Citation
The role of subcellular compartments and structures in eukaryotic gene expression

Material Information

Title:
The role of subcellular compartments and structures in eukaryotic gene expression
Creator:
Zambetti, Gerard Paul, 1958-
Publication Date:
Language:
English
Physical Description:
xii, 219 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Cells ( jstor )
Cytochalasins ( jstor )
Cytoskeleton ( jstor )
DNA ( jstor )
Hela cells ( jstor )
Histones ( jstor )
Messenger RNA ( jstor )
Polyribosomes ( jstor )
RNA ( jstor )
Signals ( jstor )
Gene Expression Regulation ( mesh )
RNA, Messenger ( mesh )
Transcription, Genetic ( mesh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1989.
Bibliography:
Includes bibliographical references (leaves 206-218).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Gerard Paul Zambetti.

Record Information

Source Institution:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Resource Identifier:
22253045 ( OCLC )
ocm22253045
0025463579 ( ALEPH )

Downloads

This item has the following downloads:


Full Text














THE ROLE OF SUBCELLULAR COMPARTMENTS AND STRUCTURES
IN EUKARYOTIC GENE EXPRESSION












By

GERARD PAUL ZAMBETTI


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA
1989















ACKNOWLEDGEMENTS

I would like to acknowledge the dedication of Drs.

Janet and Gary Stein to their work. Their commitment to

science has provided us with a well-equipped lab and the

funds to pursue our research. I would also like to extend

special thanks to the Stein's for their constant support and

guidance during my graduate studies. In addition, I would

like to thank Drs. Bert Flanegan, Tom Rowe and Dick Moyer

for their helpful advice as members of my graduate

committee.

My experiences with my fellow coworkers in the Stein's

lab have been very interesting, rewarding and fulfilling. I

would like to acknowledge and thank Marie Giorgio, Linda

Green, Farhad Marashi, Brian O'Donnell and Mary Beth Kennedy

for their technical guidance and assistance, and Ken Wright

and Joe Teixeira for their help dealing with the computers.

I thank Pat Naples for her appreciation and pledge of care

for "the coffee mug." I would like to thank Dave Collart,

Tim Morris and Charles Stewart for their friendship and for

their advice on raising bees, fishing, and golfing,

respectively. I would like to thank Andre van Wijnen for his

friendship, scientific expertise on and off the "Foos" ball

field, and for keeping an eye on Pat Naples and my coffee









mug. I would particularly like to thank the following

individuals for their tremendous inspiration: April, Emilie,

Ashley, Danny, Shannon, John, Aubrey, Stephan, Alan, Brooke,

Kate, Sarah and Nikki.

I would like to thank the members of the Department of

Immunology and Medical Microbiology. I will always remember

the football games in which Dr. Ed Siden led our team to an

undefeated record against the Pathology team starring Dr.

Ward Wakeland, and the late night "Nerf-ball" baseball games

in the hallway with Mark Labow, Paul Hermonat, Brian Masters

and Dick Wright.

Lastly, I would like to thank my family. The Lord has

truly blessed me with a loving and supportive family and I

fully appreciate all that they have done and sacrificed for

me during my studies.


iii















TABLE OF CONTENTS


PAGE

ACKNOWLEDGEMENTS........................................ ii

LIST Of FIGURES... ...................................... vi

LIST OF TABLES................................. .......... ix

KEY TO ABBREVIATIONS .....................................

ABSTRACT........................ .......................... xi

CHAPTERS

1) INTRODUCTION
General Background.. .............................. 1
Histone Genes and Proteins.......................... 2
Histone Gene Regulation: Transcriptional and Post-
Transcriptional Control........................ 3
Subcellular Compartments........................... 10
The Cytoskeleton: Microtubules, Intermediate
Filaments and Microfilaments........................ 12
Cytoskeletal-mRNA Interactions..................... 16
Nonmembrane-Bound and Membrane-Bound Polyribosomes:
The Signal Hypothesis........................... 19
Overview of Project............................... 22

2) GENERAL METHODS

Conditions for Enzyme Reactions.................... 28
Mammalian Cell Culture............................ 28
Plasmid DNA....................................... 30
DNA Isolation and Purification.................... 35
Isolation of Mammalian RNA........................ 40
Two-Dimensional Gel Electrophoresis and Immuno-
Blotting Analysis................................ 48
Northern Blot Analysis............................. 49
Sl Nuclease Protection Analysis.................... 52
In Vitro Nuclear Run-on Transcription Analysis..... 55
Radiolabeling DNA for Northern Blot Analysis....... 58
Site-Directed Mutagenesis.......................... 61
Transfection of DNA into Cells..................... 71
Establishment of Polyclonal and Monoclonal Stably
Transformed Cell Lines........................... 73









3) SUBCELLULAR LOCATION OF HISTONE mRNAs ON CYTOSKELETON
ASSOCIATED NONMEMBRANE-BOUND POLYSOMES IN HELA S3
CELLS
Introduction..... .................................... 75
Results.............................. .. ....... .... 77
Discussion............ .. ............ ............. 90

4) SUBCELLULAR LOCATION OF HISTONE mRNA PLAYS A ROLE IN
THE POSTTRANSCRIPTIONAL REGULATION OF HISTONE
GENE EXPRESSION
Introduction....................................... 96
Results ........ ................................ 97
Discussion.... ........ ......... .... .............. 126

5) DIFFERENTIAL ASSOCIATION OF MEMBRANE-BOUND AND
NONMEMBRANE-BOUND POLYSOMES WITH CELL CYTOSTRUCTURE
Introduction..................................... 130
Results............ ............. .................. 131
Discussion......................................... 146

6) HETEROGENEOUS PATTERN FOR CYTOSKELETAL-mRNA
INTERACTIONS
Introduction. ..................................... 153
Results........................................... 154
Discussion ........................................ 166

7) THE INFLUENCE OF THE CYTOSKELETON ON THE REGULATION
OF c-Fos GENE EXPRESSION
Introduction. .................. ................... 168
Results................. .......................... 171
Discussion ......................... ................ 190

8) SUMMARY AND FUTURE CONSIDERATIONS..................... 196

REFERENCES.............................................. 206

BIOGRAPHICAL SKETCH..................................... 219















LIST OF FIGURES


Figure Page

2-1 Outline of the cloning scheme for the construction of
the signal peptide-histone fusion gene............... 34

2-2 Outline of procedure for the isolation of subcellular
polysomal fractions................................. 45

3-1 Northern blot analysis of H3 histone, H4 histone and
HLA-B7 mRNA in subcellular fractions................. 81

3-2 Two-dimensional gel electrophoresis of cytoskeleton
and soluble associated proteins...................... 85

3-3 Northern blot analysis of H3 histone, H4 histone and
HLA-B7 mRNAs isolated from subcellular fractions of
cells treated with metabolic inhibitors.............. 89

3-4 Northern blot analysis of H3 histone, H4 histone and
HLA-B7 mRNAs associated with the cytoskeleton and
soluble fractions from HeLa cells treated with
metabolic inhibitors................................ 92

4-1 Schematic diagram of endogenous H3 histone mRNA ST519
and the beta-lactamase signal peptide-H3 histone
fusion mRNA ........................................ 100

4-2 Expression of the signal peptide-histone fusion gene
in HeLa cells....................................... 103

4-3 The subcellular localization of the signal peptide-
histone fusion mRNA................................. 106

4-4 The stability of the signal peptide-histone fusion
mRNA following inhibition of DNA synthesis.......... 109

4-5 Schematic diagram of wild type and mutated signal
peptide-histone fusion mRNAs....................... 112

4-6 Distribution of SPH3E1, SPH3Elalpha, and SPH3E1ATG
mRNAs in nonmembrane-bound and membrane-bound
polysomal fractions................................. 115

4-7 Effects of hydroxyurea treatment on SPH3E1 mRNA...... 119

vi















4-8 Effects of hydroxyurea treatment on SPH3E1ATG
mRNA ................................................. 121

4-9 Effects of hydroxyurea treatment on SPH3Elalpha
mRNA ................................................. 123

4-10 Quantitation of SPH3E1, SPH3Elalpha, SPH3E1ATG
mRNA during hydroxyurea treatment.................. 125

5-1 Northern blot analysis of the cytoskeleton and
soluble phase distribution of H3 histone, H4 histone
and HLA-B7 mRNAs in cytochalasin D treated cells.... 135

5-2 Northern blot analysis of the cytoskeleton and
soluble phase distribution of c-fos mRNA in
cytochalasin D, puromycin, CD/puro, and
CD/cycloheximide treated cells ..................... 140

5-3 Northern blot analysis of the cytoskeleton and
soluble phase distribution of nonmembrane-bound
and membrane bound polysomal mRNAs in cytochalasin D,
puromycin, CD/puro and CD/cycloheximide treated
cells................................................ 145

6-1 Cytochalasin D and puromycin cotreatment does not
release SPH3E1 or SPH3E1ATG- mRNA from the
cytoskeleton........................................ 157

6-2 The wild type signal peptide-histone fusion mRNA is
not released from the cytoskeleton in CD and
puromycin cotreated polyclonal HeLa cell cultures... 161

6-3 Endogenous membrane-bound polysomal mRNAs are
released from the cytoskeleton during cotreatment
with CD and puromycin in SPH3E1 and SPH3E1ATG-
expressing cell cultures........................... 163

7-1 Effects of cytochalasin D and puromycin treatment on
steady state levels of c-fos and chorionic
gonadotropin mRNA................................... 175

7-2 Densitometric analysis of steady state levels of
c-fos mRNA during cytochalasin D and puromycin
treatments......................................... 177


vii















7-3 Time course of c-fos mRNA accumulation during
cytochalasin D and puromycin treatments in
exponentially growing HeLa cells................... 181

7-4 Effect of cytochalasin D on transcription of c-fos
in HeLa cells...................................... 184

7-5 Effect of protein synthesis inhibition on
cytochalasin D induction of c-fos transcription in
HeLa cells........................... .... .............. 188


viii















LIST OF TABLES
Table Page

3-1 Quantity of histone and HLA-B7 mRNAs in the
subcellular fractions.................................. 82

4-1 QuAntitation of SPH3E1, SPH3Elalpha and SPH3E1ATG
mRNA in nonmembrane-bound and membrane-bound
polysome fractions ........ ....... ...... ............ 116

5-1 The percent of cytoskeleton and soluble phase
associated mRNAs in cells treated with
cytochalasin D..................................... 136

5-2 Percent distribution of nonmembrane-bound and
membrane bound polysomal RNAs in the Csk and Sol
fractions from CD, Puro, CD/puromycin and
CD/cycloheximide treated cells...................... 141

6-1 The percent of cytoskeleton associated mRNAs
isolated from cytochalasin D, puromycin and
CD/puromycin treated cells.......................... 158















KEY TO ABBREVIATIONS

BSA Bovine Serum Albumin

cpm Counts per minute

dCTP Deoxycytidine-5'-triphosphate

ddCTP Dideoxycytidine-5'-triphosphate

DNA Deoxyribonucleic acid

DNase Deoxyribonuclease

DTT Dithiothreitol

EDTA Ethylenediaminetetraacetic acid

Hepes N-2 hydroxyethyl piperazine-N'-2
ethanesulfonic acid

HU Hydroxyurea

MCi Microcurie

Mg Microgram

Al Microliter

Am Micrometer

AM Micromolar

OD Optical density

PVS Polyvinyl sulfate

RNA Ribonucleic acid

rpm Revolutions per minute

SDS Sodium dodecylsulfate

SSC Standard saline citrate buffer

Tris (hydroxymethyl)aminomethane

x















Abstract of Dissertation Presented to the Graduate School of the
University of Florida in Partial Fulfillment of the Requirements
for the Degree of Doctor of Philosophy


THE ROLE OF SUBCELLULAR COMPARTMENTS AND STRUCTURES
IN EUKARYOTIC GENE EXPRESSION

By

Gerard Paul Zambetti

December 1989


Chairperson: Janet Stein
Major Department: Immunology and Medical Microbiology


Histone mRNAs naturally reside on nonmembrane-bound

polysomes that are associated with the cytoskeleton. To

study whether the subcellular location plays a role in the

coupling of histone mRNA stability to DNA synthesis, a

signal peptide-histone fusion gene was constructed that

encodes a histone mRNA that is directed to membrane-bound

polysomes. The signal peptide-histone fusion mRNA when

localized in the foreign subcellular compartment is no

longer destabilized when DNA synthesis is inhibited. A

single nucleotide substitution in the signal peptide-histone

fusion gene by site-directed mutagenesis resulted in the

localization of the histone fusion mRNA on nonmembrane-bound

polysomes and restored the coupling of mRNA stability with









DNA synthesis. These results indicate that the subcellular

location of histone mRNA plays an important role in the

posttranscriptional regulation of histone gene expression.

We have determined that the association of histone mRNA

with the cytoskeleton is dependent on the integrity of actin

filaments. Disruption of the microfilaments with

cytochalasin D efficiently released histone mRNA from the

cytoskeleton into the soluble phase. In contrast, membrane-

bound polysomal mRNAs remained attached to the cytoskeleton

during cytochalasin D treatment. Subsequent studies have

demonstrated that membrane-bound polysomal mRNAs are

attached to the cytoskeleton at two different sites: 1) a

cytochalasin D sensitive site and 2) a puromycin sensitive

site.

Disruption of the cytoskeleton with cytochalasin D

resulted in a rapid and marked stimulation in transcription

of the c-fos proto-oncogene and an increase in c-fos mRNA

cellular levels. Transcription of several other genes was

unaffected by the cytochalasin D treatment. These results

suggest that the nucleus can respond to the structural

organization of the cytoskeleton and selectively adjust the

regulation of gene expression accordingly.


xii















CHAPTER 1

INTRODUCTION



General Background

Histones are small basic proteins that are involved in

the packaging of eukaryotic DNA into chromatin. It is

estimated that more than 2 meters of DNA are contained

within the limited area of the nucleus. The condensation of

the DNA to such a great extent is due primarily to its

interactions with the histone proteins. In addition to their

structural properties histones play a functional role in

controlling gene transcription. The way in which the histone

proteins are arranged along a region of DNA appears to

affect the transcriptional properties of that DNA domain.

The complex nature of the regulation of histone protein

synthesis at the transcriptional, posttranscriptional, and

posttranslational levels makes these genes an important

model for studying eukaryotic gene expression. However, one

of the most important reasons for studying the regulation of

histone gene expression is that the synthesis of the

majority of histone proteins (cell cycle dependent histones)

occurs during DNA replication. Elucidation of the mechanisms

coupling histone protein synthesis with DNA synthesis may











yield a better understanding of the processes controlling

proliferation, differentiation, cell aging and neoplasia.



Histone Genes and Proteins

There are five major classes of histone proteins (H4,

H2B, HIA, H3, and H1) ranging in molecular weight from

11,000 to 21,000 Daltons. They are basic proteins that have

been highly conserved throughout evolution. For example,

there are only two amino acids out of 102 which differ

between histone H4 from pea seedlings and calf thymus, which

suggests a critical role for these proteins in cell survival

(DeLange et al., 1969). The histone proteins are encoded by

a family of moderately repeated genes (Wilson and Melli,

1977; Kedes, 1979). In humans, the histone genes are

arranged in clusters that are not organized in simple tandem

repeats as found in the sea urchin and other lower

eukaryotic genomes (Heintz et al., 1981; Sierra et al.,

1982; Carozzi et al., 1984). The clusters are localized on

chromosomes 1, 6, and 12 and are interspersed with

repetitive elements (Green et al., 1984b; Collart et al.,

1985). It has been speculated that these repetitive elements

may play a role in recombination and gene duplication during

the evolution of this multi-gene family. The general

structure of the human histone genes is less complex than

many other eukaryotic genes since the histone protein coding

region is not interrupted by introns and the encoded mRNAs











are not polyadenylated (Adensik and Darnell, 1972). However,

the genes coding for histone proteins that are synthesized

in the absence of DNA synthesis (cell cycle independent

histones) generally contain introns and code for mRNAs that

are poly-adenylated (Engel et al., 1982; Harvey et al.,

1983; rush et al., 1985; Wells and Kedes, 1985). Subsequent

discussions will generalize what is true only for the cell

cycle dependent histones unless otherwise indicated.



Histone Gene Requlation: Transcriptional and Post-
Transcriptional Control


The stringent requirement to package newly replicated

DNA into chromatin, the invariable 1:1 molar ratio of

histone protein to DNA and the inability of most eukaryotic

cells to store unbound histone proteins implies a temporal

and functional coupling of histone protein synthesis with

DNA replication (Prescott, 1966; Allfrey et al., 1963).

Support for this hypothesis first came from studies on

synchronized cell cultures of Euplotes eurystomus in which

the synthesis of histone protein was found to occur only

during the S phase of the cell cycle, the time when DNA

replication takes place (Prescott, 1966). Furthermore, the

quantity of histone protein within the cell doubled during S

phase. The temporal coupling of histone protein synthesis

with DNA synthesis has since been confirmed and well

documented by a variety of direct experimental approaches











(Robbins and Borun, 1967; Spaulding et al., 1966; Stein and

Borun, 1972). In vitro translation studies using polysomal

RNA isolated from cells at various stages of the cell cycle

indicated that the histone mRNA was present exclusively

during S phase (Spalding et al., 1966; Gallwitz and Mueller,

1969; Jacobs-Lorena et al., 1972; Gallwitz and Briendl,

1972; Perry and Kelley, 1973; Borun et al., 1975).

Quantitation of histone mRNA content during the cell cycle

by Northern blot analysis, using radiolabeled histone cDNA

and genomic clones, demonstrated that histone mRNA steady

levels closely parallel the rates of histone protein

synthesis as well as the rates of DNA replication (Heintz et

al., 1983; Plumb et al., 1983a; Baumbach et al., 1984). The

timing of histone protein synthesis during DNA synthesis is

not coincidental and represents a functional relationship

between these two processes. This is supported by the

following observations: 1) there is a coordinate induction

of histone protein synthesis and DNA synthesis during

stimulation of quiescent cells to proliferate (DeLisle et

al., 1983; Green et al., 1984a); 2) inhibition of DNA

synthesis with compounds such as hydroxyurea or cytosine

arabinoside results in a loss of histone mRNA with a

concomitant decrease in histone protein synthesis (Breindl

and Gallwitz, 1973; Butler and Mueller, 1973; Borun et al.,

1975; Baumbach et al., 1984) and 3) terminal differentiation

is marked by a down regulation in histone protein synthesis











in conjunction with the decrease in proliferative activity

(Bird et al., 1985; Challoner et al., 1989; Stein et al.,

1989).

The expression of histone genes during the cell cycle

is regulated at both the transcriptional and

posttranscriptional levels. Analysis by hybrid selection of

RNA radiolabeled in synchronized HeLa cells demonstrates a

burst of 3- to 5- fold in transcription of the histone genes

within the first two hours of S phase, followed by a

reduction to a basal level that remains constant until the

following S phase (Plumb et al., 1983a). Similar results

were obtained when histone gene transcription during the

cell cycle was measured by nuclear run-on analysis (Sive et

al., 1984; Baumbach et al., 1987). Steady state levels of

histone mRNA, however, were elevated 15-20 fold during S

phase and closely paralleled the rates of DNA synthesis

(Plumb et al., 1983a; Heintz et al., 1983; Baumbach et al.,

1984). Maximal accumulation of histone mRNA occurred at 5

hours into S phase and returned to a basal level as DNA

synthesis ended. The timing and extent of the increase in

histone transcription can not account for the marked

increase in histone mRNA steady state levels and must be a

consequence of a posttranscriptional control mechanism.

Posttranscriptional regulation of histone gene expression is

further supported by DNA synthesis inhibitor studies. The

estimated half life of histone mRNA in exponentially growing











HeLa cells is 45-60 minutes (Sittman et al., 1983; Plumb et

al., 1983). Hydroxyurea, or any other compound or treatment

that inhibits DNA synthesis studied to date, results in a

rapid and selective destabilization of histone mRNA (half

life of 10-15 minutes) with little or no effect on histone

gene transcription (Sittman et al., 1983; Plumb et al.,

1983; Baumbach et al., 1987).

A long-standing observation concerning histone mRNA

turnover during inhibition of DNA synthesis is that the

mechanism is completely dependent on protein synthesis

(Butler and Mueller, 1973; Gallwitz, 1975; Stahl and

Gallwitz, 1977; Stimac et al., 1983; Baumbach et al., 1984;

Helms et al., 1984). Pretreatment of cells with inhibitors

of protein synthesis such as high salt, cycloheximide or

puromycin followed by the addition of a DNA synthesis

inhibitor prevents the destabilization of histone mRNAs and

actually results in an increase in their steady state levels

due to the continued transcription of the histone genes.

This observation led Butler and Mueller and others to

hypothesize that the histone proteins can autoregulate their

own synthesis through a feedback loop operative at the

posttranscriptional level (Butler and Mueller, 1973; Stein

and Stein, 1984; Wu and Bonner, 1985). The model predicts

that at the natural end of S phase or when DNA synthesis is

interrupted with inhibitors a transient accumulation of

unbound histone protein may arise due to a loss in high-











affinity binding sites for the newly synthesized histone

proteins. Unbound histone protein may then interact with

histone mRNA-containing polysomes resulting in a

conformational change in the mRNA that is more accessible to

ribonuclease. Growing support for this model comes from a

cell-free mRNA decay system in which the destabilization of

histone mRNA is accelerated when incubated in the presence

of histone proteins (Peltz and Ross, 1987). This result

appears to be specific for histone mRNA since the rates of

decay for gamma globin mRNA, c-myc mRNA, total poly(A)" RNA

or total poly(A)+ RNA are unaffected by the presence of

histone proteins.

Gene transfer studies demonstrated that the minimal

sequence necessary for coupling histone mRNA stability with

DNA replication lies within the 3' terminus of the mRNA

(Stauber et al., 1986; Levine et al., 1987; Pandey and

Marzluff, 1987). Removal of only 60 nucleotides from the 3'

end of a murine H3 histone mRNA releases the mutant mRNA

from destabilization during inhibition of DNA synthesis

(Levine et al., 1987). Conversely, the last 30 nucleotides

of histone H3 mRNA when fused to the 3' end of human gamma

globin mRNA are sufficient to confer instability to the

chimeric mRNA when DNA synthesis is inhibited, whereas wild

type gamma globin mRNA remains stable (Pandey and Marzluff,

1987). Contained within the minimal target sequence for

destabilization is a stem-loop structure which is common to











all known cell cycle dependent histone mRNAs (Hentschel and

Birnstiel, 1981). The presence of the stem-loop structure is

not sufficient by itself to couple mRNA stability with DNA

replication. The target sequences must be present in the

proper position at the 3' terminus of the mRNA to be

operative. Aberrant histone mRNA transcripts containing the

target sequences at an internal position are fully stable

during the inhibition of DNA synthesis (Alterman et al.

1985; Luscher et al., 1985; Pandey and Marzluff, 1987;

Levine et al., 1987). Furthermore, moving the stem-loop

structure 380 nucleotides downstream from the translation

stop codon abolishes the coupling of histone mRNA stability

with DNA replication despite the retention of the stem loop

structure at the 3'terminus (Graves et al., 1987).

An additional constraint on the histone

posttranscriptional regulatory mechanism is that translation

must proceed to within close proximity of the natural

termination codon for destabilization to occur during

inhibition of DNA synthesis (Graves et al., 1987). Frame-

shift mutations in histone mRNA resulting in the premature

termination of translation more than 300 nucleotides from

the 3' terminus stabilize the messenger RNA when DNA

synthesis is interrupted (Graves et al., 1987). Other frame-

shift mutants that allow translation to continue past the

natural UGA stop codon into the 3' untranslated region are

also stable when DNA synthesis is inhibited (Capasso et al.,











1987). Correcting for translation read through in these

mutants by inserting stop codons in all three reading frames

at the natural translation termination site restores the

coupling of mRNA stability to DNA replication.

Detailed studies on deletion mutants suggest that the

histone nascent polypeptide is not involved in the

posttranscriptional regulatory process (Capasso et al.,

1987). Systematic removal of approximately 100 nucleotide

blocks spanning nearly the entire protein coding region had

no effect on the destabilization of these mutant histone

mRNAs when DNA synthesis was inhibited. Consistent with this

result, the deletion of the ATG translation start codon

which prevents the synthesis of histone protein did not

prevent the destabilization of the mRNA during inhibition of

DNA replication. Furthermore, as discussed above, the

minimal target sequences containing the stem-loop structure

confer instability to gamma globin mRNA when DNA synthesis

is interrupted (Pandey and Marzluff, 1987). The globin-

histone chimeric mRNA, although regulated as wild type

histone mRNA, does not encode any histone protein sequences.

Destabilization of histone mRNA appears to occur in a

stepwise manner initiating at the 3' terminus (Ross et al.

1986). The first detectable histone mRNA degradation product

lacks 5 nucleotides from the 3' terminus (Ross and Kobs,

1986; Ross et al., 1986). This degradation product is

detectable in the in vitro mRNA decay system as well as in









10

whole cells (Ross et al., 1986). It is unclear whether this

product arises from a single endonucleolytic scission or

from multiple cuts removing one or more of the nucleotides

at a time. Degradation continues rapidly in a 3' to 5'

direction carried out by an exonuclease which is part of the

ribosome complex (Ross et al., 1987). These results are

consistent with the requirement for translation to proceed

near the 3' terminus for the destabilization of the histone

mRNA during inhibition of DNA synthesis.



Subcellular Compartments

The appearance of histone mRNA on polysomes within

minutes after transcription and the equally rapid transfer

of the newly synthesized histone proteins into the nucleus

where they complex with DNA imply that histone protein

synthesis may be compartmentalized in a region located just

outside the nucleus (Spaulding et al., 1966; Borun et al.,

1967; Robbins and Borun, 1967). The asymmetric distribution

of eukaryotic mRNAs in the cytoplasm supports this

possibility. Morphological studies initially demonstrated

that polyribosomes are concentrated in areas surrounding the

nucleus in mouse 3T3 cells (Fulton et al., 1980). Later,

localization of specific mRNAs by in situ hybridization

techniques provided direct evidence that mRNAs are

differentially distributed throughout the cell. Tubulin mRNA

is preferentially located in the periphery of the cytoplasm









11

whereas vimentin mRNA is concentrated in perinuclear regions

in chick myoblast and fibroblast cells (Lawrence and Singer,

1986). Furthermore, actin mRNA is concentrated in the

lamellipodia, structures involved in cell locomotion

(Lawrence and Singer, 1986). The requirement for actin

protein in the lamellipodia during cell movement (Wang,

1984) suggests a functional relationship between where the

mRNA is localized and where the encoded protein is needed

(Lawrence and Singer, 1986).

Localization of mRNAs in distinct areas of the

cytoplasm may occur due to an association of the mRNA with

an underlying structure. This structure could serve as an

anchor to concentrate mRNAs in particular regions of the

cytoplasm. Consistent with this reasoning is the existence

of a complex, proteinaceous structure in the cytoplasm of

most eukaryotic cells that is referred to as the

cytoskeleton. The cytoskeleton plays a role in cell shape,

cell motility and the intracellular transport of

macromolecules and organelles (Clarke and Spudich, 1977;

Goldman et al., 1978; and reviewed in Nielsen et al., 1983).

In addition, there is growing support for the hypothesis

that the cytoskeleton plays a key role in regulating the

translation process (Lenk et al., 1977; Lenk and Penman,

1979; Fulton et al., 1980; Cervera et al., 1981; van Verooij

et al., 1981; Nielsen et al., 1983; Howe and Hershey, 1984).











The Cytoskeleton: Microtubules. Intermediate Filaments
and Microfilaments


The cytoskeleton structure is an interconnected system

of three major classes of protein fibers, namely the

microtubules, intermediate filaments and microfilaments.

Each system represents a heterogenous population of

proteins. The microtubules, for example, are composed of 13

protofilaments of the well characterized alpha and beta

tubulin proteins (Amos and Klug, 1974). These filaments are

25 nm in diameter and appear to contain a hollow core.

Several microtubule associated proteins (MAPs) have also

been identified which appear to facilitate the assembly of

the microtubules and promote their interactions with other

cellular organelles (Sloboda et al., 1976, Bulinski and

Borisy, 1980; Bloom et al., 1984; Binder et al., 1985). It

has long been recognized that in mitotic cells the

microtubules reorganize into the mitotic spindle including

the astral, kinetochore and continuous fibers which mediate

the segregation of the chromosomes (Weber et al., 1975).

During interphase the role of the microtubules is less clear

and somewhat controversial. Studies on agents that cause the

depolymerization of the microtubules, such as colchicine and

colcemid, suggest that the microtubules play a role in cell

shape and the intracellular transport of macromolecules and

organelles (Hayden and Allen, 1984; Vale et al., 1985).











There are at least five major classes of protein that

constitute the intermediate filaments: 1) desmin, 2)

vimentin, 3) keratin, 4) neurofilaments and 5) glial

filaments. Biochemical and immunological studies

demonstrated that these proteins are generally expressed in

a celltype specific manner (for review see Lazarides,

1980). Desmin is an acidic protein with a molecular weight

of 53,000 Daltons and is predominantly found in intermediate

filaments from cardiac, smooth and skeletal muscle cells

(Lazarides and Hubbard, 1976; Hubbard and Lazarides, 1979).

The localization of desmin at the Z line in muscle suggests

a role for this protein in the coordination of the

contractile actions of the muscle fiber (Lazarides and

Hubbard, 1976; Izant and Lazarides, 1977).

Vimentin is found principally in intermediate filaments

from cells of mesenchymal origin. Immunological and

biochemical characterization of vimentin indicated that the

protein is 52,000 Daltons and widely conserved throughout

evolution (Brown et al., 1976; Bennett et al., 1978; Franke

et al., 1979). A characteristic feature of the vimentin

intermediate filaments is their sensitivity to colchicine

which erroneously led researchers to believe initially that

they were disaggregation products of the microtubules

(Goldman and Knipe, 1973; Holltrop et al., 1974; Blose and

Chacko, 1976). The collapse of vimentin into filamentous

bundles around the nucleus during colchicine treatment









14

suggests that these filaments are in close association with

the microtubules.

The keratin filaments, also known as tonofilaments, are

predominantly found in epithelial cells. The keratin

proteins are a family of approximately 30 distinct

polypeptides ranging in molecular weight from 40,000-65,000

Daltons (Steinert, 1975; Steinert and Gullino, 1976; Sun and

Green, 1978; Moll et al., 1982). The keratins can be clearly

divided into acidic and basic groups based on two-

dimensional electrophoretic analysis. Although only a few

keratin subtypes are expressed in any one epithelial cell,

there is always a coordinated synthesis of at least one

class each of the acidic and basic keratin subunits (Moll et

al., 1982; Woodcock-Mitchell et al., 1982; Fuchs and

Marchuk, 1983). The combination of keratin subtypes

expressed by an epithelial cell is characteristic of the

tissue origin as well as the differentiation state of the

cell (Roop et al., 1983; Sun et al., 1983). In addition,

some epithelially derived tumors express different keratin

subtypes than those found in the normal counterpart and

these differences may be useful in diagnostic tests

(Summerhayes et al., 1981; Osborn, 1983).

Little is known about the function and organization of

the intermediate filaments from neuronal and glial cells.

The major cytoskeletal element of neuronal axons and

dendrites are the neuronal filaments which are generally









15

composed of three large polypeptides with molecular weights

of 200,000, 150,000, and 68,000 Daltons (Hoffman and Lasek,

1975; Delacourte et al., 1980). Glial filaments are

specifically found in astrocytes and other types of glial

cells and consist of a single protein, the glial fibrillary

acidic protein (GFA), with a molecular weight of 51,000

Daltons (Schachner et al., 1977; Goldman et al., 1978).

Although the intermediate filament proteins from the

different cell types are heterogeneous in their chemical

composition, they assemble into similar morphological

structures consisting of filaments that are 10 nm in

diameter that are highly resistant to extraction with

detergents. It has been proposed that the intermediate

filaments contain a constant and variable region, analogous

to the structure of antibodies. The constant domain would

conserve the morphology whereas the variable domain would

confer functional specificity (Lazarides, 1980).

The microfilaments are the thinnest of the cytoskeletal

filament systems, with an average diameter of 6 nm, and are

composed primarily of actin protein. It has been estimated

that approximately 5-10% of total cellular protein is actin

which exists in an equilibrium between monomeric and

filamentous forms (Hartwig and Stossel, 1975).

Microfilaments from non-muscle cells contain two predominant

species of actin protein, namely beta- and gamma-actin. The

non-muscle actin proteins are quite similar to muscle











specific alpha-actin with respect to molecular weight

(42,000 Daltons), amino acid sequence and polymeric

structure (Tilney and Detmers, 1975; Hartwig and Stossel,

1975; Kane, 1975; Garrels and Gibson, 1976; Whalen et al.,

1976; Rubenstein and Spudich, 1977). These results suggest

that beta- and gamma-actin protein in non-muscle cells may

play a role in contraction processes such as cell motility ,

chromosome movement and exocytosis (Berl et al., 1973;

Huxley, 1973; Sanger, 1975).



Cytoskeletal-mRNA Interactions

Early studies using stereo-electron microscopic

analysis of whole cells indicated that polysomes are

associated with the cytoskeleton structure (Wolosewick and

Porter, 1977). Closer examination of the cell interior, by

removing membranes and soluble cytoplasmic proteins with

detergent, reveals that many of the ultrastructural features

and nearly all the polysomes are retained on the

cytoskeletal framework (Lenk et al., 1977). Furthermore, the

non-random topological distribution of the polysomes is

preserved in the cytoskeleton preparation (Fulton et al.,

1980). The association of the polysomes with the

cytoskeleton does not appear to be due to trapping since

monosomes and independent ribosomal subunits are efficiently

removed by the detergent extraction (Lenk et al., 1977;

Cervera et al., 1981; Ornelles et al., 1986). These results









17

indicate that actively translated mRNAs are associated with

the cytoskeleton and this association may be requisite for

protein synthesis. Consistent with this possibility, the

inhibition of host protein synthesis coincides with the

release of host mRNA from the cytoskeletal structure and the

attachment of viral mRNA to the cytoskeleton in poliovirus

infected and adenovirus infected cells (Cervera et al.,

1981; Lemieux and Beaud, 1982). During development,

maternally inherited mRNAs participate in protein synthesis

only at the time they become associated with the

cytoskeleton in sea urchin oocytes (Moon et al., 1983).

The region of the polysome involved in its attachment

to the cytoskeleton is not known. Previous results indicate

that the association of polysomal mRNA with the cytoskeleton

is through the mRNA or mRNP particle and not through the

ribosome (Lenk et al., 1977; Lenk and Penman, 1979; Cervera

et al., 1981; Lemieux and Beaud, 1982). Disruption of

polysomes by heat shock, high salt, sodium fluoride or

pactamycin treatment releases the ribosomal subunits but not

the mRNA from the cytoskeleton into the soluble phase (Lenk

et al., 1977; Cervera et al., 1981; van Venrooij et al.,

1981; Howe and Hershey, 1984). Immunofluorescence studies

indicate that the cap-binding protein is associated with the

cytoskeleton suggesting that the attachment of eukaryotic

mRNAs to the cytoskeleton may occur via the 5' mRNA cap

structure (Zumbe et al., 1982). Earlier studies suggest that











the association of eukaryotic mRNAs with the cytoskeleton

may occur through the poly-A tract (Milcarek and Penman,

1974). However, the association of uncapped poliovirus mRNAs

(Bonneau et al., 1985) and poly-A- histone mRNAs (Jeffery,

1984; Bonneau et al., 1985) indicates that the attachment

site might also exist in an internal region contained within

the 5' and 3' ends of the mRNA. Isaacs and Fulton (1987)

have presented evidence suggesting that myosin heavy chain

in embryonic chicken muscle cells is co-translationally

assembled into the cytoskeleton. The myosin nascent

polypeptide would therefore serve as an additional

cytoskeleton attachment site for the polysomal myosin mRNA.

Based on these results it appears that several mechanisms

may operate in the attachment of a specific polysomal mRNA

or mRNP to the cytoskeleton and these attachment sites may

vary depending on the species of mRNA.

The component of the cytoskeleton to which the mRNA is

attached is not known although the data accumulated to date

suggest that the microfilaments may be involved in the mRNA-

cytoskeleton association. Removal of tubulin from the

cytoskeleton by using cold calcium-containing buffers during

the isolation procedure has no effect on the attachment of

mRNA with the cytoskeleton; this result suggests that the

microtubules do not play a role in the association of mRNA

with the cytoskeleton (Lenk et al., 1977; Howe and Hershey,

1984; Ornelles et al., 1986). Disruption of vimentin









19

filaments with heat shock or indirectly with colcemid has no

effect on protein synthesis as determined by two-dimensional

electrophoresis indicating that translation is not dependent

on the integrity of the intermediate filaments (Welch and

Feramisco, 1985). Other reports suggest that the attachment

of mRNA to the cytoskeleton is mediated by the

microfilaments (Lenk et al., 1977; Howe and Hershey, 1984;

Ornelles et al., 1986). Treatment with cytochalasins, either

cytochalasin B or D, to disrupt the actin-containing

microfilaments results in the release of poly-A+ mRNA from

the cytoskeleton into the soluble phase. At least in the

case of cytochalasin D treatment, the release of poly-A+

mRNA from the cytoskeleton occurs in a dose dependent manner

and stoichiometrically reflects the degree of inhibition of

protein synthesis (Ornelles et al., 1986). These results

indicate that intact microfilaments are required for the

association of mRNA to the cytoskeleton; however, it can not

be concluded that the actin fibers directly bind the mRNA.



Nonmembrane-Bound and Membrane-Bound Polyribosomes:
The Signal Hypothesis


As described above, nearly 100 percent of the actively

translated polysomes are associated with the cytoskeleton.

Studies on vesicular stomatitis virus infected HeLa cells

demonstrated that membrane-bound polysomal mRNA coding for

the viral G glycoprotein and "free" polysomal mRNA coding









20
for the polymerase, nucleocapsid and matrix proteins are all

attached to the cytoskeleton during translation (Cervera et

al., 1981). The association of free polysomes with the

cytoskeleton has also been demonstrated by electron

microscopy (Wolosewick and Porter, 1979). Free polysomes are

generally the class of polysomes involved in the synthesis

of intracellular proteins whereas membrane-bound polysomes

are generally involved in the synthesis of exported proteins

that are destined for the cell surface or secretion (for

review see Emr et al., 1980). The association of free

polysomal mRNAs with the cytoskeleton suggests that the

polysome is anchored to a scaffold, albeit a dynamic

structure, and not freely diffusible within the cytoplasm.

The term "free polysome" is operationally defined and is a

misnomer when viewed in light of the biochemical and

microscopic studies on the cytoskeleton. The proper

reference to free polysomes is nonmembrane-bound polysomes.

The mechanism by which mRNAs assemble into membrane-

bound polysomes has been described in the signal hypothesis

(Blobel and Dobberstein, 1975). Many types of signal

peptides exist that target proteins to various subcellular

membrane compartments such as the endoplasmic reticulum,

mitochondria and chloroplasts in eukaryotes as well as the

cell membrane in prokaryotes (Date et al., 1980; Schatz and

Butow, 1983; Muller and Blobel, 1984; Cline, 1986). The work

presented here is focused on events that occur at the









21

endoplasmic reticulum and on what is generally known for the

synthesis of proteins that are localized on the cell surface

or secreted from the cell. Most cell surface or secreted

proteins are initially synthesized with a segment of amino

acid residues at the N-terminus that is not usually found in

the mature protein. This segment is commonly referred to as

a signal peptide. Although signal peptides are not highly

conserved in sequence, they are fairly conserved in

structure and based on the compilation of 277 signal

peptides ranging from bacteria to higher eukaryotes, a

consensus structure has been deduced (Watson, 1984). In

general, signal peptides are 25-30 amino acids in length.

They contain a charged amino acid within the first five

residues, which is followed by a stretch of at least nine

hydrophobic amino acids, and terminate at a small uncharged

amino acid such as alanine, serine or glycine. It is

believed that the hydrophobic domain of the signal peptide

facilitates the transfer of the protein across the lipid

environment of specific intracellular membranes whereas the

small, uncharged amino acid is thought to direct the

protease to cleave the peptide from the mature protein

(Hortin and Boime, 1981).

Presumably, translation of mRNA encoding exported

proteins is initiated on nonmembrane-bound polysomes.

Following the synthesis of approximately 70 amino acids, the

point at which the entire signal peptide has emerged from









22
the ribosome, the signal recognition complex (SRP) binds to

the signal peptide and arrests translation (Walter and

Blobel, 1981). The SRP is an 11S ribonucleic acid-protein

complex composed of six non-identical polypeptides and one

small cytoplasmic RNA molecule (Walter and Blobel, 1980;

Walter'and Blobel, 1982; Walter and Blobel, 1983). The RNA

molecule of SRP is 300 ribonucleotides in length and shares

approximately 80% homology with a middle repetitive human

DNA family (Ullu et al., 1982; Li et al., 1982). With the

SRP bound to the signal peptide, the complex can then

associate with the membrane of the endoplasmic reticulum

through the interaction with the SRP receptor which is also

known as the docking protein (Gilmore et al., 1982a; Gilmore

et al., 1982b; Meyer et al., 1982a; Meyer et al., 1982b).

The SRP then dissociates from the polysome with the

resultant release of the translational block. As translation

resumes the protein is co-translocated from the cytoplasm

into the endoplasmic reticulum. During translocation, a

signal peptidase which is located in the lumen of the

endoplasmic reticulum removes the signal peptide from the

protein (Maurer and Mckean, 1978; Walter et al., 1984).



Overview of Project

The overall aim of this work is to better define the

mechanisms) involved in coupling histone protein synthesis

with DNA replication. Specifically, we have focused our











attention on the posttranscriptional regulation of histone

gene expression. The evidence cited above suggests that the

cytoplasm of eukaryotic cells is a highly organized region

which contains subcellular compartments that concentrate

translation factors as well as specific mRNAs (Fulton et

al., 1980; Howe and Hershey, 1984; Lawrence and Singer,

1986; Ornelles et al., 1986). Traditionally, the idea of

subcellular compartments refers to organelles such as the

nucleus, endoplasmic reticulum, and mitochondria. For

example, a popular biochemical definition of

compartmentation is "a simple regulatory mechanism in which

the enzymes for catabolism and biosynthesis are physically

separated by membrane-bound cell organelles" (Rawn, 1983). A

broader definition of subcellular compartmentation includes

any specialized region of the cell regardless of the

presence of a membrane and may be extended to such

components and regions as 1) nonmembrane-bound and membrane-

bound polysomes, 2) cytoskeleton and soluble phase, and 3)

spatial location (i.e., near the nucleus versus near the

plasma membrane).

Histone mRNAs and the factors that are involved in

their selective degradation during the inhibition of DNA

synthesis may be localized in a particular subcellular

compartment. Consistent with this reasoning, the subcellular

compartment may influence the posttranscriptional control of

histone gene expression. Based on this possibility, we have











specifically asked the question: Does the subcellular

location of histone mRNA play a role in the destabilization

of histone mRNA during inhibition of DNA synthesis? To

address this question, we have applied a combination of

molecular and cellular approaches first, to determine the

natural location of histone mRNA and second, to alter the

subcellular compartment to study whether the foreign

location affects histone mRNA stability. The rationale for

this approach is that directing histone mRNA to an altered

subcellular location may physically remove the message from

the factors that are involved in the selective degradation

of histone mRNA during inhibition of DNA synthesis.

Our initial studies demonstrated that histone mRNAs are

translated predominantly on nonmembrane-bound polysomes that

are associated with the cytoskeleton. The subcellular

location of the mRNA was altered biologically by

constructing a histone fusion gene that contains sequences

coding for the signal peptide of the beta-lactamase gene of

E. coli pBR322 plasmid DNA. The encoded fusion histone mRNA

was directed to membrane-bound polysomes and was not

destabilized during inhibition of DNA synthesis.

Inactivation of signal peptide function by a single

nucleotide substitution in the ATG translation start codon

of the signal peptide resulted in the association of the

mutated fusion mRNA with nonmembrane-bound polysomes and

restored the coupling of the mRNA stability with DNA











replication. These results indicated that the subcellular

location plays a role in the posttranscriptional control of

histone gene regulation.

During the course of studying histone mRNA subcellular

localization it was necessary to examine histone mRNA-

cytoskeletal interactions in detail. Previously, Ornelles et

al. (1986) reported that total poly-A+ mRNA, as a

heterogenous population, is released from the cytoskeleton

in HeLa cells by cytochalasin D treatment. We demonstrated

by Northern blot analysis that cytochalasin D treatment of

HeLa cells readily releases histone mRNA, which is not poly-

adenylated, from the cytoskeleton into the soluble phase.

Surprisingly, mRNA coding for the cell surface HLA-B7 class

I antigen remained associated with the cytoskeleton during

cytochalasin D treatment. Subsequent studies demonstrated

that HLA-B7 mRNA expresses at least two distinct

cytoskeletal attachment sites: a cytochalasin D sensitive

site and a puromycin sensitive site. The puromycin sensitive

site appears to be a feature of membrane-bound polysomal

mRNAs and is most likely the nascent polypeptide and/or

ribosome associated with the protein substructure of the

endoplasmic reticulum.

Cytochalasin D and puromycin cotreatment, conditions

that efficiently release HLA-B7 membrane-bound polysomal

mRNA and histone nonmembrane-bound polysomal mRNA from the

cytoskeleton into the soluble phase, did not dissociate the











signal peptide-histone fusion mRNA from the cytoskeleton.

The nucleotide sequences of the signal peptide-histone

fusion mRNA encoding the signal peptide contain a

cytochalasin D and puromycin insensitive cytoskeletal

attachment site which is not expressed by histone mRNA or

HLA-B7 mRNA. These results provide evidence for the

heterogeneic pattern for cytoskeleton-mRNA interactions.

Lastly, we investigated the role of the cytoskeleton in

the regulation of gene expression by studying the effects of

disrupting the microfilaments with cytochalasin D on the

transcription and steady state mRNA levels of several genes.

We determined that the transcriptional and

posttranscriptional regulation of the c-fos proto-oncogene

is quite sensitive to the perturbation of the cytoskeleton

structure. Transcription of the c-fos gene is selectively

stimulated with a concomitant increase in c-fos mRNA steady

state levels within minutes of the addition of cytochalasin

D. Consistent with previous results, the transcription of

beta-actin was also elevated in cytochalasin D treated

cells. These findings suggests that the cell monitors the

organization of the cytoskeleton and selectively regulates

gene expression accordingly.















CHAPTER 2

GENERAL METHODS



Materials

[a-3P]dCTP (-3,000 Ci/mmol), [a- P]dATP (-3,000

Ci/mmol), [gamma-32P]ATP (-3,000 Ci/mmol) and [a- S]dATP

(>1,000 Ci/mmol) radionucleotides were purchased from

Amersham, Arlington Heights, IL; polyvinylsulfonic acid

(PVS), polyethylene glycol 8,000 (PEG), XAR-5 x-ray film

were obtained from Eastman Kodak Co., Rochester, NY;

ultrapure electrophoresis grade agarose and Zeta-probe nylon

membranes were from Bio Rad, Richmond, CA; formaldehyde

solution (37% w/w) was from Fisher Scientific, Fair Lawn,

NJ; nitrocellulose was from Schleicher and Schuell, Keene,

NH; RPI scintillator ppo-popop concentrated liquid

scintillator (Liquifluor) was from Research Products

International, Elk Grove Village, IL; formamide was from

Bethesda Reasearch laboratories (BRL), Gaithersburg, MD;

acrylamide, calf intestine alkaline phosphatase, nuclease

Sl, E. coli DNA polymerase I large fragment (Klenow enzyme)

and most restriction endonucleases were obtained from

Boehringer Mannheim Biochemicals (BMB), Indianapolis, IN; T4

DNA ligase was from New England Bio Labs (NEB), Beverly, MA;











T4 polynucleotide kinase (cloned) was from United States

Biochemical Corp. (USB), Cleveland, OH; cytochalasin D,

polyoxyethylene sorbitan monopalmitate (Tween 40), sodium

deoxycholate (NaDOC), sodium dodecyl sulfate (SDS), Triton

X-100, and DNase I (DN-EP) were purchased from Sigma, St.

Louis,'MO; lysozyme was purchased from Worthington

Biochemicals, Freehold, N.J.; fetal bovine, calf bovine and

horse sera were obtained from Gibco Laboratories, Grand

Island, NY or Flow Laboratories, McLean, VA; cycloheximide

was kindly provided by Upjohn, Kalamazoo, Michigan.



Conditions for Enzyme Reactions

The buffers and incubation conditions for each of the

restriction endonucleases and DNA modifying enzymes used in

this study were as described by the specific recommendations

of the manufacturers unless otherwise indicated.



Mammalian Cell Culture

HeLa Monolayer Cell Cultures

HeLa S3 suspension cells (human cervical carcinoma cell

line; ATCC ccl 2.2) were seeded into EMEM (Eagles-modified

minimum essential medium) containing 5% fetal calf serum, 5%

horse serum, 100 U/ml penicillin, 100 Ag/ml streptomycin and

1 mM glutamine at 3x106 cells per 10 cm tissue culture dish

and incubated at 370C under 5% CO2. Cells were maintained at

sub-confluent densities by splitting the cultures 1:10 into

fresh medium every 3 to 5 days.











HeLa Suspension Cell Cultures

HeLa S3 cells were grown and maintained in suspension

at 3-6x105 cells/ml in SMEM (Joklik-modified minimum

essential medium) supplemented with 7% calf serum, 100 U/ml

penicillin, 100 Cg/ml streptomycin and 1 mM glutamine in a

warm room at 370C. Monoclonal and polyclonal HeLa S3 cell

lines, which were isolated during G418 selection of

transfected monolayer cultures, were maintained in SMEM

containing 5% fetal calf serum, 5% horse serum, 100 U/ml

penicillin, 100 ig/ml streptomycin and 1 mM glutamine at 3-

6x105 cells/ml.



WI-38 Monolayer Cell Cultures

WI-38 cells (normal, human diploid fibroblast-like

cells; ATCC ccl 75) at passage 28, were grown as monolayers

in EMEM containing 10% fetal calf serum, 100 U/ml

penicillin, 100 ig/ml streptomycin and 1 mM glutamine at

37C under 5% CO2. Cell cultures were made quiescent by

maintaining cultures in EMEM containing 0.5% fetal calf

serum, 100 U/ml penicillin, 100 gg/ml streptomycin and 1 mM

glutamine at 370C under 5% CO2 for 48 hours.



Metabolic Inhibitor Treatments

Inhibition of DNA synthesis was usually performed with

1-5 mM hydroxyurea for 30 to 60 minutes. The drug was always

prepared fresh in IX spinner salts (Gibco) as a 100 mM stock

solution.











Protein synthesis was inhibited with 10 gg/ml

cycloheximide for varying lengths of time. Cycloheximide

stock solutions [500 gg/ml] were prepared fresh in IX

spinner salts. Protein synthesis was also inhibited with 0.4

mM puromycin for varying lengths of time. Puromycin stock

solutions [54.4 mg/ml] were prepared in dimethyl sulfoxide

(DMSO) and stored at -200C.

To study the dependence of protein synthesis on the

destabilization of histone mRNA during the inhibition of DNA

synthesis, we pre-treated cells with 10 gg/ml cycloheximide

for 5 minutes and then added 1 mM hydroxyurea for an

additional 30 minutes.

Disruption of the cytoskeleton was generally achieved

by treating the cells with 5 to 60 gg/ml cytochalasin D for

15-20 minutes at 370C. The cytochalasin D stock solutions

[5-10 mg/ml] were prepared in DMSO and stored at -200C.



Plasmid DNA

The human histone genes used in this study were

previously isolated by Sierra et al. from a lambda Ch4A

bacteriophage library (1982). The histone genes were

subsequently subcloned into Escherichia coli pBR322 plasmid

DNA and propagated in E. coli strain HB101 bacterium (Sierra

et al., 1982; Plumb et al., 1983; Stein et al., 1984).

Recombinant plasmids ST519 and FF435C each contain a

distinct genomic DNA fragment encoding a human H3 histone











gene. The recombinant plasmid FO108A contains an entire

human H4 histone gene which includes the promoter, coding

and 3' non-transcribed regions.

An HLA-B7 cDNA clone, pDP001, was generously supplied

by Dr. Sherman Weissman, Yale University, New Haven,

Connecticut (Sood et al., 1981). The pDP001 plasmid DNA was

constructed from the human cell line RPMI 4265 and contains

a 1400 bp insert coding for HLA-B7 in the PstI site of

pBR322 plasmid DNA. Therefore, the plasmid confers

tetracycline resistance and not ampicillin resistance to E.

coli HB101 bacteria.

The phCGa plasmid DNA was generously provided by Dr.

John Fiddes, California Biotechnology Inc., Mountain View,

California and Dr. John Nilson, Case Western Reserve

University, Cleveland, Ohio. The phCGa plasmid is a cDNA

clone containing a 621 bp fragment coding for the alpha

subunit of human chorionic gonadotropin inserted into the

HindIII site of pBR322 and confers ampicillin resistance

(Fiddes and Goodman, 1979).

The beta-lactamase signal peptide-globin fusion gene,

pSP125e, was kindly provided by Dr. Vishwanath Lingappa,

University of California at San Francisco. The pSP125e clone

contains the signal peptide from the beta-lactamase gene of

E. coli plasmid pBR322 fused in frame to the coding sequence

for chimpanzee alpha globin. This fusion gene was subcloned

into the pSP64 vector (Promega Biotech) as a HindIII-PstI









32
fragment and is under control of the SP6 promoter (Simon et

al., 1987).

To study the regulation of histone mRNA localized on

membrane-bound polysomes, we constructed a beta-lactamase

signal peptide-histone fusion gene as outlined in Figure 2-

1. The first intermediate, pSPpSTdeltaHH/E, involved the

placement of the E. coli pBR322 beta-lactamase signal

peptide-globin fusion gene from pSP125e under

transcriptional control of the cell cycle-dependent H3

histone regulatory region of pST519deltaH. The 840 bp

EcoRI/HindIII fragment from pST519deltaH (Marashi et al.,

1986) was isolated electrophoretically and blunt-ended using

the Klenow fragment of DNA polymerase I. The signal peptide-

globin fusion construct was digested with BglII restriction

endonuclease, which cuts once in the untranslated leader

region of the fusion gene, blunt-ended with Klenow fragment

and dephosphorylated using calf intestinal alkaline

phosphatase. The 840 bp blunt-ended fragment from pST519 was

ligated into the BglII blunt-ended site of pSP125e using T4

DNA ligase. The construction of the second intermediate,

pSPpSTdeltaHH/EpST, involved the substitution of the

chimpanzee globin coding sequences in pSPpSTdeltaHH/E with

the H3 histone coding sequences from pST519. The

pSPpSTdeltaHH/E DNA was digested with NcoI, which cuts at

the signal peptide-globin coding region junction, and

treated with calf intestinal phosphatase. The pST519 DNA was









Figure 2-1. Outline of the cloning scheme for the
construction of the signal peptide-histone fusion gene.

Restriction endonuclease sites are as follows: B,
BglII; E, EcoRI; H, HindIII; N, NcoI; P, PstI; S, SmaI.
Abbreviations: S.P., E. coli pBR322 beta-lactamase signal
peptide coding sequences; H3REG, transcriptional H3 histone
regulatory region including CAAT and TATAA consensus
sequences; CAP, histone H3 mRNA transcription start site; H3
struct, sequences coding for H3 histone protein; ATG,
translation start codon; TAA, translation stop codon; SP6,
bacteriophage SP6 promoter.













ATG
SI--S.P-- N-Globin--- nSP125e


,1


/2 Leader'

CAP
STATAA I H
T 795bp 125bp |20bp I


EcolHind
Isolate E/H fragment
Klenow


pST519AH
lr\


//2 Lead


SP6
CAP
~ TATAA j,.1 j
H3 1 1-- ,I S.P4GLOBIN I pSPpSTAHH/E


(ATG)
E CAP N H
kH3 Reg- H3 Struct.-- pST519


Nco I ,
Phosphatase

Ncol


Ligate


.SP



pS STAHH/EpST




3
HpaI
Isolate 1.1 Kb fragment
pUC8 Hinc Lgate


6
6 H3Cap H
HISeqa ATG T fp H pp, T/
43 Seq. ,I PP-" 4 -4H3 Seq. I I .IpSPpSTAHH/EpST


,SPH3


i-


40pEnhaAcer-

H3 SQ. 214H3 SEQ-?*p -
N*210bp "


EcoR I
EcoRI Isolate Enhancer cassette
Phosphatase

Ligate


H3 Struct.


P SPE
>F pSPH3E


SV0ES


t -









35

digested with NcoI, which cuts at the ATG translation start

codon, and ligated to NcoI/dephosphorylated pSPpSTdeltaHH/E

DNA using T4 DNA ligase. The signal peptide-histone fusion

gene was subcloned into pUC8 plasmid DNA by lighting the 1.1

kbp HpaI fragment from pSPpSTdeltaHH/EpST into the HincII

site of pUC8 to form pSPH3. The signal peptide-histone

fusion gene in pSPH3 was transcriptionally enhanced by

placing the SV40 viral enhancer element from pSVE108A

(Shiels et al., 1985) into the EcoRI site in the polylinker

of pSPH3 to form pSPH3El (containing one enhancer element)

and pSPH3E2 (containing 2-3 enhancer elements).



DNA Isolation and Purification

Plasmid DNA Preparations

Plasmid DNAs used in the experiments described here

were harbored in Escherichia coli strain HB101 bacteria (F-,

recA 13) unless otherwise indicated. Bacteria containing the

appropriate plasmid were grown in medium containing

antibiotics (usually 25-50 Ag/ml ampicillin or tetracycline)

as specified by the genotype of the plasmid or bacterium.

The following procedure is the routine method for

isolating pBR322 derived plasmid DNAs and includes an

amplification step with chloramphenicol for higher yields of

DNA (Maniatis et al., 1982a). Plasmids that are derived from

pUC8 DNA are also prepared as follows; however, due to their

high copy number the amplification step is unnecessary. The









36

standard protocol for the isolation of pUC8 related plasmid

DNAs is the same as described below except that the 500 ml

culture is inoculated directly and allowed to grow overnight

into the late log stage.

Starter cultures were prepared by inoculating 5 ml LB

mediumn(Luria-Bertani medium: 1% Bacto tryptone, 0.5% Bacto

yeast extract, 1% NaCl) supplemented with 0.1% glucose with

25-50 ul of bacterial glycerol stock and incubated overnight

at 370C. The 5 ml starter culture was transferred to 500 ml

pre-warmed LB medium supplemented with glucose and incubated

at 370C until the optical density at 590 nm (0.D.590) of the

culture reached 0.55 units. Plasmid DNA was amplified by

treating the culture with 200 gg/ml chloramphenicol

(prepared as a 20 mg/ml stock solution in 95% ethanol and

filter sterilized) at 370C for 12-16 hours. The bacteria

were centrifuged at 5,000 rpm, 40C for 10 minutes in a

Beckman JA-10 rotor and J2-21 centrifuge. The cell pellet

was resuspended in 10 ml solution I (50 mM glucose, 25 mM

Tris pH 8.0, 10 mM EDTA, 5 mg/ml lysozyme) and incubated at

room temperature for 5 minutes. The cells were lysed at 0C

with 20 ml solution II (1% SDS, 0.5 M NaOH) for 5 minutes.

The cell lysate was treated with 15 ml 5 M potassium

acetate, pH 4.8 and kept on ice for 5 minutes. The lysate

was transferred to a 50 ml polycarbonate tube and

centrifuged at 16,000 rpm for 20 minutes at 40C in Beckman

JA-20 rotor to pellet the bacterial DNA and cell debris. The









37

supernatant was transferred to a 150 ml Corex tube (Corning)

and nucleic acids were precipitated from solution with 30 ml

isopropanol at room temperature for 15 minutes. The DNA was

pelleted by centrifugation at 5,000 rpm in Beckman JS-7.5

rotor for 30 minutes at 200C. The pellet was briefly dried

under vacuum and resuspended in 8 ml 10:1 TE buffer (10 mM

Tris pH 8.0, 1 mM EDTA). The DNA solution was adjusted to a

final concentration of 1 mg/ml of CsC1 (refractive index of

1.3860) and 600 ig/ml ethidium bromide. The DNA solution was

then transferred to a 16 x 76 mm Quick-Seal tube (Beckman)

and centrifuged to equilibrium at 45,000 rpm in a Beckman

Type-50 Ti rotor and Beckman L5-65 ultracentrifuge for 36-48

hours at 200C. The supercoiled plasmid DNA was removed from

the cesium chloride gradient by puncturing the side of the

tube just below the DNA band with a syringe containing a 22

gauge needle. The DNA was extracted repeatedly with 1-

butanol to remove the ethidium bromide and to reduce the

volume of the solution. Cesium chloride was removed by

dialysis against 10:1 TE buffer at 40C. The DNA was

quantitated by absorbance at 260 nm and stored at -200C.

Routinely, the yield for pBR322 derived plasmids was 500-800

Ag DNA per 500 ml amplified culture.



M13 Bacteriophage DNA Preparations

M13 is a filamentous DNA bacteriophage that is specific

for male E. coli bacteria. M13 phage DNA is useful for site











directed mutagenesis and dideoxy DNA sequencing reactions

since it can be readily isolated as a double-stranded

covalently closed circular DNA replicative form (RF) from

the infected bacteria and as a circular, single-stranded DNA

genome (SS) from the mature phage particle. In addition, M13

phage DNA has been altered genetically to facilitate cloning

and subsequent manipulations. One such derivative, M13mpl8,

is small in size, maintained in high copy number

(approximately 200 RF molecules per cell), contains a

convenient polylinker for the insertion of foreign DNA (up

to 25 kb), and expresses beta-galactosidase which is

inactivated by the insertion of DNA into the polylinker

site.



Single-stranded templates. Single-stranded M13 DNA

templates were prepared from individual "plaques" which

formed on a lawn of E. coli strain JM103 bacteria

(delta(lac-proAB), supE / F'[traD36, proA+, proB+, lacIq

lacZdeltaM15]) that were infected with M13 bacteriophage or

transfected with M13 double stranded, covalently closed

circular DNA. A single plaque was removed from the agar

plate with a sterile pasteur pipette and placed in 2 ml YT

medium (0.8% Bacto-tryptone, 0.5% Bacto-yeast extract, 0.5%

NaC1). Two drops of an overnight JM103 bacterial culture

were added to the phage and incubated at 370C with agitation

for 6 hours. Longer incubation times result in deletions











within the phage DNA. The cell culture (1.5 ml) was

transferred to a microcentrifuge tube and spun in an

Eppendorf centrifuge at 12,000 x g for 10 minutes at 40C.

The supernatant (1.2 ml) was transferred to a sterile

microcentrifuge tube, 300 ul of 20% PEG, 2.5 M NaC1 were

added and the sample was incubated at room temperature for

15 minutes. The remaining 200-300 ul of supernatant were

removed and stored at -200C as a phage stock. The phage

suspension was centrifuged at 12,000 x g for 5 minutes at

room temperature and the supernatant was decanted. The

pellet was resuspended in 150 ul TES buffer (20 mM Tris-HCl

pH 7.5, 10 mM NaC1, 0.1 mM Na2EDTA). The sample was

extracted with phenol as follows: 1) added 50 ul phenol and

vortexed for 2 seconds; 2) incubated at room temperature for

5 minutes; 3) vortexed for 2 seconds; and centrifuged at

12,000 x g for 4 minutes at room temperature. DNA was

precipitated from 130 ul of aqueous phase with 5 ul 3 M

sodium acetate and 340 ul 95% ethanol on crushed dry ice for

15 minutes and collected by centrifugation at 12,000 x g,

for 15 minutes at 40C. The supernatant was discarded and the

pellet was washed in 70% ethanol at room temperature. The

sample was centrifuged at 12,000 x g, room temperature for 5

minutes. The DNA pellet was dried under vacuum, resuspended

in 80 ul TES buffer and stored at -20C.











Double-stranded templates. E. coli strain JM101

(delta(lac-proAB), supE / F' [proA+, DroB', lacIq,

lacZdeltaM15]) bacteria were grown overnight in 5 ml YT

medium at 370C with agitation. The overnight culture (1 ml)

was transferred to 100 ml prewarmed YT medium and incubated

at 37C until the O.D.590 reached 0.4 units. To assure

exponential growth the culture was again diluted 1:100 into

500 ml prewarmed YT medium and grown to an O.D.590 of 0.4

units. The culture was infected with 500 ul of M13

bacteriophage supernatant which had been prepared from an

isolated plaque as described above for the preparation of

M13 single-stranded DNA. The infected cells were incubated

at 370C with agitation for no more than 8 hours. The cells

were harvested and RF M13 DNA was isolated as described

above for the preparation of plasmid DNA. Routinely, the

yield was 300 Ag of supercoiled M13 DNA per 500 ml culture.



Isolation of Mammalian RNA

Isolation of Total Cellular RNA

The following procedure for the isolation of total

cellular RNA was developed by Dr Mark Plumb in the Stein's

laboratory primarily for work with HeLa cells. However, this

procedure has been successfully used without modification

for the isolation of total cellular RNA from human HL-60

cells, mouse 3T3-L1 cells, rat osteoblast primary cell

cultures, and Trypanosome cruzii cells.










Exponentially growing HeLa cells (5 x 107 cells) were

harvested by centrifugation at 1,500 rpm for 5 minutes at

370C in an IEC rotor. The cells were washed in phosphate-

buffered saline (PBS; 150 mM NaCl, 10 mM sodium phosphate pH

6.8) and resuspended in 3 ml lysis buffer (2 mM Tris-HCl pH

7.4, 1 mM EDTA) containing 5 gg/ml PVS. Cells were lysed in

the presence of 2.4% SDS and 88 pg/ml of proteinase K at

room temperature for 15 minutes. Lysates were adjusted to

300 mM NaCl, extracted with 5 ml Tris-saturated phenol and 5

ml CHCl3/isoamyl alcohol (IAA) (24:1, v/v) and centrifuged

at 3,000 rpm in an IEC rotor at room temperature. The

aqueous phase was then extracted with 5 ml CHCl3/IAA and

centrifuged at 3,000 rpm in an IEC rotor at room

temperature. The phenol/chloroform and chloroform

extractions were repeated as described above. Nucleic acids

were precipitated from the aqueous phase with 2.5 volumes of

95% ethanol at -20C in the presence of 53 mM potassium

acetate.

Nucleic acids were recovered from the ethanol

suspension by centrifugation at 12,000 x g and resuspended

in TCM buffer (10 mM Tris-Hcl, pH 7.4, CaCl2, 10 mM MgCl2)

for digestion with DNase I. The DNase I was dissolved in 20

mM Tris-HCl pH 7.4, 10 mM CaCl2 at 1 mg/ml, preincubated at

370C for 20 minutes and treated with 0.1 volume of

proteinase K [1 mg/ml] at 370C for 2 hours to remove

ribonuclease activity (Tullis and Rubin, 1980). The nucleic









42

acid samples were then digested with 0.1 mg/ml of proteinase

K treated DNase I for 20-30 minutes at 370C. Following DNase

I digestion, 0.05 volumes of 5 M NaCl and 0.25 volumes of

10% SDS were added to each sample and the RNA solutions were

repeatedly extracted with phenol and chloroform until the

interface between the aqueous and organic phases was clean.

RNA was precipitated from the aqueous phase with 2.5 volumes

of 95% ethanol, at -200C overnight. The RNA was collected at

12,000 rpm in a JA20 rotor at 40C for 30 minutes. The pellet

was resuspended in double distilled water, quantitated by

optical density at 260 nm and stored at -200C. Typical

yields of RNA were 400 gg per 90% confluent 10 cm plate of

HeLa S3 cells and 1 mg per 5 x 107 HeLa S3 cells with an

O.D.260/O.D.28g of 1.8 to 2.0.



Isolation of Nonmembrane-bound, Membrane-bound and Total
Polysomal RNA

The subcellular fractionation scheme used in these

studies is a modified procedure described by Venkatesan and

Steele (1972) and is outlined in Figure 2-2. Exponentially

growing HeLa cells (5 x 108 cells) were collected by

centrifugation at 1,500 rpm in an IEC rotor at 370C for 5

minutes. All subsequent procedures were carried out at 4C.

Cells were washed several times in PBS and resuspended in 25

ml RSB (10 mM Tris-HC1 pH 7.4, 10 mM NaC1, 2.5 mM MgCl2).

After incubation on ice for 20 minutes, the cells were











disrupted with 15 strokes in a tight fitting Dounce

homogenizer. The homogenate was then centrifuged at 2,000 x

g for 5 minutes. The supernatant supernatantt A) was removed

and maintained in an ice bath while the nuclear pellet

(pellet A) was resuspended in 9 ml TMN (20 mM Tris-HCl pH

7.5, 5 mM MgCl2, 25 mM NaC1, 3 mM dithiothreitol). The

nuclear suspension (pellet A) was adjusted to 1% Triton X-

100 and 1% NaDOC, vortexed briefly and centrifuged at 500 x

g for 10 minutes. The supernatant supernatantt C) from this

centrifugation step was removed and saved on ice for the

isolation of nucleus-associated rough endoplasmic reticulum

(NRER) polysomes. The supernatant from the centrifugation

step following homogenization supernatantt A) was

centrifuged at 12,000 rpm, 40C for 10 minutes in a Beckman

JA20 rotor. The resulting supernatant supernatantt B) was

removed onto ice for subsequent isolation of light

endoplasmic reticulum (LER)-associated polysomal RNA and

nonmembrane-bound polysomal RNA. The pellet (pellet B) was

resuspended in 9 ml TMN, adjusted to 1% Triton X-100 and 1%

NaDOC and centrifuged at 10,000 rpm, 40C for 10 minutes in a

JA20 rotor. The supernatant supernatantt D) was removed and

stored on ice for the isolation of mitochondria-associated

rough endoplasmic reticulum (MRER) polysomal RNA.

Exponentially growing HeLa cells (2.5 x 108 cells) were

collected by centrifugation for the isolation of total

polysomal RNA. The cell pellet was washed in PBS and



















Figure 2-2. Outline of procedure for the isolation of
subcellular polysomal fractions.
















HeLa Cells


homogenize
centrifuge


in RSB
2,000xg, 40C, 5'


supernatant A


centrifuge 11,400xg
10'



supernatant B pellet B

Triton/NaDOC
centrifuge 7,800x
10'
I 1


Triton/NaDOC
centrifuge 500xg
10'


discard pellet


discard pellet





centrifuge
200,000xg, 2 hrs
2M sucrose


Band at
interface


pellet


supernatant D super





centrifuge
200,000xg, 2 hrs
2M sucrose


pellet


natant C


centrifuge
200,000xg, 2 hrs
2M sucrose


pellet


LER Nonmembrane-bound


pellet A


NRER


MRER











resuspended in 15 ml TMN. The sample was adjusted to 1%

Triton X-100 and 1% NaDOC, disrupted with several strokes in

a tight fitting Dounce homogenizer and centrifuged at 12,000

x g at 40C for 10 minutes in a JA20 rotor. The supernatant

was removed and saved at 0C.

Each of the fractions (NRER, MRER, LER, nonmembrane-

bound, and total polysomal RNA) were layered onto a 3 ml 2 M

sucrose pad (prepared in RSB containing 100 uM spermidine)

and centrifuged at 40C for 2 hours at 48,000 x g in a

Beckman Type 50.2 Ti rotor (200,000 x g) without the brake.

The LER formed a cloudy band at the top of the sucrose pad

and was carefully removed by aspiration. The remaining

fractions were pelleted under these conditions and gently

resuspended in 3 ml TMN buffer. The samples were then

extracted extensively with phenol and chloroform as

described above for the isolation of total cellular RNA. The

RNA was precipitated from solution with 3 volumes of 95%

ethanol at -200C in the presence of 53 mM potassium acetate.

The RNA was digested with DNase I, extracted with phenol and

chloroform, and ethanol precipitated as described above for

the preparation of total cellular RNA. Typical yields were

1.5-2.0 mg MRER and NRER RNA, 2-3 mg nonmembrane-bound RNA,

1 mg LER RNA and 4-6 mg total polysomal RNA per liter of

exponentially growing HeLa cells.











Isolation of Cytoskeleton and Soluble Phase RNA

The cytoskeleton and soluble fractions were prepared as

previously described by Penman and coworkers (Cervera et

al., 1981). Exponentially growing HeLa cells (5 x 108 cells)

were harvested and washed in cold PBS. The cell pellet was

resuspended in 2 ml extraction buffer (10 mM Pipes pH 6.8,

100 mM KC1, 2.5 mM MgCl2, 0.3 M sucrose, 1 mM

phenylmethylsulfonyl fluoride) and Triton X-100 was

immediately added to a final concentration of 0.5%. The

sample was incubated at 0C for 3 minutes and then

centrifuged at 700 rpm in an IEC centrifuge for 3 minutes at

40C. The supernatant (SOL) was removed and stored on ice.

The pellet was resuspended in 8 ml RSB containing 1 mM

phenylmethylsulfonyl fluoride, 1% Tween 40 and 0.5% NaDOC.

The nuclei were stripped of cytoplasmic tags with 15 strokes

in a precision-bore stainless steel homogenizer with a

clearance of 0.002 inches and were pelleted at 2,000 rpm for

3 minutes at 40C in an IEC rotor. The supernatant (CSK) was

removed and saved at 0C for subsequent RNA isolation. Both

the CSK and SOL fractions were extracted in the presence of

1% SDS and 0.3 M NaCl with phenol and chloroform. Nucleic

acids were precipitated from the aqueous phase with 3

volumes of 95% ethanol at -200C in the presence of 53 mM

potassium acetate. The RNA was digested with DNase I, phenol

and chloroform extracted, and ethanol precipitated as

described above for the isolation of total cellular RNA.











Typical yields of RNA were 250-300 Mg from CSK and 100-150

Ag from SOL per 2.5 x 107 HeLa cells (50 ml exponentially

growing suspension culture).



Two-Dimensional Gel Electrophoresis and
Immunoblotting Analysis

The cytoskeleton and soluble fractions were isolated as

described above and each sample was dialyzed in 2 mM Tris-

HC1 pH 7.5 and treated with DNase I (20 gg/ml) and RNase A

(20 Ag/ml) in the presence of 0.5 mM MgC12 at 40C for 1

hour. The samples were dialyzed against 2 mM Tris-HCl pH 7.5

and then lyophilized. Two-dimensional gel electrophoresis

and immunoblotting analyses were performed by Dr. Warren

Schmidt (Department of Pathology, Vanderbilt University,

Nashville, TN). The protein preparations were focused in the

first dimension using equilibrium conditions as described by

O' Farrell (1975) with pH 3 to 10 or 5 to 7 ampholines. The

second dimension was electrophoresed on slab gels containing

a 3% stacking gel and 7.5% resolving gel as described by

Laemmli (1970). The proteins were then either stained with

Coomassie Brilliant Blue or electrotransferred to

nitrocellulose filters as described by Towbin et al. (1979).

Where indicated, immunotransfer analyses (Glass et al.,

1981) were performed with commercially available or other

(Schmidt et al., 1982) antibodies to actin, tubulin and

prekeratin.










Northern Blot Analysis

Aqarose-Formaldehyde RNA Denaturing Gel Electrophoresis

RNA samples were resolved electrophoretically in 1.5%

agarose-6% (w/v) formaldehyde horizontal slab gels and

running buffer (20 mM MOPS (morpholinepropane-sulfonic acid)

pH 7.0, 5 mM sodium acetate, 1 mM EDTA, 3.7% (w/v)

formaldehyde) as described by Rave et al. (1979). Routinely

10 gg RNA per sample were dried in a Savant Speed Vac

concentrator and resuspended in 3.2 ul double distilled

water (ddH0O), 5 ul formamide, 1 ul 10x MOPS (200 mM MOPS pH

7.0, 50 mM sodium acetate, 10 mM EDTA), 0.8 ul 37% (w/v)

formaldehyde and 2 ul sample buffer (0.5 ml formamide, 0.1

ml 10x MOPS, 80 ul 37% (w/v) formaldehyde and 0.32 ml 0.2%

bromophenol blue-90% glycerol). The samples were then heated

at 600C for 10 minutes, quick chilled to 0C and loaded onto

the gels. The 1.5% agarose-6% formaldehyde gels were

prepared by melting 3 g electrophoresis grade agarose in 144

ml ddHO2 plus 20 ml 10x MOPS buffer in a microwave oven

(Whirlpool) at full power for 3-4 minutes. The agarose

solution was cooled to approximately 650C (warm to the

touch) while stirring and then adjusted to 6% formaldehyde

with 36 ml 37% (w/v) formaldehyde. For minigels, 35 ml

agarose-formaldehyde solution was cast in a plexiglass gel

tray (10 cm x 6.3 cm) with an 8 well comb (1 mm x 5 mm per

well). The gel was electrophoresed at 40-45 milliamps until

the bromophenol blue migrated 9 cm (approximately 1.5









50

hours). For full size RNA gels, 200 ml agarose-formaldehyde

solution was cast in a plexiglass gel tray (24.5 cm x 19.8

cm) with 2: 20 well combs (1 mm x 6 mm per well). The gel

was electrophoresed at 100-120 volts until the bromophenol

blue migrated 11 cm (approximately 4 hours). The

formaldehyde gels were stained for 20 minutes in ethidium

bromide solution (1 Ag/ml ethidium bromide, 0.1 M ammonium

acetate) and destined for at least 2 hours in double

distilled water. RNA samples were then visualized by

fluorescence under ultraviolet light using a short

wavelength transilluminator (UVP, inc.; San Gabriel, CA).

The gels were usually photographed at f4.5 for 1/4 second

with Type 57 high speed Polaroid film and a Polaroid model

545 camera mounted on a stand above the transilluminator.



Transfer of RNA from Aqarose-Formaldehyde Gels to
Hybridization Filters

RNA samples were transferred to nitrocellulose (0.45

um) or nylon membrane hybridization filters in 20x SSC as

previously described by Thomas (1975). The gels were soaked

in 20x SSC (3 M NaCl, 0.3 M sodium citrate pH 7.0) for 20

minutes and were not stained with ethidium bromide. The

hybridization filters were uniformly wetted in ddH2O and

then 20x SSC. The gel was placed with the wells facing

downward onto a sheet of 3 MM paper (Whatman) and sponge

which had been soaked in 20x SSC. Strips of used X-ray films









51

were placed on areas of the sponge that were not covered by

the gel so as to direct the flow of 20x SSC only through the

gel. The filter was directly layered onto the gel and any

air bubbles that were trapped between the gel and filter

were carefully removed. The transfer set-up was completed by

placing two sheets of 3 MM paper followed by 2-3 boxes of

facial tissues (Kleenex brand) on top of the hybridization

filter. The buffer chamber was filled with 20x SSC and

transfer was carried out for 36 hours (note: complete

transfer is usually achieved within 14 hours). After

transfer, the filters were rinsed in 2x SSC for 10 minutes

to remove particles of agarose, air dried and baked in vacuo

at 800C for 2 hours. The filters were stored in sealed

hybridization bags at 40C.



Hybridization of Filters-Immobilized RNA (Northern Blot)

Filters (nylon or nitrocellulose) were prehybridized

for 3-4 hours in 0.5 ml hybridization buffer per cm2 filter

area at 430C for the detection of chorionic gonadotropin

alpha, HLA-B7 and c-fos mRNA and at 480C for histone mRNA.

Hybridization buffer consisted of 50% formamide, 5x SSC, 10x

Denhardt's (100x Denhardt's: 2% (w/v) ficoll 400, 2% (w/v)

polyvinylpyrrolidone), 1% SDS, 50 mM sodium phosphate pH

7.0, 20 gg/ml BSA, and 250 gg/ml E. coli DNA. The filters

were hybridized at the appropriate temperature for 36 hours

in 0.1 ml hybridization buffer per cm2 filter containing











1xl10 cpm/ml of each thermally denatured, 3P-radiolabeled

DNA probe. After hybridization, the filters were washed with

5x SSC, ix Denhardt's (0.5-1 ml/cm2 filter) for 10-15

minutes at room temperature to remove unbound probe. The

filters were then washed, in order, with the following

solutions (0.5 ml/cm2 filter area): 1) 5x SSC, Ix

Denhardt's; 2) 2x SSC, 0.1% SDS; 3) Ix SSC, 0.1% SDS; and 4)

0.1x SSC, 0.1% SDS at 600-650C for 30 minutes per wash.

After washing the filters were briefly air dried and then

exposed to preflashed Kodak XAR5 x-ray film at -70C with a

Cronex Lightning Plus intensifying screen (Dupont) for

varying lengths of time. Hybridization was quantitated by

scanning laser densitometric analysis of multiple exposures

of autoradiographs that were within the linear range of the

film.



S1 Nuclease Protection Analysis

Sl nuclease protection analysis was performed

essentially as described by Berk and Sharp (1977) and was

used in the work presented here to detect simultaneously

both endogenous H3 histone mRNA and signal peptide-histone

fusion mRNA in the same RNA sample. The Sl probe was

prepared by digesting 30 pg pSPH3E1, pSPH3Elalpha, or

pSPH3E1ATG- DNA with 30 units of SmaI at 300C for 3 hours.

The 450 bp SmaI fragment was isolated from a 0.8% agarose

minigel by the freeze-squeeze method. The solution









53

containing the SmaI fragment was butanol extracted to reduce

the volume and to remove the ethidium bromide. The fragment

was then extracted with phenol and chloroform and

precipitated in 2.5 volumes 95% ethanol at -200C overnight.

The DNA was collected by centrifugation at 12,000 x g at 40C

for 15"minutes and resuspended in 5 ul 10 mM Tris-HCl pH

8.0, 5 ul 10x CIP buffer (0.5 M Tris-HCl pH 8.0, 10 mM

MgCl2, 1 mM ZnCl2, 10 mM spermidine) and 38 ul ddH20. The

blunt-ended DNA was dephosphorylated with 0.12 units calf

intestinal alkaline phosphatase (CIP) at 370C for 15 minutes

and then at 550C for 15 minutes. A second aliquot of CIP was

added and the incubations at 370 and 550C were repeated. The

reaction was terminated with 40 ul ddH20, 10 ul 10x STE (100

mM Tris-HC1 pH 8.0, 1 M NaCI, 10 mM EDTA) and 5 ul 10% SDS

and heated at 680C for 15 minutes. The sample was extracted

with phenol and chloroform, adjusted to 0.25 M sodium

acetate and precipitated with 2.5 volumes of 95% ethanol at

-20C overnight. The dephosphorylated SmaI fragment was

pelleted at 12,000 x g, 40C for 15 minutes, vacuum dried and

resuspended in 12 ul Ix kinase buffer (66 mM Tris-HCl pH

9.5, 10 mM MgC12, 10 mM beta-mercaptoethanol, 2 mM

spermidine). The Sl fragment was phosphorylated with 50 uCi

[gamma-32 P]ATP and 1 ul polynucleotide kinase [30 units/ul]

at 370C for 30 minutes. The reaction was terminated with 0.5

ul 100 mM EDTA at 700C for 10 minutes. The DNA solution was

diluted with 1 ml elutip low salt buffer (20 mM Tris-HCl pH

7.4, 0.2 M NaC1, 1 mM EDTA) and passed over a Schleicher and









54

Schuell Elutip column. The column was washed with 5 ml low

salt buffer to remove unincorporated radiolabeled

ribonucleotide and the DNA fragment was eluted in 400 ul

high salt buffer (Tris-HC1 pH 7.4, 1 M NaCl, 1 mM EDTA). The

radiolabeled Sl probe was usually used immediately and any

excess was stored in high salt buffer at 4C.

Routinely, 10-25 gg RNA (30 ul) and 10 ul S1 probe were

co-precipitated with 100 ul 95% ethanol at -200C overnight.

The sample was centrifuged at 12,000 x g, 40C for 15-30

minutes. The pellet was vacuum dried and resuspended in 10

ul 5x hybridization buffer (0.2 M Pipes pH 6.4, 2 M NaC1, 5

mM EDTA) and 40 ul recrystallized formamide. The sample was

heated at 900C for 10 minutes and then incubated at 550C for

3 hours. Single-stranded nucleic acids were digested with Sl

nuclease by adding 400 ul ice cold Sl nuclease buffer (0.03

M sodium acetate pH 4.6, 0.25 M NaC1, 1 mM ZnSO4) and 900

units S1 nuclease at 370C for 30 minutes. The Sl digestion

reaction was terminated by organic extraction with 0.5

volume phenol and 0.5 volume chloroform and then 0.5 volume

chloroform alone. Nucleic acids were precipitated from the

aqueous phase with 1 ml 95% ethanol at -200C overnight.

The S1 nuclease digested samples were collected at

12,000 x g, 40C for 30 minutes. The pellets were vacuum

dried and resuspended in 5 ul loading buffer (80% formamide,

lx TBE [10x TBE: 500 mM Tris-HCl pH 8.3, 500 mM boric acid,

10 mM EDTA], 0.1% bromophenol blue, 0.1% xylene cyanol). The









55

samples were denatured by heating at 1000C for 2 minutes and

then quickly chilled at 0C to prevent reannealing prior to

loading onto the gel. Six percent polyacrylamide-8.3 M urea

(cross linked at 20:1 acrylamide:bis-acrylamide) gels with

dimensions of either 16 cm x 18 cm x 1.5 mm (1.5 mm x 6 mm

15 well comb or 1.5 mm x 4 mm 20 well comb) or 32.5 cm x 44

cm (0.5 mm x 8 mm 25 well comb) were prepared and pre-

electrophoresed for 30 minutes. The samples were loaded with

drawn-out capillary tubes or a Rainin Pipetteman (0-20 ul

capacity) using flat pipette tips. The large gels were

electrophoresed at 50 watts constant power (-1200 V, -45 A)

for 3-4 hours and the small gels were electrophoresed at 300

V (25-35 A) for 2-3 hours. The gels were placed on 2 sheets

of 3 MM Whatman paper, dried under vacuum at 800C for 1-2

hours and exposed to pre-flashed XAR5 x-ray film with a

Cronex Lightning Plus intensifying screen at -700C for

varying lengths of time. Sl analysis was quantitated by

scanning laser densitometry of multiple autoradiographic

exposures that were within the linear range of the film.



In Vitro Nuclear Run-On Transcription Analysis

The in vitro nuclear run-on transcription assays were

performed by Anna Ramsey-Ewing as described by Baumbach et

al. (1987). Cells were harvested by centrifugation and the

cell pellet washed twice in cold isotonic buffer (125 mM

KC1, 30 mM Tris-HCl pH 7.9, 5 mM MgCl2, 10 mM beta-









56
mercaptoethanol). Cells were disrupted by homogenization (6-

12 strokes) with a Dounce homogenizer, Wheaton type A

pestle. After >90% of the cells had been lysed, nuclei were

pelleted by centrifugation at 2000 rpm for 10 minutes in an

IEC centrifuge at 40C and resuspended in nuclei storage

buffer containing 40% glycerol (50 mM Tris-HCl pH 8.3, 5 mM

MgCl2, 0.1 mM EDTA). Nuclei were aliquoted and either snap

frozen in liquid nitrogen or used fresh in the in vitro

transcription reactions. Reactions typically contained 107

nuclei, 100 uCi alpha-32P-UTP (3000 Ci/mmole), 1 mM ATP,

0.25 mM GTP and CTP in a final volume of 130 ul and were

incubated for 30 minutes with intermittent shaking at 300C.

Radiolabeled RNAs were isolated by treatment of nuclei with

DNase I (100 Ag/ml) in the presence of 0.6 M NaC1, 50 mM

Tris-HCl pH 7.5, 20 mM MgCl2 for 15 minutes at room

temperature. The mixture was then incubated with proteinase

K (200 Ag/ml) for 30-60 minutes at 370C in the presence of

150 mM NaC1, 12.5 mM EDTA, 100 mM Tris-HCl pH 7.5 and 20 mM

MgC12. Sodium acetate (pH 5.5) was added to 0.2 M and

nucleic acids extracted several times by the hot phenol

method (Clayton and Darnell, Jr., 1983; Sherrer and Darnell,

1962). To the aqueous solution of 32P-labeled RNAs, 150 Ag

of yeast RNA and 2.5 volumes of 95% ethanol were added.

Precipitation was overnight at -200C. Radiolabeled

transcripts were resuspended in 10 mM Tris-HCl pH 8.0, 1 mM

EDTA and an aliquot of each sample was precipitated with 150









57

Mg yeast RNA and cold 10% TCA. TCA-precipitable counts were

determined by liquid scintillation spectrometry.

DNA excess hybridization has also been described by

Baumbach et al. (1987). In a preliminary experiment we

determined that 2 pg of H4 histone insert in pFO002 was at

least a two-fold DNA excess when hybridized to in vitro

nuclear run-on transcripts. Southern blots containing

restriction endonuclease digested DNA fragments or slot

blots containing linearized plasmid DNAs were prepared.

Southern blots on nitrocellulose or slot blots on Nylon were

prehybridized in 1 M NaCl, 20 mM Tris-HCl pH 7.4, 2 mM EDTA,

0.1% SDS, 5x Denhardt's, 250 Ag/ml E. coli DNA and 12.5 mM

sodium pyrophosphate at 650C for at least 6 hours.

Hybridizations were conducted at 650C for 72 hours in 1 M

NaCl, 20 mM Tris-HCl pH 7.4, 2 mM EDTA, 0.1% SDS, 2.5x

Denhardt's, 250 Ag/ml E. coli DNA with 32P-labeled

transcripts at 5x105-1X106 TCA-precipitable counts per ml of

hybridization solution. Blots were washed at 650C for 15

minutes in fresh prehybridization solution [0.13-0.14

ml/cm2], 1 hour in 2x SSC/0.1% SDS [0.5 ml/cm2], overnight

in 2x SSC/0.1% SDS [0.5 ml/cm2] and 1 hour in 0.2x SSC/0.1%

SDS [0.5 ml/cm2]. Air dried filters were autoradiographed

with XAR-5 or Cronex film and Cronex lightning Plus screens

at -70C for varying periods of time and developed with an

X-O-MAT X-ray film processor.











Radiolabeling DNA for Northern Blot Analysis

DNA used for Northern blot analysis was uniformally

labeled by nick translation as described by Maniatis et al.

(1982b) or by the random priming method of Roberts and

Wilson (1985). Radiolabeled probes prepared in this manner

are also suitable for other purposes such as Southern blot

analysis.



Random Priming Method

This protocol is very efficient for labeling small to

intermediate-sized DNA fragments (100-2000 bp in length) and

is the preferred method for work with purified DNA inserts.

Supercoiled plasmid DNA is labeled much less efficiently by

the random priming method and should be fragmented by

sonication prior to use. Routinely, specific activities of

1x109 cpm/gg DNA are achieved using as little as 20-100 ng

DNA. Material for oligolabeling DNA fragments was purchased

from Bethesda Research Laboratories as a kit.

The isotope (50 uCi [a-32P] dCTP) was vacuum dried and

resuspended in 10 ul of 2.5x reaction buffer (500 mM Hepes

pH 6.6, 12.5 mM MgCl2, 25 mM beta-mercaptoethanol, 125 mM

Tris-HCl pH 8, 1 mg/ml BSA, 7.5 mg/ml synthetic DNA

oligodeoxynucleotide primers, 50 uM each dGTP, dATP, dTTP).

The DNA fragment (100 ng) in 14 ul ddH2O was heated at 1000C

for 2 minutes and immediately chilled on ice. The denatured

DNA was added to the 1.5 ml microcentrifuge tube containing











the isotope and buffer and the priming reaction was

initiated with 5 units Klenow enzyme [5 U/ul]. The sample

was incubated at room temperature for at least 2 hours

(usually overnight). The reaction was terminated with 1 ul

250 mM EDTA and 175 ul TE buffer (10 mM Tris-HCl pH 8, 1 mM

EDTA) and extracted once with 200 ul chloroform/isoamyl

alcohol. Unincorporated radiolabeled deoxynucleotide was

removed from the DNA by chromatography over a (10 mm x 100

mm) Biogel A-15m (Bio Rad) column in TE buffer. Fourteen

fractions were collected; 800 ul in the first fraction and

200 ul in each subsequent fraction. Fractions containing

radiolabeled DNA were determined by Cerenkov counting in the

tritium channel with a Beckman LS-230 scintillation counter.

The peak fractions were pooled and accurately quantitated by

counting 2 ul DNA in 5 ml Triton-toluene based scintillation

cocktail (2000 ml toluene, 1066 ml Triton X-100, 134 ml

liquifluor) in the 32P channel. The samples were immediately

used for hybridization studies and excess probe was stored

at 4C.



Nick-Translation Method

Nick-translation was the common procedure for

uniformally labeling DNA fragments or supercoiled DNA before

the development of the random primer method. A disadvantage

to using the nick-translation procedure is that the system

must be optimized for efficiency for each lot of E. coli DNA









60
polymerase I enzyme. In addition, the specific activity (1-2

x 108 cpm/Ag DNA) achieved with the nick-translation

procedure is much lower than the random primer method (1 x

109 cpm/Ag DNA).

DNase I [1 mg/ml in 10 mM HCl] was activated by

incubating 1 ul of the enzyme in 9 ul DNase buffer (10 mM

Tris-HCl pH 7.5, 5 mM MgCl2, 1 mg/ml BSA) at 0C for 2

hours. The isotope (40-80 uCi [a-32p] dCTP) was dried in a

Savant Speed Vac centrifuge. The following components were

added, in order, to the isotope : 1) 12.25 ul ddHO2; 2) 2.5

ul 10x nick-translation buffer (500 mM Tris-HC1 pH 7.8, 100

mM beta-mercaptoethanol, 50 mM MgCl2); 3) 5 ul 10x dNTPs

(100 uM of each dATP, dGTP, dTTP); 4) 1.25 ul BSA [1 mg/ml];

5) 2.5 ul DNA [100 ng/ul]; and 6) 0.5 ul DNA polymerase I [5

U/ul]. The activated DNase I was diluted with 990 ul ice

cold ddH2O (1:1,000 dilution; 1 ng/ul final concentration)

and 1 ul of diluted enzyme was added to the nick-translation

mix. The sample was incubated at 140C for 45 minutes and the

reaction was then terminated with 20 ul 250 mM EDTA and 155

ul TE buffer. The sample was extracted once with 200 ul

chloroform and unincorporated radiolabeled

deoxyribonucleotides were removed by chromatography over a

Biogel A-15m column. The DNA was quantitated and immediately

used for hybridization.











Site-Directed Mutagenesis

In the past, researchers had to rely on nature to

produce the proper mutations to study how the normal

biological processes function. Zoller and Smith (1983) have

designed a powerful method for selectively introducing

single nucleotide mutations into specific sites of any

cloned, sequenced region of DNA (site-directed mutagenesis).

In addition, this procedure can be used to selectively

create deletion or insertion mutations in DNA fragments of

known sequence. The general approach of site-directed

mutagenesis is to incorporate an oligonucleotide containing

the appropriate mutation into the complementary strand of

recombinant M13 DNA. The heteroduplex is transfected into

bacteria and the resulting mutated bacteriophage are

isolated by various selection processes.

As discussed in Chapter 4, the signal peptide-histone

fusion mRNA is associated with membrane-bound polysomes and

is stable during inhibition of DNA synthesis. It was unclear

whether the uncoupling of the histone fusion mRNA stability

from DNA replication was due to the altered subcellular

location or to a change in mRNA structure, due to the

nucleotide sequence coding for the signal peptide. To

address these possibilities, we have introduced point

mutations into the signal peptide coding region with the

intention to inactivate signal peptide function. In doing

so, mRNA structure is perturbed as little as possible and











the mutated histone fusion mRNA, like endogenous histone

mRNA, associates with nonmembrane-bound polysomes.


Subcloning of the Signal Peptide-Histone Fusion Gene
into M13 DNA

The signal peptide-histone fusion gene (SPH3) was

subcloned into M13mpl8 RF DNA. SPH3 DNA was digested with

EcoRI and HindIII and the 1100 bp fragment was isolated from

a 0.8% agarose gel. The M13mpl8 DNA was digested with EcoRI

and HindIII and the 7196 bp fragment was isolated from a

0.8% agarose gel. The 1100 bp SPH3 DNA fragment (-50 ng) and

7196 bp M13 DNA fragment (-50 ng) were ligated in 10 ul Ix

ligation buffer (50 mM Tris pH 7.6, 10 mM MgCl2, 20 mM

dithiothreitol, 1 mM ATP and 50 .g/ml BSA) with 0.004 U T4

DNA ligase (NEB) at 220C overnight. The ligation mix was

transfected into competent JM101 bacteria, white plaques

were isolated, and M13/SPH3 recombinants were screened by

restriction endonuclease digestion analysis. Single-stranded

M13/SPH3 DNA was isolated from bacteriophage particles as

described above.



Synthesis and Processing of Oligonucleotides

The signal peptide encoded by the SPH3 histone fusion

gene was mutated by substituting leucine at amino acid

position 10 and proline at position 12 with histidine

residues. It was predicted that the introduction of two

positively charged amino acids into the hydrophobic region











of the signal peptide would disrupt its recognition by the

signal peptide recognition particle and would therefore,

prevent the translocation of the mutated histone fusion mRNA

to membrane-bound polysomes.

An oligonucleotide (SPa) containing two point mutations

was synthesized by Tom Doyle in the Department of

Microbiology and Immunology, University of Florida,

Gainesville, Florida. The oligonucleotide was composed of

the following sequence: 5' CAAAAAAGTGAATATGGGCGA 3', with

the mutated nucleotides underlined. The oligonucleotide was

received in -2.5 ml 37% ammonium hydroxide and was heated at

550C for 6 hours to remove the protecting amine group. The

sample was dried under a gentle stream of air in the fume

hood and resuspended in 1 ml ddH20. The sample was extracted

two times with 600 ul n-butanol and the oligonucleotide was

precipitated from the aqueous phase by adding 200 ul 0.5 M

ammonium acetate and 2 ml 95% ethanol and chilling at -700C

for 30 minutes. The sample was centrifuged at 12,000 x g at

40C for 30 minutes, washed in 80% ethanol and resuspended in

200 ul ddH20. The yield of oligonucleotide was estimated

spectrophotometrically and was found to be 2.64 mg

(A260/A80 of 2.0).

A second oligonucleotide (ATG-) was designed to destroy

the signal peptide ATG translation start codon of the SPH3

fusion gene and thereby completely block the synthesis of

any signal peptide. The SPH3ATG- mRNA retains the histone











translation start codon in its proper context, although

further downstream from the 5' terminus than endogenous H3

histone mRNA, and should therefore be translated on

nonmembrane-bound polysomes. In addition, SPH3ATG- mRNA

differs from SPH3 wild type signal peptide-histone fusion

mRNA at only one nucleotide. The sequence of the ATG-

oligonucleotide is as follows: 5' AATACTCAAACTCTTCC 3', and

was prepared and processed as described for the SPa

oligonucleotide. The yield of ATG- oligonucleotide was only

445 Ag (A260/A280 of 1.41).



Optimization of Conditions for Site-Directed Mutagenesis

It was necessary to optimize the conditions for the

hybridization of the oligonucleotide to M13 template so that

the synthesis of the second strand was primed by the

oligonucleotide from the correct site. Proper priming by the

oligonucleotide was tested by primer extension analysis.

After limited primer extension, the samples were digested

with a restriction endonuclease that recognized a site

downstream from the expected priming site. The number and

intensity of the fragments produced by the digestion

indicated the number of priming sites and the location of

the preferred site.

The oligonucleotide (20 pmol) was phosphorylated with 5

units T4 polynucleotide kinase in 100 mM Tris-HCl pH 8.0, 10

mM MgC12, 5 mM dithiothreitol, 20 uCi [gamma-32P] ATP at 370C











for 45 minutes. The reaction was terminated by heating at

650C for 10 minutes, and unincorporated radiolabeled

nucleotides were removed by chromatography through a

Sephadex G-25 (Pharmacia) column (10 mm x 100 mm) in 50 mM

ammonium bicarbonate (pH 7.8).

The phosphorylated oligonucleotide (10-30 molar excess

over template DNA) was added to 0.5 pmol of M13 recombinant

DNA and the volume was adjusted to 10 ul with ddHO2 and 1 ul

solution A (200 mM Tris-HCl pH 7.5, 100 mM MgCl2, 500 mM

NaCl, 10 mM dithiothreitol). The solution was heated at 550C

for 5 minutes and then cooled for 5 minutes at room

temperature. The primer extension reaction also contained 1

ul of 2.5 mM dCTP, 1 ul 2.5 mM dATP, 1 ul 2.5 mM dTTP, 1 ul

2.5 mM dGTP, 0.5 ul solution A and 1 unit Klenow enzyme. The

reaction proceeded at room temperature for 5 minutes and was

terminated by heating at 650C for 10 minutes. The sample was

diluted with 2 ul 10x PstI buffer (100 mM Tris-HCl pH 7.5, 1

M NaCI, 100 mM MgCl2, 1 mg/ml BSA) and 7 ul ddHO2 and then

digested with 1 ul PstI restriction endonuclease [5 U/ul] at

370C for 1 hour. The sample was heated at 1000C for 2

minutes, quickly cooled to 0C and diluted with 20 ul S1

loading buffer. The PstI digested samples (10 ul) were

resolved electrophoretically in 5% acrylamide (20:1;

acrylamide:bis), 7 M urea at 300 volts (-35 mA) for 1.5

hours. The gels were dried under vacuum at 800C for 1 hour

and analyzed by autoradiography. Primer extension analysis









66

revealed a single major band at -80 bp for each molar ratio

of oligonucleotide to template DNA studied. This was the

expected size fragment and suggested that under these

conditions, the oligonucleotide was priming the synthesis of

the second strand from the proper site. If several

predominant bands had been detected (i.e. multiple priming

sites), more stringent annealing conditions would have been

required.



Synthesis of the Mutated Strand

The oligonucleotide (1.3 Mg) was phosphorylated in 100

mM Tris-HCl pH 8, 10 mM MgCl2, 5 mM dithiothreitol, 10 uM

ATP with 15 units T4 polynucleotide kinase at 370C for 45

minutes. The reaction was terminated by heating at 650C for

10 minutes.

The phosphorylated oligonucleotide (13.3 pmole) was

annealed to M13/SPH3 recombinant DNA in Ix solution A by

incubating the sample at 550C for 5 minutes and then at room

temperature for 5 minutes. After hybridization, the DNA was

diluted with 10 ul solution C (1 ul solution B [0.2 M Tris-

HC1 pH 7.5, 0.1 M MgCl2, 0.1 M dithiothreitol], 1 ul 10 mM

dCTP, 1 ul 10 mM dTTP, 1 ul 10 mM dGTP, 0.5 ul 0.1 mM dATP,

1 ul 10 mM ATP, 1.5 ul [gamma-32P] dATP, 1.5 ul T4 DNA ligase

[1 U/ul], 2 ul ddH20) and the synthesis of the second strand

was initiated with 0.5 ul Klenow enzyme [100 U/16.7 ul] at

room temperature. After 5 minutes, 1 ul 10 mM dATP was added











and the incubation was continued at room temperature

overnight.



Enrichment for Covalently Closed Double-Stranded DNA

The in vitro synthesis of the entire second strand is

very inefficient due primarily to the large size of the M13

genome. The percent of covalently closed, double-stranded

DNA molecules is therefore, very small in comparison to the

partially double-stranded, incomplete DNA molecules. These

incomplete DNA molecules, when transfected into bacteria,

give rise to wild type plaque formation which complicates

the selection process for the mutated clones. Enrichment for

covalently closed, double-stranded DNA molecules by alkaline

sucrose gradient centrifugation greatly facilitates the

selection process.

The DNA was precipitated from the overnight extension

and ligation reaction by adding 30 ul ddH20, 50 ul 1.6 M

NaCl-13% PEG at 0C for 15 minutes. The DNA was pelleted at

12,000 x g at room temperature for 15 minutes. The pellet

was gently washed in 100 ul cold 0.8 M NaCl-6.5% PEG,

centrifuged at 12,000 x g for 30 seconds and resuspended in

180 ul TE buffer. The sample was denatured with 20 ul 2 N

sodium hydroxide and layered onto a 5%-20% alkaline sucrose

step gradient. The gradient was prepared by adding to a 0.5

in x 2 in centrifuge tube nitrocellulosee or polyallomer; do

not use Beckman Ultra-clear tubes which are incompatible











with the alkali conditions), in order, the following

solutions each containing 0.2 N NaOH, 1 M NaCl, 2 mM EDTA:

1) 1 ml 20% sucrose; 2) 1 ml 17.5% sucrose; 3) 1 ml 15%

sucrose; 4) 1 ml 10% sucrose; 5) 5% sucrose. The tube was

incubated at 40C for 2 hours. The samples were centrifuged

through the alkaline sucrose gradients in a Beckman SW 50.1

rotor at 37,000 rpm for 2 hours at 40C without the brake.

The samples were recovered from the gradients by puncturing

the bottom of the tube with a 21 gauge needle and collecting

7 drops per fraction in 1.5 ml microcentrifuge tubes

(usually -60 fractions). Fractions containing covalently

closed, double-stranded DNA were determined by Cherenkov

scintillation counting in the tritium channel, pooled and

neutralized with 1M Tris-citrate pH 5.



Isolation of Mutated M13 Recombinant Bacteriophage

The DNA was transfected into E. coli JM101 competent

cells, plated onto YT agar and incubated overnight at 370C.

Individual plaques were picked and bacteriophage were

subsequently prepared. Bacteriophage suspensions (2 ul) were

spotted onto a 0.45 micron nitrocellulose filter and

prehybridized in 6x SSC, 10x Denhardt's, 0.2% SDS (10 ml/100

cm2) at 670C for 1 hour. The filter was rinsed in 50 ml 6x

SSC for 1 minute at 210C and hybridized in 10 ml 6x SSC, 10x

Denhardt's containing 1x106 cpm radiolabeled oligonucleotide

at 210C for 1 hour. The filter was washed three times in 50

ml 6x SSC at 210C for a total of 10 minutes. The filter was











briefly dried under a heat lamp and placed against pre-

flashed XAR5 x-ray film without a screen for 1 hour at room

temperature. Under such low stringency each phage spot was

positive, including the negative control M13/SPH3 wild type

bacteriophage. The filter was re-washed at 350C in 6x SSC

for 5 minutes, air dried and exposed to pre-flashed XAR5

film for 1 hour. At the higher wash temperature many of the

phage spots were less intense whereas several remained

unchanged. When the filter was washed at 480C in 6x SSC for

5 minutes the negative control and nearly all the phage

spots completely disappeared. The bacteriophage (-5%) that

remained positive after the 480C wash were sequenced to

confirm the presence of the mutations.



DNA Sequencing

The site directed mutations in M13/SPH3 recombinant

DNAs were confirmed by Sanger's dideoxynucleotide chain

terminator DNA sequencing procedure using the "SequenaseTM

DNA Sequencing Kit" from United States Biochemical

Corporation, Cleveland, Ohio. The Sequenase enzyme is

derived from bacteriophage T7 DNA polymerase and has been

modified to efficiently use dideoxyribonucleotides, alpha-

thio deoxyribonucleotides and other nucleotide analogs that

are commonly used for sequencing. In addition, the Sequenase

enzyme expresses high processivity and low 3'-5' exonuclease

activity.










Annealing Template and Primer

The primer for synthesizing the complementary strand of

wild type and mutated M13/SPH3 recombinant DNA is a 20 bp

oligonucleotide which hybridizes to a site adjacent to the

polylinker. The annealing reaction was prepared by adding 1

ul priier (0.5 pmol), 7 ul single-stranded M13/SPH3

recombinant DNA (0.5-1.0 pmol) and 2 ul 5X sequencing buffer

(200 mM Tris-HCl pH 7.5, 100 mM MgCl2, 250 mM NaC1). The

sample was heated at 650C for 2 minutes and slowly cooled to

room temperature.



