Citation
Regulation of mitochondrial gene expression during early development of Xenopus laevis

Material Information

Title:
Regulation of mitochondrial gene expression during early development of Xenopus laevis
Creator:
Ammini, Chandramohan V
Publication Date:
Language:
English
Physical Description:
xi, 274 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
DNA ( jstor )
Eggs ( jstor )
Embryos ( jstor )
Gels ( jstor )
In vitro fertilization ( jstor )
Messenger RNA ( jstor )
Mitochondria ( jstor )
Mitochondrial DNA ( jstor )
Promoter regions ( jstor )
RNA ( jstor )
Dissertations, Academic -- Molecular Genetics and Microbiology -- UF ( lcsh )
Molecular Genetics and Microbiology thesis, Ph. D ( lcsh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1997.
Bibliography:
Includes bibliographical references (leaves 248-273).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Chandramohan V. Ammini.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
027672258 ( ALEPH )
37274513 ( OCLC )

Downloads

This item has the following downloads:


Full Text










REGULATION OF MITOCHONDRIAL GENE EXPRESSION
DURING EARLY DEVELOPMENT OF XENOPUS LAEVIS













By

CHANDRAMOHAN V. AMMINI


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


1997














ACKNOWLEDGEMENTS


I thank Dr. William W. Hauswirth, my mentor and supervisor, for

his constant support in both academic and personal matters. He gave

me immense freedom in the conduct of experiments and stood by me

during difficult times. I knew I could always count on him. I would

also like to thank all the past and present colleagues in the lab, who

have made life in the lab enjoyable and friendly.

I would like to thank the members of my advisory committee,

Drs. Al Lewin, Maury Swanson, and Tom Rowe, for the various

constructive suggestions they have made during the course of the

investigation and for taking the time to review various documents,

including this one. I also appreciate the input from all the other

faculty and students in the department, which has helped in my

personal growth. I also thank the other personnel in the Department,

especially Joyce Conners and Brad Moore, for their efficient help.

My special thanks go to Hyma, my wife, who has stood by me

during all times, good and bad, and made this all possible.















TABLE OF CONTENTS


ACKNOWLEDGEMENTS

LIST OF TABLES . .

LIST OF FIGURES . .


ABSTRACT .


CHAPTERS


1 INTRODUCTION .
General Introduction. .
Mitnhnnrdrial DNA


Mitochondrial DNA Replication
Mitochondrial Transcription .
Regulation of Mitochondrial Gene


ix
. ix






4
6


Expression .' 15


Focus of Dissertation .

2 MATERIALS AND METHODS .

Frogs . .
DNA Primers . .
Laboratory Fertilization of Eggs.. .
De-jellying of Eggs and Embryos .
Isolation of Mitochondria from Eggs and Embryos. .
Isolation of Mitochondria from Ovary Tissue .
Dimethyl Sulfate Footprinting of Mitochondrial DNA. .
Steady State RNA Analysis. .
Mitochondrial Run On Transcription. .
Measurement of Mitochondrial Adenine Nucleotides
Electrophoretic Mobility Shift Assays .


25
25
25
27
28
29
30
48
56
61
63


: : :


. .








3 STEADY STATE ANALYSIS OF MITOCHONDRIAL
RNA LEVELS . 68

Introduction . 68
Results . 72
Discussion ........ 92

4 ANALYSIS OF PROTEIN-MITOCHONDRIAL DNA
INTERACTIONS AT CRITICAL CIS-ELEMENTS 1 01

Introduction . .. 101
Results. . 115
Discussion . 159

5 MITOCHONDRIAL TRANSCRIPTION RATE ANALYSIS. 178

Introduction . .. 178
Results. . 8 1
Discussion ...... 2 1 2

6 SUMMARY AND PERSPECTIVES ... 230

LIST OF REFERENCES ... 248

BIOGRAPHICAL SKETCH. . 274














LIST OF TABLES


3 -1 Steady state levels of mitochondrial RNA in total egg or
embryonic RNA during early development
of Xenopus laevis ..... 77

3-2 Mitochondrial mRNA steady state levels in isolated
mitochondria from distinct developmental
stages of X. laevis. .. 82

3-3 Steady state levels of mitochondrial RNA (normalized
to mtDNA) during early development of X. laevis 89

5-1 Promoter-wise and overall transcription rates per unit
mitochondrial genome during early development
of Xenopus laevis. . 190

5-2 Mitochondrial adenine nucleotide levels during early
development of Xenopus laevis. 210

5-3 Total adenine nucelotide levels in unfertilized eggs and
early developmental stages of Xenopus laevis 211














LIST OF FIGURES


2-1 Experiment to determine the optimal number of cycles
of linear amplification .. ... .. 43

2-2 Experiment comparing 3 different thermostable DNA
polymerases for accurate amplification of the
footprint ladder .. 45

3-1 Steady state levels of mitochondrial RNA during early
development of Xenopus laevis .. 75

3-2 Steady state levels of mitochondrial RNA isolated from
purified mitochondria during early development
of Xenopus laevis ..... 81

3-3 Steady state levels of mitochondrial RNA per unit
mitochondrial genome during early development
of Xenopus laevis .... 87

3-4 Steady state levels of mitochondrial mRNAs per unit
mitochondrial genome during early development
of Xenopus laevis . 91

3-5 Revised view of mitochondrial gene regulation during
early development of Xenopus laevis 99

4-1 General scheme for in vivo DNA footprinting. 117

4-2 In organello footprint of the promoter region. 122

4-3 In organello footprinting of the D-loop upstream region 124









4-4 Schematic view of protein-DNA interactions detected by
in organello footprinting of the D-loop upstream region 128

4-5 In vivo footprinting of the H-strand of D-loop upstream
region during early development of X. laevis 132

4-6 In vivo footprinting of the L-strand of D-loop upstream
region during early development of X. laevis. 134

4-7 In vivo footprinting of the L-strand of the promoter
region during early development of X. laevis. .. 137

4-8 In organello footprint of the mTERF region
in ovary mtDNA .. 140

4-9 Summary of footprints on the L- and H-strand of the
mTERF region of ovary mtDNA ... 142

4-10 In vivo footprinting of the L-strand of the mTERF region
during early development of X. laevis 146

4-11 In vivo footprinting of the H-strand of the mTERF region
during early development of X. laevis 148

4-12 Gel mobility shift assay for mTERF protein. 152

4-13 Comparison of the relative abundance of mTERF in
distinct developmental stages 156

5-1 Size fractionation of mitochondrial run-on RNA. 183

5-2 Hybridization target panel for strand-specific
detection of run-on transcripts 1 86

5-3 Mitochondrial run-on transcription in early
developmental stages .......... 189

5-4 Promoter-wise and overall transcription rates
during early development .. .. .. 192








5-5 Comparison of mitochondrial transcription rates and
steady state levels of mitochondrial transcripts during
early development of X. laevis 196

5-6 Effect of addition of metabolic intermediates on the
transcription rate of 20 hr stage mitochondria 200

5-7 Effect of addition of metabolic inhibitors on the
transcription rate of 20 hr stage mitochondria .. 204














Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

REGULATION OF MITOCHONDRIAL GENE EXPRESSION
DURING EARLY DEVELOPMENT OF XENOPUS LAEVIS

By

Chandramohan V. Ammini

May, 1997

Chairperson: William W. Hauswirth
Major Department: Molecular Genetics and Microbiology


Mitochondrial transcript levels are actively regulated during early

development of Xenopus laevis, whereas mitochondrial DNA (mtDNA)

levels are constant during this time, providing the unique

opportunity to study mitochondrial transcriptional regulation

decoupled from mtDNA replication. The main focus of this

dissertation was to gain further insights into the molecular

mechanisms of mitochondrial gene regulation in this system.

Measurement of steady state transcript levels per unit

mitochondrial genome showed that transcript levels were basal up to








gastrulation, with a coordinate induction thereafter. Mitochondrial

run-on transcription assays using isolated organelles from distinct

developmental stages showed that transcription was the primary

determinant of differences in transcript abundance. To test whether

transcription was regulated by the changing stoichiometries of the

Xenopus mitochondrial transcription factor A (xl-mtTFA), in vivo

footprinting of mtDNA was carried out. Although footprint assays

confirmed that the mtTFA binds the D-loop region in a phased

manner, no significant differences were detected in the occupancy of

xl-mtTFA during regulated transcription, showing that regulation

was not by changing xl-mtTFA binding to mtDNA. Mitochondrial

transcriptional activity showed a positive correlation with the

metabolic status of mitochondria, as indicated by mitochondrial ATP

measurements and run-on transcription assays in the presence of

metabolic intermediates. This suggests that transcriptional

regulation may be sensitive to the mitochondrial metabolic status.

Footprinting and band shift assays confirmed the presence of the

mitochondrial termination factor (mTERF) in Xenopus mitochondria.

The mode of footprinting suggested a localized distortion of DNA

structure, consistent with in vitro reports of DNA bending by this








protein. However, the binding site was equivalently occupied during

regulated transcription, and band shift assays showed equivalent

protein concentrations during this time, suggesting that mTERF is a

constitutive DNA-bending protein, which remains bound to its

cognate site at all times, posing a physical block to the elongating

RNA polymerase.














CHAPTER 1
INTRODUCTION


General Introduction


Mitochondria are essential organelles of eukaryotic cells which

are largely maternally inherited and play a vital role in cellular

physiology. Their principal function in the cell is production of

adenosine triphosphate (ATP) by the highly efficient process of

oxidative phosphorylation, but they also contribute to the

biosynthesis of macromolecules such as pyrimidines, amino acids,

phospholipids, nucleotides, folate coenzymes, heme, urea, and many

other metabolites (Attardi and Schatz, 1988).

A feature that sets them apart from other organelles is their small

but essential DNA genome, which is distinct from nuclear DNA. Each

human cell has hundreds of mitochondria and thousands of mtDNAs.

The presence of an extranuclear genome necessitates the presence of

biosynthetic machinery for the transcription and replication of

mitochondrial DNA, and mitochondrial ribosomes for the translation

of mitochondrial mRNAs. Mitochondrial biogenesis involves a major

contribution of gene products (more than 300) encoded in the






2

nuclear genome, and a minor, though essential, contribution of gene

products (less than 40) encoded in the mitochondrial genome

(Attardi and Schatz, 1988). Sophisticated mechanisms ensure the

import and intramitochondrial sorting of cytoplasmically synthesized

proteins, phospholipids, and probably a few RNAs. Hence,

mitochondrial biogenesis is complex and under multiple layers of

regulation (Attardi and Schatz, 1988; Chomyn and Attardi, 1992).

The linkage of chronic degenerative human diseases to

mitochondrial dysfunction has resulted in a dramatic upswing of

scientific interest in the biogenesis and regulation of this complex

organelle. Mitochondrial encephalomyopathies are a diverse group

of disorders that result from the structural, biochemical, or genetic

derangement of mitochondria. Therefore, they are manifested

primarily in organs requiring high energy levels, like the brain,

heart, muscle, kidney and endocrine glands. Since these

encephalomyopathies share systemic features, they are named after

the symptoms they induce, like MELAS (Myoclonic Epilepsy, Lactic

Acidosis and Stroke-like episodes), MERRF (Myoclonic Epilepsy with

Ragged-Red Fibers), LHON (Leber's heriditary optic neuropathy), KSS

(Kearns-Sayre syndrome), etc. (Wallace, 1993).

The physiological basis of all these disorders is that mitochondria

have to produce a certain amount of energy continually.






3

Theoretically, a defect in any one of the three to four hundred plus

genes (nuclear- or mitochondrial-encoded) involved in

mitochondrial biogenesis can weaken mitochondrial function, leading

ultimately to chronic degenerative disease. If the mutation is in

mtDNA, an intracellular mixture of normal and mutant mtDNAs is

created- a phenomenon called heteroplasmy (Wallace, 1993).

Replicative segregation of heteroplasmic genotypes towards

homoplasmic types leads to rapid fixation of the mutations (Laipis et

al., 1988; Yoneda et al., 1992). Cellular model systems, where human

cells lacking mtDNA are repopulated with exogenous mitochondria

from patients with mitochondrial myopathies (King and Attardi,

1988; 1989; Chomyn et al., 1991) have provided elegant tools to

study the role of these mtDNA mutations in cellular physiology.

These studies show that even 10-15% of wild type mtDNA, when

present in the same organelle with 85-90% mutant mtDNA, has a

protective effect against protein synthesis and respiration defects,

(Yoneda et al., 1994; Attardi et al., 1995). In human disease, a

similar mechanism is presumed to induce disease when the genetic

threshold is crossed. This explains how a mtDNA mutation can be

present at birth, yet only be clinically manifest in the adult or

primarily affect only certain tissues. In higher plants, mitochondrial

dysfunction, resulting from rearrangements in mtDNA, or






4

incompatibility between mitochondrial and nuclear genetic

backgrounds, often result in cytoplasmic male sterility, causing

infertile pollen (Levings and Brown, 1989).


Mitochondrial DNA


Mitochondrial DNA has the same basic role in all eukaryotes that

contain it: it encodes rRNA and tRNA components of a mitochondrial

protein synthesizing system, which translate a limited number of

mtDNA-encoded mRNAs that code for some of the subunits of key

enzyme systems involved in oxidative phosphorylation. There is

extraordinary variation in the size, structure, organization, and mode

of expression of the mtDNA. They include the gigantic 570-kb circles

of maize (Lonsdale et al., 1984), 46-kb linear molecules of

Tetrahymena (Borst, 1980), 74-85 kb of Saccharomyces cerevisiae

(Zamaroczy and Bernardi, 1986), the extraordinarily complicated

maxicircles of Trypanosoma brucei (Benne, 1985; Simpson, 1987),

and the extremely compact vertebrate mtDNA (16-20 kb). The

existence and structure of vertebrate mtDNA was established more

that 25 years ago. In all vertebrate systems studied to date, mtDNA

is a closed circular duplex species of approximately 16-18 kb, which

in many cases contains a triple-stranded region called the

Displacement loop or D-loop (ranging from 0.5-1.7 kb in different







5

species) at a specific location in the genome. Early studies on the

mode of mtDNA replication revealed that each strand of the duplex

could be distinguished on the basis of G+T base composition: a bias in

composition results in different buoyant densities of each strand

('heavy' or H-strand and 'light' or L-strand) in alkaline cesium

chloride gradients.

The most striking feature of vertebrate mtDNA is its extremely

compact gene organization which allows it to encode information for

37 known genes. The major coding strand (the H-strand) contains 28

genes: two rRNAs, 14 tRNAs, and 12 proteins. The L-strand encodes

8 tRNAs and one protein. The 13 proteins include seven subunits of

NADH dehydrogenase (ND 1, 2, 3, 4, 4L, 5, 6), three subunits of

cytochrome c oxidase (COX 1, 2, 3), two subunits of ATP synthase

(ATPase 6, 8), and the apocytochrome b (Cyt b). In most cases, these

genes abut each other or are separated by only a few nucleotides,

and there are no introns, the only noncoding stretch being in the D-

loop control region housing the transcription and replication

elements. Almost all reading frames lack significant nontranslated

flanking regions (Montoya et al., 1981), and most of them lack even a

complete termination codon, ending instead with either a T or TA

following the last sense codon. In these cases, completion of the






6

termination codon TAA occurs post-transcriptionally by

polyadenylation of the mRNAs (Ojala et al., 1981).

Mitochondrial DNA Replication


The mechanism of vertebrate mtDNA replication has been studied

primarily in cultures of human and mouse cells, yeast, rat liver, and

is understood in considerable detail. In 1973, Berk and Clayton,

using mouse L cell lines lacking the cytoplasmic thymidine kinase

but retaining the mitochondrial enzyme, which allowed selective

radiolabeling of mtDNA, showed that mtDNA replication continues

throughout the cell cycle, doubling at about the same rate as the cell,

with mtDNA molecules being selected at random for replication. This

phenomenon forms the basis of replicative segregation of

heteroplasmic genotypes.

There are two separate and distinct origins of replication for each

strand. The origin of H-strand synthesis (OH) is located within the

non-coding D-loop region of the genome (Robberson and Clayton,

1972; Brown and Vinograd, 1974; Robberson et al., 1974; Tapper and

Clayton, 1981), whereas the origin of L-strand synthesis (OL) is

nested within a cluster of five tRNA genes located several kilobases

away from the On (Martens and Clayton, 1979). A commitment to

mtDNA replication begins by the initiation of H-strand synthesis that






7

results in strand elongation over the entire length of the genome.

Initiation of L-strand synthesis begins only after the 0, is exposed as

a single-stranded template. Asynchronous replication of each strand

then completes replication, the region between the two origins being

replicated last.

The critical elements of the mammalian H-strand replication

origin include the L-strand promoter and three downstream

conserved sequence blocks (CSB I, II, III). The involvement of RNA

primers in the initiation of H-strand synthesis was shown by the

presence of alkali-sensitive 5' ends in D-loop DNA (Gillum and

Clayton, 1979; Brennicke and Clayton, 1981). The RNA primer was

shown to originate from the L-strand promoter (Chang and Clayton,

1985; Chang et al., 1985), with a sharp transition from RNA to DNA

occurring within a series of highly conserved sequence blocks (CSB

1, 2, 3), in a region of mtDNA which is otherwise highly divergent

across species (Walberg and Clayton, 1981). A search for an

endonucleolytic activity with the ability to recognize features of the

CSBs and process nascent RNA transcripts led to the discovery of

mouse RNAase MRP (mitochondrial RNA processing) (Chang and

Clayton, 1987a). This was found to be a ribonucleoprotein, with a

136-nucleotide RNA species (Chang and Clayton, 1987b), with a 10

nucleotide sequence complementary to CSB II (Chang and Clayton,








1989). The involvement of this factor in creating replication primers

has been questioned by a subcellular and suborganellar fractionation

study which failed to detect RNase MRP RNA in mitochondria (Kiss

and Filipowicz, 1992). However, a recent analysis of the RNase MRP

RNA distribution by direct in situ hybridization localized a definable

portion of intracellular RNase MRP to the mitochondria of mouse cells

(Li et al, 1994).

CSB II (also called GC cluster C in yeast), is GC rich and is the most

conserved element in mtDNA replication origins from Saccharomyces

cerevisiae to humans. Xu and Clayton (1995) found a stable and

persistent RNA-DNA hybrid formation beginning at the 5' end of CSB

II during in vitro transcription with templates carrying yeast

replication origins. CSB II was the necessary and sufficient nucleic

acid element for establishing stable hybrids, with the efficiency of

hybrid formation decreasing with increasing distance between CSB II

and the promoter. Once made, the RNA strands of these RNA-DNA

hybrids could be elongated efficiently by mtDNA polymerase. These

results suggest that after transcription initiation, the next critical

step for initiating mtDNA replication is the formation of a stable

RNA-DNA hybrid. Xu and Clayton (1996) also found the formation of

a similar RNA-DNA hybrid (R-loop) in the human system. Efficient

hybrid formation was again dependent on the GC-rich CSB II






9

element. Interestingly, efficient hybrid formation was influenced by

sequences 5' to the hybrid, including the CSB III element. In

structural studies of this RNA-DNA hybrid, Lee and Clayton (1996)

found the R-loop to be exceptionally stable, with extensive

intrastrand folding, suggesting that the RNA strand in the RNA-DNA

is organized into a specific conformation, which may have important

implications for RNA processing in vivo. These newly discovered

features of H-strand priming increase the analogy between mtDNA

replication and ColEl plasmid replication. In the ColEl plasmid origin

of replication, a stretch of six rG residues in the primer RNA,

hybridized to a distant downstream region of template strand dCs at

the ColEl origin, is of fundamental importance in forming primer 3'

ends by stabilizing an RNA-DNA hybrid duplex site recognized by

RNase H (Masukata and Tomizawa, 1990).

After priming occurs in the CSB region, DNA replication either

proceeds to completion or terminates prematurely 500 to 1800

nucleotides (depending on the vertebrate species) downstream

(Gillum and Clayton, 1978; Dunon-Bluteau and Brun, 1987), creating

the triple DNA structure known as the Displacement loop (D-loop),

one of the enduring mysteries of mitochondrial molecular biology

(Kasamatsu et al., 1971; Brown and Vinograd, 1974; Clayton, 1982).

The in vivo role of the D-loop is not understood in any system.






10

Bogenhagen and Clayton (1978) studied the kinetics of D-loop DNA

(7S DNA) formation by pulse-chase experiments in Mouse L-cells.

The half-life of pulse-labeled 7S DNA is approximately 70 minutes, a

turnover so rapid that at least 95% of this DNA pool is lost without

acting as primers for H-strand synthesis, suggesting that the primary

role of D-loop DNA is not replication priming.

After successful H-strand synthesis proceeds approximately two-

thirds of the way around the genome, the L-strand origin, 0L is

exposed (Martens and Clayton, 1979). This origin is located in a 30

to 33 base noncoding region within a cluster of five tRNA genes,

forming a stable stem-loop structure highly conserved in most

vertebrates (Martens and Clayton, 1979; Tapper and Clayton, 1981;

Wong and Clayton, 1985a). A primase activity, distinct from

mitochondrial RNA polymerase, has been identified which recognizes

0, and synthesizes 9-12 base RNA primers, which are then used by

DNA polymerase-yfor L-strand synthesis (Wong and Clayton, 1985b).

Both the conserved stem-loop and 5' flanking sequences are

important for L-strand initiation, with five nucleotides at the base of

this stem loop the site of RNA to DNA transition (Hixson et al., 1986).






11

Mitochondrial Transcription


The coding capacity of the mitochondrial genome is relatively

constant among different organisms (except plant mtDNA, which

encodes more proteins); however, genome size, structure, and mode

of expression are variable. Vertebrate transcription is usually

achieved by symmetrical, almost genome-length polycistronic

transcription (Aloni and Attardi, 1971; Murphy et al., 1975) from

two overlapping divergent promoters in the D-loop region, following

by processing to generate unit-length mRNAs. In contrast, yeast

genomes have at least 20 different promoters, each driving the

expression of shorter polycistronic RNAs (Costanzo and Fox, 1990),

with differences in promoter strength and attenuation of

transcription determining transcript levels (Mueller and Getz, 1986).

Most plant genomes also display multiple promoters (Mulligan et al.,

1988; Levings and Brown, 1989), but differential transcription is

achieved by selective amplification of subgenomic size fragments,

resulting in increased mRNA levels as a consequence of increase in

gene dosage (Muise and Hauswirth, 1995).

Vertebrate mitochondria have only two major promoters, the L-

strand promoter (LSP) and the H-strand promoter (HSP) for

transcription of each strand (Montoya et al., 1982; Chang and Clayton,






12

1984). The existence of a third promoter, specific for transcription of

the rRNA genes, has been proposed (Montoya et al., 1983; Chomyn

and Attardi, 1992) on the basis of SI nuclease protection studies. In

humans, the LSP and HSP, the two bi-directional promoters, are in

close proximity but do not overlap. These promoters require two

distinct sequence elements for activity (Chang and Clayton, 1984;

Hixson and Clayton, 1985; Topper and Clayton, 1989), one

surrounding the initiation site and the other located just upstream of

the start site, required for activation by the human transcription

factor, h-mtTFA (Fisher and Clayton, 1985). Bi-directional

transcription initiation is also seen in chicken (L'Abbe er al., 1991)

and Xenopus laevis (Bogenhagen and Yoza, 1986). In Xenopus, there

are two bi-directional promoter elements, each consisting of two

overlapping octamer sequences (analogous to the nonanucleotide

promoter of yeast) located on opposite DNA strands (Bogenhagen et

al., 1986; Bogenhagen and Yoza, 1986; Bogenhagen and Romanelli,

1988).

The search for protein factors which activate mitochondrial

transcription led to the identification and isolation of the human

mitochondrial transcription factor, h-mtTFA (Fisher and Clayton,

1985). Molecular cloning of this protein from human (Parisi and

Clayton, 1991), yeast (Diffley and Stillman, 1991), and Xenopus laevis






13

(Antoschechkin and Bogenhagen, 1995) revealed homology to the

high mobility group (HMG) of proteins. Another protein, called

mtTFB or the specificity factor in yeast mitochondria, has been

isolated and cloned (Schinkel et al., 1987), and has amino acid

homologies to bacterial o factors (Jang and Jaehning, 1991), but

operates by a distinct mechanism (Shadel and Clayton, 1995).

Recently, Antoschechkin and Bogenhagen (1995) isolated a similar

protein from Xenopus laevis mitochondria, the xl-mtTFB. This is the

first report of the existence of such a protein in metazoan

mitochondria. Mitochondrial transcription factor A (mtTFA) appears

to be the primary transcription factor in human mitochondria,

absolutely required from high levels of specific transcription

initiation in vitro. In contrast, sc-mtTFB appears to be the primary

transcription factor in the yeast system, with the sc-mtTFA protein

playing only a minor role in overall transcription initiation efficiency

(Shadel and Clayton, 1993). In Xenopus laevis, xl-mtTFB appears to

be the basal transcription factor, with xl-mtTFA required for

transcriptional activation (Antoschechkin and Bogenhagen, 1995).

Hence, the role of sc-mtTFA is fundamentally different from its

homologs in vertebrates. In vitro binding studies with purified

mtTFA from yeast, human, and Xenopus mitochondria display






14

generalized binding of this protein to any DNA, but phased or

periodic binding to the DNA of mitochondrial regulatory regions

(Diffley and Stillman, 1991; 1992; Fisher et al., 1992; Antoschechkin

and Bogenhagen, 1995). This led to the suggestion that the in vivo

role of this protein might be in packaging of mtDNA regulatory

elements into a specific structural conformation, a suggestion which

has been confirmed for cow (Ghivizzani et al., 1993), human

(Ghivizzani et al., 1994), and Xenopus (this study) mitochondria by in

organello and in vivo footprinting (Madsen et al., 1996; Ammini et

al., 1996).

General processing of the polycistronic transcripts to generate

individual mRNAs is not fully understood yet. The tRNA genes are

interspersed among the H-strand and L-strand encoded protein

genes, with some of them abutting the rRNA or mRNA sequences.

This peculiar arrangement led to the proposal of the tRNA

punctuation model of RNA processing in mitochondria (Ojala et al.,

1981), implying the existence of a very precise processing machinery

which recognizes the tRNA sequences with an RNAse P-like activity,

and the process is believed to occur co-transcriptionally. The

existence of an RNAse P activity in mitochondria of HeLa cells has

been reported (Doersen et al., 1985), and a 5'- and 3'-tRNA





15

processing activity has been identified and characterized in rat liver

mitochondria (Manam and Van Tuyle, 1987).


Regulation of Mitochondrial Gene Expression


Mitochondrial biogenesis requires the coordination of both nuclear-

and mitochondrial-encoded mitochondrial genes. How this

coordination is achieved to meet the dynamic energy needs of the

cell is still one of the central questions in mitochondrial molecular

biology. The aggregate of the experiments done in this field suggests

that there is no one answer. The mode of regulation seems to be as

varied as the plethora of regulatory events involved in mitochondrial

biogenesis. More is known about the regulation of genes encoded on

mtDNA than those on nuclear-DNA. Mitochondrial gene expression is

regulated by both transcriptional and post-transcriptional

mechanisms. The levels of the ribosomal RNAs seem to be controlled

by a transcription termination mechanism in vertebrate

mitochondria, as the two rRNAs have a 15- to 60-fold higher rate of

synthesis than mRNAs (Gelfand and Attardi, 1981). After initiation

of transcription from the HSP, transcription is terminated

downstream of the ribosomal genes by DNA-binding protein-

mediated termination at a tridecamer sequence in the tRNAle" gene

(Christianson and Clayton, 1986; 1988). The protein factor,





16

mitochondrial transcription termination factor (mTERF), has been

isolated from human mitochondria (Kruse et al., 1989; Hess et al.,

1991) and shown to cause sequence-specific termination of

transcription in vitro. Regulation of mRNA levels has been shown to

operate at the level of differential transcription in some cases. In

yeast, the relative strengths of the multiple promoters, which vary

over a 20-fold range, coupled with transcriptional attenuation

(Mueller and Getz, 1986) of the polycistronic units, have been shown

to dictate transcript levels in mitochondrial run-on assays. Thyroid

hormone is a physiological effector of mammalian mitochondrial

biosynthesis, influencing respiration, cytochrome content, protein

synthesis and increasing mitochondrial RNA levels (Kadenbach et al.,

1964). Mutvei et al. (1989) showed by run-on transcription assays

that the increased mitochondrial transcript levels in rat liver during

thyroid hormone treatment were due to increased mitochondrial

transcription. Many central regulatory events of hormone action are

being increasingly traced to their effects on mitochondrial gene

expression by increasing mitochondrial transcript levels. Androgen

treatment of mice (Cornwall et al., 1992), and corticotropin treatment

of bovine cultured cells (Raikhinstein and Hanukoglu, 1993) both

cause the induction of mitochondrial RNAs, as shown by subtractive

hybridization screens, although the exact mechanism of regulation,






17

whether transcriptional or post-transcriptionally regulated RNA

stability, is not known. In a differential screen to isolate cDNAs for

mRNAs whose levels are suppressed by interferon treatment, many

mitochondrial mRNAs were picked up (Lou et al., 1994). These

results were confirmed by Northern blot analyses and were found to

be at the level of transcription rather than stability of these RNAs,

and was dependent on protein synthesis. Similar screens have

traced increased expression of mitochondrial-encoded genes in

skeletal muscle of humans with diabetes mellitus (Antonetti et al.,

1995), despite decreases in mtDNA copy number, suggesting that the

increased mitochondrial gene expression may contribute to the

increase in mitochondrial respiration observed in uncontrolled

diabetes.

Control at the level of RNA stability is clearly seen for the tRNAs

(King and Attardi, 1993). The tRNA genes belong to three distinct

transcription units, which exhibit widely different rates of

transcription. Thus, in HeLa cells, the rDNA transcription unit is

transcribed -25 times more frequently than the mRNA genes

downstream of the mTERF element, while the L-strand transcription

unit is transcribed 10-16 times more frequently than the H-strand

transcription unit (Chomyn and Attardi, 1992; King and Attardi,

1993). Despite these wide differences in transcription rates of the





18

tRNA genes, the steady state levels of the various tRNAs are more or

less similar. Pulse labeling experiments have indicated that this

uniformity may not be due to differences in the metabolic stability of

the mature tRNAs (half-lives longer than 24 h), but may be due to

elimination of excess tRNA transcripts before they enter the mature

pool (Chomyn and Attardi, 1992; King and Attardi, 1993).

Regulation of gene expression can also be pre-transcriptional, at

the level of gene dosage. The number of mtDNA genomes per cell is

variable and has been estimated as >1000 in mouse L-cell fibroblasts

and >8000 in cultured human cells (Bogenhagen and Clayton, 1974;

Robin and Wong, 1988). In some cases, mtDNA is amplified to

extraordinarily high numbers, as in Xenopus laevis oocytes (-108 per

oocyte) due to the large number (107) of organelles per cell (Chase

and Dawid, 1972; Webb and Smith, 1977). Highly oxidative tissues

such as heart muscle contain a significantly greater number of

mtDNA genomes than do the more glycolytic type II skeletal muscles

(Annex and Williams, 1990). Therefore, mtDNA is not just a static

repository of genetic information but is under dynamic control. A

correlation between gene expression and mtDNA copy number has

been reported in a few cases. Williams et al. (1986) studied the

regulation of mitochondrial gene expression during long-term

electrical stimulation of rabbit skeletal muscle, and found the higher





19

oxidative capacity induced by this protocol to also elevate Cyt b

mRNA, rRNA, and mtDNA levels, suggesting that the regulation was

at the level of mtDNA copy number (Williams, 1986). Amplification

of subgenomic fragments as a mechanism for control of

mitochondrial transcript levels has been reported for maize (Muise

and Hauswirth, 1995).


Focus Of Dissertation


The embryogenesis of vertebrate species like Xenopus laevis and

mouse provide invaluable natural model systems for understanding

some of the intricacies of mitochondrial gene regulation. They

illustrate the existence of general control mechanisms for mtDNA

replication and transcription that are not evident from experiments

with undifferentiated cells growing in culture (Attardi and Schatz,

1988). In both species, mtDNA replication occurs during oogenesis

and stops at maturation, whereas transcription of mtDNA is activated

some time after fertilization, long before the resumption of mtDNA

synthesis. In the mouse, the mitochondrial genome is inactive in the

egg and the 2-cell embryo, after which a high rate of mitochondrial

transcription was detected (Piko and Taylor, 1987). The relative

period of basal transcription in the X. laevis system is longer,

allowing more experimental malleability. The other advantages of





20

choosing Xenopus embryos as a model system for this study are

manifold: this vertebrate embryo is accessible in adequate numbers

throughout the year, its biology has been well studied, efficient

synchronous fertilization can be achieved in the laboratory ex vivo, a

considerable amount of molecular studies on mitochondria and

mtDNA metabolism have been done, and the particular features of

mitochondrial biogenesis and nucleic acid metabolism during early

development make it extremely amenable for fulfilling the aims of

this study. The disadvantage of this system is the non-availability of

Xenopus laevis inbred lines, making it essential to utilize eggs and

embryos from a single female frog within one experiment to avoid

sequence heterogeneity.

Oogenesis in Xenopus laevis is generally characterized by the

synthesis and storage of macromolecules like yolk protein (Wahli et

al., 1981), histones (Woodland, 1980), DNA polymerases (Zierler et

al., 1985), and organelles like ribosomes (Bozzoni et al., 1982;

Pierandrei-Amaldi et al., 1982) and mitochondria (Dawid, 1966;

Chase and Dawid, 1972), to enable rapid divisions during early

cleavage of the embryo without fresh biogenesis of these

components. The stockpiling of mitochondria (-107 organelles per

mature oocyte) also necessitates the dramatic amplification of mtDNA

(Webb and Smith, 1977), which accounts for 99 % of the total oocyte






21

DNA. These mitochondria are partitioned into cleaving cells during

early embryogenesis, with production of new mitochondria occurring

only after two days of fertilization (Chase and Dawid, 1972).

Therefore, active mtDNA replication does not occur in the fully

developed oocyte and in the developing embryos until relatively late

in development (Chase and Dawid, 1972; Webb and Smith, 1977).

However, early studies suggest that transcription of mtDNA is

activated soon after fertilization, long before active synthesis of

mtDNA starts, suggesting a decoupling of mitochondrial transcription

and replication (Chase and Dawid, 1972; Young and Zimmerman,

1973; Dawid et al.. 1985). Meziane et al. (1989) reported further

proof for active regulation of mitochondrial gene expression by

performing Northern analyses of mitochondrial transcripts during

early development. They found high levels of transcripts in the

unfertilized eggs and post-neurula stages (after I day post-

fertilization), with 5- to 10-fold lower levels between 6 and 24 hours

of development. Based on these results, they suggested, contrary to

the findings of the earlier groups, that a fertilization induced

shutdown of mitochondrial transcription occurs in X. laevis, with

active transcription resuming only late during embryogenesis.

However, all four groups agree that resumption of active

mitochondrial transcription appears to be decoupled from active





22

mtDNA replication, emphasizing the value of this natural model for

studying the developmental regulation of mitochondrial gene

expression. Insights gained in this system should be more or less

generally applicable to mammalian mitochondria, as the size,

structure and organization of Xenopus mtDNA are extremely similar

to that mammals, especially human (Roe et al., 1985; Dunon-Bluteau

et al., 1985; Cairns and Bogenhagen, 1986). Additional similarities

can be noted in the similarity of organization of the transcriptional

promoters and mode of transcription from the LSP and HSP

(Bogenhagen and Yoza, 1986; Bogenhagen el al., 1986; Bogenhagen

and Romanelli, 1988), presence of the transcription factors mtTFA

and mtTFB (Antoschechkin and Bogenhagen, 1995), and the presence

of the tridecamer mTERF element (with only one base change from

the human equivalent) at the 16S rRNA/tRNAL'" boundary.

The main focus of this research project was to utilize this natural

model to gain further insights into the molecular mechanisms of the

developmental control of mitochondrial gene expression. However, it

was initially essential to clarify the confusion in the literature

regarding the transcriptional status of the mitochondria during

fertilization and early embryogenesis. To achieve this aim, the steady

state levels of mitochondrial transcripts during early development

were measured by Northern analyses and the value of this system





23

re-established. Then the molecular mechanisms responsible for

these rapid changes in mitochondrial transcript levels were

investigated by two main approaches, mitochondrial run-on

transcription and in vivo footprinting of mtDNA during early

development of X. Iaevis. The mitochondrial run-on transcription

assay was developed based on modifications of the protocol of Gaines

et al. (1987) to measure the transcription rates of mitochondria

isolated from unfertilized eggs and distinct embryonic stages (with

basal and enhanced steady state levels). These assays were aimed at

determining whether the primary determinant of the differential

transcript levels was at a transcriptional or post-transcriptional level.

It is known that changes in mtDNA are not the main regulatory

event, as the levels of mtDNA do not change during the first two days

of development (Chase and Dawid, 1972).

The second approach was to conduct an extensive in vivo DMS

(dimethyl sulfate) footprint analysis of the known regulatory

elements of transcription during the developmental stages of basal

and activated mitochondrial transcription, so that changes in protein-

DNA interactions could be correlated with transcriptional regulation.

In order to perform this comparative analysis, it was initially

essential to establish a baseline in vivo footprint pattern for Xenopus

mtDNA, as no previous studies are available for comparison. This





24

was done by performing in organello DMS footprinting of ovary

mtDNA. An in vivo DMS footprinting protocol based on DMS

treatment of intact eggs and developing embryos was then

developed (Ammini et al., 1996), based on modifications of the

somatic tissue in i" ;..'.* protocols of Ghivizzani et al. (1993). The

regions footprinted were the promoter region, the region between

the promoters and origin of H-strand replication, and the mTERF

element. In addition, band shift assays were designed to look for the

presence of the mTERF protein in Xenopus mitochondria, as its

presence in X. laevis mitochondria is suspected but not confirmed.

The results of these various experiments, along with my

interpretation of the results and predictions about possible

mechanisms for the developmental regulation of mitochondrial gene

expression, are presented in the following chapters.












CHAPTER 2
MATERIALS AND METHODS


Frogs


Sexually mature male and female Xenopus laevis frogs were

purchased from Xenopus I, Ann Arbor, Michigan, and maintained in

separate tanks using standard procedures (Wu and Gerhart, 1991).


DNA Primers


Primers were synthesized by the DNA synthesis core, ICBR,

University of Florida, and gel purified where necessary using

standard procedures (Maniatis et al., 1989).


Laboratory Fertilization of Eggs


Fertilized embryos were obtained using the in vitro fertilization

procedure of Hollinger and Corton (1980). The female frogs were

injected with 700-1000 U HCG (Sigma CG-5; reconstituted in water at

1000 U/ml and stored at 40C for 3-4 weeks) into the peritoneal

cavity 10 hrs before eggs were required and placed into white

buckets with about 2 liters of Ix OR-2 (10x OR-2 is 825 mM NaCI, 25

25





26

mM KCI, 10 mM CaCl2, 10 mM MgCl2, 10 mM Na2HPO4, 50 mM

HEPES, pH to 7.8 with NaOH. The divalent and monovalent ions were

made up as separate stocks and diluted just before use). After

spontaneous egg laying begins (usually 12-18 hrs later), eggs were

gently squeezed from the female onto 100 x15 mm petridishes

containing -20 ml of 1 x OR-2 in batches of 400-500 eggs. It was

found that eggs stored in Ix OR-2 could be successfully fertilized

within 4 hrs of laying. Therefore, fertilization could be done in a

staggered fashion in batches of 500-1000 over the course of 8 hrs,

during which time the frog was allowed to lay its eggs at its own

pace in fresh lx OR-2 buffer. In this way, a high yield of fertilized

embryos could be obtained (3000-6000 embryos compared to only

<1500 with the quick squeeze protocol).

Sperm was obtained by dissecting the testes from a male frog

(anesthetized on ice) and gently macerating it in 1.5 X OR-2 to

release the sperm. Sperm motility was observed under a light

microscope after diluting the saline to 0.5 X OR-2. The eggs were

then drained completely of excess IX OR-2, 5-10 drops of the sperm

suspension added to each dish of eggs, and 30-50 ml of IX F-l was

quickly added to dilute the sperm suspension (O1x F-l is 412.5 mM

NaCI, 12.5 mM KCI, 2.5 mM CaCl2, 0.625mM MgCl2, 5 mM Na2HP04,






27

25 mM HEPES, pH to 7.8 with NaOH. The divalent and monovalent

ions were made up as separate stocks and diluted just before use).

After re-placing the lid, the petridishes were gently swirled to

evenly distribute the sperm and also to spread out the eggs into a

monolayer, and then left undisturbed. Fertilization can be monitored

within 30 minutes, as fertilized eggs undergo the cortical reaction

and the animal pole rotates to top. Unfertilized and damaged eggs

can then be culled. During the first 8 hours of growth, the Ix F-I

buffer was replaced with 0.2x F-I buffer in the petridishes.

Afterwards, the whole petridish was immersed in a large dish filled

with 2-3 liters of 0.2x F-l buffer. This step is very critical for

obtaining good survival of the embryos. The embryos were allowed

to hatch in this volume of buffer without further changes.


De-jellying of Eggs and Embryos


Eggs and embryos were de-jellied by gently swirling in 2%

Cysteine solution [Cysteine, free base; made using Ix OR-2 within 1

hour of use and titrated to pH 7.8 with NaOH (4.5 ml 1 M NaOH per

100 ml)] for 3-4 minutes, followed by repeated washing in Ix OR-2

(for eggs) or 0.2x F-l (for embryos) to remove traces of the cysteine

solution. The de-jellied eggs or embryos were then gently placed

into a fresh petridish of Ix OR-2 (eggs) or 0.2x F-l (embryos) for





28

sorting and counting using a broad-tipped 10 ml pipet. The eggs and

early embryos are especially fragile after de-jellying and should be

handled only using broad-tipped pipets.


Isolation of Mitochondria from Eggs and Embryos


Mitochondria were purified from eggs and embryos with

modifications of the protocol used by McKee et al. (1990) for the

isolation of heart mitochondria. This protocol was adopted both due

its ease of application and the replacement of EDTA with EGTA, which

is especially important in run-on and band-shift experiments, where

chelation of Mg"' must be avoided.

De-jellied eggs and embryos were floated in MSE buffer (40 mis

for 200-300 eggs or embryos) and homogenized in a glass dounce

homegenizer with a type B teflon pestle with 7-10 strokes. The

homogenate was spun at 1,500 x g for 10 min. in a JA20 rotor; the

supernatant was re-spun as above and the second supernatant spun

at -9,000 x g for 10 min in a JA20 rotor; the pellet was collected,

resuspended in 1 ml of MSE and spun in an Eppendorf tube at 9,000

x g for 2 min. This step was repeated 2-3 times until the

supernatant cleared up to remove traces of fat. The final pellet was

used as such in the experiments involving run-on transcription or

mitochondrial DNA isolation in the footprinting experiments. In






29

experiments where further purification of mitochondria was

necessary (e.g. ATP measurement studies), mitochondria were

purified in a scaled-down sucrose gradient in a TLS-55 rotor. This

gradient was pre-formed with 0.8 ml each of 51% sucrose and 34%

sucrose, and the mitochondrial pellet was resuspended in 20%

sucrose and layered on top in a volume of 0.6 ml. The gradient was

spun at 37,000 rpm in a TLS-55 rotor in a TL100 centrifuge

(Beckman) for 10 min. The mitochondrial band at the 34%/51%

sucrose interface was collected, diluted with an equal volume of MSE

buffer and re-pelleted in an Eppendorf centrifuge at 9,000 x g for 2

min.

Isolation of Mitochondria from Ovary Tissue


Isolation of mitochondria from ovaries of adult frogs was done

according to the protocol used for purification of bovine brain

mitochondria by Hehman and Hauswirth (1992), with the

modifications described below. Whole ovaries were dissected from

anesthetized female frogs and dropped into chilled MSB-Ca-' buffer

(about 100 ml/ovary). The tissue was minced and, homegenized in a

glass homegenizer by three strokes of a motor driven, teflon coated

pestle. Then EDTA was added to a final concentration of 20mM. This

was then passed through three layers of cheese cloth and centrifuged






30

in a JAlO rotor at 1,500 x g for 10 min; the supernatant was collected

and recentrifuged as above. The supernatant from the second spin

was centrifuged in a JAO1 rotor at -17,700 x g for 45 min. The

pellets were gently resuspended in 10 ml of MSB-EDTA per 40 ml of

discarded supernatant and re-spun at -23,000 x g in a JA17 rotor for

20 min. Each pellet was brought up in 10 ml of 20% sucrose-TE

buffer and layered on top of a sucrose step gradient (10 mis each of

51% and 34% sucrose-TE). The gradients were then spun in a

Beckman SW27 rotor at 22,000 rpm for 20 min. The mitochondrial

band at the 34%/51% sucrose interface was carefully collected with a

Pasteur pipet, diluted with an equal volume of MSB-EDTA and

pelleted at -23,000 x g in a JA17 rotor. The pellets were then

processed for in organello methylation or quick-frozen in a dry

ice/ethanol bath and stored at -700C.


Dimethyl Sulfate Footprinting of Mitochondrial DNA


Oligonucleotides


WH352. 21 base oligonucleotide ACT CAA ACC.TCC ACT ATT

GAC. Corresponds to mitochondrial L-strand sequence 17498-17518

(Roe elt al.. 1985).






31

WH353. 21 base oligonucleotide TAA CCA TAA AAT ATG CTA

AGT. Corresponds to mitochondrial H-strand sequence 1725-1705 in

the sequence correction by Dunon-Bluteau et al., (1985), and

incorporating the changes listed in Cairns and Bogenhagen (1986).

WH354. 21 base oligonucleotide CCC ATG TTA TAC ATT TTT

GTA. Corresponds to mitochondrial L-strand sequence 2008-2028

(Roe et al., 1985).

WH355. 21 base oligonucleotide CCT TTA TGC TTT CGG AGC

TTT. Corresponds to H-strand sequence 3832-3812 (Dunon-Bluteau

et al., 1985).

WH356. 21 base oligonucleotide AAT CTG TTG TGA CCT TAA

CCT. Corresponds to L-strand sequence 3073-3093 (Dunon-Bluteau

et al.. 1985).

WH357. 21 base oligonucleotide CTT CAT GTT TTT TTT TTT TCT.

Corresponds to L-strand sequence 3187-3207 (Dunon-Bluteau et al.,

1985).

WH358. 21 base oligonucleotide GTG GAT AAT AAT AGG AAA

GCT. Corresponds to H-strand sequence 3387-3367 (Dunon-Bluteau

et al., 1985).

WH359. 21 base oligonucleotide AGG GCT AGC TAG CGT GGC

AGA. Corresponds to L-strand sequence 4717-4737 (Roe et al.,

1985).






32

WH360. 21 base oligonucleotide TGG GGC CTT TAC GGT GTT

GTA. Corresponds to H-strand 4925-4905 (Roe et al., 1985).


Plasmid Clones


The three clones described below were used to make strand-

specific riboprobes for probing Southern blots in the in organello

footprinting experiments. All the clones were constructed as

described below except where indicated. The DNA of the

corresponding region was PCR amplified with the indicated primers.

For this, the primers were first 5'-end phosphorylated with g-'"P

using T4 polynucleotide kinase (US Biochemicals) according to

manufacturer's instructions. The kinased primers were then used to

amplify the mtDNA fragments with either Taq DNA polymerase (BRL)

or Pfu DNA polymerase (Stratagene). Then the PCR products were

gel purified (where necessary) and ligated with HincII-linearized pBS

(+/-) phagemid (Stratagene) overnight at room temperature. The

linearized vector was 5'-end dephosphorylated with Shrimp Alkaline

Phosphatase (USB), deactivated at 650C for 15 min. and purified after

organic extractions. Different dilutions of the ligations were used to

transform DH5a cells (BRL) according to the supplier's protocols and

plated on LB plates containing ampicillin, IPTG, and X-gal (Maniatis

et al., 1989) White colonies were screened for the presence of the






33

insert as a single copy by digesting with Hind III and BamHI (BRL)

which flank the Hinci site. Positive clones were amplified in a large

scale culture and DNA isolated and purified by either CsCI gradients

(Maniatis et al., 1989) or Wizard maxi-prep columns (Promega

Corporation).

pBSLSP. This plasmid (3405 bp) contains the frog mitochondrial

sequence 3631-3832 in the corrected sequence of Dunon-Bluteau et

al. (1985). This stretch of DNA (amplified with primers WH354 &

WH355) is cloned in the reverse orientation and contains all the

promoter elements in the D-loop region (including LSP 1 & 2 and HSP

1 & 2). Strand-specific riboprobes made from this clone were used

to probe in organello footprint Southern blots of the promoter region

using the Avall site at 3836 as reference.

pBSCSB. This plasmid (3404 bp) contains the frog mitochondrial

sequence 3187-3387 in the corrected sequence of Dunon-Bluteau et

al. (1985). This stretch of DNA (amplified with primers WH357 &

WH 358) is cloned in the forward orientation and contains the two D-

loop 5' start sites, and the conserved sequence box 1 (CSB 1).

Strand-specific riboprobes made from this clone were used to probe

in organello footprint Southern blots of the CSB region using the

HaeIII site at 3187 as reference.





34

pBSmTERF. This plasmid (3412 bp) contains the frog

mitochondrial sequence 4717-4925 (Roe et al., 1985). This stretch of

DNA (amplified with primers WH359 & WH360) is cloned in the

reverse orientation and contains the terminal end of the 16S rRNA

gene, the entire tRNAI- gene carrying the mTERF element, and the

initial sequences of the NDI gene. Strand-specific riboprobes made

from this clone were used to probe in organello footprint Southern

blots of the mTERF region using the SspI site at 4927 as reference.


Riboprobes


The DNA clones were linearized with HindIII for transcription

with T7 RNA polymerase, and with BamHI for transcription with T3

RNA polymerase. For transcription reactions, 1 ug of linearized DNA

was used in a standard analytical scale transcription reaction in the

supplier's buffer (Stratagene), with 100 uCi of a32P-UTP

(3,00OCi/mmol). The whole transcription reaction was loaded on a

4% non-denaturing polyacrylamide gel and the full-length RNA

product band located with a very short exposure (30 sec) on X-ray

film. This band was cut out, macerated in a 15 ml centrifuge tube

and added directly to the hybridization solution.





35

In Organello Methylation of Mitochondrial DNA


After the final centrifugation step, the pelleted mitochondria (-2

ml) were resuspended in an equal volume of phosphate-buffered

saline (PBS: 140 mM NaCI, 2.5 mM KC1, 10 mM Na2HP04, 1.5 mM

KH2PO4, pH 7.5) and 400 ul aliquots were transferred into Eppendorf

tubes and placed at room temperature. Then Dimethyl Sulfate (DMS)

was added in concentrations of 0.125%, 0.25% and 0.5%, vortexed

briefly to mix well and incubated at room temperature for 3 minutes.

Then 1 ml of ice-cold PBS was added to dilute out the DMS and

mitochondria pelleted immediately by centrifuging for 1 min at

10,000 x g. PBS washes were repeated twice to remove all traces of

DMS. Then 400 ul of mitochondrial lysis buffer was added and

mtDNA extracted as described below. The methylation reaction of

0.125% for 3 minutes was found to give satisfactory in organello

reactions which matched the reaction of 0.125% for 1.5 minutes using

purified mitochondrial DNA.


In Vivo Methylation of Eggs and Embryos


De-i.1i..J eggs or embryos Nwere drained of buffer, refloated in

PBS containing 0.125 % DMS and gently swirled for 3 minutes. The

DMS solution was rapidly emptied after 3 minutes and the eggs or





36

embryos repeatedly washed with buffer to remove traces of DMS.

Mitochondria are then isolated by differential centrifugation as

described above, except that banding on sucrose gradients was not

performed. The mitochondrial pellets were quick-frozen and stored

at -800C, or mtDNA was extracted immediately as described below.

Typically, one mitochondrial pellet from a batch of 400 eggs or

embryos yielded sufficient mtDNA to perform 10-12 primer

extension reactions. Similar patterns of methylation in control DNA

were achieved by 0.125% DMS treatment for 30-45 sec.


Purification of Mitochondrial DNA for Footprinting


The mitochondrial pellet was resuspended in 400 ul of lysis

buffer and SDS added to 1%. The mitochondrial lysate was then

extracted twice each with phenol, phenol:chloroform:iso amyl alcohol

(25:24:1), and chloroform and then ethanol precipitated with 2.5

volumes ethanol. For in c ... '. footprinting using Southern

blotting, the mtDNA samples were digested with restriction enzymes

and a 10% aliquot checked on a 1% agarose gel for complete reaction.

The control DNA samples were first methylated as described below

and then used for restriction digestion in order to avoid artifactual

methylation patterns arising on linearized DNA. Restriction digestion

of the DNA samples was not performed in the primer extension






37

protocol as the sequencing reference is provided by the site of

hybridization of the primer. On an average, about 0.8 to 1 ug mtDNA

is recovered from 300-400 eggs, assuming -4 ng mtDNA/egg (Chase

and Dawid, 1972; Webb and Smith, 1977).


In Vitro Methylation of Purified Mitochondrial DNA


Mitochondrial DNA isolated from control mitochondrial pellets

(untreated with DMS either in -* .. lih.' or in vivo) was resuspended

in 200 ul of 50 mM sodium cacodylate (pH 7.0). DMS titrations were

then done for short reaction times (30 sec. to 1.5 min), as necessary

to match the respective extent of in organello or in vivo reaction.

Then 50 ul of chilled DMS stop buffer (1.5 M sodium acetate (pH 7.4),

1 M 2-mercaptoethanol) was added and the mtDNA samples ethanol

precipitated.


Piperidine Cleavage of Methylated DNA


To cleave the mtDNA at methylated residues, the DNA pellets

were resuspended in 200 ul of 10% piperidine and incubated at 900C

for 30 min. Then the DNA was again ethanol precipitated in the

presence of 2.5 M ammonium acetate, resuspended in 200 ul of

water and dried in a speed-vac to remove all traces of piperidine.






38

Samples were resuspended in 20 ul of formamide loading dye (for

Southern blotting) or TE (for primer extension reactions).


Southern Blot Detection of In Organello Footprints


As a preliminary experiment to optimize loading intensities, equal

amounts of test and control mtDNA samples from above (1/20th to

1/10th of each sample) were loaded into adjacent lanes of a 6%

polyacrylamide, 7.5M urea sequencing gel and electrophoresed under

standard sequencing gel conditions. Based on the hybridization

signals on the Southern blots of these gels, loading volumes for each

stage were decided by a combination of visual assessment and

Phosphorimager (Molecular Dynamics) quantitation.

DNA transfer to membrane was by vacuum blotting using the

method of Lopez et al. (1993). Briefly, following electrophoresis, a

precut piece of nylon transfer membrane (Hybond-N+ from

Amersham, Chicago. IL) was placed directly on the gel surface and

allowed to draw the buffer for 5 min. The sandwich was then placed

in a standard gel-drying apparatus, membrane side down, on a single

sheet of Whatman 3mm paper (Whatman Paper Ltd., Clifton, NJ),

covered with plastic wrap, and the DNA transferred to the membrane

by applying vacuum (without heat) for 45 min to 1 hour. After

transfer, DNA was crosslinked to the membrane on a transilluminator





39

at full power for 3-5 minutes. Pre-hybridization and hybridization

were done using the protocol of Church and Gilbert (1984). To

prehybridize the membrane, 30 ml of hybridization solution (7% SDS,

1% BSA, ImM EDTA, and 0.5 M sodium phosphate buffer (0.5 M with

respect to Na', pH 7.2) was added to the rolled-up membrane in a

rolling hybridization bottle (Robbins Scientific) and placed in a

hybridization oven (Biometra, Tampa, FL) for 30 min at 650C. After

prehybridization, the solution was replaced with 10 ml of

hybridization solution containing the crushed polyacrylamide gel

slice containing the labeled probe, and hybridized overnight at 650C.

The hybridized blots were washed three times with 100 ml of wash

buffer (40 mM sodium phosphate buffer, pH 7.2, ImM EDTA, 1% SDS)

at 600C for 30 min each in the hybridization bottles, followed by a

20 min wash in 500 ml of buffer in a Tupperware tray, and exposed

to X-ray film.


Linear Amplification of Footprints by Primer Extension


The most important factor for obtaining accurate and

reproducible sequences is optimal selection of genomic primers. In

theory, a primer can be as close as 10-30 nucleotides to the domain

of interest. However, in practice, I have found that primers located





40

about 100 nucleotides away from the region to be analyzed work

best in providing reproducible genomic ladders which are essentially

free of low molecular weight background. In general, primers which

fall within 70-150 bp of the target region were used successfully.

Some of the primers used in the primer extension footprinting

experiments have been described above for the creation of the three

plasmid clones used for production of riboprobes. Additional

primers which were used in the primer extension footprinting

experiments are described below.

WH 476. 21 base oligonucleotide GGT CAG TTT CTA TCT ATG

AAG. Corresponds to the L-strand sequence 4582-4602 (Roe et al.,

1985).

WH 479. 21 base oligonucleotide TTC TAT ACA AGG CTA ACA

GTC. Corresponds to the H-strand sequence 3582-3602 (Dunon-

Bluteau et al., 1985).

WH 480. 21 base oligonucleotide CGC TAA ACC CCC CTA CCC CCC.

Corresponds to the L-strand sequence 3425-3445 (Dunon-Bluteau et

al., 1985).

End labeling of oligonucleotide primers. Gel purified

primers were 5' end-labeled to a high specific activity with g- 2P

ATP (ICN, 7000 Ci/millimole) and a T4 Polynucleotide Kinase kit (USB

Corporation-Amersham Life Science) in a standard 50 ul reaction.






41

Free label was removed by two sequential ethanol precipitations in

the presence of 2.5 M ammonium acetate.

Optimization of Primer extension reaction conditions.

Preliminary experiments indicated that about one tenth of the

piperidine cleaved DNA sample (about 50-100 ng) was sufficient for

obtaining a useable primer extension signal. Increasing primer

concentration beyond 1 picomole per reaction did not further

enhance signal intensity and led to higher background. The results

of an experiment designed to determine the number of linear

amplification cycles necessary to obtain reproducible results are

shown in Figure 2-1. Amplifying for 10-15 cycles provided adequate

signal intensity, whereas non-specific bands began to appear with a

higher number of cycles (compare lanes 3 and 4 with lanes 6 and 7).

It is important to note that some of the non-specific bands appearing

with higher cycles are 1-2 nucleotides longer than the authentic

bands, suggesting that the Taq DNA polymerase was adding non-

templated nucleotides to the 3' end of duplex DNA (Clark, 1988)

made in earlier cycles. Thermostable polymerases having a 3'-5'

proofreading ability, such as Vent DNA polymerase or Pfu DNA

polymerase. have been used to alleviate this problem in ligation-

mediated PCR (LMPCR) footprinting protocols (Garrity and Wold,



















Figure 2-1. Experiment to determine the optimal number
of cycles of linear amplification. Mitochondrial DNA from X.
laevis ovaries which had been processed for in organello footprinting
(as described for Figures 4-2 and 4-3) was used as a template for
primer extension with "'P-end labeled primer WH 480 as described
in Materials and Methods. The samples were denatured at 940C for 5
min, followed by independent cycling of each reaction for 1, 5, 10,
15, 20, 30, and 40 cycles (lanes 1-7) with the following profile: 940C
for 1 min, 60'C for 1 min, and 720C for 5 min. The reactions were
then phenol extracted, ethanol precipitated, run on 6% sequencing
gels and autoradiographed. Note the appearance of additional bands
which are longer by 1-2 nucleotide, especially in the samples cycled
for 30 and 40 cycles (lanes 6 and 7). Cycling for 15 cycles was found
to be optimal with respect to both signal intensity and fidelity of
reproduction of the footprint ladder.













PCR cycles (#) 1 5 10 15 20 3 0 4 u
Lane (#) 1 2 3 4 5 6 7


C -- 2127


LSP2


- S gLf- 2039

--. --1998




*--1938


N-- VW-1901
l-1895
M11-;I s

















Figure 2-2. Experiment comparing 3 different thermostable
DNA polymerases for accurate amplification of the footprint
ladder. The performance of two thermostable polymerases, Vent
DNA polymerase (NEB) and Pfu DNA polymerase (Stratagene), which
possess 3'-5' proofreading ability in addition to the polymerase
activity, were compared with Taq DNA polymerase (GIBCO BRL),
which does not possess the 3'-5' proofreading function. DNA
template and primer were the same as that described for Figure 2-1.
Each 100-ul reaction was assembled in the manufacturer's
recommended buffer, with 2 mM MgClI, 1 pMol 'P-end labeled
primer, the indicated dNTP concentrations, and 2-2.5 units of the
respective enzyme. The samples were denatured at 940C for 5 min,
then cycled for 5 cycles with the profile: 940C for 2 min, 650c for I
min. 720C for 5 min, followed by 10 cycles with the profile: 94'C for
2 min. 680 for 30 sec, 720C for 3 min. The reactions were then
phenol extracted, ethanol precipitated, run on 6% sequencing gels
and autoradiographed. Note that only Taq DNA polymerase gives
reproducible banding patterns at a wide range of dNTP
concentrations.











DNA polymerase Vent Taq Pfui
dNTP (uM) 20 100 200 20 0 40 60 0 100 100


*- PSB-------r-----2085

.2 0 8 5



LSP2 E...-

-- S ---M---2026


-1998



-1977


h 3lfH-B "-~l -1946

gab -L B-1938

V-U







-1914


CsRBL


- I


-I


1 J 4 -') 0 / N 1 ) 0


----


rc-... OY Cikr ---- -- c- ---
Cr
L;fL~LI

t2' alc--- "i-
ti' ~~llrrrr~r






46

1992). The results of an experiment with Pfu DNA polymerase and

Vent DNA polymerase in a PEF reaction using the manufacturer's

suggested buffers for primer extension are shown in Figure 2-2.

Neither polymerase primer extended accurately in this system,

compared to the reproducible pattern produced by Taq DNA

polymerase at a wide range of dNTP concentrations (compare lanes

4-8 with lanes 1-3 and lanes 9 & 10). The manufacturers suggest

lowering the annealing temperature of primers for these

polymerases due to the lower ionic ircn-iJh of the buffers. However,

these and a variety of other conditions were tried with these

polymerases, but without success (data not shown). It remains

probable that these polymerases could be adapted to this system, but

only after extensive optimization of buffer and PCR conditions, as has

been noted for Vent DNA polymerase in the LMPCR protocols (Garrity

and Wold, 1992; Hornstra and Yang, 1993). However, the need for a

reliable thermostable polymerase which requires minimal buffer

optimizations is ably fulfilled by Taq DNA polymerase, and I have

used this polymerase in all the other experiments described. For Taq

DNA polymerase, a final dNTP concentration of 20 uM was chosen for

specificity and reproducibility (Figure 2-2, lanes 4-8 and data not

shown). Lowering dNTP concentration below this level sacrificed

both fidelity and signal intensity. Most current protocols for primer






47

extension up to 300 or 400 bases recommend extension times of 10

minutes to allow completion of all initiated primers (Garrity and

Wold, 1992). However, an extension time of 3 minutes was found to

be sufficient for a number of primer-template combinations without

compromising fidelity or sensitivity. Based on these considerations, a

typical PEF reaction consisted of:

50-100 ng piperidine cleaved DNA

1 picomole "2P-5' end-labeled primer

IX Taq polymerase reaction buffer (BRL)

2 mM MgC1,

20 uM each of dATP, TTP, dGTP, dCTP

2.5 U thermostable DNA polymerase (BRL)

The reaction was assembled on ice and cycled in a thermal cycler

as follows : denaturing at 940C for 5 minutes, followed by 10-15

cycles with the profile: denaturing at 94 oC for 1 minute, annealing at

45-650C (based on primer T,) for 1 minute, and primer extension at

720C for 3 minutes. The tubes were then immediately chilled on ice,

10 ug of carrier tRNA added, and ethanol precipitated in the

presence of 2.5 M ammonium acetate. An organic extraction prior to

DNA precipitation was usually not necessary. The precipitate was

resuspended in 5 ul of sequencing dye, and 1.5 ul of each reaction





48

resolved in a 6% polyacrylamide-7 M urea gel as a preliminary test

to optimize signal intensities. Using visual inspection or

Phosphorimager quantitation, the signals in each sample were

equalized in a final gel and autoradiographed to obtain the footprint

pattern. Autoradiography at room temperature for 12-48 hours was

usually sufficient to generate adequate signal intensity.


Steady State RNA Analysis


Oligonucleotides


WH 513. 20 base oligonucleotide GTA TAG GCG ATA GAA CAA

TC. Corresponds to the L-strand sequence 3174-3194 in the 16S

gene (Roe et al., 1985).

WH 514. 21 base oligonucleotide CTA CAT TGA TAT AGA GAG

AGG. Corresponds to the H-strand sequence 4655-4675 in the 16S

gene.

WH 515. 20 base oligonucleotide CTC CCA CCA TAT TGA CTT CG.

Corresponds to the L-strand sequence 15680-15699 in the ND6 gene.

WH 516. 20 base oligonucleotide CCT TCT CCT TTT TAT GCT GC.

Corresponds to the H-strand sequence 16092-16110 in the ND6 gene.






49

WH 529. 21 base oligonucleotide CAG CAG ACA CAT CTA TAG

CCT. Corresponds the L-strand sequence 16418-16438 in the Cyt b

gene.

WH 530. 20 base oligonucleotide GTG TAT CTG CAA CTA GGG

CT. Corresponds to the H-strand sequence 17226-17245 in the Cyt b

gene

WH 534. 20 base oligonucleotide ACT TCA CTT CCA CGA CCA

TA. Corresponds to the L-strand sequence 9168-9187 in the Cox II

gene.

WH 535. 20 base oligonucleotide CTA GTA TTG ATG AAG ATC

AG. Corresponds to the H-strand sequence 9771-9790 in the Cox II

gene.

WH 536. 20 base oligonucleotide GAT CCT CCT AGC AGT AGC

AT. Corresponds to the L-strand sequence 4849-4868 in the NDI

gene.

WH 537. 20 base oligonucleotide GTT ATG GCT AGT GTG ATT

GG. Corresponds to the H-strand sequence 5696-5715 in the NDI

gene.

WH 538. 21 base oligonucleotide CTC ACT TCT CAA ACT ACC

TTA. Corresponds to the L-strand sequence 12409-12429 in the ND4

gene.





50

WH 539. 20 base oligonucleotide TGT GTT CTC GGG TAT GTG TA.

Corresponds to the H-strand sequence 13553-13572 in the ND4 gene.

WH 581. 38 base oligonucleotide GTT GGT TGG TTT CGA GGC

CAT GAT TAC TGT TGC CAA TC. Corresponds to the H-strand

sequence 10359-10396 in the ATPase 6 gene. This oligonucleotide

was 5'-end labeled and used as a hybridization probe for detecting

ATPase 6 mRNA in Northern blots.

WH 583. 36 base oligonucleotide GGC GGG TTT GGC AAG AAG

TGG TGA GGT TTA GCG AGG. Corresponds to the H-strand sequence

2634-2669 in the 12S rRNA gene. This oligonucleotide was 5'-end

labeled and used as a hybridization probe for detecting 12 S rRNA in

Northern blots.


Plasmid Clones


The cloning strategy was identical to the one used for the

construction of the footprinting clones described earlier. All the

clones described below were derived from pBS (+/-) phagemid

(Stratagene), with the PCR-amplified gene-specific fragments cloned

into the HinclI site.

pBS16S. This plasmid (4.7 kb) contains the 16 S rRNA sequence

information from 3174-4675 (amplified with oligos WH513 & WH

514). The insert is cloned in the reverse orientation. Therefore, T3






51

RNA polymerase makes the H-strand sense of cRNA whereas T7 RNA

polymerase makes the L-strand sense.

pBSND1. This plasmid (4.066 kb) contains the ND1 gene

sequence information from 4849-5715 (amplified with oligos WH536

& WH537). The insert is cloned in the reverse orientation.

Therefore, the strand sense of the cRNAs are same as above.

pBSCOX II. This plasmid (3.822 kb) contains the Cox II gene

sequence information from 9168-9790 (amplified with oligos WH534

& WH535). The insert is cloned in the reverse orientation.

Therefore, the strand sense of the cRNAs are same as that of pBS16S.

pBSND4. This plasmid (4.362 kb) contains the ND4 gene

sequence information from 12409-13571 (amplified with oligos

WH538 & WH539). The insert is cloned in the forward orientation.

Therefore, T3 RNA polymerase makes the L-strand sense of cRNA

whereas T7 RNA polymerase makes the H-strand sense.

pBSCYTb. This plasmid (4.028 kb) contains the Cytb gene

sequence information from 16417-17245 (amplified by oligos

WH529 & WH530). The insert is cloned in the forward orientation.

Therefore, the strand sense of the cRNAs are same as that of pBSND4.

pBSND6. This plasmid (3.63 kb) contains the ND6 gene

sequence information from 16110-15680 (amplified with oligos WH

516 & WH 515). The insert is cloned in the forward orientation with







52

reference to the linear sequence, but cloned in the reverse

orientation with reference to the gene. Since ND6 is transcribed by

the L-strand promoter, the T3 promoter is still utilized for

synthesizing an antisense probe for the ND6 transcript.


Total RNA Extraction from Eggs and Embryos


Batches of 100 eggs or staged embryos were frozen at -700C and

used for total RNA extraction. The frozen eggs or embryos were

thawed in 10 ml of lysis buffer (4 M Guanidine thiocyanate, 100 mM

sodium acetate, pH 5.0, 5 mM EDTA) and incubated for 20 minutes at

room temperature to facilitate dissociation of nucleoprotein

complexes. The homogenate was then extracted 3-4 times with

phenol:chloroform:isoamyl alcohol (25:24:1, pH 7.0) in 50 ml

centrifuge tubes (Corning or Fisher) to remove pigment, excess

protein and cell debris. Phase separation was achieved by spinning

in a JA-10 rotor at 3,000 x g. The clarified supernatant was then

loaded as a 4.0 ml CsCl solution in SW 41 polyallomer ultracentrifuge

tubes and spun at 38,000 rpm for 24 hrs at 40C. After the spin, the

liquid phase was removed, the clear RNA pellet at the bottom of the

tube rinsed once with 80% ethanol, air-dried and resuspended in TES

buffer (10mM Tris, pH7.4, 1 mM EDTA, 0.1% SDS). The RNA






53

concentrations were then measured spectroscopically and their

A260/Ao0 ratios used as a measure of purity. Typically, ratios more

than 1.9 were obtained. If not, the samples were phenol extracted

again and ethanol precipitated.

As an alternative protocol, TriZol reagent (BRL) was also tried.

Though RNA free of DNA was obtained, abundant amounts of

polysaccharides always co-purified with the RNA, in spite of

repeated phenol extractions and ethanol precipitations. The modified

method reported by Chomczynski and Mackey (1995) for the

removal of polysaccharides from RNA was tried, but polysaccharides

were not removed adequately. Since polysaccharides interfere with

spectroscopic readings, the former method was followed in all the

experiments reported for total RNA levels.


Isolation of Total Mitochondrial Nucleic Acids


For isolating total mitochondrial RNA, crude mitochondrial pellets

were lyzed in TriZol reagent (BRL) and RNA extracted according to

the manufacturer's protocols. Co-purification of polysaccharides with

the RNA preparation was not a problem when isolated mitochondria

were used.

For experiments where the steady state levels of mitochondrial

RNA were normalized to mitochondrial DNA, it was essential to






54

isolate both DNA and RNA in the same solution. For this, a

modification of the protocol of Nelson and Krawetz (1992) by

guanidine thiocyanate/isobutyl alcohol fractionation was tried, in

which the mitochondria were lysed in 4M guanidine thiocyanate,

extracted with phenol:chloroform:isoamyl alcohol (25:24:1, pH 7.0),

and the nucleic acids precipitated with isobutyl alcohol. Although

this method was used successfully, the yields of nucleic acids were

very poor. An alternative, more successful protocol was identical to

the protocol for isolation of mtDNA detailed in the footprinting

section, except that pH 7.0 was maintained in all solutions to

facilitate the simultaneous isolation of RNA and DNA.


Northern Analysis of Mitochondrial RNA


The RNA samples were denatured in 50% formamide, Ix MOPS

buffer (20 mM MOPS, pH 7.0, 5 mM sodium acetate, 0.1 mM EDTA),

0.22 M formaldehyde, 40 ug/ml ethidium bromide by heating at

650C for 15 min. The samples were then cooled on ice, loading buffer

added (10 x loading buffer is 1 mM EDTA, pH 8.0, 0.25%

bromophenol blue, 0.25% xylene cyanol, 50% glycerol), and

electrophoresed in 1.2 % formaldehyde agarose gels in a horizontal

gel apparatus (Model H5, BRL) at 80-100 volts. After






55

electrophoresis, the RNA samples were transferred to nylon N' by

downward transfer with lOx SSC (20x SSC is 3M NaCI, 0.3M sodium

citrate, pH 7.0). The blots were then air-dried and uv-crosslinked by

the autocrosslink program in Stratalinker (Stratagene).

The blots were pre-hybridized in 6x SSPE (20x SSPE is 3.6M NaCI,

0.2M sodium phosphate, 0.02M EDTA, pH 7.7), 50% formamide, 5x

Denhardt's solution [50x Denhardt's solution is 1% each of Ficoll 400

(Sigma), polyvinylpyrrolidone (Kodak), and bovine serum albumin

(Fraction V, USB-Amersham)], 0.5% SDS, 200 ug/ml tRNA at 600C for

1 hour. Radiolabeled riboprobes were synthesized from linearized

gene-specific clones using T3 and T7 RNA polymerases (Stratagene),

added to a fresh aliquot of the same buffer @ 50-100 ng/ml, and

hybridized overnight at 600C. Following hybridization, the blots were

washed in 40 mM Na', 1% SDS, 1 mM EDTA at 600C for 1.5 hr with 3-

4 changes. Following the washes, excess wash solution was removed

and the blots exposed to both film and phosphorimaging screen.


Dot Blot Quantitation of Mitochondrial DNA


The same aliquot of mitochondrial nucleic acids used for the

Northern analysis was used to quantitate the level of mtDNA in that

sample, so that the steady state levels could be corrected to unit






56

mitochondrial genome. For this, the samples were incubated with 3

ul of RNase Cocktail (Ambion, Inc.) at 370C for 15' to degrade RNA.

The samples were then adjusted to 0.4 M NaOH and denatured at

960C for 10', cooled on ice and SSC added to lOx. The samples were

then filtered through a pre-wetted nylon N+ membrane in a dot blot

apparatus (Bio-Rad). The dots were washed three times with 500 ul

of lOx SSC, air-dried, uv-crosslinked, and hybridized with mtDNA

specific riboprobes using the hybridization buffer system of Church

and Gilbert (1984) described in the footprinting section. The

Phosphorimager quantitation of mtDNA on the dot blots were used to

normalize the levels of the mitochondrial RNAs (measured by

Northern analyses) to unit mitochondrial genome.


Mitochondrial Run On Transcription


Oligonucleotides


WH540. 22 base oligonucleotide CCG ACG TCT GCA GTA AGT

CAT G. Corresponds to the L-strand sequence 1603-1624 in Dunon-

Bluteau et al. (1985).

WH541. 21 base oligonucleotide CAG ATT CAC TAC CGA CAG

ATG. Corresponds to the H-strand sequence 3078-3058 in Dunon-

Bluteau et al. (1985).








Plasmid Clones


Most of the plasmid clones used for the production of the non-

radioactive gene- and strand-specific riboprobes have been

described in the steady state RNA analysis section above. The one

plasmid clone which has not been described earlier is the pBSD-Loop

clone, which is described below.

pBSD-Loop. The Xenopus D-loop region (from 1603-3078 in

Dunon-Bluteau et al., 1985) including the two putative TAS elements

and the 3' ends, were PCR amplified using primers WH540 and

WH541, and the PCR product cloned into the Hincil site of pBS (+/-)

phagemid (Stratagene). The insert was cloned in the forward

orientation. Therefore, T3 RNA polymerase makes the L-strand

sense and T7 RNA polymerase makes the H-strand sense of cRNAs.


Preparation of Riboprobes for Strand-specific Probing


In order to obtain gene- and strand-specific hybridization targets

for analyzing the labeled run-on transcripts, only riboprobes are

suitable. Large-scale synthesis of cold riboprobes for strand-specific

probing was done with the MegaScript kit (Ambion, Inc.) using the

mitochondrial gene-specific clones linearized with the appropriate

restriction enzyme. The large-scale reactions were allowed to






58

incubate for 4-6 hours and typically yielded 100-120 ug of RNA per

reaction. The reactions were phenol-extracted and ethanol

precipitated twice in the presence of 0.5M ammonium acetate. The

RNA yield was calculated spectroscopically, 1 ug of each transcript

electrophoresed in parallel lanes of 1.2% formaldehyde-agarose gels,

and blotted onto nylon membranes as described in the section on

steady state analyses of mitochondrial RNA. In some of the earlier

experiments, combinations of RNAs were run in the same lane as L-

strand or H-strand sets. This was not followed in later experiments

due to difficulties in quantitating the bands after hybridization.

Since in vitro transcription reactions always result in shorter

transcripts of the same specific sequence, gel purification of the RNA

was attempted. Although effective, the method is labor-intensive

and inefficient. To overcome this problem, the membranes carrying

the RNA blots were trimmed around the specific RNA bands prior to

hybridization, to aid in ease of quantitation. This method was

preferred over dot-blotting the probe panel due to the following

reasons: (1) electrophoresing the RNA samples each time serves as a

checkpoint for RNA degradation, (2) gene assignments are

unambiguous due to the pattern of specific RNA sizes on the blot, and

(3) removal of template DNA and shorter transcripts is automatically

facilitated.






59

Mitochondrial Run-On Transcription Assay


The incubation conditions for the run-on transcription assays are

modifications of the protocols of Gaines et al. (1987) and Gaines

(1996). Mitochondria from eggs and staged-embryos were isolated

in MSE buffer as outlined in the mitochondrial isolation section. After

one wash with MSE buffer in the microcentrifuge, the pellets were

resuspended in 1 ml of MSE buffer and spun at 750 x g in a

microcentrifuge to pellet pigment and debris which were carried

over during handling of the bigger volumes. The supernatant was

then spun at 10,000 x g for 1 min to pellet mitochondria. The pellet

was then resuspended in run-on wash buffer (40 mM Tris, 7.2, 50

mM NaCI, 10% glycerol, 5 mM MgCl2, 1 mg/ml BSA) and the

mitochondria re-pelleted. The final pellets were resuspended in the

basic run-on buffer (40 mM Tris, 7.2, 50 mM NaCI, 10% glycerol, 5

mM MgCl2,, 2 mg/ml BSA).

Supplementation of this basic buffer with salts, nucleotides, TCA

cycle intermediates or drugs interfering with mitochondrial

metabolism was done by adding the components to a 1.2x or 1.25 x

Basic buffer, mixing the components, and then resuspending the

mitochondria in the final mixture. Run-on reactions were initiated

by the addition of [a32P]UTP (50-100 mci) to the mitochondrial






60

suspension on ice and then incubating at 300C for 30 min. Following

the incubation, the samples were cooled on ice, and then pelleted in a

microcentrifuge at 10,000 x g for 1 min. The mitochondrial pellets

were either used immediately for probing mtDNA-specific cold

probes or stored at -800C till necessary.

To detect and quantify the run-on RNA, the mitochondrial pellets

were resuspended in 50 mM Tris, 7.5, 200 mM NaCI, 25 mM EDTA.

After adding SDS to 1% to lyse the mitochondria, the lysate was spun

for 2 min at 14, 000 x g in a microcentrifuge to remove pigment. The

supernatant was added to the pre-hybridized riboprobe panel in

fresh hybridization solution and allowed to hybridize in a rolling

hybridization oven (Biometra) at 600C overnight. The pre-

hybridization, hybridization, and wash conditions were the same, as

that used for the steady state RNA analyses. All quantitations were

performed using Imagequant software (Molecular Dynamics) on the

Phosphorimager.

To correct for differences in the yield of mitochondria obtained

from the different developmental stages, the mtDNA levels in each

run-on reaction was measured as follows. Prior to the addition of the

radiolabel, 10% of the mitochondrial suspension in basic buffer was

removed, pelleted and lysed in mitochondrial lysis buffer (described






61

in the footprinting section). The lysate was then extracted twice with

phenol:chloroform:isoamyl alcohol, once with chloroform, and then

processed for dot blotting (without ethanol precipitation) as

described in the steady state analysis section.


Measurement of Mitochondrial Adenine Nucleotides


Extraction Of Adenine Nucleotides


The total egg/embryonic and mitochondrial adenine nucleotides

were measured by reversed-phase, ion-paired HPLC (RP-HPLC).

Adenine nucleotides were extracted from eggs, embryos, and isolated

mitochondria by an adapted protocol of Weinberg et al., 1989. For

eggs and embryos, 5-25 de-jellied eggs or embryos were

homogenized in 225-400 ul of 12% TCA with an Eppendorf pestle

(Kontes) and incubated at room temperature for 5 minutes. The

tubes were then vortexed and spun in an Eppendorf centrifuge for 5

minutes. The clarified supernatant was removed and extracted twice

with 2-6 volumes of 0.5 M trioctylamine in cyclohexane, centrifuged,

the aqueous layer filtered through a 0.22 micron nylon centrifuge

filter (Micron Separations Inc.), and stored at -700C.

For extraction from isolated mitochondria, mitochondria from 300

eggs or embryos were prepared by differential centrifugation and






62

sucrose gradient sedimentation as described. The final

mitochondrial pellets were lysed in 12% TCA by repeated pipeting

and then processed as above.


HPLC Measurements


All HPLC runs were done on a CI8 silica HPLC column using an

injection volume of 100 ul, the mobile phase being 0.2M sodium

phosphate titrated to pH 5.75 with tetrabutyl ammonium hydroxide

(TBAH), by the isocratic elution mode. Signal amplification, peak

detection, and area quantitations were done using Nelson PE

hardware and software. Standard calibration curves for ATP, ADP,

and AMP were generated using ultrapure ATP, ADP, and AMP

(Sigma), and used to calculate the amounts of the three adenine

nucleotides in the total egg/embryo and mitochondrial TCA extracts.


Estimation of protein concentrations


The adenine nucleotide levels found in each developmental stage

were normalized to the amount of mitochondrial protein in the

respective extract. For this, protein pellets obtained after TCA

precipitation were resuspended in resuspension buffer (Tris, pH 8.5,

0.5% SDS, ImM EDTA, ImM PMSF) using an Eppendorf pestle (Kontes)

and repeated pipeting. After thorough resuspension, the insoluble






63

debris was removed by a brief centrifugation. The clarified

supernatant was used for protein estimation by the Lowry method

(1951), using BSA as a standard.


Electrophoretic Mobility Shift Assays


Oligonucleotides


WH 615. 40 base oligonucleotide AGA TTA GGG CTA GCT AGC

GTG GCA GAG CCT GGC TAA TGC G. Corresponds to the native L-

strand sequence 4712-4751 (Roe et al., 1985).

WH 616. 41 base oligonucleotide GCT TAG GTC TTT CGC ATT

AGC CAG GCT CTG CCA CGC TAG CT. Corresponds to the native H-

strand sequence 4763-4723.

WH 639. 46 base oligonucleotide AGA TTA GGG CTA GCT AGC

GTG GCA GGG CCT GGC TAA TGC GAA AGA. Corresponds to the L-

strand sequence 4712-4756, with a point mutation at position 4737

(A to G) which is analogous to the MELAS transition at position 3243

(A to G) in the human mitochondrial genome.

WH 640. 44 base oligonucleotide GCT TAG GTC TTT CGC ATT

AGC CAG GCC CTG CCA CGC TAG CTA GC. Corresponds to the H-strand

sequence 4763-4720, with a point mutation at position 4737 (T to C

transition), to match the mutation in WH 639.






64

WH 654. 46 base oligonucleotide AGA TTA GGG CTA GCT AGC

GAG CCA GGG CCT GGC TAA TGC GAA AGA. Corresponds to the L-

strand sequence 4712-4756, with three point mutations in the

mTERF consensus sequence (Valverde et al., 1994) at positions 4731

(T to A), 4733 (G to C), and 4737 (A to G).

WH 655. 20 base oligonucleotide GCT TAG GTC TTT CGC ATT AG.

Corresponds to the H-strand sequence 4763-4744.


Preparation of Band Shift Probes and Competitors


To make the 52 bp wild type mTERF bandshift probe, 1 nmol of

WH 615 and WH 616 were denatured in 10mM Tris, pH 7.5, 10 mM

NaCI at 950C for 4 min, followed by annealing at 510C for 10 min.

The annealed templates were kept on ice and used to perform a fill-

in reaction with either Klenow fragment (New England Biolabs) or

Sequenase (USB-Amersham) DNA polymerase. The use of Klenow

was discontinued in later experiments due to incomplete filling-in of

the termini which led to production of two major products in native

gels. Radiolabeled probes were made using either [a- 'P]TTP or

dATP. Unincorporated radiolabel was removed using spin-columns

(Sephadex 25, Pharmacia) and the probe specific activity calculated.






65

The specific competitor with a single point mutation at 4737 (the

MELAS competitor) was prepared by annealing WH 639 and WH 640

as described above. The specific competitor with three point

mutations in the mTERF consensus sequence was prepared using WH

654 & WH 655. Annealing was done at room temperature in this

case and processed as above. The filled-in probes were diluted to a

concentration of 10 picomoles/ul and frozen at -200C.


Preparation of S-13 Mitochondrial Lysate


Mitochondria from 400 eggs or embryos were purified as

described in the mitochondrial isolation section. The S-13 lysate was

prepared by an adaptation of the protocol of Fernandez-Silva et al.

(1996) for preparing S-13 mitochondrial lysates from HeLa cells.

The high speed mitochondrial pellet was resuspended in 500 ul

lysis buffer (10% v/v glycerol, 25 mM Hepes-KOH, pH 7.6, 5 mM

MgCl,. 0.5 mM EGTA, 1 mM DTT, 1 mM PMSF, 1 ug/ml of Aprotinin,

Leupeptin and Pepstatin A). Tween 20 and KCI were added to final

concentrations of 0.5% and 0.5 M, respectively. The mitochondria

were homogenized with an Eppendorf pestle (Kontes) and repeated

pipeting. The lysate was then kept on ice for 5 min, followed by a 30

sec vortexing. After a further incubation on ice for 5 min, the lysate






66

was centrifuged at 13,000 x g for 45 min in a microcentrifuge at 40C.

The clear supernatant was collected carefully, avoiding the fluffy

layer floating on top. Aliquots were rapidly frozen in a dry ice-

ethanol bath and stored at -800C. Protein concentrations were

determined by the Lowry method.

The extracts were assayed for presence of DNA endonuclease

activity by incubating 20 ug of the extract from each stage with 1 ug

of 100 bp ladder (GIBCO BRL) and incubated at 370C for 30'. The

reactions were run on a 1% agarose gel and stained with ethidium

bromide. By this assay, no detectable DNA endonuclease activity was

detected (data not shown).


Band Shift Assay


The protocol for the mobility shift assay for mTERF is essentially

the one described by Fernandez-Silva et al. (1996) for human

mitochondrial lysates, with some modifications. The DNA-binding

reactions were assembled on ice and consisted of the following

components: 0.1 pMol of the mTERF bandshift probe (0.2-lx

10"cpm/pMol), 5 ug BSA, 5 ug poly (dl-dC).(dI-dC) as non-specific

competitor, and the desired amounts of the S-13 mitochondrial

extract (usually from 10 to 60 ug). The buffer and salt conditions





67

were modified accordingly to obtain final concentrations of 25 mM

HEPES, pH 7.6, 100 mM KCI, 12.5 mM MgC92, 1 mM DTT, 12% glycerol.

The samples were gently mixed, spun down briefly, and incubated in

a room temperature water bath for 15 min. After the incubation, the

samples were placed on ice and then loaded onto a 5%

polyacrylamide:bisacrylamide (80:1) gel in Tris-glycine buffer

containing 2.5% glycerol. The gel had been pre-run for at least 2 hr

at 150 volts. Samples on the gel were run at 100-200 volts at room

temperature under conditions which did not heat the gel. After the

run, the gel was transferred to 3 mm paper, dried, and exposed to

film or phosphor screens.

For competition experiments, the specified molar excess of cold

competitors were added to the reactions after a 15 min pre-

incubation with the wild type probe.














CHAPTER 3
STEADY STATE ANALYSIS OF MITOCHONDRIAL RNA LEVELS


Introduction


Xenopius eggs, as those of other animals, contain large numbers of

mitochondria and consequently large amounts of mtDNA and mtRNA

(Dawid. 1965; 1966). This stockpile of mitochondria, along with

other organelles and macromolecules, are partitioned into the rapidly

dividing embryos, bypassing the need for fresh biogenesis of these

components until later in embryogenesis (Chase and Dawid, 1972).

Active synthesis of mtDNA does not occur till about 40-48 hours of

development. Chase and Dawid (1972) used '"C incorporation to

measure mitochondrial rRNA synthesis during early development in

Xenopus laevis by polyacrylamide gel electrophoresis and

scintillation counting of gel slices. Before the gastrula stage (10

hours of development), the rate of synthesis was very low. It

increased 4-5 fold after the gastrula stage and -8-9 fold by

neurulation (by 22 hours post-fertilization). On the basis of these






69

data, they concluded that after the gastrula stage, there is a "switch-

on" of mitochondrial rRNA synthesis at gastrulation (10 hours post-

fertilization). Accumulation then proceeded at a constant rate, and

by 96 hours post-fertilization, the content of both mitochondrial

rRNAs per embryo had doubled.

Young and Zimmerman (1973) measured the synthesis of mtRNA

by "P labeling of disaggregated Xenopus embryos at different

developmental stages, followed by electrophoresis and scintillation

counting of gel slices. They could detect mitochondrial RNA synthesis

in the blastula, albeit at a very low level. Older embryos (26-32

hours post-fertilization) had greater incorporation (2.5 fold more)

over the gastrula stage (10 hours post-fertilization). Differences in

the extent of disaggregation and resultant differences in '"P uptake

by the embryos were inherent problems in their system. However,

their results support the general conclusion that the older the

embryos. the greater is the incorporation into mitochondrial RNA.

Dawid et al. (1985) microinjected ["3P]GTP into fertilized eggs and

analyzed labeled RNA by methyl mercury hydroxide agarose gel

electrophoresis. They could not detect RNA synthesis of any kind

before the mid-blastula (6-7 hours) stage, with the reservation that





70

they did not show whether the microinjected GTP could enter the

mitochondria from the fertilized egg cytoplasm. Shortly after the

mid-blastula transition (MBT), RNA synthesis was detected both in

total RNA and in RNA prepared from isolated mitochondria.

Webb et al. (1975) investigated mitochondrial RNA synthesis

during oocyte maturation by injecting [3H]GTP into full-grown (Stage

VI) and in vitro matured (progesterone treated stage VI oocytes)

oocytes of Xenopus laevis and studied RNA synthesis in a

polyacrylamide gel system. They found that the rate of mtRNA

synthesis remained essentially constant throughout maturation.

Furthermore, their measured rates of mitochondrial rRNA synthesis

were similar to those reported by Chase and Dawid (1972) for pre-

gastrula embryos. They concluded that mtRNA synthesis progresses

throughout the terminal stages of Xenopus oogenesis and its rate of

synthesis remains essentially unchanged by the events associated

with fertilization.

Meziane et al. (1989) directly measured the steady state levels of

mitochondrial RNAs during X. Iaevis development by Northern

hybridization. In this study, they isolated total RNA from

unfertilized egg and embryos at distinct stages of development,





71

resolved the RNA on formaldehyde agarose gels, blotted them onto

nylon filters, and probed them with gene-specific DNA probes. They

found that the levels of all mitochondrial mRNAs decreased abruptly

within a few hours after fertilization (by a factor of 5-10), remained

at a very low level up to the late neurula stage (24 hours of

development), and increased again during organogenesis. However,

the levels of mitochondrial rRNAs remained essentially constant

during early development. On the basis of these data, they suggested

that the mitochondrial genome was completely inactivated at

fertilization and during early embryonic development and that the

reactivation of mitochondrial transcription in the developing embryo

was decoupled from active DNA replication, since the mtDNA levels

do not vary during this time (Chase and Dawid, 1972).

The early part of the results obtained by Meziane et al. (1989) are

in direct contradiction of the studies reported by the earlier groups.

Chase and Dawid (1972) did not find any evidence for differences in

mtRNA synthesis rates in unfertilized eggs vs. early embryos. Dawid

et al. (1985) found increased incorporation of microinjected ["P]GTP

into mtRNA only after the mid-blastula transition (after 7 hours of

development). In all these studies, increasing rates of mtRNA





72

synthesis were observed only after the mid-blastula transition.

Thus, earlier studies do not support the observation by Meziane et al.

(1989) that mRNA levels decrease after fertilization and remain at a

very low level till the late neurula stage. Hence, the findings of

Meziane et al. (1989) remain a solitary piece of evidence suggesting

that fertilization in Xenopus laevis induces a rapid shutdown of

mitochondrial transcription.

To resolve these issues and extend our understanding of

mitochondrial transcriptional regulation in the Xenopus laevis

embryogenesis system, I re-investigated the steady state levels of

mitochondrial RNAs during early development of X. laevis. The

pattern of early developmental steady state levels of mitochondrial

mRNAs I observed were not in agreement with their results. My

interpretation of these discrepancies and additional experiments

which clarify the situation are presented in the following sections.


Results


Xenopus eggs were fertilized in vitro as described in Materials

and Methods. Developmental stages were identified according to the

Nieuwkoop-Faber tables (Nieuwkoop and Faber, 1967). Total RNA





73

from batches of 100 viable eggs or embryos were extracted as

described in Materials and Methods. Identical amounts of total RNA

(2 ug) extracted from unfertilized eggs and staged embryos were run

on a 1.2% formaldehyde-agarose gel, blotted to nylon membranes,

and probed with gene-specific riboprobes. The results of such an

analysis for six different mRNA species spanning early development

are shown in Figure 3-1, panels A-F. The mRNA levels were

quantitated using a Phosphorimager. The level of each transcript at

each developmental stage is relative to the egg level (Table 3-1),

setting the egg level to unity. All mRNAs showed a 1.5 to 2 fold

decrease in transcript levels by 14 hours of development over that of

the unfertilized egg, returned to egg levels by 20 hours in the case of

ND1, Cyt b, CO II and ATPase 6 (Figure 3-1, panels A, D, E, F and

Table 3-1). and increased .1.rIir..i1. thereafter. In contrast, the

levels of ND4 and ND6 (Figure 3-1, panels B and C) continued to be

low even in the tadpole stage (50 hours of development). The 12S

and 16S rRNA levels continued to decrease marginally during this

window of development (Figure 3-1, panels G & H and Table 3-1).

The complex pattern of bands in the two rRNA blots have been

observed by other groups working on different systems (Williams,













Figure 3-1. Steady state levels of mitochondrial RNA during early development of
Xenopus laevis. Total RNA was isolated from unfertilized eggs and embryonic stages at 5, 13, 20, 30,
38, and 50 hours post-fertilization as described in Materials and Methods. 2 ug of total RNA from each
developmental stage was run in a 1.2% formaldchyde-agarose gel, blotted on nylon N' membranes,
hybridized with gene-specific riboprobes synthesized by in vitro transcription from linearized clones,
washed, and exposed to x-ray film or phosphorimager (described in Materials and Methods). Each lane
(labeled accordingly) corresponds to the respective mRNA or rRNA level in the corresponding
developmental stage. Panel A: NDI mRNA; Panel B: ND4 mRNA; Panel C: ND6 mRNA; Panel D: Cyt b
mRNA; Panel E: CO II: Panel F: ATPase 6 mRNA; Panel G: 12S rRNA; Panel H: 16S rRNA. The complex
pattern of bands seen in panels G and H represent multiple products corresponding to the 12S and 16S
sequences, and is found in ribosomal RNA blots from other animal systems (see text).














0 ,,00 0 O 0 00 0

A ** D


B w -9 -e -rry


S* *w 9 E


1C ** 4-1 F










G

p, L LL~I-
DDffC
v, U) 0 0
U)nv


H


U) U


ii::;;;

Cu*1 3
I~aem


Figure 3-1...continued














Table 3-1. Steady state levels** of mitochondrial RNA in total egg or
embryonic RNA during early development of X. laevis.


Egg 5 hr* 14 hr 20 hr 30 hr 38 hr 50 hr
ND 1 1.0 0.9 0.7 1.3 1.3 1.4 1.2
ND 4 1.0 0.6 0.5 0.8 0.8 0.8 0.6
Cyt b 1.0 0.8 0.4 1.0 1.0 1.4 1.2
ATPase 6 1.0 0.6 0.4 1.0 1.1 1.5 1.4
CO II 1.0 0.8 0.6 1.0 1.2 1.2 1.2
ND 6 1.0 1.1 0.7 0.7 1.0 0.5 0.5
16 S rRNA 1.0 0.9 0.8 0.9 0.8 0.6 0.7
12 S rRNA 1.0 0.9 0.9 0.9 0.7 0.7 0.8


* Hours post-fertilization
** Steady state levels are expressed as fold over egg, with the egg
levels set to unity.





78

1986; Williams et al., 1986) but they were not discussed except in

one case (Mazo et al., 1983) where they have been accurately

analyzed. In rat liver mitochondria, it has been unambiguously

demonstrated that six abundant poly(A) transcripts ranging from 1.3

to 0.7 kb were non-random fragments of the 16S rRNA, all carrying

its 5' terminus (Mazo et al., 1983). The mechanism for this non-

random degradation or premature termination of synthesis has not

yet been established.

The above results do not agree with the findings reported by

Meziane et al. (1989), where they found a 5-10 fold decrease in

steady state levels of most mtRNAs analyzed within 5-7 hours of

development. All transcripts remained at a low level until 24-28

hours of development, and increased thereafter. One of the

possibilities for this discrepancy between labs is that there may be

strain-specific differences in the frogs used for analyses.

Commercially sold Xenopus laevis is highly heterozygous. After the

mid-blastula transition at 7 hours of development, there is a

dramatic increase in nuclear transcription, with the concomitant

appearance of new species of nuclear RNAs. It is conceivable that

the quantity and quality of specific nuclear RNAs may be under the






79

influence of both genetic and environmental factors. Meziane et al.

(1989) analyzed mitochondrial mRNAs in the context of rapidly

fluctuating total RNA (nuclear plus mitochondrial) levels. Hence, a

normalization based on spectroscopic measurement of total RNA is

not the optimal choice in this case, because the actual steady state

levels of mitochondrial RNAs could be camouflaged by strain and

animal-specific variations in total RNA metabolism.

To remove the interference from differential amounts of nuclear

RNA in the samples, mitochondrial RNA was prepared from sucrose

gradient purified mitochondria as described in Materials and

Methods. Equal amounts (0.5 ug) of mitochondrial RNA were

electrophoresed and blotted as above with mtDNA specific

riboprobes (Figure 3-2, panels A-F). Since the bulk of the

mitochondrial RNA is rRNA. the mitochondrial mRNA levels were

normalized to the steady state levels of mitochondrial 16S rRNA, and

the level of each transcript at each developmental stage expressed

relative to the level in the unfertilized egg, setting the egg level to

unity (Table 3-2). With the bulk of the interference from nuclear

RNA removed, Cox II, Cyt b. ND1 and ND4 levels now showed a 2-2.5














Figure 3-2. Steady state levels of mitochondrial RNA isolated from purified mitochondria
during early development of Xenopus laevis. Mitochondrial RNA was isolated from sucrose-
gradient purified miiocliondria prepared from unfertilized eggs and embryonic stages at 13, 22, and 43
hours post-fertilization. 0.5 ug of RNA from these distinct stages were run on 1.2% formaldehyde-
agarose gels, blotted on nylon N' membranes, hybridized with gene-specific riboprobes synthesized by
in vilro transcription from linearized clones, washed, and exposed to x-ray film or phosphorimager
(described in Materials and Methods). Each lane (labeled accordingly) corresponds to the respective
mRNA or rRNA level in the corresponding developmental stage. Panel A: NDI mRNA; Panel B: ND4
moRNA; Panel C: ND6 mRNA; Panel D: Cyt b mRNA; Panel E: CO II mRNA; Panel F: 16S rRNA. The complex
pattern of bands seen in panels F represent multiple products corresponding to the 16S sequence, and is
found in ribosomal RNA blots from other animal systems (see text).






















C *


C


1P T at

tlJ -~ -~f -
D




E






F















Table 3-2. Mitochondrial mRNA steady state levels** in isolated
mitochondria from distinct developmental stages of X. laevis.


Egg 13 hr* 22 hr 43 hr
ND1 1.0 0.9 1.3 3.4
ND4 1.0 0.6 0.8 2.8
Cyt b 1.0 0.5 0.8 3.1
CO II 1.0 0.9 1.2 3.0
ND6 1.0 0.8 0.8 0.8


* Hours post-fertilization.
** The steady state level of each
16S rRNA level in that stage and
the egg levels set to unity.


stage has been normalized to the
is expressed as fold over egg, with





83

fold increase over egg levels in the 43 hour-old embryo. ND6 levels,

however, showed a marginal decrease during this time.

Based on the above results, I conclude that there are no

substantial reductions in steady state levels of mitochondrial mRNAs

soon after fertilization as reported by Meziane et al. (1989).

Although these results seem to agree well with the observations of

Chase and Dawid (1972), Young and Zimmerman (1975) and Dawid et

al. (1985), they suffer from the following drawback. The mRNA

levels were normalized to rRNA levels based on the assumption that

the rRNA levels do not change drastically during development.

However, if these levels do change due to active transcription in the

later stages of development, the mRNA levels would be

underestimated in these stages. Therefore, a more static reference is

needed.

One macromolecule whose level does not change during the first

two days of development in Xenopus laevis is the mtDNA molecule.

The mtDNA remains at a concentration of 4 ng per embryo during

the first 48 hours of development after fertilization (Chase and

Dawid, 1972). Net increases in its level could be detected only at 60

hours, after which it continued to increase, reaching 8 ng per embryo






84

by 96 hours of development (Chase and Dawid, 1972). Hence the

perfect macromolecular species to normalize mitochondrial RNA

levels is the mitochondrial DNA itself. This also makes teleological

sense, since it is the template for mitochondrial transcription.

In order to normalize mtRNA levels to mtDNA levels, it is crucial

to isolate DNA and RNA simultaneously using a single method from

the same embryos. If they are isolated in parallel rather than

simultaneously, the chances of introducing additional experimental

errors are increased. Hence, mitochondrial DNA and RNA were

simultaneously isolated from purified mitochondria of distinct

developmental stages using pH 7.0 buffers as described in Materials

and Methods. Equal volumes of the DNA/RNA mixture from each

developmental stage were RNAase treated to remove RNA, alkali

denatured and dot blotted as described in Materials and Methods to

quantitate the level of mtDNA in each sample using a

Phosphorimager. This quantitation was used to approximately

normalize the level of mtDNA in each stock sample to that of the

sample with the lowest amount of mtDNA by adding sterile water.

In control experiments, DNAse I digestion of the same samples prior

to alkali denaturation and dot blotting completely eliminated the






85

signal (not shown), confirming that the blots truly represented the

levels of just mtDNA, without any RNA carryover.

Equal volumes of these approximately normalized samples were

then electrophoresed on formaldehyde-agarose gels, blotted and

hybridized as described earlier (Figure 3-3, panels A-F). In a

parallel experiment, the same volume of sample from each stage was

again dot blotted for mtDNA quantitation as described above (Figure

3-3, panel G). The Phosphorimager quantitation of the mRNA levels

in the Northern blots were then corrected for the mtDNA levels in

each stage, and the steady state level of each transcript at distinct

developmental stages expressed relative to the level in the

unfertilized egg, setting the egg level to unity (Figure 3-4 and Table

3-3). As seen in Figure 3-4 and Table 3-3, the steady state levels of

ND1, ND4, Cyt b, Coll and ATPase 6 (panels A, B, D, E, F) remained at

more or less egg levels until 9 hours of development. The levels of

these transcripts were about 4-fold more than egg levels by 20

hours, 6-8 fold more by 30 hours, and 17-23 fold more by 48 hours

of development. The high levels seen at 48 hours drops down to the

levels seen at 30 hours in the 5-day old tadpole (7 days from the

time of fertilization). ND6 (Figure 3-3, panel C) showed lower steady






Figure 3-3. Steady state levels of mitochondrial RNA per unit mitochondrial genome
during early development of Xenopus laevis. Mitochondrial DNA and RNA were simultaneously
isolated in the same solution from mitochondria prepared from unfertilized eggs and embryonic stages
at 6 hours, 9 hours 20 hours 30 hours, 48 hours, and 7 days post-fertilization. An equal volume of
sample from each developmental stage was RNAase-treated, alkali-denatured at 960C for 5 minutes,
and dot blotted in lOx SSC as described in Materials and Methods. The dot blots were hybridized with
an antisense riboprobe to Cyt b, washed, and the mtDNA levels quantitated using the Phosphorimager.
The Phosphorimager quantilation was used to approximately normalize (lie samples fromii each
developmental stage to the mtDNA level in that respective stage. The DNA dot blot experiment was
again repeated as above with normalized samples to accurately estimate the actual mtDNA levels for
correcting the RNA levels (Panel G). Digestion with DNAse I completely eliminated this signal (not
shown). Each lane in Panel G (labeled accordingly) corresponds to the mtDNA level of the respective
developmental stage. In parallel experiments, equal volumes of these approximately normalized
RNA/DNA samples were then run on 1.2% formaldehyde-agarose gels, blotted to nylon N' membranes,
hybridized with gene-specific riboprobes synthesized by in vitro transcription from linearized clones,
washed, and exposed to x-ray film or Phosphorimager (described in Materials and Methods). Each lane
(labeled accordingly) corresponds to the respective mRNA or rRNA level of the corresponding
developmental stage. Panel A: NDI mRNA; Panel B: ND4 mRNA; Panel C: ND6 mRNA; Panel D: Cyt b
mRNA; Panel E: CO II mRNA; Panel F: ATPase 6 mRNA; Panel H: 12S rRNA; Panel 1: 16S rRNA. The
complex pattern of bands seen in panels H and I represent multiple products corresponding to the 16S
and 12S sequences, and is found in ribosomal RNA blots from other animal systems (see text). The shift
in mobility seen in some of the lanes is an electrophoretic artifact, and does not represent a higher
molecular weight species.















A .e9


B i *1



C 0 *< f*a*


*00
,. .s*9 9


M ^ ^ c L l i

*i 4 *1.
OC mC
i~h oe 00














H



(Kb) CD 0 0
CD 0) r CO ') t-
9.5- I I I I I I
7.5-


4.4-



2.4-



1.35-


12 4-





0.24-


(Kb) 0

9.5- I I
7.5-

4.4-



2.4-


165 4









0.24-


Figure 3-3...continued















Table 3-3. Steady state levels** of mitochondrial RNA (normalized to
mtDNA) during early development of X. laevis.


Egg 6 hr* 9 hr 20 hr 30 hr 48 hr 7 days
ND 1 1.0 1.3 1.5 4.6 7.2 19.5 6.1
ND 4 1.0 1.4 1.6 3.7 6.2 17.7 4.9
Cyt b 1.0 1.2 1.3 4.0 8.1 23.1 6.6
ATPase 6 1.0 1.3 1.2 3.7 8.1 28.7 8.5
CO II 1.0 1.0 1.3 3.7 6.8 19.7 8.0
ND 6 1.0 0.7 1.1 2.8 3.7 8.4 2.3
16 S rRNA 1.0 0.9 1.1 1.9 2.2 3.8 1.3
12 S rRNA 1.0 0.8 1.0 1.7 2.2 4.2 1.9


* Time post-fertilization.
** Steady state level of each developmental stage has been
normalized to the level of mtDNA in that stage and is expressed as
fold over the level in the egg, with the egg level set to unity.




Full Text
166
activity initially, with inhibition at higher levels. Though attractive,
this model has not received any in vivo test as yet to substantiate its
claims. Such an evidence would have to show that there is a
dynamic regulation of mtTFA levels in response to different
transcriptional activities of the mitochondria.
In order to differentiate between these two models and gain
additional insight into the mechanism of mitochondrial
transcriptional regulation, in vivo footprinting of mtDNA across
distinct developmental stages of Xenopus laevis was carried out
(Figures 4-5, 4-6, 4-7), to test whether the in vivo occupancy of
mtDNA by the mitochondrial transcription factor changes during the
periods of basal and activated transcription. If the mtTFA protein
responds to changes in the transcriptional status of the mitochondria
by either pathway outlined above, it should be detected in this assay.
Detailed examination of multiple footprinting experiments carried
out with different frogs revealed that there were no detectable
differences in the occupancy or mode of footprinting (either
protection or hypersensitivity) found in the unfertilized egg and the
various developmental stages in both the D-loop upstream region
(Figures 4-5 and 4-6) and in the promoter region (Figure 4-7). Since


175
evidence of a highly localized mTERF-mediated distortion of DNA
structure.
In order to look at the occupancy of the mTERF element during
regulated transcription, in vivo footprinting of this region across
early development of X. laevis was performed. The results showed
relatively equivalent occupancy of the protein at its binding site
during both basal and activated transcription, as indicated by the
footprints on the L- and H-strand (Figures 4-10 and 4-11). These
data immediately suggest that the third scenario outlined above is
most likely, i.e., the mTERF protein appears to be constitutively
present on mtDNA at its cognate site with equal occupancy, and its
binding does not seem to be affected by the transcriptional needs of
the cell.
An indirect prediction of the above findings is that the intra-
mitochondrial levels of the mTERF protein during regulated
transcription in X. laevis would not be subject to fluctuations since it
appears to be bound equivalently to mtDNA at all times.
Unfortunately, antibodies specific to mTERF are not available for any
system. Therefore, gel mobility shift assays (Fernandez-Silva et al.,
1996) were used to detect the presence of the mTERF protein (Figure


213
1994) have been reported for Trypanosoma brucei and T. congolense
mitochondria between the procyclic (oxidative) and bloodstream
(glycolytic) forms.
Gene dosage as a regulator of transcript levels has been reported
in plant mitochondria of maize (Zea mays), where selective DNA
amplification of sub-genomic-size fragments has been shown to
regulate transcript levels (Muise and Hauswirth, 1995), with a direct
correlation between mitochondrial gene copy number and
mitochondrial transcriptional rate. The only report of an analogous
mechanism in animal mitochondria has been for mammalian striated
muscles (Williams et al., 1986). The steady state levels of
mitochondrial rRNA and Cyt b mRNA were found to increase in
parallel with mtDNA levels, when oxidative capacity of rabbit
striated muscles was induced by long-term electrical stimulation
(conditions which simulate exercise), suggesting that variation in
gene dosage was the major regulatory event (Williams, 1986).
Regulation of mitochondrial transcript levels during early
development of Xenopus laevis seems to clearly belong to the first
category mentioned above, namely, regulation at the level of
transcription of mtDNA. The mtDNA levels in this system do not


126
bars on the right) and the in organello footprints seen in Figure 4-3,
both in position and extent. The comparison of footprint patterns
seen in Figures 4-2 and 4-3 with the in vitro binding pattern of xl-
mtTFA (Antoschechkin and Bogenhagen, 1995) strongly suggests that
the protein-DNA interactions detected by in organello footprinting
are primarily due to the binding of xl-mtTFA to mtDNA in vivo.
Based on the in organello footprints (Figures 4-2 and 4-3), a
schematic representation of protein-DNA interactions in the D-loop
upstream region is presented in Figure 4-4. The binding pattern of
xl-mtTFA was periodic or phased, with regions of extensive protein-
DNA interactions and certain zones of exclusion. The C-rich regions
like CSB2 and CSB3 were unbound. Binding was strong between the
cis-elements in this critical stretch of mtDNA. Binding was also
dependent on the existence of a minimum spacing of ~35 bp between
the elements (between CSB2 and CSB3 and between the two bi
directional promoters). The 150 bp spacing between LSP2 and CSB3
allowed at least 3 units of interactions. Hence, like its counterparts
in yeast, cow, and human mitochondria (Diffley and Stillman, 1991;
1992; Ghivizzani et al., 1993; 1994), the Xenopus mtTFA is involved


241
which the mtTFA has been shown to have different binding affinities
for the HSP and LSP (Fisher and Clayton, 1988), and the ability to
activate as well as repress transcription within narrow ranges of
concentrations (Dairaghi et al., 1995; Barat-Gueride et al, 1989;
Antoschechkin and Bogenhagen, 1995). In addition, the mtTFA gene
has been shown to have binding sites for nuclear respiratory factors
(NRF-1 & NRF-2) in its proximal promoter (Virbasius and Scarpulla,
1994), suggesting that NRF-moduIated activation of mtTFA, in
conjunction with the effect of varying stoichiometries of this protein
on mitochondrial transcription, may be one of the ways in which the
nucleus and the mitochondria coordinate gene expression in the cell.
Although appealing in logic, this model has not been tested
extensively, mainly due to the paucity of experimental situations
where transcription is dramatically regulated. The X. laevis
embryogenesis model provides the first opportunity to test this
model. Therefore, in vivo footprinting of the D-loop region during
embryogenesis of X. laevis was performed with the main aim of
looking for differences in the pattern or occupancy of footprinting in
the critical regions around the promoters. Surprisingly, extensive
footprint analyses revealed a similar occupancy of mtDNA by the


209
calculated using calibration curves generated with ultrapure AMP,
ADP, and ATP. The values were then normalized to mitochondrial
protein to account for differences in yield of mitochondria (Table 5-
2). The ATP levels were more or less constant (650-850 pMol/mg
mitochondrial protein) in the unfertilized eggs and embryos until 21
hours of development. However, ATP levels in the 30 hr embryo
showed a 2 fold increase over egg levels (Table 5-2). The 2 fold
increase in the 30 hr embryo was still evident when the adenine
nucleotide levels were expressed as the energy charge (ratio of [ATP
]to [ADP + AMP]), which takes into consideration the concentrations
of all three species of adenine nucleotides (Table 5-2). The
individual levels of AMP and ADP, however, do not show any
particular trends with respect to developmental time. In conclusion,
these data indicate increased mitochondrial activity in the 30 hr
embryo compared to the earlier developmental timepoints,
consistent with the observations made above. In contrast, the total
adenine nucleotide content per embryo was almost constant during
early development (Table 5-3). ATP levels in the eggs and four early
developmental stages were -2000 pMol per egg or embryo, which
translates to an ATP concentration of 2 mM per egg or embryo, if a


43
PCR cycles (#) 1 5 1 0 1 5 20 30 40
Lane (#) 1 2 3 4 5 6 7
r-
:s*~
SSP5f
-2127
E
LSP2
2039
-1998
-1938
1901
1895


36
embryos repeatedly washed with buffer to remove traces of DMS.
Mitochondria are then isolated by differential centrifugation as
described above, except that banding on sucrose gradients was not
performed. The mitochondrial pellets were quick-frozen and stored
at -80C, or mtDNA was extracted immediately as described below.
Typically, one mitochondrial pellet from a batch of 400 eggs or
embryos yielded sufficient mtDNA to perform 10-12 primer
extension reactions. Similar patterns of methylation in control DNA
were achieved by 0.125% DMS treatment for 30-45 sec.
Purification of Mitochondrial DNA for Footprinting
The mitochondrial pellet was resuspended in 400 ul of lysis
buffer and SDS added to 1%. The mitochondrial lysate was then
extracted twice each with phenol, phenol:chloroform:iso amyl alcohol
(25:24:1), and chloroform and then ethanol precipitated with 2.5
volumes ethanol. For in organella footprinting using Southern
blotting, the mtDNA samples were digested with restriction enzymes
and a 10% aliquot checked on a 1% agarose gel for complete reaction.
The control DNA samples were first methylated as described below
and then used for restriction digestion in order to avoid artifactual
methylation patterns arising on linearized DNA. Restriction digestion
of the DNA samples was not performed in the primer extension


40
about 100 nucleotides away from the region to be analyzed work
best in providing reproducible genomic ladders which are essentially
free of low molecular weight background. In general, primers which
fall within 70-150 bp of the target region were used successfully.
Some of the primers used in the primer extension footprinting
experiments have been described above for the creation of the three
plasmid clones used for production of riboprobes. Additional
primers which were used in the primer extension footprinting
experiments are described below.
WH 476. 21 base oligonucleotide GGT CAG TTT CTA TCT ATG
AAG. Corresponds to the L-strand sequence 4582-4602 (Roe et al.,
1985).
WH 479. 21 base oligonucleotide TTC TAT ACA AGG CTA ACA
GTC. Corresponds to the H-strand sequence 3582-3602 (Dunon-
Bluteau et al., 1985).
WH 480. 21 base oligonucleotide CGC TAA ACC CCC CTA CCC CCC.
Corresponds to the L-strand sequence 3425-3445 (Dunon-Bluteau et
al., 1985).
End labeling of oligonucleotide primers. Gel purified
primers were 5' end-labeled to a high specific activity with g-3"P
ATP (ICN, 7000 Ci/millimole) and a T4 Polynucleotide Kinase kit (USB
Corporation-Amersham Life Science) in a standard 50 ul reaction.


n
>
ft
t
1
*
1 '
t
f
1
f
f
1

Egg
13 hr
22 hr
43 hr
Egg
13 hr
22 hr
43 hr
18


5-5 Comparison of mitochondrial transcription rates and
steady state levels of mitochondrial transcripts during
early development of X. laevis 196
5-6 Effect of addition of metabolic intermediates on the
transcription rate of 20 hr stage mitochondria 2 00
5-7 Effect of addition of metabolic inhibitors on the
transcription rate of 20 hr stage mitochondria 204
viii


239
preceding new mitochondrial biogenesis. Unfortunately, the
regulation of mitochondrial protein synthesis is a poorly understood
field at this time. Nevertheless, it would be worth investigating this
possibility. The other possibility is that the increased pool of
mitochondrial CO mRNA may be translated in a coordinate fashion,
but the limiting factor could be disproportionate expression (either at
the level of nuclear transcription or cytoplasmic translation) of some
or all of the 10 nuclear subunits of CO, which could also lead to the
general phenotype of constant CO activity during embryogenesis, in
spite of increased levels of mitochondrial CO subunit transcripts and
proteins. This would be an interesting avenue of research, which
might yield shed new light on nuclear-mitochondrial interactions.
One of the main thrusts of this project was to attempt to obtain
some answers to the complex questions of how transcriptional
regulation is achieved in the mitochondria and what developmental
cues could be responsible. A major avenue of investigation was to
look for differences in protein-DNA interactions in the D-loop control
region which houses the critical cis-elements for initiation of bi
directional (HSP & LSP) transcription and H-strand replication
(Chapter 4). For this, it was initially essential to establish the


173
footprinting of ovary mtDNA was performed in this study to look for
occupancy of the mTERF cis element. The analysis showed strong
footprints in and around the tridecamer sequence (Figure 4-8), with
the surrounding regions showing no evidence of protein-DNA
interactions, confirming the presence of the protein in the ovary
mitochondria. While the mode of footprinting was primarily
protection on the L-strand, the H-strand revealed DMS
hypersensitive sites at positions 4729 and 4744 (Figures 4-8 and 4-
9). These residues exactly flank the tridecamer sequence, suggesting
a localized distortion or bend in DNA induced by protein binding to
this site in vivo. These results are consistent with the in vitro
observations of Shang and Clayton (1994) that mTERF protein bends
DNA when bound to its cognate site.
DMS methylates N-7 of guanines in the major groove. Hence, a
hypersensitive guanine is an indication of a compression of the major
groove, caused by protein binding in the minor groove on the other
side. Further evidence in support of these observations is the DNase
I footprint pattern of purified mTERF protein on a human mtDNA
fragment (Kruse et al., 1989). A DNAse I hypersensitive site flanks
the tridecamer sequence (which is completely protected) in both L-


108
Virbasius and Scarpulla, 1991; Virbasius et ah, 1993). But the
suggestion that NRF-1 and NRF-2 may play a more integrative role in
nuclear-mitochondrial interactions gained more credence with the
discovery of its binding sites in the proximal promoters of both
mouse and human genes encoding the mitochondrial RNA-processing
RNA (Evans and Scarpulla, 1990) and the human gene for mtTFA
(Virbasius and Scarpulla, 1994). These studies suggest that NRF-
dependent modulation of the amount of mtTFA in the mitochondria
may be one of the ways in which the nucleus and the mitochondria
coordinate gene expression in the cell.
The mitochondrial genotype in yeast can influence nuclear gene
expression, a phenomenon called retrograde regulation (Parikh et al.,
1987), and the existence of shared transcription factors between the
nucleus and mitochondria has been proposed (Parisi and Clayton,
1991). Diffley and Stillman (1991) proposed that ABF2 may play a
role in coordinating nuclear-mitochondrial interactions in yeast,
perhaps by directly monitoring the amount of mtDNA, as ABF2 has
been found in both the mitochondria and the nucleus of yeast. There
remains, however, no direct proof of a relationship between mtTFA
expression and the rate of mtDNA transcription or replication. One


138
reactivities and relatively equivalent occupancy. This conclusion
suggests, but does not directly prove, that the xl-mtTFA protein
could be present in relatively equivalent concentrations in the
mitochondria during all stages of development.
Protein-DNA Interactions at the mTERF Element
Mitochondrial DNA from total ovaries were processed for
footprinting by methylation in organello, along with protein-free
naked mtDNA methylated in vitro, as described in Materials and
Methods. The reference point in mtDNA was created by cleaving the
DNA with SspI and probing with mTERF specific riboprobes (Figure
4-8). The core of the mTERF element (nucleotides 4731-4742) is a
tridecamer sequence (Christianson and Clayton, 1986; 1988) which
starts just after the 16S rRNA gene and continues into the 5 end of
the tRNAlc gene in the frog genome. Footprinting was clearly seen
on both strands in the mTERF element in ovary mtDNA (Figures 4-8
and 4-9). On the L-strand, protected residues were detectable at
positions 4732, 4733, 4736, 4742, 4743, and a hypersensitive
residue at position 4738, all within the tridecamer sequence. On the
H-strand, protection was seen at positions 4734 and 4740.


oxidative capacity induced by this protocol to also elevate Cyt b
mRNA, rRNA, and mtDNA levels, suggesting that the regulation was
at the level of mtDNA copy number (Williams, 1986). Amplification
of subgenomic fragments as a mechanism for control of
mitochondrial transcript levels has been reported for maize (Muise
and Hauswirth, 1995).
Focus Of Dissertation
The embryogenesis of vertebrate species like Xenopus laevis and
mouse provide invaluable natural model systems for understanding
some of the intricacies of mitochondrial gene regulation. They
illustrate the existence of general control mechanisms for mtDNA
replication and transcription that are not evident from experiments
with undifferentiated cells growing in culture (Attardi and Schatz,
1988). In both species, mtDNA replication occurs during oogenesis
and stops at maturation, whereas transcription of mtDNA is activated
some time after fertilization, long before the resumption of mtDNA
synthesis. In the mouse, the mitochondrial genome is inactive in the
egg and the 2-cell embryo, after which a high rate of mitochondrial
transcription was detected (Piko and Taylor, 1987). The relative
period of basal transcription in the X. laevis system is longer,
allowing more experimental malleability. The other advantages of


272
Wong, T.W., and D.A. Clayton. 1985b. Isolation and characterization
of a DNA primase from human mitochondria. J. Biol. Chem.
260:1 1530-1 1535.
Woodland, H.R. 1980. Histone synthesis during development of
Xenopus. FEBS Lett. 121:1-7.
Wu, M., and J. Gerhart. 1991. Raising Xenopus in the laboratory.
Meth. Cell Biol. 36:3-19.
Xu, B. and D.A. Clayton. 1995. A persistent RNA-DNA hybrid is
formed during transcription at a phylogenetically conserved
mitochondrial DNA sequence. Mol. Cell. Biol. 15:580-589.
Xu, B. and D.A. Clayton. 1996. RNA-DNA hybrid formation at the
human mitochondrial heavy-strand origin ceases at replication start
sites: an implication for RNA-DNA hybrids serving as primers. EMBO
J. 15:3135-3143.
Yoneda, M., Chomyn, A., Martinuzzi, A., Hurko, O., and G. Attardi.
1992. Marked replicative advantage of human mitochondrial DNA
carrying a point mutation that causes the MELAS
encephalomyopathy. Proc. Natl. Acad. Sci. USA 89:11164-11168.
Yoneda, M., Miyatake, T., and G. Attardi. 1994. Complementation of
mutant and wild-type human mitochondrial DNAs coexisting since
the mutation events and lack of complementation of DNAs introduced
separately into a cell within distinct organelles. Mol. Cell. Biol.
14:2699-2712.
Young, P.G., and A.M. Zimmerman. 1973. Synthesis of mitochondrial
RNA in disaggregated embryos of Xenopus laevis. Dev. Biol. 33:196-
205.
Zamaroczy, M., and G. Bernardi. 1986. The primary structure of the
mitochondrial genome of Saccharomyces cerevisiae.-a review. Gene
47:155-177.


