Citation
The Structure and function of cytochrome P450 in the hepatopancreas of the Florida spiny lobster Panulirus argus

Material Information

Title:
The Structure and function of cytochrome P450 in the hepatopancreas of the Florida spiny lobster Panulirus argus
Creator:
Boyle, Sean Michael, 1966-
Publication Date:
Language:
English
Physical Description:
xxi, 106 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Amino acids ( jstor )
Antibodies ( jstor )
Complementary DNA ( jstor )
Cytochromes ( jstor )
Enzymes ( jstor )
Hepatopancreas ( jstor )
Lobsters ( jstor )
Microsomes ( jstor )
Rats ( jstor )
Yeasts ( jstor )
Cytochrome P-450 Enzyme System -- analysis ( mesh )
Cytochrome P-450 Enzyme System -- chemistry ( mesh )
Cytochrome P-450 Enzyme System -- physiology ( mesh )
Liver ( mesh )
Lobsters ( mesh )
Pancreas ( mesh )
Structure-Activity Relationship ( mesh )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1997.
Bibliography:
Includes bibliographical references (leaves 93-104).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Sean Michael Boyle.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
48927452 ( OCLC )
ocm48927452
002284512 ( ALEPH )

Downloads

This item has the following downloads:


Full Text











THE STRUCTURE AND FUNCTION OF CYTOCHROME P450 IN THE
HEPATOPANCREAS OF THE FLORIDA SPINY LOBSTER, PANULIRUS ARGUS

















By


SEAN MICHAEL BOYLE


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY



UNIVERSITY OF FLORIDA


1997









This dissertation is dedicated to the memory of



Bridgette Bernadette Phillips














ACKNOWLEDGMENTS


Many people have rendered support to me over the years.

This section may prove to be a bit extensive.

I would like to first acknowledge my father, John Jude

Boyle. He has a master's degree in sociology, a degree in

medicine and was a Jesuit deacon. His analytical disposition

and extremely strong dedication to medicine served as a

constant example of qualities to be sought.

My mother, Donna Deloris Boyle, taught me lessons not

so analytical in nature. She demonstrated time and time

again that logic usually fails when applied to everyday

life, and that love and compassion are the tools of

existence. She is now in charge of a Hospice division in the

mountains of Georgia. Somewhat fitting for her, I think.

My siblings also helped shape and guided me through the

years. As children, my two older sisters, Michelle Davina

and Melissa Renee, would play a game in which they were

school teachers and my brother, Christopher David, and I,

were the students. When the two sisters tired of the game, I

would assume the role of teacher and subject my poor brother

to hours more of schooling. I now have two younger sisters,

Kelly Ann and Katie Marie. My stepmother, Donna, has given

me plenty of moral support throughout.









The first professional teacher to instill within me a

desire for knowledge was at the time a high school geometry

teacher named Ronald Blatnick. His sense of humor coupled to

the proficiency he enjoyed in the subject was the first

example I had encountered which illustrated that learning

could indeed be fun and rewarding. It was Ron who taught me

how to play chess and encouraged me to begin programming

computers. Programming skills would later greatly shape my

scientific career.

Other teachers in high school were also exemplary. Mike

Beistle taught world history, English, and theater. His

classes were filled with compassion and impromptu

interpretation of various subjects. Mike Muschamp was the

principle and he taught American history. He was part judge

and part teacher, but always fair and just. His example of

how a person with integrity handles all forms of life's

adversities, coupled with his rather strong Georgian accent,

still serves as a role model for me.

While obtaining an undergraduate degree, I was taking a

general biology class. One day it was announced that a

professor needed a few students to help culture Bryozoans. I

had no clue what such a creature was, but I went to see the

professor anyway. I found Frank Maturo, Jr. I soon found

that the questions he was asking about these small, colonial

sessile invertebrates were fascinating. I also found that he

was called "Doc". I spent most of my first 2 years of

college in his lab. The single most important lesson he









taught me was that a carefully planned experiment could

answer a question one has, and that exotic solutions to such

questions are usually not desirable. As a brief example, he

was interested in the question of whether or not a certain

species of Bryozoan could self-fertilize. He showed me a

proposal a graduate student had written to address this

question. It contained many complex biochemical experiments.

I told him that I thought it was a really "cool" proposal.

He then asked if I could think of a better way. Well, I

could not. He then said, "Why not put a colony in a jar, and

see if more criters' show up".

One day I was on my way to visit "Doc" when I noticed a

person in the closet across from Doc's lab. I said hello to

him and asked him what he was doing in the closet. He told

me his name was Mike Miyamoto and he was a new faculty

member in the Department of Zoology. He told me the

university had promised him a big laboratory, but instead

gave him that closet. I welcomed him to the University of

Florida. Mike did eventually get his lab and I went to work

with him using my programming skills to help manage the

mitochondrial DNA he was analyzing. Mike taught me to be as

thorough as possible when analyzing or proofing data. He

also introduced me to molecular biology.

Jon Reiskind, also a professor in zoology, helped me to

realize that scientific research need not only be filled

with hard work and stress, but can be viewed as a type of

art. He worked with the speciation of wolf spiders. These









are beautiful animals with very strict geographical

boundaries. I have fond memories of collecting specimens at

night, spotting the spider's eyes with a head light.

While completing my undergraduate degree in zoology, I

attended a lecture given by John Schell at the Whitney

Marine Laboratory for Biomedical Research, or something to

that effect. The name of the Lab has changed many times and

is now just the Whitney Lab, after Mr. Whitney, the man who

donated the money for the lab to be built. Mr. Whitney has

passed away, but his wife visits every year during the

annual review process. When I sat listening to John, I did

not know that I would be spending the next 7 or 8 years at

the Whitney Lab.

John was lecturing on the metabolism of benzo-a-pyrene

in the Florida spiny lobster. He mentioned that the lobsters

did not get cancer. This caught my attention. I applied to

an undergraduate program at the Whitney lab and asked to

work in John Schell's lab. I was told he actually worked for

a one Margaret O. James. I looked up a couple of her papers,

there were many, and I was hooked, line and sinker. I was

working for Michael Corbett at the time, and he spoke very

highly of Margaret James. I remember the time he took

explaining what the "Respiratory Burst" was to a kid who

barely knew what "WBC" meant. So, I asked him to write a

letter of recommendation for me. I was accepted (in the off

season) into the undergraduate research training program at









the Whitney Lab. This delayed my graduation by a year, but

as it turned out, it was the right thing to do.

Arriving at the Whitney Lab, I expected to first meet

Margaret. But instead, I met John Pritchard. He is a very

tall, NIH scientist and immediately began explaining my

project to me. I was to isolate apical membranes from the

spiny lobster hepatopancreas. When he was done, he asked if

I had any questions. I think I replied, "Dr. Pritchard was

it?". But it was my lack of even basic cellular physiology

that allowed me to first meet Bill Carr and Mike Greenberg.

Both would come into the lab late at night and ask if I knew

what the "hell" I was doing. They were both very kind in

explaining osmosis, concentration gradients, passive and

nonpassive uptake mechanisms. Eventually, I met all the

faculty this way, and learned that each was approachable. I

owe them all a great deal.

I met Robin Wallace also. I would eventually work for

him over the course of one summer. I packed up my car and

moved to St. Petersberg in order to work on the snook

project. My car was stolen soon after. Dr. Wallace trained

me to "Score" follicles from fish. The fish he used as an

example was Fundulus heteroclitus. These are really nice

fish because they are very small, but have huge follicles.

This job was going to be easy. I was wrong. I was to work on

Centropomus undecimalis, a huge fish, with tiny, little

follicles. Robin Wallace has a breadth of knowledge that is

wide: from classical music (did you know that Vivaldi was









known as the "Red Monk" because he had red hair?) to

paintings (Robin paints and sells art work) to science

(Robin wrote the book on Vitellogenin, several I think).

During this time, I did meet Margaret. But I had

learned my lesson with John Pritchard. I was ready with pen

and paper at my first meeting with the "Boss". I still have

those first 5 pages of notes. It took me about a week just

to work through them and prepare some questions. The answers

to those questions raised more questions: a cycle that has

been going on for 8 years. To date, she has not run out of

answers. She has the uncanny ability to solve problems in

fields that are not her specialty. She has on more than one

occasion solved problems I was having in molecular biology,

often with limited information. She possesses an insight and

understanding about Science in general that, as far as I

have seen, very few scientist achieve. I feel privileged to

have been her student.

As for the other members on my committee, I know little

of them on a personal level. But each was chosen because of

the respect they command in their given fields. Ray Bergeron

and his group are well known to both the medical and

industrial fields. He is difficult to keep up with in a

conversation and giving seminars with him around strikes

fear in the heart of many a graduate student. But more often

than not, his questions gently lead the student into deeper

contemplation of a given subject.









I first became aware of Bill Buhi and his lab when I

heard of some studies he was doing with a faculty member in

zoology. The study dealt with a protein oviductt secretary

protein?) that he was trying to detect in alligators and

pigs. Several years later, our lab would look at P450s in

various species with an antibody that he and Idania Alverez

helped produce. I thank Idania for her help.

I first became acquainted with Kathleen Shiverick's

work via a journal article. Later, I was to take several

classes she taught. Of the many courses I have taken, her

courses stand out in my mind as being the most clearly

taught. I admit I was anxious to learn the material. I was

very happy when she agreed to be a member of my committee.

The final member of my committee is Rob Greenberg. He

and a then postdoc named Clay Smith have taught me most of

what I know about molecular biology. Interestingly, they are

nearly opposite in technique and approach to molecular

biology, in my mind. I have had the advantage to incorporate

both styles and feel fairly confident in my molecular

biology skills. I hope to one day reach the level of

understanding both men have in not only the narrow field of

molecular biology, but in Science in general.

Hank Trapido-Rosenthal, a post-doctoral fellow working

in Dr. Carr's lab, was the first to teach me molecular

biology at the Whitney Lab. Hank was very patient and I am

very much in his debt. And a special thank you to Dave

Price. He was the first person to point out that certain









lambda vectors have chiral maps. I was using the wrong

enatiomer for about six months before he, quite by chance,

asked me how my work was progressing. After a few minutes

talking with Dave, my project began to work just fine.

Jason Li was the first graduate student I met in

Margaret's group. Jason and I quickly became friends. He

taught me a great deal about HPLC function and microsome

preparation. I owe a great deal to Dr. Li Chung-Li. His

kindness both in and out of the lab made my time as a

graduate student a very positive experience. He and his

wife, Gena, often fed me, and allowed me to play with their

two wonderful children.

Gary LaFleur was a graduate student under the

supervision of Robin Wallace. Gary always had a quietness

about him and could befriend an angry rattle snake. He was

always willing to help anyone who asked. This trait cost him

many a long night, as he would have to catch up with his

work. He is a kind soul and I am fortunate to know him and

his wife, Susanna.

The other students and post-docs at the Whitney Lab

were all helpful. Mike Jeziorski is a post-doc who will

actually stop what he is doing and look up an answer to a

question you might ask of him, if he does not already know

the answer. My guilt concerning this trait eventually caused

me to start asking questions of Rob instead of Mike. Rob now

tells me to look it up. Steve Munger was another student who

would without fail offer assistance if you asked. In fact,









he frequently offered assistance even if you did not ask.

But to be honest, I don't ever recall turning down his help.

Gena White, a technician, also never failed to help if

called upon. Her many years of experience were quite

valuable to me during my training. I have found that

technicians often know more than most.

I would like to thank both Louise McDonald and Shirley

Metts. Without their help over the years, I would not have a

place to live nor money to spend. I would like to also thank

Lynn Milstead and Jim Netherton III for their expertise in

graphics and photography. The Whitney Lab would be far less

than it is without these two artists. A very special thank

you to Jan Kallman, our department secretary. There is

nothing Jan can't do. And thanks to Nancy Rosa. She was

always busy, but could find time to help. And thanks to the

folks at the editorial department who read this

dissertation. Thank you "MDL".

And finally, I wish to acknowledge Mr. Billy Raulerson

and Mr. Bob Birkett. Mr. Raulerson is one of those people

who can build just about anything. Mr. Birkett can fix

anything. I have see them both do it many times. I came to

know Mr. Raulerson fairly well over the years. Often we

talked about science and more times than not his

experimental design would be far superior to whomever's

project design we were talking about. This might seem a bit

strange at first, but Mr. Raulerson could approach a problem

from the outside, unbiased and unaffected by what famous









groups had done before or what a protocol dictated. I

learned a great deal from him, more than he will ever know.

As unbelievable as it may be, I have left out many

people I wish to thank. I have edited my original

acknowledgments. Those I have left out are people more

involved in my personal life, but as most know, my personal

life is mostly taken up by research. I thank all my friends

who have tolerated my ways. Again, I have been fortunate.

Finally, thank you to Ali Farakabesh. Besides being one of

my closest friends, he gave me the computer I typed this

manuscript on. All of my friends are that giving. I am very

fortunate indeed.

And a special thanks to Mr. Lefty. His devotion, in

spite of Feline Leukemia, has been an inspiration to me and

everyone who knows him. He is truly a good kitty. And he is

still alive.









TABLE OF CONTENTS


page

ACKNOWLEDGMENTS...... ........... .. ..................... iii

TABLE OF CONTENTS ..................................... xiii

LIST OF TABLES ......... ....... ... ............. ......... xv

LIST OF FIGURES .......... ............... .......... xvi

KEY TO ABBREVIATIONS. ................................ ..xviii

ABSTRACT ..... .............. .. ................ .......... xx

CHAPTERS

1 CYTOCHROME P450: SOME BACKGROUND INFORMATION...... 1

Introduction ....................................... 1
Cytochrome P450 and Cytochrome P450 Reductase..... 6
Previous Characterization of Cytochrome P450 in
the Spiny Lobster............................... 12
A Preview ...................... ..... ............. 17

2 CROSS-REACTIVITY OF AN ANTIBODY TO SPINY LOBSTER
P450 2L WITH MICROSOMES FROM OTHER SPECIES....... 18

Introduction......... ............................ 18
Materials and Methods ............................ 20
Results and Discussion............................. 23

3 CDNA AND PROTEIN SEQUENCE OF A MAJOR FORM OF P450,
CYP2L, IN THE HEPATOPANCREAS OF THE SPINY
LOBSTER, PANULIRUS ARGUS ......................... 32

Introduction................... ................... 32
Material and Methods.................. ............. 35
Results and Discussion ............................ 41

4 CATALYTIC CHARACTERIZATION OF CYP2L1 IN BACTERIA
AND YEAST EXPRESSION SYSTEMS .................... 57

Introduction.......................................... 57
Materials and Methods ............................ 61
Results..................................... ...... 73
Discussion........................................... 79


xiii










TABLE OF CONTENTS, CONTINUED


5 SUMMARY OF RESULTS .............................. .. 89

REFERENCES............................................. 93

BIOGRAPHICAL SKETCH ............ ... ...................... 105








LIST OF TABLES


Table page

1.1 Some CYP families and their model substrates...... 3


2.1 Classification and P450 Contents of Hepatic
Microsomal Preparation of the Species Studied..... 25


3.1 The N-terminal Amino Acid Sequences in a P450-
containing fraction Isolated from Spiny Lobster
Hepatopancreas Microsomes......................... 43


3.2 Sequence of some of the Primers Used to Obtain
the cDNA Clones................................... 45


4.1 In vitro Steroid metabolism in crustaceans species.. 58


4.2 Monooxygenase Activity of Spiny Lobster Cytochrome
P450 Fractions in the Presence of NADPH and NADPH
Cytochrome Reductase from Rat Liver................ 60


4.3 Primer Sequences Used in this Study ................. 63


4.4 Expression Vectors Used in this Study and their
Attributes ....................... ............... 66












LIST OF FIGURES


Figure page

1.1 An example of a cytochrome P450 difference spectra... 8


1.2 Proposed reaction mechanism for P450 mediated
oxygen activation and oxygenation of a substrate...10


1.3 The anatomy of the Florida spiny lobster,
Panulirus argus.....................................13


1.4 Cross-section of the spiny lobster hepatopancreas....15


2.1 Immunoreactivity of microsomes from invertebrate
and vertebrate species with anti-CYP2L antibodies
generated in rabbit................................ 25


2.2 Composite picture of various Western blots done with
invertebrate and vertebrate microsomal fractions...28


2.3 Twenty micrometer cryo-sections of spiny lobster
hepatopancreas .....................................31


3.1 SDS-PAGE of a spiny lobster P450-containing
fraction stained with Coomassie blue...............42


3.2 Cloning strategy showing the clones used to meld
together a full-length cDNA sequence................47


3.3 Nucleotide and conceptualized protein sequence
of the spiny lobster cytochrome P450, CYP2L........48


3.4 Hydropathy plots of the rat CYP2B1, rat CYP2B2,
rat CYP2D4 and CYP2L. .............................. 50


xvi











LIST OF FIGURES, CONTINUED


3.5 Comparison of the deduced amino acid of CYP2L with
that of rat CYPs 2B1, 2B2, 2B4 and 2D4..............52


3.6 Northern blot total RNA isolated from the
hepatopancreas of the spiny lobster................55


3.7 RT-PCR of total RNA isolated from the spiny lobster
hepatopancreas .................. ................. 56


4.1 The oligonucleotide sequence of expression primers
MJ25, MJ24, and BRN1................................64


4.2 SDS-PAGE of induced bacterial cells (BL21) expressing
cytochrome P450 2L1 from the expression vector
pET28a.............................................74


4.3 Western blot of total cell lysate from BL21 bacterial
cells expressing the pET28a construct induced with
0.4 mM IPTG........................................75


4.4 SDS-PAGE of pET28a derived cytochrome P450 2L1
expressed in bacterial cells (BL21) and purified
using metal chelation chromatography...............76


4.5 Western blot of microsomes from yeast expressing the
cytochrome P450 2L1 insert......................... 77


4.6 TLC separation of progesterone and testosterone
metabolites produced by expressed cytochrome P450
2L1 .............................................. 84


4.7 TLC separation of progesterone and testosterone
metabolites produced by expressed cytochrome P450
2L1 ................................. ............... 87


xvii








LIST OF ABBREVIATIONS


cDNA complementary or copy DNA
CO carbon monoxide
CsCl cesium chloride
CYP cytochrome P450
Da dalton
dATP deoxyadenosine triphosphate
dCTP deoxycytidine triphosphate
dGTP deoxyguanosine triphosphate
DI sterile deionized water
DNA deoxyribonucleic acid
dNTP deoxynucleoside triphosphate
DTT dithiothreitol
dTTP deoxythymidine triphosphate
EDTA ethylenediaminetetraacetic acid
EtOH ethanol
FAD flavin adenine dinucleotide
FITC fluorescein isothiocyanate
FMN flavin mononucleotide
g gram
h hour
i.p. intraperitoneal
K' potassium
KC1 potassium chloride
kb kilobase
kD kilodalton
kg kilogram
M molar
MeOH methanol
mg milligram
MgC12 magnesium chloride
ml milliliter
mM millimolar
mRNA messenger ribonucleic acid
MW molecular weight
Mr molecular mass
Na sodium
NaCl sodium chloride
P-NAD beta nicotinamide adenine dinucleotide
NADPH nicotinamide adenine dinucleotide
phosphate
nmole nanomole
P450 cytochrome P450
PAGE polyacylamide gel electrophoresis
PCR polymerase chain reaction
pmol picomole
PMSF phenylmethylsulfonyl fluoride
PVDF polyvinylidene fluoride
RNA ribonucleic acid


xviii








LIST OF ABBREVIATIONS, CONTINUED


SDS sodium dodecyl sulfate
SRS substrate recognition site
Taq Thermus aquaticus
TBS tris-buffered saline
TCDD 2,3,7,8-tetrachlorodibenzo-p-dioxin
TLC thin layer chromatography
TRIS Tris[hydroxymethy]aminomethane
Tween-20 polyoxyethylene-20-sorbitan
ici microcurie
9g microgram
gl microliter
pm micrometer
v volume
w weight
YNB yeast nitrogen base


xix








Abstract of Dissertation Presented to the Graduate School of
the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

THE STRUCTURE AND FUNCTION OF CYTOCHROME P450 IN THE
HEPATOPANCREAS OF THE FLORIDA SPINY LOBSTER, PANULIRUS ARGUS

By

Sean Michael Boyle

May, 1997

Chairperson: Margaret O. James
Major Department: Medicinal Chemistry

Cytochrome P450s are a superfamily of enzymes which

participate in Phase I biotransformation reactions within a

cell. These monooxygenase enzymes are found in a variety of

plant and animal species, including the Florida spiny

lobster, Panulirus argus.

Using partially purified cytochrome P450 from the spiny

lobster hepatopancreas, polyclonal antibodies were obtained

from rabbit sera. The antibodies cross-reacted strongly with

cytochrome P450 from the spiny lobster hepatopancreas.

Cytochrome P450s from other species were examined for

immunoreactivity with the spiny lobster anti-P450

antibodies. Cross-reactivity was detected with the slipper

lobster, but not the American lobster or blue crab. The

killifish, among others, yielded strongly immunoreactive

proteins. In addition, phenobarbital-treated rats also

cross-reacted with the spiny lobster antibodies.

The cDNA encoding an isoform of this enzyme found in

the hepatopancreas of the spiny lobster was isolated from a









cDNA library made from this tissue. This novel cytochrome

P450 enzymes was designated as cytochrome P450 2L1. The

deduced protein shared 35% identity with rat isoforms in the

2B family. Cytochrome P450 2L1 contains amino acids that are

invariant in all known cytochrome P450s and has the highly

conserved heme-binding domain.

Cytochrome P450 2L1 was expressed in the methylotrophic

yeast, Pichia pastoris. Whole cell and microsomal fractions

from yeast that expressed cytochrome P450 2L1 were

catalytically active with radiolabeled testosterone and

progesterone in an NADPH-dependent manner.

The major finding reported within this dissertation is

the cDNA sequence of a novel cytochrome P450 isolated from

the Florida spiny lobster. This cytochrome P450 represents a

new subfamily, and shares structural features with

cytochrome P450s found in the cytochrome P450 gene 2 family.














CHAPTER 1
CYTOCHROME P450: SOME BACKGROUND INFORMATION


Introduction


Cytochrome P450s are monooxygenases capable of

oxidizing a wide variety of endogenous and exogenous

compounds (Gibson and Skett, 1986). Cytochrome P450s

comprise a superfamily of enzymes which are distributed in

microorganisms, plants, and animals. The endogenous

functions of P450s are varied. For example, in

microorganisms like Pseudomonas putida, cytochrome P450

enables the organism to use camphor as a carbon source

(Takemori et al., 1993). In plants, some cytochrome P450s

are involved in the metabolism of hormones, leading to the

ripening of fruit, such as in the avocado (Stegeman and

Hahn, 1994). In animals, mitochondrial P450s are involved in

steroid metabolism, such as the synthesis of estrogen in

humans (Stegeman and Hahn, 1994). When an exogenous compound

(a xenobiotic) enters into an organism, cytochrome P450s are

the primary enzymes which modify the compound in order to

facilitate excretion.

Cytochrome P450 was first discovered in 1955 at the

University of Pennsylvania by Drs. G. R. Williams and M.

Klingenberg (Omura, 1993). The two researchers independently









noted that when rat liver microsomes were bubbled with

carbon monoxide and then reduced with nicotinamide adenine

dinucleotide phosphate (NADPH), a peak at 450 nm was

observed. In 1962, Drs. T. Omura and R. Sato at Osaka

University confirmed that the enzyme contained a b-type

cytochrome and named the protein "P-450" for "a pigment with

absorption at 450 nanometers".

Cytochrome P450s are membrane-bound in eukaryotic

organisms and are found in the endoplasmic reticulum (or

microsomess" when the endoplasmic reticulum is disrupted and

forms aggregates) and in the mitochondria (Black, 1992). In

prokaryotic organisms, cytochrome P450s are soluble and are

found in the cytoplasm.

Cytochrome P450s are assigned to one of 74 gene

families based on the amino acid identity of the cytochrome

P450 in question to all other known cytochrome P450 amino

acid sequences (Nelson et al., 1993). If the apoprotein is

greater than 40% identical on the amino acid level to

cytochrome P450 apoproteins of a particular gene family,

then that cytochrome P450 is placed into that same gene

family. If the apoprotein is greater than 55% identical on

the amino acid level to cytochrome P450 apoproteins of a

particular gene sub-family, then that cytochrome P450 is

placed into that same gene subfamily. Table 1.1 lists a few

cytochrome P450 families and model substrates that are

metabolized by certain cytochrome P450 isoforms. The

substrates listed in table 1.1 are substrates that are










Table 1.1 Some CYP families and their model substrates.


CYP Model Substrate Structure


1Al Ethoxyresorufin /H520 o



1A2 Phenacetin



1Bl Estrone



2As Coumarin Q-0



2Bs Pentoxyresorufin co ;

0
2Cs Mephenytoin ,HC
N-CH3

NH
2Ds Debrisoquine N-""-NH

/

2E1 Ethanol /\OH




3As Testosterone




4As Lauric acid ,OH


Arrows indicate the position of monooxygenation by cytochrome P450
enzymes.









characteristically metabolized by a particular cytochrome

P450 enzyme or cytochrome P450 enzymes within that

subfamily, but does not exclude the possibility that these

same substrates are metabolized by cytochrome P450 enzymes

in other sub-families and families. In fact, cytochrome

P450s have a broad substrate preferences. An important

function of cytochrome P450 in families 1 to 4 is the

monooxygenation of exogenous compounds (xenobiotics).

The genes that encode mammalian cytochrome P450 enzymes

can be induced by various compounds. Benzo-a-pyrene or

2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), for example,

causes the increased transcription of the cytochrome P450

1Al gene (Fujii-Kuriyama, 1993). Phenobarbital causes

increased transcription of cytochrome P450 2B genes (Fujii-

Kuriyama, 1993). Other compounds may stabilize existing mRNA

levels, as is thought for cytochrome P450 2E1 induction by

EtOH (Fujii-Kuriyama, 1993).

Cytochrome P450s have been detected in most tissues (in

humans, erythrocytes and striated muscle lack cytochrome

P450). Cytochrome P450s exist as two general classes: a

group of enzymes localized in particular tissues involved

typically in steroidogenesis and a group involved in the

metabolism of xenobiotics (Gonzalez, 1992). Xenobiotics are

defined as molecules that are not utilized by the body for

energy or the normal regulation of a physiological process.

Cytochrome P450s are important in determining the duration

of action and toxicity of various drugs, such as










acetaminophen. How long a xenobiotic remains in the body is

often determined by cytochrome P450 metabolism, especially

if the xenobiotic is lipophilic.

The liver is the organ that generally contains the

highest levels of cytochrome P450 in most species. Buhler et

al. (1992) demonstrated that the rat liver regionally

expresses various forms of cytochrome P450. Anundi et al.

(1993) speculated (and demonstrated in the rat liver) that

acetaminophen toxicity may be centrilobulary restricted due

to localized expression of cytochrome P450 2E1. Others have

further defined the regional expression of cytochrome P450s

1A1/2, 2E1, 2B1/2, and 3A1/2 (Oinonen et al., 1996, 1994;

Anundi et al., 1993). Interestingly, cytochrome P450s

2C11/12 are not zone-restricted.

In the human brain, cytochrome P450s are important in

the detoxification of xenobiotics, including psychoactive

drugs, such as serotonin (5-hydroxytryptamine) uptake

blockers (Baumann and Rochat, 1995). It has been reported

that mutations in the cytochrome P450 2D6 gene have been

associated with Alzheimer's disease (Saitoh et al., 1995).

In microsomal fractions from rat brain, cytochrome P450s

2C7, 2C11, 2E1, 4A3, 4A8 and a 2D have been identified by N-

terminal microsequencing (Warner et al., 1994) and low

levels of cytochrome P450 17 protein expression have been

detected (Sanne and Kreuger, 1995).

Cytochrome P450s in the eye (Stoltz et al.,1994),

kidney (Ma et al., 1993), arteries (Escalante et al., 1993),










skin (Toda et al., 1994) and muscle (Pereira et al., 1994)

are important in the metabolism of arachadonic acid into

physiologically active metabolites known as eicosanoids

(Coon et al., 1992). Compounds derived from arachadonic

acid, such as 12-hydroxyeicosatetraenoic acid, lower

intraocular pressure in the eye and modulate activity of the

Na+/K+ ATPase in the eye, kidney and muscle.

Cytochrome P450s are found in both breast and ovarian

tissues, where they mediate estrogen biosynthesis. Estrogen

levels increase in the follicle as the follicle develops,

and decrease at ovulation (Tilly et al., 1992). Both

estrogen, and cytochrome P450 19 protein (the cytochrome

P450 enzyme that catalyzes the conversion of testosterone to

17p-estradiol), are elevated in breast tissues from breast

cancer patients (Brodie, 1993).


Cytochrome P450 and Cytochrome P450 Reductase


Cytochrome P450 is a phase I enzyme, a member of a

large group of diverse enzymes involved in the first steps

of xenobiotic metabolism. Cytochrome P450 utilizes molecular

oxygen and reducing equivalents derived from NADPH in order

to insert an oxygen atom into a substrate (Guengerich and

McDonald, 1990). Cytochrome P450 is a monomer and has a

molecular mass of approximately 45-60 kDa. The enzyme is

anchored (Brown and Black, 1989, Black, 1992) to the









endoplasmic reticulum and contains a non-covalently bound

iron protoporphyrin IX prosthetic group.

When the cytochrome P450 enzyme is reduced with a

reducing agent such as NADPH or diothionite, and then

completed with CO, a maximal absorbance at 450 nm is

observed (Omura and Sato, 1964, see figure 1.1). It is this

characteristic of these monooxygenase enzymes that accounts

for the name cytochromee P450".

Figure 1.2 outlines the reaction mechanism between

enzyme, substrate and oxygen. Cytochrome P450 binds both

molecular oxygen and substrate and requires electrons

(reducing equivalents) from cytochrome P450 reductase. It

is thought that when the substrate binds (step 2) to

cytochrome P450, a conformational change occurs within the

enzyme, allowing the first electron donation (step 3)from

the reductase (figure 1.2). Molecular oxygen then binds to

the reduced enzyme complex (step 4). Cytochrome P450

reductase is an oxidoreductase (molecular mass around 78

kDa) and is found in close association with the cytochrome

P450. The reductase accepts 2 electrons from NADPH (in the

form of reducing equivalents) and donates 2 electrons

sequentially to the cytochrome P450 (Smith et al., 1994).

Cytochrome P450 reductase contains both flavin adenine

dinucleotide and flavin mononucleotide (FAD and FMN

respectively) and uses these flavins in the oxidized and

reduced form (quinone and semiquinone states) to pass single

electrons to cytochrome P450. The second electron may also



























0.00-





-0.03 ,
400 450 500

Nanometers
Figure 1.1. An example of a cytochrome P450 difference
spectra. Spiny lobster microsomes (solubilized in 0.5%
cholic acid) were diluted to about 1 mg/ml and bubbled with
CO. A portion of the sample was then reduced with sodium
dithionite, and the other portion was used as a reference
solution. The spectrum was recorded from 500 to 400 nm. This
sample has a cytochrome P450 content of 1.28 nmol P450/mg
protein.









be donated by cytochrome bs in some instances (step 5).

Oxygen scission occurs (step 5), with loss of one of the

oxygen atoms to water.

Cytochrome P450s introduce oxygen into alkanes,

heteroatom-containing alkanes or t-bonded systems (step 6)

by variations on a radical type mechanism (Guengerich and

McDonald, 1990 and Koymans et al., 1993). In each case, a

radical is formed (on the substrate) either by hydrogen

abstraction or electron transfer followed by radical

recombination with a hydroxyl radical formed at the heme

site. Loss of a second hydrogen from the substrate would

form an unsaturated compound (Guengerich and McDonald,

1990). The cytochrome P450 enzymes is regenerated to the

ferric state when the hydroxylated product is released (step

1). Cytochrome P450 reductase and oxygen can be replaced

with an organic peroxide to complete the reaction (by going

to point 6 directly from point 2).

This dissertation concerns the CYP enzyme systems in

crustacea and describes the use of the Florida spiny

lobster, Panulirus argus, as an animal model. The spiny

lobster is a commercially important species in Florida due

to consumer demand of this sea food. Over 4 million Kg of

spiny lobster were harvested from the Florida Keys in 1992.

The shellfish industry represents an important fraction of

South Florida's economy. The spiny lobster offers an animal

model whose anatomy (figure 1.3) and presumably enzyme

systems are evolutionary divergent from our own and from



























1.

Fe3

P450


Monooxygenated
Substrate


2.
Fe3+
Substrate Fe

P450-Substra
Complex


NADPH NADP + I-

P450 eductase



e- Fe2+

te P450-Substrate
Complex


02


[FeO]3+ V [Fe ]+ [F O2]2+

P450-Substrate P4 Substrate P450-Substrate
Complex H20 2H Complex Complex
H20 2H+C-
6. 5. 4.
Figure 1.2. Proposed reaction mechanism for P450 mediated
oxygen activation and oxygenation of a substrate. ROOH, an
organic peroxide, can be used as an oxygen donor to
cytochrome P450.









other common animal models such as the rat or mouse. For

example, in mammals, certain cytochrome P450 genes are

inducible or upregulated by chemicals such as 3-

methylcholanthrene cytochromee P450s in the 1A gene

subfamily) and phenobarbital cytochromee P450s in the 2A, 2B

and 2C gene subfamilies), producing large amounts of the

particular cytochrome P450 protein. Fish do not undergo gene

upregulation in response to phenobarbital, but do respond to

3-methylcholanthrene by upregulating cytochrome P450 enzymes

in the 1A gene family. Crustacea do not respond to either 3-

methylcholanthrene (James, 1989) or phenobarbital (Stegeman

and Hahn, 1994).

Lobsters have been used as models in several studies.

FMRFamide-like peptides have been isolated from the American

lobster (Worden et al., 1995) and have been shown to

potentiate transmitter release in the nerve terminals to

muscle and cause muscle contraction directly. Crustaceans

have a primitive immune system, consisting of cellular and

humoral responses (Takahashi et al., 1995). Spiny lobsters

have been shown, like salmon and mole rats, to use polarity

as a means of navigation (Lohmann et al., 1995).

An intriguing reason to study the enzyme systems of the

spiny lobster is that the lobster is apparently resistance

to carcinogenesis. It is believed that crustacea do not

undergo carcinogenesis (Mix, 1986). An understanding of the

metabolic pathways, especially those leading to reactive









intermediates in both sensitive and resistant species, may

yield more insight into the mechanism of carcinogenesis.