Labeling Reaction

The complementary strand was synthesized by incubating

the annealed sample with 1 ul 100 mM dithiothreitol, 2 ul

labeling nucleotide mix (1.5 uM dGTP, 1.5 uM dCTP, 1.5 uM

dTTP), 0.5 ul [a- S] dATP [10 uCi/ul] and 2 ul Sequenase

[1.5 U/ul] at room temperature for 5 minutes. Elongation was

terminated by mixing 3.5 ul aliquots of the labeling

reaction with 2.5 ul of one of the dideoxy nucleotide

solution (ddATP, ddCTP, ddGTP, ddTTP). The dideoxy

nucleotide solutions were 80 uM dATP, 80 uM dCTP, 80 uM

dGTP, 80 uM dTTP, 50 mM NaCl and 8 uM of the appropriate

dideoxyribonucleotide. The sequencing samples were diluted

with 4 ul stop solution (95% formamide, 20 mM EDTA, 0.05%

bromophenol blue and 0.05% xylene cyanol), heated at 750C

for 2 minutes and loaded onto a 6% acrylamide-8.3 M urea gel









71

(32.5 cm x 44 cm) with a 60 well shark toothed comb. The gel

was run at 75 W constant, ~2500 V, -40 mA for 3-5 hours

(Xylene Cyanol dye was 15 cm from the bottom of gel). The

gel was soaked in 10% acetic acid-12% methanol in the fume

hood for 1 hour, placed onto 2 sheets of 3 MM Whatman paper,

and dried under vacuum at 800C for 45 minutes. The gel was

exposed to preflashed XAR5 x-ray film at room temperature

for 12-18 hours.



Transfection of DNA into Cells

Introduction of Plasmid DNA into Bacterial Cells

An E. coli overnight cell culture was diluted 1:100

into 100 ml LB medium and incubated at 370C until the

optical density was approximately 0.37 at 590 nm. The cells

were chilled at 0C for 10 minutes and then centrifuged at

5,000 rpm, 40C for 5 minutes in a Beckman JA20 rotor. The

pellet was resuspended in 20 ml of cold CaC12 buffer (60 mM

CaCI2, 10 mM Pipes pH 7.0, 15% glycerol) and incubated at

0C for 30 minutes. The cells were collected by

centrifugation at 2,500 rpm for 5 minutes at 40C in a JA20

rotor, resuspended in 2.6 ml CaC12 buffer and divided into

100-200 ul aliquots. The competent cells were either used

immediately for transformation or stored in microcentrifuge

tubes at -80C.

For transformation, 100 ul competent E. coli cells were

mixed with 10 ul plasmid DNA (-10 ng) and incubated at OC

for 10 minutes. The cells were then heat shocked at 370C for











5 minutes, diluted with 0.9 ml prewarmed LB medium and

incubated at 370C for 1 hour. Different volumes of the

transfected bacterial cell culture (usually 10-200 ul) were

plated onto the appropriate medium dictated by the genotype

of the host and the introduced plasmid DNA.



Introduction of DNA into HeLa Cells

HeLa monolayer cell cultures were transfected with

plasmid DNA, according to Gorman et al. (1982), in a calcium

phosphate/DNA complex prepared as described by Graham and

van der Eb (1973). HeLa S3 cells growing exponentially in

suspension culture were plated into 20 ml completed EMEM

(EMEM supplemented with 5% fetal calf serum, 5% horse serum,

100 U penicillin, 100 gg/ml streptomycin and 1 mM glutamine)

at 3x106 cells per 10 cm tissue culture dish (Corning or

Falcon) and incubated overnight at 370C in 5% CO2. The

monolayer cell culture was refed with 10 ml completed EMEM

and incubated at 370C in 5% CO2 for 4 hours. The DNA/calcium

phosphate precipitate was prepared by adding 20 gg DNA in

500 ul 250 mM CaCl2 dropwise to 500 ul 2x Hebs buffer (50 mM

Hepes, 280 mM NaC1, 1.5 mM Na2HPO4, pH 7.120.05) while

vortexing the solution. The DNA/CaC12 precipitate was added

dropwise to the monolayer cell culture and incubation was

continued at 37C in 5% CO2 for 4 hours. The HeLa cells were

glycerol shocked by replacing the medium with 2 ml completed

EMEM containing 15% glycerol for 1 minute. The transfected










cells were then washed with 10 ml EMEM, refed with 20 ml

completed EMEM and incubated at 370C, 5% CO2.



Establishment of Polyclonal and Monoclonal Stably
Transformed Cell Lines

Polyclonal and monoclonal cell lines were isolated by

growing HeLa cell cultures that were co-transfected with

pSV2neo and the plasmid DNA of interest in medium containing

the antibiotic G418. The plasmid pSV2-neo, constructed by

Southern and Berg (1982), carries the bacterial

aminoglycoside phosphotransferase 3' (II) gene under the

control of the SV40 early promoter and confers resistance to

the aminoglycoside antibiotic G418. The rationale behind the

co-transfection method is that HeLa cells that are competent

to take up pSV2-neo DNA are equally competent to take up the

plasmid DNA of interest, and therefore, a certain percentage

of the G418 resistant cells contain both species of DNA.

Ideally, the selectable marker should be carried by the

vector that contains the gene which is to be studied.

HeLa cells in monolayer culture were co-transfected

with the plasmid DNA to be studied and pSV2-neo DNA (molar

ratio of 20:1, respectively) by the calcium phosphate

precipitation method as described above. After 36-48 hours

post-glycerol shock, the transfected cells were resuspended

in 5 ml Puck saline A [0.04% (w/v) KC1, 0.8% (w/v) NaC1,

0.035% (w/v) NaHCO3, 0.1% (w/v) glucose] containing 0.02%









74

(w/v) EDTA and 0.5 ml of the cell suspension was seeded into

20 ml completed EMEM containing 500 gg/ml biologically

active Geneticin (G418, Gibco) in 10 cm tissue culture

dishes. The cells were incubated at 370C, 5% CO, and refed

every 3-4 days with completed EMEM containing G418

antibiotic. Within 2-3 weeks, the majority of the cells had

died and individual colonies of G418 resistant HeLa cells

had formed. Polyclonal cell lines were established by

combining the G418 resistant colonies from a 10 cm dish as a

single, heterogeneous cell population (usually 20-40

colonies). For the establishment of monoclonal cell lines,

individual colonies were picked from the dish with sterile

pasteur pipettes and cultured as separate cell lines.















CHAPTER 3

SUBCELLULAR LOCATION OF HISTONE mRNAs ON CYTOSKELETON
ASSOCIATED NONMEMBRANE-BOUND POLYSOMES IN HELA S3 CELLS


INTRODUCTION

Histone biosynthesis occurs primarily during the S

phase of the cell cycle and is temporally as well as

functionally coupled with DNA replication (Allfrey et al.,

1963; Prescott, 1966; Spaulding et al., 1966; Robbins and

Borun, 1967; Stein and Borun, 1972). Early studies using in

vitro translation analysis of polysomal RNA isolated from S

phase HeLa cells provided an initial indication that histone

protein synthesis occurs on non-membrane-bound, light

polysomes (Jacobs-Lorena et al., 1972; Liautard and

Jeanteur, 1979; Gallwitz and Breindl, 1972; Borun et al.,

1967). In these studies it was demonstrated that

translatable, polysome-associated histone mRNAs have a

sedimentation coefficient of 8-10S and fluctuate in a cell

cycle-dependent manner. Histone mRNA was not detected by in

vitro translation studies on polyribosomes isolated from

HeLa cells in the G1 phase of the cell cycle (Borun et al.,

1967; Borun et al., 1975; Pederson and Robbins, 1970).

Consistent with this observation, the inhibition of DNA

replication by hydroxyurea or cytosine arabinoside treatment











resulted in the rapid disappearance of histone mRNAs from

these polysomes (Borun et al., 1967; Breindl and Gallwitz,

1974; Gallwitz, 1975).

The light polysomes on which translatable histone mRNAs

reside are presumably nonmembrane-bound ("free") polysomes

as predicted by the signal hypothesis (Blobel and

Dobberstein, 1975). Several lines of evidence suggest that

nonmembrane-bound polysomes are not freely diffusible within

the cytoplasm but are attached to the cytoskeleton. Penman

and co-workers (Lenk et al., 1977) have demonstrated that

nearly 100% of total cytoplasmic polysomes co-fractionate

with the cytoskeletal framework. In addition, vesicular

stomatitis virus encoded nonmembrane-bound and membrane-

bound polysomal mRNAs are associated with the cytoskeleton

in virally infected HeLa cells (Cervera et al., 1983).

Taken together, these observations provide a basis for

the possibility that histone mRNA-containing polysomes

and/or their subcellular location may play a role in the

regulation of histone gene expression. Such reasoning is

consistent with the appearance of translatable histone mRNAs

on polysomes within minutes following transcription (Borun

et al., 1967), the equally rapid transfer of newly

synthesized histones into the nucleus where they complex

with DNA (Robbins and Borun, 1967; Spaulding et al., 1966),

and the degradation of histone mRNAs and cessation of

histone protein synthesis in parallel with the inhibition of











DNA replication (Spaulding et al., 1966; Robbins and Borun,

1967; Borun et al., 1967; Baumbach et al., 1984). To address

the relationship between the localization of histone mRNAs

and the control of cellular histone mRNA levels, we have

used cloned human histone genes to examine the distribution

of histone mRNAs on nonmembrane-bound and membrane-bound

polysomes and the association of histone mRNA-containing

polysomes with the cytoskeleton. As predicted from previous

results of in vitro translation analysis and cDNA

hybridization studies, histone mRNAs were found to reside

predominantly on nonmembrane-bound polysomes. Both the

nonmembrane-bound polysomes containing histone mRNAs and the

membrane-bound polysomes containing the cell surface class I

HLA-B7 antigen mRNAs were found associated with the

cytoskeleton.



RESULTS

Localization of Histone mRNA and HLA-B7 mRNA in Subcellular
Fractions

To determine the intracellular locations of histone

mRNA and HLA-B7 mRNA, HeLa cells were first fractionated

into nonmembrane-bound and membrane-bound polysomal

components by the procedure outlined in Fig. 2-2. The

membrane-bound polysomes are represented by the mitochondria

associated rough endoplasmic reticulum (MRER) and the

nucleus associated rough endoplasmic reticulum (NRER)










fractions. The light endoplasmic reticulum (LER), which is

deficient in polysomes by definition, was also isolated

following this subcellular fractionation scheme. Histone and

HLA-B7 mRNA content in each of the subcellular fractions was

determined by Northern blot analysis. Briefly, RNA was

extracted from the samples, quantitated and electrophoresed

in agarose under denaturing conditions. The RNA was then

transferred to nitrocellulose filters for hybridization with
P-labeled (nick-translated) pFOO08A (H4 histone), pFF435C

(H3 histone) and pDP001 (cDNA clone of HLA-B7 class I

antigen) DNA probes. A typical screening of subcellular

fractions with these probes is represented by the

autoradiograph in Figure 3-1, and Table 3-1 summarizes the

numerical values derived from densitometric analysis of the

Northern blot. The HLA-B7 mRNA and histone mRNA species are

each present in total cellular RNA and total polysomal RNA

which were included as positive controls. Non-membrane-bound

polysomal RNA contains approximately 55% and 51% of the

total H4 and H3 histone mRNA, respectively. Surprisingly,

the LER fraction contains approximately 38% of the H4

histone mRNA and 41% of the H3 histone mRNA, which may be a

consequence of the method by which the fraction is isolated.

The LER and non-membrane-bound polysomal sample is

centrifuged through a 2 M sucrose pad under conditions where

the LER forms a loose band on top of the pad, while the

nonmembrane-bound polysomes are pelleted. The LER band is











removed by aspiration and occasionally material is removed

from within the sucrose pad. This material may be the source

of histone mRNA in the LER fraction, which could decrease

the true percentage of total histone message found on the

nonmembrane-bound polysomes. The HLA-B7 mRNA was located

almost exclusively on membrane-bound polysomes. Nearly 90%

of the HLA-B7 mRNA was collectively found on the NRER and

MRER, while less than 11% was measured in the LER and

nonmembrane-bound polysomal RNA fractions.



Histone mRNA and HLA-B7 mRNA Distribution Between Csk and
Sol Fractions

Existing within the cytoplasm of eukaryotic cells is an

intricate network of protein filaments, which is referred to

as the cytoskeleton. This structure can be prepared from

HeLa cells treated with non-ionic detergent as described by

Penman and coworkers (Cervera et al., 1981). We used this

procedure for the isolation of the cytoskeleton (Csk) and

soluble (Sol) fractions which were subsequently assayed for

mRNA content by Northern blot analysis.

Log phase, suspension grown HeLa S3 cells were

fractionated into a Csk phase and Sol phase as described in

Chapter 2. Although this fractionation procedure has been

characterized previously (Lenk and Penman, 1979), we

examined the protein heterogeneity of each fraction by two-

dimensional gel electrophoresis and immunoblotting

techniques in collaboration with Dr. Warren Schmidt. As seen









Figure 3-1. Northern blot analysis of H3 histone. H4 histone
and HLA-B7 mRNA in subcellular fractions.

The cytoskeleton and soluble fractions, as well as the
nonmembrane-bound and membrane-bound polysomal RNA
fractions, were isolated from HeLa cells by the procedures
described in Chapter 2 (Cervera et al., 1981; Venkatesan and
Steele, 1972). In addition, total polysomal RNA and total
cellular RNA were isolated (Plumb et al., 1983, Venkatesan
and Steele, 1972). RNA was extracted from each subcellular
fraction and 50 yg of RNA from each preparation was resolved
by 1.5% agarose, 6% formaldehyde gel electrophoresis. The
RNA was transferred to nitrocellulose and hybridized to
radiolabeled pFF435C (H3 histone and pFO108A (H4 histone)
probes, followed by hybridization to P-labeled (nick-
translated) pDP001 (cDNA of HLA-B7) probe. The hybridized
filters were then exposed to preflashed XAR5 x-ray film at -
700C for 72 hours. From left to right, lanes: 1) total
cellular RNA; 2) Csk RNA; 3) Sol phase RNA; 4) NRER; 5)
MRER; 6) nonmembrane-bound polysomal RNA; 7) LER; and 8)
total polysomal RNA.























H LA-B7








1 2 3 4 5 6 7 8









82

Table 3-1. Quantity of histone and HLA-B7 mRNAs in the
subcellular fractions.

H3 H4 HLA-B7
Cytoskeleton 90% 84% 97%
Soluble 10% 16% 3%

NRER 3% 3% 29%
MRER 6% 5% 60%
Free 51% 54% 5%
LER 40% 38% 6%

The distribution of histone and HLA-B7 mRNAs in the
NRER, MRER, LER and nonmembrane-bound polysomal fractions as
well as the cytoskeleton and soluble fractions was
determined by Northern blot analysis. The values have been
normalized with respect to the total yield of RNA within
each fraction.











in Figure 3-2, the cytoskeleton fraction clearly contained

actin as well as the major HeLa cytokeratins (Franke et al.,

1981). In addition, vimentin appeared to be enriched in the

cytoskeleton, which was confirmed by immunoblot analysis.

Extraction of the cytoskeleton required a cold, calcium

containing buffer and consequently the tubulins were

solubilized and therefore absent in the Csk fraction. The

tubulin proteins were clearly contained in the soluble

fraction as determined by immunoblot analysis. Additional

support for separation of cytoskeleton and soluble phases

comes from the observation that the bulk of the tRNA species

is in the soluble phase which is in agreement with

previously reported values (data not shown; Cervera et al.

1983). Although the HLA-B7 messenger RNA is found on

membrane-bound polysomes and the histone mRNA on

nonmembrane-bound polysomes, both species of messenger RNAs

are associated almost exclusively with the cytoskeletal

fraction. Nearly 97% of the HLA-B7 mRNA and approximately

85-90% of the H3 and H4 histone messages are retained in the

Csk (Fig. 3-1; Table 3-1).



The Effects of Metabolic Inhibitors on the Subcellular
Localization of Histone and HLA-B7 mRNA

Detectable levels of histone mRNA were observed in each

of the subcellular samples, including the Sol fraction and

the membrane-bound polysomal fractions. However, the HLA-B7









Figure 3-2. Two-dimensional gel electrophoresis of
cvtoskeleton and soluble associated proteins.

HeLa cells were fractionated into a cytoskeleton and
soluble phase, protein was extracted from each phase and
subsequently analyzed by two-dimensional gel electrophoresis
as described in Chapter 2. Proteins of the soluble fraction
(Sol), A, were separated using wide range (pH 3-7)
ampholines while cytoskeletal proteins (Csk), B, were
separated with narrow range (pH 5-7) ampholines to more
clearly identify cytoskeletal species. V: vimentin, a:
actin, and t: tubulins. Unlabeled arrows in B depict HeLa
cytokeratins of 54 Kd (pI 6.0); 52.5 Kd (pI 6.1); 46 Kd (pI
5.1); and 45 Kd (pI 5.7), which were spots highly reactive
with commercially prepared prekeratin or stratum corneum
antisera (Franke et al., 1981).









pH
7.0 6.4
T v


5.2 4.1
T T


5.4 5.0 4.4
T T V


A)








43K-


43K-


I A


CSK


SOL ...









86

mRNA was located almost exclusively in the cytoskeleton and

membrane-bound polysome fractions. The widespread

subcellular localization of histone mRNA may be due to non-

specific trapping of nonmembrane-bound polysomes in each of

the fractions during the isolation procedure. Alternatively,

this observation may reflect the presence of mRNAs encoding

variant histone proteins that could be targeted to the

different cytoplasmic compartments. Inhibition of DNA

synthesis with hydroxyurea results in a rapid

destabilization of cell cycle dependent histone mRNAs,

whereas cell cycle independent histone mRNAs remain stable

in the presence of this drug (Baumbach et al., 1984; Heintz

et al., 1983; DeLisle et al., 1983; Graves and Marzluff,

1984; Plumb et al., 1983). Conversely, inhibition of protein

synthesis with cycloheximide results in a 2-3 fold increase

in cytoplasmic levels of histone mRNAs (Butler and Mueller,

1973; Baumbach et al., 1984). Differential sensitivity of

histone mRNAs in the subcellular fractions to hydroxyurea or

cycloheximide treatment would favor the latter suggestion

that cell cycle dependent and independent histone gene

transcripts may selectively reside in specific cytoplasmic

compartments.

Treatment of exponentially growing HeLa cells with

hydroxyurea, as described in Chapter 2, resulted in a

complete and selective destabilization of histone mRNA in

the LER, nonmembrane-bound and membrane-bound polysomal











fractions (Figure 3-3). This is in sharp contrast to the

HLA-B7 mRNA which appeared to be fully stable under these

conditions. Cycloheximide treatment had a stabilizing effect

on the levels of histone mRNA in each subcellular fraction

(Figure 3-3). When compared with control HeLa cells,

cycloheximide treatment resulted in a 2.1 fold (H4) and a

2.4 fold (H3) increase in the levels of histone mRNA in the

nonmembrane-bound polysomal fraction. Similar increases were

also seen for levels of histone mRNAs in the LER and

membrane-bound polysomal fractions. Inhibition of protein

synthesis with cycloheximide followed by DNA synthesis

inhibition with hydroxyurea resulted in the stabilization of

histone mRNA in each subcellular fraction, whereas the

stability of HLA-B7 mRNA remained unaffected (Figure 3-3).

Similar results were obtained when these inhibitor studies

were expanded to include the cytoskeleton and soluble

fractions (Figure 3-4). Cycloheximide treatment resulted in

a 2-3 fold increase in the representation of H3 and H4

histone mRNA over untreated cultures in both the

cytoskeleton and soluble fractions. HLA-B7 mRNA appeared to

be only moderately stabilized in the presence of this drug.

When cells were treated with hydroxyurea, histone mRNA

levels were greatly reduced in both the cytoskeleton and

soluble fractions whereas the HLA-B7 mRNA was found in

comparable levels to those present in the untreated samples.

Consistent with previous data, cotreatment of HeLa cells









Figure 3-3. Northern blot analysis of H3 histone. H4 histone
and HLA-B7 mRNAs isolated from subcellular fractions of
cells treated with metabolic inhibitors.

Exponentially growing HeLa cells were incubated in the
presence of metabolic inhibitors and fractionated into
nonmembrane-bound and membrane-bound polysomes as described
in Chapter 2. RNA was extracted from each fraction and
assayed for H3 histone mRNA, H4 histone mRNA and HLA-B7 mRNA
content by Northern blot analysis as described in Figure 3-1
and Chapter 2. Upper panel from left to right, lanes: 1)
control (untreated), nonmembrane-bound polysomes; 2)
control, NRER; 3) control, MRER; 4) control, LER (omitted);
5) cycloheximide (Cy), nonmembrane-bound polysomes; 6) Cy,
NRER; 7) Cy, MRER; and 8) Cy, LER. Lower panel from left to
right, lanes: 1) hydroxyurea (HU), nonmembrane-bound
polysomes; 2) Hu, NRER; 3) Hu, MRER; 4) Hu, LER; 5) CY/HU,
nonmembrane-bound polysomes; 6) Cy/Hu, NRER; 7) Cy/Hu, MRER;
and 8) Cy/Hu, LER.




Full Text
172
In addition, CD at concentrations equal to or greater than
10 jLtg/ml releases poly-A+ RNA from the cytoskeleton in a
dose dependent manner (Ornelles et al.. 1986). The release
of poly-A+ RNA from the cytoskeleton occurs in a dose
dependent manner and results in a stoichiometric inhibition
of protein synthesis.
To study immediate gene responses to cytochalasin D,
exponentially growing HeLa S3 cells were treated with 10
lig/ml of the drug for only 15 minutes. From each cell
culture total cellular RNA for Northern blot analysis and
nuclei for in vitro nuclear run-on transcription analysis
were isolated as described in Chapter 2. As shown in Figure
7-1, Northern blot analysis reveals a rapid and extensive
accumulation of c-fos mRNA in CD treated cells (lane 2). The
response of the c-fos gene is in sharp contrast to hCGar mRNA
steady state levels which are unaffected by the drug
treatment (Fig. 7-1). Quantitation by scanning laser
densitometry of several exposures of autoradiograms obtained
from four separate experiments indicates an average increase
of 20 fold in c-fos mRNA levels (Fig. 7-2). The
concentration of cytochalasin D used in these experiments
inhibits protein synthesis by 50 percent (Ornelles et al..
1986) It is well established that inhibition of protein
synthesis leads to an increase in c-fos mRNA presumably due
to increased mRNA stability (Muller et al., 1984; Mitchell
et al. 1985? Andrews et al.. 1987? Rahmsdorf et al.. 1987).


4-8 Effects of hydroxyurea treatment on SPH3E1ATG"
mRNA 121
4-9 Effects of hydroxyurea treatment on SPH3Elalpha
mRNA 123
4-10 Quantitation of SPH3E1, SPH3Elalpha, SPH3E1ATG'
mRNA during hydroxyurea treatment 125
5-1 Northern blot analysis of the cytoskeleton and
soluble phase distribution of H3 histone, H4 histone
and HLA-B7 mRNAs in cytochalasin D treated cells.... 135
5-2 Northern blot analysis of the cytoskeleton and
soluble phase distribution of c-fos mRNA in
cytochalasin D, puromycin, CD/puro, and
CD/cycloheximide treated cells 140
5-3 Northern blot analysis of the cytoskeleton and
soluble phase distribution of nonmembrane-bound
and membrane bound polysomal mRNAs in cytochalasin D,
puromycin, CD/puro and CD/cycloheximide treated
cells 145
6-1 Cytochalasin D and puromycin cotreatment does not
release SPH3E1 or SPH3E1ATG mRNA from the
cytoskeleton 157
6-2 The wild type signal peptide-histone fusion mRNA is
not released from the cytoskeleton in CD and
puromycin cotreated polyclonal HeLa cell cultures... 161
6-3 Endogenous membrane-bound polysomal mRNAs are
released from the cytoskeleton during cotreatment
with CD and puromycin in SPH3E1 and SPH3E1ATG"
expressing cell cultures 163
7-1 Effects of cytochalasin D and puromycin treatment on
steady state levels of c-fos and chorionic
gonadotropin mRNA 175
7-2 Densitometric analysis of steady state levels of
c-fos mRNA during cytochalasin D and puromycin
treatments 177
vii


211
Huxley, H. (1973) Nature 243, 445.
Isaacs, W., and Fulton, A. (1987) Proc. Natl. Acad. Sci.
U.S.A. 84/ 6174.
Izant, J., and Lazarides, E. (1977) Proc. Natl. Acad. Sci.
U.S.A. 74, 1450.
Jacobs-Lorena, M., Baglioni, C., and Borun, T. (1972) Proc.
Natl. Acad. Sci. U.S.A. 69, 2095.
Jeffery, W. (1984) Dev. Biol. 103, 482.
Kaiser, C., and Botstein, D. (1986) Mol. Cell. Biol. 6,
2382.
Kaiser, C., Preuss, D., Grisafi, P., and Botstein, D. (1987)
Science 235. 312.
Kane, R. (1975) J. Cell Biol. 66, 305.
Kedes, L. (1979) Annu. Rev. Biochem. 4_8, 837.
Laeminli, U. (1970) Nature 227. 680.
Lawrence, J., and Singer, R. (1986) Cell 45, 407.
Lawrence, J., Singer, R., Villnave, C., Stein, J., and
Stein, G. (1988) Proc. Natl. Acad. Sci. U.S.A. 85, 463.
Lazarides, E. (1980) Nature 283. 249.
Lazarides, E., and Hubbard, B. (1976) Proc. Natl. Acad. Sci.
U.S.A. 73, 4344.
Lemieux, R., and Beaud, G. (1982) Eur. J. Bioch. 129, 273.
Lenk, R., and Penman, S. (1979) Cell 6, 289.
Lenk, R., Ransom, L., Kaufmann, Y., and Penman, S. (1977)
Cell 10, 67.
Levine, B., Chodchoy, N., Marzluff, W., and Skoultchi, A.
(1987) Proc. Natl. Acad. Sci. U.S.A. M/ 6189.
Li, W., Reddy, R., Henning, D., Epstein, P., and Busch, H.
(1982) J. Biol. Chem. 257, 5136.
Liautard, J., and Jeanteur, P. (1979) Nucl. Acids Res. 7
135.


CHAPTER 3
SUBCELLULAR LOCATION OF HISTONE mRNAs ON CYTOSKELETON
ASSOCIATED NONMEMBRANE-BOUND POLYSOMES IN HELA S3 CELLS
INTRODUCTION
Histone biosynthesis occurs primarily during the S
phase of the cell cycle and is temporally as well as
functionally coupled with DNA replication (Allfrey et al..
1963; Prescott, 1966; Spaulding et al. 1966; Robbins and
Borun, 1967; Stein and Borun, 1972). Early studies using in
vitro translation analysis of polysomal RNA isolated from S
phase HeLa cells provided an initial indication that histone
protein synthesis occurs on non-membrane-bound, light
polysomes (Jacobs-Lorena et al.. 1972; Liautard and
Jeanteur, 1979; Gallwitz and Breindl, 1972; Borun et al.
1967). In these studies it was demonstrated that
translatable, polysome-associated histone mRNAs have a
sedimentation coefficient of 8-10S and fluctuate in a cell
cycle-dependent manner. Histone mRNA was not detected by in
vitro translation studies on polyribosomes isolated from
HeLa cells in the G1 phase of the cell cycle (Borun et al..
1967; Borun et al.. 1975; Pederson and Robbins, 1970).
Consistent with this observation, the inhibition of DNA
replication by hydroxyurea or cytosine arabinoside treatment
75


mug. I would particularly like to thank the following
individuals for their tremendous inspiration: April, Emilie,
Ashley, Danny, Shannon, John, Aubrey, Stephan, Alan, Brooke,
Kate, Sarah and Nikki.
I would like to thank the members of the Department of
Immunology and Medical Microbiology. I will always remember
the football games in which Dr. Ed Siden led our team to an
undefeated record against the Pathology team starring Dr.
Ward Wakeland, and the late night ,,Nerf-ball" baseball games
in the hallway with Mark Labow, Paul Hermonat, Brian Masters
and Dick Wright.
Lastly, I would like to thank my family. The Lord has
truly blessed me with a loving and supportive family and I
fully appreciate all that they have done and sacrificed for
me during my studies.
iii


132
with the cytoskeleton (Jeffery, 1984; Stein et al.. 1977?
Adensik and Darnell, 1972; Zambetti et al.. 1985). The
distribution of histone mRNAs between the cytoskeletal and
the soluble fractions was determined by Northern blot
analysis before and after cytochalasin D treatment. As seen
in Figure 5-1, H3 and H4 cell cycle dependent histone mRNAs
are primarily associated with the cytoskeleton in untreated
HeLa cell cultures (lanes 1 and 2). Quantitation of the
autoradiograph in Figure 5-1 by scanning laser densitometry
revealed that >90% of the histone mRNAs were associated with
the cytoskeleton in control cell cultures (Table 5-1), which
is consistent with previously reported values (Zambetti et
al.. 1985). Upon addition of cytochalasin D, histone mRNAs
were released from the cytoskeleton into the soluble phase
(Fig. 5-1, lanes 3-8). As shown in Table 5-1, less than 35%
of the histone mRNAs remained associated with the
cytoskeleton in HeLa cell cultures treated with 10 g/ml
cytochalasin D. Treatment with 40 ^ig/xa. 1 cytochalasin D
resulted in the dissociation of >70% of the histone mRNAs
from the cytoskeleton. The extent to which cytochalasin D
releases non-polyadenylated histone mRNA from the
cytoskeleton is similar to that reported for total,
heterogeneous poly-A+ RNA (Ornelles et al. 1986).


BIOGRAPHICAL SKETCH
Gerard Paul Zambetti was born in Queens, New York, on
August 4, 1958. He attended Archbishop Molloy High School
(Queens, New York) and graduated in the spring of 1976. He
then attended the State University of New York at
Plattsburgh and graduated with a Bachelor of Science degree
in biochemistry and biophysics in the spring of 1980. He
then studied bacteriophage Lambda DNA replication and gene
regulation with Dr. Robert Shuster at Emory University
(Atlanta, Georgia) and graduated with a Master of Science
degree in biochemistry. He continued to research the
regulation of gene expression with Drs. Janet and Gary Stein
in the Department of Immunology and Medical Microbiology at
the University of Florida. In the fall of 1984, he married
Stacey Ann Chapman in Atlanta, Georgia, and on May 6, 1987,
they were blessed with a beautiful daughter, Shannon Kelly
Zambetti.
219


CHAPTER 2
GENERAL METHODS
Materials
[a-32P]dCTP (-3,000 Ci/mmol) [a-32P]dATP (-3,000
Ci/mmol), [gamma-32P]ATP (-3,000 Ci/mmol) and [a-35S]dATP
(>1,000 Ci/mmol) radionucleotides were purchased from
Amersham, Arlington Heights, IL; polyvinylsulfonic acid
(PVS), polyethylene glycol 8,000 (PEG), XAR-5 x-ray film
were obtained from Eastman Kodak Co., Rochester, NY;
ultrapure electrophoresis grade agarose and Zeta-probe nylon
membranes were from Bio Rad, Richmond, CA; formaldehyde
solution (37% w/w) was from Fisher Scientific, Fair Lawn,
NJ; nitrocellulose was from Schleicher and Schuell, Keene,
NH; RPI scintillator ppo-popop concentrated liquid
scintillator (Liquifluor) was from Research Products
International, Elk Grove Village, IL; formamide was from
Bethesda Reasearch laboratories (BRL), Gaithersburg, MD;
acrylamide, calf intestine alkaline phosphatase, nuclease
SI, Ej¡_ coli DNA polymerase I large fragment (Klenow enzyme)
and most restriction endonucleases were obtained from
Boehringer Mannheim Biochemicals (BMB), Indianapolis, IN; T4
DNA ligase was from New England Bio Labs (NEB), Beverly, MA;
27


36
standard protocol for the isolation of pUC8 related plasmid
DNAs is the same as described below except that the 500 ml
culture is inoculated directly and allowed to grow overnight
into the late log stage.
Starter cultures were prepared by inoculating 5 ml LB
medium"(Luria-Bertani medium: 1% Bacto tryptone, 0.5% Bacto
yeast extract, 1% NaCl) supplemented with 0.1% glucose with
25-50 ul of bacterial glycerol stock and incubated overnight
at 37C. The 5 ml starter culture was transferred to 500 ml
pre-warmed LB medium supplemented with glucose and incubated
at 37C until the optical density at 590 nm (O.D. 590) of the
culture reached 0.55 units. Plasmid DNA was amplified by
treating the culture with 200 ig/ml chloramphenicol
(prepared as a 20 mg/ml stock solution in 95% ethanol and
filter sterilized) at 37C for 12-16 hours. The bacteria
were centrifuged at 5,000 rpm, 4C for 10 minutes in a
Beckman JA-10 rotor and J2-21 centrifuge. The cell pellet
was resuspended in 10 ml solution I (50 mM glucose, 25 mM
Tris pH 8.0, 10 mM EDTA, 5 mg/ml lysozyme) and incubated at
room temperature for 5 minutes. The cells were lysed at 0C
with 20 ml solution II (1% SDS, 0.5 M NaOH) for 5 minutes.
The cell lysate was treated with 15 ml 5 M potassium
acetate, pH 4.8 and kept on ice for 5 minutes. The lysate
was transferred to a 50 ml polycarbonate tube and
centrifuged at 16,000 rpm for 20 minutes at 4C in Beckman
JA-20 rotor to pellet the bacterial DNA and cell debris. The


45
HeLa Cells
homogenize in RSB
centrifuge 2,000xg, 4C, 5'
I
supernatant A
pellet A
centrifuge ll,400xg
10'
I
supernatant B
pellet B
Triton/NaDOC
centrifuge 7,800x
10'
I I
Triton/NaDOC
centrifuge 500xg
10'
discard pellet
discard pellet supernatant D supernatant C
centrifuge
200,000xg, 2 hrs
2M sucrose
centrifuge
200,000xg, 2 hrs
2M sucrose
centrifuge
200,000xg, 2 hrs
2M sucrose
I 1
Band at pellet pellet pellet
interface
LER
Nonmembrane-bound
NRER
MRER



PAGE 1

7+( 52/( 2) 68%&(//8/$5 &203$570(176 $1' 6758&785(6 ,1 (8.$5<27,& *(1( (;35(66,21 %\ *(5$5' 3$8/ =$0%(77, $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

$&.12:/( '*(0(176 ZRXOG OLNH WR DFNQRZOHGJH WKH GHGLFDWLRQ RI 'UV -DQHW DQG *DU\ 6WHLQ WR WKHLU ZRUN 7KHLU FRPPLWPHQW WR VFLHQFH KDV SURYLGHG XV ZLWK D ZHOOHTXLSSHG ODE DQG WKH IXQGV WR SXUVXH RXU UHVHDUFK ZRXOG DOVR OLNH WR H[WHQG VSHFLDO WKDQNV WR WKH 6WHLQnV IRU WKHLU FRQVWDQW VXSSRUW DQG JXLGDQFH GXULQJ P\ JUDGXDWH VWXGLHV ,Q DGGLWLRQ ZRXOG OLNH WR WKDQN 'UV %HUW )ODQHJDQ 7RP 5RZH DQG 'LFN 0R\HU IRU WKHLU KHOSIXO DGYLFH DV PHPEHUV RI P\ JUDGXDWH FRPPLWWHH 0\ H[SHULHQFHV ZLWK P\ IHOORZ FRZRUNHUV LQ WKH 6WHLQnV ODE KDYH EHHQ YHU\ LQWHUHVWLQJ UHZDUGLQJ DQG IXOILOOLQJ ZRXOG OLNH WR DFNQRZOHGJH DQG WKDQN 0DULH *LRUJLR /LQGD *UHHQ )DUKDG 0DUDVKL %ULDQ 2n'RQQHOO DQG 0DU\ %HWK .HQQHG\ IRU WKHLU WHFKQLFDO JXLGDQFH DQG DVVLVWDQFH DQG .HQ :ULJKW DQG -RH 7HL[HLUD IRU WKHLU KHOS GHDOLQJ ZLWK WKH FRPSXWHUV WKDQN 3DW 1DSOHV IRU KHU DSSUHFLDWLRQ DQG SOHGJH RI FDUH IRU WKH FRIIHH PXJ ZRXOG OLNH WR WKDQN 'DYH &ROODUW 7LP 0RUULV DQG &KDUOHV 6WHZDUW IRU WKHLU IULHQGVKLS DQG IRU WKHLU DGYLFH RQ UDLVLQJ EHHV ILVKLQJ DQG JROILQJ UHVSHFWLYHO\ ZRXOG OLNH WR WKDQN $QGUH YDQ :LMQHQ IRU KLV IULHQGVKLS VFLHQWLILF H[SHUWLVH RQ DQG RII WKH )RRV EDOO ILHOG DQG IRU NHHSLQJ DQ H\H RQ 3DW 1DSOHV DQG P\ FRIIHH

PAGE 3

PXJ ZRXOG SDUWLFXODUO\ OLNH WR WKDQN WKH IROORZLQJ LQGLYLGXDOV IRU WKHLU WUHPHQGRXV LQVSLUDWLRQ $SULO (PLOLH $VKOH\ 'DQQ\ 6KDQQRQ -RKQ $XEUH\ 6WHSKDQ $ODQ %URRNH .DWH 6DUDK DQG 1LNNL ZRXOG OLNH WR WKDQN WKH PHPEHUV RI WKH 'HSDUWPHQW RI ,PPXQRORJ\ DQG 0HGLFDO 0LFURELRORJ\ ZLOO DOZD\V UHPHPEHU WKH IRRWEDOO JDPHV LQ ZKLFK 'U (G 6LGHQ OHG RXU WHDP WR DQ XQGHIHDWHG UHFRUG DJDLQVW WKH 3DWKRORJ\ WHDP VWDUULQJ 'U :DUG :DNHODQG DQG WKH ODWH QLJKW 1HUIEDOO EDVHEDOO JDPHV LQ WKH KDOOZD\ ZLWK 0DUN /DERZ 3DXO +HUPRQDW %ULDQ 0DVWHUV DQG 'LFN :ULJKW /DVWO\ ZRXOG OLNH WR WKDQN P\ IDPLO\ 7KH /RUG KDV WUXO\ EOHVVHG PH ZLWK D ORYLQJ DQG VXSSRUWLYH IDPLO\ DQG IXOO\ DSSUHFLDWH DOO WKDW WKH\ KDYH GRQH DQG VDFULILFHG IRU PH GXULQJ P\ VWXGLHV LLL

PAGE 4

7$%/( 2) &217(176 3$*( $&.12:/('*(0(176 LL /,67 2 ),*85(6 YL /,67 2) 7$%/(6 L[ .(< 72 $%%5(9,$7,216 ; $%675$&7 [L &+$37(56 f ,1752'8&7,21 *HQHUDO %DFNJURXQG +LVWRQH *HQHV DQG 3URWHLQV +LVWRQH *HQH 5HJXODWLRQ 7UDQVFULSWLRQDO DQG 3RVW 7UDQVFULSWLRQDO &RQWURO 6XEFHOOXODU &RPSDUWPHQWV 7KH &\WRVNHOHWRQ 0LFURWXEXOHV ,QWHUPHGLDWH )LODPHQWV DQG 0LFURILODPHQWV &\WRVNHOHWDOP51$ ,QWHUDFWLRQV 1RQPHPEUDQH%RXQG DQG 0HPEUDQH%RXQG 3RO\ULERVRPHV 7KH 6LJQDO +\SRWKHVLV 2YHUYLHZ RI 3URMHFW f *(1(5$/ 0(7+2'6 0DWHULDOV &RQGLWLRQV IRU (Q]\PH 5HDFWLRQV 0DPPDOLDQ &HOO &XOWXUH 3ODVPLG '1$ '1$ ,VRODWLRQ DQG 3XULILFDWLRQ ,VRODWLRQ RI 0DPPDOLDQ 51$ 7ZR'LPHQVLRQDO *HO (OHFWURSKRUHVLV DQG ,PPXQR %ORWWLQJ $QDO\VLV 1RUWKHUQ %ORW $QDO\VLV 6, 1XFOHDVH 3URWHFWLRQ $QDO\VLV ,Q 9LWUR 1XFOHDU 5XQRQ 7UDQVFULSWLRQ $QDO\VLV 5DGLRODEHOLQJ '1$ IRU 1RUWKHUQ %ORW $QDO\VLV 6LWH'LUHFWHG 0XWDJHQHVLV 7UDQVIHFWLRQ RI '1$ LQWR &HOOV (VWDEOLVKPHQW RI 3RO\FORQDO DQG 0RQRFORQDO 6WDEO\ 7UDQVIRUPHG &HOO /LQHV LY

PAGE 5

f 68%&(//8/$5 /2&$7,21 2) +,6721( P51$V 21 &<726.(/(721 $662&,$7(' 1210(0%5$1(%281' 32/<620(6 ,1 +(/$ 6 &(//6 ,QWURGXFWLRQ 5HVXOWV 'LVFXVVLRQ f 68%&(//8/$5 /2&$7,21 2) +,6721( 8O51$ 3/$<6 $ 52/( ,1 7+( 326775$16&5,37,21$/ 5(*8/$7,21 2) +,6721( *(1( (;35(66,21 ,QWURGXFWLRQ 5HVXOWV 'LVFXVVLRQ f ',))(5(17,$/ $662&,$7,21 2) 0(0%5$1(%281' $1' 1210(0%5$1(%281' 32/<620(6 :,7+ &(// &<726758&785( ,QWURGXFWLRQ 5HVXOWV 'LVFXVVLRQ f +(7(52*(1(286 3$77(51 )25 &<726.(/(7$/OWO51$ ,17(5$&7,216 ,QWURGXFWLRQ 5HVXOWV 'LVFXVVLRQ ` 7+( ,1)/8(1&( 2) 7+( &<726.(/(721 21 7+( 5(*8/$7,21 2) F)RV *(1( (;35(66,21 ,QWURGXFWLRQ 5HVXOWV 'LVFXVVLRQ f 6800$5< $1' )8785( &216,'(5$7,216 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ Y

PAGE 6

/,67 2) ),*85(6 )LJXUH 3DJH 2XWOLQH RI WKH FORQLQJ VFKHPH IRU WKH FRQVWUXFWLRQ RI WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ JHQH 2XWOLQH RI SURFHGXUH IRU WKH LVRODWLRQ RI VXEFHOOXODU SRO\VRPDO IUDFWLRQV 1RUWKHUQ EORW DQDO\VLV RI + KLVWRQH + KLVWRQH DQG +/$% P51$ LQ VXEFHOOXODU IUDFWLRQV 7ZRGLPHQVLRQDO JHO HOHFWURSKRUHVLV RI F\WRVNHOHWRQ DQG VROXEOH DVVRFLDWHG SURWHLQV 1RUWKHUQ EORW DQDO\VLV RI + KLVWRQH + KLVWRQH DQG +/$% P51$V LVRODWHG IURP VXEFHOOXODU IUDFWLRQV RI FHOOV WUHDWHG ZLWK PHWDEROLF LQKLELWRUV 1RUWKHUQ EORW DQDO\VLV RI + KLVWRQH + KLVWRQH DQG +/$% P51$V DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ DQG VROXEOH IUDFWLRQV IURP +H/D FHOOV WUHDWHG ZLWK PHWDEROLF LQKLELWRUV 6FKHPDWLF GLDJUDP RI HQGRJHQRXV + KLVWRQH P51$ 67 DQG WKH EHWDODFWDPDVH VLJQDO SHSWLGH+ KLVWRQH IXVLRQ P51$ ([SUHVVLRQ RI WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ JHQH LQ +H/D FHOOV 7KH VXEFHOOXODU ORFDOL]DWLRQ RI WKH VLJQDO SHSWLGH KLVWRQH IXVLRQ P51$ 7KH VWDELOLW\ RI WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ IROORZLQJ LQKLELWLRQ RI '1$ V\QWKHVLV 6FKHPDWLF GLDJUDP RI ZLOG W\SH DQG PXWDWHG VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$V 'LVWULEXWLRQ RI 63+( 63+(ODOSKD DQG 63+($7*r P51$V LQ QRQPHPEUDQHERXQG DQG PHPEUDQHERXQG SRO\VRPDO IUDFWLRQV (IIHFWV RI K\GUR[\XUHD WUHDWPHQW RQ 63+( P51$ YL

PAGE 7

(IIHFWV RI K\GUR[\XUHD WUHDWPHQW RQ 63+($7* P51$ (IIHFWV RI K\GUR[\XUHD WUHDWPHQW RQ 63+(ODOSKD P51$ 4XDQWLWDWLRQ RI 63+( 63+(ODOSKD 63+($7*n P51$ GXULQJ K\GUR[\XUHD WUHDWPHQW 1RUWKHUQ EORW DQDO\VLV RI WKH F\WRVNHOHWRQ DQG VROXEOH SKDVH GLVWULEXWLRQ RI + KLVWRQH + KLVWRQH DQG +/$% P51$V LQ F\WRFKDODVLQ WUHDWHG FHOOV 1RUWKHUQ EORW DQDO\VLV RI WKH F\WRVNHOHWRQ DQG VROXEOH SKDVH GLVWULEXWLRQ RI FIRV P51$ LQ F\WRFKDODVLQ SXURP\FLQ &'SXUR DQG &'F\FORKH[LPLGH WUHDWHG FHOOV 1RUWKHUQ EORW DQDO\VLV RI WKH F\WRVNHOHWRQ DQG VROXEOH SKDVH GLVWULEXWLRQ RI QRQPHPEUDQHERXQG DQG PHPEUDQH ERXQG SRO\VRPDO P51$V LQ F\WRFKDODVLQ SXURP\FLQ &'SXUR DQG &'F\FORKH[LPLGH WUHDWHG FHOOV &\WRFKDODVLQ DQG SXURP\FLQ FRWUHDWPHQW GRHV QRW UHOHDVH 63+( RU 63+($7*f P51$ IURP WKH F\WRVNHOHWRQ 7KH ZLOG W\SH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ LV QRW UHOHDVHG IURP WKH F\WRVNHOHWRQ LQ &' DQG SXURP\FLQ FRWUHDWHG SRO\FORQDO +H/D FHOO FXOWXUHV (QGRJHQRXV PHPEUDQHERXQG SRO\VRPDO P51$V DUH UHOHDVHG IURP WKH F\WRVNHOHWRQ GXULQJ FRWUHDWPHQW ZLWK &' DQG SXURP\FLQ LQ 63+( DQG 63+($7* H[SUHVVLQJ FHOO FXOWXUHV (IIHFWV RI F\WRFKDODVLQ DQG SXURP\FLQ WUHDWPHQW RQ VWHDG\ VWDWH OHYHOV RI FIRV DQG FKRULRQLF JRQDGRWURSLQ P51$ 'HQVLWRPHWULF DQDO\VLV RI VWHDG\ VWDWH OHYHOV RI FIRV P51$ GXULQJ F\WRFKDODVLQ DQG SXURP\FLQ WUHDWPHQWV YLL

PAGE 8

7LPH FRXUVH RI FIRV P51$ DFFXPXODWLRQ GXULQJ F\WRFKDODVLQ DQG SXURP\FLQ WUHDWPHQWV LQ H[SRQHQWLDOO\ JURZLQJ +H/D FHOOV (IIHFW RI F\WRFKDODVLQ RQ WUDQVFULSWLRQ RI FIRV LQ +H/D FHOOV (IIHFW RI SURWHLQ V\QWKHVLV LQKLELWLRQ RQ F\WRFKDODVLQ LQGXFWLRQ RI FIRV WUDQVFULSWLRQ LQ +H/D FHOOV YLLL

PAGE 9

/,67 2) 7$%/(6 7DEOH 3DJH 4XDQWLW\ RI KLVWRQH DQG +/$% P51$V LQ WKH VXEFHOOXODU IUDFWLRQV 4X£QWLWDWLRQ RI 63+( 63+(ODOSKD DQG 63+($7* P51$ LQ QRQPHPEUDQHERXQG DQG PHPEUDQHERXQG SRO\VRPH IUDFWLRQV 7KH SHUFHQW RI F\WRVNHOHWRQ DQG VROXEOH SKDVH DVVRFLDWHG P51$V LQ FHOOV WUHDWHG ZLWK F\WRFKDODVLQ 3HUFHQW GLVWULEXWLRQ RI QRQPHPEUDQHERXQG DQG PHPEUDQH ERXQG SRO\VRPDO 51$V LQ WKH &VN DQG 6RO IUDFWLRQV IURP &' 3XUR &'SXURP\FLQ DQG &'F\FORKH[LPLGH WUHDWHG FHOOV 7KH SHUFHQW RI F\WRVNHOHWRQ DVVRFLDWHG P51$V LVRODWHG IURP F\WRFKDODVLQ SXURP\FLQ DQG &'SXURP\FLQ WUHDWHG FHOOV L[

PAGE 10

.(< 72 $%%5(9,$7,216 %6$ %RYLQH 6HUXP $OEXPLQ FSP &RXQWV SHU PLQXWH G&7! 'HR[\F\WLGLQHnWULSKRVSKDWH GG&73 'LGHR[\F\WLGLQHnWULSKRVSKDWH '1$ 'HR[\ULERQXFOHLF DFLG '1DVH 'HR[\ULERQXFOHDVH '77 'LWKLRWKUHLWRO ('7$ (WK\OHQHGLDPLQHWHWUDDFHWLF DFLG +HSHV 1 K\GUR[\HWK\O SLSHUD]LQH1n HWKDQHVXOIRQLF DFLG +8 +\GUR[\XUHD MXFL 0LFURFXULH 0J 0LFURJUDP 0O 0LFUROLWHU 0P 0LFURPHWHU PP 0LFURPRODU 2' 2SWLFDO GHQVLW\ 396 3RO\YLQ\O VXOIDWH 51$ 5LERQXFOHLF DFLG USP 5HYROXWLRQV SHU PLQXWH 6'6 6RGLXP GRGHF\OVXOIDWH 66& 6WDQGDUG VDOLQH FLWUDWH EXIIHU 7ULV K\GUR[\PHWK\OfDPLQRPHWKDQH [

PAGE 11

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ 7+( 52/( 2) 68%&(//8/$5 &203$570(176 $1' 6758&785(6 ,1 (8.$5<27,& *(1( (;35(66,21 %\ *HUDUG 3DXO =DPEHWWL 'HFHPEHU &KDLUSHUVRQ -DQHW 6WHLQ 0DMRU 'HSDUWPHQW ,PPXQRORJ\ DQG 0HGLFDO 0LFURELRORJ\ +LVWRQH P51$V QDWXUDOO\ UHVLGH RQ QRQPHPEUDQHERXQG SRO\VRPHV WKDW DUH DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ 7R VWXG\ ZKHWKHU WKH VXEFHOOXODU ORFDWLRQ SOD\V D UROH LQ WKH FRXSOLQJ RI KLVWRQH P51$ VWDELOLW\ WR '1$ V\QWKHVLV D VLJQDO SHSWLGHKLVWRQH IXVLRQ JHQH ZDV FRQVWUXFWHG WKDW HQFRGHV D KLVWRQH P51$ WKDW LV GLUHFWHG WR PHPEUDQHERXQG SRO\VRPHV 7KH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ ZKHQ ORFDOL]HG LQ WKH IRUHLJQ VXEFHOOXODU FRPSDUWPHQW LV QR ORQJHU GHVWDELOL]HG ZKHQ '1$ V\QWKHVLV LV LQKLELWHG $ VLQJOH QXFOHRWLGH VXEVWLWXWLRQ LQ WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ JHQH E\ VLWHGLUHFWHG PXWDJHQHVLV UHVXOWHG LQ WKH ORFDOL]DWLRQ RI WKH KLVWRQH IXVLRQ P51$ RQ QRQPHPEUDQHERXQG SRO\VRPHV DQG UHVWRUHG WKH FRXSOLQJ RI P51$ VWDELOLW\ ZLWK [L

PAGE 12

'1$ V\QWKHVLV 7KHVH UHVXOWV LQGLFDWH WKDW WKH VXEFHOOXODU ORFDWLRQ RI KLVWRQH P51$ SOD\V DQ LPSRUWDQW UROH LQ WKH SRVWWUDQVFULSWLRQDO UHJXODWLRQ RI KLVWRQH JHQH H[SUHVVLRQ :H KDYH GHWHUPLQHG WKDW WKH DVVRFLDWLRQ RI KLVWRQH P51$ ZLWK WKH F\WRVNHOHWRQ LV GHSHQGHQW RQ WKH LQWHJULW\ RI DFWLQ ILODPHQWV 'LVUXSWLRQ RI WKH PLFURILODPHQWV ZLWK F\WRFKDODVLQ HIILFLHQWO\ UHOHDVHG KLVWRQH P51$ IURP WKH F\WRVNHOHWRQ LQWR WKH VROXEOH SKDVH ,Q FRQWUDVW PHPEUDQH ERXQG SRO\VRPDO P51$V UHPDLQHG DWWDFKHG WR WKH F\WRVNHOHWRQ GXULQJ F\WRFKDODVLQ WUHDWPHQW 6XEVHJXHQW VWXGLHV KDYH GHPRQVWUDWHG WKDW PHPEUDQHERXQG SRO\VRPDO P51$V DUH DWWDFKHG WR WKH F\WRVNHOHWRQ DW WZR GLIIHUHQW VLWHV f D F\WRFKDODVLQ VHQVLWLYH VLWH DQG f D SXURP\FLQ VHQVLWLYH VLWH 'LVUXSWLRQ RI WKH F\WRVNHOHWRQ ZLWK F\WRFKDODVLQ UHVXOWHG LQ D UDSLG DQG PDUNHG VWLPXODWLRQ LQ WUDQVFULSWLRQ RI WKH FIRV SURWRRQFRJHQH DQG DQ LQFUHDVH LQ FIRV P51$ FHOOXODU OHYHOV 7UDQVFULSWLRQ RI VHYHUDO RWKHU JHQHV ZDV XQDIIHFWHG E\ WKH F\WRFKDODVLQ WUHDWPHQW 7KHVH UHVXOWV VXJJHVW WKDW WKH QXFOHXV FDQ UHVSRQG WR WKH VWUXFWXUDO RUJDQL]DWLRQ RI WKH F\WRVNHOHWRQ DQG VHOHFWLYHO\ DGMXVW WKH UHJXODWLRQ RI JHQH H[SUHVVLRQ DFFRUGLQJO\ [LL

PAGE 13

&+$37(5 ,1752'8&7,21 *HQHUDO %DFNJURXQG +LVWRQHV DUH VPDOO EDVLF SURWHLQV WKDW DUH LQYROYHG LQ WKH SDFNDJLQJ RI HXNDU\RWLF '1$ LQWR FKURPDWLQ ,W LV HVWLPDWHG WKDW PRUH WKDQ PHWHUV RI '1$ DUH FRQWDLQHG ZLWKLQ WKH OLPLWHG DUHD RI WKH QXFOHXV 7KH FRQGHQVDWLRQ RI WKH '1$ WR VXFK D JUHDW H[WHQW LV GXH SULPDULO\ WR LWV LQWHUDFWLRQV ZLWK WKH KLVWRQH SURWHLQV ,Q DGGLWLRQ WR WKHLU VWUXFWXUDO SURSHUWLHV KLVWRQHV SOD\ D IXQFWLRQDO UROH LQ FRQWUROOLQJ JHQH WUDQVFULSWLRQ 7KH ZD\ LQ ZKLFK WKH KLVWRQH SURWHLQV DUH DUUDQJHG DORQJ D UHJLRQ RI '1$ DSSHDUV WR DIIHFW WKH WUDQVFULSWLRQDO SURSHUWLHV RI WKDW '1$ GRPDLQ 7KH FRPSOH[ QDWXUH RI WKH UHJXODWLRQ RI KLVWRQH SURWHLQ V\QWKHVLV DW WKH WUDQVFULSWLRQDO SRVWWUDQVFULSWLRQDO DQG SRVWWUDQVODWLRQDO OHYHOV PDNHV WKHVH JHQHV DQ LPSRUWDQW PRGHO IRU VWXG\LQJ HXNDU\RWLF JHQH H[SUHVVLRQ +RZHYHU RQH RI WKH PRVW LPSRUWDQW UHDVRQV IRU VWXG\LQJ WKH UHJXODWLRQ RI KLVWRQH JHQH H[SUHVVLRQ LV WKDW WKH V\QWKHVLV RI WKH PDMRULW\ RI KLVWRQH SURWHLQV FHOO F\FOH GHSHQGHQW KLVWRQHVf RFFXUV GXULQJ '1$ UHSOLFDWLRQ (OXFLGDWLRQ RI WKH PHFKDQLVPV FRXSOLQJ KLVWRQH SURWHLQ V\QWKHVLV ZLWK '1$ V\QWKHVLV PD\

PAGE 14

\LHOG D EHWWHU XQGHUVWDQGLQJ RI WKH SURFHVVHV FRQWUROOLQJ SUROLIHUDWLRQ GLIIHUHQWLDWLRQ FHOO DJLQJ DQG QHRSODVLD +LVWRQH *HQHV DQG 3URWHLQV 7KHUH DUH ILYH PDMRU FODVVHV RI KLVWRQH SURWHLQV + +% +L$ + DQG +,f UDQJLQJ LQ PROHFXODU ZHLJKW IURP WR 'DOWRQV 7KH\ DUH EDVLF SURWHLQV WKDW KDYH EHHQ KLJKO\ FRQVHUYHG WKURXJKRXW HYROXWLRQ )RU H[DPSOH WKHUH DUH RQO\ WZR DPLQR DFLGV RXW RI ZKLFK GLIIHU EHWZHHQ KLVWRQH + IURP SHD VHHGOLQJV DQG FDOI WK\PXV ZKLFK VXJJHVWV D FULWLFDO UROH IRU WKHVH SURWHLQV LQ FHOO VXUYLYDO 'H/DQJH HW DO f 7KH KLVWRQH SURWHLQV DUH HQFRGHG E\ D IDPLO\ RI PRGHUDWHO\ UHSHDWHG JHQHV :LOVRQ DQG 0HOOL .HGHV f ,Q KXPDQV WKH KLVWRQH JHQHV DUH DUUDQJHG LQ FOXVWHUV WKDW DUH QRW RUJDQL]HG LQ VLPSOH WDQGHP UHSHDWV DV IRXQG LQ WKH VHD XUFKLQ DQG RWKHU ORZHU HXNDU\RWLF JHQRPHV +HLQW] HW DO 6LHUUD HW DOA &DUR]]L HW DO f 7KH FOXVWHUV DUH ORFDOL]HG RQ FKURPRVRPHV DQG DQG DUH LQWHUVSHUVHG ZLWK UHSHWLWLYH HOHPHQWV *UHHQ HW DO E &ROODUW HW DO f ,W KDV EHHQ VSHFXODWHG WKDW WKHVH UHSHWLWLYH HOHPHQWV PD\ SOD\ D UROH LQ UHFRPELQDWLRQ DQG JHQH GXSOLFDWLRQ GXULQJ WKH HYROXWLRQ RI WKLV PXOWLJHQH IDPLO\ 7KH JHQHUDO VWUXFWXUH RI WKH KXPDQ KLVWRQH JHQHV LV OHVV FRPSOH[ WKDQ PDQ\ RWKHU HXNDU\RWLF JHQHV VLQFH WKH KLVWRQH SURWHLQ FRGLQJ UHJLRQ LV QRW LQWHUUXSWHG E\ LQWURQV DQG WKH HQFRGHG P51$V

PAGE 15

DUH QRW SRO\DGHQ\ODWHG $GHQVLN DQG 'DUQHOO f +RZHYHU WKH JHQHV FRGLQJ IRU KLVWRQH SURWHLQV WKDW DUH V\QWKHVL]HG LQ WKH DEVHQFH RI '1$ V\QWKHVLV FHOO F\FOH LQGHSHQGHQW KLVWRQHVf JHQHUDOO\ FRQWDLQ LQWURQV DQG FRGH IRU P51$V WKDW DUH SRO\DGHQ\ODWHG (QJHO HW DO +DUYH\ HW DO UXVK HW DO :HOOV DQG .HGHV f 6XEVHTXHQW GLVFXVVLRQV ZLOO JHQHUDOL]H ZKDW LV WUXH RQO\ IRU WKH FHOO F\FOH GHSHQGHQW KLVWRQHV XQOHVV RWKHUZLVH LQGLFDWHG +LVWRQH *HQH 5HJXODWLRQ 7UDQVFULSWLRQDO DQG 3RVW 7UDQVFULSWLRQDO &RQWURO 7KH VWULQJHQW UHTXLUHPHQW WR SDFNDJH QHZO\ UHSOLFDWHG '1$ LQWR FKURPDWLQ WKH LQYDULDEOH PRODU UDWLR RI KLVWRQH SURWHLQ WR '1$ DQG WKH LQDELOLW\ RI PRVW HXNDU\RWLF FHOOV WR VWRUH XQERXQG KLVWRQH SURWHLQV LPSOLHV D WHPSRUDO DQG IXQFWLRQDO FRXSOLQJ RI KLVWRQH SURWHLQ V\QWKHVLV ZLWK '1$ UHSOLFDWLRQ 3UHVFRWW $OOIUH\ HW DO f 6XSSRUW IRU WKLV K\SRWKHVLV ILUVW FDPH IURP VWXGLHV RQ V\QFKURQL]HG FHOO FXOWXUHV RI (XSORWHV HXUYVWRPXV LQ ZKLFK WKH V\QWKHVLV RI KLVWRQH SURWHLQ ZDV IRXQG WR RFFXU RQO\ GXULQJ WKH 6 SKDVH RI WKH FHOO F\FOH WKH WLPH ZKHQ '1$ UHSOLFDWLRQ WDNHV SODFH 3UHVFRWW f )XUWKHUPRUH WKH TXDQWLW\ RI KLVWRQH SURWHLQ ZLWKLQ WKH FHOO GRXEOHG GXULQJ 6 SKDVH 7KH WHPSRUDO FRXSOLQJ RI KLVWRQH SURWHLQ V\QWKHVLV ZLWK '1$ V\QWKHVLV KDV VLQFH EHHQ FRQILUPHG DQG ZHOO GRFXPHQWHG E\ D YDULHW\ RI GLUHFW H[SHULPHQWDO DSSURDFKHV

PAGE 16

5REELQV DQG %RUXQ 6SDXOGLQJ HW DO 6WHLQ DQG %RUXQ f ,Q YLWUR WUDQVODWLRQ VWXGLHV XVLQJ SRO\VRPDO 51$ LVRODWHG IURP FHOOV DW YDULRXV VWDJHV RI WKH FHOO F\FOH LQGLFDWHG WKDW WKH KLVWRQH P51$ ZDV SUHVHQW H[FOXVLYHO\ GXULQJ 6 SKDVH 6SDOGLQJ HW DO *DOOZLW] DQG 0XHOOHU -DFREV/RUHQD HW DO *DOOZLW] DQG %ULHQGO 3HUU\ DQG .HOOH\ %RUXQ HW DO f 4XDQWLWDWLRQ RI KLVWRQH P51$ FRQWHQW GXULQJ WKH FHOO F\FOH E\ 1RUWKHUQ EORW DQDO\VLV XVLQJ UDGLRODEHOHG KLVWRQH F'1$ DQG JHQRPLF FORQHV GHPRQVWUDWHG WKDW KLVWRQH P51$ VWHDG\ OHYHOV FORVHO\ SDUDOOHO WKH UDWHV RI KLVWRQH SURWHLQ V\QWKHVLV DV ZHOO DV WKH UDWHV RI '1$ UHSOLFDWLRQ +HLQW] HW DO 3OXPE HW DO D %DXPEDFK HW DOA f 7KH WLPLQJ RI KLVWRQH SURWHLQ V\QWKHVLV GXULQJ '1$ V\QWKHVLV LV QRW FRLQFLGHQWDO DQG UHSUHVHQWV D IXQFWLRQDO UHODWLRQVKLS EHWZHHQ WKHVH WZR SURFHVVHV 7KLV LV VXSSRUWHG E\ WKH IROORZLQJ REVHUYDWLRQV f WKHUH LV D FRRUGLQDWH LQGXFWLRQ RI KLVWRQH SURWHLQ V\QWKHVLV DQG '1$ V\QWKHVLV GXULQJ VWLPXODWLRQ RI TXLHVFHQW FHOOV WR SUROLIHUDWH 'H/LVOH HW DO *UHHQ HW DO Df f LQKLELWLRQ RI '1$ V\QWKHVLV ZLWK FRPSRXQGV VXFK DV K\GUR[\XUHD RU F\WRVLQH DUDELQRVLGH UHVXOWV LQ D ORVV RI KLVWRQH P51$ ZLWK D FRQFRPLWDQW GHFUHDVH LQ KLVWRQH SURWHLQ V\QWKHVLV %UHLQGO DQG *DOOZLW] %XWOHU DQG 0XHOOHU %RUXQ HW DO %DXPEDFK HW DO f DQG f WHUPLQDO GLIIHUHQWLDWLRQ LV PDUNHG E\ D GRZQ UHJXODWLRQ LQ KLVWRQH SURWHLQ V\QWKHVLV

PAGE 17

LQ FRQMXQFWLRQ ZLWK WKH GHFUHDVH LQ SUROLIHUDWLYH DFWLYLW\ %LUG HW DO &KDOORQHU HW DO 6WHLQ HW DO f 7KH H[SUHVVLRQ RI KLVWRQH JHQHV GXULQJ WKH FHOO F\FOH LV UHJXODWHG DW ERWK WKH WUDQVFULSWLRQDO DQG SRVWWU£QVFULSWLRQDO OHYHOV $QDO\VLV E\ K\EULG VHOHFWLRQ RI 51$ UDGLRODEHOHG LQ V\QFKURQL]HG +H/D FHOOV GHPRQVWUDWHV D EXUVW RI WR IROG LQ WUDQVFULSWLRQ RI WKH KLVWRQH JHQHV ZLWKLQ WKH ILUVW WZR KRXUV RI 6 SKDVH IROORZHG E\ D UHGXFWLRQ WR D EDVDO OHYHO WKDW UHPDLQV FRQVWDQW XQWLO WKH IROORZLQJ 6 SKDVH 3OXPE HW DO Df 6LPLODU UHVXOWV ZHUH REWDLQHG ZKHQ KLVWRQH JHQH WUDQVFULSWLRQ GXULQJ WKH FHOO F\FOH ZDV PHDVXUHG E\ QXFOHDU UXQRQ DQDO\VLV 6LYH HW DO %DXPEDFK HW DO f 6WHDG\ VWDWH OHYHOV RI KLVWRQH P51$ KRZHYHU ZHUH HOHYDWHG IROG GXULQJ 6 SKDVH DQG FORVHO\ SDUDOOHOHG WKH UDWHV RI '1$ V\QWKHVLV 3OXPE HW DO D +HLQW] HW DO %DXPEDFK HW DO f 0D[LPDO DFFXPXODWLRQ RI KLVWRQH P51$ RFFXUUHG DW KRXUV LQWR 6 SKDVH DQG UHWXUQHG WR D EDVDO OHYHO DV '1$ V\QWKHVLV HQGHG 7KH WLPLQJ DQG H[WHQW RI WKH LQFUHDVH LQ KLVWRQH WUDQVFULSWLRQ FDQ QRW DFFRXQW IRU WKH PDUNHG LQFUHDVH LQ KLVWRQH P51$ VWHDG\ VWDWH OHYHOV DQG PXVW EH D FRQVHTXHQFH RI D SRVWWUDQVFULSWLRQDO FRQWURO PHFKDQLVP 3RVWWUDQVFULSWLRQDO UHJXODWLRQ RI KLVWRQH JHQH H[SUHVVLRQ LV IXUWKHU VXSSRUWHG E\ '1$ V\QWKHVLV LQKLELWRU VWXGLHV 7KH HVWLPDWHG KDOI OLIH RI KLVWRQH P51$ LQ H[SRQHQWLDOO\ JURZLQJ

PAGE 18

+H/D FHOOV LV PLQXWHV 6LWWPDQ HW DO 3OXPE HW DO f +\GUR[\XUHD RU DQ\ RWKHU FRPSRXQG RU WUHDWPHQW WKDW LQKLELWV '1$ V\QWKHVLV VWXGLHG WR GDWH UHVXOWV LQ D UDSLG DQG VHOHFWLYH GHVWDELOL]DWLRQ RI KLVWRQH P51$ KDOI OLIH RI PLQXWHVf ZLWK OLWWOH RU QR HIIHFW RQ KLVWRQH JHQH WUDQVFULSWLRQ 6LWWPDQ HW DO 3OXPE HW DO %DXPEDFK HW DO f $ ORQJVWDQGLQJ REVHUYDWLRQ FRQFHUQLQJ KLVWRQH P51$ WXUQRYHU GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV LV WKDW WKH PHFKDQLVP LV FRPSOHWHO\ GHSHQGHQW RQ SURWHLQ V\QWKHVLV %XWOHU DQG 0XHOOHU *DOOZLW] 6WDKO DQG *DOOZLW] 6WLPDF HW DO %DXPEDFK HW DO +HOPV HW DO f 3UHWUHDWPHQW RI FHOOV ZLWK LQKLELWRUV RI SURWHLQ V\QWKHVLV VXFK DV KLJK VDOW F\FORKH[LPLGH RU SXURP\FLQ IROORZHG E\ WKH DGGLWLRQ RI D '1$ V\QWKHVLV LQKLELWRU SUHYHQWV WKH GHVWDELOL]DWLRQ RI KLVWRQH P51$V DQG DFWXDOO\ UHVXOWV LQ DQ LQFUHDVH LQ WKHLU VWHDG\ VWDWH OHYHOV GXH WR WKH FRQWLQXHG WUDQVFULSWLRQ RI WKH KLVWRQH JHQHV 7KLV REVHUYDWLRQ OHG %XWOHU DQG 0XHOOHU DQG RWKHUV WR K\SRWKHVL]H WKDW WKH KLVWRQH SURWHLQV FDQ DXWRUHJXODWH WKHLU RZQ V\QWKHVLV WKURXJK D IHHGEDFN ORRS RSHUDWLYH DW WKH SRVWWUDQVFULSWLRQDO OHYHO %XWOHU DQG 0XHOOHU 6WHLQ DQG 6WHLQ :X DQG %RQQHU f 7KH PRGHO SUHGLFWV WKDW DW WKH QDWXUDO HQG RI 6 SKDVH RU ZKHQ '1$ V\QWKHVLV LV LQWHUUXSWHG ZLWK LQKLELWRUV D WUDQVLHQW DFFXPXODWLRQ RI XQERXQG KLVWRQH SURWHLQ PD\ DULVH GXH WR D ORVV LQ KLJK

PAGE 19

DIILQLW\ ELQGLQJ VLWHV IRU WKH QHZO\ V\QWKHVL]HG KLVWRQH SURWHLQV 8QERXQG KLVWRQH SURWHLQ PD\ WKHQ LQWHUDFW ZLWK KLVWRQH P51$FRQWDLQLQJ SRO\VRPHV UHVXOWLQJ LQ D FRQIRUPDWLRQDO FKDQJH LQ WKH P51$ WKDW LV PRUH DFFHVVLEOH WR ULERQXFOHDVH *URZLQJ VXSSRUW IRU WKLV PRGHO FRPHV IURP D FHOOIUHH P51$ GHFD\ V\VWHP LQ ZKLFK WKH GHVWDELOL]DWLRQ RI KLVWRQH P51$ LV DFFHOHUDWHG ZKHQ LQFXEDWHG LQ WKH SUHVHQFH RI KLVWRQH SURWHLQV 3HOW] DQG 5RVV f 7KLV UHVXOW DSSHDUV WR EH VSHFLILF IRU KLVWRQH P51$ VLQFH WKH UDWHV RI GHFD\ IRU JDPPD JORELQ P51$ FP\F P51$ WRWDO SRO\$fn 51$ RU WRWDO SRO\$f 51$ DUH XQDIIHFWHG E\ WKH SUHVHQFH RI KLVWRQH SURWHLQV *HQH WUDQVIHU VWXGLHV GHPRQVWUDWHG WKDW WKH PLQLPDO VHJXHQFH QHFHVVDU\ IRU FRXSOLQJ KLVWRQH P51$ VWDELOLW\ ZLWK '1$ UHSOLFDWLRQ OLHV ZLWKLQ WKH n WHUPLQXV RI WKH P51$ 6WDXEHU HW DO /HYLQH HW DO 3DQGH\ DQG 0DU]OXII f 5HPRYDO RI RQO\ QXFOHRWLGHV IURP WKH n HQG RI D PXULQH + KLVWRQH P51$ UHOHDVHV WKH PXWDQW P51$ IURP GHVWDELOL]DWLRQ GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV /HYLQH HW DO f &RQYHUVHO\ WKH ODVW QXFOHRWLGHV RI KLVWRQH + P51$ ZKHQ IXVHG WR WKH n HQG RI KXPDQ JDPPD JORELQ P51$ DUH VXIILFLHQW WR FRQIHU LQVWDELOLW\ WR WKH FKLPHULF P51$ ZKHQ '1$ V\QWKHVLV LV LQKLELWHG ZKHUHDV ZLOG W\SH JDPPD JORELQ P51$ UHPDLQV VWDEOH 3DQGH\ DQG 0DU]OXII f &RQWDLQHG ZLWKLQ WKH PLQLPDO WDUJHW VHTXHQFH IRU GHVWDELOL]DWLRQ LV D VWHPORRS VWUXFWXUH ZKLFK LV FRPPRQ WR

PAGE 20

DOO NQRZQ FHOO F\FOH GHSHQGHQW KLVWRQH P51$V +HQWVFKHO DQG %LUQVWLHO f 7KH SUHVHQFH RI WKH VWHPORRS VWUXFWXUH LV QRW VXIILFLHQW E\ LWVHOI WR FRXSOH P51$ VWDELOLW\ ZLWK '1$ UHSOLFDWLRQ 7KH WDUJHW VHTXHQFHV PXVW EH SUHVHQW LQ WKH SURSHU SRVLWLRQ DW WKH n WHUPLQXV RI WKH P51$ WR EH RSHUDWLYH $EHUUDQW KLVWRQH P51$ WUDQVFULSWV FRQWDLQLQJ WKH WDUJHW VHTXHQFHV DW DQ LQWHUQDO SRVLWLRQ DUH IXOO\ VWDEOH GXULQJ WKH LQKLELWLRQ RI '1$ V\QWKHVLV $OWHUPDQ HW DO /XVFKHU HW DO 3DQGH\ DQG 0DU]OXII /HYLQH HW DOA f )XUWKHUPRUH PRYLQJ WKH VWHPORRS VWUXFWXUH QXFOHRWLGHV GRZQVWUHDP IURP WKH WUDQVODWLRQ VWRS FRGRQ DEROLVKHV WKH FRXSOLQJ RI KLVWRQH P51$ VWDELOLW\ ZLWK '1$ UHSOLFDWLRQ GHVSLWH WKH UHWHQWLRQ RI WKH VWHP ORRS VWUXFWXUH DW WKH nWHUPLQXV *UDYHV HW DO f $Q DGGLWLRQDO FRQVWUDLQW RQ WKH KLVWRQH SRVWWUDQVFULSWLRQDO UHJXODWRU\ PHFKDQLVP LV WKDW WUDQVODWLRQ PXVW SURFHHG WR ZLWKLQ FORVH SUR[LPLW\ RI WKH QDWXUDO WHUPLQDWLRQ FRGRQ IRU GHVWDELOL]DWLRQ WR RFFXU GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV *UDYHV HW DO f )UDPH VKLIW PXWDWLRQV LQ KLVWRQH P51$ UHVXOWLQJ LQ WKH SUHPDWXUH WHUPLQDWLRQ RI WUDQVODWLRQ PRUH WKDQ QXFOHRWLGHV IURP WKH n WHUPLQXV VWDELOL]H WKH PHVVHQJHU 51$ ZKHQ '1$ V\QWKHVLV LV LQWHUUXSWHG *UDYHV HW DO f 2WKHU IUDPH VKLIW PXWDQWV WKDW DOORZ WUDQVODWLRQ WR FRQWLQXH SDVW WKH QDWXUDO 8*$ VWRS FRGRQ LQWR WKH XQWUDQVODWHG UHJLRQ DUH DOVR VWDEOH ZKHQ '1$ V\QWKHVLV LV LQKLELWHG &DSDVVR HW DO

PAGE 21

f &RUUHFWLQJ IRU WUDQVODWLRQ UHDG WKURXJK LQ WKHVH PXWDQWV E\ LQVHUWLQJ VWRS FRGRQV LQ DOO WKUHH UHDGLQJ IUDPHV DW WKH QDWXUDO WUDQVODWLRQ WHUPLQDWLRQ VLWH UHVWRUHV WKH FRXSOLQJ RI P51$ VWDELOLW\ WR '1$ UHSOLFDWLRQ 'HWDLOHG VWXGLHV RQ GHOHWLRQ PXWDQWV VXJJHVW WKDW WKH KLVWRQH QDVFHQW SRO\SHSWLGH LV QRW LQYROYHG LQ WKH SRVWWUDQVFULSWLRQDO UHJXODWRU\ SURFHVV &DSDVVR HW DO f 6\VWHPDWLF UHPRYDO RI DSSUR[LPDWHO\ QXFOHRWLGH EORFNV VSDQQLQJ QHDUO\ WKH HQWLUH SURWHLQ FRGLQJ UHJLRQ KDG QR HIIHFW RQ WKH GHVWDELOL]DWLRQ RI WKHVH PXWDQW KLVWRQH P51$V ZKHQ '1$ V\QWKHVLV ZDV LQKLELWHG &RQVLVWHQW ZLWK WKLV UHVXOW WKH GHOHWLRQ RI WKH $7* WUDQVODWLRQ VWDUW FRGRQ ZKLFK SUHYHQWV WKH V\QWKHVLV RI KLVWRQH SURWHLQ GLG QRW SUHYHQW WKH GHVWDELOL]DWLRQ RI WKH P51$ GXULQJ LQKLELWLRQ RI '1$ UHSOLFDWLRQ )XUWKHUPRUH DV GLVFXVVHG DERYH WKH PLQLPDO WDUJHW VHTXHQFHV FRQWDLQLQJ WKH VWHPORRS VWUXFWXUH FRQIHU LQVWDELOLW\ WR JDPPD JORELQ P51$ ZKHQ '1$ V\QWKHVLV LV LQWHUUXSWHG 3DQGH\ DQG 0DU]OXII f 7KH JORELQ KLVWRQH FKLPHULF P51$ DOWKRXJK UHJXODWHG DV ZLOG W\SH KLVWRQH P51$ GRHV QRW HQFRGH DQ\ KLVWRQH SURWHLQ VHTXHQFHV 'HVWDELOL]DWLRQ RI KLVWRQH P51$ DSSHDUV WR RFFXU LQ D VWHSZLVH PDQQHU LQLWLDWLQJ DW WKH n WHUPLQXV 5RVV HW DO f 7KH ILUVW GHWHFWDEOH KLVWRQH P51$ GHJUDGDWLRQ SURGXFW ODFNV QXFOHRWLGHV IURP WKH n WHUPLQXV 5RVV DQG .REV 5RVV HW DOA f 7KLV GHJUDGDWLRQ SURGXFW LV GHWHFWDEOH LQ WKH LQ YLWUR P51$ GHFD\ V\VWHP DV ZHOO DV LQ

PAGE 22

ZKROH FHOOV 5RVV HW DOA f ,W LV XQFOHDU ZKHWKHU WKLV SURGXFW DULVHV IURP D VLQJOH HQGRQXFOHRO\WLF VFLVVLRQ RU IURP PXOWLSOH FXWV UHPRYLQJ RQH RU PRUH RI WKH QXFOHRWLGHV DW D WLPH 'HJUDGDWLRQ FRQWLQXHV UDSLGO\ LQ D n WR n GLUHFWLRQ FDUULHG RXW E\ DQ H[RQXFOHDVH ZKLFK LV SDUW RI WKH ULERVRPH FRPSOH[ 5RVV HW DO f 7KHVH UHVXOWV DUH FRQVLVWHQW ZLWK WKH UHTXLUHPHQW IRU WUDQVODWLRQ WR SURFHHG QHDU WKH n WHUPLQXV IRU WKH GHVWDELOL]DWLRQ RI WKH KLVWRQH P51$ GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV 6XEFHOOXODU &RPSDUWPHQWV 7KH DSSHDUDQFH RI KLVWRQH P51$ RQ SRO\VRPHV ZLWKLQ PLQXWHV DIWHU WUDQVFULSWLRQ DQG WKH HTXDOO\ UDSLG WUDQVIHU RI WKH QHZO\ V\QWKHVL]HG KLVWRQH SURWHLQV LQWR WKH QXFOHXV ZKHUH WKH\ FRPSOH[ ZLWK '1$ LPSO\ WKDW KLVWRQH SURWHLQ V\QWKHVLV PD\ EH FRPSDUWPHQWDOL]HG LQ D UHJLRQ ORFDWHG MXVW RXWVLGH WKH QXFOHXV 6SDXOGLQJ HW DO %RUXQ HW DO 5REELQV DQG %RUXQ f 7KH DV\PPHWULF GLVWULEXWLRQ RI HXNDU\RWLF P51$V LQ WKH F\WRSODVP VXSSRUWV WKLV SRVVLELOLW\ 0RUSKRORJLFDO VWXGLHV LQLWLDOO\ GHPRQVWUDWHG WKDW SRO\ULERVRPHV DUH FRQFHQWUDWHG LQ DUHDV VXUURXQGLQJ WKH QXFOHXV LQ PRXVH 7 FHOOV )XOWRQ HW DO f /DWHU ORFDOL]DWLRQ RI VSHFLILF P51$V E\ LQ VLWX K\EULGL]DWLRQ WHFKQLTXHV SURYLGHG GLUHFW HYLGHQFH WKDW P51$V DUH GLIIHUHQWLDOO\ GLVWULEXWHG WKURXJKRXW WKH FHOO 7XEXOLQ P51$ LV SUHIHUHQWLDOO\ ORFDWHG LQ WKH SHULSKHU\ RI WKH F\WRSODVP

PAGE 23

ZKHUHDV YLPHQWLQ P51$ LV FRQFHQWUDWHG LQ SHULQXFOHDU UHJLRQV LQ FKLFN P\REODVW DQG ILEUREODVW FHOOV /DZUHQFH DQG 6LQJHU f )XUWKHUPRUH DFWLQ P51$ LV FRQFHQWUDWHG LQ WKH ODPHOOLSRGLD VWUXFWXUHV LQYROYHG LQ FHOO ORFRPRWLRQ /DZUHQFH DQG 6LQJHU f 7KH UHTXLUHPHQW IRU DFWLQ SURWHLQ LQ WKH ODPHOOLSRGLD GXULQJ FHOO PRYHPHQW :DQJ f VXJJHVWV D IXQFWLRQDO UHODWLRQVKLS EHWZHHQ ZKHUH WKH P51$ LV ORFDOL]HG DQG ZKHUH WKH HQFRGHG SURWHLQ LV QHHGHG /DZUHQFH DQG 6LQJHU f /RFDOL]DWLRQ RI P51$V LQ GLVWLQFW DUHDV RI WKH F\WRSODVP PD\ RFFXU GXH WR DQ DVVRFLDWLRQ RI WKH P51$ ZLWK DQ XQGHUO\LQJ VWUXFWXUH 7KLV VWUXFWXUH FRXOG VHUYH DV DQ DQFKRU WR FRQFHQWUDWH P51$V LQ SDUWLFXODU UHJLRQV RI WKH F\WRSODVP &RQVLVWHQW ZLWK WKLV UHDVRQLQJ LV WKH H[LVWHQFH RI D FRPSOH[ SURWHLQDFHRXV VWUXFWXUH LQ WKH F\WRSODVP RI PRVW HXNDU\RWLF FHOOV WKDW LV UHIHUUHG WR DV WKH F\WRVNHOHWRQ 7KH F\WRVNHOHWRQ SOD\V D UROH LQ FHOO VKDSH FHOO PRWLOLW\ DQG WKH LQWUDFHOOXODU WUDQVSRUW RI PDFURPROHFXOHV DQG RUJDQHOOHV &ODUNH DQG 6SXGLFK *ROGPDQ HW DO DQG UHYLHZHG LQ 1LHOVHQ HW DO f ,Q DGGLWLRQ WKHUH LV JURZLQJ VXSSRUW IRU WKH K\SRWKHVLV WKDW WKH F\WRVNHOHWRQ SOD\V D NH\ UROH LQ UHJXODWLQJ WKH WUDQVODWLRQ SURFHVV /HQN HW DO /HQN DQG 3HQPDQ )XOWRQ HW DO &HUYHUD HW DO YDQ 9HURRLM HW DO 1LHOVHQ HW DO +RZH DQG +HUVKH\ f

PAGE 24

7KH &YWRVNHOHWRQ 0LFURWXEXOHV ,QWHUPHGLDWH )LODPHQWV DQG 0LFURILODPHQWV 7KH F\WRVNHOHWRQ VWUXFWXUH LV DQ LQWHUFRQQHFWHG V\VWHP RI WKUHH PDMRU FODVVHV RI SURWHLQ ILEHUV QDPHO\ WKH PLFURWXEXOHV LQWHUPHGLDWH ILODPHQWV DQG PLFURILODPHQWV (DFK V\VWHP UHSUHVHQWV D KHWHURJHQRXV SRSXODWLRQ RI SURWHLQV 7KH PLFURWXEXOHV IRU H[DPSOH DUH FRPSRVHG RI SURWRILODPHQWV RI WKH ZHOO FKDUDFWHUL]HG DOSKD DQG EHWD WXEXOLQ SURWHLQV $PRV DQG .OXJ f 7KHVH ILODPHQWV DUH QP LQ GLDPHWHU DQG DSSHDU WR FRQWDLQ D KROORZ FRUH 6HYHUDO PLFURWXEXOH DVVRFLDWHG SURWHLQV 0$3Vf KDYH DOVR EHHQ LGHQWLILHG ZKLFK DSSHDU WR IDFLOLWDWH WKH DVVHPEO\ RI WKH PLFURWXEXOHV DQG SURPRWH WKHLU LQWHUDFWLRQV ZLWK RWKHU FHOOXODU RUJDQHOOHV 6ORERGD HW DO %XOLQVNL DQG %RULV\ %ORRP HW DO %LQGHU HW DO f ,W KDV ORQJ EHHQ UHFRJQL]HG WKDW LQ PLWRWLF FHOOV WKH PLFURWXEXOHV UHRUJDQL]H LQWR WKH PLWRWLF VSLQGOH LQFOXGLQJ WKH DVWUDO NLQHWRFKRUH DQG FRQWLQXRXV ILEHUV ZKLFK PHGLDWH WKH VHJUHJDWLRQ RI WKH FKURPRVRPHV :HEHU HW DO f 'XULQJ LQWHUSKDVH WKH UROH RI WKH PLFURWXEXOHV LV OHVV FOHDU DQG VRPHZKDW FRQWURYHUVLDO 6WXGLHV RQ DJHQWV WKDW FDXVH WKH GHSRO\PHUL]DWLRQ RI WKH PLFURWXEXOHV VXFK DV FROFKLFLQH DQG FROFHPLG VXJJHVW WKDW WKH PLFURWXEXOHV SOD\ D UROH LQ FHOO VKDSH DQG WKH LQWUDFHOOXODU WUDQVSRUW RI PDFURPROHFXOHV DQG RUJDQHOOHV +D\GHQ DQG $OOHQ 9DOH HW DO f

PAGE 25

7KHUH DUH DW OHDVW ILYH PDMRU FODVVHV RI SURWHLQ WKDW FRQVWLWXWH WKH LQWHUPHGLDWH ILODPHQWV f GHVPLQ f YLPHQWLQ f NHUDWLQ f QHXURILODPHQWV DQG f JOLDO ILODPHQWV %LRFKHPLFDO DQG LPPXQRORJLFDO VWXGLHV GHPRQVWUDWHG WKDW WKHVH SURWHLQV DUH JHQHUDOO\ H[SUHVVHG LQ D FHOOW\SH VSHFLILF PDQQHU IRU UHYLHZ VHH /D]DULGHV f 'HVPLQ LV DQ DFLGLF SURWHLQ ZLWK D PROHFXODU ZHLJKW RI 'DOWRQV DQG LV SUHGRPLQDQWO\ IRXQG LQ LQWHUPHGLDWH ILODPHQWV IURP FDUGLDF VPRRWK DQG VNHOHWDO PXVFOH FHOOV /D]DULGHV DQG +XEEDUG +XEEDUG DQG /D]DULGHV f 7KH ORFDOL]DWLRQ RI GHVPLQ DW WKH = OLQH LQ PXVFOH VXJJHVWV D UROH IRU WKLV SURWHLQ LQ WKH FRRUGLQDWLRQ RI WKH FRQWUDFWLOH DFWLRQV RI WKH PXVFOH ILEHU /D]DULGHV DQG +XEEDUG ,]DQW DQG /D]DULGHV f 9LPHQWLQ LV IRXQG SULQFLSDOO\ LQ LQWHUPHGLDWH ILODPHQWV IURP FHOOV RI PHVHQFK\PDO RULJLQ ,PPXQRORJLFDO DQG ELRFKHPLFDO FKDUDFWHUL]DWLRQ RI YLPHQWLQ LQGLFDWHG WKDW WKH SURWHLQ LV 'DOWRQV DQG ZLGHO\ FRQVHUYHG WKURXJKRXW HYROXWLRQ %URZQ HW DO %HQQHWW HW DO )UDQNH HW DO f $ FKDUDFWHULVWLF IHDWXUH RI WKH YLPHQWLQ LQWHUPHGLDWH ILODPHQWV LV WKHLU VHQVLWLYLW\ WR FROFKLFLQH ZKLFK HUURQHRXVO\ OHG UHVHDUFKHUV WR EHOLHYH LQLWLDOO\ WKDW WKH\ ZHUH GLVDJJUHJDWLRQ SURGXFWV RI WKH PLFURWXEXOHV *ROGPDQ DQG .QLSH +ROOWURS HW DO %ORVH DQG &KDFNR f 7KH FROODSVH RI YLPHQWLQ LQWR ILODPHQWRXV EXQGOHV DURXQG WKH QXFOHXV GXULQJ FROFKLFLQH WUHDWPHQW

PAGE 26

VXJJHVWV WKDW WKHVH ILODPHQWV DUH LQ FORVH DVVRFLDWLRQ ZLWK WKH PLFURWXEXOHV 7KH NHUDWLQ ILODPHQWV DOVR NQRZQ DV WRQRILODPHQWV DUH SUHGRPLQDQWO\ IRXQG LQ HSLWKHOLDO FHOOV 7KH NHUDWLQ SURWHLQV DUH D IDPLO\ RI DSSUR[LPDWHO\ GLVWLQFW SRO\SHSWLGHV UDQJLQJ LQ PROHFXODU ZHLJKW IURP 'DOWRQV 6WHLQHUW 6WHLQHUW DQG *XOOLQR 6XQ DQG *UHHQ 0ROO HW DO f 7KH NHUDWLQV FDQ EH FOHDUO\ GLYLGHG LQWR DFLGLF DQG EDVLF JURXSV EDVHG RQ WZR GLPHQVLRQDO HOHFWURSKRUHWLF DQDO\VLV $OWKRXJK RQO\ D IHZ NHUDWLQ VXEW\SHV DUH H[SUHVVHG LQ DQ\ RQH HSLWKHOLDO FHOO WKHUH LV DOZD\V D FRRUGLQDWHG V\QWKHVLV RI DW OHDVW RQH FODVV HDFK RI WKH DFLGLF DQG EDVLF NHUDWLQ VXEXQLWV 0ROO HW DOA :RRGFRFN0LWFKHOO HW DO )XFKV DQG 0DUFKXN f 7KH FRPELQDWLRQ RI NHUDWLQ VXEW\SHV H[SUHVVHG E\ DQ HSLWKHOLDO FHOO LV FKDUDFWHULVWLF RI WKH WLVVXH RULJLQ DV ZHOO DV WKH GLIIHUHQWLDWLRQ VWDWH RI WKH FHOO 5RRS HW DO 6XQ HW DO f ,Q DGGLWLRQ VRPH HSLWKHOLDOO\ GHULYHG WXPRUV H[SUHVV GLIIHUHQW NHUDWLQ VXEW\SHV WKDQ WKRVH IRXQG LQ WKH QRUPDO FRXQWHUSDUW DQG WKHVH GLIIHUHQFHV PD\ EH XVHIXO LQ GLDJQRVWLF WHVWV 6XPPHUKD\HV HW DO 2VERUQ f /LWWOH LV NQRZQ DERXW WKH IXQFWLRQ DQG RUJDQL]DWLRQ RI WKH LQWHUPHGLDWH ILODPHQWV IURP QHXURQDO DQG JOLDO FHOOV 7KH PDMRU F\WRVNHOHWDO HOHPHQW RI QHXURQDO D[RQV DQG GHQGULWHV DUH WKH QHXURQDO ILODPHQWV ZKLFK DUH JHQHUDOO\

PAGE 27

FRPSRVHG RI WKUHH ODUJH SRO\SHSWLGHV ZLWK PROHFXODU ZHLJKWV RI DQG 'DOWRQV +RIIPDQ DQG /DVHN 'HODFRXUWH HW DO f *OLDO ILODPHQWV DUH VSHFLILFDOO\ IRXQG LQ DVWURF\WHV DQG RWKHU W\SHV RI JOLDO FHOOV DQG FRQVLVW RI D VLQJOH SURWHLQ WKH JOLDO ILEULOODU\ DFLGLF SURWHLQ *)$f ZLWK D PROHFXODU ZHLJKW RI 'DOWRQV 6FKDFKQHU HW DO *ROGPDQ HW DO f $OWKRXJK WKH LQWHUPHGLDWH ILODPHQW SURWHLQV IURP WKH GLIIHUHQW FHOO W\SHV DUH KHWHURJHQHRXV LQ WKHLU FKHPLFDO FRPSRVLWLRQ WKH\ DVVHPEOH LQWR VLPLODU PRUSKRORJLFDO VWUXFWXUHV FRQVLVWLQJ RI ILODPHQWV WKDW DUH QP LQ GLDPHWHU WKDW DUH KLJKO\ UHVLVWDQW WR H[WUDFWLRQ ZLWK GHWHUJHQWV ,W KDV EHHQ SURSRVHG WKDW WKH LQWHUPHGLDWH ILODPHQWV FRQWDLQ D FRQVWDQW DQG YDULDEOH UHJLRQ DQDORJRXV WR WKH VWUXFWXUH RI DQWLERGLHV 7KH FRQVWDQW GRPDLQ ZRXOG FRQVHUYH WKH PRUSKRORJ\ ZKHUHDV WKH YDULDEOH GRPDLQ ZRXOG FRQIHU IXQFWLRQDO VSHFLILFLW\ /D]DULGHV f 7KH PLFURILODPHQWV DUH WKH WKLQQHVW RI WKH F\WRVNHOHWDO ILODPHQW V\VWHPV ZLWK DQ DYHUDJH GLDPHWHU RI QP DQG DUH FRPSRVHG SULPDULO\ RI DFWLQ SURWHLQ ,W KDV EHHQ HVWLPDWHG WKDW DSSUR[LPDWHO\ b RI WRWDO FHOOXODU SURWHLQ LV DFWLQ ZKLFK H[LVWV LQ DQ HTXLOLEULXP EHWZHHQ PRQRPHULF DQG ILODPHQWRXV IRUPV +DUWZLJ DQG 6WRVVHO f 0LFURILODPHQWV IURP QRQPXVFOH FHOOV FRQWDLQ WZR SUHGRPLQDQW VSHFLHV RI DFWLQ SURWHLQ QDPHO\ EHWD DQG JDPPDDFWLQ 7KH QRQPXVFOH DFWLQ SURWHLQV DUH TXLWH VLPLODU WR PXVFOH

PAGE 28

VSHFLILF DOSKDDFWLQ ZLWK UHVSHFW WR PROHFXODU ZHLJKW 'DOWRQVf DPLQR DFLG VHTXHQFH DQG SRO\PHULF VWUXFWXUH 7LOQH\ DQG 'HWPHUV +DUWZLJ DQG 6WRVVHO .DQH *DUUHOV DQG *LEVRQ :KDOHQ HW DOA 5XEHQVWHLQ DQG 6SXGLFK f 7KHVH UHVXOWV VXJJHVW WKDW EHWD DQG JDPPDDFWLQ SURWHLQ LQ QRQPXVFOH FHOOV PD\ SOD\ D UROH LQ FRQWUDFWLRQ SURFHVVHV VXFK DV FHOO PRWLOLW\ FKURPRVRPH PRYHPHQW DQG H[RF\WRVLV %HUO HW DO +X[OH\ 6DQJHU f &YWRVNHOHWDOP51$ ,QWHUDFWLRQV (DUO\ VWXGLHV XVLQJ VWHUHRHOHFWURQ PLFURVFRSLF DQDO\VLV RI ZKROH FHOOV LQGLFDWHG WKDW SRO\VRPHV DUH DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ VWUXFWXUH :RORVHZLFN DQG 3RUWHU f &ORVHU H[DPLQDWLRQ RI WKH FHOO LQWHULRU E\ UHPRYLQJ PHPEUDQHV DQG VROXEOH F\WRSODVPLF SURWHLQV ZLWK GHWHUJHQW UHYHDOV WKDW PDQ\ RI WKH XOWUDVWUXFWXUDO IHDWXUHV DQG QHDUO\ DOO WKH SRO\VRPHV DUH UHWDLQHG RQ WKH F\WRVNHOHWDO IUDPHZRUN /HQN HW DO f )XUWKHUPRUH WKH QRQUDQGRP WRSRORJLFDO GLVWULEXWLRQ RI WKH SRO\VRPHV LV SUHVHUYHG LQ WKH F\WRVNHOHWRQ SUHSDUDWLRQ )XOWRQ HW DO f 7KH DVVRFLDWLRQ RI WKH SRO\VRPHV ZLWK WKH F\WRVNHOHWRQ GRHV QRW DSSHDU WR EH GXH WR WUDSSLQJ VLQFH PRQRVRPHV DQG LQGHSHQGHQW ULERVRPDO VXEXQLWV DUH HIILFLHQWO\ UHPRYHG E\ WKH GHWHUJHQW H[WUDFWLRQ /HQN HW DO &HUYHUD HW DO 2UQHOOHV HW DO f 7KHVH UHVXOWV

PAGE 29

LQGLFDWH WKDW DFWLYHO\ WUDQVODWHG P51$V DUH DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ DQG WKLV DVVRFLDWLRQ PD\ EH UHTXLVLWH IRU SURWHLQ V\QWKHVLV &RQVLVWHQW ZLWK WKLV SRVVLELOLW\ WKH LQKLELWLRQ RI KRVW SURWHLQ V\QWKHVLV FRLQFLGHV ZLWK WKH UHOHDVH RI KRVW P51$ IURP WKH F\WRVNHOHWDO VWUXFWXUH DQG WKH DWWDFKPHQW RI YLUDO P51$ WR WKH F\WRVNHOHWRQ LQ SROLRYLUXV LQIHFWHG DQG DGHQRYLUXV LQIHFWHG FHOOV &HUYHUD HW DO /HPLHX[ DQG %HDXG f 'XULQJ GHYHORSPHQW PDWHUQDOO\ LQKHULWHG P51$V SDUWLFLSDWH LQ SURWHLQ V\QWKHVLV RQO\ DW WKH WLPH WKH\ EHFRPH DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ VHD XUFKLQ RRF\WHV 0RRQ HW DO f 7KH UHJLRQ RI WKH SRO\VRPH LQYROYHG LQ LWV DWWDFKPHQW WR WKH F\WRVNHOHWRQ LV QRW NQRZQ 3UHYLRXV UHVXOWV LQGLFDWH WKDW WKH DVVRFLDWLRQ RI SRO\VRPDO P51$ ZLWK WKH F\WRVNHOHWRQ LV WKURXJK WKH P51$ RU P513 SDUWLFOH DQG QRW WKURXJK WKH ULERVRPH /HQN HW DO /HQN DQG 3HQPDQ &HUYHUD HW DO /HPLHX[ DQG %HDXG f 'LVUXSWLRQ RI SRO\VRPHV E\ KHDW VKRFN KLJK VDOW VRGLXP IOXRULGH RU SDFWDP\FLQ WUHDWPHQW UHOHDVHV WKH ULERVRPDO VXEXQLWV EXW QRW WKH P51$ IURP WKH F\WRVNHOHWRQ LQWR WKH VROXEOH SKDVH /HQN HW DO &HUYHUD HW DO YDQ 9HQURRLM HW DO +RZH DQG +HUVKH\ f ,PPXQRIOXRUHVFHQFH VWXGLHV LQGLFDWH WKDW WKH FDSELQGLQJ SURWHLQ LV DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ VXJJHVWLQJ WKDW WKH DWWDFKPHQW RI HXNDU\RWLF P51$V WR WKH F\WRVNHOHWRQ PD\ RFFXU YLD WKH n P51$ FDS VWUXFWXUH =XPEH HW DO f (DUOLHU VWXGLHV VXJJHVW WKDW

PAGE 30

WKH DVVRFLDWLRQ RI HXNDU\RWLF P51$V ZLWK WKH F\WRVNHOHWRQ PD\ RFFXU WKURXJK WKH SRO\$ WUDFW 0LOFDUHN DQG 3HQPDQ f +RZHYHU WKH DVVRFLDWLRQ RI XQFDSSHG SROLRYLUXV P51$V %RQQHDX HW DO f DQG SRO\$ KLVWRQH P51$V -HIIHU\ %RQQHDX HW DO f LQGLFDWHV WKDW WKH DWWDFKPHQW VLWH PLJKW DOVR H[LVW LQ DQ LQWHUQDO UHJLRQ FRQWDLQHG ZLWKLQ WKH n DQG r HQGV RI WKH P51$ ,VDDFV DQG )XOWRQ f KDYH SUHVHQWHG HYLGHQFH VXJJHVWLQJ WKDW P\RVLQ KHDY\ FKDLQ LQ HPEU\RQLF FKLFNHQ PXVFOH FHOOV LV FRWUDQVODWLRQDOO\ DVVHPEOHG LQWR WKH F\WRVNHOHWRQ 7KH P\RVLQ QDVFHQW SRO\SHSWLGH ZRXOG WKHUHIRUH VHUYH DV DQ DGGLWLRQDO F\WRVNHOHWRQ DWWDFKPHQW VLWH IRU WKH SRO\VRPDO P\RVLQ P51$ %DVHG RQ WKHVH UHVXOWV LW DSSHDUV WKDW VHYHUDO PHFKDQLVPV PD\ RSHUDWH LQ WKH DWWDFKPHQW RI D VSHFLILF SRO\VRPDO P51$ RU P513 WR WKH F\WRVNHOHWRQ DQG WKHVH DWWDFKPHQW VLWHV PD\ YDU\ GHSHQGLQJ RQ WKH VSHFLHV RI P51$ 7KH FRPSRQHQW RI WKH F\WRVNHOHWRQ WR ZKLFK WKH P51$ LV DWWDFKHG LV QRW NQRZQ DOWKRXJK WKH GDWD DFFXPXODWHG WR GDWH VXJJHVW WKDW WKH PLFURILODPHQWV PD\ EH LQYROYHG LQ WKH P51$ F\WRVNHOHWRQ DVVRFLDWLRQ 5HPRYDO RI WXEXOLQ IURP WKH F\WRVNHOHWRQ E\ XVLQJ FROG FDOFLXPFRQWDLQLQJ EXIIHUV GXULQJ WKH LVRODWLRQ SURFHGXUH KDV QR HIIHFW RQ WKH DWWDFKPHQW RI P51$ ZLWK WKH F\WRVNHOHWRQ WKLV UHVXOW VXJJHVWV WKDW WKH PLFURWXEXOHV GR QRW SOD\ D UROH LQ WKH DVVRFLDWLRQ RI P51$ ZLWK WKH F\WRVNHOHWRQ /HQN HW DO +RZH DQG +HUVKH\ 2UQHOOHV HW DO f 'LVUXSWLRQ RI YLPHQWLQ

PAGE 31

ILODPHQWV ZLWK KHDW VKRFN RU LQGLUHFWO\ ZLWK FROFHPLG KDV QR HIIHFW RQ SURWHLQ V\QWKHVLV DV GHWHUPLQHG E\ WZRGLPHQVLRQDO HOHFWURSKRUHVLV LQGLFDWLQJ WKDW WUDQVODWLRQ LV QRW GHSHQGHQW RQ WKH LQWHJULW\ RI WKH LQWHUPHGLDWH ILODPHQWV :HOFK DQG )HUDPLVFR f 2WKHU UHSRUWV VXJJHVW WKDW WKH DWWDFKPHQW RI P51$ WR WKH F\WRVNHOHWRQ LV PHGLDWHG E\ WKH PLFURILODPHQWV /HQN HW DO +RZH DQG +HUVKH\ 2UQHOOHV HW DO f 7UHDWPHQW ZLWK F\WRFKDODVLQV HLWKHU F\WRFKDODVLQ % RU WR GLVUXSW WKH DFWLQFRQWDLQLQJ PLFURILODPHQWV UHVXOWV LQ WKH UHOHDVH RI SRO\$ P51$ IURP WKH F\WRVNHOHWRQ LQWR WKH VROXEOH SKDVH $W OHDVW LQ WKH FDVH RI F\WRFKDODVLQ WUHDWPHQW WKH UHOHDVH RI SRO\$ P51$ IURP WKH F\WRVNHOHWRQ RFFXUV LQ D GRVH GHSHQGHQW PDQQHU DQG VWRLFKLRPHWULFDOO\ UHIOHFWV WKH GHJUHH RI LQKLELWLRQ RI SURWHLQ V\QWKHVLV 2UQHOOHV HW DO f 7KHVH UHVXOWV LQGLFDWH WKDW LQWDFW PLFURILODPHQWV DUH UHTXLUHG IRU WKH DVVRFLDWLRQ RI P51$ WR WKH F\WRVNHOHWRQ KRZHYHU LW FDQ QRW EH FRQFOXGHG WKDW WKH DFWLQ ILEHUV GLUHFWO\ ELQG WKH P51$ 1RQPHPEUDQH%RXQG DQG 0HPEUDQH%RXQG 3RO\ULERVRPHV 7KH 6LJQDO +\SRWKHVLV $V GHVFULEHG DERYH QHDUO\ SHUFHQW RI WKH DFWLYHO\ WUDQVODWHG SRO\VRPHV DUH DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ 6WXGLHV RQ YHVLFXODU VWRPDWLWLV YLUXV LQIHFWHG +H/D FHOOV GHPRQVWUDWHG WKDW PHPEUDQHERXQG SRO\VRPDO P51$ FRGLQJ IRU WKH YLUDO JO\FRSURWHLQ DQG IUHH SRO\VRPDO P51$ FRGLQJ

PAGE 32

IRU WKH SRO\PHUDVH QXFOHRFDSVLG DQG PDWUL[ SURWHLQV DUH DOO DWWDFKHG WR WKH F\WRVNHOHWRQ GXULQJ WUDQVODWLRQ &HUYHUD HW DO f 7KH DVVRFLDWLRQ RI IUHH SRO\VRPHV ZLWK WKH F\WRVNHOHWRQ KDV DOVR EHHQ GHPRQVWUDWHG E\ HOHFWURQ PLFURVFRS\ :RORVHZLFN DQG 3RUWHU f )UHH SRO\VRPHV DUH JHQHUDOO\ WKH FODVV RI SRO\VRPHV LQYROYHG LQ WKH V\QWKHVLV RI LQWUDFHOOXODU SURWHLQV ZKHUHDV PHPEUDQHERXQG SRO\VRPHV DUH JHQHUDOO\ LQYROYHG LQ WKH V\QWKHVLV RI H[SRUWHG SURWHLQV WKDW DUH GHVWLQHG IRU WKH FHOO VXUIDFH RU VHFUHWLRQ IRU UHYLHZ VHH (PU HW DO f 7KH DVVRFLDWLRQ RI IUHH SRO\VRPDO P51$V ZLWK WKH F\WRVNHOHWRQ VXJJHVWV WKDW WKH SRO\VRPH LV DQFKRUHG WR D VFDIIROG DOEHLW D G\QDPLF VWUXFWXUH DQG QRW IUHHO\ GLIIXVLEOH ZLWKLQ WKH F\WRSODVP 7KH WHUP IUHH SRO\VRPH LV RSHUDWLRQDOO\ GHILQHG DQG LV D PLVQRPHU ZKHQ YLHZHG LQ OLJKW RI WKH ELRFKHPLFDO DQG PLFURVFRSLF VWXGLHV RQ WKH F\WRVNHOHWRQ 7KH SURSHU UHIHUHQFH WR IUHH SRO\VRPHV LV QRQPHPEUDQHERXQG SRO\VRPHV 7KH PHFKDQLVP E\ ZKLFK P51$V DVVHPEOH LQWR PHPEUDQH ERXQG SRO\VRPHV KDV EHHQ GHVFULEHG LQ WKH VLJQDO K\SRWKHVLV %OREHO DQG 'REEHUVWHLQ f 0DQ\ W\SHV RI VLJQDO SHSWLGHV H[LVW WKDW WDUJHW SURWHLQV WR YDULRXV VXEFHOOXODU PHPEUDQH FRPSDUWPHQWV VXFK DV WKH HQGRSODVPLF UHWLFXOXP PLWRFKRQGULD DQG FKORURSODVWV LQ HXNDU\RWHV DV ZHOO DV WKH FHOO PHPEUDQH LQ SURNDU\RWHV 'DWH HW DO 6FKDW] DQG %XWRZ 0XOOHU DQG %OREHO &OLQH f 7KH ZRUN SUHVHQWHG KHUH LV IRFXVHG RQ HYHQWV WKDW RFFXU DW WKH