Figure 4-6. In vivo footprinting of the L-strand of D-Ioop
upstream region during early development of X. laevis.
Samples were processed exactly as described for the footprinting of
the H-strand in the legend to Figure 4-5, with the following
differences. Linear amplification of the footprint ladder was done
using 32P-end labeled primer WH 479. Hence, the polarity of
transcription from LSP is opposite to that in Figure 4-5. Denaturation
was done at 94C for 4 min, followed by 15 cycles with the profile:
94C for 1 min, 53C for 1 min, 72C for 3 min. Following the
reaction, the samples were phenol extracted, ethanol precipitated,
run on 6% sequencing gels, and autoradiographed. Nucleotide
numbering is according to Roe et al. (1985). Residues protected
(open circles) or hypersensitive (filled squares) to DMS methylation
are indicated.


CHAPTER 5
MITOCHONDRIAL TRANSCRIPTION RATE ANALYSIS
Introduction
Northern analyses of mitochondrial transcripts during very early
development of Xenopus laevis showed evidence of active regulation
of transcript levels in the developing embryo (Chapter 3). To briefly
recapitulate the results, transcript levels were basal in the
unfertilized eggs and developing embryos upto 10 hours of
development, increased to ~4-fold by 20 hours, ~7-fold by 30 hours,
and peaked at 20-28 fold over egg levels by 48 post-fertilization.
After this time, the steady state levels seemed to stabilize at a lower
but significant 6-8 fold over egg levels by 7 days of development.
These dramatic differences in mitochondrial transcript levels happen
in the context of unchanged levels of mitochondrial DNA, the
template of transcription, which remains at approximately 4 ng per
embryo over this two-day period, and shows detectable increases in
DNA levels only after 55-60 hours of development (Chase and Dawid,
178


I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is
fully adequate, in scope and quality, as a dissertation for tjte degree
of Doctor of Philosophy
X
William W. Hauswirth, Chair
Eminent Scholar of Molecular
Genetics and Microbiology
I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is
fully adequate, in scope and quality, as a dissertation for the degree
of Doctor of Philosophy
Alfred $/ Lewin
V
Professor of Molecular Genetics
and Microbiology
I certify that 1 have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is
fully adequate, in scope and quality, as a dissertation for the degree
of Doctor of Philosophy
Maurice S. Swanson
Associate Professor of Molecular
Genetics and Microbiology


4-4 Schematic view of protein-DNA interactions detected by
in organello footprinting of the D-loop upstream region 12 8
4-5 In vivo footprinting of the H-strand of D-loop upstream
region during early development of X. laevis 13 2
4-6 In vivo footprinting of the L-strand of D-loop upstream
region during early development of X. laevis 134
4-7 In vivo footprinting of the L-strand of the promoter
region during early development of X. laevis 13 7
4-8 In organello footprint of the mTERF region
in ovary mtDNA 140
4-9 Summary of footprints on the L- and H-strand of the
mTERF region of ovary mtDNA 142
4-10 In vivo footprinting of the L-strand of the mTERF region
during early development of X. laevis 146
4-11 In vivo footprinting of the H-strand of the mTERF region
during early development of X. laevis 14 8
4-12 Gel mobility shift assay for mTERF protein 152
4-13 Comparison of the relative abundance of mTERF in
distinct developmental stages 156
5 -1 Size fractionation of mitochondrial run-on RNA 18 3
5-2 Hybridization target panel for strand-specific
detection of run-on transcripts 186
5-3 Mitochondrial run-on transcription in early
developmental stages 189
5-4 Promoter-wise and overall transcription rates
during early development 192
vii


79
influence of both genetic and environmental factors. Meziane et al.
(1989) analyzed mitochondrial mRNAs in the context of rapidly
fluctuating total RNA (nuclear plus mitochondrial) levels. Hence, a
normalization based on spectroscopic measurement of total RNA is
not the optimal choice in this case, because the actual steady state
levels of mitochondrial RNAs could be camouflaged by strain and
animal-specific variations in total RNA metabolism.
To remove the interference from differential amounts of nuclear
RNA in the samples, mitochondrial RNA was prepared from sucrose
gradient purified mitochondria as described in Materials and
Methods. Equal amounts (0.5 ug) of mitochondrial RNA were
electrophoresed and blotted as above with mtDNA specific
riboprobes (Figure 3-2, panels A-F). Since the bulk of the
mitochondrial RNA is rRNA, the mitochondrial mRNA levels were
normalized to the steady state levels of mitochondrial 16S rRNA, and
the level of each transcript at each developmental stage expressed
relative to the level in the unfertilized egg, setting the egg level to
unity (Table 3-2). With the bulk of the interference from nuclear
RNA removed, Cox II, Cyt b, ND1 and ND4 levels now showed a 2-2.5


46
1992). The results of an experiment with Pfu DNA polymerase and
Vent DNA polymerase in a PEF reaction using the manufacturer's
suggested buffers for primer extension are shown in Figure 2-2.
Neither polymerase primer extended accurately in this system,
compared to the reproducible pattern produced by Taq DNA
polymerase at a wide range of dNTP concentrations (compare lanes
4-8 with lanes 1-3 and lanes 9 & 10). The manufacturers suggest
lowering the annealing temperature of primers for these
polymerases due to the lower ionic strength of the buffers. However,
these and a variety of other conditions were tried with these
polymerases, but without success (data not shown). It remains
probable that these polymerases could be adapted to this system, but
only after extensive optimization of buffer and PCR conditions, as has
been noted for Vent DNA polymerase in the LMPCR protocols (Garrity
and Wold, 1992; Hornstra and Yang, 1993). However, the need for a
reliable thermostable polymerase which requires minimal buffer
optimizations is ably fulfilled by Taq DNA polymerase, and I have
used this polymerase in all the other experiments described. For Taq
DNA polymerase, a final dNTP concentration of 20 uM was chosen for
specificity and reproducibility (Figure 2-2, lanes 4-8 and data not
shown). Lowering dNTP concentration below this level sacrificed
both fidelity and signal intensity. Most current protocols for primer


85
signal (not shown), confirming that the blots truly represented the
levels of just mtDNA, without any RNA carryover.
Equal volumes of these approximately normalized samples were
then electrophoresed on formaldehyde-agarose gels, blotted and
hybridized as described earlier (Figure 3-3, panels A-F). In a
parallel experiment, the same volume of sample from each stage was
again dot blotted for mtDNA quantitation as described above (Figure
3-3, panel G). The Phosphorimager quantitation of the mRNA levels
in the Northern blots were then corrected for the mtDNA levels in
each stage, and the steady state level of each transcript at distinct
developmental stages expressed relative to the level in the
unfertilized egg, setting the egg level to unity (Figure 3-4 and Table
3-3). As seen in Figure 3-4 and Table 3-3, the steady state levels of
ND1, ND4, Cyt b. Coll and ATPase 6 (panels A, B, D, E, F) remained at
more or less egg levels until 9 hours of development. The levels of
these transcripts were about 4-fold more than egg levels by 20
hours, 6-8 fold more by 30 hours, and 17-23 fold more by 48 hours
of development. The high levels seen at 48 hours drops down to the
levels seen at 30 hours in the 5-day old tadpole (7 days from the
time of fertilization). ND6 (Figure 3-3, panel C) showed lower steady


146
I .-STRAND
Froa 2
Frog 1
H-STRAND
PROMOTER
4672-pi fair-
16 S
rRNA
leu
tRNA
4695 *"* '
4749
471
4732'
4762*
uni *
MMH

CT -a **-
m
* fc -*s
a?s
r. *
T
Pi pa M aw H


26
mM KC1, 10 mM CaCl2, 10 mM MgCl2, 10 mM Na2HP04, 50 mM
HEPES, pH to 7.8 with NaOH. The divalent and monovalent ions were
made up as separate stocks and diluted just before use). After
spontaneous egg laying begins (usually 12-18 hrs later), eggs were
gently squeezed from the female onto 100 xl5 mm petridishes
containing -20 ml of 1 x OR-2 in batches of 400-500 eggs. It was
found that eggs stored in lx OR-2 could be successfully fertilized
within 4 hrs of laying. Therefore, fertilization could be done in a
staggered fashion in batches of 500-1000 over the course of 8 hrs,
during which time the frog was allowed to lay its eggs at its own
pace in fresh lx OR-2 buffer. In this way, a high yield of fertilized
embryos could be obtained (3000-6000 embryos compared to only
<1500 with the quick squeeze protocol).
Sperm was obtained by dissecting the testes from a male frog
(anesthetized on ice) and gently macerating it in 1.5 X OR-2 to
release the sperm. Sperm motility was observed under a light
microscope after diluting the saline to 0.5 X OR-2. The eggs were
then drained completely of excess IX OR-2, 5-10 drops of the sperm
suspension added to each dish of eggs, and 30-50 ml of IX F-l was
quickly added to dilute the sperm suspension (lOx F-l is 412.5 mM
NaCl, 12.5 mM KC1, 2.5 mM CaCl2, 0.625mM MgCl2, 5 mM Na2HP04,


Figure 4-9. Summary of footprints on the L- and H-strand of the mTERF region of ovary
mtDNA. The mTERF binding region of X. laevis mtDNA is shown, with the boundaries of 16S rRNA and
tRNAle. The tridecamer termination box is shown in bold letters (hatched box below). The footprints
seen in Figure 4-8 are indicated as protected (open circles) or hypersensitive (filled squares) residues.


198
cue, which could be proteins, non-protein factors, or changes in
mitochondrial physiology, could trigger transcriptional activation.
Based on the hypothesis that one of the biochemical differences
among the developmental stages is related to the mitochondrial
energy levels, a simple experiment was conducted. This experiment
was based on the idea that an in vitro simulation of active
mitochondrial metabolism (putatively found in transcriptionally
active embryonic stages) could be accomplished by using non-
stimulated mitochondria (putatively found in transcriptionally less
active embryonic stages) and tricarboxylic acid cycle intermediates.
For this experiment, mitochondria were isolated from 20 hour-old
embryos, a stage at which transcription is not yet fully activated
(only ~5 fold over egg). Equal aliquots (each equivalent to 100
embryos) of the mitochondrial suspension were incubated in basic
buffer (panel A of Figure 5-6A), basic buffer plus sodium phosphate
(panel B), basic buffer + ADP (panel C), basic buffer + a-ketoglutaric
acid (panel D), basic buffer + phosphate and ADP (panel E), basic
buffer + phosphate, ADP, and a-ketoglutaric acid (panel F), or basic
buffer + ATP (panel G). Figure 5-6B shows the Phosphorimager
quantitation of the overall transcription rates measured with these


Figure 4-13. Comparison of the relative abundance of niTERF in distinct developmental
stages. A. 0.1 pMol f the radiolabeled band shift probe (wild type) was incubated with increasing
concentrations of the S-13 mitochondrial protein extract for 20 min at room temperature. Lanes 1, 7,
13, and 19 represent the free probe, without any added protein. Lanes 2-6, 8-12, 14-18, and 20-24
represent increasing concentrations of the S-13 extract as 5, 10, 15, 20, and 25 ug per reaction. After
the incubation, the samples were kept on ice and immediately loaded onto a 5% non-denaturing
polyacrylamide gel, dried, and autoradiographed as described in Materials and Methods. The positions
of the free probe and shifted species are shown, as are the developmental stages of the embryos used
for this experiment. The two species of bands seen for the free probe and the band shift represent
incomplete filling-in by the Klenow DNA polymerase used in this experiment, which was always seen
when this polymerase was used, regardless of the conditions tried. Hence, Sequenase DNA polymerase
(USB-Amersham) was used for obtaining a single probe species (as in Figure 4-12). But it should be
noted that the region of mTERF binding, the tridecamer sequence, is completely double-stranded even
before filling-in with Klenow fragement, as it is provided by the annealing of the two oligonucleotides.
Hence, both shifted bands represent mTERF binding. B. The gel in part A was quantitated using a
phosphorimager, and the phosphorimager volume units are plotted as a function of increasing
concentrations of the mitochondrial S-13 extract.


93
3-1). Meziane et al. (1989) analyzed mitochondrial mRNA levels in
total RNA from egg and embryonic stages and found that shortly (6-8
hours) after fertilization, there was a 5-10 fold reduction in
mitochondrial mRNA levels, which went up again only after the late
neurula stage (26-28 hours post-fertilization). This kind of sharp
decline in mitochondrial mRNA levels had not been observed in
earlier studies by other groups and was not observed when I
repeated their experiment. I found only a 1.5-2 fold reduction in
levels of some mRNAs (ND4, ATPase 6, Cyt b) by 14 hours of
development, while other mRNAs (ND1, CO II) showed even smaller
reductions (Figure 3-1, panels A-F and Table 3-1). This variation
between labs can be best explained by the fact that the total RNA
normalization employed by Meziane et al. (1989) for their Northern
analysis was not the optimal choice in this system, given the wealth
of information available on nucleic acid metabolism during
embryogenesis in Xenopus laevis.
The fertilized egg and cleaving embryos up to the mid-blastula
stage (12 divisions, 4000 cells, -7 hours post-fertilization) synthesize
nuclear DNA and divide rapidly, but are inactive in nuclear
transcription. Soon after this mid-blastula transition (Newport and



PAGE 1

5(*8/$7,21 2) 0,72&+21'5,$/ *(1( (;35(66,21 '85,1* ($5/< '(9(/230(17 2) ;(12386 /$(9,6 %\ &+$1'5$02+$1 9 $00,1, $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

$&.12:/('*(0(176 WKDQN 'U :LOOLDP : +DXVZLUWK P\ PHQWRU DQG VXSHUYLVRU IRU KLV FRQVWDQW VXSSRUW LQ ERWK DFDGHPLF DQG SHUVRQDO PDWWHUV +H JDYH PH LPPHQVH IUHHGRP LQ WKH FRQGXFW RI H[SHULPHQWV DQG VWRRG E\ PH GXULQJ GLIILFXOW WLPHV NQHZ FRXOG DOZD\V FRXQW RQ KLP ZRXOG DOVR OLNH WR WKDQN DOO WKH SDVW DQG SUHVHQW FROOHDJXHV LQ WKH ODE ZKR KDYH PDGH OLIH LQ WKH ODE HQMR\DEOH DQG IULHQGO\ ZRXOG OLNH WR WKDQN WKH PHPEHUV RI P\ DGYLVRU\ FRPPLWWHH 'UV $ /HZLQ 0DXU\ 6ZDQVRQ DQG 7RP 5RZH IRU WKH YDULRXV FRQVWUXFWLYH VXJJHVWLRQV WKH\ KDYH PDGH GXULQJ WKH FRXUVH RI WKH LQYHVWLJDWLRQ DQG IRU WDNLQJ WKH WLPH WR UHYLHZ YDULRXV GRFXPHQWV LQFOXGLQJ WKLV RQH DOVR DSSUHFLDWH WKH LQSXW IURP DOO WKH RWKHU IDFXOW\ DQG VWXGHQWV LQ WKH GHSDUWPHQW ZKLFK KDV KHOSHG LQ P\ SHUVRQDO JURZWK DOVR WKDQN WKH RWKHU SHUVRQQHO LQ WKH 'HSDUWPHQW HVSHFLDOO\ -R\FH &RQQHUV DQG %UDG 0RRUH IRU WKHLU HIILFLHQW KHOS 0\ VSHFLDO WKDQNV JR WR +\PD P\ ZLIH ZKR KDV VWRRG E\ PH GXULQJ DOO WLPHV JRRG DQG EDG DQG PDGH WKLV DOO SRVVLEOH Q

PAGE 3

7$%/( 2) &217(176 $&.12:/('*(0(176 LL /,67 2) 7$%/(6 Y /,67 2) ),*85(6 YL $%675$&7 L[ &+$37(56 ,1752'8&7,21 *HQHUDO ,QWURGXFWLRQ 0LWRFKRQGULDO '1$ 0LWRFKRQGULDO '1$ 5HSOLFDWLRQ 0LWRFKRQGULDO 7UDQVFULSWLRQ 5HJXODWLRQ RI 0LWRFKRQGULDO *HQH ([SUHVVLRQ n )RFXV RI 'LVVHUWDWLRQ 0$7(5,$/6 $1' 0(7+2'6 )URJV '1$ 3ULPHUV /DERUDWRU\ )HUWLOL]DWLRQ RI (JJV 'HMHOO\LQJ RI (JJV DQG (PEU\RV ,VRODWLRQ RI 0LWRFKRQGULD IURP (JJV DQG (PEU\RV ,VRODWLRQ RI 0LWRFKRQGULD IURP 2YDU\ 7LVVXH 'LPHWK\O 6XOIDWH )RRWSULQWLQJ RI 0LWRFKRQGULDO '1$ 6WHDG\ 6WDWH 51$ $QDO\VLV 0LWRFKRQGULDO 5XQ 2Q 7UDQVFULSWLRQ 0HDVXUHPHQW RI 0LWRFKRQGULDO $GHQLQH 1XFOHRWLGHV (OHFWURSKRUHWLF 0RELOLW\ 6KLIW $VVD\V LLL

PAGE 4

67($'< 67$7( $1$/<6,6 2) 0,72&+21'5,$/ 51$ /(9(/6 ,QWURGXFWLRQ 5HVXOWV 'LVFXVVLRQ $1$/<6,6 2) 3527(,10,72&+21'5,$/ '1$ ,17(5$&7,216 $7 &5,7,&$/ &,6(/(0(176 ,QWURGXFWLRQ 5HVXOWV 'LVFXVVLRQ 0,72&+21'5,$/ 75$16&5,37,21 5$7( $1$/<6,6 ,QWURGXFWLRQ 5HVXOWV 'LVFXVVLRQ 6800$5< $1' 3(563(&7,9(6 /,67 2) 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ ,9

PAGE 5

/,67 2) 7$%/(6 6WHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO 51$ LQ WRWDO HJJ RU HPEU\RQLF 51$ GXULQJ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV 0LWRFKRQGULDO P51$ VWHDG\ VWDWH OHYHOV LQ LVRODWHG PLWRFKRQGULD IURP GLVWLQFW GHYHORSPHQWDO VWDJHV RI ; ODHYLV 6WHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO 51$ QRUPDOL]HG WR PW'1$f GXULQJ HDUO\ GHYHORSPHQW RI ; ODHYLV 3URPRWHUZLVH DQG RYHUDOO WUDQVFULSWLRQ UDWHV SHU XQLW PLWRFKRQGULDO JHQRPH GXULQJ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV 0LWRFKRQGULDO DGHQLQH QXFOHRWLGH OHYHOV GXULQJ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV 7RWDO DGHQLQH QXFHORWLGH OHYHOV LQ XQIHUWLOL]HG HJJV DQG HDUO\ GHYHORSPHQWDO VWDJHV RI ;HQRSXV ODHYLV Y

PAGE 6

/,67 2) ),*85(6 ([SHULPHQW WR GHWHUPLQH WKH RSWLPDO QXPEHU RI F\FOHV RI OLQHDU DPSOLILFDWLRQ ([SHULPHQW FRPSDULQJ GLIIHUHQW WKHUPRVWDEOH '1$ SRO\PHUDVHV IRU DFFXUDWH DPSOLILFDWLRQ RI WKH IRRWSULQW ODGGHU 6WHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO 51$ GXULQJ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV 6WHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO 51$ LVRODWHG IURP SXULILHG PLWRFKRQGULD GXULQJ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV 6WHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO 51$ SHU XQLW PLWRFKRQGULDO JHQRPH GXULQJ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV 6WHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO P51$V SHU XQLW PLWRFKRQGULDO JHQRPH GXULQJ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV 5HYLVHG YLHZ RI PLWRFKRQGULDO JHQH UHJXODWLRQ GXULQJ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV *HQHUDO VFKHPH IRU LQ YLYR '1$ IRRWSULQWLQJ ,Q RUJDQHOOR IRRWSULQW RI WKH SURPRWHU UHJLRQ ,Q RUJDQHOOR IRRWSULQWLQJ RI WKH 'ORRS XSVWUHDP UHJLRQ YL

PAGE 7

6FKHPDWLF YLHZ RI SURWHLQ'1$ LQWHUDFWLRQV GHWHFWHG E\ LQ RUJDQHOOR IRRWSULQWLQJ RI WKH 'ORRS XSVWUHDP UHJLRQ ,Q YLYR IRRWSULQWLQJ RI WKH +VWUDQG RI 'ORRS XSVWUHDP UHJLRQ GXULQJ HDUO\ GHYHORSPHQW RI ; ODHYLV ,Q YLYR IRRWSULQWLQJ RI WKH /VWUDQG RI 'ORRS XSVWUHDP UHJLRQ GXULQJ HDUO\ GHYHORSPHQW RI ; ODHYLV ,Q YLYR IRRWSULQWLQJ RI WKH /VWUDQG RI WKH SURPRWHU UHJLRQ GXULQJ HDUO\ GHYHORSPHQW RI ; ODHYLV ,Q RUJDQHOOR IRRWSULQW RI WKH P7(5) UHJLRQ LQ RYDU\ PW'1$ 6XPPDU\ RI IRRWSULQWV RQ WKH / DQG +VWUDQG RI WKH P7(5) UHJLRQ RI RYDU\ PW'1$ ,Q YLYR IRRWSULQWLQJ RI WKH /VWUDQG RI WKH P7(5) UHJLRQ GXULQJ HDUO\ GHYHORSPHQW RI ; ODHYLV ,Q YLYR IRRWSULQWLQJ RI WKH +VWUDQG RI WKH P7(5) UHJLRQ GXULQJ HDUO\ GHYHORSPHQW RI ; ODHYLV *HO PRELOLW\ VKLIW DVVD\ IRU P7(5) SURWHLQ &RPSDULVRQ RI WKH UHODWLYH DEXQGDQFH RI P7(5) LQ GLVWLQFW GHYHORSPHQWDO VWDJHV 6L]H IUDFWLRQDWLRQ RI PLWRFKRQGULDO UXQRQ 51$ +\EULGL]DWLRQ WDUJHW SDQHO IRU VWUDQGVSHFLILF GHWHFWLRQ RI UXQRQ WUDQVFULSWV 0LWRFKRQGULDO UXQRQ WUDQVFULSWLRQ LQ HDUO\ GHYHORSPHQWDO VWDJHV 3URPRWHUZLVH DQG RYHUDOO WUDQVFULSWLRQ UDWHV GXULQJ HDUO\ GHYHORSPHQW YLL

PAGE 8

&RPSDULVRQ RI PLWRFKRQGULDO WUDQVFULSWLRQ UDWHV DQG VWHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO WUDQVFULSWV GXULQJ HDUO\ GHYHORSPHQW RI ; ODHYLV (IIHFW RI DGGLWLRQ RI PHWDEROLF LQWHUPHGLDWHV RQ WKH WUDQVFULSWLRQ UDWH RI KU VWDJH PLWRFKRQGULD (IIHFW RI DGGLWLRQ RI PHWDEROLF LQKLELWRUV RQ WKH WUDQVFULSWLRQ UDWH RI KU VWDJH PLWRFKRQGULD YLLL

PAGE 9

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ 5(*8/$7,21 2) 0,72&+21'5,$/ *(1( (;35(66,21 '85,1* ($5/< '(9(/230(17 2) ;(12386 /$(9,6 %\ &KDQGUDPRKDQ 9 $PPLQL 0D\ &KDLUSHUVRQ :LOOLDP : +DXVZLUWK 0DMRU 'HSDUWPHQW 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ 0LWRFKRQGULDO WUDQVFULSW OHYHOV DUH DFWLYHO\ UHJXODWHG GXULQJ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV ZKHUHDV PLWRFKRQGULDO '1$ PW'1$f OHYHOV DUH FRQVWDQW GXULQJ WKLV WLPH SURYLGLQJ WKH XQLTXH RSSRUWXQLW\ WR VWXG\ PLWRFKRQGULDO WUDQVFULSWLRQDO UHJXODWLRQ GHFRXSOHG IURP PW'1$ UHSOLFDWLRQ 7KH PDLQ IRFXV RI WKLV GLVVHUWDWLRQ ZDV WR JDLQ IXUWKHU LQVLJKWV LQWR WKH PROHFXODU PHFKDQLVPV RI PLWRFKRQGULDO JHQH UHJXODWLRQ LQ WKLV V\VWHP 0HDVXUHPHQW RI VWHDG\ VWDWH WUDQVFULSW OHYHOV SHU XQLW PLWRFKRQGULDO JHQRPH VKRZHG WKDW WUDQVFULSW OHYHOV ZHUH EDVDO XS WR ,;

PAGE 10

JDVWUXODWLRQ ZLWK D FRRUGLQDWH LQGXFWLRQ WKHUHDIWHU 0LWRFKRQGULDO UXQRQ WUDQVFULSWLRQ DVVD\V XVLQJ LVRODWHG RUJDQHOOHV IURP GLVWLQFW GHYHORSPHQWDO VWDJHV VKRZHG WKDW WUDQVFULSWLRQ ZDV WKH SULPDU\ GHWHUPLQDQW RI GLIIHUHQFHV LQ WUDQVFULSW DEXQGDQFH 7R WHVW ZKHWKHU WUDQVFULSWLRQ ZDV UHJXODWHG E\ WKH FKDQJLQJ VWRLFKLRPHWULHV RI WKH ;HQRSXV PLWRFKRQGULDO WUDQVFULSWLRQ IDFWRU $ [OPW7)$f LQ YLYR IRRWSULQWLQJ RI PW'1$ ZDV FDUULHG RXW $OWKRXJK IRRWSULQW DVVD\V FRQILUPHG WKDW WKH PW7)$ ELQGV WKH 'ORRS UHJLRQ LQ D SKDVHG PDQQHU QR VLJQLILFDQW GLIIHUHQFHV ZHUH GHWHFWHG LQ WKH RFFXSDQF\ RI [OPW7)$ GXULQJ UHJXODWHG WUDQVFULSWLRQ VKRZLQJ WKDW UHJXODWLRQ ZDV QRW E\ FKDQJLQJ [OPW7)$ ELQGLQJ WR PW'1$ 0LWRFKRQGULDO WUDQVFULSWLRQDO DFWLYLW\ VKRZHG D SRVLWLYH FRUUHODWLRQ ZLWK WKH PHWDEROLF VWDWXV RI PLWRFKRQGULD DV LQGLFDWHG E\ PLWRFKRQGULDO $73 PHDVXUHPHQWV DQG UXQRQ WUDQVFULSWLRQ DVVD\V LQ WKH SUHVHQFH RI PHWDEROLF LQWHUPHGLDWHV 7KLV VXJJHVWV WKDW WUDQVFULSWLRQDO UHJXODWLRQ PD\ EH VHQVLWLYH WR WKH PLWRFKRQGULDO PHWDEROLF VWDWXV )RRWSULQWLQJ DQG EDQG VKLIW DVVD\V FRQILUPHG WKH SUHVHQFH RI WKH PLWRFKRQGULDO WHUPLQDWLRQ IDFWRU P7(5)f LQ ;HQRSXV PLWRFKRQGULD 7KH PRGH RI IRRWSULQWLQJ VXJJHVWHG D ORFDOL]HG GLVWRUWLRQ RI '1$ VWUXFWXUH FRQVLVWHQW ZLWK LQ YLWUR UHSRUWV RI '1$ EHQGLQJ E\ WKLV [

PAGE 11

SURWHLQ +RZHYHU WKH ELQGLQJ VLWH ZDV HTXLYDOHQWO\ RFFXSLHG GXULQJ UHJXODWHG WUDQVFULSWLRQ DQG EDQG VKLIW DVVD\V VKRZHG HTXLYDOHQW SURWHLQ FRQFHQWUDWLRQV GXULQJ WKLV WLPH VXJJHVWLQJ WKDW P7(5) LV D FRQVWLWXWLYH '1$EHQGLQJ SURWHLQ ZKLFK UHPDLQV ERXQG WR LWV FRJQDWH VLWH DW DOO WLPHV SRVLQJ D SK\VLFDO EORFN WR WKH HORQJDWLQJ 51$ SRO\PHUDVH [L

PAGE 12

&+$37(5 ,1752'8&7,21 *HQHUDO ,QWURGXFWLRQ 0LWRFKRQGULD DUH HVVHQWLDO RUJDQHOOHV RI HXNDU\RWLF FHOOV ZKLFK DUH ODUJHO\ PDWHUQDOO\ LQKHULWHG DQG SOD\ D YLWDO UROH LQ FHOOXODU SK\VLRORJ\ 7KHLU SULQFLSDO IXQFWLRQ LQ WKH FHOO LV SURGXFWLRQ RI DGHQRVLQH WULSKRVSKDWH $73f E\ WKH KLJKO\ HIILFLHQW SURFHVV RI R[LGDWLYH SKRVSKRU\ODWLRQ EXW WKH\ DOVR FRQWULEXWH WR WKH ELRV\QWKHVLV RI PDFURPROHFXOHV VXFK DV S\ULPLGLQHV DPLQR DFLGV SKRVSKROLSLGV QXFOHRWLGHV IRODWH FRHQ]\PHV KHPH XUHD DQG PDQ\ RWKHU PHWDEROLWHV $WWDUGL DQG 6FKDW] f $ IHDWXUH WKDW VHWV WKHP DSDUW IURP RWKHU RUJDQHOOHV LV WKHLU VPDOO EXW HVVHQWLDO '1$ JHQRPH ZKLFK LV GLVWLQFW IURP QXFOHDU '1$ (DFK KXPDQ FHOO KDV KXQGUHGV RI PLWRFKRQGULD DQG WKRXVDQGV RI PW'1$V 7KH SUHVHQFH RI DQ H[WUDQXFOHDU JHQRPH QHFHVVLWDWHV WKH SUHVHQFH RI ELRV\QWKHWLF PDFKLQHU\ IRU WKH WUDQVFULSWLRQ DQG UHSOLFDWLRQ RI PLWRFKRQGULDO '1$ DQG PLWRFKRQGULDO ULERVRPHV IRU WKH WUDQVODWLRQ RI PLWRFKRQGULDO P51$V 0LWRFKRQGULDO ELRJHQHVLV LQYROYHV D PDMRU FRQWULEXWLRQ RI JHQH SURGXFWV PRUH WKDQ f HQFRGHG LQ WKH

PAGE 13

QXFOHDU JHQRPH DQG D PLQRU WKRXJK HVVHQWLDO FRQWULEXWLRQ RI JHQH SURGXFWV OHVV WKDQ f HQFRGHG LQ WKH PLWRFKRQGULDO JHQRPH $WWDUGL DQG 6FKDW] f 6RSKLVWLFDWHG PHFKDQLVPV HQVXUH WKH LPSRUW DQG LQWUDPLWRFKRQGULDO VRUWLQJ RI F\WRSODVPLFDOO\ V\QWKHVL]HG SURWHLQV SKRVSKROLSLGV DQG SUREDEO\ D IHZ 51$V +HQFH PLWRFKRQGULDO ELRJHQHVLV LV FRPSOH[ DQG XQGHU PXOWLSOH OD\HUV RI UHJXODWLRQ $WWDUGL DQG 6FKDW] &KRP\Q DQG $WWDUGL f 7KH OLQNDJH RI FKURQLF GHJHQHUDWLYH KXPDQ GLVHDVHV WR PLWRFKRQGULDO G\VIXQFWLRQ KDV UHVXOWHG LQ D GUDPDWLF XSVZLQJ RI VFLHQWLILF LQWHUHVW LQ WKH ELRJHQHVLV DQG UHJXODWLRQ RI WKLV FRPSOH[ RUJDQHOOH 0LWRFKRQGULDO HQFHSKDORP\RSDWKLHV DUH D GLYHUVH JURXS RI GLVRUGHUV WKDW UHVXOW IURP WKH VWUXFWXUDO ELRFKHPLFDO RU JHQHWLF GHUDQJHPHQW RI PLWRFKRQGULD 7KHUHIRUH WKH\ DUH PDQLIHVWHG SULPDULO\ LQ RUJDQV UHTXLULQJ KLJK HQHUJ\ OHYHOV OLNH WKH EUDLQ KHDUW PXVFOH NLGQH\ DQG HQGRFULQH JODQGV 6LQFH WKHVH HQFHSKDORP\RSDWKLHV VKDUH V\VWHPLF IHDWXUHV WKH\ DUH QDPHG DIWHU WKH V\PSWRPV WKH\ LQGXFH OLNH 0(/$6 0\RFORQLF (SLOHSV\ /DFWLF $FLGRVLV DQG 6WURNHOLNH HSLVRGHVf 0(55) 0\RFORQLF (SLOHSV\ ZLWK 5DJJHG5HG )LEHUVf /+21 /HEHUfV KHULGLWDU\ RSWLF QHXURSDWK\f .66 .HDUQV6D\UH V\QGURPHf HWF :DOODFH f 7KH SK\VLRORJLFDO EDVLV RI DOO WKHVH GLVRUGHUV LV WKDW PLWRFKRQGULD KDYH WR SURGXFH D FHUWDLQ DPRXQW RI HQHUJ\ FRQWLQXDOO\

PAGE 14

7KHRUHWLFDOO\ D GHIHFW LQ DQ\ RQH RI WKH WKUHH WR IRXU KXQGUHG SOXV JHQHV QXFOHDU RU PLWRFKRQGULDOHQFRGHGf LQYROYHG LQ PLWRFKRQGULDO ELRJHQHVLV FDQ ZHDNHQ PLWRFKRQGULDO IXQFWLRQ OHDGLQJ XOWLPDWHO\ WR FKURQLF GHJHQHUDWLYH GLVHDVH ,I WKH PXWDWLRQ LV LQ PW'1$ DQ LQWUDFHOOXODU PL[WXUH RI QRUPDO DQG PXWDQW PW'1$V LV FUHDWHG D SKHQRPHQRQ FDOOHG KHWHURSODVP\ :DOODFH f 5HSOLFDWLYH VHJUHJDWLRQ RI KHWHURSODVPLF JHQRW\SHV WRZDUGV KRPRSODVPLF W\SHV OHDGV WR UDSLG IL[DWLRQ RI WKH PXWDWLRQV /DLSLV HW DO
PAGE 15

LQFRPSDWLELOLW\ EHWZHHQ PLWRFKRQGULDO DQG QXFOHDU JHQHWLF EDFNJURXQGV RIWHQ UHVXOW LQ F\WRSODVPLF PDOH VWHULOLW\ FDXVLQJ LQIHUWLOH SROOHQ /HYLQJV DQG %URZQ f 0LWRFKRQGULDO '1$ 0LWRFKRQGULDO '1$ KDV WKH VDPH EDVLF UROH LQ DOO HXNDU\RWHV WKDW FRQWDLQ LW LW HQFRGHV U51$ DQG W51$ FRPSRQHQWV RI D PLWRFKRQGULDO SURWHLQ V\QWKHVL]LQJ V\VWHP ZKLFK WUDQVODWH D OLPLWHG QXPEHU RI PW'1$HQFRGHG P51$V WKDW FRGH IRU VRPH RI WKH VXEXQLWV RI NH\ HQ]\PH V\VWHPV LQYROYHG LQ R[LGDWLYH SKRVSKRU\ODWLRQ 7KHUH LV H[WUDRUGLQDU\ YDULDWLRQ LQ WKH VL]H VWUXFWXUH RUJDQL]DWLRQ DQG PRGH RI H[SUHVVLRQ RI WKH PW'1$ 7KH\ LQFOXGH WKH JLJDQWLF NE FLUFOHV RI PDL]H /RQVGDOH HW DO f NE OLQHDU PROHFXOHV RI 7HWUDK\PHQD %RUVW f NE RI 6DFFKDURP\FHV FHUHYLVLDH =DPDURF]\ DQG %HUQDUGL f WKH H[WUDRUGLQDULO\ FRPSOLFDWHG PD[LFLUFOHV RI 7U\SDQRVRPD EUXFHL %HQQH 6LPSVRQ f DQG WKH H[WUHPHO\ FRPSDFW YHUWHEUDWH PW'1$ NEf 7KH H[LVWHQFH DQG VWUXFWXUH RI YHUWHEUDWH PW'1$ ZDV HVWDEOLVKHG PRUH WKDW \HDUV DJR ,Q DOO YHUWHEUDWH V\VWHPV VWXGLHG WR GDWH PW'1$ LV D FORVHG FLUFXODU GXSOH[ VSHFLHV RI DSSUR[LPDWHO\ NE ZKLFK LQ PDQ\ FDVHV FRQWDLQV D WULSOHVWUDQGHG UHJLRQ FDOOHG WKH 'LVSODFHPHQW ORRS RU 'ORRS UDQJLQJ IURP NE LQ GLIIHUHQW

PAGE 16

VSHFLHVf DW D VSHFLILF ORFDWLRQ LQ WKH JHQRPH (DUO\ VWXGLHV RQ WKH PRGH RI PW'1$ UHSOLFDWLRQ UHYHDOHG WKDW HDFK VWUDQG RI WKH GXSOH[ FRXOG EH GLVWLQJXLVKHG RQ WKH EDVLV RI *7 EDVH FRPSRVLWLRQ D ELDV LQ FRPSRVLWLRQ UHVXOWV LQ GLIIHUHQW EXR\DQW GHQVLWLHV RI HDFK VWUDQG nKHDY\n RU +VWUDQG DQG nOLJKWn RU /VWUDQGf LQ DONDOLQH FHVLXP FKORULGH JUDGLHQWV 7KH PRVW VWULNLQJ IHDWXUH RI YHUWHEUDWH PW'1$ LV LWV H[WUHPHO\ FRPSDFW JHQH RUJDQL]DWLRQ ZKLFK DOORZV LW WR HQFRGH LQIRUPDWLRQ IRU NQRZQ JHQHV 7KH PDMRU FRGLQJ VWUDQG WKH +VWUDQGf FRQWDLQV JHQHV WZR U51$V W51$V DQG SURWHLQV 7KH /VWUDQG HQFRGHV W51$V DQG RQH SURWHLQ 7KH SURWHLQV LQFOXGH VHYHQ VXEXQLWV RI 1$'+ GHK\GURJHQDVH 1' / f WKUHH VXEXQLWV RI F\WRFKURPH F R[LGDVH &2; f WZS VXEXQLWV RI $73 V\QWKDVH $73DVH f DQG WKH DSRF\WRFKURPH E &\W Ef ,Q PRVW FDVHV WKHVH JHQHV DEXW HDFK RWKHU RU DUH VHSDUDWHG E\ RQO\ D IHZ QXFOHRWLGHV DQG WKHUH DUH QR LQWURQV WKH RQO\ QRQFRGLQJ VWUHWFK EHLQJ LQ WKH ORRS FRQWURO UHJLRQ KRXVLQJ WKH WUDQVFULSWLRQ DQG UHSOLFDWLRQ HOHPHQWV $OPRVW DOO UHDGLQJ IUDPHV ODFN VLJQLILFDQW QRQWUDQVODWHG IODQNLQJ UHJLRQV 0RQWR\D HW DO f DQG PRVW RI WKHP ODFN HYHQ D FRPSOHWH WHUPLQDWLRQ FRGRQ HQGLQJ LQVWHDG ZLWK HLWKHU D 7 RU 7$ IROORZLQJ WKH ODVW VHQVH FRGRQ ,Q WKHVH FDVHV FRPSOHWLRQ RI WKH

PAGE 17

WHUPLQDWLRQ FRGRQ 7$$ RFFXUV SRVWWUDQVFULSWLRQDOO\ E\ SRO\DGHQ\ODWLRQ RI WKH P51$V 2MDOD HW DO f 0LWRFKRQGULDO '1$ 5HSOLFDWLRQ 7KH PHFKDQLVP RI YHUWHEUDWH PW'1$ UHSOLFDWLRQ KDV EHHQ VWXGLHG SULPDULO\ LQ FXOWXUHV RI KXPDQ DQG PRXVH FHOOV \HDVW UDW OLYHU DQG LV XQGHUVWRRG LQ FRQVLGHUDEOH GHWDLO ,Q %HUN DQG &OD\WRQ XVLQJ PRXVH / FHOO OLQHV ODFNLQJ WKH F\WRSODVPLF WK\PLGLQH NLQDVH EXW UHWDLQLQJ WKH PLWRFKRQGULDO HQ]\PH ZKLFK DOORZHG VHOHFWLYH UDGLRODEHOLQJ RI PW'1$ VKRZHG WKDW PW'1$ UHSOLFDWLRQ FRQWLQXHV WKURXJKRXW WKH FHOO F\FOH GRXEOLQJ DW DERXW WKH VDPH UDWH DV WKH FHOO ZLWK PW'1$ PROHFXOHV EHLQJ VHOHFWHG DW UDQGRP IRU UHSOLFDWLRQ 7KLV SKHQRPHQRQ IRUPV WKH EDVLV RI UHSOLFDWLYH VHJUHJDWLRQ RI KHWHURSODVPLF JHQRW\SHV 7KHUH DUH WZR VHSDUDWH DQG GLVWLQFW RULJLQV RI UHSOLFDWLRQ IRU HDFK VWUDQG 7KH RULJLQ RI +VWUDQG V\QWKHVLV +f LV ORFDWHG ZLWKLQ WKH QRQFRGLQJ 'ORRS UHJLRQ RI WKH JHQRPH 5REEHUVRQ DQG &OD\WRQ %URZQ DQG 9LQRJUDG 5REEHUVRQ HW DK 7DSSHU DQG &OD\WRQ f ZKHUHDV WKH RULJLQ RI /VWUDQG V\QWKHVLV 2Of LV QHVWHG ZLWKLQ D FOXVWHU RI ILYH W51$ JHQHV ORFDWHG VHYHUDO NLOREDVHV DZD\ IURP WKH + 0DUWHQV DQG &OD\WRQ f $ FRPPLWPHQW WR PW'1$ UHSOLFDWLRQ EHJLQV E\ WKH LQLWLDWLRQ RI +VWUDQG V\QWKHVLV WKDW

PAGE 18

UHVXOWV LQ VWUDQG HORQJDWLRQ RYHU WKH HQWLUH OHQJWK RI WKH JHQRPH ,QLWLDWLRQ RI /VWUDQG V\QWKHVLV EHJLQV RQO\ DIWHU WKH 2O LV H[SRVHG DV D VLQJOHVWUDQGHG WHPSODWH $V\QFKURQRXV UHSOLFDWLRQ RI HDFK VWUDQG WKHQ FRPSOHWHV UHSOLFDWLRQ WKH UHJLRQ EHWZHHQ WKH WZR RULJLQV EHLQJ UHSOLFDWHG ODVW 7KH FULWLFDO HOHPHQWV RI WKH PDPPDOLDQ +VWUDQG UHSOLFDWLRQ RULJLQ LQFOXGH WKH /VWUDQG SURPRWHU DQG WKUHH GRZQVWUHDP FRQVHUYHG VHTXHQFH EORFNV &6% ,, ,,,f 7KH LQYROYHPHQW RI 51$ SULPHUV LQ WKH LQLWLDWLRQ RI +VWUDQG V\QWKHVLV ZDV VKRZQ E\ WKH SUHVHQFH RI DONDOLVHQVLWLYH f HQGV LQ 'ORRS '1$ *LOOXP DQG &OD\WRQ %UHQQLFNH DQG &OD\WRQ f 7KH 51$ SULPHU ZDV VKRZQ WR RULJLQDWH IURP WKH /VWUDQG SURPRWHU &KDQJ DQG &OD\WRQ &KDQJ HW DO f ZLWK D VKDUS WUDQVLWLRQ IURP 51$ WR '1$ RFFXUULQJ ZLWKLQ D VHULHV RI KLJKO\ FRQVHUYHG VHTXHQFH EORFNV &6% f LQ D UHJLRQ RI PW'1$ ZKLFK LV RWKHUZLVH KLJKO\ GLYHUJHQW DFURVV VSHFLHV :DOEHUJ DQG &OD\WRQ f $ VHDUFK IRU DQ HQGRQXFOHRO\WLF DFWLYLW\ ZLWK WKH DELOLW\ WR UHFRJQL]H IHDWXUHV RI WKH &6%V DQG SURFHVV QDVFHQW 51$ WUDQVFULSWV OHG WR WKH GLVFRYHU\ RI PRXVH 51$DVH 053 PLWRFKRQGULDO 51$ SURFHVVLQJf &KDQJ DQG &OD\WRQ Df 7KLV ZDV IRXQG WR EH D ULERQXFOHRSURWHLQ ZLWK D QXFOHRWLGH 51$ VSHFLHV &KDQJ DQG &OD\WRQ Ef ZLWK D QXFOHRWLGH VHTXHQFH FRPSOHPHQWDU\ WR &6% ,, &KDQJ DQG &OD\WRQ

PAGE 19

f 7KH LQYROYHPHQW RI WKLV IDFWRU LQ FUHDWLQJ UHSOLFDWLRQ SULPHUV KDV EHHQ TXHVWLRQHG E\ D VXEFHOOXODU DQG VXERUJDQHOODU IUDFWLRQDWLRQ VWXG\ ZKLFK IDLOHG WR GHWHFW 51DVH 053 51$ LQ PLWRFKRQGULD .LVV DQG )LOLSRZLF] f +RZHYHU D UHFHQW DQDO\VLV RI WKH 51DVH 053 51$ GLVWULEXWLRQ E\ GLUHFW LQ VLWX K\EULGL]DWLRQ ORFDOL]HG D GHILQDEOH SRUWLRQ RI LQWUDFHOOXODU 51DVH 053 WR WKH PLWRFKRQGULD RI PRXVH FHOOV /L HW DO f &6% ,, DOVR FDOOHG *& FOXVWHU & LQ \HDVWf LV *& ULFK DQG LV WKH PRVW FRQVHUYHG HOHPHQW LQ PW'1$ UHSOLFDWLRQ RULJLQV IURP 6DFFKDURP\FHV FHUHYLVLDH WR KXPDQV ;X DQG &OD\WRQ f IRXQG D VWDEOH DQG SHUVLVWHQW 51$'1$ K\EULG IRUPDWLRQ EHJLQQLQJ DW WKH f HQG RI &6% ,, GXULQJ LQ YLWUR WUDQVFULSWLRQ ZLWK WHPSODWHV FDUU\LQJ \HDVW UHSOLFDWLRQ RULJLQV &6% ,, ZDV WKH QHFHVVDU\ DQG VXIILFLHQW QXFOHLF DFLG HOHPHQW IRU HVWDEOLVKLQJ VWDEOH K\EULGV ZLWK WKH HIILFLHQF\ RI K\EULG IRUPDWLRQ GHFUHDVLQJ ZLWK LQFUHDVLQJ GLVWDQFH EHWZHHQ &6% ,, DQG WKH SURPRWHU 2QFH PDGH WKH 51$ VWUDQGV RI WKHVH 51$'1$ K\EULGV FRXOG EH HORQJDWHG HIILFLHQWO\ E\ PW'1$ SRO\PHUDVH 7KHVH UHVXOWV VXJJHVW WKDW DIWHU WUDQVFULSWLRQ LQLWLDWLRQ WKH QH[W FULWLFDO VWHS IRU LQLWLDWLQJ PW'1$ UHSOLFDWLRQ LV WKH IRUPDWLRQ RI D VWDEOH 51$'1$ K\EULG ;X DQG &OD\WRQ f DOVR IRXQG WKH IRUPDWLRQ RI D VLPLODU 51$'1$ K\EULG 5ORRSf LQ WKH KXPDQ V\VWHP (IILFLHQW K\EULG IRUPDWLRQ ZDV DJDLQ GHSHQGHQW RQ WKH *&ULFK &6% ,,

PAGE 20

HOHPHQW ,QWHUHVWLQJO\ HIILFLHQW K\EULG IRUPDWLRQ ZDV LQIOXHQFHG E\ VHTXHQFHV f WR WKH K\EULG LQFOXGLQJ WKH &6% ,,, HOHPHQW ,Q VWUXFWXUDO VWXGLHV RI WKLV 51$'1$ K\EULG /HH DQG &OD\WRQ f IRXQG WKH 5ORRS WR EH H[FHSWLRQDOO\ VWDEOH ZLWK H[WHQVLYH LQWUDVWUDQG IROGLQJ VXJJHVWLQJ WKDW WKH 51$ VWUDQG LQ WKH 51$'1$ LV RUJDQL]HG LQWR D VSHFLILF FRQIRUPDWLRQ ZKLFK PD\ KDYH LPSRUWDQW LPSOLFDWLRQV IRU 51$ SURFHVVLQJ LQ YLYR 7KHVH QHZO\ GLVFRYHUHG IHDWXUHV RI +VWUDQG SULPLQJ LQFUHDVH WKH DQDORJ\ EHWZHHQ PW'1$ UHSOLFDWLRQ DQG &RO(O SODVPLG UHSOLFDWLRQ ,Q WKH &RO(O SODVPLG RULJLQ RI UHSOLFDWLRQ D VWUHWFK RI VL[ U* UHVLGXHV LQ WKH SULPHU 51$ K\EULGL]HG WR D GLVWDQW GRZQVWUHDP UHJLRQ RI WHPSODWH VWUDQG G&V DW WKH &RO(O RULJLQ LV RI IXQGDPHQWDO LPSRUWDQFH LQ IRUPLQJ SULPHU f HQGV E\ VWDELOL]LQJ DQ 51$'1$ K\EULG GXSOH[ VLWH UHFRJQL]HG E\ 51DVH + 0DVXNDWD DQG 7RPL]DZD f $IWHU SULPLQJ RFFXUV LQ WKH &6% UHJLRQ '1$ UHSOLFDWLRQ HLWKHU SURFHHGV WR FRPSOHWLRQ RU WHUPLQDWHV SUHPDWXUHO\ WR QXFOHRWLGHV GHSHQGLQJ RQ WKH YHUWHEUDWH VSHFLHVf GRZQVWUHDP *LOOXP DQG &OD\WRQ 'XQRQ%OXWHDX DQG %UXQ f FUHDWLQJ WKH WULSOH '1$ VWUXFWXUH NQRZQ DV WKH 'LVSODFHPHQW ORRS 'ORRSf RQH RI WKH HQGXULQJ P\VWHULHV RI PLWRFKRQGULDO PROHFXODU ELRORJ\ .DVDPDWVX HW DO %URZQ DQG 9LQRJUDG &OD\WRQ f 7KH LQ YLYR UROH RI WKH 'ORRS LV QRW XQGHUVWRRG LQ DQ\ V\VWHP

PAGE 21

%RJHQKDJHQ DQG &OD\WRQ f VWXGLHG WKH NLQHWLFV RI 'ORRS '1$ 6 '1$f IRUPDWLRQ E\ SXOVHFKDVH H[SHULPHQWV LQ 0RXVH /FHOOV 7KH KDOIOLIH RI SXOVHODEHOHG 6 '1$ LV DSSUR[LPDWHO\ PLQXWHV D WXUQRYHU VR UDSLG WKDW DW OHDVW b RI WKLV '1$ SRRO LV ORVW ZLWKRXW DFWLQJ DV SULPHUV IRU +VWUDQG V\QWKHVLV VXJJHVWLQJ WKDW WKH SULPDU\ UROH RI 'ORRS '1$ LV QRW UHSOLFDWLRQ SULPLQJ $IWHU VXFFHVVIXO +VWUDQG V\QWKHVLV SURFHHGV DSSUR[LPDWHO\ WZR WKLUGV RI WKH ZD\ DURXQG WKH JHQRPH WKH /VWUDQG RULJLQ / LV H[SRVHG 0DUWHQV DQG &OD\WRQ f 7KLV RULJLQ LV ORFDWHG LQ D WR EDVH QRQFRGLQJ UHJLRQ ZLWKLQ D FOXVWHU RI ILYH W51$ JHQHV IRUPLQJ D VWDEOH VWHPORRS VWUXFWXUH KLJKO\ FRQVHUYHG LQ PRVW YHUWHEUDWHV 0DUWHQV DQG &OD\WRQ 7DSSHU DQG &OD\WRQ :RQJ DQG &OD\WRQ Df $ SULPDVH DFWLYLW\ GLVWLQFW IURP PLWRFKRQGULDO 51$ SRO\PHUDVH KDV EHHQ LGHQWLILHG ZKLFK UHFRJQL]HV / DQG V\QWKHVL]HV EDVH 51$ SULPHUV ZKLFK DUH WKHQ XVHG E\ '1$ SRO\PHUDVH\ IRU /VWUDQG V\QWKHVLV :RQJ DQG &OD\WRQ Ef %RWK WKH FRQVHUYHG VWHPORRS DQG f +DQNLQJ VHTXHQFHV DUH LPSRUWDQW IRU /VWUDQG LQLWLDWLRQ ZLWK ILYH QXFOHRWLGHV DW WKH EDVH RI WKLV VWHP ORRS WKH VLWH RI 51$ WR '1$ WUDQVLWLRQ +L[VRQ HW DO f

PAGE 22

0LWRFKRQGULDO 7UDQVFULSWLRQ 7KH FRGLQJ FDSDFLW\ RI WKH PLWRFKRQGULDO JHQRPH LV UHODWLYHO\ FRQVWDQW DPRQJ GLIIHUHQW RUJDQLVPV H[FHSW SODQW PW'1$ ZKLFK HQFRGHV PRUH SURWHLQVf KRZHYHU JHQRPH VL]H VWUXFWXUH DQG PRGH RI H[SUHVVLRQ DUH YDULDEOH 9HUWHEUDWH WUDQVFULSWLRQ LV XVXDOO\ DFKLHYHG E\ V\PPHWULFDO DOPRVW JHQRPHOHQJWK SRO\FLVWURQLF WUDQVFULSWLRQ $ORQL DQG $WWDUGL 0XUSK\ HW DO f IURP WZR RYHUODSSLQJ GLYHUJHQW SURPRWHUV LQ WKH 'ORRS UHJLRQ IROORZLQJ E\ SURFHVVLQJ WR JHQHUDWH XQLWOHQJWK P51$V ,Q FRQWUDVW \HDVW JHQRPHV KDYH DW OHDVW GLIIHUHQW SURPRWHUV HDFK GULYLQJ WKH H[SUHVVLRQ RI VKRUWHU SRO\FLVWURQLF 51$V &RVWDQ]R DQG )R[ f ZLWK GLIIHUHQFHV LQ SURPRWHU VWUHQJWK DQG DWWHQXDWLRQ RI WUDQVFULSWLRQ GHWHUPLQLQJ WUDQVFULSW OHYHOV 0XHOOHU DQG *HW] f 0RVW SODQW JHQRPHV DOVR GLVSOD\ PXOWLSOH SURPRWHUV 0XOOLJDQ HW DO /HYLQJV DQG %URZQ f EXW GLIIHUHQWLDO WUDQVFULSWLRQ LV DFKLHYHG E\ VHOHFWLYH DPSOLILFDWLRQ RI VXEJHQRPLF VL]H IUDJPHQWV UHVXOWLQJ LQ LQFUHDVHG P51$ OHYHOV DV D FRQVHTXHQFH RI LQFUHDVH LQ JHQH GRVDJH 0XLVH DQG +DXVZLUWK f 9HUWHEUDWH PLWRFKRQGULD KDYH RQO\ WZR PDMRU SURPRWHUV WKH / VWUDQG SURPRWHU /63f DQG WKH +VWUDQG SURPRWHU +63f IRU WUDQVFULSWLRQ RI HDFK VWUDQG 0RQWR\D HW DO &KDQJ DQG &OD\WRQ

PAGE 23

f 7KH H[LVWHQFH RI D WKLUG SURPRWHU VSHFLILF IRU WUDQVFULSWLRQ RI WKH U51$ JHQHV KDV EHHQ SURSRVHG 0RQWR\D HW DO &KRP\Q DQG $WWDUGL f RQ WKH EDVLV RI 6, QXFOHDVH SURWHFWLRQ VWXGLHV ,Q KXPDQV WKH /63 DQG +63 WKH WZR ELGLUHFWLRQDO SURPRWHUV DUH LQ FORVH SUR[LPLW\ EXW GR QRW RYHUODS 7KHVH SURPRWHUV UHTXLUH WZR GLVWLQFW VHTXHQFH HOHPHQWV IRU DFWLYLW\ &KDQJ DQG &OD\WRQ +L[VRQ DQG &OD\WRQ 7RSSHU DQG &OD\WRQ f RQH VXUURXQGLQJ WKH LQLWLDWLRQ VLWH DQG WKH RWKHU ORFDWHG MXVW XSVWUHDP RI WKH VWDUW VLWH UHTXLUHG IRU DFWLYDWLRQ E\ WKH KXPDQ WUDQVFULSWLRQ IDFWRU KPW7)$ )LVKHU DQG &OD\WRQ f %LGLUHFWLRQDO WUDQVFULSWLRQ LQLWLDWLRQ LV DOVR VHHQ LQ FKLFNHQ /f$EEH HW DO f DQG ;HQRSXV ODHYLV %RJHQKDJHQ DQG
PAGE 24

$QWRVFKHFKNLQ DQG %RJHQKDJHQ f UHYHDOHG KRPRORJ\ WR WKH KLJK PRELOLW\ JURXS +0*f RI SURWHLQV $QRWKHU SURWHLQ FDOOHG PW7)% RU WKH VSHFLILFLW\ IDFWRU LQ \HDVW PLWRFKRQGULD KDV EHHQ LVRODWHG DQG FORQHG 6FKLQNHO HW DO f DQG KDV DPLQR DFLG KRPRORJLHV WR EDFWHULDO D IDFWRUV -DQJ DQG -DHKQLQJ f EXW RSHUDWHV E\ D GLVWLQFW PHFKDQLVP 6KDGHO DQG &OD\WRQ f 5HFHQWO\ $QWRVFKHFKNLQ DQG %RJHQKDJHQ f LVRODWHG D VLPLODU SURWHLQ IURP ;HQRSXV ODHYLV PLWRFKRQGULD WKH [OPW7)% 7KLV LV WKH ILUVW UHSRUW RI WKH H[LVWHQFH RI VXFK D SURWHLQ LQ PHWD]RDQ PLWRFKRQGULD 0LWRFKRQGULDO WUDQVFULSWLRQ IDFWRU $ PW7)$f DSSHDUV WR EH WKH SULPDU\ WUDQVFULSWLRQ IDFWRU LQ KXPDQ PLWRFKRQGULD DEVROXWHO\ UHTXLUHG IURP KLJK OHYHOV RI VSHFLILF WUDQVFULSWLRQ LQLWLDWLRQ LQ YLWUR ,Q FRQWUDVW VFPW7(% DSSHDUV WR EH WKH SULPDU\ WUDQVFULSWLRQ IDFWRU LQ WKH \HDVW V\VWHP ZLWK WKH VFPW7)$ SURWHLQ SOD\LQJ RQO\ D PLQRU UROH LQ RYHUDOO WUDQVFULSWLRQ LQLWLDWLRQ HIILFLHQF\ 6KDGHO DQG &OD\WRQ f ,Q ;HQRSXV ODHYLV [OPW7)% DSSHDUV WR EH WKH EDVDO WUDQVFULSWLRQ IDFWRU ZLWK [OPW7)$ UHTXLUHG IRU WUDQVFULSWLRQDO DFWLYDWLRQ $QWRVFKHFKNLQ DQG %RJHQKDJHQ f +HQFH WKH UROH RI VFPW7)$ LV IXQGDPHQWDOO\ GLIIHUHQW IURP LWV KRPRORJV LQ YHUWHEUDWHV ,Q YLWUR ELQGLQJ VWXGLHV ZLWK SXULILHG PW7)$ IURP \HDVW KXPDQ DQG ;HQRSXV PLWRFKRQGULD GLVSOD\

PAGE 25

JHQHUDOL]HG ELQGLQJ RI WKLV SURWHLQ WR DQ\ '1$ EXW SKDVHG RU SHULRGLF ELQGLQJ WR WKH '1$ RI PLWRFKRQGULDO UHJXODWRU\ UHJLRQV 'LIIOH\ DQG 6WLOOPDQ )LVKHU HW DO $QWRVFKHFKNLQ DQG %RJHQKDJHQ f 7KLV OHG WR WKH VXJJHVWLRQ WKDW WKH LQ YLYR UROH RI WKLV SURWHLQ PLJKW EH LQ SDFNDJLQJ RI PW'1$ UHJXODWRU\ HOHPHQWV LQWR D VSHFLILF VWUXFWXUDO FRQIRUPDWLRQ D VXJJHVWLRQ ZKLFK KDV EHHQ FRQILUPHG IRU FRZ *KLYL]]DQL HW DO f KXPDQ *KLYL]]DQL HW DO f DQG ;HQRSXV WKLV VWXG\f PLWRFKRQGULD E\ LQ RUJDQHOOR DQG LQ YLYR IRRWSULQWLQJ 0DGVHQ HW DO $PPLQL HW DO f *HQHUDO SURFHVVLQJ RI WKH SRO\FLVWURQLF WUDQVFULSWV WR JHQHUDWH LQGLYLGXDO P51$V LV QRW IXOO\ XQGHUVWRRG \HW 7KH W51$ JHQHV DUH LQWHUVSHUVHG DPRQJ WKH +VWUDQG DQG /VWUDQG HQFRGHG SURWHLQ JHQHV ZLWK VRPH RI WKHP DEXWWLQJ WKH U51$ RU P51$ VHTXHQFHV 7KLV SHFXOLDU DUUDQJHPHQW OHG WR WKH SURSRVDO RI WKH W51$ SXQFWXDWLRQ PRGHO RI 51$ SURFHVVLQJ LQ PLWRFKRQGULD 2MDOD HW DO f LPSO\LQJ WKH H[LVWHQFH RI D YHU\ SUHFLVH SURFHVVLQJ PDFKLQHU\ ZKLFK UHFRJQL]HV WKH W51$ VHTXHQFHV ZLWK DQ 51$VH 3OLNH DFWLYLW\ DQG WKH SURFHVV LV EHOLHYHG WR RFFXU FRWUDQVFULSWLRQDOO\ 7KH H[LVWHQFH RI DQ 51$VH 3 DFWLYLW\ LQ PLWRFKRQGULD RI +H/D FHOOV KDV EHHQ UHSRUWHG 'RHUVHQ HW DO f DQG D f DQG fW51$

PAGE 26

SURFHVVLQJ DFWLYLW\ KDV EHHQ LGHQWLILHG DQG FKDUDFWHUL]HG LQ UDW OLYHU PLWRFKRQGULD 0DQDP DQG 9DQ 7X\OH f 5HJXODWLRQ RI 0LWRFKRQGULDO *HQH ([SUHVVLRQ 0LWRFKRQGULDO ELRJHQHVLV UHTXLUHV WKH FRRUGLQDWLRQ RI ERWK QXFOHDU DQG PLWRFKRQGULDOHQFRGHG PLWRFKRQGULDO JHQHV +RZ WKLV FRRUGLQDWLRQ LV DFKLHYHG WR PHHW WKH G\QDPLF HQHUJ\ QHHGV RI WKH FHOO LV VWLOO RQH RI WKH FHQWUDO TXHVWLRQV LQ PLWRFKRQGULDO PROHFXODU ELRORJ\ 7KH DJJUHJDWH RI WKH H[SHULPHQWV GRQH LQ WKLV ILHOG VXJJHVWV WKDW WKHUH LV QR RQH DQVZHU 7KH PRGH RI UHJXODWLRQ VHHPV WR EH DV YDULHG DV WKH SOHWKRUD RI UHJXODWRU\ HYHQWV LQYROYHG LQ PLWRFKRQGULDO ELRJHQHVLV 0RUH LV NQRZQ DERXW WKH UHJXODWLRQ RI JHQHV HQFRGHG RQ PW'1$ WKDQ WKRVH RQ QXFOHDU'1$ 0LWRFKRQGULDO JHQH H[SUHVVLRQ LV UHJXODWHG E\ ERWK WUDQVFULSWLRQDO DQG SRVWWUDQVFULSWLRQDO PHFKDQLVPV 7KH OHYHOV RI WKH ULERVRPDO 51$V VHHP WR EH FRQWUROOHG E\ D WUDQVFULSWLRQ WHUPLQDWLRQ PHFKDQLVP LQ YHUWHEUDWH PLWRFKRQGULD DV WKH WZR U51$V KDYH D WR IROG KLJKHU UDWH RI V\QWKHVLV WKDQ P51$V *HOIDQG DQG $WWDUGL f $IWHU LQLWLDWLRQ RI WUDQVFULSWLRQ IURP WKH +63 WUDQVFULSWLRQ LV WHUPLQDWHG GRZQVWUHDP RI WKH ULERVRPDO JHQHV E\ '1$ELQGLQJ SURWHLQ PHGLDWHG WHUPLQDWLRQ DW D WULGHFDPHU VHTXHQFH LQ WKH W51$OHf JHQH &KULVWLDQVRQ DQG &OD\WRQ f 7KH SURWHLQ IDFWRU

PAGE 27

PLWRFKRQGULDO WUDQVFULSWLRQ WHUPLQDWLRQ IDFWRU P7(5)f KDV EHHQ LVRODWHG IURP KXPDQ PLWRFKRQGULD .UXVH HW DO +HVV HW DO f DQG VKRZQ WR FDXVH VHTXHQFHVSHFLILF WHUPLQDWLRQ RI WUDQVFULSWLRQ LQ YLWUR 5HJXODWLRQ RI P51$ OHYHOV KDV EHHQ VKRZQ WR RSHUDWH DW WKH OHYHO RI GLIIHUHQWLDO WUDQVFULSWLRQ LQ VRPH FDVHV ,Q \HDVW WKH UHODWLYH VWUHQJWKV RI WKH PXOWLSOH SURPRWHUV ZKLFK YDU\ RYHU D IROG UDQJH FRXSOHG ZLWK WUDQVFULSWLRQDO DWWHQXDWLRQ 0XHOOHU DQG *HW] f RI WKH SRO\FLVWURQLF XQLWV KDYH EHHQ VKRZQ WR GLFWDWH WUDQVFULSW OHYHOV LQ PLWRFKRQGULDO UXQRQ DVVD\V 7K\URLG KRUPRQH LV D SK\VLRORJLFDO HIIHFWRU RI PDPPDOLDQ PLWRFKRQGULDO ELRV\QWKHVLV LQIOXHQFLQJ UHVSLUDWLRQ F\WRFKURPH FRQWHQW SURWHLQ V\QWKHVLV DQG LQFUHDVLQJ PLWRFKRQGULDO 51$ OHYHOV .DGHQEDFK HW DO f 0XWYHL HW DO f VKRZHG E\ UXQRQ WUDQVFULSWLRQ DVVD\V WKDW WKH LQFUHDVHG PLWRFKRQGULDO WUDQVFULSW OHYHOV LQ UDW OLYHU GXULQJ WK\URLG KRUPRQH WUHDWPHQW ZHUH GXH WR LQFUHDVHG PLWRFKRQGULDO WUDQVFULSWLRQ 0DQ\ FHQWUDO UHJXODWRU\ HYHQWV RI KRUPRQH DFWLRQ DUH EHLQJ LQFUHDVLQJO\ WUDFHG WR WKHLU HIIHFWV RQ PLWRFKRQGULDO JHQH H[SUHVVLRQ E\ LQFUHDVLQJ PLWRFKRQGULDO WUDQVFULSW OHYHOV $QGURJHQ WUHDWPHQW RI PLFH &RUQZDOO HW DO f DQG FRUWLFRWURSLQ WUHDWPHQW RI ERYLQH FXOWXUHG FHOOV 5DLNKLQVWHLQ DQG +DQXNRJOX f ERWK FDXVH WKH LQGXFWLRQ RI PLWRFKRQGULDO 51$V DV VKRZQ E\ VXEWUDFWLYH K\EULGL]DWLRQ VFUHHQV DOWKRXJK WKH H[DFW PHFKDQLVP RI UHJXODWLRQ

PAGE 28

ZKHWKHU WUDQVFULSWLRQDO RU SRVWWUDQVFULSWLRQDOO\ UHJXODWHG 51$ VWDELOLW\ LV QRW NQRZQ ,Q D GLIIHUHQWLDO VFUHHQ WR LVRODWH F'1$V IRU P51$V ZKRVH OHYHOV DUH VXSSUHVVHG E\ LQWHUIHURQ WUHDWPHQW PDQ\ PLWRFKRQGULDO P51$V ZHUH SLFNHG XS /RX HW DO f 7KHVH UHVXOWV ZHUH FRQILUPHG E\ 1RUWKHUQ EORW DQDO\VHV DQG ZHUH IRXQG WR EH DW WKH OHYHO RI WUDQVFULSWLRQ UDWKHU WKDQ VWDELOLW\ RI WKHVH 51$V DQG ZDV GHSHQGHQW RQ SURWHLQ V\QWKHVLV 6LPLODU VFUHHQV KDYH WUDFHG LQFUHDVHG H[SUHVVLRQ RI PLWRFKRQGULDOHQFRGHG JHQHV LQ VNHOHWDO PXVFOH RI KXPDQV ZLWK GLDEHWHV PHOOLWXV $QWRQHWWL HW DO f GHVSLWH GHFUHDVHV LQ PW'1$ FRS\ QXPEHU VXJJHVWLQJ WKDW WKH LQFUHDVHG PLWRFKRQGULDO JHQH H[SUHVVLRQ PD\ FRQWULEXWH WR WKH LQFUHDVH LQ PLWRFKRQGULDO UHVSLUDWLRQ REVHUYHG LQ XQFRQWUROOHG GLDEHWHV &RQWURO DW WKH OHYHO RI 51$ VWDELOLW\ LV FOHDUO\ VHHQ IRU WKH W51$V .LQJ DQG $WWDUGL f 7KH W51$ JHQHV EHORQJ WR WKUHH GLVWLQFW WUDQVFULSWLRQ XQLWV ZKLFK H[KLELW ZLGHO\ GLIIHUHQW UDWHV RI WUDQVFULSWLRQ 7KXV LQ +H/D FHOOV WKH U'1$ WUDQVFULSWLRQ XQLW LV WUDQVFULEHG a WLPHV PRUH IUHTXHQWO\ WKDQ WKH P51$ JHQHV GRZQVWUHDP RI WKH P7(5) HOHPHQW ZKLOH WKH /VWUDQG WUDQVFULSWLRQ XQLW LV WUDQVFULEHG WLPHV PRUH IUHTXHQWO\ WKDQ WKH +VWUDQG WUDQVFULSWLRQ XQLW &KRP\Q DQG $WWDUGL .LQJ DQG $WWDUGL f 'HVSLWH WKHVH ZLGH GLIIHUHQFHV LQ WUDQVFULSWLRQ UDWHV RI WKH

PAGE 29

W51$ JHQHV WKH VWHDG\ VWDWH OHYHOV RI WKH YDULRXV W51$V DUH PRUH RU OHVV VLPLODU 3XOVH ODEHOLQJ H[SHULPHQWV KDYH LQGLFDWHG WKDW WKLV XQLIRUPLW\ PD\ QRW EH GXH WR GLIIHUHQFHV LQ WKH PHWDEROLF VWDELOLW\ RI WKH PDWXUH W51$V KDOIOLYHV ORQJHU WKDQ Kf EXW PD\ EH GXH WR HOLPLQDWLRQ RI H[FHVV W51$ WUDQVFULSWV EHIRUH WKH\ HQWHU WKH PDWXUH SRRO &KRP\Q DQG $WWDUGL .LQJ DQG $WWDUGL f 5HJXODWLRQ RI JHQH H[SUHVVLRQ FDQ DOVR EH SUHWUDQVFULSWLRQDO DW WKH OHYHO RI JHQH GRVDJH 7KH QXPEHU RI PW'1$ JHQRPHV SHU FHOO LV YDULDEOH DQG KDV EHHQ HVWLPDWHG DV LQ PRXVH /FHOO ILEUREODVWV DQG LQ FXOWXUHG KXPDQ FHOOV %RJHQKDJHQ DQG &OD\WRQ 5RELQ DQG :RQJ f ,Q VRPH FDVHV PW'1$ LV DPSOLILHG WR H[WUDRUGLQDULO\ KLJK QXPEHUV DV LQ ;HQRSXV ODHYLV RRF\WHV a SHU RRF\WHf GXH WR WKH ODUJH QXPEHU f RI RUJDQHOOHV SHU FHOO &KDVH DQG 'DZLG :HEE DQG 6PLWK f +LJKO\ R[LGDWLYH WLVVXHV VXFK DV KHDUW PXVFOH FRQWDLQ D VLJQLILFDQWO\ JUHDWHU QXPEHU RI PW'1$ JHQRPHV WKDQ GR WKH PRUH JO\FRO\WLF W\SH ,, VNHOHWDO PXVFOHV $QQH[ DQG :LOOLDPV f 7KHUHIRUH PW'1$ LV QRW MXVW D VWDWLF UHSRVLWRU\ RI JHQHWLF LQIRUPDWLRQ EXW LV XQGHU G\QDPLF FRQWURO $ FRUUHODWLRQ EHWZHHQ JHQH H[SUHVVLRQ DQG PW'1$ FRS\ QXPEHU KDV EHHQ UHSRUWHG LQ D IHZ FDVHV :LOOLDPV HW DO f VWXGLHG WKH UHJXODWLRQ RI PLWRFKRQGULDO JHQH H[SUHVVLRQ GXULQJ ORQJWHUP HOHFWULFDO VWLPXODWLRQ RI UDEELW VNHOHWDO PXVFOH DQG IRXQG WKH KLJKHU

PAGE 30

R[LGDWLYH FDSDFLW\ LQGXFHG E\ WKLV SURWRFRO WR DOVR HOHYDWH &\W E P51$ U51$ DQG PW'1$ OHYHOV VXJJHVWLQJ WKDW WKH UHJXODWLRQ ZDV DW WKH OHYHO RI PW'1$ FRS\ QXPEHU :LOOLDPV f $PSOLILFDWLRQ RI VXEJHQRPLF IUDJPHQWV DV D PHFKDQLVP IRU FRQWURO RI PLWRFKRQGULDO WUDQVFULSW OHYHOV KDV EHHQ UHSRUWHG IRU PDL]H 0XLVH DQG +DXVZLUWK f )RFXV 2I 'LVVHUWDWLRQ 7KH HPEU\RJHQHVLV RI YHUWHEUDWH VSHFLHV OLNH ;HQRSXV ODHYLV DQG PRXVH SURYLGH LQYDOXDEOH QDWXUDO PRGHO V\VWHPV IRU XQGHUVWDQGLQJ VRPH RI WKH LQWULFDFLHV RI PLWRFKRQGULDO JHQH UHJXODWLRQ 7KH\ LOOXVWUDWH WKH H[LVWHQFH RI JHQHUDO FRQWURO PHFKDQLVPV IRU PW'1$ UHSOLFDWLRQ DQG WUDQVFULSWLRQ WKDW DUH QRW HYLGHQW IURP H[SHULPHQWV ZLWK XQGLIIHUHQWLDWHG FHOOV JURZLQJ LQ FXOWXUH $WWDUGL DQG 6FKDW] f ,Q ERWK VSHFLHV PW'1$ UHSOLFDWLRQ RFFXUV GXULQJ RRJHQHVLV DQG VWRSV DW PDWXUDWLRQ ZKHUHDV WUDQVFULSWLRQ RI PW'1$ LV DFWLYDWHG VRPH WLPH DIWHU IHUWLOL]DWLRQ ORQJ EHIRUH WKH UHVXPSWLRQ RI PW'1$ V\QWKHVLV ,Q WKH PRXVH WKH PLWRFKRQGULDO JHQRPH LV LQDFWLYH LQ WKH HJJ DQG WKH FHOO HPEU\R DIWHU ZKLFK D KLJK UDWH RI PLWRFKRQGULDO WUDQVFULSWLRQ ZDV GHWHFWHG 3LNR DQG 7D\ORU f 7KH UHODWLYH SHULRG RI EDVDO WUDQVFULSWLRQ LQ WKH ; ODHYLV V\VWHP LV ORQJHU DOORZLQJ PRUH H[SHULPHQWDO PDOOHDELOLW\ 7KH RWKHU DGYDQWDJHV RI

PAGE 31

FKRRVLQJ ;HQRSXV HPEU\RV DV D PRGHO V\VWHP IRU WKLV VWXG\ DUH PDQLIROG WKLV YHUWHEUDWH HPEU\R LV DFFHVVLEOH LQ DGHTXDWH QXPEHUV WKURXJKRXW WKH \HDU LWV ELRORJ\ KDV EHHQ ZHOO VWXGLHG HIILFLHQW V\QFKURQRXV IHUWLOL]DWLRQ FDQ EH DFKLHYHG LQ WKH ODERUDWRU\ H[ YLYR D FRQVLGHUDEOH DPRXQW RI PROHFXODU VWXGLHV RQ PLWRFKRQGULD DQG PW'1$ PHWDEROLVP KDYH EHHQ GRQH DQG WKH SDUWLFXODU IHDWXUHV RI PLWRFKRQGULDO ELRJHQHVLV DQG QXFOHLF DFLG PHWDEROLVP GXULQJ HDUO\ GHYHORSPHQW PDNH LW H[WUHPHO\ DPHQDEOH IRU IXOILOOLQJ WKH DLPV RI WKLV VWXG\ 7KH GLVDGYDQWDJH RI WKLV V\VWHP LV WKH QRQDYDLODELOLW\ RI ;HQRSXV ODHYLV LQEUHG OLQHV PDNLQJ LW HVVHQWLDO WR XWLOL]H HJJV DQG HPEU\RV IURP D VLQJOH IHPDOH IURJ ZLWKLQ RQH H[SHULPHQW WR DYRLG VHTXHQFH KHWHURJHQHLW\ 2RJHQHVLV LQ ;HQRSXV ODHYLV LV JHQHUDOO\ FKDUDFWHUL]HG E\ WKH V\QWKHVLV DQG VWRUDJH RI PDFURPROHFXOHV OLNH \RON SURWHLQ :DKOL HW DO f KLVWRQHV :RRGODQG f '1$ SRO\PHUDVHV =LHUOHU HW DO f DQG RUJDQHOOHV OLNH ULERVRPHV %R]]RQL HW DO 3LHUDQGUHL$PDOGL HW DO f DQG PLWRFKRQGULD 'DZLG &KDVH DQG 'DZLG f WR HQDEOH UDSLG GLYLVLRQV GXULQJ HDUO\ FOHDYDJH RI WKH HPEU\R ZLWKRXW IUHVK ELRJHQHVLV RI WKHVH FRPSRQHQWV 7KH VWRFNSLOLQJ RI PLWRFKRQGULD a RUJDQHOOHV SHU PDWXUH RRF\WHf DOVR QHFHVVLWDWHV WKH GUDPDWLF DPSOLILFDWLRQ RI PW'1$ :HEE DQG 6PLWK f ZKLFK DFFRXQWV IRU b RI WKH WRWDO RRF\WH

PAGE 32

'1$ 7KHVH PLWRFKRQGULD DUH SDUWLWLRQHG LQWR FOHDYLQJ FHOOV GXULQJ HDUO\ HPEU\RJHQHVLV ZLWK SURGXFWLRQ RI QHZ PLWRFKRQGULD RFFXUULQJ RQO\ DIWHU WZR GD\V RI IHUWLOL]DWLRQ &KDVH DQG 'DZLG f 7KHUHIRUH DFWLYH PW'1$ UHSOLFDWLRQ GRHV QRW RFFXU LQ WKH IXOO\ GHYHORSHG RRF\WH DQG LQ WKH GHYHORSLQJ HPEU\RV XQWLO UHODWLYHO\ ODWH LQ GHYHORSPHQW &KDVH DQG 'DZLG :HEE DQG 6PLWK f +RZHYHU HDUO\ VWXGLHV VXJJHVW WKDW WUDQVFULSWLRQ RI PW'1$ LV DFWLYDWHG VRRQ DIWHU IHUWLOL]DWLRQ ORQJ EHIRUH DFWLYH V\QWKHVLV RI PW'1$ VWDUWV VXJJHVWLQJ D GHFRXSOLQJ RI PLWRFKRQGULDO WUDQVFULSWLRQ DQG UHSOLFDWLRQ &KDVH DQG 'DZLG
PAGE 33

PW'1$ UHSOLFDWLRQ HPSKDVL]LQJ WKH YDOXH RI WKLV QDWXUDO PRGHO IRU VWXG\LQJ WKH GHYHORSPHQWDO UHJXODWLRQ RI PLWRFKRQGULDO JHQH H[SUHVVLRQ ,QVLJKWV JDLQHG LQ WKLV V\VWHP VKRXOG EH PRUH RU OHVV JHQHUDOO\ DSSOLFDEOH WR PDPPDOLDQ PLWRFKRQGULD DV WKH VL]H VWUXFWXUH DQG RUJDQL]DWLRQ RI ;HQRSXV PW'1$ DUH H[WUHPHO\ VLPLODU WR WKDW PDPPDOV HVSHFLDOO\ KXPDQ 5RH HW DL 'XQRQ%OXWHDX HW DL &DLUQV DQG %RJHQKDJHQ f $GGLWLRQDO VLPLODULWLHV FDQ EH QRWHG LQ WKH VLPLODULW\ RI RUJDQL]DWLRQ RI WKH WUDQVFULSWLRQDO SURPRWHUV DQG PRGH RI WUDQVFULSWLRQ IURP WKH /63 DQG +63 %RJHQKDJHQ DQG
PAGE 34

UHHVWDEOLVKHG 7KHQ WKH PROHFXODU PHFKDQLVPV UHVSRQVLEOH IRU WKHVH UDSLG FKDQJHV LQ PLWRFKRQGULDO WUDQVFULSW OHYHOV ZHUH LQYHVWLJDWHG E\ WZR PDLQ DSSURDFKHV PLWRFKRQGULDO UXQRQ WUDQVFULSWLRQ DQG LQ YLYR IRRWSULQWLQJ RI PW'1$ GXULQJ HDUO\ GHYHORSPHQW RI ; ODHYLV 7KH PLWRFKRQGULDO UXQRQ WUDQVFULSWLRQ DVVD\ ZDV GHYHORSHG EDVHG RQ PRGLILFDWLRQV RI WKH SURWRFRO RI *DLQHV HW DO f WR PHDVXUH WKH WUDQVFULSWLRQ UDWHV RI PLWRFKRQGULD LVRODWHG IURP XQIHUWLOL]HG HJJV DQG GLVWLQFW HPEU\RQLF VWDJHV ZLWK EDVDO DQG HQKDQFHG VWHDG\ VWDWH OHYHOVf 7KHVH DVVD\V ZHUH DLPHG DW GHWHUPLQLQJ ZKHWKHU WKH SULPDU\ GHWHUPLQDQW RI WKH GLIIHUHQWLDO WUDQVFULSW OHYHOV ZDV DW D WUDQVFULSWLRQDO RU SRVWWUDQVFULSWLRQDO OHYHO ,W LV NQRZQ WKDW FKDQJHV LQ PW'1$ DUH QRW WKH PDLQ UHJXODWRU\ HYHQW DV WKH OHYHOV RI PW'1$ GR QRW FKDQJH GXULQJ WKH ILUVW WZR GD\V RI GHYHORSPHQW &KDVH DQG 'DZLG f 7KH VHFRQG DSSURDFK ZDV WR FRQGXFW DQ H[WHQVLYH LQ YLYR '06 GLPHWK\O VXOIDWHf IRRWSULQW DQDO\VLV RI WKH NQRZQ UHJXODWRU\ HOHPHQWV RI WUDQVFULSWLRQ GXULQJ WKH GHYHORSPHQWDO VWDJHV RI EDVDO DQG DFWLYDWHG PLWRFKRQGULDO WUDQVFULSWLRQ VR WKDW FKDQJHV LQ SURWHLQ '1$ LQWHUDFWLRQV FRXOG EH FRUUHODWHG ZLWK WUDQVFULSWLRQDO UHJXODWLRQ ,Q RUGHU WR SHUIRUP WKLV FRPSDUDWLYH DQDO\VLV LW ZDV LQLWLDOO\ HVVHQWLDO WR HVWDEOLVK D EDVHOLQH LQ YLYR IRRWSULQW SDWWHUQ IRU ;HQRSXV PW'1$ DV QR SUHYLRXV VWXGLHV DUH DYDLODEOH IRU FRPSDULVRQ 7KLV

PAGE 35

ZDV GRQH E\ SHUIRUPLQJ LQ RUJDQHOOR '06 IRRWSULQWLQJ RI RYDU\ PW'1$ $Q LQ YLYR '06 IRRWSULQWLQJ SURWRFRO EDVHG RQ '06 WUHDWPHQW RI LQWDFW HJJV DQG GHYHORSLQJ HPEU\RV ZDV WKHQ GHYHORSHG $PPLQL HW DO f EDVHG RQ PRGLILFDWLRQV RI WKH VRPDWLF WLVVXH LQ RUJDQHOOR SURWRFROV RI *KLYL]]DQL HW DO f 7KH UHJLRQV IRRWSULQWHG ZHUH WKH SURPRWHU UHJLRQ WKH UHJLRQ EHWZHHQ WKH SURPRWHUV DQG RULJLQ RI +VWUDQG UHSOLFDWLRQ DQG WKH P7(5) HOHPHQW ,Q DGGLWLRQ EDQG VKLIW DVVD\V ZHUH GHVLJQHG WR ORRN IRU WKH SUHVHQFH RI WKH P7(5) SURWHLQ LQ ;HQRSXV PLWRFKRQGULD DV LWV SUHVHQFH LQ ; ODHYLV PLWRFKRQGULD LV VXVSHFWHG EXW QRW FRQILUPHG 7KH UHVXOWV RI WKHVH YDULRXV H[SHULPHQWV DORQJ ZLWK P\ LQWHUSUHWDWLRQ RI WKH UHVXOWV DQG SUHGLFWLRQV DERXW SRVVLEOH PHFKDQLVPV IRU WKH GHYHORSPHQWDO UHJXODWLRQ RI PLWRFKRQGULDO JHQH H[SUHVVLRQ DUH SUHVHQWHG LQ WKH IROORZLQJ FKDSWHUV

PAGE 36

&+$37(5 0$7(5,$/6 $1' 0(7+2'6 )URJV 6H[XDOO\ PDWXUH PDOH DQG IHPDOH ;HQRSXV ODHYLV IURJV ZHUH SXUFKDVHG IURP ;HQRSXV $QQ $UERU 0LFKLJDQ DQG PDLQWDLQHG LQ VHSDUDWH WDQNV XVLQJ VWDQGDUG SURFHGXUHV :X DQG *HUKDUW f '1$ 3ULPHUV 3ULPHUV ZHUH V\QWKHVL]HG E\ WKH '1$ V\QWKHVLV FRUH ,&%5 8QLYHUVLW\ RI )ORULGD DQG JHO SXULILHG ZKHUH QHFHVVDU\ XVLQJ VWDQGDUG SURFHGXUHV 0DQLDWLV HW DO f /DERUDWRU\ )HUWLOL]DWLRQ RI (JJV )HUWLOL]HG HPEU\RV ZHUH REWDLQHG XVLQJ WKH LQ YLWUR IHUWLOL]DWLRQ SURFHGXUH RI +ROOLQJHU DQG &RUWRQ f 7KH IHPDOH IURJV ZHUH LQMHFWHG ZLWK 8 +&* 6LJPD &* UHFRQVWLWXWHG LQ ZDWHU DW 8PO DQG VWRUHG DW r& IRU ZHHNVf LQWR WKH SHULWRQHDO FDYLW\ KUV EHIRUH HJJV ZHUH UHTXLUHG DQG SODFHG LQWR ZKLWH EXFNHWV ZLWK DERXW OLWHUV RI O[ 25 O2[ 25 LV P0 1D&O

PAGE 37

P0 .& P0 &D&O P0 0J&O P0 1D+3 P0 +(3(6 S+ WR ZLWK 1D2+ 7KH GLYDOHQW DQG PRQRYDOHQW LRQV ZHUH PDGH XS DV VHSDUDWH VWRFNV DQG GLOXWHG MXVW EHIRUH XVHf $IWHU VSRQWDQHRXV HJJ OD\LQJ EHJLQV XVXDOO\ KUV ODWHUf HJJV ZHUH JHQWO\ VTXHH]HG IURP WKH IHPDOH RQWR [O PP SHWULGLVKHV FRQWDLQLQJ PO RI [ 25 LQ EDWFKHV RI HJJV ,W ZDV IRXQG WKDW HJJV VWRUHG LQ O[ 25 FRXOG EH VXFFHVVIXOO\ IHUWLOL]HG ZLWKLQ KUV RI OD\LQJ 7KHUHIRUH IHUWLOL]DWLRQ FRXOG EH GRQH LQ D VWDJJHUHG IDVKLRQ LQ EDWFKHV RI RYHU WKH FRXUVH RI KUV GXULQJ ZKLFK WLPH WKH IURJ ZDV DOORZHG WR OD\ LWV HJJV DW LWV RZQ SDFH LQ IUHVK O[ 25 EXIIHU ,Q WKLV ZD\ D KLJK \LHOG RI IHUWLOL]HG HPEU\RV FRXOG EH REWDLQHG HPEU\RV FRPSDUHG WR RQO\ ZLWK WKH TXLFN VTXHH]H SURWRFROf 6SHUP ZDV REWDLQHG E\ GLVVHFWLQJ WKH WHVWHV IURP D PDOH IURJ DQHVWKHWL]HG RQ LFHf DQG JHQWO\ PDFHUDWLQJ LW LQ ; 25 WR UHOHDVH WKH VSHUP 6SHUP PRWLOLW\ ZDV REVHUYHG XQGHU D OLJKW PLFURVFRSH DIWHU GLOXWLQJ WKH VDOLQH WR ; 25 7KH HJJV ZHUH WKHQ GUDLQHG FRPSOHWHO\ RI H[FHVV ,; 25 GURSV RI WKH VSHUP VXVSHQVLRQ DGGHG WR HDFK GLVK RI HJJV DQG PO RI ,; )O ZDV TXLFNO\ DGGHG WR GLOXWH WKH VSHUP VXVSHQVLRQ O2[ )O LV P0 1D&O P0 .& P0 &D&O P0 0J&O P0 1D+3

PAGE 38

P0 +(3(6 S+ WR ZLWK 1D2+ 7KH GLYDOHQW DQG PRQRYDOHQW LRQV ZHUH PDGH XS DV VHSDUDWH VWRFNV DQG GLOXWHG MXVW EHIRUH XVHf $IWHU UHSODFLQJ WKH OLG WKH SHWULGLVKHV ZHUH JHQWO\ VZLUOHG WR HYHQO\ GLVWULEXWH WKH VSHUP DQG DOVR WR VSUHDG RXW WKH HJJV LQWR D PRQROD\HU DQG WKHQ OHIW XQGLVWXUEHG )HUWLOL]DWLRQ FDQ EH PRQLWRUHG ZLWKLQ PLQXWHV DV IHUWLOL]HG HJJV XQGHUJR WKH FRUWLFDO UHDFWLRQ DQG WKH DQLPDO SROH URWDWHV WR WRS 8QIHUWLOL]HG DQG GDPDJHG HJJV FDQ WKHQ EH FXOOHG 'XULQJ WKH ILUVW KRXUV RI JURZWK WKH O[ )O EXIIHU ZDV UHSODFHG ZLWK [ )O EXIIHU LQ WKH SHWULGLVKHV $IWHUZDUGV WKH ZKROH SHWULGLVK ZDV LPPHUVHG LQ D ODUJH GLVK ILOOHG ZLWK OLWHUV RI [ )O EXIIHU 7KLV VWHS LV YHU\ FULWLFDO IRU REWDLQLQJ JRRG VXUYLYDO RI WKH HPEU\RV 7KH HPEU\RV ZHUH DOORZHG WR KDWFK LQ WKLV YROXPH RI EXIIHU ZLWKRXW IXUWKHU FKDQJHV 'HMHOO\LQJ RI (JJV DQG (PEU\RV (JJV DQG HPEU\RV ZHUH GHMHOOLHG E\ JHQWO\ VZLUOLQJ LQ b &\VWHLQH VROXWLRQ >&\VWHLQH IUHH EDVH PDGH XVLQJ O[ 25 ZLWKLQ KRXU RI XVH DQG WLWUDWHG WR S+ ZLWK 1D2+ PO 0 1D2+ SHU POf@ IRU PLQXWHV IROORZHG E\ UHSHDWHG ZDVKLQJ LQ O[ 25 IRU HJJVf RU [ )O IRU HPEU\RVf WR UHPRYH WUDFHV RI WKH F\VWHLQH VROXWLRQ 7KH GHMHOOLHG HJJV RU HPEU\RV ZHUH WKHQ JHQWO\ SODFHG LQWR D IUHVK SHWULGLVK RI O[ 25 HJJVf RU [ )O HPEU\RVf IRU

PAGE 39

VRUWLQJ DQG FRXQWLQJ XVLQJ D EURDGWLSSHG PO SLSHW 7KH HJJV DQG HDUO\ HPEU\RV DUH HVSHFLDOO\ IUDJLOH DIWHU GHMHOO\LQJ DQG VKRXOG EH KDQGOHG RQO\ XVLQJ EURDGWLSSHG SLSHWV ,VRODWLRQ RI 0LWRFKRQGULD IURP (JJV DQG (PEU\RV 0LWRFKRQGULD ZHUH SXULILHG IURP HJJV DQG HPEU\RV ZLWK PRGLILFDWLRQV RI WKH SURWRFRO XVHG E\ 0F.HH HW DO f IRU WKH LVRODWLRQ RI KHDUW PLWRFKRQGULD 7KLV SURWRFRO ZDV DGRSWHG ERWK GXH LWV HDVH RI DSSOLFDWLRQ DQG WKH UHSODFHPHQW RI ('7$ ZLWK (*7$ ZKLFK LV HVSHFLDOO\ LPSRUWDQW LQ UXQRQ DQG EDQGVKLIW H[SHULPHQWV ZKHUH FKHODWLRQ RI 0J PXVW EH DYRLGHG 'HMHOOLHG HJJV DQG HPEU\RV ZHUH IORDWHG LQ 06( EXIIHU PLV IRU HJJV RU HPEU\RVf DQG KRPRJHQL]HG LQ D JODVV GRXQFH KRPHJHQL]HU ZLWK D W\SH % WHIORQ SHVWOH ZLWK VWURNHV 7KH KRPRJHQDWH ZDV VSXQ DW [ J IRU PLQ LQ D -$ URWRU WKH VXSHUQDWDQW ZDV UHVSXQ DV DERYH DQG WKH VHFRQG VXSHUQDWDQW VSXQ DW [ J IRU PLQ LQ D -$ URWRU WKH SHOOHW ZDV FROOHFWHG UHVXVSHQGHG LQ PO RI 06( DQG VSXQ LQ DQ (SSHQGRUI WXEH DW [ J IRU PLQ 7KLV VWHS ZDV UHSHDWHG WLPHV XQWLO WKH VXSHUQDWDQW FOHDUHG XS WR UHPRYH WUDFHV RI IDW 7KH ILQDO SHOOHW ZDV XVHG DV VXFK LQ WKH H[SHULPHQWV LQYROYLQJ UXQRQ WUDQVFULSWLRQ RU PLWRFKRQGULDO '1$ LVRODWLRQ LQ WKH IRRWSULQWLQJ H[SHULPHQWV ,Q

PAGE 40

H[SHULPHQWV ZKHUH IXUWKHU SXULILFDWLRQ RI PLWRFKRQGULD ZDV QHFHVVDU\ HJ $73 PHDVXUHPHQW VWXGLHVf PLWRFKRQGULD ZHUH SXULILHG LQ D VFDOHGGRZQ VXFURVH JUDGLHQW LQ D 7/6 URWRU 7KLV JUDGLHQW ZDV SUHIRUPHG ZLWK PO HDFK RI b VXFURVH DQG b VXFURVH DQG WKH PLWRFKRQGULDO SHOOHW ZDV UHVXVSHQGHG LQ b VXFURVH DQG OD\HUHG RQ WRS LQ D YROXPH RI PO 7KH JUDGLHQW ZDV VSXQ DW USP LQ D 7/6 URWRU LQ D 7/ FHQWULIXJH %HFNPDQf IRU PLQ 7KH PLWRFKRQGULDO EDQG DW WKH bb VXFURVH LQWHUIDFH ZDV FROOHFWHG GLOXWHG ZLWK DQ HTXDO YROXPH RI 06( EXIIHU DQG UHSHOOHWHG LQ DQ (SSHQGRUI FHQWULIXJH DW [ J IRU PLQ ,VRODWLRQ RI 0LWRFKRQGULD IURP 2YDU\ 7LVVXH ,VRODWLRQ RI PLWRFKRQGULD IURP RYDULHV RI DGXOW IURJV ZDV GRQH DFFRUGLQJ WR WKH SURWRFRO XVHG IRU SXULILFDWLRQ RI ERYLQH EUDLQ PLWRFKRQGULD E\ +HKPDQ DQG +DXVZLUWK f ZLWK WKH PRGLILFDWLRQV GHVFULEHG EHORZ :KROH RYDULHV ZHUH GLVVHFWHG IURP DQHVWKHWL]HG IHPDOH IURJV DQG GURSSHG LQWR FKLOOHG 06%&D EXIIHU DERXW PORYDU\f 7KH WLVVXH ZDV PLQFHG DQG KRPHJHQL]HG LQ D JODVV KRPHJHQL]HU E\ WKUHH VWURNHV RI D PRWRU GULYHQ WHIORQ FRDWHG SHVWOH 7KHQ ('7$ ZDV DGGHG WR D ILQDO FRQFHQWUDWLRQ RI P0 7KLV ZDV WKHQ SDVVHG WKURXJK WKUHH OD\HUV RI FKHHVH FORWK DQG FHQWULIXJHG

PAGE 41

LQ D -$ URWRU DW [ J IRU PLQ WKH VXSHUQDWDQW ZDV FROOHFWHG DQG UHFHQWULIXJHG DV DERYH 7KH VXSHUQDWDQW IURP WKH VHFRQG VSLQ ZDV FHQWULIXJHG LQ D -$ URWRU DW [ J IRU PLQ 7KH SHOOHWV ZHUH JHQWO\ UHVXVSHQGHG LQ PO RI 06%('7$ SHU PO RI GLVFDUGHG VXSHUQDWDQW DQG UHVSXQ DW [ J LQ D -$ URWRU IRU PLQ (DFK SHOOHW ZDV EURXJKW XS LQ PO RI b VXFURVH7( EXIIHU DQG OD\HUHG RQ WRS RI D VXFURVH VWHS JUDGLHQW PLV HDFK RI b DQG b VXFURVH7(f 7KH JUDGLHQWV ZHUH WKHQ VSXQ LQ D %HFNPDQ 6: URWRU DW USP IRU PLQ 7KH PLWRFKRQGULDO EDQG DW WKH bb VXFURVH LQWHUIDFH ZDV FDUHIXOO\ FROOHFWHG ZLWK D 3DVWHXU SLSHW GLOXWHG ZLWK DQ HTXDO YROXPH RI 06%('7$ DQG SHOOHWHG DW [ J LQ D -$ URWRU 7KH SHOOHWV ZHUH WKHQ SURFHVVHG IRU LQ RUJDQHOOR PHWK\ODWLRQ RU TXLFNIUR]HQ LQ D GU\ LFHHWKDQRO EDWK DQG VWRUHG DW r& 'LPHWK\O 6XOIDWH )RRWSULQWLQJ RI 0LWRFKRQGULDO '1$ 2OLJRQXFOHRWLGHV :+ EDVH ROLJRQXFOHRWLGH $&7 &$$ $&& 7&& $&7 $77 *$& &RUUHVSRQGV WR PLWRFKRQGULD@ /VWUDQG VHTXHQFH 5RH HW DO f

PAGE 42

:+ EDVH ROLJRQXFOHRWLGH 7$$ &&$ 7$$ $$7 $7* &7$ $*7 &RUUHVSRQGV WR PLWRFKRQGULDO +VWUDQG VHTXHQFH LQ WKH VHTXHQFH FRUUHFWLRQ E\ 'XQRQ%OXWHDX HW DO f DQG LQFRUSRUDWLQJ WKH FKDQJHV OLVWHG LQ &DLUQV DQG %RJHQKDJHQ f :+ EDVH ROLJRQXFOHRWLGH &&& $7* 77$ 7$& $77 777 *7$ &RUUHVSRQGV WR PLWRFKRQGULDO /VWUDQG VHTXHQFH 5RH HW DO f :+ EDVH ROLJRQXFOHRWLGH &&7 77$ 7*& 777 &** $*& 777 &RUUHVSRQGV WR +VWUDQG VHTXHQFH 'XQRQ%OXWHDX HW DO f :+ EDVH ROLJRQXFOHRWLGH $$7 &7* 77* 7*$ &&7 7$$ &&7 &RUUHVSRQGV WR /VWUDQG VHTXHQFH 'XQRQ%OXWHDX HW DO f :+ EDVH ROLJRQXFOHRWLGH &77 &$7 *77 777 777 777 7&7 &RUUHVSRQGV WR /VWUDQG VHTXHQFH 'XQRQ%OXWHDX HW DO f :+ EDVH ROLJRQXFOHRWLGH *7* *$7 $$7 $$7 $** $$$ *&7 &RUUHVSRQGV WR +VWUDQG VHTXHQFH 'XQRQ%OXWHDX HW DO f :+ EDVH ROLJRQXFOHRWLGH $** *&7 $*& 7$* &*7 **& $*$ &RUUHVSRQGV WR /VWUDQG VHTXHQFH 5RH HW DO f

PAGE 43

:+ EDVH ROLJRQXFOHRWLGH 7** **& &77 7$& **7 *77 *7$ &RUUHVSRQGV WR +VWUDQG 5RH HW DO f 3ODVPLG &ORQHV 7KH WKUHH FORQHV GHVFULEHG EHORZ ZHUH XVHG WR PDNH VWUDQG VSHFLILF ULERSUREHV IRU SURELQJ 6RXWKHUQ EORWV LQ WKH LQ RUJDQHOOR IRRWSULQWLQJ H[SHULPHQWV $OO WKH FORQHV ZHUH FRQVWUXFWHG DV GHVFULEHG EHORZ H[FHSW ZKHUH LQGLFDWHG 7KH '1$ RI WKH FRUUHVSRQGLQJ UHJLRQ ZDV 3&5 DPSOLILHG ZLWK WKH LQGLFDWHG SULPHUV )RU WKLV WKH SULPHUV ZHUH ILUVW nHQG SKRVSKRU\ODWHG ZLWK J3 XVLQJ 7 SRO\QXFOHRWLGH NLQDVH 86 %LRFKHPLFDOVf DFFRUGLQJ WR PDQXIDFWXUHUnV LQVWUXFWLRQV 7KH NLQDVHG SULPHUV ZHUH WKHQ XVHG WR DPSOLI\ WKH PW'1$ IUDJPHQWV ZLWK HLWKHU 7DT '1$ SRO\PHUDVH %5/f RU 3IX '1$ SRO\PHUDVH 6WUDWDJHQHf 7KHQ WKH 3&5 SURGXFWV ZHUH JHO SXULILHG ZKHUH QHFHVVDU\f DQG OLJDWHG ZLWK +LQF,,OLQHDUL]HG S%6 f SKDJHPLG 6WUDWDJHQHf RYHUQLJKW DW URRP WHPSHUDWXUH 7KH OLQHDUL]HG YHFWRU ZDV nHQG GHSKRVSKRU\ODWHG ZLWK 6KULPS $ONDOLQH 3KRVSKDWDVH 86%f GHDFWLYDWHG DW r& IRU PLQ DQG SXULILHG DIWHU RUJDQLF H[WUDFWLRQV 'LIIHUHQW GLOXWLRQV RI WKH OLJDWLRQV ZHUH XVHG WR WUDQVIRUP '+D FHOOV %5/f DFFRUGLQJ WR WKH VXSSOLHUnV SURWRFROV DQG SODWHG RQ /% SODWHV FRQWDLQLQJ DPSLFLOOLQ ,37* DQG ;JDO 0DQLDWLV HW DO f :KLWH FRORQLHV ZHUH VFUHHQHG IRU WKH SUHVHQFH RI WKH

PAGE 44

LQVHUW DV D VLQJOH FRS\ E\ GLJHVWLQJ ZLWK +LQG ,,, DQG %DP+, %5/f ZKLFK IODQN WKH +LQGL VLWH 3RVLWLYH FORQHV ZHUH DPSOLILHG LQ D ODUJH VFDOH FXOWXUH DQG '1$ LVRODWHG DQG SXULILHG E\ HLWKHU &V&O JUDGLHQWV 0DQLDWLV HW DO f RU :L]DUG PD[LSUHS FROXPQV 3URPHJD &RUSRUDWLRQf S%6/63 7KLV SODVPLG ESf FRQWDLQV WKH IURJ PLWRFKRQGULDO VHTXHQFH LQ WKH FRUUHFWHG VHTXHQFH RI 'XQRQ%OXWHDX HW DO f 7KLV VWUHWFK RI '1$ DPSOLILHG ZLWK SULPHUV :+ t :+f LV FORQHG LQ WKH UHYHUVH RULHQWDWLRQ DQG FRQWDLQV DOO WKH SURPRWHU HOHPHQWV LQ WKH 'ORRS UHJLRQ LQFOXGLQJ /63 t DQG +63 t f 6WUDQGVSHFLILF ULERSUREHV PDGH IURP WKLV FORQH ZHUH XVHG WR SUREH LQ RUJDQHOOR IRRWSULQW 6RXWKHUQ EORWV RI WKH SURPRWHU UHJLRQ XVLQJ WKH $YDLO VLWH DW DV UHIHUHQFH S%6&6% 7KLV SODVPLG ESf FRQWDLQV WKH IURJ PLWRFKRQGULDO VHTXHQFH LQ WKH FRUUHFWHG VHTXHQFH RI 'XQRQ%OXWHDX HW DO f 7KLV VWUHWFK RI '1$ DPSOLILHG ZLWK SULPHUV :+ t :+ f LV FORQHG LQ WKH IRUZDUG RULHQWDWLRQ DQG FRQWDLQV WKH WZR ORRS n VWDUW VLWHV DQG WKH FRQVHUYHG VHTXHQFH ER[ &6% f 6WUDQGVSHFLILF ULERSUREHV PDGH IURP WKLV FORQH ZHUH XVHG WR SUREH LQ RUJDQHOOR IRRWSULQW 6RXWKHUQ EORWV RI WKH &6% UHJLRQ XVLQJ WKH +DHOOO VLWH DW DV UHIHUHQFH

PAGE 45

S%6P7(5) 7KLV SODVPLG ESf FRQWDLQV WKH IURJ PLWRFKRQGULDO VHTXHQFH 5RH HW DO f 7KLV VWUHWFK RI '1$ DPSOLILHG ZLWK SULPHUV :+ t :+f LV FORQHG LQ WKH UHYHUVH RULHQWDWLRQ DQG FRQWDLQV WKH WHUPLQDO HQG RI WKH 6 U51$ JHQH WKH HQWLUH W51$nf JHQH FDUU\LQJ WKH P7(5) HOHPHQW DQG WKH LQLWLDO VHTXHQFHV RI WKH 1' JHQH 6WUDQGVSHFLILF ULERSUREHV PDGH IURP WKLV FORQH ZHUH XVHG WR SUREH LQ RUJDQHOOR IRRWSULQW 6RXWKHUQ EORWV RI WKH P7(5) UHJLRQ XVLQJ WKH 6VS, VLWH DW DV UHIHUHQFH 5LERSUREHV 7KH '1$ FORQHV ZHUH OLQHDUL]HG ZLWK +LQGOOO IRU WUDQVFULSWLRQ ZLWK 7 51$ SRO\PHUDVH DQG ZLWK %DP+, IRU WUDQVFULSWLRQ ZLWK 7 51$ SRO\PHUDVH )RU WUDQVFULSWLRQ UHDFWLRQV XJ RI OLQHDUL]HG '1$ ZDV XVHG LQ D VWDQGDUG DQDO\WLFDO VFDOH WUDQVFULSWLRQ UHDFWLRQ LQ WKH VXSSOLHUnV EXIIHU 6WUDWDJHQHf ZLWK X&L RI DS873 &LPPROf 7KH ZKROH WUDQVFULSWLRQ UHDFWLRQ ZDV ORDGHG RQ D b QRQGHQDWXULQJ SRO\DFU\ODPLGH JHO DQG WKH IXOOOHQJWK 51$ SURGXFW EDQG ORFDWHG ZLWK D YHU\ VKRUW H[SRVXUH VHFf RQ ;UD\ ILOP 7KLV EDQG ZDV FXW RXW PDFHUDWHG LQ D PO FHQWULIXJH WXEH DQG DGGHG GLUHFWO\ WR WKH K\EULGL]DWLRQ VROXWLRQ

PAGE 46

,Q 2UJDQHOOD 0HWK\ODWLRQ RI 0LWRFKRQGULDO '1$ $IWHU WKH ILQDO FHQWULIXJDWLRQ VWHS WKH SHOOHWHG PLWRFKRQGULD a POf ZHUH UHVXVSHQGHG LQ DQ HTXDO YROXPH RI SKRVSKDWHEXIIHUHG VDOLQH 3%6 P0 1D&O P0 .& P0 1D+3 P0 .+32 S+ f DQG XO DOLTXRWV ZHUH WUDQVIHUUHG LQWR (SSHQGRUI WXEHV DQG SODFHG DW URRP WHPSHUDWXUH 7KHQ 'LPHWK\O 6XOIDWH '06f ZDV DGGHG LQ FRQFHQWUDWLRQV RI b b DQG b YRUWH[HG EULHIO\ WR PL[ ZHOO DQG LQFXEDWHG DW URRP WHPSHUDWXUH IRU PLQXWHV 7KHQ PO RI LFHFROG 3%6 ZDV DGGHG WR GLOXWH RXW WKH '06 DQG PLWRFKRQGULD SHOOHWHG LPPHGLDWHO\ E\ FHQWULIXJLQJ IRU PLQ DW [ J 3%6 ZDVKHV ZHUH UHSHDWHG WZLFH WR UHPRYH DOO WUDFHV RI '06 7KHQ XO RI PLWRFKRQGULDO O\VLV EXIIHU ZDV DGGHG DQG PW'1$ H[WUDFWHG DV GHVFULEHG EHORZ 7KH PHWK\ODWLRQ UHDFWLRQ RI b IRU PLQXWHV ZDV IRXQG WR JLYH VDWLVIDFWRU\ LQ RUJDQHOOD UHDFWLRQV ZKLFK PDWFKHG WKH UHDFWLRQ RI b IRU PLQXWHV XVLQJ SXULILHG PLWRFKRQGULDO '1$ ,Q 9LYR 0HWK\ODWLRQ RI (JJV DQG (PEU\RV 'HMHOOLHG HJJV RU HPEU\RV ZHUH GUDLQHG RI EXIIHU UHIORDWHG LQ 3%6 FRQWDLQLQJ b '06 DQG JHQWO\ VZLUOHG IRU PLQXWHV 7KH '06 VROXWLRQ ZDV UDSLGO\ HPSWLHG DIWHU PLQXWHV DQG WKH HJJV RU

PAGE 47

HPEU\RV UHSHDWHGO\ ZDVKHG ZLWK EXIIHU WR UHPRYH WUDFHV RI '06 0LWRFKRQGULD DUH WKHQ LVRODWHG E\ GLIIHUHQWLDO FHQWULIXJDWLRQ DV GHVFULEHG DERYH H[FHSW WKDW EDQGLQJ RQ VXFURVH JUDGLHQWV ZDV QRW SHUIRUPHG 7KH PLWRFKRQGULDO SHOOHWV ZHUH TXLFNIUR]HQ DQG VWRUHG DW r& RU PW'1$ ZDV H[WUDFWHG LPPHGLDWHO\ DV GHVFULEHG EHORZ 7\SLFDOO\ RQH PLWRFKRQGULDO SHOOHW IURP D EDWFK RI HJJV RU HPEU\RV \LHOGHG VXIILFLHQW PW'1$ WR SHUIRUP SULPHU H[WHQVLRQ UHDFWLRQV 6LPLODU SDWWHUQV RI PHWK\ODWLRQ LQ FRQWURO '1$ ZHUH DFKLHYHG E\ b '06 WUHDWPHQW IRU VHF 3XULILFDWLRQ RI 0LWRFKRQGULDO '1$ IRU )RRWSULQWLQJ 7KH PLWRFKRQGULDO SHOOHW ZDV UHVXVSHQGHG LQ XO RI O\VLV EXIIHU DQG 6'6 DGGHG WR b 7KH PLWRFKRQGULDO O\VDWH ZDV WKHQ H[WUDFWHG WZLFH HDFK ZLWK SKHQRO SKHQROFKORURIRUPLVR DP\O DOFRKRO f DQG FKORURIRUP DQG WKHQ HWKDQRO SUHFLSLWDWHG ZLWK YROXPHV HWKDQRO )RU LQ RUJDQHOOD IRRWSULQWLQJ XVLQJ 6RXWKHUQ EORWWLQJ WKH PW'1$ VDPSOHV ZHUH GLJHVWHG ZLWK UHVWULFWLRQ HQ]\PHV DQG D b DOLTXRW FKHFNHG RQ D b DJDURVH JHO IRU FRPSOHWH UHDFWLRQ 7KH FRQWURO '1$ VDPSOHV ZHUH ILUVW PHWK\ODWHG DV GHVFULEHG EHORZ DQG WKHQ XVHG IRU UHVWULFWLRQ GLJHVWLRQ LQ RUGHU WR DYRLG DUWLIDFWXDO PHWK\ODWLRQ SDWWHUQV DULVLQJ RQ OLQHDUL]HG '1$ 5HVWULFWLRQ GLJHVWLRQ RI WKH '1$ VDPSOHV ZDV QRW SHUIRUPHG LQ WKH SULPHU H[WHQVLRQ

PAGE 48

SURWRFRO DV WKH VHTXHQFLQJ UHIHUHQFH LV SURYLGHG E\ WKH VLWH RI K\EULGL]DWLRQ RI WKH SULPHU 2Q DQ DYHUDJH DERXW WR XJ PW'1$ LV UHFRYHUHG IURP HJJV DVVXPLQJ a QJ PW'1$HJJ &KDVH DQG 'DZLG :HEE DQG 6PLWK f ,Q 9LWUR 0HWK\ODWLRQ RI 3XULILHG 0LWRFKRQGULDO '1$ 0LWRFKRQGULDO '1$ LVRODWHG IURP FRQWURO PLWRFKRQGULDO SHOOHWV XQWUHDWHG ZLWK '06 HLWKHU LQ RUJDQHOOR RU LQ YLYRf ZDV UHVXVSHQGHG LQ XO RI P0 VRGLXP FDFRG\ODWH S+ f '06 WLWUDWLRQV ZHUH WKHQ GRQH IRU VKRUW UHDFWLRQ WLPHV VHF WR PLQf DV QHFHVVDU\ WR PDWFK WKH UHVSHFWLYH H[WHQW RI LQ RUJDQHOOR RU LQ YLYR UHDFWLRQ 7KHQ XO RI FKLOOHG '06 VWRS EXIIHU 0 VRGLXP DFHWDWH S+ f 0 PHUFDSWRHWKDQROf ZDV DGGHG DQG WKH PW'1$ VDPSOHV HWKDQRO SUHFLSLWDWHG 3LSHULGLQH &OHDYDJH RI 0HWK\ODWHG '1$ 7R FOHDYH WKH PW'1$ DW PHWK\ODWHG UHVLGXHV WKH '1$ SHOOHWV ZHUH UHVXVSHQGHG LQ XO RI b SLSHULGLQH DQG LQFXEDWHG DW r& IRU PLQ 7KHQ WKH '1$ ZDV DJDLQ HWKDQRO SUHFLSLWDWHG LQ WKH SUHVHQFH RI 0 DPPRQLXP DFHWDWH UHVXVSHQGHG LQ XO RI ZDWHU DQG GULHG LQ D VSHHGYDF WR UHPRYH DOO WUDFHV RI SLSHULGLQH

PAGE 49

6DPSOHV ZHUH UHVXVSHQGHG LQ XO RI IRUPDPLGH ORDGLQJ G\H IRU 6RXWKHUQ EORWWLQJf RU 7( IRU SULPHU H[WHQVLRQ UHDFWLRQVf 6RXWKHUQ %ORW 'HWHFWLRQ RI ,Q 2UJDQHOOD )RRWSULQWV $V D SUHOLPLQDU\ H[SHULPHQW WR RSWLPL]H ORDGLQJ LQWHQVLWLHV HTXDO DPRXQWV RI WHVW DQG FRQWURO PW'1$ VDPSOHV IURP DERYH WK WR WK RI HDFK VDPSOHf ZHUH ORDGHG LQWR DGMDFHQW ODQHV RI D b SRO\DFU\ODPLGH 0 XUHD VHTXHQFLQJ JHO DQG HOHFWURSKRUHVHG XQGHU VWDQGDUG VHTXHQFLQJ JHO FRQGLWLRQV %DVHG RQ WKH K\EULGL]DWLRQ VLJQDOV RQ WKH 6RXWKHUQ EORWV RI WKHVH JHOV ORDGLQJ YROXPHV IRU HDFK VWDJH ZHUH GHFLGHG E\ D FRPELQDWLRQ RI YLVXDO DVVHVVPHQW DQG 3KRVSKRULPDJHU 0ROHFXODU '\QDPLFVf TXDQWLWDWLRQ '1$ WUDQVIHU WR PHPEUDQH ZDV E\ YDFXXP EORWWLQJ XVLQJ WKH PHWKRG RI /RSH] HW DO f %ULHIO\ IROORZLQJ HOHFWURSKRUHVLV D SUHFXW SLHFH RI Q\ORQ WUDQVIHU PHPEUDQH +\ERQG1 IURP $PHUVKDP &KLFDJR ,/f ZDV SODFHG GLUHFWO\ RQ WKH JHO VXUIDFH DQG DOORZHG WR GUDZ WKH EXIIHU IRU PLQ 7KH VDQGZLFK ZDV WKHQ SODFHG LQ D VWDQGDUG JHOGU\LQJ DSSDUDWXV PHPEUDQH VLGH GRZQ RQ D VLQJOH VKHHW RI :KDWPDQ PP SDSHU :KDWPDQ 3DSHU /WG &OLIWRQ 1-f FRYHUHG ZLWK SODVWLF ZUDS DQG WKH '1$ WUDQVIHUUHG WR WKH PHPEUDQH E\ DSSO\LQJ YDFXXP ZLWKRXW KHDWf IRU PLQ WR KRXU $IWHU WUDQVIHU '1$ ZDV FURVVOLQNHG WR WKH PHPEUDQH RQ D WUDQVLOOXPLQDWRU

PAGE 50

DW IXOO SRZHU IRU PLQXWHV 3UHK\EULGL]DWLRQ DQG K\EULGL]DWLRQ ZHUH GRQH XVLQJ WKH SURWRFRO RI &KXUFK DQG *LOEHUW f 7R SUHK\EULGL]H WKH PHPEUDQH PO RI K\EULGL]DWLRQ VROXWLRQ b 6'6 b %6$ ,P0 ('7$ DQG 0 VRGLXP SKRVSKDWH EXIIHU 0 ZLWK UHVSHFW WR 1D S+ f ZDV DGGHG WR WKH UROOHGXS PHPEUDQH LQ D UROOLQJ K\EULGL]DWLRQ ERWWOH 5REELQV 6FLHQWLILFf DQG SODFHG LQ D K\EULGL]DWLRQ RYHQ %LRPHWUD 7DPSD )/f IRU PLQ DW r& $IWHU SUHK\EULGL]DWLRQ WKH VROXWLRQ ZDV UHSODFHG ZLWK PO RI K\EULGL]DWLRQ VROXWLRQ FRQWDLQLQJ WKH FUXVKHG SRO\DFU\ODPLGH JHO VOLFH FRQWDLQLQJ WKH ODEHOHG SUREH DQG K\EULGL]HG RYHUQLJKW DW r& 7KH K\EULGL]HG EORWV ZHUH ZDVKHG WKUHH WLPHV ZLWK PO RI ZDVK EXIIHU P0 VRGLXP SKRVSKDWH EXIIHU S+ ,P0 ('7$ b 6'6f DW r& IRU PLQ HDFK LQ WKH K\EULGL]DWLRQ ERWWOHV IROORZHG E\ D PLQ ZDVK LQ PO RI EXIIHU LQ D 7XSSHUZDUH WUD\ DQG H[SRVHG WR ;UD\ ILOP /LQHDU $PSOLILFDWLRQ RI )RRWSULQWV E\ 3ULPHU ([WHQVLRQ 7KH PRVW LPSRUWDQW IDFWRU IRU REWDLQLQJ DFFXUDWH DQG UHSURGXFLEOH VHTXHQFHV LV RSWLPDO VHOHFWLRQ RI JHQRPLF SULPHUV ,Q WKHRU\ D SULPHU FDQ EH DV FORVH DV QXFOHRWLGHV WR WKH GRPDLQ RI LQWHUHVW +RZHYHU LQ SUDFWLFH KDYH IRXQG WKDW SULPHUV ORFDWHG

PAGE 51

DERXW QXFOHRWLGHV DZD\ IURP WKH UHJLRQ WR EH DQDO\]HG ZRUN EHVW LQ SURYLGLQJ UHSURGXFLEOH JHQRPLF ODGGHUV ZKLFK DUH HVVHQWLDOO\ IUHH RI ORZ PROHFXODU ZHLJKW EDFNJURXQG ,Q JHQHUDO SULPHUV ZKLFK IDOO ZLWKLQ ES RI WKH WDUJHW UHJLRQ ZHUH XVHG VXFFHVVIXOO\ 6RPH RI WKH SULPHUV XVHG LQ WKH SULPHU H[WHQVLRQ IRRWSULQWLQJ H[SHULPHQWV KDYH EHHQ GHVFULEHG DERYH IRU WKH FUHDWLRQ RI WKH WKUHH SODVPLG FORQHV XVHG IRU SURGXFWLRQ RI ULERSUREHV $GGLWLRQDO SULPHUV ZKLFK ZHUH XVHG LQ WKH SULPHU H[WHQVLRQ IRRWSULQWLQJ H[SHULPHQWV DUH GHVFULEHG EHORZ :+ EDVH ROLJRQXFOHRWLGH **7 &$* 777 &7$ 7&7 $7* $$* &RUUHVSRQGV WR WKH /VWUDQG VHTXHQFH 5RH HW DO f :+ EDVH ROLJRQXFOHRWLGH 77& 7$7 $&$ $** &7$ $&$ *7& &RUUHVSRQGV WR WKH +VWUDQG VHTXHQFH 'XQRQ %OXWHDX HW DO f :+ EDVH ROLJRQXFOHRWLGH &*& 7$$ $&& &&& &7$ &&& &&& &RUUHVSRQGV WR WKH /VWUDQG VHTXHQFH 'XQRQ%OXWHDX HW DO f (QG ODEHOLQJ RI ROLJRQXFOHRWLGH SULPHUV *HO SXULILHG SULPHUV ZHUH n HQGODEHOHG WR D KLJK VSHFLILF DFWLYLW\ ZLWK J3 $73 ,&1 &LPLOOLPROHf DQG D 7 3RO\QXFOHRWLGH .LQDVH NLW 86% &RUSRUDWLRQ$PHUVKDP /LIH 6FLHQFHf LQ D VWDQGDUG XO UHDFWLRQ

PAGE 52

)UHH ODEHO ZDV UHPRYHG E\ WZR VHTXHQWLDO HWKDQRO SUHFLSLWDWLRQV LQ WKH SUHVHQFH RI 0 DPPRQLXP DFHWDWH 2SWLPL]DWLRQ RI 3ULPHU H[WHQVLRQ UHDFWLRQ FRQGLWLRQV 3UHOLPLQDU\ H[SHULPHQWV LQGLFDWHG WKDW DERXW RQH WHQWK RI WKH SLSHULGLQH FOHDYHG '1$ VDPSOH DERXW QJf ZDV VXIILFLHQW IRU REWDLQLQJ D XVHDEOH SULPHU H[WHQVLRQ VLJQDO ,QFUHDVLQJ SULPHU FRQFHQWUDWLRQ EH\RQG SLFRPROH SHU UHDFWLRQ GLG QRW IXUWKHU HQKDQFH VLJQDO LQWHQVLW\ DQG OHG WR KLJKHU EDFNJURXQG 7KH UHVXOWV RI DQ H[SHULPHQW GHVLJQHG WR GHWHUPLQH WKH QXPEHU RI OLQHDU DPSOLILFDWLRQ F\FOHV QHFHVVDU\ WR REWDLQ UHSURGXFLEOH UHVXOWV DUH VKRZQ LQ )LJXUH $PSOLI\LQJ IRU F\FOHV SURYLGHG DGHTXDWH VLJQDO LQWHQVLW\ ZKHUHDV QRQVSHFLILF EDQGV EHJDQ WR DSSHDU ZLWK D KLJKHU QXPEHU RI F\FOHV FRPSDUH ODQHV DQG ZLWK ODQHV DQG f ,W LV LPSRUWDQW WR QRWH WKDW VRPH RI WKH QRQVSHFLILF EDQGV DSSHDULQJ ZLWK KLJKHU F\FOHV DUH QXFOHRWLGHV ORQJHU WKDQ WKH DXWKHQWLF EDQGV VXJJHVWLQJ WKDW WKH 7DT '1$ SRO\PHUDVH ZDV DGGLQJ QRQ WHPSODWHG QXFOHRWLGHV WR WKH n HQG RI GXSOH[ '1$ &ODUN f PDGH LQ HDUOLHU F\FOHV 7KHUPRVWDEOH SRO\PHUDVHV KDYLQJ D nn SURRIUHDGLQJ DELOLW\ VXFK DV 9HQW '1$ SRO\PHUDVH RU 3IX '1$ SRO\PHUDVH KDYH EHHQ XVHG WR DOOHYLDWH WKLV SUREOHP LQ OLJDWLRQ PHGLDWHG 3&5 /03&5f IRRWSULQWLQJ SURWRFROV *DUULW\ DQG :ROG