Previous Characterization of P450 in the Spiny Lobster


The James group have characterized both phase I and II

systems in both the spiny lobster (James, 1990, Schell and

James, 1989) and in the American lobster (James et al.,

1989, Li and James, 1993).

The hepatopancreas is a fatty, digestive gland found in

all crustacea and consists of blind-ending tubules (figure

1.4). The primary function of the hepatopancreas is

secretion of digestive enzymes into the stomach and the

subsequent uptake of nutrients (Gibson and Barker,1979).

The hepatopancreas of the spiny lobster contains

cytochrome P450 in amounts comparable to those found in rat

liver (- 1 nmole P450/mg microsomal protein, James and

Little, 1980). The major site of xenobiotic

biotransformation in the spiny lobster is the

hepatopancreas, although cytochrome P450 has been detected

in the antennal gland and in the nose of this animal.

Cytochrome P450 has been partially purified from the

hepatopancreas of the spiny lobster (James,1990). Microsomes

prepared from the spiny lobster hepatopancreas contain high

levels of cytochrome P450. Solubilization of the microsomes

produces an enriched cytochrome P450 fraction termed the Ml

fraction or "red fraction" (James and Little, 1980). The red






















Pericardium


Intestine


Hepatopancreas


Figure 1.3. The anatomy of the Florida spiny lobster,
Panulirus argus. The hepatopancreas is an organ analogous to
the mammalian liver and contains large amounts of cytochrome
P450 (- 1 nmol cytochrome P450/ mg microsomal protein).









fraction can be resolved into partially purified P450s using

anion exchange, hydrophobic interaction and absorption

chromatography (James, 1990).

Reconstitution experiments using cytochrome P450

isolated from the hepatopancreas from the spiny lobster, and

substrates such as benzphetamine, progesterone, testosterone

and benzo-a-pyrene, demonstrated that the spiny lobster

cytochrome P450 is able to metabolize a diverse group of

substrates (James, 1989, James, 1990). Little activity was

reported with ethoxy- or pentoxy- resorufin, substrates

characteristically metabolized by cytochrome P450 enzymes in

the gene subfamilies 1A and 2B, or with ecdysone, the

molting hormone in spiny lobsters. (James, 1990).

The above studies were done using cytochrome P450

reductase from rat liver microsomes. To date, cytochrome

P450 reductase from spiny lobster hepatopancreas microsomes

has not been purified. Low cytochrome c reductase activity

has been detected (James and Little, 1980) in spiny lobster

hepatopancreas microsomes and hepatopancreas cytosol. The

ratio of cytochrome P450 to cytochrome P450 reductase in

mammals is in the range of 10:1 to 100:1; therefore

concentrations of cytochrome P450 reductase in the spiny

lobster may be very low. However, other artificial pathways

can be used to supply single electrons to cytochrome P450

(for example, the use of peroxides), so it is possible the

spiny lobster uses a novel pathway to pass electrons to

cytochrome P450 in vivo. Cumene hydroperoxide-dependent









































hepatopancreas. Tissues were frozen and 20 mm sections
cut. The circular structures are the blind-ending
tubules.









monooxygenation of several substrates was similar to NADPH-

dependent activity in M1 fractions (James, 1984). For

example, mollusks may use a NADPH-independent cytochrome

P450 pathway (Livingstone et al., 1989) to oxidize

xenobiotics. Another plausible reason for failure to isolate

cytochrome P450 reductase from the spiny lobster is that it

may have been degraded by digestive enzymes and bile salts

liberated during the isolation procedure (James, 1990).

Studies addressing the apparent resistance of spiny

lobster to chemical carcinogenesis have yielded some insight

into this phenomenon (James et al., 1992). Spiny lobsters

dosed with increasing amounts of the carcinogen benzo-a-

pyrene indicated a dose-dependency in DNA adduct formation.

Benzo-a-pyrene is metabolized into a reactive intermediate

which covalently binds to DNA. Interestingly, when the

southern flounder (Paralichthys lethostigma, a carcinogen

sensitive species) was fed hepatopancreas from a spiny

lobster dosed with radiolabeled benzo-a-pyrene, DNA adducts

were formed in the liver and the intestinal DNA of the fish

(James et al., 1991). These studies suggest trophic transfer

is a potential threat to consumers of this species and serve

to reinforce the use of the spiny lobster as a model system

for studying questions concerning carcinogenesis and

transfer of carcinogenic chemicals among species.










A Preview


In the following chapters, studies concerning the

structure and function of cytochrome P450 in the Florida

spiny lobster will be presented.

An antibody to spiny lobster cytochrome P450 has been

generated and used to screen microsomal fractions from other

invertebrate and vertebrate animals. The spiny lobster

cytochrome P450s seem to share epitopes with some

invertebrate and vertebrate species. There is preliminary

evidence that the cytochrome P450s in the spiny lobster

hepatopancreas may be localized to certain cell types in the

hepatopancreas.

The primary structure of one isoform of cytochrome

P450, cytochrome P450 2L1, has been determined and is most

similar to known cytochrome P450s found in rats. Hydropathy

plots reveal overall similarity in predicted secondary

structure as well. Northern blot and RT-PCR analysis

indicate that a possible alternatively spliced form of the

mRNA for cytochrome P450 2L1 may be present in the

hepatopancreas.

Cytochrome P450 2L1 was inserted into a vector and

transfected into the yeast Pichia pastoris. Upon incubation

with radiolabeled testosterone and progesterone, both intact

yeast and yeast microsomes yielded a 16C-hydroxylation

product.














CHAPTER 2
CROSS-REACTIVITY OF AN ANTIBODY TO SPINY LOBSTER P450 2L
WITH MICROSOMES FROM OTHER SPECIES


Introduction


Individual members of the superfamily of cytochrome

P450 enzymes catalyze the oxidation of a wide variety of

endogenous and xenobiotic substrates (Omura et al., 1993;

Ortiz de Montellano; 1986; Ruckpaul and Rein, 1984). Members

of one or more of the cytochrome P450 families have been

found in diverse species of both plant and animal kingdoms,

and the cytochrome P450 enzyme system is thought to be

widespread (Nelson et al., 1993). While the gene and protein

sequences of many mammalian cytochrome P450s are known

(Nelson et al., 1993), much less is known about cytochrome

P450s in fish and aquatic invertebrate species.

Fish cytochrome P450s have been cloned from rainbow

trout (Oncorhynchus mykiss cytochrome P450s 1A1, 2K1, 11A,

17 and 19) and plaice (Pleuronectes platessi, cytochrome

P450 1Al; Stegeman and Hahn, 1994). We recently cloned a

cytochrome P450 cytochromee P450 2L) from the Florida spiny

lobster, Panulirus argus (James et al., 1993). The only

other cytochrome P450 sequence that has been cloned from an

aquatic invertebrate to date is that of the pond snail

(Lymnea stagnalis, cytochrome P450 10, Nelson et. al.,









1993). Of the other invertebrate species (Nelson et al.,

1993), cytochrome P450 have been cloned from the house fly

(Musca domestic, cytochrome P450 6A1), fruit fly

(Drosophila melanogaster, cytochrome P450s 4D1, 4E1 and

6A2), butterfly (Papilio polyxenes, cytochrome P450 6B1)

and cockroach (Blaberus discoidalis, cytochrome P450 6C1).

The spiny lobster cytochrome P450 2L is the first complete

member of the cytochrome P450 2 gene family from an

invertebrate, and to date the second non-mammalian

cytochrome P450 2 gene family form.

In mammalian species, the cytochrome P450 2 gene

family is very important for monooxygenation of a wide range

of structurally diverse xenobiotics and endogenous

substrates (Omura et al., 1993; Ortiz de Montellano; 1986;

Ruckpaul and Rein, 1984; Nelson et al., 1993). Although

sequence identity of the spiny lobster cytochrome P450 2L

form with other cytochrome P450s was low, certain regions of

the primary sequence showed very high similarity to other 2

family members (James et al., 1996), suggesting that there

may be epitopes in common. Few studies have investigated the

cross-reactivity of invertebrate cytochrome P450s with

vertebrate cytochrome P450 antibodies. One study found

cross-reactivity of an anti-scup cytochrome P450 1A antibody

to microsomal fractions of the sea star, Asterias rubens

(den Besten et al., 1993). Another study found that

microsomes made from the mid-gut gland of the chiton

Cryptochiton stelleri cross-reacted with an antibody to









rainbow trout cytochrome P450s 2K1 and 1Al (Schlenk and

Buhler, 1989).

The objective of the present study was to investigate

whether an antibody to a microsomal cytochrome P450 isolated

from the hepatopancreas of the Florida spiny lobster would

cross-react with microsomal fractions isolated from

hepatopancreas and liver of other invertebrate and

vertebrate species.


Materials and Methods



Antibody Preparation


Partially purified cytochrome P450 (11.5 nmol

spectrally measured cytochrome P450/mg protein) was isolated

from microsomes prepared from hepatopancreas of the Florida

spiny lobster by ion-exchange, hydrophobic and absorptive

chromatography (James, 1990). Samples were subjected to SDS-

PAGE in one dimension (Laemmli, 1970). The major band from

SDS-PAGE (52.5 kD apparent molecular mass) was detected with

Coomassie blue dye and excised. Each gel slice contained

about 3.0 gg of cytochrome P450 as determined by difference

spectra (see below). Six micrograms of cytochrome P450 were

homogenized in 1 ml of a 50% Freunds complete adjuvant-

saline solution. The homogenate was then sheared with a 19

gauge needle. Pre-immunization serum was obtained from a

pathogen free, New Zealand White rabbit 2 weeks earlier. The









rabbit was immunized with four 0.25 ml injections along the

back. The rabbit received boosters of 6 gg of cytochrome

P450 in 1 ml of 50% Freunds incomplete adjuvant-saline every

2 weeks. A total of seven immunizations were given, with

detectable titers (as detected by Western blotting)

beginning after the third injection.


Microsome Preparation


The fish and invertebrates used in these studies (see

table 2.1) were locally caught, adult feral species of

either sex, with the exception of the channel catfish. The

channel catfish (Ictaluris punctatus) were obtained from the

LSU aquaculture facility and were 800+/-100 g body weight.

The rats were male, Sprague-Dawley strain, and were 200+/-20

g. The phenobarbital-induced rats were pretreated with 80 mg

phenobarbital/kg i.p. for 4 days before sacrifice on the

fifth day. Microsomes were prepared as described previously

(James, 1990). Briefly, tissues were removed from the animal

and homogenized in 0.05 M potassium phosphate (pH 7.4),

1.15% KC1, 0.1 mM EDTA, 0.2 mM PMSF. The homogenate was

centrifuged at 13,000g and the supernatant centrifuged at

176,000g to pellet the microsomes. Solubilized microsomes

(Ml fractions) were isolated from the invertebrates by

stirring the microsomes at 40C for 1 h in buffer containing

0.01 M potassium phosphate (pH 7.6), 20% v/v glycerol, 0.5%

w/v sodium cholate, 0.1 mM EDTA, 0.1 mM dithiothreitol, 0.2










mM PMSF (1 ml buffer/g wet weight hepatopancreas) and

centrifuging at 176,000g for 90 min. Protein contents were

determined by the method of Lowry et al. (1951).

Concentrations of cytochrome P450 in the samples were

determined by CO difference spectra (see table 2.1)

(Estabrook et al., 1972).


Western Blots


Samples of microsomal protein, 200 gg, were subjected

to SDS-PAGE on 4%-8.5% discontinuous gels in a Protean II

apparatus (BioRad). Proteins were electro-blotted onto

nitrocellulose using a Tris-glycine-methanol buffer system

(25 mM Tris base, 192 mM glycine, 20% v/v methanol). After

the transfer, the membranes were blocked in 3% gelatin-TBS

(Tris-buffered saline, 20 mM Tris, 500 mM NaC1, pH 7.5) for

1 h. The primary antibody (1:200 in 1% gelatin-TBS-0.05%

Tween-20) was applied for 2 h and secondary antibody (Biorad

goat-anti-rabbit alkaline phosphatase, 1:3000) was applied

for 1 h. Detection was by color development with 5-bromo-4-

chloro-3-indolyl phosphate and nitro blue tetrazolium

(BioRad).


Immunocytochemistry


Hepatopancreas was fixed overnight in Zamboni's

fixative (2% Paraformaldehyde and 0.15% picric acid in 0.1 M

potassium phosphate, pH 7.4). Tissues were then subjected to









increasing concentrations (0,10,20 and 30% (w/v)) of sucrose

(w/v) in PBS (phosphate buffered saline, 20 mM potassium

phosphate, pH 7.4, 500 mM NaCI) for 2 h at each

concentration, allowing the tissues to remain in 30% sucrose

in PBS overnight. Tissues were frozen in O.C.T compound (10%

(v/v) polyvinyl alcohol and 4% (v/v) polyethylene glycol,

Miles Inc.) and sectioned (20 pm) on a cryostat. Sections

were blocked in 1.0% (w/v) normal goat serum for 30 min.

Sections were washed once for 15 min in PBS and incubated

for 1 h with the primary antibody (1:50 in PBS/1% normal

goat serum). Sections were washed (2 X 15 min) in PBS and

the secondary antibody (goat-anti-rabbit fluorescein

isothiocyanate, 1:50) applied for 1 hr. Slides were viewed

with a fluorescent microscope.


Results and Discussion


Studies of the immunological relationships between

cytochrome P450s in aquatic species have mostly been done in

fish. We isolated microsomes from representative species in

both the cartilaginous and bony fish classes and in the

class crustacea. Table 2.1 list the systematics of the

species we screened with the anti-spiny lobster cytochrome

P450 antibody.

As expected, anti-spiny lobster cytochrome P450

antibody consistently cross-reacted with microsomal

fractions, solubilized fractions (Ml) and partially purified









cytochrome P450 from the hepatopancreas of the spiny

lobster. Three bands were usually detected, at high

molecular mass (not shown), at 52.5 kD (figure 2.1 and

figure 2.2) and at 30 kD (not shown). We have Northern blot

and RT-PCR evidence for what appears to be a splice variant

of about 1.5 kb of cytochrome P450 2L (James et al., in

preparation), and the 30 kD immunoreactive band may either

represent the translated product of this cytochrome P450 2L

truncated message, or perhaps is a breakdown product of

cytochrome P450. Under conditions used in this study,

cytochrome P450 2L can be detected at 0.05 pmol/lane.

With hepatopancreas microsomal preparations from the

other invertebrates studied, immunoreactivity at a similar

molecular mass to that of the spiny lobster cytochrome P450

was detected with the slipper lobster (figure 2.1 and figure

2.2). This lobster is in the same infraorder as the spiny

lobster. Cross-reactivity at higher molecular mass was

detected with samples from the American lobster, but there

was no detectable cross-reactivity with the other

invertebrate samples studied (figure 2.1 and figure 2.2).

Many factors effect the cytochrome P450 levels in marine

invertebrate species (Stegeman and Hahn, 1994). Failure to

detect immunoreactive proteins may be due not only to lower

levels of overall cytochrome P450 contained in the

hepatopancreas or digestive gland of the invertebrates

studied, but may also be related to differential expression

of a particular cytochrome P450 isoform.













Table 2.1
Classification and cytochrome P450 Contents of Hepatic Preparations
of the Species Studied

Classification cytochrome P450
content
(nmol/mg protein)
Phylum Arthropoda
Subphylum Chelicerata
Class Xiphosura
Limulus polyphemus, the horse shoe crab' 0.41
Subphylum Mandibulata
Class Crustacea
Order Decapoda
Suborder Dendrobranchiata
Infraorder Penaeidea
Superfamily Penaeoidea
Family Penaeidae
Penaeus aztecus, the brown shrimp' 0.10
Suborder Pleocyemata
Infraorder Palinura
Superfamily Palinuroidea
Family Palinuridae
Panulirus argus, the Florida spiny lobster' 1.30
Family Scyllaridae
Scyllarides nodifer, the slipper lobster' 0.06
Infraorder Astacidea
Superfamily Nephropoidea
Family Nephropidae
Homarus americanus, the American lobster2 0.91
Infraorder Brachyura
Superfamily Portunoidea
Family Portunidae
Callinectes sapidus, the blue crab' 0.33
Phylum Chordata
Class Chondrichthyes
Order Rajiformes
Family Rajidae
Raja eglanteria, the clear-nose skate' 0.53
Class Osteichthyes
Order Siluriformes
Family Ictaluridae
Ictalurus punctatus, the channel catfish' 0.23
Order Atheriniformes
Family Cyprinodontidae
Fundulus heteroclitus, the killifish' 0.36
Order Perciformes
Family Centropomidae
Centropomus undecimalis, the snook3 0.18
Class Mammalia
Order Rodentia
Family Muridae
Rattus rattus, control Sprague-Dawley rat' 1.10
phenobarbital-induced rat' 1.80

IMicrosomes prepared from fresh liver or hepatopancreas. Fractions prepared from
fresh hepatopancreas. 'Microsomes prepared from frozen livers.









Hepatic microsomes from the one member of the

chondrichthyes class that were screened, the clear-nose

skate, cross-reacted with the spiny lobster anti-cytochrome

P450 antibody (figure 2.2).

Hepatic microsomes from all of the bony fish studied

cross-reacted and gave signals in the 45-66 kDa region, with

the strongest signals from the killifish microsomal samples

followed by the catfish (figure 2.1 and figure 2.2). In

other experiments with different microsomal preparations

from the clear-nose skate and the snook, stronger signals

were observed than those shown in figure 2.1 (figure 2.2).

An antibody to rat cytochrome P450 2B1 and one to scup

cytochrome P450 2B have been shown to cross-react with

microsomes from the killifish, the little skate and the

channel catfish (Stegeman and Hahn, 1994).

Microsomal fractions from control and phenobarbital-

induced rats showed cross-reactivity to anti-cytochrome P450

2L in the 45-66 kDa range (figure 2.1 and figure 2.2).

Interestingly, of the cytochrome P450s available in the data

bank for comparison, cytochrome P450 2L shows the most

similarity to the rat cytochrome P450 2D4.

These results suggest that cytochrome P450 in the spiny

lobster hepatopancreas may share similar epitopes with

cytochrome P450s in the slipper lobster, and possibly the

American lobster, but that other invertebrates screened for

cytochrome P450s with similar epitopes were possibly not

present or were present in amounts below the limit of

















A

kD

66.2 -


45.0


B
kD
66.2 -


1 2 3 4 5 6










7 8 9 10 11 12 13


45.0 -


Figure 2.1. Western blots of microsomes from several
species, probed with anti-spiny lobster P450. In each
lane, 200 gg of protein was loaded. Lane 1, blue crab;
2, American lobster; 3, slipper lobster; 4, spiny
lobster; 5, brown shrimp; 6, horse-shoe crab; 7, spiny
lobster; 8, clear-nose skate; 9, catfish; 10,
killifish; 11, snook; 12, control rat; 13,
phenobarbital-induced rat. The migration of molecular
mass markers 45 and 66.2 is shown.























4 5 6 7 8 9 10 11 12 13


52.5 kDa-





Figure 2.2. Composite picture of various Western blots
done with invertebrate and vertebrate microsomal
fractions. Arrow point to the spiny lobster cytochrome
P450 at an apparent molecular mass of 52.5 kDa. Lane 1,
female spiny lobster M1 fraction; 2, slipper lobster
microsomes; 3, American lobster Ml fraction; 4, blue
crab M1 fraction; 5, brown shrimp microsomes; 6, horse-
shoe crab M1 fraction; 7, clear-nose skate microsomes;
8, snook liver microsomes; 9, catfish liver microsomes;
10, killifish liver microsomes; 11, empty lane; 12,
control rat liver microsomes; 13, phenobarbital-induced
rat liver microsomes.










detection. In vivo studies have shown that the American

lobster and the spiny lobster metabolize benzo(a)pyrene very

differently. Very slow cytochrome P450-dependent

monooxygenation of benzo(a)pyrene occurs in the American

lobster, but rapid monooxygenation of benzo(a)pyrene in the

spiny lobster (James and Little, 1980). These differences

probably reflect the cytochrome P450 composition of

hepatopancreas in the two species. It would be important to

isolate microsomes from other crustacea in the suborder

Pleocyemata and to determine if these cross-react with the

cytochrome P450 antibody to the spiny lobster form.

However, even with spiny lobster microsomes, the level

of cross-reactivity may be related to the molting stage of

the animal. Our laboratory has found wide variation in

cytochrome P450 content in the hepatopancreas of the spiny

lobster, and variations such as these may well affect

attempts at quantification using Western blot techniques. As

is apparent by examination of table 2.1, different amounts

of cytochrome P450 were present for electroblotting. It is

possible that some samples had levels of immunoreactive

cytochrome P450 below the detection limit. Nevertheless,

this antibody may be used to screen an expression library

from the slipper lobster or other species which demonstrate

cross-reactivity. Such heterologous probes are very valuable

where information about the primary sequence of the target

protein is unknown.









The spiny lobster antibody also cross-reacted with

microsomes from cartilaginous and bony fish and from rat.

Why these species would share an epitope with the spiny

lobster is unknown, but may be related to the incidence of

expression of the cytochrome P450 2 family. Immunlogical

relationships and other molecular data relating to

invertebrates will not only provide insight into the

phylogenetic relationships of invertebrates, but can serve

as out-groups in phylogenetic analysis of mammalian systems

(Nei, 1987).

The hepatopancreas of crustaceans is composed

principally of four cell types: the E (Embryonalenzellen=

embryonic), R (Restzellen= absorption), B (Blasenzellen=

proteases) and F (Fibrillenzellen= peroxidases; Gibson and

Barker, 1979). Immunocytochemical studies of the spiny

lobster hepatopancreas seem to reveal a defined distribution

pattern for cytochrome P450 (figure 2.3). Immuno-reactivity

appears to be localized in particular cells lining the

hepatopancreas. Furthermore, the reactivity appears to be

localized at the basal end of the cell. What functional

significance this localization may serve in vivo is unknown.

We can not at present identify the cell type or types in the

hepatopancreas that immuno-react with the spiny lobster

anti-cytochrome P450 antibody.



















































Figure 2.3. Twenty micrometer cryo-sections of spiny lobster
hepatopancreas. Sections were incubated with cytochrome P450
2L antibody and stained with an FITC-linked secondary
antibody. The lighter areas are cytochrome P450 in the spiny
lobster hepatopancreas and seem to localize in apical cells.















CHAPTER 3
cDNA AND PROTEIN SEQUENCE OF A MAJOR FORM OF P450, CYP2L, IN
THE HEPATOPANCREAS OF THE SPINY LOBSTER, PANULIRUS ARGUS


Introduction


Cytochrome P450s are a superfamily of important

monooxygenase enzymes that are found in many animal and

plant species of varying biological complexity (Nelson et

al., 1993). The major function of these enzymes is to

introduce oxygen into, or remove hydrogen from, an organic

substrate of either endogenous or exogenous origin, usually

increasing the hydrophilicity of the substrate and altering

its pharmacological or physiological activity (Guengerich

and Shimada, 1991). The monooxygenation of xenobiotics is

usually catalyzed by members of cytochrome P450 families 1-

4. The protein structure of individual members of the

cytochrome P450 superfamily, as it is related to catalytic

function, is an active current area of research.

Considerable advances have been made in deducing the amino

acid sequences and further structural details of bacterial,

fungal, and some mammalian cytochrome P450s (Ortiz de

Montellano, 1986; Gonzalez, 1990), but very little sequence

or structural information has been published for these in

nonmammalian animals (Nelson et al., 1993; Stegeman and

Hahn, 1994). The few invertebrate cytochrome P450 cDNA and










deduced amino acid sequences known fall into the families 4,

6, and 10 and include the neotropical cockroach, Blaberus

discoidalis (Bradfield et al., 1991), the fruit fly,

Drosophila melanogaster (Nelson et al., 1993), the house

fly, Musca domestic (Cohen et al., 1994), and the pond

snail, Lymnea stagnalis (Nelson et al., 1993). No cytochrome

P450 sequence information is available for crustacean

species. Obtaining sequence information from divergent

species may help to further characterize the phylogeny of

this enzyme superfamily, which probably arose from the

duplication of an ancestral gene (Nelson et al., 1993;

Stegeman and Hahn, 1994; Nelson and Strobel, 1987; Nebert

and Gonzalez, 1987; Nebert et al., 1989). Such an ancestral

gene may have had a very broad substrate pool and paralogues

might have evolved more specific substrate selectivites

(Nelson and Strobel, 1987).

This report concerns cytochrome P450 found in the

hepatopancreas, or digestive organ, of the spiny lobster,

Panulirus argus. The spiny lobster hepatopancreas cytochrome

P450 system has some interesting features (James and Little,

1984; James, 1989; James, 1990). Although microsomes

isolated from the hepatopancreas contain high concentrations

of spectrally measured cytochrome P450 (comparable to or

somewhat higher than cytochrome P450 concentrations found in

hepatic microsomes from control rats), no conclusive

evidence has yet been obtained for the presence of an NADPH-

cytochrome P450 reductase in spiny lobster hepatopancreas










microsomes, although low cytochrome c reductase activity is

present (James, 1989). The lack of measurable NADPH-

cytochrome P450 reductase may be because any cytochrome P450

reductase present undergoes proteolysis during the

preparation of microsomes (James, 1990). It has not been

possible to measure NADPH-cytochrome P450 reductase in spiny

lobster hepatopancreas microsomes by immunological methods,

as these microsomes do not contain any proteins which cross-

react with an antibody to rat or rabbit NADPH-cytochrome

P450 reductase (unpublished observations).

Additionally, there is no evidence that spiny lobster

cytochrome P450s can be induced by treatment with polycyclic

aromatic compounds, although polycyclic aromatic compounds

are rapidly metabolized by the spiny lobster (James and

Little, 1984; and James, unpublished observations).

In previous studies, a spiny lobster fraction (given

the trivial designation DI) was partially purified from

hepatopancreas microsomes by chromatography and the

catalytic activities of this cytochrome P450 with

benzphetamine, ethoxycoumarin, aminopyrine, testosterone,

progesterone, benzo(a)pyrene and resorufin ethers were

measured in the presence of rat NADPH cytochrome P450

reductase (James, 1990). The present paper reports a 39

amino acid N-terminal sequence of the cytochrome P450

protein found in the Di fraction and the sequence of a CYP

cDNA cloned from hepatopancreas mRNA by polymerase chain










reaction (PCR) techniques, using primers to this N-terminal

sequence.


Materials and Methods



Isolation of cytochrome P450 Samples for Sequence Analysis


A partially purified cytochrome P450 Di fraction (11.5

nmol spectrally measured cytochrome P450/mg protein) was

obtained from spiny lobster hepatopancreas microsomal

fractions by ion-exchange, hydrophobic, and absorption

chromatography as described previously (James, 1990).

Duplicate samples of the DI preparation were subjected to

SDS-PAGE in one dimension by the method of Laemmli (Laemmli,

1970), as shown in figure 3.1. One gel was stained with

Coomassie blue and analyzed densitometrically (ISCO Model

1312) to determine the percentage of protein in each band.

The major band, at molecular weight 52,500 (see figure 3.1),

was examined for sequence analysis.

Proteins were then electrophoretically transferred from

an unstained gel to an Immobilon PVDF (polyvinylidene

fluoride) membrane (Millipore, Bedford, MA) in the Towbin

buffer system (Towbin et al., 1979). Proteins were localized

on the PVDF membrane by Coomassie blue staining and the

membrane stored at -200C until sequencing. N-terminal amino

acid sequence analysis was carried out at the University of

Florida Protein Chemistry Core facility in the










Interdisciplinary Center for Biotechnology Research (ICBR).

The band of molecular mass 52,500 daltons from the PVDF

membrane (about 4.5 gg protein) was applied to an Applied

Biosystems Model 470A gas-phase protein sequencer with an

on-line analytical HPLC system. The peptide sequence data

was compared with sequences present in the Genetics Computer

Group (GCG, Madison, WI) protein database, using FASTA

computer programs (Dayhoff et al., 1983; Devereux et al.,

1984; Pearson and Lipmann, 1988), as well as the National

Center for Biotechnology Information (NCBI), using the BLAST

network service.


Preparation of RNA, mRNA, and cDNA


The hepatopancreas from a male spiny lobster was

removed and a l-g sample was homogenized in a guanidine

isothiocyanate-containing buffer following the methods of

Chirgwin et al. (Chirgwin et al., 1979). Total RNA was

isolated by centrifugation through a CsC1 cushion.

Polyadenylated RNA was fractionated using an oligo(dT)

affinity push column (Stratagene Cloning Systems, La Jolla,

CA). The mRNA, 5 jg, was incubated with reverse

transcriptase (1000 units, AMV, Life Technologies) in the

presence of 500 pm dATP, dCTP, dGTP, and dTTP (dNTP mix), 50

mM Tris-Cl, pH 8.3, 75 mM KC1, 3 mM MgC12, 10 mM

dithiothreitol, and 1 gg Not I primer/adapter (Life

Technologies, Inc., Gaithersburg, MD) in a total volume of









20 Ri (Okayama and Berg, 1982; Gubler and Hoffman, 1983).

After incubation at 420C for 80 min, the reaction mixture

was placed on ice. A sample, 18 Il, was added to 25 mM Tris-

Cl, pH 7.5, 100 mM KC1, 5 mM MgC12, 10 mM ammonium sulfate,

0.15 mM P-NAD', 0.25 mM dNTP mix, 1.2 mM dithiothreitol, 10

units of Escherichia coli DNA ligase, 40 units E. coli DNA

polymerase I, and 2 units E. coli RNAse H in a total volume

of 0.15 ml. After incubation at 160C for 2 h, 10 units of T4

DNA polymerase was added and the incubation continued for 5

min at 160C. The resulting blunt-ended cDNA was extracted

with an equal volume of phenol:chloroform:isoamyl alcohol,

25:24:1. The DNA in the aqueous phase of the extract was

precipitated by the addition of one-half vol of 7.5 M

ammonium acetate and 2 vol of ice-cold ethanol. The blunt-

ended cDNA was ligated to a Sal I adapter by incubating, in

a 50 il volume, with 50 mM Tris-Cl, pH 7.6, 10 mM MgC12, 1

mM ATP, 5% polyethylene glycol 8000, 1 mM dithiothreitol, 10

ig Sal I adapter, and 5 units T4 DNA ligase for 16 h at

160C. The cDNA in the reaction mixture was extracted and

precipitated as above. The cDNA was then incubated with 50

mM Tris-Cl, pH 8.0, 10 mM MgC12, 100 mM NaC1, and 1200

units/ml Not I endonuclease in a final volume of 0.05 ml for

2h at 370C. The cDNA was isolated as before and size-

fractionated on a Sephacryl-500 HR column. High-molecular

weight cDNA was ligated into Xgt22a using the Lambda

Superscript System (Life Technologies, inc.).









cDNA Library Screening


Degenerate primers HT23 and HT24 were designed against

the N-terminal sequence data derived from sequencing the

52,500 band of the Di fraction (see table 3.1).

The sequences of these primers, and other important

primers used, are shown in table 3.2. Using primers HT23 and

HT24 in a polymerase chain reaction (PCR)(Compton, 1990),

clone II was isolated. The relationships of the different

clones obtained to each other, and to the sequence of the

target cytochrome P450, are shown in figure 3.2. Clone II

was 117 base pairs and coded for 39 amino acids which

differed only by one residue from the N-terminal sequence of

the isolated cytochrome P450 in the Di fraction. Clone I was

then generated using an exact primer, HT26, obtained from

clone II and a vector primer to the 5' end of Xgt22a. Clone

I contained base pairs 1 to 93 of the target cytochrome

P450. Clone IV, which coded for 851 base pairs, was

generated using an exact primer, HT25, obtained from clone

II, and a vector primer to the 3' end of Xgt22a. Clone III,

which represents a cDNA corresponding to all of the coding

region of the mRNA of this cytochrome P450, was isolated

using HT23 and MJ10, primers derived from exact sequence

data in clone V (table 3.2). Clone VI was obtained using

this primer set, but represents an incomplete clone. All

coding regions of the target cytochrome P450 were

represented by at least three independent clones and all









clones were sequenced at least twice. In this manner, a

consensus sequence was obtained. The PCR tubes contained the

following: 5 gl cDNA library in 10 mM MgSO4 (2.9 X 1010

plaque-forming units/ml), 10 il of PCR buffer (500 mM KC1,

100 mM Tris-Cl, pH 8.4, 15 mM MgCl2, and 1 mg gelatin/ml), 1

gl of a solution containing 20 mM dNTP mix, and 100 pmol

each of the degenerate primers or 30 pmol each of

nondegenerate primers. The volume was made up to 99 1l with

sterile, deionized water and the reaction tubes were heated

at 940C for 5 min. Taq DNA polymerase (5 units, Promega,

Madison, WI) was then added for a final volume of 100 gl and

the reaction tubes were heated and cooled for 35 cycles

under the following temperature regime: 940C for 1 min

denaturingg), 510C for 2 min (annealing), and 720C for 3 min

(elongating). A final 10-min extension period at 720C was

included.


Cloning and Sequencing of PCR Products


PCR products were cloned into pGEM-T (Promega) and used

to transform competent JM109 cells. Plasmid templates were

prepared for sequencing using the Wizard Mini-Prep system

(Promega). Manual dideoxy sequencing was done using the

Sequenase Sequencing Kit (USB, Cleveland, OH). Additional

sequencing was done by the ICBR Sequencing Core located at

the University of Florida.










RT-PCR Experiments


Total RNA was isolated from the spiny lobster

hepatopancreas as described above. Ten micrograms of RNA

were used in the following reaction: 100 pmol of an oligo dT

primer to a final volume of 6 gl diethylpyrocarbonate-

treated water. The mixture was heated at 650C for 10 min and

then placed on ice. To this mixture was added 2 jl of PCR

buffer, 1g1 of 20 mM dNTP mix, 1 gl of RNase inhibitor

(Rnasin, Promega, Inc.), 1 1 of Superscript Reverse

Transcriptase (200 units, Life Technologies, Inc.) and the

reaction volume brought up to 20 il with DEPC water. The

reaction mixture was incubated at 420C for 2 hours. Portions

of this reaction, 1 l1, were used in the PCR reaction using

primers HT23 (figure 3.2, 100 pmol) and oligo dT (100 pmol)

under the reaction conditions described above, but with the

annealing temperature of 450C. A portion of the PCR product,

1 gl, was then nested using primers HT25 and MJ11 with an

annealing temperature of 510C.


