed by the presence of the embryo, and this
inhibition has been shown to be independent of a prior decrease in uterine estrogen
receptor expression or maintenance of progesterone receptor expression (Robinson et ah,
1999). The subtle increase in expression of OTR mRNA observed between day 40 and 50
of pregnancy may be due to reduced secretion of IFN-t. This means that once IFN-t
secretion wanes, there is resumption of expression of OTR mRNA, and after day 50 the

116
OTRs are coupled to the prostaglandin synthesis mechanism (Fuchs et al., 1996b). The
inhibitory effect of IFN-r on OTR mRNA expression is a direct effect on the OTR gene
itself (Horn et ah, 1998).
The chorioallantois was found to express OTR mRNA although at a significantly
lower level (P < 0.01) than observed in the caruncular and intercaruncular endometrium.
Fuchs et ah (1992) and Ivell et ah (1995) reported low concentrations of OTR in the
chorioallantois of pregnant cows. In the present study, OTR mRNA expression was
detected in the chorioallantois as early as day 30 of pregnancy. The significance of OTR
mRNA expression in the chorioallantois at this time is not clear. Fuchs et ah (2003)
suggested that OT may have a role in angiogenesis and promotion of growth of the
embryo or fetus. Expression of OTR also has been reported in human vascular
endothelial cells isolated from the umbilical vein (Thibonnier et ah, 1999) where it was
implicated in cellular proliferation. This effect of OT to stimulate cell proliferation via
OTR probably occurs by increasing intracellular calcium uptake, tyrosine
phosphorylation and activation of the PKC pathway (Fuchs et ah, 2003).
Immunohistochemical localization of OTR using a specific anti-OTR antibody
revealed that OTR was primarily localized to the luminal epithelium of the
intercaruncular endometrium and glandular epithelium. Very little if any OTR was
localized in the stroma. This is expected since OT-induced PGF2„ occurs predominantly
in the luminal endometrial epithelial cells (Fortier et ah, 1988). These results are similar
to those of others who reported immunostaining in the luminal endometrial and glandular
epithelium of prepubertal heifers with no immunolocalization in the stroma (Bathgate et
ah, 1995; Fuchs et ah, 1996a, b). Intense staining for OTR protein was observed at estrus

117
which was also the time of highest OTR mRNA expression. Wathes and Lamming (1995)
reported that at the onset of luteolysis, OTR first appeared in the luminal epithelium,
increased in the superficial glands during luteolysis and were present in the caruncular
stroma and deep glands at estrus. This may explain the positive immunostaining observed
in the GE at estrus whereas on other days of the cycle, the immunoreactivity was barely
detected. Thus there appears to be stage specific days (temporal) and spatial expression
(tissue type) for OTR protein.
In pregnant cows, immunoreactive OTR was not detected during the days
examined in this study. This may be a reflection of the low levels of OTR mRNA
expression during early pregnancy which indicates that the OTR is regulated at the
transcriptional level in the endometrium. There is also the possibility that the sensitivity
of method used for detection of the OTR protein was low. Ivell et al. (2000) reported that
few immunopositive stained cells occur in the luminal epithelium in pregnant cows,
although immunoreactivity increases towards term. In conclusion, bovine OTR mRNA
and protein were expressed highest during proestrus and estrus at a time when luteolysis
is occurring. The increase in OTR expression at this time is believed to enhance the
process of luteolysis whereby OT stimulates PGF2„ synthesis from the endometrium and
causes structural regression of the CL. However, during the peri-implantation period,
OTR mRNA was expressed at very low levels, which may be due to inhibition by
progesterone and IFN-x at the time of maternal recognition of pregnancy. As pregnancy
advances there is an increase in OTR mRNA believed to be due to reduced inhibition by
IFN-x. Absence of detectable OTR protein during the peri-implantation period is a
reflection that the OTR is inhibited and may be translationally regulated.

118
In both the caruncular and intercaruncular endometrium, PGHS-2 mRNA was
expressed at low levels on days 0 (estrus), 3 and 7 and at high levels on days 14 and 18 of
the cycle. Our results support those of Arosh et al. (2002) who reported low expression
of PGHS-2 mRNA and protein in endometrium taken from abattoir samples between
days 1 and 12 and high levels between days 13 and 21 of the cycle. Highest expression of
PGHS-2 occurs at the time of expected luteolysis (days 16 - 17) of the cycle in cows. A
biphasic expression of PGHS-2 mRNA was observed in this study similar to the findings
of Arosh et al. (2002), an indication that PGHS-2 is an inducible enzyme in bovine
endometrium. Increased synthesis of PGHS-2 starting at day 14 is necessary for initiation
of luteolysis.
In vivo (Fuchs et al., 1996b; Bums et al., 1997) and in vitro (Asselin et al., 1997b;
Xiao et al., 1999) studies show that OT induces PGHS-2 mRNA and protein. The
increase in PGHS-2 mRNA in cows beginning on days 14 and 18 is due partly to
increased secretion of OT. Furthermore an increase in PGHS-2 was reported to occur
around luteolysis (Charpigny et al., 1997). Increased PGHS-2 towards the end of the
cycle initiates pulses of PGF2„ which occur at intervals of 6 to 8 h during luteolysis
(Kindahl et al., 1981).
Expression of PGHS-2 mRNA in the caruncular endometrium was higher than in
the intercaruncular endometrium. This is similar to results from other studies which have
also shown that the caruncular endometrium expresses more PGHS-2 than the
intercaruncular endometrium (Huslig et al., 1979). Guilbault et al.(l 984) showed that
caruncular endometrial tissue from postpartum dairy cows synthesizes more PGF2„ and
PGFM than intercaruncular tissue. Asselin et al. (1998) however, showed in vitro that the

119
production of PGF2a was higher in the intercaruncular than in the caruncular
endometrium (Asselin et al., 1998). Whether high expression of PGHS-2 mRNA in the
caruncular endometrium would result in more PGF2a synthesis than by the
intercaruncular endometrium cannot be ascertained from this study.
In pregnant cows, there was low expression of PGHS-2 mRNA on day 7 of
pregnancy. Expression increased at day 14 and was highest on day 18, followed by a
decrease until day 50. Although PGHS-2 mRNA is upregulated during the time when
maternal recognition of pregnancy is expected to occur, this does not translate into
secretion of pulsatile PGF2a that can lead to luteolysis as occurs in cyclic cows.
Guzeloglu et al. (2003) reported high expression of PGHS-2 protein in endometrium of
day 17 pregnant cows. Charpigny et al. (1997) observed high and transient expression of
PGHS-2 in ovine endometrium during early pregnancy at the time of maternal
recognition of pregnancy. Perhaps the inability to secretion of PGF2a peaks is the
suppression of OTR such that the PGF2a synthesis system is not coupled to OTR. Asselin
et al. (1997c) reported that roIFN-r stimulates PGE2 and upregulates the expression of
PGHS-2 mRNA in both bovine endometrial stromal and epithelial cells.
In vitro, IFN-t upregulates PGHS-2 in a dose dependent manner within the
physiological range in the vicinity of the conceptus (Asselin et al., 1997a). It has been
shown that most isoforms of rbIFN-x stimulate PGHS-2 mRNA and protein at a maximal
dose of 20 pg/ml (Parent et al., 2003a). In the presence of PMA, several isoforms of
IFN-x reduced PGF211 and PGE2 synthesis in bovine endometrial epithelial cells.
However, this effect was reversed at high concentrations of IFN-x for those isoforms that
induced PGE2 synthesis in the absence of PMA (Parent et al., 2003a).

120
It has been suggested that the mechanisms leading to stimulation or inhibition of
prostaglandin synthesis at the time of implantation may be mediated by different types or
state of IFN-r receptors (Parent et al., 2003a) and that the different isoforms of IFN-t
may have different affinities for the receptor. At low doses of IFN-t (< 1 pg) an
inhibition of both PGF2a and PGE2 were observed but at high doses (> 1 pg/ml)
production of PGE2 in epithelial cells and both prostaglandins was increased in the
stromal cells (Parent et al., 2003a). Thatcher et al. (2003b) reported that IFN-r alone
failed to induce PGES and PGHS-2 mRNA in BEND cells. In the presence of phorbol 12,
13-dibutyrate (PdBu), an activator of PKC and inducer of PGF2a, INF-r inhibited the
secretion of PGF2a. Interferon-r doses of < 1 pg /ml suppressed PdBu stimulated-PGF2a
and PGE2 in BEND cells. They attributed the failure of inhibition at higher doses to the
desensitization of IFN-r receptor. In the present study, PGES mRNA was reduced in
pregnant cows when compared to cyclic on days (14 to 18), which is the time when the
conceptus secretes the greatest amount of IFN-r. Moreover, after day 22 the PGES
mRNA concentrations also did not change much in pregnant cows. This result does not
support the results by Asselin et al. (1997c) but agrees with those of Thatcher et al.
(2003b) on the effect of IFN-r. It is important to note that in this study there was reduced
PGFS mRNA expression around the time of implantation. This reduction is expected to
lead to reduced synthesis of PGF2a by the endometrium and favor establishment of
pregnancy.
Xiao et al. (1998) reported that IFN-r inhibits synthesis of PGFS in bovine
endometrial epithelial cells. Asselin et al. (1998) observed no significant difference in the
level of prostaglandin synthesis between caruncular and intercaruncular epithelial cells

121
after IFN-r stimulation. However, the PGE2:PGF2c ratio was higher in the caruncular
region, an indication that PGE2 is preferentially modulated in the caruncles. Since these
are the points where the fetal membranes attach during implantation, they concluded that
the preferential secretion of PGE2 in these regions may play a role in establishment of
pregnancy. Inhibition of OT-induced PGF21, from the endometrium by IFN-r in cattle is
via downregulation of the OTR. This may be via a mechanism independent of the OTR
as demonstrated in BEND cells, which directly inhibits PKC-regulated PGF2„ production,
PGHS-2 and PLA2 expression (Binelli et ah, 2000).
In the present study we observed increased expression of PGHS-2 during the
period of maternal recognition of pregnancy. The significance of this increase may be
that PGHS-2 could be involved in other mechanisms that enhance implantation. During
the estrous cycle, PGES mRNA was elevated on days 18 and estrus but was reduced on
corresponding days of pregnancy. The increase in endometrial PGES mRNA may play a
role at the time of ovulation and increased uterine blood flow. The expression of PGHS-2
mRNA in the chorioallantois was higher than that observed in the caruncular and
intercaruncular endometrium. This may suggest that the conceptus membranes may be a
major source of prostaglandins during the peri-implantation period. The bovine placenta
consists of two types of cells, the uninucleate principal cells and the binucleate cells
(Wooding, 1984). Fetal placental principal cells are the primary source for prostaglandin
synthesis in the form of PGF2„, while the binucleate cells secrete PGE2 (Gross and
Williams, 1988). The binucleate cells differentiate during the period of implantation
(Bjorkman, 1968). Towards parturition there is a decrease in the number of binucleate
cells which leads to a possible shift in synthesis from PGE2 to PGF2„ (Gross et ah, 1985).

122
Increased expression of PGHS-2 in the chorioallantois may also be due to stimulation
from the amniotic fluids. In pigs (Robertson et al., 1985) and humans (Shatz et ah, 1987),
fetal urine and amniotic fluids have been shown to contain estrogens which stimulate
PGF2„ synthesis during late gestation.
Immunohistochemistry showed that during the estrous cycle, PGHS-2 protein was
primarily localized to the luminal epithelial cells of the intercaruncular and caruncular
endometrium. The most superficial glands showed some staining, especially in
endometrium of days 14 and 18 and to a lesser extent at estrus. These results are similar
to those reported in the ovine endometrium where staining was observed in the luminal
epithelial cells and glands close to the uterine lumen but no staining was observed in the
deep glands, stroma and myometrium (Charpigny et ah, 1977). Smith et ah (1980)
reported increased PGHS-2 immunostaining in caruncular endometrium of sheep on days
13 to 15. Arosh et ah (2002), using Western blotting, reported a significant correlation
between PGHS-2 mRNA and protein in bovine endometrium. However, Thatcher et ah
(2003a) did not observe a positive correlation at day 17 of pregnancy between PGHS-2
mRNA and protein. The PGHS-2 mRNA and protein were expressed at low levels
between days 1 to 12 and high levels from days 12 to 21. A similar pattern was found in
this study using Real Time PCR coupled with immunohistochemistry with high
expression of PGHS-2 protein observed in the intercaruncular endometrium on days 14
and 18 and low to no staining on days 3 and 7. The stroma was immuno-negative to
PGHS-2 staining at all stages of the cycle.
In pregnant cows, PGHS-2 protein was localized to the luminal epithelial cells
and to a lesser extent the superficial glands. Results from this study also show that

123
PGHS-2 protein was low on comparable days of pregnancy and the cycle. However, no
staining was detected in day 14 pregnant cows. Positive immunostaining was observed in
luminal and glandular epithelium on days 18 and 23 of pregnancy, but was less intense on
days 40 and 50. The PGHS-2 mRNA paralleled the expression of PGHS-2 protein.
Similarly in ovine pregnancy PGHS-2 protein was also localized to luminal epithelial
cells and was undetectable or at low levels in endometrial stroma and glands (Gibb et al.,
2000).
It can be concluded that PGHS-2 mRNA is expressed highest around the time of
luteolysis during the estrous cycle and at low levels during the other days of the cycle.
During pregnancy, PGHS-2 was expressed highest around the period of maternal
recognition of pregnancy. Since peaks for PGF2a at this time are blocked, but there is
increased basal PGF2a secretion (Williams et ah, 1983; Mishra et ah, 2003) the increased
PGHS-2 mRNA expression at this time may be involved in events favoring implantation
instead of luteolysis. The absence of luteolytic peaks is due probably to a decrease in
OTR. It also suggests that IFN-x does not act by decreasing PGHS-2 mRNA.
Expression of the PGES mRNA has been reported in the bovine uterus during the
estrous cycle (Arosh et ah, 2002). In other bovine tissues, PGES has been reported to be
expressed highest in seminal vesicular glands and preovulatory follicles, moderate to high
expression in the stomach, intestine, pituitary and liver (Filion et ah, 2001). In bovine
ovarian follicles, regulation of PGES is under the stimulation of LH and expression is
highest in the granulosa cells with little expression in the theca intema cells (Filion et ah,
2001). Expression of PGES in the follicles was shown to parallel that of PGHS-2,
suggesting that the enzymes may be co-regulated (Filion et ah, 2001).

124
In vitro studies have shown that PGES mRNA expression is increased or induced
by pro-inflammatory cytokines like the ones that induce PGHS-2. Such factors as IFN-r,
TNFa and LPS stimulate PGHS-2 synthesis (Jakobsson et al., 1999b; Thoren and
Jakobsson, 2000; Mancini et ah, 2001; Murakami et ah, 2001; Parent et ah, 2002).
Although IFN-t is considered the primary secretory product that controls maternal
recognition of pregnancy (Parent et ah, 2002), PGE2 may have a luteotrophic role in
ruminants (Pratt et ah, 1977; Magness et ah, 1981). For successful establishment of
pregnancy, the ratio of PGE2:PGF2a at the time of implantation may be more important
than the absolute quantity of each hormone (Parent et ah, 2002).
The PGES may have a role in implantation since embryos from several animals
including the mouse (Mashbum et ah, 1990), rabbit (Kasamo et ah, 1986) and cow
(Lewis et ah, 1982) can convert arachidonic acid to PGE2. High expression of PGES
mRNA was observed on day 18 and estrus, followed by moderate expression on day 3
and the lowest expression was observed on day 7 of the estrous cycle. Although
expression of PGES mRNA on day 14 was numerically higher than on day 7, the
difference was not significant. These results are similar to those of Arosh et ah (2002)
who reported that PGES mRNA expression was moderate from days 1 - 3, low from days
4-12 and high from days 13-21 of the cycle. Arosh et ah (2002) reported co¬
expression of PGHS-2 mRNA and PGES mRNA at high levels from days 13-21 of the
cycle. In the present study PGHS-2 mRNA was highly expressed on days 14 to 18 of the
cycle, whereas PGES mRNA was highly expressed on day 18 and estrus. This increase in
PGES expression at estrus may be constitutive in anticipation of impending ovulatory

125
response and release of the ovulatory follicle or is necessary for increased blood flow to
the uterus.
Although PGES and PGHS-2 mRNA were expressed highly at estrus and day 18
of the cycle, both partial and simple correlations revealed no positive correlation between
the two enzymes. However, other reports indicate that induction of PGHS-2 and PGES
mRNA are linked and may be co-regulated in follicles (Sirois, 1994; Liu et al., 1997; Liu
and Sirois, 1998; Filion et ah, 2001) and in the bovine endometrium (Arosh et ah, 2002).
The PGES mRNA was highly correlated with OTR mRNA across all stages of the estrous
cycle and after adjusting for stage of the cycle. Thus OTR mRNA expression may be
coupled with PGES mRNA expression and serve some role in the periovulatory period as
well as being co-regulated. The OTR and PGFS mRNA were correlated but not amplified
in association hormonal or physiological changes during the estrous cycle.
In vivo, the LH surge in cows occurs at the beginning of estrus (Liu et ah, 1997;
Jo et ah, 2002). Filion et ah (2001) showed that the level of ovarian PGES mRNA was
low at 0 h and increased significantly 18 - 24 h after onset of estrus. Results from the
present study suggest that endometrial PGES mRNA is also expressed highest at the time
of the LH surge.
The observed decrease in PGES mRNA expression from days 3 to 7 of the cycle
agrees with the findings reported by Arosh et ah (2002). Low expression of PGES mRNA
observed in the present study occurred at the time of low expression of OTR mRNA.
Such a result suggests co-expression of the two genes. During pregnancy, there was
reduced expression of PGES mRNA from day 14 to 18 followed by a slight increase in
expression from days 22 to 50. Day 14 is the approximate time when the embryo begins

126
producing IFN-x and this observed decrease in PGES mRNA expression may result from
IFN-t.
The expression of PGHS-2 mRNA in both the caruncular and intercaruncular
endometrium was high from days 14 to 22 of pregnancy. Asselin et al. (1997c) showed
that PGE2 and PGHS-2 can be stimulated by IFN-x in bovine endometrial cells. Secretion
of PGE2 was also increased by roIFN-x in both bovine endometrial stromal and epithelial
cells to the extent that in epithelial cells the primary prostaglandin produced was changed
from PGF2u to PGE2 (Asselin et al., 1996; 1997a). However, the observed increase in
PGE2 could have been due to the dose of IFN-x or contamination of IFN-x with LPS
(Xiao et al., 1998). Parent et al. (2002) showed that in bovine endometrial stromal cells,
PGES mRNA expression was increased in the presence of LPS, TNFa and IFN-x and that
there was also a simultaneous increase in PGHS-2 expression. In the present study,
PGES mRNA did not increase around the period of maternal recognition of pregnancy,
which does not support the earlier results from in vitro studies.
Oxytocin is involved in the regulation of PGES synthesis. Asselin et al. (1997b)
showed that OT stimulated PGE2 in endometrial epithelial cells via a PKC mediated
pathway. Expression of PGES has also been studied in vitro using BEND cells where it
was shown that IFN-x stimulated PGHS-2 and PGES after addition of PMA but not LPS,
agonists known to influence synthesis of prostaglandins (Parent et al., 2001). However,
those results differed from those utilizing primary endometrial epithelial cells in which
LPS stimulated PGES synthesis (Parent et al., 2001). In vitro studies have shown that
PGE2 is the main prostaglandin produced during delayed response in various cells
(Fournier et al., 1997; Matsumoto et al., 1997), and in vivo studies have shown that

127
production of PGE2 is affected profoundly by PGHS-2 inhibitors. This indicates that the
PGHS-2 pathway may be linked selectively to the terminal PGE2 via PGES (Jackobsson
etal. (1999a).
Two pathways involving the synthesis of PGES and PGE2 exist inside cells. One
involves the cPGES:cPLA2/PGHS-l/cPGES and the second involves
mPGES:cPLA2/PGHS-2/mPGES. The physiological role of cPGES may be to produce
PGES for homeostatic functions (Murakami et al., 2000). However, mPGES is
perinuclear, inducible and preferentially coupled to PGHS-2 and is involved in
production of PGE2 for delayed responses. It has been suggested that when PGHS-2 is
already present in the tissues, mPGES regulates the immediate synthesis of PGE2 which
may be due to a priming effect (Murakami et al., 2000). Coupling of mPGES to PGHS-2
and not PGHS-1 may be due to their subcellular location as well as their microdomains in
which PGES is closely located to PGHS-2 than to PGHS-1. The type of PGES
investigated in this study is mPGES, since the sequence used to design the primers and
probes was based on the mPGES that was found highly expressed in bovine granulosa
cells (Filion et al., 2001).
The PGES mRNA expression in the chorioallantois was comparable to the levels
expressed in the intercaruncular endometrium of pregnant cows after day 22. No
significant difference was observed in expression of PGES mRNA in the chorioallantois
among the days studied. It has been shown in sheep that PGES mRNA is expressed in the
ovine placenta from day 65 of gestation until term (Martin et al., 2002). The PGES
protein was localized in endothelial cells of maternal blood vessels in the plácenteme and
fetal uninucleate trophoblast cells where it may have the function of regulating placental

128
blood flow and endocrine functions (Martin et al., 2000). There is a possibility that PGES
could serve a similar function in the placenta of cows.
In conclusion during the estrous cycle endometrial PGES mRNA is highly
expressed during the late luteal phase and at estrus (day 0). It is possible the PGES gene
is upregulated in response to the process of ovulation. During pregnancy PGES mRNA
was not elevated around the period of maternal recognition of pregnancy.
During the estrous cycle, steady state levels of PGFS mRNA were low early in
the cycle and higher from the mid to late luteal phases of the cycle (days 7 to 18). These
results are similar to those of Madore et al. (2003) who reported low expression of PGFS
mRNA in bovine endometrium between days 1 to 6 of the estrous cycle and higher
expression in later stages of the cycle. In the present study, the highest expression was
observed on day 7 of the cycle, whereas Madore et al. (2003) reported highest expression
on days 10 tol2. The difference in the results between the present study and that by
Madore et al. (2003) could be due to the fact that we did not evaluate samples from days
10 to 12 of the estrous cycle. Also, their determination of the stage of the cycle was based
on ovarian appearance.
Estrogen and progesterone separately had no significant effect on PGFS mRNA
expression in isolated bovine endometrial epithelial cells (Xiao et al., 1998) but when
both steroids were present PGFS mRNA was upregulated. In that same study,
progesterone did not increase PGHS-2 or PGFS mRNA but stimulated increased PGF2o,
synthesis. This indicates that the effect of progesterone on PGF2a secretion is at the level
of translation, although a similar effect could be due to regulation of the substrate.

129
The type of PGFS that is expressed in the bovine endometrium has been reported
to have properties of 20a-hydroxysteroid dehydrogenase (20a-HSD) (Madore et al.,
2003). The 20a-HSD can convert progesterone to a biologically inert steroid,
20a-hydroxyprogesterone (Ishida et ah, 2003). The increase in PGFS mRNA observed
from days 7 to 15 of the cycle may be partly explained by its modulation by progesterone
in the endometrium. Progesterone peaks about day 12 of the estrous cycle and then
downregulates it own receptor (Robinson et ah, 2001). The decrease in PGFS mRNA
expression observed by day 15 may be due to the fact that PGFS and progesterone
interact in such a way that reduction of progesterone may lead to downregulation of
PGFS. Madore et ah (2003) reported that endometrial PGFS and progesterone were
highly correlated and were both simultaneously expressed during the estrous cycle. This
suggests that PGFS mRNA expression may be upregulated by progesterone. The
mechanism of PGFS downregulating its own receptor may be via the inactivation of
progesterone to its less active metabolite 20a-hydroxyprogesterone (Madore et ah, 2003).
Comparison of PGFS mRNA expression between pregnant and cyclic cows from
days 7 to 18 of the cycle or pregnancy were not different, with highest expression
observed on day 7. The lowest level of PGFS mRNA was at estrus when progesterone is
also low. In cyclic animals after day 15, there are low plasma progesterone
concentrations and increased production of estrogen by the preovulatory follicle. At this
time, there is also increased synthesis of estrogen receptors which stimulate development
of OTR. Pulses of OT in cows during the estrous cycle occur around day 18 (Kindahl et
ah, 1981). Oxytocin at this time is contributed mainly by the hypothalamus and the large
luteal cells (McCracken et ah, 1999). Oxytocin binds to OTR in the endometrial epithelial

130
cells initiating synthesis of PGHS-2 which is followed by an increase in PGH2.
Conversion of PGH2 to PGF2„ would necessitate increased synthesis of PGFS. The
increased synthesis of OT and OTR that is associated with reduction in progesterone
concentration probably explains the increased expression of PGFS mRNA observed on
day 18 of the cycle.
During pregnancy, there was a reduction in PGFS mRNA expression from days
14 to 50 of pregnancy. The significance of reduced PGFS mRNA expression during this
period may be a way to modulate the PGE2: PGF2„ ratio that is necessary for maintenance
of pregnancy. The reduction in PGFS mRNA is likely due to IFN-r produced by the
trophoblast between days 15 and 24 of gestation since this molecule prevents luteolysis
by suppressing endometrial PGF20 secretion (Meyer et al., 1996). During pregnancy, the
steady decline in PGFS mRNA expression following maternal recognition of pregnancy
and during the implantation period leads to inhibition of luteolytic pulses of PGF2a.
Recombinant blFN-r either alone or in the presence of estrogen and
progesterone inhibits induction of PGFS mRNA in vitro (Xiao et ah, 1998, 1999). This
supports our in vivo results in which we observed a decrease in mRNA expression of
PGFS during the peri-implantation period. The decrease in PGFS mRNA expression
observed in the present study during the peri-implantation period may be desirable for the
process of implantation, since it would lead to decreased PGF2a synthesis. Since there
was no change in PGES mRNA, this would result in no change in PGE2 concentrations,
an increase in the ratio of PGE2:PGF2a and hence improve chances of embryo survival.
Asselin and Fortier (2000) showed that PGFS mRNA expression is
downregulated in response to low doses of roIFN-T in bovine endometrial epithelial cells.

131
Under these conditions 1 ng/ml roIFN-x was able to inhibit PGF2a synthesis. In vivo the
concentrations of natural IFN- t would be higher than 1 ng/ml and would be expected to
inhibit PGFS synthesis. Although no significant difference in PGFS mRNA expression
across peri-implantation was observed in the chorioallantois, there was an increase at day
50 (P < 0.06). Wu et al. (2001) reported no change in PGFS mRNA expression in the
fetal placenta, although their study was conducted in sheep approaching parturition.
In conclusion, PGFS mRNA was expressed highest mid-cycle (day 7) and at
proestrus. There was low expression at estrus and in the early luteal phase. During
pregnancy, PGFS mRNA expression was reduced during the peri-implantation period, an
effect that was probably due to IFN-t.

CHAPTER 5
GENERAL DISCUSSION AND CONCLUSIONS
The major objective of this dissertation was to evaluate the changes in the
expression of the enzymes involved in prostaglandin synthesis and OTR during the
estrous cycle and the periods during and after maternal recognition of pregnancy. This
involved characterization of the expression of OTR, PGHS-2, PGES and PGFS mRNA in
the endometrium and chorioallantois of cows during the estrous cycle and pregnancy.
The early stages of pregnancy were compared to corresponding days of the estrous cycle.
Also evaluated was the potential source of OT (ovarian versus pituitary) that drives
PGFia synthesis during the peri-implantation period and whether the CL could respond
by releasing OT in response to PGFia. These studies were performed to address the
question whether the OT/OTR and prostanoid system are active during the peri-
implantation period. Increased secretion of PGF2„ and luteolysis due to an active
OT/OTR and prostaglandin synthesis system could be one of the mechanisms that
contribute to high embryo losses that occur during the peri-implantation period. This
would be possible in situations when an embryo/conceptus fails to elicit adequate
antiluteolytic signals during the period of implantation. In Chapter 3, an experiment was
conducted to determine whether PGF20 induces increased plasma concentrations of OT
on days 22 and 40 of pregnancy. Ovarian intact and bilaterally ovariectomized cows
were utilized to determine if the CL could serve as a source of OT.
132

133
Ovarian intact cows at day 22 of pregnancy were expected to contain an abundance of
OT-laden luteal secretory granules, whereas by day 40 the CL is expected to be depleted
of secretory granules (Fields and Fields, 1996; Salli et al., 2001).
In order to test this hypothesis, ovariectomized cows at day 22 of pregnancy were
injected with two sub-luteolytic doses of 25 pg PGF2a and one luteolytic dose of 25 mg
PGF20L in a series of three injections at 60 min intervals. Ovarian-intact cows at day 22
and 40 of pregnancy were treated with the same series of three injections of either PGF20
or saline. No OT response was observed in either the ovariectomized or ovarian intact
cows following the two sub-luteolytic doses of PGF21,. However, a significant increase
was observed in plasma OT in the ovarian intact cows after the luteolytic dose of PGF2o,
This means that the CL of peri-implantation cows is only capable of releasing OT in
response to PGF2a at a luteolytic dose of PGF2a. In several instances, non-significant
increases in OT concentrations after each injection were also observed even in
ovariectomized cows. This means that the OT was coming from a non-luteal such as the
neurohypophysis. In addition, several reports have indicated that preovulatory follicles
are also a source of OT in the cow (Schams et al., 1983; Voss and Fortune, 1991; Meidan
et al., 1992; Bemdtson et al., 1996). After the period of maternal recognition of
pregnancy when luteal concentrations of OT decline, the neurohypophysis may
contribute to plasma OT (Parkinson et al., 1992).
Comparison between saline and PGF2„-treated groups on day 22 showed an
increase in plasma OT concentrations in response to PGF2„. Although PGF2a can induce
release of OT on day 22 of pregnancy, the concentrations OTR in the endometrium at this
time are low (Fig. 5-2) and hence this may not augment luteolytic pulses of PGF2a and

134
result ¡n luteolysis. In day 40 ovarian intact cows, the response of OT to the luteolytic
dose of PGF2a and saline were not different, which means that the CL was not responsive
to PGF21, releasing OT. This means that OT granules were still present on day 22 of
pregnancy but by day 40 the concentration of luteal OT was very low (Fig 5-2). Nichols
et al. (2003) found no OT mRNA and protein in CL from day 40 pregnant cows, which
supports the results from the present study. The original hypothesis for this experiment
was that PGF2„ could cause release of OT form the CL and after binding to the OTR in
the endometrium could result in further release of PGF2„ from the uterus resulting in
luteolysis with termination of pregnancy. However, the results from this experiment do
not seem to support that hypothesis, since there is very little luteal OT in the CL by day
40 of pregnancy. Although a response was observed on day 22, OTR were downregulated
by IFN-i.
Cattle in this study were commercial Brahman x Angus that were not used to
intensive management. In instances where there was a response to saline that resulted in
elevation of OT, this may reflect a response by the animal to the stress of handling.
Stress leads to activation of p-receptors for catecholamines such as norepinephrine, which
stimulate secretion and release of OT (Kotwica et al., 2002). However, long-term stress
downregulates the luteal P-receptors due to sustained high concentrations of
catecholamines (Kotwica et al., 2002). Skarzynski et al. (2000a) showed that
norepinephrine stimulates PGF20-stimulated OT secretion from luteal cells. It had been
shown earlier (Fuchs et al., 1996b; Balaguer et al., 2000) that peri-implantation cows
show increased responsiveness to OT with advancing pregnancy indicating an active
OT-prostanoid system during this time. In some circumstances this could lead to

135
increased PGF2,, synthesis in the endometrium and increased luteolytic pulses that could
ultimately cause luteolysis and termination of pregnancy during the peri-implantation
period. This study showed that the CL is a possible source of OT that could contribute to
uterine secretion of PGF2a during early pregnancy. However, OTR are suppressed during
this time, so there would not be coupling of OT and OTR to the prostaglandin synthesis
pathway.
The second objective of this dissertation was to determine the changes in
expression of the mRNA of the enzymes that are involved in prostaglandin synthesis
during luteolysis and OTR. Oxytocin binds to OTR with resultant synthesis of PGF211
predominantly in the luminal epithelial cells and PGE2 in the stromal cells of the
endometrium (Desnoyers et al., 1994; Parent et al., 2003b) (Fig. 5-1). In Chapter 4,
changes in the expression of steady state concentrations of OTR, PGHS-2, PGES and
PGFS mRNA in the endometrium of cyclic non-pregnant beef cows were evaluated. The
highest expression of OTR mRNA was observed on day 18 of the cycle and at estrus
which is expected since this is the time when there are high estrogen concentrations and
stimulation of endometrial OTR which are involved in augmentation of luteolysis (Fig.
5-1). In vitro and in vivo studies have indicated that OT may have a modulatory role in
the luteolytic process by augmenting the PGF20 pulses that are involved in luteolysis
(Kotwica et al., 1997; 1998a). Immunohistochemical localization of OTR protein
followed a pattern which was close to that observed for the OTR mRNA. During the
estrous cycle OTR mRNA expression was highest during estrus and lowest during most
of the luteal phase. This low expression may be a result of inhibition by progesterone
(Lamming and Mann, 1995; Robinson et al., 1999) via a non-genomic pathway (Grazzini

136
et al., 1998; Picard, 1998; Bogacki et al., 2002). Estradiol does not have a direct effect on
the OTR in spite of the fact that there are half pallindromic ERE in the bovine OTR
(Bathgate et al., 1995; Ivell and Walther, 1999). However, it may stimulate the OTR via
non-genomic mechanisms i.e. binding transcription factors such as AP-1 and Spl or
cofactors (SRC and CBP) (Sanchez, et al., 2002; Bazer et al., 2003; Telgmann et al.,
2003)
The PGHS-2 mRNA was expressed at low levels during the early and mid-luteal
phases of the estrous cycle but at high levels in the late luteal phase. Increased
expression of PGHS-2 together with increased expression of OTR at this time would be
necessary for synthesis of PGF2a for induction of luteolysis (Fig. 5-1). The PGHS-2
protein was also expressed in a similar pattern with highest expression observed on days
14 and 18 of the cycle, a period when luteolysis is expected to occur. Similarly, staining
for the PGHS-2 protein was more intense on those days. Arosh et al. (2002) reported
similar findings when he used Western blotting to study expression of PGHS-2 protein in
cyclic cows.
The expression of PGES mRNA was highest on day 18 and day 0 (estrus).
Reduction in expression of PGES during the cycle coincided with the reduction in
expression of OTR mRNA. The positive partial and simple correlations between the OTR
and PGES indicate their expression is co-regulated (Table 4-9 and Table 4-10). The main
factor regulating ovarian PGES expression during the cycle is LH. Filion et al. (2001)
observed high expression of PGES in bovine follicles at the time of the LH surge.
Although endometrial PGES mRNA was expressed highest at the same time as that

137
reported for ovarian PGES, we cannot conclude from this study that they are under the
same regulation.
Expression of PGFS mRNA expression was low during estrus and the early luteal
phase. There was an increase during the mid-luteal phase (day 7), a decrease on day 14
and an elevation on day 18 (Fig 5-1). Prostaglandin F synthase is modulated by
progesterone and it has been suggested that PGFS can convert progesterone to its less
active metabolite (20a-hydroxyprogesterone) downregulating its own expression
(Madore et al., 2003). The increase in PGFS mRNA observed on day 18 of the estrous
cycle is probably due to the stimulation by estrogen from preovulatory follicles which
also stimulates development of endometrial OTR. Increased expression of OTR increases
endometrial responsiveness to OT which then stimulates synthesis of PGF1S-2 and PGFS
and ultimately leads to production of luteolytic PGF21,.
During the period of maternal recognition of pregnancy, OTR mRNA expression
was low in pregnant cows. Comparisons between cyclic and pregnant cows on days 7 to
18 showed that whereas OTR increased on day 18 of the cycle, they remained low in
pregnant cows. A significant status (cyclic-pregnant) by day interaction for OTR mRNA
expression was observed in the caruncular endometrium. Reduced expression of OTR in
pregnant cows may be due to IFN-x secreted by the conceptus. The bovine OTR has an
interferon response element which binds interferon response factor (IRF) and bovine
IRF1 and IRF2 which are expressed in a temporal manner during peri-implantation
suggesting that they are under the regulation of IFN-x (Telgmann et al., 2003).
The results from pregnant animals were surprising in that the highest expression
of PGHS-2 was observed on days 14, 18 and 22 of pregnancy, a period when maternal

138
recognition of pregnancy occurs in cows. This is also the same time when there are high
levels of IFN-x produced by the conceptus. This increased expression of PGHS-2 may
play a role in implantation and embryonic development. Expression of PGHS-2 protein is
increased in areas of the endometrium where attachment of the conceptus has not
occurred, but reduced at the sites of attachment in the hybrid syncytium (Emond et al.,
2003). This suggests that PGHS-2 may play an important role in adhesion of the embryo
during implantation.
In vitro studies have indicated that the ratio of PGE2 to PGF2a at the time of
maternal recognition of pregnancy may be important for sustained pregnancy (Parent et
al., 2002). If the PGE2 is higher then pregnancy continues but if more PGF2,, is produced
then the animal may be more at risk of losing the pregnancy. Similar to findings of
Arosh et al. (2002), PGHS-2 mRNA was also expressed at high levels simultaneously
with PGES mRNA. It has been suggested that the two enzymes may be co-regulated
(Filion et al., 2001; Parent et al., 2002). The highest staining for PGHS-2 protein was
observed on days 18 and 22 which reflected the pattern of mRNA and indicates that the
PGHS-2 may be transcriptionally and translationally regulated.
This study is the first to show expression of PGES mRNA in peri-implantation
cows and these results do not support those from in vitro studies conducted using
endometrial epithelial cells (Asselin et al., 1997a). The PGES mRNA decreased from day
14 which is about the time that the conceptus is beginning to secrete large quantities of
IFN-x. Parent et al. (2002) showed that IFN-x stimulated synthesis of PGES and PGHS-2
simultaneously and Asselin et al. (1996; 1997a) showed that IFN-x stimulates both PGE2
and PGF2C, simultaneously. Normally PGF201 is preferentially synthesized by the luminal

139
epithelial cells in the endometrium, whereas PGE2 is produced in the stroma (Fortier et
al., 1988; Asselin et al., 1996; Parent et al., 2003b). Although the exact function of
endometrial PGE2 in cattle has not been elucidated, it may stimulate secretion of growth
factors, regulation of immune response to prevent embryo rejection and rescue of the CL
(Pratt et al., 1977; Magness et al., 1981; Gimenez and Henricks, 1983; Thibodeaux et al.,
1992; Emond et al., 1998). Prostaglandin E2 is involved in angiogenesis during
implantation in domestic pigs and cattle (Keys et al., 1985; Emond et al., 1998).
An interesting pattern of PGFS mRNA expression was observed in the peri-
implantation period. There was a continuous reduction in expression of PGFS mRNA from
days 7 to 50. This is the first study that we are aware of to extensively assess the expression
of PGFS mRNA during the peri-implantation period. The explanation for decreased PGFS
mRNA expression is believed to be due to the effect of IFN-r that is produced by the
conceptas (Fig. 5-2). Most in vitro studies have shown that rbIFN-r alone and in the
presence of progesterone and estrogen inhibits PGFS synthesis (Xiao et al., 1998; 1999). At
the same time decreased PGFS synthesis during the peri-implantation period should result
in less PGH2 being available for conversion to PGF20. Perhaps this is one way in which the
ratio of PGE2 to PGF2„ is modulated to provide favorable conditions for maintenance of
pregnancy.
After the period of maternal recognition of pregnancy, from day 30 onwards, there was
an increase in expression of OTR mRNA in pregnant cows but at much lower concentrations
compared to cyclic cows (Fig. 5-2). This means the OTR system that is involved in prostaglandin
synthesis is resuming. This agrees with results of those studies which had shown increased
response to OT with advancing pregnancy. Fuchs et al. (1996b) had reported earlier that OTR are

140
already increased by day 50. The slight increase in OTR mRNA observed from days 30 to 50
may be due to the waning inhibitory effects of IFN-x. Fuchs et al. (2003) reported expression of
immunoreactive OTR and OTR mRNA in the cytotrophoblast at all stages of pregnancy,
although, the maternal cryptal cells did express the OTR at term. Furthermore, Fuchs et al.
(2003) reported immunostaining for OTR in the vasculature of caruncles, an indication that the
OT may be involved in angiogenesis. The lack of detectable OTR protein in the endometrium
from days 7 to 50 of pregnancy is believed to be due to the inhibition by IFN-r. Since OTR
mRNA was present in these animals, regulation of the OTR may be happening at the translation
level.
Endometrial OTR have been reported to increase throughout pregnancy starting at day 50
and reach a peak at parturition and labor (Fuchs et al, 1996b). In this study OTR were expressed
in the chorioallantois but at much lower levels than those observed in the caruncular and
intercaruncular endometrium. The significance of OTR in the chorioallantois at this time is not
clear, however, they may be involved in cell proliferation, angiogenesis and fetal growth
(Thibonnier et al., 1999; Fuchs et al., 2003). There was decreased expression of PGHS-2 mRNA
during later stages of the peri-implantation period, perhaps due to the effect of a long term high
progesterone environment and low expression of OTR in the endometrium. Expression of PGES
mRNA was unchanged from days 22 to 50 of pregnancy, however, there was a decrease in
PGHS-2 mRNA and PGFS mRNA over the same period. There was an increase in OTR from
days 30 to 50. The maximal OTR concentrations during this period were the same as those
observed on day 7 to 14 of the cycle. This means that although the OTR are increasing, the
concentrations are still too low to augment any luteolytic PGF2a pulses. Failure of release of OT
from the CL in the first study indicates that there would not be enough OT from the CL to

141
augment any OT-induced prostaglandin synthesis. This in combination with the decrease in
PGHS-2, PGFS and low OTR means the OTR are not coupled to the prostanoid synthesis
mechanism during this period, hence unlikely to lead to embryo loss.
Conclusions
The estrous cycle and peri-implantation period are associated with synthesis of
enzymes that stimulate secretion of prostaglandins. During the estrous cycle, OT is
released from the neurohypophysis and stimulates synthesis of PGF20. from the
endometrium which is transported to the ovary where it causes release of luteal OT which
augments pulses of PGFja leading to luteolysis (Flint et al., 1990). In pregnant animals
pulsatile PGF2„ has to be blocked in order for the pregnancy to be sustained. Embryo loss
may occur if the conceptus fails to initiate strong luteotrophic signals i.e. IFN-t. In this
study we showed that PGF2„ induces release of ovarian OT from early (day 22) but not
late (day 40) peri-implantation cows. However, this OT release was significant only if a
luteolytic dose of PGF2a (25 mg) was administered. It was also shown that besides the
ovary, the neurohypophysis could act as a source of OT probably as a result of stressing
the animals during injection and sample collection.
The release of luteal OT during the peri-implantation period may not be coupled
to the prostaglandin synthesis mechanism that would lead to luteolytic PGF2a pulses. This
is because OTR mRNA expression during the peri-implantation was low due to inhibition
by IFN-t. The IFN-t is secreted by the conceptus between days 12 to 25 and is maximal
around day 18 (Bartol et al., 1985). During the same period very low levels of OTR
mRNA were expressed. Thus it is unlikely that luteal OT at this time would be a
significant contributor to the process of embryo loss during the late peri-implantation

142
period. Results from the present study showing very low expression of OTR mRNA and
protein during the peri-implantation period do not support the original hypothesis that OT
and OTR drive prostaglandin synthesis leading to embryo loss during the peri-
implantation period.
During the estrous cycle, OTR mRNA and protein were expressed highest during estrus
and proestrus and low expression was observed during the early luteal and mid-luteal phases of
the cycle. In peri-implantation cows, OTR mRNA and protein were expressed at low levels with
a slight increase in OTR mRNA after day 30 of pregnancy. In the early stages of pregnancy, the
inhibition of OTR mRNA expression is due to progesterone and later IFN-t as the embryo
elongates. This effect wanes and the OTR system becomes re-established. The results from this
study support the hypothesis that the OTR become established after maternal recognition of
pregnancy. However, receptors are not coupled to PGF2a synthesis until after day 50 of
pregnancy as has been shown by Fuchs et al. (1996b).
Prostaglandin G/H synthase-2 is the rate limiting enzyme in the conversion of
arachidonic acid to PGF2„. The PGHS-2 mRNA and protein were expressed at high levels in the
late luteal phase and proestrus. After a period of progesterone dominance and then decline,
accumulation of arachidonic acid occurs in the endometrium and is hydrolyzed to PGH2 and
finally to prostaglandins. Towards the end of the estrous cycle estrogens enhance the
development of OTR and synthesis of PGHS-2 as well as PGFS (Fig. 5.1). Increased expression
of PGHS-2 mRNA during the period of maternal recognition of pregnancy as has been shown in
ovine endometrium (Charpigny et al., 1997) suggests that PGHS-2 may be important for
implantation. The importance of PGHS-2 has been shown in studies with mice whereby
inhibitors of PGHS-2 resulted in implantation failure (Reese et al., 2001).

143
Prostaglandin E synthase stimulates synthesis of PGE2 which is a potent
vasodilator. In cattle PGE2 plays a role in cervical relaxation (Fuchs et al., 2002) and in
ovulation (Filion et al., 2001). Expression of endometrial PGES mRNA was highest
during proestrus and estrus which were the same periods when OTR mRNA was highly
expressed implying OTR and PGES are co-regulated. The endometrial PGES may be
involved in the ovulatory process which is coincident with high expression of mPGES in
granulosa cells in the ovary (Filion et al., 2001). It may also be involved stimulation of
PGE2 that causes increased blood flow to the uterus. During the peri-implantation period,
endometrial PGES mRNA was not increased as we had expected which may suggest that
it may not have a major role in implantation in cattle. However, this needs further
investigation.
During the estrous cycle, PGFS mRNA was expressed highest in the late luteal
phase. Temporal expression of PGFS during the estrous cycle seemed to be under
regulation of progesterone and OT as suggested by Madore et al. (2003). However,
during pregnancy, PGFS mRNA was downregulated by IFN-t secreted by the conceptus
(Fig. 5.2).
The physiological status whereby PGHS-2 is increased during the time of
implantation and PGFS is decreased may be favorable for implantation. During this same
period, there is low expression of OTR mRNA and low levels of luteal OT. These
conditions should be favorable for embryo survival during the peri-implantation period
rather than embryo loss as we had hypothesized earlier. Taken together the results from
this research give us an understanding of the spatial and temporal expression of OTR as
well as the prostanoid synthesizing enzymes during the estrous cycle, period of maternal

144
recognition of pregnancy and late peri-implantation period. The results show the complex
relationship between the various enzymes, hormones and receptors that partly play
important roles in luteolysis and implantation. Finally a better understanding of the
regulatory role of these enzymes and receptors gives us further insight into successful
pregnancy establishment during the peri-implantation period and can serve a basis for
designing strategies to improve it. Further studies are needed to establish the roles of
PGHS-2 during the period of maternal recognition of pregnancy in cattle. It would also
be interesting to determine whether endometrial PGE2 is involved in ovulation during the
estrous cycle and whether it has any effect on the corpus luteum of pregnancy.
Hypothetical models for the regulation of expression of the components involved
in the synthesis of prostaglandins and OTR during the estrous cycle and peri-implantation
period are shown in Fig. 5-1 and Fig 5-2.

Fig. 5-1. Hypothetical model for the regulation of OTR, PGHS-2, PGES and PGFS expression during the estrous cycle.
Bars indicate approximate mRNA expression during the estrous cycle. Oxytocin receptor (OTR), Oxytocin (OT), Interferon-tau
receptor (IFNR), Interferon-tau (IFN-x), Luteinizing hormone (LH), Progesterone (P4), Estrogen (E2), Prostaglandin G/H synthase-2
(PGHS-2), Arachidonic acid (AA), Prostaglandin H2 (PGH2), Prostaglandin F2ot (PGF2a), Prostaglandin E2 (PGE2), Estrogen (E2),
Prostaglandin F synthase (PGFS), Prostaglandin E synthase (PGES) and Stromal (ST) cells.

D7
PGHS-2 _
I
D14
I
PGFS
D18 DO (Estrus)
I i
1
PGF,

Fig. 5-2. Hypothetical model for the regulation of OTR, PGHS-2, PGES and PGFS expression during the peri-implantation period.
Bars indicate approximate mRNA expression. Oxytocin receptor (OTR), Oxytocin (OT), Interferon-tau receptor (IFNR), Interferon-
tau (IFN-t), Luteinizing hormone (LH), Progesterone (P4), Estrogen (E2), Prostaglandin G/H synthase-2 (PGHS-2), Arachidonic acid
(AA), Prostaglandin H2 (PGH2), Prostaglandin F2a (PGF2a), Prostaglandin E2 (PGE2), Estrogen (E2), Prostaglandin F synthase (PGFS),
Prostaglandin E synthase (PGES) and Stromal (ST) cells.

D7 D14 D18 D22 D40
CL
LE OTR
(-)
â– 
AA
IFN-x
-É-
IFNR
PGHS-2
I
PGE,
PGH
ií
% PGF2,
PGHS-2
PGFS
PGES
OTR
ill.
1 1
1
â–  â– 
â–  â– 
â– 
â–  I
1 â– 
â– 
â–  I
r 1 â– 
PGF„
Epithelium
f
m
m
m
Ik PGF” ) sfe *
> L / si ,.) ,.) i I <+> i
A
P4
1
(+) ?
HI Brain
148

APPENDIX A
CONTRASTS FOR TREATMENT, PERIOD, TIME AND THEIR INTERACTIONS
Table A-l. Treatment contrasts
T1
T2
T3
T4
T5
Contrast 1
Treatment
PGF2a vs Saline
1
1
-1
-1
0
Contrast 2
Treatment
Day 22 vs Day 40
1
1
1
-1
0
Contrast 3
Treatment
Contrast 1 x Contrast 2
1
-1
-1
1
0
Contrast 4
Treatment
Sham vs Ovariectomized
-1
-1
-1
-1
4
Table A-2. Period Contrasts.
Period 1
Period 2
Period 3
Contrast 5
Period
Period 1,2 vs 3
-1
-1
2
Contrast 6
Period
Period 1 vs 2
1
-1
0
Table A-3. Contrasts for Treatment x Period interactions.
Contrast
1x5
-1
-1
2
-1
-1
2
1
1
-2
1
1
-2
0
0
0
Contrast
1 x 6
1
-1
0
1
-1
0
-1
1
0
-1
1
0
0
0
0
Contrast
2x5
-1
-1
2
1
1
-2
-1
-1
2
1
1
-2
0
0
0
Contrast
2x6
1
-1
0
-1
1
0
1
-1
0
-1
1
0
0
0
0
Contrast
3x5
-1
-1
2
1
1
-2
1
1
-2
-1
-1
2
0
0
0
Contrast
3x6
1
-1
0
-1
1
0
-1
1
0
1
-1
0
0
0
0
Contrast
4x5
1
1
-2
1
1
-2
1
1
-2
1
1
-2
-4
-4
8
Contrast
4x6
-1
1
0
-1
1
0
-1
1
0
-1
1
0
4
-4
0
149

150
Table A-4. Time contrasts. Time (min)
5
10
15
30
45
60
Contrast time 1 (7)
5
-1
-1
-1
-1
-1
Contrast time 2 (8)
0
4
-1
-1
-1
-1
Contrast time 3 (9)
0
0
3
-1
-1
-1
Contrast time 4 (10)
0
0
0
2
2
-1
Contrast time 5(11)
0
0
0
0
0
-1
Table A-5. Period * Time Contrasts.
Period* Time Interactions
Contrast
5x7
-5
1
1
1
1
1
-5
1
1
1
1
1
10
-2
-2
-2
-2
-2
Contrast
6x7
5
-1
-1
-1
-1
-1
-5
1
1
1
1
1
0
0
0
0
0
0
Contrast
5x8
0
-4
1
1
1
1
0
-4
1
1
1
1
0
8
-2
-2
-2
-2
Contrast
6x8
0
4
-1
-1
-1
-1
0
-4
1
1
1
1
0
0
0
0
0
0
Contrast
5x9
0
0
-3
1
1
1
0
0
-3
1
1
1
0
0
6
-2
-2
-2
Contrast
6x9
0
0
3
-1
-1
-1
0
0
-3
1
1
1
0
0
0
0
0
0
Contrast
5x 10
0
0
0
-2
1
1
0
0
0
-2
1
1
0
0
0
4
-2
-2
Contrast
6x 10
0
0
0
2
-1
-1
0
0
0
-2
1
1
0
0
0
0
0
0
Contrast
5x11
0
0
0
0
-1
1
0
0
0
0
-1
1
0
0
0
0
2
-2
Contrast
6x11
0
0
0
0
1
-1
0
0
0
0
-1
1
0
0
0
0
0
0

APPENDIX B
DATA FOR OTR mRNA EXPRESSION
Well
Type
Primer/Probe
Ct
StdDEV Ct
Qty (ng)
Mean Qty
StdDev
A1
STND
OTR
20.3
0.08
200.00
200.00
0.0
A2
STND
OTR
20.4
0.08
200.00
200.00
0.0
A3
STND
OTR
20.25
0.08
200.00
200.00
0.0
A4
STND
OTR
21.58
0.08
100.00
100.00
0.0
A5
STND
OTR
21.27
0.08
100.00
100.00
0.0
A6
STND
OTR
21.28
0.08
100.00
100.00
0.0
A7
STND
OTR
22.30
0.08
50.00
200.00
0.0
A8
STND
OTR
22.41
0.08
50.00
200.00
0.0
A9
STND
OTR
22.41
0.08
50.00
200.00
0.0
A10
STND
OTR
23.49
0.08
25.00
200.00
0.0
All
STND
OTR
23.68
0.08
25.00
200.00
0.0
A12
STND
OTR
23.71
0.08
25.00
200.00
0.0
B1
STND
OTR
25.12
0.08
12.50
200.00
0.0
B2
STND
OTR
24.46
0.08
12.50
200.00
0.0
B3
STND
OTR
24.51
0.08
12.50
200.00
0.0
B4
STND
OTR
25.35
0.08
6.25
200.00
0.0
B5
STND
OTR
25.60
0.08
6.25
200.00
0.0
B6
STND
OTR
25.49
0.08
6.25
200.00
0.0
B7
STND
OTR
26.24
0.08
3.13
200.00
0.0
B8
STND
OTR
26.42
0.08
3.13
200.00
0.0
B9
STND
OTR
26.35
0.08
3.13
200.00
0.0
BIO
STND
OTR
27.67
0.08
1.56
200.00
0.0
Bll
STND
OTR
27.87
0.08
1.56
200.00
0.0
B12
STND
OTR
28.11
0.08
1.56
200.00
0.0
151

APPENDIX C
DATA FOR 18S rRNA EXPRESSION
Well
Type
Primer/Probe
Ct
StdDEV Ct
Qty (pg)
Mean Qty(pg) StdDev
El
STND
18S
17.32
0.09
200.00
200.00
0.0
E2
STND
18S
17.14
0.09
200.00
200.00
0.0
E3
STND
18S
17.23
0.09
200.00
200.00
0.0
E4
STND
18S
18.74
0.13
100.00
100.00
0.0
E5
STND
18S
18.75
0.13
100.00
100.00
0.0
E6
STND
18S
18.97
0.13
100.00
100.00
0.0
E7
STND
18S
19.31
0.09
50.00
200.00
0.0
E8
STND
18S
19.29
0.09
50.00
200.00
0.0
E9
STND
18S
19.44
0.09
50.00
200.00
0.0
E10
STND
18S
21.28
0.05
25.00
200.00
0.0
Ell
STND
18S
21.21
0.05
25.00
200.00
0.0
E12
STND
18S
21.31
0.05
25.00
200.00
0.0
FI
STND
18S
21.10
0.08
12.50
200.00
0.0
F2
STND
18S
20.98
0.08
12.50
200.00
0.0
F3
STND
18S
20.93
0.08
12.50
200.00
0.0
F4
STND
18S
21.06
0.04
6.25
200.00
0.0
F5
STND
18S
21.02
0.04
6.25
200.00
0.0
F6
STND
18S
21.09
0.04
6.25
200.00
0.0
F7
STND
18S
21.03
0.01
3.13
200.00
0.0
F8
STND
18S
21.05
0.01
3.13
200.00
0.0
F9
STND
18S
21.03
0.01
3.13
200.00
0.0
F10
STND
18S
21.20
0.05
1.56
200.00
0.0
FI 1
STND
18S
21.24
0.05
1.56
200.00
0.0
F12
STND
18S
21.14
0.05
1.56
200.00
0.0
152

APPENDIX D
DATA FOR PGHS-2 rnRNA EXPRESSION
Well
Type
Primer/Probe
Ct
StdDEV Ct
Qty (ng)
Mean Qty (ng)StdDev
Al
STND
PGHS-2
25.11
0.00
800.00
800.00
0.0
A2
STND
PGHS-2
24.87
0.00
800.00
800.00
0.0
A3
STND
PGHS-2
24.95
0.00
800.00
800.00
0.0
A4
STND
PGHS-2
25.44
0.00
400.00
400.00
0.0
A5
STND
PGHS-2
25.57
0.00
400.00
400.00
0.0
A6
STND
PGHS-2
25.50
0.00
400.00
400.00
0.0
A7
STND
PGHS-2
26.44
0.00
200.00
200.00
0.0
A8
STND
PGHS-2
26.42
0.00
200.00
200.00
0.0
A9
STND
PGHS-2
26.54
0.00
200.00
200.00
0.0
A10
STND
PGHS-2
27.54
0.00
100.00
100.00
0.0
All
STND
PGHS-2
27.54
0.00
100.00
100.00
0.0
A12
STND
PGHS-2
27.47
0.00
100.00
100.00
0.0
B1
STND
PGHS-2
28.51
0.00
50.00
50.00
0.0
B2
STND
PGHS-2
28.24
0.00
50.00
50.00
0.0
B3
STND
PGHS-2
28.30
0.00
50.00
50.00
0.0
B4
STND
PGHS-2
29.22
0.00
25.00
25.00
0.0
B5
STND
PGHS-2
29.40
0.00
25.00
25.00
0.0
B6
STND
PGHS-2
29.37
0.00
25.00
25.00
0.0
B7
STND
PGHS-2
30.53
0.00
12.50
12.50
0.0
B8
STND
PGHS-2
30.22
0.00
12.50
12.50
0.0
B9
STND
PGHS-2
30.44
0.00
12.50
12.50
0.0
BIO
STND
PGHS-2
31.44
0.00
6.25
6.25
0.0
Bll
STND
PGHS-2
31.66
0.00
6.25
6.25
0.0
B12
STND
PGHS-2
31.60
0.00
6.25
6.25
0.0
Cl
STND
PGHS-2
32.94
0.00
3.13
3.13
0.0
C2
STND
PGHS-2
32.41
0.00
3.13
3.13
0.0
C3
STND
PGHS-2
32.16
0.00
3.13
3.13
0.0
C4
STND
PGHS-2
33.33
0.00
1.56
1.56
0.0
C5
STND
PGHS-2
33.36
0.00
1.56
1.56
0.0
C6
STND
PGHS-2
33.46
0.00
1.56
1.56
0.0
153

APPENDIX E
DATA FOR PGES mRNA EXPRESSION
Well
Type
Primer/Probe
Ct
StdDEV Ct
Qty (ng)
Mean Qty
StdDev
A1
STND
PGES
27.05
0.05
400.00
400.00
0.0
A2
STND
PGES
27.16
0.05
400.00
400.00
0.0
A3
STND
PGES
27.09
0.05
400.00
400.00
0.0
A4
STND
PGES
28.04
0.05
200.00
200.00
0.0
A5
STND
PGES
28.04
0.05
200.00
200.00
0.0
A6
STND
PGES
28.12
0.05
200.00
200.00
0.0
A7
STND
PGES
29.11
0.06
100.00
100.00
0.0
A8
STND
PGES
29.16
0.06
100.00
100.00
0.0
A9
STND
PGES
29.22
0.06
100.00
100.00
0.0
B1
STND
PGES
23.49
0.04
50.00
50.00
0.0
B2
STND
PGES
23.68
0.04
50.00
50.00
0.0
B3
STND
PGES
23.71
0.04
50.00
50.00
0.0
B4
STND
PGES
25.12
0.12
25.00
25.00
0.0
B5
STND
PGES
24.46
0.12
25.00
25.00
0.0
B6
STND
PGES
24.51
0.12
25.00
25.00
0.0
B7
STND
PGES
25.35
0.15
12.50
12.50
0.0
B8
STND
PGES
25.60
0.15
12.50
12.50
0.0
B9
STND
PGES
25.49
0.00
12.50
12.50
0.0
Cl
STND
PGES
26.24
0.19
6.25
6.25
0.0
C2
STND
PGES
26.42
0.19
6.25
6.25
0.0
C3
STND
PGES
26.35
0.19
6.25
6.25
0.0
C4
STND
PGES
27.67
0.10
3.13
3.13
0.0
C5
STND
PGES
27.87
0.10
3.13
3.13
0.0
C6
STND
PGES
28.11
0.10
3.13
3.13
0.0
Cl
STND
PGES
27.87
0.12
1.56
1.56
0.0
C8
STND
PGES
28.11
0.12
1.56
1.56
0.0
C9
STND
PGES
27.87
0.12
1.56
1.56
0.0
154

APPENDIX F
DATA FOR PGFS mRNA EXPRESSION
Well
Type
Primer/Probe
ct
StdDEV Ct
Qty (ng)
Mean Qty
StdDev
D1
STND
PGFS
18.14
0.03
400.00
400.00
0.0
D2
STND
PGFS
18.19
0.03
400.00
400.00
0.0
D3
STND
PGFS
18.19
0.03
400.00
400.00
0.0
D4
STND
PGFS
19.23
0.06
200.00
200.00
0.0
D5
STND
PGFS
19.25
0.06
200.00
200.00
0.0
D6
STND
PGFS
19.35
0.06
200.00
200.00
0.0
D7
STND
PGFS
20.28
0.03
100.00
100.00
0.0
D8
STND
PGFS
20.22
0.03
100.00
100.00
0.0
D9
STND
PGFS
20.27
0.03
100.00
100.00
0.0
El
STND
PGFS
21.18
0.07
50.00
50.00
0.0
E2
STND
PGFS
21.28
0.07
50.00
50.00
0.0
E3
STND
PGFS
21.31
0.07
50.00
50.00
0.0
E4
STND
PGFS
22.43
0.02
25.00
25.00
0.0
E5
STND
PGFS
22.41
0.02
25.00
25.00
0.0
E6
STND
PGFS
22.46
0.02
25.00
25.00
0.0
E7
STND
PGFS
23.27
0.03
12.50
12.50
0.0
E8
STND
PGFS
23.26
0.03
12.50
12.50
0.0
E9
STND
PGFS
23.32
0.03
12.50
12.50
0.0
FI
STND
PGFS
24.26
0.05
6.25
6.25
0.0
F2
STND
PGFS
24.35
0.05
6.25
6.25
0.0
F3
STND
PGFS
24.35
0.05
6.25
6.25
0.0
F4
STND
PGFS
25.25
0.03
3.13
3.13
0.0
F5
STND
PGFS
25.18
0.03
3.13
3.13
0.0
F6
STND
PGFS
25.23
0.03
3.13
3.13
0.0
F7
STND
PGFS
26.02
0.06
1.56
1.56
0.0
F8
STND
PGFS
26.11
0.06
1.56
1.56
0.0
F9
STND
PGFS
26.13
0.06
1.56
1.56
0.0
155

REFERENCES
Abdelgadir, S.E., Swanson, L., Oldfield, J.E. and Stormshak, F. (1987). Prostaglandin
F2a-induced release of oxytocin from bovine corpora lútea in vitro. Biol. Reprod.
37:550-555.
Acosta, T.J., Yoshizawa, N., Ohtani, M. and Miyamoto, A. (2002). Local changes in
blood flow and midcycle corpus luteum after prostaglandin F2a injection in the
cow. Biol. Reprod. 66:651-658.
Arosh, J.A., Parent, J., Chapdelaine, P., Sirios, J. and Fortier, M.A. (2002). Expression of
cyclooxygenases 1 and 2 and prostaglandin E synthase in bovine endometrial
tissue during the estrous cycle. Biol. Reprod. 67:161-169.
Asselin, E., Bazer, F.W. and Fortier, M.A. (1997a). Recombinant ovine and bovine
interferons regulate prostaglandin production and oxytocin response in cultured
bovine endometrial cells. Biol. Reprod. 56:402-408.
Asselin, E., Drolet, P. and Fortier, M.A. (1997b). Cellular mechanisms involved during
oxytocin-induced prostaglandin F2a production in endometrial epithelial cells in
vitro: role of cyclooxygenase-2. Endocrinology 138:4798-4805.
Asselin, E., Drolet, P. and Fortier, M.A. (1998). In vitro response to oxytocin and
interferon-x in bovine endometrial cells from caruncular and intercaruncular areas.
Biol. Reprod. 59:241-247.
Asselin, E. and Fortier, M.A. (2000). Detection and regulation of the messenger for a
putative bovine endometrial 9-keto-prostaglandin E2 reductase: effect of oxytocin
and interferon-tau. Biol. Reprod. 62:125-131.
Asselin, E., Goff, A.K., Bergeron, H. and Fortier, M.A. (1996) Influence of sex steroids
on the production of prostaglandin F2a and E2 and response to oxytocin in
cultured epithelial and stromal cells of the bovine endometrium. Biol. Reprod.
54:371-379.
Asselin, E., Lacroix, D. and Fortier, M.A. (1997a). Interferon-x increases PGE2
production and Cox-2 gene expression in bovine endometrium in vitro. Mol. Cell.
Endocrinol. 132:117-126.
156

157
Assinder, S.J., Carey, M., Parkinson, T. and Nicholson, H.D. (2000). Oxytocin and
vasopressin expression in the ovine testis and epididymis: changes with onset of
spermatogenesis. Biol. Reprod. 63:448-456.
Bale, T.L. and Dorsa, D.M. (1997). Cloning, novel promoter sequence and estrogen
regulation of a rat oxytocin receptor gene. Endocrinology 138:1151-1158.
Balaguer, S.A., Drost, M., Fuchs, A-R., Chang, S.M., Binta, H.P., Canino, C.J. and
Fields, M.J. (2000). Early pregnancy prostanoid responsiveness to an oxytocin
challenge. Biol. Reprod. 62 (Suppl. 1):255.
Bartol, F.F., Roberts, R.M., Bazer, F.W., Lewis, G.S., Godkin, J.D. and Thatcher, W.W.
(1985). Characterization of proteins produced in vitro by periattachment
conceptuses. Biol. Reprod. 32:681-693.
Bathgate, R.A.D., Rust, W., Balvers, M. Hartung, S., Morley, S. and Ivell, R. (1995)
Structure and expression of the bovine oxytocin receptor gene. DNA Cell Biol.
14:1037-1048.
Bathgate, R.A.D., Tillman, G. and Ivell, R. (1998). Molecular mechanisms of bovine
oxytocin receptor gene regulation. Biol. Reprod. 58 (Suppl. 1): 121.
Bazer, F.W., Flemming, G.W.J., Safe, S.H., and Spencer, T.E. (2003). The ovine
oxytocin receptor promoter/enhancer region is responsive to estrogen receptor
alpha. Biol. Reprod. 68 (Suppl. 1): 131.
Bazer, F.W., Spencer, T.E. and Ott, T.L. (1997). Interferon tau: a novel pregnancy
recognition signal. Am. J. Reprod. Immunol. 37:414-420.
Bazer, F.W., Thatcher, W.W., Hansen, P.J., Mirando, M.A., Ott, T.L. and Plante, C.
(1991) Physiological mechanisms of pregnancy recognition in ruminants. J.
Reprod. Fértil. 43 (Suppl. l):39-47.
Beard, A.P. and Lamming, G.E. (1994). Estradiol concentration and the development of
the oxytocin receptor and oxytocin-induced prostaglandin F2„ release in ewes. J.
Reprod. Fértil. 100:469-475.
Benyo, D.F. and Pate, J.L. (1992). Tumor necrosis factor-alpha alters bovine luteal cell
synthetic capacity and viability. Endocrinology 130:854-960.
Berndtson, A.K., Weaver, C.J. and Fortune, J.E. (1996). Differential effects of steroid
production by bovine granulosa cells. Mol. Cell. Endocrinol. 116:191-198.

158
Binelli, M., Guzeloglu, A., Badinga, L., Arnold, D.R., Sirois, J. and Hansen, T.R. (2000).
Interferon-x modulates phorbol ester-induced production of prostaglandin and
expression of cyclooxygenase-2 and phospholipase A2 from bovine endometrial
cells. Biol. Reprod. 63:417-424.
Bjorkman, N. (1968). Fine structure of cryptal and trophoblastic giant cells in the bovine
placentome. J. Ultrastruct. Res. 24:249-258.
Blair, R.M., Saatman, R., Liou, S.S., Fortune, J.E. and Hansel, W. (1997). Roles of
leukotrienes in bovine coipus luteum regression: an in vivo microdialysis study.
Proc. Soc. Exp. Biol. Med. 216:72-80.
Bogacki, M. and Kotwica, J. (1999). Influence of norepinephrine on progesterone
synthesis and post-translational processing of oxytocin synthesis in bovine corpus
luteum. Theriogenology 52:91-102.
Bogacki, M., Silvia, W.J., Rekawiecki, R. and Kotwica, J. (2002). Direct inhibitory effect
of progesterone on oxytocin-induced secretion of prostaglandin F2a from bovine
endometrial tissue. Biol. Reprod. 67:184-188.
Bridges, P.J., Wright, D.J., Buford, W.I., Ahmad, N., Hemandez-Fonseca, H.,
McCormick, M.L., Schrick, F.N., Dailey, R.A., Lewis, P.E. and Inskeep, E.K.
(2000). Ability of induced corpora lútea to maintain pregnancy in beef cows. J.
Anim. Sci. 78:2942-2949.
Burgess, J.R. and Reddy, C.C. (1997). Isolation and characterization of an enzyme from
sheep seminal vesicles that catalyzes the glutathione-dependent reduction of
prostaglandin H2 to prostaglandin F2 alpha. Biochem. Mol. Biol. Int. 41:217-226.
Burgess, J.R., Yang, H., Chang, M„ Rao, M.K, Tu, C.P. and Reddy, C.C. (1987).
Enzymatic transformation of PGH2 to PGF2 alpha characterized by glutathione S-
transferases. Biochem. Biophys. Res. Commun. 142:441-447.
Bums, P.D., Graf, G.A., Hayes, S.H. and Silvia, W.J. (1997). Cellular mechanisms by
which oxytocin stimulates uterine PGF2a synthesis in bovine endometrium: roles
of phospholipases C and A2. Domest. Anim. Endocrinol. 14:181-191.
Bums, P.D., Hayes, S.H. and Silvia, W.J. (1998). Cellular mechanisms by which
oxytocin mediates uterine prostaglandin F2a synthesis in bovine endometrium:
role of calcium. Domest. Anim. Endocrinol. 15:477-487.

159
Bums, P.D., Mendes, Jr. J.O.B., Yemm, R.S., Clay, M.C., Nelson, S.E., Hayes, S.H. and
Silvia, J.W. (2001). Cellular mechanisms by which oxytocin mediates ovine
endometrial prostaglandin F2a synthesis: role of G¡ proteins and mitogen-activated
protein kinases. Biol. Reprod. 65:1150-1155.
Cerbito, W.A., Miyamoto, A., Sauervein, H., Wijayaguguwardane, M.P.B., Ohtani, M.,
Takagi, M. and Sato, K. (1997). Evidence for uterine hom differences in local
concentrations of oxytocin receptor and prostaglandin F2(1 during the estrous cycle
and early pregnancy. Reprod. Domest. Anim. 32:161-165.
Charpigny, G., Reinaud, P., Huet, J.C., Guillmont, M., Charlier, M., Pemollet, J.C. and
Martal, J. (1988). High homology between a trophoblastic protein (trophoblastin)
isolated from ovine embryo and a interferons. FEBS Lett 228:12-16.
Charpigny, G., Reinaud, P., Tamby, J.P., Creminon, C. and Guillomont, M. (1997).
Cyclooxygenase-2 unlike cyclooxygenase-1 is highly expressed in ovine embryos
during the implantation period. Biol. Reprod. 57:1032-1040.
Charpigny, G., Reinaud, P., Tamby, J.P., Cremion, C., Martal, J., Maclouf, J. and
Guillmont, M. (1977). Expression of cyclooxygenase 1 and 2 in ovine
endometrium during the estrous cycle and early pregnancy. Endocrinology
138:2163-2171.
Chegini, N. and Rao, C.V. (1987). Dynamics of nuclear associated granules in bovine
luteal cells after treatment in vitro with prostaglandin F2a. Endocrinology
121:1870-1878.
Copelin, J.P., Smith, M.F., Gaverick, H.A.and Youngquist, R.S. (1987). Effect of the
uterus on subnormal luteal function in anestrous beef cows. J. Anim. Sci.
64:1506-1511.
Copelin, J.P., Smith, M.F., Keisler, D.H. and Garverick, H.A. (1989). Effect of active
immunization of prepartum and postpartum cows against prostaglandin F-2a on
life span and progesterone secretion of short-lived corpora lútea. J. Reprod. Fértil.
87:199-207.
Copland, J.A., Jeng, Y.J., Strakova, Z., Ives, K.L., Hellmich, M.R. and Soloff, M.S.
(1999). Demonstration of functional human oxytocin receptors in human breast
HS578T cells and their up-regulation through a protein kinase C-dependent
pathway. Endocrinology 140:2258-2267.
Corteel, M. (1975). Luteolysis induced by prostaglandin F2a compared with natural
luteolysis in the ewe. Ann. Biol. Anim. Biochim. Biophys. 15:175-180.

160
Davis, A.J., Fleet, I.R., Hansford, P.A., Harrison, F.A. and Maulé Walker, F.M. (1985).
Pulmonary metabolism of PGF2a in the conscious non-pregnant cow. J. Physiol
(Lond) 358:107P.
Demmers, K.J., Derecka, K. and Flint, A. (2001). Trophoblast interferon and pregnancy.
Reproduction 121:41-49.
de Moraes, A.A. and Hansen, P.J. (1997). Granulocyte-macrophage colony-stimulating
factor promotes development of in vitro produced bovine embryos. Biol. Reprod.
57:1060-1065.
Denning-Kendall, P.A. and Wathes, D.C. (1994). Acute effects of PGF2„, LH and
estradiol on second messenger system and on the secretion of oxytocin and
progesterone from granulosa and early luteal cells of the ewe. Biol. Reprod.
50:765-773.
Desnoyers, D.G., Wetzels, C. and Thatcher, W.W. (1994). Natural and recombinant
bovine interferon-x regulates basal and oxytocin-induced secretion of
prostaglandin F2a and E2 by epithelial cells and stromal cells in the endometrium.
Reprod. Fértil. Dev. 6:193-202.
Diaz, F.J., Anderson, L.E., Wu, Y.L., Rabot, A., Tsai, S.J. and Wiltbank, M.C. (2002).
Regulation of progesterone and prostaglandin F-2 alpha production in the CL.
Mol. Cell. Endocrinol. 191:65-80.
Douglas, W.S. and Britt, J.H. (2000). In vivo oxytocin release from microdialyzed bovine
corpora lútea during spontaneous and prostaglandin-induced regression. Biol.
Reprod. 62:726-730.
Doualla-Bell, F. and Koromilas, A. (2001). Induction of PG G/H synthase-2 in bovine
myometrial cells by interferon-x requires the activation of the p38 MAPK
pathway. Endocrinology 142:5107-5115.
Drost, M., Savio, J.D., Barros, C.M., Badinga, L. and Thatcher, W.W. (1992).
Ovariectomy by colpotomy in cows. J. Am. Vet. Med. Assoc. 200:337-339.
Emond, V., Asselin, E., Fortier, M.A., Murphy, B.D. and Lambert, R.D. (2000).
Interferon tau stimulates macrophage colony stimulating factor gene expression in
bovine lymphocytes and endometrial stromal cells. Biol. Reprod. 62:1728-1737.

161
Emond, V., Fortier, M.A., Murphy, B.D and Lambert, R.D. (1998). Prostaglandin E2
regulates both interleukin-2 and granulocyte-macrophage colony-stimulating
factor gene expression in bovine lymphocytes. Biol. Reprod. 58:143-151.
Emond, V., MacLaren, L.A., Kimmins, S., Arosh, J.A., Fortier, M.A. and Lambert, R.D.
(2003). The expression of cyclooxygenase-2 and granulocyte-macrophage-colony
stimulating factor in the endometrial epithelium of the cow is upregulated during
early pregnancy and in response to intrauterine infusions of interferon-tau. Biol.
Reprod. (In Press).
Farin, C.E., Imakawa, FL, Hansen, T.R., McDonell, J.J., Murphy, C.N., Farm, P.W. and
Roberts, R.M. (1990). Expression of trophoblastic interferon genes in sheep and
cattle. Biol. Reprod. 43:210-218.
Feng, H.C. Bhave, M. and Fairclough, R.J. (2000). Regulation of oxytocin receptor in
sheep: tissue specificity, multiple transcripts and mRNA editing. J. Reprod. Fértil.
120:187-200.
Fields, M.J., Barros, C.M., Watkins, W.B. and Fields, P.A. (1992). Characterization of
large luteal cells and their secretory granules throughout the estrous cycle of the
cow. Biol. Reprod. 46:535-545.
Fields, M.J., Dubois, W., Ball, B., Drost, M. and Fields, P.A. (1987). The effect of
prostaglandin F2a on mitochondrial electron dense inclusions and secretory
granules in the bovine large luteal cell during pregnancy. Adv. Exp. Med. Biol.
219:677-681.
Fields, M.J., Dubois, W., Brackett, K.H., Faulkner, R.F., Ball, B.A., Martin, J.M., Drost,
M. and Fields, P.A. (1989). In-vivo effect of prostaglandin F2„ treatment on
secretory granules in the corpus luteum of the late pregnant cow. J. Reprod. Fértil.
37:215-223.
Fields, M.J. and Fields, P.A. (1986). Luteal neurophysin in the non-pregnant cow and
ewe: immunocytochemical localization in membrane-bound secretory granules of
the large luteal cell. Endocrinology 118:1723-1725.
Fields, M.J and Fields, P.A. (1996). Morphological characteristics of the bovine corpus
luteum during the estrous cycle and pregnancy. Theriogenology 45:1295-1325.
Filion, F., Bouchard, N., Goff, A.K., Lussier, J.G. and Sirois, J. (2001). Molecular
cloning and induction of bovine prostaglandin E synthase by gonadotropins in
ovarian follicles prior to ovulation in vivo. J. Biol. Chem. 276:34323-34330.