PAGE 53

)LJXUH ([SHULPHQW WR GHWHUPLQH WKH RSWLPDO QXPEHU RI F\FOHV RI OLQHDU DPSOLILFDWLRQ 0LWRFKRQGULDO '1$ IURP ; ODHYLV RYDULHV ZKLFK KDG EHHQ SURFHVVHG IRU LQ RUJDQHOOR IRRWSULQWLQJ DV GHVFULEHG IRU )LJXUHV DQG f ZDV XVHG DV D WHPSODWH IRU SULPHU H[WHQVLRQ ZLWK 3HQG ODEHOHG SULPHU :+ DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH VDPSOHV ZHUH GHQDWXUHG DW r& IRU PLQ IROORZHG E\ LQGHSHQGHQW F\FOLQJ RI HDFK UHDFWLRQ IRU DQG F\FOHV ODQHV f ZLWK WKH IROORZLQJ SURILOH r& IRU PLQ r& IRU PLQ DQG r& IRU PLQ 7KH UHDFWLRQV ZHUH WKHQ SKHQRO H[WUDFWHG HWKDQRO SUHFLSLWDWHG UXQ RQ b VHTXHQFLQJ JHOV DQG DXWRUDGLRJUDSKHG 1RWH WKH DSSHDUDQFH RI DGGLWLRQDO EDQGV ZKLFK DUH ORQJHU E\ QXFOHRWLGH HVSHFLDOO\ LQ WKH VDPSOHV F\FOHG IRU DQG F\FOHV ODQHV DQG f &\FOLQJ IRU F\FOHV ZDV IRXQG WR EH RSWLPDO ZLWK UHVSHFW WR ERWK VLJQDO LQWHQVLW\ DQG ILGHOLW\ RI UHSURGXFWLRQ RI WKH IRRWSULQW ODGGHU

PAGE 54

3&5 F\FOHV f /DQH f U} Vra 663I ( /63

PAGE 55

)LJXUH ([SHULPHQW FRPSDULQJ GLIIHUHQW WKHUPRVWDEOH '1$ SRO\PHUDVHV IRU DFFXUDWH DPSOLILFDWLRQ RI WKH IRRWSULQW ODGGHU 7KH SHUIRUPDQFH RI WZR WKHUPRVWDEOH SRO\PHUDVHV 9HQW '1$ SRO\PHUDVH 1(%f DQG 3IX '1$ SRO\PHUDVH 6WUDWDJHQHf ZKLFK SRVVHVV ff SURRIUHDGLQJ DELOLW\ LQ DGGLWLRQ WR WKH SRO\PHUDVH DFWLYLW\ ZHUH FRPSDUHG ZLWK 7DT '1$ SRO\PHUDVH *,%&2 %5/f ZKLFK GRHV QRW SRVVHVV WKH ff SURRIUHDGLQJ IXQFWLRQ '1$ WHPSODWH DQG SULPHU ZHUH WKH VDPH DV WKDW GHVFULEHG IRU )LJXUH (DFK XO UHDFWLRQ ZDV DVVHPEOHG LQ WKH PDQXIDFWXUHUfV UHFRPPHQGHG EXIIHU ZLWK P0 0J&O S0RO 3HQG ODEHOHG SULPHU WKH LQGLFDWHG G173 FRQFHQWUDWLRQV DQG XQLWV RI WKH UHVSHFWLYH HQ]\PH 7KH VDPSOHV ZHUH GHQDWXUHG DW r& IRU PLQ WKHQ F\FOHG IRU F\FOHV ZLWK WKH SURILOH r& IRU PLQ rF IRU PLQ r& IRU PLQ IROORZHG E\ F\FOHV ZLWK WKH SURILOH r& IRU PLQ r IRU VHF r& IRU PLQ 7KH UHDFWLRQV ZHUH WKHQ SKHQRO H[WUDFWHG HWKDQRO SUHFLSLWDWHG UXQ RQ b VHTXHQFLQJ JHOV DQG DXWRUDGLRJUDSKHG 1RWH WKDW RQO\ 7DT '1$ SRO\PHUDVH JLYHV UHSURGXFLEOH EDQGLQJ SDWWHUQV DW D ZLGH UDQJH RI G173 FRQFHQWUDWLRQV

PAGE 56

'1$ SRO\PHUDVH 9HQW 7DT 3IX G173 X0f IH 88/

PAGE 57

f 7KH UHVXOWV RI DQ H[SHULPHQW ZLWK 3IX '1$ SRO\PHUDVH DQG 9HQW '1$ SRO\PHUDVH LQ D 3() UHDFWLRQ XVLQJ WKH PDQXIDFWXUHUnV VXJJHVWHG EXIIHUV IRU SULPHU H[WHQVLRQ DUH VKRZQ LQ )LJXUH 1HLWKHU SRO\PHUDVH SULPHU H[WHQGHG DFFXUDWHO\ LQ WKLV V\VWHP FRPSDUHG WR WKH UHSURGXFLEOH SDWWHUQ SURGXFHG E\ 7DT '1$ SRO\PHUDVH DW D ZLGH UDQJH RI G173 FRQFHQWUDWLRQV FRPSDUH ODQHV ZLWK ODQHV DQG ODQHV t f 7KH PDQXIDFWXUHUV VXJJHVW ORZHULQJ WKH DQQHDOLQJ WHPSHUDWXUH RI SULPHUV IRU WKHVH SRO\PHUDVHV GXH WR WKH ORZHU LRQLF VWUHQJWK RI WKH EXIIHUV +RZHYHU WKHVH DQG D YDULHW\ RI RWKHU FRQGLWLRQV ZHUH WULHG ZLWK WKHVH SRO\PHUDVHV EXW ZLWKRXW VXFFHVV GDWD QRW VKRZQf ,W UHPDLQV SUREDEOH WKDW WKHVH SRO\PHUDVHV FRXOG EH DGDSWHG WR WKLV V\VWHP EXW RQO\ DIWHU H[WHQVLYH RSWLPL]DWLRQ RI EXIIHU DQG 3&5 FRQGLWLRQV DV KDV EHHQ QRWHG IRU 9HQW '1$ SRO\PHUDVH LQ WKH /03&5 SURWRFROV *DUULW\ DQG :ROG +RUQVWUD DQG
PAGE 58

H[WHQVLRQ XS WR RU EDVHV UHFRPPHQG H[WHQVLRQ WLPHV RI PLQXWHV WR DOORZ FRPSOHWLRQ RI DOO LQLWLDWHG SULPHUV *DUULW\ DQG :ROG f +RZHYHU DQ H[WHQVLRQ WLPH RI PLQXWHV ZDV IRXQG WR EH VXIILFLHQW IRU D QXPEHU RI SULPHUWHPSODWH FRPELQDWLRQV ZLWKRXW FRPSURPLVLQJ ILGHOLW\ RU VHQVLWLYLW\ %DVHG RQ WKHVH FRQVLGHUDWLRQV D W\SLFDO 3() UHDFWLRQ FRQVLVWHG RI QJ SLSHULGLQH FOHDYHG '1$ SLFRPROH 3n HQGODEHOHG SULPHU ,; 7DT SRO\PHUDVH UHDFWLRQ EXIIHU %5/f P0 0J&Of X0 HDFK RI G$73 773 G*73 G&73 8 WKHUPRVWDEOH '1$ SRO\PHUDVH %5/f 7KH UHDFWLRQ ZDV DVVHPEOHG RQ LFH DQG F\FOHG LQ D WKHUPDO F\FOHU DV IROORZV GHQDWXULQJ DW r& IRU PLQXWHV IROORZHG E\ F\FOHV ZLWK WKH SURILOH GHQDWXULQJ DW r& IRU PLQXWH DQQHDOLQJ DW r& EDVHG RQ SULPHU 7 f IRU PLQXWH DQG SULPHU H[WHQVLRQ DW r& IRU PLQXWHV 7KH WXEHV ZHUH WKHQ LPPHGLDWHO\ FKLOOHG RQ LFH XJ RI FDUULHU W51$ DGGHG DQG HWKDQRO SUHFLSLWDWHG LQ WKH SUHVHQFH RI 0 DPPRQLXP DFHWDWH $Q RUJDQLF H[WUDFWLRQ SULRU WR '1$ SUHFLSLWDWLRQ ZDV XVXDOO\ QRW QHFHVVDU\ 7KH SUHFLSLWDWH ZDV UHVXVSHQGHG LQ XO RI VHTXHQFLQJ G\H DQG XO RI HDFK UHDFWLRQ

PAGE 59

UHVROYHG LQ D b SRO\DFU\ODPLGH 0 XUHD JHO DV D SUHOLPLQDU\ WHVW WR RSWLPL]H VLJQDO LQWHQVLWLHV 8VLQJ YLVXDO LQVSHFWLRQ RU 3KRVSKRULPDJHU TXDQWLWDWLRQ WKH VLJQDOV LQ HDFK VDPSOH ZHUH HTXDOL]HG LQ D ILQDO JHO DQG DXWRUDGLRJUDSKHG WR REWDLQ WKH IRRWSULQW SDWWHUQ $XWRUDGLRJUDSK\ DW URRP WHPSHUDWXUH IRU KRXUV ZDV XVXDOO\ VXIILFLHQW WR JHQHUDWH DGHTXDWH VLJQDO LQWHQVLW\ 6WHDG\ 6WDWH 51$ $QDO\VLV 2OLJRQXFOHRWLGHV :+ EDVH ROLJRQXFOHRWLGH *7$ 7$* *&* $7$ *$$ &$$ 7& &RUUHVSRQGV WR WKH /VWUDQG VHTXHQFH LQ WKH 6 JHQH 5RH HW DO f :+ EDVH ROLJRQXFOHRWLGH &7$ &$7 7*$ 7$7 $*$ *$* $** &RUUHVSRQGV WR WKH +VWUDQG VHTXHQFH LQ WKH 6 JHQH :+ EDVH ROLJRQXFOHRWLGH &7& &&$ &&$ 7$7 7*$ &77 &* &RUUHVSRQGV WR WKH /VWUDQG VHTXHQFH LQ WKH 1' JHQH :+ EDVH ROLJRQXFOHRWLGH &&7 7&7 &&7 777 7$7 *&7 *& &RUUHVSRQGV WR WKH +VWUDQG VHTXHQFH LQ WKH 1' JHQH

PAGE 60

:+ EDVH ROLJRQXFOHRWLGH &$* &$* $&$ &$7 &7$ 7$* &&7 &RUUHVSRQGV WKH /VWUDQG VHTXHQFH LQ WKH &\W E JHQH :+ EDVH ROLJRQXFOHRWLGH *7* 7$7 &7* &$$ &7$ *** &7 &RUUHVSRQGV WR WKH +VWUDQG VHTXHQFH LQ WKH &\W E JHQH :+ EDVH ROLJRQXFOHRWLGH $&7 7&$ &77 &&$ &*$ &&$ 7$ &RUUHVSRQGV WR WKH /VWUDQG VHTXHQFH LQ WKH &R[ ,, JHQH :+ EDVH ROLJRQXFOHRWLGH &7$ *7$ 77* $7* $$* $7& $* &RUUHVSRQGV WR WKH +VWUDQG VHTXHQFH LQ WKH &R[ ,, JHQH :+ EDVH ROLJRQXFOHRWLGH *$7 &&7 &&7 $*& $*7 $*& $7 &RUUHVSRQGV WR WKH /VWUDQG VHTXHQFH LQ WKH 1' JHQH :+ EDVH ROLJRQXFOHRWLGH *77 $7* *&7 $*7 *7* $77 ** &RUUHVSRQGV WR WKH +VWUDQG VHTXHQFH LQ WKH 1' JHQH :+ EDVH ROLJRQXFOHRWLGH &7& $&7 7&7 &$$ $&7 $&& 77$ &RUUHVSRQGV WR WKH /VWUDQG VHTXHQFH LQ WKH 1' JHQH

PAGE 61

:+ EDVH ROLJRQXFOHRWLGH 7*7 *77 &7& *** 7$7 *7* 7$ &RUUHVSRQGV WR WKH +VWUDQG VHTXHQFH LQ WKH 1' JHQH :+ EDVH ROLJRQXFOHRWLGH *77 **7 7** 777 &*$ **& &$7 *$7 7$& 7*7 7*& &$$ 7& &RUUHVSRQGV WR WKH +VWUDQG VHTXHQFH LQ WKH $73DVH JHQH 7KLV ROLJRQXFOHRWLGH ZDV fHQG ODEHOHG DQG XVHG DV D K\EULGL]DWLRQ SUREH IRU GHWHFWLQJ $73DVH P51$ LQ 1RUWKHUQ EORWV :+ EDVH ROLJRQXFOHRWLGH **& *** 777 **& $$* $$* 7** 7*$ **7 77$ *&* $** &RUUHVSRQGV WR WKH +VWUDQG VHTXHQFH LQ WKH 6 U51$ JHQH 7KLV ROLJRQXFOHRWLGH ZDV fHQG ODEHOHG DQG XVHG DV D K\EULGL]DWLRQ SUREH IRU GHWHFWLQJ 6 U51$ LQ 1RUWKHUQ EORWV 3ODVPLG &ORQHV 7KH FORQLQJ VWUDWHJ\ ZDV LGHQWLFDO WR WKH RQH XVHG IRU WKH FRQVWUXFWLRQ RI WKH IRRWSULQWLQJ FORQHV GHVFULEHG HDUOLHU $OO WKH FORQHV GHVFULEHG EHORZ ZHUH GHULYHG IURP S%6 f SKDJHPLG 6WUDWDJHQHf ZLWK WKH 3&5DPSOLILHG JHQHVSHFLILF IUDJPHQWV FORQHG LQWR WKH +LQGL VLWH S%66 7KLV SODVPLG NEf FRQWDLQV WKH 6 U51$ VHTXHQFH LQIRUPDWLRQ IURP DPSOLILHG ZLWK ROLJRV :+ t :+ f 7KH LQVHUW LV FORQHG LQ WKH UHYHUVH RULHQWDWLRQ 7KHUHIRUH 7

PAGE 62

51$ SRO\PHUDVH PDNHV WKH +VWUDQG VHQVH RI F51$ ZKHUHDV 7 51$ SRO\PHUDVH PDNHV WKH /VWUDQG VHQVH S%61'O 7KLV SODVPLG NEf FRQWDLQV WKH 1' JHQH VHTXHQFH LQIRUPDWLRQ IURP DPSOLILHG ZLWK ROLJRV :+ t :+f 7KH LQVHUW LV FORQHG LQ WKH UHYHUVH RULHQWDWLRQ 7KHUHIRUH WKH VWUDQG VHQVH RI WKH F51$V DUH VDPH DV DERYH S%6&2; ,, 7KLV SODVPLG NEf FRQWDLQV WKH &R[ ,, JHQH VHTXHQFH LQIRUPDWLRQ IURP DPSOLILHG ZLWK ROLJRV :+ t :+f 7KH LQVHUW LV FORQHG LQ WKH UHYHUVH RULHQWDWLRQ 7KHUHIRUH WKH VWUDQG VHQVH RI WKH F51$V DUH VDPH DV WKDW RI S%66 S%61' 7KLV SODVPLG NEf FRQWDLQV WKH 1' JHQH VHTXHQFH LQIRUPDWLRQ IURP DPSOLILHG ZLWK ROLJRV :+ t :+f 7KH LQVHUW LV FORQHG LQ WKH IRUZDUG RULHQWDWLRQ 7KHUHIRUH 7 51$ SRO\PHUDVH PDNHV WKH /VWUDQG VHQVH RI F51$ ZKHUHDV 7 51$ SRO\PHUDVH PDNHV WKH +VWUDQG VHQVH S%6&<7E 7KLV SODVPLG NEf FRQWDLQV WKH &\WE JHQH VHTXHQFH LQIRUPDWLRQ IURP DPSOLILHG E\ ROLJRV :+ t :+f 7KH LQVHUW LV FORQHG LQ WKH IRUZDUG RULHQWDWLRQ 7KHUHIRUH WKH VWUDQG VHQVH RI WKH F51$V DUH VDPH DV WKDW RI S%61' S%61' 7KLV SODVPLG NEf FRQWDLQV WKH 1' JHQH VHTXHQFH LQIRUPDWLRQ IURP DPSOLILHG ZLWK ROLJRV :+ t :+ f 7KH LQVHUW LV FORQHG LQ WKH IRUZDUG RULHQWDWLRQ ZLWK

PAGE 63

UHIHUHQFH WR WKH OLQHDU VHTXHQFH EXW FORQHG LQ WKH UHYHUVH RULHQWDWLRQ ZLWK UHIHUHQFH WR WKH JHQH 6LQFH 1' LV WUDQVFULEHG E\ WKH /VWUDQG SURPRWHU WKH 7 SURPRWHU LV VWLOO XWLOL]HG IRU V\QWKHVL]LQJ DQ DQWLVHQVH SUREH IRU WKH 1' WUDQVFULSW 7RWDO 51$ ([WUDFWLRQ IURP (JJV DQG (PEU\RV %DWFKHV RI HJJV RU VWDJHG HPEU\RV ZHUH IUR]HQ DW r& DQG XVHG IRU WRWDO 51$ H[WUDFWLRQ 7KH IUR]HQ HJJV RU HPEU\RV ZHUH WKDZHG LQ PO RI O\VLV EXIIHU 0 *XDQLGLQH WKLRF\DQDWH P0 VRGLXP DFHWDWH S+ P0 ('7$f DQG LQFXEDWHG IRU PLQXWHV DW URRP WHPSHUDWXUH WR IDFLOLWDWH GLVVRFLDWLRQ RI QXFOHRSURWHLQ FRPSOH[HV 7KH KRPRJHQDWH ZDV WKHQ H[WUDFWHG WLPHV ZLWK SKHQROFKORURIRUPLVRDP\O DOFRKRO S+ f LQ PO FHQWULIXJH WXEHV &RUQLQJ RU )LVKHUf WR UHPRYH SLJPHQW H[FHVV SURWHLQ DQG FHOO GHEULV 3KDVH VHSDUDWLRQ ZDV DFKLHYHG E\ VSLQQLQJ LQ D -$ URWRU DW [ J 7KH FODULILHG VXSHUQDWDQW ZDV WKHQ ORDGHG DV D PO &V&O VROXWLRQ LQ 6: SRO\DOORPHU XOWUDFHQWULIXJH WXEHV DQG VSXQ DW USP IRU KUV DW r& $IWHU WKH VSLQ WKH OLTXLG SKDVH ZDV UHPRYHG WKH FOHDU 51$ SHOOHW DW WKH ERWWRP RI WKH WXEH ULQVHG RQFH ZLWK b HWKDQRO DLUGULHG DQG UHVXVSHQGHG LQ 7(6 EXIIHU O2P0 7ULV S+ P0 ('7$ b 6'6f 7KH 51$

PAGE 64

FRQFHQWUDWLRQV ZHUH WKHQ PHDVXUHG VSHFWURVFRSLFDOO\ DQG WKHLU $f$R UDWLRV XVHG DV D PHDVXUH RI SXULW\ 7\SLFDOO\ UDWLRV PRUH WKDQ ZHUH REWDLQHG ,I QRW WKH VDPSOHV ZHUH SKHQRO H[WUDFWHG DJDLQ DQG HWKDQRO SUHFLSLWDWHG $V DQ DOWHUQDWLYH SURWRFRO 7UL=RO UHDJHQW %5/f ZDV DOVR WULHG 7KRXJK 51$ IUHH RI '1$ ZDV REWDLQHG DEXQGDQW DPRXQWV RI SRO\VDFFKDULGHV DOZD\V FRSXULILHG ZLWK WKH 51$ LQ VSLWH RI UHSHDWHG SKHQRO H[WUDFWLRQV DQG HWKDQRO SUHFLSLWDWLRQV 7KH PRGLILHG PHWKRG UHSRUWHG E\ &KRPF]\QVNL DQG 0DFNH\ f IRU WKH UHPRYDO RI SRO\VDFFKDULGHV IURP 51$ ZDV WULHG EXW SRO\VDFFKDULGHV ZHUH QRW UHPRYHG DGHTXDWHO\ 6LQFH SRO\VDFFKDULGHV LQWHUIHUH ZLWK VSHFWURVFRSLF UHDGLQJV WKH IRUPHU PHWKRG ZDV IROORZHG LQ DOO WKH H[SHULPHQWV UHSRUWHG IRU WRWDO 51$ OHYHOV ,VRODWLRQ RI 7RWDO 0LWRFKRQGULDO 1XFOHLF $FLGV )RU LVRODWLQJ WRWDO PLWRFKRQGULDO 51$ FUXGH PLWRFKRQGULDO SHOOHWV ZHUH O\]HG LQ 7UL=RO UHDJHQW %5/f DQG 51$ H[WUDFWHG DFFRUGLQJ WR WKH PDQXIDFWXUHUfV SURWRFROV &RSXULILFDWLRQ RI SRO\VDFFKDULGHV ZLWK WKH 51$ SUHSDUDWLRQ ZDV QRW D SUREOHP ZKHQ LVRODWHG PLWRFKRQGULD ZHUH XVHG )RU H[SHULPHQWV ZKHUH WKH VWHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO 51$ ZHUH QRUPDOL]HG WR PLWRFKRQGULDO '1$ LW ZDV HVVHQWLDO WR

PAGE 65

LVRODWH ERWK '1$ DQG 51$ LQ WKH VDPH VROXWLRQ )RU WKLV D PRGLILFDWLRQ RI WKH SURWRFRO RI 1HOVRQ DQG .UDZHW] f E\ JXDQLGLQH WKLRF\DQDWHLVREXW\O DOFRKRO IUDFWLRQDWLRQ ZDV WULHG LQ ZKLFK WKH PLWRFKRQGULD ZHUH O\VHG LQ 0 JXDQLGLQH WKLRF\DQDWH H[WUDFWHG ZLWK SKHQROFKORURIRUPLVRDP\O DOFRKRO S+ f DQG WKH QXFOHLF DFLGV SUHFLSLWDWHG ZLWK LVREXW\O DOFRKRO $OWKRXJK WKLV PHWKRG ZDV XVHG VXFFHVVIXOO\ WKH \LHOGV RI QXFOHLF DFLGV ZHUH YHU\ SRRU $Q DOWHUQDWLYH PRUH VXFFHVVIXO SURWRFRO ZDV LGHQWLFDO WR WKH SURWRFRO IRU LVRODWLRQ RI PW'1$ GHWDLOHG LQ WKH IRRWSULQWLQJ VHFWLRQ H[FHSW WKDW S+ ZDV PDLQWDLQHG LQ DOO VROXWLRQV WR IDFLOLWDWH WKH VLPXOWDQHRXV LVRODWLRQ RI 51$ DQG '1$ 1RUWKHUQ $QDO\VLV RI 0LWRFKRQGULDO 51$ 7KH 51$ VDPSOHV ZHUH GHQDWXUHG LQ b IRUPDPLGH O[ 0236 EXIIHU P0 0236 S+ P0 VRGLXP DFHWDWH P0 ('7$f 0 IRUPDOGHK\GH XJPO HWKLGLXP EURPLGH E\ KHDWLQJ DW r& IRU PLQ 7KH VDPSOHV ZHUH WKHQ FRROHG RQ LFH ORDGLQJ EXIIHU DGGHG [ ORDGLQJ EXIIHU LV P0 ('7$ S+ b EURPRSKHQRO EOXH b [\OHQH F\DQRO b JO\FHUROf DQG HOHFWURSKRUHVHG LQ b IRUPDOGHK\GH DJDURVH JHOV LQ D KRUL]RQWDO JHO DSSDUDWXV 0RGHO + %5/f DW YROWV $IWHU

PAGE 66

HOHFWURSKRUHVLV WKH 51$ VDPSOHV ZHUH WUDQVIHUUHG WR Q\ORQ 1 E\ GRZQZDUG WUDQVIHU ZLWK O2[ 66& [ 66& LV 0 1D&O 0 VRGLXP FLWUDWH S+ f 7KH EORWV ZHUH WKHQ DLUGULHG DQG XYFURVVOLQNHG E\ WKH DXWRFURVVOLQN SURJUDP LQ 6WUDWDOLQNHU 6WUDWDJHQHf 7KH EORWV ZHUH SUHK\EULGL]HG LQ [ 663( [ 663( LV 0 1D&O 0 VRGLXP SKRVSKDWH 0 ('7$ S+ f b IRUPDPLGH [ 'HQKDUGWfV VROXWLRQ >[ 'HQKDUGWfV VROXWLRQ LV b HDFK RI )LFROO 6LJPDf SRO\YLQ\OS\UUROLGRQH .RGDNf DQG ERYLQH VHUXP DOEXPLQ )UDFWLRQ 9 86%$PHUVKDPf@ b 6'6 XJPO W51$ DW r& IRU KRXU 5DGLRODEHOHG ULERSUREHV ZHUH V\QWKHVL]HG IURP OLQHDUL]HG JHQHVSHFLILF FORQHV XVLQJ 7 DQG 7 51$ SRO\PHUDVHV 6WUDWDJHQHf DGGHG WR D IUHVK DOLTXRW RI WKH VDPH EXIIHU # QJPO DQG K\EULGL]HG RYHUQLJKW DW r& )ROORZLQJ K\EULGL]DWLRQ WKH EORWV ‘ ZHUH ZDVKHG LQ P0 1D b 6'6 P0 ('7$ DW r& IRU KU ZLWK FKDQJHV )ROORZLQJ WKH ZDVKHV H[FHVV ZDVK VROXWLRQ ZDV UHPRYHG DQG WKH EORWV H[SRVHG WR ERWK ILOP DQG SKRVSKRULPDJLQJ VFUHHQ 'RW %ORW 4XDQWLWDWLRQ RI 0LWRFKRQGULDO '1$ 7KH VDPH DOLTXRW RI PLWRFKRQGULDO QXFOHLF DFLGV XVHG IRU WKH 1RUWKHUQ DQDO\VLV ZDV XVHG WR TXDQWLWDWH WKH OHYHO RI PW'1$ LQ WKDW VDPSOH VR WKDW WKH VWHDG\ VWDWH OHYHOV FRXOG EH FRUUHFWHG WR XQLW

PAGE 67

PLWRFKRQGULDO JHQRPH )RU WKLV WKH VDPSOHV ZHUH LQFXEDWHG ZLWK XO RI 51DVH &RFNWDLO $PELRQ ,QFf DW r& IRU f WR GHJUDGH 51$ 7KH VDPSOHV ZHUH WKHQ DGMXVWHG WR 0 1D2+ DQG GHQDWXUHG DW r& IRU f FRROHG RQ LFH DQG 66& DGGHG WR O2[ 7KH VDPSOHV ZHUH WKHQ ILOWHUHG WKURXJK D SUHZHWWHG Q\ORQ 1 PHPEUDQH LQ D GRW EORW DSSDUDWXV %LR5DGf 7KH GRWV ZHUH ZDVKHG WKUHH WLPHV ZLWK XO RI O2[ 66& DLUGULHG XYFURVVOLQNHG DQG K\EULGL]HG ZLWK PW'1$ VSHFLILF ULERSUREHV XVLQJ WKH K\EULGL]DWLRQ EXIIHU V\VWHP RI &KXUFK DQG *LOEHUW f GHVFULEHG LQ WKH IRRWSULQWLQJ VHFWLRQ 7KH 3KRVSKRULPDJHU TXDQWLWDWLRQ RI PW'1$ RQ WKH GRW EORWV ZHUH XVHG WR QRUPDOL]H WKH OHYHOV RI WKH PLWRFKRQGULDO 51$V PHDVXUHG E\ 1RUWKHUQ DQDO\VHVf WR XQLW PLWRFKRQGULDO JHQRPH 0LWRFKRQGULDO 5XQ 2Q 7UDQVFULSWLRQ 2OLJRQXFOHRWLGHV :+ EDVH ROLJRQXFOHRWLGH &&* $&* 7&7 *&$ *7$ $*7 &$7 &RUUHVSRQGV WR WKH /VWUDQG VHTXHQFH LQ 'XQRQ %OXWHDX HW DO f :+ EDVH ROLJRQXFOHRWLGH &$* $77 &$& 7$& &*$ &$* $7* &RUUHVSRQGV WR WKH +VWUDQG VHTXHQFH LQ 'XQRQ %OXWHDX HW DO f

PAGE 68

3ODVPLG &ORQHV 0RVW RI WKH SODVPLG FORQHV XVHG IRU WKH SURGXFWLRQ RI WKH QRQn UDGLRDFWLYH JHQH DQG VWUDQGVSHFLILF ULERSUREHV KDYH EHHQ GHVFULEHG LQ WKH VWHDG\ VWDWH 51$ DQDO\VLV VHFWLRQ DERYH 7KH RQH SODVPLG FORQH ZKLFK KDV QRW EHHQ GHVFULEHG HDUOLHU LV WKH S%6'/RRS FORQH ZKLFK LV GHVFULEHG EHORZ S%6'/RRS 7KH ;HQRSXV 'ORRS UHJLRQ IURP LQ 'XQRQ%OXWHDX HW DO f LQFOXGLQJ WKH WZR SXWDWLYH 7$6 HOHPHQWV DQG WKH f HQGV ZHUH 3&5 DPSOLILHG XVLQJ SULPHUV :+ DQG :+ DQG WKH 3&5 SURGXFW FORQHG LQWR WKH +LQGL VLWH RI S%6 f SKDJHPLG 6WUDWDJHQHf 7KH LQVHUW ZDV FORQHG LQ WKH IRUZDUG RULHQWDWLRQ 7KHUHIRUH 7 51$ SRO\PHUDVH PDNHV WKH /VWUDQG VHQVH DQG 7 51$ SRO\PHUDVH PDNHV WKH +VWUDQG VHQVH RI F51$V 3UHSDUDWLRQ RI 5LERSUREHV IRU 6WUDQGVSHFLILF 3URELQJ ,Q RUGHU WR REWDLQ JHQH DQG VWUDQGVSHFLILF K\EULGL]DWLRQ WDUJHWV IRU DQDO\]LQJ WKH ODEHOHG UXQRQ WUDQVFULSWV RQO\ ULERSUREHV DUH VXLWDEOH /DUJHVFDOH V\QWKHVLV RI FROG ULERSUREHV IRU VWUDQGVSHFLILF SURELQJ ZDV GRQH ZLWK WKH 0HJD6FULSW NLW $PELRQ ,QFf XVLQJ WKH PLWRFKRQGULDO JHQHVSHFLILF FORQHV OLQHDUL]HG ZLWK WKH DSSURSULDWH UHVWULFWLRQ HQ]\PH 7KH ODUJHVFDOH UHDFWLRQV ZHUH DOORZHG WR

PAGE 69

LQFXEDWH IRU KRXUV DQG W\SLFDOO\ \LHOGHG XJ RI 51$ SHU UHDFWLRQ 7KH UHDFWLRQV ZHUH SKHQROH[WUDFWHG DQG HWKDQRO SUHFLSLWDWHG WZLFH LQ WKH SUHVHQFH RI 0 DPPRQLXP DFHWDWH 7KH 51$ \LHOG ZDV FDOFXODWHG VSHFWURVFRSLFDOO\ XJ RI HDFK WUDQVFULSW HOHFWURSKRUHVHG LQ SDUDOOHO ODQHV RI b IRUPDOGHK\GHDJDURVH JHOV DQG EORWWHG RQWR Q\ORQ PHPEUDQHV DV GHVFULEHG LQ WKH VHFWLRQ RQ VWHDG\ VWDWH DQDO\VHV RI PLWRFKRQGULDO 51$ ,Q VRPH RI WKH HDUOLHU H[SHULPHQWV FRPELQDWLRQV RI 51$V ZHUH UXQ LQ WKH VDPH ODQH DV / VWUDQG RU +VWUDQG VHWV 7KLV ZDV QRW IROORZHG LQ ODWHU H[SHULPHQWV GXH WR GLIILFXOWLHV LQ TXDQWLWDWLQJ WKH EDQGV DIWHU K\EULGL]DWLRQ 6LQFH LQ YLWUR WUDQVFULSWLRQ UHDFWLRQV DOZD\V UHVXOW LQ VKRUWHU WUDQVFULSWV RI WKH VDPH VSHFLILF VHTXHQFH JHO SXULILFDWLRQ RI WKH 51$ ZDV DWWHPSWHG $OWKRXJK HIIHFWLYH WKH PHWKRG LV ODERULQWHQVLYH DQG LQHIILFLHQW 7R RYHUFRPH WKLV SUREOHP WKH PHPEUDQHV FDUU\LQJ WKH 51$ EORWV ZHUH WULPPHG DURXQG WKH VSHFLILF 51$ EDQGV SULRU WR K\EULGL]DWLRQ WR DLG LQ HDVH RI TXDQWLWDWLRQ 7KLV PHWKRG ZDV SUHIHUUHG RYHU GRWEORWWLQJ WKH SUREH SDQHO GXH WR WKH IROORZLQJ UHDVRQV f HOHFWURSKRUHVLQJ WKH 51$ VDPSOHV HDFK WLPH VHUYHV DV D FKHFNSRLQW IRU 51$ GHJUDGDWLRQ f JHQH DVVLJQPHQWV DUH XQDPELJXRXV GXH WR WKH SDWWHUQ RI VSHFLILF 51$ VL]HV RQ WKH EORW DQG f UHPRYDO RI WHPSODWH '1$ DQG VKRUWHU WUDQVFULSWV LV DXWRPDWLFDOO\ IDFLOLWDWHG

PAGE 70

0LWRFKRQGULDO 5XQ2Q 7UDQVFULSWLRQ $VVD\ 7KH LQFXEDWLRQ FRQGLWLRQV IRU WKH UXQRQ WUDQVFULSWLRQ DVVD\V DUH PRGLILFDWLRQV RI WKH SURWRFROV RI *DLQHV HW DO f DQG *DLQHV f 0LWRFKRQGULD IURP HJJV DQG VWDJHGHPEU\RV ZHUH LVRODWHG LQ 06( EXIIHU DV RXWOLQHG LQ WKH PLWRFKRQGULDO LVRODWLRQ VHFWLRQ $IWHU RQH ZDVK ZLWK 06( EXIIHU LQ WKH PLFURFHQWULIXJH WKH SHOOHWV ZHUH UHVXVSHQGHG LQ PO RI 06( EXIIHU DQG VSXQ DW [ J LQ D PLFURFHQWULIXJH WR SHOOHW SLJPHQW DQG GHEULV ZKLFK ZHUH FDUULHG RYHU GXULQJ KDQGOLQJ RI WKH ELJJHU YROXPHV 7KH VXSHUQDWDQW ZDV WKHQ VSXQ DW [ J IRU PLQ WR SHOOHW PLWRFKRQGULD 7KH SHOOHW ZDV WKHQ UHVXVSHQGHG LQ UXQRQ ZDVK EXIIHU P0 7ULV P0 1D&O b JO\FHURO P0 0J&O PJPO %6$f DQG WKH PLWRFKRQGULD UHSHOOHWHG 7KH ILQDO SHOOHWV ZHUH UHVXVSHQGHG LQ WKH EDVLF UXQRQ EXIIHU P0 7ULV P0 1D&O b JO\FHURO P0 0J&O PJPO %6$f 6XSSOHPHQWDWLRQ RI WKLV EDVLF EXIIHU ZLWK VDOWV QXFOHRWLGHV 7&$ F\FOH LQWHUPHGLDWHV RU GUXJV LQWHUIHULQJ ZLWK PLWRFKRQGULDO PHWDEROLVP ZDV GRQH E\ DGGLQJ WKH FRPSRQHQWV WR D [ RU [ %DVLF EXIIHU PL[LQJ WKH FRPSRQHQWV DQG WKHQ UHVXVSHQGLQJ WKH PLWRFKRQGULD LQ WKH ILQDO PL[WXUH 5XQRQ UHDFWLRQV ZHUH LQLWLDWHG E\ WKH DGGLWLRQ RI >D3@873 PFLf WR WKH PLWRFKRQGULDO

PAGE 71

VXVSHQVLRQ RQ LFH DQG WKHQ LQFXEDWLQJ DW r& IRU PLQ )ROORZLQJ WKH LQFXEDWLRQ WKH VDPSOHV ZHUH FRROHG RQ LFH DQG WKHQ SHOOHWHG LQ D PLFURFHQWULIXJH DW [ J IRU PLQ 7KH PLWRFKRQGULDO SHOOHWV ZHUH HLWKHU XVHG LPPHGLDWHO\ IRU SURELQJ PW'1$VSHFLILF FROG SUREHV RU VWRUHG DW r& WLOO QHFHVVDU\ 7R GHWHFW DQG TXDQWLI\ WKH UXQRQ 51$ WKH PLWRFKRQGULDO SHOOHWV ZHUH UHVXVSHQGHG LQ P0 7ULV P0 1D&O P0 ('7$ $IWHU DGGLQJ 6'6 WR b WR O\VH WKH PLWRFKRQGULD WKH O\VDWH ZDV VSXQ IRU PLQ DW [ J LQ D PLFURFHQWULIXJH WR UHPRYH SLJPHQW 7KH VXSHUQDWDQW ZDV DGGHG WR WKH SUHK\EULGL]HG ULERSUREH SDQHO LQ IUHVK K\EULGL]DWLRQ VROXWLRQ DQG DOORZHG WR K\EULGL]H LQ D UROOLQJ K\EULGL]DWLRQ RYHQ %LRPHWUDf DW r& RYHUQLJKW 7KH SUH K\EULGL]DWLRQ K\EULGL]DWLRQ DQG ZDVK FRQGLWLRQV ZHUH WKH VDPH DV WKDW XVHG IRU WKH VWHDG\ VWDWH 51$ DQDO\VHV $OO TXDQWLWDWLRQV ZHUH SHUIRUPHG XVLQJ ,PDJHTXDQW VRIWZDUH 0ROHFXODU '\QDPLFVf RQ WKH 3KRVSKRULPDJHU 7R FRUUHFW IRU GLIIHUHQFHV LQ WKH \LHOG RI PLWRFKRQGULD REWDLQHG IURP WKH GLIIHUHQW GHYHORSPHQWDO VWDJHV WKH PW'1$ OHYHOV LQ HDFK UXQRQ UHDFWLRQ ZDV PHDVXUHG DV IROORZV 3ULRU WR WKH DGGLWLRQ RI WKH UDGLRODEHO b RI WKH PLWRFKRQGULDO VXVSHQVLRQ LQ EDVLF EXIIHU ZDV UHPRYHG SHOOHWHG DQG O\VHG LQ PLWRFKRQGULDO O\VLV EXIIHU GHVFULEHG

PAGE 72

LQ WKH IRRWSULQWLQJ VHFWLRQf 7KH O\VDWH ZDV WKHQ H[WUDFWHG WZLFH ZLWK SKHQROFKORURIRUPLVRDP\O DOFRKRO RQFH ZLWK FKORURIRUP DQG WKHQ SURFHVVHG IRU GRW EORWWLQJ ZLWKRXW HWKDQRO SUHFLSLWDWLRQf DV GHVFULEHG LQ WKH VWHDG\ VWDWH DQDO\VLV VHFWLRQ 0HDVXUHPHQW RI 0LWRFKRQGULDO $GHQLQH 1XFOHRWLGHV ([WUDFWLRQ 2I $GHQLQH 1XFOHRWLGHV 7KH WRWDO HJJHPEU\RQLF DQG PLWRFKRQGULDO DGHQLQH QXFOHRWLGHV ZHUH PHDVXUHG E\ UHYHUVHGSKDVH LRQSDLUHG +3/& 53+3/&f $GHQLQH QXFOHRWLGHV ZHUH H[WUDFWHG IURP HJJV HPEU\RV DQG LVRODWHG PLWRFKRQGULD E\ DQ DGDSWHG SURWRFRO RI :HLQEHUJ HW DO )RU HJJV DQG HPEU\RV GHMHOOLHG HJJV RU HPEU\RV ZHUH KRPRJHQL]HG LQ XO RI b 7&$ ZLWK DQ (SSHQGRUI SHVWOH .RQWHVf DQG LQFXEDWHG DW URRP WHPSHUDWXUH IRU PLQXWHV 7KH WXEHV ZHUH WKHQ YRUWH[HG DQG VSXQ LQ DQ (SSHQGRUI FHQWULIXJH IRU PLQXWHV 7KH FODULILHG VXSHUQDWDQW ZDV UHPRYHG DQG H[WUDFWHG WZLFH ZLWK YROXPHV RI 0 WULRFW\ODPLQH LQ F\FORKH[DQH FHQWULIXJHG WKH DTXHRXV OD\HU ILOWHUHG WKURXJK D PLFURQ Q\ORQ FHQWULIXJH ILOWHU 0LFURQ 6HSDUDWLRQV ,QFf DQG VWRUHG DW r& )RU H[WUDFWLRQ IURP LVRODWHG PLWRFKRQGULD PLWRFKRQGULD IURP HJJV RU HPEU\RV ZHUH SUHSDUHG E\ GLIIHUHQWLDO FHQWULIXJDWLRQ DQG

PAGE 73

VXFURVH JUDGLHQW VHGLPHQWDWLRQ DV GHVFULEHG 7KH ILQDO PLWRFKRQGULDO SHOOHWV ZHUH O\VHG LQ b 7&$ E\ UHSHDWHG SLSHWLQJ DQG WKHQ SURFHVVHG DV DERYH +3/& 0HDVXUHPHQWV $OO +3/& UXQV ZHUH GRQH RQ D &O VLOLFD +3/& FROXPQ XVLQJ DQ LQMHFWLRQ YROXPH RI XO WKH PRELOH SKDVH EHLQJ 0 VRGLXP SKRVSKDWH WLWUDWHG WR S+ ZLWK WHWUDEXW\O DPPRQLXP K\GUR[LGH 7%$+f E\ WKH LVRFUDWLF HOXWLRQ PRGH 6LJQDO DPSOLILFDWLRQ SHDN GHWHFWLRQ DQG DUHD TXDQWLWDWLRQV ZHUH GRQH XVLQJ 1HOVRQ 3( KDUGZDUH DQG VRIWZDUH 6WDQGDUG FDOLEUDWLRQ FXUYHV IRU $73 $'3 DQG $03 ZHUH JHQHUDWHG XVLQJ XOWUDSXUH $73 $'3 DQG $03 6LJPDf DQG XVHG WR FDOFXODWH WKH DPRXQWV RI WKH WKUHH DGHQLQH QXFOHRWLGHV LQ WKH WRWDO HJJHPEU\R DQG PLWRFKRQGULDO 7&$ H[WUDFWV (VWLPDWLRQ RI SURWHLQ FRQFHQWUDWLRQV 7KH DGHQLQH QXFOHRWLGH OHYHOV IRXQG LQ HDFK GHYHORSPHQWDO VWDJH ZHUH QRUPDOL]HG WR WKH DPRXQW RI PLWRFKRQGULDO SURWHLQ LQ WKH UHVSHFWLYH H[WUDFW )RU WKLV SURWHLQ SHOOHWV REWDLQHG DIWHU 7&$ SUHFLSLWDWLRQ ZHUH UHVXVSHQGHG LQ UHVXVSHQVLRQ EXIIHU 7ULV S+ b 6'6 ,P0 ('7$ ,P0 306)f XVLQJ DQ (SSHQGRUI SHVWOH .RQWHVf DQG UHSHDWHG SLSHWLQJ $IWHU WKRURXJK UHVXVSHQVLRQ WKH LQVROXEOH

PAGE 74

GHEULV ZDV UHPRYHG E\ D EULHI FHQWULIXJDWLRQ 7KH FODULILHG VXSHUQDWDQW ZDV XVHG IRU SURWHLQ HVWLPDWLRQ E\ WKH /RZU\ PHWKRG f XVLQJ %6$ DV D VWDQGDUG (OHFWURSKRUHWLF 0RELOLW\ 6KLIW $VVD\V 2OLJRQXFOHRWLGHV :+ EDVH ROLJRQXFOHRWLGH $*$ 77$ *** &7$ *&7 $*& *7* *&$ *$* &&7 **& 7$$ 7*& &RUUHVSRQGV WR WKH QDWLYH / VWUDQG VHTXHQFH 5RH HW DO f :+ EDVH ROLJRQXFOHRWLGH *&7 7$* *7& 777 &*& $77 $*& &$* *&7 &7* &&$ &*& 7$* &7 &RUUHVSRQGV WR WKH QDWLYH + VWUDQG VHTXHQFH :+ EDVH ROLJRQXFOHRWLGH $*$ 77$ *** &7$ *&7 $*& *7* *&$ *** &&7 **& 7$$ 7*& *$$ $*$ &RUUHVSRQGV WR WKH / VWUDQG VHTXHQFH ZLWK D SRLQW PXWDWLRQ DW SRVLWLRQ $ WR *f ZKLFK LV DQDORJRXV WR WKH 0(/$6 WUDQVLWLRQ DW SRVLWLRQ $ WR *f LQ WKH KXPDQ PLWRFKRQGULDO JHQRPH :+ EDVH ROLJRQXFOHRWLGH *&7 7$* *7& 777 &*& $77 $*& &$* *&& &7* &&$ &*& 7$* &7$ *& &RUUHVSRQGV WR WKH +VWUDQG VHTXHQFH ZLWK D SRLQW PXWDWLRQ DW SRVLWLRQ 7 WR & WUDQVLWLRQf WR PDWFK WKH PXWDWLRQ LQ :+

PAGE 75

:+ EDVH ROLJRQXFOHRWLGH $*$ 77$ *** &7$ *&7 $*& *$* &&$ *** &&7 **& 7$$ 7*& *$$ $*$ &RUUHVSRQGV WR WKH / VWUDQG VHTXHQFH ZLWK WKUHH SRLQW PXWDWLRQV LQ WKH P7(5) FRQVHQVXV VHTXHQFH 9DOYHUGH HO DO f DW SRVLWLRQV 7 WR $f WR &f DQG $ WR *f :+ EDVH ROLJRQXFOHRWLGH *&7 7$* *7& 777 &*& $77 $* &RUUHVSRQGV WR WKH +VWUDQG VHTXHQFH 3UHSDUDWLRQ RI %DQG 6KLIW 3UREHV DQG &RPSHWLWRUV 7R PDNH WKH ES ZLOG W\SH P7(5) EDQGVKLIW SUREH QPRO RI :+ DQG :+ ZHUH GHQDWXUHG LQ O2P0 7ULV S+ P0 1D&O DW r& IRU PLQ IROORZHG E\ DQQHDOLQJ DW r& IRU PLQ 7KH DQQHDOHG WHPSODWHV ZHUH NHSW RQ LFH DQG XVHG WR SHUIRUP D ILOO LQ UHDFWLRQ ZLWK HLWKHU .OHQRZ IUDJPHQW 1HZ (QJODQG %LRODEVf RU 6HTXHQDVH 86%$PHUVKDPf '1$ SRO\PHUDVH 7KH XVH RI .OHQRZ ZDV GLVFRQWLQXHG LQ ODWHU H[SHULPHQWV GXH WR LQFRPSOHWH ILOOLQJLQ RI WKH WHUPLQL ZKLFK OHG WR SURGXFWLRQ RI WZR PDMRU SURGXFWV LQ QDWLYH JHOV 5DGLRODEHOHG SUREHV ZHUH PDGH XVLQJ HLWKHU >D3@773 RU G$73 8QLQFRUSRUDWHG UDGLRODEHO ZDV UHPRYHG XVLQJ VSLQFROXPQV 6HSKDGH[ 3KDUPDFLDf DQG WKH SUREH VSHFLILF DFWLYLW\ FDOFXODWHG

PAGE 76

7KH VSHFLILF FRPSHWLWRU ZLWK D VLQJOH SRLQW PXWDWLRQ DW WKH 0(/$6 FRPSHWLWRUf ZDV SUHSDUHG E\ DQQHDOLQJ :+ DQG :+ DV GHVFULEHG DERYH 7KH VSHFLILF FRPSHWLWRU ZLWK WKUHH SRLQW PXWDWLRQV LQ WKH P7(5) FRQVHQVXV VHTXHQFH ZDV SUHSDUHG XVLQJ :+ t :+ $QQHDOLQJ ZDV GRQH DW URRP WHPSHUDWXUH LQ WKLV FDVH DQG SURFHVVHG DV DERYH 7KH ILOOHGLQ SUREHV ZHUH GLOXWHG WR D FRQFHQWUDWLRQ RI SLFRPROHVXO DQG IUR]HQ DW r& 3UHSDUDWLRQ RI 6 0LWRFKRQGULDO /\VDWH 0LWRFKRQGULD IURP HJJV RU HPEU\RV ZHUH SXULILHG DV GHVFULEHG LQ WKH PLWRFKRQGULDO LVRODWLRQ VHFWLRQ 7KH 6 O\VDWH ZDV SUHSDUHG E\ DQ DGDSWDWLRQ RI WKH SURWRFRO RI )HUQDQGH]6LOYD HW DO f IRU SUHSDULQJ 6 PLWRFKRQGULDO O\VDWHV IURP +H/D FHOOV 7KH KLJK VSHHG PLWRFKRQGULDO SHOOHW ZDV UHVXVSHQGHG LQ XO O\VLV EXIIHU b YY JO\FHURO P0 +HSHV.2+ S+ P0 0J&/ P0 (*7$ P0 '77 P0 306) XJPO RI $SURWLQLQ /HXSHSWLQ DQG 3HSVWDWLQ $f 7ZHHQ DQG .& ZHUH DGGHG WR ILQDO FRQFHQWUDWLRQV RI b DQG 0 UHVSHFWLYHO\ 7KH PLWRFKRQGULD ZHUH KRPRJHQL]HG ZLWK DQ (SSHQGRUI SHVWOH .RQWHVf DQG UHSHDWHG SLSHWLQJ 7KH O\VDWH ZDV WKHQ NHSW RQ LFH IRU PLQ IROORZHG E\ D VHF YRUWH[LQJ $IWHU D IXUWKHU LQFXEDWLRQ RQ LFH IRU PLQ WKH O\VDWH

PAGE 77

ZDV FHQWULIXJHG DW [ J IRU UDLQ LQ D PLFURFHQWULIXJH DW r& 7KH FOHDU VXSHUQDWDQW ZDV FROOHFWHG FDUHIXOO\ DYRLGLQJ WKH IOXII\ OD\HU IORDWLQJ RQ WRS $OLTXRWV ZHUH UDSLGO\ IUR]HQ LQ D GU\ LFH HWKDQRO EDWK DQG VWRUHG DW r& 3URWHLQ FRQFHQWUDWLRQV ZHUH GHWHUPLQHG E\ WKH /RZU\ PHWKRG 7KH H[WUDFWV ZHUH DVVD\HG IRU SUHVHQFH RI '1$ HQGRQXFOHDVH DFWLYLW\ E\ LQFXEDWLQJ XJ RI WKH H[WUDFW IURP HDFK VWDJH ZLWK XJ RI ES ODGGHU *,%&2 %5/f DQG LQFXEDWHG DW r& IRU n 7KH UHDFWLRQV ZHUH UXQ RQ D b DJDURVH JHO DQG VWDLQHG ZLWK HWKLGLXP EURPLGH %\ WKLV DVVD\ QR GHWHFWDEOH '1$ HQGRQXFOHDVH DFWLYLW\ ZDV GHWHFWHG GDWD QRW VKRZQf %DQG 6KLIW $VVD\ 7KH SURWRFRO IRU WKH PRELOLW\ VKLIW DVVD\ IRU P7(5) LV HVVHQWLDOO\ WKH RQH GHVFULEHG E\ )HUQDQGH]6LOYD HO DO f IRU KXPDQ PLWRFKRQGULDO O\VDWHV ZLWK VRPH PRGLILFDWLRQV 7KH '1$ELQGLQJ UHDFWLRQV ZHUH DVVHPEOHG RQ LFH DQG FRQVLVWHG RI WKH IROORZLQJ FRPSRQHQWV S0RO RI WKH P7(5) EDQGVKLIW SUREH O[ FSPS0ROf XJ %6$ XJ SRO\ GOG&fGOG&f DV QRQVSHFLILF FRPSHWLWRU DQG WKH GHVLUHG DPRXQWV RI WKH 6 PLWRFKRQGULDO H[WUDFW XVXDOO\ IURP WR XJf 7KH EXIIHU DQG VDOW FRQGLWLRQV

PAGE 78

ZHUH PRGLILHG DFFRUGLQJO\ WR REWDLQ ILQDO FRQFHQWUDWLRQV RI P0 +(3(6 S+ P0 .& P0 0J&O P0 '77 b JO\FHURO 7KH VDPSOHV ZHUH JHQWO\ PL[HG VSXQ GRZQ EULHIO\ DQG LQFXEDWHG LQ D URRP WHPSHUDWXUH ZDWHU EDWK IRU PLQ $IWHU WKH LQFXEDWLRQ WKH VDPSOHV ZHUH SODFHG RQ LFH DQG WKHQ ORDGHG RQWR D b SRO\DFU\ODPLGHUELVDFU\ODPLGH f JHO LQ 7ULVJO\FLQH EXIIHU FRQWDLQLQJ b JO\FHURO 7KH JHO KDG EHHQ SUHUXQ IRU DW OHDVW KU DW YROWV 6DPSOHV RQ WKH JHO ZHUH UXQ DW YROWV DW URRP WHPSHUDWXUH XQGHU FRQGLWLRQV ZKLFK GLG QRW KHDW WKH JHO $IWHU WKH UXQ WKH JHO ZDV WUDQVIHUUHG WR PP SDSHU GULHG DQG H[SRVHG WR ILOP RU SKRVSKRU VFUHHQV )RU FRPSHWLWLRQ H[SHULPHQWV WKH VSHFLILHG PRODU H[FHVV RI FROG FRPSHWLWRUV ZHUH DGGHG WR WKH UHDFWLRQV DIWHU D PLQ SUHn LQFXEDWLRQ ZLWK WKH ZLOG W\SH SUREH

PAGE 79

&+$37(5 67($'< 67$7( $1$/<6,6 2) 0,72&+21'5,$/ 51$ /(9(/6 ,QWURGXFWLRQ ;HQRSXV HJJV DV WKRVH RI RWKHU DQLPDOV FRQWDLQ ODUJH QXPEHUV RI PLWRFKRQGULD DQG FRQVHTXHQWO\ ODUJH DPRXQWV RI PW'1$ DQG PW51$ 'DZLG f 7KLV VWRFNSLOH RI PLWRFKRQGULD DORQJ ZLWK RWKHU RUJDQHOOHV DQG PDFURPROHFXOHV DUH SDUWLWLRQHG LQWR WKH UDSLGO\ GLYLGLQJ HPEU\RV E\SDVVLQJ WKH QHHG IRU IUHVK ELRJHQHVLV RI WKHVH FRPSRQHQWV XQWLO ODWHU LQ HPEU\RJHQHVLV &KDVH DQG 'DZLG f $FWLYH V\QWKHVLV RI PW'1$ GRHV QRW RFFXU WLOO DERXW KRXUV RI GHYHORSPHQW &KDVH DQG 'DZLG f XVHG 0& LQFRUSRUDWLRQ WR PHDVXUH PLWRFKRQGULDO U51$ V\QWKHVLV GXULQJ HDUO\ GHYHORSPHQW LQ ;HQRSXV ODHYLV E\ SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV DQG VFLQWLOODWLRQ FRXQWLQJ RI JHO VOLFHV %HIRUH WKH JDVWUXOD VWDJH KRXUV RI GHYHORSPHQWf WKH UDWH RI V\QWKHVLV ZDV YHU\ ORZ ,W LQFUHDVHG IROG DIWHU WKH JDVWUXOD VWDJH DQG IROG E\ QHXUXODWLRQ E\ KRXUV SRVWIHUWLOL]DWLRQf 2Q WKH EDVLV RI WKHVH

PAGE 80

GDWD WKH\ FRQFOXGHG WKDW DIWHU WKH JDVWUXOD VWDJH WKHUH LV D fVZLWFK RQf RI PLWRFKRQGULDO U51$ V\QWKHVLV DW JDVWUXODWLRQ KRXUV SRVWn IHUWLOL]DWLRQf $FFXPXODWLRQ WKHQ SURFHHGHG DW D FRQVWDQW UDWH DQG E\ KRXUV SRVWIHUWLOL]DWLRQ WKH FRQWHQW RI ERWK PLWRFKRQGULDO U51$V SHU HPEU\R KDG GRXEOHG 3@*73 LQWR IHUWLOL]HG HJJV DQG DQDO\]HG ODEHOHG 51$ E\ PHWK\O PHUFXU\ K\GUR[LGH DJDURVH JHO HOHFWURSKRUHVLV 7KH\ FRXOG QRW GHWHFW 51$ V\QWKHVLV RI DQ\ NLQG EHIRUH WKH PLGEODVWXOD KRXUVf VWDJH ZLWK WKH UHVHUYDWLRQ WKDW

PAGE 81

WKH\ GLG QRW VKRZ ZKHWKHU WKH PLFURLQMHFWHG *73 FRXOG HQWHU WKH PLWRFKRQGULD IURP WKH IHUWLOL]HG HJJ F\WRSODVP 6KRUWO\ DIWHU WKH PLGEODVWXOD WUDQVLWLRQ 0%7f 51$ V\QWKHVLV ZDV GHWHFWHG ERWK LQ WRWDO 51$ DQG LQ 51$ SUHSDUHG IURP LVRODWHG PLWRFKRQGULD :HEE HW DO f LQYHVWLJDWHG PLWRFKRQGULDO 51$ V\QWKHVLV GXULQJ RRF\WH PDWXUDWLRQ E\ LQMHFWLQJ >+@*73 LQWR IXOOJURZQ 6WDJH 9,f DQG LQ YLWUR PDWXUHG SURJHVWHURQH WUHDWHG VWDJH 9, RRF\WHVf RRF\WHV RI ;HQRSXV ODHYLV DQG VWXGLHG 51$ V\QWKHVLV LQ D SRO\DFU\ODPLGH JHO V\VWHP 7KH\ IRXQG WKDW WKH UDWH RI PW51$ V\QWKHVLV UHPDLQHG HVVHQWLDOO\ FRQVWDQW WKURXJKRXW PDWXUDWLRQ )XUWKHUPRUH WKHLU PHDVXUHG UDWHV RI PLWRFKRQGULDO U51$ V\QWKHVLV ZHUH VLPLODU WR WKRVH UHSRUWHG E\ &KDVH DQG 'DZLG f IRU SUH JDVWUXOD HPEU\RV 7KH\ FRQFOXGHG WKDW PW51$ V\QWKHVLV SURJUHVVHV WKURXJKRXW WKH WHUPLQDO VWDJHV RI ;HQRSXV RRJHQHVLV DQG LWV UDWH RI V\QWKHVLV UHPDLQV HVVHQWLDOO\ XQFKDQJHG E\ WKH HYHQWV DVVRFLDWHG ZLWK IHUWLOL]DWLRQ 0H]LDQH HW DO f GLUHFWO\ PHDVXUHG WKH VWHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO 51$V GXULQJ ; ODHYLV GHYHORSPHQW E\ 1RUWKHUQ K\EULGL]DWLRQ ,Q WKLV VWXG\ WKH\ LVRODWHG WRWDO 51$ IURP XQIHUWLOL]HG HJJ DQG HPEU\RV DW GLVWLQFW VWDJHV RI GHYHORSPHQW

PAGE 82

UHVROYHG WKH 51$ RQ IRUPDOGHK\GH DJDURVH JHOV EORWWHG WKHP RQWR Q\ORQ ILOWHUV DQG SUREHG WKHP ZLWK JHQHVSHFLILF '1$ SUREHV 7KH\ IRXQG WKDW WKH OHYHOV RI DOO PLWRFKRQGULDO P51$V GHFUHDVHG DEUXSWO\ ZLWKLQ D IHZ KRXUV DIWHU IHUWLOL]DWLRQ E\ D IDFWRU RI f UHPDLQHG DW D YHU\ ORZ OHYHO XS WR WKH ODWH QHXUXOD VWDJH KRXUV RI GHYHORSPHQWf DQG LQFUHDVHG DJDLQ GXULQJ RUJDQRJHQHVLV +RZHYHU WKH OHYHOV RI PLWRFKRQGULDO U51$V UHPDLQHG HVVHQWLDOO\ FRQVWDQW GXULQJ HDUO\ GHYHORSPHQW 2Q WKH EDVLV RI WKHVH GDWD WKH\ VXJJHVWHG WKDW WKH PLWRFKRQGULDO JHQRPH ZDV FRPSOHWHO\ LQDFWLYDWHG DW IHUWLOL]DWLRQ DQG GXULQJ HDUO\ HPEU\RQLF GHYHORSPHQW DQG WKDW WKH UHDFWLYDWLRQ RI PLWRFKRQGULDO WUDQVFULSWLRQ LQ WKH GHYHORSLQJ HPEU\R ZDV GHFRXSOHG IURP DFWLYH '1$ UHSOLFDWLRQ VLQFH WKH PW'1$ OHYHOV GR QRW YDU\ GXULQJ WKLV WLPH &KDVH DQG 'DZLG f 7KH HDUO\ SDUW RI WKH UHVXOWV REWDLQHG E\ 0H]LDQH HW DO f DUH LQ GLUHFW FRQWUDGLFWLRQ RI WKH VWXGLHV UHSRUWHG E\ WKH HDUOLHU JURXSV &KDVH DQG 'DZLG f GLG QRW ILQG DQ\ HYLGHQFH IRU GLIIHUHQFHV LQ PW51$ V\QWKHVLV UDWHV LQ XQIHUWLOL]HG HJJV YV HDUO\ HPEU\RV 'DZLG HW DO f IRXQG LQFUHDVHG LQFRUSRUDWLRQ RI PLFURLQMHFWHG >3@*73 LQWR PW51$ RQO\ DIWHU WKH PLGEODVWXOD WUDQVLWLRQ DIWHU KRXUV RI GHYHORSPHQWf ,Q DOO WKHVH VWXGLHV LQFUHDVLQJ UDWHV RI PW51$

PAGE 83

V\QWKHVLV ZHUH REVHUYHG RQO\ DIWHU WKH PLGEODVWXOD WUDQVLWLRQ 7KXV HDUOLHU VWXGLHV GR QRW VXSSRUW WKH REVHUYDWLRQ E\ 0H]LDQH HW DO f WKDW P51$ OHYHOV GHFUHDVH DIWHU IHUWLOL]DWLRQ DQG UHPDLQ DW D YHU\ ORZ OHYHO WLOO WKH ODWH QHXUXOD VWDJH +HQFH WKH ILQGLQJV RI 0H]LDQH HW DO f UHPDLQ D VROLWDU\ SLHFH RI HYLGHQFH VXJJHVWLQJ WKDW IHUWLOL]DWLRQ LQ ;HQRSXV ODHYLV LQGXFHV D UDSLG VKXWGRZQ RI PLWRFKRQGULDO WUDQVFULSWLRQ 7R UHVROYH WKHVH LVVXHV DQG H[WHQG RXU XQGHUVWDQGLQJ RI PLWRFKRQGULDO WUDQVFULSWLRQDO UHJXODWLRQ LQ WKH ;HQRSXV ODHYLV HPEU\RJHQHVLV V\VWHP UHLQYHVWLJDWHG WKH VWHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO 51$V GXULQJ HDUO\ GHYHORSPHQW RI ; ODHYLV 7KH SDWWHUQ RI HDUO\ GHYHORSPHQWDO VWHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO P51$V REVHUYHG ZHUH QRW LQ DJUHHPHQW ZLWK WKHLU UHVXOWV 0\ LQWHUSUHWDWLRQ RI WKHVH GLVFUHSDQFLHV DQG DGGLWLRQDO H[SHULPHQWV ZKLFK FODULI\ WKH VLWXDWLRQ DUH SUHVHQWHG LQ WKH IROORZLQJ VHFWLRQV 5HVXOWV ;HQRSXV HJJV ZHUH IHUWLOL]HG LQ YLWUR DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 'HYHORSPHQWDO VWDJHV ZHUH LGHQWLILHG DFFRUGLQJ WR WKH 1LHXZNRRS)DEHU WDEOHV 1LHXZNRRS DQG )DEHU f 7RWDO 51$

PAGE 84

IURP EDWFKHV RI YLDEOH HJJV RU HPEU\RV ZHUH H[WUDFWHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV ,GHQWLFDO DPRXQWV RI WRWDO 51$ XJf H[WUDFWHG IURP XQIHUWLOL]HG HJJV DQG VWDJHG HPEU\RV ZHUH UXQ RQ D b IRUPDOGHK\GHDJDURVH JHO EORWWHG WR Q\ORQ PHPEUDQHV DQG SUREHG ZLWK JHQHVSHFLILF ULERSUREHV 7KH UHVXOWV RI VXFK DQ DQDO\VLV IRU VL[ GLIIHUHQW P51$ VSHFLHV VSDQQLQJ HDUO\ GHYHORSPHQW DUH VKRZQ LQ )LJXUH SDQHOV $) 7KH P51$ OHYHOV ZHUH TXDQWLWDWHG XVLQJ D 3KRVSKRULPDJHU 7KH OHYHO RI HDFK WUDQVFULSW DW HDFK GHYHORSPHQWDO VWDJH LV UHODWLYH WR WKH HJJ OHYHO 7DEOH f VHWWLQJ WKH HJJ OHYHO WR XQLW\ $OO P51$V VKRZHG D WR IROG GHFUHDVH LQ WUDQVFULSW OHYHOV E\ KRXUV RI GHYHORSPHQW RYHU WKDW RI WKH XQIHUWLOL]HG HJJ UHWXUQHG WR HJJ OHYHOV E\ KRXUV LQ WKH FDVH RI 1' &\W E &2 ,, DQG $73DVH )LJXUH SDQHOV $ ( ) DQG 7DEOH f DQG LQFUHDVHG PDUJLQDOO\ WKHUHDIWHU ,Q FRQWUDVW WKH OHYHOV RI 1' DQG 1' )LJXUH SDQHOV % DQG &f FRQWLQXHG WR EH ORZ HYHQ LQ WKH WDGSROH VWDJH KRXUV RI GHYHORSPHQWf 7KH 6 DQG 6 U51$ OHYHOV FRQWLQXHG WR GHFUHDVH PDUJLQDOO\ GXULQJ WKLV ZLQGRZ RI GHYHORSPHQW )LJXUH SDQHOV t + DQG 7DEOH f 7KH FRPSOH[ SDWWHUQ RI EDQGV LQ WKH WZR U51$ EORWV KDYH EHHQ REVHUYHG E\ RWKHU JURXSV ZRUNLQJ RQ GLIIHUHQW V\VWHPV :LOOLDPV

PAGE 85

)LJXUH 6WHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO 51$ GXULQJ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV 7RWDO 51$ ZDV LVRODWHG IURP XQIHUWLOL]HG HJJV DQG HPEU\RQLF VWDJHV DW DQG KRXUV SRVWIHUWLOL]DWLRQ DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV XJ RI WRWDO 51$ IURP HDFK GHYHORSPHQWDO VWDJH ZDV UXQ LQ D b IRUPDOGHK\GHDJDURVH JHO EORWWHG RQ Q\ORQ 1 PHPEUDQHV K\EULGL]HG ZLWK JHQHVSHFLILF ULERSUREHV V\QWKHVL]HG E\ LQ YLWUR WUDQVFULSWLRQ IURP OLQHDUL]HG FORQHV ZDVKHG DQG H[SRVHG WR [UD\ ILOP RU SKRVSKRULPDJHU GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGVf (DFK ODQH ODEHOHG DFFRUGLQJO\f FRUUHVSRQGV WR WKH UHVSHFWLYH P51$ RU U51$ OHYHO LQ WKH FRUUHVSRQGLQJ GHYHORSPHQWDO VWDJH 3DQHO $ 1' P51$ 3DQHO % 1' P51$ 3DQHO & 1' P51$ 3DQHO &\W E P51$ 3DQHO ( &2 ,, 3DQHO ,n $73DVF P51$ 3DQHO 6 U51$ 3DQHO + 6 U51$ 7KH FRPSOH[ SDWWHUQ RI EDQGV VHHQ LQ SDQHOV DQG + UHSUHVHQW PXOWLSOH SURGXFWV FRUUHVSRQGLQJ WR WKH 6 DQG 6 VHTXHQFHV DQG LV IRXQG LQ ULERVRPDO 51$ EORWV IURP RWKHU DQLPDO V\VWHPV VHH WH[Wf

PAGE 86

(JJ KU KU KU KU KU KU f f f f r f f r r I f r r L m ‘r r (JJ KU KU KU KU KU KU

PAGE 87

)LJXUH >FRQWLQXHG P L (JJ P WPP KU PUQ KU O c W KU P KU b P KU f 039 KU /

PAGE 88

7DEOH 6WHDG\ VWDWH OHYHOVrr RI PLWRFKRQGULDO 51$ LQ WRWDO HJJ RU HPEU\RQLF 51$ GXULQJ HDUO\ GHYHORSPHQW RI ; ODHYLV (JJ KUr KU KU KU KU KU 1' 1' &\W E $73DVH &2 ,, 1' 6 U51$ 6 U51$ r +RXUV SRVWIHUWLOL]DWLRQ rr 6WHDG\ VWDWH OHYHOV DUH H[SUHVVHG DV IROG RYHU HJJ ZLWK WKH HJJ OHYHOV VHW WR XQLW\

PAGE 89

:LOOLDPV HW DO f EXW WKH\ ZHUH QRW GLVFXVVHG H[FHSW LQ RQH FDVH 0D]R HW DO f ZKHUH WKH\ KDYH EHHQ DFFXUDWHO\ DQDO\]HG ,Q UDW OLYHU PLWRFKRQGULD LW KDV EHHQ XQDPELJXRXVO\ GHPRQVWUDWHG WKDW VL[ DEXQGDQW SRO\ $fnWUDQVFULSWV UDQJLQJ IURP WR NE ZHUH QRQUDQGRP IUDJPHQWV RI WKH 6 U51$ DOO FDUU\LQJ LWV f WHUPLQXV 0D]R HW DO f 7KH PHFKDQLVP IRU WKLV QRQ UDQGRP GHJUDGDWLRQ RU SUHPDWXUH WHUPLQDWLRQ RI V\QWKHVLV KDV QRW \HW EHHQ HVWDEOLVKHG 7KH DERYH UHVXOWV GR QRW DJUHH ZLWK WKH ILQGLQJV UHSRUWHG E\ 0H]LDQH HW DO f ZKHUH WKH\ IRXQG D IROG GHFUHDVH LQ VWHDG\ VWDWH OHYHOV RI PRVW PW51$V DQDO\]HG ZLWKLQ KRXUV RI GHYHORSPHQW $OO WUDQVFULSWV UHPDLQHG DW D ORZ OHYHO XQWLO KRXUV RI GHYHORSPHQW DQG LQFUHDVHG WKHUHDIWHU 2QH RI WKH SRVVLELOLWLHV IRU WKLV GLVFUHSDQF\ EHWZHHQ ODEV LV WKDW WKHUH PD\ EH VWUDLQVSHFLILF GLIIHUHQFHV LQ WKH IURJV XVHG IRU DQDO\VHV &RPPHUFLDOO\ VROG ;HQRSXV ODHYLV LV KLJKO\ KHWHUR]\JRXV $IWHU WKH PLGEODVWXOD WUDQVLWLRQ DW KRXUV RI GHYHORSPHQW WKHUH LV D GUDPDWLF LQFUHDVH LQ QXFOHDU WUDQVFULSWLRQ ZLWK WKH FRQFRPLWDQW DSSHDUDQFH RI QHZ VSHFLHV RI QXFOHDU 51$V ,W LV FRQFHLYDEOH WKDW WKH TXDQWLW\ DQG TXDOLW\ RI VSHFLILF QXFOHDU 51$V PD\ EH XQGHU WKH

PAGE 90

LQIOXHQFH RI ERWK JHQHWLF DQG HQYLURQPHQWDO IDFWRUV 0H]LDQH HW DO f DQDO\]HG PLWRFKRQGULDO P51$V LQ WKH FRQWH[W RI UDSLGO\ IOXFWXDWLQJ WRWDO 51$ QXFOHDU SOXV PLWRFKRQGULDOf OHYHOV +HQFH D QRUPDOL]DWLRQ EDVHG RQ VSHFWURVFRSLF PHDVXUHPHQW RI WRWDO 51$ LV QRW WKH RSWLPDO FKRLFH LQ WKLV FDVH EHFDXVH WKH DFWXDO VWHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO 51$V FRXOG EH FDPRXIODJHG E\ VWUDLQ DQG DQLPDOVSHFLILF YDULDWLRQV LQ WRWDO 51$ PHWDEROLVP 7R UHPRYH WKH LQWHUIHUHQFH IURP GLIIHUHQWLDO DPRXQWV RI QXFOHDU 51$ LQ WKH VDPSOHV PLWRFKRQGULDO 51$ ZDV SUHSDUHG IURP VXFURVH JUDGLHQW SXULILHG PLWRFKRQGULD DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV (TXDO DPRXQWV XJf RI PLWRFKRQGULDO 51$ ZHUH HOHFWURSKRUHVHG DQG EORWWHG DV DERYH ZLWK PW'1$ VSHFLILF ULERSUREHV )LJXUH SDQHOV $)f 6LQFH WKH EXON RI WKH PLWRFKRQGULDO 51$ LV U51$ WKH PLWRFKRQGULDO P51$ OHYHOV ZHUH QRUPDOL]HG WR WKH VWHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO 6 U51$ DQG WKH OHYHO RI HDFK WUDQVFULSW DW HDFK GHYHORSPHQWDO VWDJH H[SUHVVHG UHODWLYH WR WKH OHYHO LQ WKH XQIHUWLOL]HG HJJ VHWWLQJ WKH HJJ OHYHO WR XQLW\ 7DEOH f :LWK WKH EXON RI WKH LQWHUIHUHQFH IURP QXFOHDU 51$ UHPRYHG &R[ ,, &\W E 1' DQG 1' OHYHOV QRZ VKRZHG D

PAGE 91

)LJXUH 6WHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO 51$ LVRODWHG IURP SXULILHG PLWRFKRQGULD GXULQJ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV 0LWRFKRQGULDO 51$ ZDV LVRODWHG IURP VXFURVH JUDGLHQW SXULILHG PLWRFKRQGULD SUHSDUHG IURP XQIHUWLOL]HG HJJV DQG HPEU\RQLF VWDJHV DW DQG KRXUV SRVWIHUWLOL]DWLRQ XJ RI 51$ IURP WKHVH GLVWLQFW VWDJHV ZHUH UXQ RQ b IRUPDOGHK\GH DJDURVH JHOV EORWWHG RQ Q\ORQ 1 PHPEUDQHV K\EULGL]HG ZLWK JHQHVSHFLILF ULERSUREHV V\QWKHVL]HG E\ LQ YLWUR WUDQVFULSWLRQ IURP OLQHDUL]HG FORQHV ZDVKHG DQG H[SRVHG WR [UD\ ILOP RU SKRVSKRULPDJHU GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGVf (DFK ODQH ODEHOHG DFFRUGLQJO\f FRUUHVSRQGV WR WKH UHVSHFWLYH P51$ RU U51$ OHYHO LQ WKH FRUUHVSRQGLQJ GHYHORSPHQWDO VWDJH 3DQHO $ 1' P51$ 3DQHO % 1' P51$ 3DQHO & 1' P51$ 3DQHO &\W E P51$ 3DQHO ( &2 ,, P51$ 3DQHO ) 6 U51$ 7KH FRPSOH[ SDWWHUQ RI EDQGV VHHQ LQ SDQHOV ) UHSUHVHQW PXOWLSOH SURGXFWV FRUUHVSRQGLQJ WR WKH 6 VHTXHQFH DQG LV IRXQG LQ ULERVRPDO 51$ EORWV IURP RWKHU DQLPDO V\VWHPV VHH WH[Wf

PAGE 92

Q IW W r ‘n W I I I m (JJ KU KU KU (JJ KU KU KU

PAGE 93

7DEOH 0LWRFKRQGULDO P51$ VWHDG\ VWDWH OHYHOVrr LQ LVRODWHG PLWRFKRQGULD IURP GLVWLQFW GHYHORSPHQWDO VWDJHV RI ; ODHYLV (JJ KUr KU KU 1' 1' &\W E &2 ,, 1' r +RXUV SRVWIHUWLOL]DWLRQ rr 7KH VWHDG\ VWDWH OHYHO RI HDFK VWDJH KDV EHHQ QRUPDOL]HG WR WKH 6 U51$ OHYHO LQ WKDW VWDJH DQG LV H[SUHVVHG DV IROG RYHU HJJ ZLWK WKH HJJ OHYHOV VHW WR XQLW\

PAGE 94

IROG LQFUHDVH RYHU HJJ OHYHOV LQ WKH KRXUROG HPEU\R 1' OHYHOV KRZHYHU VKRZHG D PDUJLQDO GHFUHDVH GXULQJ WKLV WLPH %DVHG RQ WKH DERYH UHVXOWV FRQFOXGH WKDW WKHUH DUH QR VXEVWDQWLDO UHGXFWLRQV LQ VWHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO P51$V VRRQ DIWHU IHUWLOL]DWLRQ DV UHSRUWHG E\ 0H]LDQH HW DO f $OWKRXJK WKHVH UHVXOWV VHHP WR DJUHH ZHOO ZLWK WKH REVHUYDWLRQV RI &KDVH DQG 'DZLG f
PAGE 95

E\ KRXUV RI GHYHORSPHQW &KDVH DQG 'DZLG f +HQFH WKH SHUIHFW PDFURPROHFXODU VSHFLHV WR QRUPDOL]H PLWRFKRQGULDO 51$ OHYHOV LV WKH PLWRFKRQGULDO '1$ LWVHOI 7KLV DOVR PDNHV WHOHRORJLFDO VHQVH VLQFH LW LV WKH WHPSODWH IRU PLWRFKRQGULDO WUDQVFULSWLRQ ,Q RUGHU WR QRUPDOL]H PW51$ OHYHOV WR PW'1$ OHYHOV LW LV FUXFLDO WR LVRODWH '1$ DQG 51$ VLPXOWDQHRXVO\ XVLQJ D VLQJOH PHWKRG IURP WKH VDPH HPEU\RV ,I WKH\ DUH LVRODWHG LQ SDUDOOHO UDWKHU WKDQ VLPXOWDQHRXVO\ WKH FKDQFHV RI LQWURGXFLQJ DGGLWLRQDO H[SHULPHQWDO HUURUV DUH LQFUHDVHG +HQFH PLWRFKRQGULDO '1$ DQG 51$ ZHUH VLPXOWDQHRXVO\ LVRODWHG IURP SXULILHG PLWRFKRQGULD RI GLVWLQFW GHYHORSPHQWDO VWDJHV XVLQJ S+ EXIIHUV DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV (TXDO YROXPHV RI WKH '1$51$ PL[WXUH IURP HDFK GHYHORSPHQWDO VWDJH ZHUH 51$DVH WUHDWHG WR UHPRYH 51$ DONDOL GHQDWXUHG DQG GRW EORWWHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV WR TXDQWLWDWH WKH OHYHO RI PW'1$ LQ HDFK VDPSOH XVLQJ D 3KRVSKRULPDJHU 7KLV TXDQWLWDWLRQ ZDV XVHG WR DSSUR[LPDWHO\ QRUPDOL]H WKH OHYHO RI PW'1$ LQ HDFK VWRFN VDPSOH WR WKDW RI WKH VDPSOH ZLWK WKH ORZHVW DPRXQW RI PW'1$ E\ DGGLQJ VWHULOH ZDWHU ,Q FRQWURO H[SHULPHQWV '1$VH GLJHVWLRQ RI WKH VDPH VDPSOHV SULRU WR DONDOL GHQDWXUDWLRQ DQG GRW EORWWLQJ FRPSOHWHO\ HOLPLQDWHG WKH

PAGE 96

VLJQDO QRW VKRZQf FRQILUPLQJ WKDW WKH EORWV WUXO\ UHSUHVHQWHG WKH OHYHOV RI MXVW PW'1$ ZLWKRXW DQ\ 51$ FDUU\RYHU (TXDO YROXPHV RI WKHVH DSSUR[LPDWHO\ QRUPDOL]HG VDPSOHV ZHUH WKHQ HOHFWURSKRUHVHG RQ IRUPDOGHK\GHDJDURVH JHOV EORWWHG DQG K\EULGL]HG DV GHVFULEHG HDUOLHU )LJXUH SDQHOV $)f ,Q D SDUDOOHO H[SHULPHQW WKH VDPH YROXPH RI VDPSOH IURP HDFK VWDJH ZDV DJDLQ GRW EORWWHG IRU PW'1$ TXDQWLWDWLRQ DV GHVFULEHG DERYH )LJXUH SDQHO *f 7KH 3KRVSKRULPDJHU TXDQWLWDWLRQ RI WKH P51$ OHYHOV LQ WKH 1RUWKHUQ EORWV ZHUH WKHQ FRUUHFWHG IRU WKH PW'1$ OHYHOV LQ HDFK VWDJH DQG WKH VWHDG\ VWDWH OHYHO RI HDFK WUDQVFULSW DW GLVWLQFW GHYHORSPHQWDO VWDJHV H[SUHVVHG UHODWLYH WR WKH OHYHO LQ WKH XQIHUWLOL]HG HJJ VHWWLQJ WKH HJJ OHYHO WR XQLW\ )LJXUH DQG 7DEOH f $V VHHQ LQ )LJXUH DQG 7DEOH WKH VWHDG\ VWDWH OHYHOV RI 1' 1' &\W E &ROO DQG $73DVH SDQHOV $ % ( )f UHPDLQHG DW PRUH RU OHVV HJJ OHYHOV XQWLO KRXUV RI GHYHORSPHQW 7KH OHYHOV RI WKHVH WUDQVFULSWV ZHUH DERXW IROG PRUH WKDQ HJJ OHYHOV E\ KRXUV IROG PRUH E\ KRXUV DQG IROG PRUH E\ KRXUV RI GHYHORSPHQW 7KH KLJK OHYHOV VHHQ DW KRXUV GURSV GRZQ WR WKH OHYHOV VHHQ DW KRXUV LQ WKH GD\ ROG WDGSROH GD\V IURP WKH WLPH RI IHUWLOL]DWLRQf 1' )LJXUH SDQHO &f VKRZHG ORZHU VWHDG\

PAGE 97

)LJXUH 6WHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO 51$ SHU XQLW PLWRFKRQGULDO JHQRPH GXULQJ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV 0LWRFKRQGULDO '1$ DQG 51$ ZHUH VLPXOWDQHRXVO\ LVRODWHG LQ WKH VDPH VROXWLRQ IURP PLWRFKRQGULD SUHSDUHG IURP XQIHUWLOL]HG HJJV DQG HPEU\RQLF VWDJHV DW KRXUV KRXUV KRXUV KRXUV KRXUV DQG GD\V SRVWIHUWLOL]DWLRQ $Q HTXDO YROXPH RI VDPSOH IURP HDFK GHYHORSPHQWDO VWDJH ZDV 51$DVHWUHDWHG DONDOLGHQDWXUHG DW r& IRU PLQXWHV DQG GRW EORWWHG LQ O2[ 66& DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH GRW EORWV ZHUH K\EULGL]HG ZLWK DQ DQWLVHQVH ULERSUREH WR &\W E ZDVKHG DQG WKH PW'1$ OHYHOV TXDQWLWDWHG XVLQJ WKH 3KRVSKRULPDJHU 7KH 3KRVSKRULPDJHU TXDQWLWDWLRQ ZDV XVHG WR DSSUR[LPDWHO\ QRUPDOL]H WKH VDPSOHV IURP HDFK GHYHORSPHQWDO VWDJH WR WKH PW'1$ OHYHO LQ WKDW UHVSHFWLYH VWDJH 7KH '1$ GRW EORW H[SHULPHQW ZDV DJDLQ UHSHDWHG DV DERYH ZLWK QRUPDOL]HG VDPSOHV WR DFFXUDWHO\ HVWLPDWH WKH DFWXDO PW'1$ OHYHOV IRU FRUUHFWLQJ WKH 51$ OHYHOV 3DQHO *f 'LJHVWLRQ ZLWK '1$VH FRPSOHWHO\ HOLPLQDWHG WKLV VLJQDO QRW VKRZQf (DFK ODQH LQ 3DQHO ODEHOHG DFFRUGLQJO\f FRUUHVSRQGV WR WKH PW'1$ OHYHO RI WKH UHVSHFWLYH GHYHORSPHQWDO VWDJH ,Q SDUDOOHO H[SHULPHQWV HTXDO YROXPHV RI WKHVH DSSUR[LPDWHO\ QRUPDOL]HG 51$'1$ VDPSOHV ZHUH WKHQ UXQ RQ b IRUPDOGHK\GHDJDURVH JHOV EORWWHG WR Q\ORQ 1 PHPEUDQHV K\EULGL]HG ZLWK JHQHVSHFLILF ULERSUREHV V\QWKHVL]HG E\ LQ YLWUR WUDQVFULSWLRQ IURP OLQHDUL]HG FORQHV ZDVKHG DQG H[SRVHG WR [UD\ ILOP RU 3KRVSKRULPDJHU GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGVf (DFK ODQH ODEHOHG DFFRUGLQJO\f FRUUHVSRQGV WR WKH UHVSHFWLYH P51$ RU U51$ OHYHO RI WKH FRUUHVSRQGLQJ GHYHORSPHQWDO VWDJH 3DQHO $ 1' P51$ 3DQHO % 1' P51$ 3DQHO & 1' P51$ 3DQHO &\W E P51$ 3DQHO ( &2 ,, P51$ 3DQHO ) $73DVF P51$ 3DQHO + 6 U51$ 3DQHO 6 U51$ 7KH FRPSOH[ SDWWHUQ RI EDQGV VHHQ LQ SDQHOV + DQG UHSUHVHQW PXOWLSOH SURGXFWV FRUUHVSRQGLQJ WR WKH 6 DQG 6 VHTXHQFHV DQG LV IRXQG LQ ULERVRPDO 51$ EORWV IURP RWKHU DQLPDO V\VWHPV VHH WH[Wf 7KH VKLIW LQ PRELOLW\ VHHQ LQ VRPH RI WKH ODQHV LV DQ HOHFWURSKRUHWLF DUWLIDFW DQG GRHV QRW UHSUHVHQW D KLJKHU PROHFXODU ZHLJKW VSHFLHV

PAGE 98

R F (JJ KU KU KU KU KU GD\V D (JJ KU KU KU KU KU GD\V (JJ KU KU KU KU KU GD\V ,6

PAGE 99

)LJXUH FRQWLQXHG KU

PAGE 100

7DEOH 6WHDG\ VWDWH OHYHOVrr RI PLWRFKRQGULDO 51$ QRUPDOL]HG WR PW'1$f GXULQJ HDUO\ GHYHORSPHQW RI ; ODHYLV (JJ KUr KU KU KU KU GD\V 1' 1' &\W E $73DVH &2 ,, 1' 6 U51$ 6 U51$ r 7LPH SRVWIHUWLOL]DWLRQ rr 6WHDG\ VWDWH OHYHO RI HDFK GHYHORSPHQWDO VWDJH KDV EHHQ QRUPDOL]HG WR WKH OHYHO RI PW'1$ LQ WKDW VWDJH DQG LV H[SUHVVHG DV IROG RYHU WKH OHYHO LQ WKH HJJ ZLWK WKH HJJ OHYHO VHW WR XQLW\

PAGE 101

)LJXUH 6WHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO P51$V SHU XQLW PLWRFKRQGULDO JHQRPH GXULQJ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV 7KH VWHDG\ VWDWH OHYHOV RI VL[ PLWRFKRQGULDO P51$V IURP HDFK GHYHORSPHQWDO VWDJH DV PHDVXUHG E\ SKRVSKRULPDJHU TXDQWLWDWLRQ RI WKH JHOV VKRZQ LQ )LJXUH KDYH EHHQ QRUPDOL]HG WR WKH PW'1$ OHYHO RI WKH UHVSHFWLYH GHYHORSPHQWDO VWDJH DQG LV H[SUHVVHG DV IROG RYHU HJJ OHYHOV ZLWK WKH HJJ OHYHO VHW WR XQLW\

PAGE 102

)ROG RYHU HJJ 7LPH SRVWIHUWLOL]DWLRQ

PAGE 103

VWDWH OHYHOV FRPSDUHG WR WKH RWKHU P51$V 7KH VWHDG\ VWDWH OHYHO RI 1' UHPDLQHG DW QHDU HJJ OHYHOV WLOO KRXUV RI GHYHORSPHQW LQFUHDVHG WR IROG E\ KRXUV IROG E\ KRXUV DQG IROG E\ KRXUV RI GHYHORSPHQW $JDLQ WKH GD\ ROG WDGSROH VKRZHG D GHFUHDVHG OHYHO FRPSDUDEOH WR WKH KRXU VWDJH 6LJQLILFDQWO\ WKH VWHDG\ VWDWH OHYHOV RI WKH 6 DQG 6 U51$V ZHUH QRW VWDWLF GXULQJ GHYHORSPHQW )LJXUH SDQHOV + t ,f MXVWLI\LQJ WKH PW'1$ QRUPDOL]DWLRQ 7KH\ UHPDLQHG DW QHDU HJJ OHYHOV XQWLO KRXUV RI GHYHORSPHQW LQFUHDVHG IROG RYHU HJJ OHYHOV E\ KRXUV IROG E\ KRXUV DQG aIROG E\ KRXUV RI GHYHORSPHQW 7DEOH f ,Q WKH GD\ ROG WDGSROH OHYHOV GHFUHDVHG EXW ZHUH VWLOO KLJKHU WKDQ HJJ OHYHOV IROG IRU 6 DQG IROG IRU 6 U51$f 7KHUHIRUH WKH SDWWHUQ RI VWHDG\ VWDWH OHYHOV RI WKH U51$V PRUH RU OHVV IROORZHG WKH SDWWHUQ VKRZQ E\ WKH P51$V DOEHLW WR D OHVVHU IROG 'LVFXVVLRQ 7KH VWHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO 51$ P51$ DQG U51$f GXULQJ YHU\ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV DV UHSRUWHG E\ 0H]LDQH HW DO f FRXOG QRW EH UHSURGXFHG LQ RXU ODERUDWRU\ HYHQ WKRXJK VLPLODU SURWRFROV ZHUH HPSOR\HG )LJXUH DQG 7DEOH

PAGE 104

f 0H]LDQH HW DO f DQDO\]HG PLWRFKRQGULDO P51$ OHYHOV LQ WRWDO 51$ IURP HJJ DQG HPEU\RQLF VWDJHV DQG IRXQG WKDW VKRUWO\ KRXUVf DIWHU IHUWLOL]DWLRQ WKHUH ZDV D IROG UHGXFWLRQ LQ PLWRFKRQGULDO P51$ OHYHOV ZKLFK ZHQW XS DJDLQ RQO\ DIWHU WKH ODWH QHXUXOD VWDJH KRXUV SRVWIHUWLOL]DWLRQf 7KLV NLQG RI VKDUS GHFOLQH LQ PLWRFKRQGULDO P51$ OHYHOV KDG QRW EHHQ REVHUYHG LQ HDUOLHU VWXGLHV E\ RWKHU JURXSV DQG ZDV QRW REVHUYHG ZKHQ UHSHDWHG WKHLU H[SHULPHQW IRXQG RQO\ D IROG UHGXFWLRQ LQ OHYHOV RI VRPH P51$V 1' $73DVH &\W Ef E\ KRXUV RI GHYHORSPHQW ZKLOH RWKHU P51$V 1' &2 ,,f VKRZHG HYHQ VPDOOHU UHGXFWLRQV )LJXUH SDQHOV $) DQG 7DEOH f 7KLV YDULDWLRQ EHWZHHQ ODEV FDQ EH EHVW H[SODLQHG E\ WKH IDFW WKDW WKH WRWDO 51$ QRUPDOL]DWLRQ HPSOR\HG E\ 0H]LDQH HW DO f IRU WKHLU 1RUWKHUQ DQDO\VLV ZDV QRW WKH RSWLPDO FKRLFH LQ WKLV V\VWHP JLYHQ WKH ZHDOWK RI LQIRUPDWLRQ DYDLODEOH RQ QXFOHLF DFLG PHWDEROLVP GXULQJ HPEU\RJHQHVLV LQ ;HQRSXV ODHYLV 7KH IHUWLOL]HG HJJ DQG FOHDYLQJ HPEU\RV XS WR WKH PLGEODVWXOD VWDJH GLYLVLRQV FHOOV KRXUV SRVWIHUWLOL]DWLRQf V\QWKHVL]H QXFOHDU '1$ DQG GLYLGH UDSLGO\ EXW DUH LQDFWLYH LQ QXFOHDU WUDQVFULSWLRQ 6RRQ DIWHU WKLV PLGEODVWXOD WUDQVLWLRQ 1HZSRUW DQG

PAGE 105

.LUVFKQHU Df FHOO GLYLVLRQ VORZV GRZQ GXH WR WKH LQVHUWLRQ RI DQG SKDVHV LQWR WKH OHQJWKHQLQJ FHOO F\FOH DQG YHU\ DFWLYH 51$ V\QWKHVLV UHVXPHV LQ WKH HPEU\R 1HZSRUW DQG .LUVFKQHU Ef 0LWRFKRQGULDO 51$ LV D PDMRU FRPSRQHQW RI WKH WRWDO 51$ SRRO LQ WKH XQIHUWLOL]HG HJJ %XW WKH OHYHO RI PW51$V LQ WKH WRWDO 51$ SRRO DUH SURJUHVVLYHO\ GLOXWHG E\ LQFUHDVLQJ OHYHOV RI QXFOHDU WUDQVFULSWV DV HPEU\RJHQHVLV SURFHHGV +HQFH PHDVXULQJ PW51$ OHYHOV LQ WKH FRQWH[W RI UDSLGO\ IOXFWXDWLQJ WRWDO 51$ OHYHO ZRXOG EH VXEMHFW WR JHQHWLF HQYLURQPHQWDO DQG DQLPDOVSHFLILF YDULDWLRQV FRQFHDOLQJ WKH UHDO SLFWXUH RI VWHDG\ VWDWH OHYHOV GXH WR ODUJH XQFHUWDLQWLHV LQ PW51$ OHYHOV 7KHVH FRQVLGHUDWLRQV PD\ SDUWO\ H[SODLQ WKH GLVDJUHHPHQW EHWZHHQ P\ UHVXOWV DQG WKRVH RI 0H]LDQH HW DO f WKRXJK LW VWLOO GRHV QRW IXOO\ H[SODLQ WKH IROG GHFUHDVH LQ WUDQVFULSW OHYHOV E\ WKH PLGEODVWXOD VWDJH VHHQ E\ WKRVH DXWKRUV 'XH WR WKH DERYH FRQVLGHUDWLRQV LW LV PDQGDWRU\ WR KDYH DQ LQWHUQDO FRQWURO IRU QRUPDOL]DWLRQ RI WKH PLWRFKRQGULDO P51$ OHYHOV 1RUPDOL]DWLRQ RI WKH PLWRFKRQGULDO P51$ OHYHOV WR PLWRFKRQGULDO U51$ OHYHOV ZDV LQLWLDOO\ DWWHPSWHG KHUH EXW VXIIHUV IURP WKH DVVXPSWLRQ WKDW WKH U51$ OHYHOV GR QRW IOXFWXDWH PXFK GXULQJ HDUO\ GHYHORSPHQW $OWKRXJK WKLV DVVXPSWLRQ SURYHG QRW WR EH WUXH

PAGE 106

GLVFXVVHG EHORZf WKLV QRUPDOL]DWLRQ UHYHDOHG WKDW WKH VWHDG\ VWDWH OHYHOV RI PRVW PLWRFKRQGULDO P51$V LQFUHDVHG IROG E\ ODWHU VWDJHV RI GHYHORSPHQW )LJXUH SDQHOV $) DQG 7DEOH f 7KLV LQFUHDVHG OHYHO ZDV FRQFHDOHG LQ WKH DQDO\VLV XVLQJ WRWDO 51$ QRUPDOL]DWLRQ 7DEOH f GXH WR WKH GLOXWLRQ RI PLWRFKRQGULDO 51$ OHYHOV E\ KLJKHU OHYHOV RI QXFOHDU WUDQVFULSWV +RZHYHU WKH OHYHOV RI PLWRFKRQGULDO U51$V ZHUH DOVR IRXQG WR LQFUHDVH GXULQJ HDUO\ GHYHORSPHQW WKRXJK WR D OHVVHU IROG WKDQ P51$f ZKHQ WKH 51$ OHYHOV ZHUH QRUPDOL]HG WR WKH OHYHOV RI PW'1$ )LJXUH SDQHOV + t DQG 7DEOH f +HQFH QRUPDOL]DWLRQ ZLWK PLWRFKRQGULDO U51$ DOVR GRHV QRW UHIOHFW WKH WUXH OHYHOV RI PLWRFKRQGULDO P51$ LQ HDFK VWDJH RI GHYHORSPHQW 0LWRFKRQGULDO '1$ DSSHDUV WR EH WKH RSWLPDO PDFURPROHFXODU VSHFLHV IRU QRUPDOL]LQJ PLWRFKRQGULDO 51$ OHYHOV VLQFH DFWLYH PW'1$ V\QWKHVLV GRHV QRW UHVXPH LQ WKH GHYHORSLQJ HPEU\R XQWLO KRXUV RI GHYHORSPHQW &KDVH DQG 'DZLG f 7KHUHIRUH PW'1$ OHYHOV LQ WKH HPEU\R GXULQJ WKLV WLPH UHPDLQ DW WKH OHYHOV IRXQG LQ WKH XQIHUWLOL]HG HJJ a QJHJJf $FFXPXODWLRQ RI PW'1$ LQFUHDVHV DIWHU WKLV WLPH OHDGLQJ WR D GRXEOLQJ RI PW'1$ FRQWHQW SHU HPEU\R E\ KRXUV RI GHYHORSPHQW &KDVH DQG 'DZLG f

PAGE 107

:KHQ PLWRFKRQGULDO P51$ OHYHOV ZHUH H[SUHVVHG SHU XQLW PLWRFKRQGULDO JHQRPH )LJXUH DQG 7DEOH f D SDWWHUQ RI UHJXODWLRQ HPHUJHG LQ ZKLFK PLWRFKRQGULDO P51$ OHYHOV ZHUH EDVDO LQ WKH XQIHUWLOL]HG HJJ DQG HPEU\RV XS WR KRXUV SRVWIHUWLOL]DWLRQ SUHJDVWUXOD VWDJHVf DIWHU ZKLFK WKHUH ZDV D VWHDG\ LQFUHDVH LQ WUDQVFULSW OHYHOV ZKLFK FXOPLQDWHG LQ D IROG LQFUHDVH RYHU HJJ OHYHOV E\ KRXUV RI GHYHORSPHQW )LJXUH f %\ GD\V RI GHYHORSPHQW WKH P51$ OHYHOV GURSSHG VRPHZKDW IURP WKH KLJK OHYHOV IRXQG LQ WKH KRXU VWDJH WR OHYHOV HTXLYDOHQW WR WKRVH LQ WKH KRXU HPEU\R IROG RYHU HJJf ,W LV SRVVLEOH WKDW WUDQVFULSWLRQ VWDELOL]HV WR D ORZHU EXW VLJQLILFDQW OHYHO DIWHU DQ LQLWLDO EXUVW LQ UHVSRQVH WR VRPH GHYHORSPHQWDO FXH 7KH ILQGLQJV RI WKLV VWXG\ FRUURERUDWH DQG H[WHQG HDUOLHU UHSRUWV LQ WKH OLWHUDWXUH 6WXGLHV RI PLWRFKRQGULDO P51$ V\QWKHVLV GRQH HLWKHU E\ PLFURLQMHFWLRQ RI *73 LQWR RRF\WHV :HEE HW DO f DQG IHUWLOL]HG HJJV 'DZLG HW DO f RU E\ FXOWXULQJ HPEU\RV ZLWK &2 &KDVH DQG 'DZLG f RU 3
PAGE 108

DSSHDUV WR EH DFWLYDWHG LQ WKH HPEU\R OHDGLQJ WR KLJKHU UDWHV RI PW51$ V\QWKHVLV 7KH SRVWIHUWLOL]DWLRQ GURS LQ VWHDG\ VWDWH OHYHOV )LJXUH GRWWHG OLQHf VHHQ E\ 0H]LDQH HW DO f DSSHDUV WR EH DQ DUWLIDFW LQWURGXFHG E\ WKH PHWKRG RI QRUPDOL]DWLRQ XVHG %DVHG RQ WKHVH UHVXOWV D UHYLVLRQ RI FXUUHQW WKLQNLQJ DERXW PLWRFKRQGULDO JHQH UHJXODWLRQ GXULQJ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV LV ZDUUDQWHG ,Q WKH UHYLVHG YLHZ WUDQVFULSW OHYHOV DUH DW D EDVDO OHYHO XQWLO KRXUV RI GHYHORSPHQW DIWHU ZKLFK WKHUH LV D VWHDG\ LQFUHDVH LQ WUDQVFULSW OHYHOV SUREDEO\ DV D UHVXOW RI WKH UHVXPSWLRQ RI DFWLYH WUDQVFULSWLRQ LQ WKH HPEU\R )LJXUH VROLG OLQHf 'XULQJ WKLV WLPH WKHUH LV QR LQFUHDVH LQ WKH PW'1$ OHYHOV &KDVH DQG 'DZLG f +HQFH WKLV UHSUHVHQWV D WUXH UHJXODWLRQ RI JHQH H[SUHVVLRQ DW WKH OHYHO RI WUDQVFULSWLRQ 'LIIHUHQFHV LQ P51$ WXUQRYHU FRXOG DOVR EH D IDFWRU LQIOXHQFLQJ WKHVH OHYHOV EXW LV XQOLNHO\ WR EH WKH PDMRU GHWHUPLQDQW EHFDXVH PLWRFKRQGULDO WUDQVFULSWLRQ UDWHV PHDVXUHG LQ D UXQRQ WUDQVFULSWLRQ DVVD\ FRUUHODWHG ZHOO ZLWK WKH FKDQJHV LQ VWHDG\ VWDWH OHYHOV GLVFXVVHG LQ &KDSWHU f 7KLV VWXG\ IXUWKHU DFFHQWXDWHV WKH YDOXH DQG LPSRUWDQFH RI WKH HDUO\ HPEU\RJHQHVLV PRGHO RI ;HQRSXV ODHYLV IRU XQGHUVWDQGLQJ WKH

PAGE 109

)LJXUH 5HYLVHG YLHZ RI PLWRFKRQGULDO JHQH UHJXODWLRQ GXULQJ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV %DVHG RQ WKH GDWD VKRZQ LQ 7DEOH DQG )LJXUH D UHYLVHG SLFWXUH RI PLWRFKRQGULDO JHQH UHJXODWLRQ GXULQJ HPEU\RJHQHVLV RI ;HQRSXV ODHYLV LV SUHVHQWHG 7KH GRWWHG OLQH UHSUHVHQWV D VXPPDU\ RI WKH GDWD UHSRUWHG E\ 0F]LDQF HO WLO f 7KH\ IRXQG D IROG UHGXFWLRQ LQ PLWRFKRQGULDO P51$ OHYHOV KRXUV DIWHU IHUWLOL]DWLRQ 7KLV ORZ OHYHO ZDV PDLQWDLQHG WLOO WKH ODWH QHXUXOD VWDJH KRXUV SRVWIHUWLOL]DWLRQf DIWHU ZKLFK WKH OHYHOV LQFUHDVHG DJDLQ :KHQ WKH PW51$ OHYHOV ZHUH QRUPDOL]HG WR WKH PW'1$ OHYHOV LQ HDFK VWDJH )LJXUH )LJXUH DQG 7DEOH f D GLIIHUHQW SLFWXUH HPHUJHG VROLG OLQHf 7KHUH ZHUH QR GLIIHUHQFH LQ VWHDG\ VWDWH OHYHOV RI VL[ GLIIHUHQW PLWRFKRQGULDO P51$V WLOO KRXUV RI GHYHORSPHQW DIWHU ZKLFK D VWHDG\ LQFUHDVH ZDV QRWHG 7KH OHYHOV RI PRVW P51$V UHDFKHG IROG RYHU HJJ OHYHOV E\ KRXUV a IROG E\ KRXUV DQG IROG E\ KRXUV RI GHYHORSPHQW $IWHU WKLV WLPH WKH VWHDG\ VWDWH OHYHOV VHHP WR VWDELOL]H WR D ORZHU EXW VLJQLILFDQW IROG RYHU HJJ OHYHOV E\ DQRWKHU GD\V RI GHYHORSPHQW 7KH KLJK OHYHOV REVHUYHG E\ 0H]LDQH HW DO f VHHPV WR EH DQ DUWHIDFW RI LQDFFXUDWH QRUPDOL]DWLRQ 7KLV UHYLVHG SDWWHUQ RI PLWRFKRQGULDO JHQH UHJXODWLRQ VROLG OLQHf FRUURERUDWHV WKH SUHGLFWLRQV PDGH E\ HDUOLHU ZRUNHUV &KDVH DQG 'DZLG
PAGE 110

7UDQVFULSW OHYHOV IROG RYHU HJJf 7LPH SRVWIHUWLOL]DWLRQ

PAGE 111

PROHFXODU EDVLV RI PLWRFKRQGULDO JHQH UHJXODWLRQ ,W LV RQH RI WKH IHZ QDWXUDO PRGHOV DYDLODEOH IRU VWXG\LQJ FRQWURO RI JHQH H[SUHVVLRQ LQ PLWRFKRQGULD ZLWKRXW FKHPLFDO SK\VLFDO RU KRUPRQDO LQWHUIHUHQFH 6LQFH DFWLYH UHSOLFDWLRQ RI PW'1$ GRHV QRW RFFXU LQ WKH ILUVW KRXUV RI GHYHORSPHQW UHJXODWLRQ RI JHQH H[SUHVVLRQ ZLWKRXW WKH DGGLWLRQDO FRPSOH[LW\ RI FKDQJHV LQ JHQH GRVDJH FDQ EH GLUHFWO\ VWXGLHG

PAGE 112

&+$37(5 $1$/<6,6 2) 3527(,10,72&+21'5,$/ '1$ ,17(5$&7,216 $7 &5,7,&$/ &,6 (/(0(176 ,QWURGXFWLRQ 0LWRFKRQGULDO ELRJHQHVLV LV D FRPSOH[ DQG KLJKO\ VRSKLVWLFDWHG SURFHVV ZKLFK UHTXLUHV WKH FRRUGLQDWLRQ RI JHQH H[SUHVVLRQ LQ ERWK WKH QXFOHXV DQG PLWRFKRQGULD 9HUWHEUDWH PW'1$ HQFRGHV RQO\ D KDQGIXO RI WKHVH JHQH SURGXFWV ZKLFK LQFOXGH WKH WZR U51$V IRXQG LQ WKH PLWRFKRQGULDO ULERVRPHV W51$V DQG SURWHLQV 7KH SURWHLQV DUH DOO FRPSRQHQWV RI WKH UHVSLUDWRU\ FRPSOH[HV 0RVW RI WKH JHQH SURGXFWV LQYROYHG LQ WKH UHSOLFDWLRQ DQG WUDQVFULSWLRQ RI PW'1$ DUH HQFRGHG LQ WKH QXFOHXV +RZHYHU WKH SRVVLELOLW\ UHPDLQV WKDW VRPH RI WKH PLWRFKRQGULDOHQFRGHG JHQH SURGXFWV FRXOG KDYH SOHLRWURSKLF IXQFWLRQV LQ DGGLWLRQ WR WKHLU FRPPRQO\ NQRZQ UROHV LQ PLWRFKRQGULDO SK\VLRORJ\ 5HFHQW GHYHORSPHQWV LQ XQGHUVWDQGLQJ WKH PHFKDQLVPV RI PLWRFKRQGULDO '1$ UHSOLFDWLRQ DQG WUDQVFULSWLRQ KDYH OHG WR WKH LGHQWLILFDWLRQ RI VRPH RI WKH HVVHQWLDO QXFOHXVHQFRGHG FRPSRQHQWV

PAGE 113

&OD\WRQ &KRP\Q DQG $WWDUGL f $PRQJ WKHVH WKH PLWRFKRQGULDO WUDQVFULSWLRQ IDFWRU $ PW7)$f KDV WXUQHG RXW WR EH D NH\ PROHFXOH ZLWK SOHLRWURSKLF UROHV LQ WKH PLWRFKRQGULD ,Q DGGLWLRQ WR LWV HVWDEOLVKHG UROH DV D WUDQVFULSWLRQDO DFWLYDWRU )LVKHU DQG &OD\WRQ f WKH DELOLW\ RI PW7)$ WR ZUDS DQG EHQG '1$ DQG KHQFH IXQFWLRQ DV D PW'1$ SDFNDJLQJ SURWHLQ 'LIIOH\ DQG 6WLOOPDQ 3DULVL DQG &OD\WRQ )LVKHU HW DO *KLYL]]DQL HW DO f KDV EHHQ WKH IRFXV RI UHFHQW UHVHDUFK 7KH PW7)$ SURWHLQ ZDV DEOH WR IRUP WUDQVFULSWLRQFRPSHWHQW SUHn LQLWLDWLRQ FRPSOH[HV LQ WKH DEVHQFH RI WKH KXPDQ PW51$ SRO\PHUDVH IUDFWLRQ VXJJHVWLQJ LWV PRGH RI DFWLYDWLRQ ZDV PHGLDWHG WKURXJK GLUHFW ELQGLQJ RI '1$ )LVKHU HW DO f 7KH FORQLQJ RI WKH KXPDQ 3DULVL DQG &OD\WRQ f \HDVW 'LIIOH\ DQG 6WLOOPDQ f DQG ;HQRSXV ODHYLV $QWRVFKHFKNLQ DQG %RJHQKDJHQ f PW7)$ UHYHDOHG KRPRORJ\ WR D JURXS RI VPDOO QXFOHDU '1$ ELQGLQJ SURWHLQV WKH KLJK PRELOLW\ JURXS +0*f SURWHLQV *HQH GLVUXSWLRQ RI $%) WKH \HDVW PW7)$f OHG WR WKH UDSLG ORVV RI PW'1$ ZKHQ JURZQ RQ JOXFRVH PHGLD DQG D JURZWK GHIHFW RQ PHGLXP FRQWDLQLQJ JO\FHURO ZKHUH PLWRFKRQGULDO JHQH H[SUHVVLRQ ZDV UHTXLUHGf HYHQ WKRXJK DOPRVW DOO RI WKH FHOOV DSSHDUHG WR FRQWDLQ ZLOGW\SH OHYHOV RI PW'1$

PAGE 114

+HQFH $%) ZDV LPSOLFDWHG LQ ERWK WKH PDLQWHQDQFH DQG WKH H[SUHVVLRQ RI WKH PLWRFKRQGULDO JHQRPH 'LIIOH\ DQG 6WLOOPDQ f '1DVH IRRWSULQWLQJ H[SHULPHQWV UHYHDOHG WKDW ERWK KXPDQ )LVKHU HW DO f DQG \HDVW 'LIIOH\ DQG 6WLOOPDQ f PW7)$ DUH IOH[LEOH LQ WKHLU VHTXHQFH UHFRJQLWLRQ H[KLELWLQJ JHQHUDOL]HG ELQGLQJ RI XQUHODWHG '1$ EXW ELQGLQJ WR WKH UHJXODWRU\ UHJLRQV RI PW'1$ LQ D fSKDVHGf IDVKLRQ (YLGHQFH IRU WKLV fSKDVHGf ELQGLQJ LQ YLYR ZDV UHSRUWHG E\ *KLYL]]DQL HW DO f LQ KXPDQ SODFHQWDO PLWRFKRQGULD XVLQJ WKH WHFKQLTXH RI LQ RUJDQHOOD '06 IRRWSULQWLQJ *KLYL]]DQL HW DO f $%) LV DQ H[WUHPHO\ DEXQGDQW SURWHLQ ZLWK DSSUR[LPDWHO\ PROHFXOH RI $%) IRU HYHU\ ES RI PW'1$ 'LIIOH\ DQG 6WLOOPDQ f 7KXV WKHUH LV HQRXJK $%) WR FRDW WKH HQWLUH PLWRFKRQGULDO JHQRPH %DVHG RQ WKH JHQHUDO DELOLW\ RI $%) WR ELQG QRQVSHFLILFDOO\ WR '1$ E\ ZUDSSLQJ DQG LWV VSHFLILF SKDVHG ELQGLQJ DW NH\ UHJXODWRU\ VHTXHQFHV 'LIIOH\ DQG 6WLOOPDQ f VXJJHVWHG WKDW WKH '1$ELQGLQJ SURSHUWLHV RI $%) PD\ SURYLGH D PHFKDQLVP ZKHUHE\ PRVW RI WKH PW'1$ FDQ EH SDFNDJHG E\ $%) ZLWKRXW LQWHUIHULQJ ZLWK WKH ELQGLQJ RI NH\ UHJXODWRU\ SURWHLQV DOORZLQJ LW WR EH DQ DFWLYDWRU RI ERWK WUDQVFULSWLRQ DQG UHSOLFDWLRQ

PAGE 115

7KH KXPDQ PW7)$ KXPW7)$f LV QRW DV DEXQGDQW DV $%) ZLWK PLQLPXP HVWLPDWHV RI DW OHDVW SURWHLQ PRQRPHUV SHU PW'1$ LQ KXPDQ .% FHOOV )LVKHU HW DO f 7KH ;HQRSXV PW7)$ [OPW7)$f RFFXUV DW DSSUR[LPDWHO\ FRSLHV SHU PW'1$ PROHFXOH LQ WRWDO RYDU\ PLWRFKRQGULD DOORZLQJ [OPW7)$ PROHFXOH SHU ES RI PW'1$ $QWRVFKHFKNLQ DQG %RJHQKDJHQ f 7KHUHIRUH WKH DEXQGDQFH RI [OPW7)$ LV LQWHUPHGLDWH EHWZHHQ WKDW RI WKH KXPDQ DQG \HDVW KRPRORJV ,Q KXPDQ PLWRFKRQGULD WKH PLWRFKRQGULDO JHQRPHRUJDQL]LQJ IXQFWLRQ RI PW7)$ VHHPV WR EH UHVWULFWHG WR MXVW WKH 'ORRS UHJLRQ RI PW'1$ *KLYL]]DQL HW DO f VXJJHVWLQJ WKDW KPW7)$ GRHV QRW FRDW WKH HQWLUH PLWRFKRQGULDO JHQRPH 7KLV PD\ EH FRQVLVWHQW ZLWK LWV UHODWLYHO\ ORZ DEXQGDQFH LQ KLJKHU YHUWHEUDWHV 7KH LPSRUWDQFH RI PDLQWDLQLQJ WKH SURPRWHU VSDFLQJ LQWHJULW\ EHWZHHQ WKH ELQGLQJ VLWH IRU KXPW7)$ DQG WKH WUDQVFULSWLRQ VWDUW VLWH ZDV VKRZQ UHFHQWO\ E\ 'DLUDJKL HW DO f $OWHULQJ WKH GLVWDQFH EHWZHHQ WKH KXPW7)$ ELQGLQJ VLWH DQG WKH WUDQVFULSWLRQ VWDUW VLWH JUHDWO\ LPSDLUHG WUDQVFULSWLRQ LQLWLDWLRQ HIILFLHQF\ 7KLV GHFUHDVH ZDV VKRZQ WR EH D FRQVHTXHQFH RI DOWHULQJ WKH SRVLWLRQ RI PW7)$ ELQGLQJ DV RSSRVHG WR WKH VWUHQJWK RI ELQGLQJ DV MXGJHG E\ WKH VKLIW LQ D '1$VH K\SHUVHQVLWLYH VLWH ZKLFK PDWFKHG WKH FKDQJH

PAGE 116

LQ VSDFLQJ 7KHVH UHVXOWV XQGHUOLQH WKH LPSRUWDQFH RI WKH LQ YLYR fSKDVHGf ELQGLQJ RI PW7)$ IRU PW'1$ PHWDEROLVP $OVR WKH VWULFW GLVWDQFH UHTXLUHPHQWV EHWZHHQ WKH SURWHLQ ELQGLQJ VLWHV DQG VWDUW SRLQWV RI WUDQVFULSWLRQ VXJJHVW WKDW WKH SURWHLQ DFWLYDWHV WUDQVFULSWLRQ PDLQO\ E\ GLVWRUWLQJ WKH SURPRWHU VHTXHQFH WR IDFLOLWDWH SRO\PHUDVH UHFRJQLWLRQ UDWKHU WKDQ E\ WKH PHFKDQLVP RI EULQJLQJ WRJHWKHU WKH WUDQVFULSWLRQ PDFKLQHU\ 'DLUDJKL HW DO f 7KH PW7)$ KDV EHHQ VKRZQ WR KDYH GLIIHUHQW ELQGLQJ DIILQLWLHV IRU WKH +VWUDQG DQG /VWUDQG SURPRWHUV RI KXPDQ PLWRFKRQGULD )LVKHU DQG &OD\WRQ f 8VLQJ PW7)$ SXULILHG IURP KXPDQ .% FHOO PLWRFKRQGULD LW ZDV IRXQG WKDW DW ORZ SURWHLQ FRQFHQWUDWLRQV RQO\ WKH /63 ZDV DFWLYH LQ LQ YLWUR WUDQVFULSWLRQ ZLWK WKH +63 EHFRPLQJ DFWLYH RQO\ DW KLJKHU FRQFHQWUDWLRQV 7KHVH HYHQWV DOVR FRUUHODWHG ZLWK WKH DSSHDUDQFH RI SURWHFWHG UHJLRQV DW WKH /63 RU +63 LQ '1$VH IRRWSULQWLQJ H[SHULPHQWV )LVKHU DQG &OD\WRQ f %DVHG RQ WKHVH REVHUYDWLRQV D VLPSOH PRGHO IRU WKH UHJXODWLRQ RI PLWRFKRQGULDO JHQH H[SUHVVLRQ KDV EHHQ SURSRVHG &OD\WRQ 'DLUDJKL HW DO f 7KLV PRGHO LV EDVHG RQ WKH IXQFWLRQDO FRQVHTXHQFHV RI YDU\LQJ WKH VWRLFKLRPHWULHV RI KPW7)$ WR PW'1$ LQ YLYR 7LWUDWLRQ RI /63 ZLWK KPW7)$ LQ YLWUR GHPRQVWUDWHG WKDW WKH

PAGE 117

SURPRWLRQ RI WUDQVFULSWLRQ LQLWLDWLRQ RFFXUV RYHU D EURDG UDQJH RI K PW7)$ FRQFHQWUDWLRQV 'DLUDJKL HW DO f $GGLWLRQ RI LQFUHDVLQJ DPRXQWV RI WKH SURWHLQ LQLWLDOO\ VWLPXODWHG WKH /63 XQWLO D PD[LPDO OHYHO RI VSHFLILF LQLWLDWLRQ ZDV UHDFKHG DW D UDWLR RI KPW7)$ PROHFXOH SHU ES RI WHPSODWH $ GHFUHDVH LQ /63 WUDQVFULSWLRQ EHJDQ EHWZHHQ UDWLRV RI PW7)$ PROHFXOH SHU DQG ES WHPSODWH &RPSOHWH LQKLELWLRQ RI /63 WUDQVFULSWLRQ RFFXUUHG DW KLJKHU OHYHOV $QWRVFKHFKNLQ DQG %RJHQKDJHQ f REVHUYHG D VLPLODU HIIHFW RI YDU\LQJ OHYHOV RI [OPW7)$ RQ WUDQVFULSWLRQ HIILFLHQF\ LQ DQ LQ YLWUR WUDQVFULSWLRQ V\VWHP ZLWK ;HQRSXV PW'1$ WHPSODWHV 7KH UDQJH RI FRQFHQWUDWLRQV DW ZKLFK [OPW7)$ VWLPXODWHG WKH PLWRFKRQGULDO SURPRWHUV ZDV TXLWH QDUURZ ,Q YLWUR WUDQVFULSWLRQ ZDV DOPRVW FRPSOHWHO\ DEROLVKHG DW SURWHLQ FRQFHQWUDWLRQV RQO\ ILYH WLPHV KLJKHU WKDQ WKDW UHTXLUHG IRU PD[LPDO VWLPXODWLRQ 7KHVH HIIHFWV RI [OPW7)$ RQ DOWHULQJ '1$ FRQIRUPDWLRQ DQG WUDQVFULSWLRQ HIILFLHQF\ KDG EHHQ VWXGLHG E\ HDUOLHU ZRUNHUV 0LJQRWWH DQG %DUDW 0LJQRWWH HW DO f XVLQJ DQ DEXQGDQW PLWRFKRQGULDO SURWHLQ ZKLFK WKH\ FDOOHG PW'1$ ELQGLQJ SURWHLQ& PW'%3&f ,W ZDV QRW NQRZQ DW WKDW WLPH WKDW WKLV SURWHLQ ZDV WKH PLWRFKRQGULDO WUDQVFULSWLRQ IDFWRU ,Q IDFW LW ZDV FKDUDFWHUL]HG DV DQ LQKLELWRU RI

PAGE 118

WUDQVFULSWLRQ DV WKLV SURWHLQ LQKLELWHG LQ YLWUR WUDQVFULSWLRQ DW KLJK FRQFHQWUDWLRQV %DUDW*XHULGH HW DO f +HQFH LW KDV EHHQ SURSRVHG WKDW WKH PRGXODWLRQ RI WKH UDWLR RI PW7)$ WR PW'1$ FRXOG SRWHQWLDOO\ GLFWDWH WKH UHODWLYH H[SUHVVLRQ IURP WKH WZR SURPRWHUV ,Q WKLV PRGHO PW7)$ LV SURGXFWLYHO\ ERXQG WR WKH /63 DW ORZ PW7)$ WR PW'1$ UDWLRV DOORZLQJ WUDQVFULSWLRQ IURP WKH /63 DQG VXEVHTXHQW SULPLQJ RI +VWUDQG '1$ UHSOLFDWLRQ $W KLJKHU PW7)$ WR '1$ UDWLRV WKH SURWHLQ ZRXOG EH ERXQG WR ERWK /63 DQG +63 DOORZLQJ LQLWLDWLRQ RI WUDQVFULSWLRQ IURP +63 ZLWK D SRVVLEOH GRZQUHJXODWLRQ RI /63 ZKLFK ZRXOG DOORZ FRQWLQXHG ORZ OHYHO UHSOLFDWLRQ SULPLQJ IURP WKH /63 +HQFH PW7)$ PD\ SURYLGH DQ LPSRUWDQW FRQWURO SRLQW IRU ERWK PLWRFKRQGULDO FRS\ QXPEHU DQG WUDQVFULSWLRQDO DFWLYLW\ &OD\WRQ 'DLUDJKL HW DO f 7KH JHQRPLF VHTXHQFH RI WKH PW7)$ JHQH KDV UHFHQWO\ EHHQ UHSRUWHG 7RPLQDJD HW DO f 8VLQJ WKLV LQIRUPDWLRQ 9LUEDVLXV DQG 6FDUSXOOD f IRXQG UHFRJQLWLRQ VLWHV IRU WKH QXFOHDU UHVSLUDWRU\ IDFWRUV 15) DQG 15) LQ WKH SUR[LPDO SURPRWHU RI WKH KXPDQ PW7)$ JHQH 7KHVH IDFWRUV KDYH EHHQ SUHYLRXVO\ LPSOLFDWHG LQ WKH DFWLYDWLRQ RI FHUWDLQ QXFOHDU JHQHV WKDW FRQWULEXWH WR PLWRFKRQGULDO UHVSLUDWRU\ IXQFWLRQ (YDQV DQG 6FDUSXOOD &KDX HW DO