PAGE 33

HQGRSODVPLF UHWLFXOXP DQG RQ ZKDW LV JHQHUDOO\ NQRZQ IRU WKH V\QWKHVLV RI SURWHLQV WKDW DUH ORFDOL]HG RQ WKH FHOO VXUIDFH RU VHFUHWHG IURP WKH FHOO 0RVW FHOO VXUIDFH RU VHFUHWHG SURWHLQV DUH LQLWLDOO\ V\QWKHVL]HG ZLWK D VHJPHQW RI DPLQR DFLG UHVLGXHV DW WKH 1WHUPLQXV WKDW LV QRW XVXDOO\ IRXQG LQ WKH PDWXUH SURWHLQ 7KLV VHJPHQW LV FRPPRQO\ UHIHUUHG WR DV D VLJQDO SHSWLGH $OWKRXJK VLJQDO SHSWLGHV DUH QRW KLJKO\ FRQVHUYHG LQ VHTXHQFH WKH\ DUH IDLUO\ FRQVHUYHG LQ VWUXFWXUH DQG EDVHG RQ WKH FRPSLODWLRQ RI VLJQDO SHSWLGHV UDQJLQJ IURP EDFWHULD WR KLJKHU HXNDU\RWHV D FRQVHQVXV VWUXFWXUH KDV EHHQ GHGXFHG :DWVRQ f ,Q JHQHUDO VLJQDO SHSWLGHV DUH DPLQR DFLGV LQ OHQJWK 7KH\ FRQWDLQ D FKDUJHG DPLQR DFLG ZLWKLQ WKH ILUVW ILYH UHVLGXHV ZKLFK LV IROORZHG E\ D VWUHWFK RI DW OHDVW QLQH K\GURSKRELF DPLQR DFLGV DQG WHUPLQDWH DW D VPDOO XQFKDUJHG DPLQR DFLG VXFK DV DODQLQH VHULQH RU JO\FLQH ,W LV EHOLHYHG WKDW WKH K\GURSKRELF GRPDLQ RI WKH VLJQDO SHSWLGH IDFLOLWDWHV WKH WUDQVIHU RI WKH SURWHLQ DFURVV WKH OLSLG HQYLURQPHQW RI VSHFLILF LQWUDFHOOXODU PHPEUDQHV ZKHUHDV WKH VPDOO XQFKDUJHG DPLQR DFLG LV WKRXJKW WR GLUHFW WKH SURWHDVH WR FOHDYH WKH SHSWLGH IURP WKH PDWXUH SURWHLQ +RUWLQ DQG %RLPH f 3UHVXPDEO\ WUDQVODWLRQ RI P51$ HQFRGLQJ H[SRUWHG SURWHLQV LV LQLWLDWHG RQ QRQPHPEUDQHERXQG SRO\VRPHV )ROORZLQJ WKH V\QWKHVLV RI DSSUR[LPDWHO\ DPLQR DFLGV WKH SRLQW DW ZKLFK WKH HQWLUH VLJQDO SHSWLGH KDV HPHUJHG IURP

PAGE 34

WKH ULERVRPH WKH VLJQDO UHFRJQLWLRQ FRPSOH[ 653f ELQGV WR WKH VLJQDO SHSWLGH DQG DUUHVWV WUDQVODWLRQ :DOWHU DQG %OREHO f 7KH 653 LV DQ 6 ULERQXFOHLF DFLGSURWHLQ FRPSOH[ FRPSRVHG RI VL[ QRQLGHQWLFDO SRO\SHSWLGHV DQG RQH VPDOO F\WRSODVPLF 51$ PROHFXOH :DOWHU DQG %OREHO :DOWHUnDQG %OREHO :DOWHU DQG %OREHO f 7KH 51$ PROHFXOH RI 653 LV ULERQXFOHRWLGHV LQ OHQJWK DQG VKDUHV DSSUR[LPDWHO\ b KRPRORJ\ ZLWK D PLGGOH UHSHWLWLYH KXPDQ '1$ IDPLO\ 8OOX HW DO /L HW DOA f :LWK WKH 653 ERXQG WR WKH VLJQDO SHSWLGH WKH FRPSOH[ FDQ WKHQ DVVRFLDWH ZLWK WKH PHPEUDQH RI WKH HQGRSODVPLF UHWLFXOXP WKURXJK WKH LQWHUDFWLRQ ZLWK WKH 653 UHFHSWRU ZKLFK LV DOVR NQRZQ DV WKH GRFNLQJ SURWHLQ *LOPRUH HW DO D *LOPRUH HW DO E 0H\HU HW DO D 0H\HU HW DO Ef 7KH 653 WKHQ GLVVRFLDWHV IURP WKH SRO\VRPH ZLWK WKH UHVXOWDQW UHOHDVH RI WKH WUDQVODWLRQDO EORFN $V WUDQVODWLRQ UHVXPHV WKH SURWHLQ LV FRWUDQVORFDWHG IURP WKH F\WRSODVP LQWR WKH HQGRSODVPLF UHWLFXOXP 'XULQJ WUDQVORFDWLRQ D VLJQDO SHSWLGDVH ZKLFK LV ORFDWHG LQ WKH OXPHQ RI WKH HQGRSODVPLF UHWLFXOXP UHPRYHV WKH VLJQDO SHSWLGH IURP WKH SURWHLQ 0DXUHU DQG 0FNHDQ :DOWHU HW DO f 2YHUYLHZ RI 3URMHFW 7KH RYHUDOO DLP RI WKLV ZRUN LV WR EHWWHU GHILQH WKH PHFKDQLVPVf LQYROYHG LQ FRXSOLQJ KLVWRQH SURWHLQ V\QWKHVLV ZLWK '1$ UHSOLFDWLRQ 6SHFLILFDOO\ ZH KDYH IRFXVHG RXU

PAGE 35

DWWHQWLRQ RQ WKH SRVWWUDQVFULSWLRQDO UHJXODWLRQ RI KLVWRQH JHQH H[SUHVVLRQ 7KH HYLGHQFH FLWHG DERYH VXJJHVWV WKDW WKH F\WRSODVP RI HXNDU\RWLF FHOOV LV D KLJKO\ RUJDQL]HG UHJLRQ ZKLFK FRQWDLQV VXEFHOOXODU FRPSDUWPHQWV WKDW FRQFHQWUDWH WUDQVODWLRQ IDFWRUV DV ZHOO DV VSHFLILF P51$V )XOWRQ HW DO +RZH DQG +HUVKH\ /DZUHQFH DQG 6LQJHU 2UQHOOHV HW DO f 7UDGLWLRQDOO\ WKH LGHD RI VXEFHOOXODU FRPSDUWPHQWV UHIHUV WR RUJDQHOOHV VXFK DV WKH QXFOHXV HQGRSODVPLF UHWLFXOXP DQG PLWRFKRQGULD )RU H[DPSOH D SRSXODU ELRFKHPLFDO GHILQLWLRQ RI FRPSDUWPHQWDWLRQ LV D VLPSOH UHJXODWRU\ PHFKDQLVP LQ ZKLFK WKH HQ]\PHV IRU FDWDEROLVP DQG ELRV\QWKHVLV DUH SK\VLFDOO\ VHSDUDWHG E\ PHPEUDQHERXQG FHOO RUJDQHOOHV 5DZQ f $ EURDGHU GHILQLWLRQ RI VXEFHOOXODU FRPSDUWPHQWDWLRQ LQFOXGHV DQ\ VSHFLDOL]HG UHJLRQ RI WKH FHOO UHJDUGOHVV RI WKH SUHVHQFH RI D PHPEUDQH DQG PD\ EH H[WHQGHG WR VXFK FRPSRQHQWV DQG UHJLRQV DV f QRQPHPEUDQHERXQG DQG PHPEUDQH ERXQG SRO\VRPHV f F\WRVNHOHWRQ DQG VROXEOH SKDVH DQG f VSDWLDO ORFDWLRQ LH QHDU WKH QXFOHXV YHUVXV QHDU WKH SODVPD PHPEUDQHf +LVWRQH P51$V DQG WKH IDFWRUV WKDW DUH LQYROYHG LQ WKHLU VHOHFWLYH GHJUDGDWLRQ GXULQJ WKH LQKLELWLRQ RI '1$ V\QWKHVLV PD\ EH ORFDOL]HG LQ D SDUWLFXODU VXEFHOOXODU FRPSDUWPHQW &RQVLVWHQW ZLWK WKLV UHDVRQLQJ WKH VXEFHOOXODU FRPSDUWPHQW PD\ LQIOXHQFH WKH SRVWWUDQVFULSWLRQDO FRQWURO RI KLVWRQH JHQH H[SUHVVLRQ %DVHG RQ WKLV SRVVLELOLW\ ZH KDYH

PAGE 36

VSHFLILFDOO\ DVNHG WKH TXHVWLRQ 'RHV WKH VXEFHOOXODU ORFDWLRQ RI KLVWRQH P51$ SOD\ D UROH LQ WKH GHVWDELOL]DWLRQ RI KLVWRQH P51$ GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV" 7R DGGUHVV WKLV TXHVWLRQ ZH KDYH DSSOLHG D FRPELQDWLRQ RI PROHFXODU DQG FHOOXODU DSSURDFKHV ILUVW WR GHWHUPLQH WKH QDWXUDO ORFDWLRQ RI KLVWRQH P51$ DQG VHFRQG WR DOWHU WKH VXEFHOOXODU FRPSDUWPHQW WR VWXG\ ZKHWKHU WKH IRUHLJQ ORFDWLRQ DIIHFWV KLVWRQH P51$ VWDELOLW\ 7KH UDWLRQDOH IRU WKLV DSSURDFK LV WKDW GLUHFWLQJ KLVWRQH P51$ WR DQ DOWHUHG VXEFHOOXODU ORFDWLRQ PD\ SK\VLFDOO\ UHPRYH WKH PHVVDJH IURP WKH IDFWRUV WKDW DUH LQYROYHG LQ WKH VHOHFWLYH GHJUDGDWLRQ RI KLVWRQH P51$ GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV 2XU LQLWLDO VWXGLHV GHPRQVWUDWHG WKDW KLVWRQH P51$V DUH WUDQVODWHG SUHGRPLQDQWO\ RQ QRQPHPEUDQHERXQG SRO\VRPHV WKDW DUH DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ 7KH VXEFHOOXODU ORFDWLRQ RI WKH P51$ ZDV DOWHUHG ELRORJLFDOO\ E\ FRQVWUXFWLQJ D KLVWRQH IXVLRQ JHQH WKDW FRQWDLQV VHTXHQFHV FRGLQJ IRU WKH VLJQDO SHSWLGH RI WKH EHWDODFWDPDVH JHQH RI ( FROL S%5 SODVPLG '1$ 7KH HQFRGHG IXVLRQ KLVWRQH P51$ ZDV GLUHFWHG WR PHPEUDQHERXQG SRO\VRPHV DQG ZDV QRW GHVWDELOL]HG GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV ,QDFWLYDWLRQ RI VLJQDO SHSWLGH IXQFWLRQ E\ D VLQJOH QXFOHRWLGH VXEVWLWXWLRQ LQ WKH $7* WUDQVODWLRQ VWDUW FRGRQ RI WKH VLJQDO SHSWLGH UHVXOWHG LQ WKH DVVRFLDWLRQ RI WKH PXWDWHG IXVLRQ P51$ ZLWK QRQPHPEUDQHERXQG SRO\VRPHV DQG UHVWRUHG WKH FRXSOLQJ RI WKH P51$ VWDELOLW\ ZLWK '1$

PAGE 37

UHSOLFDWLRQ 7KHVH UHVXOWV LQGLFDWHG WKDW WKH VXEFHOOXODU ORFDWLRQ SOD\V D UROH LQ WKH SRVWWUDQVFULSWLRQDO FRQWURO RI KLVWRQH JHQH UHJXODWLRQ 'XULQJ WKH FRXUVH RI VWXG\LQJ KLVWRQH P51$ VXEFHOOXODU ORFDOL]DWLRQ LW ZDV QHFHVVDU\ WR H[DPLQH KLVWRQH P51$ F\WRVNHOHWDO LQWHUDFWLRQV LQ GHWDLO 3UHYLRXVO\ 2UQHOOHV HW DOA f UHSRUWHG WKDW WRWDO SRO\$ P51$ DV D KHWHURJHQRXV SRSXODWLRQ LV UHOHDVHG IURP WKH F\WRVNHOHWRQ LQ +H/D FHOOV E\ F\WRFKDODVLQ WUHDWPHQW :H GHPRQVWUDWHG E\ 1RUWKHUQ EORW DQDO\VLV WKDW F\WRFKDODVLQ WUHDWPHQW RI +H/D FHOOV UHDGLO\ UHOHDVHV KLVWRQH P51$ ZKLFK LV QRW SRO\ DGHQ\ODWHG IURP WKH F\WRVNHOHWRQ LQWR WKH VROXEOH SKDVH 6XUSULVLQJO\ P51$ FRGLQJ IRU WKH FHOO VXUIDFH +/$% FODVV DQWLJHQ UHPDLQHG DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ GXULQJ F\WRFKDODVLQ WUHDWPHQW 6XEVHTXHQW VWXGLHV GHPRQVWUDWHG WKDW +/$% P51$ H[SUHVVHV DW OHDVW WZR GLVWLQFW F\WRVNHOHWDO DWWDFKPHQW VLWHV D F\WRFKDODVLQ VHQVLWLYH VLWH DQG D SXURP\FLQ VHQVLWLYH VLWH 7KH SXURP\FLQ VHQVLWLYH VLWH DSSHDUV WR EH D IHDWXUH RI PHPEUDQHERXQG SRO\VRPDO P51$V DQG LV PRVW OLNHO\ WKH QDVFHQW SRO\SHSWLGH DQGRU ULERVRPH DVVRFLDWHG ZLWK WKH SURWHLQ VXEVWUXFWXUH RI WKH HQGRSODVPLF UHWLFXOXP &\WRFKDODVLQ DQG SXURP\FLQ FRWUHDWPHQW FRQGLWLRQV WKDW HIILFLHQWO\ UHOHDVH +/$% PHPEUDQHERXQG SRO\VRPDO P51$ DQG KLVWRQH QRQPHPEUDQHERXQG SRO\VRPDO P51$ IURP WKH F\WRVNHOHWRQ LQWR WKH VROXEOH SKDVH GLG QRW GLVVRFLDWH WKH

PAGE 38

VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ IURP WKH F\WRVNHOHWRQ 7KH QXFOHRWLGH VHTXHQFHV RI WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ HQFRGLQJ WKH VLJQDO SHSWLGH FRQWDLQ D F\WRFKDODVLQ DQG SXURP\FLQ LQVHQVLWLYH F\WRVNHOHWDO DWWDFKPHQW VLWH ZKLFK LV QRW H[SUHVVHG E\ KLVWRQH P51$ RU +/$%P51$ 7KHVH UHVXOWV SURYLGH HYLGHQFH IRU WKH KHWHURJHQHLF SDWWHUQ IRU F\WRVNHOHWRQP51$ LQWHUDFWLRQV /DVWO\ ZH LQYHVWLJDWHG WKH UROH RI WKH F\WRVNHOHWRQ LQ WKH UHJXODWLRQ RI JHQH H[SUHVVLRQ E\ VWXG\LQJ WKH HIIHFWV RI GLVUXSWLQJ WKH PLFURILODPHQWV ZLWK F\WRFKDODVLQ RQ WKH WUDQVFULSWLRQ DQG VWHDG\ VWDWH P51$ OHYHOV RI VHYHUDO JHQHV :H GHWHUPLQHG WKDW WKH WUDQVFULSWLRQDO DQG SRVWWUDQVFULSWLRQDO UHJXODWLRQ RI WKH FIRV SURWRRQFRJHQH LV TXLWH VHQVLWLYH WR WKH SHUWXUEDWLRQ RI WKH F\WRVNHOHWRQ VWUXFWXUH 7UDQVFULSWLRQ RI WKH FIRV JHQH LV VHOHFWLYHO\ VWLPXODWHG ZLWK D FRQFRPLWDQW LQFUHDVH LQ FIRV P51$ VWHDG\ VWDWH OHYHOV ZLWKLQ PLQXWHV RI WKH DGGLWLRQ RI F\WRFKDODVLQ &RQVLVWHQW ZLWK SUHYLRXV UHVXOWV WKH WUDQVFULSWLRQ RI EHWDDFWLQ ZDV DOVR HOHYDWHG LQ F\WRFKDODVLQ WUHDWHG FHOOV 7KHVH ILQGLQJV VXJJHVWV WKDW WKH FHOO PRQLWRUV WKH RUJDQL]DWLRQ RI WKH F\WRVNHOHWRQ DQG VHOHFWLYHO\ UHJXODWHV JHQH H[SUHVVLRQ DFFRUGLQJO\

PAGE 39

&+$37(5 *(1(5$/ 0(7+2'6 0DWHULDOV >D3@G&73 &LPPROf >D3@G$73 &LPPROf >JDPPD3@$73 &LPPROf DQG >D6@G$73 &LPPROf UDGLRQXFOHRWLGHV ZHUH SXUFKDVHG IURP $PHUVKDP $UOLQJWRQ +HLJKWV ,/ SRO\YLQ\OVXOIRQLF DFLG 396f SRO\HWK\OHQH JO\FRO 3(*f ;$5 [UD\ ILOP ZHUH REWDLQHG IURP (DVWPDQ .RGDN &R 5RFKHVWHU 1< XOWUDSXUH HOHFWURSKRUHVLV JUDGH DJDURVH DQG =HWDSUREH Q\ORQ PHPEUDQHV ZHUH IURP %LR 5DG 5LFKPRQG &$ IRUPDOGHK\GH VROXWLRQ b ZZf ZDV IURP )LVKHU 6FLHQWLILF )DLU /DZQ 1QLWURFHOOXORVH ZDV IURP 6FKOHLFKHU DQG 6FKXHOO .HHQH 1+ 53, VFLQWLOODWRU SSRSRSRS FRQFHQWUDWHG OLTXLG VFLQWLOODWRU /LTXLIOXRUf ZDV IURP 5HVHDUFK 3URGXFWV ,QWHUQDWLRQDO (ON *URYH 9LOODJH ,/ IRUPDPLGH ZDV IURP %HWKHVGD 5HDVHDUFK ODERUDWRULHV %5/f *DLWKHUVEXUJ 0' DFU\ODPLGH FDOI LQWHVWLQH DONDOLQH SKRVSKDWDVH QXFOHDVH 6, (McB FROL '1$ SRO\PHUDVH ODUJH IUDJPHQW .OHQRZ HQ]\PHf DQG PRVW UHVWULFWLRQ HQGRQXFOHDVHV ZHUH REWDLQHG IURP %RHKULQJHU 0DQQKHLP %LRFKHPLFDOV %0%f ,QGLDQDSROLV ,1 7 '1$ OLJDVH ZDV IURP 1HZ (QJODQG %LR /DEV 1(%f %HYHUO\ 0$

PAGE 40

7 SRO\QXFOHRWLGH NLQDVH FORQHGf ZDV IURP 8QLWHG 6WDWHV %LRFKHPLFDO &RUS 86%f &OHYHODQG 2+ F\WRFKDODVLQ SRO\R[\HWK\OHQH VRUELWDQ PRQRSDOPLWDWH 7ZHHQ f VRGLXP GHR[\FKRODWH 1D'2&f VRGLXP GRGHF\O VXOIDWH 6'6f 7ULWRQ ; DQG '1DVH '1(3f ZHUH SXUFKDVHG IURP 6LJPD 6W /RXLV02 O\VR]\PH ZDV SXUFKDVHG IURP :RUWKLQJWRQ %LRFKHPLFDOV )UHHKROG 1IHWDO ERYLQH FDOI ERYLQH DQG KRUVH VHUD ZHUH REWDLQHG IURP *LEFR /DERUDWRULHV *UDQG ,VODQG 1< RU )ORZ /DERUDWRULHV 0F/HDQ 9$ F\FORKH[LPLGH ZDV NLQGO\ SURYLGHG E\ 8SMRKQ .DODPD]RR 0LFKLJDQ &RQGLWLRQV IRU (Q]\PH 5HDFWLRQV 7KH EXIIHUV DQG LQFXEDWLRQ FRQGLWLRQV IRU HDFK RI WKH UHVWULFWLRQ HQGRQXFOHDVHV DQG '1$ PRGLI\LQJ HQ]\PHV XVHG LQ WKLV VWXG\ ZHUH DV GHVFULEHG E\ WKH VSHFLILF UHFRPPHQGDWLRQV RI WKH PDQXIDFWXUHUV XQOHVV RWKHUZLVH LQGLFDWHG 0DPPDOLDQ &HOO &XOWXUH +H/D 0RQROD\HU &HOO &XOWXUHV +H/D 6 VXVSHQVLRQ FHOOV KXPDQ FHUYLFDO FDUFLQRPD FHOO OLQH $7&& FFO f ZHUH VHHGHG LQWR (0(0 (DJOHVPRGLILHG PLQLPXP HVVHQWLDO PHGLXPf FRQWDLQLQJ b IHWDO FDOI VHUXP b KRUVH VHUXP 8PO SHQLFLOOLQ JPO VWUHSWRP\FLQ DQG P0 JOXWDPLQH DW [r FHOOV SHU FP WLVVXH FXOWXUH GLVK DQG LQFXEDWHG DW r& XQGHU b & &HOOV ZHUH PDLQWDLQHG DW VXEFRQIOXHQW GHQVLWLHV E\ VSOLWWLQJ WKH FXOWXUHV LQWR IUHVK PHGLXP HYHU\ WR GD\V

PAGE 41

+H/D 6XVSHQVLRQ &HOO &XOWXUHV +H/D 6 FHOOV ZHUH JURZQ DQG PDLQWDLQHG LQ VXVSHQVLRQ DW [O FHOOVPO LQ 60(0 -RNOLNPRGLILHG PLQLPXP HVVHQWLDO PHGLXPf VXSSOHPHQWHG ZLWK b FDOI VHUXP 8PO SHQLFLOOLQ [JPO VWUHSWRP\FLQ DQG P0 JOXWDPLQH LQ D ZDUP URRP DW r& 0RQRFORQDO DQG SRO\FORQDO +H/D 6 FHOO OLQHV ZKLFK ZHUH LVRODWHG GXULQJ VHOHFWLRQ RI WUDQVIHFWHG PRQROD\HU FXOWXUHV ZHUH PDLQWDLQHG LQ 60(0 FRQWDLQLQJ b IHWDO FDOI VHUXP b KRUVH VHUXP 8PO SHQLFLOOLQ [JPO VWUHSWRP\FLQ DQG P0 JOXWDPLQH DW [V FHOOVPO :, 0RQROD\HU &HOO &XOWXUHV :, FHOOV QRUPDO KXPDQ GLSORLG ILEUREODVWOLNH FHOOV $7&& FFO f DW SDVVDJH ZHUH JURZQ DV PRQROD\HUV LQ (0(0 FRQWDLQLQJ b IHWDO FDOI VHUXP 8PO SHQLFLOOLQ QJPO VWUHSWRP\FLQ DQG P0 JOXWDPLQH DW r& XQGHU b & &HOO FXOWXUHV ZHUH PDGH TXLHVFHQW E\ PDLQWDLQLQJ FXOWXUHV LQ (0(0 FRQWDLQLQJ b IHWDO FDOI VHUXP 8PO SHQLFLOOLQ [JP VWUHSWRP\FLQ DQG P0 JOXWDPLQH DW r& XQGHU b & IRU KRXUV 0HWDEROLF ,QKLELWRU 7UHDWPHQWV ,QKLELWLRQ RI '1$ V\QWKHVLV ZDV XVXDOO\ SHUIRUPHG ZLWK P0 K\GUR[\XUHD IRU WR PLQXWHV 7KH GUXJ ZDV DOZD\V SUHSDUHG IUHVK LQ ,; VSLQQHU VDOWV *LEFRf DV D P0 VWRFN VROXWLRQ

PAGE 42

3URWHLQ V\QWKHVLV ZDV LQKLELWHG ZLWK QJPO F\FORKH[LPLGH IRU YDU\LQJ OHQJWKV RI WLPH &\FORKH[LPLGH VWRFN VROXWLRQV > LJPO@ ZHUH SUHSDUHG IUHVK LQ ,; VSLQQHU VDOWV 3URWHLQ V\QWKHVLV ZDV DOVR LQKLELWHG ZLWK P0 SXURP\FLQ IRU YDU\LQJ OHQJWKV RI WLPH 3XURP\FLQ VWRFN VROXWLRQV > PJPO@ ZHUH SUHSDUHG LQ GLPHWK\O VXOIR[LGH '062f DQG VWRUHG DW r& 7R VWXG\ WKH GHSHQGHQFH RI SURWHLQ V\QWKHVLV RQ WKH GHVWDELOL]DWLRQ RI KLVWRQH P51$ GXULQJ WKH LQKLELWLRQ RI '1$ V\QWKHVLV ZH SUHWUHDWHG FHOOV ZLWK 0JPO F\FORKH[LPLGH IRU PLQXWHV DQG WKHQ DGGHG P0 K\GUR[\XUHD IRU DQ DGGLWLRQDO PLQXWHV 'LVUXSWLRQ RI WKH F\WRVNHOHWRQ ZDV JHQHUDOO\ DFKLHYHG E\ WUHDWLQJ WKH FHOOV ZLWK WR OLJPO F\WRFKDODVLQ IRU PLQXWHV DW r& 7KH F\WRFKDODVLQ VWRFN VROXWLRQV > PJPO@ ZHUH SUHSDUHG LQ '062 DQG VWRUHG DW r& 3ODVPLG '1$ 7KH KXPDQ KLVWRQH JHQHV XVHG LQ WKLV VWXG\ ZHUH SUHYLRXVO\ LVRODWHG E\ 6LHUUD HW DO IURP D ODPEGD &K$ EDFWHULRSKDJH OLEUDU\ f 7KH KLVWRQH JHQHV ZHUH VXEVHJXHQWO\ VXEFORQHG LQWR (VFKHULFKLD FROL S%5 SODVPLG '1$ DQG SURSDJDWHG LQ (BVB FROL VWUDLQ +% EDFWHULXP 6LHUUD HW DO 3OXPE HW DO 6WHLQ HW DO f 5HFRPELQDQW SODVPLGV 67 DQG ))& HDFK FRQWDLQ D GLVWLQFW JHQRPLF '1$ IUDJPHQW HQFRGLQJ D KXPDQ + KLVWRQH

PAGE 43

JHQH 7KH UHFRPELQDQW SODVPLG )$ FRQWDLQV DQ HQWLUH KXPDQ + KLVWRQH JHQH ZKLFK LQFOXGHV WKH SURPRWHU FRGLQJ DQG n QRQWUDQVFULEHG UHJLRQV $Q +/$% F'1$ FORQH S'322O ZDV JHQHURXVO\ VXSSOLHG E\ 'U 6KHUPDQ :HLVVPDQ
PAGE 44

IUDJPHQW DQG LV XQGHU FRQWURO RI WKH 63 SURPRWHU 6LPRQ HW DO f 7R VWXG\ WKH UHJXODWLRQ RI KLVWRQH P51$ ORFDOL]HG RQ PHPEUDQHERXQG SRO\VRPHV ZH FRQVWUXFWHG D EHWDODFWDPDVH VLJQDO SHSWLGHKLVWRQH IXVLRQ JHQH DV RXWOLQHG LQ )LJXUH 7KHILUVW LQWHUPHGLDWH S63S67GHOWD++( LQYROYHG WKH SODFHPHQW RI WKH (BMB FROL S%5 EHWDODFWDPDVH VLJQDO SHSWLGHJORELQ IXVLRQ JHQH IURP S63H XQGHU WUDQVFULSWLRQDO FRQWURO RI WKH FHOO F\FOHGHSHQGHQW + KLVWRQH UHJXODWRU\ UHJLRQ RI S67GHOWD+ 7KH ES (FR5,+LQGOOO IUDJPHQW IURP S67GHOWD+ 0DUDVKL HW DO f ZDV LVRODWHG HOHFWURSKRUHWLFDOO\ DQG EOXQWHQGHG XVLQJ WKH .OHQRZ IUDJPHQW RI '1$ SRO\PHUDVH 7KH VLJQDO SHSWLGH JORELQ IXVLRQ FRQVWUXFW ZDV GLJHVWHG ZLWK %JOOO UHVWULFWLRQ HQGRQXFOHDVH ZKLFK FXWV RQFH LQ WKH XQWUDQVODWHG OHDGHU UHJLRQ RI WKH IXVLRQ JHQH EOXQWHQGHG ZLWK .OHQRZ IUDJPHQW DQG GHSKRVSKRU\ODWHG XVLQJ FDOI LQWHVWLQDO DONDOLQH SKRVSKDWDVH 7KH ES EOXQWHQGHG IUDJPHQW IURP S67 ZDV OLJDWHG LQWR WKH %JOOO EOXQWHQGHG VLWH RI S63H XVLQJ 7 '1$ OLJDVH 7KH FRQVWUXFWLRQ RI WKH VHFRQG LQWHUPHGLDWH S63S67GHOWD++(S67 LQYROYHG WKH VXEVWLWXWLRQ RI WKH FKLPSDQ]HH JORELQ FRGLQJ VHTXHQFHV LQ S63S67GHOWD++( ZLWK WKH + KLVWRQH FRGLQJ VHTXHQFHV IURP S67 7KH S63S67GHOWD++( '1$ ZDV GLJHVWHG ZLWK 1FRO ZKLFK FXWV DW WKH VLJQDO SHSWLGHJORELQ FRGLQJ UHJLRQ MXQFWLRQ DQG WUHDWHG ZLWK FDOI LQWHVWLQDO SKRVSKDWDVH 7KH S67 '1$ ZDV

PAGE 45

)LJXUH 2XWOLQH RI WKH FORQLQJ VFKHPH IRU WKH FRQVWUXFWLRQ RI WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ JHQH 5HVWULFWLRQ HQGRQXFOHDVH VLWHV DUH DV IROORZV % %JO,, ( (FR5, + +LQG,,, 1 1FRO 3 3VW, 6 6PDO $EEUHYLDWLRQV 63 FROL S%5 EHWDODFWDPDVH VLJQDO SHSWLGH FRGLQJ VHTXHQFHV +5(* WUDQVFULSWLRQDO + KLVWRQH UHJXODWRU\ UHJLRQ LQFOXGLQJ &$$7 DQG 7$7$$ FRQVHQVXV VHTXHQFHV &$3 KLVWRQH + P51$ WUDQVFULSWLRQ VWDUW VLWH + VWUXFW VHTXHQFHV FRGLQJ IRU + KLVWRQH SURWHLQ $7* WUDQVODWLRQ VWDUW FRGRQ 7$$ WUDQVODWLRQ VWRS FRGRQ 63 EDFWHULRSKDJH 63 SURPRWHU

PAGE 47

GLJHVWHG ZLWK 1FRO ZKLFK FXWV DW WKH $7* WUDQVODWLRQ VWDUW FRGRQ DQG OLJDWHG WR 1FROGHSKRVSKRU\ODWHG S63S67GHOWD++( '1$ XVLQJ 7 '1$ OLJDVH 7KH VLJQDO SHSWLGHKLVWRQH IXVLRQ JHQH ZDV VXEFORQHG LQWR S8& SODVPLG '1$ E\ OLJDWLQJ WKH NES +SDO IUDJPHQW IURP S63S67GHOWD++(S67 LQWR WKH +LQGL VLWH R S8& WR IRUP S63+ 7KH VLJQDO SHSWLGHKLVWRQH IXVLRQ JHQH LQ S63+ ZDV WUDQVFULSWLRQDOO\ HQKDQFHG E\ SODFLQJ WKH 69 YLUDO HQKDQFHU HOHPHQW IURP S69($ 6KLHOV HW DO f LQWR WKH (FR5, VLWH LQ WKH SRO\OLQNHU RI S63+ WR IRUP S63+(O FRQWDLQLQJ RQH HQKDQFHU HOHPHQWf DQG S63+( FRQWDLQLQJ HQKDQFHU HOHPHQWVf '1$ ,VRODWLRQ DQG 3XULILFDWLRQ 3ODVPLG '1$ 3UHSDUDWLRQV 3ODVPLG '1$V XVHG LQ WKH H[SHULPHQWV GHVFULEHG KHUH ZHUH KDUERUHG LQ (VFKHULFKLD FROL VWUDLQ +% EDFWHULD )a UHF$ f XQOHVV RWKHUZLVH LQGLFDWHG %DFWHULD FRQWDLQLQJ WKH DSSURSULDWH SODVPLG ZHUH JURZQ LQ PHGLXP FRQWDLQLQJ DQWLELRWLFV XVXDOO\ MXJPO DPSLFLOOLQ RU WHWUDF\FOLQHf DV VSHFLILHG E\ WKH JHQRW\SH RI WKH SODVPLG RU EDFWHULXP 7KH IROORZLQJ SURFHGXUH LV WKH URXWLQH PHWKRG IRU LVRODWLQJ S%5 GHULYHG SODVPLG '1$V DQG LQFOXGHV DQ DPSOLILFDWLRQ VWHS ZLWK FKORUDPSKHQLFRO IRU KLJKHU \LHOGV RI '1$ 0DQLDWLV HW DO Df 3ODVPLGV WKDW DUH GHULYHG IURP S8& '1$ DUH DOVR SUHSDUHG DV IROORZV KRZHYHU GXH WR WKHLU KLJK FRS\ QXPEHU WKH DPSOLILFDWLRQ VWHS LV XQQHFHVVDU\ 7KH

PAGE 48

VWDQGDUG SURWRFRO IRU WKH LVRODWLRQ RI S8& UHODWHG SODVPLG '1$V LV WKH VDPH DV GHVFULEHG EHORZ H[FHSW WKDW WKH PO FXOWXUH LV LQRFXODWHG GLUHFWO\ DQG DOORZHG WR JURZ RYHUQLJKW LQWR WKH ODWH ORJ VWDJH 6WDUWHU FXOWXUHV ZHUH SUHSDUHG E\ LQRFXODWLQJ PO /% PHGLXP/XULD%HUWDQL PHGLXP b %DFWR WU\SWRQH b %DFWR \HDVW H[WUDFW b 1D&Of VXSSOHPHQWHG ZLWK b JOXFRVH ZLWK XO RI EDFWHULDO JO\FHURO VWRFN DQG LQFXEDWHG RYHUQLJKW DW r& 7KH PO VWDUWHU FXOWXUH ZDV WUDQVIHUUHG WR PO SUHZDUPHG /% PHGLXP VXSSOHPHQWHG ZLWK JOXFRVH DQG LQFXEDWHG DW r& XQWLO WKH RSWLFDO GHQVLW\ DW QP 2' f RI WKH FXOWXUH UHDFKHG XQLWV 3ODVPLG '1$ ZDV DPSOLILHG E\ WUHDWLQJ WKH FXOWXUH ZLWK LJPO FKORUDPSKHQLFRO SUHSDUHG DV D PJPO VWRFN VROXWLRQ LQ b HWKDQRO DQG ILOWHU VWHULOL]HGf DW r& IRU KRXUV 7KH EDFWHULD ZHUH FHQWULIXJHG DW USP r& IRU PLQXWHV LQ D %HFNPDQ -$ URWRU DQG FHQWULIXJH 7KH FHOO SHOOHW ZDV UHVXVSHQGHG LQ PO VROXWLRQ P0 JOXFRVH P0 7ULV S+ P0 ('7$ PJPO O\VR]\PHf DQG LQFXEDWHG DW URRP WHPSHUDWXUH IRU PLQXWHV 7KH FHOOV ZHUH O\VHG DW r& ZLWK PO VROXWLRQ ,, b 6'6 0 1D2+f IRU PLQXWHV 7KH FHOO O\VDWH ZDV WUHDWHG ZLWK PO 0 SRWDVVLXP DFHWDWH S+ DQG NHSW RQ LFH IRU PLQXWHV 7KH O\VDWH ZDV WUDQVIHUUHG WR D PO SRO\FDUERQDWH WXEH DQG FHQWULIXJHG DW USP IRU PLQXWHV DW r& LQ %HFNPDQ -$ URWRU WR SHOOHW WKH EDFWHULDO '1$ DQG FHOO GHEULV 7KH

PAGE 49

VXSHUQDWDQW ZDV WUDQVIHUUHG WR D PO &RUH[ WXEH &RUQLQJf DQG QXFOHLF DFLGV ZHUH SUHFLSLWDWHG IURP VROXWLRQ ZLWK PO LVRSURSDQRO DW URRP WHPSHUDWXUH IRU PLQXWHV 7KH '1$ ZDV SHOOHWHG E\ FHQWULIXJDWLRQ DW USP LQ %HFNPDQ -6 URWRU IRU PLQXWHV DW r& 7KH SHOOHW ZDV EULHIO\ GULHG XQGHU YDFXXP DQG UHVXVSHQGHG LQ PO 7( EXIIHU P0 7ULV S+ P0 ('7$f 7KH '1$ VROXWLRQ ZDV DGMXVWHG WR D ILQDO FRQFHQWUDWLRQ RI PJPO RI &V&O UHIUDFWLYH LQGH[ RI f DQG 0JPO HWKLGLXP EURPLGH 7KH '1$ VROXWLRQ ZDV WKHQ WUDQVIHUUHG WR D [ PP 4XLFN6HDO WXEH %HFNPDQf DQG FHQWULIXJHG WR HTXLOLEULXP DW USP LQ D %HFNPDQ 7\SH 7L URWRU DQG %HFNPDQ / XOWUDFHQWULIXJH IRU KRXUV DW r& 7KH VXSHUFRLOHG SODVPLG '1$ ZDV UHPRYHG IURP WKH FHVLXP FKORULGH JUDGLHQW E\ SXQFWXULQJ WKH VLGH RI WKH WXEH MXVW EHORZ WKH '1$ EDQG ZLWK D V\ULQJH FRQWDLQLQJ D JDXJH QHHGOH 7KH '1$ ZDV H[WUDFWHG UHSHDWHGO\ ZLWK EXWDQRO WR UHPRYH WKH HWKLGLXP EURPLGH DQG WR UHGXFH WKH YROXPH RI WKH VROXWLRQ &HVLXP FKORULGH ZDV UHPRYHG E\ GLDO\VLV DJDLQVW 7( EXIIHU DW r& 7KH '1$ ZDV TXDQWLWDWHG E\ DEVRUEDQFH DW QP DQG VWRUHG DW r& 5RXWLQHO\ WKH \LHOG IRU S%5 GHULYHG SODVPLGV ZDV MLJ '1$ SHU PO DPSOLILHG FXOWXUH 0 %DFWHULRSKDJH '1$ 3UHSDUDWLRQV 0 LV D ILODPHQWRXV '1$ EDFWHULRSKDJH WKDW LV VSHFLILF IRU PDOH / FROL EDFWHULD 0 SKDJH '1$ LV XVHIXO IRU VLWH

PAGE 50

GLUHFWHG PXWDJHQHVLV DQG GLGHR[\ '1$ VHTXHQFLQJ UHDFWLRQV VLQFH LW FDQ EH UHDGLO\ LVRODWHG DV D GRXEOHVWUDQGHG FRYDOHQWO\ FORVHG FLUFXODU '1$ UHSOLFDWLYH IRUP 5)f IURP WKH LQIHFWHG EDFWHULD DQG DV D FLUFXODU VLQJOHVWUDQGHG '1$ JHQRPH 66f IURP WKH PDWXUH SKDJH SDUWLFOH ,Q DGGLWLRQ 0 SKDJH '1$ KDV EHHQ DOWHUHG JHQHWLFDOO\ WR IDFLOLWDWH FORQLQJ DQG VXEVHTXHQW PDQLSXODWLRQV 2QH VXFK GHULYDWLYH 0PSO LV VPDOO LQ VL]H PDLQWDLQHG LQ KLJK FRS\ QXPEHU DSSUR[LPDWHO\ 5) PROHFXOHV SHU FHOOf FRQWDLQV D FRQYHQLHQW SRO\OLQNHU IRU WKH LQVHUWLRQ RI IRUHLJQ '1$ XS WR NEf DQG H[SUHVVHV EHWDJDODFWRVLGDVH ZKLFK LV LQDFWLYDWHG E\ WKH LQVHUWLRQ RI '1$ LQWR WKH SRO\OLQNHU VLWH 6LQJOHVWUDQGHG WHPSODWHV 6LQJOHVWUDQGHG 0 '1$ WHPSODWHV ZHUH SUHSDUHG IURP LQGLYLGXDO SODTXHV ZKLFK IRUPHG RQ D ODZQ RI (BMB FROL VWUDLQ -0 EDFWHULD GHOWDODFSUR$%f VXS( )n>WUD' SUR$r SUR% ODFOT ODF=GHOWD0@f WKDW ZHUH LQIHFWHG ZLWK 0 EDFWHULRSKDJH RU WUDQVIHFWHG ZLWK 0 GRXEOH VWUDQGHG FRYDOHQWO\ FORVHG FLUFXODU '1$ $ VLQJOH SODTXH ZDV UHPRYHG IURP WKH DJDU SODWH ZLWK D VWHULOH SDVWHXU SLSHWWH DQG SODFHG LQ PO <7 PHGLXP b %DFWRWU\SWRQH b %DFWR\HDVW H[WUDFW b 1D&Of 7ZR GURSV RI DQ RYHUQLJKW -0 EDFWHULDO FXOWXUH ZHUH DGGHG WR WKH SKDJH DQG LQFXEDWHG DW r& ZLWK DJLWDWLRQ IRU KRXUV /RQJHU LQFXEDWLRQ WLPHV UHVXOW LQ GHOHWLRQV

PAGE 51

ZLWKLQ WKH SKDJH '1$ 7KH FHOO FXOWXUH POf ZDV WUDQVIHUUHG WR D PLFURFHQWULIXJH WXEH DQG VSXQ LQ DQ (SSHQGRUI FHQWULIXJH DW [ J IRU PLQXWHV DW r& 7KH VXSHUQDWDQW POf ZDV WUDQVIHUUHG WR D VWHULOH PLFURFHQWULIXJH WXEH XO RI b 3(* 0 1D&O ZHUH DGGHG DQG WKH VDPSOH ZDV LQFXEDWHG DW URRP WHPSHUDWXUH IRU PLQXWHV 7KH UHPDLQLQJ XO RI VXSHUQDWDQW ZHUH UHPRYHG DQG VWRUHG DW r& DV D SKDJH VWRFN 7KH SKDJH VXVSHQVLRQ ZDV FHQWULIXJHG DW [ J IRU PLQXWHV DW URRP WHPSHUDWXUH DQG WKH VXSHUQDWDQW ZDV GHFDQWHG 7KH SHOOHW ZDV UHVXVSHQGHG LQ XO 7(6 EXIIHU P0 7ULV+&O S+ P0 1D&O P0 1D('7$f 7KH VDPSOH ZDV H[WUDFWHG ZLWK SKHQRO DV IROORZV f DGGHG XO SKHQRO DQG YRUWH[HG IRU VHFRQGV" f LQFXEDWHG DW URRP WHPSHUDWXUH IRU PLQXWHV" f YRUWH[HG IRU VHFRQGV" DQG FHQWULIXJHG DW [ J IRU PLQXWHV DW URRP WHPSHUDWXUH '1$ ZDV SUHFLSLWDWHG IURP XO RI DTXHRXV SKDVH ZLWK XO 0 VRGLXP DFHWDWH DQG XO b HWKDQRO RQ FUXVKHG GU\ LFH IRU PLQXWHV DQG FROOHFWHG E\ FHQWULIXJDWLRQ DW [ J IRU PLQXWHV DW r& 7KH VXSHUQDWDQW ZDV GLVFDUGHG DQG WKH SHOOHW ZDV ZDVKHG LQ b HWKDQRO DW URRP WHPSHUDWXUH 7KH VDPSOH ZDV FHQWULIXJHG DW [ J URRP WHPSHUDWXUH IRU PLQXWHV 7KH '1$ SHOOHW ZDV GULHG XQGHU YDFXXP UHVXVSHQGHG LQ XO 7(6 EXIIHU DQG VWRUHG DW r&

PAGE 52

'RXEOHVWUDQGHG WHPSODWHV ( FROL VWUDLQ -0 GHOWDODFSUR$%f VXS( )n ISUR$ SUR%r ODFOT ODF=GHOWD0,6@f EDFWHULD ZHUH JURZQ RYHUQLJKW LQ PO <7 PHGLXP DW r& ZLWK DJLWDWLRQ 7KH RYHUQLJKW FXOWXUH POf ZDV WUDQVIHUUHG WR PO SUHZDUPHG <7 PHGLXP DQG LQFXEDWHG DW r& XQWLO WKH 2' UHDFKHG XQLWV 7R DVVXUH H[SRQHQWLDO JURZWK WKH FXOWXUH ZDV DJDLQ GLOXWHG LQWR PO SUHZDUPHG <7 PHGLXP DQG JURZQ WR DQ 2' RI XQLWV 7KH FXOWXUH ZDV LQIHFWHG ZLWK XO RI 0 EDFWHULRSKDJH VXSHUQDWDQW ZKLFK KDG EHHQ SUHSDUHG IURP DQ LVRODWHG SODTXH DV GHVFULEHG DERYH IRU WKH SUHSDUDWLRQ RI 0 VLQJOHVWUDQGHG '1$ 7KH LQIHFWHG FHOOV ZHUH LQFXEDWHG DW r& ZLWK DJLWDWLRQ IRU QR PRUH WKDQ KRXUV 7KH FHOOV ZHUH KDUYHVWHG DQG 5) 0 '1$ ZDV LVRODWHG DV GHVFULEHG DERYH IRU WKH SUHSDUDWLRQ RI SODVPLG '1$ 5RXWLQHO\ WKH \LHOG ZDV QT RI VXSHUFRLOHG 0 '1$ SHU PO FXOWXUH ,VRODWLRQ RI 0DPPDOLDQ 51$ ,VRODWLRQ RI 7RWDO &HOOXODU 51$ 7KH IROORZLQJ SURFHGXUH IRU WKH LVRODWLRQ RI WRWDO FHOOXODU 51$ ZDV GHYHORSHG E\ 'U 0DUN 3OXPE LQ WKH 6WHLQnV ODERUDWRU\ SULPDULO\ IRU ZRUN ZLWK +H/D FHOOV +RZHYHU WKLV SURFHGXUH KDV EHHQ VXFFHVVIXOO\ XVHG ZLWKRXW PRGLILFDWLRQ IRU WKH LVRODWLRQ RI WRWDO FHOOXODU 51$ IURP KXPDQ +/ FHOOV PRXVH 7/ FHOOV UDW RVWHREODVW SULPDU\ FHOO FXOWXUHV DQG 7U\SDQRVRPH FUX]LL FHOOV

PAGE 53

([SRQHQWLDOO\ JURZLQJ +H/D FHOOV [ FHOOVf ZHUH KDUYHVWHG E\ FHQWULIXJDWLRQ DW USP IRU PLQXWHV DW r& LQ DQ ,(& URWRU 7KH FHOOV ZHUH ZDVKHG LQ SKRVSKDWH EXIIHUHG VDOLQH 3%6 P0 1D&O P0 VRGLXP SKRVSKDWH S+ f DQG UHVXVSHQGHG LQ PO O\VLV EXIIHU P0 7ULV+&O S+ OP0 ('7$f FRQWDLQLQJ /LJPO 396 &HOOV ZHUH O\VHG LQ WKH SUHVHQFH RI b 6'6 DQG [JPO RI SURWHLQDVH DW URRP WHPSHUDWXUH IRU PLQXWHV /\VDWHV ZHUH DGMXVWHG WR P0 1D&O H[WUDFWHG ZLWK PO 7ULVVDWXUDWHG SKHQRO DQG PO &+&OLVRDP\O DOFRKRO ,$$f YYf DQG FHQWULIXJHG DW USP LQ DQ ,(& URWRU DW URRP WHPSHUDWXUH 7KH DTXHRXV SKDVH ZDV WKHQ H[WUDFWHG ZLWK PO &+&,$$ DQG FHQWULIXJHG DW USP LQ DQ ,(& URWRU DW URRP WHPSHUDWXUH 7KH SKHQROFKORURIRUP DQG FKORURIRUP H[WUDFWLRQV ZHUH UHSHDWHG DV GHVFULEHG DERYH 1XFOHLF DFLGV ZHUH SUHFLSLWDWHG IURP WKH DTXHRXV SKDVH ZLWK YROXPHV RI b HWKDQRO DW r& LQ WKH SUHVHQFH RI P0 SRWDVVLXP DFHWDWH 1XFOHLF DFLGV ZHUH UHFRYHUHG IURP WKH HWKDQRO VXVSHQVLRQ E\ FHQWULIXJDWLRQ DW [ J DQG UHVXVSHQGHG LQ 7&0 EXIIHU P0 7ULV+FO S+ &D&O P0 0J&Of IRU GLJHVWLRQ ZLWK '1DVH 7KH '1DVH ZDV GLVVROYHG LQ P0 7ULV+&O S+ P0 &D&O DW PJPO SUHLQFXEDWHG DW r& IRU PLQXWHV DQG WUHDWHG ZLWK YROXPH RI SURWHLQDVH > PJPO@ DW r& IRU KRXUV WR UHPRYH ULERQXFOHDVH DFWLYLW\ 7XOOLV DQG 5XELQ f 7KH QXFOHLF

PAGE 54

DFLG VDPSOHV ZHUH WKHQ GLJHVWHG ZLWK PJPO RI SURWHLQDVH WUHDWHG '1DVH IRU PLQXWHV DW r& )ROORZLQJ '1DVH GLJHVWLRQ YROXPHV RI 0 1D&O DQG YROXPHV RI b 6'6 ZHUH DGGHG WR HDFK VDPSOH DQG WKH 51$ VROXWLRQV ZHUH UHSHDWHGO\ H[WUDFWHG ZLWK SKHQRO DQG FKORURIRUP XQWLO WKH LQWHUI£FH EHWZHHQ WKH DTXHRXV DQG RUJDQLF SKDVHV ZDV FOHDQ 51$ ZDV SUHFLSLWDWHG IURP WKH DTXHRXV SKDVH ZLWK YROXPHV RI b HWKDQRO DW r& RYHUQLJKW 7KH 51$ ZDV FROOHFWHG DW USP LQ D -$ URWRU DW r& IRU PLQXWHV 7KH SHOOHW ZDV UHVXVSHQGHG LQ GRXEOH GLVWLOOHG ZDWHU TXDQWLWDWHG E\ RSWLFDO GHQVLW\ DW QP DQG VWRUHG DW r& 7\SLFDO \LHOGV RI 51$ ZHUH [J SHU b FRQIOXHQW FP SODWH RI +H/D 6 FHOOV DQG PJ SHU [ +H/D 6 FHOOV ZLWK DQ f f 2 f RI WR ,VRODWLRQ RI 1RQPHPEUDQHERXQG 0HPEUDQHERXQG DQG 7RWDO 3ROYVRPDO 51$ 7KH VXEFHOOXODU IUDFWLRQDWLRQ VFKHPH XVHG LQ WKHVH VWXGLHV LV D PRGLILHG SURFHGXUH GHVFULEHG E\ 9HQNDWHVDQ DQG 6WHHOH f DQG LV RXWOLQHG LQ )LJXUH ([SRQHQWLDOO\ JURZLQJ +H/D FHOOV [ FHOOVf ZHUH FROOHFWHG E\ FHQWULIXJDWLRQ DW USP LQ DQ ,(& URWRU DW r& IRU PLQXWHV $OO VXEVHTXHQW SURFHGXUHV ZHUH FDUULHG RXW DW r& &HOOV ZHUH ZDVKHG VHYHUDO WLPHV LQ 3%6 DQG UHVXVSHQGHG LQ PO 56% P0 7ULV+&O S+ P0 1D&O P0 0J&Of $IWHU LQFXEDWLRQ RQ LFH IRU PLQXWHV WKH FHOOV ZHUH

PAGE 55

GLVUXSWHG ZLWK VWURNHV LQ D WLJKW ILWWLQJ 'RXQFH KRPRJHQL]HU 7KH KRPRJHQDWH ZDV WKHQ FHQWULIXJHG DW [ J IRU PLQXWHV 7KH VXSHUQDWDQW VXSHUQDWDQW $f ZDV UHPRYHG DQG PDLQWDLQHG LQ DQ LFH EDWK ZKLOH WKH QXFOHDU SHOOHW SHOOHW $f ZDV UHVXVSHQGHG LQ PO 701 P0 7ULV+&O S+ P0 0J&O P0 1D&O P0 GLWKLRWKUHLWROf 7KH QXFOHDU VXVSHQVLRQ SHOOHW $f ZDV DGMXVWHG WR b 7ULWRQ ; DQG b 1D'2& YRUWH[HG EULHIO\ DQG FHQWULIXJHG DW [ J IRU PLQXWHV 7KH VXSHUQDWDQW VXSHUQDWDQW &f IURP WKLV FHQWULIXJDWLRQ VWHS ZDV UHPRYHG DQG VDYHG RQ LFH IRU WKH LVRODWLRQ RI QXFOHXVDVVRFLDWHG URXJK HQGRSODVPLF UHWLFXOXP 15(5f SRO\VRPHV 7KH VXSHUQDWDQW IURP WKH FHQWULIXJDWLRQ VWHS IROORZLQJ KRPRJHQL]DWLRQ VXSHUQDWDQW $f ZDV FHQWULIXJHG DW USP r& IRU PLQXWHV LQ D %HFNPDQ -$ URWRU 7KH UHVXOWLQJ VXSHUQDWDQW VXSHUQDWDQW %f ZDV UHPRYHG RQWR LFH IRU VXEVHTXHQW LVRODWLRQ RI OLJKW HQGRSODVPLF UHWLFXOXP /(5fDVVRFLDWHG SRO\VRPDO 51$ DQG QRQPHPEUDQHERXQG SRO\VRPDO 51$ 7KH SHOOHW SHOOHW %f ZDV UHVXVSHQGHG LQ PO 701 DGMXVWHG WR b 7ULWRQ ; DQG b 1D'2& DQG FHQWULIXJHG DW USP r& IRU PLQXWHV LQ D -$ URWRU 7KH VXSHUQDWDQW VXSHUQDWDQW 'f ZDV UHPRYHG DQG VWRUHG RQ LFH IRU WKH LVRODWLRQ RI PLWRFKRQGULDDVVRFLDWHG URXJK HQGRSODVPLF UHWLFXOXP 05(5f SRO\VRPDO 51$ ([SRQHQWLDOO\ JURZLQJ +H/D FHOOV [ FHOOVf ZHUH FROOHFWHG E\ FHQWULIXJDWLRQ IRU WKH LVRODWLRQ RI WRWDO SRO\VRPDO 51$ 7KH FHOO SHOOHW ZDV ZDVKHG LQ 3%6 DQG

PAGE 56

)LJXUH 2XWOLQH RI SURFHGXUH IRU WKH LVRODWLRQ RI VXEFHOOXODU SROYVRPDO IUDFWLRQV

PAGE 57

+H/D &HOOV KRPRJHQL]H LQ 56% FHQWULIXJH [J r& n VXSHUQDWDQW $ SHOOHW $ FHQWULIXJH OO[J n VXSHUQDWDQW % SHOOHW % 7ULWRQ1D'2& FHQWULIXJH [ n , 7ULWRQ1D'2& FHQWULIXJH [J n GLVFDUG SHOOHW GLVFDUG SHOOHW VXSHUQDWDQW VXSHUQDWDQW & FHQWULIXJH [J KUV 0 VXFURVH FHQWULIXJH [J KUV 0 VXFURVH FHQWULIXJH [J KUV 0 VXFURVH %DQG DW SHOOHW SHOOHW SHOOHW LQWHUIDFH /(5 1RQPHPEUDQHERXQG 15(5 05(5

PAGE 58

UHVXVSHQGHG LQ PO 701 7KH VDPSOH ZDV DGMXVWHG WR b 7ULWRQ ;f§ DQG b 1D'2& GLVUXSWHG ZLWK VHYHUDO VWURNHV LQ D WLJKW ILWWLQJ 'RXQFH KRPRJHQL]HU DQG FHQWULIXJHG DW [ J DW r& IRU PLQXWHV LQ D -$ URWRU 7KH VXSHUQDWDQW ZDV UHPRYHG DQG VDYHG DW r& (DFK RI WKH IUDFWLRQV 15(5 05(5 /(5 QRQPHPEUDQH ERXQG DQG WRWDO SRO\VRPDO 51$f ZHUH OD\HUHG RQWR D PO 0 VXFURVH SDG SUHSDUHG LQ 56% FRQWDLQLQJ X0 VSHUPLGLQHf DQG FHQWULIXJHG DW r& IRU KRXUV DW [ J LQ D %HFNPDQ 7\SH 7L URWRU [ Jf ZLWKRXW WKH EUDNH 7KH /(5 IRUPHG D FORXG\ EDQG DW WKH WRS RI WKH VXFURVH SDG DQG ZDV FDUHIXOO\ UHPRYHG E\ DVSLUDWLRQ 7KH UHPDLQLQJ IUDFWLRQV ZHUH SHOOHWHG XQGHU WKHVH FRQGLWLRQV DQG JHQWO\ UHVXVSHQGHG LQ PO 701 EXIIHU 7KH VDPSOHV ZHUH WKHQ H[WUDFWHG H[WHQVLYHO\ ZLWK SKHQRO DQG FKORURIRUP DV GHVFULEHG DERYH IRU WKH LVRODWLRQ RI WRWDO FHOOXODU 51$ 7KH 51$ ZDV SUHFLSLWDWHG IURP VROXWLRQ ZLWK YROXPHV RI b HWKDQRO DW r& LQ WKH SUHVHQFH RI P0 SRWDVVLXP DFHWDWH 7KH 51$ ZDV GLJHVWHG ZLWK '1DVH H[WUDFWHG ZLWK SKHQRO DQG FKORURIRUP DQG HWKDQRO SUHFLSLWDWHG DV GHVFULEHG DERYH IRU WKH SUHSDUDWLRQ RI WRWDO FHOOXODU 51$ 7\SLFDO \LHOGV ZHUH PJ 05(5 DQG 15(5 51$ PJ QRQPHPEUDQHERXQG 51$ PJ /(5 51$ DQG PJ WRWDO SRO\VRPDO 51$ SHU OLWHU RI H[SRQHQWLDOO\ JURZLQJ +H/D FHOOV

PAGE 59

,VRODWLRQ RI &YWRVNHOHWRQ DQG 6ROXEOH 3KDVH 51$ 7KH F\WRVNHOHWRQ DQG VROXEOH IUDFWLRQV ZHUH SUHSDUHG DV SUHYLRXVO\ GHVFULEHG E\ 3HQPDQ DQG FRZRUNHUV &HUYHUD HW DO f ([SRQHQWLDOO\ JURZLQJ +H/D FHOOV [ FHOOVf ZHUH KDUYHVWHG DQG ZDVKHG LQ FROG 3%6 7KH FHOO SHOOHW ZDV UHVXVSHQGHG LQ PO H[WUDFWLRQ EXIIHU P0 3LSHV S+ P0 .& P0 0J&O 0 VXFURVH P0 SKHQ\OPHWK\OVXOIRQ\O IOXRULGHf DQG 7ULWRQ ; ZDV LPPHGLDWHO\ DGGHG WR D ILQDO FRQFHQWUDWLRQ RI b 7KH VDPSOH ZDV LQFXEDWHG DW rF IRU PLQXWHV DQG WKHQ FHQWULIXJHG DW USP LQ DQ ,(& FHQWULIXJH IRU PLQXWHV DW r& 7KH VXSHUQDWDQW 62/f ZDV UHPRYHG DQG VWRUHG RQ LFH 7KH SHOOHW ZDV UHVXVSHQGHG LQ PO 56% FRQWDLQLQJ P0 SKHQ\OPHWK\OVXOIRQ\O IOXRULGH b 7ZHHQ DQG b 1D'2& 7KH QXFOHL ZHUH VWULSSHG RI F\WRSODVPLF WDJV ZLWK VWURNHV LQ D SUHFLVLRQERUH VWDLQOHVV VWHHO KRPRJHQL]HU ZLWK D FOHDUDQFH RI LQFKHV DQG ZHUH SHOOHWHG DW USP IRU PLQXWHV DW r& LQ DQ ,(& URWRU 7KH VXSHUQDWDQW &6.f ZDV UHPRYHG DQG VDYHG DW r& IRU VXEVHJXHQW 51$ LVRODWLRQ %RWK WKH &6. DQG 62/ IUDFWLRQV ZHUH H[WUDFWHG LQ WKH SUHVHQFH RI b 6'6 DQG 0 1D&O ZLWK SKHQRO DQG FKORURIRUP 1XFOHLF DFLGV ZHUH SUHFLSLWDWHG IURP WKH DJXHRXV SKDVH ZLWK YROXPHV RI b HWKDQRO DW r& LQ WKH SUHVHQFH RI P0 SRWDVVLXP DFHWDWH 7KH 51$ ZDV GLJHVWHG ZLWK '1DVH SKHQRO DQG FKORURIRUP H[WUDFWHG DQG HWKDQRO SUHFLSLWDWHG DV GHVFULEHG DERYH IRU WKH LVRODWLRQ RI WRWDO FHOOXODU 51$

PAGE 60

7\SLFDO \LHOGV RI 51$ ZHUH QJ IURP &6. DQG QJ IURP 62/ SHU [ +H/D FHOOV PO H[SRQHQWLDOO\ JURZLQJ VXVSHQVLRQ FXOWXUHf 7ZR'LPHQVLRQDO *HO (OHFWURSKRUHVLV DQG ,PPXQRERWWLQR $QDO\VLV 7KH F\WRVNHOHWRQ DQG VROXEOH IUDFWLRQV ZHUH LVRODWHG DV GHVFULEHG DERYH DQG HDFK VDPSOH ZDV GLDO\]HG LQ P0 7ULV +& S+ DQG WUHDWHG ZLWK '1DVH [JPOf DQG 51DVH $ LLJPOf LQ WKH SUHVHQFH RI P0 0J&O DW r& IRU KRXU 7KH VDPSOHV ZHUH GLDO\]HG DJDLQVW P0 7ULV+&O S+ DQG WKHQ O\RSKLOL]HG 7ZRGLPHQVLRQDO JHO HOHFWURSKRUHVLV DQG LPPXQREORWWLQJ DQDO\VHV ZHUH SHUIRUPHG E\ 'U :DUUHQ 6FKPLGW 'HSDUWPHQW RI 3DWKRORJ\ 9DQGHUELOW 8QLYHUVLW\ 1DVKYLOOH 71f 7KH SURWHLQ SUHSDUDWLRQV ZHUH IRFXVHG LQ WKH ILUVW GLPHQVLRQ XVLQJ HTXLOLEULXP FRQGLWLRQV DV GHVFULEHG E\ 2n )DUUHOO f ZLWK S+ WR RU WR DPSKROLQHV 7KH VHFRQG GLPHQVLRQ ZDV HOHFWURSKRUHVHG RQ VODE JHOV FRQWDLQLQJ D b VWDFNLQJ JHO DQG b UHVROYLQJ JHO DV GHVFULEHG E\ /DHPPOL f 7KH SURWHLQV ZHUH WKHQ HLWKHU VWDLQHG ZLWK &RRPDVVLH %ULOOLDQW %OXH RU HOHFWURWUDQVIHUUHG WR QLWURFHOOXORVH ILOWHUV DV GHVFULEHG E\ 7RZELQ HW DO f :KHUH LQGLFDWHG LPPXQRWUDQVIHU DQDO\VHV *ODVV HW DO f ZHUH SHUIRUPHG ZLWK FRPPHUFLDOO\ DYDLODEOH RU RWKHU 6FKPLGW HW DO f DQWLERGLHV WR DFWLQ WXEXOLQ DQG SUHNHUDWLQ

PAGE 61

1RUWKHUQ %ORW $QDO\VLV $JDURVH)RUPDOGHK\GH 51$ 'HQDWXULQJ *HO (OHFWURSKRUHVLV 51$ VDPSOHV ZHUH UHVROYHG HOHFWURSKRUHWLFDOO\ LQ b DJDURVHb ZYf IRUPDOGHK\GH KRUL]RQWDO VODE JHOV DQG UXQQLQJ EXIIHU P0 0236 PRUSKROLQHSURSDQHVXOIRQLF DFLGf S+ P0 VRGLXP DFHWDWH P0 ('7$ b ZYf IRUPDOGHK\GHf DV GHVFULEHG E\ 5DYH HW DO f 5RXWLQHO\ QT 51$ SHU VDPSOH ZHUH GULHG LQ D 6DYDQW 6SHHG 9DF FRQFHQWUDWRU DQG UHVXVSHQGHG LQ XO GRXEOH GLVWLOOHG ZDWHU GG+f XO IRUPDPLGH XO O2[ 0236 P0 0236 S+ P0 VRGLXP DFHWDWH P0 ('7$f XO b ZYf IRUPDOGHK\GH DQG XO VDPSOH EXIIHU PO IRUPDPLGH PO O2[ 0236 XO b ZYf IRUPDOGHK\GH DQG PO b EURPRSKHQRO EOXHb JO\FHUROf 7KH VDPSOHV ZHUH WKHQ KHDWHG DW r& IRU PLQXWHV TXLFN FKLOOHG WR r& DQG ORDGHG RQWR WKH JHOV 7KH b DJDURVHb IRUPDOGHK\GH JHOV ZHUH SUHSDUHG E\ PHOWLQJ J HOHFWURSKRUHVLV JUDGH DJDURVH LQ PO GG+ SOXV PO O2[ 0236 EXIIHU LQ D PLFURZDYH RYHQ :KLUOSRROf DW IXOO SRZHU IRU PLQXWHV 7KH DJDURVH VROXWLRQ ZDV FRROHG WR DSSUR[LPDWHO\ r& ZDUP WR WKH WRXFKf ZKLOH VWLUULQJ DQG WKHQ DGMXVWHG WR b IRUPDOGHK\GH ZLWK PO b ZYf IRUPDOGHK\GH )RU PLQLJHOV PO DJDURVHIRUPDOGHK\GH VROXWLRQ ZDV FDVW LQ D SOH[LJODVV JHO WUD\ FP [ FPf ZLWK DQ ZHOO FRPE PP [ PP SHU ZHOOf 7KH JHO ZDV HOHFWURSKRUHVHG DW PLOOLDPSV XQWLO WKH EURPRSKHQRO EOXH PLJUDWHG FP DSSUR[LPDWHO\

PAGE 62

KRXUVf )RU IXOO VL]H 51$ JHOV PO DJDURVHIRUPDOGHK\GH VROXWLRQ ZDV FDVW LQ D SOH[LJODVV JHO WUD\ FP [ FPf ZLWK ZHOO FRPEV PP [ PP SHU ZHOOf 7KH JHO ZDV HOHFWURSKRUHVHG DW YROWV XQWLO WKH EURPRSKHQRO EOXH PLJUDWHG FP DSSUR[LPDWHO\ KRXUVf 7KH IRUPDOGHK\GH JHOV ZHUH VWDLQHG IRU PLQXWHV LQ HWKLGLXP EURPLGH VROXWLRQ JPO HWKLGLXP EURPLGH 0 DPPRQLXP DFHWDWHf DQG GHVWDLQHG IRU DW OHDVW KRXUV LQ GRXEOH GLVWLOOHG ZDWHU 51$ VDPSOHV ZHUH WKHQ YLVXDOL]HG E\ IOXRUHVFHQFH XQGHU XOWUDYLROHW OLJKW XVLQJ D VKRUW ZDYHOHQJWK WUDQVLOOXPLQDWRU 893 LQF 6DQ *DEULHO &$f 7KH JHOV ZHUH XVXDOO\ SKRWRJUDSKHG DW I IRU VHFRQG ZLWK 7\SH KLJK VSHHG 3RODURLG ILOP DQG D 3RODURLG PRGHO FDPHUD PRXQWHG RQ D VWDQG DERYH WKH WUDQVLOOXPLQDWRU 7UDQVIHU RI 51$ IURP $TDURVH)RUPDOGHKYGH *HOV WR +\EULGL]DWLRQ )LOWHUV 51$ VDPSOHV ZHUH WUDQVIHUUHG WR QLWURFHOOXORVH XUQf RU Q\ORQ PHPEUDQH K\EULGL]DWLRQ ILOWHUV LQ [ 66& DV SUHYLRXVO\ GHVFULEHG E\ 7KRPDV f 7KH JHOV ZHUH VRDNHG LQ 2[ 66& 0 1D&O 0 VRGLXP FLWUDWH S+ f IRU PLQXWHV DQG ZHUH QRW VWDLQHG ZLWK HWKLGLXP EURPLGH 7KH K\EULGL]DWLRQ ILOWHUV ZHUH XQLIRUPO\ ZHWWHG LQ GG+ DQG WKHQ 2[ 66& 7KH JHO ZDV SODFHG ZLWK WKH ZHOOV IDFLQJ GRZQZDUG RQWR D VKHHW RI 00 SDSHU :KDWPDQf DQG VSRQJH ZKLFK KDG EHHQ VRDNHG LQ 2[ 66& 6WULSV RI XVHG ;UD\ ILOPV

PAGE 63

ZHUH SODFHG RQ DUHDV RI WKH VSRQJH WKDW ZHUH QRW FRYHUHG E\ WKH JHO VR DV WR GLUHFW WKH IORZ RI 2[ 66& RQO\ WKURXJK WKH JHO 7KH ILOWHU ZDV GLUHFWO\ OD\HUHG RQWR WKH JHO DQG DQ\ DLU EXEEOHV WKDW ZHUH WUDSSHG EHWZHHQ WKH JHO DQG ILOWHU ZHUH FDUHIXOO\ UHPRYHG 7KH WUDQVIHU VHWXS ZDV FRPSOHWHG E\ SODFLQJ WZR VKHHWV RI 00 SDSHU IROORZHG E\ ER[HV RI IDFLDO WLVVXHV .OHHQH[ EUDQGf RQ WRS RI WKH K\EULGL]DWLRQ ILOWHU 7KH EXIIHU FKDPEHU ZDV ILOOHG ZLWK [ 66& DQG WUDQVIHU ZDV FDUULHG RXW IRU KRXUV QRWH FRPSOHWH WUDQVIHU LV XVXDOO\ DFKLHYHG ZLWKLQ KRXUVf $IWHU WUDQVIHU WKH ILOWHUV ZHUH ULQVHG LQ [ 66& IRU PLQXWHV WR UHPRYH SDUWLFOHV RI DJDURVH DLU GULHG DQG EDNHG LQ YDFXR DW r& IRU KRXUV 7KH ILOWHUV ZHUH VWRUHG LQ VHDOHG K\EULGL]DWLRQ EDJV DW r& +\EULGL]DWLRQ RI )LOWHUV,PPRELOL]HG 51$ 1RUWKHUQ %ORWf )LOWHUV Q\ORQ RU QLWURFHOOXORVHf ZHUH SUHK\EULGL]HG IRU KRXUV LQ PO K\EULGL]DWLRQ EXIIHU SHU FP ILOWHU DUHD DW r& IRU WKH GHWHFWLRQ RI FKRULRQLF JRQDGRWURSLQ DOSKD +/$% DQG FIRV P51$ DQG DW r& IRU KLVWRQH P51$ +\EULGL]DWLRQ EXIIHU FRQVLVWHG RI b IRUPDPLGH [ 66& O2[ 'HQKDUGWnV O22[ 'HQKDUGWnV b ZYf ILFROO b ZYf SRO\YLQ\OS\UUROLGRQHf b 6'6 P0 VRGLXP SKRVSKDWH S+ [JPO %6$ DQG JPO (AB FROL '1$ 7KH ILOWHUV ZHUH K\EULGL]HG DW WKH DSSURSULDWH WHPSHUDWXUH IRU KRXUV LQ PO K\EULGL]DWLRQ EXIIHU SHU FP ILOWHU FRQWDLQLQJ

PAGE 64

O[O2 FSPPO RI HDFK WKHUPDOO\ GHQDWXUHG M3UDGLRODEHOHG '1$ SUREH $IWHU K\EULGL]DWLRQ WKH ILOWHUV ZHUH ZDVKHG ZLWK [ 66& O[ 'HQKDUGWnV POFP ILOWHUf IRU PLQXWHV DW URRP WHPSHUDWXUH WR UHPRYH XQERXQG SUREH 7KH ILOWHUV ZHUH WKHQ ZDVKHG LQ RUGHU ZLWK WKH IROORZLQJ VROXWLRQV POFP ILOWHU DUHDf f [ 66& O[ 'HQKDUGWnV f [ 66& b 6'6 f O[ 66& b 6'6 DQG f 2O[ 66& b 6'6 DW rr& IRU PLQXWHV SHU ZDVK $IWHU ZDVKLQJ WKH ILOWHUV ZHUH EULHIO\ DLU GULHG DQG WKHQ H[SRVHG WR SUHIODVKHG .RGDN ;$5 [UD\ ILOP DW r& ZLWK D &URQH[ /LJKWQLQJ 3OXV LQWHQVLI\LQJ VFUHHQ 'XSRQWf IRU YDU\LQJ OHQJWKV RI WLPH +\EULGL]DWLRQ ZDV TXDQWLWDWHG E\ VFDQQLQJ ODVHU GHQVLWRPHWULF DQDO\VLV RI PXOWLSOH H[SRVXUHV RI DXWRUDGLRJUDSKV WKDW ZHUH ZLWKLQ WKH OLQHDU UDQJH RI WKH ILOP 6, 1XFOHDVH 3URWHFWLRQ $QDO\VLV 6, QXFOHDVH SURWHFWLRQ DQDO\VLV ZDV SHUIRUPHG HVVHQWLDOO\ DV GHVFULEHG E\ %HUN DQG 6KDUS f DQG ZDV XVHG LQ WKH ZRUN SUHVHQWHG KHUH WR GHWHFW VLPXOWDQHRXVO\ ERWK HQGRJHQRXV + KLVWRQH P51$ DQG VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ LQ WKH VDPH 51$ VDPSOH 7KH 6, SUREH ZDV SUHSDUHG E\ GLJHVWLQJ QJ S63+(O S63+(ODOSKD RU S63+(O$7* '1$ ZLWK XQLWV RI 6PDO DW r& IRU KRXUV 7KH ES 6PDO IUDJPHQW ZDV LVRODWHG IURP D b DJDURVH PLQLJHO E\ WKH IUHH]HVTXHH]H PHWKRG 7KH VROXWLRQ

PAGE 65

FRQWDLQLQJ WKH 6PDO IUDJPHQW ZDV EXWDQRO H[WUDFWHG WR UHGXFH WKH YROXPH DQG WR UHPRYH WKH HWKLGLXP EURPLGH 7KH IUDJPHQW ZDV WKHQ H[WUDFWHG ZLWK SKHQRO DQG FKORURIRUP DQG SUHFLSLWDWHG LQ YROXPHV b HWKDQRO DW r& RYHUQLJKW 7KH '1$ ZDV FROOHFWHG E\ FHQWULIXJDWLRQ DW [ J DW r& IRU PLQXWHV DQG UHVXVSHQGHG LQ XO P0 7ULV+&O S+ XO O2[ &,3 EXIIHU 0 7ULV+&O S+ P0 0J&O P0 =Q&O P0 VSHUPLGLQHf DQG XO GG+ 7KH EOXQWHQGHG '1$ ZDV GHSKRVSKRU\ODWHG ZLWK XQLWV FDOI LQWHVWLQDO DONDOLQH SKRVSKDWDVH &,3f DW r& IRU PLQXWHV DQG WKHQ DW r& IRU PLQXWHV $ VHFRQG DOLTXRW RI &,3 ZDV DGGHG DQG WKH LQFXEDWLRQV DW r DQG r& ZHUH UHSHDWHG 7KH UHDFWLRQ ZDV WHUPLQDWHG ZLWK XO GG+ XO O2[ 67( P0 7ULV+&O S+ 0 1D&O P0 ('7$f DQG XO b 6'6 DQG KHDWHG DW r& IRU PLQXWHV 7KH VDPSOH ZDV H[WUDFWHG ZLWK SKHQRO DQG FKORURIRUP DGMXVWHG WR 0 VRGLXP DFHWDWH DQG SUHFLSLWDWHG ZLWK YROXPHV RI b HWKDQRO DW r& RYHUQLJKW 7KH GHSKRVSKRU\ODWHG 6PDO IUDJPHQW ZDV SHOOHWHG DW [ J r& IRU PLQXWHV YDFXXP GULHG DQG UHVXVSHQGHG LQ XO O[ NLQDVH EXIIHU P0 7ULV+&O S+ P0 0J&O P0 EHWDPHUFDSWRHWKDQRO P0 VSHUPLGLQHf 7KH 6, IUDJPHQW ZDV SKRVSKRU\ODWHG ZLWK X&L >JDPPD3@$73 DQG XO SRO\QXFOHRWLGH NLQDVH > XQLWVXO@ DW r& IRU PLQXWHV 7KH UHDFWLRQ ZDV WHUPLQDWHG ZLWK XO P0 ('7$ DW r& IRU PLQXWHV 7KH '1$ VROXWLRQ ZDV GLOXWHG ZLWK PO HOXWLS ORZ VDOW EXIIHU P0 7ULV+&O S+ 0 1D&O P0 ('7$f DQG SDVVHG RYHU D 6FKOHLFKHU DQG

PAGE 66

6FKXHOO (OXWLS FROXPQ 7KH FROXPQ ZDV ZDVKHG ZLWK PO ORZ VDOW EXIIHU WR UHPRYH XQLQFRUSRUDWHG UDGLRODEHOHG ULERQXFOHRWLGH DQG WKH '1$ IUDJPHQW ZDV HOXWHG LQ XO KLJK VDOW EXIIHU 7ULV+&O S+ 0 1D&O P0 ('7$f 7KH UDGLRODEHOHG 6, SUREH ZDV XVXDOO\ XVHG LPPHGLDWHO\ DQG DQ\ H[FHVV ZDV VWRUHG LQ KLJK VDOW EXIIHU DW r& 5RXWLQHO\ QT 51$ XOf DQG XO 6, SUREH ZHUH FRSUHFLSLWDWHG ZLWK XO b HWKDQRO DW r& RYHUQLJKW 7KH VDPSOH ZDV FHQWULIXJHG DW [ J r& IRU PLQXWHV 7KH SHOOHW ZDV YDFXXP GULHG DQG UHVXVSHQGHG LQ XO [ K\EULGL]DWLRQ EXIIHU 0 3LSHV S+ 0 1D&O P0 ('7$f DQG XO UHFU\VWDOOL]HG IRUPDPLGH 7KH VDPSOH ZDV KHDWHG DW r& IRU PLQXWHV DQG WKHQ LQFXEDWHG DW r& IRU KRXUV 6LQJOHVWUDQGHG QXFOHLF DFLGV ZHUH GLJHVWHG ZLWK 6, QXFOHDVH E\ DGGLQJ XO LFH FROG 6, QXFOHDVH EXIIHU 0 VRGLXP DFHWDWH S+ 0 1D&O P0 =Q62Lf DQG XQLWV 6, QXFOHDVH DW r& IRU PLQXWHV 7KH 6, GLJHVWLRQ UHDFWLRQ ZDV WHUPLQDWHG E\ RUJDQLF H[WUDFWLRQ ZLWK YROXPH SKHQRO DQG YROXPH FKORURIRUP DQG WKHQ YROXPH FKORURIRUP DORQH 1XFOHLF DFLGV ZHUH SUHFLSLWDWHG IURP WKH DTXHRXV SKDVH ZLWK PO b HWKDQRO DW r& RYHUQLJKW 7KH 6, QXFOHDVH GLJHVWHG VDPSOHV ZHUH FROOHFWHG DW [ J r& IRU PLQXWHV 7KH SHOOHWV ZHUH YDFXXP GULHG DQG UHVXVSHQGHG LQ XO ORDGLQJ EXIIHU b IRUPDPLGH O[ 7%( >O2[ 7%( P0 7ULV+&O S+ P0 ERULF DFLG P0 ('7$@ b EURPRSKHQRO EOXH b [\OHQH F\DQROf 7KH

PAGE 67

VDPSOHV ZHUH GHQDWXUHG E\ KHDWLQJ DW r& IRU PLQXWHV DQG WKHQ TXLFNO\ FKLOOHG DW r& WR SUHYHQW UHDQQHDOLQJ SULRU WR ORDGLQJ RQWR WKH JHO 6L[ SHUFHQW SRO\DFU\ODPLGH 0 XUHD FURVV OLQNHG DW DFU\ODPLGHELVDFU\ODPLGHf JHOV ZLWK GLPHQVLRQV RI HLWKHU FP [ FP [ PP PP [ PP ZHOO FRPE RU PP [ PP ZHOO FRPEf RU FP [ FP PP [ PP ZHOO FRPEf ZHUH SUHSDUHG DQG SUH HOHFWURSKRUHVHG IRU PLQXWHV 7KH VDPSOHV ZHUH ORDGHG ZLWK GUDZQRXW FDSLOODU\ WXEHV RU D 5DLQLQ 3LSHWWHPDQ XO FDSDFLW\f XVLQJ IODW SLSHWWH WLSV 7KH ODUJH JHOV ZHUH HOHFWURSKRUHVHG DW ZDWWV FRQVWDQW SRZHU 9 $f IRU KRXUV DQG WKH VPDOO JHOV ZHUH HOHFWURSKRUHVHG DW 9 $f IRU KRXUV 7KH JHOV ZHUH SODFHG RQ VKHHWV RI 00 :KDWPDQ SDSHU GULHG XQGHU YDFXXP DW r& IRU KRXUV DQG H[SRVHG WR SUHIODVKHG ;$5 [UD\ ILOP ZLWK D &URQH[ /LJKWQLQJ 3OXV LQWHQVLI\LQJ VFUHHQ DW r& IRU YDU\LQJ OHQJWKV RI WLPH 6, DQDO\VLV ZDV TXDQWLWDWHG E\ VFDQQLQJ ODVHU GHQVLWRPHWU\ RI PXOWLSOH DXWRUDGLRJUDSKLF H[SRVXUHV WKDW ZHUH ZLWKLQ WKH OLQHDU UDQJH RI WKH ILOP ,Q 9LWUR 1XFOHDU 5XQ2Q 7UDQVFULSWLRQ $QDO\VLV 7KH LQ YLWUR QXFOHDU UXQRQ WUDQVFULSWLRQ DVVD\V ZHUH SHUIRUPHG E\ $QQD 5DPVH\(ZLQJ DV GHVFULEHG E\ %DXPEDFK HW DO f &HOOV ZHUH KDUYHVWHG E\ FHQWULIXJDWLRQ DQG WKH FHOO SHOOHW ZDVKHG WZLFH LQ FROG LVRWRQLF EXIIHU P0 .& P0 7ULV+&O S+ P0 0J&O P0 EHWD

PAGE 68

PHUFDSWRHWKDQROf &HOOV ZHUH GLVUXSWHG E\ KRPRJHQL]DWLRQ VWURNHVf ZLWK D 'RXQFH KRPRJHQL]HU :KHDWRQ W\SH $ SHVWOH $IWHU !b RI WKH FHOOV KDG EHHQ O\VHG QXFOHL ZHUH SHOOHWHG E\ FHQWULIXJDWLRQ DW USP IRU PLQXWHV LQ DQ ,(& FHQWULIXJH DW r& DQG UHVXVSHQGHG LQ QXFOHL VWRUDJH EXIIHU FRQWDLQLQJ b JO\FHURO P0 7ULV+&O S+ P0 0J&O P0 ('7$f 1XFOHL ZHUH DOLTXRWHG DQG HLWKHU VQDS IUR]HQ LQ OLTXLG QLWURJHQ RU XVHG IUHVK LQ WKH LQ YLWUR WUDQVFULSWLRQ UHDFWLRQV 5HDFWLRQV W\SLFDOO\ FRQWDLQHG QXFOHL X&L DOSKD3873 &LPPROHf O P0 $73 P0 *73 DQG &73 LQ D ILQDO YROXPH RI XO DQG ZHUH LQFXEDWHG IRU PLQXWHV ZLWK LQWHUPLWWHQW VKDNLQJ DW r& 5DGLRODEHOHG 51$V ZHUH LVRODWHG E\ WUHDWPHQW RI QXFOHL ZLWK '1DVH JPOf LQ WKH SUHVHQFH RI 0 1D&O P0 7ULV+&O S+ P0 0J&O IRU PLQXWHV DW URRP WHPSHUDWXUH 7KH PL[WXUH ZDV WKHQ LQFXEDWHG ZLWK SURWHLQDVH MXJPOf IRU PLQXWHV DW r& LQ WKH SUHVHQFH RI P0 1D&O P0 ('7$ P0 7ULV+&O S+ DQG P0 0J&O 6RGLXP DFHWDWH S+ f ZDV DGGHG WR 0 DQG QXFOHLF DFLGV H[WUDFWHG VHYHUDO WLPHV E\ WKH KRW SKHQRO PHWKRG &OD\WRQ DQG 'DUQHOO -U 6KHUUHU DQG 'DUQHOO f 7R WKH DTXHRXV VROXWLRQ RI M3ODEHOHG 51$V J RI \HDVW 51$ DQG YROXPHV RI b HWKDQRO ZHUH DGGHG 3UHFLSLWDWLRQ ZDV RYHUQLJKW DW & 5DGLRODEHOHG WUDQVFULSWV ZHUH UHVXVSHQGHG LQ P0 7ULV+&O S+ P0 ('7$ DQG DQ DOLTXRW RI HDFK VDPSOH ZDV SUHFLSLWDWHG ZLWK

PAGE 69

0J \HDVW 51$ DQG FROG b 7&$ 7&$SUHFLSLWDEOH FRXQWV ZHUH GHWHUPLQHG E\ OLTXLG VFLQWLOODWLRQ VSHFWURPHWU\ '1$ H[FHVV K\EULGL]DWLRQ KDV DOVR EHHQ GHVFULEHG E\ %DXPEDFK HW DO f ,Q D SUHOLPLQDU\ H[SHULPHQW ZH GHWHUPLQHG WKDW ILJ RI + KLVWRQH LQVHUW LQ S) ZDV DW OHDVW £ WZRIROG '1$ H[FHVV ZKHQ K\EULGL]HG WR LQ YLWUR QXFOHDU UXQRQ WUDQVFULSWV 6RXWKHUQ EORWV FRQWDLQLQJ UHVWULFWLRQ HQGRQXFOHDVH GLJHVWHG '1$ IUDJPHQWV RU VORW EORWV FRQWDLQLQJ OLQHDUL]HG SODVPLG '1$V ZHUH SUHSDUHG 6RXWKHUQ EORWV RQ QLWURFHOOXORVH RU VORW EORWV RQ 1\ORQ ZHUH SUHK\EULGL]HG LQ 0 1D&O P0 7ULV+&O S+ P0 ('7$ b 6'6 [ 'HQKDUGWnV PJPO (BcB FROL '1$ DQG P0 VRGLXP S\URSKRVSKDWH DW r& IRU DW OHDVW KRXUV +\EULGL]DWLRQV ZHUH FRQGXFWHG DW r& IRU KRXUV LQ 0 1D&O P0 7ULV+&O S+ P0 ('7$ b 6'6 [ 'HQKDUGWnV JPO (AB FROL '1$ ZLWK L3ODEHOHG WUDQVFULSWV DW [OO;' 7&$SUHFLSLWDEOH FRXQWV SHU PO RI K\EULGL]DWLRQ VROXWLRQ %ORWV ZHUH ZDVKHG DW r& IRU PLQXWHV LQ IUHVK SUHK\EULGL]DWLRQ VROXWLRQ > POFP@ KRXU LQ [ 66&b 6'6 > POFP@ RYHUQLJKW LQ [ 66&b 6'6 > POFP@ DQG KRXU LQ [ 66&b 6'6 > POFP@ $LU GULHG ILOWHUV ZHUH DXWRUDGLRJUDSKHG ZLWK ;$5 RU &URQH[ ILOP DQG &URQH[ OLJKWQLQJ 3OXV VFUHHQV DW r& IRU YDU\LQJ SHULRGV RI WLPH DQG GHYHORSHG ZLWK DQ ;20$7 ;UD\ ILOP SURFHVVRU

PAGE 70

5DGLRODEHOLQT '1$ IRU 1RUWKHUQ %ORW $QDO\VLV '1$ XVHG IRU 1RUWKHUQ EORW DQDO\VLV ZDV XQLIRUPDOO\ ODEHOHG E\ QLFN WUDQVODWLRQ DV GHVFULEHG E\ 0DQLDWLV HW DOA Ef RU E\ WKH UDQGRP SULPLQJ PHWKRG RI 5REHUWV DQG :LOVRQ f 5DGLRODEHOHG SUREHV SUHSDUHG LQ WKLV PDQQHU DUH DOVR VXLWDEOH IRU RWKHU SXUSRVHV VXFK DV 6RXWKHUQ EORW DQDO\VLV 5DQGRP 3ULPLQJ 0HWKRG 7KLV SURWRFRO LV YHU\ HIILFLHQW IRU ODEHOLQJ VPDOO WR LQWHUPHGLDWHVL]HG '1$ IUDJPHQWV ES LQ OHQJWKf DQG LV WKH SUHIHUUHG PHWKRG IRU ZRUN ZLWK SXULILHG '1$ LQVHUWV 6XSHUFRLOHG SODVPLG '1$ LV ODEHOHG PXFK OHVV HIILFLHQWO\ E\ WKH UDQGRP SULPLQJ PHWKRG DQG VKRXOG EH IUDJPHQWHG E\ VRQLFDWLRQ SULRU WR XVH 5RXWLQHO\ VSHFLILF DFWLYLWLHV RI O[O2 FSPM[J '1$ DUH DFKLHYHG XVLQJ DV OLWWOH DV QJ '1$ 0DWHULDO IRU ROLJRODEHOLQJ '1$ IUDJPHQWV ZDV SXUFKDVHG IURP %HWKHVGD 5HVHDUFK /DERUDWRULHV DV D NLW 7KH LVRWRSH X&L >D3@ G&73f ZDV YDFXXP GULHG DQG UHVXVSHQGHG LQ XO RI [ UHDFWLRQ EXIIHU P0 +HSHV S+ P0 0J&O P0 EHWDPHUFDSWRHWKDQRO P0 7ULV+&O S+ PJPO %6$ PJPO V\QWKHWLF '1$ ROLJRGHR[\QXFOHRWLGH SULPHUV X0 HDFK G*73 G$73 G773f 7KH '1$ IUDJPHQW QJf LQ XO GG+" ZDV KHDWHG DW r& IRU PLQXWHV DQG LPPHGLDWHO\ FKLOOHG RQ LFH 7KH GHQDWXUHG '1$ ZDV DGGHG WR WKH PO PLFURFHQWULIXJH WXEH FRQWDLQLQJ

PAGE 71

WKH LVRWRSH DQG EXIIHU DQG WKH SULPLQJ UHDFWLRQ ZDV LQLWLDWHG ZLWK XQLWV .OHQRZ HQ]\PH > 8XO@ 7KH VDPSOH ZDV LQFXEDWHG DW URRP WHPSHUDWXUH IRU DW OHDVW KRXUV XVXDOO\ RYHUQLJKWf 7KH UHDFWLRQ ZDV WHUPLQDWHG ZLWK XO P0 ('7$ DQG XO 7( EXIIHU P0 7ULV+&O S+ P0 ('7$f DQG H[WUDFWHG RQFH ZLWK XO FKORURIRUPLVRDP\O DOFRKRO 8QLQFRUSRUDWHG UDGLRODEHOHG GHR[\QXFOHRWLGH ZDV UHPRYHG IURP WKH '1$ E\ FKURPDWRJUDSK\ RYHU D PP [ PPf %LRJHO $P %LR 5DGf FROXPQ LQ 7( EXIIHU )RXUWHHQ IUDFWLRQV ZHUH FROOHFWHG XO LQ WKH ILUVW IUDFWLRQ DQG XO LQ HDFK VXEVHTXHQW IUDFWLRQ )UDFWLRQV FRQWDLQLQJ UDGLRODEHOHG '1$ ZHUH GHWHUPLQHG E\ &HUHQNRY FRXQWLQJ LQ WKH WULWLXP FKDQQHO ZLWK D %HFNPDQ /6 VFLQWLOODWLRQ FRXQWHU 7KH SHDN IUDFWLRQV ZHUH SRROHG DQG DFFXUDWHO\ TXDQWLWDWHG E\ FRXQWLQJ XO '1$ LQ PO 7ULWRQWROXHQH EDVHG VFLQWLOODWLRQ FRFNWDLO PO WROXHQH PO 7ULWRQ ; PO OLTXLIOXRUf LQ WKH M3 FKDQQHO 7KH VDPSOHV ZHUH LPPHGLDWHO\ XVHG IRU K\EULGL]DWLRQ VWXGLHV DQG H[FHVV SUREH ZDV VWRUHG DW r& 1LFN7UDQVODWLRQ 0HWKRG 1LFNWUDQVODWLRQ ZDV WKH FRPPRQ SURFHGXUH IRU XQLIRUPDOO\ ODEHOLQJ '1$ IUDJPHQWV RU VXSHUFRLOHG '1$ EHIRUH WKH GHYHORSPHQW RI WKH UDQGRP SULPHU PHWKRG $ GLVDGYDQWDJH WR XVLQJ WKH QLFNWUDQVODWLRQ SURFHGXUH LV WKDW WKH V\VWHP PXVW EH RSWLPL]HG IRU HIILFLHQF\ IRU HDFK ORW RI (BcB FROL '1$

PAGE 72

SRO\PHUDVH HQ]\PH ,Q DGGLWLRQ WKH VSHFLILF DFWLYLW\ [ FSPQJ '1$f DFKLHYHG ZLWK WKH QLFNWUDQVODWLRQ SURFHGXUH LV PXFK ORZHU WKDQ WKH UDQGRP SULPHU PHWKRG [ FSPMXJ '1$f '1DVH > PJPO LQ P0 +&O@ ZDV DFWLYDWHG E\ LQFXEDWLQJ XO RI WKH HQ]\PH LQ XO '1DVH EXIIHU P0 7ULV+&O S+ P0 0J&O PJPO %6$f DW r& IRU KRXUV 7KH LVRWRSH X&L >DM3@ G&73f ZDV GULHG LQ D 6DYDQW 6SHHG 9DF FHQWULIXJH 7KH IROORZLQJ FRPSRQHQWV ZHUH DGGHG LQ RUGHU WR WKH LVRWRSH f XO GG+ f XO O2[ QLFNWUDQVODWLRQ EXIIHU P0 7ULV+&O S+ P0 EHWDPHUFDSWRHWKDQRO P0 0J&Of f XO O2[ G173V X0 RI HDFK G$73 G*73 G773f f XO %6$ > PJPO@ f XO '1$ QJXO@ DQG f XO '1$ SRO\PHUDVH > 8XO@ 7KH DFWLYDWHG '1DVH ZDV GLOXWHG ZLWK XO LFH FROG GG+ GLOXWLRQ QJXO ILQDO FRQFHQWUDWLRQf DQG XO RI GLOXWHG HQ]\PH ZDV DGGHG WR WKH QLFNWUDQVODWLRQ PL[ 7KH VDPSOH ZDV LQFXEDWHG DW r& IRU PLQXWHV DQG WKH UHDFWLRQ ZDV WKHQ WHUPLQDWHG ZLWK XO P0 ('7$ DQG XO 7( EXIIHU 7KH VDPSOH ZDV H[WUDFWHG RQFH ZLWK XO FKORURIRUP DQG XQLQFRUSRUDWHG UDGLRODEHOHG GHR[\ULERQXFOHRWLGHV ZHUH UHPRYHG E\ FKURPDWRJUDSK\ RYHU D %LRJHO $P FROXPQ 7KH '1$ ZDV TXDQWLWDWHG DQG LPPHGLDWHO\ XVHG IRU K\EULGL]DWLRQ

PAGE 73

6LWH'LUHFWHG 0XWDJHQHVLV ,Q WKH SDVW UHVHDUFKHUV KDG WR UHO\ RQ QDWXUH WR SURGXFH WKH SURSHU PXWDWLRQV WR VWXG\ KRZ WKH QRUPDO ELRORJLFDO SURFHVVHV IXQFWLRQ =ROOHU DQG 6PLWK f KDYH GHVLJQHG D SRZHUIXO PHWKRG IRU VHOHFWLYHO\ LQWURGXFLQJ VLQJOHQXFOHRWLGH PXWDWLRQV LQWR VSHFLILF VLWHV RI DQ\ FORQHG VHTXHQFHG UHJLRQ RI '1$ VLWHGLUHFWHG PXWDJHQHVLVf ,Q DGGLWLRQ WKLV SURFHGXUH FDQ EH XVHG WR VHOHFWLYHO\ FUHDWH GHOHWLRQ RU LQVHUWLRQ PXWDWLRQV LQ '1$ IUDJPHQWV RI NQRZQ VHTXHQFH 7KH JHQHUDO DSSURDFK RI VLWHGLUHFWHG PXWDJHQHVLV LV WR LQFRUSRUDWH DQ ROLJRQXFOHRWLGH FRQWDLQLQJ WKH DSSURSULDWH PXWDWLRQ LQWR WKH FRPSOHPHQWDU\ VWUDQG RI UHFRPELQDQW 0 '1$ 7KH KHWHURGXSOH[ LV WUDQVIHFWHG LQWR EDFWHULD DQG WKH UHVXOWLQJ PXWDWHG EDFWHULRSKDJH DUH LVRODWHG E\ YDULRXV VHOHFWLRQ SURFHVVHV $V GLVFXVVHG LQ &KDSWHU WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ LV DVVRFLDWHG ZLWK PHPEUDQHERXQG SRO\VRPHV DQG LV VWDEOH GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV ,W ZDV XQFOHDU ZKHWKHU WKH XQFRXSOLQJ RI WKH KLVWRQH IXVLRQ P51$ VWDELOLW\ IURP '1$ UHSOLFDWLRQ ZDV GXH WR WKH DOWHUHG VXEFHOOXODU ORFDWLRQ RU WR D FKDQJH LQ P51$ VWUXFWXUH GXH WR WKH QXFOHRWLGH VHTXHQFH FRGLQJ IRU WKH VLJQDO SHSWLGH 7R DGGUHVV WKHVH SRVVLELOLWLHV ZH KDYH LQWURGXFHG SRLQW PXWDWLRQV LQWR WKH VLJQDO SHSWLGH FRGLQJ UHJLRQ ZLWK WKH LQWHQWLRQ WR LQDFWLYDWH VLJQDO SHSWLGH IXQFWLRQ ,Q GRLQJ VR P51$ VWUXFWXUH LV SHUWXUEHG DV OLWWOH DV SRVVLEOH DQG

PAGE 74

WKH PXWDWHG KLVWRQH IXVLRQ P51$ OLNH HQGRJHQRXV KLVWRQH P51$ DVVRFLDWHV ZLWK QRQPHPEUDQHERXQG SRO\VRPHV 6XEFORQLQT RI WKH 6LJQDO 3HSWLGH+LVWRQH )XVLRQ *HQH LQWR 0 '1$ 7KH VLJQDO SHSWLGHKLVWRQH IXVLRQ JHQH 63+f ZDV VXEFORQHG LQWR 0PSO 5) '1$ 63+ '1$ ZDV GLJHVWHG ZLWK (FR5, DQG +LQGOOO DQG WKH ES IUDJPHQW ZDV LVRODWHG IURP D b DJDURVH JHO 7KH 0PSO '1$ ZDV GLJHVWHG ZLWK (FR5, DQG +LQGOOO DQG WKH ES IUDJPHQW ZDV LVRODWHG IURP D b DJDURVH JHO 7KH ES 63+ '1$ IUDJPHQW QJf DQG ES 0 '1$ IUDJPHQW QJf ZHUH OLJDWHG LQ XO O[ OLJDWLRQ EXIIHU P0 7ULV S+ P0 0J&O P0 GLWKLRWKUHLWRO P0 $73 DQG QTUDO %6$f ZLWK 8 7 '1$ OLJDVH 1(%f DW r& RYHUQLJKW 7KH OLJDWLRQ PL[ ZDV WUDQVIHFWHG LQWR FRPSHWHQW -0 EDFWHULD ZKLWH SODTXHV ZHUH LVRODWHG DQG 063+ UHFRPELQDQWV ZHUH VFUHHQHG E\ UHVWULFWLRQ HQGRQXFOHDVH GLJHVWLRQ DQDO\VLV 6LQJOHVWUDQGHG 063+ '1$ ZDV LVRODWHG IURP EDFWHULRSKDJH SDUWLFOHV DV GHVFULEHG DERYH 6\QWKHVLV DQG 3URFHVVLQJ RI 2OLJRQXFOHRWLGHV 7KH VLJQDO SHSWLGH HQFRGHG E\ WKH 63+ KLVWRQH IXVLRQ JHQH ZDV PXWDWHG E\ VXEVWLWXWLQJ OHXFLQH DW DPLQR DFLG SRVLWLRQ DQG SUROLQH DW SRVLWLRQ ZLWK KLVWLGLQH UHVLGXHV ,W ZDV SUHGLFWHG WKDW WKH LQWURGXFWLRQ RI WZR SRVLWLYHO\ FKDUJHG DPLQR DFLGV LQWR WKH K\GURSKRELF UHJLRQ

PAGE 75

RI WKH VLJQDO SHSWLGH ZRXOG GLVUXSW LWV UHFRJQLWLRQ E\ WKH VLJQDO SHSWLGH UHFRJQLWLRQ SDUWLFOH DQG ZRXOG WKHUHIRUH SUHYHQW WKH WUDQVORFDWLRQ RI WKH PXWDWHG KLVWRQH IXVLRQ P51$ WR PHPEUDQHERXQG SRO\VRPHV $Q ROLJRQXFOHRWLGH 63Df FRQWDLQLQJ WZR SRLQW PXWDWLRQV ZDV V\QWKHVL]HG E\ 7RP 'R\OH LQ WKH 'HSDUWPHQW RI 0LFURELRORJ\ DQG ,PPXQRORJ\ 8QLYHUVLW\ RI )ORULGD *DLQHVYLOOH )ORULGD 7KH ROLJRQXFOHRWLGH ZDV FRPSRVHG RI WKH IROORZLQJ VHJXHQFH n &$$$$$$*7*$$7$7***&*$ n ZLWK WKH PXWDWHG QXFOHRWLGHV XQGHUOLQHG 7KH ROLJRQXFOHRWLGH ZDV UHFHLYHG LQ a PO b DPPRQLXP K\GUR[LGH DQG ZDV KHDWHG DW r& IRU KRXUV WR UHPRYH WKH SURWHFWLQJ DPLQH JURXS 7KH VDPSOH ZDV GULHG XQGHU D JHQWOH VWUHDP RI DLU LQ WKH IXPH KRRG DQG UHVXVSHQGHG LQ PO GG+ 7KH VDPSOH ZDV H[WUDFWHG WZR WLPHV ZLWK XO QEXWDQRO DQG WKH ROLJRQXFOHRWLGH ZDV SUHFLSLWDWHG IURP WKH DTXHRXV SKDVH E\ DGGLQJ XO 0 DPPRQLXP DFHWDWH DQG PO b HWKDQRO DQG FKLOOLQJ DW r& IRU PLQXWHV 7KH VDPSOH ZDV FHQWULIXJHG DW [ J DW r& IRU PLQXWHV ZDVKHG LQ b HWKDQRO DQG UHVXVSHQGHG LQ XO GG+ 7KH \LHOG RI ROLJRQXFOHRWLGH ZDV HVWLPDWHG VSHFWURSKRWRPHWULFDOO\ DQG ZDV IRXQG WR EH PJ ARA f $ VHFRQG ROLJRQXFOHRWLGH $7*ff ZDV GHVLJQHG WR GHVWUR\ WKH VLJQDO SHSWLGH $7* WUDQVODWLRQ VWDUW FRGRQ RI WKH 63+ IXVLRQ JHQH DQG WKHUHE\ FRPSOHWHO\ EORFN WKH V\QWKHVLV RI DQ\ VLJQDO SHSWLGH 7KH 63+$7* P51$ UHWDLQV WKH KLVWRQH

PAGE 76

WUDQVODWLRQ VWDUW FRGRQ LQ LWV SURSHU FRQWH[W DOWKRXJK IXUWKHU GRZQVWUHDP IURP WKH n WHUPLQXV WKDQ HQGRJHQRXV + KLVWRQH P51$ DQG VKRXOG WKHUHIRUH EH WUDQVODWHG RQ QRQPHPEUDQHERXQG SRO\VRPHV ,Q DGGLWLRQ 63+$7*f P51$ GLIIHUV IURP 63+ ZLOG W\SH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ DW RQO\ RQH QXFOHRWLGH 7KH VHTXHQFH RI WKH $7*a ROLJRQXFOHRWLGH LV DV IROORZV n $$7$&7&$$$&7&77&& n DQG ZDV SUHSDUHG DQG SURFHVVHG DV GHVFULEHG IRU WKH 63D ROLJRQXFOHRWLGH 7KH \LHOG RI $7* ROLJRQXFOHRWLGH ZDV RQO\ 0J ARA f 2SWLPL]DWLRQ RI &RQGLWLRQV IRU 6LWH'LUHFWHG 0XWDJHQHVLV ,W ZDV QHFHVVDU\ WR RSWLPL]H WKH FRQGLWLRQV IRU WKH K\EULGL]DWLRQ RI WKH ROLJRQXFOHRWLGH WR 0 WHPSODWH VR WKDW WKH V\QWKHVLV RI WKH VHFRQG VWUDQG ZDV SULPHG E\ WKH ROLJRQXFOHRWLGH IURP WKH FRUUHFW VLWH 3URSHU SULPLQJ E\ WKH ROLJRQXFOHRWLGH ZDV WHVWHG E\ SULPHU H[WHQVLRQ DQDO\VLV $IWHU OLPLWHG SULPHU H[WHQVLRQ WKH VDPSOHV ZHUH GLJHVWHG ZLWK D UHVWULFWLRQ HQGRQXFOHDVH WKDW UHFRJQL]HG D VLWH GRZQVWUHDP IURP WKH H[SHFWHG SULPLQJ VLWH 7KH QXPEHU DQG LQWHQVLW\ RI WKH IUDJPHQWV SURGXFHG E\ WKH GLJHVWLRQ LQGLFDWHG WKH QXPEHU RI SULPLQJ VLWHV DQG WKH ORFDWLRQ RI WKH SUHIHUUHG VLWH 7KH ROLJRQXFOHRWLGH SPROf ZDV SKRVSKRU\ODWHG ZLWK XQLWV 7 SRO\QXFOHRWLGH NLQDVH LQ P0 7ULV+&O S+ P0 0J&O P0 GLWKLRWKUHLWRO X&L >JDPPD3@ $73 DW r&

