Citation
Targeted in vitro construction of conditional lethal vaccinia virus mutants

Material Information

Title:
Targeted in vitro construction of conditional lethal vaccinia virus mutants
Creator:
Hassett, Daniel E., 1964-
Publication Date:
Language:
English
Physical Description:
viii, 212 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
DNA ( jstor )
Enzymes ( jstor )
Genetic mutation ( jstor )
Infections ( jstor )
Messenger RNA ( jstor )
RNA ( jstor )
Telomeres ( jstor )
Vaccinia ( jstor )
Vaccinia virus ( jstor )
Viruses ( jstor )
Alanine ( mesh )
Amino Acid Sequence ( mesh )
Department of Molecular Genetics and Microbiology thesis Ph.D ( mesh )
Dissertations, Academic -- College of Medicine -- Department of Molecular Genetics and Microbiology -- UF ( mesh )
Genes, Structural, Viral ( mesh )
Molecular Sequence Data ( mesh )
Mutagenesis, Site-Directed -- methods ( mesh )
Research ( mesh )
Telomere ( mesh )
Vaccinia virus -- genetics ( mesh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 1995.
Bibliography:
Bibliography: leaves 195-211.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Daniel E. Hassett.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
028314766 ( ALEPH )
50397208 ( OCLC )
ALR0052 ( NOTIS )

Downloads

This item has the following downloads:

EWIL9RCIP_D8ET52.xml

targetedinvitroc00hass.pdf

targetedinvitroc00hass_0158.txt

targetedinvitroc00hass_0084.txt

targetedinvitroc00hass_0169.txt

targetedinvitroc00hass_0173.txt

targetedinvitroc00hass_0134.txt

targetedinvitroc00hass_0220.txt

targetedinvitroc00hass_0050.txt

targetedinvitroc00hass_0122.txt

targetedinvitroc00hass_0125.txt

targetedinvitroc00hass_0067.txt

targetedinvitroc00hass_0046.txt

targetedinvitroc00hass_0098.txt

targetedinvitroc00hass_0066.txt

targetedinvitroc00hass_0126.txt

targetedinvitroc00hass_0047.txt

targetedinvitroc00hass_0063.txt

targetedinvitroc00hass_0168.txt

targetedinvitroc00hass_0000.txt

targetedinvitroc00hass_0065.txt

targetedinvitroc00hass_0044.txt

targetedinvitroc00hass_0024.txt

targetedinvitroc00hass_0161.txt

targetedinvitroc00hass_0162.txt

targetedinvitroc00hass_0177.txt

targetedinvitroc00hass_0012.txt

targetedinvitroc00hass_0094.txt

targetedinvitroc00hass_0205.txt

targetedinvitroc00hass_0174.txt

targetedinvitroc00hass_0099.txt

targetedinvitroc00hass_0178.txt

targetedinvitroc00hass_0025.txt

targetedinvitroc00hass_0096.txt

targetedinvitroc00hass_0111.txt

targetedinvitroc00hass_0039.txt

targetedinvitroc00hass_0037.txt

targetedinvitroc00hass_0087.txt

targetedinvitroc00hass_0058.txt

AA00009025_00001_pdf.txt

targetedinvitroc00hass_0171.txt

EWIL9RCIP_D8ET52_xml.txt

targetedinvitroc00hass_0141.txt

targetedinvitroc00hass_0199.txt

targetedinvitroc00hass_0011.txt

targetedinvitroc00hass_0004.txt

targetedinvitroc00hass_0056.txt

targetedinvitroc00hass_0079.txt

targetedinvitroc00hass_0149.txt

targetedinvitroc00hass_0032.txt

targetedinvitroc00hass_0022.txt

targetedinvitroc00hass_0057.txt

targetedinvitroc00hass_0102.txt

targetedinvitroc00hass_0153.txt

targetedinvitroc00hass_0052.txt

targetedinvitroc00hass_0211.txt

targetedinvitroc00hass_0042.txt

targetedinvitroc00hass_0103.txt

targetedinvitroc00hass_0071.txt

targetedinvitroc00hass_0093.txt

targetedinvitroc00hass_0045.txt

targetedinvitroc00hass_0123.txt

targetedinvitroc00hass_0048.txt

AA00009025_00001.pdf

targetedinvitroc00hass_0214.txt

targetedinvitroc00hass_0223.txt

targetedinvitroc00hass_0156.txt

targetedinvitroc00hass_0166.txt

targetedinvitroc00hass_0215.txt

targetedinvitroc00hass_0060.txt

targetedinvitroc00hass_0146.txt

targetedinvitroc00hass_0017.txt

targetedinvitroc00hass_0193.txt

targetedinvitroc00hass_0202.txt

targetedinvitroc00hass_0097.txt

targetedinvitroc00hass_0139.txt

targetedinvitroc00hass_0130.txt

targetedinvitroc00hass_0088.txt

targetedinvitroc00hass_0110.txt

targetedinvitroc00hass_0002.txt

targetedinvitroc00hass_0072.txt

targetedinvitroc00hass_0101.txt

targetedinvitroc00hass_0157.txt

targetedinvitroc00hass_0034.txt

targetedinvitroc00hass_0206.txt

targetedinvitroc00hass_0131.txt

targetedinvitroc00hass_0028.txt

targetedinvitroc00hass_0082.txt

targetedinvitroc00hass_0023.txt

targetedinvitroc00hass_0190.txt

targetedinvitroc00hass_0188.txt

targetedinvitroc00hass_0138.txt

targetedinvitroc00hass_0170.txt

targetedinvitroc00hass_0151.txt

targetedinvitroc00hass_0181.txt

targetedinvitroc00hass_0105.txt

targetedinvitroc00hass_0077.txt

targetedinvitroc00hass_0031.txt

targetedinvitroc00hass_0152.txt

targetedinvitroc00hass_0136.txt

targetedinvitroc00hass_0216.txt

targetedinvitroc00hass_0018.txt

targetedinvitroc00hass_0140.txt

targetedinvitroc00hass_0210.txt

targetedinvitroc00hass_0148.txt

targetedinvitroc00hass_0180.txt

targetedinvitroc00hass_0005.txt

targetedinvitroc00hass_0154.txt

targetedinvitroc00hass_0128.txt

targetedinvitroc00hass_0114.txt

targetedinvitroc00hass_0040.txt

targetedinvitroc00hass_0143.txt

targetedinvitroc00hass_0159.txt

targetedinvitroc00hass_0118.txt

targetedinvitroc00hass_0016.txt

targetedinvitroc00hass_0061.txt

targetedinvitroc00hass_0035.txt

targetedinvitroc00hass_0038.txt

targetedinvitroc00hass_0029.txt

targetedinvitroc00hass_0003.txt

targetedinvitroc00hass_0129.txt

targetedinvitroc00hass_0142.txt

targetedinvitroc00hass_0064.txt

targetedinvitroc00hass_0109.txt

targetedinvitroc00hass_0127.txt

targetedinvitroc00hass_0191.txt

targetedinvitroc00hass_0090.txt

targetedinvitroc00hass_0175.txt

targetedinvitroc00hass_0209.txt

targetedinvitroc00hass_0124.txt

targetedinvitroc00hass_0010.txt

targetedinvitroc00hass_0007.txt

targetedinvitroc00hass_0089.txt

targetedinvitroc00hass_0020.txt

targetedinvitroc00hass_0078.txt

targetedinvitroc00hass_0201.txt

targetedinvitroc00hass_0217.txt

targetedinvitroc00hass_0112.txt

targetedinvitroc00hass_0107.txt

targetedinvitroc00hass_0194.txt

targetedinvitroc00hass_pdf.txt

targetedinvitroc00hass_0115.txt

targetedinvitroc00hass_0075.txt

targetedinvitroc00hass_0150.txt

targetedinvitroc00hass_0179.txt

targetedinvitroc00hass_0049.txt

targetedinvitroc00hass_0147.txt

targetedinvitroc00hass_0196.txt

targetedinvitroc00hass_0041.txt

targetedinvitroc00hass_0184.txt

targetedinvitroc00hass_0076.txt

targetedinvitroc00hass_0015.txt

targetedinvitroc00hass_0036.txt

targetedinvitroc00hass_0187.txt

targetedinvitroc00hass_0100.txt

targetedinvitroc00hass_0069.txt

targetedinvitroc00hass_0213.txt

targetedinvitroc00hass_0051.txt

targetedinvitroc00hass_0212.txt

targetedinvitroc00hass_0062.txt

targetedinvitroc00hass_0030.txt

targetedinvitroc00hass_0008.txt

targetedinvitroc00hass_0135.txt

targetedinvitroc00hass_0120.txt

targetedinvitroc00hass_0095.txt

targetedinvitroc00hass_0185.txt

targetedinvitroc00hass_0163.txt

targetedinvitroc00hass_0155.txt

targetedinvitroc00hass_0219.txt

targetedinvitroc00hass_0068.txt

targetedinvitroc00hass_0006.txt

targetedinvitroc00hass_0085.txt

targetedinvitroc00hass_0086.txt

targetedinvitroc00hass_0055.txt

targetedinvitroc00hass_0019.txt

targetedinvitroc00hass_0116.txt

targetedinvitroc00hass_0167.txt

targetedinvitroc00hass_0043.txt

targetedinvitroc00hass_0207.txt

targetedinvitroc00hass_0218.txt

targetedinvitroc00hass_0176.txt

targetedinvitroc00hass_0119.txt

targetedinvitroc00hass_0222.txt

targetedinvitroc00hass_0195.txt

targetedinvitroc00hass_0137.txt

targetedinvitroc00hass_0073.txt

targetedinvitroc00hass_0144.txt

targetedinvitroc00hass_0132.txt

targetedinvitroc00hass_0221.txt

targetedinvitroc00hass_0026.txt

targetedinvitroc00hass_0197.txt

targetedinvitroc00hass_0106.txt

targetedinvitroc00hass_0121.txt

targetedinvitroc00hass_0001.txt

targetedinvitroc00hass_0208.txt

targetedinvitroc00hass_0083.txt

targetedinvitroc00hass_0104.txt

targetedinvitroc00hass_0021.txt

targetedinvitroc00hass_0117.txt

targetedinvitroc00hass_0164.txt

targetedinvitroc00hass_0053.txt

targetedinvitroc00hass_0204.txt

targetedinvitroc00hass_0160.txt

targetedinvitroc00hass_0165.txt

targetedinvitroc00hass_0133.txt

targetedinvitroc00hass_0113.txt

targetedinvitroc00hass_0009.txt

targetedinvitroc00hass_0080.txt

targetedinvitroc00hass_0182.txt

targetedinvitroc00hass_0091.txt

targetedinvitroc00hass_0070.txt

targetedinvitroc00hass_0186.txt

targetedinvitroc00hass_0203.txt

targetedinvitroc00hass_0172.txt

targetedinvitroc00hass_0054.txt

targetedinvitroc00hass_0108.txt

targetedinvitroc00hass_0198.txt

targetedinvitroc00hass_0183.txt

targetedinvitroc00hass_0189.txt

targetedinvitroc00hass_0074.txt

targetedinvitroc00hass_0081.txt

targetedinvitroc00hass_0145.txt

targetedinvitroc00hass_0200.txt

targetedinvitroc00hass_0013.txt

targetedinvitroc00hass_0092.txt

targetedinvitroc00hass_0192.txt

targetedinvitroc00hass_0027.txt

targetedinvitroc00hass_0059.txt

targetedinvitroc00hass_0033.txt

targetedinvitroc00hass_0014.txt


Full Text














TARGETED IN VITRO CONSTRUCTION OF CONDITIONAL LETHAL
VACCINIA VIRUS MUTANTS














By
DANIEL E. HASSETT








A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE
UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE
REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1995




TARGETED IN VITRO CONSTRUCTION OF CONDITIONAL LETHAL
VACCINIA VIRUS MUTANTS
By
DANIEL E. HASSETT
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE
UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE
REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1995


This work is dedicated to my parents, Alan and Noel and Miss
Loretta.


ACKNOWLEDGMENTS
I wish to offer my sincere thanks and gratitude to Rich Condit
whose friendship, support and unending patience has made my
graduate career a very enjoyable experience.
I thank all of my labmates in the Condit and Moyer labs for
their interest in my work, suggestions and friendship. Thanks go to
Ms. Jackie Lewis for her help in cloning and sequencing some of the
DIR mutants. Special thanks go to Ms. Joyce Conners for her helpful
advice and friendship over the last five years.
I would like to thank my family for their love and support
especially my parents, they deserve much of the credit for making
me the person I am today. I would like to thank the Donald who
helped to make Florida my home. I would also like to thank Elinor
and Bruce Cuvilier who helped me at a time in my life when I was
unable to help myself, their belief in me meant more to me than
either of them will ever know. Lastly I would like to offer my
thanks to N. Loretta Sukhu for her love, patience and perseverance.
iii


TABLE OF CONTENTS
ACKNOWLEDGEMENTS i
ABSTRACT vi
CHAPTERS
1 INTRODUCTION AND BACKROUND 1
Genome and Genomic Organization 6
Viral Life Cycle 9
Viral Genetics 33
Clustered Charge to Alanine Mutagenesis 37
Transient Dominant Selection 42
Capping of mRNA and the Vaccinia mRNA Capping
Enzyme 50
2 MATERIALS AND METHODS 60
Recombinant DNA Techniques 60
Virological Techniques 72
3 TESTING CLUSTERED CHARGE TO ALANINE MUTAGENESIS
AND TRANSIENT DOMINANT SELECTION ON
THE VACCINIA VIRUS GENE G2R 87
Introduction 87
Results 90
Discussion 109


4 CONSTRUCTION AND CHARACTERIZATION OF A NOVEL
CONDITIONAL LETHAL MUTANT IN THE LARGE SUBUNIT
OF THE VACCINIA VIRUS mRNA CAPPING ENZYME 112
Introduction 112
Results 118
Discussion 167
5 SUMMARY 182
Clustered Charge to Alanine Mutagenesis 183
Transient Dominant Selection 188
Future Experiments with E793 190
LIST OF REFERENCES 195
BIOGRAPHICAL SKETCH 212
v


Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
TARGETED IN VITRO CONSTRUCTION OF CONDITIONAL
LETHAL VACCINIA VIRUS MUTANTS
By
Daniel E. Hassett
December, 1995
Chairperson: Richard C. Condit Ph.D.
Major Department: Molecular Genetics and Microbiology
The goal of this study has been to develop a general directed
genetic method for the creation of site-specific, conditionally lethal,
temperature-sensitive vaccinia virus mutants. The techniques of
clustered charge to alanine mutagenesis and transient dominant
selection were tested as a mutagenesis strategy and as a means of
targeted gene replacement, respectively. The efficiency of clustered
charge to alanine mutagenesis and transient dominant selection were
vi


initially assessed by the creation of nine novel alleles of the vaccinia
virus G2R gene because a simple drug selection can be used to select
for mutations that alter the function of G2R. Three of the G2R
mutants were conditionally lethal as measured by one step growth
experiments. These data indicate that 33% of the clustered charge to
alanine alleles were conditionally lethal in vivo. The experiments
with G2R also revealed that on average 11% of the viral progeny
isolated during the transient dominant selection contained the
clustered charge to alanine mutation.
To demonstrate the generality of the method, nine clustered
charge to alanine mutations were created in the large subunit of the
heterodimeric vaccinia virus capping enzyme, gene DIR. In addition
to catalyzing the formation of a cap 0 structure on newly synthesized
mRNA, the vaccinia capping enzyme has been shown to be an early
gene transcription termination factor and an intermediate gene
transcription initiation factor. One of the nine mutations created in
DIR was temperature-sensitive for growth as measured by one-step
growth experiments. In vivo characterization of the conditional
lethal DIR allele revealed that protein, DNA and mRNA synthesis
appear relatively normal at the nonpermissive temperature. The
Vll


mutant is, however, defective in the resolution of viral telomeres and
blocked at an early stage of viral assembly. Methyltransferase
assays on purified virions revealed that the mutant capping enzyme
protein is thermolabile for methyltransferase activity in vitro.
The results with the vaccinia virus genes G2R and DIR
demonstrate that clustered charge to alanine mutagenesis and
transient dominant selection can be used as a general directed
genetic method for the creation of conditionally lethal, temperature-
sensitive vaccinia virus mutants.
Vlll


CHAPTER 1
INTRODUCTION AND BACKGROUND
The science of modern molecular biology has relied heavily on
genetics to gain insight into the molecular mechanisms of living
systems. Many of the fundamental biochemical mechanisms used by
living systems have been initially uncovered and understood through
the genetic analysis of eukaryotic viruses. The small genome size
and quick replicative cycle of viruses have made them attractive
model systems with which to study the processes of DNA and RNA
replication, transcription, translation and post translational protein
processing. The genetic analysis of the orthopoxvirus vaccinia has
been at the forefront of many of these investigations.
Orthopoxviruses, whose prototypic member is vaccinia, are
characterized by their large (192-300 kb) double-stranded DNA
genome, cytoplasmic site of replication and packaging within their
virions of all the enzymes necessary for early gene transcription
1


2
(reviewed in 78). Medical interest in vaccinia began because of the
virus ability to provide protective immunity against variola virus,
the causative agent of smallpox. Although the global eradication of
smallpox was completed in 1979, largely due to the use of vaccinia as
a live virus vaccine, medical interest continues because of vaccinias
potential use as a recombinant live virus vaccine vector (30, 36, 42,
88). The ability to genetically manipulate vaccinia and the capability
of the virus to express foreign genes when placed under the control
of appropriate viral regulatory signals are essential aspects of
recombinant vaccinia vaccine design. Therefore successful vaccine
design requires detailed knowledge of the general biology of the
poxvirus replication cycle. The basic biology of vaccinia is also of
interest, primarily due to the cytoplasmic site of viral replication. To
replicate within the cytoplasm vaccinia must encode most if not all of
the genetic information necessary for DNA replication, transcription
and controlled gene expression (78). The cytoplasmic site of
replication, packaging of viral enzymes within the viral particle and
the ease with which the viral genome may be genetically
manipulated has made vaccinia an excellent model system with
which to study many aspects of eukaryotic biology.


3
Most of the genetic analysis of vaccinia virus has focused on
the isolation and characterization of randomly generated viral
mutants (reviewed in 15). The characterization of these mutants has
proven quite useful in deciphering the general mechanisms involved
in the control of eukaryotic gene expression, DNA replication and
mRNA processing. However, the applicability of vaccinia virus
genetics has been limited by 1) the inability to target specific viral
genes for mutagenesis and 2) the laborious screening procedures
necessary for the isolation of viral mutants.
The purpose of this dissertation is to develop a directed genetic
method for the creation of conditionally lethal temperature-sensitive
mutations in specific vaccinia virus genes. Directed genetics of
vaccinia virus involves the in vitro mutagenesis of cloned copies of
viral genes followed by recombination-mediated gene replacement,
to transfer these mutations onto the viral chromosome. Two
problems must be addressed in order to successfully apply directed
genetics to vaccinia virus: 1) the in vitro mutagenesis scheme must
produce a high proportion of conditional lethal mutants in vivo; 2)
the mutant alleles must be efficiently recombined back onto the viral
chromosome. Clustered charge to alanine mutagenesis and transient


4
dominant selection were tested as a means of making site-specific
mutations in vitro that are temperature-sensitive in vivo and as a
strategy for targeted gene replacement, respectively. The mutation
of charged amino acids (Asp, Glu, His, Lys, Arg), closely spaced within
the primary sequence of a polypeptide, to alanines has been shown
to produce a high proportion of temperature-sensitive mutants when
these mutations are assayed in vivo (25, 130). Recombination
mediated gene replacement involving the dominant selectable
marker xanthine-guanine phosphoribosyltransferase from
Escherichia coli (ecogpt) was then used to transplace the wild type
chromosomal copy of the gene of interest with a clustered charge to
alanine mutant copy (32).
Clustered charge to alanine mutagenesis and transient
dominant selection were tested by creating mutations in the vaccinia
virus genes G2R and DIR. The efficiency of the vaccinia virus
directed genetic method was initially assessed by creating mutations
in G2R, because mutations in G2R produce viruses with selectable
phenotypes (70). The ability to select rather than to screen for
viruses containing clustered charge to alanine mutations which
altered G2R function made it possible to easily determine the


5
phenotypes of individual mutations. As a result of transient
dominant selection, individual plaques are produced which contain a
heterogeneous population of wild type and mutant viruses. The
selectability of the G2R mutants also made it possible to determine
what percentage of viruses within this heterogenous population
contain the mutation of interest. The general applicability of the
directed genetic method was assessed by creating mutations in DIR,
which encodes the large subunit of the heterodimeric vaccinia mRNA
capping enzyme. The vaccinia virus mRNA capping enzyme is
encoded by genes DIR (large subunit) and D12L (small subunit) (77,
86). In addition to its role in mRNA 5 end formation, the capping
enzyme also catalyzes the termination of early gene transcription
and the initiation of intermediate gene transcription (109, 114, 126).
The multifunctional nature of the capping enzyme and the lack of
temperature-sensitive mutations in the large subunit make the
capping enzyme an excellent target for directed genetics. In
addition, the in vivo analysis of a capping enzyme mutant would
provide more information about the role the mRNA capping enzyme
plays in vivo during the viral life cycle.


6
Genome and Genomic Organization
The vaccinia virus genome (Copenhagen strain) is a double-
stranded DNA molecule of 191,636 bp in length (41, 54). The ends of
the genome terminate in incompletely base-paired hairpin loops
which serve to covalently crosslink each strand of the DNA duplex
thereby generating a single contiguous polynucleotide chain.
Nucleotide sequencing of the hairpin termini indicate that they exist
in two isomeric forms, the sequences of which are inverted and
complementary with respect to each another (4). Adjacent to each
hairpin termini are 12 kb inverted terminal repeat sequences that
contain within them numerous smaller direct repeat elements (41).
Computer assisted sequence analysis of the viral genome
suggests a coding capacity of 198 intronless genes (41). By
convention open reading frames are designated by their relative
position with respect to Hindlll restriction sites. (65, 99). Digestion
of the vaccinia virus chromosome with Hindlll produces 16
fragments ranging in size form 49 kb (A fragment) to 273 bp (P
fragment) (41) (Fig. 1).


Fig. 1. Structure of the vaccinia virus genome. The relative position of the centrally
conserved core and the nonessential left and right hand ends of the viral genome. Below is a
vaccinia Hindlll restriction map indicating the relative size and position of each Hindlll fragment.
(?) relative map positions of 20 of the temperature sensitive mutants in the Condit collection. The
Hindlll fragments which contain the vaccinia virus genes G2R and DIR are indicated by G2R and
DIR, respectively.


nonessential left end conserved core region nonessential right end
??? ft? ? fe? ?
G2R
D1R
C NMK
F
E <
D 1
G
L
J
H
D
A
B
oo


9
The vaccinia virus genome can also be functionally divided into
three regions, a central core containing genes required for replication
in tissue culture flanked on either side by two regions which contain
genes nonessential for tissue culture replication. The central core,
which extends from the HindIII E fragment through the left hand
two thirds of the HindIII A fragment contains approximately 100
genes (41). The genes within the central core are highly conserved
among other members of the orthopoxviridae and encode the
enzymatic activities necessary for the survival and reproduction of
the virus within the infected cell. In contrast the nonessential genes
encode proteins necessary for pathogenesis and spread within the
infected host organism (41).
Viral Life Cycle
The critical events in the life cycle of vaccinia virus which
include attachment and penetration of the infecting virion, early
intermediate and late gene expression, DNA replication, virion
morphogenesis and release are diagrammatically represented in Fig.
2 (reviewed in 78). Attachment to and penetration of the host cell
are poorly understood processes primarily due to a lack of any


Fig. 2. The life cycle of vaccinia virus. A generalized scheme for vaccinia replication is
shown. IMV-intracellular membranated virus, IEV-intracellular enveloped virus,
EEV-extracellular enveloped virus, VITF vaccinia-intermediate transcription factors, VLTF-
vaccinia late transcription factors, VETF-vaccinia early transcription factors.


IMV
j lateral body
EEV
membrane


1 2
definitive information about the identity of the cellular or viral
receptors involved. Following attachment and penetration, the
infecting virus reaches the cytoplasm which is the site of all
subsequent viral transcription and replication. Almost immediately
after penetration there is a partial uncoating of the virion (uncoating
I) that serves to facilitate the onset early viral transcription.
Early Transcription
The transcription of early genes is directed by an RNA
polymerase, an early transcription factor and an early gene specific
RNA polymerase associated protein packaged within the virion (79).
One-half of the viral genome is transcribed during the early phase of
the infection (78). Early genes encode proteins such as the core RNA
polymerase subunits, viral mRNA capping enzyme and polyA
polymerase as well as enzymes involved in DNA replication and
nucleic acid biosynthesis (78).
The DNA dependant RNA polymerase activity isolated from
virion particles contains at least 8 subunits and has a molecular mass
in excess of 450 kDa (78). This core RNA polymerase contains all of
the catalytic activities necessary for RNA polymerization from single


stranded DNA, but it lacks initiation specificity and the ability to
transcribe a double-stranded DNA template (reviewed in 79).
Recently two distinct populations of RNA polymerase activity
have been observed within purified virions. These polymerase
populations differ in their association with a 94 kDa protein termed
Rap94 for RJ4A polymerase associated protein of 94 kDa. Rap94 is
encoded by the H4 gene of vaccinia virus (1, 55). Rap94 confers
early promoter specificity on the core RNA polymerase. Although
essential for early gene transcription, Rap94 is not required for the
transactivation of late gene transcription in vitro (132).
Specific transcription of a double-stranded DNA template
containing an early promoter can be conferred on the core RNA
polymerase-Rap94 complex by the addition of a heterodimeric
protein referred to as vaccinia parly transcription factor (vETF)
(reviewed in 79). vETF is composed of an 82 kDa protein (the
product of the A7L gene) containing leucine zipper and zinc finger
motifs and a 70 kDa protein (the product of the D6R gene) which
contains motifs associated with helicases and ATPases (8, 40).
Purified vETF has been shown to be a sequence specific DNA binding
protein as well as a DNA dependant ATPase (9). vETF recognizes cis


1 4
acting sequences contained within early viral promoters, since point
mutations in a consensus early promoter which abrogated vETF DNA
binding abolished early transcription activity (134). VETF has also
been shown to bend DNA around the region of the transcriptional
start site (8).
The Rap 94-containing core polymerase and vETF within the
infecting virion are sufficient for the transcription of early genes
(79). These early mRNAs are terminated, capped and polyadenylated
by virally encoded enzymes also contained within the virion (79).
Early Transcription Termination
The vaccinia virus mRNA capping enzyme catalyzes the
termination of early gene transcription in response to the cis acting
sequence UUUUUNU in the nascent mRNA (114). Early transcription
termination occurs 70 to 75 nucleotides downstream of a TTTTTNT
element in the sense DNA strand (96, 135). Both mRNA capping
enzyme subunits are required for early transcription termination
activity; however, neither functional guanyltransferase nor (guanine-
7)methyltransferase active sites are necessary for termination (63).
A model for early transcription termination has been described that


calls for the capping enzyme to bind to mRNA as it is extruded from
the back of the elongating polymerase (63). Upon encountering the
UUUUUNU signal the capping enzyme catalyzes the termination of
transcription via protein-protein contacts with the elongation
complex. Consistent with this data is the observation that the large
subunit of the capping enzyme is capable of binding RNA. Although
the RNA binding of the DIR protein is nonspecific, RNA binding can
be preferentially competed with poly U, indicating that this RNA
binding domain may be involved in recognition of the UUUUUNU
sequence in vivo (64). The domain responsible for the interaction of
the capping enzyme with the early transcription elongation complex
is presently unknown.
Following termination early transcripts, which have been
capped and polyadenylated, are extruded from the viral core into the
cytoplasm (78). The accumulation of early gene products which
encode transcription factors specific for intermediate gene
transcription and the onset of viral DNA replication lead to the
second transcriptional stage of the viral life cycle the transactivation
of intermediate genes.


Intermediate Transcription
The transcription of intermediate and late vaccinia genes
occurs after the onset of DNA replication (79). The two classes of
post replicative genes can be distinguished by their relative
transcriptional activity in the presence inhibitors of DNA synthesis.
Intermediate genes are defined as those post replicative genes
capable of being expressed from plasmids transfected into infected
cells that have been treated with a DNA synthesis inhibitor (127).
Therefore all of the trans-acting factors necessary for intermediate
gene transcription are present in the infected cells prior to DNA
replication (79). Five intermediate genes have been identified to
date, three of which function as late transcription factors (56, 127).
Transcription from intermediate promoters requires the core
RNA polymerase complex, rpo 30 (gene E4L), an undefined cellular
factor or factors termed VITF-2 or vaccinia intermediate
transcription factor 2 and the vaccinia mRNA capping enzyme, (97,
98, 126). The capping enzyme forms a stable complex with the core
RNA polymerase and complex formation is required for binding of
the polymerase at the intermediate promoter (126). Therefore the


participation of vaccinia capping enzyme in intermediate
transcription initiation is at a level other than that of mRNA capping
(44). The mRNA capping enzyme domain necessary for the
transactivation of intermediate transcription is unknown.
Late Transcription
With continuing DNA synthesis and the buildup of intermediate
proteins, some of which encode late transcription factors, the last
transcriptional phase of the viral life cycle begins. Late genes encode
structural proteins of the viral particle, the early transcriptional
machinery packaged within the developing virion and enzymes
involved in morphogenesis (78).
A genetic approach has been used to identify some of the
intermediate gene products required for late gene expression.
Intermediate and late transcription is blocked in the presence of DNA
synthesis inhibitors (127). However, intermediate promoters are
utilized if they are contained on plasmids transfected into the
inhibitor treated infected cells (127). Late transcription factors,
encoded by intermediate genes, were identified by transfecting
cloned vaccinia genes into DNA synthesis inhibitor treated cells and


assaying for transcription of a late promoter containing reporter gene
construct (133). This methodology identified three intermediate
genes, AIL, A2L and G8R that function as late transcription factors
(56). The exact role each of these proteins plays in the transcription
of late genes is unknown. Recently a factor identified as P3 has been
shown to also be required for high level in vitro transcription of a
late promoter containing reporter construct. The P3 late
transcription factor activity is present in infected cells prior to the
onset of DNA replication; it is, however, not detected in uninfected
cells. It remains to be determined if P3 is a cellular factor activated
by the infection or is virally encoded (58).
Structure of Intermediate and Late Transcripts
Two distinguishing features of intermediate and late mRNA
transcripts are the presence of nontemplated polyadenylate residues
at their 5 ends and the lack of discrete 3 ends (79). The
nontemplated adenylate residues at the 5 end of capped
intermediate and late mRNAs are thought to arise via a slippage
mechanism by the RNA polymerase (79). The average length of the
polyA head is between 35 to 50 nucleotides (79). Interestingly, in


1 9
the absence of a poly A head, the translational start site of most
intermediate and late mRNAs would be coterminal with the 5 end.
Therefore the poly A head may function in a manner analogous to a 5
untranslated region, increasing the efficiency of translation initiation
by facilitating the binding of either translation initiation factors or
the 40s ribosomal subunit (79).
Transcripts derived from individual intermediate and late
genes are heterogeneous in length at their 3 ends due to a lack of
discrete sites of transcription termination. The termination of
intermediate and late transcription appears to occur randomly,
generating a population of mRNA molecules of different lengths. This
heterogeneity in size can be detected as a smear upon northern
analysis of individual intermediate or late viral mRNAs.
DNA Replication
Orthopoxvirus DNA replication occurs in areas of the cytoplasm
known as virosomes or viral factories. Because replication of
vaccinia DNA can occur in enucleated cells, it assumed that all of the
replication machinery is virally encoded (92). Many of the viral
enzymes necessary for DNA replication have been identified; these


20
include a DNA polymerase, a nicking-joining enzyme, a DNA
topoisomerase, a dUTPase, and a DNA binding protein (reviewed in
78, 123).
Several previously mentioned structural features of the
vaccinia virus genome are shown in Fig. 3. The ends of the genome
consist of incompletely base paired hairpin termini which covalently
crosslink each strand of the genome (Fig. 3,1). The DNA sequences of
the hairpin ends are inverted and complementary isomers of each
other termed flip and flop or fast and slow based upon their relative
mobilities in nondenaturing agarose gels. On either side of the viral
chromosome, adjacent to the hairpin ends are located 12 kb inverted
terminal repeats (Fig. 3,2). Within these inverted terminal repeats
are numerous small tandemly arranged direct repeat elements. The
direct repeat sequences begin about 100 base pairs from the hairpin
ends and extend inward for approximately 3 kb into the inverted
terminal repeats (Fig. 3,3) (5).
The exact mechanism of poxvirus DNA replication is unknown;
however, the available data suggests that replication occurs in a
semiconservative fashion and begins with a site-specific nick within


Fig. 3. Structural elements of the vaccinia virus genome.
1) Nucleotide sequence of the maximum base paired structure of the
vaccinia virus hairpin ends flip (S) and flop (F). Below is the
nucleotide sequences of flip arranged 5-3 and flop arranged 3-5
demonstrating the inverted complementary nature of the hairpin
isomers. Adapted from Baroudy, B.M., S. Venkatesan and B. Moss
1983. Structure and replication of vaccinia virus telomeres.
Cold.Spring.Harbor.Symp.Quant.Biol. 47 Pt 2 :p 726.
2) Vaccinia genome showing the location of the 12 kb inverted
terminal repeats. 3) A single inverted terminal repeat
demonstrating the position of the direct repeats.


22
0 10 10 ca
A-*-0-T-T-A-0-T-*-*-A-T-T-*-T-A-T.A-T-A-T-A--T-T-t-T-A-T-A-A-T-T-*-A-T-T-T-A-A-T-T-T.T-YV-r-r-r-r-1-r-r-r--C-r-C-r-J
A-T C-A-A-T-C A-T-T-T-A-A T-AJ-A-T-A-T-A-T-T A-A-A-A-T A-T T-A-A-T-t-A A-A-l T-A-A-A-A-t A-J-4-4 4-4-J-4-4-4-r-C-4<-4-S'
.. T V T V V 6 V V T-T
oo re to oo 0 40 <0 10 10
A A A 0 0 C A T A-A
T-A-G-T-T-A-li }-A-A-A-T-/A-/A-T-A-T-A-T-A- Vr-T-T-AT-/AT-T-A-A-f Vi-A A-I-T-T-1- T-4-r-r-r-r-4-rr- T-t-GTCTT
T-T-C-A-A-T-C-A-T-T-T-A-A-T-A-T-A-T-A T-A-T-T-A A-A-AT-A-T-T-A-A-T-T-A-A-A-T-T-A-A-A-A-T A r-4-4-4-4 r-4-4-4-r-( -4-C-4
00 TO 10 00 100 JV
r '0 jo jo 40 so oo jo oo so 100
S
r 100 SO SO 70 60 SO 40 30 JO 10
* A!tT4AAAtATAA7A!TAA!G7AC!AAAACT!AtAT4tTA7TAAn!A7CTAACTAAAG!t45TAAA!!4!AiA!At4AttnA1AA'>AAUtAAlTT!ACTA'
2.
CM
T"
20
12 kb inverted terminal repeats
i 1 1 1 1 1 1 r
40 60 80 100 120 1 40 160 180
Hairpin end
3.
kilobase pairs
K>
Hairpin end
aimninijimn.r
2 4
direct repeats
T
6
T
8
10


23
the inverted terminal repeat. The isolation of replicative
intermediates of rabbitpox virus and vaccinia which consist of
concatameric forms of genomic DNA arranged in a head to head or
tail to tail linear array (concatamers consisting of a left end of the
genome fused to a left end of another genome or a right end of the
genome fused to another right end) have lead to the formulation of a
model for DNA replication outlined in Fig. 4 (5, 82). In this model
DNA replication begins with a nick within the inverted terminal
repeats proximal to the hairpin termini. The nick generates a free 3
hydroxyl capable of acting as a primer for DNA synthesis. Elongation
of the free 3 end generates a replication intermediate that is slightly
longer than genome length (Fig. 4,2). The self complementarity of
opposing strands of the duplex allows the DNA strands to fold back
upon themselves forming hairpin ends (Fig. 4,3). One hairpin
contains a free 3 hydroxyl and thus can act as a primer for the
duplication of the entire genome (Figs. 4,4 and 4,5). The resulting
molecule consists of two genomes arranged such that the right end of
one genome is fused to the right end of another genome (tail to tail)
with a nick at one end (Fig. 4,5). Continuation of this process yields a
tetrameric molecule consisting of genomes arranged head to head


Fig. 4. Self-priming model for vaccinia virus DNA
replication. Sequences of the inverted terminal repeats and their
complements are indicated by uppercase and lowercase letters
respectively. F and S denote flip and flop hairpin ends. Newly
replicated DNA is represented by dashed lines. Shown is a scheme
which replication is initiated by a nick at one end of the genome.
Adapted from Baroudy, B.M., S. Venkatesan and B. Moss 1983.
Structure and replication of vaccinia virus telomeres.
Cold.Spring.Harbor.Symp.Quant.Biol. 47 Pt 2:p 725,


25
O E F
O
ITT
r*ck
1 9 d
-TTT-
F E 0^
O
v f F
' rds

f e o
O'
d A B C O E F
0 b e d
B ^
i
I i O
\_4
b cc
A or N-
.5-V^r
r /*
b'-'c
I d
FEO
d
f E 0
O1

I d
r n
F E 0

0 E F
I d "
' d

1
F
E
0 '
. 0
E
F
t

d ,
d

1
F
E
0 ^
¡B


26
and tail to tail (not shown). Support of this model includes the
isolation of just such tetrameric replication intermediates (82).
Additional support of the model has been provided by temperature
shift experiments with replication deficient mutants which during
the initial phases of DNA replication incorporate radiolabeled DNA
precursors near the ends of the genome (94).
Telomere Resolution
The vaccinia replication scheme outlined in Fig. 4 leads to two
copies of the viral genome fused at a duplex copy of a hairpin loop
(Fig. 4,5). The duplicated form of the hairpin loop is called the
concatamer junction. The resolution of concatameric DNA into
genome length units, containing terminal hairpin ends (Fig. 4,6), a
process known as telomere resolution, has been described as a site-
specific recombination event that requires an as yet unidentified
transacting telomere resolvase and two identical inverted copies of a
cis element known as the telomere resolution target (reviewed in
23). Although the exact mechanism is unknown, during telomere
resolution a cruciform structure is formed by intrastrand base
pairing between flip and flop sequences within the concatamer


27
junction (21). Cruciform structures have been observed in electron
micrographs of concatamer junction containing plasmids (21). The
arms of the cruciform consist of flip and flop sequences and the base
forms a holiday structure. Site-specific nicking, strand exchange and
ligation then serve to reconstitute the terminal hairpin ends (73).
Circular plasmids containing a concatamer junction and
sorrounding flanking sequences will resolve, when transfected into
infected cells, into linear minichromosomes with covalently closed
hairpin ends (21, 73). This in vivo assay has been used to determine
the sequence requirements for telomere resolution (73). Optimal
resolution of circular plasmids into linear minichromosomes in vivo
requires two inverted copies of a 53 base pair sequence, flanking
inverted repeats capable of intrastrand base pairing. Two inverted
copies of the telomere resolution target are present in each
concatamer, one on either side of the concatamer junction. Each
telomere resolution target consists of a 20 base pair core domain
absolutely required for resolution and two auxiliary domains which
when present serve to enhance the resolution efficiency (21). The
sequence of the core element is absolutely conserved among
divergent members of the orthopoxviridae, implying that there may


28
be common transacting factors recognizing this sequence during the
resolution event (23). Although the sequences of the auxiliary
domains are less highly conserved the relative positions of purines
and pyrimidines in these regions is maintained among the
orthopoxviridae (23, 71).
It has been shown that the telomere resolution target functions
as a promoter during the latter stages of the vaccinia virus life cycle
(89, 119). The RNA transcript from the telomere region appears not
to code for protein (53). Sequence analysis of the telomere
resolution target indicates that the critical region appears to be a
good candidate for a late viral promoter (119). Whether the
telomere resolution target functions as an intermediate or late
promoter is unknown, as is the role that transcription plays in the
resolution event (G. McFadden, personal communication).
Transacting Factors Required for Resolution
There is very little information regarding the protein factors
involved in the resolution of vaccinia telomeres. The minimal
enzymatic activities required for resolution are a site-specific
endonuclease and a DNA ligase although proteins capable of


29
catalyzing strand exchange are also probably involved (118). A
nicking-joining enzymatic activity isolated from purified virions has
been shown to preferentially cleave within the core domain of the
telomere resolution target (61, 72). The nicking-joining activity
comigrates with a 50 kDa polypeptide which has been previously
shown to be a single strand specific endonuclease (61). Although
definitive proof is still lacking, this enzymatic activity is a good
candidate for the site-specific endonuclease necessary for telomere
resolution. A genetic approach has also been taken to identify
factors involved in telomere resolution. Six noncomplementing
temperature-sensitive mutants have been identified which are
incapable of resolving DNA concatamers at the nonpermissive
temperature (10, 74). Five of the six complementation groups have a
corresponding defect in the synthesis of late viral proteins. The
observation that mutants defective in late protein synthesis are also
defective in telomere resolution suggests that a critical factor
synthesized late during infection is required for telomere resolution
(74).
The single temperature-sensitive mutant which is incapable of
telomere resolution but not defective in late gene expression maps to


30
the small subunit of the vaccinia virus capping enzyme (10).
Therefore, genetic evidence implicates the small subunit of the
vaccinia virus capping enzyme (gene D12L) in the resolution process.
Although no direct biochemical role in resolution has been
demonstrated for the mRNA capping enzyme, it is interesting to
speculate in light of the capping enzymes function as an initiation
factor for intermediate transcription that transcription of the
telomere resolution target may play a role in resolution (10).
Transcription through the telomere resolution target may open up
the DNA strands and facilitate the formation of a unique secondary
structure that is recognized by the enzymes involved in resolution.
Alternatively, by unwinding the DNA strands, transcription may
indirectly aid the binding of the DNA resolvase (10).
Virion Morphogenesis and Release
Much of the information available on the morphogenesis of
poxviruses comes from electron microscopic examination of cells
infected with viral mutants (20). These observations have led to the
model for morphogenesis depicted in Fig. 2. Morphogenesis begins
within an electron dense region of the cytoplasm known as


viroplasm. Viroplasm is thought to consist of nucleoprotein
complexes which are the result of viral DNA replication, although
direct evidence for this is lacking. The first distinct structure in the
morphogenesis pathway is the appearance of viral crescents.
Crescents consist of two closely opposed lipid bilayer membranes
derived from the host cells intermediate compartment (116). Spike
like projections known as spicules radiate from the convex surface of
the crescent. Spicules are thought to give the crescent its rigid
convex shape (78). Crescents envelope a portion of the viroplasm
producing a spherical membranated structure, containing within it a
granular electron dense material. The next stage in morphogenesis is
thought to be the condensation of the granular material within the
spherical particle to produce an extremely electron dense material
presumably composed of nucleoprotein. There is some evidence that
condensed nucleoprotein may be injected into the spherical particle
before it is sealed, although at present this conclusion is somewhat
speculative (76). Following the condensation or injection of the
nucleoprotein, there occurs a series of complex morphological
changes within the developing particle that results in the formation
of the first infectious form of the virus. The first infectious form is a


32
membranated brick shaped virion particle that surrounds a
biconcave nucleoprotein containing core. Between the core walls and
the inner surface of the viral membrane are two granular structures
of unknown function known as lateral bodies. Packaged within the
core is the viral DNA and early transcription apparatus (78).
A majority of these infectious particles, known as intracellular
membranated virus (IMV), remain within the cytoplasm. However, a
small subset of IMV particles are actively transported out of the
viroplasm. The IMV particle obtains two additional lipid bilayer
membranes which are derived from the host cell golgi apparatus (49,
101). This triply membranated intracellular enveloped virion (IEV)
is then transported to the plasma membrane. Fusion of the
outermost viral membrane with the plasma membrane liberates the
now doubly membranated viral particle from the cytoplasm into the
extracellular milieu (91). The doubly membranated form, known as
extracellular enveloped virus (EEV) is the form responsible for the
dissemination of the infection in vivo and plaque formation in vitro
(90).


3 3
Viral Genetics
The relatively small genome size, lack of introns and
recombinagenic nature of poxviruses make them very amenable to
genetic study (reviewed in 15). The isolation and characterization of
poxvirus mutants has been of fundamental importance in
understanding the biology of the viral infection. These mutants have
proven valuable for studying all aspects of viral replication. In
addition, the isolation of viral mutants has provided poxvirologists
with the reagents necessary for the later biochemical analysis of
specific enzymatic activities encoded by the virus.
There are presently six reported collections of viral mutants,
each of which has been characterized to varying degrees (reviewed
in 15). This discussion will focus on three collections of vaccinia
virus temperature-sensitive mutants, that of Dales and coworkers,
Ensinger and coworkers, and Condit and coworkers.
The Dales collection was isolated in vaccinia virus strain IHD-W
(International Health Department) by chemical mutagenesis of a
wild-type viral stock followed by screening individual plaque
isolates for temperature sensitivity. Ninety temperature-sensitive


34
mutants were isolated and characterized by electron microscopic
examination of mutant infected cells at the nonpermissive
temperature (40C). This collection was divided into 17 classes based
upon the stage in viral morphogenesis reached under nonpermissive
conditions (20). Complementation and recombination mapping has
been reported on subsets of this collection, however there has been
no attempt to map the complete collection by either
complementation analysis or marker rescue (31, 69).
Ensinger and coworkers have isolated a set of 100
temperature-sensitive mutants in the WR (western reserve) strain of
vaccinia virus by chemical mutagenesis of a wild-type stock. A total
of 62 mutants have been mapped by complementation analysis or
marker rescue (27-29).
Condit and coworkers have isolated a series of 65 temperature-
sensitive mutants in the WR strain of vaccinia virus comprising 32
separate complementation groups (13, 14). Of this collection, 29
complementation groups have been assigned a position on the viral
chromosome by marker rescue (14, 104, 120). The position of 20 of
these complementation groups are shown in Fig. 1. As expected from
mutations which affect essential genes, mutants in this collection


3 5
cluster within the centrally conserved core. To localize a mutant to a
particular open reading frame, fine mapping has now been done on a
number of these mutants (12, 34, 50, 70, 87, 95, 121).
Mutant Classification
In addition to the morphological classification of Dales et al.,
biochemical analysis of the phenotypes of temperature-sensitive
viral mutants has been used as a means of classification. Condit and
coworkers divided their collection into four groups, normal, DNA-,
defective late, and abortive late (reviewed in 15). The normal
phenotype includes all viral mutants which display normal patterns
of protein and DNA synthesis at the nonpermissive temperature.
Viruses classified as DNA- are those that are incapable of
[3H]thymidine incorporation at the nonpermissive temperature. The
defective late mutants comprise a very heterogeneous group of
viruses, which at the nonpermissive temperature, display defects in
the synthesis of late viral proteins. The abortive late phenotype is
characterized by an abrupt cessation of late protein synthesis at
approximately 8 hours post infection.


36
Directed Viral Genetics
The Condit temperature-sensitive mutant collection represents
mutations in only 20% of the essential virus genes (45). With the
publication of the complete sequence of vaccinia virus, it became
clear that there are a number of genes of both known and unknown
function for which there are no temperature-sensitive alleles (41,
54).
The traditional approach to generating temperature-sensitive
vaccinia virus mutants has involved random chemical mutagenesis of
viral stocks followed by screening for temperature sensitivity by
either assaying individual plaques or through a plaque enlargement
protocol. The utility of both methods is limited by requiring the
investigator to screen large numbers of plaques isolates. An
additional problem with the traditional approach to vaccinia virus
genetics is that the random mutagenesis methods employed do not
allow an investigator to target specific open reading frames for
mutational analysis. It is for these reasons that a more direct
approach for the creation of temperature-sensitive mutants must be
found. The goal of directed viral genetics is to target specific viral


37
open reading frames for mutagenesis in vitro and then place the
mutant allele back into its normal location in the viral genome (15).
For directed genetics to be applied to a complex DNA virus such
as vaccinia, two important criteria must be met. The difficulty in
successfully screening large numbers of viruses necessitates that the
mutagenesis scheme chosen produce a high proportion of
conditionally lethal mutants. The second obstacle that must be
overcome involves the targeted insertion of the mutant allele back
into the viral chromosome, along with the displacement of the wild-
type genomic copy of the gene.
This dissertation attempts to address the question of whether
or not clustered charge to alanine mutagenesis and transient
dominant selection can be used as a general method for the creation
of temperature-sensitive mutations in specific vaccinia virus genes.
Clustered Charge to Alanine Mutagenesis
Clustered charge to alanine mutagenesis is actually a
refinement of a technique known as alanine scanning mutagenesis,
first reported by Cunningham and Wells as an in vitro mutagenesis
method that caused minimal disturbances to the resulting proteins


38
secondary structure (19). In this report individual amino acids
within a previously defined receptor binding domain of human
growth hormone (hGH) were systematically mutated to alanines. The
authors chose alanine because it is a small aliphatic amino acid
commonly found both on the surface, as well as buried within the
hydrophobic core of a variety of proteins and in a variety of
secondary structures. Therefore the authors felt that single alanine
substitutions would be unlikely to cause any extreme electrostatic or
steric disturbances in the mutant protein, and thus would be unlikely
to grossly alter the mutant proteins secondary structure.
Elimination of amino acid side chains beyond the 6 carbon, by
replacement with alanine, would aid in the identification of those
amino acids whose side chains participate in protein-protein
interactions between hGH and the hGH receptor. Recognition of the
recombinant alanine substitution hGH mutants by monoclonal
antibodies specific for the native structure of hGH demonstrated that
most of these mutants retained the secondary structure of the wild-
type protein (19). The initial reporting of alanine scanning was


followed by a number of other reports which demonstrated the
utility of this method for the examination of both interprotein and
intraprotein interactions (2, 6, 11).
Alanine scanning was later modified by Bennett et al., who
mutated clusters of charged amino acids (Glu, Asp, His, Lys, Arg) to
alanines in an effort to define functional determinants on the surface
of human tissue plasminogen activator protein (htPA) (7). Clusters of
charged amino acids were targeted for mutagenesis because the
authors theorized that highly charged regions in the primary
sequence of a protein would be located on the surface, rather than
buried within the interior of the folded protein. In addition, charged
surface residues are also important mediators of electrostatic
protein-protein interactions, therefore loss of the surface charge
could disrupt these interprotein interactions. Charged clusters were
mutated in groups of 1 to 4 amino acids and clusters spanning
cysteine residues were avoided in order to refrain from disrupting
disulfide bonds which act to stabilize protein secondary structure.
The recombinantly expressed mutant proteins were tested in vitro
for a variety of functional activities and compared to wild-type htPA
protein. These data helped to localize some of the functional domains


40
involved in htPAs diverse biological activities, which include
activation of plasminogen to plasmin, stimulation of tPA by fibrin,
and inhibition of tPA by tissue plasminogen activator inhibitor
protein (7).
Most of the reports which used clustered charge to alanine
mutagenesis involved examining recombinantly expressed protein or
peptide fragments in vitro. However in 1993 Wertman, Drubin and
Botstein demonstrated that clustered charge to alanine mutagenesis
could be used to create mutations that were temperature-sensitive in
vivo (130). In a mutational analysis of the Saccharomvces cerevisiae
actin gene (ACT1) 16 out of the 34 mutations constructed were
conditionally lethal for colony formation. Of the 16 conditional lethal
mutations, 9 were both cold sensitive and heat sensitive and 6 were
strictly heat sensitive conditional lethals. Examination of the three
dimensional crystallographic structure of yeast actin confirmed that
81% of the clustered charge to alanine mutations created in this
study targeted residues located on the surface of the folded protein
(130).
Clustered charge to alanine mutagenesis has also been used by
Diamond and Kierkagaard to create temperature-sensitive mutations


in the RNA dependent RNA polymerase protein of polio virus (25).
Of the 27 mutations constructed, 9 (35%) yielded viruses which the
authors classified as temperature-sensitive. These viruses were
classified as temperature-sensitive based upon either a small plaque
phenotype or decreased accumulation of viral RNA at the
nonpermissive temperature (39.5C) (25). Interestingly, all of these
viruses are capable of producing infectious progeny at the
nonpermissive temperature, therefore none of these viruses are
conditional lethal temperature-sensitive mutants.
Following the initial demonstration that clustered charge to
alanine mutagenesis can be used to create temperature-sensitive
mutations in vivo, other investigators have used this technique to
make temperature-sensitive alleles in a number of diverse proteins
including the HIV type 1 integrase gene and the yeast ubiquitin-
conjugating enzyme CDC34 (UBC3) (93, 131). These results have
served to demonstrate that clustered charge to alanine mutants can
be created in proteins that serve structural, as well as enzymatic,
functions.


Transient Dominant Selection
The ability of homologous viral and plasmid DNA sequences to
recombine in vivo has been used to create deletion and insertion
mutants as well as viruses expressing foreign genes (80).
Recombination can also be used as a means of targeted gene
replacement to introduce site-specific mutations into the viral
genome (33). The principal limitation of this technology has been a
low proportion of recombinants (1:1000) among a backround of wild-
type nonrecombinant viruses (33). A number of selection and
screening methods have been devised to aid in the identification of
viral recombinants (32, 38, 66). One of the most widley used
techniques for the identification of viral recombinants has been a
transient dominant selection method which relies upon the ability of
recombinant viruses expressing the Escherichia coli xanthine-guanine
phosphoribosyltransferase protein (ecogpt) to grow and form plaques
in the presence of mycophenolic acid (MPA). The antibiotic
mycophenolic acid blocks inosine monophosphate dehydrogenase, a
cellular enzyme in the de novo guanine monophosphate synthesis
pathway (83). The selection for viral recombinants is made possible


by the different catalytic activities of the mammalian and bacterial
enzymes hypoxanthine phosphoribosyltransferase and xanthine-
guanine phosphoribosyltransferase. The bacterial enzyme (ecogpt)
will efficiently use xanthine as a substrate for purine biosynthesis
via the salvage pathway, whereas the mammalian enzyme will not
(83). Therefore, when provided with xanthine and grown on an
appropriate cell line, only viruses expressing ecogpt will form
plaques in the presence of MPA.
During this study, this methodology was applied as a means of
targeted gene replacement, the salient features of which are
illustrated in Fig. 5. Infected cells were transfected with a plasmid
that contained tandemly arranged single copies of a mutant vaccinia
gene and the ecogpt gene. The ecogpt gene was under the
transcriptional control of a vaccinia virus promoter (p7.5k) which
drives expression of ecogpt at both early and late times after
infection (33). Single crossover homologous recombination events
integrate the plasmid into the genome and generate a virus which
contains the ecogpt cassette flanked on either side by a copy of the
gene of interest (33). Viruses which have integrated the plasmid
into the genome can be selected for by plating the lysate from the


Fig. 5. Recombination events occurring within infected cells
during transient dominant selection. A transfected plasmid
containing both the ecogpt gene and a mutant vaccinia gene will
homologously recombine into the viral genome during the infection
transfection experiment. The mycophenolic acid resistant
recombinant virus produced contains the ecogpt gene flanked on
either side by a copy of the gene of interest. During the growth of
each mycophenolic acid resistant plaque, the virus will resolve the
gene duplication generating viruses which have either retained
(bottom left) or lost (bottom right) the mutation.


4 5
wild type
vaccinia virus
chromosome
I
infection-transfection

mycophenolic acid resistant recombinant


46
infected, transfected cells in the presence of MPA (33). Duplication
of the cloned gene makes these mycophenolic acid resistant viruses
unstable, so that during the growth of each MPA resistant plaque,
resolution will occur via recombination between the two genomic
copies of the gene of interest. The products of the resolution event
will be viruses which have lost the ecogpt gene and contain only a
single copy of the gene of interest. Resolution occurs during the
growth of each MPA resistant plaque such that each MPA resistant
plaque contains a mixture of viruses, some of which have a mutant
vaccinia gene derived from the transfected plasmid, while others
retain a wild-type copy of the vaccinia gene. Unresolved viruses
which retain the ecogpt gene will preseumably serve a helper
function for growth of resolved viruses in the presence of MPA.
This study will address a number of important questions about
transient dominant selection including: 1) Can transient dominant
selection be used to insert site-specific mutations into essential
vaccinia genes? 2) What is the percentage of mutant viruses within
each MPA resistant plaque?; 3) How many total viruses need to be
screened for temperature sensitivity before an unknown mutation
can be adjudged to not confer a temperature-sensitive phenotype?


4 7
A protocol, which is outlined in Fig. 6, has been developed to answer
these questions by creating mutations in the vaccinia virus gene G2R,
a gene with a selectable phenotype. The advantages of using the
vaccinia G2R gene to determine the efficiency of both clustered
charge to alanine mutagenesis and transient dominant selection is
discussed in detail in other sections of this dissertation (see chapter 1
and introduction to chapter 3). Briefly, a transient dominant
selection experiment was done with a plasmid containing a known
conditional lethal, temperature-sensitive G2R allele (Cts56).
Individually isolated MPA resistant plaques were then tested for the
presence of the Cts56 allele by plating at 31<>C and 40<>C in the
presence and absence of isatin-B-thiosemicarbazone (IBT). Wild-
type viruses will not grow in the presence of IBT. Loss of G2R
function results in viruses which are IBT dependent, therefore Cts56
is dependent upon IBT for growth at 40C. The Cts56 virus is also
resistant to IBT at 31C. The phenotype of individual IBT resistant
plaques can then be determined by re-plating them at 31<>C and 40C
in the presence and absence of IBT. The isolation of viruses with the
Cts56 phenotype proves that transient dominant selection can be


Fig. 6. Testing the efficiency of transient dominant selection
by making mutations in G2R. Mycophenolic acid resistant
plaques are isolated from a transient dominant selection experiment
done with wild type vaccinia virus and a plasmid which contains the
ecogpt gene and a mutant copy of G2R. Viruses within the
mycophenolic acid resistant plaque that contain a mutation that
alters G2R function can be selected for by plating individual
mycophenolic acid resistant plaques in the presence of IBT. The
efficiency of transient dominant selection can be measured by
determining the percentage of viruses containing the mutation (+IBT)
among the total population (31C -IBT).


4 9
infection transfection
wild type
vaccinia virus
Mutant vaccinia
gene
(select for recombinants
with mycophenolic acid
/ \
Test the phenotype of individual IBT
resistant plaques by replating at 31 C
and 40C + and IBT


50
used to insert site-specific conditionally lethal mutations into the
viral genome. In addition, the proportion of IBT resistant viruses
within individual MPA resistant plaques will indicate how many total
viruses from each transient dominant selection experiment involving
a clustered charge to alanine mutant of unknown phenotype will
need to be screened for temperature sensitivity. This information
will be used to determine how to modify the protocol in order to
screen clustered charge to alanine mutations in genes without
selectable phenotypes. In these cases progeny from individual MPA
resistant plaques will be isolated by plated at 31C and screened
individually by plating at 31C and 40<>C.
Capping of mRNA and the Vaccinia mRNA Capping Enzyme
The nucleus is the site of eukaryotic mRNA synthesis and
maturation (75). Initially mRNAs are synthesized by RNA
polymerase II in the form of precursor molecules known as pre-
mRNA or heterogeneous nuclear RNA (hnRNA). Pre-mRNAs undergo
extensive posttranscriptional modifications within the nucleus,
including 5 terminal capping, 3 terminal polyadenylation, splicing
and internal methylations, before being transported to the cytoplasm


and entering the pool of mature translationally competent mRNA
(75). The modifications occurring to the 5 end of eukaryotic mRNAs
are of particular interest because mRNA is synthesized, translated
and possibly degraded in a 5 to 3 direction (75).
The 5 end of a mature eukaryotic mRNA molecule consists of a
cap structure, m7GpppN, in which the first encoded nucleotide is
linked to a 7-methylguanosine residue by a unique 5-5
phosphodiester bond (105). The cap structure of mRNA is necessary
for efficient translation initiation and protects the mRNA from
degradation by 5-3* exonucleases (105, 106). In addition, the
presence of a cap structure on nuclear mRNA facilitates mRNA
splicing and nuclear export (43, 57, 59). Capping of pre-mRNA
occurs cotranscriptionally and is one of the initial steps in the
posttranscriptional mRNA maturation pathway (75).
The formation of the mRNA cap structure (m7GpppA) occurs in
three sequential enzymatic reactions (reviewed in 75, 105). The 5
end of the triphosphorylated primary mRNA transcript is first
cleaved to a diphosphorylated form by an mRNA triphosphatase and
then capped with guanosine monophosphate by an mRNA
guanyltransferase. During the guanyltransferase reaction, a stable


intermediate forms via a covalent phosphoamide bond between a
lysine residue in the guanyltransferase active site and the phosphate
moiety of guanosine monophosphate (75, 110). Following
guanylation the guanine cap is methylated at the N? position by a
(guanine-7)methyltransferase (75). This general mechanism for
capping mRNA occurs in vaccinia, reovirus, cytoplasmic polyhedrosis
virus and probably most eukaryotic cells, although cap formation in
vesicular stomatitis virus is thought to occur by the transfer of a
guanosine diphosphate to the 5 end of a monophosphorylated
primary mRNA transcript (reviewed in 75).
Methylation of the nucleotides adjacent to the 7-
methylguanosine residue occurs to varying extents, and this provides
a basis for the following cap nomenclature system: m7GpppN (cap 0),
m^GpppNm (cap 1), nFGpppNmpNm (cap 2), irFGpppNmpNmpNm (cap 3)
and m7GpppNmpNmpNmpNm (cap 4). Generally these methylation
reactions are thought to occur sequentially, although there is
evidence that at least in the case of vesicular stomatitis virus and
cytoplasmic polyhedrosis virus the 20-methylation of the
penultimate nucleotide can occur prior to the methylation of the
guanosine cap (reviewed in 75). The cap 0 structure, which is the


minimal cap structure required to facilitate translation initiation, is
found on the 5 end of mRNA isolated from yeast, slime molds and
some viral mRNAs (37, 62, 128), whereas mRNAs containing a cap 1
structure have been isolated from slime molds, animal cells and
many animal viruses (62). The cap 2 structure is found on mRNA
from insects, vertebrates and their viral parasites (62).
Interestingly, only cap 1 mRNA is found in the nucleus, implying that
the methyltransferases responsible for forming the other cap
structures are confined to the cytoplasm (62).
Because the enzymatic machinery necessary for capping mRNA
is localized within the nucleus, many cytoplasmic viruses including
vaccinia have evolved their own mRNA capping enzymes (75). All of
these viruses package capping enzymes within the viral particle,
along with a virally encoded RNA polymerase which ensures the
capping of mRNAs synthesized during the early phases of the viral
life cycle. The packaging of a viral capping enzyme and a viral RNA
polymerase within the virion has been used to develop in vitro
transcription/capping assays, whereby the mechanism of mRNA
capping has been examined in detail (reviewed in 39, 75). In the
case of vaccinia, incubation of purified virus particles in vitro with a


54
nonionic detergent, a reducing agent, all four ribonucleoside
triphosphates, magnesium and S-adenosyl-L-methionine results in
the formation of early viral mRNA molecules which contain cap 0 or
cap 1 structures at their 5 ends (62). The vaccinia mRNA capping
enzyme catalyzes the formation of the cap 0 structure, and the
methylation of the penultimate nucleotide is done by the small
subunit of the vaccinia poly A polymerase protein (102, 115, 124).
The multifunctional nature of many cytoplasmic viral capping
enzymes is in contrast to cellular capping enzymes. The L protein of
vesicular stomatitis virus is thought to contain the guanyltransferase,
(guanine-7)methyltransferase and (nucleoside-20-)
methyltransferase active sites, in addition to serving as a subunit of
the RNA dependent RNA polymerase (128). The NS3 protein of
flaviviruses functions as a protease, a helicase and an mRNA
triphosphatase (129). Among avian reoviruses, a single protein
encodes both RNA dependent RNA polymerase and guanyltransferase
activities (117). As previously discussed, the vaccinia capping
enzyme functions as an early transcription termination factor and an
intermediate transcription initiation factor. The biochemical
activities of cellular capping enzymes seem to be confined to capping


5 5
mRNA. In rat liver, yeast, and brine shrimp the RNA triphosphatase
and guanyltransferase activities remain tightly associated during
multiple chromatographic purification steps. However (guanine-
7)methyltransferase activity does not coelute with the RNA
triphosphatase-guanytransferase containing fractions (75). Single
polypeptides with RNA triphosphatase and guanyltransferase
activities have been isolated from brine shrimp and rat liver (75). In
contrast, the yeast Saccharomvces cerevisiae contains two tightly
associated polypeptides, an 80 kDa RNA triphosphatase and a 52 kDa
guanyltransferase (75).
The only nonviral capping enzymes which have been cloned
are those from Saccharomvces cerevisiae (CEG1) and
Schizosaccharomvces pombe (PCE1) (103). The close association of
the RNA triphosphatase and guanyltransferase activities in many
eukaryotic capping enzymes may indicate that the RNA
triphosphatase and guanyltransferase reaction are coupled in vivo.
Vaccinia Virus mRNA Capping Enzyme
Although the specific functions of the vaccinia virus mRNA
capping enzyme have been previously discussed in detail in earlier


56
sections of this dissertation it may be useful to review what is known
about the vaccinia virus mRNA capping enzyme. The vaccinia virus
mRNA capping enzyme is a heterodimer composed of a 97 kDa large
subunit and a 33 kDa small subunit encoded by the vaccinia genes
DIR and D12L respectively (77, 86). The heterodimer contains
mRNA triphosphatase, guanyltransferase and (guanine-
7)methyltransferase enzymatic activities (108, 115, 124). The
domain structure of the enzymatic activities involved in capping
mRNA are fairly well defined, with the mRNA triphosphatase and
guanyltransferase active sites being localized to the amino terminal
60 kilodaltons of DIR, and the (guanine-7)methyltransferase domain
being contained within a stable heterodimer formed between the
carboxyl terminal portion of DIR and an intact D12L protein (107,
112).
During the guanyltransferase reaction, guanosine
monophosphate becomes covalently linked to a lysine residue (K260)
in the large subunit forming a enzyme-GMP intermediate. The
guanyltransferase active site has been mapped to a conserved KTDG
motif at amino acids 260-263 in DIR (17, 84). The KTDG motif is part


57
of a larger, complex motif associated with nucleotidyl transferases
such as capping enzymes and DNA and RNA ligases (111).
Heterodimerization between DIR and D12L and wild-type
levels of methyltransferase activity have been detected by
coexpression in bacteria of a plasmid encoding amino acids 498-844
of DIR and a full length D12L protein (46). However, the detection of
low levels of methyltransferase activity by expression of only amino
acids 540-844 of DIR indicates that the (guanine-7)
methyltransferase active site resides solely within the carboxyl
terminal 304 amino acids of DIR (16). Nevertheless, it is clear from
this data that heterodimerization between DIR and D12L is required
for full methyltransferase activity. A methyltransferase motif
UU[D/E]xGxGxG, where U is an aliphatic amino acid and x is any
amino acid, was identified in DIR that bears homology to motifs
found in the methyltransferases of flaviviruses, reoviruses and the
Hhal methyltransferase (68). All of these methyltransferases utilize
S-adenosyl-L-methionine as a substrate, and this motif is presumed
to be involved in binding S-adenosyl-L-methionine. The vaccinia
DIR sequence AIDFGNG (amino acids 596-602) lacks the third glycine
residue of the consensus sequence, however this sequence has


58
nevertheless recently been shown to be essential for
methyltransferase activity in vitro (68). A number of
alaninescanning mutants have been generated in recombinantly
expressed DIR and examined for D1R-D12L subunit association and
methyltransferase activity (68). One of these mutations
(H682A,Y683A) is defective in methyltransferase activity, but not
subunit association, implying that these two amino acids form part of
the methyltransferase active site. S-adenosyl-L-methionine has also
been covalently photocrosslinked to amino acids 499-579 and 806-
844, implicating these residues in the binding of S-adenosyl-L-
methionine (48).
The vaccinia virus mRNA capping enzyme also functions as an
early gene transcription termination factor and an intermediate gene
transcription initiation factor (109, 126). Transcription termination
of early genes requires a full length intact heterodimer and the
sequence UUUUUNU in the nascent mRNA (64, 114). The mechanism
of early termination is not known but it is thought that the capping
enzyme catalyzes termination by protein-protein interactions with
the viral transcription elongation complex. A recombinantly
expressed guanyltransferase defective capping enzyme mutant is


able to catalyze early transcription termination in vitro, therefore
termination is independent of cap formation. The capping enzyme
forms a stable complex with the viral RNA polymerase prior to
binding of the polymerase complex at the intermediate promoter
(126). The formation of the capping enzyme-RNA polymerase
complex is necessary for transcription initiation (126).
The vaccinia capping enzyme has also been genetically
implicated in the resolution of vaccinia virus telomeres (10). A
temperature-sensitive mutation mapped to the small subunit of the
vaccinia virus mRNA capping enzyme (gene D12L) which exhibits
normal protein and DNA expression under nonpermissive conditions
is unable to resolve viral telomeres at the nonpermissive
temperature (40C) (10). Although the phenotype of this mutant
genetically implicates the vaccinia mRNA capping enzyme in
telomere resolution, there is no biochemical evidence that the
capping enzyme participates either directly or indirectly in the
resolution of viral telomeres.


CHAPTER 2
MATERIALS AND METHODS
Recombinant DNA Techniques
Bacterial Strain and Methods
Escherichia coli strain JM101 (SupE, thiA(lac-proAB)
F[traD36,proAB+,lacIq lacZAM15] was used as host to propagate all
plasmid, phage and phagemid constructs. Standard techniques that
have been previously described were followed for the growth,
maintenance and isolation of all plasmids, phage and phagemid
constructs (100).
Electroporation of DNA into JM101
Electrocompetent bacterial cells were prepared from log phase
cultures of JM101 (ODoo between 0.5-1.0) grown in Lennox L broth.
60


Cells were pelleted at 5,000 x g for 15 min in a GS3 rotor (Sorvall) at
4<>C, washed twice with 1 liter of ice cold distilled water, re-pelleted
at 5000 x g, resuspended in 5 ml of cold 20% glycerol and stored at -
70oC. Electroporations were done with a Biorad gene pulser set at 2.5
kV, 25 pF, 200 Q (average time constant of 4-5 msec, field strength
of 12.5 kV) in 1 cm2 cuvettes, using a protocol recommended by the
manufacturer.
Construction of G2R and DIR Vectors
Mutant G2R containing plasmids for transient dominant
selection were constructed using two similar protocols. For wild-type
G2R, AS1, and Cts56, a plasmid pUC118G was constructed, which
consists of the phagemid vector pUC118 (125), a cassette containing
the constitutive p7.5k vaccinia promoter upstream from the
Escherichia coli guanine phosphoribosyltransferase (ecogpt) gene
(obtained as a 1.1 kb Hpal, Dral fragment from pTKgpt-Fls (33)),
and a 982 base pair PvuII, EcoRV fragment derived from the
vaccinia virus HindIII G fragment, containing the wild-type G2R gene
with 82 nucleotides of 5' flanking sequence and 236 nucleotides of 3'
flanking sequence (70). The G2R containing DNA was placed adjacent


62
to and upstream from the p7.5k promoter, with the G2R sequences in
the opposite transcriptional orientation relative to the p7.5k
promoter. Single stranded pUC118G phagemid DNA (125) was used
as a template for mutagenesis to construct mutants AS1 and Cts56,
and transient dominant selections were done using double-stranded
plasmid DNA containing either wild-type or mutant G2R sequences.
For AS2 through AS9, mutagenesis of G2R was done using single
stranded DNA from an M13mpl9 G2R clone, provided by J. Lewis,
containing only the coding sequence of G2R obtained by PCR
amplification. Mutant G2R genes were then subcloned into a plasmid
containing pGEM3ZF- (Promega) vector DNA and the p7.5k ecogpt
cassette described above for conferring resistance to mycophenolic
acid. The G2R gene was placed adjacent to and upstream from the
p7.5k promoter, with the G2R sequences in the same transcriptional
orientation relative to the 7.5K promoter. The transcription start site
of G2R has been previously mapped to base 10,335 of the vaccinia
virus strain WR HindIII G fragment, therefore none of the cloned G2R
sequences used in this study contain the promoter for the G2R gene
(70).


63
The phage M13mpl8DlRNco- used as a template for all DIR
mutagenesis experiments was a gift from E. Niles. The phage
M13mpl8DlRNco- contains the complete DIR open reading frame in
which an internal Ncol restriction endonuclease site at position
+2,235, relative to the transcriptional start site, has been removed by
site directed mutagenesis using an oligonucleotide which disrupts the
Ncol recognition sequence without altering the DIR coding sequence
(47). The plasmids used in the transient dominant selection
experiments with DIR were made using the following protocol. The
DIR gene was subcloned as a 2.8 kb PstI SacI fragment from
appropriately mutagenized M13mpl8DlRNco- clones into the 7.5K-
ecogpt containing vector pBSgptB cut with PstI and SacI. The
plasmid pBSgptB, a gift from P. Turner, was made by inserting a 2 kb
EcoRI fragment, containing the p7.5k ecogpt cassette from pTK61-gpt
(33) into the EcoRI site of pBluescriptKS(+) (Stratagene). Mutant
copies of DIR were inserted upstream from and in the same
transcriptional orientation as the p7.5k ecogpt cassette. None of the
cloned DIR sequences used in this study contained the promoter for
the DIR gene (85).


64
Mutagenesis of G2R and DIR
Clustered charge to alanine mutations were created in cloned
copies of G2R and DIR using oligonucleotide directed mutagenesis.
The sequence of all G2R and DIR mutagenic oligonucleotides are
shown in Tables 1 and 2, respectively. All G2R mutations were made
using the Amersham oligonucleotide mutagenesis kit according to the
manufacturers instructions. Oligonucleotide directed mutagenesis on
DIR was performed using the T7-gen in vitro mutagenesis kit
according to the manufacturers instructions (U. S. Biochemicals).
Mutagenic oligonucleotides, synthesized by the DNA synthesis
core facility of the University of Florida, were designed to include 12
nucleotides 5' and 9 nucleotides 3' of the mismatched region (19).
DNA Sequencing
All DNA sequencing was done using the Sequenase version 2.0
kit according to the manufacturers instructions (U.S. Biochemicals)
and appropriate oligonucleotide primers. The complete G2R sequence
of each mutant phage or phagmid was confirmed byDNA sequence
analysis. The G2R gene from mutant viral DNA was amplified by


Table 1. G2R mutant oligonucleotides
mutation*
oligoligonucleotide sequence
amino acid changest
ts56
AS1
AS2
AS3
AS4
AS5
AS6
AS7
AS8
AS9
5 CTTGAGAAAATCTACAAAGAAT 3
5TTAGAAATATATGC AGCGTATGCCGCAGCTGGAAAGT 3
5 TCCAACGATTCCGCAGCTTCTGTAA 3
5 TCCATACTTAATGCCGCCGATAAAT 3
5 AGAACATCTACCGCTGCATTTGTTGT 3
5 GTTCCGCTTCCTGCAGCAAATAAAT 3
5 ATATAAATATTCGCGGCCGCTATAACAAC 3
5 TGAGGAGTGTATGCCGCGAGGAGATA 3
5 GTTATGGGGACGGCCGCATTAGAAT 3
5 ATCTCCAACGATGCCGCAGCTGCTGTAAGTA 3
G -> R
DRKYHK -> AAAYAA
TEDEE -> TEAAE
LSEEL -> LSAAL
TNKKV -> TNAAV
LFDKG -> LFAAG
IKDRN -> IAAAN
LLKEY -> LLAAY
SNERV -> SNAAV
TEDEE -> TAAAA
Bold face letters indicate mutant nucleotides. indicates the G2R mutant designation, t denotes the
amino acid changes created in the G2R protein by each mutant oligonucleotide.
o\


Table 2. DIR mutant oligonucleotides
mutation*
oligonucleotide sequence
amino acid changest
El 26
D326
K348
K392
E516
E531
D545
K558
E793
E806
5 AAAAATATAGCAGCGGCCGCTGTCGATAGTC 3
5 TACTTACITGCTGCTAGCGCGGCATTGATTGCAT 3
5 AGTAAACGGCCCTGCGTATGCCGCTGACGCGAATACTAT 3
5 ATAGTATTTGCGGCCGCAATTGCAAAATCAATGTTA 3
5 TTGATGCTTTGAGCTGCTAAAGCTGCGACTATGA 3
5 ACATCCGATAGTGCAGCCGCGTTAAAGA 3
5 TCTGGATTTAATGCAAATGCAGCATTATTGG 3
5 CCCAACGGTCCTGCAGTTGCTGCATTCGTAAA 3
5 TTAATAAACGCTGCGCTAGCTGCTATAATTGTAG 3
5 CTTGTAGATGGTGCAGCTGCCATTGTAG 3
EERHI -> AAAAI
DRLEE -> AALAA
KSKKYE -> ASAAYA
KIKKE -> AIAAA
EHLRD -> AALAA
EDKLS -> AAALS
DKFRL -> AAFAL
KRTRG -> AATAG
ERSKK -> AASAA
EDRPS -> AAAPS
Bold face letters indicate mutant nucleotides. indicates the DIR mutant designation, t denotes the
amino acid changes created in the DIR protein by each mutant oligonucleotide.
On
On


67
PCR, and appropriate selected regions of the G2R PCR product were
sequenced to confirm the presence of the desired mutations in Cts56,
ASI, AS4, AS6, and AS9 viruses. The presence of the mutant
sequence in the DIR phage clones was confirmed by DNA sequencing
of selected regions of DIR surrounding the mutation of interest. DNA
sequence analysis of PCR amplification products from portions of the
DIR open reading frame confirmed the presence of the E516 and
E793 mutation in E516 and E793 viral DNA, respectively. The E126
and D326 mutations created novel Nhel and Notl restriction enzyme
sites respectively, in DIR. Portions of the DIR gene from either El26
or D326 viral DNA were amplified by PCR and subjected to
restriction enzyme digestion and agarose gel electrophoresis to
confirm the presence of the appropriate mutations in the El26 and
D326 viral DNA (data not shown) (100).
Sodium Dodecvl Sulfate Polyacrylamide Gel Electrophoresis
Protein samples in lx Laemmli sample buffer were boiled and
separated on 10% SDS polyacrylamide slab gels as described (60).
Following electrophoresis, the gels were stained with Coomassie blue,
destained in 7.5% glacial acetic acid, 5% methanol, and dried


68
according to standard techniques (100). Autoradiograms of
radiolabeled protein samples were made using Kodak XAR film at -
70C.
Northern Blot Analysis
Five ug of each purified RNA sample was denatured in
formamide and separated on a 1.2% formaldehyde agarose gel using
standard techniques (100). The RNA was transferred from the gel
onto a GeneScreen membrane in phosphate buffer (136 mM NaH2P04,
6.4 mM Na2HPC>4) overnight, according to the method of Southern
(117). The RNA was fixed to the membrane by irradiation at 254 nm
in a Stratalinker (Stratagene) for 1 minute. The membrane was
prehybridized in 7 ml of a solution containing 50% formamide, 10%
dextran sulfate, 1.45 M NaCl, 100 ug/ml denatured salmon sperm
DNA, 2X P buffer (IX P buffer contains 1% bovine serum albumin
(BSA, Sigma fraction V), 1% polyvinylpyrrolidone (MW 40,000), 1%
ficoll (MW 40,000), 0.25 M Tris-HCl [pH 7.5], 0.5% sodium phosphate,
5% SDS) for 3 hours at 55oC. Hybridizations were done by adding
lxlO6 cpm of the appropriate radiolabeled riboprobe to the
prehybridizing membrane and incubating at 55<>C overnight.


69
Nonspecifically bound radioactivity was removed by washing the
membrane once in 0.1X SSC (IX SSC is 150 mM NaCl, 15 mM sodium
citrate), 0.1% SDS for 15 minutes at room temperature and twice for
30 minutes each in 0.1X SSC, 1% SDS at 65<>C. Autoradiograms were
made using Kodak XAR film at -70<>C.
Preparation of Radiolabeled Riboprobes
Plasmids used to prepare antisense riboprobes specific for the
vaccinia virus C11R, G8R and F17R mRNA transcripts were a gift
from B. Moss, and their construction has been described elsewhere
(3). Briefly, 678, 530 and 682 nucleotides of coding sequence
corresponding to the 5 ends of vaccinia virus genes C11R, G8R and
F17R respectively, were each inserted into the vector plasmid
pGEM3ZF (Promega). The plasmids were linearized by restriction
enzyme digestion with EcoRI (C11R and G8R) or BamHI (F17R) and
subjected to transcription with T7 RNA polymerase (Promega) to
generate antisense RNA molecules of 316 (C11R), 300 (G8R), or 126
(F17R) nucleotides in length. Each 20 ul transcription reaction
contained 1 ug of linearized plasmid DNA, 40 mM Tris-HCl [pH 7.5], 6
mM MgCh, 2 mM spermidine, 10 mM NaCl, 5 mM dithiothreitol, 0.5


70
mM each of ATP, GTP and UTP, 12 uM unlabeled CTP, 50 uCi
[oc32P]CTP (3,000 Ci/mmol, Amersham), 20 units of RNasin (Promega),
and 20 units of T7 RNA polymerase (Promega). Following a 60
minute incubation at 37C, 20 units of RNAse free DNAse (Promega)
was added to the reaction and the 37C incubation was continued for
an additional 15 minutes. The labeled RNA was purified by
extraction with phenol-chloroform (1:1), precipitated with
ammonium acetate and isopropanol and quantitated by liquid
scintillation counting according to standard techniques (100).
Western Blot Analysis of E793 Virions
Transfer of proteins from 10% sodium dodecyl sulfate
polyacrylamide gels to nitrocellulose was done according to the
method of Towbin (122). Rabbit polyclonal antiseras for DIR and
D12L, kindly provided by E. Niles and S. Shuman, respectively, were
each used at a dilution of 1:2000. The primary antibody was detected
by using horseradish peroxidase linked polyclonal anti-rabbit
antisera (Amersham) at a dilution of 1:10,000 and visualized by
Amershams enhanced chemiluminescence western blotting kit
according to the manufacturers instructions.


Virion Directed In Vitro Transcription and Methvltransferase Assays
Purified vaccinia virus virions were preincubated at 30<>C, 35C
or 40C in 100 ul reactions containing 13 ug/ml virus, 0.01 M Tris-
HCL [pH 8.5], 0.01% nonidet P40, 0.02 M dithiothreitol, 0.2 M MgCl2.
At 15 minute intervals 10 ul samples were removed and held on ice
until the conclusion of the preincubation time course. For the
transcription reactions, 10 ul of a solution containing 10 mM ATP, 2
mM GTP, 2 mM CTP, 0.66 mM unlabeled UTP, 0.4 uCi [3H]UTP (14
Ci/mmol, Amersham) was added to each preincubated sample and
transcription reactions were carried out at 30C for 30 minutes. For
methyltransferase reactions, 10 ul of a solution containing 10 mM
ATP, 2 mM GTP, 2 mM CTP, 2 mM unlabeled UTP, 0.66 uCi [3H]S-
adenosyl-L-methionine (15 Ci/mmol, Amersham) was added to each
preincubated sample and methyltransferase reactions were carried
out at 30C for 30 minutes. The reactions were terminated by
spotting 15 ul onto a DE81 filter (Whatman). Unincorporated
radioactivity was removed by washing in 0.5 M Na2HP04, after which
the filters were analyzed by liquid scintillation counting according to
established methods (100). Wild-type and E793 transcription and


72
methyltransferase reactions were normalized to identical reactions
carried out with wild-type or E793 virus that had not been
preincubated and the results expressed as the percent of activity
relative to non-preincubated controls.
Virological Techniques
Cells and Virus
BSC40 and CV1 cells were routinely maintained at 37C in 5%
CO2. BSC40 cells were grown in Dulbecco's Modified Eagle medium
(DME, Life Technologies) with 10% Hyclone (Hyclone Laboratories).
CV1 cells were maintained in CV1 medium, which is Dulbecco's
modified Eagle medium supplemented with 1% nonessential amino
acids (Sigma), 1% sodium pyruvate (Sigma) and 10% fetal calf serum
(Life Technologies). Stocks of wild-type vaccinia virus strain WR
were grown on BSC40 cells at 37C. Temperature-sensitive vaccinia
virus mutants were grown on BSC40 cells at 31C. The isatin-6-
thiosemicarbazone dependent mutant G2A was grown on BSC40 cells
at 37C in the presence of 45 pM IBT (Pfaltz and Bauer).


73
Preparation of IBT
A 1 mg/ml stock of IBT in acetone was diluted with 4 volumes
of 0.25 N NaOH and further diluted 1:100 in DME+10% Hyclone+1%
Noble agar (Difco) for a final concentration of 45 pM. IBT containing
media was added to infected BSC40 cells following the 60 minute
absorption period and remained in the media throughout the course
of the infection.
Plaque Titration
Viral stocks were thawed, sonicated in a Vibra cell sonicator
with a cuphorn attachment (Sonics and Materials) for 1 minute and
serially diluted in PBSAM (170 mM NaCl, 3.4 mM KC1, 10 mM
Na2HP04, 1.8 mM K2HP04 [pH 7.2], 10 mM MgCl2, 0.01% BSA).
Confluent monolayers of BSC40 cells on 60 mm dishes were infected
with 0.5 ml aliquots of each viral dilution for one hour at either 31C
or 40C. The inocula were removed and each dish was overlaid with
4 ml of DME+10% Hyclone containing 1% molten noble agar (Difco),
allowed to solidify and incubated at 31C, or 40oC for 6 days. The
plaques were stained by overlaying the cells with 4 ml of DME+10%


Hyclone, 1% molten Noble agar, 0.005% neutral red (3-Amino-7-
dimethylamino-2-methylphenazine hydrochloride, Sigma) and
incubating at 31C or 40C from 3 hours to overnight. For permanent
records of wild-type and mutant plaques, the Noble agar overlay was
removed after staining with neutral red and the cell monolayers
were stained with a solution of 0.25% crystal violet (Sigma) in 20%
ethanol at room temperature for a few hours. The dishes were then
rinsed with distilled water and air dried.
Viral Plaque Isolation
Infected monolayers of BSC40 or CV1 cells were stained with
neutral red as described above to visualize individual plaques. Well
isolated single plaques were picked with a sterile pasteur pipette and
placed in 3 ml of PBSAM, frozen and thawed 3 times and then plaque
titrated as previously described.
Preparation of Viral Stocks
Confluent monolayers of BSC40 cells, on 100 mm dishes, were
infected with the appropriate virus at a low multiplicity of infection
(moi) (between 0.01 and 0.1 plaque forming units per cell) and


incubated at either 37oC (wild-type) or 31C (mutants) until the
cytopathic effect was complete. Cells were scraped from the dishes
into the media and pelleted by centrifugation at 400 x g for 5
minutes at 4C. The cell pellets were resuspended in 0.1-1.0 ml of
PBSAM/lxlO? infected cells, frozen and thawed 3 times and stored
at -70oC.
Transient Dominant Selection
Transient dominant selection was performed essentially as
described by Falkner and Moss (33). CV1 cells on 60 mm dishes
were pretreated overnight in CV1 media containing MPA, (15 ug/ml
hypoxanthine, 250 ug/ml xanthine, 25 ug/ml mycophenolic acid,
Sigma) infected with wild-type vaccinia virus (moi of 0.05 plaque
forming units per cell), transfected with 20 ug of plasmid DNA using
Transfectase (Life Technologies) according to the manufacturers
instructions, and incubated at 37C for three days. Infected,
transfected cells were harvested by scraping from the dish into the
media, pelleted by centrifugation at 400 x g for five minutes,
resuspended in 1 ml of PBSAM, frozen and thawed three times and
stored at -70<>C. The samples were plaque titrated on CV1 cells in the


presence of MPA for 3 to 5 days. The plaque titrations were done
essentially as described above except that CV1 cells and media were
used and 0.5% Sekem HGT agarose was used in place of 1% Noble
agar.
For the G2R mutant screen, 10 individual MPA resistant
plaques from each transfection were picked and plaque titrated on
BSC40 cells in the presence and absence of 45 pM IBT at 31<>C and
40C. To determine their phenotypes, individual IBT resistant
plaques were picked, then re-plaqued in the presence and absence of
IBT at 31C and 40C. Individual G2R mutant viruses were then re
plaque purified, and viral stocks were grown as described above. For
the DIR mutant screen, five individual MPA resistant plaques from
each transfection were plaque titrated on BSC40 cells at 31C. Fifty
individual plaques, ten from each original MPA resistant plaque,
were picked, then re-plaqued at 31C and 40C. Individual plaques
from dishes showing either heterogeneity in plaque size or reduced
plaque size in comparison to wild-type were re-plaque purified at
31C, and viral stocks prepared as previously described.


77
One Step Growth Experiments
Confluent monolayers of BSC40 cells on 60 mm dishes were
infected at 31C or 40C with the indicated virus at an moi of 6. At
various times post infection, infected cells were scraped from the
dishes into the media and frozen and thawed 3 times. Viral yields
were determined by plaque titration on BSC40 cells at 31C. The
data is expressed as the number of plaque forming units produced
per infected cell (pfu/cell).
Marker Rescues
Confluent monolayers of BSC40 cells on 60 mm dishes were
infected with the mutant virus indicated in the figure, incubated at
31C for four hours, transfected with 20 ug/ml of the appropriate
DNA in HBS (125 mM CaCl2, 150 mM NaCl, 0.7 mM Na2HP04, 5 mM
KC1, 20 mM N-[2-hydroxyethyl] piperazine-N-[2-ethanesulfonic acid]
(HEPES), 6 mM Dextrose) and shifted to 40C for three days. The cells
were stained with crystal violet as previously described. The DNA
constructs used in the marker rescue experiments are described in
the figure legends.