PAGE 119

9LUEDVLXV DQG 6FDUSXOOD 9LUEDVLXV HW DK f %XW WKH VXJJHVWLRQ WKDW 15) DQG 15) PD\ SOD\ D PRUH LQWHJUDWLYH UROH LQ QXFOHDUPLWRFKRQGULDO LQWHUDFWLRQV JDLQHG PRUH FUHGHQFH ZLWK WKH GLVFRYHU\ RI LWV ELQGLQJ VLWHV LQ WKH SUR[LPDO SURPRWHUV RI ERWK PRXVH DQG KXPDQ JHQHV HQFRGLQJ WKH PLWRFKRQGULDO 51$SURFHVVLQJ 51$ (YDQV DQG 6FDUSXOOD f DQG WKH KXPDQ JHQH IRU PW7)$ 9LUEDVLXV DQG 6FDUSXOOD f 7KHVH VWXGLHV VXJJHVW WKDW 15) GHSHQGHQW PRGXODWLRQ RI WKH DPRXQW RI PW7)$ LQ WKH PLWRFKRQGULD PD\ EH RQH RI WKH ZD\V LQ ZKLFK WKH QXFOHXV DQG WKH PLWRFKRQGULD FRRUGLQDWH JHQH H[SUHVVLRQ LQ WKH FHOO 7KH PLWRFKRQGULDO JHQRW\SH LQ \HDVW FDQ LQIOXHQFH QXFOHDU JHQH H[SUHVVLRQ D SKHQRPHQRQ FDOOHG UHWURJUDGH UHJXODWLRQ 3DULNK HW DO f DQG WKH H[LVWHQFH RI VKDUHG WUDQVFULSWLRQ IDFWRUV EHWZHHQ WKH QXFOHXV DQG PLWRFKRQGULD KDV EHHQ SURSRVHG 3DULVL DQG &OD\WRQ f 'LIIOH\ DQG 6WLOOPDQ f SURSRVHG WKDW $%) PD\ SOD\ D UROH LQ FRRUGLQDWLQJ QXFOHDUPLWRFKRQGULDO LQWHUDFWLRQV LQ \HDVW SHUKDSV E\ GLUHFWO\ PRQLWRULQJ WKH DPRXQW RI PW'1$ DV $%) KDV EHHQ IRXQG LQ ERWK WKH PLWRFKRQGULD DQG WKH QXFOHXV RI \HDVW 7KHUH UHPDLQV KRZHYHU QR GLUHFW SURRI RI D UHODWLRQVKLS EHWZHHQ PW7)$ H[SUHVVLRQ DQG WKH UDWH RI PW'1$ WUDQVFULSWLRQ RU UHSOLFDWLRQ 2QH

PAGE 120

VWXG\ 7RPLQDJD HW DO f ZKLFK ZRXOG DUJXH DJDLQVW WKLV PRGHO UHSRUWHG WKDW WKH OHYHOV RI PW7)$ P51$ ZHUH QRW FKDQJHG LQ FHOO OLQHV ODFNLQJ PLWRFKRQGULDO '1$ RU ZLWK D GHIHFWLYH PLWRFKRQGULDO JHQRPH VXJJHVWLQJ WKDW WKH UHJXODWLRQ RI PW7)$ OHYHOV LQ WKH FHOO LV QRW GLUHFWO\ OLQNHG WR WKH OHYHOV RI PW'1$ +RZHYHU WKHVH FHOOV ZHUH FXOWXUHG VR DV WR JHQHUDWH DGHTXDWH JO\FRO\WLF HQHUJ\ LQ WKH DEVHQFH RI D IXQFWLRQDO UHVSLUDWRU\ FKDLQ 7KHUHIRUH LW LV SRVVLEOH WKDW D QRUPDO VLJQDOLQJ SDWKZD\ ZKLFK UHVSRQGV WR GHILFLHQFLHV LQ HQHUJ\ SURGXFWLRQ PLJKW KDYH EHHQ FXUWDLOHG +HQFH WKLV PRGHO RI PLWRFKRQGULDO JHQH UHJXODWLRQ WKRXJK DWWUDFWLYH VWLOO UHPDLQV VSHFXODWLYH $QRWKHU QXFOHXVHQFRGHG IDFWRU ZKLFK KDV EHHQ WKH IRFXV RI LQWHQVH UHVHDUFK LV WKH PLWRFKRQGULDO WUDQVFULSWLRQ WHUPLQDWLRQ IDFWRU FDOOHG P7(50 RU P7(5)f ,W ZDV SXULILHG IURP +H/D FHOO PLWRFKRQGULD DV DQ DFWLYLW\ ZKLFK SURPRWHV VSHFLILF WHUPLQDWLRQ RI +VWUDQG WUDQVFULSWV DW WKH 6 U51$OHXF\OW51$ ERXQGDU\ .UXVH HW DO f 8VLQJ '1$ DIILQLW\ FKURPDWRJUDSK\ WKUHH SRO\SHSWLGHV ZLWK D SUHGRPLQDQW N'D VSHFLHV ZKLFK KDG WKH WHUPLQDWLRQ SURPRWLQJ DFWLYLW\ ZHUH LGHQWLILHG 'DJD HW DO f 7KH '1$ HOHPHQW WR ZKLFK WKLV SURWHLQ ELQGV KDG EHHQ LGHQWLILHG

PAGE 121

HDUOLHU E\ LQ YLWUR WUDQVFULSWLRQ DVVD\V DV D WULGHFDPHU VHTXHQFH f 7**&$*$*&&&**f FRQWDLQHG HQWLUHO\ ZLWKLQ WKH JHQH IRU OHXF\O W51$ LQ KXPDQ PW'1$ &KULVWLDQVRQ DQG &OD\WRQ f $ VHDUFK RI VHTXHQFH GDWD EDVHV UHYHDOHG WKH H[LVWHQFH RI WKLV WHUPLQDWLRQ VLJQDO LQ D ZLGH YDULHW\ RI RUJDQLVPV IURP SURWR]RD WR PDPPDOV 9DOYHUGH HW DO f RFFXUULQJ DW WKH f HQG RI WKH ODUJH U51$ LQGHSHQGHQW RI WKH DGMDFHQW JHQH $OWKRXJK WKH WULGHFDPHU VHTXHQFH LWVHOI GLYHUJHG LQ ZLGHO\ VHSDUDWHG SK\OD D ZHOOFRQVHUYHG KHSWDPHU 7**&$*$ WKH PLWRFKRQGULDO U51$ WHUPLQDWLRQ ER[ FRXOG EH GHILQHG 7KLV HYROXWLRQDU\ FRQVHUYDWLRQ VWURQJO\ VXJJHVWV WKDW PLWRFKRQGULDO U51$ WUDQVFULSWLRQ WHUPLQDWLRQ LV D ZLGHO\ FRQVHUYHG PHFKDQLVP LQ DQLPDOV 5HVHDUFK LQWR WKLV WHUPLQDWLRQ PHFKDQLVP DVVXPHG QHZ GLPHQVLRQV ZLWK WKH LGHQWLILFDWLRQ RI SRLQW PXWDWLRQV LQ WKLV FLV HOHPHQW +HVV HW DO f WKDW ZHUH OLQNHG ZLWK WKH FKURQLF GHJHQHUDWLYH KXPDQ GLVHDVH 0(/$6 PLWRFKRQGULDO P\RSDWK\ HQFHSKDORSDWK\ ODFWLF DFLGRVLV DQG VWURNHOLNH HSLVRGHVf ,Q D FHOO IUHH DVVD\ XVLQJ SDUWLDOO\ SXULILHG P7(5) WKH 0(/$6 PXWDWLRQ DQ $ WR WUDQVLWLRQ DW SRVLWLRQ f UHGXFHG WHUPLQDWLRQ RI WKH 6 U51$ LQ LQ YLWUR WUDQVFULSWLRQ UHDFWLRQV 7KHUHIRUH WKH DXWKRUV

PAGE 122

,OO VXJJHVWHG WKDW WKH PROHFXODU GHIHFW LQ 0(/$6 PD\ EH WKH LQDELOLW\ WR SURGXFH WKH FRUUHFW W\SH DQG TXDQWLW\ RI U51$ UHODWLYH WR RWKHU PLWRFKRQGULDO JHQH SURGXFWV UHVXOWLQJ LQ GHIHFWV LQ SURWHLQ V\QWKHVLV $V D FODVVLF H[DPSOH RI FDVHV ZKHUH LQ YLWUR UHVXOWV FDQQRW EH QHFHVVDULO\ H[WUDSRODWHG LQ YLYR &KRP\Q HW DO f IRXQG WKDW WKH 0(/$6 PXWDWLRQ GLG QRW FDXVH DQ\ FKDQJH LQ OHYHOV RI WKH WUDQVFULSWV XSVWUHDP RU GRZQVWUHDP RI WKH P7(5) HOHPHQW FRPSDUHG WR FRQWUROV 7KH\ WUDQVIHUUHG PLWRFKRQGULD IURP JHQHWLFDOO\ XQUHODWHG 0(/$6 SDWLHQWV LQWR KXPDQ PW'1$OHVV Srf FHOOV .LQJ DQG $WWDUGL &KRP\Q HW DO f DQG IRXQG PDUNHG GHIHFWV LQ PLWRFKRQGULDO SURWHLQ V\QWKHVLV DQG UHVSLUDWRU\ DFWLYLW\ EXW QR VLJQLILFDQW FKDQJH LQ VWHDG\ VWDWH OHYHOV RI WKH +VWUDQG HQFRGHG U51$V P51$V DQG OHXF\OW51$ +RZHYHU D PDUNHG GHFUHDVH LQ DIILQLW\ RI SXULILHG P7(5) IRU WKH PXWDQW WDUJHW VHTXHQFH ZDV DJDLQ REVHUYHG LQ LQ YLWUR DVVD\V VXJJHVWLQJ WKDW WKH UHGXFHG DIILQLW\ PD\ EH FRPSHQVDWHG LQ YLYR E\ UHJXODWLRQ RI WKH SURWHLQ OHYHOV &KRP\Q HW DO f 7KH UHGXFWLRQ LQ ODEHOLQJ RI YDULRXV PLWRFKRQGULDO WUDQVODWLRQ SURGXFWV ZDV DOVR QRW FRUUHODWHG ZLWK WKHLU 885HQFRGHG OHXFLQH FRQWHQW DUJXLQJ DJDLQVW DQ HIIHFW RI WKH 0(/$6 PXWDWLRQ RQ

PAGE 123

WKH OHXF\OW51$885 IXQFWLRQ RU VWDELOLW\ $ VPDOO EXW FRQVLVWHQW LQFUHDVH OHVV WKDW IROGf LQ WKH VWHDG\VWDWH OHYHOV RI D SDUWLDOO\ SURFHVVHG 51$ WUDQVFULSW 51$f FRUUHVSRQGLQJ WR D FRQWLJXRXV FRS\ RI WKH 6 U51$ W51$OFX 885f 1' JHQHV ZDV GHWHFWHG LQ FHOOV FRQWDLQLQJ DOPRVW HQWLUHO\ PXWDWHG PW'1$ .LQJ HW DO f 7KLV KDV OHG WR D PRGHO LQ ZKLFK 51$ FRXOG EH LQFRUSRUDWHG LQWR ULERVRPHV UHQGHULQJ WKHP IXQFWLRQDOO\ GHILFLHQW 6FKRQ HW DO f %XW WKLV PRGHO VWLOO UHPDLQV VSHFXODWLYH ZLWKRXW DQ\ GLUHFW SURRI RI GHIHFWLYH ULERVRPHV 6KDQJ DQG &OD\WRQ f XQGHUWRRN D GHWDLOHG LQ YLWUR FKDUDFWHUL]DWLRQ RI P7(5) 8VLQJ SXULILHG KXPDQ PLWRFKRQGULDO P7(5) WKH\ IRXQG WKDW WKH SURWHLQ WHUPLQDWHG WUDQVFULSWLRQ HORQJDWLRQ E\ KHWHURORJRXV 51$ SRO\PHUDVHV 7 7 ( FROL RU \HDVW PLWRFKRQGULDO 51$ SRO\PHUDVHVf DOWKRXJK WHUPLQDWLRQ RI WKHVH KHWHURORJRXV SRO\PHUDVHV ZDV GHWHFWHG RQO\ LQ WKH WUDQVFULSWLRQ SRODULW\ RSSRVLWH WKDW RI PLWRFKRQGULDO U51$ V\QWKHVLV +63 GULYHQf 7KH HIILFLHQF\ RI WHUPLQDWLRQ LQ WKH KRPRORJRXV KXPDQ 51$ SRO\PHUDVH V\VWHP ZDV DSSUR[LPDWHO\ IROG JUHDWHU LQ WKLV VDPH RSSRVLWH SRODULW\ 6KDQJ DQG &OD\WRQ f ,I WKHVH SKHQRPHQD FDQ EH VKRZQ WR RSHUDWH LQ YLYR LW ZRXOG SURYLGH D PHFKDQLVP IRU WKH

PAGE 124

ULERVRPDO 51$V WR EH DPSOLILHG PRUH HIILFLHQWO\ ZLWKRXW LQWHUIHUHQFH IURP DQWLVHQVH WUDQVFULSWV IURP WKH /63 7KLV HIIHFW RQ KHWHURORJRXV 51$ SRO\PHUDVHV VXJJHVWV WKDW VSHFLILF LQWHUDFWLRQV EHWZHHQ WKH P7(5) DQG 51$ SRO\PHUDVHV DUH QRW OLNHO\ WR EH FULWLFDO 5DWKHU WKH P7(5) SURWHLQ ERXQG RQ LWV FRJQDWH VLWH VHHPV WR EH LQWHUIHULQJ ZLWK WKH IRUZDUG SURJUHVV RI WKH 51$ SRO\PHUDVH IXQFWLRQLQJ DV D SK\VLFDO URDGEORFN 6KDQJ DQG &OD\WRQ f ,Q VXSSRUW RI WKLV VXJJHVWLRQ LW KDV EHHQ IRXQG WKDW WKLV SURWHLQ ELQGV WLJKWO\ WR '1$ ZLWK D KDOIOLIH RI PLQ RQ LWV FRJQDWH '1$ ELQGLQJ VLWH &KRP\Q HW DO f &LUFXODU SHUPXWDWLRQ DQDO\VLV ZLWK WKH SHUPXWDWLRQ YHFWRU S&< UHYHDOHG WKDW P7(5) ERXQG WR LWV '1$ ELQGLQJ VLWH LQGXFHV EHQGLQJ LQ WKH '1$ KHOL[ ZLWK D EHQGLQJ DQJOH RI r 6KDQJ DQG &OD\WRQ f +HQFH ELQGLQJ RI P7(5) WR LWV FRJQDWH VLWH LQGXFHV D ORFDOL]HG FRQIRUPDWLRQDO FKDQJH LQ PW'1$ ,W LV SRVVLEOH WKDW WKLV '1$ FRQIRUPDWLRQDO FKDQJH PD\ EH FRQWULEXWLQJ VLJQLILFDQWO\ WR WKH WHUPLQDWLRQ SKHQRPHQRQ VSRQVRUHG E\ P7(5) +RZHYHU LQ YLYR HYLGHQFH IRU '1$ EHQGLQJ E\ WKLV SURWHLQ LV QRW DYDLODEOH \HW ,W LV DOVR QRW NQRZQ LI WKLV SURWHLQ LV FRQVWLWXWLYHO\ ERXQG WR LWV FRJQDWH VLWH DW DOO WLPHV RU ZKHWKHU LW LV

PAGE 125

RQO\ UHFUXLWHG WR LWV VLWH GXULQJ DFWLYH WUDQVFULSWLRQ DORQJ ZLWK WKH DVVHPEO\ RI WKH WUDQVFULSWLRQ PDFKLQHU\ 7KH ;HQRSXV ODHYLV HPEU\RJHQHVLV PRGHO DIIRUGV WKH XQLTXH RSSRUWXQLW\ WR DWWHPSW WR DQVZHU VRPH RI WKHVH TXHVWLRQV 7KHUH DUH GUDPDWLF FKDQJHV LQ JHQH H[SUHVVLRQ RI PLWRFKRQGULD GXULQJ HDUO\ GHYHORSPHQW ZLWK WUDQVFULSWLRQ EHLQJ EDVDO XQWLO WKH ILUVW KRXUV RI HPEU\RJHQHVLV DIWHU ZKLFK DFWLYH WUDQVFULSWLRQ UHVXPHV LQ WKH HPEU\R GLVFXVVHG LQ FKDSWHU f GXULQJ D WLPH ZKHQ PW'1$ UHSOLFDWLRQ LV QRW DFWLYH &KDVH DQG 'DZLG f 7KHUHIRUH WUDQVFULSWLRQ LV GHFRXSOHG IURP UHSOLFDWLRQ RI PW'1$ GXULQJ WKLV WLPH D VLWXDWLRQ QRW HDVLO\ REWDLQHG LQ RWKHU DYDLODEOH PRGHO V\VWHPV ZKHUH UHSOLFDWLRQ DQG WUDQVFULSWLRQ RI PW'1$ DUH PRUH RU OHVV FRQVWLWXWLYH DQG VLPXOWDQHRXV 7KH VSHFLILF DLP RI WKH H[SHULPHQWV GHVFULEHG LQ WKH IROORZLQJ VHFWLRQV ZDV WR SHUIRUP LQ YLYR IRRWSULQWLQJ RI PW'1$ WR ORRN IRU FKDQJHV LQ SURWHLQ'1$ LQWHUDFWLRQV FRUUHOHWHG ZLWK FKDQJHV LQ WKH WUDQVFULSWLRQDO VWDWXV RI WKH PLWRFKRQGULD 7KH VSHFLILF UHJLRQV RI PW'1$ ZKLFK ZHUH DQDO\]HG LQFOXGHG WKH 'ORRS XSVWUHDP UHJLRQ KRXVLQJ WKH FULWLFDO FLV HOHPHQWV LQYROYHG LQ WUDQVFULSWLRQ DQG UHSOLFDWLRQf DQG WKH P7(5) ELQGLQJ VLWH ,W ZDV KRSHG WKDW WKHVH

PAGE 126

DQDO\VHV ZRXOG OHQG PRUH LQVLJKW LQWR WKH UROHV SOD\HG E\ WKH PW7)$ DQG P7(5) SURWHLQ LQ WKH UHJXODWLRQ RI WUDQVFULSWLRQ 5HVXOWV ,Q 2UJDQHOOR )RRWSULQWLQJ RI WKH '/RRS 8SVWUHDP 5HJLRQ ,Q YLYR IRRWSULQWLQJ LV D SRZHUIXO WHFKQLTXH WR LQYHVWLJDWH '1$ SURWHLQ LQWHUDFWLRQV LQ OLYLQJ FHOOV 1LFN DQG *LOEHUW &KXUFK HW DO f ,Q RUJDQHOOR IRRWSULQWLQJ WR VWXG\ SURWHLQPLWRFKRQGULDO '1$ LQWHUDFWLRQV LQ LVRODWHG RUJDQHOOHV ZDV GHYHORSHG LQ RXU ODERUDWRU\ *KLYL]]DQL HW DO f DGDSWHG WKLV SURWRFRO WR ;HQRSXV ODHYLV IRU ERWK LQ RUJDQHOOR IRRWSULQW DQDO\VLV RI LVRODWHG RYDU\ PLWRFKRQGULD DV ZHOO DV LQ YLYR IRRWSULQW DQDO\VLV RI HJJV DQG HPEU\RV $PPLQL HW DO f 7KH WHFKQLFDO VWHSV LQYROYHG LQ LQ YLYR IRRWSULQWLQJ XVLQJ GLPHWK\O VXOIDWH '06f D VPDOO UDSLGO\ GLIIXVLEOH PROHFXOH DUH RXWOLQHG LQ )LJXUH ,Q VWHS D K\SRWKHWLFDO SURWHLQ'1$ LQWHUDFWLRQ LV VFKHPDWL]HG :KHQ FHOOV DUH WUHDWHG ZLWK '06 JHQRPLF '1$ LV PHWK\ODWHG DW WKH 1 SRVLWLRQ RI JXDQLQHV DQG 1 SRVLWLRQ RI DGHQLQHV 0HWK\ODWLRQ WLPHV DQG FRQFHQWUDWLRQV DUH YDULHG VR DV WR REWDLQ D SDUWLDO PHWK\ODWLRQ RI WKH UHVLGXHV DV LQ

PAGE 127

)LJXUH *HQHUDO VFKHPH IRU LQ YLYR '1$ IRRWSULQWLQJ '1$ LV PHWK\ODWHG DW WKH 1 SRVLWLRQ RI JXDQRVLQH DQG WKH 1 SRVLWLRQ RI DGHQRVLQH LQ YLYR RU LQ RUJDQHOOR E\ GLPHWK\O VXOIDWH '06f WUHDWPHQW RI LQWDFW FHOOV RU LVRODWHG PLWRFKRQGULD %LQGLQJ RI D SURWHLQ LQ YLYR ZRXOG OHDG WR HLWKHU SURWHFWLRQ RU K\SHUVHQVLWLYLW\ RI WKH FRUUHVSRQGLQJ UHVLGXH LQ JHQRPLF '1$ 7KH '06 WUHDWHG PLWRFKRQGULDO '1$ LV WKHQ LVRODWHG DQG FXW ZLWK D VXLWDEOH UHVWULFWLRQ HQ]\PH WR SURYLGH D UHIHUHQFH SRLQW IRU GHWHFWLRQ E\ 6RXWKHUQ EORWWLQJ )RU SULPHU H[WHQVLRQ IRRWSULQWLQJ WKH UHIHUHQFH SRLQW LV SURYLGHG E\ WKH SULPHU DQQHDOLQJ VLWH 8QPRGLILHG JHQRPLF '1$ LV LVRODWHG LQ SDUDOOHO E\ VLPLODU SURFHGXUHV DQG WKH QDNHG '1$ LV '06 PRGLILHG LQ HPSLULFDO UHDFWLRQV WLOO SDWWHUQV PDWFKLQJ LQ YLYR PHWK\ODWLRQ DUH REWDLQHG 0RGLILHG LQ YLYR DQG QDNHG '1$ DUH WKHQ FOHDYHG DW WKH PHWK\ODWHG UHVLGXHV WR JHQHUDWH WKH IRRWSULQW ODGGHU E\ SLSHULGLQH WUHDWPHQW DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH IRRWSULQW ODGGHU LV WKHQ GHWHFWHG E\ UXQQLQJ WKH FOHDYHG LQ YLYR DQG QDNHG '1$ LQ SDUDOOHO ODQHV RI D b VHTXHQFLQJ JHO DQG 6RXWKHUQ EORWWLQJ ZLWK VKRUW ULERSUREHV QW ORQJf K\EULGL]LQJ QHDU WKH UHIHUHQFH SRLQW :KHQ VWDUWLQJ PDWHULDO LV ORZ DV ZLWK IHUWLOL]HG HPEU\RVf DQ DOWHUQDWLYH PHWKRG RI GHWHFWLRQ LV HPSOR\HG 7KH FOHDYHG IRRWSULQW ODGGHU LV OLQHDUO\ DPSOLILHG IRU F\FOHV ZLWK 7DT '1$ SRO\PHUDVH XVLQJ D 3HQG ODEHOHG SULPHU DQQHDOLQJ WR WKH UHIHUHQFH SRLQW 7KH SULPHU H[WHQVLRQ UHDFWLRQV DUH WKHQ UHVROYHG RQ D b VHTXHQFLQJ JHO DQG DXWRUDGLRJUDSKHG WR REWDLQ WKH LQ YLYR IRRWSULQW SDWWHUQ 7KH ILOOHG VTXDUH VKRZQ DERYH WKH VHTXHQFLQJ JHO UHIHUV WR DQ H[DPSOH RI D '06 K\SHUVHQVLWLYH EDQG DQG WKH RSHQ FLUFOH WR D '06SURWHFWHG EDQG

PAGE 128

6HTXHQFLQJ JHO

PAGE 129

WKH *VSHFLILF VHTXHQFLQJ UHDFWLRQ RI WKH 0D[DP*LOEHUW VHTXHQFLQJ SURWRFRO 0D[DP DQG *LOEHUW f 7KH 1 SRVLWLRQ RI JXDQLQH LV GLUHFWHG WRZDUGV WKH PDMRU JURRYH RI '1$ DQG LV IUHTXHQWO\ FRQWDFWHG E\ VHTXHQFHVSHFLILF '1$ELQGLQJ SURWHLQV 7KHUHIRUH D JXDQLQH ZLOO EH PHWK\ODWHG DW D ORZHU IUHTXHQF\ SURWHFWHGf FRPSDUHG WR QHLJKERULQJ JXDQLQHV LQ WKH SUHVHQFH RI WKH ERXQG SURWHLQ +RZHYHU SURWHLQ ELQGLQJ WR '1$ FDQ DOVR UHVXOW LQ PHWK\ODWLRQ DW D KLJKHU IUHTXHQF\ K\SHUVHQVLWLYLW\f FDXVHG E\ HLWKHU D ORFDOL]HG GLVWRUWLRQ RI WKH '1$ VWUXFWXUH E\ SURWHLQ ELQGLQJ RU E\ WUDSSLQJ RI '06 LQ K\GURSKRELF SRFNHWV RI WKH SURWHLQ OHDGLQJ WR ORFDOL]HG KLJKHU FRQFHQWUDWLRQV 7R LGHQWLI\ WKHVH fSURWHFWHGf RU fK\SHUVHQVLWLYHf UHVLGXHV GXH WR PLFURVHTXHQFH HQYLURQPHQW FRQWURO UHDFWLRQV DUH FDUULHG RXW LQ SDUDOOHO HLWKHU ZLWK FHOOV WKDW VHUYH DV D FRQWURO IRU WKH HIIHFW WR EH REVHUYHG HJ XQIHUWLOL]HG HJJV YV GHYHORSLQJ HPEU\RV GHULYHG E\ IHUWLOL]DWLRQ RI WKH VDPH EDWFK RI HJJVf RU ZLWK SURWHLQIUHH JHQRPLF '1$ ZKLFK LV PHWK\ODWHG LQ YLWUR $IWHU PHWK\ODWLRQ JHQRPLF '1$ LV SXULILHG IURP WKH FRQWURO DQG WHVW VDPSOHV DQG FXW ZLWK D VXLWDEOH UHVWULFWLRQ HQ]\PH WR FUHDWH D UHIHUHQFH SRLQW IRU FRPSDULVRQ 7KHQ WKH '1$ VDPSOHV DUH FOHDYHG DW WKH PRGLILHG QXFOHRWLGHV XVLQJ SLSHULGLQH ZKLFK UHPRYHV WKH

PAGE 130

PHWK\ODWHG EDVH DQG EUHDNV WKH SKRVSKDWH EDFNERQH DW WKH VLWH RI ORVV RI WKH EDVH 0D[DP DQG *LOEHUW f JLYLQJ WKH IDPLO\ RI IUDJPHQWV WKH IRRWSULQW ODGGHUf GHULYHG E\ SDUWLDO PHWK\ODWLRQ VWHS f 7KH IRRWSULQW ODGGHUV IURP WKH FRQWURO DQG WHVW VDPSOHV DUH WKHQ UHVROYHG RQ D b SRO\DFU\ODPLGH0 XUHD JHO WUDQVIHUUHG WR Q\ORQ PHPEUDQH E\ YDFXXP WUDQVIHU /RSH] HW DO f DQG GHWHFWHG E\ K\EULGL]DWLRQ ZLWK UDGLRODEHOHG ULERSUREHV K\EULGL]LQJ QHDU WKH UHIHUHQFH SRLQW &RPSDULVRQ RI WKH WHVW ODQHV LQ YLYR '1$f ZLWK WKH FRQWURO ODQHV QDNHG '1$f LQ VWHS DOORZV WKH LGHQWLILFDWLRQ RI WKH K\SHUVHQVLWLYH ILOOHG VTXDUHf DQG SURWHFWHG RSHQ FLUFOHf UHVLGXHV ,Q RUGHU WR ORRN IRU GLIIHUHQFHV LQ SURWHLQ'1$ LQWHUDFWLRQV LQ WKH UHJXODWRU\ UHJLRQ RI ;HQRSXV PW'1$ GXULQJ EDVDO DQG DFWLYDWHG WUDQVFULSWLRQ LW LV ILUVW HVVHQWLDO WR HVWDEOLVK WKH SDWWHUQ RI IRRWSULQWLQJ VHHQ LQ WKH 'ORRS UHJLRQ 7R VWDQGDUGL]H WKH PHWKRG LW ZDV HVVHQWLDO WR REWDLQ PLWRFKRQGULD LQ ODUJH TXDQWLWLHV 7KH RYDU\ LV D WLVVXH ULFK LQ PLWRFKRQGULD ZLWK WKRXVDQGV RI RRF\WHV LQ GLIIHUHQW VWDJHV RI GHYHORSPHQW D ODUJH SURSRUWLRQ RI ZKLFK DUH PDWXUH RRF\WHV +HQFH PLWRFKRQGULD ZHUH LVRODWHG IURP ;HQRSXV RYDULHV DQG SURFHVVHG IRU LQ RUJDQHOOR IRRWSULQWLQJ DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH UHVXOWV RI VXFK DQ DQDO\VLV IRU ERWK WKH + DQG /

PAGE 131

VWUDQG RI WKH SURPRWHU UHJLRQ DQG WKH 'ORRS XSVWUHDP UHJLRQ DUH VKRZQ LQ )LJXUH DQG )LJXUH 5HODWLYH WR WKH QDNHG '1$ FRQWUROV ODQHV ODEHOHG f&ff PXOWLSOH VLWHV RI DOWHUHG PHWK\ODWLRQ ZHUH UHDGLO\ GHWHFWHG LQ RUJDQHOOR ODQHV ODEHOHG 7ff LQ WKLV FULWLFDO VWUHWFK RI PW'1$ 0LWRFKRQGULDO WUDQVFULSWLRQ LQ ;HQRSXV ODHYLV LQLWLDWHV IURP WZR ELGLUHFWLRQDO SURPRWHUV VSDFHG ES DSDUW %RJHQKDJHQ DQG
PAGE 132

)LJXUH ,Q RUJDQHOOR IRRWSULQW RI WKH SURPRWHU UHJLRQ 0LWRFKRQGULD ZHUH LVRODWHG IURP ; ODHYLV RYDU\ DQG '06 WUHDWHG LQ RUJDQHOOR 8QWUHDWHG PLWRFKRQGULD ZHUH XVHG WR LVRODWH PW'1$ DQG '06 WUHDWHG LQ YLWUR %RWK LQ RUJDQHOOR DQG LQ YLWUR PHWK\ODWHG PW'1$ ZHUH FXW ZLWK $YDLO WR SURYLGH D UHIHUHQFH SRLQW DW SRVLWLRQ RI WKH ; ODHYLV JHQRPH FOHDYHG ZLWK SLSHULGLQH DQG SURFHVVHG IRU HOHFWURSKRUHVLV DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH FOHDYHG '1$ VDPSOHV ZHUH WKHQ UXQ RQ b VHTXHQFLQJ JHOV EORWWHG WR Q\ORQ PHPEUDQHV SUREHG ZLWK ULERSUREHV VSHFLILF WR WKH SURPRWHU UHJLRQ DQG DXWRUDGLRJUDSKHG GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGVf 7KH ODQHV ODEHOHG f&f FRUUHVSRQG WR LQ YLWUR PHWK\ODWHG QDNHG PW'1$ ZKHUHDV ODQHV ODEHOHG f7f UHIHUV WR LQ RUJDQHOOR PHWK\ODWHG PW'1$ 1XFOHRWLGH QXPEHULQJ FRUUHVSRQGV WR WKH VHTXHQFH UHSRUWHG E\ 5RH HW DO f 7KH UHJLRQ RI WKH /VWUDQG SURPRWHUV /63f DUH LQGLFDWHG E\ WKH JUH\ EDUV DQG WKH +VWUDQG SURPRWHUV +63f E\ WKH EODFN EDUV 7KH GLUHFWLRQ RI WUDQVFULSWLRQ LV LQGLFDWHG E\ WKH DUURZV 7KH UHVLGXHV SURWHFWHG RSHQ FLUFOHVf RU K\SHUVHQVLWLYH ILOOHG VTXDUHVf WR '06 PHWK\ODWLRQ DUH LQGLFDWHG 7KH VWLSSOHG EDUV RQ WKH ULJKW VLGH RI WKH ILJXUH FRUUHVSRQG WR WKH UHJLRQV IRRWSULQWHG E\ [OPW7)$ LQ WKH LQ YLWUR '1$VH IRRWSULQWV UHSRUWHG E\ $QWRVFKHFKNLQ DQG %RJHQKDJHQ f 1RWH WKH FRUUHVSRQGHQFH EHWZHHQ WKH LQ YLWUR '1$VH IRRWSULQW RI [OPW7)$ DQG WKH LQ RUJDQHOOR '06 IRRWSULQW VXJJHVWLQJ WKDW WKH PDMRULW\ RI WKH '1$SURWHLQ LQWHUDFWLRQV GHWHFWHG LQ WKH LQ RUJDQHOOR IRRWSULQW DUH GXH WR ELQGLQJ RI [OPW7)$ WR PW'1$ LQ YLYR

PAGE 133

+675$1' & 7 7 & /675$1' & 7 7 & f§ f§ f§ f§ W /63 $ /63 f§ ,Q YLWUR '1$DVH IRRWSULQW RI [OPW7)$

PAGE 134

)LJXUH ,Q RUJDQHOOR IRRWSULQWLQJ RI WKH ',RRS XSVWUHDP UHJLRQ 2YDU\ PW'1$ ZDV SURFHVVHG IRU LQ RUJDQHOOR IRRWSULQWLQJ DV GHVFULEHG LQ WKH OHJHQG WR )LJXUH H[FHSW WKDW WKH PW'1$ VDPSOHV ZHUH FXW ZLWK +DHOOO WR SURYLGH D UHIHUHQFH SRLQW DW QXFOHRWLGH RI WKH ; ODHYLV JHQRPH 5RH HW DO f DQG WKH 6RXWKHUQ EORWV ZHUH SUREHG ZLWK UDGLRODEHOHG ULERSUREHV VSHFLILF WR WKH &6% UHJLRQ /DQHV f&f FRUUHVSRQG WR LQ YLWUR PHWK\ODWHG QDNHG PW'1$ ZKHUHDV ODQHV ODEHOHG 7f UHIHU WR LQ RUJDQHOOR PHWK\ODWHG PW'1$ 1XFOHRWLGH QXPEHULQJ FRUUHVSRQGV WR WKH VHTXHQFH UHSRUWHG E\ 5RH HW DO f *HQRPLF ODQGPDUNV DQG FULWLFDO FLVHOHPHQWV DUH LQGLFDWHG 7KH UHVLGXHV SURWHFWHG RSHQ FLUFOHVf RU K\SHUVHQVLWLYH ILOOHG VTXDUHVf WR '06 PHWK\ODWLRQ DUH LQGLFDWHG 7KH EDUV RQ WKH ULJKW VLGH RI WKH ILJXUH FRUUHVSRQGV WR WKH UHJLRQV IRRWSULQWHG E\ [O PW7)$ LQ LQ YLWUR '1$VH IRRWSULQWV UHSRUWHG E\ $QWRVFKHFKNLQ DQG %RJHQKDJHQ f 1RWH WKH FRUUHVSRQGHQFH EHWZHHQ WKH LQ YLWUR '1$VH IRRWSULQW RI [OPW7)$ DQG WKH LQ RUJDQHOOR '06 IRRWSULQW VXJJHVWLQJ WKDW WKH PDMRULW\ RI WKH '1$SURWHLQ LQWHUDFWLRQV GHWHFWHG LQ WKH LQ RUJDQHOOR IRRWSULQW DUH GXH WR ELQGLQJ RI [OPW7)$ WR PW'1$ LQ YLYR

PAGE 135

+675$1' & 7 7 & /675$1' ‘ (:0& 352027(5 &6% f§ /675$1' & 7 7 & r ‘ ,77` L f§ f§ 'LRRS U n HQG r f§ f§ ,Q YLWUR '1$DVH IRROSULQW RI [OPW7)$

PAGE 136

DQG VKRZHG DOWHUHG PHWK\ODWLRQ UHDFWLYLWLHV )LJXUH f %RWK RI WKHVH UHJLRQV ZHUH IRRWSULQWHG E\ WKH PLWRFKRQGULDO WUDQVFULSWLRQ IDFWRU [OPW7)$f LQ LQ YLWUR '1$VH IRRWSULQWV UHSRUWHG E\ $QWRVFKHFKNLQ DQG %RJHQKDJHQ f VKRZQ DV WKH VWLSSOHG EDUV RQ WKH ULJKW VLGH RI )LJXUH )RRWSULQWLQJ RI WKH UHJLRQ GRZQVWUHDP RI /63 VKRZLQJ WKH FRQVHUYHG VHTXHQFH ER[HV DQG &6% f DQG WKH WZR PDMRU UHSOLFDWLRQ VWDUW VLWHV RI ORRS '1$ &DLUQV DQG %RJHQKDJHQ f DUH VKRZQ LQ )LJXUHV DQG 7KHUH LV D VSDFLQJ RI ES EHWZHHQ /63 DQG &6% DQG WKUHH EORFNV RI IRRWSULQWHG UHVLGXHV >EHWZHHQ UHVLGXHV DQG DQG ILJXUH f DQG EHWZHHQ DQG )LJXUH f@ ZHUH GHWHFWHG LQ ERWK VWUDQGV 0XOWLSOH VLWHV RI DOWHUHG PHWK\ODWLRQ ZHUH DOVR FOHDUO\ VHHQ )LJXUH f EHWZHHQ WKH FRQVHUYHG VHTXHQFH ER[HV &6%Vf ERWK EHWZHHQ &6% DQG &6% VSDFHG ES DSDUWf DQG EHWZHHQ &6% DQG &6% VSDFHG ES DSDUWf 1RWH WKDW WKH KLJKO\ *ULFK &6% ZDV GHYRLG RI DQ\ IRRWSULQWV %XW &6% VKRZHG D SUHGRPLQDQW SDWWHUQ RI SURWHFWLRQ RQ WKH +VWUDQG LQ FRQWUDVW WR K\SHUVHQVLWLYLW\ RQ WKH / VWUDQG $JDLQ WKHUH LV YHU\ JRRG FRUUHVSRQGHQFH EHWZHHQ WKH LQ YLWUR '1$VH IRRWSULQW SDWWHUQ RI [OPW7)$ )LJXUH ORQJLWXGLQDO

PAGE 137

EDUV RQ WKH ULJKWf DQG WKH LQ RUJDQHOOR IRRWSULQWV VHHQ LQ )LJXUH ERWK LQ SRVLWLRQ DQG H[WHQW 7KH FRPSDULVRQ RI IRRWSULQW SDWWHUQV VHHQ LQ )LJXUHV DQG ZLWK WKH LQ YLWUR ELQGLQJ SDWWHUQ RI [O PW7)$ $QWRVFKHFKNLQ DQG %RJHQKDJHQ f VWURQJO\ VXJJHVWV WKDW WKH SURWHLQ'1$ LQWHUDFWLRQV GHWHFWHG E\ LQ RUJDQHOOR IRRWSULQWLQJ DUH SULPDULO\ GXH WR WKH ELQGLQJ RI [OPW7)$ WR PW'1$ LQ YLYR %DVHG RQ WKH LQ RUJDQHOOR IRRWSULQWV )LJXUHV DQG f D VFKHPDWLF UHSUHVHQWDWLRQ RI SURWHLQ'1$ LQWHUDFWLRQV LQ WKH 'ORRS XSVWUHDP UHJLRQ LV SUHVHQWHG LQ )LJXUH 7KH ELQGLQJ SDWWHUQ RI [OPW7)$ ZDV SHULRGLF RU SKDVHG ZLWK UHJLRQV RI H[WHQVLYH SURWHLQ '1$ LQWHUDFWLRQV DQG FHUWDLQ ]RQHV RI H[FOXVLRQ 7KH &ULFK UHJLRQV OLNH &6% DQG &6% ZHUH XQERXQG %LQGLQJ ZDV VWURQJ EHWZHHQ WKH FLVHOHPHQWV LQ WKLV FULWLFDO VWUHWFK RI PW'1$ %LQGLQJ ZDV DOVR GHSHQGHQW RQ WKH H[LVWHQFH RI D PLQLPXP VSDFLQJ RI a ES EHWZHHQ WKH HOHPHQWV EHWZHHQ &6% DQG &6% DQG EHWZHHQ WKH WZR ELn GLUHFWLRQDO SURPRWHUVf 7KH ES VSDFLQJ EHWZHHQ /63 DQG &6% DOORZHG DW OHDVW XQLWV RI LQWHUDFWLRQV +HQFH OLNH LWV FRXQWHUSDUWV LQ \HDVW FRZ DQG KXPDQ PLWRFKRQGULD 'LIIOH\ DQG 6WLOOPDQ *KLYL]]DQL HW DO f WKH ;HQRSXV PW7)$ LV LQYROYHG

PAGE 138

)LJXUH 6FKHPDWLF YLHZ RI SURWHLQ'1$ LQWHUDFWLRQV GHWHFWHG E\ LQ RUJDQHOOR IRRWSULQWLQJ RI WKH 'ORRS XSVWUHDP UHJLRQ 7KH FDUWRRQ RQ WRS UHSUHVHQWV WKH 'ORRS UHJLRQ RI ; ODHYLV VKRZLQJ WKH 'ORRS '1$ VROLG OLQHf UHSOLFDWLRQ SULPHU SURYLGHG E\ WUDQVFULSWLRQ IURP WKH /63 GRWWHG OLQHf WKH WKUHH FRQVHUYHG VHTXHQFH ER[HV &6% f DQG WKH WZR ELGLUHFWLRQDO SURPRWHUV 7KH KDWFKHG ER[ EHWZHHQ WKH WZR ELGLUHFWLRQDO SURPRWHUV UHSUHVHQWV WKH FULWLFDO UHJLRQ WR ZKLFK [O PW7)$ JUH\ EOREf ELQGV DQG DFWLYDWHV WUDQVFULSWLRQ ELGLUHFWLRQDOO\ 7KH FDUWRRQ EHORZ LV D EORZXS RI WKH 'ORRS XSVWUHDP UHJLRQ GHSLFWLQJ D VXPPDU\ RI SURWHLQ'1$ LQWHUDFWLRQV GHWHFWHG E\ WKH LQ RUJDQHOOR IRRWSULQW DQDO\VLV VKRZQ LQ )LJXUHV DQG 7KH VSDFLQJ EHWZHHQ WKH &6%V DQG WKH WUDQVFULSWLRQ VWDUW VLWHV DUH VKRZQ E\ WKH EDUV EHORZ %DVHG RQ D FRPSDULVRQ RI WKH LQ RUJDQHOOR IRRWSULQWV ZLWK WKH LQ YLWUR '1$VH IRRWSULQWV RI [OPW7)$ $QWRVFKHFKNLQ DQG %RJHQKDJHQ f WKH fSKDVHGf SDWWHUQ RI ELQGLQJ LQ WKLV UHJLRQ DSSHDUV WR EH SULPDULO\ GXH WR ELQGLQJ RI [OPW7)$ WR PW'1$ 1RWH WKDW D PLQLPXP VSDFLQJ RI ES VHHPV WR DOORZ WKH ELQGLQJ RI RQH XQLW RI PW7)$

PAGE 139

&6% 'ORRS f HQGV /63 +63 0 /63 +63 6£! ?O 2 *! &6% &6% &6% WR RR ES ES ES ES ES

PAGE 140

LQ WKH SDFNDJLQJ RI PW'1$ LQ YLYR IXQFWLRQDOO\ RUJDQL]LQJ WKH UHJXODWRU\ FLV HOHPHQWV LQ WKH PDMRU FRQWURO UHJLRQ ,Q 9LYR )RRWSULQWLQJ 'XULQJ (DUO\ 'HYHORSPHQW RI ;HQRSXV 2QFH WKH SDWWHUQ RI IRRWSULQWLQJ LQ WKH 'ORRS XSVWUHDP UHJLRQ RI ;HQRSXV PW'1$ ZDV HVWDEOLVKHG WKH VWDJH ZDV VHW IRU DGGUHVVLQJ WKH LPSRUWDQW TXHVWLRQ RI ZKHWKHU GLIIHUHQFHV LQ SURWHLQ'1$ LQWHUDFWLRQV FRXOG EH GHWHFWHG GXULQJ WKH UHVXPSWLRQ RI DFWLYH WUDQVFULSWLRQ LQ ; ODHYLV GXULQJ HDUO\ HPEU\RJHQHVLV 7KH PDMRU H[SHULPHQWDO ERWWOHQHFN HQFRXQWHUHG KRZHYHU ZDV RQH RI VHQVLWLYLW\ ZKHUH WKH 6RXWKHUQ EORWWLQJ XVHG LQ WKH DERYH H[SHULPHQWV FRXOG QRW GHWHFW WKH IRRWSULQWV JHQHUDWHG IURP HPEU\RV DW HDFK VWDJH &ROOHFWLQJ WKH HPEU\RV IURP PDQ\ IHPDOH IURJV ZDV DOVR QRW IHDVLEOH GXH WR LQWHUDQLPDO VHTXHQFH KHWHURJHQHLW\ +HQFH DQ DOWHUQDWLYH PHWKRG WR GHWHFW WKH IRRWSULQW ODGGHU KDG WR EH GHYHORSHG 3ULPHU H[WHQVLRQ IRRWSULQWLQJ 3()f LV D 3&5EDVHG LQQRYDWLRQ RULJLQDOO\ GHVFULEHG E\ 6DOX] DQG -RVW D Ef ZKLFK ZDV DGDSWHG WR ;HQRSXV ODHYLV $PPLQL HW DO f ,Q WKLV PHWKRG JHQRPHVSHFLILF SULPHUV ZKLFK SURYLGH WKH UHIHUHQFH SRLQW )LJXUH

PAGE 141

f DUH UDGLRODEHOHG WR D KLJK VSHFLILF DFWLYLW\ DQG XVHG WR SHUIRUP D OLQHDU DPSOLILFDWLRQ RI WKH IRRWSULQW ODGGHU ZLWK 7DT '1$ SRO\PHUDVH LQ D WKHUPDO F\FOHU )ROORZLQJ SULPHU H[WHQVLRQ WKH KHWHURJHQHRXV '1$ SRSXODWLRQ LV VL]HUHVROYHG RQ D VHTXHQFLQJ JHO DQG DXWRUDGLRJUDSKHG WR REWDLQ WKH LQ YLYR IRRWSULQWLQJ SDWWHUQV $GXOW IHPDOH IURJV ZHUH LQGXFHG WR OD\ HJJV WKH HJJV IHUWLOL]HG LQ YLWUR DQG WKH HPEU\RV VWDJHG DW GLVWLQFW GHYHORSPHQWDO VWDJHV DFFRUGLQJ WR 1LHXZNRRS DQG )DEHU f 3URWHLQIUHH PW'1$ XQIHUWLOL]HG HJJV DQG VWDJHG HPEU\RV ZHUH WKHQ SURFHVVHG IRU LQ YLYR IRRWSULQWLQJ E\ SULPHU H[WHQVLRQ IRRWSULQWLQJ DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV ,Q YLYR IRRWSULQWLQJ RI WKH 'ORRS XSVWUHDP UHJLRQ GXULQJ HDUO\ GHYHORSPHQW LV VKRZQ LQ )LJXUH +VWUDQGf DQG )LJXUH /VWUDQGf 7KH WZR SDQHOV FRUUHVSRQG WR WKH HPEU\RV REWDLQHG IURP WZR GLIIHUHQW IHPDOH IURJV 5HJLRQV RI DOWHUHG PHWK\ODWLRQ UHDFWLYLWLHV ZHUH GHWHFWHG EHWZHHQ &6% DQG &6% EHWZHHQ &6% DQG &6% DQG DOVR LQ WKH UHJLRQ XSVWUHDP RI &6% )LJXUH f )RRWSULQWV LQ WKH GHYHORSPHQWDO VWDJHV VKRXOG EH FRPSDUHG WR ERWK QDNHG '1$ ODQHV ODEHOHG &RQWUROf DQG LQ YLYR PHWK\ODWHG HJJ '1$ ODQHV ODEHOHG (JJf 7KH PRVW LPSRUWDQW SRLQW WR HPHUJH IURP D SHUXVDO RI WKHVH IRRWSULQWV LV WKDW D IRRWSULQW

PAGE 142

)LJXUH ,Q YLYR IRRWSULQWLQJ RI WKH +VWUDQG RI 'ORRS XSVWUHDP UHJLRQ GXULQJ HDUO\ GHYHORSPHQW RI ; ODHYLV 8QIHUWLOL]HG HJJV HJJf DQG HPEU\RQLF VWDJHV DW GLIIHUHQW WLPHV SRVWn IHUWLOL]DWLRQ LQGLFDWHG DERYH WKH ODQHVf IURP WZR GLIIHUHQW IHPDOH IURJV ZHUH '06WUHDWHG LQ YLYR DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGVf 0LWRFKRQGULDO '1$ ZDV DOVR LVRODWHG IURP XQIHUWLOL]HG HJJV RI WKH VDPH IHPDOH IURJV DQG '06WUHDWHG LQ YLWUR WR SURYLGH WKH QDNHG '1$ ODQHV FRQWUROf 7KH LQ YLYR DQG LQ YLWUR '06WUHDWHG PW'1$ VDPSOHV ZHUH WKHQ SURFHVVHG IRU IRRWSULQWLQJ E\ SULPHU H[WHQVLRQ DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7DT '1$ SRO\PHUDVH ZDV XVHG IRU OLQHDU DPSOLILFDWLRQ RI WKH IRRWSULQW ODGGHU XVLQJ 3HQG ODEHOHG SULPHU :+ 'HQDWXUDWLRQ ZDV GRQH DW r& IRU PLQ IROORZHG E\ F\FOHV ZLWK WKH SURILOH r& IRU PLQ r& IRU PLQ r& IRU PLQ )ROORZLQJ WKH UHDFWLRQ WKH VDPSOHV ZHUH SKHQRO H[WUDFWHG HWKDQRO SUHFLSLWDWHG UXQ RQ b VHTXHQFLQJ JHOV DQG DXWRUDGLRJUDSKHG 7KH QXFOHRWLGH SRVLWLRQV 5RH HW DO f DUH VKRZQ RQ WKH OHIW VLGH RI WKH ILJXUH DORQJ ZLWK FULWLFDO FLVHOHPHQWV DQG WKH GLUHFWLRQ RI WUDQVFULSWLRQ 2Q WKH ULJKW VLGH UHVLGXHV SURWHFWHG RSHQ FLUFOHVf RU K\SHUVHQVLWLYH ILOOHG VTXDUHVf WR '06 PHWK\ODWLRQ DUH LQGLFDWHG

PAGE 143

+675$1' )URJ )URJ &6% &6% /675$1' 352027(5 9 'ORRS n HQG '/RRS n HQG

PAGE 144

)LJXUH ,Q YLYR IRRWSULQWLQJ RI WKH /VWUDQG RI ',RRS XSVWUHDP UHJLRQ GXULQJ HDUO\ GHYHORSPHQW RI ; ODHYLV 6DPSOHV ZHUH SURFHVVHG H[DFWO\ DV GHVFULEHG IRU WKH IRRWSULQWLQJ RI WKH +VWUDQG LQ WKH OHJHQG WR )LJXUH ZLWK WKH IROORZLQJ GLIIHUHQFHV /LQHDU DPSOLILFDWLRQ RI WKH IRRWSULQW ODGGHU ZDV GRQH XVLQJ 3HQG ODEHOHG SULPHU :+ +HQFH WKH SRODULW\ RI WUDQVFULSWLRQ IURP /63 LV RSSRVLWH WR WKDW LQ )LJXUH 'HQDWXUDWLRQ ZDV GRQH DW r& IRU PLQ IROORZHG E\ F\FOHV ZLWK WKH SURILOH r& IRU PLQ r& IRU PLQ r& IRU PLQ )ROORZLQJ WKH UHDFWLRQ WKH VDPSOHV ZHUH SKHQRO H[WUDFWHG HWKDQRO SUHFLSLWDWHG UXQ RQ b VHTXHQFLQJ JHOV DQG DXWRUDGLRJUDSKHG 1XFOHRWLGH QXPEHULQJ LV DFFRUGLQJ WR 5RH HW DO f 5HVLGXHV SURWHFWHG RSHQ FLUFOHVf RU K\SHUVHQVLWLYH ILOOHG VTXDUHVf WR '06 PHWK\ODWLRQ DUH LQGLFDWHG

PAGE 145

, ,675$1' )URJ )URJ /675$1' 352027(5 f§ &6% f§ } 6 }r Wa &6% f§ f§

PAGE 146

HLWKHU SURWHFWHG RU K\SHUVHQVLWLYHf ZKLFK DSSHDUHG LQ WKH (JJ FRPSDUHG WR FRQWUROf DOVR DSSHDUHG LQ DOO WKH HPEU\RQLF VWDJHV IRU ERWK WKH +VWUDQG )LJXUH f DQG WKH /VWUDQG )LJXUH f 7KH VDPH SKHQRPHQRQ ZDV REVHUYHG LQ WKH IRRWSULQW SDWWHUQV LQ WKH / VWUDQG RI WKH SURPRWHU UHJLRQ )LJXUH f QDPHO\ IRRWSULQWV ZKLFK DSSHDUHG LQ WKH HJJ EHWZHHQ WKH WZR ELGLUHFWLRQDO SURPRWHUV DQG EHWZHHQ /63 DQG &6%f DOVR DSSHDUHG LQ DOO HPEU\RQLF VWDJHV 7KHUH ZHUH QR GLVFHUQLEOH GLIIHUHQFHV LQ SDWWHUQV RI IRRWSULQWLQJ EHWZHHQ WKH VWDJHV ZKHQ WUDQVFULSWLRQ ZDV EDVDO KUf RU DFWLYDWHG KU KU KUf )RRWSULQWLQJ LQ WKLV UHJXODWRU\ UHJLRQ RI PW'1$ IURP WKH SURPRWHU UHJLRQ WR WKH UHSOLFDWLRQ VWDUW VLWHVf KDV EHHQ VKRZQ WR EH SULPDULO\ GXH WR WKH ELQGLQJ RI WKH PW7)$ SURWHLQ WR PW'1$ LQ ;HQRSXV VKRZQ HDUOLHU LQ )LJXUHV DQG $QWRVFKHFKNLQ DQG %RJHQKDJHQ f FRZ *KLYL]]DQL HW DO f \HDVW 'LIIOH\ DQG 6WLOOPDQ f DQG KXPDQ )LVKHU HW DO *KLYL]]DQL HW DO f PLWRFKRQGULD +HQFH WKH PRVW LPSRUWDQW FRQFOXVLRQ WKDW HPHUJHG IURP WKH LQ YLYR IRRWSULQWLQJ DQDO\VLV GXULQJ HDUO\ GHYHORSPHQW RI ; ODHYLV LV WKDW WKH [OPW7)$ DSSHDUV WR EH FRQVWLWXWLYHO\ ERXQG WR WKH PW'1$ VKRZLQJ VLPLODU PHWK\ODWLRQ

PAGE 147

)LJXUH ,Q YLYR IRRWSULQWLQJ RI WKH /VWUDQG RI WKH SURPRWHU UHJLRQ GXULQJ HDUO\ GHYHORSPHQW RI ; ODHYLV 7KH GHYHORSPHQWDO VWDJHV DQG IURJV DUH WKH VDPH DV WKRVH VKRZQ LQ )LJXUHV DQG 6DPSOHV ZHUH SURFHVVHG IRU SULPHU H[WHQVLRQ IRRWSULQWLQJ H[DFWO\ DV GHVFULEHG LQ WKH )LJXUH OHJHQG ZLWK WKH IROORZLQJ FKDQJHV /LQHDU DPSOLILFDWLRQ RI WKH IRRWSULQW ODGGHU ZDV SHUIRPHG XVLQJ 3HQG ODEHOHG SULPHU :+ 'HQDWXUDWLRQ ZDV GRQH DW r& IRU PLQ IROORZHG E\ F\FOHV ZLWK WKH SURILOH r& IRU PLQ r& IRU PLQ r& IRU PLQ )ROORZLQJ WKH UHDFWLRQ WKH VDPSOHV ZHUH SKHQRO H[WUDFWHG HWKDQRO SUHFLSLWDWHG UXQ RQ b VHTXHQFLQJ JHOV DQG DXWRUDGLRJUDSKHG 1XFOHRWLGH QXPEHULQJ LV DFFRUGLQJ WR 5RH HW DO f 7KH SRVLWLRQV DQG GLUHFWLRQ RI WKH WZR ELGLUHFWLRQDO SURPRWHUV DUH DOVR LQGLFDWHG 7KH RSHQ FLUFOHV LQGLFDWH QXFOHRWLGH UHVLGXHV SURWHFWHG IURP '06 PHWK\ODWLRQ

PAGE 148

675$1' )URJ )URJ 2 X X -= F HR f§ 8f 2 &2 A UI ! 8 W  1 0 ,2 f§ Vrm I f§ f§ f§ f§ f§ f§ ‘‘f§

PAGE 149

UHDFWLYLWLHV DQG UHODWLYHO\ HTXLYDOHQW RFFXSDQF\ 7KLV FRQFOXVLRQ VXJJHVWV EXW GRHV QRW GLUHFWO\ SURYH WKDW WKH [OPW7)$ SURWHLQ FRXOG EH SUHVHQW LQ UHODWLYHO\ HTXLYDOHQW FRQFHQWUDWLRQV LQ WKH PLWRFKRQGULD GXULQJ DOO VWDJHV RI GHYHORSPHQW 3URWHLQ'1$ ,QWHUDFWLRQV DW WKH P7(5) (OHPHQW 0LWRFKRQGULDO '1$ IURP WRWDO RYDULHV ZHUH SURFHVVHG IRU IRRWSULQWLQJ E\ PHWK\ODWLRQ LQ RUJDQHOOR DORQJ ZLWK SURWHLQIUHH QDNHG PW'1$ PHWK\ODWHG LQ YLWUR DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH UHIHUHQFH SRLQW LQ PW'1$ ZDV FUHDWHG E\ FOHDYLQJ WKH '1$ ZLWK 6VS, DQG SURELQJ ZLWK P7(5) VSHFLILF ULERSUREHV )LJXUH f 7KH FRUH RI WKH P7(5) HOHPHQW QXFOHRWLGHV f LV D WULGHFDPHU VHTXHQFH &KULVWLDQVRQ DQG &OD\WRQ f ZKLFK VWDUWV MXVW DIWHU WKH 6 U51$ JHQH DQG FRQWLQXHV LQWR WKH f HQG RI WKH W51$OFf JHQH LQ WKH IURJ JHQRPH )RRWSULQWLQJ ZDV FOHDUO\ VHHQ RQ ERWK VWUDQGV LQ WKH P7(5) HOHPHQW LQ RYDU\ PW'1$ )LJXUHV DQG f 2Q WKH /VWUDQG SURWHFWHG UHVLGXHV ZHUH GHWHFWDEOH DW SRVLWLRQV DQG D K\SHUVHQVLWLYH UHVLGXH DW SRVLWLRQ DOO ZLWKLQ WKH WULGHFDPHU VHTXHQFH 2Q WKH +VWUDQG SURWHFWLRQ ZDV VHHQ DW SRVLWLRQV DQG

PAGE 150

)LJXUH ,Q RUJDQHOOR IRRWSULQW RI WKH P7(5) UHJLRQ LQ RYDU\ PW'1$ 0LWRFKRQGULD ZHUH LVRODWHG IURP ; ODHYLV RYDU\ DQG '06 WUHDWHG LQ RUJDQHOOR 8QWUHDWHG PLWRFKRQGULD ZHUH XVHG WR LVRODWH PW'1$ DQG '06 WUHDWHG LQ YLWUR %RWK LQ RUJDQHOOR DQG LQ YLWUR PHWK\ODWHG PW'1$ ZHUH FXW ZLWK 6VS, WR SURYLGH D UHIHUHQFH SRLQW DW QXFOHRWLGH RI WKH ; ODHYLV JHQRPH 5RH HW DO f FOHDYHG ZLWK SLSHULGLQH DQG SURFHVVHG IRU HOHFWURSKRUHVLV DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH FOHDYHG '1$ VDPSOHV ZHUH WKHQ UXQ RQ b VHTXHQFLQJ JHOV EORWWHG WR Q\ORQ PHPEUDQHV SUREHG ZLWK UDGLRODEHOHG ULERSUREHV VSHFLILF WR WKH P7(5) UHJLRQ DQG DXWRUDGLRJUDSKHG GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGVf 7KH ODQHV ODEHOHG f&f FRUUHVSRQG WR LQ YLWUR PHWK\ODWHG QDNHG PW'1$ ZKHUHDV ODQHV ODEHOHG f7f UHIHU WR LQ RUJDQHOOR PHWK\ODWHG PW'1$ 1XFOHRWLGH QXPEHULQJ FRUUHVSRQGV WR WKH VHTXHQFH UHSRUWHG E\ 5RH HW DO f *HQRPLF ODQGPDUNV DQG FULWLFDO FLVHOHPHQWV DUH LQGLFDWHG 7KH UHVLGXHV SURWHFWHG RSHQ FLUFOHVf RU K\SHUVHQVLWLYH ILOOHG VTXDUHVf WR '06 PHWK\ODWLRQ DUH LQGLFDWHG

PAGE 151

W51$H8 6 U51$ ,675$1' +675$1' f§ f§ f§ f§ f§

PAGE 152

)LJXUH 6XPPDU\ RI IRRWSULQWV RQ WKH / DQG +VWUDQG RI WKH P7(5) UHJLRQ RI RYDU\ PW'1$ 7KH P7(5) ELQGLQJ UHJLRQ RI ; ODHYLV PW'1$ LV VKRZQ ZLWK WKH ERXQGDULHV RI 6 U51$ DQG W51$OHf 7KH WULGHFDPHU WHUPLQDWLRQ ER[ LV VKRZQ LQ EROG OHWWHUV KDWFKHG ER[ EHORZf 7KH IRRWSULQWV VHHQ LQ )LJXUH DUH LQGLFDWHG DV SURWHFWHG RSHQ FLUFOHVf RU K\SHUVHQVLWLYH ILOOHG VTXDUHVf UHVLGXHV

PAGE 153

6 U51$ +675$1' 352027(5 51$ OHX 7I 77 7" /VWUDQG *&&&$$*$77$***&7$*&7$*&*72*&$*$*&&7*;7$$7*&;$$$*$&&7$$*&7&77777$7&$***cUS& +VWUDQG &***77&7$$7&&&*$7&*$7&*&$&&;7&7&;*$&&*$77$&*&777&7**$77&*$*$$$$$7$*7&&*$$ $ $ P7(5) ELQGLQJ VLWH

PAGE 154

+\SHUVHQVLWLYH UHVLGXHV DW DQG IODQN WKH ERUGHUV RI WKH WULGHFDPHU VHTXHQFH RQ HLWKHU VLGH 3URWHFWLRQ ZLWKLQ WKH WULGHFDPHU VHTXHQFH DQG K\SHUVHQVLWLYLW\ RQ WKH IODQNV )LJXUH f VXJJHVW D ORFDOL]HG GLVWRUWLRQ RI WKH '1$ VWUXFWXUH 6KDQJ DQG &OD\WRQ f UHSRUWHG WKDW SXULILHG KXPDQ P7(5) SURWHLQ FRXOG EHQG '1$ WR D r DQJOH LQ LQ YLWUR FLUFXODU SHUPXWDWLRQ DVVD\V ,Q FRQFOXVLRQ IRRWSULQWLQJ FRQILUPV WKH LQ YLYR RFFXSDQF\ RI WKH P7(5) HOHPHQW LQ RYDU\ PW'1$ DQG WKH PRGH RI IRRWSULQWLQJ SURYLGHV LQ YLYR FRQILUPDWLRQ RI WKH LQ YLWUR REVHUYDWLRQV RI 6KDQJ DQG &OD\WRQ f WKDW P7(5) SURWHLQ FDXVHV '1$ EHQGLQJ DW LWV ELQGLQJ VLWH 5HODWLYHO\ OLWWOH LV NQRZQ DERXW KRZ WKH P7(5) SURWHLQ FRRUGLQDWHV WUDQVFULSWLRQ WHUPLQDWLRQ ,W LV DOVR QRW NQRZQ ZKHWKHU WKH SURWHLQ LV FRQVWLWXWLYHO\ ERXQG WR LWV WDUJHW VLWH DW DOO WLPHV SRVLQJ D URDGEORFN WR DQ\ DGYDQFLQJ 51$ SRO\PHUDVHV RU ZKHWKHU LW JHWV UHFUXLWHG WR LWV FRJQDWH VLWH RQO\ GXULQJ DFWLYH WUDQVFULSWLRQ LQGHSHQGHQWO\ RU DV D FRPSRQHQW RI WKH WUDQVFULSWLRQ PDFKLQHU\ ,Q YLYR IRRWSULQWLQJ RI WKLV VLWH DFURVV HDUO\ GHYHORSPHQW RI ;HQRSXV GXULQJ ZKLFK PLWRFKRQGULDO WUDQVFULSWLRQ LV FOHDUO\ UHJXODWHGf ZRXOG EH D GLUHFW ZD\ WR ORRN DW WKH RFFXSDQF\ DW WKLV VLWH DQG DQVZHU WKLV TXHVWLRQ )RU WKLV PLWRFKRQGULDO '1$ IURP XQIHUWLOL]HG

PAGE 155

HJJV DQG GLVWLQFW GHYHORSPHQWDO VWDJHV ZHUH SURFHVVHG IRU LQ YLYR IRRWSULQWLQJ DORQJ ZLWK SURWHLQIUHH PW'1$ IURP XQIHUWLOL]HG HJJV PHWK\ODWHG LQ YLWUR DV FRQWUROV 7KH UHVXOWV RI VXFK DQ LQ YLYR IRRWSULQW DQDO\VLV IRU WKH /VWUDQG RI PW'1$ DW WKH P7(5) UHJLRQ DUH VKRZQ LQ )LJXUH &RPSDUHG WR WKH PHWK\ODWLRQ SDWWHUQ RI QDNHG '1$ FRQWURO ODQHVf SURWHFWHG UHVLGXHV ZHUH GHWHFWHG LQ WKH XQIHUWLOL]HG HJJV HJJf DW UHVLGXHV DQG 7KH HPEU\RQLF VWDJHV DOVR VKRZHG VLPLODU SURWHFWLRQV DW WKH VDPH UHVLGXHV ZLWK QR GLVFHUQLEOH GLIIHUHQFHV EHWZHHQ WKH VWDJHV ZKHQ WUDQVFULSWLRQ ZDV EDVDO KUf RU DFWLYDWHG KU KU KUf )RRWSULQWLQJ DW WKH P7(5) UHJLRQ RQ WKH +VWUDQG LV VKRZQ LQ )LJXUH 6WURQJ K\SHUVHQVLWLYH VLWHV ZHUH UHDGLO\ GHWHFWHG DW SRVLWLRQV DQG IODQNLQJ WKH WULGHFDPHU VHTXHQFHf ERWK LQ WKH XQIHUWLOL]HG HJJ DQG DOO WKH HPEU\RQLF VWDJHV 7KLV UHVLGXH ZDV VHHQ WR EH K\SHUVHQVLWLYH HYHQ LQ WKH RYDU\ PW'1$ E\ LQ RUJDQHOOR IRRWSULQWLQJ )LJXUH f 7KH K\SHUVHQVLWLYH EDQG DW PXVW EH GXH WR PHWK\ODWLRQ DQG FOHDYDJH RI WKH $ UHVLGXH DW )LJXUH f RU LW FRXOG EH D SRO\PRUSKLF UHVLGXH LQ WKH IURJV EHLQJ DQDO\]HG DV WKHUH LV QR FRUUHVSRQGLQJ UHVLGXH LQ WKH SXEOLVKHG ; ODHYLV VHTXHQFH RI 5RH HW DO f ,W VKRXOG EH QRWHG WKDW WKHUH ZHUH

PAGE 156

)LJXUH ,Q YLYR IRRWSULQWLQJ RI WKH /VWUDQG RI WKH P7(5) UHJLRQ GXULQJ HDUO\ GHYHORSPHQW RI ; ODHYLV 8QIHUWLOL]HG HJJV HJJf DQG HPEU\RQLF VWDJHV DW GLIIHUHQW WLPHV SRVWn IHUWLOL]DWLRQ LQGLFDWHG DERYH WKH ODQHVf IURP WZR GLIIHUHQW IHPDOH IURJV ZHUH '06 WUHDWHG LQ YLYR DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGVf 0LWRFKRQGULDO '1$ ZDV DOVR LVRODWHG IURP XQIHUWLOL]HG HJJV RI WKH VDPH IHPDOH IURJV DQG '06 WUHDWHG LQ YLWUR WR SURYLGH WKH QDNHG '1$ ODQHV FRQWUROf 7KH LQ YLYR DQG LQ YLWUR '06 WUHDWHG PW'1$ VDPSOHV ZHUH WKHQ SURFHVVHG IRU IRRWSULQWLQJ E\ SULPHU H[WHQVLRQ DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7DT '1$ SRO\PHUDVH ZDV XVHG IRU OLQHDU DPSOLILFDWLRQ RI WKH IRRWSULQW ODGGHU XVLQJ 3HQG ODEHOHG SULPHU :+ 'HQDWXUDWLRQ ZDV GRQH DW r& IRU PLQ IROORZHG E\ F\FOHV ZLWK WKH SURILOH r& IRU PLQ r& IRU PLQ r& IRU PLQ )ROORZLQJ WKH UHDFWLRQ WKH VDPSOHV ZHUH SKHQRO H[WUDFWHG HWKDQRO SUHFLSLWDWHG UXQ RQ b VHTXHQFLQJ JHOV DQG DXWRUDGLRJUDSKHG 7KH QXFOHRWLGH SRVLWLRQV 5RH HW DO f DUH VKRZQ DORQJ ZLWK WKH WULGHFDPHU P7(5) HOHPHQW QXFOHRWLGHV f DQG WKH GLUHFWLRQ RI WUDQVFULSWLRQ 5HVLGXHV SURWHFWHG RSHQ FLUFOHVf IURP '06 PHWK\ODWLRQ DUH LQGLFDWHG

PAGE 157

, 675$1' )URD )URJ +675$1' 352027(5 SL IDLU} 6 U51$ OHX W51$ f§ rfr }‘ f n f§ n f§r XQf§L r 00+ f§ &7 r f§D rrf§ P rff IF r rV D"V U fr 7 3L SD 0 DZ +

PAGE 158

)LJXUH ,Q YLYR IRRWSULQWLQJ RI WKH +VWUDQG RI WKH P7(5) UHJLRQ GXULQJ HDUO\ GHYHORSPHQW RI ; ODHYLV 6DPSOHV ZHUH SURFHVVHG H[DFWO\ DV GHVFULEHG IRU WKH IRRWSULQWLQJ RI WKH / VWUDQG LQ WKH OHJHQG WR )LJXUH ZLWK WKH IROORZLQJ GLIIHUHQFHV /LQHDU DPSOLILFDWLRQ RI WKH IRRWSULQW ODGGHU ZDV GRQH XVLQJ 3HQG ODEHOHG SULPHU :+ +HQFH WKH SRODULW\ RI WUDQVFULSWLRQ IURP +63 LV RSSRVLWH WR WKDW LQ )LJXUH 'HQDWXUDWLRQ ZDV GRQH DW r& IRU PLQ IROORZHG E\ F\FOHV ZLWK WKH SURILOH r& IRU PLQ r& IRU PLQ r& IRU PLQ )ROORZLQJ WKH UHDFWLRQ WKH VDPSOHV ZHUH SKHQRO H[WUDFWHG HWKDQRO SUHFLSLWDWHG UXQ RQ b VHTXHQFLQJ JHOV DQG DXWRUDGLRJUDSKHG 1XFOHRWLGH QXPEHULQJ LV DFFRUGLQJ WR 5RH HW DO f 7KH WULGHFDPHU P7(5) HOHPHQW QXFOHRWLGHV f LV LQGLFDWHG E\ WKH ILOOHG ER[ 5HVLGXHV K\SHUVHQVLWLYH ILOOHG VTXDUHVf WR '06 PHWK\ODWLRQ DUH LQGLFDWHG

PAGE 159

2V A W UR f§L 2n FR RR W\L I W fIFr 8 YR 8PP f Q }W }L }r rf D Lf cDL 0O 6L XEL &RQWURO rI } L P ‘ 8 U LU (JJ Q L V LU KU cPL rU " Q m D L VL QL DL KU P L f £ m / LO / &RQWURO cPL M/ L-L ;@ 3c D L LW M (JJ ‘ r r r } DL KU QD r U L LOL L DL KU 7 fr A mf L 8 L X KU PP .( LL  L L ,, KU R I4 72 II4 1! +675$1'

PAGE 160

GLIIHUHQFHV LQ WKH GHJUHH RI PHWK\ODWLRQ K\SHUVHQVLWLYLW\f DW SRVLWLRQV DQG DPRQJ WKH GLIIHUHQW GHYHORSPHQWDO VWDJHV 7KH LPSOLFDWLRQ RI WKLV LV XQFOHDU DW WKLV OHYHO RI GHWHFWLRQ 7KH UHVROXWLRQ RI WKH H[SHULPHQW ZLWKLQ WKH WULGHFDPHU VHTXHQFH LQ )LJXUH LV QRW DGHTXDWH WR PDNH DQ\ FRQFOXVLRQV DERXW WKH RWKHU UHVLGXHV LQ WKLV UHJLRQ ,Q FRQFOXVLRQ LQ RUJDQHOOR IRRWSULQWLQJ FRQILUPV WKH SUHVHQFH RI WKH P7(5) SURWHLQ LQ ; ODHYLV PLWRFKRQGULD IXUWKHU H[WHQGLQJ WKH OLVW RI FRPPRQ FLVHOHPHQWV DQG WUDQVDFWLQJ IDFWRUV LQ IURJ DQG KXPDQ PLWRFKRQGULD &RPSDULVRQ RI WKH LQ YLYR IRRWSULQWV RI WKLV FLV HOHPHQW DFURVV HDUO\ GHYHORSPHQW RI ; ODHYLV VKRZ WKDW WKH P7(5) SURWHLQ LV FRQVWLWXWLYHO\ ERXQG WR LWV FRJQDWH VLWH DW UHODWLYHO\ HTXDO RFFXSDQF\ LQ YLYR DW DOO WLPHV VXJJHVWLQJ WKDW WKH PLWRFKRQGULDO OHYHOV RI WKLV IDFWRU DUH QRW DFWLYHO\ UHJXODWHG GXULQJ GLIIHUHQWLDO WUDQVFULSWLRQDO DFWLYLW\ LQ WKH PLWRFKRQGULD ,Q RUGHU WR FRQILUP IXUWKHU WKH VXJJHVWLRQ WKDW WKH PLWRFKRQGULDO OHYHOV RI WKLV IDFWRU PD\ EH UHODWLYHO\ FRQVWDQW GXULQJ UHJXODWHG WUDQVFULSWLRQ WKH P7(5) SURWHLQ ZDV GHWHFWHG E\ HOHFWURSKRUHWLF PRELOLW\ VKLIW DVVD\V )RU WKLV WKH PHWKRG RI )HUQDQGH]6LOYD HW DO f IRU GHWHFWLQJ WKH SUHVHQFH DQG HVWLPDWLQJ WKH UHODWLYH

PAGE 161

DEXQGDQFH RI KXPDQ P7(5) LQ PLWRFKRQGULDO O\VDWHV ZDV DGDSWHG WR ;HQRSXV PLWRFKRQGULD 6 [ J VXSHUQDWDQWf PLWRFKRQGULDO SURWHLQ H[WUDFWV ZHUH SUHSDUHG E\ O\VLV RI LVRODWHG PLWRFKRQGULD IURP HJJV RU HPEU\RV XVLQJ 7ZHHQ DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH SUREH XVHG IRU WKHVH DVVD\V ZDV D UDGLRODEHOHG ES GV'1$ ZLWK WKH WULGHFDPHU P7(5) VHTXHQFH f7**&$*$*&&7**f FHQWHUHG LQ LW %DQG VKLIW DVVD\V ZLWK XJ RI 6 PLWRFKRQGULDO SURWHLQ H[WUDFW VDWXUDWHV WKH DPRXQW RI SUREH XVHGf SUHSDUHG IURP D KU EO£VWXOD VKRZHG D VLQJOH EDQG VKLIW )LJXUH $ FRPSDUH ODQH WR ODQH f ,Q RUGHU WR FRQILUP WKDW WKH REVHUYHG EDQG VKLIW ZDV GXH WR VSHFLILF ELQGLQJ RI WKH P7(5) SURWHLQ FRPSHWLWLRQ ZLWK VSHFLILF DQG QRQVSHFLILF FRPSHWLWRUV ZDV SHUIRUPHG &RPSHWLWLRQ ZDV GUDVWLF ZLWK WKH FROG FRPSHWLWRU ZKLFK ZDV LGHQWLFDO WR WKH UDGLRODEHOHG SUREH ZLOG W\SHf ZLWK VKLIWV RI b b DQG b RI FRQWUROV ODQHV DQG )LJXUH %f DW DQG IROG PRODU H[FHVV UHVSHFWLYHO\ &RPSHWLWLRQ ZDV OHVV GUDVWLF ZLWK D FROG FRPSHWLWRU EHDULQJ RQH SRLQW PXWDWLRQ $ WR *f DW SRVLWLRQ DQDORJRXV WR WKH KXPDQ 0(/$6 PXWDWLRQ DW SRVLWLRQ f ZLWK VKLIWV RI b DQG b RI FRQWUROV ODQHV DQG )LJXUH %f DW DQG IROG PRODU H[FHVV UHVSHFWLYHO\ ZKHUHDV WKH FRPSHWLWRU DW

PAGE 162

)LJXUH *HO PRELOLW\ VKLIW DVVD\ IRU P7(5) SURWHLQ $ 7KH ES GV'1$ EDQG VKLIW SUREH ZDV V\QWKHVL]HG E\ ILOOLQJ LQ DQQHDOHG :+ PHUf DQG :+ PHUf ROLJRV ZLWK >D 3@G$73 XVLQJ 6HTXHQDVH '1$ SRO\PHUDVH DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV S0RO RI WKH UDGLRODEHOHG SUREH ZDV LQFXEDWHG ZLWK XJ RI WKH 6 PLWRFKRQGULDO SURWHLQ H[WUDFW SUHSDUHG IURP HDUO\ EO£VWXOD KU SRVWIHUWLOL]DWLRQf HPEU\RV IRU PLQ DW URRP WHPSHUDWXUH 7KH VDPSOHV ZHUH WKHQ SODFHG RQ LFH DQG WKH LQGLFDWHG PRODU H[FHVV RI FROG FRPSHWLWRUV DGGHG 7KH ZLOG W\SH FRPSHWLWRU UHIHUV WR WKH QRQUDGLRODEHOHG YHUVLRQ RI WKH SUREH WKH VLQJOH PXWDQW UHIHUV WR WKH ES GV'1$ SUREH ZLWK D VLQJOH PXWDWLRQ DW SRVLWLRQ $ WR *f ZKLFK LV VLPLODU WR WKH 0(/$6 PXWDWLRQ LQ KXPDQ PW'1$ DW *RWR HW DO f DQG WKH WULSOH PXWDQW UHIHUV WR WKH VDPH ES GV'1$ SUREH ZLWK WKUHH FKDQJHV DW SRVLWLRQV W WR $f WR &f DQG $ WR *f $IWHU DGGLWLRQ RI WKH FRPSHWLWRUV WKH VDPSOHV ZHUH JHQWO\ PL[HG DQG LQFXEDWHG DJDLQ DW URRP WHPSHUDWXUH IRU PLQ $IWHU WKH LQFXEDWLRQ WKH VDPSOHV ZHUH NHSW RQ LFH DQG LPPHGLDWHO\ ORDGHG RQWR D b QRQGHQDWXULQJ SRO\DFU\ODPLGHELVDFU\ODPLGH f JHO GULHG DQG DXWRUDGLRJUDSKHG 7KH SRVLWLRQV RI WKH IUHH SUREH DQG WKH VKLIWHG VSHFLHV DUH LQGLFDWHG /DQH VKRZV WKH FRQWURO EDQG VKLIW ZLWKRXW DQ\ DGGHG FRPSHWLWRUV /DQHV DQG VKRZ WKH HIIHFW RI DGGLQJ WKH ZLOGW\SH VLQJOH PXWDQW DQG WULSOH PXWDQW FRPSHWLWRUV UHVSHFWLYHO\ DW WKH LQGLFDWHG PRODU H[FHVV RYHU SUREH % 7KH JHO LQ $ ZDV TXDQWLWDWHG XVLQJ D SKRVSKRULPDJHU 7KH EDQG VKLIW LV H[SUHVVHG DV SHUFHQWDJH RI FRQWURO VHWWLQJ WKH FRQWURO EDQG VKLIW ZLWKRXW FRPSHWLWRUf WR b 7KH b EDQG VKLIW LV SORWWHG DV D IXQFWLRQ RI WKH PRODU H[FHVV RI HDFK FROG FRPSHWLWRU

PAGE 163

$ 3UREH&RPSHWLWRU 0RODU H[FHVVf 0LWRH[W XJf :LOG W\SH 2 A : 0 nf P7(5) VKLIW 6LQJOH 7ULSOH 0XWDQW 0XWDQW &0 &0 Lf§ &0 &0

PAGE 164

% F R 8 65 2 F F P RR :LOG W\SH 6LQJOH PXWDQW 7ULSOH PXWDQW 0RODU H[FHVV RI FROG FRPSHWLWRU 8)LJXUH FRQWLQXHG

PAGE 165

GLG QRW KDYH DQ\ HIIHFW ODQH DQG )LJXUH %f &RPSHWLWLRQ ZDV OHDVW GUDVWLF ZKHQ D FROG FRPSHWLWRU EHDULQJ WKUHH SRLQW PXWDWLRQV LQ WKH FRQVHUYHG WULGHFDPHU VHTXHQFH 7 WR $ DW WR & DW $ WR DW f ZDV XVHG ZLWK VKLIWV RI b DQG b RI FRQWUROV ODQHV DQG )LJXUH %f DW DQG IROG PRODU H[FHVV UHVSHFWLYHO\ ZKHUHDV WKH FRPSHWLWRU DW GLG QRW KDYH DQ\ HIIHFW ODQH DQG )LJXUH %f ,Q FRQFOXVLRQ WKH FRPSHWLWLRQ GDWD VKRZ WKDW WKH REVHUYHG EDQG VKLIW ZDV VSHFLILFDOO\ GXH WR WKH ELQGLQJ RI WKH P7(5) SURWHLQ DQG QRW GXH WR QRQVSHFLILF SURWHLQ'1$ LQWHUDFWLRQV ,Q RUGHU WR LQYHVWLJDWH WKH UHODWLYH DEXQGDQFH RI WKH P7(5) SURWHLQ GXULQJ EDVDO DQG DFWLYDWHG WUDQVFULSWLRQ LQ ; ODHYLV &KDSWHU f IRXU GLVWLQFWLYH GHYHORSPHQWDO VWDJHV ZHUH FKRVHQ IRU DQDO\VLV 0LWRFKRQGULDO WUDQVFULSWLRQ LV EDVDO LQ WKH XQIHUWLOL]HG HJJ DQG HDUO\ EO£VWXOD KU SRVWIHUWLOL]DWLRQf EHFRPHV DFWLYDWHG LQ WKH ODWH QHXUXOD KU SRVWIHUWLOL]DWLRQf DQG LV KLJKO\ DFWLYDWHG LQ WKH KDWFKHG WDGSROH KU SRVWIHUWLOL]DWLRQf 0LWRFKRQGULD ZHUH SUHSDUHG IURP WKHVH HJJV DQG HPEU\RV DQG WKH 6 PLWRFKRQGULDO SURWHLQ H[WUDFWV XVHG WR SHUIRUP EDQG VKLIW DVVD\V DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV )LJXUH $ VKRZV WKH UHVXOWV RI D EDQG

PAGE 166

)LJXUH &RPSDULVRQ RI WKH UHODWLYH DEXQGDQFH RI QL7(5) LQ GLVWLQFW GHYHORSPHQWDO VWDJHV $ S0RO I WKH UDGLRODEHOHG EDQG VKLIW SUREH ZLOG W\SHf ZDV LQFXEDWHG ZLWK LQFUHDVLQJ FRQFHQWUDWLRQV RI WKH 6 PLWRFKRQGULDO SURWHLQ H[WUDFW IRU PLQ DW URRP WHPSHUDWXUH /DQHV DQG UHSUHVHQW WKH IUHH SUREH ZLWKRXW DQ\ DGGHG SURWHLQ /DQHV DQG UHSUHVHQW LQFUHDVLQJ FRQFHQWUDWLRQV RI WKH 6 H[WUDFW DV DQG XJ SHU UHDFWLRQ $IWHU WKH LQFXEDWLRQ WKH VDPSOHV ZHUH NHSW RQ LFH DQG LPPHGLDWHO\ ORDGHG RQWR D b QRQGHQDWXULQJ SRO\DFU\ODPLGH JHO GULHG DQG DXWRUDGLRJUDSKHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH SRVLWLRQV RI WKH IUHH SUREH DQG VKLIWHG VSHFLHV DUH VKRZQ DV DUH WKH GHYHORSPHQWDO VWDJHV RI WKH HPEU\RV XVHG IRU WKLV H[SHULPHQW 7KH WZR VSHFLHV RI EDQGV VHHQ IRU WKH IUHH SUREH DQG WKH EDQG VKLIW UHSUHVHQW LQFRPSOHWH ILOOLQJLQ E\ WKH .OHQRZ '1$ SRO\PHUDVH XVHG LQ WKLV H[SHULPHQW ZKLFK ZDV DOZD\V VHHQ ZKHQ WKLV SRO\PHUDVH ZDV XVHG UHJDUGOHVV RI WKH FRQGLWLRQV WULHG +HQFH 6HTXHQDVH '1$ SRO\PHUDVH 86%$PHUVKDPf ZDV XVHG IRU REWDLQLQJ D VLQJOH SUREH VSHFLHV DV LQ )LJXUH f %XW LW VKRXOG EH QRWHG WKDW WKH UHJLRQ RI P7(5) ELQGLQJ WKH WULGHFDPHU VHTXHQFH LV FRPSOHWHO\ GRXEOHVWUDQGHG HYHQ EHIRUH ILOOLQJLQ ZLWK .OHQRZ IUDJHPHQW DV LW LV SURYLGHG E\ WKH DQQHDOLQJ RI WKH WZR ROLJRQXFOHRWLGHV +HQFH ERWK VKLIWHG EDQGV UHSUHVHQW P7(5) ELQGLQJ % 7KH JHO LQ SDUW $ ZDV TXDQWLWDWHG XVLQJ D SKRVSKRULPDJHU DQG WKH SKRVSKRULPDJHU YROXPH XQLWV DUH SORWWHG DV D IXQFWLRQ RI LQFUHDVLQJ FRQFHQWUDWLRQV RI WKH PLWRFKRQGULDO 6 H[WUDFW

PAGE 167

8QIHU (JJ KU KU KU P7(5) VKLIW A fffLQ 0LOO ,+95 ,56

PAGE 168

$UELWUDU\ XQLWV 0LWRFKRQGULDO 6 H[WUDFW XJf )LJXUH FRQWLQXHG

PAGE 169

VKLIW H[SHULPHQW FDUULHG RXW E\ LQFXEDWLQJ D FRQVWDQW DPRXQW RI SUREH S0RO SHU UHDFWLRQf ZLWK LQFUHDVLQJ DPRXQWV RI WKH 6 PLWRFKRQGULDO O\VDWH IURP IRXU GLVWLQFW GHYHORSPHQWDO VWDJHV 7KH P7(5) EDQG VKLIWV FDQ EH UHDGLO\ GHWHFWHG HYHQ LQ XJ RI WKH 6 H[WUDFW ODQHV RI )LJXUH $f IURP WKH IRXU VWDJHV 3KRVSKRULPDJHU TXDQWLWDWLRQ RI WKH VKLIWHG VSHFLHV DV D IXQFWLRQ RI LQFUHDVLQJ 6 H[WUDFW FRQFHQWUDWLRQ LV VKRZQ LQ )LJXUH % 7KH DEXQGDQFH RI WKH VKLIWHG VSHFLHV LQFUHDVHV ZLWK LQFUHDVLQJ H[WUDFW FRQFHQWUDWLRQ LQ DOO IRXU VWDJHV ZLWK UHODWLYHO\ OLWWOH GLIIHUHQFHV DPRQJ WKHP LQ WKH SDWWHUQ RI VKLIWLQJ 7KH PLQRU GLIIHUHQFHV VHHQ LQ WKH JHO VKLIW SDWWHUQV DPRQJ WKH VWDJHV )LJXUH %f FRXOG EH GXH WR VOLJKW GLIIHUHQFHV LQ WKH DFWXDO DPRXQWV RI PLWRFKRQGULDO SURWHLQ LQ WKH H[WUDFWV GXH WR D FHUWDLQ GHJUHH RI XQDYRLGDEOH FRQWDPLQDWLRQ ZLWK F\WRSODVPLF SURWHLQV $OVR WKH JHO VKLIW DVVD\ LV D PHDVXUH RI RQO\ WKH IXQFWLRQDO FRPSRQHQW RI WKH P7(5) SURWHLQ LQ WKH H[WUDFWV 7KHUHIRUH WKLV PHWKRG LV DW EHVW RQO\ VHPLTXDQWLWDWLYH 1HYHUWKHOHVV LW DOORZV D FRPSDUDWLYH HVWLPDWH RI WKH P7(5) SURWHLQ OHYHOV GXULQJ EDVDO DQG DFWLYDWHG WUDQVFULSWLRQ ZKLFK VXJJHVW WKDW WKH SURWHLQ OHYHOV RI P7(5) DUH QHDUO\ FRQVWDQW GXULQJ D SHULRG RI YDVW FKDQJHV LQ UHJXODWHG WUDQVFULSWLRQ LQ WKH GHYHORSLQJ HPEU\RV

PAGE 170

'LVFXVVLRQ )RRWSULQWLQJ RI WKH '/RRS 8SVWUHDP 5HJLRQ 2QH RI WKH PRVW LPSRUWDQW GHYHORSPHQWV LQ WKH ILHOG RI PLWRFKRQGULDO JHQH UHJXODWLRQ LQ WKLV GHFDGH KDV EHHQ WKH GLVFRYHU\ WKDW WKH PLWRFKRQGULDO WUDQVFULSWLRQ IDFWRU PW7)$f LV QRW RQO\ DQ DFWLYDWRU RI WUDQVFULSWLRQ EXW DOVR D PW'1$ SDFNDJLQJ SURWHLQ LQ \HDVW 'LIIOH\ DQG 6WLOOPDQ f KXPDQ 3DULVL DQG &OD\WRQ )LVKHU HW DO f FRZ *KLYL]]DQL HW DO f DQG ;HQRSXV ODHYLV $QWRVFKHFKNLQ DQG %RJHQKDJHQ WKLV ZRUNf 7KHVH SURWHLQV EHORQJ WR WKH KLJK PRELOLW\ JURXS RI SURWHLQV SRVVHVVLQJ WKH FKDUDFWHULVWLF +LJK 0RELOLW\ *URXS +0*f PRWLI 0RVW RI WKH +0* SURWHLQV DUH DEXQGDQW QRQKLVWRQH QXFOHDU SURWHLQV 7KHVH LQFOXGH PDQ\ '1$ELQGLQJ SURWHLQV LQFOXGLQJ WUDQVFULSWLRQ IDFWRUV VXFK DV WKH QXFOHRODU WUDQVFULSWLRQ IDFWRU K8%) -DQW]HQ HW DO f WKH O\PSKRF\WHVSHFLILF HQKDQFHU ELQGLQJ SURWHLQ /() 7UDYLV HW DO f DQG WKH WHVWLVGHWHUPLQLQJ IDFWRU 65< 6LQFODLU HW DO f ,Q DOO WKHVH FDVHV WKH +0* GRPDLQ VHHPV WR KDYH DQ LQIOXHQFH LQ GLUHFWLQJ WKH PDQLSXODWLRQ RI '1$ VWUXFWXUH E\ EHQGLQJ ZUDSSLQJ RU VXSHUFRLOLQJ '1$ /LOOH\ *URVVFKHGO HW DO f 7KH

PAGE 171

PW7)$ SURWHLQ VDWLVILHV LWV GHVLJQDWLRQ DV DQ +0* SURWHLQ H[KLELWLQJ WKH DELOLW\ WR EHQG DQG ZUDS PW'1$ 'LIIOH\ DQG 6WLOOPDQ )LVKHU HW DO f 7KH VRPHZKDW VXUSULVLQJ REVHUYDWLRQ ZDV WKDW WKLV SURWHLQ NOWKRXJK SRVVHVVLQJ D ORZ VHTXHQFH VSHFLILFLW\ KDG WKH DELOLW\ WR ELQG WR FULWLFDO UHJXODWRU\ UHJLRQV LQ D fSKDVHGf IDVKLRQ ZLWK FHUWDLQ SUHIHUUHG UHJLRQV RI H[FOXVLRQ 'LIIOH\ DQG 6WLOOPDQ )LVKHU HW DO *KLYL]]DQL HW DO f ,Q RUJDQHOOR IRRWSULQWLQJ RI ; ODHYLV RYDU\ PW'1$ UHYHDOHG WKDW SURWHLQ'1$ LQWHUDFWLRQV LQ WKH 'ORRS XSVWUHDP UHJLRQ RI IURJ PW'1$ VHHPHG WR EH KLJKO\ RUGHUHG ZLWK VWURQJ RFFXSDQF\ EHLQJ IRXQG LQ SHULRGLF VWUHWFKHV RI '1$ LQ D QRQUDQGRP IDVKLRQ )LJXUHV DQG f &RQFXUUHQW ZLWK WKLV LQYHVWLJDWLRQ $QWRVFKHFKNLQ DQG %RJHQKDJHQ f FORQHG WKH ;HQRSXV KRPRORJ RI WKH PW7)$ WKH [OPW7)$ DQG IRXQG WKDW WKLV SURWHLQ ELQGV WKH 'ORRS XSVWUHDP UHJLRQ LQ D SKDVHG PDQQHU LQ LQ YLWUR '1$VH IRRWSULQW DVVD\V HDFK ELQGLQJ VLWH VSDQQLQJ DSSUR[LPDWHO\ ES RI '1$ 7KH LQ RUJDQHOOR IRRWSULQWV PLUURUHG WKLV SDWWHUQ DSSHDULQJ DV RQH XQLW RI LQWHUDFWLRQ SHU ES RI '1$ )LJXUH f $ FDUHIXO FRPSDULVRQ RI WKH IRRWSULQWHG UHVLGXHV LQ WKH H[SHULPHQWV RI $QWRVFKHFKNLQ DQG %RJHQKDJHQ f ZLWK WKH LQ YLYR IRRWSULQWV REWDLQHG LQ WKLV ZRUN

PAGE 172

UHYHDOHG D FORVH FRUUHVSRQGHQFH EHWZHHQ WKH WZR ELQGLQJ SDWWHUQV VXJJHVWLQJ WKDW WKH LQ YLYR IRRWSULQWV VHHQ LQ WKLV UHJLRQ RI PW'1$ DUH SULPDULO\ GXH WR WKH [OPW7)$ SURWHLQ $ VLPLODU VFHQDULR KDV EHHQ UHSRUWHG IRU KXPDQ PLWRFKRQGULD ZKHUH WKH LQ YLWUR ELQGLQJ SDWWHUQV RI KPW7)$ FORVHO\ PDWFKHG WKH LQ YLYR IRRWSULQW SDWWHUQ LQ WKH 'ORRS XSVWUHDP UHJLRQ *KLYL]]DQL HW DO )LVKHU HW DO f 7KH VLWXDWLRQ LV OLNHO\ WR EH VLPLODU LQ \HDVW 'LIIOH\ DQG 6WLOOPDQ f DOWKRXJK GLUHFW LQ YLYR HYLGHQFH LV QRW DYDLODEOH DV \HW 7KHUHIRUH WKH SKDVHG ELQGLQJ RI PW'1$ E\ WKH PLWRFKRQGULDO WUDQVFULSWLRQ IDFWRU VHHPV WR EH D SKHQRPHQRQ FRQVHUYHG IURP \HDVW WR PDQ 7KH H[WHQVLYH SURWHLQ'1$ LQWHUDFWLRQV GHWHFWHG E\ LQ RUJDQHOOR IRRWSULQWLQJ DSSHDUHG WR EH VSHFLILF WR WKH 'ORRS XSVWUHDP UHJLRQ 1R IRRWSULQWV ZHUH GHWHFWHG LQ RWKHU UHJLRQV RI ;HQRSXV PW'1$ OLNH WKH RULJLQ RI /VWUDQG '1$ UHSOLFDWLRQ GDWD QRW VKRZQf RYHU VXEVWDQWLDO UHJLRQV RI PW'1$ )LJXUHV DQG f VXUURXQGLQJ WKH UHFRJQLWLRQ VHTXHQFH IRU WKH PLWRFKRQGULDO WUDQVFULSWLRQ WHUPLQDWLRQ IDFWRU P7(5)f DQG LQ UHJLRQV XSVWUHDP RI WKH f HQG RI WKH 'ORRS LQ WKH SXWDWLYH WHUPLQDWLRQ DVVRFLDWHG VHTXHQFH RU 7$6 HOHPHQW GDWD QRW VKRZQf 6LPLODU REVHUYDWLRQV ZHUH PDGH LQ KXPDQ PLWRFKRQGULD

PAGE 173

*KLYL]]DQL HW DO f +RZHYHU WKLV REVHUYDWLRQ LV PRUH VXUSULVLQJ LQ ;HQRSXV ODHYLV GXH WR WKH DSSDUHQWO\ KLJKHU DEXQGDQFH RI [OPW7)$ FRSLHV SHU XQLW PW'1$f LQ WRWDO RYDU\ PLWRFKRQGULD PHDVXUHG E\ $QWRVFKHFKNLQ DQG %RJHQKDJHQ f DV FRPSDUHG WR WKH ORZHU OHYHOV UHSRUWHG IRU KPW7)$ PRQRPHUV SHU XQLW PW'1$f E\ )LVKHU HW DO f 7KLV KLJKHU FRQFHQWUDWLRQ RI [OPW7)$ PROHFXOH RI [OPW7)$ ES RI PW'1$f FRXOG DOORZ H[WHQVLYH FRDWLQJ RI WKH PW'1$ E\ WKLV SURWHLQ ,Q WKLV FRQQHFWLRQ LW LV LPSRUWDQW WR QRWH WKDW WKH [OPW7)$ OHYHOV UHSRUWHG E\ $QWRVFKHFKNLQ DQG %RJHQKDJHQ f ZHUH IURP WRWDO RYDULDQ PLWRFKRQGULD QRW IURP LVRODWHG JHUP OLQH FHOOV $ PLWRFKRQGULDO SUHSDUDWLRQ IURP WRWDO RYDULHV ZRXOG LQFOXGH EHVLGHV VXEVWDQWLDO IROOLFXODU WLVVXH RRF\WHV DW YDULRXV VWDJHV RI GHYHORSPHQW ZLWK HDFK VWDJH EHLQJ GUDPDWLFDOO\ GLIIHUHQW ZLWK UHVSHFW WR WKH RUJDQHOOHV DQG PDFURPROHFXOHV WKH\ DUH VWRFNSLOLQJ IRU ODWHU GHYHORSPHQW 7KLV LQKHUHQW FDYHDW LQ WKH [OPW7)$ OHYHOV UHGXFHV WKH UHOHYDQFH RI WKLV PHDVXUHPHQW HYHQ WKRXJK LW VXJJHVWV WKDW WKH OHYHOV RI PW7)$ LQ ;HQRSXV PLWRFKRQGULD FRXOG EH KLJKHU WKDQ WKDW UHSRUWHG IRU KXPDQ PLWRFKRQGULD ,W LV DOVR QRW NQRZQ LI WKH VDPH OHYHOV ZRXOG EH VHHQ LQ WKH VRPDWLF FHOOV RI ; ODHYLV 1HYHUWKHOHVV WKH LQ RUJDQHOOR

PAGE 174

H[SHULPHQWV GR QRW VXJJHVW H[WHQVLYH FRDWLQJ RI WKH PW'1$ E\ [O PW7)$ EXW FRQILUP WKDW [OPW7)$ ELQGV UDWKHU SUHIHUHQWLDOO\ WR WKH UHJXODWRU\ UHJLRQV RI PW'1$ LQ D SHULRGLF IDVKLRQ 7KH IDFWRUV ZKLFK LQIOXHQFH WKH SHULRGLF ELQGLQJ E\ D UHODWLYHO\ QRQVSHFLILF SURWHLQ OLNH PW7)$ VHHP WR OLH LQ WKH VHTXHQFH RI PW'1$ LWVHOI *&ULFK VHTXHQFHV OLNH &6% DQG &6% VHHP WR EH H[FOXVLRQ VHTXHQFHV )LJXUH f 7KLV VLWXDWLRQ ZDV DOVR VHHQ LQ KXPDQ PLWRFKRQGULD ZKHUH &6% DQG &6% VHHPHG WR EH SRVLWLRQHG DW RFFXSDQF\ PLQLPD *KLYL]]DQL HW DO f ,Q \HDVW SRO\$f VHTXHQFHV SRVLWLRQHG EHWZHHQ VLWHV RI '1$VH SURWHFWLRQ DSSHDUHG WR VHUYH DV QXOO ELQGLQJ GRPDLQV IRU $%) 'LIIOH\ DQG 6WLOOPDQ f ,Q FRQWUDVW WR WKLV H[FOXVLRQ RI ELQGLQJ DW FHUWDLQ VHTXHQFHV WKH VWURQJ DIILQLW\ RI PW7)$ IRU WKH /63 PD\ VHUYH DV DQ DQFKRULQJ VLWH ZLWK WKH RWKHU FRQVHUYHG HOHPHQWV LQ WKLV UHJLRQ VHUYLQJ WR LQFOXGH RU H[FOXGH ELQGLQJ RI WKLV SURWHLQ 7KLV ZRXOG UHVXOW LQ SDFNDJLQJ RI WKH '1$ LQ D SKDVHG PDQQHU *KLYL]]DQL HW DO f VWUDWHJLFDOO\ SRVLWLRQLQJ LPSRUWDQW FLV HOHPHQWV RI UHSOLFDWLRQ DQG WUDQVFULSWLRQ LQ WKH ULJKW FRQIRUPDWLRQ 1RZ WKDW WKH LPSRUWDQFH RI SKDVHG ELQGLQJ E\ WKH PW7)$ KDV EHHQ ZHOO HVWDEOLVKHG LQ D YDULHW\ RI V\VWHPV LW ZRXOG EH LQWHUHVWLQJ

PAGE 175

WR VSHFXODWH ZKHWKHU WKLV UHPDUNDEOH SURWHLQ FDQ DOVR UHJXODWH WUDQVFULSWLRQ LQ PLWRFKRQGULD 5HJXODWLRQ FRXOG EH DFKLHYHG LQ DW OHDVW WZR GLIIHUHQW ZD\V ,Q WKH ILUVW PRGHO WKH fLQ SKDVHf ELQGLQJ RI PW7)$ FRXOG VKLIW fRXW RI SKDVHf LQ UHVSRQVH WR VRPH FHOOXODU VWLPXOXV 7KLV ZRXOG UDSLGO\ VKXW GRZQ WUDQVFULSWLRQUHSOLFDWLRQ VHUYLQJ DV DQ RQRII VZLWFK IRU PLWRFKRQGULDO JHQH H[SUHVVLRQ ,Q WKH VHFRQG PRUH SRSXODU PRGHO &OD\WRQ 'DLUDJKL HW DO f FKDQJHV LQ WKH VWRLFKLRPHWU\ RI PW7)$ WR PW'1$ LQ WKH PLWRFKRQGULD KDYH EHHQ SURSRVHG DV D UHJXODWRU RI WUDQVFULSWLRQ 7KH ILUVW PRGHO LV XQOLNHO\ EHFDXVH RI PXOWLSOH FRQVLGHUDWLRQV )LUVW 'DLUDJKL HW DO f KDYH VKRZQ WKDW LQFUHDVLQJ WKH VSDFLQJ EHWZHHQ WKH /63 DQG WKH PW7)$ VSHFLILF ELQGLQJ VLWH DOVR SURSRUWLRQDWHO\ VKLIWHG WKH K\SHUVHQVLWLYH VLWH FDXVHG E\ PW7)$ ELQGLQJ GHFUHDVLQJ WUDQVFULSWLRQ LQLWLDWLRQ HIILFLHQF\ VKRZLQJ WKDW WKH PW7)$ KDV VWULFW SURPRWHU VSDFLQJ UHTXLUHPHQWV IRU DFFXUDWH WUDQVFULSWLRQ LQLWLDWLRQ ,W LV VWLOO SRVVLEOH WKDW VRPH XQLGHQWLILHG SURWHLQ PLJKW PRGXODWH WKH ELQGLQJ DFWLYLW\ RI PW7)$ LQ YLYR 6HFRQGO\ WKH PW7)$ SURWHLQ VHHPV WR EH XQDEOH WR ELQG WR FHUWDLQ *&ULFK VHTXHQFHV OLNH &6% DQG &6% *KLYL]]DQL HW DO WKLV ZRUNf RU 3RO\$f WUDFWV 'LIIOH\ DQG 6WLOOPDQ f 7KH VWUDWHJLF

PAGE 176

SRVLWLRQLQJ RI WKHVH VHTXHQFHV LQ WKH 'ORRS XSVWUHDP UHJLRQ DOORZV WKH fSKDVHGf ELQGLQJ WR RFFXU PDNLQJ WKH OLNHOLKRRG RI DQ fLQ SKDVHf SDWWHUQ JRLQJ fRXW RI SKDVHf XQOLNHO\ ,W LV VWLOO SRVVLEOH KRZHYHU WKDW DQ DV \HW XQLGHQWLILHG LQ YLYR IDFWRU PLJKW FKDQJH WKHVH ELQGLQJ FKDUDFWHULVWLFV 7KH VHFRQG PRGHO KDV PRUH DSSHDO ZLWK VRPH LQ YLWUR HYLGHQFH WR VXSSRUW LW 7KH PW7)$ SURWHLQ KDV EHHQ VKRZQ WR KDYH PRUH DIILQLW\ IRU WKH /63 RYHU WKH +63 LQ LQ YLWUR WUDQVFULSWLRQ DVVD\V DQG IRRWSULQWLQJ DVVD\V )LVKHU DQG &OD\WRQ f $OVR WKLV SURWHLQ VHHPV WR LQKLELW WUDQVFULSWLRQ DW KLJKHU FRQFHQWUDWLRQV IRU ERWK WKH KXPDQ 'DLUDJKL HW DO f DQG ;HQRSXV $QWRVFKHFKNLQ DQG %RJHQKDJHQ f KRPRORJV 7KH GHJUHH RI VWLPXODWLRQ RI EDVDO WUDQVFULSWLRQ E\ PW7)$ GLIIHUV ZLWK WKH SURPRWHU +63 EHLQJ DFWLYDWHG IROG DQG /63 RQO\ IROG LQ WKH SUHVHQFH RI [OPW7)$ $QWRVFKHFKNLQ DQG %RJHQKDJHQ f 7KHVH SKHQRPHQD RI GLIIHUHQWLDO DIILQLW\ GLIIHUHQWLDO VWLPXODWLRQ DQG QDUURZ UDQJH RI IXQFWLRQDO SURWHLQ FRQFHQWUDWLRQV VXJJHVW D PHFKDQLVP IRU VHOHFWLYH UHJXODWLRQ RI WUDQVFULSWLRQ ZLWK YHU\ ORZ OHYHOV RI PW7)$ VWLPXODWLQJ WKH /63 WR SURGXFH WKH SULPHUV IRU UHSOLFDWLRQ +LJKHU OHYHOV ZRXOG VLJQLILFDQWO\ DFWLYDWH +63 DQG VOLJKWO\ LQFUHDVH /63

PAGE 177

DFWLYLW\ LQLWLDOO\ ZLWK LQKLELWLRQ DW KLJKHU OHYHOV 7KRXJK DWWUDFWLYH WKLV PRGHO KDV QRW UHFHLYHG DQ\ LQ YLYR WHVW DV \HW WR VXEVWDQWLDWH LWV FODLPV 6XFK DQ HYLGHQFH ZRXOG KDYH WR VKRZ WKDW WKHUH LV D G\QDPLF UHJXODWLRQ RI PW7)$ OHYHOV LQ UHVSRQVH WR GLIIHUHQW WUDQVFULSWLRQDO DFWLYLWLHV RI WKH PLWRFKRQGULD ,Q RUGHU WR GLIIHUHQWLDWH EHWZHHQ WKHVH WZR PRGHOV DQG JDLQ DGGLWLRQDO LQVLJKW LQWR WKH PHFKDQLVP RI PLWRFKRQGULDO WUDQVFULSWLRQDO UHJXODWLRQ LQ YLYR IRRWSULQWLQJ RI PW'1$ DFURVV GLVWLQFW GHYHORSPHQWDO VWDJHV RI ;HQRSXV ODHYLV ZDV FDUULHG RXW )LJXUHV f WR WHVW ZKHWKHU WKH LQ YLYR RFFXSDQF\ RI PW'1$ E\ WKH PLWRFKRQGULDO WUDQVFULSWLRQ IDFWRU FKDQJHV GXULQJ WKH SHULRGV RI EDVDO DQG DFWLYDWHG WUDQVFULSWLRQ ,I WKH PW7)$ SURWHLQ UHVSRQGV WR FKDQJHV LQ WKH WUDQVFULSWLRQDO VWDWXV RI WKH PLWRFKRQGULD E\ HLWKHU SDWKZD\ RXWOLQHG DERYH LW VKRXOG EH GHWHFWHG LQ WKLV DVVD\ 'HWDLOHG H[DPLQDWLRQ RI PXOWLSOH IRRWSULQWLQJ H[SHULPHQWV FDUULHG RXW ZLWK GLIIHUHQW IURJV UHYHDOHG WKDW WKHUH ZHUH QR GHWHFWDEOH GLIIHUHQFHV LQ WKH RFFXSDQF\ RU PRGH RI IRRWSULQWLQJ HLWKHU SURWHFWLRQ RU K\SHUVHQVLWLYLW\f IRXQG LQ WKH XQIHUWLOL]HG HJJ DQG WKH YDULRXV GHYHORSPHQWDO VWDJHV LQ ERWK WKH 'ORRS XSVWUHDP UHJLRQ )LJXUHV DQG f DQG LQ WKH SURPRWHU UHJLRQ )LJXUH f 6LQFH

PAGE 178

WKH IRRWSULQWV LQ WKLV UHJLRQ RI PW'1$ DUH SULPDULO\ GXH WR PW7)$ ELQGLQJ $QWRVFKHFKNLQ DQG %RJHQKDJHQ f WKHVH UHVXOWV VXJJHVW HTXLYDOHQW RFFXSDQF\ RI PW7)$ GXULQJ ERWK EDVDO DQG DFWLYDWHG WUDQVFULSWLRQ LQ WKH PLWRFKRQGULD 7KH DERYH ILQGLQJV DUH LQFRQVLVWHQW ZLWK ERWK SURSRVHG PRGHOV RI WUDQVFULSWLRQDO UHJXODWLRQ 7KH ILUVW PRGHO RI FKDQJHV LQ fSKDVLQJf KDV QR H[SHULPHQWDO VXSSRUW DV WKLV ZRXOG KDYH FUHDWHG D VKLIW LQ WKH IRRWSULQWLQJ SDWWHUQ ZKLFK ZDV QRW WKH FDVH 7KH VHFRQG PRGHO ZRXOG KDYH SUHGLFWHG ORZ RU KLJK OHYHOV RI PW7)$ GXULQJ EDVDO RU DFWLYDWHG WUDQVFULSWLRQ UHVXOWLQJ LQ ORZHU RU KLJKHU RFFXSDQF\ RI PW'1$ 7KLV VFHQDULR ZDV DOVR QRW VHHQ LQ WKH LQ YLYR IRRWSULQWV +RZHYHU WKHVH H[SHULPHQWV GR QRW VKRZ ZKHWKHU WKH DFWXDO SURWHLQ OHYHOV RI PW7)$ FKDQJH LQ UHVSRQVH WR WKHVH HYHQWV 7KLV ZRXOG UHTXLUH GLUHFW PHDVXUHPHQW RI PW7)$ SURWHLQ OHYHOV GXULQJ GHYHORSPHQW (YHQ LI D GLIIHUHQFH LQ SURWHLQ OHYHOV ZDV IRXQG WKH HTXLYDOHQW RFFXSDQF\ RI PW7)$ ZRXOG VWLOO UHPDLQ XQH[SODLQHG 'LIIOH\ DQG 6WLOOPDQ f TXDQWLILHG WKH DPRXQW RI VFPW7)$ $%)f LQ \HDVW FHOOV JURZQ RQ HLWKHU JOXFRVH RU JO\FHURO E\ LPPXQREORWWLQJ DQG IRXQG YLUWXDOO\ LGHQWLFDO DPRXQWV RI $%) VKRZLQJ WKDW $%) OHYHOV ZHUH QRW GLFWDWHG E\ PLWRFKRQGULDO DFWLYLW\

PAGE 179

RU WRWDO DPRXQWV RI PW'1$ ZKLFK LQFUHDVH ZKHQ FHOOV DUH JURZQ RQ D QRQIHUPHQWDEOH FDUERQ VRXUFH VXFK DV JO\FHURO %XW $%) LV DQ H[WUHPHO\ DEXQGDQW SURWHLQ LQ \HDVW ZLWK PROHFXOHV RI $%) SHU FHOO 'LIIOH\ DQG 6WLOOPDQ f DQG PLWRFKRQGULDO WUDQVFULSWLRQ LQ \HDVW UHTXLUHV D VSHFLILFLW\ IDFWRU WKH VFPW7)% SURWHLQ 6FKLQNHO HW DO /LVRZVN\ DQG 0LFKDHOLV f LQ DGGLWLRQ WR WKH 51$ SRO\PHUDVH IRU WUDQVFULSWLRQ LQLWLDWLRQ ZLWK $%) SOD\LQJ RQO\ D PLQRU UROH ,Q FRQWUDVW WKH ;HQRSXV PLWRFKRQGULDO WUDQVFULSWLRQDO DSSDUDWXV FRQVLVWV RI WKH 51$ SRO\PHUDVH D EDVDO WUDQVFULSWLRQ IDFWRU [OPW7)% DQG WKH VSHFLILF DFWLYDWRU RI WUDQVFULSWLRQ [OPW7)$ $QWRVFKHFKNLQ DQG %RJHQKDJHQ f $OVR KPW7)$ )LVKHU HW DO f DQG [OPW7)$ $QWRVFKHFKNLQ DQG %RJHQKDJHQ f KDYH DQ DGGLWLRQDO FDUER[\ WHUPLQDO H[WHQVLRQ DV ZHOO DV D OLQNHU UHJLRQ EHWZHHQ WKH WZR +0* ER[ GRPDLQV 7KHUHIRUH DQ\ FRQFOXVLRQV DERXW PW7)$ GHULYHG IURP VWXGLHV RQ $%) FDQQRW EH QHFHVVDULO\ H[WUDSRODWHG WR KLJKHU RUJDQLVPV ,Q FRQFOXVLRQ WKH LQ YLYR IRRWSULQWLQJ DQDO\VHV UHSRUWHG KHUH VKRZ WKDW UHJXODWLRQ RI PLWRFKRQGULDO WUDQVFULSWLRQ GXULQJ ; ODHYLV GRHV QRW DSSHDU WR EH D VLPSOH PDWWHU RI YDU\LQJ PW7)$ OHYHOV EXW

PAGE 180

KDV DGGLWLRQDO OHYHOV RI FRPSOH[LW\ PDQ\ RI ZKLFK PD\ QRW EH DW WKH PW'1$ RU PW7)$ OHYHO 7KHVH PLJKW LQYROYH LQWUDPLWRFKRQGULDO RU QXFOHDUPLWRFKRQGULDO VLJQDOV PHGLDWHG E\ SURWHLQV RU VHFRQG PHVVHQJHUV LQ UHVSRQVH WR FKDQJHV LQ WKH ELRFKHPLFDO HQYLURQPHQW RI WKH PLWRFKRQGULD GXULQJ GHYHORSPHQW ,W LV DOVR FRQFHLYDEOH WKDW SURWHLQSURWHLQ LQWHUDFWLRQV FRXOG EH LQYROYHG LQ WKLV UHJXODWLRQ VLQFH VXFK LQWHUDFWLRQV ZRXOG QRW EH GHWHFWHG E\ WKH LQ YLYR IRRWSULQWLQJ WHFKQLTXH ,Q DGGLWLRQ WR WKHVH SRVVLELOLWLHV LW LV FRQFHLYDEOH WKDW YDU\LQJ OHYHOV RI WKH PLWRFKRQGULDO 51$ SRO\PHUDVH GXULQJ GHYHORSPHQW FRXOG UHJXODWH PLWRFKRQGULDO WUDQVFULSWLRQ $ VWXG\ RI WKH YDULRXV QXFOHDU 51$ SRO\PHUDVHV GXULQJ ;HQRSXV GHYHORSPHQW KDYH IRXQG WKH SRO\PHUDVHV WR EH VWRFNSLOHG LQ WKH IXOO\ JURZQ RRF\WHV RI ; ODHYLV ZLWK WKH OHYHOV UHPDLQLQJ KLJK LQ WKH HDUO\ HPEU\RV ZKHQ QXFOHDU WUDQVFULSWLRQ LV DOPRVW FRPSOHWHO\ VKXW GRZQ 5RHGHU D Ef 7KLV VXJJHVWV WKDW QXFOHDU 51$ SRO\PHUDVH OHYHOV DQG QXFOHDU WUDQVFULSWLRQDO DFWLYLW\ DUH QRW VWULFWO\ FRUUHODWHG +RZHYHU QRWKLQJ LV NQRZQ DERXW WKH OHYHOV RI PLWRFKRQGULDO 51$ SRO\PHUDVH GXULQJ ;HQRSXV GHYHORSPHQW 7KHUHIRUH WUDQVFULSWLRQDO FRQWURO E\ UHJXODWLRQ RI 51$ SRO\PHUDVH OHYHOV VWLOO UHPDLQV D IRUPDO SRVVLELOLW\

PAGE 181

3URWHLQ'1$ ,QWHUDFWLRQV DW WKH P7(5) (OHPHQW 7KH PLWRFKRQGULDO WUDQVFULSWLRQ WHUPLQDWLRQ IDFWRU P7(5)f DQG LWV ELQGLQJ VLWH KDYH EHHQ LQWHQVLYHO\ VWXGLHG LQ WKH SDVW GHFDGH 7KLV '1$ELQGLQJ SURWHLQ ELQGV WLJKWO\ WR PW'1$ DW LWV FRJQDWH VLWH ZLWK D KDOIOLIH RI PLQ &KRP\Q HW DO f ,WV IXQFWLRQ LV ZLGHO\ EHOLHYHG WR EH DWWHQXDWLRQ RI WUDQVFULSWLRQ IURP WKH +63 DW WKH P7(5) HOHPHQW DOORZLQJ VHOHFWLYH DPSOLILFDWLRQ RI WKH U51$V RYHU WKH P51$V 0XWDWLRQV LQ RU DURXQG WKH ELQGLQJ VLWH RI WKLV SURWHLQ KDYH EHHQ OLQNHG ZLWK FKURQLF KXPDQ GLVHDVHV *RWR HW DO =HYLDQL HW DO f XQGHUOLQLQJ WKH LPSRUWDQFH RI P7(5) LQ SURSHU PLWRFKRQGULDO IXQFWLRQ ,Q JHQHUDO WUDQVFULSWLRQ HORQJDWLRQ ‘ LV YHU\ SURFHVVLYH DQG UHTXLUHV VSHFLDO VLJQDOV IRU WHUPLQDWLRQ 7HUPLQDWLRQ XVXDOO\ LQYROYHV WKUHH VWHSV SDXVLQJ RI WKH HORQJDWLRQ FRPSOH[ UHOHDVH RI WKH QDVFHQW 51$ FKDLQ DQG GLVVRFLDWLRQ RI WKH 51$ SRO\PHUDVH 7HUPLQDWLRQ PD\ EH PHGLDWHG E\ 51$ELQGLQJ SURWHLQV HJ UKR GHSHQGHQW WHUPLQDWLRQf VHOIFRPSOHPHQWDU\ VWUXFWXUHV LQ 51$ HJ UKRLQGHSHQGHQW WHUPLQDWLRQf RU E\ '1$ELQGLQJ SURWHLQV HJ WHUPLQDWLRQ IDFWRU IRU 51$ SRO\PHUDVH 77)f 7KH WKLUG FODVV RI WHUPLQDWRUV ELQG WR '1$ DW D VHTXHQFH GRZQVWUHDP RI WKH fHQG RI

PAGE 182

WKH QDVFHQW WUDQVFULSW DQG FDXVHV SDXVLQJ RI WKH SRO\PHUDVH DQG WUDQVFULSW UHOHDVH /DQJ HW DO f 7KH P7(5) SURWHLQ DSSDUHQWO\ EHORQJV WR WKLV FODVV RI WUDQVFULSWLRQ WHUPLQDWRUV 7KH PROHFXODU EDVLV RI WUDQVFULSWLRQ WHUPLQDWLRQ E\ P7(5) LV VWLOO XQFOHDU +RZHYHU WKH LQ YLWUR VWXGLHV RI 6KDQJ DQG &OD\WRQ f ZLWK SXULILHG P7(5) SURWHLQ VXJJHVW WKDW WHUPLQDWLRQ PD\ LQYROYH ORFDOL]HG GLVWRUWLRQ RI '1$ VWUXFWXUH E\ '1$ EHQGLQJ LQGXFHG E\ WKH ELQGLQJ RI WKLV SURWHLQ WR LWV FRJQDWH VLWH 7HUPLQDWLRQ ZDV DOVR LQGHSHQGHQW RI WKH 51$ SRO\PHUDVH XVHG VKRZLQJ WKDW WHUPLQDWLRQ GRHV QRW LQYROYH VSHFLILF LQWHUDFWLRQV EHWZHHQ WKH 51$ SRO\PHUDVH DQG P7(5) 7KLV LV DQDORJRXV WR WKH WUDQVFULSWLRQDO WHUPLQDWLRQ LQGXFHG E\ WKH \HDVW 51$ SRO\PHUDVH WUDQVFULSWLRQ WHUPLQDWRU 5HEOS ZKLFK LQGXFHV DOO WKUHH QXFOHDU 51$ SRO\PHUDVHV WR SDXVH /DQJ HW DO f VKRZLQJ WKDW WKH IXQFWLRQLQJ RI WKH SRO WHUPLQDWRU GRHV QRW UHTXLUH DQ\ VSHFLILF SURWHLQSURWHLQ FRQWDFWV EHWZHHQ 5HEOS DQG SRO\PHUDVH 7KH P7(5) SURWHLQ KDV EHHQ SXULILHG IURP KXPDQ PLWRFKRQGULD E\ WZR JURXSV .UXVH HW DO +HVV HW DO f +RZHYHU WKH JHQH HQFRGLQJ WKLV LPSRUWDQW SURWHLQ KDV QRW EHHQ FORQHG \HW +HQFH QRWKLQJ LV NQRZQ DERXW WKH UHJXODWLRQ RI WKLV SURWHLQ LQ WKH FHOO $W

PAGE 183

OHDVW WKUHH VFHQDULRV FDQ EH HQYLVDJHG ,Q WKH ILUVW SRVVLELOLW\ WKH P7(5) SURWHLQ OHYHOV FRXOG EH DFWLYHO\ UHJXODWHG LQ UHVSRQVH WR WKH FKDQJLQJ WUDQVFULSWLRQDO QHHGV RI WKH FHOO $OWHUQDWLYHO\ WKH SURWHLQ FRXOG EH DOZD\V SUHVHQW LQ PLWRFKRQGULD DW VLPLODU OHYHOV EXW ZRXOG JHW UHFUXLWHG WR LWV ELQGLQJ VLWH DORQJ ZLWK WKH WUDQVFULSWLRQ PDFKLQHU\ GXULQJ DFWLYH WUDQVFULSWLRQ +RZHYHU D WKLUG SRVVLELOLW\ UHPDLQV WKH SURWHLQ FRXOG EH FRQVWLWXWLYHO\ ERXQG WR LWV VLWH SURYLGLQJ D SK\VLFDO EORFN WR DGYDQFLQJ 51$ SRO\PHUDVHV DW DOO WLPHV ZKHWKHU WUDQVFULSWLRQ LV EDVDO RU DFWLYDWHG 2QH RI WKH ZD\V WR DWWHPSW WR UHVROYH WKHVH TXHVWLRQV ZRXOG EH WR ORRN DW WKH RFFXSDQF\ RI WKH P7(5) FLV HOHPHQW GXULQJ UHJXODWHG WUDQVFULSWLRQ E\ LQ YLYR IRRWSULQWLQJ 7KH ;HQRSXV HPEU\RJHQHVLV V\VWHP SURYLGHV D JRRG PRGHO RI UHJXODWHG WUDQVFULSWLRQ $OWKRXJK WKH SUHVHQFH RI WKH P7(5) SURWHLQ LQ ; ODHYLV PLWRFKRQGULD KDV QRW EHHQ GHPRQVWUDWHG \HW ;HQRSXV PW'1$ KDV D WULGHFDPHU WHUPLQDWLRQ ER[ DW WKH HQG RI WKH 6 U51$ JHQH ZKLFK LV DOPRVW FRPSOHWHO\ LGHQWLFDO WR WKH KXPDQ KRPRORJXH D PDWFK RI UHVLGXHVf +HQFH LW ZDV FRQVLGHUHG H[WUHPHO\ OLNHO\ WKDW D VLPLODU IDFWRU H[LVWHG LQ ;HQRSXV PLWRFKRQGULD ,Q RUGHU WR FRQILUP WKH SUHVHQFH RI WKH P7(5) SURWHLQ LQ ;HQRSXV PLWRFKRQGULD LQ RUJDQHOOR

