Citation
Rep-mediated nicking of the adeno-associated virus (AAV) origin of DNA replication

Material Information

Title:
Rep-mediated nicking of the adeno-associated virus (AAV) origin of DNA replication
Creator:
Brister, James Rodney, 1966-
Publication Date:
Language:
English
Physical Description:
ix, 127 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Dependovirus ( jstor )
DNA ( jstor )
DNA replication ( jstor )
Duplexes ( jstor )
Gels ( jstor )
Genomes ( jstor )
In vitro fertilization ( jstor )
Nucleotides ( jstor )
Palindromes ( jstor )
Substrate specificity ( jstor )
DNA Replication ( mesh )
Dependovirus -- genetics ( mesh )
Endonucleases ( mesh )
Genome, Viral ( mesh )
Replication Origin ( mesh )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 2000.
Bibliography:
Includes bibliographical references (leaves 116-126).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by James Rodney Brister.

Record Information

Source Institution:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
52293498 ( OCLC )
ocm52293498
0025450036 ( ALEPH )

Downloads

This item has the following downloads:


Full Text










REP-MEDIATED NICKING OF THE
ADENO-ASSOCIATED VIRUS (AAV)
ORIGIN OF DNA REPLICATION















By

JAMES RODNEY BRISTER II


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FUFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA












DEDICATION



This work is dedicated to my family, Linda, Sallie, Linnie, Bill, and Beasty.















ACKNOWLEDGEMENTS


I would like to acknowledge the past and present members of the Muzyczka

laboratory for helping to create an exciting research environment. In particular I would

like to thank Irene Zolotukhin who purified the Rep68 used in this work as well as Sergei

"Mr. GFP" Zolotukhin, Dan "Big Cat" Pereira, Dan "Dr. Doom" Lackner, Zengi "Retired

Great Scientist" Li, and Corrine Abernathy. Additionally, I would like to thank Amy

Lossie from the Driscoll lab and Pricilla Non from the Swanson laboratory.

I am indebted to my friends Srinivas Midituru, Shaun Opie, Meg Davis, and Ken

Warrington for countless acts of generosity and kindness. I am also indebted to Phil

Lapis for many helpful discussions and Joyce Conners for lubricating the administrative

path to graduation. I would like to thank my committee members Al Lewin, Tom Rowe,

Bert Flanegan, and Dick Moyer for their time and efforts. Finally, I would like to thank

my mentor Nick "Papa Gator" Muzyczka for providing me the challenges, teaching and

encouragement necessary to complete this work.















TABLE OF CONTENTS


page

ACKNOW LEDGEM ENTS............................... .................................................... iii

TABLE OF CONTENTS ................................................. iv

LIST O F FIG U R ES ......................................................................................................... vi

A BST R A C T .......................................................................... ...................................viii

THE ADENO-ASSOCIATED VIRUS (AAV) ORIGIN OF DNA REPLICATION.................1

The AAV Life Cycle.......................... ................................ ........................ 1
The Model of AAV DNA Replication...................... ..... ...................3
Factors Involved in AAV DNA Replication.................................................4
The AAV Rep Proteins.................................................... ........................6
The AAV Terminal Repeat (TR)................................................8

MATERIALS AND METHODS................................ ..........................19

Purification of Baculovirus-Expressed Rep68 .................................................... 19
Synthetic TR Substrates.................................................. 19
Rep trs Endonuclease Assay............................... ............. ...................... 20
TR Binding Assay........................................ .......................................... 21
Construction of No-end AAV Substrates.......................... ......................22
In vitro AAV DNA Replication Assay................................ .......................23

REP-MEDIATED NICKING OF THE AAV ORIGIN REQUIRES TWO BIOCHEMICAL
ACTIVITIES, DNA HELICASE ACTIVITY AND TRANSESTERIFICATION........28

Introduction .................................................. ................................................28
R e su lts .......................................................................... ..............................3 1
D discussion ................................................... .......................................... 38

THE MECHANISM OF REP-MEDIATED AAV ORIGIN NICKING ................................ 63

Introduction..............................................................63
R results ....................................................... ...........................................66
D discussion .......................................................................................... ..... 73










Page

REP INTERACTION WITH THE AAV ORIGIN OF DNA REPLICATION .....................94

Sequence Elements Required for Rep-mediated trs Nicking...........................94
Model of Rep-Mediated Nicking of the AAV Origin of DNA Replication..............97
Rep Association with the AAV TR during trs Nicking................................ ..98
Rep Cleavage Activity Effects the Rate AAV DNA Replication.......................101

APPENDIX ADDITONAL REP NICKING DATA ................................................... 114

R E FE R E N C E S ........................................................................ .............................. 116

BIOGRAPHICAL SKETCH .......................................................... 127















LIST OF FIGURES


Figure page

1. AAV life cycle............................................................ ....................... 12

2. Model of AAV DNA Replication.......................................... ..................... 14

3. A AV genetic m ap........................................................ .............................. 16

4. The AAV TR. ............................ ...... ............... ......................... 18

5. Construction of synthetic AAV TR substrates................................... ............ 25

6. Construction of AAV no-end substrates. .............................................27

7. Endonuclease analysis of synthetic AAV TR substrates...............................49

8. Rep68 endonuclease assays on 1 bp transversion mutants ......................... 51

9. Rep68 endonuclease assays on 2 bp transversion mutants.........................53

10. Rep68 endonuclease assays on 1 nt transversion mutants..........................55

11. Rep68 Endonuclease reactions on single-stranded TR mutants................... 57

12. Secondary structure at the AAV trs.......................... ........... .............. 59

13. Role of trs stem-loop in Rep68 endonuclease reaction.................................. 61

14. Rep nicking activity on RBE insertion mutants............................................... 81

15. Rep nicking activity on RBE insertion mutants
in the NOSTEM background......................... ..................... 84

16. Rep endonuclease activity on RBE polarity mutants..................................... 87

17. Rep endonuclease activity on RBE' substitution mutants................................90

18. Rep endonuclease activity on RBE' substitution mutants
in the NOSTEM background..........................................................93











Figure


19. Rep endonuclease activity on RBE' deletions............................................... 104

20. Model of Rep interaction with the AAV TR during trs nicking ......................106

21. Rep68 association with the AAV TR during trs nicking................................ 108

22. Relationship between Rep68 complex formation with the AAV TR
and trs nicking activity. .................................................................... 110

23. In vitro DNA replication of AAV no-end constructs
containing 1 bp transversions at the trs.............................................112

24. Affect of NaCI concentration on Rep trs nicking.......................................... 114

25. Secondary Rep68 cleavage sites observed on wt TRs
and 2 bp tranversion substrates. .................................................. 115











ABSTRACT


Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

REP-MEDIATED NICKING OF THE
ADENO-ASSOCIATED VIRUS (AAV)
ORIGIN OF DNA REPLICATION

By

James Rodney Brister II

August 2000

Chairman: Nicolas Muzyczka, Ph.D.
Major Department: Molecular Genetics and Microbiology

The single-stranded adeno-associated virus type 2 (AAV) genome is flanked by

terminal repeats (TRs) that fold back on themselves to form hairpinned structures.

During AAV DNA replication the TRs are nicked by the viral encoded Rep proteins at the

terminal resolution site (trs). This Rep endonuclease reaction is ATP-dependent and

apparently requires three TR sequence elements, the Rep binding element (RBE), a

small palindrome that comprises a single tip of an internal hairpin within the TR (RBE'),

and the trs. Here we characterize the role of these elements in the Rep endonuclease

reaction and determine the mechanism of this reaction. The minimal trs sequence

necessary for Rep cleavage is 3'-CCGGT/TG-5', and this 7 base core sequence is

required only on the nicked strand. We also identify a potential stem-loop structure at

the trs. Interestingly, Rep nicking on a TR substrate that fixes this trs stem-loop in the

extruded form no longer requires ATP. This suggests that the trs endonuclease reaction

occurs in two discrete steps. First, the Rep DNA helicase activity unwinds the TR,

thereby extruding a stem-loop structure at the trs. Next, Rep transesterification activity

viii










cleaves the trs. Our data also indicate that Rep is tethered to the RBE in a specific

orientation during trs nicking. This orientation appears to align Rep on the AAV TR

allowing specific nucleotide contacts with the RBE' and directing nicking to the trs.

Accordingly, alterations in the polarity or position of the RBE relative to the trs greatly

inhibit Rep nicking. Substitutions within the RBE' also reduce Rep specific activity, but

to a lesser extent. Interestingly, Rep interactions with the RBE and RBE' during nicking

seem to be functionally distinct. Rep contacts with the RBE appear necessary for both

the DNA helicase and trs cleavage steps of the endonuclease reaction. On the other

hand, RBE' contacts seem to be required primarily for TR unwinding and formation of

the trs stem-loop structure, not cleavage. Together these results suggest a model of

Rep interaction with the AAV TR during origin nicking through a tripartite cleavage signal

comprised of the RBE, the RBE', and the trs.

















THE ADENO-ASSOCIATED VIRUS (AAV) ORIGIN OF DNA REPLICATION



The AAV Life Cycle



Over time organisms have evolved many seemingly divergent strategies to

replicate and maintain their genetic material. Unlike other organisms, viruses and

bacteriaphages are dependent on a host cell for their survival. Accordingly, these

organisms have evolved highly specialized strategies that allow them to exploit infected

cells and replicate their genetic material. Perhaps one of the more interesting strategies

is that of the small single-stranded adeno-associated virus (AAV). Initially discovered as

a contaminant of human adenovirus (Ad) stocks (3, 14, 72), AAV is unique among

members of the parvovirus family in that efficient DNA replication and virion production

are dependent on the genetic contributions of unrelated helper viruses. This

dependency results in a novel, bipartite life cycle that includes both lytic and latent

stages. In the absence of helper virus, AAV establishes a latent infection and integrates

into the host cell genome where the AAV provirus is maintained through subsequent

rounds of cellular replication. Super-infection of these proviral cell lines with helper virus

rescues the integrated provirus resulting in AAV DNA replication and culminating in the

release of progeny virions (see Fig. 1).

Although the bipartite AAV life cycle implies a direct role of helper virus in AAV

productive infection, the precise nature of helper functions is poorly understood. In












cultured cells, AAV DNA replication can be induced by a number of viruses including Ad

and herpes as well as genotoxic agents such as hydroxyurea and UV light (76, 110-

112). However, AAV DNA replication is primarily associated with Ad co-infection. Ad

gene products facilitate the expression of AAV proteins by transactivating viral

transcription and promoting message stability (12, 16, 17, 44, 45, 78). Yet, the

accumulation of AAV proteins alone does not result in high levels of AAV DNA

replication (96). Indeed, recent studies suggest a model wherein Ad gene products

promote AAV DNA replication though cell cycle manipulation, creating a permissive

environment for productive infection (27, 54, 60, 71). Without evidence to support direct

involvement of Ad DNA replication machinery in helper functions, AAV DNA replication

in this environment seems to be almost entirely dependent on cellular factors (61, 88,

111).

Despite ambiguity and variability in helper contributions, the AAV encoded

requirements for infection are explicit and concise. Productive viral infection requires

expression of the two AAV genes, rep and cap (35, 90). The cap gene provides the

structural components of the AAV capsid where as the rep gene codes for a family of

non-structural proteins that are involved in nearly all aspects of the AAV life cycle,

including DNA replication, virion packaging, proviral integration, and transcriptional

regulation (33, 59, 62, 69, 91). Surprisingly, the only cis elements necessary for AAV

infection are the 145-nucleotide palindromes that flank the single-stranded viral genome

(4, 8, 9, 95). Extensive complimentary base pairing allows each terminal repeat (TR) to

fold back on itself, forming a double-stranded hairpin structure (7, 74). These hairpinned

structures function as origins of AAV DNA replication as well as packaging and









integration signals, and all of these functions appear to require direct interaction between

the AAV Rep proteins and the viral TRs (4, 36, 59, 86).



The Model of AAV DNA Replication



The infectious AAV virion contains a single-stranded DNA flanked by the

hairpinnned TRs. This single-stranded AAV genome appears to be transcriptionally

silent, and a second, complementary strand must be synthesized to create a duplex,

transcriptionally active AAV genome (31). This second strand synthesis is initiated from

the hydroxyl primer formed by the hairpinned TR at the viral 3' end (31). Presumably

host cell DNA polymerase(s) elongate this primer, replicating internal AAV sequences

and creating a so-called "turnaround" intermediate, a duplex AAV molecule that is

covalently closed at one end through the hairpinned TR (Fig. 2, mT). Since expression

of the AAV Rep proteins enhances both lytic and latent viral infections (4, 36, 59, 86),

AAV second strand DNA synthesis appears common to both types of infection.

Resolution of covalently closed AAV termini requires the endonuclease activity of

viral proteins (86). The AAV Rep proteins introduce a single-stranded nick into the TR

phosphate backbone at the terminal resolution site (trs) (42, 43). Subsequent unwinding

of the cleaved TR creates a 3'-hydroxyl primer that can be used for repair synthesis of

the TR. This terminal resolution reaction results in a linear, duplex intermediate

composed of two full-length single-stranded AAV genomes (Fig. 2, mE). Reinitiation of

AAV DNA replication on these linear intermediates requires that the newly synthesized

TR separate from the template DNA strand and fold into the self-annealed, hairpinned









configuration. This conformational change provides a 3' primer for the synthesis of

internal AAV DNA sequences.

The AAV DNA replication scheme has been termed rolling hairpin replication (15,

33). Like the rolling circle replication (RCR) scheme of covalently closed, circular

plasmids, the rolling hairpin model postulates that only leading strand DNA synthesis is

necessary for AAV DNA replication. Moreover, in both schemes, replication proteins are

necessary to nick duplex origin sequences and create a 3'-hydroxyl primer that can be

elongated by DNA polymerase. However, during RCR, a single initiation event would

result in synthesis of the entire circular DNA genome. In contrast, replication of the

linear AAV genome seems to be semi-continuous, requiring two initiation events, one to

synthesize a TR primer and a second to replicate internal AAV sequences.



Factors Involved In AAV DNA Replication



AAV DNA replication is somewhat unique in that both cellular and helper virus

encoded factors are required in addition to AAV peptides. In this context, genetic

studies indicate that five Ad regions facilitate AAV DNA replication. These include the

E1A, E1 B, E2A, E4, and VA regions (12, 16, 17, 44, 45, 78). Of these Ad genes only the

E2A region, which encodes a single-stranded DNA binding protein (Ad-DBP), has been

shown to participate directly in AAV DNA synthesis (61, 98, 99). However, it remains

unclear if this protein is actually required for AAV DNA replication (61, 62). The other Ad

helper factors all appear to stimulate AAV protein expression (75). Accordingly, Ad E1A

is required for rep transcriptional activation, and Ad E1 B, E2A, E4, and VA regions all

appear to facilitate message accumulation and stability (12, 16, 17, 44, 45, 78).












Transcriptional control of Rep expression appears important to the lytic AAV infection

because high levels of Rep expression do allow some AAV DNA replication in the

absence of other helper factors (37, 38, 96).

In addition to other activities, Ad infection creates a permissive cellular

environment for AAV DNA synthesis that can be mimicked by treatment with cytotoxic

agents (76, 111, 112). Several Ad proteins may have roles in cellular manipulation (60),

but the Ad E4 open reading frame 6 protein (E4orf6) stimulates AAV DNA replication in

the absence of other helper factors (31). Recent experiments have identified a cellular

protein that binds to the AAV TRs, the single-stranded D-stem binding protein (ssD-BP)

(54, 70, 71). This protein binds the AAV 3' termini and apparently prevents elongation of

TR primers by host cell DNA polymerase(s). Ad E4 orf 6 and other cytotoxic agents

seem to indirectly cause the dephosphorylation of ssD-BP (71). This alteration seems to

alter ssD-BP DNA binding activity and appears to release the AAV DNA replication block

(54, 70, 71).

Efforts to characterize other cellular factors have been facilitated by the

development of an in vitro AAV DNA replication assay (39, 62). Inhibitor and protein

fractionation studies using this assay indicate that the DNA polymerase a-primase is not

required for AAV DNA replication (62, 86). Since the DNA polymerase a-primase is

necessary only for lagging strand synthesis, this observation suggests that only leading

strand synthesis is necessary during AAV DNA replication, consistent with the rolling

hairpin model. These same studies suggest that either DNA polymerase 8 or

polymerase s is used for AAV DNA synthesis (62, 86). Accordingly, protein fractionation

studies indicate that the DNA polymerase accessory proteins replication factor C (RFC)

and proliferating cell nuclear antigen (PCNA) are also required for AAV DNA replication










(61). Although these accessory proteins are necessary for DNA polymerase 5 activity in

the simian virus 40 (SV40) DNA replication system, recent studies suggest that these

same factors may facilitate polymerase e activity (1, 115). Like other DNA viruses, AAV

replication also requires a single-stranded DNA binding protein. Both the cellular DNA

binding protein RPA and Ad-DBP appear to stimulate AAV DNA replication and increase

DNA polymerase processivity (61, 100), and it is not clear which is actually used during

an AAV infection. Finally, Rep was recently shown to interact with PC4, another protein

involved in SV40 DNA replication (102).



The AAV Rep Proteins



The AAV rep gene encodes a family of non-structural proteins involved in every

aspect of the AAV life cycle including viral DNA replication, transcription, packaging, and

proviral integration (4, 29, 38, 91, 102). This family of proteins can be divided into two

classes based on the promoter used to initiate transcription, p5 or pi9. Each promoter

produces both a spliced and an unspliced message allowing translation of four distinct

Rep proteins (Fig. 3A). Genetic studies have identified the p5 Rep proteins as essential

for viral DNA replication, and several groups have observed that high level expression of

either Rep78 or Rep68 is sufficient for the accumulation of AAV DNA replication

intermediates and infectious virion production in cells that are co-infected with Ad (37,

38, 96,113).

The biochemical characterization of the p5 Rep proteins has been facilitated by

the purification of Rep68 to homogeneity and Rep78 to near homogeneity (18, 42, 43).

Although the amino acid sequences of Rep78 and 68 differ at the carboxy termini, these










peptides share a number of biochemical properties. In vitro both Rep78 and 68 are able

to bind to the AAV TR in a sequence-specific manner (19, 57, 77). This binding activity

is mediated through a double-stranded DNA element referred to as the Rep binding

element (RBE). Additionally both Rep 78 and 68 are ATP dependent DNA helicases

that are able to unwind duplex DNAs containing an RBE (42, 117). Finally, both Rep78

and 68 are ATP-dependent endonucleases that are able to catalyze site-specific nicking

of the AAV TR at the trs (18, 42).

The p19 Rep proteins, Rep52 and 40, have not been as well characterized as the

larger, p5 Rep proteins. Rep52 and 40 are involved in the regulation of viral

transcription (49, 68), but they may have additional roles in the accumulation of single-

stranded AAV DNA and virus packaging (28, 73). Rep52 is an ATP-dependent helicase

and would presumably facilitate the unwinding of double-stranded AAV replication

intermediates into single-stranded progeny (81). Since neither Rep52 nor 40 bind the

AAV TR, it appears that the p19 Rep proteins mediate their activities through interaction

with other proteins (43, 56, 67, 104).

Several groups have constructed rep mutants in an attempt to associate Rep

biochemical activities with functional peptide domains. Characterization of these Rep

mutants has identified several discrete peptide domains involved in TR binding, ATPase,

DNA helicase, and trs nicking activities (Fig. 3B). As expected, Rep78 and 68 mutants

that are unable to bind the AAV TRs are also unable to nick the trs and stimulate AAV

replication (56, 114). Furthermore, mutations that abolish Rep78 and 68 ATPase activity

also prevent DNA helicase and trs cleavage activities, as well as viral transcriptional

activation and DNA replication (50, 56, 93, 104). Thus both DNA binding and ATPase

activities appear necessary for Rep trs nicking. Finally, recent Rep mutational analysis









has identified several domains involved in Rep oligomerization. These domains appear

to be distributed throughout the peptide and overlap residues involved in both TR

binding and DNA helicase activities (24).

The AAV Rep proteins share a number of functional and sequence homologies

with other replication proteins. Most notably the peptide sequence of AAV Rep is similar

to the replication proteins of other parvoviruses. Additionally, AAV Rep appears to

include several DNA helicase and endonuclease motifs conserved in the peptide

sequences of RCR proteins (Fig. 2B) (10, 41). Given the similar DNA replication

functions of RCR proteins and AAV Rep, the conservation of these biochemical activities

is not too surprising. However, these shared activities may also indicate that the

mechanism of origin cleavage is similar in both RCR and AAV rolling hairpin replication.



The AAV Terminal Repeat (TR)




Functioning as viral origins of DNA replication, integration signals, and packaging

signals, the AAV TRs are the only cis elements required for both lytic and latent AAV

infections (59). All of the functions attributed to the TRs are thought to require specific

interactions with the Rep proteins. Accordingly, the TRs contain specific sequences and

secondary structures that allow interaction with the AAV Rep proteins (56, 89, 117).

During AAV DNA replication, Rep78 and 68 bind the AAV TR and induce a site-specific

nick at the trs (42). This Rep-mediated cleavage event generates a 3'-hydroxyl primer

for repair synthesis of the TR (42, 86).

At least three separate elements within the AAV TR are required for site-specific

trs endonuclease activity, the canonical RBE (located in the A-stem), the RBE' (located









in the B/C-stem), and sequences near the trs (Fig. 4). Binding assays clearly

demonstrate that specific sequences within the RBE are required for stable Rep binding

to both linear and hairpinned TR substrates (18, 57, 58, 77). Interference and protection

assays detect a broad region of Rep contacts with the RBE and many of these occur

along a core repetitive sequence, G(A/C)GC4 (Fig. 4) (18, 57, 58, 77). Rep contacts with

the RBE appear critical to the AAV life cycle. AAV substrates containing multiple

transversions in either of the middle two G(A/C)GC4 repeats replicate at much reduced

levels compared to wild-type AAV constructs (8). Furthermore, RBE homologues are

found at the AAV promoters and the proviral integration site, and these RBE

homologues appear to facilitate Rep-mediated transcriptional regulation and proviral

integration (57, 105).

Although the RBE appears to be the primary element through which Rep

associates with the TR, both Rep binding and nicking activities are enhanced by

sequences within the terminal hairpin (18, 58, 92, 109). Linear TR substrates, devoid of

the terminal hairpin, are bound 125 to 170- fold less efficiently than complete, hairpinned

TR substrates (57, 77). Moreover, chemical interference assays detect discrete Rep

contacts within one of the small internal palindromes that form the tips of the terminal

hairpin (see Fig. 4) (77). This small internal palindrome has been termed the RBE'.

Despite "flipping" and "flopping" of internal TR sequences during AAV DNA replication,

the RBE' is maintained in a constant position relative to the RBE and trs. Since the

RBE' is contained within the AAV terminal hairpin, the structural context of this element

is also presumed to be important.

Finally, it appears that Rep recognizes specific nucleotides at the trs during

nicking. Although insertion of heterologous sequences between the RBE and the









nicking site reduces Rep cleavage activity, nicking still occurs at the correct site,

between the two thymidines in the double-stranded DNA sequence 3'-GGTJ!GA-5' (85).

Furthermore, deletion of sequences near the trs reduces both the specific activity of Rep

nicking and the accumulation of AAV DNA replication intermediates (95, 97). Curiously,

binding assays done in the absence of ATP do not detect Rep contacts at the trs (77).

This observation implies that ATP is necessary to stimulate conformational changes that

allow contact between the Rep catalytic site and the trs. Indeed, Rep does not require

ATP to cleave TR substrates containing large regions of single-stranded DNA flanking

the nicking site (85). However, Rep nicks these substrates at two sites, the trs and a site

11 nt downstream (85). Thus the Rep transesterification reaction does not require ATP,

but the nicking intermediate does not appear to include large regions of single-stranded

DNA flanking the trs.

The emerging picture of Rep interaction with the AAV TRs depicts a complex set

of interactions that culminate in site specific nicking at the trs. Together, the RBE, RBE',

and trs appear to facilitate Rep interaction with the TR during trs nicking, but the

mechanism of this interaction is poorly understood. Although the RBE and RBE' have

been characterized in the context of Rep binding, the contribution of these elements to

Rep cleavage has not been determined. In fact, the sequences at the trs recognized by

Rep during nicking are not known. Furthermore, the role of ATP in the Rep

endonuclease reaction is not clear. Thus little is known of Rep interaction with the AAV

TR during trs cleavage. Understanding the mechanics of the Rep endonuclease

reaction should provide a better appreciation of Rep function at the AAV TRs and the

role of nicking during AAV infection. Perhaps, this will provide some general insights

into the function of other replication proteins at their cognate origins.









Figure 1. AAV life cycle.

During a latent infection of a permissive cell, the AAV genome migrates to the

nucleus and preferentially integrates into human chromosome 19, where the AAV

provirus is maintained through subsequent rounds of cellular DNA replication. Co-

infection of proviral cell lines with Ad stimulates a lytic AAV infection that includes high

levels of AAV DNA replication and packaging of single-stranded progeny genomes into

infectious virions. See text for details.












AAV


Proviral Integration


Adenovirus


AAVDNA
Replication


Packaging of
Progeny Virions


Viral Attachment


ov,-T









Figure 2. Model of AAV DNA Replication.

The boxed region illustrates the steps involved in the terminal resolution of AAV

viral ends. In vitro Rep68 is necessary and sufficient for both the site-specific

endonuclease and helicase activities required for terminal resolution. The viral 3' end

is indicated with an arrow. Circles depict Rep covalently attached to the viral 5' end at

the terminal resolution site (trs).

















SDNA Polymerase


(mT) t

J Rep68 or 78



| DNA Helicase



SDNA Polymerase

(mE) I


Reinitiation


S | DNA Polymerase,
Strand Displacement


tr+
^T+









Figure 3. AAV genetic map.

(A) The AAV genetic map is shown with each rep and cap transcript depicted

as a box. The resultant protein is indicated next to each transcript. (B) A functional

map of Rep78 and 68 is given. The start positions of Rep 78 and 68 and Rep 52 and

40 are indicated with arrows. Rep domains involved in single-stranded DNA cleavage

are indicated with black boxes. Those domains involved in Rep DNA helicase and

ATPase activities are indicated with gray boxes. Finally, domains involved in Rep

homomeric interaction are indicated with an open box.
















-p5 -p19 p40
FTR]-


Rep78

Rep68

Rep52

Rep40

-- VP1


S- VP2, VP3





B.

REP78 and 68 REP52 and 40

NH2 n COOH


Conervd CeaageDomin


Rep/ Rep interaction Domains Conserved Hellcase Domain


~111111



















Figure 4. The AAV TR.

The AAV TR is depicted in the hairpinned conformation. The RBE is indicated with a box, the RBE' with a dashed oval, and

the trs with an arrow. The major Rep contacts with TR sequences as determined by Ryan et al. (78) are indicated in bold. Various

restriction endonuclease sites are also shown.



















.T T RBE'
-C Q.
C G
C"'G
A T
G C
C G
G C
G C Dde I BssH II EaeI Msc I Bfa I
E G C
SC GG ATGACGAGCGACAG GC GACGAG.AG, A ACTCCATCAC AGGGGTT (3')
T TT
G CCGAGTC CTCCcTCGCTCGCGC TCI"T:CrTCACCGC TGAGGTAGTGA CCCCAAGATC (5')
G C
G c RBE trs
Sma ..G C.
Hpa II
XmaI C G
G C
A A A____

A Stem D Stem









OD














MATERIALS AND METHODS


Purification of Baculovirus-Expressed Rep68



Rep68 was purified to homogeneity from baculovirus-infected Sf9 cells as

previously described (117). Rep68 was purified by sequential chromatography on

phenyl-Sepharose, ssDNA-cellulose, and DEAE-cellulose. Preparations were more than

99% pure as judged by use of sodium dodecyl sulfate (SDS)-acrylamide gel

electrophoresis followed by silver staining (117).



Synthetic TR Substrates



The TR substrates used in this study were constructed from gel purified,

synthetic oligonucleotides (Genosys) as previously described (11). However,

construction methods were scaled up to increase yields. Accordingly, 500 pmol of two

annealed oligos containing the RBE and the trs sequences were ligated to 1,000 pmol of

a third self-annealed oligo containing the terminal hairpin (see Fig. 5). Oligos were

ligated at 320C for 2 hrs in 100-Al reaction volume containing 50 mM Tris-HCI (pH 7.5),

10 mM MgCI,, 10 mM dithiothreitol, 1 mM ATP, 25 pg/ml bovine serum albumin (BSA),

and 1,600 units of T4 DNA Ligase (New England Biolabs). Complete 163 nt TR

constructs were purified from ethidium bromide stained, 10% denaturing polyacrylamide










gels containing 50% urea. Constructs were excised from gels and eluted in 50 mM Tris-

HCI (pH7.5), 10 mM EDTA, 0.1% SDS, 0.3M NaOAc at room temp for 12-24 hrs. The

elution reactions were phenol/ chloroform extracted twice, and eluted TR constructs

were ethanol precipitated and 70% ethanol washed. DNA concentrations of these

purified substrates were determined using the Pico Green fluorometric reagent

(Molecular Probes). Each panel of mutant and wt constructs was assayed together to

insure accurate relative DNA concentrations. Typically, 5 to 30 pmol of purified TR was

recovered from each ligation reaction. These substrates were 5' labeled at 37C in a 10-

pl reaction containing 200 fmol TR construct, 70 mM Tris-HCI (pH 7.6), 10 mM MgCI, 5

mM dithiothreitol, 20 pCi [y-3P] ATP, and 20 units of T4 Polynucleotide Kinase (New

England Biolabs). Final concentrations of labeled substrates were determined on the

basis of specific activity and confirmed with the Pico Green fluorometric reagent

(Molecular Probes).



Rep trs Endonuclease Assay



The trs endonuclease reactions were performed as described previously (11, 42).

Rep68 nicking assays were done in 20-pl reactions containing 25 mM HEPES-KOH (pH

7.5), 20 mM NaCI, 5.5 mM MgCI, 10 ng/ml BSA, 0.2% Tween 20, 0.25 nM 5'-labeled TR

substrate (1x104 cpm/fmol) and 0.5 mM ATP, unless otherwise indicated. Nicking

reactions were incubated with 0.25 to 50 nM Rep68 at 37C for 1 hr. Proteinase K

digested reaction products were phenol/ chloroform extracted, ethanol precipitated, 70%

ethanol washed, and fractionated on 10% denaturing polyacrylamide gels containing

50% urea. The amount of product formed was determined with a phosphorimager (Fuji).









To confirm that we were in the linear range of the phosphorimager, we experimentally

compared radioactive standards by phosphorimager and scintillation counting.

Unless otherwise indicated each mutant was assayed at three or four Rep

concentrations, giving several data points for each substrate. Since the kinetics of Rep

nicking are sigmoidal with respect to enzyme concentration (117), this approach

provided the opportunity to measure Rep activity within a linear range for nicking and to

repeat the nicking assay multiple times for each substrate. Only the correct sized

product resulting from Rep cleavage at the trs was counted for analysis. Minor cuts at

less favored sites or nicks present in the starting substrate were not included in

phosphorimager analysis.



TR Binding Assay



TR binding assays were done under the same reaction conditions as the nicking

assays. In general, binding reactions contained 25 mM HEPES-KOH (pH 7.5), 20 mM

NaCI, 5.5 mM MgCI,, 10 ng/ml BSA, 0.2% Tween 20, 0.25 nM 5'-labeled TR substrate

(1x104 cpm/fmol) and 0.5 mM ATP. However, ATP was excluded from binding reactions

where indicated to prevent accumulation of covalent Rep complexes with the nicked TR.

Binding reactions were incubated with 0.25 to 50 nM Rep68 at 37C for 1 hr. Reaction

products were loaded directly on 0.5X TBE (pH7.5-8.0) 3.5% native polyacrylamide gels

and resolved at 10 to 20 volts/cm for 3 to 6 hrs.

In some cases the amount of nicked product associated with the Rep-bound TR

complexes was determined by excising each of these complexes from the gel. When

this was done, the concentration of labeled TR substrate in the binding reaction was









increased to 2.5 nM and Rep68 to 37.5 nM. Under these conditions, each of the six

Rep-bound TR complexes could be seen as a discrete band after a 30-min exposure of

the wet gel to autoradiograph film. After exposure six TR complexes and the substrate

band were cut individually from the gel and eluted in 50 mM Tris-HCI (pH7.5), 10 mM

EDTA, 0.1% SDS, 0.3M NaOAc at room temp for 12-16 hrs. The eluted complexes

were then digested with proteinase K, phenol/ chloroform extracted, ethanol precipitated,

and 70% ethanol washed. Recovered DNA was fractionated on 10% denaturing

polyacrylamide gels containing 50% urea, and the amount of substrate and product was

determined by use of phosphorimager analysis as described previously.



Construction of No-end AAV Substrates



AAV no-end constructs (86) were made from the same oligos used to make the

sythetic TRs. The phosphorylated oligos were ligated to a duplex DNA containing the wt

AAV coding sequences. Two annealed oligos, 50 pmol each, containing the RBE and

the trs sequences were ligated to 250 pmol of a third self-annealed oligo containing the

terminal hairpin as above (see Fig. 5). The resultant TR was then ligated to 5 pmol of

the 4.5 kbXbal fragment from plM45. Oligos were ligated at 32C for 2 hrs in 100-pl

reaction volume containing 50 mM Tris-HCI (pH 7.5), 10 mM MgCI,, 10 mM dithiothreitol,

1 mM ATP, 25 .g/ml bovine serum albumin (BSA), and 1,600 units of T4 DNA Lgase

(New England Biolabs). Incomplete reaction products were digested away using 3000

units Exo III (New England Biolabs), and resultant, covalently closed no-end molecules

were purified from 0.7% agarose gels run in TAE. DNAs were were excised from gels

and eluted in 50 mM Tris-HCI (pH7.5), 10 mM EDTA, 0.1% SDS, 0.3M NaOAc at room









temp for 12-24 hrs. The elution reactions were phenol/ chloroform extracted twice, and

eluted no-end constructs were ethanol precipitated and 70% ethanol washed. DNA

concentrations of these purified substrates were determined by absorbance at 260 nm or

using the Pico Green fluorometric reagent (Molecular Probes).



In vitro AAV DNA Replication Assay



In vitro AAV DNA replication assays were done essentially as described by Ni et

al. (61, 62). AAV DNA replication was assayed in 100 pl reaction volume containing 250

ng of no-end substrate, 1 pmol of Rep68, 25 mM HEPES-KOH (pH 7.5), 20 mM NaCI,

5.5 mM MgClI, 10 ng/ml BSA, 100 .M each dATP, dCTP, dTTP, dGTP, 80 pCi [a-3P]

dATP, 5 mM ATP, 40 mM creatine phosphate, 3.3 pig creatine phospokinase, and 1.5

mg of Ad-infected HeLa S100 extract described previously (61). Replication assays

were incubated at 37C and 20 il aliquots were removed from each reaction at the times

indicated and stopped by the addition of 20 il of 20 mM Tris-HCI (pH 7.5), 20 mM EDTA,

1% SDS. Reactions were then digested with 10 gg proteinase K at 370C for 1 hr,

phenol/ chloroform extracted, and ethanol precipitated. DNA pellets were resuspended

in the appropriate buffer and digested with Dpnl at 370C for 2 hr to remove methylated,

starting substrates. AAV replication products were resolved on a 0.7 % agarose gel by

use of electrophoresis. The amount of AAV DNA replication was determined by

phosphorimaging as described above. Only the monomer length, duplex replication

products (mT and mE) were included in the phosphorimager analysis.