Northern Blot Analysis


Ten micrograms of RNA isolated from the hepatopancreas

of the spiny lobster were denatured following the methods of

McMasters and Charmichael (1977). After electrophoresis in

1.1% agarose/ 10 mM sodium phosphate buffer, pH 7.0, the RNA

was transferred using a vacuum blotter to a .45 Jpm Magna










nylon membrane (MCI, Westborough, MA) using a vacuum

blotter. The membrane was probed with a 32P-dCTP labeled PCR

product corresponding to the first 705 base pairs of CYP2L.

This probe was labeled by random prime labeling (Pharmacia

oligo labeling kit). RNA in the blots was hybridized by

incubating in a solution containing 0.75 M NaC1, 0.05 M

NaH2PO4H20, 0.005 M EDTA, 0.1 mg/ml herring sperm DNA, 0.1%

SDS for 12 hrs at 680C. The membrane was washed three times

at 680C in 0.025 M NaC1, 0.001 M NaH2PO4H20, 0.1 mM EDTA and

exposed with intensifying screens to X-ray film for at least

12 hrs at -800C.


Results and Discussion



N-Terminal Sequence of Spiny Lobster cytochrome P450


One-dimensional SDS-PAGE showed that the Di preparation from

spiny lobster hepatopancreas microsomes contained a major

protein band of 52,500-Da and some minor bands (figure 3.1).

Densitometric analysis of the Coomassie blue-stained

bands (not shown) showed that the 52,500-Da bands accounted

for 80% of the protein in the Di fraction. Microsequence

analysis of about 5 gg protein from the 52,500-Da band in

the Di preparation showed that this band accounted for 75%

of the total protein. This peptide was sequenced through

residue 39 (table 3.1).




















1" 2 ::/
.:lk'd5L1 *-"&"si'


Figure 3.1. SDS-PAGE of the spiny lobster cytochrome
P450-containing fraction stained with Coomassie blue.
Lane 1, molecular weight standards. Lane 2, DI fraction,
11.5 nmol cytochrome P450/mg protein. The 52,500-Da band
was shown by densitometry to contain about 80% of the
total protein in this fraction.






























Table 3.1.
The N-Terminal Amino Acid Sequences in a
cytochrome P450-Containing fraction' Isolated from Spiny Lobster
Hepatopancreas Microsomes

Sequence Residues identified by microsequencingb

Major MLTGALLLLL VVVIVYLLDK KPSGLPPGIW GWPLVGRMP

Minor' (T)WIK(K)V(L)AM

a The cytochrome P450-containing fraction (Di
fraction) was isolated from spiny lobster
hepatopancreas microsomes as described previously
(James, 1990). The predominant protein band in this
fraction, of mol. wt 52,500 on one-dimensional SDS-PAGE
(see figure 1.3), was used for microsequencing.
b About 40 pmol was submitted for microsequencing as
described under Methods. The overall repetitive yield
was 94%. Parentheses indicate ambiguous amino acid
assignments in the minor sequence.
c The major sequence shown accounted for 75% of the
total protein in this band (30 pmol in the sample
sequenced). The minor sequence in the 52.5 kD DI band
accounted for 20% of the protein (8 pmol). The identity
of this protein is not known.









Partial N-terminal sequence information was obtained

for a minor peptide in the 52,500-Da band (table 3.1).

The first 39 amino acids obtained from N-terminal

sequencing of the 52,000-Da major band in the D1 preparation

included hydrophobic amino acids characteristic of membrane-

bound proteins (Black, 1992).

Comparison of this N-terminal sequence to the N-

terminal sequences of other proteins in the GCG database

revealed similarities to several mammalian cytochrome P450s

in the 2 family (Philips et al., 1983; Labbe et al., 1988;

Ueno and Gonzalez, 1990) and similarities to short stretches

of the N-terminal sequences of cytochrome P450s in the 1,3,

and 4 families (Kawajiri et al., 1986; Hardwick et al.,

1987; Aoyama et al., 1989). From the spectrally measured

cytochrome P450 content of DI (11.5 nmol/mg), the

calculated specific content of a pure cytochrome P450 of

molecular mass 52,500 Da (19 nmol/mg), and the percentage

of protein in the 52,500-Da band (80%), we would expect 76%

of the protein in the Di fraction to be cytochrome P450.

This number matched well with the observed value for the

major component of the Di preparation (75%) and provided

confidence that the 39 amino acid N-terminal sequence was

that of a cytochrome P450 from the spiny lobster

hepatopancreas.


































Table 3.2.
Sequence of some of the Primers Used to Obtain the cDNA Clones

Primer Sequence Type and Location
name


HT23 ATG (CT)TI ACI GGI GCI (CT)TI (CT)TI (CT)T
HT24 GGC ATI C(GT)I CCI ACI A(AG)I GGC CA
HT25 TTG CTG CTG GTG GTA ATA GTC TAC
HT26 TCC CCA TAT ACG TGG GGG AAG TCC
HT36 GTC AAG AAC TGG ATG GGC
MJ10 TGT CAG GAG TGG AGT TAT

Sa.a, amino acid


Degenerate, a.a' 1-8
Degenerate, a.a 39-32
Exact, a.a 9-16
Exact, a.a 31-24
Exact, a.a. 224-230
Exact, 3' to stop codon










cDNA Sequence


Degenerate primers were designed that corresponded to

regions of the 39 N-terminal amino acids of the D1

preparation. The sequences of the degenerate primers and

other selected primers used are shown in table 3.2.

The degenerate primers were used to PCR screen a spiny

lobster cDNA library. The process was repeated with exact

primers to obtain further cDNA sequences. A new exact primer

was required about every 200 base pairs. Sequences obtained

were melded to form a complete sequence (figure 3.2).

A separate clone which coded for all of the cytochrome

P450 sequence was obtained using primers HT23 and MJ10 (see

figure 3.2). This sequence has an open reading frame of 492

amino acids (calculated Mr of 56,669) and contains the heme-

binding signature, residues 429 to 438, that is conserved in

all CYPs (figure 3.3). The individual amino acids that are

invariant in all known cytochrome P450s are highlighted in

figure 3.3 with double underlining. The deduced amino acid

sequence of this clone differs by 1 amino acid in the first

39 amino acids from the microsequenced D1 peptide. Residue

11 of the clone was found to be leucine and not valine, as

in the peptide. Comparison of the deduced 492-amino acid

cytochrome P450 sequence with other protein sequences using

the BLAST program showed that the sequence was highly






















HT23 MJ10
180 360 540 720 900 1080 1260 1470,1530
I 1 1 I I1 I I I CYP2L

Clone I
Clone II
Clone III
Clone IV
Clone V
Clone VI
Figure 3.2. Cloning strategy showing the clones used to meld
together a full-length cDNA sequence. The primers HT23 and
MJ10 shown were used to generate a single clone (clone III)
representing the entire coding portion of the mRNA. The
sequence of these primers are shown in table 3.2.















ATGCTGACGGGGGCGCGCTTTTATTGCTGCTCGGTGTAATAGTCTACCTCCTCGACAAG CCATCAGGA


CTTCCCCCA


CTTAAGCAAC
LPP

GTTOAA0CAC
V K Q

TGCAACTTCA
C N F
CNhF

AAGCTTTTT
K L F
TTTATTCTA
F I L

GCCTGCCTGF
A C L
ACL

GTTCTCAAC
V L N

ACTCAGCTT
T Q L
TOL

CTTTTGATGJ
L L M

TTGAAGATT
L K D

TTGGACGCCT


G A L L L
GALLL

GTATATGGGGATGG
G I V G W

:TGCGTAAAAAGTA
L RK K Y

AATTGGTTAAGACG
K L V K T
KLVKT

GGAAGGCAACGAT
GE G N D

GCCAGCTAGGGAC
R 9 L R D

GTGCAGGACTGAA
V Q E L K
VQKEL(

TGATTTGGAAGCTT
VI W K L

TCACTACCACCACA
L T T T T

ATCACCCCAGACTTT
I T PD F

ACATGK TTTC
Y M K T F

ACCTGATAGATTTG
Y L I D L


CCACTGGTGGGU
PL V G

GGCGACATCAA
G D I I

GCTCTGTCCAAG1
ALKS
A L S X

GTTGGTGTCGTC
V G V V


L G M G


K H T D

GTTGCAGATCACC
V A D H

GACAACATGCAG<
D N M Q

GTCAAGAACTGG
V K N V

ATCAAGGAGCACC
I K E H

CAAGAGCGCAAU


VIVYLLD

OAiTGCCCTCGAGGTCAA
R P 3 R K

kCGTGGCGCATCGGAACCAGA
T W R I G T

TTCGATGCTCAGACAACCA
FECSDRP

CAGTTTT GG GA0420
F S H G V X V

AAGTCCAGACTGGAGGCC
K 5S R L E AA

CACCATGCCCCTACCAAAG
OPMPLPK
a P M P L P K

:GGTATTCGCTTCGATCAA
R Y SL 0 D

iGCTTTGCTTTGMCCTCTTC
GFALILY

TGGGCGTTAGGGTACTACGA
H G VR V L

AGGCCACGCTGGACCCGTCA
SA T L D P 5

PiAGTCCTCTCTCCACATG
E D P L S T


CATCTGG
H L

GTCAAT
V N

GrCTTCT
D F

-ACACGC
0 T

ATCCAGC
I Q

TCCATAI
SI

,AGGGTC
B G

AACTACC
N Y

GACGGG
D G

APCCCA
N P

qARCATTe


PSG

CCGRCCAG
AD o

GTATTCCTT
V F L

TACACtTTC
Y T F


HAR
CrGTCGC





kATAGCTT



Q Y F

TACCGTGG
L P W
LPV

TCTGCGAG
V C I
VCH

AGGACTTA
K D L

GAAACCGTT
ST V


CGAGCCGTGATCATGGACCTGTTTGGCGCTGGTACCGAACCACTTCACATGATACGATGGACATTCTC 936
R A V I M D L F G A G T Z T T 5 T H I R W T r L 312

TATTTGATGAAGTACCCCGAGGTGCAGGCCAGATMCCAGAAGA GAGATCGCCGTCCCTAGGCAC 1008
Y L M K Y P E V Q A K I 0 R E I D A A V P R G T 336

TTACCCTCTCTCGAACACAAGGATAAGTTGGCGTACTTTGAGGC CGATCCACGAGGCACCGCATTGTG 1080
L P S L E H K D K L A Y F K A T I H I V H A I V 360

TCTCTTGTTCCGCTTGGTGTATCCCACTACACCAACCAAGATACCGACTCGCCGGCTACAGACTTCCCAAG 1152
3 L V P L G V S H Y T H 0 D T Z L A G Y R L P K 384

GGGACGTGGTGATG0ATCATCTAGAGTTTCCACAGAGACCCAGTTACTGGG AGACCTA 1224
G T V V M S H L 0 C C H R D P S Y 1 8 K P N E F 408

TACCCGGAACATTTCCTGGACGACACGGGCAAACGTCAAG MCACCGTCAATCTCTTA 1296
Y P E H F L D D Q G K F V K E H L V N t V G 432

CGCCGGGTATGGTTGGGCGAGTCTCTGGCCAGGATGGAGCTCTTCGTCTTCCTGTCGGCGATACTGCAGAC 1366
R R V C V G E S L A R H L F V F L S A I L 0 Q 456

TTCACCTTCTCGGCCCCTAAGGGAGAGGTTGC ACACTGAGAAACCCGACAAATGCTATTCTCTTTT 1440
F T F S A P K G E V L H T E K D P Q Q H L F S F 40

CCCAAGCCCTATCAAGTTATATCAGGAGAG TAGTGTTCCTTTGAACCAGGM GCAACTCC 1512
P K P Y O V I I R E R E 492

ACTCCTGACATTTGGCAGTATAACAAGTTGATGTCCATTCTTGTAACTTATACTG TCATTSGBTACTGG 1584
ATGATA 1590


Figure 3.3. Nucleotide and deduced protein sequence of the spiny lobster
cytochrome P450, CYP2L. The open reading frame of 492 amino acids
defines a protein with a calculated molecular mass of 56,669 Da. The
heme-binding signature is underlined and invariant amino acids in all
known cytochrome P450s are bold and double underlined.











similar to cytochrome P450s in the 2 family but not to any

non-cytochrome P450 sequences. Rat CYPs 2B1, 2B2, and 2D4

were all 36% identical at the amino acid level to the spiny

lobster sequence. While several studies have shown the

catalytic activity of a cytochrome P450 is not necessarily

indicative of a particular cytochrome P450 family, it was of

interest that previous reconstitution experiments with the

Di cytochrome P450 showed good activity with substrates

commonly monooxygenated by cytochrome P450s in the 2B

family, such as testosterone (63 and 16a), progesterone

(16a), benzphetamine, and aminopyrine (James, 1990; James

and Shiverick, 1984).

Although the overall sequence identity of the spiny

lobster cytochrome P450 with cytochrome P450s in the 2

family was less than 40%, this new form was assigned to the

2 family by the CYP nomenclature committee and given a new

subfamily name, CYP2L.

Because the N-terminal sequence of the CYP2L described above

was 1 amino acid different from the cytochrome P450 sequence

in the DI fraction, obtained by microsequencing of the

protein, the spiny lobster hepatopancreas cDNA library was

rescreened by PCR with an exact probe to the N-terminal

sequence. Other positive clones were obtained and have been

partially sequenced. The deduced N-terminal amino acid

sequence of one of these clones was identical to the first

39 amino acids of the Di cytochrome P450 protein. This
















50 50
SA B
25



-25 -25
-2501 51

-50 ............... ......... ....... ......... -50 ,... .. ,,| ..... ... ... ... ... ..
S100 200 300 400 100 200 300 400
S50 50



25:14 25j



50 -50
-50 ......... |........ lii... .... .... .. .. ii -50 iirii .l ... i ...|. .lll|.. ...... l I. l.
100 200 300 400 500 100 200 300 400
Residue Number

Figure 3.4. Hydropathy plots of the rat CYP2B1 (Fujii-
Kuriyama et al, 1982; accession number J00719)(A), rat
CYP2B2 (Mizukami et al, 1983; accession number A21162)(B),
rat CYP2D4 (Matsunaga et al, 1990; accession number
P13108)(c), and spiny lobster CYP2L (accession number
U44826)(D). The hydropathy index computation was done using
PCGENE (Intelligenetics, Mountain View, CA) with an interval
(sliding window) of nine amino acids (Kyte and Doolittle,
1982).









suggests that there may be other closely related members of

the CYP2L subfamily in spiny lobster hepatopancreas.


Comparison With Other 2 Family CYPs


Comparisons of hydropathy plots of CYP2L and rat CYPs

2B1, 2B2, and 2D4 indicate several structural similarities

between these forms (figure 3.4). The peaks that line up in

all forms appear to correspond to alpha helical regions

present in 2 family members.

The alignment of primary sequences of CYP2L and rat CYPs

2B1, 2B2, and 2D4 are shown in figure. 3.5. Some regions of

the sequence of spiny lobster 2L and rat 2 family CYPs show

high homology, whereas other regions bear little similarity

to each other. It was remarkable that the string of leucines

at positions 6-11 of the spiny lobster CYP2L and the PPG

cluster at spiny lobster 2L residues 26-28 were found in

several members of the mammalian 2 family cytochrome P450s

(Philips et al., 1983; Labbe et al., 1988; Kawajiri et al.,

1986). These highly conserved portions probably contribute

to the hydrophobicity of the N-terminus and its ability to

associate with microsomal membranes (Black, 1992). Substrate

recognition sites (SRS) have been suggested for rat 2B2 at

positions 97-118 (SRS1), 199-206 (SRS2), 234-242 (SRS3),

287-305 (SRS4), 360-370 (SRS5), and 471-478 (SRS6) by Gotoh

(1992). The 2L sequence has residues in common with other 2

family members in several of these substrate recognition













RAT2B1 -- ep t aL-Vg- --1 vr ghp r gn-i pl l qldrg 49
RAT2B2 --eps LLLL-lvrgh n rpl Llqldrg 49
CYP2L --lt-------M-psrsk 43
RAT2D4 rmptgs paIft vdlmhrrqRw trLlqidfq 55
RAT2B1 lns Vftdt gqaeD tiavi 104
RAT2B2 &lnsf tQLPeKYG frvhIep t c tdt glgqaeoD sggtiavi 104
CYP2L D _dqv ELYGIfkl --Ec fyt 96
RAT2D4 nMpagfq LcR GfSlqLafes glpaLR seDR 1hfn 110
RAI2BI epi-t--l:Sq l1RL 155
RAT2B2 epi-f--kE REL 155
I LnD ': 149
RAT2D4 dqs 4Gqprs waIArys rq RR st f9 aG aEwVtef La 165
RAT2B1 E-sqga LdptflfQc ta csf gFdyqflrll yfslLs 210
RAT2B2 sLPJsqgaPLdptflfQci tllcsf gePFdytr qflrll s L5L 210
CYP2L pksINA adhgqyftq 204
RAT2D4 afadg sgffpntlLd AypNaqLfac Fey rfirll diEees 220
RAT2B1 sQlFfsgf ------a qIsknL JilI ghiVe TL 259
RAT2B2 -EsQF-f fsgky? .---. --ahIsknLE Y ghiVe aTLDP 259
CYP2L FylF ELitfVknwmg vLrd ktfl TLDP 259
RAT2D4 jp ylv -i ------1LgkVf sjpkafvamLdelLtvSA 268
RAT2B1 a Of IrYErMe ke nhhTefhhLmis LLStG tggl 313
RAT2B2 -? i '. rM rrr r.r LL TE i 313
CYP2L N- c~i s GTETT 313
RAT2D4 .p 3E~ek 323

RAT2B2 vIgsh 368
CYP2L L I aVprg PShKda EtHEivPLGs 368
RAT2D4 MIl I vIgqvr rleMadqaRMp Ft nuH adIL'LG_ p 378

RATB21 tt5 iy ssal YFD t EHFLt 1ls 423



RAT2B2 Ea MFGIILQNF hla-pkdiDl ees gI 477
CYP2L l EL hTE qm-L 477
RAT2D4 EL fTcrpDyg--ifga 486

RAT2B1 gk itYcfsaM- 491
RAT2B2 gk oIcfs- 491
CYP2L fS fYQ iirePe 492
RAT2D4 IT tRYLcasp- 500

Figure 3.5. Comparison of the deduced amino acid sequence of
CYP2L with that of rat CYPs 2B1, 2B2, 2B4 (accession number
S19172) and 2D4. Boxes show residues that are identical
between 2L and 2D4 or the 2B subfamily members, while
conserved amino acids are indicated by capital letters. For
the complete sequence, there were 115 amino acids (23.4%)
that were identical in all five forms and 64 additional
similar amino acids (13.0%). Comparing the C-terminal half
(residues 250-492) of CYP2L with the C-terminal halves of
2B1, 2B2, 2B4 and 2D4, there were 73 identical residues
(30.3%) and an additional 38 similar residues (15.8%). These
comparisons were made using CLUSTAL V.










sites. The GV residues at CYP2L positions 106-107 fall in

SRS1 and are identical in the sequences shown in figure 3.5.

In SRS2, the leucine at CYP2L position 195 and the T at

CYP2L position 199 are present in the rat sequences (figure

3.5). In SRS4 there were several residues found in all five

sequences, i.e., LF at 295-296, AG at 298-299, T at 302, and

ST at 304-305 (figure 3.5). In SRS5 residues P (364), GV

(366-367) and H (369) were common in the compared sequences.

It has been suggested that S at position 304 and V residues

at positions 363 and 367 may contribute to substrate binding

(He et al., 1994). The regions designated as SRS3 and SRS6

did not have common residues in the 2 family members that

were compared in figure 3.5. Other highly conserved regions

are found at residues 119-121, 252, 257-258, 325, 327-329,

408, 410-415, 438-439, 442-443, 445-447, 449, and 454-455

(figure 3.5). Several investigators have noted that regions

of the C-terminus of cytochrome P450 sequences show greater

homology overall than N-terminal regions (Kalb et al., 1988;

Lewis, 1995). This is true for the CYP2L sequence with

selected rat 2B and 2D sequences (figure 3.5).


Northern Blot and RT-PCR


Northern blot analysis reveals a primary transcript of

about 1.8 kB in size (figure 3.6).

This result serves to confirm that the message for

CYP2L1 is present in the spiny lobster hepatopancreas.










Furthermore, there is an indication of a second transcript

around 1.5 kb (figure 3.6). Experiments using RT-PCR also

suggest the existence of a second transcript (figure 3.7),

however these results require confirmation.

There are numerous examples of alternatively spliced

cytochrome P450 messages in the 2 family (Kimura et al.,

1989; Miles et al., 1989 Yamano et al., 1989; Lacroix et

al., 1990). What function such a transcript may serve is

unknown. Our lab consistently notes a 30 kDa band that

immunoreacts with a polyclonal antibody to CYP2L on Western

Blots (Boyle and James, 1996).

The only other invertebrate cytochrome P450s that have

been sequenced and assigned families to date have been from

insects and a pond snail and are in the 4,6, and 10 families

(Nelson et al, 1993). Thus, this is the first report of a 2

family cytochrome P450 in an invertebrate and extends the

incidence of this family in the animal kingdom.





















kb


2.4>


1.4>





Figure 3.6. Northern blot of total RNA isolated from the
hepatopancreas of the spiny lobster. Ten micrograms of total
RNA were blotted onto a nylon membrane and probed with a
32P-CTP-labeled probe, as described in Methods. Arrows mark
a possible 1.5 kb message (lower arrow) and about a 2.1 kb
message (upper arrow).




















kb

1.90






.95
.83

Figure 3.7. RT-PCR of total RNA isolated from the spiny
lobster hepatopancreas. RNA was primed with an oligo-dT
primer and reverse transcribed as described in Methods.
Using HT25 and MJ11, a primer just upstream to the poly-T
tail, two bands were detected. The band at around 1.8 kb
(upper arrow) is the expected product for a normal
transcript. The product around 1.0 kb (lower arrow) may
represent an alternatively spliced message.















CHAPTER 4
CATALYTIC CHARACTERIZATION OF CYTOCHROME P450 2L1 IN
BACTERIAL AND YEAST EXPRESSION SYSTEMS


Introduction


Cytochrome P450 enzymes catalyze the insertion of

oxygen into both endogenous and exogenous substrates found

in many animal and plant species (Nelson et al., 1993). In

its dual role, cytochrome P450s function as integral parts

of biosynthetic pathways, such as steroid biosynthesis, and

in the initial or phase I detoxification pathways of

xenobiotics.

Tissues from several crustacean species are able to

metabolize various steroid hormones in vitro (Table 4.1).

Studies have shown that invertebrates possess steroid

hormones similar or identical to those found in mammalian

species (Burns et al., 1984; Fairs et al., 1989). Tcholakian

and Eik-Nes (1971) reported that progesterone could be

metabolized to 11-deoxycorticosterone (21-

hydroxyprogesterone), androstenedione and to 20-

hydroxyprogesterone in the androgenicc gland" of the blue

crab, reactions that can be catalyzed by cytochrome P450.

Ovarian tissues from the crab, Portunus tritubeculatus,

hydroxylate progesterone in the 17a-position (Teshima and

Kanazawa, 1971). The shore crab, Carcinus maenas,

























Table 4.1. in vitro Steroid Metabolism in Crustacean Species

species organ substrate(s) products)


Blue crab
Callinectes sapidus

Crab
Portunus trituberculatus

shore crab
Carcinus maenas


AG P 210HP,200HP Tcholakian and
Andro Eik-Nes, 1971


Ovaries


Testes Andro


VD + AO estrone 17POHE


17cOHP Teshima and
Kanazawa, 1971

T Blanchet et al.
1978


American lobster
Homarus americanus

Shrimp
Penaeus monodon

Florida spiny lobster
Panulirus argus


Testes


Ovaries

purified
protein
from
HP


200HP


200HP


Burns et al.,
1984

Young et al.,
1992


T 16aOHT,160H3T James and
600HT Shiverick, 1984
P
16aOHP,6POHP
17aOHP,210HP


AnG Ec
200HEc

HP=hepatopancreas, VD=vas deferens, AG=androgenic gland, AnG=antennal gland.
P=progesterone, Andro=androstenedione, Ecdysone, 210HP=21-hydroxyprogesterone,
200HP=20-hydroxyprogesterone, 17aOHP=17a-hydroxyprogesterone, 17POHE=170-
estradiol, 16aOHT=16a-hydroxytestosterone, 1600HT=16j-hydroxytestosterone,
6pOHP=6p-hydroxyprogestererone, 200HEc=20-hydroxyecdysone.


reference










metabolizes androstenedione to testosterone and estrone to

17p-estradiol in vas deferens and testes tissue preparations

(Blanchet et al., 1978). Lachaise and Lafont (1984)

demonstrated that the shore crab could metabolize

ponasterone A (25-deoxy-20-hydroxyecdysone) to 25-

hydroxyecdysone. American lobster testes were shown to

metabolize progesterone to 20-hydroxyprogesterone (Burns et

al., 1984), and shrimp, Penaeus monodon, ovary was also

shown to metabolize progesterone to 20-hydroxyprogesterone

(Young et al., 1992).

James reported that the Ml fraction from the spiny

lobster hepatopancreas could metabolize a variety of

substrates (Table 4.2, James, 1990; James, 1989). Two

catalytically active fractions (D1 and D2) of cytochrome

P450 in the spiny lobster hepatopancreas were isolated

(James, 1990). The fractions have a similar apparent

molecular mass and overlapping substrate preferences for

benzo-a-pyrene, benzphetamine, ethoxycoumarin, testosterone

and progesterone (James, 1990; James and Shiverick, 1984).

Progesterone was hydroxylated in the 16a, 60, and 21

positions, while testosterone was hydroxylated in the 16a,

16p and 6p positions (Table 4.2, James, 1990, James and

Shiverick, 1984). Hydroxylation of progesterone or

testosterone at the 16 or 6 position diminishes the

biological activity of these steroids. The molting hormone,

ecdysone, was metabolized to 20-hydroxyecdysone in

mitochondria from spiny lobster antennal gland, as well as























Table 4.2. Monooxygenase Activity of Spiny Lobster Cytochrome P450
Fractions in the Presence of NADPH and NADPH-Cytochrome P450 Reductase
from Rat Liver.


P450

Substrate

Benzphetamine

Aminopyrine

7-Ethoxycoumarin

Methylphenoxazone

Ethylphenoxazone

Pentylphenoxazone

Benzylphenoxazone

Benzo(a)pyrene

Testosterone 16a-

6P-

Progesterone 16a-

6P-

21-


Nanomoles product formed/min/nmol cytochrome


M1

26.3+5.3 (8)

19.8

0.325+0.139 (4)

0.0189

0.0620.051 (5)

0.002

0.010

1.43+0.41 (5)

1.3

0.6

4.96+0.28 (8)

1.18+0.41 (8)

0.670.42 (8)


D1

50+15 (4)

40

0.1400.023 (3)

0.0040.001 (3)

0.0070.002 (4)

0.011+0.001 (3)

0.0040.001 (3)

1.97+0.83 (5)

8.6515.81 (3)

7.31+6.16 (3)

43.4+9.1 (3)

0.90.3 (3)

0.47+0.02 (3)


D2

122+62 (4)

76

0.183

0.005+0.001 (3)

0.00510.002 (3)

0.013+0.001 (3)

0.0030.001 (3)

1.540.39 (4)

4.1

3.4

21.1

6.2

0.41


Note: Values shown are means SD (n) or individual values. This data was
taken from (James, 1990). M1=solubilized microsomal fractions, D1 and D2
are chromatographic fraction of the M1 material.










in gonadal tissues and hepatopancreas mitochondria (James

and Shiverick, 1984).

We have cloned a cytochrome P450, cytochrome P450 2L1,

from the hepatopancreas of the spiny lobster (James et al.,

1996). The first 39 amino acids deduced from the DNA

sequence of cytochrome P450 2L1 are nearly identical to N-

terminal amino acid sequence data obtained from the D1

fraction, differing by only one amino acid (James et al.,

1996). This difference, a substitution of a leucine for a

valine, is a conservative change. However, a clone was

obtained in which this substitution was absent (James et

al., 1996).

The following study reports upon the expression of

cytochrome P450 2L1 in bacteria and yeast. Functional

cytochrome P450 2L1 was obtained from yeast and its

catalytic activity determined using testosterone and

progesterone substrates.


Materials and Methods



Spiny Lobster and Rat Protein Preparations


Microsomes were prepared from a male spiny lobster

hepatopancreas as described previously (James, 1990). The

"Ml" fraction was prepared by stirring the microsomal

fraction in 0.5% cholic acid for 1 hr at 4C. The mixture









was centrifuged at 110,000 x g for 90 min and the dense, red

liquid fraction isolated (Ml fraction, James, 1990).

Cytochrome P450 reductase was isolated from

phenobarbital-treated rats (80 mg/kg for 4 days) by the

method of Yasukochi and Masters (1976). Protein

concentration of the various preparations described in this

paper were done using the method of Lowry et al. (1951).

Spectral determination of cytochrome P450 content followed

the procedure of Estabrook (1972). SDS-PAGE was done using

the methods of Laemmli (1970).


Construct Preparation


Two cytochrome P450 2L1 constructs were prepared for

insertion into bacterial or fungal cells. The first

construct, AO, was designed to express the entire deduced

amino acid sequence of cytochrome P450 2L1. AO was

generated using primers MJ24 and MJ25 (table 4.3 and figure

4.1). A Xgt22a cDNA library made from spiny lobster

hepatopancreas (James et al., 1996) was screened using these

two primers in a polymerase chain reaction (Compton, 1990).

The PCR tubes contained the following: 5 li cDNA library in

10 mM MgSO4 (2.9 X 1010 plaque-forming units/ml), 10 gl of

PCR buffer (500 mM KC1, 100 mM Tris-Cl, pH 8.4, 15 mM MgC12,

and 1 mg gelatin/ml), 1 pl of a solution containing 20 mM

dNTP mix, and 30 pmol of each primer. The volume was made up

to 99 ig with sterile, deionized water and the reaction























Table 4.3. Primer Sequences Used in this Study.

Primer
Name Sequence Comments

BRN1 AGTCGAATTCCATATGGCTCTGTTATTA GCACTTTTTTTATTGCTG CTGGTG 5'-EcoR I,
M A L L L A V F L L L L V Nde I sites

AGTCGAATTCCATATGCTGACGGGGGCG CTGCT 5'-EcoR I,
MJ25 M L T G A L L Nde I sites

MJ24 GCGAATTCGTGCACTCACTCCCTCTCCCT GATGA 3'-EcoR I,
(- E R E R I I)' Sal I sites

M13 CGCCAGGGTT TTCCCAGTCA CGAC 5'-
polylinker
HT26 TCCCCATAT ACCTGGGGGAAGTCC 3'-antisense
G W I G PP LG

HT36 GTC AAG AAC TGG ATG GGC 5'-sense
V K N W M G

HT38 ATC TTT CAA CTC GCA GAC CCC 3'-antisense
(D K L E C V G)1

Ph94 GACTGGTTCC AATTGACAAG C 5'-AOX1 site
(5' to
polylinker)
Ph93 GGATGTCAGA ATGCCATTTG C 3'-AOX1 site
(3' to
polylinker)

'Residues in parenthesis are the inverse translation products















EcoR I M L T G A L L
MJ25 5' AGTCGAATTCCAT ATG CTG ACG GGG GCG CTG CT 3'
Nde I


EcoR I E R E
MJ24 5' GCGAATTCGTCGAC TCA CTC CCT CTC
Sal I


EcoR I M
BRN1 5' AGTCGAATTCCAT ATG
Nde I


R I I
CCT GAT GA 3'


A L L L A V
GCT CTG TTA TTA GCA GTT


F L L L L V
TTT TTA TTG CTG CTG GTG
CYP 2L1

Figure 4.1. The oligonucleotide sequence of expression
primers MJ25, MJ24, and BRN1. MJ25 and BRN1 both incorporate
unique EcoR I and Nde I endonuclease restriction sites to
enable ligation of the PCR product into expression vectors
that have these sites within the polylinker region. MJ24
incorporates unique EcoR I and Sal I sites into a PCR
product. The resulting PCR product contains 5' and 3' EcoR I
sites, and a 5' Nde I site and a 3' Sal I site.










tubes were heated at 940C for 5 min. Pmo I (5 units,

Boehrinher Mannheim, Inc.), a thermostable DNA polymerase

with proofreading capabilities, was then added for a final

volume of 100 il and the reaction tubes were heated and

cooled for 35 cycles under the following temperature regime:

940C for 1 min denaturingg), 600C for 2 min (annealing), and

720C for 3 min (elongating). A final 10-min extension period

at 720C was included. A full length clone was constructed

and ligated into pGEM-T (Promega).

A second construct was prepared, Al, and was designed

to replace the first 7 amino acids of cytochrome P450 2L1

with the amino acids MALLLAVF (the Barnes modification). Al

was generated using primers BRN1 and MJ24 (see table 4.3 and

fig 4.1) in a PCR reaction using conditions identical to

those used for 0A. Al was also ligated into pGEM-T.


Bacterial Expression Vectors


AO and Al were excised from pGEM-T using either Nde I and

Sal I endonucleases or only EcoR I endonuclease, depending

upon which bacterial expression vector was to be used (see

table 4.4 for characteristics of the various expression

vectors used in this study). The Nde I/Sal I endonuclease

pair was used for DNA products to be directionally inserted

into pET21c, pET28a or pCW. EcoR I Nde I/Sal I endonuclease

reactions were as follows: 1 gg of plasmid DNA containing

either the AO or Al construct was incubated in 50 mM Tris-
































Table 4.4. Expression Vectors Used in this Study and their
Attributes

Vector Polylinker Selection Bacterial Strain Tag Promoter
pMAL-p2 EcoR I Ampicillin DH5a C-MBP tac
pCW Nde I/Sal I Ampicillin DH5a C-PH (NU) tac
pPET21c Nde I/Sal I Ampicillin BL21 C-PH (NU) T7
pPET28a Nde I/Sal I Kanamycin BL21 N-PH T7
pPICZa EcoR I Zeocin GS115 none AOX1

C-MBP=C-terminal maltose binding protein; C-PH=C-terminal polyhistidine;
NU=not used; N-PH=N-terminal polyhistidine; AOXl=Alcohol Oxidase 1.










Cl, pH 8.0, 10 mM MgCl2, 100 mM NaC1, 1200 units/ml Nde I

and Sal I endonuclease in a final volume of 0.05 ml for 2h

at 370C. The excised DNA was gel purified and portions (1/10

of the total product recovered from the gel) ligated into

pCW, pET28a and pET21c vectors that had been digested and

gel purified in the same manner.