PAGE 184

IRRWSULQWLQJ RI RYDU\ PW'1$ ZDV SHUIRUPHG LQ WKLV VWXG\ WR ORRN IRU RFFXSDQF\ RI WKH P7(5) FLV HOHPHQW 7KH DQDO\VLV VKRZHG VWURQJ IRRWSULQWV LQ DQG DURXQG WKH WULGHFDPHU VHTXHQFH )LJXUH f ZLWK WKH VXUURXQGLQJ UHJLRQV VKRZLQJ QR HYLGHQFH RI SURWHLQ'1$ LQWHUDFWLRQV FRQILUPLQJ WKH SUHVHQFH RI WKH SURWHLQ LQ WKH RYDU\ PLWRFKRQGULD :KLOH WKH PRGH RI IRRWSULQWLQJ ZDV SULPDULO\ SURWHFWLRQ RQ WKH /VWUDQG WKH +VWUDQG UHYHDOHG '06 K\SHUVHQVLWLYH VLWHV DW SRVLWLRQV DQG )LJXUHV DQG f 7KHVH UHVLGXHV H[DFWO\ IODQN WKH WULGHFDPHU VHTXHQFH VXJJHVWLQJ D ORFDOL]HG GLVWRUWLRQ RU EHQG LQ '1$ LQGXFHG E\ SURWHLQ ELQGLQJ WR WKLV VLWH LQ YLYR 7KHVH UHVXOWV DUH FRQVLVWHQW ZLWK WKH LQ YLWUR REVHUYDWLRQV RI 6KDQJ DQG &OD\WRQ f WKDW P7(5) SURWHLQ EHQGV '1$ ZKHQ ERXQG WR LWV FRJQDWH VLWH '06 PHWK\ODWHV 1 RI JXDQLQHV LQ WKH PDMRU JURRYH +HQFH D K\SHUVHQVLWLYH JXDQLQH LV DQ LQGLFDWLRQ RI D FRPSUHVVLRQ RI WKH PDMRU JURRYH FDXVHG E\ SURWHLQ ELQGLQJ LQ WKH PLQRU JURRYH RQ WKH RWKHU VLGH )XUWKHU HYLGHQFH LQ VXSSRUW RI WKHVH REVHUYDWLRQV LV WKH '1DVH IRRWSULQW SDWWHUQ RI SXULILHG P7(5) SURWHLQ RQ D KXPDQ PW'1$ IUDJPHQW .UXVH HW DO f $ '1$VH K\SHUVHQVLWLYH VLWH IODQNV WKH WULGHFDPHU VHTXHQFH ZKLFK LV FRPSOHWHO\ SURWHFWHGf LQ ERWK /

PAGE 185

DQG +VWUDQGV )LJXUH RI .UXVH HW DO f '1$VH GRHV QRW UHFRJQL]H WKH '1$ VHTXHQFH SHU VH EXW DSSHDUV LQVWHDG WR VHQVH '1$ EDFNERQH JHRPHWU\ DQG FXWV DW SRLQWV ZKHUH WKH PLQRU JURRYH LV ZLGH 'UHZ DQG 7UDYHUV f 7KH FU\VWDO VWUXFWXUH RI WKH FRPSOH[ RI '1$VH DQG QLFNHG '1$ VKRZV WKH HQ]\PH WR EH ERXQG DW D ZLGH PLQRU JURRYH DQG WKH '1$ WR EH EHQW r DZD\ IURP WKH SURWHLQ UHVXOWLQJ LQ D FRPSUHVVLRQ RI WKH PDMRU JURRYH RQ WKH RSSRVLWH VLGH 6XFN HW DO f +HQFH '1$VHO LV D SUREH RI PLQRU JURRYH GHIRUPDWLRQ LQ SURWHLQ'1$ FRPSOH[HV 'LPHWK\O VXOIDWH RQ WKH RWKHU KDQG LV D SUREH RI PDMRU JURRYH ELQGLQJ SURWHLQV +HQFH WKH PRVW GLUHFW LQWHUSUHWDWLRQ RI WKH '06 K\SHUVHQVLWLYH VLWHV VHHQ LQ )LJXUH LV WKDW WKH P7(5) SURWHLQ LV D PDMRU JURRYH ELQGLQJ SURWHLQ ZKLFK EHQGV RU GLVWRUWV WKH '1$ ORFDOO\ DW WKH ELQGLQJ VLWH FDXVLQJ WKH '06 K\SHUVHQVLWLYH VLWHVf ZLGHQLQJ WKH PLQRU JURRYH RQ WKH IODQNV ZKLFK DSSHDU DV WKH '1$VH K\SHUVHQVLWLYH VLWHV VHHQ LQ WKH UHSRUW RI .UXVH HW DO f ,W LV LPSRUWDQW WR QRWH WKDW WKHVH IRRWSULQWV VKRZLQJ GLVWRUWLRQ RI '1$ VWUXFWXUH DSSHDU VSHFLILFDOO\ LQ DQG DURXQG WKH P7(5) HOHPHQW ZLWK QR HYLGHQFH RI DQ\ RWKHU SURWHLQ'1$ LQWHUDFWLRQV RU FKDQJHV LQ '1$ VWUXFWXUH LQ WKH VHTXHQFHV VXUURXQGLQJ WKLV HOHPHQW )LJXUH f 7KLV LV VWURQJ

PAGE 186

HYLGHQFH RI D KLJKO\ ORFDOL]HG P7(5)PHGLDWHG GLVWRUWLRQ RI '1$ VWUXFWXUH ,Q RUGHU WR ORRN DW WKH RFFXSDQF\ RI WKH P7(5) HOHPHQW GXULQJ UHJXODWHG WUDQVFULSWLRQ LQ YLYR IRRWSULQWLQJ RI WKLV UHJLRQ DFURVV HDUO\ GHYHORSPHQW RI ; ODHYLV ZDV SHUIRUPHG 7KH UHVXOWV VKRZHG UHODWLYHO\ HTXLYDOHQW RFFXSDQF\ RI WKH SURWHLQ DW LWV ELQGLQJ VLWH GXULQJ ERWK EDVDO DQG DFWLYDWHG WUDQVFULSWLRQ DV LQGLFDWHG E\ WKH IRRWSULQWV RQ WKH / DQG +VWUDQG )LJXUHV DQG f 7KHVH GDWD LPPHGLDWHO\ VXJJHVW WKDW WKH WKLUG VFHQDULR RXWOLQHG DERYH LV PRVW OLNHO\ LH WKH P7(5) SURWHLQ DSSHDUV WR EH FRQVWLWXWLYHO\ SUHVHQW RQ PW'1$ DW LWV FRJQDWH VLWH ZLWK HTXDO RFFXSDQF\ DQG LWV ELQGLQJ GRHV QRW VHHP WR EH DIIHFWHG E\ WKH WUDQVFULSWLRQDO QHHGV RI WKH FHOO $Q LQGLUHFW SUHGLFWLRQ RI WKH DERYH ILQGLQJV LV WKDW WKH LQWUD PLWRFKRQGULDO OHYHOV RI WKH P7(5) SURWHLQ GXULQJ UHJXODWHG WUDQVFULSWLRQ LQ ; ODHYLV ZRXOG QRW EH VXEMHFW WR IOXFWXDWLRQV VLQFH LW DSSHDUV WR EH ERXQG HTXLYDOHQWO\ WR PW'1$ DW DOO WLPHV 8QIRUWXQDWHO\ DQWLERGLHV VSHFLILF WR P7(5) DUH QRW DYDLODEOH IRU DQ\ V\VWHP 7KHUHIRUH JHO PRELOLW\ VKLIW DVVD\V )HUQDQGH]6LOYD HW DO f ZHUH XVHG WR GHWHFW WKH SUHVHQFH RI WKH P7(5) SURWHLQ )LJXUH

PAGE 187

$ t %f DQG REWDLQ FRPSDUDWLYH HVWLPDWHV RI LWV UHODWLYH DEXQGDQFH LQ WKH PLWRFKRQGULD RI GLVWLQFW GHYHORSPHQWDO VWDJHV 7KHVH DVVD\V VKRZHG WKH IXQFWLRQDO OHYHOV RI WKH P7(5) SURWHLQ WR EH UHODWLYHO\ FRQVWDQW GXULQJ WKLV WLPH RI GHYHORSPHQW )LJXUH $ t %f UHJDUGOHVV RI WKH WUDQVFULSWLRQDO VWDWXV RI WKH PLWRFKRQGULD 7KHVH ILQGLQJV SURYLGH VRPH DGGLWLRQDO LQVLJKWV LQWR WKH LQ YLYR SUHYDOHQFH DQG UROH RI WKLV LPSRUWDQW PLWRFKRQGULDO SURWHLQ ,WV FRQVWDQW OHYHO LQ PLWRFKRQGULD DQG FRQVWLWXWLYH RFFXSDQF\ RI PW'1$ DUH VXUSULVLQJ REVHUYDWLRQV ZKLFK SRVH PRUH TXHVWLRQV WKDQ DQVZHUV UHJDUGLQJ WKH LQ YLYR UROH RI P7(5) ,Q LQ YLWUR DVVD\V WKLV SURWHLQ LV QHFHVVDU\ DQG VXIILFLHQW IRU WHUPLQDWLRQ RI WUDQVFULSWLRQ 6KDQJ DQG &OD\WRQ f :KHWKHU WKH VDPH KROGV WUXH LQ YLYR UHPDLQV DQ RSHQ TXHVWLRQ DW WKLV WLPH 7KH ORFDOL]HG GLVWRUWLRQ RI WKH '1$ VWUXFWXUH LQGXFHG E\ P7(5) PLJKW SDXVH WKH 51$ SRO\PHUDVH OHDGLQJ WR WUDQVFULSWLRQDO WHUPLQDWLRQ LQ VRPH FDVHV WKHUHE\ DOORZLQJ VHOHFWLYH U51$ DPSOLILFDWLRQ 2FFDVLRQDO UHDGWKURXJK ZRXOG DOORZ WKH H[SUHVVLRQ RI WKH GRZQVWUHDP JHQHV 7KHVH VWXGLHV KRZHYHU GR QRW SLQSRLQW WKH H[DFW PROHFXODU PHFKDQLVP RI WHUPLQDWLRQ RU UHDGWKURXJK ,W LV SRVVLEOH WKDW WHUPLQDWLRQ DQG UHDGWKURXJK PLJKW LQYROYH LQWHUDFWLRQ RI RWKHU SURWHLQV RU WKH

PAGE 188

SRO\PHUDVH ZLWK WKH P7(5) SURWHLQ DOWKRXJK WKHUH LV QR HYLGHQFH WR VXJJHVW DQ\ RI WKLV IURP WKHVH H[SHULPHQWV 7KHVH ZLOO KDYH WR DZDLW WKH PROHFXODU FORQLQJ RI WKH JHQH HQFRGLQJ WKH P7(5) SURWHLQ ,Q VXPPDU\ WKH LQ YLYR IRRWSULQWLQJ DQDO\VHV KDYH IXUQLVKHG IUHVK LQVLJKWV LQWR WKH FHOOXODU UROHV RI WZR LPSRUWDQW PLWRFKRQGULDO SURWHLQV WKH PLWRFKRQGULDO WUDQVFULSWLRQ IDFWRU [OPW7)$ DQG WKH PLWRFKRQGULDO WUDQVFULSWLRQ WHUPLQDWLRQ IDFWRU P7(5)f 7KH [O PW7)$ SURWHLQ ZDV VKRZQ WR FRQVWLWXWLYHO\ ELQG WKH UHJXODWRU\ UHJLRQV RI ;HQRSXV PW'1$ LQ D SHULRGLF IDVKLRQ SRVVLEO\ SUHVHQWLQJ LPSRUWDQW FLVHOHPHQWV LQ WKH FRUUHFW VWUXFWXUDO FRQWH[W IRU WKH UHSOLFDWLRQ DQG WUDQVFULSWLRQ PDFKLQHU\ +RZHYHU WKH IRRWSULQW GDWD UXOH RXW WKH SRVVLELOLW\ RI DFWLYH UHJXODWLRQ RI PLWRFKRQGULDO WUDQVFULSWLRQ E\ FKDQJLQJ OHYHOV RI WKLV SURWHLQ LQ PLWRFKRQGULD 6HFRQGO\ WKH SUHVHQFH RI WKH P7(5) SURWHLQ LQ ;HQRSXV PLWRFKRQGULD ZDV FRQILUPHG E\ LQ YLYR IRRWSULQWLQJ DQG EDQG VKLIW DVVD\V 7KH PRGH RI IRRWSULQWLQJ VKRZHG HYLGHQFH RI '1$ EHQGLQJ DW WKH ELQGLQJ VLWH $Q XQH[SHFWHG DQG LQWULJXLQJ ILQGLQJ ZDV WKDW WKLV SURWHLQ ZDV FRQVWLWXWLYHO\ ERXQG WR LWV FRJQDWH VLWH GXULQJ ERWK EDVDO DQG DFWLYDWHG WUDQVFULSWLRQ RSHQLQJ XS QHZ TXHVWLRQV DERXW LWV UROH LQ YLYR

PAGE 189

&+$37(5 0,72&+21'5,$/ 75$16&5,37,21 5$7( $1$/<6,6 ,QWURGXFWLRQ 1RUWKHUQ DQDO\VHV RI PLWRFKRQGULDO WUDQVFULSWV GXULQJ YHU\ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV VKRZHG HYLGHQFH RI DFWLYH UHJXODWLRQ RI WUDQVFULSW OHYHOV LQ WKH GHYHORSLQJ HPEU\R &KDSWHU f 7R EULHIO\ UHFDSLWXODWH WKH UHVXOWV WUDQVFULSW OHYHOV ZHUH EDVDO LQ WKH XQIHUWLOL]HG HJJV DQG GHYHORSLQJ HPEU\RV XSWR KRXUV RI GHYHORSPHQW LQFUHDVHG WR aIROG E\ KRXUV aIROG E\ KRXUV DQG SHDNHG DW IROG RYHU HJJ OHYHOV E\ SRVWIHUWLOL]DWLRQ $IWHU WKLV WLPH WKH VWHDG\ VWDWH OHYHOV VHHPHG WR VWDELOL]H DW D ORZHU EXW VLJQLILFDQW IROG RYHU HJJ OHYHOV E\ GD\V RI GHYHORSPHQW 7KHVH GUDPDWLF GLIIHUHQFHV LQ PLWRFKRQGULDO WUDQVFULSW OHYHOV KDSSHQ LQ WKH FRQWH[W RI XQFKDQJHG OHYHOV RI PLWRFKRQGULDO '1$ WKH WHPSODWH RI WUDQVFULSWLRQ ZKLFK UHPDLQV DW DSSUR[LPDWHO\ QJ SHU HPEU\R RYHU WKLV WZRGD\ SHULRG DQG VKRZV GHWHFWDEOH LQFUHDVHV LQ '1$ OHYHOV RQO\ DIWHU KRXUV RI GHYHORSPHQW &KDVH DQG 'DZLG

PAGE 190

f +HQFH LW LV SRVVLEOH WKDW WUDQVFULSWLRQ LV GHFRXSOHG IURP UHSOLFDWLRQ RI PW'1$ GXULQJ WKLV ZLQGRZ RI GHYHORSPHQW D VLWXDWLRQ ZKLFK LV QRW HDVLO\ REWDLQHG LQ RWKHU V\VWHPV GXH WR WKH FRQVWLWXWLYH DQG VLPXOWDQHRXV RFFXUUHQFH RI WKHVH WZR ELRV\QWKHWLF HYHQWV LQ WKH PLWRFKRQGULD $QRWKHU LQWHUHVWLQJ IHDWXUH RI WKH FKDQJHV LQ WKH WUDQVFULSW SDWWHUQV ZDV WKH DSSDUHQW FRRUGLQDWH SDWWHUQ RI UHJXODWLRQ RI WKH VL[ PLWRFKRQGULDO P51$V DQDO\]HG &KDSWHU f )LYH GLIIHUHQW P51$V 1' 1' &2 ,, $73DVH DQG &\W Ef DOO RI ZKLFK DUH HQFRGHG RQ WKH +VWUDQG VKRZHG PRUH RU OHVV VLPLODU OHYHOV RI WUDQVFULSW DEXQGDQFH RYHU GLVWLQFW GHYHORSPHQWDO WLPH SRLQWV )LJXUH DQG 7DEOH f 7KH RWKHU P51$ DQDO\]HG 1' GLVSOD\HG D ORZHU EXW VLPLODU WUHQG RI WUDQVFULSW DEXQGDQFH )LJXUH DQG 7DEOH f ,Q FRQWUDVW 1' WKH RQO\ P51$ HQFRGHG RQ WKH /VWUDQG WUDQVFULEHG E\ WKH /VWUDQG SURPRWHU /63f LV QRW DV DFWLYH DV WKH +63 LQ LQ YLWUR WUDQVFULSWLRQ DVVD\V $QWRVFKHFKNLQ DQG %RJHQKDJHQ f 7KLV PLJKW H[SODLQ WKH ORZHU DEXQGDQFH RI WKLV WUDQVFULSW LQ YLYR )XUWKHUPRUH WKH WZR U51$V 6 DQG 6 U51$f DOVR H[KLELWHG DQ LQFUHDVLQJ WUHQG DOEHLW PXFK ORZHU WKDQ WKH P51$V GXULQJ WKLV WLPH )LJXUH DQG 7DEOH f 7KLV LV D VXUSULVLQJ REVHUYDWLRQ EHFDXVH

PAGE 191

RI WKH ORQJ KDOIOLIH RI WKHVH U51$V KRXUVf PHDVXUHG E\ &KDVH DQG 'DZLG f VXJJHVWLQJ WKDW WKH LQFUHDVHG U51$ OHYHOV PXVW EH GXH WR DFWLYH WUDQVFULSWLRQ UDWKHU WKDQ GLIIHUHQWLDO WXUQRYHU 7DNHQ WRJHWKHU WKH FRRUGLQDWH SDWWHUQ RI FKDQJHV LQ P51$ DQG U51$ DEXQGDQFH VWURQJO\ VXJJHVWV WKDW WKH SULPDU\ GHWHUPLQDQW RI LQFUHDVHG VWHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO WUDQVFULSWV GXULQJ HDUO\ HPEU\RJHQHVLV RI ; ODHYLV LV LQFUHDVHG WUDQVFULSWLRQ RI PW'1$ 2QH RI WKH PRVW GLUHFW ZD\V WR FRQILUP WKLV VXJJHVWLRQ LV WR PHDVXUH WKH PLWRFKRQGULDO WUDQVFULSWLRQ UDWH DFURVV HDUO\ GHYHORSPHQW RI ; ODHYLV XVLQJ D PLWRFKRQGULDO UXQRQ WUDQVFULSWLRQ DVVD\ ZLWK LVRODWHG PLWRFKRQGULD 0LWRFKRQGULDO UXQRQ WUDQVFULSWLRQ V\VWHPV KDYH EHHQ GHVFULEHG IRU SODQWV 0XLVH DQG +DXVZLUWK f \HDVW 3R\WRQ HW DO f +H/D FHOOV *DLQHV f PDPPDOLDQ OLYHU DQG EUDLQ (QULTXH] HW DO f 7KH FORVH FRUUHVSRQGHQFH EHWZHHQ WKH LQ RUJDQHOOR DQG LQ YLYR WUDQVFULSWV LQ LQLWLDWLRQ VLWHV DQG SURFHVVLQJ SDWWHUQV LV ZHOO HVWDEOLVKHG *DLQHV DQG $WWDUGL *DLQHV HW DO f PDNLQJ LW D YDOXDEOH WRRO IRU WKH DQDO\VLV RI RUJDQHOOH JHQH H[SUHVVLRQ ,Q RUJDQHOOR PLWRFKRQGULDO SURWHLQ V\QWKHVLV V\VWHPV KDYH DOVR EHHQ GHVFULEHG 0F.HH HW DO

PAGE 192

3R\WRQ HO DO f ZKLFK IXUWKHU DFFHQWXDWH WKH DXWKHQWLFLW\ RI WKH UHVXOWV REWDLQHG LQ LVRODWHG PLWRFKRQGULDO V\VWHPV :LWK WKH DLP RI FRPSDULQJ WKH PLWRFKRQGULDO WUDQVFULSWLRQDO UDWHV RI GLVWLQFW GHYHORSPHQWDO VWDJHV RI ; ODHYLV D PLWRFKRQGULDO UXQRQ WUDQVFULSWLRQ DVVD\ ZDV GHYHORSHG IRU ;HQRSXV HJJV DQG HPEU\RV E\ PRGLI\LQJ WKH SURWRFRO RI *DLQHV HW DO f $ FORVH FRUUHODWLRQ ZDV IRXQG EHWZHHQ WKH VWHDG\ VWDWH OHYHOV RI WKH PLWRFKRQGULDO 51$V DQG WUDQVFULSWLRQDO UDWHV FRQILUPLQJ WKDW WUDQVFULSWLRQ LV WKH SULPDU\ GHWHUPLQDQW RI WKH REVHUYHG GLIIHUHQFHV LQ PLWRFKRQGULDO WUDQVFULSW OHYHOV DFURVV HDUO\ GHYHORSPHQW RI ; ODHYLV 7KHVH UHVXOWV DORQJ ZLWK LQYHVWLJDWLRQV LQWR VRPH RI WKH SUREDEOH FDXVHV RI WKH GLIIHUHQWLDO UHDGLQHVV IRU WUDQVFULSWLRQ LQ WKH GLIIHUHQW VWDJHV DUH GLVFXVVHG LQ WKH IROORZLQJ VHFWLRQV 5HVXOWV 0LWRFKRQGULDO UXQRQ WUDQVFULSWLRQ UHDFWLRQV XVXDOO\ DOORZ HORQJDWLRQ RI SUHLQLWLDWHG WUDQVFULSWLRQ FRPSOH[HV DQG SRVW WUDQVFULSWLRQDO SURFHVVLQJ RI WKH SRO\FLVWURQLF WUDQVFULSWV *DLQHV DQG $WWDUGL f ,Q RUGHU WR WHVW WKH ; ODHYLV UXQRQ WUDQVFULSWLRQ V\VWHP IRU ERWK LQFRUSRUDWLRQ RI ODEHO DQG SRVWWUDQVFULSWLRQDO

PAGE 193

SURFHVVLQJ UXQRQ UHDFWLRQV ZHUH FDUULHG RXW DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV XVLQJ PLWRFKRQGULD LVRODWHG IURP XQIHUWLOL]HG HJJV DQG KRXUWDGSROHV )ROORZLQJ WKH UHDFWLRQV 51$ ZDV LVRODWHG IURP WKH PLWRFKRQGULD XVLQJ WKH 7UL=RO UHDJHQW *,%&2 %5/f DFFRUGLQJ WR WKH PDQXIDFWXUHUfV LQVWUXFWLRQV 7KH 51$ VDPSOHV ZHUH WKHQ UXQ RQ IRUPDOGHK\GHDJDURVH JHOV DV GHVFULEHG IRU WKH VWHDG\ VWDWH DQDO\VLV LQ 0DWHULDOV DQG 0HWKRGV GULHG DW r & LQ D JHO GU\HU DQG DXWRUDGLRJUDSKHG )LJXUH f 7KH EXON RI WKH ODEHOHG VSHFLHV IDOO EHWZHHQ WKH PROHFXODU ZHLJKW UDQJH RI NE DQG NE 7KH PDWXUH IXOO\ SURFHVVHG PLWRFKRQGULDO WUDQVFULSWV RI ; ODHYLV IDOO ZLWKLQ WKLV UDQJH LQGLFDWLQJ WKDW WKH PLQ UXQRQ UHDFWLRQV DOORZHG WKH SURFHVVLQJ RI WKH PDMRULW\ RI WKH ODEHOHG 51$V )XUWKHU LQFXEDWLRQV XS WR f RU f ZHUH WULHG EXW GLG QRW VLJQLILFDQWO\ DGG WR WKH HIILFLHQF\ RI WKH UHDFWLRQ GDWD QRW VKRZQf +HQFH WKH PLQ UHDFWLRQ WLPH ZDV FKRVHQ IRU WKH UHVW RI WKH H[SHULPHQWV 7KH DERYH DVVD\ GRHV QRW SHUPLW WKH LGHQWLILFDWLRQ DQG TXDQWLWDWLRQ RI VSHFLILF WUDQVFULSWV ZKLFK ZRXOG DOORZ D FRPSDULVRQ RI WKH DFWLYLW\ RI WKH WZR SURPRWHUV GXULQJ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV ,Q RUGHU WR DOORZ WKH LGHQWLILFDWLRQ RI JHQHVSHFLILF DQG VWUDQGVSHFLILF WUDQVFULSWV JHQHVSHFLILF DQG VWUDQGVSHFLILF

PAGE 194

NEf f§ f§ )LJXUH 6L]H IUDFWLRQDWLRQ RI PLWRFKRQGULDO UXQRQ 51$ 0LWRFKRQGULDO UXQRQ WUDQVFULSWLRQ UHDFWLRQV ZHUH SHUIRUPHG ZLWK PLWRFKRQGULD IURP KRXUROG WDGSROHV ODQH f RU HJJ ODQHV DQG f LQ EDVLF UXQRQ EXIIHU DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 51$ ZDV WKHQ LVRODWHG IURP WKHVH VDPSOHV XVLQJ WKH 7UL=RO UHDJHQW *,%&2 %5/f DFFRUGLQJ WR WKH PDQXIDFWXUHUfV LQVWUXFWLRQV 7KH 51$ ZDV WKHQ GHQDWXUHG DQG ORDGHG RQWR b IRUPDOGHK\GHDJDURVH JHOV DV GHVFULEHG LQ WKH VWHDG\ VWDWH DQDO\VLV VHFWLRQ RI 0DWHULDOV DQG 0HWKRGV $IWHU HOHFWURSKRUHVLV WKH JHO ZDV GULHG DW r & LQ JHO GU\HU DQG DXWRUDGLRJUDSKHG WR GHWHFW WKH UXQRQ SURGXFWV 7KH PROHFXODU ZHLJKWV RI DQ 51$ ODGGHU UXQ LQ SDUDOOHO DUH VKRZQ RQ WKH OHIW VLGH RI WKH ILJXUH DQG WKH SRVLWLRQV RI WKH WZR PLWRFKRQGULDO U51$V 6 DQG 6 U51$ DUH LQGLFDWHG RQ WKH ULJKW 1RWH WKDW WKH PDMRULW\ RI WKH ODEHOHG VSHFLHV FOXVWHU EHWZHHQ DQG NE WKH VL]H UDQJH RI IXOO\ SURFHVVHG PLWRFKRQGULDO WUDQVFULSWV

PAGE 195

ULERSUREHV ZHUH XVHG WR SURGXFH FROG WDUJHW SUREH SDQHOV DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV )LJXUH f )LJXUH $ VKRZV WKH DSSUR[LPDWH JHQRPLF ORFDWLRQ RI WKH IRXU JHQHV XVHG IRU WKH DQDO\VLV DORQJ ZLWK WKH GLUHFWLRQ RI WUDQVFULSWLRQ RI WKH WZR ELn GLUHFWLRQDO SURPRWHUV )LJXUH % VKRZV VL[ LGHQWLFDO HWKLGLXP EURPLGHVWDLQHG WDUJHW SUREH SDQHOV XVHG LQ WKH H[SHULPHQW GHVFULEHG LQ )LJXUH 7KH LGHQWLW\ DQG VWUDQGVHQVH RI HDFK WUDQVFULSW DUH VKRZQ DERYH HDFK ODQH /DQHV DQG KDYH WKH / VWUDQG VHQVH DQG KHQFH ZRXOG GHWHFW WUDQVFULSWV RULJLQDWLQJ IURP WKH /VWUDQG SURPRWHU /63f ZKHUHDV ODQHV DQG DUH RI +VWUDQG VHQVH DQG KHQFH ZRXOG GHWHFW WUDQVFULSWLRQ IURP WKH +VWUDQG SURPRWHU +63f ,Q RUGHU WR ORRN IRU GLIIHUHQFHV LQ WKH PLWRFKRQGULDO WUDQVFULSWLRQ UDWHV DFURVV HDUO\ GHYHORSPHQW RI ; ODHYLV LW LV LPSRUWDQW WR PDLQWDLQ DV PXFK DV SRVVLEOH WKH HQGRJHQRXV GLIIHUHQFHV LQ WKH ELRFKHPLFDO FRPSRVLWLRQ RI WKH PLWRFKRQGULD IURP WKH GLIIHUHQW VWDJHV VR WKDW WKHLU HIIHFW RQ PLWRFKRQGULDO WUDQVFULSWLRQ FDQ EH FRPSDUHG +HQFH WKH UXQRQ UHDFWLRQV ZHUH SHUIRUPHG LQ WKH LVRWRQLF EXIIHU EDVLF EXIIHUf ZLWKRXW DGGLWLRQ RI H[RJHQRXV QXFOHRWLGHV RWKHU WKDQ WUDFH DPRXQWV RI >3@873 0LWRFKRQGULD

PAGE 196

)LJXUH +\EULGL]DWLRQ WDUJHW SDQHO IRU VWUDQGVSHFLILF GHWHFWLRQ RI UXQRQ WUDQVFULSWV $ $SSUR[LPDWH JHQRPLF ORFDWLRQ RI WKH IRXU JHQHV IRU ZKLFK VHQVH DQG DQWLVHQVH ULERSUREHV ZHUH V\QWKHVL]HG DUH VKRZQ DORQJ ZLWK WKH GLUHFWLRQ RI WUDQVFULSWLRQ IURP WKH WZR SURPRWHUV LQ WKH 'ORRS UHJLRQ % 7KH /VWUDQG DQG +VWUDQG VHQVH WUDQVFULSWV FRUUHVSRQGLQJ WR WKH IRXU JHQHV VKRZQ LQ SDUW $ ZHUH V\QWKHVL]HG E\ LQ YLWUR WUDQVFULSWLRQ HOHFWURSKRUHVHG RQ b IRUPDOGHK\GHDJDURVH JHOV EORWWHG RQWR Q\ORQ 1 ILOWHUV DQG SURFHVVHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH VL[ SDQHOV D E F G H DQG If FRUUHVSRQG WR WKH VL[ K\EULGL]DWLRQ WDUJHW SDQHOV XVHG LQ WKH H[SHULPHQW VKRZQ LQ )LJXUH IRU K\EULGL]DWLRQ ZLWK UXQRQ 51$ 1RWH WKDW WKH ILOWHUV KDYH EHHQ SUHFLVHO\ WULPPHG EHORZ HDFK HWKLGLLLPVWDLQHG EDQG SULRU WR K\EULGL]DWLRQ WR UHPRYH WKH LQHYLWDEOH VKRUWHU WUDQVFULSWV ZKLFK ZRXOG LQWHUIHUH ZLWK TXDQWLWDWLRQ ,Q WKLV K\EULGL]DWLRQ IRUPDW UXQRQ WUDQVFULSWLRQ IURP WKH /VWUDQG SURPRWHU /63f ZRXOG EH GHWHFWHG E\ WKH WKUHH / VWUDQG VHQVH WUDQVFULSWV RI 6 ODQH f 1' ODQH f DQG 1' ODQH f 7UDQVFULSWLRQ IURP WKH +VWUDQG SURPRWHU +63f ZRXOG EH GHWHFWHG E\ WKH WKUHH +VWUDQG VHQVH WUDQVFULSWV RI 6 ODQH f 1' ODQH f DQG &\W E ODQH f

PAGE 197

+63

PAGE 198

ZHUH LVRODWHG IURP HJJV RU HPEU\RVf IURP XQIHUWLOL]HG HJJV DQG HPEU\RV DW KU KU KU KU DQG KU SRVWIHUWLOL]DWLRQ DQG XVHG LQ UXQRQ UHDFWLRQV 7KH PLWRFKRQGULDO O\VDWH ZDV WKHQ XVHG WR SUREH WKH FROG WDUJHW SDQHOV VKRZQ LQ )LJXUH %f DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV DQG DXWRUDGLRJUDSKHG WR UHYHDO SURPRWHUVSHFLILF WUDQVFULSWLRQ )LJXUH $f 7R FRUUHFW IRU GLIIHUHQFHV LQ WKH \LHOG RI PLWRFKRQGULD LVRODWHG IURP HDFK VWDJH b RI WKH PLWRFKRQGULD XVHG LQ HDFK UXQRQ UHDFWLRQ ZDV XVHG WR TXDQWLWDWH WKH OHYHO RI PW'1$ LQ HDFK SUHSDUDWLRQ E\ GRWEORWWLQJ DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV )LJXUH %f 3KRVSKRULPDJHU TXDQWLWDWLRQ RI WKH EORWV VKRZQ LQ )LJXUHV $ DQG % ZHUH XVHG WR FDOFXODWH WKH SURPRWHUVSHFLILF DQG RYHUDOO WUDQVFULSWLRQ UDWHV SHU XQLW PLWRFKRQGULDO JHQRPH DFURVV HDUO\ GHYHORSPHQW RI ; ODHYLV 7DEOH DQG )LJXUH f 7UDQVFULSWLRQ ZDV EDVDO LQ WKH XQIHUWLOL]HG HJJ DQG RQO\ VOLJKWO\ VWLPXODWHG LQ WKH HPEU\RQLF VWDJHV XS WR KRXUV RI GHYHORSPHQW 7DEOH DQG )LJXUH f 7UDQVFULSWLRQ IURP ERWK WKH /63 DQG +63 ZDV IROG KLJKHU WKDQ HJJ OHYHOV E\ KRXUV SRVWIHUWLOL]DWLRQ IROG E\ KU DQG IROG E\ KRXUV RI GHYHORSPHQW )LJXUH $f 7KH KU HPEU\R VKRZHG D GUDPDWLF ERRVW LQ WUDQVFULSWLRQDO

PAGE 199

)LJXUH 0LWRFKRQGULDO UXQRQ WUDQVFULSWLRQ LQ HDUO\ GHYHORSPHQWDO VWDJHV $ 5XQRQ WUDQVFULSWLRQ UHDFWLRQV ZHUH SHUIRUPHG XVLQJ PLWRFKRQGULD LVRODWHG IURP XQIHUWLOL]HG HJJV DQG HPEU\RQLF VWDJHV DW GLIIHUHQW WLPHV SRVWIHUWLOL]DWLRQ VKRZQ EHVLGH HDFK SDQHOf DQG WKH UDGLRODEHOHG UXQRQ SURGXFWV XVHG WR SUREH WKH FROG WDUJHW SDQHOV )LJXUH %f DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH K\EULGL]HG ILOWHUV ZHUH WKHQ ZDVKHG XQGHU VWULQJHQW FRQGLWLRQV DQG DXWRUDGLRJUDSKHG RU H[SRVHG WR SKRVSKRULPDJHU VFUHHQV IRU TXDQWLWDWLRQ ,W ZLOO EH QRWHG WKDW WKH ODVW WZR SDQHOV KDYH KLJKHU EDFNJURXQGV ZKLFK FRXOG QRW EH UHPRYHG HYHQ E\ YHU\ VWULQJHQW ZDVKHV 7KHUHIRUH WKH EDQGV ZHUH TXDQWLWDWHG LQ WKH SKRVSKRULPDJHU XVLQJ WKH DYHUDJH EDFNJURXQG RI VL[ GLIIHUHQW ORFDWLRQV RQ WKH HQWLUH ILOWHU %DFNJURXQG FRUUHFWLRQ YDOXHV ZHUH IROG PRUH IRU WKH ODVW WZR SDQHOV FRPSDUHG WR WKH RWKHU IRXU SDQHOV 7KH JHQH DQG VWUDQGVSHFLILF LGHQWLWLHV RI HDFK EDQG DUH VKRZQ RQ WRS RI WKH ILJXUH ODQHV f % b RI WKH PLWRFKRQGULD IURP WKH UXQRQ UHDFWLRQ RI HDFK GHYHORSPHQWDO VWDJH EHIRUH UDGLRODEHO DGGLWLRQf ZHUH XVHG WR TXDQWLWDWH WKH PW'1$ OHYHO LQ WKDW VDPSOH E\ GRW EORWWLQJ DIWHU 51$VH WUHDWPHQW DQG DONDOL GHQDWXUDWLRQ DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH EORWV ZHUH DXWRUDGLRJUDSKHG DQG H[SRVHG WR SKRVSKRULPDJHU VFUHHQV IRU TXDQWLWDWLRQ 7KHVH TXDQWLWDWLRQV ZHUH XVHG WR QRUPDOL]H WKH YDOXHV RI WUDQVFULSWLRQ UDWH IRU HDFK GHYHORSPHQWDO VWDJH 7DEOH f

PAGE 200

: = (JJ f KU f KU f KU f KU f KU KU KU P U4 24 O , W I , n 6 /f 1' /f 6 +f 1', +f &\W E +f 1' /f

PAGE 201

7DEOH 3URPRWHUZLVH DQG RYHUDOO WUDQVFULSWLRQ UDWHV SHU XQLW PLWRFKRQGULDO JHQRPH GXULQJ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV /63r +63r 2YHUDOOr (JJ KUrr KUrr KUrr KUrr KUrr r 7KH SKRVSKRULPDJHU TXDQWLWDWLRQ RI HDFK WUDQVFULSW LQ WKH GHYHORSPHQWDO VWDJHV VKRZQ LQ )LJXUH $ ZDV FRUUHFWHG IRU WKH VSHFLILF DFWLYLW\ RI >3@873 XVLQJ WKH QXPEHU RI 8 UHVLGXHV LQ WKH UXQRQ WUDQVFULSWV LQ WKH UHJLRQ RI K\EULGL]DWLRQ ZLWK WKH FROG WDUJHW 7KH FRUUHFWHG YDOXHV ZHUH WKHQ QRUPDOL]HG WR WKH OHYHO RI PW'1$ LQ WKDW VWDJH )LJXUH %f WR FRUUHFW IRU GLIIHUHQFHV LQ WKH \LHOG RI PLWRFKRQGULD DQG DOVR WR H[SUHVV WKH WUDQVFULSWLRQ UDWH WR XQLW PLWRFKRQGULDO JHQRPH 7KH YDOXHV DUH H[SUHVVHG DV DUELWUDU\ XQLWV rr 7LPH SRVWIHUWLOL]DWLRQ

PAGE 202

)LJXUH 3URPRWHUZLVH DQG RYHUDOO WUDQVFULSWLRQ UDWHV GXULQJ HDUO\ GHYHORSPHQW $ 7KH JUDSK VKRZV WKH PLWRFKRQGULDO WUDQVFULSWLRQ UDWHV PHDVXUHG LQ XQIHUWLOL]HG HJJV DQG ILYH GLVWLQFW GHYHORSPHQWDO VWDJHV RI ; ODHYLV 7KH FRPELQHG YDOXHV IRU WUDQVFULSWLRQ IURP HDFK SURPRWHU 7DEOH f ZHUH XVHG WR H[SUHVV WKH WUDQVFULSWLRQ UDWH DV IROG RYHU HJJ ZLWK WKH HJJ OHYHOV VHW WR XQLW\ % 7KH JUDSK VKRZV WKH RYHUDOO WUDQVFULSWLRQ UDWH LQ WKH PLWRFKRQGULD RI XQIHUWLOL]HG HJJV DQG HPEU\RV DW ILYH GLVWLQFW WLPHV SRVWIHUWLOL]DWLRQ 7KH YDOXHV IRU RYHUDOO WUDQVFULSWLRQ IURP WKH +63 DQG /63 7DEOH f ZHUH XVHG WR H[SUHVV WKH RYHUDOO WUDQVFULSWLRQ UDWH DV IROG RYHU HJJ ZLWK WKH HJJ OHYHO VHW WR XQLW\

PAGE 203

7LPH SRVWIHUWLOL]DWLRQ &G 2YHUDOO 5DWH IROG RYHU HJJf

PAGE 204

DFWLYLW\ ZLWK WKH WUDQVFULSWLRQ UDWH IURP WKH /63 DQG +63 EHLQJ IROG DQG IROG KLJKHU WKDQ HJJ OHYHOV UHVSHFWLYHO\ )LJXUH $f 0LWRFKRQGULDO WUDQVFULSWLRQ LQ WKH KU HPEU\R DOWKRXJK IROG OHVV WKDQ WKH KU VWDJH ZDV VWLOO VLJQLILFDQWO\ HOHYDWHG EHLQJ IROG DQG IROG KLJKHU WKDQ HJJ OHYHOV IRU WKH /63 DQG +63 UHVSHFWLYHO\ )LJXUH $f &RPSDULVRQ RI WKH DFWLYLW\ RI WKH WZR SURPRWHUV 7DEOH f VKRZV WKH +63 WR EH IROG PRUH DFWLYH WKDQ /63 XS WR WKH KU VWDJH DQG IROG PRUH DFWLYH DW ODWHU WLPHV 7KHUHIRUH WKH +63 DSSHDUV WR EH LQWULQVLFDOO\ PRUH DFWLYH LQ YLYR LQ DJUHHPHQW ZLWK WKH LQ YLWUR ILQGLQJV RI $QWRVFKHFKNLQ DQG %RJHQKDJHQ f ,Q FRQFOXVLRQ WKH RYHUDOO SLFWXUH ZDV RQH LQ ZKLFK PLWRFKRQGULDO WUDQVFULSWLRQ ZDV EDVDO LQ WKH XQIHUWLOL]HG HJJ DQG VOLJKWO\ VWLPXODWHG IROG RYHU HJJf LQ HDUO\ HPEU\RV XS WR KRXUV RI GHYHORSPHQW DIWHU ZKLFK WKHUH ZDV D GUDPDWLF DFWLYDWLRQ RI WUDQVFULSWLRQDO DFWLYLW\ E\ KRXUV RI GHYHORSPHQW IROG RYHU HJJf 7KH UDWHV WKHQ GURSSHG WR VOLJKWO\ ORZHU EXW VLJQLILFDQW IROG RYHU HJJf OHYHOV LQ WKH KRXUROG HPEU\R )LJXUH %f $ FRPSDULVRQ RI WKH PLWRFKRQGULDO WUDQVFULSWLRQ UDWHV RI WKHVH GLVWLQFW GHYHORSPHQWDO VWDJHV ZLWK WKH VWHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO WUDQVFULSWV DFURVV HDUO\ GHYHORSPHQW RI ; ODHYLV GLVFXVVHG LQ &KDSWHU f VKRZV D JRRG

PAGE 205

FRUUHODWLRQ EHWZHHQ WKH VWHDG\ VWDWH OHYHOV DQG WUDQVFULSWLRQDO DFWLYLW\ )LJXUH f 6WHDG\ VWDWH WUDQVFULSW OHYHOV ZHUH EDVDO XS WR KRXUV SRVWIHUWLOL]DWLRQ DIWHU ZKLFK WKH OHYHOV LQFUHDVHG WR a IROG RYHU HJJ E\ KU IROG E\ KU DQG IROG E\ KU SRVWn IHUWLOL]DWLRQ IROORZHG E\ D ORZHU EXW VLJQLILFDQW OHYHO RI IROG RYHU HJJ E\ GD\V RI GHYHORSPHQW OLQH JUDSK LQ )LJXUH f 7KH PLWRFKRQGULDO WUDQVFULSWLRQDO DFWLYLW\ PHDVXUHG DW GLIIHUHQW WLPHV SRVWIHUWLOL]DWLRQ VKRZHG LQFUHDVLQJ WUHQGV VHYHUDO KRXUV SULRU WR WKH PHDVXUHG LQFUHDVHV LQ VWHDG\ VWDWH OHYHOV EDU JUDSK LQ )LJXUH f DVVXPLQJ WKDW WKH GLIIHUHQFHV LQ WXUQRYHU RI WKH 51$V LI DQ\ DUH PLQLPDO )RU H[DPSOH WKH WUDQVFULSWLRQ UDWHV RI WKH KU DQG KU HPEU\RV ZHUH IROG RYHU HJJ OHYHOV LQGLFDWLQJ WKDW KLJKHU PLWRFKRQGULDO WUDQVFULSWLRQ GXULQJ WKHVH WLPHV LQ YLYR ZRXOG KDYH DOORZHG WKH DFFXPXODWLRQ RI WKH 51$ VWHDG\ VWDWH OHYHOV WR IROG RYHU HJJ IURP WKH EDVDO OHYHOV IRXQG LQ WKH XQIHUWLOL]HG HJJ DQG WKH KU HPEU\R $OVR WKH YHU\ KLJK WUDQVFULSWLRQDO UDWHV PHDVXUHG LQ WKH PLWRFKRQGULD RI WKH KU HPEU\R LQGLFDWLQJ YHU\ DFWLYH PLWRFKRQGULDO WUDQVFULSWLRQ LQ YLYR ZRXOG KDYH DOORZHG WKH GUDPDWLF DFFXPXODWLRQ IROG RYHU HJJ OHYHOVf RI WKH WUDQVFULSW OHYHOV E\ KRXUV RI GHYHORSPHQW

PAGE 206

)LJXUH &RPSDULVRQ RI PLWRFKRQGULDO WUDQVFULSWLRQ UDWHV DQG VWHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO WUDQVFULSWV GXULQJ HDUO\ GHYHORSPHQW RI ; ODHYLV $ VFKHPDWLF FRPSDULVRQ RI WUDQVFULSWLRQ UDWH DQG WUDQVFULSWV OHYHOV GXULQJ HDUO\ GHYHORSPHQW LV SUHVHQWHG 7KH OLQH JUDSK UHSUHVHQWV WKH JHQHUDO SDWWHUQ RI VWHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO WUDQVFULSWV REVHUYHG LQ WKLV VWXG\ GLVFXVVHG LQ &KDSWHU DQG VKRZQ LQ )LJXUH f 7KH EDU JUDSK UHSUHVHQWV WKH RYHUDOO PLWRFKRQGULDO WUDQVFULSWLRQ UDWHV PHDVXUHG LQ WKH FRUUHVSRQGLQJ GHYHORSPHQWDO WLPHSRLQWV XVLQJ PLWRFKRQGULD LVRODWHG IURP GLVWLQFW GHYHORSPHQWDO VWDJHV )LJXUH %f 7KH WUDQVFULSWLRQ UDWH DQG WUDQVFULSW OHYHOV VKRZQ RQ WKH UHVSHFWLYH
PAGE 207

7LPH SRVWIHUWLOL]DWLRQ 7UDQVFULSW OHYHOV IROG RYHU HJJf 7UDQVFULSWLRQ 5DWH IROG RYHU HJJf (IIO

PAGE 208

%\ VHYHQ GD\V RI GHYHORSPHQW WKH VWHDG\ VWDWH OHYHOV KDYH GURSSHG WR ORZHU OHYHOV IROG RYHU HJJf FRPSDUHG WR WKH KRXU WDGSROH )LJXUH f 7KLV VXJJHVWV WKDW DIWHU WKH LQLWLDO EXUVW RI YHU\ DFWLYH WUDQVFULSWLRQ LQ WKH GHYHORSLQJ HPEU\R WUDQVFULSWLRQ UHWXUQV WR D ORZHU EXW VLJQLILFDQW OHYHO &RQVLVWHQW ZLWK WKLV VXJJHVWLRQ WKH WUDQVFULSWLRQ UDWH PHDVXUHG LQ WKH KU HPEU\R ZDV KLJK IROG RYHU HJJ OHYHOf EXW DERXW IROG ORZHU WKDQ WKDW RI WKH KU HPEU\R IROG RYHU HJJ OHYHOf VXJJHVWLQJ WKDW WKH WUDQVFULSWLRQ DFWLYLW\ RI WKH PLWRFKRQGULD ZDV VWDELOL]LQJ WR D ORZHU EXW VLJQLILFDQW OHYHO DIWHU D EXUVW RI V\QWKHVLV GXULQJ HDUO\ HPEU\RJHQHVLV 7R DWWHPSW WR LQYHVWLJDWH WKH SRVVLEOH PHFKDQLVWLF GLIIHUHQFHV DPRQJ WKH PLWRFKRQGULD RI WKHVH GLVWLQFW GHYHORSPHQWDO VWDJHV ZLWK UHVSHFW WR WKH UHDGLQHVV IRU WUDQVFULSWLRQ LW ZDV K\SRWKHVL]HG WKDW DW OHDVW SDUW RI WKHVH GLIIHUHQFHV FRXOG EH UHODWHG WR WKH ELRFKHPLFDO FRPSRVLWLRQ RI WKH PLWRFKRQGULD DW HDFK GHYHORSPHQWDO WLPHSRLQW ([WHQVLYH IRRWSULQWLQJ DQDO\VHV RI WKH PW'1$ FRQWURO UHJLRQV GLG QRW UHYHDO DQ\ GLIIHUHQFHV LQ SURWHLQ'1$ LQWHUDFWLRQV GXULQJ EDVDO RU DFWLYDWHG WUDQVFULSWLRQ &KDSWHU f +HQFH LW LV SRVVLEOH WKDW WKH PLWRFKRQGULDO WUDQVFULSWLRQDO DSSDUDWXV FRXOG DOZD\V EH LQ D VWDWH RI UHDGLQHVV GXULQJ HDUO\ GHYHORSPHQW $Q XQNQRZQ GHYHORSPHQWDO

PAGE 209

FXH ZKLFK FRXOG EH SURWHLQV QRQSURWHLQ IDFWRUV RU FKDQJHV LQ PLWRFKRQGULDO SK\VLRORJ\ FRXOG WULJJHU WUDQVFULSWLRQDO DFWLYDWLRQ %DVHG RQ WKH K\SRWKHVLV WKDW RQH RI WKH ELRFKHPLFDO GLIIHUHQFHV DPRQJ WKH GHYHORSPHQWDO VWDJHV LV UHODWHG WR WKH PLWRFKRQGULDO HQHUJ\ OHYHOV D VLPSOH H[SHULPHQW ZDV FRQGXFWHG 7KLV H[SHULPHQW ZDV EDVHG RQ WKH LGHD WKDW DQ LQ YLWUR VLPXODWLRQ RI DFWLYH PLWRFKRQGULDO PHWDEROLVP SXWDWLYHO\ IRXQG LQ WUDQVFULSWLRQDOO\ DFWLYH HPEU\RQLF VWDJHVf FRXOG EH DFFRPSOLVKHG E\ XVLQJ QRQ VWLPXODWHG PLWRFKRQGULD SXWDWLYHO\ IRXQG LQ WUDQVFULSWLRQDOO\ OHVV DFWLYH HPEU\RQLF VWDJHVf DQG WULFDUER[\OLF DFLG F\FOH LQWHUPHGLDWHV )RU WKLV H[SHULPHQW PLWRFKRQGULD ZHUH LVRODWHG IURP KRXUROG HPEU\RV D VWDJH DW ZKLFK WUDQVFULSWLRQ LV QRW \HW IXOO\ DFWLYDWHG RQO\ a IROG RYHU HJJf (TXDO DOLTXRWV HDFK HTXLYDOHQW WR HPEU\RVf RI WKH PLWRFKRQGULDO VXVSHQVLRQ ZHUH LQFXEDWHG LQ EDVLF EXIIHU SDQHO $ RI )LJXUH $f EDVLF EXIIHU SOXV VRGLXP SKRVSKDWH SDQHO %f EDVLF EXIIHU $'3 SDQHO &f EDVLF EXIIHU DNHWRJOXWDULF DFLG SDQHO 'f EDVLF EXIIHU SKRVSKDWH DQG $'3 SDQHO (f EDVLF EXIIHU SKRVSKDWH $'3 DQG DNHWRJOXWDULF DFLG SDQHO )f RU EDVLF EXIIHU $73 SDQHO *f )LJXUH % VKRZV WKH 3KRVSKRULPDJHU TXDQWLWDWLRQ RI WKH RYHUDOO WUDQVFULSWLRQ UDWHV PHDVXUHG ZLWK WKHVH

PAGE 210

)LJXUH (IIHFW RI DGGLWLRQ RI PHWDEROLF LQWHUPHGLDWHV RQ WKH WUDQVFULSWLRQ UDWH RI KU VWDJH PLWRFKRQGULD $ (TXDO DOLTXRWV RI PLWRFKRQGULD LVRODWHG IURP GHYHORSLQJ HPEU\RV DW KRXUV SRVWIHUWLOL]DWLRQ ZHUH XVHG IRU UXQRQ UHDFWLRQV LQ EDVLF EXIIHU SDQHO f EDVLF EXIIHU P0 VRGLXP SKRVSKDWH SDQHO f EDVLF EXIIHU X0 $'3 SDQHO f EDVLF EXIIHU P0 D NHWRJOXWDUDWH SDQHO f EDVLF EXIIHU P0 VRGLXP SKRVSKDWH X0 $'3 SDQHO f EDVLF EXIIHU P0 VRGLXP SKRVSKDWH X0 $'3 P0 DNHWRJOXWDUDWH SDQHO f DQG EDVLF EXIIHU P0 $73 SDQHO f 7KH ODEHOHG UXQRQ SURGXFWV ZHUH WKHQ GHWHFWHG E\ K\EULGL]DWLRQ ZLWK QRQUDGLRDFWLYH JHQH DQG VWUDQGVSHFLILF 51$ WDUJHW SDQHOV 7KH VHYHQ WDUJHW SDQHOV ZHUH FKHFNHG IRU XQLIRUPLW\ RI ORDGLQJ DQG EORW WUDQVIHU E\ YLVXDOL]DWLRQ XQGHU XYOLJKW QRW VKRZQf /DQHV GHWHFW WUDQVFULSWLRQ IURP WKH /VWUDQG SURPRWHU /63f 7KH ODQH LGHQWLILFDWLRQ LV DV IROORZV 'ORRS ODQH f 6 ODQH f 1' ODQH f 1' ODQH f &\W E ODQH f &2 ,, ODQH f DQG 1' ODQH f /DQHV KDV WKH VDPH JHQH RUGHU DV ODQHV EXW GHWHFW WUDQVFULSWLRQ IURP WKH +VWUDQG SURPRWHU +63f % 3KRVSKRULPDJHU TXDQWLWDWLRQ RI WKH EORW LQ SDUW $ ZDV XVHG WR FDOFXODWH WKH RYHUDOO WUDQVFULSWLRQ UDWH LQ HDFK WUHDWPHQW DQG WKH UDWH LV H[SUHVVHG DV IROG RYHU WKDW REWDLQHG LQ WKH EDVLF EXIIHU 7KH VHYHQ UXQRQ FRQGLWLRQV EDUV f FRUUHVSRQG WR WKH VDPH RUGHU RI FRQGLWLRQV GHVFULEHG IRU SDQHOV LQ SDUW $

PAGE 212

)LJXUH FRQWLQXHG

PAGE 213

GLIIHUHQW VXEVWUDWHV 7KH WUDQVFULSWLRQDO DFWLYLW\ RI WKH PLWRFKRQGULD IURP WKH KRXUROG HPEU\R VKRZHG D GUDPDWLF LQGXFWLRQ f§ IROG RYHU EDVLF EXIIHUf ZLWK WKH DGGLWLRQ RI DOO WKH VXEVWUDWHV QHHGHG IRU HQGRJHQRXV SURGXFWLRQ RI $73 LQ WKH PLWRFKRQGULD WUHDWPHQW LQ )LJXUHV $ t %f $GGLWLRQ RI H[RJHQRXV $73 WUHDWPHQW f RU ORZ OHYHO SURGXFWLRQ RI HQGRJHQRXV $73 E\ WKH DGGLWLRQ RI WKH FLWULF DFLG F\FOH LQWHUPHGLDWH DNHWRJOXWDULF DFLG WUHDWPHQW f FDXVHG D PRGHVW VWLPXODWLRQ a IROG RYHU EDVLF EXIIHUf RI WUDQVFULSWLRQ UDWH $GGLWLRQ RI $'3 DORQH WUHDWPHQW f RU $'3 SKRVSKDWH WUHDWPHQW f UHVXOWHG LQ RQO\ D IROG ERRVW LQ WUDQVFULSWLRQ UDWH )LJXUH %f 7KH VWLPXODWLRQ RI WUDQVFULSWLRQ E\ HQGRJHQRXV SURGXFWLRQ RI $73 LQ WKH PLWRFKRQGULD ZDV IXUWKHU LQYHVWLJDWHG XVLQJ LQKLELWRUV RI R[LGDWLYH SKRVSKRU\ODWLRQ )LJXUH f (TXDO DOLTXRWV RI PLWRFKRQGULD LVRODWHG IURP KRXUROG HPEU\RV ZHUH LQFXEDWHG LQ EDVLF EXIIHU WUHDWPHQW LQ )LJXUH $ t %f EDVLF EXIIHU $73 WUHDWPHQW f EDVLF EXIIHU $'3 SKRVSKDWH DQG DNHWRJOXWDULF DFLG WUHDWPHQW f WUHDWPHQW XJPO DFWLQRP\FLQ WUHDWPHQW f WUHDWPHQW XJPO $QWLP\FLQ $ WUHDWPHQW f RU WUHDWPHQW X0 $WUDFW\ORVLGH WUHDWPHQW f 7KH ODEHOHG UXQRQ SURGXFWV

PAGE 214

)LJXUH (IIHFW RI DGGLWLRQ RI PHWDEROLF LQKLELWRUV RQ WKH WUDQVFULSWLRQ UDWH RI KU VWDJH PLWRFKRQGULD $ (TXDO DOLTXRWV RI PLWRFKRQGULD LVRODWHG IURP KU VWDJH HPEU\RV ZHUH XVHG IRU UXQRQ UHDFWLRQV LQ EDVLF EXIIHU SDQHO f EDVLF EXIIHU P0 $73 SDQHO f EDVLF EXIIHU X0 $'3 P0 VRGLXP SKRVSKDWH P0 DNHWRJOXWDUDWH SDQHO f FRQGLWLRQV RI SDQHO XJPO DFWLQRP\FLQ SDQHO f FRQGLWLRQV RI SDQHO XJPO DQWLP\FLQ $ SDQHO f FRQGLWLRQV RI SDQHO X0 DFWUDFW\ORVLGH SDQHO f 7KH ODEHOHG UXQRQ SURGXFWV ZHUH WKHQ GHWHFWHG E\ K\EULGL]DWLRQ ZLWK QRQUDGLRDFWLYH JHQH DQG VWUDQGVSHFLILF 51$ WDUJHW SDQHOV 7KH VL[ WDUJHW SDQHOV ZHUH FKHFNHG IRU XQLIRUPLW\ RI ORDGLQJ DQG EORW WUDQVIHU E\ YLVXDOL]DWLRQ XQGHU XYOLJKW QRW VKRZQf 7KH LGHQWLW\ JHQH DQG VWUDQG VHQVHf RI HDFK EDQG LV VKRZQ DERYH WKH ODQHV ZLWK WKH ILUVW IRXU EDQGV GHWHFWLQJ /63 WUDQVFULSWLRQ DQG WKH QH[W VL[ EDQGV GHWHFWLQJ +63 WUDQVFULSWLRQ % 3KRVSKRULPDJHU TXDQWLWDWLRQ RI WKH DERYH EORW ZDV XVHG WR FDOFXODWH WKH RYHUDOO WUDQVFULSWLRQ UDWH REWDLQHG LQ HDFK WUHDWPHQW DQG WKH UDWH H[SUHVVHG DV IROG RYHU WKDW REWDLQHG LQ WKH EDVLF EXIIHU 7KH VL[ UXQRQ FRQGLWLRQV EDUV f FRUUHVSRQG WR WKH VDPH RUGHU RI FRQGLWLRQV GHVFULEHG IRU SDQHOV LQ SDUW $

PAGE 215

$ /63 WUDQVFULSWLRQ U] LQ +63 WUDQVFULSWLRQ R FR 4 4 2 f§ &2 4 4 e = 1' &\W E &2,,

PAGE 216

7UDQVFULSWLRQ UDWH IROG RYHU EDVLF EXIIHUf )LJXUH FRQWLQXHG

PAGE 217

ZHUH XVHG WR SUREH D K\EULGL]DWLRQ WDUJHW SDQHO RI VWUDQGVSHFLILF ULERSUREHV DQG DXWRUDGLRJUDSKHG )LJXUH $f $GGLWLRQ RI H[RJHQRXV $73 EDU LQ )LJXUH %f VWLPXODWHG WKH RYHUDOO PLWRFKRQGULDO WUDQVFULSWLRQ UDWH IROG RYHU WKH OHYHOV LQ EDVLF EXIIHU EDU f 3URGXFWLRQ RI $73 HQGRJHQRXVO\ EDU f IXUWKHU VWLPXODWHG WKH WUDQVFULSWLRQ UDWH IROG RYHU EDVLF EXIIHUf 7KH LQKLELWRUV ZHUH DGGHG WR WKLV WKUHHFRPSRQHQW V\VWHP WUHDWPHQW f EHIRUH LQLWLDWLQJ WKH UXQRQ UHDFWLRQ $GGLWLRQ RI DQWLP\FLQ $ D UHVSLUDWRU\ FKDLQ SRLVRQ ZKLFK EORFNV HOHFWURQ WUDQVIHU IURP F\WRFKURPH E WR F\WRFKURPH F FDXVHG D IROG GURS LQ UDWHV IURP WKDW RI WUHDWPHQW EDU f JLYLQJ D QHW WUDQVFULSWLRQ UDWH RI IROG EDU f RYHU WKDW RI WKH EDVLF EXIIHU EDU f $GGLWLRQ RI DWUDFW\ORVLGH DQ LQKLELWRU RI WKH DGHQLQH QXFOHRWLGH WUDQVORFDVH FDXVHG D IROG GURS LQ WUDQVFULSWLRQ UDWHV IURP WKDW RI WUHDWPHQW EDU f JLYLQJ D QHW WUDQVFULSWLRQ UDWH RI IROG EDU f RYHU WKDW RI WKH EDVLF EXIIHU EDU f $FWLQRP\FLQ DQ LQKLELWRU RI PLWRFKRQGULDO WUDQVFULSWLRQ E\ LQWHUFDODWLRQ LQWR '1$ DOPRVW FRPSOHWHO\ DEURJDWHG WUDQVFULSWLRQ EDU f 7KH UHVLGXDO ODEHOLQJ VHHQ ZLWK WKLV GUXJ SUREDEO\ UHSUHVHQWV ODEHOLQJ EHIRUH WKH GUXJ FRXOG SHQHWUDWH WKH PLWRFKRQGULD DQG LQWHUFDODWH LQWR PW'1$ ,W VKRXOG EH QRWHG WKDW

PAGE 218

WKH VWLPXODWLRQ RI WUDQVFULSWLRQ E\ WKH DGGLWLRQ RI SKRVSKDWH $'3 DQG DNHWRJOXWDULF DFLG ZDV IROG DQG IROG RYHU WKH EDVLF EXIIHU LQ )LJXUH % EDU f DQG )LJXUH % EDU f UHVSHFWLYHO\ 5XQRQ V\VWHPV LQHYLWDEO\ VKRZ WKHVH YDULDWLRQV *DLQHV f DQG DUH SUREDEO\ GXH WR PDQ\ IDFWRUV LQFOXGLQJ YDULDWLRQV LQ WKH VSHHG RI LVRODWLRQ RI PLWRFKRQGULD SXULW\ RI WKH SUHSDUDWLRQ HWF +HQFH D GLUHFW FRPSDULVRQ RI WKH HIIHFWV RI H[SHULPHQWDO SDUDPHWHUV LV PRVW YDOLG ZLWKLQ DQ H[SHULPHQW UDWKHU WKDQ EHWZHHQ H[SHULPHQWV ,Q FRQFOXVLRQ WKH REVHUYHG LQKLELWLRQ RI PLWRFKRQGULDO WUDQVFULSWLRQ E\ GUXJV VSHFLILF WR WKH UHVSLUDWRU\ FKDLQ DQWLP\FLQ $f RU WR $73$'3 WUDQVSRUW DWUDFW\ORVLGHf VKRZV WKH LPSRUWDQFH RI R[LGDWLYH SKRVSKRU\ODWLRQ HLWKHU GLUHFWO\ RU LQGLUHFWO\ IRU PW'1$ WUDQVFULSWLRQ 7KHVH UHVXOWV DOVR VXJJHVW WKDW WKH VWLPXODWLRQ RI WKH SURFHVV RI PDNLQJ $73 E\ DFWLYDWLQJ PLWRFKRQGULDO PHWDEROLVPf UDWKHU WKDQ WKH DFWXDO $73 OHYHOV ZDV FDXVLQJ WKH REVHUYHG GUDPDWLF DFWLYDWLRQ RI WUDQVFULSWLRQ LQ WKH UHODWLYHO\ XQLQGXFHG PLWRFKRQGULD RI WKH KU HPEU\R VLQFH H[RJHQRXV DGGLWLRQ RI $73 GLG QRW FDXVH WKH VDPH IROG LQGXFWLRQ RI WUDQVFULSWLRQ DV ZDV VHHQ ZLWK WKH VWLPXODWLRQ RI HQGRJHQRXV $73 V\QWKHVLV LQ WKH PLWRFKRQGULD

PAGE 219

2Q WKH EDVLV RI WKHVH UHVXOWV LW FDQ EH HQYLVDJHG WKDW WKH GHYHORSPHQWDO FXH IRU UHVXPSWLRQ RI PLWRFKRQGULDO WUDQVFULSWLRQ LQ WKH GHYHORSLQJ HPEU\R LV UHODWHG WR WKH FKDQJLQJ ELRFKHPLFDO FRPSRVLWLRQ RI WKH PLWRFKRQGULD (DUO\ HPEU\RV SULPDULO\ XWLOL]H WKH VWRFNSLOHG QXWULHQW UHVRXUFHV LQ WKH HJJV $W D SRLQW GXULQJ HDUO\ GHYHORSPHQW WKH HPEU\RQLF FHOOV ZRXOG KDYH WR VZLWFK IURP WKLV FDWDEROLF PRGH WR ERWK D FDWDEROLF DQG DQDEROLF PRGH RI PHWDEROLVP +HQFH GUDPDWLF FKDQJHV LQ PLWRFKRQGULDO PHWDEROLVP DUH SRVVLEOH LQ WKLV V\VWHP D WKHPH FRQVLVWHQW ZLWK WKH DYDLODEOH OLWHUDWXUH RQ FDUERQ IORZ GXULQJ HPEU\RJHQHVLV RI ; ODHYLV DQG RWKHU YHUWHEUDWHV GLVFXVVHG LQ GHWDLO ODWHUf $Q LQGLUHFW SUHGLFWLRQ IURP WKH DERYH UHVXOWV ZRXOG EH WKDW WKH PLWRFKRQGULDO $73 OHYHOV DUH OLNHO\ WR EH KLJKHU LQ WKH PHWDEROLFDOO\ DFWLYH VWDJHV VLQFH $73 V\QWKHVLV LV XVXDOO\ OLQNHG WR UHVSLUDWRU\ DFWLYLW\ 7R H[DPLQH WKLV LVVXH GLUHFWO\ WKH PLWRFKRQGULDO DGHQLQH QXFOHRWLGH FRQWHQW RI XQIHUWLOL]HG HJJV DQG IRXU GLVWLQFW HPEU\RQLF VWDJHV ZHUH PHDVXUHG E\ UHYHUVHG SKDVH LRQSDLUHG KLJK SHUIRUPDQFH /LTXLG &KURPDWRJUDSK\ 53+3/&f 7KH PLWRFKRQGULD ZHUH SXULILHG WZLFH RQ VXFURVH JUDGLHQWV WR PLQLPL]H F\WRSODVPLF SURWHLQ FRQWDPLQDWLRQ DQG WKH DGHQLQH QXFOHRWLGH FRQWHQW S0ROf

PAGE 220

FDOFXODWHG XVLQJ FDOLEUDWLRQ FXUYHV JHQHUDWHG ZLWK XOWUDSXUH $03 $'3 DQG $73 7KH YDOXHV ZHUH WKHQ QRUPDOL]HG WR PLWRFKRQGULDO SURWHLQ WR DFFRXQW IRU GLIIHUHQFHV LQ \LHOG RI PLWRFKRQGULD 7DEOH f 7KH $73 OHYHOV ZHUH PRUH RU OHVV FRQVWDQW S0ROPJ PLWRFKRQGULDO SURWHLQf LQ WKH XQIHUWLOL]HG HJJV DQG HPEU\RV XQWLO KRXUV RI GHYHORSPHQW +RZHYHU $73 OHYHOV LQ WKH KU HPEU\R VKRZHG D IROG LQFUHDVH RYHU HJJ OHYHOV 7DEOH f 7KH IROG LQFUHDVH LQ WKH KU HPEU\R ZDV VWLOO HYLGHQW ZKHQ WKH DGHQLQH QXFOHRWLGH OHYHOV ZHUH H[SUHVVHG DV WKH HQHUJ\ FKDUJH UDWLR RI >$73 @WR >$'3 $03@f ZKLFK WDNHV LQWR FRQVLGHUDWLRQ WKH FRQFHQWUDWLRQV RI DOO WKUHH VSHFLHV RI DGHQLQH QXFOHRWLGHV 7DEOH f 7KH LQGLYLGXDO OHYHOV RI $03 DQG $'3 KRZHYHU GR QRW VKRZ DQ\ SDUWLFXODU WUHQGV ZLWK UHVSHFW WR GHYHORSPHQWDO WLPH ,Q FRQFOXVLRQ WKHVH GDWD LQGLFDWH LQFUHDVHG PLWRFKRQGULDO DFWLYLW\ LQ WKH KU HPEU\R FRPSDUHG WR WKH HDUOLHU GHYHORSPHQWDO WLPHSRLQWV FRQVLVWHQW ZLWK WKH REVHUYDWLRQV PDGH DERYH ,Q FRQWUDVW WKH WRWDO DGHQLQH QXFOHRWLGH FRQWHQW SHU HPEU\R ZDV DOPRVW FRQVWDQW GXULQJ HDUO\ GHYHORSPHQW 7DEOH f $73 OHYHOV LQ WKH HJJV DQG IRXU HDUO\ GHYHORSPHQWDO VWDJHV ZHUH S0RO SHU HJJ RU HPEU\R ZKLFK WUDQVODWHV WR DQ $73 FRQFHQWUDWLRQ RI P0 SHU HJJ RU HPEU\R LI D

PAGE 221

7DEOH 0LWRFKRQGULDO DGHQLQH QXFOHRWLGH OHYHOV GXULQJ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV $03r $'3r $73r (QHUJ\rr &KDUJH (JJ PLQrrr KUrrr KUrrr r 7KH UHSRUWHG YDOXHV DUH WKH OHYHOV IRXQG E\ 53+3/& LQ GRXEOHn VXFURVH JUDGLHQW SXULILHG PLWRFKRQGULD IURP HJJV RU HPE\URV DW GLVWLQFW WLPHV SRVWIHUWLOL]DWLRQ DQG DUH H[SUHVVHG DV S0RO SHU PJ PLWRFKRQGULDO SURWHLQ rr (QHUJ\ FKDUJH LV WKH UDWLR RI WKH FRQFHQWUDWLRQ RI $73 WR WKRVH RI $'3 DQG $03 rrr 7LPH SRVWIHUWLOL]DWLRQ

PAGE 222

7DEOH 7RWDO DGHQLQH QXFOHRWLGH OHYHOV LQ XQIHUWLOL]HG HJJV DQG HDUO\ GHYHORSPHQWDO VWDJHV RI ;HQRSXV ODHYLV $73 S0ROfr P0frr $'3 S0ROfr P0frr $03 S0ROfr P0frr (JJ PLQ KU KU KU r S0RO SHU HJJ RU HPEU\R rr &RQFHQWUDWLRQV DUH H[SUHVVHG DV P0 DVVXPLQJ D PLQLPXP YROXPH RI XO IRU HDFK HJJ DQG HPEU\R 7LPH SRVWIHUWLOL]DWLRQ

PAGE 223

WRWDO YROXPH RI XO SHU HJJ RU HPEU\R LV DVVXPHG $'3 OHYHOV ZHUH a S0RO SHU HJJ RU HPEU\R ZKLFK ZRXOG EH DERXW P0 SHU HJJ RU HPEU\R 7DEOH f +HQFH WKH PLWRFKRQGULDO $73 OHYHOV LQFUHDVH LQ WKH FRQWH[W RI FRQVWDQW OHYHOV RI WRWDO FHOOXODU $73 DQG $73$'3 UDWLRV LQGLFDWLQJ FOHDUFXW GLIIHUHQFHV LQ PLWRFKRQGULDO SK\VLRORJ\ DW ODWHU GHYHORSPHQWDO WLPHSRLQWV 'LVFXVVLRQ 0LWRFKRQGULDO JHQH H[SUHVVLRQ FDQ EH SRWHQWLDOO\ UHJXODWHG DW DW OHDVW IRXU EURDG OHYHOV ,Q WKH ILUVW OHYHO UHJXODWLRQ FDQ EH GLUHFWO\ DW WKH OHYHO RI WUDQVFULSWLRQ RI WKH PW'1$ OHDGLQJ WR LQFUHDVHG P51$ DQG SURWHLQ OHYHOV $QRWKHU ZD\ WR HQKDQFH P51$ OHYHOV ZRXOG EH WR DPSOLI\ WKH JHQH GRVDJH E\ LQFUHDVLQJ WKH PW'1$ FRQFHQWUDWLRQ ZKLFK ZRXOG LQGLUHFWO\ LQFUHDVH 51$ OHYHOV *HQH UHJXODWLRQ FDQ DOVR RFFXU DW D SRVWWUDQVFULSWLRQDO OHYHO E\ DOWHULQJ 51$ VWDELOLW\ DQG WXUQRYHU LQ UHVSRQVH WR FHOOXODU VWLPXOL $ IRXUWK PHFKDQLVP FRXOG EH DW WKH OHYHO RI PLWRFKRQGULDO WUDQVODWLRQ ZKLFK ZRXOG EH FORVHO\ LQWHUOLQNHG ZLWK SRVWWUDQVFULSWLRQDO PRGLILFDWLRQV VXFK DV 51$ HGLWLQJ RU SRO\DGHQ\ODWLRQ (YLGHQFH IRU GHYHORSPHQWDO UHJXODWLRQ RI SRO\DGHQ\ODWLRQ %KDW HW DO f DQG 51$ HGLWLQJ 5HDG HW DO

PAGE 224

f KDYH EHHQ UHSRUWHG IRU 7U\SDQRVRPD EUXFHL DQG 7 FRQJROHQVH PLWRFKRQGULD EHWZHHQ WKH SURF\FOLF R[LGDWLYHf DQG EORRGVWUHDP JO\FRO\WLFf IRUPV *HQH GRVDJH DV D UHJXODWRU RI WUDQVFULSW OHYHOV KDV EHHQ UHSRUWHG LQ SODQW PLWRFKRQGULD RI PDL]H =HD PD\Vf ZKHUH VHOHFWLYH '1$ DPSOLILFDWLRQ RI VXEJHQRPLFVL]H IUDJPHQWV KDV EHHQ VKRZQ WR UHJXODWH WUDQVFULSW OHYHOV 0XLVH DQG +DXVZLUWK f ZLWK D GLUHFW FRUUHODWLRQ EHWZHHQ PLWRFKRQGULDO JHQH FRS\ QXPEHU DQG PLWRFKRQGULDO WUDQVFULSWLRQDO UDWH 7KH RQO\ UHSRUW RI DQ DQDORJRXV PHFKDQLVP LQ DQLPDO PLWRFKRQGULD KDV EHHQ IRU PDPPDOLDQ VWULDWHG PXVFOHV :LOOLDPV HW DO f 7KH VWHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO U51$ DQG &\W E P51$ ZHUH IRXQG WR LQFUHDVH LQ SDUDOOHO ZLWK PW'1$ OHYHOV ZKHQ R[LGDWLYH FDSDFLW\ RI UDEELW VWULDWHG PXVFOHV ZDV LQGXFHG E\ ORQJWHUP HOHFWULFDO VWLPXODWLRQ FRQGLWLRQV ZKLFK VLPXODWH H[HUFLVHf VXJJHVWLQJ WKDW YDULDWLRQ LQ JHQH GRVDJH ZDV WKH PDMRU UHJXODWRU\ HYHQW :LOOLDPV f 5HJXODWLRQ RI PLWRFKRQGULDO WUDQVFULSW OHYHOV GXULQJ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV VHHPV WR FOHDUO\ EHORQJ WR WKH ILUVW FDWHJRU\ PHQWLRQHG DERYH QDPHO\ UHJXODWLRQ DW WKH OHYHO RI WUDQVFULSWLRQ RI PW'1$ 7KH PW'1$ OHYHOV LQ WKLV V\VWHP GR QRW

PAGE 225

YDU\ GXULQJ WKH ILUVW WZR GD\V RI GHYHORSPHQW UHPDLQLQJ DW aQJ SHU HPEU\R &KDVH DQG 'DZLG f +HQFH YDULDWLRQ LQ JHQH GRVDJH LV QRW WKH PDMRU UHJXODWRU\ HYHQW 0LWRFKRQGULDO UXQRQ WUDQVFULSWLRQ DVVD\V ZHUH XVHG WR FRPSDUH WKH WUDQVFULSWLRQDO UDWHV RI PLWRFKRQGULD LVRODWHG IURP XQIHUWLOL]HG HJJV RU GLVWLQFW HPEU\RQLF VWDJHV LQ ZKLFK WUDQVFULSW OHYHOV ZHUH HLWKHU EDVDO RU GLIIHUHQWLDOO\ HOHYDWHG )LJXUH $f 7KH UDWHV ZHUH QRUPDOL]HG WR WKH PW'1$ OHYHOV IRXQG LQ WKH PLWRFKRQGULD RI WKDW FRUUHVSRQGLQJ VWDJH )LJXUH %f DQG H[SUHVVHG DV IROG RYHU WKH UDWHV PHDVXUHG IRU XQIHUWLOL]HG HJJV )LJXUH $ t %f 7KH /VWUDQG DQG +VWUDQG SURPRWHUV /63 t +63 UHVSHFWLYHO\f ZHUH GLIIHUHQWLDOO\ DFWLYH ZLWK WKH +63 EHLQJ PRUH DFWLYH DW DOO WLPHV 7DEOH f FRQVLVWHQW ZLWK WKH REVHUYDWLRQV RI $QWRVFKHFKNLQ DQG %RJHQKDJHQ f WKDW WKH ;HQRSXV +63 LV PDQ\ IROG PRUH DFWLYH WKDQ WKH /63 LQ WKH SUHVHQFH RI [OPW7)$ LQ LQ YLWUR WUDQVFULSWLRQ DVVD\V 7KH PRVW VLJQLILFDQW ILQGLQJ RI WKHVH H[SHULPHQWV ZDV WKDW WUDQVFULSWLRQ UDWHV FRUUHODWHG ZLWK WKH SDWWHUQ RI VWHDG\ VWDWH OHYHOV RI WKH PLWRFKRQGULDO WUDQVFULSWV )LJXUH f 7KH WUDQVFULSWLRQ UDWH ZDV EDVDO LQ WKH XQIHUWLOL]HG HJJ DQG KU HPEU\RV FRUUHODWLQJ ZLWK WKH PHDVXUHG ORZ OHYHOV RI PLWRFKRQGULDO WUDQVFULSWV FRPSDUHG WR

PAGE 226

ODWHU HPEU\RQLF VWDJHVf 6OLJKWO\ LQFUHDVHG UDWHV IROG RYHU HJJf ZHUH PHDVXUHG IRU WKH KU DQG KU HPEU\RV 7KH VWHDG\ VWDWH OHYHO RI WUDQVFULSWV LQ WKH KU HPEU\R ZDV IROG RYHU HJJ OHYHOV 7DEOH DQG )LJXUH f (PEU\RV DW KU SRVWIHUWLOL]DWLRQ VKRZHG D GUDPDWLF LQFUHDVH )LJXUH f LQ RYHUDOO WUDQVFULSWLRQ UDWH IROG RYHU HJJf ,Q FRPSDULVRQ WKH WUDQVFULSW OHYHOV RI WKH KU HPEU\R ZHUH IROG RYHU HJJ OHYHOV ZLWK DQ DSSDUHQW UDSLG DFFXPXODWLRQ RI WUDQVFULSWV LQ WKH QH[W VHYHUDO KRXUV RI GHYHORSPHQW DV WKH KU HPEU\R VKRZHG D GUDPDWLF LQFUHDVH IROG RYHU HJJf LQ WUDQVFULSW OHYHOV 7DEOH DQG )LJXUH f %DVHG RQ D FRPSDULVRQ RI WKH PDUNHG VWLPXODWLRQ RI WUDQVFULSWLRQ UDWH LQ WKH KU HPEU\R DQG WKH KLJK VWHDG\ VWDWH OHYHOV PHDVXUHG LQ WKH KU DQG KU HPEU\RV IROG DQG IROG RYHU HJJ UHVSHFWLYHO\f VXJJHVW WKDW PLWRFKRQGULDO WUDQVFULSWLRQ LV DFWLYHO\ UHVXPHG LQ WKH GHYHORSLQJ HPEU\R VRPHWLPH EHWZHHQ DQG KRXUV RI GHYHORSPHQW 7KLV VXGGHQ EXUVW RI DFWLYH WUDQVFULSWLRQ FRXOG EH UHVSRQVLEOH IRU WKH KXJH DFFXPXODWLRQ RI PLWRFKRQGULDO WUDQVFULSWV IROG RYHU HJJf VHHQ DW KRXUV RI GHYHORSPHQW 7KH GDWD DOVR VXJJHVW WKDW WKH VXGGHQ EXUVW RI WUDQVFULSWLRQ PRGXODWHV EHWZHHQ DQG KRXUV RI GHYHORSPHQW EHFDXVH WKH

PAGE 227

WUDQVFULSWLRQ UDWH PHDVXUHG LQ WKH KRXU HPEU\R PLWRFKRQGULD WKRXJK VLJQLILFDQWO\ KLJK IROG RYHU HJJf ZDV DW OHDVW IROG ORZHU WKDQ WKH KU VWDJH &RQVLVWHQW ZLWK WKLV WKHPH WKH VWHDG\ VWDWH OHYHOV PHDVXUHG LQ WKH GD\ROG WDGSROH ZDV RQO\ IROG RYHU HJJ OHYHOV ORZHU WKDQ WKDW IRXQG LQ WKH KU VWDJH IROG RYHU HJJf EXW FRPSDUDEOH WR WKH OHYHOV IRXQG LQ WKH KU HPEU\R ,Q DJJUHJDWH WKHVH UHVXOWV VXJJHVW WKDW PLWRFKRQGULDO WUDQVFULSWLRQ DFWLYHO\ UHVXPHV LQ WKH HPEU\R EHWZHHQ DQG KRXUV RI GHYHORSPHQW UHPDLQV DW D KLJK OHYHO IRU VHYHUDO KRXUV DQG VWDELOL]HV WR D ORZHU EXW VLJQLILFDQW OHYHO EHIRUH KRXUV RI GHYHORSPHQW 5DWH GDWD DUH QRW DYDLODEOH EH\RQG WKH KU VWDJH +RZHYHU WKH ORZHU VWHDG\ VWDWH OHYHOV IRXQG LQ WKH GD\ROG WDGSROH IROG RYHU HJJf VXJJHVWV D ORZHU WUDQVFULSWLRQ UDWH DIWHU GD\V RI GHYHORSPHQW HTXDO WR RU ORZHU WKDQ WKH UDWHV PHDVXUHG IRU WKH KU VWDJH 1RZ WKDW D GLUHFW FRUUHODWLRQ KDV EHHQ HVWDEOLVKHG EHWZHHQ WKH VWHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO WUDQVFULSWV DQG PLWRFKRQGULDO WUDQVFULSWLRQDO DFWLYLW\ WKH SLYRWDO TXHVWLRQ LV ZKDW FHOOXODU VWLPXOL UHJXODWH WKLV YHU\ DFWLYH UHVXPSWLRQ RI WUDQVFULSWLRQ LQ WKH HPEU\R 6LQFH LVRODWHG PLWRFKRQGULD H[KLELW FKDQJHV LQ WUDQVFULSWLRQ UDWH FRUUHODWHG ZLWK WKH VWHDG\ VWDWH OHYHOV RI WUDQVFULSWV WKH RUJDQHOOHV

PAGE 228

DUH UHWDLQLQJ WKH SXWDWLYH GHYHORSPHQWDO FXH HYHQ DIWHU SXULILFDWLRQ IURP WKH FHOOXODU FRPSRQHQWV 7KLV VXJJHVWV WKDW YHU\ VKRUWOLYHG PHGLDWRUV DUH QRW OLNHO\ WR EH LQYROYHG DQG LQGLFDWHV WKH LQYROYHPHQW RI PRUH ORQJOLYHG FKDQJHV LQ WKH LQWUDPLWRFKRQGULDO HQYLURQPHQW 7ZR VFHQDULRV FDQ EH HQYLVDJHG WR WU\ WR XQGHUVWDQG WKLV UHJXODWLRQ ,Q RQH WKH GHYHORSPHQWDO FXH FRXOG EH D QXFOHDU HQFRGHG IDFWRU ZKLFK LV LPSRUWHG LQWR WKH PLWRFKRQGULD DQG VWLPXODWHV WUDQVFULSWLRQ HLWKHU E\ GLUHFWO\ DFWLYDWLQJ WUDQVFULSWLRQ RU LQGLUHFWO\ E\ LQDFWLYDWLQJ SRWHQWLDO LQKLELWRUV RI WUDQVFULSWLRQ ,Q WKH VHFRQG VFHQDULR WKH LQYROYHPHQW RI IDFWRUV ZKLFK LQIOXHQFH PLWRFKRQGULDO PHWDEROLVP FDQ EH HQYLVDJHG 6WLPXODWLRQ RI JHQHUDO PLWRFKRQGULDO DFWLYLWLHV OLNH R[LGDWLYH SKRVSKRU\ODWLRQ DQG VXEVWUDWH ELRV\QWKHVLV FRXOG LQGLUHFWO\ DFWLYDWH WUDQVFULSWLRQ DV DOO RI WKHVH DFWLYLWLHV WDNH SODFH LQ WKH PLWRFKRQGULDO PDWUL[ ZKHUH PW'1$ WUDQVFULSWLRQ DOVR WDNHV SODFH $ JRRG FDQGLGDWH IRU WKH ILUVW PHFKDQLVP ZRXOG EH WKH PLWRFKRQGULDO WUDQVFULSWLRQ IDFWRU PW7)$ ZKLFK KDV EHHQ VKRZQ WR DFWLYDWH DQG DOVR UHSUHVV WUDQVFULSWLRQ ZLWKLQ D QDUURZ UDQJH RI FRQFHQWUDWLRQV LQ ERWK KXPDQ 'DULDJKL HW DO f DQG ;HQRSXV

PAGE 229

%DUDW*HXULGH HW DO $QWRVFKHFKNLQ DQG %RJHQKDJHQ f V\VWHPV LQ LQ YLWUR DVVD\V )XUWKHU 9LUEDVLXV DQG 6FDUSXOOD f IRXQG UHFRJQLWLRQ VLWHV IRU QXFOHDU UHVSLUDWRU\ IDFWRUV 15) t 15) LQ WKH SUR[LPDO SURPRWHU RI WKH KXPDQ PW7)$ JHQH VXJJHVWLQJ WKDW WKH FHOO FRXOG YDU\ WUDQVFULSWLRQ RI WKH PW7)$ JHQH LQ UHVSRQVH WR R[LGDWLYH UHTXLUHPHQWV 7KHVH ILQGLQJV KDYH OHG WR D SRSXODU PRGHO LQ ZKLFK IOXFWXDWLQJ VWRLFKLRPHWULHV RI WKLV SURWHLQ FRXOG UHJXODWH WUDQVFULSWLRQ RI PW'1$ 'DLUDJKL HW DO $QWRVFKHFKNLQ DQG %RJHQKDJHQ f +HQFH PW7)$ ZRXOG ILW WKH ELOO RI D QXFOHDUHQFRGHG FDQGLGDWH SURWHLQ ZKRVH WUDQVFULSWLRQ FRXOG EH XSUHJXODWHG DW VRPH WLPH GXULQJ ;HQRSXV GHYHORSPHQW OHDGLQJ WR KLJKHU LQWUDPLWRFKRQGULDO FRQFHQWUDWLRQV RI WKLV SURWHLQ DQG WUDQVFULSWLRQDO DFWLYDWLRQ ZLWK WKH OHYHO RI WKH IDFWRU FDSDEOH RI ILQH WXQLQJ WKH UHJXODWLRQ $OWKRXJK WKLV PRGHO KDV DQ DSSHDOLQJ ORJLF DQG KDV YHU\ JRRG LQ YLWUR HYLGHQFH WR VXSSRUW LW LQ YLYR HYLGHQFH JDWKHUHG LQ WKLV VWXG\ E\ LQ YLYR IRRWSULQWLQJ GLVFXVVHG LQ &KDSWHU f GRHV QRW VXSSRUW GLIIHUHQWLDO RFFXSDQF\ RI WKH PW'1$ FRQWURO UHJLRQ E\ [OPW7)$ GXULQJ EDVDO DQG DFWLYDWHG WUDQVFULSWLRQ 5DWKHU WKH SURWHLQ ZDV IRXQG WR EH FRQVWLWXWLYHO\ SUHVHQW RQ PW'1$ EHWZHHQ WKH WZR ELGLUHFWLRQDO SURPRWHUV DQG LQ UHJLRQ EHWZHHQ WKH

PAGE 230

SURPRWHUV DQG +VWUDQG UHSOLFDWLRQ VWDUW VLWH GLVFXVVHG LQ &KDSWHU VHH )LJXUHV DQG f +HQFH WKH LQ YLYR OHYHOV RI WKLV SURWHLQ DUH QRW FRUUHODWHG ZLWK FKDQJHV LQ WKH WUDQVFULSWLRQDO VWDWXV RI PLWRFKRQGULD &KDQJHV LQ WKH OHYHO RI WKLV SURWHLQ LI DQ\ PD\ KDYH RWKHU DV \HW XQLGHQWLILHG IXQFWLRQV 2WKHU WKDQ WKH PW7)$ QRQH RI WKH RWKHU NQRZQ PLWRFKRQGULDO SURWHLQV DSSHDU WR ILW WKH FULWHULD RI D JOREDO UHJXODWRU RI WUDQVFULSWLRQ H[FHSW SRVVLEO\ WKH PLWRFKRQGULDO 51$ SRO\PHUDVH LWVHOI )URP D EURDGHU SHUVSHFWLYH WKH VHFRQG VFHQDULR PHQWLRQHG DERYH DSSHDUV WR KDYH PRUH UHOHYDQFH WR WKH XQLTXH IHDWXUHV RI WKLV GHYHORSPHQWDO PRGHO 7KH GHYHORSLQJ ;HQRSXV HPEU\R LV IXOO\ GHSHQGHQW RQ WKH VWRFNSLOHG PDWHUQDO QXWULHQW UHVRXUFHV LQ WKH HJJ VXFK DV \RON DQG JO\FRJHQ DSSUR[LPDWHO\ b RI WKH GU\ ZHLJKW RI DPSKLELDQ HJJV LV JO\FRJHQf IRU LWV HDUO\ GHYHORSPHQW 0HWDEROLF VWXGLHV RI FDUERQ IORZ GXULQJ DPSKLELDQ GHYHORSPHQW KDYH UHYHDOHG VHYHUDO LQWHUHVWLQJ IHDWXUHV WKH FHQWUDO WKHPH EHLQJ RQH RI GHYHORSPHQWDO GLIIHUHQFHV LQ FDUERQ PHWDEROLVP ,Q VSLWH RI WKH KXJH UHVHUYHV RI JO\FRJHQ LQ WKH HJJ FOHDYLQJ HPEU\RV GLVSOD\ DQ fXQRUWKRGR[f PHWDEROLVP LQ WKDW WKH\ GR QRW HIILFLHQWO\ R[LGL]H VWRUHG FDUERK\GUDWH EXW UDWKHU DSSHDU WR XVH

PAGE 231

DPLQR DFLGV IURP WKH VLPLODUO\ DEXQGDQW \RON UHVHUYHV DV JHQHUDO FDWDEROLF DQG DQDEROLF FDUERQ VRXUFHV 'ZRUNLQ DQG 'ZRUNLQ5DVWO f DV VXJJHVWHG E\ WKH ORZ UHVSLUDWRU\ TXRWLHQW WKH UDWLR RI &2 RXWSXW WR 2 XVDJHf XQWLO JDVWUXODWLRQ DW ZKLFK WLPH LW DSSURDFKHG RQH 0LWRFKRQGULDO JOXWDPDWH R[LGDWLRQ DSSHDUV WR EH WKH PDLQ HQHUJ\ VRXUFH XQWLO JDVWUXODWLRQ DV UHYHDOHG E\ FRPSDULVRQV RI WKH R[LGDWLRQ RI H[RJHQRXVO\ VXSSOLHG JOXWDPDWH DQG S\UXYDWH /RYWUXS 5HLQ DQG 1HOVRQ Ef DQG PHDVXUHPHQWV RI PLWRFKRQGULDO UHVSLUDWLRQ LQ LVRODWHG RUJDQHOOHV IURP GHYHORSLQJ HPEU\RV LQ ZKLFK RQO\ JOXWDPDWH RI PDQ\ VXEVWUDWHV WHVWHGf HIILFLHQWO\ VXSSRUWHG R[\JHQ FRQVXPSWLRQ /RYWUXS5HLQ DQG 1HOVRQ Df $QRWKHU LQWHUHVWLQJ GLVFRYHU\ ZDV WKDW ;HQRSXV HPEU\RV DUH QRW QRUPDOO\ JO\FRO\WLF GXULQJ HDUO\ FOHDYDJH HYHQ WKRXJK DEXQGDQW FDUERK\GUDWH JO\FRJHQf UHVHUYHV H[LVW DQG WKH JO\FRO\WLF PDFKLQHU\ LV LQWDFW DV VKRZQ E\ WKH DFWLYDWLRQ RI JO\FRO\VLV ZKHQ R[LGDWLYH SKRVSKRU\ODWLRQ LV LQKLELWHG E\ WKH XQFRXSOHUV GLQLWURSKHQRO RU FDUERQ\O F\DQLGH SKHQ\OK\GUD]RQH 7KRPDV DQG *HUKDUW 'ZRUNLQ DQG 'ZRUNLQ5DVWO f :KHWKHU WKH RQVHW RI DFWLYH JO\FRO\VLV DW JDVWUXODWLRQ ZKHQ PRUSKRORJLFDO GLIIHUHQWLDWLRQ VWDUWVf KDV D GHYHORSPHQWDO SXUSRVH LV QRW NQRZQ DW WKLV WLPH

PAGE 232

'ZRUNLQ DQG 'ZRUNLQ5DVWO f VKRZHG WKDW DFWLYDWLRQ RI JO\FRJHQ EUHDNGRZQ DQG JO\FRO\VLV DW JDVWUXODWLRQ PD\ EH D PHWDEROLF FRQVHTXHQFH RI LQFUHDVHG IUHH $'3 LQ WKH HPEU\R DV JO\FRO\VLV FRXOG EH WUDQVLHQWO\ DFWLYDWHG E\ WKH LQMHFWLRQ RI $'3 LQWR IHUWLOL]HG HJJV +RZHYHU WKH WRWDO $'3 FRQFHQWUDWLRQ LQ QRQ PDQLSXODWHG HPEU\RV GRHV QRW LQFUHDVH EHWZHHQ WKH HJJ DQG JDVWUXOD VWDJHV 7DEOH 'ZRUNLQ DQG 'ZRUNLQ5DVWO f RU EHWZHHQ HJJV DQG HDUO\ GHYHORSPHQWDO VWDJHV XSWR KRXUV RI GHYHORSPHQW 7DEOH f +HQFH LW LV SRVVLEOH WKDW WRWDO $'3 OHYHOV PD\ QRW EH DQ DFFXUDWH PHDVXUH RI fIUHH $'3f RU WKHUPRG\QDPLFDOO\ DYDLODEOH $'3 7KHUHIRUH WKH DFWLYH SRRO RI IUHH RU DYDLODEOH $'3 PD\ LQGHHG LQFUHDVH GXULQJ WKH EO£VWXOD DQG JDVWUXOD VWDJHV HYHQ ZKLOH WRWDO $'3 OHYHOV UHPDLQ FRQVWDQW 'ZRUNLQ DQG 'ZRUNLQ5DVWO f ,Q DGGLWLRQ WR WKHVH G\QDPLF PHWDEROLF FKDQJHV IHUWLOL]DWLRQ LWVHOI WULJJHUV VSLUDO ZDYHV RI LQWUDFHOOXODU &D UHOHDVH FRQWULEXWHG E\ LQRVLWRO OLSLG K\GURO\VLV %XVD DQG 1XFFLWHOOL %XVD HW DO .XERWD HW DO f 7KLV WUDQVLHQW LQFUHDVH LQ F\WRSODVPLF FDOFLXP FRXOG KDYH SURIRXQG HIIHFWV RQ PLWRFKRQGULDO SK\VLRORJ\ 2VFLOODWRU\ FKDQJHV LQ F\WRVROLF FDOFLXP FRQFHQWUDWLRQ >&D@Ff KDYH EHHQ VKRZQ

PAGE 233

WR EH GHFRGHG LQ WKH PLWRFKRQGULD 5L]]XWR HW DO +DMQRF]N\ HW DO f OHDGLQJ WR LQFUHDVHV LQ LQWUDPLWRFKRQGULDO &D>&D@Pf ZLWKLQ VHFRQGV 5L]]XWR HW DO 5XWWHU HW DO f &DUHJXODWHV VHYHUDO PDWUL[ GHK\GURJHQDVHV LQ D FRQFHQWUDWLRQGHSHQGHQW PDQQHU 0F&RUPDFN DQG 'HQWRQ f OHDGLQJ WR WKH LGHD WKDW PLWRFKRQGULD DUH WXQHG WR UHVSRQG WR RVFLOODWLQJ >&D@F VLJQDOV +DMQRF]N\ HW DO f E\ UHJXODWLQJ R[LGDWLYH PHWDEROLVP LQ FRQFRUGDQFH ZLWK FKDQJLQJ HQHUJ\ GHPDQGV RI WKH FHOO 3UDORQJ HW DO f 8QIRUWXQDWHO\ WKH VSHFLILF HIIHFWV RI WKH LQFUHDVHG >&D@P RQ PLWRFKRQGULDO PHWDEROLVP LQ ;HQRSXV ODHYLV IHUWLOL]HG HJJV KDYH QRW EHHQ LQYHVWLJDWHG \HW 7KH SRVVLELOLW\ DOVR H[LVWV WKDW WKHUH FRXOG EH FKDQJHV LQ PLWRFKRQGULDO XOWUDVWUXFWXUH GXULQJ ; ODHYLV GHYHORSPHQW DV HLWKHU WKH FDXVH RU HIIHFW RI WKHVH PHWDEROLF FKDQJHV GXULQJ GHYHORSPHQW ,Q HOHFWURQ PLFURJUDSKV RI WKLQ VHFWLRQV PXULQH HJJ PLWRFKRQGULD DSSHDU DV VPDOO FRQGHQVHG HOHFWURQGHQVH VWUXFWXUHV ,Q FRQWUDVW WKH PLWRFKRQGULD RI WKH FHOO VWDJH HPEU\RV ZHUH VZROOHQ DQG VWUXFWXUDOO\ GLVWLQFW ZLWK QXPHURXV WUDQVYHUVHO\ DUUDQJHG FULVWDH 6WHUQ HW DO 3LNR DQG &KDVH f ZLWK D FRLQFLGHQW ULVH LQ R[\JHQ FRQVXPSWLRQ DQG F\DQLGHVHQVLWLYH $73 V\QWKHVLV 0LOOV DQG

PAGE 234

%ULQVWHU *LQVEHUJ DQG +LOOPDQ f +RZHYHU WRWDO $73 OHYHOV DQG $73$'3 UDWLRV VKRZHG D SURJUHVVLYH GHFOLQH IURP WKH FHOO VWDJH WR WKH ODWHEODVWRF\VW VWDJH *LQVEHUJ DQG +LOOPDQ f ,Q WKH GHYHORSLQJ PRXVH HPEU\R PLWRFKRQGULDO WUDQVFULSWLRQ UHVXPHV DFWLYHO\ IURP WKH FHOO VWDJH RQZDUGV DV LQGLFDWHG E\ D IROG LQFUHDVH LQ U51$ DQG &2 DQG &2 ,, P51$ OHYHOV 3LNR DQG 7D\ORU f 7KLV QHZ WUDQVFULSWLRQ SOD\V DQ HVVHQWLDO UROH LQ PLWRFKRQGULDO GLIIHUHQWLDWLRQ GXULQJ FOHDYDJH VLQFH LQKLELWRUV RI PLWRFKRQGULDO 51$ DQG SURWHLQ V\QWKHVHV DOVR EORFN WKH QRUPDO JURZWK DQG GLIIHUHQWLDWLRQ RI PLWRFKRQGULDO FULVWDH 3LNR DQG &KDVH f ,Q WKH DPSKLELDQ %XIR DUHQDUXP GH /HJQDPH HW DO f DOVR IRXQG PRGLILFDWLRQV RI PLWRFKRQGULDO XOWUDVWUXFWXUH FRUUHODWHG ZLWK PHWDEROLF FKDQJHV GXULQJ RQWRJHQHVLV 0LWRFKRQGULD RI EODVWXODH ZKLFK KDG KLJK HPEU\RQLF $73 OHYHOVf GLVSOD\HG D fFRQGHQVHG FRQIRUPDWLRQf LQ FRQWUDVW WR WKH PRUH RUWKRGR[ fVZROOHQf FRQIRUPDWLRQ RI PLWRFKRQGULD LQ D ODWHU GHYHORSPHQWDO VWDJH JLOO FLUFXODWLRQf LQ ZKLFK ORZ $73 OHYHOV ZHUH PHDVXUHG 7KH DERYH VWXGLHV SRLQW WR WKH SRVVLEOH GLIIHUHQWLDWLRQ RI WKH PLWRFKRQGULD IURP DQ fHPEU\RQLFf WR DQ fDGXOWf VWDWH LQ FRQFHUW ZLWK WKH PHWDEROLF VWHDG\ VWDWHV RI WKH FHOO $ VLPLODU PHFKDQLVP RI

PAGE 235

PLWRFKRQGULDO GLIIHUHQWLDWLRQ PD\ H[LVW LQ ;HQRSXV ODHYLV DOWKRXJK WRWDO $73 OHYHOV DQG $73$'3 UDWLRV SHU HPEU\R PHDVXUHG LQ WKLV VWXG\ ZHUH UHODWLYHO\ FRQVWDQW GXULQJ HDUO\ GHYHORSPHQW RI ; ODHYLV 7DEOH f XQOLNH WKDW VHHQ GXULQJ WKH HPEU\RJHQHVLV RI WKH PRXVH DQG %XIR DUHQDUDQ ,W VKRXOG EH QRWHG WKDW WRWDO $73 PHDVXUHPHQWV UHSRUWHG LQ WKLV VWXG\ ZHUH GRQH XVLQJ UHYHUVHGSKDVH +3/& ZKHUHDV WKH WZR VWXGLHV RQ PRXVH *LQVEHUJ DQG +LOOPDQ f DQG %XIR DUHQDUDQ GH /HJQDPH HW DL f XVHG WKH ILUHIO\ OXFLIHUDVH DVVD\ IRU WRWDO $73 PHDVXUHPHQWV 7KH SRVVLELOLW\ WKDW WKHVH WZR DVVD\V PD\ QRW EH DEVROXWHO\ FRPSOHPHQWDU\ ZLWK UHJDUG WR WKH SRRO RI $73 WKH\ PHDVXUH VKRXOG EH ERUQH LQ PLQG ZKHQ FRPSDULQJ WKHVH UHVXOWV 7KH IRUHJRLQJ GLVFXVVLRQ LQGLFDWHV WKDW FDUERQ PHWDEROLVP LV LQ D FRQVWDQW VWDWH RI IOX[ GXULQJ HPEU\RJHQHVLV RI ;HQRSXV ODHYLV ZLWK G\QDPLF FKDQJHV LQ WKH SDWWHUQV RI VXEVWUDWH PRYHPHQW DQG XWLOL]DWLRQ 0LWRFKRQGULD EHLQJ D NH\ SOD\HU LQ DOO WKHVH HQHUJ\ WUDQVDFWLRQV ZRXOG KDYH GUDPDWLFDOO\ GLIIHUHQW ELRFKHPLFDO FRPSRVLWLRQV DW GLIIHUHQW GHYHORSPHQWDO WLPHSRLQWV ,W LV ZLGHO\ EHOLHYHG WKRXJK QRW IRUPDOO\ SURYHQ WKDW WKH PW'1$ PROHFXOH LV DWWDFKHG WR WKH LQQHU PLWRFKRQGULDO PHPEUDQH E\ SURWHLQ RU OLSLG

PAGE 236

DQFKRUV $OEULQJ HW DO f ,I WKLV LV WUXH WKH PW'1$ UHSOLFDWLRQ DQG WUDQVFULSWLRQ PDFKLQHU\ ZRXOG EH LQ FORVH SUR[LPLW\ WR WKH R[LGDWLYH SKRVSKRU\ODWLRQ PDFKLQHU\ LQ WKH LQQHU PHPEUDQH DV ZHOO DV EHLQJ VXEMHFW WR WKH FKDUJH DQG S+ YDULDWLRQV FDXVHG E\ FKDQJHV LQ WKH SURWRQ JUDGLHQW +HQFH WKH K\SRWKHVLV RI WKH UHJXODWLRQ RI PLWRFKRQGULDO JHQH H[SUHVVLRQ E\ WKH GHYHORSPHQWDO FKDQJHV LQ WKH ELRFKHPLVWU\ RI WKH RUJDQHOOH LV D YLDEOH RQH 7R EHJLQ WR DGGUHVV WKLV TXHVWLRQ XVLQJ WKH PLWRFKRQGULDO UXQRQ WUDQVFULSWLRQ V\VWHP D VLPSOH H[SHULPHQW ZDV FRQGXFWHG 0LWRFKRQGULD IURP D WUDQVFULSWLRQDOO\ GRZQUHJXODWHG VWDJH OLNH WKH KU VWDJH ZHUH LQFXEDWHG LQ WKH EDVLF UXQRQ EXIIHU DORQJ ZLWK WKH 7&$ F\FOH LQWHUPHGLDWH DNHWRJOXWDUDWH $'3 DQG SKRVSKDWH 7KH ORJLF EHKLQG DGGLWLRQ RI WKHVH VXEVWUDWHV ZDV WR DWWHPSW WR VLPXODWH WKH FRQGLWLRQV IRXQG LQ WKH PLWRFKRQGULD RI D WUDQVFULSWLRQDOO\ XS UHJXODWHG VWDJH OLNH WKH RU KU HPEU\R WKH DVVXPSWLRQ EHLQJ WKDW WKHVH ODWHU VWDJHV ZRXOG KDYH D PRUH DFWLYH PLWRFKRQGULDO PHWDEROLVP $V VKRZQ LQ )LJXUH DFWLYDWLRQ RI HQGRJHQRXV $73 SURGXFWLRQ E\ WKH DGGLWLRQ RI WKHVH VXEVWUDWHV GUDPDWLFDOO\ DFWLYDWHG PLWRFKRQGULDO WUDQVFULSWLRQ IROG RYHU FRQWUROf ([RJHQRXV DGGLWLRQ RI $73 VKRZHG D ORZHU IROG LQGXFWLRQ IROG RYHU FRQWUROf

PAGE 237

VXJJHVWLQJ WKDW WKH SURFHVV RI PDNLQJ $73 UDWKHU WKDQ WKH DEVROXWH OHYHOV RI WKLV QXFOHRWLGH ZDV PHGLDWLQJ WKLV HIIHFW 7KH LPSRUWDQFH RI PDLQWDLQLQJ QRUPDO R[LGDWLYH SKRVSKRU\ODWLRQ ZDV IXUWKHU VKRZQ E\ WKH DGGLWLRQ RI DQWLP\FLQ $ D GUXJ ZKLFK LQKLELWV HOHFWURQ WUDQVIHU IURP F\WRFKURPH E WR F DORQJ ZLWK WKH VXEVWUDWHV /DEHOLQJ RI 51$ ZDV PDUNHGO\ UHGXFHG FRPSDUHG WR WKH UHDFWLRQV ZLWKRXW WKLV GUXJ )LJXUH $ t %f $WUDFW\ORVLGH D GUXJ ZKLFK LQKLELWV $73$'3 WUDQVSRUW E\ WKH DGHQLQH QXFOHRWLGH WUDQVORFDVH DOVR LQKLELWHG 51$ ODEHOLQJ )LJXUH $ t %f 7KHVH UHVXOWV VXJJHVW WKDW PLWRFKRQGULDO WUDQVFULSWLRQ LV UHVSRQVLYH WR UDSLG FKDQJHV LQ PLWRFKRQGULDO PHWDEROLVP 7KLV WUDQVFULSWLRQDO UHVSRQVH LV UDSLG UHDFKLQJ PD[LPXP UDWHV ZLWKLQ PLQXWHV RI WKH DGGLWLRQ RI WKH VXEVWUDWHV SUHOLPLQDU\ NLQHWLF GDWD QRW VKRZQf $GGLWLRQ RI WKHVH VXEVWUDWHV WR VLPLODU UXQRQ UHDFWLRQV XVLQJ PLWRFKRQGULD IURP D WUDQVFULSWLRQDOO\ PRUH DFWLYH VWDJH OLNH WKH KU WDGSROH GLG QRW FDXVH DQ\ VLJQLILFDQW VWLPXODWLRQ RI WUDQVFULSWLRQ UDWHV SUHOLPLQDU\ GDWD QRW VKRZQf VXJJHVWLQJ WKDW WKH ELRFKHPLFDO HQYLURQPHQW RI WKH KU VWDJH ZDV QRW FRQGXFLYH IRU DFWLYH R[LGDWLYH SKRVSKRU\ODWLRQ DQG WKDW WKH KU VWDJH ZDV PRUH DFWLYH

PAGE 238

$OWKRXJK WKH PLWRFKRQGULDO UXQRQ fUHVFXHf H[SHULPHQWV JLYH DGGLWLRQDO LQVLJKWV LQWR WKH OLQN EHWZHHQ WKH PHWDEROLF VWDWH RI WKH PLWRFKRQGULD DQG PLWRFKRQGULDO WUDQVFULSWLRQ WKH\ DUH DW EHVW RQO\ LQ RUJDQHOOR DVVD\V DQG PD\ QRW IXOO\ UHIOHFW WKH VLWXDWLRQ LQ YLYR ,W ZLOO EH YDOXDEOH WR KDYH DGGLWLRQDO LQ YLYR FRQILUPDWLRQ RI WKH LQGLUHFW LQWHUSUHWDWLRQV GUDZQ IURP WKH UXQRQ VWXGLHV 2QH RI WKH VLPSOH ZD\V WR FRPSDUH DQG FRQWUDVW HDUO\ GHYHORSPHQW RI ; ODHYLV IRU GLIIHUHQFHV LQ R[LGDWLYH PHWDEROLVP ZRXOG EH WR PHDVXUH WKH PLWRFKRQGULDO DGHQLQH QXFOHRWLGH OHYHOV PDLQO\ $73f RI GLVWLQFW GHYHORSPHQWDO VWDJHV 0LWRFKRQGULDO $73 FRQFHQWUDWLRQV DUH XVXDOO\ FRUUHODWHG ZLWK WKH OHYHO RI R[LGDWLYH SKRVSKRU\ODWLRQ 5HGXFHG OHYHOV RI PLWRFKRQGULDO DGHQLQH QXFOHRWLGHV PDLQO\ $73 $'3f KDYH EHHQ UHSRUWHG DIWHU LQGXFHG K\SR[LD 1DND]DZD DQG 1XQRNDZD f DQG LVFKHPLD :DWDQDEH HW DO f LQ UDW OLYHU DQG DUH ORZHU E\ b LQ IDVWJURZLQJ KHSDWRPDV %DUERXU DQG &KDQ f DQG E\ b LQ KLEHUQDWLQJ EHDUV *HKQULFK DQG $SULOOH f 7KH DGHQLQH QXFOHRWLGH FRQWHQWV RI IHWDO DQG QHZERUQ UDW OLYHU PLWRFKRQGULD DUH YHU\ ORZ EXW LQFUHDVHV WR DGXOW OHYHOV ZLWKLQ KRXUV DIWHU ELUWK $SULOOH f FRQFRPLWDQW ZLWK WKH RQVHW RI R[LGDWLYH SKRVSKRU\ODWLRQ DIWHU ELUWK

PAGE 239

,Q RUGHU WR REWDLQ DQ DSSUR[LPDWH LGHD DERXW WKH LQ YLYR OHYHOV RI R[LGDWLYH SKRVSKRU\ODWLRQ GXULQJ HDUO\ GHYHORSPHQW RI ; ODHYLV WKH PLWRFKRQGULDO $73 OHYHOV RI GLVWLQFW GHYHORSPHQWDO VWDJHV ZHUH PHDVXUHG E\ UHYHUVHG SKDVHG+3/& DQG QRUPDOL]HG WR PLWRFKRQGULDO SURWHLQ OHYHOV $73 OHYHOV DQG HQHUJ\ FKDUJH UDWLR RI $73 WR $'3 $03f RI HDUO\ VWDJHV XSWR KRXUV ZHUH PRUH RU OHVV FRQVWDQW ZLWK WKH KU VWDJH VKRZLQJ D IROG LQFUHDVH LQGLFDWLQJ D PRUH DFWLYH R[LGDWLYH PHWDEROLVP LQ WKLV VWDJH RI HPEU\RJHQHVLV 7DEOH f FRPSDUHG WR WKH HDUOLHU VWDJHV 7KH PLWRFKRQGULDO $73 OHYHOV DQG HQHUJ\ FKDUJH LQFUHDVHG LQ WKH FRQWH[W RI FRQVWDQW WRWDO DGHQLQH QXFOHRWLGH OHYHOV DQG HQHUJ\ FKDUJH UDWLRV LQ WKH HJJV DQG HPEU\RV 7DEOH f VKRZLQJ WKDW WKH PHWDEROLVP LQ WKH KU HPEU\R LV PRUH DFWLYH WKDQ LQ WKH HDUOLHU VWDJHV 0LWRFKRQGULDO WUDQVFULSWLRQ UDWH RI WKLV PHWDEROLFDOO\ PRUH DFWLYH VWDJH ZDV DOVR YHU\ KLJK IROG RYHU HJJ OHYHOVf FRPSDUHG WR HDUOLHU VWDJHV )LJXUH f VKRZLQJ D FRUUHODWLRQ EHWZHHQ WKH PHWDEROLF VWDWH RI WKH PLWRFKRQGULD DQG PLWRFKRQGULDO WUDQVFULSWLRQ ,Q FRQFOXVLRQ WKH PLWRFKRQGULDO UXQRQ WUDQVFULSWLRQ DVVD\V VKRZ WKDW WKH VWHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO WUDQVFULSWV GXULQJ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV DUH SULPDULO\ GHWHUPLQHG E\ WKH

PAGE 240

WUDQVFULSWLRQDO DFWLYLW\ RI WKH PLWRFKRQGULD 7KHUH ZDV D JRRG FRUUHODWLRQ EHWZHHQ WKH VWDJHV ZKLFK H[KLELWHG KLJK PLWRFKRQGULDO WUDQVFULSWLRQ UDWHV DQG WKH VWDJHV ZLWK DFWLYH PLWRFKRQGULDO PHWDEROLVP DV PHDVXUHG E\ DGHQLQH QXFOHRWLGH OHYHOV DQG PLWRFKRQGULDO UXQRQ fUHVFXHf H[SHULPHQWVf +HQFH WKH NH\ UHJXODWRU\ HYHQW VHHPV WR EH GHYHORSPHQWDO WUDQVLWLRQV LQ PLWRFKRQGULDO SK\VLRORJ\ +RZHYHU WKH TXHVWLRQ DV WR ZKDW PROHFXODU HYHQWV RU GHYHORSPHQWDO FXHV PLJKW FDXVH WKHVH GUDPDWLF GLIIHUHQFHV LQ PLWRFKRQGULDO PHWDEROLVP UHPDLQV RSHQ IRU LQYHVWLJDWLRQ +HQFH HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV UHPDLQV D YHU\ SRZHUIXO PRGHO V\VWHP IRU IXWXUH LQYHVWLJDWLRQV LQWR WKH OLQN EHWZHHQ PLWRFKRQGULDO PHWDEROLVP DQG PLWRFKRQGULDO JHQH H[SUHVVLRQ

PAGE 241

&+$37(5 6800$5< $1' 3(563(&7,9(6 (DUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV SURYLGHV DQ H[FHOOHQW QDWXUDO PRGHO IRU LQYHVWLJDWLQJ WKH UHJXODWLRQ RI PLWRFKRQGULDO JHQH H[SUHVVLRQ &ODVVLF VWXGLHV E\ &KDVH DQG 'DZLG f RQ WKH ELRJHQHVLV RI PLWRFKRQGULD GXULQJ ; ODHYLV GHYHORSPHQW VKRZHG WKDW SURGXFWLRQ RI QHZ PLWRFKRQGULD EHJLQV UHODWLYHO\ ODWH GXULQJ HPEU\RJHQHVLV ZLWK WKH VWRFNSLOH RI PLWRFKRQGULD a SHU HJJf LQ WKH XQIHUWLOL]HG HJJ DFWLQJ DV D UHVHUYRLU IRU WKH UDSLGO\ FOHDYLQJ HPEU\RV 7KH\ UHDFKHG WKHVH FRQFOXVLRQV EDVHG RQ PHDVXUHPHQWV RI WKH OHYHOV RI PLWRFKRQGULDO SURWHLQ PW'1$ DQG F\WRFKURPH R[LGDVH DFWLYLW\ SHU HJJ RU GHYHORSLQJ HPEU\R ZKLFK UHPDLQHG FRQVWDQW IRU DERXW GD\V RI GHYHORSPHQW WR VWDJH VZLPPLQJ WDGSROH VWDJHf WKHQ LQFUHDVHG FRRUGLQDWHO\ DQG GRXEOHG E\ WKH IHHGLQJ WDGSROH VWDJH VWDJH KRXUV SRVWIHUWLOL]DWLRQf +HQFH DFWLYH UHSOLFDWLRQ RI PW'1$ GRHV QRW UHVXPH XQWLO UHODWLYHO\ ODWH LQ HPEU\RJHQHVLV ,Q FRQWUDVW DFWLYH PLWRFKRQGULDO WUDQVFULSWLRQ DSSHDUV WR UHVXPH HDUOLHU WKDQ DFWLYH PW'1$ UHSOLFDWLRQ LQ WKH GHYHORSLQJ HPEU\R

PAGE 242

+RZHYHU WKHUH LV VRPH FRQIXVLRQ LQ WKH OLWHUDWXUH DPRQJ WKH OLPLWHG QXPEHU RI VWXGLHV LQ WKLV ILHOG UHJDUGLQJ WKH SUHFLVH SDWWHUQ DQG WLPLQJ RI WKH UHVXPSWLRQ RI PLWRFKRQGULDO WUDQVFULSWLRQ &KDVH DQG 'DZLG f UHSRUWHG WKDW DFWLYH PLWRFKRQGULDO U51$ V\QWKHVLV EHJLQV DW JDVWUXODWLRQ KRXUV SRVWIHUWLOL]DWLRQf XVLQJ & LQFRUSRUDWLRQ 'DZLG HW DO f XVLQJ PLFURLQMHFWLRQ RI >3@*73 LQWR IHUWLOL]HG HJJV GHWHFWHG PLWRFKRQGULDO 51$ ODEHOLQJ VKRUWO\ DIWHU WKH PLGEODVWXOD WUDQVLWLRQ DIWHU KRXUV SRVWIHUWLOL]DWLRQf
PAGE 243

DIWHU IHUWLOL]DWLRQ DQG UHPDLQV DW WKLV ORZ OHYHO WLOO ODWH QHXUXOD EHIRUH LW LV DFWLYDWHG DJDLQ 7KHVH UHVXOWV HVSHFLDOO\ WKH VXJJHVWLRQV RI DFWLYH WUDQVFULSWLRQ LQ WKH HJJ DQG D IHUWLOL]DWLRQLQGXFHG DUUHVW RI WKH PW'1$ JHQRPH DUH LQ GLUHFW FRQWUDGLFWLRQ WR HDUOLHU VWXGLHV ,Q RUGHU WR FODULI\ WKHVH LVVXHV DQG UHHYDOXDWH WKLV QDWXUDO PRGHO IRU VWXG\LQJ PLWRFKRQGULDO JHQH UHJXODWLRQ VWHDG\ VWDWH OHYHOV RI PLWRFKRQGULDO 51$ GXULQJ HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV ZHUH DQDO\]HG E\ 1RUWKHUQ K\EULGL]DWLRQ XVLQJ WRWDO HJJHPEU\RQLF 51$ RU PLWRFKRQGULDO 51$ &KDSWHU f 8VLQJ SURWRFROV VLPLODU WR WKH RQHV XVHG E\ 0H]LDQH HW DO f IRU DQDO\VLV RI PLWRFKRQGULDO 51$fV LQ WKH FRQWH[W RI WRWDO HJJHPEU\RQLF 51$ FRXOG QRW UHSURGXFH WKHLU UHSRUWHG SDWWHUQ RI UHJXODWLRQ ,QVWHDG PRUH RU OHVV FRQVWDQW OHYHOV RI PLWRFKRQGULDO P51$V VL[ GLIIHUHQW P51$ VSHFLHVf LQ GLVWLQFW HPEU\RQLF VWDJHV ZHUH REVHUYHG ZLWK D IROG GHFUHDVH LQ WKH OHYHOV RI WUDQVFULSWV 1' $73DVH &\W Ef E\ KRXUV RI GHYHORSPHQW 7KH FRRUGLQDWH GHFUHDVH IROGf LQ P51$ OHYHOV SRVWIHUWLOL]DWLRQ REVHUYHG E\ 0H]LDQH HW DO f ZDV QRW VHHQ LQ UHSHDWHG H[SHULPHQWV ,Q FRQVLGHULQJ WKLV GLVFUHSDQF\ EHWZHHQ ODEV LW EHFDPH DSSDUHQW WKDW WKH VSHFWURVFRSLF QRUPDOL]DWLRQ HPSOR\HG E\ 0H]LDQH HW DO f ZDV QRW VXLWDEOH IRU WKH DQDO\VLV RI VWHDG\ VWDWH

PAGE 244

OHYHOV LQ WKLV GHYHORSPHQWDO V\VWHP 7RWDO HPEU\RQLF 51$ OHYHOV IOXFWXDWH GUDPDWLFDOO\ DV D IXQFWLRQ RI GHYHORSPHQW ZLWK DFWLYH QXFOHDU WUDQVFULSWLRQ UHVXPLQJ LQ WKH HPEU\R VRRQ DIWHU WKH PLG EODVWXOD WUDQVLWLRQ 1HZSRUW DQG .LUVFKQHU Ef ,Q DGGLWLRQ WR QHZ WUDQVFULSWLRQ WKH SKHQRPHQD RI IHUWLOL]DWLRQLQGXFHG WUDQVODWLRQDO DFWLYDWLRQ RI PDWHUQDO WUDQVFULSWV E\ F\WRSODVPLF SRO\DGHQ\ODWLRQ &RORW DQG 5RVEDVK 'ZRUNLQ HW DO 3DULV HW DO 3DULV DQG 5LFKWHU 6LPRQ HW DO f RU GHDGHQ\ODWLRQ /HJDJQHDX[ HW DO f DOVR DGGV WR WKH IOX[ LQ 51$ PDVV +HQFH WKH FRQFHQWUDWLRQ RI PLWRFKRQGULDO WUDQVFULSWV ZKLFK LV TXLWH KLJK LQ WKH XQIHUWLOL]HG HJJ EHFRPHV SURJUHVVLYHO\ GLOXWHG DV GHYHORSPHQW SURFHHGV 7KHUHIRUH DQ DVVHVVPHQW RI PLWRFKRQGULDO WUDQVFULSW OHYHOV LQ WKH FRQWH[W RI WKLV IOXFWXDWLQJ WRWDO 51$ OHYHOV ZRXOG EH VXEMHFW WR DQLPDO VWUDLQ JHQHWLF DQG HQYLURQPHQWDO YDULDWLRQV 7R UHPRYH WKH LQWHUIHUHQFH IURP WKH DEXQGDQW QXFOHDU DQG F\WRSODVPLF 51$ 51$ ZDV LVRODWHG IRUP SXULILHG PLWRFKRQGULD DQG PLWRFKRQGULDO '1$ ZDV XVHG WR QRUPDOL]H WKH PLWRFKRQGULDO 51$ OHYHOV EHFDXVH PW'1$ LV D PDFURPROHFXODU VSHFLHV ZKRVH UHODWLYH OHYHOV GR QRW IOXFWXDWH GXULQJ HDUO\ GHYHORSPHQW &KDVH DQG 'DZLG