Figure 5. Construction of synthetic AAV TR substrates.

This diagram depicts the steps involved in the construction of synthetic TR

substrates. See text for details.





















pGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTT (3') 52-mer (A+D)



CTCGCGCGTCTCTCCCTCACCGGTTGAGGTAGTGATCCCCAAGATC (5') 50-mer (A+D)






T T
CG
CG
AT
GC
CG
GC
GC
GC
C GGCCTCA pGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTT (3')
G CCGGAGTCACTCGCTCGp CTCGCGCGTCTCTCCCTCACCGGTTGAGGTAGTGATCCCCAAGATC (5')
CG
G C
GC
GC
C G 61-mer (B/C)
C G
CG
G C
A A
A


TT T4 DNA Llgase


T
CG
C G
A T
GC
C G
G C
GC
GC
C GGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTT (3')
G CCGGAGTCACTCGCTCGCTCGCGCGTCTCTCCCTCACCGGTTGAGGTAGTGATCCCCAAGATC (5')
C G
G C
G C
G C
C G
C G
C G Denaturing PAGE
G C
AAA









Figure 6. Construction of AAV no-end substrates.

This diagram depicts the steps involved in the construction of AAV no-end

substrates. See text for details.


































Xbal Digestion


rep cap









e-- C---a


LIgation to Synthetic TRs


re Ca p















REP-MEDIATED NICKING OF THE AAV ORIGIN REQUIRES TWO BIOCHEMICAL
ACTIVITIES, DNA HELICASE ACTIVITY AND TRANSESTERIFICATION



Introduction



The small, single-stranded DNA genome of the adeno-associated virus (AAV) is

flanked by terminal repeats (TRs), each folding back on itself to form terminal hairpinned

structures (Fig. 2). These structures are the only cis elements required for AAV DNA

replication, packaging of replicated genomes into capsids, and site-specific integration of

provirus into the host genome (59). Each of these distinct activities requires interaction

between the AAV non-structural Rep proteins and the AAV TRs (56, 89, 117).

The AAV non-structural proteins, Rep78 and Rep68, contain both ATP-

dependent DNA helicase and site-specific endonuclease activities. In our current model

of AAV DNA replication, strand-specific nicking at the trs and subsequent Rep mediated

unwinding within the TR generate a 3' primer for the initiation of subsequent DNA repair

of the TR, a process referred to as terminal resolution (Fig. 2) (86). During this process

the TR is nicked between the two thymidines in the sequence 3'-GGT/TGA-5', resulting

in a 5' phosphotyrosol linkage between Rep and the nicking site (42, 84, 86). Efforts to

characterize Rep trs nicking have been facilitated by the development of an in vitro trs

endonuclease assay. Site specific Rep nicking in this reaction is dependent on ATP

hydrolysis and the presence of Mg2' (or Mn2') (42, 85, 117). The reason why the Rep

transesterification reaction requires ATP hydrolysis has not been clarified.










The ATP dependence of AAV Rep mediated nicking is a rather novel feature that

is shared by the related parvovirus non-structural protein NS1 from the mouse minute

virus (MVM) (20). However, many other rolling circle replication initiator proteins do not

seem to require ATP for the origin nicking reaction. Notably, the geminivirus Rep protein

does not require ATP for in vitro nicking of single-stranded origin substrates. However,

this enzyme is unable to nick biologically relevant duplex substrates under these

conditions (51). Interestingly, geminivirus replication in vivo is dependent on the

formation of a stem-loop structure at the nicking site (66, 87), but the relationship

between geminivirus Rep ATPase activity and the formation of this origin stem-loop

remains unclear. The staphylococcus aurens plasmid pT181 also contains an origin

stem-loop structure. Extrusion of this stem-loop on supercoiled substrates appears to be

dependent on upstream binding of the plasmid-encoded endonuclease RepC, which

nicks the origin within the loop region of this structure, but this reaction does not require

ATP (46, 63).

Efficient AAV Rep nicking of the hairpinned TR appears to require three

sequence recognition elements within the terminal repeat. Mutational analysis of the

AAV TR has identified a core 22 bp sequence required for stable binding of Rep 78 and

Rep68 (77). This Rep binding element (RBE) is believed to be the primary recognition

element that promotes Rep binding. Interestingly, homologues of this Rep binding

element are present at the AAV p5 promoter, the preferential proviral integration site on

human chromosome 19, and within several viral and cellular promoters. Rep78 and 68

bind many of these sequences in vitro and appear to regulate AAV transcription through

direct interaction with promoter and TR RBEs in vivo (34, 48, 57, 68, 103, 105).










Efficient binding and nicking of hairpinned substrates also requires contact

between Rep and the small internal palindromes that comprise the tips of the hairpinned

TR. The presence of these internal palindromes in hairpinned TRs increases nicking 5-

50 fold (18, 42, 58, 85). Because the internal palindromes exist in two alternate

configurations (flip and flop), it had previously been thought that no specific sequence

within this region was recognized. However, Ryan et al. have identified sequence

specific contacts between Rep and a CTTTG motif within the small internal palindromes

of the TR (77). This internal palindrome has a constant position with respect to the trs

regardless of the orientation of the terminal repeat (flip or flop).

Finally, a specific sequence at the trs itself also appears to be required for

nicking. Insertion of a heterologous sequence between the nicking site and the RBE

significantly reduces nicking, but nicking occurs at the correct site (85). As yet, however,

the specific sequences that comprise the terminal resolution site have not been

identified. Curiously, high-resolution in vitro binding studies do not detect Rep contacts

at the trs in the absence of ATP (77). Furthermore, ATP is not an essential cofactor for

trs nicking if the trs region is present in a hairpinned TR substrate as single stranded

DNA (85). This observation led us to suggest that ATP-dependent Rep DNA helicase

activity is needed to melt the duplex trs to create a single stranded nicking intermediate.

Rep DNA helicase mutants are deficient in trs nicking, supporting this conclusion (93).

Additionally, studies of Rep helicase activity have shown that Rep can unwind a duplex

DNA substrate provided that it contains a RBE (117).

In our previous work, we identified the sequences within the RBE and the internal

palindromes that affect Rep nicking and sequence specific DNA binding (77). Here we

focus on the trs region of the terminal repeat. We identify a strand specific trs core









sequence required for Rep catalyzed nicking through systematic mutation of sequences

near the trs. Furthermore, we identify a potential stem-loop structure at the trs.

Surprisingly, preferential extrusion of the nicking site stem-loop entirely removes the

ATP requirement for Rep nicking. This clearly demonstrates that the AAV Rep protein

requires the extrusion of a stem-loop structure containing the nicking site prior to trs

cleavage. Furthermore, we conclude that the ATP dependent Rep DNA helicase activity

is necessary to unwind the duplex trs and allow formation of the stem-loop structure prior

to nicking.



Results




Determination of the Minimal trs

To determine the minimal trs sequences required for Rep68 nicking, a panel of

mutant TR substrates was constructed. These substrates consisted of sequential single

base pair transversions, beginning 8 base pairs upstream of the nicking site and

extending 7 base pairs downstream. Mutation of these sequences was facilitated by the

use of synthetic oligonucleotides. To construct TR substrates two annealed oligos

containing the RBE and the trs sequences were ligated to a third oligo containing the

terminal palindromes (see Fig. 5). Complete TR constructs were purified from ethidium

bromide stained, denaturing polyacrylamide gels, and DNA concentrations of the purified

substrates were determined as described in Materials and Methods. The mutants were

then 5' end-labeled using [y -32P] ATP and T4 polynucleotide kinase, and the final

concentrations of labeled substrates were determined on the basis of specific activity,










and confirmed with fluorometry. Rep trs endonuclease activity on these substrates was

assayed in vitro using homogeneously pure Rep68. All substrates were assayed

together and each substrate was assayed at several Rep concentrations. Typically (see

Fig. 7C), Rep titrations contained 0.05 to 1 pmol of enzyme in reactions containing 5

fmol of a given substrate. The results of the nicking reactions with each mutant are

shown in Figure 8.

Analysis of the mutants revealed a 7 bp sequence that appeared to be the core

recognition element required for trs activity. Mutations in this sequence, 3'-CCGGT/TG-

5', reduced Rep68 nicking 3 to 10 fold compared to the wild type substrate. Since this

core sequence included the actual nicking site, we assumed that this large inhibition

reflected direct Rep68 interaction with these nucleotides during trs nicking. One of the

mutated bases in this sequence, the first G, was not as deleterious as other core

mutations, implying that the Rep68 sequence requirements at this position were less

stringent.

Most of the substrates with mutations flanking this 7 bp core sequence were also

slightly defective for nicking, 20-50 % lower than wild type, and the results from these 1

bp transversions were consistent with data obtained from overlapping 2 bp transversions

(Fig. 9). This was surprising because we assumed that the inclusion of numerous

flanking mutations would define a region of the trs where transversions would not affect

Rep68 nicking activity. However, we were unable to define such a region suggesting

that the entirety of the mutated sequences somehow contributed to Rep68 trs nicking.

Additionally, the panel of 1 bp transversions included a mutant that was nicked an

average of 1.7 fold more efficiently than wt. Rep68 nicking assays were performed on










this mutant several times, and this substrate was consistently nicked at elevated levels

compared to wild type.

Although we felt that our mutation analysis had defined the core trs sequence, 5'-

CCGGT/TG-3', the significance of mutations outside this core remained unclear. There

seemed to be at least two classes of mutations. Those within the core trs sequence that

greatly reduced Rep68 nicking, and a second set of mutations that had a more modest

effect.


Strand Specificity of Rep68 trs Nicking

Though we had identified a core duplex sequence required for Rep68 nicking, we

had not determined the strand specificity of Rep contacts within this sequence. Previous

work indicated that insertion of heterologous sequences directly opposite the nick site

reduced Rep68 cleavage, yet deletion of these same sequences, resulting in a single-

stranded trs, did not reduce nicking. However, the single-stranded trs substrates were

nicked at two sites with approximately the same efficiency, the trs and a site 11

nucleotides downstream, indicating a possible role for the opposite strand in Rep68

nicking specificity (85). Hence, the contribution of the strand opposite the trs during

Rep68 nicking remained unclear. To clarify these inconsistencies and to determine the

strand specificity of Rep68 contacts during nicking, a new panel of trs mutants was

constructed. These substrates contained a single nucleotide transversion either on the

trs containing strand or on the opposite strand (Fig. 10). In this way each nucleotide of a

given base pair was independently mutated within the core trs sequence.

As expected, mutations on the trs containing strand reduced Rep68 cleavage by

3 to 10 fold. These data were consistent with the results from the single bp










transversions and confirmed the importance of the 7 base core sequence 3'-

CCGGT/TG-5' in Rep nicking. Surprisingly, transversions on the strand opposite the

nicking site did not inhibit nicking. Indeed, Rep68 cleaved the mutants on the uncut

strand at elevated levels compared to wild type. Because the standard deviations were

comparable to the increases in nicking, the significance of the improved nicking was not

clear. Nevertheless, the elevated Rep68 nicking activity observed on virtually all of

mutations on the strand opposite the trs suggested a general phenomenon. One

possible explanation was that these mutations slightly disrupted the duplex trs, allowing

enhanced Rep68 accessibility to the nicking site.

The nicking data for these single nucleotide transversion mutants indicated that

Rep was making strand specific contacts during nicking. Though inconsistent with the

insertion mutants mentioned above, this finding was consistent with Rep68 nicking on

substrates containing an extensively single-stranded region extending through the trs

(85). This substrate was nicked by Rep68 at wt levels despite the absence of

sequences opposite the nicking site. Our data (Fig. 11) were also consistent with results

obtained from another partially single-stranded mutant we constructed. Unlike the

extensively single-stranded mutant used in previous studies, our substrate was designed

to mimic the 3' viral terminus (see Fig. 11). As such, this substrate was double-stranded

through the RBE to the trs, but the nicked strand was single-stranded directly

downstream of the nicking site. Rep68 nicked this mutant an average of 1.6 fold more

efficiently than wt (S.D. = 0.45 fold, Fig. 10). Yet, unlike the extensively single-stranded

substrates, nicking on our substrate mostly occurred at the trs. Hence, it appeared that

the strand opposite the nicking site somehow contributed to the specificity of Rep68

nicking, but no particular base within this strand was essential.










Secondary Structure at the trs

In an attempt to better understand our data, we aligned TR sequences from the

seven AAV serotypes. With the exception of AAV5, the region near the trs showed stark

conservation among all serotypes. Curiously, this conservation included an inverted

repeat flanking the first five nucleotides of the trs core sequence (see Fig. 12).

Additionally, although AAV5 trs sequences were quite disparate with respect to the other

serotypes, these sequences also contained an inverted repeat flanking the nick site.

We, therefore, wondered if these inverted repeats were involved in Rep frs

nicking. We predicted that these inverted repeats would form an 8 bp stem structure

flanking a 5 nucleotide loop (Fig. 12). This structure seemed energetically improbable,

but other origins of DNA replication also contained such improbable structures that

appear necessary for in vivo origin function. The geminivirus origin of replication is an

11 bp stem structure flanking an 11 nucleotide loop (66, 87), and the plasmid pT181

origin is a 9 bp stem flanking a 6 nucleotide loop (63). In both examples the origin-

nicking site is within the single-stranded loop regions. Extrusion of these structures

seems to be dependent on other factors. In the case of pT181, origin stem-loop

formation appears to require binding of the RepC endonuclease, which uses the free

energy of the circular DNA superhelix to melt the loop region and promote cruciform

extrusion (63). By analogy, we hypothesized that the Rep DNA helicase activity might

facilitate the extrusion of this energetically unfavorable structure at the trs, and that such

unwinding on a linear DNA molecule would require ATP.

To determine the role of this predicted stem-loop in Rep68 trs nicking, a new

mutant was constructed wherein the predicted hairpin on the strand opposite the nick

site was deleted (Fig. 13). We reasoned that this mutant would force the sequences on









the trs-containing strand to adopt the predicted stem-loop structure (see Fig. 13).

Surprisingly, Rep not only nicked this mutant, but it nicked this mutant an average of 2.8

fold more efficiently than wild type (S.D. = 0.92 fold). This result confirmed our previous

conclusion (see Fig. 10) that Rep only made contacts with the trs' strand (the strand that

is cut) during nicking. Furthermore, the enhanced Rep nicking activity on this mutant

compared to wild type also indicated that the extruded stem-loop was a reaction

intermediate. In fact, the large difference in Rep68 nicking activity between the two

substrates implied that the extrusion of the trs stem-loop was probably a rate-limiting

step in the trs endonuclease reaction.


Elimination of the ATP Requirement for Rep Nicking

If extrusion of the trs stem-loop is a necessary step prior to nicking, and if the

Rep associated DNA helicase is necessary for extrusion to occur, then we would expect

that the trs NOSTEM substrate (Fig. 13) would be ATP independent for nicking. Indeed,

trs endonuclease reactions with the stem-loop mutant were no longer dependent on

ATP. Rep cleavage of the mutant was essentially the same in both the presence and

absence of ATP indicating that ATP was not required for the Rep68 transesterification

reaction at the trs (Fig. 13). These data were consistent with Rep68 trs assays using the

extensively single-stranded substrate that was nicked in the absence of ATP (85). The

single-stranded region of this mutant included the inverted repeat necessary for the

predicted trs stem-loop formation (see Fig. 11). Hence it is probable that this partially

single-stranded substrate could form the trs stem-loop in solution. However, unlike this

single-stranded substrate, the NOSTEM mutant used here was only nicked at the correct










Since Rep68 did not nick wild type substrates in the absence of ATP (Fig. 13),

the predicted trs stem-loop did not seem to be energetically favorable. Rather our data

suggested that this structure must be formed and stabilized prior to Rep68 mediated trs

cleavage through an active mechanism. The unwinding of the duplex trs and formation

of the stem-loop would be facilitated by Rep DNA helicase activity. We have shown

previously that Rep can unwind a duplex DNA molecule with no single stranded regions

provided that the duplex contains an internal RBE (117). Thus, Rep unwinding of the

upstream RBE present in our wt substrates would melt the adjacent trs region and

extrude the trs stem loop. The requirement for RBE dependent DNA helicase activity

would then account for the ATP requirement during trs nicking.

Interestingly, addition of adenosine 5'-O-(3-thiotriphospate) (ATPyS) to in vitro trs

assays inhibited Rep68 nicking of the NOSTEM mutant compared to addition of ATP or

no cofactor (Fig. 13). The level of nicking activity in the presence of ATPyS was

comparable to what was seen with the wild type substrate in the presence of ATP.

Since ATPyS is a non-hydrolyzable analogue, it is possible that it binds to Rep and

remains associated with the enzyme for extended periods of time, in contrast to ATP.

This would suggest that the Rep complex involved in the actual transesterification

reaction at the trs may be inhibited by the presence of ATP bound to the enzyme. Thus,

this result suggested the existence of at least two functional Rep68 conformations, the

native enzyme conformation and one resulting from ATP binding. Of these, the native

form appeared to be the more efficient for nicking, supporting the conclusion that the

Rep68 endonuclease activity is ATP-independent.










Discussion




Mapping the Minimal trs

During the course of this study, we have analyzed the effect of mutations near

the AAV trs on Rep68 catalyzed origin nicking. Our results indicate that a 7 base core

nucleotide sequence 3'-CCGGTiTG-5' is required for Rep nicking at the trs. This core

sequence is strand-specific. It is required only on the nicked strand, and it does not

matter if the complementary sequence on the opposite strand is intact. Interestingly, the

first five nucleotides of this core trs sequence are flanked by an 8 bp inverted repeat that

appears to form a stem-loop intermediate prior to nicking. Formation of this stem-loop

seems to be ATP-dependent and is presumably facilitated by Rep DNA helicase activity

acting on the nearby RBE. Conversely, Rep does not require ATP to nick the trs once

this stem-loop structure is formed, indicating that the actual endonuclease reaction is

ATP-independent. Thus, our results suggest that Rep trs nicking is a two step reaction,

requiring both a specific sequence and a structure at the trs.

Though we believe we have identified the minimal trs sequence required for

Rep68 nicking, the nature of the Rep68 interaction with this core sequence still remains

unclear. We expect some of these core nucleotides to directly interact with the Rep68

active site while others may only be involved in the extrusion and stabilization of the trs

stem-loop. Although Rep68 cleavage was significantly reduced on all single-nucleotide

transversions in the nicked strand, endonuclease activity with these mutants was

variable. Individual mutation of nucleotides within the nicked strand sequence 3'-GT/TG-

5', resulted in an average 2 to 5 fold reduction in Rep68 cleavage activity compared to










the other single nucleotide mutations in the core trs sequence. Perhaps this indicates

that these four nucleotides interact with the Rep68 active site during nicking and the

other nucleotides within the core sequence are involved in stem-loop formation.

Initially, the data obtained from single-base-pair mutants with tranversions

flanking the core trs sequence were difficult to interpret. We did not understand why

most of the flanking mutataions reduced Rep68 trs nicking. However, it now seems

likely that these flanking mutations interfered with trs stem-loop formation. Such

interference would arise from at least two possible mechanisms: First, mutations within

the stem sequence would reduce the number of base pairs within this stem-loop

structure and effectively reduce its thermodynamic stability. Second, mutations may

also affect Rep helicase interactions with these sequences preventing the extrusion of

the stem-loop. Most of our mutations flanking the core trs sequence would reduce the

number of base pairs within the predicted stem region. However, the underlined

thymidine in the sequence 3'-GT/TGAGGT-5' would not form a Watson-Crick base pair

after stem-loop extrusion (see Fig. 12), yet Rep68 nicked the 1 bp transversion of this

position less than half as efficiently as wt. Perhaps this indicates direct Rep interaction

with this nucleotide during formation of the nicking intermediate.

In general, our conclusions are consistent with results from other studies. Wang

et al. (95) concluded that the two thymidines flanking the nicking site in the context of

uncharacterized upstream sequences were not sufficient for wt Rep68 trs endonuclease

activity. Additionally, Snyder et al. (85) concluded that sequences directly across from

the nicking site contributed to Rep68 trs endonuclease activity. Yet, the 7 nucleotide

insertion mutant used in the Snyder study would have disrupted stem-loop formation

opposite the nicking site, reducing the probability of trs stem-loop formation. However,










our data do not explain results obtained from another mutant used in this same study.

Rep68 nicking activity was reduced when a 2-nucleotide transversion was made directly

across from the two thymidines at the nicking site (85). Neither of our single nucleotide

transversions at these two positions had a deleterious affect on Rep68 nicking

suggesting a cumulative phenomena or experimental error.


Architecture of the AAV TR

The finding that specific sequences at the trs are involved in Rep catalyzed

nicking is consistent with our working model of Rep interactions with the AAV TR. In this

model, site-specific Rep cleavage at the trs requires sequence specific interactions with

the RBE, the trs, and the small internal palindromes that comprise the tips of the

hairpinned TR. In addition to these elements our data indicate that a stem-loop structure

near the trs is also required for nicking.

The formation of the nicking site stem-loop structure may facilitate several

requirements for Rep trs nicking. First, formation of the stem-loop would present the

Rep active site with a single-stranded trs. This single-stranded trs appears to be the

relevant nicking substrate since Rep nicks extensively single-stranded TRs and our

stem-loop mutant in the absence of ATP. Second, the stem-loop structure would

effectively reposition the trs closer to the RBE. This seems important since binding

studies do not detect Rep contacts near the trs. It appears that the trs must be brought

inward towards the RBE for the Rep active site to associate with the nicking site. Third,

the stem-loop itself would help to stabilize trs sequences in the proper conformation and

position for nicking.










It appears that two stem-loop structures are present within the TR during Rep

nicking, the thermodynamically favorable terminal hairpin and the trs hairpin, resulting in

a saddle structure (see Fig. 13A). We assume that Rep is making contacts with loop

regions in both of these hairpins during nicking since binding assays detect terminal

hairpin contacts (77), and our nicking assays detect trs contacts. The involvement of

AAV terminal hairpin and trs stem-loop structures in Rep catalyzed nicking may have

ramifications for Rep activity on other substrates. Most notably Rep78 cleaves human

chromosome 19 substrates that include the region of site-specific, AAV proviral

integration (91, 92). This site is referred to as AAVS1 and includes a RBE homologue

and the trs homologue 3'-GTTG-5'. Urcelay et al. (92) have demonstrated Rep-

dependent nicking at AAVS1 trs homologue and have proposed that the initiation of DNA

replication from this site is involved in AAV proviral integration.

Interestingly, AAVS1 does not contain sequences near the RBE and trs

homologues capable of forming secondary structures. However, the spacing between

the RBE and trs homologues is decreased in AAVS1 compared to the AAV TR. This

decreased spacing between the AAVS1 RBE and trs may allow RBE bound Rep to

interact with the trs on this substrate in the absence of other structural features. Yet we

assume that the formation of a single-stranded nicking site is required prior to nicking, so

the mechanism of Rep AAVS1 nicking remains unclear. Perhaps this site contains other

long-range sequence elements that contribute to Rep nicking by stabilizing the nicking

complex or by facilitating a single-stranded nicking site through heterologous protein

interaction.










ATP Requirement for Rep68 trs Nicking?

Our data indicate that ATP is required during Rep trs nicking for the extrusion of

a stem-loop structure at the nicking site. Once the trs stem-loop has been formed, the

actual Rep nicking reaction does not require ATP. In fact, the Rep68 transesterification

reaction appears to be inhibited by bound ATP. Although Rep68 nicking activity on the

stem-loop mutant is the same in the absence or presence of ATP, the addition of ATPyS

to the reaction reduced nicking activity to the level observed on wt substrates. Since

ATPyS is a non- hydrolyzable analogue, it would presumably remain bound to Rep,

unlike ATP, which would be hydrolyzed. Thus it appears that Rep adopts at least two

functional conformations during trs nicking, ATP-bound and native. The ATP-bound

form appears to facilitate Rep helicase activity and the native form is the active

endonuclease.

The modulation of these two Rep conformations through ATP binding suggests a

model for Rep interaction with the AAV TR. During nicking Rep first binds the TR

through the RBE. Subsequent ATP binding results in a conformation that allows Rep to

reach out from the RBE and make downstream sequence contacts necessary for trs

unwinding. After hydrolysis of ATP Rep would relax into the native conformation. It is

unclear if Rep maintains its original contacts and pulls unwound downstream sequences

towards the RBE allowing them to self-anneal into the trs stem-loop, or if stem-loop

formation is more passive in nature. In either case, the net result of Rep helicase activity

would be the formation of the trs stem-loop. Once formed this structure presents the

single-stranded trs to the native Rep active site.

The Rep proteins of the autonomously replicating parvoviruses also require ATP

hydrolysis for in vitro origin nicking (20). The MVM NS-1 replication protein appears to










be functionally homologous to AAV Rep (20-22), suggesting that the mechanism of

origin nicking is similar in the two systems. Thus, we assume that NS-1 also requires a

single-stranded nicking site for cleavage. Yet the MVM origin sequences do not appear

to include secondary structures at the nicking site. Although NS-1 is a helicase (106)

and could presumably unwind the duplex MVM origin, the lack of secondary structure at

the nicking site implies that MVM origin nicking is distinct from AAV.

Unlike AAV, MVM origin nicking requires the accessory DNA binding proteins

HMG (at the right origin) and parvoviral initiation factor (at the left origin) (20, 22).

Although the exact nature of the interaction between these accessory proteins and the

MVM origins is unknown, Cotmore and Tattersall (22) have suggested that these

accessory proteins facilitate nicking through origin binding and direct interaction with NS-

1. Considering our results, the role of these accessory proteins may be similar to that of

the AAV trs stem-loop, i.e., stabilizing a single-stranded nicking intermediate.


General Mechanisms of Origin Nicking

The similarity between AAV Rep and other viral replication proteins is not limited

to the parvoviruses. Geminivirus origin sequences include a predicted stem-loop

structure at the nicking site similar to AAV. This structure is required for in vivo

replication (66, 87), but the mechanism of stem-loop extrusion is unknown. Although it is

tempting to draw mechanistic homologies between AAV Rep and geminivirus Rep, it is

worth noting that the geminivirus Rep does not exhibit helicase activity (26). This

observation raises questions about the functional significance of the geminivirus Rep

ATPase activity. This activity is required for viral DNA replication, but the basis of this

requirement is unclear (26). Interestingly the ATPase activities of both AAV and









geminivirus Rep proteins are not DNA dependent (26, 117). This rather novel shared

characteristic suggests a functional role for ATP-dependent conformational changes

outside the context of DNA unwinding.

In the geminivirus system this conformational switching may be required for

interactions between Rep and other proteins. Similar to AAV Rep, geminivirus Rep

protein nicks single-stranded origin substrates in vitro. However, geminivirus Rep is

unable to nick biologically relevant double-stranded origin substrates (51). Without

evidence of geminivirus Rep helicase activity others have suggested that unidentified

accessory proteins are necessary for origin nicking in vivo (26). Such hypothetical

proteins would provide the helicase activity for origin unwinding and nicking site stem-

loop formation. The geminivirus Rep ATPase activity may facilitate conformation-

dependent interactions with these hypothetical proteins.

In contrast to geminivirus, the extrusion of stem-loop structures at other origins of

DNA replication appears to require only direct interaction with initiator proteins. The S.

aurens plasmid pT181 contains an energetically improbable stem-loop structure required

for plasmid DNA replication (94). Like AAV and geminivirus this stem-loop contains the

origin nicking site. However, pT181 origin stem-loop extrusion seems to involve both the

plasmid-encoded endonuclease RepC and plasmid DNA topology. Upstream binding of

RepC increases S1 nuclease sensitivity of origin stem-loop sequences on super coiled

substrates indicating conversion of these duplex sequences to the stem-loop structure.

This Si nuclease sensitivity is not observed on Rep C bound linear substrates

suggesting that superhelical twisting is necessary to drive the formation of the origin

stem-loop (63).









Thus, it appears that AAV, geminivirus, and pT181 share a general mechanism

of origin nicking. The sequences of each origin are capable of forming a stem-loop with

the actual nicking site located within the single-stranded loop of this structure.

Formation of this stem-loop appears necessary for origin nicking in all three systems,

indicating that the preferred nicking substrate is single-stranded DNA. In the case of

AAV and pT181 origin stem-loop extrusion clearly involves interaction with cognate

origin recognition proteins. However, the mechanism of extrusion differs between the

two systems. pT181 appears to use the energy associated with superhelical coiling to

drive formation of the stem-loop (63). In contrast the linear AAV genome would require

an active mechanism of origin stem-loop extrusion. Our data indicate that this

mechanism involves endogenous Rep helicase activity.


Regulation of AAV DNA Replication

The extrusion of the AAV trs stem-loop structure appears to be rate limiting in

Rep68 trs nicking. Zhou et al. (61) recently described the reaction kinetics of Rep68

nicking on wt TR substrates as sigmoidal with respect to enzyme concentration. They

concluded that at least a dimer was required for Rep68 endonuclease activity on these

substrates. However, these studies would not have measured the reaction kinetics of

the endonuclease reaction, per se, but would have measured the kinetics of the rate-

limiting step of the reaction. Thus we conclude that the extrusion and stabilization of the

stem-loop structure requires at least a dimer of Rep68.

During viral DNA replication, AAV Rep must discriminate between 3' viral termini

and internally replicated TRs (see Fig. 2). Nicking of 3' viral termini would result in dead

end replication products where as nicking of internal TRs would create a 3' hydroxyl









primer for continued DNA synthesis. Our nicking results from a partially single-stranded

TR substrate designed to mimic these viral termini (see Fig. 10) indicate that Rep

endonuclease is active on 3' viral termini in vitro. However, analysis of AAV DNA

replication by 2-dimensional gel electrophoresis indicates that very little nicking of 3' viral

termini occurs in vivo (61). Thus Rep trs nicking appears to be regulated in vivo

ensuring efficient viral replication.

The multi-step Rep trs nicking reaction would allow regulation of trs nicking

through modulation of origin stem-loop formation. Since Rep helicase activity appears to

facilitate extrusion of this structure, one possible model of trs nicking regulation would

involve modulation of Rep helicase activity by phosphorylation. This type of regulation

has been observed with the MVM NS1 protein. Phosphorylation seems to stimulate NS1

DNA helicase, ATPase and nicking activities in vitro and increase viral replication in vivo

(64, 65).

Rep trs nicking could also be regulated through direct inhibition of origin stem-

loop extrusion. Cellular factors may regulate Rep68 nicking through such a mechanism.

Another group has recently identified a cellular protein that binds sequences within the

AAV trs stem-loop. This D-stem binding protein (ssD-BP) shows strand specific binding

activity (71). The core binding sequence appears to be 3'-AGTGA-5', and this sequence

appears to be preferentially bound as single-stranded DNA (95). Thus the binding site of

this cellular factor overlaps several nucleotides of the predicted trs stem-loop at the 3'

viral termini. ssD-BP appears to regulate AAV DNA replication by preventing initiation

through interaction with its cognate binding site (54, 71). Perhaps binding of ssD-BP

also prevents Rep trs nicking of 3' viral termini by preventing extrusion of the trs stem-

loop structure. Such a regulatory mechanism would not prevent Rep nicking of







47


replicated, duplex trs sites since ssD-BP binding shows a preference for a single-

stranded binding site.








Figure 7.


Endonuclease analysis of synthetic AAV TR substrates.


(A) The sequence of WT AAV TR substrates used in this study is shown.


The


boxed region denotes the canonical Rep binding element (RBE).


The position of the


terminal resolution site (trs) and relevant restriction enzyme sites are also indicated.


(B) Restriction enzyme analysis was performed on 5' labeled WT TR substrate.


The


products were fractionated on a 10% denaturing polyacrylamide gel.


undigested substrate.


TR indicates


(C) Rep68 endonuclease assays were performed on 5' labeled


WT TR substrate (see Materials and Methods for details).


Products were resolved on


a 10% denaturing polyacrylamide gel. The position of the 163 nt substrate and 22 nt


product are indicated.


The total amount of Rep68 used in reaction is indicated above


each lane.




















A.


yi RBE'

G
CG
G
G Ddel BssHII



GC
QGC TCAGTGAGCGAGCGAG GCGCAGQ GAGGGAGTGGCCA ACTCCATCACTAGGGGTT (3)
G; CCAGACTCCTCGCTCGCGTrcTCCCTCACCGGTTOAGGTAGTGATCCCCAAGATC (5)

-- Hpall RBE trs


G C
SC
A





B. C.

i Rep68 (fmol)





16- 63 nt
A 163 nt


S~*w < 22 nt








Figure 8. Rep68 endonuclease assays on 1 bp transversion mutants.

Individual bps were mutated to transversions and assayed for Rep68

endonuclease activity. Boxed regions denote WT AAV sequence. Arrows point to

mutated sequence. Mutants were assayed together as a panel that included WT

substrate (see Materials and Methods for details). The relative Rep specific activity for

each mutant was expressed as the fraction of mutant substrate nicked divided by the

fraction of wt substrate nicked at the same Rep concentration. Ratios obtained at

different Rep concentrations in the two trials were then averaged and graphed for each

mutant (n= 1 for mutations within the sequence 3' CCGGTTGAGG 5', and n=6 for

mutants flanking this sequence. Error bars indicate standard deviation of mean.).

Rep68 nicking activity on WT substrate is indicated with horizontal line across the

graph.






















2.5



2.0



I 1.5



1. ----------------------------------------------------












f tt tt t f tttttt





trs
T
CG
AT
GC
CG
Gc
GC



G C
SC RBE trs
cc
CG
CG
AG C








Figure 9. Rep68 endonuclease assays on 2 bp transversion mutants.

2 bp transversions were introduced near the trs. Shaded boxes denote mutated

sequences. Rep68 endonuclease activity was assayed on these mutants and wt TR

substrates (see Materials and Methods). The relative Rep specific activity for each

mutant was expressed as the fraction of mutant substrate nicked divided by the

fraction of wt substrate nicked at the same Rep concentration and graphed.




















SubsrateNickng (utandWT


V TGGCCAACTCCA
ACCGGT.TGAGGT
trs
,- TIM --,: A A-: I '-A

M I T",c A A : T A
M A AANC C I T G' A ,
M_ rGTAC:AA : rcCA
M2 A C T T C AG,. T

M T C' AAlA A -' ZC: A

M4
HA T ,.7 ,T iA C T,7,C A
A4 C, T A, .A.:..:r
M5 T C.:.. CC -- TC 7. A
M5 AL.:.;G A
ACT : ,C- G. A A

M6 A: G L.rGTJAC.: ,

M7 TGGCCAAMCCA
ACCGGT r'STCGT
Mg T- CC C 'A A ^[TA-- A
A C C r G G T G -ATJG T
A5 AC C.;GITGjGAT



MWO TGCG:.AA:: T,:[' -
ACC G T ,T A GITI


I




I

N.D.