78
Purification of Vaccinia Virus Virions
5x108 BSC40 cells, on 10-150 mm dishes, were infected at an
moi of between 0.01 and 0.1 and incubated at either 37<>C (wild-
type) or 31C (E793) until complete cytopathic effect was observed.
Cells were scraped from the dishes into the media, pelleted by
centrifugation at 400 x g for 10 minutes, washed with 20 ml of PBS
(170 mM NaCl, 3.4 mM KC1, 10 mM Na2HP04, 1.8 mM K2HP04 [pH
7.2]) and resuspended in 20 ml of 10 mM Tris-HCl [pH 7.5], 5 mM
MgCl2. The cells were lysed by dounce homogenization and the
nuclei were removed by pelleting at 400 x g. After sonication of the
supernatant fraction, the virus within the sample was pelleted
through a 36% w/v sucrose, 10 mM Tris-HCl [pH 7.5] cushion by
centrifugation at 13,500 rpm in an SW28 rotor (Beckman) at 4<>C for
40 minutes. Viral pellets were resuspended in 6 ml of 10 mM Tris-
HCL [pH 7.5], resonicated and spun through a 25%-40% w/v sucrose,
10 mM Tris-HCl [pH 7.5] gradient at 13,500 rpm in an SW28 rotor at
4C for 40 minutes. Viral bands were collected, diluted with 2
volumes of 10 mM Tris-HCl [pH 7.5] and pelleted at 15,000 rpm in an
SW28 rotor at 4C for 60 minutes. The pellet was resuspended in 4


79
ml of 10 mM Tris-HCl [pH 7.5]. The purified virus was quantitated
by Bradford assay using a Biorad protein assay kit, according to the
manufacturers instructions, and absorbance measurements at 260
nm (1 OD260 = 64 ug virus). The infectivity of the purified virus was
assayed by plaque titration on BSC40 cells at 31C. There was no
significant difference in either the quantity or infectivity of the E516
or E793 virus preparations compared to wild-type preparations.
In Vivo Protein Pulse Labeling of Infected Cells
Confluent monolayers of BSC40 cells on 35 mm dishes were
infected at an moi of 15 with the indicated virus at 31C or 40C.
After a 30 minute absorption the inoculum was removed, 2 ml of
medium prewarmed to the appropriate temperature was added to
each dish, and the incubations were continued. At various times
after infection the media was removed and the infected cells were
washed three times with 2 ml of prewarmed PBS. Proteins within
the infected cells were pulse labeled for 15 minutes with 10 uCi of
Trans[35S]-label (1,153 Ci/mmol, ICN Biochemical) in 0.5 ml of
prewarmed PBS. The label was removed and the cells were lysed in


80
0.3 ml of Laemmli sample buffer (60), scraped from the dishes,
boiled and frozen at -20C.
Viral DNA Accumulation in Infected Cells
Confluent monolayers of BSC40 cells on 60 mm dishes were
infected at a moi of 15 with either wild-type or E793 virus and
incubated at 31C or 40C. At 2 hour intervals after infection, the
cells were washed with 1 ml of PBS, scraped from the dishes into 1
ml of PBS, and pelleted by centrifugation at 400 x g for 10 minutes.
The cells were resuspended in 0.3 ml of 10X SSC containing 1 M
ammonium acetate. Samples were frozen and thawed three times
and diluted with 1.2 ml of 10X SSC. 100 ul of each diluted sample
was denatured by the addition of 2.5 ul of 10 N NaOH and 10 ul of 5
M NaCl (final concentration 0.25 N NaOH, 0.5 M NaCl) for 10 minutes
at room temperature. After denaturation 1 ul was removed, diluted
1:100 in 0.1X SSC, 0.125 N NaOH and applied to a GeneScreen
membrane (New England Nuclear), using a Schleicher and Schuell slot
blotting apparatus according to manufacturers instructions. DNA was
fixed to the membrane by irradiation at 254 nm in a Stratalinker
(Stratagene) for 1 minute. The membrane was prehybridized in 10


ml of prehybridization buffer (100 mg/ml dextran sulfate (MW
50,000), 1% SDS, 1.45 M NaCL) at 65C for 4 hours. Hybridizations
were done overnight at 65C, by the addition to the prehybridizing
membrane of 1 ml of probe mix. Nonspecifically bound radioactivity
was removed by washing the membrane twice for 5 minutes in 2X
SSC at room temperature and once for 30 minutes at 60<>C in 2X SSC,
1% SDS. Radioactivity bound to the membrane was quantitated with
an Image Quant phosphorimager according to the manufacturers
instructions.
Preparation of probe mix. 1x107 cpm/ml of radiolabeled wild-
type vaccinia virus DNA was added to 1 ml of a 1 mg/ml solution of
salmon sperm DNA, boiled for five minutes, cooled on ice for 15
minutes and used immediately.
Preparation of randomly labeled vaccinia virus DNA. Wild-
type vaccinia DNA was digested with Hindlll and radiolabeled with
[a32P] dCTP (3000Ci/mmol, Amersham) by oligo-labeling according
to the method of Feinberg and Vogelstein (35). Unincorporated
nucleotides were removed by column chromatography through
Sephadex G50 as described (100). Incorporated radioactivity was
determined by precipitation of a 1 ul aliquot of the probe reaction


82
onto filter paper (Whatman) with trichloroacetic acid followed by
liquid scintillation counting, as previously described (100).
Preparation of RNA From Infected Cells
Confluent monolayers of BSC40 cells on 100 mm dishes were
infected at an moi of 15 with wild-type or E793 virus and incubated
at either 31<>C or 40C. At various times the cells were washed once
with cold PBS, lysed in 1 ml of GT buffer (4M guanidinium
isothiocyanate, 0.1 M Tris-HCl [pH 7.5], 0.5% Sarkosyl, 0.1 M 2-
mercaptoethanol), and scraped from the dishes. Samples were
pelleted through a CsCl (5.7 M CsCl, 0.01 M
ethylenediaminetetraacetic acid (EDTA) [pH 7.5]) cushion for
approximately 24 hours at 18C in a SW-55 Ti rotor (Beckman) at
35,000 rpm. The RNA pellet was dissolved in distilled water,
precipitated with two volumes of ethanol and resuspended in
distilled water. The RNA was quantitated by absorbance at 260 nm
(1 OD26o = 40 ug/ml of RNA) (100).


83
Electron Microscopy of Infected Cells
Confluent monolayers of BSC40 cells on 60 mm dishes were
infected with either wild-type or E793 at an moi of 10 at 31C or
40oC. At 24 hours post infection, cells were washed with 1 ml of PBS,
scraped from the dish into 1 ml of PBS and pelleted by centrifugation
at 400 x g. The cell pellet was resuspended in 1 ml of 2%
glutaraldehyde in PBS, fixed overnight at room temperature,
repelleted by centrifugation at 400 x g and post-fixed in an aqueous
solution of 1% OSO4 for 1 hour. The cells were repelleted at 400 x g,
rinsed in distilled water, stained in 1% aqueous uranyl acetate for 30
minutes, rinsed again in distilled water and dehydrated in 25%, 50%,
75% and 100% ethanol for 10 minutes each. After dehydration the
cells were washed twice for 15 minutes in 100% acetone then
embedded in Spurrs epon resin which was then polymerized for 2
days at 60C. After thin sectioning the samples were mounted and
viewed with a Hitachi H7000 transmission electron microscope.


84
Southern Analysis of Concatameric and Monomeric Vaccinia DNA
Isolated From Infected Cells
Confluent monolayers of BSC40 cells on 60 mm dishes were
infected with either wild-type, Cts53 or E793 virus at an moi of 10 at
31C or 40C. At 6 and 24 hours post infection the cells were scraped
from the dish into the media, pelleted by centrifugation for 10
minutes at 400 x g, washed once with PBS and resuspended in 50 ul
of 0.15 M NaCl, 0.02 M Tris-HCl [pH 8.0], 0.01 M EDTA. The 50 ul
samples were added to 250 ul of 0.02 M Tris-HCl [pH 8.0], 0.01 M
EDTA, 0.75% SDS containing 0.8 mg/ml proteinase K (Boehringer
Mannheim) and incubated at 37C for 6 hours. The samples were
passed through a 25 gauge needle 5 times, extracted twice with
phenol chloroform (1:1) and twice with chloroform before
precipitation with 0.1 volume of 3 M sodium acetate and 2 volumes
of ethanol at room temperature for 30 minutes. The precipitate was
pelleted by centrifugation in a microfuge at 12,000 rpm for 15
minutes, washed with 1 ml of 70% ethanol air dried, resuspended in
50 ul of TE (10 mM Tris-HCl [pH 8.0] 1 mM EDTA) and quantitated by
measurement of absorbance at 260 nM. 1.5 micrograms of total


85
nucleic acid was digested with 20 units of BstEII (New England
Biolabs) overnight at 60<>C and separated on a 1.5% agarose gel in
TAE buffer (0.04 M Tris-HCL [pH 8.0], 0.001 M EDTA). Southern
alkaline transfer of the DNA onto a GeneScreen membrane was done
according to a protocol provided by the manufacturer. The DNA was
fixed to the membrane by uv irradiation at 254 nm in a Stratalinker
for 1 minute. The membrane was prehybridized in 7 ml of
prehybridization buffer (100 mg/ml dextran sulfate (MW 50,000),
1% SDS, 1.45 M NaCL) at 65C for 4 hours. Hybridization was done
overnight at 65C, by the addition to the prehybridizing membrane
of 1 ml of pBD probe mix. Nonspecifically bound radioactivity was
removed by washing the membrane twice for 5 minutes in 2X SSC at
room temperature and once for 30 minutes at 60<>C in 2X SSC, 1% SDS.
Radioactivity bound to the membrane was quantitated with an
Image Quant Phosphorimager according to the manufacturers
instructions. The resolution efficiency was calculated by determining
the ratio of the intensity of the 1.3 kb resolved telomere band to the
intensity of the 2.6 kb concatamer junction band.
Preparation of pBD probe mix Approximately 1x108 cpm of
radiolabeled pBD plasmid DNA was added to 1 ml of a 1 mg/ml


86
solution of salmon sperm DNA, boiled for five minutes, cooled on ice
for 15 minutes and added to the prehybridizing membrane
immediately.
The construction of plasmid pBD, which contains a 2.6 kilobase
BstEII-BstEII vaccinia virus concatamer junction insert was a gift
from M. Merchlinsky and has been previously described (73).
Briefly, the 2.6 kb vaccinia virus insert within plasmid pBD consists
of a double-stranded copy of the terminal hairpin loop (208 base
pairs) which is the concatamer junction and 2.4 kilobases of inverted
terminal repeat sequences. Plasmid pBD was radiolabeled with
[a32p] dCTP (3000 Ci/mmol, Amersham) by oligo-labeling according
to the method of Feinberg and Vogelstein (35). Unincorporated
nucleotides were removed by column chromatography through
Sephadex G50 as described (100). Incorporated radioactivity was
determined by precipitation of a 1 ul aliquot of the probe reaction
onto filter paper (Whatman) with trichloroacetic acid followed by
liquid scintillation counting, as previously described (100).


CHAPTER 3
TESTING CLUSTERED CHARGE TO ALANINE MUTAGENESIS AND
TRANSIENT DOMINANT SELECTION ON THE VACCINIA VIRUS GENE
G2R
Introduction
Traditional approaches to viral genetics, which involve random
mutagenesis of the virus followed by screening for phenotypes of
interest, have proven to be quite useful in the genetic and
biochemical characterization of vaccinia virus (reviewed in 5).
Random mutagenesis methods, however, are limited by their
inability to target specific open reading frames and by the laborious
screening methods required to identify mutants of interest. It is for
these reasons that a more direct approach for the creation of
temperature-sensitive virus mutants, in specific viral genes, must be
found. Practical application of directed genetics to a complex DNA
virus such as vaccinia, requires an in vitro mutagenesis scheme
which produces a high proportion of conditionally lethal mutants
87


88
combined with an efficient method for targeted replacement of the
wild-type viral gene with the mutant allele. The object of this work
was to determine if clustered charge to alanine mutagenesis and
transient dominant selection could be used as a practical method for
the creation of conditionally lethal temperature-sensitive vaccinia
virus mutants.
Clustered charge to alanine mutagenesis involves replacing
clusters of charged amino acids in a protein with alanines. Charged
residues which are clustered in the primary sequence of a
polypeptide often cannot be efficiently accommodated in the
hydrophobic core of the protein, therefore they are most likely to be
found on the surface of the folded protein (7). The replacement of
multiple charged residues with alanines has been shown to disrupt
protein-protein interactions in vitro, while not severely altering
protein secondary structure (7, 19). When this approach was applied
to the Saccharomyces cerevisiae actin (ACT1) gene, of 34 mutations
constructed, 44% had a temperature-sensitive phenotype in vivo
(130). Likewise, clustered charge to alanine mutagenesis of the
poliovirus 3D polymerase resulted in a high proportion (37% of 27


89
mutants) of temperature-sensitive mutants (25). Thus alterations of
a protein's surface charge may disrupt tertiary or quaternary
interactions and result in temperature sensitivity in vivo.
Vaccinia has proven to be an excellent model system for
studying transcription, DNA replication, and the regulation of gene
expression (78). The genome of vaccinia consists of approximately
192 kilobases of double-stranded DNA with covalently closed ends.
The poxviruses are unique among DNA viruses in that they replicate
in the cytoplasm of infected cells (78). Thus the virus encodes
virtually all of the enzymes required for viral RNA and DNA
metabolism. Numerous enzymatic activities common to other
eukaryotic organisms have been shown to be encoded by the virus
(41, 78). Genetic analysis of vaccinia has provided many of the tools
necessary for understanding the viral life cycle. Previous genetic
studies in the Condit laboratory led to the isolation of conditionally
lethal temperature-sensitive mutations in 30 separate vaccinia virus
complementation groups (13). These mutants have proven valuable
for studying all aspects of viral replication. However, vaccinia codes
for approximately 150 essential genes, therefore this collection


90
represents mutations in only 20% of the essential virus genes (41). A
directed genetic method that produces conditionally lethal
temperature-sensitive mutations in specific genes would allow one to
genetically study many of the viral genes in which there are no
conditionally lethal mutants.
Results
To evaluate the potential of clustered charge to alanine
mutagenesis as a means of creating conditionally lethal vaccinia
viruses, a series of nine clustered charge to alanine mutations were
created in the G2R gene (Fig. 7). G2R was chosen for the test because
mutations in this gene confer easily selectable phenotypes (70), thus
circumventing the necessity for screening large numbers of
individual plaque isolates to determine the phenotype conferred by a
particular mutation. The selection is based on the sensitivity of the
virus to the anti-poxviral drug isatin-B-thiosemicarbazone (IBT). As
shown in Fig. 8, plaque formation by wild-type vaccinia virus is
inhibited by IBT, deletion mutants in G2R such as G2A are dependent


Fig. 7. Deduced amino acid sequence of the vaccinia virus G2R gene product and G2R
mutants. Charged residues are indicated by boldface type. Large boldface type denotes charged
residues mutated to alanine in a given mutant. The amino acid changes corresponding to Cts56 (G151R),
and G2A (a 10 bp deletion/frameshift starting at residue 90) are designated above the appropriate
residues. AS2 and AS9 mutations are indicated by lines above and below the amino acid sequence
respectively, wt = wild type; ts = temperature sensitive; tdr = temperature dependent IBT resistance; d
= IBT dependent; indicates the termination of G2R in mutant G2A.


Full Text
TARGETED IN VITRO CONSTRUCTION OF CONDITIONAL LETHAL
VACCINIA VIRUS MUTANTS
By
DANIEL E. HASSETT
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE
UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE
REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1995

This work is dedicated to my parents, Alan and Noel and Miss
Loretta.

ACKNOWLEDGMENTS
I wish to offer my sincere thanks and gratitude to Rich Condit
whose friendship, support and unending patience has made my
graduate career a very enjoyable experience.
I thank all of my labmates in the Condit and Moyer labs for
their interest in my work, suggestions and friendship. Thanks go to
Ms. Jackie Lewis for her help in cloning and sequencing some of the
DIR mutants. Special thanks go to Ms. Joyce Conners for her helpful
advice and friendship over the last five years.
I would like to thank my family for their love and support
especially my parents, they deserve much of the credit for making
me the person I am today. I would like to thank the Donald who
helped to make Florida my home. I would also like to thank Elinor
and Bruce Cuvilier who helped me at a time in my life when I was
unable to help myself, their belief in me meant more to me than
either of them will ever know. Lastly I would like to offer my
thanks to N. Loretta Sukhu for her love, patience and perseverance.
iii

TABLE OF CONTENTS
ACKNOWLEDGEMENTS üi
ABSTRACT vi
CHAPTERS
1 INTRODUCTION AND BACKROUND 1
Genome and Genomic Organization 6
Viral Life Cycle 9
Viral Genetics 33
Clustered Charge to Alanine Mutagenesis 37
Transient Dominant Selection 42
Capping of mRNA and the Vaccinia mRNA Capping
Enzyme 50
2 MATERIALS AND METHODS 60
Recombinant DNA Techniques 60
Virological Techniques 72
3 TESTING CLUSTERED CHARGE TO ALANINE MUTAGENESIS
AND TRANSIENT DOMINANT SELECTION ON
THE VACCINIA VIRUS GENE G2R 87
Introduction 87
Results 90
Discussion 109

4 CONSTRUCTION AND CHARACTERIZATION OF A NOVEL
CONDITIONAL LETHAL MUTANT IN THE LARGE SUBUNIT
OF THE VACCINIA VIRUS mRNA CAPPING ENZYME 112
Introduction 112
Results 118
Discussion 167
5 SUMMARY 182
Clustered Charge to Alanine Mutagenesis 183
Transient Dominant Selection 188
Future Experiments with E793 190
LIST OF REFERENCES 195
BIOGRAPHICAL SKETCH 212
v

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
TARGETED IN VITRO CONSTRUCTION OF CONDITIONAL
LETHAL VACCINIA VIRUS MUTANTS
By
Daniel E. Hassett
December, 1995
Chairperson: Richard C. Condit Ph.D.
Major Department: Molecular Genetics and Microbiology
The goal of this study has been to develop a general directed
genetic method for the creation of site-specific, conditionally lethal,
temperature-sensitive vaccinia virus mutants. The techniques of
clustered charge to alanine mutagenesis and transient dominant
selection were tested as a mutagenesis strategy and as a means of
targeted gene replacement, respectively. The efficiency of clustered
charge to alanine mutagenesis and transient dominant selection were
vi

initially assessed by the creation of nine novel alleles of the vaccinia
virus G2R gene because a simple drug selection can be used to select
for mutations that alter the function of G2R. Three of the G2R
mutants were conditionally lethal as measured by one step growth
experiments. These data indicate that 33% of the clustered charge to
alanine alleles were conditionally lethal in vivo. The experiments
with G2R also revealed that on average 11% of the viral progeny
isolated during the transient dominant selection contained the
clustered charge to alanine mutation.
To demonstrate the generality of the method, nine clustered
charge to alanine mutations were created in the large subunit of the
heterodimeric vaccinia virus capping enzyme, gene DIR. In addition
to catalyzing the formation of a cap 0 structure on newly synthesized
mRNA, the vaccinia capping enzyme has been shown to be an early
gene transcription termination factor and an intermediate gene
transcription initiation factor. One of the nine mutations created in
DIR was temperature-sensitive for growth as measured by one-step
growth experiments. In vivo characterization of the conditional
lethal DIR allele revealed that protein, DNA and mRNA synthesis
appear relatively normal at the nonpermissive temperature. The
Vll

mutant is, however, defective in the resolution of viral telomeres and
blocked at an early stage of viral assembly. Methyltransferase
assays on purified virions revealed that the mutant capping enzyme
protein is thermolabile for methyltransferase activity in vitro.
The results with the vaccinia virus genes G2R and DIR
demonstrate that clustered charge to alanine mutagenesis and
transient dominant selection can be used as a general directed
genetic method for the creation of conditionally lethal, temperature-
sensitive vaccinia virus mutants.
Vlll

CHAPTER 1
INTRODUCTION AND BACKGROUND
The science of modern molecular biology has relied heavily on
genetics to gain insight into the molecular mechanisms of living
systems. Many of the fundamental biochemical mechanisms used by
living systems have been initially uncovered and understood through
the genetic analysis of eukaryotic viruses. The small genome size
and quick replicative cycle of viruses have made them attractive
model systems with which to study the processes of DNA and RNA
replication, transcription, translation and post translational protein
processing. The genetic analysis of the orthopoxvirus vaccinia has
been at the forefront of many of these investigations.
Orthopoxviruses, whose prototypic member is vaccinia, are
characterized by their large (192-300 kb) double-stranded DNA
genome, cytoplasmic site of replication and packaging within their
virions of all the enzymes necessary for early gene transcription
1

2
(reviewed in 78). Medical interest in vaccinia began because of the
virus’ ability to provide protective immunity against variola virus,
the causative agent of smallpox. Although the global eradication of
smallpox was completed in 1979, largely due to the use of vaccinia as
a live virus vaccine, medical interest continues because of vaccinia’s
potential use as a recombinant live virus vaccine vector (30, 36, 42,
88). The ability to genetically manipulate vaccinia and the capability
of the virus to express foreign genes when placed under the control
of appropriate viral regulatory signals are essential aspects of
recombinant vaccinia vaccine design. Therefore successful vaccine
design requires detailed knowledge of the general biology of the
poxvirus replication cycle. The basic biology of vaccinia is also of
interest, primarily due to the cytoplasmic site of viral replication. To
replicate within the cytoplasm vaccinia must encode most if not all of
the genetic information necessary for DNA replication, transcription
and controlled gene expression (78). The cytoplasmic site of
replication, packaging of viral enzymes within the viral particle and
the ease with which the viral genome may be genetically
manipulated has made vaccinia an excellent model system with
which to study many aspects of eukaryotic biology.

3
Most of the genetic analysis of vaccinia virus has focused on
the isolation and characterization of randomly generated viral
mutants (reviewed in 15). The characterization of these mutants has
proven quite useful in deciphering the general mechanisms involved
in the control of eukaryotic gene expression, DNA replication and
mRNA processing. However, the applicability of vaccinia virus
genetics has been limited by 1) the inability to target specific viral
genes for mutagenesis and 2) the laborious screening procedures
necessary for the isolation of viral mutants.
The purpose of this dissertation is to develop a directed genetic
method for the creation of conditionally lethal temperature-sensitive
mutations in specific vaccinia virus genes. Directed genetics of
vaccinia virus involves the in vitro mutagenesis of cloned copies of
viral genes followed by recombination-mediated gene replacement,
to transfer these mutations onto the viral chromosome. Two
problems must be addressed in order to successfully apply directed
genetics to vaccinia virus: 1) the in vitro mutagenesis scheme must
produce a high proportion of conditional lethal mutants in vivo; 2)
the mutant alleles must be efficiently recombined back onto the viral
chromosome. Clustered charge to alanine mutagenesis and transient

4
dominant selection were tested as a means of making site-specific
mutations in vitro that are temperature-sensitive in vivo and as a
strategy for targeted gene replacement, respectively. The mutation
of charged amino acids (Asp, Glu, His, Lys, Arg), closely spaced within
the primary sequence of a polypeptide, to alanines has been shown
to produce a high proportion of temperature-sensitive mutants when
these mutations are assayed in vivo (25, 130). Recombination
mediated gene replacement involving the dominant selectable
marker xanthine-guanine phosphoribosyltransferase from
Escherichia coli (ecogpt) was then used to transplace the wild type
chromosomal copy of the gene of interest with a clustered charge to
alanine mutant copy (32).
Clustered charge to alanine mutagenesis and transient
dominant selection were tested by creating mutations in the vaccinia
virus genes G2R and DIR. The efficiency of the vaccinia virus
directed genetic method was initially assessed by creating mutations
in G2R, because mutations in G2R produce viruses with selectable
phenotypes (70). The ability to select rather than to screen for
viruses containing clustered charge to alanine mutations which
altered G2R function made it possible to easily determine the

5
phenotypes of individual mutations. As a result of transient
dominant selection, individual plaques are produced which contain a
heterogeneous population of wild type and mutant viruses. The
selectability of the G2R mutants also made it possible to determine
what percentage of viruses within this heterogenous population
contain the mutation of interest. The general applicability of the
directed genetic method was assessed by creating mutations in DIR,
which encodes the large subunit of the heterodimeric vaccinia mRNA
capping enzyme. The vaccinia virus mRNA capping enzyme is
encoded by genes DIR (large subunit) and D12L (small subunit) (77,
86). In addition to its role in mRNA 5’ end formation, the capping
enzyme also catalyzes the termination of early gene transcription
and the initiation of intermediate gene transcription (109, 114, 126).
The multifunctional nature of the capping enzyme and the lack of
temperature-sensitive mutations in the large subunit make the
capping enzyme an excellent target for directed genetics. In
addition, the in vivo analysis of a capping enzyme mutant would
provide more information about the role the mRNA capping enzyme
plays in vivo during the viral life cycle.

6
Genome and Genomic Organization
The vaccinia virus genome (Copenhagen strain) is a double-
stranded DNA molecule of 191,636 bp in length (41, 54). The ends of
the genome terminate in incompletely base-paired hairpin loops
which serve to covalently crosslink each strand of the DNA duplex
thereby generating a single contiguous polynucleotide chain.
Nucleotide sequencing of the hairpin termini indicate that they exist
in two isomeric forms, the sequences of which are inverted and
complementary with respect to each another (4). Adjacent to each
hairpin termini are 12 kb inverted terminal repeat sequences that
contain within them numerous smaller direct repeat elements (41).
Computer assisted sequence analysis of the viral genome
suggests a coding capacity of 198 intronless genes (41). By
convention open reading frames are designated by their relative
position with respect to Hindlll restriction sites. (65, 99). Digestion
of the vaccinia virus chromosome with Hindlll produces 16
fragments ranging in size form 49 kb (A fragment) to 273 bp (P
fragment) (41) (Fig. 1).

Fig. 1. Structure of the vaccinia virus genome. The relative position of the centrally
conserved core and the nonessential left and right hand ends of the viral genome. Below is a
vaccinia Hindlll restriction map indicating the relative size and position of each Hindlll fragment.
(?) relative map positions of 20 of the temperature sensitive mutants in the Condit collection. The
Hindlll fragments which contain the vaccinia virus genes G2R and DIR are indicated by G2R and
DIR, respectively.

nonessential left end conserved core region nonessential right end
S, , , v, j
3
??? ??$$?? fe?
2
C Nh
IK F
E 0
G2R
1 G
L J H
D1R
D
A
B
oo

9
The vaccinia virus genome can also be functionally divided into
three regions, a central core containing genes required for replication
in tissue culture flanked on either side by two regions which contain
genes nonessential for tissue culture replication. The central core,
which extends from the HindIII E fragment through the left hand
two thirds of the HindIII A fragment contains approximately 100
genes (41). The genes within the central core are highly conserved
among other members of the orthopoxviridae and encode the
enzymatic activities necessary for the survival and reproduction of
the virus within the infected cell. In contrast the nonessential genes
encode proteins necessary for pathogenesis and spread within the
infected host organism (41).
Viral Life Cycle
The critical events in the life cycle of vaccinia virus which
include attachment and penetration of the infecting virion, early
intermediate and late gene expression, DNA replication, virion
morphogenesis and release are diagrammatically represented in Fig.
2 (reviewed in 78). Attachment to and penetration of the host cell
are poorly understood processes primarily due to a lack of any

Fig. 2. The life cycle of vaccinia virus. A generalized scheme for vaccinia replication is
shown. IMV-intracellular membranated virus, IEV-intracellular enveloped virus,
EEV-extracellular enveloped virus, VITF vaccinia-intermediate transcription factors, VLTF-
vaccinia late transcription factors, VETF-vaccinia early transcription factors.

IMV
j lateral body
EEV
membrane

1 2
definitive information about the identity of the cellular or viral
receptors involved. Following attachment and penetration, the
infecting virus reaches the cytoplasm which is the site of all
subsequent viral transcription and replication. Almost immediately
after penetration there is a partial uncoating of the virion (uncoating
I) that serves to facilitate the onset early viral transcription.
Early Transcription
The transcription of early genes is directed by an RNA
polymerase, an early transcription factor and an early gene specific
RNA polymerase associated protein packaged within the virion (79).
One-half of the viral genome is transcribed during the early phase of
the infection (78). Early genes encode proteins such as the core RNA
polymerase subunits, viral mRNA capping enzyme and polyA
polymerase as well as enzymes involved in DNA replication and
nucleic acid biosynthesis (78).
The DNA dependant RNA polymerase activity isolated from
virion particles contains at least 8 subunits and has a molecular mass
in excess of 450 kDa (78). This core RNA polymerase contains all of
the catalytic activities necessary for RNA polymerization from single

stranded DNA, but it lacks initiation specificity and the ability to
transcribe a double-stranded DNA template (reviewed in 79).
Recently two distinct populations of RNA polymerase activity
have been observed within purified virions. These polymerase
populations differ in their association with a 94 kDa protein termed
Rap94 for RJ4A polymerase associated protein of 94 kDa. Rap94 is
encoded by the H4 gene of vaccinia virus (1, 55). Rap94 confers
early promoter specificity on the core RNA polymerase. Although
essential for early gene transcription, Rap94 is not required for the
transactivation of late gene transcription in vitro (132).
Specific transcription of a double-stranded DNA template
containing an early promoter can be conferred on the core RNA
polymerase-Rap94 complex by the addition of a heterodimeric
protein referred to as vaccinia parly transcription factor (vETF)
(reviewed in 79). vETF is composed of an 82 kDa protein (the
product of the A7L gene) containing leucine zipper and zinc finger
motifs and a 70 kDa protein (the product of the D6R gene) which
contains motifs associated with helicases and ATPases (8, 40).
Purified vETF has been shown to be a sequence specific DNA binding
protein as well as a DNA dependant ATPase (9). vETF recognizes cis

1 4
acting sequences contained within early viral promoters, since point
mutations in a consensus early promoter which abrogated vETF DNA
binding abolished early transcription activity (134). VETF has also
been shown to bend DNA around the region of the transcriptional
start site (8).
The Rap 94-containing core polymerase and vETF within the
infecting virion are sufficient for the transcription of early genes
(79). These early mRNAs are terminated, capped and polyadenylated
by virally encoded enzymes also contained within the virion (79).
Early Transcription Termination
The vaccinia virus mRNA capping enzyme catalyzes the
termination of early gene transcription in response to the cis acting
sequence UUUUUNU in the nascent mRNA (114). Early transcription
termination occurs 70 to 75 nucleotides downstream of a TTTTTNT
element in the sense DNA strand (96, 135). Both mRNA capping
enzyme subunits are required for early transcription termination
activity; however, neither functional guanyltransferase nor (guanine-
7)methyltransferase active sites are necessary for termination (63).
A model for early transcription termination has been described that

calls for the capping enzyme to bind to mRNA as it is extruded from
the back of the elongating polymerase (63). Upon encountering the
UUUUUNU signal the capping enzyme catalyzes the termination of
transcription via protein-protein contacts with the elongation
complex. Consistent with this data is the observation that the large
subunit of the capping enzyme is capable of binding RNA. Although
the RNA binding of the DIR protein is nonspecific, RNA binding can
be preferentially competed with poly U, indicating that this RNA
binding domain may be involved in recognition of the UUUUUNU
sequence in vivo (64). The domain responsible for the interaction of
the capping enzyme with the early transcription elongation complex
is presently unknown.
Following termination early transcripts, which have been
capped and polyadenylated, are extruded from the viral core into the
cytoplasm (78). The accumulation of early gene products which
encode transcription factors specific for intermediate gene
transcription and the onset of viral DNA replication lead to the
second transcriptional stage of the viral life cycle the transactivation
of intermediate genes.

Intermediate Transcription
The transcription of intermediate and late vaccinia genes
occurs after the onset of DNA replication (79). The two classes of
post replicative genes can be distinguished by their relative
transcriptional activity in the presence inhibitors of DNA synthesis.
Intermediate genes are defined as those post replicative genes
capable of being expressed from plasmids transfected into infected
cells that have been treated with a DNA synthesis inhibitor (127).
Therefore all of the trans-acting factors necessary for intermediate
gene transcription are present in the infected cells prior to DNA
replication (79). Five intermediate genes have been identified to
date, three of which function as late transcription factors (56, 127).
Transcription from intermediate promoters requires the core
RNA polymerase complex, rpo 30 (gene E4L), an undefined cellular
factor or factors termed VITF-2 or vaccinia intermediate
transcription factor 2 and the vaccinia mRNA capping enzyme, (97,
98, 126). The capping enzyme forms a stable complex with the core
RNA polymerase and complex formation is required for binding of
the polymerase at the intermediate promoter (126). Therefore the

participation of vaccinia capping enzyme in intermediate
transcription initiation is at a level other than that of mRNA capping
(44). The mRNA capping enzyme domain necessary for the
transactivation of intermediate transcription is unknown.
Late Transcription
With continuing DNA synthesis and the buildup of intermediate
proteins, some of which encode late transcription factors, the last
transcriptional phase of the viral life cycle begins. Late genes encode
structural proteins of the viral particle, the early transcriptional
machinery packaged within the developing virion and enzymes
involved in morphogenesis (78).
A genetic approach has been used to identify some of the
intermediate gene products required for late gene expression.
Intermediate and late transcription is blocked in the presence of DNA
synthesis inhibitors (127). However, intermediate promoters are
utilized if they are contained on plasmids transfected into the
inhibitor treated infected cells (127). Late transcription factors,
encoded by intermediate genes, were identified by transfecting
cloned vaccinia genes into DNA synthesis inhibitor treated cells and

assaying for transcription of a late promoter containing reporter gene
construct (133). This methodology identified three intermediate
genes, AIL, A2L and G8R that function as late transcription factors
(56). The exact role each of these proteins plays in the transcription
of late genes is unknown. Recently a factor identified as P3 has been
shown to also be required for high level in vitro transcription of a
late promoter containing reporter construct. The P3 late
transcription factor activity is present in infected cells prior to the
onset of DNA replication; it is, however, not detected in uninfected
cells. It remains to be determined if P3 is a cellular factor activated
by the infection or is virally encoded (58).
Structure of Intermediate and Late Transcripts
Two distinguishing features of intermediate and late mRNA
transcripts are the presence of nontemplated polyadenylate residues
at their 5’ ends and the lack of discrete 3’ ends (79). The
nontemplated adenylate residues at the 5’ end of capped
intermediate and late mRNAs are thought to arise via a slippage
mechanism by the RNA polymerase (79). The average length of the
polyA head is between 35 to 50 nucleotides (79). Interestingly, in

1 9
the absence of a poly A head, the translational start site of most
intermediate and late mRNAs would be coterminal with the 5’ end.
Therefore the poly A head may function in a manner analogous to a 5’
untranslated region, increasing the efficiency of translation initiation
by facilitating the binding of either translation initiation factors or
the 40s ribosomal subunit (79).
Transcripts derived from individual intermediate and late
genes are heterogeneous in length at their 3’ ends due to a lack of
discrete sites of transcription termination. The termination of
intermediate and late transcription appears to occur randomly,
generating a population of mRNA molecules of different lengths. This
heterogeneity in size can be detected as a smear upon northern
analysis of individual intermediate or late viral mRNAs.
DNA Replication
Orthopoxvirus DNA replication occurs in areas of the cytoplasm
known as virosomes or viral factories. Because replication of
vaccinia DNA can occur in enucleated cells, it assumed that all of the
replication machinery is virally encoded (92). Many of the viral
enzymes necessary for DNA replication have been identified; these

20
include a DNA polymerase, a nicking-joining enzyme, a DNA
topoisomerase, a dUTPase, and a DNA binding protein (reviewed in
78, 123).
Several previously mentioned structural features of the
vaccinia virus genome are shown in Fig. 3. The ends of the genome
consist of incompletely base paired hairpin termini which covalently
crosslink each strand of the genome (Fig. 3,1). The DNA sequences of
the hairpin ends are inverted and complementary isomers of each
other termed flip and flop or fast and slow based upon their relative
mobilities in nondenaturing agarose gels. On either side of the viral
chromosome, adjacent to the hairpin ends are located 12 kb inverted
terminal repeats (Fig. 3,2). Within these inverted terminal repeats
are numerous small tandemly arranged direct repeat elements. The
direct repeat sequences begin about 100 base pairs from the hairpin
ends and extend inward for approximately 3 kb into the inverted
terminal repeats (Fig. 3,3) (5).
The exact mechanism of poxvirus DNA replication is unknown;
however, the available data suggests that replication occurs in a
semiconservative fashion and begins with a site-specific nick within

Fig. 3. Structural elements of the vaccinia virus genome.
1) Nucleotide sequence of the maximum base paired structure of the
vaccinia virus hairpin ends flip (S) and flop (F). Below is the
nucleotide sequences of flip arranged 5’-3’ and flop arranged 3’-5’
demonstrating the inverted complementary nature of the hairpin
isomers. Adapted from Baroudy, B.M., S. Venkatesan and B. Moss
1983. Structure and replication of vaccinia virus telomeres.
Cold.Spring.Harbor.Symp.Quant.Biol. 47 Pt 2 :p 726.
2) Vaccinia genome showing the location of the 12 kb inverted
terminal repeats. 3) A single inverted terminal repeat
demonstrating the position of the direct repeats.

22
«• »0 to 10 ca
A-*-0-T-T-A-C-T-*-*-A-T-T-*-T-A-T.A-T-A-T-A-»-T-T-T-T-A-T-A-A-T-T-*-A-T-T-T-A-A-T-T-T-T-*YV-r-r-r-M-r-r-r-«-C-r-C-r-J‘
A-T C-A-A-T-C A-T-T-T-A-A T-AJ-A-T-A-T-A-T-T A-A-A-A-T A-T T-A-A-T-T-A A-A-l T-A-A-A-A-1 Af-4-4 -4-4-r-4-4-4-r-0-4-C-4 •$’
.. T V T V V 6 V V T-T
•• •• to oo oo ih
• • 40 •« >0 1»
A A A 0 C C AT A-A
r-A-o-M-A^k'A-A-T-f Vf Vt-a-t-a-t-a-áVt-t-t-a t-/( a t-t-a-a-/Vt a a-t-t-t-t-á T-4-r-r*r-r-4-r-r- r-4-c-r-CT-T
T-T-C-A-A-T-C-A-T-T-T-A-A-T-A-T-A-T-A T-A-T-T-A A-A-AT-A-T-T-A-A-T-T-A-A-A-T-T-A-A-A A-T A T-4-4-4-4 T-4-4-4-r-( -4-C-A-S'
• • TO 00 00 100
r '0 10 30 40 SO 00 70 00 90 1 00
S
r 100 00 00 70 00 SO 40 30 20 i0
* A!TT4AAArATAA7AITAA!G7ACIAAAACT!AtAT4ITA77AAniAlCIAACTAAAC1tA5TAAAIIAIATAlAtAAtinA1AA'>AAmAAIIIlACT4'
2.
CM
T"
20
Hairpin end
3.
12 kb inverted terminal repeats
i 1 1 1 1 1 1 r
40 60 80 100 120 1 40 160 180
kllobase pairs
K>
Hairpin end
qiMiiiiipm r
2 4
direct repeats
T
6
T
8
10

23
the inverted terminal repeat. The isolation of replicative
intermediates of rabbitpox virus and vaccinia which consist of
concatameric forms of genomic DNA arranged in a head to head or
tail to tail linear array (concatamers consisting of a left end of the
genome fused to a left end of another genome or a right end of the
genome fused to another right end) have lead to the formulation of a
model for DNA replication outlined in Fig. 4 (5, 82). In this model
DNA replication begins with a nick within the inverted terminal
repeats proximal to the hairpin termini. The nick generates a free 3’
hydroxyl capable of acting as a primer for DNA synthesis. Elongation
of the free 3’ end generates a replication intermediate that is slightly
longer than genome length (Fig. 4,2). The self complementarity of
opposing strands of the duplex allows the DNA strands to fold back
upon themselves forming hairpin ends (Fig. 4,3). One hairpin
contains a free 3’ hydroxyl and thus can act as a primer for the
duplication of the entire genome (Figs. 4,4 and 4,5). The resulting
molecule consists of two genomes arranged such that the right end of
one genome is fused to the right end of another genome (tail to tail)
with a nick at one end (Fig. 4,5). Continuation of this process yields a
tetrameric molecule consisting of genomes arranged head to head

Fig. 4. Self-priming model for vaccinia virus DNA
replication. Sequences of the inverted terminal repeats and their
complements are indicated by uppercase and lowercase letters
respectively. F and S denote flip and flop hairpin ends. Newly
replicated DNA is represented by dashed lines. Shown is a scheme
which replication is initiated by a nick at one end of the genome.
Adapted from Baroudy, B.M., S. Venkatesan and B. Moss 1983.
Structure and replication of vaccinia virus telomeres.
Cold.Spring.Harbor.Symp.Quant.Biol. 47 Pt 2:p 725,

25
o t f
O
ITT
me*
1 9 d
-TTT-
F E 0^
♦ O
^ ° f F
• rds
©
f i o
O'
d A B C O E F
0 « b e d • t
B ^
• ■ i
I i O â– 
b cc
A «r
• .5-V^r
r / * •
b'-c
C
I • d
FEO
* • d
f E O
O'
®
I • d
r n
F E 0
©
O E F
I . d "
' d
•
1
F
E
0 'â– 
. 0
E
F
1
•
d ,
d
•
1
F
E
0 ^
¡B

26
and tail to tail (not shown). Support of this model includes the
isolation of just such tetrameric replication intermediates (82).
Additional support of the model has been provided by temperature
shift experiments with replication deficient mutants which during
the initial phases of DNA replication incorporate radiolabeled DNA
precursors near the ends of the genome (94).
Telomere Resolution
The vaccinia replication scheme outlined in Fig. 4 leads to two
copies of the viral genome fused at a duplex copy of a hairpin loop
(Fig. 4,5). The duplicated form of the hairpin loop is called the
concatamer junction. The resolution of concatameric DNA into
genome length units, containing terminal hairpin ends (Fig. 4,6), a
process known as telomere resolution, has been described as a site-
specific recombination event that requires an as yet unidentified
transacting telomere resolvase and two identical inverted copies of a
cis element known as the telomere resolution target (reviewed in
23). Although the exact mechanism is unknown, during telomere
resolution a cruciform structure is formed by intrastrand base
pairing between flip and flop sequences within the concatamer

27
junction (21). Cruciform structures have been observed in electron
micrographs of concatamer junction containing plasmids (21). The
arms of the cruciform consist of flip and flop sequences and the base
forms a holiday structure. Site-specific nicking, strand exchange and
ligation then serve to reconstitute the terminal hairpin ends (73).
Circular plasmids containing a concatamer junction and
sorrounding flanking sequences will resolve, when transfected into
infected cells, into linear minichromosomes with covalently closed
hairpin ends (21, 73). This in vivo assay has been used to determine
the sequence requirements for telomere resolution (73). Optimal
resolution of circular plasmids into linear minichromosomes in vivo
requires two inverted copies of a 53 base pair sequence, flanking
inverted repeats capable of intrastrand base pairing. Two inverted
copies of the telomere resolution target are present in each
concatamer, one on either side of the concatamer junction. Each
telomere resolution target consists of a 20 base pair core domain
absolutely required for resolution and two auxiliary domains which
when present serve to enhance the resolution efficiency (21). The
sequence of the core element is absolutely conserved among
divergent members of the orthopoxviridae, implying that there may

28
be common transacting factors recognizing this sequence during the
resolution event (23). Although the sequences of the auxiliary
domains are less highly conserved the relative positions of purines
and pyrimidines in these regions is maintained among the
orthopoxviridae (23, 71).
It has been shown that the telomere resolution target functions
as a promoter during the latter stages of the vaccinia virus life cycle
(89, 119). The RNA transcript from the telomere region appears not
to code for protein (53). Sequence analysis of the telomere
resolution target indicates that the critical region appears to be a
good candidate for a late viral promoter (119). Whether the
telomere resolution target functions as an intermediate or late
promoter is unknown, as is the role that transcription plays in the
resolution event (G. McFadden, personal communication).
Transacting Factors Required for Resolution
There is very little information regarding the protein factors
involved in the resolution of vaccinia telomeres. The minimal
enzymatic activities required for resolution are a site-specific
endonuclease and a DNA ligase although proteins capable of

29
catalyzing strand exchange are also probably involved (118). A
nicking-joining enzymatic activity isolated from purified virions has
been shown to preferentially cleave within the core domain of the
telomere resolution target (61, 72). The nicking-joining activity
comigrates with a 50 kDa polypeptide which has been previously
shown to be a single strand specific endonuclease (61). Although
definitive proof is still lacking, this enzymatic activity is a good
candidate for the site-specific endonuclease necessary for telomere
resolution. A genetic approach has also been taken to identify
factors involved in telomere resolution. Six noncomplementing
temperature-sensitive mutants have been identified which are
incapable of resolving DNA concatamers at the nonpermissive
temperature (10, 74). Five of the six complementation groups have a
corresponding defect in the synthesis of late viral proteins. The
observation that mutants defective in late protein synthesis are also
defective in telomere resolution suggests that a critical factor
synthesized late during infection is required for telomere resolution
(74).
The single temperature-sensitive mutant which is incapable of
telomere resolution but not defective in late gene expression maps to

30
the small subunit of the vaccinia virus capping enzyme (10).
Therefore, genetic evidence implicates the small subunit of the
vaccinia virus capping enzyme (gene D12L) in the resolution process.
Although no direct biochemical role in resolution has been
demonstrated for the mRNA capping enzyme, it is interesting to
speculate in light of the capping enzyme’s function as an initiation
factor for intermediate transcription that transcription of the
telomere resolution target may play a role in resolution (10).
Transcription through the telomere resolution target may open up
the DNA strands and facilitate the formation of a unique secondary
structure that is recognized by the enzymes involved in resolution.
Alternatively, by unwinding the DNA strands, transcription may
indirectly aid the binding of the DNA resolvase (10).
Virion Morphogenesis and Release
Much of the information available on the morphogenesis of
poxviruses comes from electron microscopic examination of cells
infected with viral mutants (20). These observations have led to the
model for morphogenesis depicted in Fig. 2. Morphogenesis begins
within an electron dense region of the cytoplasm known as

viroplasm. Viroplasm is thought to consist of nucleoprotein
complexes which are the result of viral DNA replication, although
direct evidence for this is lacking. The first distinct structure in the
morphogenesis pathway is the appearance of viral crescents.
Crescents consist of two closely opposed lipid bilayer membranes
derived from the host cells intermediate compartment (116). Spike
like projections known as spicules radiate from the convex surface of
the crescent. Spicules are thought to give the crescent its rigid
convex shape (78). Crescents envelope a portion of the viroplasm
producing a spherical membranated structure, containing within it a
granular electron dense material. The next stage in morphogenesis is
thought to be the condensation of the granular material within the
spherical particle to produce an extremely electron dense material
presumably composed of nucleoprotein. There is some evidence that
condensed nucleoprotein may be injected into the spherical particle
before it is sealed, although at present this conclusion is somewhat
speculative (76). Following the condensation or injection of the
nucleoprotein, there occurs a series of complex morphological
changes within the developing particle that results in the formation
of the first infectious form of the virus. The first infectious form is a

32
membranated brick shaped virion particle that surrounds a
biconcave nucleoprotein containing core. Between the core walls and
the inner surface of the viral membrane are two granular structures
of unknown function known as lateral bodies. Packaged within the
core is the viral DNA and early transcription apparatus (78).
A majority of these infectious particles, known as intracellular
membranated virus (IMV), remain within the cytoplasm. However, a
small subset of IMV particles are actively transported out of the
viroplasm. The IMV particle obtains two additional lipid bilayer
membranes which are derived from the host cell golgi apparatus (49,
101). This triply membranated intracellular enveloped virion (IEV)
is then transported to the plasma membrane. Fusion of the
outermost viral membrane with the plasma membrane liberates the
now doubly membranated viral particle from the cytoplasm into the
extracellular milieu (91). The doubly membranated form, known as
extracellular enveloped virus (EEV) is the form responsible for the
dissemination of the infection in vivo and plaque formation in vitro
(90).

3 3
Viral Genetics
The relatively small genome size, lack of introns and
recombinagenic nature of poxviruses make them very amenable to
genetic study (reviewed in 15). The isolation and characterization of
poxvirus mutants has been of fundamental importance in
understanding the biology of the viral infection. These mutants have
proven valuable for studying all aspects of viral replication. In
addition, the isolation of viral mutants has provided poxvirologists
with the reagents necessary for the later biochemical analysis of
specific enzymatic activities encoded by the virus.
There are presently six reported collections of viral mutants,
each of which has been characterized to varying degrees (reviewed
in 15). This discussion will focus on three collections of vaccinia
virus temperature-sensitive mutants, that of Dales and coworkers,
Ensinger and coworkers, and Condit and coworkers.
The Dales collection was isolated in vaccinia virus strain IHD-W
(International Health Department) by chemical mutagenesis of a
wild-type viral stock followed by screening individual plaque
isolates for temperature sensitivity. Ninety temperature-sensitive

34
mutants were isolated and characterized by electron microscopic
examination of mutant infected cells at the nonpermissive
temperature (40°C). This collection was divided into 17 classes based
upon the stage in viral morphogenesis reached under nonpermissive
conditions (20). Complementation and recombination mapping has
been reported on subsets of this collection, however there has been
no attempt to map the complete collection by either
complementation analysis or marker rescue (31, 69).
Ensinger and coworkers have isolated a set of 100
temperature-sensitive mutants in the WR (western reserve) strain of
vaccinia virus by chemical mutagenesis of a wild-type stock. A total
of 62 mutants have been mapped by complementation analysis or
marker rescue (27-29).
Condit and coworkers have isolated a series of 65 temperature-
sensitive mutants in the WR strain of vaccinia virus comprising 32
separate complementation groups (13, 14). Of this collection, 29
complementation groups have been assigned a position on the viral
chromosome by marker rescue (14, 104, 120). The position of 20 of
these complementation groups are shown in Fig. 1. As expected from
mutations which affect essential genes, mutants in this collection

3 5
cluster within the centrally conserved core. To localize a mutant to a
particular open reading frame, fine mapping has now been done on a
number of these mutants (12, 34, 50, 70, 87, 95, 121).
Mutant Classification
In addition to the morphological classification of Dales et al.,
biochemical analysis of the phenotypes of temperature-sensitive
viral mutants has been used as a means of classification. Condit and
coworkers divided their collection into four groups, normal, DNA-,
defective late, and abortive late (reviewed in 15). The normal
phenotype includes all viral mutants which display normal patterns
of protein and DNA synthesis at the nonpermissive temperature.
Viruses classified as DNA- are those that are incapable of
[3H]thymidine incorporation at the nonpermissive temperature. The
defective late mutants comprise a very heterogeneous group of
viruses, which at the nonpermissive temperature, display defects in
the synthesis of late viral proteins. The abortive late phenotype is
characterized by an abrupt cessation of late protein synthesis at
approximately 8 hours post infection.

36
Directed Viral Genetics
The Condit temperature-sensitive mutant collection represents
mutations in only 20% of the essential virus genes (45). With the
publication of the complete sequence of vaccinia virus, it became
clear that there are a number of genes of both known and unknown
function for which there are no temperature-sensitive alleles (41,
54).
The traditional approach to generating temperature-sensitive
vaccinia virus mutants has involved random chemical mutagenesis of
viral stocks followed by screening for temperature sensitivity by
either assaying individual plaques or through a plaque enlargement
protocol. The utility of both methods is limited by requiring the
investigator to screen large numbers of plaques isolates. An
additional problem with the traditional approach to vaccinia virus
genetics is that the random mutagenesis methods employed do not
allow an investigator to target specific open reading frames for
mutational analysis. It is for these reasons that a more direct
approach for the creation of temperature-sensitive mutants must be
found. The goal of directed viral genetics is to target specific viral

37
open reading frames for mutagenesis in vitro and then place the
mutant allele back into its normal location in the viral genome (15).
For directed genetics to be applied to a complex DNA virus such
as vaccinia, two important criteria must be met. The difficulty in
successfully screening large numbers of viruses necessitates that the
mutagenesis scheme chosen produce a high proportion of
conditionally lethal mutants. The second obstacle that must be
overcome involves the targeted insertion of the mutant allele back
into the viral chromosome, along with the displacement of the wild-
type genomic copy of the gene.
This dissertation attempts to address the question of whether
or not clustered charge to alanine mutagenesis and transient
dominant selection can be used as a general method for the creation
of temperature-sensitive mutations in specific vaccinia virus genes.
Clustered Charge to Alanine Mutagenesis
Clustered charge to alanine mutagenesis is actually a
refinement of a technique known as alanine scanning mutagenesis,
first reported by Cunningham and Wells as an in vitro mutagenesis
method that caused minimal disturbances to the resulting protein’s

38
secondary structure (19). In this report individual amino acids
within a previously defined receptor binding domain of human
growth hormone (hGH) were systematically mutated to alanines. The
authors chose alanine because it is a small aliphatic amino acid
commonly found both on the surface, as well as buried within the
hydrophobic core of a variety of proteins and in a variety of
secondary structures. Therefore the authors felt that single alanine
substitutions would be unlikely to cause any extreme electrostatic or
steric disturbances in the mutant protein, and thus would be unlikely
to grossly alter the mutant protein’s secondary structure.
Elimination of amino acid side chains beyond the 6 carbon, by
replacement with alanine, would aid in the identification of those
amino acids whose side chains participate in protein-protein
interactions between hGH and the hGH receptor. Recognition of the
recombinant alanine substitution hGH mutants by monoclonal
antibodies specific for the native structure of hGH demonstrated that
most of these mutants retained the secondary structure of the wild-
type protein (19). The initial reporting of alanine scanning was

followed by a number of other reports which demonstrated the
utility of this method for the examination of both interprotein and
intraprotein interactions (2, 6, 11).
Alanine scanning was later modified by Bennett et al., who
mutated clusters of charged amino acids (Glu, Asp, His, Lys, Arg) to
alanines in an effort to define functional determinants on the surface
of human tissue plasminogen activator protein (htPA) (7). Clusters of
charged amino acids were targeted for mutagenesis because the
authors theorized that highly charged regions in the primary
sequence of a protein would be located on the surface, rather than
buried within the interior of the folded protein. In addition, charged
surface residues are also important mediators of electrostatic
protein-protein interactions, therefore loss of the surface charge
could disrupt these interprotein interactions. Charged clusters were
mutated in groups of 1 to 4 amino acids and clusters spanning
cysteine residues were avoided in order to refrain from disrupting
disulfide bonds which act to stabilize protein secondary structure.
The recombinantly expressed mutant proteins were tested in vitro
for a variety of functional activities and compared to wild-type htPA
protein. These data helped to localize some of the functional domains

40
involved in htPA’s diverse biological activities, which include
activation of plasminogen to plasmin, stimulation of tPA by fibrin,
and inhibition of tPA by tissue plasminogen activator inhibitor
protein (7).
Most of the reports which used clustered charge to alanine
mutagenesis involved examining recombinantly expressed protein or
peptide fragments in vitro. However in 1993 Wertman, Drubin and
Botstein demonstrated that clustered charge to alanine mutagenesis
could be used to create mutations that were temperature-sensitive in
vivo (130). In a mutational analysis of the Saccharomvces cerevisiae
actin gene (ACT1) 16 out of the 34 mutations constructed were
conditionally lethal for colony formation. Of the 16 conditional lethal
mutations, 9 were both cold sensitive and heat sensitive and 6 were
strictly heat sensitive conditional lethals. Examination of the three
dimensional crystallographic structure of yeast actin confirmed that
81% of the clustered charge to alanine mutations created in this
study targeted residues located on the surface of the folded protein
(130).
Clustered charge to alanine mutagenesis has also been used by
Diamond and Kierkagaard to create temperature-sensitive mutations

in the RNA dependent RNA polymerase protein of polio virus (25).
Of the 27 mutations constructed, 9 (35%) yielded viruses which the
authors classified as temperature-sensitive. These viruses were
classified as temperature-sensitive based upon either a small plaque
phenotype or decreased accumulation of viral RNA at the
nonpermissive temperature (39.5°C) (25). Interestingly, all of these
viruses are capable of producing infectious progeny at the
nonpermissive temperature, therefore none of these viruses are
conditional lethal temperature-sensitive mutants.
Following the initial demonstration that clustered charge to
alanine mutagenesis can be used to create temperature-sensitive
mutations in vivo, other investigators have used this technique to
make temperature-sensitive alleles in a number of diverse proteins
including the HIV type 1 integrase gene and the yeast ubiquitin-
conjugating enzyme CDC34 (UBC3) (93, 131). These results have
served to demonstrate that clustered charge to alanine mutants can
be created in proteins that serve structural, as well as enzymatic,
functions.

Transient Dominant Selection
The ability of homologous viral and plasmid DNA sequences to
recombine in vivo has been used to create deletion and insertion
mutants as well as viruses expressing foreign genes (80).
Recombination can also be used as a means of targeted gene
replacement to introduce site-specific mutations into the viral
genome (33). The principal limitation of this technology has been a
low proportion of recombinants (1:1000) among a backround of wild-
type nonrecombinant viruses (33). A number of selection and
screening methods have been devised to aid in the identification of
viral recombinants (32, 38, 66). One of the most widley used
techniques for the identification of viral recombinants has been a
transient dominant selection method which relies upon the ability of
recombinant viruses expressing the Escherichia coli xanthine-guanine
phosphoribosyltransferase protein (ecogpt) to grow and form plaques
in the presence of mycophenolic acid (MPA). The antibiotic
mycophenolic acid blocks inosine monophosphate dehydrogenase, a
cellular enzyme in the de novo guanine monophosphate synthesis
pathway (83). The selection for viral recombinants is made possible

by the different catalytic activities of the mammalian and bacterial
enzymes hypoxanthine phosphoribosyltransferase and xanthine-
guanine phosphoribosyltransferase. The bacterial enzyme (ecogpt)
will efficiently use xanthine as a substrate for purine biosynthesis
via the salvage pathway, whereas the mammalian enzyme will not
(83). Therefore, when provided with xanthine and grown on an
appropriate cell line, only viruses expressing ecogpt will form
plaques in the presence of MPA.
During this study, this methodology was applied as a means of
targeted gene replacement, the salient features of which are
illustrated in Fig. 5. Infected cells were transfected with a plasmid
that contained tandemly arranged single copies of a mutant vaccinia
gene and the ecogpt gene. The ecogpt gene was under the
transcriptional control of a vaccinia virus promoter (p7.5k) which
drives expression of ecogpt at both early and late times after
infection (33). Single crossover homologous recombination events
integrate the plasmid into the genome and generate a virus which
contains the ecogpt cassette flanked on either side by a copy of the
gene of interest (33). Viruses which have integrated the plasmid
into the genome can be selected for by plating the lysate from the

Fig. 5. Recombination events occurring within infected cells
during transient dominant selection. A transfected plasmid
containing both the ecogpt gene and a mutant vaccinia gene will
homologously recombine into the viral genome during the infection
transfection experiment. The mycophenolic acid resistant
recombinant virus produced contains the ecogpt gene flanked on
either side by a copy of the gene of interest. During the growth of
each mycophenolic acid resistant plaque, the virus will resolve the
gene duplication generating viruses which have either retained
(bottom left) or lost (bottom right) the mutation.

4 5
wild type
vaccinia virus
chromosome
I
infection-transfection
mutant vaccinia gene
wild type vaccinia gene

46
infected, transfected cells in the presence of MPA (33). Duplication
of the cloned gene makes these mycophenolic acid resistant viruses
unstable, so that during the growth of each MPA resistant plaque,
resolution will occur via recombination between the two genomic
copies of the gene of interest. The products of the resolution event
will be viruses which have lost the ecogpt gene and contain only a
single copy of the gene of interest. Resolution occurs during the
growth of each MPA resistant plaque such that each MPA resistant
plaque contains a mixture of viruses, some of which have a mutant
vaccinia gene derived from the transfected plasmid, while others
retain a wild-type copy of the vaccinia gene. Unresolved viruses
which retain the ecogpt gene will preseumably serve a helper
function for growth of resolved viruses in the presence of MPA.
This study will address a number of important questions about
transient dominant selection including: 1) Can transient dominant
selection be used to insert site-specific mutations into essential
vaccinia genes? 2) What is the percentage of mutant viruses within
each MPA resistant plaque?; 3) How many total viruses need to be
screened for temperature sensitivity before an unknown mutation
can be adjudged to not confer a temperature-sensitive phenotype?

4 7
A protocol, which is outlined in Fig. 6, has been developed to answer
these questions by creating mutations in the vaccinia virus gene G2R,
a gene with a selectable phenotype. The advantages of using the
vaccinia G2R gene to determine the efficiency of both clustered
charge to alanine mutagenesis and transient dominant selection is
discussed in detail in other sections of this dissertation (see chapter 1
and introduction to chapter 3). Briefly, a transient dominant
selection experiment was done with a plasmid containing a known
conditional lethal, temperature-sensitive G2R allele (Cts56).
Individually isolated MPA resistant plaques were then tested for the
presence of the Cts56 allele by plating at 31<>C and 40<>C in the
presence and absence of isatin-B-thiosemicarbazone (IBT). Wild-
type viruses will not grow in the presence of IBT. Loss of G2R
function results in viruses which are IBT dependent, therefore Cts56
is dependent upon IBT for growth at 40°C. The Cts56 virus is also
resistant to IBT at 31°C. The phenotype of individual IBT resistant
plaques can then be determined by re-plating them at 31<>C and 40C
in the presence and absence of IBT. The isolation of viruses with the
Cts56 phenotype proves that transient dominant selection can be

Fig. 6. Testing the efficiency of transient dominant selection
by making mutations in G2R. Mycophenolic acid resistant
plaques are isolated from a transient dominant selection experiment
done with wild type vaccinia virus and a plasmid which contains the
ecogpt gene and a mutant copy of G2R. Viruses within the
mycophenolic acid resistant plaque that contain a mutation that
alters G2R function can be selected for by plating individual
mycophenolic acid resistant plaques in the presence of IBT. The
efficiency of transient dominant selection can be measured by
determining the percentage of viruses containing the mutation (+IBT)
among the total population (31°C -IBT).

4 9
infection - transfection
wild type
vaccinia virus
Mutant vaccinia
gene
(select for recombinants
with mycophenolic acid
/ \
Test the phenotype of individual IBT
resistant plaques by replating at 31 °C
and 40°C + and - IBT

50
used to insert site-specific conditionally lethal mutations into the
viral genome. In addition, the proportion of IBT resistant viruses
within individual MPA resistant plaques will indicate how many total
viruses from each transient dominant selection experiment involving
a clustered charge to alanine mutant of unknown phenotype will
need to be screened for temperature sensitivity. This information
will be used to determine how to modify the protocol in order to
screen clustered charge to alanine mutations in genes without
selectable phenotypes. In these cases progeny from individual MPA
resistant plaques will be isolated by plated at 31°C and screened
individually by plating at 31°C and 40<>C.
Capping of mRNA and the Vaccinia mRNA Capping Enzyme
The nucleus is the site of eukaryotic mRNA synthesis and
maturation (75). Initially mRNAs are synthesized by RNA
polymerase II in the form of precursor molecules known as pre-
mRNA or heterogeneous nuclear RNA (hnRNA). Pre-mRNAs undergo
extensive posttranscriptional modifications within the nucleus,
including 5’ terminal capping, 3’ terminal polyadenylation, splicing
and internal methylations, before being transported to the cytoplasm

and entering the pool of mature translationally competent mRNA
(75). The modifications occurring to the 5’ end of eukaryotic mRNAs
are of particular interest because mRNA is synthesized, translated
and possibly degraded in a 5’ to 3’ direction (75).
The 5’ end of a mature eukaryotic mRNA molecule consists of a
cap structure, m7GpppN, in which the first encoded nucleotide is
linked to a 7-methylguanosine residue by a unique 5’-5’
phosphodiester bond (105). The cap structure of mRNA is necessary
for efficient translation initiation and protects the mRNA from
degradation by 5’-3* exonucleases (105, 106). In addition, the
presence of a cap structure on nuclear mRNA facilitates mRNA
splicing and nuclear export (43, 57, 59). Capping of pre-mRNA
occurs cotranscriptionally and is one of the initial steps in the
posttranscriptional mRNA maturation pathway (75).
The formation of the mRNA cap structure (m7GpppA) occurs in
three sequential enzymatic reactions (reviewed in 75, 105). The 5’
end of the triphosphorylated primary mRNA transcript is first
cleaved to a diphosphorylated form by an mRNA triphosphatase and
then capped with guanosine monophosphate by an mRNA
guanyltransferase. During the guanyltransferase reaction, a stable

intermediate forms via a covalent phosphoamide bond between a
lysine residue in the guanyltransferase active site and the phosphate
moiety of guanosine monophosphate (75, 110). Following
guanylation the guanine cap is methylated at the N? position by a
(guanine-7)methyltransferase (75). This general mechanism for
capping mRNA occurs in vaccinia, reovirus, cytoplasmic polyhedrosis
virus and probably most eukaryotic cells, although cap formation in
vesicular stomatitis virus is thought to occur by the transfer of a
guanosine diphosphate to the 5’ end of a monophosphorylated
primary mRNA transcript (reviewed in 75).
Methylation of the nucleotides adjacent to the 7-
methylguanosine residue occurs to varying extents, and this provides
a basis for the following cap nomenclature system: m?GpppN (cap 0),
m7GpppNm (cap 1), m7GpppNmpNm (cap 2), rn7GpppNmpNmpNm (cap 3)
and m7GpppNmpNmpNmpNm (cap 4). Generally these methylation
reactions are thought to occur sequentially, although there is
evidence that at least in the case of vesicular stomatitis virus and
cytoplasmic polyhedrosis virus the 2’0-methylation of the
penultimate nucleotide can occur prior to the methylation of the
guanosine cap (reviewed in 75). The cap 0 structure, which is the

minimal cap structure required to facilitate translation initiation, is
found on the 5’ end of mRNA isolated from yeast, slime molds and
some viral mRNAs (37, 62, 128), whereas mRNAs containing a cap 1
structure have been isolated from slime molds, animal cells and
many animal viruses (62). The cap 2 structure is found on mRNA
from insects, vertebrates and their viral parasites (62).
Interestingly, only cap 1 mRNA is found in the nucleus, implying that
the methyltransferases responsible for forming the other cap
structures are confined to the cytoplasm (62).
Because the enzymatic machinery necessary for capping mRNA
is localized within the nucleus, many cytoplasmic viruses including
vaccinia have evolved their own mRNA capping enzymes (75). All of
these viruses package capping enzymes within the viral particle,
along with a virally encoded RNA polymerase which ensures the
capping of mRNAs synthesized during the early phases of the viral
life cycle. The packaging of a viral capping enzyme and a viral RNA
polymerase within the virion has been used to develop in vitro
transcription/capping assays, whereby the mechanism of mRNA
capping has been examined in detail (reviewed in 39, 75). In the
case of vaccinia, incubation of purified virus particles in vitro with a

54
nonionic detergent, a reducing agent, all four ribonucleoside
triphosphates, magnesium and S-adenosyl-L-methionine results in
the formation of early viral mRNA molecules which contain cap 0 or
cap 1 structures at their 5’ ends (62). The vaccinia mRNA capping
enzyme catalyzes the formation of the cap 0 structure, and the
methylation of the penultimate nucleotide is done by the small
subunit of the vaccinia poly A polymerase protein (102, 115, 124).
The multifunctional nature of many cytoplasmic viral capping
enzymes is in contrast to cellular capping enzymes. The L protein of
vesicular stomatitis virus is thought to contain the guanyltransferase,
(guanine-7)methyltransferase and (nucleoside-2’0-)
methyltransferase active sites, in addition to serving as a subunit of
the RNA dependent RNA polymerase (128). The NS3 protein of
flaviviruses functions as a protease, a helicase and an mRNA
triphosphatase (129). Among avian reoviruses, a single protein
encodes both RNA dependent RNA polymerase and guanyltransferase
activities (117). As previously discussed, the vaccinia capping
enzyme functions as an early transcription termination factor and an
intermediate transcription initiation factor. The biochemical
activities of cellular capping enzymes seem to be confined to capping

5 5
mRNA. In rat liver, yeast, and brine shrimp the RNA triphosphatase
and guanyltransferase activities remain tightly associated during
multiple chromatographic purification steps. However (guanine-
7)methyltransferase activity does not coelute with the RNA
triphosphatase-guanytransferase containing fractions (75). Single
polypeptides with RNA triphosphatase and guanyltransferase
activities have been isolated from brine shrimp and rat liver (75). In
contrast, the yeast Saccharomvces cerevisiae contains two tightly
associated polypeptides, an 80 kDa RNA triphosphatase and a 52 kDa
guanyltransferase (75).
The only nonviral capping enzymes which have been cloned
are those from Saccharomvces cerevisiae (CEG1) and
Schizosaccharomvces pombe (PCE1) (103). The close association of
the RNA triphosphatase and guanyltransferase activities in many
eukaryotic capping enzymes may indicate that the RNA
triphosphatase and guanyltransferase reaction are coupled in vivo.
Vaccinia Virus mRNA Capping Enzyme
Although the specific functions of the vaccinia virus mRNA
capping enzyme have been previously discussed in detail in earlier

56
sections of this dissertation it may be useful to review what is known
about the vaccinia virus mRNA capping enzyme. The vaccinia virus
mRNA capping enzyme is a heterodimer composed of a 97 kDa large
subunit and a 33 kDa small subunit encoded by the vaccinia genes
DIR and D12L respectively (77, 86). The heterodimer contains
mRNA triphosphatase, guanyltransferase and (guanine-
7)methyltransferase enzymatic activities (108, 115, 124). The
domain structure of the enzymatic activities involved in capping
mRNA are fairly well defined, with the mRNA triphosphatase and
guanyltransferase active sites being localized to the amino terminal
60 kilodaltons of DIR, and the (guanine-7)methyltransferase domain
being contained within a stable heterodimer formed between the
carboxyl terminal portion of DIR and an intact D12L protein (107,
112).
During the guanyltransferase reaction, guanosine
monophosphate becomes covalently linked to a lysine residue (K260)
in the large subunit forming a enzyme-GMP intermediate. The
guanyltransferase active site has been mapped to a conserved KTDG
motif at amino acids 260-263 in DIR (17, 84). The KTDG motif is part

57
of a larger, complex motif associated with nucleotidyl transferases
such as capping enzymes and DNA and RNA ligases (111).
Heterodimerization between DIR and D12L and wild-type
levels of methyltransferase activity have been detected by
coexpression in bacteria of a plasmid encoding amino acids 498-844
of DIR and a full length D12L protein (46). However, the detection of
low levels of methyltransferase activity by expression of only amino
acids 540-844 of DIR indicates that the (guanine-7)
methyltransferase active site resides solely within the carboxyl
terminal 304 amino acids of DIR (16). Nevertheless, it is clear from
this data that heterodimerization between DIR and D12L is required
for full methyltransferase activity. A methyltransferase motif
UU[D/E]xGxGxG, where U is an aliphatic amino acid and x is any
amino acid, was identified in DIR that bears homology to motifs
found in the methyltransferases of flaviviruses, reoviruses and the
Hhal methyltransferase (68). All of these methyltransferases utilize
S-adenosyl-L-methionine as a substrate, and this motif is presumed
to be involved in binding S-adenosyl-L-methionine. The vaccinia
DIR sequence AIDFGNG (amino acids 596-602) lacks the third glycine
residue of the consensus sequence, however this sequence has

58
nevertheless recently been shown to be essential for
methyltransferase activity in vitro (68). A number of
alaninescanning mutants have been generated in recombinantly
expressed DIR and examined for D1R-D12L subunit association and
methyltransferase activity (68). One of these mutations
(H682A,Y683A) is defective in methyltransferase activity, but not
subunit association, implying that these two amino acids form part of
the methyltransferase active site. S-adenosyl-L-methionine has also
been covalently photocrosslinked to amino acids 499-579 and 806-
844, implicating these residues in the binding of S-adenosyl-L-
methionine (48).
The vaccinia virus mRNA capping enzyme also functions as an
early gene transcription termination factor and an intermediate gene
transcription initiation factor (109, 126). Transcription termination
of early genes requires a full length intact heterodimer and the
sequence UUUUUNU in the nascent mRNA (64, 114). The mechanism
of early termination is not known but it is thought that the capping
enzyme catalyzes termination by protein-protein interactions with
the viral transcription elongation complex. A recombinantly
expressed guanyltransferase defective capping enzyme mutant is

able to catalyze early transcription termination in vitro, therefore
termination is independent of cap formation. The capping enzyme
forms a stable complex with the viral RNA polymerase prior to
binding of the polymerase complex at the intermediate promoter
(126). The formation of the capping enzyme-RNA polymerase
complex is necessary for transcription initiation (126).
The vaccinia capping enzyme has also been genetically
implicated in the resolution of vaccinia virus telomeres (10). A
temperature-sensitive mutation mapped to the small subunit of the
vaccinia virus mRNA capping enzyme (gene D12L) which exhibits
normal protein and DNA expression under nonpermissive conditions
is unable to resolve viral telomeres at the nonpermissive
temperature (40°C) (10). Although the phenotype of this mutant
genetically implicates the vaccinia mRNA capping enzyme in
telomere resolution, there is no biochemical evidence that the
capping enzyme participates either directly or indirectly in the
resolution of viral telomeres.

CHAPTER 2
MATERIALS AND METHODS
Recombinant DNA Techniques
Bacterial Strain and Methods
Escherichia coli strain JM101 (SupE, thiA(lac-proAB)
F’[traD36,proAB+,lacIq lacZAM15] was used as host to propagate all
plasmid, phage and phagemid constructs. Standard techniques that
have been previously described were followed for the growth,
maintenance and isolation of all plasmids, phage and phagemid
constructs (100).
Electroporation of DNA into JM101
Electrocompetent bacterial cells were prepared from log phase
cultures of JM101 (ODóoo between 0.5-1.0) grown in Lennox L broth.
60

Cells were pelleted at 5,000 x g for 15 min in a GS3 rotor (Sorvall) at
4<>C, washed twice with 1 liter of ice cold distilled water, re-pelleted
at 5000 x g, resuspended in 5 ml of cold 20% glycerol and stored at -
70oC. Electroporations were done with a Biorad gene pulser set at 2.5
kV, 25 pF, 200 Q (average time constant of 4-5 msec, field strength
of 12.5 kV) in 1 cm2 cuvettes, using a protocol recommended by the
manufacturer.
Construction of G2R and DIR Vectors
Mutant G2R containing plasmids for transient dominant
selection were constructed using two similar protocols. For wild-type
G2R, AS1, and Cts56, a plasmid pUC118G was constructed, which
consists of the phagemid vector pUC118 (125), a cassette containing
the constitutive p7.5k vaccinia promoter upstream from the
Escherichia coli guanine phosphoribosyltransferase (ecogpt) gene
(obtained as a 1.1 kb Hpal, Dral fragment from pTKgpt-Fls (33)),
and a 982 base pair PvuII, EcoRV fragment derived from the
vaccinia virus HindIII G fragment, containing the wild-type G2R gene
with 82 nucleotides of 5' flanking sequence and 236 nucleotides of 3'
flanking sequence (70). The G2R containing DNA was placed adjacent

62
to and upstream from the p7.5k promoter, with the G2R sequences in
the opposite transcriptional orientation relative to the p7.5k
promoter. Single stranded pUC118G phagemid DNA (125) was used
as a template for mutagenesis to construct mutants AS1 and Cts56,
and transient dominant selections were done using double-stranded
plasmid DNA containing either wild-type or mutant G2R sequences.
For AS2 through AS9, mutagenesis of G2R was done using single
stranded DNA from an M13mpl9 G2R clone, provided by J. Lewis,
containing only the coding sequence of G2R obtained by PCR
amplification. Mutant G2R genes were then subcloned into a plasmid
containing pGEM3ZF- (Promega) vector DNA and the p7.5k - ecogpt
cassette described above for conferring resistance to mycophenolic
acid. The G2R gene was placed adjacent to and upstream from the
p7.5k promoter, with the G2R sequences in the same transcriptional
orientation relative to the 7.5K promoter. The transcription start site
of G2R has been previously mapped to base 10,335 of the vaccinia
virus strain WR HindIII G fragment, therefore none of the cloned G2R
sequences used in this study contain the promoter for the G2R gene
(70).

63
The phage M13mpl8DlRNco- used as a template for all DIR
mutagenesis experiments was a gift from E. Niles. The phage
M13mpl8DlRNco- contains the complete DIR open reading frame in
which an internal Ncol restriction endonuclease site at position
+2,235, relative to the transcriptional start site, has been removed by
site directed mutagenesis using an oligonucleotide which disrupts the
Ncol recognition sequence without altering the DIR coding sequence
(47). The plasmids used in the transient dominant selection
experiments with DIR were made using the following protocol. The
DIR gene was subcloned as a 2.8 kb PstI - SacI fragment from
appropriately mutagenized M13mpl8DlRNco- clones into the 7.5K-
ecogpt containing vector pBSgptB cut with PstI and SacI. The
plasmid pBSgptB, a gift from P. Turner, was made by inserting a 2 kb
EcoRI fragment, containing the p7.5k ecogpt cassette from pTK61-gpt
(33) into the EcoRI site of pBluescriptKS(+) (Stratagene). Mutant
copies of DIR were inserted upstream from and in the same
transcriptional orientation as the p7.5k ecogpt cassette. None of the
cloned DIR sequences used in this study contained the promoter for
the DIR gene (85).

64
Mutagenesis of G2R and DIR
Clustered charge to alanine mutations were created in cloned
copies of G2R and DIR using oligonucleotide directed mutagenesis.
The sequence of all G2R and DIR mutagenic oligonucleotides are
shown in Tables 1 and 2, respectively. All G2R mutations were made
using the Amersham oligonucleotide mutagenesis kit according to the
manufacturers instructions. Oligonucleotide directed mutagenesis on
DIR was performed using the T7-gen in vitro mutagenesis kit
according to the manufacturers instructions (U. S. Biochemicals).
Mutagenic oligonucleotides, synthesized by the DNA synthesis
core facility of the University of Florida, were designed to include 12
nucleotides 5' and 9 nucleotides 3' of the mismatched region (19).
DNA Sequencing
All DNA sequencing was done using the Sequenase version 2.0
kit according to the manufacturers instructions (U.S. Biochemicals)
and appropriate oligonucleotide primers. The complete G2R sequence
of each mutant phage or phagmid was confirmed byDNA sequence
analysis. The G2R gene from mutant viral DNA was amplified by

Table 1. G2R mutant oligonucleotides
mutation*
oligoligonucleotide sequence
amino acid changest
ts56
AS1
AS2
AS3
AS4
AS5
AS6
AS7
AS8
AS9
5’ CTTGAGAAAATCTACAAAGAAT 3’
5’TTAGAAATATATGC AGCGTATGCCGCAGCTGGAAAGT 3 ’
5’ TCCAACGATTCCGCAGCTTCTGTAA 3’
5’ TCCATACTTAATGCCGCCGATAAAT 3’
5’ AGAACATCTACCGCTGCATTTGTTGT 3’
5’ GTTCCGCTTCCTGCAGCAAATAAAT 3’
5’ ATATAAATATTCGCGGCCGCTATAACAAC 3’
5’ TGAGGAGTGTATGCCGCGAGGAGATA 3’
5’ GTTATGGGGACGGCCGCATTAGAAT 3’
5’ ATCTCCAACGATGCCGCAGCTGCTGTAAGTA 3’
G -> R
DRKYHK -> AAAYAA
TEDEE -> TEAAE
LSEEL -> LSAAL
TNKKV -> TNAAV
LFDKG -> LFAAG
IKDRN -> IAAAN
LLKEY -> LLAAY
SNERV -> SNAAV
TEDEE -> TAAAA
Bold face letters indicate mutant nucleotides. * indicates the G2R mutant designation, t denotes the
amino acid changes created in the G2R protein by each mutant oligonucleotide.
o\
LT\

Table 2. DIR mutant oligonucleotides
mutation*
oligonucleotide sequence
amino acid changest
El 26
D326
K348
K392
E516
E531
D545
K558
E793
E806
5’ AAAAATATAGCAGCGGCCGCTGTCGATAGTC 3’
5’ TACTTACITGCTGCTAGCGCGGCATTGATTGCAT 3’
5’ AGTAAACGGCCCTGCGTATGCCGCTGACGCGAATACTAT 3’
5’ ATAGTATTTGCGGCCGCAATTGCAAAATCAATGTTA 3’
5’ TTGATGCTTTGAGCTGCTAAAGCTGCGACTATGA 3’
5’ ACATCCGATAGTGCAGCCGCGTTAAAGA 3’
5’ TCTGGATTTAATGCAAATGCAGCATTATTGG 3’
5’ CCCAACGGTCCTGCAGTTGCTGCATTCGTAAA 3’
5’ TTAATAAACGCTGCGCTAGCTGCTATAATTGTAG 3’
5’ CTTGTAGATGGTGCAGCTGCCATTGTAG 3’
EERHI -> AAAAI
DRLEE -> AALAA
KSKKYE -> ASAAYA
KIKKE -> AIAAA
EHLRD -> AALAA
EDKLS -> AAALS
DKFRL -> AAFAL
KRTRG -> AATAG
ERSKK -> AASAA
EDRPS -> AAAPS
Bold face letters indicate mutant nucleotides. * indicates the DIR mutant designation, t denotes the
amino acid changes created in the DIR protein by each mutant oligonucleotide.
Os
Os

67
PCR, and appropriate selected regions of the G2R PCR product were
sequenced to confirm the presence of the desired mutations in Cts56,
ASI, AS4, AS6, and AS9 viruses. The presence of the mutant
sequence in the DIR phage clones was confirmed by DNA sequencing
of selected regions of DIR surrounding the mutation of interest. DNA
sequence analysis of PCR amplification products from portions of the
DIR open reading frame confirmed the presence of the E516 and
E793 mutation in E516 and E793 viral DNA, respectively. The E126
and D326 mutations created novel Nhel and Notl restriction enzyme
sites respectively, in DIR. Portions of the DIR gene from either El26
or D326 viral DNA were amplified by PCR and subjected to
restriction enzyme digestion and agarose gel electrophoresis to
confirm the presence of the appropriate mutations in the El26 and
D326 viral DNA (data not shown) (100).
Sodium Dodecvl Sulfate Polyacrylamide Gel Electrophoresis
Protein samples in lx Laemmli sample buffer were boiled and
separated on 10% SDS polyacrylamide slab gels as described (60).
Following electrophoresis, the gels were stained with Coomassie blue,
destained in 7.5% glacial acetic acid, 5% methanol, and dried

68
according to standard techniques (100). Autoradiograms of
radiolabeled protein samples were made using Kodak XAR film at -
70°C.
Northern Blot Analysis
Five ug of each purified RNA sample was denatured in
formamide and separated on a 1.2% formaldehyde agarose gel using
standard techniques (100). The RNA was transferred from the gel
onto a GeneScreen membrane in phosphate buffer (136 mM NaH2P04,
6.4 mM Na2HPC>4) overnight, according to the method of Southern
(117). The RNA was fixed to the membrane by irradiation at 254 nm
in a Stratalinker (Stratagene) for 1 minute. The membrane was
prehybridized in 7 ml of a solution containing 50% formamide, 10%
dextran sulfate, 1.45 M NaCl, 100 ug/ml denatured salmon sperm
DNA, 2X P buffer (IX P buffer contains 1% bovine serum albumin
(BSA, Sigma fraction V), 1% polyvinylpyrrolidone (MW 40,000), 1%
ficoll (MW 40,000), 0.25 M Tris-HCl [pH 7.5], 0.5% sodium phosphate,
5% SDS) for 3 hours at 55oC. Hybridizations were done by adding
lxlO6 cpm of the appropriate radiolabeled riboprobe to the
prehybridizing membrane and incubating at 55<>C overnight.

69
Nonspecifically bound radioactivity was removed by washing the
membrane once in 0.1X SSC (IX SSC is 150 mM NaCl, 15 mM sodium
citrate), 0.1% SDS for 15 minutes at room temperature and twice for
30 minutes each in 0.1X SSC, 1% SDS at 65<>C. Autoradiograms were
made using Kodak XAR film at -70<>C.
Preparation of Radiolabeled Riboprobes
Plasmids used to prepare antisense riboprobes specific for the
vaccinia virus C11R, G8R and F17R mRNA transcripts were a gift
from B. Moss, and their construction has been described elsewhere
(3). Briefly, 678, 530 and 682 nucleotides of coding sequence
corresponding to the 5’ ends of vaccinia virus genes C11R, G8R and
F17R respectively, were each inserted into the vector plasmid
pGEM3ZF (Promega). The plasmids were linearized by restriction
enzyme digestion with EcoRI (C11R and G8R) or BamHI (F17R) and
subjected to transcription with T7 RNA polymerase (Promega) to
generate antisense RNA molecules of 316 (C11R), 300 (G8R), or 126
(F17R) nucleotides in length. Each 20 ul transcription reaction
contained 1 ug of linearized plasmid DNA, 40 mM Tris-HCl [pH 7.5], 6
mM MgCh, 2 mM spermidine, 10 mM NaCl, 5 mM dithiothreitol, 0.5

70
mM each of ATP, GTP and UTP, 12 uM unlabeled CTP, 50 uCi
[oc32P]CTP (3,000 Ci/mmol, Amersham), 20 units of RNasin (Promega),
and 20 units of T7 RNA polymerase (Promega). Following a 60
minute incubation at 37°C, 20 units of RNAse free DNAse (Promega)
was added to the reaction and the 37°C incubation was continued for
an additional 15 minutes. The labeled RNA was purified by
extraction with phenol-chloroform (1:1), precipitated with
ammonium acetate and isopropanol and quantitated by liquid
scintillation counting according to standard techniques (100).
Western Blot Analysis of E793 Virions
Transfer of proteins from 10% sodium dodecyl sulfate
polyacrylamide gels to nitrocellulose was done according to the
method of Towbin (122). Rabbit polyclonal antiseras for DIR and
D12L, kindly provided by E. Niles and S. Shuman, respectively, were
each used at a dilution of 1:2000. The primary antibody was detected
by using horseradish peroxidase linked polyclonal anti-rabbit
antisera (Amersham) at a dilution of 1:10,000 and visualized by
Amersham’s enhanced chemiluminescence western blotting kit
according to the manufacturers instructions.

Virion Directed In Vitro Transcription and Methvltransferase Assays
Purified vaccinia virus virions were preincubated at 30<>C, 35«C
or 40°C in 100 ul reactions containing 13 ug/ml virus, 0.01 M Tris-
HCL [pH 8.5], 0.01% nonidet P40, 0.02 M dithiothreitol, 0.2 M MgCl2.
At 15 minute intervals 10 ul samples were removed and held on ice
until the conclusion of the preincubation time course. For the
transcription reactions, 10 ul of a solution containing 10 mM ATP, 2
mM GTP, 2 mM CTP, 0.66 mM unlabeled UTP, 0.4 uCi [3H]UTP (14
Ci/mmol, Amersham) was added to each preincubated sample and
transcription reactions were carried out at 30«C for 30 minutes. For
methyltransferase reactions, 10 ul of a solution containing 10 mM
ATP, 2 mM GTP, 2 mM CTP, 2 mM unlabeled UTP, 0.66 uCi [3H]S-
adenosyl-L-methionine (15 Ci/mmol, Amersham) was added to each
preincubated sample and methyltransferase reactions were carried
out at 30°C for 30 minutes. The reactions were terminated by
spotting 15 ul onto a DE81 filter (Whatman). Unincorporated
radioactivity was removed by washing in 0.5 M Na2HP04, after which
the filters were analyzed by liquid scintillation counting according to
established methods (100). Wild-type and E793 transcription and

72
methyltransferase reactions were normalized to identical reactions
carried out with wild-type or E793 virus that had not been
preincubated and the results expressed as the percent of activity
relative to non-preincubated controls.
Virological Techniques
Cells and Virus
BSC40 and CV1 cells were routinely maintained at 37«C in 5%
CO2. BSC40 cells were grown in Dulbecco's Modified Eagle medium
(DME, Life Technologies) with 10% Hyclone (Hyclone Laboratories).
CV1 cells were maintained in CV1 medium, which is Dulbecco's
modified Eagle medium supplemented with 1% nonessential amino
acids (Sigma), 1% sodium pyruvate (Sigma) and 10% fetal calf serum
(Life Technologies). Stocks of wild-type vaccinia virus strain WR
were grown on BSC40 cells at 37°C. Temperature-sensitive vaccinia
virus mutants were grown on BSC40 cells at 31°C. The isatin-6-
thiosemicarbazone dependent mutant G2A was grown on BSC40 cells
at 37°C in the presence of 45 (iM IBT (Pfaltz and Bauer).

73
Preparation of IBT
A 1 mg/ml stock of IBT in acetone was diluted with 4 volumes
of 0.25 N NaOH and further diluted 1:100 in DME+10% Hyclone+1%
Noble agar (Difco) for a final concentration of 45 pM. IBT containing
media was added to infected BSC40 cells following the 60 minute
absorption period and remained in the media throughout the course
of the infection.
Plaque Titration
Viral stocks were thawed, sonicated in a Vibra cell sonicator
with a cuphorn attachment (Sonics and Materials) for 1 minute and
serially diluted in PBSAM (170 mM NaCl, 3.4 mM KC1, 10 mM
Na2HP04, 1.8 mM K2HP04 [pH 7.2], 10 mM MgCl2, 0.01% BSA).
Confluent monolayers of BSC40 cells on 60 mm dishes were infected
with 0.5 ml aliquots of each viral dilution for one hour at either 31»C
or 40°C. The inocula were removed and each dish was overlaid with
4 ml of DME+10% Hyclone containing 1% molten noble agar (Difco),
allowed to solidify and incubated at 31»C, or 40oC for 6 days. The
plaques were stained by overlaying the cells with 4 ml of DME+10%

Hyclone, 1% molten Noble agar, 0.005% neutral red (3-Amino-7-
dimethylamino-2-methylphenazine hydrochloride, Sigma) and
incubating at 31°C or 40°C from 3 hours to overnight. For permanent
records of wild-type and mutant plaques, the Noble agar overlay was
removed after staining with neutral red and the cell monolayers
were stained with a solution of 0.25% crystal violet (Sigma) in 20%
ethanol at room temperature for a few hours. The dishes were then
rinsed with distilled water and air dried.
Viral Plaque Isolation
Infected monolayers of BSC40 or CV1 cells were stained with
neutral red as described above to visualize individual plaques. Well
isolated single plaques were picked with a sterile pasteur pipette and
placed in 3 ml of PBSAM, frozen and thawed 3 times and then plaque
titrated as previously described.
Preparation of Viral Stocks
Confluent monolayers of BSC40 cells, on 100 mm dishes, were
infected with the appropriate virus at a low multiplicity of infection
(moi) (between 0.01 and 0.1 plaque forming units per cell) and

incubated at either 37oC (wild-type) or 31»C (mutants) until the
cytopathic effect was complete. Cells were scraped from the dishes
into the media and pelleted by centrifugation at 400 x g for 5
minutes at 4»C. The cell pellets were resuspended in 0.1-1.0 ml of
PBSAM/lxlO? infected cells, frozen and thawed 3 times and stored
at -70oC.
Transient Dominant Selection
Transient dominant selection was performed essentially as
described by Falkner and Moss (33). CV1 cells on 60 mm dishes
were pretreated overnight in CV1 media containing MPA, (15 ug/ml
hypoxanthine, 250 ug/ml xanthine, 25 ug/ml mycophenolic acid,
Sigma) infected with wild-type vaccinia virus (moi of 0.05 plaque
forming units per cell), transfected with 20 ug of plasmid DNA using
Transfectase (Life Technologies) according to the manufacturers
instructions, and incubated at 37»C for three days. Infected,
transfected cells were harvested by scraping from the dish into the
media, pelleted by centrifugation at 400 x g for five minutes,
resuspended in 1 ml of PBSAM, frozen and thawed three times and
stored at -70<>C. The samples were plaque titrated on CV1 cells in the

presence of MPA for 3 to 5 days. The plaque titrations were done
essentially as described above except that CV1 cells and media were
used and 0.5% Sekem HGT agarose was used in place of 1% Noble
agar.
For the G2R mutant screen, 10 individual MPA resistant
plaques from each transfection were picked and plaque titrated on
BSC40 cells in the presence and absence of 45 pM IBT at 31<>C and
40°C. To determine their phenotypes, individual IBT resistant
plaques were picked, then re-plaqued in the presence and absence of
IBT at 31°C and 40°C. Individual G2R mutant viruses were then re¬
plaque purified, and viral stocks were grown as described above. For
the DIR mutant screen, five individual MPA resistant plaques from
each transfection were plaque titrated on BSC40 cells at 31«C. Fifty
individual plaques, ten from each original MPA resistant plaque,
were picked, then re-plaqued at 31°C and 40«C. Individual plaques
from dishes showing either heterogeneity in plaque size or reduced
plaque size in comparison to wild-type were re-plaque purified at
31«C, and viral stocks prepared as previously described.