PAGE 77

IRU PLQXWHV 7KH UHDFWLRQ ZDV WHUPLQDWHG E\ KHDWLQJ DW r& IRU PLQXWHV DQG XQLQFRUSRUDWHG UDGLRODEHOHG QXFOHRWLGHV ZHUH UHPRYHG E\ FKURPDWRJUDSK\ WKURXJK D 6HSKDGH[ 3KDUPDFLDf FROXPQ PP [ PPf LQ P0 DPPRQLXP ELFDUERQDWH S+ f 7KH SKRVSKRU\ODWHG ROLJRQXFOHRWLGH PRODU H[FHVV RYHU WHPSODWH '1$f ZDV DGGHG WR SPRO RI 0 UHFRPELQDQW '1$ DQG WKH YROXPH ZDV DGMXVWHG WR XO ZLWK GG+ DQG XO VROXWLRQ $ P0 7ULV+&O S+ P0 0J&O P0 1D&O P0 GLWKLRWKUHLWROf 7KH VROXWLRQ ZDV KHDWHG DW r& IRU PLQXWHV DQG WKHQ FRROHG IRU PLQXWHV DW URRP WHPSHUDWXUH 7KH SULPHU H[WHQVLRQ UHDFWLRQ DOVR FRQWDLQHG XO RI P0 G&73 XO P0 G$73 XO P0 G773 XO P0 G*73 XO VROXWLRQ $ DQG XQLW .OHQRZ HQ]\PH 7KH UHDFWLRQ SURFHHGHG DW URRP WHPSHUDWXUH IRU PLQXWHV DQG ZDV WHUPLQDWHG E\ KHDWLQJ DW r& IRU PLQXWHV 7KH VDPSOH ZDV GLOXWHG ZLWK XO O2[ 3VW, EXIIHU P0 7ULV+&O S+ 0 1D&O P0 0J&O PJPO %6$f DQG XO GG+ DQG WKHQ GLJHVWHG ZLWK XO 3VW, UHVWULFWLRQ HQGRQXFOHDVH > 8XO@ DW r& IRU KRXU 7KH VDPSOH ZDV KHDWHG DW r& IRU PLQXWHV TXLFNO\ FRROHG WR r& DQG GLOXWHG ZLWK XO 6, ORDGLQJ EXIIHU 7KH 3VW, GLJHVWHG VDPSOHV XOf ZHUH UHVROYHG HOHFWURSKRUHWLFDOO\ LQ b DFU\ODPLGH DFU\ODPLGHELVf 0 XUHD DW YROWV P$f IRU KRXUV 7KH JHOV ZHUH GULHG XQGHU YDFXXP DW r& IRU KRXU DQG DQDO\]HG E\ DXWRUDGLRJUDSK\ 3ULPHU H[WHQVLRQ DQDO\VLV

PAGE 78

UHYHDOHG D VLQJOH PDMRU EDQG DW ES IRU HDFK PRODU UDWLR RI ROLJRQXFOHRWLGH WR WHPSODWH '1$ VWXGLHG 7KLV ZDV WKH H[SHFWHG VL]H IUDJPHQW DQG VXJJHVWHG WKDW XQGHU WKHVH FRQGLWLRQV WKH ROLJRQXFOHRWLGH ZDV SULPLQJ WKH V\QWKHVLV RI WKH VHFRQG VWUDQG IURP WKH SURSHU VLWH ,I VHYHUDO SUHGRPLQDQW EDQGV KDG EHHQ GHWHFWHG LH PXOWLSOH SULPLQJ VLWHVf PRUH VWULQJHQW DQQHDOLQJ FRQGLWLRQV ZRXOG KDYH EHHQ UHTXLUHG 6\QWKHVLV RI WKH 0XWDWHG 6WUDQG 7KH ROLJRQXFOHRWLGH QTf ZDV SKRVSKRU\ODWHG LQ P0 7ULV+&O S+ P0 0J&O P0 GLWKLRWKUHLWRO X0 $73 ZLWK XQLWV 7 SRO\QXFOHRWLGH NLQDVH DW r& IRU PLQXWHV 7KH UHDFWLRQ ZDV WHUPLQDWHG E\ KHDWLQJ DW r& IRU PLQXWHV 7KH SKRVSKRU\ODWHG ROLJRQXFOHRWLGH SPROHf ZDV DQQHDOHG WR 063+ UHFRPELQDQW '1$ LQ O[ VROXWLRQ $ E\ LQFXEDWLQJ WKH VDPSOH DW r& IRU PLQXWHV DQG WKHQ DW URRP WHPSHUDWXUH IRU PLQXWHV $IWHU K\EULGL]DWLRQ WKH '1$ ZDV GLOXWHG ZLWK XO VROXWLRQ & XO VROXWLRQ % > 0 7ULV +&O S+ 0 0J&O 0 GLWKLRWKUHLWRO@ XO P0 G&73 XO P0 G773 XO P0 G*73 XO P0 G$73 XO P0 $73 XO >JDPPD3@ G$73 XO 7 '1$ OLJDVH > 8XO@ XO GG+f DQG WKH V\QWKHVLV RI WKH VHFRQG VWUDQG ZDV LQLWLDWHG ZLWK XO .OHQRZ HQ]\PH > 8 XO@ DW URRP WHPSHUDWXUH $IWHU PLQXWHV XO P0 G$73 ZDV DGGHG

PAGE 79

DQG WKH LQFXEDWLRQ ZDV FRQWLQXHG DW URRP WHPSHUDWXUH RYHUQLJKW (QULFKPHQW IRU &RYDOHQWO\ &ORVHG 'RXEOH6WUDQGHG '1$ 7KH LQ YLWUR V\QWKHVLV RI WKH HQWLUH VHFRQG VWUDQG LV YHU\ LQHIILFLHQW GXH SULPDULO\ WR WKH ODUJH VL]H RI WKH 0 JHQRPH 7KH SHUFHQW RI FRYDOHQWO\ FORVHG GRXEOHVWUDQGHG '1$ PROHFXOHV LV WKHUHIRUH YHU\ VPDOO LQ FRPSDULVRQ WR WKH SDUWLDOO\ GRXEOHVWUDQGHG LQFRPSOHWH '1$ PROHFXOHV 7KHVH LQFRPSOHWH '1$ PROHFXOHV ZKHQ WUDQVIHFWHG LQWR EDFWHULD JLYH ULVH WR ZLOG W\SH SODTXH IRUPDWLRQ ZKLFK FRPSOLFDWHV WKH VHOHFWLRQ SURFHVV IRU WKH PXWDWHG FORQHV (QULFKPHQW IRU FRYDOHQWO\ FORVHG GRXEOHVWUDQGHG '1$ PROHFXOHV E\ DONDOLQH VXFURVH JUDGLHQW FHQWULIXJDWLRQ JUHDWO\ IDFLOLWDWHV WKH VHOHFWLRQ SURFHVV 7KH '1$ ZDV SUHFLSLWDWHG IURP WKH RYHUQLJKW H[WHQVLRQ DQG OLJDWLRQ UHDFWLRQ E\ DGGLQJ XO GG+ XO 0 1D&Ob 3(* DW F& IRU PLQXWHV 7KH '1$ ZDV SHOOHWHG DW [ J DW URRP WHPSHUDWXUH IRU PLQXWHV 7KH SHOOHW ZDV JHQWO\ ZDVKHG LQ XO FROG 0 1D&Ob 3(* FHQWULIXJHG DW [ J IRU VHFRQGV DQG UHVXVSHQGHG LQ XO 7( EXIIHU 7KH VDPSOH ZDV GHQDWXUHG ZLWK XO 1 VRGLXP K\GUR[LGH DQG OD\HUHG RQWR D bb DONDOLQH VXFURVH VWHS JUDGLHQW 7KH JUDGLHQW ZDV SUHSDUHG E\ DGGLQJ WR D LQ [ LQ FHQWULIXJH WXEH QLWURFHOOXORVH RU SRO\DOORPHU GR QRW XVH %HFNPDQ 8OWUDFOHDU WXEHV ZKLFK DUH LQFRPSDWLEOH

PAGE 80

ZLWK WKH DONDOL FRQGLWLRQVf LQ RUGHU WKH IROORZLQJ VROXWLRQV HDFK FRQWDLQLQJ 1 1D2+ 0 1D&O P0 ('7$ f PO b VXFURVH" f PO b VXFURVH f PO b VXFURVH f PO b VXFURVH f b VXFURVH 7KH WXEH ZDV LQFXEDWHG DW r& IRU KRXUV 7KH VDPSOHV ZHUH FHQWULIXJHG WKURXJW WKH DONDOLQH VXFURVH JUDGLHQWV LQ D %HFNPDQ 6: URWRU DW USP IRU KRXUV DW r& ZLWKRXW WKH EUDNH 7KH VDPSOHV ZHUH UHFRYHUHG IURP WKH JUDGLHQWV E\ SXQFWXULQJ WKH ERWWRP RI WKH WXEH ZLWK D JDXJH QHHGOH DQG FROOHFWLQJ GURSV SHU IUDFWLRQ LQ PO PLFURFHQWULIXJH WXEHV XVXDOO\ IUDFWLRQVf )UDFWLRQV FRQWDLQLQJ FRYDOHQWO\ FORVHG GRXEOHVWUDQGHG '1$ ZHUH GHWHUPLQHG E\ &KHUHQNRY VFLQWLOODWLRQ FRXQWLQJ LQ WKH WULWLXP FKDQQHO SRROHG DQG QHXWUDOL]HG ZLWK 0 7ULVFLWUDWH S+ ,VRODWLRQ RI 0XWDWHG 0 5HFRPELQDQW %DFWHULRSKDJH 7KH '1$ ZDV WUDQVIHFWHG LQWR (AB FROL -0 FRPSHWHQW FHOOV SODWHG RQWR <7 DJDU DQG LQFXEDWHG RYHUQLJKW DW r& ,QGLYLGXDO SODTXHV ZHUH SLFNHG DQG EDFWHULRSKDJH ZHUH VXEVHTXHQWO\ SUHSDUHG %DFWHULRSKDJH VXVSHQVLRQV XOf ZHUH VSRWWHG RQWR D PLFURQ QLWURFHOOXORVH ILOWHU DQG SUHK\EULGL]HG LQ [ 66& O2[ 'HQKDUGWnV b 6'6 PO FPf DW r& IRU KRXU 7KH ILOWHU ZDV ULQVHG LQ PO [ 66& IRU PLQXWH DW r& DQG K\EULGL]HG LQ PO [ 66& O2[ 'HQKDUGWnV FRQWDLQLQJ [r FSP UDGLRODEHOHG ROLJRQXFOHRWLGH DW r& IRU KRXU 7KH ILOWHU ZDV ZDVKHG WKUHH WLPHV LQ PO [ 66& DW r& IRU D WRWDO RI PLQXWHV 7KH ILOWHU ZDV

PAGE 81

EULHIO\ GULHG XQGHU D KHDW ODPS DQG SODFHG DJDLQVW SUHn IODVKHG ;$5 [UD\ ILOP ZLWKRXW D VFUHHQ IRU KRXU DW URRP WHPSHUDWXUH 8QGHU VXFK ORZ VWULQJHQF\ HDFK SKDJH VSRW ZDV SRVLWLYH LQFOXGLQJ WKH QHJDWLYH FRQWURO 063+ ZLOG W\SH EDFWHULRSKDJH 7KH ILOWHU ZDV UHZDVKHG DW r& LQ [ 66& IRU PLQXWHV DLU GULHG DQG H[SRVHG WR SUHIODVKHG ;$5 ILOP IRU KRXU $W WKH KLJKHU ZDVK WHPSHUDWXUH PDQ\ RI WKH SKDJH VSRWV ZHUH OHVV LQWHQVH ZKHUHDV VHYHUDO UHPDLQHG XQFKDQJHG :KHQ WKH ILOWHU ZDV ZDVKHG DW r& LQ [ 66& IRU PLQXWHV WKH QHJDWLYH FRQWURO DQG QHDUO\ DOO WKH SKDJH VSRWV FRPSOHWHO\ GLVDSSHDUHG 7KH EDFWHULRSKDJH bf WKDW UHPDLQHG SRVLWLYH DIWHU WKH r& ZDVK ZHUH VHTXHQFHG WR FRQILUP WKH SUHVHQFH RI WKH PXWDWLRQV '1$ 6HTXHQFLQJ 7KH VLWH GLUHFWHG PXWDWLRQV LQ 063+ UHFRPELQDQW '1$V ZHUH FRQILUPHG E\ 6DQJHUnV GLGHR[\QXFOHRWLGH FKDLQ WHUPLQDWRU '1$ VHTXHQFLQJ SURFHGXUH XVLQJ WKH 6HTXHQDVH '1$ 6HTXHQFLQJ .LW IURP 8QLWHG 6WDWHV %LRFKHPLFDO &RUSRUDWLRQ &OHYHODQG 2KLR 7KH 6HTXHQDVH HQ]\PH LV GHULYHG IURP EDFWHULRSKDJH 7 '1$ SRO\PHUDVH DQG KDV EHHQ PRGLILHG WR HIILFLHQWO\ XVH GLGHR[\ULERQXFOHRWLGHV DOSKD WKLR GHR[\ULERQXFOHRWLGHV DQG RWKHU QXFOHRWLGH DQDORJV WKDW DUH FRPPRQO\ XVHG IRU VHTXHQFLQJ ,Q DGGLWLRQ WKH 6HTXHQDVH HQ]\PH H[SUHVVHV KLJK SURFHVVLYLW\ DQG ORZ nn H[RQXFOHDVH DFWLYLW\

PAGE 82

$QQHDOLQJ 7HPSODWH DQG 3ULPHU 7KH SULPHU IRU V\QWKHVL]LQJ WKH FRPSOHPHQWDU\ VWUDQG RI ZLOG W\SH DQG PXWDWHG 063+ UHFRPELQDQW '1$ LV D ES ROLJRQXFOHRWLGH ZKLFK K\EULGL]HV WR D VLWH DGMDFHQW WR WKH SRO\OLQNHU 7KH DQQHDOLQJ UHDFWLRQ ZDV SUHSDUHG E\ DGGLQJ XO SULPHU SPROf XO VLQJOHVWUDQGHG 063+ UHFRPELQDQW '1$ SPROf DQG XO ; VHTXHQFLQJ EXIIHU P0 7ULV+&O S+ P0 0J&O P0 1D&Of 7KH VDPSOH ZDV KHDWHG DW r& IRU PLQXWHV DQG VORZO\ FRROHG WR URRP WHPSHUDWXUH /DEHOLQJ 5HDFWLRQ 7KH FRPSOHPHQWDU\ VWUDQG ZDV V\QWKHVL]HG E\ LQFXEDWLQJ WKH DQQHDOHG VDPSOH ZLWK XO P0 GLWKLRWKUHLWRO XO ODEHOLQJ QXFOHRWLGH PL[ X0 G*73 X0 G&73 X0 G773f XO >D6@ G$73 > X&LXO@ DQG XO 6HTXHQDVH > 8XO@ DW URRP WHPSHUDWXUH IRU PLQXWHV (ORQJDWLRQ ZDV WHUPLQDWHG E\ PL[LQJ XO DOLTXRWV RI WKH ODEHOLQJ UHDFWLRQ ZLWK XO RI RQH RI WKH GLGHR[\ QXFOHRWLGH VROXWLRQ GG$73 GG&73 GG*73 GG773f 7KH GLGHR[\ QXFOHRWLGH VROXWLRQV ZHUH X0 G$73 X0 G&73 X0 G*73 X0 G773 P0 1D&O DQG X0 RI WKH DSSURSULDWH GLGHR[\ULERQXFOHRWLGH 7KH VHTXHQFLQJ VDPSOHV ZHUH GLOXWHG ZLWK XO VWRS VROXWLRQ b IRUPDPLGH P0 ('7$ b EURPRSKHQRO EOXH DQG b [\OHQH F\DQROf KHDWHG DW r& IRU PLQXWHV DQG ORDGHG RQWR D b DFU\ODPLGH 0 XUHD JHO

PAGE 83

FP [ FPf ZLWK D ZHOO VKDUN WRRWKHG FRPE 7KH JHO ZDV UXQ DW : FRQVWDQW 9 P$ IRU KRXUV ;\OHQH &\DQRO G\H ZDV FP IURP WKH ERWWRP RI JHOf 7KH JHO ZDV VRDNHG LQ b DFHWLF DFLGb PHWKDQRO LQ WKH IXPH KRRG IRU KRXU SODFHG RQWR VKHHWV RI 00 :KDWPDQ SDSHU DQG GULHG XQGHU YDFXXP DW r& IRU PLQXWHV 7KH JHO ZDV H[SRVHG WR SUHIODVKHG ;$5 [UD\ ILOP DW URRP WHPSHUDWXUH IRU KRXUV 7UDQVIHFWLRQ RI '1$ LQWR &HOOV ,QWURGXFWLRQ RI 3ODVPLG '1$ LQWR %DFWHULDO &HOOV $Q (B FROL RYHUQLJKW FHOO FXOWXUH ZDV GLOXWHG LQWR PO /% PHGLXP DQG LQFXEDWHG DW r& XQWLO WKH RSWLFDO GHQVLW\ ZDV DSSUR[LPDWHO\ DW QP 7KH FHOOV ZHUH FKLOOHG DW r& IRU PLQXWHV DQG WKHQ FHQWULIXJHG DW USP r& IRU PLQXWHV LQ D %HFNPDQ -$ URWRU 7KH SHOOHW ZDV UHVXVSHQGHG LQ PO RI FROG &D&O EXIIHU P0 &D&O P0 3LSHV S+ b JO\FHUROf DQG LQFXEDWHG DW r& IRU PLQXWHV 7KH FHOOV ZHUH FROOHFWHG E\ FHQWULIXJDWLRQ DW USP IRU PLQXWHV DW r& LQ D -$ URWRU UHVXVSHQGHG LQ PO &D&O EXIIHU DQG GLYLGHG LQWR XO DOLTXRWV 7KH FRPSHWHQW FHOOV ZHUH HLWKHU XVHG LPPHGLDWHO\ IRU WUDQVIRUPDWLRQ RU VWRUHG LQ PLFURFHQWULIXJH WXEHV DW r& )RU WUDQVIRUPDWLRQ XO FRPSHWHQW (A FROL FHOOV ZHUH PL[HG ZLWK XO SODVPLG '1$ QJf DQG LQFXEDWHG DW r& IRU PLQXWHV 7KH FHOOV ZHUH WKHQ KHDW VKRFNHG DW r& IRU

PAGE 84

PLQXWHV GLOXWHG ZLWK PO SUHZDUPHG /% PHGLXP DQG LQFXEDWHG DW r& IRU KRXU 'LIIHUHQW YROXPHV RI WKH WUDQVIHFWHG EDFWHULDO FHOO FXOWXUH XVXDOO\ XOf ZHUH SODWHG RQWR WKH DSSURSULDWH PHGLXP GLFWDWHG E\ WKH JHQRW\SH RI WKH KRVW DQG WKH LQWURGXFHG SODVPLG '1$ ,QWURGXFWLRQ RI '1$ LQWR +H/D &HOOV +H/D PRQROD\HU FHOO FXOWXUHV ZHUH WUDQVIHFWHG ZLWK SODVPLG '1$ DFFRUGLQJ WR *RUPDQ HW DO f LQ D FDOFLXP SKRVSKDWH'1$ FRPSOH[ SUHSDUHG DV GHVFULEHG E\ *UDKDP DQG YDQ GHU (E f +H/D 6 FHOOV JURZLQJ H[SRQHQWLDOO\ LQ VXVSHQVLRQ FXOWXUH ZHUH SODWHG LQWR PO FRPSOHWHG (0(0 (0(0 VXSSOHPHQWHG ZLWK b IHWDO FDOI VHUXP b KRUVH VHUXP 8 SHQLFLOOLQ >LJP VWUHSWRP\FLQ DQG P0 JOXWDPLQHf F DW [ FHOOV SHU FP WLVVXH FXOWXUH GLVK &RUQLQJ RU )DOFRQf DQG LQFXEDWHG RYHUQLJKW DW r& LQ b & 7KH PRQROD\HU FHOO FXOWXUH ZDV UHIHG ZLWK PO FRPSOHWHG (0(0 DQG LQFXEDWHG DW r& LQ b & IRU KRXUV 7KH '1$FDOFLXP SKRVSKDWH SUHFLSLWDWH ZDV SUHSDUHG E\ DGGLQJ cT '1$ LQ XO P0 &D&O GURSZLVH WR XO [ +HEV EXIIHU P0 +HSHV P0 1D&O P0 1D+3 S+ sf ZKLOH YRUWH[LQJ WKH VROXWLRQ 7KH '1$&D&O SUHFLSLWDWH ZDV DGGHG GURSZLVH WR WKH PRQROD\HU FHOO FXOWXUH DQG LQFXEDWLRQ ZDV FRQWLQXHG DW r& LQ b & IRU KRXUV 7KH +H/D FHOOV ZHUH JO\FHURO VKRFNHG E\ UHSODFLQJ WKH PHGLXP ZLWK PO FRPSOHWHG (0(0 FRQWDLQLQJ b JO\FHURO IRU PLQXWH 7KH WUDQVIHFWHG

PAGE 85

FHOOV ZHUH WKHQ ZDVKHG ZLWK PO (0(0 UHIHG ZLWK PO FRPSOHWHG (0(0 DQG LQFXEDWHG DW r& b & (VWDEOLVKPHQW RI 3RO\FORQDO DQG 0RQRFORQDO 6WDEOY 7UDQVIRUPHG &HOO /LQHV 3RO\FORQDO DQG PRQRFORQDO FHOO OLQHV ZHUH LVRODWHG E\ JURZLQJ +H/D FHOO FXOWXUHV WKDW ZHUH FRWUDQVIHFWHG ZLWK S69QHR DQG WKH SODVPLG '1$ RI LQWHUHVW LQ PHGLXP FRQWDLQLQJ WKH DQWLELRWLF 7KH SODVPLG S69QHR FRQVWUXFWHG E\ 6RXWKHUQ DQG %HUJ f FDUULHV WKH EDFWHULDO DPLQRJO\FRVLGH SKRVSKRWUDQVIHUDVH n ,,f JHQH XQGHU WKH FRQWURO RI WKH 69 HDUO\ SURPRWHU DQG FRQIHUV UHVLVWDQFH WR WKH DPLQRJO\FRVLGH DQWLELRWLF 7KH UDWLRQDOH EHKLQG WKH FRWUDQVIHFWLRQ PHWKRG LV WKDW +H/D FHOOV WKDW DUH FRPSHWHQW WR WDNH XS S69QHR '1$ DUH HJXDOO\ FRPSHWHQW WR WDNH XS WKH SODVPLG '1$ RI LQWHUHVW DQG WKHUHIRUH D FHUWDLQ SHUFHQWDJH RI WKH UHVLVWDQW FHOOV FRQWDLQ ERWK VSHFLHV RI '1$ ,GHDOO\ WKH VHOHFWDEOH PDUNHU VKRXOG EH FDUULHG E\ WKH YHFWRU WKDW FRQWDLQV WKH JHQH ZKLFK LV WR EH VWXGLHG +H/D FHOOV LQ PRQROD\HU FXOWXUH ZHUH FRWUDQVIHFWHG ZLWK WKH SODVPLG '1$ WR EH VWXGLHG DQG S69QHR '1$ PRODU UDWLR RI UHVSHFWLYHO\f E\ WKH FDOFLXP SKRVSKDWH SUHFLSLWDWLRQ PHWKRG DV GHVFULEHG DERYH $IWHU KRXUV SRVWJO\FHURO VKRFN WKH WUDQVIHFWHG FHOOV ZHUH UHVXVSHQGHG LQ PO 3XFN VDOLQH $ >b ZYf .& b ZYf 1D&O b ZYf 1D+& b ZYf JOXFRVH@ FRQWDLQLQJ b

PAGE 86

ZYf ('7$ DQG PO RI WKH FHOO VXVSHQVLRQ ZDV VHHGHG LQWR PO FRPSOHWHG (0(0 FRQWDLQLQJ [JPO ELRORJLFDOO\ DFWLYH *HQHWLFLQ *LEFRf LQ FP WLVVXH FXOWXUH GLVKHV 7KH FHOOV ZHUH LQFXEDWHG DW r& b & DQG UHIHG HYHU\ GD\V ZLWK FRPSOHWHG (0(0 FRQWDLQLQJ DQWLELRWLF :LWKLQ ZHHNV WKH PDMRULW\ RI WKH FHOOV KDG GLHG DQG LQGLYLGXDO FRORQLHV RI UHVLVWDQW +H/D FHOOV KDG IRUPHG 3RO\FORQDO FHOO OLQHV ZHUH HVWDEOLVKHG E\ FRPELQLQJ WKH UHVLVWDQW FRORQLHV IURP D FP GLVK DV D VLQJOH KHWHURJHQHRXV FHOO SRSXODWLRQ XVXDOO\ FRORQLHVf )RU WKH HVWDEOLVKPHQW RI PRQRFORQDO FHOO OLQHV LQGLYLGXDO FRORQLHV ZHUH SLFNHG IURP WKH GLVK ZLWK VWHULOH SDVWHXU SLSHWWHV DQG FXOWXUHG DV VHSDUDWH FHOO OLQHV

PAGE 87

&+$37(5 68%&(//8/$5 /2&$7,21 2) +,6721( P51$V 21 &<726.(/(721 $662&,$7(' 1210(0%5$1(%281' 32/<620(6 ,1 +(/$ 6 &(//6 ,1752'8&7,21 +LVWRQH ELRV\QWKHVLV RFFXUV SULPDULO\ GXULQJ WKH 6 SKDVH RI WKH FHOO F\FOH DQG LV WHPSRUDOO\ DV ZHOO DV IXQFWLRQDOO\ FRXSOHG ZLWK '1$ UHSOLFDWLRQ $OOIUH\ HW DO 3UHVFRWW 6SDXOGLQJ HW DOA 5REELQV DQG %RUXQ 6WHLQ DQG %RUXQ f (DUO\ VWXGLHV XVLQJ LQ YLWUR WUDQVODWLRQ DQDO\VLV RI SRO\VRPDO 51$ LVRODWHG IURP 6 SKDVH +H/D FHOOV SURYLGHG DQ LQLWLDO LQGLFDWLRQ WKDW KLVWRQH SURWHLQ V\QWKHVLV RFFXUV RQ QRQPHPEUDQHERXQG OLJKW SRO\VRPHV -DFREV/RUHQD HW DO /LDXWDUG DQG -HDQWHXU *DOOZLW] DQG %UHLQGO %RUXQ HW DOA f ,Q WKHVH VWXGLHV LW ZDV GHPRQVWUDWHG WKDW WUDQVODWDEOH SRO\VRPHDVVRFLDWHG KLVWRQH P51$V KDYH D VHGLPHQWDWLRQ FRHIILFLHQW RI 6 DQG IOXFWXDWH LQ D FHOO F\FOHGHSHQGHQW PDQQHU +LVWRQH P51$ ZDV QRW GHWHFWHG E\ LQ YLWUR WUDQVODWLRQ VWXGLHV RQ SRO\ULERVRPHV LVRODWHG IURP +H/D FHOOV LQ WKH SKDVH RI WKH FHOO F\FOH %RUXQ HW DO %RUXQ HW DO 3HGHUVRQ DQG 5REELQV f &RQVLVWHQW ZLWK WKLV REVHUYDWLRQ WKH LQKLELWLRQ RI '1$ UHSOLFDWLRQ E\ K\GUR[\XUHD RU F\WRVLQH DUDELQRVLGH WUHDWPHQW

PAGE 88

UHVXOWHG LQ WKH UDSLG GLVDSSHDUDQFH RI KLVWRQH P51$V IURP WKHVH SRO\VRPHV %RUXQ HW DO %UHLQGO DQG *DOOZLW] *DOOZLW] f 7KH OLJKW SRO\VRPHV RQ ZKLFK WUDQVODWDEOH KLVWRQH P51$V UHVLGH DUH SUHVXPDEO\ QRQPHPEUDQHERXQG IUHHff SRO\VRPHV DV SUHGLFWHG E\ WKH VLJQDO K\SRWKHVLV %OREHO DQG 'REEHUVWHLQ f 6HYHUDO OLQHV RI HYLGHQFH VXJJHVW WKDW QRQPHPEUDQHERXQG SRO\VRPHV DUH QRW IUHHO\ GLIIXVLEOH ZLWKLQ WKH F\WRSODVP EXW DUH DWWDFKHG WR WKH F\WRVNHOHWRQ 3HQPDQ DQG FRZRUNHUV /HQN HW DO f KDYH GHPRQVWUDWHG WKDW QHDUO\ b RI WRWDO F\WRSODVPLF SRO\VRPHV FRIUDFWLRQDWH ZLWK WKH F\WRVNHOHWDO IUDPHZRUN ,Q DGGLWLRQ YHVLFXODU VWRPDWLWLV YLUXV HQFRGHG QRQPHPEUDQHERXQG DQG PHPEUDQH ERXQG SRO\VRPDO P51$V DUH DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ YLUDOO\ LQIHFWHG +H/D FHOOV &HUYHUD HW DOA f 7DNHQ WRJHWKHU WKHVH REVHUYDWLRQV SURYLGH D EDVLV IRU WKH SRVVLELOLW\ WKDW KLVWRQH P51$FRQWDLQLQJ SRO\VRPHV DQGRU WKHLU VXEFHOOXODU ORFDWLRQ PD\ SOD\ D UROH LQ WKH UHJXODWLRQ RI KLVWRQH JHQH H[SUHVVLRQ 6XFK UHDVRQLQJ LV FRQVLVWHQW ZLWK WKH DSSHDUDQFH RI WUDQVODWDEOH KLVWRQH P51$V RQ SRO\VRPHV ZLWKLQ PLQXWHV IROORZLQJ WUDQVFULSWLRQ %RUXQ HW DO f WKH HTXDOO\ UDSLG WUDQVIHU RI QHZO\ V\QWKHVL]HG KLVWRQHV LQWR WKH QXFOHXV ZKHUH WKH\ FRPSOH[ ZLWK '1$ 5REELQV DQG %RUXQ 6SDXOGLQJ HW DOA f DQG WKH GHJUDGDWLRQ RI KLVWRQH P51$V DQG FHVVDWLRQ RI KLVWRQH SURWHLQ V\QWKHVLV LQ SDUDOOHO ZLWK WKH LQKLELWLRQ RI

PAGE 89

'1$ UHSOLFDWLRQ 6SDXOGLQJ HW DO 5REELQV DQG %RUXQ %RUXQ HW DO %DXPEDFK HW DO f 7R DGGUHVV WKH UHODWLRQVKLS EHWZHHQ WKH ORFDOL]DWLRQ RI KLVWRQH P51$V DQG WKH FRQWURO RI FHOOXODU KLVWRQH P51$ OHYHOV ZH KDYH XVHG FORQHG KXPDQ KLVWRQH JHQHV WR H[DPLQH WKH GLVWULEXWLRQ RI KLVWRQH P51$V RQ QRQPHPEUDQHERXQG DQG PHPEUDQHERXQG SRO\VRPHV DQG WKH DVVRFLDWLRQ RI KLVWRQH P51$FRQWDLQLQJ SRO\VRPHV ZLWK WKH F\WRVNHOHWRQ $V SUHGLFWHG IURP SUHYLRXV UHVXOWV RI LQ YLWUR WUDQVODWLRQ DQDO\VLV DQG F'1$ K\EULGL]DWLRQ VWXGLHV KLVWRQH P51$V ZHUH IRXQG WR UHVLGH SUHGRPLQDQWO\ RQ QRQPHPEUDQHERXQG SRO\VRPHV %RWK WKH QRQPHPEUDQHERXQG SRO\VRPHV FRQWDLQLQJ KLVWRQH P51$V DQG WKH PHPEUDQHERXQG SRO\VRPHV FRQWDLQLQJ WKH FHOO VXUIDFH FODVV +/$% DQWLJHQ P51$V ZHUH IRXQG DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ 5(68/76 /RFDOL]DWLRQ RI +LVWRQH P51$ DQG +/$% P51$ LQ 6XEFHOOXODU )UDFWLRQV 7R GHWHUPLQH WKH LQWUDFHOOXODU ORFDWLRQV RI KLVWRQH P51$ DQG +/$% P51$ +H/D FHOOV ZHUH ILUVW IUDFWLRQDWHG LQWR QRQPHPEUDQHERXQG DQG PHPEUDQHERXQG SRO\VRPDO FRPSRQHQWV E\ WKH SURFHGXUH RXWOLQHG LQ )LJ 7KH PHPEUDQHERXQG SRO\VRPHV DUH UHSUHVHQWHG E\ WKH PLWRFKRQGULD DVVRFLDWHG URXJK HQGRSODVPLF UHWLFXOXP 05(5f DQG WKH QXFOHXV DVVRFLDWHG URXJK HQGRSODVPLF UHWLFXOXP 15(5f

PAGE 90

IUDFWLRQV 7KH OLJKW HQGRSODVPLF UHWLFXOXP /(5f ZKLFK LV GHILFLHQW LQ SRO\VRPHV E\ GHILQLWLRQ ZDV DOVR LVRODWHG IROORZLQJ WKLV VXEFHOOXODU IUDFWLRQDWLRQ VFKHPH +LVWRQH DQG +/$% P51$ FRQWHQW LQ HDFK RI WKH VXEFHOOXODU IUDFWLRQV ZDV GHWHUPLQHG E\ 1RUWKHUQ EORW DQDO\VLV %ULHIO\ 51$ ZDV H[WUDFWHG IURP WKH VDPSOHV TXDQWLWDWHG DQG HOHFWURSKRUHVHG LQ DJDURVH XQGHU GHQDWXULQJ FRQGLWLRQV 7KH 51$ ZDV WKHQ WUDQVIHUUHG WR QLWURFHOOXORVH ILOWHUV IRU K\EULGL]DWLRQ ZLWK 3ODEHOHG QLFNWUDQVODWHGf S)$ + KLVWRQHf S))& + KLVWRQHf DQG S'322O F'1$ FORQH RI +/$% FODVV DQWLJHQf '1$ SUREHV $ W\SLFDO VFUHHQLQJ RI VXEFHOOXODU IUDFWLRQV ZLWK WKHVH SUREHV LV UHSUHVHQWHG E\ WKH DXWRUDGLRJUDSK LQ )LJXUH DQG 7DEOH VXPPDUL]HV WKH QXPHULFDO YDOXHV GHULYHG IURP GHQVLWRPHWULF DQDO\VLV RI WKH 1RUWKHUQ EORW 7KH +/$% P51$ DQG KLVWRQH P51$ VSHFLHV DUH HDFK SUHVHQW LQ WRWDO FHOOXODU 51$ DQG WRWDO SRO\VRPDO 51$ ZKLFK ZHUH LQFOXGHG DV SRVLWLYH FRQWUROV 1RQPHPEUDQHERXQG SRO\VRPDO 51$ FRQWDLQV DSSUR[LPDWHO\ b DQG b RI WKH WRWDO + DQG + KLVWRQH P51$ UHVSHFWLYHO\ 6XUSULVLQJO\ WKH /(5 IUDFWLRQ FRQWDLQV DSSUR[LPDWHO\ b RI WKH + KLVWRQH P51$ DQG b RI WKH + KLVWRQH P51$ ZKLFK PD\ EH D FRQVHTXHQFH RI WKH PHWKRG E\ ZKLFK WKH IUDFWLRQ LV LVRODWHG 7KH /(5 DQG QRQPHPEUDQHERXQG SRO\VRPDO VDPSOH LV FHQWULIXJHG WKURXJK D 0 VXFURVH SDG XQGHU FRQGLWLRQV ZKHUH WKH /(5 IRUPV D ORRVH EDQG RQ WRS RI WKH SDG ZKLOH WKH QRQPHPEUDQHERXQG SRO\VRPHV DUH SHOOHWHG 7KH /(5 EDQG LV

PAGE 91

UHPRYHG E\ DVSLUDWLRQ DQG RFFDVLRQDOO\ PDWHULDO LV UHPRYHG IURP ZLWKLQ WKH VXFURVH SDG 7KLV PDWHULDO PD\ EH WKH VRXUFH RI KLVWRQH P51$ LQ WKH /(5 IUDFWLRQ ZKLFK FRXOG GHFUHDVH WKH WUXH SHUFHQWDJH RI WRWDO KLVWRQH PHVVDJH IRXQG RQ WKH QRQPHPEUDQHERXQG SRO\VRPHV 7KH +/$% P51$ ZDV ORFDWHG DOPRVW H[FOXVLYHO\ RQ PHPEUDQHERXQG SRO\VRPHV 1HDUO\ b RI WKH +/$% P51$ ZDV FROOHFWLYHO\ IRXQG RQ WKH 15(5 DQG 05(5 ZKLOH OHVV WKDQ b ZDV PHDVXUHG LQ WKH /(5 DQG QRQPHPEUDQHERXQG SRO\VRPDO 51$ IUDFWLRQV +LVWRQH P51$ DQG +/$% P51$ 'LVWULEXWLRQ %HWZHHQ &VN DQG 6RO )UDFWLRQV ([LVWLQJ ZLWKLQ WKH F\WRSODVP RI HXNDU\RWLF FHOOV LV DQ LQWULFDWH QHWZRUN RI SURWHLQ ILODPHQWV ZKLFK LV UHIHUUHG WR DV WKH F\WRVNHOHWRQ 7KLV VWUXFWXUH FDQ EH SUHSDUHG IURP +H/D FHOOV WUHDWHG ZLWK QRQLRQLF GHWHUJHQW DV GHVFULEHG E\ 3HQPDQ DQG FRZRUNHUV &HUYHUD HW DO f :H XVHG WKLV SURFHGXUH IRU WKH LVRODWLRQ RI WKH F\WRVNHOHWRQ &VNf DQG VROXEOH 6ROf IUDFWLRQV ZKLFK ZHUH VXEVHTXHQWO\ DVVD\HG IRU P51$ FRQWHQW E\ 1RUWKHUQ EORW DQDO\VLV /RJ SKDVH VXVSHQVLRQ JURZQ +H/D 6 FHOOV ZHUH IUDFWLRQDWHG LQWR D &VN SKDVH DQG 6RO SKDVH DV GHVFULEHG LQ &KDSWHU $OWKRXJK WKLV IUDFWLRQDWLRQ SURFHGXUH KDV EHHQ FKDUDFWHUL]HG SUHYLRXVO\ /HQN DQG 3HQPDQ f ZH H[DPLQHG WKH SURWHLQ KHWHURJHQHLW\ RI HDFK IUDFWLRQ E\ WZR GLPHQVLRQDO JHO HOHFWURSKRUHVLV DQG LPPXQREORWWLQJ WHFKQLTXHV LQ FROODERUDWLRQ ZLWK 'U :DUUHQ 6FKPLGW $V VHHQ

PAGE 92

)LJXUH 1RUWKHUQ EORW DQDO\VLV RI + KLVWRQH + KLVWRQH DQG +/$% P51$ LQ VXEFHOOXODU IUDFWLRQV 7KH F\WRVNHOHWRQ DQG VROXEOH IUDFWLRQV DV ZHOO DV WKH QRQPHPEUDQHERXQG DQG PHPEUDQHERXQG SRO\VRPDO 51$ IUDFWLRQV ZHUH LVRODWHG IURP +H/D FHOOV E\ WKH SURFHGXUHV GHVFULEHG LQ &KDSWHU &HUYHUD HW DO 9HQNDWHVDQ DQG 6WHHOH f ,Q DGGLWLRQ WRWDO SRO\VRPDO 51$ DQG WRWDO FHOOXODU 51$ ZHUH LVRODWHG 3OXPE HW DO 9HQNDWHVDQ DQG 6WHHOH f 51$ ZDV H[WUDFWHG IURP HDFK VXEFHOOXODU IUDFWLRQ DQG IVT RI 51$ IURP HDFK SUHSDUDWLRQ ZDV UHVROYHG E\ b DJDURVH b IRUPDOGHK\GH JHO HOHFWURSKRUHVLV 7KH 51$ ZDV WUDQVIHUUHG WR QLWURFHOOXORVH DQG K\EULGL]HG WR UDGLRODEHOHG S))& + KLVWRQH DQG S)2$ + KLVWRQHf SUREHV IROORZHG E\ K\EULGL]DWLRQ WR M3ODEHOHG QLFN WUDQVODWHGf S'322O F'1$ RI +/$%f SUREH 7KH K\EULGL]HG ILOWHUV ZHUH WKHQ H[SRVHG WR SUHIODVKHG ;$5 [UD\ ILOP DW r& IRU KRXUV )URP OHIW WR ULJKW ODQHV f WRWDO FHOOXODU 51$" f &VN 51$ f 6RO SKDVH 51$ f 15(5" f 05(5 f QRQPHPEUDQHERXQG SRO\VRPDO 51$" f /(5 DQG f WRWDO SRO\VRPDO 51$

PAGE 94

7DEOH 4XDQWLW\ RI KLVWRQH DQG +/$% P51$V LQ WKH VXEFHOOXODU IUDFWLRQV + + +/$% &\WRVNHOHWRQ b b b 6ROXEOH b b b 15(5 b b b 05(5 b b b )UHH b b b /(5 b b b 7KH GLVWULEXWLRQ RI KLVWRQH DQG +/$% P51$V LQ WKH 15(5 05(5 /(5 DQG QRQPHPEUDQHERXQG SRO\VRPDO IUDFWLRQV DV ZHOO DV WKH F\WRVNHOHWRQ DQG VROXEOH IUDFWLRQV ZDV GHWHUPLQHG E\ 1RUWKHUQ EORW DQDO\VLV 7KH YDOXHV KDYH EHHQ QRUPDOL]HG ZLWK UHVSHFW WR WKH WRWDO \LHOG RI 51$ ZLWKLQ HDFK IUDFWLRQ

PAGE 95

LQ )LJXUH WKH F\WRVNHOHWRQ IUDFWLRQ FOHDUO\ FRQWDLQHG DFWLQ DV ZHOO DV WKH PDMRU +H/D F\WRNHUDWLQV )UDQNH HW DO f ,Q DGGLWLRQ YLPHQWLQ DSSHDUHG WR EH HQULFKHG LQ WKH F\WRVNHOHWRQ ZKLFK ZDV FRQILUPHG E\ LPPXQREORW DQDO\VLV ([WUDFWLRQ RI WKH F\WRVNHOHWRQ UHTXLUHG D FROG FDOFLXP FRQWDLQLQJ EXIIHU DQG FRQVHTXHQWO\ WKH WXEXOLQV ZHUH VROXELOL]HG DQG WKHUHIRUH DEVHQW LQ WKH &VN IUDFWLRQ 7KH WXEXOLQ SURWHLQV ZHUH FOHDUO\ FRQWDLQHG LQ WKH VROXEOH IUDFWLRQ DV GHWHUPLQHG E\ LPPXQREORW DQDO\VLV $GGLWLRQDO VXSSRUW IRU VHSDUDWLRQ RI F\WRVNHOHWRQ DQG VROXEOH SKDVHV FRPHV IURP WKH REVHUYDWLRQ WKDW WKH EXON RI WKH W51$ VSHFLHV LV LQ WKH VROXEOH SKDVH ZKLFK LV LQ DJUHHPHQW ZLWK SUHYLRXVO\ UHSRUWHG YDOXHV GDWD QRW VKRZQ &HUYHUD HW DO f $OWKRXJK WKH +/$% PHVVHQJHU 51$ LV IRXQG RQ PHPEUDQHERXQG SRO\VRPHV DQG WKH KLVWRQH P51$ RQ QRQPHPEUDQHERXQG SRO\VRPHV ERWK VSHFLHV RI PHVVHQJHU 51$V DUH DVVRFLDWHG DOPRVW H[FOXVLYHO\ ZLWK WKH F\WRVNHOHWDO IUDFWLRQ 1HDUO\ b RI WKH +/$% P51$ DQG DSSUR[LPDWHO\ b RI WKH + DQG + KLVWRQH PHVVDJHV DUH UHWDLQHG LQ WKH &VN )LJ 7DEOH f 7KH (IIHFWV RI 0HWDEROLF ,QKLELWRUV RQ WKH 6XEFHOOXODU /RFDOL]DWLRQ RI +LVWRQH DQG +/$% P51$ 'HWHFWDEOH OHYHOV RI KLVWRQH P51$ ZHUH REVHUYHG LQ HDFK RI WKH VXEFHOOXODU VDPSOHV LQFOXGLQJ WKH 6RO IUDFWLRQ DQG WKH PHPEUDQHERXQG SRO\VRPDO IUDFWLRQV +RZHYHU WKH +/$%

PAGE 96

)LJXUH 7ZRGLPHQVLRQDO JHO HOHFWURSKRUHVLV RI FYWRVNHOHWRQ DQG VROXEOH DVVRFLDWHG SURWHLQV +H/D FHOOV ZHUH IUDFWLRQDWHG LQWR D F\WRVNHOHWRQ DQG VROXEOH SKDVH SURWHLQ ZDV H[WUDFWHG IURP HDFK SKDVH DQG VXEVHTXHQWO\ DQDO\]HG E\ WZRGLPHQVLRQDO JHO HOHFWURSKRUHVLV DV GHVFULEHG LQ &KDSWHU 3URWHLQV RI WKH VROXEOH IUDFWLRQ 6ROf $ ZHUH VHSDUDWHG XVLQJ ZLGH UDQJH S+ f DPSKROLQHV ZKLOH F\WRVNHOHWDO SURWHLQV &VNf % ZHUH VHSDUDWHG ZLWK QDUURZ UDQJH S+ f DPSKROLQHV WR PRUH FOHDUO\ LGHQWLI\ F\WRVNHOHWDO VSHFLHV 9 YLPHQWLQ D DFWLQ DQG W WXEXOLQV 8QODEHOHG DUURZV LQ % GHSLFW +H/D F\WRNHUDWLQV RI .G SL f .G SL f .G SL f DQG .G SL f ZKLFK ZHUH VSRWV KLJKO\ UHDFWLYH ZLWK FRPPHUFLDOO\ SUHSDUHG SUHNHUDWLQ RU VWUDWXP FRUQHXP DQWLVHUD )UDQNH HW DO f

PAGE 97

7 7 7 3+ .a 62/ &6.

PAGE 98

P51$ ZDV ORFDWHG DOPRVW H[FOXVLYHO\ LQ WKH F\WRVNHOHWRQ DQG PHPEUDQHERXQG SRO\VRPH IUDFWLRQV 7KH ZLGHVSUHDG VXEFHOOXODU ORFDOL]DWLRQ RI KLVWRQH P51$ PD\ EH GXH WR QRQn VSHFLILF WUDSSLQJ RI QRQPHPEUDQHERXQG SRO\VRPHV LQ HDFK RI WKH IUDFWLRQV GXULQJ WKH LVRODWLRQ SURFHGXUH $OWHUQDWLYHO\ WKLV REVHUYDWLRQ PD\ UHIOHFW WKH SUHVHQFH RI P51$V HQFRGLQJ YDULDQW KLVWRQH SURWHLQV WKDW FRXOG EH WDUJHWHG WR WKH GLIIHUHQW F\WRSODVPLF FRPSDUWPHQWV ,QKLELWLRQ RI '1$ V\QWKHVLV ZLWK K\GUR[\XUHD UHVXOWV LQ D UDSLG GHVWDELOL]DWLRQ RI FHOO F\FOH GHSHQGHQW KLVWRQH P51$V ZKHUHDV FHOO F\FOH LQGHSHQGHQW KLVWRQH P51$V UHPDLQ VWDEOH LQ WKH SUHVHQFH RI WKLV GUXJ %DXPEDFK HW DO +HLQW] HW DO 'H/LVOH HW DO *UDYHV DQG 0DU]OXII 3OXPE HW DO f &RQYHUVHO\ LQKLELWLRQ RI SURWHLQ V\QWKHVLV ZLWK F\FORKH[LPLGH UHVXOWV LQ D IROG LQFUHDVH LQ F\WRSODVPLF OHYHOV RI KLVWRQH P51$V %XWOHU DQG 0XHOOHU %DXPEDFK HW DO f 'LIIHUHQWLDO VHQVLWLYLW\ RI KLVWRQH P51$V LQ WKH VXEFHOOXODU IUDFWLRQV WR K\GUR[\XUHD RU F\FORKH[LPLGH WUHDWPHQW ZRXOG IDYRU WKH ODWWHU VXJJHVWLRQ WKDW FHOO F\FOH GHSHQGHQW DQG LQGHSHQGHQW KLVWRQH JHQH WUDQVFULSWV PD\ VHOHFWLYHO\ UHVLGH LQ VSHFLILF F\WRSODVPLF FRPSDUWPHQWV 7UHDWPHQW RI H[SRQHQWLDOO\ JURZLQJ +H/D FHOOV ZLWK K\GUR[\XUHD DV GHVFULEHG LQ &KDSWHU UHVXOWHG LQ D FRPSOHWH DQG VHOHFWLYH GHVWDELOL]DWLRQ RI KLVWRQH P51$ LQ WKH /(5 QRQPHPEUDQHERXQG DQG PHPEUDQHERXQG SRO\VRPDO

PAGE 99

IUDFWLRQV )LJXUH f 7KLV LV LQ VKDUS FRQWUDVW WR WKH +/$% P51$ ZKLFK DSSHDUHG WR EH IXOO\ VWDEOH XQGHU WKHVH FRQGLWLRQV &\FORKH[LPLGH WUHDWPHQW KDG D VWDELOL]LQJ HIIHFW RQ WKH OHYHOV RI KLVWRQH P51$ LQ HDFK VXEFHOOXODU IUDFWLRQ )LJXUH f :KHQ FRPSDUHG ZLWK FRQWURO +H/D FHOOV F\FORKH[LPLGH WUHDWPHQW UHVXOWHG LQ D IROG +f DQG D IROG +f LQFUHDVH LQ WKH OHYHOV RI KLVWRQH P51$ LQ WKH QRQPHPEUDQHERXQG SRO\VRPDO IUDFWLRQ 6LPLODU LQFUHDVHV ZHUH DOVR VHHQ IRU OHYHOV RI KLVWRQH P51$V LQ WKH /(5 DQG PHPEUDQHERXQG SRO\VRPDO IUDFWLRQV ,QKLELWLRQ RI SURWHLQ V\QWKHVLV ZLWK F\FORKH[LPLGH IROORZHG E\ '1$ V\QWKHVLV LQKLELWLRQ ZLWK K\GUR[\XUHD UHVXOWHG LQ WKH VWDELOL]DWLRQ RI KLVWRQH P51$ LQ HDFK VXEFHOOXODU IUDFWLRQ ZKHUHDV WKH VWDELOLW\ RI +/$% P51$ UHPDLQHG XQDIIHFWHG )LJXUH f 6LPLODU UHVXOWV ZHUH REWDLQHG ZKHQ WKHVH LQKLELWRU VWXGLHV ZHUH H[SDQGHG WR LQFOXGH WKH F\WRVNHOHWRQ DQG VROXEOH IUDFWLRQV )LJXUH f &\FORKH[LPLGH WUHDWPHQW UHVXOWHG LQ D IROG LQFUHDVH LQ WKH UHSUHVHQWDWLRQ RI + DQG + KLVWRQH P51$ RYHU XQWUHDWHG FXOWXUHV LQ ERWK WKH F\WRVNHOHWRQ DQG VROXEOH IUDFWLRQV +/$% P51$ DSSHDUHG WR EH RQO\ PRGHUDWHO\ VWDELOL]HG LQ WKH SUHVHQFH RI WKLV GUXJ :KHQ FHOOV ZHUH WUHDWHG ZLWK K\GUR[\XUHD KLVWRQH P51$ OHYHOV ZHUH JUHDWO\ UHGXFHG LQ ERWK WKH F\WRVNHOHWRQ DQG VROXEOH IUDFWLRQV ZKHUHDV WKH +/$% P51$ ZDV IRXQG LQ FRPSDUDEOH OHYHOV WR WKRVH SUHVHQW LQ WKH XQWUHDWHG VDPSOHV &RQVLVWHQW ZLWK SUHYLRXV GDWD FRWUHDWPHQW RI +H/D FHOOV

PAGE 100

)LJXUH 1RUWKHUQ EORW DQDO\VLV RI + KLVWRQH + KLVWRQH DQG +/$% P51$V LVRODWHG IURP VXEFHOOXODU IUDFWLRQV RI FHOOV WUHDWHG ZLWK PHWDEROLF LQKLELWRUV ([SRQHQWLDOO\ JURZLQJ +H/D FHOOV ZHUH LQFXEDWHG LQ WKH SUHVHQFH RI PHWDEROLF LQKLELWRUV DQG IUDFWLRQDWHG LQWR QRQPHPEUDQHERXQG DQG PHPEUDQHERXQG SRO\VRPHV DV GHVFULEHG LQ &KDSWHU 51$ ZDV H[WUDFWHG IURP HDFK IUDFWLRQ DQG DVVD\HG IRU + KLVWRQH P51$ + KLVWRQH P51$ DQG +/$% P51$ FRQWHQW E\ 1RUWKHUQ EORW DQDO\VLV DV GHVFULEHG LQ )LJXUH DQG &KDSWHU 8SSHU SDQHO IURP OHIW WR ULJKW ODQHV f FRQWURO XQWUHDWHGf QRQPHPEUDQHERXQG SRO\VRPHV f FRQWUR 15(5 f FRQWURO 05(5 f FRQWURO /(5 RPLWWHGf f F\FORKH[LPLGH &\f QRQPHPEUDQHERXQG SRO\VRPHV f &\ 15(5 f &\ 05(5 DQG f &\ /(5 /RZHU SDQHO IURP OHIW WR ULJKW ODQHV f K\GUR[\XUHD +8f QRQPHPEUDQHERXQG SRO\VRPHV f +X 15(5 f +X 05(5 f +X /(5 f &<+8 QRQPHPEUDQHERXQG SRO\VRPHV f &\+X 15(5 f &\+X 05(5 DQG f &\+X /(5

PAGE 101

)5(( 15(5 05(5 /(5 )5(( 15(5 05(5 /(5 &21752/ &<&/2 )5(( 1 5(5 0 5(5 /(5 )5(( 1 5(5 05(5 /(5 L FR U fr /2

PAGE 102

ZLWK F\FORKH[LPLGH DQG K\GUR[\XUHD KDG D VWDELOL]LQJ HIIHFW RQ KLVWRQH P51$ OHYHOV DQG QR DSSDUHQW HIIHFW RQ +/$% P51$ VWDELOLW\ LQ ERWK VXEFHOOXODU IUDFWLRQV 7KHUH ZHUH QR REYLRXV GLIIHUHQFHV LQ WKH VWDELOLW\ RI KLVWRQH P51$V ORFDOL]HG LQ WKH YDULRXV VXEFHOOXODU FRPSDUWPHQWV ZKHQ WUHDWHG ZLWK K\GUR[\XUHD RU F\FORKH[LPLGH ,W LV WKHUHIRUH UHDVRQDEOH WR FRQFOXGH WKDW WKH KLVWRQH P51$ LVRODWHG LQ WKH /(5 DQG PHPEUDQHERXQG IUDFWLRQV LV D FRQVHTXHQFH RI WKH VXEFHOOXODU IUDFWLRQDWLRQ SURFHGXUH 2XU UHVXOWV WDNHQ WRJHWKHU ZLWK SUHYLRXV ILQGLQJV -DFREV/RUHQD HW DO /LDXWDUG DQG -HDQWHXU *DOOZLW] DQG %UHLQGO %RUXQ HW DO 6WHLQ HW DO f VXJJHVW WKDW KLVWRQH P51$V GXULQJ QRUPDO FHOOXODU SURFHVVLQJ DUH WDUJHWHG WR WKH QRQPHPEUDQHERXQG SRO\VRPHV WKH FRPPRQ VLWH RI KLVWRQH SURWHLQ V\QWKHVLV ',6&866,21 2XU REMHFWLYHV LQ SXUVXLQJ WKHVH VWXGLHV ZHUH WZRIROG 7KH ILUVW ZDV WR FRQILUP WKDW KLVWRQH SURWHLQV DUH V\QWKHVL]HG RQ QRQPHPEUDQHERXQG SRO\VRPHV 7KH VHFRQG ZDV WR GHWHUPLQH LI WKH KLVWRQH P51$FRQWDLQLQJ SRO\VRPHV DUH DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ 2XU UDWLRQDOH IRU WKLV DSSURDFK ZDV WR EHJLQ DGGUHVVLQJ WKH TXHVWLRQV ZKHWKHU WKH VXEFHOOXODU ORFDWLRQ RI KLVWRQH FRQWDLQLQJ SRO\VRPHV FRQWULEXWHV WR Df WKH DELOLW\ RI KLVWRQH P51$V WR EH WUDQVODWHG LPPHGLDWHO\ IROORZLQJ WUDQVFULSWLRQ Ef WKH UDSLG

PAGE 103

)LJXUH 1RUWKHUQ EORW DQDO\VLV RI + KLVWRQH + KLVWRQH DQG +/$% P51$V DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ DQG VROXEOH IUDFWLRQV IURP +H/D FHOO WUHDWHG ZLWK PHWDEROLF LQKLELWRUV ([SRQHQWLDOO\ JURZLQJ +H/D FHOOV ZHUH LQFXEDWHG LQ WKH SUHVHQFH RI PHWDEROLF LQKLELWRUV DQG IUDFWLRQDWHG LQWR F\WRVNHOHWRQ DQG VROXEOH IUDFWLRQV DV GHVFULEHG LQ &KDSWHU 51$ ZDV H[WUDFWHG DQG DVVD\HG IRU + KLVWRQH + KLVWRQH DQG +/$% P51$ FRQWHQW E\ 1RUWKHUQ EORW DQDO\VLV DV GHVFULEHG LQ )LJXUH )URP OHIW WR ULJKW ODQHV f FRQWURO &VN f FRQWURO 6RO ` F\FORKH[LPLGH &\f &VN f &\6RO f K\GUR[\XUHD +8f &VN f +8 6RO f &\+8 &VN DQG f &\+8 6RO

PAGE 104

,W W +/$% &6. I  62/ &6. 62/ &6. 62/ &6. 62/ N2 UVM

PAGE 105

VKXWWOLQJ RI QHZO\ V\QWKHVL]HG KLVWRQH SRO\SHSWLGHV LQWR WKH QXFOHXV DQG Ff KLVWRQH P51$ VWDELOLW\ ,Q DJUHHPHQW ZLWK ORQJVWDQGLQJ LQ YLWUR WUDQVODWLRQ DQG F'1$ K\EULGL]DWLRQ UHVXOWV -DFREV/RUHQD HW DO /LDXWDUG DQG -HDQWHXU *DOOZLW] DQG %ULHQGO %RUXQ HW DO 6WHLQ HW DO f ZH ILQG WKDW KLVWRQH P51$V UHVLGH SUHGRPLQDQWO\ RQ QRQPHPEUDQHERXQG SRO\VRPHV :KLOH ZH FDQQRW GLVPLVV WKH SRVVLELOLW\ WKDW WKH DPRXQWV RI KLVWRQH P51$V GHWHFWHG LQ PHPEUDQHERXQG SRO\VRPDO VXEFHOOXODU IUDFWLRQV DUH ELRORJLFDOO\ VLJQLILFDQW VHH )LJXUHV DQG f ZH IHHO WKDW WKLV LV D FRQVHTXHQFH RI WKH LVRODWLRQ SURFHGXUH ZKLFK RSHUDWLRQDOO\ GHILQHV WKH IUDFWLRQ REWDLQHG 7KH DEVHQFH RI GHWHFWDEOH +/$% P51$V RQ QRQPHPEUDQHERXQG SRO\VRPHV VXJJHVWV WKDW ZKLOH P51$V HQFRGLQJ LQWUDFHOOXODU SURWHLQV PD\ EH WUDSSHG E\ WKH HQGRSODVPLF UHWLFXOXP GXULQJ WKLV VXEFHOOXODU IUDFWLRQDWLRQ WHFKQLTXH WKHUH LV OLWWOH LI DQ\ VWULSSLQJ RI PHPEUDQHERXQG SRO\VRPHV HQFRGLQJ H[WUDFHOOXODU SRO\SHSWLGHV VXFK DV WKH +/$% FODVV DQWLJHQ :LWKLQ WKLV FRQWH[W WKH TXHVWLRQ DULVHV ZKHWKHU WKH WUDQVFULSWV IURP KLVWRQH JHQHV WKDW DUH QRW H[SUHVVHG LQ D FHOO F\FOH GHSHQGHQW PDQQHU DSSUR[LPDWHO\ bf DUH UHSUHVHQWHG RQ PHPEUDQHERXQG SRO\VRPHV +RZHYHU WKLV LV QRW D OLNHO\ SRVVLELOLW\ EHFDXVH LQKLELWLRQ RI '1$ UHSOLFDWLRQ ZLWK K\GUR[\XUHD EULQJV DERXW D FRPSDUDEOH GHJUDGDWLRQ RI KLVWRQH P51$V LQ DOO WKH VXEFHOOXODU IUDFWLRQV H[DPLQHG

PAGE 106

7KH DVVRFLDWLRQ RI KLVWRQH P51$V ZLWK WKH F\WRVNHOHWRQ )LJXUH f LV FRQVLVWHQW ZLWK VWXGLHV FDUULHG RXW E\ 3HQPDQ DQG FRZRUNHUV LQ ZKLFK WKH\ H[DPLQHG WKH VXEFHOOXODU ORFDOL]DWLRQ RI YHVLFXODU VWRPDWLWLV YLUXV 969f P51$V LQ +H/D FHOOV IROORZLQJ YLUDO LQIHFWLRQ &HUYHUD HW DO f 7KHVH LQYHVWLJDWRUV REVHUYHG WKDW LQ 969LQIHFWHG +H/D FHOOV ERWK WKH YLUDO P51$ FRGLQJ IRU WKH YLUDO JO\FRSURWHLQ DQG WKH QRQPHPEUDQHERXQG SRO\VRPDO YLUDO P51$V ZHUH DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ :KLOH WKH VSHFLILF QDWXUH RI WKH DVVRFLDWLRQ RI SRO\VRPHV ZLWK WKH F\WRVNHOHWRQ UHPDLQV WR EH GHILQLWLYHO\ HVWDEOLVKHG WKH DELOLW\ WR UHOHDVH ULERVRPHV DQG UHWDLQ P51$V RQ WKH F\WRVNHOHWRQ VXJJHVWV WKDW WKHUH PD\ EH D GLUHFW DWWDFKPHQW RI P51$V WR WKH F\WRVNHOHWRQ /HQN HW DO /HQN DQG 3HQPDQ /HPLHX[ DQG %HDXG f ,W LV WKHUHIRUH UHDVRQDEOH WR VSHFXODWH WKDW WKH DVVRFLDWLRQ RI P51$V ZLWK WKH F\WRVNHOHWRQ SOD\V D IXQFWLRQDO UROH LQ SURWHLQ V\QWKHVLV DQGRU LQ WKH UHJXODWLRQ RI P51$ VWDELOLW\ 7KLV LV D SDUWLFXODUO\ DWWUDFWLYH SRVVLELOLW\ EHFDXVH WKH DVVRFLDWLRQ RI KLVWRQH P51$V ZLWK WKH F\WRVNHOHWRQ FRXOG SHUPLW WKH FRPSDUWPHQWDOL]DWLRQ RI KLVWRQH P51$FRQWDLQLQJ SRO\VRPHV LQ D SDUWLFXODU UHJLRQ RI WKH F\WRSODVP 7KH SRWHQWLDO IRU FRPSDUWPHQWDOL]DWLRQ DIIRUGHG E\ WKH F\WRVNHOHWRQ PD\ DOVR EH UHODWHG WR WKH UDSLG DQG VHOHFWLYH GHVWDELOL]DWLRQ RI KLVWRQH P51$V DW WKH QDWXUDO HQG RI 6 SKDVH RU IROORZLQJ LQKLELWLRQ RI '1$ V\QWKHVLV

PAGE 107

$V ZLWK WKH SURWRFRO XWLOL]HG WR VHSDUDWH QRQPHPEUDQH ERXQG DQG PHPEUDQHERXQG SRO\VRPHV WKH F\WRVNHOHWRQ SUHSDUDWLRQ REWDLQHG PXVW EH RSHUDWLRQDOO\ GHILQHG :KLOH WKLV GRHV QRW QHFHVVDULO\ GHWUDFW IURP WKH ELRORJLFDO UHOHYDQFH GLIIHUHQFHV LQ F\WRVNHOHWRQ SUHSDUDWLRQV DUH XQGRXEeHGO\ UHIOHFWHG LQ WKH ELRFKHPLFDO FRPSRVLWLRQ RI WKH LVRODWHG FRPSOH[ $GGLWLRQDO FKDUDFWHUL]DWLRQ RI WKH F\WRVNHOHWRQ SUHSDUDWLRQ ZLWK UHVSHFW WR SRVVLEOH YDULDWLRQV LQ UHJLRQV RI WKH FRPSOH[ PD\ SURYLGH LQVLJKW LQWR PHFKDQLVPV E\ ZKLFK VSHFLILF P51$V PD\ EH ORFDOL]HG DQG WKHLU IXQFWLRQDO SURSHUWLHV VHOHFWLYHO\ PRGXODWHG

PAGE 108

&+$37(5 68%&(//8/$5 /2&$7,21 2) +,6721( P51$ 3/$<6 $ 52/( ,1 7+( 326775$16&5,37,21$/ 5(*8/$7,21 2) +,6721( *(1( (;35(66,21 ,QWURGXFWLRQ 7KH DVVRFLDWLRQ RI KLVWRQH P51$FRQWDLQLQJ QRQPHPEUDQH ERXQG SRO\VRPHV ZLWK WKH F\WRVNHOHWRQ PD\ SURYLGH D VWUXFWXUDO EDVLV IRU WKH ORFDOL]DWLRQ RI WKH P51$ LQ VSHFLILF UHJLRQV RI WKH F\WRSODVPr &RQVLVWHQW ZLWK WKLV UHDVRQLQJ WKH IDFWRUV WKDW PHGLDWH WKH UDSLG DQG VHOHFWLYH GHVWDELOL]DWLRQ RI KLVWRQH P51$ GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV PD\ EH FRORFDOL]HG ZLWK WKH PHVVDJH LQ WKH VDPH VXEFHOOXODU FRPSDUWPHQW 7KHUHIRUH WKH VXEFHOOXODU ORFDOL]DWLRQ RI KLVWRQH P51$ PD\ SOD\ DQ LPSRUWDQW UROH LQ LWV SRVWWUDQVFULSWLRQDO UHJXODWLRQ ,Q WKLV FKDSWHU ZH GHVFULEH D ELRORJLFDO DSSURDFK XVLQJ D VHULHV RI VLJQDO SHSWLGHKLVWRQH IXVLRQ JHQHV WR VWXG\ ZKHWKHU WKH VXEFHOOXODU ORFDWLRQ RI KLVWRQH P51$ FRQWDLQLQJ SRO\VRPHV LV IXQFWLRQDOO\ UHODWHG WR WKH FRXSOLQJ RI KLVWRQH P51$ VWDELOLW\ ZLWK '1$ UHSOLFDWLRQ ,Q RUGHU WR VWXG\ WKH LQIOXHQFH RI VXEFHOOXODU ORFDWLRQ RQ KLVWRQH P51$ VWDELOLW\ ZH FRQVWUXFWHG D VLJQDO SHSWLGHKLVWRQH JHQH ZKLFK ZDV GHVLJQHG WR WDUJHW WKH HQFRGHG IXVLRQ PHVVDJH WR

PAGE 109

PHPEUDQHERXQG SRO\VRPHV 7KH DELOLW\ RI WKH FHOO WR VHOHFWLYHO\ UHFRJQL]H DQG GHVWDELOL]H KLVWRQH P51$ LQ D IRUHLJQ VXEFHOOXODU FRPSDUWPHQW FRXOG WKHQ EH H[DPLQHG %DVHG RQ WKH GDWD SUHVHQWHG KHUH ZH SURSRVH WKDW WKH VXEFHOOXODU ORFDWLRQ RI KLVWRQH P51$ ZLWK UHVSHFW WR WKH FODVV RI SRO\VRPHV LQ ZKLFK WKH\ DUH DVVRFLDWHG ZLWK SOD\V D VLJQLILFDQW UROH LQ WKH FRXSOLQJ RI KLVWRQH P51$ VWDELOLW\ ZLWK '1$ UHSOLFDWLRQ 5HVXOWV 7KH FRQVWUXFWLRQ RI WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ JHQH LV GHVFULEHG LQ &KDSWHU DQG RXWOLQHG LQ )LJXUH 7KH XSVWUHDP IODQNLQJ UHJLRQ RI WKH FKLPHULF JHQH FRQWDLQV EDVH SDLUV RI WKH n UHJXODWRU\ VHTXHQFHV RI WKH FHOO F\FOHGHSHQGHQW KXPDQ + KLVWRQH JHQH S67 LQFOXGLQJ WKH 7$7$$ DQG &&$$7 FRQVHQVXV VHTXHQFHV 7KLV UHJLRQ LV IROORZHG E\ WKH + P51$ FDS VLWH DQG VHTXHQFHV HQFRGLQJ WKH LQLWLDO QXFOHRWLGHV RI WKH QRQWUDQVODWHG + KLVWRQH OHDGHU 7KH IXVLRQ JHQH LV WKHUHIRUH XQGHU WUDQVFULSWLRQDO FRQWURO RI WKH + KLVWRQH JHQH SURPRWHU DQG D VHJPHQW RI WKH + OHDGHU ZKLFK KDV EHHQ LPSOLFDWHG LQ WKH FRXSOLQJ RI KLVWRQH P51$ OHYHOV WR '1$ V\QWKHVLV LV SUHVHQW 0RUULV HW DO f 7KH + KLVWRQH OHDGHU VHJPHQW LV IXVHG WR WKH XQWUDQVODWHG OHDGHU VHTXHQFHV RI WKH EHWDODFWDPDVH VLJQDO SHSWLGH LQFOXGLQJ WKH $7* WUDQVODWLRQ VWDUW FRGRQ 7KH + KLVWRQH VWUXFWXUDO JHQH LV IXVHG LQ IUDPH WR WKH VLJQDO SHSWLGH

PAGE 110

FRGLQJ VHTXHQFHV DQG H[WHQGV DSSUR[LPDWHO\ EDVH SDLUV EH\RQG WKH 7$$ WUDQVODWLRQ VWRS FRGRQ LQFOXGLQJ D UHJLRQ ZKLFK KDV EHHQ LPSOLFDWHG LQ KLVWRQH P51$ GHVWDELOL]DWLRQ ZKHQ '1$ V\QWKHVLV LV LQKLELWHG /XVFKHU HW DO 3DQGH\ DQG 0DU]OXII *UDYHV HW DO f $Q 69 HQKDQFHU HOHPHQW ZDV LQFRUSRUDWHG LQWR WKH XSVWUHDP (FR5, VLWH LQ WKH UHFRPELQDQW SODVPLG WR LQFUHDVH FHOOXODU OHYHOV RI WKH IXVLRQ WUDQVFULSW 7KH P51$ HQFRGHG E\ WKH IXVLRQ JHQH FRQVLVWV RI WKH ILUVW QXFOHRWLGHV RI WKH + KLVWRQH n OHDGHU VHTXHQFHV IROORZHG E\ WKH XQWUDQVODWHG OHDGHU VHTXHQFH RI WKH EHWDODFWDPDVH VLJQDO SHSWLGH WKH HQWLUH EHWDODFWDPDVH VLJQDO SHSWLGH FRGLQJ VHTXHQFHV LQFOXGLQJ WKH WUDQVODWLRQ VWDUW FRGRQf WKH HQWLUH + KLVWRQH FRGLQJ UHJLRQ ZKLFK LV IXVHG LQ IUDPH WR WKH VLJQDO SHSWLGH FRGLQJ UHJLRQ DQG WKH + KLVWRQH n XQWUDQVODWHG UHJLRQ )LJXUH f 7KH MXQFWLRQ EHWZHHQ WKH VLJQDO SHSWLGH FRGLQJ UHJLRQ DQG WKH + KLVWRQH FRGLQJ UHJLRQ KDV EHHQ VHTXHQFHG E\ 6DQJHUnV GLGHR[\ PHWKRG DQG WKH UHDGLQJ IUDPH KDV EHHQ FRQVHUYHG $OO VHTXHQFHV UHTXLUHG IRU WKH V\QWKHVLV DQG SURFHVVLQJ RI WKH FKLPHULF P51$ DV ZHOO DV IRU WUDQVODWLRQ RI WKH IXVLRQ SURWHLQ DUH SUHVHQW 7KH VLJQDO SHSWLGH+ KLVWRQH IXVLRQ JHQH ZLWK D VLQJOH 69 HQKDQFHU HOHPHQW LV GHVLJQDWHG S63+(O DQG DQ LGHQWLFDO IXVLRQ FRQVWUXFW FRQWDLQLQJ PXOWLSOH 69 HQKDQFHU HOHPHQWV LQ WKH (FR5, VLWH LV GHVLJQDWHG S63+(

PAGE 111

)LJXUH 6FKHPDWLF GLDJUDP RI HQGRJHQRXV + KLVWRQH P51$ 67 DQG WKH EHWDODFWDPDVH VLJQDO SHSWLGH+ KLVWRQH IXVLRQ P51$ 7KH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ LV LGHQWLFDO WR WKH ZLOG W\SH KLVWRQH P51$ ZLWK WKH H[FHSWLRQ RI WKH VLJQDO SHSWLGH HQFRGHG VHTXHQFHV WKDW KDYH EHHQ LQVHUWHG LQ IUDPH LQWR WKH KLVWRQH JHQH 7KH r P51$ VHTXHQFHV DQG WKH n P51$ VHTXHQFHV WKDW KDYH EHHQ LPSOLFDWHG LQ FRXSOLQJ KLVWRQH P51$ VWDELOLW\ WR '1$ V\QWKHVLV DUH UHWDLQHG LQ SODFH LQ WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ 0RUULV HW DO 3DQGH\ DQG 0DU]OXII f %R[HG DUHDV UHSUHVHQW KLVWRQH + P51$ VHTXHQFHV VLQJOH OLQHG DUHDV UHSUHVHQW EHWDODFWDPDVH VLJQDO SHSWLGH GHULYHG VHTXHQFHV

PAGE 112

&$3 $7* 7$$ n > n S67 &$3 $7* LU/ DJ 7$$ L S63+(

PAGE 113

7R WHVW IRU H[SUHVVLRQ RI WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ JHQH LQ KXPDQ FHOOV ZH WUDQVIHFWHG S63+(O DQG S63+( '1$ LQWR +H/D FHOO PRQROD\HUV E\ WKH FDOFLXP SKRVSKDWH SUHFLSLWDWLRQ PHWKRG DV GHVFULEHG LQ &KDSWHU *RUPDQ HW DO *UDKDP DQG YDQ GHU (E f )RUW\ VL[ KRXUV SRVWWUDQVIHFWLRQ FHOOV ZHUH KDUYHVWHG DQG WRWDO FHOOXODU 51$ ZDV LVRODWHG 7KH 51$ ZDV VXEMHFWHG WR 6, QXFOHDVH SURWHFWLRQ DQDO\VLV E\ D PRGLILFDWLRQ RI %HUN DQG 6KDUS f 7KH SUREH XVHG LQ WKH 6, QXFOHDVH DVVD\V ZDV WKH 6PDO IUDJPHQW IURP S63+(O ZKLFK ZDV UDGLRODEHOHG DW LWV n WHUPLQL DV GHVFULEHG LQ &KDSWHU 7KH SUREH LV FRPSOLPHQWDU\ WR HQGRJHQRXV +H/D KLVWRQH + P51$ IURP WKH r HQGODEHOHG 6PDO VLWH ZLWKLQ WKH SURWHLQ FRGLQJ UHJLRQ WR WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ MXQFWLRQ DQG WKHUHIRUH SURWHFWV D QXFOHRWLGH UHJLRQ RI WKH + P51$ IURP 6, QXFOHDVH GLJHVWLRQ $V VHHQ LQ )LJXUH ZKHQ WRWDO FHOOXODU 51$ IURP WZR LQGHSHQGHQW WUDQVIHFWLRQV RI +H/D FHOOV ZLWK S63+(O RU S63+( '1$ ZDV DQDO\]HG E\ 6, QXFOHDVH GLJHVWLRQ D QXFOHRWLGH IUDJPHQW FRUUHVSRQGLQJ WR HQGRJHQRXV + KLVWRQH P51$ ZDV SURWHFWHG DV ZHOO DV DQ DSSUR[LPDWHO\ QXFOHRWLGH IUDJPHQW FRUUHVSRQGLQJ WR WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ VSHFLHV ODQHV f ,Q +H/D FHOOV WUDQVIHFWHG ZLWK VDOPRQ VSHUP '1$ RQO\ WKH QXFOHRWLGH IUDJPHQW ZDV GHWHFWHG ODQHV DQG f 7KHVH GDWD GHPRQVWUDWH WKDW WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ JHQH LV FDSDEOH RI H[SUHVVLRQ LQ +H/D FHOOV DQG WKDW WKH P51$

PAGE 114

)LJXUH ([SUHVVLRQ RI WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ JHQH LQ +H/D FHOOV 7KH H[SUHVVLRQ RI WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ JHQH ZDV WHVWHG LQ D VKRUW WHUP WUDQVLHQW DVVD\ DQG DQDO\]HG E\ DQ 6, QXFOHDVH SURWHFWLRQ DVVD\ +H/D FHOO PRQROD\HUV ZHUH WUDQVIHFWHG ZLWK ILT '1$ DFFRUGLQJ WR *RUPDQ HW DO f LQ D FDOFLXP SKRVSKDWH'1$ FRPSOH[ SUHSDUHG DV GHVFULEHG E\ *UDKDP DQG YDQ GHU (E f 7KH WUDQVIHFWHG FHOOV ZHUH LQFXEDWHG DW r& b & IRU KRXUV IROORZLQJ WUDQVIHFWLRQ 7KH FHOOV ZHUH WKHQ KDUYHVWHG WRWDO FHOOXODU 51$ ZDV LVRODWHG DQG DQDO\]HG E\ 6, QXFOHDVH SURWHFWLRQ DVVD\ 51$ SHU VDPSOHf DV GHVFULEHG LQ &KDSWHU /DQHV DQG +H/D FHOOV WUDQVIHFWHG ZLWK VDOPRQ VSHUP '1$" ODQHV DQG +H/D FHOOV WUDQVIHFWHG ZLWK S63+(O '1$ DQG ODQHV DQG +H/D FHOOV WUDQVIHFWHG ZLWK S63+( '1$ 0DUNHU ODQHV 0f DUH UDGLRODEHOHG +LQIO GLJHVWV RI S%5 '1$ (DFK ODQH UHSUHVHQWV 51$ LVRODWHG IURP DQ LQGHSHQGHQWO\ WUDQVIHFWHG FHOO FXOWXUH

PAGE 115

,,, ] ] &2 4 D ; D Q Y! f 9f D HJ 288L 8&2 &2 &2 U ; ; D D &/ f D &2 D D R D 0 +<%5,' + P51$ (1'2*(1286 +P51$

PAGE 116

WUDQVFULEHG IURP WKLV JHQH LV VXIILFLHQWO\ VWDEOH WR EH GHWHFWHG LQ D VKRUWWHUP WUDQVLHQW WUDQVIHFWLRQ DVVD\ 7R GHWHUPLQH WKH FODVV RI SRO\VRPHV ZLWK ZKLFK WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$V DUH DVVRFLDWHG +H/D FHOOV ZHUH WUDQVIHFWHG ZLWK S63+(O DQG KRXUV ODWHU QRQPHPEUDQHERXQG DQG PHPEUDQHERXQG SRO\VRPHV ZHUH LVRODWHG DV GHVFULEHG LQ &KDSWHU 51$ ZDV LVRODWHG IURP ERWK FODVVHV RI SRO\VRPHV DQG DQDO\]HG E\ 6, QXFOHDVH SURWHFWLRQ DVVD\ XVLQJ WKH 6PDO IUDJPHQW RI WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ JHQH 3 ODEHOHGf $V VHHQ LQ )LJXUH DSSUR[LPDWHO\ b RI WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ ZDV IRXQG LQ WKH QRQPHPEUDQHERXQG SRO\VRPH IUDFWLRQ DQG DSSUR[LPDWHO\ b ZDV DVVRFLDWHG ZLWK WKH PHPEUDQHERXQG SRO\VRPHV ODQHV DQG UHVSHFWLYHO\f 7KLV LV LQ FRQWUDVW WR HQGRJHQRXV + KLVWRQH P51$ ZKLFK LV UHSUHVHQWHG E\ DSSUR[LPDWHO\ b LQ WKH QRQPHPEUDQHERXQG SRO\VRPH DQG b LQ WKH PHPEUDQHERXQG SRO\VRPH IUDFWLRQ 7KH SHUFHQW GLVWULEXWLRQ RI WKH KLVWRQH FKLPHULF P51$ ZLWKLQ WKH SRO\VRPDO 51$ IUDFWLRQV ZDV GHWHUPLQHG E\ GHQVLWRPHWULF DQDO\VLV RI WKH DXWRUDGLRJUDPV DQG WKH YDOXHV FRUUHFWHG IRU WKH WRWDO \LHOG RI 51$ LQ HDFK VXEFHOOXODU IUDFWLRQ :KLOH WKH H[WHQW WR ZKLFK WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ LV UHSUHVHQWHG RQ WKH PHPEUDQHERXQG SRO\VRPHV YDULHG IURP H[SHULPHQW WR H[SHULPHQW ZH DOZD\V REVHUYHG b RI WKH IXVLRQ P51$ LQ WKH PHPEUDQHERXQG SRO\VRPH IUDFWLRQ Q f

PAGE 117

)LJXUH 7KH VXEFHOOXODU ORFDOL]DWLRQ RI WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ +H/D FHOO PRQROD\HUV ZHUH WUDQVIHFWHG ZLWK S63+(O DQG FXOWXUHG DV GHVFULEHG LQ &KDSWHU )RUW\VL[ KRXUV DIWHU WUDQVIHFWLRQ FHOO FXOWXUHV ZHUH KDUYHVWHG DQG QRQPHPEUDQH ERXQG DQG PHPEUDQHERXQG SRO\VRPHV ZHUH LVRODWHG 7KH 51$V IURP WKHVH IUDFWLRQV ZHUH DQDO\]HG E\ WKH 6, QXFOHDVH SURWHFWLRQ DVVD\ J 51$ SHU VDPSOHf 7KH GLVWULEXWLRQ RI P51$ VSHFLHV ZLWKLQ WKH VXEFHOOXODU IUDFWLRQV ZDV TXDQWLWDWHG E\ VFDQQLQJ ODVHU GHQVLWRPHWULF DQDO\VLV RI WKH DXWRUDGLRJUDPV /DQHV f S%5 +LQIO PROHFXODU ZHLJKW PDUNHU f QRQPHPEUDQHERXQG SRO\VRPD 51$ DQG f PHPEUDQH ERXQG SRO\VRPDO 51$

PAGE 118

/8 /8 &2 && //  )86,21 P51$

PAGE 119

7KH DELOLW\ WR GLUHFW D FHOO F\FOHGHSHQGHQW KLVWRQH P51$ WR PHPEUDQHERXQG SRO\VRPHV SURYLGHG WKH SRVVLELOLW\ WR DGGUHVV WKH LQYROYHPHQW RI VXEFHOOXODU ORFDWLRQ LQ WKH FRXSOLQJ RI KLVWRQH P51$ VWDELOLW\ ZLWK '1$ UHSOLFDWLRQ $V VHHQ LQ )LJXUH ODQHV f HQGRJHQRXV KLVWRQH P51$ OHYHOVZHUH UHGXFHG E\ JUHDWHU WKDQ b DV GHWHUPLQHG E\ GHQVLWRPHWULF DQDO\VLV RI WKH DXWRUDGLRJUDP LQ +H/D FHOOV IROORZLQJ LQKLELWLRQ RI '1$ UHSOLFDWLRQ E\ WUHDWPHQW ZLWK P0 K\GUR[\XUHD IRU PLQXWHV ,Q FRQWUDVW LQKLELWLRQ RI '1$ UHSOLFDWLRQ E\ K\GUR[\XUHD WUHDWPHQW GRHV QRW UHVXOW LQ D UHGXFWLRQ RI IXVLRQ PHVVDJH OHYHOV RQ PHPEUDQHERXQG SRO\VRPHV ODQH f 7KH ILQGLQJ WKDW WKH VLJQDO SHSWLGH KLVWRQH IXVLRQ P51$ LV VWDEOH IROORZLQJ '1$ V\QWKHVLV LQKLELWLRQ LV IXUWKHU VXSSRUWHG E\ WKH 6, QXFOHDVH DQDO\VLV RI WRWDO FHOOXODU 51$ )LJXUH f 7KH HQGRJHQRXV KLVWRQH P51$ OHYHOV LQ K\GUR[\XUHD WUHDWHG +H/D FHOOV ZHUH UHGXFHG E\ DSSUR[LPDWHO\ b FRPSDUHG ZLWK WKRVH LQ XQWUHDWHG +H/D FHOOV ODQHV f ZLWK HDFK ODQH UHSUHVHQWLQJ DQ LQGHSHQGHQW WUDQVIHFWHG FHOO FXOWXUHf ,Q FRQWUDVW RQO\ D b UHGXFWLRQ LQ IXVLRQ P51$ OHYHOV ZDV PHDVXUHG ODQHV f 7KHVH UHVXOWV GHPRQVWUDWH WKDW WKH LQFRUSRUDWLRQ RI WKH ( FROL EHWDODFWDPDVH VLJQDO SHSWLGH LQWR D KXPDQ + KLVWRQH JHQH LV VXIILFLHQW WR WDUJHW WKH HQFRGHG IXVLRQ P51$ WR WKH PHPEUDQHERXQG SRO\VRPHV DQG WR FRQIHU VWDELOLW\ WR WKH IXVLRQ PHVVDJH ZKHQ '1$ V\QWKHVLV LV LQKLELWHG

PAGE 120

)LJXUH 7KH VWDELOLW\ RI WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ IROORZLQJ LQKLELWLRQ RI '1$ V\QWKHVLV +H/D FHOO PRQROD\HUV ZHUH WUDQVIHFWHG ZLWK S63+(O '1$ DQG FXOWXUHG DV GHVFULEHG LQ &KDSWHU )RUW\VL[ KRXUV DIWHU WUDQVIHFWLRQ KDOI RI WKH WUDQVIHFWHG +H/D FHOO FXOWXUHV ZHUH WUHDWHG ZLWK P0 K\GUR[\XUHD LQ FRPSOHWHG PHGLXP IRU KRXU DW r& b & &HOO FXOWXUHV ZHUH KDUYHVWHG DQG QRQPHPEUDQHERXQG DQG PHPEUDQHERXQG SRO\VRPHV ZHUH LVRODWHG 7RWDO FHOOXODU 51$ IURP ERWK WKH FRQWURO DQG K\GUR[\XUHDWUHDWHG VDPSOHV ZDV DOVR LVRODWHG 7KH 51$ ZDV DQDO\]HG E\ WKH 6, QXFOHDVH SURWHFWLRQ DVVD\ DV GHVFULEHG LQ &KDSWHU XVLQJ QT 51$ SHU VDPSOH 7KH GLVWULEXWLRQ RI P51$ VSHFLHV ZLWKLQ WKH VXEFHOOXODU IUDFWLRQV ZDV TXDQWLWDWHG E\ GHQVLWRPHWULF DQDO\VLV RI WKH DXWRUDGLRJUDPV /DQHV f FRQWURO XQWUHDWHG FHOOVf QRQPHPEUDQHERXQG SRO\VRPHV f FRQWURO PHPEUDQHERXQG SRO\VRPHV f K\GUR[\XUHD QRQPHPEUDQHERXQG SRO\VRPHV f K\GUR[\XUHD PHPEUDQHERXQG SRO\VRPHV f DQG f FRQWURO WRWDO FHOOXODU 51$ DQG f DQG f K\GUR[\XUHD WRWDO FHOOXODU 51$ /DQHV UHSUHVHQW 51$ LVRODWHG IURP LQGHSHQGHQWO\ WUDQVIHFWHG FHOO FXOWXUHV

PAGE 121

+<%5,' +P51$ (1'2*(1286 + P51$

PAGE 122

,W ZDV SRVVLEOH WKDW WKH VWDELOLW\ RI WKH KLVWRQH IXVLRQ P51$ GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV ZDV GXH WR WKH WDUJHWLQJ RI WKH P51$ WR D IRUHLJQ VXEFHOOXODU FRPSDUWPHQW QDPHO\ WKH PHPEUDQHERXQG SRO\VRPHV $OWHUQDWLYHO\ WKH QXFOHRWLGH VHTXHQFHV FRGLQJ IRU WKH VLJQDO SHSWLGH PD\ KDYH GLVUXSWHG WKH KLVWRQH P51$ VWUXFWXUH LQ VXFK D ZD\ WKDW LW ZDV QR ORQJHU UHFRJQL]HG E\ WKH IDFWRUV LQYROYHG LQ WKH GHVWDELOL]DWLRQ RI KLVWRQH P51$ 7R WHVW WKHVH SRVVLELOLWLHV WKH VLJQDO SHSWLGH ZDV PXWDWHG LQ RUGHU WR UHWDLQ WKH IXVLRQ P51$ ZLWKRXW VLJQLILFDQWO\ FKDQJLQJ WKH P51$ VWUXFWXUH RQ QRQPHPEUDQHERXQG SRO\VRPHV ,I WKH FODVV RI SRO\VRPHV SOD\V D UROH LQ WKH FRXSOLQJ RI KLVWRQH P51$ VWDELOLW\ ZLWK '1$ UHSOLFDWLRQ WKHQ WKH PXWDWHG IXVLRQ P51$V WKDW DUH UHWDLQHG RQ QRQPHPEUDQHERXQG SRO\VRPHV VKRXOG EH HIILFLHQWO\ GHVWDELOL]HG GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV &RQYHUVHO\ LI WKH P51$ VWUXFWXUH KDV EHHQ GLVUXSWHG E\ WKH QXFOHRWLGH VHTXHQFHV HQFRGLQJ WKH VLJQDO SHSWLGH WKHQ WKH PXWDWHG KLVWRQH IXVLRQ P51$V ORFDOL]HG RQ QRQPHPEUDQHERXQG SRO\VRPHV VKRXOG EH VWDEOH GXULQJ LQKLELWLRQ '1$ V\QWKHVLV 7KH VLJQDO SHSWLGHKLVWRQH IXVLRQ JHQH ZDV PXWDWHG E\ VLWH GLUHFWHG PXWDJHQHVLV =ROOHU DQG 6PLWK f DV GHVFULEHG LQ &KDSWHU DQG WKH FRUUHVSRQGLQJ P51$V DUH VFKHPDWLFDOO\ GLDJUDPPHG LQ )LJXUH 7KH ILUVW PXWDQW S63+(ODOSKD FRQWDLQV WZR SRLQW PXWDWLRQV LQ WKH UHJLRQ FRGLQJ IRU WKH K\GURSKRELF GRPDLQ RI WKH VLJQDO SHSWLGH

PAGE 123

)LJXUH 6FKHPDWLF GLDJUDP RI ZLOG W\SH DQG PXWDWHG VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$V 7KH VLJQDO SHSWLGHKLVWRQH IXVLRQ JHQH 63+(f ZDV PXWDWHG E\ VLWH GLUHFWHG PXWDJHQHVLV =ROOHU DQG 6PLWK f DV GHVFULEHG LQ &KDSWHU $EEUHYLDWLRQV + HQGRJHQRXV + KLVWRQH P51$ 63+( VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ 63+(ODOSKD VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ PXWDWHG LQ WKH K\GURSKRELF UHJLRQ RI WKH VLJQDO SHSWLGH OHX DW SRVLWLRQ DQG SUR DW SRVLWLRQ VXEVWLWXWHG ZLWK KLVf" 63+($7* VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ PXWDWHG LQ WKH VLJQDO SHSWLGH WUDQVODWLRQ VWDUW FRGRQ &$3 n FDS VWUXFWXUH $7* SUHGLFWHG WUDQVODWLRQ VWDUW FRGRQ DWJ LQWHUQDO WUDQVODWLRQ VWDUW FRGRQ IRU KLVWRQH + SURWHLQ 7$$ WUDQVODWLRQ VWRS FRGRQ

PAGE 124

63+( $OSKD $7*n QW &$3 $7* Pm *LQ +L V 3KH $UJ 9DO $OH /HX +H 3UR 3KH 3KH $OD $OD 3KH &\V /HX 3UR 9DO 3KH $OD 0HW $OD &$$ &$8 88& &*8 *8& *&& &88 $88 &&& 888 888 *&* *&$ 888 8*& &88 &&8 *88 888 *&& $8* *&8 *LQ +LV 3KH $UJ 9DO $OD +LV OLH +LV 3KH 3KH $OD $OD 3KH &\V /HX 3UR 9DO 3KH $OD 0HW $OD &$$ &$8 88& &*8 *8& *&& &D8 $88 &D& 888 888 *&* *&$ 888 8*& &88 &&8 *88 888 *&& $8* *&8 **$$*$*8 X8* $*8 $88 &$$ &$8 8& &*8 *8& *&& &88 $88 f§ +HW $OD &&& 888 888 *&* *&$ 888 8*& &8 &&8 *88 888 *&& $8* *&8

PAGE 125

ZKLFK UHVXOWV LQ WKH VXEVWLWXWLRQ RI OHXFLQH DW DPLQR DFLG SRVLWLRQ *$$r*7$f DQG SUROLQH DW SRVLWLRQ ****7*f ZLWK SRVLWLYHO\ FKDUJHG KLVWLGLQH UHVLGXHV 7KH VHFRQG PXWDQW S63+(O$7*n FRQWDLQV D VLQJOH QXFOHRWLGH VXEVWLWXWLRQ ZKLFK GHVWUR\V WKH $7* WUDQVODWLRQ LQLWLDWLRQ FRGRQ RI WKH VLJQDO SHSWLGH $7*A77*f 7KLV PXWDWLRQ VKRXOG UHVXOW LQ WKH LQLWLDWLRQ RI WUDQVODWLRQ DW WKH QDWXUDO $7* FRGRQ RI WKH KLVWRQH FRGLQJ UHJLRQ ZLWKRXW WKH V\QWKHVLV RI WKH VLJQDO SHSWLGH 7KH GLVWULEXWLRQ RI WKH 63+( 63+(ODOSKD DQG 63+($7*f VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$V LQ QRQPHPEUDQHERXQG DQG PHPEUDQHERXQG SRO\VRPH IUDFWLRQV IURP WUDQVIHFWHG +H/D PRQROD\HU FHOO FXOWXUHV ZDV GHWHUPLQHG E\ 6, QXFOHDVH SURWHFWLRQ DQDO\VLV $V VHHQ LQ )LJXUH WKH 63+($7* P51$ SDUWLWLRQHG LQWR WKH QRQPHPEUDQHERXQG SRO\VRPH IUDFWLRQ WR WKH VDPH H[WHQW DV HQGRJHQRXV KLVWRQH + P51$ $SSUR[LPDWHO\ b RI WKH 63+($7* P51$ DQG b HQGRJHQRXV KLVWRQH P51$ ZDV IRXQG DVVRFLDWHG ZLWK WKH QRQPHPEUDQHERXQG SRO\VRPHV 7DEOH f ,Q FRQWUDVW 63+( P51$ ZDV SUHGRPLQDQWO\ DVVRFLDWHG ZLWK PHPEUDQHERXQG SRO\VRPHV )LJ f $SSUR[LPDWHO\ b RI 63+( P51$ ZDV ORFDOL]HG LQ WKH PHPEUDQHERXQG SRO\VRPDO 51$ IUDFWLRQ 7DEOH f 7KH 63+(ODOSKD P51$ GLVSOD\HG D PRUH LQWHUPHGLDWH DVVRFLDWLRQ ZLWK PHPEUDQHERXQG SRO\VRPHV DSSUR[LPDWHO\ b RI WKH 63+(ODOSKD P51$ ZDV ORFDOL]HG LQ WKH PHPEUDQHERXQG SRO\VRPH IUDFWLRQ DQG b LQ WKH QRQPHPEUDQHERXQG SRO\VRPDO IUDFWLRQ )LJ DQG 7DEOH

PAGE 126

)LJXUH 'LVWULEXWLRQ RI 63+( 63+(ODOSKD DQG 63+($7* P51$V LQ QRQPHPEUDQHERXQG DQG PHPEUDQHERXQG SROYVRPDO IUDFWLRQV +H/D FHOO PRQROD\HUV ZHUH WUDQVIHFWHG ZLWK WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ JHQHV E\ WKH FDOFLXP SKRVSKDWH SUHFLSLWDWLRQ PHWKRG DQG KRXUV SRVWWUDQVIHFWLRQ QRQPHPEUDQHERXQG DQG PHPEUDQHERXQG SRO\VRPHV ZHUH LVRODWHG 51$ MXJf IURP HDFK VXEFHOOXODU IUDFWLRQ ZDV DVVD\HG IRU VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ DQG HQGRJHQRXV + KLVWRQH P51$ FRQWHQW E\ 6, QXFOHDVH SURWHFWLRQ DQDO\VLV DV GHVFULEHG LQ &KDSWHU $EEUHYLDWLRQV 63+( ZLOG W\SH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ DOSKD K\GURSKRELF PXWDQW RI 63+( $7* VLJQDO SHSWLGH WUDQVODWLRQ LQLWLDWLRQ FRGRQ PXWDQW RI 63+( /DQH QRQPHPEUDQHERXQG SRO\VRPDO 51$ /DQH PHPEUDQHERXQG SRO\VRPDO 51$

PAGE 127

L 6 3 + $/3+$ $7* S UREH IX VLRQ +

PAGE 128

7DEOH 4XDQWLWDWLRQ RI 63+( 63+(ODOSKD DQG 63+($7* LQ51$ LQ QRQPHPEUDQHERXQG DQG PHPEUDQHERXQG SRO\VRPH IUDFWLRQV 1RQPHPEUDQHERXQG 0HPEUDQHERXQG 63+( P51$ b b 63+(ODOSKD P51$ b b 63+($7*n P51$ b b (QGRJHQRXV + P51$ b b 7KH GLVWULEXWLRQ RI 63+( 63+(ODOSKD 63+($7* DQG HQGRJHQRXV + KLVWRQH P51$V LQ QRQPHPEUDQHERXQG DQG PHPEUDQHERXQG SRO\VRPH IUDFWLRQV ZDV TXDQWLWDWHG E\ GHQVLWRPHWULF DQDO\VLV RI WKH 6, QXFOHDVH SURWHFWLRQ DVVD\ SUHVHQWHG LQ )LJXUH 7KH GHQVLWRPHWULF YDOXHV REWDLQHG UHSUHVHQW WKH TXDQWLW\ RI P51$ LQ J 51$ 7KH YDOXHV ZHUH WKHQ DGMXVWHG WR UHIOHFW WKH WRWDO \LHOG RI 51$ UHFRYHUHG LQ HDFK IUDFWLRQ

PAGE 129

f 7KHVH UHVXOWV LQGLFDWH WKDW WKH PXWDWLRQ RI WKH $7* WUDQVODWLRQ VWDUW FRGRQ RI WKH VLJQDO SHSWLGH UHVXOWV LQ WKH V\QWKHVLV RI D VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ 63+($7*f WKDW LV DVVRFLDWHG ZLWK QRQPHPEUDQHERXQG SRO\VRPHV ,Q DGGLWLRQ WKH LQFRUSRUDWLRQ RI WZR KLVWLGLQH DPLQR £FLG UHVLGXHV LQ WKH K\GURSKRELF GRPDLQ RI WKH VLJQDO SHSWLGH SDUWLDOO\ EORFNV WKH WUDQVORFDWLRQ RI WKH P51$ IURP QRQPHPEUDQHERXQG SRO\VRPHV WR PHPEUDQHERXQG SRO\VRPHV 7R VWXG\ WKH VWDELOLW\ RI WKH PXWDWHG VLJQDO SHSWLGH KLVWRQH IXVLRQ P51$V GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV WKH JHQHV 63+( 63+(ODOSKD DQG 63+($7*f ZHUH WUDQVIHFWHG LQWR +H/D FHOO PRQROD\HUV E\ WKH FDOFLXP SKRVSKDWH SUHFLSLWDWLRQ PHWKRG DV GHVFULEHG LQ &KDSWHU )RUW\VL[ KRXUV SRVWWUDQVIHFWLRQ WKH FHOOV ZHUH WUHDWHG ZLWK P0 K\GUR[\XUHD DQG VDPSOHV ZHUH WDNHQ DW PLQXWH WLPH LQWHUYDOV 7RWDO FHOOXODU 51$ ZDV LVRODWHG DQG DVVD\HG IRU VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ DQG HQGRJHQRXV + KLVWRQH P51$ FRQWHQW E\ 6, QXFOHDVH SURWHFWLRQ DQDO\VLV DV GHVFULEHG LQ &KDSWHU $V VHHQ LQ )LJXUH DQG VXPPDUL]HG LQ )LJXUH LQKLELWLRQ RI '1$ V\QWKHVLV IRU RQH KRXU UHVXOWHG LQ WKH GHVWDELOL]DWLRQ RI RQO\ b RI 63+( P51$ DV FRPSDUHG WR WKH FRQWURO FHOO FXOWXUH ODQHV DQG f ,Q VKDUS FRQWUDVW 63+($7* P51$ ZDV GHVWDELOL]HG E\ b ZKLFK LV WR WKH VDPH H[WHQW DV PHDVXUHG IRU HQGRJHQRXV + KLVWRQH P51$ )LJXUH ODQHV DQG )LJ f ,QKLELWLRQ RI '1$ V\QWKHVLV IRU RQH KRXU ZLWK P0 K\GUR[\XUHD

PAGE 130

)LJXUH (IIHFWV RI KYGUR[YXUHD WUHDWPHQW RQ 63+( P51$ +H/D FHOO PRQROD\HUV ZHUH WUDQVIHFWHG ZLWK S63+(O '1$ DQG KRXUV SRVWWUDQVIHFWLRQ ZHUH WUHDWHG ZLWK P0 K\GUR[\XUHD +8f &HOOV ZHUH KDUYHVWHG DW PLQXWH LQWHUYDOV DQG WRWDO FHOOXODU 51$ ZDV SUHSDUHG 7KH 51$ AJf ZDV VXEMHFWHG WR 6, QXFOHDVH SURWHFWLRQ DQDO\VLV WR TXDQWLWDWH WKH OHYHOV RI ZLOG W\SH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ DQG HQGRJHQRXV + KLVWRQH P51$ (DFK ODQH UHSUHVHQWV DQ LQGLYLGXDOO\ WUDQVIHFWHG FHOO FXOWXUH 0: LV UDGLRODEHOHG +SD ,, GLJHVW RI S%5 '1$ /DQHV DQG FRQWURO" ODQHV DQG P0 +8 PLQXWHV" ODQHV DQG P0 +8  PLQXWHV" ODQHV DQG P0 +8 PLQXWHV

PAGE 131

SUREH IXVLRQ +

PAGE 132

)LJXUH (IIHFWV RI K\GUR[\XUHD WUHDWPHQW RQ 63+($7* P51$ +H/D FHOO PRQROD\HUV ZHUH WUDQVIHFWHG ZLWK S63+(O$7* '1$ DQG KRXUV SRVWWUDQVIHFWLRQ ZHUH WUHDWHG ZLWK P0 K\GUR[\XUHD +8f &HOOV ZHUH KDUYHVWHG DW PLQXWH LQWHUYDOV DQG WRWDO FHOOXODU 51$ ZDV SUHSDUHG 7KH 51$ Jf ZDV VXEMHFWHG WR 6, QXFOHDVH SURWHFWLRQ DQDO\VLV WR TXDQWLWDWH WKH OHYHOV RI 63+($7* P51$ DQG HQGRJHQRXV + KLVWRQH P51$ (DFK ODQH UHSUHVHQWV DQ LQGLYLGXDOO\ WUDQVIHFWHG FHOO FXOWXUH 0: LV UDGLRODEHOHG +SD ,, GLJHVW RI S%5 '1$ /DQHV DQG FRQWURO" ODQHV DQG P0 +8 PLQXWHV ODQHV DQG P0 +8 PLQXWHV ODQHV DQG P0 +8 PLQXWHV

PAGE 133

63+($7*

PAGE 134

)LJXUH (IIHFWV RI K\GUR[\XUHD WUHDWPHQW RQ 63+(ODOSKD P51$ +H/D FHOO PRQROD\HUV ZHUH WUDQVIHFWHG ZLWK S63+(ODOSKD '1$ DQG KRXUV SRVWWUDQVIHFWLRQ ZHUH WUHDWHG ZLWK P0 K\GUR[\XUHD +8f &HOOV ZHUH KDUYHVWHG DW PLQXWH LQWHUYDOV DQG WRWDO FHOOXODU 51$ ZDV SUHSDUHG 7KH 51$ /WJf ZDV VXEMHFWHG WR 6, QXFOHDVH SURWHFWLRQ DQDO\VLV WR TXDQWLWDWH WKH OHYHOV RI WKH 63+(ODOSKD P51$ DQG HQGRJHQRXV + KLVWRQH IXVLRQ P51$ (DFK ODQH UHSUHVHQWV DQ LQGLYLGXDOO\ WUDQVIHFWHG FHOO FXOWXUH 0: LV UDGLRODEHOHG +SD ,, GLJHVW RI S%5 '1$ /DQHV DQG FRQWURO ODQHV DQG P0 +8 PLQXWHV ODQHV DQG P0 +X PLQXWHV ODQHV DQG P0 +8 PLQXWHV

PAGE 135

6 3 + ( DOSKD 0: SUREH IXVLRQ +

PAGE 136

)LJXUH 4XDQWLWDWLRQ RI 63+( 63+(ODO3KD 63+($7* P51$ GXULQJ KYGUR[YXUHD WUHDWPHQW 7KH FHOOXODU OHYHOV RI WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$V DQG HQGRJHQRXV + KLVWRQH P51$ GXULQJ K\GUR[\XUHD WUHDWPHQW ZHUH GHWHUPLQHG E\ GHQVLWRPHWULF DQDO\VLV RI WKH 6, QXFOHDVH SURWHFWLRQ DVVD\V SUHVHQWHG LQ )LJXUHV WR 9DOXHV DUH SUHVHQWHG DV SHUFHQWDJH RI FRQWURO FHOOV f 63+( P51$63+(ODOSKD P51$‘ 63+($7*f P51$" HQGRJHQRXV + KLVWRQH P51$f

PAGE 137

7 ,P H+8f

PAGE 138

UHVXOWHG LQ WKH GHVWDELOL]DWLRQ RI DSSUR[LPDWHO\ b RI 63+(ODOSKD P51$ D YDOXH ZKLFK LV LQWHUPHGLDWH WR WKDW REVHUYHG IRU 63+( P51$ DQG 63+($7* P51$ )LJXUH ODQHV DQG )LJ f 7KH GHJUHH WR ZKLFK WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$V DUH GHJUDGHG GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV LV FRUUHODWHG ZLWK WKH H[WHQW WR ZKLFK WKH P51$ LV DVVRFLDWHG ZLWK QRQPHPEUDQHERXQG SRO\VRPHV 7KHVH UHVXOWV VXJJHVW WKDW WKH VXEFHOOXODU ORFDOL]DWLRQ RI WKH KLVWRQH P51$ SOD\V D VLJQLILFDQW UROH LQ WKH FRXSOLQJ RI LWV VWDELOLW\ WR '1$ UHSOLFDWLRQ 'LVFXVVLRQ 7R RXU NQRZOHGJH WKLV UHSUHVHQWV WKH ILUVW GHPRQVWUDWLRQ WKDW WKH DGGLWLRQ RI D VLJQDO SHSWLGH FRGLQJ VHTXHQFH WR DQ P51$ WKDW LV QRUPDOO\ WUDQVODWHG RQ QRQPHPEUDQHERXQG SRO\VRPHV UHVXOWV LQ WKH WDUJHWLQJ RI WKH FKLPHULF PHVVDJH WR PHPEUDQHERXQG SRO\VRPHV LQ LQWDFW PDPPDOLDQ FHOOV 7KH UHFRJQLWLRQ RI D SURNDU\RWLF VLJQDO SHSWLGH LQ D HXNDU\RWLF FHOO LV VXSSRUWHG E\ ERWK LQ YLWUR DQG LQ YLYR VWXGLHV /LQJDSSD HW DO 7DOPDGJH HW DO D 7DOPDGJH HW DO Ef 6DFFKDURP\FHV FHUHYLVLDH KDV EHHQ VKRZQ WR H[SUHVV WKH (KB FROL S%5 EHWDODFWDPDVH JHQH LQ YLYR DQG WR SURFHVV WKH SUHFXUVRU SURWHLQ WR WKH HQ]\PDWLFDOO\ DFWLYH PDWXUH SURWHLQ 5RJJHQNDPS HW DK f 7KH SURFHVVLQJ RI WKH EDFWHULDO SUHSURWHLQ LQWR WKH PDWXUH VSHFLHV KDV DOVR EHHQ GHPRQVWUDWHG LQ YLWUR XVLQJ D