0. I I I I
0.0 0.2 0.4 0.6 0.8 1.0


Nicking (Mutant/WT)


Substrate









Figure 10. Rep68 endonuclease assays on 1 nt transversion mutants.

Individual nts within the 7 bp core sequence were mutated to transversions and

assayed for Rep68 endonuclease activity. Shaded boxes denote mutated sequence.

Mutants were assayed together as a panel that included WT substrate (see Materials

and Methods for details). The relative Rep specific activity for each mutant was

expressed as the fraction of mutant substrate nicked divided by the fraction of wt

substrate nicked at the same Rep concentration. Ratios obtained at different Rep

concentrations in the two trials were then averaged and graphed for each mutant (n=4

for all mutants. Error bars indicate standard deviation of mean. Relative Rep68 nicking

activity on WT substrate is indicated with horizontal line across the graph.














Substrate Nicking (Mutant/WT)


CCGGTTG
trs

Uncut Strand

Al GCCAAC
SCCGGTTG
BI G CCAAC
CCGGTTG


Cl GCCAAC


El C C CEA :


CCGGTTG

D1 0:.A5 1 1.
CCGGTTG


Nicked Strand
GGCCAAC

GGCCAAC
B2 CjGGTTG

GGCCAAC

GGCCAAC
D2 C Gj[T T G
GGCCAAC
E2 C C GJT G

GGCCAAC
F2 G G TC

G2 GGCCAAC
CCC0TT0

0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0








Figure 11. Rep68 Endonuclease reactions on single-stranded TR mutants.

(A) The sequence of our substrate designed to mimic the 3' viral end

(REANNEAL) is given. The boxed region indicates additional sequences deleted

opposite the trs in the extensively single-stranded substrate described by Snyder et al.

(1993). (B) Rep68 endonuclease reactions were performed on WT and REANNEAL

substrates as described in Materials and Methods. Products were resolved on a 10%

denaturing polyacrylamide gel. Numbers above lanes indicate total amounts of Rep68

in the reactions expressed in fmols.


















A.


T
T T
c G REANNEAL
G c



CG


CG









B.
Substrate WT REANNEAL

Rep68i(fmol) o


Substrate r


Product


-~, --Ip.









Figure 12. Secondary structure at the AAV trs.

(A) Sequences near the trs from the various AAV serotypes were downloaded

from GenBank and aligned. Boxed nts denote sequence changes from the

consensus. Palindromic sequences are underlined. (B) Palindromic sequences near

the AAV2 and AAV5 trs depicted as stem-loop structures. Location of AAV-5 trs is

from Chiorini et al. (1). (C) Rep68 nicking data from 1 bp transversion mutants has

been superimposed on the predicted AAV2 trs stem-loop structure. Circles denote

minimal trs as determined by 1 nt mutants.















AAV1 TCTCCCTCACCSGT TGAGGTAGT
AAV2 TCTCCCTCACCGGT TGAGGTAGT
AAV3 TCTCCCTCACCGGT TGAGGTAGT
AAV3b TCTCCCTCACCGGT TGAGGTAGT
AAV4 TCTCCCTCACCGGT TGAGGTAGT
AAV5 -CL--.C C r.fCA--G- TGTGAGAGT
AAV6 TCT.:T':CT CA':C@ T TGAGGTAGT
Consensus (3')TCTCCCTCACC%GT TGAGGTAGT(5')

trs




AAV2 C G AAV5
C T G
A-T G T
C-G trs C-G.
T-A A-T trs
C-G C-G
C-G T-A
C T C-G
T-A T-A
(3 )C-G (5 ) (3'C C-GT )
(3')T T(5') (3')CCCCC T(5')


1 bp Transversions (Mutant/ WT Cleavage)


0.32 -
0.12+ 0.13
0.14 -*) 4- 0.10
0.77 -* A 4 0.09
1.66-a C fI 0.21
0.44 T-A 4- 0.73
C-G 0.55
C-G 0.81
C T +- 0.44
T-A *- 0.67
C-G
(3')T T(5')









Figure 13. Role of trs stem-loop In Rep68 endonuclease reaction.

(A) WT and NOSTEM substrates are depicted after the formation of trs stem-

loop structure. The Rep binding element and Rep contacts with the small internal

palindromes of the terminal hairpin (RBE') are indicated with ovals. The minimal trs as

determined by 1 nt mutants is also indicated. (B) Rep68 endonuclease reactions were

performed on WT and NOSTEM substrates in the presence of 0.5 mM ATP, 0.5 mM

ATPgS, or no ATP as described in Materials and Methods. Products were resolved on

a 10% denaturing polyacrylamide gel. Numbers above lanes indicate the total amount

of Rep68 in the reactions expressed in fmols. (C) The gel from (B) was

phosporimaged and the amounts of substrate and product were determined. This data

was graphed to show relative specific activity of Rep68 on the two substrates under

the different ATP conditions.








61


















A.

G


C C
RBE G A
A T A T
C G G C
c RBE A T
GC C
C cGCC CAGTGAGCGAGCGAGCGCGCAGA ACTAGGGGTT (3')
T T
Oa cCG c TGGATCCCCAAGATC (5')


Sc .T A






Minimal trs

A T,
G C





C G (








A CCAG AGTCACTCGCTCGCTCGC ACGTC TGATCCCCAAGATC (5A)
A c trs
A A
G C








G cT C A rS














+0.5 mM ATP +0.5 mM ATPTS


Substrate WT NOSTEM WT NOSTEM WT NOSTEM

Rep68 (fmnol) 0 ? S o 8 8 8
L I C. > L Qi in .- N 0 8 ON i B


NOSTEM +ATP
NOSTEM no ATP


NOSTEM+ATPyS

WT+ATP



WT +ATPyS
WT no ATP


0 100 200 300 400 500

Rep68 (fmol)


Figure 13--continued


Substrate







Product


** 1 ** <0* Wa



.ftMr


No ATP














THE MECHANISM OF REP-MEDIATED AAV ORIGIN NICKING


Introduction



The single-stranded DNA, adeno-associated virus (AAV) genome is flanked by

terminal repeats (TRs). Internal palindromes allow each TR to fold back on itself forming

terminal hairpinned structures that function as origins for AAV DNA replication, as well

as integration and packaging signals (33, 59, 79). During infection, synthesis of the AAV

genome is initiated by an unidentified host cell DNA polymerase using the 3'-hydroxyl

primer of the hairpinned TR. This second strand synthesis results in the replication of

internal genes, allowing production of viral proteins. Yet, continued AAV DNA synthesis

requires the introduction of a site-specific, single-stranded nick into the TRs by the viral

encoded, non-structural Rep proteins, Rep78 and Rep68 (42, 62, 84, 101).

In our current model of AAV DNA replication, Rep origin nicking and subsequent

Rep mediated unwinding of the TR generate a 3'-hydroxyl primer for repair synthesis of

the TR. During this process of terminal resolution, Rep induces a single-stranded nick at

the terminal resolution site (trs), forming a 5' phosphotyrosyl linkage between Rep and

the nicking site (Fig. 2) (42, 84, 86). Current evidence suggests that this Rep origin

nicking activity requires three functional elements within the AAV TR, the canonical Rep

binding element (RBE), and a portion of the small internal palindromes within the









terminal hairpin (RBE'), and the trs (Fig. 4) (18, 57, 58, 77, 85, 105). The secondary

structure of the internal palindromes may also play a role (52).

Previously, we identified the core trs sequence necessary for efficient Rep

catalyzed nicking, 3'-CCGGT/TG-5' (11). This core sequence is strand specific in that it

is required only on the nicked strand. Interestingly, the sequences flanking the trs

contain an inverted repeat conserved among various AAV serotypes (11). Similar to

rolling circle origins of DNA replication (63, 66), these inverted repeats appear to form a

nicking site stem-loop structure. In the case of AAV, extrusion of this structure requires

ATP-dependent, Rep helicase activity, but once this structure is formed the actual

endonuclease reaction is not dependent on ATP (11). Since the nicking site is within the

single-stranded region of this origin stem-loop, it appears that the nicking intermediate is

a single-stranded trs (11).

In addition to a specific sequence and structure at the trs, efficient Rep nicking

requires two additional sequence recognition elements within the AAV TR, the RBE and

RBE'. Mutational analysis has identified a core 22 bp sequence required for stable Rep

binding to linear TR substrates (77). This RBE includes the tetrameric GAGC repeat

identified by several groups as necessary for stable Rep binding to both linear and

hairpinned TR substrates (8, 18, 57, 58, 77,105). Moreover, chemical interference

assays indicate that all major Rep contacts within the linear portion of the hairpinned TR

fall within the RBE (2, 67, 77). Thus the 22-bp RBE appears to be the primary sequence

element promoting Rep binding to the AAV TR. Homologues of this RBE are present at

the AAV p5 promoter, the preferential proviral integration site on human chromosome

19, and within several viral and cellular promoters (6, 40, 48, 50, 55, 69, 105, 107, 108).









Although the contribution of the RBE to Rep catalyzed trs nicking has not been

determined, mutant AAV genomes containing multiple transversions in the RBE replicate

at much lower levels than wt (8). This observation has led to the conclusion that stable

Rep binding to the AAV TR is necessary for efficient origin nicking and subsequent viral

replication. There is one report of a Rep mutant that fails to bind the AAV TR yet nicks

TR substrates in vitro, albeit at lowered levels compared to wt. However, this Rep

mutant does not cleave these substrates at the trs but 11 or 12 nucleotides downstream

of the correct nicking site (5). Thus our current model predicts that the RBE establishes

the polarity of Rep interaction with the AAV TR, correctly aligning Rep over the trs,

culminating in nicking of the correct strand at the correct site. This alignment over the trs

is thought to be quite precise since the correct strand of the trs is nicked even when both

strands contain the same sequence (85).

Rep interaction with the AAV TR is enhanced by sequences within the internal

palindromes of the terminal hairpin. Rep binds the complete TR with 125- to170- fold

greater affinity than linear TR substrates lacking the internal palindromes (57, 77).

Moreover, Rep trs nicking on similar linear TR substrates is reduced 4- to 50-fold

compared to hairpinned TR substrates (18, 58, 92, 109). Previously, it was thought that

Rep made no specific contacts with the terminal hairpin, but recently Ryan et al. (77)

identified Rep sequence contacts with the CTTTG motif at one tip of the secondary

structure element. Curiously, this short sequence, referred to here as the RBE', has a

constant position with respect to the trs regardless of the orientation of the TR (flip or

flop). Deletion of the RBE' and adjacent sequences reduces both Rep nicking in vitro

and viral DNA replication in vivo (9, 85, 109).









Though many functions have been attributed to the interaction of Rep with the

AAV TRs, the mechanics and architecture of this interaction remain undetermined. Here

we investigate the functional roles of the RBE and RBE' in an attempt to better

characterize the mechanism of Rep-catalyzed trs nicking in vitro. We determine the

contribution of the RBE by altering the polarity and distance of the RBE relative to the trs

within mutant TR substrates. Increased spacing between the RBE and trs or a change

in the polarity of the RBE dramatically reduces Rep specific activity, and only the wild-

type orientation of the RBE is able to support efficient Rep nicking. These data indicate

that association with the RBE is critical to the correct alignment of the Rep active site

over the trs for efficient cleavage. Additionally, we characterize the contribution of the

RBE' to Rep-mediated trs nicking using a panel of substitution mutants. The mutants

indicate that specific nucleotides within the RBE' are required for efficient, Rep-mediated

cleavage. These RBE' contacts apparently contribute to Rep mediated unwinding of

sequences near the trs and formation of the correct nicking intermediate. Together

these results suggest a model for Rep interaction with the AAV TR during trs nicking.







Results




Spacing between the RBE and tr8 is Critical during Rep Nicking

Previously we determined that Rep makes sequence-specific contacts at the trs

and that sequences flanking the trs include a conserved inverted repeat which









apparently forms a nicking site stem-loop structure (11). Substrates in which this stem-

loop was extruded (nostem) abolished the ATP requirement for Rep68 mediated trs

nicking in vitro, indicating that the actual Rep endonuclease reaction did not require

ATP. Moreover, Rep nicked the nostem substrate with a 2- to 3-fold greater specific

activity than wt. Since the specific activity of Rep nicking on this substrate was

essentially the same in the presence and absence of ATP, we concluded that the DNA

helicase activity of Rep was not required once the trs stem-loop is formed (11).

Although these observations helped to clarify the nature of Rep interaction with the trs,

the functional contribution of Rep interaction with the RBE during trs nicking remained

unclear.

To assess the importance of spacing between the RBE and the trs during Rep

nicking, a panel of insertion mutants was constructed. These mutant TRs contained 3,

5, 7, or 10 bp of heterologous sequence inserted directly between the RBE and the trs

stem-loop structure (Fig. 14A) in a region that does not overlap with either element. TRs

were constructed from three synthetic oligonucleotides that were ligated together as

described in Materials and Methods. Complete TR constructs were then purified from

ethidium bromide stained, 10% denaturing polyacrylamide gels and 5'-end labeled with

[y -"P] ATP and T4 polynucleotide kinase. Rep trs cleavage was assayed on mutant

and wt substrates in vitro using homogeneously pure Rep68 as described in Materials

and Methods.

Rep68 nicking was reduced on all of the insertion mutants compared to wt and

decreased as the spacing between the RBE and the trs increased (Fig. 14B and C).

Furthermore, no significant improvement was seen in the wt+10 mutant, in which the trs

site was expected to be on approximately the same side of the DNA helix as the wild









type substrate. It should be noted that the wt+10 mutant appears to contain a small

portion of higher molecular weight DNA (Fig. 14B). This second band appears to be a

gel artifact arising from the electrophoresis conditions used in this experiment. When this

mutant substrate is resolved at higher temperatures, a single, correctly sized DNA is

observed.

The trend in Rep68 nicking on these insertion mutants suggests that the actual

spacing between the RBE and trs is important during Rep nicking and not just the

relative position of the trs on the surface of the DNA helix. Although most of the Rep68

mediated cleavage on the mutant substrates occurred at the trs, some non-trs Rep68

nicking was observed on the 7- and 10-bp insertion mutants. This secondary site

nicking occurred on the correct strand but internal of the trs, suggesting that the

increased spacing between the RBE and trs was changing the specificity of Rep68

nicking. Together, these observations indicate that the spacing between the RBE and

the nicking site is critical for both accurate and efficient Rep68 trs cleavage.


Rep Remains bound to the RBE during trs Nicking

Although the spacing between the RBE and trs appeared important, the reason

for the spacing requirement was unclear. One possibility was that the increased

distance of our spacer mutants prevented formation of the nicking site stem-loop

structure by endogenous Rep DNA helicase activity. To investigate this possibility, we

constructed a 10-bp insertion mutant that included a preferentially extruded trs stem-loop

structure (Fig. 15A, NOSTEM+10 substrate). Rep nicking on this substrate and its wild

type counterpart, nostem, should no longer require ATP or DNA helicase activity (11).

Thus, we reasoned that if increased spacing inhibited trs stem-loop formation, then









preferentially extruding this structure should result in efficient Rep68 trs nicking of the

10-bp insertion mutant in the absence of ATP.

In fact, preferential extrusion of the nicking site stem-loop structure in the 10-bp

insertion mutant did not result in efficient trs nicking. Rep68 nicking on this substrate

was barely detectable (Fig. 15B and C, NOSTEM+10 substrate). In contrast, preferential

extrusion of the trs stem-loop structure in the wt background increased Rep68 specific

activity as previously reported (Fig. 15, NOSTEM substrate)(11). This result indicated

that Rep68 is unable to make functional contacts with the trs, in the absence of ATP,

when the spacing between the RBE and trs has been increased. Since our previous

study indicated that Rep helicase activity is not required for cleavage once the trs stem-

loop is formed, these data strongly suggested that Rep is unable to recognize and nick

the trs efficiently unless Rep is also physically interacting with the RBE.


The RBE aligns Rep over the trs

If Rep must maintain contact with the RBE during nicking, then the polarity of the

RBE within the TR should have a strong effect on nicking efficiency. To test this

prediction, we constructed three additional mutants in which the 22-bp RBE was

substituted with its compliment, inverse, or inverse compliment (Fig. 16A). If any of

these polarity changes still supported Rep trs nicking then this would suggest a possible

model of Rep interaction with the AAV TR.

Initially, we asked if the RBE polarity mutations prevented Rep binding to the

AAV TR. Although the inverse complement RBE was expected to bind with

approximately the same efficiency as wild type, it was not clear whether the more severe

alterations in strand polarity in the inverse and complement mutants would affect









binding. To assess Rep binding to these mutants, steady state binding assays were

done under the same reaction conditions as the nicking assays. However, to prevent

nicking and the subsequent accumulation of covalent complexes between Rep and the

TR substrates, ATP was omitted from the binding reactions. These reactions were then

resolved on a native polyacrylamide gel to separate the Rep-bound TR complexes from

the starting substrates. As shown in Figure 16D, all of the RBE polarity mutants were

bound by Rep at the enzyme concentrations used in the nicking assays (see Fig. 16B

and C). However, there appeared to be some disparity in Rep binding activity between

the mutant substrates. This result indicates that the strand polarity of the RBE sequence

does have a small affect on Rep binding activity but not enough to prevent TR binding at

the enzyme concentration used during nicking reactions.

In contrast, the results from Rep68 nicking assays on the three polarity mutants

indicated that only the wt RBE was capable of directing efficient Rep trs nicking (Fig.

16B and C). The reduction in Rep nicking activity on the RBE polarity mutants

compared to wt was much larger than accounted by differences in Rep binding activity.

Thus, changes in the polarity of the RBE appear to have primarily inhibited the

association of the Rep endonuclease active site with the trs. This is consistent with the

notion that the RBE aligns Rep or a Rep complex in an orientation that is favorable for

subsequent trs cleavage.

Curiously, none of our polarity mutations completely prevented Rep68 trs nicking.

The small amount of cleavage observed on these mutants may arise from at least two

possibilities. First, Rep may be capable of recognizing and cleaving the trs in the

presence of ATP, outside the context of other elements. It should be noted, however,

that the amount of Rep trs cleavage observed on these mutant substrates is quite small









(5 to 10-fold less that wt), and similar to levels observed on nicking site mutants that we

previously reported (11). Second, the low level of cleavage with the polarity mutants

may indicate that other sequence elements, like the RBE', are also contributing to the

alignment of Rep along the AAV TR, and directing nicking to the trs (see below). In

either case, the RBE appears to align Rep along the TR and direct nicking to the trs.


The RBE' is Required for Efficient Rep-mediated Nicking

Despite the importance of the RBE in Rep catalyzed nicking, previous binding

assays have detected Rep contacts with a single tip of the internal palindromes of the

AAV TR (77). This sequence, referred to as the RBE', has a constant position with

respect to the trs regardless of the orientation of the TR (flip or flop) (Fig. 16A). The

functional importance of RBE' sequences during Rep trs nicking was recently confirmed

by Wu et al (109). This group observed a 3- to 8-fold reduction in Rep nicking activity on

TR substrates in which the RBE' had been deleted.

The data from Rep68 nicking assays conducted on these RBE' substitution

substrates were consistent with previous binding and nicking assays (77, 109). Rep68

cleavage was reduced on all substrates containing substitutions in the CTTTG motif by

2- to 3-fold (Fig. 17B and C, compare AAA, AAAAT, or SWITCH with WT [FLIP]).

Furthermore, substitutions in the complementary sequence that comprises the other tip

of the internal palindromes had no effect on nicking (Fig. 17B and C, compare TTT with

WT [FLIP] or AAA with SWITCH). To determine whether other sequences within the

internal palindromes affected nicking, we made a mutant in which all of the internal

palindromic sequence was deleted in the context of a covalently closed end (Fig. 17A

and C, LINEAR). Rep specific activity on the linear substrate was only moderately









reduced compared to the specific activity observed on the RBE' substitution mutants

(Fig.17, compare AAA, SWITCH, and AAAAT to LINEAR). Together these nicking

results supported the hypothesis that Rep makes specific nucleotide contacts with the

RBE' during trs nicking and the most important contacts within the internal palindromes

are within RBE'. If internal palindrome sequences outside the RBE' contributed

significantly to Rep nicking then we would have expected a greater reduction in Rep68

nicking on the LINEAR substrate.

To confirm the importance of the RBE' to nicking, we also tested Rep68 nicking

on the wild type flop substrate. We expected this substrate to nick at approximately wild

type levels because all three components of the TR (trs, RBE, and RBE') had the correct

sequence and orientation. However, Rep68 nicked the flop substrate with about half the

efficiency as the flip substrate, suggesting that other factors influenced Rep trs nicking

activity. Since both the flip and flop orientations of the AAV TR maintain the RBE and

the RBE' in the same position relative to the trs, the difference in Rep nicking activity

must be due to the dissimilar sequences flanking the RBE' in these two substrates (Fig.

17A, compare WT [FLIP] with WT [FLOP]). Indeed, our previous analysis indicated that

Rep made additional base contacts within the terminal hairpin sequences flanking the

RBE' when bound to the flop substrates as compared to flip (77).


RBE' Facilitates DNA Helicase Activity and trs Cruciform Extrusion

Although it was clear that Rep contacts with RBE' were important for efficient

nicking, it was not clear whether they affected the DNA helicase or endonuclease activity

of Rep. We reasoned that if contacts with RBE' were important for trs transesterification

activity, then RBE' mutations should inhibit Rep nicking, even after extrusion of the trs









stem-loop structure. To clarify this issue, a panel of RBE' substitution mutants was

constructed in the nostem background (Fig. 18A). As discussed earlier, the nostem

substrate contains a pre-formed trs stem-loop structure and nicking of this substrate

does not require ATP-dependent Rep helicase activity, allowing nicking assays to be

done in the absence of ATP. Interestingly, both of our nostem RBE' mutants were

nicked at nearly wt levels in the absence of ATP (Fig. 18B). Moreover, Rep nicked these

nostem RBE' substitutions about 2-fold more efficiently than the same RBE' mutations in

the wt TR background (compare Fig. 17C, AAA and AAAAT with Fig. 18B, NOSTEM

AAA and NOSTEM AAAAT). This result indicates that Rep interaction with RBE' is not

necessary for the Rep transesterification reaction. Rather, it appears that RBE' is

required primarily for efficient, Rep-mediated unwinding of the AAV TR and formation of

the nicking intermediate.



Discussion



Previous binding and chemical interference studies in the absence of ATP have

determined that Rep makes contact with two distinct elements within the AAV TR, the

linear RBE and the CTTTG motif at one tip of one of the internal palindromes, the RBE'

(18, 57, 58, 77). In the presence of ATP, Rep makes additional contacts with the trs that

lead to transesterification (11, 42, 84, 85). Regardless of the orientation of the internal

palindromes, flip or flop, these three elements are maintained in a constant position

relative to the trs during viral DNA replication. During the course of this study we have

analyzed the contribution of Rep binding contacts along the AAV TR to Rep-mediated trs

nicking. Using synthetic AAV TR substrates we have altered the position and polarity of









the RBE relative to the trs and mutated the primary sequence of the RBE'. In vitro Rep

trs nicking assays on these mutant substrates indicate that both the RBE and RBE' are

required for efficient Rep catalyzed trs nicking.


The RBE is Required both for Origin Unwinding and for trs Nicking.

Rep nicking activity decreased dramatically when the spacing between the RBE

and the trs was altered, indicating that the position of the RBE relative to the trs is critical

for efficient cleavage. This observation is consistent with previous in vivo studies of AAV

DNA replication, in which AAV genomes harboring mutant RBEs replicated at lowered

levels compared to wt genomes (8), and in vitro studies, which indicated that the RBE

was necessary for Rep binding (18, 57, 58, 77). Recently, we showed that the trs

endonuclease reaction occurs in two steps, an initial unwinding of the TR by the Rep

associated DNA helicase that leads to the extrusion of the trs stem loop structure, and

the subsequent transesterification reaction that leads to cleavage of the trs (11). We

also demonstrated that Rep has a site-specific DNA helicase activity that unwinds DNA

containing an RBE (117). Our data from the RBE polarity and spacing mutants in this

report indicate that Rep must maintain contact with the RBE during both the TR

unwinding and the trs cleavage steps of the endonuclease reaction.

At least two models could describe Rep interaction with the TR during trs

transesterification. For example, it is possible that Rep initially binds the RBE and then

translocates along the nicked strand to the downstream nicking site, in a manner similar

to the restriction endonuclease EcoKI (23, 30, 32). Once at the trs, Rep would recognize

the nicking site and initiate the transesterification reaction. In this model the trs stem-

loop structure may function as a helicase pause site, allowing prolonged contact









between Rep and the nicking site. Alternatively, Rep may be tethered to the RBE during

nicking. Endogenous Rep helicase activity would allow downstream contact with the trs,

melting of the duplex nicking site, and formation of the nicking site stem-loop structure.

In this second model (illustrated in Fig. 21), the nicking site stem-loop structure would

effectively reposition the trs closer to the RBE bound Rep, allowing efficient cleavage.

Rep nicking data from our insertion mutants is not consistent with a translocation

model of Rep mediated trs nicking. Rep is a fairly strong helicase capable of unwinding

345 bp per minute (117). If Rep was initially binding the AAVTR through the RBE and

then actively translocating downstream analogous to EcoKI, then we would not expect

small increases in spacing between the RBE and the trs to effect the specific activity of

Rep nicking. Yet, Rep had a lowered specific activity on all spacer mutants compared to

wt (Fig. 14). Moreover, the specific activity of Rep nicking decreased rapidly as spacing

between the RBE and the trs increased. Since it is unlikely that 5, 7, or 10 bp of

intervening sequence would prevent translocation of Rep from the RBE towards the trs,

it appears that the mechanism of Rep mediated trs cleavage does not include helicase-

stimulated translocation. Furthermore, artificially fixing the trs stem-loop structure in the

extruded configuration should remove the need for Rep DNA helicase activity and thus

contact with the RBE. However, Rep nicking on our 10-bp insertion mutant was barely

detectable even after extrusion of the trs stem-loop structure (Fig. 15). Thus it appears

that Rep maintains contact with the RBE during both DNA helicase and trs cleavage

activities.

We note that none of our RBE spacer or polarity mutations completely prevented

Rep-mediated trs nicking. Apparently, Rep is able to recognize and nick the trs

regardless of RBE position, albeit at much decreased levels. Thus other elements within









the AAV TR such as the RBE' and trs must also contribute to Rep nicking. In the case of

the trs this is not surprising, because our previous study indicated that Rep makes

sequence specific contacts at the trs during nicking. Mutation of sequences within the 7

base core trs sequence site reduced Rep cleavage 6- to 10-fold compared to wt

substrates, suggesting that Rep specificity for the trs is quite stringent (11). Indeed,

Smith and Kotin (82) recently showed directly that Rep can cleave a single stranded, trs

containing oligonucleotide in the absence RBE or RBE' sequences.


Contribution of the RBE' to Rep trs Nicking.

The importance of the RBE' to Rep-mediated nicking was anticipated by viral

DNA replication assays as well as Rep binding and nicking assays (9, 18, 52, 58, 77,

109). Previous AAV DNA replication assays demonstrated that the internal palindromes

of the TR are necessary for efficient viral DNA replication. AAV plasmid constructs

deleted of the RBE' and adjacent sequences replicated at lowered levels than wt AAV

constructs (9, 52). Furthermore, in vitro studies indicated that Rep requires the internal

palindromes for efficient TR binding and nicking (18, 58, 77, 85). During TR binding,

Rep appears to make limited sequence contacts with the internal palindromes, and the

most prominent of these contacts occur within RBE' (77).

Our data confirmed that Rep is making sequence specific contacts with CTTTG

motif of the RBE'. Substitutions within this sequence significantly reduced Rep nicking

activity (Fig. 17). However, when we examined these same RBE' mutations in the

context of the nostem background, the reduction in Rep nicking activity was very small

(Fig. 18). This suggested that Rep no longer requires contact with the RBE' once the









stem-loop has been formed and implied that interaction with the RBE' was important

primarily for Rep TR unwinding activity, rather than the transesterification reaction.

The RBE' sequences appear to be the most significant Rep contacts with the

internal palindromes during trs nicking. Rep nicking activity on our linear substrate was

only slightly reduced compared to our RBE' substitution mutants, supporting this

conclusion. However, the slight reduction in Rep specific activity observed on our linear

substrate does imply that either sequences flanking the CTTTG motif or the internal

palindrome structure itself contribute to efficient Rep cleavage. Additionally, Rep nicking

activity was reduced on our flop substrate as compared to the flip substrate. Although

this alternative orientation of the AAV TR maintains the CTTTG motif in the same

position relative to the trs, the sequences flanking this motif are different from the flip

orientation. Indeed, Ryan et al. (77) observed differences in Rep binding contacts

between the flip and flop orientations within these flanking internal palindrome

sequences. Perhaps this indicates that Rep association with the flop orientation is

fundamentally different from flip. This concept is supported by chemical interference

assays that reveal differences between Rep contacts within the RBEs of the two

substrates. Although Rep makes many discrete contacts within the RBEs of both flip

and flop, the strength of individual base contacts are different in the two TR orientations

(77). Finally, the reduction in nicking activity seen with our RBE' substitution mutants

and the linear mutant (about 3 fold) was less than we and others had previously seen on

substrates that were missing portions of the internal palindromes (5-100 fold) (18, 58,

85, 109). This was most likely due to the fact that the substrates used in this study were

covalently closed at one end, whereas previous studies had used Smal cut or linear

oligonucleotide substrates. Thus, previously used substrates would likely be unwound









by the Rep helicase activity to generate single stranded DNA molecules. In contrast, the

substrates used in this study would rapidly reanneal to duplex molecules.


The RBE appears to Align Rep Asymmetrically on the TR.

When we examined all three possible polarity changes of the RBE sequence

(Fig. 15, INVERSE, COMPLEMENT and INVERSE COMPLEMENT), only the wild type

polarity retained significant nicking activity. Yet, all of these polarity mutants bound Rep

with affinities that were comparable to the wild type substrate. This suggested that RBE

binding is not particularly sensitive to strand polarity. It also suggested that Rep

interaction with the RBE during nicking is inherently asymmetric and serves to align the

Rep nicking complex in the appropriate orientation on the TR for the subsequent

helicase and transesterification reactions.

Although the RBE appears to play a central role in orienting Rep along the AAV

TR during nicking, the architecture of this interaction is undefined. It is not yet clear what

an active Rep complex looks like when it is bound to the TR. The kinetics of trs nicking

are second order with respect to Rep and ATP concentration, suggesting that a dimer of

Rep is sufficient for nicking activity (117). In contrast, Rep DNA helicase activity

appears to be first order with respect to enzyme concentration. Furthermore, binding

studies detect at least 6 different bound species, suggesting that Rep complexes can

contain as many as 6 Rep molecules (57, 83). If a Rep dimer is the active nicking

complex as implied by the kinetic data, then our data suggest that individual Rep

monomers do not associate along a twofold axis of symmetry similar to the type II

restriction endonucleases. Presumably such an arrangement of Rep molecules would

be active on both our wt and inverse-complement substrates. Indeed, our data imply









that the Rep nicking complex is arranged asymmetrically along the RBE. This

asymmetry may arise from the arrangement of Rep monomers within the homodimer or

may reflect the involvement of higher order complexes in the nicking reaction.

In conclusion, it appears that at least two discrete steps are involved in Rep-

mediated AAV origin nicking. First, Rep binds the TR through the RBE. The RBE aligns

the Rep complex along the TR allowing specific contacts with RBE'. These RBE'

contacts appear to stabilize the Rep complex and facilitate Rep mediated DNA helicase

activity. It is unclear if Rep maintains its original contacts and pulls unwound

downstream sequences towards the RBE allowing them to self-anneal into the trs stem-

loop, or if stem-loop formation is more passive in nature. In either case, the net result of

Rep helicase activity is the formation of the trs stem-loop. Once formed this structure

presents the single-stranded trs to the Rep transesterification active site in the proper

position for nicking.









Figure 14. Rep nicking activity on RBE Insertion mutants.

(A) The wt AAV TR is depicted after extrusion of trs stem-loop structure. The

RBE is indicated with a box, the RBE' is indicated with a dashed oval, the minimal trs

is indicated with small circles, and the actual nicking site is indicated with a small

arrow. The position of insertions is indicated with a large arrow. The inserted

sequences are given next to the mutant identifier. (B) Rep68 endonuclease reactions

were performed on wt and insertion substrates in the presence of 0.5 mM ATP as

described in Materials and Methods. Products were resolved on a 10% denaturing

polyacrylamide gel. A representative gel is shown. Numbers above lanes indicate the

total amount of Rep68 in the reactions expressed in femtomoles. The positions of

substrates and products are indicated. (C) Nicking data was obtained from two

independent trials. The relative Rep specific activity for each mutant was expressed

as the fraction of mutant substrate nicked divided by the fraction of wt substrate nicked

at the same Rep concentration. Ratios obtained at different Rep concentrations in the

two trials were then averaged and graphed for each mutant (n=4 for all substrates

except WT+10 where n=7). Bars indicate the standard deviation from mean.






















A.

GCC


cRE G C
c c RBE G A

SCGG GTCACTCGCTGCGTcTCGCCT-TT TGATCCCCAAGATC (5')

CG Insertions

A A





WT+3 TAC
.ATG
WT+5


WT+7


WT+10

















B.
Substrate WT WT+3 T+5WT5 +7 WT+1C














Product | *




C.
1.0

0.8

S0.6

0.4

z 0.2

0.0
WT WT+3 WT+5 WT+7 WT+10


Figure 14--continued








Figure 15. Rep nicking activity on RBE Insertion mutants In the NOSTEM
background.

(A) The two TR substrates containing preferentially extruded trs stem-loop

structure are illustrated. NOSTEM and NOSTEM+10 TRs are depicted after formation

of trs stem-loop structure. The RBE is indicated with a box, the RBE' is indicated with

a dashed oval, the minimal trs is indicated with small circles, and the actual nicking site

is indicated with a small arrow. The position and sequence of the NOSTEM+10

insertion is indicated with bold italics. (B) Rep68 endonuclease reactions were

performed on wt and the wt+10 insertion substrates in the presence of 0.5 mM ATP as

described in Materials and Methods. Rep68 endonuclease reactions were performed

on NOSTEM and NOSTEM+ 0 insertion substrates in the absence of ATP. Products

were resolved on a 10% denaturing polyacrylamide gel. Numbers above lanes

indicate the total amount of Rep68 in the reactions expressed in femtomoles. (C) The

gel from (B) was phosphorimaged and the amounts of substrate and product were

determined. The fraction of nicked substrate for wt and mutant TRs was then

calculated at each Rep concentration and plotted. Closed boxes denote wt, closed

triangles NOSTEM, open squares wt+10, and open triangles NOSTEM+10.






