EcoR I endonuclease reactions were as follows: 1 gg of

plasmid DNA containing either the AO or Al construct was

incubated in 90 mM Tris-Cl, pH 7.5, 50 mM NaC1, 10 mM MgCl2,

1200 units/ml EcoR I in a final volume of 0.05 ml for 2h at

370C. The excised DNA was gel purified and a portion (1/10

of the total product recovered from the gel) was ligated

into pMAL-p2.

DH5a bacterial cells were transformed with pCW and

pMAL-p2 constructs, while BL21 cells were transformed with

the pET vectors (table 4.4). Positive colonies were

determined using PCR and either two internal primers (HT36

and MJ24 for directional inserts) or a 5' vector primer and

a internal primer (M13 and MJ24 for bi-directional inserts).


Yeast Expression Vector


AO was excised from pGEM-T using EcoR I endonuclease

and ligated into pPICZa, a bi-directional vector, as

described above. This plasmid was then transformed into

JM109 competent cells. Positive colonies were identified by

PCR using a primer to the cytochrome P450 2L1 sequence









(HT38) and a primer to the vector (Ph94, Table 4.3). The PCR

experiments were designed to identify the correct

orientation of the DNA insert for expression. Plasmid DNA

(Qiagen, Chatsworth, CA) from a positive colony was isolated

and a portion of the plasmid DNA used for sequencing in

order to confirm the correct orientation and sequence the

cDNA .

Twenty micrograms of the plasmid DNA was digested

overnight at 250C in 20 mM Tris-acetate, pH 7.9, 10 mM Mg-

acetate, 50 mM K-acetate, 1 mM DTT, 200 units/ml Pme I (New

England Bio Labs, Inc.) and sterile, deionized water to a

final volume of 100 il.

Constructs linearized with Pme I were used to transform

GS115 cells (Pichia pastoris) by electroporation (Gene

Pulser, BioRad, Hercules, CA). Transformed cells were grown

on 2% (w/v) agar plates containing 1.0 M sorbitol, 1.0%

(w/v) dextrose, 1.34% (w/v) yeast nitrogen base lacking

amino acids, 4 x 10-5% (w/v) biotin, 0.005% (w/v) amino acid

mixture (50 mg each glutamic acid, methionine, leucine,

lysine, and isoleucine per liter DI water), 0.004% (w/v).

Colonies were randomly picked and grown in 3 mls of a

solution (MGYH) containing 1.34% (w/v) yeast nitrogen base,

1.0% (v/v) glycerol, 4 x 10-5% (w/v) biotin, 0.004% (w/v)

histidine. An aliquot of the broth containing the colonies

(5 p1) was removed and subjected to PCR analysis (in order

to determine what colonies underwent successful integration

of the cytochrome P450 2L1 construct), using an internal










primer (HT38) to cytochrome P450 2L1 and a vector primer

(Ph94).


Expression of Cytochrome P450 2L1 in Bacteria


Positive colonies containing the cytochrome P450 2L1

constructs AO or Al were grown overnight at 370C in 1 ml of

LB (Luria-Bertani broth) containing either 1 Ig

ampicillin/ml LB (pCW and pMAL-p2 transformants,) or 1 gg

kanamycin/ml LB (pET transformants, see table 4.4 for

antibiotic requirements of the various expression vectors).

In all cases, the overnight culture was diluted 1:100

in 100 ml LB culture with the appropriate antibiotic, and

the bacteria grown to a cell density of ODsoo between 0.70 to

0.80. isopropyl thio-P-D-galactoside (IPTG) was added to the

culture to a final concentration of 0.4 mM. The cultures

were grown an additional 3 hrs and harvested by

centrifugation (5,000 x g for 5 min, 40C). Cell pellets were

resuspended in 10 mls of buffer A (10 mM potassium

phosphate, pH 7.5, 0.15 M NaC1).

Cell pellets were subjected to 20 second sonication

bursts while on ice until no viscosity was evident in the

solution (typically 3 to 4 bursts were required). The

ruptured cells were centrifuged at 12,000 x g for 15 min at

40C. The pellet, consisting of insoluble material or

"inclusion bodies", was resuspended in 10 mls of buffer A.

The supernatant, consisting of soluble proteins and cell










membrane, was centrifuged at 180,000 x g for 65 min at 4'C.

The pellet from this spin was solubilized in 0.5% cholic

acid for 1 hr and the mixture centrifuged at 180,000 x g for

65 min at 4C. In addition, the inclusion body fraction was

solubalized in 0.5% cholic acid, and centrifuged at 12,000 x

g for 15 min at 40C.

Cytochrome P450 2L1 expressed from the pET28a vector

was purified using metal chelation chromatography. A His-

Bind (Novagen) column was poured and inclusion bodies

solubilized in 6 M urea were passed over the column. The

pure protein was eluted in 1.0 M imidazole.


Expression of Cytochrome P450 2L1 in Yeast


A positive colony was grown in 200 mls of MGYH. After 2

days at 300C, cells were pelleted (1,500 x g for 10 min) and

brought up in 200 mls of a solution containing 1.34% (w/v)

yeast nitrogen base, 1 x 10-5% (w/v) biotin, 0.5% (v/v)

methanol, 0.005% (w/v) histidine. Two days later (at 300C),

the cells were pelleted and resuspended in 10 mls of buffer

containing .15 M KC1, 0.05 M potassium phosphate, pH 7.4,

0.1 mM EDTA, 0.2 mM PMSF. Microsomal fractions were prepared

as described previously (James, 1990) with the following

modifications: after the cells were lysed in a French press,

the ruptured cell solution was centrifuged at 30,000 x g to

fractionate the nuclear DNA and mitochondria. The

supernatant was centrifuged at 100,000 x g for 45 min at 4C









and the microsomal pellet was resuspended in 0.25 M sucrose,

0.05 M Kpi, pH 7.4, to a final concentration of about 12 mg

microsomal protein/mi buffer.


Testosterone and Progesterone Assays


Steroid metabolism studies (n=l) in both intact cells

and microsomal fractions was done following the procedures

of James and Shiverick (1984). Whole cells (-9.3 x 109, where

OD6oo= 5.0 x 107 cells/ml) or microsomes (.12 mg or .096

nmol/ml) were placed into a tube containing the following:

53 pM [14C]-testosterone (specific activity 57 pci/pmol,

Amersham, Arlington Heights) or 43 pIM [14C]-progesterone

(specific activity 56 gci/pmol), 0.05M KPi, pH 7.4, 5 mM

MgC12, and DI water to a final volume of .25 mis.

Reactions were initiated with the addition of NADPH (2

mM, Sigma Chemical Co.) and incubated at 300C for 20 min.

Ethyl acetate (3 X 1.5 mis) was used to terminate and

extract the reaction products. The ethyl acetate fractions

were evaporated under N2 and the residues brought up in 100

il for TLC analysis.

Linear K silica (LK5DF) gel TLC plates (Whatman Int.,

Maidstone, England) were predeveloped in 100% MeOH to remove

impurities and allowed to dry. Reaction product (50 2l) were

spotted and the plates developed three times in the

following system: 70:38:0.8:1.0 diethyl ether: toluene:

MeOH: acetone. The plates were allowed to dry and were









subjected to autoradiography. Steroid standards purchased

from Sigma Chemical CO. (St. Louis, MO) and Steraloids

(Wilton, NH) were used.


Immunoquantitation of cytochrome P450 in Yeast Microsomes


Microsomal protein, 1 and 5 jg, was subjected to SDS-

PAGE. The gel was electroblotted onto PVDF membrane as

described previously (James et al, 1996). A primary antibody

(10 lg serum/ml tris-buffered saline, 0.05% (v/v) tween-20;

a 1:500 dilution) to a major form of cytochrome P450 from

the spiny lobster hepatopancreas (Boyle and James, 1996) was

used to detect cytochrome P450 2L1 in yeast microsomes. This

antibody was incubated overnight at 40C with wild-type

microsomes (1 gg antibody to 4 gg microsomes) and

centrifuged the next day for 10 minutes at 14,000 x g. The

supernatant was used in the Western blot. The secondary

antibody was a goat-anti-rabbit antibody (1:3000

dilution)conjugated to alkaline phosphatase (BioRad).

Desitometric analysis of the Western blot and of the TLC

autoradiographs was done using an electrophoretic image

band analysis system (Bioimage).










Results



Bacterial and Fungal fractions


SDS-PAGE of bacterial whole cell lysates show an

inducible protein product with an apparent molecular mass of

approximately 50 kDa (figure 4.2). When western blot

analysis of whole cell lysates is done, an immunoreactive

band is seen in the 50 kDa region (figure 4.3).

Solubilization of the bacterial membranes with cholic

acid produces a protein with an apparent molecular mass

approximately 58.5 kDa (figure 4.2). In addition,

solubilization of the inclusion bodies also liberates a

protein of an apparent molecular mass approximately 58.5 kDa

(figure 4.2). Metal chelation chromatography with inclusion

bodies solubalized in 6 M urea produces the same results,

that is, a single band at an apparent molecular mass of 58.5

kDa (figure 4.4).

An estimate of the amount of cytochrome P450 present in

the yeast microsomes was obtained using a polyclonal

antibody to spiny lobster cytochrome P450 2L (Figure 4.5).

We estimate that the transformed yeast produce between 0.02

and 0.05 pmole of cytochrome P450 2Ll/Rg yeast microsomal

protein.
























kDa

66.2----- :

45.0506-


1 2 3 4 .5 6 7

Figure 4.2. SDS-PAGE of induced bacterial cells (BL21)
expressing cytochrome P450 2L1 from the expression vector
pET28a. Lane 1, 500 pl of bacterial cells in SDS-PAGE
running buffer; 2, 12,000 x g pellet of the culture; 3,
12,000 x g pellet solubalized in 0.5% cholic acid; 4,
12,000 x g supernatant from the lane 3 treatment; 5,
12,000 x g pellet from lane 3 treatment; 6, 180,000 x g
supernatant from lane 2 supernatant; 7, 180,000 x g
supernatant from lane 3 treatment. Arrows indicate a
protein approximately 58.5 kDa.























kDA

66.2 -. ,p.
50.6-
45.0




1 "2 3
Figure 4.3. Western blot of total cell lysate from BL21
bacterial cells expressing the pET28a construct induced
with 0.4 mM IPTG. Lane 1, uninduced culture; 2, culture 1
hr. 30 min. post-induction with IPTG; 3, culture 3 hr.
post-induction with IPTG.























kDa

66.2-- U -

50.6--
45.0--


1 2 3 4 5
Figure 4.4. SDS-PAGE of pET28a derived cytochrome P450
2L1 expressed in bacterial cells (BL21) and purified
using metal chelation chromatography. Inclusion bodies
were solubalized in 6 M urea and passed over a His-bind
column. The image was enhanced in order to see the pure
protein (arrow), with an apparent molecular mass of 58.5
kDa. Lane 1, material that passed through the column
while loading; 2, column wash; 3, first fraction
following elution in a 1.0 M imidazole buffer; 4, second
fraction; 5, the third fraction.
























1 2 3 4 5 6

52.4 Kd-- -




Fig. 4.5. Western blot of microsomes from yeast
containing the cytochrome P450 2L1 insert. Proteins were
subjected to SDS-PAGE and blotted onto a PVDF membrane as
described in the Methods section. Densitometric analysis
of the microsomes from yeast expressing cytochrome P450
2L1 indicate a cytochrome P450 concentration of about
0.02 pmol cytochrome P450/ig yeast microsomal protein.
Control microsomes were made from wild type yeast.
Purified cytochrome P450 was isolated from the
hepatopancreas of the Florida spiny lobster as described
previously (James, 1990). Lane 1, wild type yeast
microsomes, 5 gg; 2, microsomes from yeast expressing
cytochrome P450 2L1, 5 gg; 3, microsomes from yeast
expressing cytochrome P450 2L1, 1 lg; 4, purified
cytochrome P450, 0.35 pmol; 5, purified cytochrome P450,
0.25 pmol; 6, purified cytochrome P450, 0.15 pmol. The
expressed cytochrome P450 2L1 has an apparent molecular
mass of about 50 kDa.










Steroid Metabolism


[14C]-testosterone was hydroxylated in the 16c position

(1.37 nmol/min/nmol cytochrome P450 2L1 and 2.31

nmol/min/nmol cytochrome P450 2L1 in incubations fortified

with rat cytochrome P450 reductase) by microsomes from yeast

expressing cytochrome P450 2L1 (Figure 4.6). Two other polar

metabolites were produced in trace amounts. A more nonpolar

metabolite in reference to testosterone was produced in an

NADPH-dependent, rat cytochrome P450 reductase-independent

manner, but was not identified.

Intact whole yeast cells expressing cytochrome P450 2L1

incubated with [4C]-testosterone, produced 16a-

hydroxytestosterone, the two polar unknowns, and one

nonpolar unknown. Intact whole cells did not require the

addition of rat cytochrome P450 reductase nor NADPH (figure

4.7).

[14C]-progesterone produced a polar metabolite (2.93

nmol/min/nmol cytochrome P450 2L1 and 3.60 nmol/min/nmol

cytochrome P450 2L1 in incubations fortified with rat

cytochrome P450 reductase) that co-migrated with a 16a-

hydroxyprogesterone standard when incubated with microsomes

from yeast expressing cytochrome P450 2L1 (Figure 4.6). One

other polar metabolite was apparent, but was produced in

trace amounts and we were unable to accurately quantify it










using densitometric methods. A more nonpolar metabolite in

reference to progesterone was produced.

Intact whole cells expressing cytochrome P450 2L1

incubated with ['4C]-progesterone, produced 16a-

hydroxyprogesterone, the polar unknown, and a nonpolar

unknown. Intact whole cells, as with the testosterone

incubations, did not require the addition of rat cytochrome

P450 reductase nor NADPH (figure 4.7).

Intact whole yeast cells lacking the cytochrome P450

2L1 construct (wild type) and microsomes made from these

same wild type yeast, were incubated with [1(C]-testosterone

or [14C]-progesterone in separate experiments (figure 4.6

and 4.7).


Discussion



Bacterial experiments


Both AO and Al were expressed successfully in bacteria

with the various expression vectors used, with the exception

of pMAL-p2. In all cases, large amounts of cytochrome P450

2L1 were detected either by SDS-PAGE (figure 4.2) or by

immunoblotting with an antibody to spiny lobster cytochrome

P450 (figure 4.3). However, no functional enzyme, as

determined by cytochrome P450 difference spectra, was

obtained with any of the bacteria strains or expression

vectors used (data not shown).




Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E7HWXIU4D_U0KG5Z INGEST_TIME 2012-06-26T22:29:23Z PACKAGE AA00011217_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES



PAGE 1

THE STRUCTURE AND FUNCTION OF CYTOCHROME P450 IN THE HEPATOPANCREAS OF THE FLORIDA SPINY LOBSTER, PANULIRUS ARGUS By SEAN MICHAEL BOYLE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 1997

PAGE 2

This dissertation is dedicated to the rnemmory of Bridgette Bernadette Phillips

PAGE 3

ACKNOWLEDGMENTS Many people have rendered support to me over the years. This section may prove to be a bit e x tensive I would like to first acknowledge my father, John Jude Boyle. He has a master's degree in socio l ogy, a degree in medicine and was a Jesuit deacon. His analytical disposition and extreme l y strong dedication to medicine served as a constant example of qualities to be sought My mother, Donna Deloris Boyle, taught me lessons not so analytical in nature She demonstrated time and time again that logic usually fails when applied to everyday life, and that love and compassion are the tools of existence She is now in charge of a Hospice division in the mountains of Georgia Somewhat fitting for her, I think. My siblings also helped shape and gu i ded me through the years As children, my two older sisters, Michelle Davina and Melissa Renee, would play a game in which they were school teachers and my brother, Christopher David, and I, were the students. When the two sisters tired of the game, I would assume the role of teacher and subject my poor brother to hours more of schooling I now have two younger sisters, Kelly Ann and Katie Marie My stepmother, Donna, has given me plenty of moral support throughout l. l. l.

PAGE 4

The first professional teacher to instill within me a desire for knowledge was at the time a high school geometry teacher named Ronald Blatnick His sense of humor coupled to the proficiency he enjoyed in the subject was the first example I had encountered which illustrated that learning could indeed be fun and rewarding It was Ron who taught me how to play chess and encouraged me to begin programming computers Programming skills would later greatly shape my scientific career Other teachers in high school were also exemplary Mike Beistle taught world history, English, and theater. His classes were filled with compassion and impromptu interpretation of various subjects Mike Muschamp was the principle and he taught American history. He was part judge and part teacher, but always fair and just. His examp l e of how a person with integrity handles all forms of life's adversities, coupled with his rather strong Georgian accent, still serves as a role model for me. While obtaining an undergraduate degree, I was taking a general biology class. One day it was announced that a professor needed a few students to help culture Bryozoans. I had no clue what such a creature was, but I went to see the professor anyway. I found Frank Maturo, Jr I soon found that the questions he was asking about these small, colonial sessile invertebrates were fascinating. I also found that he was called "Doc" I spent most of my first 2 years of college in his lab. The single most important lesson he 1V

PAGE 5

taught me was that a carefully plan ned experiment could answer a question one has, and that exotic solutions to such questions are usually not desirable. As a brief example, he was interested in the question of whether or not a certain species of Bryozoan could self-fertilize He showed me a proposal a graduate student had written to address this question. It contained many complex biochemical experiments. I told him that I thought it was a really ''cool" proposal. He then asked if I could think of a better way. Well, I could not. He then said, ''Why not put a colony in a jar, and see if more criters' show up" One day I was on my way to visit "Doc" when I noticed a person in the closet across from Doc's lab. I said hello to him and asked him what he was doing in the closet. He told me his name was Mike Miyamoto and he was a new faculty member in the Department of Zoology He told me the university had promised him a big laboratory, but instead gave him that closet I welcomed him to the University of Florida. Mike did eventually get his lab and I went to work with him using my programming skills to help manage the mitochondrial DNA he was analyzing. Mike taught me to be as thorough as possible when analyzing or proofing data He also introduced me to molecular biology. Jon Reiskind, also a professor in zoology, helped me to realize that scientific research need not only be filled with hard work and stress, but can be viewed as a type of art He worked with the speciation of wolf spiders These V

PAGE 6

are beautiful animals with very strict geographical boundaries. I have fond memories of collecting specimens at night, spotting the spider's eyes with a head light. While completing my undergraduate degree in zoology, I attended a lecture given by John Schell at the Whitney Marine Laboratory for Biomedical Research, or something to that effect. The name of the Lab has changed many times and is now just the Whitney Lab, after Mr Whitney, the man who donated the money for the lab to be built. Mr Whitney has passed away, but his wife visits every year during the annual review process. When I sat listening to John, I did not know that I would be spending the next 7 or 8 years at the Whitney Lab John was lecturing on the metabolism of benzo-a-pyrene in the Florida spiny lobster He mentioned that the lobsters did not get cancer. This caught my attention I applied to an undergraduate program at the Whitney lab and asked to work in John Schell's lab. I was told he actually worked for a one Margaret 0 James I looked up a couple of her papers, there were many, and I was hooked, line and sinker I was working for Michael Corbett at the time, and he spoke very highly of Margaret James I remember the time he took explaining what the \\Respiratory Burst" was to a kid who barely knew what "WBC" meant So, I asked him to write a letter of recommendation for me I was accepted (in the off season) into the undergraduate research training program at VJ.

PAGE 7

the Whitney Lab This delayed my graduation by a year, but as it turned out, it was the right thing to do Arriving at the Whitney Lab, I expected to first meet Margaret But instead, I met John Pritchard He is a very tall, NIH scientist and immediately began explaining my project to me I was to isolate apical membranes from the spiny lobster hepatopancreas When he was done, he asked if I had any questions I think I replied, "Dr. Pritchard was it?". But it was my lack of even basic cellular physiology that allowed me to first meet Bill Carr and Mike Greenberg. Both would come into the lab late at night and ask if I knew what the ''hell'' I was doing They were both very kind in explaining osmosis, concentrat i on gradients, passive and nonpassive uptake m echanisms. Eventually, I met all the faculty this way, and learned that eac h was approac h able I owe them all a great deal. I met Robin Wallace also. I would eventually work for him over t he c ourse of one summer I packed up my car and moved to St Petersberg in order to work on the snook project. My car was stolen soon after. Dr Wallace trained me to ''Score'' follicles from fish The fish he used as an example was Fundulus heteroclitus. These are really nice fish because they are very small, but have huge fol l icles This job wa s going to be easy I was wrong I was to work on Centropomus undecimalis, a huge fish, with tiny, little follicles Robin Wallace has a breadth of knowledge that is wide: from classical music (did you know that Vivaldi was V l l

PAGE 8

known as the "Red Monk" because he had red hair?) to paintings (Robin paints and sells art work) to science (Robin wrote the book on Vitellogenin, several I think). During this time, I did meet Margaret. But I had learned my lesson with John Pritchard I was ready with pen and paper at my first meeting with the "Boss". I still have those first 5 pages of notes. It took me about a week just to work through them and prepare some questions The answers to those questions raised more questions: a cycle that has been going on for 8 years. To date, she has not run out of answers. She has the uncanny ability to solve problems in fields that are not her specialty. She has on more than one occasion solved problems I was having in molecular biology, often with limited information. She possesses an insight and understanding about Science in general that, as far as I have seen, very few scientist achieve. I feel privileged to have been her student. As for the other members on my committee, I know little of them on a personal level But each was chosen because of the respect they command in their given fields. Ray Bergeron and his group are well known to both the medical and industrial fields. He is difficult to keep up with in a conversation and giving seminars with him around strikes fear in the heart of many a graduate student But more often than not, his questions gently lead the student into deeper contemplation of a given subject. Vl.ll.

PAGE 9

I first became aware of Bill Buhi and his lab when I heard of some studies he was doing with a faculty member in zoology The study dealt with a protein (oviduct secretory protein?) that he was trying to detect in alligators and pigs. Several years later, our lab would look at P450s in various species with an antibody that he and Idania Alverez helped produce I thank Idania for her help. I first became acquainted with Kathleen Shiverick's work via a journal article Later, I was to take several classes she taught Of the many courses I have taken, her courses stand out in my mind as being the most clearly taught. I admit I was anxious to learn the material I was very happy when she agreed to be a member of my committee The final member of my committee is Rob Greenberg. He and a then postdoc named Clay Smith have taught me most of what I know about molecular biology Interestingly, they are nearly opposite in technique and approach to molecular biology, in my mind. I have had the advantage to incorporate both styles and feel fairly confident in my molecular biology skills I hope to one day reach the level of understanding both men have in not only the narrow field of molecular biology, but in Science in general Hank Trapido-Rosenthal, a post-doctoral fellow working in Dr Carr's lab, was the first to teach me molecular biology at the Whitney Lab Hank was very patient and I am very much in his debt. And a special thank you to Dave Price. He was the first person to point out that certain lX

PAGE 10

lambda vectors have chiral maps I was us i ng the wrong enatiomer for about six months before he, qui t e by chance, asked me how my work was progressing. After a few minutes talking with Dave, my project began to work just fine Jason Li was the first graduate student I met in Margaret's group Jason and I quickly became friends He taught me a great deal about HPLC function and microsome preparation I owe a great deal to Dr Li Chung-Li. His kindness both in and out of the lab made my time as a graduate student a very positive experience. He and his wife, Gena, often fed me, and allowed me to play with their two wonderful children Gary LaFleur was a graduate student under the supervision of Robin Wallace Gary always had a quietness about him and could befriend an angry rattle snake He was always willing to help anyone who asked This trait cost him many a long night, as he would have to catch up with his work. He is a kind soul and I am fortunate to know him and his wife, Susanna The other students and post-docs at the Whitney Lab were all helpful Mike Jeziorski is a post-doc who will actually stop what he is doing and look up an answer to a question you might ask of him, if he does not already know the answer My guilt concerning this trait eventually caused me to start asking questions of Rob instead of Mike Rob now tells me to look it up Steve Munger was another student who would without fail offer assistance if you asked. In fact, X

PAGE 11

he frequently offered assistance even if you did not ask But to be honest, I don't ever recall turning down his help. Gena White, a technician, also never failed to help if called upon. Her many years of experience were quite valuable to me during my training I have found that technicians often know more than most I would like to thank both Louise McDonald and Shirley Metts. Without their help over t he years, I would not have a place to live nor money to spend I would like to also thank Lynn Milstead and Jim Netherton III for their expertise in graphics and photography The Whitney Lab would be far less than it is without these two artists A very special thank you to Jan Kallman, our department secretary There is nothing Jan can't do And thanks to Nancy Rosa. She was always busy, but could find time to help. And thanks to the folks at the editorial department who read this dissertation. Thank you "MDL" And finally, I wish to acknowledge Mr Billy Raulerson and Mr Bob Birkett Mr Raulerson is one of those people who can build just about anything. Mr. Birkett can fix anything. I have see them both do it many times. I came to know Mr Raulerson fairly well over the years Often we talked about science and more times than not his experimental design would be far superior to whomever's project design we were talking about This might seem a bit strange at first, but Mr Raulerson could approach a problem from the outside, unbiased and unaffected by what famous Xl

PAGE 12

groups had done before or what a protocol dictated I learned a great deal from him, more than h e will ever k now As unbelievable as it may be, I have left out many people I wish to thank. I have edited my or i ginal acknowledgments Those I have left out are people more involved in my personal life, but as most know, my personal life is mostly taken up by research I thank all my friends who have tolerated my ways. Again, I have been fortunate Finally, thank you to Ali Farakabesh Besides being one of my closest friends, he gave me the computer I typed this manuscript on. All of my friends are that giving I am very fortunate indeed. And a special thanks to Mr. Lefty His devotion, in spite of Feline Leukemia, has been an inspiration to me and everyone who knows him He is truly a good kitty. And he is still alive. Xl.l.

PAGE 13

TABLE O F CONTENTS page ACKNOWLEDGMENTS .. . .. ... . ..... . . ... .... . .. .... . lll TABLE OF CONTENTS ... .. .... .. . .. ........ . . .. .. .. ... Xlll L IST OF TABLES ... ... .... .. .... ...... .... . ......... xv LIST OF FIGURES .... . ... ... ..... . ... ... ....... .. . XVl KEY TO ABBREVIATIONS . ..... ....... .... .. .. . .. .. .. xviii A BSTRACT . . . . . . . . . . . . . . . . . . . . . . . xx CHAPTERS 1 CYTOCHROME P450 : SOME BACKGROUND INFORMATION. ... 1 Introduction. . . . . . . . . . . . . . . . . . . 1 Cytochrome P450 and Cytochrome P450 Reductase. .... 6 Previous Characterization of Cytochrome P450 in the Spiny Lobster . ..... . . ... . . ....... . .. .. 12 A Preview . . . . . . . . . .. . . . . . . . . . . . 1 7 2 CROSS-REACTIVITY OF AN ANTIBODY TO SPINY L OBSTER P450 2L WITH MICROSOMES FROM OTHER SP E CI E S. .. .. 18 Introduction .... . .......... .... ...... . ... ... Materials and Methods .. . .. ....... ...... .. ... . . Results and Discussion .... ........ ... ... ... . 3 CDNA AND PROTEIN SEQUENCE OF A MAJOR FORM OF P450, CYP2L, IN THE HEPATOPANCREAS OF THE SPINY 18 20 23 LOBSTER, PANULIRUS ARGUS . . . ... .. ....... ... . 32 Introduction ... .. .. .. .. ... .... ; . ... .... .. 32 Material and Methods . ... .. . .. . .. .. ... .... ... 35 Results and Discussion . . . .. .. . .. .... .. .... .. 41 4 CATALYTIC CHARACTERIZATION OF CYP2Ll IN BACTERIA AND YEAST EXPRESSION SYSTEMS ... .... .. ..... .... 57 Introduction ............. . . .... ........ ... . .. 57 Materials and Methods ...... . .... .... . ... ... .. 61 Results . . . . . . . . . . . . . . . . . . . . . 73 Discussion.. ...... .. .. ........... . ... . .. . .... 79 Xlll

PAGE 14

T A BLE OF CONTENTS, CONTI N UED 5 SUMMARY O F RESULTS .. .... ......... .. ..... .... ... 89 REFER E NCES . . . . . . . . . . . . . . . . . . . . . . 9 3 BIOGRAPHICAL SKETCH . . . . . . . . . . . . . . . . . . 10 5 XlV

PAGE 15

LIST OF TABLES Table page 1.1 Some CYP families and their model substrates ...... 3 2.1 Classification and P450 Contents of Hepatic Microsomal Preparation of the Species Studied ..... 25 3.1 The N-terminal Amino Acid Sequences in a P450containing fraction Isolated from Spiny Lobster Hepatopancreas Microsomes ................ ........ 43 3.2 Sequence of some of the Primers Used to Obtain the cDNA Clones. . . . . . . . . . . . . . . . . . 45 4.1 In vitro Steroid metabolism in crustaceans species .. 58 4.2 Monooxygenase Activity of Spiny Lobster Cytochrome P450 Fractions in the Presence of NADPH and NADPH Cytochrome Reductase from Rat Liver ............... 60 4.3 Primer Sequences Used in this Study ................. 63 4.4 Expression Vectors Used in this Study and their Attributes . . . . . . . . . . . . . . . . . . . . 6 6 xv

PAGE 16

LIST O F FIGURES Figure page 1 1 An example of a cytochrome P450 d i fference spectra ... 8 1 2 Proposed reaction mechanism for P450 mediated oxygen acti v a t ion and oxygenation of a substrate . 10 1 3 The anatomy of the Florida spiny lobster, Panulirus argus ........ . ..... .. .. ..... ......... 13 1.4 Cross-section of the spiny lobster hepatopa n creas .. . 15 2.1 Immunoreactivity of microsomes from invertebrate and vertebrate species with anti-CYP2L antibodies generated in rabbit ... . .... . .......... .. .. ..... 2 5 2 2 Composite picture of various Western blots done w ith invertebrate and vertebrate microsomal fractions ... 28 2.3 Twenty micrometer cryo-sections of spiny lobster hepa topancreas .... .... .. .. .. ............ . . ... . 31 3 1 SDS-PAGE of a spiny lobster P450-containing fraction stained with Coomassie blue .. . .. ... ... . 42 3 2 Cloning strategy showing the clones used to meld together a full-length cDNA sequence ..... . . ..... 47 3 3 Nucleotide and conceptualized prote i n sequence of the spiny lobster cytochrome P450, CYP2L .... .. 48 3 4 Hydropathy plots of the rat CYP2Bl, rat CYP2B2, rat CYP2D4 and CYP2L .. . ... ... .. ....... .... .. . .. 50 XVl

PAGE 17

LIST OF FIGURES, CONTINUED 3 5 Comparison of the deduced amino acid of CYP2L with that of rat CYPs 2Bl, 2B2, 2B4 and 2D4 ..... . .... . 52 3 6 Northern blot total RNA isolated from the hepatopancreas of the spiny lobster ................ 55 3 7 RT-PCR of total RNA isolated from the spiny lobster hepa topancreas ..................................... 5 6 4 1 The oligonucleotide sequence of expression primers MJ2 5, MJ2 4, and BRNl ............................... 6 4 4.2 SDS-PAGE of induced bacterial cells (BL21) expressing cytochrome P450 2Ll from the expression vector pET28a ............................................. 74 4.3 Western blot of total cell lysate from BL21 bacterial cells expressing the pET28a construct induced with 0 4 rnM I PTG . . . . . . . . . . . . . . . . . . . . 7 5 4.4 SDS-PAGE of pET28a derived cytochrome P450 2Ll expressed in bacterial cells (BL21) and purified using metal chelation chromatography ............... 76 4.5 Western blot of microsomes from yeast expressing the cytochrome P450 2Ll insert ......................... 77 4.6 TLC separation of progesterone and testosterone metabolites produced by expressed cytochrome P450 2 L 1 . . . . . . . . . . . . . . . . . . . . . . . . 8 4 4.7 TLC separation of progesterone and testosterone metabolites produced by expressed cytochrome P450 2 L 1 . . . . . . . . . . . . . . . . . . . . . . . . 8 7 XVll

PAGE 18

cDNA co CsCl CYP Da dATP dCTP dGTP DI DNA dNTP DTT dTTP EDTA EtOH FAD FITC FMN g h l. p K + KCl kb kD kg M MeOH mg MgCl 2 ml mM mRNA MW Mr Na + NaCl ~ -NAD + NADPH nmole P450 PAGE PCR pmol PMSF PVDF RNA LIST OF ABBREVIATIONS complementary or copy DNA carbon monoxide cesium chloride cytochrome P450 dalton deoxyadenosine triphosphate deoxycytidine triphosphate deoxyguanosine triphosphate sterile deionized water deoxyribonucleic acid deoxynucleoside triphosphate dithiothreitol deoxythymidine triphosphate ethylenediaminetetraacetic acid ethanol flavin adenine dinucleotide fluorescein isothiocyanate flavin mononucleotide gram hour intraperitoneal potassium potassium chloride kilobase kilodalton kilogram molar methanol mill i gram magnesium chloride mi ll iliter millimo l ar messenger ribonucleic acid molecular weight molecular mass sodium sodium chloride beta nicotinamide adenine dinucleotide nicotinamide adenine dinucleotide phosphate nanomole cytochrome P450 polyacylamide gel electrophoresis polymerase chain reaction picomole phenylmethylsulfonyl fluor i de polyvinylidene fluoride ribonucleic acid XVlll

PAGE 19

SDS SRS Tag TBS TCDD TLC TRIS Tween-20 ci g l m V w YNB LIST OF ABBREVIATIONS, CONTINUED sodium dodecyl sulfate substrate recognition s i te Thermus aquaticus tris-buffered saline 2,3,7 8-tetrachlorodibenzo-p-dioxin thin layer chromatography Tris[hydroxymethy]aminomethane polyoxyethylene-20-sorbitan m1crocur1e microgram microliter micrometer volume weight yeast nitrogen base XlX

PAGE 20

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy THE STRUCTURE AND FUNCTION OF CYTOCHROME P450 IN THE HEPATOPANCREAS OF THE FLORIDA SPINY LOBSTER, PANULIRUS ARGUS By Sean Michael Boyle May, 1997 Chairperson: Margaret 0. James Major Department : Medicinal Chemistry Cytochrome P450s are a superfamily of enzymes which participate in Phase I biotransformation reactions within a cell. These monooxygenase enzymes are found in a variety of plant and animal species, including the Florida spiny lobster, Panulirus argus Using partially purified cytochrome P450 from the spiny lobster hepatopancreas, polyclonal antibodies were obtained from rabbit sera. The antibodies cross-reacted strongly with cytochrome P450 from the spiny lobster hepatopancreas. Cytochrome P450s from other species were examined for immunoreactivity with the spiny lobster anti-P450 antibodies. Cross-reactivity was detected with the slipper lobster, but not the American lobster or blue crab. The killifish, among others, yielded strongly immunoreactive proteins. In addition, phenobarbital-treated rats also cross-reacted with the spiny lobster antibodies. The cDNA encoding an isoform of this enzyme found in the hepatopancreas of the spiny lobster was isolated from a xx