PAGE 245

f :KHQ WKH GHYHORSPHQWDO SDWWHUQ RI PLWRFKRQGULDO 51$ VWHDG\ VWDWH OHYHOV ZDV DQDO\]HG ZLWK UHIHUHQFH WR WKH OHYHOV RI PW'1$ D SDWWHUQ FRQVLVWHQW ZLWK WKH SUHGLFWLRQV RI WKH HDUOLHU JURXSV &KDVH DQG 'DZLG 'DZLG HW DO
PAGE 246

GLVWLQFW HPEU\RQLF VWDJHV &KDSWHU f 7UDQVFULSWLRQ UDWHV ZHUH EDVDO LQ WKH XQIHUWLOL]HG HJJV DQG HDUO\ HPEU\RV XSWR KRXUV SRVW IHUWLOL]DWRQf VOLJKWO\ VWLPXODWHG IROG RYHU HJJ OHYHOVf LQ WKH KU DQG KU HPEU\RV GUDPDWLFDOO\ LQFUHDVHG LQ WKH KU VWDJH IROG RYHU HJJf DQG ZHUH VOLJKWO\ ORZHU EXW VLJQLILFDQWO\ XSUHJXODWHG LQ WKH KU WDGSROH IROG RYHU HJJf &RPSDULVRQ RI WKH WLPLQJ DQG IROGLQGXFWLRQ RI WUDQVFULSWLRQ UDWHV DQG VWHDG\ VWDWH WUDQVFULSW OHYHOV GXULQJ HDUO\ GHYHORSPHQW VKRZHG D YHU\ JRRG FRUUHODWLRQ ,QFUHDVHG OHYHOV RI WUDQVFULSWV DW HDFK GHYHORSPHQWDO WLPHSRLQW ZHUH SUHFHGHG D IHZ KRXUV EHIRUH E\ DFWLYH WUDQVFULSWLRQDO DFWLYLW\ LQ WKH LVRODWHG PLWRFKRQGULD VXJJHVWLQJ WKDW WKLV LQFUHDVHG WUDQVFULSWLRQ FRXOG GLUHFWO\ DFFRXQW IRU WKH DFFXPXODWLRQ RI WKH P51$V DQG U51$V 7KH FRRUGLQDWH SDWWHUQ RI WUDQVFULSW DEXQGDQFH LUUHVSHFWLYH RI WKH GHYHORSPHQWDO WLPHSRLQW VXJJHVWV WKDW WKHUH DUH QR JURVV GLIIHUHQFHV LQ WKH WXUQRYHU UDWHV RI WKHVH WUDQVFULSWV DV D IXQFWLRQ RI GHYHORSPHQW 2Q WKH EDVLV RI WKHVH GDWD FRQFOXGH WKDW WKH SULPDU\ GHWHUPLQDQW RI 51$ ERWK P51$ DQG U51$f VWHDG\ VWDWH OHYHOV GXULQJ HDUO\ GHYHORSPHQW RI ; ODHYLV LV WKH YDU\LQJ OHYHOV RI DFWLYDWLRQ RI PLWRFKRQGULDO WUDQVFULSWLRQ LQ WKH GHYHORSLQJ HPEU\R

PAGE 247

$OWKRXJK PLWRFKRQGULDO WUDQVFULSWLRQ KDV EHHQ VKRZQ WR UHJXODWH WUDQVFULSW OHYHOV LQ WKH GHYHORSLQJ HPEU\R FRQWURO RI PLWRFKRQGULDO JHQH H[SUHVVLRQ DV D IXQFWLRQ RI GHYHORSPHQW DSSHDUV WR KDYH DGGLWLRQDO OD\HUV RI UHJXODWLRQ ,Q RWKHU ZRUGV UHVXPSWLRQ RI PLWRFKRQGULDO WUDQVFULSWLRQ GRHV QRW DSSHDU WR QHFHVVDULO\ FRUUHODWH ZLWK LQFUHDVHG OHYHOV RI PLWRFKRQGULDO JHQH SURGXFWV VXJJHVWLQJ DGGLWLRQDO UHJXODWLRQ RI PLWRFKRQGULDO SURWHLQ V\QWKHVLV GXULQJ HDUO\ GHYHORSPHQW $Q H[DPSOH RI WKLV SKHQRPHQRQ LV WKH UHJXODWLRQ RI F\WRFKURPH R[LGDVH DFWLYLW\ GXULQJ HPEU\RJHQHVLV &KDVH DQG 'DZLG f PHDVXUHG WKH WRWDO F\WRFKURPH R[LGDVH DFWLYLW\ LQ FUXGH KRPRJHQDWHV RI ; ODHYLV HPEU\RV 7KHUH ZDV QR QHW LQFUHDVH LQ WKH DPRXQW RI F\WRFKURPH R[LGDVH SHU HPEU\R IURP LWV LQLWLDO YDOXH RI JDWRP R[\JHQPLQHPEU\R XQWLO VWDJH KRXUV SRVWn IHUWLOL]DWLRQf DIWHU ZKLFK LW LQFUHDVHG DQG KDG GRXEOHG E\ GD\V RI GHYHORSPHQW 7KH SDWWHUQ RI DFFXPXODWLRQ RI PLWRFKRQGULDO SURWHLQ DQ LQGLFDWRU RI PLWRFKRQGULDO ELRJHQHVLVf IROORZHG VLPLODU WUHQGV ZLWK LQFUHDVHV VHHQ RQO\ DIWHU KRXUV RI GHYHORSPHQW LQGLFDWLYH RI SURGXFWLRQ RI QHZ PLWRFKRQGULD 7KHUHIRUH WKH VSHFLILF DFWLYLW\ RI F\WRFKURPH R[LGDVH DFWLYLW\ SHU WRWDO PLWRFKRQGULDO SURWHLQf UHPDLQHG HVVHQWLDOO\ FRQVWDQW GXULQJ HPEU\RJHQHVLV

PAGE 248

&\WRFKURPH R[LGDVH &2f DOVR FDOOHG UHVSLUDWRU\ FRPSOH[ ,9 FRPSULVHV PLWRFKRQGULDO DQG QXFOHDUHQFRGHG VXEXQLWV SUHVHQW LQ VWRLFKLRPHWU\ .DGHQEDFK HW DO &DSDOGL f $ QXPEHU RI VWXGLHV LQ PDPPDOLDQ V\VWHPV VXJJHVW WKDW JHQH H[SUHVVLRQ RI WKH QXFOHDU DQG PLWRFKRQGULDOHQFRGHG VXEXQLWV &2 ,, ,,,f DUH DW OHDVW ORRVHO\ FRRUGLQDWHG ZLWK FRRUGLQDWH LQFUHDVHV LQ &2 VXEXQLW P51$ OHYHOV IURP ERWK FRPSDUWPHQWV SDUDOOHOLQJ LQFUHDVHG &2 DFWLYLW\ *DJQRQ HW DO .LP HW DO 7D\ORU DQG 3LNR f DOWKRXJK WKH PLWRFKRQGULDO &2 VXEXQLW OHYHOV ZHUH IROG H[FHVV RYHU WKH QXFOHDU RQHV 7D\ORU DQG 3LNR f +RZHYHU HYLGHQFH IRU GLVSURSRUWLRQDWH UHJXODWLRQ RI PLWRFKRQGULDO DQG QXFOHDU &2 VXEXQLW JHQH H[SUHVVLRQ E\ IXQFWLRQDO DFWLYLW\ LQ QHXURQV RI PRQNH\V ZDV UHSRUWHG E\ +HYQHU DQG :RQJ 5LOH\ f ZLWK &2 DFWLYLW\ PDLQO\ FRUUHODWLQJ ZLWK WKH OHYHOV RI WKH PLWRFKRQGULDO VXEXQLW P51$V 7KH OHYHOV RI &2 DFWLYLW\ KDYH DOVR EHHQ IRXQG WR EH FRUUHODWHG ZLWK WKH OHYHOV RI WKH &2 SURWHLQV LQ D QXPEHU RI VWXGLHV +HYQHU DQG :RQJ5LOH\ :LOOLDPV DQG +DUODQ f +RZHYHU RWKHU VWXGLHV KDYH IRXQG HYLGHQFH WKDW WKH PROHFXODU DFWLYLW\ RI &2 PD\ EH UHJXODWHG E\ LVR]\PH VZLWFKLQJ RU E\ FRQIRUPDWLRQDO HIIHFWV RI $73 ELQGLQJ

PAGE 249

+XWKHU DQG .DGHQEDFK %LVVRQ HW DO *DL HW DO (ZDUW HW DO f +HQFH LW LV SRVVLEOH WKDW WKH FRQVWDQW OHYHO RI &2 DFWLYLW\ PHDVXUHG E\ &KDVH DQG 'DZLG f GXULQJ ; ODHYLV HPEU\RJHQHVLV PD\ EH FRUUHODWHG ZLWK FRQVWDQW OHYHOV RI WKH &2 SURWHLQV ,Q FRQWUDVW WKH VWHDG\ VWDWH OHYHOV RI &2 ,, P51$ OHYHOV GXULQJ HDUO\ GHYHORSPHQW VKRZHG DQ LQFUHDVLQJ WUHQG ZLWK OHYHOV EHLQJ EDVDO XQWLO KRXUV SRVWIHUWLOL]DWLRQ DIWHU ZKLFK LW LQFUHDVHG WR IROG RYHU HJJ OHYHOV E\ WKH KU VWDJH IROG E\ WKH KU VWDJH DQG IROG E\ WKH KRXUROG WDGSROH %\ GD\V RI GHYHORSPHQW WKH OHYHOV KDG GURSSHG WR IROG RYHU HJJ OHYHOV FRPSDUDEOH WR WKH KU HPEU\R 7KH VDPH SDWWHUQ LV OLNHO\ WR KROG IRU WKH WZR RWKHU VXEXQLWV RI &2 &2 t ,,f EHFDXVH RI WKH SRO\FLVWURQLF QDWXUH RI PLWRFKRQGULDO WUDQVFULSWLRQ DQG WKH FRRUGLQDWH UHJXODWLRQ RI RWKHU P51$V DQDO\]HG LQ WKLV VWXG\ 7KHUHIRUH LQFUHDVHG WUDQVFULSWLRQ RI WKH PLWRFKRQGULDO VXEXQLWV RI &2 GRHV QRW WUDQVODWH GLUHFWO\ LQWR LQFUHDVHG &2 DFWLYLW\ 7KHUH DUH DW OHDVW WZR SRVVLEOH UHDVRQV IRU WKH ODFN RI FRQFRUGDQFH EHWZHHQ WKHVH PROHFXODU HYHQWV ,Q RQH SRVVLEOH VFHQDULR UHJXODWLRQ FRXOG EH DW D WUDQVODWLRQDO OHYHO ZLWK DFWLYH WUDQVODWLRQ RI P51$V LQ WKH PLWRFKRQGULD RFFXUULQJ RQO\ ODWH LQ HPEU\RJHQHVLV MXVW

PAGE 250

SUHFHGLQJ QHZ PLWRFKRQGULDO ELRJHQHVLV 8QIRUWXQDWHO\ WKH UHJXODWLRQ RI PLWRFKRQGULDO SURWHLQ V\QWKHVLV LV D SRRUO\ XQGHUVWRRG ILHOG DW WKLV WLPH 1HYHUWKHOHVV LW ZRXOG EH ZRUWK LQYHVWLJDWLQJ WKLV SRVVLELOLW\ 7KH RWKHU SRVVLELOLW\ LV WKDW WKH LQFUHDVHG SRRO RI PLWRFKRQGULDO &2 P51$ PD\ EH WUDQVODWHG LQ D FRRUGLQDWH IDVKLRQ EXW WKH OLPLWLQJ IDFWRU FRXOG EH GLVSURSRUWLRQDWH H[SUHVVLRQ HLWKHU DW WKH OHYHO RI QXFOHDU WUDQVFULSWLRQ RU F\WRSODVPLF WUDQVODWLRQf RI VRPH RU DOO RI WKH QXFOHDU VXEXQLWV RI &2 ZKLFK FRXOG DOVR OHDG WR WKH JHQHUDO SKHQRW\SH RI FRQVWDQW &2 DFWLYLW\ GXULQJ HPEU\RJHQHVLV LQ VSLWH RI LQFUHDVHG OHYHOV RI PLWRFKRQGULDO &2 VXEXQLW WUDQVFULSWV DQG SURWHLQV 7KLV ZRXOG EH DQ LQWHUHVWLQJ DYHQXH RI UHVHDUFK ZKLFK PLJKW \LHOG VKHG QHZ OLJKW RQ QXFOHDUPLWRFKRQGULDO LQWHUDFWLRQV 2QH RI WKH PDLQ WKUXVWV RI WKLV SURMHFW ZDV WR DWWHPSW WR REWDLQ VRPH DQVZHUV WR WKH FRPSOH[ TXHVWLRQV RI KRZ WUDQVFULSWLRQDO UHJXODWLRQ LV DFKLHYHG LQ WKH PLWRFKRQGULD DQG ZKDW GHYHORSPHQWDO FXHV FRXOG EH UHVSRQVLEOH $ PDMRU DYHQXH RI LQYHVWLJDWLRQ ZDV WR ORRN IRU GLIIHUHQFHV LQ SURWHLQ'1$ LQWHUDFWLRQV LQ WKH 'ORRS FRQWURO UHJLRQ ZKLFK KRXVHV WKH FULWLFDO FLVHOHPHQWV IRU LQLWLDWLRQ RI ELn GLUHFWLRQDO +63 t /63f WUDQVFULSWLRQ DQG +VWUDQG UHSOLFDWLRQ &KDSWHU f )RU WKLV LW ZDV LQLWLDOO\ HVVHQWLDO WR HVWDEOLVK WKH

PAGE 251

EDVHOLQH SDWWHUQ RI IRRWSULQWLQJ LQ WKH 'ORRS UHJLRQ RI ;HQRSXV PW'1$ LQ RUGHU WR EH DEOH WR FRPSDUH DQG FRQWUDVW IRRWSULQWLQJ DFWLRQ GXULQJ GHYHORSPHQW 7KLV ZDV GRQH XVLQJ LQ RUJDQHOOR '06 IRRWSULQWLQJ RI RYDU\ PW'1$ 6LPLODU WR WKH VFHQDULR LQ KXPDQ )LVKHU HW DO *KLYL]]DQL HW DO f DQG FRZ PLWRFKRQGULD *KLYL]]DQL HW DO f WKH ; ODHYLV 'ORRS UHJLRQ GLVSOD\HG SKDVHG RU SHULRGLF ELQGLQJ RI SURWHLQV 7KLV LQ YLYR ELQGLQJ SDWWHUQ FORVHO\ PDWFKHG WKH LQ YLWUR '1$VH IRRWSULQW SDWWHUQ RI PLWRFKRQGULDO WUDQVFULSWLRQ IDFWRU $ [OPW7)$ $QWRVFKHFKNLQ DQG %RJHQKDJHQ f VWURQJO\ LPSOLFDWLQJ WKLV SURWHLQ LQ WKH SHULRGLF ELQGLQJ RI WKH 'ORRS UHJLRQ FRQVLVWHQW ZLWK WKH HVWDEOLVKHG UROH RI PW7)$ LQ SDFNDJLQJ RI PW'1$ LQ KXPDQ FRZ DQG \HDVW PLWRFKRQGULD )LVKHU HW DO *KLYL]]DQL HW DO 'LIIOH\ DQG 6WLOOPDQ f 2QH SRSXODU DQG ORQJVWDQGLQJ WKHRU\ RI PLWRFKRQGULDO JHQH UHJXODWLRQ LV WKDW WKH PW7)$ SURWHLQ LV FDSDEOH RI UHJXODWLQJ WUDQVFULSWLRQ IURP WKH +63 DQG /63 EDVHG RQ YDU\LQJ SURWHLQ VWRLFKLRPHWULHV LQ WKH PLWRFKRQGULD LQ UHVSRQVH WR WKH HQHUJ\ QHHGV RI WKH FHOO &OD\WRQ 'DLUDJKL HW DO $QWRVFKHFKNLQ DQG %RJHQKDJHQ f 7KLV WKHRU\ LV EDVHG RQ LQ YLWUR H[SHULPHQWV LQ

PAGE 252

ZKLFK WKH PW7)$ KDV EHHQ VKRZQ WR KDYH GLIIHUHQW ELQGLQJ DIILQLWLHV IRU WKH +63 DQG /63 )LVKHU DQG &OD\WRQ f DQG WKH DELOLW\ WR DFWLYDWH DV ZHOO DV UHSUHVV WUDQVFULSWLRQ ZLWKLQ QDUURZ UDQJHV RI FRQFHQWUDWLRQV 'DLUDJKL HW DO %DUDW*XHULGH HW DO $QWRVFKHFKNLQ DQG %RJHQKDJHQ f ,Q DGGLWLRQ WKH PW7)$ JHQH KDV EHHQ VKRZQ WR KDYH ELQGLQJ VLWHV IRU QXFOHDU UHVSLUDWRU\ IDFWRUV 15) t 15)f LQ LWV SUR[LPDO SURPRWHU 9LUEDVLXV DQG 6FDUSXOOD f VXJJHVWLQJ WKDW 15)PRGX,DWHG DFWLYDWLRQ RI PW7)$ LQ FRQMXQFWLRQ ZLWK WKH HIIHFW RI YDU\LQJ VWRLFKLRPHWULHV RI WKLV SURWHLQ RQ PLWRFKRQGULDO WUDQVFULSWLRQ PD\ EH RQH RI WKH ZD\V LQ ZKLFK WKH QXFOHXV DQG WKH PLWRFKRQGULD FRRUGLQDWH JHQH H[SUHVVLRQ LQ WKH FHOO $OWKRXJK DSSHDOLQJ LQ ORJLF WKLV PRGHO KDV QRW EHHQ WHVWHG H[WHQVLYHO\ PDLQO\ GXH WR WKH SDXFLW\ RI H[SHULPHQWDO VLWXDWLRQV ZKHUH WUDQVFULSWLRQ LV GUDPDWLFDOO\ UHJXODWHG 7KH ; ODHYLV HPEU\RJHQHVLV PRGHO SURYLGHV WKH ILUVW RSSRUWXQLW\ WR WHVW WKLV PRGHO 7KHUHIRUH LQ YLYR IRRWSULQWLQJ RI WKH 'ORRS UHJLRQ GXULQJ HPEU\RJHQHVLV RI ; ODHYLV ZDV SHUIRUPHG ZLWK WKH PDLQ DLP RI ORRNLQJ IRU GLIIHUHQFHV LQ WKH SDWWHUQ RU RFFXSDQF\ RI IRRWSULQWLQJ LQ WKH FULWLFDO UHJLRQV DURXQG WKH SURPRWHUV 6XUSULVLQJO\ H[WHQVLYH IRRWSULQW DQDO\VHV UHYHDOHG D VLPLODU RFFXSDQF\ RI PW'1$ E\ WKH

PAGE 253

PW7)$ SURWHLQ GXULQJ ERWK EDVDO XQIHUWLOL]HG HJJV DQG HDUO\ HPEU\RVf DQG DFWLYDWHG SRVWQHXUXOD RU DIWHU GD\ RI GHYHORSPHQWf WUDQVFULSWLRQ +HQFH WKLV DQDO\VLV KDV XQFRYHUHG DQ DV \HW XQVXVSHFWHG UROH RI WKLV SURWHLQ QDPHO\ FRQVWLWXWLYH SDFNDJLQJ RI PW'1$ 7KH IXQFWLRQDO OHYHOV RI WKLV SURWHLQ LQ PLWRFKRQGULD DV MXGJHG E\ LWV HTXLYDOHQW RFFXSDQF\ RI PW'1$ GR QRW DSSHDU WR YDU\ LQ UHVSRQVH WR WKH WUDQVFULSWLRQDO QHHGV RI WKH PLWRFKRQGULD PDNLQJ WKH SURSRVHG PRGHO ORRN XQWHQDEOH DW OHDVW LQ DPSKLELDQV +RZHYHU LW LV VWLOO SRVVLEOH WKDW WKH PLWRFKRQGULDO FRQFHQWUDWLRQV RI PW7)$ PD\ YDU\ DV D IXQFWLRQ RI GHYHORSPHQW DV WKH SURWHLQ OHYHOV ZHUH QRW GLUHFWO\ PHDVXUHG 6LQFH WKHUH ZHUH QR PDUNHG FKDQJHV LQ SURWHLQ'1$ LQWHUDFWLRQV DW WKH LPSRUWDQW FLVHOHPHQWV GXULQJ UHJXODWHG WUDQVFULSWLRQ WKH TXHVWLRQ RI KRZ WKH FHOOV DWWDLQ WKH DELOLW\ WR DFWLYDWH WUDQVFULSWLRQ PXVW DVVXPH QHZ GLPHQVLRQV 2QH SRVVLELOLW\ LV WKDW SURWHLQSURWHLQ LQWHUDFWLRQV DUH LPSRUWDQW PHGLDWRUV RI WKLV HYHQW DV IRRWSULQWLQJ GRHV QRW GHWHFW VXFK LQWHUDFWLRQV $QRWKHU SRVVLELOLW\ ZKLFK LV PRUH FRQVLVWHQW ZLWK WKH ELRORJ\ RI WKLV RUJDQLVP LV WKDW PLWRFKRQGULDO WUDQVFULSWLRQ PD\ EH XQGHU WKH G\QDPLF FRQWURO RI FKDQJLQJ PHWDEROLF SDWWHUQV GXULQJ HPEU\RJHQHVLV )HUWLOL]DWLRQ LQGXFHV D

PAGE 254

WUDQVLHQW VSLUDO ZDYH RI FDOFLXP UHOHDVH LQ WKH HPEU\R %XVD DQG 1XFFLWHOOL %XVD HW DO .XERWD HW DO f 0LWRFKRQGULD KDYH EHHQ VKRZQ WR VHQVH RVFLOODWRU\ FKDQJHV LQ F\WRSODVPLF FDOFLXP FRQFHQWUDWLRQV 5L]]XWR HW DO +DMQRF]N\ HW DO f &DOFLXP LV DOVR D SRWHQW DFWLYDWRU RI PLWRFKRQGULDO R[LGDWLYH PHWDEROLVP WKURXJK LWV HIIHFWV RQ PDQ\ GHK\GURJHQDVHV 0F&RUPDFN DQG 'HQWRQ 3UDORQJ HW DO f 7KH HIIHFWV RI WKLV KXJH LQFUHDVH LQ F\WRSODVPLF FDOFLXP RQ PLWRFKRQGULDO SK\VLRORJ\ RI ; ODHYLV DUH XQNQRZQ EXW GHVHUYH H[SHULPHQWDO DWWHQWLRQ ,Q DGGLWLRQ WR WKHVH SKHQRPHQD FKDQJHV LQ PHWDEROLF SDWKZD\V GXULQJ HDUO\ GHYHORSPHQW KDYH EHHQ REVHUYHG $OWKRXJK WKH XQIHUWLOL]HG HJJ KDV DEXQGDQW UHVHUYHV RI \RON SURWHLQ DQG JO\FRJHQ RQO\ WKH \RON LV EURNHQ GRZQ E\ DPLQR DFLG R[LGDWLRQ DQG IHG LQWR WKH 7&$ F\FOH WR EH XVHG DV DQ HQHUJ\ VRXUFH IRU HDUO\ GHYHORSPHQW 'ZRUNLQ DQG 'ZRUNLQ5DVWO f *O\FRJHQ UHVHUYHV DUH XWLOL]HG RQO\ IURP WKH JDVWUXOD VWDJH KRXUV SRVWIHUWLOL]DWLRQf RQZDUGV FRLQFLGLQJ ZLWK WKH LQFHSWLRQ RI JO\FRO\VLV LQ WKH GHYHORSLQJ HPEU\R 7KRPDQ DQG *HUKDUW 'ZRUNLQ DQG 'ZRUNLQ5DVWO f +HQFH WKH HDUO\ HPEU\RQLF VWDJHV KDYH D SULPDULO\ FDWDEROLF PRGH RI PHWDEROLVP ZKHUHDV WKH ODWHU VWDJHV KDYH D PRUH EDODQFHG

PAGE 255

PHWDEROLF PRGH 7KHVH VWXGLHV VKRZ WKDW WKH PLWRFKRQGULDO PHWDEROLVP LV LQ D FRQVWDQW VWDWH RI IOX[ GXULQJ HPEU\RJHQHVLV ZLWK WKH SDWWHUQ RI VXEVWUDWHV LQ WKH PLWRFKRQGULD FRQVWDQWO\ FKDQJLQJ ,Q RUGHU WR WHVW WKH HIIHFW RI GLIIHUHQFHV LQ PLWRFKRQGULDO R[LGDWLYH PHWDEROLVP RQ PLWRFKRQGULDO WUDQVFULSWLRQ D UXQRQ fUHVFXHf H[SHULPHQW ZDV GHYLVHG LQ ZKLFK WKH PLWRFKRQGULDO PHWDEROLVP RI D WUDQVFULSWLRQDOO\ TXLHVFHQW VWDJH OLNH WKH KU VWDJH ZDV VWLPXODWHG E\ WKH DGGLWLRQ RI DNHWRJOXWDUDWH $'3 DQG SKRVSKDWH WR WKH EDVLF UXQRQ EXIIHU 7UDQVFULSWLRQ UDWH RI PLWRFKRQGULD LQFXEDWHG LQ WKLV EXIIHU ZDV GUDPDWLFDOO\ VWLPXODWHG E\ IROG RYHU WKH UDWH LQ EDVLF EXIIHUf VXJJHVWLQJ WKDW WKH PLWRFKRQGULDO WUDQVFULSWLRQ DSSDUDWXV ZDV LQ D VWDWH RI UHDGLQHVV EXW ZDV GHSHQGHQW GLUHFWO\ RU LQGLUHFWO\ RQ WKH PHWDEROLF VWDWH RI WKH PLWRFKRQGULD 7KLV UHVXOW DOVR LQGLUHFWO\ SUHGLFWV WKDW WKH PLWRFKRQGULD RI WKH WUDQVFULSWLRQDOO\ DFWLYH VWDJHV ZRXOG KDYH D KLJKHU UDWH RI R[LGDWLYH PHWDEROLVP ,Q RUGHU WR FRQILUP WKLV VXJJHVWLRQ WKH PLWRFKRQGULDO DGHQLQH QXFOHRWLGH OHYHOV LQ GLVWLQFW HPEU\RQLF VWDJHV ZHUH PHDVXUHG E\ 53+3/& 7KH XQIHUWLOL]HG HJJV DQG HDUO\ HPEU\RV XSWR KRXUV RI GHYHORSPHQW KDG VLPLODU OHYHOV RI PLWRFKRQGULDO $73 DQG $73$'3 UDWLRV ZKHUHDV WKH KU VWDJH

PAGE 256

KDG IROG KLJKHU OHYHOV RI $73 DQG $73$'3 UDWLRV LQGLFDWLQJ KLJKHU R[LGDWLYH PHWDEROLVP LQ WKH KU VWDJH 7KHVH FKDQJHV LQ PLWRFKRQGULDO $73 OHYHOV KDSSHQHG LQ WKH FRQWH[W RI FRQVWDQW OHYHOV RI WRWDO $73 LQ WKH HJJV RU HDUO\ HPEU\RQLF VWDJHV 0LWRFKRQGULDO WUDQVFULSWLRQ UDWHV FRUUHODWHG ZLWK WKHVH GLIIHUHQFHV LQ HQHUJ\ PHWDEROLVP WUDQVFULSWLRQ UDWH EHLQJ EDVDO LQ WKH HDUO\ HPEU\RV DQG KLJKO\ DFWLYDWHG LQ WKH KU VWDJH 7KH DERYH UHVXOWV VWURQJO\ VXJJHVW WKDW WKH VWDWH RI PLWRFKRQGULDO PHWDEROLVP GXULQJ HPEU\RJHQHVLV LV OLNHO\ WR EH D PDMRU SOD\HU LQ WKH UHJXODWLRQ RI PLWRFKRQGULDO WUDQVFULSWLRQ 7KLV ZRXOG EH D PDMRU QHZ ZD\ WR YLHZ PLWRFKRQGULDO JHQH UHJXODWLRQ ,W LV DOVR SRVVLEOH WKDW WKH FKDQJLQJ PHWDEROLF SDWWHUQV FRXOG LQGXFH VWUXFWXUDO FKDQJHV LQ WKH PLWRFKRQGULD OHDGLQJ WR GLIIHUHQWLDWLRQ RI PLWRFKRQGULD IURP D FRQGHQVHG PHWDEROLFDOO\ OHVV DFWLYH fHPEU\RQLFf VWDWH WR D VZROOHQ PHWDEROLFDOO\ PRUH DFWLYH fDGXOWf VWDWH 6XFK SKHQRPHQD KDYH EHHQ QRWHG GXULQJ HDUO\ GHYHORSPHQW RI PRXVH *LQVEHUJ DQG +LOOPDQ 3LNR DQG &KDVH f DQG %XIR DUHQDUXP 6DORPRQ GH /HJQDPH HW DO f HPEU\RV +RZHYHU LQ WKHVH WZR RUJDQLVPV VXFK FKDQJHV DUH FRXSOHG ZLWK D SURJUHVVLYH GHFOLQH LQ WRWDO $73 OHYHOV RI WKH HPEU\R GXULQJ GHYHORSPHQW 7KLV VLWXDWLRQ LV QRW VHHQ

PAGE 257

LQ ; ODHYLV ZLWK WKH WRWDO $73 OHYHOV UHPDLQLQJ FRQVWDQW GXULQJ HDUO\ GHYHORSPHQW VXJJHVWLQJ WKDW WKH IXQGDPHQWDO PHFKDQLVP RI PHWDEROLF DFWLYDWLRQ LQ ; ODHYLV PLJKW EH VOLJKWO\ GLIIHUHQW 1HYHUWKHOHVV IXWXUH UHVHDUFK LQWR WKH PHWDEROLF EDVLV RI WUDQVFULSWLRQDO UHJXODWLRQ LQ PLWRFKRQGULD VKRXOG SURYLGH LQWHUHVWLQJ LQVLJKWV LQWR RQH RI WKH ZD\V E\ ZKLFK WKH FHOO DFWLYDWHV PLWRFKRQGULDO WUDQVFULSWLRQ 7KHVH VWXGLHV FRXOG KDYH ZLGHU LPSOLFDWLRQV IRU UHJXODWLRQ RI PLWRFKRQGULDO JHQH H[SUHVVLRQ LQ JHQHUDO DV PLWRFKRQGULDO PHWDEROLVP LV QRW DV VWDWLF DV ZDV RQFH LPDJLQHG 2Q WKH FRQWUDU\ LW VHHPV WR EH LQYROYHG LQ G\QDPLF SDFLQJ RI FHOOXODU PHWDEROLVP LQ UHVSRQVH WR RVFLOODWLRQV LQ WKH OHYHOV RI FDOFLXP DQG RWKHU VHFRQG PHVVHQJHUV 7KHUHIRUH WKH FKDQJLQJ SDWWHUQV RI PLWRFKRQGULDO R[LGDWLYH PHWDEROLVP DOVR KDYH WKH SRWHQWLDO WR GLFWDWH QXFOHLF DFLG PHWDEROLVP LQ WKH PLWRFKRQGULD 7KH SUHVHQW VWXG\ DOVR SURYLGHG VRPH DGGLWLRQDO LQVLJKWV LQWR WKH LQ YLYR UROH RI WKH PLWRFKRQGULDO WUDQVFULSWLRQ WHUPLQDWLRQ IDFWRU P7(5) )RRWSULQWLQJ DQG EDQG VKLIW DVVD\V FRQILUPHG WKH SUHVHQFH RI WKLV SURWHLQ LQ ;HQRSXV PLWRFKRQGULD FRQVLVWHQW ZLWK WKH H[LVWHQFH RI WKH KLJKO\ FRQVHUYHG WULGHFDPHU WHUPLQDWLRQ ER[ LQ ;HQRSXV PW'1$ ZLWK RQO\ RQH QXFOHRWLGH FKDQJH IURP WKH KXPDQ HTXLYDOHQW

PAGE 258

7KH PRGH RI IRRWSULQWLQJ UHYHDOHG WKH SRVVLELOLW\ RI ORFDOL]HG DOWHUDWLRQV LQ '1$ VWUXFWXUH DW WKLV FLV HOHPHQW LQ YLYR FRQVLVWHQW ZLWK LWV DELOLW\ WR EHQG '1$ LQ LQ YLWUR DVVD\V 6KDQJ DQG &OD\WRQ f +RZHYHU WKH PRVW VLJQLILFDQW REVHUYDWLRQ ZDV WKDW WKLV SURWHLQ VHHPV WR RFFXS\ LWV ELQGLQJ VLWH LQ D FRQVWLWXWLYH PDQQHU QRW YDU\LQJ LWV OHYHO RI RFFXSDQF\ GXULQJ ERWK EDVDO DQG DFWLYDWHG WUDQVFULSWLRQDO DFWLYLW\ LQ WKH PLWRFKRQGULD RI ;HQRSXV HJJV DQG HPEU\RV 7KHVH UHVXOWV VXJJHVW WKH VLPSOH LGHD WKDW P7(5) RFFXSDQF\ LV DOZD\V PDLQWDLQHG LQ WKHVH FHOOV SRVLQJ D SK\VLFDO URDGEORFN WR WKH HORQJDWLQJ 51$ SRO\PHUDVHV ZLWK WKH OHYHO RI WUDQVFULSWLRQ SULPDULO\ GHWHUPLQLQJ WKH WUDQVFULSW OHYHOV RI WKH U51$V ,Q FRQFOXVLRQ WKH FXUUHQW VWXG\ KLJKOLJKWV WKH LPSRUWDQFH RI PLWRFKRQGULDO PHWDEROLF VWDWXV LQ WKH UHJXODWLRQ RI PLWRFKRQGULDO JHQH H[SUHVVLRQ 6LQFH WKH PW'1$ H[LVWV LQ D PLOLHX RI UDSLGO\ IOXFWXDWLQJ ELRFKHPLFDO HQYLURQPHQWV DQ\ VWXG\ RI QXFOHLF DFLG PHWDEROLVP VKRXOG DOVR WDNH LQWR FRQVLGHUDWLRQ WKH HIIHFWV RI FKDQJHV LQ WKH FRQFHQWUDWLRQV RI PHWDEROLF LQWHUPHGLDWHV ZKLFK FRXOG HLWKHU GLUHFWO\ RU LQGLUHFWO\ DIIHFW WKH WUDQVFULSWLRQDO DQG UHSOLFDWLRQDO PDFKLQHU\

PAGE 259

/,67 2) 5()(5(1&(6 $OEULQJ 0 *ULIILWK DQG $WWDUGL $VVRFLDWLRQ RI D SURWHLQ VWUXFWXUH RI SUREDEOH PHPEUDQH GHULYDWLRQ ZLWK +H/D FHOO PLWRFKRQGULDO '1$ QHDU LWV RULJLQ RI UHSOLFDWLRQ 3URF 1DWO $FDG 6FL 86$ $ORQL < DQG $WWDUGL 6\PPHWULFDO LQ YLYR WUDQVFULSWLRQ RI PLWRFKRQGULDO '1$ LQ +H/D FHOOV 3URF 1DWO $FDG 6FL 86$ $PPLQL &9 *KLYL]]DQL 6& 0DGVHQ &6 DQG :: +DXVZLUWK *HQRPLF IRRWSULQWLQJ RI PLWRFKRQGULDO '1$,, ,Q YLYR DQDO\VLV RI SURWHLQPLWRFKRQGULDO '1$ LQWHUDFWLRQV LQ ;HQRSXV ODHYLV HJJV DQG HPEU\RV 0HWK(Q] $QQH[ %+ DQG 56 :LOOLDPV 0LWRFKRQGULDO '1$ VWUXFWXUH DQG H[SUHVVLRQ LQ VSHFLDOL]HG VXEW\SHV RI PDPPDOLDQ VWULDWHG PXVFOH 0RO &HOO %LRO $QWRQHWWL '$ 5H\QHW & DQG &5 .DKQ ,QFUHDVHG H[SUHVVLRQ RI PLWRFKRQGULDOHQFRGHG JHQHV LQ VNHOHWDO PXVFOHV RI KXPDQV ZLWK GLDEHWHV PHOOLWXV &OLQ ,QYHVW $QWRVKHFKNLQ ,f DQG ') %RJHQKDJHQ 'LVWLQFW UROHV IRU WZR SXULILHG IDFWRUV LQ WUDQVFULSWLRQ RI ;HQRSXV PLWRFKRQGULDO '1$ 0RO &HOO %LRO $SULOOH -5 3HULQDWDO GHYHORSPHQW RI PLWRFKRQGULD LQ UDW OLYHU ,Q 0LWRFKRQGULDO 3K\VLRORJ\ DQG 3DWKRORJ\ )LVNXP HGf 9DQ 1RVWUDQG 5HLQKROG 1HZ
PAGE 260

$WWDUGL &KRP\Q $ .LQJ 03 .UXVH % /RJXHUFLR 3RORVD 3 DQG 10 1DUDVLPKDQ 5HJXODWLRQ RI PLWRFKRQGULDO JHQH H[SUHVVLRQ LQ PDPPDOLDQ FHOOV %LRFKHP 6RF 7UDQV $WWDUGL DQG 6FKDW] %LRJHQHVLV RI PLWRFKRQGULD $QQX 5HY &HOO %LRO $WWDUGL
PAGE 261

%RJHQKDJHQ ') DQG '$ &OD\WRQ 7KH QXPEHU RI PLWRFKRQGULDO GHR[\ULERQXFOHLF DFLG JHQRPHV LQ PRXVH / FHOOV DQG KXPDQ +H/D FHOOV %LRO &KHP %RJHQKDJHQ ') DQG '$ &OD\WRQ 0HFKDQLVP RI PLWRFKRQGULDO '1$ UHSOLFDWLRQ LQ PRXVH /FHOOV NLQHWLFV RI V\QWKHVLV DQG WXUQRYHU RI WKH LQLWLDWLRQ VHTXHQFH 0RO %LRO %RJHQKDJHQ ') DQG 1) ,QVGRUI 3XULILFDWLRQ RI ;HQRSXV ODHYLV PLWRFKRQGULDO 51$ SRO\PHUDVH DQG LGHQWLILFDWLRQ RI D GLVVRFLDEOH IDFWRU UHTXLUHG IRU VSHFLILF WUDQVFULSWLRQ 0RO &HOO %LRO %RJHQKDJHQ ') DQG 0) 5RPDQHOOL 7HPSODWH VHTXHQFHV UHTXLUHG IRU WUDQVFULSWLRQ RI ;HQRSXV ODHYLV PLWRFKRQGULDO '1$ IURP WZR ELGLUHFWLRQDO SURPRWHUV 0RO &HOO %LRO %RJHQKDJHQ ') DQG %.
PAGE 262

%URZQ :0 DQG 9LQRJUDG 5HVWULFWLRQ HQGRQXFOHDVH FOHDYDJH PDSV RI DQLPDO PLWRFKRQGULDO '1$V 3URF 1DWO $FDG 6FL 86$ %XVD :% )HUJXVRQ -( -RVHSK 6. :LOOLDPVRQ -5 DQG 5 1XFFLWHOOL $FWLYDWLRQ RI IURJ ;HQRSXV ODHYLVf HJJV E\ LQRVLWRO WULSKRVSKDWH &KDUDFWHUL]DWLRQ RI &DUHOHDVH IURP LQWUDFHOOXODU VWRUHV &HOO %LRO %XVD :% DQG 5 1XFFLWHOOL $Q HOHYDWHG IUHH F\WRVROLF &Dr ZDYH IROORZV IHUWLOL]DWLRQ LQ HJJV RI WKH IURJ ;HQRSXV ODHYLV &HOO %LRO &DLUQV 66 DQG ') %RJHQKDJHQ 0DSSLQJ RI WKH 'LVSODFHPHQW ORRS ZLWKLQ WKH QXFOHRWLGH VHTXHQFH RI ;HQRSXV ODHYLV PLWRFKRQGULDO '1$ &DQWDWRUH 3 3RORVD 3/ )UDFDVVR ) )ODJHOOD = DQG 01 *DGDOHWD 4XDQWLWDWLRQ RI PLWRFKRQGULDO 51$ VSHFLHV GXULQJ UDW OLYHU GHYHORSPHQW WKH FRQFHQWUDWLRQ RI F\WRFKURPH R[LGDVH VXEXQLW &ROf P51$ LQFUHDVHV DW ELUWK &HOO 'LIIHU &DSDOGL 5$ 6WUXFWXUH DQG DVVHPEO\ RI F\WRFKURPH F R[LGDVH $UFK %LRFKHP %LRSK\V &KDQJ '' DQG '$ &OD\WRQ 3UHFLVH LGHQWLILFDWLRQ RI LQGLYLGXDO SURPRWHUV IRU WUDQVFULSWLRQ RI HDFK VWUDQG RI KXPDQ PLWRFKRQGULDO '1$ &HOO &KDQJ '' DQG '$ &OD\WRQ 3ULPLQJ RI KXPDQ PLWRFKRQGULDO '1$ UHSOLFDWLRQ RFFXUV DW WKH OLJKWVWUDQG SURPRWHU 3URF 1DWO $FDG 6FL 86$ &KDQJ '' DQG '$ &OD\WRQ D $ QRYHO HQGRULERQXFOHDVH FOHDYHV DW D SULPLQJ VLWH RI PRXVH PLWRFKRQGULDO '1$ UHSOLFDWLRQ (0%2 &KDQJ '' DQG '$ &OD\WRQ E $ PDPPDOLDQ PLWRFKRQGULDO 51$ SURFHVVLQJ DFWLYLW\ FRQWDLQV QXFOHXVHQFRGHG 51$ 6FLHQFH

PAGE 263

&KDQJ '' DQG '$ &OD\WRQ 0RXVH 51$DVH 053 51$ LV HQFRGHG E\ D QXFOHDU JHQH DQG FRQWDLQV D GHFDPHU VHTXHQFH FRPSOHPHQWDU\ WR D FRQVHUYHG UHJLRQ RI PLWRFKRQGULDO 51$ VXEVWUDWH &HOO &KDQJ '' +DXVZLUWK :: DQG '$ &OD\WRQ 5HSOLFDWLRQ SULPLQJ DQG WUDQVFULSWLRQ LQLWLDWH IURP SUHFLVHO\ WKH VDPH VLWH LQ PRXVH PLWRFKRQGULDO '1$ (0%2 &KDVH -: DQG /% 'DZLG %LRJHQHVLV RI PLWRFKRQGULD GXULQJ ;HQRSXV ODHYLV GHYHORSPHQW 'HY %LRO &KDX &$ (YDQV 0DQG 5& 6FDUSXOOD 1XFOHDU UHVSLUDWRU\ IDFWRU DFWLYDWLRQ VLWHV LQ JHQHV HQFRGLQJ WKH JDPPDVXEXQLW RI $73 V\QWKDVH HXNDU\RWLF LQLWLDWLRQ IDFWRU D DQG W\URVLQH DPLQRWUDQVIHUDVH 6SHFLILF LQWHUDFWLRQ RI SXULILHG 15) ZLWK PXOWLSOH WDUJHW JHQHV %LRO &KHP &KRPF]\QVNL 3 DQG 0DFNH\ 0RGLILFDWLRQ RI WKH 75, UHDJHQW SURFHGXUH IRU LVRODWLRQ RI 51$ IURP SRO\VDFFKDULGH DQG SURWHRJO\FDQULFK VRXUFHV %LR7HFKQLTXHV &KRP\Q $ DQG $WWDUGL 5HFHQW DGYDQFHV LQ PLWRFKRQGULDO ELRJHQHVLV ,Q 0ROHFXODU 0HFKDQLVPV LQ %LRHQHUJHWLFV (UQVWHU / HGf (OVHYLHU 6FLHQFH 3XEOLVKHUV 1HZ
PAGE 264

&KULVWLDQVRQ 7: DQG '$ &OD\WRQ ,Q YLWUR WUDQVFULSWLRQ RI KXPDQ PLWRFKRQGULDO '1$ DFFXUDWH WHUPLQDWLRQ UHTXLUHV D UHJLRQ RI '1$ VHTXHQFH WKDW FDQ IXQFWLRQ ELGLUHFWLRQDOO\ 3URF 1DWO $FDG 6FL 86$ &KULVWLDQVRQ 7: DQG '$ &OD\WRQ $ WULGHFDPHU '1$ VHTXHQFH VXSSRUWV KXPDQ PLWRFKRQGULDO 51$ f HQG IRUPDWLRQ LQ YLWUR 0RO &HOO %LRO &KXUFK *0 (SKUXVVL $ *LOEHUW : DQG 6 7RQHJDZD &HOO W\SH VSHFLILF FRQWDFWV WR LPPXQRJOREXOLQ HQKDQFHUV LQ QXFOHL 1DWXUH &KXUFK *0 DQG : *LOEHUW *HQRPLF VHTXHQFLQJ 3URF 1DWO $FDG 6FL 86$ &ODUN -0 1RYHO QRQWHPSODWHG QXFOHRWLGH DGGLWLRQ UHDFWLRQV FDWDO\]HG E\ SURNDU\RWLF DQG HXNDU\RWLF '1$ SRO\PHUDVHV 1XFOHLF $FLGV 5HV &OD\WRQ '$ 5HSOLFDWLRQ RI DQLPDO PLWRFKRQGULDO '1$ &HOO &OD\WRQ '$ 5HSOLFDWLRQ DQG WUDQVFULSWLRQ RI YHUWHEUDWH PLWRFKRQGULDO '1$ $QQX 5HY &HOO %LRO &OD\WRQ '$ 7UDQVFULSWLRQ DQG UHSOLFDWLRQ RI DQLPDO PLWRFKRQGULDO '1$V ,QW 5HY &\WRO &RORW +9 DQG 0 5RVEDVFK %HKDYLRU RI LQGLYLGXDO PDWHUQDO S$51$V GXULQJ HPEU\RJHQHVLV RI ;HQRSXV ODHYLV 'HY %LRO &RUQZDOO *$ 2UJHELQ&ULVW 0 DQG 65 +DQQ 'LIIHUHQWLDO H[SUHVVLRQ RI WKH PRXVH PLWRFKRQGULDO JHQHV DQG WKH PLWRFKRQGULDO 51$SURFHVVLQJ HQGRULERQXFOHDVH 51$ E\ DQGURJHQV 0RO (QGR

PAGE 265

&RVWDQ]R 0& DQG 7' )R[ &RQWURO RI PLWRFKRQGULDO JHQH H[SUHVVLRQ LQ 6DFFKDURP\FHV FHUHYLVLDH $QQX 5HY *HQHW 'DJD $ 0LFRO 9 +HVV $HEHUVROG 5 DQG $WWDUGL 0ROHFXODU FKDUDFWHUL]DWLRQ RI WKH WUDQVFULSWLRQ WHUPLQDWLRQ IDFWRU IURP KXPDQ PLWRFKRQGULD %LRO &KHP 'DLUDJKL '6KDGHO *6 DQG '$&OD\WRQ +XPDQ PLWRFKRQn GULDO WUDQVFULSWLRQ IDFWRU $ DQG SURPRWHU VSDFLQJ LQWHJULW\ DUH UHTXLUHG IUR WUDQVFULSWLRQ LQLWLDWLRQ %LRFKHP %LRSK\ $FWD 'DZLG ,% 'HR[\ULERQXFOHLF DFLG LQ DPSKLELDQ HJJV 0RO %LRO 'DZLG ,% (YLGHQFH IRU WKH PLWRFKRQGULDO RULJLQ RI IURJ HJJ F\WRSODVPLF '1$ 3URF 1DWO $FDG 6FL 86$ 'DZLG ,% +D\QHV 65 -DPULFK 0 -RQDV ( 0L\DWDQL 6 6DUJHQW 7' DQG -$ :LQNOHV *HQH H[SUHVVLRQ LQ ;HQRSXV HPEU\RJHQHVLV (PEU\RO H[S 0RUSK 6XSSOf 'DZLG ,% .D\ %. DQG 7' 6DUJHQW *HQH H[SUHVVLRQ GXULQJ ;HQRSXV ODHYLV GHYHORSPHQW ,Q *HQH 6WUXFWXUH DQG 5HJXODWLRQ LQ 'HYHORSPHQW $ODQ 5 /LVV ,QF 1HZ
PAGE 266

'UHZ +5 DQG $$ 7UDYHUV '1$ VWUXFWXUDO YDULDWLRQV LQ WKH ( FROO W\U7 SURPRWHU &HOO 'XQRQ%OXWHDX '& DQG *0 %UXQ 0DSSLQJ DW WKH QXFOHRWLGH OHYHO RI ;HQRSXV ODHYLV PLWRFKRQGULDO 'ORRS + VWUDQG VWUXFWXUDO IHDWXUHV RI WKH f UHJLRQ %LRFKHP ,QW 'XQRQ%OXWHDX '& 9RLWRYLFK 0 DQG *0 %UXQ 1XFOHRWLGH VHTXHQFH RI D ;HQRSXV ODHYLV PLWRFKRQGULDO '1$ IUDJPHQW FRQWDLQLQJ WKH 'ORRS IODQNLQJ W51$ JHQHV DQG WKH DSRF\WRFKURPH E JHQH *HQH 'ZRUNLQ 0% DQG ( 'ZRUNLQ5DVWO 0HWDEROLF UHJXODWLRQ GXULQJ HDUO\ IURJ GHYHORSPHQW JO\FRJHQLF IOX[ LQ ;HQRSXV RRF\WHV HJJV DQG HPEU\RV 'HY %LRO 'ZRUNLQ 0% DQG ( 'ZRUNLQ5DVWO 5HJXODWLRQ RI FDUERQ IOX[ IURP DPLQR DFLGV LQWR VXJDU SKRVSKDWHV LQ ;HQRSXV HPEU\RV 'HY %LRO 'ZRUNLQ 0% DQG ( 'ZRUNLQ5DVWO &DUERQ PHWDEROLVP LQ HDUO\ DPSKLELDQ HPEU\RV 7,%6 'ZRUNLQ 0% DQG ( 'ZRUNLQ5DVWO *O\FRJHQ EUHDNGRZQ LQ FOHDYLQJ ;HQRSXV HPEU\RV LV OLPLWHG E\ $'3 0RO 5HSURG 'HY 'ZRUNLQ 0% 6KUXWNRZVNL $ DQG ( 'ZRUNLQ5DVWO 0RELOL]DWLRQ RI VSHFLILF PDWHUQDO 51$ VSHFLHV LQWR SRO\VRPHV DIWHU IHUWLOL]DWLRQ LQ ;HQRSXV ODHYLV 3URF 1DWO $FDG 6FL 86$ (QULTXH] -$ 3HUH]0DUWRV $ /RSH]3HUH] 0DQG 0RQWR\D ,Q RUJDQHOOR 51$ V\QWKHVLV V\VWHP IURP PDPPDOLDQ OLYHU DQG EUDLQ 0HWK (Q] (YDQV 0DQG 5& 6FDUSXOOD ,QWHUDFWLRQ RI QXFOHDU IDFWRUV ZLWK PXOWLSOH VLWHV LQ WKH VRPDWLF F\WRFKURPH F SURPRWHU &KDUDFWHUL]DWLRQ RI XSVWUHDP 15) $7) DQG LQWURQ 6SO UHFRJQLWLRQ VLWHV %LRO &KHP

PAGE 267

(YDQV 0DQG 5& 6FDUSXOOD 15) $ WUDQVDFWLYDWRU RI QXFOHDUHQFRGHG UHVSLUDWRU\ JHQHV LQ DQLPDO FHOOV *HQHV 'HY (ZDUW *' =KDQJ <= DQG 5$ &DSDOGL 6ZLWFKLQJ RI ERYLQH F\WRFKURPH R[LGDVH VXEXQLW 9LD LVRIRUPV LQ VNHOHWDO PXVFOH GXULQJ GHYHORSPHQW )(%6 /HWW )HUQDQGH]6LOYD 3 0LFRO 9 DQG $WWDUGL 0LWRFKRQGULDO '1$ WUDQVFULSWLRQ LQLWLDWLRQ DQG WHUPLQDWLRQ XVLQJ PLWRFKRQGULDO O\VDWHV IURP FXOWXUHG KXPDQ FHOOV 0HWK (Q] )LVKHU 53 DQG '$ &OD\WRQ $ WUDQVFULSWLRQ IDFWRU UHTXLUHG IRU SURPRWHU UHFRJQLWLRQ E\ KXPDQ PLWRFKRQGULDO 51$ SRO\PHUDVH $FFXUDWH LQLWLDWLRQ DW WKH +HDY\ DQG /LJKWVWUDQG SURPRWHUV GLVVHFWHG DQG UHFRQVWLWXWHG LQ YLWUR %LRO &KHP )LVKHU 53 DQG '$ &OD\WRQ 3XULILFDWLRQ DQG FKDUDFWHUL]DWLRQ RI KXPDQ PLWRFKRQGULDO WUDQVFULSWLRQ IDFWRU 0RO &HOO %LRO )LVKHU 53 /LVRZVN\ 7 %UHHQ *$0 DQG '$ &OD\WRQ $ UDSLG HIILFLHQW PHWKRG IRU SXULI\LQJ '1$ELQGLQJ SURWHLQV 'HQDWXUDWLRQUHQDWXUDWLRQ FKURPDWRJUDSK\ RI KXPDQ DQG \HDVW PLWRFKRQGULDO H[WUDFWV %LRO &KHP )LVKHU 53 /LVRZVN\ 7 3DULVL 0$ DQG '$ &OD\WRQ '1$ ZUDSSLQJ DQG EHQGLQJ E\ D PLWRFKRQGULDO KLJK PRELOLW\ JURXSOLNH WUDQVFULSWLRQDO DFWLYDWRU SURWHLQ %LRO &KHP )LVKHU 53 7RSSHU -1 DQG '$ &OD\WRQ 3URPRWHU VHOHFWLRQ LQ KXPDQ PLWRFKRQGULD LQYROYHV ELQGLQJ RI D WUDQVFULSWLRQ IDFWRU WR RULHQWDWLRQLQGHSHQGHQW XSVWUHDP UHJXODWRU\ HOHPHQWV &HOO *DJQRQ .XURZVNL 77 :HLVQHU 5DQG 5 =DN &RUUHODWLRQV EHWZHHQ D QXFOHDU DQG D PLWRFKRQGULDO P51$ RI

PAGE 268

F\WRFKURPH F R[LGDVH VXEXQLWV HQ]\PDWLF DFWLYLW\ DQG WRWDO P51$ FRQWHQW LQ UDW WLVVXHV 0RO &HOO %LRFKHP *DL := 6XQ 60 'LQJ <= )UHHGPDQ -6 DQG 6+3 &KDQ f 7ZR PRQRFORQDO DQWLERG\ OLQHV GLUHFWHG DJDLQVW VXEXQLW ,9 RI F\WRFKURPH R[LGDVH D VWXG\ RI RSSRVLWH HIIHFWV $UFK %LRFKHP %LRSK\V *DLQHV */ ,,, ,Q RUJDQHOOR 51$ V\QWKHVLV V\VWHP IURP +H/D FHOOV 0HWK (Q] *DLQHV DQG $WWDUGL +LJKO\ HIILFLHQW 51$V\QWKHVL]LQJ V\VWHP WKDW XVHV LVRODWHG KXPDQ PLWRFKRQGULD 1HZ LQLWLDWLRQ HYHQWV DQG LQ YLYROLNH SURFHVVLQJ SDWWHUQV 0RO &HOO %LRO *DLQHV 5RVVL & DQG $WWDUGL 0DUNHGO\ GLIIHUHQW $73 UHTXLUHPHQWV IRU U51$ V\QWKHVLV DQG PW'1$ OLJKW VWUDQG WUDQVFULSWLRQ YHUVXV P51$ V\QWKHVLV LQ LVRODWHG KXPDQ PLWRFKRQGULD %LRO &KHP *DUULW\ 3$ DQG %:ROG (IIHFWV RI GLIIHUHQW '1$ SRO\PHUDVHV LQ OLJDWLRQPHGLDWHG 3&5 HQKDQFHG JHQRPLF VHTXHQFLQJ DQG LQ YLYR IRRWSULQWLQJ 3URF 1DWO $FDG 6FL 86$ *HKQULFK 6& DQG -5 $SULOOH +HSDWLF JOXFRQHRJHQHVLV DQG PLWRFKRQGULDO IXQFWLRQ GXULQJ KLEHUQDWLRQ &RPS %LRFKHP 3K\VLRO % *KLYL]]DQL 6& 0DGVHQ &6 DQG :: +DXVZLUWK ,Q RUJDQHOOR IRRWSULQWLQJ $QDO\VLV RI SURWHLQ ELQGLQJ DW UHJXODWRU\ UHJLRQV LQ ERYLQH PLWRFKRQGULDO '1$ %LRO &KHP *KLYL]]DQL 6& 0DGVHQ &6 1HOHQ 05 $PPLQL &9 DQG :: +DXVZLUWK ,Q RUJDQHOOR IRRWSULQW DQDO\VLV RI KXPDQ PLWRFKRQGULDO '1$ +XPDQ PLWRFKRQGULDO WUDQVFULSWLRQ IDFWRU $ LQWHUDFWLRQV DW WKH RULJLQ RI UHSOLFDWLRQ 0RO &HOO %LRO *LOOXP $0 DQG '$ &OD\WRQ 'LVSODFHPHQWORRS UHSOLFDWLRQ LQLWLDWLRQ VHTXHQFH LQ DQLPDO PLWRFKRQGULDO '1$ H[LVWV DV D IDPLO\ RI GLVFUHWH OHQJWKV 3URF 1DWO $FDG 6FL 86$

PAGE 269

*LOOXP $0 DQG '$ &OD\WRQ 0HFKDQLVP RI PLWRFKRQGULDO '1$ UHSOLFDWLRQ LQ PRXVH /FHOOV 51$ SULPLQJ GXULQJ WKH LQLWLDWLRQ RI KHDY\VWUDQG V\QWKHVLV 0RO %LRO *LQVEHUJ/ DQG 1 +LOOPDQ $73 PHWDEROLVP LQ FOHDYDJH VWDJHG PRXVH HPEU\RV (PEURO ([S 0RUSK *RWR < 1RQDND DQG 6 +RUDL $ PXWDWLRQ LQ WKH W51$ /HXf 885f JHQH DVVRFLDWHG ZLWK WKH 0(/$6 VXEJURXS RI PLWRFKRQGULDO HQFHSKDORP\RSDWKLHV 1DWXUH *RWR < 1RQDND ,f DQG 6 +RUDL $ QHZ PW'1$ PXWDWLRQ DVVRFLDWHG ZLWK PLWRFKRQGULDO P\RSDWK\ HQFHSKDORSDWK\ ODFWLF DFLGRVLV DQG VWURNHOLNH HSLVRGHV 0(/$6f %LRFKLP %LRSK\V $FWD *RWR < 7RMR 0 7RK\DPD +RUDL 6 DQG 1RQDND $ QRYHO SRLQW PXWDWLRQ LQ WKH PLWRFKRQGULDO W51$ /HXf 885f JHQH LQ D IDPLO\ ZLWK PLWRFKRQGULDO P\RSDWK\ $QQ 1HXURO *URVVFKHGO 5 *LHVH DQG 3DJHO +0* GRPDLQ SURWHLQV DUFKLWHFWXUDO HOHPHQWV LQ WKH DVVHPEO\ RI QXFOHRSURWHLQ VWUXFWXUHV 7UHQGV *HQHW +DMQRF]N\ 5REE*DVSHUV /' 6HLW] 0% DQG $3 7KRPDV f 'HFRGLQJ RI F\WRVROLF FDOFLXP RVFLOODWLRQV LQ WKH PLWRFKRQGULD &HOO +HKPDQ */ DQG :: +DXVZLUWK '1$ KHOLFDVH IURP PDPPDOLDQ PLWRFKRQGULD 3URF 1DWO $FDG 6FL 86$ +HVV -) 3DULVL 0$ %HQQHWW -/ DQG '$ &OD\WRQ ,PSDLUPHQW RI PLWRFKRQGULDO WUDQVFULSWLRQ WHUPLQDWLRQ E\ D SRLQW PXWDWLRQ DVVRFLDWHG ZLWK WKH 0(/$6 VXEJURXS RI PLWRFKRQGULDO HQFHSKDORP\RSDWKLHV 1DWXUH +HYQHU 5) DQG 077 :RQJ5LOH\ %UDLQ F\WRFKURPH R[LGDVH SXULILFDWLRQ DQWLERG\ SURGXFWLRQ DQG LPPXQRKLVWRFKHPLFDO KLVWRFKHPLFDO FRUUHODWLRQV LQ WKH &16 1HXURVFL

PAGE 270

+HYQHU 5) DQG 077 :RQJ5LOH\ 5HJXODWLRQ RI F\WRFKURPH R[LGDVH SURWHLQ OHYHOV E\ IXQFWLRQDO DFWLYLW\ LQ WKH PDFDTXH PRQNH\ YLVXDO V\VWHP 1HXURVFL +HYQHU 5) DQG 077 :RQJ5LOH\ 1HXURQDO H[SUHVVLRQ RI QXFOHDU DQG PLWRFKRQGULDO JHQHV IRU F\WRFKURPH R[LGDVH &2f VXEXQLWV DQDO\]HG E\ LQ VLWX K\EULGL]DWLRQ FRPSDULVRQ ZLWK &2 DFWLYLW\ DQG SURWHLQ 1HXURVFL +HYQHU 5) DQG 077 :RQJ5LOH\ 0LWRFKRQGULDO DQG QXFOHDU JHQH H[SUHVVLRQ IRU F\WRFKURPH R[LGDVH VXEXQLWV DUH GLVSURSRUWLRQDWHO\ UHJXODWHG E\ IXQFWLRQDO DFWLYLW\ LQ QHXURQV 1HXURVFL +L[VRQ -( DQG '$ &OD\WRQ ,QLWLDWLRQ RI WUDQVFULSWLRQ IURP HDFK RI WKH WZR KXPDQ PLWRFKRQGULDO SURPRWHUV UHTXLUHV XQLTXH QXFOHRWLGHV DW WKH WUDQVFULSWLRQDO VWDUW VLWHV 3URF 1DWO $FDG 6FL 86$ +L[VRQ -( :RQW 7: DQG '$ &OD\WRQ %RWK WKH FRQVHUYHG VWHPORRS DQG GLYHUJHQW fIODQNLQJ VHTXHQFHV DUH UHTXLUHG IRU LQLWLDWLRQ DW WKH KXPDQ PLWRFKRQGULDO RULJLQ RI OLJKWVWUDQG '1$ UHSOLFDWLRQ %LRO &KHP +ROOLQJHU 7* DQG */ &RUWRQ $UWLILFLDO IHUWLOL]DWLRQ RI JDPHWHV IURP WKH 6RXWK $IULFDQ FODZHG IURJ ;HQRSXV ODHYLV *DPHWH 5HV +RUQVWUD ,. DQG 73
PAGE 271

-DQW]HQ +0 $GPRQ $ %HOO 63 DQG 5 7MLDQ 1XFOHRODU WUDQVFULSWLRQ IDFWRU K8%) FRQWDLQV D '1$ELQGLQJ PRWLI ZLWK KRPRORJ\ WR +0* SURWHLQV 1DWXUH .DGHQEDFK % *RHEHOO + DQG 0 .OLQJHQEHUJ 'LIIHUHQWLDO DFWLRQ RI WK\URLG KRUPRQHV RQ HQ]\PH OHYHOV RI WKH '31 DQG 731 VSHFLILF LVRFLWUDWH GHK\GURJHQDVH %LRFKHP %LRSK\V 5HV &RPP .DGHQEDFK % -DUDXVFK +DUWPDQQ 5 DQG 3 0HUOH 6HSDUDWLRQ RI PDPPDOLDQ F\WRFKURPH F R[LGDVH LQWR SRO\SHSWLGHV E\ D VRGLXP GRGHF\O VXOIDWHJHO HOHFWURSKRUHWLF SURFHGXUH $QDO %LRFKHP .DGHQEDFK % .XKQ1HQWZLJ / DQG 8 %XJH (YROXWLRQ RI D UHJXODWRU\ HQ]\PH F\WRFKURPHF R[LGDVH FRPSOH[ ,9f &XUU 7RS %LRHQHUJ .DVDPDWVX + 5REEHUVRQ '/ DQG 9LQRJUDG $ QRYHO FORVHGFLUFXODU PLWRFKRQGULDO '1$ ZLWK SURSHUWLHV RI D UHSOLFDWLQJ LQWHUPHGLDWH 3URF 1DWO $FDG 6FL 86$ .LP /HFRUGLHU $ DQG /+ %RZPDQ %RWK QXFOHDU DQG PLWRFKRQGULDO F\WRFKURPH F R[LGDVH P51$ OHYHOV LQFUHDVH GUDPDWLFDOO\ GXULQJ PRXVH SRVWQDWDO GHYHORSPHQW %LRFKHP .LQJ 03 DQG $WWDUGL ,QMHFWLRQ RI PLWRFKRQGULD LQWR KXPDQ FHOOV OHDGV WR D UDSLG UHSODFHPHQW RI WKH HQGRJHQRXV PLWRFKRQGULDO '1$ &HOO .LQJ 03 DQG $WWDUGL +XPDQ FHOOV ODFNLQJ PLWRFKRQGULDO '1$ UHSRSXODWLRQ ZLWK H[RJHQRXV PLWRFKRQGULD E\ FRPSOHPHQWDWLRQ 6FLHQFH .LQJ 03 DQG $WWDUGL 3RVWWUDQVFULSWLRQDO UHJXODWLRQ RI WKH VWHDG\VWDWH OHYHOV RI PLWRFKRQGULDO W51$V LQ +H/D FHOOV %LRO &KHP

PAGE 272

.LQJ 03 .RJD < 'DYLGVRQ 0 DQG ($ 6FKRQ 'HIHFWV LQ PLWRFKRQGULDO SURWHLQ V\QWKHVLV DQG UHVSLUDWRU\ FKDLQ DFWLYLW\ VHJUHJDWH ZLWK WKH W51$ /HX 885ff PXWDWLRQ DVVRFLDWHG ZLWK PLWRFKRQGULDO P\RSDWK\ HQFHSKDORSDWK\ ODFWLF DFLGRVLV DQG VWURNHn OLNH HSLVRGHV 0RO &HOO %LRO .LVV 7 DQG : )LOLSRZLF] (YLGHQFH DJDLQVW D PLWRFKRQGULDO ORFDWLRQ RI WKH 053 51$ LQ PDPPDOLDQ FHOOV &HOO .UXVH % 1DUDVLPKDQ 1 DQG $WWDUGL 7HUPLQDWLRQ RI WUDQVFULSWLRQ LQ KXPDQ PLWRFKRQGULD LGHQWLILFDWLRQ DQG SXULILFDWLRQ RI D '1$ ELQGLQJ SURWHLQ IDFWRU WKDW SURPRWHV WHUPLQDWLRQ &HOO .XERWD +<
PAGE 273

PDWHUQDO P51$V DVVRFLDWLRQ ZLWK WKH SRUWLRQ RI (J P51$ WKDW SURPRWHV GHDGHQ\ODWLRQ LQ HPEU\RV 'HYHORSPHQW /HYLQJV &6 ,OO DQG ** %URZQ 0ROHFXODU ELRORJ\ RI SODQW PLWRFKRQGULD &HOO /L 6PDJXOD &6 3DUVRQV :5LFKDUGVRQ -$ *RQ]DOH] 0 +DJOHU +. DQG 56 :LOOLDPV 6XEFHOOXODU SDUWLWLRQLQJ RI 053 51$ DVVHVVHG E\ XOWUDVWUXFWXUDO DQG ELRFKHPLFDO DQDO\VLV &HOO %LRO /LOOH\ '0+0* KDV '1$ ZUDSSHG XS 1DWXUH /RQVGDOH '0 +RGJH 73 )DXURQ &0 7KH SK\VLFDO PDS DQG RUJDQL]DWLRQ RI WKH PLWRFKRQGULDO JHQRPH IURP WKH IHUWLOH F\WRSODVP RI PDL]H 1XFOHLF $FLGV 5HV /RSH] 0& 6PHUDJH -% DQG +9 %DNHU $ VLPSOLILHG YDFXXP PHWKRG IRU JHQRPLF VHTXHQFLQJ DQG LQ YLYR IRRWSULQWLQJ %LR7HFKQLTXHV /RULPHU +( %UHZHU %DQG :/ )DQJPDQ $ WHVW RI WKH WUDQVFULSWLRQ PRGHO IRU ELDVHG LQKHULWDQFH RI \HDVW PLWRFKRQGULDO '1$ 0RO &HOO %LRO /RX $QGHUVRQ 6/ ;LQJ / DQG %< 5XELQ 6XSSUHVVLRQ RI P51$ OHYHOV DQG PLWRFKRQGULDO IXQFWLRQ LQ FHOOV UHVSRQGLQJ WR WKH DQWLFHOOXODU DFWLRQ RI LQWHUIHURQ ,QWHUIHURQ 5HV /_!YWUXS5HLQ + DQG / 1HOVRQ D &KDQJHV LQ HQHUJ\ PHWDEROLVP GXULQJ WKH HDUO\ GHYHORSPHQW RI ;HQRSXV ODHYLV ([S &HOO %LRO /f!YWUXS5HLQ + DQG / 1HOVRQ E &KDQJHV LQ PLWRFKRQGULDO UHVSLUDWLRQ GXULQJ WKH GHYHORSPHQW RI ;HQRSXV ODHYLV &HOO 'LIIHU

PAGE 274

/RZU\ 2+ 5RVHEURXJK 1)DUU $/ DQG 55DQGDOO 3URWHLQ PHDVXUHPHQW ZLWK )ROLQ SKHQRO UHDJHQW %LRO &KHP 0DGVHQ &6 *KLYL]]DQL 6& $PPLQL &9 1HOHQ 05 :: +DXVZLUWK *HQRPLF IRRWSULQWLQJ RI PLWRFKRQGULDO '1$ ,Q RUJDQHOOR DQDO\VLV RI SURWHLQPLWRFKRQGULDO '1$ LQWHUDFWLRQV LQ ERYLQH PLWRFKRQGULD 0HWK (Q] 0DQDP 6 DQG *& 9DQ 7X\OH 6HSDUDWLRQ DQG FKDUDFWHUL]DWLRQ RI f DQG fW51$ SURFHVVLQJ QXFOHDVHV IURP UDW OLYHU PLWRFKRQGULD %LRO &KHP 0DQLDWLV 7 )ULWVFK () DQG 6DPEURRN 0ROHFXODU &ORQLQJ $ /DERUDWRU\ 0DQXDO &ROG 6SULQJ +DUERU /DERUDWRU\ 3UHVV &ROG 6SULQJ +DUERU 1HZ
PAGE 275

0F.HH (( *ULHU %/ 7KRPSVRQ *6 /HXQJ $&) DQG -' 0F&RXUW E &RXSOLQJ RI PLWRFKRQGULDO PHWDEROLVP DQG SURWHLQ V\QWKHVLV LQ KHDUW PLWRFKRQGULD $P 3K\VLRO (( 0H]LDQH $( &DOOHQ -& DQG -& 0RXQRORX 0LWRFKRQGULDO JHQH H[SUHVVLRQ GXULQJ ;HQRSXV ODHYLV GHYHORSPHQW D PROHFXODU VWXG\ 0LJQRWWH % DQG 0 %DUDW &KDUDFWHUL]DWLRQ RI D ;HQRSXV ODHYLV PLWRFKRQGULDO SURWHLQ ZLWK D KLJK DIILQLW\ IRU VXSHUFRLOHG '1$ 1XFOHLF $FLGV 5HV 0LJQRWWH % 'HODLQ ( 5LFNZRRG DQG 0 %DUDW*XHULGH 7KH ;HQRSXV ODHYLV PLWRFKRQGULDO SURWHLQ PW'%3& FRRSHUDWLYHO\ IROGV WKH '1$ LQ YLWUR (0%2 0LJQRWWH % 7KHYHQ\ % DQG % 5HYHW 6WUXFWXUDO PRGLILFDWLRQV LQGXFHG E\ WKH PW'%3& SURWHLQ LQ WKH UHSOLFDWLRQ RULJLQ RI ;HQRSXV ODHYLV PLWRFKRQGULDO '1$ %LRFKLPLH 0LOOV -U 50 DQG 5/ %ULQVWHU 2[\JHQ FRQVXPSWLRQ RI SUHn LPSODQWDWLRQ PRXVH HPEU\RV ([SO &HOO 5HV 0RQWR\D &KULVWLDQVRQ 7 /HYHQV 5DELQRZLW] 0 DQG $WWDUGL ,GHQWLILFDWLRQ RI LQLWLDWLRQ VLWHV IRU KHDY\VWUDQG DQG OLJKWVWUDQG WUDQVFULSWLRQ LQ KXPDQ PLWRFKRQGULDO '1$ 3URF 1DWO $FDG 6FL 86$ 0RQWR\D *DLQHV */ DQG $WWDUGL 7KH SDWWHUQ RI WUDQVFULSWLRQ RI WKH KXPDQ PLWRFKRQGULDO U51$ JHQHV UHYHDOV WZR RYHUODSSLQJ WUDQVFULSWLRQ XQLWV &HOO 0RQWR\D 2MDOD DQG $WWDUGL 'LVWLQFWLYH IHDWXUHV RI WKH fWHUPLQDO VHTXHQFHV RI WKH KXPDQ PLWRFKRQGULDO P51$V 1DWXUH 0XHOOHU '0 DQG *6 *HW] 7UDQVFULSWLRQDO UHJXODWLRQ RI WKH PLWRFKRQGULDO JHQRPH RI \HDVW 6DFFKDURP\FHV FHUHYLVLDH %LRO &KHP

PAGE 276

0XOOLJDQ 50 0DORQH\ $3 DQG 9 :DOERW 51$ SURFHVVLQJ DQG PXOWLSOH WUDQVFULSWLRQ LQLWLDWLRQ VLWHV UHVXOW LQ WUDQVFULSW VL]H KHWHURJHQHLW\ LQ PDL]H PLWRFKRQGULD 0RO *HQ *HQHW 0XLVH 5& DQG :: +DXVZLUWK 7UDQVFULSWLRQ LQ PDL]H PLWRFKRQGULD HIIHFWV RI WLVVXH DQG PLWRFKRQGULDO JHQRW\SH &XUU *HQHW 0XLVH 5& DQG :: +DXVZLUWK 6HOHFWLYH '1$ DPSOLILFDWLRQ UHJXODWHV WUDQVFULSW OHYHOV LQ SODQW PLWRFKRQGULD &XUU *HQHW 0XUSK\ :, $WWDUGL % 7X & DQG $WWDUGL (YLGHQFH IRU FRPSOHWH V\PPHWULFDO WUDQVFULSWLRQ LQ YLYR RI PLWRFKRQGULDO '1$ LQ +H/D FHOOV 0RO %LRO 0XWYHL $ .X]HOD 6 DQG %' 1HOVRQ &RQWURO RI PLWRFKRQGULDO WUDQVFULSWLRQ E\ WK\URLG KRUPRQH (XU %LRFKHP 1DND]DZD 7 DQG 7 1XQRNDZD (QHUJ\ WUDQVGXFWLRQ DQG DGHQLQH QXFOHRWLGHV LQ PLWRFKRQGULD IURP UDW OLYHU DIWHU K\SR[LF SHUIXVLRQ %LRFKHP 7RN\R 1HOVRQ -( DQG 6$ .UDZHW] 3XULILFDWLRQ RI FORQHG DQG JHQRPLF '1$ E\ JXDQLGLQH WKLRF\DQDWHLVREXW\O DOFRKRO IUDFWLRQDWLRQ $QDO %LRFKHP 1HZSRUW DQG 0 .LUVFKQHU D $ PDMRU GHYHORSPHQWDO WUDQVLWLRQ LQ HDUO\ ;HQRSXV HPEU\RV &KDUDFWHUL]DWLRQ DQG WLPLQJ RI FHOOXODU FKDQJHV DW WKH PLGEODVWXOD VWDJH &HOO 1HZSRUW DQG 0 .LUVFKQHU E $ PDMRU GHYHORSPHQWDO WUDQVLWLRQ LQ HDUO\ ;HQRSXV HPEU\RV ,, &RQWURO RI WKH RQVHW RI WUDQVFULSWLRQ &HOO 1LFN + DQG : *LOEHUW 'HWHFWLRQ LQ YLYR RI SURWHLQ'1$ LQWHUDFWLRQV ZLWKLQ WKH ODF RSHURQ RI (VFKHULFKLD FROL 1DWXUH

PAGE 277

1LHXZNRRS 3' DQG )DEHU 1RUPDO 7DEOHV RI ;HQRSXV ODHYLV 'DXGLQf QG HGLWLRQ 1RUWK+ROODQG $PVWHUGDPf 2MDOD 0RQWR\D DQG $WWDUGL W51$ SXQFWXDWLRQ PRGHO RI 51$ SURFHVVLQJ LQ KXPDQ PLWRFKRQGULD 1DWXUH 3DULNK 96 0RUJDQ 00 6FRWW 5 &OHPHQWV /6 DQG 5$ %XWRZ 7KH PLWRFKRQGULDO JHQRW\SH FDQ LQIOXHQFH QXFOHDU JHQH H[SUHVVLRQ LQ \HDVW 6FLHQFH 3DULV DQG -' 5LFKWHU 0DWXUDWLRQVSHFLILF SRO\DGHQ\ODWLRQ DQG WUDQVODWLRQDO FRQWURO 'LYHUVLW\ RI F\WRSODVPLF SRO\DGHQ\ODWLRQ HOHPHQWV LQIOXHQFH RI SRO\ $f WDLO VL]H DQG IRUPDWLRQ RI VWDEOH SRO\DGHQ\ODWLRQ FRPSOH[HV 0RO &HOO %LRO 3DULV 6ZHQVRQ 3LZQLFD:RUPV + DQG -' 5LFKWHU 0DWXUDWLRQVSHFLILF SRO\DGHQ\ODWLRQ LQ YLWUR DFWLYDWLRQ E\ SFGF DQG SKRVSKRU\ODWLRQ RI D N' &3(ELQGLQJ SURWHLQ *HQHV 'HY 3DULVL 0$ DQG '$ &OD\WRQ 6LPLODULW\ RI KXPDQ PLWRFKRQGULDO WUDQVFULSWLRQ IDFWRU WR KLJK PRELOLW\ JURXS SURWHLQV 6FLHQFH 3LHUDQGUHL$PDOGL 3 &DPSLRQL 1 %HFFDUL ( %R]]RQL DQG ) $PDOGL ([SUHVVLRQ RI ULERVRPDOSURWHLQ JHQHV LQ ;HQRSXV ODHYLV GHYHORSPHQW &HOO 3LNR / DQG '* &KDVH 5ROH RI WKH PLWRFKRQGULDO JHQRPH GXULQJ HDUO\ GHYHORSPHQW LQ PLFH (IIHFWV RI HWKLGLXP EURPLGH DQG FKORUDPSKHQLFRO &HOO %LRO 3LNR / DQG .' 7D\ORU $PRXQWV RI PLWRFKRQGULDO '1$ DQG DEXQGDQFH RI VRPH PLWRFKRQGULDO JHQH WUDQVFULSWV LQ HDUO\ PRXVH HPEU\RV 'HY %LRO 3R\WRQ 52 %HOOXV 0F.HH (( 6HYDULQR .$ DQG % *RHKULQJ ,Q RUJDQHOOR PLWRFKRQGULDO SURWHLQ DQG 51$ V\QWKHVLV V\VWHPV IURP 6DFFKDURP\FHV FHUHYLVLDH 0HWK (Q]

PAGE 278

3UDORQJ :) 6SDW $ DQG &% :ROOKHLP '\QDPLF SDFLQJ RI FHOO PHWDEROLVP E\ LQWUDFHOOXODU &DW WUDQVLHQWV %LRO &KHP 5DLNKLQVWHLQ 0 DQG +DQXNRJOX 0LWRFKRQGULDOJHQRPH HQFRGHG 51$V 'LIIHUHQWLDO UHJXODWLRQ E\ FRUWLFRWURSLQ LQ ERYLQH DGUHQRFRUWLFDO FHOOV 3URF 1DWO $FDG 6FL 86$ 5HDG /. 6WDQNH\ .$ )LVK :5 0XWKDQL $0 DQG 6WXDUW 'HYHORSPHQWDO UHJXODWLRQ RI 51$ HGLWLQJ DQG SRO\DGHQ\ODWLRQ LQ IRXU OLIH F\FOH VWDJHV RI 7U\SDQRVRPD FRQJROHQVH 0RO %LRFKHP 3DUDVLWRO 5L]]XWR 5 %DVWLDQXWWR & %ULQL 0 0XUJLD 0 DQG 7 3R]]DQ f 0LWRFKRQGULDO &DKRPHRVWDVLV LQ LQWDFW FHOOV &HOO %LRO 5REEHUVRQ '/ DQG '$ &OD\WRQ 5HSOLFDWLRQ RI PLWRFKRQGULDO '1$ LQ PRXVH / FHOOV DQG WKHLU WK\PLGLQH NLQDVH GHULYDWLYH GLVSODFHPHQW UHSOLFDWLRQ RQ D FRYDOHQWO\FORVHG FLUFXODU WHPSODWH 3URF 1DWO $FDG 6FL 86$ 5REEHUVRQ '/ &OD\WRQ '$ DQG -) 0RUURZ &OHDYDJH RI UHSOLFDWLQJ IRUPV RI PLWRFKRQGULDO '1$ E\ (FR5, HQGRQXFOHDVH 3URF 1DWO $FDG 6FL 86$ 5RELQ (' DQG 5 :RQJ 0LWRFKRQGULDO '1$ PROHFXOHV DQG YLUWXDO QXPEHU RI PLWRFKRQGULD SHU FHOO LQ PDPPDOLDQ FHOOV &HOO 3K\VLRO 5RH %$ 0D :LOVRQ 5. DQG -) :RQJ 7KH FRPSOHWH QXFOHRWLGH VHTXHQFH RI WKH ;HQRSXV ODHYLV PLWRFKRQGULDO JHQRPH %LRO &KHP 5RHGHU 5* D 0XOWLSOH IRUPV RI GHR[\ULERQXFOHLF DFLG GHSHQGHQW ULERQXFOHLF DFLG SRO\PHUDVH LQ ;HQRSXV ODHYLV ,VRODWLRQ DQG SDUWLDO FKDUDFWHUL]DWLRQ %LRO &KHP

PAGE 279

5RHGHU 5* E 0XOWLSOH IRUPV RI GHR[\ULERQXFOHLF DFLG GHSHQGHQW ULERQXFOHLF DFLG SRO\PHUDVH LQ ;HQRSXV ODHYLV /HYHOV RI DFWLYLW\ GXULQJ RRF\WH DQG HPEU\RQLF GHYHORSPHQW %LRO &KHP 6DORPRQ GH /HJQDPH +6 )HUQDQGH] 61 0LFHOL '& 0DULDQR 0, DQG $+ /HJQDPH 0RGLILFDWLRQV RI WKH PLWRFKRQGULDO XOWUDVWUXFWXUH UHODWHG WR PHWDEROLF FKDQJHV GXULQJ %XIR DUHQDUXP RQWRJHQHVLV $FWD (PEU\RO ([S 6DOX] +3 DQG -3 -RVW *HQRPLF IRRWSULQWLQJ ZLWK 7DT SRO\PHUDVH 1DWXUH 6DOX] +3 :LHEDXHU DQG $ :DOODFH 6WXG\LQJ '1$ PRGLILFDWLRQV DQG '1$SURWHLQ LQWHUDFWLRQV LQ YLYR $ ZLQGRZ RQWR WKH QDWLYH JHQRPH 7UHQGV *HQHW 6FKLQNHO $+ *URRW .RHUNDPS 0-$ 7RXZ (3: DQG +) 7DEDN 6SHFLILFLW\ IDFWRU RI \HDVW PLWRFKRQGULDO 51$ SRO\PHUDVH %LRO &KHP 6FKRQ ($ .RJD < 'DYLGVRQ 0 0RUDHV &7 DQG 03 .LQJ 7KH PLWRFKRQGULDO W51$ /HX 885ff PXWDWLRQ LQ 0(/$6 D PRGHO IRU SDWKRJHQHVLV %LRFKLP %LRSK\V $FWD 6FKRQIHOG 3 )ULW] 6 +DODQJN : DQG 5 %RKQHQVDFN ,QFUHDVH LQ WKH DGHQLQH QXFOHRWLGH WUDQVORFDVH SURWHLQ FRQWULEXWHV WR WKH SHULQDWDO PDWXUDWLRQ RI UHVSLUDWLRQ LQ UDW OLYHU PLWRFKRQGULD %LRFKLP %LRSK\V $FWD 6KDGHO *6 DQG '$ &OD\WRQ 0LWRFKRQGULDO WUDQVFULSWLRQ LQLWLDWLRQ 9DULDWLRQ DQG FRQVHUYDWLRQ %LRO &KHP 6KDGHO *6 DQG '$ &OD\WRQ $ 6DFFKDURP\FHV FHUHYLVLDH PLWRFKRQGULDO WUDQVFULSWLRQ IDFWRU VFPW7)% VKDUHV IHDWXUHV ZLWK VLJPD IDFWRUV EXW LV IXQFWLRQDOO\ GLVWLQFW 0RO &HOO %LRO

PAGE 280

6KDQJ DQG '$ &OD\WRQ +XPDQ PLWRFKRQGULDO WUDQVFULSWLRQ WHUPLQDWLRQ H[KLELWV 51$ SRO\PHUDVH LQGHSHQGHQFH DQG ELDVHG ELSRODULW\ LQ YLWUR %LRO &KHP 6KDQJ DQG '$ &OD\WRQ $ 6DFFKDURP\FHV FHUHYLVLDH PLWRFKRQGULDO WUDQVFULSWLRQ IDFWRU VFPW7)% VKDUHV IHDWXUHV ZLWK VLJPD IDFWRU EXW LV IXQFWLRQDOO\ GLVWLQFW 0RO &HOO %LRO 6LPRQ 5 7DVVDQ -3 DQG -' 5LFKWHU 7UDQVODWLRQDO FRQWURO E\ SRO\ $f HORQJDWLRQ GXULQJ ;HQRSXV GHYHORSPHQW GLIIHUHQWLDO UHSUHVVLRQ DQG HQKDQFHPHQW E\ D QRYHO F\WRSODVPLF SRO\DGHQ\ODWLRQ HOHPHQW *HQHV 'HY 6LPSVRQ / 7KH PLWRFKRQGULDO JHQRPH RI NLQHWRSODVWLG SURWR]RD JHQRPLF RUJDQL]DWLRQ WUDQVFULSWLRQ UHSOLFDWLRQ DQG HYROXWLRQ $QQX 5HY 0LFURELRO 6LQFODLU $+ %HUWD 3 3DOPHU 06 +DZNLQV -5 *ULIILWKV %/ 6LPLWK 0)RVWHU -: )ULVFKDXI $0 /RYHOO %5 DQG 31 *RRGIHOORZ $ JHQH IURP WKH KXPDQ VH[GHWHUPLQLQJ UHJLRQ HQFRGHV D SURWHLQ ZLWK KRPRORJ\ WR D FRQVHUYHG '1$ELQGLQJ PRWLI 1DWXUH 6WHUQ 6 %LJJHUV -' DQG ( $QGHUVRQ 0LWRFKRQGULD DQG HDUO\ GHYHORSPHQW RI WKH PRXVH ([S =RRO 6XFN /DKP $ DQG & 2HIQHU 6WUXFWXUH UHILQHG WR $ RI D QLFNHG '1$ RFWDQXFOHRWLGH FRPSOH[ ZLWK '1$DVH 1DWXUH 7DSSHU '3 DQG '$ &OD\WRQ 0HFKDQLVP RI UHSOLFDWLRQ RI KXPDQ PLWRFKRQGULDO '1$ %LRO &KHP 7D\ORU .' DQG / 3LNR 0LWRFKRQGULDO ELRJHQHVLV LQ HDUO\ PRXVH HPEU\RV H[SUHVVLRQ RI WKH P51$V IRU WKH VXEXQLWV ,9 9E DQG 9LOH RI F\WRFKURPH F R[LGDVH DQG VXEXQLW 3,f RI +$73 V\QWKDVH 0RO 5HSURG 'HY

PAGE 281

7KRPDQ 0 DQG -& *HUKDUW $EVHQFH RI GRUVDOYHQWUDO GLIIHUHQFHV LQ HQHUJ\ PHWDEROLVP LQ HDUO\ HPEU\RV RI ;HQRSXV ODHYLV 'HY %LRO 7RPLQDJD $NL\DPD 6 .DJDZD < DQG 6 2KWD 8SVWUHDP UHJLRQ RI D JHQRPLF JHQH IRU KXPDQ PLWRFKRQGULDO WUDQVFULSWLRQ IDFWRU %LRFKLP %LRSK\V $FWD 7RPLQDJD +D\DVKL .DJDZD < DQG 6 2KWD 6PDOOHU LVRIRUP RI KXPDQ PLWRFKRQGULDO WUDQVFULSWLRQ IDFWRU LWV ZLGH GLVWULEXWLRQ DQG SURGXFWLRQ E\ DOWHUQDWLYH VSOLFLQJ %LRFKHP %LRSK\V 5HV &RPPXQ 7RSSHU -1 DQG '$ &OD\WRQ ,GHQWLILFDWLRQ RI WUDQVFULSWLRQDO UHJXODWRU\ HOHPHQWV LQ KXPDQ PLWRFKRQGULDO '1$ E\ OLQNHU VXEVWLWXWLRQ DQDO\VLV 0RO &HOO %LRO 7UDYLV $ $PVWHUGDP $ %HODQJHU & DQG 5 *URVVFKHGO /() D JHQH HQFRGLQJ D O\PSKRLGVSHFLILF SURWHLQ ZLWK DQ +0* GRPDLQ UHJXODWHV 7FHOO UHFHSWRU DOSKD HQKDQFHU IXQFWLRQ *HQHV 'HY 9DOYHUGH -5 0DUFR 5 DQG 5 *DUHVVH $ FRQVHUYHG KHSWDPHU PRWLI IRU ULERVRPDO 51$ WUDQVFULSWLRQ WHUPLQDWLRQ LQ DQLPDO PLWRFKRQGULD 3URF 1DWO $FDG 6FL 9LUEDVLXV -9 DQG 5& 6FDUSXOOD 7UDQVFULSWLRQDO DFWLYDWLRQ WKURXJK (76 GRPDLQ ELQGLQJ VLWHV LQ WKH F\WRFKURPH F R[LGDVH VXEXQLW ,9 JHQH 0RO &HOO %LRO 9LUEDVLXV -9 DQG 5&6FDUSXOOD $FWLYDWLRQ RI WKH KXPDQ PLWRFKRQGULDO WUDQVFULSWLRQ IDFWRU $ JHQH E\ QXFOHDU UHVSLUDWRU\ IDFWRUV $ SRWHQWLDO UHJXODWRU\ OLQN EHWZHHQ QXFOHDU DQG PLWRFKRQn GULDO JHQH H[SUHVVLRQ LQ RUJDQHOOH ELRJHQHVLV 3URF 1DWO $FDG 6FL 86$ 9LUEDVLXV &$ 9LUEDVLXV -9 DQG 5&6FDUSXOOD 15) DQ DFWLYDWRU LQYROYHG LQ QXFOHDUPLWRFKRQGULDO LQWHUDFWLRQV XWLOL]HV D QHZ '1$ELQGLQJ GRPDLQ FRQVHUYHG LQ D IDPLO\ RI GHYHORSPHQWDO UHJXODWRUV *HQHV 'HY

PAGE 282

:DKOL : 'DZLG ,% 5\IIHO *8 DQG 5 :HEHU 9LWHOORJHQHVLV DQG WKH YLWHOORJHQLQ JHQH IDPLO\ 6FLHQFH :DOEHUJ 0: DQG '$ &OD\WRQ 6HTXHQFH DQG SURSHUWLHV RI WKH KXPDQ .% FHOO DQG PRXVH / FHOO 'ORRS UHJLRQV RI PLWRFKRQGULDO '1$ 1XFOHLF $FLGV 5HV :DOODFH '& 0LWRFKRQGULDO GLVHDVHV JHQRW\SH YHUVXV SKHQRW\SH 7UHQGV *HQHW :DWDQDEH ) .DPLLNH : 1LVKLPXUD 7 +DVKLPRWR 7 DQG 7DJDZD 'HFUHDVH LQ PLWRFKRQGULDO OHYHOV RI DGHQLQH QXFOHRWLGHV DQG FRQFRPLWDQW PLWRFKRQGULDO G\VIXQFWLRQ LQ LVFKHPLF UDW OLYHU %LRFKHP 7RN\R :HEE $& /D0DUFD 0DQG /' 6PLWK 6\QWKHVLV RI PLWRFKRQGULDO 51$ E\ IXOOJURZQ DQG PDWXULQJ RRF\WHV RI 5DQD SLSLHQV DQG ;HQRSXV ODHYLV 'HY %LRO :HEE $& DQG /' 6PLWK $FFXPXODWLRQ RI PLWRFKRQGULDO '1$ GXULQJ RRJHQHVLV LQ ;HQRSXV ODHYLV 'HY %LRO :HLQEHUJ -0 'DYLV -$ $EDU]XD 0 DQG 7 .LDQL 5HODWLRQVKLS EHWZHHQ FHOO $73 DQG JOXWDWKLRQH FRQWHQW DQG SURWHFWLRQ DJDLQVW K\SR[LF SUR[LPDO WXEXOH FHOO LQMXU\ /DE &OLQ 0HG :LOOLDPV 56 0LWRFKRQGULDO JHQH H[SUHVVLRQ LQ PDPPDOLDQ VWULDWHG PXVFOH (YLGHQFH WKDW YDULDWLRQ LQ JHQH GRVDJH LV WKH PDMRU UHJXODWRU\ HYHQW %LRO &KHUQ :LOOLDPV 56 DQG : +DUODQ (IIHFWV RI LQKLELWLRQ RI PLWRFKRQGULDO SURWHLQ V\QWKHVLV LQ VNHOHWDO PXVFOH $P 3K\VLRO && :RQJ 7: DQG '$ &OD\WRQ D ,Q YLWUR UHSOLFDWLRQ RI KXPDQ PLWRFKRQGULDO '1$ DFFXUDWH LQLWLDWLRQ DW WKH RULJLQ RI OLJKWVWUDQG V\QWKHVLV &HOO

PAGE 283

:RQJ 7: DQG '$ &OD\WRQ E ,VRODWLRQ DQG FKDUDFWHUL]DWLRQ RI D '1$ SULPDVH IURP KXPDQ PLWRFKRQGULD %LRO &KHP :RRGODQG +5 +LVWRQH V\QWKHVLV GXULQJ GHYHORSPHQW RI ;HQRSXV )(%6 /HWW :X 0 DQG *HUKDUW 5DLVLQJ ;HQRSXV LQ WKH ODERUDWRU\ 0HWK &HOO %LRO ;X % DQG '$ &OD\WRQ $ SHUVLVWHQW 51$'1$ K\EULG LV IRUPHG GXULQJ WUDQVFULSWLRQ DW D SK\ORJHQHWLFDOO\ FRQVHUYHG PLWRFKRQGULDO '1$ VHTXHQFH 0RO &HOO %LRO ;X % DQG '$ &OD\WRQ 51$'1$ K\EULG IRUPDWLRQ DW WKH KXPDQ PLWRFKRQGULDO KHDY\VWUDQG RULJLQ FHDVHV DW UHSOLFDWLRQ VWDUW VLWHV DQ LPSOLFDWLRQ IRU 51$'1$ K\EULGV VHUYLQJ DV SULPHUV (0%2
PAGE 284

=HYLDQL 0 *HOOHUD & $QWR]]L & 5LPROGL 0 0RUDQGL / 9LOODQL ) 7LUDQWL 9 DQG 6 'L'RQDWR 0DWHUQDOO\ LQKHULWHG P\RSDWK\ DQG FDUGLRP\RSDWK\ DVVRFLDWLRQ ZLWK PXWDWLRQ LQ PLWRFKRQGULDO '1$ W51$ OHXf 885f /DQFHW =LHUOHU 0. 0DULQL 16WRZHUV 'DQG 50 %HQERZ 6WRFNSLOLQJ RI '1$ SRO\PHUDVHV GXULQJ RRJHQHVLV DQG HPEU\RJHQHVLV LQ WKH IURJ ;HQRSXV ODHYLV %LRO &KHP

PAGE 285

%,2*5$3+,&$/ 6.(7&+ &KDQGUDPRKDQ 9 $PPLQL REWDLQHG KLV XQGHUJUDGXDWH GHJUHH LQ DJULFXOWXUH LQ IURP WKH $QGKUD 3UDGHVK $JULFXOWXUDO 8QLYHUVLW\ ,QGLD IROORZHG E\ D PDVWHUfV GHJUHH LQ KRUWLFXOWXUH LQ IURP WKH ,QGLDQ $JULFXOWXUDO 5HVHDUFK ,QVWLWXWH ,QGLD $IWHU WZR \HDUV RI JUDGXDWH VWXGLHV LQ IORULFXOWXUH PROHFXODU JHQHWLFV DQG SODQW WLVVXH FXOWXUH KH HQWHUHG WKH JUDGXDWH SURJUDP DW WKH 8QLYHUVLW\ RI )ORULGD LQ DQG MRLQHG WKH ODERUDWRU\ RI 'U :LOOLDP : +DXVZLUWK LQ 8SRQ JUDGXDWLRQ KH ZLOO EHJLQ SRVWn GRFWRUDO VWXGLHV ZLWK 'U 3HWHU 6WDFSRROH LQ WKH 'HSDUWPHQW RI 0HGLFLQH DW WKH 8QLYHUVLW\ RI )ORULGD

PAGE 286

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WMWH GHJUHH RI 'RFWRU RI 3KLORVRSK\ ; :LOOLDP : +DXVZLUWK &KDLU (PLQHQW 6FKRODU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ $OIUHG /HZLQ 9 3URIHVVRU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 0DXULFH 6 6ZDQVRQ $VVRFLDWH 3URIHVVRU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\

PAGE 287

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ n 7KRPDV & 5RZH $VVRFLDWH 3URIHVVRU RI 3KDUPDFRORJ\ t 7KHUDSHXWLFV 7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI 0HGLFLQH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 0D\ OHDQ &ROOHJH RI 0HGLFLQH

PAGE 288

b p} 81,9(56,7< 2) )/25,'$


Transcription rate (fold over basic buffer)
205
Figure 5-7...continued


77
Table 3-1. Steady state levels** of mitochondrial RNA in total egg or
embryonic RNA during early development of X. laevis.
Egg
5 hr*
14 hr
20 hr
30 hr
38 hr
50 hr
ND 1
1.0
0.9
0.7
1.3
1.3
1.4
1.2
ND 4
1.0
0.6
0.5
0.8
0.8
0.8
0.6
Cyt b
1.0
0.8
0.4
1.0
1.0
1.4
1.2
ATPase 6
1.0
0.6
0.4
1.0
1.1
1.5
1.4
CO II
1.0
0.8
0.6
1.0
1.2
1.2
1.2
ND 6
1.0
1.1
0.7
0.7
1.0
0.5
0.5
16 S rRNA
1.0
0.9
0.8
0.9
0.8
0.6
0.7
12 S rRNA
1.0
0.9
0.9
0.9
0.7
0.7
0.8
* Hours post-fertilization
** Steady state levels are expressed as fold over egg, with the egg
levels set to unity.


73
from batches of 100 viable eggs or embryos were extracted as
described in Materials and Methods. Identical amounts of total RNA
(2 ug) extracted from unfertilized eggs and staged embryos were run
on a 1.2% formaldehyde-agarose gel, blotted to nylon membranes,
and probed with gene-specific riboprobes. The results of such an
analysis for six different mRNA species spanning early development
are shown in Figure 3-1, panels A-F. The mRNA levels were
quantitated using a Phosphorimager. The level of each transcript at
each developmental stage, is relative to the egg level (Table 3-1),
setting the egg level to unity. All mRNAs showed a 1.5 to 2 fold
decrease in transcript levels by 14 hours of development over that of
the unfertilized egg, returned to egg levels by 20 hours in the case of
ND1, Cyt b, CO II and ATPase 6 (Figure 3-1, panels A, D, E, F and
Table 3-1), and increased marginally thereafter. In contrast, the
levels of ND4 and ND6 (Figure 3-1, panels B and C) continued to be
low even in the tadpole stage (50 hours of development). The 12S
and 16S rRNA levels continued to decrease marginally during this
window of development (Figure 3-1, panels G & H and Table 3-1).
The complex pattern of bands in the two rRNA blots have been
observed by other groups working on different systems (Williams,


258
Gillum, A.M., and D.A. Clayton. 1979. Mechanism of mitochondrial
DNA replication in mouse L-cells: RNA priming during the initiation
of heavy-strand synthesis. J. Mol. Biol. 135:353-368.
Ginsberg,L., and N. Hillman. 1973. ATP metabolism in cleavage-
staged mouse embryos. J. Embrol. Exp. Morph. 30:267-282.
Goto, Y., Nonaka, I., and S. Horai. 1990. A mutation in the tRNA (Leu)
(UUR) gene associated with the MELAS subgroup of mitochondrial
encephalomyopathies. Nature 348:651-653.
Goto, Y., Nonaka, I and S. Horai. 1991. A new mtDNA mutation
associated with mitochondrial myopathy, encephalopathy, lactic
acidosis, and stroke-like episodes (MELAS). Biochim. Biophys. Acta.
1097:238-240.
Goto, Y.. Tojo, M., Tohyama, J., Horai, S., and I. Nonaka. 1992. A novel
point mutation in the mitochondrial tRNA (Leu) (UUR) gene in a
family with mitochondrial myopathy. Ann. Neurol. 31:672-675.
Grosschedl, R., Giese, K., and J. Pagel. 1994. HMG domain proteins:
architectural elements in the assembly of nucleoprotein structures.
Trends Genet. 10:94-100.
Hajnoczky, G., Robb-Gaspers, L.D., Seitz, M.B., and A.P. Thomas.
(1995). Decoding of cytosolic calcium oscillations in the
mitochondria. Cell 82:415-424.
Hehman. G.L., and W.W. Hauswirth. 1992. DNA helicase from
mammalian mitochondria. Proc. Natl. Acad. Sci. USA 89:8562-8566.
Hess, J.F., Parisi, M.A., Bennett, J.L., and D.A. Clayton. 1991.
Impairment of mitochondrial transcription termination by a point
mutation associated with the MELAS subgroup of mitochondrial
encephalomyopathies. Nature 351:236-239.
Hevner, R.F., and M.T.T. Wong-Riley. 1989. Brain cytochrome
oxidase: purification, antibody production and immunohistochemical/
histochemical correlations in the CNS. J. Neurosci. 9:3884-3898.


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EK52XEFF7_XBAA4E INGEST_TIME 2013-02-07T18:15:57Z PACKAGE AA00012971_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES


78
1986; Williams et al., 1986) but they were not discussed except in
one case (Mazo et al., 1983) where they have been accurately
analyzed. In rat liver mitochondria, it has been unambiguously
demonstrated that six abundant poly (A)'transcripts ranging from 1.3
to 0.7 kb were non-random fragments of the 16S rRNA, all carrying
its 5 terminus (Mazo et al., 1983). The mechanism for this non-
random degradation or premature termination of synthesis has not
yet been established.
The above results do not agree with the findings reported by
Meziane et al. (1989), where they found a 5-10 fold decrease in
steady state levels of most mtRNAs analyzed within 5-7 hours of
development. All transcripts remained at a low level until 24-28
hours of development, and increased thereafter. One of the
possibilities for this discrepancy between labs is that there may be
strain-specific differences in the frogs used for analyses.
Commercially sold Xenopus laevis is highly heterozygous. After the
mid-blastula transition at 7 hours of development, there is a
dramatic increase in nuclear transcription, with the concomitant
appearance of new species of nuclear RNAs. It is conceivable that
the quantity and quality of specific nuclear RNAs may be under the


217
are retaining the putative developmental cue even after purification
from the cellular components. This suggests that very short-lived
mediators are not likely to be involved, and indicates the
involvement of more long-lived changes in the intramitochondrial
environment.
Two scenarios can be envisaged to try to understand this
regulation. In one, the developmental cue could be a nuclear-
encoded factor which is imported into the mitochondria and
stimulates transcription, either by directly activating transcription or
indirectly by inactivating potential inhibitors of transcription. In the
second scenario, the involvement of factors which influence
mitochondrial metabolism can be envisaged. Stimulation of general
mitochondrial activities like oxidative phosphorylation and substrate
biosynthesis could indirectly activate transcription, as all of these
activities take place in the mitochondrial matrix, where mtDNA
transcription also takes place.
A good candidate for the first mechanism would be the
mitochondrial transcription factor, mtTFA, which has been shown to
activate and also repress transcription within a narrow range of
concentrations in both human (Dariaghi et al., 1995) and Xenopus


264
McKee, E.E., Grier, B.L., Thompson, G.S., Leung, A.C.F., and J.D. McCourt.
1990b. Coupling of mitochondrial metabolism and protein synthesis
in heart mitochondria. Am. J. Physiol. 258:E503-E510.
Meziane, A.E., Callen, J.C., and J.C. Mounolou. 1989. Mitochondrial
gene expression during Xenopus laevis development: a molecular
study. 8:1649-1655.
Mignotte, B., and M. Barat. 1986. Characterization of a Xenopus
laevis mitochondrial protein with a high affinity for supercoiled DNA.
Nucleic Acids Res. 14:5969-5980.
Mignotte, B., Delain, E., Rickwood, D., and M. Barat-Gueride. 1988.
The Xenopus laevis mitochondrial protein mtDBP-C cooperatively
folds the DNA in vitro. EMBO J. 7:3873-3879.
Mignotte, B., Theveny, B., and B. Revet. 1990. Structural
modifications induced by the mtDBP-C protein in the replication
origin of Xenopus laevis mitochondrial DNA. Biochimie 72:65-72.
Mills, Jr., R.M., and R.L. Brinster. 1967. Oxygen consumption of pre
implantation mouse embryos. Expl. Cell Res. 47:337-344.
Montoya, J., Christianson, T., Levens, D., Rabinowitz, M., and G.
Attardi. 1982. Identification of initiation sites for heavy-strand and
light-strand transcription in human mitochondrial DNA. Proc. Natl.
Acad. Sci. USA 79:7195-7199.
Montoya. J., Gaines, G.L., and G. Attardi. 1983. The pattern of
transcription of the human mitochondrial rRNA genes reveals two
overlapping transcription units. Cell 34:151-159.
Montoya, J., Ojala, D., and G. Attardi. 1981. Distinctive features of the
5-terminal sequences of the human mitochondrial mRNAs. Nature
290:465-470.
Mueller, D.M., and G.S. Getz. 1986. Transcriptional regulation of the
mitochondrial genome of yeast Saccharomyces cerevisiae. J. Biol.
Chem. 261:1 1756-1 1764.


162
(Ghivizzani et al., 1994). However, this observation is more
surprising in Xenopus laevis due to the apparently higher abundance
of xl-mtTFA (-200 copies per unit mtDNA) in total ovary
mitochondria measured by Antoschechkin and Bogenhagen (1995) as
compared to the lower levels reported for h-mtTFA (-15 monomers
per unit mtDNA) by Fisher et al. (1991). This higher concentration of
xl-mtTFA (1 molecule of xl-mtTFA/90 bp of mtDNA) could allow
extensive coating of the mtDNA by this protein. In this connection, it
is important to note that the xl-mtTFA levels reported by
Antoschechkin and Bogenhagen (1995) were from total ovarian
mitochondria, not from isolated germ line cells. A mitochondrial
preparation from total ovaries would include, besides substantial
follicular tissue, oocytes at various stages of development, with each
stage being dramatically different with respect to the organelles and
macromolecules they are stockpiling for later development. This
inherent caveat in the xl-mtTFA levels reduces the relevance of this
measurement, even though it suggests that the levels of mtTFA in
Xenopus mitochondria could be higher than that reported for human
mitochondria. It is also not known if the same levels would be seen
in the somatic cells of X. laevis. Nevertheless, the in organello


114
only recruited to its site during active transcription, along with the
assembly of the transcription machinery.
The Xenopus laevis embryogenesis model affords the unique
opportunity to attempt to answer some of these questions. There are
dramatic changes in gene expression of mitochondria during early
development, with transcription being basal until the first 10 hours
of embryogenesis, after which active transcription resumes in the
embryo (discussed in chapter 3), during a time when mtDNA
replication is not active (Chase and Dawid, 1972). Therefore,
transcription is decoupled from replication of mtDNA during this
time, a situation not easily obtained in other available model
systems, where replication and transcription of mtDNA are more or
less constitutive and simultaneous.
The specific aim of the experiments described in the following
sections was to perform in vivo footprinting of mtDNA to look for
changes in protein-DNA interactions correleted with changes in the
transcriptional status of the mitochondria. The specific regions of
mtDNA which were analyzed included the D-loop upstream region
(housing the critical cis elements involved in transcription and
replication), and the mTERF binding site. It was hoped that these


259
Hevner, R.F., and M.T.T. Wong-Riley. 1990. Regulation of cytochrome
oxidase protein levels by functional activity in the macaque monkey
visual system. J. Neurosci. 10:1331-1340.
Hevner, R.F., and M.T.T. Wong-Riley. 1991. Neuronal expression of
nuclear and mitochondrial genes for cytochrome oxidase (CO)
subunits analyzed by in situ hybridization: comparison with CO
activity and protein. J. Neurosci. 11:1942-1958.
Hevner, R.F., and M.T.T. Wong-Riley. 1993. Mitochondrial and
nuclear gene expression for cytochrome oxidase subunits are
disproportionately regulated by functional activity in neurons. J.
Neurosci. 13:1805-1819.
Hixson, J.E., and D.A. Clayton. 1985. Initiation of transcription from
each of the two human mitochondrial promoters requires unique
nucleotides at the transcriptional start sites. Proc. Natl. Acad. Sci.
USA 82:2660-2664.
Hixson. J.E., Wont, T.W., and D.A. Clayton. 1986. Both the conserved
stem-loop and divergent 5-flanking sequences are required for
initiation at the human mitochondrial origin of light-strand DNA
replication. J. Biol. Chem. 261:2384-2390.
Hollinger, T.G., and G.L. Corton. 1980. Artificial fertilization of
gametes from the South African clawed frog, Xenopus laevis. Gamete
Res. 3:45-57.
Hornstra, I.K., and T.P. Yang. 1993. In vivo footprinting and genomic
sequencing by ligation-mediated PCR. Anal. Biochem. 213:179-193.
Huther. F-J., and B. Kadenbach. 1986. Specific effects of ATP on the
kinetics of reconstituted bovine heart cytochrome-c oxidase. FEBS
Lett. 207:89-94.
Jang, S.H., and J.A. Jaehning. 1991. The yeast mitochondrial RNA
polymerase specificity factor, MTF1, is similar to bacterial sigma
factors. J. Biol. Chem. 266:22671-22677.


Time post-fertilization
Cd
Overall Rate (fold over egg)
192


Figure 5-7. Effect of addition of metabolic inhibitors on the
transcription rate of 20 hr stage mitochondria.
A. Equal aliquots of mitochondria isolated from 20 hr stage embryos
were used for run-on reactions in basic buffer (panel 1), basic buffer
+ 1 mM ATP (panel 2), basic buffer + 100 uM ADP + 10 mM sodium
phosphate + 1 mM a-ketoglutarate (panel 3), conditions of panel 3 +
10 ug/ml actinomycin D (panel 4), conditions of panel 3 + 5 ug/ml
antimycin A (panel 5), conditions of panel 3 + 500 uM actractyloside
(panel 6). The labeled run-on products were then detected by
hybridization with non-radioactive gene- and strand-specific RNA
target panels. The six target panels were checked for uniformity of
loading and blot transfer by visualization under uv-light (not shown).
The identity (gene and strand sense) of each band is shown above
the lanes, with the first four bands detecting LSP transcription, and
the next six bands detecting HSP transcription. B. Phosphorimager
quantitation of the above blot was used to calculate the overall
transcription rate obtained in each treatment and the rate expressed
as fold over that obtained in the basic buffer. The six run-on
conditions (bars 1-6) correspond to the same order of conditions
described for panels 1-6 in part A.


58
incubate for 4-6 hours and typically yielded 100-120 ug of RNA per
reaction. The reactions were phenol-extracted and ethanol
precipitated twice in the presence of 0.5M ammonium acetate. The
RNA yield was calculated spectroscopically, 1 ug of each transcript
electrophoresed in parallel lanes of 1.2% formaldehyde-agarose gels,
and blotted onto nylon membranes as described in the section on
steady state analyses of mitochondrial RNA. In some of the earlier
experiments, combinations of RNAs were run in the same lane as L-
strand or H-strand sets. This was not followed in later experiments
due to difficulties in quantitating the bands after hybridization.
Since in vitro transcription reactions always result in shorter
transcripts of the same specific sequence, gel purification of the RNA
was attempted. Although effective, the method is labor-intensive
and inefficient. To overcome this problem, the membranes carrying
the RNA blots were trimmed around the specific RNA bands prior to
hybridization, to aid in ease of quantitation. This method was
preferred over dot-blotting the probe panel due to the following
reasons: (1) electrophoresing the RNA samples each time serves as a
checkpoint for RNA degradation, (2) gene assignments are
unambiguous due to the pattern of specific RNA sizes on the blot, and
(3) removal of template DNA and shorter transcripts is automatically
facilitated.


253
Christianson, T.W., and D.A. Clayton. 1986. In vitro transcription of
human mitochondrial DNA: accurate termination requires a region of
DNA sequence that can function bi-directionally. Proc. Natl. Acad. Sci.
USA 83:6277-6281.
Christianson, T.W., and D.A. Clayton. 1988. A tridecamer DNA
sequence supports human mitochondrial RNA 3 end formation in
vitro. Mol. Cell. Biol. 8:4502-4509.
Church, G.M., Ephrussi, A., Gilbert, W., and S. Tonegawa. 1985. Cell-
type specific contacts to immunoglobulin enhancers in nuclei. Nature
313:798-801.
Church, G.M., and W. Gilbert. 1984. Genomic sequencing. Proc. Natl.
Acad. Sci. USA 81:1991-1995.
Clark, J.M. 1988. Novel non-templated nucleotide addition reactions
catalyzed by prokaryotic and eukaryotic DNA polymerases. Nucleic
Acids Res. 16:9677-9686.
Clayton, D.A. 1982. Replication of animal mitochondrial DNA. Cell
28:693-705.
Clayton, D.A. 1991. Replication and transcription of vertebrate
mitochondrial DNA. Annu. Rev. Cell Biol. 7:453-478.
Clayton. D.A. 1992. Transcription and replication of animal
mitochondrial DNAs. Int. Rev. Cytol. 141:217-232.
Colot, H.V., and M. Rosbasch. 1982. Behavior of individual maternal
pA+RNAs during embryogenesis of Xenopus laevis. Dev. Biol. 94:79-
86.
Cornwall, G.A., Orgebin-Crist, M., and S.R. Hann. 1992. Differential
expression of the mouse mitochondrial genes and the mitochondrial
RNA-processing endoribonuclease RNA by androgens. Mol. Endo.
6:1032-1042.


Figure 4-3. In organello footprinting of the D-Ioop
upstream region. Ovary mtDNA was processed for in organello
footprinting as described in the legend to Figure 4-2 except that the
mtDNA samples were cut with Haelll to provide a reference point at
nucleotide 1552 of the X. laevis genome (Roe et al., 1985), and the
Southern blots were probed with radiolabeled riboprobes specific to
the CSB region. Lanes C correspond to in vitro methylated naked
mtDNA, whereas lanes labeled T refer to in organello methylated
mtDNA. Nucleotide numbering corresponds to the sequence reported
by Roe et al. (1985). Genomic landmarks and critical cis-elements
are indicated. The residues protected (open circles) or hypersensitive
(filled squares) to DMS methylation are indicated. The 3 bars on the
right side of the figure corresponds to the regions footprinted by xl-
mtTFA in in vitro DNAse I footprints reported by Antoschechkin and
Bogenhagen (1995). Note the correspondence between the in vitro
DNAse I footprint of xl-mtTFA and the in organello DMS footprint,
suggesting that the majority of the DNA-protein interactions detected
in the in organello footprint are due to binding of xl-mtTFA to
mtDNA in vivo.


extension up to 300 or 400 bases recommend extension times of 10
minutes to allow completion of all initiated primers (Garrity and
Wold, 1992). However, an extension time of 3 minutes was found to
be sufficient for a number of primer-template combinations without
compromising fidelity or sensitivity. Based on these considerations, a
typical PEF reaction consisted of:
50-100 ng piperidine cleaved DNA
1 picomole 32P-5' end-labeled primer
IX Taq polymerase reaction buffer (BRL)
2 mM MgCl
20 uM each of dATP, TTP, dGTP, dCTP
2.5 U thermostable DNA polymerase (BRL)
The reaction was assembled on ice and cycled in a thermal cycler
as follows : denaturing at 94C for 5 minutes, followed by 10-15
cycles with the profile: denaturing at 94 C for 1 minute, annealing at
45-65C (based on primer T ) for 1 minute, and primer extension at
72C for 3 minutes. The tubes were then immediately chilled on ice,
10 ug of carrier tRNA added, and ethanol precipitated in the
presence of 2.5 M ammonium acetate. An organic extraction prior to
DNA precipitation was usually not necessary. The precipitate was
resuspended in 5 ul of sequencing dye, and 1.5 ul of each reaction


Mitochondrial Transcription
The coding capacity of the mitochondrial genome is relatively
constant among different organisms (except plant mtDNA, which
encodes more proteins); however, genome size, structure, and mode
of expression are variable. Vertebrate transcription is usually
achieved by symmetrical, almost genome-length polycistronic
transcription (Aloni and Attardi, 1971; Murphy et al., 1975) from
two overlapping divergent promoters in the D-loop region, following
by processing to generate unit-length mRNAs. In contrast, yeast
genomes have at least 20 different promoters, each driving the
expression of shorter polycistronic RNAs (Costanzo and Fox, 1990),
with differences in promoter strength and attenuation of
transcription determining transcript levels (Mueller and Getz, 1986).
Most plant genomes also display multiple promoters (Mulligan et al.,
1988; Levings and Brown, 1989), but differential transcription is
achieved by selective amplification of subgenomic size fragments,
resulting in increased mRNA levels as a consequence of increase in
gene dosage (Muise and Hauswirth, 1995).
Vertebrate mitochondria have only two major promoters, the L-
strand promoter (LSP) and the H-strand promoter (HSP) for
transcription of each strand (Montoya et al., 1982; Chang and Clayton,


(Antoschechkin and Bogenhagen, 1995) revealed homology to the
high mobility group (HMG) of proteins. Another protein, called
mtTFB or the specificity factor in yeast mitochondria, has been
isolated and cloned (Schinkel et al., 1987), and has amino acid
homologies to bacterial a factors (Jang and Jaehning, 1991), but
operates by a distinct mechanism (Shadel and Clayton, 1995).
Recently, Antoschechkin and Bogenhagen (1995) isolated a similar
protein from Xenopus laevis mitochondria, the xl-mtTFB. This is the
first report of the existence of such a protein in metazoan
mitochondria. Mitochondrial transcription factor A (mtTFA) appears
to be the primary transcription factor in human mitochondria,
absolutely required from high levels of specific transcription
initiation in vitro. In contrast, sc-mtTEB appears to be the primary
transcription factor in the yeast system, with the sc-mtTFA protein
playing only a minor role in overall transcription initiation efficiency
(Shadel and Clayton, 1993). In Xenopus laevis, xl-mtTFB appears to
be the basal transcription factor, with xl-mtTFA required for
transcriptional activation (Antoschechkin and Bogenhagen, 1995).
Hence, the role of sc-mtTFA is fundamentally different from its
homologs in vertebrates. In vitro binding studies with purified
mtTFA from yeast, human, and Xenopus mitochondria display


at full power for 3-5 minutes. Pre-hybridization and hybridization
were done using the protocol of Church and Gilbert (1984). To
prehybridize the membrane, 30 ml of hybridization solution (7% SDS,
1% BSA, ImM EDTA, and 0.5 M sodium phosphate buffer (0.5 M with
respect to Na+, pH 7.2) was added to the rolled-up membrane in a
rolling hybridization bottle (Robbins Scientific) and placed in a
hybridization oven (Biometra, Tampa, FL) for 30 min at 65C. After
prehybridization, the solution was replaced with 10 ml of
hybridization solution containing the crushed polyacrylamide gel
slice containing the labeled probe, and hybridized overnight at 65C.
The hybridized blots were washed three times with 100 ml of wash
buffer (40 mM sodium phosphate buffer, pH 7.2, ImM EDTA, 1% SDS)
at 60C for 30 min each in the hybridization bottles, followed by a
20 min wash in 500 ml of buffer in a Tupperware tray, and exposed
to X-ray film.
Linear Amplification of Footprints by Primer Extension
The most important factor for obtaining accurate and
reproducible sequences is optimal selection of genomic primers. In
theory, a primer can be as close as 10-30 nucleotides to the domain
of interest. However, in practice, I have found that primers located


gastrulation, with a coordinate induction thereafter. Mitochondrial
run-on transcription assays using isolated organelles from distinct
developmental stages showed that transcription was the primary
determinant of differences in transcript abundance. To test whether
transcription was regulated by the changing stoichiometries of the
Xenopus mitochondrial transcription factor A (xl-mtTFA), in vivo
footprinting of mtDNA was carried out. Although footprint assays
confirmed that the mtTFA binds the D-loop region in a phased
manner, no significant differences were detected in the occupancy of
xl-mtTFA during regulated transcription, showing that regulation
was not by changing xl-mtTFA binding to mtDNA. Mitochondrial
transcriptional activity showed a positive correlation with the
metabolic status of mitochondria, as indicated by mitochondrial ATP
measurements and run-on transcription assays in the presence of
metabolic intermediates. This suggests that transcriptional
regulation may be sensitive to the mitochondrial metabolic status.
Footprinting and band shift assays confirmed the presence of the
mitochondrial termination factor (mTERF) in Xenopus mitochondria.
The mode of footprinting suggested a localized distortion of DNA
structure, consistent with in vitro reports of DNA bending by this
x


216
transcription rate measured in the 48 hour embryo mitochondria,
though significantly high (36 fold over egg), was at least 2 fold lower
than the 28 hr stage. Consistent with this theme, the steady state
levels measured in the 7 day-old tadpole was only 6-8 fold over egg
levels, lower than that found in the 48 hr stage (20-28 fold over egg)
but comparable to the levels found in the 30 hr embryo. In
aggregate, these results suggest that mitochondrial transcription
actively resumes in the embryo between 20 and 28 hours of
development, remains at a high level for several hours, and stabilizes
to a lower but significant level before 48 hours of development. Rate
data are not available beyond the 48 hr stage. However, the lower
steady state levels found in the 7 day-old tadpole (6-8 fold over egg)
suggests a lower transcription rate after 2 days of development,
equal to or lower than the rates measured for the 48 hr stage.
Now that a direct correlation has been established between the
steady state levels of mitochondrial transcripts and mitochondrial
transcriptional activity, the pivotal question is what cellular stimuli
regulate this very active resumption of transcription in the embryo.
Since isolated mitochondria exhibit changes in transcription rate
correlated with the steady state levels of transcripts, the organelles


protein. However, the binding site was equivalently occupied during
regulated transcription, and band shift assays showed equivalent
protein concentrations during this time, suggesting that mTERF is a
constitutive DNA-bending protein, which remains bound to its
cognate site at all times, posing a physical block to the elongating
RNA polymerase.
xi


125
2002 and 1916, showed altered methylation reactivities (Figure 4-2).
Both of these regions were footprinted by the mitochondrial
transcription factor (xl-mtTFA) in in vitro DNAse I footprints
reported by Antoschechkin and Bogenhagen (1995), shown as the
stippled bars on the right side of Figure 4-2. Footprinting of the
region downstream of LSP, showing the conserved sequence boxes 1,
2, and 3 (CSB 1, 2, 3) and the two major replication start sites of D-
loop DNA (Cairns and Bogenhagen, 1986) are shown in Figures 4-2
and 4-3. There is a spacing of -150 bp between LSP2 and CSB3, and
three blocks of footprinted residues [between residues 1995 and
1980, 1959 and 1934 (figure 4-2), and between 1924 and 1870
(Figure 4-3)] were detected in both strands.
Multiple sites of altered methylation were also clearly seen (Figure
4-3) between the conserved sequence boxes (CSBs), both between
CSB3 and CSB2 (spaced -35 bp apart) and between CSB2 and CSB1
(spaced -85 bp apart). Note that the highly G-rich CSB2 was devoid
of any footprints. But CSB1 showed a predominant pattern of
protection on the H-strand in contrast to hypersensitivity on the L-
strand. Again, there is very good correspondence between the in
vitro DNAse I footprint pattern of xl-mtTFA (Figure 4-3, longitudinal


53
concentrations were then measured spectroscopically and their
A26/A,8o ratios used as a measure of purity. Typically, ratios more
than 1.9 were obtained. If not, the samples were phenol extracted
again and ethanol precipitated.
As an alternative protocol, TriZol reagent (BRL) was also tried.
Though RNA free of DNA was obtained, abundant amounts of
polysaccharides always co-purified with the RNA, in spite of
repeated phenol extractions and ethanol precipitations. The modified
method reported by Chomczynski and Mackey (1995) for the
removal of polysaccharides from RNA was tried, but polysaccharides
were not removed adequately. Since polysaccharides interfere with
spectroscopic readings, the former method was followed in all the
experiments reported for total RNA levels.
Isolation of Total Mitochondrial Nucleic Acids
For isolating total mitochondrial RNA, crude mitochondrial pellets
were lyzed in TriZol reagent (BRL) and RNA extracted according to
the manufacturers protocols. Co-purification of polysaccharides with
the RNA preparation was not a problem when isolated mitochondria
were used.
For experiments where the steady state levels of mitochondrial
RNA were normalized to mitochondrial DNA, it was essential to


210
Table 5-2. Mitochondrial adenine nucleotide levels during early
development of Xenopus laevis.
AMP*
ADP*
ATP*
Energy**
Charge
Egg
1076.5
2736.9
652.5
0.17
45 min***
1380.2
3634.4
850.5
0.17
1581.5
2380.4
771.5
0.19
21 hr***
2155.5
3697.8
736.3
0.12
30 hr***
1482.0
2708.9
1399.8
0.33
* The reported values are the levels found by RP-HPLC in double
sucrose gradient purified mitochondria from 300 eggs or embyros at
distinct times post-fertilization and are expressed as pMol per mg.
mitochondrial protein
** Energy charge is the ratio of the concentration of ATP to those of
ADP and AMP
*** Time post-fertilization


227
Although the mitochondrial run-on rescue experiments give
additional insights into the link between the metabolic state of the
mitochondria and mitochondrial transcription, they are at best only
in organello assays, and may not fully reflect the situation in vivo.
It will be valuable to have additional in vivo confirmation of the
indirect interpretations drawn from the run-on studies. One of the
simple ways to compare and contrast early development of X. laevis
for differences in oxidative metabolism would be to measure the
mitochondrial adenine nucleotide levels (mainly ATP) of distinct
developmental stages. Mitochondrial ATP concentrations are usually
correlated with the level of oxidative phosphorylation. Reduced
levels of mitochondrial adenine nucleotides (mainly ATP + ADP) have
been reported after induced hypoxia (Nakazawa and Nunokawa,
1977) and ischemia (Watanabe et al., 1983) in rat liver, and are
lower by 50-80% in fast-growing hepatomas (Barbour and Chan,
1983) and by 29% in hibernating bears (Gehnrich and Aprille, 1988).
The adenine nucleotide contents of fetal and newborn rat liver
mitochondria are very low, but increases to adult levels within 3-4
hours after birth (Aprille, 1986), concomitant with the onset of
oxidative phosphorylation after birth.


CHAPTER 6
SUMMARY AND PERSPECTIVES
Early development of Xenopus laevis provides an excellent
natural model for investigating the regulation of mitochondrial gene
expression. Classic studies by Chase and Dawid (1972) on the
biogenesis of mitochondria during X. laevis development showed that
production of new mitochondria begins relatively late during
embryogenesis, with the stockpile of mitochondria (~107 per egg) in
the unfertilized egg acting as a reservoir for the rapidly cleaving
embryos. They reached these conclusions based on measurements of
the levels of mitochondrial protein, mtDNA, and cytochrome oxidase
activity per egg or developing embryo, which remained constant for
about 2 days of development to stage 38 (swimming tadpole stage),
then increased coordinately and doubled by the feeding tadpole
stage (stage 45; 96 hours post-fertilization). Hence, active replication
of mtDNA does not resume until relatively late in embryogenesis.
In contrast, active mitochondrial transcription appears to resume
earlier than active mtDNA replication in the developing embryo.
230


59
Mitochondrial Run-On Transcription Assay
The incubation conditions for the run-on transcription assays are
modifications of the protocols of Gaines et al. (1987) and Gaines
(1996). Mitochondria from eggs and staged-embryos were isolated
in MSE buffer as outlined in the mitochondrial isolation section. After
one wash with MSE buffer in the microcentrifuge, the pellets were
resuspended in 1 ml of MSE buffer and spun at 750 x g in a
microcentrifuge to pellet pigment and debris which were carried
over during handling of the bigger volumes. The supernatant was
then spun at 10,000 x g for 1 min to pellet mitochondria. The pellet
was then resuspended in run-on wash buffer (40 mM Tris, 7.2, 50
mM NaCl, 10% glycerol, 5 mM MgCl2, 1 mg/ml BSA) and the
mitochondria re-pelleted. The final pellets were resuspended in the
basic run-on buffer (40 mM Tris, 7.2, 50 mM NaCl, 10% glycerol, 5
mM MgCl2,, 2 mg/ml BSA).
Supplementation of this basic buffer with salts, nucleotides, TCA
cycle intermediates or drugs interfering with mitochondrial
metabolism was done by adding the components to a 1.2x or 1.25 x
Basic buffer, mixing the components, and then resuspending the
mitochondria in the final mixture. Run-on reactions were initiated
by the addition of [a32P]UTP (50-100 mci) to the mitochondrial


electrophoresis, the RNA samples were transferred to nylon N+ by
downward transfer with lOx SSC (20x SSC is 3M NaCl, 0.3M sodium
citrate, pH 7.0). The blots were then air-dried and uv-crosslinked by
the autocrosslink program in Stratalinker (Stratagene).
The blots were pre-hybridized in 6x SSPE (20x SSPE is 3.6M NaCl,
0.2M sodium phosphate, 0.02M EDTA, pH 7.7), 50% formamide, 5x
Denhardts solution [50x Denhardts solution is 1% each of Ficoll 400
(Sigma), polyvinylpyrrolidone (Kodak), and bovine serum albumin
(Fraction V, USB-Amersham)], 0.5% SDS, 200 ug/ml tRNA at 60C for
1 hour. Radiolabeled riboprobes were synthesized from linearized
gene-specific clones using T3 and T7 RNA polymerases (Stratagene),
added to a fresh aliquot of the same buffer @ 50-100 ng/ml, and
hybridized overnight at 60C. Following hybridization, the blots were
washed in 40 mM Na+, 1% SDS, 1 mM EDTA at 60C for 1.5 hr with 3-
4 changes. Following the washes, excess wash solution was removed
and the blots exposed to both film and phosphorimaging screen.
Dot Blot Quantitation of Mitochondrial DNA
The same aliquot of mitochondrial nucleic acids used for the
Northern analysis was used to quantitate the level of mtDNA in that
sample, so that the steady state levels could be corrected to unit


48
resolved in a 6% polyacrylamide-7 M urea gel as a preliminary test
to optimize signal intensities. Using visual inspection or
Phosphorimager quantitation, the signals in each sample were
equalized in a final gel and autoradiographed to obtain the footprint
pattern. Autoradiography at room temperature for 12-48 hours was
usually sufficient to generate adequate signal intensity.
Steady State RNA Analysis
Oligonucleotides
WH 513. 20 base oligonucleotide GTA TAG GCG ATA GAA CAA
TC. Corresponds to the L-strand sequence 3174-3194 in the 16S
gene (Roe et al., 1985).
WH 514. 21 base oligonucleotide CTA CAT TGA TAT AGA GAG
AGG. Corresponds to the H-strand sequence 4655-4675 in the 16S
gene.
WH 515. 20 base oligonucleotide CTC CCA CCA TAT TGA CTT CG.
Corresponds to the L-strand sequence 15680-15699 in the ND6 gene.
WH 516. 20 base oligonucleotide CCT TCT CCT TTT TAT GCT GC.
Corresponds to the H-strand sequence 16092-16110 in the ND6 gene.


102
(Clayton, 1991; Chomyn and Attardi, 1992). Among these, the
mitochondrial transcription factor A (mtTFA) has turned out to be a
key molecule with pleiotrophic roles in the mitochondria. In addition
to its established role as a transcriptional activator (Fisher and
Clayton, 1985), the ability of mtTFA to wrap and bend DNA and
hence function as a mtDNA packaging protein (Diffley and Stillman,
1991; 1992; Parisi and Clayton, 1991; Fisher et al., 1992; Ghivizzani
et al., 1994) has been the focus of recent research.
The mtTFA protein was able to form transcription-competent pre
initiation complexes in the absence of the human mtRNA polymerase
fraction, suggesting its mode of activation was mediated through
direct binding of DNA (Fisher et al., 1987). The cloning of the human
(Parisi and Clayton, 1991), yeast (Diffley and Stillman, 1991), and
Xenopus laevis (Antoschechkin and Bogenhagen, 1995) mtTFA
revealed homology to a group of small nuclear DNA binding proteins,
the high mobility group (HMG) proteins. Gene disruption of ABF2
(the yeast mtTFA) led to the rapid loss of mtDNA when grown on
glucose media, and a growth defect on medium containing glycerol
(where mitochondrial gene expression was required), even though
almost all of the cells appeared to contain wild-type levels of mtDNA.


CHAPTER 4
ANALYSIS OF PROTEIN-MITOCHONDRIAL DNA INTERACTIONS AT
CRITICAL CIS ELEMENTS
Introduction
Mitochondrial biogenesis is a complex and highly sophisticated
process which requires the coordination of gene expression in both
the nucleus and mitochondria. Vertebrate mtDNA encodes only a
handful of these gene products, which include the two rRNAs found
in the mitochondrial ribosomes, 22 tRNAs and 13 proteins. The 13
proteins are all components of the respiratory complexes. Most of
the gene products involved in the replication and transcription of
mtDNA are encoded in the nucleus. However, the possibility remains
that some of the mitochondrial-encoded gene products could have
pleiotrophic functions, in addition to their commonly known roles in
mitochondrial physiology.
Recent developments in understanding the mechanisms of
mitochondrial DNA replication and transcription have led to the
identification of some of the essential nucleus-encoded components
101


95
(discussed below), this normalization revealed that the steady state
levels of most mitochondrial mRNAs increased 2.5-3 fold by later
stages of development (Figure 3-2, panels A-F and Table 3-2). This
increased level was concealed in the analysis using total RNA
normalization (Table 3-1) due to the dilution of mitochondrial RNA
levels by higher levels of nuclear transcripts. However, the levels of
mitochondrial rRNAs were also found to increase during early
development (though to a lesser fold than mRNA) when the RNA
levels were normalized to the levels of mtDNA (Figure 3-3, panels H
& I and Table 3-3). Hence, normalization with mitochondrial rRNA
also does not reflect the true levels of mitochondrial mRNA in each
stage of development.
Mitochondrial DNA appears to be the optimal macromolecular
species for normalizing mitochondrial RNA levels, since active
mtDNA synthesis does not resume in the developing embryo until
40-48 hours of development (Chase and Dawid, 1972). Therefore
mtDNA levels in the embryo during this time remain at the levels
found in the unfertilized egg (~4 ng/egg). Accumulation of mtDNA
increases after this time, leading to a doubling of mtDNA content per
embryo by 96 hours of development (Chase and Dawid, 1972).


212
total volume of 1 ul per egg or embryo is assumed. ADP levels were
~100 pMol per egg or embryo, which would be about 0.1 mM per egg
or embryo (Table 5-3). Hence, the mitochondrial ATP levels increase
in the context of constant levels of total cellular ATP and ATP/ADP
ratios, indicating clear-cut differences in mitochondrial physiology at
later developmental timepoints.
Discussion
Mitochondrial gene expression can be potentially regulated at at
least four broad levels. In the first level, regulation can be directly
at the level of transcription of the mtDNA, leading to increased mRNA
and protein levels. Another way to enhance mRNA levels would be
to amplify the gene dosage by increasing the mtDNA concentration,
which would indirectly increase RNA levels. Gene regulation can also
occur at a post-transcriptional level, by altering RNA stability and
turnover in response to cellular stimuli. A fourth mechanism could
be at the level of mitochondrial translation, which would be closely
interlinked with post-transcriptional modifications such as RNA
editing or polyadenylation. Evidence for developmental regulation of
polyadenylation (Bhat et al., 1992) and RNA editing (Read et al..


249
Attardi, G., Chomyn, A., King, M.P., Kruse, B., Loguercio Polosa, P., and
N.M. Narasimhan. 1989. Regulation of mitochondrial gene
expression in mammalian cells. Biochem. Soc. Trans. 18:509-513.
Attardi, G., and G. Schatz. 1988. Biogenesis of mitochondria. Annu.
Rev. Cell Biol. 4:289-333.
Attardi, G., Yoneda, M., and A. Chomyn. 1995. Complementation and
segregation behavior of disease-causing mitochondrial DNA
mutations in cellular model systems. Biochim. Biophys. Acta
1271:241-248.
Barat-Gueride, M., Dufresne, C., and D. Rickwood. 1989. Effect of DNA
conformation on the transcription of mitochondrial DNA. Eur. J.
Biochem. 183:297-302.
Barbour, R.L., and S.H. Chan. 1983. Adenine nucleotide transport in
hepatoma mitochondria and its correlation with hepatoma growth
rates and tumor size. Cancer Res. 43:1511-1517.
Benne, R. 1985. Mitochondrial genes in trypanosomes. Trends
Genet. 1:117-121.
Berk, A.J., and D.A. Clayton. 1973. A genetically distinct thymidine
kinase in mammalian mitochondria. Exclusive labeling of
mitochondrial deoxyribonucleic acid. J. Biol. Chem. 248:2722-2729.
Berk, A.J., and D.A. Clayton. 1974. Mechanism of mitochondrial DNA
replication in mouse L-cells: asynchronous replication of strands,
segregation of circular daughter molecules, aspects of topology and
turnover of an initiation sequence. J. Mol. Biol. 86:801-824.
Bhat, G.J., Souza, A.E., Feagin, J.E., and K. Stuart. 1992. Transcript-
specific developmental regulation of polyadenylation in Trapanosomci
brucei mitochondria. Mol. Biochem. Parasitol. 52:231-240.
Bisson, R., Schiavo, G., and C. Montecucco. 1987. ATP induces
conformational changes in mitochondrial cytochrome c oxidase.
Effect on the cytochrome c binding site. J. Biol. Chem. 262:5992-
5998.


266
Nieuwkoop, P.D., and J. Faber. 1967. Normal Tables of Xenopus
laevis (Daudin). 2nd edition. North-Holland (Amsterdam).
Ojala, D., Montoya, J., and G. Attardi. 1981. tRNA punctuation model
of RNA processing in human mitochondria. Nature 290:470-474.
Parikh, V.S., Morgan, M.M., Scott, R., Clements, L.S., and R.A. Butow.
1987. The mitochondrial genotype can influence nuclear gene
expression in yeast. Science 235:576-580.
Paris, J., and J.D. Richter. 1990. Maturation-specific polyadenylation
and translational control: Diversity of cytoplasmic polyadenylation
elements, influence of poly (A) tail size, and formation of stable
polyadenylation complexes. Mol. Cell. Biol. 10:5634-5645.
Paris, J., Swenson, K., Piwnica-Worms, H., and J.D. Richter. 1991.
Maturation-specific polyadenylation: in vitro activation by p34-cdc2
and phosphorylation of a 58-kD CPE-binding protein. Genes Dev.
5:1697-1708.
Parisi, M.A., and D.A. Clayton. 1991. Similarity of human
mitochondrial transcription factor 1 to high mobility group proteins.
Science 252:965-969.
Pierandrei-Amaldi, P., Campioni, N., Beccari, E., Bozzoni, I., and F.
Amaldi. 1982. Expression of ribosomal-protein genes in Xenopus
laevis development. Cell 30:163-171.
Piko, L.. and D.G. Chase. 1973. Role of the mitochondrial genome
during early development in mice. Effects of ethidium bromide and
chloramphenicol. J. Cell Biol. 58:357-378.
Piko, L.. and K.D. Taylor. 1987. Amounts of mitochondrial DNA and
abundance of some mitochondrial gene transcripts in early mouse
embryos. Dev. Biol. 123:364-374.
Poyton, R.O., Bellus, G., McKee, E.E., Sevarino, K.A., and B. Goehring.
1996. In organello mitochondrial protein and RNA synthesis systems
from Saccharomyces cerevisiae. Meth. Enz. 264:36-42.


2
nuclear genome, and a minor, though essential, contribution of gene
products (less than 40) encoded in the mitochondrial genome
(Attardi and Schatz, 1988). Sophisticated mechanisms ensure the
import and intramitochondrial sorting of cytoplasmically synthesized
proteins, phospholipids, and probably a few RNAs. Hence,
mitochondrial biogenesis is complex and under multiple layers of
regulation (Attardi and Schatz, 1988; Chomyn and Attardi, 1992).
The linkage of chronic degenerative human diseases to
mitochondrial dysfunction has resulted in a dramatic upswing of
scientific interest in the biogenesis and regulation of this complex
organelle. Mitochondrial encephalomyopathies are a diverse group
of disorders that result from the structural, biochemical, or genetic
derangement of mitochondria. Therefore, they are manifested
primarily in organs requiring high energy levels, like the brain,
heart, muscle, kidney and endocrine glands. Since these
encephalomyopathies share systemic features, they are named after
the symptoms they induce, like MELAS (Myoclonic Epilepsy, Lactic
Acidosis and Stroke-like episodes), MERRF (Myoclonic Epilepsy with
Ragged-Red Fibers), LHON (Lebers heriditary optic neuropathy), KSS
(Kearns-Sayre syndrome), etc. (Wallace, 1993).
The physiological basis of all these disorders is that mitochondria
have to produce a certain amount of energy continually.


257
cytochrome c oxidase subunits, enzymatic activity and total mRNA
content, in rat tissues. Mol. Cell. Biochem. 107:21-29.
Gai, W-Z., Sun, S-M., Ding, Y-Z., Freedman, J.S., and S.H.P. Chan.
(1988). Two monoclonal antibody lines directed against subunit IV
of cytochrome oxidase: a study of opposite effects. Arch. Biochem.
Biophys. 266:628-638.
Gaines, G.L., III. 1996. In organello RNA synthesis system from
HeLa cells. Meth. Enz. 264:43-49.
Gaines, G., and G. Attardi. 1984. Highly efficient RNA-synthesizing
system that uses isolated human mitochondria: New initiation events
and in vivo-like processing patterns. Mol. Cell. Biol. 4:1605-1617.
Gaines, G., Rossi, C., and G. Attardi. 1987. Markedly different ATP
requirements for rRNA synthesis and mtDNA light strand
transcription versus mRNA synthesis in isolated human
mitochondria. J. Biol. Chem. 262:1907-1915.
Garrity, P.A., and B.J. Wold. 1992. Effects of different DNA
polymerases in ligation-mediated PCR: enhanced genomic sequencing
and in vivo footprinting. Proc. Natl. Acad. Sci. USA 89:1021-1025.
Gehnrich, S.C., and J.R. Aprille. 1988. Hepatic gluconeogenesis and
mitochondrial function during hibernation. Comp. Biochem. Physiol.
B. 91:11-16.
Ghivizzani, S.C., Madsen, C.S., and W.W. Hauswirth. 1993. In
organello footprinting. Analysis of protein binding at regulatory
regions in bovine mitochondrial DNA. J. Biol. Chem. 268:8675-8682.
Ghivizzani, S.C.. Madsen, C.S., Nelen, M.R., Ammini, C.V., and W.W.
Hauswirth. 1994. In organello footprint analysis of human
mitochondrial DNA: Human mitochondrial transcription factor A
interactions at the origin of replication. Mol. Cell. Biol. 14:7717-7730.
Gillum, A.M., and D.A. Clayton. 1978. Displacement-loop replication
initiation sequence in animal mitochondrial DNA exists as a family of
discrete lengths. Proc. Natl. Acad. Sci. USA 75:677-681.


120
strand of the promoter region and the D-loop upstream region are
shown in Figure 4-2 and Figure 4-3. Relative to the naked DNA
controls (lanes labeled C), multiple sites of altered methylation were
readily detected in organello (lanes labeled T) in this critical stretch
of mtDNA Mitochondrial transcription in Xenopus laevis initiates
from two bi-directional promoters spaced -45 bp apart (Bogenhagen
and Yoza, 1986; Bogenhagen et al., 1986; Bogenhagen and Romanelli,
1988). A range of footprinted residues were readily detectable in
the promoter region of the bi-directional promoters (Figure 4-2).
The region just upstream of the transcription start sites for both
LSP1 (nucleotides 2100-2110) and HSP1 (nucleotides 2096-2105)
showed strongly protected residues on the corresponding coding
strands.
In contrast, primarily hypersensitive residues appeared near the
region just upstream of the transcription start sites for both LSP2A.B
(nucleotides 2031-2046) and HSP2 (nucleotides 2044-2051) on the
corresponding coding strands. A patch of strongly protected residues '
(between nucleotides 2062 and 2080) were detectable on both
strands in the 45 bp spacing between the two bi-directional
promoters. Also, the region downstream of LSP, between residues


Unfer. Egg
5.5 hr.
22.5 hr.
48 hr.
mTERF shift |
^ in Mill IHVR IRS!:
1 2 3 4 5 6 7 8 9 101112 131415161718 19 20 21222324


105
in spacing. These results underline the importance of the in vivo
phased binding of mtTFA for mtDNA metabolism. Also, the strict
distance requirements between the protein binding sites and start
points of transcription suggest that the protein activates
transcription mainly by distorting the promoter sequence to facilitate
polymerase recognition, rather than by the mechanism of bringing
together the transcription machinery (Dairaghi et al., 1995).
The mtTFA has been shown to have different binding affinities
for the H-strand and L-strand promoters of human mitochondria
(Fisher and Clayton, 1988). Using mtTFA purified from human KB
cell mitochondria, it was found that at low protein concentrations,
only the LSP was active in in vitro transcription, with the HSP
becoming active only at higher concentrations. These events also
correlated with the appearance of protected regions at the LSP or
HSP in DNAse I footprinting experiments (Fisher and Clayton, 1988).
Based on these observations, a simple model for the regulation of
mitochondrial gene expression has been proposed (Clayton, 1992;
Dairaghi et al., 1995). This model is based on the functional
consequences of varying the stoichiometries of h-mtTFA to mtDNA in
vivo. Titration of LSP with h-mtTFA in vitro demonstrated that the


Figure 3-3. Steady state levels of mitochondrial RNA per unit mitochondrial genome
during early development of Xenopus laevis. Mitochondrial DNA and RNA were simultaneously
isolated in the same solution from mitochondria prepared from unfertilized eggs and embryonic stages
at 6 hours, 9 hours 20 hours 30 hours, 48 hours, and 7 days post-fertilization. An equal volume of
sample from each developmental stage was RNAase-treated, alkali-denatured at 96C for 5 minutes,
and dot blotted in lOx SSC as described in Materials and Methods. The dot blots were hybridized with
an antisense riboprobe to Cyt b, washed, and the mtDNA levels quantitated using the Phosphorimager.
The Phosphorimager quantitation was used to approximately normalize the samples from each
developmental stage to the mtDNA level in that respective stage. The DNA dot blot experiment was
again repeated as above with normalized samples to accurately estimate the actual mtDNA levels for
correcting the RNA levels (Panel G). Digestion with DNAse I completely eliminated this signal (not
shown). Each lane in Panel G (labeled accordingly) corresponds to the mtDNA level of the respective
developmental stage. In parallel experiments, equal volumes of these approximately normalized
RNA/DNA samples were then run on 1.2% formaldehyde-agarose gels, blotted to nylon N+ membranes,
hybridized with gene-specific riboprobes synthesized by in vitro transcription from linearized clones,
washed, and exposed to x-ray film or Phosphorimager (described in Materials and Methods). Each lane
(labeled accordingly) corresponds to the respective mRNA or rRNA level of the corresponding
developmental stage. Panel A: ND1 mRNA; Panel B: ND4 mRNA; Panel C: ND6 mRNA; Panel D: Cyt b
mRNA; Panel E: CO II mRNA; Panel F: ATPasc 6 mRNA; Panel H: 12S rRNA; Panel 1: 16S rRNA. The
complex pattern of bands seen in panels H and I represent multiple products corresponding to the 16S
and 12S sequences, and is found in ribosomal RNA blots from other animal systems (see text). The shift
in mobility seen in some of the lanes is an electrophoretic artifact, and does not represent a higher
molecular weight species.


In Organella Methylation of Mitochondrial DNA
After the final centrifugation step, the pelleted mitochondria (~2
ml) were resuspended in an equal volume of phosphate-buffered
saline (PBS: 140 mM NaCl, 2.5 mM KC1, 10 mM Na2HP04, 1.5 mM
KH2PO4, pH 7.5) and 400 ul aliquots were transferred into Eppendorf
tubes and placed at room temperature. Then Dimethyl Sulfate (DMS)
was added in concentrations of 0.125%, 0.25% and 0.5%, vortexed
briefly to mix well and incubated at room temperature for 3 minutes.
Then 1 ml of ice-cold PBS was added to dilute out the DMS and
mitochondria pelleted immediately by centrifuging for 1 min at
10,000 x g. PBS washes were repeated twice to remove all traces of
DMS. Then 400 ul of mitochondrial lysis buffer was added and
mtDNA extracted as described below. The methylation reaction of
0.125% for 3 minutes was found to give satisfactory in organella
reactions which matched the reaction of 0.125% for 1.5 minutes using
purified mitochondrial DNA.
In Vivo Methylation of Eggs and Embryos
De-jellied eggs or embryos were drained of buffer, refloated in
PBS containing 0.125 % DMS and gently swirled for 3 minutes. The
DMS solution was rapidly emptied after 3 minutes and the eggs or


119
methylated base and breaks the phosphate backbone at the site of
loss of the base (Maxam and Gilbert, 1980), giving the family of
fragments (the footprint ladder) derived by partial methylation (step
2). The footprint ladders from the control and test samples are then
resolved on a 6% polyacrylamide-8M urea gel, transferred to nylon
membrane by vacuum transfer (Lopez et al., 1993), and detected by
hybridization with radiolabeled riboprobes hybridizing near the
reference point. Comparison of the test lanes (in vivo DNA) with the
control lanes (naked DNA) in step 3 allows the identification of the
hypersensitive (filled square) and protected (open circle) residues.
In order to look for differences in protein-DNA interactions in the
regulatory region of Xenopus mtDNA during basal and activated
transcription, it is first essential to establish the pattern of
footprinting seen in the D-loop region. To standardize the method, it
was essential to obtain mitochondria in large quantities. The ovary is
a tissue rich in mitochondria, with thousands of oocytes in different
stages of development, a large proportion of which are mature
oocytes. Hence, mitochondria were isolated from Xenopus ovaries
and processed for in organello footprinting as described in Materials
and Methods. The results of such an analysis for both the H- and L-


27
25 mM HEPES, pH to 7.8 with NaOH. The divalent and monovalent
ions were made up as separate stocks and diluted just before use).
After re-placing the lid, the petridishes were gently swirled to
evenly distribute the sperm and also to spread out the eggs into a
monolayer, and then left undisturbed. Fertilization can be monitored
within 30 minutes, as fertilized eggs undergo the cortical reaction
and the animal pole rotates to top. Unfertilized and damaged eggs
can then be culled. During the first 8 hours of growth, the lx F-l
buffer was replaced with 0.2x F-l buffer in the petridishes.
Afterwards, the whole petridish was immersed in a large dish filled
with 2-3 liters of 0.2x F-l buffer. This step is very critical for
obtaining good survival of the embryos. The embryos were allowed
to hatch in this volume of buffer without further changes.
De-jellying of Eggs and Embryos
Eggs and embryos were de-jellied by gently swirling in 2%
Cysteine solution [Cysteine, free base; made using lx OR-2 within 1
hour of use and titrated to pH 7.8 with NaOH (4.5 ml 1 M NaOH per
100 ml)] for 3-4 minutes, followed by repeated washing in lx OR-2
(for eggs) or 0.2x F-l (for embryos) to remove traces of the cysteine
solution. The de-jellied eggs or embryos were then gently placed
into a fresh petridish of lx OR-2 (eggs) or 0.2x F-l (embryos) for


Figure 4-8. In organello footprint of the mTERF region in
ovary mtDNA. Mitochondria were isolated from X. laevis ovary
and DMS treated in organello. Untreated mitochondria were used to
isolate mtDNA and DMS treated in vitro. Both in organello and in
vitro methylated mtDNA were cut with SspI to provide a reference
point at nucleotide 4927 of the X. laevis genome (Roe et al., 1985),
cleaved with piperidine, and processed for electrophoresis as
described in Materials and Methods. The cleaved DNA samples were
then run on 6% sequencing gels, blotted to nylon membranes, probed
with radiolabeled riboprobes specific to the mTERF region, and
autoradiographed (described in Materials and Methods). The lanes
labeled C correspond to in vitro methylated naked mtDNA, whereas
lanes labeled T refer to in organello methylated mtDNA. Nucleotide
numbering corresponds to the sequence reported by Roe et al.
(1985). Genomic landmarks and critical cis-elements are indicated.
The residues protected (open circles) or hypersensitive (filled
squares) to DMS methylation are indicated.


66
was centrifuged at 13,000 x g for 45 rain in a microcentrifuge at 4C.
The clear supernatant was collected carefully, avoiding the fluffy
layer floating on top. Aliquots were rapidly frozen in a dry ice-
ethanol bath and stored at -80C. Protein concentrations were
determined by the Lowry method.
The extracts were assayed for presence of DNA endonuclease
activity by incubating 20 ug of the extract from each stage with 1 ug
of 100 bp ladder (GIBCO BRL) and incubated at 37C for 30'. The
reactions were run on a 1% agarose gel and stained with ethidium
bromide. By this assay, no detectable DNA endonuclease activity was
detected (data not shown).
Band Shift Assay
The protocol for the mobility shift assay for mTERF is essentially
the one described by Fernandez-Silva el al. (1996) for human
mitochondrial lysates, with some modifications. The DNA-binding
reactions were assembled on ice and consisted of the following
components: 0.1 pMol of the mTERF bandshift probe (0.2-lx
106cpm/pMol), 5 ug BSA, 5 ug poly (dl-dC).(dl-dC) as non-specific
competitor, and the desired amounts of the S-13 mitochondrial
extract (usually from 10 to 60 ug). The buffer and salt conditions


Arbitrary units
Mitochondrial S-13 extract (ug)
Figure 4-13...continued


Egg
5 hr
14 hr
20 hr
30 hr
38 hr
50 hr


1


*


*
#
*
f

*
*
i

*
*
#
Egg
5 hr
14 hr
20 hr
30 hr
38 hr
50 hr


Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
REGULATION OF MITOCHONDRIAL GENE EXPRESSION
DURING EARLY DEVELOPMENT OF XENOPUS LAEVIS
By
Chandramohan V. Ammini
May, 1997
Chairperson: William W. Hauswirth
Major Department: Molecular Genetics and Microbiology
Mitochondrial transcript levels are actively regulated during early
development of Xenopus laevis, whereas mitochondrial DNA (mtDNA)
levels are constant during this time, providing the unique
opportunity to study mitochondrial transcriptional regulation
decoupled from mtDNA replication. The main focus of this
dissertation was to gain further insights into the molecular
mechanisms of mitochondrial gene regulation in this system.
Measurement of steady state transcript levels per unit
mitochondrial genome showed that transcript levels were basal up to
IX


109
study (Tominaga et al., 1993) which would argue against this model
reported that the levels of mtTFA mRNA were not changed in cell
lines lacking mitochondrial DNA or with a defective mitochondrial
genome, suggesting that the regulation of mtTFA levels in the cell is
not directly linked to the levels of mtDNA However, these cells
were cultured so as to generate adequate glycolytic energy in the
absence of a functional respiratory chain. Therefore, it is possible
that a normal signaling pathway which responds to deficiencies in
energy production might have been curtailed. Hence, this model of
mitochondrial gene regulation, though attractive, still remains
speculative.
Another nucleus-encoded factor which has been the focus of
intense research is the mitochondrial transcription termination factor
(called mTERM or mTERF). It was purified from HeLa cell
mitochondria as an activity which promotes specific termination of
H-strand transcripts at the 16S rRNA/leucyl-tRNA boundary (Kruse
et al., 1989). Using DNA affinity chromatography, three
polypeptides, with a predominant 34kDa species which had the
termination promoting activity, were identified (Daga et al., 1993).
The DNA element to which this protein binds had been identified


122
H-STRAND
C T T C
L-STRAND
C T T C
191 6
1 934-
1 946
1 953-
1 966-
1983-
1 986
1991
t
LSP 2
A
LSP 1
2106-
2131
In vitro DNAase I footprint of xl-mtTFA


3 STEADY STATE ANALYSIS OF MITOCHONDRIAL
RNA LEVELS 68
Introduction 68
Results 72
Discussion 92
4 ANALYSIS OF PROTEIN-MITOCHONDRIAL DNA
INTERACTIONS AT CRITICAL CIS-ELEMENTS 101
Introduction 101
Results 115
Discussion 159
5 MITOCHONDRIAL TRANSCRIPTION RATE ANALYSIS. . 178
Introduction 178
Results 181
Discussion 212
6 SUMMARY AND PERSPECTIVES 230
LIST OF REFERENCES 248
BIOGRAPHICAL SKETCH 274
IV


174
and H-strands (Figure 2 of Kruse et al., 1989). DNAse I does not
recognize the DNA sequence per se, but appears instead to sense DNA
backbone geometry and cuts at points where the minor groove is
wide (Drew and Travers, 1988). The crystal structure of the complex
of DNAse I and nicked DNA shows the enzyme to be bound at a wide
minor groove, and the DNA to be bent 21.5 away from the protein,
resulting in a compression of the major groove on the opposite side
(Suck et al., 1988). Hence DNAsel is a probe of minor groove
deformation in protein-DNA complexes. Dimethyl sulfate, on the
other hand, is a probe of major groove binding proteins. Hence, the
most direct interpretation of the DMS hypersensitive sites seen in
Figure 4-8 is that the mTERF protein is a major groove binding
protein, which bends or distorts the DNA locally at the binding site
(causing the DMS hypersensitive sites), widening the minor groove
on the flanks which appear as the DNAse I hypersensitive sites seen
in the report of Kruse et al. (1989). It is important to note that these
footprints showing distortion of DNA structure appear specifically in
and around the mTERF element, with no evidence of any other
protein-DNA interactions or changes in DNA structure in the
sequences surrounding this element (Figure 4-8). This is strong


183
1 2 3
(kb)
9.5
7.5
Figure 5-1. Size fractionation of mitochondrial run-on RNA.
Mitochondrial run-on transcription reactions were performed with
mitochondria from 73 hour-old tadpoles (lane 1), or egg (lanes 2 and
3) in basic run-on buffer, as described in Materials and Methods.
RNA was then isolated from these samples using the TriZol reagent
(GIBCO BRL) according to the manufacturers instructions. The RNA
was then denatured and loaded onto 1.2% formaldehyde-agarose gels
as described in the steady state analysis section of Materials and
Methods. After electrophoresis, the gel was dried at 60 C in gel
dryer and autoradiographed to detect the run-on products. The
molecular weights of an RNA ladder run in parallel are shown on the
left side of the figure, and the positions of the two mitochondrial
rRNAs, 16S and 12S rRNA, are indicated on the right. Note that the
majority of the labeled species cluster between 2.4 and 0.24 kb, the
size range of fully processed mitochondrial transcripts.


HSP
1 86


221
Dworkin and Dworkin-Rastl (1992) showed that activation of
glycogen breakdown and glycolysis at gastrulation may be a
metabolic consequence of increased free ADP in the embryo, as
glycolysis could be transiently activated by the injection of ADP into
fertilized eggs. However, the total ADP concentration in non-
manipulated embryos does not increase between the egg and
gastrula stages (Table 5-3; Dworkin and Dworkin-Rastl, 1989) or
between eggs and early developmental stages upto 30 hours of
development (Table 5-3). Hence, it is possible that total ADP levels
may not be an accurate measure of free ADP or thermodynamically
available ADP. Therefore, the active pool of free or available ADP
may indeed increase during the blstula and gastrula stages, even
while total ADP levels remain constant (Dworkin and Dworkin-Rastl,
1992).
In addition to these dynamic metabolic changes, fertilization itself
triggers spiral waves of intracellular Ca2+ release contributed by
inositol lipid hydrolysis (Busa and Nuccitelli, 1985; Busa et al., 1985;
Kubota et al., 1987). This transient increase in cytoplasmic calcium
could have profound effects on mitochondrial physiology. Oscillatory
changes in cytosolic calcium concentration ([Ca2+]c) have been shown


165
positioning of these sequences in the D-loop upstream region allows
the phased binding to occur, making the likelihood of an in phase
pattern going out of phase unlikely. It is still possible, however,
that an as yet unidentified in vivo factor might change these binding
characteristics.
The second model has more appeal, with some in vitro evidence
to support it. The mtTFA protein has been shown to have more
affinity for the LSP over the HSP in in vitro transcription assays and
footprinting assays (Fisher and Clayton, 1988). Also, this protein
seems to inhibit transcription at higher concentrations for both the
human (Dairaghi et al., 1995) and Xenopus (Antoschechkin and
Bogenhagen, 1995) homologs. The degree of stimulation of basal
transcription by mtTFA differs with the promoter, HSP1 being
activated 10-fold and LSP1 only 2-fold in the presence of xl-mtTFA
(Antoschechkin and Bogenhagen, 1995). These phenomena of
differential affinity, differential stimulation, and narrow range of
functional protein concentrations suggest a mechanism for selective
regulation of transcription, with very low levels of mtTFA
stimulating the LSP to produce the primers for replication. Higher
levels would significantly activate HSP and slightly increase LSP


7
results in strand elongation over the entire length of the genome.
Initiation of L-strand synthesis begins only after the Ol is exposed as
a single-stranded template. Asynchronous replication of each strand
then completes replication, the region between the two origins being
replicated last.
The critical elements of the mammalian H-strand replication
origin include the L-strand promoter and three downstream
conserved sequence blocks (CSB I, II, III). The involvement of RNA
primers in the initiation of H-strand synthesis was shown by the
presence of alkali-sensitive 5 ends in D-loop DNA (Gillum and
Clayton, 1979; Brennicke and Clayton, 1981). The RNA primer was
shown to originate from the L-strand promoter (Chang and Clayton,
1985; Chang et al., 1985), with a sharp transition from RNA to DNA
occurring within a series of highly conserved sequence blocks (CSB
1, 2, 3), in a region of mtDNA which is otherwise highly divergent
across species (Walberg and Clayton, 1981). A search for an
endonucleolytic activity with the ability to recognize features of the
CSBs and process nascent RNA transcripts led to the discovery of
mouse RNAase MRP (mitochondrial RNA processing) (Chang and
Clayton, 1987a). This was found to be a ribonucleoprotein, with a
136-nucleotide RNA species (Chang and Clayton, 1987b), with a 10
nucleotide sequence complementary to CSB II (Chang and Clayton,


107
transcription, as this protein inhibited in vitro transcription at high
concentrations (Barat-Gueride et al., 1989).
Hence it has been proposed that the modulation of the ratio of
mtTFA to mtDNA could potentially dictate the relative expression
from the two promoters. In this model, mtTFA is productively bound
to the LSP at low mtTFA to mtDNA ratios, allowing transcription from
the LSP and subsequent priming of H-strand DNA replication. At
higher mtTFA to DNA ratios, the protein would be bound to both LSP
and HSP, allowing initiation of transcription from HSP, with a possible
down-regulation of LSP which would allow continued, low level
replication priming from the LSP. Hence, mtTFA may provide an
important control point for both mitochondrial copy number and
transcriptional activity (Clayton, 1992; Dairaghi et al., 1995). The
genomic sequence of the mtTFA gene has recently been reported
(Tominaga et al., 1992). Using this information, Virbasius and
Scarpulla (1994) found recognition sites for the nuclear respiratory
factors, NRF-1 and NRF-2, in the proximal promoter of the human
mtTFA gene. These factors have been previously implicated in the
activation of certain nuclear genes that contribute to mitochondrial
respiratory function (Evans and Scarpulla, 1989; Chau et al., 1992;


processing activity has been identified and characterized in rat liver
mitochondria (Manam and Van Tuyle, 1987).
Regulation of Mitochondrial Gene Expression
Mitochondrial biogenesis requires the coordination of both nuclear-
and mitochondrial-encoded mitochondrial genes. How this
coordination is achieved to meet the dynamic energy needs of the
cell is still one of the central questions in mitochondrial molecular
biology. The aggregate of the experiments done in this field suggests
that there is no one answer. The mode of regulation seems to be as
varied as the plethora of regulatory events involved in mitochondrial
biogenesis. More is known about the regulation of genes encoded on
mtDNA than those on nuclear-DNA. Mitochondrial gene expression is
regulated by both transcriptional and post-transcriptional
mechanisms. The levels of the ribosomal RNAs seem to be controlled
by a transcription termination mechanism in vertebrate
mitochondria, as the two rRNAs have a 15- to 60-fold higher rate of
synthesis than mRNAs (Gelfand and Attardi, 1981). After initiation
of transcription from the HSP, transcription is terminated
downstream of the ribosomal genes by DNA-binding protein-
mediated termination at a tridecamer sequence in the tRNAle gene
(Christianson and Clayton, 1986; 1988). The protein factor,


177
polymerase with the mTERF protein, although there is no evidence to
suggest any of this from these experiments. These will have to await
the molecular cloning of the gene encoding the mTERF protein.
In summary, the in vivo footprinting analyses have furnished
fresh insights into the cellular roles of two important mitochondrial
proteins, the mitochondrial transcription factor xl-mtTFA and the
mitochondrial transcription termination factor (mTERF). The xl-
mtTFA protein was shown to constitutively bind the regulatory
regions of Xenopus mtDNA in a periodic fashion, possibly presenting
important cis-elements in the correct structural context for the
replication and transcription machinery. However, the footprint data
rule out the possibility of active regulation of mitochondrial
transcription by changing levels of this protein in mitochondria.
Secondly, the presence of the mTERF protein in Xenopus
mitochondria was confirmed by in vivo footprinting and band shift
assays. The mode of footprinting showed evidence of DNA bending
at the binding site. An unexpected and intriguing finding was that
this protein was constitutively bound to its cognate site during both
basal and activated transcription, opening up new questions about its
role in vivo.


179
1972). Hence, it is possible that transcription is decoupled from
replication of mtDNA during this window of development, a situation
which is not easily obtained in other systems due to the constitutive
and simultaneous occurrence of these two biosynthetic events in the
mitochondria.
Another interesting feature of the changes in the transcript
patterns was the apparent coordinate pattern of regulation of the six
mitochondrial mRNAs analyzed (Chapter 3). Five different mRNAs
(ND1, ND4, CO II, ATPase 6, and Cyt b), all of which are encoded on
the H-strand, showed more or less similar levels of transcript
abundance over 7 distinct developmental time points (Figure 3-3 and
Table 3-3). The other mRNA analyzed, ND6, displayed a lower but
similar trend of transcript abundance (Figure 3-3 and Table 3-3). In
contrast, ND6, the only mRNA encoded on the L-strand transcribed
by the L-strand promoter (LSP), is not as active as the HSP in in vitro
transcription assays (Antoschechkin and Bogenhagen, 1995). This
might explain the lower abundance of this transcript in vivo.
Furthermore, the two rRNAs (16S and 12S rRNA) also exhibited an
increasing trend, albeit much lower than the mRNAs, during this time
(Figure 3-3 and Table 3-3). This is a surprising observation because


37
protocol as the sequencing reference is provided by the site of
hybridization of the primer. On an average, about 0.8 to 1 ug mtDNA
is recovered from 300-400 eggs, assuming ~4 ng mtDNA/egg (Chase
and Dawid, 1972; Webb and Smith, 1977).
In Vitro Methylation of Purified Mitochondrial DNA
Mitochondrial DNA isolated from control mitochondrial pellets
(untreated with DMS either in organello or in vivo) was resuspended
in 200 ul of 50 mM sodium cacodylate (pH 7.0). DMS titrations were
then done for short reaction times (30 sec. to 1.5 min), as necessary
to match the respective extent of in organello or in vivo reaction.
Then 50 ul of chilled DMS stop buffer (1.5 M sodium acetate (pH 7.4),
1 M 2-mercaptoethanol) was added and the mtDNA samples ethanol
precipitated.
Piperidine Cleavage of Methylated DNA
To cleave the mtDNA at methylated residues, the DNA pellets
were resuspended in 200 ul of 10% piperidine and incubated at 90C
for 30 min. Then the DNA was again ethanol precipitated in the
presence of 2.5 M ammonium acetate, resuspended in 200 ul of
water and dried in a speed-vac to remove all traces of piperidine.


208
On the basis of these results, it can be envisaged that the
developmental cue for resumption of mitochondrial transcription in
the developing embryo is related to the changing biochemical
composition of the mitochondria. Early embryos primarily utilize the
stockpiled nutrient resources in the eggs. At a point during early
development, the embryonic cells would have to switch from this
catabolic mode to both a catabolic and anabolic mode of metabolism.
Hence, dramatic changes in mitochondrial metabolism are possible in
this system, a theme consistent with the available literature on
carbon flow during embryogenesis of X. laevis and other vertebrates
(discussed in detail later).
An indirect prediction from the above results would be that the
mitochondrial ATP levels are likely to be higher in the metabolically
active stages, since ATP synthesis is usually linked to respiratory
activity. To examine this issue directly, the mitochondrial adenine
nucleotide content of unfertilized eggs and four distinct embryonic
stages were measured by reversed phase, ion-paired, high
performance Liquid Chromatography (RP-HPLC). The mitochondria
were purified twice on sucrose gradients to minimize cytoplasmic
protein contamination, and the adenine nucleotide content (pMol)


69
data, they concluded that after the gastrula stage, there is a switch-
on of mitochondrial rRNA synthesis at gastrulation (10 hours post
fertilization). Accumulation then proceeded at a constant rate, and
by 96 hours post-fertilization, the content of both mitochondrial
rRNAs per embryo had doubled.
Young and Zimmerman (1973) measured the synthesis of mtRNA
by 32P labeling of disaggregated Xenopus embryos at different
developmental stages, followed by electrophoresis and scintillation
counting of gel slices. They could detect mitochondrial RNA synthesis
in the blstula, albeit at a very low level. Older embryos (26-32
hours post-fertilization) had greater incorporation (2.5 fold more)
over the gastrula stage (10 hours post-fertilization). Differences in
the extent of disaggregation and resultant differences in 32P uptake
by the embryos were inherent problems in their system. However,
their results support the general conclusion that the older the
embryos, the greater is the incorporation into mitochondrial RNA.
Dawid et al. (1985) microinjected [32P]GTP into fertilized eggs and
analyzed labeled RNA by methyl mercury hydroxide agarose gel
electrophoresis. They could not detect RNA synthesis of any kind
before the mid-blastula (6-7 hours) stage, with the reservation that


268
Roeder, R.G. 1974b. Multiple forms of deoxyribonucleic acid-
dependent ribonucleic acid polymerase in Xenopus laevis. Levels of
activity during oocyte and embryonic development. J. Biol. Chem.
249:249-256.
Salomon de Legname, H.S., Fernandez, S.N., Miceli, D.C., Mariano, M.I.,
and A.H. Legname. 1977. Modifications of the mitochondrial
ultrastructure related to metabolic changes during Bufo arenarum
ontogenesis. Acta Embryol. Exp. 2:93-107.
Saluz, H.P., and J.P. Jost. 1989. Genomic footprinting with Taq
polymerase. Nature 338:217.
Saluz, H.P., Wiebauer, K., and A. Wallace. 1991. Studying DNA
modifications and DNA-protein interactions in vivo. A window onto
the native genome. Trends Genet. 7:207-211.
Schinkel, A.H., Groot Koerkamp, M.J.A., Touw, E.P.W., and H.F. Tabak.
1987. Specificity factor of yeast mitochondrial RNA polymerase. J.
Biol. Chem. 262:12785-12791.
Schon, E.A., Koga, Y., Davidson, M., Moraes, C.T., and M.P. King. 1992.
The mitochondrial tRNA (Leu (UUR)) mutation in MELAS: a model for
pathogenesis. Biochim. Biophys. Acta 1101:206-209.
Schonfeld. P., Fritz, S., Halangk, W., and R. Bohnensack. 1993.
Increase in the adenine nucleotide translocase protein contributes to
the perinatal maturation of respiration in rat liver mitochondria.
Biochim. Biophys. Acta. 1144:353-358.
Shadel, G.S., and D.A. Clayton. 1993. Mitochondrial transcription
initiation. Variation and conservation. J. Biol. Chem. 268:16083-
16086.
Shadel, G.S., and D.A. Clayton. 1995. A Saccharomyces cerevisiae
mitochondrial transcription factor, sc-mtTFB, shares features with
sigma factors but is functionally distinct. Mol. Cell. Biol. 15:2101-
2108.


110
earlier by in vitro transcription assays as a tridecamer sequence 5-
TGGCAGAGCCCGG-3, contained entirely within the gene for leucyl-
tRNA in human mtDNA (Christianson and Clayton, 1986; 1988). A
search of sequence data bases revealed the existence of this
termination signal in a wide variety of organisms from protozoa to
mammals (Valverde et al., 1994), occurring at the 3 end of the large
rRNA, independent of the adjacent gene. Although the tridecamer
sequence itself diverged in widely separated phyla, a well-conserved
heptamer TGGCAGA the mitochondrial rRNA termination box,
could be defined. This evolutionary conservation strongly suggests
that mitochondrial rRNA transcription termination is a widely
conserved mechanism in animals.
Research into this termination mechanism assumed new
dimensions with the identification of point mutations in this cis
element (Hess et al., 1991) that were linked with the chronic,
degenerative human disease MELAS (mitochondrial myopathy,
encephalopathy, lactic acidosis and stroke-like episodes). In a cell
free assay, using partially purified mTERF, the MELAS mutation (an
A to G transition at position 3243) reduced termination of the 16S
rRNA in in vitro transcription reactions. Therefore, the authors


in the footprinting section). The lysate was then extracted twice with
phenol:chloroform:isoamyl alcohol, once with chloroform, and then
processed for dot blotting (without ethanol precipitation) as
described in the steady state analysis section.
Measurement of Mitochondrial Adenine Nucleotides
Extraction Of Adenine Nucleotides
The total egg/embryonic and mitochondrial adenine nucleotides
were measured by reversed-phase, ion-paired HPLC (RP-HPLC).
Adenine nucleotides were extracted from eggs, embryos, and isolated
mitochondria by an adapted protocol of Weinberg et al., 1989. For
eggs and embryos, 5-25 de-jellied eggs or embryos were
homogenized in 225-400 ul of 12% TCA with an Eppendorf pestle
(Kontes) and incubated at room temperature for 5 minutes. The
tubes were then vortexed and spun in an Eppendorf centrifuge for 5
minutes. The clarified supernatant was removed and extracted twice
with 2-6 volumes of 0.5 M trioctylamine in cyclohexane, centrifuged,
the aqueous layer filtered through a 0.22 micron nylon centrifuge
filter (Micron Separations Inc.), and stored at -70C.
For extraction from isolated mitochondria, mitochondria from 300
eggs or embryos were prepared by differential centrifugation and


113
ribosomal RNAs to be amplified more efficiently, without
interference from antisense transcripts from the LSP. This effect on
heterologous RNA polymerases suggests that specific interactions
between the mTERF and RNA polymerases are not likely to be
critical. Rather, the mTERF protein bound on its cognate site seems to
be interfering with the forward progress of the RNA polymerase,
functioning as a physical roadblock (Shang and Clayton, 1994). In
support of this suggestion, it has been found that this protein binds
tightly to DNA, with a half-life of 40-50 min on its cognate DNA
binding site (Chomyn et al., 1992). Circular permutation analysis
with the permutation vector pCY4 revealed that mTERF bound to its
DNA binding site induces bending in the DNA helix, with a bending
angle of -35 (Shang and Clayton, 1994). Hence, binding of mTERF to
its cognate site induces a localized conformational change in mtDNA.
It is possible that this DNA conformational change may be
contributing significantly to the termination phenomenon sponsored
by mTERF. However, in vivo evidence for DNA bending by this
protein is not available yet. It is also not known if this protein is
constitutively bound to its cognate site at all times, or whether it is


Sequencing gel


250
Bogenhagen, D.F., and D.A. Clayton. 1974. The number of
mitochondrial deoxyribonucleic acid genomes in mouse L cells and
human HeLa cells. J. Biol. Chem. 249:7991-7995.
Bogenhagen, D.F., and D.A. Clayton. 1978. Mechanism of
mitochondrial DNA replication in mouse L-cells: kinetics of synthesis
and turnover of the initiation sequence. J. Mol. Biol. 119:49-68.
Bogenhagen, D.F., and N.F. Insdorf. 1988. Purification of Xenopus
laevis mitochondrial RNA polymerase and identification of a
dissociable factor required for specific transcription. Mol. Cell. Biol.
8:2910-2916.
Bogenhagen, D.F., and M.F. Romanelli. 1988. Template sequences
required for transcription of Xenopus laevis mitochondrial DNA from
two bi-directional promoters. Mol. Cell. Biol. 8:2917-2924.
Bogenhagen, D.F., and B.K. Yoza. 1986. Accurate in vitro
transcription of Xenopus laevis mitochondrial DNA from two bi
directional promoters. Mol. Cell. Biol. 6:2543-2550.
Bogenhagen, D.F., Yoza, B.K., and S.S. Cairns. 1986. Identification of
initiation sites for transcription of Xenopus laevis mitochondrial DNA.
J. Biol. Chem. 261:8488-8494.
Borst, P. 1980. Mitochondrial nucleic acids of protozoa. In:
Biochemistry and Physiology of Protozoa Vol.3 (Levandowsky, M.,
Hunter, S.H.. eds.), Academic Press (New York), pp. 341-364.
Bozzoni. I Togoni, A., Pierandrei-Amaldi, P., Beccari, E., Buongiorno-
Nardelli, M., and F. Amaldi. 1982. Isolation and structural analysis
of ribosomal protein genes in Xenopus laevis. J. Mol. Biol. 161:353-
371.
Brennicke, A. and D.A. Clayton. 1981. Nucleotide assignment of
alkali-sensitive sites in mouse mitochondrial DNA. J. Biol. Chem.
256:10613-10617.


225
anchors (Albring et al, 1977). If this is true, the mtDNA replication
and transcription machinery would be in close proximity to the
oxidative phosphorylation machinery in the inner membrane, as well
as being subject to the charge and pH variations caused by changes
in the proton gradient. Hence the hypothesis of the regulation of
mitochondrial gene expression by the developmental changes in the
biochemistry of the organelle is a viable one.
To begin to address this question using the mitochondrial run-on
transcription system, a simple experiment was conducted.
Mitochondria from a transcriptionally down-regulated stage like the
20 hr stage were incubated in the basic run-on buffer, along with the
TCA cycle intermediate a-ketoglutarate, ADP, and phosphate. The
logic behind addition of these substrates was to attempt to simulate
the conditions found in the mitochondria of a transcriptionally up-
regulated stage like the 28 or 48 hr embryo, the assumption being
that these later stages would have a more active mitochondrial
metabolism. As shown in Figure 5-6, activation of endogenous ATP
production by the addition of these substrates dramatically activated
mitochondrial transcription (22 fold over control). Exogenous
addition of ATP showed a lower fold induction (6 fold over control),


222
to be decoded in the mitochondria (Rizzuto et al., 1994; Hajnoczky et
al., 1995), leading to increases in intramitochondrial Ca2+([Ca2+]m)
within seconds (Rizzuto et al., 1992; Rutter et al., 1993). Ca2+regulates
several matrix dehydrogenases in a concentration-dependent
manner (McCormack and Denton, 1993), leading to the idea that
mitochondria are tuned to respond to oscillating [Ca2+]c signals
(Hajnoczky et al., 1995) by regulating oxidative metabolism in
concordance with changing energy demands of the cell (Pralong et al.,
1994). Unfortunately, the specific effects of the increased [Ca2+]m on
mitochondrial metabolism in Xenopus laevis fertilized eggs have not
been investigated yet.
The possibility also exists that there could be changes in
mitochondrial ultrastructure during X. laevis development, as either
the cause or effect of these metabolic changes during development.
In electron micrographs of thin sections, murine egg mitochondria
appear as small, condensed, electron-dense structures. In contrast,
the mitochondria of the 4-8 cell stage embryos were swollen and
structurally distinct, with numerous transversely arranged cristae
(Stern et al., 1971; Piko and Chase, 1973), with a coincident rise in
oxygen consumption and cyanide-sensitive ATP synthesis (Mills and


REGULATION OF MITOCHONDRIAL GENE EXPRESSION
DURING EARLY DEVELOPMENT OF XENOPUS LAEVIS
By
CHANDRAMOHAN V. AMMINI
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1997


Figure 5-2. Hybridization target panel for strand-specific
detection of run-on transcripts. A. Approximate genomic
location of the four genes for which sense and anti-sense riboprobes
were synthesized are shown, along with the direction of transcription
from the two promoters in the D-loop region. B. The L-strand and
H-strand sense transcripts corresponding to the four genes shown in
part A were synthesized by in vitro transcription, electrophoresed on
1.2% formaldehyde-agarose gels, blotted onto nylon N+ filters, and
processed as described in Materials and Methods. The six panels (a,
b, c, d, e, and f) correspond to the six hybridization target panels
used in the experiment shown in. Figure 5-3 for hybridization with
run-on RNA. Note that the filters have been precisely trimmed
below each ethidiiim-stained band prior to hybridization to remove
the inevitable shorter transcripts which would interfere with
quantitation. In this hybridization format, run-on transcription from
the L-strand promoter (LSP) would be detected by the three L-
strand sense transcripts of 16S (lane 1), ND1 (lane 2), and ND6 (lane
6). Transcription from the H-strand promoter (HSP) would be
detected by the three H-strand sense transcripts of 16S (lane 3), ND1
(lane 4), and Cyt b (lane 5).


3 W
0
Z
>
I
# Egg
5 hr
14 hr
20 hr
28 hr
48 hr
48 hr
20 hr
>
m
r/Q
OQ
l I
I t
f I
I '
16S (L)
I ND1 (L)
| 16S (H)
NDI (H)
Cyt b (H)
ND6 (L)
189


228
In order to obtain an approximate idea about the in vivo levels of
oxidative phosphorylation during early development of X. laevis, the
mitochondrial ATP levels of distinct developmental stages were
measured by reversed phased-HPLC and normalized to mitochondrial
protein levels. ATP levels and energy charge (ratio of ATP to ADP +
AMP) of early stages upto 21 hours were more or less constant, with
the 30 hr stage showing a 2 fold increase, indicating a more active
oxidative metabolism in this stage of embryogenesis (Table 5-2),
compared to the earlier stages. The mitochondrial ATP levels and
energy charge increased in the context of constant total adenine
nucleotide levels and energy charge ratios in the eggs and embryos
(Table 5-3), showing that the metabolism in the 30 hr embryo is
more active than in the earlier stages. Mitochondrial transcription
rate of this metabolically more active stage was also very high (72
fold over egg levels), compared to earlier stages (Figure 5-5),
showing a correlation between the metabolic state of the
mitochondria and mitochondrial transcription.
In conclusion, the mitochondrial run-on transcription assays show
that the steady state levels of mitochondrial transcripts during early
development of Xenopus laevis are primarily determined by the


92
state levels compared to the other mRNAs. The steady state level of
ND6 remained at near egg levels till 9 hours of development,
increased to 3-fold by 20 hours, 4-fold by 30 hours, and 8-fold by 48
hours of development. Again, the 5-day old tadpole showed a
decreased level comparable to the 20 hour stage. Significantly, the
steady state levels of the 12S and 16S rRNAs were not static during
development (Figure 3-3, panels H & I), justifying the mtDNA
normalization. They remained at near egg levels until 9 hours of
development, increased 1.7-2 fold over egg levels by 20 hours, 2.2
fold by 30 hours, and ~4-fold by 48 hours of development (Table 3-
3). In the 5 day old tadpole, levels decreased but were still higher
than egg levels (1.3-fold for 16S and 1.9-fold for 12S rRNA).
Therefore, the pattern of steady state levels of the rRNAs more or
less followed the pattern shown by the mRNAs, albeit to a lesser fold.
Discussion
The steady state levels of mitochondrial RNA (mRNA and rRNA)
during very early development of Xenopus laevis as reported by
Meziane et al. (1989) could not be reproduced in our laboratory,
even though similar protocols were employed (Figure 3-1 and Table


LIST OF FIGURES
2-1 Experiment to determine the optimal number of cycles
of linear amplification 43
2-2 Experiment comparing 3 different thermostable DNA
polymerases for accurate amplification of the
footprint ladder 45
3-1 Steady state levels of mitochondrial RNA during early
development of Xenopus laevis 75
3-2 Steady state levels of mitochondrial RNA isolated from
purified mitochondria during early development
of Xenopus laevis 81
3-3 Steady state levels of mitochondrial RNA per unit
mitochondrial genome during early development
of Xenopus laevis 87
3-4 Steady state levels of mitochondrial mRNAs per unit
mitochondrial genome during early development
of Xenopus laevis 91
3-5 Revised view of mitochondrial gene regulation during
early development of Xenopus laevis 99
4-1 General scheme for in vivo DNA footprinting 117
4-2 In organello footprint of the promoter region 122
4-3 In organello footprinting of the D-loop upstream region 124
vi


49
WH 529. 21 base oligonucleotide CAG CAG ACA CAT CTA TAG
CCT. Corresponds the L-strand sequence 16418-16438 in the Cyt b
gene.
WH 530. 20 base oligonucleotide GTG TAT CTG CAA CTA GGG
CT. Corresponds to the H-strand sequence 17226-17245 in the Cyt b
gene
WH 534. 20 base oligonucleotide ACT TCA CTT CCA CGA CCA
TA. Corresponds to the L-strand sequence 9168-9187 in the Cox II
gene.
WH 535. 20 base oligonucleotide CTA GTA TTG ATG AAG ATC
AG. Corresponds to the H-strand sequence 9771-9790 in the Cox II
gene.
WH 536. 20 base oligonucleotide GAT CCT CCT AGC AGT AGC
AT. Corresponds to the L-strand sequence 4849-4868 in the ND1
gene.
WH 537. 20 base oligonucleotide GTT ATG GCT AGT GTG ATT
GG. Corresponds to the H-strand sequence 5696-5715 in the ND1
gene.
WH 538. 21 base oligonucleotide CTC ACT TCT CAA ACT ACC
TTA. Corresponds to the L-strand sequence 12409-12429 in the ND4
gene.


144
eggs and distinct developmental stages were processed for in vivo
footprinting, along with protein-free mtDNA from unfertilized eggs
methylated in vitro as controls. The results of such an in vivo
footprint analysis for the L-strand of mtDNA at the mTERF region are
shown in Figure 4-10. Compared to the methylation pattern of
naked DNA (control lanes), protected residues were detected in the
unfertilized eggs (egg) at residues 4732, 4736, 4742, and 4743. The
embryonic stages also showed similar protections at the same
residues, with no discernible differences between the stages when
transcription was basal (6.5 hr) or activated (34.5 hr, 56.5 hr, 60 hr).
Footprinting at the mTERF region on the H-strand is shown in
Figure 4-11. Strong hypersensitive sites were readily detected at
positions 4744 and 4745 (flanking the tridecamer sequence), both in
the unfertilized egg and all the embryonic stages. This residue was
seen to be hypersensitive even in the ovary mtDNA by in organello
footprinting (Figure 4-8). The hypersensitive band at 4745 must be
due to methylation and cleavage of the A residue at 4745 (Figure 4-
9), or it could be a polymorphic G residue in the frogs being analyzed,
as there is no corresponding G residue in the published X. laevis
sequence of Roe et al. (1985). It should be noted that there were


232
after fertilization and remains at this low level till late neurula
before it is activated again. These results, especially the suggestions
of active transcription in the egg and a fertilization-induced arrest of
the mtDNA genome, are in direct contradiction to earlier studies.
In order to clarify these issues and re-evaluate this natural model
for studying mitochondrial gene regulation, steady state levels of
mitochondrial RNA during early development of Xenopus laevis were
analyzed by Northern hybridization, using total egg/embryonic RNA
or mitochondrial RNA (Chapter 3). Using protocols similar to the ones
used by Meziane et al. (1989) for analysis of mitochondrial RNAs in
the context of total egg/embryonic RNA, I could not reproduce their
reported pattern of regulation. Instead, more or less constant levels
of mitochondrial mRNAs (six different mRNA species) in distinct
embryonic stages were observed, with a 2-fold decrease in the levels
of 3 transcripts (ND4, ATPase 6, Cyt b) by 14 hours of development.
The coordinate decrease (5-10 fold) in mRNA levels post-fertilization
observed by Meziane et al. (1989) was not seen in repeated
experiments. In considering this discrepancy between labs, it
became apparent that the spectroscopic normalization employed by
Meziane et al. (1989) was not suitable for the analysis of steady state


226
suggesting that the process of making ATP, rather than the absolute
levels of this nucleotide, was mediating this effect. The importance
of maintaining normal oxidative phosphorylation was further shown
by the addition of antimycin A, a drug which inhibits electron
transfer from cytochrome b to c,, along with the substrates. Labeling
of RNA was markedly reduced compared to the reactions without
this drug (Figure 5-7A & B). Atractyloside, a drug which inhibits
ATP/ADP transport by the adenine nucleotide translocase, also
inhibited RNA labeling (Figure 5-7A & B). These results suggest that
mitochondrial transcription is responsive to rapid changes in
mitochondrial metabolism. This transcriptional response is rapid,
reaching maximum rates within 5 minutes of the addition of the
substrates (preliminary kinetic data, not shown). Addition of these
substrates to similar run-on reactions using mitochondria from a
transcriptionally more active stage like the 48 hr tadpole did not
cause any significant stimulation of transcription rates (preliminary
data, not shown), suggesting that the biochemical environment of the
20 hr stage was not conducive for active oxidative phosphorylation,
and that the 48 hr stage was more active.


Figure 5-5. Comparison of mitochondrial transcription rates and steady state levels of
mitochondrial transcripts during early development of X. laevis. A schematic comparison of
transcription rate and transcripts levels during early development is presented. The line graph
represents the general pattern of steady state levels of mitochondrial transcripts observed in this study
(discussed in Chapter 3 and shown in Figure 3-5). The bar graph represents the overall mitochondrial
transcription rates measured in the corresponding developmental timepoints using mitochondria
isolated from distinct developmental stages (Figure 5-4B). The transcription rate and transcript levels
shown on the respective Y-axes are expressed as fold over the levels found in the unfertilized eggs.


Figure 3-[...continued
m i
Egg
m t.mm
5 hr
mrn
14 hr
l ¡ 3t #
20 hr
m
30 hr
% m 4
38 hr
MPV
50 hr
9 L


150
abundance of human mTERF in mitochondrial lysates was adapted to
Xenopus mitochondria. S-13 (13,000 x g supernatant) mitochondrial
protein extracts were prepared by lysis of isolated mitochondria
from eggs or embryos using Tween 20 as described in Materials and
Methods. The probe used for these assays was a radiolabeled 52 bp
dsDNA with the tridecamer mTERF sequence 5-TGGCAGAGCCTGG-3
centered in it. Band shift assays with 30 ug of S-13 mitochondrial
protein extract (saturates the amount of probe used) prepared from
a 5.5 hr blstula showed a single band shift (Figure 4-12A, compare
lane 1 to lane 2). In order to confirm that the observed band shift
was due to specific binding of the mTERF protein, competition with
specific and non-specific competitors was performed. Competition
was drastic with the cold competitor which was identical to the
radiolabeled probe (wild type), with shifts of 76%, 14% and 4.5% of
controls (lanes 3, 4, 5, and Figure 4-12B) at 1, 20 and 200 fold molar
excess respectively. Competition was less drastic with a cold
competitor bearing one point mutation (A to G) at position 4737
(analogous to the human MELAS mutation at position 3243), with
shifts of 40% and 7.5% of controls (lanes 7, 8 and Figure 4-12B) at 20
and 200 fold molar excess respectively, whereas the competitor at


was done by performing in organello DMS footprinting of ovary
mtDNA. An in vivo DMS footprinting protocol based on DMS
treatment of intact eggs and developing embryos was then
developed (Ammini et al., 1996), based on modifications of the
somatic tissue in organello protocols of Ghivizzani et al. (1993). The
regions footprinted were the promoter region, the region between
the promoters and origin of H-strand replication, and the mTERF
element. In addition, band shift assays were designed to look for the
presence of the mTERF protein in Xenopus mitochondria, as its
presence in X. laevis mitochondria is suspected but not confirmed.
The results of these various experiments, along with my
interpretation of the results and predictions about possible
mechanisms for the developmental regulation of mitochondrial gene
expression, are presented in the following chapters.


201
Figure 5-6...continued


4
incompatibility between mitochondrial and nuclear genetic
backgrounds, often result in cytoplasmic male sterility, causing
infertile pollen (Levings and Brown, 1989).
Mitochondrial DNA
Mitochondrial DNA has the same basic role in all eukaryotes that
contain it: it encodes rRNA and tRNA components of a mitochondrial
protein synthesizing system, which translate a limited number of
mtDNA-encoded mRNAs that code for some of the subunits of key
enzyme systems involved in oxidative phosphorylation. There is
extraordinary variation in the size, structure, organization, and mode
of expression of the mtDNA. They include the gigantic 570-kb circles
of maize (Lonsdale et al., 1984), 46-kb linear molecules of
Tetrahymena (Borst, 1980), 74-85 kb of Saccharomyces cerevisiae
(Zamaroczy and Bernardi, 1986), the extraordinarily complicated
maxicircles of Trypanosoma brucei (Benne, 1985; Simpson, 1987),
and the extremely compact vertebrate mtDNA (16-20 kb). The
existence and structure of vertebrate mtDNA was established more
that 25 years ago. In all vertebrate systems studied to date, mtDNA
is a closed circular duplex species of approximately 16-18 kb, which
in many cases contains a triple-stranded region called the
Displacement loop or D-loop (ranging from 0.5-1.7 kb in different


234
1972). When the developmental pattern of mitochondrial RNA
steady state levels was analyzed with reference to the levels of
mtDNA, a pattern consistent with the predictions of the earlier
groups (Chase and Dawid, 1972; Dawid et al., 1985; Young and
Zimmerman, 1973) emerged. The steady state levels of all
mitochondrial RNAs analyzed (six mRNA species) were basal in the
unfertilized eggs and in the embryos upto 10 hours of development,
after which the levels increased to ~4 fold by 20 hr, 6-8 fold by 20
hr, and peaked at 20-28 fold over egg levels by 48 hours of
development. After 7 days of development, transcript levels had
dropped again to levels comparable to that in the 30 hr stage (6-8
fold over egg), suggesting a stabilization of transcript levels. The
levels of the two ribosomal RNAs also followed similar trends, albeit
at lower levels of induction.
The coordinate pattern of regulation of the abundance of
mitochondrial mRNA and rRNA during early development of X. laevis
suggests that the primary determinant of the steady state levels
could be mitochondrial transcription itself. This suggestion was
confirmed by measuring mitochondrial run-on transcription rates in
organello using mitochondria isolated from unfertilized eggs or


%

UNIVERSITY OF FLORIDA
3 1262 08554 9334


5
species) at a specific location in the genome. Early studies on the
mode of mtDNA replication revealed that each strand of the duplex
could be distinguished on the basis of G+T base composition: a bias in
composition results in different buoyant densities of each strand
('heavy' or H-strand and 'light' or L-strand) in alkaline cesium
chloride gradients.
The most striking feature of vertebrate mtDNA is its extremely
compact gene organization which allows it to encode information for
37 known genes. The major coding strand (the H-strand) contains 28
genes: two rRNAs, 14 tRNAs, and 12 proteins. The L-strand encodes
8 tRNAs and one protein. The 13 proteins include seven subunits of
NADH dehydrogenase (ND 1, 2, 3, 4, 4L, 5, 6), three subunits of
cytochrome c oxidase (COX 1, 2, 3), twp subunits of ATP synthase
(ATPase 6, 8), and the apocytochrome b (Cyt b). In most cases, these
genes abut each other or are separated by only a few nucleotides,
and there are no introns, the only noncoding stretch being in the D-
loop control region housing the transcription and replication
elements. Almost all reading frames lack significant nontranslated
flanking regions (Montoya et al., 1981), and most of them lack even a
complete termination codon, ending instead with either a T or TA
following the last sense codon. In these cases, completion of the


1.-STRAND
Frog 1
Frog 2
O u. u J2 JZ
c eo U-)
O CO ^ 1/1 rf >
U t N M IO
1871
s*3
f". -- 1991
2013
- 2026
2037
2046
2064
2076


220
amino acids from the similarly abundant yolk reserves as general
catabolic and anabolic carbon sources (Dworkin and Dworkin-Rastl,
1991), as suggested by the low respiratory quotient (the ratio of CO,
output to O, usage) until gastrulation, at which time it approached
one. Mitochondrial glutamate oxidation appears to be the main
energy source until gastrulation, as revealed by comparisons of the
oxidation of exogenously supplied glutamate and pyruvate (Lovtrup-
Rein and Nelson, 1982b) and measurements of mitochondrial
respiration in isolated organelles from developing embryos, in which
only glutamate (of many substrates tested) efficiently supported
oxygen consumption (Lovtrup-Rein and Nelson, 1982a).
Another interesting discovery was that Xenopus embryos are not
normally glycolytic during early cleavage, even though abundant
carbohydrate (glycogen) reserves exist and the glycolytic machinery
is intact, as shown by the activation of glycolysis when oxidative
phosphorylation is inhibited by the uncouplers dinitrophenol or
carbonyl cyanide phenylhydrazone (Thomas and Gerhart, 1979;
Dworkin and Dworkin-Rastl, 1989; 1990). Whether the onset of
active glycolysis at gastrulation (when morphological differentiation
starts) has a developmental purpose is not known at this time.


176
4-12A & B) and obtain comparative estimates of its relative
abundance in the mitochondria of distinct developmental stages.
These assays showed the functional levels of the mTERF protein to be
relatively constant during this time of development (Figure 4-13A &
B), regardless of the transcriptional status of the mitochondria.
These findings provide some additional insights into the in vivo
prevalence and role of this important mitochondrial protein. Its
constant level in mitochondria and constitutive occupancy of mtDNA
are surprising observations which pose more questions than answers
regarding the in vivo role of mTERF. In in vitro assays, this protein
is necessary and sufficient for termination of transcription (Shang
and Clayton, 1994). Whether the same holds true in vivo remains an
open question at this time. The localized distortion of the DNA
structure induced by mTERF might pause the RNA polymerase,
leading to transcriptional termination in some cases, thereby
allowing selective rRNA amplification. Occasional readthrough would
allow the expression of the downstream genes. These studies,
however, do not pinpoint the exact molecular mechanism of
termination or readthrough. It is possible that termination and
readthrough might involve interaction of other proteins or the


247
The mode of footprinting revealed the possibility of localized
alterations in DNA structure at this cis element in vivo, consistent
with its ability to bend DNA in in vitro assays (Shang and Clayton,
1994). However, the most significant observation was that this
protein seems to occupy its binding site in a constitutive manner, not
varying its level of occupancy during both basal and activated
transcriptional activity in the mitochondria of Xenopus eggs and
embryos. These results suggest the simple idea that mTERF
occupancy is always maintained in these cells, posing a physical
roadblock to the elongating RNA polymerases, with the level of
transcription primarily determining the transcript levels of the
rRNAs.
In conclusion, the current study highlights the importance of
mitochondrial metabolic status in the regulation of mitochondrial
gene expression. Since the mtDNA exists in a milieu of rapidly
fluctuating biochemical environments, any study of nucleic acid
metabolism should also take into consideration the effects of changes
in the concentrations of metabolic intermediates, which could, either
directly or indirectly, affect the transcriptional and replicational
machinery.


97
appears to be activated in the embryo, leading to higher rates of
mtRNA synthesis. The post-fertilization drop in steady state levels
(Figure 3-5, dotted line) seen by Meziane et al. (1989) appears to be
an artifact introduced by the method of normalization used.
Based on these results, a revision of current thinking about
mitochondrial gene regulation during early development of Xenopus
laevis is warranted. In the revised view, transcript levels are at a
basal level until 10 hours of development, after which there is a
steady increase in transcript levels, probably as a result of the
resumption of active transcription in the embryo (Figure 3-5, solid
line). During this time, there is no increase in the mtDNA levels
(Chase and Dawid, 1972). Hence, this represents a true regulation of
gene expression at the level of transcription. Differences in mRNA
turnover could also be a factor influencing these levels, but is
unlikely to be the major determinant because mitochondrial
transcription rates measured in a run-on transcription assay
correlated well with the changes in steady state levels (discussed in
Chapter 5).
This study further accentuates the value and importance of the
early embryogenesis model of Xenopus laevis for understanding the


71
resolved the RNA on formaldehyde agarose gels, blotted them onto
nylon filters, and probed them with gene-specific DNA probes. They
found that the levels of all mitochondrial mRNAs decreased abruptly
within a few hours after fertilization (by a factor of 5-10), remained
at a very low level up to the late neurula stage (24 hours of
development), and increased again during organogenesis. However,
the levels of mitochondrial rRNAs remained essentially constant
during early development. On the basis of these data, they suggested
that the mitochondrial genome was completely inactivated at
fertilization and during early embryonic development and that the
reactivation of mitochondrial transcription in the developing embryo
was decoupled from active DNA replication, since the mtDNA levels
do not vary during this time (Chase and Dawid, 1972).
The early part of the results obtained by Meziane et al. (1989) are
in direct contradiction of the studies reported by the earlier groups.
Chase and Dawid (1972) did not find any evidence for differences in
mtRNA synthesis rates in unfertilized eggs vs. early embryos. Dawid
et al. (1985) found increased incorporation of microinjected [32P]GTP
into mtRNA only after the mid-blastula transition (after 7 hours of
development). In all these studies, increasing rates of mtRNA


Free label was removed by two sequential ethanol precipitations in
the presence of 2.5 M ammonium acetate.
Optimization of Primer extension reaction conditions.
Preliminary experiments indicated that about one tenth of the
piperidine cleaved DNA sample (about 50-100 ng) was sufficient for
obtaining a useable primer extension signal. Increasing primer
concentration beyond 1 picomole per reaction did not further
enhance signal intensity and led to higher background. The results
of an experiment designed to determine the number of linear
amplification cycles necessary to obtain reproducible results are
shown in Figure 2-1. Amplifying for 10-15 cycles provided adequate
signal intensity, whereas non-specific bands began to appear with a
higher number of cycles (compare lanes 3 and 4 with lanes 6 and 7).
It is important to note that some of the non-specific bands appearing
with higher cycles are 1-2 nucleotides longer than the authentic
bands, suggesting that the Taq DNA polymerase was adding non-
templated nucleotides to the 3' end of duplex DNA (Clark, 1988)
made in earlier cycles. Thermostable polymerases having a 3'-5'
proofreading ability, such as Vent DNA polymerase or Pfu DNA
polymerase, have been used to alleviate this problem in ligation-
mediated PCR (LMPCR) footprinting protocols (Garrity and Wold,


9
element. Interestingly, efficient hybrid formation was influenced by
sequences 5 to the hybrid, including the CSB III element. In
structural studies of this RNA-DNA hybrid, Lee and Clayton (1996)
found the R-loop to be exceptionally stable, with extensive
intrastrand folding, suggesting that the RNA strand in the RNA-DNA
is organized into a specific conformation, which may have important
implications for RNA processing in vivo. These newly discovered
features of H-strand priming increase the analogy between mtDNA
replication and ColEl plasmid replication. In the ColEl plasmid origin
of replication, a stretch of six rG residues in the primer RNA,
hybridized to a distant downstream region of template strand dCs at
the ColEl origin, is of fundamental importance in forming primer 3
ends by stabilizing an RNA-DNA hybrid duplex site recognized by
RNase H (Masukata and Tomizawa, 1990).
After priming occurs in the CSB region, DNA replication either
proceeds to completion or terminates prematurely 500 to 1800
nucleotides (depending on the vertebrate species) downstream
(Gillum and Clayton, 1978; Dunon-Bluteau and Brun, 1987), creating
the triple DNA structure known as the Displacement loop (D-loop),
one of the enduring mysteries of mitochondrial molecular biology
(Kasamatsu et al., 1971; Brown and Vinograd, 1974; Clayton, 1982).
The in vivo role of the D-loop is not understood in any system.


6
termination codon TAA occurs post-transcriptionally by
polyadenylation of the mRNAs (Ojala et al., 1981).
Mitochondrial DNA Replication
The mechanism of vertebrate mtDNA replication has been studied
primarily in cultures of human and mouse cells, yeast, rat liver, and
is understood in considerable detail. In 1973, Berk and Clayton,
using mouse L cell lines lacking the cytoplasmic thymidine kinase
but retaining the mitochondrial enzyme, which allowed selective
radiolabeling of mtDNA, showed that mtDNA replication continues
throughout the cell cycle, doubling at about the same rate as the cell,
with mtDNA molecules being selected at random for replication. This
phenomenon forms the basis of replicative segregation of
heteroplasmic genotypes.
There are two separate and distinct origins of replication for each
strand. The origin of H-strand synthesis (0H) is located within the
non-coding D-loop region of the genome (Robberson and Clayton,
1972; Brown and Vinograd, 1974; Robberson et ah, 1974; Tapper and
Clayton, 1981), whereas the origin of L-strand synthesis (Ol) is
nested within a cluster of five tRNA genes located several kilobases
away from the 0H (Martens and Clayton, 1979). A commitment to
mtDNA replication begins by the initiation of H-strand synthesis that


B.
c
o
U
SR
"O
c
c3
m
120-
1 oo
Wild type Single mutant Triple mutant
Molar excess of cold competitor
UJ
Figure 4-12...continued


insert as a single copy by digesting with Hind III and BamHI (BRL)
which flank the Hindi site. Positive clones were amplified in a large
scale culture and DNA isolated and purified by either CsCl gradients
(Maniatis et al., 1989) or Wizard maxi-prep columns (Promega
Corporation).
pBSLSP. This plasmid (3405 bp) contains the frog mitochondrial
sequence 3631-3832 in the corrected sequence of Dunon-Bluteau et
al. (1985). This stretch of DNA (amplified with primers WH354 &
WH355) is cloned in the reverse orientation and contains all the
promoter elements in the D-loop region (including LSP 1 & 2 and HSP
1 & 2). Strand-specific riboprobes made from this clone were used
to probe in organello footprint Southern blots of the promoter region
using the Avail site at 3836 as reference.
pBSCSB. This plasmid (3404 bp) contains the frog mitochondrial
sequence 3187-3387 in the corrected sequence of Dunon-Bluteau et
al. (1985). This stretch of DNA (amplified with primers WH357 &
WH 358) is cloned in the forward orientation and contains the two D-
loop 5' start sites, and the conserved sequence box 1 (CSB 1).
Strand-specific riboprobes made from this clone were used to probe
in organello footprint Southern blots of the CSB region using the
Haelll site at 3187 as reference.


206
were used to probe a hybridization target panel of strand-specific
riboprobes and autoradiographed (Figure 5-7A).
Addition of exogenous ATP (bar 2 in Figure 5-7B) stimulated the
overall mitochondrial transcription rate -5 fold over the levels in
basic buffer (bar 1). Production of ATP endogenously (bar 3) further
stimulated the transcription rate (8.2 fold over basic buffer). The
inhibitors were added to this three-component system (treatment 3)
before initiating the run-on reaction. Addition of antimycin A, a
respiratory chain poison which blocks electron transfer from
cytochrome b to cytochrome c,, caused a 3.5 fold drop in rates from
that of treatment 3 (bar 3), giving a net transcription rate of 2.3 fold
(bar 5) over that of the basic buffer (bar 1). Addition of
atractyloside, an inhibitor of the adenine nucleotide translocase,
caused a 4.3 fold drop in transcription rates from that of treatment 3
(bar 3), giving a net transcription rate of 1.9 fold (bar 6) over that of
the basic buffer (bar 1). Actinomycin D, an inhibitor of mitochondrial
transcription by intercalation into DNA, almost completely abrogated
transcription (bar 4). The residual labeling seen with this drug
probably represents labeling before the drug could penetrate the
mitochondria and intercalate into mtDNA. It should be noted that


161
revealed a close correspondence between the two binding patterns,
suggesting that the in vivo footprints seen in this region of mtDNA
are primarily due to the xl-mtTFA protein. A similar scenario has
been reported for human mitochondria, where the in vitro binding
patterns of h-mtTFA closely matched the in vivo footprint pattern in
the D-loop upstream region (Ghivizzani et al., 1994; Fisher et al.,
1992). The situation is likely to be similar in yeast (Diffley and
Stillman, 1991; 1992), although direct in vivo evidence is not
available as yet. Therefore, the phased binding of mtDNA by the
mitochondrial transcription factor seems to be a phenomenon
conserved from yeast to man.
The extensive protein-DNA interactions detected by in organello
footprinting appeared to be specific to the D-loop upstream region.
No footprints were detected in other regions of Xenopus mtDNA like
the origin of L-strand DNA replication (data not shown), over
substantial regions of mtDNA (Figures 4-9 and 4-10) surrounding the
recognition sequence for the mitochondrial transcription termination
factor (mTERF), and in regions upstream of the 3 end of the D-loop in
the putative termination associated sequence or TAS element (data
not shown). Similar observations were made in human mitochondria


106
promotion of transcription initiation occurs over a broad range of h-
mtTFA concentrations (Dairaghi et al., 1995). Addition of increasing
amounts of the protein initially stimulated the LSP until a maximal
level of specific initiation was reached at a ratio of 1 h-mtTFA
molecule per 230 bp of template. A decrease in LSP transcription
began between ratios of 1 mtTFA molecule per 230 and 23 bp
template. Complete inhibition of LSP transcription occurred at higher
levels. Antoschechkin and Bogenhagen (1995) observed a similar
effect of varying levels of xl-mtTFA on transcription efficiency in an
in vitro transcription system with Xenopus mtDNA templates. The
range of concentrations at which xl-mtTFA stimulated the
mitochondrial promoters was quite narrow. In vitro transcription
was almost completely abolished at protein concentrations only five
times higher than that required for maximal stimulation. These
effects of xl-mtTFA on altering DNA conformation and transcription
efficiency had been studied by earlier workers (Mignotte and Barat,
1986; Mignotte et al., 1988; 1990) using an abundant mitochondrial
protein which they called mtDNA binding protein-C (mtDBPC). It was
not known at that time that this protein was the mitochondrial
transcription factor. In fact, it was characterized as an inhibitor of


16 S rRNA
H-STRAND ....
PROMOTER
4707
1RNA
leu
4730
4762
4778
Tf TT T?
L-strand GCCCAAGATTAGGGCTAGCTAGCGTOGCAGAGCCTG(XTAATGCX3AAAGACCTAAGCTCTTTTTATCAGGG3¡rpC
H-strand CGGGTTCTAATCCCGATCGATCGCACCX3TCTCX3GACCGATTACGCTTTCTGGATTCGAGAAAAATAGTCC0GAA3
1 A A 1
mTERF binding site


262
maternal mRNAs: association with the portion of Eg2 mRNA that
promotes deadenylation in embryos. Development 116:1193-1202.
Levings, C.S. Ill, and G.G. Brown. 1989. Molecular biology of plant
mitochondria. Cell 56:171-179.
Li, K., Smagula, C.S., Parsons, W.J., Richardson, J.A., Gonzalez, M.,
Hagler, H.K. and R.S. Williams. 1994. Subcellular partitioning of MRP
RNA assessed by ultrastructural and biochemical analysis. J. Cell Biol.
124:871-882.
Lilley, D.M.J. 1992. HMG has DNA wrapped up. Nature 357:282-
283.
Lonsdale, D.M., Hodge, T.P., Fauron, C.M. 1984. The physical map and
organization of the mitochondrial genome from the fertile cytoplasm
of maize. Nucleic Acids Res. 12:9249-9261.
Lopez, M.C., Smerage, J.B., and H.V. Baker. 1993. A simplified
vacuum method for genomic sequencing and in vivo footprinting.
BioTechniques 15:362-363.
Lorimer. H.E., Brewer, B.J., and W.L. Fangman. 1995. A test of the
transcription model for biased inheritance of yeast mitochondrial
DNA. Mol. Cell. Biol. 15:4803-4809.
Lou, J.. Anderson, S.L., Xing, L., and B.Y. Rubin. 1994. Suppression of
mRNA levels and mitochondrial function in cells responding to the
anti-cellular action of interferon. J. Interferon Res. 14:33-40.
L(|>vtrup-Rein, H., and L. Nelson. 1982a. Changes in energy
metabolism during the early development of Xenopus laevis. Exp.
Cell Biol. 50:162:168.
L<)>vtrup-Rein, H., and L. Nelson. 1982b. Changes in mitochondrial
respiration during the development of Xenopus laevis. Cell Differ.
11: 125-133.


CHAPTER 2
MATERIALS AND METHODS
Frogs
Sexually mature male and female Xenopus laevis frogs were
purchased from Xenopus I, Ann Arbor, Michigan, and maintained in
separate tanks using standard procedures (Wu and Gerhart, 1991).
DNA Primers
Primers were synthesized by the DNA synthesis core, ICBR,
University of Florida, and gel purified where necessary using
standard procedures (Maniatis et al., 1989).
Laboratory Fertilization of Eggs
Fertilized embryos were obtained using the in vitro fertilization
procedure of Hollinger and Corton (1980). The female frogs were
injected with 700-1000 U HCG (Sigma CG-5; reconstituted in water at
1000 U/ml and stored at 4C for 3-4 weeks) into the peritoneal
cavity 10 hrs before eggs were required and placed into white
buckets with about 2 liters of lx OR-2 (lOx OR-2 is 825 mM NaCl, 25
25


112
the leucyl-tRNAUUR function or stability. A small but consistent
increase (less that 2-fold) in the steady-state levels of a partially
processed RNA transcript (RNA19), corresponding to a contiguous
copy of the 16S rRNA + tRNAlcu (UUR)+ ND1 genes, was detected in cells
containing almost entirely mutated mtDNA (King et al., 1992). This
has led to a model in which RNA 19 could be incorporated into
ribosomes, rendering them functionally deficient (Schon et al., 1992).
But this model still remains speculative, without any direct proof of
defective ribosomes.
Shang and Clayton (1994) undertook a detailed in vitro
characterization of mTERF. Using purified human mitochondrial
mTERF, they found that the protein terminated transcription
elongation by heterologous RNA polymerases (T3, T7, E. coli, or yeast
mitochondrial RNA polymerases), although termination of these
heterologous polymerases was detected only in the transcription
polarity opposite that of mitochondrial rRNA synthesis (HSP driven).
The efficiency of termination in the homologous human RNA
polymerase system was approximately 2-fold greater in this same
opposite polarity (Shang and Clayton, 1994). If these phenomena can
be shown to operate in vivo, it would provide a mechanism for the


261
King, M.P., Koga, Y., Davidson, M., and E.A. Schon. 1992. Defects in
mitochondrial protein synthesis and respiratory chain activity
segregate with the tRNA (Leu (UUR)) mutation associated with
mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke
like episodes. Mol. Cell. Biol. 12:480-490.
Kiss, T. and W. Filipowicz. 1992. Evidence against a mitochondrial
location of the 7-2/MRP RNA in mammalian cells. Cell 70:11-16.
Kruse, B., Narasimhan, N., and G. Attardi. 1989. Termination of
transcription in human mitochondria: identification and purification
of a DNA binding protein factor that promotes termination. Cell
58:391-397.
Kubota, H.Y., Yoshimoto, Y., Yoneda, M., and Y. Hiramota. 1987. Free
calcium wave upon activation in Xenopus eggs. Dev. Biol. 119:129-
136.
LAbbe, D., Duhaime, J.-F., Lang, B.F., and R. Moris. 1991. The
transcription of DNA in chicken mitochondria initiates from one
major bi-directional promoter. J. Biol. Chem. 266:10844-10850.
Laipis, P.J., Van de Walle, M.J., and W.W. Hauswirth. 1988. Unequal
partitioning of bovine mitochondrial genotypes among siblings. Proc.
Natl. Acad. Sci. USA 85:8107-8110.
Lang, W.H., Morrow, B.E., Ju, Q., Warner, J.R., and R.H. Reeder. 1994.
A model for transcription termination by RNA polymerase I. Cell
79:527:534.
Lang, W.H., and R.H. Reeder. 1995. Transcription termination of RNA
polymerase I due to a T-rich element interacting with Reblp. Proc.
Natl. Acad. Sci. USA 92:9781-9785.
Lee, D.Y. and D.A. Clayton. 1996. Properties of a primer RNA-DNA
hybrid at the mouse mitochondrial DNA leading-strand origin of
replication. J. Biol. Chem. 39:24262-24269.
Legagneux, V., Bouvet, P., Omilli, F., Chevalier, S., and H.B. Osborne.
1992. Identification of RNA-binding proteins specific to Xenopus Eg


231
However, there is some confusion in the literature among the limited
number of studies in this field regarding the precise pattern and
timing of the resumption of mitochondrial transcription. Chase and
Dawid (1972). reported that active mitochondrial rRNA synthesis
begins at gastrulation (10 hours post-fertilization), using 14C
incorporation. Dawid et al. (1985), using microinjection of [32P]GTP
into fertilized eggs, detected mitochondrial RNA labeling shortly after
the mid-blastula transition (after 7 hours post-fertilization). Young
and Zimmerman (1973) reported similar phenomena using
disaggregated embryos of Xenopus laevis. However, Meziane et al.
(1989), using Northern analyses of mitochondrial transcripts from
distinct developmental stages, reported a pattern of transcriptional
regulation which differed somewhat with the three earlier studies.
They found that the levels of all mitochondrial mRNAs decreased
abruptly within a few hours after fertilization (by a factor of 5-10),
remained a very low level up to the late neurula stage (24 hours of
post-fertilization), and increased again during organogenesis. The
levels of the rRNAs, however, remained essentially constant during
this time. Hence, their results suggest that active mitochondrial
transcription in the unfertilized eggs becomes arrested a few hours


DNA. These mitochondria are partitioned into cleaving cells during
early embryogenesis, with production of new mitochondria occurring
only after two days of fertilization (Chase and Dawid, 1972).
Therefore, active mtDNA replication does not occur in the fully
developed oocyte and in the developing embryos until relatively late
in development (Chase and Dawid, 1972; Webb and Smith, 1977).
However, early studies suggest that transcription of mtDNA is
activated soon after fertilization, long before active synthesis of
mtDNA starts, suggesting a decoupling of mitochondrial transcription
and replication (Chase and Dawid, 1972; Young and Zimmerman,
1973; Dawid et al., 1985). Meziane et al. (1989) reported further
proof for active regulation of mitochondrial gene expression by
performing Northern analyses of mitochondrial transcripts during
early development. They found high levels of transcripts in the
unfertilized eggs and post-neurula stages (after 1 day post
fertilization), with 5- to 10-fold lower levels between 6 and 24 hours
of development. Based on these results, they suggested, contrary to
the findings of the earlier groups, that a fertilization induced
shutdown of mitochondrial transcription occurs in X. laevis, with
active transcription resuming only late during embryogenesis.
However, all four groups agree that resumption of active
mitochondrial transcription appears to be decoupled from active


100
molecular basis of mitochondrial gene regulation. It is one of the few
natural models available for studying control of gene expression in
mitochondria without chemical, physical, or hormonal interference.
Since active replication of mtDNA does not occur in the first 48 hours
of development, regulation of gene expression without the additional
complexity of changes in gene dosage can be directly studied.


Figure 3-5. Revised view of mitochondrial gene regulation during early development of
Xenopus laevis. Based on the data shown in Table 3-3 and Figure 3-4, a revised picture of
mitochondrial gene regulation during embryogenesis of Xenopus laevis is presented. The dotted line
represents a summary of the data reported by Mczianc el til. (1989). They found a 5-10 fold reduction
in mitochondrial mRNA levels 5-8 hours after fertilization. This low level was maintained till the late
neurula stage (25-28 hours post-fertilization), after which the levels increased again. When the mtRNA
levels were normalized to the mtDNA levels in each stage (Figure 3-3, Figure 3-4, and Table 3-3), a
different picture emerged (solid line). There were no difference in steady state levels of six different
mitochondrial mRNAs till 9 hours of development, after which a steady increase was noted. The levels
of most mRNAs reached -4 fold over egg levels by 20 hours, ~8 fold by 30 hours, and 20-28 fold by 48
hours of development. After this time, the steady state levels seem to stabilize to a lower but
significant 6-8 fold over egg levels by another 5 days of development. The high levels observed by
Meziane et al. (1989) seems to be an artefact of inaccurate normalization. This revised pattern of
mitochondrial gene regulation (solid line) corroborates the predictions made by earlier workers (Chase
and Dawid, 1972; Young and Zimmerman, 1975; Dawid et al., 1985) using more indirect methods.


3 1
WH353. 21 base oligonucleotide TAA CCA TAA AAT ATG CTA
AGT. Corresponds to mitochondrial H-strand sequence 1725-1705 in
the sequence correction by Dunon-Bluteau et al., (1985), and
incorporating the changes listed in Cairns and Bogenhagen (1986).
WH354. 21 base oligonucleotide CCC ATG TTA TAC ATT TTT
GTA. Corresponds to mitochondrial L-strand sequence 2008-2028
(Roe et al., 1985).
WH355. 21 base oligonucleotide CCT TTA TGC TTT CGG AGC
TTT. Corresponds to H-strand sequence 3832-3812 (Dunon-Bluteau
et al., 1985).
WH356. 21 base oligonucleotide AAT CTG TTG TGA CCT TAA
CCT. Corresponds to L-strand sequence 3073-3093 (Dunon-Bluteau
et al., 1985).
WH357. 21 base oligonucleotide CTT CAT GTT TTT TTT TTT TCT.
Corresponds to L-strand sequence 3187-3207 (Dunon-Bluteau et al.,
1985).
WH358. 21 base oligonucleotide GTG GAT AAT AAT AGG AAA
GCT. Corresponds to H-strand sequence 3387-3367 (Dunon-Bluteau
et al., 1985).
WH359. 21 base oligonucleotide AGG GCT AGC TAG CGT GGC
AGA. Corresponds to L-strand sequence 4717-4737 (Roe et al.,
1985).


215
later embryonic stages). Slightly increased rates (4-6 fold over egg)
were measured for the 14 hr and 20 hr embryos. The steady state
level of transcripts in the 20 hr embryo was -4 fold over egg levels
(Table 3-3 and Figure 5-5). Embryos at 28 hr post-fertilization
showed a dramatic increase (Figure 5-5) in overall transcription rate
(70 fold over egg). In comparison, the transcript levels of the 30 hr
embryo were 6-8 fold over egg levels, with an apparent rapid
accumulation of transcripts in the next several hours of development,
as the 48 hr embryo showed a dramatic increase (20-28 fold over
egg) in transcript levels (Table 3-3 and Figure 5-5).
Based on a comparison of the marked stimulation of transcription
rate in the 28 hr embryo and the high steady state levels measured
in the 30 hr and 48 hr embryos (6-8 fold and 20-28 fold over egg
respectively), I suggest that mitochondrial transcription is actively
resumed in the developing embryo sometime between 20 and 28
hours of development. This sudden burst of active transcription
could be responsible for the huge accumulation of mitochondrial
transcripts (20-28 fold over egg) seen at 48 hours of development.
The data also suggest that the sudden burst of transcription
modulates between 28 and 48 hours of development, because the


Figure 3-2. Steady state levels of mitochondrial RNA isolated from purified mitochondria
during early development of Xenopus laevis. Mitochondrial RNA was isolated from sucrose-
gradient purified mitochondria prepared from unfertilized eggs and embryonic stages at 13, 22, and 43
hours post-fertilization. 0.5 ug of RNA from these distinct stages were run on 1.2% formaldehyde-
agarose gels, blotted on nylon N+ membranes, hybridized with gene-specific riboprobes synthesized by
in vitro transcription from linearized clones, washed, and exposed to x-ray film or phosphorimager
(described in Materials and Methods). Each lane (labeled accordingly) corresponds to the respective
mRNA or rRNA level in the corresponding developmental stage. Panel A: ND1 mRNA; Panel B: ND4
mRNA; Panel C: ND6 mRNA; Panel D: Cyt b mRNA; Panel E: CO II mRNA; Panel F: 16S rRNA. The complex
pattern of bands seen in panels F represent multiple products corresponding to the 16S sequence, and is
found in ribosomal RNA blots from other animal systems (see text).


271
Wahli, W., Dawid, I.B., Ryffel, G.U., and R. Weber. 1981.
Vitellogenesis and the vitellogenin gene family. Science 212:298-
304.
Walberg, M.W. and D.A. Clayton. 1981. Sequence and properties of
the human KB cell and mouse L cell D-loop regions of mitochondrial
DNA. Nucleic Acids Res. 9:5411-5421.
Wallace, D.C. 1993. Mitochondrial diseases: genotype versus
phenotype. Trends Genet. 9:128-133.
Watanabe, F., Kamiike, W., Nishimura, T., Hashimoto, T., and K.
Tagawa. 1983. Decrease in mitochondrial levels of adenine
nucleotides and concomitant mitochondrial dysfunction in ischemic
rat liver. J. Biochem. Tokyo. 94:493-499.
Webb, A.C., LaMarca, M.J., and L.D. Smith. 1975. Synthesis of
mitochondrial RNA by full-grown and maturing oocytes of Rana
pipiens and Xenopus laevis. Dev. Biol. 45:44-55.
Webb, A.C., and L.D. Smith. 1977. Accumulation of mitochondrial
DNA during oogenesis in Xenopus laevis. Dev. Biol. 56:219-225.
Weinberg, J.M., Davis, J.A., Abarzua, M., and T. Kiani. 1989.
Relationship between cell ATP and glutathione content and
protection against hypoxic proximal tubule cell injury. J. Lab. Clin.
Med. 113:612-623.
Williams, R.S. 1986. Mitochondrial gene expression in mammalian
striated muscle. Evidence that variation in gene dosage is the major
regulatory event. J. Biol. Chern. 261:12390-012394.
Williams, R.S. and W. Harlan. 1987. Effects of inhibition of
mitochondrial protein synthesis in skeletal muscle. Am. J. Physiol.
253:C866-C871.
Wong, T.W., and D.A. Clayton. 1985a. In vitro replication of human
mitochondrial DNA: accurate initiation at the origin of light-strand
synthesis. Cell 42:951-958.


84
by 96 hours of development (Chase and Dawid, 1972). Hence the
perfect macromolecular species to normalize mitochondrial RNA
levels is the mitochondrial DNA itself. This also makes teleological
sense, since it is the template for mitochondrial transcription.
In order to normalize mtRNA levels to mtDNA levels, it is crucial
to isolate DNA and RNA simultaneously using a single method from
the same embryos. If they are isolated in parallel rather than
simultaneously, the chances of introducing additional experimental
errors are increased. Hence, mitochondrial DNA and RNA were
simultaneously isolated from purified mitochondria of distinct
developmental stages using pH 7.0 buffers as described in Materials
and Methods. Equal volumes of the DNA/RNA mixture from each
developmental stage were RNAase treated to remove RNA, alkali
denatured and dot blotted as described in Materials and Methods to
quantitate the level of mtDNA in each sample using a
Phosphorimager. This quantitation was used to approximately
normalize the level of mtDNA in each stock sample to that of the
sample with the lowest amount of mtDNA by adding sterile water.
In control experiments, DNAse I digestion of the same samples prior
to alkali denaturation and dot blotting completely eliminated the


tRNA genes, the steady state levels of the various tRNAs are more or
less similar. Pulse labeling experiments have indicated that this
uniformity may not be due to differences in the metabolic stability of
the mature tRNAs (half-lives longer than 24 h), but may be due to
elimination of excess tRNA transcripts before they enter the mature
pool (Chomyn and Attardi, 1992; King and Attardi, 1993).
Regulation of gene expression can also be pre-transcriptional, at
the level of gene dosage. The number of mtDNA genomes per cell is
variable and has been estimated as >1000 in mouse L-cell fibroblasts
and >8000 in cultured human cells (Bogenhagen and Clayton, 1974;
Robin and Wong, 1988). In some cases, mtDNA is amplified to
extraordinarily high numbers, as in Xenopus laevis oocytes (~108 per
oocyte) due to the large number (107) of organelles per cell (Chase
and Dawid, 1972; Webb and Smith, 1977). Highly oxidative tissues
such as heart muscle contain a significantly greater number of
mtDNA genomes than do the more glycolytic type II skeletal muscles
(Annex and Williams, 1990). Therefore, mtDNA is not just a static
repository of genetic information but is under dynamic control. A
correlation between gene expression and mtDNA copy number has
been reported in a few cases. Williams et al. (1986) studied the
regulation of mitochondrial gene expression during long-term
electrical stimulation of rabbit skeletal muscle, and found the higher


260
Jantzen, H.M., Admon, A., Bell, S.P., and R. Tjian. 1990. Nucleolar
transcription factor hUBF contains a DNA-binding motif with
homology to HMG proteins. Nature 344:830-836.
Kadenbach, B., Goebell, H., and M. Klingenberg. 1964. Differential
action of thyroid hormones on enzyme levels of the DPN and TPN
specific isocitrate dehydrogenase. Biochem. Biophys. Res. Comm.
14:335-339.
Kadenbach, B., Jarausch, J., Hartmann, R., and P. Merle. 1983.
Separation of mammalian cytochrome c oxidase into 13 polypeptides
by a sodium dodecyl sulfate-gel electrophoretic procedure. Anal.
Biochem. 129:517-521.
Kadenbach, B., Kuhn-Nentwig, L., and U. Buge. 1987. Evolution of a
regulatory enzyme: cytochrome-c oxidase (complex IV). Curr. Top.
Bioenerg. 15:113-161.
Kasamatsu, H., Robberson, D.L., and J. Vinograd. 1971. A novel
closed-circular mitochondrial DNA with properties of a replicating
intermediate. Proc. Natl. Acad. Sci. USA 68:2252-2257.
Kim, K.. Lecordier, A., and L.H. Bowman. 1995. Both nuclear and
mitochondrial cytochrome c oxidase mRNA levels increase
dramatically during mouse postnatal development. Biochem. J.
306:353-358.
King, M.P., and G. Attardi. 1988. Injection of mitochondria into
human cells leads to a rapid replacement of the endogenous
mitochondrial DNA. Cell 52:811-819.
King, M.P., and G. Attardi. 1989. Human cells lacking mitochondrial
DNA: repopulation with exogenous mitochondria by
complementation. Science 246:500-503.
King, M.P., and G. Attardi. 1993. Post-transcriptional regulation of
the steady-state levels of mitochondrial tRNAs in HeLa cells. J. Biol.
Chem. 268:10228-10237.


270
Thoman, M., and J.C. Gerhart. 1979. Absence of dorsal-ventral
differences in energy metabolism in early embryos of Xenopus
laevis. Dev. Biol. 68:191-202.
Tominaga, K., Akiyama, S., Kagawa, Y., and S. Ohta. 1992. Upstream
region of a genomic gene for human mitochondrial transcription
factor 1. Biochim. Biophys. Acta 1131:217-219.
Tominaga, K., Hayashi, Kagawa, Y., and S. Ohta. 1993. Smaller
isoform of human mitochondrial transcription factor 1: its wide
distribution and production by alternative splicing. Biochem.
Biophys. Res. Commun. 15:544-551.
Topper, J.N., and D.A. Clayton. 1989. Identification of transcriptional
regulatory elements in human mitochondrial DNA by linker
substitution analysis. Mol. Cell. Biol. 9:1200-1211.
Travis, A., Amsterdam, A., Belanger, C., and R. Grosschedl. 1991.
LEF-1, a gene encoding a lymphoid-specific protein with an HMG
domain, regulates T-cell receptor alpha enhancer function. Genes
Dev. 5:880-894.
Valverde, J.R., Marco, R., and R. Garesse. 1994. A conserved
heptamer motif for ribosomal RNA transcription termination in
animal mitochondria. Proc. Natl. Acad. Sci. 91:5368-5371.
Virbasius, J.V., and R.C. Scarpulla. 1991. Transcriptional activation
through ETS domain binding sites in the cytochrome c oxidase
subunit IV gene. Mol. Cell. Biol. 11:5631-5638.
Virbasius, J.V. and R.C.Scarpulla. 1994. Activation of the human
mitochondrial transcription factor A gene by nuclear respiratory
factors: A potential regulatory link between nuclear and mitochon
drial gene expression in organelle biogenesis. Proc.. Natl. Acad. Sci.
USA 91:1309-1313.
Virbasius, C.A., Virbasius, J.V., and R.C.Scarpulla. 1993. NRF-1, an
activator involved in nuclear-mitochondrial interactions, utilizes a
new DNA-binding domain conserved in a family of developmental
regulators. Genes Dev. 7:2431-2445.


197
By seven days of development, the steady state levels have
dropped to lower levels (6-8 fold over egg) compared to the 48 hour-
tadpole (Figure 3-5). This suggests that after the initial burst of very
active transcription in the developing embryo, transcription returns
to a lower but significant level. Consistent with this suggestion, the
transcription rate measured in the 48 hr embryo was high (36 fold
over egg level) but about 2 fold lower than that of the 28 hr embryo
(72 fold over egg level), suggesting that the transcription activity of
the mitochondria was stabilizing to a lower but significant level after
a burst of synthesis during early embryogenesis.
To attempt to investigate the possible mechanistic differences
among the mitochondria of these distinct developmental stages with
respect to the readiness for transcription, it was hypothesized that at
least part of these differences could be related to the biochemical
composition of the mitochondria at each developmental timepoint.
Extensive footprinting analyses of the mtDNA control regions did not
reveal any differences in protein-DNA interactions during basal or
activated transcription (Chapter 4). Hence it is possible that the
mitochondrial transcriptional apparatus could always be in a state of
readiness during early development. An unknown developmental


67
were modified accordingly to obtain final concentrations of 25 mM
HEPES, pH 7.6, 100 mM KC1, 12.5 mM MgCl2, 1 mM DTT, 12% glycerol.
The samples were gently mixed, spun down briefly, and incubated in
a room temperature water bath for 15 min. After the incubation, the
samples were placed on ice and then loaded onto a 5%
polyacrylamiderbisacrylamide (80:1) gel in Tris-glycine buffer
containing 2.5% glycerol. The gel had been pre-run for at least 2 hr
at 150 volts. Samples on the gel were run at 100-200 volts at room
temperature under conditions which did not heat the gel. After the
run, the gel was transferred to 3 mm paper, dried, and exposed to
film or phosphor screens.
For competition experiments, the specified molar excess of cold
competitors were added to the reactions after a 15 min pre
incubation with the wild type probe.


129
in the packaging of mtDNA in vivo, functionally organizing the
regulatory cis elements in the major control region.
In Vivo Footprinting During Early Development of Xenopus
Once the pattern of footprinting in the D-loop upstream region of
Xenopus mtDNA was established, the stage was set for addressing the
important question of whether differences in protein-DNA
interactions could be detected during the resumption of active
transcription in X. laevis during early embryogenesis. The major
experimental bottleneck encountered, however, was one of
sensitivity where the Southern blotting used in the above
experiments could not detect the footprints generated from 300-400
embryos at each stage. Collecting the embryos from many female
frogs was also not feasible due to inter-animal sequence
heterogeneity. Hence an alternative method to detect the footprint
ladder had to be developed.
Primer extension footprinting (PEF) is a PCR-based innovation
originally described by Saluz and Jost (1989a; 1989b), which was
adapted to Xenopus laevis (Ammini et al., 1996). In this method,
genome-specific primers which provide the reference point (Figure


H-STRAND
Frog
Frog 2
CSB 3
CSB2
L-STRAND
PROMOTER
V
D-loop
5' end
4
D-Loop
5' end 2


184
riboprobes were used to produce cold target probe panels as
described in Materials and Methods (Figure 5-2). Figure 5-2A shows
the approximate genomic location of the four genes used for the
analysis, along with the direction of transcription of the two bi
directional promoters. Figure 5-2B shows six identical ethidium
bromide-stained target probe panels used in the experiment
described in Figure 5-3. The identity and strand-sense of each
transcript are shown above each lane. Lanes 1, 2, and 6 have the L-
strand sense and hence would detect transcripts originating from the
L-strand promoter (LSP), whereas lanes 3, 4, and 5 are of H-strand
sense and hence would detect transcription from the H-strand
promoter (HSP).
In order to look for differences in the mitochondrial transcription
rates across early development of X. laevis, it is important to
maintain, as much as possible, the endogenous differences in the
biochemical composition of the mitochondria from the different
stages, so that their effect on mitochondrial transcription can be
compared. Hence the run-on reactions were performed in the
isotonic buffer (basic buffer) without addition of exogenous
nucleotides, other than trace amounts of [32P]UTP. Mitochondria


204
A.
LSP
transcription
rz in
HSP
transcription
o co
Q 2
Q O
CO Q
Q £ Z
5
6
ND1
Cyt b
COII


LIST OF TABLES
3-1 Steady state levels of mitochondrial RNA in total egg or
embryonic RNA during early development
of Xenopus laevis 77
3-2 Mitochondrial mRNA steady state levels in isolated
mitochondria from distinct developmental
stages of X. laevis 82
3-3 Steady state levels of mitochondrial RNA (normalized
to mtDNA) during early development of X. laevis .... 89
5-1 Promoter-wise and overall transcription rates per unit
mitochondrial genome during early development
of Xenopus laevis 190
5-2 Mitochondrial adenine nucleotide levels during early
development of Xenopus laevis 210
5-3 Total adenine nucelotide levels in unfertilized eggs and
early developmental stages of Xenopus laevis 211
v


214
vary during the first two days of development, remaining at ~4ng
per embryo (Chase and Dawid, 1972). Hence variation in gene
dosage is not the major regulatory event. Mitochondrial run-on
transcription assays were used to compare the transcriptional rates
of mitochondria isolated from unfertilized eggs or distinct embryonic
stages in which transcript levels were either basal or differentially
elevated (Figure 5-3A). The rates were normalized to the mtDNA
levels found in the mitochondria of that corresponding stage (Figure
5-3B) and expressed as fold over the rates measured for unfertilized
eggs (Figure 5-4A & 5-4B). The L-strand and H-strand promoters
(LSP & HSP, respectively) were differentially active, with the HSP
being more active at all times (Table 5-2), consistent with the
observations of Antoschechkin and Bogenhagen (1995) that the
Xenopus HSP is many fold more active than the LSP in the presence
of xl-mtTFA in in vitro transcription assays.
The most significant finding of these experiments was that
transcription rates correlated with the pattern of steady state levels
of the mitochondrial transcripts (Figure 5-5). The transcription rate
was basal in the unfertilized egg and 5 hr embryos, correlating with
the measured low levels of mitochondrial transcripts (compared to


Figure 2-1. Experiment to determine the optimal number
of cycles of linear amplification. Mitochondrial DNA from X.
laevis ovaries which had been processed for in organello footprinting
(as described for Figures 4-2 and 4-3) was used as a template for
primer extension with 32P-end labeled primer WH 480 as described
in Materials and Methods. The samples were denatured at 94C for 5
min, followed by independent cycling of each reaction for 1, 5, 10,
15, 20, 30, and 40 cycles (lanes 1-7) with the following profile: 94C
for 1 min, 60C for 1 min, and 72C for 5 min. The reactions were
then phenol extracted, ethanol precipitated, run on 6% sequencing
gels and autoradiographed. Note the appearance of additional bands
which are longer by 1-2 nucleotide, especially in the samples cycled
for 30 and 40 cycles (lanes 6 and 7). Cycling for 15 cycles was found
to be optimal with respect to both signal intensity and fidelity of
reproduction of the footprint ladder.


28
sorting and counting using a broad-tipped 10 ml pipet. The eggs and
early embryos are especially fragile after de-jellying and should be
handled only using broad-tipped pipets.
Isolation of Mitochondria from Eggs and Embryos
Mitochondria were purified from eggs and embryos with
modifications of the protocol used by McKee et al. (1990) for the
isolation of heart mitochondria. This protocol was adopted both due
its ease of application and the replacement of EDTA with EGTA, which
is especially important in run-on and band-shift experiments, where
chelation of Mg++ must be avoided.
De-jellied eggs and embryos were floated in MSE buffer (40 mis
for 200-300 eggs or embryos) and homogenized in a glass dounce
homegenizer with a type B teflon pestle with 7-10 strokes. The
homogenate was spun at 1,500 x g for 10 min. in a JA20 rotor; the
supernatant was re-spun as above and the second supernatant spun
at -9,000 x g for 10 min in a JA20 rotor; the pellet was collected,
resuspended in 1 ml of MSE and spun in an Eppendorf tube at 9,000
x g for 2 min. This step was repeated 2-3 times until the
supernatant cleared up to remove traces of fat. The final pellet was
used as such in the experiments involving run-on transcription or
mitochondrial DNA isolation in the footprinting experiments. In


Time post-fertilization
Transcript levels (fold over egg)
Transcription Rate (fold over egg) Effl
961


52
reference to the linear sequence, but cloned in the reverse
orientation with reference to the gene. Since ND6 is transcribed by
the L-strand promoter, the T3 promoter is still utilized for
synthesizing an antisense probe for the ND6 transcript.
Total RNA Extraction from Eggs and Embryos
Batches of 100 eggs or staged embryos were frozen at -70C and
used for total RNA extraction. The frozen eggs or embryos were
thawed in 10 ml of lysis buffer (4 M Guanidine thiocyanate, 100 mM
sodium acetate, pH 5.0, 5 mM EDTA) and incubated for 20 minutes at
room temperature to facilitate dissociation of nucleoprotein
complexes. The homogenate was then extracted 3-4 times with
phenol:chloroform:isoamyl alcohol (25:24:1, pH 7.0) in 50 ml
centrifuge tubes (Corning or Fisher) to remove pigment, excess
protein and cell debris. Phase separation was achieved by spinning
in a JA-10 rotor at 3,000 x g. The clarified supernatant was then
loaded as a 4.0 ml CsCl solution in SW 41 polyallomer ultracentrifuge
tubes and spun at 38,000 rpm for 24 hrs at 4C. After the spin, the
liquid phase was removed, the clear RNA pellet at the bottom of the
tube rinsed once with 80% ethanol, air-dried and resuspended in TES
buffer (lOmM Tris, pH7.4, 1 mM EDTA, 0.1% SDS). The RNA


246
in X. laevis, with the total ATP levels remaining constant during early
development, suggesting that the fundamental mechanism of
metabolic activation in X. laevis might be slightly different.
Nevertheless, future research into the metabolic basis of
transcriptional regulation in mitochondria should provide interesting
insights into one of the ways by which the cell activates
mitochondrial transcription. These studies could have wider
implications for regulation of mitochondrial gene expression in
general, as mitochondrial metabolism is not as static as was once
imagined. On the contrary, it seems to be involved in dynamic
pacing of cellular metabolism, in response to oscillations in the levels
of calcium and other second messengers. Therefore, the changing
patterns of mitochondrial oxidative metabolism also have the
potential to dictate nucleic acid metabolism in the mitochondria.
The present study also provided some additional insights into the
in vivo role of the mitochondrial transcription termination factor,
mTERF. Footprinting and band shift assays confirmed the presence
of this protein in Xenopus mitochondria, consistent with the existence
of the highly conserved tridecamer termination box in Xenopus
mtDNA, with only one nucleotide change from the human equivalent.


256
Evans, M.J., and R.C. Scarpulla. 1990. NRF-1: A trans-activator of
nuclear-encoded respiratory genes in animal cells. Genes Dev.
4:1023-1034.
Ewart, G.D., Zhang, Y-Z., and R.A. Capaldi. 1991. Switching of bovine
cytochrome oxidase subunit Via isoforms in skeletal muscle during
development. FEBS Lett. 292:79-84.
Fernandez-Silva, P., Micol, V., and G. Attardi. 1996. Mitochondrial
DNA transcription initiation and termination using mitochondrial
lysates from cultured human cells. Meth. Enz. 264:129-139.
Fisher, R.P., and D.A. Clayton. 1985. A transcription factor required
for promoter recognition by human mitochondrial RNA polymerase.
Accurate initiation at the Heavy- and Light-strand promoters
dissected and reconstituted in vitro. J. Biol. Chem. 260:11330-
113338.
Fisher, R.P., and D.A. Clayton. 1988. Purification and characterization
of human mitochondrial transcription factor 1. Mol. Cell. Biol.
8:3496-3509.
Fisher, R.P., Lisowsky, T., Breen, G.A.M., and D.A. Clayton. 1991. A
rapid, efficient method for purifying DNA-binding proteins.
Denaturation-renaturation chromatography of human and yeast
mitochondrial extracts. J. Biol. Chem. 266:9153-9160.
Fisher, R.P., Lisowsky, T., Parisi, M.A., and D.A. Clayton. 1992. DNA
wrapping and bending by a mitochondrial high mobility group-like
transcriptional activator protein. J. Biol. Chem. 267:3358-3367.
Fisher, R.P., Topper, J.N., and D.A. Clayton. 1987. Promoter selection
in human mitochondria involves binding of a transcription factor to
orientation-independent upstream regulatory elements. Cell 50:247-
258.
Gagnon, J., Kurowski, T.T., Weisner, R.J., and R. Zak. 1991.
Correlations between a nuclear and a mitochondrial mRNA of


200


Figure 3-1. Steady state levels of mitochondrial RNA during early development of
Xenopus laevis. Total RNA was isolated from unfertilized eggs and embryonic stages at 5, 13, 20, 30,
38, and 50 hours post-fertilization as described in Materials and Methods. 2 ug of total RNA from each
developmental stage was run in a 1.2% formaldehyde-agarose gel, blotted on nylon N+ membranes,
hybridized with gene-specific riboprobes synthesized by in vitro transcription from linearized clones,
washed, and exposed to x-ray film or phosphorimager (described in Materials and Methods). Each lane
(labeled accordingly) corresponds to the respective mRNA or rRNA level in the corresponding
developmental stage. Panel A: ND1 mRNA; Panel B: ND4 mRNA; Panel C; ND6 mRNA; Panel D: Cyt b
mRNA; Panel E: CO II; Panel I': ATPasc 6 mRNA; Panel G: 12S rRNA; Panel H: 16S rRNA. The complex
pattern of bands seen in panels G and H represent multiple products corresponding to the 12S and 16S
sequences, and is found in ribosomal RNA blots from other animal systems (see text).


244
metabolic mode. These studies show that the mitochondrial
metabolism is in a constant state of flux during embryogenesis, with
the pattern of substrates in the mitochondria constantly changing.
In order to test the effect of differences in mitochondrial
oxidative metabolism on mitochondrial transcription, a run-on
rescue experiment was devised in which the mitochondrial
metabolism of a transcriptionally quiescent stage like the 20 hr stage
was stimulated by the addition of aketoglutarate, ADP, and
phosphate to the basic run-on buffer. Transcription rate of
mitochondria incubated in this buffer was dramatically stimulated
(by 22 fold over the rate in basic buffer), suggesting that the
mitochondrial transcription apparatus was in a state of readiness, but
was dependent directly or indirectly on the metabolic state of the
mitochondria. This result also indirectly predicts that the
mitochondria of the transcriptionally active stages would have a
higher rate of oxidative metabolism. In order to confirm this
suggestion, the mitochondrial adenine nucleotide levels in distinct
embryonic stages were measured by RP-HPLC. The unfertilized eggs
and early embryos upto 20 hours of development had similar levels
of mitochondrial ATP and ATP/ADP ratios, whereas the 30 hr stage


202
different substrates. The transcriptional activity of the mitochondria
from the 20 hour-old embryo showed a dramatic induction (22 fold
over basic buffer) with the addition of all the substrates needed for
endogenous production of ATP in the mitochondria (treatment 6 in
Figures 5-6A & 5-6B). Addition of exogenous ATP (treatment 7) or
low level production of endogenous ATP by the addition of the citric
acid cycle intermediate a-ketoglutaric acid (treatment 4) caused a
modest stimulation (~6 fold over basic buffer) of transcription rate.
Addition of ADP alone (treatment 3) or ADP + phosphate (treatment
5) resulted in only a 3 fold boost in transcription rate (Figure 5-6B).
The stimulation of transcription by endogenous production of ATP
in the mitochondria was further investigated using inhibitors of
oxidative phosphorylation (Figure 5-7). Equal aliquots of
mitochondria isolated from 20 hour-old embryos were incubated in
basic buffer (treatment 1 in Figure 5-7A & 5-7B), basic buffer + ATP
(treatment 2), basic buffer + ADP, phosphate, and a-ketoglutaric acid
(treatment 3), treatment 3+10 ug/ml actinomycin D (treatment 4),
treatment 3 + 5 ug/ml Antimycin A (treatment 5), or treatment 3 +
500 uM Atractyloside (treatment 6). The labeled run-on products


207
the stimulation of transcription by the addition of phosphate, ADP,
and a-ketoglutaric acid was 22 fold and 8.2 fold over the basic
buffer in Figure 5-6B (bar 6) and Figure 5-7B (bar 3), respectively.
Run-on systems inevitably show these variations (Gaines, 1996) and
are probably due to many factors, including variations in the speed
of isolation of mitochondria, purity of the preparation, etc. Hence, a
direct comparison of the effects of experimental parameters is most
valid within an experiment rather than between experiments.
In conclusion, the observed inhibition of mitochondrial
transcription by drugs specific to the respiratory chain (antimycin A)
or to ATP-ADP transport (atractyloside) shows the importance of
oxidative phosphorylation, either directly or indirectly, for mtDNA
transcription. These results also suggest that the stimulation of the
process of making ATP (by activating mitochondrial metabolism)
rather than the actual ATP levels was causing the observed dramatic
activation of transcription in the relatively un-induced mitochondria
of the 20 hr embryo, since exogenous addition of ATP did not cause
the same fold induction of transcription as was seen with the
stimulation of endogenous ATP synthesis in the mitochondria.


240
baseline pattern of footprinting in the D-loop region of Xenopus
mtDNA, in order to be able to compare and contrast footprinting
action during development. This was done using in organello DMS
footprinting of ovary mtDNA. Similar to the scenario in human
(Fisher et al., 1992; Ghivizzani et al., 1994) and cow mitochondria
(Ghivizzani et al., 1993), the X. laevis D-loop region displayed phased
or periodic binding of proteins. This in vivo binding pattern closely
matched the in vitro DNAse I footprint pattern of mitochondrial
transcription factor A, xl-mtTFA (Antoschechkin and Bogenhagen,
1995), strongly implicating this protein in the periodic binding of the
D-loop region, consistent with the established role of mtTFA in
packaging of mtDNA in human, cow, and yeast mitochondria (Fisher
et al., 1991; 1992; Ghivizzani et al., 1993; 1994; Diffley and Stillman,
1991; 1992).
One popular and long-standing theory of mitochondrial gene
regulation is that the mtTFA protein is capable of regulating
transcription from the HSP and LSP based on varying protein
stoichiometries in the mitochondria, in response to the energy needs
of the cell (Clayton, 1992; Dairaghi et al, 1995; Antoschechkin and
Bogenhagen, 1995). This theory is based on in vitro experiments in


Figure 4-11. In vivo footprinting of the H-strand of the
mTERF region during early development of X. laevis. Samples
were processed exactly as described for the footprinting of the L-
strand in the legend to Figure 4-10, with the following differences.
Linear amplification of the footprint ladder was done using 3:P-end
labeled primer WH476. Hence, the polarity of transcription from HSP
is opposite to that in Figure 4-10. Denaturation was done at 94C for
4 min, followed by 15 cycles with the profile: 94C for 1 min, 53C for
1 min, 72C for 3 min. Following the reaction, the samples were
phenol extracted, ethanol precipitated, run on 6% sequencing gels,
and autoradiographed. Nucleotide numbering is according to Roe et
al. (1985). The tridecamer mTERF element (nucleotides 4730-4743)
is indicated by the filled box. Residues hypersensitive (filled
squares) to DMS methylation are indicated


118
the G-specific sequencing reaction of the Maxam-Gilbert sequencing
protocol (Maxam and Gilbert, 1980). The N-7 position of guanine is
directed towards the major groove of DNA and is frequently
contacted by sequence-specific DNA-binding proteins. Therefore, a
guanine will be methylated at a lower frequency (protected)
compared to neighboring guanines in the presence of the bound
protein. However, protein binding to DNA can also result in
methylation at a higher frequency (hypersensitivity), caused by
either a localized distortion of the DNA structure by protein binding
or by trapping of DMS in hydrophobic pockets of the protein, leading
to localized higher concentrations. To identify these protected or
hypersensitive G residues due to microsequence environment,
control reactions are carried out in parallel either with cells that
serve as a control for the effect to be observed (e.g., unfertilized eggs
vs. developing embryos derived by fertilization of the same batch of
eggs), or with protein-free genomic DNA which is methylated in
vitro. After methylation, genomic DNA is purified from the control
and test samples and cut with a suitable restriction enzyme to create
a reference point for comparison. Then the DNA samples are cleaved
at the modified nucleotides using piperidine, which removes the


ACKNOWLEDGEMENTS
I thank Dr. William W. Hauswirth, my mentor and supervisor, for
his constant support in both academic and personal matters. He gave
me immense freedom in the conduct of experiments and stood by me
during difficult times. I knew I could always count on him. I would
also like to thank all the past and present colleagues in the lab, who
have made life in the lab enjoyable and friendly.
I would like to thank the members of my advisory committee,
Drs. A1 Lewin, Maury Swanson, and Tom Rowe, for the various
constructive suggestions they have made during the course of the
investigation and for taking the time to review various documents,
including this one. I also appreciate the input from all the other
faculty and students in the department, which has helped in my
personal growth. I also thank the other personnel in the Department,
especially Joyce Conners and Brad Moore, for their efficient help.
My special thanks go to Hyma, my wife, who has stood by me
during all times, good and bad, and made this all possible.
n


45
DNA polymerase Vent Taq Pfu
dNTP (uM) 20 100 200 20 40 60 80 100 20 100
fe.--.-
UUL-
1998
-1977


Figure 4-12. Gel mobility shift assay for mTERF protein. A. The 52 bp dsDNA band shift
probe was synthesized by filling in annealed WH615 (40-mer) and WH616 (41-mer) oligos with [a-
32P]dATP using Sequenase DNA polymerase as described in Materials and Methods. 0.1 pMol of the
radiolabeled probe was incubated with 30 ug of the S-13 mitochondrial protein extract prepared from
early blstula (5.5 hr post-fertilization) embryos for 20 min at room temperature. The samples were
then placed on ice and the indicated molar excess of cold competitors added. The wild type competitor
refers to the non-radiolabeled version of the probe, the single mutant refers to the 52 bp dsDNA probe
with a single mutation at position 4737 (A to G) which is similar to the MELAS mutation in human
mtDNA at 3243 (Goto et al, 1990), and the triple mutant refers to the same 52 bp dsDNA probe with
three changes at positions 4731 (t to A), 4733 (G to C), and 4737 (A to G). After addition of the
competitors, the samples were gently mixed and incubated again at room temperature for 15 min.
After the incubation, the samples were kept on ice and immediately loaded onto a 5% non-denaturing
polyacrylamide:bisacrylamide (80:1) gel, dried and autoradiographed. The positions of the free probe
and the shifted species are indicated. Lane 2 shows the control band shift without any added
competitors. Lanes 3-5, 6-8, and 9-11 show the effect of adding the wildtype, single mutant, and triple
mutant competitors, respectively, at the indicated molar excess over probe. B. The gel in A was
quantitated using a phosphorimager. The band shift is expressed as percentage of control, setting the
control band shift (without competitor) to 100%. The % band shift is plotted as a function of the molar
excess of each cold competitor.


124
H-STRAND
C T T C
L-STRAND E3WMC:
PROMOTER
CSB 1
1718-
1 678
L-STRAND
C T T C
- -*
ITT} I
i
4 1 871
1803
1 681
D-ioop r
5' end 1*
1 659
1 669
1646-
1 644
In vitro DNAase I foolprint of xl-mtTFA


94
Kirschner, 1982a), cell division slows down due to the insertion of G1
and G2 phases into the lengthening cell cycle, and very active RNA
synthesis resumes in the embryo (Newport and Kirschner, 1982b).
Mitochondrial RNA is a major component of the total RNA pool in the
unfertilized egg. But the level of mtRNAs in the total RNA pool are
progressively diluted by increasing levels of nuclear transcripts as
embryogenesis proceeds. Hence, measuring mtRNA levels in the
context of rapidly fluctuating total RNA level would be subject to
genetic, environmental, and animal-specific variations, concealing the
real picture of steady state levels due to large uncertainties in
mtRNA levels. These considerations may partly explain the
disagreement between my results and those of Meziane et al. (1989),
though it still does not fully explain the 5-10 fold decrease in
transcript levels by the mid-blastula stage seen by those authors.
Due to the above considerations, it is mandatory to have an
internal control for normalization of the mitochondrial mRNA levels.
Normalization of the mitochondrial mRNA levels to mitochondrial
rRNA levels was initially attempted here, but suffers from the
assumption that the rRNA levels do not fluctuate much during early
development. Although this assumption proved not to be true


Bogenhagen and Clayton (1978) studied the kinetics of D-loop DNA
(7S DNA) formation by pulse-chase experiments in Mouse L-cells.
The half-life of pulse-labeled 7S DNA is approximately 70 minutes, a
turnover so rapid that at least 95% of this DNA pool is lost without
acting as primers for H-strand synthesis, suggesting that the primary
role of D-loop DNA is not replication priming.
After successful H-strand synthesis proceeds approximately two-
thirds of the way around the genome, the L-strand origin, 0L is
exposed (Martens and Clayton, 1979). This origin is located in a 30
to 33 base noncoding region within a cluster of five tRNA genes,
forming a stable stem-loop structure highly conserved in most
vertebrates (Martens and Clayton, 1979; Tapper and Clayton, 1981;
Wong and Clayton, 1985a). A primase activity, distinct from
mitochondrial RNA polymerase, has been identified which recognizes
0L and synthesizes 9-12 base RNA primers, which are then used by
DNA polymerase-y for L-strand synthesis (Wong and Clayton, 1985b).
Both the conserved stem-loop and 5 Hanking sequences are
important for L-strand initiation, with five nucleotides at the base of
this stem loop the site of RNA to DNA transition (Hixson et al., 1986).


103
Hence, ABF2 was implicated in both the maintenance and the
expression of the mitochondrial genome (Diffley and Stillman, 1991).
DNase 1 footprinting experiments revealed that both human (Fisher
et al.. 1992) and yeast (Diffley and Stillman, 1991; 1992) mtTFA are
flexible in their sequence recognition, exhibiting generalized binding
of unrelated DNA, but binding to the regulatory regions of mtDNA in
a phased fashion. Evidence for this phased binding in vivo was
reported by Ghivizzani et al. (1994) in human placental mitochondria
using the technique of in organella DMS footprinting (Ghivizzani et
al., 1993).
ABF2 is an extremely abundant protein, with approximately 1
molecule of ABF2 for every 15 bp of mtDNA (Diffley and Stillman,
1991). Thus there is enough ABF2 to coat the entire mitochondrial
genome. Based on the general ability of ABF2 to bind nonspecifically
to DNA by wrapping and its specific, phased binding at key
regulatory sequences, Diffley and Stillman (1992) suggested that the
DNA-binding properties of ABF2 may provide a mechanism whereby
most of the mtDNA can be packaged by ABF2 without interfering
with the binding of key regulatory proteins, allowing it to be an
activator of both transcription and replication.


160
mtTFA protein satisfies its designation as an HMG protein, exhibiting
the ability to bend and wrap mtDNA (Diffley and Stillman, 1992;
Fisher et al., 1992). The somewhat surprising observation was that
this protein, klthough possessing a low sequence specificity, had the
ability to bind to critical regulatory regions in a phased fashion,
with certain preferred regions of exclusion (Diffley and Stillman,
1991; 1992; Fisher et al., 1992; Ghivizzani et al., 1994).
In organello footprinting of X. laevis ovary mtDNA revealed that
protein-DNA interactions in the D-loop upstream region of frog
mtDNA seemed to be highly ordered, with strong occupancy being
found in periodic stretches of DNA in a non-random fashion (Figures
4-2, 4-3 and 4-4). Concurrent with this investigation, Antoschechkin
and Bogenhagen (1995) cloned the Xenopus homolog of the mtTFA,
the xl-mtTFA, and found that this protein binds the D-loop upstream
region in a phased manner in in vitro DNAse I footprint assays, each
binding site spanning approximately 35 bp of DNA. The in organello
footprints mirrored this pattern, appearing as one unit of interaction
per 35 bp of DNA (Figure 4-4). A careful comparison of the
footprinted residues in the experiments of Antoschechkin and
Bogenhagen (1995) with the in vivo footprints obtained in this work


Figure 4-5. In vivo footprinting of the H-strand of D-loop
upstream region during early development of X. laevis.
Unfertilized eggs (egg) and embryonic stages at different times post
fertilization (indicated above the lanes) from two different female
frogs were DMS-treated in vivo (as described in Materials and
Methods). Mitochondrial DNA was also isolated from unfertilized
eggs of the same female frogs and DMS-treated in vitro to provide
the naked DNA lanes (control). The in vivo and in vitro DMS-treated
mtDNA samples were then processed for footprinting by primer
extension as described in Materials and Methods. Taq DNA
polymerase was used for linear amplification of the footprint ladder
using 32P-end labeled primer WH357. Denaturation was done at 94C
for 4 min, followed by 15 cycles with the profile: 94C for 1 min, 45C
for 1 min, 72C for 3 min. Following the reaction, the samples were
phenol extracted, ethanol precipitated, run on 6% sequencing gels,
and autoradiographed. The nucleotide positions (Roe et al., 1985) are
shown on the left side of the figure, along with critical cis-elements
and the direction of transcription. On the right side, residues
protected (open circles) or hypersensitive (filled squares) to DMS
methylation are indicated.


187
were isolated (from -100 eggs or embryos) from unfertilized eggs
and embryos at 5 hr, 14 hr, 20 hr, 28 hr, and 48 hr post-fertilization,
and used in run-on reactions. The mitochondrial lysate was then
used to probe the cold target panels (shown in Figure 5-2B) as
described in Materials and Methods, and autoradiographed to reveal
promoter-specific transcription (Figure 5-3A). To correct for
differences in the yield of mitochondria isolated from each stage, 10%
of the mitochondria used in each run-on reaction was used to
quantitate the level of mtDNA in each preparation by dot-blotting as
described in Materials and Methods (Figure 5-3B). Phosphorimager
quantitation of the blots shown in Figures 5-3A and 5-3B were used
to calculate the promoter-specific and overall transcription rates per
unit mitochondrial genome across early development of X. laevis
(Table 5-1 and Figure 5-4).
Transcription was basal in the unfertilized egg and only slightly
stimulated in the embryonic stages up to 20 hours of development
(Table 5-1 and Figure 5-4). Transcription from both the LSP and HSP
was 2 fold higher than egg levels by 5 hours post-fertilization, 4-5
fold by 14 hr, and 4-6 fold by 20 hours of development (Figure 5-
4A). The 28 hr embryo showed a dramatic boost in transcriptional


229
transcriptional activity of the mitochondria. There was a good
correlation between the stages which exhibited high mitochondrial
transcription rates and the stages with active mitochondrial
metabolism (as measured by adenine nucleotide levels and
mitochondrial run-on rescue experiments). Hence, the key
regulatory event seems to be developmental transitions in
mitochondrial physiology. However, the question as to what
molecular events or developmental cues might cause these dramatic
differences in mitochondrial metabolism remains open for
investigation. Hence, early development of Xenopus laevis remains a
very powerful model system for future investigations into the link
between mitochondrial metabolism and mitochondrial gene
expression.


1984). The existence of a third promoter, specific for transcription of
the rRNA genes, has been proposed (Montoya et al., 1983; Chomyn
and Attardi, 1992) on the basis of SI nuclease protection studies. In
humans, the LSP and HSP, the two bi-directional promoters, are in
close proximity but do not overlap. These promoters require two
distinct sequence elements for activity (Chang and Clayton, 1984;
Hixson and Clayton, 1985; Topper and Clayton, 1989), one
surrounding the initiation site and the other located just upstream of
the start site, required for activation by the human transcription
factor, h-mtTFA (Fisher and Clayton, 1985). Bi-directional
transcription initiation is also seen in chicken (LAbbe et al., 1991)
and Xenopus laevis (Bogenhagen and Yoza, 1986). In Xenopus, there
are two bi-directional promoter elements, each consisting of two
overlapping octamer sequences (analogous to the nonanucleotide
promoter of yeast) located on opposite DNA strands (Bogenhagen et
al., 1986; Bogenhagen and Yoza, 1986; Bogenhagen and Romanelli,
1988).
The search for protein factors which activate mitochondrial
transcription led to the identification and isolation of the human
mitochondrial transcription factor, h-mtTFA (Fisher and Clayton,
1985). Molecular cloning of this protein from human (Parisi and
Clayton, 1991), yeast (Diffley and Stillman, 1991), and Xenopus laevis


149
differences in the degree of methylation (hypersensitivity) at
positions 4744 and 4745 among the different developmental stages.
The implication of this is unclear at this level of detection. The
resolution of the experiment within the tridecamer sequence in
Figure 4-11 is not adequate to make any conclusions about the other
G residues in this region.
In conclusion, in organello footprinting confirms the presence of
the mTERF protein in X. laevis mitochondria, further extending the
list of common cis-elements and trans-acting factors in frog and
human mitochondria. Comparison of the in vivo footprints of this cis
element across early development of X. laevis show that the mTERF
protein is constitutively bound to its cognate site at relatively equal
occupancy in vivo at all times, suggesting that the mitochondrial
levels of this factor are not actively regulated during differential
transcriptional activity in the mitochondria.
In order to confirm further the suggestion that the mitochondrial
levels of this factor may be relatively constant during regulated
transcription, the mTERF protein was detected by electrophoretic
mobility shift assays. For this, the method of Fernandez-Silva et al.
(1996) for detecting the presence and estimating the relative


167
the footprints in this region of mtDNA are primarily due to mtTFA
binding (Antoschechkin and Bogenhagen, 1995), these results suggest
equivalent occupancy of mtTFA during both basal and activated
transcription in the mitochondria.
The above findings are inconsistent with both proposed models of
transcriptional regulation. The first model of changes in phasing has
no experimental support as this would have created a shift in the
footprinting pattern, which was not the case. The second model
would have predicted low or high levels of mtTFA during basal or
activated transcription, resulting in lower or higher occupancy of
mtDNA. This scenario was also not seen in the in vivo footprints.
However, these experiments do not show whether the actual protein
levels of mtTFA change in response to these events. This would
require direct measurement of mtTFA protein levels during
development. Even if a difference in protein levels was found, the
equivalent occupancy of mtTFA would still remain unexplained.
Diffley and Stillman (1992) quantified the amount of sc-mtTFA
(ABF2) in yeast cells grown on either glucose or glycerol by
immunoblotting and found virtually identical amounts of ABF2,
showing that ABF2 levels were not dictated by mitochondrial activity


60
suspension on ice and then incubating at 30C for 30 min. Following
the incubation, the samples were cooled on ice, and then pelleted in a
microcentrifuge at 10,000 x g for 1 min. The mitochondrial pellets
were either used immediately for probing mtDNA-specific cold
probes or stored at -80C till necessary.
To detect and quantify the run-on RNA, the mitochondrial pellets
were resuspended in 50 mM Tris, 7.5, 200 mM NaCl, 25 mM EDTA.
After adding SDS to 1% to lyse the mitochondria, the lysate was spun
for 2 min at 14, 000 x g in a microcentrifuge to remove pigment. The
supernatant was added to the pre-hybridized riboprobe panel in
fresh hybridization solution and allowed to hybridize in a rolling
hybridization oven (Biometra) at 60C overnight. The pre-
hybridization, hybridization, and wash conditions were the same- as
that used for the steady state RNA analyses. All quantitations were
performed using Imagequant software (Molecular Dynamics) on the
Phosphorimager.
To correct for differences in the yield of mitochondria obtained
from the different developmental stages, the mtDNA levels in each
run-on reaction was measured as follows. Prior to the addition of the
radiolabel, 10% of the mitochondrial suspension in basic buffer was
removed, pelleted and lysed in mitochondrial lysis buffer (described


224
mitochondrial differentiation may exist in Xenopus laevis, although
total ATP levels and ATP/ADP ratios per embryo measured in this
study were relatively constant during early development of X. laevis
(Table 5-3), unlike that seen during the embryogenesis of the mouse
and Bufo arenaran. It should be noted that total ATP measurements
reported in this study were done using reversed-phase HPLC,
whereas the two studies on mouse (Ginsberg and Hillman ,1973) and
Bufo arenaran (de Legname et ai, 1977) used the firefly luciferase
assay for total ATP measurements. The possibility that these two
assays may not be absolutely complementary with regard to the pool
of ATP they measure should be borne in mind when comparing these
results.
The foregoing discussion indicates that carbon metabolism is in a
constant state of flux during embryogenesis of Xenopus laevis, with
dynamic changes in the patterns of substrate movement and
utilization. Mitochondria, being a key player in all these energy
transactions, would have dramatically different biochemical
compositions at different developmental timepoints. It is widely
believed, though not formally proven, that the mtDNA molecule is
attached to the inner mitochondrial membrane by protein or lipid


38
Samples were resuspended in 20 ul of formamide loading dye (for
Southern blotting) or TE (for primer extension reactions).
Southern Blot Detection of In Organella Footprints
As a preliminary experiment to optimize loading intensities, equal
amounts of test and control mtDNA samples from above (1 /20th to
1/10th of each sample) were loaded into adjacent lanes of a 6%
polyacrylamide, 7.5M urea sequencing gel and electrophoresed under
standard sequencing gel conditions. Based on the hybridization
signals on the Southern blots of these gels, loading volumes for each
stage were decided by a combination of visual assessment and
Phosphorimager (Molecular Dynamics) quantitation.
DNA transfer to membrane was by vacuum blotting using the
method of Lopez et al. (1993). Briefly, following electrophoresis, a
precut piece of nylon transfer membrane (Hybond-N+ from
Amersham, Chicago, IL) was placed directly on the gel surface and
allowed to draw the buffer for 5 min. The sandwich was then placed
in a standard gel-drying apparatus, membrane side down, on a single
sheet of Whatman 3mm paper (Whatman Paper Ltd., Clifton, NJ),
covered with plastic wrap, and the DNA transferred to the membrane
by applying vacuum (without heat) for 45 min to 1 hour. After
transfer, DNA was crosslinked to the membrane on a transilluminator


64
WH 654. 46 base oligonucleotide AGA TTA GGG CTA GCT AGC
GAG CCA GGG CCT GGC TAA TGC GAA AGA. Corresponds to the L-
strand sequence 4712-4756, with three point mutations in the
mTERF consensus sequence (Valverde el al., 1994) at positions 4731
(T to A), 4733 (G to C), and 4737 (A to G).
WH 655. 20 base oligonucleotide GCT TAG GTC TTT CGC ATT AG.
Corresponds to the H-strand sequence 4763-4744.
Preparation of Band Shift Probes and Competitors
To make the 52 bp wild type mTERF bandshift probe, 1 nmol of
WH 615 and WH 616 were denatured in lOmM Tris, pH 7.5, 10 mM
NaCl at 95C for 4 min, followed by annealing at 51C for 10 min.
The annealed templates were kept on ice and used to perform a fill-
in reaction with either Klenow fragment (New England Biolabs) or
Sequenase (USB-Amersham) DNA polymerase. The use of Klenow
was discontinued in later experiments due to incomplete filling-in of
the termini which led to production of two major products in native
gels. Radiolabeled probes were made using either [a-32P]TTP or
dATP. Unincorporated radiolabel was removed using spin-columns
(Sephadex 25, Pharmacia) and the probe specific activity calculated.


Transcript levels (fold over egg)
Time post-fertilization


Figure 3-3...continued
-48 hr


Figure 5-4. Promoter-wise and overall transcription rates
during early development. A. The graph shows the
mitochondrial transcription rates measured in unfertilized eggs and
five distinct developmental stages of X. laevis. The combined values
for transcription from each promoter (Table 5-1) were used to
express the transcription rate as fold over egg, with the egg levels set
to unity. B. The graph shows the overall transcription rate in the
mitochondria of unfertilized eggs and embryos at five distinct times
post-fertilization. The values for overall transcription from the HSP
and LSP (Table 5-1) were used to express the overall transcription
rate as fold over egg, with the egg level set to unity.


223
Brinster, 1967; Ginsberg and Hillman, 1973). However, total ATP
levels and ATP/ADP ratios showed a progressive decline from the 2-
cell stage to the late-blastocyst stage (Ginsberg and Hillman, 1973).
In the developing mouse embryo, mitochondrial transcription
resumes actively from the 2-4 cell stage onwards, as indicated by a
25-50 fold increase in rRNA and CO I and CO II mRNA levels (Piko
and Taylor, 1987). This new transcription plays an essential role in
mitochondrial differentiation during cleavage, since inhibitors of
mitochondrial RNA and protein syntheses also block the normal
growth and differentiation of mitochondrial cristae (Piko and Chase,
1973). In the amphibian Bufo arenarum, de Legname et al. (1977)
also found modifications of mitochondrial ultrastructure correlated
with metabolic changes during ontogenesis. Mitochondria of
blastulae (which had high embryonic ATP levels) displayed a
condensed conformation, in contrast to the more orthodox swollen
conformation of mitochondria in a later developmental stage (gill
circulation), in which low ATP levels were measured.
The above studies point to the possible differentiation of the
mitochondria from an embryonic to an adult state, in concert with
the metabolic steady states of the cell. A similar mechanism of


70 Os
^4
-t-
ro
i
+- O'
co
4-
oo
tyi
f
t
fc* U
1 1
vo
1
UJ
1
mm
n t i *.
< !* 4 a
i; ¡ai
Ml Si .
ubi;
Control
*f i m
U
::::
: r
.11 ir:
Egg
:;:::!
3 ::::
: n
i s ir:
16 hr
¡mi
*r ? n
4:1 1
a 131
i: si:
ni ai::
60 hr
m
i

L
J 1 il L
Control
¡mi
jL
iJ.i X:]
1 ; P¡ ;
a i it j
Egg
*
<*. <
I 3.1
31 ai:
6.5 hr
na
* r !
i ili.
3; i:
31 ai:
25 hr
T * ^
. 4. i U.
. 3 i 3:
31 u :
34.5 hr
mm
K1.E
11 i;i
i 331 i
13 I II I
56.5 hr
7
o
fQ
"TJ
O
ffQ
N>
H-STRAND


164
to speculate whether this remarkable protein can also regulate
transcription in mitochondria. Regulation could be achieved in at
least two different ways. In the first model, the in phase binding of
mtTFA could shift out of phase, in response to some cellular
stimulus. This would rapidly shut down transcription/replication,
serving as an on/off switch for mitochondrial gene expression. In
the second, more popular model (Clayton, 1992; Dairaghi et al., 1995),
changes in the stoichiometry of mtTFA to mtDNA in the mitochondria
have been proposed as a regulator of transcription.
The first model is unlikely because of multiple considerations.
First, Dairaghi et al. (1995) have shown that increasing the spacing
between the LSP and the mtTFA specific binding site also
proportionately shifted the hypersensitive site caused by mtTFA
binding, decreasing transcription initiation efficiency, showing that
the mtTFA has strict promoter spacing requirements for accurate
transcription initiation. It is still possible that some unidentified
protein might modulate the binding activity of mtTFA in vivo.
Secondly, the mtTFA protein seems to be unable to bind to certain
GC-rich sequences like CSB2 and CSB3 (Ghivizzani et al., 1994; this
work) or Poly(A) tracts (Diffley and Stillman, 1992). The strategic


70
they did not show whether the microinjected GTP could enter the
mitochondria from the fertilized egg cytoplasm. Shortly after the
mid-blastula transition (MBT), RNA synthesis was detected both in
total RNA and in RNA prepared from isolated mitochondria.
Webb et al. (1975) investigated mitochondrial RNA synthesis
during oocyte maturation by injecting [3H]GTP into full-grown (Stage
VI) and in vitro matured (progesterone treated stage VI oocytes)
oocytes of Xenopus laevis and studied RNA synthesis in a
polyacrylamide gel system. They found that the rate of mtRNA
synthesis remained essentially constant throughout maturation.
Furthermore, their measured rates of mitochondrial rRNA synthesis
were similar to those reported by Chase and Dawid (1972) for pre-
gastrula embryos. They concluded that mtRNA synthesis progresses
throughout the terminal stages of Xenopus oogenesis and its rate of
synthesis remains essentially unchanged by the events associated
with fertilization.
Meziane et al. (1989) directly measured the steady state levels of
mitochondrial RNAs during X. laevis development by Northern
hybridization. In this study, they isolated total RNA from
unfertilized egg and embryos at distinct stages of development,


181
1990; Poyton el al, 1996), which further accentuate the authenticity
of the results obtained in isolated mitochondrial systems.
With the aim of comparing the mitochondrial transcriptional rates
of distinct developmental stages of X. laevis, a mitochondrial run-on
transcription assay was developed for Xenopus eggs and embryos by
modifying the protocol of Gaines et al. (1987). A close correlation
was found between the steady state levels of the mitochondrial RNAs
and transcriptional rates, confirming that transcription is the
primary determinant of the observed differences in mitochondrial
transcript levels across early development of X. laevis. These results,
along with investigations into some of the probable causes of the
differential readiness for transcription in the different stages, are
discussed in the following sections.
Results
Mitochondrial run-on transcription reactions usually allow
elongation of pre-initiated transcription complexes and post-
transcriptional processing of the polycistronic transcripts (Gaines and
Attardi, 1984). In order to test the X. laevis run-on transcription
system for both incorporation of label and post-transcriptional


267
Pralong, W.F., Spat, A., and C.B. Wollheim. 1994. Dynamic pacing of
cell metabolism by intracellular Ca2t transients. J. Biol. Chem.
269:27310-27314.
Raikhinstein, M., and I. Hanukoglu. 1993. Mitochondrial-genome-
encoded RNAs: Differential regulation by corticotropin in bovine
adrenocortical cells. Proc. Natl. Acad. Sci. USA 90:10509-10513.
Read, L.K., Stankey, K.A., Fish, W.R., Muthani, A.M., and K. Stuart.
1994. Developmental regulation of RNA editing and polyadenylation
in four life cycle stages of Trypanosoma congolense. Mol. Biochem.
Parasitol. 68:297-306.
Rizzuto, R., Bastianutto, C., Brini, M., Murgia, M., and T. Pozzan.
(1994). Mitochondrial Ca2+homeostasis in intact cells. J. Cell Biol.
126:1183-1194.
Robberson, D.L., and D.A. Clayton. 1972. Replication of mitochondrial
DNA in mouse L cells and their thymidine kinase derivative:
displacement replication on a covalently-closed circular template.
Proc. Natl. Acad. Sci. USA 69:3810-3814.
Robberson, D.L., Clayton, D.A., and J.F. Morrow. 1974. Cleavage of
replicating forms of mitochondrial DNA by EcoRI endonuclease. Proc.
Natl. Acad. Sci. USA 71:4447-4451.
Robin, E.D., and R. Wong. 1988. Mitochondrial DNA molecules and
virtual number of mitochondria per cell in mammalian cells. J. Cell.
Physiol. 136:507-513.
Roe, B.A., Ma, D., Wilson, R.K., and J.F. Wong. 1985. The complete
nucleotide sequence of the Xenopus laevis mitochondrial genome. J.
Biol. Chem. 260:9759-9774.
Roeder, R.G. 1974a. Multiple forms of deoxyribonucleic acid-
dependent ribonucleic acid polymerase in Xenopus laevis. Isolation
and partial characterization. J. Biol. Chem. 249:241-248.


I 34
I.-STRAND
Frog 1 Frog 2
L-STRAND
PROMOTER
1761
CSB 2
1802
S3 *=
t~-3
1833
CSB 3
1 852
1871


89
Table 3-3. Steady state levels** of mitochondrial RNA (normalized to
mtDNA) during early development of X. laevis.
Egg
6 hr*
9 hr
20 hr
30 hr
48 hr
7 days
ND 1
1.0
1.3
1.5
4.6
7.2
19.5
6.1
ND 4
1.0
1.4
1.6
3.7
6.2
17.7
4.9
Cyt b
1.0
1.2
1.3
4.0
8.1
23.1
6.6
ATPase 6
1.0
1.3
1.2
3.7
8.1
28.7
8.5
CO II
1.0
1.0
1.3
3.7
6.8
19.7
8.0
ND 6
1.0
0.7
1.1
2.8
3.7
8.4
2.3
16 S rRNA
1.0
0.9
1.1
1.9
2.2
3.8
1.3
12 S rRNA
1.0
0.8
1.0
1.7
2.2
4.2
1.9
* Time post-fertilization.
** Steady state level of each developmental stage has been
normalized to the level of mtDNA in that stage and is expressed as
fold over the level in the egg, with the egg level set to unity.


159
Discussion
Footprinting of the D-Loop Upstream Region
One of the most important developments in the field of
mitochondrial gene regulation in this decade has been the discovery
that the mitochondrial transcription factor (mtTFA) is not only an
activator of transcription, but also a mtDNA packaging protein in
yeast (Diffley and Stillman, 1991; 1992), human (Parisi and Clayton,
1991; Fisher et al., 1992), cow (Ghivizzani et al., 1993), and Xenopus
laevis (Antoschechkin and Bogenhagen, 1995; this work). These
proteins belong to the high mobility group of proteins, possessing the
characteristic High Mobility Group (HMG) motif. Most of the HMG
proteins are abundant non-histone nuclear proteins. These include
many DNA-binding proteins, including transcription factors such as
the nucleolar transcription factor hUBF (Jantzen et al., 1990), the
lymphocyte-specific enhancer binding protein LEF-1 (Travis et al.,
1991), and the testis-determining factor SRY (Sinclair et al., 1990).
In all these cases, the HMG domain seems to have an influence in
directing the manipulation of DNA structure, by bending, wrapping
or supercoiling DNA (Lilley, 1992; Grosschedl et al., 1994). The


Fold over egg
9 1
Time post-fertilization


143
Hypersensitive residues at 4729 and 4743 flank the borders of the
tridecamer sequence on either side. Protection within the tridecamer
sequence and hypersensitivity on the flanks (Figure 4-9) suggest a
localized distortion of the DNA structure. Shang and Clayton (1994)
reported that purified human mTERF protein could bend DNA to a
35 angle in in vitro circular permutation assays. In conclusion,
footprinting confirms the in vivo occupancy of the mTERF element in
ovary mtDNA, and the mode of footprinting provides in vivo
confirmation of the in vitro observations of Shang and Clayton (1994)
that mTERF protein causes DNA bending at its binding site.
Relatively little is known about how the mTERF protein
coordinates transcription termination. It is also not known whether
the protein is constitutively bound to its target site at all times,
posing a roadblock to any advancing RNA polymerases, or whether it
gets recruited to its cognate site only during active transcription,
independently or as a component of the transcription machinery. In
vivo footprinting of this site across early development of Xenopus
(during which mitochondrial transcription is clearly regulated),
would be a direct way to look at the occupancy at this site and
answer this question. For this, mitochondrial DNA from unfertilized


254
Costanzo, M.C., and T.D. Fox. 1990. Control of mitochondrial gene
expression in Saccharomyces cerevisiae. Annu. Rev. Genet. 24:91-
113.
Daga, A., Micol, V., Hess, D., Aebersold, R., and G. Attardi. 1993.
Molecular characterization of the transcription termination factor
from human mitochondria. J. Biol. Chem. 268:8123-8130.
Dairaghi, D.J., Shadel, G.S., and D.A.Clayton. 1995. Human mitochon
drial transcription factor A and promoter spacing integrity are
required fro transcription initiation. Biochem. Biophy. Acta.
1271:127-134.
Dawid, I.B. 1965. Deoxyribonucleic acid in amphibian eggs. J. Mol.
Biol. 12:581-599.
Dawid, I.B. 1966. Evidence for the mitochondrial origin of frog egg
cytoplasmic DNA. Proc. Natl. Acad. Sci. USA 56:269-276.
Dawid, I.B., Haynes, S.R., Jamrich, M., Jonas, E., Miyatani, S., Sargent,
T.D., and J.A. Winkles. 1985. Gene expression in Xenopus
embryogenesis. J. Embryol. exp. Morph. 89 (Suppl.): 113-124.
Dawid, I.B., Kay, B.K., and T.D. Sargent. 1983. Gene expression during
Xenopus laevis development. In: Gene Structure and Regulation in
Development, Alan R. Liss, Inc. (New York), pp. 171-182.
Diffley, J.G.X., and B. Stillman. 1991. A close relative of the nuclear,
high-mobility group protein HMG1 in yeast mitochondria. Proc. Natl.
Acad. Sci. USA 88:7864-7868.
Diffley, J.G.X., and B. Stillman. 1992. DNA binding properties of an
HMGl-related protein from yeast mitochondria. J. Biol. Chem.
267:3368-3374.
Doersen, C.-J., Guerrier-Takada, C., Altman, S., and G. Attardi. 1985.
Characterization of an RNase P activity from HeLa cell mitochondria.
J. Biol. Chem. 260:5942-5949.


54
isolate both DNA and RNA in the same solution. For this, a
modification of the protocol of Nelson and Krawetz (1992) by
guanidine thiocyanate/isobutyl alcohol fractionation was tried, in
which the mitochondria were lysed in 4M guanidine thiocyanate,
extracted with phenol:chloroform:isoamyl alcohol (25:24:1, pH 7.0),
and the nucleic acids precipitated with isobutyl alcohol. Although
this method was used successfully, the yields of nucleic acids were
very poor. An alternative, more successful protocol was identical to
the protocol for isolation of mtDNA detailed in the footprinting
section, except that pH 7.0 was maintained in all solutions to
facilitate the simultaneous isolation of RNA and DNA.
Northern Analysis of Mitochondrial RNA
The RNA samples were denatured in 50% formamide, lx MOPS
buffer (20 mM MOPS, pH 7.0, 5 mM sodium acetate, 0.1 mM EDTA),
0.22 M formaldehyde, 40 ug/ml ethidium bromide by heating at
65C for 15 min. The samples were then cooled on ice, loading buffer
added (10 x loading buffer is 1 mM EDTA, pH 8.0, 0.25%
bromophenol blue, 0.25% xylene cyanol, 50% glycerol), and
electrophoresed in 1.2 % formaldehyde agarose gels in a horizontal
gel apparatus (Model H5, BRL) at 80-100 volts. After


I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is
fully adequate, in scope and quality, as a dissertation for the degree
of Doctor of Philosophy.
' Thomas C. Rowe
Associate Professor of
Pharmacology & Therapeutics
This dissertation was submitted to the Graduate Faculty of the
College of Medicine and to the Graduate School and was accepted as
partial fulfillment of the requirements for the degree of Doctor of
Philosophy.
May, 1997
lean, College of Medicine


RNA polymerase makes the H-strand sense of cRNA whereas T7 RNA
polymerase makes the L-strand sense.
pBSNDl. This plasmid (4.066 kb) contains the ND1 gene
sequence information from 4849-5715 (amplified with oligos WH536
& WH537). The insert is cloned in the reverse orientation.
Therefore, the strand sense of the cRNAs are same as above.
pBSCOX II. This plasmid (3.822 kb) contains the Cox II gene
sequence information from 9168-9790 (amplified with oligos WH534
& WH535). The insert is cloned in the reverse orientation.
Therefore, the strand sense of the cRNAs are same as that of pBS16S.
pBSND4. This plasmid (4.362 kb) contains the ND4 gene
sequence information from 12409-13571(amplified with oligos
WH538 & WH539). The insert is cloned in the forward orientation.
Therefore, T3 RNA polymerase makes the L-strand sense of cRNA
whereas T7 RNA polymerase makes the H-strand sense.
pBSCYTb. This plasmid (4.028 kb) contains the Cytb gene
sequence information from 16417-17245 (amplified by oligos
WH529 & WH530). The insert is cloned in the forward orientation.
Therefore, the strand sense of the cRNAs are same as that of pBSND4.
pBSND6. This plasmid (3.63 kb) contains the ND6 gene
sequence information from 16110-15680 (amplified with oligos WH
516 & WH 515). The insert is cloned in the forward orientation with


158
shift experiment carried out by incubating a constant amount of
probe (0.1 pMol per reaction) with increasing amounts of the S-13
mitochondrial lysate from four distinct developmental stages. The
mTERF band shifts can be readily detected even in 5 ug of the S-13
extract (lanes 2, 8, 14, 20 of Figure 4-13A) from the four stages.
Phosphorimager quantitation of the shifted species as a function of
increasing S-13 extract concentration is shown in Figure 4-13B. The
abundance of the shifted species increases with increasing extract
concentration in all four stages, with relatively little differences
among them in the pattern of shifting. The minor differences seen in
the gel shift patterns among the stages (Figure 4-13B) could be due
to slight differences in the actual amounts of mitochondrial protein in
the extracts, due to a certain degree of unavoidable contamination
with cytoplasmic proteins. Also, the gel shift assay is a measure of
only the functional component of the mTERF protein in the extracts.
Therefore, this method is at best only semi-quantitative.
Nevertheless, it allows a comparative estimate of the mTERF protein
levels during basal and activated transcription, which suggest that
the protein levels of mTERF are nearly constant during a period of
vast changes in regulated transcription in the developing embryos.


168
or total amounts of mtDNA, which increase when cells are grown on a
non-fermentable carbon source such as glycerol. But ABF2 is an
extremely abundant protein in yeast, with -250,000 molecules of
ABF2 per cell (Diffley and Stillman, 1991), and mitochondrial
transcription in yeast requires a specificity factor, the sc-mtTFB
protein (Schinkel et al., 1987; Lisowsky and Michaelis, 1988; 1989),
in addition to the RNA polymerase, for transcription initiation, with
ABF2 playing only a minor role. In contrast, the Xenopus
mitochondrial transcriptional apparatus consists of the RNA
polymerase, a basal transcription factor xl-mtTFB, and the specific
activator of transcription, xl-mtTFA (Antoschechkin and Bogenhagen,
1995). Also, h-mtTFA (Fisher et al., 1992) and xl-mtTFA
(Antoschechkin and Bogenhagen, 1995) have an additional carboxy-
terminal extension as well as a linker region between the two HMG
box domains. Therefore, any conclusions about mtTFA derived from
studies on ABF2 cannot be necessarily extrapolated to higher
organisms.
In conclusion, the in vivo footprinting analyses reported here
show that regulation of mitochondrial transcription during X. laevis
does not appear to be a simple matter of varying mtTFA levels, but


194
correlation between the steady state levels and transcriptional
activity (Figure 5-5). Steady state transcript levels were basal up to
10 hours post-fertilization, after which the levels increased to ~4 fold
over egg by 20 hr, 6-8 fold by 30 hr, and 20-28 fold by 48 hr post
fertilization, followed by a lower but significant level of 6-8 fold over
egg by 7 days of development (line graph in Figure 5-5). The
mitochondrial transcriptional activity measured at different times
post-fertilization showed increasing trends several hours prior to the
measured increases in steady state levels (bar graph in Figure 5-5),
assuming that the differences in turnover of the RNAs, if any, are
minimal. For example, the transcription rates of the 14 hr and 20 hr
embryos were 5-6 fold over egg levels, indicating that higher
mitochondrial transcription during these times in vivo would have
allowed the accumulation of the RNA steady state levels to 6-8 fold
over egg from the basal levels found in the unfertilized egg and the 9
hr embryo. Also, the very high transcriptional rates measured in the
mitochondria of the 28 hr embryo, indicating very active
mitochondrial transcription in vivo, would have allowed the dramatic
accumulation (20-28 fold over egg levels) of the transcript levels by
48 hours of development.


22
mtDNA replication, emphasizing the value of this natural model for
studying the developmental regulation of mitochondrial gene
expression. Insights gained in this system should be more or less
generally applicable to mammalian mitochondria, as the size,
structure and organization of Xenopus mtDNA are extremely similar
to that mammals, especially human (Roe et ai, 1985; Dunon-Bluteau
et ai, 1985; Cairns and Bogenhagen, 1986). Additional similarities
can be noted in the similarity of organization of the transcriptional
promoters and mode of transcription from the LSP and HSP
(Bogenhagen and Yoza, 1986; Bogenhagen et ai, 1986; Bogenhagen
and Romanelli, 1988), presence of the transcription factors mtTFA
and mtTFB (Antoschechkin and Bogenhagen, 1995), and the presence
of the tridecamer mTERF element (with only one base change from
the human equivalent) at the 16S rRNA/tRNAUu boundary.
The main focus of this research project was to utilize this natural
model to gain further insights into the molecular mechanisms of the
developmental control of mitochondrial gene expression. However, it
was initially essential to clarify the confusion in the literature
regarding the transcriptional status of the mitochondria during
fertilization and early embryogenesis. To achieve this aim, the steady
state levels of mitochondrial transcripts during early development
were measured by Northern analyses and the value of this system


242
mtTFA protein during both basal (unfertilized eggs and early
embryos) and activated (post-neurula or after 1 day of development)
transcription. Hence, this analysis has uncovered an as yet
unsuspected role of this protein, namely constitutive packaging of
mtDNA. The functional levels of this protein in mitochondria, as
judged by its equivalent occupancy of mtDNA, do not appear to vary
in response to the transcriptional needs of the mitochondria making
the proposed model look untenable, at least in amphibians. However,
it is still possible that the mitochondrial concentrations of mtTFA
may vary as a function of development, as the protein levels were
not directly measured.
Since there were no marked changes in protein-DNA interactions
at the important cis-elements during regulated transcription, the
question of how the cells attain the ability to activate transcription
must assume new dimensions. One possibility is that protein-protein
interactions are important mediators of this event, as footprinting
does not detect such interactions. Another possibility, which is more
consistent with the biology of this organism, is that mitochondrial
transcription may be under the dynamic control of changing
metabolic patterns during embryogenesis. Fertilization induces a


170
Protein-DNA Interactions at the mTERF Element
The mitochondrial transcription termination factor (mTERF) and
its binding site have been intensively studied in the past decade.
This DNA-binding protein binds tightly to mtDNA at its cognate site
with a half-life of 40-50 min (Chomyn et al., 1992). Its function is
widely believed to be attenuation of transcription from the HSP at
the mTERF element, allowing selective amplification of the rRNAs
over the mRNAs. Mutations in or around the binding site of this
protein have been linked with chronic human diseases (Goto et al.,
1990; 1991; 1992; Zeviani et al., 1991), underlining the importance of
mTERF in proper mitochondrial function.
In general, transcription elongation is very processive and
requires special signals for termination. Termination usually
involves three steps: pausing of the elongation complex, release of
the nascent RNA chain, and dissociation of the RNA polymerase.
Termination may be mediated by RNA-binding proteins (e.g. rho-
dependent termination), self-complementary structures in RNA (e.g.
rho-independent termination), or by DNA-binding proteins (e.g.
termination factor for RNA polymerase I, TTF1). The third class of
terminators bind to DNA at a sequence downstream of the 3-end of


135
(either protected or hypersensitive) which appeared in the Egg
(compared to control) also appeared in all the embryonic stages, for
both the H-strand (Figure 4-5) and the L-strand (Figure 4-6). The
same phenomenon was observed in the footprint patterns in the L-
strand of the promoter region (Figure 4-7), namely, footprints which
appeared in the egg (between the two bi-directional promoters and
between LSP2 and CSB3) also appeared in all embryonic stages.
There were no discernible differences in patterns of footprinting
between the stages when transcription was basal (6.5 hr) or
activated (25 hr, 34.5 hr, 56.5 hr).
Footprinting in this regulatory region of mtDNA (from the
promoter region to the replication start sites) has been shown to be
primarily due to the binding of the mtTFA protein to mtDNA in
Xenopus (shown earlier in Figures 4-2 and 4-3; Antoschechkin and
Bogenhagen, 1995), cow (Ghivizzani et al., 1993), yeast (Diffley and
Stillman, 1991; 1992) and human (Fisher et al., 1991; 1992;
Ghivizzani et al., 1994) mitochondria. Hence, the most important
conclusion that emerged from the in vivo footprinting analysis
during early development of X. laevis is that the xl-mtTFA appears to
be constitutively bound to the mtDNA, showing similar methylation


263
Lowry, O.H., Rosebrough, N.J., Farr, A.L., and R.J. Randall. 1951.
Protein measurement with Folin phenol reagent. J. Biol. Chem.
193:265-275.
Madsen, C.S., Ghivizzani, S.C., Ammini, C.V., Nelen, M.R., W.W.
Hauswirth. 1996. Genomic footprinting of mitochondrial DNA: 1. In
organello analysis of protein-mitochondrial DNA interactions in
bovine mitochondria. Meth. Enz. 264:12-22.
Manam, S., and G.C. Van Tuyle. 1987. Separation and
characterization of 5- and 3-tRNA processing nucleases from rat
liver mitochondria. J. Biol. Chem. 262:10272-10279.
Maniatis, T., Fritsch, E.F., and J. Sambrook. 1989. Molecular Cloning:
A Laboratory Manual. Cold Spring Harbor Laboratory Press (Cold
Spring Harbor, New York).
Martens, P.A., and D.A. Clayton. 1979. Mechanism of mitochondrial
DNA replication in mouse L-cells: localization and sequence of the
light-strand origin of replication. J. Mol. Biol. 135:327-351.
Masukata, H., and J. Tomizawa. 1990. A mechanism of formation of
a persistent hybrid between elongating RNA and template DNA. Cell
62:31-338.
Maxam. A.M., and W. Gilbert. 1980. Sequencing end-labeled DNA
with base-specific chemical cleavages. Meth. Enz. 65:499-560.
Mazo, A.M., Minchencko, A.G., Avdonina, T.A., Gause, G.G., Jr., and A.T.
Pusyriov. 1983. Discrete poly (A)RNA species from rat liver
mitochondria are fragments of 16S mitochondrial rRNA carrying its
5 termini. Mol. Bio. Rep. 9:155-161.
McCormack, J.G., and R.M. Denton. 1993. Mitochondrial Ca2+transport
and the role of intramitochondrial Ca2+ in the regulation of energy
metabolism. Dev. Neurosci. 15:165-173.
McKee, E.E., Grier, B.L., Thompson, G.S., and J.D. McCourt. 1990a.
Isolation and incubation conditions to study heart mitochondrial
protein synthesis. Am. J. Physiol. 258:E492-E502.


generalized binding of this protein to any DNA, but phased or
periodic binding to the DNA of mitochondrial regulatory regions
(Diffley and Stillman, 1991; 1992; Fisher et al., 1992; Antoschechkin
and Bogenhagen, 1995). This led to the suggestion that the in vivo
role of this protein might be in packaging of mtDNA regulatory
elements into a specific structural conformation, a suggestion which
has been confirmed for cow (Ghivizzani et al., 1993), human
(Ghivizzani et al., 1994), and Xenopus (this study) mitochondria by in
organello and in vivo footprinting (Madsen et al., 1996; Ammini et
al., 1996).
General processing of the polycistronic transcripts to generate
individual mRNAs is not fully understood yet. The tRNA genes are
interspersed among the H-strand and L-strand encoded protein
genes, with some of them abutting the rRNA or mRNA sequences.
This peculiar arrangement led to the proposal of the tRNA
punctuation model of RNA processing in mitochondria (Ojala et al.,
1981), implying the existence of a very precise processing machinery
which recognizes the tRNA sequences with an RNAse P-like activity,
and the process is believed to occur co-transcriptionally. The
existence of an RNAse P activity in mitochondria of HeLa cells has
been reported (Doersen et al., 1985), and a 5- and 3-tRNA


Figure 3-4. Steady state levels of mitochondrial mRNAs per
unit mitochondrial genome during early development of
Xenopus laevis. The steady state levels of six mitochondrial
mRNAs from each developmental stage as measured by
phosphorimager quantitation of the gels shown in Figure 3-3 have
been normalized to the mtDNA level of the respective developmental
stage and is expressed as fold over egg levels, with the egg level set
to unity.


269
Shang, J., and D.A. Clayton. 1994. Human mitochondrial transcription
termination exhibits RNA polymerase independence and biased
bipolarity in vitro. J. Biol. Chem. 269:29112-29120.
Shang, J., and D.A. Clayton. 1995. A Saccharomyces cerevisiae
mitochondrial transcription factor, sc-mtTFB, shares features with
sigma factor but is functionally distinct. Mol. Cell. Biol. 15:2101-
2108.
Simon, R., Tassan, J.-P., and J.D. Richter. 1992. Translational control
by poly (A) elongation during Xenopus development: differential
repression and enhancement by a novel cytoplasmic polyadenylation
element. Genes Dev. 6:2580-2591.
Simpson. L. 1987. The mitochondrial genome of kinetoplastid
protozoa: genomic organization, transcription, replication, and
evolution. Annu. Rev. Microbiol. 41:363-382.
Sinclair. A.H., Berta, P., Palmer, M.S., Hawkins, J.R., Griffiths, B.L.,
Simith, M.J., Foster. J.W., Frischauf, A.M., Lovell, B.R., and P.N.
Goodfellow. 1990. A gene from the human sex-determining region
encodes a protein with homology to a conserved DNA-binding motif.
Nature 346:240-244.
Stern, S.. Biggers, J.D., and E. Anderson. 1971. Mitochondria and
early development of the mouse. J. Exp. Zool. 176:179-192.
Suck, D.. Lahm, A., and C. Oefner. 1988. Structure refined to 2A of a
nicked DNA octanucleotide complex with DNAase I. Nature 332:464-
468.
Tapper. D.P., and D.A. Clayton. 1981. Mechanism of replication of
human mitochondrial DNA. J. Biol. Chem. 256:5109-5115.
Taylor, K.D., and L. Piko. 1995. Mitochondrial biogenesis in early
mouse embryos: expression of the mRNAs for the subunits IV, Vb,
and Vile of cytochrome c oxidase and subunit 9 (PI) of H+-ATP
synthase. Mol. Reprod. Dev. 40:29-35.


CHAPTER 3
STEADY STATE ANALYSIS OF MITOCHONDRIAL RNA LEVELS
Introduction
Xenopus eggs, as those of other animals, contain large numbers of
mitochondria and consequently large amounts of mtDNA and mtRNA
(Dawid, 1965; 1966). This stockpile of mitochondria, along with
other organelles and macromolecules, are partitioned into the rapidly
dividing embryos, bypassing the need for fresh biogenesis of these
components until later in embryogenesis (Chase and Dawid, 1972).
Active synthesis of mtDNA does not occur till about 40-48 hours of
development. Chase and Dawid (1972) used MC incorporation to
measure mitochondrial rRNA synthesis during early development in
Xenopus laevis by polyacrylamide gel electrophoresis and
scintillation counting of gel slices. Before the gastrula stage (10
hours of development), the rate of synthesis was very low. It
increased 4-5 fold after the gastrula stage and -8-9 fold by
neurulation (by 22 hours post-fertilization). On the basis of these
68


265
Mulligan, R.M., Maloney, A.P., and V. Walbot. 1988. RNA processing
and multiple transcription initiation sites result in transcript size
heterogeneity in maize mitochondria. Mol. Gen. Genet. 211:373-380.
Muise, R.C., and W.W. Hauswirth. 1992. Transcription in maize
mitochondria: effects of tissue and mitochondrial genotype. Curr.
Genet. 22:235-242.
Muise, R.C., and W.W. Hauswirth. 1995. Selective DNA amplification
regulates transcript levels in plant mitochondria. Curr. Genet.
28:1 13-121.
Murphy. W.I., Attardi, B., Tu, C., and G. Attardi. 1975. Evidence for
complete symmetrical transcription in vivo of mitochondrial DNA in
HeLa cells. J. Mol. Biol. 99:809-814.
Mutvei, A., Kuzela, S., and B.D. Nelson. 1989. Control of
mitochondrial transcription by thyroid hormone. Eur. J. Biochem.
180:235-240.
Nakazawa, T., and T. Nunokawa. 1977. Energy transduction and
adenine nucleotides in mitochondria from rat liver after hypoxic
perfusion. J. Biochem. Tokyo. 82:1575-1583.
Nelson, J.E., and S.A. Krawetz. 1992. Purification of cloned and
genomic DNA by guanidine thiocyanate/isobutyl alcohol
fractionation. Anal. Biochem. 207:197-201.
Newport. J., and M. Kirschner. 1982a. A major developmental
transition in early Xenopus embryos: I. Characterization and timing
of cellular changes at the mid-blastula stage. Cell 30:675-686.
Newport. J., and M. Kirschner. 1982b. A major developmental
transition in early Xenopus embryos: II. Control of the onset of
transcription. Cell 30:687-696.
Nick, H., and W. Gilbert. 1985. Detection in vivo of protein-DNA
interactions within the lac operon of Escherichia coli. Nature
313:795-798.


96
When mitochondrial mRNA levels were expressed per unit
mitochondrial genome (Figure 3-3 and Table 3-3), a pattern of
regulation emerged in which mitochondrial mRNA levels were basal
in the unfertilized egg and embryos up to 10 hours post-fertilization
(pre-gastrula stages), after which there was a steady increase in
transcript levels, which culminated in a 20-28 fold increase over egg
levels by 48 hours of development (Figure 3-4). By 7 days of
development, the mRNA levels dropped somewhat from the high
levels found in the 48 hour stage to levels equivalent to those in the
30 hour embryo (6-8 fold over egg). It is possible that transcription
stabilizes to a lower but significant level after an initial burst in
response to some developmental cue.
The findings of this study corroborate and extend earlier reports
in the literature. Studies of mitochondrial mRNA synthesis done
either by micro-injection of 32GTP into oocytes (Webb et al., 1975)
and fertilized eggs (Dawid et al., 1985) or by culturing embryos with
14CO, (Chase and Dawid, 1972) or 32P (Young and Zimmerman, 1973)
all reached the same conclusion that RNA synthesis is basal in the
mature oocyte, unfertilized egg, and fertilized embryos up to the
gastrula stage (10 hours post-fertilization), after which transcription


62
sucrose gradient sedimentation as described. The final
mitochondrial pellets were lysed in 12% TCA by repeated pipeting
and then processed as above.
HPLC Measurements
All HPLC runs were done on a Cl8 silica HPLC column using an
injection volume of 100 ul, the mobile phase being 0.2M sodium
phosphate titrated to pH 5.75 with tetrabutyl ammonium hydroxide
(TBAH), by the isocratic elution mode. Signal amplification, peak
detection, and area quantitations were done using Nelson PE
hardware and software. Standard calibration curves for ATP, ADP,
and AMP were generated using ultrapure ATP, ADP, and AMP
(Sigma), and used to calculate the amounts of the three adenine
nucleotides in the total egg/embryo and mitochondrial TCA extracts.
Estimation of protein concentrations
The adenine nucleotide levels found in each developmental stage
were normalized to the amount of mitochondrial protein in the
respective extract. For this, protein pellets obtained after TCA
precipitation were resuspended in resuspension buffer (Tris, pH 8.5,
0.5% SDS, ImM EDTA, ImM PMSF) using an Eppendorf pestle (Kontes)
and repeated pipeting. After thorough resuspension, the insoluble


32
WH360. 21 base oligonucleotide TGG GGC CTT TAC GGT GTT
GTA. Corresponds to H-strand 4925-4905 (Roe et al., 1985).
Plasmid Clones
The three clones described below were used to make strand-
specific riboprobes for probing Southern blots in the in organello
footprinting experiments. All the clones were constructed as
described below except where indicated. The DNA of the
corresponding region was PCR amplified with the indicated primers.
For this, the primers were first 5'-end phosphorylated with g-32P
using T4 polynucleotide kinase (US Biochemicals) according to
manufacturer's instructions. The kinased primers were then used to
amplify the mtDNA fragments with either Taq DNA polymerase (BRL)
or Pfu DNA polymerase (Stratagene). Then the PCR products were
gel purified (where necessary) and ligated with HincII-linearized pBS
(+/-) phagemid (Stratagene) overnight at room temperature. The
linearized vector was 5'-end dephosphorylated with Shrimp Alkaline
Phosphatase (USB), deactivated at 65C for 15 min. and purified after
organic extractions. Different dilutions of the ligations were used to
transform DH5a cells (BRL) according to the supplier's protocols and
plated on LB plates containing ampicillin, IPTG, and X-gal (Maniatis
et al., 1989) White colonies were screened for the presence of the


171
the nascent transcript and causes pausing of the polymerase and
transcript release (Lang et al., 1994). The mTERF protein apparently
belongs to this class of transcription terminators.
The molecular basis of transcription termination by mTERF is still
unclear. However, the in vitro studies of Shang and Clayton (1995)
with purified mTERF protein suggest that termination may involve
localized distortion of DNA structure by DNA bending, induced by the
binding of this protein to its cognate site. Termination was also
independent of the RNA polymerase used, showing that termination
does not involve specific interactions between the RNA polymerase
and mTERF. This is analogous to the transcriptional termination
induced by the yeast RNA polymerase I transcription terminator
Reblp, which induces all three nuclear RNA polymerases to pause
(Lang et al., 1994), showing that the functioning of the pol I
terminator does not require any specific protein-protein contacts
between Reblp and polymerase.
The mTERF protein has been purified from human mitochondria
by two groups (Kruse et al., 1989; Hess et al., 1991). However, the
gene encoding this important protein has not been cloned yet. Hence,
nothing is known about the regulation of this protein in the cell. At


218
(Barat-Geuride et al, 1989; Antoschechkin and Bogenhagen, 1995)
systems in in vitro assays. Further, Virbasius and Scarpulla (1994)
found recognition sites for nuclear respiratory factors, NRF-1 & NRF-
2, in the proximal promoter of the human mtTFA gene, suggesting
that the cell could vary transcription of the mtTFA gene in response
to oxidative requirements. These findings have led to a popular
model in which fluctuating stoichiometries of this protein could
regulate transcription of mtDNA (Dairaghi et al., 1995; Antoschechkin
and Bogenhagen, 1995). Hence, mtTFA would fit the bill of a
nuclear-encoded candidate protein whose transcription could be
upregulated at some time during Xenopus development, leading to
higher intra-mitochondrial concentrations of this protein and
transcriptional activation, with the level of the factor capable of fine-
tuning the regulation. Although this model has an appealing logic
and has very good in vitro evidence to support it, in vivo evidence
gathered in this study by in vivo footprinting (discussed in Chapter
4) does not support differential occupancy of the mtDNA control
region by xl-mtTFA during basal and activated transcription. Rather,
the protein was found to be constitutively present on mtDNA
between the two bi-directional promoters and in region between the


Figure 5-6. Effect of addition of metabolic intermediates on
the transcription rate of 20 hr stage mitochondria.
A. Equal aliquots of mitochondria isolated from developing embryos
at 20 hours post-fertilization were used for run-on reactions in basic
buffer (panel 1), basic buffer + 10 mM sodium phosphate (panel 2),
basic buffer + 100 uM ADP (panel 3), basic buffer + 1 mM a-
ketoglutarate (panel 4), basic buffer + 10 mM sodium phosphate +
100 uM ADP (panel 5), basic buffer + 10 mM sodium phosphate + 100
uM ADP + 1 mM a-ketoglutarate (panel 6), and basic buffer + 1 mM
ATP (panel 7). The labeled run-on products were then detected by
hybridization with non-radioactive gene- and strand-specific RNA
target panels. The seven target panels were checked for uniformity
of loading and blot transfer by visualization under uv-light (not
shown). Lanes 1-7 detect transcription from the L-strand promoter
(LSP). The lane identification is as follows: D-loop (lane 1), 16S (lane
2), ND4 (lane 3), ND1 (lane 4), Cyt b (lane 5), CO II (lane 6), and ND6
(lane 7). Lanes 8-14 has the same gene order as lanes 1-7 but detect
transcription from the H-strand promoter (HSP). B. Phosphorimager
quantitation of the blot in part A was used to calculate the overall
transcription rate in each treatment and the rate is expressed as fold
over that obtained in the basic buffer. The seven run-on conditions
(bars 1-7) correspond to the same order of conditions described for
panels 1-7 in part A.


Table 5-3. Total adenine nucleotide levels in unfertilized eggs and early developmental stages of
Xenopus laevis
ATP
(pMol)*
(mM)**
ADP
(pMol)*
(mM)**
AMP
(pMol)*
(mM)**
Egg
2034
2.03
115
0.1 1
300
0.30
45 min0
1950
1.95
103
0.10
307
0.31
7 hr0
2030
2.03
114
0.11
310
0.31
21 hr0
1910
1.91
107
0.10
245
0.24
30 hr0
2030
2.03
121
0.12
264
0.26
* pMol per egg or embryo
** Concentrations are expressed as mM assuming a minimum volume of 1 ul for each egg and embryo
0 Time post-fertilization


172
least three scenarios can be envisaged. In the first possibility, the
mTERF protein levels could be actively regulated in response to the
changing transcriptional needs of the cell. Alternatively, the protein
could be always present in mitochondria at similar levels, but would
get recruited to its binding site along with the transcription
machinery during active transcription. However, a third possibility
remains: the protein could be constitutively bound to its site,
providing a physical block to advancing RNA polymerases at all
times, whether transcription is basal or activated.
One of the ways to attempt to resolve these questions would be to
look at the occupancy of the mTERF cis element during regulated
transcription by in vivo footprinting. The Xenopus embryogenesis
system provides a good model of regulated transcription. Although
the presence of the mTERF protein in X. laevis mitochondria has not
been demonstrated yet, Xenopus mtDNA has a tridecamer
termination box at the end of the 16S rRNA gene which is almost
completely identical to the human homologue (a match of 12/13
residues). Hence it was considered extremely likely that a similar
factor existed in Xenopus mitochondria. In order to confirm the
presence of the mTERF protein in Xenopus mitochondria, in organello


20
choosing Xenopus embryos as a model system for this study are
manifold: this vertebrate embryo is accessible in adequate numbers
throughout the year, its biology has been well studied, efficient
synchronous fertilization can be achieved in the laboratory ex vivo, a
considerable amount of molecular studies on mitochondria and
mtDNA metabolism have been done, and the particular features of
mitochondrial biogenesis and nucleic acid metabolism during early
development make it extremely amenable for fulfilling the aims of
this study. The disadvantage of this system is the non-availability of
Xenopus laevis inbred lines, making it essential to utilize eggs and
embryos from a single female frog within one experiment to avoid
sequence heterogeneity.
Oogenesis in Xenopus laevis is generally characterized by the
synthesis and storage of macromolecules like yolk protein (Wahli et
al., 1981), histones (Woodland, 1980), DNA polymerases (Zierler et
al., 1985), and organelles like ribosomes (Bozzoni et al., 1982;
Pierandrei-Amaldi et al., 1982) and mitochondria (Dawid, 1966;
Chase and Dawid, 1972), to enable rapid divisions during early
cleavage of the embryo without fresh biogenesis of these
components. The stockpiling of mitochondria (~107 organelles per
mature oocyte) also necessitates the dramatic amplification of mtDNA
(Webb and Smith, 1977), which accounts for 99 % of the total oocyte


whether transcriptional or post-transcriptionally regulated RNA
stability, is not known. In a differential screen to isolate cDNAs for
mRNAs whose levels are suppressed by interferon treatment, many
mitochondrial mRNAs were picked up (Lou et al., 1994). These
results were confirmed by Northern blot analyses and were found to
be at the level of transcription rather than stability of these RNAs,
and was dependent on protein synthesis. Similar screens have
traced increased expression of mitochondrial-encoded genes in
skeletal muscle of humans with diabetes mellitus (Antonetti et al.,
1995), despite decreases in mtDNA copy number, suggesting that the
increased mitochondrial gene expression may contribute to the
increase in mitochondrial respiration observed in uncontrolled
diabetes.
Control at the level of RNA stability is clearly seen for the tRNAs
(King and Attardi, 1993). The tRNA genes belong to three distinct
transcription units, which exhibit widely different rates of
transcription. Thus, in HeLa cells, the rDNA transcription unit is
transcribed ~25 times more frequently than the mRNA genes
downstream of the mTERF element, while the L-strand transcription
unit is transcribed 10-16 times more frequently than the H-strand
transcription unit (Chomyn and Attardi, 1992; King and Attardi,
1993). Despite these wide differences in transcription rates of the


72
synthesis were observed only after the mid-blastula transition.
Thus, earlier studies do not support the observation by Meziane et al.
(1989) that mRNA levels decrease after fertilization and remain at a
very low level till the late neurula stage. Hence, the findings of
Meziane et al. (1989) remain a solitary piece of evidence suggesting
that fertilization in Xenopus laevis induces a rapid shutdown of
mitochondrial transcription.
To resolve these issues and extend our understanding of
mitochondrial transcriptional regulation in the Xenopus laevis
embryogenesis system, I re-investigated the steady state levels of
mitochondrial RNAs during early development of X. laevis. The
pattern of early developmental steady state levels of mitochondrial
mRNAs I observed were not in agreement with their results. My
interpretation of these discrepancies and additional experiments
which clarify the situation are presented in the following sections.
Results
Xenopus eggs were fertilized in vitro as described in Materials
and Methods. Developmental stages were identified according to the
Nieuwkoop-Faber tables (Nieuwkoop and Faber, 1967). Total RNA


252
Chang, D.D. and D.A. Clayton. 1989. Mouse RNAase MRP RNA is
encoded by a nuclear gene and contains a decamer sequence
complementary to a conserved region of mitochondrial RNA
substrate. Cell 56:131-139.
Chang, D.D., Hauswirth, W.W., and D.A. Clayton. 1985. Replication
priming and transcription initiate from precisely the same site in
mouse mitochondrial DNA. EMBO J. 4:1559-1567.
Chase, J.W., and LB. Dawid. 1972. Biogenesis of mitochondria during
Xenopus laevis development. Dev. Biol. 27:504-518.
Chau, C.A., Evans, M.J., and R.C. Scarpulla. 1992. Nuclear respiratory
factor 1 activation sites in genes encoding the gamma-subunit of ATP
synthase, eukaryotic initiation factor 2a, and tyrosine
aminotransferase. Specific interaction of purified NRF-1 with
multiple target genes. J. Biol. Chem. 267:6999-7006.
Chomczynski, P., and K. Mackey. 1995. Modification of the TRI
reagent procedure for isolation of RNA from polysaccharide- and
proteoglycan-rich sources. BioTechniques 19:942-945.
Chomyn. A., and G. Attardi. 1992. Recent advances in mitochondrial
biogenesis. In: Molecular Mechanisms in Bioenergetics (Ernster, L.
ed.), Elsevier Science Publishers (New York), pp.483-509.
Chomyn. A., Martinuzzi, A., Yoneda, M., Daga, A., Hurko, O., Johns, D.,
Lai, S.T.. Nonaka, I., Angelini, C., and G. Attardi. 1992. MELAS
mutation in mtDNA binding site for transcription termination factor
causes defects in protein synthesis and in respiration but no change
in levels of upstream and downstream mature transcripts. Proc. Natl.
Acad. Sci. USA 89:4221-4225.
Chomyn, A., Mela, G., Bresolin, N., Lai, S.T., Scarlato, G., and G.
Attardi. 1991. In vitro genetic transfer of protein synthesis and
respiration defects to mitochondrial DNA-less cells with myopathy-
patient mitochondria. Mol. Cell. Biol. 11:2236-2244.


235
distinct embryonic stages (Chapter 5). Transcription rates were basal
in the unfertilized eggs and early embryos (upto 10 hours post-
fertilizaton), slightly stimulated (4-6 fold over egg levels) in the 14
hr and 20 hr. embryos, dramatically increased in the 28 hr stage (72
fold over egg), and were slightly lower but significantly up-regulated
in the 48 hr tadpole (36 fold over egg). Comparison of the timing
and fold-induction of transcription rates and steady state transcript
levels during early development showed a very good correlation .
Increased levels of transcripts at each developmental timepoint were
preceded a few hours before by active transcriptional activity in the
isolated mitochondria, suggesting that this increased transcription
could directly account for the accumulation of the mRNAs and rRNAs.
The coordinate pattern of transcript abundance irrespective of the
developmental timepoint suggests that there are no gross differences
in the turnover rates of these transcripts as a function of
development. On the basis of these data, I conclude that the primary
determinant of RNA (both mRNA and rRNA) steady state levels
during early development of X. laevis is the varying levels of
activation of mitochondrial transcription in the developing embryo.


193
activity, with the transcription rate from the LSP and HSP being 25
fold and 91 fold higher than egg levels, respectively (Figure 5-4A).
Mitochondrial transcription in the 48 hr embryo, although 2 fold less
than the 28 hr stage, was still significantly elevated, being 15 fold
and 44 fold higher than egg levels for the LSP and HSP, respectively
(Figure 5-4A). Comparison of the activity of the two promoters
(Table 5-1) shows the HSP to be 2-3 fold more active than LSP up to
the 20 hr stage, and 8-9 fold more active at later times. Therefore,
the HSP appears to be intrinsically more active in vivo, in agreement
with the in vitro findings of Antoschechkin and Bogenhagen (1995).
In conclusion, the overall picture was one in which mitochondrial
transcription was basal in the unfertilized egg and slightly stimulated
(2-6 fold over egg) in early embryos up to 20 hours of development,
after which there was a dramatic activation of transcriptional
activity by 28 hours of development (72 fold over egg). The rates
then dropped to slightly lower but significant (36 fold over egg)
levels in the 48 hour-old embryo (Figure 5-4B). A comparison of the
mitochondrial transcription rates of these distinct developmental
stages with the steady state levels of mitochondrial transcripts across
early development of X. laevis (discussed in Chapter 3) shows a good


mitochondrial transcription termination factor (mTERF), has been
isolated from human mitochondria (Kruse et al., 1989; Hess et al.,
1991) and shown to cause sequence-specific termination of
transcription in vitro. Regulation of mRNA levels has been shown to
operate at the level of differential transcription in some cases. In
yeast, the relative strengths of the multiple promoters, which vary
over a 20-fold range, coupled with transcriptional attenuation
(Mueller and Getz, 1986) of the polycistronic units, have been shown
to dictate transcript levels in mitochondrial run-on assays. Thyroid
hormone is a physiological effector of mammalian mitochondrial
biosynthesis, influencing respiration, cytochrome content, protein
synthesis and increasing mitochondrial RNA levels (Kadenbach et al.,
1964). Mutvei et al. (1989) showed by run-on transcription assays
that the increased mitochondrial transcript levels in rat liver during
thyroid hormone treatment were due to increased mitochondrial
transcription. Many central regulatory events of hormone action are
being increasingly traced to their effects on mitochondrial gene
expression by increasing mitochondrial transcript levels. Androgen
treatment of mice (Cornwall et al., 1992), and corticotropin treatment
of bovine cultured cells (Raikhinstein and Hanukoglu, 1993) both
cause the induction of mitochondrial RNAs, as shown by subtractive
hybridization screens, although the exact mechanism of regulation,


82
Table 3-2. Mitochondrial mRNA steady state levels** in isolated
mitochondria from distinct developmental stages of X. laevis.
Egg
13 hr*
22 hr
43 hr
ND1
1.0
0.9
1.3
3.4
ND4
1.0
0.6
0.8
2.8
Cyt b
1.0
0.5
0.8
3.1
CO II
1.0
0.9
1.2
3.0
ND6
1.0
0.8
0.8
0.8
* Hours post-fertilization.
** The steady state level of each stage has been normalized to the
16S rRNA level in that stage and is expressed as fold over egg, with
the egg levels set to unity.


LIST OF REFERENCES
Albring, M., Griffith, J., and G. Attardi. 1977. Association of a protein
structure of probable membrane derivation with HeLa cell
mitochondrial DNA near its origin of replication. Proc. Natl. Acad. Sci.
USA 74:1348-1352.
Aloni, Y., and G. Attardi. 1971. Symmetrical in vivo transcription of
mitochondrial DNA in HeLa cells. Proc. Natl. Acad. Sci. USA 68:1757-
1761.
Ammini, C.V., Ghivizzani, S.C., Madsen, C.S., and W.W. Hauswirth.
1996. Genomic footprinting of mitochondrial DNA:II. In vivo analysis
of protein-mitochondrial DNA interactions in Xenopus laevis eggs and
embryos. Meth.Enz. 264:23-36.
Annex, B.H., and R.S. Williams. 1990. Mitochondrial DNA structure
and expression in specialized subtypes of mammalian striated
muscle. Mol. Cell. Biol. 10:5671-5678.
Antonetti, D.A., Reynet, C., and C.R. Kahn. 1995. Increased expression
of mitochondrial-encoded genes in skeletal muscles of humans with
diabetes mellitus. J. Clin. Invest. 95:1383-1388.
Antoshechkin, I and D.F. Bogenhagen. 1995. Distinct roles for two
purified factors in transcription of Xenopus mitochondrial DNA. Mol.
Cell. Biol. 15:7032-7042.
Aprille, J.R. 1986. Perinatal development of mitochondria in rat
liver. In: Mitochondrial Physiology and Pathology (Fiskum, G. ed.),
Van Nostrand Reinhold (New York), pp. 323-332.
248


236
Although mitochondrial transcription has been shown to regulate
transcript levels in the developing embryo, control of mitochondrial
gene expression as a function of development appears to have
additional layers of regulation. In other words, resumption of
mitochondrial transcription does not appear to necessarily correlate
with increased levels of mitochondrial gene products, suggesting
additional regulation of mitochondrial protein synthesis during early
development. An example of this phenomenon is the regulation of
cytochrome oxidase activity during embryogenesis. Chase and Dawid
(1972) measured the total cytochrome oxidase activity in crude
homogenates of X. laevis embryos. There was no net increase in the
amount of cytochrome oxidase per embryo from its initial value of
0.031 gatom oxygen/min/embryo until stage 38 (60 hours post
fertilization), after which it increased and had doubled by 4 days of
development. The pattern of accumulation of mitochondrial protein
(an indicator of mitochondrial biogenesis) followed similar trends,
with increases seen only after 60 hours of development, indicative of
production of new mitochondria. Therefore, the specific activity of
cytochrome oxidase (activity per total mitochondrial protein)
remained essentially constant during embryogenesis.


Figure 4-7. In vivo footprinting of the L-strand of the
promoter region during early development of X. laevis. The
developmental stages and frogs are the same as those shown in
Figures 4-5 and 4-6. Samples were processed for primer extension
footprinting exactly as described in the Figure 4-5 legend, with the
following changes. Linear amplification of the footprint ladder was
perfomed using 32P-end labeled primer WH 355. Denaturation was
done at 94C for 4 min, followed by 15 cycles with the profile: 94C
for 1 min, 53C for 1 min, 72C for 3 min. Following the reaction, the
samples were phenol extracted, ethanol precipitated, run on 6%
sequencing gels, and autoradiographed. Nucleotide numbering is
according to Roe et al. (1985). The positions and direction of the two
bidirectional promoters are also indicated. The open circles indicate
nucleotide residues protected from DMS methylation.


o
c
Egg
6 hr
9 hr
20 hr
30 hr
48 hr
7 days
a >
Egg
6 hr
9 hr
20 hr
30 hr
48 hr
7 days
Egg
6 hr
9 hr
20 hr
30 hr
48 hr
7 days
IS


Figure 4-4. Schematic view of protein-DNA interactions detected by in organello
footprinting of the D-loop upstream region. The cartoon on top represents the D-loop region of X.
laevis, showing the D-loop DNA (solid line), replication primer provided by transcription from the LSP
(dotted line), the three conserved sequence boxes (CSB 1, 2, 3), and the two bidirectional promoters.
The hatched box between the two bidirectional promoters represents the critical region to which xl-
mtTFA (grey blob) binds and activates transcription bidirectionally. The cartoon below is a blowup of
the D-loop upstream region depicting a summary of protein-DNA interactions detected by the in
organello footprint analysis shown in Figures 4-2 and 4-3. The spacing between the CSBs and the
transcription start sites are shown by the bars below. Based on a comparison of the in organello
footprints with the in vitro DNAse I footprints of xl-mtTFA (Antoschechkin and Bogenhagen, 1995), the
phased pattern of binding in this region appears to be primarily due to binding of xl-mtTFA to mtDNA.
Note that a minimum spacing of -35 bp seems to allow the binding of one unit of mtTFA.


233
levels in this developmental system. Total embryonic RNA levels
fluctuate dramatically as a function of development, with active
nuclear transcription resuming in the embryo soon after the mid-
blastula transition (Newport and Kirschner, 1982b). In addition to
new transcription, the phenomena of fertilization-induced
translational activation of maternal transcripts by cytoplasmic
polyadenylation (Colot and Rosbash, 1982; Dworkin et al., 1985; Paris
et al., 1991; Paris and Richter, 1990; Simon et al., 1992) or
deadenylation (Legagneaux et al., 1992), also adds to the flux in RNA
mass. Hence, the concentration of mitochondrial transcripts, which is
quite high in the unfertilized egg, becomes progressively diluted as
development proceeds. Therefore, an assessment of mitochondrial
transcript levels in the context of this fluctuating total RNA levels
would be subject to animal, strain, genetic, and environmental
variations.
To remove the interference from the abundant nuclear and
cytoplasmic RNA, RNA was isolated form purified mitochondria and
mitochondrial DNA was used to normalize the mitochondrial RNA
levels, because mtDNA is a macromolecular species whose relative
levels do not fluctuate during early development (Chase and Dawid,


115
analyses would lend more insight into the roles played by the mtTFA
and mTERF protein in the regulation of transcription.
Results
In Organello Footprinting of the D-Loop Upstream Region
In vivo footprinting is a powerful technique to investigate DNA-
protein interactions in living cells (Nick and Gilbert, 1985: Church et
al., 1985). In organello footprinting to study protein-mitochondrial
DNA interactions in isolated organelles was developed in our
laboratory (Ghivizzani et al., 1993). I adapted this protocol to
Xenopus laevis for both in organello footprint analysis of isolated
ovary mitochondria as well as in vivo footprint analysis of eggs and
embryos (Ammini et al., 1996).
The technical steps involved in in vivo footprinting using
dimethyl sulfate (DMS), a small, rapidly diffusible molecule, are
outlined in Figure 4-1. In step 1, a hypothetical protein-DNA
interaction is schematized. When cells are treated with DMS,
genomic DNA is methylated at the N-7 position of guanines and N-3
position of adenines. Methylation times and concentrations are
varied so as to obtain a partial methylation of the G residues, as in


273
Zeviani, M. Gellera, C., Antozzi, C., Rimoldi, M., Morandi, L., Villani, F.,
Tiranti, V., and S. DiDonato. 1991. Maternally inherited myopathy
and cardiomyopathy: association with mutation in mitochondrial DNA
tRNA (leu) (UUR). Lancet 338:143-147.
Zierler, M.K., Marini, N.J., Stowers, D.J., and R.M. Benbow. 1985.
Stockpiling of DNA polymerases during oogenesis and embryogenesis
in the frog, Xenopus laevis. J. Biol. Chem. 260:974-981.


255
Drew, H.R., and A.A. Travers. 1988. DNA structural variations in the
E. coll tyrT promoter. Cell 37:491-502.
Dunon-Bluteau, D.C., and G.M. Brun. 1987. Mapping at the nucleotide
level of Xenopus laevis mitochondrial D-loop H strand: structural
features of the 3 region. Biochem. Int. 14:643-657.
Dunon-Bluteau, D.C., Voitovich, M., and G.M. Brun. 1985. Nucleotide
sequence of a Xenopus laevis mitochondrial DNA fragment containing
the D-loop, flanking tRNA genes and the apocytochrome b gene. Gene
35:65-78.
Dworkin, M.B., and E. Dworkin-Rastl. 1989. Metabolic regulation
during early frog development: glycogenic flux in Xenopus oocytes,
eggs, and embryos. Dev. Biol. 132:512-523.
Dworkin, M.B., and E. Dworkin-Rastl. 1990. Regulation of carbon flux
from amino acids into sugar phosphates in Xenopus embryos. Dev.
Biol. 138:177-187.
Dworkin, M.B., and E. Dworkin-Rastl. 1991. Carbon metabolism in
early amphibian embryos. TIBS 16:229-234.
Dworkin, M.B., and E. Dworkin-Rastl. 1992. Glycogen breakdown in
cleaving Xenopus embryos is limited by ADP. Mol. Reprod. Dev.
32:354-362.
Dworkin, M.B., Shrutkowski, A., and E. Dworkin-Rastl. 1985.
Mobilization of specific maternal RNA species into polysomes after
fertilization in Xenopus laevis. Proc. Natl. Acad. Sci. USA 82:7636-
7640.
Enriquez, J.A., Perez-Martos, A., Lopez-Perez, M.J., and J. Montoya. In
organello RNA synthesis system from mammalian liver and brain.
Meth. Enz. 264:50-56.
Evans, M.J., and R.C. Scarpulla. 1989. Interaction of nuclear factors
with multiple sites in the somatic cytochrome c promoter.
Characterization of upstream NRF-1, ATF and intron Spl recognition
sites. J. Biol. Chem. 264:14361-14368.


Figure 5-3. Mitochondrial run-on transcription in early
developmental stages. A. Run-on transcription reactions were
performed using mitochondria isolated from unfertilized eggs and
embryonic stages at different times post-fertilization (shown beside
each panel), and the radiolabeled run-on products used to probe the
cold target panels (Figure 5-2B), as described in Materials and
Methods. The hybridized filters were then washed under stringent
conditions and autoradiographed or exposed to phosphorimager
screens for quantitation. It will be noted that the last two panels
have higher backgrounds, which could not be removed even by very
stringent washes. Therefore, the bands were quantitated in the
phosphorimager using the average background of six different
locations on the entire filter. Background correction values were 15-
20 fold more for the last two panels compared to the other four
panels. The gene- and strand-specific identities of each band are
shown on top of the figure (lanes 1-6). B. 10% of the mitochondria
from the run-on reaction of each developmental stage (before
radiolabel addition) were used to quantitate the mtDNA level in that
sample by dot blotting after RNAse treatment and alkali
denaturation as described in Materials and Methods. The blots were
autoradiographed and exposed to phosphorimager screens for
quantitation. These quantitations were used to normalize the values
of transcription rate for each developmental stage (Table 5-1).


180
of the long half-life of these rRNAs (-50 hours) measured by Chase
and Dawid (1972), suggesting that the increased rRNA levels must be
due to active transcription rather than differential turnover. Taken
together, the coordinate pattern of changes in mRNA and rRNA
abundance strongly suggests that the primary determinant of
increased steady state levels of mitochondrial transcripts during
early embryogenesis of X. laevis is increased transcription of mtDNA.
One of the most direct ways to confirm this suggestion is to
measure the mitochondrial transcription rate across early
development of X. laevis using a mitochondrial run-on transcription
assay with isolated mitochondria. Mitochondrial run-on transcription
systems have been described for plants (Muise and Hauswirth,
1992), yeast (Poyton et al., 1996), HeLa cells (Gaines, 1996),
mammalian liver and brain (Enriquez et al., 1996). The close
correspondence between the in organello and in vivo transcripts in
initiation sites and processing patterns is well established (Gaines
and Attardi, 1984; Gaines et al., 1987), making it a valuable tool for
the analysis of organelle gene expression. In organello mitochondrial
protein synthesis systems have also been described (McKee et al.,


251
Brown, W.M., and J. Vinograd. 1974. Restriction endonuclease
cleavage maps of animal mitochondrial DNAs. Proc. Natl. Acad. Sci.
USA 71:4617-4621.
Busa, W.B., Ferguson, J.E., Joseph, S.K., Williamson, J.R., and R.
Nuccitelli. 1985. Activation of frog (Xenopus laevis) eggs by inositol
triphosphate. 1. Characterization of Ca2+release from intracellular
stores. J. Cell Biol. 101:677-682.
Busa, W.B., and R. Nuccitelli. 1985. An elevated free cytosolic Ca2*
wave follows fertilization in eggs of the frog, Xenopus laevis. J. Cell
Biol. 100:1325-1329.
Cairns, S.S., and D.F. Bogenhagen. 1986. Mapping of the Displacement
loop within the nucleotide sequence of Xenopus laevis mitochondrial
DNA. 261:8481-8487.
Cantatore, P., Polosa, P.L., Fracasso, F., Flagella, Z., and M.N. Gadaleta.
1986. Quantitation of mitochondrial RNA species during rat liver
development: the concentration of cytochrome oxidase subunit I
(Col) mRNA increases at birth. Cell Differ. 19:125-132.
Capaldi. R.A. 1990. Structure and assembly of cytochrome c oxidase.
Arch. Biochem. Biophys. 280:252-262.
Chang, D.D. and D.A. Clayton. 1984. Precise identification of
individual promoters for transcription of each strand of human
mitochondrial DNA. Cell 36:635-643.
Chang, D.D. and D.A. Clayton. 1985. Priming of human mitochondrial
DNA replication occurs at the light-strand promoter. Proc. Natl. Acad.
Sci. USA 82:351-355.
Chang, D.D. and D.A. Clayton. 1987a. A novel endoribonuclease
cleaves at a priming site of mouse mitochondrial DNA replication.
EMBO J. 6:409-417.
Chang, D.D. and D.A. Clayton. 1987b. A mammalian mitochondrial
RNA processing activity contains nucleus-encoded RNA. Science.
235:1 178-1 184.


245
had 2 fold higher levels of ATP and ATP/ADP ratios, indicating
higher oxidative metabolism in the 30 hr stage. These changes in
mitochondrial ATP levels happened in the context of constant levels
of total ATP in the eggs or early embryonic stages. Mitochondrial
transcription rates correlated with these differences in energy
metabolism, transcription rate being basal in the early embryos and
highly activated in the 28 hr stage.
The above results strongly suggest that the state of mitochondrial
metabolism during embryogenesis is likely to be a major player in
the regulation of mitochondrial transcription. This would be a major
new way to view mitochondrial gene regulation. It is also possible
that the changing metabolic patterns could induce structural changes
in the mitochondria, leading to differentiation of mitochondria from a
condensed, metabolically less active, embryonic state to a swollen,
metabolically more active, adult state. Such phenomena have been
noted during early development of mouse (Ginsberg and Hillman,
1973; Piko and Chase, 1973) and Bufo arenarum (Salomon de
Legname et al., 1977) embryos. However, in these two organisms,
such changes are coupled with a progressive decline in total ATP
levels of the embryo during development. This situation is not seen


29
experiments where further purification of mitochondria was
necessary (e.g. ATP measurement studies), mitochondria were
purified in a scaled-down sucrose gradient in a TLS-55 rotor. This
gradient was pre-formed with 0.8 ml each of 51% sucrose and 34%
sucrose, and the mitochondrial pellet was resuspended in 20%
sucrose and layered on top in a volume of 0.6 ml. The gradient was
spun at 37,000 rpm in a TLS-55 rotor in a TL100 centrifuge
(Beckman) for 10 min. The mitochondrial band at the 34%/51%
sucrose interface was collected, diluted with an equal volume of MSE
buffer and re-pelleted in an Eppendorf centrifuge at 9,000 x g for 2
min.
Isolation of Mitochondria from Ovary Tissue
Isolation of mitochondria from ovaries of adult frogs was done
according to the protocol used for purification of bovine brain
mitochondria by Hehman and Hauswirth (1992), with the
modifications described below. Whole ovaries were dissected from
anesthetized female frogs and dropped into chilled MSB-Ca++ buffer
(about 100 ml/ovary). The tissue was minced and, homegenized in a
glass homegenizer by three strokes of a motor driven, teflon coated
pestle. Then EDTA was added to a final concentration of 20mM. This
was then passed through three layers of cheese cloth and centrifuged


238
(Huther and Kadenbach, 1986; Bisson et al., 1987; Gai et al., 1988;
Ewart et al., 1991). Hence, it is possible that the constant level of CO
activity measured by Chase and Dawid (1972) during X. laevis
embryogenesis may be correlated with constant levels of the CO
proteins. In contrast, the steady state levels of CO II mRNA levels
during early development showed an increasing trend, with levels
being basal until 10 hours post-fertilization, after which it increased
to 4 fold over egg levels by the 20 hr stage, 7 fold by the 30 hr stage,
and 20 fold by the 48 hour-old tadpole. By 7 days of development,
the levels had dropped to 7 fold over egg levels, comparable to the
30 hr embryo. The same pattern is likely to hold for the two other
subunits of CO (CO I & II), because of the polycistronic nature of
mitochondrial transcription and the coordinate regulation of 7 other
mRNAs analyzed in this study. Therefore, increased transcription of
the mitochondrial subunits of CO does not translate directly into
increased CO activity.
There are at least two possible reasons for the lack of concordance
between these molecular events. In one possible scenario, regulation
could be at a translational level, with active translation of mRNAs in
the mitochondria occurring only late in embryogenesis, just


Figure 4-1. General scheme for in vivo DNA footprinting. DNA is methylated at the N-8
position of guanosine and the N-3 position of adenosine in vivo or in organello by dimethyl sulfate
(DMS) treatment of intact cells or isolated mitochondria. Binding of a protein in vivo would lead to
either protection or hypersensitivity of the corresponding G residue in genomic DNA. The DMS treated
mitochondrial DNA is then isolated and cut with a suitable restriction enzyme to provide a reference
point for detection by Southern blotting. For primer extension footprinting, the reference point is
provided by the primer annealing site. Unmodified genomic DNA is isolated in parallel by similar
procedures, and the naked DNA is DMS modified in empirical reactions till patterns matching in vivo
methylation are obtained. Modified in vivo and naked DNA are then cleaved at the methylated residues
to generate the footprint ladder by piperidine treatment as described in Materials and Methods. The
footprint ladder is then detected by running the cleaved in vivo and naked DNA in parallel lanes of a 6%
sequencing gel and Southern blotting with short riboprobes (-200 nt. long) hybridizing near the
reference point. When starting material is low (as with fertilized embryos), an alternative method of
detection is employed. The cleaved footprint ladder is linearly amplified for 15 cycles with Taq DNA
polymerase using a 32P-end labeled primer annealing to the reference point. The primer extension
reactions are then resolved on a 6% sequencing gel and autoradiographed to obtain the in vivo footprint
pattern. The filled square shown above the sequencing gel refers to an example of a DMS-
hypersensitive band, and the open circle to a DMS-protected band.


tRNAeU 16 S rRNA
140
I-STRAND H-STRAND
4625
4655
4668
4697
4750
4757
4773
4786


Figure 2-2. Experiment comparing 3 different thermostable
DNA polymerases for accurate amplification of the footprint
ladder. The performance of two thermostable polymerases, Vent
DNA polymerase (NEB) and Pfu DNA polymerase (Stratagene), which
possess 3-5 proofreading ability in addition to the polymerase
activity, were compared with Taq DNA polymerase (GIBCO BRL),
which does not possess the 3-5 proofreading function. DNA
template and primer were the same as that described for Figure 2-1.
Each 100-ul reaction was assembled in the manufacturers
recommended buffer, with 2 mM MgCl2, 1 pMol 32P-end labeled
primer, the indicated dNTP concentrations, and 2-2.5 units of the
respective enzyme. The samples were denatured at 94C for 5 min,
then cycled for 5 cycles with the profile: 94C for 2 min, 65c for 1
min, 72C for 5 min, followed by 10 cycles with the profile: 94C for
2 min, 68 for 30 sec, 72C for 3 min. The reactions were then
phenol extracted, ethanol precipitated, run on 6% sequencing gels
and autoradiographed. Note that only Taq DNA polymerase gives
reproducible banding patterns at a wide range of dNTP
concentrations.


30
in a JA10 rotor at 1,500 x g for 10 min; the supernatant was collected
and recentrifuged as above. The supernatant from the second spin
was centrifuged in a JA10 rotor at -17,700 x g for 45 min. The
pellets were gently resuspended in 10 ml of MSB-EDTA per 40 ml of
discarded supernatant and re-spun at -23,000 x g in a JA17 rotor for
20 min. Each pellet was brought up in 10 ml of 20% sucrose-TE
buffer and layered on top of a sucrose step gradient (10 mis each of
51% and 34% sucrose-TE). The gradients were then spun in a
Beckman SW27 rotor at 22,000 rpm for 20 min. The mitochondrial
band at the 34%/51% sucrose interface was carefully collected with a
Pasteur pipet, diluted with an equal volume of MSB-EDTA and
pelleted at -23,000 x g in a JA17 rotor. The pellets were then
processed for in organello methylation or quick-frozen in a dry
ice/ethanol bath and stored at -70C.
Dimethyl Sulfate Footprinting of Mitochondrial DNA
Oligonucleotides
WH352. 21 base oligonucleotide ACT CAA ACC TCC ACT ATT
GAC. Corresponds to mitochondria] L-strand sequence 17498-17518
(Roe et al., 1985).


CSB 1 2 3
D-loop 5 ends
LSP1 HSP1
M
LSP2 HSP 2
\:l O G2>
CSB 1
CSB 2 CSB 3
to
oo
25 bp
85 bp
35 bp
150 bp
45 bp


56
mitochondrial genome. For this, the samples were incubated with 3
ul of RNase Cocktail (Ambion, Inc.) at 37C for 15 to degrade RNA.
The samples were then adjusted to 0.4 M NaOH and denatured at
96C for 10, cooled on ice and SSC added to lOx. The samples were
then filtered through a pre-wetted nylon N+ membrane in a dot blot
apparatus (Bio-Rad). The dots were washed three times with 500 ul
of lOx SSC, air-dried, uv-crosslinked, and hybridized with mtDNA
specific riboprobes using the hybridization buffer system of Church
and Gilbert (1984) described in the footprinting section. The
Phosphorimager quantitation of mtDNA on the dot blots were used to
normalize the levels of the mitochondrial RNAs (measured by
Northern analyses) to unit mitochondrial genome.
Mitochondrial Run On Transcription
Oligonucleotides
WH540. 22 base oligonucleotide CCG ACG TCT GCA GTA AGT
CAT G. Corresponds to the L-strand sequence 1603-1624 in Dunon-
Bluteau et al. (1985).
WH541. 21 base oligonucleotide CAG ATT CAC TAC CGA CAG
ATG. Corresponds to the H-strand sequence 3078-3058 in Dunon-
Bluteau et al. (1985).


219
promoters and H-strand replication start site (discussed in Chapter 4;
see Figures 4-5, 4-6, and 4-7). Hence the in vivo levels of this
protein are not correlated with changes in the transcriptional status
of mitochondria. Changes in the level of this protein, if any, may
have other, as yet unidentified functions. Other than the mtTFA,
none of the other known mitochondrial proteins appear to fit the
criteria of a global regulator of transcription, except possibly the
mitochondrial RNA polymerase itself.
From a broader perspective, the second scenario mentioned above
appears to have more relevance to the unique features of this
developmental model. The developing Xenopus embryo is fully
dependent on the stockpiled maternal nutrient resources in the egg
such as yolk and glycogen (approximately 5% of the dry weight of
amphibian eggs is glycogen) for its early development. Metabolic
studies of carbon flow during amphibian development have revealed
several interesting features, the central theme being one of
developmental differences in carbon metabolism.
In spite of the huge reserves of glycogen in the egg, cleaving
embryos display an unorthodox metabolism in that they do not
efficiently oxidize stored carbohydrate but rather appear to use


3
Theoretically, a defect in any one of the three to four hundred plus
genes (nuclear- or mitochondrial-encoded) involved in
mitochondrial biogenesis can weaken mitochondrial function, leading
ultimately to chronic degenerative disease. If the mutation is in
mtDNA, an intracellular mixture of normal and mutant mtDNAs is
created- a phenomenon called heteroplasmy (Wallace, 1993).
Replicative segregation of heteroplasmic genotypes towards
homoplasmic types leads to rapid fixation of the mutations (Laipis et
al., 1988; Yoneda et al., 1992). Cellular model systems, where human
cells lacking mtDNA are repopulated with exogenous mitochondria
from patients with mitochondrial myopathies (King and Attardi,
1988; 1989; Chomyn et al., 1991) have provided elegant tools to
study the role of these mtDNA mutations in cellular physiology.
These studies show that even 10-15% of wild type mtDNA, when
present in the same organelle with 85-90% mutant mtDNA, has a
protective effect against protein synthesis and respiration defects,
(Yoneda et al., 1994; Attardi et al., 1995). In human disease, a
similar mechanism is presumed to induce disease when the genetic
threshold is crossed. This explains how a mtDNA mutation can be
present at birth, yet only be clinically manifest in the adult or
primarily affect only certain tissues. In higher plants, mitochondrial
dysfunction, resulting from rearrangements in mtDNA, or


104
The human mtTFA (hu-mtTFA) is not as abundant as ABF2, with
minimum estimates of at least 15 protein monomers per mtDNA in
human KB cells (Fisher et al., 1991). The Xenopus mtTFA (xl-mtTFA)
occurs at approximately 200 copies per mtDNA molecule in total
ovary mitochondria, allowing 1 xl-mtTFA molecule per 90 bp of
mtDNA (Antoschechkin and Bogenhagen, 1995). Therefore, the
abundance of xl-mtTFA is intermediate between that of the human
and yeast homologs. In human mitochondria, the mitochondrial
genome-organizing function of mtTFA seems to be restricted to just
the D-loop region of mtDNA (Ghivizzani et al., 1994), suggesting that
h-mtTFA does not coat the entire mitochondrial genome. This may
be consistent with its relatively low abundance in higher vertebrates.
The importance of maintaining the promoter spacing integrity
between the binding site for hu-mtTFA and the transcription start
site was shown recently by Dairaghi et al. (1995). Altering the
distance between the hu-mtTFA binding site and the transcription
start site greatly impaired transcription initiation efficiency. This
decrease was shown to be a consequence of altering the position of
mtTFA binding as opposed to the strength of binding, as judged by
the shift in a DNAse I hypersensitive site, which matched the change


169
has additional levels of complexity, many of which may not be at the
mtDNA or mtTFA level. These might involve intramitochondrial or
nuclear-mitochondrial signals mediated by proteins or second
messengers, in response to changes in the biochemical environment
of the mitochondria during development. It is also conceivable that
protein-protein interactions could be involved in this regulation,
since such interactions would not be detected by the in vivo
footprinting technique. In addition to these possibilities, it is
conceivable that varying levels of the mitochondrial RNA polymerase
during development could regulate mitochondrial transcription. A
study of the various nuclear RNA polymerases during Xenopus
development have found the polymerases to be stockpiled in the
fully grown oocytes of X. laevis, with the levels remaining high in the
early embryos when nuclear transcription is almost completely shut
down (Roeder, 1974a; 1974b). This suggests that nuclear RNA
polymerase levels and nuclear transcriptional activity are not strictly
correlated. However, nothing is known about the levels of
mitochondrial RNA polymerase during Xenopus development.
Therefore, transcriptional control by regulation of RNA polymerase
levels still remains a formal possibility.


CHAPTER 1
INTRODUCTION
General Introduction
Mitochondria are essential organelles of eukaryotic cells which
are largely maternally inherited and play a vital role in cellular
physiology. Their principal function in the cell is production of
adenosine triphosphate (ATP) by the highly efficient process of
oxidative phosphorylation, but they also contribute to the
biosynthesis of macromolecules such as pyrimidines, amino acids,
phospholipids, nucleotides, folate coenzymes, heme, urea, and many
other metabolites (Attardi and Schatz, 1988).
A feature that sets them apart from other organelles is their small
but essential DNA genome, which is distinct from nuclear DNA. Each
human cell has hundreds of mitochondria and thousands of mtDNAs.
The presence of an extranuclear genome necessitates the presence of
biosynthetic machinery for the transcription and replication of
mitochondrial DNA, and mitochondrial ribosomes for the translation
of mitochondrial mRNAs. Mitochondrial biogenesis involves a major
contribution of gene products (more than 300) encoded in the
1


63
debris was removed by a brief centrifugation. The clarified
supernatant was used for protein estimation by the Lowry method
(1951), using BSA as a standard.
Electrophoretic Mobility Shift Assays
Oligonucleotides
WH 615. 40 base oligonucleotide AGA TTA GGG CTA GCT AGC
GTG GCA GAG CCT GGC TAA TGC G. Corresponds to the native L-
strand sequence 4712-4751 (Roe et al., 1985).
WH 616. 41 base oligonucleotide GCT TAG GTC TTT CGC ATT
AGC CAG GCT CTG CCA CGC TAG CT. Corresponds to the native H-
strand sequence 4763-4723.
WH 639. 46 base oligonucleotide AGA TTA GGG CTA GCT AGC
GTG GCA GGG CCT GGC TAA TGC GAA AGA. Corresponds to the L-
strand sequence 4712-4756, with a point mutation at position 4737
(A to G) which is analogous to the MELAS transition at position 3243
(A to G) in the human mitochondrial genome.
WH 640. 44 base oligonucleotide GCT TAG GTC TTT CGC ATT
AGC CAG GCC CTG CCA CGC TAG CTA GC. Corresponds to the H-strand
sequence 4763-4720, with a point mutation at position 4737 (T to C
transition), to match the mutation in WH 639.


Figure 4-2. In organello footprint of the promoter region.
Mitochondria were isolated from X. laevis ovary and DMS treated in
organello. Untreated mitochondria were used to isolate mtDNA, and
DMS treated in vitro. Both in organello and in vitro methylated
mtDNA were cut with Avail to provide a reference point at position
2214 of the X. laevis genome, cleaved with piperidine and processed
for electrophoresis as described in Materials and Methods. The
cleaved DNA samples were then run on 6% sequencing gels, blotted
to nylon membranes, probed with riboprobes specific to the
promoter region, and autoradiographed (described in Materials and
Methods). The lanes labeled C correspond to in vitro methylated
naked mtDNA, whereas lanes labeled T refers to in organello
methylated mtDNA. Nucleotide numbering corresponds to the
sequence reported by Roe et al. (1985). The region of the L-strand
promoters (LSP) are indicated by the grey bars and the H-strand
promoters (HSP) by the black bars. The direction of transcription is
indicated by the arrows. The residues protected (open circles) or
hypersensitive (filled squares) to DMS methylation are indicated.
The 3 stippled bars on the right side of the figure correspond to the
regions footprinted by xl-mtTFA in the in vitro DNAse I footprints
reported by Antoschechkin and Bogenhagen (1995). Note the
correspondence between the in vitro DNAse I footprint of xl-mtTFA
and the in organello DMS footprint, suggesting that the majority of
the DNA-protein interactions detected in the in organello footprint
are due to binding of xl-mtTFA to mtDNA in vivo.


130
4-1) are radiolabeled to a high specific activity and used to perform
a linear amplification of the footprint ladder with Taq DNA
polymerase in a thermal cycler. Following primer extension, the
heterogeneous DNA population is size-resolved on a sequencing gel
and autoradiographed to obtain the in vivo footprinting patterns.
Adult female frogs were induced to lay eggs, the eggs fertilized in
vitro, and the embryos staged at distinct developmental stages
according to Nieuwkoop and Faber (1967). Protein-free mtDNA,
unfertilized eggs, and staged embryos were then processed for in
vivo footprinting by primer extension footprinting as described in
Materials and Methods. In vivo footprinting of the D-loop upstream
region during early development is shown in Figure 4-5 (H-strand)
and Figure 4-6 (L-strand). The two panels correspond to the
embryos obtained from two different female frogs. Regions of
altered methylation reactivities were detected between CSB3 and
CSB2, between CSB2 and CSB1, and also in the region upstream of
CSB3 (Figure 4-5). Footprints in the developmental stages should be
compared to both naked DNA (lanes labeled Control) and in vivo
methylated egg DNA (lanes labeled Egg). The most important point
to emerge from a perusal of these footprints is that a footprint


182
processing, run-on reactions were carried out as described in
Materials and Methods using mitochondria isolated from unfertilized
eggs and 73 hour-tadpoles. Following the reactions, RNA was
isolated from the mitochondria using the TriZol reagent (GIBCO BRL)
according to the manufacturers instructions. The RNA samples were
then run on formaldehyde-agarose gels as described for the steady
state analysis in Materials and Methods, dried at 60 C in a gel dryer,
and autoradiographed (Figure 5-1). The bulk of the labeled species
fall between the molecular weight range of 2.4 kb and 0.24 kb. The
mature, fully processed mitochondrial transcripts of X. laevis fall
within this range, indicating that the 30 min. run-on reactions
allowed the processing of the majority of the labeled RNAs. Further
incubations up to 45 or 60 were tried, but did not significantly add
to the efficiency of the reaction (data not shown). Hence, the 30 min.
reaction time was chosen for the rest of the experiments.
The above assay does not permit the identification and
quantitation of specific transcripts, which would allow a comparison
of the activity of the two promoters during early development of
Xenopus laevis. In order to allow the identification of gene-specific
and strand-specific transcripts, gene-specific and strand-specific


Figure 4-10. In vivo footprinting of the L-strand of the
mTERF region during early development of X. laevis.
Unfertilized eggs (egg) and embryonic stages at different times post
fertilization (indicated above the lanes) from two different female
frogs were DMS treated in vivo (as described in Materials and
Methods). Mitochondrial DNA was also isolated from unfertilized
eggs of the same female frogs and DMS treated in vitro to provide
the naked DNA lanes (control). The in vivo and in vitro DMS treated
mtDNA samples were then processed for footprinting by primer
extension as described in Materials and Methods. Taq DNA
polymerase was used for linear amplification of the footprint ladder
using 32P-end labeled primer WH360 Denaturation was done at 94C
for 4 min, followed by 15 cycles with the profile: 94C for 1 min, 59C
for 1 min, 72C for 3 min. Following the reaction, the samples were
phenol extracted, ethanol precipitated, run on 6% sequencing gels,
and autoradiographed. The nucleotide positions (Roe et al., 1985) are
shown, along with the tridecamer mTERF element (nucleotides 4730-
4743) and the direction of transcription. Residues protected (open
circles) from DMS methylation are indicated.


243
transient, spiral wave of calcium release in the embryo (Busa and
Nuccitelli, 1985; Busa et al., 1985; Kubota et al., 1987). Mitochondria
have been shown to sense oscillatory changes in cytoplasmic calcium
concentrations (Rizzuto et al., 1994; Hajnoczky et al., 1995). Calcium
is also a potent activator of mitochondrial oxidative metabolism
through its effects on many dehydrogenases (McCormack and Denton,
1993; Pralong et al, 1994). The effects of this huge increase in
cytoplasmic calcium on mitochondrial physiology of X. laevis are
unknown, but deserve experimental attention. In addition to these
phenomena, changes in metabolic pathways during early
development have been observed. Although the unfertilized egg has
abundant reserves of yolk protein and glycogen, only the yolk is
broken down by amino acid oxidation and fed into the TCA cycle to
be used as an energy source for early development (Dworkin and
Dworkin-Rastl, 1991). Glycogen reserves are utilized only from the
gastrula stage (10 hours post-fertilization) onwards, coinciding with
the inception of glycolysis in the developing embryo (Thoman and
Gerhart, 1979; Dworkin and Dworkin-Rastl, 1989; 1990). Hence, the
early embryonic stages have a primarily catabolic mode of
metabolism, whereas the later stages have a more balanced


83
fold increase over egg levels in the 43 hour-old embryo. ND6 levels,
however, showed a marginal decrease during this time.
Based on the above results, I conclude that there are no
substantial reductions in steady state levels of mitochondrial mRNAs
soon after fertilization as reported by Meziane et al. (1989).
Although these results seem to agree well with the observations of
Chase and Dawid (1972), Young and Zimmerman (1975) and Dawid et
al. (1985), they suffer from the following drawback. The mRNA
levels were normalized to rRNA levels based on the assumption that
the rRNA levels do not change drastically during development.
However, if these levels do change due to active transcription in the
later stages of development, the mRNA levels would be
underestimated in these stages. Therefore, a more static reference is
needed.
One macromolecule whose level does not change during the first
two days of development in Xenopus laevis is the mtDNA molecule.
The mtDNA remains at a concentration of 4 ng per embryo during
the first 48 hours of development after fertilization (Chase and
Dawid, 1972). Net increases in its level could be detected only at 60
hours, after which it continued to increase, reaching 8 ng per embryo


163
experiments do not suggest extensive coating of the mtDNA by xl-
mtTFA, but confirm that xl-mtTFA binds rather preferentially to the
regulatory regions of mtDNA in a periodic fashion.
The factors which influence the periodic binding by a relatively
non-specific protein like mtTFA seem to lie in the sequence of
mtDNA itself. GC-rich sequences like CSB2 and CSB3 seem to be
exclusion sequences (Figure 4-3). This situation was also seen in
human mitochondria, where CSB2 and CSB3 seemed to be positioned
at occupancy minima (Ghivizzani et al., 1994). In yeast, poly(A)
sequences positioned between sites of DNAse I protection appeared
to serve as null binding domains for ABF2 (Diffley and Stillman,
1992). In contrast to this exclusion of binding at certain sequences,
the strong affinity of mtTFA for the LSP may serve as an anchoring
site, with the other conserved elements in this region serving to
include or exclude binding of this protein. This would result in
packaging of the DNA in a phased manner (Ghivizzani et al., 1994),
strategically positioning important cis elements of replication and
transcription in the right conformation.
Now that the importance of phased binding by the mtTFA has
been well established in a variety of systems, it would be interesting


TABLE OF CONTENTS
ACKNOWLEDGEMENTS ii
LIST OF TABLES v
LIST OF FIGURES vi
ABSTRACT ix
CHAPTERS
1 INTRODUCTION I
General Introduction 1
Mitochondrial DNA 4
Mitochondrial DNA Replication 6
Mitochondrial Transcription 11
Regulation of Mitochondrial Gene Expression 15
Focus of Dissertation 19
2 MATERIALS AND METHODS 25
Frogs 25
DNA Primers 25
Laboratory Fertilization of Eggs 25
De-jellying of Eggs and Embryos 27
Isolation of Mitochondria from Eggs and Embryos. ... 28
Isolation of Mitochondria from Ovary Tissue 29
Dimethyl Sulfate Footprinting of Mitochondrial DNA. . 30
Steady State RNA Analysis 48
Mitochondrial Run On Transcription 56
Measurement of Mitochondrial Adenine Nucleotides . 61
Electrophoretic Mobility Shift Assays 63
iii


57
Plasmid Clones
Most of the plasmid clones used for the production of the non
radioactive gene- and strand-specific riboprobes have been
described in the steady state RNA analysis section above. The one
plasmid clone which has not been described earlier is the pBSD-Loop
clone, which is described below.
pBSD-Loop. The Xenopus D-loop region (from 1603-3078 in
Dunon-Bluteau et al, 1985) including the two putative TAS elements
and the 3 ends, were PCR amplified using primers WH540 and
WH541, and the PCR product cloned into the Hindi site of pBS (+/-)
phagemid (Stratagene). The insert was cloned in the forward
orientation. Therefore, T3 RNA polymerase makes the L-strand
sense and T7 RNA polymerase makes the H-strand sense of cRNAs.
Preparation of Riboprobes for Strand-specific Probing
In order to obtain gene- and strand-specific hybridization targets
for analyzing the labeled run-on transcripts, only riboprobes are
suitable. Large-scale synthesis of cold riboprobes for strand-specific
probing was done with the MegaScript kit (Ambion, Inc.) using the
mitochondrial gene-specific clones linearized with the appropriate
restriction enzyme. The large-scale reactions were allowed to


65
The specific competitor with a single point mutation at 4737 (the
MELAS competitor) was prepared by annealing WH 639 and WH 640
as described above. The specific competitor with three point
mutations in the mTERF consensus sequence was prepared using WH
654 & WH 655. Annealing was done at room temperature in this
case and processed as above. The filled-in probes were diluted to a
concentration of 10 picomoles/ul and frozen at -20C.
Preparation of S-13 Mitochondrial Lysate
Mitochondria from 400 eggs or embryos were purified as
described in the mitochondrial isolation section. The S-13 lysate was
prepared by an adaptation of the protocol of Fernandez-Silva et al.
(1996) for preparing S-13 mitochondrial lysates from HeLa cells.
The high speed mitochondrial pellet was resuspended in 500 ul
lysis buffer (10% v/v glycerol, 25 mM Hepes-KOH, pH 7.6, 5 mM
MgCL, 0.5 mM EGTA, 1 mM DTT, 1 mM PMSF, 1 ug/ml of Aprotinin,
Leupeptin and Pepstatin A). Tween 20 and KC1 were added to final
concentrations of 0.5% and 0.5 M, respectively. The mitochondria
were homogenized with an Eppendorf pestle (Kontes) and repeated
pipeting. The lysate was then kept on ice for 5 min, followed by a 30
sec vortexing. After a further incubation on ice for 5 min, the lysate


50
WH 539. 20 base oligonucleotide TGT GTT CTC GGG TAT GTG TA.
Corresponds to the H-strand sequence 13553-13572 in the ND4 gene.
WH 581. 38 base oligonucleotide GTT GGT TGG TTT CGA GGC
CAT GAT TAC TGT TGC CAA TC. Corresponds to the H-strand
sequence 10359-10396 in the ATPase 6 gene. This oligonucleotide
was 5-end labeled and used as a hybridization probe for detecting
ATPase 6 mRNA in Northern blots.
WH 583. 36 base oligonucleotide GGC GGG TTT GGC AAG AAG
TGG TGA GGT TTA GCG AGG. Corresponds to the H-strand sequence
2634-2669 in the 12S rRNA gene. This oligonucleotide was 5-end
labeled and used as a hybridization probe for detecting 12 S rRNA in
Northern blots.
Plasmid Clones
The cloning strategy was identical to the one used for the
construction of the footprinting clones described earlier. All the
clones described below were derived from pBS (+/-) phagemid
(Stratagene), with the PCR-amplified gene-specific fragments cloned
into the Hindi site.
pBS16S. This plasmid (4.7 kb) contains the 16 S rRNA sequence
information from 3174-4675 (amplified with oligos WH513 & WH
514). The insert is cloned in the reverse orientation. Therefore, T3


A.
Probe:Competitor
(Molar excess)
Mito.ext (ug)
Wild
type
O ^ W (M
+ +'+" +
mTERF shift-
Single Triple
Mutant Mutant
CM CM i CM CM
+ + + + + +
6 7 0
9 10 11


154
1:1 did not have any effect (lane 6 and Figure 4-12B). Competition
was least drastic when a cold competitor bearing three point
mutations in the conserved tridecamer sequence (T to A at 4731, G to
C at 4733, A to G at 4734) was used, with shifts of 54% and 48% of
controls (lanes 10, 11 and Figure 4-12B) at 20 and 200 fold molar
excess respectively, whereas the competitor at 1:1 did not have any
effect (lane 9 and Figure 4-12B), In conclusion, the competition data
show that the observed band shift was specifically due to the binding
of the mTERF protein, and not due to non-specific protein-DNA
interactions.
In order to investigate the relative abundance of the mTERF
protein during basal and activated transcription in X. laevis (Chapter
3), four distinctive developmental stages were chosen for analysis.
Mitochondrial transcription is basal in the unfertilized egg and early
blstula (5.5 hr post-fertilization), becomes activated in the late
neurula (22.5 hr post-fertilization), and is highly activated in the
hatched tadpole (48 hr post-fertilization). Mitochondria were
prepared from these eggs and embryos and the S-13 mitochondrial
protein extracts used to perform band shift assays as described in
Materials and Methods. Figure 4-13A shows the results of a band


34
pBSmTERF. This plasmid (3412 bp) contains the frog
mitochondrial sequence 4717-4925 (Roe et al., 1985). This stretch of
DNA (amplified with primers WH359 & WH360) is cloned in the
reverse orientation and contains the terminal end of the 16S rRNA
gene, the entire tRNA1' gene carrying the mTERF element, and the
initial sequences of the ND1 gene. Strand-specific riboprobes made
from this clone were used to probe in organello footprint Southern
blots of the mTERF region using the SspI site at 4927 as reference.
Riboprobes
The DNA clones were linearized with Hindlll for transcription
with T7 RNA polymerase, and with BamHI for transcription with T3
RNA polymerase. For transcription reactions, 1 ug of linearized DNA
was used in a standard analytical scale transcription reaction in the
supplier's buffer (Stratagene), with 100 uCi of a32p-UTP
(3,000Ci/mmol). The whole transcription reaction was loaded on a
4% non-denaturing polyacrylamide gel and the full-length RNA
product band located with a very short exposure (30 sec) on X-ray
film. This band was cut out, macerated in a 15 ml centrifuge tube
and added directly to the hybridization solution.


237
Cytochrome oxidase (CO), also called respiratory complex IV,
comprises 3 mitochondrial- and 10 nuclear-encoded subunits,
present in 1:1 stoichiometry (Kadenbach et al., 1983; 1987; Capaldi,
1990). A number of studies in mammalian systems suggest that
gene expression of the nuclear- and mitochondrial-encoded subunits
(CO I, II, III) are at least loosely coordinated, with coordinate
increases in CO subunit mRNA levels from both compartments
paralleling increased CO activity (Gagnon et al., 1991; Kim et al.,
1995; Taylor and Piko, 1995), although the mitochondrial CO subunit
levels were 30-50 fold excess over the nuclear ones (Taylor and Piko,
1995). However, evidence for disproportionate regulation of
mitochondrial and nuclear CO subunit gene expression by functional
activity in neurons of monkeys was reported by Hevner and Wong-
Riley (1993), with CO activity mainly correlating with the levels of
the mitochondrial subunit mRNAs. The levels of CO activity have also
been found to be correlated with the levels of the CO proteins in a
number of studies (Hevner and Wong-Riley, 1989, 1990, 1991;
Williams and Harlan, 1987). However, other studies have found
evidence that the molecular activity of CO may be regulated by
isozyme switching or by conformational effects of ATP binding


23
re-established. Then the molecular mechanisms responsible for
these rapid changes in mitochondrial transcript levels were
investigated by two main approaches, mitochondrial run-on
transcription and in vivo footprinting of mtDNA during early
development of X. laevis. The mitochondrial run-on transcription
assay was developed based on modifications of the protocol of Gaines
et al. (1987) to measure the transcription rates of mitochondria
isolated from unfertilized eggs and distinct embryonic stages (with
basal and enhanced steady state levels). These assays were aimed at
determining whether the primary determinant of the differential
transcript levels was at a transcriptional or post-transcriptional level.
It is known that changes in mtDNA are not the main regulatory
event, as the levels of mtDNA do not change during the first two days
of development (Chase and Dawid, 1972).
The second approach was to conduct an extensive in vivo DMS
(dimethyl sulfate) footprint analysis of the known regulatory
elements of transcription during the developmental stages of basal
and activated mitochondrial transcription, so that changes in protein-
DNA interactions could be correlated with transcriptional regulation.
In order to perform this comparative analysis, it was initially
essential to establish a baseline in vivo footprint pattern for Xenopus
mtDNA, as no previous studies are available for comparison. This


BIOGRAPHICAL SKETCH
Chandramohan V. Ammini obtained his undergraduate degree in
agriculture in 1987 from the Andhra Pradesh Agricultural
University, India, followed by a masters degree in horticulture in
1989 from the Indian Agricultural Research Institute, India. After
two years of graduate studies in floriculture, molecular genetics, and
plant tissue culture, he entered the graduate program at the
University of Florida in 1991, and joined the laboratory of Dr.
William W. Hauswirth in 1992. Upon graduation, he will begin post
doctoral studies with Dr. Peter Stacpoole in the Department of
Medicine at the University of Florida.
274


190
Table 5-1. Promoter-wise and overall transcription rates per unit
mitochondrial genome during early development of Xenopus laevis
LSP*
HSP*
Overall*
Egg
64.1
153.8
218.0
5 hr**
137.1
307.2
444.3
14 hr**
280.8
762.6
1043.4
20 hr**
253.8
958.0
1211.7
28 hr**
1592.6
14052.8
15645.4
48 hr**
941.5
6825.6
7767.1
* The phosphorimager quantitation of each transcript in the
developmental stages shown in Figure 5-3A was corrected for the
specific activity of [32P]UTP using the number of U residues in the
run-on transcripts in the region of hybridization with the cold target.
The corrected values were then normalized to the level of mtDNA in
that stage (Figure 5-3B) to correct for differences in the yield of
mitochondria and also to express the transcription rate to unit
mitochondrial genome. The values are expressed as arbitrary units.
** Time post-fertilization


8
1989). The involvement of this factor in creating replication primers
has been questioned by a subcellular and suborganellar fractionation
study which failed to detect RNase MRP RNA in mitochondria (Kiss
and Filipowicz, 1992). However, a recent analysis of the RNase MRP
RNA distribution by direct in situ hybridization localized a definable
portion of intracellular RNase MRP to the mitochondria of mouse cells
(Li et al, 1994).
CSB II (also called GC cluster C in yeast), is GC rich and is the most
conserved element in mtDNA replication origins from Saccharomyces
cerevisiae to humans. Xu and Clayton (1995) found a stable and
persistent RNA-DNA hybrid formation beginning at the 5 end of CSB
II during in vitro transcription with templates carrying yeast
replication origins. CSB II was the necessary and sufficient nucleic
acid element for establishing stable hybrids, with the efficiency of
hybrid formation decreasing with increasing distance between CSB II
and the promoter. Once made, the RNA strands of these RNA-DNA
hybrids could be elongated efficiently by mtDNA polymerase. These
results suggest that after transcription initiation, the next critical
step for initiating mtDNA replication is the formation of a stable
RNA-DNA hybrid. Xu and Clayton (1996) also found the formation of
a similar RNA-DNA hybrid (R-loop) in the human system. Efficient
hybrid formation was again dependent on the GC-rich CSB II


Ill
suggested that the molecular defect in MELAS may be the inability to
produce the correct type and quantity of rRNA relative to other
mitochondrial gene products, resulting in defects in protein
synthesis.
As a classic example of cases where in vitro results cannot be
necessarily extrapolated in vivo, Chomyn et al. (1992) found that the
MELAS mutation did not cause any change in levels of the transcripts
upstream or downstream of the mTERF element compared to
controls. They transferred mitochondria from 3 genetically
unrelated MELAS patients into human mtDNA-less (p) cells (King
and Attardi, 1989; Chomyn et al., 1991), and found marked defects in
mitochondrial protein synthesis and respiratory activity, but no
significant change in steady state levels of the H-strand encoded
rRNAs, mRNAs, and leucyl-tRNA. However, a marked decrease in
affinity of purified mTERF for the mutant target sequence was again
observed in in vitro assays, suggesting that the reduced affinity may
be compensated in vivo by regulation of the protein levels (Chomyn
et al, 1992). The reduction in labeling of various mitochondrial
translation products was also not correlated with their UUR-encoded
leucine content, arguing against an effect of the MELAS mutation on