(T RBE'

A T
GC
cA


TC GCCtCA GTGAGCGAGCGAGCGCGCAGA ACTAGGGGTT (3')
SC GTCACTCGCTCGCTG CGTC GATCCCCAAGATC (5')


SGC C







GC
CG CG










A C
AC






AC G









AAA
A T



GC
C GC


AC
GC

A









































NOSTEM


Um WT





0 WT+10
~A -- ,NOSTEM+10

0 100 200 300 400 500

Rep68 (fmol)


Figure 15--continued








Figure 16. Rep endonuclease activity on RBE polarity mutants.

(A) The wt AAV TR is depicted after extrusion of the trs stem-loop structure.

The RBE is indicated with a box, the RBE' is indicated with a dashed oval, the minimal

trs is indicated with small circles, and the actual nicking site is indicated with a small

arrow. The wt RBE was replaced with alternative orientations of this sequence. The

sequences of the various RBE orientations are given next to the mutant identifier.

Note that the integrity of the RBE base composition is maintained. Only the polarity of

the nucleic acid sequence has been altered. (B) Rep68 endonuclease reactions were

performed on wt and insertion substrates in the presence of 0.5 mM ATP as described

in Materials and Methods. Products were resolved on a 10% denaturing

polyacrylamide gel. A representative gel is shown. Numbers above lanes indicate the

total amount of Rep68 in the reactions expressed in femtomoles. The positions of

substrates and products are indicated. (C) The gels from two independent trials were

phosphorimaged and the amounts of substrate and product were determined. The

fraction of nicked substrate for wt and mutant TRs were calculated at each Rep

concentration, averaged between trials, and plotted. Closed boxes denote wt, closed

circles complement, closed triangles inverse, and closed, inverted triangles inverse-

complement (n=2 for all data points). Bars indicate the range at each data point in the

two independent trials. (D) Rep binding to wt and mutant TRs was assayed under

endonuclease conditions in the absence of ATP (see Materials and Methods).

Reactions were resolved on a 4% native polyacrylamide gel to separate substrate from

protein bound DNA complexes (PDC's). The positions of substrate and PDC's are

indicated.


























A.

GC

S RBE G A
AG C







c A trs
AC
C TACTCACCAA C CAA CTA TT (
AWT TAT CACTCGCTTAGCT GTATCCCCAAQATC (CA


CONVERSE T 'G








COMPLEMENT A

COMPLEMENT T


INVERSE AG




COMPLEMENT AGANC






















0.4-

0.3-

c 0.2.

z 0.1.

0.0-


WT



COMP
SINVCOMP
INV


0 100 200 300' 400 500
Rep68 (fmol)
Substrate WT COMP INV INVCOMP
Rep68 fmol o8 oo o


PDC






Substrate


'4


Figure 16--continued









Figure 17. Rep endonuclease activity on RBE' substitution mutants.

(A) The wt AAV TR is depicted after extrusion of trs stem-loop structure. The

RBE is indicated with a box, the RBE' is indicated with a dashed oval, the minimal trs

is indicated with small circles, and the actual nicking site is indicated with a small

arrow. Additionally, the position of the Smal endonuclease site is indicated with a line.

The terminal hairpins of flop and RBE' substitution mutants are also depicted. Mutated

sequences are indicated in bold. (B) Rep68 endonuclease reactions were performed

on wt and substitution substrates in the presence of 0.5 mM ATP as described in

Materials and Methods. Products were resolved on a 10% denaturing polyacrylamide

gel. Numbers above lanes indicate the total amount of Rep68 in the reactions

expressed in femtomoles. The positions of substrates and products are indicated. (C)

The gel from (B) and a second gel containing reaction products from wt and LINEAR

substrates were phosphorimaged and the amounts of substrate and product were

determined. The relative Rep specific activity for each mutant was expressed as the

fraction of mutant substrate nicked divided by the fraction wt substrate nicked at the

same Rep concentration. Ratios obtained at different Rep concentrations were then

averaged and graphed for each mutant (n=2 for all mutants except for LINEAR where

n=4). Bars indicate range between the different Rep concentrations.
























GGC
RBE' GT A
Ir -G

SC RBE G A
Gc A
AC1
c 1 O a

G GGCC'CAGTGAGCGAGCGAGCGCGCAG CTAGGGGTT (3')



Sma --G G
c GC C A
A C WT (FLIP) trs







AT A


C G C G C G C G C
C a G C G C G C G C
C G G C G C G C G C
C G G C G C G C G C
AC G TC G C G C G C G C C-
G C G C G C C C G-C
C G C G C G C G C G
C G G C G C G C G C
C G G C G C G C G C
CG GC GC GC GC




G C G C G C G C G C
C G C G C G C G C G
T A CG CG CG CG
G C CG CG C G C G
GC GC C G C GC
A AA A A T T T T A A
F AAA T TT SWITCH A

FLOP AAA TTT SWITCH AAAAT LINEAR






91








B.
Substrate WT FLOP AAA TTT SWITCH AAAAT
Rep68 fmol o o o o
Sa O NS t O o t O N 0

Substrate










Product -*4 "-





1.4

1.2
1.0

0.8
.R 0.6
S0.4

0.2
0.0


Figure 17--continued




Full Text

PAGE 1

REP-MEDIATED NICKING OF THE ADENO-ASSOCIATED VIRUS (AAV) ORIGIN OF DNA REPLICATION By JAMES RODNEY BRISTER II A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FUFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2000

PAGE 2

DEDICATION This work is dedica t ed to my fam i ly Linda Sallie Linnie Bill and Beasty

PAGE 3

ACKNOWLEDGEMENTS I would lik e to a c knowledge the past and present members of the Muzyczka laboratory for helping to create an e x citing research environment. In particular I would li k e to thank Irene Zolotukhin who purified the Rep68 used in this work as well as Sergei Mr. GFP Zolotukhin Dan Big Cat Pereira Dan Dr Doom" Lackner Zengi Retired Great Scientist' Li and Corrine Abernathy Additionally I would like to thank Amy Lassie from the Driscoll lab and Pricilla Non from the Swanson laboratory. I am indebted to my friends Srinivas Midituru Shaun Opie Meg Davis and Ken Warrington for countless acts of generosity and kindness. I am also indebted to Phil Lapis for many helpful discussions and Joyce Conners for lubricating the administrat i ve path to graduation I would like to thank my committee members Al Lewin Tom Rowe Bert Flanegan and Dick Moyer for their time and efforts Finally, I would like to thank my mentor Nick Papa Gator Muzyczka for providing me the challenges, teaching and encouragement necessary to complete this work. iii

PAGE 4

TABLE OF CONTENTS page ACKNOWLEDGEMENTS ... .. .. ... .. .. .. ..... . .. .... . . .. .. .. . . ... .. ... ... .... ..... ......... .. ....... iii TABLE OF CONTENTS ......... .. .. ... ..... .. .. .. ..... .. .... ..... ...... .. .... .. .. ... . ... ..... .. .. .. .. .. .. ... iv LIST OF FIGURES .. . .. .. ..... . .. ..... ....... . ............ . ............... ... .............. ...... .. .. .. . .. .. vi ABSTRACT ...... .. .. . .. .. . ..... .. .. .. ... ... .. .. .. . ... .. .. . .... .. .. .. ... .. .. .. .. ... ... . .. .. .. ...... ..... .. . ... viii THE ADENO-ASSOCIATED VIRUS (AAV) ORIGIN OF DNA REPLICATION ..... .. . .. .. .. 1 The AAV Life Cycle . .. .. ... .. .. ..... ......... .. . ...... ... .. .. .. ... .......... ...... .. .. .. ... . .. 1 The Model of AA V DNA Replication ..... .. ....... ... ... ........ ... . . ..... .. ...... .. .. ... . 3 Factors Involved in AA V DNA Replication .... ... .. .. .... ... ..... ... . .. .. .. .. . ... .. .. .. .. .. . 4 The AA V Rep Proteins . . .. ........... ...... .. .... ..... .. ... .. ........................ ... ..... .. .. . .. 6 The AAV Terminal Repeat (TR) .. .. .. .... .. .. .. . .. .. .. .. ..... .. .... .. . .................. ... . . 8 MATERIALS AND METHODS ..... .. ............... ........... ... . .............. .. ......... .. ..... .. .. . 19 Purification of Baculovirus-Expressed Rep68 .. .. .. .. .. .... ....... . .. .. ......... .. .. ... .. 19 Synthetic TR Substrates ................ ................ ....... ............... .. .... . .. ..... .. .. . 19 Rep trs Endonuclease Assay . .. ...... . .. .. . .. .... ..... .. ........ ....... ........... ... .. .. .. .. . 20 TR Binding Assay . ...... ....... ......................... ........ .. .... .. . . .. .. . .. ..... .. .. .. . . . .. . 21 Construction of No-end AA V Substrates ............. ... .. ....... ....... .................. .. ... 22 In vitro AA V DNA Replication Assay . .............. ....... .... .. .. .. .. . .... .. ..... .. .. ..... 23 REP-MEDIATED NICKING OF THE AAV ORIGIN REQUIRES TWO BIOCHEMICAL ACTIVITIES, DNA HELICASE ACTIVITY AND TRANSESTERIFICATION .. .. . . 28 Introduction .. ..... ......... . ..... ... ........ .. ..... ..... ....... ... .. ......... .. ..... .. ...... .. . ... . 28 Results ... .. .... .. . ....... .. .. .. ..... .... .. .. .. . .. ............ .............. .. .. ... .............. .... .... 31 D . 1scuss1on .... . . . .... .. .. ... .. ...... .. .. ................. ............ .. ... .. .. .. .. .. ..... ..... .. 38 THE MECHANISM OF REP-MEDIATED AAV ORIGIN NICKING ... .. .. .. .. .. .. .. .... .. .. .. 63 Introduction ..... . ..... .. .. .. . .. .. ..... ... ..... .......... ... ... ... ....... .. ........... .. .. .. .. . .. .. . 63 Re suits .... .. .. . .... .. ...... . .. ... ....................... . ... .. .. .. ... .. ...... ..... .. .. ..... . ..... . .... . 66 D . 1scuss1on .... .. . ....... .. ............... .. .. ...... ........................... .. ...... .. .... .. ..... .. .. 73 IV

PAGE 5

page REP INTERACTION WITH THE AAV ORIGIN OF DNA REPLICATION .. . .. .. .. .. ... . .. . 94 Sequence Elements Required for Rep mediated trs Nicking ..... ...... . .......... .. . 94 Model of Rep-Mediated Nicking of the AA V Origin of DNA Replication .. .. .. .. . 97 Rep Association with the AA V TR during trs Nicking .. . .. .. . .. .. .. . .. .. .. . .. . .. . . ... . 98 Rep Cleavag e Activity Effects the Rate AA V DNA Replicat i on .. . . ... .. .. ........ 101 APPENDIX ADDITONAL REP NICKING DATA . ......... .. ....... .. ..... .. .. . .... . .. .. .. .. 114 REFERENCES .. .. .. . .. . . .. ... .. . . .. .. . .. . . .. . .. . ... .. . . .. .. .. ......... . .. .. ... . . .. . ... . .. .. . . 1 1 6 BIOGRAPHICAL SKETCH .. . . . ... ... .. . .. .. .. .. . . .. . .. . .. .. .. . .. .. . . ... . . . .. ... . .. .. .. .. . . .. 127 V

PAGE 6

LIST OF FIGURES Figure page 1 AAV life cycle ... .. .. ... .. .. .. ... ..... ..... .. .. ... . .. ....... .. ... .. ... .. ..... ... .. .. .. ......... .. 12 2. Model of AA V DNA Replication .. .. .. ...... ..... ....... . . .. .. .. . ... .......... .. .... .. .. ... ... 14 3. AAV genetic map .. .. .. .... . ...... .. .. .... ... . .... . .. .. ... .. ... .. ...... ...... .. ... . .. ... .. .. .. 16 4. The AAV TR ... .. .. .. ........ .... .. .. ..... .. .. .. .. ... .. .. .. .. .. ... ... ........ .. ....... .. ..... .. 18 5. Construction of synthetic AA V TR substrates . ... .. .. ... .. .. .. .. .. .. .. .. ... .... . ....... 25 6. Construction of AA V no end substrates . .. ............... .. . .. ........... ...... .. ... .. . 27 7 Endo nuclease analysis of synthetic AA V TR substrates . ............. .. .. .. ... . ..... 49 8. Rep68 endonuclease assays on 1 bp transversion mutants .. .. .. .................... 51 9. Rep68 endonuclease assays on 2 bp transversion mutants .... ...... .. ... . .. .... 53 10. Rep68 endonuclease assays on 1 nt transversion mutants .. .......... .. .. ... ... 55 11 Rep68 Endonuclease reactions on single-stranded TR mutants ... ... .. ...... ... 57 12. Secondary structure at the AA V trs . ... .. .. .. ... .. .. .. . . .. ......... .. .... ..... .. ... .. . ... 59 13. Role of trs stem-loop in Rep68 endonuclease reaction ....... . ..... .. ..... .. ... .. ..... 61 14. Rep nicking activity on ABE insertion mutants ...... .. ... ...... ...... ................ .. 81 15 Rep nicking activity on ABE insertion mutants in the NOSTEM background ............ .. . ... .. .. .. . .......... ... .. ...... ...... ..... 84 16. Rep endonuclease activity on ABE polarity mutants .. ......... . ... .. .. .. .. .. .. ..... .. 87 17. Rep endonuclease activity on ABE substitution mutants .... .. ... .. .. .. .. ..... .. ... 90 18 Rep endonuclease activity on ABE substitution mutants in the NO STEM background ........... .. ....... .. ......... .. . ... .. . ...... ........ .. ... 93 VI

PAGE 7

Figure page 19 Rep endonuclease activity on ABE deletions .. .. ..................... . .. .. . . . .. .. 104 20 Model of Rep interaction with the AA V TR during trs nicking ... .. . .. . ..... .. ... 106 21 Rep68 association with the AA V TR during trs nicking .... ...... . ..... ..... .. . .. 108 22. Relationship between Rep68 comple x formation with the M V TR and trs nicking activity .... .. .. .. .. . ... .... .. .. .. . .. .. .. .. .. .... . .. .. .. . .. ..... ... 110 23 In vitro DNA replication of AAV no-end constructs containing 1 bp transversions at the trs .. .. .. ... .. .... .. .. .. .. . .. .. .. .. ... 112 24 Affect of NaCl concentration on Rep trs nicking .. .. ... .. .. .. .. ...... ..... . ...... .... . 114 25. Secondary Rep68 cleavage sites observed on wt TRs and 2 bp tranversion substrates ... .. ..... .. ... ...... .. .. .. .. .. .. .. .... . ..... ... 115 .. VII

PAGE 8

ABSTRACT Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy REP-MEDIATED NICKING OF THE ADENO-ASSOCIATED VIRUS (AAV) ORIGIN OF DNA REPLICATION By James Rodney Brister 11 August 2000 Chairman: Nicolas Muzyczka, Ph.D. Major Department: Molecular Genetics and Microbiology The single-stranded adeno-associated virus type 2 (AA V) genome is flanked by terminal repeats (TRs) that fold back on themselves to form hairpinned structures. During AA V DNA replication the TRs are nicked by the viral encoded Rep proteins at the terminal resolution site (trs) This Rep endonuclease reaction is ATP-dependent and apparently requires three TR sequence elements, the Rep binding element (ABE) a small palindrome that comprises a single tip of an internal hairpin within the TR (RBE ), and the trs Here we characterize the role of these elements in the Rep endonuclease reaction and determine the mechanism of this reaction. The minimal trs sequence necessary for Rep cleavage is 3'-CCGGT/TG-5' and this 7 base core sequence is required only on the nicked strand. We also identify a potential stem-loop structure at the trs. Interestingly, Rep nicking on a TR substrate that fixes this trs stem-loop in the extruded form no longer requires ATP. This suggests that the trs endonuclease reaction occurs in two discrete steps First, the Rep DNA helicase activity unwinds the TR, thereby extruding a stem-loop structure at the trs. Next, Rep transesterification activity ... VIII

PAGE 9

cleaves the trs. Our data also indicate that Rep is tethered to the ABE in a specific orientation during trs nicking This orientation appears to align Rep on the AA V TR allowing specific nucleotide contacts with the ABE and directing nicking to the trs Accordingly alterations in the polarity or position of the ABE relative to the trs greatly inhibit Rep nicking Substitutions within the ABE also reduce Rep specific activity, but to a lesser extent Interestingly Rep interactions with the ABE and ABE during nicking seem to be functionally distinct Rep contacts with the ABE appear necessary for both the DNA helicase and trs cleavage steps of the endonuclease reaction. On the other hand ABE' contacts seem to be required primarily for TR unwinding and formation of the trs stem-loop structure, not cleavage Together these results suggest a model of Rep interaction with the AA V TR during origin nicking through a tripartite cleavage signal comprised of the ABE, the ABE ', and the trs IX

PAGE 10

THE ADENO-ASSOCIATED VIRUS (AAV) ORIGIN OF DNA REPLICATION The AA V Life Cycle Over time organisms have evolved many seemingly divergent strategies to replicate and maintain their genetic material. Unlike other organisms, viruses and bacteriaphages are dependent on a host cell for their survival. Accordingly, these organisms have evolved highly specialized strategies that allow them to exploit infected cells and replicate their genetic material. Perhaps one of the more interesting strategies is that of the small single-stranded adeno-associated virus (AAV) Initially discovered as a contaminant of human adenovirus (Ad) stocks (3, 14, 72), AA V is unique among members of the parvovirus family in that efficient DNA replication and virion production are dependent on the genetic contributions of unrelated helper viruses. This dependency results in a novel, bipartite life cycle that includes both lytic and latent stages. In the absence of helper virus, AAV establishes a latent infection and integrates into the host cell genome where the AA V provirus is maintained through subsequent rounds of cellular replication. Super-infection of these proviral cell lines with helper virus rescues the integrated provirus resulting in AA V DNA replication and culminating in the release of progeny virions ( see Fig. 1) Although the bipartite AA V life cycle implies a direct role of helper virus in AA V productive infection, the precise nature of helper functions is poorly understood. In 1

PAGE 11

2 cultured cells AAV DNA replication can be induced by a number of viruses including Ad and herpes as well as genotoxic agents such as hydroxyurea and UV light (76, 110112) However AAV DNA replication is primarily associated with Ad co-infection. Ad gene products facilitate the e x pression of AA V proteins by transactivating viral transcription and promoting message stability (12, 16 17 44 45, 78). Yet, the accumulation of AAV proteins alone does not result in high levels of AAV DNA replication (96) Indeed recent studies suggest a model wherein Ad gene products promote AA V DNA replication though cell cycle manipulation, creating a permissive environment for productive infection (27, 54 60 71) Without evidence to support direct involvement of Ad DNA replication machinery in helper functions AA V DNA replication in this environment seems to be almost entirely dependent on cellular factors (61, 88 111). Despite ambiguity and variability in helper contributions the AA V encoded requirements for infection are explicit and concise Productive viral infection requires expression of the two AA V genes rep and cap (35 90) The cap gene provides the structural components of the AA V capsid where as the rep gene codes for a family of non structural proteins that are involved in nearly all aspects of the AA V life cycle, including DNA replication, virion packaging proviral integration and transcriptional regulation (33 59, 62 69 91). Surprisingly, the only cis elements necessary for AA V infection are the 145-nucleotide palindromes that flank the single-stranded viral genome (4 8, 9, 95) Extensive complimentary base pairing allows each terminal repeat (TR) to fold back on itself forming a double-stranded hairpin structure (7 74) These hairpinned structures function as origins of AA V DNA replication as well as packaging and

PAGE 12

3 integration signals and all of these functions appear to require direct interaction between the AAV Rep proteins and the viral TRs (4, 36, 59 86). The Model of AA V DNA Replication The infectious AA V virion contains a single stranded DNA flanked by the hairpinnned TRs. This single-stranded AA V genome appears to be transcriptionally silent and a second complementary strand must be synthesized to create a duplex, transcriptionally active AA V genome (31). This second strand synthesis is init i ated from the hydro x yl primer formed by the hairpinned TR at the viral 3 end (31). Presumably host cell DNA polymerase(s) elongate this primer replicating internal AAV sequences and creating a so-called 'turnaround intermediate a duplex AA V molecule that is covalently closed at one end through the hairpinned TR (Fig. 2 mT) Since expression of the AAV Rep proteins enhances both lytic and latent viral infections (4, 36 59, 86) AA V second strand DNA synthesis appears common to both types of infection. Resolution of covalently closed AA V termini requires the endonuclease activity of viral proteins (86). The AA V Rep proteins introduce a single-stranded nic k into the TR phosphate backbone at the terminal resolution site (trs) (42 43) Subsequent unwinding of the cleaved TR creates a 3' hydroxyl primer that can be used for repair synthesis of the TR. This terminal resolution reaction results in a linear duplex intermediate composed of two full-length single-stranded AA V genomes (Fig. 2 mE). Reinitiation of AA V DNA replication on these linear intermediates requires that the newly synthesized TR separate from the template DNA strand and fold into the self-annealed, hairpinned

PAGE 13

configuration. This conformational change provides a 3' primer for the synthesis of internal AAV DNA sequences. 4 The AA V DNA replication scheme has been termed rolling hairpin replication (15 33). Like the rolling circle replication (RCR) scheme of covalently closed circular plasmids the rolling hairpin model postulates that only leading strand DNA synthes i s i s necessary fo r AA V DNA replication. Moreover in both schemes replication proteins ar e necessary to n i ck duple x or i gin sequences and c reate a 3 -hydroxyl primer that can be elongated by DNA polymerase. However during RCR a single initiation event would result in synthesis of the entire circular DNA genome. In contrast, replication of the linear AA V genome seems to be semi continuous requiring two initiation events one to synthesize a TR primer and a second to replicate internal AA V sequences Factors Involved in AA V DNA Replication AA V DNA replication is somewhat unique in that both cellular and helper virus encoded factors are required in addition to AAV peptides. In this context, genetic studies indicate that five Ad regions facilitate AAV DNA replication. These include the E1 A, E1 B E2A, E4 and VA regions (12 16 17 44 45, 78). Of these Ad genes only the E2A region, which encodes a single-stranded DNA binding protein (Ad-DBP), has been shown to part i cipate directly in AAV DNA synthesis (61 98 99). However it remains unclear if this protein is actually required for AAV DNA replication (61 62). The other Ad helper factors all appear to stimulate AAV protein expression (75). Accordingly Ad E1A is required for rep transcriptional activation and Ad E1 B E2A, E4, and VA reg i ons all appear to facilitate message accumulation and stability (12 16, 17 44, 45 78)

PAGE 14

Transcriptional control of Rep expression appears important to the lytic AA V infection because high levels of Rep expression do allow some AA V DNA replication in the absence of other helper factors (37, 38, 96) 5 In addition to other activities Ad infection creates a permissive cellular environment for AA V DNA synthes i s that can be mimicked by treatment with cytotoxic agents (76 111 112) Several Ad proteins may have roles in cellular manipulation (60), but the Ad E4 open reading frame 6 protein (E4orf6) stimulates AA V DNA replication in the absence of other helper factors (31 ) Recent experiments have identified a cellular protein that binds to the AA V TRs the single-stranded D stem binding protein (ssD-BP) (54, 70, 71). This protein binds the AAV 3 termini and apparently prevents elongation of TR primers by host cell DNA polymerase(s) Ad E4 orf 6 and other cytotoxic agents seem to indirectly cause the dephosphorylation of ssD-BP (71). This alteration seems to alter ssD-BP DNA binding activity and appears to release the AA V DNA replication block (54, 70, 71). Efforts to characterize other cellular factors have been facilitated by the development of an in vitro AAV DNA replication assay (39 62). Inhibitor and protein fractionation studies using this assay indicate that the DNA polymerase a.-primase is not required for AAV DNA replication (62, 86) Since the DNA polymerase a.-primase is necessary only for lagging strand synthesis this observation suggests that only leading strand synthesis is necessary during AA V DNA replication, consistent with the rolling hairpin model. These same studies suggest that either DNA polymerase 8 or polymerase e is used for AA V DNA synthesis (62, 86). Accordingly, protein fractionation studies indicate that the DNA polymerase accessory proteins replication factor C (RFC) and proliferating cell nuclear antigen (PCNA) are also required for AA V DNA replication

PAGE 15

6 (61) Although these accessory proteins are necessary for DNA polymerase 6 activity in the simian virus 40 (SV40) DNA replication system, recent studies suggest that these same factors may facilitate polymerase E activity (1, 115). Like other DNA viruses, AAV replication also requires a single-stranded DNA binding protein Both the cellular DNA binding protein RPA and Ad-DBP appear to stimulate AAV DNA replication and increase DNA polymerase processivity (61 100), and it is not clear which is actually used during an AA V infection Finally, Rep was recently shown to interact with PC4, another protein involved in SV40 DNA replication (102). The AA V Rep Proteins The AA V rep gene encodes a family of non-structural proteins involved in every aspect of the AA V life cycle including viral DNA replication, transcription, packaging, and proviral integration (4, 29, 38, 91, 102) This family of proteins can be divided into two classes based on the promoter used to initiate transcription, p5 or p19. Each promoter produces both a spliced and an unspliced message allowing translation of four distinct Rep proteins (Fig 3A). Genetic studies have identified the p5 Rep proteins as essential for viral DNA replication, and several groups have observed that high level expression of either Rep78 or Rep68 is sufficient for the accumulation of AAV DNA replication intermediates and infectious virion production in cells that are co-infected with Ad (37, 38, 96, 113). The biochemical characterization of the p5 Rep proteins has been facilitated by the purification of Rep68 to homogeneity and Rep78 to near homogeneity (18, 42, 43). Although the amino acid sequences of Rep78 and 68 differ at the carboxy termini, these

PAGE 16

7 peptides share a number of biochemical properties In vitro both Rep78 and 68 are able to bind to the AAVTR in a sequence-specific manner (19 57 77). This binding activity is med i ated through a double-stranded DNA element referred to as the Rep binding element (RBE) Additionally both Rep 78 and 68 are ATP dependent DNA helicases that are able to unwind duplex DNAs containing an RBE (42 117) Finally, both Rep78 and 68 are ATP dependent endonucleas e s that are able to catalyze site-specific nicking of the AAV TR at the trs (18 42) The p19 Rep proteins Rep52 and 40 have not been as well characterized as the larger p5 Rep proteins. Rep52 and 40 are involved in the regulation of viral transcription (49, 68) but they may have additional roles in the accumulation of single stranded AAV DNA and virus packaging (28, 73) Rep52 is an ATP dependent helicase and would presumably facilitate the unwinding of double stranded AA V replication intermediates into single-stranded progeny (81) Since neither Rep52 nor 40 bind the AA V TR, it appears that the p19 Rep proteins mediate their activities through interaction with other proteins (43 56, 67 104) Several groups have constructed rep mutants in an attempt to associate Rep biochemical activities with functional peptide domains. Characterization of these Rep mutants has identified several discrete peptide domains involved in TR binding ATPase, DNA helicase and trs nicking activities (Fig 38) As expected, Rep78 and 68 mutants that are unable to bind the AA V TRs are also unable to nick the trs and stimulate AA V replication (56 114). Furthermore, mutations that abolish Rep78 and 68 ATPase activity also prevent DNA helicase and trs cleavage activities, as well as viral transcriptional activation and DNA replication (50, 56 93 104) Thus both DNA binding and ATPase activities appear necessary for Rep trs nicking. Finally recent Rep mutational analysis

PAGE 17

has identified several domains involved in Rep oligomerization. These domains appear to be distributed throughout the peptide and overlap residues involved in both TR binding and DNA helicase activities (24). 8 The AA V Rep proteins share a number of functional and sequence homologies with other replication proteins Most notably the peptide sequence of AAV Rep is similar to the replication proteins of other parvoviruses. Additionally, AA V Rep appears to include several DNA helicase and endonuclease motifs conserved in the peptide sequences of RCA proteins (Fig. 28) (10, 41 ) Given the similar DNA replication functions of RCA proteins and AA V Rep, the conservation of these biochemical activities is not too surprising. However, these shared activities may also indicate that the mechanism of origin cleavage is similar in both RCA and AAV rolling hairpin replication. The AA V Terminal Repeat (TR) Functioning as viral origins of DNA replication, integration signals, and packaging signals, the AA V TRs are the only cis elements required for both lytic and latent AA V infections (59) All of the functions attributed to the TRs are thought to require specific interactions with the Rep proteins. Accordingly, the TRs contain specific sequences and secondary structures that allow interaction with the AAV Rep proteins (56 89, 117). During AA V DNA replication, Rep78 and 68 bind the AA V TR and induce a site-specific nick at the trs (42). This Rep-mediated cleavage event generates a 3'-hydroxyl primer for repair synthesis of the TR ( 42, 86). At least three separate elements within the AA V TR are required for site-specific trs endonuclease activity, the canonical ABE (located in the A-stem), the ABE' (located

PAGE 18

9 in the B / C-stem), and sequences near the trs (Fig. 4) Binding assays clearly demonstrate that specific sequences within the ABE are required for stable Rep binding to both linear and hairpinned TR substrates (18 57 58 77) Interference and protection assays detect a broad region of Rep c ontacts with the ABE and many of these occur along a core repetitive sequence, G(A/C)GC 4 (Fig. 4 ) (18 57 58 77). Rep contacts with the ABE appear critical to the AAV life cycle AAV substrates conta i ning multiple transversions in either of the middle two G(A/C)GC 4 repeats replicate at much reduced levels compared to wild-type AAV constructs (8). Furthermore, ABE homologues are found at the AA V promoters and the proviral integration site and these ABE homologues appear to facilitate Rep-mediated transcriptional regulation and proviral integration (57 105). Although the ABE appears to be the primary element through which Rep associates with the TR both Rep binding and nicking activities are enhanced by sequences within the terminal hairpin (18, 58 92, 109) Linear TR substrates, devoid of the terminal hairpin, are bound 125 to 170 fold less efficiently than complete, hairpinned TR substrates (57, 77). Moreover, chemical interference assays detect discrete Rep contacts within one of the small internal palindromes that form the tips of the terminal hairpin (see Fig 4) (77) This small internal palindrome has been termed the ABE' Despite flipping and "flopping of internal TR sequences during AA V DNA replication the ABE is maintained in a constant position relative to the ABE and trs. Since the ABE is contained within the AA V terminal hairpin, the structural context of this element is also presumed to be important Finally, it appears that Rep recognizes specific nucleotides at the trs during nicking. Although insertion of heterologous sequences between the ABE and the

PAGE 19

10 nicking site reduces Rep cleavage activity nicking still occurs at the correct site, between the two thymidines in the double stranded DNA sequence 3'-GGT lGA-5' (85). Furthermore deletion of sequences near the trs reduces both the specific activity of Rep nicking and the accumulation of AAV DNA replication intermediates (95 97) Curiously binding assays done in the absence of ATP do not detect Rep contacts at the trs (77). This observation implies that ATP is necessary to stimulate conformational changes that allow contact between the Rep catalytic site and the trs Indeed, Rep does not require ATP to cleave TR substrates containing large regions of single-stranded DNA flanking the nicking site (85) However Rep nicks these substrates at two sites the trs and a site 11 nt downstream (85) Thus the Rep transesterification reaction does not require ATP but the nicking intermediate does not appear to include large regions of single-stranded DNA flanking the trs The emerging picture of Rep interaction with the AA V TRs depicts a complex set of interactions that culminate in site specific nicking at the trs. Together, the ABE, ABE ', and trs appear to facil i tate Rep interaction with the TR during trs nicking, but the mechanism of this interaction is poorly understood Although the ABE and ABE' have been characterized in the context of Rep binding, the contribution of these elements to Rep cleavage has not been determined. In fact, the sequences at the trs recognized by Rep during nicking are not known Furthermore the role of ATP in the Rep endonuclease reaction is not clear. Thus little is known of Rep interaction with the AAV TR during trs cleavage. Understanding the mechanics of the Rep endonuclease reaction should provide a better appreciation of Rep function at the AA V TRs and the role of nicking during AA V infection. Perhaps, this will provide some general insights into the function of other replication proteins at their cognate origins

PAGE 20

Figure 1. AAV life cycle. During a latent infection of a permissive cell, the AA V genome migrates to the nucleus and preferentially integrates into human chromosome 19, where the AA V provirus is maintained through subsequent rounds of cellular DNA replication. Co infection of proviral cell lines with Ad stimulates a lytic AA V infection that includes high levels of AA V DNA replication and packaging of single-stranded progeny genomes into infectious virions. See text for details

PAGE 21

AAV ,. I I Adenovirus AAVDNA Replication I I I I I I I I Viral Attachment ' ' ' ' ' ' Proviral Integration ', Packaging of Progeny Virions I I I 12

PAGE 22

Figure 2. Model of AA V DNA Replication. The boxed region illustrates the steps involved in the terminal resolution of AA V viral ends In vitro Rep68 is necessary and sufficient for both the site-specific endonuclease and helicase activit i es requ i red for terminal resolution The viral 3 1 end is indicated with an arrow Circles depict Rep covalently attached to the viral 5 end at the terminal resolution site (trs)

PAGE 23

. l trs (mT) .. l trs .. (mE) l trs ,. i DNA P o l y m e r ase i Rep 6 8 o r 78 i DNA H e li case i DNA Pol y m e r a s e i Reini t ia t i o n I DNA Polymerase t Strand Displacemen t + 14

PAGE 24

Figure 3. AAV genetic map. (A) The AA V genetic map is shown with each rep and cap transcript depicted as a box The resultant protein is indicated next to each transcript (B) A functional map of Rep78 and 68 is given. The start positions of Rep 78 and 68 and Rep 52 and 40 are indicated with arrows Rep domains involved in single-stranded DNA cleavage are indicated with black boxes Those domains involved in Rep DNA helicase and ATPase activities are indicated with gray boxes Finally, domains involved in Rep homomeric interaction are indicated with an open box

PAGE 25

16 A. p5 p19 p40 TRa---cap t-----c if. R ~L________ __,fV P1 IL-_...L.l ______ _,tV P 2, V P 3 B. REP78and68 REP52and40 COOH . Rep / Rep Interaction Domains Conserved Hellcase Domains

PAGE 26

Figure 4. The AAV TR. The AA V TR is depicted in the hairpinned conformation. The RBE is indicated with a box, the RBE with a dashed oval, and the trs with an arrow The major Rep contacts with TR sequences as determined by Ryan et al. (78) are indicated in bold Various restriction endonuclease sites are also shown

PAGE 27

.... .. T .. i T Tt -... .... c G .... A T G C C G G C G C E G C Q) C GGC Cf) T 0 G CCG m C G G C G C Sm a l G _ c ___ ---Hp a II C G C G X m a I C G G C A A A RBE' Od e I BssH II Ea e I Ms c I B fa l AGTGAGCGAGCGA GCGCAGIA GAGGGAG GG~CA ACTCCATCAC AGGGGTT RBE A Stem ' C TC CC TCACC1GG Jr TGAGGTAGTGAT CC CCAAGATC trs D St e m (3 ) (5 ') ...... 0)