77
One Step Growth Experiments
Confluent monolayers of BSC40 cells on 60 mm dishes were
infected at 31»C or 40«C with the indicated virus at an moi of 6. At
various times post infection, infected cells were scraped from the
dishes into the media and frozen and thawed 3 times. Viral yields
were determined by plaque titration on BSC40 cells at 31°C. The
data is expressed as the number of plaque forming units produced
per infected cell (pfu/cell).
Marker Rescues
Confluent monolayers of BSC40 cells on 60 mm dishes were
infected with the mutant virus indicated in the figure, incubated at
31°C for four hours, transfected with 20 ug/ml of the appropriate
DNA in HBS (125 mM CaCl2, 150 mM NaCl, 0.7 mM Na2HP04, 5 mM
KC1, 20 mM N-[2-hydroxyethyl] piperazine-N-[2-ethanesulfonic acid]
(HEPES), 6 mM Dextrose) and shifted to 40°C for three days. The cells
were stained with crystal violet as previously described. The DNA
constructs used in the marker rescue experiments are described in
the figure legends.

78
Purification of Vaccinia Virus Virions
5x108 BSC40 cells, on 10-150 mm dishes, were infected at an
moi of between 0.01 and 0.1 and incubated at either 37<>C (wild-
type) or 31°C (E793) until complete cytopathic effect was observed.
Cells were scraped from the dishes into the media, pelleted by
centrifugation at 400 x g for 10 minutes, washed with 20 ml of PBS
(170 mM NaCl, 3.4 mM KC1, 10 mM Na2HP04, 1.8 mM K2HP04 [pH
7.2]) and resuspended in 20 ml of 10 mM Tris-HCl [pH 7.5], 5 mM
MgCl2. The cells were lysed by dounce homogenization and the
nuclei were removed by pelleting at 400 x g. After sonication of the
supernatant fraction, the virus within the sample was pelleted
through a 36% w/v sucrose, 10 mM Tris-HCl [pH 7.5] cushion by
centrifugation at 13,500 rpm in an SW28 rotor (Beckman) at 4<>C for
40 minutes. Viral pellets were resuspended in 6 ml of 10 mM Tris-
HCL [pH 7.5], resonicated and spun through a 25%-40% w/v sucrose,
10 mM Tris-HCl [pH 7.5] gradient at 13,500 rpm in an SW28 rotor at
4«C for 40 minutes. Viral bands were collected, diluted with 2
volumes of 10 mM Tris-HCl [pH 7.5] and pelleted at 15,000 rpm in an
SW28 rotor at 4°C for 60 minutes. The pellet was resuspended in 4

79
ml of 10 mM Tris-HCl [pH 7.5]. The purified virus was quantitated
by Bradford assay using a Biorad protein assay kit, according to the
manufacturers instructions, and absorbance measurements at 260
nm (1 OD260 = 64 ug virus). The infectivity of the purified virus was
assayed by plaque titration on BSC40 cells at 31°C. There was no
significant difference in either the quantity or infectivity of the E516
or E793 virus preparations compared to wild-type preparations.
In Vivo Protein Pulse Labeling of Infected Cells
Confluent monolayers of BSC40 cells on 35 mm dishes were
infected at an moi of 15 with the indicated virus at 31°C or 40<>C.
After a 30 minute absorption the inoculum was removed, 2 ml of
medium prewarmed to the appropriate temperature was added to
each dish, and the incubations were continued. At various times
after infection the media was removed and the infected cells were
washed three times with 2 ml of prewarmed PBS. Proteins within
the infected cells were pulse labeled for 15 minutes with 10 uCi of
Trans[35S]-label (1,153 Ci/mmol, ICN Biochemical) in 0.5 ml of
prewarmed PBS. The label was removed and the cells were lysed in

80
0.3 ml of Laemmli sample buffer (60), scraped from the dishes,
boiled and frozen at -20°C.
Viral DNA Accumulation in Infected Cells
Confluent monolayers of BSC40 cells on 60 mm dishes were
infected at a moi of 15 with either wild-type or E793 virus and
incubated at 31«C or 40°C. At 2 hour intervals after infection, the
cells were washed with 1 ml of PBS, scraped from the dishes into 1
ml of PBS, and pelleted by centrifugation at 400 x g for 10 minutes.
The cells were resuspended in 0.3 ml of 10X SSC containing 1 M
ammonium acetate. Samples were frozen and thawed three times
and diluted with 1.2 ml of 10X SSC. 100 ul of each diluted sample
was denatured by the addition of 2.5 ul of 10 N NaOH and 10 ul of 5
M NaCl (final concentration 0.25 N NaOH, 0.5 M NaCl) for 10 minutes
at room temperature. After denaturation 1 ul was removed, diluted
1:100 in 0.1X SSC, 0.125 N NaOH and applied to a GeneScreen
membrane (New England Nuclear), using a Schleicher and Schuell slot
blotting apparatus according to manufacturers instructions. DNA was
fixed to the membrane by irradiation at 254 nm in a Stratalinker
(Stratagene) for 1 minute. The membrane was prehybridized in 10

ml of prehybridization buffer (100 mg/ml dextran sulfate (MW
50,000), 1% SDS, 1.45 M NaCL) at 65°C for 4 hours. Hybridizations
were done overnight at 65°C, by the addition to the prehybridizing
membrane of 1 ml of probe mix. Nonspecifically bound radioactivity
was removed by washing the membrane twice for 5 minutes in 2X
SSC at room temperature and once for 30 minutes at 60<>C in 2X SSC,
1% SDS. Radioactivity bound to the membrane was quantitated with
an Image Quant phosphorimager according to the manufacturers
instructions.
Preparation of probe mix. 1x107 cpm/ml of radiolabeled wild-
type vaccinia virus DNA was added to 1 ml of a 1 mg/ml solution of
salmon sperm DNA, boiled for five minutes, cooled on ice for 15
minutes and used immediately.
Preparation of randomly labeled vaccinia virus DNA. Wild-
type vaccinia DNA was digested with Hindlll and radiolabeled with
[a32P] dCTP (3000Ci/mmol, Amersham) by “oligo-labeling” according
to the method of Feinberg and Vogelstein (35). Unincorporated
nucleotides were removed by column chromatography through
Sephadex G50 as described (100). Incorporated radioactivity was
determined by precipitation of a 1 ul aliquot of the probe reaction

82
onto filter paper (Whatman) with trichloroacetic acid followed by
liquid scintillation counting, as previously described (100).
Preparation of RNA From Infected Cells
Confluent monolayers of BSC40 cells on 100 mm dishes were
infected at an moi of 15 with wild-type or E793 virus and incubated
at either 31<>C or 40«C. At various times the cells were washed once
with cold PBS, lysed in 1 ml of GT buffer (4M guanidinium
isothiocyanate, 0.1 M Tris-HCl [pH 7.5], 0.5% Sarkosyl, 0.1 M 2-
mercaptoethanol), and scraped from the dishes. Samples were
pelleted through a CsCl (5.7 M CsCl, 0.01 M
ethylenediaminetetraacetic acid (EDTA) [pH 7.5]) cushion for
approximately 24 hours at 18°C in a SW-55 Ti rotor (Beckman) at
35,000 rpm. The RNA pellet was dissolved in distilled water,
precipitated with two volumes of ethanol and resuspended in
distilled water. The RNA was quantitated by absorbance at 260 nm
(1 OD26o = 40 ug/ml of RNA) (100).

83
Electron Microscopy of Infected Cells
Confluent monolayers of BSC40 cells on 60 mm dishes were
infected with either wild-type or E793 at an moi of 10 at 31°C or
40oC. At 24 hours post infection, cells were washed with 1 ml of PBS,
scraped from the dish into 1 ml of PBS and pelleted by centrifugation
at 400 x g. The cell pellet was resuspended in 1 ml of 2%
glutaraldehyde in PBS, fixed overnight at room temperature,
repelleted by centrifugation at 400 x g and post-fixed in an aqueous
solution of 1% OSO4 for 1 hour. The cells were repelleted at 400 x g,
rinsed in distilled water, stained in 1% aqueous uranyl acetate for 30
minutes, rinsed again in distilled water and dehydrated in 25%, 50%,
75% and 100% ethanol for 10 minutes each. After dehydration the
cells were washed twice for 15 minutes in 100% acetone then
embedded in Spurr’s epon resin which was then polymerized for 2
days at 60°C. After thin sectioning the samples were mounted and
viewed with a Hitachi H7000 transmission electron microscope.

84
Southern Analysis of Concatameric and Monomeric Vaccinia DNA
Isolated From Infected Cells
Confluent monolayers of BSC40 cells on 60 mm dishes were
infected with either wild-type, Cts53 or E793 virus at an moi of 10 at
31°C or 40°C. At 6 and 24 hours post infection the cells were scraped
from the dish into the media, pelleted by centrifugation for 10
minutes at 400 x g, washed once with PBS and resuspended in 50 ul
of 0.15 M NaCl, 0.02 M Tris-HCl [pH 8.0], 0.01 M EDTA. The 50 ul
samples were added to 250 ul of 0.02 M Tris-HCl [pH 8.0], 0.01 M
EDTA, 0.75% SDS containing 0.8 mg/ml proteinase K (Boehringer
Mannheim) and incubated at 37°C for 6 hours. The samples were
passed through a 25 gauge needle 5 times, extracted twice with
phenol chloroform (1:1) and twice with chloroform before
precipitation with 0.1 volume of 3 M sodium acetate and 2 volumes
of ethanol at room temperature for 30 minutes. The precipitate was
pelleted by centrifugation in a microfuge at 12,000 rpm for 15
minutes, washed with 1 ml of 70% ethanol air dried, resuspended in
50 ul of TE (10 mM Tris-HCl [pH 8.0] 1 mM EDTA) and quantitated by
measurement of absorbance at 260 nM. 1.5 micrograms of total

85
nucleic acid was digested with 20 units of BstEII (New England
Biolabs) overnight at 60°C and separated on a 1.5% agarose gel in
TAE buffer (0.04 M Tris-HCL [pH 8.0], 0.001 M EDTA). Southern
alkaline transfer of the DNA onto a GeneScreen membrane was done
according to a protocol provided by the manufacturer. The DNA was
fixed to the membrane by uv irradiation at 254 nm in a Stratalinker
for 1 minute. The membrane was prehybridized in 7 ml of
prehybridization buffer (100 mg/ml dextran sulfate (MW 50,000),
1% SDS, 1.45 M NaCL) at 65°C for 4 hours. Hybridization was done
overnight at 65°C, by the addition to the prehybridizing membrane
of 1 ml of pBD probe mix. Nonspecifically bound radioactivity was
removed by washing the membrane twice for 5 minutes in 2X SSC at
room temperature and once for 30 minutes at 60<>C in 2X SSC, 1% SDS.
Radioactivity bound to the membrane was quantitated with an
Image Quant Phosphorimager according to the manufacturers
instructions. The resolution efficiency was calculated by determining
the ratio of the intensity of the 1.3 kb resolved telomere band to the
intensity of the 2.6 kb concatamer junction band.
Preparation of pBD probe mix Approximately 1x108 cpm of
radiolabeled pBD plasmid DNA was added to 1 ml of a 1 mg/ml

86
solution of salmon sperm DNA, boiled for five minutes, cooled on ice
for 15 minutes and added to the prehybridizing membrane
immediately.
The construction of plasmid pBD, which contains a 2.6 kilobase
BstEII-BstEII vaccinia virus concatamer junction insert was a gift
from M. Merchlinsky and has been previously described (73).
Briefly, the 2.6 kb vaccinia virus insert within plasmid pBD consists
of a double-stranded copy of the terminal hairpin loop (208 base
pairs) which is the concatamer junction and 2.4 kilobases of inverted
terminal repeat sequences. Plasmid pBD was radiolabeled with
[a32p] dCTP (3000 Ci/mmol, Amersham) by “oligo-labeling” according
to the method of Feinberg and Vogelstein (35). Unincorporated
nucleotides were removed by column chromatography through
Sephadex G50 as described (100). Incorporated radioactivity was
determined by precipitation of a 1 ul aliquot of the probe reaction
onto filter paper (Whatman) with trichloroacetic acid followed by
liquid scintillation counting, as previously described (100).

CHAPTER 3
TESTING CLUSTERED CHARGE TO ALANINE MUTAGENESIS AND
TRANSIENT DOMINANT SELECTION ON THE VACCINIA VIRUS GENE
G2R
Introduction
Traditional approaches to viral genetics, which involve random
mutagenesis of the virus followed by screening for phenotypes of
interest, have proven to be quite useful in the genetic and
biochemical characterization of vaccinia virus (reviewed in 5).
Random mutagenesis methods, however, are limited by their
inability to target specific open reading frames and by the laborious
screening methods required to identify mutants of interest. It is for
these reasons that a more direct approach for the creation of
temperature-sensitive virus mutants, in specific viral genes, must be
found. Practical application of directed genetics to a complex DNA
virus such as vaccinia, requires an in vitro mutagenesis scheme
which produces a high proportion of conditionally lethal mutants
87

88
combined with an efficient method for targeted replacement of the
wild-type viral gene with the mutant allele. The object of this work
was to determine if clustered charge to alanine mutagenesis and
transient dominant selection could be used as a practical method for
the creation of conditionally lethal temperature-sensitive vaccinia
virus mutants.
Clustered charge to alanine mutagenesis involves replacing
clusters of charged amino acids in a protein with alanines. Charged
residues which are clustered in the primary sequence of a
polypeptide often cannot be efficiently accommodated in the
hydrophobic core of the protein, therefore they are most likely to be
found on the surface of the folded protein (7). The replacement of
multiple charged residues with alanines has been shown to disrupt
protein-protein interactions in vitro, while not severely altering
protein secondary structure (7, 19). When this approach was applied
to the Saccharomyces cerevisiae actin (ACT1) gene, of 34 mutations
constructed, 44% had a temperature-sensitive phenotype in vivo
(130). Likewise, clustered charge to alanine mutagenesis of the
poliovirus 3D polymerase resulted in a high proportion (37% of 27

89
mutants) of temperature-sensitive mutants (25). Thus alterations of
a protein's surface charge may disrupt tertiary or quaternary
interactions and result in temperature sensitivity in vivo.
Vaccinia has proven to be an excellent model system for
studying transcription, DNA replication, and the regulation of gene
expression (78). The genome of vaccinia consists of approximately
192 kilobases of double-stranded DNA with covalently closed ends.
The poxviruses are unique among DNA viruses in that they replicate
in the cytoplasm of infected cells (78). Thus the virus encodes
virtually all of the enzymes required for viral RNA and DNA
metabolism. Numerous enzymatic activities common to other
eukaryotic organisms have been shown to be encoded by the virus
(41, 78). Genetic analysis of vaccinia has provided many of the tools
necessary for understanding the viral life cycle. Previous genetic
studies in the Condit laboratory led to the isolation of conditionally
lethal temperature-sensitive mutations in 30 separate vaccinia virus
complementation groups (13). These mutants have proven valuable
for studying all aspects of viral replication. However, vaccinia codes
for approximately 150 essential genes, therefore this collection

90
represents mutations in only 20% of the essential virus genes (41). A
directed genetic method that produces conditionally lethal
temperature-sensitive mutations in specific genes would allow one to
genetically study many of the viral genes in which there are no
conditionally lethal mutants.
Results
To evaluate the potential of clustered charge to alanine
mutagenesis as a means of creating conditionally lethal vaccinia
viruses, a series of nine clustered charge to alanine mutations were
created in the G2R gene (Fig. 7). G2R was chosen for the test because
mutations in this gene confer easily selectable phenotypes (70), thus
circumventing the necessity for screening large numbers of
individual plaque isolates to determine the phenotype conferred by a
particular mutation. The selection is based on the sensitivity of the
virus to the anti-poxviral drug isatin-B-thiosemicarbazone (IBT). As
shown in Fig. 8, plaque formation by wild-type vaccinia virus is
inhibited by IBT, deletion mutants in G2R such as G2A are dependent

Fig. 7. Deduced amino acid sequence of the vaccinia virus G2R gene product and G2R
mutants. Charged residues are indicated by boldface type. Large boldface type denotes charged
residues mutated to alanine in a given mutant. The amino acid changes corresponding to Cts56 (G151R),
and G2A (a 10 bp deletion/frameshift starting at residue 90) are designated above the appropriate
residues. AS2 and AS9 mutations are indicated by lines above and below the amino acid sequence
respectively, wt = wild type; ts = temperature sensitive; tdr = temperature dependent IBT resistance; d
= IBT dependent; * indicates the termination of G2R in mutant G2A.

wt
ts
— 2 A? }
mpfrdlilfn lskflltEDE Esleivsslc rgfeisyddl ityfpDRKyH
51 Kyiskvfehv dls
ii
AS 9ts
wt
d
0- - G2 A
j 3 KCV IN*
iLSMEF HDTTLRDLVY LRLYKYSKCI RPCYKLGDNL
ts
Cts56
R
101 KGIWI
ts
wt
AS 7
AS 8
wt
Rn iyireanddl ieyllKEytp qiytysnERv pitgsklilc
151
tdr Wt
AS 4 AS 5
GFSQVTFMAY ITSHITTNKK VDVLVSKKCI DELVDPINYQ ILQNLFDKGS
201 GTINKILRKI FYSVTGGQTP

93
on IBT for growth, and a previously isolated temperature-sensitive
mutation which maps to G2R (Cts56) is resistant to IBT at the
permissive temperature (31°C) and dependent upon IBT at the
restrictive temperature (40oQ. The function of the G2R gene and the
precise mechanism of action of IBT are unknown. The predicted
amino acid sequence of the G2R gene is shown in Fig. 7 (70). For the
mutagenesis, a charge cluster was defined as two or more charged
amino acids within a five amino acid window (130). With the
exception of AS2 each of the charged residues in the window were
changed to alanines. For the mutant AS1, five charged amino acids in
a six amino acid window were each mutated to alanines.
Mutations were engineered into a cloned copy of G2R using
oligonucleotide directed mutagenesis and the mutant G2R genes were
then inserted into the viral chromosome using transient dominant
selection (33). Specifically, individual mutant G2R genes were cloned
into a plasmid vector adjacent to a cassette containing the Escherichia
coli xanthine guanine phosphoribosyltransferase gene (ecogpt)
which is under the transcriptional control of a vaccinia specific
promoter (p7.5k). The plasmids were then recombined into the

94
vaccinia genome by transfection of wild-type vaccinia virus infected
cells. Recombinant viruses resulting from a single crossover event
between plasmid G2R sequences and homologous G2R sequences on
the viral chromosome contain the ecogpt cassette flanked by two
copies of G2R, a mutant copy derived from the plasmid and the wild-
type chromosomal copy (Fig. 5). Expression of ecogpt provides these
viruses with resistance to the purine biosynthesis inhibitor
mycophenolic acid (MPA), thus recombinants can be selected for by
plating the lysate from the infected, transfected cells in the presence
of MPA. During the growth of each MPA resistant plaque, resolution
occurs via recombination between the two genomic copies of G2R,
resulting in viruses which have lost the ecogpt gene and contain only
a single copy of the G2R gene. Each MPA resistant plaque
consequently contains a mixture of viruses, some of which contain a
mutant copy of G2R derived from the transfected plasmid, while
others retain a wild-type copy of G2R. Approximately 10% of the
viruses in each plaque do not resolve (data not shown). These

95
unresolved viruses therefore retain the ecogpt gene and serve a
helper function for growth of resolved viruses in the presence of
MPA.
Quantitation of Mutant Progeny in MPA Resistant Plaques
To determine the efficiency of the transient dominant selection
protocol, experiments were conducted using plasmids containing
either the wild-type G2R gene or the temperature-sensitive G2R
allele, Cts56. Table 3 shows the results of plating five independently
isolated MPA resistant plaques from each transfection in the
presence and absence of IBT at 31°C and 40°C. Mycophenolic acid
resistant plaques isolated after transfection with a wild-type copy of
G2R contain no IBT resistant viruses, showing that the background
level of spontaneous IBT resistance in these experiments was
negligible. Transfection with a plasmid containing a known
temperature-sensitive mutant of G2R (Cts56) generates MPA
resistant plaques, most of which contain a population of IBT resistant
viruses. The percentage of IBT resistant viruses contained in
individual MPA resistant plaques is variable. This variability most

Table 3.
Screening
MPA
resistant
plaques for
mutant
recombinants
plasmid DNA
transfected
plaque #
-IBT
+IBT
-IBT
+IBT
% mutant*
wild type
1
501
0
629
0
0%
2
363
0
512
0
0%
3
29
0
3 8
0
0%
4
184
0
596
0
0%
5
295
0
326
0
0%
Cts56
1
168
5
293
1 7
10%
2
45
9
72
29
63%
3
344
1 7
425
82
24%
4
217
6
230
27
12%
5
367
25
387
104
28%
AS1
1
- 1500
93
= 1500
60
4%
2
= 1500
116
= 1500
70
5%
3
- 1500
69
* 2000
138
9%
4
= 1500
32
= 2000
56
4%
5
- 1500
258
- 2000
268
18%
Transient dominant selection was carried out with plasmids containing either a wild type G2R gene, Cts56 or AS1.
Five MPA resistant plaques from each transfection were titered at 31°C and 40°C in the presence and absence of IBT.
The data shown indicate the total number of plaques produced per 6 cm dish under each condition. * The percent
mutant was calculated by dividing the number of plaques at 40<>C +IBT by the number of plaques at 31°C -IBT.
vo
ON

97
likely reflects the efficiency and the timing of the recombination
event which resolves the G2R gene duplication. For reasons not
understood, the average percentage of IBT resistant viruses obtained
in this experiment was somewhat higher than in subsequent
experiments with mutants AS1-AS9 (see below). IBT resistant
plaques resulting from the Cts56 transient dominant selection were
plaque purified, grown, subject to DNA sequence analysis, tested for
temperature and IBT sensitivity and shown to be indistinguishable
from the original Cts56 virus (Figs. 8 and 9).
Transient dominant selection was repeated with plasmids
containing G2R sequences corresponding to the nine clustered charge
to alanine mutants depicted in Fig. 7. Transient dominant selection
done with four of the mutants (ASI, AS4, AS6, AS9) generated a
significant fraction of IBT resistant viruses similar to the results
obtained with the Cts56 plasmid. The data from a representative
experiment with the AS1 plasmid are shown in Table 3. In this and
subsequent experiments plaque assays in the presence of MPA were
incubated for five days, rather than three days as in the wild-type
and Cts56 transfections, therefore a larger total number of viruses

98
(columns labeled "-IBT") was recovered from these MPA resistant
plaques. In the course of these experiments a total of 70 MPA
resistant plaques from transient dominant selection with Cts56, AS1,
AS4, AS6, or AS9 plasmids were assayed. The fraction of IBT
resistant viruses in these MPA resistant plaques ranged from 0% to
63%, and the average number of IBT resistant viruses for all 70 MPA
resistant plaques was 10.6%. Repeated serial plaque purification of
MPA resistant plaques does not significantly alter the average
number of IBT resistant viruses observed (data not shown). MPA
resistant plaques isolated from five of these transfections (AS2, AS3,
AS5, AS7 and AS8) yielded no IBT resistant progeny viruses above
background levels. The simplest explanation for this result is that
these mutations confer phenotypes indistinguishable from that of
wild-type vaccinia. These mutations were not studied further.
Plaque Formation bv Clustered Charge To Alanine Mutants
IBT resistant plaques from transient dominant selections done
with ASI, AS4, AS6, and AS9 were re-plaque purified, grown, and
subjected to additional phenotypic analysis. Plaque assays

99
demonstrating the phenotypes of these four mutants are shown in
Fig. 8. Previous analysis of G2R mutants indicates that subtle
differences in vaccinia's response to IBT reflects variation in the
activity of the G2R protein product (70). Whereas viruses with wild-
type G2R activity are sensitive to IBT, and complete loss of G2R
function results in viruses which are IBT dependent, resistance to
IBT most likely reflects intermediate levels of G2R activity. Thus the
resistance of Cts56 to IBT at 31°C indicates that it is somewhat
compromised for G2R function, even under permissive conditions.
With this perspective in mind, it is apparent that ASI, AS4, AS6, AS9
each display temperature-sensitive G2R function, as detailed below.
Furthermore, comparison of the mutants reveals a gradient of G2R
temperature sensitivity, where AS1 is the most temperature-
sensitive followed in order by AS6, AS9, and AS4. AS1 is resistant to
IBT at 31°C, and IBT dependent at 40°C, thus G2R function in AS1 is
compromised at 31°C and absent at 40°C, comparable to Cts56. By
contrast to Cts56, minute plaques become visible after prolonged
incubation of AS1 at 40oC in the absence of IBT (data not shown).
AS6 is IBT resistant at both 31°C and 40°C, but the relative plaque

Fig. 8. Plaque formation of G2R clustered charge to alanine
mutant viruses. Plaque assays were incubated in the presence of
45 nM IBT or in the absence of drug at 31°C and 40°C for one week,
and stained with crystal violet.

101
31°-IBT 31°+IBT
G2A
Cts56
AS 1
31°-IBT 31°+IBT
AS 6
40°-IBT
40°-IBT
40°+IBT
40°+IBT
AS 9

102
sizes in the presence and absence of IBT at the two temperatures are
different. At 31<>C, AS6 forms larger plaques in the absence rather
than in the presence of IBT, whereas at 40°C AS6 forms smaller
plaques in the absence of IBT rather then in the presence of IBT.
Thus, G2R function in AS6 is compromised at both temperatures, but
the defect is more pronounced at 40°C than at 31»C. The mutants
AS4 and AS9 both display temperature dependent IBT resistance,
that is, they are sensitive to IBT at 31°C and resistant to IBT at 40°C.
Close inspection of AS4 and AS9 reveals subtle differences in plaque
size under the various conditions tested. For example, in the absence
of IBT, AS9 produces comparably sized plaques at 40oC and 31oC,
however at 40oC it produces slightly larger plaques in the presence
of IBT than it does in the absence of drug. In contrast, in the absence
of IBT, AS4 produces larger plaques at 40°C compared to 31°C, and at
40°C it produces smaller plaques in the presence of IBT than it does
in the absence of drug. These results indicate that in both mutants
G2R function is normal at 31«C and compromised at 40°C, and that
the defect in G2R function at 40C is more pronounced in AS9 than in
AS4. It is noteworthy that in the absence of IBT at 40«C, plaque

103
formation by AS4 is indistinguishable from wild-type virus, whereas
plaque formation by ASI, AS6 and AS9 is in each case measurably
defective relative to wild-type virus.
One Step Growth Experiments
One step growth experiments were performed to further
characterize the phenotypes of the clustered charge to alanine
mutants ASI, AS4, AS6 and AS9 and compare them to wild-type
virus, and Cts56 (Fig. 9). Wild-type virus grown at 31»C or 40<>C
shows a burst size between 10-200 plaque forming units per cell
with maximum yields occurring at 24-48 hours post infection. When
grown at 31<>C, all of the mutants produce normal amounts of
infectious virus with kinetics similar to that of wild-type virus. At
40»C, the growth of AS4 is indistinguishable from wild-type virus.
At 40»C, ASI, AS6, AS9 are unable to produce significant levels of
infectious progeny virus, identical to Cts56. These data demonstrate
that the clustered charge to alanine mutants ASI, AS6, and AS9 are
temperature-sensitive for growth. It is interesting that in this assay,
AS6 and AS9 appear as temperature-sensitive for growth as both

Fig. 9. One step growth experiments of wild type, and G2R
mutant viruses. One step growth experiments were done at an moi
of 6 under both permissive and nonpermissive conditions. Samples
were taken at various times post infections and titered under
permissive conditions. ■, 31°C; •, 40°C.

105
hours post infection

106
Cts56 and ASI, even though they form plaques at 40°C (Fig. 8). The
most likely explanation for this finding is that a very low yield of
virus, undetectable in a one step growth experiment, may be
sufficient for plaque formation.
Marker Rescue of AS1 and Cts56
To prove genetically that the AS1 lesion in G2R was responsible
for the virus’ conditional lethality marker rescue experiments were
carried out with AS1 and the control virus Cts56 (Fig. 10). Cells
infected with either AS1 or Cts56 were transfected with the vaccinia
virus HindIII G fragment or pG2Rap, an Ml3 clone containing only
the G2R open reading frame, and incubated under nonpermissive
conditions (40«C -IBT). The growth defect of AS1 and Cts56 at 40«C
can be rescued by transfecting into the infected cell DNA containing a
wild-type copy of either the entire HindIII G fragment or just the
G2R open reading frame. Rescue of the temperature-sensitive
phenotype most likely occurs by homologous recombination of the
transfected DNA with the mutant viral chromosome, however no
attempt was made to prove that the viruses growing at 40°C contain

Fig. 10. Marker rescue of G2R mutants AS1 and Cts56. Cells
were infected with AS1 or Cts56, transfected with calcium phosphate
precipitated DNA, incubated at 40°C for 3 days and stained with
crystal violet. Infected cells were mock transfected (no DNA)
transfected with a full length HindIII G fragment (HindIII G) or an
ml3mpl9 clone containing only the G2R open reading frame
(pG2Rap). Below, a HindIII restriction map of the vaccinina virus
chromosome showing the position and the transcriptional orientation
of the genes within the HindIII G fragment. |m¡ relative map
position of the HindIII G fragment used in the marker rescue
experiments. ggg relative map position of the pG2Rap clone used
in the marker rescue experiments.

108
No DNA
Hindlll G
AS 1
pG2Rap
Cts56
C NMKF EOIGLJH D
I III I I III I I I I I
ItTkb x ^ ^ -
Hindlll G
I
pG2Rap
VSSSSSA
G2R G5R G6R G8R G9R
G1L G3LG4L G7L

109
a wild-type copy of the G2R gene. The simplest interpretation of
these data is that the mutation responsible for temperature
sensitivity in AS 1 and also Cts56 maps to the G2R open reading
frame. Plaques seen in the absence of transfected DNA in the Cts56
experiment most likely represent revertants of Cts56 which have lost
their temperature sensitivity.
Discussion
This study has demonstrated that temperature-sensitive
conditionally lethal mutants can be created in a specific vaccinia
virus gene, G2R, with high efficiency using clustered charge to
alanine mutagenesis and transient dominant selection. The yield of
temperature-sensitive mutants is comparable to experiments done
with the yeast actin gene (130) and the poliovirus 3D polymerase
(25). Of nine clustered charge to alanine mutants tested, four (44%)
displayed some degree of temperature sensitivity in a plaque assay
as evidenced by plaque size or by an altered response to the
antipoxviral drug IBT. Three of the mutants (33%) were clearly

110
conditionally lethal for growth at 40<>C in a single step growth
experiment. Since biochemical experiments with temperature-
sensitive mutants are usually done under conditions of infection
identical to those used for a one step growth experiment, the three
mutants which are temperature-sensitive in a one step growth
experiment should be suitable for biochemical analysis of G2R gene
function in vivo.
The experiments with G2R suggest a general protocol for
isolation of temperature-sensitive mutants in genes for which there
is no selection. Mycophenolic acid resistant plaques isolated after
transient dominant selection contain approximately 11% mutant
viruses with frequencies ranging from 0% - 60% when individual
MPA resistant plaques are compared. Therefore, to screen for
temperature-sensitive mutants using transient dominant selection, at
least 50 total viruses, isolated from at least 5 different MPA resistant
plaques, should be tested for temperature sensitivity in a plaque
assay. Any virus which shows reduced plaque size at 40«C has the
potential to be temperature-sensitive in a one step growth

experiment. This protocol has been successfully tested by isolating
the AS1 virus mutant without using IBT selection (data not shown).
The combination of clustered charge to alanine mutagenesis
and transient dominant selection provides poxvirologists with a
powerful tool for the targeted construction of temperature-sensitive,
conditionally lethal vaccinia virus mutants. It should therefore now
be possible to create conditional lethal mutations in genes that have
until now proved refractile to standard genetic techniques.

CHAPTER 4
CONSTRUCTION AND CHARACTERIZATION OF A NOVEL CONDITIONAL
LETHAL MUTANT IN THE LARGE SUBUNIT OF THE VACCINIA VIRUS
mRNA CAPPING ENZYME
Introduction
Vaccinia, an orthopoxvirus, is a large double-stranded DNA
virus that replicates in the cytoplasm of infected cells (78). One
consequence of cytoplasmic replication is that the virus must encode
most of the genetic information necessary for DNA replication and
controlled gene expression. Vaccinia gene expression, which is
regulated primarily at the level of transcription, occurs in a cascade
which consists of three temporally distinct phases: early,
intermediate and late (reviewed in 79). The control of transcription
from each class of genes is modulated by class-specific cis and trans
acting factors (reviewed in 79). Specifically, early genes are

113
transcribed by enzymes packaged within the virion, a subset of early
proteins then act as transcription factors for intermediate genes, a
subset of which then serve as transcription factors for late gene
expression. The cascade is completed by the packaging within the
developing virion of the transcriptional machinery needed for early
gene expression. An additional level of control is provided by viral
DNA replication, which is required for the transcription of both
intermediate and late genes (79).
The vaccinia genome consists of 192 kilobases of double-
stranded, covalently closed linear DNA (41). Of the 200 proteins
encoded by the viral genome two of the most interesting form the
heterodimeric mRNA capping enzyme. The vaccinia mRNA capping
enzyme consists of a 97 kDa large subunit, the product of the DIR
gene and a 33 kDa small subunit, encoded by the D12L gene (77, 86).
The vaccinia virus mRNA capping enzyme is of particular interest
because, in addition to its role in capping mRNA, it also functions as
an early gene transcription termination factor and an intermediate
gene transcription initiation factor (109, 114, 126).

114
The mRNA capping enzyme converts the 5’ triphosphorylated
end of mRNA to a cap 0 structure in a series of reactions which
require mRNA triphosphatase, guanyltransferase and (guanine-
7)methyltransferase enzymatic activities (108, 115, 124). The mRNA
triphosphatase and guanyltransferase domains have been mapped to
a 60 kDa amino terminal proteolytic fragment of the large subunit
(DIR) (107). The (guanine-7)methyltransferase activity is contained
within a stable heterodimer formed between the carboxyl terminal
proteolytic fragment of DIR and the D12L protein (16, 46, 107). The
structure of the 5’ cap on eukaryotic mRNA is highly conserved and
required for optimal translational competency and mRNA stability
(reviewed in 75, 105).
The vaccinia capping enzyme also functions as an early gene
transcription termination factor (109). Transcription of early viral
genes generates mRNAs which are homogeneous in length due to
specific sites of transcription initiation and termination. Early
transcription termination requires the vaccinia virus mRNA capping
enzyme and the cis-acting sequence UUUUUNU in the nascent
transcript (113, 114). In a process which is not completely

115
understood the capping enzyme catalyzes the termination of
transcription 50-75 nucleotides downstream of the sequence
UUUUUNU (114). Although a specific transcription termination
domain has not yet been identifed, termination requires an intact full
length heterodimer and is independent of mRNA cap formation (63).
Interestingly, discrete termination of intermediate and late
transcription does not occur, this results in the formation of mRNAs
which are heterogeneous in length at their 3’ ends (18, 67).
The vaccinia mRNA capping enzyme has also been shown to be
required for the initiation of intermediate gene transcription (126).
A stable complex forms between the capping enzyme and the viral
RNA polymerase (126). Complex formation is necessary prior to
binding of the polymerase at the intermediate promoter (126). The
domain responsible for the interaction of the mRNA capping enzyme
with vaccinia RNA polymerase is unknown, however the
transcription initiation activity ascribed to the capping enzyme
requires an intact full length heterodimer and is independent of
mRNA capping (44).

116
Along with its role in capping mRNA, early mRNA termination
and intermediate mRNA initiation, the vaccinia capping enzyme has
also been genetically implicated in the resolution of viral telomeres
during late stages of infection (10). The termini of the vaccinia virus
chromosome consist of incompletely base paired hairpin loops
termed flip and flop (reviewed in 5). The sequences of flip and flop
are inverse and complementary with respect to each other. DNA
replication proceeds via concatameric intermediates that are joined
together in a head to head or tail to tail fashion (reviewed in 123).
The junctions between genomes consists of a duplex copy of the
hairpin loop that is, flip and flop base paired with each other.
Resolution of the concatamer into unit length genomes, a process
known as telomere resolution, involves an uncharacterized site-
specific recombination event that reconstitutes the terminal hairpin
loops (reviewed in 23). Telomere resolution is dependent upon two
inverted copies of a cis-acting telomere resolution target (22, 24).
One copy of each telomere resolution target is located on either side
of the concatamer junction. The telomere resolution target has been
shown to function as a viral promoter during the late stages of the

117
viral infection, implying that transcription may play a role in the
resolution process (119). In addition, temperature-sensitive vaccinia
virus mutants which are defective in late gene expression, are also
defective in the resolution of viral telomeres which implies that a
late protein (or proteins) is responsible for resolution (74).
Interestingly a temperature-sensitive mutation which has been
mapped to the small subunit of the vaccinia virus mRNA capping
enzyme, gene D12L, exhibits seemingly normal protein and DNA
synthesis under nonpermissive conditions, but is unable to resolve
viral telomeres at the nonpermissive temperature (10). Although
the phenotype of this mutant genetically implicates the mRNA
capping enzyme in telomere resolution, there is no direct biochemical
evidence that the vaccinia capping enzyme participates directly in
the resolution of viral telomeres.
Most of the information available on the capping enzyme is
derived from in vitro analysis of enzyme isolated from the virion or
from bacteria expressing recombinant capping enzyme. In an effort
to understand the biological role capping enzyme plays in vivo
during the course of a vaccinia virus infection, clustered charge to

118
alanine mutagenesis and transient dominant selection were used to
generate vaccinia viruses containing temperature-sensitive lesions in
the large subunit of the vaccinia virus mRNA capping enzyme.
Results
Domain Structure and Amino Acid Sequence of DIR
The amino acid sequence and the domain structure of the DIR
protein, the large subunit of the heterodimeric vaccinia virus mRNA
capping enzyme, is shown in Fig. 11. The DIR protein contains the
active sites for RNA triphosphatase, guanyltransferase and (guanine-
7)methyltransferase enzymatic activities (47, 68, 112).
Guanyltransferase and RNA triphosphatase active sites have been
localized to an amino terminal 60 kDa proteolytic fragment of DIR
(107). The guanyltransferase domain has been further defined as
encompassing the amino terminal 273 amino acids of DIR. During
the guanyltransferase reaction, a covalent enzyme intermediate
forms between lysine 260 and GMP, implicating this amino acid in

119
the guanyltransferase active site (17, 84). Coexpression in bacteria
of a plasmid which encodes amino acids 498-844 of DIR and a full
length D12L protein results in the formation of a stable heterodimer
capable of wild-type levels of methyltransferase activity.
However,low levels of methyltransferase activity have been detected
by expression of only amino acids 540-844 of DIR (46, 68).
Therefore, the carboxyl terminal 304 amino acids of DIR, between
amino acids 540-844, contains the (guanine-7)methyltransferase
active site as well as residues required for the interaction of DIR
with D12L (68). Although the methyltransferase active site is
completly contained within the carboxyl terminal portion of DIR, it is
clear that heterodimerization between DIR and D12L is required for
full methyltransferase activity. S-adenosyl-L-methionine (Adomet),
the methyl group donor in the methyltransferase reaction, has been
covalently photocrosslinked to amino acids 499-579 and 806-844,
implicating these residues in the binding of Adomet (48).
Mutations were made in cloned copies of the DIR gene that
altered the DIR protein coding sequence such that clusters of charged
amino acids were mutated to alanines (Fig. 11) and each of these

Fig 11. Deduced amino acid sequence of the DIR gene product and DIR mutant gene
products. Underlined residues indicate charged amino acids mutated to alanines. The numerical
designation given to each mutant is shown above the appropriate residues. The italicized underlined
numbers show the position of the mutations in the four mutant viruses isolated during the transient
dominant selection. Shading indicates the position of the previously mapped guanyltransferase (Gtase),
(guanine-7)methyltransferase (Mtase) and S-adenosyl-L-methionine binding (SAM) domains. The dot
above lysine 260, indicates the amino acid previously shown to form a covalent bond with GMP in the
enzyme GMP intermediate.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
MDANVVSSST IATYIDALAK NASELEQRST AYEINNELEL VFIKPPLITl TNVVNISTIQ
ESFIRFTVTN KEGVKIRTKI PLSKVHGLDV KNVQLVDAID NIVWEKKSIV TENRLHKECL
126
LRLSTEERHI FLDYKKYGSS IRLELVNLIQ AKTKNFTIDF KLKYFLGSGA QSKSSLLHAI
NHPKSRPNTS LEIEFTPRDN ETVPYDELIK ELTTLSRHIF MASPENVIIS PPINAPIKTF
•
MIPKQDIVGl DLENLYAVTK TDGIPITIRV TSNGLYCYFT HLGYIIRYPV KRIIDSEVVV
326
FGEAVKDKNW TVYLIKLIEP VNAINDRLEE SKYVESKLVD ICDRIVFKSK KYEGPFTTTS
392
EVVDMLSTYL PKQPEGVILF YSKGPKSNID FKIKKENTID QTANVVFRYM SSEPIIFGES
SIFVEYKKFS NDKGFPKEYG SGKIVLYNGV NYLNNIYCLE YINTHNEVGI KSVVVPIKFI
¡pip ¿¿s c't
AEFLVNGEIL KPRIDKTMKY INSEDYYGNQ BNIIV&MQ QSIKIGDIFN EDKLSDVGHQ
545 558
YANNMFRLN PEVSYFTNKE trgplgilsn yvktllismy csktflddsn krkvlaidfg
NGADLEKYFY GEIALLVATD PDADAIARGN ERYNKLNSGI KTKYYKFDYI QETIRSDTFV
SSVREVFYFG KFNIIDWQFA IHYSFHPRHY ATVMNNLSEL TASGGKVLIT TMDGDKLSKL
TDKKTFIIHK NLPSSENYMS VEKIADDRIV VYNPSTMSTP MTEYIIKKND IVRVFNEYGF
293 806
VLVDNVDFAT IlffiSj&FIN GASTM£CfiPS TRNFFEtNRG AIKCEGLDVE DtLSYYVVYV
GTase
MTase
121

122
mutations were tested for the ability to confer a temperature-
sensitive phenotype on vaccinia virus. Transient dominant selection
was done to transplace the wild-type copy of DIR on the viral
chromosome with a clustered charge to alanine mutant allele (33).
Specifically, cells infected with wild-type virus were transfected with
a plasmid containing both the Escherichia coli guanine
phosphoribosyltransferase gene (ecogpt), a dominant selectable
marker under the transcriptional control of a vaccinia promoter and
a mutant copy of DIR. After a three day incubation the infected cells
were harvested and a viral lysate was prepared. During the
infection-transfection, the plasmid becomes integrated into the viral
genome by single crossover homologous recombination between
plasmid and chromosomal DIR sequences. To select for recombinants
which have integrated the plasmid and are expressing ecogpt, the
viral lysate was plaqued in the presence of the purine biosynthesis
inhibitor mycophenolic acid (MPA). During the growth of each MPA
resistant plaque, resolution occurs via recombination between the
two genomic copies of DIR, resulting in viruses which have lost the
ecogpt gene and contain only a single copy of the DIR gene. Each

123
MPA resistant plaque therefore contains a mixture of viruses, some
of which contain a mutant copy of DIR originally derived from the
transfected plasmid, while others retain a wild-type copy of DIR.
Five individual MPA resistant plaques from each transfection were
picked and plaque titrated at 31»C to isolate individual viruses which
have resolved the ecogpt gene and now contain either a wild-type or
a mutant copy of DIR. Viruses which contain a mutation that confers
a lethal phenotype will not form plaques, therefore they are
undetectable in this assay. Previous transient dominant selection
experiments indicate, on average, 11% of the total progeny within
each MPA resistant plaque contain the mutation of interest whereas
another 10% retain the ecogpt cassette (see chapter 3). To screen for
temperature sensitivity, 50 individual plaques from each
transfection, 10 from each of the 5 original MPA resistant plaques,
were picked and plaque titrated at 31<>C and 40°C. The high levels of
non-mutant viruses within each MPA resistant plaque makes it
difficult to use this screening procedure to detect any mutation
which confers a wild-type phenotype.

124
Plaque Phenotypes of DIR Mutant Viruses
During the screening procedure four of the mutant plasmids
yielded viruses that were either temperature-sensitive for plaque
formation or that produced smaller plaques than wild-type at 31°C
or 40°C (Fig. 12). Viruses containing any of the remaining 5
mutations were not recovered, therefore it was assumed that these
mutations confer either wild-type or lethal phenotypes. The plaque
phenotypes of the four mutant viruses fell into three distinct classes.
At both temperatures, El26 produced plaques that were
distinguishably smaller than wild-type. The El26 virus also showed
a slight (less than 2 log) reduction in titer at 40°C compared to 31°C
(data not shown). The D326 virus produces a heterogeneous mixture
of large and small plaques at both temperatures, with no detectable
decrease in titer at 40C. Small plaque variants of D326 were re¬
plaque purified at 31°C and showed the same heterogeneity (data not
shown). The mutants E516 and E793 were both temperature-
sensitive for plaque formation at 40oC. E516 and E793 showed a 3
and 7 log reduction in plaque titer respectively, at 40<>C when

Fig 12. Plaque formation of wild type and the four DIR
clustered charge to alanine mutants viruses. Plaque assays
were incubated at 31°C or 40°C for 1 week and stained with crystal
violet.

126
31 °C 40°C

127
compared to 31»C (data not shown). Interestingly, although the E793
virus is profoundly temperature-sensitive in a plaque assay, the
plaques produced at 31°C are the same size as those produced by
wild-type virus at 31»C (Fig. 12).
One Step Growth Experiments
The phenotypic characterization of temperature-sensitive
mutants is done under high multiplicity of infection conditions.
Therefore in order for these results to be meaningful, the mutants
must be temperature-sensitive for growth under these same
conditions. One step growth experiments were done to determine if
E126, D326, E516 or E793 were temperature-sensitive for growth
under high multiplicity of infection conditions (Fig. 13). BSC40 cells
were infected at an moi of 6 at either 31°C or 40«C. Infected cells
were harvested at various times and the progeny were quantitated
by plaque titration at 31<>C. Wild-type virus grown at 31°C or 40<>C
showed a burst size of between 50 and 100 plaque forming units per
cell with a maximum yield occurring between 48 and 72 hours post
infection. The mutants El26, D326 and E516 produced significantly

Fig 13. One step growth experiments of wild type and of DIR mutant viruses. BSC40 cells
were infected at an moi of 6 at 31°C and 40°C. Samples were taken at various times post infection and
titered at 31oC for one week. ■, 31°C; •, 40<>C.

pfu/cell
hours post infection hours post infection hours post infection
hours post infection hours post infection

130
less virus than wild-type at both temperatures. However, all of
these viruses grew at least as well at 40«C as at 31<>C therefore none
of these viruses are temperature-sensitive for growth in this assay.
The remaining mutant, E793 is clearly temperature-sensitive for
growth during high multiplicity infections. At 31°C the burst size of
E793 is between 40 and 50 plaque forming units per cell, similar to
wild-type virus, whereas at 40«C this mutant is incapable of
producing infectious progeny.
Due to its conditional lethality in a one step growth experiment,
E793 appears to be the only biochemically useful temperature-
sensitive mutant isolated by screening the 9 clustered charge to
alanine alleles of DIR. E793 virus was therefore subjected to further
phenotypic analysis in vivo in an attempt to determine the defect
responsible for the observed temperature sensitivity.
Marker Rescue of E793 Temperature Sensitivity
To confirm that the temperature-sensitive lesion on the E793
viral chromosome is within the DIR gene, cells were infected with
E793, transfected with cloned fragments of wild-type genomic DNA

131
and incubated at 40<>C. Following a 3 day incubation at 40»C the cell
monolayers were stained and examined for plaques (Fig. 14). Double
crossover recombination events between the tranfected DNA and the
E793 chromosome, which replace the temperature-sensitive allele
with a wild-type allele generate a virus which is able to form a
plaque at 40<>C. The rescue of a temperature-sensitive marker with
cloned fragments of wild-type DNA can therefore be used to map the
position of a temperature-sensitive lesion on the viral chromosome
(27, 120). Two overlapping cosmid clones of wild-type vaccinia virus
strain WR, capable of rescuing the temperature sensitivity, place the
temperature-sensitive lesion between nucleotides 7,400 and 9,800
on the E793 chromosome, within the HindIII D fragment (Fig. 14)
(120). Rescue of the temperature sensitivity was also accomplished
with a plasmid clone containing only the DIR open reading frame
(pGEM3DINco-) confirming that the mutation responsible for the
temperature sensitivity of the E793 virus lies within the DIR gene
(47). The presence of the E793 mutation in DIR was confirmed by
DNA sequencing of DIR specific PCR amplification products from
E793 viral DNA (data not shown). The simplest explanation of these

Fig 14. Marker rescue of the E793 temperature sensitive lesion. Cells infected with E793 were
transfected with calcium phosphate precipitated DNA, incubated at 40»C for 3 days and stained with
crystal violet. Solid bars indicate the relative map position of the clones used in the marker rescue
experiments.

NODNA pWR 67-98 pWR74-111 pGEM3D1Nco-
pWR 74-111
pWR 67-98
10 kb
pGEM 3D1Nco-
C NMK F EOIGLJH D
HI l I III I l l I L
B
LO

134
data is that the E793 mutation is responsible for the temperature
sensitivity of the E793 virus.
In Vivo Protein Synthesis of E793 Infected Cells
This simplest way to determine if there is a defect in the
orderly progression of the vaccinia virus life cycle is to examine
protein synthesis within infected cells by in vivo protein pulse
labeling. Proteins within E793 infected cells were pulse labeled at
various times post infection with 35S Trans label, separated by SDS
PAGE and detected by autoradiography (Fig. 15). The normal pattern
of protein synthesis can be seen most clearly by examination of the
wild-type infection at 40°C. The shut off of host protein synthesis
and the appearance of viral early proteins is evident by 2 hours post
infection. Labeling of early viral proteins diminishes by 6 hours post
infection. Labeling of late proteins begins at 4 hours and persists up
to at least 16 hours post infection. The pattern of protein synthesis
in the wild-type infection at 31°C is slightly delayed due to the
decreased growth temperature but is otherwise identical to the wild-
type infections carried out at 40oC. In the E793 infections at both
1

Fig 15. Protein synthesis of wild type and E793 infected BSC40 cells. Cells were infected at
31»C or 40>C with the virus indicated at the left and then pulse labeled for 15 minutes with [35S] labeled
amino acids at the times post infection indicated above each figure. Cells were harvested, and proteins
were separated on a 10% SDS-polyacrylamide gel and autoradiographed. The autoradiograms are shown.
Approximate molecular weights in kDa, are shown on the left.

LO
O
11 :m 11

137
31<>C and 40»C there appears to be less intense protein labeling and a
2 hour delay in the pattern of expression inthe mutant infections
when compared to wild-type. The decrease in the intensity of
labeling indicates that protein synthesis in the E793 infections is less
robust than in wild-type infections, suggesting that E793 is slightly
compromised for growth at both temperatures. However because the
decrease in the intensity of labeling and the 2 hour delay in
expression are as apparent at 40°C as at 31°C it is unlikely that either
are responsible for the temperature sensitivity of the E793 virus.
Viral DNA Accumulation in E793 Infected Cells
To determine if viral DNA replication was compromised in the
mutant infections at 40«C, a time course of wild-type and E793 DNA
accumulation was determined at both 31»C and 40oC. Total DNA was
isolated from wild-type or E793 infected cells at various times post
infection, fixed to a nylon membrane and hybridized to radiolabeled
wild-type vaccinia genomic DNA. The radioactivity bound to the
membrane was quantitated by phosphorimage analysis (Fig. 16).

Fig 16. DNA accumulation of wild type and E793 viral DNA.
A Southern blot was done with total DNA isolated at various times
post infection, from BSC40 cells infected at 31°C or 40°C with wild
type (1) or E793 (2). The blot was hybridized to radiolabeled wild
type vaccinia DNA and the relative amount of bound probe was
determined by phosphorimage analysis.

DNA accumulation (arbitrary units)
o
fO
o
o
O)
o
00 o
o o
N>
o
DNA accumulation (arbitrary units)
ro -u o oo o ro 4*
oooooooo
O)

140
Equivalent amounts of total DNA were loaded in each lane as judged
by ethidium bromide staining of the agarose gel (data not shown).
An increase in the amount of viral DNA in the wild-type infections
can be detected as early as 4 hours post infection at 40oCand 6 hours
post infection at 31oC. This increase in the amount of viral DNA is
evident throughout the course of the experiment. A similar pattern
of DNA synthesis was observed in cells infected with E793 virus at
both 31°C and 40°C. By 6 hours post infection there is an increase in
the amount of viral DNA in the E793 infection and this trend
continues up to at least 18 hours post infection. The variability in
the amount of viral DNA present in each sample is most likely the
result of errors introduced during the dilution of the sample prior to
loading onto the blotting apparatus. Nevertheless, for both wild type
and E793 at both 31<>C and 40°C there is an increase in the amount of
viral DNA present in the 18 hour samples relative to the 0 hour
samples. Thus, as one might expect from the appearance of late viral
proteins, the synthesis of which is coupled to DNA replication, the
E793 mutant is not temperature-sensitive for DNA synthesis.

141
Viral Gene Expression in E793 Infected Cells
Northern blot analysis was done on RNA isolated at various
times post infection from wild-type and E793 infected cells to assess
the kinetics of mRNA synthesis and the relative quantity and
structure of specific early, intermediate and late viral transcripts.
This experiment was also done to determine specifically whether the
early transcription termination and intermediate transcription
initiation functions of the E793 capping enzyme remain intact at both
31°C and 40oC. Total RNA isolated at various times post infection
from wild-type or E793 infections incubated at 31°C or 40°C was
separated on agarose formaldehyde gels, transferred to nylon
membranes and hybridized to early (C11R), intermediate (G8R) and
late (F17R) gene specific antisense riboprobes (Fig. 17). Equivalent
amounts of total RNA were loaded in each lane as judged by
ethidium bromide staining of the agarose formaldehyde gels (data
not shown). The hybridization of RNA from wild-type infected cells
to a probe specific for the vaccinia growth factor gene (gene C11R), a
well characterized early transcript, reveals that C11R message can be

Fig 17. Northern analysis of viral RNA isolated from wild type or E793 infections.
Northern blot analysis was done on total RNA isolated at the times indicated above each lane. The
virus and infection conditions are indicated at the top of the figure. Membranes were probed with
riboprobes specific for an early gene (C11R), an intermediate gene (G8R) or a late gene (F17R) as
indicated to the left and autoradiographed, an autoradiogram is shown.

early
intermediate
wt, 31 °C wt,40°C
i i i i
01.53 6 9 12 01.5 3 6 9 12
late
793, 31 °C 793, 40°C
i 1 i i
01.5 3 6 9 12 0 1.5 3 6 9 12
I I I I I I I I I I I I

144
detected at 31°C and 40<>C as early as 1.5 hours post infection. At
31<>C the C11R mRNA is present up to at least 12 hours post infection,
although maximal levels appear to peak at about 3 hours post
infection. At 40«C the levels of C11R mRNA also peak at about 3
hours post infection before rapidly declining by 6 hours. The E793
mutant infections reveal subtle differences in the overall steady
state levels of early mRNA. Like the wild-type infections, C11R
mRNA is detectable by 1.5 hours post infection at both temperatures,
however at 31°C C11R mRNA does not persist after 6 hours post
infection. At 40«C the kinetics of C11R mRNA expression appear
identical to wild-type although there does seem to be more C11R
mRNA present at 6 hours post infection. The hybridization of RNA
isolated from E793 or wild-type infected cells to a probe for G8R, an
intermediate gene which encodes a late transcription factor, reveals
no differences between the wild-type and E793 infections. The
smearing of intermediate and late mRNAs observed with the
intermediate and late probes is due to the fact that unlike early
transcripts, intermediate and late mRNAs have heterogeneous 3’
ends (18, 67). Maximal levels of G8R mRNA in the wild-type and

145
mutant infections are detected at between 6 and 9 hours at 31°C, and
at 6 hours at 40<>C. Analysis of the pattern of expression of the F17R
gene, which encodes an 11 kDa virion structural protein reveals
slight differences between the wild-type and E793 mutant infections.
At 31»C a small amount of F17R mRNA can be detected in the wild-
type infections by 6 hours and mRNA levels progressively increase
up to at least 12 hours post infection. The wild-type infection at
40°C shows similar kinetics of expression although the overall levels
of F17R mRNA are increased relative to 31°C reflective of the
increased growth temperature. The kinetics of expression of F17R
mRNA are the same in the E793 infections, however it does appear
that the steady state level of F17R mRNA present in the E793
infections at both temperatures is increased in comparison to wild-
type. The data from the northern analysis shows that gene
expression is not temperature-sensitive in the E793 infections at
40°C. Although there are minor differences in the kinetics and
quantity of mRNA expression none of these differences seem to
account for the inability of the E793 virus to produce infectious
progeny at 40«C. The presence of the three classes of mRNAs

146
indicates that there is no defect in temporal regulation of gene
expression in the E793 infections at either 31°C or 40°C. More
importantly, the discrete size of the early transcripts and the
appearance of the G8R intermediate mRNA prove that the early
transcription termination and intermediate transcription initiation
activities of the E793 mRNA capping enzyme remain intact at both
31°C and 40oC. Therefore, these data indicate that the E793 virus is
not temperature-sensitive in vivo for early transcription termination
or intermediate transcription initiation.
Viral Morphogenesis of E793
At the nonpermissive temperature E793 infected cells contain
late proteins and viral DNA but produce no infectious progeny,
therefore it was hypothesized that E793 could be defective in virion
morphogenesis. Electron microscopy of wild-type and E793 infected
cells was done to determine if the E793 virus is able to synthesize
mature viral particles at 31«C and 40oC. Vaccinia morphogenesis
occurs within discrete areas of the cytoplasm known as viral
factories or virosomes, (reviewed in 78). Virosomes consist of an

147
electron dense substance known as viroplasm which is thought to
contain viral DNA and protein. The first step in morphogenesis is the
appearance of a membraneous crescent shaped structure within the
viroplasm. The crescent envelopes a portion of the viroplasm,
forming a spheroid shaped immature particle which appears circular
on a two dimensional electron micrograph. The circular immature
particle matures into the characteristic brick shaped, infectious
virion. To assess viral morphogenesis electron micrographs were
prepared at 24 hours post infection from wild-type and E793
infected cells grown at 31»C and 40°C. (Fig. 18). Immature and
numerous mature virions can be clearly observed in the wild-type
infected cells grown at 40oC. The cytoplasm of cells infected at 31°C
with either wild-type or E793 were comparable and contained
immature and some mature particles (not shown in the micrographs)
centered around the viral DNA or viroplasm. The relative scarcity of
mature particles in the wild-type or E793 infections at 31»C relative
to wild-type at 40<>C reflects the delay in development due to the
lower temperature of incubation. In addition, fewer mature particles
were observed in cells infected with E793 at 31«C than in cells

Fig 18. Electon micrographs of BSC40 cells infected with wild type or E793 virus at 31<>C
and 40»C. Cells were infected at an moi of 10 and processed for electron microscopy at 24 hours post
infection. (1), wild type 31°C (2), wild type 40°C (3), E793 31°C (4) E793 40°C. V- viroplasm; C-crescent;
I-immature particle; M-mature particle. Magnifications 1) x 12,500 2) x 8,750 3) x 15,000 4) x 10,000

On

Fig. 18. continued
150

151
panuuuoo 'gx ‘Sij

Fig. 18. continued
152

153
infected with wild-type at 31«C which may indicate that the E793
virus is slightly compromised for growth at 31°C. However, there is a
clear difference between the wild-type and mutant infections at
40°C. Virtually all of the cells infected with E793 at 40«C contained
large amounts of viroplasm and occassionally some immature
particles, but no mature viral particles were seen. A micrograph of
one of the few cells containing any immature viral particles is shown
in Fig. 18. Immature particles within cells infected with E793 at 40°C
were extremely rare and in no case were mature particles ever seen.
These results indicate that under nonpermissive conditions the
temperature sensitivity of the E793 virus leads to a block in virion
morphogenesis at its earliest stages.
Resolution of E793 Telomeres
A previously described temperature-sensitive mutation in the
small subunit of the vaccinia virus capping enzyme (ts9383) has
been shown to be capable of normal protein synthesis but is
defective in the resolution of viral DNA into genome length units
(10). Characterization of this mutant at 40«C by electron microscopy

154
has revealed that the infected cells contain viroplasm and defective
crescents, as well as a few immature and mature particles (20).
Because this mutation was in a subunit of the mRNA capping enzyme
and like E793 was defective in morphogenesis it was therefore of
interest to determine if the E793 mutant is defective in telomere
resolution. Resolution of poxvirus concatamers into genomic length
monomers containing hairpin ends can be assayed by Southern blot
analysis of viral DNA isolated at 24 hrs post infection (74). The
presence of a BstEII restriction endonuclease site within the inverted
terminal repeats, directly adjacent to the viral telomeres, can be used
to differentiate between monomeric and concatameric forms of
vaccinia genomic DNA. BstEII digestion of a genome length monomer
generates 2 1.3 kb fragments, one derived from either side of the
genome (Fig 19). Each 1.3 kb fragment contains the viral telomere
and flanking inverted terminal repeat sequences (74). Because the
concatamer junction is a duplex copy of a viral telomere digestion of
concatameric DNA with BstEII generates a 2.6 kb fragment consisting
of the concatamer junction flanked on either side by inverted
terminal repeat sequences (Fig. 19). The relative efficiency of

155
telomere resolution can be expressed as the proportion of telomere
ends (1.3 kb BstEII fragments) over the amount of unresolved
concatamers (2.6 kb BstEII fragments). Total DNA was prepared
from cells infected at either 31°C or 40°C with wild-type, E793 or the
control virus Cts53. The Cts53 virus has a temperature-sensitive
mutation in the large subunit of the vaccinia RNA polymerase and is
defective in late protein synthesis (51). Late protein synthesis is
required for telomere resolution, therefore Cts53 is also defective in
the resolution of telomeres at 40°C (74). Total DNA from infected
cells was isolated at 6 and 24 hours post infection, cut with BstEII
and separated on an agarose gel. Equivalent amounts of total DNA
were loaded in each lane as judged by ethidium bromide staining of
the agarose gel (data not shown). The DNA was transferred to a
nylon membrane and hybridized to a radiolabeled plasmid which
contains a full length concatamer junction (74) (Fig. 19). There
appears to be two bands of 1.3 kb in length, one possible explanation
is that these bands correspond to flip and flop. Radioactivity bound
to the membrane was quantitated by phosphorimage analysis and
the resolution efficiency of the 24 hour samples was determined

156
(Table 4). The resolution efficiency was defined as the ratio of the
relative amounts of radioactivity hybridized to the 1.3 kb telomere
fragments versuses the 2.6 kb concatamer fragment.
The 11.2 kb fragment seen on the autoradiogram contains
direct repeat sequences proximal to both the telomere and the
concatamer junction that hybridize to direct repeat sequences in the
probe (74). Because digestion of both monomeric and concatameric
DNA with BstEII yields an 11.2 kb fragment, the labeling intensity of
this fragment can be used as a rough measure of the total amount of
viral DNA present in each sample.
Comparison of the resolution efficiencies and the amount of
concatameric DNA present in the E793 and wild type infections at 24
hours post infection indicates that E793 is defective in telomere
resolution at 40°C. In the 31°C wild-type infections, a small amount
of concatameric DNA (2.6 kb fragment) can be detected by 6 hours
post infection. By 24 hours there is an increase in the amount of
total DNA (11.2 kb fragment), a slight increase in the amount of
concatameric DNA, and a large increase in the amount of resolved
unit length genomic DNA (1.3 kb fragment). At 31°C, the resolution

Fig 19. Telomere resolution of wild type, E793 and Cts53 at
31«C and 40»C. Total DNA was isolated at the times indicated above
each lane and analyzed by digestion with BstEII, electrophoresis
through a 1.5% agarose gel and Southern blotting with radiolabeled
pBD plasmid, an autoradiogram is shown. The virus and infection
conditions are indicated at the top of the figure. The 1.3 kb telomere
fragment and the 2.6 kb concatamer junction are indicated to the
left. Bottom. Schematic representation of the 1.3, 2.6 and 11.2 kb
BstEII fragments derived from monomeric (Telomere) or
concatameric (Concatamer) viral DNA. BstEII sites are indicated by
arrows. I I direct repeat sequences. Relative size and
genomic position of the concatamer junction fragment in plasmid
pBD.

158
11.2 kb
2.6 kb
1.3 kb
wt E793 Cts53
' 31 °C 40°C ' '31°C 40<>C,,31oC 40°C 1
6 24 6 24 6 24 6 24 6 24 6 24
Telomeres
Concatamer
Bst E II
1.3 kb
1
11.2 kb 2.6 kb
pBD
11.2 kb

159
Table 4. Telomere resolution efficiency
Infection
resolutionf
efficiency
wild type 31»C
1.78
wild type 40<>C
0.99
Cts53 31oC
0.80
Cts53 40«C
0.49
E793 31oC
1.14
E793 40°C
0.49
Phosphorimage analysis of the 24 hour samples was carried out on the
Southern blot shown in Fig. 19. t Resolution efficiency was calculated as the
ratio of the intensity of the 1.3 kb telomere band over the intensity of the 2.6
kb concatamer junction band.

160
efficiency of wild-type virus is 1.78. By 6 hours post infection in the
wild-type infections at 40°C there is a large amount of viral DNA,
most of which has already been resolved into genome length
monomers (compare the 1.3 kb band to the 2.6 kb band). By 24
hours post infection at 40»C there is a further increase in the total
amount of wild-type DNA, half of which is in the form of high
molecular weight concatamers (2.6 kb band) and half of which is in
the form of monomers (1.3 kb band). 24 hours post infection at 40°C
the resolution efficiency of wild-type virus is 0.99. The results seen
with the Cts53 virus demonstrate the pattern expected of a mutant
which is temperature-sensitive for telomere resolution. At 24 hours
post infection at 31°C the resolution efficiency of Cts53 is 0.88, less
than that of wild-type, indicating that Cts53 may be slightly
defective for telomere resolution at 31°C. In the Cts53 infections at
40°C by 24 hours post infection there is an increase in the amount of
concatameric DNA relative to monomeric DNA. The resolution
efficiency of Cts53 24 hours post infection at 40«C is 0.49, half that of
wild-type at 40«C, which confirms the previously reported
observation that Cts53 is unable to efficiently resolve viral telomeres

161
at 40«C (74). Analysis of the E793 infections reveals that the pattern
of resolution at 31°C is similar to wild-type. At 31»C by 6 hours post
infection most of the E793 DNA is in the form of high molecular
weight concatamers (compare the intensity of the 2.6 kb concatamer
junction band to the 1.3 kb telomere bands). By 24 hours post
infection at 31»C some of the concatameric DNA has been resolved
into unit length genomes and the resolution efficiency is 1.14, which
is similar to wild-type virus at 31°C. At 40°C however telomere
resolution in the E793 infections is measurably defective. At 6 hours
post infection at 40oC, the E793 infected cells contain a large amount
of concatameric DNA, a pattern which is indistinguishable from the
E793 31»C infections at 6 hours post infection. By 24 hours post
infection at 40<>C there is a large increase in the amount of
concatameric DNA and only a small increase in the amount of
monomeric DNA. The resolution efficiency of E793 at 40°C by 24
hours post infection is 0.49 which is identical to the resolution
efficiency of Cts53 at 40oC. These results indicate that both Cts53
and E793 are unable to efficiently resolve viral telomeres at 40°C.
Although these data show that E793 is temperature-sensitive for

162
telomere resolution, they do not unequivocally prove that the
vaccinia virus mRNA capping enzyme is directly involved in the
resolution process.
In Vitro Analysis of E793 Methvltransferase Activity
Previous work has shown that the carboxyl terminal domain of
the vaccinia virus mRNA capping enzyme, along with the full length
D12L protein, is necessary and sufficient for wild-type levels of
(guanine-7)methyltransferase activity in vitro (46, 68). Because the
E793 mutation is in the methyltransferase and D12L dimerization
domain it was hypothesized that the E793 capping enzyme may be
thermolabile for methyltransferase activity in vitro. Since the mRNA
capping enzyme is packaged in virions along with the complete
complement of enzymes necessary for early viral transcription,
methyltransferase can be assayed in an mRNA synthesis and capping
reaction directed by purified permeabilized virions in vitro.
Permeabilized E793 virions were preincubated in the absence of
ribonucleotides at either 30°C, 35°C or 40°C for periods of up to one
hour. Samples were removed during the course of the preincubation

163
and assayed for either methyltransferase or transcription activity at
30°C. Methyltransferase activity was assayed by following the
transfer of radiolabeled methyl groups from S-adenosyl-L-
methionine onto RNA made in the virion directed in vitro capping
and transcription reaction. Viral transcription was assayed by
following the incorporation of radiolabeled UTP into RNA produced in
similar in vitro reactions. Transcription was assayed in order to
demonstrate that the E793 virion transcriptional machinery was
producing adequate levels of substrate for the mRNA capping
enzyme. The results from these experiments were normalized to
assays done with either wild-type or mutant virions which had not
been preincubated (Fig. 20). The mutant and wild-type thermal
inactivation profiles for transcription are identical at all
temperatures assayed (Fig. 20,1). These results indicate that the
transcription apparatus packaged within E793 virions is as
thermostable as that packaged within wild type virions, thus any
themolability specifically associated with E793 methyltransferase
activity cannot be due to a lack of an mRNA substrate. Preincubation
of wild-type virions at 30oC, 35»C or 40oC for up to 1 hour results in

Fig. 20. In vitro transcription and methyltransferase
reactions of preincubated wild type and E793 virions.
Purified vaccinia virus virions were preincubated at 30°C, 35°C or
40«C. At 15 minute intervals 10 ul samples were removed and held
on ice until the conclusion of the preincubation timecourse.
Transcription (1) and methyltransferase (2) reactions were carried
out at 30°C for 30 minutes and the results expressed as the percent
of activity relative to non-preincubated controls.

percent methyltransferase percent transcription
165
wt, 30°C
wt, 35°C
wt, 40°C
793, 30°C
793, 350C
793, 40°C
2
wt, 30°C
wt, 35°C
wt, 40°C
793, 30°C
793, 350C
793, 40°C

166
no significant loss of methyltransferase activity (Fig. 20,2).
Preincubation of E793 virions at 30°C for up to one hour also results
in no loss of methyltransferase activity. In contrast, preincubation of
E793 virions at 35°C for 30 minutes results in 20% of the total
methyltransferase activity relative to nonpreincubated controls.
These results were confirmed by the E793 preincubation experiment
conducted at 40»C. E793 virions preincubated at 40«C for as little as
15 minutes show only 12% of the methyltransferase activity of
nonpreincubated E793 controls. Preincubation of E793 at 40°C for 1
hour results in only 8% of the total methyltransferase activity
relative to the controls. Taken together the in vitro transcription and
methyltransferase data show that the methyltransferase activity of
the E793 capping enzyme is thermolabile in vitro. The residual
amount of E793 methyltransferase activity present after the 60
minute preincubation at 35°C or 40°C most likely reflects non¬
specific binding of radiolabeled S-adenosyl-L-methionine to the
filters used in the assay.
To determine if wild-type and E793 virions contain equivalent
amounts of capping enzyme, purified virions were subjected to SDS

167
PAGE and western blot analysis (Fig. 21). This experiment was done
to demonstrate that the thermolability associated with the E793
mRNA capping enzyme is not due to a decrease in the amount of
capping enzyme packaged within the E793 virion. Analysis of a
Coomassie blue stained SDS PAGE gel of purified wild-type and E793
virions demonstrates that there is no detectable difference in the
pattern or quantity of proteins present in the E793 virions relative to
wild-type. Subjecting the virions to western blot analysis with either
anti DIR or anti D12L antisera confirms that E793 virions produced
at 31«C contain wild-type levels of capping enzyme.
Discussion
The purpose of this work was to isolate a temperature-
sensitive lesion in the large subunit of the multifunctional vaccinia
virus mRNA capping enzyme to study capping enzyme function in
vivo. In addition, and perhaps more importantly, these experiments
were also designed to confirm the general applicability of clustered
charge to alanine mutagenesis and transient dominant selection as a

Fig. 21. SDS PAGE and western blot analysis of purified wild type and E793 virions.
Purified wild type (wt) or E793 (E793) virions were analyzed by electrophoresis through a 10% SDS
PAGE gel and stained with Coomassie blue (Coomassie) or western blotted with polyclonal antisera to
DIR (anti-DIR) or D12L (anti-D12L).

Coomassie
anti-D1 R
anti-D2L
205
121
wt E793 wt E793 wt E793
19.4*
if

170
directed genetic method for the creation of temperature-sensitive
vaccinia virus mutants. The isolation and in vivo characterization of
the E793 temperature-sensitive virus demonstrates that viral
mutants, amenable to in vivo study, can be created by applying this
directed genetic method to vaccinia virus. Surprisingly, viral protein
synthesis, DNA accumulation and mRNA expression all appeared
normal in the E793 infections at 40oC, however telomere resolution
and morphogenesis were measurably defective. In addition, the
E793 capping enzyme was thermolabile for methyltransferase
activity in vitro.
The directed genetic method developed for vaccinia virus
entails creating site-specific mutations in a cloned copy of DIR such
that clusters of charged amino acids (Asp, Glu, His, Lys, Arg) closely
spaced within the primary sequence of the protein are mutated to
alanines. These mutations are then reinserted back onto the viral
chromosome using transient dominant selection as a means of
recombination mediated gene replacement (33). Transient dominant
selection yields recombinant viruses with selectable phenotypes that
contain two copies of DIR, a wild-type genomic copy and a clustered

171
charge to alanine mutant copy. Because the gene duplication makes
these viruses inherently unstable they spontaneously resolve within
the infected cell and generate a heterogeneous population of viruses,
only a fraction of which contain the clustered charge to alanine allele
(see chapter 3). One of the major findings of this work was the
demonstration that viruses containing a mutation conferring
temperature sensitivity in vivo can be detected by screening a
relatively small number of plaques (50 total) for temperature
sensitivity.
The analysis of the phenotypes of clustered charge to alanine
mutations in the Saccharomyces cerevisiae actin (ACT1) gene, as well
as, the poliovirus RNA dependent RNA polymerase gene 3D and the
vaccinia virus G2R gene indicates that on average 30-40% of these
mutants display some degree of temperature sensitivity in vivo (25,
130). Therefore the results obtained with DIR were somewhat
surprising. Only 11% (1 out of 9) of the DIR mutants tested were
temperature-sensitive in a one step growth assay. A majority of the
clustered charge to alanine mutants in yeast actin and the polio
polymerase were single or double alanine substitutions (25, 130).

)
172
However, the experiments with G2R indicated that double mutations
were rather ineffectual in producing viruses which are temperature-
sensitive in a one step growth experiment. Therefore a more
extreme mutagenesis approach was taken with the DIR gene by
mutating three to five charged residues to alanines. It is conceivable
that many of the six DIR mutations which were not recovered
conferred a lethal phenotype due to the severe alteration of the
charge characteristics of the mutant protein. However, the recovery
of mutant viruses El26, D326 and E516, each of which contain
multiple alanine substitutions and none of which are temperature-
sensitive in a one step growth experiment, indicates that multiple
alanine substitutions do not inevitably lead to lethality.
The most plausible explanation for the apparent discrepancy
between the results with DIR and those of other investigators is that
the criteria used for defining temperature sensitivity in DIR is more
stringent than that used by others. Only those vaccinia mutants
which were incapable of forming infectious progeny at 40«C in a one
step growth experiment were classified as biochemically useful
temperature-sensitive mutants. Therefore, only mutants which are

I
173
conditionally lethal are biochemically useful. The nine previously
reported polio virus 3D mutants all produce infectious progeny in a
one step growth experiment at 40°C therefore, none of these mutants
would be considered to be biochemically useful temperature-
sensitive mutants by the criteria used in this study (25). The yeast
actin mutants were classified as temperature-sensitive based upon
their inability to form macroscopic colonies at the nonpermissive
temperature (37°C) (130). Unfortunately no information is available
on the growth kinetics of these mutants, therefore it is not possible
to directly compare the results obtained with DIR to those obtained
with yeast actin. However, the ability to produce infectious progeny
is somewhat analogous to the ability of a yeast cell to divide in
culture. Therefore, if any of the actin mutants can undergo one or
two cell divisions in culture they would not be classified as
temperature-sensitive using the stringent criteria applied to the DIR
mutants.
Metyltransferase assays on purified E793 virions in vitro
demonstrated that some or all of the enzymatic activities required
for capping mRNA are thermolabile in vitro. Because the

174
methyltransferase assay measures the end-stage reaction in the
mRNA capping pathway it is difficult to definitively conclude that the
RNA triphophatase and guanyltransferase activities are not
thermolabile. Nonetheless the most logical interpretation of the in
vitro data is that the thermolability associated with the E793 capping
enzyme is due to a specific defect in the (guanine-
7)methyltransferase. The E793 mutation is in the carboxyl terminus
of DIR in a region of the protein previously reported to be required
for methyltransferase activity and dimerization of DIR with D12L
(16, 46, 68). The ability to separate the RNA triphosphatase-
guanyltransferase domains from the methyltransferase domain by
proteolysis of the holoenzyme demonstrates that these domains are
relatively self contained and able to act autonomously of each other
(107). Therefore, it is unlikely that a mutation designed to cause
only localized disturbances in the surface charge of one domain
would seriously disrupt any of the other domains. However, it is
possible that the E793 mutation causes a global unfolding of the DIR
protein at high temperatures resulting in a nonfunctional enzyme.
Further experiments are necessary to determine if the the RNA

175
triphosphatase and guanyltransferase activities are also thermolabile
in the E793 protein.
The direct involvement of the vaccinia virus mRNA capping
enzyme in the 5’ end formation of viral mRNAs, early transcription
termination and intermediate transcription initiation made it likely
that a temperature-sensitive capping enzyme mutant would be
defective in some or all of these processes. Unexpectedly, the in vivo
analysis of protein synthesis, DNA accumulation and viral
transcription in the E793 infections revealed no defect that could
account for the observed temperature sensitivity in a one step
growth experiment. In addition, northern blot analysis of RNA
isolated from E793 infected cells revealed no detectable defects in
early transcription termination or intermediate transcription
initiation at the nonpermissive temperature. There are a number of
possible explanations for the disparity between the in vivo and in
vitro data. A cellular enzyme may compensate in vivo for the
thermolability of the E793 methyltransferase activity. A cytoplasmic
(guanine-7)methyltransferase activity has been isolated from HeLa
cells, a similar enzyme within BSC40 cells could compensate for a

176
vaccinia methyltransferase defect in vivo (26). Alternatively, the
E793 mutation may result in a thermosensitive defect which
increases the Km for S-adenosyl-L-methionine binding which is
compensated in vivo by higher levels of S-adenosyl-L-methionine
than those used in vitro. Precedence for this hypothesis comes from
reports of temperature-sensitive methyltransferase mutants of
vesicular stomatitis virus. All of these mutants display a host range
defect in which the permissive cell lines have higher intracellular
levels of S-adenosyl-L-methionine than their nonpermissive
counterparts (52). The methyltransferase defect of one of these
mutants can be rescued in vitro by high levels of S-
adenosylmethionine. A third possibility is that the E793 enzyme is
stabilized in vivo possibly through the formation of a higher order
complex and that treatment of the virions in vitro disrupts this
complex and unmasks the thermolability of E793.
Phenotypically the E793 mutant is unable to effectively
resolve viral telomeres and form virion particles at 40<>C. This could
be a direct or indirect effect of loss of capping enzyme function.
Previous studies have shown that virtually all of the temperature-

177
sensitive mutants defective in telomere resolution are concomitantly
defective in late viral protein synthesis (74). This observation has
lead to the belief that resolution is catalyzed by a late protein(s).
Late protein synthesis is clearly required for morphogenesis due to
the fact that the structural components of the virion particle are
encoded by late genes (78). A temperature-sensitive mutant in the
small subunit of the mRNA capping enzyme (ts9383) shows no
observable late protein synthesis defect but is defective in both
telomere resolution and morphogenesis (10, 20). The simplest
explanation for the observed data with both E793 and ts9383 is that
the mRNA capping enzyme does not directly participate in either
telomere resolution or morphogenesis but that the mutant
phenotypes are pleiotropic effects of an undetected defect in late
viral protein synthesis. For example, a slight reduction in the
quantity of a critical late protein directly involved in telomere
resolution could disrupt the resolution process. A similar argument
could be made for virion morphogenesis. A more interesting
hypothesis is that the vaccinia mRNA capping enzyme is directly
involved in telomere resolution and the lack of unit length genomes

178
as substrates for morphogenesis leads to a corresponding defect in
virus assembly. This would require that the early steps in
morphogenesis be directly coupled to telomere resolution. The
converse situation, in which resolution is coupled to morphogenesis is
clearly not true due to the fact that telomere resolution in vivo is
uneffected by rifampicin treatment, a potent inhibitor of the early
stages of poxvirus morphogenesis (74). In addition temperature-
sensitive mutants in ORF D13, (the rifampicin resistance locus) which
is thought to be involved in the protelytic processing of viral core
polypeptides, (81) are defective in early morphogenesis but not in
telomere resolution (74). These data provide fairly conclusive
evidence that morphogenesis is not required for telomere resolution.
However the requirement for resolved, unit length genomes as
substrates for particle formation is somewhat less clear.
Unfortunately all of the resolution defective mutants except ts9383
and E793 display defects in late protein synthesis, such defects
would be expected to directly affect morphogenesis. Whether or not
resolved genomes are required prior to the early stages of viral
assembly is presently unknown. Although, in the absence of a defect

179
in late protein synthesis the phenotypes of E793 and ts9383 would
seem to suggest that resolution is required for the early stages of
viral morphogenesis.
The resolution event is a site-specific recombination that
requires a putative DNA resolvase and two inverted cis-acting
sequences termed the telomere resolution targets. Mutational
analysis has clearly defined the nature of the cis acting sequences
but there as yet has been no published data on the identity of the
DNA resolvase (21). The lack of any observed late protein synthesis
defects in the E793 and ts9383 mutants could be construed as
evidence for a more direct involvement of the vaccinia capping
enzyme in telomere resolution. However, it must be stressed that
this is strictly a phenotypic observation with no corroborating
biochemical data and as such could represent a pleitropic effect of an
as yet unobserved late protein synthesis defect. Nevertheless, there
is some biochemical data about the telomere resolution target that
can be used to form a rational hypothesis about the possible roles the
capping enzyme might play in resolution. The telomere resolution
target functions as a promoter during the latter stages of the vaccinia

180
replication cycle (53, 119). The telomeric mRNA does not code for a
protein (89). At this time it is unknown whether the telomere
resolution target functions as an intermediate or a late promoter (G.
McFadden personal communication). It is also unclear whether or
not transcription is required through this region for the resolution
event. If the telomere resolution target functions as an intermediate
promoter and if transcription of this region is required for the
resolution event then the defect in E793 could be explained as an
inability to efficiently catalyze transcription of the telomere
resolution target. Although our analysis of the intermediate G8R
mRNA transcript indicates that E793 is capable of transactivating
transcription of at least one intermediate gene at 40°C it is possible
the telomere resolution target could be more sensitive to slight
perturbations in transcription that are undetectable in the northern
assay of G8R. It has previously been proposed that binding of the
transcription machinery to the telomere resolution target or the
telomeric RNAs themselves may play a role in the resolution event
(10). If this is the case then a transcription complex containing E793
capping enzyme may directly affect the resolution event, through a

181
slight defect in transcriptional activity or mRNA stability. The
present study as well as the work on ts9383, although intriguing
does not conclusively prove or disprove that the capping enzyme
functions directly as part of the putative DNA resolvase complex.
In conclusion the isolation of E793 demonstrates the feasibility
of using clustered charge to alanine mutagenesis and transient
dominant selection as a method for creating novel vaccinia virus
mutants that are temperature-sensitive both in vivo and in vitro.
The phenotypic characterization of the E793 mutant also shows that
this directed viral genetic method can produce reagents useful for
the study of the vaccinia virus life cycle in vivo.

CHAPTER 5
SUMMARY
This work has demonstrated that clustered charge to alanine
mutagenesis and transient dominant selection can be used to create
conditional lethal temperature-sensitive vaccinia virus mutants. The
isolation of a biochemically useful conditional lethal allele of the
vaccinia virus mRNA capping enzyme has proven the general
applicability of these techniques as a strategy for isolating novel
mutants amenable to biochemical characterization in vivo. The
mechanics of the protocol and the phenotype of the mRNA capping
enzyme mutant E793 have been discussed in the preceding chapters,
therefore this chapter will focus primarily on a summary of what has
been learned about the technique and possible ways in which to
improve the method. Potential experiments designed to more closely
examine the DIR mutants in vivo and in vitro will also be discussed.
182

183
Clustered Charge to Alanine Mutagenesis
The initial observation that charge to alanine mutations in the
Saccharomvces cerevisiae actin protein produced mutants which
were temperature-sensitive in vivo has now been corroborated by
the isolation of charge to alanine temperature-sensitive mutations in
the Saccharomvces cerevisiae ubiquitin-conjugating enzyme CDC34
(UBC33), polio RNA dependant RNA polymerase 3D, the HIV1
integrase and the vaccinia virus genes G2R and DIR (25, 45, 93, 130,
131). However the question still remains as to how successful this
method is in producing biochemically useful temperature-sensitive
mutants. To consider the overall success of charge to alanine
mutagenesis a distinction must be made between the mutants which
are merely temperature-sensitive as opposed to those which are
temperatures sensitive conditional lethals. For vaccinia virus the
goal was to create mutations which could be studied in vivo
therefore conditional lethality was a requisite characteristic of all
biochemically useful mutants. Even though three of the DIR mutants

184
were temperature-sensitive (for plaque formation) only one (E793)
could be studied in vivo. Therefore, the success rate of clustered
charge to alanine mutagenesis in DIR was 11% (1/9). Likewise the
success rate of clustered charge to alanine mutagenesis with G2R was
33% (3/9). For yeast actin and the ubiquitin-conjugating enzyme
CDC34 the proportion of temperature-sensitive mutants was 44% and
6% respectively (93, 130). All of the actin and CDC34 temperature-
sensitive mutants are conditionally lethal for colony formation but
their growth characteristics in culture are unknown. Consequently, it
is difficult to determine how many of these mutants are
biochemically useful. At best, the success rate of clustered charge to
alanine mutagenesis with yeast actin and CDC34 is 44% and 18%,
respectively. For the polio 3D polymerase gene, the proportion of
mutants the authors classified as temperature-sensitive was 37%
although as discussed in chapter 4 none of these mutations produced
conditional lethal viruses (25). Therefore, by the criteria adopted for
the vaccinia virus mutants the success rate of clustered charge to
alanine mutagenesis with respect to the polio virus polymerase
would by 0%. Only one of the twenty four mutations (<5%) created in

185
the human immunodeficiency virus type I integrase gene yielded a
temperature-sensitive virus, nevertheless this mutant is
conditionally lethal (131). Collectively these results demonstrate
that clustered charge to alanine mutagenesis can be used to create
mutations which are conditionally lethal in vivo although the success
rates vary considerably.
To increase the probability of isolating a conditional lethal
vaccinia virus mutant the mutations should be scattered throughout
the protein and consist of at least double or triple amino acid
changes. Altering two charged amino acids to alanines in G2R was
completely ineffectual in producing conditional lethality (see chapter
3). Interestingly, the low proportion of temperature-sensitive
mutants initially isolated in the yeast ubiquitin-conjugating enzyme
led the investigators to create mutants which consisted of
combinations of clustered charge mutations. Four additional
“multiple scan” mutants were created by combining two previously
created non-temperature-sensitive mutations within a single mutant
(93). Although none of these multiple scan mutants were
conditionally lethal two were mildly temperature-sensitive for

186
colony formation. This raises the possibility that multiple mutations
within different regions of a protein could be designed to increase
the proportion of conditionally lethal mutants.
It is somewhat unclear exactly how clustered charge to alanine
mutations could lead to such a high proportion of in vivo
temperature-sensitive mutants. It has been hypothesized that
mutating highly charged regions of a protein targets amino acids
which are located on the surface of the folded protein (7).
Comparison of the charged clusters of the Saccharomvces cerevisiae
actin protein with the three-dimensional actin:DNAse I cocrystal
structure supports this hypothesis (130). Of the 34 clustered charge
to alanine mutations recovered in yeast actin, 81% targeted amino
acids located on the surface of the crystal structure and 72% of these
amino acids are exposed to the solvent (130). Unfortunately there is
no crystallographic data available on any of the other proteins that
have been subjected to clustered charge to alanine mutagenesis.
Therefore it is difficult to say with certainty that the charge clusters
in G2R or DIR are located on the surface of the folded protein.

187
How do these mutations exert their effects and why do so
many seem to produce a temperature-sensitive phenotype in vivo?
Bennett et al., originally proposed that clusters of charged amino
acids located on a protein’s surface would be important mediators of
protein-protein interactions through the electrostatic attraction of
oppositely charged amino acids on each protein (7). Charged amino
acids do play critical roles in protein-protein interactions, in the
coordination of metal ions in metalloproteins and the interaction of
nucleic acid binding proteins with their substrates. So it is a logical
assumption that the loss of surface charges could lead to a
destabilization of interprotein interactions. The higher the
temperature, the less stable the remaining interactions are between
the mutant protein and its partner, which results in a loss of activity.
Mutations which only alter interprotein interactions would be
expected to be temperature-sensitive for function. Alternatively the
correct folding of the mutant protein during synthesis in vivo could
be disrupted by the loss of charged residues, leading to a
temperature-sensitive for synthesis phenotype. This is clearly not
the case for the DIR mutant E793 because E793 mRNA capping

188
enzyme created at 31oC can be thermally inactivated in vitro by
incubating at 35°C. The thermal inactivation of E793 indicates that
this particular mutation is temperature-sensitive for function, at
least in vitro. In vivo a combination of misfolding during DIR
synthesis and thermal inactivation may occur at the nonpermissive
temperature. At the present time it is not known if the thermal
inactivation phenotype of the E793 DIR protein is due to the
complete denaturation of DIR, a destabilization of the D1R-D12L
heterodimer or a specific defect in the catalytic activity of the
methyltransferase which may have no effect on the folding of DIR or
the stability of the D1R-D12L interaction (see below).
Transient Dominant Selection
For the in vivo analysis of mutant phenotypes, one needs a
protocol that places the mutant allele within its normal chromosomal
context under the transcriptional control of the native promoter.
Transient dominant selection ensures that the viruses within each
mycophenolic acid resistant plaque were originally derived from a

189
recombinant which integrated the mutant allele (33). To determine
if an allele confers a temperature-sensitive phenotype only a small
proportion of the total progeny from the infection transfection need
to be screened individually for temperature sensitivity. The
temperature-sensitive mutants can then be tested for conditional
lethality in a one step growth experiment. However with minor
modifications, transient dominant selection could also be used to
isolate some of the non-temperature-sensitive clustered charge to
alanine mutations. Polymerase chain reaction and restriction
endonuclease digestion of viral plaque isolates from the transient
dominant selection can be used to screen for mutations which have
been designed to either create or remove diagnostic restriction
endonuclease sites within the gene of interest. Alternatively plaques
could be screened by hybridization using the mutant oligonucleotide
as a probe. Viruses containing mutations which confer a lethal
phenotype cannot be isolated by any method, however a lethal
phenotype could be inferred by the inability to isolate the mutation
in the absence of mycophenolic acid resistance. One use for such
screening methods could be to determine if the various enzymatic

190
activities of the vaccinia mRNA capping enzyme are essential in vivo.
For example, a number of specific mutations in the DIR protein have
been described which abolish either guanyltransferase, (guanine-
7)methyltransferase or the dimerization of recombinantly expressed
capping enzyme in vitro (16, 17, 68). The isolation of viruses
containing these mutations would demonstrate which of these
capping enzyme functions are essential in vivo.
Future Experiments With E793
The in vitro and in vivo phenotype of the E793 mutant virus
has raised some interesting questions about the possible role that the
capping enzyme plays in vivo and the essentiality of the (guanine-
7)methyltransferase activity. Are the guanyltransferase and RNA
triphosphatase activities of the E793 mutant thermolabile in vitro?
Does the E793 mutant retain the ability to dimerize with D1L in vitro
after thermal inactivation? Is the capping enzyme directly involved
in telomere resolution?

191
Themolability studies of purified virions analogous to those
done for the methyltransferase can not be used to measure the RNA
triphosphatase or guanyltransferase activity of E793 virions.
However, the mRNA made in an in vitro reaction following a 35°C or
40oC preincubation could be examined for the presence of an RNase
resistant guanine cap by thin layer chromatography. Initial attempts
at this approach were unsuccessful, therefore an alternative
approach could be taken. The capping enzyme and a number of
other virally encoded enzymatic activities can be extracted from
virion core particles following detergent treatment and DEAE
cellulose chromatography (39, 112). This crude extract of soluble
E793 virion proteins could be tested in vitro for the ability to cap a
triphosphorylated RNA. Thermolability experiments on this extract
would determine if the RNA triphosphatase and guanyltransferase
activities contained within E793 virions remain intact following
preincubation at 35«C or 40«C. Of course it would be important to
demonstrate that the E793 mRNA capping enzyme isolated from
virions has functional RNA triphosphatase, guanyltransferase and
methyltransferase activities prior to any preincubation experiments.

192
The ability of DIR to dimerize with D12L following thermal
inactivation could be tested by co-immunoprecipitation experiments
of D12L with an antibody specific for DIR.
The direct involvement of the mRNA capping enzyme in
telomere resolution cannot be adequately addressed in vivo due to
the possibility that the resolution defect is a pleiotropic effect of a
defect in late protein synthesis. However cytoplasmic extracts of
infected cells are capable of resolving poxviral concatamer junction
containing plasmids into linear plasmids with hairpin ends in vitro.
If an E793 infected cell extract made at the nonpermissive
temperature is defective for in vitro resolution it might be possible
to complement the defect with wild-type recombinant capping
enzyme. Alternatively resolution in these extracts may be
thermolabile in vitro, implying that the E793 capping enzyme is
directly responsible for the resolution defect. Recombination of
circular plasmids in the vitro assay could also generate linear
plasmids with hairpin ends (118). The E793 recombinational
machinery is presumably intact therefore it is quite possible that in
vitro there would be no observable defect in the conversion of a

193
circular plasmid to a liner plasmid with hairpin ends. The inability
to determine if the results of the in vitro resolution assay are due to
telomere resolution rather than recombination would make the data
difficult to interpret, therefore these experiments are unlikely to
demonstrate a direct role for the capping enzyme in telomere
resolution. Testing the hypothesis that the capping enzyme
participates directly in telomere resolution will have to wait for an in
vitro system that can differentiate between viral recombination and
telomere resolution.
One of the most interesting uses for the E793 mutant would be
the search for cold sensitive extragenic suppressors of the E793
temperature-sensitive mutation. The isolation and mapping of such
mutants could be first step in identifying proteins (other than D12L)
which interact with DIR in vivo. In addition extragenic suppressors
mapped to D12L could identify specific residues in D12L which
participate in protein-protein contacts with DIR.
One of the lessons from clustered charge to alanine
mutagenesis of the DIR gene was that often the phenotypic
characterization of a mutant provides very few clues as to the wild-

194
type protein’s true biological role in vivo. If the E793 mutation had
been isolated by a random rather than directed genetic approach
then the phenotype would have been seen as evidence of a direct
role for the DIR protein in telomere resolution. This should therefore
serve as a cautionary note to others pursuing a genetic approach
towards understanding biological phenomena. In the absence of any
biochemical information inaccurate conclusions about the nature of a
protein’s function can quite easily be drawn from phenotypic
observations.
In conclusion this work has led to the development of a
valuable new tool for the isolation of conditional lethal vaccinia virus
mutants. The in vivo biochemical analysis of future mutants created
using clustered charge to alanine mutagenesis and transient
dominant selection will undoubtedly provide interesting new
information about the complex life cycle of vaccinia virus.

LIST OF REFERENCES
1. Ahn, B. Y., P. D. Gershon, and B. Moss. 1994. RNA
polymerase-associated protein Rap94 confers promoter
specificity for initiating transcription of vaccinia virus early
stage genes. J. Biol. Chem. 269:7552-7557.
2. Ashkenazi, A., L. G. Presta, S. A. Marsters, T. R.
Camerato, K. A. Rosenthal, B. M. Fendly, and D. J.
Capon. 1990. Mapping the CD4 binding site for human
immunodeficiency virus by alanine scanning mutagenesis. Proc.
Natl. Acad. Sci. USA 87:7150-7154.
3. Baldick, C. J., Jr. and B. Moss. 1993. Characterization and
temporal regulation of mRNAs encoded by vaccinia virus
intermediate-stage genes. J. Virol. 67:3515-3527.
4. Baroudy, B. M., S. Venkatesan, and B. Moss. 1982.
Incompletely base-paired flip-flop terminal loops link the two
DNA strands of the vaccinia virus genome into one
uninterrupted polynucleotide chain. Cell 28:315-324.
5. Baroudy, B. M., S. Venkatesan, and B. Moss. 1 983.
Structure and replication of vaccinia virus telomeres. Cold.
Spring. Harbor. Symp. Quant. Biol. 47 Pt 2:723-729.
6. Bass, S. H., M. G. Mulkerrin, and J. A. Wells. 1991. A
systematic mutational analysis of hormone-binding
determinants in the human growth hormone receptor. Proc.
Natl. Acad. Sci. USA 88:4498-4502.
195

196
7. Bennett, W. F., N. F. Paoni, B. A. Keyt, D. Botstein, A. J.
S. Jones, L. Presta, F. M. Wurm, and M. J. Zoller. 1991.
High resolution analysis of functional determinants on human
tissue-type plasminogen activator. J. Biol. Chem.
266:5191-5201.
8. Broyles, S. S. and B. S. Fesler. 1990. Vaccinia virus gene
encoding a component of the viral early transcription factor. J.
Virol. 64:1523-1529.
9. Broyles, S. S. and B. Moss. 1988. DNA-dependent ATPase
activity associated with vaccinia virus early transcription
factor. J. Biol. Chem. 263:10761-10765.
10. Carpenter, M. S. and A. M. Delange. 1991. A
temperature-sensitive lesion in the small subunit of the
vaccinia virus-encoded mRNA capping enzyme causes a defect
in viral telomere resolution. J. Virol. 65:4042-4050.
11. Collier, I. E., P. A. Krasnov, A. Y. Strongin, H.
Birkedal-Hansen, and G. I. Goldberg. 1992. Alanine
scanning and functional analysis of the fibronectin-like
collagen-binding domain from Human 92-kDa type IV
collagenase. J Biol. Chem. 267:6766-6781.
12. Condit, R. C., R. Easterly, R. F. Pacha, Z. Fathi, and R. J.
Meis. 1991. A vaccinia virus isatin-6-thiosemicarbazone
resistance mutation maps in the viral gene encoding the
132-kDa subunit of RNA polymerase. Virology 185:857-861.
13. Condit, R. C. and A. Motyczka. 1981. Isolation and
preliminary characterization of temperature-sensitive mutants
of vaccinia virus. Virology. 113:224-241.
14. Condit, R. C., A. Motyczka, and G. Spizz. 1983. Isolation,
characterization, and physical mapping of
temperature-sensitive mutants of vaccinia virus. Virology.
128:429-443.

197
15. Condit, R. C. and E. G. Niles. 1990. Orthopoxvirus genetics.
Curr. Top. Microbiol. Immunol. 163:1-40.
16. Cong, P. and S. Shuman. 1992. Methyltransferase and
subunit association domains of vaccinia virus mRNA capping
enzyme. J. Biol. Chem. 267:16424-16429.
17. Cong, P. and S. Shuman. 1993. Covalent catalysis in
nucleotidyl transfer. A KTDG motif essential for enzyme-GMP
complex formation by mRNA capping enzyme is conserved at
the active sites of RNA and DNA ligases. J. Biol. Chem.
268:7256-7260.
18. Cooper, J. A., R. Wittek, and B. Moss. 1981. Extension of
the transcriptional and translational map of the left end of the
vaccinia virus genome to 21 kilobase pairs. J. Virol.
39:733-745.
19. Cunningham, B. C. and J. A. Wells. 1989. High resolution
epitope mapping of hGH-receptor interactions by
alanine-scanning mutagenesis. Science 244:1081-1085.
20. Dales, S., V. Milovanovitch, B. G. Pogo, S. B. Weintraub,
T. Huima, S. Wilton, and G. McFadden. 1978. Biogenesis of
vaccinia: isolation of conditional lethal mutants and electron
microscopic characterization of their phenotypically expressed
defects. Virology. 84:403-428.
21. Delange, A. M. and G. McFadden. 1986.
Sequence-nonspecific replication of transfected plasmid DNA in
poxvirus-infected cells. Proc. Natl. Acad. Sci. USA. 83:614-618.
22. Delange, A. M. and G. McFadden. 1987. Efficient resolution
of replicated poxvirus telomeres to native hairpin structures
requires two inverted symmetrical copies of a core target DNA
sequence. J. Virol. 61:1957-1963.

198
23. Delange, A. M. and G. McFadden. 1990. The role of
telomeres in poxvirus DNA replication. Curr. Top. Microbiol.
Immunol. 163:71-92.
24. Delange, A. M., M. Reddy, D. Scraba, C. Upton, and G.
McFadden. 1986. Replication and resolution of cloned
poxvirus telomeres in vivo generates linear minichromosomes
with intact viral hairpin termini. J. Virol. 59:249-259.
25. Diamond, S. E. and K. Kirkegaard. 1993. Clustered
charge-to-alanine mutagenesis of poliovirus RNA-dependent
RNA polymerase yields multiple temperature-sensitive
mutants defective in RNA synthesis. J. Virol. 68:863-876
26. Ensinger, M. J. and B. Moss. 1976. Modification of the 5'
terminus of mRNA by an RNA (guanine-7-)-methyltransferase
from HeLa cells. J Biol. Chem. 251:5283-5291.
27. Ensinger, M. J. and M. Rovinsky. 1983. Marker rescue of
temperature-sensitive mutations of vaccinia virus WR:
correlation of genetic and physical maps. J. Virol. 48:419-428.
28. Ensinger, M. J., J. P. Weir, and B. Moss. 1985. Fine
structure marker rescue of temperature-sensitive mutations of
vaccinia virus within a central conserved region of the genome.
J. Virol. 56:1027-1029.
29. Ensinger, M. J., 1982. Isolation and genetic characterization
of temperature sensitive mutants of vaccinia virus WR. J. Virol.
43:778-790.
30. Esposito, J. J. and F. A. Murphy. 1989. Infectious
recombinant vectored virus vaccines. Adv. Vet. Sci. Comp. Med.
33:195-247.

199
31. Essani, K. and S. Dales. 1983. Biogenesis of vaccinia: analysis
by three-factor crosses reveals mutual influence on stability of
drug resistance and temperature sensitivity when both
markers occur in some recombinant virus isolates.
Intervirology. 20:101-107.
32. Falkner, F. G. and B. Moss. 1988. Escherichia coli gpt gene
provides dominant selection for vaccinia virus open reading
frame expression vectors. J. Virol. 62:1849-1854.
33. Falkner, F. G. and B. Moss. 1990. Transient dominant
selection of recombinant vaccinia viruses. J. Virol.
64:3108-3111.
34. Fathi, Z. and R. C. Condit. 1991. Genetic and molecular
biological characterization of a vaccinia virus
temperature-sensitive complementation group affecting a
virion component. Virology. 181:258-272.
35. Feinberg, A. P. and B. Vogelstein. 1984. A technique for
radiolabeling DNA restriction endonuclease fragments to high
specific activity. Addendum. Anal. Biochem. 137:266-267.
36. Fenner, F., D. A. Henderson, I. Arita, Z. Jezek, and I. D.
Ladnyi. 1988. Smallpox and its Eradication. World Health
Organization, Geneva.
37. Filipowicz, W. 1978. Functions of the 5'-terminal m7G cap in
eukaryotic mRNA. FEBS Lett. 96:1-11.
38. Franke, C. A., C. M. Rice, J. H. Strauss, and D. E. Hruby.
1985. Neomycin resistance as a dominant selectable marker for
selection and isolation of vaccinia virus recombinants. Mol. Cell
Biol. 5:1918-1924.
39. Furuichi, Y. and A. J. Shatkin. 1989. Characterization of cap
structures. Methods Enzymol. 180:164-176.

200
40. Gershon, P. D. and B. Moss. 1990. Early transcription factor
subunits are encoded by vaccinia virus late genes. Proc. Natl.
Acad. Sci. USA 87:4401-4405.
41. Goebel, S. JL, G. P. Johnson, M. E. Perkus, S. W. Davis, J.
P. Winslow, and E. Paoletti. 1990. The complete DNA
sequence of vaccinia virus. Virology. 179:247-266.
42. Graham, B. S., T. J. Matthews, R. B. Belshe, M. L.
Clements, R. Dolin, P. F. Wright, G. J. Gorse, D. H.
Schwartz, M. C. Keefer, D. P. Bolognesi. 1993.
Augmentation of human immunodeficiency virus type 1
neutralizing antibody by priming with gpl60 recombinant
vaccinia and boosting with rgpl60 in vaccinia-naive adults. The
NIAID AIDS Vaccine Clinical Trials Network. J. Infect. Dis.
167:533-537.
43. Hamm, J. and I. W. Mattaj. 1990. Monomethylated cap
structures facillitate RNA export from the nucleus. Cell
63:109-1 18.
44. Harris, N., R. Rosales, and B. Moss. 1993. Transcription
initiation factor activity of vaccinia virus capping enzyme is
independent of mRNA guanylylation. Proc. Natl. Acad. Sci. USA
90:2860-2864.
45. Hassett, D. E. and R. C. Condit. 1994. Targeted construction
of temperature-sensitive mutations in vaccinia virus by
replacing clustered charged residues with alanine. Proc. Natl.
Acad. Sci. USA 91:4554-4558.
46. Higman, M. A., N. Bourgeois, and E. G. Niles. 1992. The
vaccinia virus mRNA (guanine-N7-)-methyltransferase
requires both subunits of the mRNA capping enzyme for
activity. J. Biol. Chem. 267:16430-16437.

201
47. Higman, M. A., L. A. Christen, and E. G. Niles. 1994. The
mRNA (guanine-7-)methyltransferase domain of the vaccinia
virus mRNA capping enzyme. Expression in Escherichia coli and
structural and kinetic comparison to the intact capping enzyme.
J. Biol. Chem. 269:14974-14981.
48. Higman, M. A. and E. G. Niles. 1994. Location of the
S-adenosyl-L-methionine binding region of the vaccinia virus
mRNA (guanine-7-)methyltransferase. J. Biol. Chem.
269:14982-14987.
49. Hiller, G. and K. Weber. 1985. Golgi-derived membranes
that contain an acylated viral polypeptide are used for vaccinia
virus envelopment. J. Virol. 55:651-659.
50. Hooda Dhingra, U., D. D. Patel, D. J. Pickup, and R. C.
Condit. 1990. Fine structure mapping and phenotypic analysis
of five temperature-sensitive mutations in the second largest
subunit of vaccinia virus DNA-dependent RNA polymerase.
Virology. 174:60-69.
51. Hooda Dhingra, U., C. L. Thompson, and R. C. Condit.
1989. Detailed phenotypic characterization of five temperature
sensitive mutants in the 22- and 147-kilodalton subunits of
vaccinia virus DNA-dependent RNA polymerase. J. Virol.
63:714-729.
52. Horikami, S. M., F. De Ferra, and S. A. Moyer. 1984.
Characterization of the infections of permissive and
nonpermissive cells by host range mutants of vesicular
stomatitis virus defective in RNA methylation. Virology.
138:1-15.
53. Hu, F. Q. and D. J. Pickup. 1991. Transcription of the
terminal loop region of vaccinia virus DNA is initiated from the
telomere sequences directing DNA resolution. Virology.
181:716-720.

202
54. Johnson, G. P., S. J. Goebel, and E. Paoletti. 1993. An
update on the vaccinia virus genome. Virology. 196:381-401.
55. Kane, E. M. and S. Shuman. 1992. Temperature-sensitive
mutations in the vaccinia virus H4 gene encoding a component
of the virion RNA polymerase. J. Virol. 66:5752-5762.
56. Keck, J. G., C. J. Baldick, and B. Moss. 1990. Role of DNA
replication in vaccinia virus gene expression: a naked template
is required for transcription of three late trans-activator genes.
Cell 61:801-809.
57. Konarska, M. M., R. A. Padgett, and P. A. Sharp. 1984.
Recognition of cap structure in splicing in vitro of mRNA
precursors. Cell 38:731-736.
58. Kovacs, G. R., R. Rosales, J. G. Keck, and B. Moss. 1994.
Modification of the cascade model for regulation of vaccinia
virus gene expression: purification of a prereplicative,
late-stage-specific transcription factor. J. Virol. 68:3443-3447.
59. Kranier, A. R., T. Maniatis, B. Ruskin, and M. R. Green.
1984. Normal and mutant human B Globin pre-mRNAs are
faithfully and efficiently spliced in vitro. Cell 36:993-1005.
60. Laemmli, U. K. 1970. Cleavage of structural proteins during
assembly of the head of bacteriophage T4. Nature
227:680-685.
61. Lakritz, N., P. D. Foglesong, M. Reddy, S. Baum, J.
Hurwitz, and W. R. Bauer. 1985. A vaccinia virus DNase
preparation which cross-links superhelical DNA. J. Virol.
53:935-943.
62. Lanberg, S. R. and B. Moss. 1981. Post-transcriptional
modifications of mRNA. J. Biol. Chem. 256:10054-10060.

203
63. Luo, Y., X. Mao, L. Deng, P. Cong, and S. Shuman. 1995.
The D1 and D12 subunits are both essential for the
transcription termination factor activity of vaccinia virus
capping enzyme. J. Virol. 69:3852-3856.
64. Luo, Y. and S. Shuman. 1993. RNA binding properties of
vaccinnia virus capping enzyme. J Biol. Chem.
268:21253-21262.
65. Mackett, M. and L. C. Archard. 1979. Conservation and
variation in Orthopoxvirus genome structure. J. Gen. Virol.
45:683-701.
66. Mackett, M., G. L. Smith, and B. Moss. 1984. General
method for production and selection of infectious vaccinia virus
recombinants expressing foreign genes. J. Virol. 49:857-864.
67.Mahr, A. and B. E. Roberts. 1984. Arrangement of late RNAs
transcribed from a 7.1-kilobase EcoRI vaccinia virus DNA
fragment. J. Virol. 49:510-520.
68. Mao, X. and S. Shuman. 1994. Intrinsic RNA (guanine-7)
methyltransferase activity of the vaccinia virus capping
enzyme D1 subunit is stimulated by the D12 subunit.
Identification of amino acid residues in the D1 protein required
for subunit association and methyl group transfer. J Biol. Chem.
269:24472-24479.
69. McFadden, G. and S. Dales. 1980. Biogenesis of poxviruses:
preliminary characterization of conditional lethal mutants of
vaccinia virus defective in DNA synthesis. Virology. 103:68-79.
70. Meis, R. J. and R. C. Condit. 1991. Genetic and molecular
biological characterization of a vaccinia virus gene which
renders the virus dependent on isatin-B-thiosemicarbazone
(IBT). Virology 182:442-454.

204
71. Merchlinsky, M. 1990. Mutational analysis of the resolution
sequence of vaccinia virus DNA: essential sequence consists of
two separate AT-rich regions highly conserved among
poxviruses. J. Virol. 64:5029-5035.
72. Merchlinsky, M., C. F. Garon, and B. Moss. 1988.
Molecular cloning and sequence of the concatemer junction
from vaccinia virus replicative DNA. Viral nuclease cleavage
sites in cruciform structures. J. Mol. Biol. 199:399-413.
73. Merchlinsky, M. and B. Moss. 1986. Resolution of linear
minichromosomes with hairpin ends from circular plasmids
containing vaccinia virus concatemer junctions. Cell
45:879-884.
74. Merchlinsky, M. and B. Moss. 1989. Resolution of vaccinia
virus DNA concatemer junctions requires late-gene expression.
J. Virol. 63:1595-1603.
75. Mizumoto, K. and Y. Kaziro. 1987. Messenger RNA capping
enzymes from eukaryotic cells. Prog. Nucleic Acids Res. and
Mol. Biol. 34:1-29.
76. Morgan, C. 1976. The insertion of DNA into vaccinia virus.
Science 193:591-592.
77. Morgan, J. R., L. K. Cohen, and B. E. Roberts. 1984.
Identification of the DNA sequences encoding the large subunit
of the mRNA-capping enzyme of vaccinia virus. J. Virol.
52:206-214.
78. Moss, B. 1990. Poxviridae and their replication, p. 2079-2112.
In B. N. Fields, D. M. Knipe, R. M. Chanock, M. S. Hirsch, J. L.
Melnick, T. P. Monath, and B. Roizman (eds.), Fields Virology.
Raven Press, New York.

205
79. Moss, B., B. Y. Ahn, B. Amegadzie, P. D. Gershon, and J.
G. Keck. 1991. Cytoplasmic transcription system encoded by
vaccinia virus. J. Biol. Chem. 266:1355-1358.
80. Moss, B. and C. Flexner. 1987. Vaccinia virus expression
vectors. Annu. Rev. Immunol. 5:305-324.
81. Moss, B., E. N. Rosenblum, E. Katz, and P. M. Grimley.
1969. Rifampicin: a specific inhibitor of vaccinia virus
assembly. Nature 224:1280-1284.
82. Moyer, R. W. and R. L. Graves. 1981. The mechanism of
cytoplasmic orthopoxvirus DNA replication. Cell 27:391-401.
83. Mulligan, R. C. and P. Berg. 1980. Expression of a bacterial
gene in mammalian cells. Science 209:1422-1427.
84. Niles, E. G. and L. Christen. 1993. Identification of the
vaccinia virus mRNA guanyltransferase active site lysine. J.
Biol. Chem. 268:24986-24989.
85. Niles, E. G., R. C. Condit, P. Caro, K. Davidson, L.
Matusick, and J. Seto. 1986. Nucleotide sequence and
genetic map of the 16-kb vaccinia virus HindIII D fragment.
Virology. 153:96-1 12.
86. Niles, E. G., G. J. Lee Chen, S. Shuman, B. Moss, and S. S.
Broyles. 1989. Vaccinia virus gene D12L encodes the small
subunit of the viral mRNA capping enzyme. Virology.
172:513-522.
87. Pacha, R. 1985. Characterization of a temperature-sensitive
mutant of vaccinia virus reveals a novel function that prevents
virus induced breakdown of RNA. J. Virol. 56:395-403.

206
88. Panicali, D., S. W. Davis, R. L. Weinberg, and E. Paoletti.
1983. Construction of live vaccines by using genetically
engineered poxviruses: biological activity of recombinant
vaccinia virus expressing influenza virus hemagglutinin. Proc.
Natl. Acad. Sci. USA. 80:5364-5368.
89. Parsons, B. L. and D. J. Pickup. 1990. Transcription of
orthopoxvirus telomeres at late times during infection.
Virology. 175:69-80.
90. Payne, L. G. 1980. Significance of extracellular enveloped
virus in the in vitro and in vivo dissemination of vaccinia. J.
Gen. Virol. 50:89-100.
91. Payne, L. G. and K. Kristensson. 1985. Extracellular release
of enveloped vaccinia virus from mouse nasal epithelial cells in
vivo. J. Gen. Virol. 66:643-646.
92. Pennington, T. H. and E. A. C. Follett. 1984. Vaccinia virus
replication in enucleate cells: particle production and synthesis
of viral DNA and proteins. J. Virol. 13:488-493.
93. Pitluk, Z. W., M. McDonough, P. Sangan, and D. K.
Gonda. 1995. Novel CDC34 (UBC3) ubiquitin-conjugating
enzyme mutants obtained by charged-to-alanine scanning
mutagenesis. Mol. Cell Biol. 15:1210-1219.
94. Pogo, B. G., E. M. Berkowitz, and S. Dales. 1984.
Investigation of vaccinia virus DNA replication employing a
conditional lethal mutant defective in DNA. Virology.
132:436-444.
95. Rempel, R. E., M. K. Anderson, E. Evans, and P.
Traktman. 1990. Temperature-sensitive vaccinia virus
mutants identify a gene with an essential role in viral
replication. J. Virol. 64:574-583.

207
96. Rohrmann, G., L. Yuen, and B. Moss. 1986. Transcription of
vaccinia virus early genes by enzymes isolated from vaccinia
virions terminates downstream of a regulatory sequence. Cell
46:1029-1035.
97. Rosales, R., N. Harris, B. Y. Ahn, and B. Moss. 1994.
Purification and identification of a vaccinia virus-encoded
intermediate stage promoter-specific transcription factor that
has homology to eukaryotic transcription factor Sil (TFIIS) and
an additional role as a viral RNA polymerase subunit. J. Biol.
Chem. 269:14260-14267.
98. Rosales, R., G. Sutter, and B. Moss. 1994. A cellular factor
is required for transcription of vaccinia viral
intermediate-stage genes. Proc. Natl. Acad. Sci. USA
91:3794-3798.
99. Rosel, J. L., P. L. Earl, J. P. Weir, and B. Moss. 1986.
Conserved TAAATG sequence at the transcriptional and
translational initiation sites of vaccinia virus late genes
deduced by structural and functional analysis of the HindIII H
genome fragment. J. Virol. 60:436-449.
100. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989.
Molecular Cloning. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y.
101. Schmelz, M., B. Sodeik, M. Ericsson, E. J. Wolffe, H.
Shida, G. Hiller, and G. Griffiths. 1994. Assembly of
vaccinia virus: the second wrapping cisterna is derived from
the trans Golgi network. J. Virol. 68:130-147.
102. Schnierle, B. S., P. D. Gershon, and B. Moss. 1992.
Cap-specific mRNA (nucleoside-02'-)-methyltransferase and
poly(A) polymerase stimulatory activities of vaccinia virus are
mediated by a single protein. Proc. Natl. Acad. Sci. USA
89:2897-2901.

208
103. Schwer, B. and S. Shuman. 1994. Mutational analysis of
yeast mRNA capping enzyme. Proc. Natl. Acad. Sci. USA
91:4328-4332.
104. Seto, J., L. M. Celenza, R. C. Condit, and E. G. Niles. 1987.
Genetic map of the vaccinia virus HindIII D Fragment. Virology.
160:110-119.
105. Shatkin, A. J. 1976. Capping of eucaryotic mRNAs. Cell
9:645-653.
106. Shatkin, A. J. 1985. mRNA cap binding proteins: essential
factors for initiation of translation. Cell 40:223-224.
107. Shuman, S. 1989. Functional domains of vaccinia virus mRNA
capping enzyme. Analysis by limited tryptic digestion. J. Biol.
Chem. 264:9690-9695.
108.Shuman, S. 1990. Catalytic activity of vaccinia mRNA capping
enzyme subunits coexpressed in Escherichia coli. J. Biol. Chem.
265:11960-11966.
109.Shuman, S., S. S. Broyles, and B. Moss. 1987. Purification
and characterization of a transcription termination factor from
vaccinia virions. J. Biol. Chem. 262:12372-12380.
110.Shuman, S. and J. Hurwitz. 1981. Mechanism of mRNA
capping by vaccinia virus guanylyltransferase: characterization
of an enzyme—guanylate intermediate. Proc. Natl. Acad. Sci.
USA. 78:187-191.
111.Shuman, S., Y. Liu, and B. Schwer. 1994. Covalent catalysis
in nucleotidyl transfer reactions: essential motifs conserved in
Saccharomyces cervisiae RNA capping enzyme are conserved in
Schizosaccharomyces pombe and viral capping enzymes and
among polynucleotide ligases. Proc. Natl. Acad. Sci. USA
91:12046-12050.

209
112. Shuman, S. and S. G. Morham. 1990. Domain structure of
vaccinia virus mRNA capping enzyme. Activity of the Mr
95,000 subunit expressed in Escherichia coli. J. Biol. Chem.
265:11967-11972.
113. Shuman, S. and B. Moss. 1988. Factor-dependent
transcription termination by vaccinia virus RNA polymerase.
Evidence that the cis-acting termination signal is in nascent
RNA. J. Biol. Chem. 263:6220-6225.
114. Shuman, S. and B. Moss. 1989. Bromouridine triphosphate
inhibits transcription termination and mRNA release by
vaccinia virions. J. Biol. Chem. 264:21356-21360.
115. Shuman, S., M. Surks, H. Furneaux, and J. Hurwitz. 1980.
Purification and characterization of a GTP-pyrophosphate
exchange activity from vaccinia virions. Association of the
GTP-pyrophosphate exchange activity with vaccinia mRNA
guanylyltransferase. RNA (guanine-7-)methyltransferase
complex (capping enzyme). J. Biol. Chem. 255:11588-11598.
116. Sodeik, B., R. W. Dorns, M. Ericsson, G. Hiller, C. E.
Machamer,. H. W. van’t Hof, G. van Meer, B. Moss, and
G. Griffiths. 1993. Assembly of vaccinia virus: role of the
intermediate compartment between the endoplasmic reticulum
and the Golgi stacks. J. Cell Biol. 121:521-541.
117. Southern, E. M. 1975. Detection of specific sequences among
DNA fragments separated by gel electrophoresis. J. Mol. Biol.
98:503-517.
118. Stuart, D., K. Ellison, K. Graham, and G. McFadden. 1992.
In vitro resolution of poxvirus replicative intermediates into. J.
Virol. 66:1551-1563.

210
119. Stuart, D., K. Graham, M. Schreiber, C. Macaulay, and G.
McFadden. 1991. The target DNA sequence for resolution of
poxvirus replicative intermediates is an active late promoter. J.
Virol. 65:61-70.
120. Thompson, C. L. and R. C. Condit. 1986. Marker rescue
mapping of vaccinia virus temperature-sensitive mutants using
overlapping cosmid clones representing the entire virus
genome. Virology. 150:10-20.
121. Thompson, C. L., U. Hooda Dhingra, and R. C. Condit.
1989. Fine structure mapping of five temperature-sensitive
mutants in the 22- and 147-kilodalton subunits of vaccinia
virus DNA-dependent RNA polymerase. J. Virol. 63:705-713.
122. Towbin, H., T. Staehelin, and J. Gordon. 1979.
Electrophoretic transfer of proteins from polyacrylamide gels to
nitrocellulose sheets: procedure and some applications. Proc.
Natl. Acad. Sci. USA 76:4350-4354.
123. Traktman, P. 1990. The enzymology of poxvirus DNA
replication. Curr. Top. Microbiol. Immunol. 163:93-124.
124. Venkatesan, S., A. Gershowitz, and B. Moss. 1980.
Modification of the 5' end of mRNA. Association of RNA
triphosphatase with the RNA guanylyltransferase-RNA
(guanine-7-)methyltransferase complex from vaccinia virus. J.
Biol. Chem. 255:903-908.
125. Vieira, J. and J. Messing. 1987. Production of single
stranded plasmid DNA. Methods Enzymol. 153:3-11.
126. Vos, J. C., M. Sasker, and H. G. Stunnenberg. 1991.
Vaccinia virus capping enzyme is a transcription initiation
factor. EMBO J. 10:2553-2558.

211
127. Vos, J. C. and H. G. Stunnenberg. 1988. Derepression of a
novel class of vaccinia virus genes upon DNA replication. EMBO
J. 7:3487-3492.
128. Wagner, R. R. 1990. Rhabdoviridae and their replication , p.
489-503. In B. N. Fields, D. M. Knipe, R. M. Chanock, M. S. Hirsch,
J. L. Melnick, T. P. Monath, and B. Roizman (eds.), Fields
Virology. Raven Press, New York.
129. Wengler, G. 1993. The NS3 nonstructural protein of
flaviviruses contains an RNA triphophatase activity. Virology
197:265-273.
130. Wertman, K. F., D. G. Drubin, and D. Botstein. 1992.
Systematic mutational analysis of the yeast ACT1 gene.
Genetics 132:337-350.
131. Wiskerchen, M. and M. A. Muesing. 1995. Identification
and characterization of a temperature-sensitive mutant of
human immunodificiency virus type 1 by alanine scanning
mutagenesis of the integrase gene . J Virol. 69:597-601.
132. Wright, C. F. and A. M. Coroneos. 1995. The H4 subunit of
vaccinia virus RNA polymerase is not required for transcription
initiation ata viral late promoter. J Virol. 69:2602-2604.
133. Wright, C. F. and B. Moss. 1989. Identification of factors
specific for transcription of the late class of vaccinia virus
genes. J. Virol. 63:4224-4233.
134. Yuen, L., A. J. Davison, and B. Moss. 1987. Early
promoter-binding factor from vaccinia virions. Proc. Natl. Acad.
Sci. USA. 84:6069-6073.
135. Yuen, L. and B. Moss. 1987. Oligonucleotide sequence
signaling transcriptional termination of vaccinia virus early
genes. Proc. Natl. Acad. Sci. USA. 84:6417-6421.

BIOGRAPHICAL SKETCH
Daniel E. Hassett was born in Rochester, New York, on April 28,
1964. He graduated from York Catholic High School in 1982. Dan
received a Bachelor of Science degree in biology from the
Philadelphia College of Pharmacy and Science in 1987. After being
employed in Philadelphia as a laboratory technician at both Temple
and Thomas Jefferson Universities, Dan moved to Gainesville, Florida,
in August of 1990. Shortly thereafter he was given the opportunity
to work on the weirdest protein in all the known universe in the
laboratory of Dr Richard Condit. During Dan’s stay in Florida he spent
most of his summers overseeing at the Condorosa. In 1995 Dan
received his Ph.D. from the Department of Molecular Genetics and
Microbiology at the University of Florida College of Medicine. Dan is
presently pursuing postdoctoral studies in the laboratory of J.
Lindsay Whitton in the Department of Neuropharmacology at the
Scripps research institute in La Jolla, California.
212

I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is
fully adequate, in scope and quality, as a dissertation for the degree
of Doctor of Philosophy.
Richard C. Condit, Chair
Professor of Molecular Genetics
and Microbiology
I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is
fully adequate, in scope and quality, as a dissertation for the degree
of Doctor of Philosophy.
Brian D. Cain,
Associate Professor of
Biochemistry and Molecular
Biology
I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is
fully adequate, in scope and quality, as a dissertation for the degree
of Doctor of Philosophy.
lfred'/S. Lewin,
A1
Professor of Molecular Genetics
and Microbiology
I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is
fully adequate, in scope and quality, as a dissertation for the degree
of Doctor of Philosophy.
Richard W. Moykr,
Professor of Molecular Genetics
and Microbiology

This dissertation was submitted to the Graduate Faculty of the
College of Medicine and to the Graduate School and was accepted as
partial fulfillment of the requirements for the degree of Doctor of
Philosophy.
December, 1995 / K
Dean, College of
Dean, Graduate School
Medicine

UNIVERSITY OF FLORIDA
lUlIHIIlil
3 1262 08554 3287



xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EWIL9RCIP_D8ET52 INGEST_TIME 2012-02-20T21:24:50Z PACKAGE AA00009025_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES


UNIVERSITY OF FLORIDA
IlillJli
3 1262 08554 3287



PAGE 1

7$5*(7(' ,1 9,752 &216758&7,21 2) &21',7,21$/ /(7+$/ 9$&&,1,$ 9,586 087$176 %\ '$1,(/ ( +$66(77 $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

7KLV ZRUN LV GHGLFDWHG WR P\ SDUHQWV $ODQ DQG 1RHO DQG 0LVV /RUHWWD

PAGE 3

$&.12:/('*0(176 ZLVK WR RIIHU P\ VLQFHUH WKDQNV DQG JUDWLWXGH WR 5LFK &RQGLW ZKRVH IULHQGVKLS VXSSRUW DQG XQHQGLQJ SDWLHQFH KDV PDGH P\ JUDGXDWH FDUHHU D YHU\ HQMR\DEOH H[SHULHQFH WKDQN DOO RI P\ ODEPDWHV LQ WKH &RQGLW DQG 0R\HU ODEV IRU WKHLU LQWHUHVW LQ P\ ZRUN VXJJHVWLRQV DQG IULHQGVKLS 7KDQNV JR WR 0V -DFNLH /HZLV IRU KHU KHOS LQ FORQLQJ DQG VHTXHQFLQJ VRPH RI WKH ',5 PXWDQWV 6SHFLDO WKDQNV JR WR 0V -R\FH &RQQHUV IRU KHU KHOSIXO DGYLFH DQG IULHQGVKLS RYHU WKH ODVW ILYH \HDUV ZRXOG OLNH WR WKDQN P\ IDPLO\ IRU WKHLU ORYH DQG VXSSRUW HVSHFLDOO\ P\ SDUHQWV WKH\ GHVHUYH PXFK RI WKH FUHGLW IRU PDNLQJ PH WKH SHUVRQ DP WRGD\ ZRXOG OLNH WR WKDQN WKH 'RQDOG ZKR KHOSHG WR PDNH )ORULGD P\ KRPH ZRXOG DOVR OLNH WR WKDQN (OLQRU DQG %UXFH &XYLOLHU ZKR KHOSHG PH DW D WLPH LQ P\ OLIH ZKHQ ZDV XQDEOH WR KHOS P\VHOI WKHLU EHOLHI LQ PH PHDQW PRUH WR PH WKDQ HLWKHU RI WKHP ZLOO HYHU NQRZ /DVWO\ ZRXOG OLNH WR RIIHU P\ WKDQNV WR 1 /RUHWWD 6XNKX IRU KHU ORYH SDWLHQFH DQG SHUVHYHUDQFH LLL

PAGE 4

7$%/( 2) &217(176 $&.12:/('*(0(176 L $%675$&7 YL &+$37(56 ,1752'8&7,21 $1' %$&.5281' *HQRPH DQG *HQRPLF 2UJDQL]DWLRQ 9LUDO /LIH &\FOH 9LUDO *HQHWLFV &OXVWHUHG &KDUJH WR $ODQLQH 0XWDJHQHVLV 7UDQVLHQW 'RPLQDQW 6HOHFWLRQ &DSSLQJ RI P51$ DQG WKH 9DFFLQLD P51$ &DSSLQJ (Q]\PH 0$7(5,$/6 $1' 0(7+2'6 5HFRPELQDQW '1$ 7HFKQLTXHV 9LURORJLFDO 7HFKQLTXHV 7(67,1* &/867(5(' &+$5*( 72 $/$1,1( 087$*(1(6,6 $1' 75$16,(17 '20,1$17 6(/(&7,21 21 7+( 9$&&,1,$ 9,586 *(1( *5 ,QWURGXFWLRQ 5HVXOWV 'LVFXVVLRQ

PAGE 5

&216758&7,21 $1' &+$5$&7(5,=$7,21 2) $ 129(/ &21',7,21$/ /(7+$/ 087$17 ,1 7+( /$5*( 68%81,7 2) 7+( 9$&&,1,$ 9,586 P51$ &$33,1* (1=<0( ,QWURGXFWLRQ 5HVXOWV 'LVFXVVLRQ 6800$5< &OXVWHUHG &KDUJH WR $ODQLQH 0XWDJHQHVLV 7UDQVLHQW 'RPLQDQW 6HOHFWLRQ )XWXUH ([SHULPHQWV ZLWK ( /,67 2) 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ Y

PAGE 6

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ 7$5*(7(' ,1 9,752 &216758&7,21 2) &21',7,21$/ /(7+$/ 9$&&,1,$ 9,586 087$176 %\ 'DQLHO ( +DVVHWW 'HFHPEHU &KDLUSHUVRQ 5LFKDUG & &RQGLW 3K' 0DMRU 'HSDUWPHQW 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ 7KH JRDO RI WKLV VWXG\ KDV EHHQ WR GHYHORS D JHQHUDO GLUHFWHG JHQHWLF PHWKRG IRU WKH FUHDWLRQ RI VLWHVSHFLILF FRQGLWLRQDOO\ OHWKDO WHPSHUDWXUHVHQVLWLYH YDFFLQLD YLUXV PXWDQWV 7KH WHFKQLTXHV RI FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV DQG WUDQVLHQW GRPLQDQW VHOHFWLRQ ZHUH WHVWHG DV D PXWDJHQHVLV VWUDWHJ\ DQG DV D PHDQV RI WDUJHWHG JHQH UHSODFHPHQW UHVSHFWLYHO\ 7KH HIILFLHQF\ RI FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV DQG WUDQVLHQW GRPLQDQW VHOHFWLRQ ZHUH YL

PAGE 7

LQLWLDOO\ DVVHVVHG E\ WKH FUHDWLRQ RI QLQH QRYHO DOOHOHV RI WKH YDFFLQLD YLUXV *5 JHQH EHFDXVH D VLPSOH GUXJ VHOHFWLRQ FDQ EH XVHG WR VHOHFW IRU PXWDWLRQV WKDW DOWHU WKH IXQFWLRQ RI *5 7KUHH RI WKH *5 PXWDQWV ZHUH FRQGLWLRQDOO\ OHWKDO DV PHDVXUHG E\ RQH VWHS JURZWK H[SHULPHQWV 7KHVH GDWD LQGLFDWH WKDW b RI WKH FOXVWHUHG FKDUJH WR DODQLQH DOOHOHV ZHUH FRQGLWLRQDOO\ OHWKDO LQ YLYR 7KH H[SHULPHQWV ZLWK *5 DOVR UHYHDOHG WKDW RQ DYHUDJH b RI WKH YLUDO SURJHQ\ LVRODWHG GXULQJ WKH WUDQVLHQW GRPLQDQW VHOHFWLRQ FRQWDLQHG WKH FOXVWHUHG FKDUJH WR DODQLQH PXWDWLRQ 7R GHPRQVWUDWH WKH JHQHUDOLW\ RI WKH PHWKRG QLQH FOXVWHUHG FKDUJH WR DODQLQH PXWDWLRQV ZHUH FUHDWHG LQ WKH ODUJH VXEXQLW RI WKH KHWHURGLPHULF YDFFLQLD YLUXV FDSSLQJ HQ]\PH JHQH ',5 ,Q DGGLWLRQ WR FDWDO\]LQJ WKH IRUPDWLRQ RI D FDS VWUXFWXUH RQ QHZO\ V\QWKHVL]HG P51$ WKH YDFFLQLD FDSSLQJ HQ]\PH KDV EHHQ VKRZQ WR EH DQ HDUO\ JHQH WUDQVFULSWLRQ WHUPLQDWLRQ IDFWRU DQG DQ LQWHUPHGLDWH JHQH WUDQVFULSWLRQ LQLWLDWLRQ IDFWRU 2QH RI WKH QLQH PXWDWLRQV FUHDWHG LQ ',5 ZDV WHPSHUDWXUHVHQVLWLYH IRU JURZWK DV PHDVXUHG E\ RQHVWHS JURZWK H[SHULPHQWV ,Q YLYR FKDUDFWHUL]DWLRQ RI WKH FRQGLWLRQDO OHWKDO ',5 DOOHOH UHYHDOHG WKDW SURWHLQ '1$ DQG P51$ V\QWKHVLV DSSHDU UHODWLYHO\ QRUPDO DW WKH QRQSHUPLVVLYH WHPSHUDWXUH 7KH 9OO

PAGE 8

PXWDQW LV KRZHYHU GHIHFWLYH LQ WKH UHVROXWLRQ RI YLUDO WHORPHUHV DQG EORFNHG DW DQ HDUO\ VWDJH RI YLUDO DVVHPEO\ 0HWK\OWUDQVIHUDVH DVVD\V RQ SXULILHG YLULRQV UHYHDOHG WKDW WKH PXWDQW FDSSLQJ HQ]\PH SURWHLQ LV WKHUPRODELOH IRU PHWK\OWUDQVIHUDVH DFWLYLW\ LQ YLWUR 7KH UHVXOWV ZLWK WKH YDFFLQLD YLUXV JHQHV *5 DQG ',5 GHPRQVWUDWH WKDW FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV DQG WUDQVLHQW GRPLQDQW VHOHFWLRQ FDQ EH XVHG DV D JHQHUDO GLUHFWHG JHQHWLF PHWKRG IRU WKH FUHDWLRQ RI FRQGLWLRQDOO\ OHWKDO WHPSHUDWXUH VHQVLWLYH YDFFLQLD YLUXV PXWDQWV 9OOO

PAGE 9

&+$37(5 ,1752'8&7,21 $1' %$&.*5281' 7KH VFLHQFH RI PRGHUQ PROHFXODU ELRORJ\ KDV UHOLHG KHDYLO\ RQ JHQHWLFV WR JDLQ LQVLJKW LQWR WKH PROHFXODU PHFKDQLVPV RI OLYLQJ V\VWHPV 0DQ\ RI WKH IXQGDPHQWDO ELRFKHPLFDO PHFKDQLVPV XVHG E\ OLYLQJ V\VWHPV KDYH EHHQ LQLWLDOO\ XQFRYHUHG DQG XQGHUVWRRG WKURXJK WKH JHQHWLF DQDO\VLV RI HXNDU\RWLF YLUXVHV 7KH VPDOO JHQRPH VL]H DQG TXLFN UHSOLFDWLYH F\FOH RI YLUXVHV KDYH PDGH WKHP DWWUDFWLYH PRGHO V\VWHPV ZLWK ZKLFK WR VWXG\ WKH SURFHVVHV RI '1$ DQG 51$ UHSOLFDWLRQ WUDQVFULSWLRQ WUDQVODWLRQ DQG SRVW WUDQVODWLRQDO SURWHLQ SURFHVVLQJ 7KH JHQHWLF DQDO\VLV RI WKH RUWKRSR[YLUXV YDFFLQLD KDV EHHQ DW WKH IRUHIURQW RI PDQ\ RI WKHVH LQYHVWLJDWLRQV 2UWKRSR[YLUXVHV ZKRVH SURWRW\SLF PHPEHU LV YDFFLQLD DUH FKDUDFWHUL]HG E\ WKHLU ODUJH NEf GRXEOHVWUDQGHG '1$ JHQRPH F\WRSODVPLF VLWH RI UHSOLFDWLRQ DQG SDFNDJLQJ ZLWKLQ WKHLU YLULRQV RI DOO WKH HQ]\PHV QHFHVVDU\ IRU HDUO\ JHQH WUDQVFULSWLRQ

PAGE 10

UHYLHZHG LQ f 0HGLFDO LQWHUHVW LQ YDFFLQLD EHJDQ EHFDXVH RI WKH YLUXVf DELOLW\ WR SURYLGH SURWHFWLYH LPPXQLW\ DJDLQVW YDULROD YLUXV WKH FDXVDWLYH DJHQW RI VPDOOSR[ $OWKRXJK WKH JOREDO HUDGLFDWLRQ RI VPDOOSR[ ZDV FRPSOHWHG LQ ODUJHO\ GXH WR WKH XVH RI YDFFLQLD DV D OLYH YLUXV YDFFLQH PHGLFDO LQWHUHVW FRQWLQXHV EHFDXVH RI YDFFLQLDfV SRWHQWLDO XVH DV D UHFRPELQDQW OLYH YLUXV YDFFLQH YHFWRU f 7KH DELOLW\ WR JHQHWLFDOO\ PDQLSXODWH YDFFLQLD DQG WKH FDSDELOLW\ RI WKH YLUXV WR H[SUHVV IRUHLJQ JHQHV ZKHQ SODFHG XQGHU WKH FRQWURO RI DSSURSULDWH YLUDO UHJXODWRU\ VLJQDOV DUH HVVHQWLDO DVSHFWV RI UHFRPELQDQW YDFFLQLD YDFFLQH GHVLJQ 7KHUHIRUH VXFFHVVIXO YDFFLQH GHVLJQ UHTXLUHV GHWDLOHG NQRZOHGJH RI WKH JHQHUDO ELRORJ\ RI WKH SR[YLUXV UHSOLFDWLRQ F\FOH 7KH EDVLF ELRORJ\ RI YDFFLQLD LV DOVR RI LQWHUHVW SULPDULO\ GXH WR WKH F\WRSODVPLF VLWH RI YLUDO UHSOLFDWLRQ 7R UHSOLFDWH ZLWKLQ WKH F\WRSODVP YDFFLQLD PXVW HQFRGH PRVW LI QRW DOO RI WKH JHQHWLF LQIRUPDWLRQ QHFHVVDU\ IRU '1$ UHSOLFDWLRQ WUDQVFULSWLRQ DQG FRQWUROOHG JHQH H[SUHVVLRQ f 7KH F\WRSODVPLF VLWH RI UHSOLFDWLRQ SDFNDJLQJ RI YLUDO HQ]\PHV ZLWKLQ WKH YLUDO SDUWLFOH DQG WKH HDVH ZLWK ZKLFK WKH YLUDO JHQRPH PD\ EH JHQHWLFDOO\ PDQLSXODWHG KDV PDGH YDFFLQLD DQ H[FHOOHQW PRGHO V\VWHP ZLWK ZKLFK WR VWXG\ PDQ\ DVSHFWV RI HXNDU\RWLF ELRORJ\

PAGE 11

0RVW RI WKH JHQHWLF DQDO\VLV RI YDFFLQLD YLUXV KDV IRFXVHG RQ WKH LVRODWLRQ DQG FKDUDFWHUL]DWLRQ RI UDQGRPO\ JHQHUDWHG YLUDO PXWDQWV UHYLHZHG LQ f 7KH FKDUDFWHUL]DWLRQ RI WKHVH PXWDQWV KDV SURYHQ TXLWH XVHIXO LQ GHFLSKHULQJ WKH JHQHUDO PHFKDQLVPV LQYROYHG LQ WKH FRQWURO RI HXNDU\RWLF JHQH H[SUHVVLRQ '1$ UHSOLFDWLRQ DQG P51$ SURFHVVLQJ +RZHYHU WKH DSSOLFDELOLW\ RI YDFFLQLD YLUXV JHQHWLFV KDV EHHQ OLPLWHG E\ f WKH LQDELOLW\ WR WDUJHW VSHFLILF YLUDO JHQHV IRU PXWDJHQHVLV DQG f WKH ODERULRXV VFUHHQLQJ SURFHGXUHV QHFHVVDU\ IRU WKH LVRODWLRQ RI YLUDO PXWDQWV 7KH SXUSRVH RI WKLV GLVVHUWDWLRQ LV WR GHYHORS D GLUHFWHG JHQHWLF PHWKRG IRU WKH FUHDWLRQ RI FRQGLWLRQDOO\ OHWKDO WHPSHUDWXUHVHQVLWLYH PXWDWLRQV LQ VSHFLILF YDFFLQLD YLUXV JHQHV 'LUHFWHG JHQHWLFV RI YDFFLQLD YLUXV LQYROYHV WKH LQ YLWUR PXWDJHQHVLV RI FORQHG FRSLHV RI YLUDO JHQHV IROORZHG E\ UHFRPELQDWLRQPHGLDWHG JHQH UHSODFHPHQW WR WUDQVIHU WKHVH PXWDWLRQV RQWR WKH YLUDO FKURPRVRPH 7ZR SUREOHPV PXVW EH DGGUHVVHG LQ RUGHU WR VXFFHVVIXOO\ DSSO\ GLUHFWHG JHQHWLFV WR YDFFLQLD YLUXV f WKH LQ YLWUR PXWDJHQHVLV VFKHPH PXVW SURGXFH D KLJK SURSRUWLRQ RI FRQGLWLRQDO OHWKDO PXWDQWV LQ YLYR f WKH PXWDQW DOOHOHV PXVW EH HIILFLHQWO\ UHFRPELQHG EDFN RQWR WKH YLUDO FKURPRVRPH &OXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV DQG WUDQVLHQW

PAGE 12

GRPLQDQW VHOHFWLRQ ZHUH WHVWHG DV D PHDQV RI PDNLQJ VLWHVSHFLILF PXWDWLRQV LQ YLWUR WKDW DUH WHPSHUDWXUHVHQVLWLYH LQ YLYR DQG DV D VWUDWHJ\ IRU WDUJHWHG JHQH UHSODFHPHQW UHVSHFWLYHO\ 7KH PXWDWLRQ RI FKDUJHG DPLQR DFLGV $VS *OX +LV /\V $UJf FORVHO\ VSDFHG ZLWKLQ WKH SULPDU\ VHTXHQFH RI D SRO\SHSWLGH WR DODQLQHV KDV EHHQ VKRZQ WR SURGXFH D KLJK SURSRUWLRQ RI WHPSHUDWXUHVHQVLWLYH PXWDQWV ZKHQ WKHVH PXWDWLRQV DUH DVVD\HG LQ YLYR f 5HFRPELQDWLRQ PHGLDWHG JHQH UHSODFHPHQW LQYROYLQJ WKH GRPLQDQW VHOHFWDEOH PDUNHU [DQWKLQHJXDQLQH SKRVSKRULERV\OWUDQVIHUDVH IURP (VFKHULFKLD FROL HFRJSWf ZDV WKHQ XVHG WR WUDQVSODFH WKH ZLOG W\SH FKURPRVRPDO FRS\ RI WKH JHQH RI LQWHUHVW ZLWK D FOXVWHUHG FKDUJH WR DODQLQH PXWDQW FRS\ f &OXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV DQG WUDQVLHQW GRPLQDQW VHOHFWLRQ ZHUH WHVWHG E\ FUHDWLQJ PXWDWLRQV LQ WKH YDFFLQLD YLUXV JHQHV *5 DQG ',5 7KH HIILFLHQF\ RI WKH YDFFLQLD YLUXV GLUHFWHG JHQHWLF PHWKRG ZDV LQLWLDOO\ DVVHVVHG E\ FUHDWLQJ PXWDWLRQV LQ *5 EHFDXVH PXWDWLRQV LQ *5 SURGXFH YLUXVHV ZLWK VHOHFWDEOH SKHQRW\SHV f 7KH DELOLW\ WR VHOHFW UDWKHU WKDQ WR VFUHHQ IRU YLUXVHV FRQWDLQLQJ FOXVWHUHG FKDUJH WR DODQLQH PXWDWLRQV ZKLFK DOWHUHG *5 IXQFWLRQ PDGH LW SRVVLEOH WR HDVLO\ GHWHUPLQH WKH

PAGE 13

SKHQRW\SHV RI LQGLYLGXDO PXWDWLRQV $V D UHVXOW RI WUDQVLHQW GRPLQDQW VHOHFWLRQ LQGLYLGXDO SODTXHV DUH SURGXFHG ZKLFK FRQWDLQ D KHWHURJHQHRXV SRSXODWLRQ RI ZLOG W\SH DQG PXWDQW YLUXVHV 7KH VHOHFWDELOLW\ RI WKH *5 PXWDQWV DOVR PDGH LW SRVVLEOH WR GHWHUPLQH ZKDW SHUFHQWDJH RI YLUXVHV ZLWKLQ WKLV KHWHURJHQRXV SRSXODWLRQ FRQWDLQ WKH PXWDWLRQ RI LQWHUHVW 7KH JHQHUDO DSSOLFDELOLW\ RI WKH GLUHFWHG JHQHWLF PHWKRG ZDV DVVHVVHG E\ FUHDWLQJ PXWDWLRQV LQ ',5 ZKLFK HQFRGHV WKH ODUJH VXEXQLW RI WKH KHWHURGLPHULF YDFFLQLD P51$ FDSSLQJ HQ]\PH 7KH YDFFLQLD YLUXV P51$ FDSSLQJ HQ]\PH LV HQFRGHG E\ JHQHV ',5 ODUJH VXEXQLWf DQG '/ VPDOO VXEXQLWf f ,Q DGGLWLRQ WR LWV UROH LQ P51$ f HQG IRUPDWLRQ WKH FDSSLQJ HQ]\PH DOVR FDWDO\]HV WKH WHUPLQDWLRQ RI HDUO\ JHQH WUDQVFULSWLRQ DQG WKH LQLWLDWLRQ RI LQWHUPHGLDWH JHQH WUDQVFULSWLRQ f 7KH PXOWLIXQFWLRQDO QDWXUH RI WKH FDSSLQJ HQ]\PH DQG WKH ODFN RI WHPSHUDWXUHVHQVLWLYH PXWDWLRQV LQ WKH ODUJH VXEXQLW PDNH WKH FDSSLQJ HQ]\PH DQ H[FHOOHQW WDUJHW IRU GLUHFWHG JHQHWLFV ,Q DGGLWLRQ WKH LQ YLYR DQDO\VLV RI D FDSSLQJ HQ]\PH PXWDQW ZRXOG SURYLGH PRUH LQIRUPDWLRQ DERXW WKH UROH WKH P51$ FDSSLQJ HQ]\PH SOD\V LQ YLYR GXULQJ WKH YLUDO OLIH F\FOH

PAGE 14

*HQRPH DQG *HQRPLF 2UJDQL]DWLRQ 7KH YDFFLQLD YLUXV JHQRPH &RSHQKDJHQ VWUDLQf LV D GRXEOH VWUDQGHG '1$ PROHFXOH RI ES LQ OHQJWK f 7KH HQGV RI WKH JHQRPH WHUPLQDWH LQ LQFRPSOHWHO\ EDVHSDLUHG KDLUSLQ ORRSV ZKLFK VHUYH WR FRYDOHQWO\ FURVVOLQN HDFK VWUDQG RI WKH '1$ GXSOH[ WKHUHE\ JHQHUDWLQJ D VLQJOH FRQWLJXRXV SRO\QXFOHRWLGH FKDLQ 1XFOHRWLGH VHTXHQFLQJ RI WKH KDLUSLQ WHUPLQL LQGLFDWH WKDW WKH\ H[LVW LQ WZR LVRPHULF IRUPV WKH VHTXHQFHV RI ZKLFK DUH LQYHUWHG DQG FRPSOHPHQWDU\ ZLWK UHVSHFW WR HDFK DQRWKHU f $GMDFHQW WR HDFK KDLUSLQ WHUPLQL DUH NE LQYHUWHG WHUPLQDO UHSHDW VHTXHQFHV WKDW FRQWDLQ ZLWKLQ WKHP QXPHURXV VPDOOHU GLUHFW UHSHDW HOHPHQWV f &RPSXWHU DVVLVWHG VHTXHQFH DQDO\VLV RI WKH YLUDO JHQRPH VXJJHVWV D FRGLQJ FDSDFLW\ RI LQWURQOHVV JHQHV f %\ FRQYHQWLRQ RSHQ UHDGLQJ IUDPHV DUH GHVLJQDWHG E\ WKHLU UHODWLYH SRVLWLRQ ZLWK UHVSHFW WR +LQGOOO UHVWULFWLRQ VLWHV f 'LJHVWLRQ RI WKH YDFFLQLD YLUXV FKURPRVRPH ZLWK +LQGOOO SURGXFHV IUDJPHQWV UDQJLQJ LQ VL]H IRUP NE $ IUDJPHQWf WR ES 3 IUDJPHQWf f )LJ f

PAGE 15

)LJ 6WUXFWXUH RI WKH YDFFLQLD YLUXV JHQRPH 7KH UHODWLYH SRVLWLRQ RI WKH FHQWUDOO\ FRQVHUYHG FRUH DQG WKH QRQHVVHQWLDO OHIW DQG ULJKW KDQG HQGV RI WKH YLUDO JHQRPH %HORZ LV D YDFFLQLD +LQGOOO UHVWULFWLRQ PDS LQGLFDWLQJ WKH UHODWLYH VL]H DQG SRVLWLRQ RI HDFK +LQGOOO IUDJPHQW "f UHODWLYH PDS SRVLWLRQV RI RI WKH WHPSHUDWXUH VHQVLWLYH PXWDQWV LQ WKH &RQGLW FROOHFWLRQ 7KH +LQGOOO IUDJPHQWV ZKLFK FRQWDLQ WKH YDFFLQLD YLUXV JHQHV *5 DQG ',5 DUH LQGLFDWHG E\ *5 DQG ',5 UHVSHFWLYHO\

PAGE 16

QRQHVVHQWLDO OHIW HQG FRQVHUYHG FRUH UHJLRQ QRQHVVHQWLDO ULJKW HQG """ IW" IH" *5 '5 & 10. ) ( / + $ % RR

PAGE 17

7KH YDFFLQLD YLUXV JHQRPH FDQ DOVR EH IXQFWLRQDOO\ GLYLGHG LQWR WKUHH UHJLRQV D FHQWUDO FRUH FRQWDLQLQJ JHQHV UHTXLUHG IRU UHSOLFDWLRQ LQ WLVVXH FXOWXUH IODQNHG RQ HLWKHU VLGH E\ WZR UHJLRQV ZKLFK FRQWDLQ JHQHV QRQHVVHQWLDO IRU WLVVXH FXOWXUH UHSOLFDWLRQ 7KH FHQWUDO FRUH ZKLFK H[WHQGV IURP WKH +LQG,,, ( IUDJPHQW WKURXJK WKH OHIW KDQG WZR WKLUGV RI WKH +LQG,,, $ IUDJPHQW FRQWDLQV DSSUR[LPDWHO\ JHQHV f 7KH JHQHV ZLWKLQ WKH FHQWUDO FRUH DUH KLJKO\ FRQVHUYHG DPRQJ RWKHU PHPEHUV RI WKH RUWKRSR[YLULGDH DQG HQFRGH WKH HQ]\PDWLF DFWLYLWLHV QHFHVVDU\ IRU WKH VXUYLYDO DQG UHSURGXFWLRQ RI WKH YLUXV ZLWKLQ WKH LQIHFWHG FHOO ,Q FRQWUDVW WKH QRQHVVHQWLDO JHQHV HQFRGH SURWHLQV QHFHVVDU\ IRU SDWKRJHQHVLV DQG VSUHDG ZLWKLQ WKH LQIHFWHG KRVW RUJDQLVP f 9LUDO /LIH &\FOH 7KH FULWLFDO HYHQWV LQ WKH OLIH F\FOH RI YDFFLQLD YLUXV ZKLFK LQFOXGH DWWDFKPHQW DQG SHQHWUDWLRQ RI WKH LQIHFWLQJ YLULRQ HDUO\ LQWHUPHGLDWH DQG ODWH JHQH H[SUHVVLRQ '1$ UHSOLFDWLRQ YLULRQ PRUSKRJHQHVLV DQG UHOHDVH DUH GLDJUDPPDWLFDOO\ UHSUHVHQWHG LQ )LJ UHYLHZHG LQ f $WWDFKPHQW WR DQG SHQHWUDWLRQ RI WKH KRVW FHOO DUH SRRUO\ XQGHUVWRRG SURFHVVHV SULPDULO\ GXH WR D ODFN RI DQ\

PAGE 18

)LJ 7KH OLIH F\FOH RI YDFFLQLD YLUXV $ JHQHUDOL]HG VFKHPH IRU YDFFLQLD UHSOLFDWLRQ LV VKRZQ ,09LQWUDFHOOXODU PHPEUDQDWHG YLUXV ,(9LQWUDFHOOXODU HQYHORSHG YLUXV ((9H[WUDFHOOXODU HQYHORSHG YLUXV 9,7) YDFFLQLDLQWHUPHGLDWH WUDQVFULSWLRQ IDFWRUV 9/7) YDFFLQLD ODWH WUDQVFULSWLRQ IDFWRUV 9(7)YDFFLQLD HDUO\ WUDQVFULSWLRQ IDFWRUV

PAGE 19

,09 M ODWHUDO ERG\ ((9 PHPEUDQH

PAGE 20

GHILQLWLYH LQIRUPDWLRQ DERXW WKH LGHQWLW\ RI WKH FHOOXODU RU YLUDO UHFHSWRUV LQYROYHG )ROORZLQJ DWWDFKPHQW DQG SHQHWUDWLRQ WKH LQIHFWLQJ YLUXV UHDFKHV WKH F\WRSODVP ZKLFK LV WKH VLWH RI DOO VXEVHTXHQW YLUDO WUDQVFULSWLRQ DQG UHSOLFDWLRQ $OPRVW LPPHGLDWHO\ DIWHU SHQHWUDWLRQ WKHUH LV D SDUWLDO XQFRDWLQJ RI WKH YLULRQ XQFRDWLQJ ,f WKDW VHUYHV WR IDFLOLWDWH WKH RQVHW HDUO\ YLUDO WUDQVFULSWLRQ (DUO\ 7UDQVFULSWLRQ 7KH WUDQVFULSWLRQ RI HDUO\ JHQHV LV GLUHFWHG E\ DQ 51$ SRO\PHUDVH DQ HDUO\ WUDQVFULSWLRQ IDFWRU DQG DQ HDUO\ JHQH VSHFLILF 51$ SRO\PHUDVH DVVRFLDWHG SURWHLQ SDFNDJHG ZLWKLQ WKH YLULRQ f 2QHKDOI RI WKH YLUDO JHQRPH LV WUDQVFULEHG GXULQJ WKH HDUO\ SKDVH RI WKH LQIHFWLRQ f (DUO\ JHQHV HQFRGH SURWHLQV VXFK DV WKH FRUH 51$ SRO\PHUDVH VXEXQLWV YLUDO P51$ FDSSLQJ HQ]\PH DQG SRO\$ SRO\PHUDVH DV ZHOO DV HQ]\PHV LQYROYHG LQ '1$ UHSOLFDWLRQ DQG QXFOHLF DFLG ELRV\QWKHVLV f 7KH '1$ GHSHQGDQW 51$ SRO\PHUDVH DFWLYLW\ LVRODWHG IURP YLULRQ SDUWLFOHV FRQWDLQV DW OHDVW VXEXQLWV DQG KDV D PROHFXODU PDVV LQ H[FHVV RI N'D f 7KLV FRUH 51$ SRO\PHUDVH FRQWDLQV DOO RI WKH FDWDO\WLF DFWLYLWLHV QHFHVVDU\ IRU 51$ SRO\PHUL]DWLRQ IURP VLQJOH

PAGE 21

VWUDQGHG '1$ EXW LW ODFNV LQLWLDWLRQ VSHFLILFLW\ DQG WKH DELOLW\ WR WUDQVFULEH D GRXEOHVWUDQGHG '1$ WHPSODWH UHYLHZHG LQ f 5HFHQWO\ WZR GLVWLQFW SRSXODWLRQV RI 51$ SRO\PHUDVH DFWLYLW\ KDYH EHHQ REVHUYHG ZLWKLQ SXULILHG YLULRQV 7KHVH SRO\PHUDVH SRSXODWLRQV GLIIHU LQ WKHLU DVVRFLDWLRQ ZLWK D N'D SURWHLQ WHUPHG 5DS IRU 5-$ SRO\PHUDVH DVVRFLDWHG SURWHLQ RI N'D 5DS LV HQFRGHG E\ WKH + JHQH RI YDFFLQLD YLUXV f 5DS FRQIHUV HDUO\ SURPRWHU VSHFLILFLW\ RQ WKH FRUH 51$ SRO\PHUDVH $OWKRXJK HVVHQWLDO IRU HDUO\ JHQH WUDQVFULSWLRQ 5DS LV QRW UHTXLUHG IRU WKH WUDQVDFWLYDWLRQ RI ODWH JHQH WUDQVFULSWLRQ LQ YLWUR f 6SHFLILF WUDQVFULSWLRQ RI D GRXEOHVWUDQGHG '1$ WHPSODWH FRQWDLQLQJ DQ HDUO\ SURPRWHU FDQ EH FRQIHUUHG RQ WKH FRUH 51$ SRO\PHUDVH5DS FRPSOH[ E\ WKH DGGLWLRQ RI D KHWHURGLPHULF SURWHLQ UHIHUUHG WR DV YDFFLQLD SDUO\ WUDQVFULSWLRQ IDFWRU Y(7)f UHYLHZHG LQ f Y(7) LV FRPSRVHG RI DQ N'D SURWHLQ WKH SURGXFW RI WKH $/ JHQHf FRQWDLQLQJ OHXFLQH ]LSSHU DQG ]LQF ILQJHU PRWLIV DQG D N'D SURWHLQ WKH SURGXFW RI WKH '5 JHQHf ZKLFK FRQWDLQV PRWLIV DVVRFLDWHG ZLWK KHOLFDVHV DQG $73DVHV f 3XULILHG Y(7) KDV EHHQ VKRZQ WR EH D VHTXHQFH VSHFLILF '1$ ELQGLQJ SURWHLQ DV ZHOO DV D '1$ GHSHQGDQW $73DVH f Y(7) UHFRJQL]HV FLV

PAGE 22

DFWLQJ VHTXHQFHV FRQWDLQHG ZLWKLQ HDUO\ YLUDO SURPRWHUV VLQFH SRLQW PXWDWLRQV LQ D FRQVHQVXV HDUO\ SURPRWHU ZKLFK DEURJDWHG Y(7) '1$ ELQGLQJ DEROLVKHG HDUO\ WUDQVFULSWLRQ DFWLYLW\ f 9(7) KDV DOVR EHHQ VKRZQ WR EHQG '1$ DURXQG WKH UHJLRQ RI WKH WUDQVFULSWLRQDO VWDUW VLWH f 7KH 5DS FRQWDLQLQJ FRUH SRO\PHUDVH DQG Y(7) ZLWKLQ WKH LQIHFWLQJ YLULRQ DUH VXIILFLHQW IRU WKH WUDQVFULSWLRQ RI HDUO\ JHQHV f 7KHVH HDUO\ P51$V DUH WHUPLQDWHG FDSSHG DQG SRO\DGHQ\ODWHG E\ YLUDOO\ HQFRGHG HQ]\PHV DOVR FRQWDLQHG ZLWKLQ WKH YLULRQ f (DUO\ 7UDQVFULSWLRQ 7HUPLQDWLRQ 7KH YDFFLQLD YLUXV P51$ FDSSLQJ HQ]\PH FDWDO\]HV WKH WHUPLQDWLRQ RI HDUO\ JHQH WUDQVFULSWLRQ LQ UHVSRQVH WR WKH FLV DFWLQJ VHTXHQFH 8888818 LQ WKH QDVFHQW P51$ f (DUO\ WUDQVFULSWLRQ WHUPLQDWLRQ RFFXUV WR QXFOHRWLGHV GRZQVWUHDP RI D 7777717 HOHPHQW LQ WKH VHQVH '1$ VWUDQG f %RWK P51$ FDSSLQJ HQ]\PH VXEXQLWV DUH UHTXLUHG IRU HDUO\ WUDQVFULSWLRQ WHUPLQDWLRQ DFWLYLW\ KRZHYHU QHLWKHU IXQFWLRQDO JXDQ\OWUDQVIHUDVH QRU JXDQLQH fPHWK\OWUDQVIHUDVH DFWLYH VLWHV DUH QHFHVVDU\ IRU WHUPLQDWLRQ f $ PRGHO IRU HDUO\ WUDQVFULSWLRQ WHUPLQDWLRQ KDV EHHQ GHVFULEHG WKDW

PAGE 23

FDOOV IRU WKH FDSSLQJ HQ]\PH WR ELQG WR P51$ DV LW LV H[WUXGHG IURP WKH EDFN RI WKH HORQJDWLQJ SRO\PHUDVH f 8SRQ HQFRXQWHULQJ WKH 8888818 VLJQDO WKH FDSSLQJ HQ]\PH FDWDO\]HV WKH WHUPLQDWLRQ RI WUDQVFULSWLRQ YLD SURWHLQSURWHLQ FRQWDFWV ZLWK WKH HORQJDWLRQ FRPSOH[ &RQVLVWHQW ZLWK WKLV GDWD LV WKH REVHUYDWLRQ WKDW WKH ODUJH VXEXQLW RI WKH FDSSLQJ HQ]\PH LV FDSDEOH RI ELQGLQJ 51$ $OWKRXJK WKH 51$ ELQGLQJ RI WKH ',5 SURWHLQ LV QRQVSHFLILF 51$ ELQGLQJ FDQ EH SUHIHUHQWLDOO\ FRPSHWHG ZLWK SRO\ 8 LQGLFDWLQJ WKDW WKLV 51$ ELQGLQJ GRPDLQ PD\ EH LQYROYHG LQ UHFRJQLWLRQ RI WKH 8888818 VHTXHQFH LQ YLYR f 7KH GRPDLQ UHVSRQVLEOH IRU WKH LQWHUDFWLRQ RI WKH FDSSLQJ HQ]\PH ZLWK WKH HDUO\ WUDQVFULSWLRQ HORQJDWLRQ FRPSOH[ LV SUHVHQWO\ XQNQRZQ )ROORZLQJ WHUPLQDWLRQ HDUO\ WUDQVFULSWV ZKLFK KDYH EHHQ FDSSHG DQG SRO\DGHQ\ODWHG DUH H[WUXGHG IURP WKH YLUDO FRUH LQWR WKH F\WRSODVP f 7KH DFFXPXODWLRQ RI HDUO\ JHQH SURGXFWV ZKLFK HQFRGH WUDQVFULSWLRQ IDFWRUV VSHFLILF IRU LQWHUPHGLDWH JHQH WUDQVFULSWLRQ DQG WKH RQVHW RI YLUDO '1$ UHSOLFDWLRQ OHDG WR WKH VHFRQG WUDQVFULSWLRQDO VWDJH RI WKH YLUDO OLIH F\FOH WKH WUDQVDFWLYDWLRQ RI LQWHUPHGLDWH JHQHV

PAGE 24

,QWHUPHGLDWH 7UDQVFULSWLRQ 7KH WUDQVFULSWLRQ RI LQWHUPHGLDWH DQG ODWH YDFFLQLD JHQHV RFFXUV DIWHU WKH RQVHW RI '1$ UHSOLFDWLRQ f 7KH WZR FODVVHV RI SRVW UHSOLFDWLYH JHQHV FDQ EH GLVWLQJXLVKHG E\ WKHLU UHODWLYH WUDQVFULSWLRQDO DFWLYLW\ LQ WKH SUHVHQFH LQKLELWRUV RI '1$ V\QWKHVLV ,QWHUPHGLDWH JHQHV DUH GHILQHG DV WKRVH SRVW UHSOLFDWLYH JHQHV FDSDEOH RI EHLQJ H[SUHVVHG IURP SODVPLGV WUDQVIHFWHG LQWR LQIHFWHG FHOOV WKDW KDYH EHHQ WUHDWHG ZLWK D '1$ V\QWKHVLV LQKLELWRU f 7KHUHIRUH DOO RI WKH WUDQVDFWLQJ IDFWRUV QHFHVVDU\ IRU LQWHUPHGLDWH JHQH WUDQVFULSWLRQ DUH SUHVHQW LQ WKH LQIHFWHG FHOOV SULRU WR '1$ UHSOLFDWLRQ f )LYH LQWHUPHGLDWH JHQHV KDYH EHHQ LGHQWLILHG WR GDWH WKUHH RI ZKLFK IXQFWLRQ DV ODWH WUDQVFULSWLRQ IDFWRUV f 7UDQVFULSWLRQ IURP LQWHUPHGLDWH SURPRWHUV UHTXLUHV WKH FRUH 51$ SRO\PHUDVH FRPSOH[ USR JHQH (/f DQ XQGHILQHG FHOOXODU IDFWRU RU IDFWRUV WHUPHG 9,7) RU YDFFLQLD LQWHUPHGLDWH WUDQVFULSWLRQ IDFWRU DQG WKH YDFFLQLD P51$ FDSSLQJ HQ]\PH f 7KH FDSSLQJ HQ]\PH IRUPV D VWDEOH FRPSOH[ ZLWK WKH FRUH 51$ SRO\PHUDVH DQG FRPSOH[ IRUPDWLRQ LV UHTXLUHG IRU ELQGLQJ RI WKH SRO\PHUDVH DW WKH LQWHUPHGLDWH SURPRWHU f 7KHUHIRUH WKH

PAGE 25

SDUWLFLSDWLRQ RI YDFFLQLD FDSSLQJ HQ]\PH LQ LQWHUPHGLDWH WUDQVFULSWLRQ LQLWLDWLRQ LV DW D OHYHO RWKHU WKDQ WKDW RI P51$ FDSSLQJ f 7KH P51$ FDSSLQJ HQ]\PH GRPDLQ QHFHVVDU\ IRU WKH WUDQVDFWLYDWLRQ RI LQWHUPHGLDWH WUDQVFULSWLRQ LV XQNQRZQ /DWH 7UDQVFULSWLRQ :LWK FRQWLQXLQJ '1$ V\QWKHVLV DQG WKH EXLOGXS RI LQWHUPHGLDWH SURWHLQV VRPH RI ZKLFK HQFRGH ODWH WUDQVFULSWLRQ IDFWRUV WKH ODVW WUDQVFULSWLRQDO SKDVH RI WKH YLUDO OLIH F\FOH EHJLQV /DWH JHQHV HQFRGH VWUXFWXUDO SURWHLQV RI WKH YLUDO SDUWLFOH WKH HDUO\ WUDQVFULSWLRQDO PDFKLQHU\ SDFNDJHG ZLWKLQ WKH GHYHORSLQJ YLULRQ DQG HQ]\PHV LQYROYHG LQ PRUSKRJHQHVLV f $ JHQHWLF DSSURDFK KDV EHHQ XVHG WR LGHQWLI\ VRPH RI WKH LQWHUPHGLDWH JHQH SURGXFWV UHTXLUHG IRU ODWH JHQH H[SUHVVLRQ ,QWHUPHGLDWH DQG ODWH WUDQVFULSWLRQ LV EORFNHG LQ WKH SUHVHQFH RI '1$ V\QWKHVLV LQKLELWRUV f +RZHYHU LQWHUPHGLDWH SURPRWHUV DUH XWLOL]HG LI WKH\ DUH FRQWDLQHG RQ SODVPLGV WUDQVIHFWHG LQWR WKH LQKLELWRU WUHDWHG LQIHFWHG FHOOV f /DWH WUDQVFULSWLRQ IDFWRUV HQFRGHG E\ LQWHUPHGLDWH JHQHV ZHUH LGHQWLILHG E\ WUDQVIHFWLQJ FORQHG YDFFLQLD JHQHV LQWR '1$ V\QWKHVLV LQKLELWRU WUHDWHG FHOOV DQG

PAGE 26

DVVD\LQJ IRU WUDQVFULSWLRQ RI D ODWH SURPRWHU FRQWDLQLQJ UHSRUWHU JHQH FRQVWUXFW f 7KLV PHWKRGRORJ\ LGHQWLILHG WKUHH LQWHUPHGLDWH JHQHV $,/ $/ DQG *5 WKDW IXQFWLRQ DV ODWH WUDQVFULSWLRQ IDFWRUV f 7KH H[DFW UROH HDFK RI WKHVH SURWHLQV SOD\V LQ WKH WUDQVFULSWLRQ RI ODWH JHQHV LV XQNQRZQ 5HFHQWO\ D IDFWRU LGHQWLILHG DV 3 KDV EHHQ VKRZQ WR DOVR EH UHTXLUHG IRU KLJK OHYHO LQ YLWUR WUDQVFULSWLRQ RI D ODWH SURPRWHU FRQWDLQLQJ UHSRUWHU FRQVWUXFW 7KH 3 ODWH WUDQVFULSWLRQ IDFWRU DFWLYLW\ LV SUHVHQW LQ LQIHFWHG FHOOV SULRU WR WKH RQVHW RI '1$ UHSOLFDWLRQ LW LV KRZHYHU QRW GHWHFWHG LQ XQLQIHFWHG FHOOV ,W UHPDLQV WR EH GHWHUPLQHG LI 3 LV D FHOOXODU IDFWRU DFWLYDWHG E\ WKH LQIHFWLRQ RU LV YLUDOO\ HQFRGHG f 6WUXFWXUH RI ,QWHUPHGLDWH DQG /DWH 7UDQVFULSWV 7ZR GLVWLQJXLVKLQJ IHDWXUHV RI LQWHUPHGLDWH DQG ODWH P51$ WUDQVFULSWV DUH WKH SUHVHQFH RI QRQWHPSODWHG SRO\DGHQ\ODWH UHVLGXHV DW WKHLU f HQGV DQG WKH ODFN RI GLVFUHWH f HQGV f 7KH QRQWHPSODWHG DGHQ\ODWH UHVLGXHV DW WKH f HQG RI FDSSHG LQWHUPHGLDWH DQG ODWH P51$V DUH WKRXJKW WR DULVH YLD D VOLSSDJH PHFKDQLVP E\ WKH 51$ SRO\PHUDVH f 7KH DYHUDJH OHQJWK RI WKH SRO\$ KHDG LV EHWZHHQ WR QXFOHRWLGHV f ,QWHUHVWLQJO\ LQ

PAGE 27

WKH DEVHQFH RI D SRO\ $ KHDG WKH WUDQVODWLRQDO VWDUW VLWH RI PRVW LQWHUPHGLDWH DQG ODWH P51$V ZRXOG EH FRWHUPLQDO ZLWK WKH f HQG 7KHUHIRUH WKH SRO\ $ KHDG PD\ IXQFWLRQ LQ D PDQQHU DQDORJRXV WR D f XQWUDQVODWHG UHJLRQ LQFUHDVLQJ WKH HIILFLHQF\ RI WUDQVODWLRQ LQLWLDWLRQ E\ IDFLOLWDWLQJ WKH ELQGLQJ RI HLWKHU WUDQVODWLRQ LQLWLDWLRQ IDFWRUV RU WKH V ULERVRPDO VXEXQLW f 7UDQVFULSWV GHULYHG IURP LQGLYLGXDO LQWHUPHGLDWH DQG ODWH JHQHV DUH KHWHURJHQHRXV LQ OHQJWK DW WKHLU f HQGV GXH WR D ODFN RI GLVFUHWH VLWHV RI WUDQVFULSWLRQ WHUPLQDWLRQ 7KH WHUPLQDWLRQ RI LQWHUPHGLDWH DQG ODWH WUDQVFULSWLRQ DSSHDUV WR RFFXU UDQGRPO\ JHQHUDWLQJ D SRSXODWLRQ RI P51$ PROHFXOHV RI GLIIHUHQW OHQJWKV 7KLV KHWHURJHQHLW\ LQ VL]H FDQ EH GHWHFWHG DV D VPHDU XSRQ QRUWKHUQ DQDO\VLV RI LQGLYLGXDO LQWHUPHGLDWH RU ODWH YLUDO P51$V '1$ 5HSOLFDWLRQ 2UWKRSR[YLUXV '1$ UHSOLFDWLRQ RFFXUV LQ DUHDV RI WKH F\WRSODVP NQRZQ DV YLURVRPHV RU YLUDO IDFWRULHV %HFDXVH UHSOLFDWLRQ RI YDFFLQLD '1$ FDQ RFFXU LQ HQXFOHDWHG FHOOV LW DVVXPHG WKDW DOO RI WKH UHSOLFDWLRQ PDFKLQHU\ LV YLUDOO\ HQFRGHG f 0DQ\ RI WKH YLUDO HQ]\PHV QHFHVVDU\ IRU '1$ UHSOLFDWLRQ KDYH EHHQ LGHQWLILHG WKHVH

PAGE 28

LQFOXGH D '1$ SRO\PHUDVH D QLFNLQJMRLQLQJ HQ]\PH D '1$ WRSRLVRPHUDVH D G873DVH DQG D '1$ ELQGLQJ SURWHLQ UHYLHZHG LQ f 6HYHUDO SUHYLRXVO\ PHQWLRQHG VWUXFWXUDO IHDWXUHV RI WKH YDFFLQLD YLUXV JHQRPH DUH VKRZQ LQ )LJ 7KH HQGV RI WKH JHQRPH FRQVLVW RI LQFRPSOHWHO\ EDVH SDLUHG KDLUSLQ WHUPLQL ZKLFK FRYDOHQWO\ FURVVOLQN HDFK VWUDQG RI WKH JHQRPH )LJ f 7KH '1$ VHTXHQFHV RI WKH KDLUSLQ HQGV DUH LQYHUWHG DQG FRPSOHPHQWDU\ LVRPHUV RI HDFK RWKHU WHUPHG IOLS DQG IORS RU IDVW DQG VORZ EDVHG XSRQ WKHLU UHODWLYH PRELOLWLHV LQ QRQGHQDWXULQJ DJDURVH JHOV 2Q HLWKHU VLGH RI WKH YLUDO FKURPRVRPH DGMDFHQW WR WKH KDLUSLQ HQGV DUH ORFDWHG NE LQYHUWHG WHUPLQDO UHSHDWV )LJ f :LWKLQ WKHVH LQYHUWHG WHUPLQDO UHSHDWV DUH QXPHURXV VPDOO WDQGHPO\ DUUDQJHG GLUHFW UHSHDW HOHPHQWV 7KH GLUHFW UHSHDW VHTXHQFHV EHJLQ DERXW EDVH SDLUV IURP WKH KDLUSLQ HQGV DQG H[WHQG LQZDUG IRU DSSUR[LPDWHO\ NE LQWR WKH LQYHUWHG WHUPLQDO UHSHDWV )LJ f f 7KH H[DFW PHFKDQLVP RI SR[YLUXV '1$ UHSOLFDWLRQ LV XQNQRZQ KRZHYHU WKH DYDLODEOH GDWD VXJJHVWV WKDW UHSOLFDWLRQ RFFXUV LQ D VHPLFRQVHUYDWLYH IDVKLRQ DQG EHJLQV ZLWK D VLWHVSHFLILF QLFN ZLWKLQ

PAGE 29

)LJ 6WUXFWXUDO HOHPHQWV RI WKH YDFFLQLD YLUXV JHQRPH f 1XFOHRWLGH VHTXHQFH RI WKH PD[LPXP EDVH SDLUHG VWUXFWXUH RI WKH YDFFLQLD YLUXV KDLUSLQ HQGV IOLS 6f DQG IORS )f %HORZ LV WKH QXFOHRWLGH VHTXHQFHV RI IOLS DUUDQJHG ff DQG IORS DUUDQJHG ff GHPRQVWUDWLQJ WKH LQYHUWHG FRPSOHPHQWDU\ QDWXUH RI WKH KDLUSLQ LVRPHUV $GDSWHG IURP %DURXG\ %0 6 9HQNDWHVDQ DQG % 0RVV 6WUXFWXUH DQG UHSOLFDWLRQ RI YDFFLQLD YLUXV WHORPHUHV &ROG6SULQJ+DUERU6\PS4XDQW%LRO 3W S f 9DFFLQLD JHQRPH VKRZLQJ WKH ORFDWLRQ RI WKH NE LQYHUWHG WHUPLQDO UHSHDWV f $ VLQJOH LQYHUWHG WHUPLQDO UHSHDW GHPRQVWUDWLQJ WKH SRVLWLRQ RI WKH GLUHFW UHSHDWV

PAGE 30

mf } FD $r77$7rr$77r7$7$7$7$}77W7$7$$77r$777$$7777ƒ<9UUUUUUUm&U&U-f $7 &$$7& $777$$ 7$-$7$7$77 $$$$7 $7 7$$7W$ $$O 7$$$$W $-U&6n 7 9 7 9 9 9 9 77 ff RR UH WR RR RR f $ $ $ & $ 7 $$ 7$*77$OL `$$$7$$7$7$7$ƒ 9U77$7$77$$I 9L$ $,77ƒ 7UUUUUU 7W*7&77 77&$$7&$777$$7$7$7$ 7$77$ $$$7$77$$77$$$77$$$$7 $ U UU & 72 -9 U n MR MR VR RR MR RR VR 6 U 62 62 62 -2 r $W7$$$W$7$$$7$$*$&$$$$&7$W$7W7$7$$Q$&7$$&7$$$*W7$$$$L$$W$WWQ$$$n!$$8W$$O77$&7$n &0 7 NE LQYHUWHG WHUPLQDO UHSHDWV L U +DLUSLQ HQG NLOREDVH SDLUV .! +DLUSLQ HQG DLPQLQLMLPQU GLUHFW UHSHDWV 7 7

PAGE 31

WKH LQYHUWHG WHUPLQDO UHSHDW 7KH LVRODWLRQ RI UHSOLFDWLYH LQWHUPHGLDWHV RI UDEELWSR[ YLUXV DQG YDFFLQLD ZKLFK FRQVLVW RI FRQFDWDPHULF IRUPV RI JHQRPLF '1$ DUUDQJHG LQ D KHDG WR KHDG RU WDLO WR WDLO OLQHDU DUUD\ FRQFDWDPHUV FRQVLVWLQJ RI D OHIW HQG RI WKH JHQRPH IXVHG WR D OHIW HQG RI DQRWKHU JHQRPH RU D ULJKW HQG RI WKH JHQRPH IXVHG WR DQRWKHU ULJKW HQGf KDYH OHDG WR WKH IRUPXODWLRQ RI D PRGHO IRU '1$ UHSOLFDWLRQ RXWOLQHG LQ )LJ f ,Q WKLV PRGHO '1$ UHSOLFDWLRQ EHJLQV ZLWK D QLFN ZLWKLQ WKH LQYHUWHG WHUPLQDO UHSHDWV SUR[LPDO WR WKH KDLUSLQ WHUPLQL 7KH QLFN JHQHUDWHV D IUHH f K\GUR[\O FDSDEOH RI DFWLQJ DV D SULPHU IRU '1$ V\QWKHVLV (ORQJDWLRQ RI WKH IUHH f HQG JHQHUDWHV D UHSOLFDWLRQ LQWHUPHGLDWH WKDW LV VOLJKWO\ ORQJHU WKDQ JHQRPH OHQJWK )LJ f 7KH VHOI FRPSOHPHQWDULW\ RI RSSRVLQJ VWUDQGV RI WKH GXSOH[ DOORZV WKH '1$ VWUDQGV WR IROG EDFN XSRQ WKHPVHOYHV IRUPLQJ KDLUSLQ HQGV )LJ f 2QH KDLUSLQ FRQWDLQV D IUHH f K\GUR[\O DQG WKXV FDQ DFW DV D SULPHU IRU WKH GXSOLFDWLRQ RI WKH HQWLUH JHQRPH )LJV DQG f 7KH UHVXOWLQJ PROHFXOH FRQVLVWV RI WZR JHQRPHV DUUDQJHG VXFK WKDW WKH ULJKW HQG RI RQH JHQRPH LV IXVHG WR WKH ULJKW HQG RI DQRWKHU JHQRPH WDLO WR WDLOf ZLWK D QLFN DW RQH HQG )LJ f &RQWLQXDWLRQ RI WKLV SURFHVV \LHOGV D WHWUDPHULF PROHFXOH FRQVLVWLQJ RI JHQRPHV DUUDQJHG KHDG WR KHDG

PAGE 32

)LJ 6HOISULPLQJ PRGHO IRU YDFFLQLD YLUXV '1$ UHSOLFDWLRQ 6HTXHQFHV RI WKH LQYHUWHG WHUPLQDO UHSHDWV DQG WKHLU FRPSOHPHQWV DUH LQGLFDWHG E\ XSSHUFDVH DQG ORZHUFDVH OHWWHUV UHVSHFWLYHO\ ) DQG 6 GHQRWH IOLS DQG IORS KDLUSLQ HQGV 1HZO\ UHSOLFDWHG '1$ LV UHSUHVHQWHG E\ GDVKHG OLQHV 6KRZQ LV D VFKHPH ZKLFK UHSOLFDWLRQ LV LQLWLDWHG E\ D QLFN DW RQH HQG RI WKH JHQRPH $GDSWHG IURP %DURXG\ %0 6 9HQNDWHVDQ DQG % 0RVV 6WUXFWXUH DQG UHSOLFDWLRQ RI YDFFLQLD YLUXV WHORPHUHV &ROG6SULQJ+DUERU6\PS4XDQW%LRO 3W S

PAGE 33

2 ( ) 2 ,77 UrFN G 777 ) ( A A 2 Yr I ) n UGV k I H R 2n G $ % & 2 ( ) m E H G f } % A ‘ L L 2 ‘ ?B E FF $ RU 1 f 9AU U rf EnnF f G )(2 m f G I ( 2 p f G U Q ) ( k ( ) G n G f ) ( n‘ ( ) W f G G f ) ( A c%

PAGE 34

DQG WDLO WR WDLO QRW VKRZQf 6XSSRUW RI WKLV PRGHO LQFOXGHV WKH LVRODWLRQ RI MXVW VXFK WHWUDPHULF UHSOLFDWLRQ LQWHUPHGLDWHV f $GGLWLRQDO VXSSRUW RI WKH PRGHO KDV EHHQ SURYLGHG E\ WHPSHUDWXUH VKLIW H[SHULPHQWV ZLWK UHSOLFDWLRQ GHILFLHQW PXWDQWV ZKLFK GXULQJ WKH LQLWLDO SKDVHV RI '1$ UHSOLFDWLRQ LQFRUSRUDWH UDGLRODEHOHG '1$ SUHFXUVRUV QHDU WKH HQGV RI WKH JHQRPH f 7HORPHUH 5HVROXWLRQ 7KH YDFFLQLD UHSOLFDWLRQ VFKHPH RXWOLQHG LQ )LJ OHDGV WR WZR FRSLHV RI WKH YLUDO JHQRPH IXVHG DW D GXSOH[ FRS\ RI D KDLUSLQ ORRS )LJ f 7KH GXSOLFDWHG IRUP RI WKH KDLUSLQ ORRS LV FDOOHG WKH FRQFDWDPHU MXQFWLRQ 7KH UHVROXWLRQ RI FRQFDWDPHULF '1$ LQWR JHQRPH OHQJWK XQLWV FRQWDLQLQJ WHUPLQDO KDLUSLQ HQGV )LJ f D SURFHVV NQRZQ DV WHORPHUH UHVROXWLRQ KDV EHHQ GHVFULEHG DV D VLWH VSHFLILF UHFRPELQDWLRQ HYHQW WKDW UHTXLUHV DQ DV \HW XQLGHQWLILHG WUDQVDFWLQJ WHORPHUH UHVROYDVH DQG WZR LGHQWLFDO LQYHUWHG FRSLHV RI D FLV HOHPHQW NQRZQ DV WKH WHORPHUH UHVROXWLRQ WDUJHW UHYLHZHG LQ f $OWKRXJK WKH H[DFW PHFKDQLVP LV XQNQRZQ GXULQJ WHORPHUH UHVROXWLRQ D FUXFLIRUP VWUXFWXUH LV IRUPHG E\ LQWUDVWUDQG EDVH SDLULQJ EHWZHHQ IOLS DQG IORS VHTXHQFHV ZLWKLQ WKH FRQFDWDPHU

PAGE 35

MXQFWLRQ f &UXFLIRUP VWUXFWXUHV KDYH EHHQ REVHUYHG LQ HOHFWURQ PLFURJUDSKV RI FRQFDWDPHU MXQFWLRQ FRQWDLQLQJ SODVPLGV f 7KH DUPV RI WKH FUXFLIRUP FRQVLVW RI IOLS DQG IORS VHTXHQFHV DQG WKH EDVH IRUPV D KROLGD\ VWUXFWXUH 6LWHVSHFLILF QLFNLQJ VWUDQG H[FKDQJH DQG OLJDWLRQ WKHQ VHUYH WR UHFRQVWLWXWH WKH WHUPLQDO KDLUSLQ HQGV f &LUFXODU SODVPLGV FRQWDLQLQJ D FRQFDWDPHU MXQFWLRQ DQG VRUURXQGLQJ IODQNLQJ VHTXHQFHV ZLOO UHVROYH ZKHQ WUDQVIHFWHG LQWR LQIHFWHG FHOOV LQWR OLQHDU PLQLFKURPRVRPHV ZLWK FRYDOHQWO\ FORVHG KDLUSLQ HQGV f 7KLV LQ YLYR DVVD\ KDV EHHQ XVHG WR GHWHUPLQH WKH VHTXHQFH UHTXLUHPHQWV IRU WHORPHUH UHVROXWLRQ f 2SWLPDO UHVROXWLRQ RI FLUFXODU SODVPLGV LQWR OLQHDU PLQLFKURPRVRPHV LQ YLYR UHTXLUHV WZR LQYHUWHG FRSLHV RI D EDVH SDLU VHTXHQFH IODQNLQJ LQYHUWHG UHSHDWV FDSDEOH RI LQWUDVWUDQG EDVH SDLULQJ 7ZR LQYHUWHG FRSLHV RI WKH WHORPHUH UHVROXWLRQ WDUJHW DUH SUHVHQW LQ HDFK FRQFDWDPHU RQH RQ HLWKHU VLGH RI WKH FRQFDWDPHU MXQFWLRQ (DFK WHORPHUH UHVROXWLRQ WDUJHW FRQVLVWV RI D EDVH SDLU FRUH GRPDLQ DEVROXWHO\ UHTXLUHG IRU UHVROXWLRQ DQG WZR DX[LOLDU\ GRPDLQV ZKLFK ZKHQ SUHVHQW VHUYH WR HQKDQFH WKH UHVROXWLRQ HIILFLHQF\ f 7KH VHTXHQFH RI WKH FRUH HOHPHQW LV DEVROXWHO\ FRQVHUYHG DPRQJ GLYHUJHQW PHPEHUV RI WKH RUWKRSR[YLULGDH LPSO\LQJ WKDW WKHUH PD\

PAGE 36

EH FRPPRQ WUDQVDFWLQJ IDFWRUV UHFRJQL]LQJ WKLV VHTXHQFH GXULQJ WKH UHVROXWLRQ HYHQW f $OWKRXJK WKH VHTXHQFHV RI WKH DX[LOLDU\ GRPDLQV DUH OHVV KLJKO\ FRQVHUYHG WKH UHODWLYH SRVLWLRQV RI SXULQHV DQG S\ULPLGLQHV LQ WKHVH UHJLRQV LV PDLQWDLQHG DPRQJ WKH RUWKRSR[YLULGDH f ,W KDV EHHQ VKRZQ WKDW WKH WHORPHUH UHVROXWLRQ WDUJHW IXQFWLRQV DV D SURPRWHU GXULQJ WKH ODWWHU VWDJHV RI WKH YDFFLQLD YLUXV OLIH F\FOH f 7KH 51$ WUDQVFULSW IURP WKH WHORPHUH UHJLRQ DSSHDUV QRW WR FRGH IRU SURWHLQ f 6HTXHQFH DQDO\VLV RI WKH WHORPHUH UHVROXWLRQ WDUJHW LQGLFDWHV WKDW WKH FULWLFDO UHJLRQ DSSHDUV WR EH D JRRG FDQGLGDWH IRU D ODWH YLUDO SURPRWHU f :KHWKHU WKH WHORPHUH UHVROXWLRQ WDUJHW IXQFWLRQV DV DQ LQWHUPHGLDWH RU ODWH SURPRWHU LV XQNQRZQ DV LV WKH UROH WKDW WUDQVFULSWLRQ SOD\V LQ WKH UHVROXWLRQ HYHQW 0F)DGGHQ SHUVRQDO FRPPXQLFDWLRQf 7UDQVDFWLQJ )DFWRUV 5HTXLUHG IRU 5HVROXWLRQ 7KHUH LV YHU\ OLWWOH LQIRUPDWLRQ UHJDUGLQJ WKH SURWHLQ IDFWRUV LQYROYHG LQ WKH UHVROXWLRQ RI YDFFLQLD WHORPHUHV 7KH PLQLPDO HQ]\PDWLF DFWLYLWLHV UHTXLUHG IRU UHVROXWLRQ DUH D VLWHVSHFLILF HQGRQXFOHDVH DQG D '1$ OLJDVH DOWKRXJK SURWHLQV FDSDEOH RI

PAGE 37

FDWDO\]LQJ VWUDQG H[FKDQJH DUH DOVR SUREDEO\ LQYROYHG f $ QLFNLQJMRLQLQJ HQ]\PDWLF DFWLYLW\ LVRODWHG IURP SXULILHG YLULRQV KDV EHHQ VKRZQ WR SUHIHUHQWLDOO\ FOHDYH ZLWKLQ WKH FRUH GRPDLQ RI WKH WHORPHUH UHVROXWLRQ WDUJHW f 7KH QLFNLQJMRLQLQJ DFWLYLW\ FRPLJUDWHV ZLWK D N'D SRO\SHSWLGH ZKLFK KDV EHHQ SUHYLRXVO\ VKRZQ WR EH D VLQJOH VWUDQG VSHFLILF HQGRQXFOHDVH f $OWKRXJK GHILQLWLYH SURRI LV VWLOO ODFNLQJ WKLV HQ]\PDWLF DFWLYLW\ LV D JRRG FDQGLGDWH IRU WKH VLWHVSHFLILF HQGRQXFOHDVH QHFHVVDU\ IRU WHORPHUH UHVROXWLRQ $ JHQHWLF DSSURDFK KDV DOVR EHHQ WDNHQ WR LGHQWLI\ IDFWRUV LQYROYHG LQ WHORPHUH UHVROXWLRQ 6L[ QRQFRPSOHPHQWLQJ WHPSHUDWXUHVHQVLWLYH PXWDQWV KDYH EHHQ LGHQWLILHG ZKLFK DUH LQFDSDEOH RI UHVROYLQJ '1$ FRQFDWDPHUV DW WKH QRQSHUPLVVLYH WHPSHUDWXUH f )LYH RI WKH VL[ FRPSOHPHQWDWLRQ JURXSV KDYH D FRUUHVSRQGLQJ GHIHFW LQ WKH V\QWKHVLV RI ODWH YLUDO SURWHLQV 7KH REVHUYDWLRQ WKDW PXWDQWV GHIHFWLYH LQ ODWH SURWHLQ V\QWKHVLV DUH DOVR GHIHFWLYH LQ WHORPHUH UHVROXWLRQ VXJJHVWV WKDW D FULWLFDO IDFWRU V\QWKHVL]HG ODWH GXULQJ LQIHFWLRQ LV UHTXLUHG IRU WHORPHUH UHVROXWLRQ f 7KH VLQJOH WHPSHUDWXUHVHQVLWLYH PXWDQW ZKLFK LV LQFDSDEOH RI WHORPHUH UHVROXWLRQ EXW QRW GHIHFWLYH LQ ODWH JHQH H[SUHVVLRQ PDSV WR

PAGE 38

WKH VPDOO VXEXQLW RI WKH YDFFLQLD YLUXV FDSSLQJ HQ]\PH f 7KHUHIRUH JHQHWLF HYLGHQFH LPSOLFDWHV WKH VPDOO VXEXQLW RI WKH YDFFLQLD YLUXV FDSSLQJ HQ]\PH JHQH '/f LQ WKH UHVROXWLRQ SURFHVV $OWKRXJK QR GLUHFW ELRFKHPLFDO UROH LQ UHVROXWLRQ KDV EHHQ GHPRQVWUDWHG IRU WKH P51$ FDSSLQJ HQ]\PH LW LV LQWHUHVWLQJ WR VSHFXODWH LQ OLJKW RI WKH FDSSLQJ HQ]\PHfV IXQFWLRQ DV DQ LQLWLDWLRQ IDFWRU IRU LQWHUPHGLDWH WUDQVFULSWLRQ WKDW WUDQVFULSWLRQ RI WKH WHORPHUH UHVROXWLRQ WDUJHW PD\ SOD\ D UROH LQ UHVROXWLRQ f 7UDQVFULSWLRQ WKURXJK WKH WHORPHUH UHVROXWLRQ WDUJHW PD\ RSHQ XS WKH '1$ VWUDQGV DQG IDFLOLWDWH WKH IRUPDWLRQ RI D XQLTXH VHFRQGDU\ VWUXFWXUH WKDW LV UHFRJQL]HG E\ WKH HQ]\PHV LQYROYHG LQ UHVROXWLRQ $OWHUQDWLYHO\ E\ XQZLQGLQJ WKH '1$ VWUDQGV WUDQVFULSWLRQ PD\ LQGLUHFWO\ DLG WKH ELQGLQJ RI WKH '1$ UHVROYDVH f 9LULRQ 0RUSKRJHQHVLV DQG 5HOHDVH 0XFK RI WKH LQIRUPDWLRQ DYDLODEOH RQ WKH PRUSKRJHQHVLV RI SR[YLUXVHV FRPHV IURP HOHFWURQ PLFURVFRSLF H[DPLQDWLRQ RI FHOOV LQIHFWHG ZLWK YLUDO PXWDQWV f 7KHVH REVHUYDWLRQV KDYH OHG WR WKH PRGHO IRU PRUSKRJHQHVLV GHSLFWHG LQ )LJ 0RUSKRJHQHVLV EHJLQV ZLWKLQ DQ HOHFWURQ GHQVH UHJLRQ RI WKH F\WRSODVP NQRZQ DV

PAGE 39

YLURSODVP 9LURSODVP LV WKRXJKW WR FRQVLVW RI QXFOHRSURWHLQ FRPSOH[HV ZKLFK DUH WKH UHVXOW RI YLUDO '1$ UHSOLFDWLRQ DOWKRXJK GLUHFW HYLGHQFH IRU WKLV LV ODFNLQJ 7KH ILUVW GLVWLQFW VWUXFWXUH LQ WKH PRUSKRJHQHVLV SDWKZD\ LV WKH DSSHDUDQFH RI YLUDO FUHVFHQWV &UHVFHQWV FRQVLVW RI WZR FORVHO\ RSSRVHG OLSLG ELOD\HU PHPEUDQHV GHULYHG IURP WKH KRVW FHOOV LQWHUPHGLDWH FRPSDUWPHQW f 6SLNH OLNH SURMHFWLRQV NQRZQ DV VSLFXOHV UDGLDWH IURP WKH FRQYH[ VXUIDFH RI WKH FUHVFHQW 6SLFXOHV DUH WKRXJKW WR JLYH WKH FUHVFHQW LWV ULJLG FRQYH[ VKDSH f &UHVFHQWV HQYHORSH D SRUWLRQ RI WKH YLURSODVP SURGXFLQJ D VSKHULFDO PHPEUDQDWHG VWUXFWXUH FRQWDLQLQJ ZLWKLQ LW D JUDQXODU HOHFWURQ GHQVH PDWHULDO 7KH QH[W VWDJH LQ PRUSKRJHQHVLV LV WKRXJKW WR EH WKH FRQGHQVDWLRQ RI WKH JUDQXODU PDWHULDO ZLWKLQ WKH VSKHULFDO SDUWLFOH WR SURGXFH DQ H[WUHPHO\ HOHFWURQ GHQVH PDWHULDO SUHVXPDEO\ FRPSRVHG RI QXFOHRSURWHLQ 7KHUH LV VRPH HYLGHQFH WKDW FRQGHQVHG QXFOHRSURWHLQ PD\ EH LQMHFWHG LQWR WKH VSKHULFDO SDUWLFOH EHIRUH LW LV VHDOHG DOWKRXJK DW SUHVHQW WKLV FRQFOXVLRQ LV VRPHZKDW VSHFXODWLYH f )ROORZLQJ WKH FRQGHQVDWLRQ RU LQMHFWLRQ RI WKH QXFOHRSURWHLQ WKHUH RFFXUV D VHULHV RI FRPSOH[ PRUSKRORJLFDO FKDQJHV ZLWKLQ WKH GHYHORSLQJ SDUWLFOH WKDW UHVXOWV LQ WKH IRUPDWLRQ RI WKH ILUVW LQIHFWLRXV IRUP RI WKH YLUXV 7KH ILUVW LQIHFWLRXV IRUP LV D

PAGE 40

PHPEUDQDWHG EULFN VKDSHG YLULRQ SDUWLFOH WKDW VXUURXQGV D ELFRQFDYH QXFOHRSURWHLQ FRQWDLQLQJ FRUH %HWZHHQ WKH FRUH ZDOOV DQG WKH LQQHU VXUIDFH RI WKH YLUDO PHPEUDQH DUH WZR JUDQXODU VWUXFWXUHV RI XQNQRZQ IXQFWLRQ NQRZQ DV ODWHUDO ERGLHV 3DFNDJHG ZLWKLQ WKH FRUH LV WKH YLUDO '1$ DQG HDUO\ WUDQVFULSWLRQ DSSDUDWXV f $ PDMRULW\ RI WKHVH LQIHFWLRXV SDUWLFOHV NQRZQ DV LQWUDFHOOXODU PHPEUDQDWHG YLUXV ,09f UHPDLQ ZLWKLQ WKH F\WRSODVP +RZHYHU D VPDOO VXEVHW RI ,09 SDUWLFOHV DUH DFWLYHO\ WUDQVSRUWHG RXW RI WKH YLURSODVP 7KH ,09 SDUWLFOH REWDLQV WZR DGGLWLRQDO OLSLG ELOD\HU PHPEUDQHV ZKLFK DUH GHULYHG IURP WKH KRVW FHOO JROJL DSSDUDWXV f 7KLV WULSO\ PHPEUDQDWHG LQWUDFHOOXODU HQYHORSHG YLULRQ ,(9f LV WKHQ WUDQVSRUWHG WR WKH SODVPD PHPEUDQH )XVLRQ RI WKH RXWHUPRVW YLUDO PHPEUDQH ZLWK WKH SODVPD PHPEUDQH OLEHUDWHV WKH QRZ GRXEO\ PHPEUDQDWHG YLUDO SDUWLFOH IURP WKH F\WRSODVP LQWR WKH H[WUDFHOOXODU PLOLHX f 7KH GRXEO\ PHPEUDQDWHG IRUP NQRZQ DV H[WUDFHOOXODU HQYHORSHG YLUXV ((9f LV WKH IRUP UHVSRQVLEOH IRU WKH GLVVHPLQDWLRQ RI WKH LQIHFWLRQ LQ YLYR DQG SODTXH IRUPDWLRQ LQ YLWUR f

PAGE 41

9LUDO *HQHWLFV 7KH UHODWLYHO\ VPDOO JHQRPH VL]H ODFN RI LQWURQV DQG UHFRPELQDJHQLF QDWXUH RI SR[YLUXVHV PDNH WKHP YHU\ DPHQDEOH WR JHQHWLF VWXG\ UHYLHZHG LQ f 7KH LVRODWLRQ DQG FKDUDFWHUL]DWLRQ RI SR[YLUXV PXWDQWV KDV EHHQ RI IXQGDPHQWDO LPSRUWDQFH LQ XQGHUVWDQGLQJ WKH ELRORJ\ RI WKH YLUDO LQIHFWLRQ 7KHVH PXWDQWV KDYH SURYHQ YDOXDEOH IRU VWXG\LQJ DOO DVSHFWV RI YLUDO UHSOLFDWLRQ ,Q DGGLWLRQ WKH LVRODWLRQ RI YLUDO PXWDQWV KDV SURYLGHG SR[YLURORJLVWV ZLWK WKH UHDJHQWV QHFHVVDU\ IRU WKH ODWHU ELRFKHPLFDO DQDO\VLV RI VSHFLILF HQ]\PDWLF DFWLYLWLHV HQFRGHG E\ WKH YLUXV 7KHUH DUH SUHVHQWO\ VL[ UHSRUWHG FROOHFWLRQV RI YLUDO PXWDQWV HDFK RI ZKLFK KDV EHHQ FKDUDFWHUL]HG WR YDU\LQJ GHJUHHV UHYLHZHG LQ f 7KLV GLVFXVVLRQ ZLOO IRFXV RQ WKUHH FROOHFWLRQV RI YDFFLQLD YLUXV WHPSHUDWXUHVHQVLWLYH PXWDQWV WKDW RI 'DOHV DQG FRZRUNHUV (QVLQJHU DQG FRZRUNHUV DQG &RQGLW DQG FRZRUNHUV 7KH 'DOHV FROOHFWLRQ ZDV LVRODWHG LQ YDFFLQLD YLUXV VWUDLQ ,+': ,QWHUQDWLRQDO +HDOWK 'HSDUWPHQWf E\ FKHPLFDO PXWDJHQHVLV RI D ZLOGW\SH YLUDO VWRFN IROORZHG E\ VFUHHQLQJ LQGLYLGXDO SODTXH LVRODWHV IRU WHPSHUDWXUH VHQVLWLYLW\ 1LQHW\ WHPSHUDWXUHVHQVLWLYH

PAGE 42

PXWDQWV ZHUH LVRODWHG DQG FKDUDFWHUL]HG E\ HOHFWURQ PLFURVFRSLF H[DPLQDWLRQ RI PXWDQW LQIHFWHG FHOOV DW WKH QRQSHUPLVVLYH WHPSHUDWXUH r&f 7KLV FROOHFWLRQ ZDV GLYLGHG LQWR FODVVHV EDVHG XSRQ WKH VWDJH LQ YLUDO PRUSKRJHQHVLV UHDFKHG XQGHU QRQSHUPLVVLYH FRQGLWLRQV f &RPSOHPHQWDWLRQ DQG UHFRPELQDWLRQ PDSSLQJ KDV EHHQ UHSRUWHG RQ VXEVHWV RI WKLV FROOHFWLRQ KRZHYHU WKHUH KDV EHHQ QR DWWHPSW WR PDS WKH FRPSOHWH FROOHFWLRQ E\ HLWKHU FRPSOHPHQWDWLRQ DQDO\VLV RU PDUNHU UHVFXH f (QVLQJHU DQG FRZRUNHUV KDYH LVRODWHG D VHW RI WHPSHUDWXUHVHQVLWLYH PXWDQWV LQ WKH :5 ZHVWHUQ UHVHUYHf VWUDLQ RI YDFFLQLD YLUXV E\ FKHPLFDO PXWDJHQHVLV RI D ZLOGW\SH VWRFN $ WRWDO RI PXWDQWV KDYH EHHQ PDSSHG E\ FRPSOHPHQWDWLRQ DQDO\VLV RU PDUNHU UHVFXH f &RQGLW DQG FRZRUNHUV KDYH LVRODWHG D VHULHV RI WHPSHUDWXUH VHQVLWLYH PXWDQWV LQ WKH :5 VWUDLQ RI YDFFLQLD YLUXV FRPSULVLQJ VHSDUDWH FRPSOHPHQWDWLRQ JURXSV f 2I WKLV FROOHFWLRQ FRPSOHPHQWDWLRQ JURXSV KDYH EHHQ DVVLJQHG D SRVLWLRQ RQ WKH YLUDO FKURPRVRPH E\ PDUNHU UHVFXH f 7KH SRVLWLRQ RI RI WKHVH FRPSOHPHQWDWLRQ JURXSV DUH VKRZQ LQ )LJ $V H[SHFWHG IURP PXWDWLRQV ZKLFK DIIHFW HVVHQWLDO JHQHV PXWDQWV LQ WKLV FROOHFWLRQ

PAGE 43

FOXVWHU ZLWKLQ WKH FHQWUDOO\ FRQVHUYHG FRUH 7R ORFDOL]H D PXWDQW WR D SDUWLFXODU RSHQ UHDGLQJ IUDPH ILQH PDSSLQJ KDV QRZ EHHQ GRQH RQ D QXPEHU RI WKHVH PXWDQWV f 0XWDQW &ODVVLILFDWLRQ ,Q DGGLWLRQ WR WKH PRUSKRORJLFDO FODVVLILFDWLRQ RI 'DOHV HW DO ELRFKHPLFDO DQDO\VLV RI WKH SKHQRW\SHV RI WHPSHUDWXUHVHQVLWLYH YLUDO PXWDQWV KDV EHHQ XVHG DV D PHDQV RI FODVVLILFDWLRQ &RQGLW DQG FRZRUNHUV GLYLGHG WKHLU FROOHFWLRQ LQWR IRXU JURXSV QRUPDO '1$ GHIHFWLYH ODWH DQG DERUWLYH ODWH UHYLHZHG LQ f 7KH QRUPDO SKHQRW\SH LQFOXGHV DOO YLUDO PXWDQWV ZKLFK GLVSOD\ QRUPDO SDWWHUQV RI SURWHLQ DQG '1$ V\QWKHVLV DW WKH QRQSHUPLVVLYH WHPSHUDWXUH 9LUXVHV FODVVLILHG DV '1$ DUH WKRVH WKDW DUH LQFDSDEOH RI >+@WK\PLGLQH LQFRUSRUDWLRQ DW WKH QRQSHUPLVVLYH WHPSHUDWXUH 7KH GHIHFWLYH ODWH PXWDQWV FRPSULVH D YHU\ KHWHURJHQHRXV JURXS RI YLUXVHV ZKLFK DW WKH QRQSHUPLVVLYH WHPSHUDWXUH GLVSOD\ GHIHFWV LQ WKH V\QWKHVLV RI ODWH YLUDO SURWHLQV 7KH DERUWLYH ODWH SKHQRW\SH LV FKDUDFWHUL]HG E\ DQ DEUXSW FHVVDWLRQ RI ODWH SURWHLQ V\QWKHVLV DW DSSUR[LPDWHO\ KRXUV SRVW LQIHFWLRQ

PAGE 44

'LUHFWHG 9LUDO *HQHWLFV 7KH &RQGLW WHPSHUDWXUHVHQVLWLYH PXWDQW FROOHFWLRQ UHSUHVHQWV PXWDWLRQV LQ RQO\ b RI WKH HVVHQWLDO YLUXV JHQHV f :LWK WKH SXEOLFDWLRQ RI WKH FRPSOHWH VHTXHQFH RI YDFFLQLD YLUXV LW EHFDPH FOHDU WKDW WKHUH DUH D QXPEHU RI JHQHV RI ERWK NQRZQ DQG XQNQRZQ IXQFWLRQ IRU ZKLFK WKHUH DUH QR WHPSHUDWXUHVHQVLWLYH DOOHOHV f 7KH WUDGLWLRQDO DSSURDFK WR JHQHUDWLQJ WHPSHUDWXUHVHQVLWLYH YDFFLQLD YLUXV PXWDQWV KDV LQYROYHG UDQGRP FKHPLFDO PXWDJHQHVLV RI YLUDO VWRFNV IROORZHG E\ VFUHHQLQJ IRU WHPSHUDWXUH VHQVLWLYLW\ E\ HLWKHU DVVD\LQJ LQGLYLGXDO SODTXHV RU WKURXJK D SODTXH HQODUJHPHQW SURWRFRO 7KH XWLOLW\ RI ERWK PHWKRGV LV OLPLWHG E\ UHTXLULQJ WKH LQYHVWLJDWRU WR VFUHHQ ODUJH QXPEHUV RI SODTXHV LVRODWHV $Q DGGLWLRQDO SUREOHP ZLWK WKH WUDGLWLRQDO DSSURDFK WR YDFFLQLD YLUXV JHQHWLFV LV WKDW WKH UDQGRP PXWDJHQHVLV PHWKRGV HPSOR\HG GR QRW DOORZ DQ LQYHVWLJDWRU WR WDUJHW VSHFLILF RSHQ UHDGLQJ IUDPHV IRU PXWDWLRQDO DQDO\VLV ,W LV IRU WKHVH UHDVRQV WKDW D PRUH GLUHFW DSSURDFK IRU WKH FUHDWLRQ RI WHPSHUDWXUHVHQVLWLYH PXWDQWV PXVW EH IRXQG 7KH JRDO RI GLUHFWHG YLUDO JHQHWLFV LV WR WDUJHW VSHFLILF YLUDO

PAGE 45

RSHQ UHDGLQJ IUDPHV IRU PXWDJHQHVLV LQ YLWUR DQG WKHQ SODFH WKH PXWDQW DOOHOH EDFN LQWR LWV QRUPDO ORFDWLRQ LQ WKH YLUDO JHQRPH f )RU GLUHFWHG JHQHWLFV WR EH DSSOLHG WR D FRPSOH[ '1$ YLUXV VXFK DV YDFFLQLD WZR LPSRUWDQW FULWHULD PXVW EH PHW 7KH GLIILFXOW\ LQ VXFFHVVIXOO\ VFUHHQLQJ ODUJH QXPEHUV RI YLUXVHV QHFHVVLWDWHV WKDW WKH PXWDJHQHVLV VFKHPH FKRVHQ SURGXFH D KLJK SURSRUWLRQ RI FRQGLWLRQDOO\ OHWKDO PXWDQWV 7KH VHFRQG REVWDFOH WKDW PXVW EH RYHUFRPH LQYROYHV WKH WDUJHWHG LQVHUWLRQ RI WKH PXWDQW DOOHOH EDFN LQWR WKH YLUDO FKURPRVRPH DORQJ ZLWK WKH GLVSODFHPHQW RI WKH ZLOG W\SH JHQRPLF FRS\ RI WKH JHQH 7KLV GLVVHUWDWLRQ DWWHPSWV WR DGGUHVV WKH TXHVWLRQ RI ZKHWKHU RU QRW FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV DQG WUDQVLHQW GRPLQDQW VHOHFWLRQ FDQ EH XVHG DV D JHQHUDO PHWKRG IRU WKH FUHDWLRQ RI WHPSHUDWXUHVHQVLWLYH PXWDWLRQV LQ VSHFLILF YDFFLQLD YLUXV JHQHV &OXVWHUHG &KDUJH WR $ODQLQH 0XWDJHQHVLV &OXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV LV DFWXDOO\ D UHILQHPHQW RI D WHFKQLTXH NQRZQ DV DODQLQH VFDQQLQJ PXWDJHQHVLV ILUVW UHSRUWHG E\ &XQQLQJKDP DQG :HOOV DV DQ LQ YLWUR PXWDJHQHVLV PHWKRG WKDW FDXVHG PLQLPDO GLVWXUEDQFHV WR WKH UHVXOWLQJ SURWHLQfV

PAGE 46

VHFRQGDU\ VWUXFWXUH f ,Q WKLV UHSRUW LQGLYLGXDO DPLQR DFLGV ZLWKLQ D SUHYLRXVO\ GHILQHG UHFHSWRU ELQGLQJ GRPDLQ RI KXPDQ JURZWK KRUPRQH K*+f ZHUH V\VWHPDWLFDOO\ PXWDWHG WR DODQLQHV 7KH DXWKRUV FKRVH DODQLQH EHFDXVH LW LV D VPDOO DOLSKDWLF DPLQR DFLG FRPPRQO\ IRXQG ERWK RQ WKH VXUIDFH DV ZHOO DV EXULHG ZLWKLQ WKH K\GURSKRELF FRUH RI D YDULHW\ RI SURWHLQV DQG LQ D YDULHW\ RI VHFRQGDU\ VWUXFWXUHV 7KHUHIRUH WKH DXWKRUV IHOW WKDW VLQJOH DODQLQH VXEVWLWXWLRQV ZRXOG EH XQOLNHO\ WR FDXVH DQ\ H[WUHPH HOHFWURVWDWLF RU VWHULF GLVWXUEDQFHV LQ WKH PXWDQW SURWHLQ DQG WKXV ZRXOG EH XQOLNHO\ WR JURVVO\ DOWHU WKH PXWDQW SURWHLQfV VHFRQGDU\ VWUXFWXUH (OLPLQDWLRQ RI DPLQR DFLG VLGH FKDLQV EH\RQG WKH FDUERQ E\ UHSODFHPHQW ZLWK DODQLQH ZRXOG DLG LQ WKH LGHQWLILFDWLRQ RI WKRVH DPLQR DFLGV ZKRVH VLGH FKDLQV SDUWLFLSDWH LQ SURWHLQSURWHLQ LQWHUDFWLRQV EHWZHHQ K*+ DQG WKH K*+ UHFHSWRU 5HFRJQLWLRQ RI WKH UHFRPELQDQW DODQLQH VXEVWLWXWLRQ K*+ PXWDQWV E\ PRQRFORQDO DQWLERGLHV VSHFLILF IRU WKH QDWLYH VWUXFWXUH RI K*+ GHPRQVWUDWHG WKDW PRVW RI WKHVH PXWDQWV UHWDLQHG WKH VHFRQGDU\ VWUXFWXUH RI WKH ZLOG W\SH SURWHLQ f 7KH LQLWLDO UHSRUWLQJ RI DODQLQH VFDQQLQJ ZDV

PAGE 47

IROORZHG E\ D QXPEHU RI RWKHU UHSRUWV ZKLFK GHPRQVWUDWHG WKH XWLOLW\ RI WKLV PHWKRG IRU WKH H[DPLQDWLRQ RI ERWK LQWHUSURWHLQ DQG LQWUDSURWHLQ LQWHUDFWLRQV f $ODQLQH VFDQQLQJ ZDV ODWHU PRGLILHG E\ %HQQHWW HW DO ZKR PXWDWHG FOXVWHUV RI FKDUJHG DPLQR DFLGV *OX $VS +LV /\V $UJf WR DODQLQHV LQ DQ HIIRUW WR GHILQH IXQFWLRQDO GHWHUPLQDQWV RQ WKH VXUIDFH RI KXPDQ WLVVXH SODVPLQRJHQ DFWLYDWRU SURWHLQ KW3$f f &OXVWHUV RI FKDUJHG DPLQR DFLGV ZHUH WDUJHWHG IRU PXWDJHQHVLV EHFDXVH WKH DXWKRUV WKHRUL]HG WKDW KLJKO\ FKDUJHG UHJLRQV LQ WKH SULPDU\ VHTXHQFH RI D SURWHLQ ZRXOG EH ORFDWHG RQ WKH VXUIDFH UDWKHU WKDQ EXULHG ZLWKLQ WKH LQWHULRU RI WKH IROGHG SURWHLQ ,Q DGGLWLRQ FKDUJHG VXUIDFH UHVLGXHV DUH DOVR LPSRUWDQW PHGLDWRUV RI HOHFWURVWDWLF SURWHLQSURWHLQ LQWHUDFWLRQV WKHUHIRUH ORVV RI WKH VXUIDFH FKDUJH FRXOG GLVUXSW WKHVH LQWHUSURWHLQ LQWHUDFWLRQV &KDUJHG FOXVWHUV ZHUH PXWDWHG LQ JURXSV RI WR DPLQR DFLGV DQG FOXVWHUV VSDQQLQJ F\VWHLQH UHVLGXHV ZHUH DYRLGHG LQ RUGHU WR UHIUDLQ IURP GLVUXSWLQJ GLVXOILGH ERQGV ZKLFK DFW WR VWDELOL]H SURWHLQ VHFRQGDU\ VWUXFWXUH 7KH UHFRPELQDQWO\ H[SUHVVHG PXWDQW SURWHLQV ZHUH WHVWHG LQ YLWUR IRU D YDULHW\ RI IXQFWLRQDO DFWLYLWLHV DQG FRPSDUHG WR ZLOGW\SH KW3$ SURWHLQ 7KHVH GDWD KHOSHG WR ORFDOL]H VRPH RI WKH IXQFWLRQDO GRPDLQV

PAGE 48

LQYROYHG LQ KW3$fV GLYHUVH ELRORJLFDO DFWLYLWLHV ZKLFK LQFOXGH DFWLYDWLRQ RI SODVPLQRJHQ WR SODVPLQ VWLPXODWLRQ RI W3$ E\ ILEULQ DQG LQKLELWLRQ RI W3$ E\ WLVVXH SODVPLQRJHQ DFWLYDWRU LQKLELWRU SURWHLQ f 0RVW RI WKH UHSRUWV ZKLFK XVHG FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV LQYROYHG H[DPLQLQJ UHFRPELQDQWO\ H[SUHVVHG SURWHLQ RU SHSWLGH IUDJPHQWV LQ YLWUR +RZHYHU LQ :HUWPDQ 'UXELQ DQG %RWVWHLQ GHPRQVWUDWHG WKDW FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV FRXOG EH XVHG WR FUHDWH PXWDWLRQV WKDW ZHUH WHPSHUDWXUHVHQVLWLYH LQ YLYR f ,Q D PXWDWLRQDO DQDO\VLV RI WKH 6DFFKDURPYFHV FHUHYLVLDH DFWLQ JHQH $&7f RXW RI WKH PXWDWLRQV FRQVWUXFWHG ZHUH FRQGLWLRQDOO\ OHWKDO IRU FRORQ\ IRUPDWLRQ 2I WKH FRQGLWLRQDO OHWKDO PXWDWLRQV ZHUH ERWK FROG VHQVLWLYH DQG KHDW VHQVLWLYH DQG ZHUH VWULFWO\ KHDW VHQVLWLYH FRQGLWLRQDO OHWKDOV ([DPLQDWLRQ RI WKH WKUHH GLPHQVLRQDO FU\VWDOORJUDSKLF VWUXFWXUH RI \HDVW DFWLQ FRQILUPHG WKDW b RI WKH FOXVWHUHG FKDUJH WR DODQLQH PXWDWLRQV FUHDWHG LQ WKLV VWXG\ WDUJHWHG UHVLGXHV ORFDWHG RQ WKH VXUIDFH RI WKH IROGHG SURWHLQ f &OXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV KDV DOVR EHHQ XVHG E\ 'LDPRQG DQG .LHUNDJDDUG WR FUHDWH WHPSHUDWXUHVHQVLWLYH PXWDWLRQV

PAGE 49

LQ WKH 51$ GHSHQGHQW 51$ SRO\PHUDVH SURWHLQ RI SROLR YLUXV f 2I WKH PXWDWLRQV FRQVWUXFWHG bf \LHOGHG YLUXVHV ZKLFK WKH DXWKRUV FODVVLILHG DV WHPSHUDWXUHVHQVLWLYH 7KHVH YLUXVHV ZHUH FODVVLILHG DV WHPSHUDWXUHVHQVLWLYH EDVHG XSRQ HLWKHU D VPDOO SODTXH SKHQRW\SH RU GHFUHDVHG DFFXPXODWLRQ RI YLUDO 51$ DW WKH QRQSHUPLVVLYH WHPSHUDWXUH r&f f ,QWHUHVWLQJO\ DOO RI WKHVH YLUXVHV DUH FDSDEOH RI SURGXFLQJ LQIHFWLRXV SURJHQ\ DW WKH QRQSHUPLVVLYH WHPSHUDWXUH WKHUHIRUH QRQH RI WKHVH YLUXVHV DUH FRQGLWLRQDO OHWKDO WHPSHUDWXUHVHQVLWLYH PXWDQWV )ROORZLQJ WKH LQLWLDO GHPRQVWUDWLRQ WKDW FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV FDQ EH XVHG WR FUHDWH WHPSHUDWXUHVHQVLWLYH PXWDWLRQV LQ YLYR RWKHU LQYHVWLJDWRUV KDYH XVHG WKLV WHFKQLTXH WR PDNH WHPSHUDWXUHVHQVLWLYH DOOHOHV LQ D QXPEHU RI GLYHUVH SURWHLQV LQFOXGLQJ WKH +,9 W\SH LQWHJUDVH JHQH DQG WKH \HDVW XELTXLWLQ FRQMXJDWLQJ HQ]\PH &'& 8%&f f 7KHVH UHVXOWV KDYH VHUYHG WR GHPRQVWUDWH WKDW FOXVWHUHG FKDUJH WR DODQLQH PXWDQWV FDQ EH FUHDWHG LQ SURWHLQV WKDW VHUYH VWUXFWXUDO DV ZHOO DV HQ]\PDWLF IXQFWLRQV

PAGE 50

7UDQVLHQW 'RPLQDQW 6HOHFWLRQ 7KH DELOLW\ RI KRPRORJRXV YLUDO DQG SODVPLG '1$ VHTXHQFHV WR UHFRPELQH LQ YLYR KDV EHHQ XVHG WR FUHDWH GHOHWLRQ DQG LQVHUWLRQ PXWDQWV DV ZHOO DV YLUXVHV H[SUHVVLQJ IRUHLJQ JHQHV f 5HFRPELQDWLRQ FDQ DOVR EH XVHG DV D PHDQV RI WDUJHWHG JHQH UHSODFHPHQW WR LQWURGXFH VLWHVSHFLILF PXWDWLRQV LQWR WKH YLUDO JHQRPH f 7KH SULQFLSDO OLPLWDWLRQ RI WKLV WHFKQRORJ\ KDV EHHQ D ORZ SURSRUWLRQ RI UHFRPELQDQWV f DPRQJ D EDFNURXQG RI ZLOG W\SH QRQUHFRPELQDQW YLUXVHV f $ QXPEHU RI VHOHFWLRQ DQG VFUHHQLQJ PHWKRGV KDYH EHHQ GHYLVHG WR DLG LQ WKH LGHQWLILFDWLRQ RI YLUDO UHFRPELQDQWV f 2QH RI WKH PRVW ZLGOH\ XVHG WHFKQLTXHV IRU WKH LGHQWLILFDWLRQ RI YLUDO UHFRPELQDQWV KDV EHHQ D WUDQVLHQW GRPLQDQW VHOHFWLRQ PHWKRG ZKLFK UHOLHV XSRQ WKH DELOLW\ RI UHFRPELQDQW YLUXVHV H[SUHVVLQJ WKH (VFKHULFKLD FROL [DQWKLQHJXDQLQH SKRVSKRULERV\OWUDQVIHUDVH SURWHLQ HFRJSWf WR JURZ DQG IRUP SODTXHV LQ WKH SUHVHQFH RI P\FRSKHQROLF DFLG 03$f 7KH DQWLELRWLF P\FRSKHQROLF DFLG EORFNV LQRVLQH PRQRSKRVSKDWH GHK\GURJHQDVH D FHOOXODU HQ]\PH LQ WKH GH QRYR JXDQLQH PRQRSKRVSKDWH V\QWKHVLV SDWKZD\ f 7KH VHOHFWLRQ IRU YLUDO UHFRPELQDQWV LV PDGH SRVVLEOH

PAGE 51

E\ WKH GLIIHUHQW FDWDO\WLF DFWLYLWLHV RI WKH PDPPDOLDQ DQG EDFWHULDO HQ]\PHV K\SR[DQWKLQH SKRVSKRULERV\OWUDQVIHUDVH DQG [DQWKLQH JXDQLQH SKRVSKRULERV\OWUDQVIHUDVH 7KH EDFWHULDO HQ]\PH HFRJSWf ZLOO HIILFLHQWO\ XVH [DQWKLQH DV D VXEVWUDWH IRU SXULQH ELRV\QWKHVLV YLD WKH VDOYDJH SDWKZD\ ZKHUHDV WKH PDPPDOLDQ HQ]\PH ZLOO QRW f 7KHUHIRUH ZKHQ SURYLGHG ZLWK [DQWKLQH DQG JURZQ RQ DQ DSSURSULDWH FHOO OLQH RQO\ YLUXVHV H[SUHVVLQJ HFRJSW ZLOO IRUP SODTXHV LQ WKH SUHVHQFH RI 03$ 'XULQJ WKLV VWXG\ WKLV PHWKRGRORJ\ ZDV DSSOLHG DV D PHDQV RI WDUJHWHG JHQH UHSODFHPHQW WKH VDOLHQW IHDWXUHV RI ZKLFK DUH LOOXVWUDWHG LQ )LJ ,QIHFWHG FHOOV ZHUH WUDQVIHFWHG ZLWK D SODVPLG WKDW FRQWDLQHG WDQGHPO\ DUUDQJHG VLQJOH FRSLHV RI D PXWDQW YDFFLQLD JHQH DQG WKH HFRJSW JHQH 7KH HFRJSW JHQH ZDV XQGHU WKH WUDQVFULSWLRQDO FRQWURO RI D YDFFLQLD YLUXV SURPRWHU SNf ZKLFK GULYHV H[SUHVVLRQ RI HFRJSW DW ERWK HDUO\ DQG ODWH WLPHV DIWHU LQIHFWLRQ f 6LQJOH FURVVRYHU KRPRORJRXV UHFRPELQDWLRQ HYHQWV LQWHJUDWH WKH SODVPLG LQWR WKH JHQRPH DQG JHQHUDWH D YLUXV ZKLFK FRQWDLQV WKH HFRJSW FDVVHWWH IODQNHG RQ HLWKHU VLGH E\ D FRS\ RI WKH JHQH RI LQWHUHVW f 9LUXVHV ZKLFK KDYH LQWHJUDWHG WKH SODVPLG LQWR WKH JHQRPH FDQ EH VHOHFWHG IRU E\ SODWLQJ WKH O\VDWH IURP WKH

PAGE 52

)LJ 5HFRPELQDWLRQ HYHQWV RFFXUULQJ ZLWKLQ LQIHFWHG FHOOV GXULQJ WUDQVLHQW GRPLQDQW VHOHFWLRQ $ WUDQVIHFWHG SODVPLG FRQWDLQLQJ ERWK WKH HFRJSW JHQH DQG D PXWDQW YDFFLQLD JHQH ZLOO KRPRORJRXVO\ UHFRPELQH LQWR WKH YLUDO JHQRPH GXULQJ WKH LQIHFWLRQ WUDQVIHFWLRQ H[SHULPHQW 7KH P\FRSKHQROLF DFLG UHVLVWDQW UHFRPELQDQW YLUXV SURGXFHG FRQWDLQV WKH HFRJSW JHQH IODQNHG RQ HLWKHU VLGH E\ D FRS\ RI WKH JHQH RI LQWHUHVW 'XULQJ WKH JURZWK RI HDFK P\FRSKHQROLF DFLG UHVLVWDQW SODTXH WKH YLUXV ZLOO UHVROYH WKH JHQH GXSOLFDWLRQ JHQHUDWLQJ YLUXVHV ZKLFK KDYH HLWKHU UHWDLQHG ERWWRP OHIWf RU ORVW ERWWRP ULJKWf WKH PXWDWLRQ

PAGE 53

ZLOG W\SH YDFFLQLD YLUXV FKURPRVRPH LQIHFWLRQWUDQVIHFWLRQ A P\FRSKHQROLF DFLG UHVLVWDQW UHFRPELQDQW

PAGE 54

LQIHFWHG WUDQVIHFWHG FHOOV LQ WKH SUHVHQFH RI 03$ f 'XSOLFDWLRQ RI WKH FORQHG JHQH PDNHV WKHVH P\FRSKHQROLF DFLG UHVLVWDQW YLUXVHV XQVWDEOH VR WKDW GXULQJ WKH JURZWK RI HDFK 03$ UHVLVWDQW SODTXH UHVROXWLRQ ZLOO RFFXU YLD UHFRPELQDWLRQ EHWZHHQ WKH WZR JHQRPLF FRSLHV RI WKH JHQH RI LQWHUHVW 7KH SURGXFWV RI WKH UHVROXWLRQ HYHQW ZLOO EH YLUXVHV ZKLFK KDYH ORVW WKH HFRJSW JHQH DQG FRQWDLQ RQO\ D VLQJOH FRS\ RI WKH JHQH RI LQWHUHVW 5HVROXWLRQ RFFXUV GXULQJ WKH JURZWK RI HDFK 03$ UHVLVWDQW SODTXH VXFK WKDW HDFK 03$ UHVLVWDQW SODTXH FRQWDLQV D PL[WXUH RI YLUXVHV VRPH RI ZKLFK KDYH D PXWDQW YDFFLQLD JHQH GHULYHG IURP WKH WUDQVIHFWHG SODVPLG ZKLOH RWKHUV UHWDLQ D ZLOGW\SH FRS\ RI WKH YDFFLQLD JHQH 8QUHVROYHG YLUXVHV ZKLFK UHWDLQ WKH HFRJSW JHQH ZLOO SUHVHXPDEO\ VHUYH D KHOSHU IXQFWLRQ IRU JURZWK RI UHVROYHG YLUXVHV LQ WKH SUHVHQFH RI 03$ 7KLV VWXG\ ZLOO DGGUHVV D QXPEHU RI LPSRUWDQW TXHVWLRQV DERXW WUDQVLHQW GRPLQDQW VHOHFWLRQ LQFOXGLQJ f &DQ WUDQVLHQW GRPLQDQW VHOHFWLRQ EH XVHG WR LQVHUW VLWHVSHFLILF PXWDWLRQV LQWR HVVHQWLDO YDFFLQLD JHQHV" f :KDW LV WKH SHUFHQWDJH RI PXWDQW YLUXVHV ZLWKLQ HDFK 03$ UHVLVWDQW SODTXH" f +RZ PDQ\ WRWDO YLUXVHV QHHG WR EH VFUHHQHG IRU WHPSHUDWXUH VHQVLWLYLW\ EHIRUH DQ XQNQRZQ PXWDWLRQ FDQ EH DGMXGJHG WR QRW FRQIHU D WHPSHUDWXUHVHQVLWLYH SKHQRW\SH"

PAGE 55

$ SURWRFRO ZKLFK LV RXWOLQHG LQ )LJ KDV EHHQ GHYHORSHG WR DQVZHU WKHVH TXHVWLRQV E\ FUHDWLQJ PXWDWLRQV LQ WKH YDFFLQLD YLUXV JHQH *5 D JHQH ZLWK D VHOHFWDEOH SKHQRW\SH 7KH DGYDQWDJHV RI XVLQJ WKH YDFFLQLD *5 JHQH WR GHWHUPLQH WKH HIILFLHQF\ RI ERWK FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV DQG WUDQVLHQW GRPLQDQW VHOHFWLRQ LV GLVFXVVHG LQ GHWDLO LQ RWKHU VHFWLRQV RI WKLV GLVVHUWDWLRQ VHH FKDSWHU DQG LQWURGXFWLRQ WR FKDSWHU f %ULHIO\ D WUDQVLHQW GRPLQDQW VHOHFWLRQ H[SHULPHQW ZDV GRQH ZLWK D SODVPLG FRQWDLQLQJ D NQRZQ FRQGLWLRQDO OHWKDO WHPSHUDWXUHVHQVLWLYH *5 DOOHOH &WVf ,QGLYLGXDOO\ LVRODWHG 03$ UHVLVWDQW SODTXHV ZHUH WKHQ WHVWHG IRU WKH SUHVHQFH RI WKH &WV DOOHOH E\ SODWLQJ DW !& DQG !& LQ WKH SUHVHQFH DQG DEVHQFH RI LVDWLQ%WKLRVHPLFDUED]RQH ,%7f :LOG W\SH YLUXVHV ZLOO QRW JURZ LQ WKH SUHVHQFH RI ,%7 /RVV RI *5 IXQFWLRQ UHVXOWV LQ YLUXVHV ZKLFK DUH ,%7 GHSHQGHQW WKHUHIRUH &WV LV GHSHQGHQW XSRQ ,%7 IRU JURZWK DW r& 7KH &WV YLUXV LV DOVR UHVLVWDQW WR ,%7 DW r& 7KH SKHQRW\SH RI LQGLYLGXDO ,%7 UHVLVWDQW SODTXHV FDQ WKHQ EH GHWHUPLQHG E\ UHSODWLQJ WKHP DW !& DQG & LQ WKH SUHVHQFH DQG DEVHQFH RI ,%7 7KH LVRODWLRQ RI YLUXVHV ZLWK WKH &WV SKHQRW\SH SURYHV WKDW WUDQVLHQW GRPLQDQW VHOHFWLRQ FDQ EH

PAGE 56

)LJ 7HVWLQJ WKH HIILFLHQF\ RI WUDQVLHQW GRPLQDQW VHOHFWLRQ E\ PDNLQJ PXWDWLRQV LQ *5 0\FRSKHQROLF DFLG UHVLVWDQW SODTXHV DUH LVRODWHG IURP D WUDQVLHQW GRPLQDQW VHOHFWLRQ H[SHULPHQW GRQH ZLWK ZLOG W\SH YDFFLQLD YLUXV DQG D SODVPLG ZKLFK FRQWDLQV WKH HFRJSW JHQH DQG D PXWDQW FRS\ RI *5 9LUXVHV ZLWKLQ WKH P\FRSKHQROLF DFLG UHVLVWDQW SODTXH WKDW FRQWDLQ D PXWDWLRQ WKDW DOWHUV *5 IXQFWLRQ FDQ EH VHOHFWHG IRU E\ SODWLQJ LQGLYLGXDO P\FRSKHQROLF DFLG UHVLVWDQW SODTXHV LQ WKH SUHVHQFH RI ,%7 7KH HIILFLHQF\ RI WUDQVLHQW GRPLQDQW VHOHFWLRQ FDQ EH PHDVXUHG E\ GHWHUPLQLQJ WKH SHUFHQWDJH RI YLUXVHV FRQWDLQLQJ WKH PXWDWLRQ ,%7f DPRQJ WKH WRWDO SRSXODWLRQ r& ,%7f

PAGE 57

LQIHFWLRQ WUDQVIHFWLRQ ZLOG W\SH YDFFLQLD YLUXV 0XWDQW YDFFLQLD JHQH VHOHFW IRU UHFRPELQDQWV ZLWK P\FRSKHQROLF DFLG ? 7HVW WKH SKHQRW\SH RI LQGLYLGXDO ,%7 UHVLVWDQW SODTXHV E\ UHSODWLQJ DW r& DQG r& DQG ,%7

PAGE 58

XVHG WR LQVHUW VLWHVSHFLILF FRQGLWLRQDOO\ OHWKDO PXWDWLRQV LQWR WKH YLUDO JHQRPH ,Q DGGLWLRQ WKH SURSRUWLRQ RI ,%7 UHVLVWDQW YLUXVHV ZLWKLQ LQGLYLGXDO 03$ UHVLVWDQW SODTXHV ZLOO LQGLFDWH KRZ PDQ\ WRWDO YLUXVHV IURP HDFK WUDQVLHQW GRPLQDQW VHOHFWLRQ H[SHULPHQW LQYROYLQJ D FOXVWHUHG FKDUJH WR DODQLQH PXWDQW RI XQNQRZQ SKHQRW\SH ZLOO QHHG WR EH VFUHHQHG IRU WHPSHUDWXUH VHQVLWLYLW\ 7KLV LQIRUPDWLRQ ZLOO EH XVHG WR GHWHUPLQH KRZ WR PRGLI\ WKH SURWRFRO LQ RUGHU WR VFUHHQ FOXVWHUHG FKDUJH WR DODQLQH PXWDWLRQV LQ JHQHV ZLWKRXW VHOHFWDEOH SKHQRW\SHV ,Q WKHVH FDVHV SURJHQ\ IURP LQGLYLGXDO 03$ UHVLVWDQW SODTXHV ZLOO EH LVRODWHG E\ SODWHG DW r& DQG VFUHHQHG LQGLYLGXDOO\ E\ SODWLQJ DW r& DQG !& &DSSLQJ RI P51$ DQG WKH 9DFFLQLD P51$ &DSSLQJ (Q]\PH 7KH QXFOHXV LV WKH VLWH RI HXNDU\RWLF P51$ V\QWKHVLV DQG PDWXUDWLRQ f ,QLWLDOO\ P51$V DUH V\QWKHVL]HG E\ 51$ SRO\PHUDVH ,, LQ WKH IRUP RI SUHFXUVRU PROHFXOHV NQRZQ DV SUH P51$ RU KHWHURJHQHRXV QXFOHDU 51$ KQ51$f 3UHP51$V XQGHUJR H[WHQVLYH SRVWWUDQVFULSWLRQDO PRGLILFDWLRQV ZLWKLQ WKH QXFOHXV LQFOXGLQJ f WHUPLQDO FDSSLQJ f WHUPLQDO SRO\DGHQ\ODWLRQ VSOLFLQJ DQG LQWHUQDO PHWK\ODWLRQV EHIRUH EHLQJ WUDQVSRUWHG WR WKH F\WRSODVP

PAGE 59

DQG HQWHULQJ WKH SRRO RI PDWXUH WUDQVODWLRQDOO\ FRPSHWHQW P51$ f 7KH PRGLILFDWLRQV RFFXUULQJ WR WKH f HQG RI HXNDU\RWLF P51$V DUH RI SDUWLFXODU LQWHUHVW EHFDXVH P51$ LV V\QWKHVL]HG WUDQVODWHG DQG SRVVLEO\ GHJUDGHG LQ D f WR f GLUHFWLRQ f 7KH f HQG RI D PDWXUH HXNDU\RWLF P51$ PROHFXOH FRQVLVWV RI D FDS VWUXFWXUH P*SSS1 LQ ZKLFK WKH ILUVW HQFRGHG QXFOHRWLGH LV OLQNHG WR D PHWK\OJXDQRVLQH UHVLGXH E\ D XQLTXH ff SKRVSKRGLHVWHU ERQG f 7KH FDS VWUXFWXUH RI P51$ LV QHFHVVDU\ IRU HIILFLHQW WUDQVODWLRQ LQLWLDWLRQ DQG SURWHFWV WKH P51$ IURP GHJUDGDWLRQ E\ fr H[RQXFOHDVHV f ,Q DGGLWLRQ WKH SUHVHQFH RI D FDS VWUXFWXUH RQ QXFOHDU P51$ IDFLOLWDWHV P51$ VSOLFLQJ DQG QXFOHDU H[SRUW f &DSSLQJ RI SUHP51$ RFFXUV FRWUDQVFULSWLRQDOO\ DQG LV RQH RI WKH LQLWLDO VWHSV LQ WKH SRVWWUDQVFULSWLRQDO P51$ PDWXUDWLRQ SDWKZD\ f 7KH IRUPDWLRQ RI WKH P51$ FDS VWUXFWXUH P*SSS$f RFFXUV LQ WKUHH VHTXHQWLDO HQ]\PDWLF UHDFWLRQV UHYLHZHG LQ f 7KH f HQG RI WKH WULSKRVSKRU\ODWHG SULPDU\ P51$ WUDQVFULSW LV ILUVW FOHDYHG WR D GLSKRVSKRU\ODWHG IRUP E\ DQ P51$ WULSKRVSKDWDVH DQG WKHQ FDSSHG ZLWK JXDQRVLQH PRQRSKRVSKDWH E\ DQ P51$ JXDQ\OWUDQVIHUDVH 'XULQJ WKH JXDQ\OWUDQVIHUDVH UHDFWLRQ D VWDEOH

PAGE 60

LQWHUPHGLDWH IRUPV YLD D FRYDOHQW SKRVSKRDPLGH ERQG EHWZHHQ D O\VLQH UHVLGXH LQ WKH JXDQ\OWUDQVIHUDVH DFWLYH VLWH DQG WKH SKRVSKDWH PRLHW\ RI JXDQRVLQH PRQRSKRVSKDWH f )ROORZLQJ JXDQ\ODWLRQ WKH JXDQLQH FDS LV PHWK\ODWHG DW WKH 1" SRVLWLRQ E\ D JXDQLQHfPHWK\OWUDQVIHUDVH f 7KLV JHQHUDO PHFKDQLVP IRU FDSSLQJ P51$ RFFXUV LQ YDFFLQLD UHRYLUXV F\WRSODVPLF SRO\KHGURVLV YLUXV DQG SUREDEO\ PRVW HXNDU\RWLF FHOOV DOWKRXJK FDS IRUPDWLRQ LQ YHVLFXODU VWRPDWLWLV YLUXV LV WKRXJKW WR RFFXU E\ WKH WUDQVIHU RI D JXDQRVLQH GLSKRVSKDWH WR WKH f HQG RI D PRQRSKRVSKRU\ODWHG SULPDU\ P51$ WUDQVFULSW UHYLHZHG LQ f 0HWK\ODWLRQ RI WKH QXFOHRWLGHV DGMDFHQW WR WKH PHWK\OJXDQRVLQH UHVLGXH RFFXUV WR YDU\LQJ H[WHQWV DQG WKLV SURYLGHV D EDVLV IRU WKH IROORZLQJ FDS QRPHQFODWXUH V\VWHP P*SSS1 FDS f PA*SSS1P FDS f Q)*SSS1PS1P FDS f LU)*SSS1PS1PS1P FDS f DQG P*SSS1PS1PS1PS1P FDS f *HQHUDOO\ WKHVH PHWK\ODWLRQ UHDFWLRQV DUH WKRXJKW WR RFFXU VHTXHQWLDOO\ DOWKRXJK WKHUH LV HYLGHQFH WKDW DW OHDVW LQ WKH FDVH RI YHVLFXODU VWRPDWLWLV YLUXV DQG F\WRSODVPLF SRO\KHGURVLV YLUXV WKH fPHWK\ODWLRQ RI WKH SHQXOWLPDWH QXFOHRWLGH FDQ RFFXU SULRU WR WKH PHWK\ODWLRQ RI WKH JXDQRVLQH FDS UHYLHZHG LQ f 7KH FDS VWUXFWXUH ZKLFK LV WKH

PAGE 61

PLQLPDO FDS VWUXFWXUH UHTXLUHG WR IDFLOLWDWH WUDQVODWLRQ LQLWLDWLRQ LV IRXQG RQ WKH f HQG RI P51$ LVRODWHG IURP \HDVW VOLPH PROGV DQG VRPH YLUDO P51$V f ZKHUHDV P51$V FRQWDLQLQJ D FDS VWUXFWXUH KDYH EHHQ LVRODWHG IURP VOLPH PROGV DQLPDO FHOOV DQG PDQ\ DQLPDO YLUXVHV f 7KH FDS VWUXFWXUH LV IRXQG RQ P51$ IURP LQVHFWV YHUWHEUDWHV DQG WKHLU YLUDO SDUDVLWHV f ,QWHUHVWLQJO\ RQO\ FDS P51$ LV IRXQG LQ WKH QXFOHXV LPSO\LQJ WKDW WKH PHWK\OWUDQVIHUDVHV UHVSRQVLEOH IRU IRUPLQJ WKH RWKHU FDS VWUXFWXUHV DUH FRQILQHG WR WKH F\WRSODVP f %HFDXVH WKH HQ]\PDWLF PDFKLQHU\ QHFHVVDU\ IRU FDSSLQJ P51$ LV ORFDOL]HG ZLWKLQ WKH QXFOHXV PDQ\ F\WRSODVPLF YLUXVHV LQFOXGLQJ YDFFLQLD KDYH HYROYHG WKHLU RZQ P51$ FDSSLQJ HQ]\PHV f $OO RI WKHVH YLUXVHV SDFNDJH FDSSLQJ HQ]\PHV ZLWKLQ WKH YLUDO SDUWLFOH DORQJ ZLWK D YLUDOO\ HQFRGHG 51$ SRO\PHUDVH ZKLFK HQVXUHV WKH FDSSLQJ RI P51$V V\QWKHVL]HG GXULQJ WKH HDUO\ SKDVHV RI WKH YLUDO OLIH F\FOH 7KH SDFNDJLQJ RI D YLUDO FDSSLQJ HQ]\PH DQG D YLUDO 51$ SRO\PHUDVH ZLWKLQ WKH YLULRQ KDV EHHQ XVHG WR GHYHORS LQ YLWUR WUDQVFULSWLRQFDSSLQJ DVVD\V ZKHUHE\ WKH PHFKDQLVP RI P51$ FDSSLQJ KDV EHHQ H[DPLQHG LQ GHWDLO UHYLHZHG LQ f ,Q WKH FDVH RI YDFFLQLD LQFXEDWLRQ RI SXULILHG YLUXV SDUWLFOHV LQ YLWUR ZLWK D

PAGE 62

QRQLRQLF GHWHUJHQW D UHGXFLQJ DJHQW DOO IRXU ULERQXFOHRVLGH WULSKRVSKDWHV PDJQHVLXP DQG 6DGHQRV\O/PHWKLRQLQH UHVXOWV LQ WKH IRUPDWLRQ RI HDUO\ YLUDO P51$ PROHFXOHV ZKLFK FRQWDLQ FDS RU FDS VWUXFWXUHV DW WKHLU f HQGV f 7KH YDFFLQLD P51$ FDSSLQJ HQ]\PH FDWDO\]HV WKH IRUPDWLRQ RI WKH FDS VWUXFWXUH DQG WKH PHWK\ODWLRQ RI WKH SHQXOWLPDWH QXFOHRWLGH LV GRQH E\ WKH VPDOO VXEXQLW RI WKH YDFFLQLD SRO\ $ SRO\PHUDVH SURWHLQ f 7KH PXOWLIXQFWLRQDO QDWXUH RI PDQ\ F\WRSODVPLF YLUDO FDSSLQJ HQ]\PHV LV LQ FRQWUDVW WR FHOOXODU FDSSLQJ HQ]\PHV 7KH / SURWHLQ RI YHVLFXODU VWRPDWLWLV YLUXV LV WKRXJKW WR FRQWDLQ WKH JXDQ\OWUDQVIHUDVH JXDQLQHfPHWK\OWUDQVIHUDVH DQG QXFOHRVLGHff PHWK\OWUDQVIHUDVH DFWLYH VLWHV LQ DGGLWLRQ WR VHUYLQJ DV D VXEXQLW RI WKH 51$ GHSHQGHQW 51$ SRO\PHUDVH f 7KH 16 SURWHLQ RI IODYLYLUXVHV IXQFWLRQV DV D SURWHDVH D KHOLFDVH DQG DQ P51$ WULSKRVSKDWDVH f $PRQJ DYLDQ UHRYLUXVHV D VLQJOH SURWHLQ HQFRGHV ERWK 51$ GHSHQGHQW 51$ SRO\PHUDVH DQG JXDQ\OWUDQVIHUDVH DFWLYLWLHV f $V SUHYLRXVO\ GLVFXVVHG WKH YDFFLQLD FDSSLQJ HQ]\PH IXQFWLRQV DV DQ HDUO\ WUDQVFULSWLRQ WHUPLQDWLRQ IDFWRU DQG DQ LQWHUPHGLDWH WUDQVFULSWLRQ LQLWLDWLRQ IDFWRU 7KH ELRFKHPLFDO DFWLYLWLHV RI FHOOXODU FDSSLQJ HQ]\PHV VHHP WR EH FRQILQHG WR FDSSLQJ

PAGE 63

P51$ ,Q UDW OLYHU \HDVW DQG EULQH VKULPS WKH 51$ WULSKRVSKDWDVH DQG JXDQ\OWUDQVIHUDVH DFWLYLWLHV UHPDLQ WLJKWO\ DVVRFLDWHG GXULQJ PXOWLSOH FKURPDWRJUDSKLF SXULILFDWLRQ VWHSV +RZHYHU JXDQLQH fPHWK\OWUDQVIHUDVH DFWLYLW\ GRHV QRW FRHOXWH ZLWK WKH 51$ WULSKRVSKDWDVHJXDQ\WUDQVIHUDVH FRQWDLQLQJ IUDFWLRQV f 6LQJOH SRO\SHSWLGHV ZLWK 51$ WULSKRVSKDWDVH DQG JXDQ\OWUDQVIHUDVH DFWLYLWLHV KDYH EHHQ LVRODWHG IURP EULQH VKULPS DQG UDW OLYHU f ,Q FRQWUDVW WKH \HDVW 6DFFKDURPYFHV FHUHYLVLDH FRQWDLQV WZR WLJKWO\ DVVRFLDWHG SRO\SHSWLGHV DQ N'D 51$ WULSKRVSKDWDVH DQG D N'D JXDQ\OWUDQVIHUDVH f 7KH RQO\ QRQYLUDO FDSSLQJ HQ]\PHV ZKLFK KDYH EHHQ FORQHG DUH WKRVH IURP 6DFFKDURPYFHV FHUHYLVLDH &(*f DQG 6FKL]RVDFFKDURPYFHV SRPEH 3&(f f 7KH FORVH DVVRFLDWLRQ RI WKH 51$ WULSKRVSKDWDVH DQG JXDQ\OWUDQVIHUDVH DFWLYLWLHV LQ PDQ\ HXNDU\RWLF FDSSLQJ HQ]\PHV PD\ LQGLFDWH WKDW WKH 51$ WULSKRVSKDWDVH DQG JXDQ\OWUDQVIHUDVH UHDFWLRQ DUH FRXSOHG LQ YLYR 9DFFLQLD 9LUXV P51$ &DSSLQJ (Q]\PH $OWKRXJK WKH VSHFLILF IXQFWLRQV RI WKH YDFFLQLD YLUXV P51$ FDSSLQJ HQ]\PH KDYH EHHQ SUHYLRXVO\ GLVFXVVHG LQ GHWDLO LQ HDUOLHU

PAGE 64

VHFWLRQV RI WKLV GLVVHUWDWLRQ LW PD\ EH XVHIXO WR UHYLHZ ZKDW LV NQRZQ DERXW WKH YDFFLQLD YLUXV P51$ FDSSLQJ HQ]\PH 7KH YDFFLQLD YLUXV P51$ FDSSLQJ HQ]\PH LV D KHWHURGLPHU FRPSRVHG RI D N'D ODUJH VXEXQLW DQG D N'D VPDOO VXEXQLW HQFRGHG E\ WKH YDFFLQLD JHQHV ',5 DQG '/ UHVSHFWLYHO\ f 7KH KHWHURGLPHU FRQWDLQV P51$ WULSKRVSKDWDVH JXDQ\OWUDQVIHUDVH DQG JXDQLQH fPHWK\OWUDQVIHUDVH HQ]\PDWLF DFWLYLWLHV f 7KH GRPDLQ VWUXFWXUH RI WKH HQ]\PDWLF DFWLYLWLHV LQYROYHG LQ FDSSLQJ P51$ DUH IDLUO\ ZHOO GHILQHG ZLWK WKH P51$ WULSKRVSKDWDVH DQG JXDQ\OWUDQVIHUDVH DFWLYH VLWHV EHLQJ ORFDOL]HG WR WKH DPLQR WHUPLQDO NLORGDOWRQV RI ',5 DQG WKH JXDQLQHfPHWK\OWUDQVIHUDVH GRPDLQ EHLQJ FRQWDLQHG ZLWKLQ D VWDEOH KHWHURGLPHU IRUPHG EHWZHHQ WKH FDUER[\O WHUPLQDO SRUWLRQ RI ',5 DQG DQ LQWDFW '/ SURWHLQ f 'XULQJ WKH JXDQ\OWUDQVIHUDVH UHDFWLRQ JXDQRVLQH PRQRSKRVSKDWH EHFRPHV FRYDOHQWO\ OLQNHG WR D O\VLQH UHVLGXH .f LQ WKH ODUJH VXEXQLW IRUPLQJ D HQ]\PH*03 LQWHUPHGLDWH 7KH JXDQ\OWUDQVIHUDVH DFWLYH VLWH KDV EHHQ PDSSHG WR D FRQVHUYHG .7'* PRWLI DW DPLQR DFLGV LQ ',5 f 7KH .7'* PRWLI LV SDUW

PAGE 65

RI D ODUJHU FRPSOH[ PRWLI DVVRFLDWHG ZLWK QXFOHRWLG\O WUDQVIHUDVHV VXFK DV FDSSLQJ HQ]\PHV DQG '1$ DQG 51$ OLJDVHV f +HWHURGLPHUL]DWLRQ EHWZHHQ ',5 DQG '/ DQG ZLOGW\SH OHYHOV RI PHWK\OWUDQVIHUDVH DFWLYLW\ KDYH EHHQ GHWHFWHG E\ FRH[SUHVVLRQ LQ EDFWHULD RI D SODVPLG HQFRGLQJ DPLQR DFLGV RI ',5 DQG D IXOO OHQJWK '/ SURWHLQ f +RZHYHU WKH GHWHFWLRQ RI ORZ OHYHOV RI PHWK\OWUDQVIHUDVH DFWLYLW\ E\ H[SUHVVLRQ RI RQO\ DPLQR DFLGV RI ',5 LQGLFDWHV WKDW WKH JXDQLQHf PHWK\OWUDQVIHUDVH DFWLYH VLWH UHVLGHV VROHO\ ZLWKLQ WKH FDUER[\O WHUPLQDO DPLQR DFLGV RI ',5 f 1HYHUWKHOHVV LW LV FOHDU IURP WKLV GDWD WKDW KHWHURGLPHUL]DWLRQ EHWZHHQ ',5 DQG '/ LV UHTXLUHG IRU IXOO PHWK\OWUDQVIHUDVH DFWLYLW\ $ PHWK\OWUDQVIHUDVH PRWLI 88>'(@[*[*[* ZKHUH 8 LV DQ DOLSKDWLF DPLQR DFLG DQG [ LV DQ\ DPLQR DFLG ZDV LGHQWLILHG LQ ',5 WKDW EHDUV KRPRORJ\ WR PRWLIV IRXQG LQ WKH PHWK\OWUDQVIHUDVHV RI IODYLYLUXVHV UHRYLUXVHV DQG WKH +KDO PHWK\OWUDQVIHUDVH f $OO RI WKHVH PHWK\OWUDQVIHUDVHV XWLOL]H 6DGHQRV\O/PHWKLRQLQH DV D VXEVWUDWH DQG WKLV PRWLI LV SUHVXPHG WR EH LQYROYHG LQ ELQGLQJ 6DGHQRV\O/PHWKLRQLQH 7KH YDFFLQLD ',5 VHTXHQFH $,')*1* DPLQR DFLGV f ODFNV WKH WKLUG JO\FLQH UHVLGXH RI WKH FRQVHQVXV VHTXHQFH KRZHYHU WKLV VHTXHQFH KDV

PAGE 66

QHYHUWKHOHVV UHFHQWO\ EHHQ VKRZQ WR EH HVVHQWLDO IRU PHWK\OWUDQVIHUDVH DFWLYLW\ LQ YLWUR f $ QXPEHU RI DODQLQHVFDQQLQJ PXWDQWV KDYH EHHQ JHQHUDWHG LQ UHFRPELQDQWO\ H[SUHVVHG ',5 DQG H[DPLQHG IRU '5'/ VXEXQLW DVVRFLDWLRQ DQG PHWK\OWUDQVIHUDVH DFWLYLW\ f 2QH RI WKHVH PXWDWLRQV +$<$f LV GHIHFWLYH LQ PHWK\OWUDQVIHUDVH DFWLYLW\ EXW QRW VXEXQLW DVVRFLDWLRQ LPSO\LQJ WKDW WKHVH WZR DPLQR DFLGV IRUP SDUW RI WKH PHWK\OWUDQVIHUDVH DFWLYH VLWH 6DGHQRV\O/PHWKLRQLQH KDV DOVR EHHQ FRYDOHQWO\ SKRWRFURVVOLQNHG WR DPLQR DFLGV DQG LPSOLFDWLQJ WKHVH UHVLGXHV LQ WKH ELQGLQJ RI 6DGHQRV\O/ PHWKLRQLQH f 7KH YDFFLQLD YLUXV P51$ FDSSLQJ HQ]\PH DOVR IXQFWLRQV DV DQ HDUO\ JHQH WUDQVFULSWLRQ WHUPLQDWLRQ IDFWRU DQG DQ LQWHUPHGLDWH JHQH WUDQVFULSWLRQ LQLWLDWLRQ IDFWRU f 7UDQVFULSWLRQ WHUPLQDWLRQ RI HDUO\ JHQHV UHTXLUHV D IXOO OHQJWK LQWDFW KHWHURGLPHU DQG WKH VHTXHQFH 8888818 LQ WKH QDVFHQW P51$ f 7KH PHFKDQLVP RI HDUO\ WHUPLQDWLRQ LV QRW NQRZQ EXW LW LV WKRXJKW WKDW WKH FDSSLQJ HQ]\PH FDWDO\]HV WHUPLQDWLRQ E\ SURWHLQSURWHLQ LQWHUDFWLRQV ZLWK WKH YLUDO WUDQVFULSWLRQ HORQJDWLRQ FRPSOH[ $ UHFRPELQDQWO\ H[SUHVVHG JXDQ\OWUDQVIHUDVH GHIHFWLYH FDSSLQJ HQ]\PH PXWDQW LV

PAGE 67

DEOH WR FDWDO\]H HDUO\ WUDQVFULSWLRQ WHUPLQDWLRQ LQ YLWUR WKHUHIRUH WHUPLQDWLRQ LV LQGHSHQGHQW RI FDS IRUPDWLRQ 7KH FDSSLQJ HQ]\PH IRUPV D VWDEOH FRPSOH[ ZLWK WKH YLUDO 51$ SRO\PHUDVH SULRU WR ELQGLQJ RI WKH SRO\PHUDVH FRPSOH[ DW WKH LQWHUPHGLDWH SURPRWHU f 7KH IRUPDWLRQ RI WKH FDSSLQJ HQ]\PH51$ SRO\PHUDVH FRPSOH[ LV QHFHVVDU\ IRU WUDQVFULSWLRQ LQLWLDWLRQ f 7KH YDFFLQLD FDSSLQJ HQ]\PH KDV DOVR EHHQ JHQHWLFDOO\ LPSOLFDWHG LQ WKH UHVROXWLRQ RI YDFFLQLD YLUXV WHORPHUHV f $ WHPSHUDWXUHVHQVLWLYH PXWDWLRQ PDSSHG WR WKH VPDOO VXEXQLW RI WKH YDFFLQLD YLUXV P51$ FDSSLQJ HQ]\PH JHQH '/f ZKLFK H[KLELWV QRUPDO SURWHLQ DQG '1$ H[SUHVVLRQ XQGHU QRQSHUPLVVLYH FRQGLWLRQV LV XQDEOH WR UHVROYH YLUDO WHORPHUHV DW WKH QRQSHUPLVVLYH WHPSHUDWXUH r&f f $OWKRXJK WKH SKHQRW\SH RI WKLV PXWDQW JHQHWLFDOO\ LPSOLFDWHV WKH YDFFLQLD P51$ FDSSLQJ HQ]\PH LQ WHORPHUH UHVROXWLRQ WKHUH LV QR ELRFKHPLFDO HYLGHQFH WKDW WKH FDSSLQJ HQ]\PH SDUWLFLSDWHV HLWKHU GLUHFWO\ RU LQGLUHFWO\ LQ WKH UHVROXWLRQ RI YLUDO WHORPHUHV

PAGE 68

&+$37(5 0$7(5,$/6 $1' 0(7+2'6 5HFRPELQDQW '1$ 7HFKQLTXHV %DFWHULDO 6WUDLQ DQG 0HWKRGV (VFKHULFKLD FROL VWUDLQ -0 6XS( WKL$ODFSUR$%f )f>WUD'SUR$%ODF,T ODF=$0@ ZDV XVHG DV KRVW WR SURSDJDWH DOO SODVPLG SKDJH DQG SKDJHPLG FRQVWUXFWV 6WDQGDUG WHFKQLTXHV WKDW KDYH EHHQ SUHYLRXVO\ GHVFULEHG ZHUH IROORZHG IRU WKH JURZWK PDLQWHQDQFH DQG LVRODWLRQ RI DOO SODVPLGV SKDJH DQG SKDJHPLG FRQVWUXFWV f (OHFWURSRUDWLRQ RI '1$ LQWR -0 (OHFWURFRPSHWHQW EDFWHULDO FHOOV ZHUH SUHSDUHG IURP ORJ SKDVH FXOWXUHV RI -0 2'RR EHWZHHQ f JURZQ LQ /HQQR[ / EURWK

PAGE 69

&HOOV ZHUH SHOOHWHG DW [ J IRU PLQ LQ D *6 URWRU 6RUYDOOf DW !& ZDVKHG WZLFH ZLWK OLWHU RI LFH FROG GLVWLOOHG ZDWHU UHSHOOHWHG DW [ J UHVXVSHQGHG LQ PO RI FROG b JO\FHURO DQG VWRUHG DW R& (OHFWURSRUDWLRQV ZHUH GRQH ZLWK D %LRUDG JHQH SXOVHU VHW DW N9 S) 4 DYHUDJH WLPH FRQVWDQW RI PVHF ILHOG VWUHQJWK RI N9f LQ FP FXYHWWHV XVLQJ D SURWRFRO UHFRPPHQGHG E\ WKH PDQXIDFWXUHU &RQVWUXFWLRQ RI *5 DQG ',5 9HFWRUV 0XWDQW *5 FRQWDLQLQJ SODVPLGV IRU WUDQVLHQW GRPLQDQW VHOHFWLRQ ZHUH FRQVWUXFWHG XVLQJ WZR VLPLODU SURWRFROV )RU ZLOGW\SH *5 $6 DQG &WV D SODVPLG S8&* ZDV FRQVWUXFWHG ZKLFK FRQVLVWV RI WKH SKDJHPLG YHFWRU S8& f D FDVVHWWH FRQWDLQLQJ WKH FRQVWLWXWLYH SN YDFFLQLD SURPRWHU XSVWUHDP IURP WKH (VFKHULFKLD FROL JXDQLQH SKRVSKRULERV\OWUDQVIHUDVH HFRJSWf JHQH REWDLQHG DV D NE +SDO 'UDO IUDJPHQW IURP S7.JSW)OV ff DQG D EDVH SDLU 3YX,, (FR59 IUDJPHQW GHULYHG IURP WKH YDFFLQLD YLUXV +LQG,,, IUDJPHQW FRQWDLQLQJ WKH ZLOGW\SH *5 JHQH ZLWK QXFOHRWLGHV RI n IODQNLQJ VHTXHQFH DQG QXFOHRWLGHV RI n IODQNLQJ VHTXHQFH f 7KH *5 FRQWDLQLQJ '1$ ZDV SODFHG DGMDFHQW

PAGE 70

WR DQG XSVWUHDP IURP WKH SN SURPRWHU ZLWK WKH *5 VHTXHQFHV LQ WKH RSSRVLWH WUDQVFULSWLRQDO RULHQWDWLRQ UHODWLYH WR WKH SN SURPRWHU 6LQJOH VWUDQGHG S8&* SKDJHPLG '1$ f ZDV XVHG DV D WHPSODWH IRU PXWDJHQHVLV WR FRQVWUXFW PXWDQWV $6 DQG &WV DQG WUDQVLHQW GRPLQDQW VHOHFWLRQV ZHUH GRQH XVLQJ GRXEOHVWUDQGHG SODVPLG '1$ FRQWDLQLQJ HLWKHU ZLOGW\SH RU PXWDQW *5 VHTXHQFHV )RU $6 WKURXJK $6 PXWDJHQHVLV RI *5 ZDV GRQH XVLQJ VLQJOH VWUDQGHG '1$ IURP DQ 0PSO *5 FORQH SURYLGHG E\ /HZLV FRQWDLQLQJ RQO\ WKH FRGLQJ VHTXHQFH RI *5 REWDLQHG E\ 3&5 DPSOLILFDWLRQ 0XWDQW *5 JHQHV ZHUH WKHQ VXEFORQHG LQWR D SODVPLG FRQWDLQLQJ S*(0=) 3URPHJDf YHFWRU '1$ DQG WKH SN HFRJSW FDVVHWWH GHVFULEHG DERYH IRU FRQIHUULQJ UHVLVWDQFH WR P\FRSKHQROLF DFLG 7KH *5 JHQH ZDV SODFHG DGMDFHQW WR DQG XSVWUHDP IURP WKH SN SURPRWHU ZLWK WKH *5 VHTXHQFHV LQ WKH VDPH WUDQVFULSWLRQDO RULHQWDWLRQ UHODWLYH WR WKH SURPRWHU 7KH WUDQVFULSWLRQ VWDUW VLWH RI *5 KDV EHHQ SUHYLRXVO\ PDSSHG WR EDVH RI WKH YDFFLQLD YLUXV VWUDLQ :5 +LQG,,, IUDJPHQW WKHUHIRUH QRQH RI WKH FORQHG *5 VHTXHQFHV XVHG LQ WKLV VWXG\ FRQWDLQ WKH SURPRWHU IRU WKH *5 JHQH f

PAGE 71

7KH SKDJH 0PSO'O51FR XVHG DV D WHPSODWH IRU DOO ',5 PXWDJHQHVLV H[SHULPHQWV ZDV D JLIW IURP ( 1LOHV 7KH SKDJH 0PSO'O51FR FRQWDLQV WKH FRPSOHWH ',5 RSHQ UHDGLQJ IUDPH LQ ZKLFK DQ LQWHUQDO 1FRO UHVWULFWLRQ HQGRQXFOHDVH VLWH DW SRVLWLRQ UHODWLYH WR WKH WUDQVFULSWLRQDO VWDUW VLWH KDV EHHQ UHPRYHG E\ VLWH GLUHFWHG PXWDJHQHVLV XVLQJ DQ ROLJRQXFOHRWLGH ZKLFK GLVUXSWV WKH 1FRO UHFRJQLWLRQ VHTXHQFH ZLWKRXW DOWHULQJ WKH ',5 FRGLQJ VHTXHQFH f 7KH SODVPLGV XVHG LQ WKH WUDQVLHQW GRPLQDQW VHOHFWLRQ H[SHULPHQWV ZLWK ',5 ZHUH PDGH XVLQJ WKH IROORZLQJ SURWRFRO 7KH ',5 JHQH ZDV VXEFORQHG DV D NE 3VW, 6DF, IUDJPHQW IURP DSSURSULDWHO\ PXWDJHQL]HG 0PSO'O51FR FORQHV LQWR WKH HFRJSW FRQWDLQLQJ YHFWRU S%6JSW% FXW ZLWK 3VW, DQG 6DF, 7KH SODVPLG S%6JSW% D JLIW IURP 3 7XUQHU ZDV PDGH E\ LQVHUWLQJ D NE (FR5, IUDJPHQW FRQWDLQLQJ WKH SN HFRJSW FDVVHWWH IURP S7.JSW f LQWR WKH (FR5, VLWH RI S%OXHVFULSW.6f 6WUDWDJHQHf 0XWDQW FRSLHV RI ',5 ZHUH LQVHUWHG XSVWUHDP IURP DQG LQ WKH VDPH WUDQVFULSWLRQDO RULHQWDWLRQ DV WKH SN HFRJSW FDVVHWWH 1RQH RI WKH FORQHG ',5 VHTXHQFHV XVHG LQ WKLV VWXG\ FRQWDLQHG WKH SURPRWHU IRU WKH ',5 JHQH f

PAGE 72

0XWDJHQHVLV RI *5 DQG ',5 &OXVWHUHG FKDUJH WR DODQLQH PXWDWLRQV ZHUH FUHDWHG LQ FORQHG FRSLHV RI *5 DQG ',5 XVLQJ ROLJRQXFOHRWLGH GLUHFWHG PXWDJHQHVLV 7KH VHTXHQFH RI DOO *5 DQG ',5 PXWDJHQLF ROLJRQXFOHRWLGHV DUH VKRZQ LQ 7DEOHV DQG UHVSHFWLYHO\ $OO *5 PXWDWLRQV ZHUH PDGH XVLQJ WKH $PHUVKDP ROLJRQXFOHRWLGH PXWDJHQHVLV NLW DFFRUGLQJ WR WKH PDQXIDFWXUHUV LQVWUXFWLRQV 2OLJRQXFOHRWLGH GLUHFWHG PXWDJHQHVLV RQ ',5 ZDV SHUIRUPHG XVLQJ WKH 7JHQ LQ YLWUR PXWDJHQHVLV NLW DFFRUGLQJ WR WKH PDQXIDFWXUHUV LQVWUXFWLRQV 8 6 %LRFKHPLFDOVf 0XWDJHQLF ROLJRQXFOHRWLGHV V\QWKHVL]HG E\ WKH '1$ V\QWKHVLV FRUH IDFLOLW\ RI WKH 8QLYHUVLW\ RI )ORULGD ZHUH GHVLJQHG WR LQFOXGH QXFOHRWLGHV n DQG QXFOHRWLGHV n RI WKH PLVPDWFKHG UHJLRQ f '1$ 6HTXHQFLQJ $OO '1$ VHTXHQFLQJ ZDV GRQH XVLQJ WKH 6HTXHQDVH YHUVLRQ NLW DFFRUGLQJ WR WKH PDQXIDFWXUHUV LQVWUXFWLRQV 86 %LRFKHPLFDOVf DQG DSSURSULDWH ROLJRQXFOHRWLGH SULPHUV 7KH FRPSOHWH *5 VHTXHQFH RI HDFK PXWDQW SKDJH RU SKDJPLG ZDV FRQILUPHG E\'1$ VHTXHQFH DQDO\VLV 7KH *5 JHQH IURP PXWDQW YLUDO '1$ ZDV DPSOLILHG E\

PAGE 73

7DEOH *5 PXWDQW ROLJRQXFOHRWLGHV PXWDWLRQr ROLJROLJRQXFOHRWLGH VHTXHQFH DPLQR DFLG FKDQJHVW WV $6 $6 $6 $6 $6 $6 $6 $6 $6 f &77*$*$$$$7&7$&$$$*$$7 f f77$*$$$7$7$7*& $*&*7$7*&&*&$*&7**$$$*7 f f 7&&$$&*$77&&*&$*&77&7*7$$ f f 7&&$7$&77$$7*&&*&&*$7$$$7 f f $*$$&$7&7$&&*&7*&$777*77*7 f f *77&&*&77&&7*&$*&$$$7$$$7 f f $7$7$$$7$77&*&**&&*&7$7$$&$$& f f 7*$**$*7*7$7*&&*&*$**$*$7$ f f *77$7****$&**&&*&$77$*$$7 f f $7&7&&$$&*$7*&&*&$*&7*&7*7$$*7$ f 5 '5.<+. $$$<$$ 7('(( 7($$( /6((/ /6$$/ 71..9 71$$9 /)'.* /)$$* ,.'51 ,$$$1 //.(< //$$< 61(59 61$$9 7('(( 7$$$$ %ROG IDFH OHWWHUV LQGLFDWH PXWDQW QXFOHRWLGHV r LQGLFDWHV WKH *5 PXWDQW GHVLJQDWLRQ W GHQRWHV WKH DPLQR DFLG FKDQJHV FUHDWHG LQ WKH *5 SURWHLQ E\ HDFK PXWDQW ROLJRQXFOHRWLGH R?

PAGE 74

7DEOH ',5 PXWDQW ROLJRQXFOHRWLGHV PXWDWLRQr ROLJRQXFOHRWLGH VHTXHQFH DPLQR DFLG FKDQJHVW (O . ( ( ( ( f $$$$$7$7$*&$*&**&&*&7*7&*$7$*7& f f 7$&77$&,7*&7*&7$*&*&**&$77*$77*&$7 f f $*7$$$&**&&&7*&*7$7*&&*&7*$&*&*$$7$&7$7 f f $7$*7$777*&**&&*&$$77*&$$$$7&$$7*77$ f f 77*$7*&777*$*&7*&7$$$*&7*&*$&7$7*$ f f $&$7&&*$7$*7*&$*&&*&*77$$$*$ f f 7&7**$777$$7*&$$$7*&$*&$77$77** f f &&&$$&**7&&7*&$*77*&7*&$77&*7$$$ f f 77$$7$$$&*&7*&*&7$*&7*&7$7$$77*7$* f f &77*7$*$7**7*&$*&7*&&$77*7$* f ((5+, $$$$, '5/(( $$/$$ .6..<( $6$$<$ .,..( $,$$$ (+/5' $$/$$ ('./6 $$$/6 '.)5/ $$)$/ .575* $$7$* (56.. $$6$$ ('536 $$$36 %ROG IDFH OHWWHUV LQGLFDWH PXWDQW QXFOHRWLGHV r LQGLFDWHV WKH ',5 PXWDQW GHVLJQDWLRQ W GHQRWHV WKH DPLQR DFLG FKDQJHV FUHDWHG LQ WKH ',5 SURWHLQ E\ HDFK PXWDQW ROLJRQXFOHRWLGH 2Q 2Q

PAGE 75

3&5 DQG DSSURSULDWH VHOHFWHG UHJLRQV RI WKH *5 3&5 SURGXFW ZHUH VHTXHQFHG WR FRQILUP WKH SUHVHQFH RI WKH GHVLUHG PXWDWLRQV LQ &WV $6, $6 $6 DQG $6 YLUXVHV 7KH SUHVHQFH RI WKH PXWDQW VHTXHQFH LQ WKH ',5 SKDJH FORQHV ZDV FRQILUPHG E\ '1$ VHTXHQFLQJ RI VHOHFWHG UHJLRQV RI ',5 VXUURXQGLQJ WKH PXWDWLRQ RI LQWHUHVW '1$ VHTXHQFH DQDO\VLV RI 3&5 DPSOLILFDWLRQ SURGXFWV IURP SRUWLRQV RI WKH ',5 RSHQ UHDGLQJ IUDPH FRQILUPHG WKH SUHVHQFH RI WKH ( DQG ( PXWDWLRQ LQ ( DQG ( YLUDO '1$ UHVSHFWLYHO\ 7KH ( DQG PXWDWLRQV FUHDWHG QRYHO 1KHO DQG 1RWO UHVWULFWLRQ HQ]\PH VLWHV UHVSHFWLYHO\ LQ ',5 3RUWLRQV RI WKH ',5 JHQH IURP HLWKHU (O RU YLUDO '1$ ZHUH DPSOLILHG E\ 3&5 DQG VXEMHFWHG WR UHVWULFWLRQ HQ]\PH GLJHVWLRQ DQG DJDURVH JHO HOHFWURSKRUHVLV WR FRQILUP WKH SUHVHQFH RI WKH DSSURSULDWH PXWDWLRQV LQ WKH (O DQG YLUDO '1$ GDWD QRW VKRZQf f 6RGLXP 'RGHFYO 6XOIDWH 3RO\DFU\ODPLGH *HO (OHFWURSKRUHVLV 3URWHLQ VDPSOHV LQ O[ /DHPPOL VDPSOH EXIIHU ZHUH ERLOHG DQG VHSDUDWHG RQ b 6'6 SRO\DFU\ODPLGH VODE JHOV DV GHVFULEHG f )ROORZLQJ HOHFWURSKRUHVLV WKH JHOV ZHUH VWDLQHG ZLWK &RRPDVVLH EOXH GHVWDLQHG LQ b JODFLDO DFHWLF DFLG b PHWKDQRO DQG GULHG

PAGE 76

DFFRUGLQJ WR VWDQGDUG WHFKQLTXHV f $XWRUDGLRJUDPV RI UDGLRODEHOHG SURWHLQ VDPSOHV ZHUH PDGH XVLQJ .RGDN ;$5 ILOP DW r& 1RUWKHUQ %ORW $QDO\VLV )LYH XJ RI HDFK SXULILHG 51$ VDPSOH ZDV GHQDWXUHG LQ IRUPDPLGH DQG VHSDUDWHG RQ D b IRUPDOGHK\GH DJDURVH JHO XVLQJ VWDQGDUG WHFKQLTXHV f 7KH 51$ ZDV WUDQVIHUUHG IURP WKH JHO RQWR D *HQH6FUHHQ PHPEUDQH LQ SKRVSKDWH EXIIHU P0 1D+3 P0 1D+3&!f RYHUQLJKW DFFRUGLQJ WR WKH PHWKRG RI 6RXWKHUQ f 7KH 51$ ZDV IL[HG WR WKH PHPEUDQH E\ LUUDGLDWLRQ DW QP LQ D 6WUDWDOLQNHU 6WUDWDJHQHf IRU PLQXWH 7KH PHPEUDQH ZDV SUHK\EULGL]HG LQ PO RI D VROXWLRQ FRQWDLQLQJ b IRUPDPLGH b GH[WUDQ VXOIDWH 0 1D&O XJPO GHQDWXUHG VDOPRQ VSHUP '1$ ; 3 EXIIHU ,; 3 EXIIHU FRQWDLQV b ERYLQH VHUXP DOEXPLQ %6$ 6LJPD IUDFWLRQ 9f b SRO\YLQ\OS\UUROLGRQH 0: f b ILFROO 0: f 0 7ULV+&O >S+ @ b VRGLXP SKRVSKDWH b 6'6f IRU KRXUV DW R& +\EULGL]DWLRQV ZHUH GRQH E\ DGGLQJ O[O2 FSP RI WKH DSSURSULDWH UDGLRODEHOHG ULERSUREH WR WKH SUHK\EULGL]LQJ PHPEUDQH DQG LQFXEDWLQJ DW !& RYHUQLJKW

PAGE 77

1RQVSHFLILFDOO\ ERXQG UDGLRDFWLYLW\ ZDV UHPRYHG E\ ZDVKLQJ WKH PHPEUDQH RQFH LQ ; 66& ,; 66& LV P0 1D&O P0 VRGLXP FLWUDWHf b 6'6 IRU PLQXWHV DW URRP WHPSHUDWXUH DQG WZLFH IRU PLQXWHV HDFK LQ ; 66& b 6'6 DW !& $XWRUDGLRJUDPV ZHUH PDGH XVLQJ .RGDN ;$5 ILOP DW !& 3UHSDUDWLRQ RI 5DGLRODEHOHG 5LERSUREHV 3ODVPLGV XVHG WR SUHSDUH DQWLVHQVH ULERSUREHV VSHFLILF IRU WKH YDFFLQLD YLUXV &5 *5 DQG )5 P51$ WUDQVFULSWV ZHUH D JLIW IURP % 0RVV DQG WKHLU FRQVWUXFWLRQ KDV EHHQ GHVFULEHG HOVHZKHUH f %ULHIO\ DQG QXFOHRWLGHV RI FRGLQJ VHTXHQFH FRUUHVSRQGLQJ WR WKH f HQGV RI YDFFLQLD YLUXV JHQHV &5 *5 DQG )5 UHVSHFWLYHO\ ZHUH HDFK LQVHUWHG LQWR WKH YHFWRU SODVPLG S*(0=) 3URPHJDf 7KH SODVPLGV ZHUH OLQHDUL]HG E\ UHVWULFWLRQ HQ]\PH GLJHVWLRQ ZLWK (FR5, &5 DQG *5f RU %DP+, )5f DQG VXEMHFWHG WR WUDQVFULSWLRQ ZLWK 7 51$ SRO\PHUDVH 3URPHJDf WR JHQHUDWH DQWLVHQVH 51$ PROHFXOHV RI &5f *5f RU )5f QXFOHRWLGHV LQ OHQJWK (DFK XO WUDQVFULSWLRQ UHDFWLRQ FRQWDLQHG XJ RI OLQHDUL]HG SODVPLG '1$ P0 7ULV+&O >S+ @ P0 0J&K P0 VSHUPLGLQH P0 1D&O P0 GLWKLRWKUHLWRO

PAGE 78

P0 HDFK RI $73 *73 DQG 873 X0 XQODEHOHG &73 X&L >RF3@&73 &LPPRO $PHUVKDPf XQLWV RI 51DVLQ 3URPHJDf DQG XQLWV RI 7 51$ SRO\PHUDVH 3URPHJDf )ROORZLQJ D PLQXWH LQFXEDWLRQ DW r& XQLWV RI 51$VH IUHH '1$VH 3URPHJDf ZDV DGGHG WR WKH UHDFWLRQ DQG WKH r& LQFXEDWLRQ ZDV FRQWLQXHG IRU DQ DGGLWLRQDO PLQXWHV 7KH ODEHOHG 51$ ZDV SXULILHG E\ H[WUDFWLRQ ZLWK SKHQROFKORURIRUP f SUHFLSLWDWHG ZLWK DPPRQLXP DFHWDWH DQG LVRSURSDQRO DQG TXDQWLWDWHG E\ OLTXLG VFLQWLOODWLRQ FRXQWLQJ DFFRUGLQJ WR VWDQGDUG WHFKQLTXHV f :HVWHUQ %ORW $QDO\VLV RI ( 9LULRQV 7UDQVIHU RI SURWHLQV IURP b VRGLXP GRGHF\O VXOIDWH SRO\DFU\ODPLGH JHOV WR QLWURFHOOXORVH ZDV GRQH DFFRUGLQJ WR WKH PHWKRG RI 7RZELQ f 5DEELW SRO\FORQDO DQWLVHUDV IRU ',5 DQG '/ NLQGO\ SURYLGHG E\ ( 1LOHV DQG 6 6KXPDQ UHVSHFWLYHO\ ZHUH HDFK XVHG DW D GLOXWLRQ RI 7KH SULPDU\ DQWLERG\ ZDV GHWHFWHG E\ XVLQJ KRUVHUDGLVK SHUR[LGDVH OLQNHG SRO\FORQDO DQWLUDEELW DQWLVHUD $PHUVKDPf DW D GLOXWLRQ RI DQG YLVXDOL]HG E\ $PHUVKDPfV HQKDQFHG FKHPLOXPLQHVFHQFH ZHVWHUQ EORWWLQJ NLW DFFRUGLQJ WR WKH PDQXIDFWXUHUV LQVWUXFWLRQV

PAGE 79

9LULRQ 'LUHFWHG ,Q 9LWUR 7UDQVFULSWLRQ DQG 0HWKYOWUDQVIHUDVH $VVD\V 3XULILHG YDFFLQLD YLUXV YLULRQV ZHUH SUHLQFXEDWHG DW !& m& RU m& LQ XO UHDFWLRQV FRQWDLQLQJ XJPO YLUXV 0 7ULV +&/ >S+ @ b QRQLGHW 3 0 GLWKLRWKUHLWRO 0 0J&O $W PLQXWH LQWHUYDOV XO VDPSOHV ZHUH UHPRYHG DQG KHOG RQ LFH XQWLO WKH FRQFOXVLRQ RI WKH SUHLQFXEDWLRQ WLPH FRXUVH )RU WKH WUDQVFULSWLRQ UHDFWLRQV XO RI D VROXWLRQ FRQWDLQLQJ P0 $73 P0 *73 P0 &73 P0 XQODEHOHG 873 X&L >+@873 &LPPRO $PHUVKDPf ZDV DGGHG WR HDFK SUHLQFXEDWHG VDPSOH DQG WUDQVFULSWLRQ UHDFWLRQV ZHUH FDUULHG RXW DW r& IRU PLQXWHV )RU PHWK\OWUDQVIHUDVH UHDFWLRQV XO RI D VROXWLRQ FRQWDLQLQJ P0 $73 P0 *73 P0 &73 P0 XQODEHOHG 873 X&L >+@6 DGHQRV\O/PHWKLRQLQH &LPPRO $PHUVKDPf ZDV DGGHG WR HDFK SUHLQFXEDWHG VDPSOH DQG PHWK\OWUDQVIHUDVH UHDFWLRQV ZHUH FDUULHG RXW DW r& IRU PLQXWHV 7KH UHDFWLRQV ZHUH WHUPLQDWHG E\ VSRWWLQJ XO RQWR D '( ILOWHU :KDWPDQf 8QLQFRUSRUDWHG UDGLRDFWLYLW\ ZDV UHPRYHG E\ ZDVKLQJ LQ 0 1D+3 DIWHU ZKLFK WKH ILOWHUV ZHUH DQDO\]HG E\ OLTXLG VFLQWLOODWLRQ FRXQWLQJ DFFRUGLQJ WR HVWDEOLVKHG PHWKRGV f :LOGW\SH DQG ( WUDQVFULSWLRQ DQG

PAGE 80

PHWK\OWUDQVIHUDVH UHDFWLRQV ZHUH QRUPDOL]HG WR LGHQWLFDO UHDFWLRQV FDUULHG RXW ZLWK ZLOGW\SH RU ( YLUXV WKDW KDG QRW EHHQ SUHLQFXEDWHG DQG WKH UHVXOWV H[SUHVVHG DV WKH SHUFHQW RI DFWLYLW\ UHODWLYH WR QRQSUHLQFXEDWHG FRQWUROV 9LURORJLFDO 7HFKQLTXHV &HOOV DQG 9LUXV %6& DQG &9 FHOOV ZHUH URXWLQHO\ PDLQWDLQHG DW m& LQ b &2 %6& FHOOV ZHUH JURZQ LQ 'XOEHFFRnV 0RGLILHG (DJOH PHGLXP '0( /LIH 7HFKQRORJLHVf ZLWK b +\FORQH +\FORQH /DERUDWRULHVf &9 FHOOV ZHUH PDLQWDLQHG LQ &9 PHGLXP ZKLFK LV 'XOEHFFRnV PRGLILHG (DJOH PHGLXP VXSSOHPHQWHG ZLWK b QRQHVVHQWLDO DPLQR DFLGV 6LJPDf b VRGLXP S\UXYDWH 6LJPDf DQG b IHWDO FDOI VHUXP /LIH 7HFKQRORJLHVf 6WRFNV RI ZLOGW\SH YDFFLQLD YLUXV VWUDLQ :5 ZHUH JURZQ RQ %6& FHOOV DW r& 7HPSHUDWXUHVHQVLWLYH YDFFLQLD YLUXV PXWDQWV ZHUH JURZQ RQ %6& FHOOV DW r& 7KH LVDWLQ WKLRVHPLFDUED]RQH GHSHQGHQW PXWDQW *$ ZDV JURZQ RQ %6& FHOOV DW r& LQ WKH SUHVHQFH RI S0 ,%7 3IDOW] DQG %DXHUf

PAGE 81

3UHSDUDWLRQ RI ,%7 $ PJPO VWRFN RI ,%7 LQ DFHWRQH ZDV GLOXWHG ZLWK YROXPHV RI 1 1D2+ DQG IXUWKHU GLOXWHG LQ '0(b +\FORQHb 1REOH DJDU 'LIFRf IRU D ILQDO FRQFHQWUDWLRQ RI S0 ,%7 FRQWDLQLQJ PHGLD ZDV DGGHG WR LQIHFWHG %6& FHOOV IROORZLQJ WKH PLQXWH DEVRUSWLRQ SHULRG DQG UHPDLQHG LQ WKH PHGLD WKURXJKRXW WKH FRXUVH RI WKH LQIHFWLRQ 3ODTXH 7LWUDWLRQ 9LUDO VWRFNV ZHUH WKDZHG VRQLFDWHG LQ D 9LEUD FHOO VRQLFDWRU ZLWK D FXSKRUQ DWWDFKPHQW 6RQLFV DQG 0DWHULDOVf IRU PLQXWH DQG VHULDOO\ GLOXWHG LQ 3%6$0 P0 1D&O P0 .& P0 1D+3 P0 .+3 >S+ @ P0 0J&O b %6$f &RQIOXHQW PRQROD\HUV RI %6& FHOOV RQ PP GLVKHV ZHUH LQIHFWHG ZLWK PO DOLTXRWV RI HDFK YLUDO GLOXWLRQ IRU RQH KRXU DW HLWKHU r& RU r& 7KH LQRFXOD ZHUH UHPRYHG DQG HDFK GLVK ZDV RYHUODLG ZLWK PO RI '0(b +\FORQH FRQWDLQLQJ b PROWHQ QREOH DJDU 'LIFRf DOORZHG WR VROLGLI\ DQG LQFXEDWHG DW }& RU R& IRU GD\V 7KH SODTXHV ZHUH VWDLQHG E\ RYHUOD\LQJ WKH FHOOV ZLWK PO RI '0(b

PAGE 82

+\FORQH b PROWHQ 1REOH DJDU b QHXWUDO UHG $PLQR GLPHWK\ODPLQRPHWK\OSKHQD]LQH K\GURFKORULGH 6LJPDf DQG LQFXEDWLQJ DW r& RU r& IURP KRXUV WR RYHUQLJKW )RU SHUPDQHQW UHFRUGV RI ZLOGW\SH DQG PXWDQW SODTXHV WKH 1REOH DJDU RYHUOD\ ZDV UHPRYHG DIWHU VWDLQLQJ ZLWK QHXWUDO UHG DQG WKH FHOO PRQROD\HUV ZHUH VWDLQHG ZLWK D VROXWLRQ RI b FU\VWDO YLROHW 6LJPDf LQ b HWKDQRO DW URRP WHPSHUDWXUH IRU D IHZ KRXUV 7KH GLVKHV ZHUH WKHQ ULQVHG ZLWK GLVWLOOHG ZDWHU DQG DLU GULHG 9LUDO 3ODTXH ,VRODWLRQ ,QIHFWHG PRQROD\HUV RI %6& RU &9 FHOOV ZHUH VWDLQHG ZLWK QHXWUDO UHG DV GHVFULEHG DERYH WR YLVXDOL]H LQGLYLGXDO SODTXHV :HOO LVRODWHG VLQJOH SODTXHV ZHUH SLFNHG ZLWK D VWHULOH SDVWHXU SLSHWWH DQG SODFHG LQ PO RI 3%6$0 IUR]HQ DQG WKDZHG WLPHV DQG WKHQ SODTXH WLWUDWHG DV SUHYLRXVO\ GHVFULEHG 3UHSDUDWLRQ RI 9LUDO 6WRFNV &RQIOXHQW PRQROD\HUV RI %6& FHOOV RQ PP GLVKHV ZHUH LQIHFWHG ZLWK WKH DSSURSULDWH YLUXV DW D ORZ PXOWLSOLFLW\ RI LQIHFWLRQ PRLf EHWZHHQ DQG SODTXH IRUPLQJ XQLWV SHU FHOOf DQG

PAGE 83

LQFXEDWHG DW HLWKHU R& ZLOGW\SHf RU }& PXWDQWVf XQWLO WKH F\WRSDWKLF HIIHFW ZDV FRPSOHWH &HOOV ZHUH VFUDSHG IURP WKH GLVKHV LQWR WKH PHGLD DQG SHOOHWHG E\ FHQWULIXJDWLRQ DW [ J IRU PLQXWHV DW }& 7KH FHOO SHOOHWV ZHUH UHVXVSHQGHG LQ PO RI 3%6$0O[O2" LQIHFWHG FHOOV IUR]HQ DQG WKDZHG WLPHV DQG VWRUHG DW R& 7UDQVLHQW 'RPLQDQW 6HOHFWLRQ 7UDQVLHQW GRPLQDQW VHOHFWLRQ ZDV SHUIRUPHG HVVHQWLDOO\ DV GHVFULEHG E\ )DONQHU DQG 0RVV f &9 FHOOV RQ PP GLVKHV ZHUH SUHWUHDWHG RYHUQLJKW LQ &9 PHGLD FRQWDLQLQJ 03$ XJPO K\SR[DQWKLQH XJPO [DQWKLQH XJPO P\FRSKHQROLF DFLG 6LJPDf LQIHFWHG ZLWK ZLOGW\SH YDFFLQLD YLUXV PRL RI SODTXH IRUPLQJ XQLWV SHU FHOOf WUDQVIHFWHG ZLWK XJ RI SODVPLG '1$ XVLQJ 7UDQVIHFWDVH /LIH 7HFKQRORJLHVf DFFRUGLQJ WR WKH PDQXIDFWXUHUV LQVWUXFWLRQV DQG LQFXEDWHG DW }& IRU WKUHH GD\V ,QIHFWHG WUDQVIHFWHG FHOOV ZHUH KDUYHVWHG E\ VFUDSLQJ IURP WKH GLVK LQWR WKH PHGLD SHOOHWHG E\ FHQWULIXJDWLRQ DW [ J IRU ILYH PLQXWHV UHVXVSHQGHG LQ PO RI 3%6$0 IUR]HQ DQG WKDZHG WKUHH WLPHV DQG VWRUHG DW !& 7KH VDPSOHV ZHUH SODTXH WLWUDWHG RQ &9 FHOOV LQ WKH

PAGE 84

SUHVHQFH RI 03$ IRU WR GD\V 7KH SODTXH WLWUDWLRQV ZHUH GRQH HVVHQWLDOO\ DV GHVFULEHG DERYH H[FHSW WKDW &9 FHOOV DQG PHGLD ZHUH XVHG DQG b 6HNHP +*7 DJDURVH ZDV XVHG LQ SODFH RI b 1REOH DJDU )RU WKH *5 PXWDQW VFUHHQ LQGLYLGXDO 03$ UHVLVWDQW SODTXHV IURP HDFK WUDQVIHFWLRQ ZHUH SLFNHG DQG SODTXH WLWUDWHG RQ %6& FHOOV LQ WKH SUHVHQFH DQG DEVHQFH RI S0 ,%7 DW !& DQG r& 7R GHWHUPLQH WKHLU SKHQRW\SHV LQGLYLGXDO ,%7 UHVLVWDQW SODTXHV ZHUH SLFNHG WKHQ UHSODTXHG LQ WKH SUHVHQFH DQG DEVHQFH RI ,%7 DW r& DQG r& ,QGLYLGXDO *5 PXWDQW YLUXVHV ZHUH WKHQ UHn SODTXH SXULILHG DQG YLUDO VWRFNV ZHUH JURZQ DV GHVFULEHG DERYH )RU WKH ',5 PXWDQW VFUHHQ ILYH LQGLYLGXDO 03$ UHVLVWDQW SODTXHV IURP HDFK WUDQVIHFWLRQ ZHUH SODTXH WLWUDWHG RQ %6& FHOOV DW m& )LIW\ LQGLYLGXDO SODTXHV WHQ IURP HDFK RULJLQDO 03$ UHVLVWDQW SODTXH ZHUH SLFNHG WKHQ UHSODTXHG DW r& DQG m& ,QGLYLGXDO SODTXHV IURP GLVKHV VKRZLQJ HLWKHU KHWHURJHQHLW\ LQ SODTXH VL]H RU UHGXFHG SODTXH VL]H LQ FRPSDULVRQ WR ZLOGW\SH ZHUH UHSODTXH SXULILHG DW m& DQG YLUDO VWRFNV SUHSDUHG DV SUHYLRXVO\ GHVFULEHG

PAGE 85

2QH 6WHS *URZWK ([SHULPHQWV &RQIOXHQW PRQROD\HUV RI %6& FHOOV RQ PP GLVKHV ZHUH LQIHFWHG DW }& RU m& ZLWK WKH LQGLFDWHG YLUXV DW DQ PRL RI $W YDULRXV WLPHV SRVW LQIHFWLRQ LQIHFWHG FHOOV ZHUH VFUDSHG IURP WKH GLVKHV LQWR WKH PHGLD DQG IUR]HQ DQG WKDZHG WLPHV 9LUDO \LHOGV ZHUH GHWHUPLQHG E\ SODTXH WLWUDWLRQ RQ %6& FHOOV DW r& 7KH GDWD LV H[SUHVVHG DV WKH QXPEHU RI SODTXH IRUPLQJ XQLWV SURGXFHG SHU LQIHFWHG FHOO SIXFHOOf 0DUNHU 5HVFXHV &RQIOXHQW PRQROD\HUV RI %6& FHOOV RQ PP GLVKHV ZHUH LQIHFWHG ZLWK WKH PXWDQW YLUXV LQGLFDWHG LQ WKH ILJXUH LQFXEDWHG DW r& IRU IRXU KRXUV WUDQVIHFWHG ZLWK XJPO RI WKH DSSURSULDWH '1$ LQ +%6 P0 &D&O P0 1D&O P0 1D+3 P0 .& P0 1>K\GUR[\HWK\O@ SLSHUD]LQH1>HWKDQHVXOIRQLF DFLG@ +(3(6f P0 'H[WURVHf DQG VKLIWHG WR r& IRU WKUHH GD\V 7KH FHOOV ZHUH VWDLQHG ZLWK FU\VWDO YLROHW DV SUHYLRXVO\ GHVFULEHG 7KH '1$ FRQVWUXFWV XVHG LQ WKH PDUNHU UHVFXH H[SHULPHQWV DUH GHVFULEHG LQ WKH ILJXUH OHJHQGV

PAGE 86

3XULILFDWLRQ RI 9DFFLQLD 9LUXV 9LULRQV [ %6& FHOOV RQ PP GLVKHV ZHUH LQIHFWHG DW DQ PRL RI EHWZHHQ DQG DQG LQFXEDWHG DW HLWKHU !& ZLOG W\SHf RU r& (f XQWLO FRPSOHWH F\WRSDWKLF HIIHFW ZDV REVHUYHG &HOOV ZHUH VFUDSHG IURP WKH GLVKHV LQWR WKH PHGLD SHOOHWHG E\ FHQWULIXJDWLRQ DW [ J IRU PLQXWHV ZDVKHG ZLWK PO RI 3%6 P0 1D&O P0 .& P0 1D+3 P0 .+3 >S+ @f DQG UHVXVSHQGHG LQ PO RI P0 7ULV+&O >S+ @ P0 0J&O 7KH FHOOV ZHUH O\VHG E\ GRXQFH KRPRJHQL]DWLRQ DQG WKH QXFOHL ZHUH UHPRYHG E\ SHOOHWLQJ DW [ J $IWHU VRQLFDWLRQ RI WKH VXSHUQDWDQW IUDFWLRQ WKH YLUXV ZLWKLQ WKH VDPSOH ZDV SHOOHWHG WKURXJK D b ZY VXFURVH P0 7ULV+&O >S+ @ FXVKLRQ E\ FHQWULIXJDWLRQ DW USP LQ DQ 6: URWRU %HFNPDQf DW !& IRU PLQXWHV 9LUDO SHOOHWV ZHUH UHVXVSHQGHG LQ PO RI P0 7ULV +&/ >S+ @ UHVRQLFDWHG DQG VSXQ WKURXJK D bb ZY VXFURVH P0 7ULV+&O >S+ @ JUDGLHQW DW USP LQ DQ 6: URWRU DW m& IRU PLQXWHV 9LUDO EDQGV ZHUH FROOHFWHG GLOXWHG ZLWK YROXPHV RI P0 7ULV+&O >S+ @ DQG SHOOHWHG DW USP LQ DQ 6: URWRU DW r& IRU PLQXWHV 7KH SHOOHW ZDV UHVXVSHQGHG LQ

PAGE 87

PO RI P0 7ULV+&O >S+ @ 7KH SXULILHG YLUXV ZDV TXDQWLWDWHG E\ %UDGIRUG DVVD\ XVLQJ D %LRUDG SURWHLQ DVVD\ NLW DFFRUGLQJ WR WKH PDQXIDFWXUHUV LQVWUXFWLRQV DQG DEVRUEDQFH PHDVXUHPHQWV DW QP 2' XJ YLUXVf 7KH LQIHFWLYLW\ RI WKH SXULILHG YLUXV ZDV DVVD\HG E\ SODTXH WLWUDWLRQ RQ %6& FHOOV DW r& 7KHUH ZDV QR VLJQLILFDQW GLIIHUHQFH LQ HLWKHU WKH TXDQWLW\ RU LQIHFWLYLW\ RI WKH ( RU ( YLUXV SUHSDUDWLRQV FRPSDUHG WR ZLOGW\SH SUHSDUDWLRQV ,Q 9LYR 3URWHLQ 3XOVH /DEHOLQJ RI ,QIHFWHG &HOOV &RQIOXHQW PRQROD\HUV RI %6& FHOOV RQ PP GLVKHV ZHUH LQIHFWHG DW DQ PRL RI ZLWK WKH LQGLFDWHG YLUXV DW r& RU m& $IWHU D PLQXWH DEVRUSWLRQ WKH LQRFXOXP ZDV UHPRYHG PO RI PHGLXP SUHZDUPHG WR WKH DSSURSULDWH WHPSHUDWXUH ZDV DGGHG WR HDFK GLVK DQG WKH LQFXEDWLRQV ZHUH FRQWLQXHG $W YDULRXV WLPHV DIWHU LQIHFWLRQ WKH PHGLD ZDV UHPRYHG DQG WKH LQIHFWHG FHOOV ZHUH ZDVKHG WKUHH WLPHV ZLWK PO RI SUHZDUPHG 3%6 3URWHLQV ZLWKLQ WKH LQIHFWHG FHOOV ZHUH SXOVH ODEHOHG IRU PLQXWHV ZLWK X&L RI 7UDQV>6@ODEHO &LPPRO ,&1 %LRFKHPLFDOf LQ PO RI SUHZDUPHG 3%6 7KH ODEHO ZDV UHPRYHG DQG WKH FHOOV ZHUH O\VHG LQ

PAGE 88

PO RI /DHPPOL VDPSOH EXIIHU f VFUDSHG IURP WKH GLVKHV ERLOHG DQG IUR]HQ DW r& 9LUDO '1$ $FFXPXODWLRQ LQ ,QIHFWHG &HOOV &RQIOXHQW PRQROD\HUV RI %6& FHOOV RQ PP GLVKHV ZHUH LQIHFWHG DW D PRL RI ZLWK HLWKHU ZLOGW\SH RU ( YLUXV DQG LQFXEDWHG DW m& RU r& $W KRXU LQWHUYDOV DIWHU LQIHFWLRQ WKH FHOOV ZHUH ZDVKHG ZLWK PO RI 3%6 VFUDSHG IURP WKH GLVKHV LQWR PO RI 3%6 DQG SHOOHWHG E\ FHQWULIXJDWLRQ DW [ J IRU PLQXWHV 7KH FHOOV ZHUH UHVXVSHQGHG LQ PO RI ; 66& FRQWDLQLQJ 0 DPPRQLXP DFHWDWH 6DPSOHV ZHUH IUR]HQ DQG WKDZHG WKUHH WLPHV DQG GLOXWHG ZLWK PO RI ; 66& XO RI HDFK GLOXWHG VDPSOH ZDV GHQDWXUHG E\ WKH DGGLWLRQ RI XO RI 1 1D2+ DQG XO RI 0 1D&O ILQDO FRQFHQWUDWLRQ 1 1D2+ 0 1D&Of IRU PLQXWHV DW URRP WHPSHUDWXUH $IWHU GHQDWXUDWLRQ XO ZDV UHPRYHG GLOXWHG LQ ; 66& 1 1D2+ DQG DSSOLHG WR D *HQH6FUHHQ PHPEUDQH 1HZ (QJODQG 1XFOHDUf XVLQJ D 6FKOHLFKHU DQG 6FKXHOO VORW EORWWLQJ DSSDUDWXV DFFRUGLQJ WR PDQXIDFWXUHUV LQVWUXFWLRQV '1$ ZDV IL[HG WR WKH PHPEUDQH E\ LUUDGLDWLRQ DW QP LQ D 6WUDWDOLQNHU 6WUDWDJHQHf IRU PLQXWH 7KH PHPEUDQH ZDV SUHK\EULGL]HG LQ

PAGE 89

PO RI SUHK\EULGL]DWLRQ EXIIHU PJPO GH[WUDQ VXOIDWH 0: f b 6'6 0 1D&/f DW r& IRU KRXUV +\EULGL]DWLRQV ZHUH GRQH RYHUQLJKW DW r& E\ WKH DGGLWLRQ WR WKH SUHK\EULGL]LQJ PHPEUDQH RI PO RI SUREH PL[ 1RQVSHFLILFDOO\ ERXQG UDGLRDFWLYLW\ ZDV UHPRYHG E\ ZDVKLQJ WKH PHPEUDQH WZLFH IRU PLQXWHV LQ ; 66& DW URRP WHPSHUDWXUH DQG RQFH IRU PLQXWHV DW !& LQ ; 66& b 6'6 5DGLRDFWLYLW\ ERXQG WR WKH PHPEUDQH ZDV TXDQWLWDWHG ZLWK DQ ,PDJH 4XDQW SKRVSKRULPDJHU DFFRUGLQJ WR WKH PDQXIDFWXUHUV LQVWUXFWLRQV 3UHSDUDWLRQ RI SUREH PL[ [ FSPPO RI UDGLRODEHOHG ZLOG W\SH YDFFLQLD YLUXV '1$ ZDV DGGHG WR PO RI D PJPO VROXWLRQ RI VDOPRQ VSHUP '1$ ERLOHG IRU ILYH PLQXWHV FRROHG RQ LFH IRU PLQXWHV DQG XVHG LPPHGLDWHO\ 3UHSDUDWLRQ RI UDQGRPO\ ODEHOHG YDFFLQLD YLUXV '1$ :LOG W\SH YDFFLQLD '1$ ZDV GLJHVWHG ZLWK +LQGOOO DQG UDGLRODEHOHG ZLWK >D3@ G&73 &LPPRO $PHUVKDPf E\ fROLJRODEHOLQJf DFFRUGLQJ WR WKH PHWKRG RI )HLQEHUJ DQG 9RJHOVWHLQ f 8QLQFRUSRUDWHG QXFOHRWLGHV ZHUH UHPRYHG E\ FROXPQ FKURPDWRJUDSK\ WKURXJK 6HSKDGH[ DV GHVFULEHG f ,QFRUSRUDWHG UDGLRDFWLYLW\ ZDV GHWHUPLQHG E\ SUHFLSLWDWLRQ RI D XO DOLTXRW RI WKH SUREH UHDFWLRQ

PAGE 90

RQWR ILOWHU SDSHU :KDWPDQf ZLWK WULFKORURDFHWLF DFLG IROORZHG E\ OLTXLG VFLQWLOODWLRQ FRXQWLQJ DV SUHYLRXVO\ GHVFULEHG f 3UHSDUDWLRQ RI 51$ )URP ,QIHFWHG &HOOV &RQIOXHQW PRQROD\HUV RI %6& FHOOV RQ PP GLVKHV ZHUH LQIHFWHG DW DQ PRL RI ZLWK ZLOGW\SH RU ( YLUXV DQG LQFXEDWHG DW HLWKHU !& RU m& $W YDULRXV WLPHV WKH FHOOV ZHUH ZDVKHG RQFH ZLWK FROG 3%6 O\VHG LQ PO RI *7 EXIIHU 0 JXDQLGLQLXP LVRWKLRF\DQDWH 0 7ULV+&O >S+ @ b 6DUNRV\O 0 PHUFDSWRHWKDQROf DQG VFUDSHG IURP WKH GLVKHV 6DPSOHV ZHUH SHOOHWHG WKURXJK D &V&O 0 &V&O 0 HWK\OHQHGLDPLQHWHWUDDFHWLF DFLG ('7$f >S+ @f FXVKLRQ IRU DSSUR[LPDWHO\ KRXUV DW m& LQ D 6: 7L URWRU %HFNPDQf DW USP 7KH 51$ SHOOHW ZDV GLVVROYHG LQ GLVWLOOHG ZDWHU SUHFLSLWDWHG ZLWK WZR YROXPHV RI HWKDQRO DQG UHVXVSHQGHG LQ GLVWLOOHG ZDWHU 7KH 51$ ZDV TXDQWLWDWHG E\ DEVRUEDQFH DW QP 2'R XJPO RI 51$f f

PAGE 91

(OHFWURQ 0LFURVFRS\ RI ,QIHFWHG &HOOV &RQIOXHQW PRQROD\HUV RI %6& FHOOV RQ PP GLVKHV ZHUH LQIHFWHG ZLWK HLWKHU ZLOGW\SH RU ( DW DQ PRL RI DW r& RU R& $W KRXUV SRVW LQIHFWLRQ FHOOV ZHUH ZDVKHG ZLWK PO RI 3%6 VFUDSHG IURP WKH GLVK LQWR PO RI 3%6 DQG SHOOHWHG E\ FHQWULIXJDWLRQ DW [ J 7KH FHOO SHOOHW ZDV UHVXVSHQGHG LQ PO RI b JOXWDUDOGHK\GH LQ 3%6 IL[HG RYHUQLJKW DW URRP WHPSHUDWXUH UHSHOOHWHG E\ FHQWULIXJDWLRQ DW [ J DQG SRVWIL[HG LQ DQ DTXHRXV VROXWLRQ RI b 262 IRU KRXU 7KH FHOOV ZHUH UHSHOOHWHG DW [ J ULQVHG LQ GLVWLOOHG ZDWHU VWDLQHG LQ b DTXHRXV XUDQ\O DFHWDWH IRU PLQXWHV ULQVHG DJDLQ LQ GLVWLOOHG ZDWHU DQG GHK\GUDWHG LQ b b b DQG b HWKDQRO IRU PLQXWHV HDFK $IWHU GHK\GUDWLRQ WKH FHOOV ZHUH ZDVKHG WZLFH IRU PLQXWHV LQ b DFHWRQH WKHQ HPEHGGHG LQ 6SXUUfV HSRQ UHVLQ ZKLFK ZDV WKHQ SRO\PHUL]HG IRU GD\V DW r& $IWHU WKLQ VHFWLRQLQJ WKH VDPSOHV ZHUH PRXQWHG DQG YLHZHG ZLWK D +LWDFKL + WUDQVPLVVLRQ HOHFWURQ PLFURVFRSH

PAGE 92

6RXWKHUQ $QDO\VLV RI &RQFDWDPHULF DQG 0RQRPHULF 9DFFLQLD '1$ ,VRODWHG )URP ,QIHFWHG &HOOV &RQIOXHQW PRQROD\HUV RI %6& FHOOV RQ PP GLVKHV ZHUH LQIHFWHG ZLWK HLWKHU ZLOGW\SH &WV RU ( YLUXV DW DQ PRL RI DW r& RU r& $W DQG KRXUV SRVW LQIHFWLRQ WKH FHOOV ZHUH VFUDSHG IURP WKH GLVK LQWR WKH PHGLD SHOOHWHG E\ FHQWULIXJDWLRQ IRU PLQXWHV DW [ J ZDVKHG RQFH ZLWK 3%6 DQG UHVXVSHQGHG LQ XO RI 0 1D&O 0 7ULV+&O >S+ @ 0 ('7$ 7KH XO VDPSOHV ZHUH DGGHG WR XO RI 0 7ULV+&O >S+ @ 0 ('7$ b 6'6 FRQWDLQLQJ PJPO SURWHLQDVH %RHKULQJHU 0DQQKHLPf DQG LQFXEDWHG DW r& IRU KRXUV 7KH VDPSOHV ZHUH SDVVHG WKURXJK D JDXJH QHHGOH WLPHV H[WUDFWHG WZLFH ZLWK SKHQRO FKORURIRUP f DQG WZLFH ZLWK FKORURIRUP EHIRUH SUHFLSLWDWLRQ ZLWK YROXPH RI 0 VRGLXP DFHWDWH DQG YROXPHV RI HWKDQRO DW URRP WHPSHUDWXUH IRU PLQXWHV 7KH SUHFLSLWDWH ZDV SHOOHWHG E\ FHQWULIXJDWLRQ LQ D PLFURIXJH DW USP IRU PLQXWHV ZDVKHG ZLWK PO RI b HWKDQRO DLU GULHG UHVXVSHQGHG LQ XO RI 7( P0 7ULV+&O >S+ @ P0 ('7$f DQG TXDQWLWDWHG E\ PHDVXUHPHQW RI DEVRUEDQFH DW Q0 PLFURJUDPV RI WRWDO

PAGE 93

QXFOHLF DFLG ZDV GLJHVWHG ZLWK XQLWV RI %VW(,, 1HZ (QJODQG %LRODEVf RYHUQLJKW DW !& DQG VHSDUDWHG RQ D b DJDURVH JHO LQ 7$( EXIIHU 0 7ULV+&/ >S+ @ 0 ('7$f 6RXWKHUQ DONDOLQH WUDQVIHU RI WKH '1$ RQWR D *HQH6FUHHQ PHPEUDQH ZDV GRQH DFFRUGLQJ WR D SURWRFRO SURYLGHG E\ WKH PDQXIDFWXUHU 7KH '1$ ZDV IL[HG WR WKH PHPEUDQH E\ XY LUUDGLDWLRQ DW QP LQ D 6WUDWDOLQNHU IRU PLQXWH 7KH PHPEUDQH ZDV SUHK\EULGL]HG LQ PO RI SUHK\EULGL]DWLRQ EXIIHU PJPO GH[WUDQ VXOIDWH 0: f b 6'6 0 1D&/f DW r& IRU KRXUV +\EULGL]DWLRQ ZDV GRQH RYHUQLJKW DW r& E\ WKH DGGLWLRQ WR WKH SUHK\EULGL]LQJ PHPEUDQH RI PO RI S%' SUREH PL[ 1RQVSHFLILFDOO\ ERXQG UDGLRDFWLYLW\ ZDV UHPRYHG E\ ZDVKLQJ WKH PHPEUDQH WZLFH IRU PLQXWHV LQ ; 66& DW URRP WHPSHUDWXUH DQG RQFH IRU PLQXWHV DW !& LQ ; 66& b 6'6 5DGLRDFWLYLW\ ERXQG WR WKH PHPEUDQH ZDV TXDQWLWDWHG ZLWK DQ ,PDJH 4XDQW 3KRVSKRULPDJHU DFFRUGLQJ WR WKH PDQXIDFWXUHUV LQVWUXFWLRQV 7KH UHVROXWLRQ HIILFLHQF\ ZDV FDOFXODWHG E\ GHWHUPLQLQJ WKH UDWLR RI WKH LQWHQVLW\ RI WKH NE UHVROYHG WHORPHUH EDQG WR WKH LQWHQVLW\ RI WKH NE FRQFDWDPHU MXQFWLRQ EDQG 3UHSDUDWLRQ RI S%' SUREH PL[ $SSUR[LPDWHO\ [ FSP RI UDGLRODEHOHG S%' SODVPLG '1$ ZDV DGGHG WR PO RI D PJPO

PAGE 94

VROXWLRQ RI VDOPRQ VSHUP '1$ ERLOHG IRU ILYH PLQXWHV FRROHG RQ LFH IRU PLQXWHV DQG DGGHG WR WKH SUHK\EULGL]LQJ PHPEUDQH LPPHGLDWHO\ 7KH FRQVWUXFWLRQ RI SODVPLG S%' ZKLFK FRQWDLQV D NLOREDVH %VW(,,%VW(,, YDFFLQLD YLUXV FRQFDWDPHU MXQFWLRQ LQVHUW ZDV D JLIW IURP 0 0HUFKOLQVN\ DQG KDV EHHQ SUHYLRXVO\ GHVFULEHG f %ULHIO\ WKH NE YDFFLQLD YLUXV LQVHUW ZLWKLQ SODVPLG S%' FRQVLVWV RI D GRXEOHVWUDQGHG FRS\ RI WKH WHUPLQDO KDLUSLQ ORRS EDVH SDLUVf ZKLFK LV WKH FRQFDWDPHU MXQFWLRQ DQG NLOREDVHV RI LQYHUWHG WHUPLQDO UHSHDW VHTXHQFHV 3ODVPLG S%' ZDV UDGLRODEHOHG ZLWK >DS@ G&73 &LPPRO $PHUVKDPf E\ fROLJRODEHOLQJf DFFRUGLQJ WR WKH PHWKRG RI )HLQEHUJ DQG 9RJHOVWHLQ f 8QLQFRUSRUDWHG QXFOHRWLGHV ZHUH UHPRYHG E\ FROXPQ FKURPDWRJUDSK\ WKURXJK 6HSKDGH[ DV GHVFULEHG f ,QFRUSRUDWHG UDGLRDFWLYLW\ ZDV GHWHUPLQHG E\ SUHFLSLWDWLRQ RI D XO DOLTXRW RI WKH SUREH UHDFWLRQ RQWR ILOWHU SDSHU :KDWPDQf ZLWK WULFKORURDFHWLF DFLG IROORZHG E\ OLTXLG VFLQWLOODWLRQ FRXQWLQJ DV SUHYLRXVO\ GHVFULEHG f

PAGE 95

&+$37(5 7(67,1* &/867(5(' &+$5*( 72 $/$1,1( 087$*(1(6,6 $1' 75$16,(17 '20,1$17 6(/(&7,21 21 7+( 9$&&,1,$ 9,586 *(1( *5 ,QWURGXFWLRQ 7UDGLWLRQDO DSSURDFKHV WR YLUDO JHQHWLFV ZKLFK LQYROYH UDQGRP PXWDJHQHVLV RI WKH YLUXV IROORZHG E\ VFUHHQLQJ IRU SKHQRW\SHV RI LQWHUHVW KDYH SURYHQ WR EH TXLWH XVHIXO LQ WKH JHQHWLF DQG ELRFKHPLFDO FKDUDFWHUL]DWLRQ RI YDFFLQLD YLUXV UHYLHZHG LQ f 5DQGRP PXWDJHQHVLV PHWKRGV KRZHYHU DUH OLPLWHG E\ WKHLU LQDELOLW\ WR WDUJHW VSHFLILF RSHQ UHDGLQJ IUDPHV DQG E\ WKH ODERULRXV VFUHHQLQJ PHWKRGV UHTXLUHG WR LGHQWLI\ PXWDQWV RI LQWHUHVW ,W LV IRU WKHVH UHDVRQV WKDW D PRUH GLUHFW DSSURDFK IRU WKH FUHDWLRQ RI WHPSHUDWXUHVHQVLWLYH YLUXV PXWDQWV LQ VSHFLILF YLUDO JHQHV PXVW EH IRXQG 3UDFWLFDO DSSOLFDWLRQ RI GLUHFWHG JHQHWLFV WR D FRPSOH[ '1$ YLUXV VXFK DV YDFFLQLD UHTXLUHV DQ LQ YLWUR PXWDJHQHVLV VFKHPH ZKLFK SURGXFHV D KLJK SURSRUWLRQ RI FRQGLWLRQDOO\ OHWKDO PXWDQWV

PAGE 96

FRPELQHG ZLWK DQ HIILFLHQW PHWKRG IRU WDUJHWHG UHSODFHPHQW RI WKH ZLOGW\SH YLUDO JHQH ZLWK WKH PXWDQW DOOHOH 7KH REMHFW RI WKLV ZRUN ZDV WR GHWHUPLQH LI FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV DQG WUDQVLHQW GRPLQDQW VHOHFWLRQ FRXOG EH XVHG DV D SUDFWLFDO PHWKRG IRU WKH FUHDWLRQ RI FRQGLWLRQDOO\ OHWKDO WHPSHUDWXUHVHQVLWLYH YDFFLQLD YLUXV PXWDQWV &OXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV LQYROYHV UHSODFLQJ FOXVWHUV RI FKDUJHG DPLQR DFLGV LQ D SURWHLQ ZLWK DODQLQHV &KDUJHG UHVLGXHV ZKLFK DUH FOXVWHUHG LQ WKH SULPDU\ VHTXHQFH RI D SRO\SHSWLGH RIWHQ FDQQRW EH HIILFLHQWO\ DFFRPPRGDWHG LQ WKH K\GURSKRELF FRUH RI WKH SURWHLQ WKHUHIRUH WKH\ DUH PRVW OLNHO\ WR EH IRXQG RQ WKH VXUIDFH RI WKH IROGHG SURWHLQ f 7KH UHSODFHPHQW RI PXOWLSOH FKDUJHG UHVLGXHV ZLWK DODQLQHV KDV EHHQ VKRZQ WR GLVUXSW SURWHLQSURWHLQ LQWHUDFWLRQV LQ YLWUR ZKLOH QRW VHYHUHO\ DOWHULQJ SURWHLQ VHFRQGDU\ VWUXFWXUH f :KHQ WKLV DSSURDFK ZDV DSSOLHG WR WKH 6DFFKDURP\FHV FHUHYLVLDH DFWLQ $&7f JHQH RI PXWDWLRQV FRQVWUXFWHG b KDG D WHPSHUDWXUHVHQVLWLYH SKHQRW\SH LQ YLYR f /LNHZLVH FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV RI WKH SROLRYLUXV SRO\PHUDVH UHVXOWHG LQ D KLJK SURSRUWLRQ b RI

PAGE 97

PXWDQWVf RI WHPSHUDWXUHVHQVLWLYH PXWDQWV f 7KXV DOWHUDWLRQV RI D SURWHLQnV VXUIDFH FKDUJH PD\ GLVUXSW WHUWLDU\ RU TXDWHUQDU\ LQWHUDFWLRQV DQG UHVXOW LQ WHPSHUDWXUH VHQVLWLYLW\ LQ YLYR 9DFFLQLD KDV SURYHQ WR EH DQ H[FHOOHQW PRGHO V\VWHP IRU VWXG\LQJ WUDQVFULSWLRQ '1$ UHSOLFDWLRQ DQG WKH UHJXODWLRQ RI JHQH H[SUHVVLRQ f 7KH JHQRPH RI YDFFLQLD FRQVLVWV RI DSSUR[LPDWHO\ NLOREDVHV RI GRXEOHVWUDQGHG '1$ ZLWK FRYDOHQWO\ FORVHG HQGV 7KH SR[YLUXVHV DUH XQLTXH DPRQJ '1$ YLUXVHV LQ WKDW WKH\ UHSOLFDWH LQ WKH F\WRSODVP RI LQIHFWHG FHOOV f 7KXV WKH YLUXV HQFRGHV YLUWXDOO\ DOO RI WKH HQ]\PHV UHTXLUHG IRU YLUDO 51$ DQG '1$ PHWDEROLVP 1XPHURXV HQ]\PDWLF DFWLYLWLHV FRPPRQ WR RWKHU HXNDU\RWLF RUJDQLVPV KDYH EHHQ VKRZQ WR EH HQFRGHG E\ WKH YLUXV f *HQHWLF DQDO\VLV RI YDFFLQLD KDV SURYLGHG PDQ\ RI WKH WRROV QHFHVVDU\ IRU XQGHUVWDQGLQJ WKH YLUDO OLIH F\FOH 3UHYLRXV JHQHWLF VWXGLHV LQ WKH &RQGLW ODERUDWRU\ OHG WR WKH LVRODWLRQ RI FRQGLWLRQDOO\ OHWKDO WHPSHUDWXUHVHQVLWLYH PXWDWLRQV LQ VHSDUDWH YDFFLQLD YLUXV FRPSOHPHQWDWLRQ JURXSV f 7KHVH PXWDQWV KDYH SURYHQ YDOXDEOH IRU VWXG\LQJ DOO DVSHFWV RI YLUDO UHSOLFDWLRQ +RZHYHU YDFFLQLD FRGHV IRU DSSUR[LPDWHO\ HVVHQWLDO JHQHV WKHUHIRUH WKLV FROOHFWLRQ

PAGE 98

UHSUHVHQWV PXWDWLRQV LQ RQO\ b RI WKH HVVHQWLDO YLUXV JHQHV f $ GLUHFWHG JHQHWLF PHWKRG WKDW SURGXFHV FRQGLWLRQDOO\ OHWKDO WHPSHUDWXUHVHQVLWLYH PXWDWLRQV LQ VSHFLILF JHQHV ZRXOG DOORZ RQH WR JHQHWLFDOO\ VWXG\ PDQ\ RI WKH YLUDO JHQHV LQ ZKLFK WKHUH DUH QR FRQGLWLRQDOO\ OHWKDO PXWDQWV 5HVXOWV 7R HYDOXDWH WKH SRWHQWLDO RI FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV DV D PHDQV RI FUHDWLQJ FRQGLWLRQDOO\ OHWKDO YDFFLQLD YLUXVHV D VHULHV RI QLQH FOXVWHUHG FKDUJH WR DODQLQH PXWDWLRQV ZHUH FUHDWHG LQ WKH *5 JHQH )LJ f *5 ZDV FKRVHQ IRU WKH WHVW EHFDXVH PXWDWLRQV LQ WKLV JHQH FRQIHU HDVLO\ VHOHFWDEOH SKHQRW\SHV f WKXV FLUFXPYHQWLQJ WKH QHFHVVLW\ IRU VFUHHQLQJ ODUJH QXPEHUV RI LQGLYLGXDO SODTXH LVRODWHV WR GHWHUPLQH WKH SKHQRW\SH FRQIHUUHG E\ D SDUWLFXODU PXWDWLRQ 7KH VHOHFWLRQ LV EDVHG RQ WKH VHQVLWLYLW\ RI WKH YLUXV WR WKH DQWLSR[YLUDO GUXJ LVDWLQ%WKLRVHPLFDUED]RQH ,%7f $V VKRZQ LQ )LJ SODTXH IRUPDWLRQ E\ ZLOGW\SH YDFFLQLD YLUXV LV LQKLELWHG E\ ,%7 GHOHWLRQ PXWDQWV LQ *5 VXFK DV *$ DUH GHSHQGHQW

PAGE 99

)LJ 'HGXFHG DPLQR DFLG VHTXHQFH RI WKH YDFFLQLD YLUXV *5 JHQH SURGXFW DQG *5 PXWDQWV &KDUJHG UHVLGXHV DUH LQGLFDWHG E\ EROGIDFH W\SH /DUJH EROGIDFH W\SH GHQRWHV FKDUJHG UHVLGXHV PXWDWHG WR DODQLQH LQ D JLYHQ PXWDQW 7KH DPLQR DFLG FKDQJHV FRUUHVSRQGLQJ WR &WV *5f DQG *$ D ES GHOHWLRQIUDPHVKLIW VWDUWLQJ DW UHVLGXH f DUH GHVLJQDWHG DERYH WKH DSSURSULDWH UHVLGXHV $6 DQG $6 PXWDWLRQV DUH LQGLFDWHG E\ OLQHV DERYH DQG EHORZ WKH DPLQR DFLG VHTXHQFH UHVSHFWLYHO\ ZW ZLOG W\SH WV WHPSHUDWXUH VHQVLWLYH WGU WHPSHUDWXUH GHSHQGHQW ,%7 UHVLVWDQFH G ,%7 GHSHQGHQW r LQGLFDWHV WKH WHUPLQDWLRQ RI *5 LQ PXWDQW *$

PAGE 100

ZW WV f§ $" ` PSIUGOLOIQ OVNIOOW('( (VOHLYVVOF UJIHLV\GGO LW\IS'5.\+ .\LVNYIHKY GOV LL $6 WV ZW G $ M .&9 ,1r L/60() +'77/5'/9< /5/<.<6.&, 53&<./*'1/ WV &WV 5 .*,:, WV ZW $6 $6 ZW 5Q L\LUHDQGGO LH\OO.(\WS TL\W\VQ(5Y SLWJVNOLOF WGU :W $6 $6 *)6497)0$< ,76+,771.. 9'9/96..&, '(/9'3,1<4 ,/41/)'.*6 *7,1.,/5., )<697**473

PAGE 101

RQ ,%7 IRU JURZWK DQG D SUHYLRXVO\ LVRODWHG WHPSHUDWXUHVHQVLWLYH PXWDWLRQ ZKLFK PDSV WR *5 &WVf LV UHVLVWDQW WR ,%7 DW WKH SHUPLVVLYH WHPSHUDWXUH r&f DQG GHSHQGHQW XSRQ ,%7 DW WKH UHVWULFWLYH WHPSHUDWXUH R4 7KH IXQFWLRQ RI WKH *5 JHQH DQG WKH SUHFLVH PHFKDQLVP RI DFWLRQ RI ,%7 DUH XQNQRZQ 7KH SUHGLFWHG DPLQR DFLG VHTXHQFH RI WKH *5 JHQH LV VKRZQ LQ )LJ f )RU WKH PXWDJHQHVLV D FKDUJH FOXVWHU ZDV GHILQHG DV WZR RU PRUH FKDUJHG DPLQR DFLGV ZLWKLQ D ILYH DPLQR DFLG ZLQGRZ f :LWK WKH H[FHSWLRQ RI $6 HDFK RI WKH FKDUJHG UHVLGXHV LQ WKH ZLQGRZ ZHUH FKDQJHG WR DODQLQHV )RU WKH PXWDQW $6 ILYH FKDUJHG DPLQR DFLGV LQ D VL[ DPLQR DFLG ZLQGRZ ZHUH HDFK PXWDWHG WR DODQLQHV 0XWDWLRQV ZHUH HQJLQHHUHG LQWR D FORQHG FRS\ RI *5 XVLQJ ROLJRQXFOHRWLGH GLUHFWHG PXWDJHQHVLV DQG WKH PXWDQW *5 JHQHV ZHUH WKHQ LQVHUWHG LQWR WKH YLUDO FKURPRVRPH XVLQJ WUDQVLHQW GRPLQDQW VHOHFWLRQ f 6SHFLILFDOO\ LQGLYLGXDO PXWDQW *5 JHQHV ZHUH FORQHG LQWR D SODVPLG YHFWRU DGMDFHQW WR D FDVVHWWH FRQWDLQLQJ WKH (VFKHULFKLD FROL [DQWKLQH JXDQLQH SKRVSKRULERV\OWUDQVIHUDVH JHQH HFRJSWf ZKLFK LV XQGHU WKH WUDQVFULSWLRQDO FRQWURO RI D YDFFLQLD VSHFLILF SURPRWHU SNf 7KH SODVPLGV ZHUH WKHQ UHFRPELQHG LQWR WKH

PAGE 102

YDFFLQLD JHQRPH E\ WUDQVIHFWLRQ RI ZLOGW\SH YDFFLQLD YLUXV LQIHFWHG FHOOV 5HFRPELQDQW YLUXVHV UHVXOWLQJ IURP D VLQJOH FURVVRYHU HYHQW EHWZHHQ SODVPLG *5 VHTXHQFHV DQG KRPRORJRXV *5 VHTXHQFHV RQ WKH YLUDO FKURPRVRPH FRQWDLQ WKH HFRJSW FDVVHWWH IODQNHG E\ WZR FRSLHV RI *5 D PXWDQW FRS\ GHULYHG IURP WKH SODVPLG DQG WKH ZLOG W\SH FKURPRVRPDO FRS\ )LJ f ([SUHVVLRQ RI HFRJSW SURYLGHV WKHVH YLUXVHV ZLWK UHVLVWDQFH WR WKH SXULQH ELRV\QWKHVLV LQKLELWRU P\FRSKHQROLF DFLG 03$f WKXV UHFRPELQDQWV FDQ EH VHOHFWHG IRU E\ SODWLQJ WKH O\VDWH IURP WKH LQIHFWHG WUDQVIHFWHG FHOOV LQ WKH SUHVHQFH RI 03$ 'XULQJ WKH JURZWK RI HDFK 03$ UHVLVWDQW SODTXH UHVROXWLRQ RFFXUV YLD UHFRPELQDWLRQ EHWZHHQ WKH WZR JHQRPLF FRSLHV RI *5 UHVXOWLQJ LQ YLUXVHV ZKLFK KDYH ORVW WKH HFRJSW JHQH DQG FRQWDLQ RQO\ D VLQJOH FRS\ RI WKH *5 JHQH (DFK 03$ UHVLVWDQW SODTXH FRQVHTXHQWO\ FRQWDLQV D PL[WXUH RI YLUXVHV VRPH RI ZKLFK FRQWDLQ D PXWDQW FRS\ RI *5 GHULYHG IURP WKH WUDQVIHFWHG SODVPLG ZKLOH RWKHUV UHWDLQ D ZLOGW\SH FRS\ RI *5 $SSUR[LPDWHO\ b RI WKH YLUXVHV LQ HDFK SODTXH GR QRW UHVROYH GDWD QRW VKRZQf 7KHVH

PAGE 103

XQUHVROYHG YLUXVHV WKHUHIRUH UHWDLQ WKH HFRJSW JHQH DQG VHUYH D KHOSHU IXQFWLRQ IRU JURZWK RI UHVROYHG YLUXVHV LQ WKH SUHVHQFH RI 03$ 4XDQWLWDWLRQ RI 0XWDQW 3URJHQ\ LQ 03$ 5HVLVWDQW 3ODTXHV 7R GHWHUPLQH WKH HIILFLHQF\ RI WKH WUDQVLHQW GRPLQDQW VHOHFWLRQ SURWRFRO H[SHULPHQWV ZHUH FRQGXFWHG XVLQJ SODVPLGV FRQWDLQLQJ HLWKHU WKH ZLOGW\SH *5 JHQH RU WKH WHPSHUDWXUHVHQVLWLYH *5 DOOHOH &WV 7DEOH VKRZV WKH UHVXOWV RI SODWLQJ ILYH LQGHSHQGHQWO\ LVRODWHG 03$ UHVLVWDQW SODTXHV IURP HDFK WUDQVIHFWLRQ LQ WKH SUHVHQFH DQG DEVHQFH RI ,%7 DW r& DQG r& 0\FRSKHQROLF DFLG UHVLVWDQW SODTXHV LVRODWHG DIWHU WUDQVIHFWLRQ ZLWK D ZLOGW\SH FRS\ RI *5 FRQWDLQ QR ,%7 UHVLVWDQW YLUXVHV VKRZLQJ WKDW WKH EDFNJURXQG OHYHO RI VSRQWDQHRXV ,%7 UHVLVWDQFH LQ WKHVH H[SHULPHQWV ZDV QHJOLJLEOH 7UDQVIHFWLRQ ZLWK D SODVPLG FRQWDLQLQJ D NQRZQ WHPSHUDWXUHVHQVLWLYH PXWDQW RI *5 &WVf JHQHUDWHV 03$ UHVLVWDQW SODTXHV PRVW RI ZKLFK FRQWDLQ D SRSXODWLRQ RI ,%7 UHVLVWDQW YLUXVHV 7KH SHUFHQWDJH RI ,%7 UHVLVWDQW YLUXVHV FRQWDLQHG LQ LQGLYLGXDO 03$ UHVLVWDQW SODTXHV LV YDULDEOH 7KLV YDULDELOLW\ PRVW

PAGE 104

7DEOH 6FUHHQLQJ 03$ UHVLVWDQW SODTXHV IRU PXWDQW UHFRPELQDQWV SODVPLG '1$ WUDQVIHFWHG SODTXH ,%7 ,%7 ,%7 ,%7 b PXWDQWr ZLOG W\SH b b b b b &WV b b b b b $6 b b r b b b 7UDQVLHQW GRPLQDQW VHOHFWLRQ ZDV FDUULHG RXW ZLWK SODVPLGV FRQWDLQLQJ HLWKHU D ZLOG W\SH *5 JHQH &WV RU $6 )LYH 03$ UHVLVWDQW SODTXHV IURP HDFK WUDQVIHFWLRQ ZHUH WLWHUHG DW r& DQG r& LQ WKH SUHVHQFH DQG DEVHQFH RI ,%7 7KH GDWD VKRZQ LQGLFDWH WKH WRWDO QXPEHU RI SODTXHV SURGXFHG SHU FP GLVK XQGHU HDFK FRQGLWLRQ r 7KH SHUFHQW PXWDQW ZDV FDOFXODWHG E\ GLYLGLQJ WKH QXPEHU RI SODTXHV DW r& ,%7 E\ WKH QXPEHU RI SODTXHV DW r& ,%7 YR 21

PAGE 105

OLNHO\ UHIOHFWV WKH HIILFLHQF\ DQG WKH WLPLQJ RI WKH UHFRPELQDWLRQ HYHQW ZKLFK UHVROYHV WKH *5 JHQH GXSOLFDWLRQ )RU UHDVRQV QRW XQGHUVWRRG WKH DYHUDJH SHUFHQWDJH RI ,%7 UHVLVWDQW YLUXVHV REWDLQHG LQ WKLV H[SHULPHQW ZDV VRPHZKDW KLJKHU WKDQ LQ VXEVHTXHQW H[SHULPHQWV ZLWK PXWDQWV $6$6 VHH EHORZf ,%7 UHVLVWDQW SODTXHV UHVXOWLQJ IURP WKH &WV WUDQVLHQW GRPLQDQW VHOHFWLRQ ZHUH SODTXH SXULILHG JURZQ VXEMHFW WR '1$ VHTXHQFH DQDO\VLV WHVWHG IRU WHPSHUDWXUH DQG ,%7 VHQVLWLYLW\ DQG VKRZQ WR EH LQGLVWLQJXLVKDEOH IURP WKH RULJLQDO &WV YLUXV )LJV DQG f 7UDQVLHQW GRPLQDQW VHOHFWLRQ ZDV UHSHDWHG ZLWK SODVPLGV FRQWDLQLQJ *5 VHTXHQFHV FRUUHVSRQGLQJ WR WKH QLQH FOXVWHUHG FKDUJH WR DODQLQH PXWDQWV GHSLFWHG LQ )LJ 7UDQVLHQW GRPLQDQW VHOHFWLRQ GRQH ZLWK IRXU RI WKH PXWDQWV $6, $6 $6 $6f JHQHUDWHG D VLJQLILFDQW IUDFWLRQ RI ,%7 UHVLVWDQW YLUXVHV VLPLODU WR WKH UHVXOWV REWDLQHG ZLWK WKH &WV SODVPLG 7KH GDWD IURP D UHSUHVHQWDWLYH H[SHULPHQW ZLWK WKH $6 SODVPLG DUH VKRZQ LQ 7DEOH ,Q WKLV DQG VXEVHTXHQW H[SHULPHQWV SODTXH DVVD\V LQ WKH SUHVHQFH RI 03$ ZHUH LQFXEDWHG IRU ILYH GD\V UDWKHU WKDQ WKUHH GD\V DV LQ WKH ZLOGW\SH DQG &WV WUDQVIHFWLRQV WKHUHIRUH D ODUJHU WRWDO QXPEHU RI YLUXVHV

PAGE 106

FROXPQV ODEHOHG ,%7f ZDV UHFRYHUHG IURP WKHVH 03$ UHVLVWDQW SODTXHV ,Q WKH FRXUVH RI WKHVH H[SHULPHQWV D WRWDO RI 03$ UHVLVWDQW SODTXHV IURP WUDQVLHQW GRPLQDQW VHOHFWLRQ ZLWK &WV $6 $6 $6 RU $6 SODVPLGV ZHUH DVVD\HG 7KH IUDFWLRQ RI ,%7 UHVLVWDQW YLUXVHV LQ WKHVH 03$ UHVLVWDQW SODTXHV UDQJHG IURP b WR b DQG WKH DYHUDJH QXPEHU RI ,%7 UHVLVWDQW YLUXVHV IRU DOO 03$ UHVLVWDQW SODTXHV ZDV b 5HSHDWHG VHULDO SODTXH SXULILFDWLRQ RI 03$ UHVLVWDQW SODTXHV GRHV QRW VLJQLILFDQWO\ DOWHU WKH DYHUDJH QXPEHU RI ,%7 UHVLVWDQW YLUXVHV REVHUYHG GDWD QRW VKRZQf 03$ UHVLVWDQW SODTXHV LVRODWHG IURP ILYH RI WKHVH WUDQVIHFWLRQV $6 $6 $6 $6 DQG $6f \LHOGHG QR ,%7 UHVLVWDQW SURJHQ\ YLUXVHV DERYH EDFNJURXQG OHYHOV 7KH VLPSOHVW H[SODQDWLRQ IRU WKLV UHVXOW LV WKDW WKHVH PXWDWLRQV FRQIHU SKHQRW\SHV LQGLVWLQJXLVKDEOH IURP WKDW RI ZLOGW\SH YDFFLQLD 7KHVH PXWDWLRQV ZHUH QRW VWXGLHG IXUWKHU 3ODTXH )RUPDWLRQ EY &OXVWHUHG &KDUJH 7R $ODQLQH 0XWDQWV ,%7 UHVLVWDQW SODTXHV IURP WUDQVLHQW GRPLQDQW VHOHFWLRQV GRQH ZLWK $6, $6 $6 DQG $6 ZHUH UHSODTXH SXULILHG JURZQ DQG VXEMHFWHG WR DGGLWLRQDO SKHQRW\SLF DQDO\VLV 3ODTXH DVVD\V

PAGE 107

GHPRQVWUDWLQJ WKH SKHQRW\SHV RI WKHVH IRXU PXWDQWV DUH VKRZQ LQ )LJ 3UHYLRXV DQDO\VLV RI *5 PXWDQWV LQGLFDWHV WKDW VXEWOH GLIIHUHQFHV LQ YDFFLQLDnV UHVSRQVH WR ,%7 UHIOHFWV YDULDWLRQ LQ WKH DFWLYLW\ RI WKH *5 SURWHLQ SURGXFW f :KHUHDV YLUXVHV ZLWK ZLOG W\SH *5 DFWLYLW\ DUH VHQVLWLYH WR ,%7 DQG FRPSOHWH ORVV RI *5 IXQFWLRQ UHVXOWV LQ YLUXVHV ZKLFK DUH ,%7 GHSHQGHQW UHVLVWDQFH WR ,%7 PRVW OLNHO\ UHIOHFWV LQWHUPHGLDWH OHYHOV RI *5 DFWLYLW\ 7KXV WKH UHVLVWDQFH RI &WV WR ,%7 DW r& LQGLFDWHV WKDW LW LV VRPHZKDW FRPSURPLVHG IRU *5 IXQFWLRQ HYHQ XQGHU SHUPLVVLYH FRQGLWLRQV :LWK WKLV SHUVSHFWLYH LQ PLQG LW LV DSSDUHQW WKDW $6, $6 $6 $6 HDFK GLVSOD\ WHPSHUDWXUHVHQVLWLYH *5 IXQFWLRQ DV GHWDLOHG EHORZ )XUWKHUPRUH FRPSDULVRQ RI WKH PXWDQWV UHYHDOV D JUDGLHQW RI *5 WHPSHUDWXUH VHQVLWLYLW\ ZKHUH $6 LV WKH PRVW WHPSHUDWXUH VHQVLWLYH IROORZHG LQ RUGHU E\ $6 $6 DQG $6 $6 LV UHVLVWDQW WR ,%7 DW r& DQG ,%7 GHSHQGHQW DW r& WKXV *5 IXQFWLRQ LQ $6 LV FRPSURPLVHG DW r& DQG DEVHQW DW r& FRPSDUDEOH WR &WV %\ FRQWUDVW WR &WV PLQXWH SODTXHV EHFRPH YLVLEOH DIWHU SURORQJHG LQFXEDWLRQ RI $6 DW R& LQ WKH DEVHQFH RI ,%7 GDWD QRW VKRZQf $6 LV ,%7 UHVLVWDQW DW ERWK r& DQG r& EXW WKH UHODWLYH SODTXH

PAGE 108

)LJ 3ODTXH IRUPDWLRQ RI *5 FOXVWHUHG FKDUJH WR DODQLQH PXWDQW YLUXVHV 3ODTXH DVVD\V ZHUH LQFXEDWHG LQ WKH SUHVHQFH RI Q0 ,%7 RU LQ WKH DEVHQFH RI GUXJ DW r& DQG r& IRU RQH ZHHN DQG VWDLQHG ZLWK FU\VWDO YLROHW

PAGE 109

r,%7 r,%7 *$ &WV $6 r,%7 r,%7 $6 r,%7 r,%7 r,%7 r,%7 $6

PAGE 110

VL]HV LQ WKH SUHVHQFH DQG DEVHQFH RI ,%7 DW WKH WZR WHPSHUDWXUHV DUH GLIIHUHQW $W !& $6 IRUPV ODUJHU SODTXHV LQ WKH DEVHQFH UDWKHU WKDQ LQ WKH SUHVHQFH RI ,%7 ZKHUHDV DW r& $6 IRUPV VPDOOHU SODTXHV LQ WKH DEVHQFH RI ,%7 UDWKHU WKHQ LQ WKH SUHVHQFH RI ,%7 7KXV *5 IXQFWLRQ LQ $6 LV FRPSURPLVHG DW ERWK WHPSHUDWXUHV EXW WKH GHIHFW LV PRUH SURQRXQFHG DW r& WKDQ DW !& 7KH PXWDQWV $6 DQG $6 ERWK GLVSOD\ WHPSHUDWXUH GHSHQGHQW ,%7 UHVLVWDQFH WKDW LV WKH\ DUH VHQVLWLYH WR ,%7 DW r& DQG UHVLVWDQW WR ,%7 DW r& &ORVH LQVSHFWLRQ RI $6 DQG $6 UHYHDOV VXEWOH GLIIHUHQFHV LQ SODTXH VL]H XQGHU WKH YDULRXV FRQGLWLRQV WHVWHG )RU H[DPSOH LQ WKH DEVHQFH RI ,%7 $6 SURGXFHV FRPSDUDEO\ VL]HG SODTXHV DW R& DQG R& KRZHYHU DW R& LW SURGXFHV VOLJKWO\ ODUJHU SODTXHV LQ WKH SUHVHQFH RI ,%7 WKDQ LW GRHV LQ WKH DEVHQFH RI GUXJ ,Q FRQWUDVW LQ WKH DEVHQFH RI ,%7 $6 SURGXFHV ODUJHU SODTXHV DW r& FRPSDUHG WR r& DQG DW r& LW SURGXFHV VPDOOHU SODTXHV LQ WKH SUHVHQFH RI ,%7 WKDQ LW GRHV LQ WKH DEVHQFH RI GUXJ 7KHVH UHVXOWV LQGLFDWH WKDW LQ ERWK PXWDQWV *5 IXQFWLRQ LV QRUPDO DW m& DQG FRPSURPLVHG DW r& DQG WKDW WKH GHIHFW LQ *5 IXQFWLRQ DW & LV PRUH SURQRXQFHG LQ $6 WKDQ LQ $6 ,W LV QRWHZRUWK\ WKDW LQ WKH DEVHQFH RI ,%7 DW m& SODTXH

PAGE 111

IRUPDWLRQ E\ $6 LV LQGLVWLQJXLVKDEOH IURP ZLOGW\SH YLUXV ZKHUHDV SODTXH IRUPDWLRQ E\ $6, $6 DQG $6 LV LQ HDFK FDVH PHDVXUDEO\ GHIHFWLYH UHODWLYH WR ZLOGW\SH YLUXV 2QH 6WHS *URZWK ([SHULPHQWV 2QH VWHS JURZWK H[SHULPHQWV ZHUH SHUIRUPHG WR IXUWKHU FKDUDFWHUL]H WKH SKHQRW\SHV RI WKH FOXVWHUHG FKDUJH WR DODQLQH PXWDQWV $6, $6 $6 DQG $6 DQG FRPSDUH WKHP WR ZLOGW\SH YLUXV DQG &WV )LJ f :LOGW\SH YLUXV JURZQ DW !& RU !& VKRZV D EXUVW VL]H EHWZHHQ SODTXH IRUPLQJ XQLWV SHU FHOO ZLWK PD[LPXP \LHOGV RFFXUULQJ DW KRXUV SRVW LQIHFWLRQ :KHQ JURZQ DW !& DOO RI WKH PXWDQWV SURGXFH QRUPDO DPRXQWV RI LQIHFWLRXV YLUXV ZLWK NLQHWLFV VLPLODU WR WKDW RI ZLOGW\SH YLUXV $W }& WKH JURZWK RI $6 LV LQGLVWLQJXLVKDEOH IURP ZLOGW\SH YLUXV $W }& $6, $6 $6 DUH XQDEOH WR SURGXFH VLJQLILFDQW OHYHOV RI LQIHFWLRXV SURJHQ\ YLUXV LGHQWLFDO WR &WV 7KHVH GDWD GHPRQVWUDWH WKDW WKH FOXVWHUHG FKDUJH WR DODQLQH PXWDQWV $6, $6 DQG $6 DUH WHPSHUDWXUHVHQVLWLYH IRU JURZWK ,W LV LQWHUHVWLQJ WKDW LQ WKLV DVVD\ $6 DQG $6 DSSHDU DV WHPSHUDWXUHVHQVLWLYH IRU JURZWK DV ERWK

PAGE 112

)LJ 2QH VWHS JURZWK H[SHULPHQWV RI ZLOG W\SH DQG *5 PXWDQW YLUXVHV 2QH VWHS JURZWK H[SHULPHQWV ZHUH GRQH DW DQ PRL RI XQGHU ERWK SHUPLVVLYH DQG QRQSHUPLVVLYH FRQGLWLRQV 6DPSOHV ZHUH WDNHQ DW YDULRXV WLPHV SRVW LQIHFWLRQV DQG WLWHUHG XQGHU SHUPLVVLYH FRQGLWLRQV ‘ r& f r&

PAGE 113

KRXUV SRVW LQIHFWLRQ

PAGE 114

&WV DQG $6, HYHQ WKRXJK WKH\ IRUP SODTXHV DW r& )LJ f 7KH PRVW OLNHO\ H[SODQDWLRQ IRU WKLV ILQGLQJ LV WKDW D YHU\ ORZ \LHOG RI YLUXV XQGHWHFWDEOH LQ D RQH VWHS JURZWK H[SHULPHQW PD\ EH VXIILFLHQW IRU SODTXH IRUPDWLRQ 0DUNHU 5HVFXH RI $6 DQG &WV 7R SURYH JHQHWLFDOO\ WKDW WKH $6 OHVLRQ LQ *5 ZDV UHVSRQVLEOH IRU WKH YLUXVf FRQGLWLRQDO OHWKDOLW\ PDUNHU UHVFXH H[SHULPHQWV ZHUH FDUULHG RXW ZLWK $6 DQG WKH FRQWURO YLUXV &WV )LJ f &HOOV LQIHFWHG ZLWK HLWKHU $6 RU &WV ZHUH WUDQVIHFWHG ZLWK WKH YDFFLQLD YLUXV +LQG,,, IUDJPHQW RU S*5DS DQ 0O FORQH FRQWDLQLQJ RQO\ WKH *5 RSHQ UHDGLQJ IUDPH DQG LQFXEDWHG XQGHU QRQSHUPLVVLYH FRQGLWLRQV R& ,%7f 7KH JURZWK GHIHFW RI $6 DQG &WV DW m& FDQ EH UHVFXHG E\ WUDQVIHFWLQJ LQWR WKH LQIHFWHG FHOO '1$ FRQWDLQLQJ D ZLOGW\SH FRS\ RI HLWKHU WKH HQWLUH +LQG,,, IUDJPHQW RU MXVW WKH *5 RSHQ UHDGLQJ IUDPH 5HVFXH RI WKH WHPSHUDWXUHVHQVLWLYH SKHQRW\SH PRVW OLNHO\ RFFXUV E\ KRPRORJRXV UHFRPELQDWLRQ RI WKH WUDQVIHFWHG '1$ ZLWK WKH PXWDQW YLUDO FKURPRVRPH KRZHYHU QR DWWHPSW ZDV PDGH WR SURYH WKDW WKH YLUXVHV JURZLQJ DW r& FRQWDLQ

PAGE 115

)LJ 0DUNHU UHVFXH RI *5 PXWDQWV $6 DQG &WV &HOOV ZHUH LQIHFWHG ZLWK $6 RU &WV WUDQVIHFWHG ZLWK FDOFLXP SKRVSKDWH SUHFLSLWDWHG '1$ LQFXEDWHG DW r& IRU GD\V DQG VWDLQHG ZLWK FU\VWDO YLROHW ,QIHFWHG FHOOV ZHUH PRFN WUDQVIHFWHG QR '1$f WUDQVIHFWHG ZLWK D IXOO OHQJWK +LQG,,, IUDJPHQW +LQG,,, *f RU DQ POPSO FORQH FRQWDLQLQJ RQO\ WKH *5 RSHQ UHDGLQJ IUDPH S*5DSf %HORZ D +LQG,,, UHVWULFWLRQ PDS RI WKH YDFFLQLQD YLUXV FKURPRVRPH VKRZLQJ WKH SRVLWLRQ DQG WKH WUDQVFULSWLRQDO RULHQWDWLRQ RI WKH JHQHV ZLWKLQ WKH +LQG,,, IUDJPHQW _Pc UHODWLYH PDS SRVLWLRQ RI WKH +LQG,,, IUDJPHQW XVHG LQ WKH PDUNHU UHVFXH H[SHULPHQWV JJJM UHODWLYH PDS SRVLWLRQ RI WKH S*5DS FORQH XVHG LQ WKH PDUNHU UHVFXH H[SHULPHQWV

PAGE 116

1R '1$ +LQGOOO &WV S*5DS & 10.) (2,*/-+ ,,, , ,,, , , ,W7NE [ A A +LQGOOO S*5DS n6666*5 *5 *5 *5 *5 */ */*/ */

PAGE 117

D ZLOGW\SH FRS\ RI WKH *5 JHQH 7KH VLPSOHVW LQWHUSUHWDWLRQ RI WKHVH GDWD LV WKDW WKH PXWDWLRQ UHVSRQVLEOH IRU WHPSHUDWXUH VHQVLWLYLW\ LQ $6 DQG DOVR &WV PDSV WR WKH *5 RSHQ UHDGLQJ IUDPH 3ODTXHV VHHQ LQ WKH DEVHQFH RI WUDQVIHFWHG '1$ LQ WKH &WV H[SHULPHQW PRVW OLNHO\ UHSUHVHQW UHYHUWDQWV RI &WV ZKLFK KDYH ORVW WKHLU WHPSHUDWXUH VHQVLWLYLW\ 'LVFXVVLRQ 7KLV VWXG\ KDV GHPRQVWUDWHG WKDW WHPSHUDWXUHVHQVLWLYH FRQGLWLRQDOO\ OHWKDO PXWDQWV FDQ EH FUHDWHG LQ D VSHFLILF YDFFLQLD YLUXV JHQH *5 ZLWK KLJK HIILFLHQF\ XVLQJ FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV DQG WUDQVLHQW GRPLQDQW VHOHFWLRQ 7KH \LHOG RI WHPSHUDWXUHVHQVLWLYH PXWDQWV LV FRPSDUDEOH WR H[SHULPHQWV GRQH ZLWK WKH \HDVW DFWLQ JHQH f DQG WKH SROLRYLUXV SRO\PHUDVH f 2I QLQH FOXVWHUHG FKDUJH WR DODQLQH PXWDQWV WHVWHG IRXU bf GLVSOD\HG VRPH GHJUHH RI WHPSHUDWXUH VHQVLWLYLW\ LQ D SODTXH DVVD\ DV HYLGHQFHG E\ SODTXH VL]H RU E\ DQ DOWHUHG UHVSRQVH WR WKH DQWLSR[YLUDO GUXJ ,%7 7KUHH RI WKH PXWDQWV bf ZHUH FOHDUO\

PAGE 118

FRQGLWLRQDOO\ OHWKDO IRU JURZWK DW !& LQ D VLQJOH VWHS JURZWK H[SHULPHQW 6LQFH ELRFKHPLFDO H[SHULPHQWV ZLWK WHPSHUDWXUH VHQVLWLYH PXWDQWV DUH XVXDOO\ GRQH XQGHU FRQGLWLRQV RI LQIHFWLRQ LGHQWLFDO WR WKRVH XVHG IRU D RQH VWHS JURZWK H[SHULPHQW WKH WKUHH PXWDQWV ZKLFK DUH WHPSHUDWXUHVHQVLWLYH LQ D RQH VWHS JURZWK H[SHULPHQW VKRXOG EH VXLWDEOH IRU ELRFKHPLFDO DQDO\VLV RI *5 JHQH IXQFWLRQ LQ YLYR 7KH H[SHULPHQWV ZLWK *5 VXJJHVW D JHQHUDO SURWRFRO IRU LVRODWLRQ RI WHPSHUDWXUHVHQVLWLYH PXWDQWV LQ JHQHV IRU ZKLFK WKHUH LV QR VHOHFWLRQ 0\FRSKHQROLF DFLG UHVLVWDQW SODTXHV LVRODWHG DIWHU WUDQVLHQW GRPLQDQW VHOHFWLRQ FRQWDLQ DSSUR[LPDWHO\ b PXWDQW YLUXVHV ZLWK IUHTXHQFLHV UDQJLQJ IURP b b ZKHQ LQGLYLGXDO 03$ UHVLVWDQW SODTXHV DUH FRPSDUHG 7KHUHIRUH WR VFUHHQ IRU WHPSHUDWXUHVHQVLWLYH PXWDQWV XVLQJ WUDQVLHQW GRPLQDQW VHOHFWLRQ DW OHDVW WRWDO YLUXVHV LVRODWHG IURP DW OHDVW GLIIHUHQW 03$ UHVLVWDQW SODTXHV VKRXOG EH WHVWHG IRU WHPSHUDWXUH VHQVLWLYLW\ LQ D SODTXH DVVD\ $Q\ YLUXV ZKLFK VKRZV UHGXFHG SODTXH VL]H DW !& KDV WKH SRWHQWLDO WR EH WHPSHUDWXUHVHQVLWLYH LQ D RQH VWHS JURZWK

PAGE 119

H[SHULPHQW 7KLV SURWRFRO KDV EHHQ VXFFHVVIXOO\ WHVWHG E\ LVRODWLQJ WKH $6 YLUXV PXWDQW ZLWKRXW XVLQJ ,%7 VHOHFWLRQ GDWD QRW VKRZQf 7KH FRPELQDWLRQ RI FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV DQG WUDQVLHQW GRPLQDQW VHOHFWLRQ SURYLGHV SR[YLURORJLVWV ZLWK D SRZHUIXO WRRO IRU WKH WDUJHWHG FRQVWUXFWLRQ RI WHPSHUDWXUHVHQVLWLYH FRQGLWLRQDOO\ OHWKDO YDFFLQLD YLUXV PXWDQWV ,W VKRXOG WKHUHIRUH QRZ EH SRVVLEOH WR FUHDWH FRQGLWLRQDO OHWKDO PXWDWLRQV LQ JHQHV WKDW KDYH XQWLO QRZ SURYHG UHIUDFWLOH WR VWDQGDUG JHQHWLF WHFKQLTXHV

PAGE 120

&+$37(5 &216758&7,21 $1' &+$5$&7(5,=$7,21 2) $ 129(/ &21',7,21$/ /(7+$/ 087$17 ,1 7+( /$5*( 68%81,7 2) 7+( 9$&&,1,$ 9,586 P51$ &$33,1* (1=<0( ,QWURGXFWLRQ 9DFFLQLD DQ RUWKRSR[YLUXV LV D ODUJH GRXEOHVWUDQGHG '1$ YLUXV WKDW UHSOLFDWHV LQ WKH F\WRSODVP RI LQIHFWHG FHOOV f 2QH FRQVHTXHQFH RI F\WRSODVPLF UHSOLFDWLRQ LV WKDW WKH YLUXV PXVW HQFRGH PRVW RI WKH JHQHWLF LQIRUPDWLRQ QHFHVVDU\ IRU '1$ UHSOLFDWLRQ DQG FRQWUROOHG JHQH H[SUHVVLRQ 9DFFLQLD JHQH H[SUHVVLRQ ZKLFK LV UHJXODWHG SULPDULO\ DW WKH OHYHO RI WUDQVFULSWLRQ RFFXUV LQ D FDVFDGH ZKLFK FRQVLVWV RI WKUHH WHPSRUDOO\ GLVWLQFW SKDVHV HDUO\ LQWHUPHGLDWH DQG ODWH UHYLHZHG LQ f 7KH FRQWURO RI WUDQVFULSWLRQ IURP HDFK FODVV RI JHQHV LV PRGXODWHG E\ FODVVVSHFLILF FLV DQG WUDQV DFWLQJ IDFWRUV UHYLHZHG LQ f 6SHFLILFDOO\ HDUO\ JHQHV DUH

PAGE 121

WUDQVFULEHG E\ HQ]\PHV SDFNDJHG ZLWKLQ WKH YLULRQ D VXEVHW RI HDUO\ SURWHLQV WKHQ DFW DV WUDQVFULSWLRQ IDFWRUV IRU LQWHUPHGLDWH JHQHV D VXEVHW RI ZKLFK WKHQ VHUYH DV WUDQVFULSWLRQ IDFWRUV IRU ODWH JHQH H[SUHVVLRQ 7KH FDVFDGH LV FRPSOHWHG E\ WKH SDFNDJLQJ ZLWKLQ WKH GHYHORSLQJ YLULRQ RI WKH WUDQVFULSWLRQDO PDFKLQHU\ QHHGHG IRU HDUO\ JHQH H[SUHVVLRQ $Q DGGLWLRQDO OHYHO RI FRQWURO LV SURYLGHG E\ YLUDO '1$ UHSOLFDWLRQ ZKLFK LV UHTXLUHG IRU WKH WUDQVFULSWLRQ RI ERWK LQWHUPHGLDWH DQG ODWH JHQHV f 7KH YDFFLQLD JHQRPH FRQVLVWV RI NLOREDVHV RI GRXEOH VWUDQGHG FRYDOHQWO\ FORVHG OLQHDU '1$ f 2I WKH SURWHLQV HQFRGHG E\ WKH YLUDO JHQRPH WZR RI WKH PRVW LQWHUHVWLQJ IRUP WKH KHWHURGLPHULF P51$ FDSSLQJ HQ]\PH 7KH YDFFLQLD P51$ FDSSLQJ HQ]\PH FRQVLVWV RI D N'D ODUJH VXEXQLW WKH SURGXFW RI WKH ',5 JHQH DQG D N'D VPDOO VXEXQLW HQFRGHG E\ WKH '/ JHQH f 7KH YDFFLQLD YLUXV P51$ FDSSLQJ HQ]\PH LV RI SDUWLFXODU LQWHUHVW EHFDXVH LQ DGGLWLRQ WR LWV UROH LQ FDSSLQJ P51$ LW DOVR IXQFWLRQV DV DQ HDUO\ JHQH WUDQVFULSWLRQ WHUPLQDWLRQ IDFWRU DQG DQ LQWHUPHGLDWH JHQH WUDQVFULSWLRQ LQLWLDWLRQ IDFWRU f

PAGE 122

7KH P51$ FDSSLQJ HQ]\PH FRQYHUWV WKH f WULSKRVSKRU\ODWHG HQG RI P51$ WR D FDS VWUXFWXUH LQ D VHULHV RI UHDFWLRQV ZKLFK UHTXLUH P51$ WULSKRVSKDWDVH JXDQ\OWUDQVIHUDVH DQG JXDQLQH fPHWK\OWUDQVIHUDVH HQ]\PDWLF DFWLYLWLHV f 7KH P51$ WULSKRVSKDWDVH DQG JXDQ\OWUDQVIHUDVH GRPDLQV KDYH EHHQ PDSSHG WR D N'D DPLQR WHUPLQDO SURWHRO\WLF IUDJPHQW RI WKH ODUJH VXEXQLW ',5f f 7KH JXDQLQHfPHWK\OWUDQVIHUDVH DFWLYLW\ LV FRQWDLQHG ZLWKLQ D VWDEOH KHWHURGLPHU IRUPHG EHWZHHQ WKH FDUER[\O WHUPLQDO SURWHRO\WLF IUDJPHQW RI ',5 DQG WKH '/ SURWHLQ f 7KH VWUXFWXUH RI WKH f FDS RQ HXNDU\RWLF P51$ LV KLJKO\ FRQVHUYHG DQG UHTXLUHG IRU RSWLPDO WUDQVODWLRQDO FRPSHWHQF\ DQG P51$ VWDELOLW\ UHYLHZHG LQ f 7KH YDFFLQLD FDSSLQJ HQ]\PH DOVR IXQFWLRQV DV DQ HDUO\ JHQH WUDQVFULSWLRQ WHUPLQDWLRQ IDFWRU f 7UDQVFULSWLRQ RI HDUO\ YLUDO JHQHV JHQHUDWHV P51$V ZKLFK DUH KRPRJHQHRXV LQ OHQJWK GXH WR VSHFLILF VLWHV RI WUDQVFULSWLRQ LQLWLDWLRQ DQG WHUPLQDWLRQ (DUO\ WUDQVFULSWLRQ WHUPLQDWLRQ UHTXLUHV WKH YDFFLQLD YLUXV P51$ FDSSLQJ HQ]\PH DQG WKH FLVDFWLQJ VHTXHQFH 8888818 LQ WKH QDVFHQW WUDQVFULSW f ,Q D SURFHVV ZKLFK LV QRW FRPSOHWHO\

PAGE 123

XQGHUVWRRG WKH FDSSLQJ HQ]\PH FDWDO\]HV WKH WHUPLQDWLRQ RI WUDQVFULSWLRQ QXFOHRWLGHV GRZQVWUHDP RI WKH VHTXHQFH 8888818 f $OWKRXJK D VSHFLILF WUDQVFULSWLRQ WHUPLQDWLRQ GRPDLQ KDV QRW \HW EHHQ LGHQWLIHG WHUPLQDWLRQ UHTXLUHV DQ LQWDFW IXOO OHQJWK KHWHURGLPHU DQG LV LQGHSHQGHQW RI P51$ FDS IRUPDWLRQ f ,QWHUHVWLQJO\ GLVFUHWH WHUPLQDWLRQ RI LQWHUPHGLDWH DQG ODWH WUDQVFULSWLRQ GRHV QRW RFFXU WKLV UHVXOWV LQ WKH IRUPDWLRQ RI P51$V ZKLFK DUH KHWHURJHQHRXV LQ OHQJWK DW WKHLU f HQGV f 7KH YDFFLQLD P51$ FDSSLQJ HQ]\PH KDV DOVR EHHQ VKRZQ WR EH UHTXLUHG IRU WKH LQLWLDWLRQ RI LQWHUPHGLDWH JHQH WUDQVFULSWLRQ f $ VWDEOH FRPSOH[ IRUPV EHWZHHQ WKH FDSSLQJ HQ]\PH DQG WKH YLUDO 51$ SRO\PHUDVH f &RPSOH[ IRUPDWLRQ LV QHFHVVDU\ SULRU WR ELQGLQJ RI WKH SRO\PHUDVH DW WKH LQWHUPHGLDWH SURPRWHU f 7KH GRPDLQ UHVSRQVLEOH IRU WKH LQWHUDFWLRQ RI WKH P51$ FDSSLQJ HQ]\PH ZLWK YDFFLQLD 51$ SRO\PHUDVH LV XQNQRZQ KRZHYHU WKH WUDQVFULSWLRQ LQLWLDWLRQ DFWLYLW\ DVFULEHG WR WKH FDSSLQJ HQ]\PH UHTXLUHV DQ LQWDFW IXOO OHQJWK KHWHURGLPHU DQG LV LQGHSHQGHQW RI P51$ FDSSLQJ f

PAGE 124

$ORQJ ZLWK LWV UROH LQ FDSSLQJ P51$ HDUO\ P51$ WHUPLQDWLRQ DQG LQWHUPHGLDWH P51$ LQLWLDWLRQ WKH YDFFLQLD FDSSLQJ HQ]\PH KDV DOVR EHHQ JHQHWLFDOO\ LPSOLFDWHG LQ WKH UHVROXWLRQ RI YLUDO WHORPHUHV GXULQJ ODWH VWDJHV RI LQIHFWLRQ f 7KH WHUPLQL RI WKH YDFFLQLD YLUXV FKURPRVRPH FRQVLVW RI LQFRPSOHWHO\ EDVH SDLUHG KDLUSLQ ORRSV WHUPHG IOLS DQG IORS UHYLHZHG LQ f 7KH VHTXHQFHV RI IOLS DQG IORS DUH LQYHUVH DQG FRPSOHPHQWDU\ ZLWK UHVSHFW WR HDFK RWKHU '1$ UHSOLFDWLRQ SURFHHGV YLD FRQFDWDPHULF LQWHUPHGLDWHV WKDW DUH MRLQHG WRJHWKHU LQ D KHDG WR KHDG RU WDLO WR WDLO IDVKLRQ UHYLHZHG LQ f 7KH MXQFWLRQV EHWZHHQ JHQRPHV FRQVLVWV RI D GXSOH[ FRS\ RI WKH KDLUSLQ ORRS WKDW LV IOLS DQG IORS EDVH SDLUHG ZLWK HDFK RWKHU 5HVROXWLRQ RI WKH FRQFDWDPHU LQWR XQLW OHQJWK JHQRPHV D SURFHVV NQRZQ DV WHORPHUH UHVROXWLRQ LQYROYHV DQ XQFKDUDFWHUL]HG VLWH VSHFLILF UHFRPELQDWLRQ HYHQW WKDW UHFRQVWLWXWHV WKH WHUPLQDO KDLUSLQ ORRSV UHYLHZHG LQ f 7HORPHUH UHVROXWLRQ LV GHSHQGHQW XSRQ WZR LQYHUWHG FRSLHV RI D FLVDFWLQJ WHORPHUH UHVROXWLRQ WDUJHW f 2QH FRS\ RI HDFK WHORPHUH UHVROXWLRQ WDUJHW LV ORFDWHG RQ HLWKHU VLGH RI WKH FRQFDWDPHU MXQFWLRQ 7KH WHORPHUH UHVROXWLRQ WDUJHW KDV EHHQ VKRZQ WR IXQFWLRQ DV D YLUDO SURPRWHU GXULQJ WKH ODWH VWDJHV RI WKH

PAGE 125

YLUDO LQIHFWLRQ LPSO\LQJ WKDW WUDQVFULSWLRQ PD\ SOD\ D UROH LQ WKH UHVROXWLRQ SURFHVV f ,Q DGGLWLRQ WHPSHUDWXUHVHQVLWLYH YDFFLQLD YLUXV PXWDQWV ZKLFK DUH GHIHFWLYH LQ ODWH JHQH H[SUHVVLRQ DUH DOVR GHIHFWLYH LQ WKH UHVROXWLRQ RI YLUDO WHORPHUHV ZKLFK LPSOLHV WKDW D ODWH SURWHLQ RU SURWHLQVf LV UHVSRQVLEOH IRU UHVROXWLRQ f ,QWHUHVWLQJO\ D WHPSHUDWXUHVHQVLWLYH PXWDWLRQ ZKLFK KDV EHHQ PDSSHG WR WKH VPDOO VXEXQLW RI WKH YDFFLQLD YLUXV P51$ FDSSLQJ HQ]\PH JHQH '/ H[KLELWV VHHPLQJO\ QRUPDO SURWHLQ DQG '1$ V\QWKHVLV XQGHU QRQSHUPLVVLYH FRQGLWLRQV EXW LV XQDEOH WR UHVROYH YLUDO WHORPHUHV DW WKH QRQSHUPLVVLYH WHPSHUDWXUH f $OWKRXJK WKH SKHQRW\SH RI WKLV PXWDQW JHQHWLFDOO\ LPSOLFDWHV WKH P51$ FDSSLQJ HQ]\PH LQ WHORPHUH UHVROXWLRQ WKHUH LV QR GLUHFW ELRFKHPLFDO HYLGHQFH WKDW WKH YDFFLQLD FDSSLQJ HQ]\PH SDUWLFLSDWHV GLUHFWO\ LQ WKH UHVROXWLRQ RI YLUDO WHORPHUHV 0RVW RI WKH LQIRUPDWLRQ DYDLODEOH RQ WKH FDSSLQJ HQ]\PH LV GHULYHG IURP LQ YLWUR DQDO\VLV RI HQ]\PH LVRODWHG IURP WKH YLULRQ RU IURP EDFWHULD H[SUHVVLQJ UHFRPELQDQW FDSSLQJ HQ]\PH ,Q DQ HIIRUW WR XQGHUVWDQG WKH ELRORJLFDO UROH FDSSLQJ HQ]\PH SOD\V LQ YLYR GXULQJ WKH FRXUVH RI D YDFFLQLD YLUXV LQIHFWLRQ FOXVWHUHG FKDUJH WR

PAGE 126

DODQLQH PXWDJHQHVLV DQG WUDQVLHQW GRPLQDQW VHOHFWLRQ ZHUH XVHG WR JHQHUDWH YDFFLQLD YLUXVHV FRQWDLQLQJ WHPSHUDWXUHVHQVLWLYH OHVLRQV LQ WKH ODUJH VXEXQLW RI WKH YDFFLQLD YLUXV P51$ FDSSLQJ HQ]\PH 5HVXOWV 'RPDLQ 6WUXFWXUH DQG $PLQR $FLG 6HTXHQFH RI ',5 7KH DPLQR DFLG VHTXHQFH DQG WKH GRPDLQ VWUXFWXUH RI WKH ',5 SURWHLQ WKH ODUJH VXEXQLW RI WKH KHWHURGLPHULF YDFFLQLD YLUXV P51$ FDSSLQJ HQ]\PH LV VKRZQ LQ )LJ 7KH ',5 SURWHLQ FRQWDLQV WKH DFWLYH VLWHV IRU 51$ WULSKRVSKDWDVH JXDQ\OWUDQVIHUDVH DQG JXDQLQH fPHWK\OWUDQVIHUDVH HQ]\PDWLF DFWLYLWLHV f *XDQ\OWUDQVIHUDVH DQG 51$ WULSKRVSKDWDVH DFWLYH VLWHV KDYH EHHQ ORFDOL]HG WR DQ DPLQR WHUPLQDO N'D SURWHRO\WLF IUDJPHQW RI ',5 f 7KH JXDQ\OWUDQVIHUDVH GRPDLQ KDV EHHQ IXUWKHU GHILQHG DV HQFRPSDVVLQJ WKH DPLQR WHUPLQDO DPLQR DFLGV RI ',5 'XULQJ WKH JXDQ\OWUDQVIHUDVH UHDFWLRQ D FRYDOHQW HQ]\PH LQWHUPHGLDWH IRUPV EHWZHHQ O\VLQH DQG *03 LPSOLFDWLQJ WKLV DPLQR DFLG LQ

PAGE 127

WKH JXDQ\OWUDQVIHUDVH DFWLYH VLWH f &RH[SUHVVLRQ LQ EDFWHULD RI D SODVPLG ZKLFK HQFRGHV DPLQR DFLGV RI ',5 DQG D IXOO OHQJWK '/ SURWHLQ UHVXOWV LQ WKH IRUPDWLRQ RI D VWDEOH KHWHURGLPHU FDSDEOH RI ZLOGW\SH OHYHOV RI PHWK\OWUDQVIHUDVH DFWLYLW\ +RZHYHUORZ OHYHOV RI PHWK\OWUDQVIHUDVH DFWLYLW\ KDYH EHHQ GHWHFWHG E\ H[SUHVVLRQ RI RQO\ DPLQR DFLGV RI ',5 f 7KHUHIRUH WKH FDUER[\O WHUPLQDO DPLQR DFLGV RI ',5 EHWZHHQ DPLQR DFLGV FRQWDLQV WKH JXDQLQHfPHWK\OWUDQVIHUDVH DFWLYH VLWH DV ZHOO DV UHVLGXHV UHTXLUHG IRU WKH LQWHUDFWLRQ RI ',5 ZLWK '/ f $OWKRXJK WKH PHWK\OWUDQVIHUDVH DFWLYH VLWH LV FRPSOHWO\ FRQWDLQHG ZLWKLQ WKH FDUER[\O WHUPLQDO SRUWLRQ RI ',5 LW LV FOHDU WKDW KHWHURGLPHUL]DWLRQ EHWZHHQ ',5 DQG '/ LV UHTXLUHG IRU IXOO PHWK\OWUDQVIHUDVH DFWLYLW\ 6DGHQRV\O/PHWKLRQLQH $GRPHWf WKH PHWK\O JURXS GRQRU LQ WKH PHWK\OWUDQVIHUDVH UHDFWLRQ KDV EHHQ FRYDOHQWO\ SKRWRFURVVOLQNHG WR DPLQR DFLGV DQG LPSOLFDWLQJ WKHVH UHVLGXHV LQ WKH ELQGLQJ RI $GRPHW f 0XWDWLRQV ZHUH PDGH LQ FORQHG FRSLHV RI WKH ',5 JHQH WKDW DOWHUHG WKH ',5 SURWHLQ FRGLQJ VHTXHQFH VXFK WKDW FOXVWHUV RI FKDUJHG DPLQR DFLGV ZHUH PXWDWHG WR DODQLQHV )LJ f DQG HDFK RI WKHVH

PAGE 128

)LJ 'HGXFHG DPLQR DFLG VHTXHQFH RI WKH ',5 JHQH SURGXFW DQG ',5 PXWDQW JHQH SURGXFWV 8QGHUOLQHG UHVLGXHV LQGLFDWH FKDUJHG DPLQR DFLGV PXWDWHG WR DODQLQHV 7KH QXPHULFDO GHVLJQDWLRQ JLYHQ WR HDFK PXWDQW LV VKRZQ DERYH WKH DSSURSULDWH UHVLGXHV 7KH LWDOLFL]HG XQGHUOLQHG QXPEHUV VKRZ WKH SRVLWLRQ RI WKH PXWDWLRQV LQ WKH IRXU PXWDQW YLUXVHV LVRODWHG GXULQJ WKH WUDQVLHQW GRPLQDQW VHOHFWLRQ 6KDGLQJ LQGLFDWHV WKH SRVLWLRQ RI WKH SUHYLRXVO\ PDSSHG JXDQ\OWUDQVIHUDVH *WDVHf JXDQLQHfPHWK\OWUDQVIHUDVH 0WDVHf DQG 6DGHQRV\O/PHWKLRQLQH ELQGLQJ 6$0f GRPDLQV 7KH GRW DERYH O\VLQH LQGLFDWHV WKH DPLQR DFLG SUHYLRXVO\ VKRZQ WR IRUP D FRYDOHQW ERQG ZLWK *03 LQ WKH HQ]\PH *03 LQWHUPHGLDWH

PAGE 129

0'$1996667 ,$7<,'$/$. 1$6(/(4567 $<(,11(/(/ 9),.33/,7O 71991,67,4 (6),5)7971 .(*9.,57., 3/6.9+*/'9 .194/9'$,' 1,9:(..6,9 7(15/+.(&/ /5/67((5+, )/'<..<*66 ,5/(/91/,4 $.7.1)7,') ./.<)/*6*$ 46.66//+$, 1+3.653176 /(,()735'1 (793<'(/,. (/77/65+,) 0$63(19,/6 33,1$3,.7) 0,3.4',9*O '/(1/<$97. 7'*,3,7,59 761*/<&<)7 +/*<,,5<39 .5,,'6(999 )*($9.'.1: 79
PAGE 130

PXWDWLRQV ZHUH WHVWHG IRU WKH DELOLW\ WR FRQIHU D WHPSHUDWXUH VHQVLWLYH SKHQRW\SH RQ YDFFLQLD YLUXV 7UDQVLHQW GRPLQDQW VHOHFWLRQ ZDV GRQH WR WUDQVSODFH WKH ZLOGW\SH FRS\ RI ',5 RQ WKH YLUDO FKURPRVRPH ZLWK D FOXVWHUHG FKDUJH WR DODQLQH PXWDQW DOOHOH f 6SHFLILFDOO\ FHOOV LQIHFWHG ZLWK ZLOGW\SH YLUXV ZHUH WUDQVIHFWHG ZLWK D SODVPLG FRQWDLQLQJ ERWK WKH (VFKHULFKLD FROL JXDQLQH SKRVSKRULERV\OWUDQVIHUDVH JHQH HFRJSWf D GRPLQDQW VHOHFWDEOH PDUNHU XQGHU WKH WUDQVFULSWLRQDO FRQWURO RI D YDFFLQLD SURPRWHU DQG D PXWDQW FRS\ RI ',5 $IWHU D WKUHH GD\ LQFXEDWLRQ WKH LQIHFWHG FHOOV ZHUH KDUYHVWHG DQG D YLUDO O\VDWH ZDV SUHSDUHG 'XULQJ WKH LQIHFWLRQWUDQVIHFWLRQ WKH SODVPLG EHFRPHV LQWHJUDWHG LQWR WKH YLUDO JHQRPH E\ VLQJOH FURVVRYHU KRPRORJRXV UHFRPELQDWLRQ EHWZHHQ SODVPLG DQG FKURPRVRPDO ',5 VHTXHQFHV 7R VHOHFW IRU UHFRPELQDQWV ZKLFK KDYH LQWHJUDWHG WKH SODVPLG DQG DUH H[SUHVVLQJ HFRJSW WKH YLUDO O\VDWH ZDV SODTXHG LQ WKH SUHVHQFH RI WKH SXULQH ELRV\QWKHVLV LQKLELWRU P\FRSKHQROLF DFLG 03$f 'XULQJ WKH JURZWK RI HDFK 03$ UHVLVWDQW SODTXH UHVROXWLRQ RFFXUV YLD UHFRPELQDWLRQ EHWZHHQ WKH WZR JHQRPLF FRSLHV RI ',5 UHVXOWLQJ LQ YLUXVHV ZKLFK KDYH ORVW WKH HFRJSW JHQH DQG FRQWDLQ RQO\ D VLQJOH FRS\ RI WKH ',5 JHQH (DFK

PAGE 131

03$ UHVLVWDQW SODTXH WKHUHIRUH FRQWDLQV D PL[WXUH RI YLUXVHV VRPH RI ZKLFK FRQWDLQ D PXWDQW FRS\ RI ',5 RULJLQDOO\ GHULYHG IURP WKH WUDQVIHFWHG SODVPLG ZKLOH RWKHUV UHWDLQ D ZLOGW\SH FRS\ RI ',5 )LYH LQGLYLGXDO 03$ UHVLVWDQW SODTXHV IURP HDFK WUDQVIHFWLRQ ZHUH SLFNHG DQG SODTXH WLWUDWHG DW }& WR LVRODWH LQGLYLGXDO YLUXVHV ZKLFK KDYH UHVROYHG WKH HFRJSW JHQH DQG QRZ FRQWDLQ HLWKHU D ZLOGW\SH RU D PXWDQW FRS\ RI ',5 9LUXVHV ZKLFK FRQWDLQ D PXWDWLRQ WKDW FRQIHUV D OHWKDO SKHQRW\SH ZLOO QRW IRUP SODTXHV WKHUHIRUH WKH\ DUH XQGHWHFWDEOH LQ WKLV DVVD\ 3UHYLRXV WUDQVLHQW GRPLQDQW VHOHFWLRQ H[SHULPHQWV LQGLFDWH RQ DYHUDJH b RI WKH WRWDO SURJHQ\ ZLWKLQ HDFK 03$ UHVLVWDQW SODTXH FRQWDLQ WKH PXWDWLRQ RI LQWHUHVW ZKHUHDV DQRWKHU b UHWDLQ WKH HFRJSW FDVVHWWH VHH FKDSWHU f 7R VFUHHQ IRU WHPSHUDWXUH VHQVLWLYLW\ LQGLYLGXDO SODTXHV IURP HDFK WUDQVIHFWLRQ IURP HDFK RI WKH RULJLQDO 03$ UHVLVWDQW SODTXHV ZHUH SLFNHG DQG SODTXH WLWUDWHG DW }& DQG r& 7KH KLJK OHYHOV RI QRQPXWDQW YLUXVHV ZLWKLQ HDFK 03$ UHVLVWDQW SODTXH PDNHV LW GLIILFXOW WR XVH WKLV VFUHHQLQJ SURFHGXUH WR GHWHFW DQ\ PXWDWLRQ ZKLFK FRQIHUV D ZLOGW\SH SKHQRW\SH

PAGE 132

3ODTXH 3KHQRW\SHV RI ',5 0XWDQW 9LUXVHV 'XULQJ WKH VFUHHQLQJ SURFHGXUH IRXU RI WKH PXWDQW SODVPLGV \LHOGHG YLUXVHV WKDW ZHUH HLWKHU WHPSHUDWXUHVHQVLWLYH IRU SODTXH IRUPDWLRQ RU WKDW SURGXFHG VPDOOHU SODTXHV WKDQ ZLOGW\SH DW r& RU r& )LJ f 9LUXVHV FRQWDLQLQJ DQ\ RI WKH UHPDLQLQJ PXWDWLRQV ZHUH QRW UHFRYHUHG WKHUHIRUH LW ZDV DVVXPHG WKDW WKHVH PXWDWLRQV FRQIHU HLWKHU ZLOGW\SH RU OHWKDO SKHQRW\SHV 7KH SODTXH SKHQRW\SHV RI WKH IRXU PXWDQW YLUXVHV IHOO LQWR WKUHH GLVWLQFW FODVVHV $W ERWK WHPSHUDWXUHV (O SURGXFHG SODTXHV WKDW ZHUH GLVWLQJXLVKDEO\ VPDOOHU WKDQ ZLOGW\SH 7KH (O YLUXV DOVR VKRZHG D VOLJKW OHVV WKDQ ORJf UHGXFWLRQ LQ WLWHU DW r& FRPSDUHG WR r& GDWD QRW VKRZQf 7KH YLUXV SURGXFHV D KHWHURJHQHRXV PL[WXUH RI ODUJH DQG VPDOO SODTXHV DW ERWK WHPSHUDWXUHV ZLWK QR GHWHFWDEOH GHFUHDVH LQ WLWHU DW & 6PDOO SODTXH YDULDQWV RI ZHUH UHn SODTXH SXULILHG DW r& DQG VKRZHG WKH VDPH KHWHURJHQHLW\ GDWD QRW VKRZQf 7KH PXWDQWV ( DQG ( ZHUH ERWK WHPSHUDWXUH VHQVLWLYH IRU SODTXH IRUPDWLRQ DW R& ( DQG ( VKRZHG D DQG ORJ UHGXFWLRQ LQ SODTXH WLWHU UHVSHFWLYHO\ DW !& ZKHQ

PAGE 133

)LJ 3ODTXH IRUPDWLRQ RI ZLOG W\SH DQG WKH IRXU ',5 FOXVWHUHG FKDUJH WR DODQLQH PXWDQWV YLUXVHV 3ODTXH DVVD\V ZHUH LQFXEDWHG DW r& RU r& IRU ZHHN DQG VWDLQHG ZLWK FU\VWDO YLROHW

PAGE 134

r& r&

PAGE 135

FRPSDUHG WR }& GDWD QRW VKRZQf ,QWHUHVWLQJO\ DOWKRXJK WKH ( YLUXV LV SURIRXQGO\ WHPSHUDWXUHVHQVLWLYH LQ D SODTXH DVVD\ WKH SODTXHV SURGXFHG DW r& DUH WKH VDPH VL]H DV WKRVH SURGXFHG E\ ZLOGW\SH YLUXV DW }& )LJ f 2QH 6WHS *URZWK ([SHULPHQWV 7KH SKHQRW\SLF FKDUDFWHUL]DWLRQ RI WHPSHUDWXUHVHQVLWLYH PXWDQWV LV GRQH XQGHU KLJK PXOWLSOLFLW\ RI LQIHFWLRQ FRQGLWLRQV 7KHUHIRUH LQ RUGHU IRU WKHVH UHVXOWV WR EH PHDQLQJIXO WKH PXWDQWV PXVW EH WHPSHUDWXUHVHQVLWLYH IRU JURZWK XQGHU WKHVH VDPH FRQGLWLRQV 2QH VWHS JURZWK H[SHULPHQWV ZHUH GRQH WR GHWHUPLQH LI ( ( RU ( ZHUH WHPSHUDWXUHVHQVLWLYH IRU JURZWK XQGHU KLJK PXOWLSOLFLW\ RI LQIHFWLRQ FRQGLWLRQV )LJ f %6& FHOOV ZHUH LQIHFWHG DW DQ PRL RI DW HLWKHU r& RU m& ,QIHFWHG FHOOV ZHUH KDUYHVWHG DW YDULRXV WLPHV DQG WKH SURJHQ\ ZHUH TXDQWLWDWHG E\ SODTXH WLWUDWLRQ DW !& :LOGW\SH YLUXV JURZQ DW r& RU !& VKRZHG D EXUVW VL]H RI EHWZHHQ DQG SODTXH IRUPLQJ XQLWV SHU FHOO ZLWK D PD[LPXP \LHOG RFFXUULQJ EHWZHHQ DQG KRXUV SRVW LQIHFWLRQ 7KH PXWDQWV (O DQG ( SURGXFHG VLJQLILFDQWO\

PAGE 136

)LJ 2QH VWHS JURZWK H[SHULPHQWV RI ZLOG W\SH DQG RI ',5 PXWDQW YLUXVHV %6& FHOOV ZHUH LQIHFWHG DW DQ PRL RI DW r& DQG r& 6DPSOHV ZHUH WDNHQ DW YDULRXV WLPHV SRVW LQIHFWLRQ DQG WLWHUHG DW R& IRU RQH ZHHN ‘ r& f !&

PAGE 137

SIXFHOO KRXUV SRVW LQIHFWLRQ KRXUV SRVW LQIHFWLRQ KRXUV SRVW LQIHFWLRQ KRXUV SRVW LQIHFWLRQ KRXUV SRVW LQIHFWLRQ

PAGE 138

OHVV YLUXV WKDQ ZLOGW\SH DW ERWK WHPSHUDWXUHV +RZHYHU DOO RI WKHVH YLUXVHV JUHZ DW OHDVW DV ZHOO DW m& DV DW !& WKHUHIRUH QRQH RI WKHVH YLUXVHV DUH WHPSHUDWXUHVHQVLWLYH IRU JURZWK LQ WKLV DVVD\ 7KH UHPDLQLQJ PXWDQW ( LV FOHDUO\ WHPSHUDWXUHVHQVLWLYH IRU JURZWK GXULQJ KLJK PXOWLSOLFLW\ LQIHFWLRQV $W r& WKH EXUVW VL]H RI ( LV EHWZHHQ DQG SODTXH IRUPLQJ XQLWV SHU FHOO VLPLODU WR ZLOGW\SH YLUXV ZKHUHDV DW m& WKLV PXWDQW LV LQFDSDEOH RI SURGXFLQJ LQIHFWLRXV SURJHQ\ 'XH WR LWV FRQGLWLRQDO OHWKDOLW\ LQ D RQH VWHS JURZWK H[SHULPHQW ( DSSHDUV WR EH WKH RQO\ ELRFKHPLFDOO\ XVHIXO WHPSHUDWXUH VHQVLWLYH PXWDQW LVRODWHG E\ VFUHHQLQJ WKH FOXVWHUHG FKDUJH WR DODQLQH DOOHOHV RI ',5 ( YLUXV ZDV WKHUHIRUH VXEMHFWHG WR IXUWKHU SKHQRW\SLF DQDO\VLV LQ YLYR LQ DQ DWWHPSW WR GHWHUPLQH WKH GHIHFW UHVSRQVLEOH IRU WKH REVHUYHG WHPSHUDWXUH VHQVLWLYLW\ 0DUNHU 5HVFXH RI ( 7HPSHUDWXUH 6HQVLWLYLW\ 7R FRQILUP WKDW WKH WHPSHUDWXUHVHQVLWLYH OHVLRQ RQ WKH ( YLUDO FKURPRVRPH LV ZLWKLQ WKH ',5 JHQH FHOOV ZHUH LQIHFWHG ZLWK ( WUDQVIHFWHG ZLWK FORQHG IUDJPHQWV RI ZLOGW\SH JHQRPLF '1$

PAGE 139

DQG LQFXEDWHG DW !& )ROORZLQJ D GD\ LQFXEDWLRQ DW !& WKH FHOO PRQROD\HUV ZHUH VWDLQHG DQG H[DPLQHG IRU SODTXHV )LJ f 'RXEOH FURVVRYHU UHFRPELQDWLRQ HYHQWV EHWZHHQ WKH WUDQIHFWHG '1$ DQG WKH ( FKURPRVRPH ZKLFK UHSODFH WKH WHPSHUDWXUHVHQVLWLYH DOOHOH ZLWK D ZLOGW\SH DOOHOH JHQHUDWH D YLUXV ZKLFK LV DEOH WR IRUP D SODTXH DW !& 7KH UHVFXH RI D WHPSHUDWXUHVHQVLWLYH PDUNHU ZLWK FORQHG IUDJPHQWV RI ZLOGW\SH '1$ FDQ WKHUHIRUH EH XVHG WR PDS WKH SRVLWLRQ RI D WHPSHUDWXUHVHQVLWLYH OHVLRQ RQ WKH YLUDO FKURPRVRPH f 7ZR RYHUODSSLQJ FRVPLG FORQHV RI ZLOGW\SH YDFFLQLD YLUXV VWUDLQ :5 FDSDEOH RI UHVFXLQJ WKH WHPSHUDWXUH VHQVLWLYLW\ SODFH WKH WHPSHUDWXUHVHQVLWLYH OHVLRQ EHWZHHQ QXFOHRWLGHV DQG RQ WKH ( FKURPRVRPH ZLWKLQ WKH +LQG,,, IUDJPHQW )LJ f f 5HVFXH RI WKH WHPSHUDWXUH VHQVLWLYLW\ ZDV DOVR DFFRPSOLVKHG ZLWK D SODVPLG FORQH FRQWDLQLQJ RQO\ WKH ',5 RSHQ UHDGLQJ IUDPH S*(0'O1FR f FRQILUPLQJ WKDW WKH PXWDWLRQ UHVSRQVLEOH IRU WKH WHPSHUDWXUH VHQVLWLYLW\ RI WKH ( YLUXV OLHV ZLWKLQ WKH ',5 JHQH f 7KH SUHVHQFH RI WKH ( PXWDWLRQ LQ ',5 ZDV FRQILUPHG E\ '1$ VHTXHQFLQJ RI ',5 VSHFLILF 3&5 DPSOLILFDWLRQ SURGXFWV IURP ( YLUDO '1$ GDWD QRW VKRZQf 7KH VLPSOHVW H[SODQDWLRQ RI WKHVH

PAGE 140

)LJ 0DUNHU UHVFXH RI WKH ( WHPSHUDWXUH VHQVLWLYH OHVLRQ &HOOV LQIHFWHG ZLWK ( ZHUH WUDQVIHFWHG ZLWK FDOFLXP SKRVSKDWH SUHFLSLWDWHG '1$ LQFXEDWHG DW }& IRU GD\V DQG VWDLQHG ZLWK FU\VWDO YLROHW 6ROLG EDUV LQGLFDWH WKH UHODWLYH PDS SRVLWLRQ RI WKH FORQHV XVHG LQ WKH PDUNHU UHVFXH H[SHULPHQWV

PAGE 141

12'1$ S:5 S:5 S*(0'1FR S:5 S:5 NE S*(0 '1FR & 10. ) (2,*/-+ +, O ,,, O O / % /2 /2

PAGE 142

GDWD LV WKDW WKH ( PXWDWLRQ LV UHVSRQVLEOH IRU WKH WHPSHUDWXUH VHQVLWLYLW\ RI WKH ( YLUXV ,Q 9LYR 3URWHLQ 6\QWKHVLV RI ( ,QIHFWHG &HOOV 7KLV VLPSOHVW ZD\ WR GHWHUPLQH LI WKHUH LV D GHIHFW LQ WKH RUGHUO\ SURJUHVVLRQ RI WKH YDFFLQLD YLUXV OLIH F\FOH LV WR H[DPLQH SURWHLQ V\QWKHVLV ZLWKLQ LQIHFWHG FHOOV E\ LQ YLYR SURWHLQ SXOVH ODEHOLQJ 3URWHLQV ZLWKLQ ( LQIHFWHG FHOOV ZHUH SXOVH ODEHOHG DW YDULRXV WLPHV SRVW LQIHFWLRQ ZLWK 6 7UDQV ODEHO VHSDUDWHG E\ 6'6 3$*( DQG GHWHFWHG E\ DXWRUDGLRJUDSK\ )LJ f 7KH QRUPDO SDWWHUQ RI SURWHLQ V\QWKHVLV FDQ EH VHHQ PRVW FOHDUO\ E\ H[DPLQDWLRQ RI WKH ZLOGW\SH LQIHFWLRQ DW r& 7KH VKXW RII RI KRVW SURWHLQ V\QWKHVLV DQG WKH DSSHDUDQFH RI YLUDO HDUO\ SURWHLQV LV HYLGHQW E\ KRXUV SRVW LQIHFWLRQ /DEHOLQJ RI HDUO\ YLUDO SURWHLQV GLPLQLVKHV E\ KRXUV SRVW LQIHFWLRQ /DEHOLQJ RI ODWH SURWHLQV EHJLQV DW KRXUV DQG SHUVLVWV XS WR DW OHDVW KRXUV SRVW LQIHFWLRQ 7KH SDWWHUQ RI SURWHLQ V\QWKHVLV LQ WKH ZLOGW\SH LQIHFWLRQ DW r& LV VOLJKWO\ GHOD\HG GXH WR WKH GHFUHDVHG JURZWK WHPSHUDWXUH EXW LV RWKHUZLVH LGHQWLFDO WR WKH ZLOG W\SH LQIHFWLRQV FDUULHG RXW DW R& ,Q WKH ( LQIHFWLRQV DW ERWK

PAGE 143

)LJ 3URWHLQ V\QWKHVLV RI ZLOG W\SH DQG ( LQIHFWHG %6& FHOOV &HOOV ZHUH LQIHFWHG DW R& RU !& ZLWK WKH YLUXV LQGLFDWHG DW WKH OHIW DQG WKHQ SXOVH ODEHOHG IRU PLQXWHV ZLWK >6@ ODEHOHG DPLQR DFLGV DW WKH WLPHV SRVW LQIHFWLRQ LQGLFDWHG DERYH HDFK ILJXUH &HOOV ZHUH KDUYHVWHG DQG SURWHLQV ZHUH VHSDUDWHG RQ D b 6'6SRO\DFU\ODPLGH JHO DQG DXWRUDGLRJUDSKHG 7KH DXWRUDGLRJUDPV DUH VKRZQ $SSUR[LPDWH PROHFXODU ZHLJKWV LQ N'D DUH VKRZQ RQ WKH OHIW

PAGE 144

2& r&

PAGE 145

!& DQG }& WKHUH DSSHDUV WR EH OHVV LQWHQVH SURWHLQ ODEHOLQJ DQG D KRXU GHOD\ LQ WKH SDWWHUQ RI H[SUHVVLRQ LQWKH PXWDQW LQIHFWLRQV ZKHQ FRPSDUHG WR ZLOGW\SH 7KH GHFUHDVH LQ WKH LQWHQVLW\ RI ODEHOLQJ LQGLFDWHV WKDW SURWHLQ V\QWKHVLV LQ WKH ( LQIHFWLRQV LV OHVV UREXVW WKDQ LQ ZLOGW\SH LQIHFWLRQV VXJJHVWLQJ WKDW ( LV VOLJKWO\ FRPSURPLVHG IRU JURZWK DW ERWK WHPSHUDWXUHV +RZHYHU EHFDXVH WKH GHFUHDVH LQ WKH LQWHQVLW\ RI ODEHOLQJ DQG WKH KRXU GHOD\ LQ H[SUHVVLRQ DUH DV DSSDUHQW DW r& DV DW !& LW LV XQOLNHO\ WKDW HLWKHU DUH UHVSRQVLEOH IRU WKH WHPSHUDWXUH VHQVLWLYLW\ RI WKH ( YLUXV 9LUDO '1$ $FFXPXODWLRQ LQ ( ,QIHFWHG &HOOV 7R GHWHUPLQH LI YLUDO '1$ UHSOLFDWLRQ ZDV FRPSURPLVHG LQ WKH PXWDQW LQIHFWLRQV DW r& D WLPH FRXUVH RI ZLOGW\SH DQG ( '1$ DFFXPXODWLRQ ZDV GHWHUPLQHG DW ERWK }& DQG R& 7RWDO '1$ ZDV LVRODWHG IURP ZLOGW\SH RU ( LQIHFWHG FHOOV DW YDULRXV WLPHV SRVW LQIHFWLRQ IL[HG WR D Q\ORQ PHPEUDQH DQG K\EULGL]HG WR UDGLRODEHOHG ZLOGW\SH YDFFLQLD JHQRPLF '1$ 7KH UDGLRDFWLYLW\ ERXQG WR WKH PHPEUDQH ZDV TXDQWLWDWHG E\ SKRVSKRULPDJH DQDO\VLV )LJ f

PAGE 146

)LJ '1$ DFFXPXODWLRQ RI ZLOG W\SH DQG ( YLUDO '1$ $ 6RXWKHUQ EORW ZDV GRQH ZLWK WRWDO '1$ LVRODWHG DW YDULRXV WLPHV SRVW LQIHFWLRQ IURP %6& FHOOV LQIHFWHG DW r& RU r& ZLWK ZLOG W\SH f RU ( f 7KH EORW ZDV K\EULGL]HG WR UDGLRODEHOHG ZLOG W\SH YDFFLQLD '1$ DQG WKH UHODWLYH DPRXQW RI ERXQG SUREH ZDV GHWHUPLQHG E\ SKRVSKRULPDJH DQDO\VLV

PAGE 147

'1$ DFFXPXODWLRQ DUELWUDU\ XQLWVf R R R 2f R R R R 1! 2 '1$ DFFXPXODWLRQ DUELWUDU\ XQLWVf UR X R RR R UR Wr RRRRRRRR 2f

PAGE 148

(TXLYDOHQW DPRXQWV RI WRWDO '1$ ZHUH ORDGHG LQ HDFK ODQH DV MXGJHG E\ HWKLGLXP EURPLGH VWDLQLQJ RI WKH DJDURVH JHO GDWD QRW VKRZQf $Q LQFUHDVH LQ WKH DPRXQW RI YLUDO '1$ LQ WKH ZLOGW\SH LQIHFWLRQV FDQ EH GHWHFWHG DV HDUO\ DV KRXUV SRVW LQIHFWLRQ DW R&DQG KRXUV SRVW LQIHFWLRQ DW R& 7KLV LQFUHDVH LQ WKH DPRXQW RI YLUDO '1$ LV HYLGHQW WKURXJKRXW WKH FRXUVH RI WKH H[SHULPHQW $ VLPLODU SDWWHUQ RI '1$ V\QWKHVLV ZDV REVHUYHG LQ FHOOV LQIHFWHG ZLWK ( YLUXV DW ERWK r& DQG r& %\ KRXUV SRVW LQIHFWLRQ WKHUH LV DQ LQFUHDVH LQ WKH DPRXQW RI YLUDO '1$ LQ WKH ( LQIHFWLRQ DQG WKLV WUHQG FRQWLQXHV XS WR DW OHDVW KRXUV SRVW LQIHFWLRQ 7KH YDULDELOLW\ LQ WKH DPRXQW RI YLUDO '1$ SUHVHQW LQ HDFK VDPSOH LV PRVW OLNHO\ WKH UHVXOW RI HUURUV LQWURGXFHG GXULQJ WKH GLOXWLRQ RI WKH VDPSOH SULRU WR ORDGLQJ RQWR WKH EORWWLQJ DSSDUDWXV 1HYHUWKHOHVV IRU ERWK ZLOG W\SH DQG ( DW ERWK !& DQG r& WKHUH LV DQ LQFUHDVH LQ WKH DPRXQW RI YLUDO '1$ SUHVHQW LQ WKH KRXU VDPSOHV UHODWLYH WR WKH KRXU VDPSOHV 7KXV DV RQH PLJKW H[SHFW IURP WKH DSSHDUDQFH RI ODWH YLUDO SURWHLQV WKH V\QWKHVLV RI ZKLFK LV FRXSOHG WR '1$ UHSOLFDWLRQ WKH ( PXWDQW LV QRW WHPSHUDWXUHVHQVLWLYH IRU '1$ V\QWKHVLV

PAGE 149

9LUDO *HQH ([SUHVVLRQ LQ ( ,QIHFWHG &HOOV 1RUWKHUQ EORW DQDO\VLV ZDV GRQH RQ 51$ LVRODWHG DW YDULRXV WLPHV SRVW LQIHFWLRQ IURP ZLOGW\SH DQG ( LQIHFWHG FHOOV WR DVVHVV WKH NLQHWLFV RI P51$ V\QWKHVLV DQG WKH UHODWLYH TXDQWLW\ DQG VWUXFWXUH RI VSHFLILF HDUO\ LQWHUPHGLDWH DQG ODWH YLUDO WUDQVFULSWV 7KLV H[SHULPHQW ZDV DOVR GRQH WR GHWHUPLQH VSHFLILFDOO\ ZKHWKHU WKH HDUO\ WUDQVFULSWLRQ WHUPLQDWLRQ DQG LQWHUPHGLDWH WUDQVFULSWLRQ LQLWLDWLRQ IXQFWLRQV RI WKH ( FDSSLQJ HQ]\PH UHPDLQ LQWDFW DW ERWK r& DQG R& 7RWDO 51$ LVRODWHG DW YDULRXV WLPHV SRVW LQIHFWLRQ IURP ZLOGW\SH RU ( LQIHFWLRQV LQFXEDWHG DW r& RU r& ZDV VHSDUDWHG RQ DJDURVH IRUPDOGHK\GH JHOV WUDQVIHUUHG WR Q\ORQ PHPEUDQHV DQG K\EULGL]HG WR HDUO\ &5f LQWHUPHGLDWH *5f DQG ODWH )5f JHQH VSHFLILF DQWLVHQVH ULERSUREHV )LJ f (TXLYDOHQW DPRXQWV RI WRWDO 51$ ZHUH ORDGHG LQ HDFK ODQH DV MXGJHG E\ HWKLGLXP EURPLGH VWDLQLQJ RI WKH DJDURVH IRUPDOGHK\GH JHOV GDWD QRW VKRZQf 7KH K\EULGL]DWLRQ RI 51$ IURP ZLOGW\SH LQIHFWHG FHOOV WR D SUREH VSHFLILF IRU WKH YDFFLQLD JURZWK IDFWRU JHQH JHQH &5f D ZHOO FKDUDFWHUL]HG HDUO\ WUDQVFULSW UHYHDOV WKDW &5 PHVVDJH FDQ EH

PAGE 150

)LJ 1RUWKHUQ DQDO\VLV RI YLUDO 51$ LVRODWHG IURP ZLOG W\SH RU ( LQIHFWLRQV 1RUWKHUQ EORW DQDO\VLV ZDV GRQH RQ WRWDO 51$ LVRODWHG DW WKH WLPHV LQGLFDWHG DERYH HDFK ODQH 7KH YLUXV DQG LQIHFWLRQ FRQGLWLRQV DUH LQGLFDWHG DW WKH WRS RI WKH ILJXUH 0HPEUDQHV ZHUH SUREHG ZLWK ULERSUREHV VSHFLILF IRU DQ HDUO\ JHQH &5f DQ LQWHUPHGLDWH JHQH *5f RU D ODWH JHQH )5f DV LQGLFDWHG WR WKH OHIW DQG DXWRUDGLRJUDSKHG DQ DXWRUDGLRJUDP LV VKRZQ

PAGE 151

HDUO\ LQWHUPHGLDWH ZW r& ZW r& L L L L ODWH r& r& L L L , , , , , , ‘} ,

PAGE 152

GHWHFWHG DW r& DQG !& DV HDUO\ DV KRXUV SRVW LQIHFWLRQ $W !& WKH &5 P51$ LV SUHVHQW XS WR DW OHDVW KRXUV SRVW LQIHFWLRQ DOWKRXJK PD[LPDO OHYHOV DSSHDU WR SHDN DW DERXW KRXUV SRVW LQIHFWLRQ $W m& WKH OHYHOV RI &5 P51$ DOVR SHDN DW DERXW KRXUV SRVW LQIHFWLRQ EHIRUH UDSLGO\ GHFOLQLQJ E\ KRXUV 7KH ( PXWDQW LQIHFWLRQV UHYHDO VXEWOH GLIIHUHQFHV LQ WKH RYHUDOO VWHDG\ VWDWH OHYHOV RI HDUO\ P51$ /LNH WKH ZLOGW\SH LQIHFWLRQV &5 P51$ LV GHWHFWDEOH E\ KRXUV SRVW LQIHFWLRQ DW ERWK WHPSHUDWXUHV KRZHYHU DW r& &5 P51$ GRHV QRW SHUVLVW DIWHU KRXUV SRVW LQIHFWLRQ $W m& WKH NLQHWLFV RI &5 P51$ H[SUHVVLRQ DSSHDU LGHQWLFDO WR ZLOGW\SH DOWKRXJK WKHUH GRHV VHHP WR EH PRUH &5 P51$ SUHVHQW DW KRXUV SRVW LQIHFWLRQ 7KH K\EULGL]DWLRQ RI 51$ LVRODWHG IURP ( RU ZLOGW\SH LQIHFWHG FHOOV WR D SUREH IRU *5 DQ LQWHUPHGLDWH JHQH ZKLFK HQFRGHV D ODWH WUDQVFULSWLRQ IDFWRU UHYHDOV QR GLIIHUHQFHV EHWZHHQ WKH ZLOGW\SH DQG ( LQIHFWLRQV 7KH VPHDULQJ RI LQWHUPHGLDWH DQG ODWH P51$V REVHUYHG ZLWK WKH LQWHUPHGLDWH DQG ODWH SUREHV LV GXH WR WKH IDFW WKDW XQOLNH HDUO\ WUDQVFULSWV LQWHUPHGLDWH DQG ODWH P51$V KDYH KHWHURJHQHRXV f HQGV f 0D[LPDO OHYHOV RI *5 P51$ LQ WKH ZLOGW\SH DQG

PAGE 153

PXWDQW LQIHFWLRQV DUH GHWHFWHG DW EHWZHHQ DQG KRXUV DW r& DQG DW KRXUV DW !& $QDO\VLV RI WKH SDWWHUQ RI H[SUHVVLRQ RI WKH )5 JHQH ZKLFK HQFRGHV DQ N'D YLULRQ VWUXFWXUDO SURWHLQ UHYHDOV VOLJKW GLIIHUHQFHV EHWZHHQ WKH ZLOGW\SH DQG ( PXWDQW LQIHFWLRQV $W }& D VPDOO DPRXQW RI )5 P51$ FDQ EH GHWHFWHG LQ WKH ZLOG W\SH LQIHFWLRQV E\ KRXUV DQG P51$ OHYHOV SURJUHVVLYHO\ LQFUHDVH XS WR DW OHDVW KRXUV SRVW LQIHFWLRQ 7KH ZLOGW\SH LQIHFWLRQ DW r& VKRZV VLPLODU NLQHWLFV RI H[SUHVVLRQ DOWKRXJK WKH RYHUDOO OHYHOV RI )5 P51$ DUH LQFUHDVHG UHODWLYH WR r& UHIOHFWLYH RI WKH LQFUHDVHG JURZWK WHPSHUDWXUH 7KH NLQHWLFV RI H[SUHVVLRQ RI )5 P51$ DUH WKH VDPH LQ WKH ( LQIHFWLRQV KRZHYHU LW GRHV DSSHDU WKDW WKH VWHDG\ VWDWH OHYHO RI )5 P51$ SUHVHQW LQ WKH ( LQIHFWLRQV DW ERWK WHPSHUDWXUHV LV LQFUHDVHG LQ FRPSDULVRQ WR ZLOG W\SH 7KH GDWD IURP WKH QRUWKHUQ DQDO\VLV VKRZV WKDW JHQH H[SUHVVLRQ LV QRW WHPSHUDWXUHVHQVLWLYH LQ WKH ( LQIHFWLRQV DW r& $OWKRXJK WKHUH DUH PLQRU GLIIHUHQFHV LQ WKH NLQHWLFV DQG TXDQWLW\ RI P51$ H[SUHVVLRQ QRQH RI WKHVH GLIIHUHQFHV VHHP WR DFFRXQW IRU WKH LQDELOLW\ RI WKH ( YLUXV WR SURGXFH LQIHFWLRXV SURJHQ\ DW m& 7KH SUHVHQFH RI WKH WKUHH FODVVHV RI P51$V

PAGE 154

LQGLFDWHV WKDW WKHUH LV QR GHIHFW LQ WHPSRUDO UHJXODWLRQ RI JHQH H[SUHVVLRQ LQ WKH ( LQIHFWLRQV DW HLWKHU r& RU r& 0RUH LPSRUWDQWO\ WKH GLVFUHWH VL]H RI WKH HDUO\ WUDQVFULSWV DQG WKH DSSHDUDQFH RI WKH *5 LQWHUPHGLDWH P51$ SURYH WKDW WKH HDUO\ WUDQVFULSWLRQ WHUPLQDWLRQ DQG LQWHUPHGLDWH WUDQVFULSWLRQ LQLWLDWLRQ DFWLYLWLHV RI WKH ( P51$ FDSSLQJ HQ]\PH UHPDLQ LQWDFW DW ERWK r& DQG R& 7KHUHIRUH WKHVH GDWD LQGLFDWH WKDW WKH ( YLUXV LV QRW WHPSHUDWXUHVHQVLWLYH LQ YLYR IRU HDUO\ WUDQVFULSWLRQ WHUPLQDWLRQ RU LQWHUPHGLDWH WUDQVFULSWLRQ LQLWLDWLRQ 9LUDO 0RUSKRJHQHVLV RI ( $W WKH QRQSHUPLVVLYH WHPSHUDWXUH ( LQIHFWHG FHOOV FRQWDLQ ODWH SURWHLQV DQG YLUDO '1$ EXW SURGXFH QR LQIHFWLRXV SURJHQ\ WKHUHIRUH LW ZDV K\SRWKHVL]HG WKDW ( FRXOG EH GHIHFWLYH LQ YLULRQ PRUSKRJHQHVLV (OHFWURQ PLFURVFRS\ RI ZLOGW\SH DQG ( LQIHFWHG FHOOV ZDV GRQH WR GHWHUPLQH LI WKH ( YLUXV LV DEOH WR V\QWKHVL]H PDWXUH YLUDO SDUWLFOHV DW m& DQG R& 9DFFLQLD PRUSKRJHQHVLV RFFXUV ZLWKLQ GLVFUHWH DUHDV RI WKH F\WRSODVP NQRZQ DV YLUDO IDFWRULHV RU YLURVRPHV UHYLHZHG LQ f 9LURVRPHV FRQVLVW RI DQ

PAGE 155

HOHFWURQ GHQVH VXEVWDQFH NQRZQ DV YLURSODVP ZKLFK LV WKRXJKW WR FRQWDLQ YLUDO '1$ DQG SURWHLQ 7KH ILUVW VWHS LQ PRUSKRJHQHVLV LV WKH DSSHDUDQFH RI D PHPEUDQHRXV FUHVFHQW VKDSHG VWUXFWXUH ZLWKLQ WKH YLURSODVP 7KH FUHVFHQW HQYHORSHV D SRUWLRQ RI WKH YLURSODVP IRUPLQJ D VSKHURLG VKDSHG LPPDWXUH SDUWLFOH ZKLFK DSSHDUV FLUFXODU RQ D WZR GLPHQVLRQDO HOHFWURQ PLFURJUDSK 7KH FLUFXODU LPPDWXUH SDUWLFOH PDWXUHV LQWR WKH FKDUDFWHULVWLF EULFN VKDSHG LQIHFWLRXV YLULRQ 7R DVVHVV YLUDO PRUSKRJHQHVLV HOHFWURQ PLFURJUDSKV ZHUH SUHSDUHG DW KRXUV SRVW LQIHFWLRQ IURP ZLOGW\SH DQG ( LQIHFWHG FHOOV JURZQ DW }& DQG r& )LJ f ,PPDWXUH DQG QXPHURXV PDWXUH YLULRQV FDQ EH FOHDUO\ REVHUYHG LQ WKH ZLOGW\SH LQIHFWHG FHOOV JURZQ DW m& 7KH F\WRSODVP RI FHOOV LQIHFWHG DW r& ZLWK HLWKHU ZLOGW\SH RU ( ZHUH FRPSDUDEOH DQG FRQWDLQHG LPPDWXUH DQG VRPH PDWXUH SDUWLFOHV QRW VKRZQ LQ WKH PLFURJUDSKVf FHQWHUHG DURXQG WKH YLUDO '1$ RU YLURSODVP 7KH UHODWLYH VFDUFLW\ RI PDWXUH SDUWLFOHV LQ WKH ZLOGW\SH RU ( LQIHFWLRQV DW r& UHODWLYH WR ZLOGW\SH DW !& UHIOHFWV WKH GHOD\ LQ GHYHORSPHQW GXH WR WKH ORZHU WHPSHUDWXUH RI LQFXEDWLRQ ,Q DGGLWLRQ IHZHU PDWXUH SDUWLFOHV ZHUH REVHUYHG LQ FHOOV LQIHFWHG ZLWK ( DW m& WKDQ LQ FHOOV

PAGE 156

)LJ (OHFWRQ PLFURJUDSKV RI %6& FHOOV LQIHFWHG ZLWK ZLOG W\SH RU ( YLUXV DW !& DQG R& &HOOV ZHUH LQIHFWHG DW DQ PRL RI DQG SURFHVVHG IRU HOHFWURQ PLFURVFRS\ DW KRXUV SRVW LQIHFWLRQ f ZLOG W\SH r& f ZLOG W\SH r& f ( r& f ( r& 9 YLURSODVP &FUHVFHQW ,LPPDWXUH SDUWLFOH 0PDWXUH SDUWLFOH 0DJQLILFDWLRQV f [ f [ f [ f [

PAGE 157

21

PAGE 158

)LJ FRQWLQXHG 2

PAGE 159

SDQXXXR' n[ f6LM

PAGE 160

)LJ FRQWLQXHG

PAGE 161

LQIHFWHG ZLWK ZLOGW\SH DW m& ZKLFK PD\ LQGLFDWH WKDW WKH ( YLUXV LV VOLJKWO\ FRPSURPLVHG IRU JURZWK DW r& +RZHYHU WKHUH LV D FOHDU GLIIHUHQFH EHWZHHQ WKH ZLOGW\SH DQG PXWDQW LQIHFWLRQV DW r& 9LUWXDOO\ DOO RI WKH FHOOV LQIHFWHG ZLWK ( DW m& FRQWDLQHG ODUJH DPRXQWV RI YLURSODVP DQG RFFDVVLRQDOO\ VRPH LPPDWXUH SDUWLFOHV EXW QR PDWXUH YLUDO SDUWLFOHV ZHUH VHHQ $ PLFURJUDSK RI RQH RI WKH IHZ FHOOV FRQWDLQLQJ DQ\ LPPDWXUH YLUDO SDUWLFOHV LV VKRZQ LQ )LJ ,PPDWXUH SDUWLFOHV ZLWKLQ FHOOV LQIHFWHG ZLWK ( DW r& ZHUH H[WUHPHO\ UDUH DQG LQ QR FDVH ZHUH PDWXUH SDUWLFOHV HYHU VHHQ 7KHVH UHVXOWV LQGLFDWH WKDW XQGHU QRQSHUPLVVLYH FRQGLWLRQV WKH WHPSHUDWXUH VHQVLWLYLW\ RI WKH ( YLUXV OHDGV WR D EORFN LQ YLULRQ PRUSKRJHQHVLV DW LWV HDUOLHVW VWDJHV 5HVROXWLRQ RI ( 7HORPHUHV $ SUHYLRXVO\ GHVFULEHG WHPSHUDWXUHVHQVLWLYH PXWDWLRQ LQ WKH VPDOO VXEXQLW RI WKH YDFFLQLD YLUXV FDSSLQJ HQ]\PH WVf KDV EHHQ VKRZQ WR EH FDSDEOH RI QRUPDO SURWHLQ V\QWKHVLV EXW LV GHIHFWLYH LQ WKH UHVROXWLRQ RI YLUDO '1$ LQWR JHQRPH OHQJWK XQLWV f &KDUDFWHUL]DWLRQ RI WKLV PXWDQW DW m& E\ HOHFWURQ PLFURVFRS\

PAGE 162

KDV UHYHDOHG WKDW WKH LQIHFWHG FHOOV FRQWDLQ YLURSODVP DQG GHIHFWLYH FUHVFHQWV DV ZHOO DV D IHZ LPPDWXUH DQG PDWXUH SDUWLFOHV f %HFDXVH WKLV PXWDWLRQ ZDV LQ D VXEXQLW RI WKH P51$ FDSSLQJ HQ]\PH DQG OLNH ( ZDV GHIHFWLYH LQ PRUSKRJHQHVLV LW ZDV WKHUHIRUH RI LQWHUHVW WR GHWHUPLQH LI WKH ( PXWDQW LV GHIHFWLYH LQ WHORPHUH UHVROXWLRQ 5HVROXWLRQ RI SR[YLUXV FRQFDWDPHUV LQWR JHQRPLF OHQJWK PRQRPHUV FRQWDLQLQJ KDLUSLQ HQGV FDQ EH DVVD\HG E\ 6RXWKHUQ EORW DQDO\VLV RI YLUDO '1$ LVRODWHG DW KUV SRVW LQIHFWLRQ f 7KH SUHVHQFH RI D %VW(,, UHVWULFWLRQ HQGRQXFOHDVH VLWH ZLWKLQ WKH LQYHUWHG WHUPLQDO UHSHDWV GLUHFWO\ DGMDFHQW WR WKH YLUDO WHORPHUHV FDQ EH XVHG WR GLIIHUHQWLDWH EHWZHHQ PRQRPHULF DQG FRQFDWDPHULF IRUPV RI YDFFLQLD JHQRPLF '1$ %VW(,, GLJHVWLRQ RI D JHQRPH OHQJWK PRQRPHU JHQHUDWHV NE IUDJPHQWV RQH GHULYHG IURP HLWKHU VLGH RI WKH JHQRPH )LJ f (DFK NE IUDJPHQW FRQWDLQV WKH YLUDO WHORPHUH DQG IODQNLQJ LQYHUWHG WHUPLQDO UHSHDW VHTXHQFHV f %HFDXVH WKH FRQFDWDPHU MXQFWLRQ LV D GXSOH[ FRS\ RI D YLUDO WHORPHUH GLJHVWLRQ RI FRQFDWDPHULF '1$ ZLWK %VW(,, JHQHUDWHV D NE IUDJPHQW FRQVLVWLQJ RI WKH FRQFDWDPHU MXQFWLRQ IODQNHG RQ HLWKHU VLGH E\ LQYHUWHG WHUPLQDO UHSHDW VHTXHQFHV )LJ f 7KH UHODWLYH HIILFLHQF\ RI

PAGE 163

WHORPHUH UHVROXWLRQ FDQ EH H[SUHVVHG DV WKH SURSRUWLRQ RI WHORPHUH HQGV NE %VW(,, IUDJPHQWVf RYHU WKH DPRXQW RI XQUHVROYHG FRQFDWDPHUV NE %VW(,, IUDJPHQWVf 7RWDO '1$ ZDV SUHSDUHG IURP FHOOV LQIHFWHG DW HLWKHU r& RU m& ZLWK ZLOGW\SH ( RU WKH FRQWURO YLUXV &WV 7KH &WV YLUXV KDV D WHPSHUDWXUHVHQVLWLYH PXWDWLRQ LQ WKH ODUJH VXEXQLW RI WKH YDFFLQLD 51$ SRO\PHUDVH DQG LV GHIHFWLYH LQ ODWH SURWHLQ V\QWKHVLV f /DWH SURWHLQ V\QWKHVLV LV UHTXLUHG IRU WHORPHUH UHVROXWLRQ WKHUHIRUH &WV LV DOVR GHIHFWLYH LQ WKH UHVROXWLRQ RI WHORPHUHV DW r& f 7RWDO '1$ IURP LQIHFWHG FHOOV ZDV LVRODWHG DW DQG KRXUV SRVW LQIHFWLRQ FXW ZLWK %VW(,, DQG VHSDUDWHG RQ DQ DJDURVH JHO (TXLYDOHQW DPRXQWV RI WRWDO '1$ ZHUH ORDGHG LQ HDFK ODQH DV MXGJHG E\ HWKLGLXP EURPLGH VWDLQLQJ RI WKH DJDURVH JHO GDWD QRW VKRZQf 7KH '1$ ZDV WUDQVIHUUHG WR D Q\ORQ PHPEUDQH DQG K\EULGL]HG WR D UDGLRODEHOHG SODVPLG ZKLFK FRQWDLQV D IXOO OHQJWK FRQFDWDPHU MXQFWLRQ f )LJ f 7KHUH DSSHDUV WR EH WZR EDQGV RI NE LQ OHQJWK RQH SRVVLEOH H[SODQDWLRQ LV WKDW WKHVH EDQGV FRUUHVSRQG WR IOLS DQG IORS 5DGLRDFWLYLW\ ERXQG WR WKH PHPEUDQH ZDV TXDQWLWDWHG E\ SKRVSKRULPDJH DQDO\VLV DQG WKH UHVROXWLRQ HIILFLHQF\ RI WKH KRXU VDPSOHV ZDV GHWHUPLQHG

PAGE 164

7DEOH f 7KH UHVROXWLRQ HIILFLHQF\ ZDV GHILQHG DV WKH UDWLR RI WKH UHODWLYH DPRXQWV RI UDGLRDFWLYLW\ K\EULGL]HG WR WKH NE WHORPHUH IUDJPHQWV YHUVXVHV WKH NE FRQFDWDPHU IUDJPHQW 7KH NE IUDJPHQW VHHQ RQ WKH DXWRUDGLRJUDP FRQWDLQV GLUHFW UHSHDW VHTXHQFHV SUR[LPDO WR ERWK WKH WHORPHUH DQG WKH FRQFDWDPHU MXQFWLRQ WKDW K\EULGL]H WR GLUHFW UHSHDW VHTXHQFHV LQ WKH SUREH f %HFDXVH GLJHVWLRQ RI ERWK PRQRPHULF DQG FRQFDWDPHULF '1$ ZLWK %VW(,, \LHOGV DQ NE IUDJPHQW WKH ODEHOLQJ LQWHQVLW\ RI WKLV IUDJPHQW FDQ EH XVHG DV D URXJK PHDVXUH RI WKH WRWDO DPRXQW RI YLUDO '1$ SUHVHQW LQ HDFK VDPSOH &RPSDULVRQ RI WKH UHVROXWLRQ HIILFLHQFLHV DQG WKH DPRXQW RI FRQFDWDPHULF '1$ SUHVHQW LQ WKH ( DQG ZLOG W\SH LQIHFWLRQV DW KRXUV SRVW LQIHFWLRQ LQGLFDWHV WKDW ( LV GHIHFWLYH LQ WHORPHUH UHVROXWLRQ DW r& ,Q WKH r& ZLOGW\SH LQIHFWLRQV D VPDOO DPRXQW RI FRQFDWDPHULF '1$ NE IUDJPHQWf FDQ EH GHWHFWHG E\ KRXUV SRVW LQIHFWLRQ %\ KRXUV WKHUH LV DQ LQFUHDVH LQ WKH DPRXQW RI WRWDO '1$ NE IUDJPHQWf D VOLJKW LQFUHDVH LQ WKH DPRXQW RI FRQFDWDPHULF '1$ DQG D ODUJH LQFUHDVH LQ WKH DPRXQW RI UHVROYHG XQLW OHQJWK JHQRPLF '1$ NE IUDJPHQWf $W r& WKH UHVROXWLRQ

PAGE 165

)LJ 7HORPHUH UHVROXWLRQ RI ZLOG W\SH ( DQG &WV DW m& DQG }& 7RWDO '1$ ZDV LVRODWHG DW WKH WLPHV LQGLFDWHG DERYH HDFK ODQH DQG DQDO\]HG E\ GLJHVWLRQ ZLWK %VW(,, HOHFWURSKRUHVLV WKURXJK D b DJDURVH JHO DQG 6RXWKHUQ EORWWLQJ ZLWK UDGLRODEHOHG S%' SODVPLG DQ DXWRUDGLRJUDP LV VKRZQ 7KH YLUXV DQG LQIHFWLRQ FRQGLWLRQV DUH LQGLFDWHG DW WKH WRS RI WKH ILJXUH 7KH NE WHORPHUH IUDJPHQW DQG WKH NE FRQFDWDPHU MXQFWLRQ DUH LQGLFDWHG WR WKH OHIW %RWWRP 6FKHPDWLF UHSUHVHQWDWLRQ RI WKH DQG NE %VW(,, IUDJPHQWV GHULYHG IURP PRQRPHULF 7HORPHUHf RU FRQFDWDPHULF &RQFDWDPHUf YLUDO '1$ %VW(,, VLWHV DUH LQGLFDWHG E\ DUURZV , GLUHFW UHSHDW VHTXHQFHV 5HODWLYH VL]H DQG JHQRPLF SRVLWLRQ RI WKH FRQFDWDPHU MXQFWLRQ IUDJPHQW LQ SODVPLG S%'

PAGE 166

ZW U L U ( LU &WV 2& r& r& r& r& r& NE NE NE %VW ( ,, NE 7HORPHUHV &RQFDWDPHU L LB L NE NE NE S%'

PAGE 167

7DEOH 7HORPHUH UHVROXWLRQ HIILFLHQF\ ,QIHFWLRQ UHVROXWLRQI HIILFLHQF\ ZLOG W\SH }& ZLOG W\SH !& &WV R& &WV m& ( R& ( r& 3KRVSKRULPDJH DQDO\VLV RI WKH KRXU VDPSOHV ZDV FDUULHG RXW RQ WKH 6RXWKHUQ EORW VKRZQ LQ )LJ W 5HVROXWLRQ HIILFLHQF\ ZDV FDOFXODWHG DV WKH UDWLR RI WKH LQWHQVLW\ RI WKH NE WHORPHUH EDQG RYHU WKH LQWHQVLW\ RI WKH NE FRQFDWDPHU MXQFWLRQ EDQG

PAGE 168

HIILFLHQF\ RI ZLOGW\SH YLUXV LV %\ KRXUV SRVW LQIHFWLRQ LQ WKH ZLOGW\SH LQIHFWLRQV DW r& WKHUH LV D ODUJH DPRXQW RI YLUDO '1$ PRVW RI ZKLFK KDV DOUHDG\ EHHQ UHVROYHG LQWR JHQRPH OHQJWK PRQRPHUV FRPSDUH WKH NE EDQG WR WKH NE EDQGf %\ KRXUV SRVW LQIHFWLRQ DW }& WKHUH LV D IXUWKHU LQFUHDVH LQ WKH WRWDO DPRXQW RI ZLOGW\SH '1$ KDOI RI ZKLFK LV LQ WKH IRUP RI KLJK PROHFXODU ZHLJKW FRQFDWDPHUV NE EDQGf DQG KDOI RI ZKLFK LV LQ WKH IRUP RI PRQRPHUV NE EDQGf KRXUV SRVW LQIHFWLRQ DW r& WKH UHVROXWLRQ HIILFLHQF\ RI ZLOGW\SH YLUXV LV 7KH UHVXOWV VHHQ ZLWK WKH &WV YLUXV GHPRQVWUDWH WKH SDWWHUQ H[SHFWHG RI D PXWDQW ZKLFK LV WHPSHUDWXUHVHQVLWLYH IRU WHORPHUH UHVROXWLRQ $W KRXUV SRVW LQIHFWLRQ DW r& WKH UHVROXWLRQ HIILFLHQF\ RI &WV LV OHVV WKDQ WKDW RI ZLOGW\SH LQGLFDWLQJ WKDW &WV PD\ EH VOLJKWO\ GHIHFWLYH IRU WHORPHUH UHVROXWLRQ DW r& ,Q WKH &WV LQIHFWLRQV DW r& E\ KRXUV SRVW LQIHFWLRQ WKHUH LV DQ LQFUHDVH LQ WKH DPRXQW RI FRQFDWDPHULF '1$ UHODWLYH WR PRQRPHULF '1$ 7KH UHVROXWLRQ HIILFLHQF\ RI &WV KRXUV SRVW LQIHFWLRQ DW m& LV KDOI WKDW RI ZLOGW\SH DW m& ZKLFK FRQILUPV WKH SUHYLRXVO\ UHSRUWHG REVHUYDWLRQ WKDW &WV LV XQDEOH WR HIILFLHQWO\ UHVROYH YLUDO WHORPHUHV

PAGE 169

DW m& f $QDO\VLV RI WKH ( LQIHFWLRQV UHYHDOV WKDW WKH SDWWHUQ RI UHVROXWLRQ DW r& LV VLPLODU WR ZLOGW\SH $W }& E\ KRXUV SRVW LQIHFWLRQ PRVW RI WKH ( '1$ LV LQ WKH IRUP RI KLJK PROHFXODU ZHLJKW FRQFDWDPHUV FRPSDUH WKH LQWHQVLW\ RI WKH NE FRQFDWDPHU MXQFWLRQ EDQG WR WKH NE WHORPHUH EDQGVf %\ KRXUV SRVW LQIHFWLRQ DW }& VRPH RI WKH FRQFDWDPHULF '1$ KDV EHHQ UHVROYHG LQWR XQLW OHQJWK JHQRPHV DQG WKH UHVROXWLRQ HIILFLHQF\ LV ZKLFK LV VLPLODU WR ZLOGW\SH YLUXV DW r& $W r& KRZHYHU WHORPHUH UHVROXWLRQ LQ WKH ( LQIHFWLRQV LV PHDVXUDEO\ GHIHFWLYH $W KRXUV SRVW LQIHFWLRQ DW !& WKH ( LQIHFWHG FHOOV FRQWDLQ D ODUJH DPRXQW RI FRQFDWDPHULF '1$ D SDWWHUQ ZKLFK LV LQGLVWLQJXLVKDEOH IURP WKH ( }& LQIHFWLRQV DW KRXUV SRVW LQIHFWLRQ %\ KRXUV SRVW LQIHFWLRQ DW r& WKHUH LV D ODUJH LQFUHDVH LQ WKH DPRXQW RI FRQFDWDPHULF '1$ DQG RQO\ D VPDOO LQFUHDVH LQ WKH DPRXQW RI PRQRPHULF '1$ 7KH UHVROXWLRQ HIILFLHQF\ RI ( DW r& E\ KRXUV SRVW LQIHFWLRQ LV ZKLFK LV LGHQWLFDO WR WKH UHVROXWLRQ HIILFLHQF\ RI &WV DW R& 7KHVH UHVXOWV LQGLFDWH WKDW ERWK &WV DQG ( DUH XQDEOH WR HIILFLHQWO\ UHVROYH YLUDO WHORPHUHV DW r& $OWKRXJK WKHVH GDWD VKRZ WKDW ( LV WHPSHUDWXUHVHQVLWLYH IRU

PAGE 170

WHORPHUH UHVROXWLRQ WKH\ GR QRW XQHTXLYRFDOO\ SURYH WKDW WKH YDFFLQLD YLUXV P51$ FDSSLQJ HQ]\PH LV GLUHFWO\ LQYROYHG LQ WKH UHVROXWLRQ SURFHVV ,Q 9LWUR $QDO\VLV RI ( 0HWKYOWUDQVIHUDVH $FWLYLW\ 3UHYLRXV ZRUN KDV VKRZQ WKDW WKH FDUER[\O WHUPLQDO GRPDLQ RI WKH YDFFLQLD YLUXV P51$ FDSSLQJ HQ]\PH DORQJ ZLWK WKH IXOO OHQJWK '/ SURWHLQ LV QHFHVVDU\ DQG VXIILFLHQW IRU ZLOGW\SH OHYHOV RI JXDQLQHfPHWK\OWUDQVIHUDVH DFWLYLW\ LQ YLWUR f %HFDXVH WKH ( PXWDWLRQ LV LQ WKH PHWK\OWUDQVIHUDVH DQG '/ GLPHUL]DWLRQ GRPDLQ LW ZDV K\SRWKHVL]HG WKDW WKH ( FDSSLQJ HQ]\PH PD\ EH WKHUPRODELOH IRU PHWK\OWUDQVIHUDVH DFWLYLW\ LQ YLWUR 6LQFH WKH P51$ FDSSLQJ HQ]\PH LV SDFNDJHG LQ YLULRQV DORQJ ZLWK WKH FRPSOHWH FRPSOHPHQW RI HQ]\PHV QHFHVVDU\ IRU HDUO\ YLUDO WUDQVFULSWLRQ PHWK\OWUDQVIHUDVH FDQ EH DVVD\HG LQ DQ P51$ V\QWKHVLV DQG FDSSLQJ UHDFWLRQ GLUHFWHG E\ SXULILHG SHUPHDELOL]HG YLULRQV LQ YLWUR 3HUPHDELOL]HG ( YLULRQV ZHUH SUHLQFXEDWHG LQ WKH DEVHQFH RI ULERQXFOHRWLGHV DW HLWKHU r& r& RU r& IRU SHULRGV RI XS WR RQH KRXU 6DPSOHV ZHUH UHPRYHG GXULQJ WKH FRXUVH RI WKH SUHLQFXEDWLRQ

PAGE 171

DQG DVVD\HG IRU HLWKHU PHWK\OWUDQVIHUDVH RU WUDQVFULSWLRQ DFWLYLW\ DW r& 0HWK\OWUDQVIHUDVH DFWLYLW\ ZDV DVVD\HG E\ IROORZLQJ WKH WUDQVIHU RI UDGLRODEHOHG PHWK\O JURXSV IURP 6DGHQRV\O/ PHWKLRQLQH RQWR 51$ PDGH LQ WKH YLULRQ GLUHFWHG LQ YLWUR FDSSLQJ DQG WUDQVFULSWLRQ UHDFWLRQ 9LUDO WUDQVFULSWLRQ ZDV DVVD\HG E\ IROORZLQJ WKH LQFRUSRUDWLRQ RI UDGLRODEHOHG 873 LQWR 51$ SURGXFHG LQ VLPLODU LQ YLWUR UHDFWLRQV 7UDQVFULSWLRQ ZDV DVVD\HG LQ RUGHU WR GHPRQVWUDWH WKDW WKH ( YLULRQ WUDQVFULSWLRQDO PDFKLQHU\ ZDV SURGXFLQJ DGHTXDWH OHYHOV RI VXEVWUDWH IRU WKH P51$ FDSSLQJ HQ]\PH 7KH UHVXOWV IURP WKHVH H[SHULPHQWV ZHUH QRUPDOL]HG WR DVVD\V GRQH ZLWK HLWKHU ZLOGW\SH RU PXWDQW YLULRQV ZKLFK KDG QRW EHHQ SUHLQFXEDWHG )LJ f 7KH PXWDQW DQG ZLOGW\SH WKHUPDO LQDFWLYDWLRQ SURILOHV IRU WUDQVFULSWLRQ DUH LGHQWLFDO DW DOO WHPSHUDWXUHV DVVD\HG )LJ f 7KHVH UHVXOWV LQGLFDWH WKDW WKH WUDQVFULSWLRQ DSSDUDWXV SDFNDJHG ZLWKLQ ( YLULRQV LV DV WKHUPRVWDEOH DV WKDW SDFNDJHG ZLWKLQ ZLOG W\SH YLULRQV WKXV DQ\ WKHPRODELOLW\ VSHFLILFDOO\ DVVRFLDWHG ZLWK ( PHWK\OWUDQVIHUDVH DFWLYLW\ FDQQRW EH GXH WR D ODFN RI DQ P51$ VXEVWUDWH 3UHLQFXEDWLRQ RI ZLOGW\SH YLULRQV DW R& }& RU R& IRU XS WR KRXU UHVXOWV LQ

PAGE 172

)LJ ,Q YLWUR WUDQVFULSWLRQ DQG PHWK\OWUDQVIHUDVH UHDFWLRQV RI SUHLQFXEDWHG ZLOG W\SH DQG ( YLULRQV 3XULILHG YDFFLQLD YLUXV YLULRQV ZHUH SUHLQFXEDWHG DW r& r& RU m& $W PLQXWH LQWHUYDOV XO VDPSOHV ZHUH UHPRYHG DQG KHOG RQ LFH XQWLO WKH FRQFOXVLRQ RI WKH SUHLQFXEDWLRQ WLPHFRXUVH 7UDQVFULSWLRQ f DQG PHWK\OWUDQVIHUDVH f UHDFWLRQV ZHUH FDUULHG RXW DW r& IRU PLQXWHV DQG WKH UHVXOWV H[SUHVVHG DV WKH SHUFHQW RI DFWLYLW\ UHODWLYH WR QRQSUHLQFXEDWHG FRQWUROV

PAGE 173

SHUFHQW PHWK\OWUDQVIHUDVH SHUFHQW WUDQVFULSWLRQ ZW r& ZW r& ZW r& r& & r& ZW r& ZW r& ZW r& r& & r&

PAGE 174

QR VLJQLILFDQW ORVV RI PHWK\OWUDQVIHUDVH DFWLYLW\ )LJ f 3UHLQFXEDWLRQ RI ( YLULRQV DW r& IRU XS WR RQH KRXU DOVR UHVXOWV LQ QR ORVV RI PHWK\OWUDQVIHUDVH DFWLYLW\ ,Q FRQWUDVW SUHLQFXEDWLRQ RI ( YLULRQV DW !& IRU PLQXWHV UHVXOWV LQ b RI WKH WRWDO PHWK\OWUDQVIHUDVH DFWLYLW\ UHODWLYH WR QRQSUHLQFXEDWHG FRQWUROV 7KHVH UHVXOWV ZHUH FRQILUPHG E\ WKH ( SUHLQFXEDWLRQ H[SHULPHQW FRQGXFWHG DW }& ( YLULRQV SUHLQFXEDWHG DW m& IRU DV OLWWOH DV PLQXWHV VKRZ RQO\ b RI WKH PHWK\OWUDQVIHUDVH DFWLYLW\ RI QRQSUHLQFXEDWHG ( FRQWUROV 3UHLQFXEDWLRQ RI ( DW r& IRU KRXU UHVXOWV LQ RQO\ b RI WKH WRWDO PHWK\OWUDQVIHUDVH DFWLYLW\ UHODWLYH WR WKH FRQWUROV 7DNHQ WRJHWKHU WKH LQ YLWUR WUDQVFULSWLRQ DQG PHWK\OWUDQVIHUDVH GDWD VKRZ WKDW WKH PHWK\OWUDQVIHUDVH DFWLYLW\ RI WKH ( FDSSLQJ HQ]\PH LV WKHUPRODELOH LQ YLWUR 7KH UHVLGXDO DPRXQW RI ( PHWK\OWUDQVIHUDVH DFWLYLW\ SUHVHQW DIWHU WKH PLQXWH SUHLQFXEDWLRQ DW r& RU r& PRVW OLNHO\ UHIOHFWV QRQn VSHFLILF ELQGLQJ RI UDGLRODEHOHG 6DGHQRV\O/PHWKLRQLQH WR WKH ILOWHUV XVHG LQ WKH DVVD\ 7R GHWHUPLQH LI ZLOGW\SH DQG ( YLULRQV FRQWDLQ HTXLYDOHQW DPRXQWV RI FDSSLQJ HQ]\PH SXULILHG YLULRQV ZHUH VXEMHFWHG WR 6'6

PAGE 175

3$*( DQG ZHVWHUQ EORW DQDO\VLV )LJ f 7KLV H[SHULPHQW ZDV GRQH WR GHPRQVWUDWH WKDW WKH WKHUPRODELOLW\ DVVRFLDWHG ZLWK WKH ( P51$ FDSSLQJ HQ]\PH LV QRW GXH WR D GHFUHDVH LQ WKH DPRXQW RI FDSSLQJ HQ]\PH SDFNDJHG ZLWKLQ WKH ( YLULRQ $QDO\VLV RI D &RRPDVVLH EOXH VWDLQHG 6'6 3$*( JHO RI SXULILHG ZLOGW\SH DQG ( YLULRQV GHPRQVWUDWHV WKDW WKHUH LV QR GHWHFWDEOH GLIIHUHQFH LQ WKH SDWWHUQ RU TXDQWLW\ RI SURWHLQV SUHVHQW LQ WKH ( YLULRQV UHODWLYH WR ZLOGW\SH 6XEMHFWLQJ WKH YLULRQV WR ZHVWHUQ EORW DQDO\VLV ZLWK HLWKHU DQWL ',5 RU DQWL '/ DQWLVHUD FRQILUPV WKDW ( YLULRQV SURGXFHG DW m& FRQWDLQ ZLOGW\SH OHYHOV RI FDSSLQJ HQ]\PH 'LVFXVVLRQ 7KH SXUSRVH RI WKLV ZRUN ZDV WR LVRODWH D WHPSHUDWXUH VHQVLWLYH OHVLRQ LQ WKH ODUJH VXEXQLW RI WKH PXOWLIXQFWLRQDO YDFFLQLD YLUXV P51$ FDSSLQJ HQ]\PH WR VWXG\ FDSSLQJ HQ]\PH IXQFWLRQ LQ YLYR ,Q DGGLWLRQ DQG SHUKDSV PRUH LPSRUWDQWO\ WKHVH H[SHULPHQWV ZHUH DOVR GHVLJQHG WR FRQILUP WKH JHQHUDO DSSOLFDELOLW\ RI FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV DQG WUDQVLHQW GRPLQDQW VHOHFWLRQ DV D

PAGE 176

)LJ 6'6 3$*( DQG ZHVWHUQ EORW DQDO\VLV RI SXULILHG ZLOG W\SH DQG ( YLULRQV 3XULILHG ZLOG W\SH ZWf RU ( (f YLULRQV ZHUH DQDO\]HG E\ HOHFWURSKRUHVLV WKURXJK D b 6'6 3$*( JHO DQG VWDLQHG ZLWK &RRPDVVLH EOXH &RRPDVVLHf RU ZHVWHUQ EORWWHG ZLWK SRO\FORQDO DQWLVHUD WR ',5 DQWL',5f RU '/ DQWL'/f

PAGE 177

&RRPDVVLH DQWL' 5 DQWL'/ ZW ( ZW ( ZW ( ‘ E

PAGE 178

GLUHFWHG JHQHWLF PHWKRG IRU WKH FUHDWLRQ RI WHPSHUDWXUHVHQVLWLYH YDFFLQLD YLUXV PXWDQWV 7KH LVRODWLRQ DQG LQ YLYR FKDUDFWHUL]DWLRQ RI WKH ( WHPSHUDWXUHVHQVLWLYH YLUXV GHPRQVWUDWHV WKDW YLUDO PXWDQWV DPHQDEOH WR LQ YLYR VWXG\ FDQ EH FUHDWHG E\ DSSO\LQJ WKLV GLUHFWHG JHQHWLF PHWKRG WR YDFFLQLD YLUXV 6XUSULVLQJO\ YLUDO SURWHLQ V\QWKHVLV '1$ DFFXPXODWLRQ DQG P51$ H[SUHVVLRQ DOO DSSHDUHG QRUPDO LQ WKH ( LQIHFWLRQV DW R& KRZHYHU WHORPHUH UHVROXWLRQ DQG PRUSKRJHQHVLV ZHUH PHDVXUDEO\ GHIHFWLYH ,Q DGGLWLRQ WKH ( FDSSLQJ HQ]\PH ZDV WKHUPRODELOH IRU PHWK\OWUDQVIHUDVH DFWLYLW\ LQ YLWUR 7KH GLUHFWHG JHQHWLF PHWKRG GHYHORSHG IRU YDFFLQLD YLUXV HQWDLOV FUHDWLQJ VLWHVSHFLILF PXWDWLRQV LQ D FORQHG FRS\ RI ',5 VXFK WKDW FOXVWHUV RI FKDUJHG DPLQR DFLGV $VS *OX +LV /\V $UJf FORVHO\ VSDFHG ZLWKLQ WKH SULPDU\ VHTXHQFH RI WKH SURWHLQ DUH PXWDWHG WR DODQLQHV 7KHVH PXWDWLRQV DUH WKHQ UHLQVHUWHG EDFN RQWR WKH YLUDO FKURPRVRPH XVLQJ WUDQVLHQW GRPLQDQW VHOHFWLRQ DV D PHDQV RI UHFRPELQDWLRQ PHGLDWHG JHQH UHSODFHPHQW f 7UDQVLHQW GRPLQDQW VHOHFWLRQ \LHOGV UHFRPELQDQW YLUXVHV ZLWK VHOHFWDEOH SKHQRW\SHV WKDW FRQWDLQ WZR FRSLHV RI ',5 D ZLOGW\SH JHQRPLF FRS\ DQG D FOXVWHUHG

PAGE 179

FKDUJH WR DODQLQH PXWDQW FRS\ %HFDXVH WKH JHQH GXSOLFDWLRQ PDNHV WKHVH YLUXVHV LQKHUHQWO\ XQVWDEOH WKH\ VSRQWDQHRXVO\ UHVROYH ZLWKLQ WKH LQIHFWHG FHOO DQG JHQHUDWH D KHWHURJHQHRXV SRSXODWLRQ RI YLUXVHV RQO\ D IUDFWLRQ RI ZKLFK FRQWDLQ WKH FOXVWHUHG FKDUJH WR DODQLQH DOOHOH VHH FKDSWHU f 2QH RI WKH PDMRU ILQGLQJV RI WKLV ZRUN ZDV WKH GHPRQVWUDWLRQ WKDW YLUXVHV FRQWDLQLQJ D PXWDWLRQ FRQIHUULQJ WHPSHUDWXUH VHQVLWLYLW\ LQ YLYR FDQ EH GHWHFWHG E\ VFUHHQLQJ D UHODWLYHO\ VPDOO QXPEHU RI SODTXHV WRWDOf IRU WHPSHUDWXUH VHQVLWLYLW\ 7KH DQDO\VLV RI WKH SKHQRW\SHV RI FOXVWHUHG FKDUJH WR DODQLQH PXWDWLRQV LQ WKH 6DFFKDURP\FHV FHUHYLVLDH DFWLQ $&7f JHQH DV ZHOO DV WKH SROLRYLUXV 51$ GHSHQGHQW 51$ SRO\PHUDVH JHQH DQG WKH YDFFLQLD YLUXV *5 JHQH LQGLFDWHV WKDW RQ DYHUDJH b RI WKHVH PXWDQWV GLVSOD\ VRPH GHJUHH RI WHPSHUDWXUH VHQVLWLYLW\ LQ YLYR f 7KHUHIRUH WKH UHVXOWV REWDLQHG ZLWK ',5 ZHUH VRPHZKDW VXUSULVLQJ 2QO\ b RXW RI f RI WKH ',5 PXWDQWV WHVWHG ZHUH WHPSHUDWXUHVHQVLWLYH LQ D RQH VWHS JURZWK DVVD\ $ PDMRULW\ RI WKH FOXVWHUHG FKDUJH WR DODQLQH PXWDQWV LQ \HDVW DFWLQ DQG WKH SROLR SRO\PHUDVH ZHUH VLQJOH RU GRXEOH DODQLQH VXEVWLWXWLRQV f

PAGE 180

f +RZHYHU WKH H[SHULPHQWV ZLWK *5 LQGLFDWHG WKDW GRXEOH PXWDWLRQV ZHUH UDWKHU LQHIIHFWXDO LQ SURGXFLQJ YLUXVHV ZKLFK DUH WHPSHUDWXUH VHQVLWLYH LQ D RQH VWHS JURZWK H[SHULPHQW 7KHUHIRUH D PRUH H[WUHPH PXWDJHQHVLV DSSURDFK ZDV WDNHQ ZLWK WKH ',5 JHQH E\ PXWDWLQJ WKUHH WR ILYH FKDUJHG UHVLGXHV WR DODQLQHV ,W LV FRQFHLYDEOH WKDW PDQ\ RI WKH VL[ ',5 PXWDWLRQV ZKLFK ZHUH QRW UHFRYHUHG FRQIHUUHG D OHWKDO SKHQRW\SH GXH WR WKH VHYHUH DOWHUDWLRQ RI WKH FKDUJH FKDUDFWHULVWLFV RI WKH PXWDQW SURWHLQ +RZHYHU WKH UHFRYHU\ RI PXWDQW YLUXVHV (O DQG ( HDFK RI ZKLFK FRQWDLQ PXOWLSOH DODQLQH VXEVWLWXWLRQV DQG QRQH RI ZKLFK DUH WHPSHUDWXUH VHQVLWLYH LQ D RQH VWHS JURZWK H[SHULPHQW LQGLFDWHV WKDW PXOWLSOH DODQLQH VXEVWLWXWLRQV GR QRW LQHYLWDEO\ OHDG WR OHWKDOLW\ 7KH PRVW SODXVLEOH H[SODQDWLRQ IRU WKH DSSDUHQW GLVFUHSDQF\ EHWZHHQ WKH UHVXOWV ZLWK ',5 DQG WKRVH RI RWKHU LQYHVWLJDWRUV LV WKDW WKH FULWHULD XVHG IRU GHILQLQJ WHPSHUDWXUH VHQVLWLYLW\ LQ ',5 LV PRUH VWULQJHQW WKDQ WKDW XVHG E\ RWKHUV 2QO\ WKRVH YDFFLQLD PXWDQWV ZKLFK ZHUH LQFDSDEOH RI IRUPLQJ LQIHFWLRXV SURJHQ\ DW m& LQ D RQH VWHS JURZWK H[SHULPHQW ZHUH FODVVLILHG DV ELRFKHPLFDOO\ XVHIXO WHPSHUDWXUHVHQVLWLYH PXWDQWV 7KHUHIRUH RQO\ PXWDQWV ZKLFK DUH

PAGE 181

, FRQGLWLRQDOO\ OHWKDO DUH ELRFKHPLFDOO\ XVHIXO 7KH QLQH SUHYLRXVO\ UHSRUWHG SROLR YLUXV PXWDQWV DOO SURGXFH LQIHFWLRXV SURJHQ\ LQ D RQH VWHS JURZWK H[SHULPHQW DW !& WKHUHIRUH QRQH RI WKHVH PXWDQWV ZRXOG EH FRQVLGHUHG WR EH ELRFKHPLFDOO\ XVHIXO WHPSHUDWXUH VHQVLWLYH PXWDQWV E\ WKH FULWHULD XVHG LQ WKLV VWXG\ f 7KH \HDVW DFWLQ PXWDQWV ZHUH FODVVLILHG DV WHPSHUDWXUHVHQVLWLYH EDVHG XSRQ WKHLU LQDELOLW\ WR IRUP PDFURVFRSLF FRORQLHV DW WKH QRQSHUPLVVLYH WHPSHUDWXUH r&f f 8QIRUWXQDWHO\ QR LQIRUPDWLRQ LV DYDLODEOH RQ WKH JURZWK NLQHWLFV RI WKHVH PXWDQWV WKHUHIRUH LW LV QRW SRVVLEOH WR GLUHFWO\ FRPSDUH WKH UHVXOWV REWDLQHG ZLWK ',5 WR WKRVH REWDLQHG ZLWK \HDVW DFWLQ +RZHYHU WKH DELOLW\ WR SURGXFH LQIHFWLRXV SURJHQ\ LV VRPHZKDW DQDORJRXV WR WKH DELOLW\ RI D \HDVW FHOO WR GLYLGH LQ FXOWXUH 7KHUHIRUH LI DQ\ RI WKH DFWLQ PXWDQWV FDQ XQGHUJR RQH RU WZR FHOO GLYLVLRQV LQ FXOWXUH WKH\ ZRXOG QRW EH FODVVLILHG DV WHPSHUDWXUHVHQVLWLYH XVLQJ WKH VWULQJHQW FULWHULD DSSOLHG WR WKH ',5 PXWDQWV 0HW\OWUDQVIHUDVH DVVD\V RQ SXULILHG ( YLULRQV LQ YLWUR GHPRQVWUDWHG WKDW VRPH RU DOO RI WKH HQ]\PDWLF DFWLYLWLHV UHTXLUHG IRU FDSSLQJ P51$ DUH WKHUPRODELOH LQ YLWUR %HFDXVH WKH

PAGE 182

PHWK\OWUDQVIHUDVH DVVD\ PHDVXUHV WKH HQGVWDJH UHDFWLRQ LQ WKH P51$ FDSSLQJ SDWKZD\ LW LV GLIILFXOW WR GHILQLWLYHO\ FRQFOXGH WKDW WKH 51$ WULSKRSKDWDVH DQG JXDQ\OWUDQVIHUDVH DFWLYLWLHV DUH QRW WKHUPRODELOH 1RQHWKHOHVV WKH PRVW ORJLFDO LQWHUSUHWDWLRQ RI WKH LQ YLWUR GDWD LV WKDW WKH WKHUPRODELOLW\ DVVRFLDWHG ZLWK WKH ( FDSSLQJ HQ]\PH LV GXH WR D VSHFLILF GHIHFW LQ WKH JXDQLQH fPHWK\OWUDQVIHUDVH 7KH ( PXWDWLRQ LV LQ WKH FDUER[\O WHUPLQXV RI ',5 LQ D UHJLRQ RI WKH SURWHLQ SUHYLRXVO\ UHSRUWHG WR EH UHTXLUHG IRU PHWK\OWUDQVIHUDVH DFWLYLW\ DQG GLPHUL]DWLRQ RI ',5 ZLWK '/ f 7KH DELOLW\ WR VHSDUDWH WKH 51$ WULSKRVSKDWDVH JXDQ\OWUDQVIHUDVH GRPDLQV IURP WKH PHWK\OWUDQVIHUDVH GRPDLQ E\ SURWHRO\VLV RI WKH KRORHQ]\PH GHPRQVWUDWHV WKDW WKHVH GRPDLQV DUH UHODWLYHO\ VHOI FRQWDLQHG DQG DEOH WR DFW DXWRQRPRXVO\ RI HDFK RWKHU f 7KHUHIRUH LW LV XQOLNHO\ WKDW D PXWDWLRQ GHVLJQHG WR FDXVH RQO\ ORFDOL]HG GLVWXUEDQFHV LQ WKH VXUIDFH FKDUJH RI RQH GRPDLQ ZRXOG VHULRXVO\ GLVUXSW DQ\ RI WKH RWKHU GRPDLQV +RZHYHU LW LV SRVVLEOH WKDW WKH ( PXWDWLRQ FDXVHV D JOREDO XQIROGLQJ RI WKH ',5 SURWHLQ DW KLJK WHPSHUDWXUHV UHVXOWLQJ LQ D QRQIXQFWLRQDO HQ]\PH )XUWKHU H[SHULPHQWV DUH QHFHVVDU\ WR GHWHUPLQH LI WKH WKH 51$

PAGE 183

WULSKRVSKDWDVH DQG JXDQ\OWUDQVIHUDVH DFWLYLWLHV DUH DOVR WKHUPRODELOH LQ WKH ( SURWHLQ 7KH GLUHFW LQYROYHPHQW RI WKH YDFFLQLD YLUXV P51$ FDSSLQJ HQ]\PH LQ WKH f HQG IRUPDWLRQ RI YLUDO P51$V HDUO\ WUDQVFULSWLRQ WHUPLQDWLRQ DQG LQWHUPHGLDWH WUDQVFULSWLRQ LQLWLDWLRQ PDGH LW OLNHO\ WKDW D WHPSHUDWXUHVHQVLWLYH FDSSLQJ HQ]\PH PXWDQW ZRXOG EH GHIHFWLYH LQ VRPH RU DOO RI WKHVH SURFHVVHV 8QH[SHFWHGO\ WKH LQ YLYR DQDO\VLV RI SURWHLQ V\QWKHVLV '1$ DFFXPXODWLRQ DQG YLUDO WUDQVFULSWLRQ LQ WKH ( LQIHFWLRQV UHYHDOHG QR GHIHFW WKDW FRXOG DFFRXQW IRU WKH REVHUYHG WHPSHUDWXUH VHQVLWLYLW\ LQ D RQH VWHS JURZWK H[SHULPHQW ,Q DGGLWLRQ QRUWKHUQ EORW DQDO\VLV RI 51$ LVRODWHG IURP ( LQIHFWHG FHOOV UHYHDOHG QR GHWHFWDEOH GHIHFWV LQ HDUO\ WUDQVFULSWLRQ WHUPLQDWLRQ RU LQWHUPHGLDWH WUDQVFULSWLRQ LQLWLDWLRQ DW WKH QRQSHUPLVVLYH WHPSHUDWXUH 7KHUH DUH D QXPEHU RI SRVVLEOH H[SODQDWLRQV IRU WKH GLVSDULW\ EHWZHHQ WKH LQ YLYR DQG LQ YLWUR GDWD $ FHOOXODU HQ]\PH PD\ FRPSHQVDWH LQ YLYR IRU WKH WKHUPRODELOLW\ RI WKH ( PHWK\OWUDQVIHUDVH DFWLYLW\ $ F\WRSODVPLF JXDQLQHfPHWK\OWUDQVIHUDVH DFWLYLW\ KDV EHHQ LVRODWHG IURP +H/D FHOOV D VLPLODU HQ]\PH ZLWKLQ %6& FHOOV FRXOG FRPSHQVDWH IRU D

PAGE 184

YDFFLQLD PHWK\OWUDQVIHUDVH GHIHFW LQ YLYR f $OWHUQDWLYHO\ WKH ( PXWDWLRQ PD\ UHVXOW LQ D WKHUPRVHQVLWLYH GHIHFW ZKLFK LQFUHDVHV WKH .P IRU 6DGHQRV\O/PHWKLRQLQH ELQGLQJ ZKLFK LV FRPSHQVDWHG LQ YLYR E\ KLJKHU OHYHOV RI 6DGHQRV\O/PHWKLRQLQH WKDQ WKRVH XVHG LQ YLWUR 3UHFHGHQFH IRU WKLV K\SRWKHVLV FRPHV IURP UHSRUWV RI WHPSHUDWXUHVHQVLWLYH PHWK\OWUDQVIHUDVH PXWDQWV RI YHVLFXODU VWRPDWLWLV YLUXV $OO RI WKHVH PXWDQWV GLVSOD\ D KRVW UDQJH GHIHFW LQ ZKLFK WKH SHUPLVVLYH FHOO OLQHV KDYH KLJKHU LQWUDFHOOXODU OHYHOV RI 6DGHQRV\O/PHWKLRQLQH WKDQ WKHLU QRQSHUPLVVLYH FRXQWHUSDUWV f 7KH PHWK\OWUDQVIHUDVH GHIHFW RI RQH RI WKHVH PXWDQWV FDQ EH UHVFXHG LQ YLWUR E\ KLJK OHYHOV RI 6 DGHQRV\OPHWKLRQLQH $ WKLUG SRVVLELOLW\ LV WKDW WKH ( HQ]\PH LV VWDELOL]HG LQ YLYR SRVVLEO\ WKURXJK WKH IRUPDWLRQ RI D KLJKHU RUGHU FRPSOH[ DQG WKDW WUHDWPHQW RI WKH YLULRQV LQ YLWUR GLVUXSWV WKLV FRPSOH[ DQG XQPDVNV WKH WKHUPRODELOLW\ RI ( 3KHQRW\SLFDOO\ WKH ( PXWDQW LV XQDEOH WR HIIHFWLYHO\ UHVROYH YLUDO WHORPHUHV DQG IRUP YLULRQ SDUWLFOHV DW !& 7KLV FRXOG EH D GLUHFW RU LQGLUHFW HIIHFW RI ORVV RI FDSSLQJ HQ]\PH IXQFWLRQ 3UHYLRXV VWXGLHV KDYH VKRZQ WKDW YLUWXDOO\ DOO RI WKH WHPSHUDWXUH

PAGE 185

VHQVLWLYH PXWDQWV GHIHFWLYH LQ WHORPHUH UHVROXWLRQ DUH FRQFRPLWDQWO\ GHIHFWLYH LQ ODWH YLUDO SURWHLQ V\QWKHVLV f 7KLV REVHUYDWLRQ KDV OHDG WR WKH EHOLHI WKDW UHVROXWLRQ LV FDWDO\]HG E\ D ODWH SURWHLQVf /DWH SURWHLQ V\QWKHVLV LV FOHDUO\ UHTXLUHG IRU PRUSKRJHQHVLV GXH WR WKH IDFW WKDW WKH VWUXFWXUDO FRPSRQHQWV RI WKH YLULRQ SDUWLFOH DUH HQFRGHG E\ ODWH JHQHV f $ WHPSHUDWXUHVHQVLWLYH PXWDQW LQ WKH VPDOO VXEXQLW RI WKH P51$ FDSSLQJ HQ]\PH WVf VKRZV QR REVHUYDEOH ODWH SURWHLQ V\QWKHVLV GHIHFW EXW LV GHIHFWLYH LQ ERWK WHORPHUH UHVROXWLRQ DQG PRUSKRJHQHVLV f 7KH VLPSOHVW H[SODQDWLRQ IRU WKH REVHUYHG GDWD ZLWK ERWK ( DQG WV LV WKDW WKH P51$ FDSSLQJ HQ]\PH GRHV QRW GLUHFWO\ SDUWLFLSDWH LQ HLWKHU WHORPHUH UHVROXWLRQ RU PRUSKRJHQHVLV EXW WKDW WKH PXWDQW SKHQRW\SHV DUH SOHLRWURSLF HIIHFWV RI DQ XQGHWHFWHG GHIHFW LQ ODWH YLUDO SURWHLQ V\QWKHVLV )RU H[DPSOH D VOLJKW UHGXFWLRQ LQ WKH TXDQWLW\ RI D FULWLFDO ODWH SURWHLQ GLUHFWO\ LQYROYHG LQ WHORPHUH UHVROXWLRQ FRXOG GLVUXSW WKH UHVROXWLRQ SURFHVV $ VLPLODU DUJXPHQW FRXOG EH PDGH IRU YLULRQ PRUSKRJHQHVLV $ PRUH LQWHUHVWLQJ K\SRWKHVLV LV WKDW WKH YDFFLQLD P51$ FDSSLQJ HQ]\PH LV GLUHFWO\ LQYROYHG LQ WHORPHUH UHVROXWLRQ DQG WKH ODFN RI XQLW OHQJWK JHQRPHV

PAGE 186

DV VXEVWUDWHV IRU PRUSKRJHQHVLV OHDGV WR D FRUUHVSRQGLQJ GHIHFW LQ YLUXV DVVHPEO\ 7KLV ZRXOG UHTXLUH WKDW WKH HDUO\ VWHSV LQ PRUSKRJHQHVLV EH GLUHFWO\ FRXSOHG WR WHORPHUH UHVROXWLRQ 7KH FRQYHUVH VLWXDWLRQ LQ ZKLFK UHVROXWLRQ LV FRXSOHG WR PRUSKRJHQHVLV LV FOHDUO\ QRW WUXH GXH WR WKH IDFW WKDW WHORPHUH UHVROXWLRQ LQ YLYR LV XQHIIHFWHG E\ ULIDPSLFLQ WUHDWPHQW D SRWHQW LQKLELWRU RI WKH HDUO\ VWDJHV RI SR[YLUXV PRUSKRJHQHVLV f ,Q DGGLWLRQ WHPSHUDWXUH VHQVLWLYH PXWDQWV LQ 25) WKH ULIDPSLFLQ UHVLVWDQFH ORFXVf ZKLFK LV WKRXJKW WR EH LQYROYHG LQ WKH SURWHO\WLF SURFHVVLQJ RI YLUDO FRUH SRO\SHSWLGHV f DUH GHIHFWLYH LQ HDUO\ PRUSKRJHQHVLV EXW QRW LQ WHORPHUH UHVROXWLRQ f 7KHVH GDWD SURYLGH IDLUO\ FRQFOXVLYH HYLGHQFH WKDW PRUSKRJHQHVLV LV QRW UHTXLUHG IRU WHORPHUH UHVROXWLRQ +RZHYHU WKH UHTXLUHPHQW IRU UHVROYHG XQLW OHQJWK JHQRPHV DV VXEVWUDWHV IRU SDUWLFOH IRUPDWLRQ LV VRPHZKDW OHVV FOHDU 8QIRUWXQDWHO\ DOO RI WKH UHVROXWLRQ GHIHFWLYH PXWDQWV H[FHSW WV DQG ( GLVSOD\ GHIHFWV LQ ODWH SURWHLQ V\QWKHVLV VXFK GHIHFWV ZRXOG EH H[SHFWHG WR GLUHFWO\ DIIHFW PRUSKRJHQHVLV :KHWKHU RU QRW UHVROYHG JHQRPHV DUH UHTXLUHG SULRU WR WKH HDUO\ VWDJHV RI YLUDO DVVHPEO\ LV SUHVHQWO\ XQNQRZQ $OWKRXJK LQ WKH DEVHQFH RI D GHIHFW

PAGE 187

LQ ODWH SURWHLQ V\QWKHVLV WKH SKHQRW\SHV RI ( DQG WV ZRXOG VHHP WR VXJJHVW WKDW UHVROXWLRQ LV UHTXLUHG IRU WKH HDUO\ VWDJHV RI YLUDO PRUSKRJHQHVLV 7KH UHVROXWLRQ HYHQW LV D VLWHVSHFLILF UHFRPELQDWLRQ WKDW UHTXLUHV D SXWDWLYH '1$ UHVROYDVH DQG WZR LQYHUWHG FLVDFWLQJ VHTXHQFHV WHUPHG WKH WHORPHUH UHVROXWLRQ WDUJHWV 0XWDWLRQDO DQDO\VLV KDV FOHDUO\ GHILQHG WKH QDWXUH RI WKH FLV DFWLQJ VHTXHQFHV EXW WKHUH DV \HW KDV EHHQ QR SXEOLVKHG GDWD RQ WKH LGHQWLW\ RI WKH '1$ UHVROYDVH f 7KH ODFN RI DQ\ REVHUYHG ODWH SURWHLQ V\QWKHVLV GHIHFWV LQ WKH ( DQG WV PXWDQWV FRXOG EH FRQVWUXHG DV HYLGHQFH IRU D PRUH GLUHFW LQYROYHPHQW RI WKH YDFFLQLD FDSSLQJ HQ]\PH LQ WHORPHUH UHVROXWLRQ +RZHYHU LW PXVW EH VWUHVVHG WKDW WKLV LV VWULFWO\ D SKHQRW\SLF REVHUYDWLRQ ZLWK QR FRUURERUDWLQJ ELRFKHPLFDO GDWD DQG DV VXFK FRXOG UHSUHVHQW D SOHLWURSLF HIIHFW RI DQ DV \HW XQREVHUYHG ODWH SURWHLQ V\QWKHVLV GHIHFW 1HYHUWKHOHVV WKHUH LV VRPH ELRFKHPLFDO GDWD DERXW WKH WHORPHUH UHVROXWLRQ WDUJHW WKDW FDQ EH XVHG WR IRUP D UDWLRQDO K\SRWKHVLV DERXW WKH SRVVLEOH UROHV WKH FDSSLQJ HQ]\PH PLJKW SOD\ LQ UHVROXWLRQ 7KH WHORPHUH UHVROXWLRQ WDUJHW IXQFWLRQV DV D SURPRWHU GXULQJ WKH ODWWHU VWDJHV RI WKH YDFFLQLD

PAGE 188

UHSOLFDWLRQ F\FOH f 7KH WHORPHULF P51$ GRHV QRW FRGH IRU D SURWHLQ f $W WKLV WLPH LW LV XQNQRZQ ZKHWKHU WKH WHORPHUH UHVROXWLRQ WDUJHW IXQFWLRQV DV DQ LQWHUPHGLDWH RU D ODWH SURPRWHU 0F)DGGHQ SHUVRQDO FRPPXQLFDWLRQf ,W LV DOVR XQFOHDU ZKHWKHU RU QRW WUDQVFULSWLRQ LV UHTXLUHG WKURXJK WKLV UHJLRQ IRU WKH UHVROXWLRQ HYHQW ,I WKH WHORPHUH UHVROXWLRQ WDUJHW IXQFWLRQV DV DQ LQWHUPHGLDWH SURPRWHU DQG LI WUDQVFULSWLRQ RI WKLV UHJLRQ LV UHTXLUHG IRU WKH UHVROXWLRQ HYHQW WKHQ WKH GHIHFW LQ ( FRXOG EH H[SODLQHG DV DQ LQDELOLW\ WR HIILFLHQWO\ FDWDO\]H WUDQVFULSWLRQ RI WKH WHORPHUH UHVROXWLRQ WDUJHW $OWKRXJK RXU DQDO\VLV RI WKH LQWHUPHGLDWH *5 P51$ WUDQVFULSW LQGLFDWHV WKDW ( LV FDSDEOH RI WUDQVDFWLYDWLQJ WUDQVFULSWLRQ RI DW OHDVW RQH LQWHUPHGLDWH JHQH DW r& LW LV SRVVLEOH WKH WHORPHUH UHVROXWLRQ WDUJHW FRXOG EH PRUH VHQVLWLYH WR VOLJKW SHUWXUEDWLRQV LQ WUDQVFULSWLRQ WKDW DUH XQGHWHFWDEOH LQ WKH QRUWKHUQ DVVD\ RI *5 ,W KDV SUHYLRXVO\ EHHQ SURSRVHG WKDW ELQGLQJ RI WKH WUDQVFULSWLRQ PDFKLQHU\ WR WKH WHORPHUH UHVROXWLRQ WDUJHW RU WKH WHORPHULF 51$V WKHPVHOYHV PD\ SOD\ D UROH LQ WKH UHVROXWLRQ HYHQW f ,I WKLV LV WKH FDVH WKHQ D WUDQVFULSWLRQ FRPSOH[ FRQWDLQLQJ ( FDSSLQJ HQ]\PH PD\ GLUHFWO\ DIIHFW WKH UHVROXWLRQ HYHQW WKURXJK D

PAGE 189

VOLJKW GHIHFW LQ WUDQVFULSWLRQDO DFWLYLW\ RU P51$ VWDELOLW\ 7KH SUHVHQW VWXG\ DV ZHOO DV WKH ZRUN RQ WV DOWKRXJK LQWULJXLQJ GRHV QRW FRQFOXVLYHO\ SURYH RU GLVSURYH WKDW WKH FDSSLQJ HQ]\PH IXQFWLRQV GLUHFWO\ DV SDUW RI WKH SXWDWLYH '1$ UHVROYDVH FRPSOH[ ,Q FRQFOXVLRQ WKH LVRODWLRQ RI ( GHPRQVWUDWHV WKH IHDVLELOLW\ RI XVLQJ FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV DQG WUDQVLHQW GRPLQDQW VHOHFWLRQ DV D PHWKRG IRU FUHDWLQJ QRYHO YDFFLQLD YLUXV PXWDQWV WKDW DUH WHPSHUDWXUHVHQVLWLYH ERWK LQ YLYR DQG LQ YLWUR 7KH SKHQRW\SLF FKDUDFWHUL]DWLRQ RI WKH ( PXWDQW DOVR VKRZV WKDW WKLV GLUHFWHG YLUDO JHQHWLF PHWKRG FDQ SURGXFH UHDJHQWV XVHIXO IRU WKH VWXG\ RI WKH YDFFLQLD YLUXV OLIH F\FOH LQ YLYR

PAGE 190

&+$37(5 6800$5< 7KLV ZRUN KDV GHPRQVWUDWHG WKDW FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV DQG WUDQVLHQW GRPLQDQW VHOHFWLRQ FDQ EH XVHG WR FUHDWH FRQGLWLRQDO OHWKDO WHPSHUDWXUHVHQVLWLYH YDFFLQLD YLUXV PXWDQWV 7KH LVRODWLRQ RI D ELRFKHPLFDOO\ XVHIXO FRQGLWLRQDO OHWKDO DOOHOH RI WKH YDFFLQLD YLUXV P51$ FDSSLQJ HQ]\PH KDV SURYHQ WKH JHQHUDO DSSOLFDELOLW\ RI WKHVH WHFKQLTXHV DV D VWUDWHJ\ IRU LVRODWLQJ QRYHO PXWDQWV DPHQDEOH WR ELRFKHPLFDO FKDUDFWHUL]DWLRQ LQ YLYR 7KH PHFKDQLFV RI WKH SURWRFRO DQG WKH SKHQRW\SH RI WKH P51$ FDSSLQJ HQ]\PH PXWDQW ( KDYH EHHQ GLVFXVVHG LQ WKH SUHFHGLQJ FKDSWHUV WKHUHIRUH WKLV FKDSWHU ZLOO IRFXV SULPDULO\ RQ D VXPPDU\ RI ZKDW KDV EHHQ OHDUQHG DERXW WKH WHFKQLTXH DQG SRVVLEOH ZD\V LQ ZKLFK WR LPSURYH WKH PHWKRG 3RWHQWLDO H[SHULPHQWV GHVLJQHG WR PRUH FORVHO\ H[DPLQH WKH ',5 PXWDQWV LQ YLYR DQG LQ YLWUR ZLOO DOVR EH GLVFXVVHG

PAGE 191

&OXVWHUHG &KDUJH WR $ODQLQH 0XWDJHQHVLV 7KH LQLWLDO REVHUYDWLRQ WKDW FKDUJH WR DODQLQH PXWDWLRQV LQ WKH 6DFFKDURPYFHV FHUHYLVLDH DFWLQ SURWHLQ SURGXFHG PXWDQWV ZKLFK ZHUH WHPSHUDWXUHVHQVLWLYH LQ YLYR KDV QRZ EHHQ FRUURERUDWHG E\ WKH LVRODWLRQ RI FKDUJH WR DODQLQH WHPSHUDWXUHVHQVLWLYH PXWDWLRQV LQ WKH 6DFFKDURPYFHV FHUHYLVLDH XELTXLWLQFRQMXJDWLQJ HQ]\PH &'& 8%&f SROLR 51$ GHSHQGDQW 51$ SRO\PHUDVH WKH +,9 LQWHJUDVH DQG WKH YDFFLQLD YLUXV JHQHV *5 DQG ',5 f +RZHYHU WKH TXHVWLRQ VWLOO UHPDLQV DV WR KRZ VXFFHVVIXO WKLV PHWKRG LV LQ SURGXFLQJ ELRFKHPLFDOO\ XVHIXO WHPSHUDWXUHVHQVLWLYH PXWDQWV 7R FRQVLGHU WKH RYHUDOO VXFFHVV RI FKDUJH WR DODQLQH PXWDJHQHVLV D GLVWLQFWLRQ PXVW EH PDGH EHWZHHQ WKH PXWDQWV ZKLFK DUH PHUHO\ WHPSHUDWXUHVHQVLWLYH DV RSSRVHG WR WKRVH ZKLFK DUH WHPSHUDWXUHV VHQVLWLYH FRQGLWLRQDO OHWKDOV )RU YDFFLQLD YLUXV WKH JRDO ZDV WR FUHDWH PXWDWLRQV ZKLFK FRXOG EH VWXGLHG LQ YLYR WKHUHIRUH FRQGLWLRQDO OHWKDOLW\ ZDV D UHTXLVLWH FKDUDFWHULVWLF RI DOO ELRFKHPLFDOO\ XVHIXO PXWDQWV (YHQ WKRXJK WKUHH RI WKH ',5 PXWDQWV

PAGE 192

ZHUH WHPSHUDWXUHVHQVLWLYH IRU SODTXH IRUPDWLRQf RQO\ RQH (f FRXOG EH VWXGLHG LQ YLYR 7KHUHIRUH WKH VXFFHVV UDWH RI FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV LQ ',5 ZDV b f /LNHZLVH WKH VXFFHVV UDWH RI FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV ZLWK *5 ZDV b f )RU \HDVW DFWLQ DQG WKH XELTXLWLQFRQMXJDWLQJ HQ]\PH &'& WKH SURSRUWLRQ RI WHPSHUDWXUHVHQVLWLYH PXWDQWV ZDV b DQG b UHVSHFWLYHO\ f $OO RI WKH DFWLQ DQG &'& WHPSHUDWXUH VHQVLWLYH PXWDQWV DUH FRQGLWLRQDOO\ OHWKDO IRU FRORQ\ IRUPDWLRQ EXW WKHLU JURZWK FKDUDFWHULVWLFV LQ FXOWXUH DUH XQNQRZQ &RQVHTXHQWO\ LW LV GLIILFXOW WR GHWHUPLQH KRZ PDQ\ RI WKHVH PXWDQWV DUH ELRFKHPLFDOO\ XVHIXO $W EHVW WKH VXFFHVV UDWH RI FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV ZLWK \HDVW DFWLQ DQG &'& LV b DQG b UHVSHFWLYHO\ )RU WKH SROLR SRO\PHUDVH JHQH WKH SURSRUWLRQ RI PXWDQWV WKH DXWKRUV FODVVLILHG DV WHPSHUDWXUHVHQVLWLYH ZDV b DOWKRXJK DV GLVFXVVHG LQ FKDSWHU QRQH RI WKHVH PXWDWLRQV SURGXFHG FRQGLWLRQDO OHWKDO YLUXVHV f 7KHUHIRUH E\ WKH FULWHULD DGRSWHG IRU WKH YDFFLQLD YLUXV PXWDQWV WKH VXFFHVV UDWH RI FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV ZLWK UHVSHFW WR WKH SROLR YLUXV SRO\PHUDVH ZRXOG E\ b 2QO\ RQH RI WKH WZHQW\ IRXU PXWDWLRQV bf FUHDWHG LQ

PAGE 193

WKH KXPDQ LPPXQRGHILFLHQF\ YLUXV W\SH LQWHJUDVH JHQH \LHOGHG D WHPSHUDWXUHVHQVLWLYH YLUXV QHYHUWKHOHVV WKLV PXWDQW LV FRQGLWLRQDOO\ OHWKDO f &ROOHFWLYHO\ WKHVH UHVXOWV GHPRQVWUDWH WKDW FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV FDQ EH XVHG WR FUHDWH PXWDWLRQV ZKLFK DUH FRQGLWLRQDOO\ OHWKDO LQ YLYR DOWKRXJK WKH VXFFHVV UDWHV YDU\ FRQVLGHUDEO\ 7R LQFUHDVH WKH SUREDELOLW\ RI LVRODWLQJ D FRQGLWLRQDO OHWKDO YDFFLQLD YLUXV PXWDQW WKH PXWDWLRQV VKRXOG EH VFDWWHUHG WKURXJKRXW WKH SURWHLQ DQG FRQVLVW RI DW OHDVW GRXEOH RU WULSOH DPLQR DFLG FKDQJHV $OWHULQJ WZR FKDUJHG DPLQR DFLGV WR DODQLQHV LQ *5 ZDV FRPSOHWHO\ LQHIIHFWXDO LQ SURGXFLQJ FRQGLWLRQDO OHWKDOLW\ VHH FKDSWHU f ,QWHUHVWLQJO\ WKH ORZ SURSRUWLRQ RI WHPSHUDWXUHVHQVLWLYH PXWDQWV LQLWLDOO\ LVRODWHG LQ WKH \HDVW XELTXLWLQFRQMXJDWLQJ HQ]\PH OHG WKH LQYHVWLJDWRUV WR FUHDWH PXWDQWV ZKLFK FRQVLVWHG RI FRPELQDWLRQV RI FOXVWHUHG FKDUJH PXWDWLRQV )RXU DGGLWLRQDO fPXOWLSOH VFDQf PXWDQWV ZHUH FUHDWHG E\ FRPELQLQJ WZR SUHYLRXVO\ FUHDWHG QRQWHPSHUDWXUHVHQVLWLYH PXWDWLRQV ZLWKLQ D VLQJOH PXWDQW f $OWKRXJK QRQH RI WKHVH PXOWLSOH VFDQ PXWDQWV ZHUH FRQGLWLRQDOO\ OHWKDO WZR ZHUH PLOGO\ WHPSHUDWXUHVHQVLWLYH IRU

PAGE 194

FRORQ\ IRUPDWLRQ 7KLV UDLVHV WKH SRVVLELOLW\ WKDW PXOWLSOH PXWDWLRQV ZLWKLQ GLIIHUHQW UHJLRQV RI D SURWHLQ FRXOG EH GHVLJQHG WR LQFUHDVH WKH SURSRUWLRQ RI FRQGLWLRQDOO\ OHWKDO PXWDQWV ,W LV VRPHZKDW XQFOHDU H[DFWO\ KRZ FOXVWHUHG FKDUJH WR DODQLQH PXWDWLRQV FRXOG OHDG WR VXFK D KLJK SURSRUWLRQ RI LQ YLYR WHPSHUDWXUHVHQVLWLYH PXWDQWV ,W KDV EHHQ K\SRWKHVL]HG WKDW PXWDWLQJ KLJKO\ FKDUJHG UHJLRQV RI D SURWHLQ WDUJHWV DPLQR DFLGV ZKLFK DUH ORFDWHG RQ WKH VXUIDFH RI WKH IROGHG SURWHLQ f &RPSDULVRQ RI WKH FKDUJHG FOXVWHUV RI WKH 6DFFKDURPYFHV FHUHYLVLDH DFWLQ SURWHLQ ZLWK WKH WKUHHGLPHQVLRQDO DFWLQ'1$VH FRFU\VWDO VWUXFWXUH VXSSRUWV WKLV K\SRWKHVLV f 2I WKH FOXVWHUHG FKDUJH WR DODQLQH PXWDWLRQV UHFRYHUHG LQ \HDVW DFWLQ b WDUJHWHG DPLQR DFLGV ORFDWHG RQ WKH VXUIDFH RI WKH FU\VWDO VWUXFWXUH DQG b RI WKHVH DPLQR DFLGV DUH H[SRVHG WR WKH VROYHQW f 8QIRUWXQDWHO\ WKHUH LV QR FU\VWDOORJUDSKLF GDWD DYDLODEOH RQ DQ\ RI WKH RWKHU SURWHLQV WKDW KDYH EHHQ VXEMHFWHG WR FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV 7KHUHIRUH LW LV GLIILFXOW WR VD\ ZLWK FHUWDLQW\ WKDW WKH FKDUJH FOXVWHUV LQ *5 RU ',5 DUH ORFDWHG RQ WKH VXUIDFH RI WKH IROGHG SURWHLQ

PAGE 195

+RZ GR WKHVH PXWDWLRQV H[HUW WKHLU HIIHFWV DQG ZK\ GR VR PDQ\ VHHP WR SURGXFH D WHPSHUDWXUHVHQVLWLYH SKHQRW\SH LQ YLYR" %HQQHWW HW DO RULJLQDOO\ SURSRVHG WKDW FOXVWHUV RI FKDUJHG DPLQR DFLGV ORFDWHG RQ D SURWHLQfV VXUIDFH ZRXOG EH LPSRUWDQW PHGLDWRUV RI SURWHLQSURWHLQ LQWHUDFWLRQV WKURXJK WKH HOHFWURVWDWLF DWWUDFWLRQ RI RSSRVLWHO\ FKDUJHG DPLQR DFLGV RQ HDFK SURWHLQ f &KDUJHG DPLQR DFLGV GR SOD\ FULWLFDO UROHV LQ SURWHLQSURWHLQ LQWHUDFWLRQV LQ WKH FRRUGLQDWLRQ RI PHWDO LRQV LQ PHWDOORSURWHLQV DQG WKH LQWHUDFWLRQ RI QXFOHLF DFLG ELQGLQJ SURWHLQV ZLWK WKHLU VXEVWUDWHV 6R LW LV D ORJLFDO DVVXPSWLRQ WKDW WKH ORVV RI VXUIDFH FKDUJHV FRXOG OHDG WR D GHVWDELOL]DWLRQ RI LQWHUSURWHLQ LQWHUDFWLRQV 7KH KLJKHU WKH WHPSHUDWXUH WKH OHVV VWDEOH WKH UHPDLQLQJ LQWHUDFWLRQV DUH EHWZHHQ WKH PXWDQW SURWHLQ DQG LWV SDUWQHU ZKLFK UHVXOWV LQ D ORVV RI DFWLYLW\ 0XWDWLRQV ZKLFK RQO\ DOWHU LQWHUSURWHLQ LQWHUDFWLRQV ZRXOG EH H[SHFWHG WR EH WHPSHUDWXUHVHQVLWLYH IRU IXQFWLRQ $OWHUQDWLYHO\ WKH FRUUHFW IROGLQJ RI WKH PXWDQW SURWHLQ GXULQJ V\QWKHVLV LQ YLYR FRXOG EH GLVUXSWHG E\ WKH ORVV RI FKDUJHG UHVLGXHV OHDGLQJ WR D WHPSHUDWXUHVHQVLWLYH IRU V\QWKHVLV SKHQRW\SH 7KLV LV FOHDUO\ QRW WKH FDVH IRU WKH ',5 PXWDQW ( EHFDXVH ( P51$ FDSSLQJ

PAGE 196

HQ]\PH FUHDWHG DW r& FDQ EH WKHUPDOO\ LQDFWLYDWHG LQ YLWUR E\ LQFXEDWLQJ DW r& 7KH WKHUPDO LQDFWLYDWLRQ RI ( LQGLFDWHV WKDW WKLV SDUWLFXODU PXWDWLRQ LV WHPSHUDWXUHVHQVLWLYH IRU IXQFWLRQ DW OHDVW LQ YLWUR ,Q YLYR D FRPELQDWLRQ RI PLVIROGLQJ GXULQJ ',5 V\QWKHVLV DQG WKHUPDO LQDFWLYDWLRQ PD\ RFFXU DW WKH QRQSHUPLVVLYH WHPSHUDWXUH $W WKH SUHVHQW WLPH LW LV QRW NQRZQ LI WKH WKHUPDO LQDFWLYDWLRQ SKHQRW\SH RI WKH ( ',5 SURWHLQ LV GXH WR WKH FRPSOHWH GHQDWXUDWLRQ RI ',5 D GHVWDELOL]DWLRQ RI WKH '5'/ KHWHURGLPHU RU D VSHFLILF GHIHFW LQ WKH FDWDO\WLF DFWLYLW\ RI WKH PHWK\OWUDQVIHUDVH ZKLFK PD\ KDYH QR HIIHFW RQ WKH IROGLQJ RI ',5 RU WKH VWDELOLW\ RI WKH '5'/ LQWHUDFWLRQ VHH EHORZf 7UDQVLHQW 'RPLQDQW 6HOHFWLRQ )RU WKH LQ YLYR DQDO\VLV RI PXWDQW SKHQRW\SHV RQH QHHGV D SURWRFRO WKDW SODFHV WKH PXWDQW DOOHOH ZLWKLQ LWV QRUPDO FKURPRVRPDO FRQWH[W XQGHU WKH WUDQVFULSWLRQDO FRQWURO RI WKH QDWLYH SURPRWHU 7UDQVLHQW GRPLQDQW VHOHFWLRQ HQVXUHV WKDW WKH YLUXVHV ZLWKLQ HDFK P\FRSKHQROLF DFLG UHVLVWDQW SODTXH ZHUH RULJLQDOO\ GHULYHG IURP D

PAGE 197

UHFRPELQDQW ZKLFK LQWHJUDWHG WKH PXWDQW DOOHOH f 7R GHWHUPLQH LI DQ DOOHOH FRQIHUV D WHPSHUDWXUHVHQVLWLYH SKHQRW\SH RQO\ D VPDOO SURSRUWLRQ RI WKH WRWDO SURJHQ\ IURP WKH LQIHFWLRQ WUDQVIHFWLRQ QHHG WR EH VFUHHQHG LQGLYLGXDOO\ IRU WHPSHUDWXUH VHQVLWLYLW\ 7KH WHPSHUDWXUHVHQVLWLYH PXWDQWV FDQ WKHQ EH WHVWHG IRU FRQGLWLRQDO OHWKDOLW\ LQ D RQH VWHS JURZWK H[SHULPHQW +RZHYHU ZLWK PLQRU PRGLILFDWLRQV WUDQVLHQW GRPLQDQW VHOHFWLRQ FRXOG DOVR EH XVHG WR LVRODWH VRPH RI WKH QRQWHPSHUDWXUHVHQVLWLYH FOXVWHUHG FKDUJH WR DODQLQH PXWDWLRQV 3RO\PHUDVH FKDLQ UHDFWLRQ DQG UHVWULFWLRQ HQGRQXFOHDVH GLJHVWLRQ RI YLUDO SODTXH LVRODWHV IURP WKH WUDQVLHQW GRPLQDQW VHOHFWLRQ FDQ EH XVHG WR VFUHHQ IRU PXWDWLRQV ZKLFK KDYH EHHQ GHVLJQHG WR HLWKHU FUHDWH RU UHPRYH GLDJQRVWLF UHVWULFWLRQ HQGRQXFOHDVH VLWHV ZLWKLQ WKH JHQH RI LQWHUHVW $OWHUQDWLYHO\ SODTXHV FRXOG EH VFUHHQHG E\ K\EULGL]DWLRQ XVLQJ WKH PXWDQW ROLJRQXFOHRWLGH DV D SUREH 9LUXVHV FRQWDLQLQJ PXWDWLRQV ZKLFK FRQIHU D OHWKDO SKHQRW\SH FDQQRW EH LVRODWHG E\ DQ\ PHWKRG KRZHYHU D OHWKDO SKHQRW\SH FRXOG EH LQIHUUHG E\ WKH LQDELOLW\ WR LVRODWH WKH PXWDWLRQ LQ WKH DEVHQFH RI P\FRSKHQROLF DFLG UHVLVWDQFH 2QH XVH IRU VXFK VFUHHQLQJ PHWKRGV FRXOG EH WR GHWHUPLQH LI WKH YDULRXV HQ]\PDWLF

PAGE 198

DFWLYLWLHV RI WKH YDFFLQLD P51$ FDSSLQJ HQ]\PH DUH HVVHQWLDO LQ YLYR )RU H[DPSOH D QXPEHU RI VSHFLILF PXWDWLRQV LQ WKH ',5 SURWHLQ KDYH EHHQ GHVFULEHG ZKLFK DEROLVK HLWKHU JXDQ\OWUDQVIHUDVH JXDQLQH fPHWK\OWUDQVIHUDVH RU WKH GLPHUL]DWLRQ RI UHFRPELQDQWO\ H[SUHVVHG FDSSLQJ HQ]\PH LQ YLWUR f 7KH LVRODWLRQ RI YLUXVHV FRQWDLQLQJ WKHVH PXWDWLRQV ZRXOG GHPRQVWUDWH ZKLFK RI WKHVH FDSSLQJ HQ]\PH IXQFWLRQV DUH HVVHQWLDO LQ YLYR )XWXUH ([SHULPHQWV :LWK ( 7KH LQ YLWUR DQG LQ YLYR SKHQRW\SH RI WKH ( PXWDQW YLUXV KDV UDLVHG VRPH LQWHUHVWLQJ TXHVWLRQV DERXW WKH SRVVLEOH UROH WKDW WKH FDSSLQJ HQ]\PH SOD\V LQ YLYR DQG WKH HVVHQWLDOLW\ RI WKH JXDQLQH fPHWK\OWUDQVIHUDVH DFWLYLW\ $UH WKH JXDQ\OWUDQVIHUDVH DQG 51$ WULSKRVSKDWDVH DFWLYLWLHV RI WKH ( PXWDQW WKHUPRODELOH LQ YLWUR" 'RHV WKH ( PXWDQW UHWDLQ WKH DELOLW\ WR GLPHUL]H ZLWK '/ LQ YLWUR DIWHU WKHUPDO LQDFWLYDWLRQ" ,V WKH FDSSLQJ HQ]\PH GLUHFWO\ LQYROYHG LQ WHORPHUH UHVROXWLRQ"

PAGE 199

7KHPRODELOLW\ VWXGLHV RI SXULILHG YLULRQV DQDORJRXV WR WKRVH GRQH IRU WKH PHWK\OWUDQVIHUDVH FDQ QRW EH XVHG WR PHDVXUH WKH 51$ WULSKRVSKDWDVH RU JXDQ\OWUDQVIHUDVH DFWLYLW\ RI ( YLULRQV +RZHYHU WKH P51$ PDGH LQ DQ LQ YLWUR UHDFWLRQ IROORZLQJ D r& RU R& SUHLQFXEDWLRQ FRXOG EH H[DPLQHG IRU WKH SUHVHQFH RI DQ 51DVH UHVLVWDQW JXDQLQH FDS E\ WKLQ OD\HU FKURPDWRJUDSK\ ,QLWLDO DWWHPSWV DW WKLV DSSURDFK ZHUH XQVXFFHVVIXO WKHUHIRUH DQ DOWHUQDWLYH DSSURDFK FRXOG EH WDNHQ 7KH FDSSLQJ HQ]\PH DQG D QXPEHU RI RWKHU YLUDOO\ HQFRGHG HQ]\PDWLF DFWLYLWLHV FDQ EH H[WUDFWHG IURP YLULRQ FRUH SDUWLFOHV IROORZLQJ GHWHUJHQW WUHDWPHQW DQG '($( FHOOXORVH FKURPDWRJUDSK\ f 7KLV FUXGH H[WUDFW RI VROXEOH ( YLULRQ SURWHLQV FRXOG EH WHVWHG LQ YLWUR IRU WKH DELOLW\ WR FDS D WULSKRVSKRU\ODWHG 51$ 7KHUPRODELOLW\ H[SHULPHQWV RQ WKLV H[WUDFW ZRXOG GHWHUPLQH LI WKH 51$ WULSKRVSKDWDVH DQG JXDQ\OWUDQVIHUDVH DFWLYLWLHV FRQWDLQHG ZLWKLQ ( YLULRQV UHPDLQ LQWDFW IROORZLQJ SUHLQFXEDWLRQ DW m& RU m& 2I FRXUVH LW ZRXOG EH LPSRUWDQW WR GHPRQVWUDWH WKDW WKH ( P51$ FDSSLQJ HQ]\PH LVRODWHG IURP YLULRQV KDV IXQFWLRQDO 51$ WULSKRVSKDWDVH JXDQ\OWUDQVIHUDVH DQG PHWK\OWUDQVIHUDVH DFWLYLWLHV SULRU WR DQ\ SUHLQFXEDWLRQ H[SHULPHQWV

PAGE 200

7KH DELOLW\ RI ',5 WR GLPHUL]H ZLWK '/ IROORZLQJ WKHUPDO LQDFWLYDWLRQ FRXOG EH WHVWHG E\ FRLPPXQRSUHFLSLWDWLRQ H[SHULPHQWV RI '/ ZLWK DQ DQWLERG\ VSHFLILF IRU ',5 7KH GLUHFW LQYROYHPHQW RI WKH P51$ FDSSLQJ HQ]\PH LQ WHORPHUH UHVROXWLRQ FDQQRW EH DGHTXDWHO\ DGGUHVVHG LQ YLYR GXH WR WKH SRVVLELOLW\ WKDW WKH UHVROXWLRQ GHIHFW LV D SOHLRWURSLF HIIHFW RI D GHIHFW LQ ODWH SURWHLQ V\QWKHVLV +RZHYHU F\WRSODVPLF H[WUDFWV RI LQIHFWHG FHOOV DUH FDSDEOH RI UHVROYLQJ SR[YLUDO FRQFDWDPHU MXQFWLRQ FRQWDLQLQJ SODVPLGV LQWR OLQHDU SODVPLGV ZLWK KDLUSLQ HQGV LQ YLWUR ,I DQ ( LQIHFWHG FHOO H[WUDFW PDGH DW WKH QRQSHUPLVVLYH WHPSHUDWXUH LV GHIHFWLYH IRU LQ YLWUR UHVROXWLRQ LW PLJKW EH SRVVLEOH WR FRPSOHPHQW WKH GHIHFW ZLWK ZLOGW\SH UHFRPELQDQW FDSSLQJ HQ]\PH $OWHUQDWLYHO\ UHVROXWLRQ LQ WKHVH H[WUDFWV PD\ EH WKHUPRODELOH LQ YLWUR LPSO\LQJ WKDW WKH ( FDSSLQJ HQ]\PH LV GLUHFWO\ UHVSRQVLEOH IRU WKH UHVROXWLRQ GHIHFW 5HFRPELQDWLRQ RI FLUFXODU SODVPLGV LQ WKH YLWUR DVVD\ FRXOG DOVR JHQHUDWH OLQHDU SODVPLGV ZLWK KDLUSLQ HQGV f 7KH ( UHFRPELQDWLRQDO PDFKLQHU\ LV SUHVXPDEO\ LQWDFW WKHUHIRUH LW LV TXLWH SRVVLEOH WKDW LQ YLWUR WKHUH ZRXOG EH QR REVHUYDEOH GHIHFW LQ WKH FRQYHUVLRQ RI D

PAGE 201

FLUFXODU SODVPLG WR D OLQHU SODVPLG ZLWK KDLUSLQ HQGV 7KH LQDELOLW\ WR GHWHUPLQH LI WKH UHVXOWV RI WKH LQ YLWUR UHVROXWLRQ DVVD\ DUH GXH WR WHORPHUH UHVROXWLRQ UDWKHU WKDQ UHFRPELQDWLRQ ZRXOG PDNH WKH GDWD GLIILFXOW WR LQWHUSUHW WKHUHIRUH WKHVH H[SHULPHQWV DUH XQOLNHO\ WR GHPRQVWUDWH D GLUHFW UROH IRU WKH FDSSLQJ HQ]\PH LQ WHORPHUH UHVROXWLRQ 7HVWLQJ WKH K\SRWKHVLV WKDW WKH FDSSLQJ HQ]\PH SDUWLFLSDWHV GLUHFWO\ LQ WHORPHUH UHVROXWLRQ ZLOO KDYH WR ZDLW IRU DQ LQ YLWUR V\VWHP WKDW FDQ GLIIHUHQWLDWH EHWZHHQ YLUDO UHFRPELQDWLRQ DQG WHORPHUH UHVROXWLRQ 2QH RI WKH PRVW LQWHUHVWLQJ XVHV IRU WKH ( PXWDQW ZRXOG EH WKH VHDUFK IRU FROG VHQVLWLYH H[WUDJHQLF VXSSUHVVRUV RI WKH ( WHPSHUDWXUHVHQVLWLYH PXWDWLRQ 7KH LVRODWLRQ DQG PDSSLQJ RI VXFK PXWDQWV FRXOG EH ILUVW VWHS LQ LGHQWLI\LQJ SURWHLQV RWKHU WKDQ '/f ZKLFK LQWHUDFW ZLWK ',5 LQ YLYR ,Q DGGLWLRQ H[WUDJHQLF VXSSUHVVRUV PDSSHG WR '/ FRXOG LGHQWLI\ VSHFLILF UHVLGXHV LQ '/ ZKLFK SDUWLFLSDWH LQ SURWHLQSURWHLQ FRQWDFWV ZLWK ',5 2QH RI WKH OHVVRQV IURP FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV RI WKH ',5 JHQH ZDV WKDW RIWHQ WKH SKHQRW\SLF FKDUDFWHUL]DWLRQ RI D PXWDQW SURYLGHV YHU\ IHZ FOXHV DV WR WKH ZLOG

PAGE 202

W\SH SURWHLQfV WUXH ELRORJLFDO UROH LQ YLYR ,I WKH ( PXWDWLRQ KDG EHHQ LVRODWHG E\ D UDQGRP UDWKHU WKDQ GLUHFWHG JHQHWLF DSSURDFK WKHQ WKH SKHQRW\SH ZRXOG KDYH EHHQ VHHQ DV HYLGHQFH RI D GLUHFW UROH IRU WKH ',5 SURWHLQ LQ WHORPHUH UHVROXWLRQ 7KLV VKRXOG WKHUHIRUH VHUYH DV D FDXWLRQDU\ QRWH WR RWKHUV SXUVXLQJ D JHQHWLF DSSURDFK WRZDUGV XQGHUVWDQGLQJ ELRORJLFDO SKHQRPHQD ,Q WKH DEVHQFH RI DQ\ ELRFKHPLFDO LQIRUPDWLRQ LQDFFXUDWH FRQFOXVLRQV DERXW WKH QDWXUH RI D SURWHLQfV IXQFWLRQ FDQ TXLWH HDVLO\ EH GUDZQ IURP SKHQRW\SLF REVHUYDWLRQV ,Q FRQFOXVLRQ WKLV ZRUN KDV OHG WR WKH GHYHORSPHQW RI D YDOXDEOH QHZ WRRO IRU WKH LVRODWLRQ RI FRQGLWLRQDO OHWKDO YDFFLQLD YLUXV PXWDQWV 7KH LQ YLYR ELRFKHPLFDO DQDO\VLV RI IXWXUH PXWDQWV FUHDWHG XVLQJ FOXVWHUHG FKDUJH WR DODQLQH PXWDJHQHVLV DQG WUDQVLHQW GRPLQDQW VHOHFWLRQ ZLOO XQGRXEWHGO\ SURYLGH LQWHUHVWLQJ QHZ LQIRUPDWLRQ DERXW WKH FRPSOH[ OLIH F\FOH RI YDFFLQLD YLUXV

PAGE 203

/,67 2) 5()(5(1&(6 $KQ % < 3 *HUVKRQ DQG % 0RVV 51$ SRO\PHUDVHDVVRFLDWHG SURWHLQ 5DS FRQIHUV SURPRWHU VSHFLILFLW\ IRU LQLWLDWLQJ WUDQVFULSWLRQ RI YDFFLQLD YLUXV HDUO\ VWDJH JHQHV %LRO &KHP $VKNHQD]L $ / 3UHVWD 6 $ 0DUVWHUV 7 5 &DPHUDWR $ 5RVHQWKDO % 0 )HQGO\ DQG &DSRQ 0DSSLQJ WKH &' ELQGLQJ VLWH IRU KXPDQ LPPXQRGHILFLHQF\ YLUXV E\ DODQLQH VFDQQLQJ PXWDJHQHVLV 3URF 1DWO $FDG 6FL 86$ %DOGLFN & -U DQG % 0RVV &KDUDFWHUL]DWLRQ DQG WHPSRUDO UHJXODWLRQ RI P51$V HQFRGHG E\ YDFFLQLD YLUXV LQWHUPHGLDWHVWDJH JHQHV 9LURO %DURXG\ % 0 6 9HQNDWHVDQ DQG % 0RVV ,QFRPSOHWHO\ EDVHSDLUHG IOLSIORS WHUPLQDO ORRSV OLQN WKH WZR '1$ VWUDQGV RI WKH YDFFLQLD YLUXV JHQRPH LQWR RQH XQLQWHUUXSWHG SRO\QXFOHRWLGH FKDLQ &HOO %DURXG\ % 0 6 9HQNDWHVDQ DQG % 0RVV 6WUXFWXUH DQG UHSOLFDWLRQ RI YDFFLQLD YLUXV WHORPHUHV &ROG 6SULQJ +DUERU 6\PS 4XDQW %LRO 3W %DVV 6 + 0 0XONHUULQ DQG $ :HOOV $ V\VWHPDWLF PXWDWLRQDO DQDO\VLV RI KRUPRQHELQGLQJ GHWHUPLQDQWV LQ WKH KXPDQ JURZWK KRUPRQH UHFHSWRU 3URF 1DWO $FDG 6FL 86$

PAGE 204

%HQQHWW : ) 1 ) 3DRQL % $ .H\W %RWVWHLQ $ 6 -RQHV / 3UHVWD ) 0 :XUP DQG 0 =ROOHU +LJK UHVROXWLRQ DQDO\VLV RI IXQFWLRQDO GHWHUPLQDQWV RQ KXPDQ WLVVXHW\SH SODVPLQRJHQ DFWLYDWRU %LRO &KHP %UR\OHV 6 6 DQG % 6 )HVOHU 9DFFLQLD YLUXV JHQH HQFRGLQJ D FRPSRQHQW RI WKH YLUDO HDUO\ WUDQVFULSWLRQ IDFWRU 9LURO %UR\OHV 6 6 DQG % 0RVV '1$GHSHQGHQW $73DVH DFWLYLW\ DVVRFLDWHG ZLWK YDFFLQLD YLUXV HDUO\ WUDQVFULSWLRQ IDFWRU %LRO &KHP &DUSHQWHU 0 6 DQG $ 0 'HODQJH $ WHPSHUDWXUHVHQVLWLYH OHVLRQ LQ WKH VPDOO VXEXQLW RI WKH YDFFLQLD YLUXVHQFRGHG P51$ FDSSLQJ HQ]\PH FDXVHV D GHIHFW LQ YLUDO WHORPHUH UHVROXWLRQ 9LURO &ROOLHU ( 3 $ .UDVQRY $ < 6WURQJLQ + %LUNHGDO+DQVHQ DQG *ROGEHUJ $ODQLQH VFDQQLQJ DQG IXQFWLRQDO DQDO\VLV RI WKH ILEURQHFWLQOLNH FROODJHQELQGLQJ GRPDLQ IURP +XPDQ N'D W\SH ,9 FROODJHQDVH %LRO &KHP &RQGLW 5 & 5 (DVWHUO\ 5 ) 3DFKD = )DWKL DQG 5 0HLV $ YDFFLQLD YLUXV LVDWLQWKLRVHPLFDUED]RQH UHVLVWDQFH PXWDWLRQ PDSV LQ WKH YLUDO JHQH HQFRGLQJ WKH N'D VXEXQLW RI 51$ SRO\PHUDVH 9LURORJ\ &RQGLW 5 & DQG $ 0RW\F]ND ,VRODWLRQ DQG SUHOLPLQDU\ FKDUDFWHUL]DWLRQ RI WHPSHUDWXUHVHQVLWLYH PXWDQWV RI YDFFLQLD YLUXV 9LURORJ\ &RQGLW 5 & $ 0RW\F]ND DQG 6SL]] ,VRODWLRQ FKDUDFWHUL]DWLRQ DQG SK\VLFDO PDSSLQJ RI WHPSHUDWXUHVHQVLWLYH PXWDQWV RI YDFFLQLD YLUXV 9LURORJ\

PAGE 205

&RQGLW 5 & DQG ( 1LOHV 2UWKRSR[YLUXV JHQHWLFV &XUU 7RS 0LFURELRO ,PPXQRO &RQJ 3 DQG 6 6KXPDQ 0HWK\OWUDQVIHUDVH DQG VXEXQLW DVVRFLDWLRQ GRPDLQV RI YDFFLQLD YLUXV P51$ FDSSLQJ HQ]\PH %LRO &KHP &RQJ 3 DQG 6 6KXPDQ &RYDOHQW FDWDO\VLV LQ QXFOHRWLG\O WUDQVIHU $ .7'* PRWLI HVVHQWLDO IRU HQ]\PH*03 FRPSOH[ IRUPDWLRQ E\ P51$ FDSSLQJ HQ]\PH LV FRQVHUYHG DW WKH DFWLYH VLWHV RI 51$ DQG '1$ OLJDVHV %LRO &KHP &RRSHU $ 5 :LWWHN DQG % 0RVV ([WHQVLRQ RI WKH WUDQVFULSWLRQDO DQG WUDQVODWLRQDO PDS RI WKH OHIW HQG RI WKH YDFFLQLD YLUXV JHQRPH WR NLOREDVH SDLUV 9LURO &XQQLQJKDP % & DQG $ :HOOV +LJK UHVROXWLRQ HSLWRSH PDSSLQJ RI K*+UHFHSWRU LQWHUDFWLRQV E\ DODQLQHVFDQQLQJ PXWDJHQHVLV 6FLHQFH 'DOHV 6 9 0LORYDQRYLWFK % 3RJR 6 % :HLQWUDXE 7 +XLPD 6 :LOWRQ DQG 0F)DGGHQ %LRJHQHVLV RI YDFFLQLD LVRODWLRQ RI FRQGLWLRQDO OHWKDO PXWDQWV DQG HOHFWURQ PLFURVFRSLF FKDUDFWHUL]DWLRQ RI WKHLU SKHQRW\SLFDOO\ H[SUHVVHG GHIHFWV 9LURORJ\ 'HODQJH $ 0 DQG 0F)DGGHQ 6HTXHQFHQRQVSHFLILF UHSOLFDWLRQ RI WUDQVIHFWHG SODVPLG '1$ LQ SR[YLUXVLQIHFWHG FHOOV 3URF 1DWO $FDG 6FL 86$ 'HODQJH $ 0 DQG 0F)DGGHQ (IILFLHQW UHVROXWLRQ RI UHSOLFDWHG SR[YLUXV WHORPHUHV WR QDWLYH KDLUSLQ VWUXFWXUHV UHTXLUHV WZR LQYHUWHG V\PPHWULFDO FRSLHV RI D FRUH WDUJHW '1$ VHTXHQFH 9LURO

PAGE 206

'HODQJH $ 0 DQG 0F)DGGHQ 7KH UROH RI WHORPHUHV LQ SR[YLUXV '1$ UHSOLFDWLRQ &XUU 7RS 0LFURELRO ,PPXQRO 'HODQJH $ 0 0 5HGG\ 6FUDED & 8SWRQ DQG 0F)DGGHQ 5HSOLFDWLRQ DQG UHVROXWLRQ RI FORQHG SR[YLUXV WHORPHUHV LQ YLYR JHQHUDWHV OLQHDU PLQLFKURPRVRPHV ZLWK LQWDFW YLUDO KDLUSLQ WHUPLQL 9LURO 'LDPRQG 6 ( DQG .LUNHJDDUG &OXVWHUHG FKDUJHWRDODQLQH PXWDJHQHVLV RI SROLRYLUXV 51$GHSHQGHQW 51$ SRO\PHUDVH \LHOGV PXOWLSOH WHPSHUDWXUHVHQVLWLYH PXWDQWV GHIHFWLYH LQ 51$ V\QWKHVLV 9LURO (QVLQJHU 0 DQG % 0RVV 0RGLILFDWLRQ RI WKH n WHUPLQXV RI P51$ E\ DQ 51$ JXDQLQHfPHWK\OWUDQVIHUDVH IURP +H/D FHOOV %LRO &KHP (QVLQJHU 0 DQG 0 5RYLQVN\ 0DUNHU UHVFXH RI WHPSHUDWXUHVHQVLWLYH PXWDWLRQV RI YDFFLQLD YLUXV :5 FRUUHODWLRQ RI JHQHWLF DQG SK\VLFDO PDSV 9LURO (QVLQJHU 0 3 :HLU DQG % 0RVV )LQH VWUXFWXUH PDUNHU UHVFXH RI WHPSHUDWXUHVHQVLWLYH PXWDWLRQV RI YDFFLQLD YLUXV ZLWKLQ D FHQWUDO FRQVHUYHG UHJLRQ RI WKH JHQRPH 9LURO (QVLQJHU 0 ,VRODWLRQ DQG JHQHWLF FKDUDFWHUL]DWLRQ RI WHPSHUDWXUH VHQVLWLYH PXWDQWV RI YDFFLQLD YLUXV :5 9LURO (VSRVLWR DQG ) $ 0XUSK\ ,QIHFWLRXV UHFRPELQDQW YHFWRUHG YLUXV YDFFLQHV $GY 9HW 6FL &RPS 0HG

PAGE 207

(VVDQL DQG 6 'DOHV %LRJHQHVLV RI YDFFLQLD DQDO\VLV E\ WKUHHIDFWRU FURVVHV UHYHDOV PXWXDO LQIOXHQFH RQ VWDELOLW\ RI GUXJ UHVLVWDQFH DQG WHPSHUDWXUH VHQVLWLYLW\ ZKHQ ERWK PDUNHUV RFFXU LQ VRPH UHFRPELQDQW YLUXV LVRODWHV ,QWHUYLURORJ\ )DONQHU ) DQG % 0RVV (VFKHULFKLD FROL JSW JHQH SURYLGHV GRPLQDQW VHOHFWLRQ IRU YDFFLQLD YLUXV RSHQ UHDGLQJ IUDPH H[SUHVVLRQ YHFWRUV 9LURO )DONQHU ) DQG % 0RVV 7UDQVLHQW GRPLQDQW VHOHFWLRQ RI UHFRPELQDQW YDFFLQLD YLUXVHV 9LURO )DWKL = DQG 5 & &RQGLW *HQHWLF DQG PROHFXODU ELRORJLFDO FKDUDFWHUL]DWLRQ RI D YDFFLQLD YLUXV WHPSHUDWXUHVHQVLWLYH FRPSOHPHQWDWLRQ JURXS DIIHFWLQJ D YLULRQ FRPSRQHQW 9LURORJ\ )HLQEHUJ $ 3 DQG % 9RJHOVWHLQ $ WHFKQLTXH IRU UDGLRODEHOLQJ '1$ UHVWULFWLRQ HQGRQXFOHDVH IUDJPHQWV WR KLJK VSHFLILF DFWLYLW\ $GGHQGXP $QDO %LRFKHP )HQQHU ) $ +HQGHUVRQ $ULWD = -H]HN DQG /DGQ\L 6PDOOSR[ DQG LWV (UDGLFDWLRQ :RUOG +HDOWK 2UJDQL]DWLRQ *HQHYD )LOLSRZLF] : )XQFWLRQV RI WKH nWHUPLQDO P* FDS LQ HXNDU\RWLF P51$ )(%6 /HWW )UDQNH & $ & 0 5LFH + 6WUDXVV DQG ( +UXE\ 1HRP\FLQ UHVLVWDQFH DV D GRPLQDQW VHOHFWDEOH PDUNHU IRU VHOHFWLRQ DQG LVRODWLRQ RI YDFFLQLD YLUXV UHFRPELQDQWV 0RO &HOO %LRO )XUXLFKL < DQG $ 6KDWNLQ &KDUDFWHUL]DWLRQ RI FDS VWUXFWXUHV 0HWKRGV (Q]\PRO

PAGE 208

*HUVKRQ 3 DQG % 0RVV (DUO\ WUDQVFULSWLRQ IDFWRU VXEXQLWV DUH HQFRGHG E\ YDFFLQLD YLUXV ODWH JHQHV 3URF 1DWO $FDG 6FL 86$ *RHEHO 6 -/ 3 -RKQVRQ 0 ( 3HUNXV 6 : 'DYLV 3 :LQVORZ DQG ( 3DROHWWL 7KH FRPSOHWH '1$ VHTXHQFH RI YDFFLQLD YLUXV 9LURORJ\ *UDKDP % 6 7 0DWWKHZV 5 % %HOVKH 0 / &OHPHQWV 5 'ROLQ 3 ) :ULJKW *RUVH + 6FKZDUW] 0 & .HHIHU 3 %RORJQHVL $XJPHQWDWLRQ RI KXPDQ LPPXQRGHILFLHQF\ YLUXV W\SH QHXWUDOL]LQJ DQWLERG\ E\ SULPLQJ ZLWK JSO UHFRPELQDQW YDFFLQLD DQG ERRVWLQJ ZLWK UJSO LQ YDFFLQLDQDLYH DGXOWV 7KH 1,$,' $,'6 9DFFLQH &OLQLFDO 7ULDOV 1HWZRUN ,QIHFW 'LV +DPP DQG : 0DWWDM 0RQRPHWK\ODWHG FDS VWUXFWXUHV IDFLOOLWDWH 51$ H[SRUW IURP WKH QXFOHXV &HOO +DUULV 1 5 5RVDOHV DQG % 0RVV 7UDQVFULSWLRQ LQLWLDWLRQ IDFWRU DFWLYLW\ RI YDFFLQLD YLUXV FDSSLQJ HQ]\PH LV LQGHSHQGHQW RI P51$ JXDQ\O\ODWLRQ 3URF 1DWO $FDG 6FL 86$ +DVVHWW ( DQG 5 & &RQGLW 7DUJHWHG FRQVWUXFWLRQ RI WHPSHUDWXUHVHQVLWLYH PXWDWLRQV LQ YDFFLQLD YLUXV E\ UHSODFLQJ FOXVWHUHG FKDUJHG UHVLGXHV ZLWK DODQLQH 3URF 1DWO $FDG 6FL 86$ +LJPDQ 0 $ 1 %RXUJHRLV DQG ( 1LOHV 7KH YDFFLQLD YLUXV P51$ JXDQLQH1fPHWK\OWUDQVIHUDVH UHTXLUHV ERWK VXEXQLWV RI WKH P51$ FDSSLQJ HQ]\PH IRU DFWLYLW\ %LRO &KHP

PAGE 209

+LJPDQ 0 $ / $ &KULVWHQ DQG ( 1LOHV 7KH P51$ JXDQLQHfPHWK\OWUDQVIHUDVH GRPDLQ RI WKH YDFFLQLD YLUXV P51$ FDSSLQJ HQ]\PH ([SUHVVLRQ LQ (VFKHULFKLD FROL DQG VWUXFWXUDO DQG NLQHWLF FRPSDULVRQ WR WKH LQWDFW FDSSLQJ HQ]\PH %LRO &KHP +LJPDQ 0 $ DQG ( 1LOHV /RFDWLRQ RI WKH 6DGHQRV\O/PHWKLRQLQH ELQGLQJ UHJLRQ RI WKH YDFFLQLD YLUXV P51$ JXDQLQHfPHWK\OWUDQVIHUDVH %LRO &KHP +LOOHU DQG :HEHU *ROJLGHULYHG PHPEUDQHV WKDW FRQWDLQ DQ DF\ODWHG YLUDO SRO\SHSWLGH DUH XVHG IRU YDFFLQLD YLUXV HQYHORSPHQW 9LURO +RRGD 'KLQJUD 8 ' 3DWHO 3LFNXS DQG 5 & &RQGLW )LQH VWUXFWXUH PDSSLQJ DQG SKHQRW\SLF DQDO\VLV RI ILYH WHPSHUDWXUHVHQVLWLYH PXWDWLRQV LQ WKH VHFRQG ODUJHVW VXEXQLW RI YDFFLQLD YLUXV '1$GHSHQGHQW 51$ SRO\PHUDVH 9LURORJ\ +RRGD 'KLQJUD 8 & / 7KRPSVRQ DQG 5 & &RQGLW 'HWDLOHG SKHQRW\SLF FKDUDFWHUL]DWLRQ RI ILYH WHPSHUDWXUH VHQVLWLYH PXWDQWV LQ WKH DQG NLORGDOWRQ VXEXQLWV RI YDFFLQLD YLUXV '1$GHSHQGHQW 51$ SRO\PHUDVH 9LURO +RULNDPL 6 0 ) 'H )HUUD DQG 6 $ 0R\HU &KDUDFWHUL]DWLRQ RI WKH LQIHFWLRQV RI SHUPLVVLYH DQG QRQSHUPLVVLYH FHOOV E\ KRVW UDQJH PXWDQWV RI YHVLFXODU VWRPDWLWLV YLUXV GHIHFWLYH LQ 51$ PHWK\ODWLRQ 9LURORJ\ +X ) 4 DQG 3LFNXS 7UDQVFULSWLRQ RI WKH WHUPLQDO ORRS UHJLRQ RI YDFFLQLD YLUXV '1$ LV LQLWLDWHG IURP WKH WHORPHUH VHTXHQFHV GLUHFWLQJ '1$ UHVROXWLRQ 9LURORJ\

PAGE 210

-RKQVRQ 3 6 *RHEHO DQG ( 3DROHWWL $Q XSGDWH RQ WKH YDFFLQLD YLUXV JHQRPH 9LURORJ\ .DQH ( 0 DQG 6 6KXPDQ 7HPSHUDWXUHVHQVLWLYH PXWDWLRQV LQ WKH YDFFLQLD YLUXV + JHQH HQFRGLQJ D FRPSRQHQW RI WKH YLULRQ 51$ SRO\PHUDVH 9LURO .HFN & %DOGLFN DQG % 0RVV 5ROH RI '1$ UHSOLFDWLRQ LQ YDFFLQLD YLUXV JHQH H[SUHVVLRQ D QDNHG WHPSODWH LV UHTXLUHG IRU WUDQVFULSWLRQ RI WKUHH ODWH WUDQVDFWLYDWRU JHQHV &HOO .RQDUVND 0 0 5 $ 3DGJHWW DQG 3 $ 6KDUS 5HFRJQLWLRQ RI FDS VWUXFWXUH LQ VSOLFLQJ LQ YLWUR RI P51$ SUHFXUVRUV &HOO .RYDFV 5 5 5RVDOHV .HFN DQG % 0RVV 0RGLILFDWLRQ RI WKH FDVFDGH PRGHO IRU UHJXODWLRQ RI YDFFLQLD YLUXV JHQH H[SUHVVLRQ SXULILFDWLRQ RI D SUHUHSOLFDWLYH ODWHVWDJHVSHFLILF WUDQVFULSWLRQ IDFWRU 9LURO .UDQLHU $ 5 7 0DQLDWLV % 5XVNLQ DQG 0 5 *UHHQ 1RUPDO DQG PXWDQW KXPDQ % *ORELQ SUHP51$V DUH IDLWKIXOO\ DQG HIILFLHQWO\ VSOLFHG LQ YLWUR &HOO /DHPPOL 8 &OHDYDJH RI VWUXFWXUDO SURWHLQV GXULQJ DVVHPEO\ RI WKH KHDG RI EDFWHULRSKDJH 7 1DWXUH /DNULW] 1 3 )RJOHVRQJ 0 5HGG\ 6 %DXP +XUZLW] DQG : 5 %DXHU $ YDFFLQLD YLUXV '1DVH SUHSDUDWLRQ ZKLFK FURVVOLQNV VXSHUKHOLFDO '1$ 9LURO /DQEHUJ 6 5 DQG % 0RVV 3RVWWUDQVFULSWLRQDO PRGLILFDWLRQV RI P51$ %LRO &KHP

PAGE 211

/XR < ; 0DR / 'HQJ 3 &RQJ DQG 6 6KXPDQ 7KH DQG VXEXQLWV DUH ERWK HVVHQWLDO IRU WKH WUDQVFULSWLRQ WHUPLQDWLRQ IDFWRU DFWLYLW\ RI YDFFLQLD YLUXV FDSSLQJ HQ]\PH 9LURO /XR < DQG 6 6KXPDQ 51$ ELQGLQJ SURSHUWLHV RI YDFFLQQLD YLUXV FDSSLQJ HQ]\PH %LRO &KHP 0DFNHWW 0 DQG / & $UFKDUG &RQVHUYDWLRQ DQG YDULDWLRQ LQ 2UWKRSR[YLUXV JHQRPH VWUXFWXUH *HQ 9LURO 0DFNHWW 0 / 6PLWK DQG % 0RVV *HQHUDO PHWKRG IRU SURGXFWLRQ DQG VHOHFWLRQ RI LQIHFWLRXV YDFFLQLD YLUXV UHFRPELQDQWV H[SUHVVLQJ IRUHLJQ JHQHV 9LURO 0DKU $ DQG % ( 5REHUWV $UUDQJHPHQW RI ODWH 51$V WUDQVFULEHG IURP D NLOREDVH (FR5, YDFFLQLD YLUXV '1$ IUDJPHQW 9LURO 0DR ; DQG 6 6KXPDQ ,QWULQVLF 51$ JXDQLQHf PHWK\OWUDQVIHUDVH DFWLYLW\ RI WKH YDFFLQLD YLUXV FDSSLQJ HQ]\PH VXEXQLW LV VWLPXODWHG E\ WKH VXEXQLW ,GHQWLILFDWLRQ RI DPLQR DFLG UHVLGXHV LQ WKH SURWHLQ UHTXLUHG IRU VXEXQLW DVVRFLDWLRQ DQG PHWK\O JURXS WUDQVIHU %LRO &KHP 0F)DGGHQ DQG 6 'DOHV %LRJHQHVLV RI SR[YLUXVHV SUHOLPLQDU\ FKDUDFWHUL]DWLRQ RI FRQGLWLRQDO OHWKDO PXWDQWV RI YDFFLQLD YLUXV GHIHFWLYH LQ '1$ V\QWKHVLV 9LURORJ\ 0HLV 5 DQG 5 & &RQGLW *HQHWLF DQG PROHFXODU ELRORJLFDO FKDUDFWHUL]DWLRQ RI D YDFFLQLD YLUXV JHQH ZKLFK UHQGHUV WKH YLUXV GHSHQGHQW RQ LVDWLQ%WKLRVHPLFDUED]RQH ,%7f 9LURORJ\

PAGE 212

0HUFKOLQVN\ 0 0XWDWLRQDO DQDO\VLV RI WKH UHVROXWLRQ VHTXHQFH RI YDFFLQLD YLUXV '1$ HVVHQWLDO VHTXHQFH FRQVLVWV RI WZR VHSDUDWH $7ULFK UHJLRQV KLJKO\ FRQVHUYHG DPRQJ SR[YLUXVHV 9LURO 0HUFKOLQVN\ 0 & ) *DURQ DQG % 0RVV 0ROHFXODU FORQLQJ DQG VHTXHQFH RI WKH FRQFDWHPHU MXQFWLRQ IURP YDFFLQLD YLUXV UHSOLFDWLYH '1$ 9LUDO QXFOHDVH FOHDYDJH VLWHV LQ FUXFLIRUP VWUXFWXUHV 0RO %LRO 0HUFKOLQVN\ 0 DQG % 0RVV 5HVROXWLRQ RI OLQHDU PLQLFKURPRVRPHV ZLWK KDLUSLQ HQGV IURP FLUFXODU SODVPLGV FRQWDLQLQJ YDFFLQLD YLUXV FRQFDWHPHU MXQFWLRQV &HOO 0HUFKOLQVN\ 0 DQG % 0RVV 5HVROXWLRQ RI YDFFLQLD YLUXV '1$ FRQFDWHPHU MXQFWLRQV UHTXLUHV ODWHJHQH H[SUHVVLRQ 9LURO 0L]XPRWR DQG < .D]LUR 0HVVHQJHU 51$ FDSSLQJ HQ]\PHV IURP HXNDU\RWLF FHOOV 3URJ 1XFOHLF $FLGV 5HV DQG 0RO %LRO 0RUJDQ & 7KH LQVHUWLRQ RI '1$ LQWR YDFFLQLD YLUXV 6FLHQFH 0RUJDQ 5 / &RKHQ DQG % ( 5REHUWV ,GHQWLILFDWLRQ RI WKH '1$ VHTXHQFHV HQFRGLQJ WKH ODUJH VXEXQLW RI WKH P51$FDSSLQJ HQ]\PH RI YDFFLQLD YLUXV 9LURO 0RVV % 3R[YLULGDH DQG WKHLU UHSOLFDWLRQ S ,Q % 1 )LHOGV 0 .QLSH 5 0 &KDQRFN 0 6 +LUVFK / 0HOQLFN 7 3 0RQDWK DQG % 5RL]PDQ HGVf )LHOGV 9LURORJ\ 5DYHQ 3UHVV 1HZ
PAGE 213

0RVV % % < $KQ % $PHJDG]LH 3 *HUVKRQ DQG .HFN &\WRSODVPLF WUDQVFULSWLRQ V\VWHP HQFRGHG E\ YDFFLQLD YLUXV %LRO &KHP 0RVV % DQG & )OH[QHU 9DFFLQLD YLUXV H[SUHVVLRQ YHFWRUV $QQX 5HY ,PPXQRO 0RVV % ( 1 5RVHQEOXP ( .DW] DQG 3 0 *ULPOH\ 5LIDPSLFLQ D VSHFLILF LQKLELWRU RI YDFFLQLD YLUXV DVVHPEO\ 1DWXUH 0R\HU 5 : DQG 5 / *UDYHV 7KH PHFKDQLVP RI F\WRSODVPLF RUWKRSR[YLUXV '1$ UHSOLFDWLRQ &HOO 0XOOLJDQ 5 & DQG 3 %HUJ ([SUHVVLRQ RI D EDFWHULDO JHQH LQ PDPPDOLDQ FHOOV 6FLHQFH 1LOHV ( DQG / &KULVWHQ ,GHQWLILFDWLRQ RI WKH YDFFLQLD YLUXV P51$ JXDQ\OWUDQVIHUDVH DFWLYH VLWH O\VLQH %LRO &KHP 1LOHV ( 5 & &RQGLW 3 &DUR 'DYLGVRQ / 0DWXVLFN DQG 6HWR 1XFOHRWLGH VHTXHQFH DQG JHQHWLF PDS RI WKH NE YDFFLQLD YLUXV +LQG,,, IUDJPHQW 9LURORJ\ 1LOHV ( * /HH &KHQ 6 6KXPDQ % 0RVV DQG 6 6 %UR\OHV 9DFFLQLD YLUXV JHQH '/ HQFRGHV WKH VPDOO VXEXQLW RI WKH YLUDO P51$ FDSSLQJ HQ]\PH 9LURORJ\ 3DFKD 5 &KDUDFWHUL]DWLRQ RI D WHPSHUDWXUHVHQVLWLYH PXWDQW RI YDFFLQLD YLUXV UHYHDOV D QRYHO IXQFWLRQ WKDW SUHYHQWV YLUXV LQGXFHG EUHDNGRZQ RI 51$ 9LURO

PAGE 214

3DQLFDOL 6 : 'DYLV 5 / :HLQEHUJ DQG ( 3DROHWWL &RQVWUXFWLRQ RI OLYH YDFFLQHV E\ XVLQJ JHQHWLFDOO\ HQJLQHHUHG SR[YLUXVHV ELRORJLFDO DFWLYLW\ RI UHFRPELQDQW YDFFLQLD YLUXV H[SUHVVLQJ LQIOXHQ]D YLUXV KHPDJJOXWLQLQ 3URF 1DWO $FDG 6FL 86$ 3DUVRQV % / DQG 3LFNXS 7UDQVFULSWLRQ RI RUWKRSR[YLUXV WHORPHUHV DW ODWH WLPHV GXULQJ LQIHFWLRQ 9LURORJ\ 3D\QH / 6LJQLILFDQFH RI H[WUDFHOOXODU HQYHORSHG YLUXV LQ WKH LQ YLWUR DQG LQ YLYR GLVVHPLQDWLRQ RI YDFFLQLD *HQ 9LURO 3D\QH / DQG .ULVWHQVVRQ ([WUDFHOOXODU UHOHDVH RI HQYHORSHG YDFFLQLD YLUXV IURP PRXVH QDVDO HSLWKHOLDO FHOOV LQ YLYR *HQ 9LURO 3HQQLQJWRQ 7 + DQG ( $ & )ROOHWW 9DFFLQLD YLUXV UHSOLFDWLRQ LQ HQXFOHDWH FHOOV SDUWLFOH SURGXFWLRQ DQG V\QWKHVLV RI YLUDO '1$ DQG SURWHLQV 9LURO 3LWOXN = : 0 0F'RQRXJK 3 6DQJDQ DQG *RQGD 1RYHO &'& 8%&f XELTXLWLQFRQMXJDWLQJ HQ]\PH PXWDQWV REWDLQHG E\ FKDUJHGWRDODQLQH VFDQQLQJ PXWDJHQHVLV 0RO &HOO %LRO 3RJR % ( 0 %HUNRZLW] DQG 6 'DOHV ,QYHVWLJDWLRQ RI YDFFLQLD YLUXV '1$ UHSOLFDWLRQ HPSOR\LQJ D FRQGLWLRQDO OHWKDO PXWDQW GHIHFWLYH LQ '1$ 9LURORJ\ 5HPSHO 5 ( 0 $QGHUVRQ ( (YDQV DQG 3 7UDNWPDQ 7HPSHUDWXUHVHQVLWLYH YDFFLQLD YLUXV PXWDQWV LGHQWLI\ D JHQH ZLWK DQ HVVHQWLDO UROH LQ YLUDO UHSOLFDWLRQ 9LURO

PAGE 215

5RKUPDQQ /
PAGE 216

6FKZHU % DQG 6 6KXPDQ 0XWDWLRQDO DQDO\VLV RI \HDVW P51$ FDSSLQJ HQ]\PH 3URF 1DWO $FDG 6FL 86$ 6HWR / 0 &HOHQ]D 5 & &RQGLW DQG ( 1LOHV *HQHWLF PDS RI WKH YDFFLQLD YLUXV +LQG,,, )UDJPHQW 9LURORJ\ 6KDWNLQ $ &DSSLQJ RI HXFDU\RWLF P51$V &HOO 6KDWNLQ $ P51$ FDS ELQGLQJ SURWHLQV HVVHQWLDO IDFWRUV IRU LQLWLDWLRQ RI WUDQVODWLRQ &HOO 6KXPDQ 6 )XQFWLRQDO GRPDLQV RI YDFFLQLD YLUXV P51$ FDSSLQJ HQ]\PH $QDO\VLV E\ OLPLWHG WU\SWLF GLJHVWLRQ %LRO &KHP 6KXPDQ 6 &DWDO\WLF DFWLYLW\ RI YDFFLQLD P51$ FDSSLQJ HQ]\PH VXEXQLWV FRH[SUHVVHG LQ (VFKHULFKLD FROL %LRO &KHP 6KXPDQ 6 6 6 %UR\OHV DQG % 0RVV 3XULILFDWLRQ DQG FKDUDFWHUL]DWLRQ RI D WUDQVFULSWLRQ WHUPLQDWLRQ IDFWRU IURP YDFFLQLD YLULRQV %LRO &KHP 6KXPDQ 6 DQG +XUZLW] 0HFKDQLVP RI P51$ FDSSLQJ E\ YDFFLQLD YLUXV JXDQ\O\OWUDQVIHUDVH FKDUDFWHUL]DWLRQ RI DQ HQ]\PHf§JXDQ\ODWH LQWHUPHGLDWH 3URF 1DWO $FDG 6FL 86$ 6KXPDQ 6 < /LX DQG % 6FKZHU &RYDOHQW FDWDO\VLV LQ QXFOHRWLG\O WUDQVIHU UHDFWLRQV HVVHQWLDO PRWLIV FRQVHUYHG LQ 6DFFKDURP\FHV FHUYLVLDH 51$ FDSSLQJ HQ]\PH DUH FRQVHUYHG LQ 6FKL]RVDFFKDURP\FHV SRPEH DQG YLUDO FDSSLQJ HQ]\PHV DQG DPRQJ SRO\QXFOHRWLGH OLJDVHV 3URF 1DWO $FDG 6FL 86$

PAGE 217

6KXPDQ 6 DQG 6 0RUKDP 'RPDLQ VWUXFWXUH RI YDFFLQLD YLUXV P51$ FDSSLQJ HQ]\PH $FWLYLW\ RI WKH 0U VXEXQLW H[SUHVVHG LQ (VFKHULFKLD FROL %LRO &KHP 6KXPDQ 6 DQG % 0RVV )DFWRUGHSHQGHQW WUDQVFULSWLRQ WHUPLQDWLRQ E\ YDFFLQLD YLUXV 51$ SRO\PHUDVH (YLGHQFH WKDW WKH FLVDFWLQJ WHUPLQDWLRQ VLJQDO LV LQ QDVFHQW 51$ %LRO &KHP 6KXPDQ 6 DQG % 0RVV %URPRXULGLQH WULSKRVSKDWH LQKLELWV WUDQVFULSWLRQ WHUPLQDWLRQ DQG P51$ UHOHDVH E\ YDFFLQLD YLULRQV %LRO &KHP 6KXPDQ 6 0 6XUNV + )XUQHDX[ DQG +XUZLW] 3XULILFDWLRQ DQG FKDUDFWHUL]DWLRQ RI D *73S\URSKRVSKDWH H[FKDQJH DFWLYLW\ IURP YDFFLQLD YLULRQV $VVRFLDWLRQ RI WKH *73S\URSKRVSKDWH H[FKDQJH DFWLYLW\ ZLWK YDFFLQLD P51$ JXDQ\O\OWUDQVIHUDVH 51$ JXDQLQHfPHWK\OWUDQVIHUDVH FRPSOH[ FDSSLQJ HQ]\PHf %LRO &KHP 6RGHLN % 5 : 'RUQV 0 (ULFVVRQ +LOOHU & ( 0DFKDPHU + : YDQfW +RI YDQ 0HHU % 0RVV DQG *ULIILWKV $VVHPEO\ RI YDFFLQLD YLUXV UROH RI WKH LQWHUPHGLDWH FRPSDUWPHQW EHWZHHQ WKH HQGRSODVPLF UHWLFXOXP DQG WKH *ROJL VWDFNV &HOO %LRO 6RXWKHUQ ( 0 'HWHFWLRQ RI VSHFLILF VHTXHQFHV DPRQJ '1$ IUDJPHQWV VHSDUDWHG E\ JHO HOHFWURSKRUHVLV 0RO %LRO 6WXDUW (OOLVRQ *UDKDP DQG 0F)DGGHQ ,Q YLWUR UHVROXWLRQ RI SR[YLUXV UHSOLFDWLYH LQWHUPHGLDWHV LQWR 9LURO

PAGE 218

6WXDUW *UDKDP 0 6FKUHLEHU & 0DFDXOD\ DQG 0F)DGGHQ 7KH WDUJHW '1$ VHTXHQFH IRU UHVROXWLRQ RI SR[YLUXV UHSOLFDWLYH LQWHUPHGLDWHV LV DQ DFWLYH ODWH SURPRWHU 9LURO 7KRPSVRQ & / DQG 5 & &RQGLW 0DUNHU UHVFXH PDSSLQJ RI YDFFLQLD YLUXV WHPSHUDWXUHVHQVLWLYH PXWDQWV XVLQJ RYHUODSSLQJ FRVPLG FORQHV UHSUHVHQWLQJ WKH HQWLUH YLUXV JHQRPH 9LURORJ\ 7KRPSVRQ & / 8 +RRGD 'KLQJUD DQG 5 & &RQGLW )LQH VWUXFWXUH PDSSLQJ RI ILYH WHPSHUDWXUHVHQVLWLYH PXWDQWV LQ WKH DQG NLORGDOWRQ VXEXQLWV RI YDFFLQLD YLUXV '1$GHSHQGHQW 51$ SRO\PHUDVH 9LURO 7RZELQ + 7 6WDHKHOLQ DQG *RUGRQ (OHFWURSKRUHWLF WUDQVIHU RI SURWHLQV IURP SRO\DFU\ODPLGH JHOV WR QLWURFHOOXORVH VKHHWV SURFHGXUH DQG VRPH DSSOLFDWLRQV 3URF 1DWO $FDG 6FL 86$ 7UDNWPDQ 3 7KH HQ]\PRORJ\ RI SR[YLUXV '1$ UHSOLFDWLRQ &XUU 7RS 0LFURELRO ,PPXQRO 9HQNDWHVDQ 6 $ *HUVKRZLW] DQG % 0RVV 0RGLILFDWLRQ RI WKH n HQG RI P51$ $VVRFLDWLRQ RI 51$ WULSKRVSKDWDVH ZLWK WKH 51$ JXDQ\O\OWUDQVIHUDVH51$ JXDQLQHfPHWK\OWUDQVIHUDVH FRPSOH[ IURP YDFFLQLD YLUXV %LRO &KHP 9LHLUD DQG 0HVVLQJ 3URGXFWLRQ RI VLQJOH VWUDQGHG SODVPLG '1$ 0HWKRGV (Q]\PRO 9RV & 0 6DVNHU DQG + 6WXQQHQEHUJ 9DFFLQLD YLUXV FDSSLQJ HQ]\PH LV D WUDQVFULSWLRQ LQLWLDWLRQ IDFWRU (0%2

PAGE 219

9RV & DQG + 6WXQQHQEHUJ 'HUHSUHVVLRQ RI D QRYHO FODVV RI YDFFLQLD YLUXV JHQHV XSRQ '1$ UHSOLFDWLRQ (0%2 :DJQHU 5 5 5KDEGRYLULGDH DQG WKHLU UHSOLFDWLRQ S ,Q % 1 )LHOGV 0 .QLSH 5 0 &KDQRFN 0 6 +LUVFK / 0HOQLFN 7 3 0RQDWK DQG % 5RL]PDQ HGVf )LHOGV 9LURORJ\ 5DYHQ 3UHVV 1HZ
PAGE 220

%,2*5$3+,&$/ 6.(7&+ 'DQLHO ( +DVVHWW ZDV ERUQ LQ 5RFKHVWHU 1HZ
PAGE 221

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 5LFKDUG & &RQGLW &KDLU 3URIHVVRU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ %ULDQ &DLQ $VVRFLDWH 3URIHVVRU RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ OIUHGn6 /HZLQ $ 3URIHVVRU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 5LFKDUG : 0R\NU 3URIHVVRU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\

PAGE 222

7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI 0HGLFLQH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 'HFHPEHU r 0 'HDQ &ROOHJH RI 'HDQ *UDGXDWH 6FKRRO 0HGLFLQH

PAGE 223

81,9(56,7< 2) )/25,'$ ,OLOO-OL