PAGE 139

FUXGH \HDVW H[WUDFW 5RJJHQNDPS HW DO f ,Q DGGLWLRQ LW KDV EHHQ UHSRUWHG E\ :HLGUDDQQ HW DO f WKDW ( FROL SODVPLG S%5 EHWDODFWDPDVH P51$ WKDW LV V\QWKHVL]HG DQG FDSSHG LQ YLWUR ZKHQ PLFURLQMHFWHG LQWR ;HQRSXV RRF\WHV LV WUDQVODWHG LQWR SURWHLQ WKDW LV XOWLPDWHO\ VHFUHWHG IURP WKH FHOO 7KHVH UHVXOWV VXJJHVW D FRPPRQ PHFKDQLVP RI VLJQDO SHSWLGH UHFRJQLWLRQ DPRQJ SURNDU\RWLF DQG HXNDU\RWLF RUJDQLVPV ,Q DQ DWWHPSW WR SUHYHQW WKH WUDQVORFDWLRQ RI WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ WR PHPEUDQHERXQG SRO\VRPHV ZH LQLWLDOO\ GLVUXSWHG WKH K\GURSKRELF UHJLRQ RI WKH VLJQDO SHSWLGH E\ VLWH GLUHFWHG PXWDJHQHVLV 7KLV DSSURDFK ZDV EDVHG RQ SUHYLRXV VWXGLHV GHPRQVWUDWLQJ WKDW EDFWHULDO VHFUHWRU\ SURWHLQV WKDW ZHUH PXWDWHG LQ WKH K\GURSKRELF GRPDLQ HLWKHU E\ LQVHUWLRQ RI FKDUJHG DPLQR DFLGV RU E\ GHOHWLRQ DFFXPXODWH LQ WKH F\WRSODVP RI WKH EDFWHULXP (PU HW DO %HGRXHOOH HW DO (PU DQG %DVVIRUG -U f 7KH LQFRUSRUDWLRQ RI SRVLWLYHO\ FKDUJHG KLVWLGLQH UHVLGXHV LQ WKH K\GURSKRELF GRPDLQ RI WKH VLJQDO SHSWLGH 63+(ODOSKDf KRZHYHU UHVXOWHG LQ RQO\ D SDUWLDO EORFN LQ WKH DVVRFLDWLRQ RI PXWDWHG VLJQDO SHSWLGH KLVWRQH IXVLRQ P51$ ZLWK PHPEUDQHERXQG SRO\VRPHV )LJXUH f 7KLV UHVXOW LV QRW VXUSULVLQJ LQ OLJKW RI PRUH UHFHQW VWXGLHV RQ SURWHLQ H[SRUW LQ HXNDU\RWHV ZKLFK GHPRQVWUDWH WKDW WKH UHODWLRQVKLS EHWZHHQ WKH SULPDU\ VHJXHQFH RI WKH VLJQDO SHSWLGH DQG LWV DELOLW\ WR IXQFWLRQ DV D VHFUHWRU\

PAGE 140

VLJQDO LV TXLWH YDULDEOH DQG FDQ ZLWKVWDQG VXEVWDQWLDO LQVHUWLRQ VXEVWLWXWLRQ RU GHOHWLRQ PXWDWLRQV .DLVHU DQG %RWVWHLQ .DLVHU HW DO 5DQGDOO DQG +DUG\ f 6XEVHTXHQWO\ WKH VLJQDO SHSWLGH $7* WUDQVODWLRQ VWDUW FRGRQ RI 63+( ZDV DOWHUHG E\ VLWH GLUHFWHG PXWDJHQHVLV ZKLFK FRPSOHWHO\ LQDFWLYDWHG VLJQDO SHSWLGH IXQFWLRQ )LJXUH f 7KH UHODWLYH VWDELOLW\ RI VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ 63+(f GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV DSSHDUV WR EH D UHVXOW RI WKH VXEFHOOXODU ORFDWLRQ RI WKH P51$ 'HVWDELOL]DWLRQ RI 63+($7*f P51$ ZKLFK GLIIHUV IURP 63+( P51$ E\ D VLQJOH QXFOHRWLGH ZLWK HVVHQWLDOO\ WKH VDPH NLQHWLFV DQG WR WKH VDPH H[WHQW DV HQGRJHQRXV + KLVWRQH P51$ LQGLFDWHV WKDW 63+( P51$ H[SUHVVHV WKH SURSHU VWUXFWXUDO FRQILUPDWLRQ IRU UHFRJQLWLRQ E\ WKH IDFWRUV WKDW PHGLDWH WKH VHOHFWLYH GHVWDELOL]DWLRQ RI KLVWRQH P51$ GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV 7KH GLIIHUHQFH LQ 63+( DQG 63+($7* P51$ VWDELOLW\ GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV PD\ UHIOHFW D SHUWXUEDWLRQ RI SURWHLQ VWUXFWXUH GXH WR WKH VLJQDO SHSWLGH DW WKH 1WHUPLQXV RI 63+( 7KLV SRVVLELOLW\ GRHV QRW DSSHDU OLNHO\ EDVHG RQ WKH REVHUYDWLRQV WKDW KLVWRQH DPLQR DFLG VHTXHQFHV DUH QRW UHTXLUHG WR WDUJHW WKH P51$ IRU GHVWDELOL]DWLRQ 3DQGH\ DQG 0DU]OXII f DQG 63+(ODOSKD P51$ ZKLFK H[SUHVVHV WKH PXWDWHG IRUP RI WKH VLJQDO SHSWLGH LV PRGHUDWHO\ GHVWDELOL]HG GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV )LJXUHV DQG f

PAGE 141

7KHVH UHVXOWV LQGLFDWH WKDW WKH VWDELOLW\ RI 63+( P51$ GXULQJ LQKLELWLRQ RI '1$ UHSOLFDWLRQ LV IXQFWLRQDOO\ UHODWHG WR WKH FKDQJH LQ WKH VXEFHOOXODU ORFDWLRQ RI WKH P51$ 7KH GLIIHUHQWLDO VWDELOLW\ RI 63+( P51$ DQG 63+($7*r P51$ PD\ EH GXH WR TXDOLWDWLYH GLIIHUHQFHV LQ WKH FRPSRVLWLRQ RI PHPEUDQHERXQG DQG QRQPHPEUDQHERXQG SRO\VRPHV KRZHYHU WKHUH LV QR SUHYLRXVO\ UHSRUWHG HYLGHQFH WR VXSSRUW WKLV SRVVLELOLW\ $OWHUQDWLYHO\ WKH SUHVHQFH RI WKH IXVLRQ P51$ RQ PHPEUDQHERXQG SRO\VRPHV UDWKHU WKDQ QRQPHPEUDQHERXQG SRO\VRPHV ZKHUH KLVWRQH P51$ QRUPDOO\ UHVLGHV PD\ SK\VLFDOO\ VHSDUDWH WKH PHVVDJH IURP WKH IDFWRUV WKDW DUH LQYROYHG LQ WKH VHOHFWLYH GHVWDELOL]DWLRQ RI KLVWRQH P51$ GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV 7KHVH UHVXOWV DUH FRQVLVWHQW ZLWK WKH K\SRWKHVLV WKDW WKH VXEFHOOXODU ORFDWLRQ RI KLVWRQH P51$ SOD\V DQ LPSRUWDQW UROH LQ WKH SRVWWUDQVFULSWLRQDO UHJXODWLRQ RI KLVWRQH JHQH H[SUHVVLRQ

PAGE 142

&+$37(5 ',))(5(17,$/ $662&,$7,21 2) 0(0%5$1(%281' $1' 1210(0%5$1(%281' 32/<620(6 :,7+ &(// &<726758&785( ,QWURGXFWLRQ /RFDOL]DWLRQ RI QHDUO\ DOO DFWLYHO\ WUDQVODWHG SRO\ULERVRPHV RQ WKH F\WRVNHOHWDO VWUXFWXUH LQGLFDWHV WKDW SRO\VRPDO P51$V DUH QRW IUHHO\ GLIIXVLEOH WKURXJKRXW WKH F\WRSODVP /HQN HW DO &HUYHUD HW DO 2UQHOOHV HW DO f 7KLV REVHUYDWLRQ LV IXUWKHU VXSSRUWHG E\ VXEFHOOXODU IUDFWLRQDWLRQ VWXGLHV WKDW GHPRQVWUDWH WKH DVVRFLDWLRQ RI ERWK IUHH QRQPHPEUDQHERXQGf DQG PHPEUDQH ERXQG SRO\VRPDO P51$V ZLWK WKH F\WRVNHOHWRQ &HUYHUD HW DO -HIIHU\ %RQQHDX HW DO f 3UHYLRXV UHVXOWV LQGLFDWH WKDW WKH DVVRFLDWLRQ RI SRO\VRPHV ZLWK WKH F\WRVNHOHWRQ LV PHGLDWHG LQ SDUW E\ WKH P51$ DV WUHDWPHQWV ZKLFK GLVVRFLDWH WKH ULERVRPHV IURP WKH P51$ VXFK DV KHDW VKRFN DQG KLJK VDOW UHOHDVH WKH ULERVRPDO VXEXQLWV LQWR WKH VROXEOH SKDVH ZKLOH WKH P51$ UHPDLQV DWWDFKHG WR WKH F\WRVNHOHWRQ /HQN HW DO &HUYHUD HW DO YDQ 9HQURRLM HW DO +RZH DQG +HUVKH\ f +RZHYHU WKH UHJLRQ RI WKH P51$ DQG WKH F\WRVNHOHWDO HOHPHQWV WR ZKLFK LW LV DWWDFKHG DUH QRW NQRZQ

PAGE 143

:H SUHVHQW HYLGHQFH KHUH WR VXSSRUW D PRGHO IRU PXOWLSOH VLWHV RI DWWDFKPHQW RI HXNDU\RWLF P51$ WR WKH F\WRVNHOHWRQ 8VLQJ F\WRFKDODVLQ IRU WKH GLVUXSWLRQ RI PLFURILODPHQWV ZH KDYH REVHUYHG D GLIIHUHQWLDO UHOHDVH RI VSHFLILF P51$V IURP WKH F\WRVNHOHWRQ )XUWKHU FKDUDFWHUL]DWLRQ RI WKH DVVRFLDWLRQ RI P51$ ZLWK WKH F\WRVNHOHWRQ UHYHDOHG DQ DGGLWLRQDO DWWDFKPHQW VLWH WKDW LV LQVHQVLWLYH WR F\WRFKDODVLQ WUHDWPHQW DQG SUHVHQW RQO\ LQ PHPEUDQHERXQG SRO\VRPDO P51$V 7KLV VHFRQG DWWDFKPHQW VLWH LV SXURP\FLQ VHQVLWLYH DQG DSSHDUV WR LQYROYH WKH DVVRFLDWLRQ RI WKH QDVFHQW SRO\SHSWLGH DQGRU ULERVRPH ZLWK WKH UHPQDQW SURWHLQ VWUXFWXUH RI WKH HQGRSODVPLF UHWLFXOXP 5HVXOWV &\WRFKDODVLQ 5HOHDVHV 3ROY $a 51$ IURP WKH &\WRVNHOHWRQ 'LVUXSWLRQ RI DFWLQ ILEHUV E\ F\WRFKDODVLQ WUHDWPHQW UHVXOWV LQ WKH UHOHDVH RI F\WRSODVPLF SRO\ $ 51$ IURP WKH F\WRVNHOHWRQ LQ D GRVH GHSHQGHQW PDQQHU 2UQHOOHV HW DO f 7R IXUWKHU XQGHUVWDQG WKH DVVRFLDWLRQ RI HXNDU\RWLF P51$V ZLWK WKH F\WRVNHOHWRQ ZH KDYH VWXGLHG WKH HIIHFWV RI F\WRFKDODVLQ WUHDWPHQW RQ WKH UHOHDVH RI VSHFLILF P51$V LQFOXGLQJ WKRVH WKDW DUH QRQSRO\DGHQ\ODWHG ,Q DGGLWLRQ ZH KDYH H[DPLQHG DQG FRPSDUHG WKH F\WRVNHOHWDO DVVRFLDWLRQ RI QRQPHPEUDQHERXQG DQG PHPEUDQHERXQG SRO\VRPDO P51$V &HOO F\FOH GHSHQGHQW KLVWRQH JHQHV FRGH IRU P51$V WKDW DUH FDSSHG QRQSRO\DGHQ\ODWHG DQG SUHGRPLQDQWO\ DVVRFLDWHG

PAGE 144

ZLWK WKH F\WRVNHOHWRQ -HIIHU\ 6WHLQ HW DO $GHQVLN DQG 'DUQHOO =DPEHWWL HW DO f 7KH GLVWULEXWLRQ RI KLVWRQH P51$V EHWZHHQ WKH F\WRVNHOHWDO DQG WKH VROXEOH IUDFWLRQV ZDV GHWHUPLQHG E\ 1RUWKHUQ EORW DQDO\VLV EHIRUH DQG DIWHU F\WRFKDODVLQ WUHDWPHQW $V VHHQ LQ )LJXUH + DQG + FHOO F\FOH GHSHQGHQW KLVWRQH P51$V DUH SULPDULO\ DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ XQWUHDWHG +H/D FHOO FXOWXUHV ODQHV DQG f 4XDQWLWDWLRQ RI WKH DXWRUDGLRJUDSK LQ )LJXUH E\ VFDQQLQJ ODVHU GHQVLWRPHWU\ UHYHDOHG WKDW !b RI WKH KLVWRQH P51$V ZHUH DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ FRQWURO FHOO FXOWXUHV 7DEOH f ZKLFK LV FRQVLVWHQW ZLWK SUHYLRXVO\ UHSRUWHG YDOXHV =DPEHWWL HW DO f 8SRQ DGGLWLRQ RI F\WRFKDODVLQ KLVWRQH P51$V ZHUH UHOHDVHG IURP WKH F\WRVNHOHWRQ LQWR WKH VROXEOH SKDVH )LJ ODQHV f $V VKRZQ LQ 7DEOH OHVV WKDQ b RI WKH KLVWRQH P51$V UHPDLQHG DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ +H/D FHOO FXOWXUHV WUHDWHG ZLWK JPO F\WRFKDODVLQ 7UHDWPHQW ZLWK ALJ[D F\WRFKDODVLQ UHVXOWHG LQ WKH GLVVRFLDWLRQ RI !b RI WKH KLVWRQH P51$V IURP WKH F\WRVNHOHWRQ 7KH H[WHQW WR ZKLFK F\WRFKDODVLQ UHOHDVHV QRQSRO\DGHQ\ODWHG KLVWRQH P51$ IURP WKH F\WRVNHOHWRQ LV VLPLODU WR WKDW UHSRUWHG IRU WRWDO KHWHURJHQHRXV SRO\$ 51$ 2UQHOOHV HW DO f

PAGE 145

0HPEUDQH%RXQG 3RO\VRPDO 51$ LV QRW 5HOHDVHG IURP WKH &\WRVNHOHWRQ EY &YWRFKDODVLQ 7UHDWPHQW +/$% LV D FODVV KLVWRFRPSDWLELOLW\ DQWLJHQ WKDW LV ORFDWHG RQ WKH FHOO VXUIDFH 5REE HW DO f 3UHYLRXVO\ +/$% P51$ ZDV VKRZQ WR EH DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ DQG WUDQVODWHG LQWR SURWHLQ RQ PHPEUDQHERXQG SRO\VRPHV =DPEHWWL HW DO f $V VHHQ LQ )LJXUH +/$% P51$ ZDV DOPRVW H[FOXVLYHO\ DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ FRQWURO FHOOV ODQHV DQG f DQG UHPDLQHG ODUJHO\ DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ F\WRFKDODVLQ WUHDWHG FHOOV ODQHV f $SSUR[LPDWHO\ b RI WKH +/$% P51$ ZDV DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ XQWUHDWHG FHOO FXOWXUHV 7DEOH f ,Q FRQWUDVW WR KLVWRQH P51$ DQG WRWDO SRO\$ 51$ RQO\ b RI WKH +/$% P51$ ZDV UHOHDVHG IURP WKH F\WRVNHOHWRQ LQ FHOO FXOWXUHV WUHDWHG ZLWK LJPO F\WRFKDODVLQ 7DEOH f 7KH UHWHQWLRQ RI +/$% P51$ RQ WKH F\WRVNHOHWRQ GXULQJ F\WRFKDODVLQ WUHDWPHQW PD\ EH D FRQVHTXHQFH RI WUDQVODWLQJ WKH P51$ RQ PHPEUDQHERXQG SRO\VRPHV 7R H[DPLQH WKLV SRVVLELOLW\ WKH GLVWULEXWLRQ RI FKRULRQLF JRQDGRWURSLQ DOSKD P51$ ZLWKLQ WKH F\WRVNHOHWRQ DQG VROXEOH IUDFWLRQV ZDV GHWHUPLQHG LQ F\WRFKDODVLQ WUHDWHG FHOOV &KRULRQLF JRQDGRWURSLQ LV D VHFUHWHG KHWHURGLPHULF SURWHLQ FRPSRVHG RI DOSKD DQG EHWD VXEXQLWV 0LOVWHG HW DO f 7KH DOSKD VXEXQLW LV H[SUHVVHG LQ H[SRQHQWLDOO\ JURZLQJ +H/D FHOOV 0LOVWHG HW DO f DQG 1RUWKHUQ EORW DQDO\VLV RI

PAGE 146

)LJXUH 1RUWKHUQ EORW DQDO\VLV RI WKH FYWRVNHOHWRQ DQG VROXEOH SKDVH GLVWULEXWLRQ RI + KLVWRQH + KLVWRQH DQG +/$% P51$V LQ FYWRFKDODVLQ WUHDWHG FHOOV +H/D FHOOV ZHUH WUHDWHG ZLWK WKH LQGLFDWHG FRQFHQWUDWLRQ RI F\WRFKDODVLQ IRU PLQXWHV DQG F\WRVNHOHWRQ DQG VROXEOH SKDVH 51$V ZHUH LVRODWHG (TXDO TXDQWLWLHV RI 51$ SHU VDPSOH [JODQHf ZHUH DQDO\]HG E\ 1RUWKHUQ EORW DQDO\VLV DV GHVFULEHG LQ &KDSWHU /DQHV f &RQWUROFVN" f &RQWUROVRO" f &' > JPO@FVN" f &' > 0JPO@VRO f &' > QTPOfFV. f &' > 0JPO@VRO f &' > JPO@FVN f &' > 0JPO@VRO

PAGE 147

+/$% + +

PAGE 148

7DEOH 7KH SHUFHQW RI F\WRVNHOHWRQ DQG VROXEOH SKDVH DVVRFLDWHG P51$V LQ FHOOV WUHDWHG ZLWK FYWRFKDODVLQ + + +/$% K&* &RQWURO &VN b b !b b 6RO b b b b &' > 0JPO@ &VN b b b b 6RO b b b b &' > 0JPO@ &VN b b b b 6RO b b b b &' > MLWJPO@ &VN b b b b 6RO b b b b 7KH GHQVLWRPHWULF UHVXOWV IURP )LJXUH K&* GDWD QRW VKRZQf ZHUH QRUPDOL]HG IRU WKH \LHOG RI 51$ IURP WKH F\WRVNHOHWRQ DQG VROXEOH IUDFWLRQV RI HDFK FHOO VDPSOH QRWH HTXDO TXDQWLWLHV RI F\WRVNHOHWRQ DQG VROXEOH 51$V ZHUH DQDO\]HG ZKLFK GRHV QRW WDNH LQWR FRQVLGHUDWLRQ WKH XQHTXDO GLVWULEXWLRQ RI 51$ ZLWKLQ WKHVH IUDFWLRQV RU WKH FKDQJHV WKDW RFFXU GXULQJ F\WRFKDODVLQ WUHDWPHQWf 7KH YDOXHV DUH SUHVHQWHG DV SHUFHQW GLVWULEXWLRQ RI P51$ EHWZHHQ WKH F\WRVNHOHWRQ DQG VROXEOH IUDFWLRQV

PAGE 149

VXEFHOOXODU IUDFWLRQV GHPRQVWUDWHG WKDW DSSUR[LPDWHO\ b RI WKH FKRULRQLF JRQDGRWURSLQ DOSKD K&*Df P51$ ZDV DVVRFLDWHG ZLWK PHPEUDQHERXQG SRO\VRPHV DXWRUDGLRJUDSK QRW VKRZQf $QDORJRXV WR +/$% P51$ K&*D P51$ ZDV QRW IXOO\ UHOHDVHG IURP WKH F\WRVNHOHWRQ LQ F\WRFKDODVLQ WUHDWHG FHOOV" JUHDWHU WKDQ b RI WKH JRQDGRWURSLQ P51$ ZDV DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ FRQWURO FHOOV DQG DSSUR[LPDWHO\ b UHPDLQHG DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ FHOOV WUHDWHG ZLWK QT7& F\WRFKDODVLQ DXWRUDGLRJUDSK QRW VKRZQ GDWD VXPPDUL]HG LQ 7DEOH f 1RQPHPEUDQH%RXQG 3ROYVRPDO P51$V DUH 5HOHDVHG IURP WKH &\WRVNHOHWRQ EY &\WRFKDODVLQ 7UHDWPHQW 3UHYLRXV UHVXOWV KDYH GHPRQVWUDWHG WKDW KLVWRQH P51$V DUH SUHGRPLQDQWO\ WUDQVODWHG RQ F\WRVNHOHWRQ DVVRFLDWHG QRQPHPEUDQHERXQG SRO\VRPHV =DPEHWWL HW DO f DQG DV GHVFULEHG DERYH DUH UHOHDVHG IURP WKH F\WRVNHOHWRQ LQWR WKH VROXEOH SKDVH E\ F\WRFKDODVLQ WUHDWPHQW $V DQ DGGLWLRQDO FRQWURO IRU VWXG\LQJ WKH UHOHDVH RI QRQPHPEUDQHERXQG SRO\VRPDO 51$V IURP WKH F\WRVNHOHWRQ E\ F\WRFKDODVLQ WUHDWPHQW ZH DQDO\]HG WKH GLVWULEXWLRQ RI FIRV P51$ EHWZHHQ WKH F\WRVNHOHWRQ DQG VROXEOH IUDFWLRQV IURP FRQWURO DQG F\WRFKDODVLQ WUHDWHG FHOO FXOWXUHV 7KH FIRV SURWHLQ LV ORFDOL]HG ZLWKLQ WKH QXFOHXV &XUUDQ HW DO f DQG WKHUHIRUH DFFRUGLQJ WR WKH VLJQDO K\SRWKHVLV VKRXOG EH V\QWKHVL]HG RQ QRQPHPEUDQHERXQG SRO\VRPHV %OREHO DQG

PAGE 150

'REEHUVWHLQ f 6XEFHOOXODU IUDFWLRQDWLRQ DQG 1RUWKHUQ EORW DQDO\VLV UHYHDOHG WKDW FIRV P51$ LV SUHGRPLQDQWO\ DVVRFLDWHG ZLWK QRQPHPEUDQHERXQG SRO\VRPHV GDWD QRW VKRZQf DQG WKDW DSSUR[LPDWHO\ b RI WKH FIRV P51$ LV DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ )LJXUH ODQHV DQG 7DEOH f &\WRFKDODVLQ DV ZHOO DV SXURP\FLQ &'SXURP\FLQ DQG &'F\FORKH[LPLGH GUDPDWLFDOO\ LQFUHDVHG F IRV P51$ OHYHOV DQG WKH QHZO\ V\QWKHVL]HG FIRV P51$ SDUWLWLRQHG LQWR ERWK WKH F\WRVNHOHWDO DQG VROXEOH IUDFWLRQV LQ D PDQQHU WKDW UHIOHFWV WKH GUXJ WUHDWPHQW )LJXUH ODQHV 7DEOH f /HVV WKDQ b RI WKH FIRV P51$ UHPDLQHG DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ F\WRFKDODVLQ > ILTPO@ WUHDWHG FHOOV 7DEOH f 0HPEUDQH%RXQG 3ROYVRPDO P51$V ([SUHVV 0XOWLSOH &\WRVNHOHWRQ $WWDFKPHQW 6LWHV 5HWHQWLRQ RI PHPEUDQHERXQG SRO\VRPDO P51$V RQ WKH F\WRVNHOHWRQ LQ F\WRFKDODVLQ WUHDWHG FHOOV VXJJHVWV WKDW WKLV FODVV RI SRO\VRPDO P51$ PD\ FRQWDLQ DGGLWLRQDO F\WRVNHOHWRQ DWWDFKPHQW VLWHV &HOO VXUIDFH SURWHLQV VXFK DV +/$% DQG FKRULRQLF JRQDGRWURSLQ DUH JHQHUDOO\ V\QWKHVL]HG RQ PHPEUDQHERXQG SRO\VRPHV WKDW DUH FRPSOH[HG ZLWK WKH HQGRSODVPLF UHWLFXOXP IRU UHYLHZ VHH (PU HW DO f 7KH QDWXUH RI WKH LQWHUDFWLRQ EHWZHHQ WKH SRO\VRPHV DQG WKH HQGRSODVPLF UHWLFXOXP DSSHDUV WR EH PHGLDWHG LQ SDUW E\ WKH QDVFHQW SRO\SHSWLGH WKDW LV LQVHUWHG LQWR WKH

PAGE 151

)LJXUH 1RUWKHUQ EORW DQDO\VLV RI WKH FYWRVNHOHWRQ DQG VROXEOH SKDVH GLVWULEXWLRQ RI FIRV P51$ LQ F\WRFKDODVLQ SXURPYFLQ &'SXUR DQG &'FYFORKH[LPLGH WUHDWHG FHOOV +H/D FHOOV ZHUH FXOWXUHG LQ WKH SUHVHQFH RI WKH GUXJV DQG IUDFWLRQDWHG LQWR F\WRVNHOHWRQ DQG VROXEOH SKDVHV DV GHVFULEHG LQ WKH &KDSWHU (TXDO TXDQWLWLHV RI 51$ JVDPSOHf IURP HDFK IUDFWLRQ ZHUH DVVD\HG IRU FIRV P51$ FRQWHQW E\ 1RUWKHUQ EORW DQDO\VLV /DQHV f &RQWUROFVN" f &RQWUROVRO" f &'FVN" f &'VRO" f 3XURFVN f 3XURVRO f &'SXURFVN f &'SXURVRO f &'F\FORFVN" f &'F\FORVRO

PAGE 153

7DEOH 3HUFHQW GLVWULEXWLRQ RI QRQPHPEUDQHERXQG DQG PHPEUDQHERXQG SRO\VRPDO 51$V LQ WKH &VN DQG 6RO IUDFWLRQV IURP &' 3XUR &'SXURPYFLQ DQG &'FYFORKH[LPLGH WUHDWHG FHOOV ++ +/$ % K&* IRV &RQWURO &6. b sf b sLf b sLf b 62/ b b b b &' &6. b sf b sf b sf b 62/ b b b b 3XUR &6. b sf b sf b sf b 62/ b b b b &'3XUR &6. b sf b sf b sf b 62/ b b b b &'&\FOR &6. b sf b f b sf b 62/ b b b b 7KH &VN DQG 6RO GLVWULEXWLRQ RI FIRV P51$ GXULQJ &' SXUR &'SXUR DQG &'F\FOR WUHDWPHQW ZDV TXDQWLWDWHG E\ QRUPDOL]LQJ WKH GHQVLWRPHWULF UHVXOWV IURP WKH DXWRUDGLRJUDP SUHVHQWHG LQ )LJXUH IRU WKH \LHOG RI 51$ LQ HDFK IUDFWLRQ 7KH &VN DQG 6RO GLVWULEXWLRQ RI QRQPHPEUDQHERXQG DQG PHPEUDQHERXQG SRO\VRPDO P51$V ZDV TXDQWLWDWHG GLUHFWO\ IURP WKH GHQVLWRPHWULF DQDO\VLV 7KH QXPEHUV LQ EUDFNHWV LQGLFDWH VWDQGDUG HUURU

PAGE 154

PHPEUDQH RI WKH HQGRSODVPLF UHWLFXOXP ,Q DGGLWLRQ WKH QDVFHQW SRO\SHSWLGH LV FRPSOH[HG ZLWK WKH SURWHLQV LQYROYHG LQ WKH WUDQVORFDWLRQ RI WKH H[SRUWHG SURWHLQ IURP WKH F\WRSODVP LQWR WKH OXPHQ RI WKH HQGRSODVPLF UHWLFXOXP 'XULQJ WKH LVRODWLRQ RI WKH F\WRVNHOHWRQ QHDUO\ DOO WKH OLSLG FRPSRQHQWV EXW QRW WKH SURWHLQ VXEVWUXFWXUH RI WKH HQGRSODVPLF UHWLFXOXP PHPEUDQH DUH UHPRYHG E\ GHWHUJHQW H[WUDFWLRQ /HQN HW DO f 7KH F\WRVNHOHWRQ DWWDFKPHQW VLWH DVVRFLDWHG ZLWK PHPEUDQHERXQG SRO\VRPHV ZKLFK LV LQVHQVLWLYH WR F\WRFKDODVLQ PD\ EH WKH QDVFHQW SRO\SHSWLGH FRPSOH[HG ZLWK WKH UHPQDQW SURWHLQ VWUXFWXUH RI WKH HQGRSODVPLF UHWLFXOXP 7R WHVW WKH SRVVLELOLW\ WKDW WKH QDVFHQW SRO\SHSWLGH VHUYHV DV DQ DGGLWLRQDO DQFKRU IRU WKH DWWDFKPHQW RI P51$ WR WKH F\WRVNHOHWRQ ZH FRWUHDWHG +H/D FHOOV ZLWK F\WRFKDODVLQ DQG SXURP\FLQ 3XURP\FLQ LQKLELWV SURWHLQ V\QWKHVLV E\ LQWHUUXSWLQJ SRO\SHSWLGH FKDLQ IRUPDWLRQ ZKLFK UHVXOWV LQ WKH UHOHDVH RI WKH QDVFHQW SRO\SHSWLGH DQG ULERVRUDDO VXEXQLWV IURP WKH P51$ 7KH GLVWULEXWLRQ RI PHPEUDQHERXQG DQG QRQPHPEUDQHERXQG SRO\VRPDO 51$ ZLWKLQ WKH F\WRVNHOHWRQ DQG VROXEOH IUDFWLRQV ZDV WKHQ GHWHUPLQHG E\ 1RUWKHUQ EORW DQDO\VLV $V VHHQ LQ )LJXUH WUHDWPHQW RI +H/D FHOOV ZLWK F\WRFKDODVLQ DQG SXURP\FLQ UHOHDVHG PHPEUDQHERXQG SRO\VRPDO UD51$V IURP WKH F\WRVNHOHWRQ ODQHV DQG f $SSUR[LPDWHO\ b RI +/$% P51$ DQG b RI K&*D P51$

PAGE 155

UHPDLQHG DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ F\WRFKDODVLQ WUHDWHG FHOOV WKDW ZHUH VXEVHTXHQWO\ WUHDWHG ZLWK SXURP\FLQ 7DEOH f ,Q FRQWUDVW PRUH WKDQ b RI WKH +/$% P51$ DQG b RI WKH K&*D P51$ UHPDLQHG DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ +H/D FHOOV WUHDWHG ZLWK F\WRFKDODVLQ DORQH 7DEOHf 7KH UHOHDVH RI PHPEUDQHERXQG SRO\VRPDO P51$V IURP WKH F\WRVNHOHWRQ LQ F\WRFKDODVLQ DQG SXURP\FLQ WUHDWHG +H/D FHOOV ZDV QRW D GLUHFW UHVXOW RI WKH LQKLELWLRQ RI SURWHLQ V\QWKHVLV &\WRFKDODVLQ WUHDWPHQW IROORZHG E\ WKH LQKLELWLRQ RI SURWHLQ V\QWKHVLV ZLWK F\FORKH[LPLGH D FRPSRXQG WKDW SUHVHUYHV WKH SRO\VRPDO VWUXFWXUH IDLOHG WR UHOHDVH +/$% P51$ IURP WKH F\WRVNHOHWRQ )LJXUH ODQHV DQG f *UHDWHU WKDQ b RI WKH +/$% P51$ ZDV DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ F\WRFKDODVLQ DQG F\FORKH[LPLGH WUHDWHG FHOOV 7DEOH f 7KH UHVXOWV ZHUH QRW DV GUDPDWLF IRU WKH K&*D P51$ )LJXUH ODQHV DQG f $SSUR[LPDWHO\ b RI K&*D P51$ ZDV DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ FHOOV WUHDWHG ZLWK ERWK F\WRFKDODVLQ DQG F\FORKH[LPLGH 7DEOH f 7KH UHOHDVH RI +/$% P51$ DQG K&*D P51$ IURP WKH F\WRVNHOHWRQ LQ F\WRFKDODVLQ DQG SXURP\FLQ WUHDWHG +H/D FHOOV ZDV QRW GXH VROHO\ WR WKH LQKLELWLRQ RI SURWHLQ V\QWKHVLV E\ SXURP\FLQ $V SUHYLRXVO\ UHSRUWHG WKH GLVVRFLDWLRQ RI SRO\VRPHV ZLWK KLJK VDOW RU KHDW VKRFN UHVXOWHG LQ WKH UHOHDVH RI WKH ULERVRPDO VXEXQLWV LQWR WKH VROXEOH SKDVH ZLWKRXW DIIHFWLQJ WKH DWWDFKPHQW RI SRO\ $

PAGE 156

)LJXUH 1RUWKHUQ EORW DQDO\VLV RI WKH FYWRVNHOHWRQ DQG VROXEOH SKDVH GLVWULEXWLRQ RI QRQPHPEUDQHERXQG DQG PHPEUDQHERXQG SROYVRPDO P51$V LQ FYWRFKDODVLQ SXURPYFLQ &'SXUR DQG &'FYFORKH[LPLGH WUHDWHG FHOOV +H/D FHOOV ZHUH FXOWXUHG LQ WKH SUHVHQFH RI WKH GUXJV DQG IUDFWLRQDWHG LQWR F\WRVNHOHWRQ DQG VROXEOH SKDVHV DV GHVFULEHG LQ &KDSWHU (TXDO YROXPHV RI F\WRVNHOHWRQ DQG VROXEOH SKDVH 51$ IURP HDFK FHOO FXOWXUH ZHUH DVVD\HG IRU + KLVWRQH + KLVWRQH +/$% DQG FKRULRQLF JRQDGRWURSLQ P51$V E\ 1RUWKHUQ EORW DQDO\VLV 8SSHU SDQHO SUREHG IRU +/$% DQG FKRULRQLF JRQDGRWURSLQ P51$ DQG ORZHU SDQHO SUREHG IRU + DQG+ KLVWRQH P51$ 8SSHU DQG ORZHU SDQHOV UHSUHVHQW WKH VDPH 1RUWKHUQ ILOWHU /DQHV f &RQWUROFVN f &RQWUROVRO" f &'FVN" f &'VRO f 3XURFVN" f 3XURVRO" f &'SXURFVN" f &'SXURVRO f &'F\FORFVN f &'F\FORVRO

PAGE 158

P51$ WR WKH F\WRVNHOHWRQ &HUYHUD HW DO +RZH DQG +HUVKH\ f &RQVLVWHQW ZLWK WKLV ILQGLQJ b RI +/$% P51$ DQG b RI K&*D P51$ UHPDLQHG DWWDFKHG WR WKH F\WRVNHOHWRQ LQ SXURP\FLQ WUHDWHG +H/D FHOOV 7DEOH f ,Q DGGLWLRQ b RI WKH + DQG + KLVWRQH SRO\ $f P51$ DQG b RI WKHFIRV P51$ UHPDLQHG DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ +H/D FHOOV WUHDWHG ZLWK SXURP\FLQ 7DEOH f 'LVFXVVLRQ 7KHUH LV JURZLQJ VXSSRUW IRU WKH K\SRWKHVLV WKDW WKH F\WRVNHOHWRQ RI HXNDU\RWHV LV PRUH WKDQ D VWUXFWXUDO VFDIIROG (YLGHQFH LV DFFXPXODWLQJ WR VXJJHVW WKDW WKH F\WRVNHOHWRQ LV D G\QDPLF VWUXFWXUH WKDW SOD\V DQ LQWHJUDO UROH LQ WKH SURFHVV RI SURWHLQ V\QWKHVLV ,Q DGGLWLRQ WKH F\WRVNHOHWRQ PD\ LQIOXHQFH WKH SRVWWUDQVFULSWLRQDO UHJXODWLRQ RI HXNDU\RWLF JHQHV E\ FRPSDUWPHQWDOL]LQJ P51$V ZLWKLQ WKH F\WRSODVPLF VSDFH ,W LV WKHUHIRUH RI LPSRUWDQFH WR VWXG\ WKH LQWHUDFWLRQV RI HXNDU\RWLF P51$V ZLWK WKH F\WRVNHOHWRQ 7KH H[SHULPHQWV SUHVHQWHG KHUH ZHUH GHVLJQHG WR H[DPLQH WKH DVVRFLDWLRQ RI VSHFLILF P51$V ZLWK WKH F\WRVNHOHWRQ $V GHVFULEHG SUHYLRXVO\ DQG FRQILUPHG LQ WKLV VWXG\ KLVWRQH P51$ DQG +/$% P51$ ZHUH IRXQG SUHGRPLQDQWO\ DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ =DPEHWWL HW DO f ,Q DGGLWLRQ K&*D DQG FIRV P51$V ZHUH DOVR ORFDOL]HG LQ WKH F\WRVNHOHWRQ IUDFWLRQ 5HFHQWO\ LW ZDV VKRZQ WKDW WKH DVVRFLDWLRQ RI SRO\

PAGE 159

$ 51$ ZLWK WKH F\WRVNHOHWRQ FRXOG EH GLVUXSWHG E\ SHUWXUELQJ WKH PLFURILODPHQWV ZLWK F\WRFKDODVLQ LQ +H/D FHOOV 2UQHOOHV HW DO f &RQVLVWHQW ZLWK WKHVH UHVXOWV F\WRFKDODVLQ WUHDWPHQW UHDGLO\ UHOHDVHV FIRV P51$ DQG SRO\$n KLVWRQH P51$ IURP WKH F\WRVNHOHWRQ LQWR WKH VROXEOH SKDVH 6XUSULVLQJO\ +/$% P51$ DQG K&*D P51$ ZHUH RQO\ SDUWLDOO\ UHOHDVHG IURP WKH F\WRVNHOHWRQ LQ F\WRFKDODVLQ WUHDWHG +H/D FHOOV 7KH LQHIILFLHQF\ RI F\WRFKDODVLQ LQ UHOHDVLQJ +/$% DQG K&*D P51$ IURP WKH F\WRVNHOHWRQ DSSHDUV WR EH D UHVXOW RI WKH DVVRFLDWLRQ RI WKHVH P51$V ZLWK PHPEUDQHERXQG SRO\VRPHV 'LVVRFLDWLRQ RI WKH SRO\VRPHV ZLWK SXURP\FLQ LQ WKH SUHVHQFH RI F\WRFKDODVLQ UHOHDVHV +/$% DQG K&*D P51$ IURP WKH F\WRVNHOHWRQ ,Q FRQWUDVW F\FORKH[LPLGH DQ LQKLELWRU RI SURWHLQ V\QWKHVLV WKDW SUHVHUYHV SRO\VRPDO VWUXFWXUH IDLOV WR UHOHDVH +/$% P51$ IURP WKH F\WRVNHOHWRQ LQ F\WRFKDODVLQ WUHDWHG FHOOV 7KHVH UHVXOWV VXJJHVW WKDW PHPEUDQHERXQG SRO\VRPDO P51$V DUH DWWDFKHG WR WKH F\WRVNHOHWRQ LQ DW OHDVW WZR GLIIHUHQW ZD\V 7KH ILUVW F\WRVNHOHWRQ DWWDFKPHQW VLWH LV WKURXJK WKH P51$P513 LWVHOI DQG LV VHQVLWLYH WR F\WRFKDODVLQ WUHDWPHQW 7KLV VLWH LV PRVW OLNHO\ FRPPRQ WR DOO F\WRVNHOHWDO DVVRFLDWHG P51$V LQ +H/D FHOOV DQG KDV EHHQ SUHYLRXVO\ REVHUYHG IRU SRO\ $ 51$ E\ 2UQHOOHV HW DO f 7KH VHFRQG F\WRVNHOHWDO DWWDFKPHQW VLWH ZKLFK LV FKDUDFWHULVWLF RI PHPEUDQHERXQG SRO\VRPHV DSSHDUV WR EH PHGLDWHG E\ WKH QDVFHQW SRO\SHSWLGH

PAGE 160

DQGRU ULERVRPH WKDW LV FRPSOH[HG ZLWK WKH HQGRSODVPLF UHWLFXOXP 7KH SRVVLELOLW\ WKDW WKH QDVFHQW SRO\SHSWLGH VHUYHV DV DQ DGGLWLRQDO F\WRVNHOHWRQ DWWDFKPHQW VLWH IRU PHPEUDQHERXQG SRO\VRPHV LV VXSSRUWHG E\ WKH REVHUYDWLRQ WKDW QDVFHQW SRO\SHSWLGHV XQGHUJRLQJ WUDQVORFDWLRQ LQWR WKH OXPHQ RI WKH HQGRSODVPLF UHWLFXOXP DUH UHVLVWDQW WR SURWHDVH GLJHVWLRQ IROORZLQJ GHWHUJHQW H[WUDFWLRQ &RQQROO\ HW DO f 7KH SURWHFWLRQ RI WKH QDVFHQW SRO\SHSWLGHV IURP SURWHDVH GLJHVWLRQ LQ WKH DEVHQFH RI PHPEUDQHV DSSHDUV WR EH GXH WR WKH DVVRFLDWLRQ RI WKH SRO\SHSWLGH ZLWK WKH SURWHLQV RI WKH WUDQVORFDWLRQ DSSDUDWXV RI WKH HQGRSODVPLF UHWLFXOXP 7R UHOHDVH PHPEUDQHERXQG SRO\VRPDO P51$V HIILFLHQWO\ IURP WKH F\WRVNHOHWRQ ERWK F\WRVNHOHWDO DWWDFKPHQW VLWHV PXVW EH GLVUXSWHG 'LVVRFLDWLRQ RI WKH SRO\VRPHV ZLWK SXURP\FLQ DORQH IDLOV WR UHOHDVH PHPEUDQHERXQG SRO\VRPDO P51$ IURP WKH F\WRVNHOHWRQ ,Q WKLV FDVH WKH P51$ UHPDLQV DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ WKURXJK WKH F\WRFKDODVLQ VHQVLWLYH VLWH HYHQ WKRXJK WKH SRO\VRPHV DUH QR ORQJHU DQFKRUHG WR WKH HQGRSODVPLF UHWLFXOXP &RQVLVWHQW ZLWK WKLV UHDVRQLQJ F\WRFKDODVLQ WUHDWPHQW DORQH UHVXOWV LQ RQO\ D SDUWLDO UHOHDVH RI PHPEUDQHERXQG SRO\VRPDO P51$ IURP WKH F\WRVNHOHWRQ 7KH SDUWLDO UHOHDVH RI PHPEUDQHERXQG SRO\VRPDO P51$ IURP WKH F\WRVNHOHWRQ LQ F\WRFKDODVLQ WUHDWHG FHOOV LV PRVW OLNHO\ D UHVXOW RI WKH UHOHDVH RI P51$ IURP WKH F\WRFKDODVLQ VHQVLWLYH F\WRVNHOHWRQ DWWDFKPHQW

PAGE 161

VLWH FRXSOHG ZLWK D SDUWLDO UXQ RII RI WKH SRO\VRPHV IURP WKH P51$ ZKLFK LQ HIIHFW GLVVRFLDWHV WKH QDVFHQW SRO\SHSWLGH IURP WKH P51$ ,Q DGGLWLRQ WR WKH GLIIHUHQWLDO DVVRFLDWLRQ RI PHPEUDQHERXQG DQG QRQPHPEUDQHERXQG SRO\VRPHV ZLWK WKH F\WRVNHOHWRQ WKHUH DOVR DSSHDUV WR EH GLIIHUHQFHV LQ WKH F\WRVNHOHWDO LQWHUDFWLRQ RI LQGLYLGXDO VSHFLHV RI P51$ $V VHHQ LQ 7DEOH K&*D P51$ DQG +/$% P51$ DUH UHOHDVHG IURP WKH F\WRVNHOHWRQ WR WKH VDPH H[WHQW GXULQJ &' DQG SXURP\FLQ FRWUHDWPHQW ZKLFK LV FRQVLVWHQW ZLWK WKH PHFKDQLVP IRU WKH DVVRFLDWLRQ RI PHPEUDQHERXQG SRO\VRPHV ZLWK WKH F\WRVNHOHWRQ DV GHVFULEHG DERYH +RZHYHU &' DQG F\FORKH[LPLGH FRWUHDWPHQW UHOHDVHV D ODUJHU SHUFHQWDJH RI K&*D P51$ IURP WKH F\WRVNHOHWRQ WKDQ &' WUHDWPHQW DORQH ,Q FRQWUDVW +/$% P51$ LV DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ WR WKH VDPH H[WHQW RU JUHDWHU LQ F\WRFKDODVLQ DQG F\FORKH[LPLGH FRWUHDWHG FHOOV WKDQ +H/D FHOOV WUHDWHG ZLWK &' DORQH )XUWKHUPRUH &' DQG F\FORKH[LPLGH FRWUHDWPHQW UHDGLO\ GLVVRFLDWHV KLVWRQH P51$ IURP WKH F\WRVNHOHWRQ ZKHUHDV FIRV P51$ LV RQO\ SDUWLDOO\ DIIHFWHG 7KHVH UHVXOWV VXJJHVW WKDW PXOWLSOH PHFKDQLVPV DUH RSHUDWLYH IRU WKH DVVRFLDWLRQ RI LQGLYLGXDO P51$V DQGRU SRO\VRPHV ZLWK WKH F\WRVNHOHWRQ DQG PD\ UHIOHFW GLIIHUHQFHV LQ WKH VWUXFWXUDO HQYLURQPHQW RI WKH FHOO 7KH SRVVLELOLW\ WKDW WKH VWUXFWXUDO HQYLURQPHQW RI WKH FHOO PD\ DIIHFW F\WRVNHOHWDOP51$ LQWHUDFWLRQV LV VXSSRUWHG

PAGE 162

E\ WKH DSSDUHQW FHOO W\SH VSHFLILF GLIIHUHQFHV WKDW DUH REVHUYHG IRU WKH FRPSRQHQWV RI WKH F\WRVNHOHWRQ WKDW DUH LQYROYHG LQ WKH DWWDFKPHQW RI P51$ DQG SRO\VRPHV $GDPV HW DO f IRXQG WKDW SRO\ULERVRPHV LQ UDW OLYHU FHOOV DUH DVVRFLDWHG ZLWK WKH PLFURILODPHQWV DQG DUH UHOHDVHG IURP WKH F\WRVNHOHWRQ E\ GHR[\ULERQXFOHDVH '1DVH ,f DQ HQ]\PH WKDW FDQ GHSRO\PHUL]H DFWLQ 3UHWUHDWPHQW RI WKH UDW OLYHU FHOOV ZLWK SKDOORLGLQ D FRPSRXQG WKDW VWDELOL]HV DFWLQ ILODPHQWV DEURJDWHV WKH '1DVH HIIHFWV RQ WKH SRO\ULERVRPHF\WRVNHOHWRQ LQWHUDFWLRQV $GDPV HW DO f &RQVLVWHQW ZLWK WKLV UHVXOW SRO\ $ 51$ WUDQVODWLRQ IDFWRUV DQG QHDUO\ b RI WKH SRO\VRPHV DUH SUHIHUHQWLDOO\ DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ +H/D FHOOV DQG FDQ EH UHOHDVHG LQWR WKH VROXEOH SKDVH E\ WKH GLVUXSWLRQ RI WKH PLFURILODPHQWV ZLWK F\WRFKDODVLQ % RU F\WRFKDODVLQ /HQN HW DO +RZH DQG +HUVKH\ 2UQHOOHV HW DO f ,Q FRQWUDVW -HIIHU\ f UHSRUWHG WKDW WKH DVVRFLDWLRQ RI DFWLQ P51$ DQG KLVWRQH P51$ ZLWK WKH F\WRVNHOHWRQ LQ DVFLGLDQ HJJV LV QRW DIIHFWHG E\ F\WRFKDODVLQ % WUHDWPHQW ZKLFK VXJJHVWV WKDW WKH DVVRFLDWLRQ LV LQGHSHQGHQW RI WKH PLFURILODPHQWV )XUWKHUPRUH GLVUXSWLRQ RI WKH PLFURILODPHQWV E\ F\WRFKDODVLQ % WUHDWPHQW GRHV QRW UHOHDVH SRO\ $ KLVWRQH + P51$ IURP WKH F\WRVNHOHWRQ LQ / UDW P\REODVW FHOOV %DJFKL HW DOBLB f

PAGE 163

7KH DVVRFLDWLRQ RI P51$ ZLWK WKH F\WRVNHOHWRQ DOVR DSSHDUV WR FKDQJH GXULQJ GLIIHUHQWLDWLRQ LQ FHUWDLQ FHOO W\SHV 7RK HW DO f 0LFURVFRSLF DQDO\VLV RI IHWDO UDW OXQJ ILEUREODVW FHOOV LQGLFDWHV WKDW SRO\ULERVRPHV DUH DOLJQHG LQ OLQHDU DUUD\V DORQJ WKH DFWLQOLNH VWUHVV ILEHUV 7RK Hf DOA f 7KHVH SRO\VRPHV DUH GLIILFXOW WR YLVXDOL]H DIWHU GLVUXSWLRQ RI WKH PLFURILODPHQWV E\ F\WRFKDODVLQ % WUHDWPHQW DQG DUH SUHVXPHG WR EH UHOHDVHG IURP WKH F\WRVNHOHWRQ LQWR WKH VROXEOH SKDVH 3RO\VRPHV LQ WKH PRUH GLIIHUHQWLDWHG IHWDO OXQJ ILEUREODVWV DUH DVVRFLDWHG ZLWK WKH HQGRSODVPLF UHWLFXOXP DQG DUH QR ORQJHU DIIHFWHG E\ F\WRFKDODVLQ % WUHDWPHQW 7RK HW DO f 7KHVH UHVXOWV DUH FRQVLVWHQW ZLWK WKH SRVVLELOLW\ WKDW WKH DVVRFLDWLRQ RI SRO\VRPHV ZLWK WKH F\WRVNHOHWRQ FKDQJHV GXULQJ GLIIHUHQWLDWLRQ ,Q FRQFOXVLRQ WKH UHVXOWV SUHVHQWHG KHUH SURYLGH HYLGHQFH IRU KHWHURJHQHLW\ LQ WKH LQWHUDFWLRQV RI P51$ ZLWK WKH F\WRVNHOHWRQ LQ +H/D FHOOV 0HPEUDQHERXQG DQG QRQ PHPEUDQHERXQG SRO\VRPHV DUH GLIIHUHQWLDOO\ DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ 6WXGLHV RQ WKH DVVRFLDWLRQ RI P51$ ZLWK WKH F\WRVNHOHWRQ PXVW WDNH LQWR FRQVLGHUDWLRQ WKHVH GLIIHUHQFHV ZKHQ LQWHUSUHWLQJ ZKLFK HOHPHQWV DUH LQYROYHG LQ WKH F\WRVNHOHWDO DWWDFKPHQW RI P51$ )DLOXUH WR UHOHDVH P51$ IURP WKH F\WRVNHOHWRQ ZLWK F\WRFKDODVLQV PD\ RQO\ VXJJHVW WKDW DGGLWLRQDO F\WRVNHOHWDO DWWDFKPHQW VLWHV DUH LQYROYHG 7KH GLIIHUHQWLDO DVVRFLDWLRQ RI P51$ ZLWK WKH F\WRVNHOHWRQ

PAGE 164

PD\ SOD\ DQ LPSRUWDQW SDUW LQ WKH VXEFHOOXODU ORFDOL]DWLRQ RI PHVVHQJHU 51$ ZKLFK PD\ XOWLPDWHO\ DIIHFW SRVWWUDQVFULSWLRQDO UHJXODWLRQ $W WKLV WLPH ZH FDQ QRW UXOH RXW WKH SRVVLELOLW\ WKDW P51$V ORFDOL]HG LQ GLIIHUHQW UHJLRQV RI WKH F\WRSODVP DUH DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ E\ GLIIHUHQW PHFKDQLVPV $GGLWLRQDO VWXGLHV DUH FXUUHQWO\ XQGHUZD\ WR GHILQH IXUWKHU WKH DVVRFLDWLRQ RI P51$ ZLWK WKH F\WRVNHOHWRQ DQG ZKDW LQIOXHQFH WKLV VWUXFWXUH KDV RQ WKH UHJXODWLRQ RI HXNDU\RWLF JHQH H[SUHVVLRQ

PAGE 165

&+$37(5 +(7(52*(1(286 3$77(51 )25 &<726.(/(7$/P51$ ,17(5$&7,216 ,QWURGXFWLRQ ,Q WKH SUHFHGLQJ FKDSWHU ZH SUHVHQWHG HYLGHQFH LQGLFDWLQJ WKDW HXNDU\RWLF P51$V DUH DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ D KHWHURJHQHRXV PDQQHU 'LVUXSWLRQ RI WKH PLFURILODPHQWV E\ F\WRFKDODVLQ WUHDWPHQW UHDGLO\ UHOHDVHV QRQPHPEUDQHERXQG SRO\VRPHV IURP WKH F\WRVNHOHWRQ LQWR WKH VROXEOH SKDVH ZKHUHDV PHPEUDQHERXQG SRO\VRPHV UHPDLQ DWWDFKHG WR WKH F\WRVNHOHWRQ 7KH F\WRVNHOHWDO DVVRFLDWLRQ RI PHPEUDQHERXQG SRO\VRPDO P51$V RFFXUV WKURXJK DW OHDVW WZR GLVWLQFW VLWHV D F\WRFKDODVLQ VHQVLWLYH VLWH DQG D SXURP\FLQ VHQVLWLYH VLWH ZKLFK LV WKH LQWHUDFWLRQ RI WKH QDVFHQW SRO\SHSWLGHSRO\VRPH ZLWK WKH SURWHLQ VXEVWUXFWXUH RI WKH HQGRSODVPLF UHWLFXOXP &KDSWHU f 7R UHOHDVH PHPEUDQHERXQG SRO\VRPHV IURP WKH F\WRVNHOHWRQ ERWK DWWDFKPHQW VLWHV PXVW EH GLVUXSWHG DV VHHQ GXULQJ F\WRFKDODVLQ DQG SXURP\FLQ FRWUHDWPHQW 3UHYLRXVO\ ZH KDYH GHPRQVWUDWHG WKDW D VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ 63+(f LV WDUJHWHG IURP QRQPHPEUDQHERXQG SRO\VRPHV WKH QDWXUDO VLWH RI KLVWRQH SURWHLQ V\QWKHVLV WR PHPEUDQHERXQG SRO\VRPHV &KDSWHU f 5HORFDWLQJ WKH KLVWRQH P51$ ZLWKLQ

PAGE 166

WKH FHOO HQDEOHG XV WR H[DPLQH P51$F\WRVNHOHWRQ LQWHUDFWLRQV LQ PRUH GHWDLO 7KH UHVXOWV SUHVHQWHG KHUH LQGLFDWH WKDW WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ LV DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ D PDQQHU XQOLNH WKDW UHSRUWHG IRU PHPEUDQHERXQG DQG QRQPHPEUDQHERXQG SRO\VRPHV 7KHVH UHVXOWV DUH FRQVLVWHQW ZLWK WKH H[LVWHQFH RI D F\WRVNHOHWDO DWWDFKPHQW HOHPHQW ZLWKLQ WKH P513 RU P51$ SULPDU\ VHTXHQFH DQG SURYLGH DGGLWLRQDO HYLGHQFH IRU KHWHURJHQHLW\ LQ P51$F\WRVNHOHWRQ LQWHUDFWLRQV 5HVXOWV 7R LQYHVWLJDWH IXUWKHU WKH PHFKDQLVP RI P51$ DWWDFKPHQW WR WKH F\WRVNHOHWRQ ZH KDYH VWXGLHG DQG FRPSDUHG WKH F\WRVNHOHWDO DVVRFLDWLRQ RI HQGRJHQRXV QRQPHPEUDQHERXQG SRO\VRPDO KLVWRQH P51$ ZLWK WKDW RI PHPEUDQHERXQG SRO\VRPDO VLJQDO SHSWLGHKLVWRQH FKLPHULF P51$ ,Q &KDSWHU ZH KDYH GHVFULEHG WKH FRQVWUXFWLRQ RI D VLJQDO SHSWLGH KLVWRQH FKLPHULF JHQH 63+(f WKDW ZKHQ WUDQVIHFWHG LQWR +H/D FHOOV LV WUDQVFULEHG DQG WKH UHVXOWLQJ FKLPHULF KLVWRQH P51$V DUH WDUJHWHG WR PHPEUDQHERXQG SRO\VRPHV =DPEHWWL HW DO f $OWKRXJK WKH VLJQDO SHSWLGH IXVHG WR WKH KLVWRQH JHQH LV GHULYHG IURP WKH EHWDODFWDPDVH JHQH RI WKH (/B FROL SODVPLG S%5 LW LV IXQFWLRQDO LQ +H/D FHOOV &KDSWHU f )LJXUH VFKHPDWLFDOO\ GLDJUDPV HQGRJHQRXV + KLVWRQH DQG WKH VLJQDO SHSWLGHKLVWRQH 63+(f P51$V

PAGE 167

0RQRFORQDO +H/D FHOO OLQHV H[SUHVVLQJ WKH FKLPHULF JHQH ZHUH IUDFWLRQDWHG LQWR F\WRVNHOHWRQ DQG VROXEOH SKDVHV DV GHVFULEHG E\ &HUYHUD HW DO f 6XEVHTXHQWO\ 51$ IURP HDFK IUDFWLRQ ZDV LVRODWHG DQG 63+( FKLPHULF P51$ DQG HQGRJHQRXV + KLVWRQH P51$ FRQWHQW ZDV GHWHUPLQHG E\ 6, QXFOHDVH SURWHFWLRQ DQDO\VLV &KDSWHU f $V VHHQ LQ )LJXUH DQG 7DEOH ERWK HQGRJHQRXV KLVWRQH DQG 63+( P51$V DUH SUHGRPLQDQWO\ DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ FRQWURO FHOOV b DQG b UHVSHFWLYHO\f &\WRFKDODVLQ WUHDWPHQW > JPO@ EURXJKW DERXW D OLPLWHG UHOHDVH RI 63+( P51$ IURP WKH F\WRVNHOHWRQ DV H[SHFWHG IRU D PHPEUDQHERXQG SRO\VRPDO P51$ 2QO\ b RI 63+( P51$ FRPSDUHG WR b RI HQGRJHQRXV KLVWRQH P51$ ZDV GLVVRFLDWHG IURP WKH F\WRVNHOHWRQ LQ &' WUHDWHG FHOOV $V GHVFULEHG DERYH GLVVRFLDWLRQ RI WKH ULERVRPHV E\ SXURP\FLQ GXULQJ F\WRFKDODVLQ WUHDWPHQW LV QHFHVVDU\ IRU WKH HIILFLHQW UHOHDVH RI PHPEUDQHERXQG SRO\VRPDO P51$V IURP WKH F\WRVNHOHWRQ 6XUSULVLQJO\ &' DQG SXURP\FLQ FRWUHDWPHQW DOVR IDLOHG WR UHOHDVH WKH 63+( P51$ IURP WKH F\WRVNHOHWRQ *UHDWHU WKDQ b RI WKH VLJQDO SHSWLGHKLVWRQH FKLPHULF P51$ DQG OHVV WKDQ b RI HQGRJHQRXV + KLVWRQH P51$ UHPDLQHG DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ DIWHU &' DQG SXURP\FLQ FRWUHDWPHQW 7KH VHOHFWLYH UHWHQWLRQ RI WKH FKLPHULF P51$ RQ WKH F\WRVNHOHWRQ GXULQJ &' DQG SXURP\FLQ FRWUHDWPHQW LV GHPRQVWUDWHG E\ WKH PDUNHG LQFUHDVH LQ WKH LQWHQVLW\ RI WKH VLJQDO REWDLQHG IRU WKH VDPH TXDQWLW\ RI

PAGE 168

)LJXUH &YWRFKDODVLQ DQG SXURP\FLQ FRWUHDWPHQW GRHV QRW UHOHDVH 63+( RU 63+($7*n P51$ IURP WKH FYWRVNHOHWRQ &ORQDO FHOO OLQHV H[SUHVVLQJ 63+( RU 63+($7* P51$ ZHUH WUHDWHG ZLWK LJPO F\WRFKDODVLQ P0 SXURP\FLQ RU \TPO F\WRFKDODVLQ DQG P0 SXURP\FLQ 7KH GLVWULEXWLRQ RI HQGRJHQRXV KLVWRQH DQG IXVLRQ P51$V ZLWKLQ WKH F\WRVNHOHWRQ DQG VROXEOH SKDVH IUDFWLRQV ZDV GHWHUPLQHG E\ 6, QXFOHDVH SURWHFWLRQ DQDO\VLV DV GHVFULEHG LQ &KDSWHU $QDO\VLV RI Df 63+( DQG 63+($7* P51$V DQG Ef HQGRJHQRXV + KLVWRQH P51$ /DQHV UHSUHVHQW 51$ VDPSOHV LVRODWHG IURP 63+( H[SUHVVLQJ FHOOV DQG ODQHV UHSUHVHQW 51$ VDPSOHV LVRODWHG IURP 63+($7* FHOO FXOWXUHV /DQHV DQG FRQWUROFVN 51$ ODQHV DQG FRQWUROVRO 51$ ODQHV DQG &'FVN 51$ ODQHV DQG &'VRO 51$ ODQHV DQG SXURFVN 51$ ODQHV DQG SXURVRO 51$ ODQHV DQG &'SXURFVN 51$ ODQHV DQG &'SXURVRO 51$

PAGE 169

Df

PAGE 170

7DEOH 7KH SHUFHQW RI FYWRVNHOHWRQ DVVRFLDWHG P51$V LVRODWHG IURP FYWRFKDODVLQ SXURP\FLQ DQG &'SXURP\FLQ WUHDWHG FHOOV &RQWURO &' 3XUR &'3XUR $f 63+( !b b b (QGRJHQRXV + b b f§ b %f 63+( b b b b K&* DOSKD b b b b +/$% b b b b (QGRJHQRXV + b b b b &f 63+($7* !b b !b b K&* DOSKD b b b b +/$% b b b b (QGRJHQRXV + b b b b 7KH GHQVLWRPHWULF UHVXOWV IURP DXWRUDGLRJUDSKV UHSUHVHQWHG LQ )LJXUHV WR $ WR & UHVSHFWLYHO\f ZHUH FRUUHFWHG IRU WKH WRWDO \LHOG RI 51$ IURP HDFK IUDFWLRQ QRWH HTXDO TXDQWLWLHV RI F\WRVNHOHWRQ DQG VROXEOH 51$V ZHUH DQDO\]HG LQ 6, DQG QRUWKHUQ DVVD\V ZKLFK GRHV QRW WDNH LQWR FRQVLGHUDWLRQ WKH XQHTXDO GLVWULEXWLRQ RI 51$ ZLWKLQ WKHVH IUDFWLRQV RU WKH FKDQJHV WKDW RFFXU GXULQJ &' DQGRU SXURP\FLQ WUHDWPHQWf

PAGE 171

51$ LQ WKLV VDPSOH FRPSDUHG ZLWK WKH FRQWURO F\WRVNHOHWRQ VDPSOH )LJXUH ODQH FRPSDUHG WR ODQH f 7KH LQDELOLW\ RI &' DQG SXURP\FLQ WR UHOHDVH 63+( FKLPHULF P51$ HIILFLHQWO\ IURP WKH F\WRVNHOHWRQ LV QRW XQLTXH WR WKH PRQRFORQDO FHOO OLQH DQG LV DOVR REVHUYHG LQ D SRO\FORQDO FHOO SRSXODWLRQ )LJXUH 7DEOH f ,Q WKLV FDVH b RI WKH HQGRJHQRXV + KLVWRQH P51$ DQG OHVV WKDQ b RI WKH 63+( P51$ LV UHOHDVHG IURP WKH F\WRVNHOHWRQ GXULQJ F\WRFKDODVLQ WUHDWPHQW ,Q &' DQG SXURP\FLQ FRWUHDWHG SRO\FORQDO FHOO FXOWXUHV DSSUR[LPDWHO\ b RI WKH HQGRJHQRXV KLVWRQH P51$ DQG b RI WKH 63+( P51$ UHPDLQ DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ 7R LQYHVWLJDWH ZKHWKHU WKH IDLOXUH WR UHOHDVH WKH VLJQDO SHSWLGHKLVWRQH P51$ IURP WKH F\WRVNHOHWRQ ZLWK F\WRFKDODVLQ DQG SXURP\FLQ ZDV UHODWHG WR WKH HIILFLHQF\ RI WKH GUXJ WUHDWPHQWV ZH VWXGLHG WKH DVVRFLDWLRQ RI HQGRJHQRXV PHPEUDQHERXQG SRO\VRPDO P51$V ZLWK WKH F\WRVNHOHWRQ 7KH P51$V FRGLQJ IRU +/$% D FODVV FHOO VXUIDFH KLVWRFRPSDWLELOLW\ DQWLJHQ DQG FKRULRQLF JRQDGRWURSLQ DOSKD K&*Df D VHFUHWHG SURWHLQ DUH WUDQVODWHG RQ PHPEUDQHERXQG SRO\VRPHV DQG ZHOO UHSUHVHQWHG LQ +H/D FHOOV 7KH GLVWULEXWLRQ RI +/$% DQG K&*D P51$ LQ WKH F\WRVNHOHWRQ DQG VROXEOH VDPSOHV XVHG LQ )LJXUH ZDV GHWHUPLQHG E\ 1RUWKHUQ EORW DQDO\VLV )LJXUH DQG 7DEOH f $V H[SHFWHG IRU PHPEUDQHERXQG SRO\VRPDO P51$V +/$% DQG K&*D P51$V ZHUH QRW UHOHDVHG E\ F\WRFKDODVLQ WUHDWPHQW

PAGE 172

)LJXUH 7KH ZLOG W\SH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ LV QRW UHOHDVHG IURP WKH F\WRVNHOHWRQ LQ &' DQG SXURPYFLQ FRWUHDWHG SRO\FORQDO +H/D FHOO FXOWXUHV 3RO\FORQDO FHOO FXOWXUHV H[SUHVVLQJ WKH 63+( IXVLRQ JHQH ZHUH WUHDWHG ZLWK F\WRFKDODVLQ DQG SXURP\FLQ IRU PLQXWHV &\WRVNHOHWRQ DQG VROXEOH 51$V ZHUH LVRODWHG DQG VXEMHFWHG WR 6, QXFOHDVH SURWHFWLRQ DQDO\VLV DV GHVFULEHG LQ &KDSWHU /DQH FRQWUROFVN" ODQH FRQWUROVRO ODQH &' > 0JPO@FVN ODQH &' > JPO@VRO ODQH &' > 0JPO@FVN ODQH &' > LJPO @VRO ODQH &' > MJPO@ DQG SXUR > P0@FVN DQG ODQH &' > MXJPO@ DQG SXUR > P0@VRO 0: LV UDGLRODEHOHG +SD ,, GLJHVW RI S%5

PAGE 173

0: 63+( H[FHVV SUREH (QGRJHQRXV +

PAGE 174

)LJXUH (QGRJHQRXV PHPEUDQHERXQG SRO\VRPDO P51$V DUH UHOHDVHG IURP WKH FYWRVNHOHWRQ GXULQJ FRWUHDWPHQW ZLWK &' DQG SXURP\FLQ LQ 63+( DQG 63+($7*n H[SUHVVLQJ FHOO FXOWXUHV &\WRVNHOHWRQ DQG VROXEOH 51$V JVDPSOHf ZHUH DVVD\HG E\ 1RUWKHUQ EORW DQDO\VLV IRU +/$% P51$ DQG FKRULRQLF JRQDGRWURSLQ P51$ FRQWHQW DV GHVFULEHG LQ &KDSWHU /DQH FRQWUROFVN ODQH FRQWUROVRO ODQH &'FVN" ODQH &'VRO" ODQH SXURFVN" ODQH SXURVRO ODQH &'SXURFVN DQG ODQH &'SXURVRO

PAGE 175

63+( 63+($7* +/$% K&*

PAGE 176

DORQH 2YHU b RI WKHVH P51$V ZHUH DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ DIWHU &' WUHDWPHQW ,Q FRQWUDVW OHVV WKDQ b RI WKH K&*D DQG +/$% P51$V UHPDLQHG DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ DIWHU &' DQG SXURP\FLQ FRWUHDWPHQW LQGLFDWLQJ WKDW WKH GUXJ WUHDWPHQWV ZHUH HIIHFWLYH 7KH DVVRFLDWLRQ RI WKH VLJQDO SHSWLGHKLVWRQH P51$ ZLWK WKH F\WRVNHOHWRQ LQ &' DQG SXURP\FLQ FRWUHDWHG FHOOV VXJJHVWV WKH H[LVWHQFH RI D F\WRVNHOHWRQ DWWDFKPHQW VLWH WKDW LV GLVWLQFW IURP WKH VLWH DVVRFLDWHG ZLWK HQGRJHQRXV KLVWRQH P51$ DQG IURP RWKHU PHPEUDQHERXQG SRO\VRPHV 7KHVH UHVXOWV LQGLFDWH WKDW WKH VLWH LV LQGHSHQGHQW RI WKH ULERVRPHV DQG WKH QDVFHQW SRO\SHSWLGH DQG PD\EH D SURSHUW\ RI WKH QXFOHRWLGH VHTXHQFH DQGRU SURWHLQV WKDW LQWHUDFW ZLWK WKH P51$ LWVHOI $OWHUQDWLYHO\ WKH 63+( FKLPHULF P51$ PD\ EH HIILFLHQWO\ WUDQVODWHG DQG WKHUHIRUH VXSSRUW UHn LQLWLDWLRQ RI WUDQVODWLRQ HYHQ LQ WKH SUHVHQFH RI F\WRFKDODVLQ DQG SXURP\FLQ QRWH HQGRJHQRXV KLVWRQH P51$V DUH HIILFLHQWO\ WUDQVODWHG 6WDKO DQG *DOOZLW] f 7KLV ZRXOG UHVXOW LQ WKH V\QWKHVLV RI D SRUWLRQ RI WKH VLJQDO SHSWLGH ZKLFK FRXOG WKHQ VHUYH DV DQ DQFKRU WR WKH F\WRVNHOHWDO VWUXFWXUH DV LI WKH FHOOV ZHUH WUHDWHG ZLWK F\WRFKDODVLQ DORQH 7R DGGUHVV WKLV SRVVLELOLW\ ZH KDYH VWXGLHG WKH F\WRVNHOHWDO DVVRFLDWLRQ RI D PXWDWHG VLJQDO SHSWLGHKLVWRQH FKLPHULF P51$ 63+($7* f 8VLQJ VLWH GLUHFWHG PXWDJHQHVLV =ROOHU DQG 6PLWK f WKH $7* WUDQVODWLRQ VWDUW FRGRQ IRU

PAGE 177

WKH VLJQDO SHSWLGH RI 63+( ZDV FKDQJHG WR 77* )LJXUH f 7UDQVODWLRQ VKRXOG WKHUHIRUH E\SDVV WKLV DOWHUHG VWDUW FRGRQ DQG LQLWLDWH DW WKH QRUPDO $7* FRGRQ LQ WKH KLVWRQH FRGLQJ UHJLRQ UHVXOWLQJ LQ WKH V\QWKHVLV RI KLVWRQH SURWHLQ ZLWKRXW WKH VLJQDO SHSWLGH VHTXHQFH ,QLWLDO VWXGLHV XVLQJ D +H/D PRQRFORQDO FHOO OLQH H[SUHVVLQJ WKH 63+($7* JHQH GHPRQVWUDWHG WKH ORFDOL]DWLRQ RI 63+($7* P51$ RQ QRQPHPEUDQHERXQG SRO\VRPHV ZKLFK LQGLFDWHV WKDW LQ YLYR WKH VLJQDO SHSWLGH ZDV QRW V\QWKHVL]HG )LJ f $V VHHQ LQ )LJXUH JUHDWHU WKDQ b RI 63+($7*f P51$ LV DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ WKH FRQWURO FHOO FXOWXUH &\WRFKDODVLQ DQG SXURP\FLQ FRWUHDWPHQW HIIHFWLYHO\ UHOHDVHG K&*FU DQG +/$% P51$ IURP WKH F\WRVNHOHWRQ ZLWK OLWWOH RU QR HIIHFW RQ WKH DVVRFLDWLRQ RI WKH 63+($7* P51$ ZLWK WKH F\WRVNHOHWRQ )LJXUHV DQG 7DEOH f $SSUR[LPDWHO\ b RI 63+($7* P51$ DQG OHVV WKDQ b RI +/$ DQG K&*D P51$ UHPDLQHG DWWDFKHG WR WKH F\WRVNHOHWRQ XQGHU WKHVH FRQGLWLRQV 5HJDUGOHVV RI ZKHWKHU WKH 63+($7*n P51$ FRXOG EH WUDQVODWHG LQ WKH SUHVHQFH RI F\WRFKDODVLQ DQG SXURP\FLQ QR VLJQDO SHSWLGH ZRXOG EH V\QWKHVL]HG WR DQFKRU WKH PHVVDJH WR WKH F\WRVNHOHWRQ 7KLV UHVXOW IXUWKHU VXSSRUWV WKH SURSRVDO WKDW WKH QXFOHRWLGH VHTXHQFHV FRGLQJ IRU WKH VLJQDO SHSWLGH H[SUHVV D F\WRVNHOHWRQ DWWDFKPHQW VLWH ZKLFK LV GLVWLQFW IURP WKH F\WRVNHOHWDO DWWDFKPHQW VLWH RI HQGRJHQRXV KLVWRQH P51$

PAGE 178

'LVFXVVLRQ 7KH GDWD SUHVHQWHG LQ WKLV FKDSWHU GHPRQVWUDWH WKDW WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$V 63+( DQG 63+($7*f H[SUHVV D F\WRVNHOHWRQ DWWDFKPHQW VLWH WKDW LV QRW DVVRFLDWHG ZLWK KLVWRQH P51$ +/$% P51$ RU KHWHURJHQHRXV SRO\$A P51$ &KDSWHU 2UQHOOHV HW DO f ,W LV QRW NQRZQ ZKHWKHU WKH F\WRVNHOHWRQ DWWDFKPHQW VLWH XQLTXH WR 63+( DQG 63+($7* P51$ LV GXH GLUHFWO\ WR WKH SULPDU\ QXFOHRWLGH VHTXHQFHV FRGLQJ IRU WKH VLJQDO SHSWLGH DQ DOWHUDWLRQ LQ WKH RYHUDOO FRQIRUPDWLRQ RI WKH P51$ RU WKH SURWHLQV DVVRFLDWHG ZLWK WKH P513 7KH HOHPHQWV RI WKH F\WRVNHOHWRQ WKDW DUH LQYROYHG LQ WKH DWWDFKPHQW RI 63+( P51$ DQG 63+($7* GXULQJ F\WRFKDODVLQ DQG SXURP\FLQ FRWUHDWPHQW KDYH QRW EHHQ LGHQWLILHG $VVRFLDWLRQ RI WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$V ZLWK WKH F\WRVNHOHWRQ GXULQJ F\WRFKDODVLQ DQG SXURP\FLQ FRWUHDWPHQW LQGLFDWHV WKDW WKH DWWDFKPHQW VLWH LV LQGHSHQGHQW RI LQWDFW PLFURILODPHQWV ,Q DGGLWLRQ WKH F\WRFKDODVLQ DQG SXURP\FLQ LQVHQVLWLYH F\WRVNHOHWRQ DWWDFKPHQW VLWH GRHV QRW GLUHFWO\ LQYROYH WKH PLFURWXEXOHV VLQFH WKLV F\WRVNHOHWDO FRPSRQHQW LV UHPRYHG GXULQJ WKH IUDFWLRQDWLRQ SURFHGXUH /HQN HW DO f 7KH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$V PD\ EH DVVRFLDWHG ZLWK WKH LQWHUPHGLDWH ILODPHQWV RI WKH F\WRVNHOHWRQ 3UHYLRXV VWXGLHV RQ RWKHU FHOO W\SHV LQGLFDWH WKDW P513V DUH DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ WKURXJK WKH LQWHUPHGLDWH ILODPHQWV

PAGE 179

-HIIHU\ %DJFKL HW DO f )XUWKHUPRUH SURVRPHV ZKLFK DUH VPDOO ULERQXFOHRSURWHLQ FRPSOH[HV WKDW DUH DVVRFLDWHG ZLWK WUDQVODWLRQDOO\ LQDFWLYH P51$V DUH DWWDFKHG WR WKH F\WRNHUDWLQLQWHUPHGLDWH ILODPHQWV LQ +H/D FHOOV *URVVL GH 6D HW DO f 7KH UROH RI WKH LQWHUPHGLDWH ILODPHQWV LQ WKH DWWDFKPHQW RI WKH FKLPHULF P51$V WR WKH F\WRVNHOHWRQ UHPDLQV WR EH GHWHUPLQHG ,Q &KDSWHU ZH GHPRQVWUDWHG WKDW WKH VLJQDO SHSWLGH KLVWRQH IXVLRQ P51$ 63+(f LV UHODWLYHO\ VWDEOH DV FRPSDUHG WR HQGRJHQRXV + KLVWRQH P51$ GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV 7KH XQFRXSOLQJ RI VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ VWDELOLW\ IURP '1$ V\QWKHVLV GRHV QRW DSSHDU WR EH D FRQVHTXHQFH RI LWV DVVRFLDWLRQ ZLWK WKH F\WRVNHOHWRQ WKURXJK WKH F\WRFKDODVLQ DQG SXURP\FLQ LQVHQVLWLYH VLWH 7KH PXWDWHG VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ 63+($7*f LV HIILFLHQWO\ GHVWDELOL]HG GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV DQG PRVW OLNHO\ H[SUHVVHV WKH VDPH &' DQG SXURP\FLQ LQVHQVLWLYH F\WRVNHOHWDO DWWDFKPHQW VLWH DV 63+( P51$ ,Q VXPPDU\ D F\WRVNHOHWDO DWWDFKPHQW VLWH KDV EHHQ GHWHFWHG ZKLFK LV DVVRFLDWHG ZLWK D VLJQDO SHSWLGHKLVWRQH FKLPHULF P51$ 7KLV VLWH DSSHDUV WR EH D GLUHFW RU LQGLUHFW UHVXOW RI WKH QXFOHRWLGH VHTXHQFHV FRGLQJ IRU WKH VLJQDO SHSWLGH 6WXGLHV RQ GHOHWLRQ DQG SRLQW PXWDQWV RI WKH VLJQDO SHSWLGHKLVWRQH FKLPHULF P51$V VKRXOG SURYH XVHIXO LQ SURYLGLQJ LQVLJKW LQWR WKH HOHPHQWV LQYROYHG LQ WKH DWWDFKPHQW RI WKH P51$ WR WKH F\WRVNHOHWRQ

PAGE 180

&+$37(5 7+( ,1)/8(1&( 2) 7+( &<726.(/(721 21 7+( 5(*8/$7,21 2) F)RV *(1( (;35(66,21 ,QWURGXFWLRQ 0RGLILFDWLRQV LQ JHQH H[SUHVVLRQ LV FHQWUDO WR SUROLIHUDWLRQ DQG GLIIHUHQWLDWRQ RI HXNDU\RWLF FHOOV 7KHVH SURFHVVHV DUH WLJKWO\ UHJXODWHG DQG GHSHQGHQW LQ SDUW RQ WKH SUHFLVH H[SUHVVLRQ RI SURWRRQFRJHQHV IRU UHYLHZ VHH 2KOVVRQ DQG 3IHLIHU2KOVVRQ %LVKRS f 7KH SUROLIHUDWLYH UHVSRQVH RI TXLHVFHQW ILEUREODVWV WR VHUXP RU JURZWK IDFWRU VWLPXODWLRQ LV DFFRPSDQLHG E\ D UDSLG DQG WUDQVLHQW LQGXFWLRQ RI WKH FIRV SURWRRQFRJHQH &RFKUDQ HW DO *UHHQEHUJ HW DO &XUUDQ HW DO f :LWKLQ PLQXWHV RI WKH DGGLWLRQ RI VHUXP RU JURZWK IDFWRUV WR TXLHVFHQW ILEUREODVWV WKH FIRV JHQH LV WUDQVFULEHG DQG F IRV F\WRSODVPLF P51$ OHYHOV UDSLGO\ LQFUHDVH *HQHUDOO\ WKH H[SUHVVLRQ RI WKH FIRV JHQH GXULQJ VHUXPJURZWK IDFWRU LQGXFWLRQ LV PD[LPDO DIWHU PLQXWHV DQG UHWXUQV WR SUHn VWLPXODWRU\ OHYHOV ZLWKLQ KRXUV :KLOH WKH H[DFW IXQFWLRQ RI WKH FIRV SURWHLQ LV XQNQRZQ UHFHQW HYLGHQFH VXJJHVWV WKDW WKLV QXFOHDU SURWHLQ LV SDUW RI D '1$ ELQGLQJ

PAGE 181

FRPSOH[ WKDW PD\ LQIOXHQFH WKH WUDQVFULSWLRQ RI VSHFLILF JHQHV &XUUDQ HW DO 6\WR\DPD HW DO 'LVWHO HW DO 5DXVFKHU HW DO f 6LJQDO WUDQVGXFWLRQ PRGHOV GHVFULELQJ WKH LQGXFWLRQ RI FIRV JHQH H[SUHVVLRQ GXH WR WKH ELQGLQJ RI JURZWK IDFWRUVf DW WKH SODVPD PHPEUDQH PXVW LQFOXGH D PHFKDQLVP IRU UHOD\LQJ WKH VWLPXODWRU\ VLJQDO IURP WKH FHOO VXUIDFH WKURXJK WKH F\WRSODVP DQG LQWR WKH QXFOHXV ([LVWLQJ ZLWKLQ WKH F\WRSODVP RI WKH FHOO LV DQ H[WHQVLYH DQG LQWULFDWH SURWHLQ VFDIIROG UHIHUUHG WR DV WKH F\WRVNHOHWRQ IRU UHYLHZ VHH 1LHOVHQ HW DO f ,Q DGGLWLRQ WR LWV VWUXFWXUDO SURSHUWLHV WKH F\WRVNHOHWRQ DOVR DSSHDUV WR IXQFWLRQ LQ FHOO VKDSH FHOO PRWLOLW\ WKH LQWUDFHOOXODU WUDQVSRUW RI PDFURPROHFXOHV DQG WUDQVODWLRQ RI P51$ LQWR SURWHLQ )XUWKHUPRUH WKH F\WRVNHOHWRQ PD\ LQIOXHQFH WKH UHJXODWLRQ RI JHQH H[SUHVVLRQ 6XVSHQVLRQ RI DQFKRUDJH GHSHQGHQW PRXVH 7 ILEUREODVWV LQGXFHV D PRUSKRORJLFDO FKDQJH LQ FHOO VKDSH DQG WKH F\WRVNHOHWRQ ZLWK D FRQFRPLWDQW UHGXFWLRQ LQ '1$ 51$ DQG SURWHLQ V\QWKHVLV %HQHFNH HW DO )DUPHU HW DO f 5HDWWDFKPHQW RI WKHVH FHOOV WR D VROLG VXSSRUW UHVWRUHV FHOO VKDSH DQG F\WRVNHOHWRQ VWUXFWXUH DV ZHOO DV '1$ 51$ DQG SURWHLQ V\QWKHVLV ,Q DGGLWLRQ GLVUXSWLRQ RI WKH PLFURILODPHQWV RI WKH F\WRVNHOHWRQ ZLWK F\WRFKDODVLQ LQ +(S FHOOV UHVXOWV LQ WKH HQKDQFHG H[SUHVVLRQ RI EHWD DQG JDPPD DFWLQ SURWHLQ V\QWKHVLV 7DQQHQEDXP DQG *RGPDQ f 5HPRYDO RI WKH GUXJ UHVWRUHV WKH VWUXFWXUH RI WKH F\WRVNHOHWRQ DQG UHWXUQV DFWLQ V\QWKHVLV WR QRUPDO OHYHOV

PAGE 182

7KH F\WRVNHOHWRQ DOVR DSSHDUV WR SOD\ D UROH LQ WKH WUDQVLWLRQ EHWZHHQ SUROLIHUDWLRQ DQG WKH H[SUHVVLRQ RI GLIIHUHQWLDWHG SKHQRW\SHV )RU H[DPSOH QRUPDO % FHOOV FDQ EH LQGXFHG WR SUROLIHUDWH E\ FRVWLPXODWLRQ ZLWK DQWLn LPPXQRJOREXOLQ DQG % FHOO JURZWK IDFWRU
PAGE 183

H[SUHVVLRQ GRHV QRW DSSHDU WR EH D JHQHUDO SKHQRPHQRQ VLQFH WKH WUDQVFULSWLRQ DQG VWHDG\ VWDWH OHYHOV RI VHYHUDO RWKHU DFWLYH DQG LQDFWLYH JHQHV DUH XQDIIHFWHG E\ WKH GUXJ WUHDWPHQW 7KHVH UHVXOWV LPSO\ WKDW WKH FHOO PRQLWRUV WKH RUJDQL]DWLRQ DQGRU FRPSRVLWLRQ RI WKH F\WRVNHOHWRQ DQG DGMXVW WKH UHJXODWLRQ RI FIRV JHQH H[SUHVVLRQ DFFRUGLQJO\ 7KLV ILQGLQJ LV FRQVLVWHQW ZLWK VLJQDO WUDQVGXFWLRQ PRGHOV SURSRVLQJ WKDW WKH F\WRVNHOHWRQ PD\ EH LQYROYHG LQ UHOD\LQJ VWLPXOL IURP WKH SODVPD PHPEUDQH WR WKH QXFOHXV 5HVXOWV &YWRFKDODVLQ ,QFUHDVHV F)RV P51$ /HYHOV 3UHYLRXV UHSRUWV KDYH VXJJHVWHG WKDW WKH F\WRVNHOHWRQ SOD\V D UROH LQ VLJQDO WUDQVGXFWLRQ DQG WKH UHJXODWLRQ RI JHQH H[SUHVVLRQ 7R IXUWKHU LQYHVWLJDWH WKLV IXQFWLRQDO SURSHUW\ RI WKH F\WRVNHOHWRQ ZH KDYH GLVUXSWHG WKH PLFURILODPHQWV RI +H/D 6 FHOOV ZLWK F\WRFKDODVLQ DQG PHDVXUHG WKH HIIHFWV RQ WUDQVFULSWLRQ DQG P51$ FHOOXODU OHYHOV RI D VHULHV RI JHQHV :LWKLQ PLQXWHV RI WKH DGGLWLRQ RI F\WRFKDODVLQ FHOO PRUSKRORJ\ LV GUDVWLFDOO\ DOWHUHG DV WKH F\WRVNHOHWRQ UHDUUDQJHV ZLWKRXW DQ\ DSSDUHQW TXDQWLWDWLYH RU TXDOLWDWLYH ORVV RI SURWHLQ 0LUDQGD HW DO D 0LUDQGD HW DO E 6FKOLZD 2UQHOOHV HW DO f ,W KDV EHHQ SURSRVHG WKDW F\WRFKDODVLQ DFWV E\ ELQGLQJ WR DFWLQ FDXVLQJ WKH FDSSLQJ RU IUDJPHQWDWLRQ RI WKH PLFURILODPHQWV 6HOGHQ HW DO /LQ HW DO f

PAGE 184

,Q DGGLWLRQ &' DW FRQFHQWUDWLRQV HTXDO WR RU JUHDWHU WKDQ M/WJPO UHOHDVHV SRO\$ 51$ IURP WKH F\WRVNHOHWRQ LQ D GRVH GHSHQGHQW PDQQHU 2UQHOOHV HW DO f 7KH UHOHDVH RI SRO\$ 51$ IURP WKH F\WRVNHOHWRQ RFFXUV LQ D GRVH GHSHQGHQW PDQQHU DQG UHVXOWV LQ D VWRLFKLRPHWULF LQKLELWLRQ RI SURWHLQ V\QWKHVLV 7R VWXG\ LPPHGLDWH JHQH UHVSRQVHV WR F\WRFKDODVLQ H[SRQHQWLDOO\ JURZLQJ +H/D 6 FHOOV ZHUH WUHDWHG ZLWK OLJPO RI WKH GUXJ IRU RQO\ PLQXWHV )URP HDFK FHOO FXOWXUH WRWDO FHOOXODU 51$ IRU 1RUWKHUQ EORW DQDO\VLV DQG QXFOHL IRU LQ YLWUR QXFOHDU UXQRQ WUDQVFULSWLRQ DQDO\VLV ZHUH LVRODWHG DV GHVFULEHG LQ &KDSWHU $V VKRZQ LQ )LJXUH 1RUWKHUQ EORW DQDO\VLV UHYHDOV D UDSLG DQG H[WHQVLYH DFFXPXODWLRQ RI FIRV P51$ LQ &' WUHDWHG FHOOV ODQH f 7KH UHVSRQVH RI WKH FIRV JHQH LV LQ VKDUS FRQWUDVW WR K&*DU P51$ VWHDG\ VWDWH OHYHOV ZKLFK DUH XQDIIHFWHG E\ WKH GUXJ WUHDWPHQW )LJ f 4XDQWLWDWLRQ E\ VFDQQLQJ ODVHU GHQVLWRPHWU\ RI VHYHUDO H[SRVXUHV RI DXWRUDGLRJUDPV REWDLQHG IURP IRXU VHSDUDWH H[SHULPHQWV LQGLFDWHV DQ DYHUDJH LQFUHDVH RI IROG LQ FIRV P51$ OHYHOV )LJ f 7KH FRQFHQWUDWLRQ RI F\WRFKDODVLQ XVHG LQ WKHVH H[SHULPHQWV LQKLELWV SURWHLQ V\QWKHVLV E\ SHUFHQW 2UQHOOHV HW DO f ,W LV ZHOO HVWDEOLVKHG WKDW LQKLELWLRQ RI SURWHLQ V\QWKHVLV OHDGV WR DQ LQFUHDVH LQ FIRV P51$ SUHVXPDEO\ GXH WR LQFUHDVHG P51$ VWDELOLW\ 0XOOHU HW DO 0LWFKHOO HW DO $QGUHZV HW DO 5DKPVGRUI HW DO f

PAGE 185

7R DGGUHVV WKH SRVVLELOLW\ WKDW WKH VWLPXODWLRQ RI FIRV P51$ OHYHOV ZDV GXH WR WKH SDUWLDO LQKLELWLRQ RI SURWHLQ V\QWKHVLV ZH LQYHVWLJDWHG WKH HIIHFW RI SXURP\FLQ DW D FRQFHQWUDWLRQ RI P0 ZKLFK LQKLELWV SURWHLQ V\QWKHVLV E\ PRUH WKDQ SHUFHQW +HOPV HW DO f RQ FIRV JHQH H[SUHVVLRQ &HOOV FXOWXUHG LQ WKH SUHVHQFH RI SXURP\FLQ IRU PLQXWHV H[KLELWHG IROG KLJKHU OHYHOV RI FIRV P51$ FRPSDUHG WR XQWUHDWHG FHOO FXOWXUHV )LJ ODQH DQG )LJXUH f +RZHYHU FRWUHDWPHQW ZLWK &' DQG SXURP\FLQ IRU RQO\ PLQXWHV UHVXOWHG LQ D IROG LQFUHDVH LQ FIRV P51$ OHYHOV )LJ ODQH DQG )LJ f 7KH VXSHULQGXFWLRQ RI FIRV P51$ FHOOXODU OHYHOV E\ F\WRFKDODVLQ DQG SXURP\FLQ FRWUHDWPHQW VXJJHVWV WKDW WKH VWLPXODWLRQ E\ &' DORQH LV QRW GXH VROHO\ WR LWV HIIHFW RQ SURWHLQ V\QWKHVLV DQG PD\ EH WKH UHVXOW RI WKH SHUWXUEDWLRQ RI WKH F\WRVNHOHWRQ .LQHWLFV RI F)RV P51$ $FFXPXODWLRQ 'XULQJ &\WRFKDODVLQ 7UHDWPHQW 7UHDWPHQW RI TXLHVFHQW %$/%&7 PRXVH ILEUREODVW FHOOV ZLWK JURZWK IDFWRUV RU VHUXP UHVXOWV LQ D UDSLG DQG VKRUW OLYHG LQFUHDVH LQ FIRV P51$ OHYHOV &RFKUDQ HW DO *UHHQEHUJ DQG =LII 0XOOHU HW DO f *HQHUDOO\ FHOOXODU OHYHOV RI FIRV P51$ DUH PD[LPDO DIWHU PLQXWHV RI VHUXPJURZWK IDFWRU WUHDWPHQW DQG UHWXUQ WR SUHVWLPXODWRU\ OHYHOV ZLWKLQ DQ KRXU ,Q FRQWUDVW WR VHUXP

PAGE 186

)LJXUH (IIHFWV RI FYWRFKDODVLQ DQG SXURP\FLQ WUHDWPHQW RQ VWHDG\ VWDWH OHYHOV RI FIRV DQG FKRULRQLF JRQDGRWURSLQ P51$ ([SRQHQWLDOO\ JURZLQJ +HOD FHOOV ZHUH WUHDWHG ZLWK F\WRFKDODVLQ > JPO@ SXURP\FLQ > P0@ RU F\WRFKDODVLQ > LJPO@ DQG SXURP\FLQ > P0@ WRJHWKHU IRU PLQXWHV 7KH FHOOV ZHUH KDUYHVWHG DQG WRWDO FHOOXODU 51$ ZDV LVRODWHG &KRULRQLF JRQDGRWURSLQ K&*Df DQG FIRV P51$ OHYHOV ZHUH GHWHUPLQHG E\ 1RUWKHUQ EORW DQDO\VLV DV GHVFULEHG LQ &KDSWHU (DFK ODQH UHSUHVHQWV LJ WRWDO FHOOXODU P51$ /DQHV f FRQWURO" f F\WRFKDODVLQ IRU PLQ f SXURP\FLQ IRU PLQ" DQG f &' DQG SXURP\FLQ IRU PLQXWHV

PAGE 187

FI RV K&*

PAGE 188

)LJXUH 'HQVLWRPHWULF DQODYVLV RI VWHDG\ VWDWH OHYHOV RI FIRV P51$ GXULQJ F\WRFKDODVLQ DQG SXURPYFLQ WUHDWPHQWV 6WHDG\ VWDWH OHYHOV RI FIRV P51$ GXULQJ F\WRFKDODVLQ DQG SXURP\FLQ WUHDWPHQWV ZHUH GHWHUPLQHG E\ GHQVLWRPHWULF DQDO\VLV RI WKH 1RUWKHUQ ILOWHUV 7KH YDOXHV SUHVHQWHG UHSUHVHQW WKH DYHUDJH RI WKH PLQLPDO IROG LQFUHDVH LQ FIRV P51$ OHYHOV GXULQJ WKH GUXJ WUHDWPHQWV DV FRPSDUHG WR WKH FRQWURO VDPSOH %UDFNHWV LQGLFDWH VWDQGDUG HUURU IURP WKUHH LQGHSHQGHQW H[SHULPHQWV

PAGE 189

fIRV ,QGXFWLRQ &'3XUR FRQWURO

PAGE 190

DQG JURZWK IDFWRU VWLPXODWLRQ LQKLELWLRQ RI SURWHLQ V\QWKHVLV SURGXFHV D ODUJHU DFFXPXODWLRQ RI FIRV P51$ OHYHOV ZKLFK SHUVLVWV IRU ORQJHU SHULRGV RI WLPH XVXDOO\ VHYHUDO KRXUV *UHHQEHUJ HW DO 5DKPVGRUI HW DO $QGUHZV HW DO f 7R GHWHUPLQH ZKHWKHU WKH FIRV JHQH UHVSRQVH WR F\WRFKDODVLQ WUHDWPHQW FRUUHVSRQGV WR WKDW REVHUYHG IRU VHUXPJURZWK IDFWRU VWLPXODWLRQ RU LQKLELWLRQ RI SURWHLQ V\QWKHVLV ZH H[DPLQHG WKH NLQHWLFV RI FIRV DFFXPXODWLRQ GXULQJ &' WUHDWPHQW 1RUWKHUQ EORW DQDO\VLV RI WRWDO FHOOXODU 51$ LVRODWHG IURP FHOOV WUHDWHG ZLWK MLJPO F\WRFKDODVLQ IRU YDULRXV OHQJWKV RI WLPH GHPRQVWUDWHG WKDW PD[LPDO LQGXFWLRQ RI FIRV P51$ DSSURDFKLQJ D IROG LQFUHDVH RYHU FRQWURO FXOWXUHV RFFXUHG DIWHU PLQXWHV DQG ZDV IROORZHG E\ D VKDUS GHFOLQH WR QHDU SUHVWLPXODWRU\ OHYHOV ZLWKLQ RQH KRXU )LJ ODQHV f ,Q FRQWUDVW LQKLELWLRQ RI SURWHLQ V\QWKHVLV ZLWK SXURP\FLQ UHVXOWHG LQ PD[LPDO DFFXPXODWLRQ RI FIRV P51$ OHYHOV DIWHU PLQXWHV QHDUO\ IROG KLJKHU WKDQ LQ XQWUHDWHG FHOOV DQG WKH P51$ OHYHOV UHPDLQHG HOHYDWHG IRU DW OHDVW WZR KRXUV )LJ ODQHV f 7KH DFFXPXODWLRQ RI FIRV P51$ LQ &' DQG SXURP\FLQ FRWUHDWHG FHOOV IROORZHG WKH VDPH WLPH FRXUVH DV REVHUYHG IRU SXURP\FLQ WUHDWPHQW DQG UHDFKHG KLJKHU OHYHOV WKDQ ZLWK WKH &' WUHDWPHQW DQG SXURP\FLQ WUHDWPHQW FRPELQHG )LJ ODQHV f 3DUDOOHO VWXGLHV ZHUH GRQH RQ VHUXP VWDUYHG :, KXPDQ GLSORLG ILEUREODVW FHOOV 6WLPXODWLRQ RI TXLHVFHQW FHOO

PAGE 191

FXOWXUHV ZLWK FXOWXUH PHGLXP FRQWDLQLQJ b IHWDO FDOI VHUXP UHVXOWHG LQ DQ LQFUHDVH LQ FIRV P51$ OHYHOV IRU PLQXWHV IROORZHG E\ D VKDUS UHGXFWLRQ WR EDFNURXQG OHYHOV E\ PLQXWHV &\WRFKDODVLQ DIIHFWHG FIRV JHQH H[SUHVVLRQ ZLWK WKH VDPH NLQHWLFV DV VHUXP KRZHYHU VOLJKWO\ KLJKHU OHYHOV RI FIRV P51$ ZHUH PHDVXUHG LQ &' WUHDWHG FHOOV 3XURP\FLQ WUHDWPHQW RU &' DQG SXURP\FLQ FRWUHDWPHQW FDXVHG D FRQWLQXRXV ULVH LQ FIRV P51$ OHYHOV IRU WZR KRXUV ZKLFK ZDV WKH ODVW WLPH SRLQW H[DPLQHG 7KHVH UHVXOWV LQGLFDWH WKDW WKH HIIHFWV RI F\WRFKDODVLQ RQ HLWKHU H[SRQHQWLDOO\ JURZLQJ +H/D FHOOV RU TXLHVFHQW GLSORLG ILEUREODVWV PRUH FORVHO\ UHVHPEOH WKH HIIHFWV RI VHUXP DQG JURZWK IDFWRU VWLPXODWLRQ WKDQ WKH LQKLELWLRQ RI SURWHLQ V\QWKHVLV RQ WKH H[SUHVVLRQ RI FIRV P51$ OHYHOV &\WRFKDODVLQ 6WLPXODWHV WKH 7UDQVFULSWLRQ RI WKH F)RV *HQH 7R DVVHVV WKH FRQWULEXWLRQ RI WUDQVFULSWLRQ WR WKH LQFUHDVH LQ FIRV P51$ OHYHOV GXULQJ &' WUHDWPHQW ZH PHDVXUHG WKH WUDQVFULSWLRQDO DFWLYLW\ RI WKH FIRV JHQH E\ LQ YLWUR QXFOHDU UXQRQ WUDQVFULSWLRQ DQDO\VLV DV GHVFULEHG LQ &KDSWHU 7UHDWPHQW RI +H/D FHOOV ZLWK F\WRFKDODVLQ IRU PLQXWHV UHVXOWHG LQ D VLJQLILFDQW LQFUHDVH LQ WUDQVFULSWLRQ RI WKH FIRV JHQH 7KH GDWD SUHVHQWHG LQ )LJ UHSUHVHQW D WZHOYH IROG LQFUHDVH LQ FIRV WUDQVFULSWLRQ LQ F\WRFKDODVLQ WUHDWHG FHOOV FRPSDUHG WR XQWUHDWHG

PAGE 192

)LJXUH 7LPH FRXUVH RI FIRV P51$ DFFXPXODWLRQ GXULQJ FYWRFKDODVLQ DQG SXURPYFLQ WUHDWPHQWV LQ H[SRQHQWLDOO\ JURZLQJ +H/D FHOOV +H/D FHOOV ZHUH WUHDWHG ZLWK F\WRFKDODVLQ > QTPO@ SXURP\FLQ > P0@ RU F\WRFKDODVLQ DQG SXURP\FLQ IRU WKH LQGLFDWHG WLPHV 7KH FHOOV ZHUH FROOHFWHG DQG WRWDO FHOOXODU 51$ ZDV LVRODWHG 7KH OHYHOV RI FIRV P51$ ZHUH GHWHUPLQHG E\ 1RUWKHUQ EORW DQDO\VLV DV GHVFULEHG LQ &KDSWHU (DFK ODQH UHSUHVHQWV J WRWDO FHOOXODU 51$ /DQHV f FRQWURO PLQ" f FRQWURO PLQ" f '062 FRQWURO PLQ f &' PLQ f &' PLQ f &' PLQ f &' PLQ f &' PLQ f &' PLQ f &'3XUR PLQ f &'3XUR PLQ f &'3XUR PLQ f &'3XUR PLQ f &'3XUR PLQ f &'3XUR PLQ f 3XUR PLQ f 3XUR PLQ f 3XUR PLQ f 3XUR PLQ f 3XUR PLQXWHV

PAGE 193

F)26

PAGE 194

FRQWURO FHOOV ,Q FRQWUDVW SXURP\FLQ WUHDWPHQW IRU PLQXWHV GLG QRW VLJQLILFDQWO\ DIIHFW WKH WUDQVFULSWLRQ RI WKH FIRV JHQH &RWUHDWPHQW RI +H/D FHOOV ZLWK SXURP\FLQ DQG F\WRFKDODVLQ IRU PLQXWHV DOVR VWLPXODWHG FIRV JHQH WUDQVFULSWLRQ ZKLFK LQGLFDWHV WKDW LQKLELWLRQ RI SURWHLQ V\QWKHVLV GXULQJ &' WUHDWPHQW GRHV QRW DIIHFW WKH LQGXFWLRQ RI FIRV WUDQVFULSWLRQ 7DQQHQEDXP DQG FRZRUNHUV KDYH GHPRQVWUDWHG DQ LQFUHDVH LQ DFWLQ WUDQVFULSWLRQ GXULQJ &' WUHDWPHQW f ,Q OLJKW RI WKLV REVHUYDWLRQ ZH PHDVXUHG WKH WUDQVFULSWLRQ RI WKH EHWDDFWLQ JHQH LQ RXU VWXGLHV DV D SRVLWLYH FRQWURO &RQVLVWHQW ZLWK SUHYLRXV ILQGLQJV &' LQFUHDVHG DFWLQ WUDQVFULSWLRQ EXW RQO\ IROG RYHU FRQWURO FHOOV )LJ f &RWUHDWPHQW ZLWK &' DQG SXURP\FLQ IRU PLQXWHV DOVR LQFUHDVHG WUDQVFULSWLRQ RI WKH DFWLQ JHQH IROG FRPSDUHG WR FRQWUROV DQG SUHVXPDEO\ UHIOHFWV WKH HIIHFWV RI WKH F\WRFKDODVLQ )LJ f 7KH F\WRFKDODVLQ VWLPXODWLRQ RI FIRV DQG EHWDDFWLQ WUDQVFULSWLRQ LV XQDIIHFWHG E\ LQKLELWLRQ RI SURWHLQ V\QWKHVLV 7KH HOHYDWLRQ LQ FIRV DQG DFWLQ WUDQVFULSWLRQ GXULQJ F\WRFKDODVLQ WUHDWPHQW PD\ EH SDUW RI D JHQHUDO SKHQRPHQRQ LQ ZKLFK WKH WUDQVFULSWLRQDO DFWLYLW\ RI DOO JHQHV EHFRPHV LQFUHDVHG $OWHUQDWLYHO\ WUDQVFULSWLRQ RI ULERVRPDO 51$ JHQHV E\ 51$ SRO\PHUDVH ZKLFK UHSUHVHQWV DSSUR[LPDWHO\ b RI WKH WUDQVFULSWLRQDO DFWLYLW\ PHDVXUHG E\ QXFOHDU UXQ RQ DVVD\V 0DU]OXII DQG +XDQJ f PD\ EH LQKLELWHG E\

PAGE 195

)LJXUH (IIHFW RI FYWRFKDODVLQ RQ WUDQVFULSWLRQ RI HOn IRV LQ +H/D FHOOV ([SRQHQWLDOO\ JURZLQJ +H/D FHOOV ZHUH WUHDWHG ZLWK F\WRFKDODVLQ SXURP\FLQ RU &' DQG SXURP\FLQ IRU PLQXWHV 5DGLRODEHOHG 51$V ZHUH SUHSDUHG E\ LQ YLWUR QXFOHDU UXQRQ WUDQVFULSWLRQ DQG K\EULGL]HG WR 6RXWKHUQ EORWV RI HOHFWURSKRUHWLFDOO\ VHSDUDWHG UHVWULFWLRQ HQ]\PH GLJHVWHG SODVPLG '1$V FSPILOWHUf ,QVHUW '1$V K\EULGL]LQJ WR WUDQVFULSWV IURP WKH FRUUHVSRQGLQJ JHQHV DUH LQGLFDWHG ERWK 5LER VLJQDOV UHSUHVHQW 6 ULERVRPDO 51$ WUDQVFULSWVf 8QWUHDWHG '062 RQO\ &\WRFKDODVLQ &' > MXJPO@" 3XURP\FLQ SXURP\FLQ > P0@ 3XUR&\WR FRWUHDWPHQW ZLWK &' > JPO@ DQG SXURP\FLQ > P0@ $XWRUDGLRJUDPV LQ XSSHU SDQHO IRU HDFK WUHDWPHQW UHSUHVHQW D KRXU H[SRVXUH $XWRUDGLRJUDPV LQ ORZHU SDQHO LQGLFDWLQJ )RV DQG + KLVWRQH WUDQVFULSWLRQ UHSUHVHQW D GD\ H[SRVXUH

PAGE 196

8175($7(' 5,%2 $&7,1 5,%2 )26 + )26 + 5,%2 $&7,1 5,%2 )26 + )26 + &<72&+$/$6,1 38 52&<72

PAGE 197

F\WRFKDODVLQ DQG WKHUHE\ UDLVH WKH HIIHFWLYH FRQFHQWUDWLRQ RI RWKHU WUDQVFULSWV 7R DGGUHVV WKHVH SRVVLELOLWLHV ZH H[DPLQHG WKH WUDQVFULSWLRQ RI WKH 6 U51$ JHQH DV ZHOO DV RWKHU JHQHV GXULQJ &' WUHDWPHQW $V VHHQ LQ )LJ WKH WUDQVFULSWLRQ RI 6 ULERVRPDO 51$ DQG FHOO F\FOH GHSHQGHQW KLVWRQH + JHQHV LV QRW VLJQLILFDQWO\ DIIHFWHG E\ F\WRFKDODVLQ ,Q DGGLWLRQ &' KDV QR HIIHFW RQ WKH WUDQVFULSWLRQ RI JHQHV FRGLQJ IRU +/$% )LJ f EHWD JORELQ DQG D FHOO F\FOH LQGHSHQGHQW +% KLVWRQH GDWD QRW VKRZQf 7KHVH UHVXOWV VXJJHVW WKDW WKH LQFUHDVH LQ WUDQVFULSWLRQ RI FIRV DQG EHWDDFWLQ JHQHV GXULQJ F\WRFKDODVLQ WUHDWPHQW LV D VHOHFWLYH UHVSRQVH DQG QRW DQ HIIHFW RQ WUDQVFULSWLRQ LQ JHQHUDO 7UDQVFULSWLRQDO ,QGXFWLRQ RI F)RV 'XULQJ &' 7UHDWPHQW GRHV QRW 5HTXLUH 1HZ 3URWHLQ 6\QWKHVLV 7KH LQFUHDVH LQ FIRV JHQH WUDQVFULSWLRQ GXULQJ &' WUHDWPHQW PD\ EH D VHFRQGDU\ HIIHFW RI WKH GUXJ &\WRFKDODVLQ PD\ LQGXFH WKH V\QWKHVLV RI D SURWHLQ WKDW LQ WXUQ UHJXODWHV WKH WUDQVFULSWLRQDO DFWLYLW\ RI WKH FIRV JHQH 7R WHVW WKLV SRVVLELOLW\ +H/D FHOOV ZHUH SUHWUHDWHG ZLWK SXURP\FLQ IRU PLQXWHV SULRU WR WUHDWPHQW ZLWK F\WRFKDODVLQ 7KH FHOOV ZHUH WKHQ LQFXEDWHG LQ WKH SUHVHQFH RI ERWK GUXJV IRU DQ DGGLWLRQDO PLQXWHV &HOO FXOWXUHV WUHDWHG ZLWK SXURP\FLQ DORQH ZHUH LQFXEDWHG IRU PLQXWHV LQ WKH SUHVHQFH RI WKH LQKLELWRU ZKLOH FRQWURO FHOOV

PAGE 198

ZHUH LQFXEDWHG LQ DQ HTXLYDOHQW FRQFHQWUDWLRQ RI '062 IRU PLQXWHV 7UHDWPHQW RI +H/D FHOOV ZLWK F\WRFKDODVLQ IRU PLQXWHV UHVXOWHG LQ WKH H[SHFWHG VWLPXODWLRQ RI FIRV WUDQVFULSWLRQ )LJ f 3UHWUHDWPHQW RI +H/D FHOOV ZLWK SXURP\FLQ GLG QRW EORFN WKH &' LQGXFHG VWLPXODWLRQ RI FIRV WUDQVFULSWLRQ DQG LQ IDFW PDUNHGO\ LQFUHDVHG WKH WUDQVFULSWLRQ RI WKH FIRV JHQH )LJ f 7KHVH UHVXOWV VXJJHVW WKDW WKH WUDQVFULSWLRQ IDFWRUV DUH SUHVHQW ZLWKLQ WKH FHOOV SULRU WR F\WRFKDODVLQ WUHDWPHQW ZKLFK LV FRQVLVWHQW ZLWK SUHYLRXV ILQGLQJV WKDW WKH IDFWRUV LQYROYHG LQ WKH LQFUHDVH LQ FIRV WUDQVFULSWLRQ GXULQJ VHUXP VWLPXODWLRQ RI TXLHVFHQW ILEUREODVWV DUH SUHH[LVWHQW 6DVVRQH&RUVL DQG 9HUPD *UHHQEHUJ HW DO f &\WRFKDODVLQ 5HOHDVHV F)RV P51$ IURP WKH &YWRVNHOHWRQ LQWR WKH 6ROXEOH 3KDVH 7KH PDUNHG LQFUHDVH LQ FIRV P51$ FHOOXODU OHYHOV GXULQJ F\WRFKDODVLQ WUHDWPHQW LV QRW FRPSOHWHO\ DFFRXQWHG IRU E\ WKH LQFUHDVH LQ FIRV WUDQVFULSWLRQ DQG PD\ EH SDUWO\ D UHVXOW RI HQKDQFHG P51$ VWDELOLW\ 3UHYLRXV UHVXOWV LQGLFDWHG WKDW F\WRFKDODVLQ >! UHOHDVHV SRO\$ 51$ IURP WKH F\WRVNHOHWRQ LQWR WKH VROXEOH SKDVH LQ D GRVH GHSHQGHQW PDQQHU 2UQHOOHV HW DO f 7KH VWDELOL]DWLRQ RI FIRV P51$ GXULQJ F\WRFKDODVLQ WUHDWPHQW PD\ WKHUHIRUH EH D FRQVHTXHQFH RI DQ DOWHUDWLRQ LQ P51$ VXEFHOOXODU ORFDWLRQ 7R EHJLQ DGGUHVVLQJ WKLV SRVVLELOLW\ ZH KDYH

PAGE 199

)LJXUH (IIHFW RI SURWHLQ V\QWKHVLV LQKLELWLRQ RQ FYWRFKDODVLQ LQGXFWLRQ RI FIRV WUDQVFULSWLRQ LQ +H/D FHOOV ([SRQHQWLDOO\ JURZLQJ +H/D FHOOV ZHUH WUHDWHG ZLWK F\WRFKDODVLQ SXURP\FLQ RU SXURP\FLQ DQG &' IRU WKH LQGLFDWHG WLPHV 5DGLRODEHOHG 51$V ZHUH SUHSDUHG E\ LQ YLWUR QXFOHDU UXQRQ WUDQVFULSWLRQ DQG K\EULGL]HG WR 6RXWKHUQ EORWV RI HOHFWURSKRUHWLFDOO\ VHSDUDWHG UHVWULFWLRQ HQ]\PH GLJHVWHG SODVPLG '1$V FSPILOWHUf ,QVHUW '1$V K\EULGL]LQJ WR WUDQVFULSWV IURP WKH FRUUHVSRQGLQJ JHQHV DUH LQGLFDWHG 8QWUHDWHG '062 IRU PLQ &\WRFKDODVLQ &' > 0JUDO@ IRU PLQ 3XURP\FLQ SXURP\FLQ > P0@ IRU PLQ 3XUR &\WR SXURP\FLQ > P0@ IRU PLQ DQG &' > JPO@ IRU WKH ODVW PLQXWHV

PAGE 200

8175($7(' 5,%2 $&7,1 + L )26 +/$% &<72&+$/$6,1 38520<& ,1 3852&<72 5,%2 f§ $& 7,1 +$ )26 +/$%

PAGE 201

H[DPLQHG WKH VXEFHOOXODU ORFDWLRQ RI FIRV P51$ ZLWK UHVSHFW WR LWV DVVRFLDWLRQ ZLWK WKH F\WRVNHOHWDO VWUXFWXUH LQ ERWK FRQWURO DQG F\WRFKDODVLQ WUHDWHG FHOOV 1RUWKHUQ EORW DQDO\VLV RI F\WRVNHOHWDO DQG VROXEOH SKDVH 51$V IURP XQWUHDWHG +H/D FHOOV GHPRQVWUDWHG WKDW DSSUR[LPDWHO\ b RI FIRV P51$ LV DVVRFLDWHG ZLWK WKH F\WRVNHOHWDO VWUXFWXUH )LJXUH DQG 7DEOH f &\WRFKDODVLQ WUHDWPHQW HIILFLHQWO\ GLVUXSWHG WKLV DVVRFLDWLRQ DQG UHOHDVHG FIRV P51$ IURP WKH F\WRVNHOHWRQ LQWR WKH VROXEOH SKDVH *UHDWHU WKDQ b RI WKH FIRV P51$ DFFXPXODWHG LQ WKH VROXEOH SKDVH LQ F\WRFKDODVLQ WUHDWHG FHOOV &\WRFKDODVLQ DQG SXURP\FLQ FRWUHDWPHQW DOVR SUHIHUHQWLDOO\ LQFUHDVHG FIRV P51$ OHYHOV LQ WKH VROXEOH SKDVH 1HDUO\ b RI WKH FIRV P51$ ZDV ORFDOL]HG LQ WKH VROXEOH IUDFWLRQ LVRODWHG IURP &' DQG SXURP\FLQ FRWUHDWHG FHOOV &RQVLVWHQW ZLWK WKH ZRUN RI 2UQHOOHV HW DO f SXURP\FLQ WUHDWPHQW DORQH ZKLFK DOVR LQFUHDVHG FIRV P51$ OHYHOV KDG HVVHQWLDOO\ QR HIIHFW RQ WKH F\WRVNHOHWDO DQG VROXEOH SKDVH GLVWULEXWLRQ RI WKH P51$ $SSUR[LPDWHO\ b RI WKH FIRV P51$ UHPDLQHG DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ SXURP\FLQ WUHDWHG FHOOV 7KHVH UHVXOWV LQGLFDWH WKDW WKH PDMRULW\ RI WKH FIRV P51$ V\QWKHVL]HG GXULQJ F\WRFKDODVLQ WUHDWPHQW LV ORFDOL]HG LQ DQ DOWHUHG VXEFHOOXODU UHJLRQ $FFXPXODWLRQ RI FIRV P51$ LQ DQ XQQDWXUDO VXEFHOOXODU FRPSDUWPHQW PD\ SK\VLFDOO\ UHPRYH LW IURP WKH UHJXODWRU\ IDFWRUV WKDW DUH LQYROYHG LQ LWV VWDELOLW\

PAGE 202

'LVFXVVLRQ 3UHYLRXV UHVXOWV VXJJHVW WKDW WKH RUJDQL]DWLRQ RI WKH F\WRVNHOHWRQ PD\ LQIOXHQFH JHQH H[SUHVVLRQ DQG XOWLPDWHO\ FHOO JURZWK DQG GLIIHUHQWLDWLRQ :H SUHVHQW HYLGHQFH KHUH VXSSRUWLQJ WKH UROH RI WKH F\WRVNHOHWRQ LQ UHJXODWLQJ JHQH H[SUHVVLRQ 6SHFLILFDOO\ GLVUXSWLRQ RI WKH PLFURILODPHQWV ZLWK F\WRFKDODVLQ UHVXOWV LQ D UDSLG DQG GUDPDWLF DFFXPXODWLRQ RI FIRV P51$ 7KH LQGXFWLRQ RI FIRV JHQH H[SUHVVLRQ GXULQJ F\WRFKDODVLQ WUHDWPHQW LV DFFRPSDQLHG E\ DQ LQFUHDVH LQ WUDQVFULSWLRQ RI WKH FIRV JHQH DV GLUHFWO\ GHWHUPLQHG E\ LQ YLWUR QXFOHDU UXQ RQ DQDO\VLV 7KH HIIHFW RI F\WRFKDODVLQ WUHDWPHQW RQ WUDQVFULSWLRQ LV QRW OLPLWHG WR WKH FIRV JHQH &RQVLVWHQW ZLWK SUHYLRXV UHVXOWV DFWLQ WUDQVFULSWLRQ ZDV DOVR HOHYDWHG LQ F\WRFKDODVLQ WUHDWHG FHOOV 7DQQHQEDXP DQG *RGPDQ f +RZHYHU WKH VWLPXODWLRQ RI WUDQVFULSWLRQ RI WKH FIRV DQG DFWLQ JHQHV ZDV QRW D FRQVHTXHQFH RI LQFUHDVHG WUDQVFULSWLRQ LQ JHQHUDO 51$ SRO\PHUDVH ,, WUDQVFULSWLRQ RI VHYHUDO JHQHV VXFK DV KLVWRQH + FHOO F\FOH GHSHQGHQWf KLVWRQH +% FHOO F\FOH LQGHSHQGHQWf DQG +/$% KLVWRFRPSDWDELOLW\ DQWLJHQ ZDV XQDIIHFWHG LQ FHOOV WUHDWHG ZLWK F\WRFKDODVLQ ,Q DGGLWLRQ F\WRFKDODVLQ KDG QR HIIHFW RQ WUDQVFULSWLRQ RI WKH 6 ULERVRPDO 51$ JHQHV E\ 51$ SRO\PHUDVH RU WUDQVFULSWLRQ RI WKH EHWDJORELQ JHQH D WUDQVFULSWLRQDOO\ LQDFWLYH JHQH LQ +H/D FHOOV

PAGE 203

5HJXODWLRQ RI FIRV JHQH H[SUHVVLRQ LV FRQWUROOHG DW ERWK WKH WUDQVFULSWLRQDO DQG SRVWWUDQVFULSWLRQDO OHYHOV $ YDULHW\ RI DJHQWV VXFK DV VHUXP JURZWK IDFWRUV DQG GLIIHUHQWLDWLRQ IDFWRUV WUDQVFULSWLRQDOO\ LQGXFH FIRV JHQH H[SUHVVLRQ LQ D UDSLG DQG WUDQVLHQW PDQQHU *UHHQEHUJ DQG =LII f ,Q FRQWUDVW LQKLELWLRQ RI SURWHLQ V\QWKHVLV ZLWK F\FORKH[LPLGH RU KHDW VKRFN UHVXOWV LQ D VORZHU EXW PRUH SHUVLVWHQW DFFXPXODWLRQ RI FIRV P51$ ZLWK PLQLPDO RU QR HIIHFW RQ FIRV WUDQVFULSWLRQ $QGUHZV HW DO 5DKPVGRUI HW DO f 7KH LQFUHDVH LQ FIRV P51$ OHYHOV GXULQJ LQKLELWLRQ RI SURWHLQ V\QWKHVLV DSSHDUV WR EH ODUJHO\ SRVWWUDQVFULSWLRQDOO\ UHJXODWHG WKURXJK WKH VWDELOL]DWLRQ RI WKH FIRV P51$ 3UHYLRXV UHVXOWV KDYH GHPRQVWUDWHG WKDW F\WRFKDODVLQ FDQ LQKLELW SURWHLQ V\QWKHVLV LQ D GRVH GHSHQGHQW PDQQHU E\ UHOHDVLQJ SRO\$ 51$ IURP WKH F\WRVNHOHWRQ LQWR WKH VROXEOH SKDVH DV P513 SDUWLFOHV 2UQHOOHV HW DO f 7KH FRQFHQWUDWLRQ RI F\WRFKDODVLQ XVHG LQ WKLV VWXG\ ZDV VXIILFLHQW WR LQKLELW SURWHLQ V\QWKHVLV E\ SHUFHQW +RZHYHU RXU UHVXOWV VXJJHVW WKDW WKH LQGXFWLRQ RI FIRV JHQH H[SUHVVLRQ E\ F\WRFKDODVLQ WUHDWPHQW LV QRW D UHVXOW RI WKH SDUWLDO LQKLELWLRQ RI SURWHLQ V\QWKHVLV &\WRFKDODVLQ DQG SXURP\FLQ FRWUHDWPHQW UHVXOWHG LQ URXJKO\ DQ DGGLWLYH LQFUHDVH LQ FIRV JHQH WUDQVFULSWLRQ VXJJHVWLQJ WKH HIIHFWV RI WKH WZR GUXJV RQ WUDQVFULSWLRQ DUH GXH WR GLIIHUHQW PHFKDQLVPV &RQVLVWHQW ZLWK WKLV UHDVRQLQJ WKH FHOOXODU OHYHO RI FIRV P51$ LQ

PAGE 204

F\WRFKDODVLQ DQG SXURP\FLQ FRWUHDWHG FHOOV LV JUHDWHU WKDQ WKH OHYHOV RI FIRV P51$ LQ &' WUHDWHG DQG SXURP\FLQ WUHDWHG FHOOV FRPELQHG )XUWKHUPRUH WKH WLPH FRXUVH RI F IRV P51$ DFFXPXODWLRQ LQ F\WRFKDODVLQ WUHDWHG FHOOV LV PRUH UDSLG DQG VKRUWHU OLYHG WKDQ WKDW REVHUYHG LQ SXURP\FLQ WUHDWHG FHOOV 6WLPXODWLRQ RI FIRV WUDQVFULSWLRQ E\ F\WRFKDODVLQ WUHDWPHQW FDQ RFFXU GXULQJ LQKLELWLRQ RI SURWHLQ V\QWKHVLV DQG WKHUHIRUH DSSHDUV WR EH GHSHQGHQW RQ IDFWRUV WKDW DUH DOUHDG\ SUHVHQW ZLWKLQ WKH WUHDWHG FHOOV 3UHWUHDWPHQW ZLWK SXURP\FLQ IRU PLQXWHV IROORZHG E\ WKH DGGLWLRQ RI F\WRFKDODVLQ IRU PLQXWHV UHVXOWV LQ D PDUNHG LQFUHDVH LQ FIRV WUDQVFULSWLRQ )LJ f )XUWKHUPRUH LQKLELWLRQ RI SURWHLQ V\QWKHVLV IRU PLQXWHV ZLWK SXURP\FLQ DORQH UHVXOWV LQ D VLJQLILFDQW LQFUHDVH LQ FIRV WUDQVFULSWLRQ 7KHVH UHVXOWV DUH FRQVLVWHQW ZLWK SUHYLRXV UHSRUWV VXJJHVWLQJ WKDW WKH FIRV JHQH LV QHJDWLYHO\ UHJXODWHG E\ D ODELOH IDFWRU 0LWFKHOO HW DO *UHHQEHUJ HW DO 6DVVRQH&RUVL DQG 9HUPD f 7KH LQFUHDVH LQ WKH FHOOXODU OHYHOV RI FIRV P51$ GXULQJ F\WRFKDODVLQ WUHDWPHQW LV JUHDWHU WKDQ WKH PHDVXUHG LQFUHDVH LQ WKH WUDQVFULSWLRQ RI WKH JHQH DQG PD\ EH GXH WR WKH VWDELOL]DWLRQ RI FIRV P51$ XQGHU WKHVH FRQGLWLRQV +RZHYHU LW LV SRVVLEOH WKDW GXULQJ F\WRFKDODVLQ WUHDWPHQW WKH PHFKDQLVP LQYROYHG LQ WKH WXUQRYHU RI FIRV P51$ UHPDLQV RSHUDWLYH GHVSLWH WKH UHGXFHG OHYHOV RI SURWHLQ V\QWKHVLV

PAGE 205

3UHYLRXV VWXGLHV RQ F\WRFKDODVLQ WUHDWHG +H/D FHOOV GHPRQVWUDWHG WKH VHOHFWLYH GHVWDELOL]DWLRQ RI KLVWRQH P51$ GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV XQSXEOLVKHG GDWDf 7KLV HYHQW LV VWULFWO\ GHSHQGHQW RQ SURWHLQ V\QWKHVLV DQG GHPRQVWUDWHV WKH FRPSHWHQFH RI F\WRFKDODVLQ WUHDWHG FHOOV WR FDUU\ RXW FHUWDLQ SRVWWUDQVFULSWLRQDO SURFHVVHV 7KH DSSDUHQW VWDELOL]DWLRQ RI FIRV P51$ GXULQJ F\WRFKDODVLQ WUHDWPHQW PD\ WKHUHIRUH EH D UHVXOW RI WKH UHOHDVH RI WKH P51$ IURP WKH F\WRVNHOHWRQ LQ PRQRVRPH RU P513 IRUP 5HOHDVH RI FIRV P51$ IURP WKH F\WRVNHOHWRQ LQWR WKH VROXEOH SKDVH FRXOG SK\VLFDOO\ VHSDUDWH WKH PHVVDJH IURP WKH IDFWRUV LQYROYHG LQ LWV WXUQRYHU 7KHVH UHJXODWRU\ IDFWRUV PD\ EH VHTXHVWHUHG DQG FRQFHQWUDWHG E\ WKH F\WRVNHOHWRQ RU DQ LQWHJUDO FRPSRQHQW RI WKH ULERVRPH 7KH PHFKDQLVP RI LQGXFWLRQ RI FIRV JHQH H[SUHVVLRQ E\ F\WRFKDODVLQ WUHDWPHQW LV QRW NQRZQ 0DQ\ RI WKH LQGXFHUV RI FIRV WUDQVFULSWLRQ VWXGLHG WR GDWH DSSHDU WR HIIHFW SURWHLQ NLQDVH & DQGRU DGHQ\ODWH F\FODVH HQ]\PH DFWLYLWLHV 9HUPD DQG 6DVVRQH&RUVL f 7KH LQGXFWLRQ RI FIRV JHQH H[SUHVVLRQ E\ F\WRFKDODVLQ PD\ DOVR RFFXU DV DQ LQGLUHFW HIIHFW RQ SURWHLQ NLQDVH & RU DGHQ\ODWH F\FODVH OHYHOV DOWKRXJK WKLV KDV QRW \HW EHHQ GHWHUPLQHG $OWHUQDWLYHO\ WKH GLVUXSWLRQ RI WKH F\WRVNHOHWRQ E\ F\WRFKDODVLQ PD\ DOVR SHUWXUE WKH QXFOHDU PDWUL[ ZKLFK PD\ LQ WXUQ DIIHFW WUDQVFULSWLRQ +RZHYHU D PRGHO ZKLFK LQFOXGHV WKH DOWHUDWLRQ LQ WUDQVFULSWLRQ DV D UHVXOW RI WKH SHUWXUEDWLRQ

PAGE 206

RI WKH QXFOHDU PDWUL[ PXVW H[SODLQ WKH VHOHFWLYH DFWLYDWLRQ RI FIRV DQG DFWLQ JHQHV DQG WKHUHIRUH GRHV QRW DSSHDU OLNHO\ ,Q FRQWUDVW VWLPXODWLRQ RI FIRV JHQH H[SUHVVLRQ E\ F\WRFKDODVLQ PD\ EH D UHVXOW RI WKH DOWHUDWLRQV LQ WKH F\WRVNHOHWRQ GXH WR WKH GLVUXSWLRQ RI WKH PLFURILODPHQWV $QDORJRXV WR WKH ZRUN SUHVHQWHG KHUH LW KDV UHFHQWO\ EHHQ UHSRUWHG WKDW WKH GLVUXSWLRQ RI WKH PLFURWXEXOHV ZLWK FROFKLFLQH QRFRGD]ROH RU YLQEODVWLQH LQGXFHV WKH WUDQVFULSWLRQ RI FKORUDPSKHQLFRO DFHW\O WUDQVIHUDVH JHQHV FRQWDLQLQJ SURPRWHU HOHPHQWV IURP WKH KXPDQ FIRV RU EHWD DFWLQ JHQH 1J f ,QWHUHVWLQJO\ VHTXHQFH DQDO\VLV LQGLFDWHV WKDW DFWLQ DQG FIRV JHQHV FRQWDLQ VLPLODU WUDQVFULSWLRQ FRQVHQVXV VHTXHQFHV UHIHUUHG WR DV VHUXP UHVSRQVH HOHPHQWV ORFDWHG LQ WKHLU SURPRWHU UHJLRQV 0RKXQ DQG *DUUHW f 7KH FRRUGLQDWH LQGXFWLRQ RI FIRV DQG DFWLQ WUDQVFULSWLRQ GXULQJ F\WRFKDODVLQ RU FROFKLFLQH WUHDWPHQW PD\ EH PHGLDWHG E\ WKH LQWHUDFWLRQ RI WKH VDPH RU VLPLODU WUDQV DFWLQJ IDFWRUVf ZLWK WKH VHUXP UHVSRQVH HOHPHQW 6HYHUDO UHSRUWV KDYH SRVWXODWHG WKDW WKH F\WRVNHOHWRQ LV LQYROYHG LQ VLJQDO WUDQVGXFWLRQ 5RWKVWHLQ 5HELOODUG HW DO %OXP DQG :LFKD f )RU H[DPSOH 5HELOODUG DQG FRZRUNHUV f UHSRUWHG WKDW WKH VWLPXODWLRQ RI TXLHVFHQW 6ZLVV 7 FHOOV ZLWK HSLGHUPDO JURZWK IDFWRU (*)f DQG LQVXOLQ UHVXOWV LQ WKH UDSLG DFFXPXODWLRQ RI FIRV P51$ 7KH LQFUHDVH LQ FIRV JHQH

PAGE 207

H[SUHVVLRQ GXULQJ (*) DQG LQVXOLQ FRWUHDWPHQW FDQ EH LQKLELWHG E\ GLVUXSWLRQ RI WKH F\WRVNHOHWRQ ZLWK F\WRFKDODVLQ 7KLV UHVXOW LV FRQVLVWHQW ZLWK WKH K\SRWKHVLV WKDW WKH F\WRVNHOHWRQ PD\ EH LQYROYHG LQ UHOD\LQJ WKH (*)LQVXOLQ VLJQDO IURP WKH FHOO VXUIDFH WR WKH QXFOHXV 7KH UHVXOWV SUHVHQWHG KHUH GHVFULELQJ WKH VWLPXODWLRQ RI F IRV JHQH H[SUHVVLRQ ZLWK F\WRFKDODVLQ DOWKRXJK FRQWUDU\ WR 5HELOODUGnV UHVXOWV DUH FRQVLVWHQW ZLWK WKHLU LQWHUSUHWDWLRQ WKDW WKH QXFOHXV PRQLWRUV WKH LQWHJULW\ RI WKH F\WRVNHOHWRQ DQG DGMXVWV WKH H[SUHVVLRQ RI SDUWLFXODU JHQHV DFFRUGLQJO\ 5DWKHU WKDQ F\WRFKDODVLQ LQKLELWLQJ D VLJQDO IURP WKH FHOO VXUIDFH WR WKH QXFOHXV WKH GUXJ LQ RXU KDQGV PD\ PLPLF WKH VLJQDO WR VWLPXODWH FIRV JHQH H[SUHVVLRQ &HOO W\SH FXOWXUH FRQGLWLRQV DQG GUXJ GRVDJH HIIHFWV PD\ H[SODLQ WKH GLIIHUHQFHV REVHUYHG EHWZHHQ RXU UHVXOWV DQG WKRVH RI 5HELOODUGnV HW DO f ,Q VXPPDU\ F\WRFKDODVLQ VWLPXODWHV FIRV JHQH H[SUHVVLRQ WKURXJK LQFUHDVHG WUDQVFULSWLRQ DQG P51$ VWDELOLW\ 7KH HIIHFW RI F\WRFKDODVLQ RQ FIRV JHQH H[SUHVVLRQ PD\ EH LQ UHVSRQVH WR WKH DOWHUDWLRQV LQ WKH F\WRVNHOHWRQ DQG FHOO VKDSH :KHWKHU RWKHU HOHPHQWV RI WKH F\WRVNHOHWRQ VXFK DV WKH LQWHUPHGLDWH ILODPHQWV FDQ HOLFLW WKH VDPH UHVSRQVH UHPDLQV WR EH GHWHUPLQHG 7DNHQ WRJHWKHU ZLWK SUHYLRXV UHSRUWV WKH DELOLW\ RI F\WRFKDODVLQ WR VWLPXODWH FIRV LQ TXLHVFHQW ILEUREODVWV ZLWK WKH VDPH NLQHWLFV DQG YLUWXDOO\ WR WKH VDPH H[WHQW DV VHUXP VXSSRUWV WKH UROH RI WKH F\WRVNHOHWRQ LQ VLJQDO WUDQVGXFWLRQ

PAGE 208

&+$37(5 6800$5< $1' )8785( &216,'(5$7,216 7UH LQLWLDO HPSKDVLV RI WKH ZRUN SUHVHQWHG LQ WKLV GLVVHUWDWLRQ ZDV IRFXVHG RQ VWXG\LQJ WKH SRVWWUDQVFULSWLRQDO UHJXODWLRQ RI KLVWRQH JHQH H[SUHVVLRQ :KHQ WKLV SURMHFW ZDV XQGHUWDNHQ OLWWOH ZDV NQRZQ FRQFHUQLQJ WKH FRXSOLQJ RI KLVWRQH P51$ VWDELOLW\ WR '1$ UHSOLFDWLRQ ,W ZDV FOHDU WKDW WKH GHVWDELOL]DWLRQ RI KLVWRQH P51$ GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV ZDV VHOHFWLYH DQG UHTXLUHG RQJRLQJ SURWHLQ V\QWKHVLV %XWOHU DQG 0XHOOHU *DOOZLW] 6WDKO DQG *DOOZLW] 6WLPDF HW DO %DXPEDFK HW DO +HOPV HW DO f ,Q DGGLWLRQ LW ZDV NQRZQ WKDW WKH NLQHWLFV RI KLVWRQH JHQH H[SUHVVLRQ ZHUH H[WUHPHO\ UDSLG ZKLFK LV HYLGHQW E\ WKH DSSHDUDQFH RI WUDQVODWDEOH KLVWRQH P51$V RQ SRO\VRPHV ZLWKLQ PLQXWHV IROORZLQJ WUDQVFULSWLRQ %RUXQ HW DO f DQG WKH HTXDOO\ UDSLG WUDQVIHU RI QHZO\ V\QWKHVL]HG KLVWRQH SURWHLQ LQWR WKH QXFOHXV 6SDXOGLQJ HW DO 5REELQV DQG %RUXQ f $W WKDW WLPH VHYHUDO UHVHDUFK JURXSV ZHUH SURYLGLQJ HYLGHQFH WKDW VXJJHVWHG WKH FHOO LV RUJDQL]HG LQ D KLJKO\ RUGHUHG PDQQHU 3HQPDQ DQG FRn ZRUNHUV ZKLOH VWXG\LQJ WKH VWUXFWXUDO DQG IXQFWLRQDO SURSHUWLHV RI WKH F\WRVNHOHWRQ ZHUH GHYHORSLQJ WKH

PAGE 209

SHUVSHFWLYH WKDW F\WRVWUXFWXUH FDQ IRUP VXEFHOOXODU FRPSDUWPHQWV WKDW DUH LQGHSHQGHQW RI PHPEUDQH HQYHORSHV )XOWRQ HW DO &HUYHUD HW DO f )XUWKHUPRUH 6LQJHU DQG FRZRUNHUV XVLQJ LQ VLWX K\EULGL]DWLRQ WHFKQLTXHV ZHUH GHPRQVWUDWLQJ WKH ORFDOL]DWLRQ RI VSHFLILF P51$V LQ GLVFUHWH DUHDV RI WKH F\WRSODVP /DZUHQFH DQG 6LQJHU f %DVHG RQ WKHVH REVHUYDWLRQV DQG WKH LQIRUPDWLRQ DYDLODEOH FRQFHUQLQJ KLVWRQH JHQH H[SUHVVLRQ ZH SURSRVHG WKDW KLVWRQH P51$V DQG WKH IDFWRUV WKDW DUH LQYROYHG LQ WKHLU VHOHFWLYH GHVWDELOL]DWLRQ GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV DUH FRFRPSDUWPHQWDOL]HG LQ D SHULQXFOHDU UHJLRQ 7KLV PRGHO SUHGLFWHG WKDW WKH VXEFHOOXODU ORFDWLRQ RI KLVWRQH P51$ SOD\V D UROH LQ WKH FRXSOLQJ RI KLVWRQH P51$ VWDELOLW\ ZLWK '1$ UHSOLFDWLRQ 7R DGGUHVV WKLV TXHVWLRQ ZH ILUVW GHWHUPLQHG WKH QRUPDO VXEFHOOXODU ORFDWLRQ RI KLVWRQH P51$ 6XEFHOOXODU IUDFWLRQDWLRQ DQG 1RUWKHUQ EORW DQDO\VLV GHPRQVWUDWHG WKDW KLVWRQH P51$V DUH QDWXUDOO\ ORFDWHG RQ QRQPHPEUDQHERXQG SRO\VRPHV WKDW DUH DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ &KDSWHU f 7KH VXEFHOOXODU ORFDOL]DWLRQ RI KLVWRQH P51$ ZDV WKHQ DOWHUHG E\ LQFRUSRUDWLQJ QXFOHRWLGH VHTXHQFHV FRGLQJ IRU D VLJQDO SHSWLGH LQWR DQ + KLVWRQH P51$ &KDSWHU f 7KH PRGLILHG KLVWRQH JHQH ZKHQ WUDQVIHFWHG LQWR +H/D FHOOV H[SUHVVHG D VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ ZKLFK ZDV GLUHFWHG WR PHPEUDQHERXQG SRO\VRPHV 7KH KLVWRQH IXVLRQ

PAGE 210

P51$ LQ FRQWUDVW WR HQGRJHQRXV KLVWRQH P51$ ZDV QRW HIILFLHQWO\ GHVWDELOL]HG ZKHQ '1$ V\QWKHVLV ZDV LQWHUUXSWHG ZLWK K\GUR[\XUHD 6LWH GLUHFWHG PXWDJHQHVLV DQDO\VLV RI WKH KLVWRQH IXVLRQ JHQH DQG VXEVHTXHQW LQ YLYR VWXGLHV LQGLFDWHG WKDW WKH XQFRXSOLQJ RI WKH KLVWRQH IXVLRQ P51$ VWDELOLW\ IURP '$ UHSOLFDWLRQ ZDV GXH WR WKH DOWHUHG VXEFHOOXODU ORFDWLRQ DQG ZDV QRW GXH WR WKH SHUWXUEDWLRQ RI P51$ VWUXFWXUH ,W KDV VLQFH EHHQ GHPRQVWUDWHG E\ LQ VLWX K\EULGL]DWLRQ DQDO\VLV WKDW KLVWRQH P51$V DUH ORFDOL]HG LQ JUDSH OLNH FOXVWHUV WKURXJKRXW WKH F\WRSODVP /DZUHQFH HW DO f ,Q WKLV UHJDUG WKH LQLWLDO SURSRVDO WKDW KLVWRQH P51$V DUH FRPSDUWPHQWDOL]HG LQ D UHJLRQ FORVH WR WKH QXFOHXV ZDV LQFRUUHFW 7KH QRQXQLIRUP GLVWULEXWLRQ RI KLVWRQH P51$V ZLWKLQ WKH F\WRSODVP KRZHYHU VXJJHVWV WKDW KLVWRQH P51$V DUH FRPSDUWPHQWDOL]HG 7KH VWDELOLW\ RI KLVWRQH IXVLRQ P51$ GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV GXH WR WKH DVVRFLDWLRQ RI WKH P51$ ZLWK PHPEUDQHERXQG SRO\VRPHV LV FRQVLVWHQW ZLWK WKH SRVVLELOLW\ WKDW WKHVH FRPSDUWPHQWV DUH LQYROYHG LQ WKH SRVWWUDQVFULSWLRQDO UHJXODWLRQ RI KLVWRQH JHQH H[SUHVVLRQ 7KH SURSRVDO WKDW KLVWRQH SURWHLQ V\QWKHVLV LV DXWRJHQRXVO\ UHJXODWHG SURYLGHV RQH SRVVLEOH H[SODQDWLRQ IRU WKH UROH RI WKH VXEFHOOXODU FRPSDUWPHQWV LQ WKH SRVWWUDQVFULSWLRQDO UHJXODWLRQ RI KLVWRQH JHQH H[SUHVVLRQ $V SURSRVHG E\ %XWOHU DQG 0XHOOHU f DQG VHYHUDO RWKHU

PAGE 211

UHVHDUFK JURXSV 6WHLQ DQG 6WHLQ :X DQG %RQQHU f D FULWLFDO FRQFHQWUDWLRQ RI XQERXQG KLVWRQH SURWHLQ PD\ EH UHTXLUHG IRU WKH GHVWDELOL]DWLRQ RI KLVWRQH P51$ GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV /RFDOL]DWLRQ RI KLVWRQH P51$ LQ FOXVWHUV PD\ FUHDWH SRFNHWV ZLWKLQ WKH F\WRSODVP LQ ZKLFK eKH XQERXQG KLVWRQH SURWHLQ FRXOG UHDFK WKH QHFHVVDU\ FRQFHQWUDWLRQ IRU WKH GHVWDELOL]DWLRQ RI KLVWRQH P51$ WR RFFXU 7KH DOWHUDWLRQ LQ VXEFHOOXODU ORFDWLRQ RI WKH KLVWRQH IXVLRQ P51$ KDV EHHQ GHPRQVWUDWHG E\ VXEFHOOXODU IUDFWLRQDWLRQ DQG 6, QXFOHDVH SURWHFWLRQ DQDO\VLV &KDSWHU f ,W UHPDLQV WR EH GHWHUPLQHG E\ LQ VLWX K\EULGL]DWLRQ DQDO\VLV ZKHWKHU WKH VSDWLDO GLVWULEXWLRQ RI WKH KLVWRQH IXVLRQ P51$ KDV EHHQ VLJQLILFDQWO\ DOWHUHG FRPSDUHG ZLWK WKDW RI HQGRJHQRXV KLVWRQH P51$ )XUWKHUPRUH LGHQWLILFDWLRQ DQG SXULILFDWLRQ RI WKH FRPSRQHQWV LQYROYHG LQ WKH SRVWWUDQVFULSWLRQDO UHJXODWLRQ RI KLVWRQH JHQH H[SUHVVLRQ PD\ SURYLGH WKH RSSRUWXQLW\ WR PRQLWRU GLUHFWO\ WKH VXEFHOOXODU ORFDOL]DWLRQ RI WKHVH IDFWRUV E\ LPPXQRIOXRUHVFHQFH FHOO IUDFWLRQDWLRQ DQG ELRFKHPLFDO DQDO\VLV $QRWKHU DVSHFW FRQFHUQLQJ WKH ORFDOL]DWLRQ RI KLVWRQH P51$ LQ WKH F\WRSODVP ZKLFK ZDUUDQWV DGGLWLRQDO FRQVLGHUDWLRQ LV ZKHWKHU D VLQJOH FODVV RU PXOWLSOH FODVVHV RI KLVWRQH P51$V DUH FRQWDLQHG ZLWKLQ D FOXVWHU )RU H[DPSOH D SDUWLFXODU FOXVWHU PD\ FRQWDLQ RQO\ + KLVWRQH

PAGE 212

P51$ + DQG + KLVWRQH P51$ WRJHWKHU RU DQ\ FRPELQDWLRQ RI JURXSLQJV RI WKH GLIIHUHQW FODVVHV RI KLVWRQH P51$V 7KH SDWWHUQ IRU WKHVH JURXSLQJV PD\ EH LPSRUWDQW LQ WKH WUDQVSRUW RI WKH QHZO\ V\QWKHVL]HG KLVWRQH SURWHLQV LQWR WKH QXFOHXV DQGRU WKH FRRUGLQDWH UHJXODWLRQ RI KLVWRQH SURWHLQ V\QWKHVLV $OWKRXJK XQUHODWHG WR WKH SUREOHPV DGGUHVVHG KHUH LW ZRXOG EH LQWHUHVWLQJ IURP WKH VWDQGSRLQW RI VWXG\LQJ WKH SURFHVV RI SURWHLQ VHFUHWLRQ WR GHWHUPLQH WKH VXEFHOOXODU ORFDOL]DWLRQ RI WKH KLVWRQH IXVLRQ SURWHLQ ([DPLQDWLRQ RI VXEFHOOXODU IUDFWLRQV LVRODWHG IURP +H/D FHOOV ZKLFK DUH H[SUHVVLQJ WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ JHQH E\ VWDQGDUG ELRFKHPLFDO WHFKQLTXHV VXFK DV DFLG H[WUDFWLRQ DQG WULWRQXUHD JHO HOHFWURSKRUHVLV ZRXOG SURYLGH LQVLJKW LQWR KRZ WKH IXVLRQ SURWHLQ LV SURFHVVHG DQG ZKHUH WKH IXVLRQ SURWHLQ LV ORFDWHG ,Q VWXG\LQJ WKH VXEFHOOXODU ORFDWLRQ RI KLVWRQH P51$ LW ZDV GHWHUPLQHG WKDW KLVWRQH P51$ LV SUHGRPLQDQWO\ DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ DQG WKDW WKLV DVVRFLDWLRQ LV GHSHQGHQW RQ WKH LQWHJULW\ RI WKH PLFURILODPHQWV &KDSWHUV DQG f &\WRFKDODVLQ WUHDWPHQW ZKLFK GLVUXSWV WKH DFWLQ ILODPHQWV UHOHDVHV KLVWRQH P51$ IURP WKH F\WRVNHOHWRQ LQWR WKH VROXEOH SKDVH 7KLV UHVXOW LV FRQVLVWHQW ZLWK WKH REVHUYDWLRQ RI 3HQPDQ DQG FRZRUNHUV WKDW KHWHURJHQHRXV SRO\$ 51$ LV UHOHDVHG IURP WKH F\WRVNHOHWRQ LQ F\WRFKDODVLQ WUHDWHG +H/D FHOOV 2UQHOOHV HW D/ f

PAGE 213

7KH UHOHDVH RI KLVWRQH P51$ IURP WKH F\WRVNHOHWRQ E\ F\WRFKDODVLQ WUHDWPHQW SUHVHQWHG WKH RSSRUWXQLW\ WR VWXG\ WKH UROH RI WKH F\WRVNHOHWRQ LQ WKH SRVWWUDQVFULSWLRQDO UHJXODWLRQ RI KLVWRQH JHQH H[SUHVVLRQ +LVWRQH P51$ ZDV UHOHDVHG LQWR WKH VROXEOH SKDVH ZLWK PRGHUDWH DPRXQWV RI F\WRFKDODVLQ > XJPO@ VLQFH KLJKHU OHYHOV RI &' VLJQLILFDQWO\ LQKLELW SURWHLQ V\QWKHVLV 7KH FHOOV ZHUH WKHQ WUHDWHG ZLWK K\GUR[\XUHD WR LQKLELW '1$ UHSOLFDWLRQ 7KHVH WUHDWPHQWV UHVXOWHG LQ WKH GHVWDELOL]DWLRQ RI KLVWRQH P51$ LQ WKH VROXEOH IUDFWLRQ WR WKH VDPH H[WHQW DQG ZLWK WKH VDPH NLQHWLFV DV WKH GHVWDELOL]DWLRQ RI KLVWRQH P51$ LQ WKH F\WRVNHOHWRQ IUDFWLRQ 2QH LQWHUSUHWDWLRQ RI WKLV UHVXOW LV WKDW WKH F\WRVNHOHWRQ LV QRW UHTXLUHG IRU KLVWRQH P51$ GHVWDELOL]DWLRQ GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV ,Q DGGLWLRQ 2UQHOOHV HW DO f UHSRUWHG WKDW &' WUHDWPHQW RI +H/D FHOOV UHOHDVHV SRO\$ 51$ IURP WKH F\WRVNHOHWRQ LQWR WKH VROXEOH SKDVH LQ PRQRVRPH RU P513 IRUP ZKLFK VXJJHVWV WKDW KLVWRQH P51$ LQ WKH VROXEOH SKDVH GRHV QRW QHHG WR EH WUDQVODWHG WR EH GHVWDELOL]HG GXULQJ LQKLELWLRQ RI '1$ V\QWKHVLV 7KLV UHVXOW LV LQ FRQWUDVW WR WKH JHQHWLF VWXGLHV WKDW LQGLFDWH KLVWRQH P51$ PXVW EH WUDQVODWHG WR ZLWKLQ FORVH SUR[LPLW\ RI WKH WUDQVODWLRQ VWRS FRGRQ IRU GHVWDELOL]DWLRQ WR RFFXU *UDYHV HW DO &DSDVVR HW DO f 7KH UHOHDVH RI KLVWRQH P51$ LQWR WKH VROXEOH SKDVH DV D PRQRVRPH RU P513 GXULQJ F\WRFKDODVLQ WUHDWPHQW KDV QRW \HW EHHQ GHWHUPLQHG DQG DGGLWLRQDO VWXGLHV ZLOO EH

PAGE 214

QHFHVVDU\ WR FODULI\ WKHVH LQWHUSUHWDWLRQV RI WKH F\WRFKDODVLQ 'K\GUR[\XUHD H[SHULPHQWV )RU H[DPSOH VXFURVH GHQVLW\ JUDGLHQW DQDO\VLV RI VROXEOH SKDVH 51$ IURP F\WRFKDODVLQ WUHDWHG FHOOV VKRXOG GHPRQVWUDWH ZKHWKHU KLVWRQH P51$ LV UHOHDVHG IURP WKH F\WRVNHOHWRQ LQ WKH VDPH PDQQHU DV SRO\$ 51$ )XUWKHUPRUH JHO ILOWUDWLRQ VWXGLHV DV GHVFULEHG E\ $GDPV HW DO f RQ WKH FRPSRVLWLRQ RI WKH KLVWRQH P51$ LQ WKH VROXEOH SKDVH DIWHU F\WRFKDODVLQ WUHDWPHQW VKRXOG DOVR SURYLGH LQIRUPDWLRQ RQ ZKHWKHU WKH KLVWRQH P51$ DOWKRXJK QR ORQJHU DQFKRUHG WR WKH F\WRVNHOHWRQ PD\ VWLOO EH FRPSOH[HG ZLWK F\WRVNHOHWDO FRPSRQHQWV 7KHVH F\WRVNHOHWDO FRPSRQHQWV PD\ EH QHFHVVDU\ IRU KLVWRQH P51$ GHVWDELOL]DWLRQ GXULQJ LQKLELWLRQ RI '1$ UHSOLFDWLRQ 7KH GLVWULEXWLRQ RI +/$% P51$ EHWZHHQ WKH F\WRVNHOHWRQ DQG VROXEOH IUDFWLRQV GXULQJ F\WRFKDODVLQ DQG K\GUR[\XUHD FRWUHDWPHQW ZDV DOVR DQDO\]HG DV DQ LQWHUQDO FRQWURO IRU HTXDO ORDGLQJ RI WKH 51$ 6XUSULVLQJO\ LQ YLHZ RI WKH UHVXOWV RI 2UQHOOHV HW DO f F\WRFKDODVLQ WUHDWPHQW IDLOHG WR UHOHDVH +/$% P51$ IURP WKH F\WRVNHOHWRQ &KDSWHU f 6XEVHTXHQW VWXGLHV GHPRQVWUDWHG WKDW SRO\VRPDO +/$% P51$ DV ZHOO DV RWKHU PHPEUDQHERXQG SRO\VRPHV DUH UHOHDVHG IURP WKH F\WRVNHOHWRQ GXULQJ F\WRFKDODVLQ DQG SXURP\FLQ FRWUHDWPHQW &KDSWHU f 3XURP\FLQ DORQH RU F\WRFKDODVLQ DQG F\FORKH[LPLGH FRWUHDWPHQW GRHV QRW UHOHDVH PHPEUDQHERXQG SRO\VRPHV IURP

PAGE 215

WKH F\WRVNHOHWRQ 7KHVH UHVXOWV VXJJHVW WKDW RQH PHFKDQLVP IRU WKH DWWDFKPHQW RI PHPEUDQHERXQG SRO\VRPHV WR WKH F\WRVNHOHWRQ LV WKURXJK WKH LQWHUDFWLRQ RI WKH SRO\VRPH FRPSOH[ ZLWK WKH HQGRSODVPLF UHWLFXOXP 7KLV LQWHUDFWLRQ DSSHDUV WR LQYROYH WKH QDVFHQW SRO\SHSWLGH KRZHYHU RWKHU SRVVLELOLWLHV PD\ H[LVW 7KH UHORFDWLRQ RI VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ WR PHPEUDQHERXQG SRO\VRPHV SUHVHQWHG WKH RSSRUWXQLW\ WR VWXG\ WKH F\WRVNHOHWDO LQWHUDFWLRQV RI PHPEUDQHERXQG SRO\VRPDO P51$V LQ PRUH GHWDLO 2XU PRGHO SUHGLFWHG WKDW KLVWRQH IXVLRQ P51$ ZRXOG UHPDLQ DWWDFKHG WR WKH F\WRVNHOHWRQ GXULQJ &' WUHDWPHQW DQG ZRXOG EH UHOHDVHG LQWR WKH VROXEOH SKDVH GXULQJ &' DQG SXURP\FLQ FRWUHDWPHQW $V VHHQ LQ &KDSWHU WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ UHPDLQHG DWWDFKHG WR WKH F\WRVNHOHWRQ GXULQJ F\WRFKDODVLQ WUHDWPHQW DV ZHOO DV GXULQJ F\WRFKDODVLQ DQG SXURP\FLQ FRWUHDWPHQW 7KH UHWHQWLRQ RI VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ RQ WKH F\WRVNHOHWRQ XQGHU WKHVH FRQGLWLRQV GHPRQVWUDWHV WKDW WKH KLVWRQH IXVLRQ P51$ LV DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ D PDQQHU WKDW LV GLIIHUHQW IURP WKDW REVHUYHG IRU ZLOG W\SH KLVWRQH P51$ +/$% PHPEUDQHERXQG SRO\VRPDO 51$ DQG KHWHURJHQHRXV SRO\$ 51$ $OWKRXJK LW LV ZHOO GRFXPHQWHG WKDW P51$V DUH DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ WKHUH DUH QR NQRZQ F\WRVNHOHWRQ DWWDFKPHQW VLWHV LGHQWLILHG WR GDWH 'LVVHFWLRQ RI WKH VLJQDO SHSWLGHKLVWRQH IXVLRQ P51$ E\ GHOHWLRQ DQG VLWH GLUHFWHG PXWDWLRQ DQDO\VLV VKRXOG SURYH

PAGE 216

XVHIXO LQ WKH LGHQWLILFDWLRQ RI DQ P51$F\WRVNHOHWRQ DWWDFKPHQW VLWH 7KH UROH RI WKH F\WRVNHOHWRQ VWUXFWXUH LQ LQIOXHQFLQJ JHQH H[SUHVVLRQ LV VXSSRUWHG E\ WKH REVHUYDWLRQ WKDW F\WRFKDODVLQ WUHDWPHQW UHVXOWHG LQ D UDSLG DQG GUDPDWLF LQFUHDVH LQ FIRV JHQH WUDQVFULSWLRQ ZLWK D FRQFRPLWDQW LQFUHDVH LQ FIRV P51$ FHOOXODU OHYHOV &KDSWHU f &RQVLVWHQW ZLWK SUHYLRXV UHVXOWV 7DQQHQEDXP DQG *RGPDQ f &' WUHDWPHQW DOVR LQFUHDVHG EHWDDFWLQ JHQH WUDQVFULSWLRQ +RZHYHU WKHVH PRGLILFDWLRQV LQ JHQH H[SUHVVLRQ DSSHDU WR EH VHOHFWLYH DQG QRW D JHQHUDO SKHQRPHQRQ VLQFH WKH WUDQVFULSWLRQ RI VHYHUDO RWKHU JHQHV ZDV XQDIIHFWHG E\ WKH GUXJ WUHDWPHQW 7KH LQFUHDVH LQ FIRV P51$ FHOOXODU OHYHOV ZDV ODUJHU WKDQ WKH LQFUHDVH LQ FIRV JHQH WUDQVFULSWLRQ DQG PD\ EH GXH WR D VWDELOL]DWLRQ RI WKH FIRV PHVVDJH XQGHU WKHVH FRQGLWLRQV &HOO IUDFWLRQDWLRQ DQG 1RUWKHUQ EORW DQDO\VLV GHPRQVWUDWHG WKDW FIRV P51$ LV DVVRFLDWHG ZLWK WKH F\WRVNHOHWRQ LQ FRQWURO FHOOV DQG DFFXPXODWHV LQ WKH VROXEOH SKDVH LQ F\WRFKDODVLQ WUHDWHG FHOOV &KDSWHU f 6WDELOL]DWLRQ RI FIRV P51$ PD\ EH GXH WR WKH DOWHUHG VXEFHOOXODU ORFDWLRQ RI WKH PHVVDJH GXULQJ F\WRFKDODVLQ WUHDWPHQW $GGLWLRQDO VWXGLHV DUH QHHGHG WR GHILQH WKH PROHFXODU EDVLV IRU WKH UROH RI WKH F\WRVNHOHWDO VWUXFWXUH LQ WKH WUDQVFULSWLRQDO DQG SRVWWUDQVFULSWLRQDO UHJXODWLRQ RI FIRV JHQH H[SUHVVLRQ

PAGE 217

,Q VXPPDU\ WKH ZRUN SUHVHQWHG LQ WKLV GLVVHUWDWLRQ LV FRQVLVWHQW ZLWK WKH K\SRWKHVLV WKDW VXEFHOOXODU FRPSDUWPHQWV DQG FHOO VWUXFWXUH SOD\ DQ LPSRUWDQW UROH LQ WKH UHJXODWLRQ RI JHQH H[SUHVVLRQ 7KH LQIOXHQFH RI P51$ VXEFHOOXODU ORFDWLRQ RQ WKH SRVWWUDQVFULSWLRQDO FRQWURO RI KLVWRQH JHQH H[SUHVVLRQ DQG SRVVLEO\ FIRV JHQH H[SUHVVLRQ LQGLFDWHV WKDW UHJXODWRU\ IDFWRUV PD\ EH FRQFHQWUDWHG DQG VHTXHVWHUHG LQ VSHFLILF UHJLRQV RU E\ VSHFLILF VWUXFWXUHV 7KH GLIIHUHQWLDO DVVRFLDWLRQ RI P51$ ZLWK WKH F\WRVNHOHWRQ PD\ EH D PHFKDQLVP IRU ORFDOL]DWLRQ RI P51$ LQ D SDUWLFXODU UHJLRQ RI WKH FHOO ZKLFK LQ WXUQ PD\ DIIHFW WKH SRVWWUDQVFULSWLRQDO UHJXODWRU\ SURFHVV /DVWO\ WKH HIIHFW RI GLVUXSWLQJ WKH PLFURILODPHQWV ZLWK F\WRFKDODVLQ RQ F IRV JHQH DQG EHWDDFWLQ JHQH H[SUHVVLRQ VXJJHVWV WKDW WKH QXFOHXV FDQ WUDQVFULSWLRQDOO\ UHVSRQG LQ D VHOHFWLYH PDQQHU WR WKH VWUXFWXUDO RUJDQL]DWLRQ RI WKH F\WRVNHOHWRQ

PAGE 218

5()(5(1&(6 $GDPV $ )H\ ( 3LNH 6 7D\ORUVRQ & :KLWH + DQG 5DELQ % f %LRFKHP $GHVQLN 0 DQG 'DUQHOO f 0RO %LRO $OOIUH\ 9 /LWWDX 9 DQG 0LUVN\ $ f 3URF 1DWO $FDG 6FL 86$ $OWHUPDQ 5 6SUHFKHU & *UDYHV 5 0DU]OXII : DQG 6NRXOWFKL $ f 0RO &HOO %LRO $PRV / DQG .OXJ $ f &HOO 6FL $QGUHZV +DUGLQJ 0 &DOYHUW DQG $GDPVRQ ( f 0RO &HOO %LRO %DJFKL 7 /DUVRQ DQG 6HOOV % f ([S &HOO 5HV %DXPEDFK / 6WHLQ DQG 6WHLQ f %LRFKHPLVWU\ %DXPEDFK / 0DUDVKL ) 3OXPE 0 6WHLQ DQG 6WHLQ f %LRFKHPLVWU\ %HGRXHOOH + %DVVIRUG -U 3 )RZOHU $ =DELQ %HFNZLWK DQG +RIQXQJ 0 f 1DWXUH %HQHFNH %%HQ =HnHY $ DQG 3HQPDQ 6 f &HOO %HQQHW )HOOLQL 6 DQG +ROW]HU + f 'LIIHUHQWLDWLRQ %HUN $ DQG 6KDUS 3 f 3URF 1DWO $FDG 6FL 86$ %HUO 6 3XV]NLQ 6 DQG 1LFNODV : f 6FLHQFH %LQGHU / )UDQNIXUWHU $ DQG 5HEKXQ / f &HOO %LRO

PAGE 219

%LUG 5 -DFREV ) 6WHLQ 6WHLQ DQG 6HOOV % f %LRFKHP %LRSK\V $FWD %LVKRS -0 f $QQX 5HY %LRFKHP %OREHO DQG 'REEHUVWHLQ % f &HOO %LRO %ORRP /XFD ) DQG 9DOOHH 5 f &HOO %LRO f %ORVH 6 DQG &KDFNR 6 f &HOO %LRO %OXP DQG :LFKD 0 f &HOO 3K\V %RQQHDX $ 'DUYHDX $ DQG 6RQHQEHUJ 1 f &HOO %LRO %RUXQ 7 6FKDUII 0 DQG 5REELQV ( f 3URF 1DWO $FDG 6FL 86$ %RUXQ 7 *DEULHOOL ) $MLUR =ZHLGOHU $ DQG %DJOLRQL & f &HOO %ULHQGO 0 DQG *DOOZLW] f (XU %LRFKHP %ULHQGO 0 DQG *DOOZLW] f (XU %LRFKHP %URZQ 6 /HYLQVRQ : DQG 6SXGLFK f 6XSUDPROHF 6WUXFW %UXVK 'RGJVRQ &KRL 25 6WHYHQV : DQG (QJHO f 0RO &HOO %LRO %XOLQVNL DQG %RULV\ f &HOO %LRO %XWOHU : DQG 0XHOOHU f %LRFKHP %LRSK\V $FWD &DSDVVR 2 %OHHFNHU DQG +HLQW] 1 f (0%2 &DUR]]L 1 0DUDVKL ) 3OXPE 0 =LPPHUPDQ 6 =LPPHUPDQ $ :HOOV 6WHLQ DQG 6WHLQ f 6FLHQFH &HUYHUD 0 'UH\IXVV DQG 3HQPDQ 3 f &HOO

PAGE 220

&KDOORQHU 3 0RVV 6 DQG *URXGLQH 0 f 0RO &HOO %LRO &ODUNH 0 DQG 6SXGLFK f $QQX 5HY %LRFKHP &OD\WRQ DQG 'DUQHOO -U f 0RO &HOO %LRO &OLQH-. f %LRO &KHP &RFKUDQ % =XOOR 9HUPD DQG 6WLOHV & f 6FLHQFH &ROODUW 6WHLQ DQG 6WHLQ f 0RO &HOO %LRFK r &RQQROO\ 7 &ROOLQV 3 DQG *LOPRUH 5 f &HOO %LRO &XUUDQ 7 0LOOHU $ =RNDV / DQG 9HUPD f &HOO &XUUDQ 7 DQG 0RUJDQ f 6FLHQFH 'DWH 7 =ZL]LQVNL & /XGPHUHU 6 DQG :LFNQHU : f 3URF 1DWO $FDG 6FL 86$ 'HODQJH 5 )DPEURXJK 6PLWK ( DQG %RQQHU f %LRO &KHP 'H/LVOH $ *UDYHV 5 0DU]OXII : DQG -RKQVRQ / f 0RO &HOO %LRO 'HODFRXUWH $ )LOOHDWUHDX %RXOWHDX ) %LVHUWH DQG 6FKUHYHO f %LRO 'LDPRQG / 2n%ULHQ 7 DQG %DLUG : f $GY &DQFHU 5HV 'LVWHO 5 5R +6 5RVHQ % *URYHV DQG 6SLHJHOPDQ % f &HOO (PU 6 DQG %DVVIRUG -U 3 f %LRO &KHP (PU 6 6FKZDUW] 0 DQG 6LOKDY\ 7 f 3URF 1DWO $FDG 6FL 86$ 7 (PU 6 +DOO 0 DQG 6LOKDY\ 7 f &HOO %LRO

PAGE 221

(QJHO 6XJDUPDQ % DQG 'RGJVRQ f 1DWXUH )DQQHU 6 :DQ %HQ=HnHY $ DQG 3HQPDQ 6 f 0RO &HOO %LRO )LGGHV DQG *RRGPDQ + f 1DWXUH )UDQNH : 6FKPLG ( 2VERUQ 0 DQG :HEHU f &HOO %LRO )UDQNH : 6FKLOOHU 0ROO 5 :LQWHU 6 6FKPLG ( (QJHOEUHFKW 'HQN + .UHSOHU 5 DQG 3ODW]HU % f 0RO %LRO )XFKV ( DQG 0DUFKXN f 3URF 1DWO $FDG 6FL 86$ )XOWRQ $ :DQ DQG 3HQPDQ 6 f &HOO *DOOZLW] f 1DWXUH *DOOZLW] DQG 0XHOOHU f %LRO &KHP *DOOZLW] DQG %ULHQGO 0 f %LRFKHP %LRSK\V 5HV &RPPXQ *DUUHOV DQG *LEVRQ : f &HOO *LOPRUH 5 %OREHO DQG :DOWHU 3 Df &HOO %LRO *LOPRUH 5 :DOWHU 3 DQG %OREHO Ef &HOO %LRO *ODVV : %ULJJV 5 DQG +QLOLFD / f 6FLHQFH *ROGPDQ 5 DQG .QLSH f &ROG 6SULQJ +DUE 6\PS 4XDQW %LRO *ROGPDQ 6FKDXPEHUJ + DQG 1RUWRQ : f &HOO %LRO *RUPDQ & 0RIIDW / DQG +RZDUG % f 0RO &HOO %LRO *UDKDP ) DQG YDQ GHU (E $ f 9LURORJ\ *UDYHV 5 DQG 0DU]OXII : f 0RO &HOO %LRO

PAGE 222

*UDYHV 5 3DQGH\ 1 &KRGFKR\ 1 DQG 0DU]OXII : f &HOO *UHHQ / 6WHLQ DQG 6WHLQ Df 0RO &HOO %LRFKHP *UHHQ / YDQ $QWZHUSHQ 5 6WHLQ DQG 6WHLQ Ef 6FLHQFH *UHHQEHUJ 0 DQG =LII ( f 1DWXUH *UHHQEHUJ 0 +HUPDQRZVNL $ DQG =LII ( f 0RO &HOO %LRO *URVVL GH 6D 0) 0DUWLQV GH 6D & +DUSHU ) /LQN &RX[ 0 +XHVFD 0 DQG 6FKHUUHU f &HOO %LRO *XQQLQJ 3 3RQWH 3 2ND\DPD + (QJHO %ODX + DQG .HGHV / f 0RO &HOO %LRO +DUWZLJ DQG 6WRVVHO 7 f %LRO &KHP +DUYH\ 5 :KLWLQJ &ROHV / .ULHJ 3 DQG :HOOV f 3URF 1DWO $FDG 6FL 86$ +D\GHQ DQG $OOHQ 5 f &HOO %LRO +HLQW] 1 =HUQLN 0 DQG 5RHGHU 5 f &HOO +HLQW] 1 6LYH + DQG 5RHGHU 5 f 0RO &HOO %LRO +HOPV 6 %DXPEDFK / 6WHLQ DQG 6WHLQ f )(%6 /HWWHUV +HQWVFKHO & DQG %LUQVWLHO 0 f &HOO +RIIPDQ 3 DQG /DVHN 5 f &HOO %LRO +ROOWURS 0 5DLV] / DQG 6LPPRQV + f &HOO %LRO +RUWLQ DQG %RLPH f &HOO +RZH DQG +HUVKH\ f &HOO +XEEDUG % DQG /D]DULGHV ( f &HOO %LRO +XEHUPDQ ( DQG &DOODKDQ 0 f 3URF 1DWO $FDG 6FL 86$

PAGE 223

+X[OH\ + f 1DWXUH ,VDDFV : DQG )XOWRQ $ f 3URF 1DWO $FDG 6FL 86$ ,]DQW DQG /D]DULGHV ( f 3URF 1DWO $FDG 6FL 86$ -DFREV/RUHQD 0 %DJOLRQL & DQG %RUXQ 7 f 3URF 1DWO $FDG 6FL 86$ -HIIHU\ : f 'HY %LRO .DLVHU & DQG %RWVWHLQ f 0RO &HOO %LRO .DLVHU & 3UHXVV *ULVDIL 3 DQG %RWVWHLQ f 6FLHQFH .DQH 5 f &HOO %LRO .HGHV / f $QQX 5HY %LRFKHP B /DHPLQOL 8 f 1DWXUH /DZUHQFH DQG 6LQJHU 5 f &HOO /DZUHQFH 6LQJHU 5 9LOOQDYH & 6WHLQ DQG 6WHLQ f 3URF 1DWO $FDG 6FL 86$ /D]DULGHV ( f 1DWXUH /D]DULGHV ( DQG +XEEDUG % f 3URF 1DWO $FDG 6FL 86$ /HPLHX[ 5 DQG %HDXG f (XU %LRFK /HQN 5 DQG 3HQPDQ 6 f &HOO  /HQN 5 5DQVRP / .DXIPDQQ < DQG 3HQPDQ 6 f &HOO /HYLQH % &KRGFKR\ 1 0DU]OXII : DQG 6NRXOWFKL $ f 3URF 1DWO $FDG 6FL 86$ 0 /L : 5HGG\ 5 +HQQLQJ (SVWHLQ 3 DQG %XVFK + f %LRO &KHP /LDXWDUG DQG -HDQWHXU 3 f 1XFO $FLGV 5HV

PAGE 224

/LQ 7RELQ *UXPHW 0 DQG /LQ 6 f &HOO %LRO /LQJDSSD 9 &KDLGH]
PAGE 225

0RRQ 5 1LFRVLD 5 2OVHQ & +LOOH 0 DQG -HIIHU\ : f 'HY %LRO 0RUULV 7 0DUDVKL ) :HEHU / +LFNH\ ( *UHHQVSDQ %RQQHU 6WHLQ DQG 6WHLQ f 3URF 1DWO $FDG 6FL 86$ 0XOOHU 0 DQG %OREHO f 3URF 1DWO $FDG 6FL 86$ 0XOOHU 5 %UDYR 5 %XUFNKDUGW DQG &XUUDQ 7 f 1DWXUH 1J 6 f &HOO %LRO D 1LHOVHQ 3 *RHO] 6 DQG 7UDFKVHO + f &HOO %LRO ,QW 5HS 2n)DUUHOO 3 f %LRO &KHP 2KOVVRQ 5 DQG 3IHLIHU2KOVVRQ 6 f ([S &HOO 5HV 2UQHOOHV )H\ ( DQG 3HQPDQ 6 f 0RO &HOO %LRO 2VERUQ 0 f ,QYHVW 'HUPDWRO V 3DQGH\ 1 DQG 0DU]OXII : f 0RO &HOO %LRO B! 3HGHUVRQ 7 DQG 5REELQV ( f &HOO %LRO B 3HOW] 6 DQG 5RVV f 0RO &HOO %LRO 3HQPDQ 6 &DSHR )H\ ( &KDWWHUMHH 3 5HLWHU 7 (UPLVFK 6 DQG :DQ f LQ 7KH PRGHUQ FHOO ELRORJ\ VHULHV 6SDWLDO RUJDQL]DWLRQ RI HXNDU\RWLF FHOOV 0F,QWRVK -5 (G $ODQ 5 /LVV 1HZ
PAGE 226

5DXVFKHU ,,, ) &RKHQ &XUUDQ 7 %RV 7 9RJW 3 %RKPDQQ 7MLDQ 5 DQG )UDQ]D -U % f 6FLHQFH 5DYH 1 &UNYHQMDNRY 5 DQG %RHGWNHU + f 1XFO $FLGV 5HV 5DZQ f LQ %LRFKHPLVWU\ :DVVHUPDQ 0 DQG 1LFNRO (GV +DUSHU DQG 5RZ 1HZ
PAGE 227

6FKDW] DQG %XWRZ 5 f &HOO 6FKHUUHU DQG 'DUQHOO f %LRFKHP %LRSK\V 5HV &RPP 6FKOLZD 0 f &HOO %LRO 6FKPLGW : 3DUGXH 5 7XWW 0 %ULJJV 5 %ULQNOH\ % DQG +QLOLFD / f 3URF 1DWO $FDG 6FL 86$ 7 6HOGHQ / *HUVKPDQ / DQG (VWHV f %LRFK %LRSK\V 5HV &RPPXQ 6KLHOV $ 0DUDVKL ) 6WHLQ DQG 6WHLQ f %LRFKHP %LRSK\V 5HV &RPP 6LHUUD ) /LFKWOHU $ 0DUDVKL ) 5LFNLHV 5 9DQ '\NH 7 &ODVN 6 :HOOV 6WHLQ DQG 6WHLQ f 3URF 1DWO $FDG 6FL 86$ 7 6LPRQ 3HUDUD ( DQG /LQJDSSD 9 f &HOO %LRO 6LWWPDQ *UDYHV 5 DQG 0DU]OXII : f 3URF 1DWO $FDG 6FL 86$ 6LYH + +HLQW] 1 DQG 5RHGHU 5 f 0RO &HOO %LRO 6ORERGD 5 'HQWOHU : DQG 5RVHQEDXP f %LRFKHPLVWU\ 6RRG $ 3HUHLUD DQG :HLVVPDQ 6 f 3URF 1DWO $FDG 6FL 86$ 6RXWKHUQ 3 DQG %HUJ 3 f 0RO $SSO *HQ 6SDXOGLQJ .DMLZDUD .r DQG 0XHOOHU f 3URF 1DWO $FDG 6FL 86$ 6WDKO + DQG *DOOZLW] f (XU %LRFKHP 6WDXEHU & /XVFKHU % (FNQHU 5 /RWVFKHU ( DQG 6KXPSHUOL f (0%2 6WHLQ DQG %RUXQ 7 f &HOO %LRO 6WHLQ DQG 6WHLQ f 0RO &HOO %LRFKHP r 6WHLQ 6WHLQ DQG 0F*XLUH 3 f %LRFKHPLVWU\

PAGE 228

6WHLQ 7KUDOO & 3DUN : 0DQV 5 DQG 6WHLQ f 6FLHQFH 6WHLQ 6LHUUD ) 6WHLQ 3OXPE 0 0DUDVKL ) &DUR]]L 1 3URNRSS DQG %DXPEDFK / f LQ +LVWRQH *HQHV 6WHLQ 6WHLQ DQG 0DU]OXII : (GV -RKQ :LOH\ DQG 6RQV 1HZ
PAGE 229

8OOX ( 0XUSK\ 6 DQG 0HOOL 0 f &HOO 9DOH 5 6FKQDSS % 5HHVH 7 DQG 6KHHW] 0 f &HOO YDQ 9HQURRLM : 6LOOHNHQV 3 YDQ (HNHOHQ $ DQG 5HLQGHUV 5 f ([S &HOO 5HV 9HQNDWHVDQ 1 DQG 6WHHOH : f %LRFKHP %LRSK\V $FWD 9HUPD DQG 6DVVRQH&RUVL 3 f &HOO :DOWHU 3 DQG %OREHO f 3URF 1DWO $FDG 6FL 86$ :DOWHU 3 DQG %OREHO f &HOO %LRO :DOWHU 3 DQG %OREHO f 1DWXUH :DOWHU 3 DQG %OREHO f &HOO :DOWHU 3 *LOPRUH 5 DQG %OREHO f &HOO :DQJ
PAGE 230

:X 5 DQG %RQQHU : f 0RO &HOO %LRO
PAGE 231

%,2*5$3+,&$/ 6.(7&+ *HUDUG 3DXO =DPEHWWL ZDV ERUQ LQ 4XHHQV 1HZ
PAGE 232

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ IDQHW / 6WHLQ &KDLU n3URIHVVRU RI ,PPXQRORJ\ DQG 0HGLFDO 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DVAfGLVVLUADWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ -FIU\ 6ALQ A3URIHVVRU RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ As -DLPHV % )ODQHJDQ SURIHVVRU RI ,PPXQGORJ\ DQG 0HGLFDO 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 7KRPDV & 5RZH $VVLVWDQW 3URIHVVRU RI 3KDUPDFRORJ\ DQG 7KHUDSHXWLFV FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 5LFKDUG : 0R\HU 3URIHVVRU RI ,PPXQRORJ\ DQG 0HGLFDO 0LFURELRORJ\

PAGE 233

7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI 0HGLFLQH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 'HFHPEHU 'HDQ &ROOHJH RI 0HGLFLQH 'HDQ *UDGXDWH 6FKRRO

PAGE 234

81,9(56,7< 2) )/25,'$


Figure 5-2. Northern blot analysis of the cvtoskeleton and
soluble phase distribution of c-fos mRNA in cytochalasin D.
puromvcin. CD/puro. and CD/cvcloheximide treated cells.
HeLa cells were cultured in the presence of the drugs
and fractionated into cytoskeleton and soluble phases as
described in the Chapter 2. Equal quantities of RNA (10
g/sample) from each fraction were assayed for c-fos mRNA
content by Northern blot analysis. Lanes: 1) Control/csk? 2)
Control/sol? 3) CD/csk? 4) CD/sol? 5) Puro/csk; 6) Puro/sol;
7) CD/puro/csk; 8) CD/puro/sol; 9) CD/cyclo/csk? 10)
CD/cyclo/sol.


165
the signal peptide of SPH3E1 was changed to TTG (Figure 4-
5). Translation should therefore bypass this altered start
codon and initiate at the normal ATG codon in the histone
coding region, resulting in the synthesis of histone protein
without the signal peptide sequence. Initial studies using a
HeLa monoclonal cell line expressing the SPH3E1ATG" gene
demonstrated the localization of SPH3E1ATG" mRNA on
nonmembrane-bound polysomes, which indicates that in vivo
the signal peptide was not synthesized (Fig. 4-6) As seen
in Figure 6-1, greater than 90% of SPH3E1ATG mRNA is
associated with the cytoskeleton in the control cell
culture. Cytochalasin D and puromycin cotreatment
effectively released hCGcr and HLA-B7 mRNA from the
cytoskeleton with little or no effect on the association of
the SPH3E1ATG mRNA with the cytoskeleton (Figures 6-1 and
6-3, Table 6-1). Approximately 77% of SPH3E1ATG" mRNA and
less than 35% of HLA and hCGa mRNA remained attached to the
cytoskeleton under these conditions. Regardless of whether
the SPH3E1ATG' mRNA could be translated in the presence of
cytochalasin D and puromycin, no signal peptide would be
synthesized to anchor the message to the cytoskeleton. This
result further supports the proposal that the nucleotide
sequences coding for the signal peptide express a
cytoskeleton attachment site which is distinct from the
cytoskeletal attachment site of endogenous histone mRNA.


37
supernatant was transferred to a 150 ml Corex tube (Corning)
and nucleic acids were precipitated from solution with 30 ml
isopropanol at room temperature for 15 minutes. The DNA was
pelleted by centrifugation at 5,000 rpm in Beckman JS-7.5
rotor for 30 minutes at 20C. The pellet was briefly dried
under vacuum and resuspended in 8 ml 10:1 TE buffer (10 mM
Tris pH 8.0, 1 mM EDTA). The DNA solution was adjusted to a
final concentration of 1 mg/ml of CsCl (refractive index of
1.3860) and 600 Mg/ml ethidium bromide. The DNA solution was
then transferred to a 16 x 76 mm Quick-Seal tube (Beckman)
and centrifuged to equilibrium at 45,000 rpm in a Beckman
Type-50 Ti rotor and Beckman L5-65 ultracentrifuge for 36-48
hours at 20C. The supercoiled plasmid DNA was removed from
the cesium chloride gradient by puncturing the side of the
tube just below the DNA band with a syringe containing a 22
gauge needle. The DNA was extracted repeatedly with 1-
butanol to remove the ethidium bromide and to reduce the
volume of the solution. Cesium chloride was removed by
dialysis against 10:1 TE buffer at 4C. The DNA was
quantitated by absorbance at 260 nm and stored at -20C.
Routinely, the yield for pBR322 derived plasmids was 500-800
jig DNA per 500 ml amplified culture.
M13 Bacteriophage DNA Preparations
M13 is a filamentous DNA bacteriophage that is specific
for male L. coli bacteria. M13 phage DNA is useful for site


74
(w/v) EDTA and 0.5 ml of the cell suspension was seeded into
20 ml completed EMEM containing 500 /xg/ml biologically
active Geneticin (G418, Gibco) in 10 cm tissue culture
dishes. The cells were incubated at 37C, 5% C02 and refed
every 3-4 days with completed EMEM containing G418
antibiotic. Within 2-3 weeks, the majority of the cells had
died and individual colonies of G418 resistant HeLa cells
had formed. Polyclonal cell lines were established by
combining the G418 resistant colonies from a 10 cm dish as a
single, heterogeneous cell population (usually 20-40
colonies). For the establishment of monoclonal cell lines,
individual colonies were picked from the dish with sterile
pasteur pipettes and cultured as separate cell lines.


41
Exponentially growing HeLa cells (5 x 107 cells) were
harvested by centrifugation at 1,500 rpm for 5 minutes at
37C in an IEC rotor. The cells were washed in phosphate-
buffered saline (PBS; 150 mM NaCl, 10 mM sodium phosphate pH
6.8) and resuspended in 3 ml lysis buffer (2 mM Tris-HCl pH
7.4, l"mM EDTA) containing 5 /Lig/ml PVS. Cells were lysed in
the presence of 2.4% SDS and 88 /xg/ml of proteinase K at
room temperature for 15 minutes. Lysates were adjusted to
300 mM NaCl, extracted with 5 ml Tris-saturated phenol and 5
ml CHCl3/isoamyl alcohol (IAA) (24:1, v/v) and centrifuged
at 3,000 rpm in an IEC rotor at room temperature. The
aqueous phase was then extracted with 5 ml CHC13/IAA and
centrifuged at 3,000 rpm in an IEC rotor at room
temperature. The phenol/chloroform and chloroform
extractions were repeated as described above. Nucleic acids
were precipitated from the aqueous phase with 2.5 volumes of
95% ethanol at -20C in the presence of 53 mM potassium
acetate.
Nucleic acids were recovered from the ethanol
suspension by centrifugation at 12,000 x g and resuspended
in TCM buffer (10 mM Tris-Hcl, pH 7.4, CaCl2, 10 mM MgCl2)
for digestion with DNase I. The DNase I was dissolved in 20
mM Tris-HCl pH 7.4, 10 mM CaCl2 at 1 mg/ml, preincubated at
37C for 20 minutes and treated with 0.1 volume of
proteinase K [1 mg/ml] at 37C for 2 hours to remove
ribonuclease activity (Tullis and Rubin, 1980). The nucleic


fos Induction
177
70
60
CDPuro
control


157
a)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16


146
mRNA to the cytoskeleton (Cervera et al.. 1981; Howe and
Hershey, 1984). Consistent with this finding, 79% of HLA-B7
mRNA and 85% of hCGa mRNA remained attached to the
cytoskeleton in puromycin treated HeLa cells (Table 5-2). In
addition, 79% of the H3 and H4 histone poly A mRNA and 83%
of the"c-fos mRNA remained associated with the cytoskeleton
in HeLa cells treated with puromycin (Table 5-2).
Discussion
There is growing support for the hypothesis that the
cytoskeleton of eukaryotes is more than a structural
scaffold. Evidence is accumulating to suggest that the
cytoskeleton is a dynamic structure that plays an integral
role in the process of protein synthesis. In addition, the
cytoskeleton may influence the posttranscriptional
regulation of eukaryotic genes by compartmentalizing mRNAs
within the cytoplasmic space. It is therefore of importance
to study the interactions of eukaryotic mRNAs with the
cytoskeleton.
The experiments presented here were designed to examine
the association of specific mRNAs with the cytoskeleton. As
described previously and confirmed in this study, histone
mRNA and HLA-B7 mRNA were found predominantly associated
with the cytoskeleton (Zambetti et al.. 1985). In addition,
hCGa and c-fos mRNAs were also localized in the cytoskeleton
fraction. Recently it was shown that the association of poly


23
attention on the posttranscriptional regulation of histone
gene expression. The evidence cited above suggests that the
cytoplasm of eukaryotic cells is a highly organized region
which contains subcellular compartments that concentrate
translation factors as well as specific mRNAs (Fulton et
al.. 1980; Howe and Hershey, 1984; Lawrence and Singer,
1986; Ornelles et al.. 1986). Traditionally, the idea of
subcellular compartments refers to organelles such as the
nucleus, endoplasmic reticulum, and mitochondria. For
example, a popular biochemical definition of
compartmentation is "a simple regulatory mechanism in which
the enzymes for catabolism and biosynthesis are physically
separated by membrane-bound cell organelles" (Rawn, 1983). A
broader definition of subcellular compartmentation includes
any specialized region of the cell regardless of the
presence of a membrane and may be extended to such
components and regions as 1) nonmembrane-bound and membrane-
bound polysomes, 2) cytoskeleton and soluble phase, and 3)
spatial location (i.e., near the nucleus versus near the
plasma membrane).
Histone mRNAs and the factors that are involved in
their selective degradation during the inhibition of DNA
synthesis may be localized in a particular subcellular
compartment. Consistent with this reasoning, the subcellular
compartment may influence the posttranscriptional control of
histone gene expression. Based on this possibility, we have


4
(Robbins and Borun, 1967; Spaulding et al.. 1966; Stein and
Borun, 1972). In vitro translation studies using polysomal
RNA isolated from cells at various stages of the cell cycle
indicated that the histone mRNA was present exclusively
during S phase (Spalding et al.. 1966; Gallwitz and Mueller,
1969; Jacobs-Lorena et al.. 1972; Gallwitz and Briendl,
1972; Perry and Kelley, 1973; Borun et al.. 1975).
Quantitation of histone mRNA content during the cell cycle
by Northern blot analysis, using radiolabeled histone cDNA
and genomic clones, demonstrated that histone mRNA steady
levels closely parallel the rates of histone protein
synthesis as well as the rates of DNA replication (Heintz et
al.. 1983; Plumb et al.. 1983a; Baumbach et al. 1984). The
timing of histone protein synthesis during DNA synthesis is
not coincidental and represents a functional relationship
between these two processes. This is supported by the
following observations: 1) there is a coordinate induction
of histone protein synthesis and DNA synthesis during
stimulation of quiescent cells to proliferate (DeLisle et
al.. 1983; Green et al.. 1984a); 2) inhibition of DNA
synthesis with compounds such as hydroxyurea or cytosine
arabinoside results in a loss of histone mRNA with a
concomitant decrease in histone protein synthesis (Breindl
and Gallwitz, 1973; Butler and Mueller, 1973; Borun et al..
1975; Baumbach et al.. 1984) and 3) terminal differentiation
is marked by a down regulation in histone protein synthesis


31
gene. The recombinant plasmid F0108A contains an entire
human H4 histone gene which includes the promoter, coding
and 3' non-transcribed regions.
An HLA-B7 cDNA clone, pDPOOl, was generously supplied
by Dr. Sherman Weissman, Yale University, New Haven,
Connecticut (Sood et al.. 1981). The pDPOOl plasmid DNA was
constructed from the human cell line RPMI 4265 and contains
a 1400 bp insert coding for HLA-B7 in the PstI site of
pBR322 plasmid DNA. Therefore, the plasmid confers
tetracycline resistance and not ampicillin resistance to E.
coli HB101 bacteria.
The phCGa plasmid DNA was generously provided by Dr.
John Fiddes, California Biotechnology Inc., Mountain View,
California and Dr. John Nilson, Case Western Reserve
University, Cleveland, Ohio. The phCGa plasmid is a cDNA
clone containing a 621 bp fragment coding for the alpha
subunit of human chorionic gonadotropin inserted into the
Hindlll site of pBR322 and confers ampicillin resistance
(Fiddes and Goodman, 1979).
The beta-lactamase signal peptide-globin fusion gene,
pSP125e, was kindly provided by Dr. Vishwanath Lingappa,
University of California at San Francisco. The pSP125e clone
contains the signal peptide from the beta-lactamase gene of
E. coli plasmid pBR322 fused in frame to the coding sequence
for chimpanzee alpha globin. This fusion gene was subcloned
into the pSP64 vector (Promega Biotech) as a Hindlll-PstI


Abstract of Dissertation Presented to the Graduate School of the
University of Florida in Partial Fulfillment of the Requirements
for the Degree of Doctor of Philosophy
THE ROLE OF SUBCELLULAR COMPARTMENTS AND STRUCTURES
IN EUKARYOTIC GENE EXPRESSION
By
Gerard Paul Zambetti
December 1989
Chairperson: Janet Stein
Major Department: Immunology and Medical Microbiology
Histone mRNAs naturally reside on nonmembrane-bound
polysomes that are associated with the cytoskeleton. To
study whether the subcellular location plays a role in the
coupling of histone mRNA stability to DNA synthesis, a
signal peptide-histone fusion gene was constructed that
encodes a histone mRNA that is directed to membrane-bound
polysomes. The signal peptide-histone fusion mRNA when
localized in the foreign subcellular compartment is no
longer destabilized when DNA synthesis is inhibited. A
single nucleotide substitution in the signal peptide-histone
fusion gene by site-directed mutagenesis resulted in the
localization of the histone fusion mRNA on nonmembrane-bound
polysomes and restored the coupling of mRNA stability with
xi


216
Stein, J., Thrall, C., Park, W., Mans, R., and Stein, G.
(1975) Science 189, 557.
Stein, G., Sierra, F., Stein, J., Plumb, M., Marashi, F.,
Carozzi, N., Prokopp, K., and Baumbach, L. (1984) in Histone
Genes, Stein, G., Stein J., and Marzluff, W. Eds. (John
Wiley and Sons, New York) pp 397-455.
Stein, G., Lian, J., Stein, J., Briggs, R., Shalhoub, V. ,
Wright, K., Pauli, U., and van Wijnen, A. (1989) Proc. Natl.
Acad* Sci. U.S.A. 86, 1865.
Steinert, P. (1975) Biochem. J. 149, 39.
Steinert, P., and Gullino, M. (1976) Biochem. Biophys. Res.
Commun. 70, 221.
Stimac, E., Groppi, V., and Coffino, P. (1983) Biochem.
Biophys. Res. Commun. 114. 131.
Summerhayes, I., Cheng, Y.-S., Sun, T-T., and Chen, L.
(1981) J. Cell Biol. 90, 63.
Sun, T-T., and Green, H. (1978) J. Biol. Chem. 253. 2053.
Sun, T-T., Eichner, R., Nelson, W., Tseng, S., and Weiss, R.
(1983) J. Invest. Dermatol. 81, 109s.
Sytoyama, C., Frunzio, R., Liau, G., Mudryj, M., and De
Crombrugghe, B. (1986) Proc. Natl. Acad. Sci. U.S.A. 83.,
3213.
Talmadge, K., Stahl, S,, and Gilbert, W. (1980a) Proc. Natl.
Acad. Sci. U.S.A. 77, 3369.
Talmadge, K., Kaufman, J., and Gilbert, W. (1980b) Proc.
Natl. Acad. Sci. U.S.A. 77, 3988.
Tannenbaum, J., and Godman, G. (1983) Mol. Cell. Biol. 3,
132.
Thomas, P. (1980) Proc. Natl. Acad. Sci. U.S.A. 72, 5201.
Tilney, L., and Detmers, P. (1975) J. Cell Biol. 66, 508.
Toh, B., Lolait, S., Mathy, J-P., and Baum, R. (1980) Eur.
J. Cell Biol. 22, 376.
Towbin, H., Staehelin, T., and Gordon, J. (1979) Proc. Natl.
Acad. Sci. U.S.A. 76, 4350.
Tullis, R., and Rubin, H. (1980) Anal. Biochem. 107. 260.


152
may play an important part in the subcellular localization
of messenger RNA, which may ultimately affect
posttranscriptional regulation. At this time, we can not
rule out the possibility that mRNAs localized in different
regions of the cytoplasm are associated with the
cytoskeleton by different mechanisms. Additional studies are
currently underway to define further the association of mRNA
with the cytoskeleton and what influence this structure has
on the regulation of eukaryotic gene expression.


i 15
S P H 3
1 2
ALPHA ATG"
12 12
p robe
fu sion
H 3


148
and/or ribosome that is complexed with the endoplasmic
reticulum. The possibility that the nascent polypeptide
serves as an additional cytoskeleton attachment site for
membrane-bound polysomes is supported by the observation
that nascent polypeptides undergoing translocation into the
lumen of the endoplasmic reticulum are resistant to protease
digestion following detergent extraction (Connolly et al..
1989). The protection of the nascent polypeptides from
protease digestion, in the absence of membranes, appears to
be due to the association of the polypeptide with the
proteins of the translocation apparatus of the endoplasmic
reticulum.
To release membrane-bound polysomal mRNAs efficiently
from the cytoskeleton, both cytoskeletal attachment sites
must be disrupted. Dissociation of the polysomes with
puromycin alone fails to release membrane-bound polysomal
mRNA from the cytoskeleton. In this case, the mRNA remains
associated with the cytoskeleton through the cytochalasin D
sensitive site even though the polysomes are no longer
anchored to the endoplasmic reticulum. Consistent with this
reasoning, cytochalasin D treatment alone results in only a
partial release of membrane-bound polysomal mRNA from the
cytoskeleton. The partial release of membrane-bound
polysomal mRNA from the cytoskeleton in cytochalasin D
treated cells is most likely a result of the release of mRNA
from the cytochalasin D sensitive cytoskeleton attachment


54
Schuell Elutip column. The column was washed with 5 ml low
salt buffer to remove unincorporated radiolabeled
ribonucleotide and the DNA fragment was eluted in 400 ul
high salt buffer (Tris-HCl pH 7.4, 1 M NaCl, 1 mM EDTA). The
radiolabeled SI probe was usually used immediately and any
excess "was stored in high salt buffer at 4C.
Routinely, 10-25 nq RNA (30 ul) and 10 ul SI probe were
co-precipitated with 100 ul 95% ethanol at -20C overnight.
The sample was centrifuged at 12,000 x g, 4C for 15-30
minutes. The pellet was vacuum dried and resuspended in 10
ul 5x hybridization buffer (0.2 M Pipes pH 6.4, 2 M NaCl, 5
mM EDTA) and 40 ul recrystallized formamide. The sample was
heated at 90C for 10 minutes and then incubated at 55C for
3 hours. Single-stranded nucleic acids were digested with SI
nuclease by adding 400 ul ice cold SI nuclease buffer (0.03
M sodium acetate pH 4.6, 0.25 M NaCl, 1 mM ZnSOi) and 900
units SI nuclease at 37C for 30 minutes. The SI digestion
reaction was terminated by organic extraction with 0.5
volume phenol and 0.5 volume chloroform and then 0.5 volume
chloroform alone. Nucleic acids were precipitated from the
aqueous phase with 1 ml 95% ethanol at -20C overnight.
The SI nuclease digested samples were collected at
12,000 x g, 4C for 30 minutes. The pellets were vacuum
dried and resuspended in 5 ul loading buffer (80% formamide,
lx TBE [lOx TBE: 500 mM Tris-HCl pH 8.3, 500 mM boric acid,
10 mM EDTA], 0.1% bromophenol blue, 0.1% xylene cyanol). The


185
cytochalasin D and thereby raise the effective concentration
of other transcripts. To address these possibilities, we
examined the transcription of the 18S rRNA gene as well as
other genes during CD treatment. As seen in Fig. 7-4, the
transcription of 18S ribosomal RNA and cell cycle dependent
histone H4 genes is not significantly affected by
cytochalasin D. In addition, CD has no effect on the
transcription of genes coding for HLA-B7 (Fig. 7-5), beta-
globin and a cell cycle independent H2B histone (data not
shown). These results suggest that the increase in
transcription of c-fos and beta-actin genes during
cytochalasin D treatment is a selective response and not an
effect on transcription in general.
Transcriptional Induction of c-Fos During CD Treatment does
not Require New Protein Synthesis
The increase in c-fos gene transcription during CD
treatment may be a secondary effect of the drug.
Cytochalasin D may induce the synthesis of a protein that in
turn regulates the transcriptional activity of the c-fos
gene. To test this possibility, HeLa cells were pre-treated
with puromycin for 15 minutes prior to treatment with
cytochalasin D. The cells were then incubated in the
presence of both drugs for an additional 15 minutes. Cell
cultures treated with puromycin alone were incubated for 30
minutes in the presence of the inhibitor while control cells


199
research groups (Stein and Stein, 1984; Wu and Bonner,
1985), a critical concentration of unbound histone protein
may be required for the destabilization of histone mRNA
during inhibition of DNA synthesis. Localization of histone
mRNA in clusters may create pockets within the cytoplasm in
which £he unbound histone protein could reach the necessary
concentration for the destabilization of histone mRNA to
occur.
The alteration in subcellular location of the histone
fusion mRNA has been demonstrated by subcellular
fractionation and SI nuclease protection analysis (Chapter
4). It remains to be determined by in situ hybridization
analysis whether the spatial distribution of the histone
fusion mRNA has been significantly altered compared with
that of endogenous histone mRNA. Furthermore, identification
and purification of the components involved in the
posttranscriptional regulation of histone gene expression
may provide the opportunity to monitor directly the
subcellular localization of these factors by
immunofluorescence, cell fractionation and biochemical
analysis.
Another aspect concerning the localization of histone
mRNA in the cytoplasm, which warrants additional
consideration, is whether a single class or multiple classes
of histone mRNAs are contained within a cluster. For
example, a particular cluster may contain only H3 histone


103
<
<
III
z
z
CO
Q
a
X
a
v>
(/>
V)
a
1
2
3
eg
OJ
UJ
Ui
UJ
CO
CO
CO
r
X
X
a
a
CL
a
CO
a
a o. a
4 5 6
M
344
220
HYBRID H3 mRNA
130
ENDOGENOUS H3mRNA
75


167
(Jeffery, 1984; Bagchi et al., 1987), Furthermore, prosomes,
which are small ribonucleoprotein complexes that are
associated with translationally inactive mRNAs, are attached
to the cytokeratin-intermediate filaments in HeLa cells
(Grossi de Sa et al.. 1988). The role of the intermediate
filaments in the attachment of the chimeric mRNAs to the
cytoskeleton remains to be determined.
In Chapter 5, we demonstrated that the signal peptide-
histone fusion mRNA (SPH3E1) is relatively stable, as
compared to endogenous H3 histone mRNA, during inhibition of
DNA synthesis. The uncoupling of signal peptide-histone
fusion mRNA stability from DNA synthesis does not appear to
be a consequence of its association with the cytoskeleton
through the cytochalasin D and puromycin insensitive site.
The mutated signal peptide-histone fusion mRNA (SPH3E1ATG")
is efficiently destabilized during inhibition of DNA
synthesis and most likely expresses the same CD and
puromycin insensitive cytoskeletal attachment site as SPH3E1
mRNA.
In summary, a cytoskeletal attachment site has been
detected which is associated with a signal peptide-histone
chimeric mRNA. This site appears to be a direct or indirect
result of the nucleotide sequences coding for the signal
peptide. Studies on deletion and point mutants of the signal
peptide-histone chimeric mRNAs should prove useful in
providing insight into the elements involved in the
attachment of the mRNA to the cytoskeleton.


Figure 2-2. Outline of procedure for the isolation of
subcellular polvsomal fractions.


202
necessary to clarify these interpretations of the
cytochalasin D-hydroxyurea experiments. For example, sucrose
density gradient analysis of soluble phase RNA from
cytochalasin D treated cells should demonstrate whether
histone mRNA is released from the cytoskeleton in the same
manner as poly-A+ RNA. Furthermore, gel filtration studies
as described by Adams et al. (1983) on the composition of
the histone mRNA in the soluble phase after cytochalasin D
treatment should also provide information on whether the
histone mRNA, although no longer anchored to the
cytoskeleton, may still be complexed with cytoskeletal
components. These cytoskeletal components may be necessary
for histone mRNA destabilization during inhibition of DNA
replication.
The distribution of HLA-B7 mRNA between the
cytoskeleton and soluble fractions during cytochalasin D and
hydroxyurea cotreatment was also analyzed as an internal
control for equal loading of the RNA. Surprisingly, in view
of the results of Ornelles et al. (1986), cytochalasin D
treatment failed to release HLA-B7 mRNA from the
cytoskeleton (Chapter 5). Subsequent studies demonstrated
that polysomal HLA-B7 mRNA, as well as other membrane-bound
polysomes, are released from the cytoskeleton during
cytochalasin D and puromycin cotreatment (Chapter 5).
Puromycin alone or cytochalasin D and cycloheximide
cotreatment does not release membrane-bound polysomes from


170
The cytoskeleton also appears to play a role in the
transition between proliferation and the expression of
differentiated phenotypes. For example, normal B cells can
be induced to proliferate by co-stimulation with anti
immunoglobulin and B cell growth factor (Yoshizaki et al..
1982). "Cytochalasin D (CD) can substitute for B cell growth
factor and provide the signal, presumably through the
perturbation of the cytoskeleton, to induce proliferation of
anti-immunoglobulin treated normal B cells (Rothstein, 1985;
Rothstein, 1986). Also, promyelocytic leukemia HL60 cells
cultured in the presence of tumor-promoting phorbol esters
undergo rearrangement of the cytoskeleton and differentiate
into non-dividing macrophage-like cells (Rovera et al..
1979? Huberman et al.. 1979). Although the effects of
phorbol esters on cultured cells are many, it is possible
that the alteration in the cytoskeletal structure may be
involved in the progression of the differentiation pathway
(Diamond et al., 1980; Penman et al., 1983).
To define further the role of the cytoskeleton in gene
regulation, we have studied the effects of disrupting the
cytoskeleton with cytochalasin D on the regulation of a
series of genes. We report here that cytochalasin D
treatment of exponentially growing HeLa cells rapidly
induces the transcription of the c-fos gene. This increase
in transcription is accompanied by an increase in c-fos mRNA
levels. The effect of cytochalasin D on c-fos gene


Figure 3-2. Two-dimensional gel electrophoresis of
cvtoskeleton and soluble associated proteins.
HeLa cells were fractionated into a cytoskeleton and
soluble phase, protein was extracted from each phase and
subsequently analyzed by two-dimensional gel electrophoresis
as described in Chapter 2. Proteins of the soluble fraction
(Sol), A, were separated using wide range (pH 3-7)
ampholines while cytoskeletal proteins (Csk), B, were
separated with narrow range (pH 5-7) ampholines to more
clearly identify cytoskeletal species. V: vimentin, a:
actin, and t: tubulins. Unlabeled arrows in B depict HeLa
cytokeratins of 54 Kd (pi 6.0); 52.5 Kd (pi 6.1); 46 Kd (pi
5.1); and 45 Kd (pi 5.7), which were spots highly reactive
with commercially prepared prekeratin or stratum corneum
antisera (Franke et al.. 1981).


154
the cell enabled us to examine mRNA-cytoskeleton
interactions in more detail. The results presented here
indicate that the signal peptide-histone fusion mRNA is
associated with the cytoskeleton in a manner unlike that
reported for membrane-bound and nonmembrane-bound polysomes.
These results are consistent with the existence of a
cytoskeletal attachment element within the mRNP or mRNA
primary sequence and provide additional evidence for
heterogeneity in mRNA-cytoskeleton interactions.
Results
To investigate further the mechanism of mRNA attachment
to the cytoskeleton, we have studied and compared the
cytoskeletal association of endogenous nonmembrane-bound
polysomal histone mRNA with that of membrane-bound
polysomal, signal peptide-histone chimeric mRNA. In Chapter
4, we have described the construction of a signal peptide-
histone chimeric gene (SPH3E1) that when transfected into
HeLa cells is transcribed and the resulting chimeric histone
mRNAs are targeted to membrane-bound polysomes (Zambetti et
al.. 1986). Although the signal peptide fused to the histone
gene is derived from the beta-lactamase gene of the EL_ coli
plasmid pBR322, it is functional in HeLa cells (Chapter 4).
Figure 4-5 schematically diagrams endogenous H3 histone and
the signal peptide-histone (SPH3E1) mRNAs.


9
1987). Correcting for translation read through in these
mutants by inserting stop codons in all three reading frames
at the natural translation termination site restores the
coupling of mRNA stability to DNA replication.
Detailed studies on deletion mutants suggest that the
histone nascent polypeptide is not involved in the
posttranscriptional regulatory process (Capasso et al..
1987) Systematic removal of approximately 100 nucleotide
blocks spanning nearly the entire protein coding region had
no effect on the destabilization of these mutant histone
mRNAs when DNA synthesis was inhibited. Consistent with this
result, the deletion of the ATG translation start codon
which prevents the synthesis of histone protein did not
prevent the destabilization of the mRNA during inhibition of
DNA replication. Furthermore, as discussed above, the
minimal target sequences containing the stem-loop structure
confer instability to gamma globin mRNA when DNA synthesis
is interrupted (Pandey and Marzluff, 1987). The globin-
histone chimeric mRNA, although regulated as wild type
histone mRNA, does not encode any histone protein sequences.
Destabilization of histone mRNA appears to occur in a
stepwise manner initiating at the 3' terminus (Ross et al..
1986). The first detectable histone mRNA degradation product
lacks 5 nucleotides from the 3' terminus (Ross and Kobs,
1986; Ross et al. 1986). This degradation product is
detectable in the in vitro mRNA decay system as well as in


Figure 7-3. Time course of c-fos mRNA accumulation during
cvtochalasin D and puromvcin treatments in exponentially
growing HeLa cells.
HeLa cells were treated with cytochalasin D [10 nq/ml],
puromycin [0.4 mM] or cytochalasin D and puromycin for the
indicated times. The cells were collected and total cellular
RNA was isolated. The levels of c-fos mRNA were determined
by Northern blot analysis as described in Chapter 2. Each
lane represents 10 /g total cellular RNA. Lanes: 1)
control/0 min.? 2) control/60 min.? 3) DMSO control/60 min.;
4) CD/15 min.; 5) CD/30 min.; 6) CD/45 min.; 7) CD/60 min.;
8) CD/90 min.; 9) CD/120 min.; 10) CDPuro/15 min.; 11)
CDPuro/30 min.; 12) CDPuro/45 min.; 13) CDPuro/60 min.; 14)
CDPuro/90 min.; 15) CDPuro/120 min.; 16) Puro/15 min.; 17)
Puro/45 min.; 18) Puro/60 min.; 19) Puro/90 min.; 20)
Puro/120 minutes.


93
shuttling of newly synthesized histone polypeptides into the
nucleus and c) histone mRNA stability.
In agreement with long-standing in vitro translation
and cDNA hybridization results (Jacobs-Lorena et al.. 1972?
Liautard and Jeanteur, 1979; Gallwitz and Briendl, 1972?
Borun et al.. 1975; Stein et al.. 1975), we find that
histone mRNAs reside predominantly on nonmembrane-bound
polysomes. While we cannot dismiss the possibility that the
amounts of histone mRNAs detected in membrane-bound
polysomal subcellular fractions are biologically significant
(see Figures 3-1 and 3-3), we feel that this is a
consequence of the isolation procedure which operationally
defines the fraction obtained. The absence of detectable
HLA-B7 mRNAs on nonmembrane-bound polysomes suggests that
while mRNAs encoding intracellular proteins may be trapped
by the endoplasmic reticulum during this subcellular
fractionation technique, there is little, if any, stripping
of membrane-bound polysomes encoding extracellular
polypeptides, such as the HLA-B7 class I antigen. Within
this context, the question arises whether the transcripts
from histone genes that are not expressed in a cell cycle-
dependent manner (approximately 8-10%) are represented on
membrane-bound polysomes. However, this is not a likely
possibility because inhibition of DNA replication with
hydroxyurea brings about a comparable degradation of histone
mRNAs in all the subcellular fractions examined.


137
subcellular fractions demonstrated that approximately 75% of
the chorionic gonadotropin alpha (hCGa) mRNA was associated
with membrane-bound polysomes (autoradiograph not shown).
Analogous to HLA-B7 mRNA, hCGa mRNA was not fully released
from the cytoskeleton in cytochalasin D treated cells?
greater than 90% of the gonadotropin mRNA was associated
with the cytoskeleton in control cells and approximately 77%
remained associated with the cytoskeleton in cells treated
with 10 nq/TC 1 cytochalasin D (autoradiograph not shown; data
summarized in Table 5-1).
Nonmembrane-Bound Polvsomal mRNAs are Released from the
Cytoskeleton bv Cytochalasin D Treatment
Previous results have demonstrated that histone mRNAs
are predominantly translated on cytoskeleton associated,
nonmembrane-bound polysomes (Zambetti et al., 1985) and as
described above, are released from the cytoskeleton into the
soluble phase by cytochalasin D treatment. As an additional
control for studying the release of nonmembrane-bound
polysomal RNAs from the cytoskeleton by cytochalasin D
treatment, we analyzed the distribution of c-fos mRNA
between the cytoskeleton and soluble fractions from control
and cytochalasin D treated cell cultures. The c-fos protein
is localized within the nucleus (Curran et al.. 1984) and
therefore, according to the signal hypothesis, should be
synthesized on nonmembrane-bound polysomes (Blobel and


208
Challoner, P., Moss, S., and Groudine, M. (1989) Mol. Cell.
Biol. 9, 902.
Clarke, M., and Spudich, J. (1977) Annu. Rev. Biochem. 46.
797.
Clayton, D., and Darnell Jr., J. (1983) Mol. Cell. Biol. 3,
1552.
Cline,JK. (1986) J. Biol. Chem. 261, 14804.
Cochran, B., Zullo, J., Verma, I., and Stiles, C. (1984)
Science 226. 1080.
Collart, D., Stein, G., and Stein, J. (1985) Mol. Cell.
Bioch. 67. 161*
Connolly, T., Collins, P., and Gilmore, R. (1989) J. Cell
Biol. 108, 299.
Curran, T., Miller, A., Zokas, L., and Verma, I. (1984) Cell
36, 259.
Curran, T., and Morgan, J. (1985) Science 229. 1265.
Date, T., Zwizinski, C., Ludmerer, S., and Wickner, W.
(1980) Proc. Natl. Acad. Sci. U.S.A. 77, 827.
Delange, R., Fambrough, D., Smith, E. and Bonner, J. (1969)
J. Biol. Chem. 244, 5669.
DeLisle, A., Graves, R., Marzluff, W., and Johnson, L.
(1983) Mol. Cell. Biol. 3, 1920.
Delacourte, A., Filleatreau, G., Boulteau, F., Biserte, G.,
and Schrevel, J. (1980) Biol. J. 191, 543.
Diamond, L., O'Brien, T., and Baird, W. (1980) Adv. Cancer
Res. 32., 1.
Distel, R., Ro, H.-S., Rosen, B., Groves, D., and
Spiegelman, B. (1987) Cell 49, 835.
Emr, S., and Bassford Jr., P. (1982) J. Biol. Chem. 257,
5852.
Emr, S., Schwartz, M., and Silhavy, T. (1978) Proc. Natl.
Acad. Sci, U.S.A. T5, 5802.
Emr, S., Hall, M., and Silhavy, T. (1980) J. Cell Biol. 86.
701.


204
useful in the identification of an mRNA-cytoskeleton
attachment site.
The role of the cytoskeleton structure in influencing
gene expression is supported by the observation that
cytochalasin D treatment resulted in a rapid and dramatic
increase in c-fos gene transcription with a concomitant
increase in c-fos mRNA cellular levels (Chapter 7).
Consistent with previous results (Tannenbaum and Godman,
1983), CD treatment also increased beta-actin gene
transcription. However, these modifications in gene
expression appear to be selective and not a general
phenomenon, since the transcription of several other genes
was unaffected by the drug treatment. The increase in c-fos
mRNA cellular levels was larger than the increase in c-fos
gene transcription and may be due to a stabilization of the
c-fos message under these conditions. Cell fractionation and
Northern blot analysis demonstrated that c-fos mRNA is
associated with the cytoskeleton in control cells and
accumulates in the soluble phase in cytochalasin D treated
cells (Chapter 5). Stabilization of c-fos mRNA may be due to
the altered subcellular location of the message during
cytochalasin D treatment. Additional studies are needed to
define the molecular basis for the role of the cytoskeletal
structure in the transcriptional and posttranscriptional
regulation of c-fos gene expression.


13
There are at least five major classes of protein that
constitute the intermediate filaments: 1) desmin, 2)
vimentin, 3) keratin, 4) neurofilaments and 5) glial
filaments. Biochemical and immunological studies
demonstrated that these proteins are generally expressed in
a cell"type specific manner (for review see Lazarides,
1980). Desmin is an acidic protein with a molecular weight
of 53,000 Daltons and is predominantly found in intermediate
filaments from cardiac, smooth and skeletal muscle cells
(Lazarides and Hubbard, 1976; Hubbard and Lazarides, 1979).
The localization of desmin at the Z line in muscle suggests
a role for this protein in the coordination of the
contractile actions of the muscle fiber (Lazarides and
Hubbard, 1976; Izant and Lazarides, 1977).
Vimentin is found principally in intermediate filaments
from cells of mesenchymal origin. Immunological and
biochemical characterization of vimentin indicated that the
protein is 52,000 Daltons and widely conserved throughout
evolution (Brown et al.. 1976; Bennett et al.. 1978; Franke
et al.. 1979). A characteristic feature of the vimentin
intermediate filaments is their sensitivity to colchicine
which erroneously led researchers to believe initially that
they were disaggregation products of the microtubules
(Goldman and Knipe, 1973; Holltrop et al.. 1974; Blose and
Chacko, 1976). The collapse of vimentin into filamentous
bundles around the nucleus during colchicine treatment


8
all known cell cycle dependent histone mRNAs (Hentschel and
Birnstiel, 1981). The presence of the stem-loop structure is
not sufficient by itself to couple mRNA stability with DNA
replication. The target sequences must be present in the
proper position at the 3' terminus of the mRNA to be
operative. Aberrant histone mRNA transcripts containing the
target sequences at an internal position are fully stable
during the inhibition of DNA synthesis (Alterman et al..
1985; Luscher et al.. 1985; Pandey and Marzluff, 1987;
Levine et al. 1987). Furthermore, moving the stem-loop
structure 380 nucleotides downstream from the translation
stop codon abolishes the coupling of histone mRNA stability
with DNA replication despite the retention of the stem loop
structure at the 3'terminus (Graves et al.. 1987).
An additional constraint on the histone
posttranscriptional regulatory mechanism is that translation
must proceed to within close proximity of the natural
termination codon for destabilization to occur during
inhibition of DNA synthesis (Graves et al.. 1987). Frame-
shift mutations in histone mRNA resulting in the premature
termination of translation more than 300 nucleotides from
the 3' terminus stabilize the messenger RNA when DNA
synthesis is interrupted (Graves et al.. 1987). Other frame-
shift mutants that allow translation to continue past the
natural UGA stop codon into the 31 untranslated region are
also stable when DNA synthesis is inhibited (Capasso et al..


68
with the alkali conditions), in order, the following
solutions each containing 0.2 N NaOH, 1 M NaCl, 2 mM EDTA:
1) 1 ml 20% sucrose? 2) 1 ml 17.5% sucrose; 3) 1 ml 15%
sucrose; 4) 1 ml 10% sucrose; 5) 5% sucrose. The tube was
incubated at 4C for 2 hours. The samples were centrifuged
througt the alkaline sucrose gradients in a Beckman SW 50.1
rotor at 37,000 rpm for 2 hours at 4C without the brake.
The samples were recovered from the gradients by puncturing
the bottom of the tube with a 21 gauge needle and collecting
7 drops per fraction in 1.5 ml microcentrifuge tubes
(usually -60 fractions). Fractions containing covalently
closed, double-stranded DNA were determined by Cherenkov
scintillation counting in the tritium channel, pooled and
neutralized with 1M Tris-citrate pH 5.
Isolation of Mutated M13 Recombinant Bacteriophage
The DNA was transfected into E^_ coli JM101 competent
cells, plated onto YT agar and incubated overnight at 37C.
Individual plaques were picked and bacteriophage were
subsequently prepared. Bacteriophage suspensions (2 ul) were
spotted onto a 0.45 micron nitrocellulose filter and
prehybridized in 6x SSC, lOx Denhardt's, 0.2% SDS (10 ml/100
cm2) at 67C for 1 hour. The filter was rinsed in 50 ml 6x
SSC for 1 minute at 21C and hybridized in 10 ml 6x SSC, lOx
Denhardt's containing 1x10 cpm radiolabeled oligonucleotide
at 21C for 1 hour. The filter was washed three times in 50
ml 6x SSC at 21C for a total of 10 minutes. The filter was


53
containing the Smal fragment was butanol extracted to reduce
the volume and to remove the ethidium bromide. The fragment
was then extracted with phenol and chloroform and
precipitated in 2.5 volumes 95% ethanol at -20C overnight.
The DNA was collected by centrifugation at 12,000 x g at 4C
for 15"minutes and resuspended in 5 ul 10 mM Tris-HCl pH
8.0, 5 ul lOx CIP buffer (0.5 M Tris-HCl pH 8.0, 10 mM
MgCl2, 1 mM ZnCl2, 10 mM spermidine) and 38 ul ddH20. The
blunt-ended DNA was dephosphorylated with 0.12 units calf
intestinal alkaline phosphatase (CIP) at 37C for 15 minutes
and then at 55C for 15 minutes. A second aliquot of CIP was
added and the incubations at 37 and 55C were repeated. The
reaction was terminated with 4 0 ul ddH20, 10 ul lOx STE (100
mM Tris-HCl pH 8.0, 1 M NaCl, 10 mM EDTA) and 5 ul 10% SDS
and heated at 68C for 15 minutes. The sample was extracted
with phenol and chloroform, adjusted to 0.25 M sodium
acetate and precipitated with 2.5 volumes of 95% ethanol at
-20C overnight. The dephosphorylated Smal fragment was
pelleted at 12,000 x g, 4C for 15 minutes, vacuum dried and
resuspended in 12 ul lx kinase buffer (66 mM Tris-HCl pH
9.5, 10 mM MgCl2, 10 mM beta-mercaptoethanol, 2 mM
spermidine). The SI fragment was phosphorylated with 50 uCi
[gamma-32P]ATP and 1 ul polynucleotide kinase [30 units/ul]
at 37C for 30 minutes. The reaction was terminated with 0.5
ul 100 mM EDTA at 70C for 10 minutes. The DNA solution was
diluted with 1 ml elutip low salt buffer (20 mM Tris-HCl pH
7.4, 0.2 M NaCl, 1 mM EDTA) and passed over a Schleicher and


30
Protein synthesis was inhibited with 10 /ng/ml
cycloheximide for varying lengths of time. Cycloheximide
stock solutions [500 ig/ml] were prepared fresh in IX
spinner salts. Protein synthesis was also inhibited with 0.4
mM puromycin for varying lengths of time. Puromycin stock
solutions [54.4 mg/ml] were prepared in dimethyl sulfoxide
(DMSO) and stored at -2 0C.
To study the dependence of protein synthesis on the
destabilization of histone mRNA during the inhibition of DNA
synthesis, we pre-treated cells with 10 Mg/ml cycloheximide
for 5 minutes and then added 1 mM hydroxyurea for an
additional 30 minutes.
Disruption of the cytoskeleton was generally achieved
by treating the cells with 5 to 60 lig/ml cytochalasin D for
15-20 minutes at 37C. The cytochalasin D stock solutions
[5-10 mg/ml] were prepared in DMSO and stored at -20C.
Plasmid DNA
The human histone genes used in this study were
previously isolated by Sierra et al. from a lambda Ch4A
bacteriophage library (1982). The histone genes were
subseguently subcloned into Escherichia coli pBR322 plasmid
DNA and propagated in E_s_ coli strain HB101 bacterium (Sierra
et al.. 1982; Plumb et al.. 1983; Stein et al.. 1984).
Recombinant plasmids ST519 and FF435C each contain a
distinct genomic DNA fragment encoding a human H3 histone


Figure 7-1. Effects of cvtochalasin D and puromycin
treatment on steady state levels of c-fos and chorionic
gonadotropin mRNA.
Exponentially growing Hela cells were treated with
cytochalasin D [10 /g/ml], puromycin [0.4 mM], or
cytochalasin D [10 ig/ml] and puromycin [0.4 mM] together
for 15 minutes. The cells were harvested and total cellular
RNA was isolated. Chorionic gonadotropin (hCGa) and c-fos
mRNA levels were determined by Northern blot analysis as
described in Chapter 2. Each lane represents 10 ig total
cellular mRNA. Lanes: 1) control? 2) cytochalasin D for 15
min.; 3) puromycin for 15 min.? and 4) CD and puromycin for
15 minutes.


107
The ability to direct a cell cycle-dependent histone
mRNA to membrane-bound polysomes provided the possibility to
address the involvement of subcellular location in the
coupling of histone mRNA stability with DNA replication. As
seen in Figure 4-4 (lanes 1-4), endogenous histone mRNA
levels"were reduced by greater than 90%, as determined by
densitometric analysis of the autoradiogram, in HeLa cells
following inhibition of DNA replication by treatment with 1
mM hydroxyurea for 60 minutes. In contrast, inhibition of
DNA replication by hydroxyurea treatment does not result in
a reduction of fusion message levels on membrane-bound
polysomes (lane 4). The finding that the signal peptide-
histone fusion mRNA is stable following DNA synthesis
inhibition is further supported by the SI nuclease analysis
of total cellular RNA (Figure 4-4). The endogenous histone
mRNA levels in hydroxyurea treated HeLa cells were reduced
by approximately 95% compared with those in untreated
HeLa cells (lanes 5-8) (with each lane representing an
independent transfected cell culture). In contrast, only a
4% reduction in fusion mRNA levels was measured (lanes 5-8).
These results demonstrate that the incorporation of the E.
coli beta-lactamase signal peptide into a human H3 histone
gene is sufficient to target the encoded fusion mRNA to the
membrane-bound polysomes and to confer stability to the
fusion message when DNA synthesis is inhibited.


Figure 2-1. Outline of the cloning scheme for the
construction of the signal peptide-histone fusion gene.
Restriction endonuclease sites are as follows: B,
BglII; E, EcoRI; H, HindIII; N, Ncol; P, PstI; S, Smal.
Abbreviations: S.P., coli pBR322 beta-lactamase signal
peptide coding sequences; H3REG, transcriptional H3 histone
regulatory region including CAAT and TATAA consensus
sequences; CAP, histone H3 mRNA transcription start site; H3
struct, sequences coding for H3 histone protein; ATG,
translation start codon; TAA, translation stop codon; SP6,
bacteriophage SP6 promoter.


171
expression does not appear to be a general phenomenon since
the transcription and steady state levels of several other
active and inactive genes are unaffected by the drug
treatment. These results imply that the cell monitors the
organization and/or composition of the cytoskeleton and
adjust "the regulation of c-fos gene expression accordingly.
This finding is consistent with signal transduction models
proposing that the cytoskeleton may be involved in relaying
stimuli from the plasma membrane to the nucleus.
Results
Cvtochalasin D Increases c-Fos mRNA Levels
Previous reports have suggested that the cytoskeleton
plays a role in signal transduction and the regulation of
gene expression. To further investigate this functional
property of the cytoskeleton, we have disrupted the
microfilaments of HeLa S3 cells with cytochalasin D and
measured the effects on transcription and mRNA cellular
levels of a series of genes. Within minutes of the addition
of cytochalasin D, cell morphology is drastically altered as
the cytoskeleton rearranges without any apparent
quantitative or qualitative loss of protein (Miranda et al..
1974a; Miranda et al., 1974b; Schliwa, 1982; Ornelles et
al.. 1986). It has been proposed that cytochalasin D acts by
binding to actin, causing the capping or fragmentation of
the microfilaments (Selden et al.. 1980; Lin et al.. 1980).


UNIVERSITY OF FLORIDA
3 1262 08557 0066


Figure 3-1. Northern blot analysis of H3 histone, H4 histone
and HLA-B7 mRNA in subcellular fractions.
The cytoskeleton and soluble fractions, as well as the
nonmembrane-bound and membrane-bound polysomal RNA
fractions, were isolated from HeLa cells by the procedures
described in Chapter 2 (Cervera et al., 1981; Venkatesan and
Steele, 1972) In addition, total polysomal RNA and total
cellular RNA were isolated (Plumb et al.. 1983, Venkatesan
and Steele, 1972) RNA was extracted from each subcellular
fraction and 50 fsq of RNA from each preparation was resolved
by 1.5% agarose, 6% formaldehyde gel electrophoresis. The
RNA was transferred to nitrocellulose and hybridized to
radiolabeled pFF435C (H3 histone and pFO108A (H4 histone)
probes, followed by hybridization to j2P-labeled (nick-
translated) pDPOOl (cDNA of HLA-B7) probe. The hybridized
filters were then exposed to preflashed XAR5 x-ray film at -
70C for 72 hours. From left to right, lanes: 1) total
cellular RNA? 2) Csk RNA; 3) Sol phase RNA; 4) NRER? 5)
MRER; 6) nonmembrane-bound polysomal RNA? 7) LER; and 8)
total polysomal RNA.


Figure 4-10. Quantitation of SPH3E1. SPH3ElalPha. SPH3E1ATG
mRNA during hvdroxvurea treatment.
The cellular levels of the signal peptide-histone
fusion mRNAs and endogenous H3 histone mRNA during
hydroxyurea treatment were determined by densitometric
analysis of the SI nuclease protection assays presented in
Figures 4-7 to 4-9. Values are presented as percentage of
control cells (, SPH3E1 mRNASPH3Elalpha mRNA;,
SPH3E1ATG mRNA?0, endogenous H3 histone mRNA).


Figure 3-4. Northern blot analysis of H3 histone. H4 histone
and HLA-B7 mRNAs associated with the cytoskeleton and
soluble fractions from HeLa cell treated with metabolic
inhibitors.
Exponentially growing HeLa cells were incubated in the
presence of metabolic inhibitors and fractionated into
cytoskeleton and soluble fractions as described in Chapter
2. RNA was extracted and assayed for H3 histone, H4 histone
and HLA-B7 mRNA content by Northern blot analysis as
described in Figure 3-1. From left to right, lanes: 1)
control, Csk; 2) control, Sol; 3} cycloheximide (Cy), Csk;
4) Cy,"Sol; 5) hydroxyurea (HU), Csk; 6) HU, Sol; 7) Cy/HU,
Csk; and 8) Cy/HU, Sol.


Figure 3-3. Northern blot analysis of H3 histone. H4 histone
and HLA-B7 mRNAs isolated from subcellular fractions of
cells treated with metabolic inhibitors.
Exponentially growing HeLa cells were incubated in the
presence of metabolic inhibitors and fractionated into
nonmembrane-bound and membrane-bound polysomes as described
in Chapter 2. RNA was extracted from each fraction and
assayed for H3 histone mRNA, H4 histone mRNA and HLA-B7 mRNA
content by Northern blot analysis as described in Figure 3-1
and Chapter 2. Upper panel from left to right, lanes: 1)
control (untreated), nonmembrane-bound polysomes; 2)
contro, NRER; 3) control, MRER; 4) control, LER (omitted);
5) cycloheximide (Cy), nonmembrane-bound polysomes; 6) Cy,
NRER; 7) Cy, MRER; and 8) Cy, LER. Lower panel from left to
right, lanes: 1) hydroxyurea (HU), nonmembrane-bound
polysomes; 2) Hu, NRER; 3) Hu, MRER; 4) Hu, LER; 5) CY/HU,
nonmembrane-bound polysomes; 6) Cy/Hu, NRER; 7) Cy/Hu, MRER;
and 8) Cy/Hu, LER.


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E7JEYIHGD_AM9AO5 INGEST_TIME 2012-12-07T22:58:22Z PACKAGE AA00012891_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES


192
cytochalasin D and puromycin co-treated cells is greater
than the levels of c-fos mRNA in CD treated and puromycin
treated cells combined. Furthermore, the time course of c-
fos mRNA accumulation in cytochalasin D treated cells is
more rapid and shorter lived than that observed in puromycin
treated cells.
Stimulation of c-fos transcription by cytochalasin D
treatment can occur during inhibition of protein synthesis
and therefore appears to be dependent on factors that are
already present within the treated cells. Pretreatment with
puromycin for 15 minutes followed by the addition of
cytochalasin D for 15 minutes results in a marked increase
in c-fos transcription (Fig. 7-5). Furthermore, inhibition
of protein synthesis for 30 minutes with puromycin alone
results in a significant increase in c-fos transcription.
These results are consistent with previous reports
suggesting that the c-fos gene is negatively regulated by a
labile factor (Mitchell et al.. 1985? Greenberg et al..
1986? Sassone-Corsi and Verma, 1987).
The increase in the cellular levels of c-fos mRNA
during cytochalasin D treatment is greater than the measured
increase in the transcription of the gene and may be due to
the stabilization of c-fos mRNA under these conditions.
However, it is possible that during cytochalasin D treatment
the mechanism involved in the turnover of c-fos mRNA remains
operative despite the reduced levels of protein synthesis.


Figure 6-1. Cvtochalasin D and puromycin cotreatment does
not release SPH3E1 or SPH3E1ATG' mRNA from the cvtoskeleton.
Clonal cell lines expressing SPH3E1 or SPH3E1ATG"
mRNA were treated with 10 ig/ml cytochalasin D, 0.4 mM
puromycin or 10 y.q/ml cytochalasin D and 0.4 mM puromycin.
The distribution of endogenous histone and fusion mRNAs
within the cytoskeleton and soluble phase fractions was
determined by SI nuclease protection analysis as described
in Chapter 2. Analysis of a) SPH3E1 and SPH3E1ATG mRNAs and
b) endogenous H3 histone mRNA. Lanes 1-8 represent RNA
samples isolated from SPHE1 expressing cells and lanes 9-16
represent RNA samples isolated from SPH3E1ATG" cell
cultures. Lanes 1 and 9, control-csk RNA; lanes 2 and 10,
control-sol RNA; lanes 3 and 11, CD-csk RNA; lanes 4 and 12,
CD-sol RNA; lanes 5 and 13, puro-csk RNA; lanes 6 and 14,
puro-sol RNA; lanes 7 and 15, CD/puro-csk RNA; lanes 8 and
16, CD/puro-sol RNA.


S P H 3 E 1 alpha
3 4 5 6 7 8
123
MW 1 2
probe
fusion
H3


28
T4 polynucleotide kinase (cloned) was from United States
Biochemical Corp. (USB), Cleveland, OH; cytochalasin D,
polyoxyethylene sorbitan monopalmitate (Tween 40), sodium
deoxycholate (NaDOC), sodium dodecyl sulfate (SDS), Triton
X-100, and DNase I (DN-EP) were purchased from Sigma, St.
Louis,"MO; lysozyme was purchased from Worthington
Biochemicals, Freehold, N.J.; fetal bovine, calf bovine and
horse sera were obtained from Gibco Laboratories, Grand
Island, NY or Flow Laboratories, McLean, VA; cycloheximide
was kindly provided by Upjohn, Kalamazoo, Michigan.
Conditions for Enzyme Reactions
The buffers and incubation conditions for each of the
restriction endonucleases and DNA modifying enzymes used in
this study were as described by the specific recommendations
of the manufacturers unless otherwise indicated.
Mammalian Cell Culture
HeLa Monolayer Cell Cultures
HeLa S3 suspension cells (human cervical carcinoma cell
line; ATCC ccl 2.2) were seeded into EMEM (Eagles-modified
minimum essential medium) containing 5% fetal calf serum, 5%
horse serum, 100 U/ml penicillin, 100 /g/ml streptomycin and
1 mM glutamine at 3x10 cells per 10 cm tissue culture dish
and incubated at 37C under 5% C02. Cells were maintained at
sub-confluent densities by splitting the cultures 1:10 into
fresh medium every 3 to 5 days.


32
fragment and is under control of the SP6 promoter (Simon et
al.. 1987).
To study the regulation of histone mRNA localized on
membrane-bound polysomes, we constructed a beta-lactamase
signal peptide-histone fusion gene as outlined in Figure 2-
1. The"first intermediate, pSPpSTdeltaHH/E, involved the
placement of the E_j_ coli pBR3 22 beta-lactamase signal
peptide-globin fusion gene from pSP125e under
transcriptional control of the cell cycle-dependent H3
histone regulatory region of pST519deltaH. The 840 bp
EcoRI/Hindlll fragment from pST519deltaH (Marashi et al..
1986) was isolated electrophoretically and blunt-ended using
the Klenow fragment of DNA polymerase I. The signal peptide-
globin fusion construct was digested with Bglll restriction
endonuclease, which cuts once in the untranslated leader
region of the fusion gene, blunt-ended with Klenow fragment
and dephosphorylated using calf intestinal alkaline
phosphatase. The 840 bp blunt-ended fragment from pST519 was
ligated into the Bglll blunt-ended site of pSP125e using T4
DNA ligase. The construction of the second intermediate,
pSPpSTdeltaHH/EpST, involved the substitution of the
chimpanzee globin coding sequences in pSPpSTdeltaHH/E with
the H3 histone coding sequences from pST519. The
pSPpSTdeltaHH/E DNA was digested with Ncol, which cuts at
the signal peptide-globin coding region junction, and
treated with calf intestinal phosphatase. The pST519 DNA was


10
whole cells (Ross et al. 1986). It is unclear whether this
product arises from a single endonucleolytic scission or
from multiple cuts removing one or more of the nucleotides
at a time. Degradation continues rapidly in a 3' to 5'
direction carried out by an exonuclease which is part of the
ribosome complex (Ross et al.. 1987). These results are
consistent with the requirement for translation to proceed
near the 3' terminus for the destabilization of the histone
mRNA during inhibition of DNA synthesis.
Subcellular Compartments
The appearance of histone mRNA on polysomes within
minutes after transcription and the equally rapid transfer
of the newly synthesized histone proteins into the nucleus
where they complex with DNA imply that histone protein
synthesis may be compartmentalized in a region located just
outside the nucleus (Spaulding et al.. 1966; Borun et al..
1967; Robbins and Borun, 1967). The asymmetric distribution
of eukaryotic mRNAs in the cytoplasm supports this
possibility. Morphological studies initially demonstrated
that polyribosomes are concentrated in areas surrounding the
nucleus in mouse 3T3 cells (Fulton et al.. 1980). Later,
localization of specific mRNAs by in situ hybridization
techniques provided direct evidence that mRNAs are
differentially distributed throughout the cell. Tubulin mRNA
is preferentially located in the periphery of the cytoplasm


60
polymerase I enzyme. In addition, the specific activity (1-2
x 103 cpm//ng DNA) achieved with the nick-translation
procedure is much lower than the random primer method (1 x
103 cpm/jug DNA) .
DNase I [1 mg/ml in 10 mM HCl] was activated by
incubating 1 ul of the enzyme in 9 ul DNase buffer (10 mM
Tris-HCl pH 7.5, 5 mM MgCl2, 1 mg/ml BSA) at 0C for 2
hours. The isotope (40-80 uCi [a-j2P] dCTP) was dried in a
Savant Speed Vac centrifuge. The following components were
added, in order, to the isotope : 1) 12.25 ul ddH20; 2) 2.5
ul lOx nick-translation buffer (500 mM Tris-HCl pH 7.8, 100
mM beta-mercaptoethanol, 50 mM MgCl2) ; 3) 5 ul lOx dNTPs
(100 uM of each dATP, dGTP, dTTP); 4) 1.25 ul BSA [1 mg/ml];
5) 2.5 ul DNA (100 ng/ul]; and 6) 0.5 ul DNA polymerase I [5
U/ul]. The activated DNase I was diluted with 990 ul ice
cold ddH20 (1:1,000 dilution; 1 ng/ul final concentration)
and 1 ul of diluted enzyme was added to the nick-translation
mix. The sample was incubated at 14C for 45 minutes and the
reaction was then terminated with 20 ul 250 mM EDTA and 155
ul TE buffer. The sample was extracted once with 200 ul
chloroform and unincorporated radiolabeled
deoxyribonucleotides were removed by chromatography over a
Biogel A-15m column. The DNA was quantitated and immediately
used for hybridization.


DNA synthesis. These results indicate that the subcellular
location of histone mRNA plays an important role in the
posttranscriptional regulation of histone gene expression.
We have determined that the association of histone mRNA
with the cytoskeleton is dependent on the integrity of actin
filaments. Disruption of the microfilaments with
cytochalasin D efficiently released histone mRNA from the
cytoskeleton into the soluble phase. In contrast, membrane-
bound polysomal mRNAs remained attached to the cytoskeleton
during cytochalasin D treatment. Subseguent studies have
demonstrated that membrane-bound polysomal mRNAs are
attached to the cytoskeleton at two different sites: 1) a
cytochalasin D sensitive site and 2) a puromycin sensitive
site.
Disruption of the cytoskeleton with cytochalasin D
resulted in a rapid and marked stimulation in transcription
of the c-fos proto-oncogene and an increase in c-fos mRNA
cellular levels. Transcription of several other genes was
unaffected by the cytochalasin D treatment. These results
suggest that the nucleus can respond to the structural
organization of the cytoskeleton and selectively adjust the
regulation of gene expression accordingly.
xii


CHAPTER 4
SUBCELLULAR LOCATION OF HISTONE mRNA PLAYS A ROLE IN THE
POSTTRANSCRIPTIONAL REGULATION OF HISTONE GENE EXPRESSION
Introduction
The association of histone mRNA-containing nonmembrane-
bound polysomes with the cytoskeleton may provide a
structural basis for the localization of the mRNA in
specific regions of the cytoplasm* Consistent with this
reasoning, the factors that mediate the rapid and selective
destabilization of histone mRNA during inhibition of DNA
synthesis may be co-localized with the message in the same
subcellular compartment. Therefore, the subcellular
localization of histone mRNA may play an important role in
its posttranscriptional regulation.
In this chapter, we describe a biological approach,
using a series of signal peptide-histone fusion genes, to
study whether the subcellular location of histone mRNA-
containing polysomes is functionally related to the coupling
of histone mRNA stability with DNA replication. In order to
study the influence of subcellular location on histone mRNA
stability, we constructed a signal peptide-histone gene
which was designed to target the encoded fusion message to
96


193
Previous studies on cytochalasin D treated HeLa cells
demonstrated the selective destabilization of histone mRNA
during inhibition of DNA synthesis (unpublished data). This
event is strictly dependent on protein synthesis and
demonstrates the competence of cytochalasin D treated cells
to carry out certain posttranscriptional processes. The
apparent stabilization of c-fos mRNA during cytochalasin D
treatment may therefore be a result of the release of the
mRNA from the cytoskeleton in monosome or mRNP form. Release
of c-fos mRNA from the cytoskeleton into the soluble phase
could physically separate the message from the factors
involved in its turnover. These regulatory factors may be
sequestered and concentrated by the cytoskeleton or an
integral component of the ribosome.
The mechanism of induction of c-fos gene expression by
cytochalasin D treatment is not known. Many of the inducers
of c-fos transcription studied to date appear to effect
protein kinase C and/or adenylate cyclase enzyme activities
(Verma and Sassone-Corsi, 1987). The induction of c-fos gene
expression by cytochalasin D may also occur as an indirect
effect on protein kinase C or adenylate cyclase levels
although this has not yet been determined. Alternatively,
the disruption of the cytoskeleton by cytochalasin D may
also perturb the nuclear matrix which may in turn affect
transcription. However, a model which includes the
alteration in transcription as a result of the perturbation


39
within the phage DNA. The cell culture (1.5 ml) was
transferred to a microcentrifuge tube and spun in an
Eppendorf centrifuge at 12,000 x g for 10 minutes at 4C.
The supernatant (1.2 ml) was transferred to a sterile
microcentrifuge tube, 300 ul of 20% PEG, 2.5 M NaCl were
added and the sample was incubated at room temperature for
15 minutes. The remaining 200-300 ul of supernatant were
removed and stored at -20C as a phage stock. The phage
suspension was centrifuged at 12,000 x g for 5 minutes at
room temperature and the supernatant was decanted. The
pellet was resuspended in 150 ul TES buffer (20 mM Tris-HCl
pH 7.5, 10 mM NaCl, 0.1 mM Na2EDTA) The sample was
extracted with phenol as follows: 1) added 50 ul phenol and
vortexed for 2 seconds? 2) incubated at room temperature for
5 minutes? 3) vortexed for 2 seconds? and centrifuged at
12,000 x g for 4 minutes at room temperature. DNA was
precipitated from 130 ul of aqueous phase with 5 ul 3 M
sodium acetate and 340 ul 95% ethanol on crushed dry ice for
15 minutes and collected by centrifugation at 12,000 x g,
for 15 minutes at 4C. The supernatant was discarded and the
pellet was washed in 70% ethanol at room temperature. The
sample was centrifuged at 12,000 x g, room temperature for 5
minutes. The DNA pellet was dried under vacuum, resuspended
in 80 ul TES buffer and stored at -20C.


ACKNOWLE DGEMENTS
I would like to acknowledge the dedication of Drs.
Janet and Gary Stein to their work. Their commitment to
science has provided us with a well-equipped lab and the
funds to pursue our research. I would also like to extend
special thanks to the Stein's for their constant support and
guidance during my graduate studies. In addition, I would
like to thank Drs. Bert Flanegan, Tom Rowe and Dick Moyer
for their helpful advice as members of my graduate
committee.
My experiences with my fellow coworkers in the Stein's
lab have been very interesting, rewarding and fulfilling. I
would like to acknowledge and thank Marie Giorgio, Linda
Green, Farhad Marashi, Brian O'Donnell and Mary Beth Kennedy
for their technical guidance and assistance, and Ken Wright
and Joe Teixeira for their help dealing with the computers.
I thank Pat Naples for her appreciation and pledge of care
for "the coffee mug." I would like to thank Dave Collart,
Tim Morris and Charles Stewart for their friendship and for
their advice on raising bees, fishing, and golfing,
respectively. I would like to thank Andre van Wijnen for his
friendship, scientific expertise on and off the "Foos" ball
field, and for keeping an eye on Pat Naples and my coffee
11


188
UNTREATED
RIBO-
ACTIN -
H4 -
i
FOS -
HLA-B7-
CYTOCHALASIN D
PUROMYC IN
PURO+CYTO
RIBO
AC TIN -
HA -
FOS -
HLA-B7-


19
filaments with heat shock or indirectly with colcemid has no
effect on protein synthesis as determined by two-dimensional
electrophoresis indicating that translation is not dependent
on the integrity of the intermediate filaments (Welch and
Feramisco, 1985). Other reports suggest that the attachment
of mRNA to the cytoskeleton is mediated by the
microfilaments (Lenk et al.. 1977; Howe and Hershey, 1984;
Ornelles et al.. 1986) Treatment with cytochalasins, either
cytochalasin B or D, to disrupt the actin-containing
microfilaments results in the release of poly-A+ mRNA from
the cytoskeleton into the soluble phase. At least in the
case of cytochalasin D treatment, the release of poly-A+
mRNA from the cytoskeleton occurs in a dose dependent manner
and stoichiometrically reflects the degree of inhibition of
protein synthesis (Ornelles et al. 1986). These results
indicate that intact microfilaments are required for the
association of mRNA to the cytoskeleton; however, it can not
be concluded that the actin fibers directly bind the mRNA.
Nonmembrane-Bound and Membrane-Bound Polyribosomes;
The Signal Hypothesis
As described above, nearly 100 percent of the actively
translated polysomes are associated with the cytoskeleton.
Studies on vesicular stomatitis virus infected HeLa cells
demonstrated that membrane-bound polysomal mRNA coding for
the viral G glycoprotein and "free" polysomal mRNA coding


2
yield a better understanding of the processes controlling
proliferation, differentiation, cell aging and neoplasia.
Histone Genes and Proteins
There are five major classes of histone proteins (H4,
H2B, HiA, H3, and HI) ranging in molecular weight from
11,000 to 21,000 Daltons. They are basic proteins that have
been highly conserved throughout evolution. For example,
there are only two amino acids out of 102 which differ
between histone H4 from pea seedlings and calf thymus, which
suggests a critical role for these proteins in cell survival
(DeLange et al.. 1969). The histone proteins are encoded by
a family of moderately repeated genes (Wilson and Melli,
1977; Kedes, 1979). In humans, the histone genes are
arranged in clusters that are not organized in simple tandem
repeats as found in the sea urchin and other lower
eukaryotic genomes (Heintz et al.. 1981; Sierra et al.
1982; Carozzi et al.. 1984). The clusters are localized on
chromosomes 1, 6, and 12 and are interspersed with
repetitive elements (Green et al.. 1984b; Collart et al..
1985). It has been speculated that these repetitive elements
may play a role in recombination and gene duplication during
the evolution of this multi-gene family. The general
structure of the human histone genes is less complex than
many other eukaryotic genes since the histone protein coding
region is not interrupted by introns and the encoded mRNAs


63
of the signal peptide would disrupt its recognition by the
signal peptide recognition particle and would therefore,
prevent the translocation of the mutated histone fusion mRNA
to membrane-bound polysomes.
An oligonucleotide (SPa) containing two point mutations
was synthesized by Tom Doyle in the Department of
Microbiology and Immunology, University of Florida,
Gainesville, Florida. The oligonucleotide was composed of
the following seguence: 5' CAAAAAAGTGAATATGGGCGA 3', with
the mutated nucleotides underlined. The oligonucleotide was
received in ~2.5 ml 37% ammonium hydroxide and was heated at
55C for 6 hours to remove the protecting amine group. The
sample was dried under a gentle stream of air in the fume
hood and resuspended in 1 ml ddH20. The sample was extracted
two times with 600 ul n-butanol and the oligonucleotide was
precipitated from the aqueous phase by adding 200 ul 0.5 M
ammonium acetate and 2 ml 95% ethanol and chilling at -70C
for 30 minutes. The sample was centrifuged at 12,000 x g at
4C for 30 minutes, washed in 80% ethanol and resuspended in
200 ul ddH20. The yield of oligonucleotide was estimated
spectrophotometrically and was found to be 2.64 mg
(^26o/^280 2.0).
A second oligonucleotide (ATG) was designed to destroy
the signal peptide ATG translation start codon of the SPH3
fusion gene and thereby completely block the synthesis of
any signal peptide. The SPH3ATG" mRNA retains the histone


135
1 2345678
HLA-B7
H3
H4


67
and the incubation was continued at room temperature
overnight.
Enrichment for Covalently Closed Double-Stranded DNA
The in vitro synthesis of the entire second strand is
very inefficient due primarily to the large size of the M13
genome. The percent of covalently closed, double-stranded
DNA molecules is therefore, very small in comparison to the
partially double-stranded, incomplete DNA molecules. These
incomplete DNA molecules, when transfected into bacteria,
give rise to wild type plaque formation which complicates
the selection process for the mutated clones. Enrichment for
covalently closed, double-stranded DNA molecules by alkaline
sucrose gradient centrifugation greatly facilitates the
selection process.
The DNA was precipitated from the overnight extension
and ligation reaction by adding 30 ul ddH20, 50 ul 1.6 M
NaCl-13% PEG at 0cC for 15 minutes. The DNA was pelleted at
12,000 x g at room temperature for 15 minutes. The pellet
was gently washed in 100 ul cold 0.8 M NaCl-6.5% PEG,
centrifuged at 12,000 x g for 30 seconds and resuspended in
180 ul TE buffer. The sample was denatured with 20 ul 2 N
sodium hydroxide and layered onto a 5%-20% alkaline sucrose
step gradient. The gradient was prepared by adding to a 0.5
in x 2 in centrifuge tube (nitrocellulose or polyallomer; do
not use Beckman Ultra-clear tubes which are incompatible


189
examined the subcellular location of c-fos mRNA, with
respect to its association with the cytoskeletal structure,
in both control and cytochalasin D treated cells.
Northern blot analysis of cytoskeletal and soluble
phase RNAs from untreated HeLa cells demonstrated that
approximately 80% of c-fos mRNA is associated with the
cytoskeletal structure (Figure 5-2 and Table 5-2).
Cytochalasin D treatment efficiently disrupted this
association and released c-fos mRNA from the cytoskeleton
into the soluble phase. Greater than 70% of the c-fos mRNA
accumulated in the soluble phase in cytochalasin D treated
cells. Cytochalasin D and puromycin cotreatment also
preferentially increased c-fos mRNA levels in the soluble
phase. Nearly 80% of the c-fos mRNA was localized in the
soluble fraction isolated from CD and puromycin co-treated
cells. Consistent with the work of Ornelles et al. (1986),
puromycin treatment alone, which also increased c-fos mRNA
levels, had essentially no effect on the cytoskeletal and
soluble phase distribution of the mRNA. Approximately 85% of
the c-fos mRNA remained associated with the cytoskeleton in
puromycin treated cells. These results indicate that the
majority of the c-fos mRNA synthesized during cytochalasin D
treatment is localized in an altered subcellular region.
Accumulation of c-fos mRNA in an unnatural subcellular
compartment may physically remove it from the regulatory
factors that are involved in its stability.


207
Bird, R., Jacobs, F., Stein, G. Stein, J., and Sells, B.
(1985) Biochem. Biophys. Acta 824, 209.
Bishop, J.M. (1983) Annu. Rev. Biochem. 52, 301.
Blobel, G., and Dobberstein, B. (1975) J. Cell Biol. 67,
835.
Bloom, G. Luca, F. and Vallee, R. (1984) J. Cell Biol. 98
331.
Blose, S., and Chacko, S. (1976) J. Cell Biol. 70, 459.
Blum, J., and Wicha, M. (1988) J. Cell. Phys. 135, 13.
Bonneau, A., Darveau, A., and Sonenberg, N. (1985) J. Cell
Biol. 100, 1209.
Borun, T., Scharff, M., and Robbins, E. (1967) Proc. Natl.
Acad. Sci. U.S.A. 58, 1977.
Borun, T., Gabrielli, F., Ajiro, K., Zweidler, A., and
Baglioni, C. (1975) Cell 4, 59.
Briendl, M., and Gallwitz, D. (1973) Eur. J. Biochem. 32.
381.
Briendl, M., and Gallwitz, D. (1974) Eur. J. Biochem. 45.
91.
Brown, S., Levinson, W., and Spudich, J. (1976) Supramolec.
Struct. 5, 119.
Brush, D., Dodgson, J., Choi, O.-R., Stevens, W., and Engel,
J. (1985) Mol. Cell. Biol. 5, 1307.
Bulinski, J., and Borisy, G. (1980) J. Cell Biol. 87, 802.
Butler, W., and Mueller, G. (1973) Biochem. Biophys. Acta
294. 481.
Capasso, O., Bleecker, G., and Heintz, N, (1987) EMBO J. 6,
1825.
Carozzi, N., Marashi, F., Plumb, M., Zimmerman, S.,
Zimmerman, A., Wells, J., Stein, G., and Stein, J. (1984)
Science 224, 1115.
Cervera, M., Dreyfuss, G., and Penman, P. (1981) Cell 23,
113.


76
resulted in the rapid disappearance of histone mRNAs from
these polysomes (Borun et al.. 1967; Breindl and Gallwitz,
1974; Gallwitz, 1975).
The light polysomes on which translatable histone mRNAs
reside are presumably nonmembrane-bound ("free) polysomes
as predicted by the signal hypothesis (Blobel and
Dobberstein, 1975). Several lines of evidence suggest that
nonmembrane-bound polysomes are not freely diffusible within
the cytoplasm but are attached to the cytoskeleton. Penman
and co-workers (Lenk et al.. 1977) have demonstrated that
nearly 100% of total cytoplasmic polysomes co-fractionate
with the cytoskeletal framework. In addition, vesicular
stomatitis virus encoded nonmembrane-bound and membrane-
bound polysomal mRNAs are associated with the cytoskeleton
in virally infected HeLa cells (Cervera et al. 1983).
Taken together, these observations provide a basis for
the possibility that histone mRNA-containing polysomes
and/or their subcellular location may play a role in the
regulation of histone gene expression. Such reasoning is
consistent with the appearance of translatable histone mRNAs
on polysomes within minutes following transcription (Borun
et al. 1967) the equally rapid transfer of newly
synthesized histones into the nucleus where they complex
with DNA (Robbins and Borun, 1967; Spaulding et al. 1966),
and the degradation of histone mRNAs and cessation of
histone protein synthesis in parallel with the inhibition of


90
with cycloheximide and hydroxyurea had a stabilizing effect
on histone mRNA levels and no apparent effect on HLA-B7 mRNA
stability in both subcellular fractions. There were no
obvious differences in the stability of histone mRNAs
localized in the various subcellular compartments when
treated with hydroxyurea or cycloheximide. It is therefore
reasonable to conclude that the histone mRNA isolated in the
LER and membrane-bound fractions is a consequence of the
subcellular fractionation procedure. Our results, taken
together with previous findings (Jacobs-Lorena et al.. 1972;
Liautard and Jeanteur, 1979; Gallwitz and Breindl, 1972;
Borun et al., 1975; Stein et al.. 1975) suggest that histone
mRNAs, during normal cellular processing, are targeted to
the nonmembrane-bound polysomes, the common site of histone
protein synthesis.
DISCUSSION
Our objectives in pursuing these studies were two-fold.
The first was to confirm that histone proteins are
synthesized on nonmembrane-bound polysomes. The second was
to determine if the histone mRNA-containing polysomes are
associated with the cytoskeleton. Our rationale for this
approach was to begin addressing the questions whether the
subcellular location of histone containing polysomes
contributes to; a) the ability of histone mRNAs to be
translated immediately following transcription, b) the rapid


66
revealed a single major band at -80 bp for each molar ratio
of oligonucleotide to template DNA studied. This was the
expected size fragment and suggested that under these
conditions, the oligonucleotide was priming the synthesis of
the second strand from the proper site. If several
predominant bands had been detected (i.e. multiple priming
sites), more stringent annealing conditions would have been
required.
Synthesis of the Mutated Strand
The oligonucleotide (1.3 nq) was phosphorylated in 100
mM Tris-HCl pH 8, 10 mM MgCl2, 5 mM dithiothreitol, 10 uM
ATP with 15 units T4 polynucleotide kinase at 37C for 45
minutes. The reaction was terminated by heating at 65C for
10 minutes.
The phosphorylated oligonucleotide (13.3 pmole) was
annealed to M13/SPH3 recombinant DNA in lx solution A by
incubating the sample at 55C for 5 minutes and then at room
temperature for 5 minutes. After hybridization, the DNA was
diluted with 10 ul solution C (1 ul solution B [0.2 M Tris-
HCl pH 7.5, 0.1 M MgCl2, 0.1 M dithiothreitol], 1 ul 10 mM
dCTP, 1 ul 10 mM dTTP, 1 ul 10 mM dGTP, 0.5 ul 0.1 mM dATP,
1 ul 10 mM ATP, 1.5 ul [gamma-32P] dATP, 1.5 ul T4 DNA ligase
[1 U/ul], 2 ul ddH20) and the synthesis of the second strand
was initiated with 0.5 ul Klenow enzyme [100 U/16.7 ul] at
room temperature. After 5 minutes, 1 ul 10 mM dATP was added


175
1
2
3
4
c-f os
hCG


62
the mutated histone fusion mRNA, like endogenous histone
mRNA, associates with nonmembrane-bound polysomes.
Subcloninq of the Signal Peptide-Histone Fusion Gene
into M13 DNA
The signal peptide-histone fusion gene (SPH3) was
subcloned into M13mpl8 RF DNA. SPH3 DNA was digested with
EcoRI and Hindlll and the 1100 bp fragment was isolated from
a 0.8% agarose gel. The M13mpl8 DNA was digested with EcoRI
and Hindlll and the 7196 bp fragment was isolated from a
0.8% agarose gel. The 1100 bp SPH3 DNA fragment (-50 ng) and
7196 bp M13 DNA fragment (-50 ng) were ligated in 10 ul lx
ligation buffer (50 mM Tris pH 7.6, 10 mM MgCl2, 20 mM
dithiothreitol, 1 mM ATP and 50 nq/ral BSA) with 0.004 U T4
DNA ligase (NEB) at 22C overnight. The ligation mix was
transfected into competent JM101 bacteria, white plaques
were isolated, and M13/SPH3 recombinants were screened by
restriction endonuclease digestion analysis. Single-stranded
M13/SPH3 DNA was isolated from bacteriophage particles as
described above.
Synthesis and Processing of Oligonucleotides
The signal peptide encoded by the SPH3 histone fusion
gene was mutated by substituting leucine at amino acid
position 10 and proline at position 12 with histidine
residues. It was predicted that the introduction of two
positively charged amino acids into the hydrophobic region


KEY TO ABBREVIATIONS
BSA
Bovine Serum Albumin
cpm
Counts per minute
dCT>
Deoxycytidine-5'-triphosphate
ddCTP
Dideoxycytidine-5'-triphosphate
DNA
Deoxyribonucleic acid
DNase
Deoxyribonuclease
DTT
Dithiothreitol
EDTA
Ethylenediaminetetraacetic acid
Hepes
N-2 hydroxyethyl piperazine-N'-2
ethanesulfonic acid
HU
Hydroxyurea
juci
Microcurie
Mg
Microgram
Ml
Microliter
Mm
Micrometer
mm
Micromolar
OD
Optical density
PVS
Polyvinyl sulfate
RNA
Ribonucleic acid
rpm
Revolutions per minute
SDS
Sodium dodecylsulfate
SSC
Standard saline citrate buffer
Tris
(hydroxymethyl)aminomethane
x


166
Discussion
The data presented in this chapter demonstrate that the
signal peptide-histone fusion mRNAs (SPH3E1 and SPH3E1ATG")
express a cytoskeleton attachment site that is not
associated with histone mRNA, HLA-B7 mRNA or heterogeneous
poly-A^ mRNA (Chapter 5; Ornelles et al.. 1986). It is not
known whether the cytoskeleton attachment site unique to
SPH3E1 and SPH3E1ATG mRNA is due directly to the primary
nucleotide sequences coding for the signal peptide, an
alteration in the overall conformation of the mRNA or the
proteins associated with the mRNP.
The elements of the cytoskeleton that are involved in
the attachment of SPH3E1 mRNA and SPH3E1ATG" during
cytochalasin D and puromycin cotreatment have not been
identified. Association of the signal peptide-histone fusion
mRNAs with the cytoskeleton during cytochalasin D and
puromycin cotreatment indicates that the attachment site is
independent of intact microfilaments. In addition, the
cytochalasin D and puromycin insensitive cytoskeleton
attachment site does not directly involve the microtubules
since this cytoskeletal component is removed during the
fractionation procedure (Lenk et al.. 1977). The signal
peptide-histone fusion mRNAs may be associated with the
intermediate filaments of the cytoskeleton. Previous studies
on other cell types indicate that mRNPs are associated with
the cytoskeleton through the intermediate filaments


17
indicate that actively translated mRNAs are associated with
the cytoskeleton and this association may be requisite for
protein synthesis. Consistent with this possibility, the
inhibition of host protein synthesis coincides with the
release of host mRNA from the cytoskeletal structure and the
attachment of viral mRNA to the cytoskeleton in poliovirus
infected and adenovirus infected cells (Cervera et al..
1981; Lemieux and Beaud, 1982). During development,
maternally inherited mRNAs participate in protein synthesis
only at the time they become associated with the
cytoskeleton in sea urchin oocytes (Moon et al.. 1983).
The region of the polysome involved in its attachment
to the cytoskeleton is not known. Previous results indicate
that the association of polysomal mRNA with the cytoskeleton
is through the mRNA or mRNP particle and not through the
ribosome (Lenk et al.. 1977; Lenk and Penman, 1979; Cervera
et al.. 1981; Lemieux and Beaud, 1982). Disruption of
polysomes by heat shock, high salt, sodium fluoride or
pactamycin treatment releases the ribosomal subunits but not
the mRNA from the cytoskeleton into the soluble phase (Lenk
et al.. 1977; Cervera et al.. 1981; van Venrooij et al..
1981; Howe and Hershey, 1984). Immunofluorescence studies
indicate that the cap-binding protein is associated with the
cytoskeleton suggesting that the attachment of eukaryotic
mRNAs to the cytoskeleton may occur via the 5' mRNA cap
structure (Zumbe et al.. 1982). Earlier studies suggest that


138
Dobberstein, 1975). Subcellular fractionation and Northern
blot analysis revealed that c-fos mRNA is predominantly
associated with nonmembrane-bound polysomes (data not
shown), and that approximately 80% of the c-fos mRNA is
associated with the cytoskeleton (Figure 5-2, lanes 1 and 2;
Table $-2). Cytochalasin D as well as puromycin,
CD/puromycin and CD/cycloheximide dramatically increased c-
fos mRNA levels, and the newly synthesized c-fos mRNA
partitioned into both the cytoskeletal and soluble fractions
in a manner that reflects the drug treatment (Figure 5-2,
lanes 3-10; Table 5-2). Less than 30% of the c-fos mRNA
remained associated with the cytoskeleton in cytochalasin D
[10 fiq/ml] treated cells (Table 5-2).
Membrane-Bound Polvsomal mRNAs Express Multiple Cytoskeleton
Attachment Sites
Retention of membrane-bound polysomal mRNAs on the
cytoskeleton in cytochalasin D treated cells suggests that
this class of polysomal mRNA may contain additional
cytoskeleton attachment sites. Cell surface proteins, such
as HLA-B7 and chorionic gonadotropin, are generally
synthesized on membrane-bound polysomes that are complexed
with the endoplasmic reticulum (for review see Emr et al.,
1980). The nature of the interaction between the polysomes
and the endoplasmic reticulum appears to be mediated in part
by the nascent polypeptide that is inserted into the


158
Table 6-1. The percent of cvtoskeleton associated mRNAs
isolated from cvtochalasin D. puromycin and CD/puromycin
treated cells.
Control
CD
Puro
CD/Puro
A)
SPH3E1
>95%
93%
--
62%
Endogenous
H3
81%
31%

27%
B)
SPH3E1
93%
79%
94%
72%
hCG alpha
98%
81%
95%
18%
HLA-B7
99%
84%
93%
28%
Endogenous
H3
92%
46%
90%
26%
C)
SPH3E1ATG"
>90%
87%
>89%
77%
hCG alpha
98%
81%
89%
29%
HLA-B7
97%
89%
88%
35%
Endogenous
H3
78%
56%
79%
24%
The densitometric results from autoradiographs
represented in Figures 6-2 to 6-4 (A to C, respectively)
were corrected for the total yield of RNA from each fraction
(note: equal quantities of cytoskeleton and soluble RNAs
were analyzed in SI and northern assays which does not take
into consideration the unequal distribution of RNA within
these fractions or the changes that occur during CD and/or
puromycin treatment).


40
Double-stranded templates. E. coli strain JM101
(delta(lac-proAB) supE / F' fproA+. proB*. laclq.
lacZdeltaMIS]) bacteria were grown overnight in 5 ml YT
medium at 37C with agitation. The overnight culture (1 ml)
was transferred to 100 ml prewarmed YT medium and incubated
at 37C until the O.D. 590 reached 0.4 units. To assure
exponential growth the culture was again diluted 1:100 into
500 ml prewarmed YT medium and grown to an O.D. 590 of 0.4
units. The culture was infected with 500 ul of M13
bacteriophage supernatant which had been prepared from an
isolated plaque as described above for the preparation of
M13 single-stranded DNA. The infected cells were incubated
at 37C with agitation for no more than 8 hours. The cells
were harvested and RF M13 DNA was isolated as described
above for the preparation of plasmid DNA. Routinely, the
yield was 300 nq of supercoiled M13 DNA per 500 ml culture.
Isolation of Mammalian RNA
Isolation of Total Cellular RNA
The following procedure for the isolation of total
cellular RNA was developed by Dr Mark Plumb in the Stein's
laboratory primarily for work with HeLa cells. However, this
procedure has been successfully used without modification
for the isolation of total cellular RNA from human HL-60
cells, mouse 3T3-L1 cells, rat osteoblast primary cell
cultures, and Trypanosome cruzii cells.


TABLE OF CONTENTS
PAGE
ACKNOWLEDGEMENTS ii
LIST O FIGURES vi
LIST OF TABLES ix
KEY TO ABBREVIATIONS X
ABSTRACT xi
CHAPTERS
1) INTRODUCTION
General Background 1
Histone Genes and Proteins 2
Histone Gene Regulation: Transcriptional and Post-
Transcriptional Control 3
Subcellular Compartments 10
The Cytoskeleton: Microtubules, Intermediate
Filaments and Microfilaments 12
Cytoskeletal-mRNA Interactions 16
Nonmembrane-Bound and Membrane-Bound Polyribosomes:
The Signal Hypothesis 19
Overview of Project 22
2) GENERAL METHODS
Materials 27
Conditions for Enzyme Reactions 28
Mammalian Cell Culture 28
Plasmid DNA 3 0
DNA Isolation and Purification 35
Isolation of Mammalian RNA 40
Two-Dimensional Gel Electrophoresis and Immuno-
Blotting Analysis 48
Northern Blot Analysis 49
SI Nuclease Protection Analysis 52
In Vitro Nuclear Run-on Transcription Analysis 55
Radiolabeling DNA for Northern Blot Analysis 58
Site-Directed Mutagenesis 61
Transfection of DNA into Cells 71
Establishment of Polyclonal and Monoclonal Stably
Transformed Cell Lines 73
iv


214
Rauscher III, F. Cohen, D., Curran, T. Bos, T., Vogt, P.,
Bohmann, D., Tjian, R., and Franza Jr., B. (1988) Science
240. 1010.
Rave, N., Crkvenjakov, R., and Boedtker, H. (1979) Nucl.
Acids Res. 6, 3559.
Rawn, J. (1983) in Biochemistry. Wasserman, M., and Nickol,
D., Eds. (Harper and Row, New York) p 528.
Rebillard, M., Leibovitch, S., Jullien, M., Talha, S., and
Harel, L. (1987) Exp. Cell. Res. 172, 432.
Robb, R., Terhorst, C., and Strominger, J. (1978) J. Biol.
Chem. 253. 5319.
Robbins, E., and Borun, T. (1967) Proc. Natl. Acad. Sci.
U.S.A. 57, 409.
Roberts, C., and Wilson, G. (1985) Focus 7, 16.
Roggenkamp, R., Kustermann-Kuhn, B., and Hollenberg, C.
(1981) Proc. Natl. Acad. Sci. U.S.A. 78, 4466.
Roop, D., Hawley-Nelson, P., Cheng, C., and Yuspa, S. (1983)
Proc. Natl. Acad. Sci. U.S.A. 80, 716.
Ross, J., and Kobs, G. (1986) J. Mol. Biol. 188, 579.
Ross, J. Peltz, S. Kobs, G., and Brewer, G. (1986) Mol.
Cell. Biol. 6, 4362.
Ross, J., Kobs, G., Brewer, G., and Peltz, S. (1987) J.
Biol. Chem. 262, 9374.
Rovera, G,, Santoli, D., and Damsky, C. (1979) Proc. Natl.
Acad. Sci. U.S.A. 26, 1779.
Rothstein, T. (1985) J. Immunology 135. 106.
Rothstein, T. (1986) J. Immunology 136. 813.
Rubenstein, P., and Spudich, J. (1977) Proc. Natl. Acad.
Sci. U.S.A. 74, 120.
Sanger, J. (1975) Proc. Natl. Acad. Sci. U.S.A. 72, 2451.
Sassone-Corsi, P., and Verma, I. (1987) Nature 326. 507.
Schachner, M., Hedley-White, E., Hsu, D., Schoonmaker, G.,
and Bignami, A. (1977) J. Cell Biol. 75., 67.


42
acid samples were then digested with 0.1 mg/ml of proteinase
K treated DNase I for 20-30 minutes at 37C. Following DNase
I digestion, 0.05 volumes of 5 M NaCl and 0.25 volumes of
10% SDS were added to each sample and the RNA solutions were
repeatedly extracted with phenol and chloroform until the
interfce between the aqueous and organic phases was clean.
RNA was precipitated from the aqueous phase with 2.5 volumes
of 95% ethanol, at -20C overnight. The RNA was collected at
12,000 rpm in a JA20 rotor at 4C for 30 minutes. The pellet
was resuspended in double distilled water, quantitated by
optical density at 260 nm and stored at -20C. Typical
yields of RNA were 400 /xg per 90% confluent 10 cm plate of
HeLa S3 cells and 1 mg per 5 x 107 HeLa S3 cells with an
0 D 260/ O D. 280 of 1.8 to 2.0.
Isolation of Nonmembrane-bound. Membrane-bound and Total
Polvsomal RNA
The subcellular fractionation scheme used in these
studies is a modified procedure described by Venkatesan and
Steele (1972) and is outlined in Figure 2-2. Exponentially
growing HeLa cells (5 x 108 cells) were collected by
centrifugation at 1,500 rpm in an IEC rotor at 37C for 5
minutes. All subsequent procedures were carried out at 4C.
Cells were washed several times in PBS and resuspended in 25
ml RSB (10 mM Tris-HCl pH 7.4, 10 mM NaCl, 2.5 mM MgCl2) .
After incubation on ice for 20 minutes, the cells were


119
probe
fusion
H3


50
hours). For full size RNA gels, 200 ml agarose-formaldehyde
solution was cast in a plexiglass gel tray (24.5 cm x 19.8
cm) with 2: 20 well combs (1 mm x 6 mm per well). The gel
was electrophoresed at 100-120 volts until the bromophenol
blue migrated 11 cm (approximately 4 hours). The
formaldehyde gels were stained for 20 minutes in ethidium
bromide solution (1 /g/ml ethidium bromide, 0.1 M ammonium
acetate) and destained for at least 2 hours in double
distilled water. RNA samples were then visualized by
fluorescence under ultraviolet light using a short
wavelength transilluminator (UVP, inc.; San Gabriel, CA).
The gels were usually photographed at f4.5 for 1/4 second
with Type 57 high speed Polaroid film and a Polaroid model
545 camera mounted on a stand above the transilluminator.
Transfer of RNA from Aqarose-Formaldehvde Gels to
Hybridization Filters
RNA samples were transferred to nitrocellulose (0.45
urn) or nylon membrane hybridization filters in 20x SSC as
previously described by Thomas (1975). The gels were soaked
in 2Ox SSC (3 M NaCl, 0.3 M sodium citrate pH 7.0) for 20
minutes and were not stained with ethidium bromide. The
hybridization filters were uniformly wetted in ddH20 and
then 2Ox SSC. The gel was placed with the wells facing
downward onto a sheet of 3 MM paper (Whatman) and sponge
which had been soaked in 2Ox SSC. Strips of used X-ray films


14
suggests that these filaments are in close association with
the microtubules.
The keratin filaments, also known as tonofilaments, are
predominantly found in epithelial cells. The keratin
proteins are a family of approximately 30 distinct
polypeptides ranging in molecular weight from 40,000-65,000
Daltons (Steinert, 1975; Steinert and Gullino, 1976; Sun and
Green, 1978; Moll et al.. 1982). The keratins can be clearly
divided into acidic and basic groups based on two-
dimensional electrophoretic analysis. Although only a few
keratin subtypes are expressed in any one epithelial cell,
there is always a coordinated synthesis of at least one
class each of the acidic and basic keratin subunits (Moll et
al. 1982; Woodcock-Mitchell et al.. 1982; Fuchs and
Marchuk, 1983). The combination of keratin subtypes
expressed by an epithelial cell is characteristic of the
tissue origin as well as the differentiation state of the
cell (Roop et al.. 1983; Sun et al.. 1983). In addition,
some epithelially derived tumors express different keratin
subtypes than those found in the normal counterpart and
these differences may be useful in diagnostic tests
(Summerhayes et al.. 1981; Osborn, 1983).
Little is known about the function and organization of
the intermediate filaments from neuronal and glial cells.
The major cytoskeletal element of neuronal axons and
dendrites are the neuronal filaments which are generally


164
alone. Over 80% of these mRNAs were associated with the
cytoskeleton after CD treatment. In contrast, less than 28%
of the hCGa and HLA-B7 mRNAs remained associated with the
cytoskeleton after CD and puromycin cotreatment indicating
that the drug treatments were effective.
The association of the signal peptide-histone mRNA with
the cytoskeleton in CD and puromycin co-treated cells
suggests the existence of a cytoskeleton attachment site
that is distinct from the site associated with endogenous
histone mRNA and from other membrane-bound polysomes. These
results indicate that the site is independent of the
ribosomes and the nascent polypeptide and maybe a property
of the nucleotide sequence and/or proteins that interact
with the mRNA itself. Alternatively, the SPH3E1 chimeric
mRNA may be efficiently translated and therefore support re
initiation of translation even in the presence of
cytochalasin D and puromycin (note: endogenous histone mRNAs
are efficiently translated; Stahl and Gallwitz, 1977). This
would result in the synthesis of a portion of the signal
peptide which could then serve as an anchor to the
cytoskeletal structure as if the cells were treated with
cytochalasin D alone.
To address this possibility, we have studied the
cytoskeletal association of a mutated signal peptide-histone
chimeric mRNA (SPH3E1ATG ) Using site directed mutagenesis
(Zoller and Smith, 1983) the ATG translation start codon for


SPH3E1ATG-
121


149
site coupled with a partial "run off" of the polysomes from
the mRNA, which in effect dissociates the nascent
polypeptide from the mRNA.
In addition to the differential association of
membrane-bound and nonmembrane-bound polysomes with the
cytoskeleton, there also appears to be differences in the
cytoskeletal interaction of individual species of mRNA. As
seen in Table 5-2, hCGa mRNA and HLA-B7 mRNA are released
from the cytoskeleton to the same extent during CD and
puromycin cotreatment, which is consistent with the
mechanism for the association of membrane-bound polysomes
with the cytoskeleton as described above. However, CD and
cycloheximide cotreatment releases a larger percentage of
hCGa mRNA from the cytoskeleton than CD treatment alone. In
contrast, HLA-B7 mRNA is associated with the cytoskeleton to
the same extent or greater in cytochalasin D and
cycloheximide co-treated cells than HeLa cells treated with
CD alone. Furthermore, CD and cycloheximide cotreatment
readily dissociates histone mRNA from the cytoskeleton
whereas c-fos mRNA is only partially affected. These results
suggest that multiple mechanisms are operative for the
association of individual mRNAs and/or polysomes with the
cytoskeleton and may reflect differences in the structural
environment of the cell.
The possibility that the structural environment of the
cell may affect cytoskeletal-mRNA interactions is supported


64
translation start codon in its proper context, although
further downstream from the 5' terminus than endogenous H3
histone mRNA, and should therefore be translated on
nonmembrane-bound polysomes. In addition, SPH3ATG mRNA
differs from SPH3 wild type signal peptide-histone fusion
mRNA at only one nucleotide. The sequence of the ATG~
oligonucleotide is as follows: 5' AATACTCAAACTCTTCC 3', and
was prepared and processed as described for the SPa
oligonucleotide. The yield of ATG" oligonucleotide was only
445 Mg (^26o/^280 1.41) .
Optimization of Conditions for Site-Directed Mutagenesis
It was necessary to optimize the conditions for the
hybridization of the oligonucleotide to M13 template so that
the synthesis of the second strand was primed by the
oligonucleotide from the correct site. Proper priming by the
oligonucleotide was tested by primer extension analysis.
After limited primer extension, the samples were digested
with a restriction endonuclease that recognized a site
downstream from the expected priming site. The number and
intensity of the fragments produced by the digestion
indicated the number of priming sites and the location of
the preferred site.
The oligonucleotide (20 pmol) was phosphorylated with 5
units T4 polynucleotide kinase in 100 mM Tris-HCl pH 8.0, 10
mM MgCl2, 5 mM dithiothreitol, 20 uCi [gamma-32P] ATP at 37C


184
UNTREATED
RIBO
ACTIN
RIBO
FOS
H4
FOS
H4
RIBO
ACTIN
RIBO
FOS
H4
FOS
H4
CYTOCHALASIN D
PU RO/CYTO


109
512
396
344
298
220
154
130
HYBRID H3mRNA
ENDOGENOUS H3 mRNA


24
specifically asked the question: Does the subcellular
location of histone mRNA play a role in the destabilization
of histone mRNA during inhibition of DNA synthesis? To
address this question, we have applied a combination of
molecular and cellular approaches first, to determine the
natural location of histone mRNA and second, to alter the
subcellular compartment to study whether the foreign
location affects histone mRNA stability. The rationale for
this approach is that directing histone mRNA to an altered
subcellular location may physically remove the message from
the factors that are involved in the selective degradation
of histone mRNA during inhibition of DNA synthesis.
Our initial studies demonstrated that histone mRNAs are
translated predominantly on nonmembrane-bound polysomes that
are associated with the cytoskeleton. The subcellular
location of the mRNA was altered biologically by
constructing a histone fusion gene that contains sequences
coding for the signal peptide of the beta-lactamase gene of
E. coli pBR322 plasmid DNA. The encoded fusion histone mRNA
was directed to membrane-bound polysomes and was not
destabilized during inhibition of DNA synthesis.
Inactivation of signal peptide function by a single
nucleotide substitution in the ATG translation start codon
of the signal peptide resulted in the association of the
mutated fusion mRNA with nonmembrane-bound polysomes and
restored the coupling of the mRNA stability with DNA


143
remained associated with the cytoskeleton in cytochalasin D
treated cells that were subsequently treated with puromycin
(Table 5-2). In contrast, more than 75% of the HLA-B7 mRNA
and 72% of the hCGa mRNA remained associated with the
cytoskeleton in HeLa cells treated with cytochalasin D alone
(Table"5-2). The release of membrane-bound polysomal mRNAs
from the cytoskeleton in cytochalasin D and puromycin
treated HeLa cells was not a direct result of the inhibition
of protein synthesis. Cytochalasin D treatment followed by
the inhibition of protein synthesis with cycloheximide, a
compound that preserves the polysomal structure, failed to
release HLA-B7 mRNA from the cytoskeleton (Figure 5-3, lanes
9 and 10). Greater than 80% of the HLA-B7 mRNA was
associated with the cytoskeleton in cytochalasin D and
cycloheximide treated cells (Table 5-2). The results were
not as dramatic for the hCGa mRNA (Figure 5-3, lanes 9 and
10). Approximately 52% of hCGa mRNA was associated with the
cytoskeleton in cells treated with both cytochalasin D and
cycloheximide (Table 5-2).
The release of HLA-B7 mRNA and hCGa mRNA from the
cytoskeleton in cytochalasin D and puromycin treated HeLa
cells was not due solely to the inhibition of protein
synthesis by puromycin. As previously reported, the
dissociation of polysomes with high salt or heat shock
resulted in the release of the ribosomal subunits into the
soluble phase without affecting the attachment of poly A+


112
SPH3E1:
Alpha :
ATG' :
80 nt
CAP
ATG
$m
5
10
15
20
25
Gin
Hi s
Phe
Arg
Val
Ale
Leu
He
Pro
Phe
Phe
Ala
Ala
Phe
Cys
Leu
Pro
Val
Phe
Ala1
Met
Ala
CAA
CAU
UUC
CGU
GUC
GCC
CUU
AUU
CCC
UUU
UUU
GCG
GCA
UUU
UGC
CUU
CCU
GUU
UUU
GCC
AUG
GCU
Gin
His
Phe
Arg
Val
Ala
His
lie
His
Phe
Phe
Ala
Ala
Phe
Cys
Leu
Pro
Val
Phe
Ala
Met
Ala
CAA
CAU
UUC
CGU
GUC
GCC
CaU
AUU
CaC
UUU
UUU
GCG
GCA
UUU
UGC
CUU
CCU
GUU
UUU
GCC
AUG
GCU
GGAAGAGU uUG AGU AUU CAA CAU UC CGU GUC GCC CUU AUU
- - Het Ala
CCC UUU UUU GCG GCA UUU UGC CU CCU GUU UUU GCC AUG GCU


26
signal peptide-histone fusion mRNA from the cytoskeleton.
The nucleotide sequences of the signal peptide-histone
fusion mRNA encoding the signal peptide contain a
cytochalasin D and puromycin insensitive cytoskeletal
attachment site which is not expressed by histone mRNA or
HLA-B7"mRNA. These results provide evidence for the
heterogeneic pattern for cytoskeleton-mRNA interactions.
Lastly, we investigated the role of the cytoskeleton in
the regulation of gene expression by studying the effects of
disrupting the microfilaments with cytochalasin D on the
transcription and steady state mRNA levels of several genes.
We determined that the transcriptional and
posttranscriptional regulation of the c-fos proto-oncogene
is quite sensitive to the perturbation of the cytoskeleton
structure. Transcription of the c-fos gene is selectively
stimulated with a concomitant increase in c-fos mRNA steady
state levels within minutes of the addition of cytochalasin
D. Consistent with previous results, the transcription of
beta-actin was also elevated in cytochalasin D treated
cells. These findings suggests that the cell monitors the
organization of the cytoskeleton and selectively regulates
gene expression accordingly.


59
the isotope and buffer and the priming reaction was
initiated with 5 units Klenow enzyme [5 U/ul]. The sample
was incubated at room temperature for at least 2 hours
(usually overnight). The reaction was terminated with 1 ul
250 mM EDTA and 175 ul TE buffer (10 mM Tris-HCl pH 8, 1 mM
EDTA) and extracted once with 200 ul chloroform/isoamyl
alcohol. Unincorporated radiolabeled deoxynucleotide was
removed from the DNA by chromatography over a (10 mm x 100
mm) Biogel A-15m (Bio Rad) column in TE buffer. Fourteen
fractions were collected; 800 ul in the first fraction and
200 ul in each subsequent fraction. Fractions containing
radiolabeled DNA were determined by Cerenkov counting in the
tritium channel with a Beckman LS-230 scintillation counter.
The peak fractions were pooled and accurately quantitated by
counting 2 ul DNA in 5 ml Triton-toluene based scintillation
cocktail (2000 ml toluene, 1066 ml Triton X-100, 134 ml
liquifluor) in the j2P channel. The samples were immediately
used for hybridization studies and excess probe was stored
at 4C.
Nick-Translation Method
Nick-translation was the common procedure for
uniformally labeling DNA fragments or supercoiled DNA before
the development of the random primer method. A disadvantage
to using the nick-translation procedure is that the system
must be optimized for efficiency for each lot of E_¡_ coli DNA


Figure 7-5. Effect of protein synthesis inhibition on
cvtochalasin D induction of c-fos transcription in HeLa
cells.
Exponentially growing HeLa cells were treated with
cytochalasin D, puromycin, or puromycin and CD for the
indicated times. Radiolabeled RNAs were prepared by in vitro
nuclear run-on transcription and hybridized to Southern
blots of electrophoretically separated restriction enzyme
digested plasmid DNAs (107 cpm/filter). Insert DNAs
hybridizing to transcripts from the corresponding genes are
indicated. Untreated, DMSO for 15 min.; Cytochalasin D, CD
[10 Mg/ral] for 15 min.; Puromycin, puromycin [0.04 mM] for
30 min.; Puro + Cyto, puromycin [0.04 mM] for 30 min. and CD
[10 g/ml] for the last 15 minutes.


18
the association of eukaryotic mRNAs with the cytoskeleton
may occur through the poly-A tract (Milcarek and Penman,
1974). However, the association of uncapped poliovirus mRNAs
(Bonneau et al.. 1985) and poly-A" histone mRNAs (Jeffery,
1984; Bonneau et al.. 1985) indicates that the attachment
site might also exist in an internal region contained within
the 5' and 3* ends of the mRNA. Isaacs and Fulton (1987)
have presented evidence suggesting that myosin heavy chain
in embryonic chicken muscle cells is co-translationally
assembled into the cytoskeleton. The myosin nascent
polypeptide would therefore serve as an additional
cytoskeleton attachment site for the polysomal myosin mRNA.
Based on these results it appears that several mechanisms
may operate in the attachment of a specific polysomal mRNA
or mRNP to the cytoskeleton and these attachment sites may
vary depending on the species of mRNA.
The component of the cytoskeleton to which the mRNA is
attached is not known although the data accumulated to date
suggest that the microfilaments may be involved in the mRNA-
cytoskeleton association. Removal of tubulin from the
cytoskeleton by using cold calcium-containing buffers during
the isolation procedure has no effect on the attachment of
mRNA with the cytoskeleton; this result suggests that the
microtubules do not play a role in the association of mRNA
with the cytoskeleton (Lenk et al.. 1977; Howe and Hershey,
1984; Ornelles et al.. 1986). Disruption of vimentin


CHAPTER 7
THE INFLUENCE OF THE CYTOSKELETON ON THE REGULATION
OF c-Fos GENE EXPRESSION
Introduction
Modifications in gene expression is central to
proliferation and differentiaton of eukaryotic cells. These
processes are tightly regulated and dependent in part on the
precise expression of proto-oncogenes (for review see
Ohlsson and Pfeifer-Ohlsson, 1987? Bishop, 1983). The
proliferative response of quiescent fibroblasts to serum or
growth factor stimulation is accompanied by a rapid and
transient induction of the c-fos proto-oncogene (Cochran et
al., 1984; Greenberg et al.. 1984; Curran et al., 1985).
Within minutes of the addition of serum or growth factors to
quiescent fibroblasts the c-fos gene is transcribed and c-
fos cytoplasmic mRNA levels rapidly increase. Generally, the
expression of the c-fos gene during serum/growth factor
induction is maximal after 30 minutes and returns to pre
stimulatory levels within 1-2 hours. While the exact
function of the c-fos protein is unknown, recent evidence
suggests that this nuclear protein is part of a DNA binding
168


117
1). These results indicate that the mutation of the ATG
translation start codon of the signal peptide results in the
synthesis of a signal peptide-histone fusion mRNA
(SPH3E1ATG) that is associated with nonmembrane-bound
polysomes. In addition, the incorporation of two histidine
amino cid residues in the hydrophobic domain of the signal
peptide partially blocks the translocation of the mRNA from
nonmembrane-bound polysomes to membrane-bound polysomes.
To study the stability of the mutated signal peptide-
histone fusion mRNAs during inhibition of DNA synthesis, the
genes (SPH3E1, SPH3Elalpha# and SPH3E1ATG) were transfected
into HeLa cell monolayers by the calcium phosphate
precipitation method as described in Chapter 2. Forty-six
hours posttransfection, the cells were treated with 1 mM
hydroxyurea and samples were taken at 20 minute time
intervals. Total cellular RNA was isolated and assayed for
signal peptide-histone fusion mRNA and endogenous H3 histone
mRNA content by SI nuclease protection analysis as described
in Chapter 2. As seen in Figure 4-7 and summarized in Figure
4-10, inhibition of DNA synthesis for one hour resulted in
the destabilization of only 46% of SPH3E1 mRNA as compared
to the control cell culture (lanes 1,2 and 7,8). In sharp
contrast, SPH3E1ATG" mRNA was destabilized by 94%, which is
to the same extent as measured for endogenous H3 histone
mRNA (Figure 4-8 lanes 1,2 and 7,8? Fig. 4-10). Inhibition
of DNA synthesis for one hour with 1 mM hydroxyurea


179
cultures with culture medium containing 10% fetal calf serum
resulted in an increase in c-fos mRNA levels for 60 minutes
followed by a sharp reduction to backround levels by 120
minutes. Cytochalasin D affected c-fos gene expression with
the same kinetics as serum; however, slightly higher levels
of c-fos mRNA were measured in CD treated cells. Puromycin
treatment or CD and puromycin cotreatment caused a
continuous rise in c-fos mRNA levels for two hours, which
was the last time point examined. These results indicate
that the effects of cytochalasin D on either exponentially
growing HeLa cells or quiescent diploid fibroblasts more
closely resemble the effects of serum and growth factor
stimulation than the inhibition of protein synthesis on the
expression of c-fos mRNA levels.
Cytochalasin D Stimulates the Transcription of the c-Fos
Gene
To assess the contribution of transcription to the
increase in c-fos mRNA levels during CD treatment, we
measured the transcriptional activity of the c-fos gene by
in vitro nuclear run-on transcription analysis as described
in Chapter 2. Treatment of HeLa cells with cytochalasin D
for 15 minutes resulted in a significant increase in
transcription of the c-fos gene. The data presented in Fig.
7-4 represent a twelve fold increase in c-fos transcription
in cytochalasin D treated cells compared to untreated,


16
specific alpha-actin with respect to molecular weight
(42,000 Daltons), amino acid sequence and polymeric
structure (Tilney and Detmers, 1975; Hartwig and Stossel,
1975; Kane, 1975; Garrels and Gibson, 1976; Whalen et al.
1976; Rubenstein and Spudich, 1977). These results suggest
that beta- and gamma-actin protein in non-muscle cells may
play a role in contraction processes such as cell motility ,
chromosome movement and exocytosis (Berl et al.. 1973;
Huxley, 1973; Sanger, 1975).
Cvtoskeletal-mRNA Interactions
Early studies using stereo-electron microscopic
analysis of whole cells indicated that polysomes are
associated with the cytoskeleton structure (Wolosewick and
Porter, 1977) Closer examination of the cell interior, by
removing membranes and soluble cytoplasmic proteins with
detergent, reveals that many of the ultrastructural features
and nearly all the polysomes are retained on the
cytoskeletal framework (Lenk et al.. 1977). Furthermore, the
non-random topological distribution of the polysomes is
preserved in the cytoskeleton preparation (Fulton et al..
1980). The association of the polysomes with the
cytoskeleton does not appear to be due to trapping since
monosomes and independent ribosomal subunits are efficiently
removed by the detergent extraction (Lenk et al.. 1977;
Cervera et al.. 1981; Ornelles et al.. 1986). These results


12
The Cvtoskeleton: Microtubules. Intermediate Filaments
and Microfilaments
The cytoskeleton structure is an interconnected system
of three major classes of protein fibers, namely the
microtubules, intermediate filaments and microfilaments.
Each system represents a heterogenous population of
proteins. The microtubules, for example, are composed of 13
protofilaments of the well characterized alpha and beta
tubulin proteins (Amos and Klug, 1974). These filaments are
25 nm in diameter and appear to contain a hollow core.
Several microtubule associated proteins (MAPs) have also
been identified which appear to facilitate the assembly of
the microtubules and promote their interactions with other
cellular organelles (Sloboda et al.. 1976, Bulinski and
Borisy, 1980; Bloom et al.. 1984; Binder et al.. 1985). It
has long been recognized that in mitotic cells the
microtubules reorganize into the mitotic spindle including
the astral, kinetochore and continuous fibers which mediate
the segregation of the chromosomes (Weber et al.. 1975).
During interphase the role of the microtubules is less clear
and somewhat controversial. Studies on agents that cause the
depolymerization of the microtubules, such as colchicine and
colcemid, suggest that the microtubules play a role in cell
shape and the intracellular transport of macromolecules and
organelles (Hayden and Allen, 1984; Vale et al.. 1985).


106
LU
LU CO
CC 5
LL
1634
512
344
220
FUSION mRNA


213
Moon, R. Nicosia, R. Olsen, C. Hille, M. and Jeffery, W.
(1983) Dev. Biol. 95, 447.
Morris, T., Marashi, F., Weber, L., Hickey, E., Greenspan,
D., Bonner, J., Stein, J., and Stein, G. (1986) Proc. Natl.
Acad. Sci. U.S.A. 83, 981.
Muller, M., and Blobel, G. (1984) Proc. Natl. Acad. Sci.
U.S.A. 81, 7421.
Muller, R., Bravo, R., Burckhardt, J., and Curran, T. (1984)
Nature 312, 716.
Ng, S. (1989) J. Cell Biol. 107, 79a.
Nielsen, P., Goelz, S., and Trachsel, H. (1983) Cell Biol.
Int. Rep. 7, 245.
O'Farrell, P. (1975) J. Biol. Chem. 250, 4007.
Ohlsson, R., and Pfeifer-Ohlsson, S. (1987) Exp. Cell Res.
173. 1.
Ornelles, D., Fey, E., and Penman, S. (1986) Mol. Cell.
Biol. 6, 1650.
Osborn, M. (1983) J. Invest. Dermatol. 81, 104s.
Pandey, N. and Marzluff, W. (1987) Mol. Cell. Biol. 1_>
4557.
Pederson, T. and Robbins, E. (1970) J. Cell Biol. 4_5, 509.
Peltz, S., and Ross, J. (1987) Mol. Cell. Biol. 7, 4345.
Penman, S., Capeo, D., Fey, E., Chatterjee, P., Reiter, T.,
Ermisch, S., and Wan, K. (1983) in The modern cell biology
series: Spatial organization of eukaryotic cells. McIntosh,
J.R., Ed. (Alan R. Liss, New York) pp 385-415.
Perry, R., and Kelley, D. (1973) J. Mol. biol. 79, 681.
Plumb, M., Stein, J., and Stein, G. (1983) Nucl. Acids Res.
11. 2391.
Prescott, D. (1966) J. Cell Biol. 31, 1.
Rahmsdorf, H., Schonthal, A., Angel, P., Litfin, M., Ruther,
U., and Herrlich, P. (1987) Nucl. Acids Res. 15, 1643.
Randall, L., and Hardy, S. (1989) Science 243. 1156.


71
(32.5 cm x 44 cm) with a 60 well shark toothed comb. The gel
was run at 75 W constant, -2500 V, -40 mA for 3-5 hours
(Xylene Cyanol dye was 15 cm from the bottom of gel). The
gel was soaked in 10% acetic acid-12% methanol in the fume
hood for 1 hour, placed onto 2 sheets of 3 MM Whatman paper,
and dried under vacuum at 80C for 45 minutes. The gel was
exposed to preflashed XAR5 x-ray film at room temperature
for 12-18 hours.
Transfection of DNA into Cells
Introduction of Plasmid DNA into Bacterial Cells
An E_. coli overnight cell culture was diluted 1:100
into 100 ml LB medium and incubated at 37C until the
optical density was approximately 0.37 at 590 nm. The cells
were chilled at 0C for 10 minutes and then centrifuged at
5,000 rpm, 4C for 5 minutes in a Beckman JA20 rotor. The
pellet was resuspended in 20 ml of cold CaCl2 buffer (60 mM
CaCl2, 10 mM Pipes pH 7.0, 15% glycerol) and incubated at
0C for 30 minutes. The cells were collected by
centrifugation at 2,500 rpm for 5 minutes at 4C in a JA20
rotor, resuspended in 2.6 ml CaCl2 buffer and divided into
100-200 ul aliquots. The competent cells were either used
immediately for transformation or stored in microcentrifuge
tubes at -80C.
For transformation, 100 ul competent E^. coli cells were
mixed with 10 ul plasmid DNA (-10 ng) and incubated at 0C
for 10 minutes. The cells were then heat shocked at 37C for


3
are not polyadenylated (Adensik and Darnell, 1972). However,
the genes coding for histone proteins that are synthesized
in the absence of DNA synthesis (cell cycle independent
histones) generally contain introns and code for mRNAs that
are poly-adenylated (Engel et al.. 1982; Harvey et al..
1983; rush et al.. 1985; Wells and Kedes, 1985). Subsequent
discussions will generalize what is true only for the cell
cycle dependent histones unless otherwise indicated.
Histone Gene Regulation: Transcriptional and Post-
Transcriptional Control
The stringent requirement to package newly replicated
DNA into chromatin, the invariable 1:1 molar ratio of
histone protein to DNA and the inability of most eukaryotic
cells to store unbound histone proteins implies a temporal
and functional coupling of histone protein synthesis with
DNA replication (Prescott, 1966; Allfrey et al.. 1963).
Support for this hypothesis first came from studies on
synchronized cell cultures of Euplotes eurvstomus in which
the synthesis of histone protein was found to occur only
during the S phase of the cell cycle, the time when DNA
replication takes place (Prescott, 1966). Furthermore, the
quantity of histone protein within the cell doubled during S
phase. The temporal coupling of histone protein synthesis
with DNA synthesis has since been confirmed and well
documented by a variety of direct experimental approaches


79
removed by aspiration and occasionally material is removed
from within the sucrose pad. This material may be the source
of histone mRNA in the LER fraction, which could decrease
the true percentage of total histone message found on the
nonmembrane-bound polysomes. The HLA-B7 mRNA was located
almost "exclusively on membrane-bound polysomes. Nearly 90%
of the HLA-B7 mRNA was collectively found on the NRER and
MRER, while less than 11% was measured in the LER and
nonmembrane-bound polysomal RNA fractions.
Histone mRNA and HLA-B7 mRNA Distribution Between Csk and
Sol Fractions
Existing within the cytoplasm of eukaryotic cells is an
intricate network of protein filaments, which is referred to
as the cytoskeleton. This structure can be prepared from
HeLa cells treated with non-ionic detergent as described by
Penman and coworkers (Cervera et al.. 1981). We used this
procedure for the isolation of the cytoskeleton (Csk) and
soluble (Sol) fractions which were subsequently assayed for
mRNA content by Northern blot analysis.
Log phase, suspension grown HeLa S3 cells were
fractionated into a Csk phase and Sol phase as described in
Chapter 2. Although this fractionation procedure has been
characterized previously (Lenk and Penman, 1979), we
examined the protein heterogeneity of each fraction by two-
dimensional gel electrophoresis and immunoblotting
techniques in collaboration with Dr. Warren Schmidt. As seen


FREE
NRER
MRER
LER
FREE
NRER
MRER
LER
CONTROL CYCLO
FREE
N RER
M RER
LER
FREE
N RER
MRER
LER
i co r
>
09
*1
00
LO


15
composed of three large polypeptides with molecular weights
of 200,000, 150,000, and 68,000 Daltons (Hoffman and Lasek,
1975; Delacourte et al.. 1980). Glial filaments are
specifically found in astrocytes and other types of glial
cells and consist of a single protein, the glial fibrillary
acidic" protein (GFA), with a molecular weight of 51,000
Daltons (Schachner et al.. 1977; Goldman et al.. 1978).
Although the intermediate filament proteins from the
different cell types are heterogeneous in their chemical
composition, they assemble into similar morphological
structures consisting of filaments that are 10 nm in
diameter that are highly resistant to extraction with
detergents. It has been proposed that the intermediate
filaments contain a constant and variable region, analogous
to the structure of antibodies. The constant domain would
conserve the morphology whereas the variable domain would
confer functional specificity (Lazarides, 1980).
The microfilaments are the thinnest of the cytoskeletal
filament systems, with an average diameter of 6 nm, and are
composed primarily of actin protein. It has been estimated
that approximately 5-10% of total cellular protein is actin
which exists in an equilibrium between monomeric and
filamentous forms (Hartwig and Stossel, 1975).
Microfilaments from non-muscle cells contain two predominant
species of actin protein, namely beta- and gamma-actin. The
non-muscle actin proteins are quite similar to muscle


Figure 4-8. Effects of hydroxyurea treatment on SPH3E1ATG
mRNA.
HeLa cell monolayers were transfected with pSPH3ElATG
DNA and 46 hours post-transfection were treated with 1 mM
hydroxyurea (HU). Cells were harvested at 20 minute
intervals and total cellular RNA was prepared. The RNA (10
/g) was subjected to SI nuclease protection analysis to
quantitate the levels of SPH3E1ATG" mRNA and endogenous H3
histone mRNA. Each lane represents an individually
transfected cell culture. MW is radiolabeled Hpa II digest
of pBR322 DNA. Lanes 1 and 2, control? lanes 3 and 4, 1 mM
HU 20 minutes; lanes 5 and 6, 1 mM HU 40 minutes; lanes 7
and 8, 1 mM HU 60 minutes.


43
disrupted with 15 strokes in a tight fitting Dounce
homogenizer. The homogenate was then centrifuged at 2,000 x
g for 5 minutes. The supernatant (supernatant A) was removed
and maintained in an ice bath while the nuclear pellet
(pellet A) was resuspended in 9 ml TMN (20 mM Tris-HCl pH
7.5, 5 mM MgCl2, 25 mM NaCl, 3 mM dithiothreitol) The
nuclear suspension (pellet A) was adjusted to 1% Triton X-
100 and 1% NaDOC, vortexed briefly and centrifuged at 500 x
g for 10 minutes. The supernatant (supernatant C) from this
centrifugation step was removed and saved on ice for the
isolation of nucleus-associated rough endoplasmic reticulum
(NRER) polysomes. The supernatant from the centrifugation
step following homogenization (supernatant A) was
centrifuged at 12,000 rpm, 4C for 10 minutes in a Beckman
JA20 rotor. The resulting supernatant (supernatant B) was
removed onto ice for subsequent isolation of light
endoplasmic reticulum (LER)-associated polysomal RNA and
nonmembrane-bound polysomal RNA. The pellet (pellet B) was
resuspended in 9 ml TMN, adjusted to 1% Triton X-100 and 1%
NaDOC and centrifuged at 10,000 rpm, 4C for 10 minutes in a
JA20 rotor. The supernatant (supernatant D) was removed and
stored on ice for the isolation of mitochondria-associated
rough endoplasmic reticulum (MRER) polysomal RNA.
Exponentially growing HeLa cells (2.5 x 108 cells) were
collected by centrifugation for the isolation of total
polysomal RNA. The cell pellet was washed in PBS and


Figure 4-3. The subcellular localization of the signal
peptide-histone fusion mRNA.
HeLa cell monolayers were transfected with pSPH3El and
cultured as described in Chapter 2. Forty-six hours after
transfection, cell cultures were harvested and nonmembrane-
bound and membrane-bound polysomes were isolated. The RNAs
from these fractions were analyzed by the SI nuclease
protection assay (5 /g RNA per sample). The distribution of
mRNA species within the subcellular fractions was
quantitated by scanning laser densitometric analysis of the
autoradiograms. Lanes: 1) pBR322 Hinfl molecular weight
marker; 2) nonmembrane-bound polysoma1 RNA; and 3) membrane-
bound polysomal RNA.


20
for the polymerase, nucleocapsid and matrix proteins are all
attached to the cytoskeleton during translation (Cervera et
al. 1981). The association of free polysomes with the
cytoskeleton has also been demonstrated by electron
microscopy (Wolosewick and Porter, 1979). Free polysomes are
generally the class of polysomes involved in the synthesis
of intracellular proteins whereas membrane-bound polysomes
are generally involved in the synthesis of exported proteins
that are destined for the cell surface or secretion (for
review see Emr et al.. 1980). The association of free
polysomal mRNAs with the cytoskeleton suggests that the
polysome is anchored to a scaffold, albeit a dynamic
structure, and not freely diffusible within the cytoplasm.
The term "free polysome" is operationally defined and is a
misnomer when viewed in light of the biochemical and
microscopic studies on the cytoskeleton. The proper
reference to free polysomes is nonmembrane-bound polysomes.
The mechanism by which mRNAs assemble into membrane-
bound polysomes has been described in the signal hypothesis
(Blobel and Dobberstein, 1975). Many types of signal
peptides exist that target proteins to various subcellular
membrane compartments such as the endoplasmic reticulum,
mitochondria and chloroplasts in eukaryotes as well as the
cell membrane in prokaryotes (Date et al.. 1980; Schatz and
Butow, 1983; Muller and Blobel, 1984; Cline, 1986). The work
presented here is focused on events that occur at the


7
affinity binding sites for the newly synthesized histone
proteins. Unbound histone protein may then interact with
histone mRNA-containing polysomes resulting in a
conformational change in the mRNA that is more accessible to
ribonuclease. Growing support for this model comes from a
cell-free mRNA decay system in which the destabilization of
histone mRNA is accelerated when incubated in the presence
of histone proteins (Peltz and Ross, 1987) This result
appears to be specific for histone mRNA since the rates of
decay for gamma globin mRNA, c-myc mRNA, total poly(A)' RNA
or total poly(A)+ RNA are unaffected by the presence of
histone proteins.
Gene transfer studies demonstrated that the minimal
seguence necessary for coupling histone mRNA stability with
DNA replication lies within the 3' terminus of the mRNA
(Stauber et al.. 1986; Levine et al.. 1987; Pandey and
Marzluff, 1987). Removal of only 60 nucleotides from the 3'
end of a murine H3 histone mRNA releases the mutant mRNA
from destabilization during inhibition of DNA synthesis
(Levine et al.. 1987). Conversely, the last 30 nucleotides
of histone H3 mRNA when fused to the 3' end of human gamma
globin mRNA are sufficient to confer instability to the
chimeric mRNA when DNA synthesis is inhibited, whereas wild
type gamma globin mRNA remains stable (Pandey and Marzluff,
1987). Contained within the minimal target sequence for
destabilization is a stem-loop structure which is common to


197
perspective that cytostructure can form subcellular
compartments that are independent of membrane envelopes
(Fulton et al.. 1980; Cervera et al., 1981). Furthermore,
Singer and co-workers, using in situ hybridization
techniques, were demonstrating the localization of specific
mRNAs in discrete areas of the cytoplasm (Lawrence and
Singer, 1986).
Based on these observations and the information
available concerning histone gene expression, we proposed
that histone mRNAs and the factors that are involved in
their selective destabilization during inhibition of DNA
synthesis are co-compartmentalized in a perinuclear region.
This model predicted that the subcellular location of
histone mRNA plays a role in the coupling of histone mRNA
stability with DNA replication.
To address this question, we first determined the
normal subcellular location of histone mRNA. Subcellular
fractionation and Northern blot analysis demonstrated that
histone mRNAs are naturally located on nonmembrane-bound
polysomes that are associated with the cytoskeleton (Chapter
3). The subcellular localization of histone mRNA was then
altered by incorporating nucleotide sequences coding for a
signal peptide into an H3 histone mRNA (Chapter 4). The
modified histone gene, when transfected into HeLa cells,
expressed a signal peptide-histone fusion mRNA which was
directed to membrane-bound polysomes. The histone fusion


95
As with the protocol utilized to separate nonmembrane-
bound and membrane-bound polysomes, the cytoskeleton
preparation obtained must be operationally defined. While
this does not necessarily detract from the biological
relevance, differences in cytoskeleton preparations are
undoub£edly reflected in the biochemical composition of the
isolated complex. Additional characterization of the
cytoskeleton preparation with respect to possible variations
in regions of the complex may provide insight into
mechanisms by which specific mRNAs may be localized and
their functional properties selectively modulated.


155
Monoclonal HeLa cell lines expressing the chimeric gene
were fractionated into cytoskeleton and soluble phases as
described by Cervera et al. (1981). Subsequently, RNA from
each fraction was isolated and SPH3E1 chimeric mRNA and
endogenous H3 histone mRNA content was determined by SI
nuclease protection analysis (Chapter 2). As seen in Figure
6-1 and Table 6-1, both endogenous histone and SPH3E1 mRNAs
are predominantly associated with the cytoskeleton in
control cells (92% and 93%, respectively). Cytochalasin D
treatment [10 /g/ml] brought about a limited release of
SPH3E1 mRNA from the cytoskeleton as expected for a
membrane-bound polysomal mRNA. Only 15% of SPH3E1 mRNA
compared to 40% of endogenous histone mRNA was dissociated
from the cytoskeleton in CD treated cells. As described
above, dissociation of the ribosomes by puromycin during
cytochalasin D treatment is necessary for the efficient
release of membrane-bound polysomal mRNAs from the
cytoskeleton. Surprisingly, CD and puromycin cotreatment
also failed to release the SPH3E1 mRNA from the
cytoskeleton. Greater than 70% of the signal peptide-histone
chimeric mRNA and less than 26% of endogenous H3 histone
mRNA remained associated with the cytoskeleton after CD and
puromycin cotreatment. The selective retention of the
chimeric mRNA on the cytoskeleton during CD and puromycin
cotreatment is demonstrated by the marked increase in the
intensity of the signal obtained for the same quantity of


127
crude yeast extract (Roggenkamp et al.. 1981). In addition,
it has been reported by Weidraann et al. (1984) that
E. coli plasmid pBR322 beta-lactamase mRNA that is
synthesized and capped in vitro. when microinjected into
Xenopus oocytes, is translated into protein that is
ultimately secreted from the cell. These results suggest a
common mechanism of signal peptide recognition among
prokaryotic and eukaryotic organisms.
In an attempt to prevent the translocation of the
signal peptide-histone fusion mRNA to membrane-bound
polysomes, we initially disrupted the hydrophobic region of
the signal peptide by site directed mutagenesis. This
approach was based on previous studies demonstrating that
bacterial secretory proteins that were mutated in the
hydrophobic domain, either by insertion of charged amino
acids or by deletion, accumulate in the cytoplasm of the
bacterium (Emr et al.. 1978? Bedouelle et al.. 1980; Emr and
Bassford, Jr., 1982). The incorporation of positively
charged histidine residues in the hydrophobic domain of the
signal peptide (SPH3Elalpha) however, resulted in only a
partial block in the association of mutated signal peptide-
histone fusion mRNA with membrane-bound polysomes (Figure 4-
6). This result is not surprising in light of more recent
studies on protein export in eukaryotes, which demonstrate
that the relationship between the primary seguence of the
signal peptide and its ability to function as a secretory


34


Figure 5-1. Northern blot analysis of the cvtoskeleton and
soluble phase distribution of H3 histone. H4 histone and
HLA-B7 mRNAs in cvtochalasin D treated cells.
HeLa cells were treated with the indicated
concentration of cytochalasin D for 20 minutes and
cytoskeleton and soluble phase RNAs were isolated. Equal
quantities of RNA per sample (10 /xg/lane) were analyzed by
Northern blot analysis as described in Chapter 2. Lanes: 1)
Control/csk? 2) Control/sol? 3) CD [5 /g/ml]/csk? 4) CD [5
Mg/ml]/sol; 5) CD [10 nq/ml)/csK; 6) CD [10 Mg/ml]/sol; 7)
CD [40 4g/ml]/csk; 8) CD [40 Mg/ml]/sol.


25
replication. These results indicated that the subcellular
location plays a role in the posttranscriptional control of
histone gene regulation.
During the course of studying histone mRNA subcellular
localization it was necessary to examine histone mRNA-
cytoskeletal interactions in detail. Previously, Ornelles et
al (1986) reported that total poly-A+ mRNA, as a
heterogenous population, is released from the cytoskeleton
in HeLa cells by cytochalasin D treatment. We demonstrated
by Northern blot analysis that cytochalasin D treatment of
HeLa cells readily releases histone mRNA, which is not poly-
adenylated, from the cytoskeleton into the soluble phase.
Surprisingly, mRNA coding for the cell surface HLA-B7 class
I antigen remained associated with the cytoskeleton during
cytochalasin D treatment. Subsequent studies demonstrated
that HLA-B7 mRNA expresses at least two distinct
cytoskeletal attachment sites: a cytochalasin D sensitive
site and a puromycin sensitive site. The puromycin sensitive
site appears to be a feature of membrane-bound polysomal
mRNAs and is most likely the nascent polypeptide and/or
ribosome associated with the protein substructure of the
endoplasmic reticulum.
Cytochalasin D and puromycin cotreatment, conditions
that efficiently release HLA-B7 membrane-bound polysomal
mRNA and histone nonmembrane-bound polysomal mRNA from the
cytoskeleton into the soluble phase, did not dissociate the


217
Ullu, E., Murphy, S., and Melli, M. (1982) Cell 29, 195.
Vale, R., Schnapp, B., Reese, T., and Sheetz, M. (1985) Cell
40, 449.
van Venrooij, W., Sillekens, P., van Eekelen, A., and
Reinders, R. (1981) Exp. Cell Res. 135. 79.
Venkatesan, N., and Steele, W. (1972) Biochem. Biophys. Acta
287. 526.
Verma, I., and Sassone-Corsi, P. (1987) Cell 51, 513.
Walter, P., and Blobel, G. (1980) Proc. Natl. Acad. Sci.
U.S.A. 77, 7112.
Walter, P., and Blobel, G. (1981) J. Cell Biol. 91, 557.
Walter, P., and Blobel, G. (1982) Nature 299, 691.
Walter, P., and Blobel, G. (1983) Cell 14, 525.
Walter, P. Gilmore, R., and Blobel, G. (1984) Cell 38, 5.
Wang, Y-L. (1984) J. Cell Biol. 99, 1478.
Watson, M. (1984) Nucl. Acids Res. 12, 5145.
Weber, K. Bibring, T., and Osborn, M. (1975) Exp. Cell Res.
95, 111.
Welch, W., and Feramisco, J. (1985) Mol. Cell. Biol. 5,
1571.
Wells, D., and Kedes, L. (1985) Proc. Natl. Acad. Sci.
U.S.A. 82, 2834.
Whalen, R., Butler-Browne, G., and Gros, F. (1976) Proc.
Natl. Acad. Sci. U.S.A. 23, 2018.
Wiedman, M., Huth, A., and Rapoport, T. (1984) Nature 309,
637.
Wilson, M., and Melli, M. (1977) J. Mol. Biol. 110, 511.
Wolosewick, J., and Porter, K. (1977) Am. J. Anat. 149. 197.
Wolosewick, J., and Porter, K. (1979) J. Cell Biol. 82, 114.
Woodcock-Mitchell, J., Eichner, R., Nelson, W., and Sun, T-
T. (1982) J. Cell Biol. 95, 580.


6
HeLa cells is 45-60 minutes (Sittman et al. 1983? Plumb et
al.. 1983). Hydroxyurea, or any other compound or treatment
that inhibits DNA synthesis studied to date, results in a
rapid and selective destabilization of histone mRNA (half
life of 10-15 minutes) with little or no effect on histone
gene transcription (Sittman et al.. 1983; Plumb et al.,
1983; Baumbach et al.. 1987).
A long-standing observation concerning histone mRNA
turnover during inhibition of DNA synthesis is that the
mechanism is completely dependent on protein synthesis
(Butler and Mueller, 1973; Gallwitz, 1975; Stahl and
Gallwitz, 1977; Stimac et al.. 1983; Baumbach et al.. 1984?
Helms et al.. 1984). Pretreatment of cells with inhibitors
of protein synthesis such as high salt, cycloheximide or
puromycin followed by the addition of a DNA synthesis
inhibitor prevents the destabilization of histone mRNAs and
actually results in an increase in their steady state levels
due to the continued transcription of the histone genes.
This observation led Butler and Mueller and others to
hypothesize that the histone proteins can autoregulate their
own synthesis through a feedback loop operative at the
posttranscriptional level (Butler and Mueller, 1973; Stein
and Stein, 1984; Wu and Bonner, 1985). The model predicts
that at the natural end of S phase or when DNA synthesis is
interrupted with inhibitors a transient accumulation of
unbound histone protein may arise due to a loss in high-


CHAPTER 5
DIFFERENTIAL ASSOCIATION OF MEMBRANE-BOUND AND
NONMEMBRANE-BOUND POLYSOMES WITH CELL CYTOSTRUCTURE
Introduction
Localization of nearly all actively translated
polyribosomes on the cytoskeletal structure indicates that
polysomal mRNAs are not freely diffusible throughout the
cytoplasm (Lenk et al.. 1977; Cervera et al.. 1981; Ornelles
et al.. 1986). This observation is further supported by
subcellular fractionation studies that demonstrate the
association of both "free" (nonmembrane-bound) and membrane-
bound polysomal mRNAs with the cytoskeleton (Cervera et al,,
1981; Jeffery, 1984; Bonneau et al.. 1985).
Previous results indicate that the association of
polysomes with the cytoskeleton is mediated in part by the
mRNA, as treatments which dissociate the ribosomes from the
mRNA, such as heat shock and high salt, release the
ribosomal subunits into the soluble phase while the mRNA
remains attached to the cytoskeleton (Lenk et al.. 1977;
Cervera et al.. 1981; van Venrooij et al.. 1981; Howe and
Hershey, 1984). However, the region of the mRNA and the
cytoskeletal elements to which it is attached are not known.
130


200
mRNA, H3 and H4 histone mRNA together, or any combination of
groupings of the different classes of histone mRNAs. The
pattern for these groupings may be important in the
transport of the newly synthesized histone proteins into the
nucleus and/or the coordinate regulation of histone protein
synthesis.
Although unrelated to the problems addressed here, it
would be interesting from the standpoint of studying the
process of protein secretion to determine the subcellular
localization of the histone fusion protein. Examination of
subcellular fractions isolated from HeLa cells which are
expressing the signal peptide-histone fusion gene, by
standard biochemical techniques, such as acid extraction and
triton-urea gel electrophoresis, would provide insight into
how the fusion protein is processed and where the fusion
protein is located.
In studying the subcellular location of histone mRNA,
it was determined that histone mRNA is predominantly
associated with the cytoskeleton and that this association
is dependent on the integrity of the microfilaments
(Chapters 3 and 5). Cytochalasin D treatment, which disrupts
the actin filaments, releases histone mRNA from the
cytoskeleton into the soluble phase. This result is
consistent with the observation of Penman and co-workers
that heterogeneous poly-A+ RNA is released from the
cytoskeleton in cytochalasin D treated HeLa cells (Ornelles
et aL, 1986) .


163
SPHE1
1 2 3 4 5 6 7 8
SPH3E1ATG-
1 2 3 4 5 6 7 8
HLA-B7
hCG


7-3 Time course of c-fos mRNA accumulation during
cytochalasin D and puromycin treatments in
exponentially growing HeLa cells 181
7-4 Effect of cytochalasin D on transcription of c-fos
in HeLa cells 184
7-5 Effect of protein synthesis inhibition on
cytochalasin D induction of c-fos transcription in
HeLa cells 188
viii


56
mercaptoethanol). Cells were disrupted by homogenization (6-
12 strokes) with a Dounce homogenizer, Wheaton type A
pestle. After >90% of the cells had been lysed, nuclei were
pelleted by centrifugation at 2000 rpm for 10 minutes in an
IEC centrifuge at 4C and resuspended in nuclei storage
buffer "containing 40% glycerol (50 mM Tris-HCl pH 8.3, 5 mM
MgCl2, 0.1 mM EDTA). Nuclei were aliquoted and either snap
frozen in liquid nitrogen or used fresh in the in vitro
transcription reactions. Reactions typically contained 107
nuclei, 100 uCi alpha-32P-UTP (3000 Ci/mmole), l mM ATP,
0.25 mM GTP and CTP in a final volume of 130 ul and were
incubated for 30 minutes with intermittent shaking at 30C.
Radiolabeled RNAs were isolated by treatment of nuclei with
DNase I (100 /g/ml) in the presence of 0.6 M NaCl, 50 mM
Tris-HCl pH 7.5, 20 mM MgCl2 for 15 minutes at room
temperature. The mixture was then incubated with proteinase
K (200 jug/ml) for 3 0-60 minutes at 37C in the presence of
150 mM NaCl, 12.5 mM EDTA, 100 mM Tris-HCl pH 7.5 and 20 mM
MgCl2. Sodium acetate (pH 5.5) was added to 0.2 M and
nucleic acids extracted several times by the hot phenol
method (Clayton and Darnell, Jr., 1983; Sherrer and Darnell,
1962) To the aqueous solution of j2P-labeled RNAs, 150 /g
of yeast RNA and 2.5 volumes of 95% ethanol were added.
Precipitation was overnight at -203C. Radiolabeled
transcripts were resuspended in 10 mM Tris-HCl pH 8.0, 1 mM
EDTA and an aliquot of each sample was precipitated with 150


169
complex that may influence the transcription of specific
genes (Curran et al., 1984; Sytoyama et al., 1986; Distel et
al.. 1987; Rauscher et al., 1988).
Signal transduction models describing the induction of
c-fos gene expression due to the binding of growth factor(s)
at the plasma membrane must include a mechanism for relaying
the stimulatory signal from the cell surface, through the
cytoplasm and into the nucleus. Existing within the
cytoplasm of the cell is an extensive and intricate protein
scaffold referred to as the cytoskeleton (for review see
Nielsen et al.. 1983). In addition to its structural
properties the cytoskeleton also appears to function in cell
shape, cell motility, the intracellular transport of
macromolecules and translation of mRNA into protein.
Furthermore, the cytoskeleton may influence the regulation
of gene expression. Suspension of anchorage dependent mouse
3T6 fibroblasts induces a morphological change in cell shape
and the cytoskeleton with a concomitant reduction in DNA,
RNA and protein synthesis (Benecke et al.. 1978; Farmer et
al.. 1983). Reattachment of these cells to a solid support
restores cell shape and cytoskeleton structure as well as
DNA, RNA and protein synthesis. In addition, disruption of
the microfilaments of the cytoskeleton with cytochalasin D
in HEp-2 cells results in the enhanced expression of beta
and gamma actin protein synthesis (Tannenbaum and Godman,
1983). Removal of the drug restores the structure of the
cytoskeleton and returns actin synthesis to normal levels.


72
5 minutes, diluted with 0.9 ml prewarmed LB medium and
incubated at 37C for 1 hour. Different volumes of the
transfected bacterial cell culture (usually 10-200 ul) were
plated onto the appropriate medium dictated by the genotype
of the host and the introduced plasmid DNA.
Introduction of DNA into HeLa Cells
HeLa monolayer cell cultures were transfected with
plasmid DNA, according to Gorman et al. (1982), in a calcium
phosphate/DNA complex prepared as described by Graham and
van der Eb (1973). HeLa S3 cells growing exponentially in
suspension culture were plated into 20 ml completed EMEM
(EMEM supplemented with 5% fetal calf serum, 5% horse serum,
100 U penicillin, 100 [ig/m1 streptomycin and 1 mM glutamine)
c
at 3x10 cells per 10 cm tissue culture dish (Corning or
Falcon) and incubated overnight at 37C in 5% C02. The
monolayer cell culture was refed with 10 ml completed EMEM
and incubated at 37C in 5% C02 for 4 hours. The DNA/calcium
phosphate precipitate was prepared by adding 20 ¡q DNA in
500 ul 250 mM CaCl2 dropwise to 500 ul 2x Hebs buffer (50 mM
Hepes, 280 mM NaCl, 1.5 mM Na2HP04, pH 7.120.05) while
vortexing the solution. The DNA/CaCl2 precipitate was added
dropwise to the monolayer cell culture and incubation was
continued at 37C in 5% C02 for 4 hours. The HeLa cells were
glycerol shocked by replacing the medium with 2 ml completed
EMEM containing 15% glycerol for 1 minute. The transfected


Figure 5-3. Northern blot analysis of the cvtoskeleton and
soluble phase distribution of nonmembrane-bound and
membrane-bound polvsomal mRNAs in cvtochalasin D. puromvcin.
CD/puro and CD/cvcloheximide treated cells.
HeLa cells were cultured in the presence of the drugs
and fractionated into cytoskeleton and soluble phases as
described in Chapter 2. Equal volumes of cytoskeleton and
soluble phase RNA from each cell culture were assayed for H3
histone, H4 histone, HLA-B7 and chorionic gonadotropin mRNAs
by Northern blot analysis. Upper panel, probed for HLA-B7
and chorionic gonadotropin mRNA, and lower panel, probed for
H3 and"H4 histone mRNA. Upper and lower panels represent the
same Northern filter. Lanes: 1) Control/csk; 2) Control/sol?
3) CD/csk? 4) CD/sol; 5) Puro/csk? 6) Puro/sol? 7)
CD/puro/csk? 8) CD/puro/sol; 9) CD/cyclo/csk; 10)
CD/cyclo/sol.


94
The association of histone mRNAs with the cytoskeleton
(Figure 3-1) is consistent with studies carried out by
Penman and co-workers in which they examined the subcellular
localization of vesicular stomatitis virus (VSV) mRNAs in
HeLa cells following viral infection (Cervera et al.. 1981).
These investigators observed that in VSV-infected HeLa cells
both the viral mRNA coding for the G viral glycoprotein and
the nonmembrane-bound polysomal viral mRNAs were associated
with the cytoskeleton. While the specific nature of the
association of polysomes with the cytoskeleton remains to be
definitively established, the ability to release ribosomes
and retain mRNAs on the cytoskeleton suggests that there may
be a direct attachment of mRNAs to the cytoskeleton (Lenk et
al.. 1977; Lenk and Penman, 1979? Lemieux and Beaud, 1982).
It is therefore reasonable to speculate that the association
of mRNAs with the cytoskeleton plays a functional role in
protein synthesis and/or in the regulation of mRNA
stability. This is a particularly attractive possibility
because the association of histone mRNAs with the
cytoskeleton could permit the compartmentalization of
histone mRNA-containing polysomes in a particular region of
the cytoplasm. The potential for compartmentalization
afforded by the cytoskeleton may also be related to the
rapid and selective destabilization of histone mRNAs at the
natural end of S phase or following inhibition of DNA
synthesis.


51
were placed on areas of the sponge that were not covered by
the gel so as to direct the flow of 2Ox SSC only through the
gel. The filter was directly layered onto the gel and any
air bubbles that were trapped between the gel and filter
were carefully removed. The transfer set-up was completed by
placing two sheets of 3 MM paper followed by 2-3 boxes of
facial tissues (Kleenex brand) on top of the hybridization
filter. The buffer chamber was filled with 20x SSC and
transfer was carried out for 36 hours (note: complete
transfer is usually achieved within 14 hours). After
transfer, the filters were rinsed in 2x SSC for 10 minutes
to remove particles of agarose, air dried and baked in vacuo
at 80C for 2 hours. The filters were stored in sealed
hybridization bags at 4C.
Hybridization of Filters-Immobilized RNA (Northern Blot)
Filters (nylon or nitrocellulose) were prehybridized
for 3-4 hours in 0.5 ml hybridization buffer per cm2 filter
area at 43C for the detection of chorionic gonadotropin
alpha, HLA-B7 and c-fos mRNA and at 48C for histone mRNA.
Hybridization buffer consisted of 50% formamide, 5x SSC, lOx
Denhardt's (lOOx Denhardt's: 2% (w/v) ficoll 400, 2% (w/v)
polyvinylpyrrolidone), 1% SDS, 50 mM sodium phosphate pH
7.0, 20 /xg/ml BSA, and 250 /g/ml E^_ coli DNA. The filters
were hybridized at the appropriate temperature for 36 hours
in 0.1 ml hybridization buffer per cm2 filter containing


182
control cells. In contrast, puromycin treatment for 15
minutes did not significantly affect the transcription of
the c-fos gene. Cotreatment of HeLa cells with puromycin and
cytochalasin D for 15 minutes also stimulated c-fos gene
transcription, which indicates that inhibition of protein
synthesis during CD treatment does not affect the induction
of c-fos transcription.
Tannenbaum and co-workers have demonstrated an increase
in actin transcription during CD treatment (1983). In light
of this observation, we measured the transcription of the
beta-actin gene in our studies as a positive control.
Consistent with previous findings, CD increased actin
transcription, but only 5 fold over control cells (Fig. 7-
4). Cotreatment with CD and puromycin for 15 minutes also
increased transcription of the actin gene 5 fold compared to
controls and presumably reflects the effects of the
cytochalasin D (Fig. 7-4). The cytochalasin D stimulation of
c-fos and beta-actin transcription is unaffected by
inhibition of protein synthesis.
The elevation in c-fos and actin transcription during
cytochalasin D treatment may be part of a general phenomenon
in which the transcriptional activity of all genes becomes
increased. Alternatively, transcription of ribosomal RNA
genes by RNA polymerase I, which represents approximately
50% of the transcriptional activity measured by nuclear run-
on assays (Marzluff and Huang, 1985), may be inhibited by


CHAPTER 6
HETEROGENEOUS PATTERN FOR CYTOSKELETAL-mRNA INTERACTIONS
Introduction
In the preceding chapter we presented evidence
indicating that eukaryotic mRNAs are associated with the
cytoskeleton in a heterogeneous manner. Disruption of the
microfilaments by cytochalasin D treatment readily releases
nonmembrane-bound polysomes from the cytoskeleton into the
soluble phase, whereas membrane-bound polysomes remain
attached to the cytoskeleton. The cytoskeletal association
of membrane-bound polysomal mRNAs occurs through at least
two distinct sites: a cytochalasin D sensitive site and a
puromycin sensitive site, which is the interaction of the
nascent polypeptide/polysome with the protein substructure
of the endoplasmic reticulum (Chapter 5). To release
membrane-bound polysomes from the cytoskeleton, both
attachment sites must be disrupted as seen during
cytochalasin D and puromycin cotreatment. Previously, we
have demonstrated that a signal peptide-histone fusion mRNA
(SPH3E1) is targeted from nonmembrane-bound polysomes, the
natural site of histone protein synthesis, to membrane-bound
polysomes (Chapter 4). Relocating the histone mRNA within
153


129
These results indicate that the stability of SPH3E1
mRNA during inhibition of DNA replication is functionally
related to the change in the subcellular location of the
mRNA. The differential stability of SPH3E1 mRNA and
SPH3E1ATG* mRNA may be due to qualitative differences in the
composition of membrane-bound and nonmembrane-bound
polysomes; however, there is no previously reported evidence
to support this possibility. Alternatively, the presence of
the fusion mRNA on membrane-bound polysomes rather than
nonmembrane-bound polysomes, where histone mRNA normally
resides, may physically separate the message from the
factors that are involved in the selective destabilization
of histone mRNA during inhibition of DNA synthesis. These
results are consistent with the hypothesis that the
subcellular location of histone mRNA plays an important role
in the posttranscriptional regulation of histone gene
expression.


126
resulted in the destabilization of approximately 70% of
SPH3Elalpha mRNA, a value which is intermediate to that
observed for SPH3E1 mRNA and SPH3E1ATG mRNA (Figure 4-9
lanes 1,2 and 7,8; Fig. 4-10). The degree to which the
signal peptide-histone fusion mRNAs are degraded during
inhibition of DNA synthesis is correlated with the extent to
which the mRNA is associated with nonmembrane-bound
polysomes. These results suggest that the subcellular
localization of the histone mRNA plays a significant role in
the coupling of its stability to DNA replication.
Discussion
To our knowledge, this represents the first
demonstration that the addition of a signal peptide coding
sequence to an mRNA that is normally translated on
nonmembrane-bound polysomes results in the targeting of the
chimeric message to membrane-bound polysomes in intact
mammalian cells. The recognition of a prokaryotic signal
peptide in a eukaryotic cell is supported by both in vitro
and in vivo studies (Lingappa et al.. 1984; Talmadge et al.,
1980a; Talmadge et al., 1980b). Saccharomyces cerevisiae has
been shown to express the Eh_ coli pBR325 beta-lactamase gene
in vivo and to process the precursor protein to the
enzymatically active, mature protein (Roggenkamp et ah,
1981). The processing of the bacterial pre-protein into the
mature species has also been demonstrated in vitro using a


57
Mg yeast RNA and cold 10% TCA. TCA-precipitable counts were
determined by liquid scintillation spectrometry.
DNA excess hybridization has also been described by
Baumbach et al. (1987) In a preliminary experiment we
determined that 2 fig of H4 histone insert in pF0002 was at
least two-fold DNA excess when hybridized to in vitro
nuclear run-on transcripts. Southern blots containing
restriction endonuclease digested DNA fragments or slot
blots containing linearized plasmid DNAs were prepared.
Southern blots on nitrocellulose or slot blots on Nylon were
prehybridized in 1 M NaCl, 20 mM Tris-HCl pH 7.4, 2 mM EDTA,
0.1% SDS, 5x Denhardt's, 250 mg/ml E_¡_ coli DNA and 12.5 mM
sodium pyrophosphate at 65C for at least 6 hours.
Hybridizations were conducted at 65C for 72 hours in 1 M
NaCl, 20 mM Tris-HCl pH 7.4, 2 mM EDTA, 0.1% SDS, 2.5x
Denhardt's, 250 g/ml E^_ coli DNA with i2P-labeled
transcripts at 5xl05-lX10D TCA-precipitable counts per ml of
hybridization solution. Blots were washed at 65C for 15
minutes in fresh prehybridization solution [0.13-0.14
ml/cm2], 1 hour in 2x SSC/0.1% SDS [0.5 ml/cm2], overnight
in 2x SSC/0.1% SDS [0.5 ml/cm2] and 1 hour in 0.2x SSC/0.1%
SDS [0.5 ml/cm2] Air dried filters were autoradiographed
with XAR-5 or Cronex film and Cronex lightning Plus screens
at -70C for varying periods of time and developed with an
X-O-MAT X-ray film processor.


173
To address the possibility that the stimulation of c-fos
mRNA levels was due to the partial inhibition of protein
synthesis, we investigated the effect of puromycin at a
concentration of 0.4 mM, which inhibits protein synthesis by
more than 90 percent (Helms et al.. 1984), on c-fos gene
expression. Cells cultured in the presence of puromycin for
15 minutes exhibited 9 fold higher levels of c-fos mRNA
compared to untreated cell cultures (Fig. 7-1, lane 3; and
Figure 8-2) However, cotreatment with CD and puromycin for
only 15 minutes resulted in a 49 fold increase in c-fos mRNA
levels (Fig. 7-1, lane 4 and Fig. 7-2) The superinduction
of c-fos mRNA cellular levels by cytochalasin D and
puromycin cotreatment suggests that the stimulation by CD
alone is not due solely to its effect on protein synthesis
and may be the result of the perturbation of the
cytoskeleton.
Kinetics of c-Fos mRNA Accumulation During Cytochalasin D
Treatment
Treatment of quiescent BALB/C-3T3 mouse fibroblast
cells with growth factors or serum results in a rapid and
short lived increase in c-fos mRNA levels (Cochran et al.,
1984; Greenberg and Ziff, 1984; Muller et al.. 1984).
Generally, cellular levels of c-fos mRNA are maximal after
30 minutes of serum/growth factor treatment and return to
pre-stimulatory levels within an hour. In contrast to serum


47
Isolation of Cvtoskeleton and Soluble Phase RNA
The cytoskeleton and soluble fractions were prepared as
previously described by Penman and coworkers (Cervera et
al.. 1981). Exponentially growing HeLa cells (5 x 108 cells)
were harvested and washed in cold PBS. The cell pellet was
resuspended in 2 ml extraction buffer (10 mM Pipes pH 6.8,
100 mM KC1, 2.5 mM MgCl2, 0.3 M sucrose, 1 mM
phenylmethylsulfonyl fluoride) and Triton X-100 was
immediately added to a final concentration of 0.5%. The
sample was incubated at 0c for 3 minutes and then
centrifuged at 700 rpm in an IEC centrifuge for 3 minutes at
4C. The supernatant (SOL) was removed and stored on ice.
The pellet was resuspended in 8 ml RSB containing 1 mM
phenylmethylsulfonyl fluoride, 1% Tween 40 and 0.5% NaDOC.
The nuclei were stripped of cytoplasmic tags with 15 strokes
in a precision-bore stainless steel homogenizer with a
clearance of 0.002 inches and were pelleted at 2,000 rpm for
3 minutes at 4C in an IEC rotor. The supernatant (CSK) was
removed and saved at 0C for subseguent RNA isolation. Both
the CSK and SOL fractions were extracted in the presence of
1% SDS and 0.3 M NaCl with phenol and chloroform. Nucleic
acids were precipitated from the agueous phase with 3
volumes of 95% ethanol at -20C in the presence of 53 mM
potassium acetate. The RNA was digested with DNase I, phenol
and chloroform extracted, and ethanol precipitated as
described above for the isolation of total cellular RNA.


Table 3-1. Quantity of histone and HLA-B7 mRNAs in the
subcellular fractions.
82
H3
H4
HLA-B7
Cytoskeleton
90%
84%
97%
Soluble
10%
16%
3%
NRER
3%
3%
29%
MRER
6%
5%
60%
Free
51%
54%
5%
LER
40%
38%
6%
The distribution of histone and HLA-B7 mRNAs in the
NRER, MRER, LER and nonmembrane-bound polysomal fractions as
well as the cytoskeleton and soluble fractions was
determined by Northern blot analysis. The values have been
normalized with respect to the total yield of RNA within
each fraction.


3) SUBCELLULAR LOCATION OF HISTONE mRNAs ON CYTOSKELETON
ASSOCIATED NONMEMBRANE-BOUND POLYSOMES IN HELA S3
CELLS
Introduction 75
Results 77
Discussion 90
4) SUBCELLULAR LOCATION OF HISTONE UlRNA PLAYS A ROLE IN
THE POSTTRANSCRIPTIONAL REGULATION OF HISTONE
GENE EXPRESSION
Introduction 96
Results 97
Discussion 126
5) DIFFERENTIAL ASSOCIATION OF MEMBRANE-BOUND AND
NONMEMBRANE-BOUND POLYSOMES WITH CELL CYTOSTRUCTURE
Introduction 130
Results 131
Discussion 146
6) HETEROGENEOUS PATTERN FOR CYTOSKELETAL-ltlRNA
INTERACTIONS
Introduction 153
Results 154
Discussion 166
7} THE INFLUENCE OF THE CYTOSKELETON ON THE REGULATION
OF c-Fos GENE EXPRESSION
Introduction 168
Results 171
Discussion 190
8) SUMMARY AND FUTURE CONSIDERATIONS 196
REFERENCES 206
BIOGRAPHICAL SKETCH 219
v


110
It was possible that the stability of the histone
fusion mRNA during inhibition of DNA synthesis was due to
the targeting of the mRNA to a foreign subcellular
compartment, namely the membrane-bound polysomes.
Alternatively, the nucleotide sequences coding for the
signal "peptide may have disrupted the histone mRNA structure
in such a way that it was no longer recognized by the
factors involved in the destabilization of histone mRNA. To
test these possibilities, the signal peptide was mutated in
order to retain the fusion mRNA, without significantly
changing the mRNA structure, on nonmembrane-bound polysomes.
If the class of polysomes plays a role in the coupling of
histone mRNA stability with DNA replication then the mutated
fusion mRNAs that are retained on nonmembrane-bound
polysomes should be efficiently destabilized during
inhibition of DNA synthesis. Conversely, if the mRNA
structure has been disrupted by the nucleotide sequences
encoding the signal peptide then the mutated histone fusion
mRNAs localized on nonmembrane-bound polysomes should be
stable during inhibition DNA synthesis.
The signal peptide-histone fusion gene was mutated by
site directed mutagenesis (Zoller and Smith, 1983) as
described in Chapter 2 and the corresponding mRNAs are
schematically diagrammed in Figure 4-5. The first mutant,
pSPH3Elalpha, contains two point mutations in the region
coding for the hydrophobic domain of the signal peptide,


150
by the apparent cell type specific differences that are
observed for the components of the cytoskeleton that are
involved in the attachment of mRNA and polysomes. Adams et
al. (1983) found that polyribosomes in rat liver cells are
associated with the microfilaments and are released from the
cytoskeleton by deoxyribonuclease I (DNase I) an enzyme
that can depolymerize actin. Pretreatment of the rat liver
cells with phalloidin, a compound that stabilizes actin
filaments, abrogates the DNase I effects on the
polyribosome-cytoskeleton interactions (Adams et al.. 1983).
Consistent with this result, poly A+ RNA, translation
factors and nearly 100% of the polysomes are preferentially
associated with the cytoskeleton in HeLa cells and can be
released into the soluble phase by the disruption of the
microfilaments with cytochalasin B or cytochalasin D (Lenk
et al.. 1977; Howe and Hershey, 1984; Ornelles et al.,
1986). In contrast, Jeffery (1984) reported that the
association of actin mRNA and histone mRNA with the
cytoskeleton in ascidian eggs is not affected by
cytochalasin B treatment, which suggests that the
association is independent of the microfilaments.
Furthermore, disruption of the microfilaments by
cytochalasin B treatment does not release poly A+ histone H4
mRNA from the cytoskeleton in L6 rat myoblast cells (Bagchi
et al_i_, 1987) .


This dissertation was submitted to the Graduate Faculty of the
College of Medicine and to the Graduate School and was accepted as
partial fulfillment of the requirements for the degree of Doctor
of Philosophy.
December 1989
Dean, College of Medicine
Dean, Graduate School


78
fractions. The light endoplasmic reticulum (LER), which is
deficient in polysomes by definition, was also isolated
following this subcellular fractionation scheme. Histone and
HLA-B7 mRNA content in each of the subcellular fractions was
determined by Northern blot analysis. Briefly, RNA was
extracted from the samples, quantitated and electrophoresed
in agarose under denaturing conditions. The RNA was then
transferred to nitrocellulose filters for hybridization with
32P-labeled (nick-translated) pF0108A (H4 histone), pFF435C
(H3 histone) and pDPOOl (cDNA clone of HLA-B7 class I
antigen) DNA probes. A typical screening of subcellular
fractions with these probes is represented by the
autoradiograph in Figure 3-1, and Table 3-1 summarizes the
numerical values derived from densitometric analysis of the
Northern blot. The HLA-B7 mRNA and histone mRNA species are
each present in total cellular RNA and total polysomal RNA
which were included as positive controls. Non-membrane-bound
polysomal RNA contains approximately 55% and 51% of the
total H4 and H3 histone mRNA, respectively. Surprisingly,
the LER fraction contains approximately 38% of the H4
histone mRNA and 41% of the H3 histone mRNA, which may be a
consequence of the method by which the fraction is isolated.
The LER and non-membrane-bound polysomal sample is
centrifuged through a 2 M sucrose pad under conditions where
the LER forms a loose band on top of the pad, while the
nonmembrane-bound polysomes are pelleted. The LER band is


Figure 7-4. Effect of cvtochalasin D on transcription of el
fos in HeLa cells.
Exponentially growing HeLa cells were treated with
cytochalasin D, puromycin, or CD and puromycin for 15
minutes. Radiolabeled RNAs were prepared by in vitro nuclear
run-on transcription and hybridized to Southern blots of
electrophoretically separated restriction enzyme digested
plasmid DNAs (107 cpm/filter). Insert DNAs hybridizing to
transcripts from the corresponding genes are indicated (both
Ribo signals represent 18S ribosomal RNA transcripts).
Untreated, DMSO only; Cytochalasin D, CD [10 jug/ml]?
Puromycin, puromycin [0.04 mM] ; Puro/Cyto, cotreatment with
CD [10 g/ml] and puromycin [0.04 mM]. Autoradiograms in
upper panel for each treatment represent a 28 hour exposure.
Autoradiograms in lower panel, indicating Fos and H4 histone
transcription, represent a 4 day exposure.


48
Typical yields of RNA were 250-300 ng from CSK and 100-150
ng from SOL per 2.5 x 107 HeLa cells (50 ml exponentially
growing suspension culture).
Two-Dimensional Gel Electrophoresis and
Immunob1ottino Analysis
The cytoskeleton and soluble fractions were isolated as
described above and each sample was dialyzed in 2 mM Tris-
HC1 pH 7.5 and treated with DNase I (20 /xg/ml) and RNase A
(20 iig/ml) in the presence of 0.5 mM MgCl2 at 4C for 1
hour. The samples were dialyzed against 2 mM Tris-HCl pH 7.5
and then lyophilized. Two-dimensional gel electrophoresis
and immunoblotting analyses were performed by Dr. Warren
Schmidt (Department of Pathology, Vanderbilt University,
Nashville, TN). The protein preparations were focused in the
first dimension using equilibrium conditions as described by
O' Farrell (1975) with pH 3 to 10 or 5 to 7 ampholines. The
second dimension was electrophoresed on slab gels containing
a 3% stacking gel and 7.5% resolving gel as described by
Laemmli (1970). The proteins were then either stained with
Coomassie Brilliant Blue or electrotransferred to
nitrocellulose filters as described by Towbin et al. (1979).
Where indicated, immunotransfer analyses (Glass et al..
1981) were performed with commercially available or other
(Schmidt et al.. 1982) antibodies to actin, tubulin and
prekeratin.


73
cells were then washed with 10 ml EMEM, refed with 20 ml
completed EMEM and incubated at 37C, 5% C02.
Establishment of Polyclonal and Monoclonal Stablv
Transformed Cell Lines
Polyclonal and monoclonal cell lines were isolated by
growing HeLa cell cultures that were co-transfected with
pSV2neo and the plasmid DNA of interest in medium containing
the antibiotic G418. The plasmid pSV2-neo, constructed by
Southern and Berg (1982), carries the bacterial
aminoglycoside phosphotransferase 3' (II) gene under the
control of the SV40 early promoter and confers resistance to
the aminoglycoside antibiotic G418. The rationale behind the
co-transfection method is that HeLa cells that are competent
to take up pSV2-neo DNA are egually competent to take up the
plasmid DNA of interest, and therefore, a certain percentage
of the G418 resistant cells contain both species of DNA.
Ideally, the selectable marker should be carried by the
vector that contains the gene which is to be studied.
HeLa cells in monolayer culture were co-transfected
with the plasmid DNA to be studied and pSV2-neo DNA (molar
ratio of 20:1, respectively) by the calcium phosphate
precipitation method as described above. After 36-48 hours
post-glycerol shock, the transfected cells were resuspended
in 5 ml Puck saline A [0.04% (w/v) KC1, 0.8% (w/v) NaCl,
0.035% (w/v) NaHC03, 0.1% (w/v) glucose] containing 0.02%


Figure 4-1. Schematic diagram of endogenous H3 histone mRNA
ST519 and the beta-lactamase signal peptide-H3 histone
fusion mRNA.
The signal peptide-histone fusion mRNA is identical to
the wild type histone mRNA with the exception of the signal
peptide encoded sequences that have been inserted in frame
into the histone gene. The 5* mRNA sequences and the 3' mRNA
sequences that have been implicated in coupling histone mRNA
stability to DNA synthesis are retained in place in the
signal peptide-histone fusion mRNA (Morris et al.. 1986;
Pandey and Marzluff, 1987). Boxed areas represent histone H3
mRNA sequences, single lined areas represent beta-lactamase
signal peptide derived sequences.


Figure 4-7. Effects of hvdroxvurea treatment on SPH3E1 mRNA.
HeLa cell monolayers were transfected with pSPH3El DNA
and 46 hours post-transfection were treated with 1 mM
hydroxyurea (HU). Cells were harvested at 20 minute
intervals and total cellular RNA was prepared. The RNA (10
^g) was subjected to SI nuclease protection analysis to
quantitate the levels of wild type signal peptide-histone
fusion mRNA and endogenous H3 histone mRNA. Each lane
represents an individually transfected cell culture. MW is
radiolabeled Hpa II digest of pBR322 DNA. Lanes 1 and 2,
control? lanes 3 and 4, 1 mM HU 20 minutes? lanes 5 and 6, 1
mM HU 0 minutes? lanes 7 and 8, 1 mM HU 60 minutes.


46
resuspended in 15 ml TMN. The sample was adjusted to 1%
Triton X100 and 1% NaDOC, disrupted with several strokes in
a tight fitting Dounce homogenizer and centrifuged at 12,000
x g at 4C for 10 minutes in a JA20 rotor. The supernatant
was removed and saved at 0C.
Each of the fractions (NRER, MRER, LER, nonmembrane-
bound, and total polysomal RNA) were layered onto a 3 ml 2 M
sucrose pad (prepared in RSB containing 100 uM spermidine)
and centrifuged at 4C for 2 hours at 48,000 x g in a
Beckman Type 50.2 Ti rotor (200,000 x g) without the brake.
The LER formed a cloudy band at the top of the sucrose pad
and was carefully removed by aspiration. The remaining
fractions were pelleted under these conditions and gently
resuspended in 3 ml TMN buffer. The samples were then
extracted extensively with phenol and chloroform as
described above for the isolation of total cellular RNA. The
RNA was precipitated from solution with 3 volumes of 95%
ethanol at -2 0C in the presence of 53 mM potassium acetate.
The RNA was digested with DNase I, extracted with phenol and
chloroform, and ethanol precipitated as described above for
the preparation of total cellular RNA. Typical yields were
1.5-2.0 mg MRER and NRER RNA, 2-3 mg nonmembrane-bound RNA,
1 mg LER RNA and 4-6 mg total polysomal RNA per liter of
exponentially growing HeLa cells.


186
were incubated in an equivalent concentration of DMSO for 30
minutes. Treatment of HeLa cells with cytochalasin D for 15
minutes resulted in the expected stimulation of c-fos
transcription (Fig. 7-5). Pretreatment of HeLa cells with
puromycin did not block the CD induced stimulation of c-fos
transcription and in fact, markedly increased the
transcription of the c-fos gene (Fig. 7-5). These results
suggest that the transcription factors are present within
the cells prior to cytochalasin D treatment, which is
consistent with previous findings that the factors involved
in the increase in c-fos transcription during serum
stimulation of quiescent fibroblasts are pre-existent
(Sassone-Corsi and Verma, 1987; Greenberg et al.. 1986).
Cytochalasin D Releases c-Fos mRNA from the Cvtoskeleton
into the Soluble Phase
The marked increase in c-fos mRNA cellular levels
during cytochalasin D treatment is not completely accounted
for by the increase in c-fos transcription and may be partly
a result of enhanced mRNA stability. Previous results
indicated that cytochalasin D [>10 releases poly-A+
RNA from the cytoskeleton into the soluble phase in a dose
dependent manner (Ornelles et al.. 1986). The stabilization
of c-fos mRNA during cytochalasin D treatment may therefore
be a consequence of an alteration in mRNA subcellular
location. To begin addressing this possibility, we have


61
Site-Directed Mutagenesis
In the past, researchers had to rely on nature to
produce the proper mutations to study how the normal
biological processes function. Zoller and Smith (1983) have
designed a powerful method for selectively introducing
singlenucleotide mutations into specific sites of any
cloned, sequenced region of DNA (site-directed mutagenesis).
In addition, this procedure can be used to selectively
create deletion or insertion mutations in DNA fragments of
known sequence. The general approach of site-directed
mutagenesis is to incorporate an oligonucleotide containing
the appropriate mutation into the complementary strand of
recombinant M13 DNA. The heteroduplex is transfected into
bacteria and the resulting mutated bacteriophage are
isolated by various selection processes.
As discussed in Chapter 4, the signal peptide-histone
fusion mRNA is associated with membrane-bound polysomes and
is stable during inhibition of DNA synthesis. It was unclear
whether the uncoupling of the histone fusion mRNA stability
from DNA replication was due to the altered subcellular
location or to a change in mRNA structure, due to the
nucleotide sequence coding for the signal peptide. To
address these possibilities, we have introduced point
mutations into the signal peptide coding region with the
intention to inactivate signal peptide function. In doing
so, mRNA structure is perturbed as little as possible and


58
Radiolabelinq DNA for Northern Blot Analysis
DNA used for Northern blot analysis was uniformally
labeled by nick translation as described by Maniatis et al
(1982b) or by the random priming method of Roberts and
Wilson (1985). Radiolabeled probes prepared in this manner
are also suitable for other purposes such as Southern blot
analysis.
Random Priming Method
This protocol is very efficient for labeling small to
intermediate-sized DNA fragments (100-2000 bp in length) and
is the preferred method for work with purified DNA inserts.
Supercoiled plasmid DNA is labeled much less efficiently by
the random priming method and should be fragmented by
sonication prior to use. Routinely, specific activities of
lxlO9 cpm/jxg DNA are achieved using as little as 20-100 ng
DNA. Material for oligolabeling DNA fragments was purchased
from Bethesda Research Laboratories as a kit.
The isotope (50 uCi [a-32P] dCTP) was vacuum dried and
resuspended in 10 ul of 2.5x reaction buffer (500 mM Hepes
pH 6.6, 12.5 mM MgCl2, 25 mM beta-mercaptoethanol, 125 mM
Tris-HCl pH 8, 1 mg/ml BSA, 7.5 mg/ml synthetic DNA
oligodeoxynucleotide primers, 50 uM each dGTP, dATP, dTTP).
The DNA fragment (100 ng) in 14 ul ddH?0 was heated at 100C
for 2 minutes and immediately chilled on ice. The denatured
DNA was added to the 1.5 ml microcentrifuge tube containing


198
mRNA, in contrast to endogenous histone mRNA, was not
efficiently destabilized when DNA synthesis was interrupted
with hydroxyurea. Site directed mutagenesis analysis of the
histone fusion gene and subsequent .in vivo studies indicated
that the uncoupling of the histone fusion mRNA stability
from DA replication was due to the altered subcellular
location and was not due to the perturbation of mRNA
structure.
It has since been demonstrated by in situ hybridization
analysis that histone mRNAs are localized in "grape like
clusters" throughout the cytoplasm (Lawrence et al.. 1988).
In this regard, the initial proposal that histone mRNAs are
compartmentalized in a region close to the nucleus was
incorrect. The non-uniform distribution of histone mRNAs
within the cytoplasm, however, suggests that histone mRNAs
are compartmentalized. The stability of histone fusion mRNA
during inhibition of DNA synthesis, due to the association
of the mRNA with membrane-bound polysomes, is consistent
with the possibility that these compartments are involved in
the posttranscriptional regulation of histone gene
expression.
The proposal that histone protein synthesis is
autogenously regulated provides one possible explanation for
the role of the subcellular compartments in the
posttranscriptional regulation of histone gene expression.
As proposed by Butler and Mueller (1973) and several other


181
c-FOS


178
and growth factor stimulation, inhibition of protein
synthesis produces a larger accumulation of c-fos mRNA
levels which persists for longer periods of time, usually
several hours (Greenberg et al.. 1986; Rahmsdorf et al..
1987; Andrews et al.. 1987). To determine whether the c-fos
gene response to cytochalasin D treatment corresponds to
that observed for serum/growth factor stimulation or
inhibition of protein synthesis, we examined the kinetics of
c-fos accumulation during CD treatment. Northern blot
analysis of total cellular RNA isolated from cells treated
with 10 jig/ml cytochalasin D for various lengths of time
demonstrated that maximal induction of c-fos mRNA,
approaching a 40 fold increase over control cultures,
occured after 30 minutes and was followed by a sharp decline
to near pre-stimulatory levels within one hour (Fig. 7-3,
lanes 4-9). In contrast, inhibition of protein synthesis
with puromycin resulted in maximal accumulation of c-fos
mRNA levels after 90 minutes, nearly 130 fold higher than in
untreated cells, and the mRNA levels remained elevated for
at least two hours (Fig. 7-3, lanes 16-20). The accumulation
of c-fos mRNA in CD and puromycin co-treated cells followed
the same time course as observed for puromycin treatment and
reached higher levels than with the CD treatment and
puromycin treatment combined (Fig. 7-3, lanes 10-15).
Parallel studies were done on serum starved WI38 human
diploid fibroblast cells. Stimulation of quiescent cell


128
signal is quite variable and can withstand substantial
insertion, substitution or deletion mutations (Kaiser and
Botstein, 1986? Kaiser et al.. 1987; Randall and Hardy,
1989). Subsequently, the signal peptide ATG translation
start codon of SPH3E1 was altered by site directed
mutagenesis which completely inactivated signal peptide
function (Figure 4-6).
The relative stability of signal peptide-histone fusion
mRNA (SPH3E1) during inhibition of DNA synthesis appears to
be a result of the subcellular location of the mRNA.
Destabilization of SPH3E1ATG mRNA, which differs from
SPH3E1 mRNA by a single nucleotide, with essentially the
same kinetics and to the same extent as endogenous H3
histone mRNA indicates that SPH3E1 mRNA expresses the proper
structural confirmation for recognition by the factors that
mediate the selective destabilization of histone mRNA during
inhibition of DNA synthesis.
The difference in SPH3E1 and SPH3E1ATG mRNA stability
during inhibition of DNA synthesis may reflect a
perturbation of protein structure due to the signal peptide
at the N-terminus of SPH3E1. This possibility does not
appear likely based on the observations that histone amino
acid sequences are not required to target the mRNA for
destabilization (Pandey and Marzluff, 1987) and SPH3Elalpha
mRNA, which expresses the mutated form of the signal
peptide, is moderately destabilized during inhibition of DNA
synthesis (Figures 4-8 and 4-10).


133
Membrane-Bound Polysomal RNA is not Released from the
Cytoskeleton bv Cvtochalasin D Treatment
HLA-B7 is a class I histocompatibility antigen that is
located on the cell surface (Robb et al.. 1978). Previously,
HLA-B7 mRNA was shown to be associated with the cytoskeleton
and translated into protein on membrane-bound polysomes
(Zambetti et al., 1985). As seen in Figure 5-1, HLA-B7 mRNA
was almost exclusively associated with the cytoskeleton in
control cells (lanes 1 and 2) and remained largely
associated with the cytoskeleton in cytochalasin D treated
cells (lanes 3-8). Approximately 98% of the HLA-B7 mRNA was
associated with the cytoskeleton in untreated cell cultures
(Table 5-1). In contrast to histone mRNA and total poly-A+
RNA, only 11% of the HLA-B7 mRNA was released from the
cytoskeleton in cell cultures treated with 10 /ig/ml
cytochalasin D (Table 5-1).
The retention of HLA-B7 mRNA on the cytoskeleton during
cytochalasin D treatment may be a consequence of translating
the mRNA on membrane-bound polysomes. To examine this
possibility, the distribution of chorionic gonadotropin
alpha mRNA within the cytoskeleton and soluble fractions was
determined in cytochalasin D treated cells. Chorionic
gonadotropin is a secreted, heterodimeric protein composed
of alpha and beta subunits (Milsted et al., 1985). The alpha
subunit is expressed in exponentially growing HeLa cells
(Milsted et al.. 1985), and Northern blot analysis of


113
which results in the substitution of leucine at amino acid
position 10 (GAA-*GTA) and proline at position 12 (GGG-+GTG)
with positively charged histidine residues. The second
mutant, pSPH3ElATG', contains a single nucleotide
substitution which destroys the ATG translation initiation
codon of the signal peptide (ATG-^TTG). This mutation should
result in the initiation of translation at the natural ATG
codon of the histone coding region without the synthesis of
the signal peptide.
The distribution of the SPH3E1, SPH3Elalpha and
SPH3E1ATG signal peptide-histone fusion mRNAs in
nonmembrane-bound and membrane-bound polysome fractions from
transfected HeLa monolayer cell cultures was determined by
SI nuclease protection analysis. As seen in Figure 4-6, the
SPH3E1ATG" mRNA partitioned into the nonmembrane-bound
polysome fraction to the same extent as endogenous histone
H3 mRNA. Approximately 82% of the SPH3E1ATG" mRNA and 83%
endogenous histone mRNA was found associated with the
nonmembrane-bound polysomes (Table 4-1). In contrast, SPH3E1
mRNA was predominantly associated with membrane-bound
polysomes (Fig. 4-6). Approximately 68% of SPH3E1 mRNA was
localized in the membrane-bound polysomal RNA fraction
(Table 4-1). The SPH3Elalpha mRNA displayed a more
intermediate association with membrane-bound polysomes;
approximately 40% of the SPH3Elalpha mRNA was localized in
the membrane-bound polysome fraction and 60% in the
nonmembrane-bound polysomal fraction (Fig. 4-6 and Table 4-


35
digested with Ncol, which cuts at the ATG translation start
codon, and ligated to Ncol/dephosphorylated pSPpSTdeltaHH/E
DNA using T4 DNA ligase. The signal peptide-histone fusion
gene was subcloned into pUC8 plasmid DNA by ligating the 1.1
kbp Hpal fragment from pSPpSTdeltaHH/EpST into the Hindi
site o pUC8 to form pSPH3. The signal peptide-histone
fusion gene in pSPH3 was transcriptionally enhanced by
placing the SV40 viral enhancer element from pSVE108A
(Shiels et al.. 1985) into the EcoRI site in the polylinker
of pSPH3 to form pSPH3El (containing one enhancer element)
and pSPH3E2 (containing 2-3 enhancer elements).
DNA Isolation and Purification
Plasmid DNA Preparations
Plasmid DNAs used in the experiments described here
were harbored in Escherichia coli strain HB101 bacteria (F~,
recA 13) unless otherwise indicated. Bacteria containing the
appropriate plasmid were grown in medium containing
antibiotics (usually 25-50 jug/ml ampicillin or tetracycline)
as specified by the genotype of the plasmid or bacterium.
The following procedure is the routine method for
isolating pBR322 derived plasmid DNAs and includes an
amplification step with chloramphenicol for higher yields of
DNA (Maniatis et al.. 1982a). Plasmids that are derived from
pUC8 DNA are also prepared as follows; however, due to their
high copy number the amplification step is unnecessary. The


83
in Figure 3-2, the cytoskeleton fraction clearly contained
actin as well as the major HeLa cytokeratins (Franke et al..
1981). In addition, vimentin appeared to be enriched in the
cytoskeleton, which was confirmed by immunoblot analysis.
Extraction of the cytoskeleton required a cold, calcium
containing buffer and consequently the tubulins were
solubilized and therefore absent in the Csk fraction. The
tubulin proteins were clearly contained in the soluble
fraction as determined by immunoblot analysis. Additional
support for separation of cytoskeleton and soluble phases
comes from the observation that the bulk of the tRNA species
is in the soluble phase which is in agreement with
previously reported values (data not shown; Cervera et al.
1983). Although the HLA-B7 messenger RNA is found on
membrane-bound polysomes and the histone mRNA on
nonmembrane-bound polysomes, both species of messenger RNAs
are associated almost exclusively with the cytoskeletal
fraction. Nearly 97% of the HLA-B7 mRNA and approximately
85-90% of the H3 and H4 histone messages are retained in the
Csk (Fig. 3-1? Table 3-1).
The Effects of Metabolic Inhibitors on the Subcellular
Localization of Histone and HLA-B7 mRNA
Detectable levels of histone mRNA were observed in each
of the subcellular samples, including the Sol fraction and
the membrane-bound polysomal fractions. However, the HLA-B7


Figure 6-3. Endogenous membrane-bound polysomal mRNAs are
released from the cvtoskeleton during cotreatment with CD
and puromycin in SPH3E1 and SPH3E1ATG' expressing cell
cultures.
Cytoskeleton and soluble RNAs (10 ;g/sample) were
assayed by Northern blot analysis for HLA-B7 mRNA and
chorionic gonadotropin mRNA content as described in Chapter
2. Lane 1, control-csk; lane 2, control-sol; lane 3, CD-csk?
lane 4, CD-sol? lane 5, puro-csk? lane 6, puro-sol; lane 7,
CD/puro-csk; and lane 8, CD/puro-sol.


22
the ribosome, the signal recognition complex (SRP) binds to
the signal peptide and arrests translation (Walter and
Blobel, 1981). The SRP is an 11S ribonucleic acid-protein
complex composed of six non-identical polypeptides and one
small cytoplasmic RNA molecule (Walter and Blobel, 1980;
Walter'and Blobel, 1982; Walter and Blobel, 1983). The RNA
molecule of SRP is 300 ribonucleotides in length and shares
approximately 80% homology with a middle repetitive human
DNA family (Ullu et al. 1982; Li et al^., 1982). With the
SRP bound to the signal peptide, the complex can then
associate with the membrane of the endoplasmic reticulum
through the interaction with the SRP receptor which is also
known as the docking protein (Gilmore et al.. 1982a; Gilmore
et al.. 1982b; Meyer et al.. 1982a; Meyer et al.. 1982b).
The SRP then dissociates from the polysome with the
resultant release of the translational block. As translation
resumes the protein is co-translocated from the cytoplasm
into the endoplasmic reticulum. During translocation, a
signal peptidase which is located in the lumen of the
endoplasmic reticulum removes the signal peptide from the
protein (Maurer and Mckean, 1978; Walter et al.. 1984).
Overview of Project
The overall aim of this work is to better define the
mechanism(s) involved in coupling histone protein synthesis
with DNA replication. Specifically, we have focused our


77
DNA replication (Spaulding et al.. 1966; Robbins and Borun,
1967; Borun et al.. 1967; Baumbach et al.. 1984). To address
the relationship between the localization of histone mRNAs
and the control of cellular histone mRNA levels, we have
used cloned human histone genes to examine the distribution
of histone mRNAs on nonmembrane-bound and membrane-bound
polysomes and the association of histone mRNA-containing
polysomes with the cytoskeleton. As predicted from previous
results of in vitro translation analysis and cDNA
hybridization studies, histone mRNAs were found to reside
predominantly on nonmembrane-bound polysomes. Both the
nonmembrane-bound polysomes containing histone mRNAs and the
membrane-bound polysomes containing the cell surface class I
HLA-B7 antigen mRNAs were found associated with the
cytoskeleton.
RESULTS
Localization of Histone mRNA and HLA-B7 mRNA in Subcellular
Fractions
To determine the intracellular locations of histone
mRNA and HLA-B7 mRNA, HeLa cells were first fractionated
into nonmembrane-bound and membrane-bound polysomal
components by the procedure outlined in Fig. 2-2. The
membrane-bound polysomes are represented by the mitochondria
associated rough endoplasmic reticulum (MRER) and the
nucleus associated rough endoplasmic reticulum (NRER)


81


38
directed mutagenesis and dideoxy DNA sequencing reactions
since it can be readily isolated as a double-stranded
covalently closed circular DNA replicative form (RF) from
the infected bacteria and as a circular, single-stranded DNA
genome (SS) from the mature phage particle. In addition, M13
phage DNA has been altered genetically to facilitate cloning
and subsequent manipulations. One such derivative, M13mpl8,
is small in size, maintained in high copy number
(approximately 200 RF molecules per cell), contains a
convenient polylinker for the insertion of foreign DNA (up
to 25 kb), and expresses beta-galactosidase which is
inactivated by the insertion of DNA into the polylinker
site.
Single-stranded templates. Single-stranded M13 DNA
templates were prepared from individual "plaques" which
formed on a lawn of E_j_ coli strain JM103 bacteria
(delta(lac-proAB) supE / F'[traD36, proA*. proB+, laclq,
lacZdeltaM15]) that were infected with M13 bacteriophage or
transfected with M13 double stranded, covalently closed
circular DNA. A single plaque was removed from the agar
plate with a sterile pasteur pipette and placed in 2 ml YT
medium (0.8% Bacto-tryptone, 0.5% Bacto-yeast extract, 0.5%
NaCl) Two drops of an overnight JM103 bacterial culture
were added to the phage and incubated at 37C with agitation
for 6 hours. Longer incubation times result in deletions


218
Wu, R., and Bonner, W. (1985) Mol. Cell. Biol. 5, 2959.
Yoshizaki, K., Nakagawa, T., Kaieda, T.f Muraguchi, A.,
Yamamura, Y., and Kishimoto, T. (1982) J. Immunology 128.
1296.
Zambetti, G., Stein, J., and Stein, G. (1986) Proc. Natl.
Acad. Sci. U.S.A. 84/ 2683.
Zambetti, G., Schmidt, W., Stein, G., and Stein, J. (1985)
J. CeU. Phys. 125, 345.
Zoller, M., and Smith, M. (1983) Methods Enzymol. 100. 468.
Zumbe, A., Stahli, C., and Trachsel, H. (1982) Proc. Natl.
Acad. Sci. U.S.A. 79, 2927.


11
whereas vimentin mRNA is concentrated in perinuclear regions
in chick myoblast and fibroblast cells (Lawrence and Singer,
1986). Furthermore, actin mRNA is concentrated in the
lamellipodia, structures involved in cell locomotion
(Lawrence and Singer, 1986). The requirement for actin
protein in the lamellipodia during cell movement (Wang,
1984) suggests a functional relationship between where the
mRNA is localized and where the encoded protein is needed
(Lawrence and Singer, 1986).
Localization of mRNAs in distinct areas of the
cytoplasm may occur due to an association of the mRNA with
an underlying structure. This structure could serve as an
anchor to concentrate mRNAs in particular regions of the
cytoplasm. Consistent with this reasoning is the existence
of a complex, proteinaceous structure in the cytoplasm of
most eukaryotic cells that is referred to as the
cytoskeleton. The cytoskeleton plays a role in cell shape,
cell motility and the intracellular transport of
macromolecules and organelles (Clarke and Spudich, 1977;
Goldman et al.. 1978; and reviewed in Nielsen et al.. 1983).
In addition, there is growing support for the hypothesis
that the cytoskeleton plays a key role in regulating the
translation process (Lenk et al.. 1977; Lenk and Penman,
1979; Fulton et al.. 1980; Cervera et al.. 1981; van Verooij
et al. 1981; Nielsen et al.. 1983; Howe and Hershey, 1984).


191
Regulation of c-fos gene expression is controlled at
both the transcriptional and posttranscriptional levels. A
variety of agents such as serum, growth factors and
differentiation factors transcriptionally induce c-fos gene
expression in a rapid and transient manner (Greenberg and
Ziff, 984). In contrast, inhibition of protein synthesis
with cycloheximide or heat shock results in a slower but
more persistent accumulation of c-fos mRNA with minimal or
no effect on c-fos transcription (Andrews et al.. 1987;
Rahmsdorf et al.. 1987). The increase in c-fos mRNA levels
during inhibition of protein synthesis appears to be largely
posttranscriptionally regulated through the stabilization of
the c-fos mRNA. Previous results have demonstrated that
cytochalasin D can inhibit protein synthesis in a dose
dependent manner by releasing poly-A+ RNA from the
cytoskeleton into the soluble phase as mRNP particles
(Ornelles et al.. 1986). The concentration of cytochalasin D
used in this study was sufficient to inhibit protein
synthesis by 50 percent. However, our results suggest that
the induction of c-fos gene expression by cytochalasin D
treatment is not a result of the partial inhibition of
protein synthesis. Cytochalasin D and puromycin cotreatment
resulted in roughly an additive increase in c-fos gene
transcription, suggesting the effects of the two drugs on
transcription are due to different mechanisms. Consistent
with this reasoning, the cellular level of c-fos mRNA in


21
endoplasmic reticulum and on what is generally known for the
synthesis of proteins that are localized on the cell surface
or secreted from the cell. Most cell surface or secreted
proteins are initially synthesized with a segment of amino
acid residues at the N-terminus that is not usually found in
the mature protein. This segment is commonly referred to as
a signal peptide. Although signal peptides are not highly
conserved in sequence, they are fairly conserved in
structure and based on the compilation of 277 signal
peptides ranging from bacteria to higher eukaryotes, a
consensus structure has been deduced (Watson, 1984) In
general, signal peptides are 25-30 amino acids in length.
They contain a charged amino acid within the first five
residues, which is followed by a stretch of at least nine
hydrophobic amino acids, and terminate at a small uncharged
amino acid such as alanine, serine or glycine. It is
believed that the hydrophobic domain of the signal peptide
facilitates the transfer of the protein across the lipid
environment of specific intracellular membranes whereas the
small, uncharged amino acid is thought to direct the
protease to cleave the peptide from the mature protein
(Hortin and Boime, 1981).
Presumably, translation of mRNA encoding exported
proteins is initiated on nonmembrane-bound polysomes.
Following the synthesis of approximately 70 amino acids, the
point at which the entire signal peptide has emerged from


70
Annealing Template and Primer
The primer for synthesizing the complementary strand of
wild type and mutated M13/SPH3 recombinant DNA is a 20 bp
oligonucleotide which hybridizes to a site adjacent to the
polylinker. The annealing reaction was prepared by adding 1
ul primer (0.5 pmol), 7 ul single-stranded M13/SPH3
recombinant DNA (0.5-1.0 pmol) and 2 ul 5X sequencing buffer
(200 mM Tris-HCl pH 7.5, 100 mM MgCl2, 250 mM NaCl). The
sample was heated at 65C for 2 minutes and slowly cooled to
room temperature.
Labeling Reaction
The complementary strand was synthesized by incubating
the annealed sample with 1 ul 100 mM dithiothreitol, 2 ul
labeling nucleotide mix (1.5 uM dGTP, 1.5 uM dCTP, 1.5 uM
dTTP) 0.5 ul [a-35S] dATP [10 uCi/ul] and 2 ul Sequenase
[1.5 U/ul] at room temperature for 5 minutes. Elongation was
terminated by mixing 3.5 ul aliquots of the labeling
reaction with 2.5 ul of one of the dideoxy nucleotide
solution (ddATP, ddCTP, ddGTP, ddTTP). The dideoxy
nucleotide solutions were 80 uM dATP, 80 uM dCTP, 80 uM
dGTP, 80 uM dTTP, 50 mM NaCl and 8 uM of the appropriate
dideoxyribonucleotide. The sequencing samples were diluted
with 4 ul stop solution (95% formamide, 20 mM EDTA, 0.05%
bromophenol blue and 0.05% xylene cyanol), heated at 75C
for 2 minutes and loaded onto a 6% acrylamide-8.3 M urea gel


Figure 4-5. Schematic diagram of wild type and mutated
signal peptide-histone fusion mRNAs.
The signal peptide-histone fusion gene (SPH3E1) was
mutated by site directed mutagenesis (Zoller and Smith,
1983) as described in Chapter 2. Abbreviations: H3,
endogenous H3 histone mRNA; SPH3E1, signal peptide-histone
fusion mRNA; SPH3Elalpha, signal peptide-histone fusion mRNA
mutated in the hydrophobic region of the signal peptide (leu
at position 10 and pro at position 12 substituted with his)?
SPH3E1ATG signal peptide-histone fusion mRNA mutated in
the signal peptide translation start codon; CAP, 5' cap
structure; ATG, predicted translation start codon; atg,
internal translation start codon for histone H3 protein;
TAA, translation stop codon.


REFERENCES
Adams, A., Fey, E. G., Pike, S., Taylorson, C., White, H.,
and Rabin, B. (1983) Biochem. J. 216. 215.
Adesnik, M. and Darnell, J. (1972) J. Mol. Biol. 67., 397.
Allfrey, V., Littau, V., and Mirsky, A. (1963) Proc. Natl.
Acad. Sci. U.S.A. 49., 414.
Alterman, R., Sprecher, C., Graves, R., Marzluff, W., and
Skoultchi, A. (1985) Mol. Cell. Biol. 5, 2316.
Amos, L. and Klug, A. (1974) J. Cell Sci. 14., 523.
Andrews, G., Harding, M., Calvert, J., and Adamson, E.
(1987) Mol. Cell. Biol. 7, 117.
Bagchi, T., Larson, D., and Sells, B. (1987) Exp. Cell Res.
168. 160.
Baumbach, L., Stein, G., and Stein, J. (1987) Biochemistry
26, 6178.
Baumbach, L., Marashi, F., Plumb, M., Stein, G., and Stein,
J. (1984) Biochemistry 23., 1618.
Bedouelle, H., Bassford Jr., P., Fowler, A., Zabin, I.,
Beckwith, J., and Hofnung, M. (1980) Nature 285, 78.
Benecke, B.-J., Ben Ze'ev, A., and Penman, S. (1978) Cell
14, 931.
Bennet, G., Fellini, S., and Holtzer, H. (1978)
Differentiation 12, 71.
Berk, A., and Sharp, P. (1978) Proc. Natl. Acad. Sci. U.S.A.
75, 1274.
Berl, S., Puszkin, S., and Nicklas, W. (1973) Science 179,
441.
Binder, L., Frankfurter, A., and Rebhun, L. (1985) J. Cell
Biol. 101, 1371.
206


145
123456789 10


CHAPTER 1
INTRODUCTION
General Background
Histones are small basic proteins that are involved in
the packaging of eukaryotic DNA into chromatin. It is
estimated that more than 2 meters of DNA are contained
within the limited area of the nucleus. The condensation of
the DNA to such a great extent is due primarily to its
interactions with the histone proteins. In addition to their
structural properties histones play a functional role in
controlling gene transcription. The way in which the histone
proteins are arranged along a region of DNA appears to
affect the transcriptional properties of that DNA domain.
The complex nature of the regulation of histone protein
synthesis at the transcriptional, posttranscriptional, and
posttranslational levels makes these genes an important
model for studying eukaryotic gene expression. However, one
of the most important reasons for studying the regulation of
histone gene expression is that the synthesis of the
majority of histone proteins (cell cycle dependent histones)
occurs during DNA replication. Elucidation of the mechanisms
coupling histone protein synthesis with DNA synthesis may
1


80
60
40
20
0
125
20
T Im e(HU)
40
60


It
t:
HLA-B7
(
CSK
f

<
SOL
CSK
SOL
CSK
SOL
CSK
SOL
kO
rsj


I certify that I have read this study and that in my opinion
it conforms to acceptable standards of scholarly presentation and
is fully adequate, in scope and quality, as a dissertation for the
degree of Doctor of Philosophy. /
fanet L. Stein, Chair
'Professor of Immunology and
Medical Microbiology
I certify that I have read this study and that in my opinion
it conforms to acceptable standards of scholarly presentation and
is fully adequate, in scope and quality, as/^)diss9ir^ation for the
degree of Doctor of Philosophy.
J3cfry 5, S^in
"^Professor of Biochemistry
and Molecular Biology
I certify that I have read this study and that in my opinion
it conforms to acceptable standards of scholarly presentation and
is fully adequate, in scope and quality, as a dissertation for the
degree of Doctor of Philosophy.
I ^2
Jaimes B. Flanegan
professor of Immundlogy and
Medical Microbiology
I certify that I have read this study and that in my opinion
it conforms to acceptable standards of scholarly presentation and
is fully adequate, in scope and quality, as a dissertation for the
degree of Doctor of Philosophy.
Thomas C. Rowe
Assistant Professor of
Pharmacology and Therapeutics
I certify that I have read this study and that in my opinion
it conforms to acceptable standards of scholarly presentation and
is fully adequate, in scope and quality, as a dissertation for the
degree of Doctor of Philosophy.
Richard W. Moyer/
Professor of Immunology and
Medical Microbiology


195
expression during EGF and insulin cotreatment can be
inhibited by disruption of the cytoskeleton with
cytochalasin D. This result is consistent with the
hypothesis that the cytoskeleton may be involved in relaying
the EGF/insulin signal from the cell surface to the nucleus.
The results presented here describing the stimulation of c-
fos gene expression with cytochalasin D, although contrary
to Rebillard's results, are consistent with their
interpretation that the nucleus monitors the integrity of
the cytoskeleton and adjusts the expression of particular
genes accordingly. Rather than cytochalasin D inhibiting a
signal from the cell surface to the nucleus, the drug in our
hands may mimic the signal to stimulate c-fos gene
expression. Cell type, culture conditions and drug dosage
effects may explain the differences observed between our
results and those of Rebillard's et al. (1987) .
In summary, cytochalasin D stimulates c-fos gene
expression through increased transcription and mRNA
stability. The effect of cytochalasin D on c-fos gene
expression may be in response to the alterations in the
cytoskeleton and cell shape. Whether other elements of the
cytoskeleton such as the intermediate filaments can elicit
the same response remains to be determined. Taken together
with previous reports, the ability of cytochalasin D to
stimulate c-fos in quiescent fibroblasts with the same
kinetics and virtually to the same extent as serum supports
the role of the cytoskeleton in signal transduction.


203
the cytoskeleton. These results suggest that one mechanism
for the attachment of membrane-bound polysomes to the
cytoskeleton is through the interaction of the polysome
complex with the endoplasmic reticulum. This interaction
appears to involve the nascent polypeptide; however other
possibilities may exist.
The relocation of signal peptide-histone fusion mRNA to
membrane-bound polysomes presented the opportunity to study
the cytoskeletal interactions of membrane-bound polysomal
mRNAs in more detail. Our model predicted that histone
fusion mRNA would remain attached to the cytoskeleton during
CD treatment and would be released into the soluble phase
during CD and puromycin cotreatment. As seen in Chapter 6,
the signal peptide-histone fusion mRNA remained attached to
the cytoskeleton during cytochalasin D treatment as well as
during cytochalasin D and puromycin cotreatment. The
retention of signal peptide-histone fusion mRNA on the
cytoskeleton under these conditions demonstrates that the
histone fusion mRNA is associated with the cytoskeleton in a
manner that is different from that observed for wild type
histone mRNA, HLA-B7 membrane-bound polysomal RNA and
heterogeneous poly-A+ RNA. Although it is well documented
that mRNAs are associated with the cytoskeleton, there are
no known cytoskeleton attachment sites identified to date.
Dissection of the signal peptide-histone fusion mRNA, by
deletion and site directed mutation analysis, should prove


141
Table 5-2. Percent distribution of nonmembrane-bound and
membrane-bound polysomal RNAs in the Csk and Sol fractions
from CD. Puro, CD/puromvcin and CD/cvcloheximide treated
cells.
H3/H4
HLA-
B7
hCG
fos
Control
CSK
87%
(5)
97%
(i)
96%
(i)
80%
SOL
13%
3%
4%
20%
CD
CSK
18%
(4)
75%
(6)
72%
(6)
29%
SOL
82%
25%
28%
71%
Puro
CSK
79%
(7)
79%
(9)
85%
(5)
83%
SOL
21%
21%
15%
17%
CD/Puro
CSK
18%
(4)
25%
(3)
26%
(3)
20%
SOL
82%
75%
74%
80%
CD/Cyclo
CSK
19%
(8)
81%
(+2)
52%
(10)
40%
SOL
81%
19%
48%
60%
The
Csk
and Sol
distribution of
c-fos
mRNA during
CD,
puro, CD/puro and CD/cyclo treatment was quantitated by
normalizing the densitometric results from the autoradiogram
presented in Figure 5-2 for the yield of RNA in each
fraction. The Csk and Sol distribution of nonmembrane-bound
and membrane-bound polysomal mRNAs was quantitated directly
from the densitometric analysis. The numbers in brackets
indicate standard error.


65
for 45 minutes. The reaction was terminated by heating at
65C for 10 minutes, and unincorporated radiolabeled
nucleotides were removed by chromatography through a
Sephadex G-25 (Pharmacia) column (10 mm x 100 mm) in 50 mM
ammonium bicarbonate (pH 7.8).
The phosphorylated oligonucleotide (10-30 molar excess
over template DNA) was added to 0.5 pmol of M13 recombinant
DNA and the volume was adjusted to 10 ul with ddH20 and 1 ul
solution A (200 mM Tris-HCl pH 7.5, 100 mM MgCl2, 500 mM
NaCl, 10 mM dithiothreitol). The solution was heated at 55C
for 5 minutes and then cooled for 5 minutes at room
temperature. The primer extension reaction also contained 1
ul of 2.5 mM dCTP, 1 ul 2.5 mM dATP, 1 ul 2.5 mM dTTP, 1 ul
2.5 mM dGTP, 0.5 ul solution A and 1 unit Klenow enzyme. The
reaction proceeded at room temperature for 5 minutes and was
terminated by heating at 65C for 10 minutes. The sample was
diluted with 2 ul lOx PstI buffer (100 mM Tris-HCl pH 7.5, 1
M NaCl, 100 mM MgCl2, 1 mg/ml BSA) and 7 ul ddH20 and then
digested with 1 ul PstI restriction endonuclease [5 U/ul] at
37C for 1 hour. The sample was heated at 100C for 2
minutes, quickly cooled to 0C and diluted with 20 ul SI
loading buffer. The PstI digested samples (10 ul) were
resolved electrophoretically in 5% acrylamide (20:1;
acrylamide:bis), 7 M urea at 300 volts (-35 mA) for 1.5
hours. The gels were dried under vacuum at 80C for 1 hour
and analyzed by autoradiography. Primer extension analysis


136
Table 5-1. The percent of cytoskeleton and soluble phase
associated mRNAs in cells treated with cvtochalasin D.
H3
H4
HLA-B7
hCG
Control
Csk
93%
96%
>98%
90%
Sol
7%
4%
< 2%
10%
CD [5 Mg/ml]
Csk
24%
20%
79%
69%
Sol
76%
80%
21%
31%
CD [10 Mg/ml]
Csk
33%
31%
87%
77%
Sol
67%
69%
13%
23%
CD [40 jitg/ml]
Csk
26%
20%
64%
41%
Sol
74%
80%
36%
59%
The densitometric
results
from Figure
5.1 (hCG data not
shown) were normalized
for the
yield of RNA
. from the
cytoskeleton
and soluble fractions of each
cell sample
(note: equal quantities of cytoskeleton and soluble RNAs
were analyzed which does not take into consideration the
unequal distribution of RNA within these fractions or the
changes that occur during cytochalasin D treatment). The
values are presented as percent distribution of mRNA between
the cytoskeleton and soluble fractions.


161
MW 1 2 3 4 5 6 7 8
SPH3E1
excess probe
Endogenous H3


98
coding sequences and extends approximately 300 base pairs
beyond the TAA translation stop codon, including a region
which has been implicated in histone mRNA destabilization
when DNA synthesis is inhibited (Luscher et al.. 1985?
Pandey and Marzluff, 1987? Graves et al.. 1987). An SV40
enhancer element was incorporated into the upstream EcoRI
site in the recombinant plasmid to increase cellular levels
of the fusion transcript. The mRNA encoded by the fusion
gene consists of the first 20 nucleotides of the H3 histone
5' leader sequences followed by the untranslated leader
sequence of the beta-lactamase signal peptide, the entire
beta-lactamase signal peptide coding sequences (including
the translation start codon), the entire H3 histone coding
region which is fused in frame to the signal peptide coding
region, and the H3 histone 3' untranslated region (Figure 4-
1). The junction between the signal peptide coding region
and the H3 histone coding region has been sequenced by
Sanger's dideoxy method and the reading frame has been
conserved. All sequences required for the synthesis and
processing of the chimeric mRNA, as well as for translation
of the fusion protein, are present. The signal peptide-H3
histone fusion gene with a single SV40 enhancer element is
designated pSPH3El and an identical fusion construct
containing multiple SV40 enhancer elements in the EcoRI site
is designated pSPH3E2.


151
The association of mRNA with the cytoskeleton also
appears to change during differentiation in certain cell
types (Toh et al.. 1980). Microscopic analysis of fetal rat
lung fibroblast cells indicates that polyribosomes are
aligned in linear arrays along the actin-like stress fibers
(Toh e al. 1980). These polysomes are difficult to
visualize after disruption of the microfilaments by
cytochalasin B treatment and are presumed to be released
from the cytoskeleton into the soluble phase. Polysomes in
the more differentiated fetal lung fibroblasts are
associated with the endoplasmic reticulum and are no longer
affected by cytochalasin B treatment (Toh et al.. 1980).
These results are consistent with the possibility that the
association of polysomes with the cytoskeleton changes
during differentiation.
In conclusion, the results presented here provide
evidence for heterogeneity in the interactions of mRNA with
the cytoskeleton in HeLa cells. Membrane-bound and non-
membrane-bound polysomes are differentially associated with
the cytoskeleton. Studies on the association of mRNA with
the cytoskeleton must take into consideration these
differences when interpreting which elements are involved in
the cytoskeletal attachment of mRNA. Failure to release mRNA
from the cytoskeleton with cytochalasins may only suggest
that additional cytoskeletal attachment sites are involved.
The differential association of mRNA with the cytoskeleton


147
A+ RNA with the cytoskeleton could be disrupted by
perturbing the microfilaments with cytochalasin D in HeLa
cells (Ornelles et al.. 1986). Consistent with these
results, cytochalasin D treatment readily releases c-fos
mRNA and poly-A' histone mRNA from the cytoskeleton into the
soluble phase. Surprisingly, HLA-B7 mRNA and hCGa mRNA were
only partially released from the cytoskeleton in
cytochalasin D treated HeLa cells.
The inefficiency of cytochalasin D in releasing HLA-B7
and hCGa mRNA from the cytoskeleton appears to be a result
of the association of these mRNAs with membrane-bound
polysomes. Dissociation of the polysomes with puromycin in
the presence of cytochalasin D releases HLA-B7 and hCGa mRNA
from the cytoskeleton. In contrast, cycloheximide, an
inhibitor of protein synthesis that preserves polysomal
structure, fails to release HLA-B7 mRNA from the
cytoskeleton in cytochalasin D treated cells. These results
suggest that membrane-bound polysomal mRNAs are attached to
the cytoskeleton in at least two different ways. The first
cytoskeleton attachment site is through the mRNA/mRNP itself
and is sensitive to cytochalasin D treatment. This site is
most likely common to all cytoskeletal associated mRNAs in
HeLa cells and has been previously observed for poly A+ RNA
by Ornelles et al. (1986). The second cytoskeletal
attachment site which is characteristic of membrane-bound
polysomes appears to be mediated by the nascent polypeptide


87
fractions (Figure 3-3). This is in sharp contrast to the
HLA-B7 mRNA which appeared to be fully stable under these
conditions. Cycloheximide treatment had a stabilizing effect
on the levels of histone mRNA in each subcellular fraction
(Figure 3-3). When compared with control HeLa cells,
cycloheximide treatment resulted in a 2.1 fold (H4) and a
2.4 fold (H3) increase in the levels of histone mRNA in the
nonmembrane-bound polysomal fraction. Similar increases were
also seen for levels of histone mRNAs in the LER and
membrane-bound polysomal fractions. Inhibition of protein
synthesis with cycloheximide followed by DNA synthesis
inhibition with hydroxyurea resulted in the stabilization of
histone mRNA in each subcellular fraction, whereas the
stability of HLA-B7 mRNA remained unaffected (Figure 3-3).
Similar results were obtained when these inhibitor studies
were expanded to include the cytoskeleton and soluble
fractions (Figure 3-4). Cycloheximide treatment resulted in
a 2-3 fold increase in the representation of H3 and H4
histone mRNA over untreated cultures in both the
cytoskeleton and soluble fractions. HLA-B7 mRNA appeared to
be only moderately stabilized in the presence of this drug.
When cells were treated with hydroxyurea, histone mRNA
levels were greatly reduced in both the cytoskeleton and
soluble fractions whereas the HLA-B7 mRNA was found in
comparable levels to those present in the untreated samples.
Consistent with previous data, cotreatment of HeLa cells


29
HeLa Suspension Cell Cultures
HeLa S3 cells were grown and maintained in suspension
at 3-6xl05 cells/ml in SMEM (Joklik-modified minimum
essential medium) supplemented with 7% calf serum, 100 U/ml
penicillin, 100 /xg/ml streptomycin and 1 mM glutamine in a
warm room at 37C. Monoclonal and polyclonal HeLa S3 cell
lines, which were isolated during G418 selection of
transfected monolayer cultures, were maintained in SMEM
containing 5% fetal calf serum, 5% horse serum, 100 U/ml
penicillin, 100 /xg/ml streptomycin and 1 mM glutamine at 3-
6x10s cells/ml.
WI-38 Monolayer Cell Cultures
WI-38 cells (normal, human diploid fibroblast-like
cells; ATCC ccl 75) at passage 28, were grown as monolayers
in EMEM containing 10% fetal calf serum, 100 U/ml
penicillin, 100 /ng/ml streptomycin and 1 mM glutamine at
37C under 5% C02. Cell cultures were made quiescent by
maintaining cultures in EMEM containing 0.5% fetal calf
serum, 100 U/ml penicillin, 100 /xg/m1 streptomycin and 1 mM
glutamine at 37C under 5% C02 for 48 hours.
Metabolic Inhibitor Treatments
Inhibition of DNA synthesis was usually performed with
1-5 mM hydroxyurea for 30 to 60 minutes. The drug was always
prepared fresh in IX spinner salts (Gibco) as a 100 mM stock
solution.


131
We present evidence here to support a model for
multiple sites of attachment of eukaryotic mRNA to the
cytoskeleton. Using cytochalasin D for the disruption of
microfilaments, we have observed a differential release of
specific mRNAs from the cytoskeleton. Further
characterization of the association of mRNA with the
cytoskeleton revealed an additional attachment site that is
insensitive to cytochalasin D treatment and present only in
membrane-bound polysomal mRNAs. This second attachment site
is puromycin sensitive and appears to involve the
association of the nascent polypeptide and/or ribosome with
the remnant protein structure of the endoplasmic reticulum.
Results
Cytochalasin D Releases Polv A~ RNA from the Cytoskeleton
Disruption of actin fibers by cytochalasin D treatment
results in the release of cytoplasmic poly A+ RNA from the
cytoskeleton in a dose dependent manner (Ornelles et al..
1986). To further understand the association of eukaryotic
mRNAs with the cytoskeleton, we have studied the effects of
cytochalasin D treatment on the release of specific mRNAs,
including those that are non-polyadenylated. In addition we
have examined and compared the cytoskeletal association of
nonmembrane-bound and membrane-bound polysomal mRNAs.
Cell cycle dependent histone genes code for mRNAs that
are capped, non-polyadenylated and predominantly associated


215
Schatz, G. and Butow, R. (1983) Cell 22, 316.
Scherrer, K., and Darnell, J. (1962) Biochem. Biophys. Res.
Comm. 2/ 486.
Schliwa, M. (1982) J. Cell Biol. 92, 79.
Schmidt, W., Pardue, R., Tutt, M., Briggs, R., Brinkley, B.,
and Hnilica, L. (1982) Proc. Natl. Acad. Sci. U.S.A. T9,
3138.
Selden, L., Gershman, L., and Estes, J. (1980) Bioch.
Biophys. Res. Commun. 95, 1854.
Shiels, A., Marashi, F., Stein, J., and Stein, G. (1985)
Biochem. Biophys. Res. Comm. 127, 239.
Sierra, F., Lichtler, A., Marashi, F., Rickies, R., Van
Dyke, T., Clask, S., Wells, J., Stein, J., and Stein, G.
(1982) Proc. Natl. Acad. Sci. U.S.A. T9, 1795.
Simon, K., Perara, E., and Lingappa, V. (1987) J. Cell Biol.
104. 1165.
Sittman, D., Graves, R., and Marzluff, W. (1983) Proc. Natl.
Acad. Sci. U.S.A. 80, 1849.
Sive, H., Heintz, N., and Roeder, R. (1984) Mol. Cell. Biol.
4, 2723.
Sloboda, R., Dentler, W., and Rosenbaum, J. (1976)
Biochemistry .15, 4497.
Sood, A., Pereira, D., and Weissman, S. (1981) Proc. Natl.
Acad. Sci. U.S.A. 78, 616.
Southern, P., and Berg, P. (1982) J. Mol. Appl. Gen. 1, 327.
Spaulding, J., Kajiwara, K*, and Mueller, G. (1966) Proc.
Natl. Acad. Sci. U.S.A. 56, 1535.
Stahl, H., and Gallwitz, D. (1977) Eur. J. Biochem. 72, 385.
Stauber, C., Luscher, B., Eckner, R., Lotscher, E., and
Shumperli, D. (1986) EMBO J. 5, 3297.
Stein, G., and Borun, T. (1972) J. Cell Biol. 52, 292.
Stein, G., and Stein, J. (1984) Mol. Cell. Biochem. 64, 105*
Stein, J., Stein, G., and McGuire, P. (1977) Biochemistry
16, 2207.


Figure 4-9. Effects of hydroxyurea treatment on SPH3Elalpha
mRNA.
HeLa cell monolayers were transfected with pSPH3Elalpha
DNA and 46 hours post-transfection were treated with 1 mM
hydroxyurea (HU). Cells were harvested at 20 minute
intervals and total cellular RNA was prepared. The RNA (10
/Ltg) was subjected to SI nuclease protection analysis to
quantitate the levels of the SPH3Elalpha mRNA and endogenous
H3 histone fusion mRNA. Each lane represents an individually
transfected cell culture. MW is radiolabeled Hpa II digest
of pBR322 DNA. Lanes 1 and 2, control; lanes 3 and 4, 1 mM
HU 20 minutes; lanes 5 and 6, 1 mM Hu 40 minutes; lanes 7
and 8, 1 mM HU 60 minutes.


52
lxlO6 cpm/ml of each thermally denatured, j2P-radiolabeled
DNA probe. After hybridization, the filters were washed with
5x SSC, lx Denhardt's (0.5-1 ml/cm2 filter) for 10-15
minutes at room temperature to remove unbound probe. The
filters were then washed, in order, with the following
solutions (0.5 ml/cm2 filter area): 1) 5x SSC, lx
Denhardt's; 2) 2x SSC, 0.1% SDS; 3) lx SSC, 0.1% SDS; and 4)
O.lx SSC, 0.1% SDS at 60-65C for 30 minutes per wash.
After washing the filters were briefly air dried and then
exposed to preflashed Kodak XAR5 x-ray film at -70C with a
Cronex Lightning Plus intensifying screen (Dupont) for
varying lengths of time. Hybridization was quantitated by
scanning laser densitometric analysis of multiple exposures
of autoradiographs that were within the linear range of the
film.
SI Nuclease Protection Analysis
SI nuclease protection analysis was performed
essentially as described by Berk and Sharp (1977) and was
used in the work presented here to detect simultaneously
both endogenous H3 histone mRNA and signal peptide-histone
fusion mRNA in the same RNA sample. The SI probe was
prepared by digesting 30 ng pSPH3El, pSPH3Elalpha, or
pSPH3ElATG DNA with 3 0 units of Smal at 3 0C for 3 hours.
The 450 bp Smal fragment was isolated from a 0.8% agarose
minigel by the freeze-squeeze method. The solution


Figure 7-2. Densitometric anlavsis of steady state levels of
c-fos mRNA during cytochalasin D and puromvcin treatments.
Steady state levels of c-fos mRNA during cytochalasin D
and puromycin treatments were determined by densitometric
analysis of the Northern filters. The values presented
represent the average of the minimal fold increase in c-fos
mRNA levels during the drug treatments as compared to the
control sample. Brackets indicate standard error from three
independent experiments.


205
In summary, the work presented in this dissertation is
consistent with the hypothesis that subcellular compartments
and cell structure play an important role in the regulation
of gene expression. The influence of mRNA subcellular
location on the posttranscriptional control of histone gene
expression and possibly c-fos gene expression, indicates
that regulatory factors may be concentrated and sequestered
in specific regions or by specific structures. The
differential association of mRNA with the cytoskeleton may
be a mechanism for localization of mRNA in a particular
region of the cell, which in turn may affect the
posttranscriptional regulatory process. Lastly, the effect
of disrupting the microfilaments with cytochalasin D on c-
fos gene and beta-actin gene expression suggests that the
nucleus can transcriptionally respond in a selective manner
to the structural organization of the cytoskeleton.


THE ROLE OF SUBCELLULAR COMPARTMENTS AND STRUCTURES
IN EUKARYOTIC GENE EXPRESSION
By
GERARD PAUL ZAMBETTI
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1989


159
RNA in this sample compared with the control cytoskeleton
sample (Figure 6-1, lane 1 compared to lane 7). The
inability of CD and puromycin to release SPH3E1 chimeric
mRNA efficiently from the cytoskeleton is not unique to the
monoclonal cell line and is also observed in a polyclonal
cell population (Figure 6-2, Table 6-1). In this case, 62%
of the endogenous H3 histone mRNA and less than 5% of the
SPH3E1 mRNA is released from the cytoskeleton during
cytochalasin D treatment. In CD and puromycin co-treated
polyclonal cell cultures approximately 27% of the endogenous
histone mRNA and 62% of the SPH3E1 mRNA remain associated
with the cytoskeleton.
To investigate whether the failure to release the
signal peptide-histone mRNA from the cytoskeleton with
cytochalasin D and puromycin was related to the efficiency
of the drug treatments, we studied the association of
endogenous membrane-bound polysomal mRNAs with the
cytoskeleton. The mRNAs coding for HLA-B7, a class I cell
surface histocompatibility antigen and chorionic
gonadotropin alpha (hCGa), a secreted protein, are
translated on membrane-bound polysomes and well represented
in HeLa cells. The distribution of HLA-B7 and hCGa mRNA in
the cytoskeleton and soluble samples used in Figure 6-1 was
determined by Northern blot analysis (Figure 6-3 and Table
6-1). As expected for membrane-bound polysomal mRNAs, HLA-B7
and hCGa mRNAs were not released by cytochalasin D treatment


LIST OF TABLES
Table Page
3-1 Quantity of histone and HLA-B7 mRNAs in the
subcellular fractions 82
4-1 Quntitation of SPH3E1, SPH3Elalpha and SPH3E1ATG"
mRNA in nonmembrane-bound and membrane-bound
polysome fractions 116
5-1 The percent of cytoskeleton and soluble phase
associated mRNAs in cells treated with
cytochalasin D 13 6
5-2 Percent distribution of nonmembrane-bound and
membrane bound polysomal RNAs in the Csk and Sol
fractions from CD, Puro, CD/puromycin and
CD/cycloheximide treated cells 141
6-1 The percent of cytoskeleton associated mRNAs
isolated from cytochalasin D, puromycin and
CD/puromycin treated cells 158
ix


209
Engel, J. Sugarman, B., and Dodgson, J. (1982) Nature 297,
434.
Fanner, S., Wan, K., Ben-Ze'ev, A., and Penman, S. (1983)
Mol. Cell. Biol. 3, 182.
Fiddes, J., and Goodman, H. (1979) Nature 281. 351.
Franke, W., Schmid, E., Osborn, M., and Weber, K. (1979) J.
Cell Biol. 81, 570.
Franke, W., Schiller, D., Moll, R., Winter, S., Schmid, E.,
Engelbrecht, I., Denk, H., Krepler, R., and Platzer, B.
(1981) J. Mol. Biol. 153/ 933.
Fuchs, E., and Marchuk, D. (1983) Proc. Natl. Acad. Sci.
U.S.A. 80, 4321.
Fulton, A., Wan, K., and Penman, S. (1980) Cell 20, 849.
Gallwitz, D. (1975) Nature 257, 247.
Gallwitz, D., and Mueller, G. (1969) J. Biol. Chem. 244.
5947,
Gallwitz, D., and Briendl, M. (1972) Biochem. Biophys. Res.
Commun. 42, 1106.
Garrels, J., and Gibson, W. (1976) Cell 9, 793.
Gilmore, R., Blobel, G., and Walter, P. (1982a) J. Cell
Biol. 95, 463.
Gilmore, R., Walter, P., and Blobel, G. (1982b) J. Cell
Biol. 95, 470.
Glass, W., Briggs, R., and Hnilica, L. (1981) Science 211.
70.
Goldman, R., and Knipe, D. (1973) Cold Spring Harb. Symp.
Quant. Biol. 37., 523.
Goldman, J., Schaumberg, H., and Norton, W. (1978) J. Cell
Biol. 78, 426.
Gorman, C., Moffat, L., and Howard, B. (1982) Mol. Cell.
Biol. 2, 1044.
Graham, F., and van der Eb, A. (1973) Virology 52, 456.
Graves, R., and Marzluff, W. (1984) Mol. Cell. Biol. 4, 351.


69
briefly dried under a heat lamp and placed against pre
flashed XAR5 x-ray film without a screen for 1 hour at room
temperature. Under such low stringency each phage spot was
positive, including the negative control M13/SPH3 wild type
bacteriophage. The filter was re-washed at 35C in 6x SSC
for 5 minutes, air dried and exposed to pre-flashed XAR5
film for 1 hour. At the higher wash temperature many of the
phage spots were less intense whereas several remained
unchanged. When the filter was washed at 48C in 6x SSC for
5 minutes the negative control and nearly all the phage
spots completely disappeared. The bacteriophage (-5%) that
remained positive after the 48C wash were sequenced to
confirm the presence of the mutations.
DNA Sequencing
The site directed mutations in M13/SPH3 recombinant
DNAs were confirmed by Sanger's dideoxynucleotide chain
terminator DNA sequencing procedure using the "Sequenase
DNA Sequencing Kit" from United States Biochemical
Corporation, Cleveland, Ohio. The Sequenase enzyme is
derived from bacteriophage T7 DNA polymerase and has been
modified to efficiently use dideoxyribonucleotides, alpha-
thio deoxyribonucleotides and other nucleotide analogs that
are commonly used for sequencing. In addition, the Sequenase
enzyme expresses high processivity and low 3'-5' exonuclease
activity.


201
The release of histone mRNA from the cytoskeleton by
cytochalasin D treatment presented the opportunity to study
the role of the cytoskeleton in the posttranscriptional
regulation of histone gene expression. Histone mRNA was
released into the soluble phase with moderate amounts of
cytochalasin D [10 ug/ml], since higher levels of CD
significantly inhibit protein synthesis. The cells were then
treated with hydroxyurea to inhibit DNA replication. These
treatments resulted in the destabilization of histone mRNA
in the soluble fraction to the same extent and with the same
kinetics as the destabilization of histone mRNA in the
cytoskeleton fraction. One interpretation of this result is
that the cytoskeleton is not required for histone mRNA
destabilization during inhibition of DNA synthesis. In
addition, Ornelles et al. (1986) reported that CD treatment
of HeLa cells releases poly-A+ RNA from the cytoskeleton
into the soluble phase in monosome or mRNP form, which
suggests that histone mRNA in the soluble phase does not
need to be translated to be destabilized during inhibition
of DNA synthesis. This result is in contrast to the genetic
studies that indicate histone mRNA must be translated to
within close proximity of the translation stop codon for
destabilization to occur (Graves et al., 1987? Capasso et
al.. 1987). The release of histone mRNA into the soluble
phase as a monosome or mRNP during cytochalasin D treatment
has not yet been determined and additional studies will be


210
Graves, R., Pandey, N., Chodchoy, N., and Marzluff, W.
(1987) Cell 48, 615.
Green, L., Stein, G., and Stein, J. (1984a) Mol. Cell.
Biochem. .60, 123.
Green, L., van Antwerpen, R., Stein, J., and Stein, G.
(1984b) Science 226, 838.
Greenberg, M., and Ziff, E. (1984) Nature 311. 433.
Greenberg, M., Hermanowski, A., and Ziff, E. (1986) Mol.
Cell. Biol. 6, 1050.
Grossi de Sa, M.-F., Martins de Sa, C., Harper, F., Link-
Coux, M., Huesca, M., and Scherrer, K. (1988) J. Cell Biol.
107. 1517.
Gunning, P., Ponte, P., Okayama, H., Engel, J., Blau, H.,
and Kedes, L. (1983) Mol. Cell. Biol. 3, 787.
Hartwig, J., and Stossel, T. (1975) J. Biol. Chem. 250.
5696.
Harvey, R., Whiting, J., Coles, L., Krieg, P., and Wells, J.
(1983) Proc. Natl. Acad. Sci. U.S.A. 80/ 2819.
Hayden, J., and Allen, R. (1984) J. Cell Biol. 99, 1785.
Heintz, N., Zernik, M. and Roeder, R. (1981) Cell 24., 661.
Heintz, N., Sive, H., and Roeder, R. (1983) Mol. Cell. Biol.
3, 539.
Helms, S., Baumbach, L., Stein, G., and Stein, J. (1984)
FEBS Letters 168/ 65.
Hentschel, C., and Birnstiel, M. (1981) Cell 25, 301.
Hoffman, P., and Lasek, R. (1975) J. Cell Biol. 66, 351.
Holltrop, M., Raisz, L., and Simmons, H. (1974) J. Cell
Biol. 60, 346.
Hortin, G., and Boime, I. (1981) Cell 24, 453.
Howe, J., and Hershey, J. (1984) Cell 37, 85.
Hubbard, B., and Lazarides, E. (1979) J. Cell Biol. 80, 166.
Huberman, E., and Callahan, M. (1979) Proc. Natl. Acad. Sci.
USA 76, 1293.


LIST OF FIGURES
Figure Page
2-1 Outline of the cloning scheme for the construction of
the signal peptide-histone fusion gene 34
2-2 Outline of procedure for the isolation of subcellular
polysomal fractions 45
3-1 Northern blot analysis of H3 histone, H4 histone and
HLA-B7 mRNA in subcellular fractions 81
3-2 Two-dimensional gel electrophoresis of cytoskeleton
and soluble associated proteins 85
3-3 Northern blot analysis of H3 histone, H4 histone and
HLA-B7 mRNAs isolated from subcellular fractions of
cells treated with metabolic inhibitors 89
3-4 Northern blot analysis of H3 histone, H4 histone and
HLA-B7 mRNAs associated with the cytoskeleton and
soluble fractions from HeLa cells treated with
metabolic inhibitors 92
4-1 Schematic diagram of endogenous H3 histone mRNA ST519
and the beta-lactamase signal peptide-H3 histone
fusion mRNA 100
4-2 Expression of the signal peptide-histone fusion gene
in HeLa cells 103
4-3 The subcellular localization of the signal peptide-
histone fusion mRNA 106
4-4 The stability of the signal peptide-histone fusion
mRNA following inhibition of DNA synthesis 109
4-5 Schematic diagram of wild type and mutated signal
peptide-histone fusion mRNAs 112
4-6 Distribution of SPH3E1, SPH3Elalpha, and SPH3E1ATG*
mRNAs in nonmembrane-bound and membrane-bound
polysomal fractions 115
4-7 Effects of hydroxyurea treatment on SPH3E1 mRNA 119
vi


140


55
samples were denatured by heating at 100C for 2 minutes and
then quickly chilled at 0C to prevent reannealing prior to
loading onto the gel. Six percent polyacrylamide-8.3 M urea
(cross linked at 20:1 acrylamide:bis-acrylamide) gels with
dimensions of either 16 cm x 18 cm x 1.5 mm (1.5 mm x 6 mm
15 well comb or 1.5 mm x 4 mm 20 well comb) or 32.5 cm x 44
cm (0.5 mm x 8 mm 25 well comb) were prepared and pre-
electrophoresed for 30 minutes. The samples were loaded with
drawn-out capillary tubes or a Rainin Pipetteman (0-20 ul
capacity) using flat pipette tips. The large gels were
electrophoresed at 50 watts constant power (-1200 V, -45 A)
for 3-4 hours and the small gels were electrophoresed at 300
V (25-35 A) for 2-3 hours. The gels were placed on 2 sheets
of 3 MM Whatman paper, dried under vacuum at 80C for 1-2
hours and exposed to pre-flashed XAR5 x-ray film with a
Cronex Lightning Plus intensifying screen at -70C for
varying lengths of time. SI analysis was quantitated by
scanning laser densitometry of multiple autoradiographic
exposures that were within the linear range of the film.
In Vitro Nuclear Run-On Transcription Analysis
The in vitro nuclear run-on transcription assays were
performed by Anna Ramsey-Ewing as described by Baumbach et
al. (1987). Cells were harvested by centrifugation and the
cell pellet washed twice in cold isotonic buffer (125 mM
KC1, 30 mM Tris-HCl pH 7.9, 5 mM MgCl2, 10 mM beta-


Figure 6-2. The wild type signal peptide-histone fusion mRNA
is not released from the cytoskeleton in CD and puromvcin
co-treated polyclonal HeLa cell cultures.
Polyclonal cell cultures expressing the SPH3E1 fusion
gene were treated with cytochalasin D and puromycin for 20
minutes. Cytoskeleton and soluble RNAs were isolated and
subjected to SI nuclease protection analysis as described in
Chapter 2. Lane 1, control-csk? lane 2, control-sol; lane 3,
CD [10 Mg/ml]-csk; lane 4, CD [10 /g/ml]-sol; lane 5, CD [30
Mg/ml]-csk; lane 6, CD [30 /ig/ml ]-sol; lane 7, CD [10 /jg/ml]
and puro [0.4 mM]-csk; and lane 8, CD [10 jug/ml] and puro
[0.4 mM]-sol. MW is radiolabeled Hpa II digest of pBR322.


Figure 4-2. Expression of the signal peptide-histone fusion
gene in HeLa cells.
The expression of the signal peptide-histone fusion
gene was tested in a short term transient assay and analyzed
by an SI nuclease protection assay. HeLa cell monolayers
were transfected with 20 fiq DNA according to Gorman et al.
(1982), in a calcium phosphate/DNA complex prepared as
described by Graham and van der Eb (1973). The transfected
cells were incubated at 37C/ 5% C02 for 46 hours following
transfection. The cells were then harvested, total cellular
RNA was isolated and analyzed by SI nuclease protection
assay (200 RNA per sample) as described in Chapter 2.
Lanes 1 and 2, HeLa cells transfected with salmon sperm DNA?
lanes 3 and 4, HeLa cells transfected with pSPH3El DNA; and
lanes 5 and 6, HeLa cells transfected with pSPH3E2 DNA.
Marker lanes (M) are radiolabeled Hinfl digests of pBR322
DNA. Each lane represents RNA isolated from an independently
transfected cell culture.


7.0
T
5.2
T
4.1
T
85
PH
6.4
1
43 K~
SOL
CSK


194
of the nuclear matrix must explain the selective activation
of c-fos and actin genes and therefore does not appear
likely. In contrast, stimulation of c-fos gene expression by
cytochalasin D may be a result of the alterations in the
cytoskeleton due to the disruption of the microfilaments.
Analogous to the work presented here, it has recently been
reported that the disruption of the microtubules with
colchicine, nocodazole, or vinblastine induces the
transcription of chloramphenicol acetyl transferase genes
containing promoter elements from the human c-fos or beta-
actin gene (Ng, 1989). Interestingly, sequence analysis
indicates that actin and c-fos genes contain similar
transcription consensus sequences, referred to as serum
response elements, located in their promoter regions (Mohun
and Garret, 1987). The coordinate induction of c-fos and
actin transcription during cytochalasin D or colchicine
treatment may be mediated by the interaction of the same or
similar trans acting factor(s) with the serum response
element.
Several reports have postulated that the cytoskeleton
is involved in signal transduction (Rothstein, 1985;
Rebillard et al. 1987; Blum and Wicha, 1988). For example,
Rebillard and co-workers (1987) reported that the
stimulation of quiescent Swiss 3T3 cells with epidermal
growth factor (EGF) and insulin results in the rapid
accumulation of c-fos mRNA. The increase in c-fos gene


190
Discussion
Previous results suggest that the organization of the
cytoskeleton may influence gene expression and ultimately
cell growth and differentiation. We present evidence here
supporting the role of the cytoskeleton in regulating gene
expression. Specifically, disruption of the microfilaments
with cytochalasin D results in a rapid and dramatic
accumulation of c-fos mRNA. The induction of c-fos gene
expression during cytochalasin D treatment is accompanied by
an increase in transcription of the c-fos gene as directly
determined by in vitro nuclear run on analysis.
The effect of cytochalasin D treatment on transcription
is not limited to the c-fos gene. Consistent with previous
results actin transcription was also elevated in
cytochalasin D treated cells (Tannenbaum and Godman, 1983).
However, the stimulation of transcription of the c-fos and
actin genes was not a consequence of increased transcription
in general. RNA polymerase II transcription of several
genes, such as histone H4 (cell cycle dependent), histone
H2B (cell cycle independent), and HLA-B7 histocompatability
antigen, was unaffected in cells treated with cytochalasin
D. In addition, cytochalasin D had no effect on
transcription of the 18S ribosomal RNA genes by RNA
polymerase I or transcription of the beta-globin gene, a
transcriptionally inactive gene in HeLa cells.


49
Northern Blot Analysis
Agarose-Formaldehyde RNA Denaturing Gel Electrophoresis
RNA samples were resolved electrophoretically in 1.5%
agarose-6% (w/v) formaldehyde horizontal slab gels and
running buffer (20 mM MOPS (morpholinepropane-sulfonic acid)
pH 7.0", 5 mM sodium acetate, 1 mM EDTA, 3.7% (w/v)
formaldehyde) as described by Rave et al. (1979). Routinely
10 nq RNA per sample were dried in a Savant Speed Vac
concentrator and resuspended in 3.2 ul double distilled
water (ddH20) 5 ul formamide, 1 ul lOx MOPS (200 mM MOPS pH
7.0, 50 mM sodium acetate, 10 mM EDTA), 0.8 ul 37% (w/v)
formaldehyde and 2 ul sample buffer (0.5 ml formamide, 0.1
ml lOx MOPS, 80 ul 37% (w/v) formaldehyde and 0.32 ml 0.2%
bromophenol blue-90% glycerol). The samples were then heated
at 60C for 10 minutes, quick chilled to 0C and loaded onto
the gels. The 1.5% agarose-6% formaldehyde gels were
prepared by melting 3 g electrophoresis grade agarose in 144
ml ddH20 plus 20 ml lOx MOPS buffer in a microwave oven
(Whirlpool) at full power for 3-4 minutes. The agarose
solution was cooled to approximately 65C (warm to the
touch) while stirring and then adjusted to 6% formaldehyde
with 36 ml 37% (w/v) formaldehyde. For minigels, 35 ml
agarose-formaldehyde solution was cast in a plexiglass gel
tray (10 cm x 6.3 cm) with an 8 well comb (1 mm x 5 mm per
well). The gel was electrophoresed at 40-45 milliamps until
the bromophenol blue migrated 9 cm (approximately 1.5


104
transcribed from this gene is sufficiently stable to be
detected in a short-term transient transfection assay.
To determine the class of polysomes with which the
signal peptide-histone fusion mRNAs are associated, HeLa
cells were transfected with pSPH3El and 46 hours later
nonmembrane-bound and membrane-bound polysomes were isolated
as described in Chapter 2. RNA was isolated from both
classes of polysomes and analyzed by SI nuclease protection
assay using the Smal fragment of the signal peptide-histone
fusion gene (32P-5 1-labeled) As seen in Figure 4-3,
approximately 30% of the signal peptide-histone fusion mRNA
was found in the nonmembrane-bound polysome fraction and
approximately 70% was associated with the membrane-bound
polysomes (lanes 1 and 2 respectively). This is in contrast
to endogenous H3 histone mRNA which is represented by
approximately 90% in the nonmembrane-bound polysome and 10%
in the membrane-bound polysome fraction. The percent
distribution of the histone chimeric mRNA within the
polysomal RNA fractions was determined by densitometric
analysis of the autoradiograms and the values corrected for
the total yield of RNA in each subcellular fraction. While
the extent to which the signal peptide-histone fusion mRNA
is represented on the membrane-bound polysomes varied from
experiment to experiment, we always observed 60-90% of the
fusion mRNA in the membrane-bound polysome fraction (n=6).


142
membrane of the endoplasmic reticulum. In addition, the
nascent polypeptide is complexed with the proteins involved
in the translocation of the exported protein from the
cytoplasm into the lumen of the endoplasmic reticulum.
During the isolation of the cytoskeleton nearly all the
lipid components but not the protein substructure of the
endoplasmic reticulum membrane are removed by detergent
extraction (Lenk et al.. 1977). The cytoskeleton attachment
site associated with membrane-bound polysomes, which is
insensitive to cytochalasin D, may be the nascent
polypeptide complexed with the remnant protein structure of
the endoplasmic reticulum.
To test the possibility that the nascent polypeptide
serves as an additional anchor for the attachment of mRNA to
the cytoskeleton, we co-treated HeLa cells with cytochalasin
D and puromycin. Puromycin inhibits protein synthesis by
interrupting polypeptide chain formation which results in
the release of the nascent polypeptide and ribosoraal
subunits from the mRNA. The distribution of membrane-bound
and nonmembrane-bound polysomal RNA within the cytoskeleton
and soluble fractions was then determined by Northern blot
analysis.
As seen in Figure 5-3, treatment of HeLa cells with
cytochalasin D and puromycin released membrane-bound
polysomal raRNAs from the cytoskeleton (lanes 7 and 8).
Approximately 25% of HLA-B7 mRNA and 20% of hCGa mRNA


Table 4-1. Quantitation of SPH3E1, SPH3Elalpha and
SPH3E1ATG" inRNA in nonmembrane-bound and membrane-bound
polysome fractions.
116
Nonmembrane-bound Membrane-bound
SPH3E1 mRNA
32%
68%
SPH3Elalpha mRNA
60%
40%
SPH3E1ATG' mRNA
82%
18%
Endogenous H3 mRNA
83%
17%
The distribution of SPH3E1, SPH3Elalpha, SPH3E1ATG-,
and endogenous H3 histone mRNAs in nonmembrane-bound and
membrane-bound polysome fractions was quantitated by
densitometric analysis of the SI nuclease protection assay
presented in Figure 4-6. The densitometric values obtained
represent the quantity of mRNA in 5 g RNA. The values were
then adjusted to reflect the total yield of RNA recovered in
each fraction.


97
membrane-bound polysomes. The ability of the cell to
selectively recognize and destabilize histone mRNA in a
foreign subcellular compartment could then be examined.
Based on the data presented here, we propose that the
subcellular location of histone mRNA, with respect to the
class of polysomes in which they are associated with, plays
a significant role in the coupling of histone mRNA stability
with DNA replication.
Results
The construction of the signal peptide-histone fusion
gene is described in Chapter 2 and outlined in Figure 2-1.
The upstream flanking region of the chimeric gene contains
210 base pairs of the 5' regulatory sequences of the cell
cycle-dependent human H3 histone gene pST519 including the
TATAA and CCAAT consensus sequences. This region is followed
by the H3 mRNA cap site and sequences encoding the initial
20 nucleotides of the non-translated H3 histone leader. The
fusion gene is, therefore, under transcriptional control of
the H3 histone gene promoter, and a segment of the H3 leader
which has been implicated in the coupling of histone mRNA
levels to DNA synthesis is present (Morris et al.. 1986).
The H3 histone leader segment is fused to the untranslated
leader sequences of the beta-lactamase signal peptide
including the ATG translation start codon. The H3 histone
structural gene is fused in frame to the signal peptide


212
Lin, D. Tobin, K., Grumet, M., and Lin, S. (1980) J. Cell
Biol. 84., 455.
Lingappa, V., Chaidez, J., Yost, C., and Hedgpeth, J. (1984)
Proc. Natl. Acad. Sci. U.S.A. 81, 456.
Luscher, B., Stauber, C., Schindler, R., and Schumperli, D.
(1985) Proc. Natl. Acad. Sci. U.S.A. 82, 4389.
Maniatis T., Fritsch, E., and Sambrook, J. (1982a) in
Molecular Cloning. (Cold Spring Harbor, New York) pp 86-90.
Maniatis T., Fritsch, E., and Sambrook, J. (1982b) in
Molecular Cloning. (Cold Spring Harbor, New York) pp 109-
112.
Marashi, F., Helms, S., Shiels, A., Silverstein, S.,
Greenspan, D., Stein, G., and Stein, J. (1986) Can. J.
Bioch. Cell Biol. 64, 277.
Marzluff, W., and Huang, R. (1985) in Transcription and
Translation. Hames, B. and Higgins, S. Eds. (IRL Press,
Oxford) pp 89-129.
Maurer, R., and Mckean, D. (1978) J. Biol. Chem. 253. 6315.
Meyer, D. Krause, E., and Dobberstein, B. (1982a) Nature
297. 647.
Meyer, R. Louvard, D., and Dobberstein, B. (1982b) J. Cell
Biol. 92, 579.
Milcarek, C., and Penman, S. (1974) J. Mol. Biol. 89, 327.
Milsted, A., Silver, B., Cox, R., and Nilson, J. (1985)
Endocrinology 117. 2033.
Miranda, A., Godman, G., Deitch, A., and Tannenbaum, S.
(1974a) J. Cell Biol. 61, 481.
Miranda, A., Godman, G., and Tannenbaum, S. (1974b) J. Cell
Biol. 62, 406.
Mitchell, R., Zokas, L., Schreiber, R., and Verma, I. (1985)
Cell 40, 209.
Mohun, T., and Garret, N. (1987) Develop. 101. 393.
Moll, R., Franke, W., Schiller, D., Geiger, B., and Krepler,
R. (1982) Cell 21, 11.


5
in conjunction with the decrease in proliferative activity
(Bird et al.. 1985; Challoner et al.. 1989; Stein et al..
1989) .
The expression of histone genes during the cell cycle
is regulated at both the transcriptional and
posttrnscriptional levels. Analysis by hybrid selection of
RNA radiolabeled in synchronized HeLa cells demonstrates a
burst of 3- to 5- fold in transcription of the histone genes
within the first two hours of S phase, followed by a
reduction to a basal level that remains constant until the
following S phase (Plumb et al.. 1983a). Similar results
were obtained when histone gene transcription during the
cell cycle was measured by nuclear run-on analysis (Sive et
al.. 1984; Baumbach et al.. 1987). Steady state levels of
histone mRNA, however, were elevated 15-20 fold during S
phase and closely paralleled the rates of DNA synthesis
(Plumb et al.. 1983a; Heintz et al.. 1983; Baumbach et al..
1984) Maximal accumulation of histone mRNA occurred at 5
hours into S phase and returned to a basal level as DNA
synthesis ended. The timing and extent of the increase in
histone transcription can not account for the marked
increase in histone mRNA steady state levels and must be a
consequence of a posttranscriptional control mechanism.
Posttranscriptional regulation of histone gene expression is
further supported by DNA synthesis inhibitor studies. The
estimated half life of histone mRNA in exponentially growing


Figure 4-6. Distribution of SPH3E1. SPH3Elalpha. and
SPH3E1ATG mRNAs in nonmembrane-bound and membrane-bound
polvsomal fractions.
HeLa cell monolayers were transfected with the signal
peptide-histone fusion genes by the calcium phosphate
precipitation method and 46 hours posttransfection
nonmembrane-bound and membrane-bound polysomes were
isolated. RNA (5 jug) from each subcellular fraction was
assayed for signal peptide-histone fusion mRNA and
endogenous H3 histone mRNA content by SI nuclease protection
analysis as described in Chapter 2. Abbreviations: SPH3E1,
wild type signal peptide-histone fusion mRNA; alpha,
hydrophobic mutant of SPH3E1; ATG, signal peptide
translation initiation codon mutant of SPH3E1. Lane 1,
nonmembrane-bound polysomal RNA; Lane 2, membrane-bound
polysomal RNA.


Figure 4-4. The stability of the signal peptide-histone
fusion mRNA following inhibition of DNA synthesis.
HeLa cell monolayers were transfected with pSPH3El DNA
and cultured as described in Chapter 2. Forty-six hours
after transfection, half of the transfected HeLa cell
cultures were treated with 1 mM hydroxyurea in completed
medium for 1 hour at 37C, 5% C02. Cell cultures were
harvested and nonmembrane-bound and membrane-bound polysomes
were isolated. Total cellular RNA from both the control and
hydroxyurea-treated samples was also isolated. The RNA was
analyzed by the SI nuclease protection assay as described in
Chapter 2, using 5 nq RNA per sample. The distribution of
mRNA species within the subcellular fractions was
quantitated by densitometric analysis of the autoradiograms.
Lanes: 1) control (untreated cells) nonmembrane-bound
polysomes; 2) control, membrane-bound polysomes; 3)
hydroxyurea, nonmembrane-bound polysomes; 4) hydroxyurea,
membrane-bound polysomes; 5) and 6) control, total cellular
RNA; and 7) and 8) hydroxyurea, total cellular RNA. Lanes 5-
8 represent RNA isolated from independently transfected cell
cultures.


86
mRNA was located almost exclusively in the cytoskeleton and
membrane-bound polysome fractions. The widespread
subcellular localization of histone mRNA may be due to non
specific trapping of nonmembrane-bound polysomes in each of
the fractions during the isolation procedure. Alternatively,
this observation may reflect the presence of mRNAs encoding
variant histone proteins that could be targeted to the
different cytoplasmic compartments. Inhibition of DNA
synthesis with hydroxyurea results in a rapid
destabilization of cell cycle dependent histone mRNAs,
whereas cell cycle independent histone mRNAs remain stable
in the presence of this drug (Baumbach et al.. 1984; Heintz
et al.. 1983; DeLisle et al.. 1983; Graves and Marzluff,
1984; Plumb et al.. 1983). Conversely, inhibition of protein
synthesis with cycloheximide results in a 2-3 fold increase
in cytoplasmic levels of histone mRNAs (Butler and Mueller,
1973; Baumbach et al.. 1984). Differential sensitivity of
histone mRNAs in the subcellular fractions to hydroxyurea or
cycloheximide treatment would favor the latter suggestion
that cell cycle dependent and independent histone gene
transcripts may selectively reside in specific cytoplasmic
compartments.
Treatment of exponentially growing HeLa cells with
hydroxyurea, as described in Chapter 2, resulted in a
complete and selective destabilization of histone mRNA in
the LER, nonmembrane-bound and membrane-bound polysomal


CHAPTER 8
SUMMARY AND FUTURE CONSIDERATIONS
Tre initial emphasis of the work presented in this
dissertation was focused on studying the posttranscriptional
regulation of histone gene expression. When this project was
undertaken little was known concerning the coupling of
histone mRNA stability to DNA replication. It was clear that
the destabilization of histone mRNA during inhibition of DNA
synthesis was selective and required ongoing protein
synthesis (Butler and Mueller, 1973; Gallwitz, 1975; Stahl
and Gallwitz, 1977; Stimac et al.. 1983; Baumbach et al..
1984; Helms et al.. 1984). In addition, it was known that
the kinetics of histone gene expression were extremely rapid
which is evident by the appearance of translatable histone
mRNAs on polysomes within minutes following transcription
(Borun et al.. 1967) and the equally rapid transfer of newly
synthesized histone protein into the nucleus (Spaulding et
al.. 1966; Robbins and Borun, 1967). At that time, several
research groups were providing evidence that suggested the
cell is organized in a highly ordered manner. Penman and co
workers, while studying the structural and functional
properties of the cytoskeleton, were developing the
196


100
CAP
I
ATG
TAA
5'
[
3'
pST 5 19
CAP
I
ATG
ir/L-
a;g
TAA
i
pSPH3E1


101
To test for expression of the signal peptide-histone
fusion gene in human cells, we transfected pSPH3El and
pSPH3E2 DNA into HeLa cell monolayers by the calcium
phosphate precipitation method as described in Chapter 2
(Gorman et al., 1982; Graham and van der Eb, 1973). Forty-
six hours post-transfection cells were harvested and total
cellular RNA was isolated. The RNA was subjected to SI
nuclease protection analysis by a modification of Berk and
Sharp (1978). The probe used in the SI nuclease assays was
the Smal fragment from pSPH3El which was radiolabeled at its
5' termini as described in Chapter 2. The probe is
complimentary to endogenous HeLa histone H3 mRNA from the 5*
end-labeled Smal site within the protein coding region to
the signal peptide-histone fusion junction and therefore
protects a 130 nucleotide region of the H3 mRNA from SI
nuclease digestion. As seen in Figure 4-2, when total
cellular RNA from two independent transfections of HeLa
cells with pSPH3El or pSPH3E2 DNA was analyzed by SI
nuclease digestion, a 130 nucleotide fragment corresponding
to endogenous H3 histone mRNA was protected as well as an
approximately 280 nucleotide fragment corresponding to the
signal peptide-histone fusion mRNA species (lanes 3-6). In
HeLa cells transfected with salmon sperm DNA, only the 130
nucleotide fragment was detected (lanes 1 and 2). These data
demonstrate that the signal peptide-histone fusion gene is
capable of expression in HeLa cells and that the mRNA