PAGE 28

MATERIALS AND METHODS Purification of Baculovirus-Expressed Rep68 Rep68 was purified to homogeneity from baculovirus-infected Sf9 cells as previously described ( 117) Rep68 was purified by sequential chromatography on phenyl-Sepharose ssDNA cellulose and DEAE-cellulose Preparations were more than 99 % pure as judged by use of sodium dodecyl sulfate (SDS ) -acrylamide gel electrophoresis followed by silver staining (117) Synthetic TR Substrates The TR substrates used in this study were constructed from gel pur i fied synthetic oligonucleotides (Genosys) as previously described (11). However construction methods were scaled up to increase yields Accordingly 500 pmol of two annealed oligos containing the ABE and the trs sequences were ligated to 1,000 pmol of a th i rd self-annealed oligo containing the terminal hairpin (see Fig 5) Oligos were ligated at 32 C for 2 hrs in 100-I reaction volume containing 50 mM Tris-HCI ( pH 7 5) 10 mM MgCl 2 10 mM dithiothreitol, 1 mM ATP 25 / ml bovine serum albumin (BSA ) and 1 600 units of T 4 DNA Ligase (New England Biolabs). Complete 163 nt TR constructs were purified from ethidium bromide stained 10% denaturing polyacrylam i de 19

PAGE 29

20 gels containing 50% urea Constructs were excised from gels and eluted in 50 mM Tris HCI (pH7.5) 10 mM EDTA, 0.1 % SOS 0 3M NaOAc at room temp for 12-24 hrs The elution reactions were phenol / chloroform extracted twice and eluted TR constructs were ethanol precipitated and 70 % ethanol washed DNA concentrations of these purified substrates were determined using the Pico Green fluorometric reagent (Mo l ecu l ar Probes ). Each panel of mutant and wt constructs was assayed together to insure ac c urate relative DNA concentrations. Typically, 5 to 30 pmol of purified TR was recovered from each ligation reaction These substrates were 5 labeled at 37 C in a 10 I reaction containing 200 fmol TR construct 70 mM Tris-HCI (pH 7.6) 1 O mM MgCl 2 5 mM dithiothreitol 20 Ci [ y32 P] ATP and 20 units of T4 Polynucleotide Kinase (New England Biolabs) Final concentrations of labeled substrates were determ i ned on the basis of specific activity and confirmed with the Pico Green fluorometric reagent (Molecular Probes ) Rep trs Endonuclease Assay The trs endonuclease reactions were performed as described previously (11 42 ). Rep68 nicking assays were done in 20-I reactions containing 25 mM HEPES-KOH (pH 7.5), 20 mM NaCl 5.5 mM MgCl 2 10 ng / ml BSA 0 2 % Tween 20 0.25 nM 5'-labeled TR substrate (1 x 10 4 cpm / fmol) and 0 5 mM ATP unless otherwise indicated. Nicking reactions were incubated with 0 25 to 50 nM Rep68 at 37 C for 1 hr Proteinase K d i gested reaction products were phenol / chloroform extracted ethanol precipitated 70 % ethanol washed and fractionated on 10 % denaturing polyacrylamide gels containing 50 % urea The amount of product formed was determined with a phosphorimager (Fu j i)

PAGE 30

To confirm that we were in the linear range of the phosphorimager, we experimentally compared radioactive standards by phosphorimager and scintillation counting. 21 Unless otherwise indicated each mutant was assayed at three or four Rep concentrations giv i ng several data points for each substrate. Since the kinetics of Rep nicking are sigmoidal with respect to enzyme concentration (117) this approach provided the opportunity to measure Rep activity within a linear range for nicking and to repeat the nicking assay multiple times for each substrate Only the correct sized product resulting from Rep cleavage at the trs was counted for analysis Minor cuts at less favored sites or nicks present in the starting substrate were not included in phosphorimager analysis. TR Binding Assay TR binding assays were done under the same reaction conditions as the nicking assays In general binding reactions contained 25 mM HEPES-KOH (pH 7.5), 20 mM NaCl, 5.5 mM MgCl 2 10 ng / ml BSA, 0.2 % Tween 20, 0.25 nM 5'-labeled TR substrate (1x10 4 cpm / fmol) and 0.5 mM ATP. However, ATP was excluded from binding reactions where indicated to prevent accumulation of covalent Rep complexes with the nicked TR. Binding reactions were incubated with 0.25 to 50 nM Rep68 at 37C for 1 hr. Reaction products were loaded directly on 0 5X TSE (pH7.5 8.0) 3.5% native polyacrylamide gels and resolved at 10 to 20 volts / cm for 3 to 6 hrs. In some cases the amount of nicked product associated with the Rep-bound TR complexes was determined by excising each of these complexes from the gel When this was done, the concentration of labeled TR substrate in the binding reaction was

PAGE 31

22 increased to 2.5 nM and Rep68 to 37.5 nM. Under these conditions, each of the six Rep-bound TR complexes could be seen as a discrete band after a 30-min exposure of the wet gel to autoradiograph film After exposure si x TR complexes and the substrate band were cut individually from the gel and eluted in 50 mM Tris-HCI (pH7.5), 10 mM EDTA 0 1 % SOS 0.3M NaOAc at room temp for 12-16 hrs The eluted complexes were then digested with proteinase K, phenol / chloroform extracted, ethanol precipitated and 70% ethanol washed. Recovered DNA was fractionated on 10% denaturing polyacrylamide gels containing 50% urea and the amount of substrate and product was determined by use of phosphorimager analysis as described previously. Construction of No-end AA V Substrates AA V no-end constructs (86) were made from the same oligos used to make the sythetic TRs The phosphorylated oligos were ligated to a duplex DNA containing the wt AAV coding sequences. Two annealed oligos, 50 pmol each, containing the ABE and the trs sequences were ligated to 250 pmol of a third self-annealed oligo containing the terminal hairpin as above (see Fig. 5) The resultant TR was then ligated to 5 pmol of the 4.5 kb Xbal fragment from plM45 Oligos were ligated at 32 C for 2 hrs in 100-I reaction volume containing 50 mM Tris HCI (pH 7.5), 1 O mM MgCl 2 1 O mM dithiothreitol 1 mM ATP, 25 / ml bovine serum albumin (BSA), and 1,600 units of T4 DNA Ligase (New England Biolabs). Incomplete reaction products were digested away using 3000 units Exo Ill (New England Biolabs), and resultant covalently closed no-end molecules were purified from 0.7% agarose gels run in TAE. DNAs were were excised from gels and eluted in 50 mM Tris-HCI (pH7.5) 10 mM EDTA 0.1% SOS, 0.3M NaOAc at room

PAGE 32

23 temp for 12 24 hrs The elution reactions were phenol / chloroform extracted twice, and eluted no-end constructs were ethanol precipitated and 70% ethanol washed. DNA concentrations of these purified substrates were determined by absorbance at 260 nm or using the Pico Green fluorometric reagent (Molecular Probes) In vitro AA V DNA Replication Assay In vitro AA V DNA replication assays were done essentially as described by Ni et al. (61 62) AAV DNA replication was assayed in 100 I reaction volume containing 250 ng of no-end substrate, 1 pmol of Rep68, 25 mM HEP ES-KOH (pH 7 5), 20 mM NaCl, 5.5 mM MgCl 2 10 ng / ml BSA 100 Meach dATP, dCTP, dTTP, dGTP, 80 Ci [a3 2 P] dATP 5 mM ATP, 40 mM creatine phosphate, 3.3 g creatine phospokinase and 1.5 mg of Ad-infected He La S100 extract described previously {61). Replication assays were incubated at 37 C and 20 I aliquots were removed from each reaction at the times indicated and stopped by the addition of 20 I of 20 mM Tris-HCI (pH 7.5), 20 mM EDTA 1 % SOS. Reactions were then digested with 1 O g proteinase K at 37 C for 1 hr, phenol / chloroform extracted, and ethanol precipitated. DNA pellets were resuspended in the appropriate buffer and digested with Dpnl at 37 C for 2 hr to remove methylated, starting substrates. AA V replication products were resolved on a 0. 7 % agarose gel by use of electrophoresis. The amount of AA V DNA replication was determined by phosphorimaging as described above. Only the monomer length, duplex replication products (mT and mE) were included in the phosphorimager analysis.

PAGE 33

Figure 5. Construction of synthetic AAV TR substrates. This diagram depicts the steps involved in the construction of synthetic TR substrates. See text for details.

PAGE 34

pG T G A GCG A GCG A GCGCGC A G A G A GGG A G T GGCC AA CTCC AT C A C TA GGGGTT { 3 ) 52-mer ( A+D) T C C A G C G G G C T T CTCGCGCG T C T CTCCCTC A CCGGTTG A GGT A G T G A TCCCC AA G A TC (5 ) 50-mer (A+D) T G G T C G C C C GGCCTC A Annealing p G T G A GCG A GCG A GCGCGC A G A G A GGG A G T GGCC AA C T CC AT C A C T AGGGGT T ( 3 ') G C G G G C C C G CCGG A G T C A CTCGCTCG p G CTCGCGCGTCTCTCCCTC A CCG G TTG A GGT A GTG A TCC C C AA G AT C {5 ) A C C C G 61-mer (S I C ) G G C A A T C C A G C G G G C T G C G G G C C C G T T G G T C G C C C T4 DNA Llgase GGCCT C AGTGAG C GAGCGAGCG C GCAGAGAGGGAGTG GC CAACT C CATCACTAGGGGTT C CGGAGT C ACTCGCTCGCTCGCGCGTCTCTCCCTCACCGGTTGAGGTAGTGATCCCCAAGATC G C C C G G G Denaturing PAGE C A A A ( 3 ) (5 ') 25

PAGE 35

Figure 6. Construction of AAV no-end substrates. This diagram depicts the steps involved in the construct i on of AA V no-end substrates. See text for details.

PAGE 36

27 p lM45 X bal X bal Xbal Digestion I rep I I cap I I rep I I cap I Ligation to Synthetic TRs .. reo ca o .. I

PAGE 37

REP-MEDIATED NICKING OF THE AAV ORIGIN REQUIRES TWO BIOCHEMICAL ACTIVITIES DNA HELICASE ACTIVITY AND TRANSESTERIFICATION Introduction The small single stranded DNA genome of the adeno-associated virus (AA V) is flanked by terminal repeats (TRs) each folding back on itself to form terminal hairpinned structures (Fig. 2). These structures are the only cis elements required for AAV DNA replication, packaging of replicated genomes into capsids and site-specific integration of provirus into the host genome (59) Each of these distinct activities requires interaction between the AA V non structural Rep proteins and the AA V TRs (56, 89, 117) The AA V non-structural proteins Rep78 and Rep68, contain both ATP dependent DNA helicase and site-specific endonuclease activities. In our current model of AA V DNA replication strand-specific nicking at the trs and subsequent Rep mediated unwinding within the TR generate a 3 primer for the initiation of subsequent DNA repair of the TR, a process referred to as terminal resolution (Fig 2) (86) During this process the TR is nicked between the two thymidines in the sequence 3' -GGT /TGA-5 resulting in a 5' phosphotyrosol linkage between Rep and the nicking site (42 84, 86) Efforts to characterize Rep trs nicking have been facilitated by the development of an in vitro trs endonuclease assay Site specific Rep nicking in this reaction is dependent on ATP hydrolysis and the presence of Mg 2 + (or Mn 2 + ) {42, 85, 117) The reason why the Rep transesterification reaction requires ATP hydrolysis has not been clarified. 28

PAGE 38

29 The ATP dependence of AA V Rep mediated nicking is a rather novel feature that is shared by the related parvovirus non structural protein NS1 from the mouse m i nute vi rus (MVM) (20) However many other rolling circle replication initiator proteins do not seem to require ATP for the origin nicking reaction. Notably the geminivirus Rep protein does not require ATP for in vitro nicking of singl estranded origin substrates However 1 th i s enzyme is unable to nick biologically relevant duple x substrates under these conditions (51) Interestingly geminivirus replication in vivo is dependent on the formation of a stem loop structure at the nicking site (66 87), but the relationship between geminivirus Rep ATPase activity and the formation of this origin steml oop remains unclear The staphylococcus aurens plasmid pT181 also contains an origin stem-loop structure Extrusion of this stem-loop on supercoiled substrates appears to be dependent on upstream binding of the plasmid-encoded endonuclease RepC which ni c ks the origin within the loop region of this structure, but this reaction does not require ATP (46 63). Efficient AA V Rep nicking of the hairpinned TR appears to require three sequence recognition elements within the terminal repeat Mutational analysis of the AAV TR has identified a core 22 bp sequence required for stable binding of Rep 78 and Rep68 (77). This Rep binding element (ABE) is believed to be the primary recognition element that promotes Rep binding Interestingly, homologues of this Rep binding element are present at the AAV p5 promoter the preferential proviral integration site on human chromosome 19 and within several viral and cellular promoters Rep78 and 68 bind many of these sequences in vitro and appear to regulate AA V transcription through direct interaction with promoter and TR RBEs in vivo (34, 48 57, 68, 103, 105).

PAGE 39

30 Efficient binding and nicking of hairpinned substrates also requires contact between Rep and the small internal palindromes that comprise the tips of the hairpinned TR. The presence of these internal palindromes in hairpinned TRs increases nicking 5 50 fold (18, 42, 58, 85) Because the internal palindromes exist in two alternate configurations (flip and flop) it had previously been thought that no specific sequence within this region was recognized. However, Ryan et al. have identified sequence specific contacts between Rep and a C f f I G motif within the small internal palindromes of the TR (77) This internal palindrome has a constant position with respect to the trs regardless of the orientation of the terminal repeat (flip or flop) Finally, a specific sequence at the trs itself also appears to be required for nicking Insertion of a heterologous sequence between the nicking site and the RBE significantly reduces nicking, but nicking occurs at the correct site (85). As yet, however the specific sequences that comprise the terminal resolution site have not been identified. Curiously, high-resolution in vitro binding studies do not detect Rep contacts at the trs in the absence of ATP (77). Furthermore, ATP is not an essential cofactor for trs nicking if the trs region is present in a hairpinned TR substrate as single stranded DNA (85). This observation led us to suggest that ATP-dependent Rep DNA helicase activity is needed to melt the duplex trs to create a single stranded nicking intermediate. Rep DNA helicase mutants are deficient in trs nicking, supporting this conclusion (93). Additionally, studies of Rep helicase activity have shown that Rep can unwind a duplex DNA substrate provided that it contains a RBE (117) In our previous work, we identified the sequences within the RBE and the internal palindromes that affect Rep nicking and sequence specific DNA binding (77) Here we focus on the trs region of the terminal repeat. We identify a strand specific trs core

PAGE 40

31 sequence required for Rep catalyzed nicking through systematic mutation of sequences near the trs. Furthermore we identify a potential stem-loop structure at the trs. Surprisingly preferential extrusion of the nicking site stem-loop entirely removes the ATP requirement f o r Rep nicking This clearly dem o nstrates that the AAV Rep prote i n requires the ext rusion of a stem-loop stru c tur e containing the nicking site prior t o trs cleavage. Furthermore we conclude that the ATP dependent Rep DNA helicase activity is necessary to unwind the duple x trs and allow formation of the stem loop structure prior to nicking Results Determination of the Minimal trs To determine the minimal trs sequences required for Rep68 nicking a panel of mutant TR substrates was constructed. These substrates consisted of sequential single base pair transversions beginning 8 base pairs upstream of the nicking site and extending 7 base pairs downstream. Mutation of these sequences was facilitated by the use of synthetic oligonucleotides To construct TR substrates two annealed oligos containing the ABE and the trs sequences were ligated to a third oligo containing the terminal palindromes (see Fig 5) Complete TR constructs were purified from ethidium bromide stained denaturing polyacrylamide gels and DNA concentrations of the purified substrates were determined as described in Materials and Methods The mutants were then 5 end-labeled using [ y 32 P] ATP and T4 polynucleotide kinase and the final concentrations of labeled substrates were determined on the basis of specific activity

PAGE 41

32 and confirmed with fluorometry Rep trs endonuclease activ i ty on these substrates was assayed in vitro using homogeneously pure Rep68 All substrates were assayed together and ea c h substrate was assayed at several Rep concentrations Typically ( see Fig 7C) Rep titrations contained 0.05 to 1 pmol of enzyme in reactions containing 5 fmol of a given substrat e. Th e result s of the nicking reactions with each mutant are shown in F i gure 8 Analysis of the mutants revealed a 7 bp sequence that appeared to be the core recognit i on element required for trs activity Mutations in this sequence 3 -CCGGT/fG5', reduced Rep68 nicking 3 to 1 O fold compared to the wild type substrate Since this core sequence included the actual nicking site we assumed that this large inhibition reflected direct Rep68 interaction with these nucleotides during trs nicking One of the mutated bases in this sequence the first G was not as deleterious as other core mutations, implying that the Rep68 sequence requirements at this position were less stringent Most of the substrates with mutations flanking this 7 bp core sequence were also slightly defective for nicking, 20-50 % lower than wild type, and the results from these 1 bp transversions were consistent with data obtained from overlapping 2 bp transversions (Fig 9). This was surprising because we assumed that the inclusion of numerous flanking mutations would define a region of the trs where transversions would not affect Rep68 nicking activity However, we were unable to define such a region suggesting that the entirety of the mutated sequences somehow contributed to Rep68 trs nicking Additionally the panel of 1 bp transversions included a mutant that was nicked an average of 1 7 fold more efficiently than wt. Rep68 nicking assays were performed on

PAGE 42

33 this mutant several times and this substrate was consistently nicked at elevated levels compared to wild type. Although we felt that our mutation analysis had defined the core trs sequence 5 CCGGT/TG-3 the significance of mutations outside this core remained unclear There seemed to be at least two classes of mutations Those within the core trs sequence that greatly reduced Rep68 nicking and a second set of mutations that had a more modest effect Strand Specificity of Rep68 trs Nicking Though we had identified a core duplex sequence required for Rep68 nicking we had not determined the strand specificity of Rep contacts within this sequence. Previous work indicated that insertion of heterologous sequences directly opposite the nick site reduced Rep68 cleavage, yet deletion of these same sequences, resulting in a single stranded trs, did not reduce nicking. However, the single-stranded trs substrates were nicked at two sites with approximately the same efficiency the trs and a site 11 nucleotides downstream, indicating a possible role for the opposite strand in Rep68 nicking specificity (85). Hence the contribution of the strand opposite the trs during Rep68 nicking remained unclear To clarify these inconsistencies and to determine the strand specificity of Rep68 contacts during nicking a new panel of trs mutants was constructed. These substrates contained a single nucleotide transversion either on the trs containing strand or on the opposite strand (Fig 10) In this way each nucleotide of a given base pair was independently mutated within the core trs sequence. As expected, mutations on the trs containing strand reduced Rep68 cleavage by 3 to 1 O fold These data were consistent with the results from the single bp

PAGE 43

34 transversions and confirmed the importance of the 7 base core sequence 3' CCGGT/TG 5 in Rep nicking. Surprisingly, transversions on the strand oppos i te the nicking site did not inhibit nicking Indeed, Rep68 cleaved the mutants on the uncut strand at elevated levels compared to wild type Because the standard dev i ations were c omparable to the increases in nicking the significance of the improved nicking was not clear. Nevertheless, the elevated Rep68 nicking activity observed on virtually all of mutations on the strand opposite the trs suggested a general phenomenon One possible explanation was that these mutations slightly disrupted the duplex trs allowing enhanced Rep68 accessibility to the nicking site. The nicking data for these single nucleotide transversion mutants indicated that Rep was making strand specific contacts during nicking. Though inconsistent with the insertion mutants mentioned above this finding was consistent with Rep68 nicking on substrates containing an extensively single-stranded region extending through the trs (85). This substrate was nicked by Rep68 at wt levels despite the absence of sequences opposite the nicking site Our data (Fig. 11) were also consistent with results obtained from another partially single-stranded mutant we constructed. Unlike the extensively single-stranded mutant used in previous studies, our substrate was designed to mimic the 3' viral terminus (see Fig 11 ) As such, this substrate was double-stranded through the ABE to the trs, but the nicked strand was single-stranded directly downstream of the nicking site Rep68 nicked this mutant an average of 1.6 fold more efficiently than wt (S.D = 0.45 fold Fig 10). Yet, unlike the extensively single-stranded substrates, nicking on our substrate mostly occurred at the trs Hence it appeared that the strand opposite the nicking site somehow contributed to the specificity of Rep68 nicking but no particular base within this strand was essential.

PAGE 44

35 Secondary Structure at the trs In an attempt to better understand our data we aligned TR sequences from the seven AAV serotypes With the e x cepti o n of AAV5 the region near the trs showed stark conservation among all serotypes Curiou s ly, this conservation included an inverted repeat flanking the first fi v e nucleot i d es of th e trs core sequence (see Fig. 12 ) Additionally although AA V5 trs sequen c es were qu i te disparate with respect to the other serotypes these sequences also contained an inverted repeat flanking the nick site. We therefore, wondered if these inverted repeats were involved in Rep trs nicking. We predicted that these inverted repeats would form an 8 bp stem structure flanking a 5 nucleotide loop (Fig 12 ) This structure seemed energetically improbable but other origins of DNA replication also contained such improbable structures that appear necessary for in vivo or i gin function. The geminivirus or i gin of replication is an 11 bp stem structure flanking an 11 nucleotide loop {66 87) and the plasmid pT181 origin is a 9 bp stem flanking a 6 nucleotide loop {63 ) In both examples the origin nicking site is within the single-stranded loop regions Extrusion of these structures seems to be dependent on other factors In the case of pT181 origin stem-loop formation appears to require bind i ng of the RepC endonuclease which uses the free energy of the circular DNA superhelix to melt the loop region and promote cruciform extrusion {63) By analogy we hypothesized that the Rep DNA helicase activity might facilitate the extrusion of this energetically unfavorable structure at the trs and that such unwinding on a linear DNA molecule would require ATP To determine the role of this predicted stem-loop in Rep68 trs nicking a new mutant was constructed wherein the predicted hairpin on the strand opposite the nick site was deleted (Fig 13). We reasoned that this mutant would force the sequences on

PAGE 45

36 the trs-containing strand to adopt the predicted stem-loop structure (see Fig 13). Surprisingly, Rep not only nicked this mutant but it nicked this mutant an average of 2.8 fold more efficiently than wild type (S.D. = 0 92 fold) This result confirmed our previous conclusion (see Fig 10) that Rep only made contacts with the trs strand (the strand that is cut ) during nicking Furthermore the enhanced Rep nicking activity on this mutant compared to wild type also indicated that the extruded stem-loop was a reaction intermediate In fa c t, the large difference in Rep68 nicking activity between the two substrates implied that the extrusion of the trs stem-loop was probably a rate-limit i ng step in the trs endonuclease reaction. Elimination of the ATP Requirement for Rep Nicking If extrusion of the trs stem-loop is a necessary step prior to nicking, and if the Rep associated DNA helicase is necessary for extrusion to occur, then we would expect that the trs NOSTEM substrate (Fig 13) would be ATP independent for nicking. Indeed trs endonuclease reactions with the stem-loop mutant were no longer dependent on ATP Rep cleavage of the mutant was essentially the same in both the presence and absence of ATP indicating that ATP was not required for the Rep68 transesterification reaction at the trs (Fig. 13) These data were consistent with Rep68 trs assays using the extensively single-stranded substrate that was nicked in the absence of ATP (85). The single stranded region of this mutant included the inverted repeat necessary for the predicted trs stem-loop formation (see Fig. 11). Hence it is probable that this partially single-stranded substrate could form the trs stem-loop in solution. However unlike this single-stranded substrate, the NOSTEM mutant used here was only nicked at the correct site.

PAGE 46

37 Since Rep68 did not nick wild type substrates in the absence of ATP (Fig. 13), the predicted trs stem-loop did not seem to be energetically favorable. Rather our data suggested that this structure must be formed and stabilized prior to Rep68 mediated trs cleavage through an active mechanism The unwinding of the duplex trs and formation of the stem-loop would be facilitated by Rep DNA helicase activity We have shown previously that Rep can unwind a duplex DNA molecule with no single stranded regions provided that the duplex contains an internal ABE (117) Thus, Rep unwinding of the upstream ABE present in our wt substrates would melt the adjacent trs region and extrude the trs stem loop The requirement for ABE dependent DNA helicase activity would then account for the ATP requirement during trs nicking. Interestingly, addition of adenosine 5'-0-(3-thiotriphospate) (ATPyS) to in vitro trs assays inhibited Rep68 nicking of the NOSTEM mutant compared to addition of ATP or no cofactor (Fig. 13) The level of nicking activity in the presence of ATPyS was comparable to what was seen with the wild type substrate in the presence of ATP. Since ATPyS is a non-hydrolyzable analogue, it is possible that it binds to Rep and remains associated with the enzyme for extended periods of time, in contrast to ATP. This would suggest that the Rep complex involved in the actual transesterification reaction at the trs may be inhibited by the presence of ATP bound to the enzyme. Thus, this result suggested the existence of at least two functional Rep68 conformations, the native enzyme conformation and one resulting from ATP binding. Of these, the native form appeared to be the more efficient for nicking, supporting the conclusion that the Rep68 endonuclease activity is ATP-independent.

PAGE 47

38 Discussion Mapping the Minimal trs During the course of this study we have analyzed the effect of mutations near the AA V trs on Rep68 catalyzed origin nicking Our results ind i cate that a 7 base core nucleotide sequence 3 -CCGGT/TG 5' is required for Rep n ic king at the trs. This core sequence is strand-specific It is required only on the nicked strand and it does not matter if the complementary sequence on the opposite strand is intact Interestingly the first five nucleotides of this core trs sequence are flanked by an 8 bp inverted repeat that appears to form a stem-loop intermed i ate prior to nicking. Formation of this stem-loop seems to be ATP-dependent and is presumably facilitated by Rep DNA helicase activ i ty acting on the nearby ABE Conversely Rep does not require ATP to nick the trs once this stem-loop structure is formed indicating that the actual endonuclease reaction is ATP-independent. Thus, our results suggest that Rep trs nicking is a two step reaction requiring both a specific sequence and a structure at the trs Though we believe we have identified the minimal trs sequence required for Rep68 nicking the nature of the Rep68 interaction with this core sequence still remains unclear We expect some of these core nucleotides to directly interact with the Rep68 active site while others may only be involved in the extrusion and stabilization of the trs stem-loop. Although Rep68 cleavage was significantly reduced on all single-nucleotide transversions in the nicked strand endonuclease activity with these mutants was variable Individual mutation of nucleotides within the nicked strand sequence 3 -GT/TG5 resulted in an average 2 to 5 fold reduction in Rep68 cleavage activity compared to

PAGE 48

the other single nucleotide mutations in the core trs sequence Perhaps this indicates that these four nu c leotides interact with the Rep68 active site during nicking and the other nucleotides within the core sequence are involved in stem loop formation. 39 Initially the data obtained from single-base pair mutants with tranversions flanking the core trs sequence were difficult to interpret We did not understand why most of the flanking mutataions reduced Rep68 trs nicking However, it now seems likely that these flanking mutations interfered with trs stem-loop formation. Such interference would arise from at least two possible mechanisms: First mutations within the stem sequence would reduce the number of base pairs within this stem-loop structure and effectively reduce its thermodynamic stability Second mutations may also affect Rep helicase interactions with these sequences preventing the extrusion of the stem loop Most of our mutations flanking the core trs sequence would reduce the number of base pairs within the predicted stem region. However, the underlined thymidine in the sequence 3 -GT{fGAGGI-5 would not form a Watson-Crick base pair after stem-loop extrusion (see Fig. 12) yet Rep68 nicked the 1 bp transversion of this position less than half as efficiently as wt. Perhaps this indicates direct Rep interaction with this nucleotide during formation of the nicking intermediate. In general, our conclusions are consistent with results from other studies. Wang et al. (95) concluded that the two thymidines flanking the nicking site in the context of uncharacterized upstream sequences were not sufficient for wt Rep68 trs endonuclease activity Additionally, Snyder et al. (85) concluded that sequences directly across from the nicking site contributed to Rep68 trs endonuclease activity. Yet the 7 nucleotide insertion mutant used in the Snyder study would have disrupted stem-loop formation opposite the nicking site, reducing the probability of trs stem-loop formation. However

PAGE 49

40 our data do not explain results obtained from another mutant used in this same study Rep68 nicking activity was reduced when a 2-nucleotide transversion was made directly across from the two thymidines at the ni c king site (85) Neither of our single nucleotide transversions at these two positions had a deleterious affect on Rep68 nicking suggesting a cumulative phenomena or e x perimental error Architecture of the AAV TR The finding that specific sequences at the trs are involved in Rep catalyzed nicking is consistent with our working model of Rep interactions with the AAV TR. In this model, site-specific Rep cleavage at the trs requires sequence specific interactions with the ABE the trs and the small internal palindromes that comprise the tips of the hairpinned TR In addition to these elements our data indicate that a stem-loop structure near the trs is also required for nicking. The formation of the nicking site stem-loop structure may facilitate several requirements for Rep trs nicking. First, formation of the stem-loop would present the Rep active site with a single-stranded trs This single-stranded trs appears to be the relevant nicking substrate since Rep nicks extensively single-stranded TRs and our stem-loop mutant in the absence of ATP Second the stem loop structure would effectively reposition the trs closer to the ABE. This seems important since binding studies do not detect Rep contacts near the trs It appears that the trs must be brought inward towards the ABE for the Rep active site to associate with the nicking site. Third the stem loop itself would help to stabilize trs sequences in the proper conformation and position for nicking

PAGE 50

41 It appears that two stem-loop structures are present within the TR during Rep nicking, the thermodynamically favorable terminal hairpin and the trs hairpin, resulting in a saddle structure (see Fig. 13A). We assume that Rep is making contacts with loop regions in both of these hairpins during nicking since binding assays detect terminal hairpin contacts (77) and our nicking assays detect trs contacts The involvement of AA V terminal hairp i n and trs stem-loop structures in Rep catalyzed nicking may have ramifications for Rep activity on other substrates Most notably Rep78 cleaves human chromosome 19 substrates that include the region of site-specific, AA V proviral integration (91, 92). This site is referred to as AAVS1 and includes a RBE homologue and the trs homologue 3 'GTTG-5 '. Urcelay et al. (92) have demonstrated Rep dependent nicking at AAVS1 trs homologue and have proposed that the initiation of DNA replication from this site is involved in AA V proviral integration. Interestingly, AAVS1 does not contain sequences near the RBE and trs homologues capable of forming secondary structures. However, the spacing between the RBE and trs homologues is decreased in AAVS1 compared to the AAV TR This decreased spacing between the AA VS 1 RBE and trs may allow RBE bound Rep to interact with the trs on this substrate in the absence of other structural features. Yet we assume that the formation of a single-stranded nicking site is required prior to nicking, so the mechanism of Rep AAVS1 nicking remains unclear. Perhaps this site contains other long-range sequence elements that contribute to Rep nicking by stabilizing the nicking complex or by facilitating a single-stranded nicking site through heterologous protein interaction

PAGE 51

42 ATP Requirement for Rep68 trs Nicking? Our data indicate that ATP is required during Rep trs nicking for the extrusion of a stem-loop structure at the nicking site. Once the trs stem-loop has been formed, the actual Rep nicking reaction does not require ATP In fact, the Rep68 transesterification reaction appears to be inhibited by bound ATP. Although Rep68 nicking activity on the stem-loop mutant is the same in the absence or presence of ATP the addition of ATP y S to the reaction reduced nicking activity to the level observed on wt substrates Since ATPyS is a nonhydrolyzable analogue it would presumably remain bound to Rep unlike ATP, which would be hydrolyzed. Thus it appears that Rep adopts at least two functional conformations during trs nicking, ATP-bound and native. The ATP-bound form appears to facilitate Rep helicase activity and the native form is the active endonuclease. The modulation of these two Rep conformations through ATP binding suggests a model for Rep interaction with the AA V TR. During nicking Rep first binds the TR through the ABE. Subsequent ATP binding results in a conformation that allows Rep to reach out from the ABE and make downstream sequence contacts necessary for trs unwinding. After hydrolysis of ATP Rep would relax into the native conformation. It is unclear if Rep maintains its original contacts and pulls unwound downstream sequences towards the ABE allowing them to self-anneal into the trs stem-loop or if stem-loop formation is more passive in nature In either case the net result of Rep helicase activity would be the formation of the trs stem-loop. Once formed this structure presents the single-stranded trs to the native Rep active site The Rep proteins of the autonomously replicating parvoviruses also require ATP hydrolysis for in vitro origin nicking (20). The MVM NS-1 replication protein appears to

PAGE 52

43 be functionally homologous to AA V Rep (20-22) suggesting that the mechanism of origin nicking is similar in the two systems. Thus, we assume that NS 1 also requires a single-stranded nicking site for cleavage. Yet the MVM origin sequences do not appe ar to include secondary structures at the nicking site Although NS-1 is a helicase (106) and could presumably unwind the duplex MVM origin the lack of secondary structure at the nicking site implies that MVM origin nicking is distinct from AA V. Unlike AA V, MVM origin nicking requires the accessory DNA binding proteins HMG (at the right origin) and parvoviral intiation factor (at the left origin) (20, 22). Although the exact nature of the interaction between these accessory proteins and the MVM origins is unknown, Cotmore and Tattersall {22) have suggested that these accessory proteins facilitate nicking through origin binding and direct interaction with NS1 Considering our results, the role of these accessory proteins may be similar to that of the AAV trs stem-loop, i.e ., stabilizing a single-stranded nicking intermediate General Mechanisms of Origin Nicking The similarity between AA V Rep and other viral replication proteins is not limited to the parvoviruses. Geminivirus origin sequences include a predicted stem-loop structure at the nicking site similar to AA V. This structure is required for in vivo replication (66, 87) but the mechanism of stem-loop extrusion is unknown. Although it is tempting to draw mechanistic homologies between AA V Rep and geminivirus Rep it is worth noting that the geminivirus Rep does not exhibit helicase activity {26) This observation raises questions about the functional significance of the geminivirus Rep ATPase activity This activity is required for viral DNA replication, but the basis of this requirement is unclear (26). Interestingly the ATPase activities of both AAV and

PAGE 53

geminivirus Rep proteins are not DNA dependent (26, 117) This rather novel shared characteristic suggests a functional role for ATP-dependent conformational changes outside the context of DNA unwinding In the geminivirus system this conformational switching may be required for interactions between Rep and other proteins. Similar to AA V Rep geminivirus Rep protein nicks single-stranded origin substrates in vitro However, geminivirus Rep is unable to nick biologically relevant double-stranded origin substrates (51). Without evidence of geminivirus Rep helicase activity others have suggested that unidentified accessory proteins are necessary for origin nicking in vivo (26). Such hypothetical proteins would provide the helicase activity for origin unwinding and nicking site stem loop formation. The geminivirus Rep ATPase activity may facilitate conformation dependent interactions with these hypothetical proteins 44 In contrast to geminivirus the extrusion of stem loop structures at other origins of DNA replication appears to require only direct interaction with initiator proteins. The S. aurens plasmid pT181 contains an energetically improbable stem-loop structure required for plasmid DNA replication (94). Like AAV and geminivirus this stem-loop contains the origin nicking site However, pT181 origin stem-loop extrusion seems to involve both the plasmid-encoded endonuclease RepC and plasmid DNA topology. Upstream binding of RepC increases S1 nuclease sensitivity of origin stem-loop sequences on super coiled substrates indicating conversion of these duplex sequences to the stem-loop structure. This S 1 nuclease sensitivity is not observed on Rep C bound linear substrates suggesting that superhelical twisting is necessary to drive the formation of the origin stem-loop (63).