PAGE 21

cDNA library made from this tissue. This novel cytochrome P450 enzymes was designated as cytochrome P450 2Ll. The deduced protein shared 35% identity with rat isoforms in the 2B family. Cytochrome P450 2Ll contains amino acids that are invariant in all known cytochrome P450s and has the highly conserved heme-binding domain. Cytochrome P450 2Ll was expressed in the methylotrophic yeast, Pichia pastoris. Whole cell and microsomal fractions from yeast that expressed cytochrome P450 2Ll were catalytically active with radiolabeled testosterone and progesterone in an NADPH-dependent manner. The major finding reported within this dissertation is the cDNA sequence of a novel cytochrome P450 isolated from the Florida spiny lobster. This cytochrome P450 represents a new subfamily, and shares structural features with cytochrome P450s found in the cytochrome P450 gene 2 family XXl

PAGE 22

CHAPTER 1 CYTOCHROME P450 : SOME BACKGROUND INFORMATION Introduction Cytochrome P450s are monooxygenases capable of oxidizing a wide variety of endogenous and exogenous compounds (Gibson and Skett, 1986) Cytochrome P450s comprise a superfamily of enzymes which are distributed in microorganisms, plants, and animals The endogenous functions of P450s are varied. For example, in microorganisms like Pseudomonas putida, cytochrome P450 enables the organism to use camphor as a carbon source (Takemori et al. 1 1993). In plants, some cytochrome P450s are involved in the metabolism of hormones, leading to the ripening of fruit, such as in the avocado (Stegeman and Hahn, 1994). In animals, mitochondrial P450s are involved in steroid metabolism, such as the synthesis of estrogen in humans (Stegeman and Hahn, 1994) When an e x ogenous compound (a xenobiotic) enters into an orga nism, cytochrome P450s are the primary enzymes which modify the compound in order to facilitate excretion. Cytochrome P450 was first discovered in 1955 at the University of Pennsylvania by Drs. G R Williams and M. Klingenberg (Omura, 1993) The two researchers independently 1

PAGE 23

2 noted that when rat liver microsomes were bubbled with carbon monoxide and then reduced with nicotinamide adenine dinucleotide phosphate (NADPH), a peak at 450 nm was observed. In 1962, Drs T. Omura and R. Sato at Osaka University confirmed that the enzyme contained ab-type cytochrome and named the protein "P-450" for "a pigment with absorption at 450 nanometers". Cytochrome P450s are membrane-bound in eukaryotic organisms and are found in the endoplasmic reticulum (or "microsomes" when the endoplasmic reticulum is disrupted and forms aggregates) and in the mitochondria (Black, 1992) In prokaryotic organisms, cytochrome P450s are soluble and are found in the cytoplasm. Cytochrome P450s are assigned to one of 74 gene families based on the amino acid identity of the cytochrome P450 in question to all other known cytochrome P450 amino acid sequences (Nelson et al., 1993) If the apoprotein is greater than 40% identical on the amino acid level to cytochrome P450 apoproteins of a particular gene family, then that cytochrome P450 is placed into that same gene family If the apoprotein is greater than 55% identical on the amino acid level to cytochrome P450 apoproteins of a particular gene sub-family, then that cytochrome P450 lS placed into that same gene subfamily Table 1.1 lists a few cytochrome P450 families and model substrates that are metabolized by certain cytochrome P450 isoforms The substrates listed in table 1 1 are substrates that are

PAGE 24

Table 1 .1 Some CYP families and their m o del substrates CYP Model Substrate lAl Ethoxyresorufin 1A2 Phenacetin lBl Estrone 2As Coumarin 2Bs Pentoxyresorufin 2Cs Mephenytoin Structure H 0 N 0 NH 0 0 0 2Ds Debrisoquine 11 N -CNEi / 2El Ethanol OH 3As Testosterone / 4As Laurie acid / Arrows indicate the position of monooxygenation by cytochrome P450 enzymes 0 I 3 OH

PAGE 25

characteristically metabolized by a particular cytochrome P450 enzyme or cytochrome P450 enzymes within that subfamily, but does not exclude the possibility that these same substrates are metabolized by cytochrome P450 enzymes in other sub-families and families. In fact, cytochrome P450s have a broad substrate preferences. An important function of cytochrome P450 in families 1 to 4 is the monooxygenation of exogenous compounds (xenobiotics). 4 The genes that encode mammalian cytochrome P450 enzymes can be induced by various compounds. Benzo-a-pyrene or 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), for example, causes the increased transcription of the cytochrome P450 lAl gene (Fujii-Kuriyama, 1993). Phenobarbital causes increased transcription of cytochrome P450 2B genes (Fujii Kuriyama, 1993). Other compounds may stabilize existing mRNA levels, as is thought for cytochrome P450 2El induction by EtOH (Fujii-Kuriyama, 1993). Cytochrome P450s have been detected in most tissues (in humans, erythrocytes and striated muscle lack cytochrome P450) Cytochrome P450s exist as two general classes: a group of enzymes localized in particular tissues involved typically in steroidogenesis and a group involved in the metabolism of xenobiotics (Gonzalez, 1992) Xenobiotics are defined as molecules that are not utilized by the body for energy or the normal regulation of a physiological process. Cytochrome P450s are important in determining the duration of action and toxicity of various drugs, such as

PAGE 26

acetaminophen How long a xenobiotic remains in the body is often determined by cytochrome P450 metabolism, especially if the xenobiotic is lipophilic. 5 The liver is the organ that generally contains the highest levels of cytochrome P450 in most species Buhler et al. (1992) demonstrated that the rat liver regionally expresses various forms of cytochrome P450 Anundi et al. (1993) speculated (and demonstrated in the rat liver) that acetaminophen toxicity may be centrilobulary restricted due to localized expression of cytochrome P450 2El. Others have further defined the regional expression of cytochrome P450s lAl/2, 2El, 2Bl/2, and 3Al/2 (Oinonen et al., 1996, 1994; Anundi et al., 1993) Interestingly, cytochrome P450s 2Cll/12 are not zone-restricted In the human brain, cytochrome P450s are important in the detoxification of xenobiotics, including psychoactive drugs, such as serotonin (5-hydroxytryptamine) uptake blockers (Baumann and Rochat, 1995). It has been reported that mutations in the cytochrome P450 2D6 gene have been associated with Alzheimer's disease (Saitoh et al., 1995). In microsomal fractions from rat brain, cytochrome P450s 2C7, 2Cll, 2El, 4A3, 4A8 and a 2D have been identified by terminal microsequencing (Warner et al., 1994) and low levels of cytochrome P450 17 protein expression have been detected (Sanne and Kreuger, 1995) Cytochrome P450s in the eye (Stoltz et al ,1994), kidney (Ma et al., 1993), arteries (Escalante et al 1993),

PAGE 27

skin (Toda et al 1994) and muscle ( P ere i ra et al., 1994) are important in the metabolism of arachadonic acid into physiologically active metabolites known as eicosanoids 6 (Coon et al 1992). Compounds derived from arachadonic acid, such as 12-hydroxyeicosatetraenoic acid, lower intraocular pressure in the eye and modulate activity of the Na+/K+ ATPase in the eye, kidney and muscle. Cytochrome P450s are found in both breast and ovarian tissues, where they mediate estrogen b i osynthesis. Estrogen levels increase in the follicle as the follicle develops, and decrease at ovulation (Tilly et al 1992). Both estrogen, and cytochrome P450 19 protein (the cytochrome P450 enzyme that catalyzes the conversion of testosterone to 17P-estradiol), are elevated in breast tissues from breast cancer patients (Brodie, 1993) Cytochrome P450 and Cytochrome P450 Reductase Cytochrome P450 is a phase I enzyme, a member of a large group of diverse enzymes involved in the first steps of xenobiotic metabolism Cytochrome P450 utilizes molecular oxygen and reducing equivalents derived from NADPH in order to insert an oxygen atom into a substrate (Guengerich and McDonald, 1990). Cytochrome P450 is a monomer and has a molecular mass of approximately 45-60 kDa. The enzyme is anchored (Brown and Black, 1989, Black, 1992) to the

PAGE 28

endoplasmic reticulum and contains a non-covalently bound iron protoporphyrin IX prosthetic group When the cytochrome P450 enzyme is reduced with a reducing agent such as NADPH or diothionite, and then complexed with CO, a maximal absorbance at 450 nm is observed (Omura and Sato, 1964, see figure 1.1) It is this characteristic of these monooxygenase enzymes that accounts for the name ''cytochrome P450" 7 Figure 1.2 outlines the reaction mechanism between enzyme, substrate and oxygen. Cytochrome P450 binds both molecular oxygen and substrate and requires electrons (reducing equivalents) from cytochrome P450 reductase It is thought that when the substrate binds (step 2) to cytochrome P450, a conformational change occurs within the enzyme, allowing the first electron donation (step 3)from the reductase (figure 1.2). Molecular oxygen then binds to the reduced enzyme complex (step 4) Cytochrome P450 reductase is an oxidoreductase (molecular mass around 78 kDa) and is found in close association with the cytochrome P450. The reductase accepts 2 electrons from NADPH (in the form of reducing equivalents) and donates 2 electrons sequentially to the cytochrome P450 (Smith et al 1994). Cytochrome P450 reductase contains both flavin adenine dinucleotide and flavin mononucleotide (FAD and FMN respectively) and uses these flavins in the oxidized and reduced form (quinone and semiquinone states) to pass single electrons to cytochrome P450. The second electron may also

PAGE 29

0.03 C 0 -9 0.00 8 -0.03.C::=:::::_-------..---------400 450 500 Nanometers Figure 1 1. An example of a cytochrome P450 difference spectra Spiny lobster microsomes (solubilized in 0 5% cholic acid) were diluted to about 1 mg/ml and bubbled with CO. A portion of the sample was then reduced with sodium dithionite, and the other portion was used as a reference solution The spectrum was recorded from 500 to 400 run This sample has a cytochrome P450 content of 1.28 nmol P450/mg protein.

PAGE 30

be donated by cytochrome b 5 in some instances (step 5). Oxygen scission occurs {step 5), with loss of one of the oxygen atoms to water. 9 Cytochrome P450s introduce oxygen into alkanes, heteroatom-containing alkanes or 7t -bonde d systems { step 6) by variations on a radical type mechanism (Guengerich and McDonald, 1990 and Koymans et al., 1993) In each case, a radical is formed (on the substrate) either by hydrogen abstraction or electron transfer followed by radical recombination with a hydroxyl radical formed at the heme site. Loss of a second hydrogen from the substrate would form an unsaturated compound (Guengerich and McDonald, 1990). The cytochrome P450 enzymes is regenerated to the ferric state when the hydroxylated produc t is released (step 1) Cytochrome P450 reductase and oxygen can be replaced with an organic peroxide to comple te the reaction (by going to point 6 directly from point 2). This dissertation concerns the CYP enzyme systems in crustacea and describes the use of the Florida spiny lobster, Panulirus argus, as an animal model The spiny lobster is a commercially important species in Florida due to consumer demand of this sea food Over 4 million Kg of spiny lobster were harvested from the Florida Keys in 1992 The shellfish industry represents an i mportant fraction of South Florida's economy. The spiny lobster offers an animal model whose anatomy (figure 1 3) and presumably enzyme systems are evolutionary divergent from our own and from

PAGE 31

M o n ooxyge nat ed ~ Substrate 1 Fe3+ P 450 [Fe0] 3 + NADP H NADP@ + if 2. Substrate Fe 3 + __ l __ ~.,.__ ~ P4 50-S ub s trate Comp l ex ROH ROOH + [Fe 0 2 ] P 450 R ed u c ta se 3. eFe2+ __ l ___ .,~ .---~., P4l0 -S ub strate Complex 10 P450 -S u bstra t e Complex P4 5 0-S u b s tra te Com p I ex ) P450 -S ub strate Complex 6 s. 4. Figure 1 2 Proposed reaction mechanism for P450 mediated oxygen activation and oxygenation of a substrate ROOH, an organic peroxide, can be used as an oxygen donor to cytochrome P450

PAGE 32

11 other common animal models such as the rat or mouse For example, in mammals, certain cytochrome P450 genes are inducible or upregulated by chemicals such as 3methylcholanthrene (cytochrome P450s in the lA gene subfamily) and phenobarbital (cytochrome P450s in the 2A, 2B and 2C gene subfamilies), producing large amounts of the particular cytochrome P450 protein Fish do not undergo gene upregulation in response to phenobarbital, but do respond to 3-methylcholanthrene by upregulating cytochrome P450 enzymes in the lA gene family. Crustacea do not respond to either 3methylcholanthrene {James, 1989) or phenobarbital (Stegeman and Hahn, 1994) Lobsters have been used as models in several studies. FMRFamide-like peptides have been isolated from the American lobster (Worden et al., 1995) and have been shown to potentiate transmitter release in the nerve terminals to muscle and cause muscle contraction directly Crustaceans have a primitive immune system, consisting of cellular and humeral responses (Takahashi et al 1995) Spiny lobsters have been shown, like salmon and mole rats, to use polarity as a means of navigation (Lohmann et al., 1995). An intriguing reason to study the enzyme systems of the spiny lobster is that the lobster is apparently resistance to carcinogenesis. It is believed that crustacea do not undergo carcinogenesis (Mix, 1986). An understanding of the metabolic pathways, especially those leading to reactive

PAGE 33

intermediates in both sensitive and resistant species, may yield more insight into the mechanism of carcinogenesis. Previous Characterization of P450 in the Spiny Lobster 12 The James group have characterized both phase I and II systems in both the spiny lobster (James, 1990, Schell and James, 1989) and in the American lobster (James et al., 1989, Li and James, 1993). The hepatopancreas is a fatty, digestive gland found in all crustacea and consists of blind-ending tubules (figure 1.4) The primary function of the hepatopancreas is secretion of digestive enzymes into the stomach and the subsequent uptake of nutrients (Gibson and Barker,1979) The hepatopancreas of the spiny lobster contains cytochrome P450 in amounts comparable to those found in rat liver (~ 1 nmole P450/mg microsomal protein, James and Little, 1980). The major site of xenobiotic biotransforrnation in the spiny lobster is the hepatopancreas, although cytochrome P450 has been detected in the antennal gland and in the nose of this animal Cytochrome P450 has been partially purified from the hepatopancreas of the spiny lobster (James,1990). Microsomes prepared from the spiny lobster hepatopancreas contain high levels of cytochrome P450 Solubilization of the microsomes produces an enriched cytochrome P450 fraction termed the Ml fraction or "red fraction" (James and Little, 1980) The red

PAGE 34

Intestine Pericardium Gonads and heart Stomach Antenna I gland Hepatopancreas 13 Figure 1 3 The anatomy of the Florida sp i ny lobs t er, Panulirus argus The hepatopancreas is an organ a n alogous to the mammalian liver and contains large amou n ts of cytochrome P450 (~ 1 nmol cytochrome P450/ mg microsomal protein)

PAGE 35

14 fraction can be resolved into partially purified P450s using anion exchange, hydrophobic interaction and absorption chromatography (James, 1990). Reconstitution experiments using cytochrome P450 isolated from the hepatopancreas from the spiny lobster, and substrates such as benzphetamine, progesterone, testosterone and benzo-a-pyrene, demonstrated that the spiny lobster cytochrome P450 is able to metabolize a diverse group of substrates (James, 1989, James, 1990). Little activity was reported with ethoxyor pentoxyresorufin, substrates characteristically metabolized by cytochrome P450 enzymes in the gene subfamilies lA and 2B, or with ecdysone, the molting hormone in spiny lobsters. (James, 1990). The above studies were done using cytochrome P450 reductase from rat liver microsomes. To date, cytochrome P450 reductase from spiny lobster hepatopancreas microsomes has not been purified. Low cytochrome c reductase activity has been detected (James and Little, 1980) in spiny lobs ter hepatopancreas microsomes and hepatopancreas cytosol. The ratio of cytochrome P450 to cytochrome P450 reductase mammals is in the range of 10:1 to 100:l; therefore in concentrations of cytochrome P450 reductase in the spiny lobster may be very low However, other artificial pathways can be used to supply single electrons to cytochrome P450 (for example, the use of peroxides), so it is possible the spiny lobster uses a novel pathway to pass electrons to cytochrome P450 in vivo. Cumene hydroperoxide-dependent

PAGE 36

15 ;-~ Figure 1.4. Cross-section of the spiny lobster hepatopancreas. Tissues were frozen and 20 mm sections cut. The circular structures are the blind-ending tubules

PAGE 37

1 6 monooxygenation of several substrates was similar to NADPH dependent activity in Ml fractions (James, 1984). For example, mollusks may use a NADPH-independent cytochrome P450 pathway (Livingstone et al., 1989) to oxidize xenobiotics. Another plausible reason for failure to isolate cytochrome P450 reductase from the spiny lobster is that it may have been degraded by digestive enzymes and bile salts liberated during the isolation procedure (James, 1990). Studies addressing the apparent resistance of spiny lobster to chemical carcinogenesis have yielded some insight into this phenomenon (James et al 1992). Spiny lobsters dosed with increasing amounts of the carcinogen benzo-a pyrene indicated a dose-dependency in DNA adduct formation. Benzo-a-pyrene is metabolized into a reactive intermediate which covalently binds to DNA. Interestingly, when the southern flounder (Paralichthys lethostigma, a carcinogen sensitive species) was fed hepatopancreas from a spiny lobster dosed with radiolabeled benzo-a-pyrene, DNA adducts were formed in the liver and the intestinal DNA of the fish (James et al., 1991) These studies suggest trophic transfer is a potential threat to consumers of this species and serve to reinforce the use of the spiny lobster as a model system for studying questions concerning carcinogenesis and transfer of carcinogenic chemicals among species

PAGE 38

A Preview In the following chapters, studies concerning the structure and function of cytochrome P450 in the Florida spiny lobster will be presented. 1 7 An antibody to spiny lobster cytochrome P450 has been generated and used to screen microsomal fractions from other invertebrate and vertebrate animals The spiny lobster cytochrome P450s seem to share epitopes with some invertebrate and vertebrate species There is preliminary evidence that the cytochrome P450s in the spiny lobster hepatopancreas may be localized to certain cell types in the hepatopancreas. The primary structure of one isoform of cytochrome P450, cytochrome P450 2Ll, has been determined and is most similar to known cytochrome P450s found in rats. Hydropathy plots reveal overall similarity in predicted secondary structure as well. Northern blot and RT-PCR analysis indicate that a possible alternatively spliced form of the mRNA for cytochrome P450 2Ll may be present in the hepatopancreas Cytochrome P450 2Ll was inserted into a vector and transfected into the yeast Pichia pastoris Upon incubation with radiolabeled testosterone and progesterone, both intact yeast and yeast microsomes yielded a 16a-hydroxylation product.

PAGE 39

CHAPTER 2 CROSS-REACTIVITY OF AN ANTIBODY TO SPINY LOBSTER P450 2L WITH MICROSOMES FROM OTHER SPECIES Introduction Individual members of the superfamily of cytochrome P450 enzymes catalyze the oxidation of a wide variety of endogenous and xenobiotic substrates (Omura et al ., 1993; Ortiz de Montellano; 1986; Ruckpaul and Rein 1984). Members of one or more of the cytochrome P450 families have been found in diverse species of both plant and animal kingdoms, and the cytochrome P450 enzyme system is thought to be widespread (Nelson et al., 1993) While the gene and protein sequences of many mammalian cytochrome P450s are known (Nelson et al., 1993), much less is known about cytochrome P450s in fish and aquatic invertebrate species. Fish cytochrome P450s have been cloned from rainbow trout (Oncorhynchus mykiss, cytochrome P450s lAl, 2Kl, 11A, 17 and 19) and plaice (Pleuronectes platessi, cytochrome P450 lAl; Stegeman and Hahn, 1994). We recently cloned a cytochrome P450 (cytochrome P450 2L) from the Florida spiny lobster, Panulirus argus (James et al 1993) The only other cytochrome P450 sequence that has been cloned from an aquatic invertebrate to date is that of the pond snail (Lymnea stagnalis, cytochrome P450 10, Nelson et al 18

PAGE 40

19 1993). Of the other invertebrate species (Nelson et al ., 1993), cytochrome P450 have been cloned from the house fly (Musca domestica, cytochrome P450 6Al), fruit fly (Drosophila melanogaster, cytochrome P450s 4Dl, 4El and 6A2), butterfly (Papilio polyxenes, cytochrome P450 6Bl) and cockroach (Blaberus discoidalis cytochrome P4 50 6Cl). The spiny lobster cytochrome P450 2L is the first complete member of the cytochrome P450 2 gene fami ly from an invertebrate, and to date the second n on-mammalian cytochrome P450 2 gene family form In mammalian species, the cytoch ro me P450 2 gene family is very important for monooxygenation of a wide range of structurally diverse xenobiotics and endogenous substrates (Omura et al., 1993; Ortiz de Montellano; 1986; Ruckpaul and Rein, 1984; Nelson et al., 1993). Although sequence identity of the spiny lobster cytochrome P450 2L form with other cytochrome P450s was low, certai n regions of the primary sequence showed very high similarity to other 2 family members (James et al 1996), suggesting that there may be epitopes in common. Few studies have investigated the cross-reactivity of invertebrate cytochrome P450s with vertebrate cytochrome P450 antib od i es. One study found cross-reactivity of an anti-scup cytochrome P450 lA antibody to microsomal fractions of the sea star, Asterias rubens (den Besten et al 1993). An ot h er study found that microsomes made from the mid-gut gland of the chiton Cryptochiton stelleri cross-reacted with an antibody to

PAGE 41

rainbow trout cytochrome P450s 2K1 and lAl (Schlenk and Buhler, 1989) 20 The objective of the present study was to investigate whether an antibody to a microsomal cytochrome P450 isolated from the hepatopancreas of the Florida spiny lobster would cross-react with microsomal fractions isolated from hepatopancreas and liver of other invertebrate and vertebrate species. Materials and Methods Antibody Preparation Partially purified cytochrome P450 (11.5 nmol spectrally measured cytochrome P450/mg protein) was isolated from microsomes prepared from hepatopancreas of the Florida spiny lobster by ion-exchange, hydrophobic and absorptive chromatography (James, 1990). Samples were subjected to SDS PAGE in one dimension (Laernmli, 1970) The major band from SDS-PAGE (52.5 kD apparent molecular mass) was detected with Coomassie blue dye and excised. Each gel slice contained about 3.0 g of cytochrome P450 as determined by difference spectra (see below). Six micrograms of cytochrome P450 were homogenized in 1 ml of a 50% Freunds complete adjuvant saline solution. The homogenate was then sheared with a 19 gauge needle. Pre-immunization serum was obtained from a pathogen free, New Zealand White rabbit 2 weeks earlier. The

PAGE 42

21 rabbit was immunized w it h four 0 25 ml injections along the back. The rabbit received boosters of 6 g of cytochrome P450 in 1 ml of 50% Freunds incomplete adjuvant-sa lin e every 2 weeks. A total of seven immunizations we r e g iv en, with detectable titers (as detected by Western blotting) beginning after the third injection Microsome Preparation The fish and invertebrates used in these studies (see table 2.1) were locally caught, adult feral species of either sex, with the exception of the channel catfish The channel catfish (Ictaluris punctatus) were obtai n ed from the LSU aquaculture facility and were 800+/-100 g body weight. The rats were male, Sprague-Dawley strain, and were 200+/-20 g The phenobarbital-induced rats were pretreated with 80 mg phenobarbital/kg i p for 4 days before sacrifice on the fifth day. Microsomes were prepared as described previously (James, 1990) Briefly, tissues were removed from the animal and homogenized in 0.05 M potassium phosphate (pH 7 4), 1.15% KCl, 0 1 mM EDTA, 0.2 mM PMSF. The homogenate was centrifuged at 13,000g and the supernatant centrifuged at 176,000g to pellet the microsomes Solubilized microsomes (Ml fractions) were isolated from the invertebrates by stirring the microsomes at 4 C for 1 h in buffer containing 0 01 M potassium phosphate (pH 7 6), 20% v / v glycerol, 0 5 % w/v sodium cholate, 0.1 mM EDTA, 0.1 mM dithiothreitol, 0.2

PAGE 43

mM PMSF (1 ml buffer/g wet weight hepatopancreas) and centrifuging at 176,000g for 90 min Protein contents were determined by the method of Lowry et al (1951) Concentrations of cytochrome P450 in the samples were determined by CO difference spectra (see table 2 1) (Estabrook et al 1972). Western Blots Samples of microsomal protein, 200 g, were subjected to SDS-PAGE on 4%-8 5% discontinuous gels in a Protean II apparatus (BioRad). Proteins were electro-blotted onto nitrocellulose using a Tris-glycine methanol buffer system 22 (25 mM Tris base, 192 mM glycine, 20% v/v methanol) After the transfer, the membranes were blocked in 3% gelatin-TBS (Tris-buffered saline, 20 mM Tris, 500 mM NaCl, pH 7 5) for 1 h. The primary antibody (1 : 200 in 1% gelatin-TBS 0 05% Tween-20) was applied for 2 hand secondary antibody (Biorad goat-anti-rabbit alkaline phosphatase, 1 : 3000) was applied for 1 h. Detection was by color development with 5-bromo-4chloro 3-indolyl phosphate and nitro blue tetrazolium (BioRad) Immunocytochemistry Hepatopancreas was fixed overnight in Zamboni's fixative (2% Paraformaldehyde and 0.15% picric acid in 0 .1 M potassium phosphate, pH 7.4). Tissues were then subjected to

PAGE 44

23 increasing concentrations (0,10 20 and 30% (w/v)) o f sucrose (w/v) in PBS {phosphate buffered sali n e, 20 mM potassium phosphate, pH 7 4, 500 mM NaCl) for 2 hat each concentration, allowing the tissues to remain in 30% sucrose in PBS overnight Tissues were frozen in O C T compound (10% (v/v) polyvinyl alcohol and 4% (v/v) polyethylene glycol, Miles Inc ) and sectioned (20 ) on a cryostat. Sections were blocked in 1.0% (w/v) normal goat serum for 30 min. Sections were washed once for 15 min i n PBS and i ncubated for 1 h with the primary antibody (1 : 50 in P BS/1% no r mal goat serum). Sections were washed (2 X 15 min) in PBS and the secondary antibody (goat-antir abbit fluorescei n isothiocyanate, 1 : 50) applied for 1 hr Slides were viewed with a fluorescent microscope Results and Discussion Studies of the immunological relationships between cytochrome P450s in aquatic species have mostly b een done in fish. We isolated microsomes from represe n tative species in both the cartilaginous and bony fish classes and in the class crustacea. Table 2 1 list the systematics of the species we screened with the anti-spiny lobster cytochrome P450 antibody. As expected, anti-spiny lobster cytochrome P450 antibody consistently cross-reacted with microsomal fractions, solubilized fractions (Ml) and partial l y purified

PAGE 45

2 4 cytochrome P450 from the hepatopancreas of the sp i ny lobster. Three bands were usually detected, at high molecular mass (not shown), at 52 5 kD (figure 2.1 and figure 2.2) and at 30 kD (not shown) We have Northern blot and RT-PCR evidence for what appears to be a splice variant of about 1 5 kb of cytochrome P450 2L (James et al in preparation), and the 30 kD immunoreactive band may either represent the translated product of this cytochrome P450 2L truncated message, or perhaps is a breakdown product of cytochrome P450. Under conditions used in this study, cytochrome P450 2L can be detected at 0.05 pmol/lane With hepatopancreas microsomal preparations from the other invertebrates studied, immunoreactivity at a similar molecular mass to that of the spiny lobster cytoc h ro m e P450 was detected with the slipper lobster (fig u re 2 1 a n d figure 2 2). This lobster is in the same i n fraorder as the spiny lobster Cross-reactivity at higher mo l ecular mass was detected with samples from the American lobster, but there was no detectable cross-reactivity with the other invertebrate samples studied (figure 2.1 and figure 2 2) Many factors effect the cytochrome P450 levels in marine invertebrate species (Stegeman and H ahn, 1994) Failure to detect immunoreactive proteins may be due not on l y to lower levels of overall cytochrome P450 contained in the hepatopancreas or digestive gland of the invertebrates studied, but may also be related to differential expression of a particular cytochrome P450 isoform.

PAGE 46

Table 2.1 Classification and cytochrome P450 Contents of H epatic Prep a r a tions of the Species Studied Classification content Phylum Arthropoda Subphylum Chelicerata Class Xiphosura Limulus polyphemus, the horse shoe crab 1 Subphylum Mandibulata Class Crustacea Order Decapoda Suborder Dendrobranchiata Infraorder Penaeidea Superfamily Penaeoidea Fami l y Penaeidae Penaeus aztecus, the brown shrimp 1 Suborder Pleocyemata Infraorder Palinura Superfamily Palinuroidea Family Palinuridae Panulirus argus, the Florida spiny lobster 2 Family Scyllaridae Scyllarides nodifer, the slipper lobster 1 Infraorder Astacidea Superfamily Nephropoidea Family Nephropidae Homarus americanus, the American lobster 2 Infraorder Brachyura Superfamily Portunoidea Family Portunidae Callinectes sapidus, the blue crab 2 Phylum Chordata Class Chondrichthyes Order Rajiformes Family Rajidae Raja eglanteria, the clear-nose skate 1 Class Osteichthyes Order Siluriformes Family Ictaluridae Ictalurus punctatus, the channel catfish 1 Order Atheriniformes Fami l y Cyprinodontidae Fundulus heteroclitus, the killifish 1 Order Perciformes Family Centropomidae Centropomus undecimalis, the snook 3 Class Mammalia Order Rodentia Family Muridae Rattus rattus, control Sprague Dawley rat 1 phenobarbital-induced rat 1 cytochrome P450 (nmol/mg protein) 0 41 0 10 1.30 0.06 0.91 0.33 0.53 0.23 0. 36 0.18 1.10 1.80 25 1 Microsomes prepared from fresh liver or hepatopa n creas. 2 Fractions prepared from fresh hepatopancreas. 3 Microsomes prepared from frozen livers.

PAGE 47

26 Hepatic microsomes from the one member of the chondrichthyes class that were screened, the clear-nose skate, cross-reacted with the spiny lobster anti-cytochrome P450 antibody (figure 2.2) Hepatic microsomes from all of the bony fish studied cross-reacted and gave signals in the 45-66 kDa region, with the strongest signals from the killifish microsomal samples followed by the catfish (figure 2.1 and figure 2 2). In other experiments with different microsomal preparations from the clear-nose skate and the snook, stronger signals were observed than those shown in figure 2.1 (figure 2.2). An antibody to rat cytochrome P450 2Bl and one to scup cytochrome P450 2B have been shown to cross-react with microsomes from the killifish, the little skate and the channel catfish (Stegeman and Hahn, 1994). Microsomal fractions from control and phenobarbital induced rats showed cross-reactivity to anti-cytochrome P450 2L in the 45-66 kDa range (figure 2.1 and figure 2.2). Interestingly, of the cytochrome P450s available in the data bank for comparison, cytochrome P450 2L shows the most similarity to the rat cytochrome P450 2D4. These results suggest that cytochrome P450 in the spiny lobster hepatopancreas may share similar epitopes with cytochrome P450s in the slipper lobster, and possibly the American lobster, but that other invertebrates screened for cytochrome P450s with similar epitopes were possibly not present or were present in amounts below the limit of

PAGE 48

A B kD 66 2 45 0 kD 45.0 1 2 3 7 8 4 5 6 9 10 11 12 13 ,. tr Figure 2.1. Western blots of microsomes from several species, probed with anti-spiny lobster P450 In each lane, 200 g of protein was loaded Lane 1, blue crab; 2, American lobster; 3, slipper lobster; 4, spiny lobster ; 5, brown shrimp; 6, horse-shoe crab; 7, spiny lobster; 8, clear-nose skate; 9, catfish ; 10, killifish; 11, snook ; 12, contro l rat ; 13, phenobarbital-induced rat The migration of molecular mass markers 45 and 66.2 is shown 27

PAGE 49

28 1 2 3 4 5 6 7 8 9 10 11 12 13 52.5 kDa Figure 2 2 Composite picture of various Western blots done with invertebrate and vertebrate microsomal fractions. Arrow point to tl1e spiny lobster cytochrome P450 at an apparent molecular mass of 52.5 kDa Lane 1 female spiny lobster Ml fraction; 2, slipper lobster micros o mes; 3, American lobster Ml fraction; 4, blue crab Ml fraction; 5, brown shrimp microsomes; 6, horse shoe crab Ml fraction; 7, clear nose skate microsomes; 8, snook liver microsomes; 9, catfish liver microsome s ; 10, killifish liver microsomes; 11, empty lane; 12, control rat liver microsomes; 13, phenobarbital-induced rat liver microsomes

PAGE 50

29 detection In vivo studies have shown that the American lobster and the spiny lobster metabol i ze benzo(a}pyrene very differently Very slow cytochrome P450-dependent monooxygenation of benzo(a)pyrene occurs in the American lobster, but rapid monooxygenation of benzo(a}pyrene in the spiny lobster (James and Little, 1980}. These differences probably reflect the cytochrome P450 composition of hepatopancreas in the two species It would be important to isolate microsomes from other crustacea in the suborder Pleocyemata and to determine if these cross react with the cytochrome P450 antibody to the spiny lobster form. However, even with spiny lobster microsomes, the level of cross-reactivity may be related to the molting stage of the animal. Our laboratory has found wide variation in cytochrome P450 content in the hepatopancreas of the spiny lobster, and variations such as these may well affect attempts at quantification using Western blot techniques As is apparent by examination of table 2.1, different amounts of cytochrome P450 were present for electroblotting It is possible that some samples had levels of irnrnunoreactive cytochro me P45 0 below the detection limit Nevertheless, this antibody may be used to screen an expression library from the slipper lobster or other species which demonstrate cross-reactivity. Such heterologous probes are very valuable where information about the primary sequence of the target protein is unknown

PAGE 51

30 The spiny lobster antibody also cross-reacted with microsomes from cartilaginous and bony fish and from rat. Why these species would share an epitope with the spiny lobster is unknown, but may be related to the incidence of expression of the cytochrome P450 2 family Irnrnunlogical relationships and other molecular data relating to invertebrates will not only provide insight into the phylogenetic relationships of invertebrates, but can serve as out-groups in phylogenetic analysis of mammalian systems (Nei, 1987) The hepatopancreas of crustaceans is composed principally of four cell types: the E (Embryonalenzellen= embryonic), R (Restzellen= absorption), B (Blasenzellen= proteases) and F (Fibrillenzellen= peroxidases; Gibson and Barker, 1979). Irnrnunocytochemical studies of the spiny lobster hepatopancreas seem to reveal a defined distribution pa t tern for cytochrome P450 (figure 2.3) Immune-reactivity appears to be localized in particular cells lining the hepatopancreas. Furthermore, the reactivity appears to be localized at the basal end of the cell. What functional significance this localization may serve in vivo is unknown We can not at present identify the cell type or types in the hepatopancreas that irnrnuno-react with the spiny lobster anti-cytochrome P450 antibody.