162
Flint, A.P.F. and Sheldrick, E.L. (1982). Ovarian oxytocin is stimulated by
prostaglandins. Nature 297:587-588.
Flint, A.P.F. and Sheldrick, E.L. (1983). Evidence for a systemic role for ovarian
oxytocin in luteal regression in sheep. J. Reprod. Fértil. 67:215-225.
Flint, A.P.F, Sheldrick, E.L., McCann, T.J. and Jones, D.S.C. (1990). Luteal oxytocin:
characteristics and control of synchronous episodes of oxytocin and PGF2a
secretion at luteolysis in ruminants. Dom. Anim. Endocrinol. 7:111-124.
Flint, A.P., Stewart, H.J., Lamming, G.E. and Payne, J.H. (1992). Role of the oxytocin
receptor in the choice between cyclicity and gestation in ruminants. J. Reprod.
Fértil. Suppl. 45:53-58.
Fortier, M.A., Guilbault, L.A. and Grasso, F. (1988). Specific properties of epithelial
cells from the endometrium of cows. J. Reprod. Fértil. 83:239-248.
Fournier, T., Fadok, V. and Henson, P.M. (1997). Tumor necrosis factor-a inversely
regulates prostaglandin D2 and prostaglandin E2 production in murine
macrophages. J. Biol. Chem. 272:31065-31072.
Freidman, S., Gurevich, M. and Shemesh, M. (1995). Bovine cyclic endometrium
contains high-affinity LH/hCG binding sites. Biol. Reprod. 52:1020-1026.
Friedman, A., Weiss, S., Levy, N. and Meidan, R. (2000). Role of tumor necrosis factor a
and its receptor in luteal regression: induction of programmed cell death in bovine
corpus luteum-derived endothelial cells. Biol. Reprod. 63:1905-1912.
Fuchs, A.R. (1987). Prostaglandin F2a and oxytocin interactions in ovarian and uterine
function. J. Steroid Biochem. 27:1073-1080.
Fuchs, A.R., Behrens, O., Helmer, H., Liu, C.H., Barros, C.M. and Fields, M.J. (1990).
Oxytocin and vasopressin receptors in the bovine endometrium and myometrium
during the estrous cycle and early pregnancy. Endocrinology 127:629-636.
Fuchs, A.R., Drost, M., Morissey, P., Chang, S.M. and Fields, M.J. (1997). Steroid
effects on oxytocin and PGF2a interaction in endometrium of prepubertal heifers.
Biol. Reprod. 56 (Suppl. 1): 187.

163
Fuchs, A.R., Helmer, H., Chang, S.M. and Fields, M.J. (1992). Concentrations of
oxytocin receptors in the placenta and fetal membranes of cows during pregnancy
and labor. J. Reprod. Fértil. 96:775-783.
Fuchs, A.R., Ivell, R., Fields, P.A., Chang, S.M. and Fields, M.J. (1996a). Oxytocin
receptors in the bovine cervix: distribution and gene expression during the estrous
cycle. Biol. Reprod. 54:700-708.
Fuchs, A.R., Ivell, R., Ganz, N., Fields, M.J. and Giménez, T. (2001). Secretion of
oxytocin in pregnant and parturient cows: corpus luteum may contribute to
plasma oxytocin at term. Biol. Reprod. 65:1135-1141.
Fuchs, A.R., Rollyson, M.K., Meyer, M., Fields, M.J., Minix, J.M. and Randel, R.D.
(1996b). Oxytocin induces prostaglandin F2 alpha release in pregnant cows:
influence of gestational age and oxytocin receptor concentrations. Biol. Reprod.
54:647-653.
Fuchs, A. R., Balvers, M., Telgmann, R., Ivell, R., Pfarrer, C.D., Caliesen, H. and
Dantzer, V. (2003) Localization of interferon-tau and oxytocin receptor protein
and messenger RNA in bovine placentomes throughout gestation. Biol. Reprod.
(In Press).
Furuya, K., McCardle, C.A. and Ivell, R. (1990). The regulation of oxytocin gene
expression in early bovine luteal cells. Mol. Cell Endocrinol. 70:80-88.
Gibb, W., Sun, M., Gyomorey, S., Lye, S.J. and Challis, J.R.G. (2000). Localization of
prostaglandin synthase type-1 (PGHS-1) mRNA and prostaglandin synthase type-
2 (PGHS-2) mRNA in ovine myometrium and endometrium throughout gestation.
J. Endocrinol. 165:51-58.
Giménez, T, and Henricks, D.M. (1983). Prolongation of the luteal phase by
prostaglandin E2 during the estrous cycle in the cow. Theriogenology 19:963-970.
Gimpl, G. and Fahrenholz, F. (2001). The oxytocin receptor system: structure, function
and regulation. Physiol. Rev. 81:629-683.
Godkin, J.D., Smith, S.E., Johnson, R.D. and Dore, J.J.E. (1997). The role of trophoblast
interferons in the maintenance of early pregnancy in ruminants. Am. J. Reprod.
Immunol. 37:137-143.
Goff, A.K. (1991). Role of oxytocin in estrous cycle regulation. Agbiotech News
Information. 3:829-833.
Goff, A.K. (2002) Embryonic signals and survival. Reprod. Dom. Anim. 37:133-139.

Goff, A.K. and Kombe, A. (2003). Steroid hormone modulation of prostaglandin
synthesis in the ruminant endometrium. Biol. Reprod. 68(Suppl. 1):97.
164
Grazzini, F., Guillon, G., Mouilac, B. and Zingg, H.H. (1998). Inhibition of oxytocin
receptor function by direct binding of progesterone. Nature 392:509-512.
Gross, T.S., Thatcher, W.W., Hansen, P.J., Johnson, J.W., and Helmer, S.D. (1988a).
Presence of an intracellular endometrial inhibitor of prostaglandin synthesis
during early pregnancy in the cow. Theriogenology 35:359-378.
Gross, T.S., Thatcher, W.W., Hansen, P J. and Lacroix, M.C. (1988b). Prostaglandin
secretion by perifused bovine endometrium: secretion towards the myometrial and
luminal sides at day 17 post-estrus as altered by pregnancy. Prostaglandins
35:343-357.
Gross, T.S. and Williams, W.F. (1988). Bovine placental prostaglandin synthesis:
principal cell synthesis as modulated by the binucleate cell. Biol. Reprod.
38:1027-1034.
Gross, T.S., Williams, W.F. and Manspeaker, J.E. (1985). In vitro placental prostaglandin
synthesis in late pregnant and prepartum cow. Biol. Reprod. 32 (Suppl.l):154.
Guilbault, L.A., Thatcher, W.W., Drost, M. and Hopkins, S.M. (1984). Source of
prostaglandins during the early postpartum period in cattle. Biol. Reprod. 31:879-
887.
Guillomot, M., Michel, C., Gaye, P., Charlier, M., Trojan, J. and Martal, J. (1990).
Cellular localization of an embryonic interferon, ovine trophoblastin and its
mRNA in sheep embryos during pregnancy. Biol. Cell. 68:203-211.
Guldenar, S.E.F., Wathes, D.C. and Pickering, B.T. (1984). Immunocytochemical
evidence for the presence of oxytocin and neurophysin in the large cells of the
bovine corpus luteum. Cell Tiss. Res. 237:349-352.
Guverich, M. and Shemesh, M. (1994). Induction of cyclooxygenase and prostaglandin
E2 production by the bovine pre-embryo. Reprod. Fértil. Dev. 6:687-691.
Guzeloglu, A., Bilby, T. R., Kamimura, S., Meikle, A., Badinga, L., Dinges, A.C.,
Hernandez, O. and Thatcher, W.W. (2003). Effects of pregnancy and bovine
somatotrophin (bST) on endometrial estrogen receptor-a, PGHS-2 and PGF2a
secretion on day 17 after estrus in nonlactating dairy cows. Biol. Reprod. 66
(Suppl. 1 ):314.

165
Habib, A., Creminon, C., Frobert, Y., Grassi, J., Pradelles, P. and Maclouf, J. (1993).
Demonstration of an inducible cyclooxygenase in human endometrial cells using
antibodies raised against the carboxyl-terminal region of the cyclooxygenase-2. J.
Biol. Chem. 268:23448-23454.
Hamberg, M and Samuelsson, B. (1967). On the mechanism of the biosynthesis of
prostaglandin E-l andF-1 alpha. J. Biochem. 242:5336-5343.
Haynes, N.B., Collier, R.J., Kiser, T.E. and Hafs, H.D. (1978). Effect of prostaglandin E2
and F2c on serum luteinizing hormone, testosterone and prolactin in bulls. J.
Anim. Sci. 47:923-925.
Heath, E., Weinstein, P., Merrit, B., Shanks, R. and Hixon, J. (1983). Effects of
prostaglandins on the bovine corpus luteum: granules, lipid inclusions and
progesterone secretion. Biol. Reprod. 29:977-985.
Hedge, G.A. (1972). The effects of prostaglandins on ACTH secretion. Endocrinology
91:561.
Helmer, S.D., Hansen, P.J., Thatcher, W.W., Johnson, J.W. and Bazer, F.W. (1989).
Intrauterine infusion of highly enriched bovine trophoblast protein-1 complex
exerts an antiluteolytic effect to extend corpus luteum lifespan in cyclic cattle. J.
Reprod. Fértil. 87:89-101.
Henderson, K.M. and McNatty, K.P. (1975). A biochemical hypothesis to explain the
mechanism of luteal regression. Prostaglandins 9:779-797.
Herschmann, H. R. (1996). Review: prostaglandin synthase-2. Biochem. Biophys. Acta.
129:125-140.
Hirakawa, T., Minegishi, T., Abe, K., Kishi, H., Ibuki,Y. and Miyamoto, K. (1999). A
role of insulin-like growth factor I in luteinizing hormone receptor expression in
granulosa cells. Endocrinology 140:4965^1971.
Hla, T. and Neilson, K. (1992). Human cyclooxygenase-2 cDNA. Proc. Natl. Acad. Sci.
U.S.A. 89:7384-7388.
Hooper, S.B., Watkins, W.B. and Thorbum, G.D. (1986). Oxytocin, oxytocin-associated
neurophysin and prostaglandin F2a concentrations in the utero-ovarian vein of
pregnant and non-pregnant sheep. Endocrinology 119:2590-2597.
Horn, S., Bathgate, R., Lioutus, C., Bracken, K. and Ivell, R. (1998). Bovine endometrial
epithelial cells as a model system to study oxytocin receptor regulation. Hum.
Reprod. Update 4:605-614.

166
Huslig, R.L., Fogwell, R.L. and Smith, W.L. (1979). The prostaglandin forming
cyclooxygenase of ovine uterus: relationship to luteal function. Biol. Reprod.
21:589-600.
Ignar-Trowbridge, D.M., Pimental, M., Parker, M.G., McLachlan, J.A. and Korach, K.S.
(1996). Peptide growth factor cross-talk with estrogen receptor requires the A/B
domain and occurs independently of protein kinase C or estradiol. Endocrinology
137:1735-1744.
Imakawa, K., Calson, K.D., McGuire, W.J., Christenson, R.K. and Taylor, A. (1997).
Enhancement of ovine trophoblast interferon by granulocyte macrophage-colony
stimulating factor: possible involvement of protein kinase C. J. Mol Endocrinol
19:121-130.
Ishida, M., Hirabayashi, K., Suzuki, M., Yamanouchi, K and Nishimara, M. (2003).
Cloning and chromosomal localization of mouse 20a-hydroxysteroid
dehydrogenase gene. J. Reprod. Dev. 49:79-85.
Ivell, R., Bathgate, R. and Walther, N. (1999) Luteal peptides and their genes as
important markers of ovarian differentiation. Reprod. Domest. Rum. 54
(Suppl):207-216.
Ivell, R., Bathgate, R., Walther, N. and Kimura, T. (1998). The molecular basis of
oxytocin and oxytocin receptor expression in reproductive tissues. Adv. Exp.
Med. Biol. 449:297-306.
Ivell, R., Brackett, K., Fields, M.J. and Richter, D. (1985). Ovulation triggers oxytocin
gene expression in the bovine ovary. FEBS Lett. 190:263-267.
Ivell, R., Fuchs, A-R., Bathgate, R., Tillmann, G. and Kimura, T. (2000). Regulation of
the oxytocin receptor in bovine reproductive tissues and the role of steroids.
Reprod. Dom. Anim, 35:134-141.
Ivell, R. and Richter, D. (1984). The gene for the hypothalamic peptide hormone
oxytocin is highly expressed in the bovine corpus luteum: biosynthesis, structure
and sequence analysis. EMBO J. 3:2351-2354.
Ivell, R., Rust, W., Einspanier, A. Hartung, S., Fields, M. and Fuchs, A.R. (1995).
Oxytocin and oxytocin receptor gene expression in the reproductive tract of the
pregnant cow: rescue of luteal oxytocin production at term. Biol. Reprod. 53:553-
560.
Ivell, R. and Russell, J.A. (1996). Oxytocin: cellular and molecular approaches in
medicine and research. Rev. Rep.1:13-18.

167
Ivell, R. and Walther, N. (1999). The role of steroids in the oxytocin hormone system.
Mol. Cell. Endocrinol. 151:95-101.
Jakobsson, P., Morgenstem, R., Mancini, J., Ford-Hutchinson, A. and Persson, B.
(1999a). Common structural features of MAPEG-a widespread superfamily of
membrane associated proteins with highly divergent functions in eicosanoids and
glutathione metabolism. Protein Sci. 8:689-692.
Jakobsson, P., Morgenstem, R., Mancini, J., Ford-Hutchinson, A. and Persson, B. (2000).
Membrane-associated proteins in eicosanoids and glutathione metabolism
(MAPEG). A widespread protein superfamily. Am. J. Respir. Crit. Care Med.
161:20-24.
Jakobsson, P., Thoren, S., Morgenstem, R. and Samuelsson, B. (1999b). Identification of
human prostaglandin E synthase: a microsomal, glutathione-dependent, inducible
enzyme, constituting a potential novel drug target. Proc. Natl. Acad. Sci. USA
96:7220-7225.
Jarry, H., Homshuck, R., Pitzel, L. and Wuttke, W. (1992). Demonstration of oxytocin
release by bovine luteal cells using the reverse hemolytic plaque assay. Biol.
Reprod. 46:408-413.
Jenner, L.J., Parkinson, T.J. and Lamming, G.E. (1991). Uterine oxytocin receptors in
cyclic and pregnant cows. J. Reprod. Fértil. 91:49-58.
Juengel, J.L., Garverick, H.A., Johnson, A.L., Youngquist, R.S. and Smith, M.F. (1993).
Apoptosis during luteal regression in cattle. Endocrinology 132:249-254.
Kankofer, M. and Wiercinski, J. (1999). Prostaglandin E2 9-ketoreductase from bovine
term placenta. Prostaglandins Leukot. Essent. Fatty Acids 61:29-32.
Kasamo, M., Ishikawa, M., Yamashita, K., Senoguku, K. and Shimizu, T. (1986).
Possible role of prostaglandin F in blastocyst implantation. Prostaglandins
31:321-326.
Kato, S., Tora, L., Yamauchi, J., Masushige, S., Ballard, M. and Chambón, P. (1992). A
far upstream estrogen response element of the ovalbumin gene contains several
half-palindromic 5’-TGACC-3’ motifs acting synergistically. Cell 68:731-742.
Kerbler, T.L., Buhr, M.M., Jordan, L.T., Leslie, K.E. and Walton, J.S. (1997).
Relationship between maternal plasma progesterone concentration and interferon-
tau synthesis by the conceptos in cattle. Theriogenology 47:703-714.
Keys, J.L., King, G.J. and Kennedy, T.G. (1985). Increased uterine vascular permeability
at the time of embryonic attachment in the pig. Biol. Reprod. 34:405-411.

168
Kindahl, H., Lindell, J.O. and Edqvist, L.E. (1981). Release of prostaglandin F2a during
the estrous cycle. Acta Vet. Scand. 77:143-158.
King, G.J., Atkinson, B.A. and Robertson, H.A. (1982). Implantation and early
placentation in domestic ungulates. J. Reprod. Fértil. 31(Suppl.):17-30.
Knickerbocker, J.J., Thatcher, W.W., Bazer, F.W., Drost, M., Barron, D.H., Fincher,
K.B. and Roberts, R.M. (1986). Proteins secreted by day 16 to 16 day conceptuses
extends corpus luteum function in cows. J. Reprod. Fértil. 77:381.
Kniss, D.A. (1999). Cyclooxygenases in reproductive medicine and biology. J. Soc.
Gynecol. Invest. 6:285-292.
Kombé, A, Sirois, J. and Goff, A.K. (2003). Prolonged progesterone treatment of
endometrial epithelial cells modifies the effect of estradiol on their sensitivity to
oxytocin. Steroids 68:651-658.
Kotwica, J., Bogacki, M. and Rekawiecki, R. (2002). Neural regulation of the bovine
corpus luteum. Domest. Anim. Endocrinol. 23:299-308.
Kotwica, J. and Skarzynski, D. (1993). Influence of oxytocin removal from the corpus
luteum on secretory function and duration of the estrous cycle in cattle. J. Reprod.
Fértil. 97:411-417.
Kotwica, J., Skarzynski, D., Jaroszewski, J. and Bogacki, M. (1994). Norepinephrine
affects secretory function of corpus luteum independently on prostaglandins in
conscious cattle. Prostaglandins 48:1-10.
Kotwica, J., Skarzynski, D., Jaroszewski, J. and Kotwica, C. (1991). Effect of
norepinephrine on the release of progesterone and ovarian oxytocin in cattle.
Anim. Reprod. Sci. 26:179-191.
Kotwica, J., Skarzynski, D., Jaroszewski, J., Williams, G. L. and Bogacki. M. (1998a).
Uterine secretion of prostaglandin F2a stimulated by different doses of oxytocin
and released spontaneously during luteolysis in cattle. Reprod. Nutr. Dev. 38:217-
226.
Kotwica, J., Skarzynski, M., Melin, P. and Staostka, B. (1997). The use of an oxytocin
antagonist to study the function of ovarian oxytocin during luteolysis in cattle.
Theriogenology 48:1287-1299.
Kotwica, J., Skarzynski, D., Misziekel, G. and Okuda, K. (1998b). Oxytocin modulates
the pulsatile secretion of PGF2et in initiated luteolysis in cattle. Res. Vet. Sci. 66:1-
5.

169
Kramer, R.M. and Sharp, J.D. (1997). Structure, function and regulation of Ca2+
sensitive cytosolic phospholipase A2. FEBS Lett. 410:49-53.
Kubata, B., Duszenko, M., Kabututu, Z., Rawer, M., Szallies, A. Fujimori, K., Inui, T.,
Nozaki, T., Yamashita, K., Horii, T., Urade, Y. and Hayaishi, O. (2000).
Identification of a novel prostaglandin F2a synthase in Trypanosoma brucei. J.
Exp. Med. 192:1327-1338.
Kuchinke, W., Barski, O., Watanabe, K. and Hayaishi, O. (1992). A lung type
prostaglandin F synthase is expressed in bovine liver: cDNA sequence and
expression in E. coli. Biochem. Biophys. Res. Commun. 183:1238-1246.
Kujubu, D.A., Fletcher, B.S., Vamum, B.C., Lim, R.W. and Herschmann, H.R. (1991).
TIS10, a phorbol ester tumor promoter-inducible mRNA from Swiss 3T3 cells,
encodes a novel prostaglandin synthase/cyclooxygenase homologue. J. Biol.
Chem. 266:12866-12872.
Laffance, M. and Goff, A.K. (1985). Effect of pregnancy on oxytocin induced release of
prostaglandin F2a in heifers. Biol. Reprod. 33:1113-1119.
Lafrance, M. and Goff, A. K. (1990). Control of bovine uterine PGF2a release in vitro.
Biol. Reprod. 42:288-293.
Lamming, G.E and Mann, G.E. (1995). Control of endometrial oxytocin receptors and
prostaglandin F2a production in cows by progesterone and estradiol. J. Reprod.
Fértil. 103:69-73.
Lamming, G.E., Wathes, D.C., Flint, A.P., Payne, J.H., Stevenson, K.R. and Vallet, J.L.
(1995). Local action of trophoblast interferons in suppression of the development
of oxytocin and estradiol receptors in ovine endometrium. J. Reprod. Fértil.
105:165-175.
Lamsa, J.C., Cushman, R.A., Nay, M.G. and McCracken, J.A. (1992). In vivo
desensitization of high affinity PGF2a receptor in the ovine corpus luteum.
Prostaglandins 43:165-179.
Lemaster, J.W., Seals, R.C., Hopkins, F.M. and Shriek, F.N. (1999). Effect of
administration of oxytocin on embryonic survival in progestogen supplemented
cattle. Prostaglandins 57:259-268.
Leung, S.T., Cheng, Z., Sheldrick, E.L., Derecka, K. and Flint, A.P.F. (2001). The
effects of lipopolysaccharide and interleukins-la, -2 and -6 on oxytocin receptor
expression and prostaglandin production in bovine endometrium. J. Endocrinol.
168:497-508.

170
Leung, S.T., Derecka, K., Mann, G.E., Flint, A.P.F. and Wathes, D.C. (2000). Uterine
lymphocyte distribution and interleukin expression during early pregnancy in
cows. J. Reprod. Fértil. 119:25-33.
Leung, S.T. and Wathes, D.C. (2000). Estradiol regulation of oxytocin receptor
expression in cyclic bovine endometrium. J. Reprod. Fértil. 119:287-292.
Lewis, G.S., Thatcher, W.W., Bazer, F.W. and Curl, J.S. (1982). Metabolism of
arachidonic acid in vitro by bovine blastocysts and endometrium. Biol. Reprod.
27:431-439.
Lewis, G.S. and Waterman, R.A. (1985). Metabolism of arachidonic acid in vitro ovine
conceptuses recovered during early pregnancy. Prostaglandins 30:263-283.
Lewis, T.S., Shapiro, P.S. and Ahn, N.G. (1998). Signal transduction through MAP
kinase cascades. Adv. Cancer Res. 74:49-139.
Levy, N., Gordin, M., Smith, M.F., Bolden-Tiller, O.U. and Meidan, R. (2003).
Hormonal regulation and cell-specific expression of endothelin-converting
enzyme 1 isoforms in bovine ovarian endothelial and steroidogenic cells. Biol.
Reprod. 68:1361-1368.
Littell, R.C., Henry, P.R. and Ammerman, C.B. (1998). Statistical analysis of repeated
measures data using SAS procedures. J. Anim. Sci. 76:1216-1231.
Liu, J., Antaya, M., Boerboom, D., Lussier, J. G. and Silversides, D.W. (1999). The
delayed activation of the prostaglandin G/H synthase-2 promoter in bovine
granulosa cells is associated with down-regulation of truncated upstream
stimulatory factor-2. J. Biol. Chem. 274:35037-35045.
Liu, J., Antaya, M., Goff, A.K., Boerboom, D., Silversides, D.W., Lussier, J.G. and
Sirois, J. (2001). Molecular characterization of bovine prostaglandin G/H
synthase-2 and regulation in uterine stromal cells. Biol. Reprod. 64:983-991.
Liu, J., Carriere, P.D., Dore, M. and Sirois, J. (1997). Prostaglandin G/H synthase-2 is
expressed in bovine preovulatory follicles after endogenous surge of luteinizing
hormone. 57:1524-1531.
Liu, J and Sirois, J. (1998). Follicle size-dependent induction of prostaglandin G/H
synthase during superovulation in cattle. Biol. Reprod. 58:1527-1532.
Madore, E., Harvey, E., Parent, J., Chapdelaine, P. and Arosh, J.A. (2003). An aldolase
reductase with 20a-hydroxysteroid dehydrogenase activity is most likely the
enzyme responsible for the production of prostaglandin F2a in the bovine
endometrium. J. Biol. Chem. 278:11205-11212.

171
Magness, R.R., Huie, J.M., Hoyer, G.L., Huecksteadt, T.P., Reynolds, L.P., Seperich,
G.J., Whysong, G. and Weems, C.W. (1981). Effect of chronic ipsilateral or
contralateral intrauterine infusion of prostaglandin E2 (PGE2) on luteal function of
unilaterally ovariectomized ewes. Prostaglandins Leukotrienes Med. 6:389-401.
Mamluk, R., Chen, D., Greber, Y., Davis, J. and Meidan, R. (1998). Characterization of
prostaglandin F2a and LH receptor mRNA expression in different bovine luteal
cell types. Biol. Reprod. 58:849-856.
Mancini, J.A., Blood, K., Gray, J., Gordon, R., Claveau, D., Chan, C.C. and Riendeau, D.
(2001). Cloning, expression, and up-regulation of inducible rat prostaglandin E
synthase during lipopolysaccharide-induced pyresis and adjuvant-induced
arthritis. J. Biol. Chem. 276:4469-4475.
Mann, G.E. and Lamming, G.E. (1994). Use of repeated biopsies to monitor endometrial
oxytocin receptors in cows. Vet. Rec. 135:403-405.
Mann, G.E. and Lamming, G.E. (1995). Progesterone inhibition of the development of
the luteolytic signal in cows. J. Reprod. Fértil. 104:1-5.
Mann, G.E. and Lamming, G.E. (1999). The influence of progesterone during early
pregnancy in cattle. Reprod. Dom. Anim. 34:269-274.
Mann, G.E. and Lamming, G.E. (2001). Relationship between maternal endocrine
environment, early embryo development and inhibition of luteolytic mechanism
in cows. Reproduction 121:175-180.
Mann, G.E., Mann, S.J. and Lamming, G.E. (1996). The interrelationship between the
maternal hormone environment and the embryo during early stages of pregnancy.
J. Reprod. Fértil. Abstract Series 17:55.
Mann, G.E., Payne, J.H. and Lamming, G.E. (2001). Hormonal regulation of oxytocin-
induced prostaglandin F2a secretion by the bovine and ovine uterus in vivo.
Domest. Anim. Endocrinol. 21:127-141.
Martin, R.L., Whittle, W.L., Holloway, A.C., Gyomorey, S., Gibb, W., Lye, S. and
Challis, J.R.G. (2002). Ontogeny and regulation of ovine placental prostaglandin
E2 synthase. Biol. Reprod. 67:868-873.
Mashbum, P.B., Shabanowitz, R.B. and Clark, M.R. (1990). Immunohistochemical
localization of prostaglandin H synthase in the embryo and uterus of the mouse
from ovulation through implantation. Mol. Reprod. Dev. 25:309-316.

172
Matsumoto, H., Naraba, H., Murakami, M., Kudo, L, Yamaki, K., Ueno, A. and Oh-ishi,
S. (1997). Concordant induction of prostaglandin E2 synthase with
cyclooxygenase-2 leads to preferred production of prostaglandin E2 over
thromboxane and prostaglandin D2 in lipopolysaccharide-stimulated rat peritoneal
macrophages. Biochem. Biophys. Res. Commun. 235:148-152.
McArdle, C.A. and Holtorf, A.P. (1989). Oxytocin and progesterone release from bovine
corpus luteal cells in culture: effects of insulin-like growth factor I, insulin and
prostaglandins Endocrinology 124:1278-1286.
McCracken, J.A., Custer, E.E. and Lamsa, J.C. (1999). Luteolysis a neuroendocrine
mediated event. Physiol. Rev. 79:263-323.
McCracken, J.A., Custer, E.E., Lamsa, J.E. and Robinson, A.G. (1995). The central
oxytocin pulse generator: a pacemaker for luteolysis. In Ivell, R., Russell, J.A.
(eds.), Oxytocin cellular and molecular approaches in medicine and research,
New York: Plenum press, pp 133-154.
Meidan, D.W., Thatcher, W.W., Gilad, E., Aflalo, L., Greber, E.S. and Girsh, E. (1993).
Oxytocin and estradiol concentrations in follicular fluid as a means for
classification of large bovine follicles. Theriogenology 39:421-432.
Meidan, R., Altstein, M. and Girish, E. (1992). Biosynthesis and release of oxytocin by
granulosa cells derived from preovulatory bovine follicles: effects of forskolin
and insulin-like growth factors. Biol. Reprod. 46:715-720.
Meidan, R., Milvae, R.A., Weiss, S., Levy, N. and Friedman, A. (1999). Intra-ovarian
regulation of luteolysis. Reprod. Dom. Rum. (Suppl.) 54:217-228.
Melton, A.A., Berry, R.O. and Butler, O.D. (1951). The interval between the time of
ovulation and attachment of the bovine embryo. J. Anim. Sci. 10:993-1005.
Meyer, H.H., Mittermeier, T. and Schams, D. (1988). Dynamics of oxytocin, estrogen
and progestin receptors in the bovine endometrium during the estrous cycle. Acta
Endocrinol. 118:96-104.
Meyer, M.D., Hansen, P.J., Thatcher, W.W., Drost, M. and Roberts, R.M. (1995). Effect
of bovine interferon-x on body temperature and plasma progesterone
concentrations in cyclic dairy cows. J. Dairy Sci. 78:1470.
Meyer, M.D., Desnoyers, G.D., Oldick, B., Thatcher, W.W., Drost, M., Schalue, T.K.
and Roberts, R.M. (1996). Treatment with recombinant bovine interferon-tau in
útero attenuates secretion of prostaglandin F from cultured endometrial epithelial
cells. J. Dairy Sci. 79:1375-1384.

Milvae, R.A., Hincley, S.T. and Carlson, J.C. (1996). Luteotropic and luteolytic
mechanisms in the bovine corpus luteum. Theriogenology 45:1327-1349.
173
Mirando, M.A., Becker, W.C. and Whiteaker, S.S (1993). Relationships among
endometrial oxytocin receptors, oxytocin-stimulated phosphoinositide hydrolysis
and prostaglandin F2a secretion in vitro, and plasma concentrations of ovarian
steroids before and during corpus luteum regression in cyclic heifers. Biol.
Reprod. 48:874-882.
Mishra, D.P., Meyer, H.H.D. and Prakash, B.S. (2003). Validation of a sensitive enzyme
immunoassay for 13, 14-dihydro-15-keto-PGF2a in buffalo plasma and its
application for reproductive health status monitoring. Anim. Reprod. Sci. 78:33-
48.
Miyamoto, Y., Skarzynski, D.J. and K. Okuda, K. (2000). Is tumor necrosis factor a a
trigger for the initiation of endometrial prostaglandin F2a release at luteolysis in
cattle? Biol. Reprod. 62:1109-1115.
Mizrachi, D. and Shemesh, M. (1999). Follicle-stimulating hormone receptor and its
messenger ribonucleic acid are present in the bovine cervix and can regulate
cervical prostanoid synthesis. Biol. Reprod. 61:776-784.
Moonen, P., Buytenhek, M. and Nugteren, D.H. (1982). Purification of PGH-PGE
isomerase from sheep vesicular gland. Meth. Enzymol. 86:84-91.
Morita, L, Schindler, M., Regier, M.K., Otto, J.C., Hor, T., DeWitt, D.L. and Smith, W.L.
(1995). Different intracellular locations for prostaglandin endoperoxide H
synthase-1 and -2. J. Biol. Chem. 270:10902-10908.
Munir, L, Fukunaga, K., Kanasaki, H., Miyazaki, K., Ohba, T., Okamura, H. and
Miyamoto, E. (2000). Expression of cyclooxygenase 2 by prostaglandin E2 in
human endometrial adenocarcinoma cell line FIEC-1B. Biol. Reprod. 63:933-941.
Murakami, M., Naraba, H., Tanioka, T., Semmyo, N., Nakatami, Y., Kojima, F., Ikeda,
T., Fueki, M., Ueno, A., Oh, S. and Kudo, I. (2000). Regulation of prostaglandin
E2 biosynthesis by inducible membrane-associated prostaglandin E2 synthase that
acts in concert with cyclooxygenase-2. J. Biol. Chem. 275:32783-32792.
Murakami, S., Miyamoto, Y., Skarzynski, D.J. and Okuda, K. (2001). Effects of tumor
necrosis factor-a on secretion of prostaglandin E2 and F2a in bovine endometrium
throughout the estrus cycle. Theriogenology 55:1667-1678.
Nagata, S. and Goldstein, P. (1995). The Fas death factor. Science 267:1449-1456.

174
Nancarrow, C.D., Buckmaster, W., Chamley, R.I., Cox, I.A., Cummins, L., Drinan, J.P.,
Findlay, J.R., Goding, B.J., Restall, W. and Thorbum, G.D. (1973). Hormonal
changes around estrus in the cow. J. Reprod. Fértil. 32:320-321.
Newcomb, R., Booth, W.D. and Rowson, L.E.A. (1977). The effect of oxytocin treatment
on the levels of prostaglandin F in the blood of heifers. J. Reprod. Fértil. 49:17-
24.
Nichols, N., Binta, H., Fields, P., Campbell-Thompson, M., Drost, M., Ivell, R., Chang,
S-M., Johnson, E. and Fields, M.J. (2003). Expression and localization of luteal
oxytocin and relaxin-like factor during the peri-implantation period of bovine
pregnancy. Biol. Reprod. 68 (Suppl. 1 ):335.
Niswender, G.D., Juengel, J.L., Silva, P., Rollyson, M.K. and Mclntush, E.W. (2000).
Mechanisms controlling the function and life of the corpus luteum. Phys. Rev.
80:1-29.
Niswender, G.D., Scwall, R.H., Fitz, T.A., Farin, C.E. and Sawyer, H.R. (1985).
Regulation of luteal functions in domestic ruminants: new concepts. Recent Prog.
Horm. Res. 41:101-151.
Northey, D.L. and French, L.R. (1980). Effect of embryo removal and intrauterine
infusion of embryonic homogenates on the lifespan of the bovine corpus luteum.
J. Anim. Sci. 50:298-302
Ogino, N., Miyamoto, T., Yamamoto, S. and Hayaishi, O. (1977). Prostaglandin
endoperoxide E isomerase from bovine vesicular gland microsomes, a
glutathione-requiring enzyme. J. Biol. Chem. 252:890-895.
Ojeda, S.R., Wheaton, J.E. and McCann, S.M. (1975). Prostaglandin E2-induced release
of luteinizing hormone-releasing factor (LRF). Neuroendocrinology 17:283.
Okuda, K., Kasahara, Y., Murakami, S., Takahashi, H., Woclawek-Potocka, I. and
Skarzynski, D.J. (2003). Interferon-r blocks the stimulatory effect of tumor
necrosis factor a on prostaglandin F2„ synthesis by bovine endometrial stromal
cells. Biol. Reprod. (In Press).
Okuda, K., Miyamoto, Y. and Skarzynski, D.J. (2002). Regulation of endometrial
prostaglandin F2o, synthesis during luteolysis and early pregnancy in cattle. Dom.
Anim. Endocrinol. 23:255-264.
Orwig, K.E., Bertrand, J.E, Ou, B.R., Forsberg, N.E. and Stormshak, F. (1994).
Involvement of protein kinase-C, calpains and calpastain in prostaglandin F2a-
induced secretion from the bovine corpus luteum. Endocrinology 134:78-83.

175
Parent, J., Chapdelaine, P., Sirois, J. and Fortier, M.A. (2002). Expression of microsomal
prostaglandin E synthase in bovine endometrium: co-expression with
cyclooxygenase type 2 and regulation by interferon tau. Endocrinology
143:2936-2943.
Parent, J., Villeneuve, C., Alexenco, A.P., Ealy, A.D., and Fortier, M.A. (2003a).
Influence of different isoforms of recombinant trophoblastic interferons on
prostaglandin production in cultured bovine endometrial cells. Biol. Reprod.
68:1035-1043.
Parent, J., Villeneuve, C. and Fortier, M.A. (2003b). Evaluation of cyclooxygenase 1 and
cyclooxygenase 2 to the production of PGE2 and PGF2a in epithelial cells from
bovine endometrium. Reproduction 126:539-547.
Parkinson, T.J., Wathes, D.C., Jenner, L.M. and Lamming, G.E. (1992). Plasma and
luteal concentrations of oxytocin in cyclic and early pregnant cattle. J. Reprod.
Fértil. 94:161-167.
Penny, L.A., Armstrong, D., Bramley, T.A., Webb, R., Collins, R. and Watson, E.D.
(1999). Immune cells and cytokine production in the bovine corpus luteum
throughout the estrous cycle and after induced luteolysis. J. Reprod. Fértil.
115:87-96.
Pexton, J.E., Ford, S.P. Wilson, L. Jr., Butcher, R.L. and Inskeep, E.K. (1975).
Prostaglandin F in uterine tissue and venous plasma of ewes with intrauterine
devices. J. Anim. Sci. 41:144-153.
Picard, D. (1998). Steroids tickle cells inside and out. Nature 392:509-512.
Pratt, B.R., Butcher, R.L. and Inskeep, E.K. (1977). Antiluteolytic effect of the conceptas
and of PGE2 in ewes. J. Anim. Sci. 45:784-791.
Pru, J.K., Rueda, B, R., Austin, K.J., Thatcher, W.W. and Guzeloglu, A. (2001).
Interferon-tau suppresses prostaglandin F2a secretion independently of the
mitogen-activated protein kinase and nuclear factor k B pathways. Biol. Reprod.
64: 965-973.
Redmer, D.A. and Reynolds, L.P. (1996). Angiogenesis in the ovary. Rev. Reprod.
1:182-192.
Reese, J., Zhao, X., Ma, W., Brown, N., Maziasz, J.T. and Dey, S.K. (2001).
Comparative analysis of pharmacological and /or genetic disruption of
cyclooxygenase-1 and cyclooxygenase-2 function in female reproduction in mice.
Endocrinology 142:3198-3206.

176
Renegar, R.H., Hafs, H.D. and Britt, J.H. (1978). Luteolysis, growth hormone,
glucocoticoids, prolactin and milk production in lactating dairy cows given
prostaglandin F2a. J. Anim. Sci. 47:532-537.
Richards, J.S., Russel, D.L., Robker, R.L., Dajee, M. and Alliston, T.N. (1998).
Molecular mechanisms of ovulation and luteinization. Mol. Cell. Endocrinol.
145:47-54.
Roberts, J.S., McCracken, J.A., Gavagan, J.E. and Solof, M.S. (1976). Oxytocin release
of prostaglandin F2a from ovine endometrium in vitro: correlation with estrous
cycle and oxytocin-receptor binding. Endocrinology 99:1107-1114.
Robertson, H.A., Dwyer, R.J. and King, G.J. (1985). Estrogens in fetal and maternal
fluids throughout pregnancy in the pig and comparisons with the ewe and cow. J.
Endocrinol. 106:335-360.
Robinson, R.S., Mann, G.E., Lamming, G.E. and Wathes, D.C. (1999). The effect of
pregnancy on the expression of uterine oxytocin, estrogen and progesterone
receptors during early pregnancy in the cow. J. Endocrinol. 160:21-33.
Robinson, R.S., Mann, G.E., Lamming, G.E. and Wathes, D.C. (2001). Expression of
oxytocin, estrogen and progesterone receptors in uterine biopsy samples
throughout the estrous cycle and early pregnancy in cows. Reproduction 122:965-
979.
Rueda, B.R., Tilly, K.I., Botros, I.W., Jolly, P.D., Hansen, T.R., Hoyer, P.B. and Tilly,
J.L. (1997). Increased bax and interleukin-ip-converting enzyme messenger
ribonucleic acid levels coincide with apoptosis in the bovine corpus luteum during
structural regression. Biol. Reprod. 56:186-193.
Salli, U., Supanic, S. and Stormshak, F. (2000). Phosphorylation of myristoylated
alanine-rich C kinase substrate (MARCKS) protein associated with bovine luteal
oxytocin exocytosis. Biol. Reprod. 63:2-20.
Sanborn, B.M., Qian, A., K.u, C.Y., Wen, Y., Anwer, K., Monga, M. and Singh, S.P.
(1995). Mechanisms regulating oxytocin receptor coupling to phospholipase C in
rat and human myometrium. Adv. Exp. Med. Biol. 395:469-480.
Sanchez, R., Nguyen, D., Rocha, W., White, J.H. and Mader, S. (2002). Diversity in the
mechanisms of gene regulation by estrogen receptors. BioEssays 24:244-254.
Schallenberger, E., Schams, D. and Meyer, H.H.D. (1989). Sequences of pituitary,
ovarian and uterine hormone secretion during the first 5 weeks of pregnancy in
dairy cattle. J. Reprod. Fértil. (Suppl. 37):277-286.

177
Schams, D., Schallenberger, E., Meyer, H.H.D., Bullerman, B., Breitinger, H.J.,
Enzelhofer, G., Koll, R., Kruip, T.A.M., Walters, D.L. and Karg, H. (1985),
Ovarian oxytocin during the estrous cycle in cattle. Amico, J.A. and Robinson,
A.G. (Eds), Oxytocin, Clinical and Laboratory Studies. Elsevier Biomedical,
Amsterdam, pp 317-334.
Schams, D., Walters, D.L. and Schallenberger, E., Bullermann, B. and Karg, H. (1983).
Ovarian oxytocin in the cow. Acta. Endocr. Copen. Suppl. 253, Abstr 164.
Schatz, F., Markiewicz, L., and Gurpide, E. (1987). Differential effects of estradiol,
arachidonic acid and A23187 on prostaglandin F2a output by epithelial and
stromal cells ofhuman endometrium. Endocrinology 120:1465-1471.
Shaw, W.D. and Britt, J.H. (2000). In vivo oxytocin release from microdialyzed bovine
corpora lútea during spontaneous and prostaglandin-induced regression. Biol.
Reprod. 62:726-730.
Sheldrick, E.L., Flick-Smith, Fl.C. and Dos Santos Cruz, G.J. (1993). Oxytocin receptor
binding activity in cultured ovine endometrium. J. Reprod. Fértil. 98:521-528.
Sheldrick, F.L. and Flint, A.P.F. (1983a). Regression of the corpora lútea in sheep in
response to cloprostenol is not affected by loss of luteal oxytocin after
hysterectomy. J. Reprod. Fértil. 68:155-160.
Sheldrick, E.L. and Flint, A.P.F. (1983b). Luteal concentrations of oxytocin decline
during pregnancy in the ewe. J. Reprod. Fértil. 68:477-480.
Sheldrick, E.L. and Flint, A.P.F. (1989). Post-translational processing of oxytocin-
neurophysin prohormone in the ovine corpus luteum, activity of peptidyl glycine
a-amidating monooxygenase and concentration of its cofactor, ascorbic acid. J.
Endocrinol. 122:313-322.
Shemesh, M. (2001). Actions of gonadotropins on the uterus. Reproduction 121:835-842.
Shemesh, M., Guverich, M., Mizrachi, D., Stram, Y., Shore, L.S. and Fields, M J. (2001).
Functional importance of bovine uterine and vascular LH/hCG receptors. Sem.
Reprod. Med. 19:87-96.
Shemesh, M., Milaguir, F., Ayalon, N. and Hansel, W. (1979). Steroidogenesis and
prostaglandin synthesis by cultured bovine blastocysts. J. Reprod. Fértil. 56:171-
185.
Shemesh, M., Mizrachi, M.D., Gurevich, M., Stram, Y., Shore, L.S. and M.J. Fields
(2000). Direct involvement of luteinizing hormone in uterine function. Reprod.
Domest. Anim. 35:163-166.

178
Silvia, W.J., Lewis, G.S., McCracken, J.A., Thatcher, W.W. and Wilson, L. Jr. (1991).
Review: hormonal regulation of uterine secretion of prostaglandin F2a during
luteolysis in ruminants. Biol. Reprod. 4:655-663.
Silvia, W.J. and Taylor, M.L. (1989). Relationship between uterine secretion of
prostaglandin F2a induced by oxytocin and endogenous concentrations of estradiol
and progesterone at three stages of the bovine estrous cycle. J. Anim. Sci.
67:2347-2353.
Sirois, J. (1994). Induction of prostaglandin endoperoxide synthase-2 by human chorionic
gonadotropin in bovine preovulatory follicles in vivo. Endocrinology 135:841-
848.
Sirois, J. and Richards, J.S. (1993). Transcriptional regulation of the rat prostaglandin
endoperoxide synthase 2 gene in granulosa cells. J. Biol. Chem. 268:21931-
21938.
Skarzynski, D.J., Bogacki, M. and Kotwica, J. (1997). Changes in ovarian oxytocin
secretion as an indicator of corpus luteum response to prostaglandin F20 treatment
in cattle. Theriogenology 48:733-742.
Skarzynski, D.J., Bogacki, M. and Kotwica, J. (1999). Involvement of ovarian steroids in
basal and oxytocin-stimulated prostaglandin (PG) F2a secretion by the bovine
endometrium in vitro. Theriogenology 52:385-397.
Skarzynski, D.J., Jaroszewski, J.J and Okuda, K. (2001). Luteotrophic mechanisms in
the bovine corpus luteum: role of oxytocin, prostaglandin F2a, progesterone and
norepinephrine. J. Reprod. Dev. 47:125-137.
Skarzynski, D J., Kobayashi, S. and Okuda, K. (2000a). Influence of nitric oxide and
norepinephrine on prostaglandin F2„-induced oxytocin secretion and intracellular
calcium mobilization in cultured bovine luteal cells. Biol. Reprod. 63:1000-1005.
Skarzynski, D. J. and Kotwica, J. (1993). Mechanism of norepinephrine influence on the
secretion of ovarian oxytocin and progesterone in conscious cattle. J. Reprod.
Fértil. 97:419-424.
Skarzynski, D. J., Miyamoto, Y. and Okuda, K. (2000b). Production of prostaglandin F2a
by cultured bovine endometrial cells in response to tumor necrosis factor a: cell
type specificity and intracellular mechanisms. Biol. Reprod. 62:1116-1120.
Skarzynski, D. J. and Okuda, K. (1999). Sensitivity of bovine corpora lútea to
prostaglandin F2a is dependent on progesterone, oxytocin, and prostaglandins.
Biol. Reprod. 60:1292-1298.

179
Smith, G.W., Juengel, J.L., Mclntush, E.W., Youngquist, R.S., Gaverick, H.A. and
Smith, M.F. (1996). Ontogenies of messenger RNA encoding tissue inhibitor of
metalloproteinases 1 and 2 within bovine periovulatory follicles and luteal tissue.
Dom. Anim. Endocrinol. 13:151-160.
Smith, S.E., Dore, J.J.E. and Godkin, J.D. (1993). Effects of recombinant bovine
trophoblast protein-1 on the regulation of gene expression and prostaglandin F20
release by isolated uterine glandular epithelial and stromal cells. Biol. Reprod. 48
(Suppl. 1):404.
Smith, S.E and Godkin, J.D. (1992). Characterization of isolated bovine uterine glandular
epithelial and stromal cells. Biol. Reprod. 46 (Suppl. 1):488.
Smith, W.L. (1989). The eicosanoids and their biochemical mechanisms of action.
Biochem J. 259:315-324.
Smith, W.L., Dewitt, D.L and Garavito, R.M. (2000). Cyclooxygenases: structural,
cellular and molecular biology. Annu. Rev. Biochem. 69:145-182.
Smith, W.L., Garavito, R.M. and Dewitt, D.L (1996). Prostaglandin endoperoxide FI
synthases (cyclooxygenaes)-l and 2. J. Biol. Chem. 271:33157-33160.
Smith, W.L., Huslig, R.L., Rollins, T.E. and Fogwell, R.L. (1980). Uterine prostaglandin¬
forming cyclooxygenase: relationship to luteolysis and subcellular localization.
Adv. Prostaglandin Thromboxane Res. 8:1345-1349.
Spencer, T.E. and Bazer, F.W. (1996). Ovine interferon tau suppresses transcription of
estrogen receptor and oxytocin receptor genes in the ovine endometrium.
Endocrinology 137:1144-1147.
Spencer, T.E., Becker, W.C., George, P., Mirando, M.A., Ogle, T.F. and Bazer, F.W.
(1995a). Ovine interferon-x regulates expression of endometrial receptors for
estrogen and oxytocin but not progesterone. Biol. Reprod. 53:732-745.
Spencer, T.E., Becker, W.C., George, P., Mirando, M.A., Ogle, T.F. and Bazer, F.W.
(1995b). Ovine interferon-x inhibits estrogen receptor up-regulation and estrogen-
induced luteolysis in cyclic ewes. Endocrinology 136:4932-4944.
Spencer, T.E., Ing, N.H., Ott, T.L., Mayes, J.S., Becker, W.C., Watson, G.H., Mirando,
M.A. and Bazer, F.W. (1995c). Intrauterine injections of ovine interferon-x alters
estrogen receptor and oxytocin receptor expression in endometrium of cyclic
ewes. J. Mol. Endocrinol. 15:203-220.
Spencer, T.E., Ott, T.L. and Bazer, F.W. (1996). Tau-interferon: pregnancy recognition
signal in ruminants. Proc. Soc. Exp. Biol. Med. 213:215-229.

180
Subbaramaiah, K., Chung, W.J., Michaluart, P., Telang, N., Tanabe, T., Inoue, H., Jang,
M., Pezzuto, J.M. and Dannenberg, A.J. (1998). Resveratrol inhibits
cyclooxygenase-2 transcription and activity in phorbol ester-treated human
mammary epithelial cells. J. Biol. Chem. 273:21875-21882.
Suzuki, T., Fujii, Y., Miyano, M., Chen, L.Y., Takahashi, T. and Watanabe, K. (1999a).
cDNA cloning, expression, and mutagenesis study of liver-type prostaglandin F
synthase. J. Biol. Chem. 274:241-248.
Suzuki, T, Nishizawa, M., Fukui, M., Okuda, E. Nakajima, T. and Ito, S. (1999b). cDNA
cloning expression and characterization of human prostaglandin F synthase. FEBS
Lett. 462:335-340.
Swinney, D.C., Mak, A.Y., Barnett, J. and Ramesha, C.S. (1997). Differential allosteric
regulation of prostaglandin H synthase 1 and 2 by arachidonic acid. J. Biol.
Chem. 272:12393-12398.
Takemura, M., Kimura, T., Nomura, S., Makino, Y., Inove, T., Kichuki, T., Kubota, Y.,
Tokugawa, Y., Nokunaga, T., Kamiura, S., Onove, H., Azuma, C., Saji, F.,
Kitamura, Y. and Tanizawa, O. (1994). Expression and localization of human
oxytocin mRNA and its protein in chorion and deciduas during parturition. J.
Clin. Invest. 93:2319-2324.
Taniguchi, H., Yokomizo, Y. and Okuda, K. (2002). Fas-Fas ligand system mediates
luteal cell death in bovine corpus luteum. Biol. Reprod. 66:754-759.
Tanioka, T., Nakatami, Y., Semmyo, N., Murakami, M. and Kudo, I. (2000). Molecular
identification of cytosolic prostaglandin E synthase that is functionally coupled
with cyclooxygenase-1 in immediate prostaglandin E2 biosynthesis. J. Biol.
Chem. 275:32775-32782.
Telgmann, R., Bathgate, R.A.D., Jaeger, S., Tillmann, G. and Ivell, R. (2003).
Transcriptional regulation of the bovine oxytocin receptor. Biol. Reprod. 68:1015-
1026.
Thatcher, W.W., Guzeloglu, A., Meikle, A., Kamimura, S., Bilby, T., Kowalski, A.,
Badinga, L., Pershing, R., Bartolomé, J. and Santos, E.P. (2003a). Regulation of
embryo survival in cattle. Reproduction (Suppl.) 61:253-266.
Thatcher, W.W., Guzeloglu, A. and Michel, F. (2003b). Bovine endometrial cells:
molecular and functional responses to phorbol ester and interferon-tau (IFN-t).
Biol. Reprod. 68 (Suppl. 1):244.
Thatcher, W.W., Meyer, M.D. and Danet-Desnoyers, G. (1995). Maternal recognition of
pregnancy. J. Reprod. Fértil. 49:15-28.

181
Thatcher, W.W., Staples, C.R., Danet-Desnoyers, G., Oldick, B. and Schmitt, E-P.
(1994). Embryo health and mortality in sheep and cattle. J. Anim. Sci. 72 (Suppl.
3): 16-30.
Thatcher, W.W., Wolfenson, D., Curl, J.S., Rico, L.E., Knickerbocker, J.J., Bazer, F.W.
and Drost, M. (1984). Prostaglandin dynamics associated with development of the
bovine conceptas. Anim. Reprod. Sci. 7:149-176.
Thibodeaux, J.K., Myers, M.W., Roussel, J.D. and Godke, R.A. (1992). Intrauterine
infusion of prostaglandin E2 and subsequent luteal function in cattle.
Prostaglandins 44:531-541.
Thibonnier, M., Comarty, D.M., Preston, J.A., Plesnisher, C.L., Dweik, R.A. and
Erzurum, S.C. (1999). Human vascular endothelial cells express oxytocin
receptors. Endocrinology 140:1304-1309.
Thoren, S. and Jakobsson, P. (2000). Coordinate up and down-regulation of glutathione-
dependent prostaglandin E synthase and cyclooxygenase in A549 cells. Inhibition
by NS-398 and leukotriene C4. Eur. J. Biochem. 267:6428-6434.
Tsai, S.J., Juengel, J.L. and Wiltbank, M.C. (1997). Hormonal regulation of monocyte
chemoattractant protein-1 messenger ribonucleic acid expression in corpora lútea.
Endocrinology 138:4517-4520.
Tsai, S J. and Wiltbank, M.C. (1997). Prostaglandin F2a induces expression of
prostaglandin G/H synthase-2 in the ovine corpus luteum: a potential positive
feedback loop during luteolysis. Biol. Reprod. 57:1016-1022.
Tsai, S.J., Wiltbank, M.C. and Bodensteiner, K.J. (1996). Distinct mechanisms regulate
induction of messenger ribonucleic acid for prostaglandin G/H synthase-2, PGE
(EP3) receptor in bovine preovulatory follicles. Endocrinology 137:3348-3355.
Tyselling, K.A., Thatcher, W.W., Bazer, F.W., Hansen, P.J. and Mirando, M.A. (1998).
Mechanisms regulating prostaglandin F2a synthesis in the bovine endometrium. J.
Dairy Sci. 81:382-389.
Vallet, J.L., Lamming, G.E. and Batten, M. (1990). Control of the endometrial oxytocin
receptors and uterine response to oxytocin by progesterone and estradiol in the
ewe. J. Reprod. Fértil. 90:625-634.
Voss, A.K. and Fortune, J.E. (1991). Oxytocin secretion by bovine granulosa cells:
effects of stage of follicular development, gonadotropins and coculture with theca
intema. Endocrinology 128:1991-1999.

182
Walters, D.L., Schams, D., Bullemian, B. and Schallenberger, E. (1983). Pulsatile
secretion of gonadotropins, ovarian steroids and ovarian oxytocin during
luteolysis in the cow. Biol. Reprod. 28 (Suppl.l):142.
Ward, K.E.L., Longwell, L.C., Kreider, J.L. and Godke, R.A. (1976). Effect of unilateral
ovariectomy on cycling heifers. J. Anim. Sci. 43:309.
Watanabe, K. (2002). Prostaglandin F synthase. Prostaglandins Other Lipid Mediators.
68-69:401-407.
Watanabe, K., Fujii, Y., Nakayama, K, Okhubo, H., Kuramitsu, S., Kagamiyama, FI.,
Nakanishi, S. and ffayaishi, O. (1988). Structural similarity of the bovine lung
prostaglandin F synthase to lens G-crystallin of the European common frog. Proc.
Natl. Acad. Sci. USA 85:11-15.
Watanabe, K., Yoshida, R., Shimizu, T. and Hayaishi, O. (1985). Enzymatic formation of
prostaglandin F2 alpha from prostaglandin H2 and D2. Purification and properties
of prostaglandin F synthase from bovine lung. J. Biol. Chem. 260:7035-7041.
Wathes, D.C. and Denning-Kall, P.A. (1992). Control of synthesis and secretion of
ovarian oxytocin in ruminants. J. Reprod. Fértil. 45:39-52.
Wathes, D.C, Guldenaar, S.E., Swann, R.W., Webb, R., Porter, D.G. and Pickering, B.T.
(1986). A combined radioimmunoassay and immunocytochemical study of
ovarian oxytocin production during the periovulatory period in the ewe. J.
Reprod. Fértil. 78:167-173.
Wathes, D.C. and Lamming, G.E. (1995). The oxytocin receptor, luteolysis and the
maintenance of pregnancy. J. Reprod. Fértil. 49:53-67.
Wathes, D.C., Mann, G.E., Payne, J.H., Riley, P.R., Stevenson, K.R. and Lamming, G.E.
(1996). The regulation of oxytocin, estradiol and progesterone receptor in
different uterine regions by estradiol, progesterone and oxytocin in
ovariectomized ewes. J. Endocrinol. 151:375-393.
Wathes, D.C., Swann, R.W., Birkett, S.D., Porter, D.G. and BT Pickering, B.T. (1983).
Characterization of oxytocin, vasopressin, and neurophysin from the bovine
corpus luteum. Endocrinology 113:693-698.
Wathes, D.C., Swann, R.W. and Pickering, B.T. (1984). Variations in oxytocin,
vasopressin and neurophysin concentrations in the bovine ovary during the
estrous cycle in the cow. J. Reprod. Fértil. 71:551-557.
Webb, R., Woad, K.J. and Armstrong, D.G. (2002). Corpus luteum (CL) function: local
control mechanisms. Domest. Anim. Endocrinol. 23:277-285.

183
Westbrook, C. and Jarabak, J. (1975). Purification and partial characterization of an
NADH -linked delta 13-15-ketoprostaglandin reductase from human placenta.
Biochem. Biophys. Res. Commun. 66:541-546.
Williams, C.S. and Dubois, R.N. (1996). Prostaglandin endoperoxide synthase: why two
isoforms? Am. J. Med. 106:37S-42S.
Williams, G.L., Gazal, O.S., Leshin, L.S., Stanko, R.L. and Anderson, L.L. (2001).
Physiological regulation of maternal behaviour in heifers: roles of genital
stimulation, intracerebral oxytocin release and ovarian steroids. Biol. Reprod.
65:295-300.
Williams, W.F., Lewis, G.S., Thatcher, W.W. and Underwood, C.S. (1983). Plasma 13,
14-dihydro-15-keto-PGF2a in pregnant and nonpregnant heifers prior to and
during surgery and following intrauterine injection of PGF2a. Prostaglandins
25:891-899.
Wiltbank, M.C., Wiepz, G.J., Knickerbocker, J.J., Belfiore, C.J. and Niswender, G.D.
(1992). Proteins secreted by the early ovine conceptas block the action of
prostaglandin F2a on large luteal cells. Biol. Reprod. 46:475-482.
Wintergalen, N., Thole, H.H., Galla, H.J. and Schlegel, W. (1995). Prostaglandin E2 9-
ketoreductase from the corpus luteum of a pseudopregnant rabbit is a member of
the aldo-keto reductase superfamily featuring 20-hydroxysteroid dehydrogenase
activity. Eur. J. Biochem. 234:264-270.
Wolfenson, D.D., Bartol, F.F., Badinga, L., Barros, C.M., Marple, D.N., Cummins, K.,
Wolf, D., Lucy, M.C., Spencer, T.E. and Thatcher, W.W. (1993). Secretion of
PGF2C, and oxytocin during hyperthermia in cyclic and pregnant heifers.
Theriogenology 39:1129-1141.
Wong, W.Y.L., DeWitt, D.L., Smith, W.L. and Richards, J.S. (1989). Rapid induction of
prostaglandin endoperoxide synthase in rat preovulatory follicles by luteinizing
hormone and cAMP is blocked by inhibitors of transcription and translation. Mol.
Endocrinol. 3:1714-1723.
Wooding, F.B. (1984). Role of binucleate cells in fetomatemal cell fusion at implantation
in sheep. Am. J. Anat. 170:233-50.
Wooding, F.B.P. and Flint, A.P.F. (1994). Placentation. In Marshall’s Physiology of
Reproduction, Vol. 3 (Ed.) Lamming, G.E. Chapman & Hall, pp 233-460.
Wright, M.F., Sayre, B., Inskeep, E.K. and Flores, LA. (2001). Prostaglandin F2a
regulation of the bovine corpus luteum endothelin system during the early and
mid-luteal phase. Biol. Reprod. 65:1710-1717.

184
Wu, W.X., Ma, X.H., Yoshizato, T., Shinozuka, N. and Nathaniel, P.W. (2001). Increase
in prostaglandin H synthase 2, but not prostaglandin F2a synthase mRNA in
intrauterine tissues during betamethasone-induced premature labor and
spontaneous term labor in sheep. J. Soc. Gynecol. Investig. 8:69-76.
Wu, Y. and Wiltbank, M. (2002). Transcriptional regulation of cyclooxygenase-2 gene
changes from protein kinase (PK) A- to PKC-dependence after luteinization of
granulosa cells. Biol. Reprod. 66:1505-1514.
Wu, Y. and Wiltbank, M.C. (2001). Transcriptional regulation of cyclooxygenase in
ovine large luteal cells. Biol. Reprod. 65:1565-1572.
Wuttke, W., Pitzel, L., Knoke, I., Theiling, K. and Jarry, H. (1997). Immune-endocrine
interactions affecting luteal function in pigs. J. Reprod. Fértil. Suppl. 52:19-29.
Xiao, C.W., Liu, J. M., Sirois, J. and Goff, A.K. (1998). Regulation of cyclooxygenase-2
and prostaglandin F synthase expression by steroid hormones and interferon-r in
bovine endometrial cells. Endocrinology 139:2293-2299.
Xiao, W. C., Murphy, B.D., Sirois, J. and Goff, A.K. (1999). Down-regulation of
oxytocin-induced cyclooxygenase-2 and prostaglandin F synthase expression by
interferon-x in bovine endometrial cells. Biol. Reprod. 60:656-663.
Xie, W.L., Chipman, J.G., Robertson, D.L., Erikson, R.L. and Simmons, D.L. (1991).
Expression of a mitogen-responsive gene encoding prostaglandin synthase is
regulated by mRNA splicing. Proc. Natl. Acad. Sci. USA. 88:2692-2696.
Zhang, B. and Tsang, P.C.W. (2001). Are matrix metalloproteinase 2 (MMP-2) and tissue
inhibitor of metalloproteinases 2 (TIMP-2) coordinately expressed with
membrane type 1 metalloproteinase (MT1-MMP) in the bovine corpus luteum
(CL) during the estrous cycle? Biol. Reprod. 64 (Suppl. 1):236.
Zhang, B., Yan, L., Moses, M.A. and Tsang, P.C.W. (2002). Bovine membrane-type 1
matrix metalloproteinase: molecular cloning and expression in the corpus luteum.
Biol. Reprod. 67:99-106.
Zhang, V., O’Sullivan, M., Hussain, H., Roswit, W.T. and Holtzman, M.J. (1996).
Molecular cloning, functional expression, and selective regulation of ovine
prostaglandin H synthase-2. Biochem. Biophys. Res. Commun. 227:499-506.
Zinng, H.H., Grazzini, E., Breton, C., Larcher, A., Rozen, F., Russo, C., Guillon, G. and
Mouillac, B. (1998). Genomic and non-genomic mechanisms of oxytocin recptor
regulation. Adv. Exp. Med. Biol. 449:287-295.

BIOGRAPHICAL SKETCH
Hilary Binta was born in Uganda on August 27lh 1965 to the late Dr. Paul B. Binta
and lmelda Binta. Hilary received his Bachelor of Veterinary Medicine (BVM) degree
from Makerere University, Kampala, Uganda in 1992. He worked briefly as a Teaching
Assistant in the Department of Veterinary Reproduction from 1991 to 1992. He received
his Master of Science degree in Veterinary Clinical Studies from University of Nairobi,
Kenya in 1994. He was appointed a Lecturer in the Department of Veterinary
Reproduction, Makerere University in 1995. After completion of his degree he will
return to Uganda to lecture and conduct research in the Department of Veterinary
Reproduction, Makerere University.
185

I certify that I have read this study and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope and quality, as a
dissertation for the degree of Doctor of Philosophy.
Michael J. Fiejds, Chair
Professor ofAnimal Sciences
I certify that I have read this study and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope and quality, as a
dissertation for the degree of Doctor df Philosophy.
William W. Thatcher
Graduate Research Professor of Animal Sciences
I certify that I have read this study and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope and quality, as a
dissertation for the degree of Doctorp£Philosophy.
Peter J. Hansen
Professor of Animal Sciences
I certify that I have read this study and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope and quality, as a
dissertation for the degree of Doctor of Philosophy.
Maarten Drost
Professor of Veterinary Medicine
I certify that I have read this study and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope and quality, as a
dissertation for the degree of Doctor of Philosophy.
Scientist of Biochemistry and Molecular Biology

This dissertation was submitted to the Graduate Faculty of the College of
Agricultural and Life Sciences and to the Graduate School and was accepted as partial
fulfillment of the requirements for the degree of Doctor of Philosophy.
December 2003
Dean, Graduate School

UNIVERSITY OF FLORIDA
3 1262 08556 iilP



xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID ETJJS4F4A_PN9C82 INGEST_TIME 2014-04-14T19:31:47Z PACKAGE AA00014263_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES



PAGE 1

(;35(66,21 2) *(1(6 ,192/9(' ,1 35267$12,' 6<17+(6,6 ,1 7+( (1'20(75,80 $1' &+25,2$//$172,6 2) 7+( &2: %\ +,/$5< %,17$ $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

$&.12:/('*0(176 ZRXOG OLNH WR WKDQN 'U 0 )LHOGV IRU EHLQJ P\ JUDGXDWH DGYLVRU DQG FKDLUPDQ RI P\ VXSHUYLVRU\ FRPPLWWHH :LWKRXW KLV FRQVWDQW HQFRXUDJHPHQW DQG VXSSRUW LW ZRXOG KDYH QRW EHHQ SRVVLEOH WR ILQLVK P\ GLVVHUWDWLRQ 0\ WKDQNV JR WR DOO RI P\ FRPPLWWHH PHPEHUV 'UV :LOOLDP 7KDWFKHU 3HWHU +DQVHQ 1DQF\ 'HQVORZ DQG 0DDUWHQ 'URVWf IRU WKHLU YDOXDEOH LQSXW DQG DGYLFH UHJDUGLQJ P\ UHVHDUFK ZRXOG OLNH WR WKDQN 'U 6KRX 0HL &KDQJ IRU LQWURGXFLQJ PH WR PRVW RI WKH ODERUDWRU\ WHFKQLTXHV WKDW XVHG WR FRQGXFW P\ UHVHDUFK 0\ WKDQNV DOVR JR WR 'UV /RNHQJD %DGLQJD DQG 5RVDOLD 6LPPHQ IRU DOORZLQJ PH WR XVH WKH IDFLOLWLHV LQ WKHLU ODEV ZRXOG DOVR OLNH WR WKDQN $OODQ (OGUHG DQG WKH JUDGXDWH VWXGHQWV LQ RXU ODE 1LFROH 1LFKROV DQG (OL]DEHWK -RKQVRQf IRU WKHLU DVVLVWDQFH DQG IULHQGVKLS GXULQJ P\ VWD\ LQ WKH ODE DP JUDWHIXO WR WKH ,QVWLWXWH IRU ,QWHUQDWLRQDO (GXFDWLRQ IRU KDYLQJ RIIHUHG PH D )XOEULJKW )HOORZVKLS DQG WR 0DNHUHUH 8QLYHUVLW\ IRU JUDQWLQJ PH VWXG\ OHDYH WR SXUVXH P\ JUDGXDWH VWXGLHV DW WKH 8QLYHUVLW\ RI )ORULGD 0\ JUDWLWXGH DOVR JRHV WR 8QLYHUVLW\ RI )ORULGD IRU JUDQWLQJ PH DQ DVVLVWDQWVKLS WR FRPSOHWH P\ VWXGLHV ZRXOG OLNH WR WKDQN P\ IDPLO\ IRU WKHLU VXSSRUW WKURXJKRXW P\ HGXFDWLRQ 0\ WKDQNV DOVR JR WR DOO RI WKH JUDGXDWH VWXGHQWV IDFXOW\ DQG VWDII LQ WKH 'HSDUWPHQW RI $QLPDO 6FLHQFHV IRU WKHLU IULHQGVKLS DQG DVVLVWDQFH GXULQJ P\ VWXGLHV WKDQN DOO RI P\ IULHQGV HVSHFLDOO\ 'U (GPRQG .DEDJDPEH -XUMHQ /X\N[ -XVWLQ 6RERWD DQG (ULF +LHUV IRU WKHLU FRQVWDQW LL HQFRXUDJHPHQW DQG VXSSRUW

PAGE 3

, ZRXOG OLNH WR WKDQN P\ ZLIH $QJHOD IRU DOO RI WKH ORYH XQGHUVWDQGLQJ DQG VXSSRUW WKDW VKH JDYH PH GXULQJ P\ JUDGXDWH VWXGLHV /DVW EXW QRW OHDVW ZRXOG OLNH WR WKDQN P\ VRQ -HIIUH\ IRU DOO RI WKH KDSSLQHVV DQG ORYH WKDW KH EULQJV WR P\ OLIH

PAGE 4

7$%/( 2) &217(176 3DJH $&.12:/('*(0(176 LL /,67 2) 7$%/(6 YLL /,67 2) ),*85(6 L[ $%675$&7 [LL &+$37(5 ,1752'8&7,21 /,7(5$785( 5(9,(: /XWHRO\VLV )XQFWLRQDO /XWHRO\VLV 6WUXFWXUDO /XWHRO\VLV 5HJXODWLRQ RI 3URVWDJODQGLQ 6\QWKHVLV ,QKLELWLRQ RI /XWHRO\VLV E\ WKH (PEU\R 5HVXPSWLRQ RI 3URVWDJODQGLQ 6\QWKHVLV DIWHU 0DWHUQDO 5HFRJQLWLRQ RI 3UHJQDQF\ 3URSHUWLHV RI WKH .H\ (OHPHQWV ,QYROYHG LQ /XWHRO\VLV %RYLQH 2[\WRFLQ 5HFHSWRU 2[\WRFLQ 5HFHSWRU 6LJQDOLQJ 5HJXODWLRQ RI 2[\WRFLQ 5HFHSWRU 3URVWDJODQGLQ +6\QWKDVH 6WUXFWXUH RI %RYLQH 3*+6 *HQH 6LJQDO 7UDQVGXFWLRQ WKURXJK 3*+6 5HJXODWLRQ RI 3*+6 *HQH ([SUHVVLRQ 3URVWDJODQGLQ ) 6\QWKDVH 5HJXODWLRQ RI 3URVWDJODQGLQ ) 6\QWKDVH 3URVWDJODQGLQ ( 6\QWKDVH 5HJXODWLRQ RI 3URVWDJODQGLQ ( 6\QWKDVH %RYLQH /XWHDO 27 LY

PAGE 5

5(/($6( 2) 2;<72&,1 )520 29$5,$1 9(5686 3,78,7$5< 7,668(6 ,1 5(63216( 72 3*)D ,1 29$5,(&720,=(' $1' 6+$0 29$5,(&720,=(' &2:6 '85,1* 7+( 3(5,,03/$17$7,21 3(5,2' ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 5HVXOWV 'LVFXVVLRQ (;35(66,21 2) 2;<72&,1 5(&(3725 35267$*/$1',1 *+ 6<17+$6( ( $1' ) 6<17+$6(6 ,1 7+( %29,1( (1'20(75,80 $1' &+25,2$//$172,6 '85,1* 7+( (675286 &<&/( $1' 3(5, ,03/$17$7,21 3(5,2' ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 5HVXOWV 'LVFXVVLRQ *(1(5$/ ',6&866,21 $1' &21&/86,216 $33(1',; $ &2175$676 )25 75($70(17 3(5,2' 7,0( $1' ,17(5$&7,216 % '$7$ )25 275 P51$ (;35(66,21 & '$7$ )25 6 U51$ (;35(66,21 '$7$ )25 3*+6 UQ51$ (;35(66,21 ( '$7$ )25 3*(6 P51$ (;35(66,21 ) '$7$ )25 3*)6 P51$ (;35(66,21 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+

PAGE 6

/,67 2) 7$%/(6 7DEOH (GJH 3URVWDJODQGLQ V\QWKDVH HQ]\PHV WKDW EHORQJ WR WKH DOGRNHWRUHGXFWDVH VXSHUIDPLO\ 0HPEUDQH DVVRFLDWHG SURWHLQV LQ HLFRVDQRLGV DQG JOXWDWKLRQH PHWDEROLVP VXSHUIDPLO\ ([SHULPHQWDO GHVLJQ IRU LQ YLYR VWXG\ WR DVFHUWDLQ UHVSRQVH RI 3*)D2U VDOLQH RQ OXWHDO 27 UHOHDVH LQ SHULLPSODQWDWLRQ FRZV 6HTXHQFHV RI SULPHUV DQG SUREHV XVHG IRU 573&5 /HDVW VTXDUHV PHDQV IRU 275 3*+6 3*(6 DQG 3*)6 P51$ LQ LQWHUFDUXQFXODU HQGRPHWULXP RI EHHI FRZV IURP GD\ WR RI WKH HVWURXV F\FOH RU SUHJQDQF\ /HDVW VTXDUHV PHDQV IRU 275 3*+6 3*(6 DQG 3*)6 P51$ LQ LQWHUn FDUXQFXODU HQGRPHWULXP RI EHHI FRZV IURP GD\V WR RI WKH HVWURXV F\FOH /HDVW VTXDUHV PHDQV IRU 275 3*+6 3*(6 DQG 3*)6 P51$ LQ LQWHUFDUXQFXODU HQGRPHWULXP RI EHHI FRZV IURP GD\V WR RI SUHJQDQF\ /HDVW VTXDUHV PHDQV IRU 275 3*+6 3*(6 DQG 3*)6 P51$ LQ WKH FKRULRDOODQWRLV RI EHHI FRZV IURP GD\V WR RI SUHJQDQF\ /HDVW VTXDUHV PHDQV IRU 275 DQG 3*+6 P51$ LQ FDUXQFXODU HQGRPHWULXP RI EHHI FRZV IURP GD\V WR RI WKH HVWURXV F\FOH RU SUHJQDQF\ /HDVW VTXDUHV PHDQV IRU 275 DQG 3*+6 P51$ LQ FDUXQFXODU HQGRPHWULXP RI EHHI FRZV IURP GD\V WR RI WKH HVWURXV F\FOH /HDVW VTXDUHV PHDQV IRU 275 3*+6 3*(6 DQG 3*)6 P51$ LQ FDUXQFXODU HQGRPHWULXP RI EHHI FRZV IURP GD\V WR RI SUHJQDQF\ &RUUHODWLRQV EHWZHHQ P51$V IRU 275 3*(6 3*+6 DQG 3*)6 LQ LQWHUFDUXQFXODU HQGRPHWULXP RI EHHI FRZV RQ GD\V DQG RI WKH HVWURXV F\FOH YL

PAGE 7

&RUUHODWLRQV EHWZHHQ P51$V IRU 275 3*(6 3*+6 DQG 3*)6 LQ LQWHUFDUXQFXODU HQGRPHWULXP RI EHHI FRZV RQ GD\V DQG RI WKH HVWURXV F\FOH RU SUHJQDQF\

PAGE 8

/,67 2) ),*85(6 )LJXUH SDJH ([SHULPHQWDO SURWRFRO IRU UHVSRQVH RI 3*)D RU VDOLQH RQ OXWHDO 27 UHOHDVH LQ SHULLPSODQWDWLRQ FRZV /HDVW VTXDUHV PHDQV s 6(0f SODVPD FRQFHQWUDWLRQV RI R[\WRFLQ LQ RYDULHFWRPL]HG DQG VKDPRYDULHFWRPL]HG 3*)DWUHDWHG FRZV GD\ SUHJQDQW /HDVW VTXDUHV PHDQV s 6(0f SODVPD FRQFHQWUDWLRQV RI R[\WRFLQ LQ VKDPRYDULHFWRPL]HG 3*)D DQG VDOLQHWUHDWHG FRZV GD\ SUHJQDQW /HDVW VTXDUHV PHDQV s 6(0f SODVPD FRQFHQWUDWLRQV RI R[\WRFLQ LQ VKDPRYDULHFWRPL]HG 3*) DQG VDOLQHWUHDWHG FRZV GD\ SUHJQDQW 7UHDWPHQW E\ GD\ RI SUHJQDQF\ E\ SHULRG LQWHUDFWLRQ IRU R[\WRFLQ LQ VKDPRYDULHFWRPL]HG FRZV UHFHLYLQJ 3*) RU VDOLQH RQ GD\ RU RI SUHJQDQF\ $PSOLILFDWLRQ SORW VKRZLQJ VHULDO GLOXWLRQV RI WRWDO 51$ XVHG LQ WKH YDOLGDWLRQ WR TXDQWLWDWH 275 P51$ $PSOLILFDWLRQ SORW VKRZLQJ VHULDO GLOXWLRQV RI WRWDO 51$ XVHG LQ WKH YDOLGDWLRQ WR TXDQWLWDWH 6 U51$ 6WDQGDUG FXUYH IRU HVWLPDWLRQ RI HIILFLHQF\ RI DPSOLILFDWLRQ RI 275 JHQH IRU YDOLGDWLRQ RI $ $ &W PHWKRG 6WDQGDUG FXUYH IRU HVWLPDWLRQ RI HIILFLHQF\ RI DPSOLILFDWLRQ RI 6 U51$ JHQH IRU YDOLGDWLRQ RI $ $ &W PHWKRG $PSOLILFDWLRQ SORW VKRZLQJ VHULDO GLOXWLRQV RI WRWDO 51$ XVHG LQ WKH YDOLGDWLRQ WR TXDQWLWDWH 3*+6 P51$ 6WDQGDUG FXUYH IRU HVWLPDWLRQ RI HIILFLHQF\ RI DPSOLILFDWLRQ RI 3*+6 JHQH IRU YDOLGDWLRQ RI $ $ &W PHWKRG $PSOLILFDWLRQ SORW VKRZLQJ VHULDO GLOXWLRQV RI WRWDO 51$ XVHG LQ YDOLGDWLRQ WR TXDQWLWDWH 3*(6 P51$ H[SUHVVLRQ YLLL

PAGE 9

6WDQGDUG FXUYH IRU HVWLPDWLRQ RI HIILFLHQF\ RI DPSOLILFDWLRQ RI 3*(6 JHQH IRU YDOLGDWLRQ RI $ $ &W PHWKRG $PSOLILFDWLRQ SORW VKRZLQJ VHULDO GLOXWLRQV RI WRWDO 51$ XVHG LQ WKH YDOLGDWLRQ WR TXDQWLWDWH 3*)6 P51$ H[SUHVVLRQ 6WDQGDUG FXUYH IRU HVWLPDWLRQ RI HIILFLHQF\ RI DPSOLILFDWLRQ RI 3*)6 JHQH IRU YDOLGDWLRQ RI $ $&[ PHWKRG 2[\WRFLQ UHFHSWRU FRQFHQWUDWLRQV LQ LQWHUFDUXQFXODU HQGRPHWULXP RI EHHI FRZV F\FOLFSUHJQDQW LQWHUDFWLRQ E\ GD\ 3URVWDJODQGLQ *+ 6\QWKDVH P51$ FRQFHQWUDWLRQV LQ LQWHUFDUXQFXODU HQGRPHWULXP RI EHHI FRZV F\FOLFSUHJQDQW LQWHUDFWLRQ E\ GD\ YV 5HJUHVVLRQ FXUYHV IRU 275 3*)6 3*+6 DQG 3*(6 P51$ H[SUHVVLRQ LQ LQWHUFDUXQFXODU HQGRPHWULXP RI EHHI FRZV IURP GD\V WR RI SUHJQDQF\ 2[\WRFLQ UHFHSWRU DQG 3*+6 P51$ FRQFHQWUDWLRQV LQ FDUXQFXODU HQGRPHWULXP RI EHHI FRZV F\FOLFSUHJQDQW E\ GD\ LQWHUDFWLRQ IRU 275 DQG GD\ IRU 3*+6 5HJUHVVLRQ FXUYHV IRU 275 DQG 3*+6 P51$ H[SUHVVLRQ LQ FDUXQFXODU HQGRPHWULXP RI EHHI FRZV IURP GD\V HVWUXVf WR RI WKH HVWURXV F\FOH 5HJUHVVLRQ FXUYHV IRU 275 DQG 3*+6 P51$ H[SUHVVLRQ LQ FDUXQFXODU HQGRPHWULXP RI EHHI FRZV IURP GD\V WR RI SUHJQDQF\ ,PPXQRKLVWRFKHPLFDO VWDLQLQJ RI ERYLQH 275 LQ UHSUHVHQWDWLYH VHFWLRQV RI WKH LQWHUFDUXQFXODU HQGRPHWULXP GXULQJ WKH HVWURXV F\FOH ,PPXQRKLVWRFKHPLFDO VWDLQLQJ RI ERYLQH 275 LQ UHSUHVHQWDWLYH VHFWLRQV RI WKH LQWHUFDUXQFXODU HQGRPHWULXP GXULQJ WKH SHULLPSODQWDWLRQ SHULRG ,PPXQRKLVWRFKHPLFDO VWDLQLQJ RI ERYLQH 3*+6 LQ UHSUHVHQWDWLYH VHFWLRQV RI WKH LQWHUFDUXQFXODU HQGRPHWULXP GXULQJ WKH HVWURXV F\FOH ,PPXQRKLVWRFKHPLFDO VWDLQLQJ RI ERYLQH 3*+6 LQ UHSUHVHQWDWLYH VHFWLRQV RI WKH LQWHUFDUXQFXODU HQGRPHWULXP GXULQJ WKH SHULLPSODQWDWLRQ SHULRG ,OO +\SRWKHWLFDO PRGHO IRU WKH UHJXODWLRQ RI 275 3*+6 3*(6 DQG 3*)6 H[SUHVVLRQ GXULQJ WKH ERYLQH HVWURXV F\FOH +\SRWKHWLFDO PRGHO IRU WKH UHJXODWLRQ RI 275 3*+6 3*(6 DQG 3*)6 H[SUHVVLRQ GXULQJ WKH SHULLPSODQWDWLRQ SHULRG L[

PAGE 10

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ (;35(66,21 2) *(1(6 ,192/9(' ,1 35267$12,' 6<17+(6,6 ,1 7+( (1'20(75,80 $1' &+25,2$//$172,6 2) 7+( &2: %\ +LODU\ %LQWD 'HFHPEHU &KDLUPDQ 0LFKDHO )LHOGV 0DMRU 'HSDUWPHQW $QLPDO 6FLHQFHV 2[\WRFLQ 27f SURGXFHG E\ WKH FRUSXV OXWHXP &/f DQG WKH QHXURK\SRSK\VLV DXJPHQWV SXOVDWLOH SURVWDJODQGLQ )f3*)f WKDW XOWLPDWHO\ OHDGV WR OXWHRO\VLV (Q]\PHV LQYROYHG LQ WKH SDWKZD\ IRU SURVWDJODQGLQ V\QWKHVLV KDYH D UROH LQ OXWHRO\VLV DQG PD\ KDYH LPSRUWDQW IXQFWLRQV GXULQJ WKH LPSODQWDWLRQ SHULRG WKDW LQIOXHQFH HPEU\R VXUYLYDO RU ORVV 2XU REMHFWLYHV ZHUH f 7R GHWHUPLQH WKH HIIHFW RI 3*)D RQ SODVPD 27 LQ SHULLPSODQWDWLRQ FRZV f 7R GHWHUPLQH KRZ WKH H[SUHVVLRQ RI R[\WRFLQ UHFHSWRU 275f SURVWDJODQGLQ *+ V\QWKDVH 3*+6f DQG ( DQG ) V\QWKDVHV 3*(6 DQG 3*)6f FKDQJHV LQ WKH HQGRPHWULXP RI F\FOLF FRZV f 7R DVFHUWDLQ WKH HIIHFW RI WKH FRQFHSWDV RQ H[SUHVVLRQ RI SURVWDJODQGLQ V\QWKHVLV HQ]\PHV DQG 275 GXULQJ WKH SHULRG RI PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ [

PAGE 11

f 7R GHWHUPLQH ZKHWKHU 275 DQG SURVWDJODQGLQ V\QWKHVLV V\VWHP DUH UHHVWDEOLVKHG DIWHU PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ 7R HYDOXDWH WKH UROH RI 27 GXULQJ WKH SHUL LPSODQWDWLRQ SHULRG RYDULHFWRPL]HG 'D\ f RU RYDULDQ LQWDFW 'D\V DQG f SUHJQDQW FRZV ZHUH FKDOOHQJHG ZLWK HLWKHU 3*)L RU VDOLQH $ GRVH RI PJ 3*)D UHVXOWHG LQ VLJQLILFDQW UHOHDVH RI OXWHDO 27 LQ 'D\ EXW QRW 'D\ FRZV ([SUHVVLRQ RI 275 DQG 3*(6 ZDV KLJK DW HVWUXV DQG ORZ GXULQJ WKH OXWHDO SKDVH 7KH 3*+6 ZDV KLJKO\ H[SUHVVHG GXULQJ WKH ODWH OXWHDO SKDVH SURHVWUXV DQG IURP GD\V WR RI SUHJQDQF\ ([SUHVVLRQ RI 3*(6 GHFUHDVHG GXULQJ WKH SHULLPSODQWDWLRQ SHULRG 7KH 3*)6 ZDV H[SUHVVHG KLJKO\ RQ 'D\V DQG RI WKH F\FOH DQG FRPSDUDEOH GD\V RI SUHJQDQF\ EXW ZDV GRZQUHJXODWHG ODWHU 3RVLWLYH FRUUHODWLRQV ZHUH REVHUYHG IRU 2753*(6 3*(63*)6 DQG 2753*)6 ,W LV FRQFOXGHG WKDW WKH &/ LV FDSDEOH RI VHFUHWLQJ 27 LQ UHVSRQVH WR 3*)D GXULQJ WKH HDUO\ SHULLPSODQWDWLRQ SHULRG 7KH QHXURK\SRSK\VLV LV D VRXUFH RI SODVPD 27 GXULQJ SHULLPSODQWDWLRQ SHULRG 7KH ORZ H[SUHVVLRQ RI 275 P51$ DQG SURWHLQ GXULQJ SHUL LPSODQWDWLRQ DQG ORZ OXWHDO 27 PD\ QRW EH DGHTXDWH WR LQLWLDWH SXOVDWLOH 3*)D V\QWKHVLV ,QFUHDVHG H[SUHVVLRQ RI 3*(6 DW HVWUXV PD\ EH LQYROYHG LQ RYXODWLRQ ,QFUHDVHG 3*+6 PD\ EH EHQHILFLDO GXULQJ LPSODQWDWLRQ 7KH ORZ OXWHDO 27 GHFUHDVHG H[SUHVVLRQ RI 275 3*)6 DQG 3*(6 GXULQJ WKH SHULLPSODQWDWLRQ SHULRG PD\ HQKDQFH PDLQWHQDQFH RI SUHJQDQF\ [L

PAGE 12

&+$37(5 ,1752'8&7,21 'XULQJ WKH HVWURXV F\FOH LQ FDWWOH SURVWDJODQGLQ )} VHFUHWHG IURP WKH HQGRPHWULXP SOD\V DQ LPSRUWDQW UROH LQ OXWHRO\VLV ZKHUHE\ LW FDXVHV UHJUHVVLRQ RI WKH FRUSXV OXWHXP DQG HQDEOHV RYXODWLRQ RI D QHZ IROOLFOH 0LOYDH HW DO f 3URVWDJODQGLQ )D DOVR SOD\V DQ LPSRUWDQW UROH GXULQJ SDUWXULWLRQ WKURXJK LWV DFWLRQV WR FDXVH FRQWUDFWLRQ RI WKH XWHUXV 3URVWDJODQGLQ ( RQ WKH RWKHU KDQG LV LQYROYHG LQ FHUYLFDO UHOD[DWLRQ GXULQJ HVWUXV DQG SDUWXULWLRQ 0L]UDFKL DQG 6KHPHVK )XFKV HW DO f 3URVWDJODQGLQV DUH V\QWKHVL]HG E\ K\GURO\VLV RI PHPEUDQH SKRVSKROLSLGV E\ SKRVSKROLSDVHV WR DUDFKLGRQLF DFLG $UDFKLGRQLF DFLG LV FRQYHUWHG WR 3*+ E\ F\FORR[\JHQDVHV 3URVWDJODQGLQ *+ V\QWKDVHVf 7KH 3*+ LV FRQYHUWHG WR HLWKHU 3*)D RU 3*( E\ SURVWDJODQGLQ ) V\QWKDVH 3*)6f RU SURVWDJODQGLQ ( V\QWKDVH 3*(6f UHVSHFWLYHO\ 3URVWDJODQGLQ ( V\QWKDVH VWLPXODWHV 3*( ZKLFK LV LPSOLFDWHG LQ WKH LPSODQWDWLRQ SURFHVV (PRQG HW DO /HXQJ HW DO f 'XULQJ HDUO\ VWDJHV RI SUHJQDQF\ D FKDQJH LQ WKH SDWWHUQ RI V\QWKHVLV RI SURVWDJODQGLQ V\QWKHVL]LQJ HQ]\PHV LV QHFHVVDU\ WR HQDEOH WKH HPEU\R WR LQKLELW WKH OXWHRO\LF 3*)& SXOVHV WKDW RFFXU WRZDUGV WKH HQG RI WKH F\FOH )DLOXUH RI WKLV WR RFFXU PD\ OHDG WR OXWHRO\VLV DQG SUHJQDQF\ ORVV DQG FRXOG EH D SRWHQWLDO FDXVH IRU LQIHUWLOLW\ LQ FDWWOH )RU WKH HPEU\R WR VXUYLYH LW PXVW VHFUHWH DGHTXDWH LQWHUIHURQWDX ,)1[f WKH VLJQDO IRU PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ WR GHSUHVV WKH SXOVHV RI 3*)D DQG VXVWDLQ SUHJQDQF\ 7KDWFKHU HW DO 5RELQVRQ HW DO 0DQQ DQG /DPPLQJ f

PAGE 13

2[\WRFLQ LV SURGXFHG E\ WKH ODUJH OXWHDO FHOOV IURP WKH FRUSXV OXWHXP &/f DV ZHOO DV WKH QHXURK\SRSK\VLV 0F&UDFNHQ HW DO )LHOGV DQG )LHOGV f 6WXGLHV KDYH LQGLFDWHG WKDW 27 SOD\V D PRGXODWRU\ UROH LQ WKH OXWHRO\WLF SURFHVV .RWZLFD HW DO f 'XULQJ SUHJQDQF\ 27FRQWDLQLQJ OXWHDO JUDQXOHV DUH UHOHDVHG DW DERXW WKH WLPH ZKHQ LPSODQWDWLRQ LV WDNLQJ SODFH 0HOWRQ HW DO .LQJ HW DO )LHOGV HW DO :RRGLQJ DQG )OLQW f $ SRVVLELOLW\ H[LVWV WKDW GXULQJ WKH UHOHDVH RI WKHVH 27 FRQWDLQLQJ JUDQXOHV OXWHRO\WLF SXOVHV RI 3*)D FRXOG EH LQLWLDWHG $Q DFWLYH 27275 V\VWHP PD\ EH IXQFWLRQDOO\ FRXSOHG WR WKH SURVWDQRLG V\VWHP GXULQJ WKLV SHULRG DQG LQ FLUFXPVWDQFHV ZKHUH WKH OXWHRWURSKLF VLJQDOV DUH QRW VWURQJ WKHUH FRXOG EH WKH SRVVLELOLW\ RI IDLOXUH WR HVWDEOLVK DQG PDLQWDLQ SUHJQDQF\ 0DQQ DQG /DPPLQJ f ([RJHQRXV 27 KDV EHHQ VKRZQ WR LQWHUIHUH ZLWK HPEU\RQLF GHYHORSPHQW DQG UHVXOWHG LQ UHGXFHG SUHJQDQF\ UDWHV ZKHQ DGPLQLVWHUHG WR FRZV GXULQJ WR GD\V RI SUHJQDQF\ /HPDVWHU HW DO f )XUWKHUPRUH SUHPDWXUH XWHULQH VHFUHWLRQ RI 3*) KDV EHHQ VKRZQ WR OHDG WR VKRUW OXWHDO SKDVHV DQG HDUO\ HPEU\R ORVV LQ FDWWOH &RSHOLQ HW DO f %ULGJHV HW DO f VXJJHVWHG WKDW 3*)D VHFUHWHG E\ WKH HQGRPHWULXP RU HPEU\R PD\ EH EHQHILFLDO IRU PDLQWHQDQFH RI SUHJQDQF\ EXW FRQFHQWUDWLRQV EH\RQG VRPH WKUHVKROG FDQ OHDG WR OXWHDO UHJUHVVLRQ DQG ORVV RI SUHJQDQF\ ,W LV LPSRUWDQW WR NQRZ ZKHWKHU 3*)D FDXVHV UHOHDVH RI WKHVH JUDQXOHV VLQFH 27 FRXOG DXJPHQW OXWHRO\WLF SXOVHV LQ FDVH DQ HPEU\R GRHV QRW SURGXFH VXIILFLHQW LQWHUIHURQU ,)1[f RU LI WKH &/ GRHV QRW SURGXFH VXIILFLHQW SURJHVWHURQH WR VXVWDLQ SUHJQDQF\ 7KH OXWHRO\WLF PDFKLQHU\ EHFRPHV UHHVWDEOLVKHG DIWHU PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ VLQFH QHLWKHU WHPSRUDU\ SUHVHQFH RI WKH FRQFHSWXV RU ,)1U LQIXVLRQ LQWR WKH XWHUXV H[WHQGV WKH &/ OLIHVSDQ PRUH WKDQ D IHZ GD\V 1RUWKH\ DQG )UHQFK f 7KXV SRVWLPSODQWDWLRQ V\QWKHVLV RI 3*)D

PAGE 14

V\QWKHVLV LV LPSRUWDQW VLQFH DFWLYDWLRQ RI 3*)D DIWHU PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ PD\ OHDG WR SUHJQDQF\ ORVV $OWKRXJK WKH H[SUHVVLRQ RI HQGRPHWULDO 3*+6 DQG 275 KDYH EHHQ ZHOO GHVFULEHG GXULQJ WKH HVWURXV F\FOH DQG HDUO\ SUHJQDQF\ LQ FDWWOH QR FRPSUHKHQVLYH VWXG\ KDV ORRNHG DW WKH FKDQJH LQ H[SUHVVLRQ SDWWHUQV RI 3*+6 3*(6 3*)6 DQG 275 EHIRUH GXULQJ DQG DIWHU PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ XVLQJ FRPSDULVRQV EHWZHHQ F\FOLF DQG SUHJQDQW FRZV RQ VLPLODU GD\V 7KH UHVXOWV IURP WKLV VWXG\ ZLOO LQFUHDVH RXU XQGHUVWDQGLQJ DERXW SHULLPSODQWDWLRQ HYHQWV DQG PD\ SURYH XVHIXO LQ VWUDWHJLHV WR PLQLPL]H HPEU\R ORVVHV GXULQJ WKLV SHULRG 7KH ILUVW REMHFWLYH RI WKLV GLVVHUWDWLRQ ZDV WR GHWHUPLQH WKH HIIHFW RI 3*)LD RQ SODVPD 27 LQ EHHI FRZV GXULQJ WKH HDUO\ GD\ f DQG ODWH GD\ f SHULLPSODQWDWLRQ SHULRG 7KH VHFRQG REMHFWLYH ZDV WR GHWHUPLQH KRZ 275 DQG WKH SURVWDJODQGLQ V\QWKHVL]LQJ HQ]\PHV FKDQJH GXULQJ WKH SURFHVV RI OXWHRO\LV 7KH WKLUG REMHFWLYH ZDV WR DVFHUWDLQ WKH HIIHFW RI WKH FRQFHSWDV RQ 3*)f V\QWKHVLV GXULQJ HDUO\ VWDJHV RI SUHJQDQF\ 7KH ILQDO REMHFWLYH ZDV WR GHWHUPLQH ZKHWKHU WKH 275 DQG WKH SURVWDJODQGLQ V\QWKHVLV V\VWHP DUH UHHVWDEOLVKHG DIWHU PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\

PAGE 15

&+$37(5 /,7(5$785( 5(9,(: /XWHROYVLV /XWHRO\VLV LV WKH SURFHVV E\ ZKLFK D IXQFWLRQDO &/ LV FRQYHUWHG LQWR D QRQn IXQFWLRQDO FRUSXV DOELFDQV ,W RFFXUV DW WKH HQG RI WKH HVWURXV F\FOH RU DW WKH HQG RI SUHJQDQF\ 3URVWDJODQGLQ )4 LV WKH OXWHRO\WLF DJHQW WKDW LV UHOHDVHG IURP WKH XWHUXV DQG WUDQVSRUWHG WR WKH &/ ZKHUH LW LQGXFHV OXWHRO\VLV ,W LV XVXDOO\ UHOHDVHG LQ D VHULHV RI SXOVHV 1DQFDUURZ HW DO f 7UDQVIHU RI 3*)D WR WKH XWHUXV LQYROYHV D FRXQWHUFXUUHQW PHFKDQLVP 7KDWFKHU HW DO f DV ZHOO DV V\VWHPLF GHOL YHU\ :DUG HW DO f 7KH IDFW WKDW ERWK V\VWHPLF DQG ORFDO WUDQVIHU RI 3*)D RFFXU LQ FRZV LV IXUWKHU VXSSRUWHG E\ WKH ILQGLQJ WKDW RQO\ b RI >+@ 3*)D LV PHWDEROL]HG LQ RQH SDVVDJH WKURXJK WKH OXQJV RI FRZV 'DYLV HW DO f /XWHRO\VLV LQYROYHV FKDQJHV LQ H[SUHVVLRQ RI PDQ\ JHQHV LQ WKH VPDOO DQG ODUJH OXWHDO VWHURLGRJHQLF FHOOV DQG WKH HQGRWKHOLDO FHOOV ZLWKLQ WKH &/ 0DPOXN HW DO ,YHOO HW DO 0HLGDQ HW DO f (QGRWKHOLQ (7f SOD\V DQ HVVHQWLDO UROH LQ 3*)DLQGXFHG OXWHDO UHJUHVVLRQ 0HLGDQ HW DO f DQG ODFN RI (7 LQ HDUO\ ERYLQH &/ KDV EHHQ DWWULEXWHG WR WKHLU UHIUDFWRULQHVV WR H[RJHQRXVO\ DGPLQLVWHUHG 3*)D 7KH PHFKDQLVP RI UHIUDFWRULQHVV LV QRW ZHOO XQGHUVWRRG EXW KDV EHHQ DWWULEXWHG WR VHYHUDO IDFWRUV (QGRWKHOLQV (7f DUH LQLWLDOO\ V\QWKHVL]HG DV SUHFXUVRU SURWHLQV FDOOHG SUHSUR(7V SS7f WKDW DUH ILUVW FOHDYHG WR JHQHUDWH ELJ (7V DQG WKHQ SURFHVVHG WR DFWLYH SHSWLGHV E\

PAGE 16

HQGRWKHOLQ FRQYHUWLQJ HQ]\PH (&(f (QGRWKHOLQ FRQYHUWLQJ HQ]\PH (&(f FOHDYHV LQDFWLYH ELJ (7 WR DFWLYH (7 SHSWLGH /HY\ HW DO f 3URVWDJODQGLQ )D UHJXODWHV WKH DPRXQW RI P51$ HQFRGLQJ (&( LQ D F\FOHSKDVH VSHFLILF PDQQHU EHLQJ FRQVWLWXWLYHO\ H[SUHVVHG LQ &/ DW GD\V DQG RI WKH HVWURXV F\FOH :ULJKW HW DO f 7KH SXOVDWLOH UHOHDVH RI 27 E\ WKH QHXURK\SRSK\VLV DQG &/ VWLPXODWHV WKH SURGXFWLRQ RI SXOVDWLOH XWHULQH 3*)D *RII f 2[\WRFLQ VWLPXODWLRQ RI 3*)D LQFUHDVHV DW OXWHRO\VLV /DIUDQFH DQG *RII f ,QFUHDVH LQ UHVSRQVH WR 27 LV GXH WR WKH LQFUHDVH LQ QXPEHU RI 275 0F&UDFNHQ HW DO f 2[\WRFLQ ELQGV WR HQGRPHWULDO 275 WR VWLPXODWH 3*)D SURGXFWLRQ 5REHUWV HW DO 6LOYLD HW DO f 7KH LQLWLDO UHOHDVH RI 3*)D WULJJHUV UHOHDVH RI DGGLWLRQDO 27 IURP WKH &/ E\ D SRVLWLYH IHHGEDFN ORRS )OLQW HW DO f :KHUHDV 3*)DLV LXWHRO\WLF 3*( LV OXWHRWURSKLF 3UDWW HW DO %D]HU HW DO f ,Q YLWUR 3*)RL LV V\QWKHVL]HG LQ JUHDWHU TXDQWLW\ LQ HSLWKHOLDO FHOOV WKDQ LQ VWURPDO FHOOV ZKHUHDV VWURPDO FHOOV V\QWKHVL]H PRUH 3*( WKDQ HSLWKHOLDO FHOOV )RUWLHU HW DO 'HVQR\HUV HW DO f 5HFRPELQDQW RYLQH ,)1U DQG UHFRPELQDQW ERYLQH ,)1U SUHIHUHQWLDOO\ VWLPXODWH 3*( LQ HSLWKHOLDO FHOOV DQG ERWK SURVWDJODQGLQV LQ VWURPDO FHOOV $VVHOLQ HW DO Df $VVHOLQ HW DO Df VXJJHVWHG D UROH IRU 3*( NHWRUHGXFWDVH .3*5f ZKLFK FRQYHUWV 3*( WR 3*)D 7KH SUHVHQFH RI .3*5 LQ WKH HQGRPHWULDO HSLWKHOLDO FHOOV FRXOG OHDG WR V\QWKHVLV RI PRUH 3*)RW ZKHUHDV LWV DEVHQFH LQ WKH VWURPDO FHOOV ZRXOG OHDG WR D QHW DFFXPXODWLRQ RI 3*( $OWHUQDWLYHO\ ,)1U PD\ LQKLELW RU GRZQUHJXODWH .3*5 DFWLYLW\ LQ HSLWKHOLDO FHOOV VR WKDW 3*+6 LV XSUHJXODWHG UHVXOWLQJ LQ DQ DFFXPXODWLRQ RI 3*( $VVHOLQ HW DO Df +RZHYHU WKHUH DUH QRZ GRXEWV WKDW .3*5 H[LVWV LQ WKH ERYLQH HQGRPHWULXP 7KHUH H[LVWV D SRVLWLYH IHHGEDFN

PAGE 17

SDWKZD\ LQ WKH &/ RI FDWWOH ZKHUHE\ D VPDOO DPRXQW RI 3*)D VWLPXODWHV LQWUDOXWHDO SURGXFWLRQ RI 3*)D GXH WR LQGXFWLRQ RI 3*+6 &ULWLFDO UHJXODWLRQ RI WKLV SRVLWLYH IHHGEDFN SDWKZD\ LV PHGLDWHG E\ SURWHLQ NLQDVH & 3.&fPHGLDWHG DFWLYDWLRQ RI WUDQVFULSWLRQDO IDFWRUV WKDW LQWHUDFW ZLWK WKH (ER[ LQ WKH f IODQNLQJ UHJLRQ RI WKH 3*+6 JHQH 'LD] HW DO f &RUSXV OXWHXP JURZWK QHFHVVLWDWHV LQFUHDVHG YDVFXODWXUH DQG VHYHUDO IDFWRUV KDYH EHHQ LPSOLFDWHG LQ WKLV YDVFXODU JURZWK :HEE HW DK f 7KH DQJLRJHQLF IDFWRUV ILEUREODVW JURZWK IDFWRU DQG YDVFXODU HQGRWKHOLDO JURZWK IDFWRU DUH LQYROYHG LQ UHJXODWLRQ RI OXWHDO IXQFWLRQ 5HGPHU DQG 5H\QROGV f 7KH PDMRU KLVWRFRPSDWLELOLW\ FRPSOH[ 0+&f SURWHLQV PD\ DOVR SOD\ D UROH GXULQJ OXWHRO\VLV &KDQJHV LQ 0+& H[SUHVVLRQ RQ OXWHDO FHOOV KDYH EHHQ LPSOLFDWHG LQ 7 O\PSKRF\WHPHGLDWHG LPPXQH UHVSRQVH GXULQJ OXWHRO\VLV 3HQQ\ HW DK f ,QVXOLQOLNH JURZWK IDFWRUV ,*), DQG ,*),,f DUH LQWUD RYDULDQ IDFWRUV WKDW KDYH EHHQ UHSRUWHG WR PRGXODWH OXWHDO IXQFWLRQ DQG OXWHDO VWHURLGRJHQHVLV E\ FKDQJLQJ /+ UHFHSWRU VWDELOLW\ LQ JUDQXORVD FHOOV 0F$UGOH DQG +ROWRUI +LUDNDZD HW DK f &RQWURYHUV\ VWLOO H[LVWV RQ WKH UROH RI 27 GXULQJ OXWHRO\VLV DOWKRXJK QXPHURXV VWXGLHV KDYH GHPRQVWUDWHG WKDW 27 LV FUXFLDO IRU OXWHRO\VLV LQ FDWWOH /DPPLQJ DQG 0DQQ %XPV HW DK f +RZHYHU RWKHU VWXGLHV VXJJHVW WKDW OXWHRO\VLV FDQ EH LQLWLDWHG ZLWKRXW 27 .RWZLFD HW DK f VKRZHG WKDW FRQWLQXRXV EORFNDGH RI 275 XVLQJ D VSHFLILF 27 DQWDJRQLVW IURP GD\ XQWLO HVWUXV GLG QRW DIIHFW OXWHRO\VLV 7KLV OHG WR WKH VXJJHVWLRQ WKDW 27 PD\ SOD\ D SHUPLVVLYH UROH RU PD\ FRQWULEXWH WR WKH FRPSOHWLRQ RI OXWHRO\VLV RQFH LW KDV EHJXQ .RWZLFD HW DK f

PAGE 18

6FKDPV HW DO f REVHUYHG D GHFUHDVH LQ 27 VHFUHWLRQ DIWHU PLGOXWHDO SKDVH RI WKH HVWURXV F\FOH LQ K\VWHUHFWRPL]HG FRZV VXJJHVWLQJ WKDW WKH 3*) V\QWKHVL]HG LQ WKH XWHUXV VWLPXODWHV UHOHDVH RI 27 GXULQJ OXWHRO\VLV %ODLU HW DO f VKRZHG WKDW OXWHDO DQG SODVPD FRQFHQWUDWLRQV RI 27 GXULQJ VSRQWDQHRXV DQG LQGXFHG OXWHRO\VLV LQ KHLIHUV UHPDLQHG XQDOWHUHG ZKHQ PHDVXUHG XVLQJ DQ LQ YLYR PLFURGLDO\VLV V\VWHP 2[\WRFLQ IURP WKH QHXURK\SRSK\VLV DSSHDUV WR EH UHOHDVHG LQ D SXOVDWLOH ZD\ WR LQLWLDWH 3*)f VHFUHWLRQ IURP WKH XWHUXV 6LOYLD HW DO f 5HVSRQVLYHQHVV RI WKH XWHUXV WR 27 LQFUHDVHV DW OXWHRO\VLV ZKHQ HQGRJHQRXV SXOVDWLOH VHFUHWLRQ RI 3*)D KDV EHJXQ 3URJHVWHURQH SURPRWHV DFFXPXODWLRQ RI DUDFKLGRQLF DFLG DQG 3*+6 LQ WKH XWHUXV WKXV HQVXULQJ WKDW OXWHRO\VLV RFFXUV DW WKH DSSURSULDWH WLPH 6LOYLD HW DO f )XQFWLRQDO /XWHRO\VLV )XQFWLRQDO OXWHRO\VLV LV WKH UHGXFWLRQ LQ SURJHVWHURQH FRQFHQWUDWLRQ DVVRFLDWHG ZLWK WKH OXWHRO\WLF SURFHVV FDXVHG E\ 3*)D 0F&UDFNHQ HW DO f ,W KDV EHHQ DWWULEXWHG WR VHYHUDO IDFWRUV QDPHO\ D FKDQJH LQ OXWHDO PHPEUDQH FRPSRVLWLRQ DQG GHFUHDVHG IOXLGLW\ ZKLFK PD\ SUHYHQW OXWHLQL]LQJ KRUPRQH /),f UHFHSWRU DJJUHJDWLRQ DQG EORFNLQJ /), IXQFWLRQ 7KLV FRXOG SUHYHQW FRXSOLQJ WR DGHQ\ODWH F\FODVH DQG FDXVH D GHFOLQH LQ F\FOLF DGHQRVLQH PRQRVSKRVSKDWH F$03f DQG SURJHVWHURQH V\QWKHVLV +HQGHUVRQ DQG 0F1DWW\ f ,Q DGGLWLRQ 3*)D DFWLYDWHV WKH SKRVSKROLSDVH & 3/&f SDWKZD\ OHDGLQJ WR DQ LQFUHDVH LQ FDOFLXP LRQV LQ WKH ODUJH OXWHDO FHOOV ZKLFK LV DVVRFLDWHG ZLWK OXWHRO\VLV 0F&UDFNHQ HW DO f 7KH 3*)D H[HUWV DQWLVWHURLGRJHQLF HIIHFWV WKDW LQYROYH V\QWKHVLV RI SURJHVWHURQH IURP FKROHVWHURO ,W PD\ DOVR DIIHFW OXWHRO\VLV E\ DOWHULQJ OXWHDO EORRG IORZ WR WKH RYDU\ ZLWK WKH &/ 'HFUHDVHG RYDULDQ EORRG IORZ KDV EHHQ VXJJHVWHG DV RQH RI WKH PHFKDQLVPV E\ ZKLFK 3*)D OHDGV WR OXWHRO\VLV

PAGE 19

1LVZHQGHU HW DO f ,W KDV UHFHQWO\ EHHQ VKRZQ WKDW WKHUH LV LQFUHDVHG EORRG IORZ ZKLFK SDUDOOHOV LQFUHDVHG &/ YROXPH DQG SODVPD FRQFHQWUDWLRQ RI SURJHVWHURQH IURP GD\V WR RI WKH HVWURXV F\FOH $FRVWD HW DO f ,W ZDV IXUWKHU REVHUYHG WKDW PLGn F\FOH &/ KDYH GHFUHDVHG EORRG IORZ VXJJHVWLQJ WKDW WKH ODFN RI LQWUDOXWHDO YDVFXODU UHVSRQVH WR 3*)D PD\ EH RQH RI WKH UHDVRQV IRU HDUO\ F\FOH &/ IDLOXUH WR UHVSRQG WR 3*)D $FRVWD HW DO f 6WUXFWXUDO /XWHROYVLV 6WUXFWXUDO OXWHRO\VLV LQYROYHV LQYROXWLRQ RI WKH &/ 6HYHUDO IDFWRUV KDYH EHHQ LPSOLFDWHG LQ VWUXFWXUDO OXWHRO\VLV LQFOXGLQJ WXPRU QHFURVLV IDFWRU D 71)Df WKDW KDV EHHQ VKRZQ WR LQKLELW /+LQGXFHG SURJHVWHURQH SURGXFWLRQ LQ ERYLQH OXWHDO FHOOV %HQ\R DQG 3DWH f 0RQRF\WH FKHPRDWWUDFWDQW SURWHLQ H[SUHVVHG LQ WKH &/ DFWV DV D PHGLDWRU RI LQYDVLRQ RI LPPXQH FHOOV WKDW DUH LQYROYHG LQ SKDJRF\WRVLV DV ZHOO DV SURGXFWLRQ RI F\WRNLQHV ZKLFK SOD\ D UROH LQ VWUXFWXUDO OXWHRO\VLV 7VDL HW DO f 0DWUL[ PHWDOORSURWHLQDVH 003f LV ORFDOL]HG LQ WKH ERYLQH OXWHDO HQGRWKHOLDO FHOOV DQG LV LQYROYHG LQ DQJLRJHQHVLV LQ WKH &/ =KDQJ DQG 7VDQJ f 0HPEUDQH W\SH PDWUL[ PHWDOORSURWHLQDVH 07003f DFWLYDWHV SUR003 WR 003 $FWLYH 07 003 DQG 003 DUH LQFUHDVHG FRRUGLQDWHO\ LQ PLG WR ODWH VWDJH ERYLQH &/ DQG PD\ EH LQYROYHG LQ GLJHVWLRQ RI H[WUDFHOOXODU PDWUL[ DQG VWUXFWXUDO UHJUHVVLRQ RI WKH &/ =KDQJ HW DO f 7LVVXH LQKLELWRUV RI PHWDOORSURWHLQDVHV 7,03f DUH SURGXFHG E\ WKH &/ WR LQKLELW WKH DFWLRQV RI WLVVXH PHWDOORSURWHLQDVHV WKDW DUH LQYROYHG LQ WLVVXH UHPRGHOLQJ RI WKH H[WUDFHOOXODU PDWUL[ ,Q SDUWLFXODU 7,03 LQ WKH ERYLQH &/ LQFUHDVHV WUHPHQGRXVO\ K DIWHU 3*)DLQGXFHG OXWHRO\VLV 6PLWK HW DO f

PAGE 20

'XULQJ VWUXFWXUDO OXWHRO\VLV FHOOV RI WKH &/ XQGHUJR DSRSWRVLV -XHQJHO HW DO 5XHGD HW DO f ,PPXQH FHOOV PDFURSKDJHV DQG 7O\PSKRF\WHVf KDYH EHHQ UHSRUWHG WR SOD\ D UROH LQ VWUXFWXUDO OXWHRO\VLV 3HQQ\ HW DO f ,W LV VHHPV WKDW WKLV PHFKDQLVP LV PHGLDWHG E\ WKH )DV)DV OLJDQG V\VWHP 7O\PSKRF\WHV H[SUHVV WKH )DV OLJDQG DQG 71)D ZKHUHDV PDFURSKDJHV DUH WKH PDLQ VRXUFH RI WKH 71)D 7KH )DV DQWLJHQ LV D PHPEHU RI WKH 71)D IDPLO\ RI UHFHSWRUV WKDW LQWHUDFWV ZLWK LWV OLJDQG WR LQGXFH DSRSWRVLV 1DJDWD DQG *ROGVWHLQ f 6WUXFWXUDO OXWHRO\VLV LV HQKDQFHG E\ WKH 7 FHOOV VHQGLQJ DSRSWRWLF VLJQDOV WR WKH OXWHDO FHOOV ZKHUH )DV H[SUHVVLRQ LV LQGXFHG E\ OHXNRF\WHVWLPXODWHG F\WRNLQHV VXFK DV 71)D DQG LQWHUIHURQ JDPPD ,)1\f ,W KDV EHHQ VKRZQ WKDW ,)1\ E\ LWVHOI UHGXFHV WKH YLDELOLW\ RI ERYLQH OXWHDO FHOOV DQG LWV F\WRWR[LF HIIHFW LV DXJPHQWHG ZKHQ FRPELQHG ZLWK 71)D 7DQLJXFKL HW DO f +RZHYHU 71)D KDV QR HIIHFW RQ ERYLQH OXWHDO FHOO GHDWK XQWLO GD\ RI FXOWXUH %HQ\R DQG 3DWH f 7KH )DV P51$ LV H[SUHVVHG KLJKO\ LQ ERYLQH OXWHDO FHOOV DERXW WKH WLPH RI OXWHRO\VLV LPSOLFDWLQJ LWV UROH LQ DSRSWRVLVPHGLDWHG VWUXFWXUDO OXWHRO\VLV 7DQLJXFKL HW DO f 7KH 71)D LV VHFUHWHG E\ PDFURSKDJHV LQ UHVSRQVH WR 3*)D LQ WKH &/ :XWWNH HW DO f ,WV HIIHFWV DUH PHGLDWHG YLD WKH WXPRU QHFURVLV D UHFHSWRU 71)5f ZKRVH P51$ ZDV VKRZQ WR EH H[SUHVVHG LQ HQGRWKHOLDO DQG VWHURLGRJHQLF FHOOV RI WKH ERYLQH &/ ZLWK KLJKHVW H[SUHVVLRQ LQ HQGRWKHOLDO FHOOV )ULHGPDQ HW DO f )XUWKHUPRUH 71)5 ZDV H[SUHVVHG KLJKHVW RQ GD\V GXULQJ WKH WLPH RI OXWHDO UHJUHVVLRQ )ULHGPDQ HW DO f /XWHDO HQGRWKHOLDO FHOOV DOVR H[SUHVV SURJHVWHURQH UHFHSWRU ZKLFK SURWHFWV DJDLQVW SURJUDPPHG FHOO GHDWK (QGRWKHOLDO FHOOGHULYHG (7 FDXVHV D GHFOLQH LQ VWHURLGRJHQLF DFWLYLW\ WKXV OHDGLQJ WR IXQFWLRQDO OXWHRO\VLV 0HLGDQ HW DO f +RZHYHU (7 PD\

PAGE 21

DOVR OHDG WR VWUXFWXUDO OXWHRO\VLV YLD D PHFKDQLVP ZKHUH LW UHJXODWHV DSRSWRVLV )ULHGPDQ HW DO f SURSRVHG WKDW GXULQJ OXWHRO\VLV 3*)D VWLPXODWHV VHFUHWLRQ RI (7 DQG PDFURSKDJHV VHFUHWH 71)D 7KHUH LV D V\QHUJLVWLF HIIHFW EHWZHHQ 71)D DQG (7 WR LQKLELW VWHURLGRJHQHVLV DQG UHGXFH SURJHVWHURQH VHFUHWLRQ 7KLV OHDGV WR LQFUHDVHG H[SUHVVLRQ RI 71)5 DQG WKXV IDFLOLWDWHV 71)D LQGXFHG DSRSWRVLV DQG VWUXFWXUDO OXWHRO\VLV 0HLGDQ HW DO f 5HJXODWLRQ RI 3URVWDJODQGLQ 6\QWKHVLV 3URVWDJODQGLQ LV WKH OXWHRO\WLF DJHQW LQ FRZV DQG LWV UHJXODWLRQ LV GHSHQGHQW RQ VHYHUDO SDWKZD\V WKDW LQYROYH 27 VWHURLGV DQG F\WRNLQHV 2NXGD HW DO f 7KH SURGXFWLRQ RI 3*)D LQ WKH ERYLQH HQGRPHWULXP LV UHJXODWHG E\ HVWURJHQV DQG SURJHVWHURQH DW WZR OHYHOV EDVDO DQG 27VWLPXODWHG 6NDU]\QVNL HW DO f 3URJHVWHURQH KDV EHHQ VKRZQ WR VWLPXODWH EDVDO SURGXFWLRQ RI 3*)D LQ HQGRPHWULDO FHOOV ;LDR HW DO f 7KH VWLPXODWRU\ HIIHFW PD\ EH DVVRFLDWHG ZLWK SRVWWUDQVODWLRQDO HYHQWV VLQFH LW KDV EHHQ VKRZQ WKDW SURJHVWHURQH VWLPXODWHG EDVDO 3*)D V\QWKHVLV LQ ERYLQH HQGRPHWULDO FHOOV EXW GLG QRW LQFUHDVH H[SUHVVLRQ RI HLWKHU 3*+6 RU 3*)6 P51$ $VVHOLQ HW DO ;LDR HW DO 6NDU]\QVNL HW DO 2NXGD HW DO f 3URJHVWHURQH LV WKH SULQFLSDO UHJXODWRU RI HQGRPHWULDO 3*)D VHFUHWLRQ GXULQJ WKH LQWUDOXWHDO SKDVH 6NDU]\QVNL HW DO f %RWK 27 DQG SURJHVWHURQH LQFUHDVHG 3*)D V\QWKHVLV IURP ERYLQH HQGRPHWULXP LQ YLWUR (VWURJHQ DORQH KDG QR HIIHFW EXW DXJPHQWHG WKDW RI SURJHVWHURQH 6NDU]\QVNL HW DO f )XUWKHU HYLGHQFH RI SURJHVWHURQH UHJXODWLRQ FRPHV IURP VWXGLHV ZKLFK KDYH VKRZQ WKDW 3*)D DQG 3*( FRQFHQWUDWLRQV

PAGE 22

DUH KLJKHU LQ ERYLQH HQGRPHWULXP IURP WKH XWHULQH KRP LSVLODWHUDO WR WKH DFWLYH &/ DQG DUH SRVLWLYHO\ FRUUHODWHG ZLWK SURJHVWHURQH FRQFHQWUDWLRQV &HUELWR HW DO f $ SRVLWLYH IHHGEDFN SDWKZD\ H[LVWV LQ ODUJH OXWHDO FHOOV LQ WKH &/ VXFK WKDW 3*)D VWLPXODWLRQ LQGXFHV LQWUDOXWHDO 3*)D DV D UHVXOW RI LQGXFWLRQ RI 3*+6 7KH HIIHFW RI SURJHVWHURQH RQ XWHULQH VHQVLWLYLW\ WR 27 LQYROYHV D QRQ JHQRPLF DFWLRQ =LQQJ HW DK f 3URJHVWHURQH ELQGV WR WKH 275 ZLWK KLJK DIILQLW\ DQG LQKLELWV ELQGLQJ RI 27 WR LWV UHFHSWRU ,QWDFW FRZV LQ WKH PLGOXWHDO SKDVH DQG RYDULHFWRPL]HG SURJHVWHURQHSULPHG FRZV VHFUHWH 3*)D DIWHU WUHDWPHQW ZLWK HVWURJHQ 7KDWFKHU HW DK f VXJJHVWLQJ WKDW SURJHVWHURQH SULPLQJ LV QHFHVVDU\ WR LQGXFH 3*)D VHFUHWLRQ E\ WKH ERYLQH XWHUXV DQG WKDW HVWURJHQ PD\ MXVW EH DFWLQJ DV D PRGXODWRU RI WKLV SURFHVV 2NXGD HW DK f 0DQQ HW DK f VXJJHVWHG WKDW WKH PRVW OLNHO\ PHFKDQLVP E\ ZKLFK SURJHVWHURQH WUHDWPHQW LQGXFHV UHVSRQVLYHQHVV WR R[\WRFLQ PD\ EH WKURXJK WKH XSUHJXODWLRQ RI SRVW UHFHSWRU VLJQDOLQJ SDWKZD\V DQGRU HQ]\PHV LQYROYHG LQ SURVWDJODQGLQ V\QWKHVLV 3URJHVWHURQH DSSHDUV WR SURPRWH XWHULQH DFFXPXODWLRQ RI DUDFKLGRQLF DFLG 3*+6 DQG RWKHU VXEVWDQFHV QHHGHG IRU V\QWKHVLV RI 3*)D DQG DOVR H[HUWV D VXSSUHVVLYH HIIHFW RQ VHFUHWLRQ WKDW LV GHFUHDVHG DIWHU SURORQJHG H[SRVXUH 6LOYLD HW DK f (VWUDGLRO RQ WKH RWKHU KDQG KDV ERWK VWLPXODWRU\ DQG LQKLELWRU\ HIIHFWV RQ 3*)D VHFUHWLRQ IURP WKH HQGRPHWULXP :DWKHV DQG /DPPLQJ f (VWUDGLRO KDV EHHQ VKRZQ WR KDYH QR HIIHFW RQ 3*)D VHFUHWLRQ IURP WKH HQGRPHWULXP DORQH ZKHUHDV LQ FRPELQDWLRQ ZLWK SURJHVWHURQH LW DPSOLILHG WKH VWLPXODWRU\ HIIHFWV RI SURJHVWHURQH 6NDU]\QVNL HW DK f 2[\WRFLQ VWLPXODWLRQ RI SURVWDJODQGLQ VHFUHWLRQ LV LQGXFHG LQ RYDULHFWRPL]HG DQLPDOV E\ WUHDWPHQW ZLWK SURJHVWHURQH DORQH VXJJHVWLQJ WKDW HVWURJHQ LV QRW HVVHQWLDO IRU LQFUHDVH LQ UHVSRQVH WR 27 *RII DQG .RPEH f +RZHYHU HVWURJHQ

PAGE 23

PD\ SOD\ D UROH RI FRPSOHWLRQ RI OXWHRO\VLV E\ VWLPXODWLQJ WKH LQFUHDVH LQ 275 (VWUDGLRO LQGXFHV 3*)D SURGXFWLRQ LQ YLYR 7KDWFKHU HW DO f DQG LQFUHDVHV 275 H[SUHVVLRQ DIWHU SULPLQJ ZLWK SURJHVWHURQH /DPPLQJ DQG 0DQQ f 8QGHU LQ YLWUR FRQGLWLRQV 275 XSUHJXODWHV VSRQWDQHRXVO\ LQ HQGRPHWULDO WLVVXHV WDNHQ IURP DQ\ VWDJH RI WKH HVWURXV F\FOH 6KHOGULFN HW DO f VXJJHVWLQJ D IRUP RI FRQVWLWXWLYH XSUHJXODWLRQ RI 275 ,Q YLYR 275 DQG LWV P51$ DUH XSUHJXODWHG ZLWKLQ D VKRUW ZLQGRZ RI WR GD\V DURXQG WKH GD\ RI HVWUXV DUH XQGHWHFWDEOH EHWZHHQ GD\V DQG DQG VWDUW WR GHYHORS LQ WKH OXPLQDO HSLWKHOLXP RI WKH HQGRPHWULXP EHWZHHQ DQG GD\V DIWHU HVWUXV )XFKV HW DO -HQQHU HW DO 0DQQ DQG /DPPLQJ 5RELQVRQ HW DO f 7KH\ EHFRPH DSSDUHQW ODWHU LQ WKH VXSHUILFLDO JODQGV RI WKH HQGRPHWULXP 5RELQVRQ HW DO f 2[\WRFLQ UHFHSWRUV ZHUH VKRZQ WR DSSHDU EHIRUH FKDQJHV LQ SODVPD FRQFHQWUDWLRQV RI SURJHVWHURQH RU HVWUDGLRO 5RELQVRQ HW DO f LQGLFDWLQJ WKDW XSUHJXODWLRQ RI 275 LV QRW D UHVXOW RI FKDQJHV LQ SODVPD VWHURLG FRQFHQWUDWLRQV ,Q WKH ERYLQH HQGRPHWULXP WKH KLJKHVW QXPEHU RI 275 DUH H[SUHVVHG LQ WKH OXPLQDO HSLWKHOLXP DQG LW LV WKLV OD\HU RI FHOOV WKDW LV PRVW UHVSRQVLYH WR H[RJHQRXV 27 LQ WHUPV RI 3*)FW VHFUHWLRQ 5RELQVRQ HW DO f 'HYHORSPHQW RI 275 LQ WKH OXPLQDO HSLWKHOLXP DORQH LV SUREDEO\ VXIILFLHQW WR HOLFLW IXOO OXWHRO\WLF VHFUHWLRQ RI 3*)FO :DWKHV DQG /DPPLQJ f 'HYHORSPHQW RI 275 LQ WKH FDUXQFXODU VWURPD DQG GHHS JODQGV DW HVWUXV LV GHSHQGHQW RQ HVWURJHQ :DWKHV DQG /DPPLQJ f 7KH GHFUHDVHG H[SUHVVLRQ RI 275 DIWHU HVWUXV LV UHSRUWHGO\ GXH WR GHFUHDVHG SODVPD HVWUDGLRO FRQFHQWUDWLRQV DQG WKH IXUWKHU GHFOLQH LQ WKH OXWHDO SKDVH LV GXH WR SURJHVWHURQH DFWLQJ YLD KLJK FRQFHQWUDWLRQV RI SURJHVWHURQH UHFHSWRUV SUHVHQW LQ WKH VWURPD /DPPLQJ DQG 0DQQ f 7KLV DFWLRQ LV

PAGE 24

SUREDEO\ LQGLUHFW VLQFH QR SURJHVWHURQH UHVSRQVH HOHPHQW KDV EHHQ LGHQWLILHG LQ WKH ERYLQH 275 JHQH SURPRWHU %DWKJDWH HW DO f ,Q PRVW FHOOV DQG WLVVXHV 3*+6 LV DQ LQGXFLEOH HQ]\PH WKDW LV QRW H[SUHVVHG XQGHU QRUPDO RU UHVWLQJ FRQGLWLRQV 6PLWK HW DO .QLVV 6PLWK HW DO f %RWK WKH 3*+6 P51$ DQG SURWHLQ DUH H[SUHVVHG LQ WKH HQGRPHWULXP DW ORZ OHYHOV EHWZHHQ GD\V DQG DQG DW KLJK OHYHOV EHWZHHQ GD\V DQG RI WKH HVWURXV F\FOH $URVK HW DO f 7KH 3*+6 P51$ DQG SURWHLQ DUH KLJKO\ FRUUHODWHG VXJJHVWLQJ WKDW 3*+6 H[SUHVVLRQ LV UHJXODWHG DW ERWK WKH P51$ DQG SURWHLQ OHYHOV 0D[LPDO H[SUHVVLRQ RI 3*+6 RFFXUV DW WKH H[SHFWHG WLPH RI OXWHRO\VLV GD\V WR f LQ WKH FRZ 7KH 3*+6 P51$ DQG SURWHLQ DUH QRW H[SUHVVHG LQ WKH ERYLQH HQGRPHWULXP RQ DQ\ GD\ RI WKH F\FOH $URVK HW DO f 3URVWDJODQGLQ + V\QWKDVH DQG 3*(6 PD\ EH UHVSRQVLEOH IRU 3*( SURGXFWLRQ GXULQJ WKH HVWURXV F\FOH 7KH 3*(6 DQG 3*+6 DUH IXQFWLRQDOO\ FRXSOHG LQ WKH SUHRYXODWRU\ IROOLFOH )LOLRQ HW DO f DQG LQ WKH HQGRPHWULXP $URVK HW DO f 7KLV IXQFWLRQDO FRXSOLQJ DSSHDUV WR EH DQ HIILFLHQW PHFKDQLVP IRU UHJXODWLRQ RI WKH FRQYHUVLRQ RI DUDFKLGRQLF DFLG LQWR 3*( 3URVWDJODQGLQ + V\QWKDVH LV H[SUHVVHG LQ SUHRYXODWRU\ IROOLFOHV GXULQJ WKH HVWURXV F\FOH ZLWK OHYHOV ORZ DW RQVHW RI HVWUXV DQG K DIWHU HVWUXV EXW KLJK OHYHOV K DIWHU HVWUXV K SRVW/+ VXUJHf 7KLV UHVXOW VXJJHVWV WKDW LQGXFWLRQ RI 3*+6 LQ ERYLQH SUHRYXODWRU\ IROOLFOHV LV SK\VLRORJLFDO DQG GHSHQGHQW RQ WKH /+ VXUJH /LX HW DO f ([RJHQRXV 3*) SUREDEO\ DFWV WKURXJK SURWHLQ NLQDVH & DQG FDOFLXPGHSHQGHQW SDWKZD\V WR VWLPXODWH ODUJH OXWHDO FHOOV WR H[SUHVV 3*+6 ZKLFK WKHQ OHDGV WR OXWHDO SURGXFWLRQ RI 3*)D 7VDL HW DO 7VDL DQG :LOWEDQN f 7KXV WKH 3*)D FUHDWHV

PAGE 25

DQ DXWRFULQHSDUDFULQH ORRS WKDW DXJPHQWV WKH OXWHRO\WLF HIIHFW RI 3*)D SURGXFHG E\ WKH XWHUXV 2[\WRFLQ VWLPXODWHV 3*) VHFUHWLRQ IURP WKH HQGRPHWULXP GXULQJ WKH IROOLFXODU SKDVH HVWUXV HDUO\ OXWHDO DQG PLG WR ODWH OXWHDO VWDJHV RI WKH HVWURXV F\FOH 6LOYLD DQG 7D\ORU 0HLGDQ HW DO 0LUDQGR HW DO :ROIHQVRQ HW DO ;LDR HW DO 0L\DPRWR HW DK f 2[\WRFLQ PD\ SOD\ D VXSSRUWLYH UROH WR UHJXODWH 3*)D V\QWKHVLV VLQFH LW KDV EHHQ UHSRUWHG WKDW 27 LV QRW QHFHVVDU\ IRU OXWHRO\VLV LQ FRZV .RWZLFD HW DK Ef ,W KDV EHHQ UHSRUWHG WKDW WKH FRQFHQWUDWLRQV RI 27 LQ LQWDFW DQG PLFURGLDO\]HG &/ DUH ORZ GXULQJ VSRQWDQHRXV OXWHRO\VLV 3DUNLQVRQ HW DK 'RXJODV DQG %ULWW f )XUWKHUPRUH .RWZLFD HW DK f VKRZHG WKDW DGPLQLVWUDWLRQ RI 27 DQWDJRQLVW DW WKH WLPH RI OXWHRO\VLV GLG QRW VWRS WKH OXWHRO\WLF SURFHVV QRU GLG LW DIIHFW WKH GXUDWLRQ RI WKH HVWURXV F\FOH LQ KHLIHUV 6HYHUDO VWXGLHV KDYH VKRZQ WKDW 27 ELQGLQJ WR LWV UHFHSWRU VWLPXODWHV XWHULQH SURGXFWLRQ RI 3*)D 1HZFRPE HW DK 6LOYLD DQG 7D\ORU /DIUDQFH DQG *RII f 7KLV HIIHFW LV DOVR DIIHFWHG E\ RYDULDQ VWHURLGV ZKLFK LQIOXHQFH WKH UHVSRQVLYHQHVV RI WKH XWHUXV WR 27 /DIUDQFH DQG *RII /DPPLQJ DQG 0DQQ f 2[\WRFLQ VWLPXODWHV 3*)D V\QWKHVLV E\ HQGRPHWULDO FHOOV YLD LQFUHDVHG LQWUDFHOOXODU FDOFLXP LRQV %XUQV HW DW f 7KH LQFUHDVH LQ FDOFLXP LRQV LV GXH WR VWLPXODWLRQ RI 3/& DQG LQRVLWRO WULSKRVSKDWH ,3f LQ WKH 3.& VLJQDOLQJ SDWKZD\ %XPV HW DK f 7UHDWPHQW RI HQGRPHWULDO HSLWKHOLDO FHOOV ZLWK 27 IROORZHG E\ SURJHVWHURQH LQKLELWV WKH LQFUHDVH RI FDOFLXP LRQV VXJJHVWLQJ WKDW SURJHVWHURQH EORFNV WKH V\QWKHVLV RI 3*)FO E\ GLVUXSWLQJ WKLV LQWUDFHOOXODU SDWKZD\ ,W DSSHDUV WKDW WKLV HIIHFW LV PHGLDWHG WKURXJK WKH GLUHFW LQWHUIHUHQFH RI WKH LQWHUDFWLRQ RI 27 ZLWK LWV RZQ UHFHSWRU %RJDFNL HW DK f

PAGE 26

/XWHLQL]LQJ KRUPRQH KDV EHHQ LPSOLFDWHG LQ WKH V\QWKHVLV DQG UHJXODWLRQ RI 3*)D SURGXFWLRQ )UHLGPDQ HW DO 6KHPHVK HW DO f LWV HIIHFW EHLQJ UHVWULFWHG WR PLG WR ODWH OXWHDO SKDVHV RI WKH F\FOH 6KHPHVK f 3URVWDJODQGLQ )D DFWLQJ YLD WKH 3.& SDWKZD\ PD\ DFWLYDWH DQ LQFUHDVH LQ LQWUDFHOOXODU FDOFLXP ZKLFK LQ WXUQ VWLPXODWHV 3*)D V\QWKHVLV IURP WKH HQGRPHWULXP WR IRUP DQ DXWRDPSOLILFDWLRQ V\VWHP RI LWV RZQ SURGXFWLRQ %XPV HW DO 6NDU]\QVNL HW DO f 1RUHSLQHSKULQH VWLPXODWHV 3*)D UHOHDVH GXULQJ WKH IROOLFXODU SKDVH DQG HDUO\ OXWHDO SKDVH WLPH SHULRGV ZKHQ WKH LQIOXHQFH RI SURJHVWHURQH LV PLQLPDO 6NDU]\QVNL HW DO f ,W KDV EHHQ GHPRQVWUDWHG WKDW 71)D UHFHSWRUV DUH SUHVHQW LQ WKH ERYLQH HQGRPHWULXP 6NDU]\QVNL HW DO Df )XUWKHUPRUH 71)D FDQ VWLPXODWH UHOHDVH RI 3*)D IURP ERYLQH HQGRPHWULDO VWURPDO FHOOV EXW QRW LQ HSLWKHOLDO FHOOV 6NDU]\QVNL HW DO Df 0RUHRYHU 71)D VWLPXODWHV V\QWKHVLV RI 3*)D GXULQJ ERWK OXWHDO DQG IROOLFXODU SKDVHV RI WKH F\FOH 7KLV HIIHFW LV LQ FRQWUDVW WR WKH HIIHFWV RI 27 ZKLFK RQO\ VWLPXODWHV 3*)D V\QWKHVLV GXULQJ WKH IROOLFXODU SKDVH 7KH IDFW WKDW WKH EXON RI 3*)D LV SURGXFHG E\ WKH HSLWKHOLDO FHOOV $VVHOLQ HW DO 6NDU]\QVNL HW DO Df ZKHUHDV 71)D VWLPXODWLRQ LV GLUHFWHG WR WKH VWURPDO FHOOV PD\ VXJJHVW WKDW DQ DXWRDPSOLILFDWLRQ ORRS RI 3*)D V\QWKHVLV PD\ H[LVW HDUO\ LQ OXWHRO\VLV 7XPRU QHFURVLV IDFWRU D PD\ SOD\ DQ DFWLYH UROH LQ WKH LQLWLDWLRQ RI OXWHRO\VLV DQG ODWHU 27LQGXFHG 3*)D SOD\V D UROH LQ WKH FRPSOHWLRQ RI OXWHRO\VLV 2NXGD HW DO f $URVK HW DO f VKRZHG FRH[SUHVVLRQ RI 3*)6 DQG 3*(6 P51$ LQ ERYLQH HQGRPHWULXP GXULQJ WKH HVWURXV F\FOH 7KH 3*(6 ZDV FRH[SUHVVHG DW KLJK OHYHO ZLWK 3*+6 EHWZHHQ GD\V DQG RI WKH HVWURXV F\FOH VXJJHVWLQJ WKDW WKH PHFKDQLVP IRU WKH V\QWKHVLV RI 3*( LV DOUHDG\ SUHVHQW E\ GD\ RI WKH F\FOH 3URVWDJODQGLQ ( V\QWKDVH

PAGE 27

ZDV H[SUHVVHG DW PRGHUDWH ORZ DQG KLJK OHYHOV RQ GD\V DQG RI WKH HVWURXV F\FOH UHVSHFWLYHO\ $URVK HW DO f ,QKLELWLRQ RI /XWHROYVLV E\ WKH (PEU\R ([SDQVLRQ DQG FHOO GLYLVLRQ RI WKH HPEU\R LV FRQWUROOHG E\ IDFWRUV VHFUHWHG E\ WKH HQGRPHWULXP EXW WKH FRPSOHWH QDWXUH RI WKHVH IDFWRUV LV VWLOO XQNQRZQ *RII f ,W LV QHFHVVDU\ WKDW WKH FRQFHSWXV HORQJDWHV UDSLGO\ VR DV WR DWWDFK WR DV PXFK DUHD RI WKH HQGRPHWULXP DV SRVVLEOH LQ RUGHU WR UHGXFH WKH VHFUHWLRQ RI 3*)D *RII f ,QWHUIHURQ[ LV SURGXFHG E\ WKH WURSKREODVW EHWZHHQ GD\V WR RI JHVWDWLRQ %DUWRO HW DO f DQG SUHYHQWV OXWHRO\VLV E\ VXSSUHVVLQJ HQGRPHWULDO 3*)D VHFUHWLRQ YLD GRZQUHJXODWLRQ RI H[SUHVVLRQ RI HVWURJHQ DQG 275 6SHQFHU HW DO Ef (YLGHQFH WKDW WKH HPEU\R RU ,)1[ LQKLELWV OXWHRO\VLV LV SURYLGHG IURP VWXGLHV E\ .QLFNHUERFNHU HW DO f ZKHUH WKH\ VKRZHG WKDW DGPLQLVWUDWLRQ RI ZKROH FRQFHSWXV VHFUHWRU\ SURWHLQV LQWR WKH XWHUXV UHGXFHG SXOVDWLOH 3*)D SXOVHV IURP WKH XWHUXV DQG H[WHQGHG WKH HVWURXV F\FOH IURP GD\V WR GD\V LQ F\FOLF FRZV ,QWUDXWHULQH DGPLQLVWUDWLRQ RI UHFRPELQDQW ERYLQH LQWHUIHURQ[ UE,)1[f LQFUHDVHG WKH LQWHUHVWURXV LQWHUYDO H[WHQGHG WKH OLIH RI WKH &/ DQG DEROLVKHG 27LQGXFHG 3*)D V\QWKHVLV 0H\HU HW DO f 3UHVHQFH RI DQ LQWUDFHOOXODU HQGRPHWULDO LQKLELWRU RI 3*)D LQ WKH HQGRPHWULXP RI SUHJQDQW FRZV ZDV VKRZQ E\ WKH LQKLELWLRQ RI 3*) V\QWKHVLV E\ FRW\OHGRQDU\ PLFURVRPHV IURP SDUWXULHQW FDWWOH ZKHUHE\ V\QWKHVLV ZDV UHGXFHG E\ b ZKHQ LQFXEDWLRQ ZDV GRQH LQ HQGRPHWULDO F\WRVROLF VXSHUQDWDQWV IURP SUHJQDQW FRZV EXW RQO\ E\ b ZKHQ LQFXEDWHG ZLWK HQGRPHWULDO F\WRVROLF VXSHUQDWDQW IURP F\FOLF FRZV GD\ SRVWHVWUXV *URVV HW DO Df

PAGE 28

8VLQJ D SHULIXVLRQ GHYLFH *URVV HW DO Ef VKRZHG WKDW WKH VHFUHWLRQ UDWHV RI 3*( ZHUH QRW DIIHFWHG E\ SUHJQDQF\ VWDWXV ZKHUHDV 3*) VHFUHWLRQ ZDV GHFUHDVHG +RZHYHU WKH UDWHV ZHUH LQFUHDVHG LQ F\FOLF DQG EUHG FRZV WKDW ZHUH QRW SUHJQDQW 7KH\ IXUWKHU GHPRQVWUDWHG WKDW SURVWDJODQGLQ VHFUHWLRQ ZDV QRW VWLPXODWHG E\ 27 LQ GD\ SUHJQDQW FRZV 7KLV LV LQ FRQWUDVW WR UHVXOWV IURP LQ YLWUR VWXGLHV WKDW KDYH VKRZQ WKDW ,)1[ LQFUHDVHV V\QWKHVLV RI 3*( $VVHOLQ HW DO Df 7KLV HIIHFW KRZHYHU PD\ EH D GRVH UHVSRQVH VLQFH ORZ GRVHV RI ,)1U WKHUH LV LQKLELWLRQ ZKHUHDV DW KLJK GRVHV WKHUH LV VWLPXODWLRQ 6SHQFHU HW DO f SURSRVHG WKDW ,)1[ PD\ EORFN HVWURJHQ UHFHSWRU V\QWKHVLV DQG WKXV 275 V\QWKHVLV E\ f LQGLUHFWO\ VWDELOL]LQJ RU SUHYHQWLQJ WKH GRZQUHJXODWLRQ RI SURJHVWHURQH UHFHSWRU JHQH H[SUHVVLRQ E\ SURJHVWHURQH DQG f GLUHFWO\ LQKLELWLQJ HVWURJHQ UHFHSWRU JHQH H[SUHVVLRQ DQG WKXV DOORZLQJ WKH PDLQWHQDQFH RI WKH &/ DQG VXFFHVVIXO PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ +RZHYHU LW KDV UHFHQWO\ EHHQ UHSRUWHG WKDW ,)1[ SUHYHQWV OXWHRO\VLV LQ VKHHS E\ GLUHFWO\ LQKLELWLQJ DQG VLOHQFLQJ WUDQVFULSWLRQ RI (5D JHQH ZKLFK SUHYHQWV WKH DELOLW\ RI DFWLYDWHG HVWURJHQ UHFHSWRU D (5Df WR LQFUHDVH 275 JHQH WUDQVFULSWLRQ %D]HU HW DO f ,QFUHDVHG RXWSXW RI ,)1[ LV GXH WR LQFUHDVHG VL]H RI WKH HPEU\R UDWKHU WKDQ LQFUHDVHG V\QWKHVLV VXJJHVWLQJ WKDW HPEU\R HORQJDWLRQ LV LPSRUWDQW LQ SUHYHQWLQJ OXWHRO\VLV VLQFH VPDOOHU HPEU\RV ZLOO SURGXFH OHVV ,)1[ DQG OHDG WR HPEU\R ORVV ,QWHUIHURQ[ DOVR VWLPXODWHV SURWHLQ VHFUHWLRQ IURP WKH HQGRPHWULXP (PRQG HW DO f (QGRPHWULDO SURWHLQV DQG JUDQXORF\WH PDFURSKDJH FRORQ\ VWLPXODWLQJ IDFWRU *0&6)f KDYH EHHQ VKRZQ WR LQFUHDVH ,)1[ SURGXFWLRQ LQ RYLQH HPEU\RV ,PDNDZD HW DO f 7KH *0&6) LV D F\WRNLQH WKDW SURPRWHV FRQFHSWDV JURZWK DQG VXUYLYDO

PAGE 29

KRZHYHU LW KDG QR HIIHFW RQ ,)1[ LQ WKH FRZ GH 0RUDHV DQG +DQVHQ f ,QWHUIHURQ [ SURGXFHG E\ WKH WURSKREODVW PD\ EH IXUWKHU VWLPXODWHG E\ *0&6) IURP WKH HQGRPHWULDO HSLWKHOLXP ,PDNDZD HW DO f 7KH VWURPDO FHOOV LQ WKH XWHUXV UHVSRQG E\ LQFUHDVLQJ *0&6) OHDGLQJ WR DQ DXWR DPSOLILFDWLRQ ORRS (PRQG HW DO f 5HFRPELQDQW RYLQH LQWHUIHURQU UR,)1Uf KDV EHHQ VKRZQ WR XSUHJXODWH 3*+6 H[SUHVVLRQ LQ ERWK HSLWKHOLDO DQG VWURPDO FHOOV IROORZHG E\ LQFUHDVHG SURGXFWLRQ RI 3*( LQ HSLWKHOLDO DQG 3*)D LQ VWURPDO FHOOV RI ERYLQH HQGRPHWULXP LQ YLWUR $VVHOLQ HW DO Ff 8SUHJXODWLRQ RI 3*+6 ZDV JUHDWHU LQ VWURPDO WKDQ HSLWKHOLDO FHOOV 8QGHU LQ YLWUR FRQGLWLRQV QDWXUDO ERYLQH ,)1[ VLJQLILFDQWO\ GLPLQLVKHG EDVDO 3*)D EXW QRW 3*( VHFUHWLRQ IURP ERYLQH HQGRPHWULDO H[SODQWV *RGNLQ HW DO f +RZHYHU UE,)1[ ZDV IRXQG WR LQKLELW ERWK 3*)D DQG 3*( LQ ERYLQH HSLWKHOLDO EXW KDG QR HIIHFW RQ VWURPDO FHOOV 6PLWK DQG *RGNLQ 6PLWK HW DO 'HVQR\HUV HW DO *RGNLQ HW DO f 'XULQJ HDUO\ SUHJQDQF\ LQ FRZV GD\V WR f WKHUH LV VXSSUHVVLRQ RI 275 DQG HVWURJHQ UHFHSWRUV )DULQ HW DO 5RELQVRQ HW DO f %D]HU HW DO f K\SRWKHVL]HG WKDW ,)1[ GRZQUHJXODWHV 275 E\ LQKLELWLRQ RI XSUHJXODWLRQ RI 275 'HFUHDVHG H[SUHVVLRQ RI HVWURJHQ UHFHSWRUV RFFXUV LQ WKH SUHJQDQW KRUQ RI XQLODWHUDOO\ SUHJQDQW HZHV /DPPLQJ HW DO f DQG LQWUDXWHULQH LQIXVLRQ RI UR,)1[ GXULQJ WKH OXWHDO SKDVH LQKLELWV HVWURJHQ DQG 275 H[SUHVVLRQ LQ WKH HQGRPHWULXP 6SHQFHU HW DO Ff 5HFRPELQDQW R,)1[ SUHYHQWV XSUHJXODWLRQ RI HVWURJHQ DQG 275 P51$ DQG SURWHLQ H[SUHVVLRQ DIWHU H[RJHQRXV HVWUDGLRO DGPLQLVWUDWLRQ RQ GD\ 6SHQFHU HW DO Ff 5RELQVRQ HW DO f IDLOHG WR GHWHFW 275 P51$ DQG SURWHLQ LQ WKH OXPLQDO

PAGE 30

HSLWKHOLXP RI FRZV DW GD\ RI SUHJQDQF\ EXW ZDV DEOH WR GHWHFW LW LQ QRQ SUHJQDQW FRZV LQGLFDWLQJ WKDW SUHVHQFH RI WKH HPEU\R VXSSUHVVHG H[SUHVVLRQ RI 275 7KH HIILFLHQF\ RI LQKLELWLRQ RI WKH OXWHRO\WLF PHFKDQLVP GXULQJ SUHJQDQF\ GHSHQGV RQ ,)1W 0DQQ DQG /DPPLQJ f 7KH\ VKRZHG WKDW GD\ SUHJQDQW GDLU\ FRZV SURGXFHG OHVV 3*)D PHWDEROLWH GLK\GURNHWR 3*) 3*)0 f DIWHU DQ 27 LXf FKDOOHQJH FRPSDUHG WR XQLQVHPLQDWHG FRQWURO FRZV 7KH\ IXUWKHU VKRZHG WKDW FRZV ZLWK DQ HPEU\R DQG PHDVXUDEOH TXDQWLWLHV RI ,)1W DWWHQXDWHG WKH 3*)D UHVSRQVH WR 27 WKDQ WKRVH ZLWKRXW DQ HPEU\R &RQVHTXHQWO\ VXFFHVVIXO HVWDEOLVKPHQW RI SUHJQDQF\ DSSHDUV WR GHSHQG RQ WKH SUHVHQFH RI D ZHOO GHYHORSHG HPEU\R WKDW SURGXFHV HQRXJK ,)1W ,Q ERWK FRZV DQG VKHHS H[SUHVVLRQ RI 3*+6 LV PRGXODWHG LQ UHVSRQVH WR YDULRXV VWLPXOL DQG LV FRUUHODWHG ZLWK SURGXFWLRQ RI SURVWDJODQGLQV GXULQJ PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ $VVHOLQ HW DO E &KDUSLJQ\ HW DO f 7KH 3*+6 SURWHLQ LV H[SUHVVHG IRU H[WHQGHG SHULRGV LQ SUHJQDQW DQLPDOV VXJJHVWLQJ WKDW LQFUHDVHG SURGXFWLRQ RI SURVWDJODQGLQV PD\ EH LQYROYHG LQ UHFRJQLWLRQ RI SUHJQDQF\ &KDUSLJQ\ HW DO f %LQHOOL HW DO f VKRZHG WKDW ,)1W GLUHFWO\ LQKLELWV 3.&UHJXODWHG 3*)D SURGXFWLRQ DQG H[SUHVVLRQ RI 3*+6 DQG SKRVSKROLSDVH $ 3/$f ,QWHUIHURQ[ DOVR ZDV VKRZQ WR VXSSUHVV 3*)D SURGXFWLRQ DQG 3*+6 LQGHSHQGHQW RI 27LQGXFHG HDUO\ VLJQDOLQJ HYHQWV 3/&,3'$*3.&f LQ LPPRUWDOL]HG ERYLQH HQGRPHWULDO %(1'f FHOOV 3UX HW DO f ,QWHUIHURQ[ PD\ LQKLELW OXWHRO\VLV E\ VKLIWLQJ WKH SULPDU\ SURVWDJODQGLQ SURGXFHG LQ WKH HQGRPHWULXP IURP OXWHRO\WLF 3*)RL WR OXWHRWURSKLF 3*( 2NXGD HW DO f 7KH 71)D VWLPXODWHV 3*)D V\QWKHVLV LQ VWURPDO FHOOV EXW QRW LQ HSLWKHOLDO FHOOV RI WKH ERYLQH HQGRPHWULXP 6NDU]\QVNL HW DO Ef ,W KDV EHHQ

PAGE 31

VXJJHVWHG WKDW LW PD\ LQGXFH ORFDO DXWRDPSOLILFDWLRQ RI 3*) LQ WKH HQGRPHWULXP 6NDU]\QVNL HW DO f DQG WKXV LQLWLDWH D SRVLWLYH ORRS EHWZHHQ SLWXLWDU\ DQG RYDULDQ 27 DQG XWHULQH 3*)4 WR FRPSOHWH OXWHRO\VLV 6NDU]\QVNL HW DO 2NXGD HW DO f ,W ZDV UHFHQWO\ VKRZQ WKDW VXSSUHVVLRQ RI 71)D LQGXFHG3*)D VHFUHWLRQ E\ ,)1 7 LV YLD GRZQUHJXODWLRQ RI 3*+6 H[SUHVVLRQ VWLPXODWHG E\ 71)D 2NXGD HW DO f ,QWHUIHURQ[ LQKLELWV SURGXFWLRQ RI 3*)D LQ ERYLQH HQGRPHWULDO HSLWKHOLDO FHOOV E\ GRZQUHJXODWLQJ WKH H[SUHVVLRQ RI 3*+6 ;LDR HW DO f +RZHYHU LW HQKDQFHV 3*+6 P51$ DQG 3*)RL V\QWKHVLV LQ VWURPDO FHOOV ZKLFK DUH WKH SULQFLSDO VLWH IRU 3*( V\QWKHVLV 7KH H[SUHVVLRQ RI 3*+6 LQ ERYLQH HPEU\RV DSSHDUV WR EH WUDQVLHQW DQG LV DVVRFLDWHG ZLWK WKH ILUVW FOHDYDJHV ZLWK D GHFUHDVH RFFXUULQJ DW WKH PRUXOD VWDJH *XYHULFK DQG 6KHPHVK f /DUJH DPRXQWV RI WKH HQ]\PH KDYH EHHQ UHSRUWHG WR EH SURGXFHG EHWZHHQ KDWFKLQJ DQG LPSODQWDWLRQ LQ RYLQH /HZLV DQG :DWHUPDQ f DQG ERYLQH FRQFHSWXVHV 6KHPHVK HW DO /HZLV HW DO f (ORQJDWLRQ RI WKH FRQFHSWXV PD\ EH GXH WR VWLPXODWLRQ E\ VHYHUDO PLWRJHQV DQG JURZWK IDFWRUV VRPH RI ZKLFK VWLPXODWH 3*+6 H[SUHVVLRQ 7KH H[SUHVVLRQ RI 3*+6 LQ RYLQH HPEU\RV LV GHYHORSPHQWDOO\ UHODWHG DQG RFFXUV DW D WLPH ZKHQ WKH HPEU\R WXUQV LQWR D ILODPHQWRXV W\SH 7KH SDWWHUQ LV DOVR VLPLODU WR WKDW RI ,)1W ZKLFK EHJLQV RQ GD\ DQG HQGV DERXW GD\ RI SUHJQDQF\ LQ VKHHS &KDUSLJQ\ HW DO *XLOORPRW HW DO f +LJK OHYHOV RI SURJHVWHURQH GXULQJ SUHJQDQF\ DOVR KDYH DQ LQKLELWRU\ HIIHFW RQ XSUHJXODWLRQ RI HVWUDGLRO DQG 275 7KH HPEU\R PD\ IXUWKHU SUHYHQW OXWHRO\VLV E\ VHFUHWLQJ D SURWHLQ WKDW EORFNV WKH HIIHFW RI SURVWDJODQGLQV RQ WKH ODUJH OXWHDO FHOOV LQ WKH &/ WR PDLQWDLQ D FRQVWDQW VRXUFH RI SURJHVWHURQH :LOWEDQN HW DO f

PAGE 32

&RQFHQWUDWLRQV RI OLQROHQLF DFLG DUH LQFUHDVHG LQ WKH HQGRPHWULXP RI FDWWOH GXULQJ SUHJQDQF\ DQG OLQROHQLF DFLG LV D FRPSHWLWLYH LQKLELWRU RI DUDFKLGRQLF DFLG PHWDEROLVP 7KDWFKHU HW DO f /LQROHQLF DFLG KDV DQ HIIHFW RQ OLPLWLQJ WKH DPRXQW RI DUDFKLGRQLF DFLG WKDW FDQ EH FRQYHUWHG WR 3*)D DQG LWV V\QWKHVLV LV LQFUHDVHG E\ ,)1[ 5HVXPSWLRQ RI WKH 3URVWDJODQGLQ 6\QWKHVLV 6\VWHP DIWHU 0DWHUQDO 5HFRJQLWLRQ RI 3UHJQDQF\ 7HUPLQDWLRQ RI ,)1[ H[SUHVVLRQ LV GHSHQGHQW RQ LPSODQWDWLRQ VLQFH FHVVDWLRQ RI R,)1[ H[SUHVVLRQ RFFXUV LQ WKH UHJLRQV RI WKH WURSKREODVW WKDW KDYH HVWDEOLVKHG FHOOXODU FRQWDFWV ZLWK WKH XWHULQH HSLWKHOLXP GXULQJ WKH LPSODQWDWLRQ SURFHVV 'HPPHUV HW DO f ,QWUDXWHULQH LQIXVLRQ RI ,)1[ LQWR F\FOLF -HUVH\ FRZV IURP GD\V WR LQFUHDVHG WKH F\FOH OHQJWK WR GD\V +HOPHU HW DO f ZKHUHDV ZKHQ WKH FRQFHSWRV ZDV OHIW LQ WKH XWHUXV DQG WKHQ UHPRYHG RQ GD\V RU OXWHDO OLIH VSDQ ZDV H[WHQGHG EXW RQO\ IRU D IHZ GD\V 1RUWKH\ DQG )UHQFK f ZKLFK VXJJHVWV WKDW 3*) V\QWKHVLV EHFRPHV UHHVWDEOLVKHG DIWHU PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ ,Q WKH LQWHUFDUXQFXODU ERYLQH HQGRPHWULXP 275 ZHUH ORZ RQ GD\ DQG EHFDPH XSUHJXODWHG E\ PRUH WKDQ WHQ IROG RQ GD\ )XFKV HW DO f (QGRPHWULDO 275 KDV EHHQ VKRZQ WR FKDQJH DV D IXQFWLRQ RI JHVWDWLRQDO DJH LQ SUHJQDQW EHHI FDWWOH IURP GD\V WR )XFKV HW DO Ef 7KHUH ZDV DOVR D SDUDOOHO LQFUHDVH LQ SODVPD 3*)0 DIWHU FKDOOHQJH ZLWK LX RI 27 VXJJHVWLQJ WKDW DW GD\ RI SUHJQDQF\ WKH 275 LV IXQFWLRQDOO\ FRXSOHG WR 3*)FO UHOHDVH DQG WKHLU FRQFHQWUDWLRQ GHWHUPLQHV WKH PDJQLWXGH RI 27LQGXFHG 3*)D GXULQJ JHVWDWLRQ %DODJXHU HW DO f FKDOOHQJHG EHHI SUHJQDQW FRZV ZLWK 27 LXf IURP GD\V WR RI SUHJQDQF\ DQG UHSRUWHG LQFUHDVHG 3*)0 LQ SODVPD 7KH UHVSRQVH RI

PAGE 33

3*)0 DIWHU 27 LQFUHDVHG IURP GD\V WR RI SUHJQDQF\ 7KLV UHVXOW VXJJHVWV WKDW WKH 27SURVWDQRLG V\VWHP PD\ EH DFWLYH GXULQJ WKLV SHULLPSODQWDWLRQ SHULRG GD\V WR f 0DWHUQDO SODVPD SURJHVWHURQH FRQFHQWUDWLRQV ZHUH FRUUHODWHG ZLWK ,)1[ SURGXFWLRQ LQ ERYLQH FRQFHSWXVHV VXJJHVWLQJ WKDW KLJKHU PDWHUQDO SURJHVWHURQH SURYLGHV D PRUH VXLWDEOH HQYLURQPHQW IRU WKH GHYHORSLQJ FRQFHSWDV .HUEOHU HW DO f 7KLV PHDQV WKDW LQ WKH DEVHQFH RI ,)1U DIWHU PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ WKH KLJK FRQFHQWUDWLRQV RI SURJHVWHURQH DUH HQRXJK WR PDLQWDLQ SUHJQDQF\ 3URSHUWLHV RI WKH .H\ (OHPHQWV ,QYROYHG LQ /XWHROYVLV %RYLQH 2[\WRFLQ 5HFHSWRU 7KH ERYLQH 275 LV D PHPEHU RI WKH UKRGRSVLQW\SH FODVV f SURWHLQ FRXSOHG UHFHSWRU IDPLO\ *3&5f 7KH VHYHQ WUDQVPHPEUDQH D KHOL[HV DUH KLJKO\ FRQVHUYHG *LPSO DQG )DKUHQKRO] f 7KH 275 HQFRGHV D SURWHLQ RI DPLQR DFLGV ,W FRQVLVWV RI WZR LQWURQV RQH LQ WKH f QRQFRGLQJ UHJLRQ WKDW DSSHDUV WR EH GLIIHUHQWLDOO\ VSOLFHG LQ WKH ERYLQH XWHUXV DQG D FRQVHUYHG LQWURQ ZLWKLQ WKH RSHQ UHDGLQJ IUDPH EHWZHHQ WKH UHJLRQV HQFRGLQJ WKH WUDQVPHPEUDQH GRPDLQV 9, DQG 9,, 7KH ERYLQH 275 FRQVLVWV RI WKUHH PDMRU WUDQVFULSWV DW NE NE DQG NE %DWKJDWH HW DO f 7KH 275 JHQH SURPRWHU ODFNV DQ HVWURJHQ UHVSRQVH HOHPHQW (5(f +RUQ HW DO f 6LPLODUO\ WKH KXPDQ 275 JHQH GRHV QRW KDYH (5( LQ LWV VHTXHQFH XSVWUHDP RI WKH WUDQVFULSWLRQ VWDUW VLWH DQG QRQH RI LWV (5( KDOIVLWHV UHVSRQG WR LQFUHDVHG HVWURJHQ DFWLYLW\ ZKHQ FRWUDQVIHFWHG ZLWK HVWURJHQ UHFHSWRU ,YHOO HW DO 7HOJPDQQ HW DO f +RZHYHU WKH ODFN RI (5( GRHV QRW H[FOXGH SRWHQWLDO HIIHFWV RI HVWURJHQ RQ JHQH H[SUHVVLRQ VLQFH WKHUH DUH KDOI SDOLQGURPLF (5( PRWLIV WKDW FRXOG DFW V\QHUJLVWLFDOO\ WR PHGLDWH HVWURJHQ DFWLYDWLRQ DV KDV EHHQ VKRZQ LQ WKH RYDOEXPLQ JHQH .DWR HW DO f

PAGE 34

,Q VKHHS KRZHYHU LW KDV UHFHQWO\ EHHQ VKRZQ WKDW OLJDQGHG (5D VWLPXODWHV 275 SURPRWHU WKURXJK ERWK '1$ DQG SURWHLQSURWHLQ LQWHUDFWLRQV ZLWK WKH SURPRWHU HOHPHQWV DFWLYDWRU SURWHLQ $Sf DQG 6SO GHVSLWH WKH ODFN RI FRQVHQVXV ELQGLQJ VLWHV IRU (5D RQ RYLQH 275 %D]HU HW DO f 2[\WRFLQ 5HFHSWRU 6LJQDOLQJ 2[\WRFLQ ELQGV WR D FHOOVXUIDFH PHPEUDQH UHFHSWRU DQG DFWLYDWHV DQ LQWUDFHOOXODU VLJQDOLQJ SDWKZD\ WKDW OHDGV WR DFWLYDWLRQ RI 3/& *LPSO DQG )DKUHQKRO] f 2QFH DFWLYDWHG 3/& FOHDYHV SKRVSKDWLG\OLQRVLWRO ELVSKRVSKDWH LQWR WKH VHFRQG PHVVHQJHUV GLDF\OJO\FHURO '$*f DQG ,3 7KH '$* LQFUHDVHV 3*)D V\QWKHVLV E\ DFWLYDWLQJ SURWHLQ NLQDVH & DFWLYLW\ 3URWHLQ NLQDVH & WKHQ DFWLYDWHV D QXPEHU RI LQWUDFHOOXODU HQ]\PHV WKDW OHDG WR DFWLYDWLRQ RI SKRVSKROLSDVH $ 3/$f %XPV HW DO f 7KH 3.& DFWLYDWHV 5DV RU 5DI ZKLFK SKRVSKRU\ODWHV DQG DFWLYDWHV PLWRJHQ DFWLYDWHG SURWHLQ NLQDVH 0$3. NLQDVHf 0(.f /HZLV HW DO f 7KH F\WRVROLF IRUP RI 3/$ PRELOL]HV DUDFKLGRQLF DFLG IURP SKRVSKROLSLGV .UDPHU DQG 6KDUS f 7KH DUDFKLGRQLF DFLG LV FRQYHUWHG WR SURVWDJODQGLQ + 3*+f E\ SURVWDJODQGLQ + V\QWKDVH 3*+6f 6PLWK f 7KH 3*+ LV WKHQ FRQYHUWHG WR 3*)D E\ WKH HQ]\PH SURVWDJODQGLQ ) V\QWKDVH 3*)6f 5HJXODWLRQ RI 2[\WRFLQ 5HFHSWRU $OWKRXJK DGPLQLVWUDWLRQ RI HVWUDGLRO LQ YLYR VWLPXODWHV DQ LQFUHDVH LQ XWHULQH 275 %HDUG DQG /DPPLQJ :DWKHV HW DO f 275 XSUHJXODWLRQ LQ YLWUR RFFXUV VSRQWDQHRXVO\ LQ WKH DEVHQFH RI HVWURJHQV 6KHOGULFN HW DO +RUQ HW DO /HXQJ DQG :DWKHV f ,Q YLWUR DQG LQ YLYR 27 FDXVHV VKRUWWHUP XSUHJXODWLRQ RI

PAGE 35

275 H[SUHVVLRQ EXW WKLV HIIHFW LV QRW PDLQWDLQHG IRU PRUH WKDQ WR GD\V /HXQJ DQG :DWKHV f (VWURJHQV DOVR PD\ LQLWLDWH QRQJHQRPLF UHDFWLRQV LQ WKH DEVHQFH RI HVWUDGLRO UHFHSWRU ,JQDU7URZEULGJH HW DO f 7KHUH VHHP WR EH VSHFLHV GLIIHUHQFHV EHWZHHQ FDWWOH DQG VKHHS LQ WKH ZD\ 275 DUH UHJXODWHG /HXQJ DQG :DWKHV f 'XULQJ HDUO\ SUHJQDQF\ LQ FRZV WKH HPEU\R LV DEOH WR VXSSUHVV GHYHORSPHQW RI 275 DURXQG GD\ GHVSLWH WKH SUHVHQFH RI D KLJK QXPEHU RI HVWURJHQ UHFHSWRUV 5RELQVRQ HW DO f ,W KDV EHHQ VXJJHVWHG WKDW LQ VKHHS KRZHYHU WKDW WKH LQKLELWLRQ RI 275 H[SUHVVLRQ E\ ,)1[ PD\ EH PHGLDWHG LQLWLDOO\ E\ LQKLELWLRQ RI XWHULQH HVWUDGLRO UHFHSWRUV 6SHQFHU HW DO Df 3URJHVWHURQH KDV DQ LQKLELWRU\ HIIHFW RQ 275 H[SUHVVLRQ EXW WKLV HIIHFW LV ORVW DIWHU GD\V EHFDXVH SURJHVWHURQH GRZQUHJXODWHV LWV RZQ UHFHSWRU 0F&UDFNHQ HW DO .RPE HW DO f ,QKLELWRU\ HIIHFWV RI SURJHVWHURQH RQ HQGRPHWULDO WLVVXH DUH QRW PHGLDWHG WKURXJK JHQRPLF PHFKDQLVPV VXFK DV DFWLYDWLRQ RU VXSSUHVVLRQ RI VSHFLILF JHQHV OLNH 275 RU 3*+6 VLQFH WKH HIIHFWV FDQ EH VHHQ XQGHU YHU\ VKRUW WHUP FXOWXUH FRQGLWLRQV %RJDFNL HW DO f 3URJHVWHURQH ZDV DEOH WR VXSSUHVV WKH DELOLW\ RI R[\WRFLQ WR LQGXFH HQGRPHWULDO VHFUHWLRQ RI 3*)f DW FRQFHQWUDWLRQV DV ORZ DV Q0 QJPOf ZKLFK LV LQ WKH SK\VLRORJLFDO UDQJH )XUWKHU HYLGHQFH IURP QRQJHQRPLF HIIHFWV ZDV WKH ILQGLQJ WKDW SURJHVWHURQH LQKLELWV 27 ELQGLQJ WR 275FRQWDLQLQJ PHPEUDQHV LQ YLWUR DQG VXSSUHVVHV 27LQGXFHG LQRVLWRO SKRVSKDWH SURGXFWLRQ DQG FDOFLXP PRELOL]DWLRQ ZKLFK DUH KLJKO\ VWHURLG DQG UHFHSWRU VSHFLILF HIIHFWV *UD]]LQL HW DO %RJDFNL HW DO f 3LFDUG f VXJJHVWHG WKDW SURJHVWHURQH ELQGV WR WKH 275 DW DQ DOORVWHULF UHFHSWRU VLWH WR LQGXFH FRQIRUPDWLRQDO FKDQJH DQG WKXV SUHYHQWV 27 ELQGLQJ WR LWV

PAGE 36

UHFHSWRU ,Q YLWUR VWXGLHV KDYH VKRZQ WKDW VWLPXODWLRQ RI 3*)D E\ 27 LV PHGLDWHG E\ FDOFLXP LRQV %XPV HW DO f 7KLV 27LQGXFHG LQWUDFHOOXODU FDOFLXP UHOHDVH LV LQKLELWHG LQ ERYLQH HQGRPHWULDO FHOOV WKDW KDYH EHHQ SUHLQFXEDWHG ZLWK SURJHVWHURQH VXJJHVWLQJ WKDW WKH LQKLELWRU\ HIIHFWV RI SURJHVWHURQH PD\ EH YLD GLVUXSWLRQ RI WKH FDOFLXP VLJQDOLQJ SDWKZD\ %RJDFNL HW DO f 'HYHORSPHQW RI 275 LQ WKH OXPLQDO HSLWKHOLXP LV QRW GLUHFWO\ SUHFHGHG E\ FKDQJHV LQ WKH FRQFHQWUDWLRQ RI SURJHVWHURQH RU LWV UHFHSWRUV DQ LQGLFDWLRQ WKDW D WLPH GHSHQGHQW PHFKDQLVP PD\ PHGLDWH WKH LQKLELWRU\ HIIHFW RI SURJHVWHURQH RQ 275 IXQFWLRQ :DWKHV DQG /DPPLQJ 5RELQVRQ HW DO f 'XULQJ WKH OXWHDO SKDVH LQ QRQSUHJQDQW FRZV SURLQIODPPDWRU\ LQWHUOHXNLQV PD\ IRUP SDUW RI WKH LQKLELWRU\ PHFKDQLVP E\ ZKLFK SURJHVWHURQH LQKLELWV 275 ZKLOH DW WKH VDPH WLPH HQKDQFLQJ EDVDO SURVWDJODQGLQ V\QWKHVLV /HXQJ HW DO f $Q LQFUHDVH LQ EDVDO SURVWDJODQGLQ V\QWKHVLV GRHV QRW DFWLYDWH OXWHRO\VLV LQ WKH DEVHQFH RI 275 VLQFH SXOVHV RI 3*)D DUH UHTXLUHG 0F&UDFNHQ HW DO f /LSRSRO\VDFFKDULGH VWLPXODWHV 3*)D ZLWKRXW DOWHULQJ 275 P51$ ZKHUHDV ,/OD DQG VXSSUHVV 275 LQ WKH ODWH OXWHDO SKDVH /HXQJ HW DO f 'XULQJ SUHJQDQF\ WKH XSUHJXODWLRQ RI 275 DQG OXWHRO\VLV LV LQKLELWHG E\ VHFUHWLRQ RI ,)1[ IURP WKH WURSKRHFWRGHUP IURP GD\V WR LQ FDWWOH %DUWRO HW DO )DULQ HW DO f $GPLQLVWUDWLRQ RI UHFRPELQDQW ,)1U GXULQJ SUHJQDQF\ LQKLELWV 27LQGXFHG 3*)D VHFUHWLRQ E\ GRZQUHJXODWLRQ RI 275 LQ WKH HQGRPHWULXP DQG E\ GHFUHDVLQJ 3*+6 DQG 3*)6 YLD D PHFKDQLVP LQGHSHQGHQW RI FKDQJHV LQ 275 ;LDR HW DO f 3RVVLEO\ LQFUHDVHG EDVDO VHFUHWLRQ RI 3*+6 RFFXUV GXULQJ SUHJQDQF\ 7KH DQWLOXWHRO\WLF HIIHFWV RI ,)1[ DUH WR GLUHFWO\ LQKLELW DQG VLOHQFH HVWURJHQ UHFHSWRU D JHQH

PAGE 37

WUDQVFULSWLRQ WKDW LQ WXUQ LQKLELW WKH DELOLW\ RI DFWLYDWHG (5D WR LQFUHDVH 275 JHQH WUDQVFULSWLRQ %D]HU HW DO f &DUXQFOHV DUH GLIIHUHQWLDWHG VLWHV RI WKH HQGRPHWULXP LQ ZKLFK SODFHQWDWLRQ RFFXUV LQ UXPLQDQWV ,QWHUFDUXQFXODU DUHDV DUH SULYLOHJHG VLWHV IRU UHJXODWLRQ RI 3*)D SURGXFWLRQ E\ 27 D SURFHVV WKDW UHVXOWV LQ OXWHRO\VLV $VVHOLQ HW DO f (QGRPHWULDO FHOOV IURP LQWHUFDUXQFXODU DUHDV DUH PRUH UHVSRQVLYH WR 27 DQG WKRVH IURP FDUXQFXODU UHJLRQV DUH PRUH UHVSRQVLYH WR ,)1U $VVHOLQ HW DO f 3URVWDJODQGLQ + 6YQWKDVH W3*+6 6WUXFWXUH RI WKH %RYLQH 3*+6 *HQH 7KHUH DUH WZR LVR IRUPV RI 3*+6 FDOOHG YDULRXVO\ DV 3*+6 DQG 3*+6 RU &2; DQG &2; 7KH WZR LVRIRUPV KDYH PROHFXODU ZHLJKWV RI DQG UHVSHFWLYHO\ DQG WKHLU DPLQR DFLGV DUH b LGHQWLFDO EXW WKHLU VWUXFWXUDO DQG IXQFWLRQDO GRPDLQV DUH FRQVHUYHG +OD DQG 1LHOVRQ f 7KHVH HQ]\PHV DUH GHULYHG IURP JHQHV ORFDWHG RQ GLIIHUHQW FKURPRVRPHV WKDW HQFRGH GLIIHUHQW VL]HV RI P51$ NE IRU 3*+6 DQG NE IRU 3*+6 :KHUHDV 3*+6 LV LQGXFLEOH +HUVKPDQQ f 3*+6 LV FRQVWLWXWLYHO\ H[SUHVVHG :LOOLDPV DQG 'XERLV f 7KH ERYLQH 3*+6 P51$ FRQVLVWV RI D fXQWUDQVODWHG UHJLRQ RI ES DQ RSHQ UHDGLQJ IUDPH RI ES DQG D fXQWUDQVODWHG UHJLRQ RI ES FRQWDLQLQJ PXOWLSOH UHSHDWV RI WKH 6KDZ.DPHQ VHTXHQFH f$777$f /LX HW DO f ,W LV XQGHWHFWDEOH LQ PRVW WLVVXHV EXW FDQ EH LQGXFHG E\ DJRQLVWV DQG LV JHQHUDOO\ UHIHUUHG WR DV WKH LQGXFLEOH LVR IRUP 7KH JHQH FRQVLVWV RI H[RQV DQG LQWURQV 7KH WUDQVFULSWLRQ VWDUW VLWH LV D JXDQLGLQH UHVLGXH 7KH JHQH FRQVLVWV RI VHYHUDO FLVDFWLQJ HOHPHQWV ES XSVWUHDP RI WKH FDS VLWH LQFOXGLQJ F\FOLF DGHQRVLQH PRQRSKRVSKDWH ELQGLQJ SURWHLQ

PAGE 38

&(%3f $3 $3 QXFOHDU IDFWRU NDSSD % 1)N%f DFWLYDWRU WUDQVFULSWLRQ IDFWRUF\FOLF $03 UHVSRQVH HOHPHQW $7)&5(f DQG (ER[ ELQGLQJ SURWHLQV ,W GRHV QRW FRQWDLQ 7$7$ ER[ PRWLIV /LX HW DO f 0XWDWLRQ RI WKH &(%3 UHVXOWV LQ UHGXFWLRQ RI IRUVNROLQ DFWLYLW\ ZKHUHDV GHOHWLRQ RI $7)&5( DEROLVKHV 73$VWLPXODWHG WUDQVFULSWLRQ RI 3*+6 LQ KXPDQ HQGRWKHOLDO FHOOV 6XEEDUDPDLDK HW DO f 7KH SURWHLQ HQFRGHG E\ WKH ERYLQH 3*+6 JHQH LV VLPLODU WR RWKHU PDPPDOLDQ KRPRORJV EHLQJ b DQG b LGHQWLFDO WR KXPDQ +OD DQG :LHOVRQ f DQG RYLQH =KDQJ HW DO f SURWHLQ VHTXHQFHV UHVSHFWLYHO\ 6LJQDO 7UDQVGXFWLRQ 7KURXJK 3*+6 3URVWDJODQGLQ + V\QWKDVH LV SUHVHQW LQ ERWK WKH HQGRSODVPLF UHWLFXOXP DQG WKH QXFOHDU HQYHORSH EXW DSSHDUV WZLFH DV PXFK LQ WKH QXFOHDU HQYHORSH ZKHUHDV 3*+6 LV HTXDOO\ GLVWULEXWHG LQ WKH HQGRSODVPLF UHWLFXOXP DQG QXFOHDU HQYHORSH 0RULWD HW DO f 6ZLQQH\ HW DO f UHSRUWHG WKDW QHJDWLYH UHJXODWLRQ RI 3*+6 SHUPLWV 3*+6 WR R[\JHQDWH ORZ FRQFHQWUDWLRQV RI DUDFKLGRQLF DFLG $$f S0f XS WR IRXU WLPHV PRUH HIILFLHQWO\ WKDQ 3*+6 /LPLWLQJ LQWUDFHOOXODU FRQFHQWUDWLRQV RI $$ OHDGV WR WKH 3*+6 SDWKZD\ DQG KLJKHU FRQFHQWUDWLRQV S0f OHDGV WR 3*+6 V\QWKHVLV 0XUDNDPL HW DO f 7KUHH SKRVSKROLSDVH $ 3/$f IRUPV DUH LQYROYHG LQ DJRQLVW VWLPXODWHG $$ UHOHDVH EXW WKHUH LV QR JHQHUDO FRXSOLQJ RI VSHFLILF OLSDVHV WR 3*+6 RU 3*+6 0XUDNDPL HW DO f 3URVWDJODQGLQ + V\QWKDVH VHOHFWLYHO\ FRXSOHV WR RWKHU WHUPLQDO LVRPHUDVHV HVSHFLDOO\ 3*( V\QWKDVH DQG 3*, V\QWKDVH 6PLWK HW DO f $ QXPEHU RI LQIODPPDWRU\ DJHQWV VXFK DV ,/ OLSRSRO\VDFFKDULGH /36f DQG RWKHU JURZWK IDFWRUV VKDUH FRQYHUJHQW SDWKZD\V WKDW UHJXODWH WUDQVFULSWLRQ RI 3*+6 7KHVH LQFOXGH 1)N% DQG &(%3 VLJQDOLQJ SDWKZD\V FRPPRQ LQ LQIODPPDWRU\

PAGE 39

UHVSRQVHV 7KH RWKHUV DUH RQH RU PRUH RI WKH PLWRJHQ DFWLYDWHG SURWHLQ NLQDVH 0$3.f FDVFDGHV H[WUDFHOOXODU UHJXODWHG NLQDVH (5.f -DQXV NLQDVH -1.6$3.f DQG S5.0SN (DFK RI WKHVH SDWKZD\V KDV EHHQ VKRZQ WR FRQWULEXWH RU EH VROHO\ UHTXLUHG IRU LQFUHDVHG H[SUHVVLRQ RI 3*+6 LQ GLIIHUHQW FHOO FXOWXUH V\VWHPV 6PLWK HW DO f 5HJXODWLRQ RI 3*+6 *HQH ([SUHVVLRQ 3URVWDJODQGLQ *+ V\QWKDVH JHQH LV HOHYDWHG E\ JURZWK IDFWRUV DQG PHGLDWRUV RI LQIODPPDWLRQ VXFK DV ,/ 71)D /36 DQG 2WHWUDGHFDQR\OSKRUERO DFHWDWH 73$f +RZHYHU JOXFRFRUWLFRLGV DQG DQWLLQIODPPDWRU\ F\WRNLQHV VXSSUHVV 3*+6 H[SUHVVLRQ 6PLWK HW DK f 6HYHUDO FLVUHVSRQVLYH HOHPHQWV DFW DV NH\ UHJXODWRU\ HOHPHQWV WKDW PHGLDWH 3*+6 WUDQVFULSWLRQ LQ YDULRXV FHOO W\SHV 7KH '1$ HOHPHQWV DUH XWLOL]HG LQ D FHOO VSHFLILF DQG DFWLYDWRUVSHFLILF PDQQHU ,Q ERYLQH JUDQXORVD FHOOV DQG RYLQH ODUJH OXWHDO FHOOV (ER[ DUH HVVHQWLDO HOHPHQWV /LX HW DK :X DQG :LOWEDQN f ,Q UDW JUDQXORVD FHOOV &(%3 RU ( ER[ KDYH EHHQ UHSRUWHG WR EH WKH HVVHQWLDO HOHPHQWV IRU UHJXODWLRQ RI 3*+6 6LURLV DQG 5LFKDUGV f ZKHUHDV LQ ERYLQH JUDQXORVD FHOOV LW LV RQO\ WKH ( ER[ WKDW LV LPSRUWDQW IRU WUDQVFULSWLRQ RI 3*+6 E\ /+ RU SURWHLQ NLQDVH $ 3.$f DFWLYDWRUV /LX HW DK f ,Q RYLQH ODUJH OXWHDO FHOOV WKH (ER[ &(%3 DQG &5( LQ FRPELQDWLRQ DUH LQYROYHG LQ WKH LQGXFWLRQ RI 3*+6 E\ 3*)D DV ZHOO DV 3.& DFWLYDWRUV :X DQG :LOWEDQN f 7KH 3*+6 SURPRWHU KDV EHHQ VKRZQ WR EH LQGXFLEOH E\ EURPR F$03 EXW QRW SKRUERO HVWHUV LQ IUHVK JUDQXORVD FHOOV +RZHYHU DIWHU OXWHLQL]DWLRQ RI JUDQXORVD FHOOV E\ GD\ RI WUHDWPHQW ZLWK IRUVNROLQ WKH 3*+6 SURPRWHU ZDV LPPHGLDWHO\ LQGXFLEOH E\ SKRUERO HVWHUV EXW QRW E\ IRUVNROLQ :X DQG

PAGE 40

:LOWEDQN f 7KLV FKDQJH LQ UHVSRQVLYHQHVV KDV OHG WR WKH VXJJHVWLRQ WKDW OXWHLQL]DWLRQ FKDQJHV WUDQVFULSWLRQDO UHJXODWLRQ RI 3*+6 IURP 3.$ WR 3.& GHSHQGHQFH ZLWK WKH (ER[ EHLQJ WKH FUXFLDO HOHPHQW LQ WUDQVFULSWLRQDO DFWLYDWLRQ DQG UHPDLQLQJ FRQVHUYHG :X DQG :LOWEDQN f 7KH LQWUDFHOOXODU HIIHFWRU V\VWHPV LQYROYHG LQ LQGXFWLRQ RI 3*+6 DUH YLD 3.& GLUHFWO\ UHJXODWLQJ WUDQVFULSWLRQ RI 3*+6 JHQH LQ ODUJH OXWHDO FHOOV E\ DFWLQJ WKURXJK '1$ HOHPHQWV &5( DQG &(%3f FORVH WR D SXWDWLYH WUDQVFULSWLRQDO VWDUW SRLQW DQG SDUWLFXODUO\ DQ (ER[ UHJLRQ &$&*7*f DW ES :X DQG :LOWEDQN f %RYLQH XWHULQH VWURPDO FHOOV VWLPXODWHG ZLWK SKRUERO P\ULVWDWH DFHWDWH 30$f DQ DFWLYDWRU RI 3.& H[KLELW D PDUNHG H[SUHVVLRQ RI 3*+6 P51$ DQG SURWHLQ DIWHU WRO K RI VWLPXODWLRQ /LX HW DO f +RZHYHU WKLV VWLPXODWLRQ LV WUDQVLHQW DQG WKH 3*+6 WUDQVFULSW LV YHU\ XQVWDEOH ZKHUHDV WKH SURWHLQ LV PRUH VWDEOH :DQLQJ RI 3*+6 H[SUHVVLRQ E\ K LV DFFRPSDQLHG E\ LQFUHDVHG 3*( V\QWKHVLV VXJJHVWLQJ WKDW D WHPSRUDO DVVRFLDWLRQ H[LVWV EHWZHHQ LQGXFWLRQ RI 3*+6 P51$ 3*+6 SURWHLQ DQG 3*( 7KHUH VHHPV WR EH D GLIIHUHQFH LQ WKH PHFKDQLVP RI UHJXODWLRQ RI 3*+6 JHQH EHWZHHQ XWHULQH VWURPDO FHOOV DQG JUDQXORVD FHOOV ,Q XWHULQH VWURPDO FHOOV WKHUH LV D SURPRWHU UHJLRQ ORFDWHG DW WKDW GRHV QRW SOD\ D UROH LQ JUDQXORVD FHOOV /LX HW DK f 7KLV PD\ DFFRXQW IRU WKH GLIIHUHQFHV LQ VWLPXODWLRQ 30$ VWLPXODWLRQ LQ XWHULQH VWURPDO FHOOV DQG IRUVNROLQ LQ JUDQXORVD FHOOV /LX HW DK f 0XWDWLRQ RI &5( DQG &(%3 OHDGV WR UHGXFHG 3.&PHGLDWHG WUDQVFULSWLRQ :X DQG :LOWEDQN f ,Q WKH &/ 3*)D DFWV E\ VWLPXODWLQJ SURWHLQ NLQDVH & DQG FDOFLXP LRQV WR VWLPXODWH ODUJH OXWHDO FHOOV ZKLFK H[SUHVV 3*+6 DQG WKHQ SURGXFH 3*)D 7VDL DQG :LOWEDQN f

PAGE 41

7KH OXWHDO 3*)D IXQFWLRQV LQ DQ DXWRFULQHSDUDFULQH ZD\ WR LQFUHDVH WKH OXWHRO\WLF HIIHFWV FDXVHG E\ 3*)D RI HQGRPHWULDO RULJLQ 7XPRU QHFURVLV IDFWRU D LV D SRWHQW VWLPXODWRU RI 3*)D VHFUHWLRQ IURP WKH ERYLQH HQGRPHWULXP :KHUHDV WKH WDUJHW IRU 71)D DUH WKH HQGRPHWULDO VWURPDO FHOOV YLD DFWLYDWLRQ RI 3/$ DQG DUDFKLGRQLF DFLG FRQYHUVLRQ WKH WDUJHW IRU 27 WR VWLPXODWH 3*) DUH WKH HSLWKHOLDO FHOOV 6NDU]\QVNL HW DO Ef ,W KDV IXUWKHU EHHQ VXJJHVWHG WKDW 71)D PD\ VWLPXODWH 3*)& V\QWKHVLV E\ LQGXFLQJ QLWULF R[LGH V\QWKDVH (YLGHQFH RI WKLV SURFHVV FRPHV IURP H[SHULPHQWV VKRZLQJ LQFUHDVHG SURGXFWLRQ RI 3*)D DIWHU LQFXEDWLRQ RI HQGRPHWULDO FHOOV ZLWK D QLWULF R[LGH GRQRU 6QLWURVR$DFHW\OSHQLFLOODPLQH 6NDU]\QVNL HW DK Df 5HFRPELQDQW ERYLQH LQWHUIHURQ U LQGXFHV DFWLYDWLRQ RI WKH -DQXV NLQDVHVLJQDO WUDQVGXFHU DQG DFWLYDWRU RI WUDQVFULSWLRQ DQG S 0$3. SDWKZD\V LQ ERYLQH P\RPHWULDO FHOOV ,QKLELWLRQ RI S 0$3. SDWKZD\ E\ D VSHFLILF LQKLELWRU 6%f KDV EHHQ VKRZQ LQ YLWUR WR GHFUHDVH P51$ DQG SURWHLQ IRU 3*+6 LQ P\RPHWULDO FHOOV 'RXDOOD %HOO DQG .RURPLODV f 7KLV UHVXOW VXJJHVWV WKDW S SDWKZD\ XSUHJXODWHV 3*+6 H[SUHVVLRQ DW WKH SRVWWUDQVFULSWLRQDO OHYHO EHFDXVH LQKLELWLRQ GHVWDELOL]HV ,)1U LQGXFHG 3*+6 P51$ 7KH LQFUHDVHG VHQVLWLYLW\ VXJJHVWV WKDW 0$3 NLQDVH DQG 3, NLQDVH SDWKZD\V DUH ERWK VWLPXODWHG E\ 3*( DQG ERWK DUH LQYROYHG LQ 3*+6 H[SUHVVLRQ DQG WKDW 3.$ LV XSVWUHDP RI 3*(LQGXFHG DFWLYDWLRQ RI 0$3 NLQDVH LQ WKHVH FHOOV 0XQLU HW DK f 3URVWDJODQGLQ ) 6\QWKDVH $UDFKLGRQLF DFLG WKDW LV SURGXFHG E\ K\GURO\VLV RI SKRVSKROLSLGV LV WKH SUHFXUVRU IRU 3*)D V\QWKHVLV ,W LV FRQYHUWHG WR 3*+ E\ 3*+6 (YLGHQFH WKDW 3*+ LV WKH

PAGE 42

GLUHFW SUHFXUVRU IRU 3*)D ZDV ILUVW SUHVHQWHG E\ +DPEHUJ DQG 6DPXHOVRQ f ,W ZDV ODWHU GHPRQVWUDWHG WKDW WKH HQ]\PH FDWDO\]LQJ WKH FRQYHUVLRQ KDV JOXWDWKLRQH 6 WUDQVIHUDVH *67f SHUR[LGDVH DFWLYLW\ DQG GRHV QRW KDYH D 3*' NHWRUHGXFWDVH DFWLYLW\ %XUJHVV HW DO f 7KH 3*+ FDQ EH FRQYHUWHG WR 3*)f YLD WKUHH SDWKZD\V ,Q WKH ILUVW 3*+ LV FRQYHUWHG WR 3*)D E\ 3*)6 DOVR NQRZQ DV HQGRSHUR[LGH GHK\GURJHQDVH 7KH VHFRQG SDWKZD\ LQYROYHV FRQYHUVLRQ RI 3*+ WR 3*' E\ 3*' V\QWKDVH DQG WKHQ 3*' FRQYHUVLRQ WR 3*)f E\ 3*' NHWRUHGXFWDVH 7KH WKLUG SDWKZD\ LQYROYHV FRQYHUVLRQ RI 3*+ WR 3*( E\ 3*(6 DQG WKHQ 3*( WR 3*)f E\ 3*( NHWRUHGXFWDVH :DWDQDEH f 3URVWDJODQGLQ ) V\QWKDVHV EHORQJ WR WKH DOGRNHWRUHGXFWDVH $.5f VXSHUIDPLO\ 7DEOH f 6L[ GLIIHUHQW IRUPV RI 3*)6 KDYH EHHQ UHSRUWHG LQ OLWHUDWXUH WKUHH RI ZKLFK ZHUH LGHQWLILHG LQ FRZV /XQJ W\SH SURVWDJODQGLQ ) V\QWKDVH 3*)6f :DWDQDEH HW DK f FDWDO\]HV WKH UHGXFWLRQ RI 3*+ WR 3*)D DQG 3*' WR D VWHUHRLVRPHU RI 3*)FO D 3*)f 7KH RWKHU WZR DUH OXQJ W\SH 3*)6 IRXQG LQ WKH OLYHU DOVR NQRZQ DV 3*)6 .XFKLQNH HW DK :DWDQDEH HW DK f DQG WKH OLYHU W\SH 3*)6 DOVR NQRZQ DV GLK\GURGLRO GHK\GURJHQDVH ''%;f 6X]XNL HW DK Df 7KH RWKHUV DUH KXPDQ 3*)6 6X]XNL HW DK Ef VKHHS 3*)6 :X HW DK f DQG D 3*)6 LVRODWHG IURP 7U\SDQRVRPD EUXFHL .XEDWD HW DK f 7KH 3*)6 DQG 3*)6 DUH b LGHQWLFDO ZKHUHDV ''%; LV b LGHQWLFDO WR 3*)6 DQG 3*)6 $PRQJ WKH DERYH IDPLO\ PHPEHUV RQO\ 3*)6 LV DOVR FODVVLILHG DV $.5& DQG FDWDO\]HV WKH UHGXFWLRQ RI 3*' DQG 3*+ DQG WKH R[LGDWLRQ RI D 3*) GHVSLWH YHU\ KLJK KRPRORJ\ ZLWKLQ WKH IDPLO\ 6X]XNL HW DK Df

PAGE 43

5HJXODWLRQ RI 3URVWDJODQGLQ ) 6\QWKDVH $VVHOLQ DQG )RUWLHU f UHSRUWHG H[SUHVVLRQ RI D NHWR SURVWDJODQGLQ UHGXFWDVH HQ]\PH .3*5f DOVR NQRZQ DV 3*)6/ LQ WKH ERYLQH HQGRPHWULXP 7KLV HQ]\PH LV b KRPRORJRXV WR ERYLQH OXQJ 3*)6 7KH 3*)6/ LV GRZQUHJXODWHG E\ UHFRPELQDQW RYLQH ,)1W ZKHUHDV OXQJ W\SH 3*)6 LV UHGXFHG E\ KLJK DQG ORZ GRVHV RI UR,)1[ +RZHYHU 27 GLG QRW KDYH DQ\ HIIHFW RQ WKH P51$ H[SUHVVLRQ RI 3*)6/ DQG 3*)6 LQ ERYLQH HQGRPHWULDO HSLWKHOLDO FHOOV $VVHOLQ DQG )RUWLHU f 2[\WRFLQ XSUHJXODWHV 3*)6 P51$ LQ ERYLQH HQGRPHWULDO HSLWKHOLDO FHOOV EXW UEO)1[ LQKLELWV 27LQGXFHG 3*)6 DV ZHOO DV 3*+6 ;LDR HW DO f 7DEOH 3URVWDJODQGLQ V\QWKDVH HQ]\PHV WKDW EHORQJ WR WKH DOGRNHWRUHGXFWDVH VXSHUIDPLO\ (Q]\PH 6RXUFH ,QWUDFHOOXODU /RFDWLRQ 5HIHUHQFH 3*( NHWRUHGXFWDVH +XPDQ SODFHQWD &\WRVRO :HVWEURRN DQG -DUDEDN f 5DEELW &/ &\WRVRO :LQWHUJDOHQ HW DO f %RYLQH SODFHQWD &\WRVRO .DQNRIHU DQG :LHUFLQVNL f 3*' NHWRUHGXFWDVH +XPDQ OXQJ &\WRVRO 6X]XNL HW DO Ef /XQJW\SH %RYLQH OXQJ &\WRVRO :DWDQDEH HW DO f /LYHUW\SH %RYLQH OLYHU &\WRVRO 6X]XNL HW DO Df 3*+ HQGRSHUR[LGH UHGXFWDVH %RYLQH OXQJ &\WRVRO :DWDQDEH HW DO f 6KHHS VHPLQDO YHVLFOH 0LFURVRPHV %XUJHVV DQG 5HGG\ f 7U\SDQRVRPD EUXFHL &\WRVRO .XEDWD HW DO f 3*)6 %RYLQH HQGRPHWULXP 0DGRUH HW DO f $IWHU :DWDQDEH HW DO f ZLWK PRGLILFDWLRQV

PAGE 44

5HJXODWLRQ RI 3*)6 LQ HQGRPHWULDO FHOOV LQ YLWUR LV GHSHQGHQW RQ WKH VWHURLG SUHVHQW DQG WKH FHOO W\SH ,Q VWURPDO FHOOV QHLWKHU HVWURJHQ QRU SURJHVWHURQH KDG DQ\ HIIHFW RQ 3*)6 P51$ OHYHOV ;LDR HW DO f +RZHYHU WKH SUHVHQFH RI ERWK VWHURLGV XSUHJXODWHG 3*)6 P51$ FRPSDUHG WR SURJHVWHURQH DORQH )XUWKHUPRUH UEO)1U DORQH RU LQ WKH SUHVHQFH RI ERWK VWHURLGV GHFUHDVHG 3*)6 P51$ H[SUHVVLRQ ;LDR HW D f 7KH GHFUHDVHG H[SUHVVLRQ RI 3*)6 P51$ LQ ERWK WKH HSLWKHOLDO DQG VWURPDO FHOOV E\ UE,)1[ FRXOG EH WKH FDXVH RI WKH REVHUYHG LQFUHDVH LQ WKH 3*(3*)f UDWLR 0DGRUH HW DO f UHSRUWHG H[SUHVVLRQ LQ WKH ERYLQH HQGRPHWULXP RI DQ DOGRNHWRUHGXFWDVH ZLWK D+6' DFWLYLW\ NQRZQ DV $.5% 7KH $.5% KDV b KRPRORJ\ ZLWK 3*)6 RI WKH $.5 IDPLO\ 8QOLNH WKH RWKHU 3*)6 WKH P51$ IRU $.5% ZDV H[SUHVVHG LQ WKH HQGRPHWULXP IURP GD\V WR RI WKH HVWURXV F\FOH DQG LQ HQGRPHWULDO FHOO FXOWXUHV VXJJHVWLQJ WKDW $.5% LV WKH PDLQ LVRIRUP WKDW LV SUHVHQW LQ WKH ERYLQH HQGRPHWULXP 3URVWDJODQGLQ ( 6\QWKDVH 3*(6 ,Q FRZV ,)1W LV WKH HPEU\RQLF VLJQDO WKDW LV UHVSRQVLEOH IRU PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ 3URVWDJODQGLQ ( V\QWKDVH 3*(6f LV D GRZQVWUHDP HQ]\PH WKDW FDWDO\]HV WKH FRQYHUVLRQ RI 3*+ WR 3*( %RYLQH 3*(6 ZDV FORQHG UHFHQWO\ )LOLRQ HW DO f DQG LV D PHPEHU RI D SURWHLQ VXSHUIDPLO\ FRQVLVWLQJ RI PHPEUDQHDVVRFLDWHG SURWHLQV LQYROYHG LQ HLFRVDQRLG DQG JOXWDWKLRQH PHWDEROLVP 03(* IDPLO\f -DNREVVRQ HW DO D 7DEOH f 7KH DFWLYLW\ RI 3*(6 LV GHSHQGHQW RQ JOXWDWKLRQH ZKLFK PD\ DFW DV D FRHQ]\PH 2JLQR HW DO -DNREVVRQ HW DO E 0XUDNDPL HW DO f 7KH ERYLQH 3*(6 F'1$ FRQVLVWV RI D fXQWUDQVODWHG UHJLRQ RI ES DQ RSHQ UHDGLQJ IUDPH RI ES DQG D fXQWUDQVODWHG UHJLRQ RI ES *HQ%DQN DFFHVVLRQ QXPEHU

PAGE 45

$< )LOLRQ HW DO f 7KH FRGLQJ UHJLRQ RI WKH 3*(6 F'1$ HQFRGHV D DPLQR DFLG SURWHLQ 7ZR LVRIRUPV RI 3*(6 KDYH EHHQ UHSRUWHG QXFOHDU PHPEUDQH DVVRFLDWHG 3*(6 P3*(6f DQG F\WRVROLF 3*(6 F3*(6f 7KH P3*(6 ZDV SDUWLDOO\ SXULILHG IURP PLFURVRPDO IUDFWLRQV RI ERYLQH 2JLQR HW DO f DQG RYLQH VHPLQDO YHVLFXODU JODQGV DQG KDV EHHQ VKRZQ WR UHTXLUH JOXWDWKLRQH 0RRQHQ HW DO f 7KH P3*(6 LV JOXWDWKLRQHGHSHQGHQW LQGXFLEOH DQG IXQFWLRQDOO\ OLQNHG WR 3*+6 ,W KDV EHHQ SURSRVHG WR EH D UHJXODWRU RI LQIODPPDWRU\ SURFHVVHV 0XUDNDPL HW DO f 7KH LVRIRUP H[SUHVVHG LQ RYDULDQ IROOLFOHV LV WKH P3*(6 )LOLRQ HW DO f 7KH F3*(6 LV FRQVWLWXWLYHO\ H[SUHVVHG DQG LV IXQFWLRQDOO\ FRXSOHG WR 3*(6 DQG LV WKRXJKW WR EH LQYROYHG LQ WKH V\QWKHVLV RI 3*( QHHGHG WR PDLQWDLQ WLVVXH KRPHRVWDWLF IXQFWLRQV 7DQLRND HW DO f 7DEOH 0HPEUDQH DVVRFLDWHG SURWHLQV LQ HLFRVDQRLGV DQG JOXWDWKLRQH PHWDEROLVP VXSHUIDPLO\ 6XEIDPLO\ 3URWHLQ )XQFWLRQ OLSRR[\JHQDVH DFWLYDWLQJ SURWHLQ 0HGLDWRUV LQ LQIODPPDWLRQ /HXNRWULHQH V\QWKDVH 0HGLDWRUV LQ DLUZD\ REVWUXFWLRQ 0LFURVRPDO JOXWDWKLRQH 6WUDQVIHUDVH 3URWHFW DJDLQVW PHWDEROLWHV IURP R[LGDWLYH VWUHVV 0LFURVRPDO JOXWDWKLRQH 6WUDQVIHUDVH ,OO ( FROL 9 FKROHUDH ,9 0LFURVRPDO JOXWDWKLRQH 6WUDQVIHUDVH &DWDO\]HV JOXWDWKLRQH GHSHQGHQW UHGXFWLRQ RI OLSLG K\GURSHUR[LGHV 0LFURVRPDO JOXWDWKLRQH 6WUDQVIHUDVH OLNH ,QYROYHG LQ UHGR[ UHJXODWLRQ $IWHU -DNREVVRQ HW DO Df

PAGE 46

5HJXODWLRQ RI 3URVWDJODQGLQ ( 6\QWKDVH ([SUHVVLRQ RI 3*(6 LQ IROOLFXODU FHOOV LV QRW FRQVWLWXWLYH EXW LV LQGXFHG E\ JRQDGRWURSLQV SULRU WR IROOLFXODU UXSWXUH DQG LQGXFWLRQ RI 3*(6 SDUDOOHOV WKDW RI 3*+6 )LOLRQ HW DO f 7KH 3*(6 LV DOVR UHJXODWHG E\ SURLQIODPPDWRU\ DJRQLVWV LQFOXGLQJ ,/ > /36 71)D DQG 30$ 7KRUHQ DQG -DNREVVRQ f XVHG D KXPDQ OXQJ FDQFHU DGHQRFDUFLQRPD FHOO OLQH DQG GHPRQVWUDWHG WKDW 3*(6 DFWLYLW\ ZDV VWLPXODWHG E\ ,/ S DQG 71)D EXW LQKLELWHG E\ GH[DPHWKDVRQH &\FOLF $03GHSHQGHQW SURWHLQ NLQDVH LV WKH SULPDU\ VHFRQG PHVVHQJHU LQYROYHG LQ VLJQDO WUDQVGXFWLRQ E\ JRQDGRWURSLQV 5LFKDUGV HW DO f 6HYHUDO DJRQLVWV WKDW HIIHFW WUDQVGXFWLRQ YLD WKLV SDWKZD\ PD\ DOVR EH LQYROYHG LQ UHJXODWLRQ RI 3*(6 JHQH H[SUHVVLRQ ,Q YLWUR VWXGLHV LQYROYLQJ WKH XVH RI ERYLQH HSLWKHOLDO DQG VWURPDO HQGRPHWULDO FHOOV KDYH VKRZQ WKDW 3*(6 H[SUHVVLRQ LV LQFUHDVHG LQ WKH SUHVHQFH RI /36 71)D DQG ,)1W LQ VWURPDO FHOOV DQG ,)1W LQ HSLWKHOLDO FHOOV 3DUHQW HW DO f ,Q VWURPDO FHOOV ,)1W LQGXFHV D UDSLG LQFUHDVH RI 3*(6 DQG 3*+6 P51$ H[SUHVVLRQ ,Q %(1' FHOOV 30$ LQFUHDVHG 3*(6 P51$ 3*+6 P51$ 3*)D DQG 3*( VXJJHVWLQJ WKDW WKHUH LV D FRUUHODWLRQ EHWZHHQ 3*(6 DQG 3*+6 H[SUHVVLRQ DV UHJDUGV WKH V\QWKHVLV RI 3*( 3DUHQW HW DO f %RYLQH /XWHDO 27 7KH UXPLQDQW &/ V\QWKHVL]HV DQG VHFUHWHV 27 EHVLGHV SURGXFLQJ SURJHVWHURQH :DWKHV HW DO ,YHOO DQG 5LFKWHU f 2[\WRFLQ LV DOVR SURGXFHG E\ JUDQXORVD FHOOV RI WKH SUHRYXODWRU\ IROOLFOH 6DOOL HW DO f &RQFHQWUDWLRQV RI OXWHDO 27 DQG YDVRSUHVVLQ LQFUHDVH GXULQJ WKH HDUO\ OXWHDO SKDVH GD\V WR f DUH PD[LPDO GXULQJ WKH PLGOXWHDO SKDVH GD\V WR f DQG GHFOLQH DIWHUZDUGV :DWKHV HW DO $EGHOJDGLU HW DO 3DUNLQVRQ HW DO f +RZHYHU P51$ FRQFHQWUDWLRQV RI 27 UHDFK D SHDN

PAGE 47

PXFK HDUOLHU DW GD\ RI WKH F\FOH ,YHOO HW DO 6DOOL HW DK f 7KH KLJK FRQFHQWUDWLRQV RI 27 DQG QHXURSK\VLQ ZLWKLQ WKH &/ VXJJHVWV WKDW 27 LV V\QWKHVL]HG ORFDOO\ )OLQW DQG 6KHOGULFN f DGPLQLVWHUHG 3*)f SJ LPf WR FRZV GXULQJ WKH OXWHDO SKDVH DQG REVHUYHG UHOHDVH RI OXWHDO 27 ZLWKLQ PLQ WKDW UHDFKHG D PD[LPXP LQ PLQ 6LPLODUO\ QRUHSLQHSKULQH FDXVHV VHFUHWLRQ RI OXWHDO 27 ZKHQ DGPLQLVWHUHG WR KHLIHUV GXULQJ WKH PLG OXWHDO SKDVH 6NDU]\QVNL DQG .RWZLFD f 7KH PHFKDQLVP RI DFWLRQ IRU UHOHDVH RI 27 LV YLD V\PSDWKHWLF DFWLYDWLRQ RI SDGUHQHUJLF UHFHSWRUV RI OXWHDO FHOOV DQG WKURXJK F$03 PHGLDWLRQ 6NDU]\QVNL DQG .RWZLFD f 7KH ERYLQH &/ FRQWDLQV ERWK ODUJH DQG VPDOO OXWHDO VWHURLGRJHQLF FHOOV DQG LW LV WKH IRUPHU WKDW SUHGRPLQDQWO\ SURGXFH 27 )LHOGV DQG )LHOGV f 7KH 27QHXURSK\VLQ, P51$ LQFUHDVHV DIWHU OXWHLQL]DWLRQ DQG UHDFKHV D SHDN E\ GD\ RI WKH F\FOH WKHQ GHFOLQHV WR ORZ FRQFHQWUDWLRQV GXULQJ WKH PLGOXWHDO SKDVH ,YHOO HW DO f 7KH 27 FRQFHQWUDWLRQV LQ WKH &/ DUH PDLQWDLQHG E\ VWLPXODWLRQ RI WKH SRVW WUDQVODWLRQDO 27QHXURSK\VLQ SURFHVV :DWKHV HW DO $EGHOJDGLU HW DO )XFKV :DWKHV DQG 'HQQLQJ.HQGDOO f 3HSWLG\O JO\FLQH DDPLGDWLQJ PRQRR[\JHQDVH LV WKH WHUPLQDO HQ]\PH UHVSRQVLEOH IRU SRVWWUDQVODWLRQDO SURFHVVLQJ RI 27QHXURSK\VLQ $EGHOJDGLU HW DO )XUX\D HW DO f DQG KDV EHHQ UHSRUWHG WR EH KLJKHVW LQ WKH RYDULHV RI UXPLQDQWV GXULQJ WKH PLGOXWHDO SKDVH 6KHOGULFN DQG )OLQW %RJDFNL HW DO f 7KLV FRLQFLGHV ZLWK WKH WLPH RI KLJKHVW OHYHOV RI OXWHDO 27 6NDU]\QVNL HW DO f 3URVWDJODQGLQV DFW RQ WKH &/ WR LQGXFH WKH UHOHDVH RI 27 ZKLFK LV IDFLOLWDWHG E\ WKH KLJK QXPEHU RI 3*)D UHFHSWRUV LQ WKH ODUJH OXWHDO FHOOV 1LVZHQGHU HW DO f ,Q UXPLQDQWV GXULQJ WKH OXWHDO SKDVH 27 DQG SURJHVWHURQH DUH VHFUHWHG FRQFRPLWDQWO\ IURP

PAGE 48

WKH RYDU\ +RZHYHU SURJHVWHURQH VHFUHWLRQ LV LQKLELWHG DQG 27 VHFUHWLRQ VWLPXODWHG E\ H[RJHQRXV 3*) :DOWHUV HW DO f ,W KDV EHHQ SRVWXODWHG WKDW D FHQWUDO 27 SXOVH JHQHUDWRU IXQFWLRQV DV WKH SDFHPDNHU IRU OXWHRO\VLV 0F&UDFNHQ HW DO f 7KH XWHUXV WUDQVGXFHV K\SRWKDODPLF VLJQDOV LQ WKH IRUP RI 27 VHFUHWLRQ LQWR OXWHRO\WLF SXOVHV RI XWHULQH 3*)D *LPSO DQG )DKUHQKRO] f $ SRVLWLYH IHHGEDFN ORRS H[LVWV WKDW DPSOLILHV QHXUDO DQG OXWHDO 27 VLJQDOV 3URVWDJODQGLQ )D KDV EHHQ VKRZQ WR LQGXFH UHOHDVH RI 27 IURP OXWHDO VOLFHV LQ YLWUR $EGHOJDGLU HW DO f /XWHDO FHOOV FRQWDLQ YHVLFOHV ZKLFK FDUU\ 27QHXURSK\VLQ JUDQXOHV 2[\WRFLQ LV VHFUHWHG DV D SURKRUPRQH ,YHOO DQG 5LFKWHU f SDFNDJHG DQG VWRUHG LQ VHFUHWRU\ JUDQXOHV DQG UHOHDVHG DW WKH FHOO VXUIDFH E\ H[RF\WRVLV )LHOGV HW DO f 7KH SURGXFWLRQ RI WKH JUDQXOHV LV UHVWULFWHG WR WKH ODUJH OXWHDO FHOOV *XOGHQDU HW DO f 'XULQJ WKH HVWURXV F\FOH WKH KLJKHVW QXPEHU RI JUDQXOHV RFFXUV DERXW GD\ DQG DUH SURJUHVVLYHO\ GHSOHWHG EHJLQQLQJ DW DERXW GD\ DIWHU HVWUXV )LHOGV HW DO f ,Q SUHJQDQW DQLPDOV KRZHYHU WKH JUDQXOHV DUH PDLQWDLQHG DW KLJK OHYHOV EH\RQG GD\ RI SUHJQDQF\ EXW EHFRPH GHSOHWHG E\ GD\ )LHOGV DQG )LHOGV f ,W LV QRW NQRZQ H[DFWO\ ZK\ WKLV GLIIHUHQFH H[LVWV EHWZHHQ SUHJQDQW DQG F\FOLF FRZV DOWKRXJK LW KDV EHHQ VXJJHVWHG WKDW WKH SUHVHQFH RI WKH HPEU\R PD\ SOD\ D PDMRU UROH 6DOOL HW DO f )URP GD\ DQG RQZDUGV LQ SUHJQDQW FDWWOH D VHFRQG SRSXODWLRQ RI JUDQXOHV HPHUJHV DQG LQFUHDVHV XQWLO PD[LPDO QXPEHUV DUH GHWHFWHG DERXW GD\ DQG GD\ RI SUHJQDQF\ 7KH FRQWHQW RI WKHVH JUDQXOHV LV QRW NQRZQ )LHOGV HW DO f ,Q YLWUR 3*)D WUHDWPHQW KDV EHHQ VKRZQ WR GHSOHWH WKH ODUJH OXWHDO FHOOV RI WKHLU VHFUHWRU\ JUDQXOHV ZLWKLQ K RI WUHDWPHQW LQ F\FOLF +HDWK HW DO f DQG SUHJQDQW FRZV )LHOGV HW DO f &RUWHHO f UHSRUWHG WKDW GHSOHWLRQ RI JUDQXOHV LQ

PAGE 49

VKHHS &/ RFFXUUHG ZLWKLQ PLQ RI WUHDWPHQW ZKHUHDV &KHJLQL DQG 5DR f UHSRUWHG LQ YLWUR GHSOHWLRQ DIWHU K RI WUHDWPHQW LQ WR PR SUHJQDQW FRZV 8VLQJ D PLFURGLDO\VLV V\VWHP LQ WKH &/ 6KDZ DQG %ULWW f VKRZHG WKDW DGPLQLVWUDWLRQ RI D OXWHRO\WLF GRVH RI PJ 3*)D LP OHG WR UHOHDVH RI OXWHDO 27 LQ FRZV WR GD\V RI WKH F\FOH +RZHYHU QR 27 ZDV GHWHFWHG LQ DQLPDOV ZKLFK ZHUH XQGHUJRLQJ VSRQWDQHRXV OXWHRO\VLV ZKLFK VXJJHVWV WKDW OXWHDO 27 PD\ FRQWULEXWH OHVV WR OXWHRO\VLV LQ FRZV WKDQ KDV EHHQ SURSRVHG LQ VKHHS 0F&UDFNHQ HW DO f 6WLPXODWLRQ RI ERYLQH OXWHDO FHOOV ZLWK 3*)D RQ GD\ RI F\FOH ZDV VKRZQ WR SURPRWH SKRVSKRU\ODWLRQ RI D SURWHLQ WKDW LV SKRVSKRU\ODWHG E\ SURWHLQ NLQDVH FDOOHG P\ULVWR\ODWHG DODQLQHULFK & NLQDVH VXEVWUDWH 0$5.6f 6DOOL HW DK f $IWHU SKRVSKRU\ODWLRQ 0$5.6 WUDQVORFDWHV WR WKH SODVPD PHPEUDQH DQG GLVVRFLDWHV DFWLQ FRUWH[ ZKLFK HQKDQFHV H[RF\WRVLV RI 27 FRQWDLQLQJ JUDQXOHV ([RF\WRVLV LQYROYHV WUDQVSRUW RI WKH JUDQXOHV YLD DQ DFWLQ FRPSOH[ WKDW LV XVXDOO\ DVVRFLDWHG ZLWK WKH SODVPD PHPEUDQH 6DOOL HW DK f )XFKV HW DK f REVHUYHG ORZ DPSOLWXGH VSXUWV RI 27 ZKLFK ZHUH LQWHUPLWWHQW GXULQJ SUHJQDQF\ LQ FRZV 7RZDUGV WHUP WKHUH ZDV DQ LQFUHDVH LQ ERWK IUHTXHQF\ DQG DPSOLWXGH DQG GXULQJ ODERU D GUDPDWLF LQFUHDVH ZDV REVHUYHG ,QGLYLGXDO SHDNV RI 27 REVHUYHG LQ WKH XWHURRYDULDQ YHLQ GXULQJ ODWH JHVWDWLRQ FRXOG EH GXH WR 27 IURP WKH &/ DV ZHOO DV WKH SRVWHULRU SLWXLWDU\ )XFKV HW DK f 0DWHUQDO FDUXQFOHV KDYH EHHQ VXJJHVWHG DV DQRWKHU SXWDWLYH VRXUFH RI 27 ,YHOO HW DK )XFKV HW DK f 7KH SUHVHQFH RI 27FRQWDLQLQJ OXWHDO JUDQXOHV IROORZHG E\ WKHLU GHOD\HG UHOHDVH GXULQJ WKH HDUO\ SHULLPSODQWDWLRQ SHULRG VXJJHVWV WKDW OXWHDO 27 PD\ EH LQYROYHG LQ 27GULYHQ SURVWDJODQGLQ V\QWKHVLV 7KH SUHVHQFH RI WKH UHVSHFWLYH 275 LQ WKH

PAGE 50

HQGRPHWULXP LQ WKH SHULLPSODQWDWLRQ SHULRG DV ZHOO DV LQFUHDVHG H[SUHVVLRQ RI HQ]\PHV LQYROYHG LQ SURVWDJODQGLQ V\QWKHVLV ZRXOG LQFUHDVH FKDQFHV RI HPEU\R ORVV ,Q WKLV GLVVHUWDWLRQ WKH HIIHFW RI 3*)AQ RQ UHOHDVH RI OXWHDO 27 RQ UHSUHVHQWDWLYH GD\V GXULQJ HDUO\ GD\ f DQG ODWH GD\ f SHULLPSODQWDWLRQ SHULRG ZLOO EH H[DPLQHG 7KH RWKHU PDMRU REMHFWLYHV ZLOO EH WR GHWHUPLQH WKH FKDQJHV LQ H[SUHVVLRQ RI SURVWDJODQGLQ V\QWKHVLV HQ]\PHV 3*+6 3*(6 DQG 3*)6f DQG 275 WKDW RFFXU GXULQJ OXWHRO\VLV KRZ WKHLU H[SUHVVLRQ LV DIIHFWHG E\ WKH SUHVHQFH RI D FRQFHSWXV DQG ZKHWKHU WKH SURVWDJODQGLQ V\QWKHVLV V\VWHP LV UHHVWDEOLVKHG DIWHU WKH SHULRG RI PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\

PAGE 51

&+$37(5 5(/($6( 2) 2;<72&,1 )520 29$5,$1 9(5686 3,78,7$5< 7,668(6 ,1 5(63216( 72 3*)f ,1 29$5,(&720,=(' $1' 6+$029$5,(&720,=(' &2:6 '85,1* 7+( 3(5,,03/$17$7,21 3(5,2' ,QWURGXFWLRQ 7KH PDMRU VRXUFH RI OXWHDO 27 DUH WKH ODUJH OXWHDO FHOOV WKDW DUH GHULYHG IURP JUDQXORVD FHOOV DIWHU RYXODWLRQ $EGHOJDGLU HW DO 3DUNLQVRQ HW DO f /XWHDO 27 LV PD[LPDO GXULQJ WKH PLGOXWHDO SKDVH ZKHUHDV WKH 27 P51$ LV PD[LPDO RQ GD\ RI WKH F\FOH ,YHOO HW DO f /XWHDO 27 LV VWRUHG LQ VHFUHWRU\ JUDQXOHV 'XULQJ WKH HVWURXV F\FOH H[RF\WRVLV UHVXOWV LQ D GHFOLQH LQ WKH QXPEHU RI VHFUHWRU\ JUDQXOHV EHWZHHQ GD\V WR ZKHUHDV 27 FRQWDLQLQJ VHFUHWRU\ JUDQXOHV LQ SUHJQDQW FRZV DUH PDLQWDLQHG DW D KLJK OHYHO EH\RQG GD\ )LHOGV DQG )LHOGV f ,Q SUHJQDQW DQLPDOV H[RF\WRVLV RI 27FRQWDLQLQJ OXWHDO VHFUHWRU\ JUDQXOHV FRLQFLGHV ZLWK WKH GHFOLQH LQ ,)1U VHFUHWLRQ )LHOGV DQG )LHOGV f 2QH VHFUHWRJRJXH WKDW UHOHDVHV OXWHDO 27 LQ YLWUR $EGHOJDGLU HW DO &KHJLQL DQG 5DR -DUU\ HW DO f DQG LQ YLYR )OLQW DQG 6KHOGULFN )LHOGV HW DO 2UZLJ HW DO f LV 3*)D 1RUHSLQHSKULQH KDV DOVR EHHQ VKRZQ WR VWLPXODWH V\QWKHVLV DQG UHOHDVH RI 27 IURP WKH &/ E\ VWLPXODWLRQ RI SDGUHQHUJLF UHFHSWRUV DV ZHOO DV SRVWWUDQVODWLRQDO PRGLILFDWLRQ RI WKH 27 SUHFXUVRU 6NDU]\QVNL DQG .RWZLFD f 0F&UDFNHQ HW DO f K\SRWKHVL]HG WKDW 27 IURP WKH QHXURK\SRSK\VLV VWLPXODWHV VHFUHWLRQ RI XWHULQH 3*)D 6XEVHTXHQWO\ XWHULQH 3*)FO VWLPXODWHV UHOHDVH RI 27 IURP WKH &/

PAGE 52

$OWKRXJK WKLV VHHPV WR EH WKH VLWXDWLRQ LQ VKHHS WKH FRQWULEXWLRQ RI OXWHDO 27 LQ FDWWOH WR OXWHRO\VLV LV TXHVWLRQDEOH VLQFH GHSOHWLRQ RI OXWHDO 27 E\ b XVLQJ QRUHSLQHSKULQH IDLOHG WR H[WHQG WKH OXWHDO SKDVH LQ F\FOLF FRZV .RWZLFD DQG 6NDU]\QVNL 6NDU]\QVNL DQG .RWZLFD f 6LPLODU UHVXOWV KDYH EHHQ UHSRUWHG LQ VKHHS ZKHUH H[RJHQRXV 3*)D LQGXFHG OXWHRO\VLV LQ K\VWHUHFWRPL]HG HZHV SRVVHVVLQJ OHVV WKDQ b RI PLGOXWHDO 27 VWRUHV DV UDSLGO\ DV IRU LQWDFW DQLPDOV 6KHOGULFN DQG )OLQW Df 0RUHRYHU 6KDZ HW DO f XVLQJ PLFURGLDO\VLV REVHUYHG D UDSLG GHFOLQH LQ OXWHDO 27 VHFUHWLRQ DIWHU GD\ RI WKH F\FOH 7KH DEVHQFH RI DQ\ PHDVXUDEOH 27 LQ WKH &/ GXULQJ OXWHRO\VLV OHG WKH DXWKRUV WR VXJJHVW WKDW WKH FRQWULEXWLRQ RI OXWHDO 27 WR WKH OXWHRO\WLF SURFHVV LQ FRZV PD\ EH PLQLPDO /XWHDO 27 FRQFHQWUDWLRQV GR QRW GLIIHU EHWZHHQ SUHJQDQW DQG F\FOLF FRZV IURP GD\ WR RI WKH F\FOH 3DUNLQVRQ HW DO f ,Q SUHJQDQW DQLPDOV FRQFHQWUDWLRQV GHFUHDVH DIWHU GD\ DQG UHPDLQ DW VLJQLILFDQWO\ ORZHU OHYHOV WKDQ LQ WKH OXWHDO SKDVH RI QRQSUHJQDQW DQLPDOV 3DUNLQVRQ HW DO f 0RVW VWXGLHV RQ OXWHDO 27 KDYH EHHQ FRQGXFWHG LQ FRZV GXULQJ WKH HVWURXV F\FOH 6FDQW LQIRUPDWLRQ KDV EHHQ SXEOLVKHG UHJDUGLQJ OXWHDO 27 GXULQJ WKH SHULLPSODQWDWLRQ SHULRG 7KHUH LV D SRVVLELOLW\ WKDW WKH 27SURVWDQRLG V\VWHP PD\ EH IXQFWLRQDO DIWHU GD\ GXULQJ WKH SHULLPSODQWDWLRQ SHULRG LQ LQVWDQFHV ZKHUH WKH FRQFHSWDV IDLOV WR LQLWLDWH D VWURQJ DQWLOXWHRO\WLF VLJQDO ,W LV LPSRUWDQW WKHUHIRUH WR GHWHUPLQH ZKHWKHU DW WKLV VWDJH WKH &/ LV FDSDEOH RI UHVSRQGLQJ WR 3*)DE\ UHOHDVH RI 27 IURP WKH JUDQXOHV WKDW VWLOO UHPDLQ LQ WKH &/ 7KLV FRXOG EH RQH RI WKH PHFKDQLVPV WKDW OHDG WR OXWHRO\VLV DQG FRQVHTXHQWO\ HPEU\R ORVV GXULQJ WKH SHULLPSODQWDWLRQ SHULRG 7KH REMHFWLYHV RI WKLV VWXG\ ZHUH WR GHWHUPLQH WKH VRXUFH RI 27 WKDW VHUYHV WR GULYH WKH 275SURVWDQRLG V\VWHP RI WKH HQGRPHWULXP DQG FRQFHSWDV GXULQJ WKH SHUL

PAGE 53

LPSODQWDWLRQ SHULRG ,W LV K\SRWKHVL]HG WKDW 27FRQWDLQLQJ VHFUHWRU\ JUDQXOHV LQ WKH &/ RI SUHJQDQW DQLPDOV EHWZHHQ GD\V DQG UHOHDVH WKHLU FRQWHQWV LQ UHVSRQVH WR VXEOXWHRO\WLF GRVHV RI 3*)D $OWHUQDWLYHO\ WKH VRXUFH RI 27 DW WKLV WLPH PD\ EH WKH SRVWHULRU SLWXLWDU\ 7KH VSHFLILF REMHFWLYHV ZHUH WR WHVW ZKHWKHU 3*) LQFUHDVHV FLUFXODWLQJ 27 GXULQJ WKH SHULLPSODQWDWLRQ SHULRG DQG ZKHWKHU WKH VRXUFH RI 27 LV OXWHDO RU RI SLWXLWDU\ RULJLQ $QRWKHU JRDO ZDV WR GHWHUPLQH ZKHWKHU WKHUH ZDV D GLIIHUHQFH LQ 27 UHVSRQVH EHWZHHQ WKH HDUO\ GD\ f DQG ODWH GD\ f SHULLPSODQWDWLRQ SHULRG WR 3*)D 0DWHULDOV DQG 0HWKRGV %UDKPDQ$QJXV FURVVEUHG FRZV DW GD\ RI SUHJQDQF\ ZHUH GLYLGHG LQWR WZR JURXSV 2QH JURXS ZDV ELODWHUDOO\ RYDULHFWRPL]HG 29; Q f DQG WKH RWKHU VKDP RYDULHFWRPL]HG 6KDP29; Q 7DEOH f 2YDULHFWRP\ ZDV FRQGXFWHG DV GHVFULEHG E\ 'URVW HW DO f %ULHIO\ DQLPDOV ZHUH UHVWUDLQHG LQ D FKXWH 7KH SHULQHDO UHJLRQ DQG YXOYD ZHUH ZDVKHG DQG GLVLQIHFWHG 7KH VWDWXV RI WKH RYDULHV DQG XWHUXV ZHUH GHWHUPLQHG E\ UHFWDO H[DPLQDWLRQ $QLPDOV ZHUH JLYHQ HSLGXUDO DQHVWKHVLD XVLQJ PO b /LGRFDLQH +& $ YDJLQRVFRSH ZDV XVHG WR FRQILUP WKH DEVHQFH RI LQIHFWLRQV DQG D VWDE LQFLVLRQ ZDV PDGH DQG HQODUJHG LQ WKH IRUQL[ WR JDLQ DFFHVV WR WKH RYDULHV $Q HFUDVHXU ZDV WKHQ XVHG WR UHPRYH WKH RYDULHV $OO WKH DQLPDOV LQ WKH VKDPRYDULHFWRPL]HG JURXS XQGHUZHQW WKH VDPH SURFHGXUHV DV WKRVH RYDULHFWRPL]HG LQFOXGLQJ WKH VWDE LQFLVLRQ DQG PDQLSXODWLRQ RI WKH RYDULHV &RZV ZHUH WKHQ LQMHFWHG LYf DW K LQWHUYDOV ZLWK WZR SJ VXEOXWHRO\WLF GRVHV RI 3*)D /XWDO\VH p 3KDUPDFLD t 8SMRKQ .DODPD]RR 0,f RU VDOLQH 3HULRGV DQG )LJ f 2QH KRXU DIWHU WKH VHFRQG LQMHFWLRQ 3HULRG f WKH FRZV UHFHLYHG D OXWHRO\WLF GRVH RI 3*)D PJf LYf RU VDOLQH

PAGE 54

$Q DGGLWLRQDO JURXS RI QLQH GD\ SUHJQDQW FRZV ZHUH VKDPRYDULHFWRPL]HG DQG GLYLGHG LQWR WZR JURXSV WR UHFHLYH HLWKHU 3*) Q f RU VDOLQH Q f %ORRG VDPSOHV ZHUH FROOHFWHG IURP WKH MXJXODU YHLQ HYHU\ PLQ VWDUWLQJ PLQ EHIRUH RYDULHFWRP\ RU VKDPRYDULHFWRP\ XQWLO WKH ILUVW 3*)D VDOLQH LQMHFWLRQ HYHU\ PLQ IRU WKH ILUVW PLQ IROORZLQJ HDFK 3*)D VDOLQH LQMHFWLRQ DQG WKHQ HYHU\ PLQ XQWLO PLQ IROORZLQJ HDFK LQMHFWLRQ )LJ f %ORRG VDPSOHV ZHUH NHSW RQ LFH WUDQVSRUWHG WR WKH ODERUDWRU\ DQG SODVPD KDUYHVWHG DQG VWRUHG DW r& XQWLO DVVD\HG IRU 27 7DEOH ([SHULPHQWDO GHVLJQ IRU LQ YLYR VWXG\ WR DVFHUWDLQ UHVSRQVH RI 3*)D RU VDOLQH RQ OXWHDO 27 UHOHDVH LQ SHULLPSODQWDWLRQ FRZV 'D\ RI 3UHJQDQF\ 'D\ 'D\ 7UHDWPHQWV 3*)D 6DOLQH 3*)D 6DOLQH 6KDP2YDULHFWRPL]HG Q Q Q Q 2YDULHFWRPL]HG Q )LJ ([SHULPHQWDO SURWRFRO IRU UHVSRQVH RI 3*)D RU VDOLQH RQ OXWHDO 27 UHOHDVH LQ SHULLPSODQWDWLRQ FRZV &URVVEDUV UHSUHVHQW WLPHV DW ZKLFK EORRG VDPSOHV ZHUH WDNHQ 29; 3*)& SJfVDOLQH 3*) SJfVDOLQH 3*) PJfVDOLQH 6KDP29; L L O O 3HULRG 3HULRG 3HULRG 7LPH PLQf