PAGE 54

45 Thus it appears that AAV geminivirus and pT181 share a general mechanism of or i gin nicking. The sequences of each origin are capable of form i ng a stem-loop with the actual nicking site located within the single-stranded loop of this structure Formation of this stem loop appears necessary for origin nicking in all three systems indicating that the preferred nicking substrate is single stranded DNA In the case o f AA V and p T181 origin stem-loop extrusion clearly involves interact i on with cognat e origin recognition proteins However the mechanism of extrusion differs between the two systems. pT181 appears to use the energy associated with superhelical coiling to drive formation of the stem-loop (63) In contrast the linear AAV genome would require an active mechanism of origin stem-loop extrusion Our data indicate that this mechanism involves endogenous Rep helicase activity. Regulation of AA V DNA Replication The extrus i on of the AA V trs stem loop structure appears to be rate limiting in Rep68 trs nicking Zhou et al. (61) recently described the reaction kinetics of Rep68 nicking on wt TR substrates as sigmoidal with respect to enzyme concentration They concluded that at least a dimer was required for Rep68 endonuclease activity on these substrates However these studies would not have measured the reaction kinetics of the endonuclease reaction per se but would have measured the kinetics of the rate limiting step of the reaction. Thus we conclude that the extrusion and stabilization of the stem-loop structure requires at least a dimer of Rep68. During viral DNA replication, AA V Rep must discriminate between 3' viral termini and internally replicated TRs (see Fig. 2) Nicking of 3 viral termini would result in dead end replication products where as nicking of internal TRs would create a 3 hydroxyl

PAGE 55

46 primer for continued DNA synthesis. Our nicking results from a partially single-stranded TR substrate designed to mimic these viral termini (see Fig. 10) indicate that Rep endonuclease is active on 3 viral termini i n vitro However analysis of AAV DNA replication by 2-dimensional gel electrophoresis indicates that very little nicking of 3 viral termini occurs in vivo (61 ) Thus Rep trs nicking appears to be regulated in vivo ensuring efficient viral replication The multi-step Rep trs nicking reaction would allow regulation of trs nicking through modulation of origin stem loop formation. Since Rep helicase activity appears to facilitate extrusion of this structure one possible model of trs nicking regulation would involve modulation of Rep helicase activity by phosphorylation. This type of regulation has been observed with the MVM NS1 protein. Phosphorylation seems to stimulate NS1 DNA helicase ATPase and nicking activities in vitro and increase viral replication in vivo (64, 65) Rep trs nicking could also be regulated through direct inhibition of origin stem loop extrusion. Cellular factors may regulate Rep68 nicking through such a mechanism Another group has recently identified a cellular protein that binds sequences within the AAV trs stem-loop This D-stem binding protein (ssD-BP) shows strand specific binding activity (71 ) The core binding sequence appears to be 3 -AGTGA-5 and this sequence appears to be preferentially bound as single stranded DNA (95). Thus the binding site of this cellular factor overlaps several nucleotides of the predicted trs stem-loop at the 3 viral termini. ssD-BP appears to regulate AA V DNA replication by preventing initiation through interaction with its cognate binding site (54 71 ). Perhaps binding of ssD-BP also prevents Rep trs nicking of 3 viral termini by preventing extrusion of the trs stem loop structure Such a regulatory mechanism would not prevent Rep nicking of

PAGE 56

replicated, duplex trs sites since ssD BP binding shows a preference for a single stranded binding site. 47

PAGE 57

Figure 7. Endonuclease analysis of synthetic AAV TR substrates. (A) The sequence of WT AAV TR substrates used in this study is shown. The boxed region denotes the canonical Rep binding element (RBE). The position of the terminal resolution site (trs) and relevant restriction enzyme sites are also indicated. (B) Restriction enzyme analysis was performed on 5' labeled WT TR substrate. The products were fractionated on a 10% denaturing polyacrylamide gel. TR indicates undigested substrate (C) Rep68 endonuclease assays were performed on 5' labeled WT TR substrate (see Materials and Methods for details). Products were resolved on a 10% denaturing polyacrylamide gel. The position of the 163 nt substrate and 22 nt product are indicated. The total amount of Rep68 used in reaction is indicated above each lane.

PAGE 58

A. B. ~ ...... .. T .... :T T': ABE' .. C G : t .. A T G C C G g Ddel BssHII G C C GGC: TCAGTG A GCGAGCG A G CGCGCAG 11.GAGGGAGTGG CC A A CTCCATC A CT AGGGGTT T G CCG [;AG~ "ACTCGCTCGCTCGCGC ~TC rcTCCCTCACCGGT .t,TGAGGTAGTG A TCCCCAAGATC C G T G C I g Hpall ABE trs "O (tS "O C C G C G G C A A A I (tS Q) a: (J) (J) a. "O Cl)._COIQ ., .... .. ., +66 nt +56 nt +39 nt C. Aep68 (fmol) 0 0 0 0 0 0 0 0 LO ,-N "q" ..... ' ~ ' + 163 nt
PAGE 59

Figure 8. Rep68 endonuclease assays on 1 bp transversion mutants. Individual bps were mutated to transversions and assayed for Rep68 endonuclease activity Boxed regions denote WT AAV sequence. Arrows point to mutated sequence Mutants were assayed together as a panel that included WT substrate (see Materials and Methods for details ). The relative Rep specific activity for each mutant was expressed as the fraction of mutant substrate nicked divided by the fraction of wt substrate n icke d at the same Rep concentration Ratios obtained at different Rep concentrations in the two trials were then averaged and graphed for each mutant (n=11 for mutations within the sequence 3' CCGGTTGAGG 5 1 and n=6 for mutants flanking this sequence Error bars indicate standard deviation of mean .). Rep68 nicking activity on WT substrate is indicated with horizontal line across the graph.

PAGE 60

51 2.5 --------------------------, Q) 2 .0 a. "O 1 5 :.::r C cu ::, 1 0 .. ----------------------------------------------------------WT O> C 0 0 5 z 0 0 C T G T T A A C C A G A A C G G A C A A T T G G A C T T G C t t t t t t t t t t t t t t t I I I A G 'T G G C C A A C T C C A T I I I T C A C C G G T T G A G G T A I I I t t t t ' , trs , ; ... T ; ... ; T T , C G ... , C G , A T ... , G C ... ... ... C G , ... G C ... , G C ... ... G C C GGC C A GTG A GCG A GCG A GCGCGC A G A G GG GT GGCCA A CTCC A A CT A GGGGTT (3 ') T G CCG GTCACTCGCTCGCTCGCGCGTCTC cc CACCGGT TGAGGT TGATCCCCAAGATC (5 ) C G f G C G C RBE trs G C C G C G C G G C A A A

PAGE 61

Figure 9. Rep68 endonuclease assays on 2 bp transversion mutants. 2 bp transversions were introduced near the trs Shaded boxes denote mutated sequences. Rep68 endonuclease activity was assayed on these mutants and wt TR substrates (see Materials and Methods ) The relative Rep specific activity for each mutant was expressed as the fraction of mutant substrate nicked divided by the fraction of wt substrate nicked at the same Rep conce ntration and graphed

PAGE 62

WT MO Mt M2 M3 M4 M5 M6 Ml MB M9 M10 Substrate TGGCCAACTCCA AC C GGTfT GAGG T trs GTGCCAACTCCA CA CGGTTGAGGT TTTCCAACTCCA A~A GGTTGAGGT TGTA AACTCCA ACT TT GAGGT TGG AAAA CTCCA ACC'l'TTTGAGGT TGGC.ACACTCCA ACC TGT GAGGT TGGC CCC TCCA ACCGGGG AGGT TGGCCA AT CCA ACCGGTGT GGT TGGCCAA G CA ACCGGTTTC GT TGGC CAAC TACA ACCGGTTGATGT TGGC CA ACTAhA A C C G G T T G A T :, T T T GGCCAAC TCAC A C C G G T T GA G 1 T G ' 53 Nicking (Mutant/WT) N.D. 0.0 0.2 0 4 0.6 0.8 1.0

PAGE 63

Figure 10. Rep68 endonuclease assays on 1 nt transverslon mutants. Individual nts within the 7 bp core sequence were mutated to transversions and assayed for Rep68 endonuclease activity Shaded boxes denote mutated sequence. Mutants were assayed together as a panel that included WT substrate (see Materials and Methods for details) The relative Rep specific activity for each mutant was expressed as the fraction of mutant substrate nicked divided by the fraction of wt substrate nicked at the same Rep concentration. Ratios obtained at different Rep concentrations in the two trials were then averaged and graphed for each mutant (n=4 for all mutants. Error bars indicate standard deviation of mean. Relative Rep68 nicking activity on wr substrate is indicated with horizontal line across the graph

PAGE 64

WT A1 B1 C1 D1 E1 F1 Gt A2 B2 C2 D2 E2 F2 G2 Substrate GGCCAAC CCGGTf G trs [!jGCCAAC CCGGTTG G(!jCCAAC CCGG TT G GG~CA A C CCGGTTG GGC~AAC CCGGTTG GGCC @JA C CCGGTTG GGCCAjgC CCGGTTG GGCCAA ~ CCGGTTG GGCCAAC ~ CGGTTG GGCCAAC C ~GGTT G GGCC AA C cc (!] GTTG GGCCAAC CCG l!]TT G GGCC AA C CCGGjTG GGCCAAC CCGGT~G GGCCAAC CCGGTT~ 55 Nick i ng ( Mutant/WT ) Uncut Strand Nicked Strand 0 0 0.5 1 0 1 5 2.0 2 5 3.0 3 5 4 0

PAGE 65

Figure 11. Rep68 Endonuclease reactions on single-stranded TR mutants. (A) The sequence of our substrate designed to mimic the 3' viral end (REANNEAL) is given. The boxed region indicates additional sequences deleted opposite the trs in the extensively single-stranded substrate described by Snyder et al. (1993) (B) Rep68 endonuclease reactions were performed on WT and REANNEAL substrates as described in Materials and Methods. Products were resolved on a 10% denaturing polyacrylamide gel. Numbers above lanes indicate total amounts of Rep68 in the reactions expressed in fmols

PAGE 66

A. B. T C C A G C G G G C T T T G G T C G C C REANNEAL C GGCCTC A GTG A GCG A GCG A GCGCGCA ~GAGGGAGTG GCC AI (3') G CCGG Di.GT C ACTCGCTCGCTCGCG CGTC 'l CTCCCTCACCGGT TGAGGTAGTGATCCCCAAGATC {5') g g g g ABE trs C G C G C G G C A A A Substrate Rep68 (fmol) Substrate Product WT REANNEAL 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 N v 0 N v 57

PAGE 67

Figure 12. Secondary structure at the AAV trs. (A) Sequences near the trs from the various AA V serotypes were downloaded from GenBank and aligned Boxed nts denote sequence changes from the consensus Palindromic sequences are underlined. (8) Palindromic sequences near the AAV2 and AAVS trs depicted as stem-loop structures Location of AAV-5 trs is from Chiarini et al. (1 ). (C) Rep68 nicking data from 1 bp transversion mutants has been superimposed on the predicted AAV2 trs stem loop structure Circles denote minimal trs as determined by 1 nt mutants

PAGE 68

A. r-------------------------. AAV1 AAV2 AAV3 TCTCCCTCACC!g}sT TGAGGTAGT TCTCCCTCACCGGT TGAGGTAGT TCTCCCTCACCGGT TGAGGTAGT AAV3b TCTCCCTCACCGGT TGAGGTAGT AAV4 TCTCCCTCACCGGT TGAGGTAGT AAVs [g:[gcccTc~MG~ TG[I)GAGAGT AAV6 TCTCCCTCACC[gGT TGAGGTAGT Consensus ( 3 ') TCTCCCTCACCo/cGT TGAGGTAGT ( 5') fJ trs B. ,-------------------------, I C. AAV2 CG G C T A T cG trs T-A C-G C-G C T T-A AAV5 G G T C-G~ AT trs ( 3 ) TC GT ( 5 ) C-G T-A C-G T-A C-G (3')CCCCC T(S') 0.32 0.12 + C @G + 0 13 0 .1 4-+C T+0.10 0 77 + A T + 0.09 1.66 + C G + 0.21 0.44 + T-A + 0.73 C-G + 0.55 C-G + 0 81 C T + 0 .44 T -A + 0.67 C-G (3'}T T(S') 1 bp Transversions (Mutant/ WT Cleavage) 59

PAGE 69

Figure 13. Role of trs stem-loop In Rep68 endonuclease reaction. (A) WT and NOSTEM substrates are depicted after the formation of trs stem loop structure. The Rep binding element and Rep contacts with the small internal pal i ndromes of the terminal hairpin (R8E') are indicated with ovals The minimal trs as determined by 1 nt mutants is also indicated. (8) Rep68 endonuclease react i ons were performed on WT and NOSTEM substrates in the presence of 0 5 mM ATP 0 5 mM ATPgS or no ATP as described in Materials and Methods. Products were resolved on a 10 % denaturing polyacrylamide gel. Numbers above lanes indicate the total amount of Rep68 in the reactions expressed in fmols. (C) The gel from (8) was phosporimaged and the amounts of substrate and product were determined This data was graphed to show relative specific activity of Rep68 on the two substrates under the different ATP conditions

PAGE 70

A. GGC .. ..... . T fT ,f. .s; q .. RBE' G A T A G C A T G C G C T c .. t; A G C G G G C T C G C C C GGCC G A A T RBE C C AGT G A GCG A GCGAGCGCGCAGA A CT AGGGGTT G C G G G C C C G CCGG l!l..:.iwTwC~A~ C ~ T~:.:.:._j~i..x.~..liUl~~.t..k.~ G TG A TCCCCAAGATC G A C C C G G G C A A T ...... ;T To \,c q./ c .. ti A T G C C G G C G C G C WT A T G G Minimal trs T C GGCCTC A GTGAGCG A GCGAGCGCGCAG A A CT A GGGGTT G C G G G C C C G CCG '-'10~....:.U~.Ll<..!,i.lo~c..lil..l"-'--~~~il..&..:"'4,I G TGAT CCCC AAGATC G C C C G G G C NOSTEM T A C T C G C G T C ktr s A A A A ( 3') ( 5 I) ( 3.) ( 5 I ) 61

PAGE 71

62 B. +0.5 mM ATP +0 5 mM ATPyS No ATP Substrate wr NOSTEM wr NOSTEM WT NOSTEM Rep68 (fmol) 000 000000000000000 0 LO O O LO O O LO O O LO O O LO O O LO 0 0 N LO O N LO N LO N LO N LO N LO Substrate Jlii N -.i II' Product C. 0 5 NOSTEM +ATP 0 4 NOSTEM no ATP Q) co a... (J) 0.3 NOSTEM+ATP,,S D 0 ::, Cl) 'C 0.2 Q) WT+ATP 0 z 0.1 WT +ATPyS 0 0 I WT no ATP 0 100 200 300 400 500 Rep68 (fmol) Figure 13--continued

PAGE 72

THE MECHANISM OF REP-MEDIATED AAV ORIGIN NICKING Introduction The single-stranded DNA adeno associated virus (AA V) genome is flanked by terminal repeats (TRs) Internal palindromes allow each TR to fold back on itself forming terminal hairp i nned structures that function as origins for AA V DNA replication as well as integration and packaging s i gnals (33 59 79). During infection synthesis of the AA V genome is initiated by an unidentified host cell DNA polymerase using the 3'-hydro x yl primer of the hairpinned TR This second strand synthesis results in the replication of internal genes allowing production of viral proteins. Yet continued AAV DNA synthesis requires the introdu c tion of a site-specific single-stranded nick into the TRs by the viral encoded non-structural Rep proteins Rep78 and Rep68 (42 62 84, 101 ) In our current model of AAV DNA replication Rep origin nicking and subsequent Rep mediated unwinding of the TR generate a 3 'hydroxyl primer for repair synthesis of the TR During this process of terminal resolution, Rep induces a single-stranded nick at the terminal resolution site (trs) forming a 5 phosphotyrosyl linkage between Rep and the nicking site (Fig 2) (42 84 86). Current evidence suggests that this Rep origin nicking act i vity requires three functional elements within the AA V TR, the canonical Rep binding element (ABE) and a portion of the small internal palindromes within the 63

PAGE 73

terminal hairpin (ABE ), and the trs (Fig. 4) (18 57 58 77, 85 105). The secondary structure of the internal palindromes may also play a role (52 ). 64 Previously we identified the core trs sequence necessary for efficient Rep catalyzed nicking 3 -CCGGT{fG 5 (11 ) This core sequence is strand specifi c in that it is required only on the nicked strand Interestingly the sequences flanking the trs contain an inverted repeat conserved among variou s AA V serotypes (11) Similar to rolling circle origins of DNA replication (63, 66) these inverted repeats appear to form a nicking site stem-loop structure In the case of AA V extrusion of this structure requires ATP-dependent, Rep helicase activity but once this structure is formed the actual endonuclease reaction is not dependent on ATP (11) Since the nicking site is within the single-stranded region of this origin stem-loop it appears that the nicking intermediate is a single-stranded trs (11 ) In addition to a specific sequence and structure at the trs, efficient Rep nicking requires two additional sequence recognition elements within the AA V TR the ABE and ABE '. Mutational analysis has identified a core 22 bp sequence required for stable Rep binding to linear TR substrates (77). This ABE includes the tetrameric GAGC repeat identified by several groups as necessary for stable Rep binding to both linear and hairpinned TR substrates (8 18 57 58 77 105) Moreover chemical interference assays indicate that all major Rep contacts within the linear portion of the hairpinned TR fall within the ABE (2 67 77) Thus the 22-bp ABE appears to be the primary sequence element promoting Rep binding to the AA V TR. Homologues of this ABE are present at the AAV p5 promoter the prefer.ential proviral integration site on human chromosome 19, and within several viral and cellular promoters (6 40 48, 50 55 69, 105, 107 108)

PAGE 74

65 Although the contribution of the ABE to Rep catalyzed trs nicking has not been determined, mutant AA V genomes containing multiple transversions in the ABE replicate at mu c h lower level s than wt (8). This observation has led to the conclusion that stable Rep binding to the AA V TR is necessary for efficient origin nicking and subsequent viral repli c ation. There i s one report of a Rep mutant that fails to bind the AAV TR yet n i cks TR substrates in v i tro albe i t at lowered levels compared to wt However this Rep mutant does not cleave these substrates at the trs but 11 or 12 nucleotides downstream of the c orrect nicking site (5) Thus our current model predicts that the ABE establishes the polarity of Rep interaction with the AAV TR correctly aligning Rep over the trs culminating in nicking of the correct strand at the correct site This alignment over the trs is thought to be quite precise since the correct strand of the trs is nicked even when both strands contain the same sequence (85). Rep interaction with the AA V TR is enhanced by sequences within the internal palindromes of the terminal hairpin Rep binds the complete TR with 125to170fold greater affinity than linear TR substrates lacking the internal palindromes (57, 77) Moreover Rep trs nicking on similar linear TR substrates is reduced 4to SO-fold compared to hairpinned TR substrates (18 58 92 109) Previously, it was thought that Rep made no specific contacts with the terminal hairpin, but recently Ryan et al. (77) identified Rep sequence contacts with the C I I I G motif at one tip of the secondary structure element. Curiously, this short sequence referred to here as the ABE has a constant position w i th respect to the trs regardless of the orientation of the TR (flip or flop). Deletion of the ABE' and adjacent sequences reduces both Rep nicking in vitro and viral DNA replication in vivo {9 ; 85 109).

PAGE 75

66 Though many functions have been attributed to the interaction of Rep with the AA V TRs, the mechanics and architecture of this interaction remain undetermined Here we investigate the functional roles of the ABE and ABE in an attempt to better characterize the mechanism of Rep-catalyzed trs nicking in vitro We determine the contribution of the ABE by altering the polarity and distance of the ABE relative to the trs within mutant TR substrates. Increased spacing between the ABE and trs or a change in the polarity of the ABE dramatically reduces Rep specific activity, and only the wild type orientation of the ABE is able to support efficient Rep nicking These data indicate that association with the ABE is critical to the correct alignment of the Rep active site over the trs for efficient cleavage Additionally we characterize the contribution of the ABE to Rep-mediated trs nicking using a panel of substitution mutants The mutants indicate that specific nucleotides within the ABE' are required for efficient, Rep-mediated cleavage These ABE contacts apparently contribute to Rep mediated unwinding of sequences near the trs and formation of the correct nicking intermediate. Together these results suggest a model for Rep interaction with the AA V TR during trs nicking Results Spacing between the ABE and trs Is Crltlcal during Rep Nicking Previously we determined that Rep makes sequence-specific contacts at the trs and that sequences flanking the trs include a conserved inverted repeat which

PAGE 76

67 apparently forms a nicking site stem-loop structure (11 ) Substrates in which this stem loop was extruded (nostem) abolished the ATP requirement for Rep68 mediated trs nicking in vitro indicating that the actual Rep endonuclease reaction did not require ATP Moreover, Rep nicked the nostem substrate with a 2to 3 fold greater spec i fic activity than wt Since the specific activity of Rep nicking on this substrate was essentially the same in the presence and absence of ATP, we concluded that the DNA helicase activity of Rep was not required once the trs stem-loop is formed (11). Although these observations helped to clarify the nature of Rep interaction with the trs the functional contribution of Rep interaction with the ABE during trs nicking remained unclear To assess the importance of spacing between the ABE and the trs during Rep nicking a panel of insertion mutants was constructed. These mutant TRs contained 3 5 7 or 10 bp of heterologous sequence inserted directly between the ABE and the trs stem-loop structure (Fig 14A) in a region that does not overlap with either element TRs were constructed from three synthetic oligonucleotides that were ligated together as described in Materials and Methods Complete TR constructs were then purified from ethidium bromide stained 10% denaturing polyacrylamide gels and 5 -end labeled with [ y 32 P] ATP and T4 polynucleotide kinase. Rep trs cleavage was assayed on mutant and wt substrates in vitro using homogeneously pure Rep68 as described in Materials and Methods. Rep68 nicking was reduced on all of the insertion mutants compared to wt and decreased as the spacing between the ABE and the trs increased (Fig 148 and C) Furthermore no significant improvement was se~n in the wt+ 1 O mutant in which the trs site was expected to be on approximately the same side of the DNA helix as the wild

PAGE 77

68 type substrate It should be noted that the wt+ 10 mutant appears to contain a small portion of higher molecular weight DNA (Fig. 148) This second band appears to be a gel artifact arising from the electrophoresis conditions used in this experiment When this mutant substrate is resolved at higher temperatures a single correctly sized DNA is observed The trend in Rep68 nicking on these insertion mutants suggests that the actual spacing between the ABE and trs is important during Rep nicking and not just the relative position of the trs on the surface of the DNA heli x. Although most of the Rep68 mediated cleavage on the mutant substrates occurred at the trs, some non-trs Rep68 nicking was observed on the 7and 10-bp insertion mutants. This secondary site nicking occurred on the correct strand but internal of the trs, suggesting that the increased spacing between the ABE and trs was changing the specificity of Rep68 nicking. Together, these observations indicate that the spacing between the ABE and the nicking site is critical for both accurate and efficient Rep68 trs cleavage. Rep Remains bound to the RBE during trs Nicking Although the spacing between the ABE and trs appeared important, the reason for the spacing requirement was unclear One possibility was that the increased distance of our spacer mutants prevented formation of the nicking site stem-loop structure by endogenous Rep DNA helicase activity. To investigate this possibility, we constructed a 10 bp insertion mutant that included a preferentially extruded trs stem-loop structure (Fig 15A NOSTEM+ 10 substrate) Rep nicking on this substrate and its wild type counterpart, nostem, should no longer require ATP or DNA helicase activity (11) Thus we reasoned that if increased spacing inhibited trs stem-loop formation, then

PAGE 78

preferentially extruding this structure should result in efficient Rep68 trs nicking of the 10 bp insertion mutant in the absence of ATP. 69 In fact, preferential extrusion of the nicking site stem-loop structure in the 10-bp insertion mutant did not result in efficient trs nicking Rep68 nicking on this substrate was barely detectable (Fig. 158 and C NO STEM+ 1 O substrate). In contrast, preferential extrusion of the trs stem-loop structure in the wt background increased Rep68 specific activity as previously reported (Fig 15 NOSTEM substrate) (11). This result indicated that Rep68 is unable to make functional contacts with the trs in the absence of ATP when the spacing between the ABE and trs has been increased Since our previous study indicated that Rep helicase activity is not required for cleavage once the trs stem loop is formed these data strongly suggested that Rep is unable to recognize and nick the trs efficiently unless Rep is also physically interacting with the ABE. The RBE aligns Rep over the trs If Rep must maintain contact with the ABE during nicking then the polarity of the ABE within the TR should have a strong effect on nicking efficiency. To test this prediction we constructed three additional mutants in which the 22-bp ABE was substituted with its compliment, inverse, or inverse compliment (Fig. 16A). If any of these polarity changes still supported Rep trs nicking then this would suggest a possible model of Rep interaction with the AA V TR. Initially we asked if the ABE polarity mutations prevented Rep binding to the AA V TR. Although the inverse complement ABE was expected to bind with approximately the same efficiency as wild type, it was not clear whether the more severe alterations in strand polarity in the inverse and complement mutants would affect

PAGE 79

70 binding To assess Rep binding to these mutants steady state binding assays were done under the same reaction conditions as the nicking assays. However, to prevent nicking and the subsequent accumulation of covalent complexes between Rep and the TR substrates, ATP was omitted from the binding reactions. These reactions were then resolved on a native polyacrylamide gel to separate the Rep-bound TR complexes from the starting substrates. As shown in Figure 16D, all of the ABE polarity mutants were bound by Rep at the enzyme concentrations used in the nicking assays (see Fig 16B and C). However there appeared to be some disparity in Rep binding activity between the mutant substrates This result indicates that the strand polarity of the ABE sequence does have a small affect on Rep binding activity but not enough to prevent TR binding at the enzyme concentration used during nicking reactions In contrast the results from Rep68 nicking assays on the three polarity mutants indicated that only the wt ABE was capable of directing efficient Rep trs nicking (Fig. 16B and C). The reduction in Rep nicking activity on the ABE polarity mutants compared to wt was much larger than accounted by differences in Rep binding activity. Thus, changes in the polarity of the ABE appear to have primarily inhibited the association of the Rep endonuclease active site with the trs. This is consistent with the notion that the ABE aligns Rep or a Rep complex in an orientation that is favorable for subsequent trs cleavage Curiously, none of our polarity mutations completely prevented Rep68 trs nicking. The small amount of cleavage observed on these mutants may arise from at least two possibilities. First, Rep may be capable of recognizing and cleaving the trs in the presence of ATP outside the context of other elements. It should be noted, however, that the amount of Rep trs cleavage observed on these mutant substrates is quite small

PAGE 80

71 (5 to 10 fold less that wt), and similar to levels observed on nicking site mutants that we previously reported (11 ). Second the low level of cleavage with the polarity mutants may ind i cate that other sequen c e elements like the ABE ', are also contributing to the alignment of Rep along the AAV TR and directing nicking to the trs (see below ) In eith e r cas e, the ABE appears to al i gn Rep along the TR and direct nicking to the trs. The ABE' Is Required for Efficient Rep-mediated Nicking Despite the importance of the ABE in Rep catalyzed ni c king previous binding assays have detected Rep contacts with a single tip of the internal pal i ndromes of the AAV TR (77). This sequence referred to as the ABE ', has a constant position with respect to the trs regardless of the orientation of the TR (flip or flop) (Fig 16A) The functional importance of ABE sequences during Rep trs nicking was recently confirmed by Wu et al (109 ). This group observed a 3 to 8-fold reduction in Rep n i cking activity on TR substrates in which the ABE had been deleted. The data from Rep68 nicking assays conducted on these ABE substitution substrates were consistent with previous binding and nicking assays (77 109) Rep68 cleavage was reduced on all substrates containing substitutions in the C I I I G motif by 2to 3-fold (Fig. 178 and C compare AAA AAAAT or SWITCH with WT [FLIP]) Furthermore, substitutions in the complementary sequence that comprises the other tip of the internal palindromes had no effect on nicking (Fig 178 and C compare I I I with WT [FLJP] or AAA with SWITCH) To determine whether other sequences with i n the internal palindromes affected nicking we made a mutant in which all of the internal palindromic sequence was deleted in the context of a covalently closed end (Fig. 17 A and C LINEAR). Rep specific activity on the linear substrate was only moderately

PAGE 81

72 reduced compared to the specific activity observed on the ABE' substitution mutants (Fig.17 compare AAA, SWITCH and AAAAT to LINEAR) Together these nicking results supported the hypothesis that Rep makes specif i c nucleotide contacts w i th the ABE during trs nicking and the most important contacts within the internal palindromes are within ABE '. If internal palindrome sequences outside the ABE contributed significantly to Rep nicking then we would have expected a greater reduction in Rep68 nicking on the LINEAR substrate To confirm the importance of the ABE' to nicking, we also tested Rep68 nicking on the wild type flop substrate We expected this substrate to nick at approximately wild type levels because all three components of the TR (trs ABE, and ABE') had the correct sequence and orientation. However, Rep68 nicked the flop substrate with about half the efficiency as the flip substrate suggesting that other factors influenced Rep trs nicking activity Since both the flip and flop orientations of the AA V TR maintain the ABE and the ABE in the same position relative to the trs, the difference in Rep nicking activity must be due to the dissimilar sequences flanking the ABE' in these two substrates (Fig. 17A, compare WT [FLIP] with WT [FLOP]). Indeed, our previous analysis indicated that Rep made additional base contacts within the terminal hairpin sequences flanking the ABE when bound to the flop substrates as compared to flip (77) ABE' Facilitates DNA Helicase Activity and trs Cruciform Extrusion Although it was clear that Rep contacts with ABE were important for efficient nicking, it was not clear whether they affected the DNA helicase or endonuclease activity of Rep We reasoned that if contacts with ABE' were important for trs transesterification activity then ABE mutations should inhibit Rep nicking, even after extrusion of the trs I

PAGE 82

73 stem loop structure. To clarify this issue a panel of R8E substitution mutants was constructed in the nostem background (Fig. 18A) As discussed earlier the nostem substrate contains a pre-formed trs stem-loop structure and nicking of this substrate does not require ATP dependent Rep helicase activity allowing nicking assays to be done i n the absence of ATP Interestingly both of our nostem R8E mutants were nicked at nearly wt levels in the absence of ATP (Fig. 188) Moreover Rep nicked these nostem R8E substitutions about 2-fold more efficiently than the same R8E mutations in the wt TR background (compare Fig 17C AAA and AAAAT with Fig 188, NOSTEM AAA and NO STEM AAAA T). This result indicates that Rep interaction with R8E is not necessary for the Rep transesterification reaction. Rather, it appears that R8E is required primarily for efficient Rep-mediated unwinding of the AA V TR and formation of the nicking intermediate Discussion Previous binding and chemical interference studies in the absence of ATP have determined that Rep makes contact with two distinct elements within the AA V TR, the linear R8E and the CI I I G motif at one tip of one of the internal palindromes the R8E' {18 57 58 77). In the presence of ATP, Rep makes additional contacts with the trs that lead to transesterification (11 42 84 85) Regardless of the orientation of the internal palindromes flip or flop, these three elements are maintained in a constant position relative to the trs during viral DNA replication. During the course of this study we have analyzed the contribution of Rep binding contacts along the AA V TR to Rep-mediated trs nicking Using synthetic AA V TR substrates we have altered the position and polarity of

PAGE 83

74 the RBE relative to the trs and mutated the primary sequence of the RBE' In vitro Rep trs nicking assays on these mutant substrates indicate that both the ABE and RBE are required for eff i c i ent Rep catalyzed trs ni c king. The RBE is Required both for Origin Unwinding and for trs Nicking. Rep nicking activity de c reased dramat i cally when the spacing between the RBE and the trs was alt e red indicating that the position of the RBE relative to the trs is criti c al for efficient cleavage. This observation is consistent with previous in v i vo studies of AA V DNA replication in which AA V genomes harboring mutant RBEs replicated at l owered levels compared to wt genomes (8) and in vitro studies which indicated that the RBE was necessary for Rep binding (18 57 58 77) Recently we showed that the trs endonuclease reaction occurs in two steps, an initial unwinding of the TR by the Rep assoc i ated DNA helicase that leads to the extrus i on of the trs stem loop structure, and the subsequent transesterification reaction that leads to cleavage of the trs (11). We also demonstrated that Rep has a site-specific DNA helicase activity that unwinds DNA containing an RBE (117) Our data from the RBE polarity and spacing mutants in this report indicate that Rep must maintain contact with the RBE during both the TR unwind i ng and the trs cleavage steps of the endonuclease reaction. At least two models could describe Rep interaction with the TR during trs transesterification For e x ample it is possible that Rep initially binds the RBE and then translocates along the nicked strand to the downstream nicking site, in a manner simila r to the restriction endonuclease EcoKI (23 30 32) Once at the trs Rep would recognize the nicking site and initiate the transesterification reaction. In this model the trs stem loop structure may function as a helicase pause site allowing prolonged contact

PAGE 84

75 between Rep and the nicking site Alternatively, Rep may be tethered to the ABE during nicking. Endogenous Rep helicase activity would allow downstream contact with the trs melting of the duple x nicking site and formation of the nicking site stem-loop structure In this second model (illustrated in Fig 21 ) the nicking site stem-loop structure would effectively reposition the trs closer to the ABE bound Rep allowing efficient cleavage Rep nicking data from our insertion mutants is not consistent with a translocation model of Rep mediated trs nicking Rep is a fairly strong helicase capable of unwinding 345 bp per minute (117) If Rep was initially b i nding the AA V TR through the ABE and then actively translocating downstream analogous to EcoKI then we would not expect small increases in spacing between the ABE and the trs to effect the specific activity of Rep nicking Yet, Rep had a lowered specific activity on all spacer mutants compared to wt (Fig 14) Moreover, the specific activity of Rep nicking decreased rapidly as spacing between the ABE and the trs increased Since it is unlikely that 5 7, or 10 bp of intervening sequence would prevent translocation of Rep from the ABE towards the trs it appears that the mechanism of Rep mediated trs cleavage does not include helicase stimulated translocation Furthermore, artificially fi x ing the trs stem-loop structure in the extruded configuration should remove the need for Rep DNA helicase activity and thus contact with the ABE. However Rep nicking on our 10-bp insertion mutant was barely detectable even after extrusion of the trs stem-loop structure (Fig. 15). Thus it appears that Rep maintains contact with the ABE during both DNA helicase and trs cleavage activities. We note that none of our ABE spacer or polarity mutations completely prevented Rep-mediated trs nicking Apparently, Rep is able to recognize and nick the trs regardless of ABE position, albeit at much decreased levels. Thus other elements within