PAGE 52

31 Figure 2 3 Twenty micrometer cryo-sections of spiny lobster hepatopancreas. Sections were incubated with cytochrome P450 2L antibody and stained with an FITC linked secondary antibody The lighter areas are cytochrome P450 in the spiny lobster hepatopancreas and seem to localize in apical cells

PAGE 53

CHAPTER 3 cDNA AND PROTEIN SEQUENCE OF A MAJOR FORM OF P450, CYP2L, IN THE HEPATOPANCREAS OF THE SPINY LOBSTER, PANULIRUS ARGUS Introduction Cytochrome P450s are a superfamily of important monooxygenase enzymes that are found in many animal and plant species of varying biological complexity (Nelson et al., 1993) The major function of these enzymes is to introduce oxygen into, or remove hydrogen from, an organic substrate of either endogenous or exogenous origin, usually increasing the hydrophilicity of the substrate and altering its pharmacological or physiological activity (Guengerich and Shimada, 1991). The monooxygenation of xenobiotics is usually catalyzed by members of cytochrome P450 families 14. The protein structure of individual members of the cytochrome P450 superfamily, as it is related to catalytic function, is an active current area of research Considerable advances have been made in deducing the amino acid sequences and further structural details of bacterial, fungal, and some mammalian cytochrome P450s (Ortiz de Montellano, 1986; Gonzalez, 1990), but very little sequence or structural information has been published for these in nonmammalian animals (Nelson et al 1993; Stegeman and Hahn, 1994) The few invertebrate cytochrome P450 cDNA and 32

PAGE 54

33 deduced amino acid sequences known fall into the families 4, 6, and 10 and include the neotropical cockroach, Blaberus discoidalis (Bradfield et al., 1991), the fruit fly, Drosophila melanogaster (Nelson et al., 1993), the house fly, Musca domestica (Cohen et al., 1994), and the pond snail, Lymnea stagnalis (Nelson et al., 1993). No cytochrome P450 sequence information is available for crustacean species. Obtaining sequence information from divergent species may help to further characterize the phylogeny of this enzyme superfamily, which probably arose from the duplication of an ancestral gene (Nelson et al., 1993; Stegeman and Hahn, 1994; Nelson and Strobel, 1987; Nebert and Gonzalez, 1987; Nebert et al 1989). Such an ancestral gene may have had a very broad substrate pool and paralogues might have evolved more specific substrate selectivites (Nelson and Strobel, 1987). This report concerns cytochrome P450 found in the hepatopancreas, or digestive organ, of the spiny lobster, Panulirus argus. The spiny lobster hepatopancreas cytochrome P450 system has some interesting features (James and Little, 1984; James, 1989; James, 1990). Although microsomes isolated from the hepatopancreas contain high concentrations of spectrally measured cytochrome P450 (comparable to or somewhat higher than cytochrome P450 concentrations found in hepatic microsomes from control rats), no conclusive evidence has yet been obtained for the presence of an NADPH cytochrome P450 reductase in spiny lobster hepatopancreas

PAGE 55

34 microsomes, although low cytochrome~ reductase activity is present (James, 1989). The lack of measurable NADPH cytochrome P450 reductase may be because any cytochrome P450 reductase present undergoes proteolysis during the preparation of microsomes (James, 1990) It has not been possible to measure NADPH cytochrome P450 reductase in spiny lobster hepatopancreas microsomes by immunological methods, as these microsomes do not contain any proteins which cross react with an antibody to rat or rabbit NADPH-cytochrome P450 reductase (unpublished observations). Additionally, there is no evidence that spiny lobster cytochrome P450s can be induced by treatment with polycyclic aromatic compounds, although p o lycyclic aromatic compounds are rapidly metabolized by the spiny lobster (James and Little, 1984; and James, unpublished observations) In previous studies, a spiny lobster fraction (given the trivial designation D 1 ) was partially purified from hepatopancreas microsomes by chromatography and the catalytic activities of this cytochrome P450 with benzphetamine, ethoxycoumarin, aminopyrine, testosterone, progesterone, benzo(a)pyrene and resorufin ethers were measured in the presence of rat NADPH cytochrome P450 reductase (James, 1990). The present paper reports a 39 amino acid N terrninal sequence of the cytochrome P450 protein found in the D 1 fraction and the sequence of a CYP cDNA cloned from hepatopancreas mRNA by polymerase chain

PAGE 56

35 reaction (PCR) techniques, using primers to this N-term i nal sequence Materials and Methods Isolation of cytochrome P450 Samples for Sequence Analysis A partially purified cytochrome P450 D 1 fraction (11.5 nmol spectrally measured cytochrome P450/mg protein) was obtained from spiny lobster hepatopancreas microsomal fractions by ion-exchange, hydrophobic, and absorption chromatography as described previously (James, 1990) Duplicate samples of the D 1 preparation were subjected to SDS-PAGE in one dimension by the method of Laemrnli (Laemrnli, 1970), as shown in figure 3.1. One gel was stained with Coomassie blue and analyzed densitometrically (ISCO Model 1312) to determine the percentage of protein in each band. The major band, at molecular weight 52,500 (see figure 3 1), was examined for sequence analysis Proteins were then electrophoretically transferred from an unstained gel to an Imrnobilon PVDF (polyvinylidene fluoride) membrane (Millipore, Bedford, MA) in the Towbin buffer system (Towbin et al., 1979) Protei n s were localized on the PVDF membrane by Coomassie blue staining and the membrane stored at -20 C until sequencing. N-terminal amino acid sequence analysis was carried out at the University of Florida Protein Chemistry Core facility in the

PAGE 57

36 Interdisciplinary Center for Biotechnology Research (ICBR). The band of molecular mass 52,500 daltons from the PVDF membrane (about 4.5 g protein) was applied to an Applied Biosystems Model 470A gas-phase protein sequencer with an on-line analytical HPLC system. The peptide sequence data was compared with sequences present in the Genetics Computer Group (GCG, Madison, WI) protein database, using FASTA computer programs (Dayhoff et al., 1983; Devereux et al 1984; Pearson and Lipmann, 1988), as well as the National Center for Biotechnology Information (NCBI), using the BLAST network service Preparation of RNA, rnRNA, and cDNA The hepatopancreas from a male spiny lobster was removed and a 1-g sample was homogenized in a guanidine isothiocyanate-containing buffer following the methods of Chirgwin et al (Chirgwin et al., 1979). Total RNA was isolated by centrifugation through a CsCl cushion. Polyadenylated RNA was fractionated using an oligo(dT) affinity push column (Stratagene Cloning Systems, La Jolla, CA) The mRNA, 5 g, was incubated with reverse transcriptase (1000 units, Af:IIV, Life Technologies) in the presence of 500 rn dATP, dCTP, dGTP, and dTTP (dNTP mix}, 50 rnM Tris-Cl, pH 8 3, 75 rnM KCl, 3 rnM MgC1 2 10 rnM dithiothreitol, and 1 g Not I primer/adapter (Life Technologies, Inc., Gaithersburg, MD) in a total volume of

PAGE 58

37 20 l (Okayama and Berg, 1 982 ; Gub l er an d H of f man, 1983) After incubation at 42 C for 80 min, the reaction mi x ture was placed on ice A sample, 18 l, was added to 25 mM Tris Cl, pH 7.5, 100 mM KCl, 5 mM MgC1 2 10 mM ammonium sulfate, 0.15 mM P -NAD + 0.2 5 mM dNTP mix, 1 2 mM dithiothreitol, 10 units of Escherichia coli DNA ligase, 40 units E coli DNA polymerase I, and 2 units E coli RNAse Hin a total volume of 0.15 ml. After incubation at 16 C for 2 h, 10 units of T4 DNA polymerase was added and the i n cubation continued for 5 min at 16 C The resulting blunt-ended cDNA was e x tracted with an equal volume of phenol : chloroform : isoarnyl alcohol, 25 : 24 : 1 The DNA in the aqueous phase of the extract was precipitated by the addition of one-half vol of 7.5 M ammonium acetate and 2 vol of ice-cold ethanol The bluntended cDNA was ligated to a Sal I adapter by incubating in a 50 l volume, with 50 mM Tris-Cl~ pH 7.6, 10 mM MgC1 2 1 mM ATP, 5% polyethylene glycol 8000, 1 mM dithiothreitol 10 g Sal I adapter, and 5 units T4 DNA ligase for 16 hat 16 C The cDNA in the reaction mixture was extracted and precipitated as above. The cDNA was then incubated with 50 mM Tris-Cl, pH 8.0 10 mM MgC1 2 100 mM NaCl, and 1200 units/ml Not I endonuclease in a final volume of 0.05 ml for 2h at 37 C The cDNA was isolated as before and size fractionated on a Sephacryl-500 HR column. High-molecular weight cDNA was ligated into Agt22a using the Lambda Superscript System (Life Technologies, inc.).

PAGE 59

38 cDNA Library Screening Degenerate primers HT23 and HT24 were designed against the N-terminal sequence data derived from sequencing the 52,500 band of the D 1 fraction (see table 3 1). The sequences of these primers, and other important primers used, are shown in table 3 2. Using primers HT23 and HT24 in a polymerase chain reaction (PCR) (Compton, 1990), clone II was isolated The relationships of the different clones obtained to each other, and to the sequence of the target cytochrome P450, are shown in figure 3.2. Clone II was 117 base pairs and coded for 39 amino acids which differed only by one residue from the N-terminal sequence of the isolated cytochrome P450 in the D 1 fraction. C l one I was then generated using an exact primer, HT26, obtained from clone II and a vector primer to the 5' end of A gt22a Clone I contained base pairs 1 to 93 of the target cytochrome P450 Clone IV, which coded for 851 base pairs, was generated using an exact primer, HT25, obtained from clone II, and a vector primer to the 3' end of A gt22a. Clone III, which represents a cDNA corresponding to all of the coding region of the mRNA of this cytochrome P450, was isolated using HT23 and MJlO, primers derived from exact sequence data in clone V (table 3 2) Clone VI was obtained using this primer set, but represents an incomplete clone All coding regions of the target cytochrome P450 were represented by at least three independent clones and all

PAGE 60

39 clones were sequenced at least twice. In this manner, a consensus sequence was obtained. The PCR tubes contained the following: 5 l cDNA library in 10 mM MgS0 4 (2 9 X 10 10 plaque-forming units/ml), 10 l of PCR buffer (500 mM KCl, 100 mM Tris-Cl, pH 8.4, 15 mM MgC1 2 and 1 mg gelatin/ml), 1 l of a solution containing 20 mM dNTP mix, and 100 pmol each of the degenerate primers or 30 pmol each of nondegenerate primers The volume was made up to 99 l with sterile, deionized water and the reaction tubes were heated at 94 C for 5 min Taq DNA polymerase (5 units, Promega, Madison, WI) was then added for a final volume of 100 land the reaction tubes were heated and cooled for 35 cycles under the following temperature regime : 94 C for 1 min (denaturing), 51 C for 2 min (annealing), and 72 C for 3 min (elongating). A final 10-min extension period at 72 C was included. Cloning and Sequencing of PCR Products PCR products were cloned into pGEM-T (Promega) and used to transform competent JM109 cells Plasmid templates were prepared for sequencing using the Wizard Mini-Prep system (Promega) Manual dideoxy sequencing was done us in g the Sequenase Sequencing Kit (USB, Cleveland, OH) Add i tional sequencing was done by the ICBR Sequencing Core located at the University of Florida

PAGE 61

40 RT-PCR Exper i ments Total RNA was isolated from the spiny lobster hepatopancreas as described above Ten micrograms of RNA were used in the following reaction : 100 pmol of an oligo dT primer to a final volume of 6 l diethylpyrocarbonate treated water. The mi x ture was heated at 65 C for 10 m in and then placed on i ce To this mixture was added 2 l of PCR buffer, 1 1 of 20 mM dNTP mix, 1 l of RNase inhibitor (Rnasin, P r omega, I n c ), 1 l of Superscript Reverse Transcriptase (200 units, Life Technologies, Inc ) and the reaction volume brought up to 20 l with DEPC w ater The reaction mixture was incubated at 42 C for 2 hours Portions of this reaction, 1 l, were used in the PCR reaction using primers HT23 (figure 3 2, 100 pmol) and oligo dT (100 pmol) under the reaction conditions described above, but with the annealing temperature of 45 C A portion of the PCR product, 1 l, was then nested using primers HT25 and MJll with an annealing temperature of s1 c Northern Blot Analysis Ten micrograms of RNA isolated from the hepatopancreas of the spiny lobster were denatured following the methods of McMasters and Charmichael (1977). After electrophores i s in 1 1% agarose/ 10 mM sodium phosphate buffer, pH 7 0 the RNA was transferred using a vacuum blotter to a 45 m Magna

PAGE 62

41 nylon membrane (MCI, Westborough, MA) u s in g a vacuum blotter. The membrane was p robed with a 3 2 P-dCTP labeled PCR product corresponding to the first 705 base pairs of CYP2L This probe was labeled by random prime labeling (Pharmacia oligo labeling kit). RNA in the blots was hybridized by incubating in a solution containing 0 75 M NaCl, 0 05 M NaH 2 P0 H 2 0, 0 005 M EDTA, 0 1 mg / ml herring sperm DNA, 0 1 % SDS for 12 hrs at 68 C The membrane was washed th r ee times at 68 C in O 02 5 M NaCl, 0 001 M NaH 2 P0 4 H 2 0, 0 .1 mM EDTA and exposed with intensifying screens to X ray fi l m for at least 12 hrs at -80 C Results and Discussion N-Terminal Sequence of Spiny Lobster cytochrome P450 One dimensional SDS-PAGE showed that the D 1 preparation from spiny lobster hepatopancreas microsomes contained a major protein band of 52,500-Da and some minor bands (figure 3 1) Densitometric analysis of the Coomassie blue-stained bands (not shown) showed that the 52 500-Da bands accounted for 80% of the protein in the D 1 fract i on M i crosequence analysis of about 5 g protein from the 52,500-Da band in the D 1 preparation showed that this band accounted for 75 % of the total protein. This peptide was sequenced through residue 39 (table 3.1)

PAGE 63

Figure 3 1. SDS-PAGE of the spiny lobster cytochrome P450 containing fraction stained with Coomassie blue. Lane 1, molecular weight standards. Lane 2, D 1 fraction, 11 5 nmol cytochrome P450/mg protein. The 52,500-Da band was shown by densitometry to contain about 80% of the total protein in this fraction 4 2

PAGE 64

Table 3 1. The N-Terminal Amino Acid Sequences in a cytochrome P450-Containing fraction a Isolated from Spiny Lobster Hepatopancreas Microsomes Sequence Residues identified by microsequencingb MLTGALLLLL VWIVYLLDK KPSGLP PGIW GWPLVGRMP (T)WIK(K)V(L)AM a The cytochrome P450-containing fracti0n (D 1 fraction) was isolated from spiny lobster hepatopancreas microsomes as described previously (James, 1990). The predominant protein band in this fraction, of mol. wt 52,500 on one-dimensional SDS-PAGE (see figure 1.3), was used for microseguencing. b About 40 pmol was submitted for microsequencing as described under Methods The overall repetitive yield was 94% Parentheses indicate ambiguous amino acid assignments in the minor sequence. c The major sequence shown accounted for 75% of the total protein in this band (30 pmol in the sample sequenced). The minor sequence in the 52.5 kD D 1 band accounted for 20% of the protein (8 pmol). The identity of this protein is not known. 43

PAGE 65

Partial N-terminal sequence information was obtained for a minor peptide in the 52,500-Da band (table 3 1). 44 The first 39 amino acids obtained from N-terminal sequencing of the 52,000-Da major band in the D 1 preparation included hydrophobic amino acids characteristic of membrane bound proteins (Black, 1992) Comparison of this N-terminal sequence to the terminal sequences of other proteins in the GCG database revealed similarities to several mammalian cytochrome P450s in the 2 family (Philips et al 1983; Labbe et al., 1988; Ueno and Gonzalez, 1990) and similarities to short stretches of the N-terminal sequences of cytochrome P450s in the 1,3, and 4 families (Kawajiri et al., 1986; Hardwick et al., 1987; Aoyama et al 1989). From the spectrally measured cytochrome P450 content of D 1 (11.5 nmol/mg), the calculated specific content of a pure cytochrome P450 of molecular mass 52,500 Da (19 nmol/mg), and the percentage of protein in the 52,500-Da band (80%), we would expect 76% of the protein in the D 1 fraction to be cytochrome P450 This number matched well with the observed value for the major component of the D 1 preparation (75%) and provided confidence that the 39 amino acid N-terminal sequence was that of a cytochrome P450 from the spiny lobster hepatopancreas.

PAGE 66

45 Table 3.2. Sequence of some of the Primers Used to Obtain the cDNA Clones Pri me r name HT23 HT24 HT25 HT26 HT36 MJlO ATG GGC TTG TCC GTC TGT Sequence (CT)TI ACI GGI GCI (CT)TI (CT)TI ATI C(GT)I CCI ACI A(AG)I GGC CA CTG CTG GTG GTA ATA GTC TAC CCA TAT ACG TGG GGG AAG TCC AAG AAC TGG ATG GGC CAG GAG TGG AGT TAT 1 a a, amino acid Type and Location (CT) T Degenerate, a a 1 1-8 Degenerate, a a 39-32 Exact, a.a 9-16 Exact, a a 31-24 Exact, a.a. 224-230 Exact, 3 I to stop codon

PAGE 67

cDNA Sequence Degenerate primers were designed that corresponded to regions of the 39 N-terminal amino acids of the D 1 preparation. The sequences of the degenerate primers and other selected primers used are shown in table 3.2. 46 The degenerate primers were used to PCR screen a spiny lobster cDNA library The process was repeated with exact primers to obtain further cDNA sequences. A new exact primer was required about every 200 base pairs. Sequences obtained were melded to form a complete sequence (figure 3 2). A separate clone which coded for all of the cytochrome P450 sequence was obtained using primers HT23 and MJlO (see figure 3 2). This sequence has an open reading frame of 492 amino acids (calculated Mr of 56,669) and contains the heme binding signature, residues 429 to 438, that is conserved in all CYPs (figure 3.3). The individual amino acids that are invariant in all known cytochrome P450s are highlighted in figure 3 3 with double underlining. The deduced amino acid sequence of this clone differs by 1 amino acid in the first 39 amino acids from the microsequenced D 1 peptide Residue 11 of the clone was found to be leucine and not valine, as in the peptide. Comparison of the deduced 492-amino acid cytochrome P450 sequence with other protein sequences using the BLAST program showed that the sequence was highly

PAGE 68

HT23 i 180 i Clone I Clone II Clone Ill Clone IV 360 i 540 i 720 I 900 I MJ10 1080 1260 1470!1530 I I I I CYP2L -----------------.. .. ... An Clone V Clone VI 4 7 Figure 3 2 Cloning strategy showing the clones used to meld together a full-length cDNA sequence The primers HT23 and MJlO shown were used to generate a single clone (clone III) representing the entire coding port i on of the mRNA The sequence of these primers are shown in table 3 2

PAGE 69

ATGCTGACGGGGGCGCT GC TTTTATTGCTGCTGGTGGTAATAGT C TA CCTCC T CG ACAAGAAGCCATCAGGA 72 M L T G A L L L L L L V V I V Y L L D K K P S G 24 CTTCCCCCAGG'l'.Al'ATGGGGATGGCCACTGG TGGGAAGAATGC CCTC GAGGTCAAAACATCTGGCCGACCAG 144 L P P G I W G W P L V G R M P S R S K H L 'A D Q 48 GTTAAGCAACTGCGTAAAAAGTATGGCGACATAATCACGTGGCGC'ATCGGAACCAGAGTCAATGTATTCCTT 216 V K Q L R K K Y G D I I T W R I G T R V N V F L 72 TGCAACTTC'AAATTGGTTAAGACGGCTCTGTCCAAGTTCGAGTGCTCAGACAGACCAGACTTCTACACTTTC 288 C N F K L V K T 'A L S K F E C S D R P D F Y T F 96 AAGCTTTTTGGGGAAGGCAA C GATGTTGGTGTCGTCTTTAGCAAl'GGTGTGATGTGGCAGACGCACCGTCGC 360 K L F G E G N D V G V V F S N G V M W Q T H R R 120 TTTATTCTACGCCAGCTGAGGGACCTGGGTATGGGTAAGTCCAGACTGGAGGCCGCCATCCAGCACGAAGCC 432 F I L R Q L R D L G M G K S R L E A A I Q H E A 144 GCCTGCCTGGTGCAGGAGCTGAAGAAACACACAGACCAGCCCATGCCCCTACC'AAAGTCCAT'AAACCTAGCT 504 A C L V Q E L K K H T D Q P M P L P K S I N L A 168 GTTCTCAACGTGATTTGGAAGCTTGTTGC'AGATCACCGGTATTCGCTTCAGGATCAAGAGGGTCAATACTTC 576 V L N V I W K L V A D H R Y S L Q D Q E G Q Y F 192 ACTCAGCTTCTCACTACCACCACAGACAACATGCAGGGCTTTGCTTTGAACCTCTTCAACTACCTACCGTGG 648 T Q L L T T T T D N M Q G F A L N L f N Y L P W 216 CTTTTGAT GAT CACCCCAGACTT TG TC AAGAACTGGATGGGCGTTAGGGTACTACGAGACGGGGTCTGCGA G 720 L L M I T P O F V K N W M G V R V L R O G V C E 240 TTGAAAGATTACATGAAGACTTTCA T C AAGGAGCA CCAGGCCACGC TGGA CCCGT C'AAAC C CAAAGGACTTA 7 92 L K D Y M K T F I K E H Q A T L D P S N P K D L 264 TTGGACGCCTACCTGATAGATTTGCAAGAGCGCAAGGAA.GATCCTCTCTCCACAATGAACATTGAAACCGTT 864 L D 'A Y L I D L Q E R K E D P L S T M N I E T V 288 CGAGCCGTGA TCATGGA CCTG TTTGGCGCTGGTAC CGAGACCACT TCAACCATGATACGATGGACGATTCTC 936 R A V I M D L F G A G T E T T S T M I R W T I L 3 12 TATTTGATGAAGTACCCCGAGGTGCAGGCCAAGATCCAGAGAGAGATTGATGCCGCCGTCCCTAGGGGCACC 1008 Y L M K Y P E V Q A K I Q R E I D A A V P R G T 336 TTACCCTCTCTCGAACACAAGGATAAGTTGGCGTACTTTGAGGCGACGATCCACGAGGTGCACCGCATTGTG 1080 L P S L E H K D K L A Y F E A T l H I V H i I V 36 0 TCTCTTGTTCCGCTTGGTGTATCCCACTACACCAACCAAGATACCGAGCTCGCCGGCTACAGACTTCCCAAG 1152 S L V P L G V S H Y T N Q D T E L A G Y R L P K 384 GGGACGGTGGTGA TGA GTCATC TAGAGTGTTGCCA C AGAGAC C CAAGTTACTGGGAGAAGCCTAATGAGTT C 1224 G T V V M S H L E C C H R D P S Y W E K P N E F 408 TA CCC GGAACATTTCCTGGACGATCAGGGCAAATTCGTCAAGAGGGAACACCTCGTCA'ACTTCTCTGTAGGT 1296 Y P B H F L D D Q G K F V K R E H L V N I S V G 432 CGCCGGGT ATGT GTGGGCGAGTCTC TGGCCAGGAT GGAGC T CTTCG TCTT CC TGTCGGCGATA CT GCAGAA C 1 368 R R V C V G E S L A R M E L F V F L S A I L Q M 456 TT C ACCTTCTCGGCCCCTAAGGGAGAGGTGCTGCACACTGAGAAAGACCCGCAAC'AAATGCTATTCTCTTTT 1440 F T F S A P K G E V L H T E K D P Q Q M L F S F 480 CCCAAGCCCT ATCAAGTTAT CATC AGGGAGAGGGA GTGAT TCCTTTGAACCAGTGGAAATGTTCATAA CTCC 1512 P K P Y Q V I I R E R E 49 2 A CTCCTGACATTTGGCAGTAT AACAAGTTGATGTCCATT C TTGTAACTTATAT CTTCAT TGAAGTGACTGTG 158 4 ATGATA 1590 48 Figure 3.3. Nucleotide and deduced pr otein sequence of the spiny lobster cytochrome P450, CYP2L. The open reading frame of 492 amino acids defines a protein with a calculated m olec ular mass of 56,669 Da. The heme-binding signature is underlined and invariant amino acids in all known cytochrome P450s are bold and double underlined.

PAGE 70

49 similar to cytochrome P450s in the 2 fam i ly b ut not to any non-cytochrome P450 sequences Rat CYPs 2Bl 2B2 and 2D4 were all 36% identical at the amino acid level to the spiny lobster sequence. While several studies have shown the catalytic activity of a cytochrome P450 is not necessarily indicative of a particular cytochrome P450 family, it was of interest that previous reconstitution e x periments with the D 1 cytochrome P450 showed good activity with substrates commonly monooxygenated by cytochrome P450s in the 2B family, such as testosterone (6 ~ and 16 a ), p r ogesterone ( 1 6a), benzphetamine, and aminopyrine (James, 1990 ; James and Shiverick, 1984) Although the overall sequence identity of the spiny lobster cytochrome P450 with cytochrome P450s in the 2 family was less than 40%, this new form was assigned to the 2 family by the CYP nomenclature committee and given a new subfamily name, CYP2L. Because the N-terminal sequence of the CYP2L described above was 1 amino acid different from the cytochrome P450 sequence in the D 1 fraction, obtained by microsequencing of the protein, the spiny lobster hepatopancreas cDNA li brary was rescreened by PCR with an exact probe to the N-terminal sequence. Other positive clones were obtained and have been partially sequenced. The deduced N-terminal amino acid sequence of one of these clones was identical to the first 39 amino acids of the D 1 cytochrome P450 protein. This

PAGE 71

X Cl) u C: .,,:::; co a. 0 u J: 50 ---------------. 25 0 -25 -50 50 25 0 -25 A C 100 200 300 400 100 200 300 400 500 50 -,--------------, 25 0 -25 -50 50 25 0 25 B 100 200 300 400 D .. -50 -.Lrr.,.,..,.,"T"m'TmTmrT'TTll'TTT1mTl'TTT'rTTTTTTTTTTT-rrri 100 200 300 400 Residue Number Figure 3.4. Hydropathy plots of the rat CYP2Bl (Fujii Kuriyama et al, 1982; accession number J00719) (A), rat CYP2B2 (Mizukami et al, 1983; accession number A21162) (B), rat CYP2D4 (Matsunaga et al, 1990; accession number 50 P13108) (c), and spiny lobster CYP2L (accession number U44826) (D) The hydropathy index computation was done using PCGENE (Intelligenetics, Mountain View, CA) with an interval (sliding window) of nine amino acids (Kyte and Doolittle, 1982)

PAGE 72

5 1 suggests that there may be other closely related members of the CYP2L subfamily in spiny lobster hepatopancreas. Comparison With Other 2 Family CYPs Comparisons of hydropathy plots of CYP2L and rat CYPs 2Bl, 2B2, and 2D4 indicate several structural similarities between these forms (figure 3 4). The peaks that line up in all forms appear to correspond to alpha helical regions present in 2 family members. The alignment of primary sequences of CYP2L and rat CY P s 2Bl, 2B2, and 2D4 are shown in figure. 3.5. Some regions of the sequence of spiny lobster 2L and rat 2 family CYPs show high homology, whereas other regions bear little similarity to each other It was remarkable that the string of leucines at positions 6-11 of the spiny lobster CYP2L and the PPG cluster at spiny lobster 2L residues 26-28 were found in several members of the mammalian 2 family cytochrome P450s (Philips et al., 1983; Labbe et al., 1988; Kawajiri et al., 1986). These highly conserved portions probably contribute to the hydrophobicity of the N-terminus and its ability to associate with microsomal membranes (Black, 1992) Substrate recognition sites (SRS) have been suggested for rat 2B2 at positions 97-118 (SRSl), 199-206 (SRS2), 234-242 (SRS3), 287-305 (SRS4), 360-370 (SRSS), and 471-478 (SRS6) by Gotoh (1992). The 2L sequence has residues in common with other 2 family members in several of these substrate recognition

PAGE 73

RAT2Bl RAT2B2 CYP2L RAT2D4 RAT2Bl RAT2B2 CYP2L RAT2D4 RAT2Bl RAT2B2 CYP2L RAT2D4 RAT2Bl RAT2B2 CYP2L RAT2D4 RAT2B1 RAT2B2 CYP2L AAT2D4 RAT2B1 RAT2B2 CYP2L RAT2D4 RAT2Bl RAT2B2 CYP2L RAT2D4 RAT2B1 RAT2B2 CYP2L RAT2D4 RAT2Bl RAT2B2 CYP2L RAT2D4 RAT2B1 RAT2B2 CYP2L RAT2D4 i=,--ept LLL~~~~ ~~~--lvrgh rgnf ~~~1Llqldrg gk gk Jt10 f S ~otr..,ro lT ~~~--lvrghPIKlSrgnf UIJ~hLlqldrg t::.!:lLl~~~~;;qRwi~ 1 .____,.v-n.~~ gqaeD gqaeDf l!KltlALI .... ""' E C .......... v,t\V..seDt dptflfQcit rnrr dptf 1 fQci t alPM pl pk s IN .un. u...u." fspntlLdNr'l. fgel~Fdyt.M'"qflrlle fg Fdyt qflrlle fslLs """"fslLs DnMq dmlEees ad sl egqyft~~..,._.fadRJFey rfirll qvI gsh .. ... p-_,...dR qqvigshr-,_ dR~~ ~aVprgt hK c..;revigqvr ""--.....J 491 491 492 500 ssal D ssal >f.UP::: C C h S S V 1,. '14-1'-' ILQN ILQN IuLC"'-L "-..,.HE IIMIVII HE VlofR s r.E.H FL4,,fC14, tri;,,..'PEHFL !Vu,"EHFLQ:JIQGl ,i:;-r;.,,p EH FL hla-pkdiDl kesgI hla-pkdiDl esgI ~evlhTEk~qm-L MP l t"l(:lqprpSDyg--ifga 49 49 43 S5 104 104 96 110 155 155 149 165 210 210 204 220 259 259 259 268 313 313 313 323 368 368 368 378 423 423 423 433 477 477 477 486 52 Figure 3.5. Comparison of the deduced amino acid sequence of CYP2L with that of rat CYPs 2Bl, 2B2, 2B4 (accession number S19172) and 2D4. Boxes show residues that are identical between 2L and 2D4 or the 2B subfamily members, while conserved amino acids are indicated by capital letters For the complete sequence, there were 115 amino acids (23.4%) that were identical in all five forms and 64 additional similar amino acids (13 0%) Comparing the C-terminal half (residues 250-492) of CYP2L with the C-terminal halves of 2Bl, 2B2, 2B4 and 2D4, there were 73 identical residues (30 .3 %) and an additional 38 similar residues (15.8%). These comparisons were made using CLUSTAL V

PAGE 74

53 sites. The GV residues at CYP2L positions 106-107 fall in SRSl and are identical in the sequences shown in figure 3 5. In SRS2, the leucine at CYP2L position 195 and the Tat CYP2L position 199 are present in the rat sequences (figure 3.5). In SRS4 there were several residues found in all five sequences, i e LF at 295-296, AG at 298-299, Tat 302, and ST at 304-305 (figure 3 5). In SRS5 residues P (364), GV (366-367) and H (369) were common in the compared sequences It has been suggested that Sat position 304 and V residues at positions 363 and 367 may contribute to substrate binding (He et al., 1994). The regions designated as SRS3 and SRS6 did not have common residues in the 2 family members that were compared in figure 3 5 Other highly conserved regions are found at residues 119-121, 252, 257-258, 325, 327-329, 408, 410-415, 438-439, 442-443, 445-447, 449, and 454-455 (figure 3 5). Several investigators have noted that regions of the C-terminus of cytochrome P450 sequences show greater homology overall than N-terminal regions (Kalb et al., 1988; Lewis, 1995). This is true for the CYP2L sequence with selected rat 2B and 2D sequences (figu r e 3 5) Northern Blot and RT-PCR Northern blot analysis reveals a primary transcript of about 1.8 kB in size (figure 3.6). This result serves to confirm that the message for CYP2Ll is present in the spiny lobster hepatopancreas

PAGE 75

Furthermore, there is an indication of a second transcript around 1.5 kb (figure 3.6). Experiments using RT-PCR also suggest the existence of a second transcript (figure 3.7), however these results require confirmation. 54 There are numerous examples of alternatively spliced cytochrome P450 messages in the 2 family (Kimura et al., 1989; Miles et al., 1989 Yamano et al 1989; Lacroix et al., 1990). What function such a transcript may serve is unknown. Our lab consistently notes a 30 kDa band that immunoreacts with a polyclonal antibody to CYP2L on Western Bl o ts (B o yle and James, 1996). Th e only other invertebrate cytochrome P450s that have been sequenced and assigned families to date have been from insects and a pond snail and are in the 4,6, and 10 families (N e lson et al, 1993). Thus, this is the first report of a 2 family cytochrome P450 in an invertebrate and extends the incidence of this family in the animal kingdom.