PAGE 55

2[\WRFLQ 5DGLRLPPXQRDVVD\ ([WUDFWLRQ RI 3ODVPD 6DPSOHV 7KH PHWKRG XVHG IRU 27 H[WUDFWLRQ IURP SODVPD VDPSOHV ZDV DGDSWHG IURP :DWKHV HW DO f ZLWK PRGLILFDWLRQV (DFK 6(33$. &O FDUWULGJH :DWHUV $VVRFLDWHV 0LOIRUG 0$ 86$f ZDV SUHZHWWHG ZLWK PO RI b WULIOXRURDFHWLF DFLG LQ b DFHWRQLWULOH 7KH FROXPQV ZHUH WKHQ HOXWHG ZLWK PO GHLRQL]HGGLVWLOOHG ZDWHU 3ODVPD VDPSOHV POf ZHUH GLOXWHG f ZLWK SKRVSKDWH EXIIHU 0 S+ f )ROORZLQJ DSSOLFDWLRQ RI WKH SODVPD PO b WULIOXRURDFHWLF DFLG ZDV DGGHG DQG WKH H[WUDFW HOXWHG ZLWK PO RI b WULIOXRURDFHWLF DFLG LQ b DFHWRQLWULOH LQWR [ PP WXEHV (OXWLRQ VROYHQW ZDV GULHG XQGHU DQ DLU VWUHDP DSSDUDWXV LQ D ZDWHU EDWK VHW DW r& DQG H[WUDFW UHGLVVROYHG LQ PO DVVD\ EXIIHU 0 SKRVSKDWH EXIIHU S+ ZLWK 0 ('7$ 0 1D&O DQG b %6$f (DFK H[WUDFWLRQ EDWFK LQFOXGHG WKH IROORZLQJ FRQWUROV f 3KRVSKDWH EXIIHU POf f PO ERYLQH SODVPD PO SKRVSKDWH EXIIHU f PO ERYLQH SODVPD VSLNHG ZLWK ORZ DPRXQW POf RI 27 SJf LQ PO SKRVSKDWH EXIIHU f PO ERYLQH SODVPD VSLNHG ZLWK KLJK DPRXQW POf RI 27 SJf LQ PO SKRVSKDWH EXIIHU 7KH PHDQ H[WUDFWLRQ HIILFLHQF\ ZDV s b $VVD\ SURFHGXUH 'XSOLFDWHV IURP HDFK H[WUDFWHG VDPSOH SLf DQG WULSOLFDWHV RI 27 VWDQGDUGV SJ SJ SLf ZHUH XVHG IRU WKH DVVD\ 7KH 27 DQWLERG\ ZDV IURP UDEELW

PAGE 56

DQG ZDV NLQGO\ GRQDWHG E\ 'U 'LHWHU 6FKDPV 7HFKQLFDO 8QLYHUVLW\ RI 0XQLFK )UHLVLQJ *HUPDQ\ 7KH ZRUNLQJ GLOXWLRQ RI WKH DQWLERG\ ZDV $VVD\ EXIIHU ZDV DGGHG WR JODVV DVVD\ WXEHV [ PPf IROORZHG E\ MM H[WUDFW 7KH WXEHV ZHUH NHSW RQ LFH WKURXJKRXW WKH SURFHGXUH 7KH DQWLVHUXP SLf ZDV DGGHG WR DOO SODVPD H[WUDFWV PL[HG WKRURXJKO\ DQG LQFXEDWHG DW r& IRU K 7KH WUDFHU >O,27@ &DW 1(; S&L VWRFN VROXWLRQf IURP 3HUNLQ(OPHU /LIH 6FLHQFHV %RVWRQ 0$ ZDV DGGHG WR PO DVVD\ EXIIHU DQG DOLTXRWHG LQWR SL LQ PO FHQWULIXJH WXEHV DQG VWRUHG DW r& $SSUR[LPDWHO\ FSP SL >O,27@ ZDV DGGHG WR DOO WXEHV DQG LQFXEDWLRQ FRQWLQXHG DW r& IRU DQRWKHU K 3DQVRUELQ FHOO VXVSHQVLRQ SLf &DOELRFKHP 6DQ 'LHJR &$f ZDV SUHSDUHG E\ DGGLQJ SL SKRVSKDWH EXIIHU YRUWH[HG DQG FHQWULIXJHG DW [ J IRU PLQ 7KH VXSHUQDWDQW ZDV DVSLUDWHG DQG GLVFDUGHG DQG WKH SHOOHW UHVXVSHQGHG LQ SKRVSKDWH EXIIHU :DVKLQJ ZDV UHSHDWHG DV DERYH DQG WKH ILQDO SHOOHW UHVXVSHQGHG LQ PO SKRVSKDWH EXIIHU 7R VHSDUDWH WKH ERXQG DQG IUHH 27 ZLWKLQ WKH DVVD\ SL SURWHLQ FHOO VXVSHQVLRQ ZDV DGGHG WR HDFK DVVD\ WXEH H[FHSW WKH WRWDO FRXQW WXEHVf PL[HG ZHOO DQG LQFXEDWHG DW r& IRU K )ROORZLQJ LQFXEDWLRQ WXEHV ZHUH FHQWULIXJHG DW [ J XVLQJ D 6RUYDOO 5& % FHQWULIXJH ZLWK DQ +6 URWRU 'X 3RQW ,QVWUXPHQWV 1HZWRZQ &7f WKH VXSHUQDWDQW GLVFDUGHG DQG WKH WXEHV ZLWK SHOOHWV LH ERXQG 27f FRXQWHG LQ D JDPPD FRXQWHU 7KH FRQFHQWUDWLRQV RI 27 ZHUH H[SUHVVHG DV SJPO 7KH VHQVLWLYLW\ RI WKH DVVD\ ZDV SJPO 7KH LQWHU DQG LQWUD DVVD\ FRHIILFLHQWV RI YDULDWLRQ ZHUH DQG b

PAGE 57

6WDWLVWLFDO $QDO\VLV 'DWD ZHUH DQDO\]HG XVLQJ WKH 6WDWLVWLFDO $QDO\VLV 6\VWHP 6$6f VRIWZDUH YHUVLRQ 6$6 ,QVWLWXWH &DU\ 1&f 2[\WRFLQ FRQFHQWUDWLRQV ZHUH DQDO\]HG E\ OHDVW VTXDUHV DQDO\VLV RI YDULDQFH XVLQJ WKH 0L[HG 0RGHO V\VWHP RI 6$6 352& 0,;('f IRU UHSHDWHG PHDVXUHV DQDO\VLV 7KH PDWKHPDWLFDO PRGHO LQFOXGHG WKH LQGHSHQGHQW HIIHFWV RI WUHDWPHQW WLPH SHULRG WUHDWPHQW [ WLPH WUHDWPHQW [ SHULRG SHULRG [ WLPH DQG WUHDWPHQW [ SHULRG [ WLPH &RZ ZDV FRQVLGHUHG DV D UDQGRP YDULDEOH QHVWHG ZLWKLQ WUHDWPHQW $ VHULHV RI RUWKRJRQDO FRQWUDVWV ZHUH FRQGXFWHG WR H[DPLQH GLIIHUHQFHV EHWZHHQ WUHDWPHQWV VHH $SSHQGL[ $f 7 GD\ 3*)R6KDPRYDULHFWRPL]HG 7GD\ 6DOLQH6KDP RYDULHFWRPL]HG 7GD\ 3*)R6KDPRYDULHFWRPL]HG 7GD\ 6DOLQH6KDP RYDULHFWRPL]HG 7GD\ 3*)DRYDULHFWRPL]HGf DQG 3HULRGV 3HULRG IURP WR PLQ 3HULRG IURP WR PLQ DQG 3HULRG IURP WR PLQ 7LPH ZLWKLQ HDFK SHULRG ZDV IURP WR PLQ )LJ f 'DWD DUH SUHVHQWHG DV OHDVW VTXDUHV PHDQV s 6(0 7KH FRYDULDQFH VWUXFWXUH XVHG ZDV DXWRUHJUHVVLYH RI RUGHU /LWWHOO HW DO f 5HVXOWV (IIHFW RI 3*) RQ 27 UHVSRQVH LQ VKDPRYDULHFWRPL]HG DQG RYDULHFWRPL]HG GD\ SUHJQDQW FRZV LV VKRZQ LQ )LJ 7KHUH ZDV QR PDMRU LQFUHDVH LQ SODVPD 27 IURP WKH WLPH RI RYDULHFWRP\ WR WKH WLPH RI ILUVW LQMHFWLRQ RI 3*)D ,Q WZR RI WKH IRXU RYDULHFWRPL]HG FRZV SODVPD 27 LQFUHDVHG PLQ IROORZLQJ WKH ILUVW LQMHFWLRQ RI 3*)D 1R DGGLWLRQDO LQFUHDVH LQ 27 ZDV REVHUYHG IROORZLQJ WKH VHFRQG DQG WKLUG LQMHFWLRQ RI 3*)& )LJ f 2YDULDQ LQWDFW FRZV VKRZHG QR UHVSRQVH WR WKH ILUVW WZR LQMHFWLRQV RI 3*)f SUREDEO\ EHFDXVH WKH FRQFHQWUDWLRQ RI 3*)f XVHG ZDV WRR ORZ 7KH WKLUG LQMHFWLRQ RI3*)f PJf UHVXOWHG LQ D VLJQLILFDQW LQFUHDVH LQ SODVPD 27 LQ DOO FRZV

PAGE 58

'D\ 3UHJQDQF\ f§ff§ 6KDP29; 3*) Q f f§R 29; 3*) Q f )LJ /HDVW VTXDUHV PHDQV s 6(0f SODVPD FRQFHQWUDWLRQV RI R[\WRFLQ LQ RYDULHFWRPL]HG DQG VKDPRYDULHFWRPL]HG 3*)DWUHDWHG FRZV GD\ SUHJQDQW $UURZV LQGLFDWH WLPH DQG PLQf DW ZKLFK 3*)R LQMHFWLRQ ZDV JLYHQ LYf 7KH UHVSRQVH WR 3*)f RU VDOLQH LQ VKDPRYDULHFWRPL]HG FRZV RQ GD\ RI SUHJQDQF\ LV VKRZQ LQ )LJ 1R GLIIHUHQFH ZDV REVHUYHG LQ 27 UHVSRQVH WR 3*)D RU VDOLQH DIWHU WKH ILUVW DQG VHFRQG LQMHFWLRQV 3 f +RZHYHU LQ VDOLQHWUHDWHG FRZV WKHUH ZDV D QXPHULFDO LQFUHDVH DIWHU WKH VHFRQG LQMHFWLRQ 6XEVHTXHQWO\ SODVPD 27 GHFOLQHG WR FRQFHQWUDWLRQV REVHUYHG SULRU WR WUHDWPHQW ,Q FRZV WUHDWHG ZLWK 3*)R WKHUH ZDV D VLJQLILFDQW LQFUHDVH LQ SODVPD 27 PLQ DIWHU WKH WKLUG LQMHFWLRQ PJf 7KHUH ZDV QR WUHDWPHQW E\ WLPH LQWHUDFWLRQ LQ DQ\ RI WKH WLPH SHULRGV

PAGE 59

'D\ 3UHJQDQF\ 6KDP29; 3*) Q f 6KDP29; 6DOLQH Q f )LJ /HDVW VTXDUHV PHDQV s 6(0f SODVPD FRQFHQWUDWLRQV RI R[\WRFLQ LQ VKDP RYDULHFWRPL]HG 3*) DQG VDOLQHWUHDWHG FRZV GD\ SUHJQDQW $UURZV LQGLFDWH WLPH DQG PLQf DW ZKLFK 3*) RU VDOLQH ZDV LQMHFWHG LYf 3ODVPD FRQFHQWUDWLRQV RI 27 LQ VKDPRYDULHFWRPL]HG GD\ SUHJQDQW FRZV IROORZLQJ 3*) RU VDOLQH WUHDWPHQW DUH VKRZQ LQ )LJ /LWWOH YDULDWLRQ ZDV REVHUYHG LQ SODVPD 27 IROORZLQJ WKH ILUVW DQG VHFRQG LQMHFWLRQV RI HLWKHU 3*)D RU VDOLQH +RZHYHU D WHPSRUDO DFXWH UHVSRQVH RI 27 WR 3*) RU VDOLQH ZDV REVHUYHG DIWHU WKH WKLUG LQMHFWLRQ 7KLV ZDV QRW D VXVWDLQHG LQFUHDVH DV REVHUYHG LQ VKDPRYDULHFWRPL]HG DQLPDOV UHVSRQVH WR 3*)D DW GD\ RI SUHJQDQF\ )LJ f7KLV LQGLFDWHV WKDW LQ GD\ SUHJQDQW FRZV QHLWKHU 3*)D QRU VDOLQH KDG DQ\ DSSUHFLDEOH HIIHFW LQ LQFUHDVLQJ SODVPD 27 FRQFHQWUDWLRQV

PAGE 60

'D\ 3UHJQDQF\ )LJ /HDVW VTXDUHV PHDQV s 6(0f SODVPD FRQFHQWUDWLRQV RI R[\WRFLQ LQ VKDP RYDULHFWRPL]HG 3*)LD DQG VDOLQHWUHDWHG FRZV GD\ SUHJQDQW $UURZV LQGLFDWH WLPH DQG PLQf DW ZKLFK HLWKHU 3*)D RU VDOLQH ZDV LQMHFWHG LYf 7KH 27 UHVSRQVH WR 3*)D YHUVXV VDOLQH ZDV GLIIHUHQW RQ GD\ YHUVXV GD\ RI SUHJQDQF\ 2UWKRJRQDO FRQWUDVWV VKRZHG D WUHDWPHQW E\ GD\ RI SUHJQDQF\ E\ SHULRG RI LQWHUDFWLRQ )LJ $f 2Q GD\ RI SUHJQDQF\ WKHUH ZDV D VLJQLILFDQW 3 f WUHDWPHQW E\ SHULRG LQWHUDFWLRQ LQGLFDWLYH RI DQ LQFUHDVH LQ SODVPD 27 LQ SHULRG LQ 3*)D WUHDWHG FRZV ZKHUHDV IRU VDOLQH WUHDWHG FRZV WKHUH ZDV QR LQFUHDVH LQ SODVPD 27 +RZHYHU RQ GD\ FRZV WKHUH ZDV QR VXEVWDQWLDO LQFUHDVH LQ SODVPD 27 LQ HLWKHU 3*) RU VDOLQH WUHDWHG FRZV IRU DQ\ RI WKH SHULRGV )LJ %f

PAGE 61

3HULRG )LJ 7UHDWPHQW E\ GD\ RI SUHJQDQF\ E\ SHULRG LQWHUDFWLRQ IRU R[\WRFLQ LQ VKDP RYDULHFWRPL]HG FRZV UHFHLYLQJ HLWKHU 3*)D RU VDOLQH RQ GD\ RU RI SUHJQDQF\ 3 f 'DWD UHSUHVHQW OHDVW VTXDUHV PHDQV s 6(0

PAGE 62

'LVFXVVLRQ $GPLQLVWUDWLRQ RI VXEOXWHRO\WLF GRVHV RI SJ 3*)DLYf IDLOHG WR FDXVH D VLJQLILFDQW LQFUHDVH LQ 27 VHFUHWLRQ LQ GD\ RYDULHFWRPL]HG RU RYDULDQLQWDFW SUHJQDQW FRZV +RZHYHU D OXWHRO\WLF GRVH RI PJ LYf GLG LQFUHDVH SODVPD 27 FRQFHQWUDWLRQV LQ RYDULDQLQWDFW FRZV 7KLV VXJJHVWV WKDW PRVW RI WKH LQFUHDVH LQ SODVPD 27 FRQFHQWUDWLRQV PHDVXUHG LQ RYDULDQLQWDFW FRZV DW GD\ RI SUHJQDQF\ ZDV VHFUHWHG IURP WKH &/ LQ UHVSRQVH WR 3*)Q ,QWDFW FRZV DW GD\ RU RI SUHJQDQF\ IDLOHG WR UHVSRQG WR VXEOXWHRO\WLF 3*)D GRVHV RI SJ 7KH IDLOXUH RI DQ 27 UHVSRQVH WR WKH VXE OXWHRO\WLF GRVH RI 3*)D LV OLNHO\ D UHVXOW RI DQ LQDGHTXDWH GRVH RI 3*)D 7KLV LV LQ FRQWUDVW WR WKH KLJKHU GRVH RI PJ RI 3*) WKDW ZDV DGPLQLVWHUHG LQ WKH WKLUG SHULRG RI GD\ SUHJQDQW FRZV 7KH LQFUHDVH LQ SODVPD 27 FRQFHQWUDWLRQV DW GD\ LQ SUHJQDQW FRZV ZDV REVHUYHG ZLWKLQ PLQ DIWHU LQMHFWLRQ RI PJ RI 3*)D UHDFKHG D SHDN ZLWKLQ PLQ DQG GHFOLQHG WKHUHDIWHU 7KHVH UHVXOWV DUH VLPLODU WR WKRVH UHSRUWHG LQ F\FOLF EHHI KHLIHUV E\ 6DOOL HW DO f ZKHUH WKHUH ZDV DQ LQFUHDVH LQ SODVPD 27 FRQFHQWUDWLRQV ZLWKLQ PLQ RI WUHDWPHQW ZLWK 3*)D ZKLFK UHPDLQHG HOHYDWHG IRU PLQ DQG WKHQ GHFOLQHG WR EDVDO FRQFHQWUDWLRQV E\ PLQ )LHOGV HW DO f UHSRUWHG WKDW RQO\ b RI ODUJH OXWHDO FHOOV KDG VHFUHWRU\ JUDQXOHV DW PLQ DIWHU DGPLQLVWUDWLRQ RI PJ 3*)D LQ SUHJQDQW FRZV RQH WR WZR ZHHNV SULRU WR SDUWXULWLRQ 6DOOL HW DO f UHSRUWHG WKDW WKH PHFKDQLVP E\ ZKLFK 3*)D LQGXFHV UHOHDVH RI 27 IURP 27 FRQWDLQLQJ JUDQXOHV LQ WKH &/ LV D 3.& PHGLDWHG HYHQW WKDW DFWLYDWHV 0$5.6 SURWHLQ ZKLFK WUDQVORFDWHV WKH 27 JUDQXOHV WR WKH PHPEUDQH DQG GLVUXSWV WKH DFWLQ FRPSOH[ LQ WKH VHFUHWRU\ SURFHVV 7KH\ GHWHUPLQHG WKH ORFDWLRQ RI 0$5.6 SURWHLQ LQ F\WRVROLF DQG PHPEUDQH IUDFWLRQV RI

PAGE 63

VHFWLRQV IURP &/ RI GD\ SUHJQDQW FRZV WKDW KDG EHHQ WUHDWHG ZLWK 3*)R 7UDQVORFDWLRQ RI 0$5.6 FDXVHV PRYHPHQW RI VHFUHWRU\ JUDQXOHV WR WKH PHPEUDQH ZKHUH WKH\ UHOHDVH 27 $ GRVH GHSHQGHQW HIIHFW RI 3*)D WR SJf RQ 27 VHFUHWLRQ ZDV UHSRUWHG E\ 6NDU]\QVNL HW DO f ZKR VKRZHG WKDW &/ VHQVLWLYLW\ WR 3*)MX LQFUHDVHG LQ WKH ODWH OXWHDO SKDVH 7R HYRNH D VLPLODU 27 UHVSRQVH RQ GD\V DQG RI WKH F\FOH 3*)D RQ GD\ FRXOG EH UHGXFHG IROG 7KH ODFN RI UHVSRQVH ZLWK SJ 3*)F LQ WKH SUHVHQW H[SHULPHQW LQGLFDWHV WKH FRQFHQWUDWLRQ ZDV WRR ORZ WR HIIHFW D FKDQJH LQ SODVPD 27 FRQFHQWUDWLRQ 6NDU]\QVNL HW DO f IDLOHG WR DFKLHYH OXWHDO UHJUHVVLRQ XVLQJ SJ 3*)R DOWKRXJK WKH SODVPD 27 FRQFHQWUDWLRQ LQFUHDVH ZDV FRPSDUDEOH WR WKDW REVHUYHG GXULQJ VSRQWDQHRXV OXWHRO\VLV SJPOf $ SJ GRVH RI 3*)RW UHOHDVHG SJPO ZKHUHDV SJ KDG QR HIIHFW RQ OXWHDO 27 UHOHDVH :H XVHG SJ LQ WKLV H[SHULPHQW QRW NQRZLQJ WKH UHVXOWV E\ 6NDU]\QVNL HW DO f 2UZLJ HW DO f LQYHVWLJDWHG WKH HIIHFW RI SJ 3*)D RQ 27 UHOHDVH IURP WKH &/ RI GD\ F\FOLF EHHI FRZV DQG DFWLYDWLRQ RI 3.& 3HDN SODVPD FRQFHQWUDWLRQV RI 27 RFFXUUHG WR PLQ DIWHU LQMHFWLRQ RI 3*)D KL DGGLWLRQ WKHUH ZDV D KLJK FRUUHODWLRQ U f EHWZHHQ PHPEUDQH 3.& DQG 27 UHOHDVH VXJJHVWLQJ D UROH IRU 3.& LQ 27 UHOHDVH IURP OXWHDO FHOOV ,Q WKHLU VWXG\ WKH &/ ZDV UHPRYHG DW GLIIHUHQW WLPHV DIWHU 3*)D LQMHFWLRQ $ VPDOOHU SHDN LQ 27 ZDV REVHUYHG LQ DQLPDOV LQ ZKLFK WKH &/ ZDV UHPRYHG DW PLQ UHODWLYH WR WKH 3*)f LQMHFWLRQ WKDQ LQ WKRVH DQLPDOV LQ ZKLFK LW ZDV UHPRYHG ODWHU VXJJHVWLQJ WKDW PRVW RI WKH 27 ZDV RI OXWHDO RULJLQ ,Q WKH SUHVHQW VWXG\ DQ LQFUHDVH LQ SODVPD 27 FRQFHQWUDWLRQV RFFXUUHG LQ RYDULHFWRPL]HG 3*)DWUHDWHG DQLPDOV DW WR PLQ DIWHU WKH ILUVW 3*)D LQMHFWLRQ 7KH

PAGE 64

FDXVH RI WKLV VLQJOH HOHYDWLRQ LQ SODVPD 27 FRQFHQWUDWLRQ LV QRW FOHDU 2QH SRVVLEOH VRXUFH RI SODVPD 27 LV WKH QHXURK\SRSKVLV 0F&UDFNHQ HW DO f +RZHYHU 6FKDPV HW DO f UHSRUWHG WKDW LWV FRQWULEXWLRQ LV PLQLPDO 7KH VDPSOLQJ LQ WKH SUHVHQW VWXG\ ZDV LQ WKH MXJXODU YHLQ ZKLFK ZRXOG EH DQ LQGLFDWLRQ RI SRVVLEOH VHFUHWLRQ IURP WKH KHDG RU QHXURK\SRSK\VLV 3URVWDJODQGLQV KDYH EHHQ VKRZQ WR VWLPXODWH UHOHDVH RI VHYHUDO KRUPRQHV IURP ERWK WKH SRVWHULRU R[\WRFLQf DQG DQWHULRU SLWXLWDU\ JODQG SURODFWLQ DGUHQRFRUWLFRWURSKLF JURZWK DQG OXWHLQL]LQJ KRUPRQHf +D\QHV HW DO 5HQHJDU HW DO &ROOLHU HW DO f 7KH UHOHDVH RI SLWXLWDU\ KRUPRQHV PRGXODWHG E\ H[RJHQRXV 3*)f LV HLWKHU GLUHFW RU YLD WKH K\SRWKDODPXV +HGJH 2MHGD HW DO f 8QH[SHFWHGO\ ZH REVHUYHG LQFUHDVHG 27 UHOHDVH LQ VKDPRYDULHFWRPL]HG FRZV WUHDWHG ZLWK VDOLQH ,W KDV EHHQ VXJJHVWHG WKDW 27 FDQ EH UHOHDVHG DV UHVXOW RI PDQXDO PDQLSXODWLRQ RI WKH RYDU\ RU WKH XWHUXV :LOOLDPV HW DO f 1R LQFUHDVH LQ SODVPD 27 ZDV REVHUYHG LPPHGLDWHO\ IROORZLQJ RYDULHFWRP\ $OO DQLPDOV LQ WKH JURXS WKDW ZDV VKDPRYDULHFWRPL]HG XQGHUZHQW WKH VDPH SURFHGXUHV DV WKRVH RYDULHFWRPL]HG LQFOXGLQJ LQFLVLRQ DQG PDQLSXODWLRQ RI WKH RYDULHV ,W KDV EHHQ VKRZQ WKDW QRUHSLQHSKULQH DOVR LQGXFHV UHOHDVH RI 27 IURP WKH &/ DQG LV LQYROYHG LQ SRVWWUDQVODWLRQDO SURFHVVLQJ RI 27 2[\WRFLQ PD\ DOVR DXWRUHJXODWH LWV RZQ FRQFHQWUDWLRQ LQ WKH &/ DOWKRXJK WKH PHFKDQLVP LV QRW FOHDU %RJDFNL DQG .RWZLFD f 1RUHSLQHSKULQH DIIHFWV OXWHDO V\QWKHVLV RI 27 E\ VWLPXODWLQJ DGUHQHUJLF UHFHSWRUV 6LPLODU HIIHFWV DV WKRVH GXH WR QRUHSLQHSKULQH PD\ KDYH RFFXUUHG LQ WKLV VWXG\ EURXJKW DERXW E\ WKH VWUHVV DQLPDOV H[SHULHQFHG GXULQJ WKH H[SHULPHQW .RWZLFD HW DO f 7KLV FRXOG OHDG WR VHFUHWLRQ RI QRUHSLQHSKULQH LQWR FLUFXODWLRQ UHVXOWLQJ LQ UHOHDVH

PAGE 65

RI OXWHDO 27 7KLV PD\ EH WKH FDVH LQ WKRVH LQVWDQFHV ZKHUH WKHUH ZDV DQ LQFUHDVH LQ SODVPD 27 IROORZLQJ VDOLQH LQMHFWLRQ +RZHYHU VLQFH QR PDMRU 27 LQFUHDVH ZDV REVHUYHG LQ SHULRGV DQG WKH VXSSRVHG HIIHFW IURP QRUHSLQHSKULQH PD\ EH PLQLPDO $OWHUQDWLYHO\ WKH LQFUHDVH LQ 27 PD\ KDYH EHHQ IURP WKH SRVWHULRU SLWXLWDU\ DV D QHXUDO DIIHUHQW UHIOH[ IURP KDQGOLQJ WKH FHUYL[ IRPL[ DQG YDJLQD HJ )HUJXVRQfV UHIOH[ 1RUHSLQHSKULQH VWLPXODWHV FRQFRPLWDQW SURJHVWHURQH V\QWKHVLV DQG SRVW WUDQVODWLRQDO SURFHVVLQJ RI 27 V\QWKHVLV E\ DFWLYDWLQJ K\GUR[\VWHURLG GHK\GURJHQDVH LQ WKH ERYLQH &/ ,W KDV EHHQ VKRZQ WKDW VWUHVV PLPLFNHG E\ QRUHSLQHSKULQH LQIXVLRQ PD\ LQFUHDVH SURJHVWHURQH V\QWKHVLV RYDULDQ 27 DQG SDGUHQHUJLF UHFHSWRUV .RWZLFD HW DO f 1R SURJHVWHURQH PHDVXUHPHQWV ZHUH GRQH LQ WKLV VWXG\ 6NDU]\QVNL DQG .RWZLFD f UHSRUWHG WKDW DGPLQLVWUDWLRQ RI UHSHDWHG PJ GRVHV RI QRUHSLQHSKULQH DW PLQ LQWHUYDOV WR F\FOLF FRZV UHVXOWHG LQ D GHFUHDVH LQ WKH TXDQWLW\ RI 27 UHOHDVHG HDFK WLPH IURP WKH &/ LQGLFDWLQJ D GHSOHWLRQ RI 27 ,Q WKH SUHVHQW VWXG\ QR UHVSRQVLYHQHVV ZDV VHHQ IROORZLQJ 3*)f XQWLO DIWHU WKH WKLUG LQMHFWLRQ RI D ODUJH 3*)D GRVH RI PJ 7KLV LQGLFDWHV WKDW WKH VXEOXWHRO\WLF SJ GRVHV DGPLQLVWHUHG ZHUH QRW FDSDEOH RI HOLFLWLQJ DQ REVHUYDEOH UHVSRQVH ,YHOO HW DO f UHSRUWHG WKDW WKHUH ZDV QR GH QRYR V\QWKHVLV RI 27 SURn KRUPRQH LQ WKH PLGOXWHDO &/ 7KLV VXJJHVWV WKDW RQFH 27 LV GHSOHWHG WKHUH LV QR UHSOHQLVKPHQW RI VWRUHG 27 2YDULHFWRPL]HG FRZV DW GD\V RI SUHJQDQF\ WUHDWHG ZLWK 3*)O, KDG D VOLJKW EXW QRQVLJQLILFDQW LQFUHDVH LQ 27 FRQFHQWUDWLRQV RI DERXW WR SJPO IROORZLQJ WKH VHFRQG DQG WKLUG LQMHFWLRQV 7KLV PLQLPDO LQFUHDVH LQ 27 FRQFHQWUDWLRQV LQGLFDWHV DQ 27 FRQWULEXWLRQ RI QHXURK\SRSK\VHDO RULJLQ LQ RYDULHFWRPL]HG FRZV LQ WKH DEVHQFH RI D &/ 7KH 27 UHVSRQVH WR 3*)D LQ VKDP

PAGE 66

RYDULHFWRPL]HG FRZV RQ GD\V ZDV JUHDWHU WKDQ DW GD\ RI SUHJQDQF\ )LJ $ DQG %f ,Q ERWK JURXSV RI DQLPDOV D VLJQLILFDQW UHOHDVH RI 27 ZDV REVHUYHG DIWHU WKH OXWHRO\WLF GRVH RI 27 'D\ &/ EHOLHYHG WR EH GHSOHWHG RI 27 ZHUH H[SHFWHG WR JLYH D PLQLPDO UHVSRQVH WR 3*)D 7KH UHVSRQVH REVHUYHG PD\ LQGLFDWH DQ DOWHUQDWLYH VRXUFH RI 27 VLQFH 1LFKROV HW DO f VKRZHG QR OXWHDO 27 RU 27 P51$ LQ GD\ &/ ,QGHHG D VLPLODU HOHYDWLRQ LQ SODVPD 27 FRQFHQWUDWLRQV ZDV REVHUYHG LQ WKH VDOLQH WUHDWHG FRZV DW GD\ LQGLFDWLQJ QHXURK\SRSK\VHDO UHOHDVH 6KHOGULFN DQG )OLQW Ef UHSRUWHG GHFUHDVHG FRQFHQWUDWLRQ RI 27 LQ RYLQH &/ GXULQJ SUHJQDQF\ IURP QJJ ZHW ZHLJKW DW GD\ WR OHVV WKDQ QJJ DW GD\ RI SUHJQDQF\ $ GHFUHDVH LQ OXWHDO 27 WKHUHIRUH UHGXFHV WKH OLNHOLKRRG RI OXWHDO UHJUHVVLRQ DQG XWHULQH FRQWUDFWLOLW\ ZKLFK ZRXOG IXUWKHU DVVLVW LQ WKH HVWDEOLVKPHQW RI SUHJQDQF\ 2QH NQRZQ FDXVH IRU IDLOXUH RI 3*) WR VWLPXODWH IXUWKHU UHOHDVH RI 27 PD\ EH 3*)4 UHFHSWRU GHVHQVLWL]DWLRQ 6NDU]\QVNL DQG 2NXGD f ,Q WKH RYDU\ WKLV KDV EHHQ DWWULEXWHG WR SURVWDJODQGLQV SURGXFHG ORFDOO\ LQ WKH &/ 'HQQLQJ.HQGDOO HW DO f /DPVD HW DO f VKRZHG WKDW ORZ OHYHO LQIXVLRQ RI 3*)f LQWR WKH RYDULDQ DUWHU\ OHG WR GHVHQVLWL]DWLRQ RI WKH &/ LQ UHOHDVLQJ 27 LQ HZHV +RZHYHU LQ WKLV VWXG\ ZH REVHUYHG UHOHDVH RI 27 DIWHU WKH WKLUG LQMHFWLRQ VXJJHVWLQJ WKDW GHVHQVLWL]DWLRQ ZDV QRW WKH FDXVH RI IDLOXUH WR UHOHDVH KLJK DPRXQWV RI 27 RQ WKH ILUVW DQG VHFRQG LQMHFWLRQV RI 3*) LQ WKH VKDPRYDULHFWRPL]HG FRZV ,Q SHULRGV RQH DQG WZR GRVHV RI 3*)f ZHUH WRR ORZ )OLQW DQG 6KHOGULFN f DQG 6FKDOOHQEHUJHU HW DO f UHSRUWHG DQ LQFUHDVH LQ SODVPD 27 LQ SUHJQDQW FRZV EHWZHHQ GD\V WR +LJKHU FRQFHQWUDWLRQV RI 27 ZHUH IRXQG LQ WKH DRUWD WKDQ LQ WKH FDXGD YHQD FDYD VXJJHVWLQJ D QRQOXWHDO VRXUFH +RRSHU HW DO f UHSRUWHG KLJKHU 27 FRQFHQWUDWLRQV LQ WKH MXJXODU YHLQ WKDQ LQ WKH FDURWLG DUWHU\

PAGE 67

RI ODWH OXWHDO SKDVH VKHHS DQ LQGLFDWLRQ WKDW WKH QHXURK\SRSK\VLV FRXOG EH FRQWULEXWLQJ WR WKH SODVPD 27 3DUNLQVRQ HW DO f VXJJHVWHG D SRVVLELOLW\ RI 27 UHOHDVH IURP WKH QHXURK\SRSK\VLV LQ FRZV DIWHU WKH OHYHOV RI 27 IURP WKH &/ GHFOLQHG DURXQG WKH WLPH RI PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ 6FKDPV HW DO f :DWKHV HW DO f DQG 0HLGDQ HW DO f UHSRUWHG WKDW IROOLFOHV FRXOG DOVR EH D VRXUFH RI 27 ,Q WKH SUHVHQW VWXG\ KRZHYHU ERWK RYDULHV ZHUH UHPRYHG 7KH FRQFOXVLRQV IURP WKLV VWXG\ DUH WKDW 3*)D LQGXFHV UHOHDVH RI 27 IURP WKH &/ RI GD\ EXW QRW GD\ SUHJQDQW FRZV DQG WKDW WKH GRVH RI 3*)D KDV WR EH OXWHRO\WLF LQ RUGHU IRU D VXEVWDQWLDO DPRXQW RI 27 WR EH UHOHDVHG 7KHVH WZR JURXSV RI FRZV UHSUHVHQW FRZV LQ WKH HDUO\ LH GD\ f DQG ODWH LH GD\ f SHULLPSODQWDWLRQ SHULRGV )DLOXUH IRU UHOHDVH RI 27 DW GD\ PHDQV FRZV DW WKLV VWDJH KDYH YHU\ OLWWOH 27 LQ WKH &/ DQG WKDW 27 IURP WKH &/ DW WKLV VWDJH LV XQOLNHO\ WR LQLWLDWH SXOVDWLOH VHFUHWLRQ RI 3*)FO

PAGE 68

&+$37(5 (;35(66,21 2) 2;<72&,1 5(&(3725 35267$*/$1',1 *+ ) $1' ( 6<17+$6(6 ,1 7+( %29,1( (1'20(75,80 $1' &+25,2$//$172,6 '85,1* 7+( (675286 &<&/( $1' 3(5,,03/$17$7,21 3(5,2' ,QWURGXFWLRQ 2[\WRFLQ DQG WKH 275 SOD\ LPSRUWDQW UROHV LQ UHSURGXFWLYH SURFHVVHV LQFOXGLQJ OXWHRO\VLV HVWDEOLVKPHQW RI SUHJQDQF\ PLONOHW GRZQ DQG SDUWXULWLRQ LQ IHPDOHV DQG HMDFXODWLRQ LQ PDOHV ,YHOO DQG 5XVVHO $VVLQGHU HW DO f ,QKLELWLRQ RI WKH 275 SOD\V DQ LPSRUWDQW UROH LQ WKH HVWDEOLVKPHQW RI SUHJQDQF\ :DWKHV DQG /DPPLQJ f DQG WKH LQGXFWLRQ RI 275 GXULQJ ODERU IDFLOLWDWHV GHOLYHU\ RI WKH IHWXV )XFKV HW DO f %ORFNDGH RI HQGRPHWULDO 275 ZLWK DQ 27 DQWDJRQLVW IURP GD\V WR RI WKH F\FOH DIIHFWV QHLWKHU WKH GXUDWLRQ RI OXWHRO\VLV QRU WKH GXUDWLRQ RI WKH HVWURXV F\FOH LQ KHLIHUV .RWZLFD HW DO f +RZHYHU .RWZLFD HW DO Ef UHSRUWHG WKDW EORFNDGH RI 275 GHFUHDVHV WKH PDJQLWXGH RI 3*)D UHOHDVH LQGLFDWLQJ WKDW 27 KDV D VXSSRUWLYH DQG PRGXODWRU\ UROH RI WKH DPSOLWXGH RI 3*)D WKDW LQLWLDWHV OXWHRO\VLV LQ FDWWOH 8VLQJ OLJDQG ELQGLQJ DVVD\V )XFKV HW DO f UHSRUWHG WKDW 275 FRQFHQWUDWLRQV RQ GD\V DQG RI SUHJQDQF\ ZHUH VLPLODU WR WKRVH LQ F\FOLF FRZV 2Q GD\V DQG UHFHSWRU FRQFHQWUDWLRQV LQ SUHJQDQW FRZV UHPDLQHG ORZ DQG ZHUH ORZHU WKDQ LQ F\FOLF FRZV 2[\WRFLQ DGPLQLVWHUHG WR SUHJQDQW FRZV OHDGV WR LQFUHDVHG SURGXFWLRQ RI 3*)0 LQ D

PAGE 69

GRVHGHSHQGHQW IDVKLRQ WKDW RFFXUV ODWHU LQ SUHJQDQF\ DW DSSUR[LPDWHO\ GD\ )XFKV HW DO Ef 3URVWDJODQGLQ ) LV D OXWHRO\VLQ UHOHDVHG E\ WKH HQGRPHWULXP DW WKH HQG RI D QRUPDO HVWURXV F\FOH LQ UHVSRQVH WR 27 ZKHQ QR FRQFHSWXV LV SUHVHQW +RZHYHU LQ WKH SUHVHQFH RI D YLDEOH HPEU\R WKHUH LV VXSSUHVVLRQ RI SXOVDWLOH 3*) VHFUHWLRQ 6LOYLD HW DO )OLQW HW DO f ,W LV QRZ ZHOO HVWDEOLVKHG WKDW 275 LV VXSSUHVVHG E\ ,)1U GXULQJ WKH SHULRG RI PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ 7HOJPDQQ HW DO f ,Q FDVHV ZKHUH WKH FRQFHSWXV VHFUHWHV LQDGHTXDWH LQWHUIHURQU ,)1Uf WKHUH PD\ EH D SRVVLELOLW\ RI 275 VWLPXODWLRQ DQG 3*)D VHFUHWLRQ WKDW FRXOG DXJPHQW WKH OXWHRO\WLF SURFHVV DQG OHDG WR HPEU\R ORVV 2[\WRFLQ ELQGV WR LWV UHFHSWRU DQG FRXSOHV WR *c DQG *T SURWHLQV OHDGLQJ WR DFWLYDWLRQ RI 3.& DQG 3/& SDWKZD\V 6DQERUQ HW DO &RSODQG HW DO f (YHQWXDOO\ 3*+6 DQG 3*) V\QWKHVLV RFFXU ZKLFK OHDGV WR OXWHRO\VLV GXULQJ WKH HVWURXV F\FOH $OWKRXJK WKHVH HYHQWV RFFXU LQ DQ HVWURJHQ GRPLQDWHG HQYLURQPHQW WKH ERYLQH 275 GRHV QRW UHVSRQG WR DFWLYDWHG HVWUDGLRO UHFHSWRUV ,YHOO HW DO f ,W ZDV UHFHQWO\ VKRZQ WKDW WKH RYLQH 275 SURPRWHU LV VWLPXODWHG E\ OLJDQGHG (5D WKURXJK SURWHLQSURWHLQ DQG SURWHLQ '1$ LQWHUDFWLRQV %D]HU HW DO f $ SURJHVWHURQHSULPHG HQGRPHWULXP VHHPV WR EH QHFHVVDU\ IRU 27LQGXFHG DFWLYDWLRQ RI 3*+6 VLQFH LW KDV EHHQ VKRZQ WKDW SUHSXEHUWDO KHLIHUV IDLO WR UHVSRQG WR 27 XQOHVV WKH\ DUH SULPHG E\ SURJHVWHURQH )XFKV HW DO f $OWKRXJK VHYHUDO VWXGLHV RQ WKH H[SUHVVLRQ RI 275 KDYH EHHQ FRQGXFWHG GXULQJ WKH HVWURXV F\FOH DQG HDUO\ SUHJQDQF\ H[SUHVVLRQ RI 275 P51$ GXULQJ PRVW RI WKH SHULLPSODQWDWLRQ KDV QRW EHHQ LQYHVWLJDWHG 7KH LPSRUWDQFH RI XQGHUVWDQGLQJ WKH SDWWHUQ RI H[SUHVVLRQ RI 275 GXULQJ WKH SHULLPSODQWDWLRQ SHULRG DULVHV EHFDXVH LI 275 DUH DFWLYHO\ H[SUHVVHG DQG FRXSOHG WR WKH SURVWDJODQGLQ V\QWKHVLV

PAGE 70

SDWKZD\ WKLV PD\ LQLWLDWH OXWHRO\WLF SXOVHV RI 3*)D GXULQJ HDUO\ SUHJQDQF\ 7KLV PD\ EH RQH RI WKH PHFKDQLVPV WKDW OHDG WR KLJK HPEU\R ORVV GXULQJ HDUO\ SUHJQDQF\ LQ FDWWOH 3DUWLFXODUO\ LQ KLJK SURGXFLQJ GDLU\ FRZV 3URVWDJODQGLQ *+ V\QWKDVH 3*+6f DOVR NQRZQ DV F\FORR[\JHQDVH LV D NH\ UDWH OLPLWLQJ HQ]\PH LQ WKH SURVWDJODQGLQ ELRV\QWKHWLF SDWKZD\ ZKLFK FRQYHUWV DUDFKLGRQLF DFLG WR 3*+ 7KH 3*+ LV FRQYHUWHG WR 3*)D E\ 3*)6 :DWDQDEH HW DO f 7KH 3*+6 LV SUHVHQW DW ORZ FRQFHQWUDWLRQV LQ PRVW WLVVXHV EXW LV XVXDOO\ LQGXFHG E\ D YDULHW\ RI PLWRJHQV .XMXEX HW DO ;LH HW DO f LQWHUOHXNLQ +DELE HW DO f DQG JURZWK IDFWRUV :RQJ HW DO +HUVFKPDQQ f :LWKLQ WKH ERYLQH HQGRPHWULXP WZR W\SHV RI FHOOV SOD\ DQ LPSRUWDQW UROH LQ WKH V\QWKHVLV RI SURVWDJODQGLQV 7KH HSLWKHOLDO FHOOV SUHGRPLQDQWO\ VHFUHWH 3*)D ZKHUHDV WKH VWURPDO FHOOV VHFUHWH 3*( 6FKDW] HW DO )RUWLHU HW DO 'HVQR\HUV HW DO 3DUHQW HW DO Ef 'XULQJ HDUO\ SUHJQDQF\ WKH ORVV RI XWHULQH UHVSRQVLYHQHVV WR 27 FDXVHV WKH VXSSUHVVLRQ RI WKH SXOVDWLOH SDWWHUQ RI 3*)D VHFUHWLRQ OHDGLQJ WR PDLQWHQDQFH RI WKH &/ ,Q YLYR VWXGLHV KDYH UHYHDOHG WKH H[SUHVVLRQ DQG UHJXODWLRQ RI 3*+6 LQ XWHULQH WLVVXHV GXULQJ WKH HVWURXV F\FOH $URVK HW DO f DQG ODWHU VWDJHV RI SUHJQDQF\ )XFKV HW DO f $URVK HW DO f UHSRUWHG KLJK H[SUHVVLRQ RI 3*+6 P51$ LQ HQGRPHWULXP RI FRZV EHWZHHQ GD\V RI WKH HVWURXV F\FOH DQG ORZ H[SUHVVLRQ EHWZHHQ GD\V $OWKRXJK *X]HORJOX HW DO f UHSRUWHG KLJK H[SUHVVLRQ RI 3*+6 P51$ LQ HQGRPHWULXP RI GD\ SUHJQDQW GDLU\ FRZV QR H[WHQVLYH VWXGLHV KDYH EHHQ FRQGXFWHG RQ WKH H[SUHVVLRQ LQ WKH HQGRPHWULXP DQG FKRULRDOODQWRLV GXULQJ WKH SHULLPSODQWDWLRQ SHULRG (YDOXDWLRQ RI WKH SDWWHUQ RI H[SUHVVLRQ RI 3*+6 GXULQJ WKH HQWLUH SHUL LPSODQWDWLRQ SHULRG LV QHFHVVDU\ VLQFH LW ZRXOG HQKDQFH RXU XQGHUVWDQGLQJ RI LWV SUREDEOH

PAGE 71

UROH LQ HVWDEOLVKPHQW RI SUHJQDQF\ 'HSHQGLQJ XSRQ WKH UHODWLYH DPRXQWV RI HDFK WKH GRZQVWUHDP HQ]\PHV 3*)6 DQG 3*(6 PD\ OHDG WR SUHGRPLQDQWO\ FRQYHUVLRQ RI 3*+ WR 3*)D ZKLFK LV OXWHRO\WLF RU WR 3*( ZKLFK PD\ EH OXWHRWURSKLF LQ UXPLQDQWV 3UDWW HW DO f ,Q D VLWXDWLRQ ZKHUH WKHUH LV LQFUHDVHG HQGRPHWULDO H[SUHVVLRQ RI 3*+6 LQ F\FOLF RU SUHJQDQW FRZV DURXQG WKH WLPH RI OXWHRO\VLV RU PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ WKHUH ZRXOG SUREDEO\ EH LQFUHDVHG V\QWKHVLV RI 3*(6 LQ SUHJQDQF\ 7KLV FRXOG EH LQ DQWLFLSDWLRQ IRU VXFFHVVIXO SUHJQDQF\ WR PDLQWDLQ D 3*(3*)D UDWLR WKDW LV IDYRUDEOH IRU PDLQWDLQLQJ SUHJQDQF\ 6WXGLHV RQ WKH H[SUHVVLRQ RI 3*(6 DQG 3*)6 LQ WKH ERYLQH HQGRPHWULXP DQG FKRULRDOODQWRLV ZLOO LQFUHDVH RXU XQGHUVWDQGLQJ RI WKH SK\VLRORJLFDO IXQFWLRQV RI WKHVH HQ]\PHV LQ F\FOLF DQG SHULLPSODQWDWLRQ FRZV 3URVWDJODQGLQ ( DQG ) V\QWKDVHV DUH NH\ HQ]\PHV LQ WKH SDWKZD\ WR SURVWDJODQGLQ V\QWKHVLV WKDW DUH LQYROYHG LQ FRQYHUVLRQ RI 3*+ WR 3*( DQG 3*)D UHVSHFWLYHO\ :DWDQDEH HW DK f 'HVSLWH WKH LPSRUWDQFH RI 3*)6 LQ SURVWDQRLG V\QWKHVLV DQG UHSURGXFWLRQ OLWWOH LQIRUPDWLRQ H[LVWV DERXW LWV P51$ H[SUHVVLRQ DQG UHJXODWLRQ GXULQJ WKH HVWURXV F\FOH DQG WKH SHULLPSODQWDWLRQ SHULRG ,QFUHDVHG H[SUHVVLRQ RI 3*)6 GXULQJ WKH SHULLPSODQWDWLRQ SHULRG FRXOG OHDG WR LQFUHDVHG V\QWKHVLV RI 3*)D ZKLFK PD\ OHDG WR KLJK 3*)R3*( UDWLR QRW IDYRULQJ LPSODQWDWLRQ 8QGHUVWDQGLQJ WKH PHFKDQLVPV WKDW FRQWURO WKH PDLQWHQDQFH RI SUHJQDQF\ DQG YLDELOLW\ RI WKH FRQFHSWXV GXULQJ WKH SHUL LPSODQWDWLRQ SHULRG VKRXOG SURYLGH LQVLJKW LQWR FDXVHV RI HPEU\R ORVV WKDW RFFXU GXULQJ WKLV WLPH ,W LV K\SRWKHVL]HG WKDW 275 3*+6 DQG 3*)6 P51$ DUH GRZQUHJXODWHG ZKHUHDV 3*(6 LV XSUHJXODWHG LQ WKH HQGRPHWULXP DQG FKRULRDOODQWRLV GXULQJ WKH SHUL

PAGE 72

LPSODQWDWLRQ SHULRG 6XFK D UHVSRQVH VKRXOG OHDG WR OHVV FKDQFHV RI OXWHRO\VLV DQG LQFUHDVH HPEU\R VXUYLYDO 7KH REMHFWLYHV RI WKLV VWXG\ ZHUH WR FKDUDFWHUL]H WKH H[SUHVVLRQ RI 275 3*+6 3*(6 DQG 3*)6 LQ ERYLQH FDUXQFXODU DQG LQWHUFDUXQFXODU HQGRPHWULXP DV ZHOO DV WKH FKRULRDOODQWRLV GXULQJ WKH HVWURXV F\FOH DQG WKH SHUL LPSODQWDWLRQ SHULRG 0DWHULDOV DQG 0HWKRGV $QLPDOV 7LVVXHV ZHUH FROOHFWHG IURP PXOWLSDURXV %UDKPDQ$QJXV FURVVEUHG FRZV Q HDFK GD\f RQ GD\ HVWUXVf DQG RI WKH HVWURXV F\FOH DQG DW GD\V DQG RI SUHJQDQF\ Q WR FRZV HDFK GD\f (VWUXV ZDV LQGXFHG ZLWK 3*)D PJ LP /XWDO\VHp 3KDUPDFLD t 8SMRKQ .DODPD]RR 0,f &RZV ZHUH H[SRVHG WR D IHUWLOH EXOO ZLWK D FKLQ EDOO PDUNHU DQG DOVR EUHG DW HVWUXV E\ DUWLILFLDO LQVHPLQDWLRQ WR HQKDQFH SUHJQDQF\ UDWHV &RZV ZHUH VODXJKWHUHG DQG WLVVXHV FROOHFWHG IURP DQLPDOV SURFHVVHG WKURXJK WKH 8QLYHUVLW\ RI )ORULGD $QLPDO 6FLHQFH DEDWWRLU )RU FRZV OHVV WKDQ GD\V RI SUHJQDQF\ SUHJQDQF\ ZDV FRQILUPHG E\ REVHUYDWLRQ RI D FRQFHSWXV RU HPEU\R DIWHU IOXVKLQJ WKH XWHULQH KRUQV ZLWK SK\VLRORJLFDO VDOLQH )RU FRZV DW RU GD\V SUHJQDQF\ ZDV FRQILUPHG XVLQJ XOWUDVRXQG (QGRPHWULDO VDPSOHV ZHUH FROOHFWHG IURP WKH XWHULQH KRUQ LSVLODWHUDO WR WKH &/ DQG FDUH ZDV WDNHQ WR VHSDUDWH WKH FDUXQFXODU IURP WKH LQWHUFDUXQFXODU HQGRPHWULXP 7KH FKRULRDOODQWRLV ZDV FROOHFWHG IURP FRZV ZKLFK ZHUH DW OHDVW GD\V SUHJQDQW 7LVVXHV ZHUH VQDSIUR]HQ LQ OLTXLG QLWURJHQ DQG WKHQ VWRUHG DW r& XQWLO 51$ H[WUDFWLRQ

PAGE 73

51$ ([WUDFWLRQ 7RWDO 51$ ZDV LVRODWHG IURP WKH FDUXQFXODU DQG LQWHUFDUXQFXODU HQGRPHWULXP DV ZHOO DV WKH FKRULRDOODQWRLV XVLQJ 7UL]RO UHDJHQW ,Q9LWURJHQ &DUOVEDG &$f IROORZLQJ WKH PDQXIDFWXUHUV LQVWUXFWLRQV $IWHU H[WUDFWLRQ WKH 51$ SHOOHW ZDV UHVXVSHQGHG LQ SL SUHZDUPHG r&f 51$VHFXUH r1 5HVXVSHQVLRQ VROXWLRQ $PELRQ $XVWLQ 7;f DQG WKH UHVXOWDQW 51$ VXVSHQVLRQ KHDWHG DW r& IRU PLQ WR UHPRYH FRQWDPLQDWLQJ 51$VH $ '1$IUHH0 NLW $PELRQf ZDV XVHG WR UHPRYH FRQWDPLQDWLQJ JHQRPLF '1$ IURP WKH 51$ VDPSOHV %ULHIO\ YROXPH RI ; '1DVH EXIIHU P0 7ULV&O S+ P0 0J&K P0 &D&OLf DQG SL '1$VH 51$VH IUHH XQLWVSOf ZHUH DGGHG WR WKH 51$ VXVSHQVLRQ 7KH 51$ VDPSOHV ZHUH WKHQ PL[HG JHQWO\ DQG LQFXEDWHG DW r& IRU PLQ $W HQG RI LQFXEDWLRQ YROXPH SLf RI '1DVH ,QDFWLYDWLRQ 5HDJHQW IURP WKH '1$IUHH NLW ZDV DGGHG DQG WKH FRQWHQWV ZHUH PL[HG DQG LQFXEDWHG DW r& IRU PLQ 7KH PL[WXUH ZDV FHQWULIXJHG DW [ J IRU PLQ WR SHOOHW WKH '1DVH ,QDFWLYDWLRQ 5HDJHQW 7UHDWHG 51$ VDPSOHV ZHUH UHFRYHUHG DQG WKHLU FRQFHQWUDWLRQV GHWHUPLQHG XVLQJ D VSHFWURSKRWRPHWHU DW QP 7KH TXDOLW\ RI WKH 51$ VDPSOHV ZDV DVVHVVHG E\ WKH LQWHJULW\ RI 6 DQG 6 ULERVRPDO 51$ DIWHU HOHFWURSKRUHVLV RI SJ WRWDO 51$ 7KH 51$ VDPSOHV ZHUH VWRUHG DW r& XQWLO DQDO\VLV 9DOLGDWLRQ RI WKH 5HODWLYH 4XDQWLWDWLRQ RI 275 3*(6 3*)6 UQ51$ DQG 6 U51$ 7KH $ $&L PHWKRG IRU UHODWLYH JHQH TXDQWLWDWLRQ LV EDVHG RQ WKH IROORZLQJ SULQFLSOH 7KH WKUHVKROG F\FOH &M LQGLFDWHV WKH IUDFWLRQDO F\FOH QXPEHU DW ZKLFK WKH DPRXQW RI DPSOLILHG WDUJHW UHDFKHV D IL[HG WKUHVKROG 7KH PHDQ &U 7KUHVKROGf YDOXHV RI UHSOLFDWH UXQV IRU WKH WDUJHW JHQH DUH GHWHUPLQHG 7KH GLIIHUHQFH $&7f EHWZHHQ WKH PHDQ &W YDOXHV RI WKH WDUJHW JHQH DQG WKH HQGRJHQRXV FRQWURO 6 U51$f LV FDOFXODWHG 7KHQ

PAGE 74

$ $&W LV WKH GLIIHUHQFH EHWZHHQ $&7 DQG WKH &W YDOXH RI WKH FDOLEUDWRU 7KH DPRXQW RI WDUJHW 275 3*+6 3*(6 3*)6f QRUPDOL]HG WR HQGRJHQRXV UHIHUHQFH 6 U51$f DQG UHODWLYH WR WKH FDOLEUDWRU LV GHWHUPLQHG E\ WKH IRUPXOD UHODWLYH FRQFHQWUDWLRQ RI WDUJHW P51$ $$&7 ,QWHUFDUXQFXODU HQGRPHWULDO 51$ VDPSOH IURP D FRZ LQ HVWUXV ZDV FKRVHQ LQ ZKLFK WKH 275 DQG 3*+6 WUDQVFULSWV ZHUH EHOLHYHG WR EH KLJKO\ H[SUHVVHG FDOLEUDWRU VDPSOHf )RU 3*(6 DQG 3*)6 WKH FDOLEUDWRU ZDV WRWDO 51$ IURP LQWHUFDUXQFXODU HQGRPHWULXP IURP D FRZ DW GD\ RI SUHJQDQF\ ,Q RUGHU WR XVH WKH $ $ &W PHWKRG IRU UHODWLYH TXDQWLWDWLRQ RI P51$ H[SUHVVLRQ IRU WKH UHVSHFWLYH JHQHV D YDOLGDWLRQ VWXG\ ZDV FRQGXFWHG WR GHPRQVWUDWH WKDW WKH HIILFLHQFLHV RI DPSOLILFDWLRQ IRU WKH 275 3*+6 3*(6 DQG 3*)6 JHQHV WDUJHW DPSOLILFDWLRQf DQG 6 U51$ UHIHUHQFH DPSOLILFDWLRQf DUH DSSUR[LPDWHO\ HTXDO ,Q RUGHU IRU WKH HIILFLHQFLHV RI DPSOLILFDWLRQ IRU WKH WZR JHQHV WR EH HTXDO WKH DEVROXWH YDOXH RI WKH VORSH RI ORJ LQSXW DPRXQW RI 51$ YHUVXV $&W VKRXOG EH OHVV WKDQ $SSOLHG %LRV\VWHPV XVHU %XOOHWLQ f RU WKH VORSHV RI WKH GLOXWLRQ FXUYHV IRU WKH VSHFLILF WDUJHW JHQH DQG WKDW IRU 6 U51$ VKRXOG EH DSSUR[LPDWHO\ HTXDO 7KH YDOLGDWLRQ VWXG\ DOVR SURYLGHG LQIRUPDWLRQ RQ WKH FRQFHQWUDWLRQ RI WRWDO 51$ WR EH XVHG GXULQJ 3&5 IRU DOO WKH JHQHV DQG 6 U51$ )RU 275 JHQH H[SUHVVLRQ VHULDO GLOXWLRQV RI WRWDO 51$ ZHUH FRQGXFWHG IURP QJ WR QJ $SSHQGL[ %f SJ WR SJ IRU 6 U51$ $SSHQGL[ &f QJ WR QJ IRU 3*+6 $SSHQGL[ 'f DQG QJ WR QJ IRU 3*(6 DQG 3*)6 $SSHQGLFHV ( DQG )f $PSOLILFDWLRQ SORWV IRU 275 )LJ f 6 U51$ )LJ f 3*+6 )LJ f 3*(6 )LJ f DQG 3*)6 )LJ f ZHUH FRQVWUXFWHG 7KUHVKROG F\FOH &Wf YDOXHV ZHUH SORWWHG DJDLQVW ORJ FRQFHQWUDWLRQ DQG WKH VORSH ZDV GHWHUPLQHG 7KH VORSH f IRU WKH VWDQGDUG FXUYH RI WKH 275 JHQH )LJ f

PAGE 75

IRU 3*+6 )LJ f IRU 3*(6 )LJ f DQG IRU 3*)6 )LJ f ZHUH FRPSDUDEOH WR WKDW RI 6 U51$ )LJ f 7KH YDOXHV REWDLQHG FRQILUPHG WKH YDOLGLW\ RI WKH $ $ 2U PHWKRG IRU GHWHUPLQLQJ UHODWLYH DEXQGDQFH RI WKH JHQHV VWXGLHG 3&5 3ULPHUV DQG 3UREHV 3ULPHUV ZHUH GHVLJQHG E\ $VVD\ E\ 'HVLJQ $SSOLHG %LRV\VWHPV )RVWHU &LW\ &$f DQG DUH VKRZQ LQ 7DEOH 7DEOH 6HTXHQFHV RI SULPHUV DQG SUREHV XVHG IRU 573&5 P51$ 3ULPHU VHTXHQFH3UREH 3f )RUZDUG )f 5HYHUVH 5f $PSOLFRQ VL]H EDVHVf 5HIHUHQFH 275 **&&7$&$7&$&*7**$7&$& )f %DWKJDWH HW DO f $*&$**7**&$$**$&*$7 5f $&***&$&$$7*7$ 3f 3*+6 &*7*$$*&&&7$7*$$7&$777* )f /LX HW DO f &77&7$$&7&7*&$*&&$777&&7 5f 7&7&7&&7*7$$*77&& 3f 3*(6 **$$&*$&&&$*$7*7**$$ )f )LOLRQ HW DO f $&$$$*&&&$**$$&$**$$5f )$0&&7&$*$*&&&$&&**0*%1) 3f 3*)6 &$$*&&7***$$**$&77&77 )f 6X]XNL HW DO f &$**7$7&&$&*$$$7&777&7&$ 5f )$0$**$&**&$$&*7*$70*%1)4 3f 3&5 3URWRFRO 7KH 3&5 PDVWHUPL[ FRQVLVWHG RI SL RI ; 7KHUPR6FULSW 5HDFWLRQ PL[ 3ODWLQXP 4XDQWLWDWLYH 573&5 7KHPR6FULSW 2QH6WHS V\VWHP ,Q9LWURJHQf 3ULPHUV ; SL Q0f DQG SUREHV SL Q0f ZHUH REWDLQHG IURP $SSOLHG

PAGE 76

%LRV\VWHPV &XVWRPHU 6HW ,' 275F'1$275O &2;F'1$&2;D 3*(6F'1$ *(6G 3*)6F'1$*)6E 7DT0DQ SUREHV DQWLVHQVH VHTXHQFHf XVHG )$0 DV UHSRUWHU G\H DQG D PLQRU JURRYH ELQGLQJ QRQIOXRUHVFHQW TXHQFKHU G\H 0*%1)4f 3ULPHUV IRU 6 U51$ SL Q0 HDFKf DQG 7DT0DQ SUREH SL Q0 HXNDU\RWLF 6 U51$ 0*% HQGRJHQRXV FRQWUROf ZHUH REWDLQHG IURP $SSOLHG %LRV\VWHPV 7KH SUREH XVHV 9,& DV UHSRUWHU G\H DQG 0*%1)4 DV D TXHQFKHU 7KHUPR6FULSW SOXV3ODWLQXP 7DT HQ]\PH PL[ SL 3ODWLQXP 4XDQWLWDWLYH 573&5 7KHUPR6FULSW 2QH6WHS 6\VWHPf ZDV REWDLQHG IURP ,Q9LWURJHQ $XWRFODYHG GLVWLOOHG ZDWHU SLf ZDV DGGHG WR WKH DERYH FRPSRQHQWV WR JLYH D ILQDO YROXPH RI SL SHU UHDFWLRQ WXEH 7RWDO 51$ QJf ZDV XVHG IRU 275 3*+6 3*(6 DQG 3*)6 JHQH H[SUHVVLRQ DQDO\VLV DQG SJ WRWDO 51$ SHU UHDFWLRQ IRU WKHO6 U51$ JHQH )RU LQWHU DQG LQWUDDVVD\ FRQWURO WRWDO 51$ IURP FDUXQFXODU HQGRPHWULXP IURP D FRZ LQ HVWUXV ZDV XVHG IRU 275 DQG 3*+6 JHQHV ZKHUHDV LQWHUFDUXQFXODU HQGRPHWULXP IURP D FRZ DW GD\ RI SUHJQDQF\ ZDV XVHG IRU 3*(6 DQG 3*)6 $OO VDPSOHV ZHUH UXQ LQ WULSOLFDWH $ VHW RI WZR UHDFWLRQV IRU QRWHPSODWH FRQWUROV 17&f IRU ERWK WKH WDUJHW JHQH DQG 6 U51$ ZHUH LQFOXGHG 7KH 17& FRQVLVWHG RI SL ZDWHU 7KH LQGLYLGXDO JHQHV 275 3*+6 3*(6 DQG 3*)6f DQG 6 U51$ JHQH H[SUHVVLRQ 573&5 ZHUH FRQGXFWHG RQ WKH VDPH VDPSOH SODWH 3URFHGXUH $OO UHDJHQWV ZHUH NHSW RQ LFH ,Q HDFK DVVD\ WKH PDVWHU PL[WXUH IRU HLWKHU 275 3*+6 DQG 6 U51$ RU 3*(6 3*)6 DQG 6 U51$ ZHUH DGGHG WR WKH ZHOOV ILUVW IROORZHG E\ GHLRQL]HG GRXEOHGLVWLOOHG ZDWHU SULPHUV DQG SUREH 7KH 7DT SRO\PHUDVH ZDV DGGHG ODVW $XWRFODYHG GRXEOH GLVWLOOHG ZDWHU ZDV WKHQ DGGHG WR WKH 17& ZHOOV DQG WKHVH ZHOOV FDSSHG ZLWK RSWLFDO FDSV $SSOLHG %LRV\VWHPVf SULRU WR DGGLWLRQ RI 51$ WR

PAGE 77

WKH UHVW RI WKH ZHOOV 7KH ZHOO FRQWHQWV ZHUH YRUWH[HG EULHIO\ DQG WUDQVSRUWHG RQ LFH WR WKH ,QWHUGLVFLSOLQDU\ &HQWHU IRU %LRWHFKQRORJ\ 5HVHDUFK ,&%5f 3URWHLQ &RUH /DERUDWRU\ 7KH SODWH ZDV FHQWULIXJHG EULHIO\ WR EULQJ GRZQ WKH ZHOO FRQWHQWV EHIRUH LW ZDV ORDGHG LQWR D *HQH$PS IRU RQHVWHS 5HDO 7LPH 3&5 7KHUPDO &\FOHU 3URWRFRO 5HYHUVH WUDQVFULSWLRQ UHDFWLRQ IRU ILUVW VWUDQG F'1$ V\QWKHVLV ZDV FRQGXFWHG DW r& IRU PLQ ,QDFWLYDWLRQ RI UHYHUVH WUDQVFULSWDVH GHQDWXUDWLRQ RI 51$'1$ DQG DFWLYDWLRQ RI 7DT '1$ SRO\PHUDVH ZHUH FRQGXFWHG DW r& IRU PLQ $PSOLILFDWLRQ ZDV DFKLHYHG ZLWK F\FOHV DW r& IRU VHF H[WHQVLRQf DQG r& IRU PLQ DQQHDOLQJf 5XQ WLPH ZDV K PLQ $QDO\VLV RI 5HVXOWV )URP *HQH $03 'DWD IURP WKH *HQH$PS UXQV ZHUH HQWHUHG LQWR WKH *HQH$PS 6'6 VRIWZDUH SURJUDP WR GHWHUPLQH &W YDOXHV WKUHVKROG F\FOHf DQG DPSOLILFDWLRQ SORWV 7KH GDWD IRU &M YDOXHV IRU 275 3*+6 3*(6 3*)6 DQG 6 U51$ DQG FDOLEUDWRU VDPSOH ZHUH XVHG WR GHWHUPLQH WKH UHODWLYH TXDQWLW\ RI WKH LQGLYLGXDO JHQHV XVLQJ WKH $ $ &U PHWKRG 5HVXOWV ZHUH H[SUHVVHG DV DUELWUDU\ XQLWV UHODWLYH WR WKH FDOLEUDWRU VDPSOH DQG QRUPDOL]HG DJDLQVW 6 U51$ ,PPXQRKLVWRFKHPLFDO /RFDOL]DWLRQ IRU 275 DQG 3*+6 &DUXQFXODU DQG LQWHUFDUXQFXODU HQGRPHWULXP ZHUH GLVVHFWHG VHSDUDWHO\ 7LVVXHV ZHUH IL[HG LQ b ZYf SDUDIRUPDOGHK\GH LQ SKRVSKDWH EXIIHUHG VDOLQH S+ f IRU K )ROORZLQJ IL[DWLRQ WLVVXHV ZHUH GHK\GUDWHG LQ HWKDQRO DQG HPEHGGHG LQ SDUDIILQ 7LVVXH VHFWLRQV ZHUH FXW DW SP WKLFNQHVV DQG PRXQWHG RQWR 6XSHUIURVW FKDUJHG PLFURVFRSLF VOLGHV )LVKHU 3LWWVEXUJ 3$f 6HFWLRQV ZHUH GHSDUDIILQL]HG DQG K\GUDWHG LQ D VHULHV RI

PAGE 78

JUDGHG DOFRKROV [\OHQH UDLQf [\OHQH PLQf b HWKDQRO IRU PLQ [ f b K\GURJHQ SHUR[LGH LQ PHWKDQRO WR EORFN HQGRJHQRXV SHUR[LGDVHV PLQf b HWKDQRO PLQf b HWKDQRO PLQf DQG ZDWHU PLQf $QWLJHQ UHWULHYDO ZDV XVHG WR XQPDVN DQWLJHQLF 275 DQG 3*+6 VLWHV %ULHIO\ VOLGHV ZHUH ERLOHG DW r & IRU PLQ LQ ('7$ EXIIHU S+ f IRU 275 DQG 0 FLWULF DFLG EXIIHU IRU 3*+6 5LFKDUG $OODQ 6FLHQWLILF .DODPD]RR 0,f 6OLGHV ZHUH NHSW LQ 7ULV EXIIHU ,;f XQWLO EORFNLQJ VHUXP ZDV DGGHG 6HFWLRQV ZHUH LQFXEDWHG DW r& IRU PLQ LQ $YLGLQ%LRWLQ EORFNLQJ UHDJHQW FRQWDLQLQJ JRDW VHUXP WR EORFN QRQVSHFLILF ELQGLQJ 7KH SULPDU\ PRXVH PRQRFORQDO DQWLERG\ DJDLQVW KXPDQ 275 DQWL275 ) ZDV D NLQG GRQDWLRQ IURP 'U 7 .LPXUD 2VDND 8QLYHUVLW\ 0HGLFDO 6FKRRO 2VDND -DSDQf 7DNHPXUD HW DO f ZDV VKRZQ WR UHDFW ZLWK ERYLQH 275 )XFKV HW DO Df $QWLVHUXP ZDV DGGHG WR WKH VHFWLRQV DW D GLOXWLRQ RI DQG LQFXEDWLRQ FRQGXFWHG DW URRP WHPSHUDWXUH r&f IRU K )RU 3*+6 LPPXQRVWDLQLQJ WKH SULPDU\ SRO\FORQDO DQWLERG\ 3* E KXPDQ DQWL3*+6 2[IRUG %LRPHGLFDO 5HVHDUFK 2[IRUG 0,f ZDV XVHG DW D GLOXWLRQ RI 6HFRQGDU\ ELRWLQ\ODWHG DQWLERG\ LQ WKH $%& 9HFWDVWDLQ NLW 9HFWRU /DERUDWRULHV ,QF %XUOLQJDPH &$f ZDV DGGHG DQG VHFWLRQV LQFXEDWHG DW r& IRU PLQ IROORZHG E\ 9HFWDVWDLQ $%& UHDJHQW IRU PLQ 'LDPLQREHQ]LGLQHWHWUDK\GURFKORULGH '$%f UHDJHQW ZDV WKHQ DSSOLHG WR WKH WLVVXH VHFWLRQV IRU PLQ ([FHVV '$% ZDV ZDVKHG DZD\ E\ SODFLQJ WKH VOLGHV LQ GLVWLOOHG ZDWHU &RXQWHUVWDLQLQJ ZDV FRQGXFWHG IRU PLQ XVLQJ KHPDWR[\OLQ 5LFKDUG $OODQ 6FLHQWLILFf 6HFWLRQV ZHUH ULQVHG LQ UXQQLQJ ZDWHU IRU VHF DQG FODULILHG ZLWK D FODULILHU 5LFKDUG $OODQ 6FLHQWLILFf 6HFWLRQV ZHUH WKHQ GHK\GUDWHG XVLQJ D VHULHV RI JUDGHG HWKDQRO IURP b b b [ f DQG [\OHQH GLSV LQ HDFK

PAGE 79

VROXWLRQf 6HFWLRQV ZHUH VHDOHG ZLWK 5LFKDUG $OODQ 6FLHQWLILF PRXQWLQJ PHGLXP DQG FRYHU VOLSV 6HFWLRQV ZHUH YLHZHG XQGHU D =HLVV $[LRSODQ ,, PLFURVFRSH WR GHWHFW IRU VSHFLILF LPPXQRVWDLQLQJ IRU 275 RU 3*+6 DQWLJHQ 3KRWRPLFURJUDSKV ZHUH WDNHQ DW ; PDJQLILFDWLRQ )RU 275 QHJDWLYH FRQWUROV LQFOXGHG VHFWLRQV IURP WKH VDPH WLVVXH ZLWK DQWLERG\ GLOXWLRQ EXIIHU VXEVWLWXWLQJ IRU WKH SULPDU\ DQWLERG\ ZKHUHDV IRU 3*+6 SUHLPPXQH UDEELW VHUXP 3* F 2[IRUG %LRFKHPLFDO 5HVHDUFKf DW D GLOXWLRQ RI ZDV VXEVWLWXWHG IRU SULPDU\ DQWLERG\ 6WDWLVWLFDO $QDO\VLV 'DWD ZHUH DQDO\]HG XVLQJ WKH 6WDWLVWLFDO $QDO\VLV 6\VWHP 6$6f VRIWZDUH YHUVLRQ 6$6 ,QVWLWXWH &DU\ 1&f *URXS PHDQV RI 275 3*+6 3*(6 DQG 3*)6 P51$ E\ WLVVXH DQG GD\ RI SUHJQDQF\ RU F\FOH ZHUH FRPSXWHG 'DWD ZLWK XQHTXDO HUURU YDULDQFHV ZHUH ORJWUDQVIRUPHG IRU GDWD DQDO\VLV 7KH PRGHO FRQVLVWHG RI FRQFHQWUDWLRQ RI 275 3*+6 3*(6 DQG 3*)6 P51$ DV WKH GHSHQGHQW YDULDEOHV DQG VWDWXV F\FOLF RU SUHJQDQWf WLVVXH FDUXQFXODU LQWHUFDUXQFXODU HQGRPHWULXP DQG FKRULRDOODQWRLVf GD\ RI F\FOHSUHJQDQF\ VWDWXV [ WLVVXH VWDWXV [ GD\ WLVVXH [ GD\ VWDWXV [ WLVVXH [ GD\ DV LQGHSHQGHQW YDULDEOHV 6LJQLILFDQFH RI GLIIHUHQFHV EHWZHHQ JURXS PHDQV E\ VWDWXV W\SH RI WLVVXH DQG GD\ RI SUHJQDQF\ RU F\FOH ZHUH WHVWHG XVLQJ $129$ 2UWKRJRQDO FRQWUDVWV ZHUH FRQGXFWHG IRU WKH HIIHFWV RI VWDWXV GD\ DQG WLVVXH 'LIIHUHQFHV LQ PHDQV ZHUH FRQVLGHUHG VWDWLVWLFDOO\ VLJQLILFDQW DW 3 6LPSOH DQG SDUWLDO FRUUHODWLRQV ZHUH FRQGXFWHG WR GHWHUPLQH WKH UHODWLRQVKLSV EHWZHHQ WKH GLIIHUHQW JHQHV 7UDQVIRUPHG GDWD DUH SUHVHQWHG DV OHDVW VTXDUHV PHDQV s 6(0

PAGE 80

)LJ $PSOLILFDWLRQ SORW VKRZLQJ VHULDO GLOXWLRQV RI WRWDO 51$ XVHG LQ WKH YDOLGDWLRQ WR TXDQWLWDWH 275 P51$ 5Q QRUPDOL]HG UHSRUWHUf IOXRUHVFHQW HPLVVLRQ LQWHQVLW\ RI WKH UHSRUWHU G\H GLYLGHG E\ WKH IOXRUHVFHQW HPLVVLRQ LQWHQVLW\ RI WKH SDVVLYH UHIHUHQFH G\H

PAGE 81

&\FOH 1XPEHU

PAGE 82

)LJ $PSOLILFDWLRQ SORW VKRZLQJ VHULDO GLOXWLRQV RI WRWDO 51$ XVHG LQ WKH YDOLGDWLRQ WR TXDQWLWDWH 6 U51$

PAGE 83

&\FOH 1XPEHU

PAGE 84

)LJ 6WDQGDUG FXUYH IRU HVWLPDWLRQ RI HIILFLHQF\ RI DPSOLILFDWLRQ RI WKH 275 JHQH IRU YDOLGDWLRQ RI $ $ &W PHWKRG

PAGE 85

F 6WDQGDUG &XUYH /RJ &2 r

PAGE 86

)LJ 6WDQGDUG FXUYH IRU HVWLPDWLRQ RI HIILFLHQF\ RI DPSOLILFDWLRQ RI 6 U51$ JHQH IRU YDOLGDWLRQ RI $ $ &W PHWKRG

PAGE 87

% & 6WDQGDUG &XUYH IW W i  r W r r /RJ &2 21

PAGE 88

)LJ $PSOLILFDWLRQ SORW VKRZLQJ VHULDO GLOXWLRQV RI WRWDO 51$ XVHG LQ WKH YDOLGDWLRQ WR TXDQWLWDWH 3*+6 P51$

PAGE 89

&\FOH 1XPEHU

PAGE 90

)LJ 6WDQGDUG FXUYH IRU HVWLPDWLRQ RI HIILFLHQF\ RI DPSOLILFDWLRQ RI 3*+6 JHQH IRU YDOLGDWLRQ RI $ $ &M PHWKRG

PAGE 91

F W /RJ &2 6WDQGDUG &XUYH  O r ; + r r 6ORSH ,QWHUFHSW &RUUHODWLRQ

PAGE 92

)LJ $PSOLILFDWLRQ SORW VKRZLQJ VHULDO GLOXWLRQV RI WRWDO 51$ XVHG LQ WKH YDOLGDWLRQ WR TXDQWLWDWH 3*(6 UQ51$

PAGE 93

&\FOH 1XPEHU

PAGE 94

)LJ 6WDQGDUG FXUYH IRU HVWLPDWLRQ RI HIILFLHQF\ RI DPSOLILFDWLRQ RI 3*(6 JHQH IRU YDOLGDWLRQ RI $ $ &M PHWKRG

PAGE 95

f 6WDQGDUG &XUYH L /RJ &2

PAGE 96

)LJ $PSOLILFDWLRQ SORW VKRZLQJ VHULDO GLOXWLRQV RI WRWDO 51$ XVHG LQ WKH YDOLGDWLRQ WR TXDQWLWDWH 3*)6 P51$

PAGE 97

b Q &\FOH 1XPEHU RR 21

PAGE 98

)LJ 6WDQGDUG FXUYH IRU HVWLPDWLRQ RI HIILFLHQF\ RI DPSOLILFDWLRQ RI 3*)6 JHQH IRU YDOLGDWLRQ RI $ $ &M PHWKRG

PAGE 99

;f 6WDQGDUG &XUYH r L n r r r r /RJ &2 RR RR

PAGE 100

5HVXOWV ([SUHVVLRQ RI 275 3*+6 3*(6 DQG 3*)6 P51$ LQ ,QWHUFDUXQFXODU (QGRPHWULXP RI &YFLLF3UHJQDQW &RZV IURP 'D\V WRO $ VLJQLILFDQW GLIIHUHQFH ZDV REVHUYHG EHWZHHQ GD\ DQG IRU 275 P51$ DV VKRZQ E\ RUWKRJRQDO FRQWUDVWV 3 f 7DEOH f 7KHUH ZDV D VLJQLILFDQW VWDWXV F\FOLFSUHJQDQWf E\ GD\ YHUVXV GD\ LQWHUDFWLRQ 3 f 7KH P51$ IRU 275 LQFUHDVHG IURP GD\ WR GD\ LQ F\FOLF FRZV EXW UHPDLQHG ORZ LQ SUHJQDQW FRZV 7KH VWDWXV E\ GD\ LQWHUDFWLRQ LV VKRZQ LQ )LJ $ VWDWXV E\ GD\ LQWHUDFWLRQ 3 f ZDV GHWHFWHG IRU 3*+6 P51$ 7DEOH f ,Q ERWK F\FOLF DQG SUHJQDQW FRZV 3*+6 P51$ LQFUHDVHG RQ GD\V DQG EXW WKH LQFUHDVH ZDV DSSUHFLDEO\ JUHDWHU LQ SUHJQDQW FRZV 7DEOH DQG )LJ f )RU 3*(6 P51$ VLJQLILFDQW VWDWXV E\ GD\ LQWHUDFWLRQV 3 DQG 3 f ZHUH GHWHFWHG 7DEOH f ,Q SDUWLFXODU 3*(6 P51$ LQFUHDVHG DSSUHFLDEO\ RQ GD\ IRU F\FOLF FRZV EXW GLG QRW FKDQJH IRU SUHJQDQW FRZV 7DEOH f 7KH FKDQJH LQ 3*(6 P51$ DVVRFLDWHG ZLWK SUHJQDQF\ UHIOHFWV DQ DWWHQXDWLRQ LQ FRQWUDVW WR D VWLPXODWLRQ IRU 3*+6 P51$ $ PRUH FRPSOH[ SDWWHUQ RI FKDQJH ZDV GHWHFWHG IRU 3*)6 P51$ 7DEOH f 7KH PHDQ H[SUHVVLRQ RI 3*)6 P51$ RQ GD\ ZDV KLJKHU WKDQ IRU GD\V IRU ERWK F\FOLF DQG SUHJQDQW FRZV 3 f 7KH H[SUHVVLRQ GHFOLQHG E\ GD\ LQ F\FOLF FRZV EXW ZDV PRUH VXVWDLQHG LQ SUHJQDQW FRZV DW GD\ IROORZHG E\ D GHFUHDVH RQ GD\ 7DEOH f

PAGE 101

7DEOH /HDVW VTXDUHV PHDQV IRU 275 3*+6 3*(6 DQG 3*)6 P51$ LQ LQWHUFDUDQFXODU HQGRPHWULXP RI EHHI FRZV IURP GD\ 'f WR RI WKH HVWURXV F\FOH RU SUHJQDQF\ &\FOLF 3UHJQDQW &RQWUDVWV 5HVSRQVH ' ' ' 6(0 &O & & &O[ & &O[ & 275 16 16 r 16 r 3*+6 16 rr 16 rr 16 3*(6 16 r rr r rr 3*)6 16 } 16 } 16 rr 3 r 3 W 3 16 QRW VLJQLILFDQW f&O &\FOH YV 3UHJQDQW & YV' & YV )LJ 2[\WRFLQ UHFHSWRU P51$ FRQFHQWUDWLRQV LQ LQWHUFDUXQFXODU HQGRPHWULXP RI EHHI FRZV F\FOLFSUHJQDQW LQWHUDFWLRQ E\ 'D\ 3 f 'DWD UHSUHVHQW OHDVW VTXDUHV PHDQV s 6(0

PAGE 102

'D\ RI &\FOH RU 3UHJQDQF\ )LJ 3URVWDJODQGLQ *+ 6\QWKDVH P51$ FRQFHQWUDWLRQV LQ LQWHUFDUXQFXODU HQGRPHWULXP RI EHHI FRZV F\FOLFSUHJQDQW LQWHUDFWLRQ E\ 'D\ YV 3 f 'DWD UHSUHVHQW OHDVW VTXDUHV PHDQV s 6(0 ([SUHVVLRQ RI 275 3*+6 3*(6 DQG 3*)6 LQ ,QWHUFDUXQFXODU (QGRPHWULXP GXULQJ WKH (VWURXV &\FOH DQG 3UHJQDQF\ 7KH PHDQ H[SUHVVLRQ RI 275 P51$ GXULQJ HVWUXV '2f ZDV VLJQLILFDQWO\ KLJKHU WKDQ WKDW RQ GD\V DQG 3 f 7DEOH f 6LPLODUO\ H[SUHVVLRQ DW ZDV GHFUHDVHG EXW KLJKHU WKDQ WKH DYHUDJH RI DQG 3 f ([SUHVVLRQ RI 275 P51$ LQFUHDVHG DJDLQ DW SURHVWUXV RQ 3 f 7KH 3*+6 P51$ LQFUHDVHG LQ WKH LQWHUFDUXQFXODU HQGRPHWULXP RQ GD\V DQG FRPSDUHG WR WKH HDUOLHU VWDJHV RI WKH F\FOH 3 7DEOH f ([SUHVVLRQ RI 3*(6 P51$ ZDV KLJKHVW GXULQJ HVWUXV '2f DQG SURHVWUXV 'f FRPSDUHG WR WKH HDUO\

PAGE 103

DQG PLGOXWHDO VWDJHV RI WKH HVWURXV F\FOH LH GD\V DQG 7DEOH f ,Q FRQWUDVW 3*)6 P51$ ZDV ORZ DW HVWUXV DQG LQFUHDVHG LQ WKH PLGOXWHDO LH GD\V DQG f DQG SURHVWUXV GD\ f VWDJHV RIWKH HVWURXV F\FOH 3 7DEOH f 7DEOH /HDVW VTXDUHV PHDQV IRU 275 3*+6 3*(6 DQG 3*)6 P51$ LQ LQWHUFDUXQFXODU HQGRPHWULXP RI EHHI FRZV IURP GD\V WR RI WKH HVWURXV F\FOH 5HVSRQVH 'D\V RI WKH (VWURXV &\FOH 6(0 &RQWUDVWV f '2 ' ' &O & & & 275 AA 16 r 3*+6 r r rr 16 3*(6 rr 16 r rr 3*)6 r rr rr 16 rr 3 r 3 3 16 QRW VLJQLILFDQW D&O YV DQG & YV' & YV DQG & YV 7KH UHJUHVVLRQ FXUYHV IRU 275 H[SUHVVLRQ LQ WKH LQWHUFDUXQFXODU HQGRPHWULXP LQ SUHJQDQW FRZV VKRZHG DQ LQLWLDO ORZ H[SUHVVLRQ ZKLFK VWHDGLO\ LQFUHDVHG IURP GD\V WR RI SUHJQDQF\ )LJ $f 7KHUH ZDV DQ LQFUHDVH LQ 3*+6 H[SUHVVLRQ RQ GD\V WR IROORZHG E\ D GHFUHDVH DV SUHJQDQF\ DGYDQFHG WR GD\ ZKHUHDV IRU 3*(6 WKHUH ZDV D VOLJKW LQFUHDVH IURP GD\V WR RI SUHJQDQF\ )LJ %f 7KH WHPSRUDO H[SUHVVLRQ RI 275 P51$ LQ LQWHUFDUXQFXODU HQGRPHWULXP IURP GD\V WR RI SUHJQDQF\ VKRZHG DQ LQFUHDVH LQ H[SUHVVLRQ DIWHU GD\ 7DEOH f ([SUHVVLRQ RI 3*+6 P51$ LQFUHDVHG IURP GD\V WR IROORZHG E\ D GHFUHDVH IURP GD\V WR RI SUHJQDQF\ 7DEOH f

PAGE 104

7KH FRQFHQWUDWLRQ IRU 3*(6 P51$ ZDV KLJKHVW RQ GD\ DQG WKHQ GHFUHDVHG IURP GD\ WR $Q LQFUHDVH ZDV REVHUYHG RQ GD\ ([SUHVVLRQ RI 3*)6 P51$ ZDV KLJKHVW RQ GD\ DQG ZDV IROORZHG E\ D GHFUHDVH XQWLO GD\ RI SUHJQDQF\ 7DEOH f 7DEOH /HDVW VTXDUHV PHDQV IRU 275 3*+6 3*(6 DQG 3*)6 P51$ LQ LQWHUFDUXQFXODU HQGRPHWULXP RI EHHI FRZV IURP GD\V WR RI SUHJQDQF\ 5HVSRQVH 'D\V RI 3UHJQDQF\ 6(0 &RQWUDVWV D ' ' ' &O & & & & & 275 rr rr rr r 16 16 3*+6 rr 16 16 W 16 16 3*(6 rr rr 16 16 16 16 3*)6 rr W 16 16 16 16 rr 3 r 3 A 3 16 QRW VLJQLILFDQW D&O YV & YV & YV & YV & YV & YV ,Q WKH FKRULRDOODQWRLV H[SUHVVLRQ RI 275 3*+6 3*(6 DQG 3*)6 GLG QRW GLIIHU EHWZHHQ GD\V DQG 7DEOH f $ VOLJKW GLIIHUHQFH LQ 275 P51$ H[SUHVVLRQ ZDV GHWHFWHG ZLWK DYHUDJH H[SUHVVLRQ EHLQJ JUHDWHU IRU GD\ WKDQ GD\ +RZHYHU WKLV LV UDWKHU D VXEWOH GLIIHUHQFH DQG RYHUDOO H[SUHVVLRQ ZDV ORZ

PAGE 105

P51$ $UELWUDU\ XQLWVf $ % 'D\ RI 3UHJQDQF\ )LJ 5HJUHVVLRQ FXUYHV IRU 275 f P51$ [ f 3*)6 ‘f 3DQHO $f DQG 3*+6 ‘f 3*(6 ff 3DQHO %f P51$ H[SUHVVLRQ LQ LQWHUFDUXQFXODU HQGRPHWULXP RI EHHI FRZV IURP GD\V WR RI SUHJQDQF\ 'DWD UHSUHVHQW OHDVW VTXDUHV PHDQV

PAGE 106

7DEOH /HDVW VTXDUHV PHDQV IRU 275 3*+6 3*(6 DQG 3*)6 P51$ LQ FKRULRDOODQWRLV RI EHHI FRZV IURP GD\V WR RI SUHJQDQF\ 5HVSRQVH 'D\V RI 3UHJQDQF\ 6(0 &RQWUDVWV D ' &O & 275 r 16 3*+6 16 16 3*(6 16 16 3*)6 16 16 rr 3 r 3 I 3 16 QRW VLJQLILFDQW f &O YV & YV ([SUHVVLRQ RI 275 DQG 3*+6 P51$ LQ &DUXQFXODU (QGRPHWULXP 5HVXOWV FRPSDULQJ F\FOLF DQG SUHJQDQW FRZV IURP GD\V WR DUH VKRZQ LQ 7DEOH ,Q F\FOLF DQLPDOV 275 P51$ ZDV H[SUHVVHG KLJKO\ RQ GD\ RI WKH F\FOH EXW WKLV DPSOLILFDWLRQ LQ H[SUHVVLRQ ZDV EORFNHG RU GLG QRW RFFXU LQ SUHJQDQW FRZV 3 f 3UHVHQFH RI WKH FRQFHSWDV KDG DQ LQKLELWRU\ HIIHFW RQ WKH H[SUHVVLRQ RI 275 P51$ LQ WKH FDUXQFXODU HQGRPHWULXP 7KLV OHDG WR WKH REVHUYHG VWDWXV E\ YHUVXV LQWHUDFWLRQ 3 f WKDW LV GHSLFWHG LQ )LJ $ ([SUHVVLRQ RI 3*+6 P51$ LQFUHDVHG IURP GD\ WR GD\V 3 f IRU ERWK F\FOLF DQG SUHJQDQW FRZV +RZHYHU WKH DYHUDJH LQFUHDVH IRU GD\V DQG ZDV JUHDWHU IRU SUHJQDQW FRZV WKDQ IRU F\FOLF FRZV 3 f 7KHVH FKDQJHV DUH GHSLFWHG LQ )LJXUH % DQG DUH GXH WR D VXVWDLQHG LQFUHDVH LQ 3*+6 P51$ H[SUHVVLRQ LQ SUHJQDQF\ +RZHYHU WKH VWDWXV [ GD\ LQWHUDFWLRQ ZDV QRW VLJQLILFDQW

PAGE 107

7DEOH /HDVW VTXDUHV PHDQV IRU 275 DQG 3*+6 P51$ LQ FDUXQFXODU HQGRPHWULXP RI EHHI FRZV IURP GD\V WR RI WKH HVWURXV F\FOH RU SUHJQDQF\ &\FOLF 3UHJQDQW &RQWUDVWV f 5HVSRQVH ' ' ' 6(0 &O & & &O[ & 275 W 16 r 16 r 3*+6 16 rr 16 rr 16 rr 3 r 3 3 16 QRW VLJQLILFDQW D&O &\FOH YV 3UHJQDQW & YV & YV ,Q WKH FDUXQFXODU HQGRPHWULXP RI F\FOLF FRZV 275 P51$ ZDV VLJQLILFDQWO\ KLJKHU RQ '2 DQG YHUVXV WKH HDUO\ OXWHDO DQG PLGOXWHDO GD\V RI WKH HVWURXV F\FOH GD\V DQG 7DEOH f 1R GLIIHUHQFHV ZHUH REVHUYHG EHWZHHQ YHUVXV DQG 7KHVH FKDQJHV SDUDOOHOHG WKH UHVSRQVH IRU LQWHUFDUXQFXODU HQGRPHWULXP 7DEOH f $V UHSRUWHG IRU LQWHUFDUXQFXODU HQGRPHWULXP 7DEOH f 3*+6 P51$ LQFUHDVHG GUDPDWLFDOO\ RQ GD\V DQG 3 f DQG ZDV ORZ DW HVWUXV 7DEOH f 7DEOH /HDVW VTXDUHV PHDQV IRU 275 DQG 3*+6 P51$ LQ FDUXQFXODU HQGRPHWULXP RI EHHI FRZV IURP GD\V WR RI WKH HVWURXV F\FOH 'D\V RI WKH (VWURXV &\FOH &RQWUDVWV D 5HVSRQVH '2 ' ' 6(0 &O & & & 275 rr W 16 r 3*+6 rr rr rr 16 rr 3 r 3 I 3 16 QRW VLJQLILFDQW D&O YV DQG & YV & YV' DQG & YV' S Q

PAGE 108

3*+6 P51$ 275 P51$ $UELWUDU\ XQLWV UHODWLYH WR 6 U1$f $UELWUDU\ XQLWV UHODWLYH WR 6 U51$f 'D\ RI &\FOH RU 3UHJQDQF\ )LJ 275 DQG 3*+6 P51$ FRQFHQWUDWLRQV LQ FDUXQFXODU HQGRPHWULXP RI EHHI FRZV $f &\FOLF3UHJQDQW E\ 'D\ LQWHUDFWLRQ 3 f IRU 275 DQG %f 'D\ 3 f IRU 3*+6 'DWD UHSUHVHQWV OHDVW VTXDUHV PHDQV s 6(0 UHODWLYH FRQFHQWUDWLRQ WR 6 U51$

PAGE 109

:KHQ H[DPLQLQJ WKH WHPSRUDO H[SUHVVLRQ RI 275 P51$ RI FDUXQFXODU HQGRPHWULXP WKURXJKRXW SUHJQDQF\ IURP GD\ WR GD\ 275 P51$ H[SUHVVLRQ LQFUHDVHG DIWHU GD\ 3 7DEOH f 7KH G\QDPLF EXW GLVWLQFW FKDQJHV LQ 275 P51$ DQG 3*+6 P51$ H[SUHVVLRQ DUH UHIOHFWHG E\ UHJUHVVLRQ FXUYHV GXULQJ WKH HVWURXV F\FOH )LJ $ DQG %f $ WUDQVLWLRQDO SDWWHUQ 3 f LQ 3*+6 P51$ H[SUHVVLRQ ZDV GHWHFWHG ZLWK DQ LQFUHDVH LQ FDUXQFXODU H[SUHVVLRQ IURP GD\ WR GD\ IROORZHG E\ D GHFUHDVH LQ H[SUHVVLRQ GXULQJ WKH SHULRG RI WR GD\V RI SUHJQDQF\ 7DEOH f 7KLV WHPSRUDO SDWWHUQ LV UHIOHFWHG E\ WKH FXUYLOLQHDU UHJUHVVLRQ GHSLFWHG LQ )LJ IRU 3*+6 7KHUH ZDV DQ LQFUHDVH LQ 3*+6 P51$ IURP GD\V WR DQG IROORZHG ODWHU E\ D GHFUHDVH DV SUHJQDQF\ DGYDQFHG 7DEOH /HDVW VTXDUHV PHDQV IRU 275 3*+6 3*(6 DQG 3*)6 P51$ LQ FDUXQFXODU HQGRPHWULXP RI EHHI FRZV IURP GD\V WR RI SUHJQDQF\ 'D\V RI 3UHJQDQF\ &RQWUDVWVD 5HVSRQVH ' ' ' 6(0 &O & & & & & 275 rr rr rr W 16 16 3*+6 rr rr rr W 16 16 rr 3 r 3 3 16 QRW VLJQLILFDQW D&O YV & YV' & YV & YV & YV & YV

PAGE 110

3*+6 P51$ 275 P51$ $UELWUDU\ XQLWVf $UELWUDU\ XQLWVf 'D\ RI &\FOH )LJ $f 5HJUHVVLRQ FXUYH IRU 275 DQG %f 3*+6 P51$ H[SUHVVLRQ LQ FDUXQFXODU HQGRPHWULXP RI EHHI FRZV IURP GD\V HVWUXVf WR RI WKH HVWURXV F\FOH 'DWD UHSUHVHQW OHDVW VTXDUHV PHDQV

PAGE 111

% nF Lf§ T ] D 'D\ RI 3UHJQDQF\ )LJ 5HJUHVVLRQ FXUYHV IRU 275 f P51$ [ f DQG 3*+6 ‘f P51$ LQ FDUXQFXODU HQGRPHWULXP RI EHHI FRZV IURP GD\V WR RI SUHJQDQF\ 'DWD UHSUHVHQW OHDVW VTXDUHV PHDQV &RUUHODWLRQV EHWZHHQ WKH GLIIHUHQW P51$V 'XULQJ WKH HVWURXV F\FOH 275 P51$ DQG 3*(6 P51$ LQ LQWHUFDUXQFXODU HQGRPHWULXP ZHUH SRVLWLYHO\ FRUUHODWHG DQG WKLV UHODWLRQVKLS ZDV HYLGHQW DIWHU DGMXVWLQJ IRU GD\V RI WKH HVWURXV F\FOH 7DEOH f 7KXV WKH\ DUH SRVLWLYHO\ DVVRFLDWHG GXULQJ SHULRGV RI HOHYDWHG H[SUHVVLRQ RU UHGXFHG H[SUHVVLRQ ,Q FRQWUDVW SRVLWLYH FRUUHODWLRQV IRU 2753*)6 DQG 3*(63*)6 ZHUH RQO\ GHWHFWHG DIWHU DGMXVWLQJ IRU GD\ RI WKH HVWURXV F\FOH 7DEOH f 7KLV LQGLFDWHV D FRUHJXODWHG H[SUHVVLRQ WKDW GRHV QRW DSSHDU WR EH UHVSRQVLYH WR VWDJHV RI WKH HVWURXV F\FOH ZKHUH H[SUHVVLRQ RI RQH RU WKH RWKHU LV DPSOLILHG $FURVV GD\V DQG f RI SUHJQDQF\ RU WKH HVWURXV F\FOH D SRVLWLYH FRUUHODWLRQ ZDV REVHUYHG EHWZHHQ 275 DQG 3*(6 ZKHWKHU FDOFXODWHG DV D VLPSOH FRUUHODWLRQ 7DEOH f RU DV D SDUWLDO FRUUHODWLRQ 7DEOH f 7KLV UHVXOW LV LQGLFDWLYH RI MRLQW FRH[SUHVVLRQ RI 275 P51$ DQG 3*(6 P51$ DQG FRUHJXODWLRQ LQ UHVSRQVH WR SK\VLRORJLFDO DQGRU KRUPRQH IXQFWLRQ DVVRFLDWHG ZLWK GD\ DQG SUHJQDQF\ VWDWXV F\FOH YHUVXV SUHJQDQF\f 3DUWLDO FRUUHODWLRQV EXW QRW VLPSOH FRUUHODWLRQV ZHUH VLJQLILFDQW IRU

PAGE 112

2753*)6 DQG 3*(63*)6 7DEOH f 7KHVH UHVSRQVHV LPSO\ D FRUHJXODWHG H[SUHVVLRQ WKDW LV RQO\ GHSHQGHQW RQ GD\ RI F\FOH RU SUHJQDQF\ 7DEOH &RUUHODWLRQV EHWZHHQ P51$V IRU 275 3*(6 3*+6 DQG 3*)6 LQ LQWHUFDUXQFXODU HQGRPHWULXP RI EHHI FRZV RQ GD\V DQG RI WKH HVWURXV F\FOH 6LPSOH &RUUHODWLRQV 3DUWLDO &RUUHODWLRQV D U 3 U 3 2753*(6 2753*)6 2753*+6 3*+63*(6 3*+63*)6 3*(63*)6 D &RUUHODWLRQV DGMXVWHG IRU GD\ RI F\FOH 7DEOH &RUUHODWLRQV EHWZHHQ P51$V IRU 275 3*(6 3*+6 DQG 3*)6 LQ LQWHUFDUXQFXODU HQGRPHWULXP RI EHHI FRZV RQ GD\V DQG RI WKH HVWURXV F\FOH RU SUHJQDQF\ 6LPQOH &RUUHODWLRQV 3DUWLDO &RUUHODWLRQV D U 3 U 3 2753*(6 2753*)6 2753*+6 3*+63*(6 3*+63*)6 3*(63*)6 &RUUHODWLRQV DGMXVWHG IRU ERWK GD\ DQG SUHJQDQF\ VWDWXV

PAGE 113

,PPXQRKLVWRFKHPLFDO /RFDOL]DWLRQ RI 275 DQG 3*+6 'XULQJ WKH (VWURXV &\FOH DQG 3UHJQDQF\ ,PPXQRKLVWRFKHPLVWU\ ZDV XVHG WR LGHQWLI\ WKH H[SUHVVLRQ RI 275 SURWHLQ )LJ DQG f DQG 3*+6 SURWHLQ )LJ DQG f LQ WKH LQWHUFDUXQFXODU HQGRPHWULXP RI F\FOLF GD\V DQG f DQG SUHJQDQW FRZV GD\V DQG f 8WHULQH VHFWLRQV IURP GD\ HVWUXV FRZVf VKRZHG LQWHQVH SRVLWLYH LPPXQRVWDLQLQJ IRU 275 SURWHLQ )LJ $f FRPSDUHG WR FRQWURO VHFWLRQV ZKHUH QR SULPDU\ DQWLERG\ KDG EHHQ DGGHG )LJ %f ,QWHQVH VWDLQLQJ IRU LPPXQRUHDFWLYH 275 ZDV ORFDOL]HG SULPDULO\ LQ WKH OXPLQDO HSLWKHOLXP /(f ZLWK OHVV VWDLQLQJ LQ WKH HSLWKHOLXP RI VXSHUILFLDO JODQGV *(f 1R VWDLQLQJ ZDV REVHUYHG LQ WKH VWURPD 7KH OLWWOH VWDLQLQJ WKDW ZDV REVHUYHG RQ GD\V DQG ZDV ORFDOL]HG LQ WKH /( )LJ & DQG 'f ,QWHQVH SRVLWLYH VWDLQLQJ ZDV REVHUYHG LQ WKH /( RQ GD\ )LJ (f ,Q GD\ F\FOLF FRZV LPPXQRUHDFWLYH 275 ZDV REVHUYHG LQ WKH /( DQG *( DOWKRXJK WKH LQWHQVLW\ RI VWDLQLQJ ZDV OHVV WKDQ WKDW REVHUYHG DW HVWUXV 'XULQJ SUHJQDQF\ QR SRVLWLYH LPPXQRVWDLQLQJ IRU 275 SURWHLQ ZDV REVHUYHG RQ GD\V DQG )LJ f )RU 3*+6 XWHULQH VHFWLRQV IURP FRZV RQ GD\V HVWUXVf DQG VKRZHG LQWHQVH SRVLWLYH VWDLQLQJ IRU LPPXQRUHDFWLYH 3*+6 SURWHLQ DQG WKH VWDLQLQJ ZDV ORFDOL]HG LQ WKH OXPLQDO HSLWKHOLDO FHOOV DQG VXSHUILFLDO JODQGXODU HSLWKHOLXP )LJ $f 7KH LQWHQVLW\ RI SRVLWLYH VWDLQLQJ IRU 3*+6 SURWHLQ ZDV ORZ LQ WKH OXPLQDO HSLWKHOLXP RI FRZV RQ GD\V DQG )LJ & DQG 'f ZLWK QR SRVLWLYH VWDLQLQJ REVHUYHG LQ WKH JODQGXODU HSLWKHOLXP DV ZHOO DV WKH VWURPD 'XULQJ SUHJQDQF\ QR SRVLWLYH VWDLQLQJ IRU 3*+6 SURWHLQ ZDV VHHQ LQ WKH OXPLQDO HSLWKHOLXP RQ GD\V )LJ $f DQG )LJ %f ZKHUHDV WKHUH ZDV LQFUHDVHG SRVLWLYH VWDLQLQJ IRU 3*+6 SURWHLQ RQ GD\V

PAGE 114

)LJ &f DQG )LJ 'f 3RVLWLYH LPPXQRVWDLQLQJ ZDV DOVR REVHUYHG LQ GD\ FRZV EXW LQ WKLV FDVH LW ZDV SUHGRPLQDQWO\ LQ WKH OXPLQDO HSLWKHOLXP )LJ 'f 3RVLWLYH VWDLQLQJ REVHUYHG LQ GD\ FRZV )LJ (f ZDV OHVV LQWHQVH WKDQ WKDW VHHQ RQ GD\V DQG 7KHUH ZDV QRW VXIILFLHQW UHSOLFDWLRQ RI WKH LPPXQRKLVWRFKHPLFDO UHVSRQVHV LH RQH FRZ SHU SK\VLRORJLFDO VWDJHf WR TXDQWLI\ WHPSRUDO DQG VSDWLDO GLIIHUHQFHV LQ 275 DQG 3*+6 SURWHLQ DVVRFLDWHG ZLWK SUHJQDQF\ VWDWXV RU GD\V FKDUDFWHUL]HG )ORZHYHU WKH UHVSRQVHV GHSLFWHG IRU H[SUHVVLRQ VXSSRUW WKH TXDQWLWDWLYH FKDQJHV GHWHUPLQHG IRU H[SUHVVLRQ RI 275 P51$ DQG 3*)6 P51$

PAGE 115

)LJ ,PPXQRKLVWRFKHPLFDO VWDLQLQJ RI ERYLQH 275 LQ UHSUHVHQWDWLYH VHFWLRQV RI WKH LQWHUFDUXQFXODU HQGRPHWULXP GXULQJ WKH HVWURXV F\FOH 7LVVXHV ZHUH FROOHFWHG IL[HG VHFWLRQHG DQG VWDLQHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV $ GD\ HVWUXVf % GD\ QHJDWLYH FRQWURO & GD\ f GD\ f ( GD\ f DQG ) GD\ f /( OXPLQDO HSLWKHOLXP *( JODQGXODU HSLWKHOLXP 6( VWURPD $UURZV LQGLFDWH SRVLWLYH EURZQf LPPXQRVWDLQLQJ IRU WKH 275 SURWHLQ 3KRWRPLFURJUDSKV ZHUH WDNHQ DW ; PDJQLILFDWLRQ

PAGE 117

)LJ ,PPXQRKLVWRFKHPLFDO VWDLQLQJ RI ERYLQH 275 LQ UHSUHVHQWDWLYH VHFWLRQV RI WKH LQWHUFDUXQFXODU HQGRPHWULXP GXULQJ WKH SHULLPSODQWDWLRQ SHULRG 7LVVXHV ZHUH FROOHFWHG IL[HG DQG VWDLQHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV $ GD\ f % GD\ f & GD\ f GD\ f DQG ( GD\ f /( OXPLQDO HSLWKHOLXP *( JODQGXODU HSLWKHOLXP 6( VWURPD $UURZV LQGLFDWH SRVLWLYH EURZQf LPPXQRVWDLQLQJ IRU WKH 275 SURWHLQ 3KRWRPLFURJUDSKV ZHUH WDNHQ DW ; PDJQLILFDWLRQ

PAGE 118

Y ( 67 ‘ t 9Ln Y /( n7 ? U9 I r

PAGE 119

)LJ ,PPXQRKLVWRFKHPLFDO VWDLQLQJ RI ERYLQH 3*+6 LQ UHSUHVHQWDWLYH VHFWLRQV RI WKH LQWHUFDUXQFXODU HQGRPHWULXP GXULQJ WKH HVWURXV F\FOH 7LVVXHV ZHUH FROOHFWHG IL[HG VHFWLRQHG DQG VWDLQHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV $ GD\ HVWUXVf % GD\ QHJDWLYH FRQWURO & GD\ f GD\ f ( GD\ f DQG ) GD\ f /( OXPLQDO HSLWKHOLXP *( JODQGXODU HSLWKHOLXP 6( VWURPD $UURZV LQGLFDWH SRVLWLYH EURZQf LPPXQRVWDLQLQJ IRU WKH 3*+6 SURWHLQ 3KRWRPLFURJUDSKV ZHUH WDNHQ DW ; PDJQLILFDWLRQ

PAGE 121

)LJ ,PPXQRKLVWRFKHPLFDO VWDLQLQJ RI ERYLQH 3*+6 LQ UHSUHVHQWDWLYH VHFWLRQV RI WKH LQWHUFDUXQFXODU HQGRPHWULXP GXULQJ WKH SHULLPSODQWDWLRQ SHULRG 7LVVXHV ZHUH FROOHFWHG IL[HG VHFWLRQHG DQG VWDLQHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV $ GD\ f % GD\ f & GD\ f GD\ f ( GD\ f DQG ) GD\ f /( OXPLQDO HSLWKHOLXP *( JODQGXODU HSLWKHOLXP 6( VWURPD $UURZV LQGLFDWH SRVLWLYH EURZQf LPPXQRVWDLQLQJ IRU WKH 3*+6 SURWHLQ 3KRWRPLFURJUDSKV ZHUH WDNHQ DW ; PDJQLILFDWLRQ

PAGE 123

'LVFXVVLRQ 2[\WRFLQ UHFHSWRU P51$ LV UHODWLYHO\ VSDUVH LQ ERYLQH WLVVXHV EXW KDV EHHQ PHDVXUHG E\ 51$VH SURWHFWLRQ DVVD\V 53$f DQG 573&5 ,YHOO HW DO )XFKV HW DO Df 8VLQJ 53$ ,YHOO HW DO f REVHUYHG KLJK H[SUHVVLRQ RI 275 LQ HQGRPHWULXP DW HVWUXV DQG ORZ H[SUHVVLRQ RQ GD\ RI WKH F\FOH LQ FRZV ,Q WKH SUHVHQW VWXG\ WKH KLJKHVW H[SUHVVLRQ RI 275 P51$ ZDV REVHUYHG DW HVWUXV DQG GD\ RI WKH HVWURXV F\FOH 1R VLJQLILFDQW GLIIHUHQFH ZDV REVHUYHG LQ WKH H[SUHVVLRQ RI 275 P51$ EHWZHHQ WKHVH LQWHUYHQLQJ GD\V RI WKH OXWHDO SKDVH $QLPDOV LQ WKH GD\ JURXS ZHUH LQ SURHVWUXV DQG ZRXOG DFFRXQW IRU H[SUHVVLRQ EHLQJ WKH VDPH DV GD\ RI HVWUXV 2[\WRFLQ UHFHSWRUV ZHUH KLJKO\ H[SUHVVHG GXULQJ HVWUXV DW D WLPH ZKHQ WKHUH DUH KLJK FRQFHQWUDWLRQV RI SODVPD HVWUDGLRO DQG HQGRPHWULDO HVWURJHQ UHFHSWRUV 2[\WRFLQ UHFHSWRUV VHHP WR EH FRQVWLWXWLYHO\ H[SUHVVHG LQ WKH ERYLQH HQGRPHWULXP DQG EHFRPH XSUHJXODWHG HVSHFLDOO\ GXULQJ HVWUXV DQG DW SDUWXULWLRQ )XFKV HW DO +RUQ HW DO f +RZHYHU WKH UROH RI HVWUDGLRO LQ VWLPXODWLQJ 275 XSUHJXODWLRQ LQ FDWWOH KDV QRW EHHQ SURYHQ $OWKRXJK WKHUH DUH KDOIHVWURJHQ UHVSRQVH HOHPHQWV LQ WKH ERYLQH 275 WKH\ DUH QRW UHVSRQVLYH WR HVWURJHQ %DOH DQG 'RUVD f ,QGLUHFW HIIHFWV RI HVWUDGLRO RQ WKH 275 PD\ EH D SRVVLELOLW\ YLD SURWHLQSURWHLQ LQWHUDFWLRQV ZLWK WUDQVFULSWLRQ IDFWRUV DQG PRGXODWLRQ RI WKH DFWLYLW\ RI XSVWUHDP VLJQDOLQJ FRPSRQHQWV RQ WKH 275 6DQFKH] HW DO f ,W KDV EHHQ VKRZQ LQ YLWUR WKDW OLJDQGHG (5D ELQGV WKH RYLQH 275 YLD 6SO DQG $3 WUDQVFULSWLRQ IDFWRUV %D]HU HW DO f )RU WKH ERYLQH 275 WKH FRIDFWRUV VWHURLG UHFHSWRU FRDFWLYDWRU DFWLYDWRU 65&f DQG &5(% ELQGLQJ SURWHLQ &%3f ZHUH VKRZQ WR

PAGE 124

LQGXFH 275 UHSRUWHU DFWLYLW\ LQ YLWUR ZKHQ VWLPXODWHG E\ HVWUDGLRO 7HOJPDQQ HW DO f 7KH ORZHVW H[SUHVVLRQ IRU 275 P51$ ZDV REVHUYHG GXULQJ WKH OXWHDO SKDVH HVSHFLDOO\ RQ GD\V DQG RI WKH HVWURXV F\FOH ZKLFK LV LQ DJUHHPHQW ZLWK WKRVH RI 5RELQVRQ HW DO f IRU 275 P51$ DQG ZLWK RWKHUV ZKR XVHG 27 ELQGLQJ LH SURWHLQ ELQGLQJf VWXGLHV WR HYDOXDWH 275 H[SUHVVLRQ LQ WKH ERYLQH HQGRPHWULXP 0H\HU HW DO )XFKV HW DO -HQQHU HW DO 0DQQ DQG /DPPLQJ &HUELWR HW DO f 2[\WRFLQ UHFHSWRU P51$ FRQFHQWUDWLRQV ZHUH ORZHVW RQ GD\V DQG DQG KLJKHVW RQ GD\V DQG 6LPLODUO\ D VWXG\ FRQGXFWHG LQ VKHHS VKRZHG WKDW 275 P51$ H[SUHVVLRQ ZDV KLJKHVW LQ WKH HQGRPHWULXP DW HVWUXV FRPSDUHG WR GD\V DQG RI WKH F\FOH )HQJ HW DO f 2XU UHVXOWV GLIIHU IURP WKRVH RI 5RELQVRQ HW DO f LQ WKDW WKH\ GHWHFWHG QR 275 P51$ EHWZHHQ GD\V DQG RI WKH HVWURXV F\FOH DQG HDUO\ SUHJQDQF\ 7KH GLIIHUHQFH PD\ EH GXH WR WKH VHQVLWLYLW\ RI 5HDO 7LPH 573&5 ZKLFK LV PRUH VHQVLWLYH WKDQ WKH LQ VLWX K\EULGL]DWLRQ XVHG E\ 5RELQVRQ HW DO f 2[\WRFLQ UHFHSWRU P51$ EHFDPH XSUHJXODWHG DIWHU GD\ RI WKH F\FOH 7KLV LV WKH GD\ FRQFHQWUDWLRQV RI SURJHVWHURQH VWDUW WR GHFOLQH LQ F\FOLF FRZV DQG PD\ DFW DV D VLJQDO IRU XSUHJXODWLRQ RI 275 5RELQVRQ HW DO f 0DQQ HW DO f UHSRUWHG WKDW 275 XSUHJXODWLRQ RFFXUV DW GD\V DIWHU HVWUXV DW D WLPH ZKHQ D IDOO LQ SURJHVWHURQH DQG D ULVH LQ HVWUDGLRO KDYH QRW \HW RFFXUUHG ([SUHVVLRQ RI 275 P51$ ZDV ORZ IURP GD\V WR RI SUHJQDQF\ ZKLFK PD\ EH GXH WR VXSSUHVVLRQ E\ SURJHVWHURQH DFWLQJ YLD SURJHVWHURQH UHFHSWRUV WKDW DUH LQ KLJK FRQFHQWUDWLRQV LQ WKH VWURPD DW WKLV WLPH 5RELQVRQ HW DO f 3URJHVWHURQH KDV EHHQ

PAGE 125

VKRZQ WR VXSSUHVV 275 LQ RYDULHFWRPL]HG FRZV /DPPLQJ DQG 0DQQ f DQG VKHHS 9DOOHW HW DO :DWKHV HW DO f +RZHYHU WKHVH DFWLRQV PD\ EH QRQJHQRPLF VLQFH WKHUH LV QR SURJHVWHURQH UHVSRQVH HOHPHQW RQ WKH ERYLQH 275 %DWKJDWH HW DO f 7KH LQKLELWLRQ RI 275 P51$ H[SUHVVLRQ PD\ DOVR EH GXH WR WKH DFWLRQ RI ,)1W /DPPLQJ HW DO f 7KH SUHVHQW VWXG\ DOVR UHYHDOHG WKDW E\ GD\ RI SUHJQDQF\ WKH 275 P51$ H[SUHVVLRQ KDG VWDUWHG WR LQFUHDVH ZKLFK PD\ EH GXH WR GHFUHDVHG VHFUHWLRQ RI ,)1W 7KLV PHDQV WKDW WKH 275 EHJLQV WR EH UHHVWDEOLVKHG DIWHU WKH SHULRG RI PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ 8SUHJXODWLRQ RI 275 P51$ LQ ERWK WKH FDUXQFXODU DQG LQWHUFDUXQFXODU HQGRPHWULXP ZDV GHWHFWHG HDUOLHU WKDQ GD\ ZKHUHDV DV RWKHUV KDYH UHSRUWHG WKDW 275 P51$ DQG 27ELQGLQJ LQ LQWHUFDUXQFXODU HQGRPHWULXP EHJLQ WR EH XSUHJXODWHG E\ GD\ RI SUHJQDQF\ )XFKV HW DO ,YHOO HW DO f 7KLV HDUO\ GHWHFWLRQ RI WKH 275 P51$ PD\ EH GXH WR WKH VHQVLWLYLW\ RI WKH 5HDO 7LPH 57 3&5 WHFKQLTXH XVHG IRU TXDQWLWDWLRQ +RZHYHU WKHVH UHVXOWV GLIIHU IURP WKRVH RI )XFKV HW DO f ZKR UHSRUWHG WKDW 275 ZHUH QRW H[SUHVVHG LQ WKH FDUXQFXODU HQGRPHWULXP RI SHUL LPSODQWDWLRQ FRZV 2[\WRFLQ DOVR SUHIHUHQWLDOO\ VWLPXODWHV V\QWKHVLV RI 3*)D LQ HSLWKHOLDO FHOOV IURP LQWHUFDUXQFXODU UDWKHU WKDQ FDUXQFXODU DUHDV ERWK LQ YLWUR $VVHOLQ HW DO f DQG LQ YLYR 3H[WRQ HW DO f ,Q WKH SUHVHQW VWXG\ QR GLIIHUHQFH ZDV REVHUYHG LQ WKH H[SUHVVLRQ RI 275 P51$ EHWZHHQ WKH FDUXQFXODU DQG LQWHUFDUXQFXODU HQGRPHWULXP %DODJXHU HW DO f UHSRUWHG DQ LQFUHDVHG UHVSRQVH WR 27LQGXFHG 3*)D ZLWK UHVXOWDQW LQFUHDVHV LQ 3*)0 IURP GD\V WR RI SUHJQDQF\ +RZHYHU *URVV HW DO Ef GLG QRW REVHUYH LQFUHDVHG 3*)f LQ HQGRPHWULXP IURP GD\ SUHJQDQW FRZV ZKHQ WKH\ ZHUH WUHDWHG ZLWK 27 7KH GLIIHUHQFH LQ WKHVH UHVXOWV PD\ EH GXH WR WKH IDFW

PAGE 126

WKDW WKH\ ZHUH GRQH RQ GLIIHUHQW GD\V DQG XQGHU GLIIHUHQW FRQGLWLRQV LQ YLYR YV LQ YLWURf +RZHYHU WKH UHODWLYHO\ ORZ H[SUHVVLRQ RI 275 P51$ REVHUYHG LQ WKH SUHVHQW VWXG\ ZRXOG WHQG WR VXJJHVW WKDW WKH 275 PD\ QRW EH IXQFWLRQDOO\ FRXSOHG WR WKH SURVWDJODQGLQ V\QWKHVLV LQ HDUO\ SUHJQDQF\ WKURXJK GD\ 7KH ORZ OHYHOV RI 275 P51$ LQ WKH FDUXQFXODU DQG LQWHUFDUXQFXODU HQGRPHWULXP IURP GD\V WR RI SUHJQDQF\ DUH EHOLHYHG WR EH GXH WR WKH VXSSUHVVLYH HIIHFW RI ,)1[ WKDW LV SURGXFHG E\ WKH FRQFHSWRV ,QWHUIHURQ7 KDV EHHQ VKRZQ WR LQKLELW H[SUHVVLRQ RI 275 LQ YLYR 6SHQFHU DQG %D]HU f DQG LQ YLWUR +RUQ HW DO /HXQJ HW DO f ,QWHUIHURQ7 GRZQUHJXODWHV HQGRPHWULDO 275 P51$ E\ LQWHUIHULQJ ZLWK WKH HQGRFULQH ORRS E\ ZKLFK 27 VWLPXODWHV 3*)f VHFUHWLRQ IURP WKH HQGRPHWULXP ,YHOO HW DK f ,QWHUIHURQ7 LV EHOLHYHG WR DFW YLD WKH LQWHUIHURQ W\SH UHFHSWRU WR VXSSUHVV 275 H[SUHVVLRQ 5RELQVRQ HW DK f %RYLQH 275 KDV LQWHUIHURQ UHVSRQVH HOHPHQWV ZKLFK FDQ ELQG ,)1W %DWKJDWH HW DK f $ SXWDWLYH LQWHUIHURQ UHVSRQVLYH HOHPHQW ,5(f DSSUR[LPDWHO\ IURP WKH WUDQVFULSWLRQ VLWH RI WKH ERYLQH 275 KDV EHHQ VKRZQ WR ELQG PRXVH LQWHUIHURQ UHVSRQVH IDFWRU ,5)f DQG ,5) %RYLQH ,5) DQG ,5) DUH DOVR H[SUHVVHG LQ D WHPSRUDO SDWWHUQ VXJJHVWLQJ WKH UROH RI ,)1W LQ WKH UHJXODWLRQ RI 275 H[SUHVVLRQ GXULQJ WKH SHULLPSODQWDWLRQ SHULRG 7HOJPDQQ HW DK f 2[\WRFLQ UHFHSWRU P51$ H[SUHVVLRQ LQ SUHJQDQW DQLPDOV LV VXSSUHVVHG E\ WKH SUHVHQFH RI WKH HPEU\R DQG WKLV LQKLELWLRQ KDV EHHQ VKRZQ WR EH LQGHSHQGHQW RI D SULRU GHFUHDVH LQ XWHULQH HVWURJHQ UHFHSWRU H[SUHVVLRQ RU PDLQWHQDQFH RI SURJHVWHURQH UHFHSWRU H[SUHVVLRQ 5RELQVRQ HW DK f 7KH VXEWOH LQFUHDVH LQ H[SUHVVLRQ RI 275 P51$ REVHUYHG EHWZHHQ GD\ DQG RI SUHJQDQF\ PD\ EH GXH WR UHGXFHG VHFUHWLRQ RI ,)1W 7KLV PHDQV WKDW RQFH ,)1W VHFUHWLRQ ZDQHV WKHUH LV UHVXPSWLRQ RI H[SUHVVLRQ RI 275 P51$ DQG DIWHU GD\ WKH

PAGE 127

275V DUH FRXSOHG WR WKH SURVWDJODQGLQ V\QWKHVLV PHFKDQLVP )XFKV HW DO Ef 7KH LQKLELWRU\ HIIHFW RI ,)1U RQ 275 P51$ H[SUHVVLRQ LV D GLUHFW HIIHFW RQ WKH 275 JHQH LWVHOI +RUQ HW DK f 7KH FKRULRDOODQWRLV ZDV IRXQG WR H[SUHVV 275 P51$ DOWKRXJK DW D VLJQLILFDQWO\ ORZHU OHYHO 3 f WKDQ REVHUYHG LQ WKH FDUXQFXODU DQG LQWHUFDUXQFXODU HQGRPHWULXP )XFKV HW DK f DQG ,YHOO HW DK f UHSRUWHG ORZ FRQFHQWUDWLRQV RI 275 LQ WKH FKRULRDOODQWRLV RI SUHJQDQW FRZV ,Q WKH SUHVHQW VWXG\ 275 P51$ H[SUHVVLRQ ZDV GHWHFWHG LQ WKH FKRULRDOODQWRLV DV HDUO\ DV GD\ RI SUHJQDQF\ 7KH VLJQLILFDQFH RI 275 P51$ H[SUHVVLRQ LQ WKH FKRULRDOODQWRLV DW WKLV WLPH LV QRW FOHDU )XFKV HW DK f VXJJHVWHG WKDW 27 PD\ KDYH D UROH LQ DQJLRJHQHVLV DQG SURPRWLRQ RI JURZWK RI WKH HPEU\R RU IHWXV ([SUHVVLRQ RI 275 DOVR KDV EHHQ UHSRUWHG LQ KXPDQ YDVFXODU HQGRWKHOLDO FHOOV LVRODWHG IURP WKH XPELOLFDO YHLQ 7KLERQQLHU HW DK f ZKHUH LW ZDV LPSOLFDWHG LQ FHOOXODU SUROLIHUDWLRQ 7KLV HIIHFW RI 27 WR VWLPXODWH FHOO SUROLIHUDWLRQ YLD 275 SUREDEO\ RFFXUV E\ LQFUHDVLQJ LQWUDFHOOXODU FDOFLXP XSWDNH W\URVLQH SKRVSKRU\ODWLRQ DQG DFWLYDWLRQ RI WKH 3.& SDWKZD\ )XFKV HW DK f ,PPXQRKLVWRFKHPLFDO ORFDOL]DWLRQ RI 275 XVLQJ D VSHFLILF DQWL275 DQWLERG\ UHYHDOHG WKDW 275 ZDV SULPDULO\ ORFDOL]HG WR WKH OXPLQDO HSLWKHOLXP RI WKH LQWHUFDUXQFXODU HQGRPHWULXP DQG JODQGXODU HSLWKHOLXP 9HU\ OLWWOH LI DQ\ 275 ZDV ORFDOL]HG LQ WKH VWURPD 7KLV LV H[SHFWHG VLQFH 27LQGXFHG 3*)f RFFXUV SUHGRPLQDQWO\ LQ WKH OXPLQDO HQGRPHWULDO HSLWKHOLDO FHOOV )RUWLHU HW DK f 7KHVH UHVXOWV DUH VLPLODU WR WKRVH RI RWKHUV ZKR UHSRUWHG LPPXQRVWDLQLQJ LQ WKH OXPLQDO HQGRPHWULDO DQG JODQGXODU HSLWKHOLXP RI SUHSXEHUWDO KHLIHUV ZLWK QR LPPXQRORFDOL]DWLRQ LQ WKH VWURPD %DWKJDWH HW DK )XFKV HW DK D Ef ,QWHQVH VWDLQLQJ IRU 275 SURWHLQ ZDV REVHUYHG DW HVWUXV

PAGE 128

ZKLFK ZDV DOVR WKH WLPH RI KLJKHVW 275 P51$ H[SUHVVLRQ :DWKHV DQG /DPPLQJ f UHSRUWHG WKDW DW WKH RQVHW RI OXWHRO\VLV 275 ILUVW DSSHDUHG LQ WKH OXPLQDO HSLWKHOLXP LQFUHDVHG LQ WKH VXSHUILFLDO JODQGV GXULQJ OXWHRO\VLV DQG ZHUH SUHVHQW LQ WKH FDUXQFXODU VWURPD DQG GHHS JODQGV DW HVWUXV 7KLV PD\ H[SODLQ WKH SRVLWLYH LPPXQRVWDLQLQJ REVHUYHG LQ WKH *( DW HVWUXV ZKHUHDV RQ RWKHU GD\V RI WKH F\FOH WKH LPPXQRUHDFWLYLW\ ZDV EDUHO\ GHWHFWHG 7KXV WKHUH DSSHDUV WR EH VWDJH VSHFLILF GD\V WHPSRUDOf DQG VSDWLDO H[SUHVVLRQ WLVVXH W\SHf IRU 275 SURWHLQ ,Q SUHJQDQW FRZV LPPXQRUHDFWLYH 275 ZDV QRW GHWHFWHG GXULQJ WKH GD\V H[DPLQHG LQ WKLV VWXG\ 7KLV PD\ EH D UHIOHFWLRQ RI WKH ORZ OHYHOV RI 275 P51$ H[SUHVVLRQ GXULQJ HDUO\ SUHJQDQF\ ZKLFK LQGLFDWHV WKDW WKH 275 LV UHJXODWHG DW WKH WUDQVFULSWLRQDO OHYHO LQ WKH HQGRPHWULXP 7KHUH LV DOVR WKH SRVVLELOLW\ WKDW WKH VHQVLWLYLW\ RI PHWKRG XVHG IRU GHWHFWLRQ RI WKH 275 SURWHLQ ZDV ORZ ,YHOO HW DO f UHSRUWHG WKDW IHZ LPPXQRSRVLWLYH VWDLQHG FHOOV RFFXU LQ WKH OXPLQDO HSLWKHOLXP LQ SUHJQDQW FRZV DOWKRXJK LPPXQRUHDFWLYLW\ LQFUHDVHV WRZDUGV WHUP ,Q FRQFOXVLRQ ERYLQH 275 P51$ DQG SURWHLQ ZHUH H[SUHVVHG KLJKHVW GXULQJ SURHVWUXV DQG HVWUXV DW D WLPH ZKHQ OXWHRO\VLV LV RFFXUULQJ 7KH LQFUHDVH LQ 275 H[SUHVVLRQ DW WKLV WLPH LV EHOLHYHG WR HQKDQFH WKH SURFHVV RI OXWHRO\VLV ZKHUHE\ 27 VWLPXODWHV 3*)f V\QWKHVLV IURP WKH HQGRPHWULXP DQG FDXVHV VWUXFWXUDO UHJUHVVLRQ RI WKH &/ +RZHYHU GXULQJ WKH SHULLPSODQWDWLRQ SHULRG 275 P51$ ZDV H[SUHVVHG DW YHU\ ORZ OHYHOV ZKLFK PD\ EH GXH WR LQKLELWLRQ E\ SURJHVWHURQH DQG ,)1[ DW WKH WLPH RI PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ $V SUHJQDQF\ DGYDQFHV WKHUH LV DQ LQFUHDVH LQ 275 P51$ EHOLHYHG WR EH GXH WR UHGXFHG LQKLELWLRQ E\ ,)1[ $EVHQFH RI GHWHFWDEOH 275 SURWHLQ GXULQJ WKH SHULLPSODQWDWLRQ SHULRG LV D UHIOHFWLRQ WKDW WKH 275 LV LQKLELWHG DQG PD\ EH WUDQVODWLRQDOO\ UHJXODWHG

PAGE 129

,Q ERWK WKH FDUXQFXODU DQG LQWHUFDUXQFXODU HQGRPHWULXP 3*+6 P51$ ZDV H[SUHVVHG DW ORZ OHYHOV RQ GD\V HVWUXVf DQG DQG DW KLJK OHYHOV RQ GD\V DQG RI WKH F\FOH 2XU UHVXOWV VXSSRUW WKRVH RI $URVK HW DO f ZKR UHSRUWHG ORZ H[SUHVVLRQ RI 3*+6 P51$ DQG SURWHLQ LQ HQGRPHWULXP WDNHQ IURP DEDWWRLU VDPSOHV EHWZHHQ GD\V DQG DQG KLJK OHYHOV EHWZHHQ GD\V DQG RI WKH F\FOH +LJKHVW H[SUHVVLRQ RI 3*+6 RFFXUV DW WKH WLPH RI H[SHFWHG OXWHRO\VLV GD\V f RI WKH F\FOH LQ FRZV $ ELSKDVLF H[SUHVVLRQ RI 3*+6 P51$ ZDV REVHUYHG LQ WKLV VWXG\ VLPLODU WR WKH ILQGLQJV RI $URVK HW DO f DQ LQGLFDWLRQ WKDW 3*+6 LV DQ LQGXFLEOH HQ]\PH LQ ERYLQH HQGRPHWULXP ,QFUHDVHG V\QWKHVLV RI 3*+6 VWDUWLQJ DW GD\ LV QHFHVVDU\ IRU LQLWLDWLRQ RI OXWHRO\VLV ,Q YLYR )XFKV HW DO E %XPV HW DO f DQG LQ YLWUR $VVHOLQ HW DO E ;LDR HW DO f VWXGLHV VKRZ WKDW 27 LQGXFHV 3*+6 P51$ DQG SURWHLQ 7KH LQFUHDVH LQ 3*+6 P51$ LQ FRZV EHJLQQLQJ RQ GD\V DQG LV GXH SDUWO\ WR LQFUHDVHG VHFUHWLRQ RI 27 )XUWKHUPRUH DQ LQFUHDVH LQ 3*+6 ZDV UHSRUWHG WR RFFXU DURXQG OXWHRO\VLV &KDUSLJQ\ HW DO f ,QFUHDVHG 3*+6 WRZDUGV WKH HQG RI WKH F\FOH LQLWLDWHV SXOVHV RI 3*)f ZKLFK RFFXU DW LQWHUYDOV RI WR K GXULQJ OXWHRO\VLV .LQGDKO HW DO f ([SUHVVLRQ RI 3*+6 P51$ LQ WKH FDUXQFXODU HQGRPHWULXP ZDV KLJKHU WKDQ LQ WKH LQWHUFDUXQFXODU HQGRPHWULXP 7KLV LV VLPLODU WR UHVXOWV IURP RWKHU VWXGLHV ZKLFK KDYH DOVR VKRZQ WKDW WKH FDUXQFXODU HQGRPHWULXP H[SUHVVHV PRUH 3*+6 WKDQ WKH LQWHUFDUXQFXODU HQGRPHWULXP +XVOLJ HW DO f *XLOEDXOW HW DOO f VKRZHG WKDW FDUXQFXODU HQGRPHWULDO WLVVXH IURP SRVWSDUWXP GDLU\ FRZV V\QWKHVL]HV PRUH 3*)D DQG 3*)0 WKDQ LQWHUFDUXQFXODU WLVVXH $VVHOLQ HW DO f KRZHYHU VKRZHG LQ YLWUR WKDW WKH

PAGE 130

SURGXFWLRQ RI 3*)D ZDV KLJKHU LQ WKH LQWHUFDUXQFXODU WKDQ LQ WKH FDUXQFXODU HQGRPHWULXP $VVHOLQ HW DO f :KHWKHU KLJK H[SUHVVLRQ RI 3*+6 P51$ LQ WKH FDUXQFXODU HQGRPHWULXP ZRXOG UHVXOW LQ PRUH 3*)D V\QWKHVLV WKDQ E\ WKH LQWHUFDUXQFXODU HQGRPHWULXP FDQQRW EH DVFHUWDLQHG IURP WKLV VWXG\ ,Q SUHJQDQW FRZV WKHUH ZDV ORZ H[SUHVVLRQ RI 3*+6 P51$ RQ GD\ RI SUHJQDQF\ ([SUHVVLRQ LQFUHDVHG DW GD\ DQG ZDV KLJKHVW RQ GD\ IROORZHG E\ D GHFUHDVH XQWLO GD\ $OWKRXJK 3*+6 P51$ LV XSUHJXODWHG GXULQJ WKH WLPH ZKHQ PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ LV H[SHFWHG WR RFFXU WKLV GRHV QRW WUDQVODWH LQWR VHFUHWLRQ RI SXOVDWLOH 3*)D WKDW FDQ OHDG WR OXWHRO\VLV DV RFFXUV LQ F\FOLF FRZV *X]HORJOX HW DO f UHSRUWHG KLJK H[SUHVVLRQ RI 3*+6 SURWHLQ LQ HQGRPHWULXP RI GD\ SUHJQDQW FRZV &KDUSLJQ\ HW DO f REVHUYHG KLJK DQG WUDQVLHQW H[SUHVVLRQ RI 3*+6 LQ RYLQH HQGRPHWULXP GXULQJ HDUO\ SUHJQDQF\ DW WKH WLPH RI PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ 3HUKDSV WKH LQDELOLW\ WR VHFUHWLRQ RI 3*)WO SHDNV LV WKH VXSSUHVVLRQ RI 275 VXFK WKDW WKH 3*)D V\QWKHVLV V\VWHP LV QRW FRXSOHG WR 275 $VVHOLQ HW DO Ff UHSRUWHG WKDW UR,)1[ VWLPXODWHV 3*( DQG XSUHJXODWHV WKH H[SUHVVLRQ RI 3*+6 P51$ LQ ERWK ERYLQH HQGRPHWULDO VWURPDO DQG HSLWKHOLDO FHOOV ,Q YLWUR ,)1W XSUHJXODWHV 3*+6 LQ D GRVH GHSHQGHQW PDQQHU ZLWKLQ WKH SK\VLRORJLFDO UDQJH LQ WKH YLFLQLW\ RI WKH FRQFHSWXV $VVHOLQ HW DO Df ,W KDV EHHQ VKRZQ WKDW PRVW LVRIRUPV RI UEO)1[ VWLPXODWH 3*+6 P51$ DQG SURWHLQ DW D PD[LPDO GRVH RI SJPO 3DUHQW HW DO Df ,Q WKH SUHVHQFH RI 30$ VHYHUDO LVRIRUPV RI ,)1[ UHGXFHG 3*) DQG 3*( V\QWKHVLV LQ ERYLQH HQGRPHWULDO HSLWKHOLDO FHOOV +RZHYHU WKLV HIIHFW ZDV UHYHUVHG DW KLJK FRQFHQWUDWLRQV RI ,)1[ IRU WKRVH LVRIRUPV WKDW LQGXFHG 3*( V\QWKHVLV LQ WKH DEVHQFH RI 30$ 3DUHQW HW DO Df

PAGE 131

,W KDV EHHQ VXJJHVWHG WKDW WKH PHFKDQLVPV OHDGLQJ WR VWLPXODWLRQ RU LQKLELWLRQ RI SURVWDJODQGLQ V\QWKHVLV DW WKH WLPH RI LPSODQWDWLRQ PD\ EH PHGLDWHG E\ GLIIHUHQW W\SHV RU VWDWH RI ,)1U UHFHSWRUV 3DUHQW HW DO Df DQG WKDW WKH GLIIHUHQW LVRIRUPV RI ,)1U PD\ KDYH GLIIHUHQW DIILQLWLHV IRU WKH UHFHSWRU $W ORZ GRVHV RI ,)1W SJf DQ LQKLELWLRQ RI ERWK 3*)D DQG 3*( ZHUH REVHUYHG EXW DW KLJK GRVHV SJPOf SURGXFWLRQ RI 3*( LQ HSLWKHOLDO FHOOV DQG ERWK SURVWDJODQGLQV ZDV LQFUHDVHG LQ WKH VWURPDO FHOOV 3DUHQW HW DO Df 7KDWFKHU HW DO Ef UHSRUWHG WKDW ,)1U DORQH IDLOHG WR LQGXFH 3*(6 DQG 3*+6 P51$ LQ %(1' FHOOV ,Q WKH SUHVHQFH RI SKRUERO GLEXW\UDWH 3G%Xf DQ DFWLYDWRU RI 3.& DQG LQGXFHU RI 3*)D ,1)[ LQKLELWHG WKH VHFUHWLRQ RI 3*)D ,QWHUIHURQ[ GRVHV RI SJ PO VXSSUHVVHG 3G%X VWLPXODWHG3*)D DQG 3*( LQ %(1' FHOOV 7KH\ DWWULEXWHG WKH IDLOXUH RI LQKLELWLRQ DW KLJKHU GRVHV WR WKH GHVHQVLWL]DWLRQ RI ,)1U UHFHSWRU ,Q WKH SUHVHQW VWXG\ 3*(6 P51$ ZDV UHGXFHG LQ SUHJQDQW FRZV ZKHQ FRPSDUHG WR F\FOLF RQ GD\V WR f ZKLFK LV WKH WLPH ZKHQ WKH FRQFHSWXV VHFUHWHV WKH JUHDWHVW DPRXQW RI ,)1U 0RUHRYHU DIWHU GD\ WKH 3*(6 P51$ FRQFHQWUDWLRQV DOVR GLG QRW FKDQJH PXFK LQ SUHJQDQW FRZV 7KLV UHVXOW GRHV QRW VXSSRUW WKH UHVXOWV E\ $VVHOLQ HW DO Ff EXW DJUHHV ZLWK WKRVH RI 7KDWFKHU HW DO Ef RQ WKH HIIHFW RI ,)1U ,W LV LPSRUWDQW WR QRWH WKDW LQ WKLV VWXG\ WKHUH ZDV UHGXFHG 3*)6 P51$ H[SUHVVLRQ DURXQG WKH WLPH RI LPSODQWDWLRQ 7KLV UHGXFWLRQ LV H[SHFWHG WR OHDG WR UHGXFHG V\QWKHVLV RI 3*)D E\ WKH HQGRPHWULXP DQG IDYRU HVWDEOLVKPHQW RI SUHJQDQF\ ;LDR HW DO f UHSRUWHG WKDW ,)1U LQKLELWV V\QWKHVLV RI 3*)6 LQ ERYLQH HQGRPHWULDO HSLWKHOLDO FHOOV $VVHOLQ HW DO f REVHUYHG QR VLJQLILFDQW GLIIHUHQFH LQ WKH OHYHO RI SURVWDJODQGLQ V\QWKHVLV EHWZHHQ FDUXQFXODU DQG LQWHUFDUXQFXODU HSLWKHOLDO FHOOV

PAGE 132

DIWHU ,)1U VWLPXODWLRQ +RZHYHU WKH 3*(3*)D UDWLR ZDV KLJKHU LQ WKH FDUXQFXODU UHJLRQ DQ LQGLFDWLRQ WKDW 3*( LV SUHIHUHQWLDOO\ PRGXODWHG LQ WKH FDUXQFOHV 6LQFH WKHVH DUH WKH SRLQWV ZKHUH WKH IHWDO PHPEUDQHV DWWDFK GXULQJ LPSODQWDWLRQ WKH\ FRQFOXGHG WKDW WKH SUHIHUHQWLDO VHFUHWLRQ RI 3*( LQ WKHVH UHJLRQV PD\ SOD\ D UROH LQ HVWDEOLVKPHQW RI SUHJQDQF\ ,QKLELWLRQ RI 27LQGXFHG 3*) IURP WKH HQGRPHWULXP E\ ,)1U LQ FDWWOH LV YLD GRZQUHJXODWLRQ RI WKH 275 7KLV PD\ EH YLD D PHFKDQLVP LQGHSHQGHQW RI WKH 275 DV GHPRQVWUDWHG LQ %(1' FHOOV ZKLFK GLUHFWO\ LQKLELWV 3.&UHJXODWHG 3*)f SURGXFWLRQ 3*+6 DQG 3/$ H[SUHVVLRQ %LQHOOL HW DK f ,Q WKH SUHVHQW VWXG\ ZH REVHUYHG LQFUHDVHG H[SUHVVLRQ RI 3*+6 GXULQJ WKH SHULRG RI PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ 7KH VLJQLILFDQFH RI WKLV LQFUHDVH PD\ EH WKDW 3*+6 FRXOG EH LQYROYHG LQ RWKHU PHFKDQLVPV WKDW HQKDQFH LPSODQWDWLRQ 'XULQJ WKH HVWURXV F\FOH 3*(6 P51$ ZDV HOHYDWHG RQ GD\V DQG HVWUXV EXW ZDV UHGXFHG RQ FRUUHVSRQGLQJ GD\V RI SUHJQDQF\ 7KH LQFUHDVH LQ HQGRPHWULDO 3*(6 P51$ PD\ SOD\ D UROH DW WKH WLPH RI RYXODWLRQ DQG LQFUHDVHG XWHULQH EORRG IORZ 7KH H[SUHVVLRQ RI 3*+6 P51$ LQ WKH FKRULRDOODQWRLV ZDV KLJKHU WKDQ WKDW REVHUYHG LQ WKH FDUXQFXODU DQG LQWHUFDUXQFXODU HQGRPHWULXP 7KLV PD\ VXJJHVW WKDW WKH FRQFHSWXV PHPEUDQHV PD\ EH D PDMRU VRXUFH RI SURVWDJODQGLQV GXULQJ WKH SHULLPSODQWDWLRQ SHULRG 7KH ERYLQH SODFHQWD FRQVLVWV RI WZR W\SHV RI FHOOV WKH XQLQXFOHDWH SULQFLSDO FHOOV DQG WKH ELQXFOHDWH FHOOV :RRGLQJ f )HWDO SODFHQWDO SULQFLSDO FHOOV DUH WKH SULPDU\ VRXUFH IRU SURVWDJODQGLQ V\QWKHVLV LQ WKH IRUP RI 3*)f ZKLOH WKH ELQXFOHDWH FHOOV VHFUHWH 3*( *URVV DQG :LOOLDPV f 7KH ELQXFOHDWH FHOOV GLIIHUHQWLDWH GXULQJ WKH SHULRG RI LPSODQWDWLRQ %MRUNPDQ f 7RZDUGV SDUWXULWLRQ WKHUH LV D GHFUHDVH LQ WKH QXPEHU RI ELQXFOHDWH FHOOV ZKLFK OHDGV WR D SRVVLEOH VKLIW LQ V\QWKHVLV IURP 3*( WR 3*)f *URVV HW DK f

PAGE 133

,QFUHDVHG H[SUHVVLRQ RI 3*+6 LQ WKH FKRULRDOODQWRLV PD\ DOVR EH GXH WR VWLPXODWLRQ IURP WKH DPQLRWLF IOXLGV ,Q SLJV 5REHUWVRQ HW DO f DQG KXPDQV 6KDW] HW DK f IHWDO XULQH DQG DPQLRWLF IOXLGV KDYH EHHQ VKRZQ WR FRQWDLQ HVWURJHQV ZKLFK VWLPXODWH 3*)f V\QWKHVLV GXULQJ ODWH JHVWDWLRQ ,PPXQRKLVWRFKHPLVWU\ VKRZHG WKDW GXULQJ WKH HVWURXV F\FOH 3*+6 SURWHLQ ZDV SULPDULO\ ORFDOL]HG WR WKH OXPLQDO HSLWKHOLDO FHOOV RI WKH LQWHUFDUXQFXODU DQG FDUXQFXODU HQGRPHWULXP 7KH PRVW VXSHUILFLDO JODQGV VKRZHG VRPH VWDLQLQJ HVSHFLDOO\ LQ HQGRPHWULXP RI GD\V DQG DQG WR D OHVVHU H[WHQW DW HVWUXV 7KHVH UHVXOWV DUH VLPLODU WR WKRVH UHSRUWHG LQ WKH RYLQH HQGRPHWULXP ZKHUH VWDLQLQJ ZDV REVHUYHG LQ WKH OXPLQDO HSLWKHOLDO FHOOV DQG JODQGV FORVH WR WKH XWHULQH OXPHQ EXW QR VWDLQLQJ ZDV REVHUYHG LQ WKH GHHS JODQGV VWURPD DQG P\RPHWULXP &KDUSLJQ\ HW DK f 6PLWK HW DK f UHSRUWHG LQFUHDVHG 3*+6 LPPXQRVWDLQLQJ LQ FDUXQFXODU HQGRPHWULXP RI VKHHS RQ GD\V WR $URVK HW DK f XVLQJ :HVWHUQ EORWWLQJ UHSRUWHG D VLJQLILFDQW FRUUHODWLRQ EHWZHHQ 3*+6 P51$ DQG SURWHLQ LQ ERYLQH HQGRPHWULXP +RZHYHU 7KDWFKHU HW DK Df GLG QRW REVHUYH D SRVLWLYH FRUUHODWLRQ DW GD\ RI SUHJQDQF\ EHWZHHQ 3*+6 P51$ DQG SURWHLQ 7KH 3*+6 P51$ DQG SURWHLQ ZHUH H[SUHVVHG DW ORZ OHYHOV EHWZHHQ GD\V WR DQG KLJK OHYHOV IURP GD\V WR $ VLPLODU SDWWHUQ ZDV IRXQG LQ WKLV VWXG\ XVLQJ 5HDO 7LPH 3&5 FRXSOHG ZLWK LPPXQRKLVWRFKHPLVWU\ ZLWK KLJK H[SUHVVLRQ RI 3*+6 SURWHLQ REVHUYHG LQ WKH LQWHUFDUXQFXODU HQGRPHWULXP RQ GD\V DQG DQG ORZ WR QR VWDLQLQJ RQ GD\V DQG 7KH VWURPD ZDV LPPXQRQHJDWLYH WR 3*+6 VWDLQLQJ DW DOO VWDJHV RI WKH F\FOH ,Q SUHJQDQW FRZV 3*+6 SURWHLQ ZDV ORFDOL]HG WR WKH OXPLQDO HSLWKHOLDO FHOOV DQG WR D OHVVHU H[WHQW WKH VXSHUILFLDO JODQGV 5HVXOWV IURP WKLV VWXG\ DOVR VKRZ WKDW

PAGE 134

3*+6 SURWHLQ ZDV ORZ RQ FRPSDUDEOH GD\V RI SUHJQDQF\ DQG WKH F\FOH +RZHYHU QR VWDLQLQJ ZDV GHWHFWHG LQ GD\ SUHJQDQW FRZV 3RVLWLYH LPPXQRVWDLQLQJ ZDV REVHUYHG LQ OXPLQDO DQG JODQGXODU HSLWKHOLXP RQ GD\V DQG RI SUHJQDQF\ EXW ZDV OHVV LQWHQVH RQ GD\V DQG 7KH 3*+6 P51$ SDUDOOHOHG WKH H[SUHVVLRQ RI 3*+6 SURWHLQ 6LPLODUO\ LQ RYLQH SUHJQDQF\ 3*+6 SURWHLQ ZDV DOVR ORFDOL]HG WR OXPLQDO HSLWKHOLDO FHOOV DQG ZDV XQGHWHFWDEOH RU DW ORZ OHYHOV LQ HQGRPHWULDO VWURPD DQG JODQGV *LEE HW DO f ,W FDQ EH FRQFOXGHG WKDW 3*+6 P51$ LV H[SUHVVHG KLJKHVW DURXQG WKH WLPH RI OXWHRO\VLV GXULQJ WKH HVWURXV F\FOH DQG DW ORZ OHYHOV GXULQJ WKH RWKHU GD\V RI WKH F\FOH 'XULQJ SUHJQDQF\ 3*+6 ZDV H[SUHVVHG KLJKHVW DURXQG WKH SHULRG RI PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ 6LQFH SHDNV IRU 3*)D DW WKLV WLPH DUH EORFNHG EXW WKHUH LV LQFUHDVHG EDVDO 3*)D VHFUHWLRQ :LOOLDPV HW DK 0LVKUD HW DK f WKH LQFUHDVHG 3*+6 P51$ H[SUHVVLRQ DW WKLV WLPH PD\ EH LQYROYHG LQ HYHQWV IDYRULQJ LPSODQWDWLRQ LQVWHDG RI OXWHRO\VLV 7KH DEVHQFH RI OXWHRO\WLF SHDNV LV GXH SUREDEO\ WR D GHFUHDVH LQ 275 ,W DOVR VXJJHVWV WKDW ,)1[ GRHV QRW DFW E\ GHFUHDVLQJ 3*+6 P51$ ([SUHVVLRQ RI WKH 3*(6 P51$ KDV EHHQ UHSRUWHG LQ WKH ERYLQH XWHUXV GXULQJ WKH HVWURXV F\FOH $URVK HW DK f ,Q RWKHU ERYLQH WLVVXHV 3*(6 KDV EHHQ UHSRUWHG WR EH H[SUHVVHG KLJKHVW LQ VHPLQDO YHVLFXODU JODQGV DQG SUHRYXODWRU\ IROOLFOHV PRGHUDWH WR KLJK H[SUHVVLRQ LQ WKH VWRPDFK LQWHVWLQH SLWXLWDU\ DQG OLYHU )LOLRQ HW DK f ,Q ERYLQH RYDULDQ IROOLFOHV UHJXODWLRQ RI 3*(6 LV XQGHU WKH VWLPXODWLRQ RI /+ DQG H[SUHVVLRQ LV KLJKHVW LQ WKH JUDQXORVD FHOOV ZLWK OLWWOH H[SUHVVLRQ LQ WKH WKHFD LQWHPD FHOOV )LOLRQ HW DK f ([SUHVVLRQ RI 3*(6 LQ WKH IROOLFOHV ZDV VKRZQ WR SDUDOOHO WKDW RI 3*+6 VXJJHVWLQJ WKDW WKH HQ]\PHV PD\ EH FRUHJXODWHG )LOLRQ HW DK f

PAGE 135

,Q YLWUR VWXGLHV KDYH VKRZQ WKDW 3*(6 P51$ H[SUHVVLRQ LV LQFUHDVHG RU LQGXFHG E\ SURLQIODPPDWRU\ F\WRNLQHV OLNH WKH RQHV WKDW LQGXFH 3*+6 6XFK IDFWRUV DV ,)1U 71)D DQG /36 VWLPXODWH 3*+6 V\QWKHVLV -DNREVVRQ HW DO E 7KRUHQ DQG -DNREVVRQ 0DQFLQL HW DK 0XUDNDPL HW DK 3DUHQW HW DK f $OWKRXJK ,)1W LV FRQVLGHUHG WKH SULPDU\ VHFUHWRU\ SURGXFW WKDW FRQWUROV PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ 3DUHQW HW DK f 3*( PD\ KDYH D OXWHRWURSKLF UROH LQ UXPLQDQWV 3UDWW HW DK 0DJQHVV HW DK f )RU VXFFHVVIXO HVWDEOLVKPHQW RI SUHJQDQF\ WKH UDWLR RI 3*(3*)D DW WKH WLPH RI LPSODQWDWLRQ PD\ EH PRUH LPSRUWDQW WKDQ WKH DEVROXWH TXDQWLW\ RI HDFK KRUPRQH 3DUHQW HW DK f 7KH 3*(6 PD\ KDYH D UROH LQ LPSODQWDWLRQ VLQFH HPEU\RV IURP VHYHUDO DQLPDOV LQFOXGLQJ WKH PRXVH 0DVKEXP HW DK f UDEELW .DVDPR HW DK f DQG FRZ /HZLV HW DK f FDQ FRQYHUW DUDFKLGRQLF DFLG WR 3*( +LJK H[SUHVVLRQ RI 3*(6 P51$ ZDV REVHUYHG RQ GD\ DQG HVWUXV IROORZHG E\ PRGHUDWH H[SUHVVLRQ RQ GD\ DQG WKH ORZHVW H[SUHVVLRQ ZDV REVHUYHG RQ GD\ RI WKH HVWURXV F\FOH $OWKRXJK H[SUHVVLRQ RI 3*(6 P51$ RQ GD\ ZDV QXPHULFDOO\ KLJKHU WKDQ RQ GD\ WKH GLIIHUHQFH ZDV QRW VLJQLILFDQW 7KHVH UHVXOWV DUH VLPLODU WR WKRVH RI $URVK HW DK f ZKR UHSRUWHG WKDW 3*(6 P51$ H[SUHVVLRQ ZDV PRGHUDWH IURP GD\V ORZ IURP GD\V DQG KLJK IURP GD\V RI WKH F\FOH $URVK HW DK f UHSRUWHG FRn H[SUHVVLRQ RI 3*+6 P51$ DQG 3*(6 P51$ DW KLJK OHYHOV IURP GD\V RI WKH F\FOH ,Q WKH SUHVHQW VWXG\ 3*+6 P51$ ZDV KLJKO\ H[SUHVVHG RQ GD\V WR RI WKH F\FOH ZKHUHDV 3*(6 P51$ ZDV KLJKO\ H[SUHVVHG RQ GD\ DQG HVWUXV 7KLV LQFUHDVH LQ 3*(6 H[SUHVVLRQ DW HVWUXV PD\ EH FRQVWLWXWLYH LQ DQWLFLSDWLRQ RI LPSHQGLQJ RYXODWRU\

PAGE 136

UHVSRQVH DQG UHOHDVH RI WKH RYXODWRU\ IROOLFOH RU LV QHFHVVDU\ IRU LQFUHDVHG EORRG IORZ WR WKH XWHUXV $OWKRXJK 3*(6 DQG 3*+6 P51$ ZHUH H[SUHVVHG KLJKO\ DW HVWUXV DQG GD\ RI WKH F\FOH ERWK SDUWLDO DQG VLPSOH FRUUHODWLRQV UHYHDOHG QR SRVLWLYH FRUUHODWLRQ EHWZHHQ WKH WZR HQ]\PHV +RZHYHU RWKHU UHSRUWV LQGLFDWH WKDW LQGXFWLRQ RI 3*+6 DQG 3*(6 P51$ DUH OLQNHG DQG PD\ EH FRUHJXODWHG LQ IROOLFOHV 6LURLV /LX HW DO /LX DQG 6LURLV )LOLRQ HW DK f DQG LQ WKH ERYLQH HQGRPHWULXP $URVK HW DK f 7KH 3*(6 P51$ ZDV KLJKO\ FRUUHODWHG ZLWK 275 P51$ DFURVV DOO VWDJHV RI WKH HVWURXV F\FOH DQG DIWHU DGMXVWLQJ IRU VWDJH RI WKH F\FOH 7KXV 275 P51$ H[SUHVVLRQ PD\ EH FRXSOHG ZLWK 3*(6 P51$ H[SUHVVLRQ DQG VHUYH VRPH UROH LQ WKH SHULRYXODWRU\ SHULRG DV ZHOO DV EHLQJ FRUHJXODWHG 7KH 275 DQG 3*)6 P51$ ZHUH FRUUHODWHG EXW QRW DPSOLILHG LQ DVVRFLDWLRQ KRUPRQDO RU SK\VLRORJLFDO FKDQJHV GXULQJ WKH HVWURXV F\FOH ,Q YLYR WKH /+ VXUJH LQ FRZV RFFXUV DW WKH EHJLQQLQJ RI HVWUXV /LX HW DK -R HW DK f )LOLRQ HW DK f VKRZHG WKDW WKH OHYHO RI RYDULDQ 3*(6 P51$ ZDV ORZ DW K DQG LQFUHDVHG VLJQLILFDQWO\ K DIWHU RQVHW RI HVWUXV 5HVXOWV IURP WKH SUHVHQW VWXG\ VXJJHVW WKDW HQGRPHWULDO 3*(6 P51$ LV DOVR H[SUHVVHG KLJKHVW DW WKH WLPH RI WKH /+ VXUJH 7KH REVHUYHG GHFUHDVH LQ 3*(6 P51$ H[SUHVVLRQ IURP GD\V WR RI WKH F\FOH DJUHHV ZLWK WKH ILQGLQJV UHSRUWHG E\ $URVK HW DK f /RZ H[SUHVVLRQ RI 3*(6 P51$ REVHUYHG LQ WKH SUHVHQW VWXG\ RFFXUUHG DW WKH WLPH RI ORZ H[SUHVVLRQ RI 275 P51$ 6XFK D UHVXOW VXJJHVWV FRH[SUHVVLRQ RI WKH WZR JHQHV 'XULQJ SUHJQDQF\ WKHUH ZDV UHGXFHG H[SUHVVLRQ RI 3*(6 P51$ IURP GD\ WR IROORZHG E\ D VOLJKW LQFUHDVH LQ H[SUHVVLRQ IURP GD\V WR 'D\ LV WKH DSSUR[LPDWH WLPH ZKHQ WKH HPEU\R EHJLQV

PAGE 137

SURGXFLQJ ,)1[ DQG WKLV REVHUYHG GHFUHDVH LQ 3*(6 P51$ H[SUHVVLRQ PD\ UHVXOW IURP ,)1W 7KH H[SUHVVLRQ RI 3*+6 P51$ LQ ERWK WKH FDUXQFXODU DQG LQWHUFDUXQFXODU HQGRPHWULXP ZDV KLJK IURP GD\V WR RI SUHJQDQF\ $VVHOLQ HW DO Ff VKRZHG WKDW 3*( DQG 3*+6 FDQ EH VWLPXODWHG E\ ,)1[ LQ ERYLQH HQGRPHWULDO FHOOV 6HFUHWLRQ RI 3*( ZDV DOVR LQFUHDVHG E\ UR,)1[ LQ ERWK ERYLQH HQGRPHWULDO VWURPDO DQG HSLWKHOLDO FHOOV WR WKH H[WHQW WKDW LQ HSLWKHOLDO FHOOV WKH SULPDU\ SURVWDJODQGLQ SURGXFHG ZDV FKDQJHG IURP 3*)X WR 3*( $VVHOLQ HW DO Df +RZHYHU WKH REVHUYHG LQFUHDVH LQ 3*( FRXOG KDYH EHHQ GXH WR WKH GRVH RI ,)1[ RU FRQWDPLQDWLRQ RI ,)1[ ZLWK /36 ;LDR HW DO f 3DUHQW HW DO f VKRZHG WKDW LQ ERYLQH HQGRPHWULDO VWURPDO FHOOV 3*(6 P51$ H[SUHVVLRQ ZDV LQFUHDVHG LQ WKH SUHVHQFH RI /36 71)D DQG ,)1[ DQG WKDW WKHUH ZDV DOVR D VLPXOWDQHRXV LQFUHDVH LQ 3*+6 H[SUHVVLRQ ,Q WKH SUHVHQW VWXG\ 3*(6 P51$ GLG QRW LQFUHDVH DURXQG WKH SHULRG RI PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ ZKLFK GRHV QRW VXSSRUW WKH HDUOLHU UHVXOWV IURP LQ YLWUR VWXGLHV 2[\WRFLQ LV LQYROYHG LQ WKH UHJXODWLRQ RI 3*(6 V\QWKHVLV $VVHOLQ HW DO Ef VKRZHG WKDW 27 VWLPXODWHG 3*( LQ HQGRPHWULDO HSLWKHOLDO FHOOV YLD D 3.& PHGLDWHG SDWKZD\ ([SUHVVLRQ RI 3*(6 KDV DOVR EHHQ VWXGLHG LQ YLWUR XVLQJ %(1' FHOOV ZKHUH LW ZDV VKRZQ WKDW ,)1[ VWLPXODWHG 3*+6 DQG 3*(6 DIWHU DGGLWLRQ RI 30$ EXW QRW /36 DJRQLVWV NQRZQ WR LQIOXHQFH V\QWKHVLV RI SURVWDJODQGLQV 3DUHQW HW DO f +RZHYHU WKRVH UHVXOWV GLIIHUHG IURP WKRVH XWLOL]LQJ SULPDU\ HQGRPHWULDO HSLWKHOLDO FHOOV LQ ZKLFK /36 VWLPXODWHG 3*(6 V\QWKHVLV 3DUHQW HW DO f ,Q YLWUR VWXGLHV KDYH VKRZQ WKDW 3*( LV WKH PDLQ SURVWDJODQGLQ SURGXFHG GXULQJ GHOD\HG UHVSRQVH LQ YDULRXV FHOOV )RXUQLHU HW DO 0DWVXPRWR HW DO f DQG LQ YLYR VWXGLHV KDYH VKRZQ WKDW

PAGE 138

SURGXFWLRQ RI 3*( LV DIIHFWHG SURIRXQGO\ E\ 3*+6 LQKLELWRUV 7KLV LQGLFDWHV WKDW WKH 3*+6 SDWKZD\ PD\ EH OLQNHG VHOHFWLYHO\ WR WKH WHUPLQDO 3*( YLD 3*(6 -DFNREVVRQ HWDO Df 7ZR SDWKZD\V LQYROYLQJ WKH V\QWKHVLV RI 3*(6 DQG 3*( H[LVW LQVLGH FHOOV 2QH LQYROYHV WKH F3*(6F3/$3*+6OF3*(6 DQG WKH VHFRQG LQYROYHV P3*(6F3/$3*+6P3*(6 7KH SK\VLRORJLFDO UROH RI F3*(6 PD\ EH WR SURGXFH 3*(6 IRU KRPHRVWDWLF IXQFWLRQV 0XUDNDPL HW DO f +RZHYHU P3*(6 LV SHULQXFOHDU LQGXFLEOH DQG SUHIHUHQWLDOO\ FRXSOHG WR 3*+6 DQG LV LQYROYHG LQ SURGXFWLRQ RI 3*( IRU GHOD\HG UHVSRQVHV ,W KDV EHHQ VXJJHVWHG WKDW ZKHQ 3*+6 LV DOUHDG\ SUHVHQW LQ WKH WLVVXHV P3*(6 UHJXODWHV WKH LPPHGLDWH V\QWKHVLV RI 3*( ZKLFK PD\ EH GXH WR D SULPLQJ HIIHFW 0XUDNDPL HW DO f &RXSOLQJ RI P3*(6 WR 3*+6 DQG QRW 3*+6 PD\ EH GXH WR WKHLU VXEFHOOXODU ORFDWLRQ DV ZHOO DV WKHLU PLFURGRPDLQV LQ ZKLFK 3*(6 LV FORVHO\ ORFDWHG WR 3*+6 WKDQ WR 3*+6 7KH W\SH RI 3*(6 LQYHVWLJDWHG LQ WKLV VWXG\ LV P3*(6 VLQFH WKH VHTXHQFH XVHG WR GHVLJQ WKH SULPHUV DQG SUREHV ZDV EDVHG RQ WKH P3*(6 WKDW ZDV IRXQG KLJKO\ H[SUHVVHG LQ ERYLQH JUDQXORVD FHOOV )LOLRQ HW DO f 7KH 3*(6 P51$ H[SUHVVLRQ LQ WKH FKRULRDOODQWRLV ZDV FRPSDUDEOH WR WKH OHYHOV H[SUHVVHG LQ WKH LQWHUFDUXQFXODU HQGRPHWULXP RI SUHJQDQW FRZV DIWHU GD\ 1R VLJQLILFDQW GLIIHUHQFH ZDV REVHUYHG LQ H[SUHVVLRQ RI 3*(6 P51$ LQ WKH FKRULRDOODQWRLV DPRQJ WKH GD\V VWXGLHG ,W KDV EHHQ VKRZQ LQ VKHHS WKDW 3*(6 P51$ LV H[SUHVVHG LQ WKH RYLQH SODFHQWD IURP GD\ RI JHVWDWLRQ XQWLO WHUP 0DUWLQ HW DO f 7KH 3*(6 SURWHLQ ZDV ORFDOL]HG LQ HQGRWKHOLDO FHOOV RI PDWHUQDO EORRG YHVVHOV LQ WKH SO£FHQWHPH DQG IHWDO XQLQXFOHDWH WURSKREODVW FHOOV ZKHUH LW PD\ KDYH WKH IXQFWLRQ RI UHJXODWLQJ SODFHQWDO

PAGE 139

EORRG IORZ DQG HQGRFULQH IXQFWLRQV 0DUWLQ HW DO f 7KHUH LV D SRVVLELOLW\ WKDW 3*(6 FRXOG VHUYH D VLPLODU IXQFWLRQ LQ WKH SODFHQWD RI FRZV ,Q FRQFOXVLRQ GXULQJ WKH HVWURXV F\FOH HQGRPHWULDO 3*(6 P51$ LV KLJKO\ H[SUHVVHG GXULQJ WKH ODWH OXWHDO SKDVH DQG DW HVWUXV GD\ f ,W LV SRVVLEOH WKH 3*(6 JHQH LV XSUHJXODWHG LQ UHVSRQVH WR WKH SURFHVV RI RYXODWLRQ 'XULQJ SUHJQDQF\ 3*(6 P51$ ZDV QRW HOHYDWHG DURXQG WKH SHULRG RI PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ 'XULQJ WKH HVWURXV F\FOH VWHDG\ VWDWH OHYHOV RI 3*)6 P51$ ZHUH ORZ HDUO\ LQ WKH F\FOH DQG KLJKHU IURP WKH PLG WR ODWH OXWHDO SKDVHV RI WKH F\FOH GD\V WR f 7KHVH UHVXOWV DUH VLPLODU WR WKRVH RI 0DGRUH HW DO f ZKR UHSRUWHG ORZ H[SUHVVLRQ RI 3*)6 P51$ LQ ERYLQH HQGRPHWULXP EHWZHHQ GD\V WR RI WKH HVWURXV F\FOH DQG KLJKHU H[SUHVVLRQ LQ ODWHU VWDJHV RI WKH F\FOH ,Q WKH SUHVHQW VWXG\ WKH KLJKHVW H[SUHVVLRQ ZDV REVHUYHG RQ GD\ RI WKH F\FOH ZKHUHDV 0DGRUH HW DO f UHSRUWHG KLJKHVW H[SUHVVLRQ RQ GD\V WRO 7KH GLIIHUHQFH LQ WKH UHVXOWV EHWZHHQ WKH SUHVHQW VWXG\ DQG WKDW E\ 0DGRUH HW DO f FRXOG EH GXH WR WKH IDFW WKDW ZH GLG QRW HYDOXDWH VDPSOHV IURP GD\V WR RI WKH HVWURXV F\FOH $OVR WKHLU GHWHUPLQDWLRQ RI WKH VWDJH RI WKH F\FOH ZDV EDVHG RQ RYDULDQ DSSHDUDQFH (VWURJHQ DQG SURJHVWHURQH VHSDUDWHO\ KDG QR VLJQLILFDQW HIIHFW RQ 3*)6 P51$ H[SUHVVLRQ LQ LVRODWHG ERYLQH HQGRPHWULDO HSLWKHOLDO FHOOV ;LDR HW DO f EXW ZKHQ ERWK VWHURLGV ZHUH SUHVHQW 3*)6 P51$ ZDV XSUHJXODWHG ,Q WKDW VDPH VWXG\ SURJHVWHURQH GLG QRW LQFUHDVH 3*+6 RU 3*)6 P51$ EXW VWLPXODWHG LQFUHDVHG 3*)f V\QWKHVLV 7KLV LQGLFDWHV WKDW WKH HIIHFW RI SURJHVWHURQH RQ 3*)D VHFUHWLRQ LV DW WKH OHYHO RI WUDQVODWLRQ DOWKRXJK D VLPLODU HIIHFW FRXOG EH GXH WR UHJXODWLRQ RI WKH VXEVWUDWH

PAGE 140

7KH W\SH RI 3*)6 WKDW LV H[SUHVVHG LQ WKH ERYLQH HQGRPHWULXP KDV EHHQ UHSRUWHG WR KDYH SURSHUWLHV RI DK\GUR[\VWHURLG GHK\GURJHQDVH D+6'f 0DGRUH HW DO f 7KH D+6' FDQ FRQYHUW SURJHVWHURQH WR D ELRORJLFDOO\ LQHUW VWHURLG DK\GUR[\SURJHVWHURQH ,VKLGD HW DK f 7KH LQFUHDVH LQ 3*)6 P51$ REVHUYHG IURP GD\V WR RI WKH F\FOH PD\ EH SDUWO\ H[SODLQHG E\ LWV PRGXODWLRQ E\ SURJHVWHURQH LQ WKH HQGRPHWULXP 3URJHVWHURQH SHDNV DERXW GD\ RI WKH HVWURXV F\FOH DQG WKHQ GRZQUHJXODWHV LW RZQ UHFHSWRU 5RELQVRQ HW DK f 7KH GHFUHDVH LQ 3*)6 P51$ H[SUHVVLRQ REVHUYHG E\ GD\ PD\ EH GXH WR WKH IDFW WKDW 3*)6 DQG SURJHVWHURQH LQWHUDFW LQ VXFK D ZD\ WKDW UHGXFWLRQ RI SURJHVWHURQH PD\ OHDG WR GRZQUHJXODWLRQ RI 3*)6 0DGRUH HW DK f UHSRUWHG WKDW HQGRPHWULDO 3*)6 DQG SURJHVWHURQH ZHUH KLJKO\ FRUUHODWHG DQG ZHUH ERWK VLPXOWDQHRXVO\ H[SUHVVHG GXULQJ WKH HVWURXV F\FOH 7KLV VXJJHVWV WKDW 3*)6 P51$ H[SUHVVLRQ PD\ EH XSUHJXODWHG E\ SURJHVWHURQH 7KH PHFKDQLVP RI 3*)6 GRZQUHJXODWLQJ LWV RZQ UHFHSWRU PD\ EH YLD WKH LQDFWLYDWLRQ RI SURJHVWHURQH WR LWV OHVV DFWLYH PHWDEROLWH DK\GUR[\SURJHVWHURQH 0DGRUH HW DK f &RPSDULVRQ RI 3*)6 P51$ H[SUHVVLRQ EHWZHHQ SUHJQDQW DQG F\FOLF FRZV IURP GD\V WR RI WKH F\FOH RU SUHJQDQF\ ZHUH QRW GLIIHUHQW ZLWK KLJKHVW H[SUHVVLRQ REVHUYHG RQ GD\ 7KH ORZHVW OHYHO RI 3*)6 P51$ ZDV DW HVWUXV ZKHQ SURJHVWHURQH LV DOVR ORZ ,Q F\FOLF DQLPDOV DIWHU GD\ WKHUH DUH ORZ SODVPD SURJHVWHURQH FRQFHQWUDWLRQV DQG LQFUHDVHG SURGXFWLRQ RI HVWURJHQ E\ WKH SUHRYXODWRU\ IROOLFOH $W WKLV WLPH WKHUH LV DOVR LQFUHDVHG V\QWKHVLV RI HVWURJHQ UHFHSWRUV ZKLFK VWLPXODWH GHYHORSPHQW RI 275 3XOVHV RI 27 LQ FRZV GXULQJ WKH HVWURXV F\FOH RFFXU DURXQG GD\ .LQGDKO HW DK f 2[\WRFLQ DW WKLV WLPH LV FRQWULEXWHG PDLQO\ E\ WKH K\SRWKDODPXV DQG WKH ODUJH OXWHDO FHOOV 0F&UDFNHQ HW DK f 2[\WRFLQ ELQGV WR 275 LQ WKH HQGRPHWULDO HSLWKHOLDO

PAGE 141

FHOOV LQLWLDWLQJ V\QWKHVLV RI 3*+6 ZKLFK LV IROORZHG E\ DQ LQFUHDVH LQ 3*+ &RQYHUVLRQ RI 3*+ WR 3*) ZRXOG QHFHVVLWDWH LQFUHDVHG V\QWKHVLV RI 3*)6 7KH LQFUHDVHG V\QWKHVLV RI 27 DQG 275 WKDW LV DVVRFLDWHG ZLWK UHGXFWLRQ LQ SURJHVWHURQH FRQFHQWUDWLRQ SUREDEO\ H[SODLQV WKH LQFUHDVHG H[SUHVVLRQ RI 3*)6 P51$ REVHUYHG RQ GD\ RI WKH F\FOH 'XULQJ SUHJQDQF\ WKHUH ZDV D UHGXFWLRQ LQ 3*)6 P51$ H[SUHVVLRQ IURP GD\V WR RI SUHJQDQF\ 7KH VLJQLILFDQFH RI UHGXFHG 3*)6 P51$ H[SUHVVLRQ GXULQJ WKLV SHULRG PD\ EH D ZD\ WR PRGXODWH WKH 3*( 3*)f UDWLR WKDW LV QHFHVVDU\ IRU PDLQWHQDQFH RI SUHJQDQF\ 7KH UHGXFWLRQ LQ 3*)6 P51$ LV OLNHO\ GXH WR ,)1U SURGXFHG E\ WKH WURSKREODVW EHWZHHQ GD\V DQG RI JHVWDWLRQ VLQFH WKLV PROHFXOH SUHYHQWV OXWHRO\VLV E\ VXSSUHVVLQJ HQGRPHWULDO 3*) VHFUHWLRQ 0H\HU HW DO f 'XULQJ SUHJQDQF\ WKH VWHDG\ GHFOLQH LQ 3*)6 P51$ H[SUHVVLRQ IROORZLQJ PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ DQG GXULQJ WKH LPSODQWDWLRQ SHULRG OHDGV WR LQKLELWLRQ RI OXWHRO\WLF SXOVHV RI 3*)D 5HFRPELQDQW EO)1U HLWKHU DORQH RU LQ WKH SUHVHQFH RI HVWURJHQ DQG SURJHVWHURQH LQKLELWV LQGXFWLRQ RI 3*)6 P51$ LQ YLWUR ;LDR HW DK f 7KLV VXSSRUWV RXU LQ YLYR UHVXOWV LQ ZKLFK ZH REVHUYHG D GHFUHDVH LQ P51$ H[SUHVVLRQ RI 3*)6 GXULQJ WKH SHULLPSODQWDWLRQ SHULRG 7KH GHFUHDVH LQ 3*)6 P51$ H[SUHVVLRQ REVHUYHG LQ WKH SUHVHQW VWXG\ GXULQJ WKH SHULLPSODQWDWLRQ SHULRG PD\ EH GHVLUDEOH IRU WKH SURFHVV RI LPSODQWDWLRQ VLQFH LW ZRXOG OHDG WR GHFUHDVHG 3*)D V\QWKHVLV 6LQFH WKHUH ZDV QR FKDQJH LQ 3*(6 P51$ WKLV ZRXOG UHVXOW LQ QR FKDQJH LQ 3*( FRQFHQWUDWLRQV DQ LQFUHDVH LQ WKH UDWLR RI 3*(3*)D DQG KHQFH LPSURYH FKDQFHV RI HPEU\R VXUYLYDO $VVHOLQ DQG )RUWLHU f VKRZHG WKDW 3*)6 P51$ H[SUHVVLRQ LV GRZQUHJXODWHG LQ UHVSRQVH WR ORZ GRVHV RI UR,)1[ LQ ERYLQH HQGRPHWULDO HSLWKHOLDO FHOOV

PAGE 142

8QGHU WKHVH FRQGLWLRQV QJPO UR,)1[ ZDV DEOH WR LQKLELW 3*)D V\QWKHVLV ,Q YLYR WKH FRQFHQWUDWLRQV RI QDWXUDO ,)1 W ZRXOG EH KLJKHU WKDQ QJPO DQG ZRXOG EH H[SHFWHG WR LQKLELW 3*)6 V\QWKHVLV $OWKRXJK QR VLJQLILFDQW GLIIHUHQFH LQ 3*)6 P51$ H[SUHVVLRQ DFURVV SHULLPSODQWDWLRQ ZDV REVHUYHG LQ WKH FKRULRDOODQWRLV WKHUH ZDV DQ LQFUHDVH DW GD\ 3 f :X HW DO f UHSRUWHG QR FKDQJH LQ 3*)6 P51$ H[SUHVVLRQ LQ WKH IHWDO SODFHQWD DOWKRXJK WKHLU VWXG\ ZDV FRQGXFWHG LQ VKHHS DSSURDFKLQJ SDUWXULWLRQ ,Q FRQFOXVLRQ 3*)6 P51$ ZDV H[SUHVVHG KLJKHVW PLGF\FOH GD\ f DQG DW SURHVWUXV 7KHUH ZDV ORZ H[SUHVVLRQ DW HVWURV DQG LQ WKH HDUO\ OXWHDO SKDVH 'XULQJ SUHJQDQF\ 3*)6 P51$ H[SUHVVLRQ ZDV UHGXFHG GXULQJ WKH SHULLPSODQWDWLRQ SHULRG DQ HIIHFW WKDW ZDV SUREDEO\ GXH WR ,)1W

PAGE 143

&+$37(5 *(1(5$/ ',6&866,21 $1' &21&/86,216 7KH PDMRU REMHFWLYH RI WKLV GLVVHUWDWLRQ ZDV WR HYDOXDWH WKH FKDQJHV LQ WKH H[SUHVVLRQ RI WKH HQ]\PHV LQYROYHG LQ SURVWDJODQGLQ V\QWKHVLV DQG 275 GXULQJ WKH HVWURXV F\FOH DQG WKH SHULRGV GXULQJ DQG DIWHU PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ 7KLV LQYROYHG FKDUDFWHUL]DWLRQ RI WKH H[SUHVVLRQ RI 275 3*+6 3*(6 DQG 3*)6 P51$ LQ WKH HQGRPHWULXP DQG FKRULRDOODQWRLV RI FRZV GXULQJ WKH HVWURXV F\FOH DQG SUHJQDQF\ 7KH HDUO\ VWDJHV RI SUHJQDQF\ ZHUH FRPSDUHG WR FRUUHVSRQGLQJ GD\V RI WKH HVWURXV F\FOH $OVR HYDOXDWHG ZDV WKH SRWHQWLDO VRXUFH RI 27 RYDULDQ YHUVXV SLWXLWDU\f WKDW GULYHV 3*)F V\QWKHVLV GXULQJ WKH SHULLPSODQWDWLRQ SHULRG DQG ZKHWKHU WKH &/ FRXOG UHVSRQG E\ UHOHDVLQJ 27 LQ UHVSRQVH WR 3*)LD 7KHVH VWXGLHV ZHUH SHUIRUPHG WR DGGUHVV WKH TXHVWLRQ ZKHWKHU WKH 27275 DQG SURVWDQRLG V\VWHP DUH DFWLYH GXULQJ WKH SHUL LPSODQWDWLRQ SHULRG ,QFUHDVHG VHFUHWLRQ RI 3*)f DQG OXWHRO\VLV GXH WR DQ DFWLYH 27275 DQG SURVWDJODQGLQ V\QWKHVLV V\VWHP FRXOG EH RQH RI WKH PHFKDQLVPV WKDW FRQWULEXWH WR KLJK HPEU\R ORVVHV WKDW RFFXU GXULQJ WKH SHULLPSODQWDWLRQ SHULRG 7KLV ZRXOG EH SRVVLEOH LQ VLWXDWLRQV ZKHQ DQ HPEU\RFRQFHSWXV IDLOV WR HOLFLW DGHTXDWH DQWLOXWHRO\WLF VLJQDOV GXULQJ WKH SHULRG RI LPSODQWDWLRQ ,Q &KDSWHU DQ H[SHULPHQW ZDV FRQGXFWHG WR GHWHUPLQH ZKHWKHU 3*)D LQGXFHV LQFUHDVHG SODVPD FRQFHQWUDWLRQV RI 27 RQ GD\V DQG RI SUHJQDQF\ 2YDULDQ LQWDFW DQG ELODWHUDOO\ RYDULHFWRPL]HG FRZV ZHUH XWLOL]HG WR GHWHUPLQH LI WKH &/ FRXOG VHUYH DV D VRXUFH RI 27

PAGE 144

2YDULDQ LQWDFW FRZV DW GD\ RI SUHJQDQF\ ZHUH H[SHFWHG WR FRQWDLQ DQ DEXQGDQFH RI 27ODGHQ OXWHDO VHFUHWRU\ JUDQXOHV ZKHUHDV E\ GD\ WKH &/ LV H[SHFWHG WR EH GHSOHWHG RI VHFUHWRU\ JUDQXOHV )LHOGV DQG )LHOGV 6DOOL HW DO f ,Q RUGHU WR WHVW WKLV K\SRWKHVLV RYDULHFWRPL]HG FRZV DW GD\ RI SUHJQDQF\ ZHUH LQMHFWHG ZLWK WZR VXEOXWHRO\WLF GRVHV RI SJ 3*)D DQG RQH OXWHRO\WLF GRVH RI PJ 3*)/ LQ D VHULHV RI WKUHH LQMHFWLRQV DW PLQ LQWHUYDOV 2YDULDQLQWDFW FRZV DW GD\ DQG RI SUHJQDQF\ ZHUH WUHDWHG ZLWK WKH VDPH VHULHV RI WKUHH LQMHFWLRQV RI HLWKHU 3*) RU VDOLQH 1R 27 UHVSRQVH ZDV REVHUYHG LQ HLWKHU WKH RYDULHFWRPL]HG RU RYDULDQ LQWDFW FRZV IROORZLQJ WKH WZR VXEOXWHRO\WLF GRVHV RI 3*)D +RZHYHU D VLJQLILFDQW LQFUHDVH ZDV REVHUYHG LQ SODVPD 27 LQ WKH RYDULDQ LQWDFW FRZV DIWHU WKH OXWHRO\WLF GRVH RI 3*)R 7KLV PHDQV WKDW WKH &/ RI SHULLPSODQWDWLRQ FRZV LV RQO\ FDSDEOH RI UHOHDVLQJ 27 LQ UHVSRQVH WR 3*)D DW D OXWHRO\WLF GRVH RI 3*)f ,Q VHYHUDO LQVWDQFHV QRQVLJQLILFDQW LQFUHDVHV LQ 27 FRQFHQWUDWLRQV DIWHU HDFK LQMHFWLRQ ZHUH DOVR REVHUYHG HYHQ LQ RYDULHFWRPL]HG FRZV 7KLV PHDQV WKDW WKH 27 ZDV FRPLQJ IURP D QRQOXWHDO VXFK DV WKH QHXURK\SRSK\VLV ,Q DGGLWLRQ VHYHUDO UHSRUWV KDYH LQGLFDWHG WKDW SUHRYXODWRU\ IROOLFOHV DUH DOVR D VRXUFH RI 27 LQ WKH FRZ 6FKDPV HW DO 9RVV DQG )RUWXQH 0HLGDQ HW DO %HPGWVRQ HW DO f $IWHU WKH SHULRG RI PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ ZKHQ OXWHDO FRQFHQWUDWLRQV RI 27 GHFOLQH WKH QHXURK\SRSK\VLV PD\ FRQWULEXWH WR SODVPD 27 3DUNLQVRQ HW DO f &RPSDULVRQ EHWZHHQ VDOLQH DQG 3*)fWUHDWHG JURXSV RQ GD\ VKRZHG DQ LQFUHDVH LQ SODVPD 27 FRQFHQWUDWLRQV LQ UHVSRQVH WR 3*)f $OWKRXJK 3*)f FDQ LQGXFH UHOHDVH RI 27 RQ GD\ RI SUHJQDQF\ WKH FRQFHQWUDWLRQV 275 LQ WKH HQGRPHWULXP DW WKLV WLPH DUH ORZ )LJ f DQG KHQFH WKLV PD\ QRW DXJPHQW OXWHRO\WLF SXOVHV RI 3*)D DQG

PAGE 145

UHVXOW cQ OXWHRO\VLV ,Q GD\ RYDULDQ LQWDFW FRZV WKH UHVSRQVH RI 27 WR WKH OXWHRO\WLF GRVH RI 3*)D DQG VDOLQH ZHUH QRW GLIIHUHQW ZKLFK PHDQV WKDW WKH &/ ZDV QRW UHVSRQVLYH WR 3*) UHOHDVLQJ 27 7KLV PHDQV WKDW 27 JUDQXOHV ZHUH VWLOO SUHVHQW RQ GD\ RI SUHJQDQF\ EXW E\ GD\ WKH FRQFHQWUDWLRQ RI OXWHDO 27 ZDV YHU\ ORZ )LJ f 1LFKROV HW DO f IRXQG QR 27 P51$ DQG SURWHLQ LQ &/ IURP GD\ SUHJQDQW FRZV ZKLFK VXSSRUWV WKH UHVXOWV IURP WKH SUHVHQW VWXG\ 7KH RULJLQDO K\SRWKHVLV IRU WKLV H[SHULPHQW ZDV WKDW 3*)f FRXOG FDXVH UHOHDVH RI 27 IRUP WKH &/ DQG DIWHU ELQGLQJ WR WKH 275 LQ WKH HQGRPHWULXP FRXOG UHVXOW LQ IXUWKHU UHOHDVH RI 3*)f IURP WKH XWHUXV UHVXOWLQJ LQ OXWHRO\VLV ZLWK WHUPLQDWLRQ RI SUHJQDQF\ +RZHYHU WKH UHVXOWV IURP WKLV H[SHULPHQW GR QRW VHHP WR VXSSRUW WKDW K\SRWKHVLV VLQFH WKHUH LV YHU\ OLWWOH OXWHDO 27 LQ WKH &/ E\ GD\ RI SUHJQDQF\ $OWKRXJK D UHVSRQVH ZDV REVHUYHG RQ GD\ 275 ZHUH GRZQUHJXODWHG E\ ,)1L &DWWOH LQ WKLV VWXG\ ZHUH FRPPHUFLDO %UDKPDQ [ $QJXV WKDW ZHUH QRW XVHG WR LQWHQVLYH PDQDJHPHQW ,Q LQVWDQFHV ZKHUH WKHUH ZDV D UHVSRQVH WR VDOLQH WKDW UHVXOWHG LQ HOHYDWLRQ RI 27 WKLV PD\ UHIOHFW D UHVSRQVH E\ WKH DQLPDO WR WKH VWUHVV RI KDQGOLQJ 6WUHVV OHDGV WR DFWLYDWLRQ RI SUHFHSWRUV IRU FDWHFKRODPLQHV VXFK DV QRUHSLQHSKULQH ZKLFK VWLPXODWH VHFUHWLRQ DQG UHOHDVH RI 27 .RWZLFD HW DO f +RZHYHU ORQJWHUP VWUHVV GRZQUHJXODWHV WKH OXWHDO 3UHFHSWRUV GXH WR VXVWDLQHG KLJK FRQFHQWUDWLRQV RI FDWHFKRODPLQHV .RWZLFD HW DO f 6NDU]\QVNL HW DO Df VKRZHG WKDW QRUHSLQHSKULQH VWLPXODWHV 3*)VWLPXODWHG 27 VHFUHWLRQ IURP OXWHDO FHOOV ,W KDG EHHQ VKRZQ HDUOLHU )XFKV HW DO E %DODJXHU HW DO f WKDW SHULLPSODQWDWLRQ FRZV VKRZ LQFUHDVHG UHVSRQVLYHQHVV WR 27 ZLWK DGYDQFLQJ SUHJQDQF\ LQGLFDWLQJ DQ DFWLYH 27SURVWDQRLG V\VWHP GXULQJ WKLV WLPH ,Q VRPH FLUFXPVWDQFHV WKLV FRXOG OHDG WR

PAGE 146

LQFUHDVHG 3*) V\QWKHVLV LQ WKH HQGRPHWULXP DQG LQFUHDVHG OXWHRO\WLF SXOVHV WKDW FRXOG XOWLPDWHO\ FDXVH OXWHRO\VLV DQG WHUPLQDWLRQ RI SUHJQDQF\ GXULQJ WKH SHULLPSODQWDWLRQ SHULRG 7KLV VWXG\ VKRZHG WKDW WKH &/ LV D SRVVLEOH VRXUFH RI 27 WKDW FRXOG FRQWULEXWH WR XWHULQH VHFUHWLRQ RI 3*)D GXULQJ HDUO\ SUHJQDQF\ +RZHYHU 275 DUH VXSSUHVVHG GXULQJ WKLV WLPH VR WKHUH ZRXOG QRW EH FRXSOLQJ RI 27 DQG 275 WR WKH SURVWDJODQGLQ V\QWKHVLV SDWKZD\ 7KH VHFRQG REMHFWLYH RI WKLV GLVVHUWDWLRQ ZDV WR GHWHUPLQH WKH FKDQJHV LQ H[SUHVVLRQ RI WKH P51$ RI WKH HQ]\PHV WKDW DUH LQYROYHG LQ SURVWDJODQGLQ V\QWKHVLV GXULQJ OXWHRO\VLV DQG 275 2[\WRFLQ ELQGV WR 275 ZLWK UHVXOWDQW V\QWKHVLV RI 3*) SUHGRPLQDQWO\ LQ WKH OXPLQDO HSLWKHOLDO FHOOV DQG 3*( LQ WKH VWURPDO FHOOV RI WKH HQGRPHWULXP 'HVQR\HUV HW DO 3DUHQW HW DO Ef )LJ f ,Q &KDSWHU FKDQJHV LQ WKH H[SUHVVLRQ RI VWHDG\ VWDWH FRQFHQWUDWLRQV RI 275 3*+6 3*(6 DQG 3*)6 P51$ LQ WKH HQGRPHWULXP RI F\FOLF QRQSUHJQDQW EHHI FRZV ZHUH HYDOXDWHG 7KH KLJKHVW H[SUHVVLRQ RI 275 P51$ ZDV REVHUYHG RQ GD\ RI WKH F\FOH DQG DW HVWUXV ZKLFK LV H[SHFWHG VLQFH WKLV LV WKH WLPH ZKHQ WKHUH DUH KLJK HVWURJHQ FRQFHQWUDWLRQV DQG VWLPXODWLRQ RI HQGRPHWULDO 275 ZKLFK DUH LQYROYHG LQ DXJPHQWDWLRQ RI OXWHRO\VLV )LJ f ,Q YLWUR DQG LQ YLYR VWXGLHV KDYH LQGLFDWHG WKDW 27 PD\ KDYH D PRGXODWRU\ UROH LQ WKH OXWHRO\WLF SURFHVV E\ DXJPHQWLQJ WKH 3*) SXOVHV WKDW DUH LQYROYHG LQ OXWHRO\VLV .RWZLFD HW DO Df ,PPXQRKLVWRFKHPLFDO ORFDOL]DWLRQ RI 275 SURWHLQ IROORZHG D SDWWHUQ ZKLFK ZDV FORVH WR WKDW REVHUYHG IRU WKH 275 P51$ 'XULQJ WKH HVWURXV F\FOH 275 P51$ H[SUHVVLRQ ZDV KLJKHVW GXULQJ HVWUXV DQG ORZHVW GXULQJ PRVW RI WKH OXWHDO SKDVH 7KLV ORZ H[SUHVVLRQ PD\ EH D UHVXOW RI LQKLELWLRQ E\ SURJHVWHURQH /DPPLQJ DQG 0DQQ 5RELQVRQ HW DO f YLD D QRQJHQRPLF SDWKZD\ *UD]]LQL

PAGE 147

HW DO 3LFDUG %RJDFNL HW DO f (VWUDGLRO GRHV QRW KDYH D GLUHFW HIIHFW RQ WKH 275 LQ VSLWH RI WKH IDFW WKDW WKHUH DUH KDOI SDOOLQGURPLF (5( LQ WKH ERYLQH 275 %DWKJDWH HW DO ,YHOO DQG :DOWKHU f +RZHYHU LW PD\ VWLPXODWH WKH 275 YLD QRQJHQRPLF PHFKDQLVPV LH ELQGLQJ WUDQVFULSWLRQ IDFWRUV VXFK DV $3 DQG 6SO RU FRIDFWRUV 65& DQG &%3f 6DQFKH] HW DO %D]HU HW DO 7HOJPDQQ HW DO f 7KH 3*+6 P51$ ZDV H[SUHVVHG DW ORZ OHYHOV GXULQJ WKH HDUO\ DQG PLGOXWHDO SKDVHV RI WKH HVWURXV F\FOH EXW DW KLJK OHYHOV LQ WKH ODWH OXWHDO SKDVH ,QFUHDVHG H[SUHVVLRQ RI 3*+6 WRJHWKHU ZLWK LQFUHDVHG H[SUHVVLRQ RI 275 DW WKLV WLPH ZRXOG EH QHFHVVDU\ IRU V\QWKHVLV RI 3*)D IRU LQGXFWLRQ RI OXWHRO\VLV )LJ f 7KH 3*+6 SURWHLQ ZDV DOVR H[SUHVVHG LQ D VLPLODU SDWWHUQ ZLWK KLJKHVW H[SUHVVLRQ REVHUYHG RQ GD\V DQG RI WKH F\FOH D SHULRG ZKHQ OXWHRO\VLV LV H[SHFWHG WR RFFXU 6LPLODUO\ VWDLQLQJ IRU WKH 3*+6 SURWHLQ ZDV PRUH LQWHQVH RQ WKRVH GD\V $URVK HW DO f UHSRUWHG VLPLODU ILQGLQJV ZKHQ KH XVHG :HVWHUQ EORWWLQJ WR VWXG\ H[SUHVVLRQ RI 3*+6 SURWHLQ LQ F\FOLF FRZV 7KH H[SUHVVLRQ RI 3*(6 P51$ ZDV KLJKHVW RQ GD\ DQG GD\ HVWUXVf 5HGXFWLRQ LQ H[SUHVVLRQ RI 3*(6 GXULQJ WKH F\FOH FRLQFLGHG ZLWK WKH UHGXFWLRQ LQ H[SUHVVLRQ RI 275 P51$ 7KH SRVLWLYH SDUWLDO DQG VLPSOH FRUUHODWLRQV EHWZHHQ WKH 275 DQG 3*(6 LQGLFDWH WKHLU H[SUHVVLRQ LV FRUHJXODWHG 7DEOH DQG 7DEOH f 7KH PDLQ IDFWRU UHJXODWLQJ RYDULDQ 3*(6 H[SUHVVLRQ GXULQJ WKH F\FOH LV /+ )LOLRQ HW DO f REVHUYHG KLJK H[SUHVVLRQ RI 3*(6 LQ ERYLQH IROOLFOHV DW WKH WLPH RI WKH /+ VXUJH $OWKRXJK HQGRPHWULDO 3*(6 P51$ ZDV H[SUHVVHG KLJKHVW DW WKH VDPH WLPH DV WKDW

PAGE 148

UHSRUWHG IRU RYDULDQ 3*(6 ZH FDQQRW FRQFOXGH IURP WKLV VWXG\ WKDW WKH\ DUH XQGHU WKH VDPH UHJXODWLRQ ([SUHVVLRQ RI 3*)6 P51$ H[SUHVVLRQ ZDV ORZ GXULQJ HVWUXV DQG WKH HDUO\ OXWHDO SKDVH 7KHUH ZDV DQ LQFUHDVH GXULQJ WKH PLGOXWHDO SKDVH GD\ f D GHFUHDVH RQ GD\ DQG DQ HOHYDWLRQ RQ GD\ )LJ f 3URVWDJODQGLQ ) V\QWKDVH LV PRGXODWHG E\ SURJHVWHURQH DQG LW KDV EHHQ VXJJHVWHG WKDW 3*)6 FDQ FRQYHUW SURJHVWHURQH WR LWV OHVV DFWLYH PHWDEROLWH DK\GUR[\SURJHVWHURQHf GRZQUHJXODWLQJ LWV RZQ H[SUHVVLRQ 0DGRUH HW DO f 7KH LQFUHDVH LQ 3*)6 P51$ REVHUYHG RQ GD\ RI WKH HVWURXV F\FOH LV SUREDEO\ GXH WR WKH VWLPXODWLRQ E\ HVWURJHQ IURP SUHRYXODWRU\ IROOLFOHV ZKLFK DOVR VWLPXODWHV GHYHORSPHQW RI HQGRPHWULDO 275 ,QFUHDVHG H[SUHVVLRQ RI 275 LQFUHDVHV HQGRPHWULDO UHVSRQVLYHQHVV WR 27 ZKLFK WKHQ VWLPXODWHV V\QWKHVLV RI 3*+6 DQG 3*)6 DQG XOWLPDWHO\ OHDGV WR SURGXFWLRQ RI OXWHRO\WLF 3*) 'XULQJ WKH SHULRG RI PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ 275 P51$ H[SUHVVLRQ ZDV ORZ LQ SUHJQDQW FRZV &RPSDULVRQV EHWZHHQ F\FOLF DQG SUHJQDQW FRZV RQ GD\V WR VKRZHG WKDW ZKHUHDV 275 LQFUHDVHG RQ GD\ RI WKH F\FOH WKH\ UHPDLQHG ORZ LQ SUHJQDQW FRZV $ VLJQLILFDQW VWDWXV F\FOLFSUHJQDQWf E\ GD\ LQWHUDFWLRQ IRU 275 P51$ H[SUHVVLRQ ZDV REVHUYHG LQ WKH FDUXQFXODU HQGRPHWULXP 5HGXFHG H[SUHVVLRQ RI 275 LQ SUHJQDQW FRZV PD\ EH GXH WR ,)1U VHFUHWHG E\ WKH FRQFHSWXV 7KH ERYLQH 275 KDV DQ LQWHUIHURQ UHVSRQVH HOHPHQW ZKLFK ELQGV LQWHUIHURQ UHVSRQVH IDFWRU ,5)f DQG ERYLQH ,5) DQG ,5) ZKLFK DUH H[SUHVVHG LQ D WHPSRUDO PDQQHU GXULQJ SHULLPSODQWDWLRQ VXJJHVWLQJ WKDW WKH\ DUH XQGHU WKH UHJXODWLRQ RI ,)1[ 7HOJPDQQ HW DO f 7KH UHVXOWV IURP SUHJQDQW DQLPDOV ZHUH VXUSULVLQJ LQ WKDW WKH KLJKHVW H[SUHVVLRQ RI 3*+6 ZDV REVHUYHG RQ GD\V DQG RI SUHJQDQF\ D SHULRG ZKHQ PDWHUQDO

PAGE 149

UHFRJQLWLRQ RI SUHJQDQF\ RFFXUV LQ FRZV 7KLV LV DOVR WKH VDPH WLPH ZKHQ WKHUH DUH KLJK OHYHOV RI ,)1[ SURGXFHG E\ WKH FRQFHSWXV 7KLV LQFUHDVHG H[SUHVVLRQ RI 3*+6 PD\ SOD\ D UROH LQ LPSODQWDWLRQ DQG HPEU\RQLF GHYHORSPHQW ([SUHVVLRQ RI 3*+6 SURWHLQ LV LQFUHDVHG LQ DUHDV RI WKH HQGRPHWULXP ZKHUH DWWDFKPHQW RI WKH FRQFHSWXV KDV QRW RFFXUUHG EXW UHGXFHG DW WKH VLWHV RI DWWDFKPHQW LQ WKH K\EULG V\QF\WLXP (PRQG HW DO f 7KLV VXJJHVWV WKDW 3*+6 PD\ SOD\ DQ LPSRUWDQW UROH LQ DGKHVLRQ RI WKH HPEU\R GXULQJ LPSODQWDWLRQ ,Q YLWUR VWXGLHV KDYH LQGLFDWHG WKDW WKH UDWLR RI 3*( WR 3*)D DW WKH WLPH RI PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ PD\ EH LPSRUWDQW IRU VXVWDLQHG SUHJQDQF\ 3DUHQW HW DO f ,I WKH 3*( LV KLJKHU WKHQ SUHJQDQF\ FRQWLQXHV EXW LI PRUH 3*) LV SURGXFHG WKHQ WKH DQLPDO PD\ EH PRUH DW ULVN RI ORVLQJ WKH SUHJQDQF\ 6LPLODU WR ILQGLQJV RI $URVK HW DO f 3*+6 P51$ ZDV DOVR H[SUHVVHG DW KLJK OHYHOV VLPXOWDQHRXVO\ ZLWK 3*(6 P51$ ,W KDV EHHQ VXJJHVWHG WKDW WKH WZR HQ]\PHV PD\ EH FRUHJXODWHG )LOLRQ HW DO 3DUHQW HW DO f 7KH KLJKHVW VWDLQLQJ IRU 3*+6 SURWHLQ ZDV REVHUYHG RQ GD\V DQG ZKLFK UHIOHFWHG WKH SDWWHUQ RI P51$ DQG LQGLFDWHV WKDW WKH 3*+6 PD\ EH WUDQVFULSWLRQDOO\ DQG WUDQVODWLRQDOO\ UHJXODWHG 7KLV VWXG\ LV WKH ILUVW WR VKRZ H[SUHVVLRQ RI 3*(6 P51$ LQ SHULLPSODQWDWLRQ FRZV DQG WKHVH UHVXOWV GR QRW VXSSRUW WKRVH IURP LQ YLWUR VWXGLHV FRQGXFWHG XVLQJ HQGRPHWULDO HSLWKHOLDO FHOOV $VVHOLQ HW DO Df 7KH 3*(6 P51$ GHFUHDVHG IURP GD\ ZKLFK LV DERXW WKH WLPH WKDW WKH FRQFHSWXV LV EHJLQQLQJ WR VHFUHWH ODUJH TXDQWLWLHV RI ,)1[ 3DUHQW HW DO f VKRZHG WKDW ,)1[ VWLPXODWHG V\QWKHVLV RI 3*(6 DQG 3*+6 VLPXOWDQHRXVO\ DQG $VVHOLQ HW DO Df VKRZHG WKDW ,)1[ VWLPXODWHV ERWK 3*( DQG 3*)& VLPXOWDQHRXVO\ 1RUPDOO\ 3*) LV SUHIHUHQWLDOO\ V\QWKHVL]HG E\ WKH OXPLQDO

PAGE 150

HSLWKHOLDO FHOOV LQ WKH HQGRPHWULXP ZKHUHDV 3*( LV SURGXFHG LQ WKH VWURPD )RUWLHU HW DO $VVHOLQ HW DO 3DUHQW HW DO Ef $OWKRXJK WKH H[DFW IXQFWLRQ RI HQGRPHWULDO 3*( LQ FDWWOH KDV QRW EHHQ HOXFLGDWHG LW PD\ VWLPXODWH VHFUHWLRQ RI JURZWK IDFWRUV UHJXODWLRQ RI LPPXQH UHVSRQVH WR SUHYHQW HPEU\R UHMHFWLRQ DQG UHVFXH RI WKH &/ 3UDWW HW DO 0DJQHVV HW DO *LPHQH] DQG +HQULFNV 7KLERGHDX[ HW DO (PRQG HW DO f 3URVWDJODQGLQ ( LV LQYROYHG LQ DQJLRJHQHVLV GXULQJ LPSODQWDWLRQ LQ GRPHVWLF SLJV DQG FDWWOH .H\V HW DO (PRQG HW DO f $Q LQWHUHVWLQJ SDWWHUQ RI 3*)6 P51$ H[SUHVVLRQ ZDV REVHUYHG LQ WKH SHUL LPSODQWDWLRQ SHULRG 7KHUH ZDV D FRQWLQXRXV UHGXFWLRQ LQ H[SUHVVLRQ RI 3*)6 P51$ IURP GD\V WR 7KLV LV WKH ILUVW VWXG\ WKDW ZH DUH DZDUH RI WR H[WHQVLYHO\ DVVHVV WKH H[SUHVVLRQ RI 3*)6 P51$ GXULQJ WKH SHULLPSODQWDWLRQ SHULRG 7KH H[SODQDWLRQ IRU GHFUHDVHG 3*)6 P51$ H[SUHVVLRQ LV EHOLHYHG WR EH GXH WR WKH HIIHFW RI ,)1U WKDW LV SURGXFHG E\ WKH FRQFHSWDV )LJ f 0RVW LQ YLWUR VWXGLHV KDYH VKRZQ WKDW UE,)1U DORQH DQG LQ WKH SUHVHQFH RI SURJHVWHURQH DQG HVWURJHQ LQKLELWV 3*)6 V\QWKHVLV ;LDR HW DO f $W WKH VDPH WLPH GHFUHDVHG 3*)6 V\QWKHVLV GXULQJ WKH SHULLPSODQWDWLRQ SHULRG VKRXOG UHVXOW LQ OHVV 3*+ EHLQJ DYDLODEOH IRU FRQYHUVLRQ WR 3*) 3HUKDSV WKLV LV RQH ZD\ LQ ZKLFK WKH UDWLR RI 3*( WR 3*)f LV PRGXODWHG WR SURYLGH IDYRUDEOH FRQGLWLRQV IRU PDLQWHQDQFH RI SUHJQDQF\ $IWHU WKH SHULRG RI PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ IURP GD\ RQZDUGV WKHUH ZDV DQ LQFUHDVH LQ H[SUHVVLRQ RI 275 P51$ LQ SUHJQDQW FRZV EXW DW PXFK ORZHU FRQFHQWUDWLRQV FRPSDUHG WR F\FOLF FRZV )LJ f 7KLV PHDQV WKH 275 V\VWHP WKDW LV LQYROYHG LQ SURVWDJODQGLQ V\QWKHVLV LV UHVXPLQJ 7KLV DJUHHV ZLWK UHVXOWV RI WKRVH VWXGLHV ZKLFK KDG VKRZQ LQFUHDVHG UHVSRQVH WR 27 ZLWK DGYDQFLQJ SUHJQDQF\ )XFKV HW DO Ef KDG UHSRUWHG HDUOLHU WKDW 275 DUH

PAGE 151

DOUHDG\ LQFUHDVHG E\ GD\ 7KH VOLJKW LQFUHDVH LQ 275 P51$ REVHUYHG IURP GD\V WR PD\ EH GXH WR WKH ZDQLQJ LQKLELWRU\ HIIHFWV RI ,)1[ )XFKV HW DO f UHSRUWHG H[SUHVVLRQ RI LPPXQRUHDFWLYH 275 DQG 275 P51$ LQ WKH F\WRWURSKREODVW DW DOO VWDJHV RI SUHJQDQF\ DOWKRXJK WKH PDWHUQDO FU\SWDO FHOOV GLG H[SUHVV WKH 275 DW WHUP )XUWKHUPRUH )XFKV HW DO f UHSRUWHG LPPXQRVWDLQLQJ IRU 275 LQ WKH YDVFXODWXUH RI FDUXQFOHV DQ LQGLFDWLRQ WKDW WKH 27 PD\ EH LQYROYHG LQ DQJLRJHQHVLV 7KH ODFN RI GHWHFWDEOH 275 SURWHLQ LQ WKH HQGRPHWULXP IURP GD\V WR RI SUHJQDQF\ LV EHOLHYHG WR EH GXH WR WKH LQKLELWLRQ E\ ,)1U 6LQFH 275 P51$ ZDV SUHVHQW LQ WKHVH DQLPDOV UHJXODWLRQ RI WKH 275 PD\ EH KDSSHQLQJ DW WKH WUDQVODWLRQ OHYHO (QGRPHWULDO 275 KDYH EHHQ UHSRUWHG WR LQFUHDVH WKURXJKRXW SUHJQDQF\ VWDUWLQJ DW GD\ DQG UHDFK D SHDN DW SDUWXULWLRQ DQG ODERU )XFKV HW DO Ef ,Q WKLV VWXG\ 275 ZHUH H[SUHVVHG LQ WKH FKRULRDOODQWRLV EXW DW PXFK ORZHU OHYHOV WKDQ WKRVH REVHUYHG LQ WKH FDUXQFXODU DQG LQWHUFDUXQFXODU HQGRPHWULXP 7KH VLJQLILFDQFH RI 275 LQ WKH FKRULRDOODQWRLV DW WKLV WLPH LV QRW FOHDU KRZHYHU WKH\ PD\ EH LQYROYHG LQ FHOO SUROLIHUDWLRQ DQJLRJHQHVLV DQG IHWDO JURZWK 7KLERQQLHU HW DO )XFKV HW DO f 7KHUH ZDV GHFUHDVHG H[SUHVVLRQ RI 3*+6 P51$ GXULQJ ODWHU VWDJHV RI WKH SHULLPSODQWDWLRQ SHULRG SHUKDSV GXH WR WKH HIIHFW RI D ORQJ WHUP KLJK SURJHVWHURQH HQYLURQPHQW DQG ORZ H[SUHVVLRQ RI 275 LQ WKH HQGRPHWULXP ([SUHVVLRQ RI 3*(6 P51$ ZDV XQFKDQJHG IURP GD\V WR RI SUHJQDQF\ KRZHYHU WKHUH ZDV D GHFUHDVH LQ 3*+6 P51$ DQG 3*)6 P51$ RYHU WKH VDPH SHULRG 7KHUH ZDV DQ LQFUHDVH LQ 275 IURP GD\V WR 7KH PD[LPDO 275 FRQFHQWUDWLRQV GXULQJ WKLV SHULRG ZHUH WKH VDPH DV WKRVH REVHUYHG RQ GD\ WR RI WKH F\FOH 7KLV PHDQV WKDW DOWKRXJK WKH 275 DUH LQFUHDVLQJ WKH FRQFHQWUDWLRQV DUH VWLOO WRR ORZ WR DXJPHQW DQ\ OXWHRO\WLF 3*)D SXOVHV )DLOXUH RI UHOHDVH RI 27 IURP WKH &/ LQ WKH ILUVW VWXG\ LQGLFDWHV WKDW WKHUH ZRXOG QRW EH HQRXJK 27 IURP WKH &/ WR

PAGE 152

DXJPHQW DQ\ 27LQGXFHG SURVWDJODQGLQ V\QWKHVLV 7KLV LQ FRPELQDWLRQ ZLWK WKH GHFUHDVH LQ 3*+6 3*)6 DQG ORZ 275 PHDQV WKH 275 DUH QRW FRXSOHG WR WKH SURVWDQRLG V\QWKHVLV PHFKDQLVP GXULQJ WKLV SHULRG KHQFH XQOLNHO\ WR OHDG WR HPEU\R ORVV &RQFOXVLRQV 7KH HVWURXV F\FOH DQG SHULLPSODQWDWLRQ SHULRG DUH DVVRFLDWHG ZLWK V\QWKHVLV RI HQ]\PHV WKDW VWLPXODWH VHFUHWLRQ RI SURVWDJODQGLQV 'XULQJ WKH HVWURXV F\FOH 27 LV UHOHDVHG IURP WKH QHXURK\SRSK\VLV DQG VWLPXODWHV V\QWKHVLV RI 3*) IURP WKH HQGRPHWULXP ZKLFK LV WUDQVSRUWHG WR WKH RYDU\ ZKHUH LW FDXVHV UHOHDVH RI OXWHDO 27 ZKLFK DXJPHQWV SXOVHV RI 3*)MD OHDGLQJ WR OXWHRO\VLV )OLQW HW DO f ,Q SUHJQDQW DQLPDOV SXOVDWLOH 3*)f KDV WR EH EORFNHG LQ RUGHU IRU WKH SUHJQDQF\ WR EH VXVWDLQHG (PEU\R ORVV PD\ RFFXU LI WKH FRQFHSWXV IDLOV WR LQLWLDWH VWURQJ OXWHRWURSKLF VLJQDOV LH ,)1[ ,Q WKLV VWXG\ ZH VKRZHG WKDW 3*)f LQGXFHV UHOHDVH RI RYDULDQ 27 IURP HDUO\ GD\ f EXW QRW ODWH GD\ f SHULLPSODQWDWLRQ FRZV )ORZHYHU WKLV 27 UHOHDVH ZDV VLJQLILFDQW RQO\ LI D OXWHRO\WLF GRVH RI 3*)D PJf ZDV DGPLQLVWHUHG ,W ZDV DOVR VKRZQ WKDW EHVLGHV WKH RYDU\ WKH QHXURK\SRSK\VLV FRXOG DFW DV D VRXUFH RI 27 SUREDEO\ DV D UHVXOW RI VWUHVVLQJ WKH DQLPDOV GXULQJ LQMHFWLRQ DQG VDPSOH FROOHFWLRQ 7KH UHOHDVH RI OXWHDO 27 GXULQJ WKH SHULLPSODQWDWLRQ SHULRG PD\ QRW EH FRXSOHG WR WKH SURVWDJODQGLQ V\QWKHVLV PHFKDQLVP WKDW ZRXOG OHDG WR OXWHRO\WLF 3*)D SXOVHV 7KLV LV EHFDXVH 275 P51$ H[SUHVVLRQ GXULQJ WKH SHULLPSODQWDWLRQ ZDV ORZ GXH WR LQKLELWLRQ E\ ,)1W 7KH ,)1U LV VHFUHWHG E\ WKH FRQFHSWXV EHWZHHQ GD\V WR DQG LV PD[LPDO DURXQG GD\ %DUWRO HW DO f 'XULQJ WKH VDPH SHULRG YHU\ ORZ OHYHOV RI 275 P51$ ZHUH H[SUHVVHG 7KXV LW LV XQOLNHO\ WKDW OXWHDO 27 DW WKLV WLPH ZRXOG EH D VLJQLILFDQW FRQWULEXWRU WR WKH SURFHVV RI HPEU\R ORVV GXULQJ WKH ODWH SHULLPSODQWDWLRQ

PAGE 153

SHULRG 5HVXOWV IURP WKH SUHVHQW VWXG\ VKRZLQJ YHU\ ORZ H[SUHVVLRQ RI 275 P51$ DQG SURWHLQ GXULQJ WKH SHULLPSODQWDWLRQ SHULRG GR QRW VXSSRUW WKH RULJLQDO K\SRWKHVLV WKDW 27 DQG 275 GULYH SURVWDJODQGLQ V\QWKHVLV OHDGLQJ WR HPEU\R ORVV GXULQJ WKH SHUL LPSODQWDWLRQ SHULRG 'XULQJ WKH HVWURXV F\FOH 275 P51$ DQG SURWHLQ ZHUH H[SUHVVHG KLJKHVW GXULQJ HVWUXV DQG SURHVWUXV DQG ORZ H[SUHVVLRQ ZDV REVHUYHG GXULQJ WKH HDUO\ OXWHDO DQG PLGOXWHDO SKDVHV RI WKH F\FOH ,Q SHULLPSODQWDWLRQ FRZV 275 P51$ DQG SURWHLQ ZHUH H[SUHVVHG DW ORZ OHYHOV ZLWK D VOLJKW LQFUHDVH LQ 275 P51$ DIWHU GD\ RI SUHJQDQF\ ,Q WKH HDUO\ VWDJHV RI SUHJQDQF\ WKH LQKLELWLRQ RI 275 P51$ H[SUHVVLRQ LV GXH WR SURJHVWHURQH DQG ODWHU ,)1W DV WKH HPEU\R HORQJDWHV 7KLV HIIHFW ZDQHV DQG WKH 275 V\VWHP EHFRPHV UHHVWDEOLVKHG 7KH UHVXOWV IURP WKLV VWXG\ VXSSRUW WKH K\SRWKHVLV WKDW WKH 275 EHFRPH HVWDEOLVKHG DIWHU PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ +RZHYHU UHFHSWRUV DUH QRW FRXSOHG WR 3*)LD V\QWKHVLV XQWLO DIWHU GD\ RI SUHJQDQF\ DV KDV EHHQ VKRZQ E\ )XFKV HW DO Ef 3URVWDJODQGLQ *+ V\QWKDVH LV WKH UDWH OLPLWLQJ HQ]\PH LQ WKH FRQYHUVLRQ RI DUDFKLGRQLF DFLG WR 3*)f 7KH 3*+6 P51$ DQG SURWHLQ ZHUH H[SUHVVHG DW KLJK OHYHOV LQ WKH ODWH OXWHDO SKDVH DQG SURHVWUXV $IWHU D SHULRG RI SURJHVWHURQH GRPLQDQFH DQG WKHQ GHFOLQH DFFXPXODWLRQ RI DUDFKLGRQLF DFLG RFFXUV LQ WKH HQGRPHWULXP DQG LV K\GURO\]HG WR 3*+ DQG ILQDOO\ WR SURVWDJODQGLQV 7RZDUGV WKH HQG RI WKH HVWURXV F\FOH HVWURJHQV HQKDQFH WKH GHYHORSPHQW RI 275 DQG V\QWKHVLV RI 3*+6 DV ZHOO DV 3*)6 )LJ f ,QFUHDVHG H[SUHVVLRQ RI 3*+6 P51$ GXULQJ WKH SHULRG RI PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ DV KDV EHHQ VKRZQ LQ RYLQH HQGRPHWULXP &KDUSLJQ\ HW DO f VXJJHVWV WKDW 3*+6 PD\ EH LPSRUWDQW IRU LPSODQWDWLRQ 7KH LPSRUWDQFH RI 3*+6 KDV EHHQ VKRZQ LQ VWXGLHV ZLWK PLFH ZKHUHE\ LQKLELWRUV RI 3*+6 UHVXOWHG LQ LPSODQWDWLRQ IDLOXUH 5HHVH HW DO f

PAGE 154

3URVWDJODQGLQ ( V\QWKDVH VWLPXODWHV V\QWKHVLV RI 3*( ZKLFK LV D SRWHQW YDVRGLODWRU ,Q FDWWOH 3*( SOD\V D UROH LQ FHUYLFDO UHOD[DWLRQ )XFKV HW DO f DQG LQ RYXODWLRQ )LOLRQ HW DO f ([SUHVVLRQ RI HQGRPHWULDO 3*(6 P51$ ZDV KLJKHVW GXULQJ SURHVWUXV DQG HVWUXV ZKLFK ZHUH WKH VDPH SHULRGV ZKHQ 275 P51$ ZDV KLJKO\ H[SUHVVHG LPSO\LQJ 275 DQG 3*(6 DUH FRUHJXODWHG 7KH HQGRPHWULDO 3*(6 PD\ EH LQYROYHG LQ WKH RYXODWRU\ SURFHVV ZKLFK LV FRLQFLGHQW ZLWK KLJK H[SUHVVLRQ RI P3*(6 LQ JUDQXORVD FHOOV LQ WKH RYDU\ )LOLRQ HW DO f ,W PD\ DOVR EH LQYROYHG VWLPXODWLRQ RI 3*( WKDW FDXVHV LQFUHDVHG EORRG IORZ WR WKH XWHUXV 'XULQJ WKH SHULLPSODQWDWLRQ SHULRG HQGRPHWULDO 3*(6 P51$ ZDV QRW LQFUHDVHG DV ZH KDG H[SHFWHG ZKLFK PD\ VXJJHVW WKDW LW PD\ QRW KDYH D PDMRU UROH LQ LPSODQWDWLRQ LQ FDWWOH +RZHYHU WKLV QHHGV IXUWKHU LQYHVWLJDWLRQ 'XULQJ WKH HVWURXV F\FOH 3*)6 P51$ ZDV H[SUHVVHG KLJKHVW LQ WKH ODWH OXWHDO SKDVH 7HPSRUDO H[SUHVVLRQ RI 3*)6 GXULQJ WKH HVWURXV F\FOH VHHPHG WR EH XQGHU UHJXODWLRQ RI SURJHVWHURQH DQG 27 DV VXJJHVWHG E\ 0DGRUH HW DO f +RZHYHU GXULQJ SUHJQDQF\ 3*)6 P51$ ZDV GRZQUHJXODWHG E\ ,)1W VHFUHWHG E\ WKH FRQFHSWXV )LJ f 7KH SK\VLRORJLFDO VWDWXV ZKHUHE\ 3*+6 LV LQFUHDVHG GXULQJ WKH WLPH RI LPSODQWDWLRQ DQG 3*)6 LV GHFUHDVHG PD\ EH IDYRUDEOH IRU LPSODQWDWLRQ 'XULQJ WKLV VDPH SHULRG WKHUH LV ORZ H[SUHVVLRQ RI 275 P51$ DQG ORZ OHYHOV RI OXWHDO 27 7KHVH FRQGLWLRQV VKRXOG EH IDYRUDEOH IRU HPEU\R VXUYLYDO GXULQJ WKH SHULLPSODQWDWLRQ SHULRG UDWKHU WKDQ HPEU\R ORVV DV ZH KDG K\SRWKHVL]HG HDUOLHU 7DNHQ WRJHWKHU WKH UHVXOWV IURP WKLV UHVHDUFK JLYH XV DQ XQGHUVWDQGLQJ RI WKH VSDWLDO DQG WHPSRUDO H[SUHVVLRQ RI 275 DV ZHOO DV WKH SURVWDQRLG V\QWKHVL]LQJ HQ]\PHV GXULQJ WKH HVWURXV F\FOH SHULRG RI PDWHUQDO

PAGE 155

UHFRJQLWLRQ RI SUHJQDQF\ DQG ODWH SHULLPSODQWDWLRQ SHULRG 7KH UHVXOWV VKRZ WKH FRPSOH[ UHODWLRQVKLS EHWZHHQ WKH YDULRXV HQ]\PHV KRUPRQHV DQG UHFHSWRUV WKDW SDUWO\ SOD\ LPSRUWDQW UROHV LQ OXWHRO\VLV DQG LPSODQWDWLRQ )LQDOO\ D EHWWHU XQGHUVWDQGLQJ RI WKH UHJXODWRU\ UROH RI WKHVH HQ]\PHV DQG UHFHSWRUV JLYHV XV IXUWKHU LQVLJKW LQWR VXFFHVVIXO SUHJQDQF\ HVWDEOLVKPHQW GXULQJ WKH SHULLPSODQWDWLRQ SHULRG DQG FDQ VHUYH D EDVLV IRU GHVLJQLQJ VWUDWHJLHV WR LPSURYH LW )XUWKHU VWXGLHV DUH QHHGHG WR HVWDEOLVK WKH UROHV RI 3*+6 GXULQJ WKH SHULRG RI PDWHUQDO UHFRJQLWLRQ RI SUHJQDQF\ LQ FDWWOH ,W ZRXOG DOVR EH LQWHUHVWLQJ WR GHWHUPLQH ZKHWKHU HQGRPHWULDO 3*( LV LQYROYHG LQ RYXODWLRQ GXULQJ WKH HVWURXV F\FOH DQG ZKHWKHU LW KDV DQ\ HIIHFW RQ WKH FRUSXV OXWHXP RI SUHJQDQF\ +\SRWKHWLFDO PRGHOV IRU WKH UHJXODWLRQ RI H[SUHVVLRQ RI WKH FRPSRQHQWV LQYROYHG LQ WKH V\QWKHVLV RI SURVWDJODQGLQV DQG 275 GXULQJ WKH HVWURXV F\FOH DQG SHULLPSODQWDWLRQ SHULRG DUH VKRZQ LQ )LJ DQG )LJ

PAGE 156

)LJ +\SRWKHWLFDO PRGHO IRU WKH UHJXODWLRQ RI 275 3*+6 3*(6 DQG 3*)6 H[SUHVVLRQ GXULQJ WKH HVWURXV F\FOH %DUV LQGLFDWH DSSUR[LPDWH P51$ H[SUHVVLRQ GXULQJ WKH HVWURXV F\FOH 2[\WRFLQ UHFHSWRU 275f 2[\WRFLQ 27f ,QWHUIHURQWDX UHFHSWRU ,)15f ,QWHUIHURQWDX ,)1[f /XWHLQL]LQJ KRUPRQH /+f 3URJHVWHURQH 3f (VWURJHQ (f 3URVWDJODQGLQ *+ V\QWKDVH 3*+6f $UDFKLGRQLF DFLG $$f 3URVWDJODQGLQ + 3*+f 3URVWDJODQGLQ )RW 3*)Df 3URVWDJODQGLQ ( 3*(f (VWURJHQ (f 3URVWDJODQGLQ ) V\QWKDVH 3*)6f 3URVWDJODQGLQ ( V\QWKDVH 3*(6f DQG 6WURPDO 67f FHOOV

PAGE 157

' 3*+6 B 3*)6 '2 (VWUXVf L 3*) %UDLQ

PAGE 158

)LJ +\SRWKHWLFDO PRGHO IRU WKH UHJXODWLRQ RI 275 3*+6 3*(6 DQG 3*)6 H[SUHVVLRQ GXULQJ WKH SHULLPSODQWDWLRQ SHULRG %DUV LQGLFDWH DSSUR[LPDWH P51$ H[SUHVVLRQ 2[\WRFLQ UHFHSWRU 275f 2[\WRFLQ 27f ,QWHUIHURQWDX UHFHSWRU ,)15f ,QWHUIHURQ WDX ,)1Wf /XWHLQL]LQJ KRUPRQH /+f 3URJHVWHURQH 3f (VWURJHQ (f 3URVWDJODQGLQ *+ V\QWKDVH 3*+6f $UDFKLGRQLF DFLG $$f 3URVWDJODQGLQ + 3*+f 3URVWDJODQGLQ )D 3*)Df 3URVWDJODQGLQ ( 3*(f (VWURJHQ (f 3URVWDJODQGLQ ) V\QWKDVH 3*)6f 3URVWDJODQGLQ ( V\QWKDVH 3*(6f DQG 6WURPDO 67f FHOOV

PAGE 159

' ' '

PAGE 160

$33(1',; $ &2175$676 )25 75($70(17 3(5,2' 7,0( $1' 7+(,5 ,17(5$&7,216 7DEOH $O 7UHDWPHQW FRQWUDVWV 7 7 7 7 7 &RQWUDVW 7UHDWPHQW 3*)D YV 6DOLQH &RQWUDVW 7UHDWPHQW 'D\ YV 'D\ &RQWUDVW 7UHDWPHQW &RQWUDVW [ &RQWUDVW &RQWUDVW 7UHDWPHQW 6KDP YV 2YDULHFWRPL]HG 7DEOH $ 3HULRG &RQWUDVWV 3HULRG 3HULRG 3HULRG &RQWUDVW 3HULRG 3HULRG YV &RQWUDVW 3HULRG 3HULRG YV 7DEOH $ &RQWUDVWV IRU 7UHDWPHQW [ 3HULRG LQWHUDFWLRQV &RQWUDVW [ &RQWUDVW [ &RQWUDVW [ &RQWUDVW [ &RQWUDVW [ &RQWUDVW [ &RQWUDVW [ &RQWUDVW [

PAGE 161

7DEOH $ 7LPH FRQWUDVWV 7LPH PLQf &RQWUDVW WLPH f &RQWUDVW WLPH f &RQWUDVW WLPH f &RQWUDVW WLPH f &RQWUDVW WLPH f 7DEOH $ 3HULRG r 7LPH &RQWUDVWV 3HULRGr 7LPH ,QWHUDFWLRQV &RQWUDVW [ &RQWUDVW [ &RQWUDVW [ &RQWUDVW [ &RQWUDVW [ &RQWUDVW [ &RQWUDVW [ &RQWUDVW [ &RQWUDVW [ &RQWUDVW [

PAGE 162

$33(1',; % '$7$ )25 275 P51$ (;35(66,21 :HOO 7\SH 3ULPHU3UREH &W 6WG'(9 &W 4W\ QJf 0HDQ 4W\ 6WG'HY $ 671' 275 $ 671' 275 $ 671' 275 $ 671' 275 $ 671' 275 $ 671' 275 $ 671' 275 $ 671' 275 $ 671' 275 $ 671' 275 $OO 671' 275 $ 671' 275 % 671' 275 % 671' 275 % 671' 275 % 671' 275 % 671' 275 % 671' 275 % 671' 275 % 671' 275 % 671' 275 %,2 671' 275 %OO 671' 275 % 671' 275

PAGE 163

$33(1',; & '$7$ )25 6 U51$ (;35(66,21 :HOO 7\SH 3ULPHU3UREH &W 6WG'(9 &W 4W\ SJf 0HDQ 4W\SJf 6WG'HY (O 671' 6 ( 671' 6 ( 671' 6 ( 671' 6 ( 671' 6 ( 671' 6 ( 671' 6 ( 671' 6 ( 671' 6 ( 671' 6 (OO 671' 6 ( 671' 6 ), 671' 6 ) 671' 6 ) 671' 6 ) 671' 6 ) 671' 6 ) 671' 6 ) 671' 6 ) 671' 6 ) 671' 6 ) 671' 6 ), 671' 6 ) 671' 6

PAGE 164

$33(1',; '$7$ )25 3*+6 UQ51$ (;35(66,21 :HOO 7\SH 3ULPHU3UREH &W 6WG'(9 &W 4W\ QJf 0HDQ 4W\ QJf6WG'HY $O 671' 3*+6 $ 671' 3*+6 $ 671' 3*+6 $ 671' 3*+6 $ 671' 3*+6 $ 671' 3*+6 $ 671' 3*+6 $ 671' 3*+6 $ 671' 3*+6 $ 671' 3*+6 $OO 671' 3*+6 $ 671' 3*+6 % 671' 3*+6 % 671' 3*+6 % 671' 3*+6 % 671' 3*+6 % 671' 3*+6 % 671' 3*+6 % 671' 3*+6 % 671' 3*+6 % 671' 3*+6 %,2 671' 3*+6 %OO 671' 3*+6 % 671' 3*+6 &O 671' 3*+6 & 671' 3*+6 & 671' 3*+6 & 671' 3*+6 & 671' 3*+6 & 671' 3*+6

PAGE 165

$33(1',; ( '$7$ )25 3*(6 P51$ (;35(66,21 :HOO 7\SH 3ULPHU3UREH &W 6WG'(9 &W 4W\ QJf 0HDQ 4W\ 6WG'HY $ 671' 3*(6 $ 671' 3*(6 $ 671' 3*(6 $ 671' 3*(6 $ 671' 3*(6 $ 671' 3*(6 $ 671' 3*(6 $ 671' 3*(6 $ 671' 3*(6 % 671' 3*(6 % 671' 3*(6 % 671' 3*(6 % 671' 3*(6 % 671' 3*(6 % 671' 3*(6 % 671' 3*(6 % 671' 3*(6 % 671' 3*(6 &O 671' 3*(6 & 671' 3*(6 & 671' 3*(6 & 671' 3*(6 & 671' 3*(6 & 671' 3*(6 &O 671' 3*(6 & 671' 3*(6 & 671' 3*(6

PAGE 166

$33(1',; ) '$7$ )25 3*)6 P51$ (;35(66,21 :HOO 7\SH 3ULPHU3UREH FW 6WG'(9 &W 4W\ QJf 0HDQ 4W\ 6WG'HY 671' 3*)6 671' 3*)6 671' 3*)6 671' 3*)6 671' 3*)6 671' 3*)6 671' 3*)6 671' 3*)6 671' 3*)6 (O 671' 3*)6 ( 671' 3*)6 ( 671' 3*)6 ( 671' 3*)6 ( 671' 3*)6 ( 671' 3*)6 ( 671' 3*)6 ( 671' 3*)6 ( 671' 3*)6 ), 671' 3*)6 ) 671' 3*)6 ) 671' 3*)6 ) 671' 3*)6 ) 671' 3*)6 ) 671' 3*)6 ) 671' 3*)6 ) 671' 3*)6 ) 671' 3*)6

PAGE 167

5()(5(1&(6 $EGHOJDGLU 6( 6ZDQVRQ / 2OGILHOG -( DQG 6WRUPVKDN ) f 3URVWDJODQGLQ )DLQGXFHG UHOHDVH RI R[\WRFLQ IURP ERYLQH FRUSRUD OWHD LQ YLWUR %LRO 5HSURG $FRVWD 7
PAGE 168

$VVLQGHU 6&DUH\ 0 3DUNLQVRQ 7 DQG 1LFKROVRQ +' f 2[\WRFLQ DQG YDVRSUHVVLQ H[SUHVVLRQ LQ WKH RYLQH WHVWLV DQG HSLGLG\PLV FKDQJHV ZLWK RQVHW RI VSHUPDWRJHQHVLV %LRO 5HSURG %DOH 7/ DQG 'RUVD '0 f &ORQLQJ QRYHO SURPRWHU VHTXHQFH DQG HVWURJHQ UHJXODWLRQ RI D UDW R[\WRFLQ UHFHSWRU JHQH (QGRFULQRORJ\ %DODJXHU 6$ 'URVW 0 )XFKV $5 &KDQJ 60 %LQWD +3 &DQLQR &DQG )LHOGV 0 f (DUO\ SUHJQDQF\ SURVWDQRLG UHVSRQVLYHQHVV WR DQ R[\WRFLQ FKDOOHQJH %LRO 5HSURG 6XSSO f %DUWRO )) 5REHUWV 50 %D]HU ): /HZLV *6 *RGNLQ -' DQG 7KDWFKHU :: f &KDUDFWHUL]DWLRQ RI SURWHLQV SURGXFHG LQ YLWUR E\ SHULDWWDFKPHQW FRQFHSWXVHV %LRO 5HSURG %DWKJDWH 5$' 5XVW : %DOYHUV 0 +DUWXQJ 6 0RUOH\ 6 DQG ,YHOO 5 f 6WUXFWXUH DQG H[SUHVVLRQ RI WKH ERYLQH R[\WRFLQ UHFHSWRU JHQH '1$ &HOO %LRO %DWKJDWH 5$' 7LOOPDQ DQG ,YHOO 5 f 0ROHFXODU PHFKDQLVPV RI ERYLQH R[\WRFLQ UHFHSWRU JHQH UHJXODWLRQ %LRO 5HSURG 6XSSO f %D]HU ): )OHPPLQJ *:6DIH 6+ DQG 6SHQFHU 7( f 7KH RYLQH R[\WRFLQ UHFHSWRU SURPRWHUHQKDQFHU UHJLRQ LV UHVSRQVLYH WR HVWURJHQ UHFHSWRU DOSKD %LRO 5HSURG 6XSSO f %D]HU ): 6SHQFHU 7( DQG 2WW 7/ f ,QWHUIHURQ WDX D QRYHO SUHJQDQF\ UHFRJQLWLRQ VLJQDO $P 5HSURG ,PPXQRO %D]HU ): 7KDWFKHU :: +DQVHQ 30LUDQGR 0$ 2WW 7/ DQG 3ODQWH & f 3K\VLRORJLFDO PHFKDQLVPV RI SUHJQDQF\ UHFRJQLWLRQ LQ UXPLQDQWV 5HSURG )UWLO 6XSSO Of %HDUG $3 DQG /DPPLQJ *( f (VWUDGLRO FRQFHQWUDWLRQ DQG WKH GHYHORSPHQW RI WKH R[\WRFLQ UHFHSWRU DQG R[\WRFLQLQGXFHG SURVWDJODQGLQ )f UHOHDVH LQ HZHV 5HSURG )UWLO %HQ\R ') DQG 3DWH -/ f 7XPRU QHFURVLV IDFWRUDOSKD DOWHUV ERYLQH OXWHDO FHOO V\QWKHWLF FDSDFLW\ DQG YLDELOLW\ (QGRFULQRORJ\ %HUQGWVRQ $. :HDYHU &DQG )RUWXQH -( f 'LIIHUHQWLDO HIIHFWV RI VWHURLG SURGXFWLRQ E\ ERYLQH JUDQXORVD FHOOV 0RO &HOO (QGRFULQRO

PAGE 169

%LQHOOL 0 *X]HORJOX $ %DGLQJD / $UQROG '5 6LURLV DQG +DQVHQ 75 f ,QWHUIHURQ[ PRGXODWHV SKRUERO HVWHULQGXFHG SURGXFWLRQ RI SURVWDJODQGLQ DQG H[SUHVVLRQ RI F\FORR[\JHQDVH DQG SKRVSKROLSDVH $ IURP ERYLQH HQGRPHWULDO FHOOV %LRO 5HSURG %MRUNPDQ 1 f )LQH VWUXFWXUH RI FU\SWDO DQG WURSKREODVWLF JLDQW FHOOV LQ WKH ERYLQH SODFHQWRPH 8OWUDVWUXFW 5HV %ODLU 50 6DDWPDQ 5 /LRX 66 )RUWXQH -( DQG +DQVHO : f 5ROHV RI OHXNRWULHQHV LQ ERYLQH FRLSXV OXWHXP UHJUHVVLRQ DQ LQ YLYR PLFURGLDO\VLV VWXG\ 3URF 6RF ([S %LRO 0HG %RJDFNL 0 DQG .RWZLFD f ,QIOXHQFH RI QRUHSLQHSKULQH RQ SURJHVWHURQH V\QWKHVLV DQG SRVWWUDQVODWLRQDO SURFHVVLQJ RI R[\WRFLQ V\QWKHVLV LQ ERYLQH FRUSXV OXWHXP 7KHULRJHQRORJ\ %RJDFNL 0 6LOYLD :5HNDZLHFNL 5 DQG .RWZLFD f 'LUHFW LQKLELWRU\ HIIHFW RI SURJHVWHURQH RQ R[\WRFLQLQGXFHG VHFUHWLRQ RI SURVWDJODQGLQ )D IURP ERYLQH HQGRPHWULDO WLVVXH %LRO 5HSURG %ULGJHV 3:ULJKW '%XIRUG :, $KPDG 1 +HPDQGH])RQVHFD + 0F&RUPLFN 0/ 6FKULFN )1 'DLOH\ 5$ /HZLV 3( DQG ,QVNHHS (. f $ELOLW\ RI LQGXFHG FRUSRUD OWHD WR PDLQWDLQ SUHJQDQF\ LQ EHHI FRZV $QLP 6FL %XUJHVV -5 DQG 5HGG\ && f ,VRODWLRQ DQG FKDUDFWHUL]DWLRQ RI DQ HQ]\PH IURP VKHHS VHPLQDO YHVLFOHV WKDW FDWDO\]HV WKH JOXWDWKLRQHGHSHQGHQW UHGXFWLRQ RI SURVWDJODQGLQ + WR SURVWDJODQGLQ ) DOSKD %LRFKHP 0RO %LRO ,QW %XUJHVV -5
PAGE 170

%XPV 3' 0HQGHV -U -2%
PAGE 171

'DYLV $)OHHW ,5 +DQVIRUG 3$ +DUULVRQ )$ DQG 0DXO :DONHU )0 f 3XOPRQDU\ PHWDEROLVP RI 3*)D LQ WKH FRQVFLRXV QRQSUHJQDQW FRZ 3K\VLRO /RQGf 3 'HPPHUV .'HUHFND DQG )OLQW $ f 7URSKREODVW LQWHUIHURQ DQG SUHJQDQF\ 5HSURGXFWLRQ GH 0RUDHV $$ DQG +DQVHQ 3f *UDQXORF\WHPDFURSKDJH FRORQ\VWLPXODWLQJ IDFWRU SURPRWHV GHYHORSPHQW RI LQ YLWUR SURGXFHG ERYLQH HPEU\RV %LRO 5HSURG 'HQQLQJ.HQGDOO 3$ DQG :DWKHV '& f $FXWH HIIHFWV RI 3*) /+ DQG HVWUDGLRO RQ VHFRQG PHVVHQJHU V\VWHP DQG RQ WKH VHFUHWLRQ RI R[\WRFLQ DQG SURJHVWHURQH IURP JUDQXORVD DQG HDUO\ OXWHDO FHOOV RI WKH HZH %LRO 5HSURG 'HVQR\HUV '* :HW]HOV & DQG 7KDWFKHU :: f 1DWXUDO DQG UHFRPELQDQW ERYLQH LQWHUIHURQ[ UHJXODWHV EDVDO DQG R[\WRFLQLQGXFHG VHFUHWLRQ RI SURVWDJODQGLQ )D DQG ( E\ HSLWKHOLDO FHOOV DQG VWURPDO FHOOV LQ WKH HQGRPHWULXP 5HSURG )UWLO 'HY 'LD] )$QGHUVRQ /( :X
PAGE 172

(PRQG 9 )RUWLHU 0$ 0XUSK\ %' DQG /DPEHUW 5' f 3URVWDJODQGLQ ( UHJXODWHV ERWK LQWHUOHXNLQ DQG JUDQXORF\WHPDFURSKDJH FRORQ\VWLPXODWLQJ IDFWRU JHQH H[SUHVVLRQ LQ ERYLQH O\PSKRF\WHV %LRO 5HSURG (PRQG 9 0DF/DUHQ /$ .LPPLQV 6 $URVK -$ )RUWLHU 0$ DQG /DPEHUW 5' f 7KH H[SUHVVLRQ RI F\FORR[\JHQDVH DQG JUDQXORF\WHPDFURSKDJHFRORQ\ VWLPXODWLQJ IDFWRU LQ WKH HQGRPHWULDO HSLWKHOLXP RI WKH FRZ LV XSUHJXODWHG GXULQJ HDUO\ SUHJQDQF\ DQG LQ UHVSRQVH WR LQWUDXWHULQH LQIXVLRQV RI LQWHUIHURQWDX %LRO 5HSURG ,Q 3UHVVf )DULQ &( ,PDNDZD )/ +DQVHQ 75 0F'RQHOO -0XUSK\ &1 )DUP 3: DQG 5REHUWV 50 f ([SUHVVLRQ RI WURSKREODVWLF LQWHUIHURQ JHQHV LQ VKHHS DQG FDWWOH %LRO 5HSURG )HQJ +& %KDYH 0 DQG )DLUFORXJK 5f 5HJXODWLRQ RI R[\WRFLQ UHFHSWRU LQ VKHHS WLVVXH VSHFLILFLW\ PXOWLSOH WUDQVFULSWV DQG P51$ HGLWLQJ 5HSURG )UWLO )LHOGV 0%DUURV &0 :DWNLQV :% DQG )LHOGV 3$ f &KDUDFWHUL]DWLRQ RI ODUJH OXWHDO FHOOV DQG WKHLU VHFUHWRU\ JUDQXOHV WKURXJKRXW WKH HVWURXV F\FOH RI WKH FRZ %LRO 5HSURG )LHOGV 0'XERLV : %DOO % 'URVW 0 DQG )LHOGV 3$ f 7KH HIIHFW RI SURVWDJODQGLQ )D RQ PLWRFKRQGULDO HOHFWURQ GHQVH LQFOXVLRQV DQG VHFUHWRU\ JUDQXOHV LQ WKH ERYLQH ODUJH OXWHDO FHOO GXULQJ SUHJQDQF\ $GY ([S 0HG %LRO )LHOGV 0'XERLV : %UDFNHWW .+ )DXONQHU 5) %DOO %$ 0DUWLQ -0 'URVW 0 DQG )LHOGV 3$ f ,QYLYR HIIHFW RI SURVWDJODQGLQ )D WUHDWPHQW RQ VHFUHWRU\ JUDQXOHV LQ WKH FRUSXV OXWHXP RI WKH ODWH SUHJQDQW FRZ 5HSURG )UWLO )LHOGV 0DQG )LHOGV 3$ f /XWHDO QHXURSK\VLQ LQ WKH QRQSUHJQDQW FRZ DQG HZH LPPXQRF\WRFKHPLFDO ORFDOL]DWLRQ LQ PHPEUDQHERXQG VHFUHWRU\ JUDQXOHV RI WKH ODUJH OXWHDO FHOO (QGRFULQRORJ\ )LHOGV 0DQG )LHOGV 3$ f 0RUSKRORJLFDO FKDUDFWHULVWLFV RI WKH ERYLQH FRUSXV OXWHXP GXULQJ WKH HVWURXV F\FOH DQG SUHJQDQF\ 7KHULRJHQRORJ\ )LOLRQ ) %RXFKDUG 1 *RII $. /XVVLHU -* DQG 6LURLV f 0ROHFXODU FORQLQJ DQG LQGXFWLRQ RI ERYLQH SURVWDJODQGLQ ( V\QWKDVH E\ JRQDGRWURSLQV LQ RYDULDQ IROOLFOHV SULRU WR RYXODWLRQ LQ YLYR %LRO &KHP

PAGE 173

)OLQW $3) DQG 6KHOGULFN (/ f 2YDULDQ R[\WRFLQ LV VWLPXODWHG E\ SURVWDJODQGLQV 1DWXUH )OLQW $3) DQG 6KHOGULFN (/ f (YLGHQFH IRU D V\VWHPLF UROH IRU RYDULDQ R[\WRFLQ LQ OXWHDO UHJUHVVLRQ LQ VKHHS 5HSURG )UWLO )OLQW $3) 6KHOGULFN (/ 0F&DQQ 7DQG -RQHV '6& f /XWHDO R[\WRFLQ FKDUDFWHULVWLFV DQG FRQWURO RI V\QFKURQRXV HSLVRGHV RI R[\WRFLQ DQG 3*)D VHFUHWLRQ DW OXWHRO\VLV LQ UXPLQDQWV 'RP $QLP (QGRFULQRO )OLQW $3 6WHZDUW +/DPPLQJ *( DQG 3D\QH -+ f 5ROH RI WKH R[\WRFLQ UHFHSWRU LQ WKH FKRLFH EHWZHHQ F\FOLFLW\ DQG JHVWDWLRQ LQ UXPLQDQWV 5HSURG )UWLO 6XSSO )RUWLHU 0$ *XLOEDXOW /$ DQG *UDVVR ) f 6SHFLILF SURSHUWLHV RI HSLWKHOLDO FHOOV IURP WKH HQGRPHWULXP RI FRZV 5HSURG )UWLO )RXUQLHU 7 )DGRN 9 DQG +HQVRQ 30 f 7XPRU QHFURVLV IDFWRUD LQYHUVHO\ UHJXODWHV SURVWDJODQGLQ DQG SURVWDJODQGLQ ( SURGXFWLRQ LQ PXULQH PDFURSKDJHV %LRO &KHP )UHLGPDQ 6 *XUHYLFK 0 DQG 6KHPHVK 0 f %RYLQH F\FOLF HQGRPHWULXP FRQWDLQV KLJKDIILQLW\ /+K&* ELQGLQJ VLWHV %LRO 5HSURG )ULHGPDQ $ :HLVV 6 /HY\ 1 DQG 0HLGDQ 5 f 5ROH RI WXPRU QHFURVLV IDFWRU D DQG LWV UHFHSWRU LQ OXWHDO UHJUHVVLRQ LQGXFWLRQ RI SURJUDPPHG FHOO GHDWK LQ ERYLQH FRUSXV OXWHXPGHULYHG HQGRWKHOLDO FHOOV %LRO 5HSURG )XFKV $5 f 3URVWDJODQGLQ )D DQG R[\WRFLQ LQWHUDFWLRQV LQ RYDULDQ DQG XWHULQH IXQFWLRQ 6WHURLG %LRFKHP )XFKV $5 %HKUHQV 2 +HOPHU + /LX &+ %DUURV &0 DQG )LHOGV 0f 2[\WRFLQ DQG YDVRSUHVVLQ UHFHSWRUV LQ WKH ERYLQH HQGRPHWULXP DQG P\RPHWULXP GXULQJ WKH HVWURXV F\FOH DQG HDUO\ SUHJQDQF\ (QGRFULQRORJ\ )XFKV $5 'URVW 0 0RULVVH\ 3 &KDQJ 60 DQG )LHOGV 0f 6WHURLG HIIHFWV RQ R[\WRFLQ DQG 3*)D LQWHUDFWLRQ LQ HQGRPHWULXP RI SUHSXEHUWDO KHLIHUV %LRO 5HSURG 6XSSO f

PAGE 174

)XFKV $5 +HOPHU + &KDQJ 60 DQG )LHOGV 0f &RQFHQWUDWLRQV RI R[\WRFLQ UHFHSWRUV LQ WKH SODFHQWD DQG IHWDO PHPEUDQHV RI FRZV GXULQJ SUHJQDQF\ DQG ODERU 5HSURG )UWLO )XFKV $5 ,YHOO 5 )LHOGV 3$ &KDQJ 60 DQG )LHOGV 0Df 2[\WRFLQ UHFHSWRUV LQ WKH ERYLQH FHUYL[ GLVWULEXWLRQ DQG JHQH H[SUHVVLRQ GXULQJ WKH HVWURXV F\FOH %LRO 5HSURG )XFKV $5 ,YHOO 5 *DQ] 1 )LHOGV 0DQG *LPQH] 7 f 6HFUHWLRQ RI R[\WRFLQ LQ SUHJQDQW DQG SDUWXULHQW FRZV FRUSXV OXWHXP PD\ FRQWULEXWH WR SODVPD R[\WRFLQ DW WHUP %LRO 5HSURG )XFKV $5 5ROO\VRQ 0. 0H\HU 0 )LHOGV 00LQL[ -0 DQG 5DQGHO 5' Ef 2[\WRFLQ LQGXFHV SURVWDJODQGLQ ) DOSKD UHOHDVH LQ SUHJQDQW FRZV LQIOXHQFH RI JHVWDWLRQDO DJH DQG R[\WRFLQ UHFHSWRU FRQFHQWUDWLRQV %LRO 5HSURG )XFKV $ 5 %DOYHUV 0 7HOJPDQQ 5 ,YHOO 5 3IDUUHU &' &DOLHVHQ + DQG 'DQW]HU 9 f /RFDOL]DWLRQ RI LQWHUIHURQWDX DQG R[\WRFLQ UHFHSWRU SURWHLQ DQG PHVVHQJHU 51$ LQ ERYLQH SODFHQWRPHV WKURXJKRXW JHVWDWLRQ %LRO 5HSURG ,Q 3UHVVf )XUX\D 0F&DUGOH &$ DQG ,YHOO 5 f 7KH UHJXODWLRQ RI R[\WRFLQ JHQH H[SUHVVLRQ LQ HDUO\ ERYLQH OXWHDO FHOOV 0RO &HOO (QGRFULQRO *LEE : 6XQ 0 *\RPRUH\ 6 /\H 6DQG &KDOOLV -5* f /RFDOL]DWLRQ RI SURVWDJODQGLQ V\QWKDVH W\SH 3*+6f P51$ DQG SURVWDJODQGLQ V\QWKDVH W\SH 3*+6f P51$ LQ RYLQH P\RPHWULXP DQG HQGRPHWULXP WKURXJKRXW JHVWDWLRQ (QGRFULQRO *LPQH] 7 DQG +HQULFNV '0 f 3URORQJDWLRQ RI WKH OXWHDO SKDVH E\ SURVWDJODQGLQ ( GXULQJ WKH HVWURXV F\FOH LQ WKH FRZ 7KHULRJHQRORJ\ *LPSO DQG )DKUHQKRO] ) f 7KH R[\WRFLQ UHFHSWRU V\VWHP VWUXFWXUH IXQFWLRQ DQG UHJXODWLRQ 3K\VLRO 5HY *RGNLQ -' 6PLWK 6( -RKQVRQ 5' DQG 'RUH --( f 7KH UROH RI WURSKREODVW LQWHUIHURQV LQ WKH PDLQWHQDQFH RI HDUO\ SUHJQDQF\ LQ UXPLQDQWV $P 5HSURG ,PPXQRO *RII $. f 5ROH RI R[\WRFLQ LQ HVWURXV F\FOH UHJXODWLRQ $JELRWHFK 1HZV ,QIRUPDWLRQ *RII $. f (PEU\RQLF VLJQDOV DQG VXUYLYDO 5HSURG 'RP $QLP

PAGE 175

*RII $. DQG .RPEH $ f 6WHURLG KRUPRQH PRGXODWLRQ RI SURVWDJODQGLQ V\QWKHVLV LQ WKH UXPLQDQW HQGRPHWULXP %LRO 5HSURG 6XSSO f *UD]]LQL ) *XLOORQ 0RXLODF % DQG =LQJJ ++ f ,QKLELWLRQ RI R[\WRFLQ UHFHSWRU IXQFWLRQ E\ GLUHFW ELQGLQJ RI SURJHVWHURQH 1DWXUH *URVV 76 7KDWFKHU :: +DQVHQ 3-RKQVRQ -: DQG +HOPHU 6' Df 3UHVHQFH RI DQ LQWUDFHOOXODU HQGRPHWULDO LQKLELWRU RI SURVWDJODQGLQ V\QWKHVLV GXULQJ HDUO\ SUHJQDQF\ LQ WKH FRZ 7KHULRJHQRORJ\ *URVV 76 7KDWFKHU :: +DQVHQ 3DQG /DFURL[ 0& Ef 3URVWDJODQGLQ VHFUHWLRQ E\ SHULIXVHG ERYLQH HQGRPHWULXP VHFUHWLRQ WRZDUGV WKH P\RPHWULDO DQG OXPLQDO VLGHV DW GD\ SRVWHVWUXV DV DOWHUHG E\ SUHJQDQF\ 3URVWDJODQGLQV *URVV 76 DQG :LOOLDPV :) f %RYLQH SODFHQWDO SURVWDJODQGLQ V\QWKHVLV SULQFLSDO FHOO V\QWKHVLV DV PRGXODWHG E\ WKH ELQXFOHDWH FHOO %LRO 5HSURG *URVV 76 :LOOLDPV :) DQG 0DQVSHDNHU -( f ,Q YLWUR SODFHQWDO SURVWDJODQGLQ V\QWKHVLV LQ ODWH SUHJQDQW DQG SUHSDUWXP FRZ %LRO 5HSURG 6XSSOOf *XLOEDXOW /$ 7KDWFKHU :: 'URVW 0 DQG +RSNLQV 60 f 6RXUFH RI SURVWDJODQGLQV GXULQJ WKH HDUO\ SRVWSDUWXP SHULRG LQ FDWWOH %LRO 5HSURG *XLOORPRW 0 0LFKHO & *D\H 3 &KDUOLHU 0 7URMDQ DQG 0DUWDO f &HOOXODU ORFDOL]DWLRQ RI DQ HPEU\RQLF LQWHUIHURQ RYLQH WURSKREODVWLQ DQG LWV P51$ LQ VKHHS HPEU\RV GXULQJ SUHJQDQF\ %LRO &HOO *XOGHQDU 6() :DWKHV '& DQG 3LFNHULQJ %7 f ,PPXQRF\WRFKHPLFDO HYLGHQFH IRU WKH SUHVHQFH RI R[\WRFLQ DQG QHXURSK\VLQ LQ WKH ODUJH FHOOV RI WKH ERYLQH FRUSXV OXWHXP &HOO 7LVV 5HV *XYHULFK 0 DQG 6KHPHVK 0 f ,QGXFWLRQ RI F\FORR[\JHQDVH DQG SURVWDJODQGLQ ( SURGXFWLRQ E\ WKH ERYLQH SUHHPEU\R 5HSURG )UWLO 'HY *X]HORJOX $ %LOE\ 7 5 .DPLPXUD 6 0HLNOH $ %DGLQJD / 'LQJHV $& +HUQDQGH] 2 DQG 7KDWFKHU :: f (IIHFWV RI SUHJQDQF\ DQG ERYLQH VRPDWRWURSKLQ E67f RQ HQGRPHWULDO HVWURJHQ UHFHSWRUD 3*+6 DQG 3*)D VHFUHWLRQ RQ GD\ DIWHU HVWUXV LQ QRQODFWDWLQJ GDLU\ FRZV %LRO 5HSURG 6XSSO f

PAGE 176

+DELE $ &UHPLQRQ & )UREHUW < *UDVVL 3UDGHOOHV 3 DQG 0DFORXI f 'HPRQVWUDWLRQ RI DQ LQGXFLEOH F\FORR[\JHQDVH LQ KXPDQ HQGRPHWULDO FHOOV XVLQJ DQWLERGLHV UDLVHG DJDLQVW WKH FDUER[\OWHUPLQDO UHJLRQ RI WKH F\FORR[\JHQDVH %LRO &KHP +DPEHUJ 0 DQG 6DPXHOVVRQ % f 2Q WKH PHFKDQLVP RI WKH ELRV\QWKHVLV RI SURVWDJODQGLQ (O DQG) DOSKD %LRFKHP +D\QHV 1% &ROOLHU 5.LVHU 7( DQG +DIV +' f (IIHFW RI SURVWDJODQGLQ ( DQG )F RQ VHUXP OXWHLQL]LQJ KRUPRQH WHVWRVWHURQH DQG SURODFWLQ LQ EXOOV $QLP 6FL +HDWK ( :HLQVWHLQ 3 0HUULW % 6KDQNV 5 DQG +L[RQ f (IIHFWV RI SURVWDJODQGLQV RQ WKH ERYLQH FRUSXV OXWHXP JUDQXOHV OLSLG LQFOXVLRQV DQG SURJHVWHURQH VHFUHWLRQ %LRO 5HSURG +HGJH *$ f 7KH HIIHFWV RI SURVWDJODQGLQV RQ $&7+ VHFUHWLRQ (QGRFULQRORJ\ +HOPHU 6' +DQVHQ 37KDWFKHU :: -RKQVRQ -: DQG %D]HU ): f ,QWUDXWHULQH LQIXVLRQ RI KLJKO\ HQULFKHG ERYLQH WURSKREODVW SURWHLQ FRPSOH[ H[HUWV DQ DQWLOXWHRO\WLF HIIHFW WR H[WHQG FRUSXV OXWHXP OLIHVSDQ LQ F\FOLF FDWWOH 5HSURG )UWLO +HQGHUVRQ .0 DQG 0F1DWW\ .3 f $ ELRFKHPLFDO K\SRWKHVLV WR H[SODLQ WKH PHFKDQLVP RI OXWHDO UHJUHVVLRQ 3URVWDJODQGLQV +HUVFKPDQQ + 5 f 5HYLHZ SURVWDJODQGLQ V\QWKDVH %LRFKHP %LRSK\V $FWD +LUDNDZD 7 0LQHJLVKL 7 $EH .LVKL + ,EXNL< DQG 0L\DPRWR f $ UROH RI LQVXOLQOLNH JURZWK IDFWRU LQ OXWHLQL]LQJ KRUPRQH UHFHSWRU H[SUHVVLRQ LQ JUDQXORVD FHOOV (QGRFULQRORJ\ A +OD 7 DQG 1HLOVRQ f +XPDQ F\FORR[\JHQDVH F'1$ 3URF 1DWO $FDG 6FL 86$ +RRSHU 6% :DWNLQV :% DQG 7KRUEXP *' f 2[\WRFLQ R[\WRFLQDVVRFLDWHG QHXURSK\VLQ DQG SURVWDJODQGLQ )Q FRQFHQWUDWLRQV LQ WKH XWHURRYDULDQ YHLQ RI SUHJQDQW DQG QRQSUHJQDQW VKHHS (QGRFULQRORJ\ +RUQ 6 %DWKJDWH 5 /LRXWXV & %UDFNHQ DQG ,YHOO 5 f %RYLQH HQGRPHWULDO HSLWKHOLDO FHOOV DV D PRGHO V\VWHP WR VWXG\ R[\WRFLQ UHFHSWRU UHJXODWLRQ +XP 5HSURG 8SGDWH

PAGE 177

+XVOLJ 5/ )RJZHOO 5/ DQG 6PLWK :/ f 7KH SURVWDJODQGLQ IRUPLQJ F\FORR[\JHQDVH RI RYLQH XWHUXV UHODWLRQVKLS WR OXWHDO IXQFWLRQ %LRO 5HSURG ,JQDU7URZEULGJH '0 3LPHQWDO 0 3DUNHU 0* 0F/DFKODQ -$ DQG .RUDFK .6 f 3HSWLGH JURZWK IDFWRU FURVVWDON ZLWK HVWURJHQ UHFHSWRU UHTXLUHV WKH $% GRPDLQ DQG RFFXUV LQGHSHQGHQWO\ RI SURWHLQ NLQDVH & RU HVWUDGLRO (QGRFULQRORJ\ ,PDNDZD &DOVRQ .' 0F*XLUH :&KULVWHQVRQ 5. DQG 7D\ORU $ f (QKDQFHPHQW RI RYLQH WURSKREODVW LQWHUIHURQ E\ JUDQXORF\WH PDFURSKDJHFRORQ\ VWLPXODWLQJ IDFWRU SRVVLEOH LQYROYHPHQW RI SURWHLQ NLQDVH & 0RO (QGRFULQRO ,VKLGD 0 +LUDED\DVKL 6X]XNL 0
PAGE 178

,YHOO 5 DQG :DOWKHU 1 f 7KH UROH RI VWHURLGV LQ WKH R[\WRFLQ KRUPRQH V\VWHP 0RO &HOO (QGRFULQRO -DNREVVRQ 3 0RUJHQVWHP 5 0DQFLQL )RUG+XWFKLQVRQ $ DQG 3HUVVRQ % Df &RPPRQ VWUXFWXUDO IHDWXUHV RI 0$3(*D ZLGHVSUHDG VXSHUIDPLO\ RI PHPEUDQH DVVRFLDWHG SURWHLQV ZLWK KLJKO\ GLYHUJHQW IXQFWLRQV LQ HLFRVDQRLGV DQG JOXWDWKLRQH PHWDEROLVP 3URWHLQ 6FL -DNREVVRQ 3 0RUJHQVWHP 5 0DQFLQL )RUG+XWFKLQVRQ $ DQG 3HUVVRQ % f 0HPEUDQHDVVRFLDWHG SURWHLQV LQ HLFRVDQRLGV DQG JOXWDWKLRQH PHWDEROLVP 0$3(*f $ ZLGHVSUHDG SURWHLQ VXSHUIDPLO\ $P 5HVSLU &ULW &DUH 0HG -DNREVVRQ 3 7KRUHQ 6 0RUJHQVWHP 5 DQG 6DPXHOVVRQ % Ef ,GHQWLILFDWLRQ RI KXPDQ SURVWDJODQGLQ ( V\QWKDVH D PLFURVRPDO JOXWDWKLRQHGHSHQGHQW LQGXFLEOH HQ]\PH FRQVWLWXWLQJ D SRWHQWLDO QRYHO GUXJ WDUJHW 3URF 1DWO $FDG 6FL 86$ -DUU\ + +RPVKXFN 5 3LW]HO / DQG :XWWNH : f 'HPRQVWUDWLRQ RI R[\WRFLQ UHOHDVH E\ ERYLQH OXWHDO FHOOV XVLQJ WKH UHYHUVH KHPRO\WLF SODTXH DVVD\ %LRO 5HSURG -HQQHU /3DUNLQVRQ 7DQG /DPPLQJ *( f 8WHULQH R[\WRFLQ UHFHSWRUV LQ F\FOLF DQG SUHJQDQW FRZV 5HSURG )UWLO -XHQJHO -/ *DUYHULFN +$ -RKQVRQ $/
PAGE 179

.LQGDKO + /LQGHOO -2 DQG (GTYLVW /( f 5HOHDVH RI SURVWDJODQGLQ )D GXULQJ WKH HVWURXV F\FOH $FWD 9HW 6FDQG .LQJ *$WNLQVRQ %$ DQG 5REHUWVRQ +$ f ,PSODQWDWLRQ DQG HDUO\ SODFHQWDWLRQ LQ GRPHVWLF XQJXODWHV 5HSURG )UWLO 6XSSOf .QLFNHUERFNHU -7KDWFKHU :: %D]HU ): 'URVW 0 %DUURQ '+ )LQFKHU .% DQG 5REHUWV 50 f 3URWHLQV VHFUHWHG E\ GD\ WR GD\ FRQFHSWXVHV H[WHQGV FRUSXV OXWHXP IXQFWLRQ LQ FRZV 5HSURG )UWLO .QLVV '$ f &\FORR[\JHQDVHV LQ UHSURGXFWLYH PHGLFLQH DQG ELRORJ\ 6RF *\QHFRO ,QYHVW .RPE $ 6LURLV DQG *RII $. f 3URORQJHG SURJHVWHURQH WUHDWPHQW RI HQGRPHWULDO HSLWKHOLDO FHOOV PRGLILHV WKH HIIHFW RI HVWUDGLRO RQ WKHLU VHQVLWLYLW\ WR R[\WRFLQ 6WHURLGV .RWZLFD %RJDFNL 0 DQG 5HNDZLHFNL 5 f 1HXUDO UHJXODWLRQ RI WKH ERYLQH FRUSXV OXWHXP 'RPHVW $QLP (QGRFULQRO .RWZLFD DQG 6NDU]\QVNL f ,QIOXHQFH RI R[\WRFLQ UHPRYDO IURP WKH FRUSXV OXWHXP RQ VHFUHWRU\ IXQFWLRQ DQG GXUDWLRQ RI WKH HVWURXV F\FOH LQ FDWWOH 5HSURG )UWLO .RWZLFD 6NDU]\QVNL -DURV]HZVNL DQG %RJDFNL 0 f 1RUHSLQHSKULQH DIIHFWV VHFUHWRU\ IXQFWLRQ RI FRUSXV OXWHXP LQGHSHQGHQWO\ RQ SURVWDJODQGLQV LQ FRQVFLRXV FDWWOH 3URVWDJODQGLQV .RWZLFD 6NDU]\QVNL -DURV]HZVNL DQG .RWZLFD & f (IIHFW RI QRUHSLQHSKULQH RQ WKH UHOHDVH RI SURJHVWHURQH DQG RYDULDQ R[\WRFLQ LQ FDWWOH $QLP 5HSURG 6FL .RWZLFD 6NDU]\QVNL -DURV]HZVNL :LOOLDPV / DQG %RJDFNL 0 Df 8WHULQH VHFUHWLRQ RI SURVWDJODQGLQ )D VWLPXODWHG E\ GLIIHUHQW GRVHV RI R[\WRFLQ DQG UHOHDVHG VSRQWDQHRXVO\ GXULQJ OXWHRO\VLV LQ FDWWOH 5HSURG 1XWU 'HY .RWZLFD 6NDU]\QVNL 0 0HOLQ 3 DQG 6WDRVWND % f 7KH XVH RI DQ R[\WRFLQ DQWDJRQLVW WR VWXG\ WKH IXQFWLRQ RI RYDULDQ R[\WRFLQ GXULQJ OXWHRO\VLV LQ FDWWOH 7KHULRJHQRORJ\ .RWZLFD 6NDU]\QVNL 0LV]LHNHO DQG 2NXGD Ef 2[\WRFLQ PRGXODWHV WKH SXOVDWLOH VHFUHWLRQ RI 3*)HW LQ LQLWLDWHG OXWHRO\VLV LQ FDWWOH 5HV 9HW 6FL

PAGE 180

.UDPHU 50 DQG 6KDUS -' f 6WUXFWXUH IXQFWLRQ DQG UHJXODWLRQ RI &D VHQVLWLYH F\WRVROLF SKRVSKROLSDVH $ )(%6 /HWW .XEDWD % 'XV]HQNR 0 .DEXWXWX = 5DZHU 0 6]DOOLHV $ )XMLPRUL ,QXL 7 1R]DNL 7
PAGE 181

/HXQJ 67 'HUHFND 0DQQ *( )OLQW $3) DQG :DWKHV '& f 8WHULQH O\PSKRF\WH GLVWULEXWLRQ DQG LQWHUOHXNLQ H[SUHVVLRQ GXULQJ HDUO\ SUHJQDQF\ LQ FRZV 5HSURG )UWLO /HXQJ 67 DQG :DWKHV '& f (VWUDGLRO UHJXODWLRQ RI R[\WRFLQ UHFHSWRU H[SUHVVLRQ LQ F\FOLF ERYLQH HQGRPHWULXP 5HSURG )UWLO /HZLV *6 7KDWFKHU :: %D]HU ): DQG &XUO -6 f 0HWDEROLVP RI DUDFKLGRQLF DFLG LQ YLWUR E\ ERYLQH EODVWRF\VWV DQG HQGRPHWULXP %LRO 5HSURG /HZLV *6 DQG :DWHUPDQ 5$ f 0HWDEROLVP RI DUDFKLGRQLF DFLG LQ YLWUR RYLQH FRQFHSWXVHV UHFRYHUHG GXULQJ HDUO\ SUHJQDQF\ 3URVWDJODQGLQV /HZLV 76 6KDSLUR 36 DQG $KQ 1* f 6LJQDO WUDQVGXFWLRQ WKURXJK 0$3 NLQDVH FDVFDGHV $GY &DQFHU 5HV /HY\ 1 *RUGLQ 0 6PLWK 0) %ROGHQ7LOOHU 28 DQG 0HLGDQ 5 f +RUPRQDO UHJXODWLRQ DQG FHOOVSHFLILF H[SUHVVLRQ RI HQGRWKHOLQFRQYHUWLQJ HQ]\PH LVRIRUPV LQ ERYLQH RYDULDQ HQGRWKHOLDO DQG VWHURLGRJHQLF FHOOV %LRO 5HSURG /LWWHOO 5& +HQU\ 35 DQG $PPHUPDQ &% f 6WDWLVWLFDO DQDO\VLV RI UHSHDWHG PHDVXUHV GDWD XVLQJ 6$6 SURFHGXUHV $QLP 6FL /LX $QWD\D 0 %RHUERRP /XVVLHU DQG 6LOYHUVLGHV ': f 7KH GHOD\HG DFWLYDWLRQ RI WKH SURVWDJODQGLQ *+ V\QWKDVH SURPRWHU LQ ERYLQH JUDQXORVD FHOOV LV DVVRFLDWHG ZLWK GRZQUHJXODWLRQ RI WUXQFDWHG XSVWUHDP VWLPXODWRU\ IDFWRU %LRO &KHP /LX $QWD\D 0 *RII $. %RHUERRP 6LOYHUVLGHV ': /XVVLHU -* DQG 6LURLV f 0ROHFXODU FKDUDFWHUL]DWLRQ RI ERYLQH SURVWDJODQGLQ *+ V\QWKDVH DQG UHJXODWLRQ LQ XWHULQH VWURPDO FHOOV %LRO 5HSURG /LX &DUULHUH 3' 'RUH 0 DQG 6LURLV f 3URVWDJODQGLQ *+ V\QWKDVH LV H[SUHVVHG LQ ERYLQH SUHRYXODWRU\ IROOLFOHV DIWHU HQGRJHQRXV VXUJH RI OXWHLQL]LQJ KRUPRQH /LX DQG 6LURLV f )ROOLFOH VL]HGHSHQGHQW LQGXFWLRQ RI SURVWDJODQGLQ *+ V\QWKDVH GXULQJ VXSHURYXODWLRQ LQ FDWWOH %LRO 5HSURG 0DGRUH ( +DUYH\ ( 3DUHQW &KDSGHODLQH 3 DQG $URVK -$ f $Q DOGRODVH UHGXFWDVH ZLWK DK\GUR[\VWHURLG GHK\GURJHQDVH DFWLYLW\ LV PRVW OLNHO\ WKH HQ]\PH UHVSRQVLEOH IRU WKH SURGXFWLRQ RI SURVWDJODQGLQ )D LQ WKH ERYLQH HQGRPHWULXP %LRO &KHP

PAGE 182

0DJQHVV 55 +XLH -0 +R\HU */ +XHFNVWHDGW 73 5H\QROGV /3 6HSHULFK *:K\VRQJ DQG :HHPV &: f (IIHFW RI FKURQLF LSVLODWHUDO RU FRQWUDODWHUDO LQWUDXWHULQH LQIXVLRQ RI SURVWDJODQGLQ ( 3*(f RQ OXWHDO IXQFWLRQ RI XQLODWHUDOO\ RYDULHFWRPL]HG HZHV 3URVWDJODQGLQV /HXNRWULHQHV 0HG 0DPOXN 5 &KHQ *UHEHU < 'DYLV DQG 0HLGDQ 5 f &KDUDFWHUL]DWLRQ RI SURVWDJODQGLQ )D DQG /+ UHFHSWRU P51$ H[SUHVVLRQ LQ GLIIHUHQW ERYLQH OXWHDO FHOO W\SHV %LRO 5HSURG 0DQFLQL -$ %ORRG *UD\ *RUGRQ 5 &ODYHDX &KDQ && DQG 5LHQGHDX f &ORQLQJ H[SUHVVLRQ DQG XSUHJXODWLRQ RI LQGXFLEOH UDW SURVWDJODQGLQ ( V\QWKDVH GXULQJ OLSRSRO\VDFFKDULGHLQGXFHG S\UHVLV DQG DGMXYDQWLQGXFHG DUWKULWLV %LRO &KHP 0DQQ *( DQG /DPPLQJ *( f 8VH RI UHSHDWHG ELRSVLHV WR PRQLWRU HQGRPHWULDO R[\WRFLQ UHFHSWRUV LQ FRZV 9HW 5HF 0DQQ *( DQG /DPPLQJ *( f 3URJHVWHURQH LQKLELWLRQ RI WKH GHYHORSPHQW RI WKH OXWHRO\WLF VLJQDO LQ FRZV 5HSURG )UWLO 0DQQ *( DQG /DPPLQJ *( f 7KH LQIOXHQFH RI SURJHVWHURQH GXULQJ HDUO\ SUHJQDQF\ LQ FDWWOH 5HSURG 'RP $QLP 0DQQ *( DQG /DPPLQJ *( f 5HODWLRQVKLS EHWZHHQ PDWHUQDO HQGRFULQH HQYLURQPHQW HDUO\ HPEU\R GHYHORSPHQW DQG LQKLELWLRQ RI OXWHRO\WLF PHFKDQLVP LQ FRZV 5HSURGXFWLRQ 0DQQ *( 0DQQ 6DQG /DPPLQJ *( f 7KH LQWHUUHODWLRQVKLS EHWZHHQ WKH PDWHUQDO KRUPRQH HQYLURQPHQW DQG WKH HPEU\R GXULQJ HDUO\ VWDJHV RI SUHJQDQF\ 5HSURG )UWLO $EVWUDFW 6HULHV 0DQQ *( 3D\QH -+ DQG /DPPLQJ *( f +RUPRQDO UHJXODWLRQ RI R[\WRFLQ LQGXFHG SURVWDJODQGLQ )D VHFUHWLRQ E\ WKH ERYLQH DQG RYLQH XWHUXV LQ YLYR 'RPHVW $QLP (QGRFULQRO 0DUWLQ 5/ :KLWWOH :/ +ROORZD\ $& *\RPRUH\ 6 *LEE : /\H 6 DQG &KDOOLV -5* f 2QWRJHQ\ DQG UHJXODWLRQ RI RYLQH SODFHQWDO SURVWDJODQGLQ ( V\QWKDVH %LRO 5HSURG 0DVKEXP 3% 6KDEDQRZLW] 5% DQG &ODUN 05 f ,PPXQRKLVWRFKHPLFDO ORFDOL]DWLRQ RI SURVWDJODQGLQ + V\QWKDVH LQ WKH HPEU\R DQG XWHUXV RI WKH PRXVH IURP RYXODWLRQ WKURXJK LPSODQWDWLRQ 0RO 5HSURG 'HY

PAGE 183

0DWVXPRWR + 1DUDED + 0XUDNDPL 0 .XGR /
PAGE 184

0LOYDH 5$ +LQFOH\ 67 DQG &DUOVRQ -& f /XWHRWURSLF DQG OXWHRO\WLF PHFKDQLVPV LQ WKH ERYLQH FRUSXV OXWHXP 7KHULRJHQRORJ\ 0LUDQGR 0$ %HFNHU :& DQG :KLWHDNHU 66 f 5HODWLRQVKLSV DPRQJ HQGRPHWULDO R[\WRFLQ UHFHSWRUV R[\WRFLQVWLPXODWHG SKRVSKRLQRVLWLGH K\GURO\VLV DQG SURVWDJODQGLQ )D VHFUHWLRQ LQ YLWUR DQG SODVPD FRQFHQWUDWLRQV RI RYDULDQ VWHURLGV EHIRUH DQG GXULQJ FRUSXV OXWHXP UHJUHVVLRQ LQ F\FOLF KHLIHUV %LRO 5HSURG 0LVKUD '3 0H\HU ++' DQG 3UDNDVK %6 f 9DOLGDWLRQ RI D VHQVLWLYH HQ]\PH LPPXQRDVVD\ IRU GLK\GURNHWR3*)D LQ EXIIDOR SODVPD DQG LWV DSSOLFDWLRQ IRU UHSURGXFWLYH KHDOWK VWDWXV PRQLWRULQJ $QLP 5HSURG 6FL 0L\DPRWR < 6NDU]\QVNL 'DQG 2NXGD f ,V WXPRU QHFURVLV IDFWRU D D WULJJHU IRU WKH LQLWLDWLRQ RI HQGRPHWULDO SURVWDJODQGLQ )D UHOHDVH DW OXWHRO\VLV LQ FDWWOH" %LRO 5HSURG 0L]UDFKL DQG 6KHPHVK 0 f )ROOLFOHVWLPXODWLQJ KRUPRQH UHFHSWRU DQG LWV PHVVHQJHU ULERQXFOHLF DFLG DUH SUHVHQW LQ WKH ERYLQH FHUYL[ DQG FDQ UHJXODWH FHUYLFDO SURVWDQRLG V\QWKHVLV %LRO 5HSURG 0RRQHQ 3 %X\WHQKHN 0 DQG 1XJWHUHQ '+ f 3XULILFDWLRQ RI 3*+3*( LVRPHUDVH IURP VKHHS YHVLFXODU JODQG 0HWK (Q]\PRO 0RULWD / 6FKLQGOHU 0 5HJLHU 0. 2WWR -& +RU 7 'H:LWW '/ DQG 6PLWK :/ f 'LIIHUHQW LQWUDFHOOXODU ORFDWLRQV IRU SURVWDJODQGLQ HQGRSHUR[LGH + V\QWKDVH DQG %LRO &KHP 0XQLU / )XNXQDJD .DQDVDNL + 0L\D]DNL 2KED 7 2NDPXUD + DQG 0L\DPRWR ( f ([SUHVVLRQ RI F\FORR[\JHQDVH E\ SURVWDJODQGLQ ( LQ KXPDQ HQGRPHWULDO DGHQRFDUFLQRPD FHOO OLQH ),(&% %LRO 5HSURG 0XUDNDPL 0 1DUDED + 7DQLRND 7 6HPP\R 1 1DNDWDPL < .RMLPD ) ,NHGD 7 )XHNL 0 8HQR $ 2K 6 DQG .XGR f 5HJXODWLRQ RI SURVWDJODQGLQ ( ELRV\QWKHVLV E\ LQGXFLEOH PHPEUDQHDVVRFLDWHG SURVWDJODQGLQ ( V\QWKDVH WKDW DFWV LQ FRQFHUW ZLWK F\FORR[\JHQDVH %LRO &KHP 0XUDNDPL 6 0L\DPRWR < 6NDU]\QVNL 'DQG 2NXGD f (IIHFWV RI WXPRU QHFURVLV IDFWRUD RQ VHFUHWLRQ RI SURVWDJODQGLQ ( DQG )D LQ ERYLQH HQGRPHWULXP WKURXJKRXW WKH HVWUXV F\FOH 7KHULRJHQRORJ\ 1DJDWD 6 DQG *ROGVWHLQ 3 f 7KH )DV GHDWK IDFWRU 6FLHQFH

PAGE 185

1DQFDUURZ &' %XFNPDVWHU : &KDPOH\ 5, &R[ ,$ &XPPLQV / 'ULQDQ -3 )LQGOD\ -5 *RGLQJ %5HVWDOO : DQG 7KRUEXP *' f +RUPRQDO FKDQJHV DURXQG HVWUXV LQ WKH FRZ 5HSURG )UWLO 1HZFRPE 5 %RRWK :' DQG 5RZVRQ /($ f 7KH HIIHFW RI R[\WRFLQ WUHDWPHQW RQ WKH OHYHOV RI SURVWDJODQGLQ ) LQ WKH EORRG RI KHLIHUV 5HSURG )UWLO 1LFKROV 1 %LQWD + )LHOGV 3 &DPSEHOO7KRPSVRQ 0 'URVW 0 ,YHOO 5 &KDQJ 60 -RKQVRQ ( DQG )LHOGV 0f ([SUHVVLRQ DQG ORFDOL]DWLRQ RI OXWHDO R[\WRFLQ DQG UHOD[LQOLNH IDFWRU GXULQJ WKH SHULLPSODQWDWLRQ SHULRG RI ERYLQH SUHJQDQF\ %LRO 5HSURG 6XSSO f 1LVZHQGHU *' -XHQJHO -/ 6LOYD 3 5ROO\VRQ 0. DQG 0FOQWXVK (: f 0HFKDQLVPV FRQWUROOLQJ WKH IXQFWLRQ DQG OLIH RI WKH FRUSXV OXWHXP 3K\V 5HY 1LVZHQGHU *' 6FZDOO 5+ )LW] 7$ )DULQ &( DQG 6DZ\HU +5 f 5HJXODWLRQ RI OXWHDO IXQFWLRQV LQ GRPHVWLF UXPLQDQWV QHZ FRQFHSWV 5HFHQW 3URJ +RUP 5HV 1RUWKH\ '/ DQG )UHQFK /5 f (IIHFW RI HPEU\R UHPRYDO DQG LQWUDXWHULQH LQIXVLRQ RI HPEU\RQLF KRPRJHQDWHV RQ WKH OLIHVSDQ RI WKH ERYLQH FRUSXV OXWHXP $QLP 6FL 2JLQR 1 0L\DPRWR 7
PAGE 186

3DUHQW &KDSGHODLQH 3 6LURLV DQG )RUWLHU 0$ f ([SUHVVLRQ RI PLFURVRPDO SURVWDJODQGLQ ( V\QWKDVH LQ ERYLQH HQGRPHWULXP FRH[SUHVVLRQ ZLWK F\FORR[\JHQDVH W\SH DQG UHJXODWLRQ E\ LQWHUIHURQ WDX (QGRFULQRORJ\ 3DUHQW 9LOOHQHXYH & $OH[HQFR $3 (DO\ $' DQG )RUWLHU 0$ Df ,QIOXHQFH RI GLIIHUHQW LVRIRUPV RI UHFRPELQDQW WURSKREODVWLF LQWHUIHURQV RQ SURVWDJODQGLQ SURGXFWLRQ LQ FXOWXUHG ERYLQH HQGRPHWULDO FHOOV %LRO 5HSURG 3DUHQW 9LOOHQHXYH & DQG )RUWLHU 0$ Ef (YDOXDWLRQ RI F\FORR[\JHQDVH DQG F\FORR[\JHQDVH WR WKH SURGXFWLRQ RI 3*( DQG 3*)D LQ HSLWKHOLDO FHOOV IURP ERYLQH HQGRPHWULXP 5HSURGXFWLRQ 3DUNLQVRQ 7:DWKHV '& -HQQHU /0 DQG /DPPLQJ *( f 3ODVPD DQG OXWHDO FRQFHQWUDWLRQV RI R[\WRFLQ LQ F\FOLF DQG HDUO\ SUHJQDQW FDWWOH 5HSURG )UWLO 3HQQ\ /$ $UPVWURQJ %UDPOH\ 7$ :HEE 5 &ROOLQV 5 DQG :DWVRQ (' f ,PPXQH FHOOV DQG F\WRNLQH SURGXFWLRQ LQ WKH ERYLQH FRUSXV OXWHXP WKURXJKRXW WKH HVWURXV F\FOH DQG DIWHU LQGXFHG OXWHRO\VLV 5HSURG )UWLO 3H[WRQ -( )RUG 63 :LOVRQ / -U %XWFKHU 5/ DQG ,QVNHHS (. f 3URVWDJODQGLQ ) LQ XWHULQH WLVVXH DQG YHQRXV SODVPD RI HZHV ZLWK LQWUDXWHULQH GHYLFHV $QLP 6FL 3LFDUG f 6WHURLGV WLFNOH FHOOV LQVLGH DQG RXW 1DWXUH 3UDWW %5 %XWFKHU 5/ DQG ,QVNHHS (. f $QWLOXWHRO\WLF HIIHFW RI WKH FRQFHSWDV DQG RI3*( LQ HZHV $QLP 6FL 3UX -. 5XHGD % 5 $XVWLQ .7KDWFKHU :: DQG *X]HORJOX $ f ,QWHUIHURQWDX VXSSUHVVHV SURVWDJODQGLQ )D VHFUHWLRQ LQGHSHQGHQWO\ RI WKH PLWRJHQDFWLYDWHG SURWHLQ NLQDVH DQG QXFOHDU IDFWRU N % SDWKZD\V %LRO 5HSURG 5HGPHU '$ DQG 5H\QROGV /3 f $QJLRJHQHVLV LQ WKH RYDU\ 5HY 5HSURG 5HHVH =KDR ; 0D : %URZQ 1 0D]LDV] -7 DQG 'H\ 6. f &RPSDUDWLYH DQDO\VLV RI SKDUPDFRORJLFDO DQG RU JHQHWLF GLVUXSWLRQ RI F\FORR[\JHQDVH DQG F\FORR[\JHQDVH IXQFWLRQ LQ IHPDOH UHSURGXFWLRQ LQ PLFH (QGRFULQRORJ\

PAGE 187

5HQHJDU 5+ +DIV +' DQG %ULWW -+ f /XWHRO\VLV JURZWK KRUPRQH JOXFRFRWLFRLGV SURODFWLQ DQG PLON SURGXFWLRQ LQ ODFWDWLQJ GDLU\ FRZV JLYHQ SURVWDJODQGLQ )D $QLP 6FL 5LFKDUGV -6 5XVVHO '/ 5RENHU 5/ 'DMHH 0 DQG $OOLVWRQ 71 f 0ROHFXODU PHFKDQLVPV RI RYXODWLRQ DQG OXWHLQL]DWLRQ 0RO &HOO (QGRFULQRO 5REHUWV -6 0F&UDFNHQ -$ *DYDJDQ -( DQG 6RORI 06 f 2[\WRFLQ UHOHDVH RI SURVWDJODQGLQ )D IURP RYLQH HQGRPHWULXP LQ YLWUR FRUUHODWLRQ ZLWK HVWURXV F\FOH DQG R[\WRFLQUHFHSWRU ELQGLQJ (QGRFULQRORJ\ 5REHUWVRQ +$ 'Z\HU 5DQG .LQJ *f (VWURJHQV LQ IHWDO DQG PDWHUQDO IOXLGV WKURXJKRXW SUHJQDQF\ LQ WKH SLJ DQG FRPSDULVRQV ZLWK WKH HZH DQG FRZ (QGRFULQRO 5RELQVRQ 56 0DQQ *( /DPPLQJ *( DQG :DWKHV '& f 7KH HIIHFW RI SUHJQDQF\ RQ WKH H[SUHVVLRQ RI XWHULQH R[\WRFLQ HVWURJHQ DQG SURJHVWHURQH UHFHSWRUV GXULQJ HDUO\ SUHJQDQF\ LQ WKH FRZ (QGRFULQRO 5RELQVRQ 56 0DQQ *( /DPPLQJ *( DQG :DWKHV '& f ([SUHVVLRQ RI R[\WRFLQ HVWURJHQ DQG SURJHVWHURQH UHFHSWRUV LQ XWHULQH ELRSV\ VDPSOHV WKURXJKRXW WKH HVWURXV F\FOH DQG HDUO\ SUHJQDQF\ LQ FRZV 5HSURGXFWLRQ 5XHGD %5 7LOO\ ., %RWURV ,: -ROO\ 3' +DQVHQ 75 +R\HU 3% DQG 7LOO\ -/ f ,QFUHDVHG ED[ DQG LQWHUOHXNLQLSFRQYHUWLQJ HQ]\PH PHVVHQJHU ULERQXFOHLF DFLG OHYHOV FRLQFLGH ZLWK DSRSWRVLV LQ WKH ERYLQH FRUSXV OXWHXP GXULQJ VWUXFWXUDO UHJUHVVLRQ %LRO 5HSURG 6DOOL 8 6XSDQLF 6 DQG 6WRUPVKDN ) f 3KRVSKRU\ODWLRQ RI P\ULVWR\ODWHG DODQLQHULFK & NLQDVH VXEVWUDWH 0$5&.6f SURWHLQ DVVRFLDWHG ZLWK ERYLQH OXWHDO R[\WRFLQ H[RF\WRVLV %LRO 5HSURG 6DQERUQ %0 4LDQ $ .X &< :HQ < $QZHU 0RQJD 0 DQG 6LQJK 63 f 0HFKDQLVPV UHJXODWLQJ R[\WRFLQ UHFHSWRU FRXSOLQJ WR SKRVSKROLSDVH & LQ UDW DQG KXPDQ P\RPHWULXP $GY ([S 0HG %LRO 6DQFKH] 5 1JX\HQ 5RFKD : :KLWH -+ DQG 0DGHU 6 f 'LYHUVLW\ LQ WKH PHFKDQLVPV RI JHQH UHJXODWLRQ E\ HVWURJHQ UHFHSWRUV %LR(VVD\V 6FKDOOHQEHUJHU ( 6FKDPV DQG 0H\HU ++' f 6HTXHQFHV RI SLWXLWDU\ RYDULDQ DQG XWHULQH KRUPRQH VHFUHWLRQ GXULQJ WKH ILUVW ZHHNV RI SUHJQDQF\ LQ GDLU\ FDWWOH 5HSURG )UWLO 6XSSO f

PAGE 188

6FKDPV 6FKDOOHQEHUJHU ( 0H\HU ++' %XOOHUPDQ % %UHLWLQJHU +(Q]HOKRIHU .ROO 5 .UXLS 7$0 :DOWHUV '/ DQG .DUJ + f 2YDULDQ R[\WRFLQ GXULQJ WKH HVWURXV F\FOH LQ FDWWOH $PLFR -$ DQG 5RELQVRQ $* (GVf 2[\WRFLQ &OLQLFDO DQG /DERUDWRU\ 6WXGLHV (OVHYLHU %LRPHGLFDO $PVWHUGDP SS 6FKDPV :DOWHUV '/ DQG 6FKDOOHQEHUJHU ( %XOOHUPDQQ % DQG .DUJ + f 2YDULDQ R[\WRFLQ LQ WKH FRZ $FWD (QGRFU &RSHQ 6XSSO $EVWU 6FKDW] ) 0DUNLHZLF] / DQG *XUSLGH ( f 'LIIHUHQWLDO HIIHFWV RI HVWUDGLRO DUDFKLGRQLF DFLG DQG $ RQ SURVWDJODQGLQ )D RXWSXW E\ HSLWKHOLDO DQG VWURPDO FHOOV RIKXPDQ HQGRPHWULXP (QGRFULQRORJ\ 6KDZ :' DQG %ULWW -+ f ,Q YLYR R[\WRFLQ UHOHDVH IURP PLFURGLDO\]HG ERYLQH FRUSRUD OWHD GXULQJ VSRQWDQHRXV DQG SURVWDJODQGLQLQGXFHG UHJUHVVLRQ %LRO 5HSURG 6KHOGULFN (/ )OLFN6PLWK )O& DQG 'RV 6DQWRV &UX] *f 2[\WRFLQ UHFHSWRU ELQGLQJ DFWLYLW\ LQ FXOWXUHG RYLQH HQGRPHWULXP 5HSURG )UWLO 6KHOGULFN )/ DQG )OLQW $3) Df 5HJUHVVLRQ RI WKH FRUSRUD OWHD LQ VKHHS LQ UHVSRQVH WR FORSURVWHQRO LV QRW DIIHFWHG E\ ORVV RI OXWHDO R[\WRFLQ DIWHU K\VWHUHFWRP\ 5HSURG )UWLO 6KHOGULFN (/ DQG )OLQW $3) Ef /XWHDO FRQFHQWUDWLRQV RI R[\WRFLQ GHFOLQH GXULQJ SUHJQDQF\ LQ WKH HZH 5HSURG )UWLO 6KHOGULFN (/ DQG )OLQW $3) f 3RVWWUDQVODWLRQDO SURFHVVLQJ RI R[\WRFLQ QHXURSK\VLQ SURKRUPRQH LQ WKH RYLQH FRUSXV OXWHXP DFWLYLW\ RI SHSWLG\O JO\FLQH DDPLGDWLQJ PRQRR[\JHQDVH DQG FRQFHQWUDWLRQ RI LWV FRIDFWRU DVFRUELF DFLG (QGRFULQRO 6KHPHVK 0 f $FWLRQV RI JRQDGRWURSLQV RQ WKH XWHUXV 5HSURGXFWLRQ 6KHPHVK 0 *XYHULFK 0 0L]UDFKL 6WUDP < 6KRUH /6 DQG )LHOGV 0 f )XQFWLRQDO LPSRUWDQFH RI ERYLQH XWHULQH DQG YDVFXODU /+K&* UHFHSWRUV 6HP 5HSURG 0HG 6KHPHVK 0 0LODJXLU ) $\DORQ 1 DQG +DQVHO : f 6WHURLGRJHQHVLV DQG SURVWDJODQGLQ V\QWKHVLV E\ FXOWXUHG ERYLQH EODVWRF\VWV 5HSURG )UWLO 6KHPHVK 0 0L]UDFKL 0' *XUHYLFK 0 6WUDP < 6KRUH /6 DQG 0)LHOGV f 'LUHFW LQYROYHPHQW RI OXWHLQL]LQJ KRUPRQH LQ XWHULQH IXQFWLRQ 5HSURG 'RPHVW $QLP

PAGE 189

6LOYLD :/HZLV *6 0F&UDFNHQ -$ 7KDWFKHU :: DQG :LOVRQ / -U f 5HYLHZ KRUPRQDO UHJXODWLRQ RI XWHULQH VHFUHWLRQ RI SURVWDJODQGLQ )D GXULQJ OXWHRO\VLV LQ UXPLQDQWV %LRO 5HSURG 6LOYLD :DQG 7D\ORU 0/ f 5HODWLRQVKLS EHWZHHQ XWHULQH VHFUHWLRQ RI SURVWDJODQGLQ )D LQGXFHG E\ R[\WRFLQ DQG HQGRJHQRXV FRQFHQWUDWLRQV RI HVWUDGLRO DQG SURJHVWHURQH DW WKUHH VWDJHV RI WKH ERYLQH HVWURXV F\FOH $QLP 6FL 6LURLV f ,QGXFWLRQ RI SURVWDJODQGLQ HQGRSHUR[LGH V\QWKDVH E\ KXPDQ FKRULRQLF JRQDGRWURSLQ LQ ERYLQH SUHRYXODWRU\ IROOLFOHV LQ YLYR (QGRFULQRORJ\ 6LURLV DQG 5LFKDUGV -6 f 7UDQVFULSWLRQDO UHJXODWLRQ RI WKH UDW SURVWDJODQGLQ HQGRSHUR[LGH V\QWKDVH JHQH LQ JUDQXORVD FHOOV %LRO &KHP 6NDU]\QVNL '%RJDFNL 0 DQG .RWZLFD f &KDQJHV LQ RYDULDQ R[\WRFLQ VHFUHWLRQ DV DQ LQGLFDWRU RI FRUSXV OXWHXP UHVSRQVH WR SURVWDJODQGLQ ) WUHDWPHQW LQ FDWWOH 7KHULRJHQRORJ\ 6NDU]\QVNL '%RJDFNL 0 DQG .RWZLFD f ,QYROYHPHQW RI RYDULDQ VWHURLGV LQ EDVDO DQG R[\WRFLQVWLPXODWHG SURVWDJODQGLQ 3*f )D VHFUHWLRQ E\ WKH ERYLQH HQGRPHWULXP LQ YLWUR 7KHULRJHQRORJ\ 6NDU]\QVNL '-DURV]HZVNL -DQG 2NXGD f /XWHRWURSKLF PHFKDQLVPV LQ WKH ERYLQH FRUSXV OXWHXP UROH RI R[\WRFLQ SURVWDJODQGLQ )D SURJHVWHURQH DQG QRUHSLQHSKULQH 5HSURG 'HY 6NDU]\QVNL .RED\DVKL 6 DQG 2NXGD Df ,QIOXHQFH RI QLWULF R[LGH DQG QRUHSLQHSKULQH RQ SURVWDJODQGLQ )DLQGXFHG R[\WRFLQ VHFUHWLRQ DQG LQWUDFHOOXODU FDOFLXP PRELOL]DWLRQ LQ FXOWXUHG ERYLQH OXWHDO FHOOV %LRO 5HSURG 6NDU]\QVNL DQG .RWZLFD f 0HFKDQLVP RI QRUHSLQHSKULQH LQIOXHQFH RQ WKH VHFUHWLRQ RI RYDULDQ R[\WRFLQ DQG SURJHVWHURQH LQ FRQVFLRXV FDWWOH 5HSURG )UWLO 6NDU]\QVNL 0L\DPRWR < DQG 2NXGD Ef 3URGXFWLRQ RI SURVWDJODQGLQ )f E\ FXOWXUHG ERYLQH HQGRPHWULDO FHOOV LQ UHVSRQVH WR WXPRU QHFURVLV IDFWRU D FHOO W\SH VSHFLILFLW\ DQG LQWUDFHOOXODU PHFKDQLVPV %LRO 5HSURG 6NDU]\QVNL DQG 2NXGD f 6HQVLWLYLW\ RI ERYLQH FRUSRUD OWHD WR SURVWDJODQGLQ )D LV GHSHQGHQW RQ SURJHVWHURQH R[\WRFLQ DQG SURVWDJODQGLQV %LRO 5HSURG

PAGE 190

6PLWK *: -XHQJHO -/ 0FOQWXVK (:
PAGE 191

6XEEDUDPDLDK &KXQJ :0LFKDOXDUW 3 7HODQJ 1 7DQDEH 7 ,QRXH + -DQJ 0 3H]]XWR -0 DQG 'DQQHQEHUJ $f 5HVYHUDWURO LQKLELWV F\FORR[\JHQDVH WUDQVFULSWLRQ DQG DFWLYLW\ LQ SKRUERO HVWHUWUHDWHG KXPDQ PDPPDU\ HSLWKHOLDO FHOOV %LRO &KHP 6X]XNL 7 )XMLL < 0L\DQR 0 &KHQ /< 7DNDKDVKL 7 DQG :DWDQDEH Df F'1$ FORQLQJ H[SUHVVLRQ DQG PXWDJHQHVLV VWXG\ RI OLYHUW\SH SURVWDJODQGLQ ) V\QWKDVH %LRO &KHP 6X]XNL 7 1LVKL]DZD 0 )XNXL 0 2NXGD ( 1DNDMLPD 7 DQG ,WR 6 Ef F'1$ FORQLQJ H[SUHVVLRQ DQG FKDUDFWHUL]DWLRQ RI KXPDQ SURVWDJODQGLQ ) V\QWKDVH )(%6 /HWW 6ZLQQH\ '& 0DN $< %DUQHWW DQG 5DPHVKD &6 f 'LIIHUHQWLDO DOORVWHULF UHJXODWLRQ RI SURVWDJODQGLQ + V\QWKDVH DQG E\ DUDFKLGRQLF DFLG %LRO &KHP 7DNHPXUD 0 .LPXUD 7 1RPXUD 6 0DNLQR < ,QRYH 7 .LFKXNL 7 .XERWD < 7RNXJDZD < 1RNXQDJD 7 .DPLXUD 6 2QRYH + $]XPD & 6DML ) .LWDPXUD < DQG 7DQL]DZD 2 f ([SUHVVLRQ DQG ORFDOL]DWLRQ RIKXPDQ R[\WRFLQ P51$ DQG LWV SURWHLQ LQ FKRULRQ DQG GHFLGXDV GXULQJ SDUWXULWLRQ &OLQ ,QYHVW 7DQLJXFKL +
PAGE 192

7KDWFKHU :: 6WDSOHV &5 'DQHW'HVQR\HUV 2OGLFN % DQG 6FKPLWW (3 f (PEU\R KHDOWK DQG PRUWDOLW\ LQ VKHHS DQG FDWWOH $QLP 6FL 6XSSO f 7KDWFKHU :: :ROIHQVRQ &XUO -6 5LFR /( .QLFNHUERFNHU -%D]HU ): DQG 'URVW 0 f 3URVWDJODQGLQ G\QDPLFV DVVRFLDWHG ZLWK GHYHORSPHQW RI WKH ERYLQH FRQFHSWDV $QLP 5HSURG 6FL 7KLERGHDX[ -. 0\HUV 0: 5RXVVHO -' DQG *RGNH 5$ f ,QWUDXWHULQH LQIXVLRQ RI SURVWDJODQGLQ ( DQG VXEVHTXHQW OXWHDO IXQFWLRQ LQ FDWWOH 3URVWDJODQGLQV 7KLERQQLHU 0 &RPDUW\ '0 3UHVWRQ -$ 3OHVQLVKHU &/ 'ZHLN 5$ DQG (U]XUXP 6& f +XPDQ YDVFXODU HQGRWKHOLDO FHOOV H[SUHVV R[\WRFLQ UHFHSWRUV (QGRFULQRORJ\ 7KRUHQ 6 DQG -DNREVVRQ 3 f &RRUGLQDWH XS DQG GRZQUHJXODWLRQ RI JOXWDWKLRQH GHSHQGHQW SURVWDJODQGLQ ( V\QWKDVH DQG F\FORR[\JHQDVH LQ $ FHOOV ,QKLELWLRQ E\ 16 DQG OHXNRWULHQH & (XU %LRFKHP 7VDL 6-XHQJHO -/ DQG :LOWEDQN 0& f +RUPRQDO UHJXODWLRQ RI PRQRF\WH FKHPRDWWUDFWDQW SURWHLQ PHVVHQJHU ULERQXFOHLF DFLG H[SUHVVLRQ LQ FRUSRUD OWHD (QGRFULQRORJ\ 7VDL 6 DQG :LOWEDQN 0& f 3URVWDJODQGLQ )D LQGXFHV H[SUHVVLRQ RI SURVWDJODQGLQ *+ V\QWKDVH LQ WKH RYLQH FRUSXV OXWHXP D SRWHQWLDO SRVLWLYH IHHGEDFN ORRS GXULQJ OXWHRO\VLV %LRO 5HSURG 7VDL 6:LOWEDQN 0& DQG %RGHQVWHLQHU .f 'LVWLQFW PHFKDQLVPV UHJXODWH LQGXFWLRQ RI PHVVHQJHU ULERQXFOHLF DFLG IRU SURVWDJODQGLQ *+ V\QWKDVH 3*( (3f UHFHSWRU LQ ERYLQH SUHRYXODWRU\ IROOLFOHV (QGRFULQRORJ\ 7\VHOOLQJ .$ 7KDWFKHU :: %D]HU ): +DQVHQ 3DQG 0LUDQGR 0$ f 0HFKDQLVPV UHJXODWLQJ SURVWDJODQGLQ )D V\QWKHVLV LQ WKH ERYLQH HQGRPHWULXP 'DLU\ 6FL 9DOOHW -/ /DPPLQJ *( DQG %DWWHQ 0 f &RQWURO RI WKH HQGRPHWULDO R[\WRFLQ UHFHSWRUV DQG XWHULQH UHVSRQVH WR R[\WRFLQ E\ SURJHVWHURQH DQG HVWUDGLRO LQ WKH HZH 5HSURG )UWLO 9RVV $. DQG )RUWXQH -( f 2[\WRFLQ VHFUHWLRQ E\ ERYLQH JUDQXORVD FHOOV HIIHFWV RI VWDJH RI IROOLFXODU GHYHORSPHQW JRQDGRWURSLQV DQG FRFXOWXUH ZLWK WKHFD LQWHPD (QGRFULQRORJ\

PAGE 193

:DOWHUV '/ 6FKDPV %XOOHPLDQ % DQG 6FKDOOHQEHUJHU ( f 3XOVDWLOH VHFUHWLRQ RI JRQDGRWURSLQV RYDULDQ VWHURLGV DQG RYDULDQ R[\WRFLQ GXULQJ OXWHRO\VLV LQ WKH FRZ %LRO 5HSURG 6XSSOOf :DUG .(/ /RQJZHOO /& .UHLGHU -/ DQG *RGNH 5$ f (IIHFW RI XQLODWHUDO RYDULHFWRP\ RQ F\FOLQJ KHLIHUV $QLP 6FL :DWDQDEH f 3URVWDJODQGLQ ) V\QWKDVH 3URVWDJODQGLQV 2WKHU /LSLG 0HGLDWRUV :DWDQDEH )XMLL < 1DND\DPD 2NKXER + .XUDPLWVX 6 .DJDPL\DPD ), 1DNDQLVKL 6 DQG +D\DLVKL 2 f 6WUXFWXUDO VLPLODULW\ RI WKH ERYLQH OXQJ SURVWDJODQGLQ ) V\QWKDVH WR OHQV *FU\VWDOOLQ RI WKH (XURSHDQ FRPPRQ IURJ 3URF 1DWO $FDG 6FL 86$ :DWDQDEH
PAGE 194

:HVWEURRN & DQG -DUDEDN f 3XULILFDWLRQ DQG SDUWLDO FKDUDFWHUL]DWLRQ RI DQ 1$'+ OLQNHG GHOWD NHWRSURVWDJODQGLQ UHGXFWDVH IURP KXPDQ SODFHQWD %LRFKHP %LRSK\V 5HV &RPPXQ :LOOLDPV &6 DQG 'XERLV 51 f 3URVWDJODQGLQ HQGRSHUR[LGH V\QWKDVH ZK\ WZR LVRIRUPV" $P 0HG 66 :LOOLDPV */ *D]DO 26 /HVKLQ /6 6WDQNR 5/ DQG $QGHUVRQ // f 3K\VLRORJLFDO UHJXODWLRQ RI PDWHUQDO EHKDYLRXU LQ KHLIHUV UROHV RI JHQLWDO VWLPXODWLRQ LQWUDFHUHEUDO R[\WRFLQ UHOHDVH DQG RYDULDQ VWHURLGV %LRO 5HSURG :LOOLDPV :) /HZLV *6 7KDWFKHU :: DQG 8QGHUZRRG &6 f 3ODVPD GLK\GURNHWR3*)D LQ SUHJQDQW DQG QRQSUHJQDQW KHLIHUV SULRU WR DQG GXULQJ VXUJHU\ DQG IROORZLQJ LQWUDXWHULQH LQMHFWLRQ RI 3*)D 3URVWDJODQGLQV :LOWEDQN 0& :LHS] *.QLFNHUERFNHU -%HOILRUH &DQG 1LVZHQGHU *' f 3URWHLQV VHFUHWHG E\ WKH HDUO\ RYLQH FRQFHSWXV EORFN WKH DFWLRQ RI SURVWDJODQGLQ )D RQ ODUJH OXWHDO FHOOV %LRO 5HSURG :LQWHUJDOHQ 1 7KROH ++ *DOOD +DQG 6FKOHJHO : f 3URVWDJODQGLQ ( NHWRUHGXFWDVH IURP WKH FRUSXV OXWHXP RI D SVHXGRSUHJQDQW UDEELW LV D PHPEHU RI WKH DOGRNHWR UHGXFWDVH VXSHUIDPLO\ IHDWXULQJ K\GUR[\VWHURLG GHK\GURJHQDVH DFWLYLW\ (XU %LRFKHP :ROIHQVRQ '' %DUWRO )) %DGLQJD / %DUURV &0 0DUSOH '1 &XPPLQV :ROI /XF\ 0& 6SHQFHU 7( DQG 7KDWFKHU :: f 6HFUHWLRQ RI 3*)& DQG R[\WRFLQ GXULQJ K\SHUWKHUPLD LQ F\FOLF DQG SUHJQDQW KHLIHUV 7KHULRJHQRORJ\ :RQJ :
PAGE 195

:X :; 0D ;+
PAGE 196

%,2*5$3+,&$/ 6.(7&+ +LODU\ %LQWD ZDV ERUQ LQ 8JDQGD RQ $XJXVW OK WR WKH ODWH 'U 3DXO % %LQWD DQG OPHOGD %LQWD +LODU\ UHFHLYHG KLV %DFKHORU RI 9HWHULQDU\ 0HGLFLQH %90f GHJUHH IURP 0DNHUHUH 8QLYHUVLW\ .DPSDOD 8JDQGD LQ +H ZRUNHG EULHIO\ DV D 7HDFKLQJ $VVLVWDQW LQ WKH 'HSDUWPHQW RI 9HWHULQDU\ 5HSURGXFWLRQ IURP WR +H UHFHLYHG KLV 0DVWHU RI 6FLHQFH GHJUHH LQ 9HWHULQDU\ &OLQLFDO 6WXGLHV IURP 8QLYHUVLW\ RI 1DLUREL .HQ\D LQ +H ZDV DSSRLQWHG D /HFWXUHU LQ WKH 'HSDUWPHQW RI 9HWHULQDU\ 5HSURGXFWLRQ 0DNHUHUH 8QLYHUVLW\ LQ $IWHU FRPSOHWLRQ RI KLV GHJUHH KH ZLOO UHWXUQ WR 8JDQGD WR OHFWXUH DQG FRQGXFW UHVHDUFK LQ WKH 'HSDUWPHQW RI 9HWHULQDU\ 5HSURGXFWLRQ 0DNHUHUH 8QLYHUVLW\

PAGE 197

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 0LFKDHO )LHMGV &KDLU 3URIHVVRU RI$QLPDO 6FLHQFHV FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU GI 3KLORVRSK\ :LOOLDP : 7KDWFKHU *UDGXDWH 5HVHDUFK 3URIHVVRU RI $QLPDO 6FLHQFHV FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRUSe3KLORVRSK\ 3HWHU +DQVHQ 3URIHVVRU RI $QLPDO 6FLHQFHV FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ ,D[/AD 0DDUWHQ 'URVW 3URIHVVRU RI 9HWHULQDU\ 0HGLFLQH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 6FLHQWLVW RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\

PAGE 198

7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI $JULFXOWXUDO DQG /LIH 6FLHQFHV DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 'HFHPEHU 'HDQ *UDGXDWH 6FKRRO

PAGE 199

81,9(56,7< 2) )/25,'$ A