PAGE 85

76 the AAV TR such as the ABE and trs must also contribute to Rep nicking In the case of the trs this is not surprising because our previous study indicated that Rep makes sequen c e specific contacts at the trs during nicking. Mutation of sequences within the 7 base c ore trs sequ e nce site redu c ed Rep cleavage 6 to 10 fold compared to wt substrat e s suggesting that Rep spe c ifi c ity for the trs i s quite stringent (11) Indeed Smith a nd Kotin ( 82 ) re c ently showed dire c tly that Rep can cleave a single stranded trs conta i ning oligonu c leotide in the absen c e ABE or ABE' sequences Contribution of the RBE' to Rep trs Nicking. The importance of the RBE to Rep-mediated nicking was anticipated by viral DNA replicat i on assays as well as Rep binding and nicking assays (9 18 52, 58 77 109) Prev i ous AA V DNA replication assays demonstrated that the internal palindromes of the TR are necessary for efficient viral DNA replication AA V plasmid constructs deleted of the ABE and adjacent sequences replicated at lowered levels than wt AA V constructs (9 52 ) Furthermore in vitro studies indicated that Rep requires the i nternal palindromes for efficient TR binding and nicking (18 58 77, 85) During TR binding, Rep appears to make limited sequence contacts with the internal palindromes and the most prominent of these contacts occur within ABE' (77). Our data confirmed that Rep is making sequence specific contacts with C I I I G motif of the ABE Substitutions within this sequence significantly reduced Rep nicking activity (Fig 17 ) However when we e x amined these same RBE' mutations in the c ontext of the nostem background the reduction in Rep nicking activity was very small (Fig 18 ) This suggested that Rep no longer requires contact with the ABE once the

PAGE 86

stem-loop has been formed and implied that interaction with the ABE was important primarily for Rep TR unwinding activity rather than the transesterification reaction The ABE sequences appear to be the most significant Rep contacts with the 77 internal palindromes during trs nicking. Rep nicking activity on our linear substrate was only slightly reduced compared to our ABE substitution mutants supporting this conclusion. However, the slight reduction in Rep specific activity observed on our linear substrate does imply that either sequences flanking the CI I I G motif or the internal palindrome structure itself contribute to efficient Rep cleavage. Additionally Rep nicking activity was reduced on our flop substrate as compared to the flip substrate. Although this alternative orientation of the AA V TR maintains the C I I I G motif in the same position relative to the trs the sequences flanking this motif are different from the flip orientation. Indeed Ryan et al. (77) observed differences in Rep binding contacts between the flip and flop orientat i ons within these flanking internal palindrome sequences Perhaps this indicates that Rep association with the flop orientation is fundamentally different from flip This concept is supported by chemical interference assays that reveal differences between Rep contacts within the RBEs of the two substrates Although Rep makes many discrete contacts within the RBEs of both flip and flop, the strength of individual base contacts are different in the two TR orientations (77). Finally, the reduction in nicking activity seen with our ABE substitution mutants and the linear mutant (about 3 fold) was less than we and others had previously seen on substrates that were missing portions of the internal palindromes (5-100 fold) (18 58, 85 109). This was most likely due to the fact that the substrates used in this study were covalently closed at one end, whereas previous studies had used Smal cut or linear oligonucleotide substrates Thus, previously used substrates would likely be unwound

PAGE 87

78 by the Rep helicase activity to generate single stranded DNA molecules In contrast the substrates used in this study would rapidly reanneal to duple x molecules. The ABE appears to Align Rep Asymmetrically on the TR. When we e x amined all three possible polarity changes of the ABE sequence (F i g 15, INVERSE, COMPLEMENT and INVERSE COMPLEMENT) only the wild type polarity retained significant nicking activity. Yet all of these polarity mutants bound Rep with affinit i es that were comparable to the wild type substrate This suggested that ABE binding is not particularly sensitive to strand polarity. It also suggested that Rep interaction with the ABE during nicking is inherently asymmetric and serves to align the Rep nicking complex in the appropriate orientation on the TR for the subsequent helicase and transesterification reactions Although the ABE appears to play a central role in orienting Rep along the AA V TR during nicking the architecture of this interaction is undefined. It is not yet clear what an active Rep complex looks like when it is bound to the TR. The kinet i cs of trs nicking are second order with respect to Rep and ATP concentration suggesting that a dimer of Rep is sufficient for nicking activity (117). In contrast Rep DNA helicase activity appears to be first order with respect to enzyme concentration. Furthermore, binding studies detect at least 6 different bound species, suggesting that Rep complexes can contain as many as 6 Rep molecules (57 83). If a Rep dimer is the active nicking complex as implied by the kinetic data then our data suggest that individual Rep monomers do not associate along a twofold axis of symmetry similar to the type II restriction endonucleases Presumably such an arrangement of Rep molecules would be active on both our wt and inverse-complement substrates. Indeed our data imply

PAGE 88

79 that the Rep nicking complex is arranged asymmetrically along the ABE This asymmetry may arise from the arrangement of Rep monomers within the homodimer or may reflect the involvement of higher order complexes in the nicking reaction In conclusion it appears that at least two discrete steps are involved in Rep mediated AA V origin nicking First Rep binds the TR through the ABE. The ABE aligns the Rep comple x along the TR allowing specific contacts with ABE '. These ABE contacts appear to stabilize the Rep complex and facilitate Rep mediated DNA helicase activity. It is unclear if Rep maintains its original contacts and pulls unwound downstream sequences towards the ABE allowing them to self-anneal into the trs stem loop or if stem-loop formation is more passive in nature. In either case, the net result of Rep helicase activity is the formation of the trs stem-loop. Once formed this structure presents the single-stranded trs to the Rep transesterification active site in the proper position for nicking

PAGE 89

Figure 14. Rep nicking activity on ABE Insertion mutants. (A) The wt AA V TR is depicted after extrusion of trs stem-loop structure. The ABE is indicated w i th a bo x, the RBE is indicated with a dashed oval the minimal trs is indicated w i th small circles and the actual nicking site is indicated with a small arrow. The position of insertions is indicated with a large arrow. The inserted sequen c es are given next to the mutant identifier (8) Rep68 endonuclease reactions were performed on wt and insertion substrates in the presence of 0.5 mM ATP as described in Materials and Methods Products were resolved on a 10% denaturing polyacrylamide gel. A representative gel is shown. Numbers above lanes indicate the total amount of Rep68 in the reactions expressed in femtomoles. The positions of substrates and products are indicated (C) Nicking data was obtained from two independent trials. The relative Rep specific activity for each mutant was expressed as the fraction of mutant substrate nicked divided by the fraction of wt substrate nicked at the same Rep concentration Ratios obtained at different Rep concentrations in the two trials were then averaged and graphed for each mutant (n=4 for all substrates except WT+10 where n = 7) Bars indicate the standard deviation from mean

PAGE 90

A. ......... Gee A... T .. .. {T Tl ABE \.C G . .: G A T A G e A T G e T A T G C C G G C G C G e e GGeC G CCGG C G G C G e G e e G e G e G G e A A A G C G A A T ABE G e C A GTGAGCG A GCG A GeGCGe AGA __J A CT A GGGGTT GTC A CTCGCTCGCTeGCGCGTCT-, TGATCCCCAAGATe G WT+3 WT+5 WT+l WT+10 .. ........................... ~ , 'l. ;'( ci I I : C nsert,ons c T f fAc i i ATG l "' .... .. ...... .. .. e A C A T G G A 1" AteGTA c i .. i T~GGATG i ... .. 1 .... ........... .. . . ... atrs .............. ............... ,? .............. ......... l TCDGA iCGTA l AG0TAGeATG 1 ............. .. ..... ..... .. .... .. .......... .............. ( 3 ') ( 5 t) 81

PAGE 91

B. Substrate Rep68 fmol Substrate Product C. 1.0 0 8 +:t C .e 0.6 =, :E O> 0.4 C .:s:. 0 z 0.2 0 0 WT 'NT+3 WT +5 'NT +? WT+10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 WT WT+3 WT+5 WT+l WT+10 Figure 14 -continued 82

PAGE 92

Figure 15. Rep nicking activity on ABE Insertion mutants In the NOSTEM background. (A) The two TR substrates containing preferentially extruded trs stem-loop structure are illustrated. NOSTEM and NOSTEM+ 10 TRs are depicted after formation of trs stem loop structure. The ABE is indicated with a box the ABE is indicated with a dashed oval the minimal trs is indicated with small circles, and the actual nicking site is indicated with a small arrow. The position and sequence of the NOSTEM+ 10 insertion is indicated with bold italics. (B) Rep68 endonuclease reactions were performed on wt and the wt+ 1 O insertion substrates in the presence of 0.5 mM ATP as described in Materials and Methods Rep68 endonuclease reactions were performed on NO STEM and NO STEM+ 1 O insertion substrates in the absence of ATP Products were resolved on a 10% denaturing polyacrylamide gel. Numbers above lanes indicate the total amount of Rep68 in the reactions expressed in femtomoles (C) The gel from (B) was phosphorimaged and the amounts of substrate and product were determined. The fraction of nicked substrate for wt and mutant TRs was then calculated at each Rep concentration and plotted Closed boxes denote wt, closed triangles NOSTEM, open squares wt+ 10 and open triangles NOSTEM+ 1 O

PAGE 93

A. .. .. ..... .. T .. '.r Tl ABE \ ~ q ,,.: c -r; A T G C C G G C G C G C C GGCC T G CCGG C G G C G C G C C G C G C G G C A A A .. T .. ( T -r ) -. ~ G .I c .... c T C G C C C ABE C A GTG A GCG A G C G A G C G C GC A G A A C TAGGGG T T ( 3 ') G T C A TCGCTC CTCGCGCGTCT TGATCCCC AA G A TC (5 '). G T A C T C G C G T A NOSTEM i k trs C T A G C G G G C GGCCTC A GTG A GCG A GCG A GCGCGC A G ArCQ Ar car AC A CT A GGGGTT G C G G G C C C G A CCGC: A GTC A C T CGC T CGCTCGCGCGTC T AQ Cr AQCArQ T G AT CCCC AA G A TC G C C C G G G C A A NOSTEM + 10 C G T A C T C G C G T A c k trs A C ( 3 ) ( 5 I ) 84

PAGE 94

B. C. Substrate Rep68 fmol Substrate Product Q) ffl ._ en J:l ::, Cl) -0 Q) .::,,::, (.) z 0.7 0.6 0 5 0.4 0.3 0 2 0 1 0.0 +0 5 mM ATP No ATP WT WT+10 NOSTEM NOSTEM+ 10 000 000 000 000 0 ll) 0 0 ll) 0 0 ll) 0 0 ll) 0 0 C\J ll) 0 C\J ll) 0 C\J ll) 0 C\J ll) ~ -., 0 100 200 300 400 500 Rep68 (fmol) Figure 15--continued NOSTEM WT WT+10 NOSTEM+10 85

PAGE 95

Figure 16. Rep endonuclease activity on RBE polarity mutants. (A) The wt AA V TR is depicted after extrusion of the trs stem-loop structure The ABE is indicated with a box the ABE is indicated with a dashed oval the minimal trs is indicated with small circles and the a c tual nicking site is indicated with a small arrow The wt ABE was replaced with alternative orientations of this sequence The sequences of the various ABE orientations are given next to the mutant identif i er Note that the integrity of the ABE base composition i$ maintained Only the polarity of the nucleic acid sequence has been altered. (8) Rep68 endonuclease reactions were performed on wt and insertion substrates in the presence of 0.5 mM ATP as described in Materials and Methods. Products were resolved on a 10 % denaturing polyacrylamide gel. A representative gel is shown. Numbers above lanes indicate the total amount of Rep68 in the reactions expressed in femtomoles The positions of substrates and products are indicated (C) The gels from two independent trials were phosphorimaged and the amounts of substrate and product were determined The fraction of nicked substrate for wt and mutant TRs were calculated at each Rep concentration, averaged between trials and plotted. Closed boxes denote wt, closed circles complement, closed triangles inverse, and closed, inverted triangles inverse complement (n=2 for all data points) Bars indicate the range at each data point in the two independent trials {D) Rep binding to wt and mutant TRs was assayed under endonuclease conditions in the absence of ATP (see Materials and Methods) Reactions were resolved on a 4% native polyacrylamide gel to separate substrate from protein bound DNA complexes (PDC s) The positions of substrate and PDC s are indicated

PAGE 96

A. WT -. _., ,. T ..._ 'T T i I / \ C G ~ t t; A T G C C G G C G C G C ABE ABE Gee G A T A G e A T G C G e G A A T T C ==-=-=-=""'=-=-=~=-=-=-~ =-=-=-=-=""'~ A CT A GGGG T T C GGCC TCAGTGAGCGA~OGAGCGCGCAGA ( 3 ') G C G G G C C C G A A CCGG GTCACTCGC T CGCT C GCGCGTCT G T G AT CCCC AA G AT C (5 ) G C C C G G G C A A T G G ,a-trs TCAGTGAGCGAGCGAGCGCGCAGA ~GTCAGTQGCTCGCTCGCGOGTCT COMPLEMENT AGTGACTCG0TCGCTQGCGCGTCT iCAGTGAG CGAGCGAGCGCG'C AGA INVERSE INVERSE COMPLEMENT AGAC6CGC'(;AGCGAGCGA G1GACT TCTGCGSGCTCGCTOGQTGAGTG~ , tcTGGGCGOTCGCTCGGTG'AGTGI\ AGACGCGCGAGCGAGCGAGTGACt 87

PAGE 97

88 B. Substrate wr COMP INV INVCOMP Rep68 fmol 000 000 000 000 0 lO O O lO O O lO O O lO 0 0 ...C\I lO O ...C\I lO O ...C\I lO O ...C\I lO Substrate Produ ct C. 0 4 (l) WT 0 3 (J) .0 :J 0 2 Cf) -0 (l) COMP 0 0 1 z INVCOMP /NV ~ 0.0 0 100 200 300 400 500 Rep68 (fmol) D. Substrate wr COMP INV INVCOMP Rep68 fmol 0 0 0 0 0 0 0 0 lO 0 lO 0 lO 0 lO 0 0 C\I lO 0 C\I lO 0 C\I lO 0 C\I lO PDC Substrate Figure 16--continued

PAGE 98

Figure 17. Rep endonuclease activity on ABE' substitution mutants. (A) The wt AAV TR is depicted after extrusion of trs stem loop structure. The ABE is indicated with a bo x the ABE is indicated with a dashed oval, the minimal trs is indicated with small circles, and the actual ni c king site is indicated with a small arrow. Additionally the position of the Smal endonuclease site is indicated with a line The terminal hairpins of flop and ABE substitution mutants are also depicted Mutated sequences are indicated in bold (B) Rep68 endonuclease reactions were performed on wt and substitution substrates in the presence of 0.5 mM ATP as described in Materials and Methods. Products were resolved on a 10 % denaturing polyacrylamide gel. Numbers above lanes indicate the total amount of Rep68 in the reactions expressed in femtomoles. The positions of substrates and products are indicated. (C) The gel from (B) and a second gel containing reaction products from wt and LINEAR substrates were phosphorimaged and the amounts of substrate and product were determined The relative Rep specific activity for each mutant was expressed as the fraction of mutant substrate nicked divided by the fraction wt substrate nicked at the same Rep concentration. Ratios obtained at different Rep concentrations were then averaged and graphed for each mutant (n=2 for all mutants except for LINEAR where n=4) Bars indicate range between the different Rep concentrations.

PAGE 99

A. Sma I GGC .. .. .. T G A { T T '; ABE T A \ t;:4/ GC c ..... t A T A T G C G C C G G C G C ABE G A G C A T G C ,.,. C T C GGCCTC A G TGA GCG A GCG A GCGCGC A G A A CT A GGGGT T Sm a I ... ...... .. T ... (T i } C. G .. G ..... t G C G C C G C G C G C G C G G CCGG ~ G T C A CTCGCTCGCTCGCGCGTCT C G G C G C G C C G C G C G G C A A A ... .... .. A .. .. fA ,A \ \ ~ ~ ; .. ,. A T G C C G G C G C G C C G WT ( FLIP ) ., T 1,: ... .. . . . iT [' i f A A \ I l I c. q \ f C .. .. c ..... t; A T A T G C G C C G C G G C G C G C G C G C G C T G A TCCCC AAGAT C G A T G G A k trs .,. A .. ,I \ ( A Ai \ :A J ./ c ..... t A T G C C G G C G C G C C G C G C G A T T T T G C G C G C G C G C C G C G C G C G C G C G G C G C G C G C C G G C G C G C G C G C G C G C G C G C C G C G C G C G C G T A C G C G C G C G G C C G C G C G C G G C G C C G C G G C A A A A T T T T A A A A T T A FLOP AM I I I SWITCH AAMT ( 3 ') ( 5 ') C G T G C LINEAR 90

PAGE 100

B. Substrate Rep68 fmol Substrate Product C. C: <'tS ::, O> C: 0 z WT FLOP AAA I I I SWITCH AAAAT 00 00 00 00 00 00 lO O lO O lO O lO O lO O lO 0 0 N lO O N lO O N lO O N lO O N lO O N lO 4 1 4 1.2 1 0 0.8 0.6 0 4 0.2 0 0 ~ -Figure 17 -continued 91

PAGE 101

Figure 18. Rep endonuclease activity on RBE' substitution mutants In the NOSTEM background. (A) The NOSTEM substrate is depicted The ABE is indicated wjth a box, the ABE is indicated with a dashed oval, the minimal trs is indicated with small circles and the actual nicking site is indicated with a small arrow The terminal hairpins of the ABE' substitution mutants are also depicted. Mutated sequences are indicated in bold. (B) Rep68 endonuclease reactions were performed on NOSTEM and NOSTEM ABE substitution substrates in the absence of ATP as described in Materials and Methods. Products were resolved on a 10% denaturing polyacrylamide gel. The gel was phosphorimaged and the amounts of substrate and product were determined. The relative Rep specific activity for each mutant was expressed as the fraction of mutant substrate nicked divided by the fraction wt substrate nicked at the same Rep concentration Ratios obtained at different Rep concentrations were then averaged and graphed for each mutant (n=4 for all mutants). Bars indicate standard deviation from the mean.

PAGE 102

A __________________________ __ B. ......... T -~ ... Tl RBE -. ~ (i ,;, c t A T G C C G G C G C G C RBE T C GGCC C A GTGAGCGAGCGAGCGCGCAGA ACTAGGGGTT G CCGGU.:.!.~T~C~A~C~T=~C~TC~G~C~T~C~G~C=G~C~G~TwC~T TGAT CCCC AAGATC C G G (3 ') ( 5 ') G C A G C T G C G C G G C G A c G .A.,, trs G C A A A . T .... fr T \ \ c ~_., .. .. c .. A T G C C G G C G C G C C G T G C C G G C G C G C C G C G C G G C A A A RBE NOSTEM ( FLIP) 1.0 0 8 C l'O :, 0 6 :E C) C 0 4 0 z 0.2 NOSTEM . .. A "' '"-.O .. "'.. A .. t i i i f A Ai G. c;; ..... \ ,A ..... C ..... G c ..... G A T A T G C G C C G C G G C G C G C G C G C G C C G C G T T G C G C C G C G G C G C G C G C G C G C C G C G C G C G C G C G G C G C A A A A A A NOSTEMAAA NOSTEM AAAA T NOSTEM NOSTEM AAA NOSTEM AAAA T 93

PAGE 103

REP INTERACTION WITH THE AAV ORIGIN OF DNA REPLICATION Sequence Elements Required for Rep-mediated trs Nicking The single stranded DNA AA V genome is flanked by TRs that that self-anneal to form terminal hairpinned structures ( see Fig. 3) These folded TRs function as origins of AAV DNA replication as well as integration and packaging signals (33, 59 79 ), and are the only AA V cis elements required for both lytic and latent AA V infections All of these various activities seem to be mediated AA V Rep protein interaction with the viral TRs (4 1 36 59, 86) During AAV DNA replication, Rep binds the TR and catalyzes a strand specific, site specific nick at the trs This ATP-dependent endonuclease reaction creates a primer for AA V DNA synthesis and shares several functional homologies with the activities of RCA proteins (84, 86, 93). In this study we have characterized the AAV TR sequences necessary for Rep-mediated trs nicking Using an in vitro nicking assay and purified Rep68, we have determined the AA V TR sequences necessary for efficient Rep mediated trs nicking Our data indicate that during the endonuclease reaction Rep interacts with three discrete sequence elements within the AAV TR the ABE the ABE ', and trs Together, these elements appear to align the Rep nicking complex along the TR in a specific orientation directing cleavage to the trs. Efficient Rep-mediated trs nicking requires the 7 base core nucleotide sequence 3 'CCGGT/fG 5 at the trs This core sequence is strand-specific and is required only 94

PAGE 104

95 on the nicked strand Interestingly the first five nucleotides of this core trs sequence are flanked by an 8 bp inverted repeat that appears to form a stem-loop intermediate prior to nicking. Although the actual sequences near the trs differ somewhat between the various AA V serotypes all of these viruses contain an inverted repeat at the nicking site (see Fig. 12) Moreover preferent i al extrusion of the trs stem-loop structure abolishes the need for ATP during the Rep endonuclease reaction (NOSTEM, see Fig. 13) Thus the Rep transesterification reaction does not require ATP Rather it appears that ATP is required to unwind the TR and allow formation of the nicking intermediate. The ABE appears to mediate the initial association between Rep and the AA V TA orient i ng Rep along the TR and directing cleavage to the trs. Consequently insertion of heterologous sequences between the ABE and the trs reduces both the specificity and activity of Rep trs nicking even after preferential extrusion of the trs stem loop (Figs. 13 and 14) Moreover changes to the ABE orientation, in relation to the trs also substantially inhibit Rep trs cleavage (Fig 15) These results imply that Rep does not translocate from the ABE to the downstream trs during the endonuclease reaction. Indeed Rep appears physically tethered to the ABE during nicking and must reach out to trs to make sequence contacts necessary for the cleavage event Although the ABE is sufficient for Rep binding in vitro studies indicate that Rep binding to the AA V TR is greatly enhanced by an element within the terminal hairpin, the ABE' (58, 77) Curiously the orientation of the ABE relative to the ABE and trs remains constant during AA V DNA replication despite flipping" and flopping of internal TR sequences. Since Rep does not bind the AA V terminal hairpin in the absence of other sequences (57), contacts with the ABE' appear to stabilize Rep interaction with the ABE ( 18 58 109). During Rep trs cleavage, the ABE appears to facilitate the formation of

PAGE 105

96 the nicking intermediate at the trs Accordingly Rep nicking is sharply reduced when the ABE is mutated in otherwise wild type substrates but nearly unchanged when these same ABE sequences are mutated in substrates containing pre-formed trs stem-loop structures. Thus the ABE does not appear necessary for the Rep cleavage reaction The ABE does not seem to be the only factor directing Rep interaction with the terminal hairpin and other features of the AA V TR appear important to this interact i on The observed disparity in Rep trs ni c king activity between the flip and flop orientations of the AA V TR indicates that either terminal hairpin sequences in addition to the ABE or the terminal hairpin structure itself are necessary for efficient Rep nicking. As mentioned earlier Ryan et al. observed several differences between Rep binding contacts with both the ABE and ABE of flip and flop substrates (77 ). Perhaps this indicates that Rep association with the flop orientation is fundamentally different from flip and that more complex factors such as TR structure are involved in Rep nicking Although we did not directly test the importance of TR structure Rep nicking data from ABE deletion mutants suggests that the structure of the terminal hairpin is required for efficient Rep trs cleavage. Deletion of both the tips of the small internal palindromes reduced Rep68 nicking more dramatically than the sum of each deletion alone (Fig 19 compare NOTIPS with DELAAA and DEL r r r ) In fact Rep68 trs nicking activity was essentially the same on the double deletion substrate NOTIPS, as our linear substrate suggesting that Rep is no longer able to make functional contacts with the ABE of NOTIPS Although the exact structure of the NOTIPS substrate is not known it seems likely that the deletion of both single-stranded tips of the small internal palindromes would disrupt the structure of this substrate If this assumption is correct, it appears that Rep contacts with the ABE' during trs nicking require the correct TR structure However

PAGE 106

the contribution of the terminal hairpin structure will remain unclear until Rep nicking is assayed on mutants that maintain a wt ABE but are altered in overall structure. Model of Rep-Mediated Nicking of the AA V Origin of DNA Replication 97 The Rep endonuclease reaction is composed of two discrete steps First, ATP dependent Rep helicase activity unwinds the TR allowing formation of the trs stem-loop structure. Next, Rep cleavage activity induces a single-stranded nick at the trs ATP is not necessary for this transesterification reaction. Recent experiments using Rep mutants appear to confirm this model. Rep mutants deficient in ATPase and DNA helicase activities are able to cut single-stranded TR substrates in vitro {24, 82). Since these single-stranded substrates contain the inverted repeat that flanks the trs they would probably form the nicking site-stem-loop structure in solution. The trs stem-loop structure seems to be important during the Rep endonuclease reaction for at least two reasons. First this structure presents the minimal trs within a single-stranded DNA loop. Since Rep no longer requires ATP to nick single-stranded TR substrates the actual nicking intermediate appears to be a single-stranded trs (25, 82). Second, formation of the trs stem-loop structure effectively repositions the nicking site closer to the ABE. This seems to be important because Rep appears physically tethered to the ABE during trs nicking and presumably, repositioning of the trs closer to the ABE is necessary for efficient Rep catalytic interaction with the nicking site Although it is possible that the actual nicking intermediate is an unwound TR that positions the trs within a large region of single-stranded DNA several lines of evidence suggest that this is not the case When large regions of single stranded DNA flank the

PAGE 107

98 trs Rep nicks two sites with the same efficiency, the trs and a site 11 nt downstream (85). Since the vast majority of Rep nicking on wt TR substrates occurs at the trs it appears that the actual nicking intermediate does not include large regions of single stranded DNA flanking the cleavage site. Indeed in vivo Rep cleaves covalently closed AA V molecules containing 4 7 kb of downstream, duplex DNA that would drive the rapid reannealling of unwound TR sequences. This situation may necessitate some device to hold the trs in a single-stranded conformation. Perhaps the trs stem-loop structure serves this function and thus facilitates efficient Rep cleavage. Origin nicking site stem-loop structures are found in a variety of RCA systems, but Rep interaction with the AA V TR appears quite distinct from the interaction of other RCA origin recognition proteins with their cognate origins. Like AA V, the single-stranded DNA geminiviruses also contains an energetically improbable stem-loop structure that positions the origin-nicking site within a single stranded loop (66, 87) Yet, geminivirus Rep does not appear to be a DNA helicase and would presumably require accessory factors for stem loop extrusion (51 66). In the S. aurens plasmid pT181 origin stem loop extrusion seems to involve both the plasmid encoded endonuclease RepC and the superhelical twisting of the plasmid DNA (63). Thus the mechanism of stem-loop extrusion seems to differ among these evolutionary distant organisms, each mechanism apparently reflecting the unique characteristics of the individual DNA replication origins Rep Association with the AA V TR during trs Nicking The geminivirus and pT181 replication proteins appear to form multimeric complexes with their cognate origins and these complexes seem required for origin

PAGE 108

99 function (13 80 116) AA V Rep also forms multimeric comple x es with the viral TRs but the importance of these Rep comple x es is unknown Six discrete Rep bound TR comple x es are observed und e r in vitro trs nicking conditions and these are termed protein DNA comp l e x es ( PDCs) 1 2 3 4 5 and 6 with the numbers ascending from th e smallest to the larg e st compl ex (Fig 21A and Fig 22A) ( 57 83 ) Crosslinking and gel filtration studies by Smith et a l. indic a te that the si x PDCs contain 1 2 3, 4 5 or 6 Rep molecules respect i vely ( 83 ) However the number of TRs involved in these comple x es remained undetermined. To clarify the contribution of the AAV TR to Rep comple x formation Li and Muzyczka labeled Rep68 with 35 S and the TR with 3 2 P and then calculated the molar ratio of protein and DNA in each Rep complex with the AA V TR (53 ) If the PDCs contained 1 to 6 Rep molecules each and a single TR then the molar ratios of Rep68 and AA V TR substrate would be expected to increase from 1 to 1 for PDC 1 to 6 to 1 for PDC 6. This was not the case The molar ratios of Rep68 to TR in the three larger comple x es PDCs 4 5 and 6 1 were less than expected and indicated that these complexes contained 2 or 3 Rep68 molecules per TR. Since these same complexes appear to conta i n 4 5 or 6 Rep molecules this observation implies that PDCs 4 5 and 6 also include 2 or 3 TRs per ind i vidual complex (53). Although the function of the Rep complexes conta i ning multiple TRs is not known similar Rep complexes have been observed before For example Rep is capable of interact i ng simultaneously w i th both a TR and a small linear ds DNA containing the preferred proviral integration site on human chromosome 19, AA VS 1 (105). Rep seems to form a bridge between the TR and the AAVS1 ABE homolog Additionally, others have also presented evidence that the duplex sequences of the AAV TR are able self-associate into higher order complexes in the absence of other factors

PAGE 109

100 (47). This observation may e x plain the concatamers sometimes observed after native electrophoresis of TR substrates (Fig 21 A) Rep comple x es containing 2 TRs also appear to have a fun c tional role during trs nicking. PDCs 4 5 and 6 form more readily than the TR is nicked so under reaction conditions where more than 50 % of the TR is nicked nearly all of the TR substrate i s asso c i a ted with these h i gher order c omple x es that c ontain 2 or 3 TRs (Fig 21 ) Although this observation suggests that the three larger Rep comple x es may have a role in nicking it does not clarify the composition of the minimal Rep ni c king complex. To determine the relationship between nicking and Rep association with the AA V TR trs endonuclease assays were done at limiting Rep concentrations allowing all six Rep comple x es to be visualized Reaction products were then resolved on a native polyacrylamide gel and each Rep bound TR band and the substrate band were then e x cised from the gel (Fig 22A) Following elution and d i gestion with proteinase the TR comple x es were resolved on a denaturing polyacrylamide gel to separate cleaved product from TR substrate Each of the excised TR complexes contained nicked product including the substrate band (Fig. 22). The association of cleaved product in the substrate band seems to indicate that the Rep complexes with the TR are falling apart during the reaction or during eletrophoresis Thus the minimal Rep nicking comple x cannot be identified by this assay However a larger fraction of nicked product is associated with the two larger PDCs than with other complexes ( Fig 22) again suggesting a functiona l relationship between Rep comple x size and ni c king activity on the TR Since these PDCs appear to contain 5 or 6 Rep mole c ules and 2 or 3 TRs it appears that trs nicking

PAGE 110

101 activity may be enhanced by the formation of Rep complexes containing multiple Rep molecules and multiple TRs Rep Cleavage Activity Effects the Rate AA V DNA Replication Several previous studies have suggested that the Rep-mediated trs nicking plays a pivotal role during AAV DNA replication (51 66) Yet no specific correlation between Rep nicking activity and AA V DNA replication has been made Since Rep cleavage is required for the generation of TR primers the current model of replication predicts that Rep nicking activity controls the rate of AA V DNA replication. To directly test this prediction, two of the previously used 1 bp tranversion mutants were built into AA V DNA replication substrates The mutant TRs were ligated to internal AA V sequences producing double stranded covalently closed viral DNAs (Fig 6). These no-end constructs were then used as substrates for DNA replication in a cell free assay. As expected, the mutation that stimulated Rep68 nicking also enhanced AA V DNA replication compared to no-end constructs containing wt TRs. Additionally, DNA replication was reduced in the mutant that inhibited trs cleavage. Thus it appears that the specific activity of Rep nicking is directly related to the rate of AA V DNA replication. The relationship between Rep trs nicking and AA V DNA replication implies that Rep cleavage can effectively regulate the rate of viral DNA synthesis. The multi-step Rep cleavage reaction may provide several possible methods of regulating trs nicking (see Discussion in Chapter 3) For example factors that influence the formation of the trs stem-loop such as the binding of heterologous proteins to the AA V TR, may effectively regulate Rep nicking Moreover since Rep nicking activity seems to be

PAGE 111

102 enhanced by the formation of higher order homomeric Rep complexes, interaction with heterologous proteins that augment the formation these Rep complexes may be crucial to the regulation of Rep nicking Thus AAV DNA replication may ultimately be regulated by the formation of active Rep nicking comple x es and the creation of an active nicking intermediate at the trs. The regulation of Rep nicking at the TR may have far reaching consequences for the AA V life cycle. There is accumulating evidence that efficient viral transcription and proviral integration also require Rep intera c tion w i th the AA V TRs (4, 29, 103) suggesting that Rep nicking may be involved in these processes. Furthermore, recent evidence of Rep DNA ligation activity may indicate that under the right conditions Rep is able to catalyze both activities associated with type I DNA topoisomerases, single stranded DNA cleavage and ligation (82) Presumably these cleavage and ligation activities would facilitate integration of the AA V provirus into the host chromosome. Thus factors that regulate Rep nicking activity may also influence other Rep activities at the AA V TR and may ultimately induce the decision between lytic and latent AA V infections

PAGE 112

Figure 19. Rep endonuclease activity on RBE' deletions. (A) The wt AAV TR is depicted after extrusion of trs stem-loop structure The ABE is indicated with a box, the ABE' is indicated with a dashed oval, the minimal trs is indicated with small circles, and the actual nicking site is indicated with a small arrow Additionally, the position of the Smal endonuclease site is indicated with a line. The terminal hairpins of flop and ABE substitution mutants are also depicted Mutated sequences are indicated in bold. (B) Rep68 endonuclease reactions were performed on wt and substitution substrates in the presence of 0.5 mM ATP as described in Materials and Methods Products were resolved on a 10% denaturing polyacrylamide ge l. Gels were phosphorimaged and the amounts of substrate and product were determined The relative Rep specific activity for each mutant was expressed as the fraction of mutant substrate nicked divided by the fraction wt substrate nicked at the same Rep concentration. Ratios obtained at different Rep concentrations were then averaged and graphed for each mutant (n=4 for all mutants). Bars indicate standard deviation from the mean.

PAGE 113

A. B. GGC ... "if" .. -.., G A ~c ,i9 ABE T A c--~ G C A T A T G C G C C G G C G C ABE G A G C A T T G C G C C GGCC~CAGTGAGCGAGCGAGCGCGCAG A ACTAGGGGTT G C G G G C C C G CCGG~GTCACTCGCTCGCTCGCGCGTCT G C C C G G G C TGAT CCCC AAG A TC G { 3 I) ( 5 ') Sma I ..... ... A A A .. T .... lT T \ \. C G .l ABE C""r; A T G C C G G C G C G C C G T G C C G G C G C G C Sma I C G C G C G G C A A A WT ( FLIP ) 1 4 1 2 [ 1 0 C: g 0 8 ::, O> 0 6 C: .:.:. 0 z 0 4 0 2 . .., ....... ... T I i T T i : C G A T G C C G G C G C G C C G T G C C G G C G C G C SMA WT WT (FL IP ) . ,... T ... .. f T T i \.C G~l A T G C C G G C G C G C C G T G C C G G C G C G C C G C G C G G C u de/AAA SMA de/AAA A T G G trs .... l. n \ : C G l ,. c-r; A T G C C G G C G C G C C G T G C C G G C G C G C C G C G C G G C A A A de/TTT de / TTT .......... .. /. n . l \, C G ./ c"-~c; A T G C C G G C G C G C C G T G C C G G C G C G C C G C G C G G C u NOT/PS NOT/PS 104

PAGE 114

Figure 20. Model of Rep Interaction with the AA V TR during trs nicking. The various steps involved in Rep catalyzed trs nicking are illustrated. The gr a y ovals each depict separate Rep molecules The black circles represent the Rep catalytic sit e. The trs is indicated with an arrow In this model, Rep makes specific nu c leotide contacts with the AA V TR as determined by Ryan et al. and Brister and Muzyczka (11 77) See te x t for details.