PAGE 76

55 kb Figure 3 6 Northern blot of total RNA isolated from the hepatopancreas of the spiny lobster. Ten micrograms of total RNA were blotted onto a nylon membrane and probed with a 32P-CTP-labeled probe, as described in Methods Arrows mark a possible 1.5 kb message ( l ower arrow ) and about a 2 1 kb message (upper arrow)

PAGE 77

kb 1.90 5 8 38 95 :. .83 Figure 3.7 RT-PCR of total RNA isolated from the spiny lobster hepatopancreas RNA was primed with an oligo-dT primer and reverse transcribed as described in Methods. Using HT25 and MJ l l, a primer just upstream to the poly-T tail, two bands were detected. The band at around 1.8 kb (upper arrow) is the expected product for a normal transcript. The product around 1.0 kb (lower arrow) may represent an alternatively spliced message. 56

PAGE 78

CHAPTER 4 CATALYTIC CHARACTERIZATION OF CYTOCHROME P450 2Ll IN BACTERIAL AND YEAST EXPRESSION SYSTEMS Introduction Cytochrome P450 enzymes catalyze the insertion of oxygen into both endogenous and exogenous substrates found in many animal and plant species (Nelson et al 1993) In its dual role, cytochrome P450s function as integral parts of biosynthetic pathways, such as steroid biosynthesis, and in the initial or phase I detoxification pathways of xenobiotics Tissues from several crustacean species are able to metabolize various steroid hormones in vitro (Table 4 1). Studies have shown that invertebrates possess steroid hormones similar or identical to those found in mammal i an species (Burns et al., 1984; Fairs et al 1989) Tcholakian and Eik-Nes (1971) reported that progesterone could be metabolized to 11-deoxycorticosterone (21hydroxyprogesterone), androstenedione and to 20hydroxyprogesterone in the "androgenic gland'' of the blue crab, reactions that can be catalyzed by cytochrome P450 Ovarian tissues from the crab, Portunus tritubeculatus, hydroxylate progesterone in the 17a-position (Teshima and Kanazawa, 1971). The shore crab, Carcinus maenas, 57

PAGE 79

Table 4.1. in vitro Steroid Metabolism in Crustacean Species species Blue crab Callinectes sapidus Crab Portunus trituberculatus shore crab Carcinus maenas American lobster Homarus amer1.canus Shrimp Penaeus monodon Florida spiny lobster Panulirus argus organ substrate(s) product(s) AG P 210HP,200HP Andra Ovaries P 17a.OHP Testes VD+ AG Testes Ovaries purified protein from HP AnG Andra estrone p p T p Ee T 17POHE 200HP 200HP 16 a. OHT,160H P T 6POHT 16a.OHP,6~0HP 17a.OHP,210HP 200HEc 58 reference Tcholakian and Eik-Nes, 1971 Teshima and Kanazawa, 1971 Blanchet et al 1978 Burns et al 1984 Young et al. 1992 James and Shiverick, 1984 HP=hepatopancreas, VD=vas deferens, AG=androgenic gland, AnG=antennal gland P=progesterone, Andro=androstenedione, Ecdysone, 210HP=21-hydroxyprogesterone, 200HP=20-hydroxyprogesterone, 17a.OHP=17a.-hydroxyprogesterone, 17 P OHE=17 P estradiol, 16a.OHT=16 a. -hydroxytestosterone, 16~0HT=16 ~ -hydroxytestosterone, 6~0HP=6P-hydroxyprogestererone, 200HEc=20-hydroxyecdysone

PAGE 80

59 metabolizes androstenedione to tes t osterone and est r o n e to 17 P -estradiol in vas deferens and testes tissue preparations (Blanchet et al 1978) Lachaise and Lafont (1984) demonstrated that the shore crab could metabolize ponasterone A (25-deoxy-20-hydroxyecdysone) to 25hydroxyecdysone American lobster testes were s h own to metabolize progesterone to 20-hydro x yprogesterone (Burns et al., 1984), and shrimp, Penaeus monodon, ovary was also shown to metabolize progesterone to 20-h y dro x yprogeste r one (Young et al., 1992) James reported that the Ml fraction from the spiny lobster hepatopancreas could metabolize a variety of substrates (Table 4 2, James, 1990; James, 1989) Two catalytically active fractions (Dl and D2) of cytochrome P450 in the spiny lobster hepatopancreas were isolated (James, 1990) The fractions have a similar apparent molecular mass and overlapping substrate prefere n ces for benzo-a-pyrene, benzphetamine, ethoxycoumarin, testosterone and progesterone {James, 1990 ; James and Shiverick 1984) Progesterone was hydroxylated in the 16 a 6 P and 21 positions, while testosterone was hydroxylated in the 16a, 16 P and 6P positions (Table 4 2, James, 1990, James and Shiverick, 1984). Hydroxylation of progesterone or testosterone at the 16 or 6 position diminishes the biological activity of these steroids The molting hormone, ecdysone, was metabolized to 20-hydroxyecdysone in mitoc h ondria from spiny lobster antennal gland, as we l l as

PAGE 81

Table 4.2. Monooxygenase Activity of Spiny Lobster Cytochrome P450 Fractions in the Presence of NADPH and NADPH-Cytochrome P450 Reductase from Rat Liver. P450 Substrate Benzphetamine Aminopyrine 7-Ethoxycoumarin Methylphenoxazone Ethylphenoxazone Pentylphenoxazone Benzylphenoxazone Benzo(a)pyrene Testosterone 16a6~Progesterone 16a6~21Nanomoles product formed/min/nmol cytochrome Ml 26.3+5.3 (8) 19.8 0.325+0.139 (4) 0 0189 0.062+0.051 (5) 0.002 0.010 1.43+0.41 (5) 1.3 0.6 4 96.28 (8) 1 18.41 (8) 0.67.42 (8) Dl 50 (4) 40 0.140+0.023 (3) 0.004 001 (3) 0.007+0.002 (4) 0.011 0 001 (3) 0.004.001 (3) 1.97.83 (5) 8 65.81 (3) 7.31+6.16 (3) 4 3 4 9 1 ( 3 ) 0.9+0.3 (3) 0.47.02 (3) D2 122 (4) 76 0.183 0 005.001 (3} 0.005+0.002 (3) 0 013 001 (3) 0 003+0.001 (3) 1.54+0.39 (4) 4.1 3 4 21 1 6.2 0.41 60 Note: Values shown are means +SD {n) or individual values. This data was taken from (James, 1990). Ml =solubilized microsomal fractions, D1 and D2 are chromatographic fraction of the Ml material.

PAGE 82

61 in gonadal tissues and hepatopancreas mitochondria (James and Shiverick, 1984). We have cloned a cytochrome P450, cytochrome P450 2Ll, from the hepatopancreas of the spiny lobster (James et al 1996). The first 39 amino acids deduced from the DNA sequence of cytochrome P450 2Ll are nearly identical to terminal amino acid sequence data obtained from the Dl fraction, differing by only one amino acid (James et al., 1996). This difference, a substitution of a leucine for a valine, is a conservative change. However, a clone was obtained in which this substitution was absent (James et al 19 9 6) The following study reports upon the expression of cytochrome P450 2Ll in bacteria and yeast Functional cytochrome P450 2Ll was obtained from yeast and its catalytic activity determined using testosterone and progesterone substrates Materials and Methods Spiny Lobster and Rat Protein Preparations Microsomes were prepared from a male spiny lobster hepatopancreas as described previously {James, 1990). The "Ml" fraction was prepared by stirring the microsomal fraction in 0.5 % cholic acid for 1 hr at 4 C The mixture

PAGE 83

62 was centrifuged at 110,000 x g for 90 min and the dense, red liquid fraction isolated (Ml fraction James, 1990). Cytochrome P450 reductase was isolated from phenobarbital-treated rats (80 mg/kg for 4 days) by the method of Yasukochi and Masters (1976) Protein concentration of the various preparations described in this paper were done using the method of Lowry et al (1951). Spectral determination of cytochrome P450 content followed the procedure of Estabrook (1972). SDS-PAGE was done using the methods of Laemmli (1970) Construct Preparation Two cytochrome P450 2Ll constructs were prepared for insertion into bacterial or fungal cells The first construct, ~O, was designed to express the entire deduced amino acid sequence of cytochrome P450 2Ll ~ O was generated using primers MJ24 and MJ25 (table 4.3 and figure 4 1). A Agt22a cDNA library made from spiny lobster hepatopancreas (James et al., 1996) was screened using these two primers in a polymerase chain reaction (Compton, 1990) The PCR tubes contained the following: 5 l cDNA library in 10 mM MgS0 4 (2.9 X 10 10 plaque-forming units/ml), 10 l of PCR buffer (500 mM KCl, 100 mM Tris-Cl, pH 8 4, 15 mM MgC1 2 and 1 mg gelatin/ml), 1 l of a solution containing 20 mM dNTP mix, and 30 pmol of each primer. The volume was made up to 99 l with sterile, deionized water and the reaction

PAGE 84

Table 4.3. Primer Sequences Used in this Study. Primer Name Sequence BRNl AGTCGAATTCCATATGGCTCTGTTATTA GCACTTTTTTTATTGCTG CTGGTG M A L L L A V F L L L L V AGTCGAATTCCATATGC TGACGGGGGCG CTGCT MJ25 M L T G A L L MJ24 GCGAATTCGTGCACTCACTCCCTCTCCCT (E R E R Ml3 CGCCAGGGTT TTCCCAGTCA CGAC HT26 TCCCCATAT ACCTGGGGGAAGTCC G W I G P P L G HT36 GTC AAG AAC TGG ATG GGC HT38 V K N W M G ATC (D TTT CAA CTC GCA GAC K L E C V Ph94 GACTGGTTCC AATTGACAAG C Ph93 GGATGTCAGA ATGCCATTTG C CCC G) 1 GATGA I I) 1 1 Residues in parenthesis are the inverse translation products 63 Comments 5'-EcoR I, Nde I sites 5 '-EcoR I, Nd e I sites 3'-EcoR I, Sal I sites 5' polylinker 3 1 -antisense 5'-sense 3'-antisense 5'-AOXl site ( 5' to polylinker) 3'-AOXl site (3' to polylinker)

PAGE 85

MJ25 5 1 MJ24 5 1 BRNl 5' EcoR I AGTCGAATTCCAT M ATG Nde I L T CTG ACG G GGG A GCG L CTG 64 L CT 3' EcoR I GCGAATTCGTCGAC Sal I E TCA CTC R CCT E CTC R CCT I GAT I GA 3 1 EcoR I M AGTCGAATTCCAT ATG Nde I A GCT F L TTT TTA L L L CTG TTA TTA L L A GCA V L TTG CTG CTG GTG CYP 2Ll V GTT Figure 4.1 The oligonucleotide sequence of expression primers MJ25, MJ24, and BRNl MJ25 and BRNl both i n cor p orate unique EcoR I and Nde I endonuclease rest r iction sites to enable ligation of the PCR product into expression vectors that have these sites within the polylinker region MJ24 incorporates unique EcoR I and Sal I sites into a PCR product. The resulting PCR product contains 5' and 3' EcoR I sites, and a 5' Nde I site and a 3' Sal I si t e

PAGE 86

65 tubes were heated at 94 C for 5 min Proo I (5 units, Boehrinher Mannheim, Inc ), a thermostable DNA polymerase with proofreading capabilities, was then added for a final volume of 100 land the reaction tubes were heated and cooled for 35 cycles under the following temperature regime: 94 C for 1 min (denaturing), 60 C for 2 min (annealing), and 72 C for 3 min (elongating) A final 10-min extension period at 72 C was included A full length clone was constructed and ligated into pGEM-T (Promega). A second construct was prepared, 6 1, and was designed to replace the first 7 amino acids of cytochrome P450 2Ll with the amino acids MALLLAVF (the Barnes modification) 61 was generated using primers BRNl and MJ24 (see table 4 3 and fig 4 1) in a PCR reaction using conditions identical to those used for 60 61 was also ligated into pGEM-T Bacterial Expression Vectors 60 and 61 were excised from pGEM-T using either Nde I and Sal I endonucleases or only EcoR I endonuclease, depending upon which bacterial expression vector was to be used (see table 4.4 for characteristics of the various expression vectors used in this study). The Nde I/Sal I endonuclease pair was used for DNA products to be directionally inserted into pET21c, pET28a or pCW EcoR I Nde I/Sal I endonuclease reactions were as follows: 1 g of plasmid DNA containing either the 60 or 61 construct was incubated in 50 mM Tris

PAGE 87

T ab l e 4.4 E x p r essio n V e ct ors U s ed in this Stu d y and th eir Attr i b u tes 66 Vector Pol;tlinker Selection Bacterial Strain Tag: Promoter pMAL-p2 EcoR I Arnpicillin DH5 a CM BP tac pCW Nde I/S a l I Arnpicillin DH5 a C-P H (NU) tac pPET21c Nde I/Sal I Arnpicillin BL21 C-P H (NU) T7 pPET28a Nde I/Sal I Kanamycin BL21 N-PH T7 pPICZa EcoR I Zeocin GSllS n o n e AOXl CM BP=Ct erminal maltose bi n di n g protein; C-PH=C-ter m inal p oly h ist i dine ; NU=not used; N-PH=N-termi n al polyhistidi n e ; AOX l = A lcohol Oxidase 1

PAGE 88

67 Cl, pH 8 0 10 rnM MgC1 2 100 mM NaCl, 1200 units / ml Nde I and Sal I endonuclease in a final volume of 0 05 ml for 2h at 37 C The excised DNA was gel purified and portions (1 / 10 of the total product recovered from the gel) ligated into pCW, pET28a and pET21c vectors that had been digested and gel purified in the same manner EcoR I endonuclease reactions were as follows : 1 g of plasmid DNA containing either the ~ O or ~ 1 construct was incubated in 90 mM Tr i s-Cl, pH 7.5 50 rnM NaCl, 10 rnM MgC1 2 1200 units/ml EcoR I in a final volume of 0 05 ml for 2h at 37 C The excised DNA was gel purified and a portion (1/10 of the total product recovered from the gel) was ligated into pMAL-p2 DH5a bacterial cells were transformed with pCW and pMAL-p2 constructs, while BL21 cells were transformed with the pET vectors (table 4.4) Positive colonies were determined using PCR and either two internal primers (HT36 and MJ24 for directional inserts) or a 5' vector primer and a internal primer (M13 and MJ24 for bi-directional inserts). Yeast Expression Vector ~O was excised from pGEM-T using EcoR I endonuclease and ligated into pPICZa, a bi-directional vector, as described above. This plasmid was then transformed into JM109 competent cells Positive colonies were identified by PCR using a primer to the cytochrome P450 2Ll sequence

PAGE 89

68 (HT38) and a primer to the vector (Ph94, Table 4.3) The PCR experiments were designed to identify the correct orientation of the DNA insert for expression. Plasmid DNA (Qiagen, Chatsworth, CA) from a positive colony was isolated and a portion of the plasmid DNA used for sequencing in order to confirm the correct orientation and sequence the cDNA. Twenty micrograms of the plasmid DNA was digested overnight at 25 C in 20 mM Tris-acetate, pH 7 9, 10 mM Mg acetate, 50 mM K-acetate, 1 mM DTT, 200 units/ml Pme I (New England Bio Labs, Inc ) and sterile, deionized water to a final volume of 100 l. Constructs linearized with Pme I were used to transform GS115 cells (Pichia pastoris) by electroporation (Gene Pulser, BioRad, Hercules, CA). Transformed cells were grown on 2% (w/v) agar plates containing 1.0 M sorbitol, 1.0% (w/v) dextrose, 1.34% (w/v) yeast nitrogen base lacking amino acids, 4 x 10 5 % (w/v) biotin, 0 005% (w/v) amino acid mixture (50 mg each glutamic acid, methionine, leucine, lysine, and isoleucine per liter DI water), 0.004% (w/v) Colonies were randomly picked and grown in 3 mls of a solution (MGYH) containing 1.34% (w/v) yeast nitrogen base, 1.0% (v/v) glycerol, 4 x 10 5 % (w/v) biotin, 0.004% (w/v) histidine. An aliquot of the broth containing the colonies (5 l) was removed and subjected to PCR analysis (in order to determine what colonies underwent successful integration of the cytochrome P450 2Ll construct), using an internal

PAGE 90

primer (HT38) to cytochrome P450 2Ll and a vector primer (Ph94) Expression of Cytochrome P450 2Ll in Bacteria 6 9 Positive colonies containing the cytochrome P450 2Ll constructs ~ O or ~1 were grown overnight at 37 C in 1 ml of LB (Luria-Bertani broth) containing either 1 g ampicillin / ml LB (pCW and pMAL-p2 transformants,) or 1 g kanamycin / ml LB (pET transformants, see table 4.4 for antibiotic requirements of the various expression vectors). In all cases the overnight culture was diluted 1:100 in 100 ml LB culture with the appropriate antibiotic, and the bacteria grown to a cell density of OD 600 between 0 70 to 0 80 isopropyl thio~ -D-galactoside (IPTG) was added to the culture to a final concentration of 0 .4 mM The cultures were grown an additional 3 hrs and harvested by centrifugation (5,000 x g for 5 min, 4 C). Cell pellets were resuspended in 10 mls of buffer A (10 mM potassium phosphate, pH 7 5, 0.15 M NaCl) Cell pellets were subjected to 20 second sonication bursts while on ice until no viscosity was evident in the solution (typically 3 to 4 bursts were required) The ruptured cells were centrifuged at 12,000 x g for 15 min at 4 C The pellet, consisting of insoluble material or "inclusion bodies", was resuspended in 10 mls of buffer A. The supernatant, consisting of soluble proteins and cell

PAGE 91

70 membrane, was centrifuged at 180,000 x g for 65 min at 4 C The pellet from this spin was solubilized in 0 5% cholic acid for 1 hr and the mixture centrifuged at 180,000 x g for 65 min at 4 C In addition, the inclusion body fraction was solubalized in 0.5% cholic acid, and centrifuged at 12,000 x g for 15 min at 4 C. Cytochrome P450 2Ll expressed from the pET28a vector was purified using metal chelation chromatography A His Bind (Novagen) column was poured and inclusion bodies solubilized in 6 M urea were passed over the column The pure protein was eluted in 1 0 M imidazole Expression of Cytochrome P450 2Ll in Yeast A positive colony was grown in 200 mls of MGYH. After 2 days at 30 C, cells were pelleted (1,500 x g for 10 min) and brought up in 200 mls of a solution containing 1.34% (w/v) yeast nitrogen base, 1 x 10 5 % (w/v) biotin, 0 5% (v/v) methanol, 0 005% (w/v) histidine Two days later (at 30 C), the cells were pelleted and resuspended in 10 mls of buffer containing .15 M KCl, 0 05 M potassium phosphate, pH 7 4, 0 1 mM EDTA, 0.2 mM PMSF. Microsomal fractions were prepared as described previously (James, 1990) with the following modifications : after the cells were lysed in a French press, the ruptured cell solution was centrifuged at 30,000 x g to fractionate the nuclear DNA and mitochondria. The supernatant was centrifuged at 100,000 x g for 45 min at 4 C

PAGE 92

7 1 and the microsomal pellet was resuspended in 0.25 M sucrose, 0 05 M Kpi, pH 7 .4, to a final concentration of about 12 mg microsomal protein/ml buffer. Testosterone and Progesterone Assays Steroid metabolism studies (n=l) in both intact cells and microsomal fractions was done following the procedures of James and Shiverick (1984). Whole cells (~9.3 x 10 9 where OD 600 = 5.0 x 10 7 cells/ml) or microsomes (.12 mg or 096 nmol/ml) were placed into a tube containing the following: 53 M [ 14 C] -testostero ne (specific activity 57 ci/mol, Amersham, Arlington Heights) or 43 M [ 14 C ]-progesterone (specific activity 56 ci/mol), 0.05M KPi, pH 7.4, 5 mM MgC1 2 and DI water to a final volume of 25 mls. Reactions were initiated with the addition of NADPH (2 mM, Sigma Chemical Co ) and incuba ted at 30 C for 20 min. Ethyl acetate (3 X 1 5 mls) was used to terminate and extract the reaction products The ethyl acetate fractions were evaporated under N 2 and the residues brought up in 100 l for TLC analysis. Linear K silica (LK5DF) gel TLC plates (Whatman Int., Maidstone, England) were predeveloped in 100% MeOH to remove impurities and allowed to dry Reaction product (50 l) were spotted and the plates developed three times in the following system : 70:38:0.8:1.0 diethyl ether: toluene: MeOH : acetone. The plates were allowed to dry and were

PAGE 93

subjected to autoradiography. Steroid standards purchased from Sigma Chemical CO. (St Louis, MO) and Steraloids (Wilton, NH) were used. Immunoquantitation of cytochrome P450 in Yeast M i crosomes 72 Microsomal protein, 1 and 5 g, was subjected to SDS PAGE. The gel was electroblotted onto PVDF membrane as described previously (James et al, 1996). A primary antibody (10 g serum/ml tris-buffered saline, 0 05% (v/v) tween-20; a 1:500 dilution) to a major form of cytochrome P450 from the spiny lobster hepatopancreas (Boyle and James, 1996) was used to detect cytochrome P450 2Ll in yeast microsomes This antibody was incubated overnight at 4 C with wild type microsomes (1 g antibody to 4 g microsomes) and centrifuged the next day for 10 minutes at 14,000 x g. The supernatant was used in the Western blot. The secondary antibody was a goat-anti-rabbit antibody (1 : 3000 dilution)conjugated to alkaline phosphatase (BioRad) Desitometric analysis of the Western blot and of the TLC autoradiographs was done using an electrophoretic image band analysis system (Bioimage)

PAGE 94

7 3 Results Bacterial and Fungal fractions SDS-PAGE of bacterial whole cell lysates show an inducible protein product with an apparent molecular mass of approximately 50 kDa (figure 4.2) When western blot analysis of whole cell lysates is done, an immunoreactive band is seen in the 50 kDa region (figure 4.3). Solubilization of the bacterial membranes with cholic acid produces a protein with an apparent molecular mass approximately 58.5 kDa (figure 4.2). In addition, solubilization of the inclusion bodies also liberates a protein of an apparent molecular mass approximately 58.5 kDa (figure 4.2). Metal chelation chromatography with inclusion bodies solubalized in 6 M urea produces the same results, that is, a single band at an apparent molecular mass of 58 5 kDa (figure 4.4). An estimate of the amount of cytochrome P450 present in the yeast microsomes was obtained using a polyclonal antibody to spiny lobster cytochrome P450 2L (Figure 4.5). We estimate that the transformed yeast produce between 0 02 and 0 05 pmole of cytochrome P450 2Ll/g yeast microsomal protein.

PAGE 95

kDa 66.2----45.0~Q~~ ~~~~ 4 5 74 6 Figure 4 2 SDS-PAGE of induced bacterial cells (BL21) expressing cytochrome P450 2Ll from the expression vector pET28a Lane 1, 500 l of bacterial cells in SDS-PAGE running buffer ; 2, 12,000 x g pellet of the culture; 3, 12,000 x g pellet solubalized in 0.5% cholic acid; 4, 12,000 x g supernatant from the lane 3 treatment; 5, 12,000 x g pellet from lane 3 treatment; 6, 180,000 x g supernatant from lane 2 supernatant ; 7, 180 000 x g supernatant from lane 3 treatment Arrows indicate a protein approximately 58 5 kDa

PAGE 96

kDA 66.2 50.6 ---' 45.0 75 2 3 Figure 4 3 Western blot of total cell lysate from BL21 bacterial cells expressing the pET28a construct induced with 0 4 mM IPTG Lane 1, uninduced culture; 2, culture 1 hr 30 min. post-induction with IPTG; 3, culture 3 hr. post-induction with IPTG.

PAGE 97

. Figure 4 4. SDS-PAGE of pET28a derived cytochrome P450 2Ll expressed in bacterial cells (BL21) and purified using meta l chelation chromatography. I nclusion bodies were solubalized in 6 M urea and passed over a His-bind column The image was enhanced in order to see the pure protein (arrow), with an apparent molecular mass of 58 5 kDa Lane 1, material that passed through the column while loading; 2, column wash; 3, firs t fraction following elution in a 1 0 M imidazole buffer; 4, second fraction; 5, the third fraction 76

PAGE 98

77 1 2 3 4 5 6 52.4 Kd-Fig. 4 5 Western blot of microsomes from yeast containing the cytochrome P450 2Ll insert. Proteins were subjected to SDS-PAGE and blotted onto a PVDF membrane as described in the M ethods section Densitometric analysis of the microsomes from yeast expressing cytochrome P450 2Ll indicate a cytochrome P450 concentration of about 0.02 pmol cytochrome P450/ g yeast mic r osomal protein Control microsomes w ere made from w il d type yeast. Purified cytochrome P450 was isolated from the hepatopancreas of the Florida spiny lobster as described previously (James, 1990) Lane 1, wild type yeast microsomes, 5 g; 2, microsomes from yeast expressing cytochrome P450 2Ll, 5 g; 3, microsomes from yeast expressing cytochrome P450 2Ll, 1 g; 4, purified cytochrome P450, 0.35 pmol; 5, purified cytochrome P450, 0.25 pmol; 6, purified cytochrome P450, 0 15 pmol. The expressed cytochrome P450 2Ll has an apparent molecular mass of about 50 kDa.

PAGE 99

78 Steroid Metabolism [ 14 C]-testosterone was hydroxylated in the 16a position (1 37 nmol/min/nrnol cytochrome P450 2Ll and 2.31 nmol / min / nrnol cytochrome P450 2Ll in incubations fortified with rat cytochrome P450 reductase) by microsomes from yeast express ing cytochrome P450 2Ll (Figure 4.6) Two other polar metabolites were produced in trace amounts A more nonpolar metabolite in reference to testosterone was produced in an NADPH-dependent, rat cytochrome P450 reductase-independent manner, but was not identified. Intact whole yeast cells expressing cytochrome P450 2Ll incubated with [ 14 C]-testosterone, produced 16a hydroxytestosterone, the two polar unknowns, and one nonpolar unknown. Intact whole cells did not require the addition of rat cytochrome P450 reductase nor NADPH (figure 4 7) [ 1 4 C]-progesterone produced a polar metabolite (2.93 nmol / min/nmol cytochrome P450 2Ll and 3 60 nrnol/min/nrnol cytochrome P450 2Ll in incubations fortified with rat cytochrome P450 reductase) that co-migrated with a 16a hydroxyprogesterone standard when incubated with rnicrosomes from yeast expressing cytochrome P450 2Ll (Figure 4 6). One other polar metabolite was apparent, but was produced in trace amounts and we were unable to accurately quantify it

PAGE 100

using densitometric methods. A more nonpolar metabolite in reference to progesterone was produced. 79 Intact whole cells expressing cytochrome P450 2Ll incubated with [ 1 4 C)-progesterone, produced 16a hydroxyprogesterone, the polar unknown, and a nonpolar unknown. Intact whole cells, as with the testosterone incubations, did not require the addition of rat cytochrome P450 reductase nor NADPH (figure 4.7). Intact whole yeast cells lacking the cytochrome P450 2Ll construct (wild type) and microsomes made from these same wild type yeast, were incubated with [ 1 4 C]-testosterone or [ 14 C] progesterone in separate experiments (figure 4 6 and 4. 7) Discussion Bacterial experiments Both ~O and ~1 were expressed successfully in bacteria with the various expression vectors used, with the exception of pMAL p2 In all cases, large amounts of cytochrome P450 2Ll were detected either by SDS PAGE (figure 4 2) or by irnmunobl o tting with an antib o dy to spiny lobster cytochrome P450 (figure 4 3). How e ver, no functional enzyme, as determined by cytochrom e P4 5 0 difference spectra, was o btained with any of the bateria strains or expression vectors used (data not shown).

PAGE 101

80 In addition, strains expressing the 50 kDa band also expressed a lower band of molecular mass 30 kDa. This 30 kDa band is consistently detected in all cytochrome P450 2Ll fractions, whether they are expressed in bacteria or yeast, or isolated from the spiny lobster hepatopancreas. It is possible that a second translation initiation start signal is present in the spiny lobster cytochrome P450 2Ll cDNA Figure 4.2 is a representative SDS polyacrylamide gel of bacterial contents before and after induction by IPTG. This type of expression was seen for all constructs, with higher concentrations of protein being produced with expression vectors utilizing the T7 promoter This finding was expected, as the T7 RNA polymerase will transcribe the expression vector, and no other DNA template in this system. The vectors utilizing the tac promoter will compete for the bacterial RNA polymerase, which will transcribe all DNA templates in the bacteria Western blot experiments with an antibody raised against a major form of cytochrome P450 in the hepatopancreas of the spiny lobster detected a major band of molecular mass 50 kDa, which is absent in uninduced bacteria harboring the pET28a-cytochrome P450 2Ll construct (figure 4 3 ) Cytochrome P450 2Ll expressed in bacteria can be solubilized in cholic acid, causing the apparent molecular mass of the 50 kDa protein to shift upward to approximately 58.5 kDa (figure 4 2) Cytochrome P450 2Ll cDNA, when

PAGE 102

81 translated, should produce a protein of molecular mass equal to 56.6 kDa. Proteins expressed in the pET28a system (table 4 4) however, are expressed with a poly-histidine tag at the N-terminal end of the protein, and thus the calculated molecular mass will be slightly larger than when calculated from the deduced amino acid sequence of cytochrome P450 2Ll The calculated molecular mass of the deduced cytochrome P450 2Ll cDNA is about 56 6 kDa, and the histidine tag (MGSSHHHHHHSSGLVPRGS) will add an additional 2,044 daltons of mass for a total mass of about 58 6 kDa. After solubilizing inclusion bodies from bacteria expressing the pET28a-cytochrome P450 2L1 construct in 6M urea, and subjecting the solubilized material to metal chelation chromatography, a single band was detected on SDS polyacylamide gels stained with Coomassie blue (figure 4.4). The apparent molecular mass of this band was calculated at 58.5 kDa. The discrepancy in apparent molecular mass between the impure and purified forms of expressed cytochrome P450 2Ll in bacteria, may be due to differential migrations of the cytochrome P450s in the presence of other bacterial proteins and presumably the bacterial membrane Membrane bound proteins such as cytochrome P450 are known to run aberrantly when subjected to SDS-PAGE We were unable to obtain a cytochrome P450 spectrum from bacterial whole cells regardless of the expression vector used. Using a pCW construct containing the bovine

PAGE 103

82 17a-hydroxylase cytochrome P450 (CYP17, kindly provided by Dr. Ronald Estabrook and Dr. Charles Fisher) and expressed under the same conditions as the cytochrome P450 2Ll construct, we obtained cytochrome P450 spectra of about 3 4 pmol cytochrome P450 17/ml of bacterial cells (density was not determined) Thus the method of expressing cytochrome P450 in bacteria under these conditions was validated. Yeast Experiments We were unable to obtain spectral data of the expressed cytochrome P450 2Ll protein. However, using an antibody raised against a major cytochrome P450 fraction from the spiny lobster and pre-incubated with wild type yeast microsomes, we were able to detect a single immunoreactive band in yeast microsomes expressing cytochrome P450 2Ll that was absent in wild type yeast (figure 4.5). We estimate that the content of cytochrome P450 2Ll per g of yeast microsomal protein to be in the range of 0.02 to 0 05 pmoles. Microsomal fractions were made using a modified procedure from that of James (1990). The initial centrifugation at 30,000 x g may have pelleted some of the microsomal fraction We have detected 16a-hydroxylation of testosterone in the 30,000 x g pellet (data not shown). In addition, the 100,000 x g centrifugation may have not been long enough at 45 minutes. It is possible that not all of

PAGE 104

the microsomal fraction was pelleted during this spin. Testosterone 16a-hydroxylase activity was also detected in the 100,000 x g supernatant (data not shown). Therefore, expression levels may actually have been higher than detected. 83 Microsomes from yeast cells expressing cytochrome P450 2Ll were incubated with [ 14 C]-testosterone (figure 4.6). Autoradiographic data from TLC separated metabolites show a co-migrating polar compound with the 16a hydroxytestosterone standard. The production of this metabolite appears to be NADPH-dependent. Based on densitometric analysis of the 16a product, we estimate that the maximum amount produced under these assay conditions was 2.31 nmol/min/nmol of cytochrome P450 2Ll. James and Shiverick (1984) demonstrated that 16a (8.65.'81 nmol/min/nmol Dl cytochrome P450 and 4.1 nmol/min/nmol D2 cytochrome P450) and 6P-hydroxylation of [ 14 C]-testosterone were catalyzed by two distinct forms of purified cytochrome P450 isolated from the spiny lobster hepatopancreas (table 4 2). We obtained slightly lower turnover numbers for 16a-hydroxylation of testosterone, and detected only trace amounts of the 6P-hydroxylated steroid. Two other polar compounds also detected in microsomes incubated with testosterone, but their identities remain unknown. One of the unknown compounds may be 6P hydroxytestosterone, a metabolite shown to be produced when

PAGE 105

84 1 2 3 4 5 6 1 8 . '. . ,. > ,,. .. .. .. ,. ' > -, ~Figure 4 6. TLC separation of progesterone and testosterone metabolites produced by expressed cytochrome P450 2Ll. Lane 1, testosterone incubated in control yeast microsomes in the presence of NADPH and rat cytochrome P450 reductase; 2, Progesterone incubated in control yeast microsomes in the presence of NADPH and rat cytochrome P450 reductase; 3, products of the incubation of microsomes made from P. pastoris expressing cytochrome P450 2Ll with [ 14 C]-testosterone in the presence of NADPH and rat cytochrome P450 reductase; 4, as for lane 3, but with no added reductase; 5, as for lane 3, but with no added NADPH or reductase; 6, products of the incubation of microsomes made from P. pastoris expressing cytochrome P450 2Ll with [ 14 C]-progesterone in the presence of NADPH and rat cytochrome P450 reductase; 7, as for lane 6, but with no added reductase; 8, as for lane 6, but with no added NADPH or reductase The arrow indicates the position of 16a-hydroxy metabolites.

PAGE 106

testosterone is incubated with the Dl fraction (James and Shiverick, 1984) 8 5 In addition, a nonpolar metabolite was also detected that migrated above testosterone in the TLC system. We believe that this metabolite is androstenedione Androstenedione i s a more nonpolar compound than is testosterone and is interconverted to testosterone This metabolite was also detected in control incubations, and was found in higher concentrations in microsomes fortified with NADPH and rat cytochrome P450 reductase. Incubation of [ 1 4 C]-testosterone with intact, whole yeast cells expressing cytochrome P450 2Ll, produced the same metabolic profile as seen with the microsome incubations (figure 4 7). When testosterone was incubated with microsomes from yeast containing the cytochrome P450 2Ll construct and TLC plates were exposed to film for one month, products co migrating near the 6p-hydroxytestosterone standard were detected, but the signals were very weak (figure 4.6). The Dl fraction hydroxylates the 16a and 6 P position of testosterone at about the same rate (Table 4.2). Cytochrome P4 5 0 2Ll expressed in yeast, however, clearly shows a preference for 16a-hydroxylation of testosterone NADPH-dependent 16a-hydroxylation of progesterone ( 3 60 nm o l / min/nmole cytochrome P450 2Ll) was evident in m icrosomes, thus indicating a cytochrome P450-dependent pathway (figure 4 6) One other polar metabolite of

PAGE 107

86 progesterone was detected on the TLC plate following autoradiography but was not identified This metabolite migrates near the 21-hydroxyprogesterone standard, and thus may be the 21-hydroxylated metabolite of progesterone A compound more nonpolar than progesterone was detected, but was not identified. Cytochrome P450 2Ll expressed in Pichia pastoris hydroxylates testosterone and progesterone predominately in the 16a position The D1 fraction has about 1/50 the hydroxylation activity for progesterone at the 6P position relative to the 16a position (Table 4.2). Experiments using more microsomal protein from yeast containing the cytochrome P450 2Ll construct are required to detect the 6P product of progesterone Exogenously added reductase was not required in either the whole cell and microsomal testosterone or progesterone incubations (figure 4.6). Trant also noted that added reductase was not required in viable Pichia pastoris cells (Trant, 1996) When either testosterone or progesterone incubations were fortified with rat cytochrome P450 reductase, turnover numbers increased (from 1.37 to 2 31 for testosterone and 2.93 to 3.60 for progesterone). This increase in turnover number after the addition of exogenous cytochrome P450 reductase would imply that the yeast cytochrome P450 reductase is limiting in these incuba tions. Incubations were also done with wild type yeast lacking the cytochrome P450 2Ll construct. Wildtype intact yeast

PAGE 108

87 1 2 3 4 6 j Figure 4.7. TLC separation of progesterone and testosterone metabolites produced by expressed cytochrome P450 2Ll. Lane 1, testosterone incubated in control yeast whole cells in the presence of NADPH and rat cytochrome P450 reductase; 2, Progesterone incubated in control yeast whole cells in the presence of NADPH and rat cytochrome P450 r eductase; 3, products of the incubation of whole cell P pastoris expressing cytochrome P450 2Ll with [ 14 C)-testosterone in the presence of NADPH and rat cytochrome P450 reductase; 4, as for lane 3, but with no added NADPH or reductase; 5, products of the incubation of whole cell P. pastoris expressing cytochrome P450 2Ll with [ 14 CJ-progesterone in the presence of NADPH and rat cytochrome P450 reductase ; 6, as for lane 5, but w ith no added NADPH or reductase. The arrow indicates the position of 16a hydroxy metabolites.

PAGE 109

cells and wild type yeast microsomes failed to produce any 16a steroid metabolites when incubated with either [ 14 C] testosterone or [ 14 C]-progesterone These incubations were fortified with NADPH and rat cytochrome P450 reductase (figures 4.6 and 4 7) 88 As yet, cytochrome P450 2Ll can not be clearly associated with the Dl or D2 fractions Further experiments are required using other substrates metabo liz ed by the Dl and D2 fractions to establish which isoform, the Dl or D2, is represented by the translated product of the Cytochrome P450 2Ll construct in yeast We have recently sequenced an additional cDNA form of cytochrome P450 cloned from a cDNA library made from the spiny lobster hepatopancreas, cytochrome P450 2L2, and there is evidence for two additional sequences (unpublished data) It is possible that cytochrome P450 2L2 or one of the other 2 partial clones are represented by the Dl or D2 fractions. Heterologous expression of cytochrome P450s from the spiny lobster in Picbia pastoris will perhaps enable the correlation of catalytically active fractions from microsomes to individual isoforms cloned from the spiny lobster and expressed in the yeast.

PAGE 110

CHAPTER 5 SUMMARY OF RESULTS In the preceding chapters I have presented data regarding the cytochrome P450 monooxygenase system in the Florida spiny lobster, Panulirus argus. The spiny lobster is a unique animal system in which one might address a variety of biological questions. Panulirus is especially suited for the study of cytochrome P450 enzymes because there is a high concentration of the enzyme in the hepatopancreas, the animal's digestive organ. In addition to these high levels of P450, the spiny lobster is a species that is consumed by humans, and unlike many other animal models, data obtained from the study of this animal has the added benefit that data obtained from studies of trophic transfere may give some indication of how xenobiotics are transferred to humans that consume the spiny lobster. Finally, like all known crustacean species, the spiny lobster does not undergo the process of carcinogenesis. Studying basic mechanisms of chemical carcinogenesis in such a species may lay the groundwork for a better understanding of this phenomenon In chapter two, data were presented showing the cross reactivity of microsomes from a variety of species to a polyclonal antibody generated against the major for1n of 89

PAGE 111

9 0 polyclonal antibody generated against the major form of cytochrome P450 in the spiny lobster Although the slipper lobster was the only invertebrate demonstrating cross reactivity, failure of the others to cross-react may be due to the very low levels of cytochrome P450 in these microsomes or perhaps due to the absense of similar cytochrome P450s in these species. Crustacean species have a very wide range of cytochrome P450 concentrations The spiny lobster and the crayfish exhibit very high levels (about 1 0 nmol P450 / mg microsomal protein) to very low levels, as found in the chiton (around 0 .1 nmol P450/mg microsomal protein). In addition, seasonal variation as well as the sex of the animal and its nutritional status often effect P450 levels Most fish microsomes cross-reacted with the spiny lobster P450 antibody, in particular, the killifish microsomes These results indicate that spiny lobster cytochrome P450 may share epitopes with the fish P450s It has been proposed that the 2 family arose in response to animal-plant warfare when animals began terrestrial colonization However, with a trout CYP2K form reported (Nelson et al, 1993) and now a spiny lobster CYP2L form, perhaps the 2 family has existed longer than previously believed Or it is possible that the fish and invertebrate 2 forms represent cytochrome P450 descendants from an

PAGE 112

ancestral gene that gave rise to the current 2 family members. 91 As pointed out in chapter 3, CYP2L is most similar to rat CYPs in the 2B and 2D families. It is possible that this similarity to both families is due to CYP2L being more similar to an ancestral gene that gave rise to the 2B and 2D families Other features of the CYP2L form reveal the presence of a highly conserved heme-binding domain and several amino acids that are invariant in all known cytochrome P450 enzymes A second clone has recently been sequenced and has been assigned the name CYP2L2. CYP2Ll and CYP2L2 are about 55% identical. CYP2Ll was modified for expression in yeast. Chapter 4 presents data pertaining to expression of CYP2Ll in the methylotrophic yeast Pichia pastoris Yeast were transfected with a linearized vector containing a 5' AOX promoter preceding the CYP2Ll code and integrated into the yeast genome After induction of the P450 gene using the AOX promoter, cells were collected and microsomal fractions made. These fractions, as well as living cells, were used in incubations with radiolabeled testosterone and progesterone. Microsomal 16a-hydroxylation of both substrates was shown to be NADPH-dependent and only the 16a product was detected Living yeast did not require the addition of NADPH and only yielded the 16a products Neither microsomes nor

PAGE 113

in tact yeast required the addition of cytochrome P450 reductase, indicating the presence of endogenous reductase that was functional with the expressed spiny lobster cytochrome P450 Studies using purified testosterone gave some indication of 16 P and 6 P production 92 Other cytochrome P450s have been detected in the hepatopancreas of the spiny lobster and it would be interesting to express these different forms in yeast as well. It has been shown that the spiny lobster "Ml" fraction can metabolize a wide range of substrates What P450 forms are responsible for these reactions are not yet defined, and an expression system like Pichia offers an excellent expression system to make such determinations.

PAGE 114

REFERENCES Anundi, L Lahteenmaki, T Rundgren, M Moldeus, P and Lindros, K. 0. (1993) Zonation of acetominophen metabolism and cytochrome P450 2El-mediated toxicity studied in isolated periportal and perivenous hepatocytes Biochem Pharmacol. 45:1251-1259 Aoyama, T Yamano, S Waxman, D J Lapenson, D P . Meyer, U A Fischer, V Tyndale, R Inada, T Kalow, W Gelboin, J. V and Gonzalez, F. J (1989). Cytochrome P-450 hPCN2, a novel cytochrome P-450 IIIA gene product that is differentially expressed in adult human liver J. Biol Chem 264 : 10388-10395 Argos, P (1987) A sensitive procedure to compare amino acids sequences. J. Mol Biol. 193(2) : 385-396 Baum, R M. (1985) New variety of street drugs poses growing problem C & EN Sept 9, pp. 7-16 Black, S.D. (1992) Membrane topology of the mammalian P450 cytochrornes FASEB J. 6 : 680-685 Blanchet, M F., Ozon, R and Meusy, J J. (1972) Metabolism of steroids, in vitro, in the male crab Carcinus maenas Comp Biochem. Physiol 41B:251-261 Boyle, S. M. and James, M. 0. (199 6) Cross-reactivity of an antibody to spiny lobster P450 2L with microsornes from other species Mar Environ Res 42 : 1-6 Bradfield, J.Y., Lee, Y-H., and Keeley, L.L (1991) Cytochrome P450 family 4 in a cockroach : Molecular cloning and regulation by hypertrehalosemic hormone Proc Natl Acad. Sci. USA 88 : 4558 4562 Brodie, A M (1993) Aromatase, its inhibitors and their use in breast cancer treatment. Pharrnacol-Ther. 60(3) : 50115 Brosen, K. (1993) The pharmacogenetics of the selective serotonin reuptake inhibitors Clinical Invest 71 (12) : 1002-9 Brown, C.A and Black, S.D (1989) Membrane topology of mammalian cytochrome P-450 from liver endoplasmic reticulum J. Biol Chem. 264(8) : 4442-4449 93

PAGE 115

Buhler, R., Lindros, K. 0., Nordling, A., Johansson, I, Ingelman-Sundberg, M. (1992) Zonation of cytochrome P450 isozymes expression and induction in rat liver. Eur. J. Biochem. 204:407-412 Burns, B. G., Sangalang, G. B., Freeman, H. C., and McMenemy, M. (1984) Bioconversion of steroids by the testes of the American lobster, Homarus americanus. Gen Comp. Endocrinol. 54:422-428 94 Carr, W.E.S, Trapido-Rosenthal, H.G. and Gleeson, R A. (1990) The role of degredative enzymes in chemosencory processes. Chem. Senses 15(2) :181-190 Chirgwin, J.M., Przbyla, A. E., MacDonald, R. J. and Rutter, W. J. (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease Biochemistry 18:5294-5299 Cohen, M.B., Koener, J.F., and Feyereisen, R. (1994) Structure and chromosomal localization of CYP6Al, a cytochrome P450-encoding gene from the house fly. Gene 146:267 272 Compton, T. (1990) "Degenerate primers for DNA amplification" in PCR Protocols (Innis, M.A., Gelfand, D. H. Sninsky, J. J and Wh i te, T. J. eds ) pp. 3 945, Academic Press, San Diego, CA. Coon, M.J., Ding, X.X., Pernecky, S.J. and Vaz, A.D. (1992) Cytochrome P450: Progress and predictions. FASEB-J. 6 (2): 669-73 Dahl, A.R. and Hadley, W.M. involved in xenobiotic toxicity of inhalants. (1991) Nasal cavity enzymes metabolism: Effect on the Crit. Rev. Tox 21(5) :345 -372 Dayhoff, M. 0., Barker, W. C., and Hunt, L. T. (1983) Establishing homologies in protein sequences Methods Enzymol. 91 :5 24 545 Devereux, J Haeberli, P., and Smithies, 0. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387-395

PAGE 116

95 den Besten, P. J., Lemaire, P Livingstone, D.R., Woodin, B. R., Stegeman, J J., Herwig, H.J and Seinen, W. (1993). Time-course and dose-response of the apparent induction of the cytochrome P450 monooxygenase system of pyloric caeca microsomes of the females sea star Asterias rubens L. by benzo[a]pyrene and polychlorinated biphenyls Aquatic Toxicol 26:23-40 Denhardt, D.T. (1966) A membrane-filter technique for detection of complementary DNA. Biochem Biophys. Res Commun 23:641-646 Escalante. B., Omata, K Sessa, W., Lee, S.G., Falck, J.R. and Schartzman, M.L. (1993) 20-hydroxyeicosatetraenoic acid is an endothelium-dependent vasoconstrictor in rabbit arteries. Eur. J. Pharmaco l 235(1) :1-7 Estabrook, R.W., Peterson, J., Barron, J and Hildebrant, A.G. {1972) The spectrophotometric measurement of turbid suspensions of cytochromes associated with drug metabolism. Methods Pharrnacol. 2:303-350 Fairs, N J., Evershed, R. P., Quinlan, P. T., and Goad, L. J. ( 1989) Detection of conjugated and unconjugated steroids in the ovary, eggs, and haemolymph of the decapod crustacean Nephrops novegicus Gen Comp. Endocrinol. 4 : 199-208 Fujii-Kuriyama, Y. (1993) "Drug-inducible P-450s" in Cytochrome P450. Omura, T., Ishimura, Y., and Fujii Kuriyama, Y. eds. VCH Publishers Inc., New York. pg 224-229 Fujii-Kuriyama, Y., Mizukami, Y Kawajiri, K., Sogawa, K., and Muramatsu, M (1982). Primary structure of a cytochrome P450: Coding nucleotide sequence of phenobarbital-inducible cytochrome P450 cDNA from rat liver Proc. Natl. Acad. Sci. USA 79:2793-2797 Gibson, G.G. and Skett, P. (1986) Introduction to Drug Metabolism, Chapman and Hall, London Gibson, R. and Barker, P L (1979) The decapod hepatopancreas. Oceanogr. Mar. Biol. Ann. Rev. 17:285346 Gonzalez, F.J. (1988) The molecular biology of cytochrome P450s. Pharrnacol. Reviews 40(4) :243-288

PAGE 117

Gonzalez, F. J. (1990) Molecular genetics of the P-450 superfamily. Pharmacol. Ther 45 : 1-38 96 Gonzalez, F J. (1992) Control of constituatively-expressed developmentally-activated rat hepatic cytochrome P450 genes Keio J Med. 42 : 68-75 Gotoh, 0. (1992) Substrate recognition sites in cytochrome P450 family 2 (CYP2) proteins inferred from comparative analysis of amino acid and coding nucleotid e sequences. J Biol. Chem 267:83-90 Gotoh, 0. (1993) ''P450 genes and their expression" in Cytochrome P450 Omura, T Ishimura Y and Fujii Kuriyama, Y eds VCH Publishers Inc., New York. pg 207-223 Gubler, U and Hoffman, B. J (1983) A simple and very effic ient method for generating cDNA libraries Gene 25 : 263-269 Guengerich, F P. and McDonald, T L. (1990) Mechanisms of cytochrome P450 catalysis. FASEB J 4:2453-2458 Guengerich, F P and Shimada T (1991) Oxidation of and carcinogenic chemicals by human cytochrome enzymes Chem. Res Tox 4(4) : 391-407 toxic P450 Hardwick, J P., Song, B-J., Huberman, E and Gonzalez, F J (1987) Isolation, complementary DNA sequence and regulation of rat hepatic lauric acid ro -hydroxylase (cytochrome P-450LAro). J Biol Chem 262 : 801-810 He, U., Luo, Z Klekotka, P.A., Burnett, V.L. and Halpert, J R (1994) Structural determinants of cytochrome P450 2B1 specificity: Evidence for five substrate recognition sites. Biochemistry 33:4419-4424 James, M O (1989) Cytochrome P450 monooxygenases crustaceans. Xenobiotica 19(10) :1063-1076 ln James, M.0. (1990) Isolation of cytochrome P450 from hepatopancreas microsomes of the spiny lobster Panulirus argus, and determination of catalytic activity with NADPH cytochrome P450 reductase from vertebrate liver. Ar ch Bioch. Biophys 282:8-17

PAGE 118

97 James, M O., Altman, A H. Li, C-L L and Boyle S.M (1992) Doseand time-dependent formation of benzo(a)pyrene metabolite DNA adducts in the spiny lobster, Panulirus argus. Marine Environ Res 34 : 299-302 James, M.O Altman, A .H ., Li, C-L. J., and Schell, J D., Jr (1995) Biotransformation, hepatopancreas DNA b i nding and pharmacokinetics of benzo[a]pyrene after oral and parenteral administration to the American lobster, Homarus americanus Chem.-Biol. Interactions 95 : 141-160 James, M O Boyle, S.M., Trapido-Rosenthal, H.G Carr, W.E.S and Shiverick, K T. (1993) Identification of a cytochrome P450 sequence in cDNA from the hepatopancreas of the Florida spiny lobster Federation of American Societies for Experimental Biology Journal 7, A1201 James, M O., Boyle, S.M Trapido-Rosenthal, Smith, W Clay, Greenberg, R M and Shiverick, K T (1996) CDNA and protein sequence of a major form of P450, CYP2L, in the hepatopancreas of the spiny lobster, Panulirus argus. Arch Biochem. Biophys 329 : 31-38 James, M O. and Kleinow, K M (1994) ''Trophic Transfer of Chemicals in the Aquatic Environment" in Aquatic Toxicology: Molecular, Biochemical and Cellular Perspectives. Malins, D C and Ostrander, G K. eds Lewis Publishers, Boca Raton, Florida. pg. 1-35 James, M.O and Little, P J. (1980) "Characterization of cytochrome P-450 dependent mixed-function oxidation in the spiny lobster, Panulirus argus." in Biochemistry, Biophysics and Regulation of Cytochrome P-450 Elsevier/North-Holland Biomedica l Press. James, M.O and Little, P.J (1984) Lack of effect of 3methylcholanthrene on in vivo disposition and in vitro metabolism of benzo(a)pyrene in the spiny lobster, Panulirus argus Comp Biochem Physiol. 78C : 241-245 James, M.O., Schell,J.D Boyle, S M., Altman, A H and Cromer, E.A (1991) Southern flounder hepatic and intestinal metabolism and DNA binding of benzo(a)pyrene (BaP) metabolites following dietary administration of low doses of BaP, BaP-7,8-dihydrodiol or a BaP metabolite mixture. Chem.-Biol. Interactions 79 : 305-321

PAGE 119

9 8 o f in James, M.O., Sc h ell, J D and Magee, V (1989) Bioavailabilty, biotransformation and elimination be n zo(a)pyrene and benzo(a)pyrene7 ,8-dihydrodiol the lobster Homarus amercanus Bull M D B L pp 121 1 19James, M. o., and Shiverick, K T (1984) Cytochrome P-450 dependent oxidation of progesterone, testosterone and ecdysone in the spiny lobster, Panulirus argus Arch. Biochem Biophys. 233:1-9 Kalb, V F and Loper, J C. (1988) Proteins from eight eukaryotic P450 families share a segmented region of sequence similarity Proc Natl. Acad Sci. USA 85:7221-7225 Kawajiri, K. Wantanabe, J ., Gotoh, 0 T agashira, Y Sogawa K and Fujii-Kur i yama Y (1986) Structure and drug inducibility of the human cytochrome P-450c gene Eur J Biochem 159 : 219-225 Kimura, H., Sogawa, K., Sakai, Y. and Fujii-Kuriyama, Y (1989) Alternative splicing mechanism in a cytochrome P-450 (P-450PB-1) gene generates the two mRNAs coding for proteins of different functions. J. Biol Chem 264 ( 4) : 2238-2242 Koymans L Donne-OP Den Kelder, G M Te Kopele, J M a n d Vermeulen, N P E (1993) Generalized cytochrome P450mediated oxidation and oxygenation r eactions in aromatic substrates with activate d N-H 0-H, C-H o r S-H substituents. Xenobiotica 23(6) : 633-648 Kyte, J and Doolittle, R F (1982) A sim p le method for displaying the hydropathic character of a protei n J Mol. Biol 157:105-132 Labbe, D., Jean, A. and Anderson, A. (1988) A constitutive member of the rat cytochrome P 4 50IIB subfamily: Full length coding sequence of the P450IIB3 cDNA DNA 7:253 260 LaChaise, F and Lafont, R (1984) Ecdysteroid metabolism in a crab, Carcinus maenas L. Steroids 43(3) :243-259 L acroix, D., Desrochers, M Lambert, M and Anderson, A. (1990) Alternative splicing of mRNA encoding rat liver cytochrome P450e (P450IIB2). Gene 86 : 20 1207

PAGE 120

Laernmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head o f bacteriophage T4 Nature 227 : 680-689 99 Lewis, D. F. V. (1995) Three-dimensio nal models of human and other mammalian microsomal P450s constructed from a alignment with P450102 (P450 bm 3 ). X enobiotica 25 :3 33-366 Li, C-L and James, M.O. (1993) Glucose and sulfate conjugations of phenol, P -napt hol and 3hydroxybenzo(a)pyrene by the American lobster (Homarus americanus) Aqat. Tox 26:57-72 Little, P.J James, M.O., Pritchard, J.B. and Bend, J R. (1985) Temperature dependent disposition of 14c benzo(a)pyrene in th e spiny lobster, Panulirus argus Toxicol Appl Pharma col 77:325-333 Livingstone, D R ., Kirchin, M A and Wiseman, A (1989) Cytochrome P450 and oxidative metabolism in molluscs. Xenobiotica 19 : 1041 1062 Lohmann, K.J. Pentcheff, N.D., Nevitt G .A. Stetten, G D, Zimmer-Faust R.K., Jarrard, H.E. an d Boles, L.C. (1995) Magnetic orientation of spiny lobsters in the ocean : Experiments with undersea co i l systems. J. Exp. Biol 198 : 2041-2048 Lowry, 0 .H., Rosenbrough, N.J., Farr, A.L., and Randall, R (1951) Protein measurement with the folin reagent J. Biol. Chem. 193:265-275 Ma, Y.H., Gebremedhin D., Schwartzman, M.L., Falck, J R., Clark, J E Masters, B.S., Harder, D.R. and Roman R J (1993) 20-hydroxyeicosatetraeno i c acid is an endogenous vasoconstrictor of can in e renal arcuate arteries. Circ -Res. 72(1) : 126-136 Matsunaga, E., Ueno, M., and Gonzalez, F J (1990) The rat P450 IID subfamily: Complete sequences of four closely linked genes and evidence that gene conversions maintained sequence homogeneity at the heme -b inding region of the cytochrome P450 active site. J. M ol Evol 30 :155-169

PAGE 121

McMaster, G.K. and Carmichael G.G. (1977} Analysis of single and double stranded nucleic acids on polyacrylamide and agarose gels by using glyoxal and acridine orange. Proc. Natl. Acad Sci. USA 74:48354838 100 Miles, J.S., McLaren, A W and Wolf, C R (1989) Alternative spicing in the human cytochrome P450IIB6 gene generates a high level of aberrant messages. Nucleic Acids Res. 17(20} :8241-8254 Mix, M C. (1986) Cancerous diseases in aquatic animals and their association with environmental pollutants: a critical review Mar. Environ Res. 20 : 1-141 Mizukami, Y., Sogawa, K., Suwa, Y., Muramatsu, M., and Fujii-Kuriyama, Y. (1983) Gene structure of a phenobarbital-inducible cytochrome P-450 in rat liver. Proc. Natl. Acad. Sci. USA 80:3958-3962 Nebert, D.W and Gonzalez, F J (1987) P450 genes: Structure, evolution and regulation. Annu. Rev Biochem. 56 : 945-993 Nerbert, D.W., Nelson, D R., and Feyereisin, R (1989) Evolution of cytochrome P450 genes Xenobiotica 19:1149-1160 Nei, M. (1987) Molecular Evolutionary Genetics Columbia University Press Nelson, D.R. and Strobel, J.W. cytochrome P450 proteins (1987) Evolution of Mol. Biol Evol. 4 : 522-593 Nelson, D R., Kamataki, T ., Waxman, D J Guengerich, F.P Estabrook, R.W Feyereisen, R., Gonzalez, F.J Coon, M J., Gunsalus I C., Gotoh, 0., Okuda K. and Nebert, D W. (1993) The P450 Superfamily : update on new sequences, gene mapping, accession numbers, early trivial names of enzymes, and nomenclature DNA and Cell Biol 12:1-51 Nhamburo, P.T., Kimura, S McBride, W., Kozak, C A Gelboin, H.V. and Gonzalez, F J (1990) The human CYP2F gene subfamily: Identification of a cDNA encoding a new cytochrome P450, cDNA-directed expression and chromosome mapping Biochemistry 29:5491-5499

PAGE 122

101 Oinonen, T., Mode, A Lobie, P. E. and Lindros, K. 0. (1996) Zonation of cytochrome P450 enzymes expression in rat liver: Isozyme-specific regulation by pituitary dependent hormones. Biochem Pharmacol. 51:1379-1387 Oinonem, T., Saarikoski, S., Husgafvel-Pursianen, K., Hirvonen, A and Lindros, K O. (1994). Pretranslational induction of cytochrome P4501A enzymes by beta-napthaflavone and 3-methylcholanthrene occurs in different liver zones. Biochem Pharrctacol 48: 21892197 Okayama, H and Berg, full-length cDNA. P. (1982) High-efficiency cloning of Mol Cell Biol 2 : 161-170 Omura, T. (1993) "Introduction: History of Cytochrome in Cytochrome P450 Omura, T Ishimura, Y., and Kuriyama, Y eds VCH Publishers Inc., New York 15 P-450" . FUJ 1-lpg. 1Omura, T. and Sato, R. liver microsomes. (1964) The carbon monoxide pigment of J Biol Chem. 239:2379-2385 Ortiz de Montellano, P.R. Structure, Mechanism, New York. (ed ) (1986) Cytochrome P450: and Biochemistry. Plenum Press, Pearson, W R and Lipmann, D. J. (1988). Improved tools for biological sequence comparison. Proc Natl. Acad Sci. USA 85:2444-2448 Pereira, B Wu, K K and Wang, L H. (1994) Molecular cloning and characterization of bovine prostacyclin synthase. Biochem Biophys Res. Commun. 203:59-66 Phillips, I. R., Shephard, E. A Ashworth, A., and Rabin, B R. (1983) Cloning and sequence analysis of a rat liver cDNA coding for a phenobarbital-inducible microheterogeneous cytochrome P450 variant: regulation of its messenger level by xenobiotics Gene 26 : 41-52 Ruckpaul, K. and Rein, H (eds.) (1984) Cytochrome P450 : Structure and Functional Relationships Biochemical and Physiochemical Aspects of Mixed Function Oxidases Akademie, Berlin Saitoh, T., Xia, Y., Chen, X., Masliah, E Galasko, D., Shults, C., Thal, L. J., Hansen, L.A., and Katzman, R. (1995) The CYP2D6B mutant allele is overrepresented in

PAGE 123

the Lewy body variant of Alzheimer s disease Ann. Neurol 37 : 1 1 0-112 1 0 2 Sanghera, M K Simpson E. R McPhau l M J Kozlowski, G. Conley, A J and Lephart, E D (1991} Immunocytochemical distribution of Aromatase cytochrome P450 in the rat brain using peptide-generated polyclonal antibodies. Endocrinology 129 : 2834-2844 Schell, J.D. and James, M 0 (1989) Glucose and sulfate conjugation of phenolic compounds by the spiny lobster (Panulirus argus) J Biochem Tox 4(2} :133-138 Schlenk, D and Buhler, D R. (1989). Determination of multiple forms of cytochrome P-450 from the digestive gland of Cryptochiton stelleri Biochem Biophys Res Commun 163 : 476-480 Schwartzman, M L Davis, K L ., Nishimura M ., Abraham, N G and Murphy, R.C (1990) The cytochrome P450 metabolic pathway of arachadonic acid in the cornea Adv Prostaglandin, Thromboxane and Leukotriene Res. 21 : 185192 Smith, G C M Tew, D.G. and Wolf, C F. (1994) Dissection of NADPH-cytochrome P450 oxidoreductase into distinct functional domains. Proc. Natl Acad Sci USA 91 : 87108714 Stegeman, J.J and Hahn, M E (1994) "Biochemistry and Molecular Biology of Monooxygenases: Current Perspectives on Forms, Functions and Reg u lation of Cytochrome P450 in Aquatic Species# in Aquatic Toxicology : Molecular, Biochemical and Cellular Perspectives. Malins, D.C and Ostrander, G K., eds Lewis Publishers, Boca Raton, Florida pg 87-206 Stoltz, R A Conners, M.S., Dunn, M.W and Schwartzman, M.L. (1994) Effect of metabolic inhibitors on arachidonic acid metabolism in the corneal epithelium : evidence for cytochrome P450-mediated reactions. J. Ocul Pharmacol. 10(1) : 307-317 Takahashi, Y Itami, T. and Kondo, M (1995} Immunodefense systems of crustacea. Fish Pathol 30:141-150 Takemori, S., Yamasaki, T and Ikushiro, S-I (1993) ''Cytochrome P-450-linked electron transport system monooxygenase reaction" in Cytochrome P 450 Omura in T

PAGE 124

Ishimura, Y., and Fujii-Kuriyama, Y. eds. VCH Publishers Inc New York. pg. 44-63 103 Tcholakian, R K and Eik-Nes, K. B (1971) Steroidogenesis in the blue crab, Callinectes sapidus Rathbun [Rathburn]. Gen. Comp. Endocrinol 17:115-124 Teshima, S., and Kanazawa, A (1971) Bioconversion of progesterone by the ovaries of crab, Portunus trituberulatus. Gen Comp Endocrinol 17:152-157 Tilly, J.L., Kowalski, K.I., Schomberg, D.W and Hsueh, A.J (1992) Apoptosis in atretic ovarian follicles is associated with selective decrease in messenger ribonucleic acid transcripts for gonadotropin receptors and cytochrome P450 Aromatase. Endocrinology 131 : 1670-1676 Toda, K., Simpson, E R Mendelson, C.R., Shizuta, Y. and Kilgore, M.W. (1994} Expression of the gene encoding Aromatase cytochrome P450 (CYP19} in fetal tissues. Mol. Endocrinol 8:210-217 ---------Towbin, H., Staehelin, T., and Gordon, J (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitro-cellulose sheets: Procedure and some applications Proc. Natl Acad. Sci. USA 76:4350-4354 Trant, J.M (1996) Functional expression of recombinant spiny dogfish shark (Squalus acanthias) cytochrome P450cl 7 (17a-hydroxylase/C 17 2 0 -lyase} in yeast (Pichia pastoris}. Arch Biochem. Biophys. 326 : 8-14 Ueno, T., and Gonzalez, F. J. (1990) Complete sequence of rat CYP2A3 gene specifically transcribed in lung. Nucleic Acids Res. 18 : 4623-4624

PAGE 125

104 von Moltke, L L Greenblatt, D J., Cotreau-Bibbo, M.M., Duan, S X., Harmatz, J S. and Shrader R I. (1994) Inhibition of desipramine hydroxylation in vitro by serotonin-reuptake-inhibitor antidepressants and by quinidine and ketoconazole: a model system to predict drug interaction in vivo. J-Pharmacol-Exp-Ther 268 (3): 1278-1283 Warner, M and Gustafsson, J.A. (1994) Effect of ethanol on cytochrome P450 in the rat brain Proc. Natl Acad Sci. USA 91:1019-1023 Williams, R.T. (1959) Detoxification Mechanisms, Chapman and Hall, London Worden, M.K Kravitz E A and Goy, M.F ( 1 995) Peptide l, an N-terminally extended analog of FMRFamide, enhances contractile activity in multiple target tissues in lobster J Exp Biol 198 : 97-108 Yamano,S Nhamburo, P T Aoyama, T Myer, U A Inaba, T Kalow, W Gelboin, H.V McBride, O W. and Gonzalez, F.J. (1989) cDNA cloning and sequence and cDNA-directed expression of human P450IIB1 : Identification of a normal and two variant cDNAs derived from the CYP2B locus on chromosome 19 and differential expression of the IIB mRNAs in human liver Biochemistry 28:7340-7348 Yasukochi, Y and Masters, B S S (1976) Some properties of a detergent-solubilized NADPH-cytochrome c (cytochrome P-450) reductase purified by biospecific affinity chromatography J Biol Chem. 251(17) :5337-5344 Young, N. J., Quinlan, P T and Goad, L J (1992) Progesterone metabolism in vitro in the decapod crustacean, Penaeus monodon. Gen Comp Endocrin. 87:300-311

PAGE 126

BIOGRAPHICAL SKETCH Sean Michael Boyle was born on the day of January 6, 1966. His father, John Jude Boyle, was just out of medical school and his mother, Donna Deloris Boyle, had been working in the mental ward of a hospital. He has two older sisters, Melissa Renee and Michelle Davina. Both are married and have one child each, meaning that Sean is in fact an uncle to his nephew Ethan and his niece Emily. He has one younger bother, Christopher David. Sean also has two younger sisters, Kelly A nn and Katie Marie, brought into this world by his stepmother, also Donna Boyle. Sean was educated in a series of excellent schools in Gainesville, Florida. From the sixth grade to the eighth, he spent rather hot days obtaining a good, solid Catholic education at St. Patricks School He was taught by strict nuns. From the ninth grade to twelfth, he attended Oak Hall Private School Sean grew up in Gainesville, Florida. The author lived in Ireland for a short time, from age 9 to 12, and may end his days there. 105

PAGE 127

1 0 6 After five years of painful undergraduate course work at the University of Florida, he finally obtained a degree in zoology After working for a year or so as a technician, he entered Graduate School in Medicinal Chemistry at the University of Florida Once there, he did not find course work painful, in fact he rather enjoyed didactic exercises. After five, or so, years, he graduated with a degree in medicinal chemistry with specialization in toxicology. He n o w resides in Washington State, pursuing postdoctoral training at the University of Washington.

PAGE 128

I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy Margaret 0 James, Chair Professor of Medicinal Chemistry I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy "Ka:~ond Berg r on Graduate Research Professor of Medicinal Chemistry I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor o Philosopry ~ r \ ~ CP ~ / J / t ,r '~ i t \ -;,, William Buhi Professor of Biochemistry and Molecular Biology

PAGE 129

I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy Robert Greenberg Assistant Scientist of the Whitney Laboratory I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. cf~ Kathleen Shiverick Professor of Pharmacology and Therapeutics I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. "() ~a. {~ e?'.'.
PAGE 130

This dissertation was submitted to the Graduate Faculty of the College of Pharmacy and to the Graduate School and was accepted as partial fulfillment of the requirements for th e degree of Doctor of Philosophy. May 199 7 I Co lege \ of Dean, Graduate School

PAGE 131

UNIVERSITY OF FLORIDA 11 11111 1 I l l I I I I III I I I I ll I ll ll l l I 11 11 111111 1 11 1 111 1 3 1262 08554 6561