PAGE 115

0 C 'I' 0 C Q o C 0 C 0 C C Q C Q C 0 o C ,. C C C Q 0 0 C ,. Q 0 0 C ,. ,. 0 Cc C 0 C C C C 0 C 0 0 O 0 C 0 Q C A ,0 C T 0 C 0 C 0 C 0 C C 0 C 0 C 0 0 C ,. ,. +ATP ATP Hydrolysis O C AGA O AO O QA O 'I' 00 CC AA C 'I' CC A 'l' C A C 'l' A OQOO 'I' 'I' ( 3 ) 'l' C 'l' C 'l' CCC 'l' C A CC OO'l''l'OAOO'l'AG'l'OA'l' CCC CAAOA'l' C ( 5 ') t trs oG C'<' ,. .. 0 .. ('> 0 .. 0 0 0 0 J .) ( r; l o o o 0 c 0 A 'I' ,. 0 C ,. 'I' 0 C 0 C 0 ,. ,. 'I' 0 C OA A C 'l'AOOOO'l''I' (3 ') 'I 'l'OA'J' CCCC AAOA'l' C ( 5 ) 0 A 'I' 106

PAGE 116

Figure 21. Rep68 association with the AAV TR during trs nicking. Rep endonuclease assay were performed at wt TR substrates at various Rep concentrations as described in Materials and Methods. Each reaction was divided into two equal aliquots (A) The first aliquot of each reaction was resolved on a 4% native polyacrylamide gel to separate substrate from Rep bound TR complexes (PDC's). The positions of each Rep complex with the TR are indicated (8) The second aliquot of each reaction was proteinase K digested, phenol-chloroform extracted and ethanol precipitated Reaction products were then resolved on a 10% denaturing polyacrylamide gel to separate starting substrate from nicked product

PAGE 117

A. 0 B. 0 Rep68 (fmol) 0 0 0 0 0 0 0 LO .,.... C\J LO .,.... C\J '?, Rep68 (fmol) 0 0 LO .,.... C\J 0 LO 0 0 0 0 T""" C\J 108 + PDC6 + PDC5 PDC4 + PDC3 PDC2 PDC 1 + Substrate + Substrate Product

PAGE 118

Figure 22. Relationship between Rep68 complex formation with the AA V TR and trs nicking activity. (A) Rep endonuclease reactions were done in the presence of ATP as described in Materials and Methods Rea c tion s were resolved on a 4 % nat i ve polyacrylamide gel to separate substrate from Rep bound TR comple x es (PDC's) The po s ition s of ea c h Rep comple x with the TR a r e ind i cated (B) Individual Rep comple x es were e x cised from the gel. Eluted comple x es were proteinase K d i gested 1 phenol chloroform extracted and ethanol precipitated Reaction products were then reso l ved on a 10 % denaturing polyacrylamide gel to separate starting substrate from nicked product. The gel was phosphorimaged the amounts of substrate and product asso c iated with each Rep comple x with the TR was determined. The fraction of cleaved compared to total TR within a particular complex was plotted

PAGE 119

A. PDC6 + PDC5 + PDC4 + PDC3 + PDC2 + PDC 1 + Substrate+ B. Total Reaction Substrate PDC 1 PDC2 PDC3 PDC4 PDCS PDC6 110 0.00 0 04 0.08 0 12 N i cked Substrate

PAGE 120

Figure 23. In vitro DNA replication of AAV no-end constructs containing 1 bp transversions at the trs. (A) Positions of the two 1 bp transversions are i ndicated with gray boxes and the mutant identifier is given above each position (B) Rep68 endonuclease rea c tions were performed on mutant and wt TR substrates as described in Materials and M e thods. Products were resolved on a 10 % denaturing polya c rylamide gel. The gel was phosphorimaged the amounts of substrate and product were determined and the fraction of nicked substrate was plotted. (C) No-end AAV replication constructs were built using wt and the two mutant TRs as described in Materials and Methods These substrates were assayed for in vitro AA V DNA replication as described in Materials and Methods Replication products were resolved on a 0. 7% agarose gel. The gel was phosphorimaged and the amount of AA V DNA replication was determined for each substrate at each time point and plotted

PAGE 121

A. B. C. T T T C G C G A T G C C G G C G C G C T C GGCCTCAGTG A GCG A GCG A GCGCGCAG ~ G A GGG A GC A CTCC A TC A CT A GGGGTT G C G G c ABE trs G C C G C G C G G C A A A 0.9 0 8 Q) 0 7 ca 0 6 Cl) .0 0 5 ::::, (/) "O 0 4 Q) ..x:: 0 0 3 z 0.2 0 1 0 0 0 200 400 600 800 1000 Rep68 (fmol) 200 180 C 160 0 140 a. 120 Q) a: 100 ----. z 0 80 ----60 40 20 0 0 20 40 60 80 100 120 Time (minutes ) MUTY WT MUTE MUTY WT MUTE ( 3 ) ( 5 ') 112

PAGE 122

APPENDIX ADDITONAL REP NICKING DATA

PAGE 123

(l) .... t't1 '.... Cl) .0 :::, Cl) i 0 z 0 7 0 6 0 5 0 4 0 3 0 2 0 1 0.0 0 ----50 100 150 200 250 NaCl Conc e ntration ( mM ) Figure 24. Affect of NaCl concentration on Rep trs nicking. Rep68 endonuclease rea c tions were performed on wt substrates under different NaCl concentrat i ons as described in Mater i als and Methods Products were resolved o n a 10 % denaturing polya c rylamide gel. The gel was phosphor i maged th e amo u nts of substrate and product were determined and the fraction of nicked substrate was plotted 114

PAGE 124

A. WT M4 MS M6 .,rirall 1,
PAGE 125

REFERENCES 1 Aboussekhra, A., M. Biggerstaff, M. K. Shivji, J. A. Vilpo, V. Moncollin, V. N. Podust, M. Protic, U. Hubscher, J. M. Egly, and R. D. Wood. 1995. Mammalian DNA nucleotide e x cision repair reconstituted with purified protein components. Cell 80:859-68. 2 Ashktorab H., and A. Srivastava. 1989. Identification of nuclear proteins that spe ci fically interact with adeno-associated virus type 2 inverted terminal repeat hairp i n DNA. J. Viral. 63:3034 9 3 Atchison, R. W., B. C. Casto and W. M. Hammon. 1966 Electron microscopy of adenovirus associat e d v i rus ( AAV) in cell cultures. Virology 29:353 7 4. Balague C., M Kalla and W.W. Zhang. 1997 Adena-associated virus Rep78 protein and term i nal repeats enhance integration of DNA sequences into the c ellular genome. J. Viral. 71 :3299-306. 5. Batchu, R. B., and P. L. Hermonat. 1995 Dissociation of conventional DNA binding and endonuclease activities by an adeno-associated virus Rep78 mutant. Biochem Biophys Res. Commun 210:717-25 6 Batchu, R. B., R. M. Kotin, and P. L Hermonat. 1994. The regulatory rep prote i n of adeno-associated virus binds to sequences within the c H-ras promoter Cancer Lett. 86:23-31. 7 Berns, K. I., and T. J. Kelly, Jr. 1974 Letter : Visualization of the inverted terminal repetition in adeno-associated virus DNA J Mol. Biol 82:267-71. 8 Bishop, B M., A. D. Santin, J. G. Quirk, and P. L. Hermonat. 1996. Role of the terminal repeat GAGC trimer the major Rep78 binding site in adeno associated virus DNA replication. FESS Lett 397:97-100 9 Bohenzky, R. A., R. B. LeFebvre and K. I. Berns. 1988 Sequence and symmetry r e quirements within the internal palindromic sequences of the adeno associated virus terminal repeat Virology 166:316-27. 1 0 Bork, P., and E. V. Koonln. 1993 An e x panding family of helicases within the DEAD / H superfamily. Nucleic Acids Res 21 :751-2 116

PAGE 126

117 11 Brister, J. R., and N. Muzyczka. 1999 Rep-mediated nicking of the adeno associated virus origin requires two b i ochemical activities DNA helicase activ i ty and transesterification. J Viral. 73:9325-36. 12. Carter, B. J., B A. Antoni, and D. F. Klessig. 1992 Adenovirus containing a deletion of the early region 2A gene allows growth of adeno-associated virus with decreased efficiency. Virology 191 :473-6. 13. Castellano, M. M., A. P. Sanz-Burgos, and C. Gutierrez. 1999. Initiation of DNA replication in a eukaryotic rolling-circle replicon : identification of mu l tiple DNA-protein complexes at the geminivirus origin. J. Mol. Biol. 290:639 52 14 Casto, B. C., R. W. Atchison, and W. M. Hammon. 1967. Studies on the relationship between adeno-associated virus type I (AA V-1) and adenoviruses. I. Replication of AAV-1 in certain cell cultures and its effect on helper adenovirus. Virology 32:52-9 15 Cavalier-Smith, T. 1974. Palindromic base sequences and replication of eukaryote chromosome ends. Nature 250:467-70 16 Chang, L. S., and T. Shenk. 1990. The adenovirus DNA-binding protein stimulates the rate of transcription directed by adenovirus and adeno-associated virus promoters. J Viral. 64:2103-9 17 Chang, L. S., Y. Shi, and T. Shenk. 1989. Adena-associated virus PS promoter contains an adenovirus E1 A-inducible element and a binding site for the major late transcription factor. J Viral. 63:3479-88 18. Chiarini, J. A., M. D. Weitzman, R. A. Owens, E. Urcelay, B. Safer, and R. M. Kotin. 1994. Biologically active Rep proteins of adeno-associated virus type 2 produced as fusion proteins i n Escherichia coli. J. Viral. 68:797-804. 19. Chiarini, J. A., S. M. Wiener, R. A. Owens, S. R. Kyostio, R. M. Kotin, and B. Safer. 1994. Sequence requirements for stable binding and function of Rep68 on the adeno-associated virus type 2 inverted terminal repeats J. Viral. 68:7448-57. 20. Christensen, J., S. F. Cotmore, and P. Tattersall. 1997. Parvovirus init i ation factor PIF: a novel human DNA-binding factor which coord i nately recognizes two ACGT motifs. J. Virol. 71 :5733-41. 21 Cotmore, S. F., J. Christensen, J. P. Nuesch, and P. Tattersall. 1995 The NS1 polypeptide of the murine parvovirus minute virus of mice binds to DNA sequences containing the motif [ACCA]2-3 J. Viral. 69:1652-60 22. Cotmore, S. F., and P. Tattersall. 1998 High-mobility group 1 / 2 proteins are essential for initiating rollingcircle-type DNA replication at a parvovirus ha i rpin origin. J. Virol. 72:8477-84.

PAGE 127

118 23 Davies, G. P ., P. Kemp, I. J. Molineux, and N. E. Murray. 1999 The DNA translocation and ATPase activities of restriction-deficient mutants of Eco Kl J Mal. Biol. 292:787 96. 24 Davis, M. D., R. S. Wonderling, S. L. Walker, and R. A. Owens. 1999. Analysis of the effects of charge cluster mutations in adeno-associated virus Rep68 protein in vitro J Viral. 73:2084-93. 25 Davis, M. D., J. Wu, and R. A. Owens. 2000. Mutational analysis of adeno associated virus type 2 Rep68 protein endonuclease activity on partially single stranded substrates J. Viral. 74:2936-42 26. Desblez, C., C. David, A. Mettouchi, J. Laufs, and B. Gronenborn. 1995. Rep protein of tomato yellow leaf curl geminivirus has an ATPase activity required for viral DNA replication [published erratum appears in Proc. Natl. Acad. Sci. USA 1995 Nov 21 ; 92(24):11322]. Proc. Natl. Acad Sci. USA 92:5640 4 27 Dobner, T., N. Horikoshi, S. Rubenwolf, and T. Shenk. 1996. Blockage by adenovirus E4orf6 of transcriptional activation by the p53 tumor suppressor. Science 272: 14 70-3. 28 Dubielzlg, R., J. A. King, S. Weger, A. Kern, and J. A. Klelnschmldt. 1999. 29. Adena-associated virus type 2 protein interactions : formation of pre encapsidation complexes J. Viral. 73:8989-98. Dyal I, J., P. Szabo, and K. I. Berns. 1999. Adena-associated virus (AA V) site specific integration: formation of AAV-AAVS1 junctions in an in vitro system. Proc. Natl. Acad Sci. USA 96: 12849-54. 30. Ellis, D. J., D. T. Dryden, T. Berge, J. M. Edwardson, and R. M. Henderson. 1999 Direct observation of DNA translocation and cleavage by the EcoKI endonuclease using atomic force microscopy. Nat. Struct. Biol. 6: 157 31 Ferrari, F. K., T. Samulski, T. Shenk, and R. J. Samulski. 1996. Second-strand synthesis is a rate-limiting step for efficient transduction by recombinant adeno associated virus vectors. J. Viral. 70:3227-34. 32 Garcia, L. R., and I. J. Mollneux. 1999. Translocation and specific cleavage of bacteriophage T7 DNA in vivo by EcoKI [In Process Citation]. Proc. Natl. Acad. Sci. USA 96:12430-5. 33 Hauswlrth, W.W., and K. I. Berns. 1977 Origin and termination of adeno associated virus DNA replication. Virology 78:488-99. 34 Hermonat, P. L. 1994. Down-regulation of the human c-fos and c-myc proto oncogene promoters by adeno-associated virus Rep78. Cancer Lett. 81 :129-36

PAGE 128

119 35. Hermonat, P. L., M.A. Labow, R. Wright, K. I. Berns, and N. Muzyczka. 1984 Genetics of adeno-associated virus: Isolation and preliminary characterization of adeno-associated virus type 2 mutants. J. Virol. 51 :329-39. 36. Hermonat, P. L., and N. Muzyczka. 1984. Use of adeno-associated virus as a mammalian DNA cloning vector : Transduction of neomycin resistance into mammalian tissue culture cells. Proc Natl. Acad. Sci USA 81 :6466-70. 37. Holscher, C., M. Horer, J. A. Kleinschmidt, H. Zentgraf, A. Burkle, and R. Heilbronn. 1994. Cell lines inducibly expressing the adeno-associated virus {AA V) rep gene: Requirements for productive replication of rep-negative AA V mutants. J Virol. 68:7169-77 38 Holscher, C., J. A. Kleinschmidt, and A. Burkle. 1995 High-level expression of adeno-associated virus (AAV) Rep78 or Rep68 protein is sufficient for infectious-particle formation by a rep negative AA V mutant. J Virol. 69:6880-5 39 Hong, G., P. Ward, and K. I. Berns. 1992 In vitro replication of adeno associated virus DNA. Proc Natl. Acad. Sci. USA 89:4673-7 40 Horer, M., S. Weger, K. Butz, F. Hoppe-Seyler, C. Geisen, and J. A. Kleinschmidt. 1995. Mutational analysis of adeno-associated virus Rep protein mediated inhibition of heterologous and homologous promoters. J Virol 69:5485-96. 41. llyina, T. V., and E. V. Koonin. 1992. Conserved sequence motifs in the initiator proteins for rolling circle DNA replication encoded by diverse replicons from eubacteria, eucaryotes and archaebacteria. Nucleic Acids Res. 20:3279-85. 42 Im, D. S., and N. Muzyczka. 1990. The AA V origin binding protein Rep68 is an ATP-dependent site specific endonuclease with DNA helicase activity. Cell 61 :447-57. 43 Im, D. S., and N. Muzyczka. 1992. Partial purification of adeno-associated virus Rep78, Rep52, and Rep40 and their biochemical characterization. J Virol. 66: 1119-28 44. Janik, J. E., M. M. Huston, K. Cho, and J. A. Rose. 1989 Efficient synthesis of adeno-associated virus structural proteins requires both adenovirus DNA binding protein and VA I RNA Virology 168:320-9. 45. Janik, J. E., M. M. Huston, and J. A. Rose. 1981 Locations of adenovirus genes required for the replication of adenovirus-associated virus Proc Natl. Acad. Sci. USA 78:1925 9

PAGE 129

120 46 Jin, R., X. Zhou, and R. P. Novick. 1996. The inactive pT181 initiator heterodimer, RepC / C binds but fails to induce melting of the plasmid replication origin. J Biol. Chem. 271:31086 91 47 Kettani, A., S. Bouaziz, A. Gorin, H. Zhao, R. A. Jones, and D. J. Patel. 1998 Solution structure of a Na cation stabilized DNA quadruplex containing G.G.G.G and G C.G.C tetrads formed by G-G-G C repeats observed in adeno-associated viral DNA J Mal. Biol. 282:619 36 48 Kokorina, N. A., A. D. Santin, C. Li, and P. L. Hermonat. 1998. Involvement of protein-DNA interaction in adeno-associated virus Rep78mediated inhibition of HIV-1 J. Hum Viral. 1 :441-50 49 Kyostio, S. R., R. A. Owens, M. D. Weitzman, B. A. Antoni, N. Chejanovsky, and B. J. Carter. 1994. Analysis of adeno-associated virus (AAV) wild-type and mutant Rep proteins for their abilities to negatively regulate AA V p5 and p19 mRNA levels J Viral. 68:2947-57. 50 Kyostlo, S. R., R. S. Wonderling, and R. A. Owens. 1995 Negative regulation of the adeno-associated virus (AA V) PS promoter involves both the PS rep binding site and the consensus ATP-binding motif of the AAV Rep68 protein J Viral. 69:6787-96 51 Laufs, J., W. Traut, F. Heyraud, V. Matzeit, S. G. Rogers, J. Schell, and B. Gronenborn. 1995. In vitro cleavage and joining at the viral origin of replication by the replication initiator protein of tomato yellow leaf curl virus. Proc. Natl. Acad. Sci. USA 92:3879-83 52 Lefebvre, R. B., S. Riva, and K. I. Berns. 1984. Conformation takes precedence over sequence in adeno associated virus DNA replication. Mal. Cell. Biol 4:1416-9 53. LI, Z., and N. Muzyczka. 1999. Unpublished Data 54. Mah, C., K. Qlng, B. Khuntirat, S. Ponnazhagan, X. S. Wang, D. M. Kube, M. C. Yoder, and A. Srivastava. 1998. Adena-associated virus type 2-mediated gene transfer: Role of epidermal growth factor receptor protein tyrosine kinase in transgene expression. J Viral. 72:9835-43. 55 McCarty, D. M., M. Christensen, and N. Muzyczka. 1991. Sequences required for coordinate induction of adeno-associated virus p19 and p40 promoters by Rep protein. J. Viral. 65:2936 45. 56 McCarty, D. M., T. H. NI, and N. Muzyczka. 1992. Analysis of mutations in adeno-associated virus Rep protein in vivo and in vitro J. Viral. 66:4050-7.

PAGE 130

121 57 McCarty, D. M., D. J. Pereira, I. Zolotukhln, X. Zhou, J. H. Ryan, and N. Muzyczka. 1994. Identification of linear DNA sequences that specifically bind the adeno-associated virus Rep prote i n. J. Virol. 68:4988-97 58 McCarty, D. M., J. H. Ryan, S. Zolotukhin, X. Zhou, and N. Muzyczka. 1994 Interaction of the adeno assoc i ated virus Rep protein with a sequence within the A palindrome of the viral term i nal repeat. J Virol. 68:4998-5006. 59. Mclaughlin, S. K., P. Collis, P. L. Hermonat, and N. Muzyczka. 1988. Adeno associated virus general transdu c t i on vectors : Analysis of proviral structures J Virol 62:1963-73 60 Moore, M., N. Horikoshi, and T. Shenk. 1996. Oncogenic potential of the adenovirus E4orf6 protein. Proc Natl. Acad Sci. USA 93: 11295-301 61. Ni, T. H., W. F. McDonald, I. Zolotukhin, T. Melendy, S. Waga, B. Stillman, and N. Muzyczka. 1998. Cellular proteins required for adeno-associated virus DNA replication in the absence of adenovirus coinfection J Virol. 72:2777-87. 62 Ni, T. H., X. Zhou, D. M. McCarty, I. Zolotukhin, and N. Muzyczka. 1994 In v i tro replication of adeno associated virus DNA. J Viral. 68:1128 38. 63 Noirot, P., J. Bargonetti, and R. P. Novick. 1990 Initiation of rolling-circle replication in pT181 plasmid : initiator protein enhances cruc i form extrusion at the origin. Proc Natl Acad. Sci. USA 87:8560 4 64 Nuesch, J. P., R. Corbau, P. Tattersall, and J. Rommelaere. 1998. Biochemical activities of minute virus of mice nonstructural protein NS1 are modulated In vitro by the phosphorylation state of the polypeptide J Virol. 72:8002-12 65. Nuesch, J. P ., S. Dettwller, R. Corbau, and J. Rommelaere. 1998. Replicative functions of minute virus of mice NS1 protein are regulated in vitro by phosphorylation through protein kinase C. J. Virol. 72:9966-77 66. Orozco, B. M., and L. Hanley-Bowdoin. 1996. A DNA structure is required for geminivirus replication origin function. J Virol. 70: 148-58. 67 Owens, R. A., M. D. Weitzman, S. R. Kyostlo, and B. J. Carter. 1993 Identification of a DNA-binding domain in the amino terminus of adeno associated virus Rep proteins. J Virol. 67:997-1005. 68 Pereira, D. J., D. M. McCarty, and N. Muzyczka. 1997 The adeno-associated virus (AA V) Rep protein acts as both a repressor and an activator to regulate AAV transcription during a productive infection J. Virol. 71:1079-88.

PAGE 131

122 69. Pereira, D. J., and N. Muzyczka. 1997. The cellular transcription factor SP1 and an unknown cellular protein are required to mediate Rep protein activation of the adeno-asso c iated virus p19 promoter. J. Viral. 71 :1747-56. 70 Qing, K., B. Khuntirat, C. Mah, D. M. Kube, X. S. Wang S. Ponnazhagan, S. Zhou, V. J. Dwarki, M. C. Yoder, and A. Srivastava. 1998. Adena-associated virus type 2 mediated gene transfer : correlation of tyrosine phosphorylation of th e ce llular single-stranded D sequence-binding protein with transgene e x press i on in human cells i n vitro and murine tissu e s in vivo J Viral. 72:1593 9. 71 Qing, K., X. S. Wang, D. M. Kube, S. Ponnazhagan A. Bajpal, and A. Srivastava. 1997. Role of tyrosine phosphorylation of a cellular protein in aden o assoc i ated virus 2-med i ated transgene e x pression. Proc Natl. Acad Sci. USA 94: 10879 84 72 Rapoza, N. P., and R. W. Atchinson. 1967 Association of AAV-1 with simian adenoviruses. Nature 215: 1186-7. 73 Redemann, B. E., E. Mendelson, and B. J. Carter. 1989 Adena-associated virus rep prote i n synthesis during productive infection. J Viral. 63:873-82. 74 Ren J., X. Qu, J. B. Chaires, J P. Trempe, S. S. Dignam, and J. D. Dignam. 1999 Spectral and physical characterization of the inverted terminal repeat DNA structure from adenoassociated virus 2 Nucleic Acids Res. 27:1985-90 75 Richardson, W. D., and H. Westphal. 1981 A cascade of adenovirus early functions is required for expression of adeno-associated virus Cell 27: 133-41. 76 Russell D. W., I. E. Alexander, and A. D. MIiier. 1995. DNA synthesis and topoisomerase inhibitors increase transduction by adeno-associated virus vectors. Proc. Natl Acad. Sci. USA 92:5719-23. 77. Ryan, J. H., S. Zolotukhin, and N. Muzyczka. 1996 Sequence requirements for binding of Rep68 to the adeno-associated virus terminal repeats. J. Viral. 70: 1542-53 78. Samulski, R. J., and T. Shenk. 1988. Adenovirus E1 B 55-Mr polypeptide facilitates timely cytoplasmic accumulation of adeno-associated virus mRNAs. J Viral 62:206 10 79 Samulski, R. J., A. Srivastava, K. I. Berns, and N. Muzyczka. 1983 Rescue of adeno-associated virus from recombinant plasmids : gene correction within the terminal repeats of AAV. Cell 33:135-43 80. Settlage, S. B., A. B. Miller, and L. Hanley-Bowdoin. 1996. Interactions between geminivirus replication proteins J Viral. 70:6790-5.

PAGE 132

81 Smith, R. H., and R. M. Kotin. 1998 The Rep52 gene product of adeno associated virus is a DNA helicase with 3' to-5' polarity J. Virol. 72:4874-81. 123 82. Smith, R. H., and R. M. Kotin. 2000 An adeno-associated virus (AA V) initiator protein Rep78, catalyzes the cleavage and ligation of single-stranded AAV ori DNA J. Virol. 74:3122-9 83. Smith, R. H., A. J. Spano, and R. M. Kotin. 1997. The Rep78 gene product of adeno-associated virus (AA V) self-associates to form a hexameric complex in the presence of AAV ori sequences. J Virol. 71 :4461-71 84 Snyder, R. 0., D. S. Im, and N. Muzyczka. 1990 Evidence for covalent attachment of the ad enc-associated virus (AA V) rep protein to the ends of the AAV genome J. Virol. 64:6204-13. 85. Snyder, R. 0., D. S. Im, T. Ni, X. Xiao, R. J. Samulski, and N. Muzyczka. 1993. Features of the adeno-associated virus origin involved in substrate recognition by the viral Rep protein J. Virol. 67:6096-104 86. Snyder, R. 0., R. J. Samulskl, and N. Muzyczka. 1990 In vitro resolution of covalently joined AA V chromosome ends. Cell 60: 105-13 87 Stanley, J. 1995. Analysis of African cassava mosaic virus recornbinants suggests strand nicking occurs within the conserved nonanucleotide motif during the initiation of rolling circle DNA replication Virology 206:707-12. 88. Straus, S. E., H. S. Ginsberg, and J. A. Rose. 1975. DNA-minus temperature sensitive mutants of adenovirus type 5 help adenovirus-associated virus replication. J. Virol. 17: 140-8 89 Surosky, R. T., M. Urabe, S. G. Godwin, S. A. McQulston, G. J. Kurtzman, K. Ozawa, and G. Natsoulis. 1997. Ade no associated virus Rep proteins target DNA sequences to a unique locus in the human genome. J. Virol. 71 :7951-9 90 Tratschln, J. D., I. L. MIiier, and B. J. Carter. 1984. Genetic analysis of adeno associated virus : properties of deletion mutants constructed in vitro and evidence for an adeno-associated virus replication function. J. Virol. 51 :611-9 91 Urabe, M., V. Hasuml, A. Kume, R. T. Surosky, G. J. Kurtzman, K. Toblta, and K. Ozawa. 1999. Charged-to-alanine scanning mutagenesis of the terrninal half of adeno-associated virus type 2 Rep78 protein. J. Virol. 73:2682 93. 92 Urcelay, E., P. Ward, S. M. Wiener, B. Safer, and R. M. Kotln. 1995. Asymmetric replication in vitro from a human sequence element is dependent on adeno-associated virus Rep protein. J. Virol. 69:2038-46.

PAGE 133

124 93. Walker, S. L., R. S. Wonderling, and R. A. Owens. 1997. Mutational analysis of the adeno-associated virus type 2 Rep68 protein helicase motifs. J. Viral. 71 :6996 7004. 94 Wang, P. Z., S. J. Projan, V. Henriquez, and R. P. Novick. 1993 Origin recognit i on specificity in pT181 plasmids is determined by a functionally asymmetric palindromic DNA element Embo J 12:45-52 95 Wang, X. S., K. Qing, S. Ponnazhagan, and A. Srivastava. 1997 Adena associated virus type 2 DNA replication in vivo : mutation analyses of the D sequence in viral inverted terminal repeats J Viral 71 :3077-82. 96. Wang, X. S., and A. Srivastava. 1998. Rescue and autonomous replication of adeno-associated virus type 2 genomes containing Rep-binding s i te mutations in the viral p5 promoter. J Viral. 72:4811-8. 97. Ward, P ., and K. I. Berns. 1995 Minimum origin requirements for linear duplex AA V DNA replication in vitro Virology 209:692-5. 98 Ward P., and K. I. Berns. 1996. In vitro replication of adeno-associated virus DNA : Enhancement by extracts from adenovirus-infected Hela cells J Viral. 70:4495-501 99 Ward, P., F. B. Dean, 0. D. ME, and K. I. Berns. 1998. Role of the adenovirus DNA-binding protein in in vitro adeno-associated virus DNA replication. J. Viral. 72:420-7 100 Ward, P., and R. M. Linden. 2000. A role for single-stranded templates in cell free adeno-associated virus DNA replication. J. Viral. 74:744-54 101. Ward, P., E. Urcelay, R. Kotin, B. Safer, and K. I. Berns. 1994. Adena associated virus DNA replication in vitro : Activation by a maltose binding protein / Rep 68 fusion protein. J Viral. 68:6029-37. 102. Weger, S., M. Wendland, J. A. Kleinschmidt, and R. Heilbronn. 1999. The adeno-associated virus type 2 regulatory proteins rep78 and rep68 interact with the transcriptional coactivator PC4 J. Viral. 73:260-9. 103. Weger, S., A. Wlstuba, D. Grimm, and J. A. Kleinschmidt. 1997 Control of adeno-associated virus type 2 cap gene expression: relative influence of helper virus, terminal repeats, and Rep proteins. J Viral. 71 :8437-47. 104 Weitzman, M. D., S. R. Kyostlo, B. J. Carter, and R. A. Owens. 1996. Interaction of wild type and mutant adeno associated virus (AAV) Rep proteins on AAV hairpin DNA. J Viral. 70:2440-8

PAGE 134

125 105. Weitzman, M. D., S. R. Kyostio, R. M. Kotin, and R. A. Owens. 1994 Adena associated virus (AA V) Rep proteins mediate complex formation between AA V DNA and its integration site in human DNA. Proc Natl. Acad. Sci. USA 91 :580812. 106 Wilson, G. M., H. K. Jindal, D. E. Yeung, W. Chen, and C. R. Astell. 1991 Expression of minute virus of mice major nonstructural protein in insect cells: Purification and identification of ATPase and helicase activities. Virology 185:908 107 Wonderling, R. S., S. R. Kyostio, S. L. Walker, and R. A. Owens. 1997. The Rep68 protein of adeno associated virus type 2 increases RNA levels from the human cytomegalovirus major immediate early promoter. Virology 236:167-76 108 Wonderling, R. S., and R. A. Owens. 1996 The Rep68 protein of adeno associated virus type 2 stimulates expression of the platelet-derived growth factor B c sis proto-oncogene [published erratum appears in J. Viral. 1996 Dec;70(12):9084]. J. Viral. 70:4783-6. 109. Wu, J., M. D. Davis, and R. A. Owens. 1999. Factors affecting the terminal resolution site endonuclease, helicase, and ATPase activities of adeno associated virus type 2 Rep proteins. J Viral. 73:8235-44. 110. Yakinoglu, A. 0., R. Heilbronn, A. Burkle, J. R. Schlehofer, and H. zur Hausen. 1988. DNA amplification of adeno-associated virus as a response to cellular genotoxic stress Cancer Res 48:3123-9. 111 Yakobson, B., T. A. Hrynko, M. J. Peak, and E. Winocour. 1989. Replication of adeno-associated virus in cells irradiated with UV light at 254 nm J Viral. 63: 1023-30 112. Yakobson, B., T. Koch, and E. Wlnocour. 1987. Replication of adeno associated virus in synchronized cells without the addition of a helper virus. J. Viral. 61 :972-81. 113 Yang, Q., F. Chen, and J. P. Trempe. 1994. Characterization of cell lines that inducibly express the adenoassociated virus Rep proteins. J. Viral. 68:4847-56 114 Yang, Q., and J. P. Trempe. 1993. Analysis of the terminal repeat bind i ng abilities of mutant adenoassociated virus replication proteins. J. Viral. 67:44427. 115. Zhang, G., E. Gibbs, Z. Kelman, M. O'Donnell, and J. Hurwitz. 1999. Studies on the interactions between human replication factor C and human proliferating cell nuclear antigen. Proc. Natl. Acad. Sci. USA 96:1869-74.

PAGE 135

116. Zhao, A. C., R. A. Ansari, M. C. Schmidt, and S. A. Khan. 1998. An oligonucleotide inhibits oligomerization of a rolling circle initiator protein at the pT181 origin of repli c ation J. Biol. Chem. 273: 16082-9. 117. Zhou, X., I. Zolotukhln, D. S. Im, and N. Muzyczka. 1999 Biochemical characterization of adeno-associated virus rep68 DNA helicase and ATPase activities J Viral. 73:1580-90 126

PAGE 136

BIOGRAPHICAL SKETCH Jam e s Rodney Brister II was born in Dallas Texas on January 22 1966. After his parents divorced Rodney moved with hi s mother and s i ster to Washington D.C. Rodney attended high school at St. Anselm s S c hool in Washington D C and the Loomis-Chaffee School in Windsor Connecticut Rodney then attended Skidmore College in Saratoga Springs New York where he earned a B.A in biology and chemistry in June 1988. He then attended Emory University where he received an M.S. in biology in June 1991. Rodney worked for several years at the National Institutes of Health before matriculat i ng at the University of Florida in1994. 127

PAGE 137

I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate in scope and quality as a dissertation for the degree of Doctor of Philosophy Nicholas Muzyczka, Ch American Cancer Society E M Koger Eminent Scholar I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy ~JJ. 2 ~mes B. Flanegan Professor of Bioche 1stry and Molecular Biology I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate i scope and quality, as a dissertation for the degree of Doctor of Philo h~ ( Alfred L in Professor of Molecular Genetics and Microbiology I certify that I have read this study and that in my opinion it co fo s to acceptable standards of scholarly presentation and is fully adequate in s ope and quality, as a dissertation for the degree of Doctor of Philosophy Richard W. Moyer Professor of Molecu ar enetics and Microbiology I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality as a dissertation for the degree of Doctor of P ~h~-------i Thomas C. R e Associate Professor of Pharmacology and Therapeutics

PAGE 138

, This dissertation was submitted to the Graduate Faculty of the College of Medicine and to the Graduate School and was accepted as partial fulfillment of the requirements for the degree of Doctor of Philosophy. December 2000 College of Medicine .... /4 Dean, Graduate School ,l I

PAGE 139

UNIVERSITY OF FLORIDA II I II 11111 1 1111 1 111 1 111 1 111 1 1 1 11 1 111 1 1111 1 11111 11 1111 1 11 1 111111 1 3 1262 08554 6389


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID ENQ37CBMO_79B7W4 INGEST_TIME 2012-12-07T20:25:31Z PACKAGE AA00012896_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES