Citation
The Generation of antigen binding site diversity in the murine Mhc class II A beta molecule

Material Information

Title:
The Generation of antigen binding site diversity in the murine Mhc class II A beta molecule
Creator:
Boehme, Stefen A., 1962-
Publication Date:
Language:
English
Physical Description:
viii, 172 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Alleles ( jstor )
Amino acids ( jstor )
Antigens ( jstor )
Binding sites ( jstor )
DNA ( jstor )
Exons ( jstor )
Molecules ( jstor )
Nucleotides ( jstor )
Species ( jstor )
T lymphocytes ( jstor )
Amino Acid Sequence ( mesh )
Antigen-Antibody Reactions ( mesh )
Base Sequence ( mesh )
Binding Sites, Antibody -- chemistry ( mesh )
Binding Sites, Antibody -- genetics ( mesh )
Department of Pathology and Laboratory Medicine thesis Ph.D ( mesh )
Dissertations, Academic -- College of Medicine -- Department of Pathology and Laboratory Medicine -- UF ( mesh )
Evolution, Molecular ( mesh )
Genes, MHC Class II -- genetics ( mesh )
Major Histocompatibility Complex -- genetics ( mesh )
Molecular Sequence Data ( mesh )
Point Mutation -- genetics ( mesh )
Polymorphism (Genetics) ( mesh )
Research ( mesh )
Selection (Genetics) ( mesh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 1990.
Bibliography:
Bibliography: leaves 161-171.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Stefen A. Boehme.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
002357426 ( ALEPH )
50763024 ( OCLC )
ALW1869 ( NOTIS )
AA00006099_00001 ( sobekcm )

Downloads

This item has the following downloads:

generationofanti00boeh.pdf

AA00006099_00001_pdf.txt

generationofanti00boeh_0115.txt

generationofanti00boeh_0181.txt

generationofanti00boeh_0050.txt

generationofanti00boeh_0069.txt

generationofanti00boeh_0075.txt

generationofanti00boeh_0122.txt

generationofanti00boeh_0013.txt

generationofanti00boeh_0032.txt

generationofanti00boeh_0183.txt

generationofanti00boeh_0060.txt

generationofanti00boeh_0030.txt

generationofanti00boeh_0084.txt

generationofanti00boeh_0045.txt

generationofanti00boeh_0156.txt

generationofanti00boeh_0141.txt

generationofanti00boeh_0161.txt

generationofanti00boeh_0059.txt

generationofanti00boeh_0036.txt

generationofanti00boeh_0160.txt

generationofanti00boeh_0128.txt

generationofanti00boeh_0090.txt

generationofanti00boeh_0170.txt

generationofanti00boeh_0112.txt

generationofanti00boeh_0073.txt

generationofanti00boeh_0055.txt

generationofanti00boeh_0051.txt

generationofanti00boeh_0100.txt

generationofanti00boeh_0061.txt

generationofanti00boeh_0163.txt

generationofanti00boeh_0095.txt

generationofanti00boeh_0123.txt

generationofanti00boeh_0039.txt

generationofanti00boeh_0109.txt

generationofanti00boeh_0137.txt

generationofanti00boeh_0062.txt

generationofanti00boeh_0171.txt

generationofanti00boeh_0006.txt

generationofanti00boeh_0138.txt

generationofanti00boeh_0042.txt

generationofanti00boeh_0046.txt

generationofanti00boeh_0102.txt

generationofanti00boeh_0038.txt

generationofanti00boeh_0152.txt

generationofanti00boeh_0058.txt

generationofanti00boeh_0159.txt

generationofanti00boeh_0047.txt

generationofanti00boeh_0099.txt

generationofanti00boeh_0087.txt

generationofanti00boeh_0145.txt

generationofanti00boeh_0067.txt

generationofanti00boeh_0057.txt

generationofanti00boeh_0178.txt

generationofanti00boeh_0056.txt

generationofanti00boeh_0074.txt

generationofanti00boeh_0031.txt

generationofanti00boeh_0003.txt

generationofanti00boeh_0043.txt

generationofanti00boeh_0091.txt

generationofanti00boeh_0053.txt

generationofanti00boeh_0139.txt

generationofanti00boeh_0136.txt

generationofanti00boeh_0010.txt

generationofanti00boeh_0173.txt

generationofanti00boeh_0048.txt

generationofanti00boeh_0148.txt

generationofanti00boeh_0017.txt

generationofanti00boeh_0149.txt

generationofanti00boeh_0063.txt

generationofanti00boeh_0016.txt

generationofanti00boeh_0071.txt

generationofanti00boeh_0176.txt

generationofanti00boeh_0070.txt

generationofanti00boeh_0007.txt

generationofanti00boeh_0083.txt

generationofanti00boeh_0049.txt

generationofanti00boeh_0081.txt

generationofanti00boeh_0011.txt

generationofanti00boeh_0034.txt

generationofanti00boeh_0106.txt

generationofanti00boeh_0134.txt

generationofanti00boeh_0015.txt

generationofanti00boeh_0147.txt

generationofanti00boeh_0009.txt

generationofanti00boeh_0127.txt

generationofanti00boeh_0165.txt

generationofanti00boeh_0068.txt

generationofanti00boeh_0008.txt

generationofanti00boeh_0153.txt

generationofanti00boeh_0107.txt

generationofanti00boeh_0125.txt

generationofanti00boeh_0110.txt

generationofanti00boeh_0004.txt

generationofanti00boeh_0054.txt

generationofanti00boeh_0079.txt

generationofanti00boeh_0096.txt

generationofanti00boeh_0064.txt

generationofanti00boeh_0021.txt

generationofanti00boeh_0041.txt

generationofanti00boeh_0168.txt

generationofanti00boeh_0169.txt

generationofanti00boeh_0082.txt

generationofanti00boeh_0066.txt

generationofanti00boeh_0002.txt

generationofanti00boeh_0143.txt

generationofanti00boeh_0129.txt

generationofanti00boeh_0151.txt

generationofanti00boeh_0113.txt

generationofanti00boeh_0155.txt

generationofanti00boeh_0119.txt

generationofanti00boeh_0182.txt

generationofanti00boeh_0126.txt

generationofanti00boeh_0086.txt

generationofanti00boeh_0162.txt

generationofanti00boeh_0174.txt

generationofanti00boeh_0117.txt

generationofanti00boeh_0077.txt

generationofanti00boeh_0025.txt

generationofanti00boeh_0029.txt

generationofanti00boeh_0114.txt

generationofanti00boeh_0121.txt

generationofanti00boeh_0022.txt

generationofanti00boeh_0019.txt

generationofanti00boeh_0158.txt

generationofanti00boeh_0140.txt

generationofanti00boeh_0103.txt

generationofanti00boeh_0154.txt

generationofanti00boeh_0000.txt

generationofanti00boeh_0118.txt

generationofanti00boeh_0026.txt

generationofanti00boeh_0175.txt

generationofanti00boeh_0020.txt

generationofanti00boeh_0179.txt

generationofanti00boeh_0044.txt

generationofanti00boeh_0040.txt

generationofanti00boeh_0037.txt

generationofanti00boeh_0104.txt

generationofanti00boeh_0164.txt

generationofanti00boeh_0167.txt

generationofanti00boeh_0023.txt

generationofanti00boeh_0131.txt

generationofanti00boeh_0142.txt

generationofanti00boeh_0080.txt

generationofanti00boeh_0108.txt

generationofanti00boeh_0150.txt

generationofanti00boeh_0111.txt

generationofanti00boeh_0018.txt

generationofanti00boeh_0014.txt

generationofanti00boeh_0065.txt

generationofanti00boeh_0101.txt

generationofanti00boeh_0078.txt

generationofanti00boeh_0124.txt

generationofanti00boeh_0144.txt

generationofanti00boeh_0105.txt

generationofanti00boeh_0092.txt

generationofanti00boeh_0094.txt

generationofanti00boeh_0028.txt

generationofanti00boeh_0072.txt

generationofanti00boeh_0146.txt

generationofanti00boeh_0132.txt

generationofanti00boeh_0157.txt

generationofanti00boeh_0097.txt

generationofanti00boeh_0027.txt

generationofanti00boeh_0089.txt

generationofanti00boeh_0116.txt

generationofanti00boeh_pdf.txt

generationofanti00boeh_0085.txt

generationofanti00boeh_0098.txt

generationofanti00boeh_0001.txt

generationofanti00boeh_0012.txt

generationofanti00boeh_0005.txt

generationofanti00boeh_0172.txt

generationofanti00boeh_0130.txt

generationofanti00boeh_0180.txt

generationofanti00boeh_0076.txt

generationofanti00boeh_0135.txt

generationofanti00boeh_0035.txt

generationofanti00boeh_0052.txt

generationofanti00boeh_0093.txt

generationofanti00boeh_0088.txt

generationofanti00boeh_0166.txt

generationofanti00boeh_0033.txt

AA00006099_00001.pdf

generationofanti00boeh_0120.txt

generationofanti00boeh_0133.txt

generationofanti00boeh_0177.txt

generationofanti00boeh_0024.txt


Full Text












THE GENERATION OF ANTIGEN BINDING SITE
DIVERSITY IN THE MURINE MHC CLASS II
A BETA MOLECULE















By

STEFEN A. BOEHME


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


1990




THE GENERATION OF ANTIGEN BINDING SITE
DIVERSITY IN THE MURINE MHC CLASS II
A BETA MOLECULE
By
STEFEN A. BOEHME
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1990


I would like to dedicate this dissertation to the three
people whose altruistic love, support and encouragement
made this work possible. Kathy, Mom, and Dad, from the
bottom of my heart, thank you, and I love you.
God bless you.


ACKNOWLEDGEMENTS
First and foremost, I would like to thank my mentor,
Dr. Ward Wakeland, for his guidance, patience, and
friendship during my tenure as his student.
I would also like to express my thanks to my committee
members, Drs. Smith, Johnson, Nick and Hauswirth, for their
assistance and encouragement.
Additionally, I certainly appreciated the support and
help from the faculty members of the Department of Pathology
and Laboratory Medicine. Furthermore, I sincerely thank Liz
(soon to be even more bored) Wilkerson, Rose (Lil' Pork
chop) Mills, and Crystal (thanks for just being you) Grimes,
for making my life easier, and well delivered doses of
sanity.
I also would like to wish the Wakeland laboratory
continued success in its scientific endeavors.
Additionally, I want to thank Drs. McConnell, Hensen,
Tarnuzzer, Zack, Potts and She, and soon to be Drs. Lu and
Mclndoe for all their help and assistance.
iii


Finally, I wish to thank my peers who brought life into
lab. Of particular notoriety are Roy Tarnuzzer, Jane
Gibson, Lena Dingier, Rick Mclndoe, Lee Grimes, Jeff
Anderson, Linda Yaswen, and Sussanna Lamers. Best of luck
to you all, and Baa-Baa-Roo!


TABLE OF CONTENTS
Page
ACKNOWLEDGEMENTS iii
ABSTRACT vii
CHAPTER I: INTRODUCTION 1
CHAPTER II: REVIEW OF THE LITERATURE 4
Genomic Organization of the Major
Histocompatibility Complex 4
Generation of Mhc Class II Gene Polymorphism .... 28
Functional Role of Mhc Polymorphism 4 3
Wild Mice 59
CHAPTER III: MATERIALS AND METHODS 67
Isolation of Genomic DNA 67
Polymerase Chain Reaction Amplification,
Cloning, and Sequencing 68
Spleen Cell Isolation, Immunostaining, and
Flow Cytometric Analysis 69
Data Analysis 70
CHAPTER IV: RESULTS 71
The Generation of Mhc Class II A@_ Gene
Polymorphism in Rodents 71
The Impact of Mhc Class II A£ Gene Polymorphisms
on the Structure of the Antigen Binding
Site 99
Serological Characterization of the Mhc
Class II A Molecule 135
CHAPTER V: DISCUSSION 146
The Genetic Mechanisms of Mhc Gene
Diversification 146
Combinatorial Association of the Ag and A£
Chains 147
Mhc Influence on Immune Responsiveness 149
The Selective Maintenance of Antigen Binding
Site Diversity 153
v


LITERATURE CITED 161
BIOGRAPHICAL SKETCH 172
Vl


Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
THE GENERATION OF ANTIGEN BINDING SITE DIVERSITY IN
THE MURINE MHC CLASS II A BETA MOLECULE
By
Stefen A. Boehme
August 1990
Chairman: Edward K. Wakeland
Major Department: Pathology and Laboratory Medicine
The genetic polymorphism of the murine major
histocompatibility complex class II Ab gene is generated by
the slow accumulation of point mutations over long
evolutionary time periods. These point mutations, which are
predominantly located in the antigen binding site,
frequently result in nonsynonymous (amino acid replacement)
mutations, and usually change the biochemical class of amino
acid. This diversity is then extensively amplified by
mechanisms that dramatically modify the antigen binding site
in a single step; intra-exonic recombination between
different alleles of Ab exon 2 (which contains the Ab
portion of the antigen binding site), and the introduction
of amino acid deletions. Consequently, natural mouse
populations contain an array of Ab alleles with highly
Vll


divergent antigen binding site structures and presumably
antigen binding properties. The accumulation of such rare
and unusual genetic events specifically within the antigen
binding site of the Mhc class II Ab gene suggests that
specialized selective mechanisms may favor the maintenance
of alleles encoding highly divergent forms of the antigen
binding site. This type of selection, referred to as
divergent allele advantage, may act in concert with other
forms of balancing selection, and drive the diversification
of the antigen binding site by selectively maintaining the
most divergent Mhc alleles within populations.
viii


CHAPTER I
INTRODUCTION
A crucial step in the initiation of all antigen-
specific immune responses is T lymphocyte recognition of
processed antigen bound to molecules encoded by the major
histocompatibility complex (Mhc). The two classes of Mhc
molecules, class I and class II, bind peptide fragments that
are derived from different cellular compartments, and
generated by various antigen processing pathways. This
allows T lymphocytes the ability to efficiently detect
cellular alterations via stimulation of their clonally
distributed T cell antigen receptor. Regulatory T
lymphocytes normally recognize antigen bound to class II
molecules, while cytotoxic T lymphocytes normally recognize
antigen complexed to class I molecules. Mhc molecules
specifically bind antigenic fragments in their antigen
binding site, which X-ray crystallographic analysis of a
class I molecule has shown to be a groove produced by two
parallel a-helices overlaying a platform composed of an
eight strand ^-pleated sheet (Bjorkman et a_l. 1987a; Brown
et al. 1988). Fragments of processed antigen, approximately
9-17 amino acids in length, are bound with micromolar
1


2
affinity within the antigen binding site groove (Buus et al.
1987) .
The importance of Mhc gene products to immune
recognition has dramatically influenced their evolution,
such that these genes exhibit an unparalleled degree of
polymorphism. Alleles often differ in greater than 10% of
their nucleotide sequence, and most of this diversity is
concentrated in the exons encoding the antigen binding site
(Benoist et al. 1983; Estess et al. 1986). These
polymorphisms modify the functional properties of Mhc
molecules in antigen presentation, causing changes in the
immune responsiveness of individuals to foreign antigens.
The evolutionary mechanisms responsible for the
generation and maintenance of Mhc diversity has been a
controversial issue in the field of immunogenetics for many
years. The goals of this dissertation are to elucidate the
molecular mechanisms responsible for this unprecedented
genetic diversity, and to determine whether selective
pressures are acting to exclusively diversify the antigen
binding site. These issues were approached by analyzing the
divergence of the antigen binding site in the murine Mhc
class II Ab gene. The polymerase chain reaction coupled
with DNA sequencing technology was employed to obtain the
nucleotide sequence of 46 alleles of Ab exon 2 (which
encodes the Ab portion of the antigen binding site).
Together with ten published sequences, the data set included


3
nucleotide sequence from 56 alleles derived from 12 Mus
species and 2 Rattus species.
The results of this analysis indicate that the
diversification of Ab exon 2 is generated by the slow
accumulation of point mutations predominantly in the antigen
binding site over long evolutionary time spans. These point
mutations frequently result in nonsynonymous (amino acid
replacement) mutations, and often change the biochemical
class of amino acid at that position. This diversity is
then extensively amplified by mechanisms that dramatically
modify the antigen binding site in a single step; intra-
exonic recombination between Ab alleles, and the
introduction of amino acid deletions. As a result, natural
mouse populations contain an array of alleles with highly
divergent binding properties. The accumulation of such rare
and unusual events specifically within the antigen binding
site of Mhc class II genes suggests that specialized
selective mechanisms may favor the maintenance of alleles
encoding highly divergent forms of the antigen binding site.
This type of selection, referred to as divergent allele
advantage, may act in concert with the other two forms of
balancing selection (overdominance and rare allele
advantage) and drive the diversification of the antigen
binding site by selectively maintaining the most divergent
Mhc alleles within populations.


CHAPTER II
REVIEW OF THE LITERATURE
The major histocompatibility complex (Mhc) was
initially detected based on its involvement in graft
rejection between different inbred mouse lines (Little and
Tyzzer 1916). The development of serological techniques
immensely augmented the study of the H-2 complex (Gorer
y
1936; 1938), and thus allowed for a greater understanding
and appreciation of the genetic diversity encoded within the
genes of the Mhc. The extensive polymorphism of the Mhc
genes, as well as their critical role in regulating immune
responsiveness has made their study particularly interesting
for scientists from many different disciplines of biology.
This literature review will concentrate on Mhc class II gene
structure, function, and genetic diversity.
Genomic Organization of the Major Histocompatibility Complex
The murine major histocompatibility complex, referred
to as H-2. is a large multigene family located on chromosome
17 of the mouse. The H-2 complex encompasses approximately
4


5
2 centiMorgans of DNA, which is equivalent to a physical
distance of at least 2.4 megabase pairs (Hood et al. 1982;
Klein 1975). Chromosomal walking and mapping techniques
have provided a detailed picture of the molecular
organization of the Mhc. A total of 50 genes have been
cloned and partially characterized from the Mhc of a BALB/c
mouse, most of which encode immune related proteins. A
molecular map of the H-2 complex, as well as the general
protein structure, is illustrated in Figure 2-1.
Mhc genes encode three families of proteins based on
their structure and function. The H-2 complex has
accordingly been divided into four regions which correspond
to the class of molecules encoded. The K and D regions
contain the class I genes, of which there are two general
types. First, the K, D, and L genes encode for the
classical transplantation antigens and are expressed on most
nucleated cells of the body. These molecules are extremely
polymorphic, and as such are responsible for mediating
heterologous graft rejection. Their physiological function
in vivo, however, is to present viral and tumor antigens to
cytotoxic T lymphocytes (Zinkernagel 1979). The second type
of class I gene, designated £>a and Tla. are much less
polymorphic. Molecular cloning studies have revealed more
than 32 genes of this type (Steinmetz et al. 1982a), located
telomeric to the D and L loci (Winoto et aJL. 1983) .


6
Although some of these genes are expressed on nucleated
blood cells (£a) or on thymocytes and certain leukemias
(Tla) (Michealson et al. 1983), their function is not yet
known (Flaherty 1980). It has been postulated, however,
that Tla molecules may serve as restriction elements for the
S lineage of T lymphocytes (Janeway et al. 1989).
Both types of class I molecules have a similar protein
structure. They consist of three extracellular domains, a
transmembrane domain, and a cytoplasmic domain, thereby
constituting a 40-45,000 dalton membrane bound glycoprotein
of approximately 350 amino acids. A fourth extracellular
domain is contributed by (3-2 microglobulin. This 12,000
dalton molecule, encoded on chromosome 2 of the mouse,
noncovalently associates with class I proteins, and is
thought to play a role in stabilizing the extracellular
domain structure of class I proteins (Klein et al. 1983b).
The S region encodes a heterogeneous assortment of
genes. Included are the classical class III genes, which
i
encode the complement proteins C2, Bf, Sip, and C4, as well
as the two homologous genes 21-OHA and 21-OHB. one of which
codes for the steroid 21-hydroxylase (Steinmetz et al.
1984). Centromeric to the D locus are the genes for two
cytotoxins, TNF-a and TNF-ff (Muller et al. 1987). Although
these S region genes are physically located within the H-2
complex, and may therefore evolve as a single genetic unit
(Bodmer 1976), Klein et al. (1983b) argue against their


7
inclusion in the Mhc because they are not functionally
related to the class I or class II histocompatibility loci.
The class II genes are contained within the I region,
which maps between the K and S regions of the H-2 complex
(Figure 2-1). Class II genes were first defined by the
differential ability of inbred mouse strains to mount an
immune response to the synthetic peptide (T,G)-AL
(McDevitt and Sela 1965). These immune response genes were
then definitively mapped using recombinant and congenie
strains of mice (McDevitt et aJL. 1972; Benacerraf and
&
McDevitt 1972). There are two isotypic forms of class II
molecules encoded within the I region, denoted A and E, and
these are assembled from polypeptides encoded by the four
functional genes Ab, Aa, Eb, and Ea. In addition, there are
three pseudogenes, termed Ab3. Ab2, and Eb2 (Widera and
Flavell 1985; Steinmetz et al. 1986). Class II molecules
are heterodimeric glycoproteins composed of a 35,000 dalton
a (alpha) chain and a 28,000 dalton b (beta) chain (Klein et
al. 1983b). These polypeptides noncovalently associate in
the cytoplasm and are subsequently expressed on the surface
of antigen presenting cells. Both the a and b chains are
organized into 5 protein domains including a hydrophobic
leader peptide of approximately 25 amino acids absent in the
mature cell surface form of the molecule, 2 approximately 90
amino acid extra-cellular domains (termed al a2 or bl b2), a
hydrophobic transmembrane segment of 25 amino acids, and a


Figure 2-1. A diagram depicting the class I, class II, and class III
gene loci and gene products within the major histocompatibility
complex located on chromosome 17 of the mouse.


class I class II class III
CHROMOSOME
I
class I
D l Qa, Tla
VO


10
highly charged cytoplasmic domain. The tertiary structure
of the a2, bl, and b2 domains is abetted by the formation of
disulfide bonds between pairs of cysteine residues located
within each domain (Mengle-Gaw and McDevitt 1985).
The domain organization of class II polypeptides
directly reflects the exon/intron organization of their
respective genes. The b chain genes, for instance, are
composed of six exons, one for each protein domain, and an
additional exon encoding the 3' untranslated region (Saito
et al. 1983). The a chain genes are very similar, except
that the transmembrane and cytoplasmic domains are combined
into a single exon. Thus, they are composed of 5 exons
(Mathis et al^. 1983; McNichols et al. 1982). A diagram of
the organization of class II a and b genes is given in
Figure 2-2.
Organization of the I-Reqion
The I region was originally divided into 5 sub-regions,
I-A, I-B, I-J, I-E, and I-C based on recombinational
analysis of various immune responsiveness traits (reviewed
by Klein 1975). The I-A and I-E subregions encode the
serologically and biochemically defined A and E molecules,
which are the immune response antigens. The Ab, Aa, and Eb
polypeptides are encoded in the I-A subregion and the Ea
chain is encoded by the I-E subregion (Jones et al. 1978;
Murphy et al. 1980).


Figure 2-2. The intron/exon organization of the Mhc class II a and b
chain genes.


L (1
CLASS II (¡GENE
CLASS II aGENE
I
ai
mim
TM/CY
3UT


13
The I-J subregion was serologically defined by reagents
directed against an I-J polypeptide, which was thought to be
a suppressor T cell factor capable of suppressing immune
responses (Murphy et al. 1976; Murphy et al. 1980).
Although these I-J suppressor factors have been
serologically defined, attempts to isolate and biochemically
characterize them have failed.
The existence of the I-B and I-C subregions were based
entirely on regulatory effects on immune responsiveness.
The I-B subregion was originally defined by Leiberman et al.
(1972) for its ability to regulate the antibody response to
an allotypic determinant on the myeloma protein MOPC 173.
Immune responses to at least 5 other antigens have been
attributed to the B region including lactate dehydrogenase B
(Melchers et al. 1973), staphylococcal nuclease (Lozner et
al. 1974), oxazolone (Fachet and Ando 1977), H-Y antigen
(Hurme et al. 1978), and trinitrophenylated mouse serum
albumin (Urba and Hildemann 1978). No protein product has
ever been detected from the I-B subregion, and its effects
can be explained by the complimentation of gene products
from both the I-A and I-E subregions (Dorf and Benacerraf
1975; Klein et al. 1981).
The C locus was first discovered with H-2h2anti-H-2h4
antiserum (David and Shreffler 1974). Rich et al. (1979a,
1979b) subsequently produced antisera containing C specific
antibodies that reacted with a suppressor factor produced in


14
allogeneic mixed lymphocyte reactions. Mapping of the C
subregion using recombinant inbred strains suggested a
position telomeric to the Ea locus and centromeric to C4.
As for the B subregion, no protein product has ever been
found.
The advent of molecular genetic analysis has allowed
the elucidation of a molecular map of the I-region.
Steinmetz et al. (1982) provided the first evidence at the
molecular level of the exact linkage of class II genes by
cloning a stretch of 200,000 contiguous base pairs from the
I-region of a BALB/c mouse. This study identified 3 of the
biochemically defined class II genes, Ab, Eb, and Ea; and
Eb2. designated a pseudogene because it did not hybridize to
a 5' probe. Southern blot analysis of the BALB/c genome
suggested that the I-region contains 2 a chain genes and
from 4 to six b chain genes, a conclusion later confirmed by
the work of Widera and Flavell (1985). Steinmetz et al.
(1982) also showed that the Ea and Eb genes are in fact
present in strains not expressing an E molecule. Thus, the
failure to express an E molecule is not a consequence of the
deletion of the entire gene, but rather must occur at the
level of transcription or translation. Subsequent
experiments involving the screening of cosmid libraries by
Davis et al. (1984) lead to the identification of the Aa
gene, and it was mapped just telomeric to the Ab locus.


15
Comparison of the molecular map of the I-region with
the genetic map has confirmed the location of the Aa and Ab
genes in the I-A subregion, and the location of the Ea gene
in the I-E subregion. The Eb gene, however, is located with
its 5' end in the I-A subregion and its 3' end in the I-E
subregion. This confines the I-J and I-B subregions to less
than 3.4 Kb of DNA at the 3' end of the Eb gene (Steinmetz
et al. 1982) Sequence analysis of this DNA fragment
definitively showed that no gene could encode for I-J in
this segment (Kobori et al. 1986).
.y
Two other class II genes have subsequently been
discovered and determined to be pseudogenes. Larhammer et
al. (1983a) identified the Ab2 gene and mapped it
approximately 20 Kb centromeric to the Ab gene. Sequence
analysis of the Ab2 gene and an Ab2 cDNA clone shows the
exon/intron organization to be the same as other class II b
genes (Larhammer et a. 1983b). The predicted amino acid
sequence of Ab2 shows only about 60% homology to other b
chains. In contrast, the typical homology among other b
chains in human and mouse is around 80%, thus indicating
that Ab2 is the most divergent member of the family.
Detection of incompletely spliced Ab2 mRNA and the finding
of an cDNA clone containing intron sequences suggests that
Ab2 transcripts are not properly processed. No cell surface
product has been isolated from the Ab2 locus. Hybridization
to restriction enzyme-digested genomic DNA of different


16
inbred strains with Ab2 probes indicated that this gene
displays a lesser degree of polymorphism than Ab.
Widera and Flavell (1985) isolated the Ab3 gene. It
shows 83% nucleotide homology with the human SBb gene and
strong homology with other class II b genes. However, an 8
nucleotide deletion makes the translation of this gene into
a functional protein an impossibility.
The position of the Ab3 gene is 75 Kb telomeric the K
gene (Widera and Flavell 1985). Steinmetz et al. (1986)
subsequently linked the Ab3 gene from the BALB/c mouse to
the rest of the I-region, thereby providing a contiguous 600
kilobase map of the K and I regions of the Mhc. The
organization of the I-region is shown in Figure 2-3. The
genes are arranged centromerically in the order of Ab3. Ab2.
Ab, Aa, Eb, Eb2, and Ea, and span approximately 300
kilobases of DNA, with the functional genes confined to a
110 kilobase region.
Homologous Recombination Within the Mhc
The molecular cloning and characterization of large
segments of the Mhc has made it possible to map meiotic
recombinational breakpoints at the nucleotide level.
Steinmetz et al. (1982a) initially analyzed 9 intra-I region
recombinant mouse strains and found that all the
recombinational events map to a 10 kilobase segment of DNA
covering part of the Eb gene. Subsequent southern blot and


\
Figure 2-3. The molecular map of the murine ^-region. The
organization of Mhc class II genes, their transcriptional orientation
and their position relative to the K region is illustrated. Adapted
from Steinmetz et al. (1986).


SCALE f 1 r
0 100 200
300
AfP Ap Aa Ep Efp Ea

400
500 kb
H
00


19
sequence analysis revealed that 3 of the recombinational
events occurred within a 1 kilobase region of DNA in the
intron between the Ebl and Eb2 exons (Kobori et aJL. 1984;
1986). Several succeeding studies have identified 3 more
intra-I region recombinants in which the breakpoints map to
this recombinational hotspot (Saha and Cullen 1986a; 1986b;
Lafuse and David 1986). The finding of highly localized
meiotic recombination points in the mouse Mhc indicates that
recombination is highly focal, and the genetic and physical
maps would not be congruent.
y
Further studies have revealed 4 additional
recombinational hotspots within the Mhc. These map to (1) a
40 kilobase stretch of DNA between the K and A loci
(Steinmetz et al. 1986; Shiroshi et al. 1982). (2) A 9.5
kilobase region of DNA between the Ab3 and Ab2 loci
(Steinmetz et aT. 1986). Further analysis of this
recombinational hotspot by Uematsu et al. (1986) revealed
that all the breakpoints were confined to a 3.5 kilobase
stretch of DNA. All the breakpoints examined showed
homologous recombination without any DNA sequences
duplicated or deleted between the parental and recombinant
haplotypes. (3) Seven breakpoints have been characterized
mapping to a 12-14 kilobase region centromeric to the Ea
gene (Lafuse and David 1986). (4) Another recombinational
hotspot was identified by Tarnuzzer (1988), that maps to a
4.7 kilobase stretch of DNA approximately


20
5 kilobases telomeric to the Aa gene. These observations
indicate that most of the recombinations within the H-2
complex occur in clusters, defining 5 recombinational
hotspots shown in Figure 2-4.
All the recombinational hotspots in H-2 have three
characteristics in common: (1) high frequency of homologous
recombination, (2) localization to a small stretch of DNA,
and (3) haplotype specificity (Steinmetz et al. 1987).
Furthermore, when the recombinational hotspots are present,
they act in a dominant fashion (Steinmetz and Uematsu 1987).
The structural basis of the recombinational hotspots
within the Mhc is unknown (Steinmetz et al. 1987).
Repetitive sequences have been identified in the proximity
of the Ab3/Ab2 and Eb hotspots (Steinmetz et al. 1987;
Uematsu et al. 1986). These repetitive sequences have been
suggested to play a role based on their similarity to Chi, a
recombinational hotspot in phage lambda, and human
hypervariable minisatellite sequences, constituting presumed
hotspots in man. These similarities may therefore indicate
that the basic mechanism of homologous recombination maybe
similar in prokaryotes and eukaryotes.
3-Dimensional Structure of Mhc Molecules
A major advance in the understanding of Mhc molecules
came with the elucidation of the 3-dimensional structure of
the class I HLA-A2 molecule (Bjorkman et al. 1987a). Plasma


Figure 2-4. Diagram illustrating the location of recombinational
hotspots (RHS) within the H-2 complex.


SCALE
r
o
K2 K
GENES E9K2
RECOMBINATIONAL HOTSPOTS
300 400
A|?2 A/? Aa EjS Ep2Ea
I I
Ai A
50 0 kb
to


23
membranes from the homozygous human lymphoblastoid cell line
JY were digested with papain to remove the transmembrane
anchor of the HLA-A2 molecule. The soluble fragment,
containing the al, a2, a3, and /32M domains, was
crystallized, and the structure was then determined from
3.5A X-ray crystallographic analysis. The molecule is
comprised of two structurally similar domains; al and a2
have the same tertiary folds, and likewise a3 and /32M have
the same tertiary folds. The a3 and /32M domains are both /3-
sandwich structures composed of 2 antiparallel /3-pleated
sheets, one with 4 /3-strands and one with 3 /3-strands.
These two sheets are connected by a disulfide bond. This
tertiary structure has been described for the constant
region of immunoglobulin molecules, and is consistent with
the amino acid homology between the 2 molecules (Orr et al.
1979).
The al and a2 domains interact symmetrically to compose
the antigen binding site (Bjorkman et al,. 1987a) It is
located on the top surface of the molecule, distal from the
membrane, in a position accessible for recognition by
receptors from the surface of another cell. The structure
consists of two parallel a-helices, each span a platform
composed of an 8 strand antiparallel /3-pleated sheet
structure. The antigen binding site is the groove that lies
between the two a-helices and atop the /3-pleated sheet. The
dimensions of the antigen binding site (ABS) groove are


24
approximately 25A long, 10A wide, and 11A deep. This
would accommodate an 8-10 amino acid fragment in a linear
conformation or 14-17 amino acids in an a-helical
confirmation. The interior of the antigen binding site is
lined with both polar and nonpolar amino acid side chains,
and many of the highly polymorphic amino acids responsible
for haplotype-specific associations with antigen are located
in the site (Bjorkman et al. 1987b).
A large continuous region of electron density that is
not accounted for by the polypeptide chain of the HLA-A2
molecule was observed in the ABS (Bjorkman et a. 1987a).
It seems likely that this extra density is from a peptide or
mixture of peptides that co-crystallized with the Mhc
molecule.
Recently, the structure of HLA-Aw68, refined to a
resolution of 2.6A, was reported (Garrett et al. 1989).
The backbone structure of the two HLA class I molecules was
very similar, excluding the 13 amino acid differences, of
which 10 are in amino acid positions that face in the
antigen binding cleft. These amino acid differences
individually cause only local structural changes, but
overall substantially transform the ABS. For instance,
comparison of the structure from the 2 alleles illustrates
that various sub-sites of the groove have contour and
charge-distribution changes. Furthermore, the physical
characteristics of pockets which extend between the a-helix


25
and /3-pleated sheets, and are thought to play a critical
role in determining peptide binding properties, can be
highly diversified between the alleles. This is due to
polymorphisms that result in amino acid side chain changes,
differences that ultimately dictate physical binding
properties. The number of amino acid differences between
HLA-A2 and HLA-Aw68 is approximately equal to the average
number of site differences between pairs of HLA alleles.
Therefore, the same degree of structural changes in local
pockets and sub-sites should be observed in other alleles.
A model of the Mhc class II ABS has been proposed based
on the class I structure and the pattern of polymorphism of
human and mouse class II alleles (Brown et al. 1988). The
basic 3-dimensional structure is the same; the two a-helices
lying atop an 8 strand /3-pleated sheet (Figure 2-5). Both
the a chain and the b chain contribute an a-helix and 4
strands of the /3-pleated sheet. There are regions of the
model, however, whose tertiary structure cannot be
accurately predicted. These areas in the b chain are (1)
the loop between /3-strand one and /3-strand two, (2) the
central a-helix, and (3) the 3' segment. The undefined
parts of the a chain are (1,2) the loops between /3-strand 1
and 2, and between /3-strands 3 and 4, and (3) the 5' a-helix
segment. Analysis of the secondary structure of class II
molecules by physical criteria, such as Fourier transform
infrared and circular dichroism spectroscopy, are consistent


site.
the
Figure 2-5. Hypothetical Mhc class II molecule antigen binding
Dotted rectangle indicates regions of predicted deviations from
class I model. Adapted from Brown et al. (1988).


27


28
with the class II model proposed by Brown et al. (1988)
(Gorga et al. 1989). Furthermore, the class II ABS model is
consistent with a variety of structural and functional
studies (Allen et al. 1987, Buus et al. 1987).
Generation of Mhc Class II Gene Polymorphism
The most outstanding feature of Mhc genes is their
unprecedented genetic polymorphism. No other vertebrate
genes exhibit such a high degree of diversity (Klein 1986).
Serological studies, tryptic peptide mapping, and molecular
characterization have estimated that greater than 100
alleles of some Mhc loci exist in natural populations of Mus
(Wakeland and Klein 1979; Duncan et al. 1979a; Gotze et al.
1980; Klein and Figueroa 1981; 1986). Many of the alleles
are globally-distributed with frequencies ranging from 1-10%
in wild mouse populations (Gotze et al. 1980; Nadeau et al.
1981). In addition, greater than 90% of wild mice are
heterozygous at H-2 (Duncan et al. 1979b), an observation
fully consistent with the high degree of diversity of Mhc
genes.
Restriction fragment length polymorphism (RFLP)
analysis with single copy probes spanning the I-region
reveals variable and conserved tracts of DNA (Steinmetz et
al. 1984; Tarnuzzer 1988). The centromeric half of the I-
region, that encodes the Ab, Aa, and 5' portion of the Eb


29
gene, shows extensive polymorphism and allelic variability.
On the other hand, the telomeric portion of the I-region,
encoding the 3' portion of the Eb gene, Eb2, and Ea.
displays little polymorphism. The boundary runs through the
Eb gene, close to and perhaps overlapping with the
recombinational hotspot in the intron between Ebl and Eb2
exons.
Nucleotide sequence comparisons of the four functional
class II genes derived from laboratory strains of mice is
consistent with the observations made at the RFLP level; Ab,
Aa, and Eb are polymorphic, whereas Ea is not (Benoist et
al. 1983a; 1983b; Choi et al. 1983; Malissen et al. 1983;
Mengle-Gaw and McDevitt 1983; Estess et al. 1986). Allelic
nucleotide sequence variation can be extensive; alleles of
Ab or Aa commonly differ by 5-10% of their nucleotide
sequence (Benoist et al. 1983b; Estess et al 1986). Thus,
the RFLP and nucleotide sequence data suggest that the
diversity is indeed greater in both the coding and non
coding regions of the variable tract as compared to the
conserved tract of the I-region.
Nucleotide sequence analysis of the Ab, Aa, and Eb
genes from different laboratory strains of mice all indicate
that the majority of the diversity is localized in the amino
terminus of the molecule, specifically the al and bl exons
(Choi et al. 1983; Benoist et al. 1983b; Estess et al.
1986). These are the exons that encode the antigen binding


30
site (Brown et al. 1988). Closer inspection of the
nucleotide sequence variation of the Ab, Aa, and Eb genes
reveals that most of the substitutions are clustered into
regions of hypervariability (Benoist et al. 1983b; Mengle-
Gaw and McDevitt 1983; Estess et al. 1986). This diversity
is also seen at the amino acid level. For instance, a Kabat
and Wu variability plot (Kabat and Wu 1970) of the 6 Aa
alleles sequenced by Benoist et al. (1983b) illustrates that
the amino acid substitutions fall into two hypervariable
regions at residues 11-15 and residues 56-57.
Hughes and Nei have examined the patterns of nucleotide
substitutions at both the class I loci (1988a), and the
class II loci (1989) of both humans and mouse. The rates of
nonsynonymous (replacement) substitutions versus synonymous
(silent) substitutions was measured for the various domains
of the Mhc molecules. In both class I and class II loci,
the membrane distal domains encoding the antigen binding
site had a much higher rate of nonsynonymous versus
synonymous substitutions. This was contrasted by the other
parts of the molecules where the reverse was observed; the
rate of synonymous substitutions exceeded that of
nonsynonymous substitutions.
These observations illustrate the extensive
polymorphism of Mhc class II genes, and imply that this
genetic diversity reflects a unique and important biological
role for these molecules. The functional significance of


31
this polymorphism is still unclear; although, it is thought
to directly relate to disease susceptibility. In addition,
the evolutionary origin of Mhc allelic diversity is unknown;
however, two hypotheses dominate speculations: retention of
ancestral polymorphisms (Klein 1980; 1987), and
hypermutational diversification (Pease 1985).
Retention of Ancestral Polymorphisms
Klein (1980) first postulated that the extensive
diversification of Mhc alleles could be explained by trans
species evolution; the hypothesis that most Mhc alleles
diverged prior to the origin of the species in which they
are presently found. The divergence of contemporary Mhc
alleles, therefore, reflects the steady accumulation of
mutations over long evolutionary timespans, rather than
hypermutational diversification subsequent to speciation.
The hypothesis of retention of ancestral polymorphisms
postulates that allelic lineages of Mhc genes are maintained
for extremely long evolutionary periods in natural
populations, independent of speciation events (Figure 2-6).
This predicts that selection may act to maintain specific
sets of alleles with specific antigen binding sites, and
consequently binding properties. The most common allelic
lineages would encode antigen binding sites which are
optimal for the presentation of the antigenicity expressed
by the prevalent endemic pathogens.


Figure 2-6. A diagrammatic illustration contrasting the evolutionary
histories of nuclear genes (A) and Mhc genes (B). The cross-hatched
vertical lines represent speciation events. Vertical lines represent
alleles or lineages of alleles. In the case of nuclear genes, all the
diversity within a species was generated after speciation events. Mhc
genes, on the other hand, have inherited multiple alleles or lineages
of alleles at the time of inception of a species, thereby illustrating
the retention of ancestral polymorphisms. Some alleles in both
examples have been lost, presumably to random genetic drift.


rvvvvv^i
Ancestral
A MUS
Ancestral
B MUS
LO
LO


34
The first experimental support for this hypothesis
demonstrated that Mhc class I molecules derived from
different sub-species of the Mus musculus complex had
identical serological reactivities and tryptic peptide maps
(Arden and Klein 1982). Direct evidence further
illustrating the antiquity of Mhc genes was reported by
McConnell et al. (1988). This study analyzed Ab gene
polymorphism by RFLP analysis, and revealed that greater
than 90% of the 31 alleles examined could be organized into
two evolutionary lineages based on the presence or absence
of an 861 basepair retroposon insertion into the intron
between the Abl and Ab2 exons. The flanking direct repeats
of host derived sequences on either side of the retroposon
indicate that the insertion into this position was a random
event during the evolutionary divergence of Ab. Ab alleles
with and without the retroposon insertion were found in 4
species and sub-species of the genus Mus. demonstrating that
this polymorphism arose in the ancestors of modern Mus
species, and was maintained as a polymorphism across
multiple speciation events. These findings have
subsequently been extended to 115 independently derived Ab
alleles, representing 9 different species or sub-species of
the genus Mus. Ab alleles from both lineages are present in
Mus caroli. demonstrating that alleles in these two lineages
diverged at least 8 million years ago (Figure 2-7)(Lu et al.
1990).


Figure 2-7. An illustration of the evolutionary origins of the three
evolutionary lineages of Ab alleles. The solid line represents
evolutionary lineage 1. The stippled line represents evolutionary
lineage 2, which was formed by a retroposon insertion into a lineage 1
allele before the separation of the 9 Mus species assayed.
Evolutionary lineage 3 is represented by the cross-hatched line, and
was formed by an additional insertion into a lineage 2 allele
subsequent to the inception of the Mus musculus complex (Lu et al.
1990).


Ancestral Mus
Lineage 1
Insertion in A^>
produces Lineage 2
Insertion in Lineage 2
produces Lineage 3
Modern
Mus m.dom m.mus
m.cas |ptd
hort spretus eery
cooki
caroli
Hi? Tested 67 18 4 6 4 12 1
1
2


37
Nucleotide sequence analysis of Ab alleles has revealed
that some of these genes have a deletion of two codons,
while others do not (Choi et al. 1983; Estess et al. 1986).
The deletions occur in exon 2 at amino acid positions 65 and
67. Figueroa et al. (1988) report 2 Ab specific monoclonal
antibodies that correlate perfectly with the two types of Ab
genes. The H-2A.m27 antibody reacts with the Ab chains that
have the two deletions, and the H-2A.m25 antibody reacts
with Ab chains that are undeleted. Strains that are
homozygous for Ab show a perfectly antithetical relationship
between the determinants that these antibodies detect, they
are either m25-positive and m27-negative or vica versa. No
molecule has been found that reacts with both antibodies,
and only one molecule reacts with neither of the two
antibodies. Utilizing these two antibodies and Northern
blot hybridization with allele-specific oligonucleotides,
Figueroa et al. (1988) where able to demonstrate the
presence or absence of the amino acid position 65/67
deletion polymorphism in 10 species and sub-species of the
genus Mus, in addition to Rattus norveoicus. This data
indicates that the 65/67 deletion polymorphism already
existed in the last common ancestor of mice and rats.
A number of different mutations affecting both the a
and b chains of the E molecule can result in E molecule non
expression (Jones et a. 1990). (These mutations will be
discussed at greater depth in the following sections of this


38
literature review.) Many of these mutations can be
identified in mice from multiple species and sub-species of
the genus Mus, indicating that the mutations were already
present in nascent species and survived multiple speciation
events.
The fact that many of these polymorphisms are found in
multiple species requires that the different alleles be
present at relatively high frequencies in the species
founding populations. These founding populations must also
have been of reasonably large sizes. If either of these two
criterion had not been met, there would be a high likelihood
of losing the polymorphism by random drift, particularly the
retroposon polymorphism in the intron of Ab, where selection
would presumably act at a minimum (Nei 1987).
These findings, together with similar results for
primates (Lawler et al. 1988; Parham et al. 1989; Gyllensten
and Erlich 1989; Mayer et al. 1988), demonstrate that the
retention of ancestral polymorphisms over extremely long
evolutionary periods can account for the extensive diversity
seen in modern Mhc alleles in natural populations of
rodents.
Hvoermutational Diversification of Class II Genes
The presence of hypervariable regions of DNA within
class II genes suggests that hypermutational mechanisms such
as gene conversion or segmental exchange may be operating to


39
rapidly diversify the regions of Mhc genes responsible for
immune responsiveness. This hypothesis predicts that most
of the polymorphism will be generated within the lifetime of
a species, potentially allowing alleles to rapidly adapt to
changes in the antigenicity of endemic pathogens (Pease
1985).
Gene conversion or segmental exchange was originally
defined in fungi (Radding et al. 1978), and is a mechanism
by which DNA sequence is copied or transferred from one gene
to another. Although the DNA sequences can be transferred
.Â¥
to and from genes anywhere in the genome, it is more common
to occur within multigenic or multiallelic families
(Baltimore 1981; Robertson 1982; Slightom et al. 1980).
Gene conversion is defined by the DNA transfer between
discrete loci, whereas intragenic segmental exchange occurs
between alleles of a particular locus. Pairing between
partially homologous sequences during meiosis or mitosis is
followed by mismatch repair thereby converting part of one
sequence to that of another. The primary evidence for gene
conversion events is the clustering of nucleotide
substitutions. This pattern of diversity is clearly
documented in Mhc class I genes (Mellor et al.. 1983; Weiss
et al. 1983; Nathenson et aJL. 1986; Geliebter and Nathenson
1987).
Direct evidence for gene conversion in Mhc class II
genes has been reported by Mengle-Gaw et al. (1984), where


40
an alloreactive T cell clone, 4.1.4, recognized a
determinate present on both the Eb and Abbmllfiolecules.
Nucleotide sequence comparisons between Ab Ab .and Eb
(Choi et al. 1983; McIntyre and Seidman 1984) revealed that
the Ab ^sequence is identical to Eb in the region where it
differs from Abb. The region exchanged must have
encompassed a minimum of 14 nucleotides, because the 3
nucleotide changes occurred in this 14 base pair stretch.
The area of exchange is flanked by regions of exact homology
extending for 20 nucleotides 5' and 9 nucleotides 3'.
McConnell et al. (1988) demonstrated evidence for
segmental exchange occurring in Mhc class II genes. By
examining the nucleotide sequence of eight alleles of Ab,
the sequence of the Ab2 exon of all 8 alleles corresponded
to the appropriate genomic evolutionary lineage, as defined
by the retroposon insertion. However, the nucleotide
sequence of the Abl exon of two of the 8 alleles, Ab and
nrl
Ab did not reflect their evolutionary lineage, and
therefore reflects the exchange of sequence, by segmental
exchange, from alleles of a different evolutionary lineage
(Figure 2-8).
At present, the relative importance of recombinational
mechanisms versus the accumulation of point mutations over
long evolutionary periods in the generation of Mhc class II
gene diversity has yet to be determined. This is one the
goals of this dissertation.


Figure 2-8. A diagram summarizing the relationships of the sequence
polymorphisms in the Abl and Ab2 exons with the retroposon
polymorphisms which occur in the intron between them. Six of the
eight Abl alleles have exon sequence polymorphisms that are associated
with the retroposon polymorphism. The remaining two alleles, A and
Abnod. appear to have been produced by intragenic segmental exchange
events. Adapted from McConnell et al. (1988).


A/S A 1
Lineage Allele Exon
1
2
3
b
nod
intron
insertions
A 2
Exon
Intragenic
segmental
exchange


43
Functional Role of Mhc Polymorphism
Regulatory T lymphocytes are responsible for initiating
and coordinating antigen specific immune responses.
Activation of virgin T regulatory cells, or regulatory T
cells that have not come into contact with their specific
ligand, is dependant upon a set of signals delivered by the
antigen presenting cell. This stringency is designed to
maintain the specificity of the resultant immune response,
and ensure the inactivity of autoreactive T cells. First,
regulatory T lymphocytes must recognize processed peptide
antigen bound to molecules encoded by the I-region of the
major histocompatibility complex. This recognition is
achieved via T cell surface structures including the
clonally distributed T cell antigen receptor, and the co
receptor molecule CD4. Second, the antigen presenting cell
must provide a costimulatory signal, such as the membrane
form of interleukin-1. The regulatory T cell must receive
both of these signals in tandem. Either signal alone is not
sufficient to induce T lymphocyte activation, or the
subsequent immune response to the antigen from which the
peptide was derived.
Class II molecules play a crucial role in this antigen
presenting cell-T cell interaction. Their function is to


44
act as promiscuous receptors for antigen fragments; thereby
making them recognizable to T lymphocytes. These two
events, antigen binding by class II molecules, and
regulatory T lymphocyte recognition of the resultant
bimolecular complex, not only forms the basis for antigen
specific immune responsiveness, but, in addition, determines
to a large extent the intensity of the ensuing immune
response.
Regulation of Expression of Class II Molecules
Consistent with their function to bind and present
antigen to regulatory T lymphocytes, the expression of class
II molecules is restricted to the antigen presenting cells
of the body. These antigen presenting cell types include
macrophage, dendritic cells, B lymphocytes, and thymic
epithelial cells. Macrophage are the primary antigen
presenting cell in the body (Unanue and Allen 1987), and as
such have the unique ability to trigger virgin T cells
(Lassila et al. 1988). However, resting macrophage do not
constitutively express class II molecules on their surface,
rather cell surface expression is under both positive and
negative control (Steinman et al. 1980; Snyder et al. 1982).
Supernatants of mitogen activated T cells induce the cell
surface expression of class II molecules on macrophage
(McNichols 1982). Biochemical analysis of the inducing
component of these supernatants have determined the factor


45
to be gamma-interferon (Steeg et al. 1982; King and Jones
1983). Gamma-interferon increases the cell surface
expression of both the A and E molecules, as well as class I
molecules. This control appears to act at the level of
transcription, such that there is a coordinate increase in
the level of mRNA of all four class II chains within 8 hours
of treatment with gamma-interferon (Paulnock-King et al.
1985). Prostoglandins, glucocorticoids, and the bacterial
endotoxin LPS have all been shown to have a negative effect
on the cell surface expression of class II molecules (Snyder
et al. 1982; Aberer et al. 1984; Steeg et al. 1982).
Precursor B lymphocytes do not express class II
molecules; however, mature B cells and plasma cells show
heterologous constitutive levels of class II on their
surface (Mond et aJ. 1981; Monroe and Cambier 1983). The
levels of class II expression on resting B cells can be
augmented by incubation with mitogen activated T cell
supernatants (Roehm et al. 1984), and subsequent studies
have shown the factor responsible for this to be
interleukin-4 (BSF-1)(Noelle jet al. 1984). Interleukin-4
can induce the levels of class II mRNA within one hour and
cell surface expression levels as early as two hours after
incubation of B cells (Polla et al. 1986). B lymphocytes do
not have the ability to activate virgin T cells (Lassila et
al. 1989). However, they may play an integral role in
antigen presentation during a secondary T cell response


46
because of their ability to pick up and display minute
quantities of antigen (Lanzavecchia 1985).
These induction mechanisms for class II molecule
expression illustrates the importance of class II molecule
cell surface expression to the interaction of regulatory T
lymphocytes and antigen presenting cells resulting in an
immune response. Furthermore, this expression of class II
molecules on limited cell types ensures regulatory T cell
reactivity can take place only while interacting with
selected cells of the body. This introduces a control
mechanism to ensure the inactivity of autoreactive T cells.
The Functional Expression of Class II Molecules
Initial serological and biochemical characterization of
Mhc class II molecules revealed a heterodimeric glycoprotein
requiring the association of both the a and b chains (Jones
£
1977; Jones et al. 1978). Serological analysis of class II
molecules expressed in inbred and wild mice has shown the A
molecule expressed in all populations of mice examined.
However, four of eleven inbred strains and 5-30% of wild
haplotype mice fail to express an E molecule on the cell
surface (Jones et al. 1981; Nizetic et al. 1984). Analysis
of the Ea and Eb polypeptides of the four inbred E-strains
by 2-dimensional gel electrophoresis revealed that the H-2b
and the H-2S mice synthesize normal Eb chains but do not
express Ea chains, whereas the H-2f and H-2^ mice do not


47
synthesize either Ea or Eb chains (Jones et a. 1978; Jones
et al. 1981). Recently the molecular defects resulting in E
molecule non-expression have been identified, and thus far,
seven independent defects have been detected (Jones et al.
1990).
K c _
The Ea gene of the H-2 and H-2 haplotypes have a 627
base pair deletion encompassing the promoter and first exon
(Mathis et al. 1983). The Eaq gene has a single nucleotide
insertion in codon 64, causing a frameshift leading to a
f
stop codon at position 69 (Vu et al. 1989). The Ea. gene
also has a single nucleotide insertion, but at codon -2,
thereby generating a downstream stop codon (Vu et a. 1989).
The Eb mutation of the H-2w3^nd H-2w2haplotypes is a
single nucleotide substitution at codon 7 generating a stop
codon. There are also two independent mutations occurring
in the RNA donor splice site at the first exon-intron border
of the Eb gene (Tacchini-Cottier and Jones 1988; Vu et al.
1988). Both of these mutations lead to aberrant RNA
processing. Jones et al. (1990) also report another Eb
mutation distinct from the first three, but have not as yet
molecularly characterized it. All the defects described
causing E molecule non-expression, with the exception of the
. f
insertion affecting the Ea gene of H-2 have also been
found in various wild mouse haplotypes (Jones et al. 1990;
Dembic et al. 1984). The large number of mice not


48
expressing an E molecule may indicate that the two Mhc class
II molecules are not functionally equivalent.
Chain Association of Class II Molecules
The extensive polymorphism of Mhc class II molecules
together with the critical nature of their function of
binding antigen allowing T lymphocyte recognition suggests
that individuals expressing a greater variance of class II
molecules on the cell surface of an antigen presenting cell
would be at a selective advantage. Fathman and Kimoto
(1981) observed that the a and b chains of a given isotype
can transassociate in heterozygotes. These findings gave
rise to the notion of free association of allelic varients
within an isotype, suggesting that 4 types of class II
heterodimers will form in a heterozygote. In contrast,
cross-isotype pairing of A and E molecule polypeptide chains
does not occur except in artificial experimental systems
(Murphy et al. 1980). Preferential isotypic pairing is due
to a strong increased affinity for the association of
isotype matched pairs of polypeptides (Sant and Germain
1989) .
Numerous observations now suggest that preferential
pairing of certain allelic A molecule polypeptide chains
limits the amount of transassociated A molecules that can be
formed. Tryptic peptide analysis from serologically related
groups of mice (Wakeland and Klein 1983) show the Aa and Ab


49
polypeptides from these strains differ by less than 10% of
their tryptic peptides (Wakeland and Darby 1983).
Restriction fragment length polymorphism analysis of the Aa
and Ab chain genes from this same allelic family
corroborates this observation at the DNA level (Tarnuzzer
1988; McConnell et al. 1986). These observations suggest
that the Aa and Ab genes on the same chromosome accumulate
mutations in a coordinate manner, thereby ensuring their
ability to functionally associate.
Gene transfection experiments by Germain et al. (1985)
clearly illustrated that allelic variation can dramatically
affect the ability of A molecule subunits to assemble
correctly, and be expressed on the cell surface. These
studies showed that haplotype mismatched chains cannot
associate as efficiently as haplotype matched chains, and
therefore are not expressed at appreciable levels. Further
! analysis indicated that polymorphisms in the amino terminal
half of the Abl domain consistently controlled a and b chain
interactions (Braunstein and Germain 1987). Buerstedde et
al. (1988), using site-directed mutagenesis and DNA mediated
gene transfer, have shown that amino acid positions 9, 12,
13, 14, and 17 of the Abl exon are responsible for proper
chain association and cell surface expression for the H-2
V
and H-2 haplotypes examined. The amino acid positions 12
and 13 being particularly significant for proper
association.


50
These studies suggest that, in order for proper subunit
association and cell surface expression, the a and b chains
of the A molecule need to be co-adapted, and therefore be
from the same or similar haplotype (Figure 2-9).
The ability of polypeptide chains of the E molecule to
associate is under different selective pressures. In the
case of the E molecule, only the Eb chain is highly
diversified while Ea exhibits very low levels of diversity.
Therefore, the diversification of Eb is only constrained by
the requirement to associate with an essentially monomorphic
Ea (Figure 2-9). This discrepancy in selective pressures of
the various class II genes to properly associate may be due
in part to the presence of a recombinational hotspot in the
second intron of Eb. Homologous recombination at this
position would not allow co-evolution of the two genes.
The Role of the Invariant Chain in Class II Molecule
Expression
Mhc class II molecules are associated intracellularly
with a third glycoprotein called the invariant chain (Ii),
which displays little allelic variation among the different
strains of mice examined (Jones et al. 1979). The invariant
chain is a basic polypeptide of 31,000 daltons that is
coprecipitated with class II molecules in
immunoprecipitations using anti-la antisera of monoclonal
antibodies. It noncovalently associates with class II


Figure 2-9. (A) Diagram illustrating the importance of maintaining A
molecule subunits that can transassociate. Chain association of two
class II A molecules is shown. Haplotype mismatched ab chain pairs
are transcribed and translated normally, but fail to associate in the
cytoplasm, a step necessary for the expression of the molecule on the
cell surface.
(B) Diagram illustrating the importance of maintaining a monomorphic
form of the Ea chain for the proper expression of the class II E
molecule. Both the a and b chains can always properly associate, due
to the ability of the monomorphic a chain to associate with all b
chains.


to


53
molecules in the membranes of the endoplasmic reticulum, but
has not been detected on the cell surface in association
with class II molecules (Sung and Jones 1981). It has been
demonstrated that the invariant chain is coordinately
regulated with class II molecules (Koch et al. 1984;
Paulnock-King et al. 1985). Although the function of the
invariant chain is unclear, it has been suggested that it
plays a role in the assembly and intracellular transport of
class II molecules to the cell surface (Sung and Jones 1981;
Jones et al. 1979).
The Presentation of Antigen by Class II Molecules
Regulatory T lymphocytes recognize the bimolecular
ligand of foreign antigen and a self class II molecule on
the surface of antigen presenting cells. However, unlike B
lymphocytes which directly interact with antigen, most T
lymphocytes only recognize a non-native form of the antigen
(Schwartz 1985). The conversion of an antigen from a native
to a non-native form has been termed antigen processing, and
is performed by antigen presenting cells which express class
II molecules on their surface. Although much is still
unknown about the intricacies of antigen processing, the
following is a summary of events (Werdelin et al. 1989;
Germain 1988).
The first step involved in antigen processing is
ingestion of the antigen. Macrophage accomplish this by


54
constitutive endocytosis, whereas B lymphocytes, by virtue
of their immunoglobulin receptor, utilize receptor-mediated
endocytosis. The ingested antigen is transported into the
interior of the cell in an endocytic vacuole.
The second step of the process takes place when the
endocytic vacuole becomes acidified and proteolytic enzymes
with an acid optimum become activated. This results in the
partial degradation of the antigen; hence, the antigen is
broken down into peptide fragments.
The third step in antigen processing is the binding of
antigenic fragments to Mhc class II molecules. This
presumably occurs in an intracellular compartment, but
exactly where in the cell this occurs is not known. Once an
antigenic fragment is bound to a class II molecule, it is
protected from complete proteolytic destruction. However,
parts of the antigen fragments which .are outside the antigen
binding site, may not be protected against further
degradation.
The fourth step consists of transporting the class II
molecule-processed antigen fragment complex back to the
surface of the antigen presenting cell. Once there, the
class II molecule acts to keep the antigen fragment in a
constant orientation with a stable conformation, thereby
allowing recognition by a T lymphocyte.
The processing requirements may vary with each
particular antigen, depending on the conditions required to


55
induce the conformational flexibility needed for the antigen
to bind a class II molecule (Allen 1987). For instance,
some proteins may require no processing, because at least a
portion of the protein has enough freedom in its native
state to become stably bound to a class II molecule. Other
proteins may simply need denaturation, such as a reduction
and alkylation of disulfide bonds, to reveal peptide
fragments able to bind to class II molecules. The most
stringent antigen processing would require proteolytic
cleavage of the native protein. Irrespective of the type of
antigen processing necessary, the immunogenic peptide must
possess two distinct features. First, it must be able to
bind to a class II molecule, and the class II molecule
contact sites of an immunogenic peptide is called an
agretope (Haber-Katz et ad. 1983). The immunogenic peptide
must also make contact with the T cell antigen receptor, and
this site on the peptide is termed an epitope.
The first direct evidence for peptide-class II molecule
association came from Babbitt et al. (1985) using an
equilibrium dialysis method employing purified class II
molecules and peptide fragments. These experiments showed a
peptide from hen egg lysozyme, HEL 46-61, previously
. k d
demonstrated to be immunogenic for H-2 and not for H-2 .
. k d
bound specifically to A. molecules but not to molecules in
a saturable process, with an affinity in the micromolar
range. This direct correlation between antigen-class II


56
molecule interaction and Mhc restriction was subsequently
extended for numerous other antigens (Buus et 1986b; 1987; Guillet et al. 1987). Furthermore, inhibition
analysis illustrated that peptides restricted to a
particular class II molecule competitively inhibited one
another from binding. This suggested that a class II
molecule contained just a single antigen binding site (Buss
et al. 1987; Babbitt et a^. 1986; Guillet et al. 1987), an
observation in agreement with X-ray crystallographic
analysis (Bjorkman et al. 1987a).
Utilizing a gel filtration system enabling complexes of
antigenic peptides and class II molecules to be separated
from unbound peptide, Buus et al. (1986b) were able to study
the kinetics of association and disassociation of these
complexes. These experiments, using the ovalbumin 323-339
j
peptide/A/ system, illustrated that the rate of complex
formation is very slow (Ka 1M-Is-1 Jdji once formed the class
II molecule peptide complex is remarkably stable (Kd 3xl0~6s~
l ,
) This suggests that the association of class II
molecules with antigen fragments most likely occurs in an
intracellular vesicular compartment as opposed to the plasma
membrane, since this would prevent soluble processed antigen
from diffusing away from the membrane bound class II
molecule. This intracellular compartment would probably
have a neutral pH, based on a 10-fold slower rate of complex
formation at pH 4.6, compared with pH 7.2, and the lability


57
of preformed complexes to acid pH. This peptide-class II
molecule complex sensitivity to acid pH may represent a
mechanism by which class II molecules could rid itself of
complexed peptide, and be available to bind newly processed
antigen. Recycling of class II molecules (Pernis 1985)
together with biosynthesis (Harding et aJL. 1989) could
effectively prevent potentially constant saturation of class
II molecule binding sites with peptides derived from self
proteins.
Babbitt et al. (1986) first observed that class II
molecules can bind antigenic fragments of self-proteins.
Lorenz and Allen (1988; 1989) further characterized the
ability of class II molecules to bind self-peptides. These
studies provided direct functional proof in vivo that self
proteins are processed constitutively, and can be presented
in a fashion similar to that by which foreign antigens are
presented. In addition, experiments by Adorini et al.
(1988; 1990) demonstrate that peptides of foreign antigens
generated by processing events must compete for binding to
class II molecules with peptides generated from self
antigens in vivo. Thus, self-tolerance does not occur at
the level of the antigen presenting cell, because antigen
presentation does not discriminate self from non-self.
Rather, it occurs at the level of the regulatory T
lymphocyte, either through functional or physical deletion
of self-reactive T cells.


58
Any given class II molecule can bind a wide variety of
peptides, however different class II molecules show distinct
broad specificity patterns. This is reflected in the
variation between alleles in their capacity to present
different peptides to the immune system. For instance, when
overlapping peptides comprising an entire protein have been
analyzed for reactivity, different Mhc class II molecules
have been found to present different peptide determinants to
T lymphocytes (Roy et a_l. 1989; Allen et al. 1987).
Furthermore, class ,11 molecules only bind a subset of
peptides derived from native protein (Braciale et al. 1989),
and there is a definite hierarchy of peptide determinants
that are immunodominant for particular allelic forms of Mhc
gene products (Ria et al. 1990; Roy et al. 1989; Berzofsky
et al. 1989). Which immunodominant region of the native
protein is ultimately recognized by T lymphocytes is
predominantly influenced by the particular Mhc class II
allele expressed. This influence reflects the ability of
processed fragments to bind to a particular class II
molecule, and demonstrates the affect Mhc class II molecule
polymorphisms have in controlling an immune response
(Benacerraf 1978; Babbitt et al. 1985; Buus et al.. 1987).
In conclusion, these studies of Mhc molecule-antigen
interaction illustrate the broad specificity of the class II
molecule antigen binding site. Although the interaction is
generally permissive, the direct correlation of peptide


59
binding and Mhc restriction powerfully illustrates the
crucial role class II molecules play in the initiation of a
T cell dependent immune response.
Wild Mice
The goals of this dissertation are to elucidate the
evolutionary mechanisms responsible for generating Mhc class
II gene polymorphism, and examine the role selection plays
in driving this extensive diversification. Previous studies
addressing these questions utilized techniques, such as
serology and tryptic peptide mapping which have a limited
capacity to answer these questions, as compared to obtaining
the DNA sequence of the genes. The nucleotide sequence of a
limited number of Mhc class II genes has been obtained only
from a few standard inbred laboratory strains of mice.
Aside from having uncertain genetic origins, inbred strains
of mice were derived from a limited number of sources that
were generated by a high degree of inbreeding. This
represents a biased sampling of the mouse population and an
artificial collection of considerable homogeneity (Ferris et
al. 1982; Klein 1974).
Wild mice are unconfined animals whose breeding is not
controlled by man (Bruell 1970), and, as such, represent a
collection of I-region haplotypes of significant
heterogeneity, particularly when compared to standard


60
laboratory inbred strains of mice. A number of features
make the study of the evolutionary dynamics of the wild
mouse Mhc particularly attractive. Natural populations of
wild mice are abundant and their phylogenetic relationships
have been extensively characterized. Furthermore, these
mice represent the product of evolutionary processes where
the I-region haplotypes are fixed and maintained through
natural selection.
Natural History of Wild Mice
Wild mice can be divided into 3 categories of animals
depending on their association with man: aboriginal,
commensal, and feral (Sage 1981). Aboriginal mice are
genuinely wild, with essentially no interaction with man.
With the exception of one subspecies that is indigenous to
northwest Africa, aboriginal mice are found only on the
Eurasian continent. Typically, they are dry-area animals,
and feed on grass, seeds, and grain.
Commensal mice, on the other hand, live in close
association with man, and rely on man for their main source
of food and shelter. Marshall (1981) distinguishes 4
commensal subspecies of Mus musculus; M. m. domesticus. M.
m. musculus. M. m. castaneus. and M. m. molossinus.
Commensal mice, like aboriginal mice are also indigenous to
Eurasia, and, in addition have radiated to habitats
throughout the world. They have successfully adapted to the


61
extremely varied climatic conditions of environments ranging
from Europe, the Americas, Australia, Africa, and several
south Pacific islands. Ferris et al. (1983) estimate that
the commensal relationship between mouse and man has existed
for approximately 1 million years. This is based on fossil
evidence, nuclear DNA variation, and mitochondrial DNA
variation.
Feral mice were once commensals of man, but reverted to
a more aboriginal existence (Bruell 1970). They are found
in areas such as agricultural fields, open grasslands,
marshes, sandhills, and coastal islands, and feed on grass
and grain (Sage 1981). Permanent reversion to feral habits
primarily occurs only in dry climatic zones.
Mus musculus domesticus is presently found throughout
the world. However it originated in western Europe and
subseguently spread to the Americas and Australia in
association to the global movements of Europeans (Bonhomme
1986a). Mus musculus musculus is endemic to northeastern
Europe and central Asia (Sage 1981); Mus musculus castaneous
is found in Malaya (Harrison 1955), India (Srivastva and
Wattel 1973), Indonesia (Hadi et al. 1976), and Nepal and
Thailand (Marshall 1977). The native range of Mus musculus
molossinus is eastern Asia, particularly Japan and Korea
(Hamijima 1962; Jones and Johnson 1965). Mus spretus is a
feral species endemic to the western rim of the Mediterrean
Sea (Bonhomme 1986b). Mus soecileaus are the aboriginal


62
mound-building mice found in the steppe of eastern Europe
(Petrov 1979). Mus spretoides is found in eastern Europe,
the Balkan penninsula, Cypress, and Turkey (Bonhomme et al.
1984). Mus cookii. Mus cervicolor. and Mus caroli are all
endemic to southeast Asia (Marshall 1986). The natural
range of Mus platvthrix is India (Marshall 1986).
Phylogenetic Relationships in the Genus Mus
The phylogenetic relationships of the various species
within the genus Mus have been extensively studied (Bonhomme
1986a), and a general understanding of their relationships
can be inferred (She et a. 1989). Different species are
distinguished from subspecies based on the presence of
reproductive barriers in natural populations. Therefore, M.
m. domesticus and M. m. musculus can interbreed in natural
habitats, and in regions where they come into contact, such
as central Europe, form a tightly defined hybrid zone. In
contrast, different species with overlapping ranges, such as
M. m. domesticus and M. spretus do not interbreed in natural
populations. Although, these two species can be bred in an
laboratory environment, the resultant male hybrids are
commonly sterile.
The three major molecular techniques employed for
biochemical systematics include protein electrophoresis,
single copy nuclear DNA (sen DNA) hybridization, and
mitochondrial (mt) DNA restriction fragment length


63
polymorphism (RFLP) analysis (She et al. 1989). Protein
electrophoresis assays only the polymorphism in the coding
regions of the genome, and therefore is likely to be
constrained by natural selection. Sen hybridization studies
reveal differences between two genomes of all single copy
DNA, including exons, introns, and flanking sequences.
Mitochondrial DNA RFLP analysis, on the other hand, assays
the cytoplasmic genome which has several unique
characteristics; such as a high evolutionary rate, strictly
maternal inheritance patterns, and an absence of
recombination.
Figure 2-10 illustrates the phylogenetic relationship
within the genus Mus and Rattus as determined by DNA-DNA
hybridization studies (She et al. 1989). Similar
phylogenetic relationships are obtained when these species
are compared by other techniques; however, the estimates of
the exact genetic distance among the Mus species vary
depending upon the technique used. In comparing 9 species
of Mus, 5 subspecies of Mus musculus. and species from the
genus Rattus, there are seven levels of divergence among the
species, ranging from 0.3 million years (Mus musculus
complex) to 10 million years (divergence between species
within the genus Mus and the genus Rattus) (Luckett and
Hartenberger 1985; She et al. 1989).
By analyzing the Mhc class II gene nucleotide sequence
from wild-derived alleles from a number of different species


64
and subspecies of the genus Mus and Rattus, it should be
possible to obtain an evolutionary perspective of the forces
acting to diversify and maintain contemporary Mhc alleles.


Figure 2-10. The phylogenetic relationships within the genus Mus and
Rattus. The percentage of DNA divergence, as detected by DNA-DNA
hybridization studies, is shown on the left axis. The estimated time
interval since speciation is listed on the right axis. Adapted from
She et al. (1989).


66
% DNA
Divergence
Million
Years


CHAPTER III
MATERIALS AND METHODS
Isolation of Genomic DNA
Genomic DNA was isolated from liver or kidney tissue by
a Protease K/SDS method as detailed in Maniatis et al.
(1982). The extraction was performed on a 340A Applied
Biosystems Inc. (Foster City, CA) nucleic acids extractor.
.v
Frozen tissues are'ground in a mortar containing liquid N2
to a fine powder, and added to 3.5 ml solution of lysis
buffer (Applied Biosystems Inc., Foster City, CA) and
Protease K (final concentration of 0.3 mg/ml) (Applied
Biosystems Inc., Foster City, CA). The solution was
incubated overnight at 65C. The remainder of the
extraction was performed by the machine. Briefly, the DNA
solution was extracted two times with a Tris equilibrated
phenol (pH 7.5)/chloroform/isoamyl alcohol solution (25:1
v/v), and one time with just the chloroform/isoamyl alcohol
solution. The genomic DNA was then ethanol precipitated,
washed in 70% ethanol, and resuspended in TE buffer (10 mM
Tris HCL, pH 7.5; 1 mM EDTA), and dialyzed overnight at 12C
against TE buffer. The resulting DNA solutions were
67


68
electrophoresed on a 0.7% agarose gel for quantification and
to confirm their high molecular weight.
Polymerase Chain Reaction Amplification. Cloning, and
Sequencing
Amplification of Ab exon two was achieved via the
polymerase chain reaction (PCR) described by Saiki et al.
(1985) with slight modification. The initial 100 n1
reaction mixture contained 1 /g of genomic DNA, 50 mM KC1,
10 mM tris (pH 8.3), 1.5 mM MgCl2, 0.01% gelatin, 0.5% DMSO
(v/v)/ and 250 mM of each dNTP (dATP, dCTP, dGTP, and dTTP).
80 pmoles of each oligonucleotide primer, which are
complementary to stable intron sequences, were also
included: mouse 2: CACGGCCCGCCGCGCTCCCGC; mouse 3:
CGGGCTGACCGCGTCCGTCCGCAG. Samples were then boiled for ten
minutes, quenched on ice, and 5 U Taq DNA polymerase
(Perkin-Elmer Cetus, Norwalk, CT) was added. The first five
amplification rounds consisted of 1 minute denaturing at
94C, 2 minutes annealing at 25C, and 3 minutes extension
at 72C. At this point, 200 jul of dH20, 5% DMSO (v/v) was
added with an additional 5 U Taq DNA polymerase. The
amplification protocol for the ensuing 23 cycles consisted
of 1 minute 94C, 2 minutes 62C, and 3 minutes 72*C.
Immediately following the last cycle was a 7 minute 72C
chase to ensure full extension of all amplified fragments.


69
The samples were then ethanol precipitated and
electrophoresed through a 5% nondenaturing acrylamide gel.
The fragment of interest was then excised and eluted into 3
ml of elution buffer; 0.5 M ammonium acetate, 0.1% SDS, and
1 mM EDTA, at 50C overnight. The mixture was then
centrifuged at 2,000 rpm for 10 minutes, the supernatant was
ethanol precipitated, the pellet was washed with 70%
ethanol, dried and resuspended in 10 1 of dH20. The
amplified fragment was then ligated with Sma 1 digested
M13mpl8 overnight at 25C under conditions described by the
supplier (Bethesda Research Laboratories, Bethesda, MD).
Insert-positive plaques were sequenced via the Sanger
dideoxyribonucleoside method employing the Sequenase
protocol (United States Biochemical, Cleveland, OH). To
eliminate potential errors introduced by the PCR, at least 2
clones per sequence were analyzed.
Spleen Cell Isolation. Immunostaininq, and Flow Cytometric
Analysis
Freshly explanted spleens were minced through wire
screens to make a single cell suspension. Red blood cells
were lysed by incubating the cells in a IX ammonium chloride
solution for 5 minutes at 25C. The remaining spleen cells
were washed thoroughly with IX PBS. 1 x 106 cells were
resuspended in 400 /I IX PBS, 0.1% NaN3 solution, and then


70
incubated in a 1:2 dilution of the monoclonal antibody-
culture supernatant for 30 minutes at 4C. The samples were
washed 3 times with IX PBS and incubated in a 800 /I volume
of a 1/500 dilution of FITC (Accurate Chemical and
Scientific Corp., Westbury, NY) in IX PBS, 0.1% NaN3 for 30
minutes at 4C. The samples were again washed 3 times with
IX PBS and brought up in a 4 00 /il volume for flow cytometry.
The cells were passed through a 4 micron nylon mesh filter
and analyzed on a FACSTAR fluorescence activated cell sorter
(Becton-Dickinson, Mountain View, CA) at a flow rate of 300
cells/second.
Data Analysis
The DNA sequence was analyzed by the following computer
programs. The nucleotide alignment and amino acid
translation was achieved using Microgenie (Beckman,
Fullerton, CA). The allelic phylogenies were constructed
using the DNAPARS and DNACOMP programs in the PHYLIP package
(Felsenstein 1989), and the neighbor-joining and UPGMA
programs (provided by M. Nei). Nucleotide divergence and
diversity was calculated with the SYNO and SEND programs
(Nei and Jin 1989).


CHAPTER IV
RESULTS
The Generation of Mhc Class II Ab Gene Polymorphism in Rodents
The mechanisms responsible for generating antigen
binding site polymorphisms in rodents has been a puzzle to
immunogeneticists for many years. In an attempt to assess
the roles mutational and recombinational processes play in
diversifying MHC class II genes, the nucleotide sequence of
46 alleles of Ab exon 2 (Abl exon) was determined and the
patterns of diversification examined. This is the most
polymorphic exon, and it contains the antigen binding site.
These alleles were obtained from a panel of rodents
containing 12 Mus species and sub-species and 2 species of
Rattus; thus providing alleles derived from species diverged
for increasing amounts of evolutionary time up to 10 million
years.
71


72
Animals
The DNA analyzed in this study was isolated from fresh
tissues or ethanol preserved tissues from various species of
rodents. The standard laboratory inbred mice were from the
mouse colony in the Tumor Biology Unit at the Department of
Pathology and Laboratory Medicine, University of Florida.
H-2 homozygous wild mice, whose origins and characteristics
have been described previously (Wakeland et al. 1987), are
from our wild mouse colony located at the Animal Care
Facility, University of Florida. Some wild-mouse derived
strains were supplied by F. Bonhomme's laboratory in
Montpellier, France. Three individuals of Rattus rattus
were trapped locally in Gainesville, Florida. The strains
included in this portion of the analysis are listed in Table
4-1.
Nucleotide Diversity Within the Abl Exon
The polymerase chain reaction coupled with DNA
sequencing technology was employed to obtain the nucleotide
sequence of 46 alleles of the Abl exon (27 alleles sequenced
by S.A.B.; 19 sequenced by J.X. She). These sequences were
combined with 10 previously reported laboratory mouse and
rat sequences to provide a data base of 56 sequences
(Malissen et al. 1983; Larhammer et al. 1983a; Eccles and
McMaster 1985; Estess et al. 1986; Acha-Orbea and McDevitt


Table 4-1. List of Ab Alleles Analyzed.
Allele
Spec i es
Strain
Geographic Origin
Abh
H. m. domesticus
C57BI/6
Lab inbred 2
Abd
H. m. domesticus
BALB/C
Lab inbred 7
At/
H. m. domesticus
B10.H
Lab inbred 5
Ab*
H. m. domesticus
B10.BR
Lab inbred 3
At/
H. m. domesticus
C3H.NB
Lab inbred
Ab*
H. m. domesticus
B10.6R
Lab inbred
Ab'
H. m. domesticus
B10.RIII
Lab inbred
Ab1
H. m. domesticus
A.SU
Lab inbred 5
Ab
H. m. domesticus
B10.PL
Lab inbred 5
AbW
H. m. domesticus
N00
Lab inbred
HudoAb7
H. m. domesticus
DR1
Florida
MudoAb'
H. m. domesticus
B10.CAA2
Hichigan
HudoAb5
M. m. domesticus
B10.STC77
Hichigan
HudoAb2
H. m. domesticus
B10.SAA48
Hichigan
HudoAb5
H. m. domesticus
B10.STC90
Hichigan
HudoAb0
H. m. domesticus
B10.BUA16
Hichigan
HudoAb6
M. m. domesticus
ERF0UD5
Horocco
Ab6
H. m. domesticus
AZR0U1
Horocco
MudoAb7
H. m. domesticus
AZROU3
Horocco
HudoAb*
H. m. domesticus
HETK0VIC2
Yugoslavia
HudoAb^
H. m. domesticus
ERFOUD1
Horocco
HudoAb717
HudoAb77
HudoAb72
H. m. domesticus
FAYIUH4
Egypt
H. m. domesticus
FAYIUH5
Egypt
H. m.' domesticus
JERUSALEH4
Israel
HudoAb75
HudoAb72
HudoAb75
H. m. domesticus
24CI
Italy
M. m. domesticus
38CH
Italy
H. m. domesticus
HETK0VIC1
Yugoslavia
HumuAb7=At/
H. m. musculus
VIB0RG7
Denmark
HumuAb7
M. m. musculus
HBS
Bulgaria
HumuAb5
M. m. musculus
HOS
Denmark
HumuAb2
M. m. musculus
HBT
Bulgaria
HumuAb5
H. m. musculus
HYL
Yugoslavia
HumuAb=MudoAbi
H. m. musculus
BRN04
Czechoslavakia
HucaAb7
H. m. castaneus
CAS
Thai land
HucaAb7
H. m. castaneus
THONBURI1
Thai land
HumoAb7
M. m. molossinus
HOL
Japan
HuspAb7
H. spretus
SEG
Spain
HuspAb7
M. spretus
SEI
Spain
HuspAb5
H. spretus
STF
Tunisia
HusiAb7
H. spicilegus
PANSEV01
Yugoslavia
HusiAb2
H. spicilegus
PANSEV02
Yugoslavia
HusiAb5
M. spicilegus
PANSEVOB
Yugoslavia
Hus i Ab2
H. spicilegus
ZRU
Bulgaria
Hus i Ab5
H. spicilegus
ZYO
Yugoslavia
HusiAb0
H. spicilegus
ZBN
Bulgaria
HustAb7
H. spretoides
XBJ
Bulgaria
HucoAb7
H. cooki i
COK
Thai land
HuceAb7
M. cervicolor popaeus
CRP
Thai land
HucrAb7
H. caroli
KAR
Thai land
HucrAb2
M. caroli
KAR2
Thai land
HuplAb7
H. platythrix
PTX
India
RT-17
R. norvegicus
RT1B
Lab inbred 5
RT-1
R. norvegicus
RT1U
Lab inbred
Rara7
R. rattus
LN3
Gainesville
Rara7
R. rattus
LN4
Gainesville
Rara0
R. rattus
LN20
Gainesvilie


Figure 4-1. The consensus and allelic nucleotide sequences of Ab exon
2. Dashed lines represent identity with the consensus sequence;
differences are noted. Asterisks represent deletions of those
nucleotides.


CONSENSUS
10 20 30 40 50 60 70 80 90 100 110 120 130 140
GGCAITXCGI GTACCAGTTC AAGGGCGAGT GCTACTTCAC CAACGGGACG CAGCGCATAC GGCICGTGAC CAGATACATC TACAACCGGG AGGAGTACGT GCGCTTCGAC AGCGACGTGG GCGAGTACCG CGCGGTGACC
Abr
Abd
A\/
Abk
AbP
Abl
Abr
Ab'
Ab
Abmv7
MudoAb7
MudoAb7
Mud oAb"
MudoAl/
MudoAb7
MudoAb0
MudoAb7
MudoAb0
MudoAb9
MudoAb70
-T ATAT-
14
MudoAb'
MudoAb'
MudoAb'/
MudoAb'
MudoAb7-5
MurnuAb7
MumuAb2
MumuAbJ
MurnuAb^
MumuAp
MumuAb6
MucaAb7
MucaAb^
MumoAb7
MuspAb7
MuspAb2
MuspAb3
MusiAb7
MusiAb2
MusiAb3
MusiAb'
MusiAb5
MusiAb6
MustAb7
MucoAb7
MuceAb7
MucrAb7
Muc r Ab"
MuplAb7
RT-17,
RT-1"
Rara7
Rara7
-GT-
C-
-C
GC-
GC-
CCC-TTC-
-ATCT---GA
T T
-ATCT A
-ATCT- A
T-
-T- -GT-
C
GC-
GC-
GC-
C--
C--CC-TTC-
-ATCT-
-ATAT-
-GA
-GT-
CCC-TTC-
TT-C
-ATCT- -A
-ATCT A
-ATCT A
-ATCT A
T
-GC-
CCC-TTC-
CCC-TTC-
-GCG-
C-
-AC-
--T-
-GC-
-TTCT
-ATCT-A
- T
T
-ATCT GA
- G
- G
-ATCT
-G -ATCT-
T-
-GC-
T-
CCC-TTC-
-G
-G C
-G -T
-G
-AGCT-GA
-ATAT
-ATCT A
CC-TTC-
-T--C
T
-GC
-ATCT GA
--T
T
-ATAT
-ATGT A
-- CCC-TTC-
C--CC-TTC-
-GT-
CCC-TTC-
C--CC-TTC-
-TCT-GA
T
-GC-
C--CC-TTC-
-G TC-TTC-
-A-AT
-AGGTC-
-GG--
-GG--
C-
C-
C-
C-
-GG
-GG
-GG--
-GG
C-
C-
-GG
-T-A-
-T
C-
-T-A-
-T
-C-
-C-
-GG
-GG-
-GG-
-GG-
-T-A-
C-
C-
-T-A-
-GG
C-
-T-C-
-C-
-TG
-GG
-A-
-GA
--TATC-
-GA
Ui


CONSENSUS
150 160
GAGCTGGGGC GGCCAGACGC
170
CGAGTACTGG
180 190
AACAGCCAGC CGGAGATCCT
200
GGAGCGAACG
210
CGGGCCGAGC
220
TGGACACGGT
230
GTGCAGACAC
240 250
AACTACGAGG GGCCGGAGAC
260
CCACACCTCC
270
CTGCGGCGGC
TTG
4Kb
At/
Abk
AbP
Ab
Abr
Ab1
Ab
Ab"^
MudoAb^
MudoAb^
MudoAb"
c-
AC
a
-c
G
-GT
--C
MudoAb5
MudoAb^
MudoAb^
MudoAb9
MudoAbJtf
MudoAb^
MudoAb^
MudoAb^
MudoAbiJ
MumuAb^
MumuAb
MumuAb^
MunTuAb**
MumuAbJ
MucaAb*
MuxnoAb^
MuspAb^
MuspAb"
MuspAb^
MusiAb*
MusiAb^
MusiAbJ
MusiAb^
MusiAb5
MusiAb6
MustAb^
MucoAb^
MuceAb^
MucrAb^
f it it-ft J-***---
c
A
MuplAb7
RT-r*
RT-l
Rara^
Rara"
-CG
AG-A-
A
C T--
A-A--
C-T***
A A
---GG
G C G T
T-A A T--A-
--C


77
1987; Figueroa et al. 1988). By aligning all the sequences
in our panel it was observed that the two codon deletion at
amino acid positions 65 and 67 were erroneously placed
previously in the literature (Estess et al. 1986). Shifting
the position of the two deletions to nucleotide positions
175-177 and 185-187 results in two less nucleotide mis
matches between the two forms of Abl. The nucleotide
sequence of all the alleles is shown in Figure 4-1.
DNA sequence analysis of these 56 sequences revealed 52
different alleles in the data set; 4 pairs of identical
alleles were found in independent samples from the Mus
musculus complex. The nucleotide diversity between alleles
was computed using Nei and Jin's program (1989). Most
allelic comparisons revealed 5-15% sequence diversity in the
Abl exon; although some alleles differed by as much as 25%
in comparisons both within and between mouse species. The
maximum value of sequence divergence was 32.7%, and occurred
1 5
between a rat allele (Rara ) and a mouse allele (MudoAb ).
The mean nucleotide sequence diversity among alleles within
a Mus species (D = 7.57 0.7%) was comparable to that
observed between species (D = 7.73 0.3%) and between all
alleles in the genus (D = 7.68 0.3%). These results
indicate that the diversification of MHC genes is
independent of the phylogenetic relationships within the
genus Mus, and contrasts diversification patterns of other
nuclear genes (She et al. 1989).


78
Phylogenetic Relationships of the Abl Alleles
The phylogenetic relationships of these Abl alleles
were analyzed using both phynetic or distance methods, such
as neighbor-joining and UPGMA (Saitou and Nei 1987; Sokal
and Sneath 1963), and parsimony analysis (DNAPARS program in
PHYLLIPpfPelsenstein 1989). The distance methods determine
the alleali'c relationships by comparing the total sequence
divergence between alleles; whereas parsimony analysis forms
a network;basing the genealogy on the fewest number of
mutations^between alleles. Similar results were obtained
for all three methods of analysis, and Figure 4-2
illustrrtes the allelic genealogy produced using UPGMA based
on the distance. The results show that alleles in
separate ^species are commonly more related than alleles
within the same species. This observation is consistent
with therretention of ancestral polymorphisms. However,
these analyses revealed very few tightly-clustered allelic
lineages that were stably maintained over evolutionary time
spans. There are only 6 lineages of closely related
alleles, or alleles with less than 2% nucleotide sequence
divergence. These lineages were strictly comprised of
alleles derived from the same or closely related species,
with divergence times of less than 1-2 million years. Most
of the Abl alleles could not be organized into homogeneous
lineages. For example, if lineages were defined as alleles


Figure 4-2. A phenogram constructed by the UPGMA method showing the
relationships between alleles based on their similarity in exon 2 of
Ab.


80
P
Mudol
Mudo2
Mudo3
Mudo8
q
Mudo4
Musp3
Mudol 1
Mudol 4
s
Muca2
f
Mus¡3
Mudo7
b
Muspl
Mumu5
Mucal
d
Mucr2
Mumu3
Mus¡6
Mudo6
r
Mudo15
Mumol
Mudo12
Mudol 3
u
k
MudolO
Musp2
nod
Mumu2
Musil
Musi4
Musi2
Musi5
Mustl
Mudo9
Mucol
Mucrl
Mumu4
Mucel
Mupl1
RT-1 b
Raral
Rara2
Rara3
RT-1 u
Mudo5
l i i i i i i l I I l l I I I I I I I I I I I
22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 0
% of nucleotide divergence


81
containing less than 5% nucleotide divergence in the Abl
exon, 25 separate singleton alleles remained. This
indicates that most of the lineages defined in the analysis
are not retained as stable polymorphisms for more than 1-2
million years. This observation sharply contrasts the
results reported by Gyllensten and Erlich (1989) for
polymorphisms of the primate class II DQa gene.
Parsimony analysis revealed a second interesting
feature of the diversification patterns among these alleles.
The most parsimonious network for all 52 alleles required
405 character changes and only 20 of the 82 (24.2%)
informative sites (nucleotide positions exhibiting at least
2 character states represented by 2 or more alleles in the
data set) were compatible with the genealogy. These results
indicate that the amount of homoplasy, or reverse, parallel,
or convergent mutations, is excessive, and suggests that the
observed evolutionary relationships are not reliable. An
example of the homoplasy in the data set is illustrated in 1
l
Figure 4-3. The actual analysis was done with nucleotide
sequences, but the presentation of the results is simplified
by showing the protein sequence. The carboxyl terminal
regions of the Ab^ and MumuAb1 alleles (underlined) are
identical to that of Abn ualthough the remainder of their
sequences are clearly different. These results might be
explained by convergent evolution, but the amount and the
patterns of homoplasy observed are best explained by


Figure 4-3. Examples of homoplasy among alleles of Ab exon 2
organized into lineages by parsimony analysis. The underlined
sequences are regions of obvious homoplasy.


Amino Acid Sequences Encoded by Ab Exon 2
Ab Alleles
14 24 34 44 54 64 74 84 94
HFVYQFKGE CYFTNGTQRI RLVTRYIYNR EEYVRFDSDV GEYRAVTELG RPDAEYWNKQ *Y*LERTRAE LDTVCRHNYE GTETPTSLRR L
Ab'"**
H
MudoAb^
H
At/
A-L
MudoAb1^
---A-L---
MustAb^
QPF
Mus iAb"
QPF
MusiAbJ
QPF
L-
-S-N-F --W
S-N W
--Y 1 L M
--Y --I L
--Y 1 L
HS -Y
A E--V
S- PEI V Y - -PH
S- PEI V E--V
S- pEI v VH
-S Y E A -V--H
-S Y Q A L *- -
-S Y E A Q -L *- -
00
u>


84
postulating intra-exonic recombinational events among the
alleles.
The Abl Exon Consists of Five Polymorphic Sub-Domains
The majority of polymorphisms in the Abl exon occurs in
5 specific regions, termed polymorphic segments. These
segments contain 56 of the 82 (68.3%) informative sites for
parsimony analysis, and are identified in Figure 4-4. Each
polymorphic segments encodes a specific element of the
hypothetical class II antigen binding site, as shown in
Figure 4-5. The BS1, BS2, and BS3 segments are located
within the region of the Abl exon that encodes the /3-pleated
sheets of the antigen binding site, the a-helix segment is
located in the 5' end of the region that encodes the a-helix
of the ABS, and the 3' segment is located at the end of the
Abl exon in a region that encodes a portion of Ab whose
structure cannot be currently predicted. The Abl exon was
divided into 5 sub-domains based on the locations of these
polymorphic segments, and each sub-domain was analyzed
separately by parsimony analysis. This revealed that the
alleles in each sub-domain could be organized into a series
of highly divergent lineages. Furthermore, the total number
of mutations needed to produce all of the lineages in all of
the sub-domains was two-fold lower than that required for
lineages constructed from the entire exon. This indicates
that these sub-domain lineages have much lower levels of


Figure 4-4.
Locations of polymorphic segments within Ab exon 2.


86
L /?1 /? 2TMCYTCY3UT
l*: '
i
I I
y
£
-V.'
yjr.<.
2 Kb
BS1 BS2 BS3 Oi-helix 3 segment
v.
Y
/? pleated sheet
50 bp


Figure 4-5. A model
molecule as proposed
areas encoded by the
of the antigen binding site of a Mhc class II
by Brown et al. (1988). The grey zones represent
polymorphic segments.


3segment
00
00


89
homoplasy, and suggests that each polymorphic segment is
evolving independently.
The Abl Exon Sub-Domain Lineages Represent Ancestral
Polymorphisms
Parsimony analysis identified 5-11 distinct lineages in
each sub-domain; primarily defined by point mutations
occurring in the polymorphic segments. The consensus
sequences of these lineages are presented in Table 4-2.
These highly diversified polymorphic segments often differ
in 20-35% of their, nucleotide sequences. The majority of
the diversity between polymorphic segments appears to result
from the accumulation of point mutations over long
evolutionary periods. As illustrated in Figure 4-2, each
sub-domain lineage contains alleles derived from multiple
mouse species, or even both mouse and rat. The data in
Table 4-3 illustrates that alleles in the same sub-domain
lineage often have identical or very similar nucleotide
sequences, yet may be derived from evolutionary distant
rodent species. For example, some polymorphic segments are
identical in alleles derived from mouse and rat, indicating
they have been retained as polymorphisms for a minimum of 10
million years. These results indicate that the polymorphic
segments in the sub-domains of the Abl exon are extremely
stable polymorphisms, some of which first arose prior to the
divergence of mice and rats.


Table 4-2. The nucleotide sequences of polymorphic segments in five
sub-domains.
* The sequences on the top of each sub-domain are consensus
sequences based on all 56 alleles.
Â¥ indicates the total number of alleles that share the same
polymorphic segment.
£ "Species" lists all the species which contain at least one allele
in that lineage. Species are numbered as following: 1: M. m.
domesticus. 2: M. m. musculus. 3: M. spretus. 4: M. m. castaneus 5: M.
m. molossinus. 6: M. spicilegus. 7: M. spretoides. 8: M. cervicolor 9:
M. cookii. 10: M. caroli. 11: M. plathvtrix. 12: Rattus rattus. 13 R.
norvegicus


Lil
ag
1
2
3
4
5
1
2
3
4
5
6
7
8
9
10
1
2
3
4
5
6
7
1
2
3
4
5
6
7
1
2
3
4
5
6
7
8
9
10
11
91
Table 4-2
Nucleotide Number of Spec ies1
* ¥ '
Sequences Alleles
13 23
TACCAGTTCAAGGGCGAG
C--CC-TTC
GC G
G CT-
GT
14 1,2,3,6,7,9,11
8 1,2,6
5 12,13
3 1,6
23 1,2,3,4,5,6,8,10
61 71 80
CGGCTCGT GACCAGAT ACAT C
--ATCT-A
--ATCT GA
--ATAT
A--TATC--GA T"
:?
T--
-AT-GT
AGT GA- CG-T--
--TA-A
12
6
5
2
11
4
4
1
1
1
1.2.3.8
1,2,4,6
1.2.3.9
12
1,2,4,6
5,6,7
1,3
11
13
10
97 107
TACGTGCGCTTC
-GG
---C A-
A-
-T-A
----C A-
13 1,2,4,5,6,8,10
13 1,2,4,6,7,10
4 1
4 1,2,3
7 1,2,3,11,13
4 1.3,6
2 12
155 165 175 185
CCAGACGCCGAGTACTGGAACAGCCAGCCGGAGATC
AC--T-***---A-T-***- 29
14
--CTCA T.***...A.T.***. 4
--CACA 2
-GG T-AA----T-- 2
--GTGG CG AA 1
--G----T A 1
1,2,3,4,5,6,7,8,9,10
1,2,4,10,11
1,2,13
2
12
13
12
242 252 262 272
GGGCCGGAGACCCACACCT CCCT GCGGCGGCTT
-A-A GT--C
-GT
AA-A C
----T C ***--
----T C
G-T-TT
T-AT----T
*****T----T--T--T A C-
A CG A
---GT G ***--
16
10
9
6
3
2
3
1
1
1
1
1,2,3,4,6,11
1.2.12.13
1.2.4,7
1,2,3
1.6
5.6
12.13
8
10
10
9


Full Text
THE GENERATION OF ANTIGEN BINDING SITE
DIVERSITY IN THE MURINE MHC CLASS II
A BETA MOLECULE
By
STEFEN A. BOEHME
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1990

I would like to dedicate this dissertation to the three
people whose altruistic love, support and encouragement
made this work possible. Kathy, Mom, and Dad, from the
bottom of my heart, thank you, and I love you.
God bless you.

ACKNOWLEDGEMENTS
First and foremost, I would like to thank my mentor,
Dr. Ward Wakeland, for his guidance, patience, and
friendship during my tenure as his student.
I would also like to express my thanks to my committee
members, Drs. Smith, Johnson, Nick and Hauswirth, for their
assistance and encouragement.
Additionally, I certainly appreciated the support and
help from the faculty members of the Department of Pathology
and Laboratory Medicine. Furthermore, I sincerely thank Liz
(soon to be even more bored) Wilkerson, Rose (Lil' Pork
chop) Mills, and Crystal (thanks for just being you) Grimes,
for making my life easier, and well delivered doses of
sanity.
I also would like to wish the Wakeland laboratory
continued success in its scientific endeavors.
Additionally, I want to thank Drs. McConnell, Hensen,
Tarnuzzer, Zack, Potts and She, and soon to be Drs. Lu and
Mclndoe for all their help and assistance.
iii

Finally, I wish to thank my peers who brought life into
lab. Of particular notoriety are Roy Tarnuzzer, Jane
Gibson, Lena Dingier, Rick Mclndoe, Lee Grimes, Jeff
Anderson, Linda Yaswen, and Sussanna Lamers. Best of luck
to you all, and Baa-Baa-Roo!

TABLE OF CONTENTS
Page
ACKNOWLEDGEMENTS iii
ABSTRACT vii
CHAPTER I: INTRODUCTION 1
CHAPTER II: REVIEW OF THE LITERATURE 4
Genomic Organization of the Major
Histocompatibility Complex 4
Generation of Mhc Class II Gene Polymorphism .... 28
Functional Role of Mhc Polymorphism 4 3
Wild Mice 59
CHAPTER III: MATERIALS AND METHODS 67
Isolation of Genomic DNA 67
Polymerase Chain Reaction Amplification,
Cloning, and Sequencing 68
Spleen Cell Isolation, Immunostaining, and
Flow Cytometric Analysis 69
Data Analysis 70
CHAPTER IV: RESULTS 71
The Generation of Mhc Class II A@_ Gene
Polymorphism in Rodents 71
The Impact of Mhc Class II A£ Gene Polymorphisms
on the Structure of the Antigen Binding
Site 99
Serological Characterization of the Mhc
Class II A Molecule 135
CHAPTER V: DISCUSSION 146
The Genetic Mechanisms of Mhc Gene
Diversification 146
Combinatorial Association of the Ag and A£
Chains 147
Mhc Influence on Immune Responsiveness 149
The Selective Maintenance of Antigen Binding
Site Diversity 153
v

LITERATURE CITED 161
BIOGRAPHICAL SKETCH 172
Vl

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
THE GENERATION OF ANTIGEN BINDING SITE DIVERSITY IN
THE MURINE MHC CLASS II A BETA MOLECULE
By
Stefen A. Boehme
August 1990
Chairman: Edward K. Wakeland
Major Department: Pathology and Laboratory Medicine
The genetic polymorphism of the murine major
histocompatibility complex class II Ab gene is generated by
the slow accumulation of point mutations over long
evolutionary time periods. These point mutations, which are
predominantly located in the antigen binding site,
frequently result in nonsynonymous (amino acid replacement)
mutations, and usually change the biochemical class of amino
acid. This diversity is then extensively amplified by
mechanisms that dramatically modify the antigen binding site
in a single step; intra-exonic recombination between
different alleles of Ab exon 2 (which contains the Ab
portion of the antigen binding site), and the introduction
of amino acid deletions. Consequently, natural mouse
populations contain an array of Ab alleles with highly
Vll

divergent antigen binding site structures and presumably
antigen binding properties. The accumulation of such rare
and unusual genetic events specifically within the antigen
binding site of the Mhc class II Ab gene suggests that
specialized selective mechanisms may favor the maintenance
of alleles encoding highly divergent forms of the antigen
binding site. This type of selection, referred to as
divergent allele advantage, may act in concert with other
forms of balancing selection, and drive the diversification
of the antigen binding site by selectively maintaining the
most divergent Mhc alleles within populations.
viii

CHAPTER I
INTRODUCTION
A crucial step in the initiation of all antigen-
specific immune responses is T lymphocyte recognition of
processed antigen bound to molecules encoded by the major
histocompatibility complex (Mhc). The two classes of Mhc
molecules, class I and class II, bind peptide fragments that
are derived from different cellular compartments, and
generated by various antigen processing pathways. This
allows T lymphocytes the ability to efficiently detect
cellular alterations via stimulation of their clonally
distributed T cell antigen receptor. Regulatory T
lymphocytes normally recognize antigen bound to class II
molecules, while cytotoxic T lymphocytes normally recognize
antigen complexed to class I molecules. Mhc molecules
specifically bind antigenic fragments in their antigen
binding site, which X-ray crystallographic analysis of a
class I molecule has shown to be a groove produced by two
parallel a-helices overlaying a platform composed of an
eight strand /?-pleated sheet (Bjorkman et al. 1987a; Brown
et al. 1988). Fragments of processed antigen, approximately
9-17 amino acids in length, are bound with micromolar
1

2
affinity within the antigen binding site groove (Buus et al.
1987) .
The importance of Mhc gene products to immune
recognition has dramatically influenced their evolution,
such that these genes exhibit an unparalleled degree of
polymorphism. Alleles often differ in greater than 10% of
their nucleotide sequence, and most of this diversity is
concentrated in the exons encoding the antigen binding site
(Benoist et al. 1983; Estess et al. 1986). These
polymorphisms modify the functional properties of Mhc
molecules in antigen presentation, causing changes in the
immune responsiveness of individuals to foreign antigens.
The evolutionary mechanisms responsible for the
generation and maintenance of Mhc diversity has been a
controversial issue in the field of immunogenetics for many
years. The goals of this dissertation are to elucidate the
molecular mechanisms responsible for this unprecedented
genetic diversity, and to determine whether selective
pressures are acting to exclusively diversify the antigen
binding site. These issues were approached by analyzing the
divergence of the antigen binding site in the murine Mhc
class II Ab gene. The polymerase chain reaction coupled
with DNA sequencing technology was employed to obtain the
nucleotide sequence of 46 alleles of Ab exon 2 (which
encodes the Ab portion of the antigen binding site).
Together with ten published sequences, the data set included

3
nucleotide sequence from 56 alleles derived from 12 Mus
species and 2 Rattus species.
The results of this analysis indicate that the
diversification of Ab exon 2 is generated by the slow
accumulation of point mutations predominantly in the antigen
binding site over long evolutionary time spans. These point
mutations frequently result in nonsynonymous (amino acid
replacement) mutations, and often change the biochemical
class of amino acid at that position. This diversity is
then extensively amplified by mechanisms that dramatically
modify the antigen binding site in a single step; intra-
exonic recombination between Ab alleles, and the
introduction of amino acid deletions. As a result, natural
mouse populations contain an array of alleles with highly
divergent binding properties. The accumulation of such rare
and unusual events specifically within the antigen binding
site of Mhc class II genes suggests that specialized
selective mechanisms may favor the maintenance of alleles
encoding highly divergent forms of the antigen binding site.
This type of selection, referred to as divergent allele
advantage, may act in concert with the other two forms of
balancing selection (overdominance and rare allele
advantage) and drive the diversification of the antigen
binding site by selectively maintaining the most divergent
Mhc alleles within populations.

CHAPTER II
REVIEW OF THE LITERATURE
The major histocompatibility complex (Mhc) was
initially detected based on its involvement in graft
rejection between different inbred mouse lines (Little and
Tyzzer 1916). The development of serological techniques
immensely augmented the study of the H-2 complex (Gorer
y
1936; 1938) , and thus allowed for a greater understanding
and appreciation of the genetic diversity encoded within the
genes of the Mhc. The extensive polymorphism of the Mhc
genes, as well as their critical role in regulating immune
responsiveness has made their study particularly interesting
for scientists from many different disciplines of biology.
This literature review will concentrate on Mhc class II gene
structure, function, and genetic diversity.
Genomic Organization of the Major Histocompatibility Complex
The murine major histocompatibility complex, referred
to as H-2. is a large multigene family located on chromosome
17 of the mouse. The H-2 complex encompasses approximately
4

5
2 centiMorgans of DNA, which is equivalent to a physical
distance of at least 2.4 megabase pairs (Hood et al. 1982;
Klein 1975). Chromosomal walking and mapping techniques
have provided a detailed picture of the molecular
organization of the Mhc. A total of 50 genes have been
cloned and partially characterized from the Mhc of a BALB/c
mouse, most of which encode immune related proteins. A
molecular map of the H-2 complex, as well as the general
protein structure, is illustrated in Figure 2-1.
Mhc genes encode three families of proteins based on
their structure and function. The H-2 complex has
accordingly been divided into four regions which correspond
to the class of molecules encoded. The K and D regions
contain the class I genes, of which there are two general
types. First, the K, D, and L genes encode for the
classical transplantation antigens and are expressed on most
nucleated cells of the body. These molecules are extremely
polymorphic, and as such are responsible for mediating
heterologous graft rejection. Their physiological function
in vivo, however, is to present viral and tumor antigens to
cytotoxic T lymphocytes (Zinkernagel 1979). The second type
of class I gene, designated £>a and Tla. are much less
polymorphic. Molecular cloning studies have revealed more
than 32 genes of this type (Steinmetz et al. 1982a), located
telomeric to the D and L loci (Winoto et aJL. 1983) .

6
Although some of these genes are expressed on nucleated
blood cells (£a) or on thymocytes and certain leukemias
(Tla) (Michealson et al. 1983), their function is not yet
known (Flaherty 1980). It has been postulated, however,
that Tla molecules may serve as restriction elements for the
S lineage of T lymphocytes (Janeway et al. 1989).
Both types of class I molecules have a similar protein
structure. They consist of three extracellular domains, a
transmembrane domain, and a cytoplasmic domain, thereby
constituting a 40-45,000 dalton membrane bound glycoprotein
of approximately 350 amino acids. A fourth extracellular
domain is contributed by (3-2 microglobulin. This 12,000
dalton molecule, encoded on chromosome 2 of the mouse,
noncovalently associates with class I proteins, and is
thought to play a role in stabilizing the extracellular
domain structure of class I proteins (Klein et al. 1983b).
The S region encodes a heterogeneous assortment of
genes. Included are the classical class III genes, which
i
encode the complement proteins C2, Bf, Sip, and C4, as well
as the two homologous genes 21-OHA and 21-OHB. one of which
codes for the steroid 21-hydroxylase (Steinmetz et al.
1984). Centromeric to the D locus are the genes for two
cytotoxins, TNF-a and TNF-ff (Muller et al. 1987). Although
these S region genes are physically located within the H-2
complex, and may therefore evolve as a single genetic unit
(Bodmer 1976), Klein et al. (1983b) argue against their

7
inclusion in the Mhc because they are not functionally
related to the class I or class II histocompatibility loci.
The class II genes are contained within the I region,
which maps between the K and S regions of the H-2 complex
(Figure 2-1). Class II genes were first defined by the
differential ability of inbred mouse strains to mount an
immune response to the synthetic peptide (T,G)-A—L
(McDevitt and Sela 1965). These immune response genes were
then definitively mapped using recombinant and congenie
strains of mice (McDevitt et a_l. 1972; Benacerraf and
&
McDevitt 1972). There are two isotypic forms of class II
molecules encoded within the I region, denoted A and E, and
these are assembled from polypeptides encoded by the four
functional genes Ab, Aa, Eb, and Ea. In addition, there are
three pseudogenes, termed Ab3. Ab2, and Eb2 (Widera and
Flavell 1985; Steinmetz et al. 1986). Class II molecules
are heterodimeric glycoproteins composed of a 35,000 dalton
a (alpha) chain and a 28,000 dalton b (beta) chain (Klein et
al. 1983b). These polypeptides noncovalently associate in
the cytoplasm and are subsequently expressed on the surface
of antigen presenting cells. Both the a and b chains are
organized into 5 protein domains including a hydrophobic
leader peptide of approximately 25 amino acids absent in the
mature cell surface form of the molecule, 2 approximately 90
amino acid extra-cellular domains (termed al a2 or bl b2), a
hydrophobic transmembrane segment of 25 amino acids, and a

Figure 2-1. A diagram depicting the class I, class II, and class III
gene loci and gene products within the major histocompatibility
complex located on chromosome 17 of the mouse.

class I class II class III
K
cHflOMosoMfTzjJz^mJUzZZZzJI
class I
D l Qa, Tla
VO

10
highly charged cytoplasmic domain. The tertiary structure
of the a2, bl, and b2 domains is abetted by the formation of
disulfide bonds between pairs of cysteine residues located
within each domain (Mengle-Gaw and McDevitt 1985).
The domain organization of class II polypeptides
directly reflects the exon/intron organization of their
respective genes. The b chain genes, for instance, are
composed of six exons, one for each protein domain, and an
additional exon encoding the 3' untranslated region (Saito
et al. 1983). The a chain genes are very similar, except
that the transmembrane and cytoplasmic domains are combined
into a single exon. Thus, they are composed of 5 exons
(Mathis et al^. 1983; McNichols et al. 1982). A diagram of
the organization of class II a and b genes is given in
Figure 2-2.
Organization of the I-Reqion
The I region was originally divided into 5 sub-regions,
I-A, I-B, I-J, I-E, and I-C based on recombinational
analysis of various immune responsiveness traits (reviewed
by Klein 1975). The I-A and I-E subregions encode the
serologically and biochemically defined A and E molecules,
which are the immune response antigens. The Ab, Aa, and Eb
polypeptides are encoded in the I-A subregion and the Ea
chain is encoded by the I-E subregion (Jones et al. 1978;
Murphy et al. 1980).

Figure 2-2. The intron/exon organization of the Mhc class II a and b
chain genes.

CLASS II (¡¡GENE
CLASS II aGENE
$2 TM CY 3’UT
m
m
N1
« 2 TM/CY 3’UT
NJ

13
The I-J subregion was serologically defined by reagents
directed against an I-J polypeptide, which was thought to be
a suppressor T cell factor capable of suppressing immune
responses (Murphy et al. 1976; Murphy et al. 1980).
Although these I-J suppressor factors have been
serologically defined, attempts to isolate and biochemically
characterize them have failed.
The existence of the I-B and I-C subregions were based
entirely on regulatory effects on immune responsiveness.
The I-B subregion was originally defined by Leiberman et al.
y
(1972) for its ability to regulate the antibody response to
an allotypic determinant on the myeloma protein MOPC 173.
Immune responses to at least 5 other antigens have been
attributed to the B region including lactate dehydrogenase B
(Melchers et al. 1973), staphylococcal nuclease (Lozner et
al. 1974), oxazolone (Fachet and Ando 1977), H-Y antigen
(Hurme et al. 1978), and trinitrophenylated mouse serum
albumin (Urba and Hildemann 1978). No protein product has
ever been detected from the I-B subregion, and its effects
can be explained by the complimentation of gene products
from both the I-A and I-E subregions (Dorf and Benacerraf
1975; Klein et al. 1981).
The C locus was first discovered with H-2h2anti-H-2h4
antiserum (David and Shreffler 1974). Rich et al. (1979a,
1979b) subsequently produced antisera containing C specific
antibodies that reacted with a suppressor factor produced in

14
allogeneic mixed lymphocyte reactions. Mapping of the C
subregion using recombinant inbred strains suggested a
position telomeric to the Ea locus and centromeric to C4.
As for the B subregion, no protein product has ever been
found.
The advent of molecular genetic analysis has allowed
the elucidation of a molecular map of the I-region.
Steinmetz et al. (1982) provided the first evidence at the
molecular level of the exact linkage of class II genes by
cloning a stretch of 200,000 contiguous base pairs from the
I-region of a BALB/c mouse. This study identified 3 of the
biochemically defined class II genes, Ab, Eb, and Ea; and
Eb2. designated a pseudogene because it did not hybridize to
a 5' probe. Southern blot analysis of the BALB/c genome
suggested that the I-region contains 2 a chain genes and
from 4 to six b chain genes, a conclusion later confirmed by
the work of Widera and Flavell (1985). Steinmetz et al.
(1982) also showed that the Ea and Eb genes are in fact
present in strains not expressing an E molecule. Thus, the
failure to express an E molecule is not a consequence of the
deletion of the entire gene, but rather must occur at the
level of transcription or translation. Subsequent
experiments involving the screening of cosmid libraries by
Davis et al. (1984) lead to the identification of the Aa
gene, and it was mapped just telomeric to the Ab locus.

15
Comparison of the molecular map of the I-region with
the genetic map has confirmed the location of the Aa and Ab
genes in the I-A subregion, and the location of the Ea gene
in the I-E subregion. The Eb gene, however, is located with
its 5' end in the I-A subregion and its 3' end in the I-E
subregion. This confines the I-J and I-B subregions to less
than 3.4 Kb of DNA at the 3' end of the Eb gene (Steinmetz
et al. 1982) . Sequence analysis of this DNA fragment
definitively showed that no gene could encode for I-J in
this segment (Kobori et al. 1986).
.f
Two other class II genes have subsequently been
discovered and determined to be pseudogenes. Larhammer et
al. (1983a) identified the Ab2 gene and mapped it
approximately 20 Kb centromeric to the Ab gene. Sequence
analysis of the Ab2 gene and an Ab2 cDNA clone shows the
exon/intron organization to be the same as other class II b
genes (Larhammer et a¿. 1983b). The predicted amino acid
sequence of Ab2 shows only about 60% homology to other b
chains. In contrast, the typical homology among other b
chains in human and mouse is around 80%, thus indicating
that Ab2 is the most divergent member of the family.
Detection of incompletely spliced Ab2 mRNA and the finding
of an cDNA clone containing intron sequences suggests that
Ab2 transcripts are not properly processed. No cell surface
product has been isolated from the Ab2 locus. Hybridization
to restriction enzyme-digested genomic DNA of different

16
inbred strains with Ab2 probes indicated that this gene
displays a lesser degree of polymorphism than Ab.
Widera and Flavell (1985) isolated the Ab3 gene. It
shows 83% nucleotide homology with the human SBb gene and
strong homology with other class II b genes. However, an 8
nucleotide deletion makes the translation of this gene into
a functional protein an impossibility.
The position of the Ab3 gene is 75 Kb telomeric the K
gene (Widera and Flavell 1985). Steinmetz et al. (1986)
subsequently linked the Ab3 gene from the BALB/c mouse to
the rest of the I-region, thereby providing a contiguous 600
kilobase map of the K and I regions of the Mhc. The
organization of the I-region is shown in Figure 2-3. The
genes are arranged centromerically in the order of Ab3. Ab2.
Ab, Aa, Eb, Eb2. and Ea, and span approximately 300
kilobases of DNA, with the functional genes confined to a
110 kilobase region.
Homologous Recombination Within the Mhc
The molecular cloning and characterization of large
segments of the Mhc has made it possible to map meiotic
recombinational breakpoints at the nucleotide level.
Steinmetz et al. (1982a) initially analyzed 9 intra-I region
recombinant mouse strains and found that all the
recombinational events map to a 10 kilobase segment of DNA
covering part of the Eb gene. Subsequent southern blot and

\
Figure 2-3. The molecular map of the murine ^-region. The
organization of Mhc class II genes, their transcriptional orientation
and their position relative to the K region is illustrated. Adapted
from Steinmetz et al. (1986).

SCALE f , p-
0 100 200
300
AfP Ap Aa Ep Efp Ea
â–  â–  â–  â–  â– â– 
400
500 kb
H
00

19
sequence analysis revealed that 3 of the recombinational
events occurred within a 1 kilobase region of DNA in the
intron between the Ebl and Eb2 exons (Kobori et aJL. 1984;
1986). Several succeeding studies have identified 3 more
intra-I region recombinants in which the breakpoints map to
this recombinational hotspot (Saha and Cullen 1986a; 1986b;
Lafuse and David 1986). The finding of highly localized
meiotic recombination points in the mouse Mhc indicates that
recombination is highly focal, and the genetic and physical
maps would not be congruent.
y
Further studies have revealed 4 additional
recombinational hotspots within the Mhc. These map to (1) a
40 kilobase stretch of DNA between the K and A loci
(Steinmetz et al. 1986; Shiroshi et al. 1982). (2) A 9.5
kilobase region of DNA between the Ab3 and Ab2 loci
(Steinmetz et aT. 1986). Further analysis of this
recombinational hotspot by Uematsu et al. (1986) revealed
that all the breakpoints were confined to a 3.5 kilobase
stretch of DNA. All the breakpoints examined showed
homologous recombination without any DNA sequences
duplicated or deleted between the parental and recombinant
haplotypes. (3) Seven breakpoints have been characterized
mapping to a 12-14 kilobase region centromeric to the Ea
gene (Lafuse and David 1986). (4) Another recombinational
hotspot was identified by Tarnuzzer (1988), that maps to a
4.7 kilobase stretch of DNA approximately

20
5 kilobases telomeric to the Aa gene. These observations
indicate that most of the recombinations within the H-2
complex occur in clusters, defining 5 recombinational
hotspots shown in Figure 2-4.
All the recombinational hotspots in H-2 have three
characteristics in common: (1) high frequency of homologous
recombination, (2) localization to a small stretch of DNA,
and (3) haplotype specificity (Steinmetz et al. 1987).
Furthermore, when the recombinational hotspots are present,
they act in a dominant fashion (Steinmetz and Uematsu 1987).
The structural basis of the recombinational hotspots
within the Mhc is unknown (Steinmetz et al. 1987).
Repetitive sequences have been identified in the proximity
of the Ab3/Ab2 and Eb hotspots (Steinmetz et al. 1987;
Uematsu et al. 1986). These repetitive sequences have been
suggested to play a role based on their similarity to Chi, a
recombinational hotspot in phage lambda, and human
hypervariable minisatellite sequences, constituting presumed
hotspots in man. These similarities may therefore indicate
that the basic mechanism of homologous recombination maybe
similar in prokaryotes and eukaryotes.
3-Dimensional Structure of Mhc Molecules
A major advance in the understanding of Mhc molecules
came with the elucidation of the 3-dimensional structure of
the class I HLA-A2 molecule (Bjorkman et al. 1987a). Plasma

\
Figure 2-4. Diagram illustrating the location of recombinational
hotspots (RHS) within the H-2 complex.

SCALE
r
0
K2 K
GENES —B-K3
RECOMBINATIONAL HOTSPOTS
300 400
A|?2 A/? Aa EjS Efi2Ea
I I â– 
ii A
50 0 kb
to

23
membranes from the homozygous human lymphoblastoid cell line
JY were digested with papain to remove the transmembrane
anchor of the HLA-A2 molecule. The soluble fragment,
containing the al, a2, a3, and /32M domains, was
crystallized, and the structure was then determined from
3.5A° X-ray crystallographic analysis. The molecule is
comprised of two structurally similar domains; al and a2
have the same tertiary folds, and likewise a3 and /32M have
the same tertiary folds. The a3 and /32M domains are both /3-
sandwich structures composed of 2 antiparallel /3-pleated
sheets, one with 4 /3-strands and one with 3 /3-strands.
These two sheets are connected by a disulfide bond. This
tertiary structure has been described for the constant
region of immunoglobulin molecules, and is consistent with
the amino acid homology between the 2 molecules (Orr et al.
1979).
The al and a2 domains interact symmetrically to compose
the antigen binding site (Bjorkman et al,. 1987a) . It is
located on the top surface of the molecule, distal from the
membrane, in a position accessible for recognition by
receptors from the surface of another cell. The structure
consists of two parallel a-helices, each span a platform
composed of an 8 strand antiparallel /3-pleated sheet
structure. The antigen binding site is the groove that lies
between the two a-helices and atop the /3-pleated sheet. The
dimensions of the antigen binding site (ABS) groove are

24
approximately 25A° long, 10A° wide, and 11A° deep. This
would accommodate an 8-10 amino acid fragment in a linear
conformation or 14-17 amino acids in an a-helical
confirmation. The interior of the antigen binding site is
lined with both polar and nonpolar amino acid side chains,
and many of the highly polymorphic amino acids responsible
for haplotype-specific associations with antigen are located
in the site (Bjorkman et al. 1987b).
A large continuous region of electron density that is
not accounted for by the polypeptide chain of the HLA-A2
molecule was observed in the ABS (Bjorkman et a¿. 1987a).
It seems likely that this extra density is from a peptide or
mixture of peptides that co-crystallized with the Mhc
molecule.
Recently, the structure of HLA-Aw68, refined to a
resolution of 2.6A°, was reported (Garrett et al. 1989).
The backbone structure of the two HLA class I molecules was
very similar, excluding the 13 amino acid differences, of
which 10 are in amino acid positions that face in the
antigen binding cleft. These amino acid differences
individually cause only local structural changes, but
overall substantially transform the ABS. For instance,
comparison of the structure from the 2 alleles illustrates
that various sub-sites of the groove have contour and
charge-distribution changes. Furthermore, the physical
characteristics of pockets which extend between the a-helix

25
and /3-pleated sheets, and are thought to play a critical
role in determining peptide binding properties, can be
highly diversified between the alleles. This is due to
polymorphisms that result in amino acid side chain changes,
differences that ultimately dictate physical binding
properties. The number of amino acid differences between
HLA-A2 and HLA-Aw68 is approximately equal to the average
number of site differences between pairs of HLA alleles.
Therefore, the same degree of structural changes in local
pockets and sub-sites should be observed in other alleles.
A model of the Mhc class II ABS has been proposed based
on the class I structure and the pattern of polymorphism of
human and mouse class II alleles (Brown et al. 1988). The
basic 3-dimensional structure is the same; the two a-helices
lying atop an 8 strand /3-pleated sheet (Figure 2-5). Both
the a chain and the b chain contribute an a-helix and 4
strands of the /3-pleated sheet. There are regions of the
model, however, whose tertiary structure cannot be
accurately predicted. These areas in the b chain are (1)
the loop between /3-strand one and /3-strand two, (2) the
central a-helix, and (3) the 3' segment. The undefined
parts of the a chain are (1,2) the loops between /3-strand 1
and 2, and between /3-strands 3 and 4, and (3) the 5' a-helix
segment. Analysis of the secondary structure of class II
molecules by physical criteria, such as Fourier transform
infrared and circular dichroism spectroscopy, are consistent

site.
the
Figure 2-5. Hypothetical Mhc class II molecule antigen binding
Dotted rectangle indicates regions of predicted deviations from
class I model. Adapted from Brown et al. (1988).

27

28
with the class II model proposed by Brown et al. (1988)
(Gorga et al. 1989). Furthermore, the class II ABS model is
consistent with a variety of structural and functional
studies (Allen et al. 1987, Buus et al. 1987).
Generation of Mhc Class II Gene Polymorphism
The most outstanding feature of Mhc genes is their
unprecedented genetic polymorphism. No other vertebrate
genes exhibit such a high degree of diversity (Klein 1986).
Serological studies, tryptic peptide mapping, and molecular
characterization have estimated that greater than 100
alleles of some Mhc loci exist in natural populations of Mus
(Wakeland and Klein 1979; Duncan et al. 1979a; Gotze et al.
1980; Klein and Figueroa 1981; 1986). Many of the alleles
are globally-distributed with frequencies ranging from 1-10%
in wild mouse populations (Gotze et al. 1980; Nadeau et al.
1981). In addition, greater than 90% of wild mice are
heterozygous at H-2 (Duncan et al. 1979b), an observation
fully consistent with the high degree of diversity of Mhc
genes.
Restriction fragment length polymorphism (RFLP)
analysis with single copy probes spanning the I-region
reveals variable and conserved tracts of DNA (Steinmetz et
al. 1984; Tarnuzzer 1988). The centromeric half of the I-
region, that encodes the Ab, Aa, and 5' portion of the Eb

29
gene, shows extensive polymorphism and allelic variability.
On the other hand, the telomeric portion of the I-region,
encoding the 3' portion of the Eb gene, Eb2, and Ea.
displays little polymorphism. The boundary runs through the
Eb gene, close to and perhaps overlapping with the
recombinational hotspot in the intron between Ebl and Eb2
exons.
Nucleotide sequence comparisons of the four functional
class II genes derived from laboratory strains of mice is
consistent with the observations made at the RFLP level; Ab,
Aa, and Eb are polymorphic, whereas Ea is not (Benoist et
al. 1983a; 1983b; Choi et al. 1983; Malissen et al. 1983;
Mengle-Gaw and McDevitt 1983; Estess et al. 1986). Allelic
nucleotide sequence variation can be extensive; alleles of
Ab or Aa commonly differ by 5-10% of their nucleotide
sequence (Benoist et al. 1983b; Estess et aJL 1986) . Thus,
the RFLP and nucleotide sequence data suggest that the
diversity is indeed greater in both the coding and non¬
coding regions of the variable tract as compared to the
conserved tract of the I-region.
Nucleotide sequence analysis of the Ab, Aa, and Eb
genes from different laboratory strains of mice all indicate
that the majority of the diversity is localized in the amino
terminus of the molecule, specifically the al and bl exons
(Choi et al. 1983; Benoist et al. 1983b; Estess et al.
1986). These are the exons that encode the antigen binding

30
site (Brown et al. 1988). Closer inspection of the
nucleotide sequence variation of the Ab, Aa, and Eb genes
reveals that most of the substitutions are clustered into
regions of hypervariability (Benoist et al. 1983b; Mengle-
Gaw and McDevitt 1983; Estess et al. 1986). This diversity
is also seen at the amino acid level. For instance, a Kabat
and Wu variability plot (Kabat and Wu 1970) of the 6 Aa
alleles sequenced by Benoist et al. (1983b) illustrates that
the amino acid substitutions fall into two hypervariable
regions at residues 11-15 and residues 56-57.
Hughes and Nei have examined the patterns of nucleotide
substitutions at both the class I loci (1988a), and the
class II loci (1989) of both humans and mouse. The rates of
nonsynonymous (replacement) substitutions versus synonymous
(silent) substitutions was measured for the various domains
of the Mhc molecules. In both class I and class II loci,
the membrane distal domains encoding the antigen binding
site had a much higher rate of nonsynonymous versus
synonymous substitutions. This was contrasted by the other
parts of the molecules where the reverse was observed; the
rate of synonymous substitutions exceeded that of
nonsynonymous substitutions.
These observations illustrate the extensive
polymorphism of Mhc class II genes, and imply that this
genetic diversity reflects a unique and important biological
role for these molecules. The functional significance of

31
this polymorphism is still unclear; although, it is thought
to directly relate to disease susceptibility. In addition,
the evolutionary origin of Mhc allelic diversity is unknown;
however, two hypotheses dominate speculations: retention of
ancestral polymorphisms (Klein 1980; 1987), and
hypermutational diversification (Pease 1985).
Retention of Ancestral Polymorphisms
Klein (1980) first postulated that the extensive
diversification of Mhc alleles could be explained by trans¬
species evolution; the hypothesis that most Mhc alleles
diverged prior to the origin of the species in which they
are presently found. The divergence of contemporary Mhc
alleles, therefore, reflects the steady accumulation of
mutations over long evolutionary timespans, rather than
hypermutational diversification subsequent to speciation.
The hypothesis of retention of ancestral polymorphisms
postulates that allelic lineages of Mhc genes are maintained
for extremely long evolutionary periods in natural
populations, independent of speciation events (Figure 2-6).
This predicts that selection may act to maintain specific
sets of alleles with specific antigen binding sites, and
consequently binding properties. The most common allelic
lineages would encode antigen binding sites which are
optimal for the presentation of the antigenicity expressed
by the prevalent endemic pathogens.

Figure 2-6. A diagrammatic illustration contrasting the evolutionary
histories of nuclear genes (A) and Mhc genes (B). The cross-hatched
vertical lines represent speciation events. Vertical lines represent
alleles or lineages of alleles. In the case of nuclear genes, all the
diversity within a species was generated after speciation events. Mhc
genes, on the other hand, have inherited multiple alleles or lineages
of alleles at the time of inception of a species, thereby illustrating
the retention of ancestral polymorphisms. Some alleles in both
examples have been lost, presumably to random genetic drift.

rvvvvv^i
Ancestral
A MUS
Ancestral
B MUS
LO
LO

34
The first experimental support for this hypothesis
demonstrated that Mhc class I molecules derived from
different sub-species of the Mus musculus complex had
identical serological reactivities and tryptic peptide maps
(Arden and Klein 1982). Direct evidence further
illustrating the antiguity of Mhc genes was reported by
McConnell et al. (1988). This study analyzed Ab gene
polymorphism by RFLP analysis, and revealed that greater
than 90% of the 31 alleles examined could be organized into
two evolutionary lineages based on the presence or absence
of an 861 basepair retroposon insertion into the intron
between the Abl and Ab2 exons. The flanking direct repeats
of host derived seguences on either side of the retroposon
indicate that the insertion into this position was a random
event during the evolutionary divergence of Ab. Ab alleles
with and without the retroposon insertion were found in 4
species and sub-species of the genus Mus. demonstrating that
this polymorphism arose in the ancestors of modern Mus
species, and was maintained as a polymorphism across
multiple speciation events. These findings have
subsequently been extended to 115 independently derived Ab
alleles, representing 9 different species or sub-species of
the genus Mus. Ab alleles from both lineages are present in
Mus caroli. demonstrating that alleles in these two lineages
diverged at least 8 million years ago (Figure 2-7)(Lu et al.
1990).

Figure 2-7. An illustration of the evolutionary origins of the three
evolutionary lineages of Ab alleles. The solid line represents
evolutionary lineage 1. The stippled line represents evolutionary
lineage 2, which was formed by a retroposon insertion into a lineage 1
allele before the separation of the 9 Mus species assayed.
Evolutionary lineage 3 is represented by the cross-hatched line, and
was formed by an additional insertion into a lineage 2 allele
subsequent to the inception of the Mus musculus complex (Lu et al.
1990).

Ancestral Mus
Insertion in Lineage 2
produces Lineage 3
Insertion in A^>
produces Lineage 2
Lineage 1
Modern
Mus m.dom m.mus
Hi? Tested 67 18
m.cas sptd
4 6
hort spretus eery
4 12 1
cooki
1

37
Nucleotide sequence analysis of Ab alleles has revealed
that some of these genes have a deletion of two codons,
while others do not (Choi et al. 1983; Estess et al. 1986).
The deletions occur in exon 2 at amino acid positions 65 and
67. Figueroa et al. (1988) report 2 Ab specific monoclonal
antibodies that correlate perfectly with the two types of Ab
genes. The H-2A.m27 antibody reacts with the Ab chains that
have the two deletions, and the H-2A.m25 antibody reacts
with Ab chains that are undeleted. Strains that are
homozygous for Ab show a perfectly antithetical relationship
between the determinants that these antibodies detect, they
are either m25-positive and m27-negative or vica versa. No
molecule has been found that reacts with both antibodies,
and only one molecule reacts with neither of the two
antibodies. Utilizing these two antibodies and Northern
blot hybridization with allele-specific oligonucleotides,
Figueroa et al. (1988) where able to demonstrate the
presence or absence of the amino acid position 65/67
deletion polymorphism in 10 species and sub-species of the
genus Mus, in addition to Rattus norveoicus. This data
indicates that the 65/67 deletion polymorphism already
existed in the last common ancestor of mice and rats.
A number of different mutations affecting both the a
and b chains of the E molecule can result in E molecule non¬
expression (Jones et a¿. 1990). (These mutations will be
discussed at greater depth in the following sections of this

38
literature review.) Many of these mutations can be
identified in mice from multiple species and sub-species of
the genus Mus, indicating that the mutations were already
present in nascent species and survived multiple speciation
events.
The fact that many of these polymorphisms are found in
multiple species requires that the different alleles be
present at relatively high frequencies in the species¬
founding populations. These founding populations must also
have been of reasonably large sizes. If either of these two
y
criterion had not been met, there would be a high likelihood
of losing the polymorphism by random drift, particularly the
retroposon polymorphism in the intron of Ab, where selection
would presumably act at a minimum (Nei 1987).
These findings, together with similar results for
primates (Lawler et al. 1988; Parham et al. 1989; Gyllensten
and Erlich 1989; Mayer et al. 1988), demonstrate that the
retention of ancestral polymorphisms over extremely long
evolutionary periods can account for the extensive diversity
seen in modern Mhc alleles in natural populations of
rodents.
Hvoermutational Diversification of Class II Genes
The presence of hypervariable regions of DNA within
class II genes suggests that hypermutational mechanisms such
as gene conversion or segmental exchange may be operating to

39
rapidly diversify the regions of Mhc genes responsible for
immune responsiveness. This hypothesis predicts that most
of the polymorphism will be generated within the lifetime of
a species, potentially allowing alleles to rapidly adapt to
changes in the antigenicity of endemic pathogens (Pease
1985).
Gene conversion or segmental exchange was originally
defined in fungi (Radding et al. 1978), and is a mechanism
by which DNA sequence is copied or transferred from one gene
to another. Although the DNA sequences can be transferred
.y
to and from genes anywhere in the genome, it is more common
to occur within multigenic or multiallelic families
(Baltimore 1981; Robertson 1982; Slightom et al. 1980).
Gene conversion is defined by the DNA transfer between
discrete loci, whereas intragenic segmental exchange occurs
between alleles of a particular locus. Pairing between
partially homologous sequences during meiosis or mitosis is
followed by mismatch repair thereby converting part of one
sequence to that of another. The primary evidence for gene
conversion events is the clustering of nucleotide
substitutions. This pattern of diversity is clearly
documented in Mhc class I genes (Mellor et al.. 1983; Weiss
et al. 1983; Nathenson et al. 1986; Geliebter and Nathenson
1987).
Direct evidence for gene conversion in Mhc class II
genes has been reported by Mengle-Gaw et al. (1984), where

40
an alloreactive T cell clone, 4.1.4, recognized a
determinate present on both the Eb and Abbmllfiolecules.
i_ y-—. -i
Nucleotide sequence comparisons between Ab . Ab .and Eb
(Choi et al. 1983; McIntyre and Seidman 1984) revealed that
the Ab ^sequence is identical to Eb in the region where it
differs from Abb. The region exchanged must have
encompassed a minimum of 14 nucleotides, because the 3
nucleotide changes occurred in this 14 base pair stretch.
The area of exchange is flanked by regions of exact homology
extending for 20 nucleotides 5' and 9 nucleotides 3'.
McConnell et al. (1988) demonstrated evidence for
segmental exchange occurring in Mhc class II genes. By
examining the nucleotide sequence of eight alleles of Ab,
the sequence of the Ab2 exon of all 8 alleles corresponded
to the appropriate genomic evolutionary lineage, as defined
by the retroposon insertion. However, the nucleotide
v.
sequence of the Abl exon of two of the 8 alleles, Ab and
r* _ j
Ab . did not reflect their evolutionary lineage, and
therefore reflects the exchange of sequence, by segmental
exchange, from alleles of a different evolutionary lineage
(Figure 2-8).
At present, the relative importance of recombinational
mechanisms versus the accumulation of point mutations over
long evolutionary periods in the generation of Mhc class II
gene diversity has yet to be determined. This is one the
goals of this dissertation.

Figure 2-8. A diagram summarizing the relationships of the sequence
polymorphisms in the Abl and Ab2 exons with the retroposon
polymorphisms which occur in the intron between them. Six of the
eight Abl alleles have exon sequence polymorphisms that are associated
with the retroposon polymorphism. The remaining two alleles, A¿ and
Abnod. appear to have been produced by intragenic segmental exchange
events. Adapted from McConnell et al. (1988).

A/S’ A 1
Lineage Allele Exon
1
2
3
b
nod
Intron
insertions
A 2
Exon
Intragenic
segmental
exchange

43
Functional Role of Mhc Polymorphism
Regulatory T lymphocytes are responsible for initiating
and coordinating antigen specific immune responses.
Activation of virgin T regulatory cells, or regulatory T
cells that have not come into contact with their specific
ligand, is dependant upon a set of signals delivered by the
antigen presenting cell. This stringency is designed to
maintain the specificity of the resultant immune response,
and ensure the inactivity of autoreactive T cells. First,
regulatory T lymphocytes must recognize processed peptide
antigen bound to molecules encoded by the I-region of the
major histocompatibility complex. This recognition is
achieved via T cell surface structures including the
clonally distributed T cell antigen receptor, and the co¬
receptor molecule CD4. Second, the antigen presenting cell
must provide a costimulatory signal, such as the membrane
form of interleukin-1. The regulatory T cell must receive
both of these signals in tandem. Either signal alone is not
sufficient to induce T lymphocyte activation, or the
subsequent immune response to the antigen from which the
peptide was derived.
Class II molecules play a crucial role in this antigen
presenting cell-T cell interaction. Their function is to

44
act as promiscuous receptors for antigen fragments; thereby
making them recognizable to T lymphocytes. These two
events, antigen binding by class II molecules, and
regulatory T lymphocyte recognition of the resultant
bimolecular complex, not only forms the basis for antigen
specific immune responsiveness, but, in addition, determines
to a large extent the intensity of the ensuing immune
response.
Regulation of Expression of Class II Molecules
Consistent with their function to bind and present
antigen to regulatory T lymphocytes, the expression of class
II molecules is restricted to the antigen presenting cells
of the body. These antigen presenting cell types include
macrophage, dendritic cells, B lymphocytes, and thymic
epithelial cells. Macrophage are the primary antigen
presenting cell in the body (Unanue and Allen 1987), and as
such have the unique ability to trigger virgin T cells
(Lassila et al. 1988). However, resting macrophage do not
constitutively express class II molecules on their surface,
rather cell surface expression is under both positive and
negative control (Steinman et al. 1980; Snyder et al. 1982).
Supernatants of mitogen activated T cells induce the cell
surface expression of class II molecules on macrophage
(McNichols 1982). Biochemical analysis of the inducing
component of these supernatants have determined the factor

45
to be gamma-interferon (Steeg et al. 1982; King and Jones
1983). Gamma-interferon increases the cell surface
expression of both the A and E molecules, as well as class I
molecules. This control appears to act at the level of
transcription, such that there is a coordinate increase in
the level of mRNA of all four class II chains within 8 hours
of treatment with gamma-interferon (Paulnock-King et al.
1985). Prostoglandins, glucocorticoids, and the bacterial
endotoxin LPS have all been shown to have a negative effect
on the cell surface expression of class II molecules (Snyder
et al. 1982; Aberer et al. 1984; Steeg et al. 1982).
Precursor B lymphocytes do not express class II
molecules; however, mature B cells and plasma cells show
heterologous constitutive levels of class II on their
surface (Mond et aJ. 1981; Monroe and Cambier 1983). The
levels of class II expression on resting B cells can be
augmented by incubation with mitogen activated T cell
supernatants (Roehm et al. 1984), and subsequent studies
have shown the factor responsible for this to be
interleukin-4 (BSF-1)(Noelle et al. 1984). Interleukin-4
can induce the levels of class II mRNA within one hour and
cell surface expression levels as early as two hours after
incubation of B cells (Polla et al. 1986). B lymphocytes do
not have the ability to activate virgin T cells (Lassila et
al. 1989). However, they may play an integral role in
antigen presentation during a secondary T cell response

46
because of their ability to pick up and display minute
quantities of antigen (Lanzavecchia 1985).
These induction mechanisms for class II molecule
expression illustrates the importance of class II molecule
cell surface expression to the interaction of regulatory T
lymphocytes and antigen presenting cells resulting in an
immune response. Furthermore, this expression of class II
molecules on limited cell types ensures regulatory T cell
reactivity can take place only while interacting with
selected cells of the body. This introduces a control
mechanism to ensure the inactivity of autoreactive T cells.
The Functional Expression of Class II Molecules
Initial serological and biochemical characterization of
Mhc class II molecules revealed a heterodimeric glycoprotein
requiring the association of both the a and b chains (Jones
1977; Jones et al. 1978). Serological analysis of class II
molecules expressed in inbred and wild mice has shown the A
molecule expressed in all populations of mice examined.
However, four of eleven inbred strains and 5-30% of wild
haplotype mice fail to express an E molecule on the cell
surface (Jones et al. 1981; Nizetic et al. 1984). Analysis
of the Ea and Eb polypeptides of the four inbred E-strains
by 2-dimensional gel electrophoresis revealed that the H-2b
and the H-2Smice synthesize normal Eb chains but do not
express Ea chains, whereas the H-2f and H-2^ mice do not

47
synthesize either Ea or Eb chains (Jones et al,. 1978; Jones
et al. 1981). Recently the molecular defects resulting in E
molecule non-expression have been identified, and thus far,
seven independent defects have been detected (Jones et al.
1990).
V\ c _
The Ea gene of the H-2 and H-2 haplotypes have a 627
base pair deletion encompassing the promoter and first exon
(Mathis et al. 1983). The Eaq gene has a single nucleotide
insertion in codon 64, causing a frameshift leading to a
f
stop codon at position 69 (Vu et al. 1989). The Ea. gene
also has a single nucleotide insertion, but at codon -2,
thereby generating a downstream stop codon (Vu et a¿. 1989) .
The Eb mutation of the H-2w3^nd H-2w2haplotypes is a
single nucleotide substitution at codon 7 generating a stop
codon. There are also two independent mutations occurring
in the RNA donor splice site at the first exon-intron border
of the Eb gene (Tacchini-Cottier and Jones 1988; Vu et al.
1988). Both of these mutations lead to aberrant RNA
processing. Jones et al. (1990) also report another Eb
mutation distinct from the first three, but have not as yet
molecularly characterized it. All the defects described
causing E molecule non-expression, with the exception of the
. f
insertion affecting the Ea gene of H-2 . have also been
found in various wild mouse haplotypes (Jones et al. 1990;
Dembic et al. 1984). The large number of mice not

48
expressing an E molecule may indicate that the two Mhc class
II molecules are not functionally equivalent.
Chain Association of Class II Molecules
The extensive polymorphism of Mhc class II molecules
together with the critical nature of their function of
binding antigen allowing T lymphocyte recognition suggests
that individuals expressing a greater variance of class II
molecules on the cell surface of an antigen presenting cell
would be at a selective advantage. Fathman and Kimoto
(1981) observed that the a and b chains of a given isotype
can transassociate in heterozygotes. These findings gave
rise to the notion of free association of allelic varients
within an isotype, suggesting that 4 types of class II
heterodimers will form in a heterozygote. In contrast,
cross-isotype pairing of A and E molecule polypeptide chains
does not occur except in artificial experimental systems
(Murphy et al. 1980). Preferential isotypic pairing is due
to a strong increased affinity for the association of
isotype matched pairs of polypeptides (Sant and Germain
1989) .
Numerous observations now suggest that preferential
pairing of certain allelic A molecule polypeptide chains
limits the amount of transassociated A molecules that can be
formed. Tryptic peptide analysis from serologically related
groups of mice (Wakeland and Klein 1983) show the Aa and Ab

49
polypeptides from these strains differ by less than 10% of
their tryptic peptides (Wakeland and Darby 1983).
Restriction fragment length polymorphism analysis of the Aa
and Ab chain genes from this same allelic family
corroborates this observation at the DNA level (Tarnuzzer
1988; McConnell et al. 1986). These observations suggest
that the Aa and Ab genes on the same chromosome accumulate
mutations in a coordinate manner, thereby ensuring their
ability to functionally associate.
Gene transfection experiments by Germain et al. (1985)
clearly illustrated that allelic variation can dramatically
affect the ability of A molecule subunits to assemble
correctly, and be expressed on the cell surface. These
studies showed that haplotype mismatched chains cannot
associate as efficiently as haplotype matched chains, and
therefore are not expressed at appreciable levels. Further
( analysis indicated that polymorphisms in the amino terminal
half of the Abl domain consistently controlled a and b chain
interactions (Braunstein and Germain 1987). Buerstedde et
al. (1988), using site-directed mutagenesis and DNA mediated
gene transfer, have shown that amino acid positions 9, 12,
13, 14, and 17 of the Abl exon are responsible for proper
chain association and cell surface expression for the H-2
V , . • • •
and H-2 haplotypes examined. The amino acid positions 12
and 13 being particularly significant for proper
association.

50
These studies suggest that, in order for proper subunit
association and cell surface expression, the a and b chains
of the A molecule need to be co-adapted, and therefore be
from the same or similar haplotype (Figure 2-9).
The ability of polypeptide chains of the E molecule to
associate is under different selective pressures. In the
case of the E molecule, only the Eb chain is highly
diversified while Ea exhibits very low levels of diversity.
Therefore, the diversification of Eb is only constrained by
the requirement to associate with an essentially monomorphic
Ea (Figure 2-9). This discrepancy in selective pressures of
the various class II genes to properly associate may be due
in part to the presence of a recombinational hotspot in the
second intron of Eb. Homologous recombination at this
position would not allow co-evolution of the two genes.
The Role of the Invariant Chain in Class II Molecule
Expression
Mhc class II molecules are associated intracellularly
with a third glycoprotein called the invariant chain (Ii),
which displays little allelic variation among the different
strains of mice examined (Jones et al. 1979). The invariant
chain is a basic polypeptide of 31,000 daltons that is
coprecipitated with class II molecules in
immunoprecipitations using anti-la antisera of monoclonal
antibodies. It noncovalently associates with class II

Figure 2-9. (A) Diagram illustrating the importance of maintaining A
molecule subunits that can transassociate. Chain association of two
class II A molecules is shown. Haplotype mismatched ab chain pairs
are transcribed and translated normally, but fail to associate in the
cytoplasm, a step necessary for the expression of the molecule on the
cell surface.
(B) Diagram illustrating the importance of maintaining a monomorphic
form of the Ea chain for the proper expression of the class II E
molecule. Both the a and b chains can always properly associate, due
to the ability of the monomorphic a chain to associate with all b
chains.

to

53
molecules in the membranes of the endoplasmic reticulum, but
has not been detected on the cell surface in association
with class II molecules (Sung and Jones 1981). It has been
demonstrated that the invariant chain is coordinately
regulated with class II molecules (Koch et al. 1984;
Paulnock-King et al. 1985). Although the function of the
invariant chain is unclear, it has been suggested that it
plays a role in the assembly and intracellular transport of
class II molecules to the cell surface (Sung and Jones 1981;
Jones et al. 1979).
The Presentation of Antigen by Class II Molecules
Regulatory T lymphocytes recognize the bimolecular
ligand of foreign antigen and a self class II molecule on
the surface of antigen presenting cells. However, unlike B
lymphocytes which directly interact with antigen, most T
lymphocytes only recognize a non-native form of the antigen
(Schwartz 1985). The conversion of an antigen from a native
to a non-native form has been termed antigen processing, and
is performed by antigen presenting cells which express class
II molecules on their surface. Although much is still
unknown about the intricacies of antigen processing, the
following is a summary of events (Werdelin et al. 1989;
Germain 1988).
The first step involved in antigen processing is
ingestion of the antigen. Macrophage accomplish this by

54
constitutive endocytosis, whereas B lymphocytes, by virtue
of their immunoglobulin receptor, utilize receptor-mediated
endocytosis. The ingested antigen is transported into the
interior of the cell in an endocytic vacuole.
The second step of the process takes place when the
endocytic vacuole becomes acidified and proteolytic enzymes
with an acid optimum become activated. This results in the
partial degradation of the antigen; hence, the antigen is
broken down into peptide fragments.
The third step in antigen processing is the binding of
antigenic fragments to Mhc class II molecules. This
presumably occurs in an intracellular compartment, but
exactly where in the cell this occurs is not known. Once an
antigenic fragment is bound to a class II molecule, it is
protected from complete proteolytic destruction. However,
parts of the antigen fragments which .are outside the antigen
binding site, may not be protected against further
degradation.
The fourth step consists of transporting the class II
molecule-processed antigen fragment complex back to the
surface of the antigen presenting cell. Once there, the
class II molecule acts to keep the antigen fragment in a
constant orientation with a stable conformation, thereby
allowing recognition by a T lymphocyte.
The processing requirements may vary with each
particular antigen, depending on the conditions required to

55
induce the conformational flexibility needed for the antigen
to bind a class II molecule (Allen 1987). For instance,
some proteins may require no processing, because at least a
portion of the protein has enough freedom in its native
state to become stably bound to a class II molecule. Other
proteins may simply need denaturation, such as a reduction
and alkylation of disulfide bonds, to reveal peptide
fragments able to bind to class II molecules. The most
stringent antigen processing would require proteolytic
cleavage of the native protein. Irrespective of the type of
antigen processing necessary, the immunogenic peptide must
possess two distinct features. First, it must be able to
bind to a class II molecule, and the class II molecule
contact sites of an immunogenic peptide is called an
agretope (Haber-Katz et ad. 1983). The immunogenic peptide
must also make contact with the T cell antigen receptor, and
this site on the peptide is termed an epitope.
The first direct evidence for peptide-class II molecule
association came from Babbitt et al. (1985) using an
equilibrium dialysis method employing purified class II
molecules and peptide fragments. These experiments showed a
peptide from hen egg lysozyme, HEL 46-61, previously
. . k d
demonstrated to be immunogenic for H-2 and not for H-2 .
. . k d
bound specifically to A. molecules but not to molecules in
a saturable process, with an affinity in the micromolar
range. This direct correlation between antigen-class II

56
molecule interaction and Mhc restriction was subsequently
extended for numerous other antigens (Buus et a¿. 1986a;
1986b; 1987; Guillet et al. 1987). Furthermore, inhibition
analysis illustrated that peptides restricted to a
particular class II molecule competitively inhibited one
another from binding. This suggested that a class II
molecule contained just a single antigen binding site (Buss
et al. 1987; Babbitt et al. 1986; Guillet et al. 1987), an
observation in agreement with X-ray crystallographic
analysis (Bjorkman et al. 1987a).
Utilizing a gel filtration system enabling complexes of
antigenic peptides and class II molecules to be separated
from unbound peptide, Buus et al. (1986b) were able to study
the kinetics of association and disassociation of these
complexes. These experiments, using the ovalbumin 323-339
j
peptide/A/ system, illustrated that the rate of complex
formation is very slow (Ka 1M-Is-1 JdjiÍ once formed the class
II molecule peptide complex is remarkably stable (Kd 3xl0“6s"
l ,
) . This suggests that the association of class II
molecules with antigen fragments most likely occurs in an
intracellular vesicular compartment as opposed to the plasma
membrane, since this would prevent soluble processed antigen
from diffusing away from the membrane bound class II
molecule. This intracellular compartment would probably
have a neutral pH, based on a 10-fold slower rate of complex
formation at pH 4.6, compared with pH 7.2, and the lability

57
of preformed complexes to acid pH. This peptide-class II
molecule complex sensitivity to acid pH may represent a
mechanism by which class II molecules could rid itself of
complexed peptide, and be available to bind newly processed
antigen. Recycling of class II molecules (Pernis 1985)
together with biosynthesis (Harding et al. 1989) could
effectively prevent potentially constant saturation of class
II molecule binding sites with peptides derived from self¬
proteins.
Babbitt et al. (1986) first observed that class II
molecules can bind antigenic fragments of self-proteins.
Lorenz and Allen (1988; 1989) further characterized the
ability of class II molecules to bind self-peptides. These
studies provided direct functional proof in vivo that self
proteins are processed constitutively, and can be presented
in a fashion similar to that by which foreign antigens are
presented. In addition, experiments by Adorini et al.
(1988; 1990) demonstrate that peptides of foreign antigens
generated by processing events must compete for binding to
class II molecules with peptides generated from self¬
antigens in vivo. Thus, self-tolerance does not occur at
the level of the antigen presenting cell, because antigen
presentation does not discriminate self from non-self.
Rather, it occurs at the level of the regulatory T
lymphocyte, either through functional or physical deletion
of self-reactive T cells.

58
Any given class II molecule can bind a wide variety of
peptides, however different class II molecules show distinct
broad specificity patterns. This is reflected in the
variation between alleles in their capacity to present
different peptides to the immune system. For instance, when
overlapping peptides comprising an entire protein have been
analyzed for reactivity, different Mhc class II molecules
have been found to present different peptide determinants to
T lymphocytes (Roy et a_l. 1989; Allen et al. 1987).
Furthermore, class ,11 molecules only bind a subset of
peptides derived from native protein (Braciale et al. 1989),
and there is a definite hierarchy of peptide determinants
that are immunodominant for particular allelic forms of Mhc
gene products (Ria et al. 1990; Roy et al. 1989; Berzofsky
et al. 1989). Which immunodominant region of the native
protein is ultimately recognized by T lymphocytes is
predominantly influenced by the particular Mhc class II
allele expressed. This influence reflects the ability of
processed fragments to bind to a particular class II
molecule, and demonstrates the affect Mhc class II molecule
polymorphisms have in controlling an immune response
(Benacerraf 1978; Babbitt et al. 1985; Buus et al.. 1987).
In conclusion, these studies of Mhc molecule-antigen
interaction illustrate the broad specificity of the class II
molecule antigen binding site. Although the interaction is
generally permissive, the direct correlation of peptide

59
binding and Mhc restriction powerfully illustrates the
crucial role class II molecules play in the initiation of a
T cell dependent immune response.
Wild Mice
The goals of this dissertation are to elucidate the
evolutionary mechanisms responsible for generating Mhc class
II gene polymorphism, and examine the role selection plays
in driving this extensive diversification. Previous studies
addressing these questions utilized techniques, such as
serology and tryptic peptide mapping which have a limited
capacity to answer these questions, as compared to obtaining
the DNA sequence of the genes. The nucleotide sequence of a
limited number of Mhc class II genes has been obtained only
from a few standard inbred laboratory strains of mice.
Aside from having uncertain genetic origins, inbred strains
of mice were derived from a limited number of sources that
were generated by a high degree of inbreeding. This
represents a biased sampling of the mouse population and an
artificial collection of considerable homogeneity (Ferris et
al. 1982; Klein 1974).
Wild mice are unconfined animals whose breeding is not
controlled by man (Bruell 1970), and, as such, represent a
collection of I-region haplotypes of significant
heterogeneity, particularly when compared to standard

60
laboratory inbred strains of mice. A number of features
make the study of the evolutionary dynamics of the wild
mouse Mhc particularly attractive. Natural populations of
wild mice are abundant and their phylogenetic relationships
have been extensively characterized. Furthermore, these
mice represent the product of evolutionary processes where
the I-region haplotypes are fixed and maintained through
natural selection.
Natural History of Wild Mice
Wild mice can be divided into 3 categories of animals
depending on their association with man: aboriginal,
commensal, and feral (Sage 1981). Aboriginal mice are
genuinely wild, with essentially no interaction with man.
With the exception of one subspecies that is indigenous to
northwest Africa, aboriginal mice are found only on the
Eurasian continent. Typically, they are dry-area animals,
and feed on grass, seeds, and grain.
Commensal mice, on the other hand, live in close
association with man, and rely on man for their main source
of food and shelter. Marshall (1981) distinguishes 4
commensal subspecies of Mus musculus; M. m. domesticus. M.
m. musculus. M. m. castaneus. and M. m. molossinus.
Commensal mice, like aboriginal mice are also indigenous to
Eurasia, and, in addition have radiated to habitats
throughout the world. They have successfully adapted to the

61
extremely varied climatic conditions of environments ranging
from Europe, the Americas, Australia, Africa, and several
south Pacific islands. Ferris et al. (1983) estimate that
the commensal relationship between mouse and man has existed
for approximately 1 million years. This is based on fossil
evidence, nuclear DNA variation, and mitochondrial DNA
variation.
Feral mice were once commensals of man, but reverted to
a more aboriginal existence (Bruell 1970). They are found
in areas such as agricultural fields, open grasslands,
marshes, sandhills, and coastal islands, and feed on grass
and grain (Sage 1981). Permanent reversion to feral habits
primarily occurs only in dry climatic zones.
Mus musculus domesticus is presently found throughout
the world. However it originated in western Europe and
subseguently spread to the Americas and Australia in
association to the global movements of Europeans (Bonhomme
1986a). Mus musculus musculus is endemic to northeastern
Europe and central Asia (Sage 1981); Mus musculus castaneous
is found in Malaya (Harrison 1955), India (Srivastva and
Wattel 1973), Indonesia (Hadi et al. 1976), and Nepal and
Thailand (Marshall 1977). The native range of Mus musculus
molossinus is eastern Asia, particularly Japan and Korea
(Hamijima 1962; Jones and Johnson 1965). Mus spretus is a
feral species endemic to the western rim of the Mediterrean
Sea (Bonhomme 1986b). Mus soecileaus are the aboriginal

62
mound-building mice found in the steppe of eastern Europe
(Petrov 1979). Mus spretoides is found in eastern Europe,
the Balkan penninsula, Cypress, and Turkey (Bonhomme et al.
1984). Mus cookii. Mus cervicolor. and Mus caroli are all
endemic to southeast Asia (Marshall 1986). The natural
range of Mus platvthrix is India (Marshall 1986).
Phylogenetic Relationships in the Genus Mus
The phylogenetic relationships of the various species
within the genus Mus have been extensively studied (Bonhomme
1986a), and a general understanding of their relationships
can be inferred (She et a¿. 1989). Different species are
distinguished from subspecies based on the presence of
reproductive barriers in natural populations. Therefore, M.
m. domesticus and M. m. musculus can interbreed in natural
habitats, and in regions where they come into contact, such
as central Europe, form a tightly defined hybrid zone. In
contrast, different species with overlapping ranges, such as
M. m. domesticus and M. soretus do not interbreed in natural
populations. Although, these two species can be bred in an
laboratory environment, the resultant male hybrids are
commonly sterile.
The three major molecular techniques employed for
biochemical systematics include protein electrophoresis,
single copy nuclear DNA (sen DNA) hybridization, and
mitochondrial (mt) DNA restriction fragment length

63
polymorphism (RFLP) analysis (She et al. 1989). Protein
electrophoresis assays only the polymorphism in the coding
regions of the genome, and therefore is likely to be
constrained by natural selection. Sen hybridization studies
reveal differences between two genomes of all single copy
DNA, including exons, introns, and flanking sequences.
Mitochondrial DNA RFLP analysis, on the other hand, assays
the cytoplasmic genome which has several unique
characteristics; such as a high evolutionary rate, strictly
maternal inheritance patterns, and an absence of
recombination.
Figure 2-10 illustrates the phylogenetic relationship
within the genus Mus and Rattus as determined by DNA-DNA
hybridization studies (She et al. 1989). Similar
phylogenetic relationships are obtained when these species
are compared by other techniques; however, the estimates of
the exact genetic distance among the Mus species vary
depending upon the technique used. In comparing 9 species
of Mus, 5 subspecies of Mus musculus. and species from the
genus Rattus, there are seven levels of divergence among the
species, ranging from 0.3 million years (Mus musculus
complex) to 10 million years (divergence between species
within the genus Mus and the genus Rattus) (Luckett and
Hartenberger 1985; She et al. 1989).
By analyzing the Mhc class II gene nucleotide sequence
from wild-derived alleles from a number of different species

64
and subspecies of the genus Mus and Rattus, it should be
possible to obtain an evolutionary perspective of the forces
acting to diversify and maintain contemporary Mhc alleles.

Figure 2-10. The phylogenetic relationships within the genus Mus and
Rattus. The percentage of DNA divergence, as detected by DNA-DNA
hybridization studies, is shown on the left axis. The estimated time
interval since speciation is listed on the right axis. Adapted from
She et al. (1989).

66
% DNA
Divergence
Million
Years

CHAPTER III
MATERIALS AND METHODS
Isolation of Genomic DNA
Genomic DNA was isolated from liver or kidney tissue by
a Protease K/SDS method as detailed in Maniatis et al.
(1982). The extraction was performed on a 340A Applied
Biosystems Inc. (Foster City, CA) nucleic acids extractor.
.V
Frozen tissues are'ground in a mortar containing liquid N2
to a fine powder, and added to 3.5 ml solution of lysis
buffer (Applied Biosystems Inc., Foster City, CA) and
Protease K (final concentration of 0.3 mg/ml) (Applied
Biosystems Inc., Foster City, CA). The solution was
incubated overnight at 65°C. The remainder of the
extraction was performed by the machine. Briefly, the DNA
solution was extracted two times with a Tris equilibrated
phenol (pH 7.5)/chloroform/isoamyl alcohol solution (25:1
v/v), and one time with just the chloroform/isoamyl alcohol
solution. The genomic DNA was then ethanol precipitated,
washed in 70% ethanol, and resuspended in TE buffer (10 mM
Tris HCL, pH 7.5; 1 mM EDTA), and dialyzed overnight at 12°C
against TE buffer. The resulting DNA solutions were
67

68
electrophoresed on a 0.7% agarose gel for quantification and
to confirm their high molecular weight.
Polymerase Chain Reaction Amplification. Cloning, and
Sequencing
Amplification of Ab exon two was achieved via the
polymerase chain reaction (PCR) described by Saiki et al.
(1985) with slight modification. The initial 100 n1
reaction mixture contained 1 /¿g of genomic DNA, 50 mM KC1,
10 mM tris (pH 8.3), 1.5 mM MgCl2, 0.01% gelatin, 0.5% DMSO
(v/v)/ and 250 mM of each dNTP (dATP, dCTP, dGTP, and dTTP).
80 pmoles of each oligonucleotide primer, which are
complementary to stable intron sequences, were also
included: mouse 2: CACGGCCCGCCGCGCTCCCGC; mouse 3:
CGGGCTGACCGCGTCCGTCCGCAG. Samples were then boiled for ten
minutes, quenched on ice, and 5 U Taq DNA polymerase
(Perkin-Elmer Cetus, Norwalk, CT) was added. The first five
amplification rounds consisted of 1 minute denaturing at
94°C, 2 minutes annealing at 25°C, and 3 minutes extension
at 72°C. At this point, 200 jul of dH20, 5% DMSO (v/v) was
added with an additional 5 U Taq DNA polymerase. The
amplification protocol for the ensuing 23 cycles consisted
of 1 minute 94°C, 2 minutes 62°C, and 3 minutes 72*C.
Immediately following the last cycle was a 7 minute 72°C
chase to ensure full extension of all amplified fragments.

69
The samples were then ethanol precipitated and
electrophoresed through a 5% nondenaturing acrylamide gel.
The fragment of interest was then excised and eluted into 3
ml of elution buffer; 0.5 M ammonium acetate, 0.1% SDS, and
1 mM EDTA, at 50°C overnight. The mixture was then
centrifuged at 2,000 rpm for 10 minutes, the supernatant was
ethanol precipitated, the pellet was washed with 70%
ethanol, dried and resuspended in 10 ¿¿1 of dH20. The
amplified fragment was then ligated with Sma 1 digested
M13mpl8 overnight at 25°C under conditions described by the
supplier (Bethesda Research Laboratories, Bethesda, MD).
Insert-positive plaques were sequenced via the Sanger
dideoxyribonucleoside method employing the Sequenase
protocol (United States Biochemical, Cleveland, OH). To
eliminate potential errors introduced by the PCR, at least 2
clones per sequence were analyzed.
Spleen Cell Isolation. Immunostaininq, and Flow Cytometric
Analysis
Freshly explanted spleens were minced through wire
screens to make a single cell suspension. Red blood cells
were lysed by incubating the cells in a IX ammonium chloride
solution for 5 minutes at 25°C. The remaining spleen cells
were washed thoroughly with IX PBS. 1 x 106 cells were
resuspended in 400 /¿I IX PBS, 0.1% NaN3 solution, and then

70
incubated in a 1:2 dilution of the monoclonal antibody-
culture supernatant for 30 minutes at 4°C. The samples were
washed 3 times with IX PBS and incubated in a 800 /¿I volume
of a 1/500 dilution of FITC (Accurate Chemical and
Scientific Corp., Westbury, NY) in IX PBS, 0.1% NaN3 for 30
minutes at 4°C. The samples were again washed 3 times with
IX PBS and brought up in a 4 00 /il volume for flow cytometry.
The cells were passed through a 4 micron nylon mesh filter
and analyzed on a FACSTAR fluorescence activated cell sorter
(Becton-Dickinson, Mountain View, CA) at a flow rate of 300
cells/second.
Data Analysis
The DNA sequence was analyzed by the following computer
programs. The nucleotide alignment and amino acid
translation was achieved using Microgenie (Beckman,
Fullerton, CA). The allelic phylogenies were constructed
using the DNAPARS and DNACOMP programs in the PHYLIP package
(Felsenstein 1989), and the neighbor-joining and UPGMA
programs (provided by M. Nei). Nucleotide divergence and
diversity was calculated with the SYNO and SEND programs
(Nei and Jin 1989).

CHAPTER IV
RESULTS
The Generation of Mhc Class II Ab Gene Polymorphism in Rodents
The mechanisms responsible for generating antigen
binding site polymorphisms in rodents has been a puzzle to
immunogeneticists for many years. In an attempt to assess
the roles mutational and recombinational processes play in
diversifying MHC class II genes, the nucleotide sequence of
46 alleles of Ab exon 2 (Abl exon) was determined and the
patterns of diversification examined. This is the most
polymorphic exon, and it contains the antigen binding site.
These alleles were obtained from a panel of rodents
containing 12 Mus species and sub-species and 2 species of
Rattus; thus providing alleles derived from species diverged
for increasing amounts of evolutionary time up to 10 million
years.
71

72
Animals
The DNA analyzed in this study was isolated from fresh
tissues or ethanol preserved tissues from various species of
rodents. The standard laboratory inbred mice were from the
mouse colony in the Tumor Biology Unit at the Department of
Pathology and Laboratory Medicine, University of Florida.
H-2 homozygous wild mice, whose origins and characteristics
have been described previously (Wakeland et al. 1987), are
from our wild mouse colony located at the Animal Care
Facility, University of Florida. Some wild-mouse derived
strains were supplied by F. Bonhomme's laboratory in
Montpellier, France. Three individuals of Rattus rattus
were trapped locally in Gainesville, Florida. The strains
included in this portion of the analysis are listed in Table
4-1.
Nucleotide Diversity Within the Abl Exon
The polymerase chain reaction coupled with DNA
sequencing technology was employed to obtain the nucleotide
sequence of 46 alleles of the Abl exon (27 alleles sequenced
by S.A.B.; 19 sequenced by J.X. She). These sequences were
combined with 10 previously reported laboratory mouse and
rat sequences to provide a data base of 56 sequences
(Malissen et al. 1983; Larhammer et al. 1983a; Eccles and
McMaster 1985; Estess et al. 1986; Acha-Orbea and McDevitt

Table 4-1. List of Ab Alleles Analyzed.
Allele
Spec i es
Strain
Geographic Origin
Ab*
H. m. domesticus
C57BI/6
Lab inbred 2
Ab5
H. m. domesticus
BALB/C
Lab inbred 1
At/
H. m. domesticus
B10.H
Lab inbred 5
Ab*
H. m. domesticus
B10.BR
Lab inbred 5
At/
H. m. domesticus
C3H.NB
Lab inbred
Ab*
H. m. domesticus
B10.6R
Lab inbred
Ab'
H. m. domesticus
B10.RIII
Lab inbred
Ab1
H. m. domesticus
A.SU
Lab inbred 5
Ab“
H. m. domesticus
B10.PL
Lab inbred 5
AbW
H. m. domesticus
N00
Lab inbred
MudoAb'
H. m. domesticus
DR1
Florida
MudoAb2
H. m. domesticus
B10.CAA2
Hichigan
HudoAb5
H. m. domesticus
B10.STC77
Hichigan
HudoAb2
H. m. domesticus
B10.SAA48
Hichigan
HudoAb5
H. m. domesticus
B10.STC90
Hichigan
HudoAb0
H. m. domesticus
B10.BUA16
Hichigan
HudoAb5
H. m. domesticus
ERF0UD5
Horocco
Ab6
H. m. domesticus
AZR0U1
Horocco
MudoAb7
H. m. domesticus
AZROU3
Horocco
HudoAb*
H. m. domesticus
HETK0VIC2
Yugoslavia
MudoAby
H. m. domesticus
ERFOUD1
Horocco
HudoAb'11
HudoAb''
HudoAb'2
M. m. domesticus
FAYIUH4
Egypt
H. m. domesticus
FAYIUH5
Egypt
H. m.'domesticus
JERUSALEH4
Israel
HudoAb'5
HudoAb'2
HudoAb'5
H. m. domesticus
24CI
Italy
M. m. domesticus
38CH
Italy
H. m. domesticus
HETK0VIC1
Yugoslavia
HumuAb'=At/
H. m. musculus
VIB0RG7
Denmark
HumuAb2
H. m. musculus
HBS
Bulgaria
HumuAb5
H. m. musculus
HOS
Denmark
HumuAb2
H. m. musculus
HBT
Bulgaria
HumuAb5
H. m. musculus
HYL
Yugoslavia
HumuAb0=MudoAb'i
H. m. musculus
BRN04
Czechoslavakia
HucaAb'
H. m. castaneus
CAS
Thai land
HucaAb2
H. m. castaneus
THONBURI1
Thai land
HumoAb'
H. m. molossinus
HOL
Japan
HuspAb'
H. spretus
SEG
Spain
HuspAb2
H. spretus
SEI
Spain
HuspAb5
H. spretus
STF
Tunisia
HusiAb'
H. spicilegus
PANSEV01
Yugoslavia
HusiAb2
H. spicilegus
PANSEV02
Yugoslavia
HusiAb5
H. spicilegus
PANSEVOB
Yugoslavia
Hus i Ab2
H. spicilegus
ZRU
Bulgaria
HusiAb0
H. spicilegus
ZYO
Yugoslavia
HusiAb0
H. spicilegus
ZBN
Bulgaria
HustAb'
H. spretoides
XBJ
Bulgaria
HucoAb'
H. cooki i
COK
Thai land
HuceAb'
H. cervicolor popaeus
CRP
Thai land
HucrAb'
H. caroli
KAR
Thai land
HucrAb2
H. caroli
KAR2
Thai land
HuplAb'
H. platythrix
PTX
India
RT-1*
R. norvegicus
RT1B
Lab inbred 5
RT-1“
R. norvegicus
RT1U
Lab inbred
Rara'
R. rattus
LN3
Gainesville
Rara2
R. rattus
LN4
Gainesville
Rara0
R. rattus
LN20
Gainesvilie

Figure 4-1. The consensus and allelic nucleotide sequences of Ab exon
2. Dashed lines represent identity with the consensus sequence;
differences are noted. Asterisks represent deletions of those
nucleotides.

CONSENSUS
10 20 30 40 50 60 70 80 90 100 110 120 130 140
GGCAXTXCGI GXACCAGXXC AAGGGCGAGX GCIACIXCAC CAACGGGACG CAGCGCAIAC GGCICGXGAC CAGAIACAXC XACAACCGGG AGGAGTACGT GCGCIICGAC AGCGACGXGG GCGAGXACCG CGCGGIGACC
Abr
Abd
A\/
Abk
AbP
Ab 1
Abr
Ab’
Ab“
Abmv7
MudoAb7
MudoAb7
MudoAb7
MudoAl/
MudoAb7
MudoAb7
MudoAb7
MudoAb7
MudoAb9
MudoAb79
-X AXAT-
14
MudoAb'
MudoAb'
MudoAb'/
MudoAb'
MudoAb7-5
MurnuAb7
MumuAb2
MurnuAbJ
MurnuAb^
MumuAp
MumuAb6
MucaAb7
MucaAb^
MumoAb7
MuspAb7
MuspAb2
MuspAb5
MusiAb7
MusiAb2
MusiAb5
MusiAb^
MusiAb5
MusiAb6
MustAb7
MucoAb7
MuceAb7
MucrAb7
Muc r Ab"
MuplAb7
RX-17,
RX-1"
Rara7
Rara7
-GX-
C-
-C—
GC-
GC-
C—CC-TIC-
-ATCT---GA
1 X
-AXCX- A
-AXCX- A
1-
-X- -GI-
C—
GC-
GC-
GC-
C--
C--CC-IIC-
-AXCX-
-AXAT-
-GA
-GX-
C—CC-ITC-
—XI-C—-
-AICT- — -A
-AXCX A
-AXCX A
-AXCX A
T
-GC-
C--CC-IXC-
C--CC-IIC-
-GCG-
C-
-A—-C-
--X-
-GC-
-TTCX
-AXCX——A
- I
—— T
-AXCX GA
- G
- -G
-AXCX
-G -ATCT-
—I-
-GC-
—X-
— C—CC-IIC-
-G
-G C—
-G -I
-G
-AGCI-—GA
-AXAX
-AXCX A
C- —C-IXC-
-I--C
—T—
-GC—
-AXCX GA
--X
1
-AXAX
-AIGI A
-- C—CC-TIC-
— C--CC-IIC-
-GX-
C--CC-IIC-
C--CC-IIC-
-TCI—-GA
X
-GC-
C--CC-TXC-
-G — XC-IXC-
-A-AX—
-AGGXC-
-GG—
-GG--
C-
C-
—C-
—C-
-GG—
-GG—
-GG—
-GG—
C-
C-
-GG—
-I-A-
-I
C-
-X-A-
-I —
---C-
—-c-
-GG—
-GG-
-GG-
-GG-
-T-A-
— C-
—C-
-T-A-
-GG —
—-C-
-X-C-
---c-
-XG—
-GG—
-A-
-GA
--TATC-
-GA
Ui

CONSENSUS
150 160
GAGCTGGGGC GGCCAGACGC
170
CGAGTACTGG
180 190
AACAGCCAGC CGGAGATCCT
200
GGAGCGAACG
210
CGGGCCGAGC
220
TGGACACGGT
230
GTGCAGACAC
240 250
AACTACGAGG GGCCGGAGAC
260
CCACACCTCC
270
CTGCGGCGGC
TTG
4Kb
At/
Abk
AbP
Ab«
Abr
Ab1
Ab“
Ab'“'
MudoAb^
MudoAb^
MudoAb"
c-
AC
a—
-c
G
— -GT
--C
MudoAb5
MudoAb^
MudoAb^
MudoAb9
MudoAbW
MudoAb^
MudoAb^“
MudoAb^
MudoAbiJ
MurauAb^
MumuAb“
MumuAb^
MumuAb*
MumuAbJ
MucaAb”
MuxnoAb^
MuspAb^
MuspAb"
MuspAb^
MusiAb*
MusiAb^
MusiAbJ
MusiAb**
MusiAb5
MusiAb6
MustAb^
MucoAb^
MuceAb^
MucrAb^
c
MuplAb^
RT-r*
RT-l“
Rara^
Rara"
— -CG
AG-A-
A
C T--
-- A-A--
—C-T—***
A A
---GG
G C G T
T-A A T--A-
--C

77
1987; Figueroa et al. 1988). By aligning all the sequences
in our panel it was observed that the two codon deletion at
amino acid positions 65 and 67 were erroneously placed
previously in the literature (Estess et al. 1986). Shifting
the position of the two deletions to nucleotide positions
175-177 and 185-187 results in two less nucleotide mis¬
matches between the two forms of Abl. The nucleotide
sequence of all the alleles is shown in Figure 4-1.
DNA sequence analysis of these 56 sequences revealed 52
different alleles in the data set; 4 pairs of identical
alleles were found in independent samples from the Mus
musculus complex. The nucleotide diversity between alleles
was computed using Nei and Jin's program (1989). Most
allelic comparisons revealed 5-15% sequence diversity in the
Abl exon; although some alleles differed by as much as 25%
in comparisons both within and between mouse species. The
maximum value of sequence divergence was 32.7%, and occurred
1 5
between a rat allele (Rara ) and a mouse allele (MudoAb ).
The mean nucleotide sequence diversity among alleles within
a Mus species (D = 7.57 ± 0.7%) was comparable to that
observed between species (D = 7.73 ± 0.3%) and between all
alleles in the genus (D = 7.68 ± 0.3%). These results
indicate that the diversification of MHC genes is
independent of the phylogenetic relationships within the
genus Mus, and contrasts diversification patterns of other
nuclear genes (She et al. 1989).

78
Phylogenetic Relationships of the Abl Alleles
The phylogenetic relationships of these Abl alleles
were analyzed using both phynetic or distance methods, such
as neighbor-joining and UPGMA (Saitou and Nei 1987; Sokal
and Sneath 1963), and parsimony analysis (DNAPARS program in
PHYLLIPpfFelsenstein 1989). The distance methods determine
the all elite relationships by comparing the total sequence
divergence between alleles; whereas parsimony analysis forms
a networic basing the genealogy on the fewest number of
mutations^between alleles. Similar results were obtained
for all three methods of analysis, and Figure 4-2
illustrártes the allelic genealogy produced using UPGMA based
on the J^C distance. The results show that alleles in
separate ^species are commonly more related than alleles
within the same species. This observation is consistent
with the^retention of ancestral polymorphisms. However,
these analyses revealed very few tightly-clustered allelic
lineages that were stably maintained over evolutionary time
spans. There are only 6 lineages of closely related
alleles, or alleles with less than 2% nucleotide sequence
divergence. These lineages were strictly comprised of
alleles derived from the same or closely related species,
with divergence times of less than 1-2 million years. Most
of the Abl alleles could not be organized into homogeneous
lineages. For example, if lineages were defined as alleles

\
Figure 4-2. A phenogram constructed by the UPGMA method showing the
relationships between alleles based on their similarity in exon 2 of
Ab.

80
P
Mudol
Mudo2
Mudo3
Mudo8
q
Mudo4
Musp3
Mudol 1
Mudol 4
s
Muca2
f
Mus¡3
Mudo7
b
Muspl
Mumu5
Mucal
d
Mucr2
Mumu3
Mus¡6
Mudo6
r
Mudo15
Mumol
Mudo12
Mudol 3
u
k
MudolO
Musp2
nod
Mumu2
Musil
Musi4
Musi2
Musi5
Mustl
Mudo9
Mucol
Mucrl
Mumu4
Mucel
MupH
RT-1 b
Raral
Rara2
Rara3
RT-1 u
Mudo5
l i i i i i i l I I l l I I I I I I I I I I I
22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 0
% of nucleotide divergence

81
containing less than 5% nucleotide divergence in the Abl
exon, 25 separate singleton alleles remained. This
indicates that most of the lineages defined in the analysis
are not retained as stable polymorphisms for more than 1-2
million years. This observation sharply contrasts the
results reported by Gyllensten and Erlich (1989) for
polymorphisms of the primate class II DQa gene.
Parsimony analysis revealed a second interesting
feature of the diversification patterns among these alleles.
The most parsimonious network for all 52 alleles required
405 character changes and only 20 of the 82 (24.2%)
informative sites (nucleotide positions exhibiting at least
2 character states represented by 2 or more alleles in the
data set) were compatible with the genealogy. These results
indicate that the amount of homoplasy, or reverse, parallel,
or convergent mutations, is excessive, and suggests that the
observed evolutionary relationships are not reliable. An
example of the homoplasy in the data set is illustrated in 1
l
Figure 4-3. The actual analysis was done with nucleotide
sequences, but the presentation of the results is simplified
by showing the protein sequence. The carboxyl terminal
regions of the Ab^ and MumuAb1 alleles (underlined) are
identical to that of Abn ualthough the remainder of their
sequences are clearly different. These results might be
explained by convergent evolution, but the amount and the
patterns of homoplasy observed are best explained by

Figure 4-3. Examples of homoplasy among alleles of Ab exon 2
organized into lineages by parsimony analysis. The underlined
sequences are regions of obvious homoplasy.

Amino Acid Sequences Encoded by Ab Exon 2
Ab Alleles
14 24 34 44 54 64 74 84 94
HFVYQFKGE CYFTNGTQRI RLVTRYIYNR EEYVRFDSDV GEYRAVTELG RPDAEYWNKQ *Y*LERTRAE LDTVCRHNYE GTETPTSLRR L
Abnod
H
MudoAb^
—H
At/'
A-L
MudoAb1^
---A-L---
MustAb^
QPF
Mus iAb"
QPF
MusiAbJ
QPF
L-
-S-N-F --W
S-N W
--Y 1 L M
--Y --I L
--Y 1 L
HS —-Y
A E--V
S- PEI V Y —- -P—H
S- PEI- - V E--V
S- pEI v V--H
-S Y E A -V--H
-S Y— Q A L *- -
-S Y E A Q -L *- -
00
U>

84
postulating intra-exonic recombinational events among the
alleles.
The Abl Exon Consists of Five Polymorphic Sub-Domains
The majority of polymorphisms in the Abl exon occurs in
5 specific regions, termed polymorphic segments. These
segments contain 56 of the 82 (68.3%) informative sites for
parsimony analysis, and are identified in Figure 4-4. Each
polymorphic segments encodes a specific element of the
hypothetical class II antigen binding site, as shown in
Figure 4-5. The BS1, BS2, and BS3 segments are located
within the region of the Abl exon that encodes the /3-pleated
sheets of the antigen binding site, the a-helix segment is
located in the 5' end of the region that encodes the a-helix
of the ABS, and the 3' segment is located at the end of the
Abl exon in a region that encodes a portion of Ab whose
structure cannot be currently predicted. The Abl exon was
divided into 5 sub-domains based on the locations of these
polymorphic segments, and each sub-domain was analyzed
separately by parsimony analysis. This revealed that the
alleles in each sub-domain could be organized into a series
of highly divergent lineages. Furthermore, the total number
of mutations needed to produce all of the lineages in all of
the sub-domains was two-fold lower than that required for
lineages constructed from the entire exon. This indicates
that these sub-domain lineages have much lower levels of

Figure 4-4.
Locations of polymorphic segments within Ab exon 2.

86
L /?1 @2 TMCYTCY3’UT
¿5 '
i
I I
y
S'
IF;
.5r.
2 Kb
BS1 BS2 BS3 Of-helix 3’ segment
v.
j
Y
/? - pleated sheet
50 bp

Figure 4-5. A model
molecule as proposed
areas encoded by the
of the antigen binding site of a Mhc class II
by Brown et al. (1988). The grey zones represent
polymorphic segments.

3’segment
00
00

89
homoplasy, and suggests that each polymorphic segment is
evolving independently.
The Abl Exon Sub-Domain Lineages Represent Ancestral
Polymorphisms
Parsimony analysis identified 5-11 distinct lineages in
each sub-domain; primarily defined by point mutations
occurring in the polymorphic segments. The consensus
sequences of these lineages are presented in Table 4-2.
These highly diversified polymorphic segments often differ
in 20-35% of their, nucleotide sequences. The majority of
the diversity between polymorphic segments appears to result
from the accumulation of point mutations over long
evolutionary periods. As illustrated in Figure 4-2, each
sub-domain lineage contains alleles derived from multiple
mouse species, or even both mouse and rat. The data in
Table 4-3 illustrates that alleles in the same sub-domain
lineage often have identical or very similar nucleotide
sequences, yet may be derived from evolutionary distant
rodent species. For example, some polymorphic segments are
identical in alleles derived from mouse and rat, indicating
they have been retained as polymorphisms for a minimum of 10
million years. These results indicate that the polymorphic
segments in the sub-domains of the Abl exon are extremely
stable polymorphisms, some of which first arose prior to the
divergence of mice and rats.

Table 4-2. The nucleotide sequences of polymorphic segments in five
sub-domains.
* - The sequences on the top of each sub-domain are consensus
sequences based on all 56 alleles.
Â¥ - indicates the total number of alleles that share the same
polymorphic segment.
£ - "Species" lists all the species which contain at least one allele
in that lineage. Species are numbered as following: 1: M. m.
domesticus. 2: M. m. musculus. 3: M. spretus. 4: M. m. castaneus 5: M.
m. molossinus. 6: M. spicilegus. 7: M. spretoides. 8: M. cervicolor 9:
M. cookii. 10: M. caroli. 11: M. plathvtrix. 12: Rattus rattus. 13 R.
norvegicusâ– 

Lil
agí
1
2
3
4
5
1
2
3
4
5
6
7
8
9
10
1
2
3
4
5
6
7
1
2
3
4
5
6
7
1
2
3
4
5
6
7
8
9
10
11
91
Table 4-2
Nucleotide Number of Spec ies1
* ¥ '
Sequences Alleles
13 23
TACCAGTTCAAGGGCGAG
C--CC-TTC
GC G
G CT-
GT
14 1,2,3,6,7,9,11
8 1,2,6
5 12,13
3 1,6
23 1,2,3,4,5,6,8,10
61 71 80
CGGCTCGT GACCAGAT ACAT C
--ATCT-—A
--ATCT — GA
--ATAT
A--TATC--GA T"
.?
T--
-—AT-—G—T
—AGT — GA- — CG-T--
--TA-A
12
6
5
2
11
4
4
1
1
1
1.2.3.8
1,2,4,6
1.2.3.9
12
1,2,4,6
5,6,7
1,3
11
13
10
97 107
TACGTGCGCTTC
-GG
---C A-
A-
-T-A
----C A-
13 1,2,4,5,6,8,10
13 1,2,4,6,7,10
4 1
4 1,2,3
7 1,2,3,11,13
4 1.3,6
2 12
155 165 175 185
CCAGACGCCGAGTACTGGAACAGCCAGCCGGAGATC
AC--T-***---A-T-***- 29
14
--CTCA T.***...A.T.***. 4
--CACA 2
-GG T-AA----T-- 2
--GTGG CG AA 1
--G----T A 1
1,2,3,4,5,6,7,8,9,10
1,2,4,10,11
1,2,13
2
12
13
12
242 252 262 272
GGGCCGGAGACCCACACCT CCCT GCGGCGGCTT
-A-A GT--C
—-GT
AA-A C
----T C ***--
----T C
G-T-T—T
T-AT----T
*****T----T--T--T A C-
A CG A
---GT G ***--
16
10
9
6
3
2
3
1
1
1
1
1,2,3,4,6,11
1.2.12.13
1.2.4,7
1,2,3
1.6
5.6
12.13
8
10
10
9

Table 4-3. Representative allelic sequences in the BS1 and a-helix
sub-domain lineages illustrating the conservation of sequence
segments.
* - The sequences presented are from: BS1, nucleotide positions 2-38;
and a-helix, nucleotide positions 151-188.

93
Table 4-3
Sub-domain Lineage Alleles
Sub-domain sequences’
MustAb1
MudoAb9
MusiAb1
MucoAb1
1 Abu
MuspAb2
MumuAb2
MuplAb1
GCATTTCGTGTACCAGTTCAAGGGCGAGTGCTACTTC
c—CC-TTC A-
C—CC-TTC A-
GC C—CC-TTC A-
GT G TC-TTC A-
T—GT C—CC-TTC
c c-TTC
C—CC-TTC
-G C C-T CC-TTC
BS1 MudoAb2 GC G
2 MumuAb1 GC G
MusiAb6 GC G
3 Rara2 -G
RT-1U -G
4 Abd GT A-
MusiAb3 GT A-
a-helix
GCCAGACGCCGAGTACTGGAACAGCCAGCCGGAGATC
MustAb1 -T AC—T-*** A-T-***-
MucrAb’ -T AC—T-*** A-T-***-
MucaAb2 AC—T-*** A-T-***-
MumuAb4 C-A TC—T-*** A-T-***-
MusiAb6 C-A —TC—T-*** A-T-***-
1 MusiAb4 -T TC—T-*** A-T-***-
MucoAb1 TC—T-*** a-T-***-
MuspAb3 A C—T-*** a-T-***-
MumoAb1 T T-*** A-T-***-
MuceAb1 T-*** A-T-***-
MuspAb1 T T-*** a-T-***-
MudoAb5
2 Ab^
RT-lb
MumuAb3
—ACTCA
—ACTCA'
CTCA
CACA
T-*** a-T-***-
AC—T-*** a-T-***-
T-*** A-T-***-
■TC—T-*** A-T-***-
MucrAb2
3 MudoAb2 C
MucaAb1 C
MuplAb1 T A

94
Amplification of Ab Diversity by Intra-Exonic Recombination
The specific association of the polymorphic segment
lineages in the various sub-domains comprising the Abl exon
occurs in numerous combinations. This indicates that intra-
exonic recombination has occurred during the diversification
of the exon, and is illustrated in Figure 4-6. For example,
the MumuAb5, MucrAb1, and MuceAb1 alleles all have sequences
from lineage 5 of the BS1 sub-domain, but have sequences in
lineages 3, 9, and 1 respectively for the BS2 sub-domain
(Figure 4-6A). Similar random associations are found for
all the lineages in all the sub-domains, indicating that
shuffling the polymorphic segments in each sub-domain to
generate novel new alleles has been a primary evolutionary
mechanism for Abl exon diversification. Alleles derived
from phylogenetically distant species commojily only share
one or two polymorphic segments, indicating that several
intra-exonic recombinational events have accumulated during
their evolutionary divergence. This shuffling process
accounts for the formation of an array of highly divergent
alleles, which may differ in greater than 10% of their
nucleotide sequence in the Abl exon.
Despite this extensive recombination, stable
associations of Abl sub-domain lineages could be found among
alleles derived from the same species or sub-species, or
closely related species. Examples of such alleles are shown

95
in Figure 4-6B, and is consistent with the finding of
closely related clusters of alleles defined by UPGMA
analysis in Figure 4-2. Analysis of the entire data set
revealed 24 of the 56 sequences could be organized into 6
groups on the basis of sharing 4 or more contiguous sub-
domain lineages. All of these groups only contained alleles
derived from the same species of species that have diverged
less than 1-2 million years. These results suggest that
many sub-domain lineage combinations are stable over
relatively short evolutionary time spans, and that intra-
exonic recombinational events in the Abl exon accumulate
slowly over evolutionary periods.
Although intra-exonic recombinational events act to
shuffle the polymorphic segments, this does not imply that
the recombinational breakpoints only occur at specific sites
in the Abl exon. Rather, these events occur throughout the
exon with no obvious pattern. This is illustrated by the
distribution of the phenotypically silent "A” to "T"
transversion substitution at nucleotide position 37 among
lineages of the BS1 sub-domain. The "A" nucleotide is
present in all alleles from lineages 3 and 4; the "T"
nucleotide is present in all lineage 2 alleles. The "A" and
the "T" is a polymorphism in lineage 1 alleles (Table 4-3).
This distribution pattern is most easily explained by
postulating that the recombinational breakpoints have
occurred on both sides of nucleotide position 37 during the

Figure 4-6. A schematic diagram of Ab exon 2 structure of some
representative alleles. Lineages of polymorphic segments are
represented by different fill patterns. (A) Alleles derived from
distantly related species sharing only 1-3 sub-domains, thus
illustrating the shuffling of sub-domain lineages by intra-exonic
recombination. (B) Alleles derived from the same species or closely
related species sharing 4-5 identical sub-domains.

97
A
Mupn
Mumu5
Mucrl
Mucol
Mucel
Mumu6
BS1 BS2 BS3 a-helix 3’ segment
—
xxxxxx<
i i
is;
'â–  /
7
/
i
i
üij
- <
<
T <
2
V '. . ?:
rm i
1 \
i
1 J
&
; ^
i a a
" i ff l
r
* A A A A
B
Mumul
Mudo3
Mus¡2
Mustl
Lineage 1 feSfeMI
Lineage 3
Lineage 2
Lineage 5 |
Lineage 6
VsVVV
Lineaqe 4 /////
Lineaqe 8
Lineage9

98
evolution of the exon. Such a process would result in the
shuffling of this silent polymorphism among lineages of Abl.
Many other examples of wandering single nucleotide
polymorphisms can be found throughout the exon (ie.
positions 14, 106, 126, 210). In addition, several
recombinational events have occurred within a polymorphic
segment. For example, the nucleotides CACA at positions
155-158 in the a-helix is found in alleles with the two
• 5
codon deletions (MudoAb ) , as well as in undeleted alleles
2
(MumuAb ). These results, therefore indicate that
y
recombinational breakpoints do not repeatedly occur at the
same positions within the exon.
In conclusion, the data indicates that specific
sections of the Abl exon, or the polymorphic segments,
contain many highly divergent allelic forms that are stable
over long evolutionary periods. The entire exon; however,
does not evolve as a single entity due to repeated intra-
exonic recombinations. As a result, the extensive diversity
between alleles predominantly arises from the
recombinational shuffling of these highly divergent
polymorphic segments into a variety of novel combinations.

99
The Impact of Mhc Class II Ab Gene Polymorphisms on the Structure
of the Antigen Binding Site
In an effort to determine whether the extensive
diversity of the Mhc Ab gene was generated and maintained
via selective pressures acting to diversify the antigen
binding site, the impact of the polymorphism on the
structure of the antigen binding site was analyzed. The
hypothetical 3-dimensional model of Mhc class II molecules
proposed by Brown et al. (1988) provides a framework in
which to assess the potential impact of these polymorphisms
on the functional properties of Ab. Forty-eight different
Mus-derived alleles were examined in this portion of the
study, and the alleles are listed in Table 4-4. The antigen
binding site was divided into 6 segments based on the
hypothetical model (Brown et al. 1988), structural features,
and patterns of polymorphism. (3-pleated sheets 1, 2, and 3
(BS1, BS2, and BS3) are encoded by amino acids 9-14, 26-31,
and 37-40 respectively. a-helix 1 extends from amino acid
56 to amino acid position 65. 29.2% of the alleles contain
a proline at position 65, and 68.8% of the alleles have a
codon deletion at this position. The a-helix 2 portion of
the antigen binding site extends from amino acid position 66
to 79. Every allele sequenced encodes cysteine at positions
15 and 79, and these residues form a disulfide bond that
probably acts to anchor the a-helix to the /3-pleated sheet

Table 4-4. List of Ab Alleles Analyzed
Allele
Species
Strain
Geographic Origin
Ab*
M. m. domesticus
C57BI/6
Lab inbred 2
kbd
M. m. domesticus
BALB/C
Lab inbred 7
At/
M. m. domesticus
B10.M
Lab inbred 3
Ab1'
M. m. domesticus
B10.UB
Lab inbred
Ab*
M. m. domesticus
B10.BR
Lab inbred 3
Atf
M. m. domesticus
C3H.NB
Lab inbred
Ab?
M. m. domesticus
B10.6R
Lab inbred 3
Abr
M. m. domesticus
B10.RI11
Lab inbred
Ab*
M. m. domesticus
A.SW
Lab inbred 3
Ab“
M. m. domesticus
B10.PL
Lab inbred 3
Ab"'*7
M. m. domesticus
NOD
Lab inbred 4
MudoAb7
M. m. domesticus
DR1
Florida
MudoAb7
M. m. domesticus
B10.CAA2
Michigan
MudoAbJ
M. m. domesticus
B10.STC77
Michigan
MudoAb*
M. m. domesticus
B10.SAA48
Michigan
MudoAbJ
M. m. domesticus
B10.STC90
Michigan
MudoAb6
M. m. domesticus
B10.BUA16
Michigan
MudoAb6
M. m. domesticus
ERFOUD5
Morocco
Ab6
M. m. domesticus
AZROU1
Morocco
MudoAb7
M. m. domesticus
AZROU3
Morocco
MudoAb77
M. m. domesticus
METK0VIC2
Yugoslavia
MudoAby
M. m. domesticus
ERFOUD1
Morocco
MudoAb7*
M. m. domesticus
FAYIUM4
Egypt
MudoAb77
M. m. domesticus
FAYIUM5
Egypt
MudoAb'^
M. m. domesticus
JERUSALEM4
Israel
MudoAb7J
M. m. domesticus
24CI
Italy
MudoAb7,7
M. m. domesticus
38CH
Italy
MudoAb75
H. m. domesticus
METKOVIC1
Yugoslavia
MumuAb7 =Afc/
M. m. musculus
VIB0URG7
Denmark
MumuAb7
M. m. musculus
MBS
Bulgaria
MumuAb3
H. m. musculus
MDS
Denmark
MumuAb1
H. m. musculus
MBT
Bulgaria
MumuAb3
H. m. musculus
MYL
Yugoslavia
MumuAb°=MudoAba
M. m. musculus
BRN04
Czechoslavakia
MucaAb7
M. m. castaneus
CAS
Thai land
MucaAb7
M. m. castaneus
THONBUR 11
Thai land
MumoAb7
M. m. molossinus
MOL
Japan
MuspAb7
M. spretus
SEG
Spain
MuspAb7
M. spretus
SEI
Spain
MuspAb3
M. spretus
STF
Tunisia
Mus i Ab7
M. spicilegus
PANSEV01
Yugoslavia
Mus i Ab7
M. spicilegus
PANSEV02
Yugoslavia
MusiAb3
M. spicilegus
PANSEVOB
Yugoslavia
Mus i Ab*
M. spicilegus
ZRU
Bulgaria
Mus i Ab3
M. spicilegus
ZYD
Yugoslavia
Mus i Ab°
H. spicilegus
ZBN
Bulgaria
MustAb7
M. spretoides
XBJ
Bulgaria
MucoAb7
M. cookii
COK
Thai land
MuceAb7
M. cervicolor popaeus
CRP
Thai land
MucrAb7
M. caroli
KAR
Thai land
MucrAb7
M. caroli
KAR2
Thai land
HuplAb7
M. platythrix
PTX
India

101
structure. The a-helix 3 section extends from amino acid 80
to amino acid 89. The most common amino acid at position 89
is proline, and in contrast to the proline at residue 65
which most likely kinks the a-helix, the proline at position
89 probably destroys the secondary a-helical structure.
The Distribution of Amino Acid Diversity
The amino acid sequences predicted from the nucleotide
sequences of 48 Mus-derived alleles of Ab exon 2 are
presented in Figure 4-7. The alleles in the panel differ by
an average of 8.6 amino acids, and most of this diversity is
localized within discrete segments of the exon. This is
illustrated by analysis of the protein sequence variability
by the convention of Kabat and Wu (Wu and Rabat 1970)(Figure
4-8, and Table 4-5). There are eleven positions with high
variability (V > 7.0), and ten positions with moderate
variability (4.0 < V < 5.5), and all these residues are
located in segments that comprise distinct portions of the
antigen binding site (Figure 4-9). These antigen binding
site segments are the /3-pleated sheets that form the floor
of the antigen binding site, and the a-helix that forms the
side of the binding site groove. It should be noted that
the amino acid residues predicted by Brown et al. (1988) to
directly contact antigenic fragments (marked by arrows in
Figure 4-8) represent only 6 of the 11 most polymorphic
residues. This suggests that amino acid positions other

Figure 4-7. The consensus and allelic amino acid sequences predicted
from the nucleotide sequence of Ab exon 2. Dashed lines represent
identity with the consensus sequence; differences are noted.
Asterisks represent deletions of those residues. Bold and underlined
amino acids in the consensus sequence have Rabat and Wu indices
greater than 7, bold amino acids have indices between 4.0 and 5.5.

consensus
MumuAb
Mudo A b'
MudoAb-*
Mudo A b**
Mudo A b^
MudoAb'7
MudoAb^. MuinuAb^
MudoAb9
MudoAb'9
MudoAb"
MudoAb"
MudoAb"
MudoAb"
MudoAb"
MumuAb-
MuinuAb''
Muir.uAb-'
MumuAb^
Mus iAb'
Mus iAb9
MustAb'
MucoAb'
MuceAb'
MucrAb'
MucrAb~
MuplAb'
14 24 34 44 54 64 74 84 94
HFVYQFKCE CYFTNGTQRI RLVTRYIYNR EEYVRFDSDV GEYRAVTELG RPDAEYWNKQ *Y»LERTRAE LDTVCRHNYE GTETPTSLRR L
-H-
-S- PEI
-S- PEI V--A
P--H
P--S
V
SA
H--QPF
—LV--QPF
H
---A
—A-L—
—A-L —
—H
S-D- L - - S Y
--S-N FM --F-- -V QK V -P--H
— I - K
S-N W S- PEI V E--V
— L-Y P--Y
-S-D L Y Q---
Y- L - Y—
- S-N W S- PEI
S-N W S- PEI V E—V——
-S-N- --W S- PEI VNM E--V
-S-N-F W S- PEI
Y—
V Y—
-P--H
-V--H
E—V
E--V
E--V -
-P--H
QPF
-HS--
K—
-H
V-'
QPF
--F D
K—
---L-SA
A
QPF —-
—L -
-F-L--A -A-D
—-LM — Y
-S-D ---L F
---S-N FM —-V
— S --F F G- S-
-S —L F- P—Y—
QK--A V
PEI —-K--V V
-L-Y-
-H-
PEI
Q—
D-F-
-F
L
MA-
-F
-F-L
-A--QPF
QPF
-y
QPF
QPF
-A-L
QPF
-V-L-SF
L
-S-D
1
-Y---N-
-S-N—
-C-N—
.. — p—Y-
— --R
T---F-
q—F
Y T--N--S- PEI
--W l S- PEL V--A-
L — -Y- —
— ---y A
— K
— -P--H
P--H
P--H
— -S--H
V--H
-- E—V- -
P--H
P--H F
-- -V--H
-W-
-FM-
VL-
-P-
-P-
—Q—C A-
-FM E C A K -P--H
—L -S Y V -PG-H
— I-
-S-D-
-H—
-GL-
--L-
-FM-
-W--
--L-
-FL-
--L-
-L—
-W--
-N-
-H-
-A V--L
-- v
P--H
-- -V--H
V--R- —*-
-- -p-SY
F--Q-D --H -I L --F--L -S Y ILI*** P
—Y — A-N W--Y --H S- PEI R R
DS-H PF -H-SS W D S- QEI--Q—-S -S--H
consensus
HFVYQFKGE CYFTNGTQRI RLVTRYIYNR EEYVRFDSDV GEYRAVTELG RPDAEYWNKO *Y*LERTRAE LDTVCRHNYE GTETPTSLRR L
BS1 BS2 BS3 a-HELIX 1 a-HELIX 2 a-HELIX 3

Figure 4-8. A variability plot of the aminó «icid positions encoded in
Ab exon 2 according to the method of Wu and Kabat (1970). The lines
underneath the bar graph indicate the positions of specific elements
of the antigen binding site. The arrows identify positions which
encode contact amino acids according to Brown et al. (1988).

VARIABILITY
BS1 BS2BS3 AH1 AH2 AH3
AMINO ACID
O

106
Table 4-5
Kabat and Wu variability data for Ab exon 2.
Amino Acid Kabat and Wu Value
Position 48 Alleles
6)
2.04
51)
2.04
V)
2.04
52)
1.00
8)
2.04
53)
1.00
9)
10.92
54)
1.00
10)
1.00
55)
1.00
11)
2.82
56)
3.79
12)
4.36
57)
7.39
13)
7.74
58)
4.80
14)
8.89
59)
1.00
15)
1.00
60)
2.04
16)
1.00
61)
10.00
17)
4.00
62)
1.00
18)
1.00
63)
2.90
19)
1.00
64)
1.00
20)
1.00
65)
4.36
21)
1.00
66)
2.90
22)
1.00
67)
4.36
23)
2.04
68)
1.00
24)
1.00
69)
1.00
25)
1.00
70)
3.69
26)
16.70
71)
3.27
27)
2.04
72)
4.27
28)
13.10
73)
1.00
29)
2.04
74)
5.58
30)
4.68
75)
5.33
31)
2.04
76)
2.04
32)
1.00
77)
2.04
33)
1.00
78)
3.60
34)
3.13
79)
1.00
35)
1.00
80)
1.00
36)
1.00
81)
2.13
37)
7.38
82)
1.00
38)
6.00
83)
1.00
39)
1.00
84)
3.13
40)
2.46
85)
7.06
41)
1.00
86)
18.45
42)
1.00
87)
3.13
43)
1.00
88)
4.92
44)
3.13
89)
16.00
45)
2.18
90)
2.04
46)
1.00
91)
1.00
47)
3.69
92)
1.00
48)
1.00
93)
2.34
49)
1.00
94)
1.00
50)
2.13
95)
3.13

107
than those predicted to be contact amino acids may play a
prominent role in determining allelic binding capacity.
As illustrated in Figure 4-9, the most polymorphic
residues in /3-strands 2 and 3 do not exactly coincide with
the central floor of the antigen binding site.
Interestingly, /3-strand 1 is separated from /3-strands 2 and
3 by a /3-turn segment whose exact structure cannot be
definitively determined from the class I model. Perhaps the
/3-turn in this segment is more abrupt than proposed by Brown
et al. (1988). Consequently, this would have the effect to
more precisely align the most polymorphic amino acids of /3-
strands 2 and 3 with the inner floor of the antigen binding
site. Alternatively, if /3-strands 2 and 3 are properly
aligned in the hypothetical model, some of the most
polymorphic amino acids, such as positions 26 and 37, could
form highly diversified pockets upon interaction with the a-
helical residues.
It is interesting to note that amino acid position 57
is highly variable (V = 7.39), with six different amino
acids detected among the 48 alleles examined. Polymorphisms
of position 57 were previously suggested to increase
susceptibility to diabetes (Todd et a_l. 1988) .
Forty-three percent (38/89) of the amino acids that
comprise Ab exon 2 are conserved (V = 1) among the alleles
in the data set (Figure 4-8, and Table 4-5). Twelve of
these conserved residues are located within the antigen

108
binding site; 2 in the /3-pleated sheet segments, and 10 are
scattered throughout the a-helical region in no
distinguishable pattern (Figure 4-9). Three of these
conserved residues play critical roles in maintaining proper
tertiary structure of the Abl domain. For instance,
residues 15 and 79 both encode for cysteine, and form the
disulfide bond stabilizing the structure of the molecule.
In addition, the N-linked glycosylation site at residue 19
is conserved. Sixty-one percent (23/38) of the conserved
amino acids are located in the /3-pleated sheets outside the
antigen binding site, or form the /3-turns.
Overall, these results indicate that extensive amino
acid diversity is only permitted in parts of the molecule
that can alter antigen binding capacity, such as the antigen
binding site. In contrast, a certain amount of amino acid
conservation is required to maintain the structural
integrity of the Abl domain.
Selective Diversification of Antigen Binding Site Codons
To investigate the possibility that diversifying
selection was involved in the development of antigen binding
site variability, the frequencies of nonsynonymous (dn,
amino acid replacement) and synonymous (ds, silent)
substitutions was measured as described by Hughes and Nei
(1988), and performed on the alleles of our data set. As
shown in Table 4-6, any two Ab exon 2 sequences in the data

Figure 4-9. Hypothetical 3-dimensional model of the Mhc class II
antigen binding site (Brown et al. 1988). Ab residues with high
variability (Kabat and Wu indices > 7.0) are depicted with solid fill,
residues with moderate variability (4.0 < V < 7.0) with grey fill, and
conserved residues (V = 1) in the antigen binding site segments only
are cross-hatched.

110

Statistical Analysis of the Nucleotide Substitutions Between Alleles of A/? Exon 2*
A0 Exon 2
Codons
Number of
Codons
% of Substitutions
d_ d„
s n
d „/d0
n' s
d„ - d„
n s
Whole exon
91
3.9 ± 0.6
9.7 ± 0.7
2.5
5.8
Non-antigen binding site
38
4.9 ± 1.3
4.1 ± 0.9
0.8
-0.8
Antigen binding site
42
3.7 ± 0.9
13.6 ± 1.4
3.7
9.9
Amino terminus
4
0.0 ± 0.0
1.5 ± 0.9
0.0
1.5
0-sheet 1
6
3.6 ± 2.2
34.9 ±9.4
9.7
31.3
0-turn 1
11
7.7 ± 1.4
1.9 ± 1.3
0.3
-5.4
0-sheet 2
6
11.2 ± 6.2
23.6 ± 7.2
2.1
12.4
0-turn 2
5
0.0 ± 0.0
0.8 ± 0.6
0.0
0.8
0-sheet 3
4
1.2 ± 1.5
18.4 ± 7.9
16.0
17.3
0-turn 3 / 0-sheet 4
15
3.4 ± 1.6
2.2 ± 1.1
0.7
-1.5
a-helix 1
10
19.9 ± 6.0
12.9 ± 3.5
0.7
-7.0
a-helix 2
14
6.0 ± 2.1
13.2 ± 2.8
2.2
7.2
a-helix 3
10
1.3 ± 0.6
16.7 ± 4.4
12.5
15.4
Carboxy terminus
6
1.4 ± 0.8
1.3 ± 1.0
0.9
-0.2
Contact amino acids
14
1.6 ± 0.6
35.4 ± 3.9
22.1
33.8
* - Mean number of nucleotide substitutions per synonymous (ds) and nonsynonymous (dn) sites,
expressed as percentages with their standard errors.
Ill

Figure 4-10. Plot of the frequencies of nonsynonymous mutations minus
the frequencies of synonymous mutations for the 11 Ab exon 2 segments;
NH3, amino terminus (5-8) ; BS1, /3-strand 1 (9-14) ; BT1, /3-turn 1 (15-
25); BS2, /3-sheet 2 (26-31); BT2, /3-turn 2 (32-36); BS3, p-sheet 3
(37-40); BT3, /3-turn 3 / /3-sheet 4 (37-55); AHI, a-helix 1 (56-65);
AH2, a-helix 2 (66-79), AH3, a-helix 3 (80-89); and COOH, carboxyl
terminus of the Abl domain (90-95).

40
(10)
ABS
SEGMENT
nh3
BS1
BT1
BS2
Ds
0.0
3.6
7.7
11.2
Dn
1.5
34.9
1.9
23.6
Dn-Ds
1.5
31.3
-5.4
12.4
i
Dn-Ds
BT2
BS3
BT3
AH1
AH2
AH3
COOH
0.0
1.2
3.4
19.9
6.0
1.3
1.4
0.8
18.4
2.2
12.9
13.2
16.7
1.3
0.8
17.2
-1.2
-7.0
7.2
15.4
-0.1^

114
set differ on average by 9.7% nonsynonymous substitutions.
This is in contrast to the average percentage of synonymous
changes between alleles, which is 3.9%. Since the majority
of substitutions in eukaryotic and prokaryotic genes are
synonymous, the ratio of nonsynonymous to synonymous
substitutions (dn/ds)can be used as a measurement of the
degree of diversifying selection. These data provide
evidence that Ab exon 2 is selectively diversified (dn/ds=
2.5). As illustrated in Table 4-6 and Figure 4-10 the
codons forming the antigen binding site are experiencing
more nonsynonymous substitutions and fewer synonymous
substitutions (dn/ds= 2.8) than non-antigen binding site
codons in exon 2 or any codons in exon 3 (dn/ds= 0.6 and
0.15, respectively). Analysis of each individual antigen
binding site segment separately shows, with the exception of
the a-helix 1 portion which has a very high frequency of
synonymous mutations, a much higher frequency of
nonsynonymous substitutions than synonymous substitutions.
This pattern is particularly apparent for the codons
predicted to encode amino acids that contact antigenic
fragments directly (dn/ds= 22.1)(Table 4-6)(Brown et al.
1988). These results strongly support the conclusion that
diversifying selection is predominantly responsible for
antigen binding site diversity.

115
Codon Deletions of the Abl Domain
The a-helix and carboxyl terminus segment of the Abl
domain occurs in 5 different lengths among the 48 Ab alleles
analyzed. In addition to the undeleted and 65/67 deletion
forms found in laboratory mouse strains (Choi et al. 1983;
Estess et al. 1988), alleles with codon deletions of
positions 65/67/72, 65/67/88-90, and 65/67/93 were detected
(Figures 4-7 and 4-11). The impact of these various codon
deletions on the structure of the antigen binding site may
not be equivalent. For instance, the deletions of amino
acids 65, 67, and 72 (the deletion of amino acid 72 was
• 5
found in only allele, MudoAb ) occur in the 5' section of
the a-helix, whereas the codon deletions of amino acids 88-
90, and 93 occur 3' the stabilizing disulfide bond, in the
segment connecting the Abl and Ab2 domains.
The codon deletions of amino acids 65, 67, and 72 would
be predicted to change the orientation of amino acids in the
a-helix segments adjacent to the deletions relative to the
undeleted alleles. Consequently, these codon deletions
should change the positions of some contact amino acids with
R groups orientated into the antigen binding site, thereby
profoundly modifying the interior structure of at least a
portion of the binding site. In addition, all the alleles
that do not delete amino acids 65 and 67, with the exception
of the MuplAb1 allele, have a proline residue at position
65. This would most likely introduce a kink into the a-

Figure 4-11. Hypothetical 3-dimensional model of the Mhc class II
antigen binding site as proposed by Brown et al. (1988) showing the
position of the amino acid deletions occurring in the a-helix and
carboxyl terminal segments.

117

118
helix structure. Thus, the two forms of a-helices have very
different structures, and most likely have some different
amino acid side chains facing into the interior of the
antigen binding site. To test the possibility that the
patterns of amino acid variability might change due to
strong diversifying selection acting on the contact amino
acids (Table 4-6), the variability of a-helix segments 1 and
2 from undeleted and 65/67 deleted alleles were measured
separately. As shown in Figure 4-12 and Table 4-7, 5
variable positions are unique to the undeleted alleles, and
3 variable positions are unique to the 65/67 deleted
alleles. The most striking difference between the two
alleles is at position 61 of the deleted alleles. The high
variability of position 61 suggests that the codon deletions
rotate the a-helix in such a manner that the side chain of
amino acid 61 becomes a contact amino acid, and, therefore
undergoes strong diversifying selection. Furthermore, amino
acid 56 is also uniquely diversified in the 65/67 deleted
alleles, additionally suggesting that the deletions change
the orientation of the a-helix further 5'. Overall, these
results indicate that diversifying selection operates on
different amino acid positions in these alleles of the a-
helix. This suggests that the codon deletions in the 5'
portion of the a-helix may change the position of some
contact amino acids, and consequently dramatically effect

Figure 4-12. Kabat and Wu variability plot of the a-helix segments 1
and 2 of undeleted alleles and alleles deleted at positions 65 and 67.
Arrows represent positions uniquely diversified for each a-helix
allele.

VARIABILITY
Y
AMINO ACID
to
o

121
Table 4-7
Kabat and Wu variability data for undeleted and amino acid
position 65, and 67 deleted alleles.
Kabat
and Wu Value
Amino Acid
Undeleted
65. 67 Deleted
Position
Alleles (15}
Alleles (33}
56
1.00
4.30*
57
3.46
6.35
58
2.14
3.81
59
1.00
1.00
60
2.14*
1.00
61
1.00
9.43*
62
1.00
1.00
63
1.00
1.00
64
1.00
1.00
65
2.14*
1.00
66
1.00
1.00
67
2.14*
1.00
68
1.00
1.00
69
1.00
1.00
70
2.14
3.96
71
3.46
2.13
72
1.00
3.30*
73
1.00
1.00
74
3.46
3.30
75
2.99
4.50
76
2.14*
1.00
77
2.14*
1.00
78
2.50
3.54
79
1.00
1.00
* - denotes uniquely diversified position for that a-helix
allele.

122
binding properties of the antigen binding site in a single
step.
The codon deletions at positions 88-90, and 93 probably
do not effect the a-helical structure of the antigen binding
site. This is predicted because these deletions occur 3'
the disulfide bond between amino acids 15 and 79 which
presumably anchors the a-helix to the ^-pleated sheet. In
addition, 80% (4/5) of the alleles deleted at position 93
have a proline residue just 5' which would probably act as
an a-helix breaker in this portion of the molecule.
However, the high frequency of alleles with deletions in the
carboxyl terminus of the Abl domain (12.5%), and the
presence of the deletion at position 93 in multiple species
ÍM. m. domesticus and M. specileaus) may suggest that
deletions in this portion of the molecule do have some
functional impact. Perhaps they subtly alter the plane of
the antigen binding site. Alternatively, these 3' deletions
may have no functional value to the molecule and may simply
be hitchhiking mutations.
It is interesting to note that the a-helix 3 and
carboxyl terminus segments of the Abl domain come in three
basic forms. These forms are dependent upon the position
and/or presence of a proline residue. The proline is found
either at position 86 or 89, and most likely acts to destroy
the a-helical structure 3' as the Abl domain extends toward
the Ab2 domain. On the other hand, 27% (13/48) of the

123
alleles do not have any proline residue in this section of
the molecule, thereby allowing a-helical secondary structure
to continue until the polypeptide connects with the Ab2
domain. Additionally, the a-helix 3 segment is extremely
polymorphic containing 2 of the 3 most diversified amino
acid positions (86, and 89) in Ab exon 2 (Figure 4-8, Table
4-5). Furthermore, this segment has undergone strong
diversifying selection (dn/ds= 12.5)(Figure 4-10, Table 4-
6). These results suggest that this portion of the molecule
can strongly influence antigen binding capacity and immune
responsiveness.
Nonconservative Amino Acid Substitutions in the Antigen
Binding Site
Protein parsimony analysis (Felsenstein 1988; 1989) was
used to obtain allelic lineages for each of the 6 defined
antigen binding site segments. Between 5 and 7 lineages
were discerned at each antigen binding site segment. The
most common motif was used as the prototypical lineage
motif, and was always found in multiple alleles (shown in
Tables 4-8 - 4-13). Comparisons of the prototypic motifs
from each lineage revealed that on average these allelic
forms differed by 32.4% ± 1.7% of their amino acids.
Surprisingly, 66.5% ± 3.6% of these substitutions result in
non-conservative amino acid changes (ie. changes between
acidic, basic, uncharged polar, or non-polar residues).

124
Table 4-8
Allelic lineages of the (3-pleated sheet 1 portion of the
antigen binding site containing amino acids 9-14.
Amino Acid Motif Number of Alleles
YQFKGE
1) QPF 8
A—QPF 1
H—QPF 1
V—QPF 1
2) A-L 8
A 1
3) F / 5
F-L 1
F-L—A 1
4) 3
V 2
H 2
5) —L 3
—LM— 1
6) A 3
SA 1
—L-SA 1
7) M— 1
MA- 1
F--Q-D 1
V-L-SF 1
V—FQ 1

125
Table 4-9
Allelic lineages of the ^-pleated sheet 2 portion of the
antigen binding site containing amino acids 26-31.
Amino Acid Motif Number of Alleles
LVTRYI
1) 12
C- 1
2) S-N 8
S 1
C-N 1
S-N-F- 1
3) —I f 6
4) S-D 5
A-D 1
5) Y 3
H 1
I 1
6) —S-N- 2
—A-N- 1
—S 1
S N- 1
Y N- 1
GL V
1

126
Table 4-10
Allelic lineages of the ^-pleated sheet 3 portion of the
antigen binding site containing amino acids 37-40.
Amino Acid Motif
Number of Alleles
YVRF
1)
W
13
W—Y
1
2)
-L—
13
3)
FM—
5
F
2
FL—
1
4)
4
L
1
5)
-L-Y
4
6)
Y
4

127
Table 4-11
Allelic lineages of the a-helix 1 portion of the antigen
binding site containing amino acids 56-65.
Amino Acid Motif Number of Alleles
PDAEYWNKQ*
1) S-P 13
-R S-P 1
-T—N—S-P 1
—G s-P 1
2) S Y 6
3) / 5
4) —P—Y 4
5) F 2
-Q F 2
S F 2
-T F 1
6) —V 3
HS 1
G 1
-E C 1

128
Table 4-12
Allelic lineages of the a-helix 2 portion of the antigen
binding site containing amino acids 66-79.
Amino Acid Motif Number of Alleles
Y * LERTRAE LDTVC
1) El V 10
EI v—A- 2
EI VNM— 1
EI 1
EI R 1
EI K—W 1
2) 13
p 1
* 1
3) Q 3
QK—AV 1
QK V 1
Q QV 1
q A- 1
4) y 5
A 2
2
1
5)

129
Table 4-13
Allelic lineages of the a-helix 3 portion of the antigen
binding site containing amino acids 80-89.
Amino Acid Motif Number of Alleles
RHNYEGTETP
1) P—H 11
P—S 1
-Y P—H 1
K-P—H 1
PG-H 1
S—H 1
2) v—H 8
V / 1
V—S 1
V—R 1
3) K 5
4) E—V- 6
-Y E—V- 2
5) L 3
Q-L 1
VL 1
R 1
ILI** 1
P-SY 1

130
These non-conservative amino acid changes would individually
be expected to cause sub-site alterations in chemical and
charge-distribution characteristics. This suggests that
antigen binding sites composed of different allelic segments
would possess highly divergent chemical properties. This is
illustrated in Figure 4-13A and B. These models distinguish
the chemical classification of the amino acids at each of
the most variable residues in the antigen binding site with
6 11
different fill patterns. MudoAb and MudoAb are two M. m.
domesticus alleles that share only one allelic segment of
the antigen binding site. These Ab alleles differ by 13
amino acid substitutions, and 10 of these substitutions are
non-conservative, indicating that they encode antigen
binding sites with fundamentally different structural (and
presumably binding) properties.
The Role of Intra-Exonic Recombination in Diversifying the
Antigen Binding Site
Inter-allelic "shuffling" of discrete antigen binding
site segments via intra-exonic recombination would be
predicted to produce recombinant alleles with antigen
binding site properties markedly different from either
parental allele. 41 of 48 alleles in the data set differ by
at least one antigen binding site allelic segment,
indicating that intra-exonic recombinational events have
been involved in the divergence of almost all the alleles.

131
An illustration of the effect of this recombination on the
antigen binding site structures is shown in Figure 4-13C.
MudoAb14represents an Ab lineage that could have been
produced by a single intra-exonic recombination between
parental alleles similar to MudoAb6 and MudoAb11
(recombinational breakpoint between BS3 and a-helix 1). As
a result of this single hypothetical recombinational event,
the antigen binding site of MudoAb14differs from those of
either parent by 6 amino acid substitutions (4 or 5 non¬
conservative) . Thus, intra-exonic recombination between
alleles composed of highly divergent antigen binding site
segments has the ability to rapidly create alleles with
unique antigen binding site characteristics. The extent of
diversity between allelic segments of the antigen binding
site coupled with the amount of intra-exonic recombination
detected among the alleles in the data set strongly suggests
that this mechanism has contributed greatly to the formation
of alleles with highly divergent functional properties.
The data discussed in this section support the view
that there has been positive selection for mutations that
create antigen binding site diversity. These mutations may
simply be point mutations in the nucleotide sequence that
may lead to a nonsynonymous substitution, and quite possibly
change the biochemical class of amino acid. Additionally,
mutations such as codon deletions and/or intra-exonic
recombination events can rapidly change the structure and

Figure 4-13. The binding site of three Mus musculus domesticus
alleles with different fill patterns representing the biochemical
class of amino acid. Cross-hatched depicts uncharged polar residues;
hatched, basic residues; densely dotted, nonpolar residues; sparsely
dotted, acidic residues; and solid fill represents deleted amino
acids. A) MudoAb6. B) MudoAb11. C) MudoAb14.

133
A

134

135
binding properties of the antigen binding site. All of
these mechanisms have interacted over evolutionary time to
create a diverse array of antigen binding sites in natural
mouse populations.
Serological Characterization of the Mhc Class II A Molecule
In an effort to examine the structural polymorphisms of
the Mhc class II A molecule, and attempt to map serological
epitopes on the Ab chain, a serological analysis employing
monoclonal antibodies was undertaken. A panel of twelve
monoclonal antibodies were used in the study. Five
monoclonal antibodies are reportedly specific for the Ab
chain, five monoclonal antibodies are specific for the Aa
chain, and two monoclonal antibodies either react with an
epitope determined by the interaction of both chains, or
have not been definitively mapped to react with either chain
(Oi et al. 1978; Pierres et al. 1980; 1981; Happier et al.
1981; Braunstein and Germain 1987). Table 4-14 presents the
12 monoclonal antibodies used in this study, and shows their
reactivity patterns with laboratory inbred strains of mice.
Mice
All the mice used in this study were from mouse colony
in the Tumor Biology Unit of the Department of Pathology and
Laboratory Medicine, University of Florida, or from our wild

136
Table 4-14
List of Monoclonal Antibodies Used to Analyze Structural
Polymorphisms of the A Molecule
MONOCLONAL ANTIBODY INBRED STRAIN REACTIVITY
40B
b, k, u, r, j, v
39H
^d, b, k. u, f
MKD6
jyjd, q, u, r, p, s, f, v, nod
25-9-17
Md.b,q.p.v
34-5-3
Md,b,q.p,v
10.2.16
Agk. u, r, j, s, t nod
40F
Mk'u,f
3 JP
Agb. k.q.u.r.p.j.^t.v
39 J
Aa^’
39F
Aak
K25-8.7
A(Jb, k, q, r, j, p, *, £, V
K24-199
Aad, j, f. v, nod

137
mouse colony, located at the Animal Care Facility,
University of Florida. The wild-derived mouse strains are
homozygous at the H-2 complex, and are maintained by sibling
matings. The wild-derived mice are from 2 sub-species of
Mus musculus; M. m. domesticus and M. m. musculus; and are
originally from diverse geographic origins. The mice
analyzed in this study are listed in Table 4-15.
Serological Characterization of the A Molecule
The two A molecule specific monoclonal antibodies, 40B
and 39H, can distinguish 3 alleles of the A molecule (Table
4-16) . The 5 Aa chain specific monoclonal antibodies, 3JP,
39J, 39F, K25-8.7, and K24-199 can distinguish 5 different
Aa alleles (Table 4-17). In addition, the monoclonal
antibodies 3JP and K25-8.7 appear to recognize the same or a
similar determinant on the Aa chain of the 28 strains
examined, because they have identical reactivity patterns.
The 5 Ab chain specific monoclonal antibodies, 10.2.16, 25-
9-17, 34-5-3, MKD6, and 40F can distinguish 8 different Ab
alleles (Table 4-18).
Mapping of Ab Specific Serological Epitopes
Three Ab specific monoclonal antibodies apparently map
to the same or similar epitope. 25-9-17 and 34-5-3 have the

138
Table 4-15
List of Strains Used in the Serological Analysis of the A
Molecule
STRAIN
SUB-SPECIES
GEOGRAPHICAL ORIGINS
C57/B6
M. m. dom.
laboratory inbred
BALB/C
M. m. dom.
laboratory inbred
BIO .M
M. m. dom.
laboratory inbred
B10.WB
M. m. dom.
laboratory inbred
B10.BR
M. m. dom.
laboratory inbred
C3H.NB
M. m. dom.
laboratory inbred
B10.6R
M. m. dom.
laboratory inbred
B10.RIII
M. m. dom.
laboratory inbred
A.SW
M. m. dom.
laboratory inbred
BIO.PL
M. m. dom.
laboratory inbred
B10.SM
M. m. dom.
laboratory inbred
NOD
M. m. dom.
laboratory inbred
NON
M. m. dom.
laboratory inbred
B10.CAA2
M. m. dom.
Michigan
B10.SAA48
M. m. dom.
Michigan
BUA 16
M. m. dom.
Michigan
DR1
M. m. dom.
Florida
JER1
M. m. dom.
Israel
JER4
M. m. dom.
Israel
AZROU2
M. m. dom.
Morocco
AZROU3
M. m. dom.
Morocco
ERFOUD1
M. m. dom.
Morocco
ERFOUD5
M. m. dom.
Morocco
METI
M. m. dom.
Yugoslavia
MET2
M. m. dom.
Yugoslavia
FAYIUM4
M. m. dom.
Egypt
BRN04
M. m. mus.
Czechoslavakia
VIBOURG7
M. m. mus.
Denmark

139
Table 4-16
Reactivity of A Molecule Specific Monoclonal Antibodies
STRAIN
MONOCLONAL
40B
ANTIBODY
39H
SUB
SPECIES
H-2
GEOGRAPHICAL
ORIGIN
BALB/C
+
+
dom
d
inbred
B6
+
+
dom
b
inbred
B10.BR
+
+
dom
k
inbred
BIO.PL
+
+
dom
u
inbred
B10.WB
+
+
dom
j
inbred
NON
+
+
dom
non
inbred
JER1
+
+
dom
Mudo16
Israel
JER4
+
+
dom
Mudo12
Israel
AZROU2
+
+
dom
Mudo17
Morocco
AZROU3
+
+
dom
Mud o 7
Morocco
METI
+ •?
+
dom
Mudo15
Yugoslavia
FAYIUM4
+
+
dom
Mudo10
Egypt
ERFOUD1
+
+
dom
Mudo9
Morocco
ERFOUD5
+
+
dom
Mudo6
Morocco
B10.CAA2
+
+
dom
Mudo 2
Michigan
BUA 16
+
+
dom
Mudo 6
Michigan
B10.SAA48
+
+
dom
Mudo4
Michigan
BIO.6R
_
—
dom
q
inbred
BIO .M
-
-
dom
f
inbred
C3H.NB
-
-
dom
p
inbred
A.SW
-
-
dom
s
inbred
NOD
-
-
dom
nod
inbred
MET2
-
-
dom
Mudo8
Yugoslavia
DR1
-
-
dom
Mudol
Florida
BRN04
-
-
mus
Mumu6
Czech.
VIBOURG7
-
-
mus
Mumul
Denmark
B10.RIII
+
—
dom
r
inbred
B10.SM
+
-
dom
V
inbred

140
Table 4-17
Reactivity of Aa Chain Specific Monoclonal Antibodies
STRAIN
MONOCLONAL
ANTIBODY
3 JP
39J 39F
K25-8.7
K24-199
C57/B6
+
-
-
+
—
B10.6R
+
-
-
+
—
BIO.PL
+
-
-
+
-
C3H.NB
+
-
-
+
-
B10.SM
+
-
-
+
-
NON
+
-
+
-
MET2
+
-
+
-
AZROU2
+
-
-
+
-
AZROU3
+
-
-
+
-
DR1
+
-
-
+
-
ERFOUD1
+
-
-
+
-
B10.CAA2
+
-
-
+
-
B10.SAA48
+
-
-
+
-
JER1
+
-
-
+
-
BRN04
+
-
-
+
-
VIBOURG7
+
—
—
+
—
BIO .M
+
—
—
+
+
B10.WB
+
-
-
+
+
JER4
+
-
-
+
+
ERFOUD5
+
-
-
+
+
BUA 16
+
—
—
+
+
B10.RIII
+
+
—
+
—
A.SW
+
+
-
+
-
METI
+
+
—
+
—
BALB/C
-
-
-
-
+
NOD
—
—
—
—
+
B10.BR
+
+
+
+
—
FAYIUM4
+
+
+
+
-

141
Table 4-18
Reactivity of A£ Chain Specific Monoclonal Antibodies
STRAIN MONOCLONAL ANTIBODY
10.2.16
25-9-17
34-5-3
MKD6
4 OF
B10.RIII
+
+
ERFOUD5
+
-
-
+
-
NOD
+
-
-
+
-
BUA 16
+
-
-
+
-
METI
+
—
+
—
BIO.PL
+
—
—
+
+
BIO .M
+
-
+
4-
NON
+
â– f!
-
+
+
AZROU3
+
—
—
+
+
A.SW
+
—
—
—
—
B10.WB
+
-
-
-
-
JER4
+
—
—
—
—
BIO.BR
+
—
—
—
+
FAYIUM4
+
—
—
—
+
BALB/C
—
+
+
+
-
B10.6R
-
+
+
+
-
B10.SM
-
+
+
+
-
C3H.NB
-
+
+
+
-
MET2
-
+
+
+
-
DR1
-
+
+
+
-
B10.SAA48
-
+
+
+
-
VIBOURG7
-
+
+
+
-
BRN04
—
+
+
+
—
B10.CAA2
—
+
+
—
—
C57/B6
-
+
+
-
-
AZROU2
—
+
+
—
—
JER1
-
+
+
+
+
ERFOUD1
+
+
+
+
+

142
same reactivity patterns. And these two monoclonal
antibodies, with the exclusion of the strain ERF0UD1, have
an antithetical relationship with the monoclonal antibody
10.2.16. The grouping of Ab alleles dependent upon these
monoclonal antibody reactivities illustrates that these
antibodies recognize the different alleles of the a-helix
(Figure 4-14). The 10.2.16+, 25-9-17", 34-5-3”alleles all
have the amino acid deletions at positions 65 and 67. In
direct contrast, alleles that are 10.2.16", 25-9-17+, and 34-
5-3+ are all undeleted, and have a proline at position 65.
Although it is impossible to definitively map where on the
a-helix these monoclonal antibodies bind, this data
illustrates that these monoclonal antibodies can distinguish
between two very different forms of the a-helix.
This data is consistent with that of Figueroa et al.
(1988) in comparing the 8 alleles in common with the two
analyses. Alleles that are 10.2.16+, 25-9-17”, and 34-5-3”
are H-2A.m27+ and H-2A.m25". Conversely the reciprocal is
observed, alleles that are 10.2.16”, 25-9-17+, and 34-5-3 +
are H-2A.m25+ and H-2A.m27”.
The epitopes for the other two Ab chain specific
monoclonal antibodies do not correlate with any structural
features encoded within Ab exon 2. Thus, the epitopes for
MKD6 and 4OF may map to the Ab2 domain, but this is highly
unlikely due to the limited phenotypic variability encoded
by this domain. Alternatively, it is possible the epitopes

Figure 4-14. The amino acid sequences of Ab exon 2 of the alleles
serologically analyzed. The sequences are grouped according to their
reactivity patterns with the monoclonal antibodies 10.2.16, 25-9-17,
and 34-5-3.

10.2.16- 25-9-17+ 34-5-3+
14 24 34 44 54 64 74 84 94
cons HFVYQFKGE CYFTNGTQRI RLVTRYIYNR EEYVRFDSDV GEYRAVTELG RPDAEYWNKQ *Y*LERIRAE LDTVCRHNYE GTETPXSLRR L
Ab*
Abrf
AbP
Ab“!
MudoAb^
MudoAb2
MudoAb-^
MudoAb^
MumuAb^
MumuAb6
T» „
—A-L
rci--
A L
-S-N
-S-N
—-A-L
--W-
S-'PEI
10.2.16+
25-9-17- 34-5-3-
V--A
V Y—
-P—H
-P—S
E—V
-V--H-
E—V
E—V
-P—H
-V--H
E—V
-V--H
At/
At/'
Abr
Ab1
--F
--H—QPF
A
—F
-S-D-
---I-
Abu
—LV--QPF -
AblwJ
H
MudoAb6
V FQ -
MudoAb2
MudoAb^
QPF -
MudoAb^2
A -
MudoAb^
A -
10.2.16+
25-9-17+ 34-5-3+
MudoAb*^
-QPF -
-S-D-
-Y---
-S N
---S-N
—L-Y-
—L—
—L—
--L
—L-Y-
--L-Y-
-F
-FM---
—L-Y-
P—Y
Y—
Y—-
-HS Y
P--Y
-S F—
P--Y
-V
K
p--H-
Q V--H-
y--- E—V—
A £—V--
V--H-
---Q V—S-
K
QK--A V P--H-
S—H-
QPF —Y A 1 FM -G Q---Q V-
4+
4+

145
recognized by these two monoclonal antibodies are dependent
upon Aa chain interaction, as opposed to strictly Ab encoded
polymorphisms. Finally their epitopes may have been
incorrectly mapped to the Ab chain.

CHAPTER V
DISCUSSION
The generation of Mhc polymorphism is a two step
process involving the production of variant alleles by
mutagenic events followed by subsequent selection and
maintenance. The alleles examined in this study have
survived this process. Additionally, by studying alleles
derived from multiple rodent species a clearer understanding
of the evolutionary processes involved in Mhc gene
diversification and selection can be elucidated.
Unfortunately, what cannot be ascertained by analyzing
alleles that have already undergone the processes of
selection and maintenance, is the spectrum of variants upon
which selection operates. Nevertheless, this can be
inferred by studying the patterns of diversification.
The Genetic Mechanisms of Mhc Gene Diversification
The results of this dissertation illustrate that variation
is introduced into single alleles predominantly by point
mutations, and, to a lesser extent, codon deletions. Novel
combinations of specific antigen binding site segments are
constantly being formed, albeit at a very slow rate, by
recombinational mechanisms. Thus, the extensive diversity
146

147
of Mhc class II Ab is generated by multi-step mutational
processes, incorporating both the retention of ancestral
polymorphisms and recombinational events.
The extent of recombination in the alleles examined in
this study conclusively illustrate its central role in the
diversification process over evolutionary time spans. The
exact recombinational mechanism employed was not addressed
by these experiments; although, the analysis does indicate
that site specific hyper-recombinational mechanisms are not
involved in this process. Either homologous recombination
or segmental exchange could be equally responsible for the
patterns of diversity observed. Analysis of DNA sequences
flanking Ab exon 2, such as Ab exon 3, and DNA segments in
Ab introns 1 and 2, indicate that in contrast to Ab exon 2,
the flanking sequence polymorphisms correlate with each
other and the retroposon polymorphism in intron 2 of Ab
(J.X. She unpublished observations). This strongly suggests
that segmental exchange events specific for Ab exon 2 are
responsible for the shuffling of allelic antigen binding
site segments.
Combinatorial Association of the Aa and Ab Chains
The extensive amino acid diversity of Ab exon 2
combined with the extent of recombination observed among the
alleles in the data set, make the hypothesis of co-evolution

148
of the Aa and Ab chains highly unlikely. This is even more
apparent when the diversity of the protein segments thought
to be responsible for chain association are considered. For
instance, there are 23 different forms of Ab ^-pleated sheet
1 among the alleles in the data set. An attempt to
correlate the allelic Ab BS1 forms with BS1 forms of the Aa
published sequences (Jones et a¿. 1990) reveals no
associations. Furthermore, there is very strong
diversifying selection acting on the Ab /3-pleated sheet 1
antigen binding site segment (dn/ds = 9.7) .
By examination of the hypothetical 3-dimensional model
of the Mhc class II antigen binding site (Brown et al.
1988), it is tempting to speculate a class II gene specific
interaction between the 3' segment of the Ab o-helix and the
5' segment of the Aa a-helix. Both regions have an
undefined tertiary structure based on the class I model.
However, there is also no correlation to be made between Ab
and Aa protein sequence polymorphisms in this region.
Additionally, there is also strong diversifying selection
acting on this Ab segment (dn/d, = 12.5).
These observations suggest that Mhc class II A molecule
subunit association is a more complex process than recent
experimental evidence outlined, and perhaps infers a more
central role for the invariant chain (Ii) in subunit
pairing. For instance, in pairs of chains that have a high
efficiency of association the role of the invariant chain to

149
stabilize the resultant molecule may be minimal. However,
in cases of lower chain association efficiency, possibly due
to nonsynonymous point mutations of critical chain pairing
residues or intra-exonic recombination, the role of the
invariant chain to pair subunits may become more critical to
subsequent cell surface expression. This scheme does raise
the question of the number of class II A molecules that may
be expressed on the cell surface of heterozygotes (either 2,
3, or 4 molecules). The answer may lie with each specific
heterozygote combination and the efficiency of each
individual chain to associate with others, and properly form
a functional molecule. This model presumes that all A
molecule subunit associations would occur more freely than
inter-isotypic pairing of class II molecule subunits.
Mhc Influence on Immune Responsiveness
The physiological role of Mhc molecules is to bind
fragments of processed antigen, thereby making them
recognizable to T lymphocytes (Shown in Figure 5-1). Mhc
class II molecules can influence immune responsiveness in 3
important ways. First, class II molecules must be able to
bind fragments of foreign antigen, to make them recognizable
to regulatory T lymphocytes. This interaction will
subsequently initiate a specific immune response toward the
foreign antigen. Mhc class II molecules are also the focal

Figure 5-1. A diagrammatic representation of the trimolecular T
lymphocyte activation complex comprised of the T cell receptor
molecule, antigen and the Mhc molecule. al, a2, a3, and b2 represent
the three class I chain regions and (32 microglobulin for class I
molecules (or the al, bl, a2, and b2 domains for class II molecules).
Adapted from Kumar et al. 1990.

rp
ra
> T-Cell Receptor
Antigen
MHC molecular
complex
Antigen-presenting cell
(APC)

152
point of regulatory T lymphocyte antigen receptor repertoire
selection events in the thymus. The T lymphocyte antigen
receptor must be able to interact in some manner with a
class II molecule in order to recognize bound antigenic
fragments. However, both the T cell receptor binding
regions and Mhc class II molecules are extremely variant
within a species, and are genetically unlinked loci. This
necessitates the individual selection of T lymphocytes
expressing antigen receptors that can interact with one's
class II molecules (positive selection), but will not react
•■ft
with one's class II molecule bound to fragments of self¬
antigen (negative selection)(Reviewed by Schwartz 1989).
Thus, the second way Mhc class II molecules can influence
immune responsiveness is through positive selection of the T
lymphocyte antigen receptor repertoire. And the third
immune response influencing mechanism is the presentation of
self-antigens leading to negative selection of the T cell
repertoire. Therefore, residues that determine antigen
binding (both self and non-self), and T lymphocyte contact
residues on the class II molecule (presumably on the a-
helix) can powerfully shape an individuals immune response
characteristics.

153
The Selective Maintenance of Antigen Binding Site Diversity
A variety of data indicates that Mhc polymorphism is
maintained by some type of balancing selection; although,
the precise mechanisms involved have remained controversial.
Overdominance (heterozygote advantage) and frequency-
dependent selection (rare allele advantage) have generally
been thought to be the most likely candidates of balancing
selection (Bodmer 1972; Hughes and Nei 1988).
The maintenance of Mhc polymorphisms by overdominance
is based on the experimental observation that Mhc-1inked
immune responsiveness is a dominant or co-dominant genetic
trait (Benacerraf and Germain 1978). Mhc heterozygotes are
capable of responding to any of the antigens recognized by
either parental haplotype, because Mhc molecules encoded by
both Mhc haplotypes are expressed on the surface of antigen
presenting cells. Therefore, immune response overdominance
proposes that the ability of Mhc heterozygotes to bind and
present a wider range of foreign antigens will enhance their
ability to resist infectious diseases, thereby increasing
their relative fitness in a population. The ability of
overdominant selection to maintain extensive polymorphisms
has been established by both theoretical treatments and
experimental observations (Nei 1987).
The hypothesis of rare allele advantage is based on the
idea that endemic pathogens, which evolve much more rapidly

154
than their endemic hosts, will tend to adapt their
antigenicity to minimize immune recognition by the most
prevalent Mhc genotypes in a population. Consequently, new
or rare Mhc alleles, whose immune response properties differ
from the common alleles, will have a possible selective
advantage due to increased resistance to the prevalent
pathogens. This type of selection predicts cyclic
fluctuations in the frequencies of Mhc alleles as pathogens
are driven to evolve their antigenicity toward evading the
immune response characteristics of prevalent Mhc alleles.
Thus, rare allele advantage leads to the maintenance of Mhc
polymorphisms by rescuing rare alleles from extinction.
There is no empirical evidence; however, to indicate that
this mode of selection operates to maintain Mhc
polymorphism.
Divergent Allele Advantage
The extensive structural diversity of the antigen
binding site of the Mhc class II Ab gene indicates that
another selective mechanism must be operating to
specifically maintain the vast array of highly divergent
alleles. This specific type of selection, termed divergent
allele advantage, may act in concert with the other forms of
balancing selection commonly thought to operate on Mhc genes
(Bodmer 1972; Zinkernagel and Dougherty 1974). All three
modes of selection would contribute to the maintenance of

155
Mhc polymorphisms, but divergent allele advantage would
preferentially favor the maintenance of highly divergent
alleles within populations.
The results of this dissertation clearly illustrate
that the various Ab allelic antigen binding sites have very
divergent structures. These structural polymorphisms
strongly impact on the functional properties of Mhc class II
molecules, and subsequently impact on immune responsiveness
to foreign antigen.
Immune Response Variation Between Divergent Mhc Alleles
Each Mhc class II allele has the capacity to bind and
present a varied yet specific set of peptides derived from
processed antigens. The inability of a specific class II
allele to bind and present a fragment from processed antigen
results in the loss of immune responsiveness for that
antigen in individuals homozygous for that Mhc allele (Buus
et al. 1987; Guillet et al. 1987). These Mhc-linked defects
in immune responsiveness, termed Ir gene defects, either
reflect the spectrum of peptides that are not bound by
products of specific Mhc genotypes, or reflect the
functional deletion of certain T lymphocytes with particular
antigen receptors during T lymphocyte ontogeny. If all the
Ir gene defects in a species were combined, they would
represent the immune response void for that species
(diagrammed in Figure 5-2). Endemic pathogens of that

Figure 5-2. A model illustrating a possible immunological basis
for divergent allele advantage. The immune response void for a
species exists within the large oval.


158
species would tend to evolve antigenicity focussed within
this void. Each Mhc allele would be capable of initiating
immune responses against a specific subset of the
antigenicity of the void. This concept is illustrated for 2
lineages of Mhc alleles in Figure 5-2. Mhc alleles with
highly divergent forms of the antigen binding site would
cover relatively unique sections of the void (ie. separate
patterns around LI (lineage 1 alleles) and L3 (lineage 3
alleles) in Figure 5-2). Alleles with similar antigen
binding sites and,,therefore, presumably binding properties,
would cover overlapping segments of the immune response void
(circles surrounding either LI or L3 in Figure 5-2).
Selection will consequently favor the maintenance of alleles
with highly divergent antigen binding sites because such
alleles will detect non-overlapping subsets of pathogen
antigenicity. Mhc class II molecules with antigen binding
sites altered by powerful single-step mutagenic events, such
as intra-exonic recombination between alleles composed of
highly divergent antigen binding site segments, and codon
deletions would be favored by selection. This is because
such novel alleles would detect segments of the immune
response void that do not overlap with those segments of the
void already covered by existing Mhc alleles.
Divergent allele advantage could interact
synergistically with overdominance, resulting in the
preferential maintenance of alleles with very different

159
antigen binding properties. Since immune response
overdominance is based on the enhanced capacity of Mhc
heterozygotes to respond to a greater spectrum of foreign
antigens, heterozygotes with alleles derived from different
lineages (L1/L3 as opposed to Ll/Ll1)could present a broader
array of antigenic peptides than two alleles derived form LI
or L3. Consequently, L1/L3 heterozygotes would be favored
over either Ll/Ll1 or L3/L31 heterozygotes and homozygotes.
Divergent allele advantage can interact with rare
allele advantage to maintain Mhc polymorphism by
preferentially favoring rare alleles with unique binding
properties. For example, consider a population in which LI
alleles are prevalent, the endemic pathogens will evolve
antigenicity that allows them to take advantage of the Ir
gene defects inherent in alleles of this lineage. As a
result, alleles in L3 would be more likely to have antigen
binding sites with properties capable of presenting newly
evolved antigens that exploit LI Ir defects than another
antigen binding site structurally related LI allele. Thus,
divergent allele advantage could interact with rare allele
advantage to preferentially maintain alleles with highly
divergent antigen binding traits.
Disease resistance is a multigenic trait, and
consequently the model described above represents a
simplification of host-pathogen interaction. In addition,
the Mhc is a tightly-linked multigenic family rather than a

160
single gene. This would tend to weaken the strength of
selection at any single locus. Nevertheless, the same model
would hold if the lineages of alleles depicted in Figure 5-2
were replaced with Mhc haplotypes.

LITERATURE CITED
Aberer, W., Stingl, L., Pogantsch, S., and Stingl, G. 1984.
J. Immunol. 133:792.
Acha-Orbea, H., and McDevitt, H.O. 1987. Proc. Natl. Acad.
Sci. USA 84:2435.
Adorini, L., Muller, S., Cardinaux, F., Lehmann, P.V.,
Falcioni, F., and Nagy, Z.A. 1988. Nature 334:623.
Adorini, L., and Nagy, Z.A. 1990. Immunol. Today 11:21.
Allen, P.M. 1987. Immunol. Today 8:270.
Allen, P.M., Babbitt, B.P., and Unanue, E.R. 1987.
Immunol. Rev♦ 98:171.
Arden, B., and Klein, J. 1982. Proc. Natl. Acad. Sci. USA
79:2342.
Babbitt, B.P., Allen, P.M., Matsueda, G., Haber, E., and
Unanue, E.R. 1985. Nature 317:359.
Babbitt, B.P., Matsueda, G., Haber, E., Unanue, E.R., and
Allen, P.M. 1986. Proc. Natl. Acad. Sci. USA
83:4509.
Baltimore, D. 1981. Cell 24:592.
Benacerraf, B. 1978. J. Immunol. 120:1809.
Benacerraf, B., and Germain, R.N. 1978. Immunol. Rev.
38:70.
Benacerraf, B., and McDevitt, H.O. 1972. Science 175:273.
Benoist, C.O., Mathis, D.J., Kanter, M.R., Williams, V.E.,
and McDevitt, H.O. 1983a. Proc. Natl. Acad. Sci.
USA 80:534.
Benoist, C.O., Mathis, D.J., Kanter, M.R., Williams, V.E.,
and McDevitt, H.O. 1983b. Cell 34:169.
Berzofsky, J.A., Brett, S.J., Streicher, H.Z., and
Takahashi, H. 1989. Immunol. Rev. 106:5.
161

162
Bjorkman, P.J., Saper, M.A., Samraoui,
Strominger, J.L., and Wiley, D.C.
329:506.
B., Bennett, W.S.,
1987a. Nature
Bjorkman, P.J., Saper,
Strominger, J.L.,
329:512.
M.A., Samraoui, B., Bennet, W.S.,
and Wiley, D.C. 1987b. Nature
Bodmer, W.F. 1972. Nature 237:139.
Bonhomme, F. 1986a. The Wild Mouse in Immunology. p. 19.
Potter, M., Nadeau, J.H., and Cancro, M.P., eds.,
Springer-Verlag, New York.
Bonhomme, F. 1986b. Modern Aspects of Species. p. 125.
Iwatsuki, K., Raven, P.H., and Bock, W.J., eds.,
University of Tokyo Press, Tokyo.
Bonhomme, F., Iskander, D., Thaler, L., and Petter, F.
1984. Evolutionary Relationships Among Rodents: A
Multidisciplinary Analysis. p. 671. Luckett, W.P.,
and Hartenberger, J.L., eds., Plenum Press, New York.
Braunstein, N.S., and Germain, R.N. 1987. Proc. Natl.
Acad. Sci. USA 84:2921.
Brown, J.H., Jardetzky, T., Saper, M.A., Samraoui, B.,
Bjorkman, P.J., and Wiley, D.C. 1988. Nature
332:845.
Bruell, J.H. 1970. Contributions to Behavior-Genetic
Analysis. p. 261. Lindzey, G., and Thiessen, D.D.,
eds., Appleton, New York.
Buerstedde, J.M., Pease, L.R., Nilson, A.E., Bell, M.P.,
Chase, C. , Buerstedde, G., and McKean, D.J. 1988. J^.
Exp. Med. 168:823.
Buus, S., Colon, S., Smith, C., Freed, J., Miles, C., and
Grey, H.M. 1986a. Proc. Natl. Acad. Sci. USA
83:3968.
Buus, S., Sette, A., Colon, S.M., Jenis, D.M., and Grey,
H.M. 1986b. Cell 47:1071.
Buus, S., Sette, A., and Grey, H.M. 1987. Immunol. Rev.
98:115.
Choi, E., McIntyre, K., Germain, R.N., and Seidman, S.G.
1983. Science 221:283.

163
Davis, M.M., Cohen, D.I., Nielsen, E.A., Steinmetz, M.A.,
Paul, W.E., and Hood, L. 1984. Proc. Natl. Acad. Sci.
USA 81:2194.
David, C.S., and Shreffler, D.C. 1974. Transplantation
17:462.
Dembic, Z., Singer, P.A., and Klein, J. 1984. EMBO J.
3:1647.
Dorf, M.E., and Benacerraf, B. 1975. Proc. Natl. Acad.
Sci. USA 72:3671.
Duncan, W.R., Wakeland, E.K., and Klein, J. 1979a.
Immunogenetics 9:261.
Duncan, W.R., Wakeland, E.K., and Klein, J. 1979b. Nature
281:603.
Eccles, P., and McMaster, W.R. 1985. Immunogenetics
22:653.
Estess, P., Begovich, A.B., Koo, M., Jones, P.P., and
McDevitt, H.O. 1986. Proc. Natl. Acad. Sci. USA
83:3594.
Fachet, J., and Ando, I. 1977. Eur. J. Immunol. 7:223.
Fathman, C.G., and Kimoto, M. 1981. Immunol. Rev. 54:57.
Felsenstein, J. 1988. Ann. Rev. Genet. 22:521.
Felsenstein, J. 1989. PHYLIP 3.2 Manual University of
California, Berkely.
Ferris, S.D., Sage, R.D., Prager, E.M., Ritte, U., and
Wilson, A.C. 1983. Genetics 105:681.
Ferris, S.D., Sage, R.D., and Wilson, A.C. 1982. Nature
295:163.
Figueroa, F., Gunther, E., and Klein, J. 1988. Nature
335:265.
Flaherty, L. 1980. The Role of the Major
Histocompatibility Complex in Immunology. Dorf, M.E.
ed., Garland, New York, p.33.
Garrett, T.P.J., Saper, M.A., Bjorkman, P.J., Strominger,
J.L., and Wiley, D.C. 1989. Nature 342:692.

164
Geliebter, J., and Nathenson, S.G. 1987. Trends in Genet.
11:107.
Germain, R.N. 1988. Cell 54:441.
Germain, R.N., Bently, D.M., and Quill, H. 1985. Cell
43:233.
Gorer, P.A. 1936. Br. J. Exp. Pathol. 17:42.
Gorer, P.A. 1938. J. Pathol. Bacteriol. 47:231.
Gorga, J.C., Dong, A., Manning, M.C., Woody, R.W., Caughey,
W.S., and Strominger, J.L. 1989. Proc. Natl. Acad.
Sci. USA 86:2321.
Gotze, D., Nadeau, J., Wakeland, E.K., Berry, R.J.,
Bonhomme, F., Egorov, J.K., Hirth, J.P., Hoogstraal,
H., Vives, J., Winking, H., and Klein, J. 1980. J.
Immunol. 124:2675.
Guillet, J.G., Lai, M.Z., Briner, T.J., Buus, S., Sette, A.,
Grey, H.M., Smith, J.A., and Gefter, M.L. 1987.
Science 235:865.
Gyllensten, U.B., and Erlich, H.A. 1989. Proc. Natl. Acad.
Sci. USA 86:9986.
Haber-Katz, E., Hamsburg, D., and Schwartz, R.H. 1983. J.
Mol. Cell. Immunol. 1:3.
Hadi, J.R., Stafford, E.E., Sukaeri, F., and Riberu, W.
1976. Southeast Asian J. Trop. Med. Public Health
7:487.
Hamajima, F. 1962. Kyushu Daioaku Nooakubu Gakuqei Zasshi
20:61.
Harding, C.V., Roof, R.W., and Unanue, E.R. 1989. Proc.
Natl. Acad. Sci. USA 86:4230.
Harrison, J.L. 1955. Proc. Zool. Soc. London 125:445.
Hood, L., Steinmetz, M., and Goodenow, R. 1982. Cell
28:685.
Hughes, A.L., and Nei, M. 1988. Nature 335:167.
Hughes, A.L., and Nei, M.
86:958.
1989
Proc. Natl. Acad. Sci. USA

165
Hurme, M., Chandler, P.R., Heterington, C.M., and Simpson,
E. 1978. J. Exp. Med. 147:768.
Jones, J.K. Jr., and Johnson, D.H. 1965. Univ. Kans.
Publ.. Mus. Nat. Hist. 16:357.
Jones, P.P. 1977. J. Exp. Med. 146:1261.
Jones, P.P., Begovich, A.B., Tacchini-Cottier, F.M., and Vu,
T.H. 1989. Immunological Research Long, E., ed. (in
press).
Jones, P.P., Murphy, D.B.,
1979. Mol. Immunol.
Hewgill, D., and McDevitt, H.O.
16:51.
Jones, P.P., Murphy, D.B., and McDevitt, H.O.
Exp. Med. 148:925.
1978. J.
Jones, P.P., Murphy, D.B., and McDevitt, H.O.
Immunogenetics 12:321.
1981.
Kappler, J.W., Skidmore, B., White, J., and Marrack, P.
1981. J. Exp. Med. 153:1198.
King, D.P., and Jones P.P. 1983. J. Immunol. 131:315.
Klein, J. 1974. Ann. Rev. Genet. 8:63.
Klein, J. 1975. Biology of the Mouse Histocompatibilitv-2
Complex Springer-Verlag, New York.
Klein, J. 1980. Immunology 80 Fougereau, M., and Dausset,
J. eds. Academic Press, London.
Klein, J. 1986. Natural History of the Major
Histocompatibility Complex Wiley, New York.
Klein, J. 1987. Human Immunology
Klein, J. and Figueroa, F. 1981.
Klein, J. and Figueroa, F. 1986.
Immunology 6:295.
Klein, J., Figueroa, F., and Nagy,
Immunol. 1:119.
Kobori, J.A., Strauss, E., Minard,
Science 234:173.
19:155.
Science 703:516.
CRC Critical Review in
Z. 1983b. Ann. Rev.
K., and Hood, L. 1986.
Kobori, J.A., Winoto, A., McNicholas, J., and Hood, L.
1984. J. Mol. Cell. Immunol. 1:125.

166
Koch, N., Wong, G.H.W., Schrader, J.W. 1984. J. Immunol.
132:1361.
Kumar, V. , Kono, D.H., Urban, J.L., and Hood, L. 1990.
Ann. Rev. Immunol. 7:657.
Lafuse, W.P., and David, C.S. 1986. Immunogenetics
24:352.
Lanzavecchia, A. 1985. Nature 314:537.
Larhammer, D., Hammerling, U., Denaro, M., Lund, T.,
Flavell, R.A., Rask, L., and Peterson, P.A. 1983a.
Cell 34:179.
Larhammer, D., Hyldig-Nielsen, J.J., Servenius, B.,
Andersson, G., Rask, L., and Peterson, P.A.
1983b. Proc. Natl. Acad. Sci. USA 80:7313.
Lassila, 0., Vainio, 0., and Matzinger, P. 1988. Nature
334:253.
Lawlor, D.A., Ward, F.E., Ennis, P.D., Jackson, A.P., and
Parham, P. 1988.
Nature
335:
268.
Lieberman, R., Paul, W.E
1972. J. Exp. Med.
., Humphrey,
136:1231.
W. ,
Stimphling, J.H.
Little, C.C, and Tyzzer,
E.E.
1916.
J.
Med. Res. 33:393.
Lorenz, R.G., and Allen,
USA 85:5220.
P.M.
1988.
Proc. Natl. Acad. Sci
Lorenz, R.G., and Allen,
P.M.
1989.
Immunol. Rev.
106:115.
Lozner, E.C., Sachs, D.H., and Shearer, G.M. 1974. J. Exp.
Med. 139:1204.
Lu, C.C., Ye, Y., She, J.X., and Wakeland, E.K. 1990.
(manuscript in preparation).
Luckett, W.P., and Hartenberger, J.L. 1985. Evolutionary
Relationships Among Rodents. A Multi-Disciplinary
Approach. Plenum Press, New York.
Malissen, M., Hunkapiller, T., and Hood, L. 1983. Science
221:283.
Maniatis, T., Fritsch, E.F., and Sambrook, J. 1982. Cold
Spring Harbor Laboratory, Cold Spring, New York.

167
Marshall,
J.T.
1977.
Bull. Am.
Mus. Nat. Hist. 158:177
Marshall,
J.T.
1981.
The Mouse
in Biomedical Research.
Vol.
I.
p. 17.
Foster, H.
L., Small, J.D., and Fox,
J.G., eds., Academic Press, New York.
Marshall, J.T. 1986. The Wild Mouse in Immunology. p. 12.
Potter, M., Nadeau, J.H., and Cancro, M.P., eds,
Springer-Verlag, New York.
Mathis, D.J., Benoist, C.O., Williams, V.E., Kanter, M.R.,
and McDevitt, H.O. 1983. Cell 32:745.
Mayer, W.E., Jonker, M., Klein, D., Ivanyi, P., van
Seventer, G., Klein, J. 1988. EMBO J. 7:2765.
McConnell, T.J., Talbot, W.S., Mclndoe, R.A.,
E.K. 1988 Nature 332:651.
and Wakeland,
McDevitt, H.O., Deak, B.D., Schreffler,
Stimpfling, J.H., and Snell, G.D.
122:517.
D.C., Klein, J.,
1972. J. Exp. Med.
McDevitt, H.O., and Sela, M. 1965. J. Exp. Med. 122:517.
McIntyre, K., and Seidman, J. 1984. Nature 308:551.
McNicholas, J., Steinmetz, M., Hunkapillar, T., Jones, P.,
and Hood, L. 1982. Science 218:1229.
Melchers, I., Rajewsky, K., Schreffler, D.C. 1973. Eur. J.
Immunol. 3:754.
Mellor, A.L., Weiss, A.H., Ramachandran, K., and Flavell,
R.A. 1983. Nature 306:792.
Mengle-Gaw, L., Conner, S., McDevitt, H.O., and Fathman,
C.G. 1984. J. Exp.Med. 160:1184.
Mengle-Gaw, L., and McDevitt, H.O. 1983. Proc. Natl. Acad.
Sci. USA 80:7621.
Mengle-Gaw, L., and McDevitt, H.O. 1985. Ann. Rev.
Immunol. 3:367.
Michealson, J., Boyse, E.A., Chorney, M., Flaherty, L.,
Fleisner, I., Hammerling, U., Reinisch, C., Rosenson,
R. , and Shen, F-W. 1983. Transplantation Proc.
15:2033.

168
Mond, J.J., Kessler S., Kung, J., and Finkelman, F.D. 1981.
J. Immunol. 127:881.
Monroe, J.G., and Cambier, J.C. 1983. J. Immunol.
130:626.
Muller, U., Jongeneel, C.V., Nedospasov, S.A., Fisher
Lindahl, K., and Steinmetz, M. 1987. Nature 325:265.
Murphy, D.B., Herzenberg, L.A., Okumura, K., and McDevitt,
H.O. 1976. J. Exp. Med. 144:699.
Murphy, D.B., Jones, P.P., Loken, M.R., and McDevitt, H.O.
1980. Proc. Natl. Acad. Sci. USA 77:5404.
Nadeau, J.H., Wakeland, E.K., Gotze, D., and Klein, J.
1981. Gen. Res. Camb. 37:17.
Nathenson, S.G., Geliebter, J., Pfaffenbach, G.M., and Zeff,
R.A. 1986. Immunol. Rev. 4:471.
Nei, M. 1987. Molecular Evolutionary Genetics Columbia
University Press, New York.
Nei, M., and Jin, L. 1989. Mol. Biol. Evol. 6:290.
Nizetic, D., Figueroa, F., and Klein, J. 1984.
Immunogenetics 19:311.
Noelle, R., Krammer, P.H., Ohara, J., Uhr, J.W., and
Vitetta, E.S. 1984. Proc. Natl. Acad. Sci. USA
81:6149.
Oi, V.T., Jones, P.P., Goding, J.W., Herzenberg, L.A., and
Herzenberg, L.A. 1978. Curr. Top. Microbiol. Immunol.
7:115.
Parham, P., Lawlor, D.A., Lomen, C.E., and Ennis, P.D.
1989. J. Immunol. 142:3937.
Paulnock-King, D., Sizer, K.C., Freund, Y.R., Jones, P.P.,
and Parnés, J.R. 1985. J.Immunol. 135:632.
Pease, L.R. 1985. Transplantation 39:227.
Pernis, B. 1985. Immunol. Today 6:45.
Petrov, B. 1979. Folia Zool. 28:13.
Pierres, M., Devaux, C., Dosseto, M., and Marchetto, S.
1981. Immunogenetics 14:481.

169
Pierres, M., Kourilsky, F.M., Rebouah, J.P., Dossetto, M.,
and Caillol, D. 1980. Eur. J. Immunol. 10:950.
Polla, B.S., Poljak, A., Ohara, J., Paul, W.E., and
Glimcher, L.H. 1986. J. Immunol. 13:3337.
Radding, C.M. 1978. Ann. Rev. Biochem. 47:847.
Ria, F., Chan, B.M.C., Scherer, M.T., Smith, J.A., and
Gefter, M.L. 1990. Nature 343:381.
Rich, S.S., David, C.S., and Rich, R.R. 1979a. J. Exp.
Med. 149:114.
Rich, R.R., Sudberry, D.A., Kastner, D.L., and Chu, L.
1979b. J. Exp. Med. 150:1555.
Robertson, M. 1982. Nature 297:629.
Roehm, N.W., Leibson, H.J., Zlotnik, A., Kappler, J.,
Marrack, P., and Cambier, J.C. 1984. J. Exp. Med.
160:679.
Roy, S., Scherer, M.T., Briner, T.J., Smith, J.A., and
Gefter, M.L. 1989. Science 244:572.
Sage, R.D. 1981. The Mouse in Biomedical Research. Vol. I.
Foster, H.L., Small, J.D., and Fox, J.G., eds.,
Academic Press, New York.
Saha,
B.K., and Cullen,
S.E.
1986a.
J.
Immunol.
136:1112.
Saha,
B.K., and Cullen,
S.E.
1986b.
J.
Immunol.
137:4004.
Saiki,
R.K., Scharf, S.
, Faloona, F.,
Mullis, K.B.
, Horn,
G.T., Erlich, H.A., and Arnheim, N. 1985. Science
230:1350.
Saito, H., Maki, R.A., Clayton, L.K., Tonegawa, S. 1983.
Proc. Natl. Acad. Sci. USA 80:5520.
Saitou, N., and Nei, M. 1987. Mol. Biol. Evol. 4:406.
Sant, A.J., and Germain, R.N. 1989. Cell 57:797.
Schwartz, R.H. 1985. Ann. Rev. Immunol. 3:237.
Schwartz, R.H. 1989. Cell 57:1073.
She, J.X., Bonhomme, F., Boursot, P., Thaler, L., and
Catzeflis, F. 1989. Biol. J. Linn. Soc. (in press).

170
Shiroishi, T., Sagai, T., and Moriwaki, K. 1982. Nature
300:370.
Slightom, J.,
21:627.
Blechl,
A. E. ,
and
Smithies, 0.
1980.
Cell
Snyder, D.S.,
299:163.
Beller,
D.I. ,
and
Unanue, E.R.
1982.
Nature
Sokal, R.R., and Sneath, P.H.A. 1963. Principles of
Numerical Taxonomy Freeman Press, San Fransisco.
Srivastva, S.P., and Wattel, B.L. 1973. Indian J. Entomol.
35:306.
Steeg, P.S., Moore, R.N., Johnson, H.M., and Oppenheim, J.J.
1982. J. Exp. Med. 156:1780.
Steinman, R.M., Nogueira, N., Witmer, M.D., Tydings, J.G.,
and Mellman, I.S. 1980. J. Exp. Med. 152:1248.
Steinmetz, M., Malissen, M., Hood, L., Orn, A., Maki, G.R.,
Dastoornikoo, G.R., Stephan, D., Gibb, E., and
Romaniuk, R. 1984. EMBO J. 3:2995.
Steinmetz, M., Minard, K., Horvath, S., McNicholas, J.,
Frelinger, J., Wake, C., Long, E., Mach, B., and Hood,
L. 1982b. Nature 300:35.
Steinmetz, M., Frelinger, J.G., Fisher, D., Hunkapillar, T.,
Pereira, D., Weissman, S.M., Uehara, H., Nathenson, S.,
and Hood, L. 1982a. Cell 24:125.
Steinmetz, M., Stephan, D., and Fisher Lindahl, K. 1986.
Cell 44:895.
Steinmetz, M., and Uematsu, Y. 1987. H-2 Antigens. Genes.
Molecules. Function. David, C.S., ed., Plenum Press,
New York.
Steinmetz, M., Uematsu, Y., and Fisher Lindahl, K. 1987.
Trends in Genet. 3:7.
Sung, E., and Jones, P.P. 1981. Mol. Immunol. 18:899.
Tacchini-Cottier, F.M., and Jones, P.P. 1988. J. Immunol.
141:3647.
Tarnuzzer, R.W. 1988. The Influence of Recombination on
the Diversification of the Murine I Region.

171
Uematsu, Y., Fisher Lindahl, K., and Steinmetz, M. 1986.
EMBO J. 5:2123.
Unanue, E.R., and Allen, P.M. 1987. Science 236:551.
Vu, T.H., Begovich, A.B., Tacchini-Cottier, F.M., and Jones,
P.P. 1989. J. Immunol. 142:2936.
Vu, T.H., Tacchini-Cottier, F.M., Day, C.E., Begovich, A.B.,
and Jones, P.P. 1988. J. Immunol. 141:3645.
Wakeland, E.K., and Darby, B.R. 1983. J. Immunol.
131:3052.
Wakeland, E.K., and Klein, J. 1979. Immunogenetics 8:27.
Wakeland, E.K., and Klein, J. 1983. J. Immunol. 130:1280.
Wakeland, E.K., Price-Laface, M., Henson, V., and Peck, A.B.
1987. Immunogenetics 26:115.
Weiss, E.H., Mellor, A., Golden, L., Fahrner, K., Simpson,
E., Hurst, J., and Flavell, R.A. 1983. Nature
301:671.
Werdelin, O., Mouritsen, S., Laub Petersen, B., Sette, A.,
and Buus, S. 1988. Immunol. Rev. 106:181.
Widera, G., and Flavell, R.A. 1985. Proc. Natl. Acad. Sci.
USA 82:5500.
Winoto, A., Steinmetz, M., and Hood, L. 1983. Proc. Natl.
Acad. Sci. USA 80:3425.
Wu, T.T., and Kabat, E.A. 1970. J. Exp. Med. 132:211.
Zinkernagel, R.M. 1979. Ann. Rev. Microbiol. 33:201.
Zinkernagel, R.M., and Doherty, P.C. 1974. Nature
251:547.

BIOGRAPHICAL SKETCH
Stefen A. Boehme was born on September 18, 1962, in
Englewood, New Jersey. He grew up with his family in the
northern New Jersey suburb of River Vale. After graduating
from Pascack Valley High school in 1980, he attended
Muhlenberg College in Allentown, Pennsylvania, and earned a
Bachelor of Science degree in biology in 1984. He began the
graduate program in the Department of Pathology and
Laboratory Medicine at the University of Florida in August
of 1984. He received his Doctor of Philosophy degree from
the Department of Pathology and Laboratory Medicine at the
University of Florida in 1990.
172

I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
dissertation for the degree of Doctor of Philosophy.
Edward K. Wakeland, Chairman
Professor of Pathology and
Laboratory Medicine
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor grf Philosophy.
William HaustfiVth
Professor of Immunology and
Medical Microbiology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
¿m Au. 72ccá
Harry Nic$!
Associate Professor of
Biochemistry and Molecular Biology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
Linda J. Smith
Assistant Professor of Pathology
and Laboratory Medicine

I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
Howard M. Johnson
Graduate Research Professor of
Pathology and Laboratory Medicine
This dissertation was submitted to the Graduate Faculty
of the College of Medicine and to the Graduate School and
was accepted as partial fulfillment of the requirements for
the degree of Doctor of Philosophy.
August, 1990
Dean, Graduate School

UNIVERSITY OF FLORIDA
3 1262 08554 4046



UNIVERSITY OF FLORIDA
3 1262 08554 4046



PAGE 1

7+( *(1(5$7,21 2) $17,*(1 %,1',1* 6,7( ',9(56,7< ,1 7+( 085,1( 0+& &/$66 ,, $ %(7$ 02/(&8/( %\ 67()(1 $ %2(+0( $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

, ZRXOG OLNH WR GHGLFDWH WKLV GLVVHUWDWLRQ WR WKH WKUHH SHRSOH ZKRVH DOWUXLVWLF ORYH VXSSRUW DQG HQFRXUDJHPHQW PDGH WKLV ZRUN SRVVLEOH .DWK\ 0RP DQG 'DG IURP WKH ERWWRP RI P\ KHDUW WKDQN \RX DQG ORYH \RX *RG EOHVV \RX

PAGE 3

$&.12:/('*(0(176 )LUVW DQG IRUHPRVW ZRXOG OLNH WR WKDQN P\ PHQWRU 'U :DUG :DNHODQG IRU KLV JXLGDQFH SDWLHQFH DQG IULHQGVKLS GXULQJ P\ WHQXUH DV KLV VWXGHQW ZRXOG DOVR OLNH WR H[SUHVV P\ WKDQNV WR P\ FRPPLWWHH PHPEHUV 'UV 6PLWK -RKQVRQ 1LFN DQG +DXVZLUWK IRU WKHLU DVVLVWDQFH DQG HQFRXUDJHPHQW $GGLWLRQDOO\ FHUWDLQO\ DSSUHFLDWHG WKH VXSSRUW DQG KHOS IURP WKH IDFXOW\ PHPEHUV RI WKH 'HSDUWPHQW RI 3DWKRORJ\ DQG /DERUDWRU\ 0HGLFLQH )XUWKHUPRUH VLQFHUHO\ WKDQN /L] VRRQ WR EH HYHQ PRUH ERUHGf :LONHUVRQ 5RVH /LOn 3RUN FKRSf 0LOOV DQG &U\VWDO WKDQNV IRU MXVW EHLQJ \RXf *ULPHV IRU PDNLQJ P\ OLIH HDVLHU DQG ZHOO GHOLYHUHG GRVHV RI VDQLW\ DOVR ZRXOG OLNH WR ZLVK WKH :DNHODQG ODERUDWRU\ FRQWLQXHG VXFFHVV LQ LWV VFLHQWLILF HQGHDYRUV $GGLWLRQDOO\ ZDQW WR WKDQN 'UV 0F&RQQHOO +HQVHQ 7DUQX]]HU =DFN 3RWWV DQG 6KH DQG VRRQ WR EH 'UV /X DQG 0FOQGRH IRU DOO WKHLU KHOS DQG DVVLVWDQFH LLL

PAGE 4

)LQDOO\ ZLVK WR WKDQN P\ SHHUV ZKR EURXJKW OLIH LQWR ODE 2I SDUWLFXODU QRWRULHW\ DUH 5R\ 7DUQX]]HU -DQH *LEVRQ /HQD 'LQJLHU 5LFN 0FOQGRH /HH *ULPHV -HII $QGHUVRQ /LQGD
PAGE 5

7$%/( 2) &217(176 3DJH $&.12:/('*(0(176 LLL $%675$&7 YLL &+$37(5 ,1752'8&7,21 &+$37(5 ,, 5(9,(: 2) 7+( /,7(5$785( *HQRPLF 2UJDQL]DWLRQ RI WKH 0DMRU +LVWRFRPSDWLELOLW\ &RPSOH[ *HQHUDWLRQ RI 0KF &ODVV ,, *HQH 3RO\PRUSKLVP )XQFWLRQDO 5ROH RI 0KF 3RO\PRUSKLVP :LOG 0LFH &+$37(5 ,,, 0$7(5,$/6 $1' 0(7+2'6 ,VRODWLRQ RI *HQRPLF '1$ 3RO\PHUDVH &KDLQ 5HDFWLRQ $PSOLILFDWLRQ &ORQLQJ DQG 6HTXHQFLQJ 6SOHHQ &HOO ,VRODWLRQ ,PPXQRVWDLQLQJ DQG )ORZ &\WRPHWULF $QDO\VLV 'DWD $QDO\VLV &+$37(5 ,9 5(68/76 7KH *HQHUDWLRQ RI 0KF &ODVV ,, $#B *HQH 3RO\PRUSKLVP LQ 5RGHQWV 7KH ,PSDFW RI 0KF &ODVV ,, $e *HQH 3RO\PRUSKLVPV RQ WKH 6WUXFWXUH RI WKH $QWLJHQ %LQGLQJ 6LWH 6HURORJLFDO &KDUDFWHUL]DWLRQ RI WKH 0KF &ODVV ,, $ 0ROHFXOH &+$37(5 9 ',6&866,21 7KH *HQHWLF 0HFKDQLVPV RI 0KF *HQH 'LYHUVLILFDWLRQ &RPELQDWRULDO $VVRFLDWLRQ RI WKH $J DQG $e &KDLQV 0KF ,QIOXHQFH RQ ,PPXQH 5HVSRQVLYHQHVV 7KH 6HOHFWLYH 0DLQWHQDQFH RI $QWLJHQ %LQGLQJ 6LWH 'LYHUVLW\ Y

PAGE 6

/,7(5$785( &,7(' %,2*5$3+,&$/ 6.(7&+ 9O

PAGE 7

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ 7+( *(1(5$7,21 2) $17,*(1 %,1',1* 6,7( ',9(56,7< ,1 7+( 085,1( 0+& &/$66 ,, $ %(7$ 02/(&8/( %\ 6WHIHQ $ %RHKPH $XJXVW &KDLUPDQ (GZDUG :DNHODQG 0DMRU 'HSDUWPHQW 3DWKRORJ\ DQG /DERUDWRU\ 0HGLFLQH 7KH JHQHWLF SRO\PRUSKLVP RI WKH PXULQH PDMRU KLVWRFRPSDWLELOLW\ FRPSOH[ FODVV ,, $E JHQH LV JHQHUDWHG E\ WKH VORZ DFFXPXODWLRQ RI SRLQW PXWDWLRQV RYHU ORQJ HYROXWLRQDU\ WLPH SHULRGV 7KHVH SRLQW PXWDWLRQV ZKLFK DUH SUHGRPLQDQWO\ ORFDWHG LQ WKH DQWLJHQ ELQGLQJ VLWH IUHTXHQWO\ UHVXOW LQ QRQV\QRQ\PRXV DPLQR DFLG UHSODFHPHQWf PXWDWLRQV DQG XVXDOO\ FKDQJH WKH ELRFKHPLFDO FODVV RI DPLQR DFLG 7KLV GLYHUVLW\ LV WKHQ H[WHQVLYHO\ DPSOLILHG E\ PHFKDQLVPV WKDW GUDPDWLFDOO\ PRGLI\ WKH DQWLJHQ ELQGLQJ VLWH LQ D VLQJOH VWHS LQWUDH[RQLF UHFRPELQDWLRQ EHWZHHQ GLIIHUHQW DOOHOHV RI $E H[RQ ZKLFK FRQWDLQV WKH $E SRUWLRQ RI WKH DQWLJHQ ELQGLQJ VLWHf DQG WKH LQWURGXFWLRQ RI DPLQR DFLG GHOHWLRQV &RQVHTXHQWO\ QDWXUDO PRXVH SRSXODWLRQV FRQWDLQ DQ DUUD\ RI $E DOOHOHV ZLWK KLJKO\ 9OO

PAGE 8

GLYHUJHQW DQWLJHQ ELQGLQJ VLWH VWUXFWXUHV DQG SUHVXPDEO\ DQWLJHQ ELQGLQJ SURSHUWLHV 7KH DFFXPXODWLRQ RI VXFK UDUH DQG XQXVXDO JHQHWLF HYHQWV VSHFLILFDOO\ ZLWKLQ WKH DQWLJHQ ELQGLQJ VLWH RI WKH 0KF FODVV ,, $E JHQH VXJJHVWV WKDW VSHFLDOL]HG VHOHFWLYH PHFKDQLVPV PD\ IDYRU WKH PDLQWHQDQFH RI DOOHOHV HQFRGLQJ KLJKO\ GLYHUJHQW IRUPV RI WKH DQWLJHQ ELQGLQJ VLWH 7KLV W\SH RI VHOHFWLRQ UHIHUUHG WR DV GLYHUJHQW DOOHOH DGYDQWDJH PD\ DFW LQ FRQFHUW ZLWK RWKHU IRUPV RI EDODQFLQJ VHOHFWLRQ DQG GULYH WKH GLYHUVLILFDWLRQ RI WKH DQWLJHQ ELQGLQJ VLWH E\ VHOHFWLYHO\ PDLQWDLQLQJ WKH PRVW GLYHUJHQW 0KF DOOHOHV ZLWKLQ SRSXODWLRQV YLLL

PAGE 9

&+$37(5 ,1752'8&7,21 $ FUXFLDO VWHS LQ WKH LQLWLDWLRQ RI DOO DQWLJHQ VSHFLILF LPPXQH UHVSRQVHV LV 7 O\PSKRF\WH UHFRJQLWLRQ RI SURFHVVHG DQWLJHQ ERXQG WR PROHFXOHV HQFRGHG E\ WKH PDMRU KLVWRFRPSDWLELOLW\ FRPSOH[ 0KFf 7KH WZR FODVVHV RI 0KF PROHFXOHV FODVV DQG FODVV ,, ELQG SHSWLGH IUDJPHQWV WKDW DUH GHULYHG IURP GLIIHUHQW FHOOXODU FRPSDUWPHQWV DQG JHQHUDWHG E\ YDULRXV DQWLJHQ SURFHVVLQJ SDWKZD\V 7KLV DOORZV 7 O\PSKRF\WHV WKH DELOLW\ WR HIILFLHQWO\ GHWHFW FHOOXODU DOWHUDWLRQV YLD VWLPXODWLRQ RI WKHLU FORQDOO\ GLVWULEXWHG 7 FHOO DQWLJHQ UHFHSWRU 5HJXODWRU\ 7 O\PSKRF\WHV QRUPDOO\ UHFRJQL]H DQWLJHQ ERXQG WR FODVV ,, PROHFXOHV ZKLOH F\WRWR[LF 7 O\PSKRF\WHV QRUPDOO\ UHFRJQL]H DQWLJHQ FRPSOH[HG WR FODVV PROHFXOHV 0KF PROHFXOHV VSHFLILFDOO\ ELQG DQWLJHQLF IUDJPHQWV LQ WKHLU DQWLJHQ ELQGLQJ VLWH ZKLFK ;UD\ FU\VWDOORJUDSKLF DQDO\VLV RI D FODVV PROHFXOH KDV VKRZQ WR EH D JURRYH SURGXFHG E\ WZR SDUDOOHO DKHOLFHV RYHUOD\LQJ D SODWIRUP FRPSRVHG RI DQ HLJKW VWUDQG ASOHDWHG VKHHW %MRUNPDQ HW DBO D %URZQ HW DO f )UDJPHQWV RI SURFHVVHG DQWLJHQ DSSUR[LPDWHO\ DPLQR DFLGV LQ OHQJWK DUH ERXQG ZLWK PLFURPRODU

PAGE 10

DIILQLW\ ZLWKLQ WKH DQWLJHQ ELQGLQJ VLWH JURRYH %XXV HW DO f 7KH LPSRUWDQFH RI 0KF JHQH SURGXFWV WR LPPXQH UHFRJQLWLRQ KDV GUDPDWLFDOO\ LQIOXHQFHG WKHLU HYROXWLRQ VXFK WKDW WKHVH JHQHV H[KLELW DQ XQSDUDOOHOHG GHJUHH RI SRO\PRUSKLVP $OOHOHV RIWHQ GLIIHU LQ JUHDWHU WKDQ b RI WKHLU QXFOHRWLGH VHTXHQFH DQG PRVW RI WKLV GLYHUVLW\ LV FRQFHQWUDWHG LQ WKH H[RQV HQFRGLQJ WKH DQWLJHQ ELQGLQJ VLWH %HQRLVW HW DO (VWHVV HW DO f 7KHVH SRO\PRUSKLVPV PRGLI\ WKH IXQFWLRQDO SURSHUWLHV RI 0KF PROHFXOHV LQ DQWLJHQ SUHVHQWDWLRQ FDXVLQJ FKDQJHV LQ WKH LPPXQH UHVSRQVLYHQHVV RI LQGLYLGXDOV WR IRUHLJQ DQWLJHQV 7KH HYROXWLRQDU\ PHFKDQLVPV UHVSRQVLEOH IRU WKH JHQHUDWLRQ DQG PDLQWHQDQFH RI 0KF GLYHUVLW\ KDV EHHQ D FRQWURYHUVLDO LVVXH LQ WKH ILHOG RI LPPXQRJHQHWLFV IRU PDQ\ \HDUV 7KH JRDOV RI WKLV GLVVHUWDWLRQ DUH WR HOXFLGDWH WKH PROHFXODU PHFKDQLVPV UHVSRQVLEOH IRU WKLV XQSUHFHGHQWHG JHQHWLF GLYHUVLW\ DQG WR GHWHUPLQH ZKHWKHU VHOHFWLYH SUHVVXUHV DUH DFWLQJ WR H[FOXVLYHO\ GLYHUVLI\ WKH DQWLJHQ ELQGLQJ VLWH 7KHVH LVVXHV ZHUH DSSURDFKHG E\ DQDO\]LQJ WKH GLYHUJHQFH RI WKH DQWLJHQ ELQGLQJ VLWH LQ WKH PXULQH 0KF FODVV ,, $E JHQH 7KH SRO\PHUDVH FKDLQ UHDFWLRQ FRXSOHG ZLWK '1$ VHTXHQFLQJ WHFKQRORJ\ ZDV HPSOR\HG WR REWDLQ WKH QXFOHRWLGH VHTXHQFH RI DOOHOHV RI $E H[RQ ZKLFK HQFRGHV WKH $E SRUWLRQ RI WKH DQWLJHQ ELQGLQJ VLWHf 7RJHWKHU ZLWK WHQ SXEOLVKHG VHTXHQFHV WKH GDWD VHW LQFOXGHG

PAGE 11

QXFOHRWLGH VHTXHQFH IURP DOOHOHV GHULYHG IURP 0XV VSHFLHV DQG 5DWWXV VSHFLHV 7KH UHVXOWV RI WKLV DQDO\VLV LQGLFDWH WKDW WKH GLYHUVLILFDWLRQ RI $E H[RQ LV JHQHUDWHG E\ WKH VORZ DFFXPXODWLRQ RI SRLQW PXWDWLRQV SUHGRPLQDQWO\ LQ WKH DQWLJHQ ELQGLQJ VLWH RYHU ORQJ HYROXWLRQDU\ WLPH VSDQV 7KHVH SRLQW PXWDWLRQV IUHTXHQWO\ UHVXOW LQ QRQV\QRQ\PRXV DPLQR DFLG UHSODFHPHQWf PXWDWLRQV DQG RIWHQ FKDQJH WKH ELRFKHPLFDO FODVV RI DPLQR DFLG DW WKDW SRVLWLRQ 7KLV GLYHUVLW\ LV WKHQ H[WHQVLYHO\ DPSOLILHG E\ PHFKDQLVPV WKDW GUDPDWLFDOO\ PRGLI\ WKH DQWLJHQ ELQGLQJ VLWH LQ D VLQJOH VWHS LQWUD H[RQLF UHFRPELQDWLRQ EHWZHHQ $E DOOHOHV DQG WKH LQWURGXFWLRQ RI DPLQR DFLG GHOHWLRQV $V D UHVXOW QDWXUDO PRXVH SRSXODWLRQV FRQWDLQ DQ DUUD\ RI DOOHOHV ZLWK KLJKO\ GLYHUJHQW ELQGLQJ SURSHUWLHV 7KH DFFXPXODWLRQ RI VXFK UDUH DQG XQXVXDO HYHQWV VSHFLILFDOO\ ZLWKLQ WKH DQWLJHQ ELQGLQJ VLWH RI 0KF FODVV ,, JHQHV VXJJHVWV WKDW VSHFLDOL]HG VHOHFWLYH PHFKDQLVPV PD\ IDYRU WKH PDLQWHQDQFH RI DOOHOHV HQFRGLQJ KLJKO\ GLYHUJHQW IRUPV RI WKH DQWLJHQ ELQGLQJ VLWH 7KLV W\SH RI VHOHFWLRQ UHIHUUHG WR DV GLYHUJHQW DOOHOH DGYDQWDJH PD\ DFW LQ FRQFHUW ZLWK WKH RWKHU WZR IRUPV RI EDODQFLQJ VHOHFWLRQ RYHUGRPLQDQFH DQG UDUH DOOHOH DGYDQWDJHf DQG GULYH WKH GLYHUVLILFDWLRQ RI WKH DQWLJHQ ELQGLQJ VLWH E\ VHOHFWLYHO\ PDLQWDLQLQJ WKH PRVW GLYHUJHQW 0KF DOOHOHV ZLWKLQ SRSXODWLRQV

PAGE 12

&+$37(5 ,, 5(9,(: 2) 7+( /,7(5$785( 7KH PDMRU KLVWRFRPSDWLELOLW\ FRPSOH[ 0KFf ZDV LQLWLDOO\ GHWHFWHG EDVHG RQ LWV LQYROYHPHQW LQ JUDIW UHMHFWLRQ EHWZHHQ GLIIHUHQW LQEUHG PRXVH OLQHV /LWWOH DQG 7\]]HU f 7KH GHYHORSPHQW RI VHURORJLFDO WHFKQLTXHV LPPHQVHO\ DXJPHQWHG WKH VWXG\ RI WKH + FRPSOH[ *RUHU \ f DQG WKXV DOORZHG IRU D JUHDWHU XQGHUVWDQGLQJ DQG DSSUHFLDWLRQ RI WKH JHQHWLF GLYHUVLW\ HQFRGHG ZLWKLQ WKH JHQHV RI WKH 0KF 7KH H[WHQVLYH SRO\PRUSKLVP RI WKH 0KF JHQHV DV ZHOO DV WKHLU FULWLFDO UROH LQ UHJXODWLQJ LPPXQH UHVSRQVLYHQHVV KDV PDGH WKHLU VWXG\ SDUWLFXODUO\ LQWHUHVWLQJ IRU VFLHQWLVWV IURP PDQ\ GLIIHUHQW GLVFLSOLQHV RI ELRORJ\ 7KLV OLWHUDWXUH UHYLHZ ZLOO FRQFHQWUDWH RQ 0KF FODVV ,, JHQH VWUXFWXUH IXQFWLRQ DQG JHQHWLF GLYHUVLW\ *HQRPLF 2UJDQL]DWLRQ RI WKH 0DMRU +LVWRFRPSDWLELOLW\ &RPSOH[ 7KH PXULQH PDMRU KLVWRFRPSDWLELOLW\ FRPSOH[ UHIHUUHG WR DV + LV D ODUJH PXOWLJHQH IDPLO\ ORFDWHG RQ FKURPRVRPH RI WKH PRXVH 7KH + FRPSOH[ HQFRPSDVVHV DSSUR[LPDWHO\

PAGE 13

FHQWL0RUJDQV RI '1$ ZKLFK LV HTXLYDOHQW WR D SK\VLFDO GLVWDQFH RI DW OHDVW PHJDEDVH SDLUV +RRG HW DO .OHLQ f &KURPRVRPDO ZDONLQJ DQG PDSSLQJ WHFKQLTXHV KDYH SURYLGHG D GHWDLOHG SLFWXUH RI WKH PROHFXODU RUJDQL]DWLRQ RI WKH 0KF $ WRWDO RI JHQHV KDYH EHHQ FORQHG DQG SDUWLDOO\ FKDUDFWHUL]HG IURP WKH 0KF RI D %$/%F PRXVH PRVW RI ZKLFK HQFRGH LPPXQH UHODWHG SURWHLQV $ PROHFXODU PDS RI WKH + FRPSOH[ DV ZHOO DV WKH JHQHUDO SURWHLQ VWUXFWXUH LV LOOXVWUDWHG LQ )LJXUH 0KF JHQHV HQFRGH WKUHH IDPLOLHV RI SURWHLQV EDVHG RQ WKHLU VWUXFWXUH DQG IXQFWLRQ 7KH + FRPSOH[ KDV DFFRUGLQJO\ EHHQ GLYLGHG LQWR IRXU UHJLRQV ZKLFK FRUUHVSRQG WR WKH FODVV RI PROHFXOHV HQFRGHG 7KH DQG UHJLRQV FRQWDLQ WKH FODVV JHQHV RI ZKLFK WKHUH DUH WZR JHQHUDO W\SHV )LUVW WKH DQG / JHQHV HQFRGH IRU WKH FODVVLFDO WUDQVSODQWDWLRQ DQWLJHQV DQG DUH H[SUHVVHG RQ PRVW QXFOHDWHG FHOOV RI WKH ERG\ 7KHVH PROHFXOHV DUH H[WUHPHO\ SRO\PRUSKLF DQG DV VXFK DUH UHVSRQVLEOH IRU PHGLDWLQJ KHWHURORJRXV JUDIW UHMHFWLRQ 7KHLU SK\VLRORJLFDO IXQFWLRQ LQ YLYR KRZHYHU LV WR SUHVHQW YLUDO DQG WXPRU DQWLJHQV WR F\WRWR[LF 7 O\PSKRF\WHV =LQNHUQDJHO f 7KH VHFRQG W\SH RI FODVV JHQH GHVLJQDWHG e!D DQG 7OD DUH PXFK OHVV SRO\PRUSKLF 0ROHFXODU FORQLQJ VWXGLHV KDYH UHYHDOHG PRUH WKDQ JHQHV RI WKLV W\SH 6WHLQPHW] HW DO Df ORFDWHG WHORPHULF WR WKH DQG / ORFL :LQRWR HW D-/ f

PAGE 14

$OWKRXJK VRPH RI WKHVH JHQHV DUH H[SUHVVHG RQ QXFOHDWHG EORRG FHOOV eDf RU RQ WK\PRF\WHV DQG FHUWDLQ OHXNHPLDV 7ODf 0LFKHDOVRQ HW DO f WKHLU IXQFWLRQ LV QRW \HW NQRZQ )ODKHUW\ f ,W KDV EHHQ SRVWXODWHG KRZHYHU WKDW 7OD PROHFXOHV PD\ VHUYH DV UHVWULFWLRQ HOHPHQWV IRU WKH 6 OLQHDJH RI 7 O\PSKRF\WHV -DQHZD\ HW DO f %RWK W\SHV RI FODVV PROHFXOHV KDYH D VLPLODU SURWHLQ VWUXFWXUH 7KH\ FRQVLVW RI WKUHH H[WUDFHOOXODU GRPDLQV D WUDQVPHPEUDQH GRPDLQ DQG D F\WRSODVPLF GRPDLQ WKHUHE\ FRQVWLWXWLQJ D GDOWRQ PHPEUDQH ERXQG JO\FRSURWHLQ RI DSSUR[LPDWHO\ DPLQR DFLGV $ IRXUWK H[WUDFHOOXODU GRPDLQ LV FRQWULEXWHG E\ PLFURJOREXOLQ 7KLV GDOWRQ PROHFXOH HQFRGHG RQ FKURPRVRPH RI WKH PRXVH QRQFRYDOHQWO\ DVVRFLDWHV ZLWK FODVV SURWHLQV DQG LV WKRXJKW WR SOD\ D UROH LQ VWDELOL]LQJ WKH H[WUDFHOOXODU GRPDLQ VWUXFWXUH RI FODVV SURWHLQV .OHLQ HW DO Ef 7KH 6 UHJLRQ HQFRGHV D KHWHURJHQHRXV DVVRUWPHQW RI JHQHV ,QFOXGHG DUH WKH FODVVLFDO FODVV ,,, JHQHV ZKLFK L HQFRGH WKH FRPSOHPHQW SURWHLQV & %I 6LS DQG & DV ZHOO DV WKH WZR KRPRORJRXV JHQHV 2+$ DQG 2+% RQH RI ZKLFK FRGHV IRU WKH VWHURLG K\GUR[\ODVH 6WHLQPHW] HW DO f &HQWURPHULF WR WKH ORFXV DUH WKH JHQHV IRU WZR F\WRWR[LQV 71)D DQG 71)II 0XOOHU HW DO f $OWKRXJK WKHVH 6 UHJLRQ JHQHV DUH SK\VLFDOO\ ORFDWHG ZLWKLQ WKH + FRPSOH[ DQG PD\ WKHUHIRUH HYROYH DV D VLQJOH JHQHWLF XQLW %RGPHU f .OHLQ HW DO Ef DUJXH DJDLQVW WKHLU

PAGE 15

LQFOXVLRQ LQ WKH 0KF EHFDXVH WKH\ DUH QRW IXQFWLRQDOO\ UHODWHG WR WKH FODVV RU FODVV ,, KLVWRFRPSDWLELOLW\ ORFL 7KH FODVV ,, JHQHV DUH FRQWDLQHG ZLWKLQ WKH UHJLRQ ZKLFK PDSV EHWZHHQ WKH DQG 6 UHJLRQV RI WKH + FRPSOH[ )LJXUH f &ODVV ,, JHQHV ZHUH ILUVW GHILQHG E\ WKH GLIIHUHQWLDO DELOLW\ RI LQEUHG PRXVH VWUDLQV WR PRXQW DQ LPPXQH UHVSRQVH WR WKH V\QWKHWLF SHSWLGH 7*f$f§/ 0F'HYLWW DQG 6HOD f 7KHVH LPPXQH UHVSRQVH JHQHV ZHUH WKHQ GHILQLWLYHO\ PDSSHG XVLQJ UHFRPELQDQW DQG FRQJHQLH VWUDLQV RI PLFH 0F'HYLWW HW D-/ %HQDFHUUDI DQG t 0F'HYLWW f 7KHUH DUH WZR LVRW\SLF IRUPV RI FODVV ,, PROHFXOHV HQFRGHG ZLWKLQ WKH UHJLRQ GHQRWHG $ DQG ( DQG WKHVH DUH DVVHPEOHG IURP SRO\SHSWLGHV HQFRGHG E\ WKH IRXU IXQFWLRQDO JHQHV $E $D (E DQG (D ,Q DGGLWLRQ WKHUH DUH WKUHH SVHXGRJHQHV WHUPHG $E $E DQG (E :LGHUD DQG )ODYHOO 6WHLQPHW] HW DO f &ODVV ,, PROHFXOHV DUH KHWHURGLPHULF JO\FRSURWHLQV FRPSRVHG RI D GDOWRQ D DOSKDf FKDLQ DQG D GDOWRQ E EHWDf FKDLQ .OHLQ HW DO Ef 7KHVH SRO\SHSWLGHV QRQFRYDOHQWO\ DVVRFLDWH LQ WKH F\WRSODVP DQG DUH VXEVHTXHQWO\ H[SUHVVHG RQ WKH VXUIDFH RI DQWLJHQ SUHVHQWLQJ FHOOV %RWK WKH D DQG E FKDLQV DUH RUJDQL]HG LQWR SURWHLQ GRPDLQV LQFOXGLQJ D K\GURSKRELF OHDGHU SHSWLGH RI DSSUR[LPDWHO\ DPLQR DFLGV DEVHQW LQ WKH PDWXUH FHOO VXUIDFH IRUP RI WKH PROHFXOH DSSUR[LPDWHO\ DPLQR DFLG H[WUDFHOOXODU GRPDLQV WHUPHG DO D RU EO Ef D K\GURSKRELF WUDQVPHPEUDQH VHJPHQW RI DPLQR DFLGV DQG D

PAGE 16

)LJXUH $ GLDJUDP GHSLFWLQJ WKH FODVV FODVV ,, DQG FODVV ,,, JHQH ORFL DQG JHQH SURGXFWV ZLWKLQ WKH PDMRU KLVWRFRPSDWLELOLW\ FRPSOH[ ORFDWHG RQ FKURPRVRPH RI WKH PRXVH

PAGE 17

FODVV FODVV ,, FODVV ,,, &+5202620( ‘ ‘‘‘‘ FODVV O 4D 7OD 92

PAGE 18

KLJKO\ FKDUJHG F\WRSODVPLF GRPDLQ 7KH WHUWLDU\ VWUXFWXUH RI WKH D EO DQG E GRPDLQV LV DEHWWHG E\ WKH IRUPDWLRQ RI GLVXOILGH ERQGV EHWZHHQ SDLUV RI F\VWHLQH UHVLGXHV ORFDWHG ZLWKLQ HDFK GRPDLQ 0HQJOH*DZ DQG 0F'HYLWW f 7KH GRPDLQ RUJDQL]DWLRQ RI FODVV ,, SRO\SHSWLGHV GLUHFWO\ UHIOHFWV WKH H[RQLQWURQ RUJDQL]DWLRQ RI WKHLU UHVSHFWLYH JHQHV 7KH E FKDLQ JHQHV IRU LQVWDQFH DUH FRPSRVHG RI VL[ H[RQV RQH IRU HDFK SURWHLQ GRPDLQ DQG DQ DGGLWLRQDO H[RQ HQFRGLQJ WKH n XQWUDQVODWHG UHJLRQ 6DLWR HW DO f 7KH D FKDLQ JHQHV DUH YHU\ VLPLODU H[FHSW WKDW WKH WUDQVPHPEUDQH DQG F\WRSODVPLF GRPDLQV DUH FRPELQHG LQWR D VLQJOH H[RQ 7KXV WKH\ DUH FRPSRVHG RI H[RQV 0DWKLV HW DOA 0F1LFKROV HW DO f $ GLDJUDP RI WKH RUJDQL]DWLRQ RI FODVV ,, D DQG E JHQHV LV JLYHQ LQ )LJXUH 2UJDQL]DWLRQ RI WKH ,5HTLRQ 7KH UHJLRQ ZDV RULJLQDOO\ GLYLGHG LQWR VXEUHJLRQV ,$ ,% ,,( DQG ,& EDVHG RQ UHFRPELQDWLRQDO DQDO\VLV RI YDULRXV LPPXQH UHVSRQVLYHQHVV WUDLWV UHYLHZHG E\ .OHLQ f 7KH ,$ DQG ,( VXEUHJLRQV HQFRGH WKH VHURORJLFDOO\ DQG ELRFKHPLFDOO\ GHILQHG $ DQG ( PROHFXOHV ZKLFK DUH WKH LPPXQH UHVSRQVH DQWLJHQV 7KH $E $D DQG (E SRO\SHSWLGHV DUH HQFRGHG LQ WKH ,$ VXEUHJLRQ DQG WKH (D FKDLQ LV HQFRGHG E\ WKH ,( VXEUHJLRQ -RQHV HW DO 0XUSK\ HW DO f

PAGE 19

)LJXUH 7KH LQWURQH[RQ RUJDQL]DWLRQ RI WKH 0KF FODVV ,, D DQG E FKDLQ JHQHV

PAGE 20

/ &/$66 ,, c*(1( &/$66 ,, D*(1( DL PLP 70&< f87

PAGE 21

7KH ,VXEUHJLRQ ZDV VHURORJLFDOO\ GHILQHG E\ UHDJHQWV GLUHFWHG DJDLQVW DQ ,SRO\SHSWLGH ZKLFK ZDV WKRXJKW WR EH D VXSSUHVVRU 7 FHOO IDFWRU FDSDEOH RI VXSSUHVVLQJ LPPXQH UHVSRQVHV 0XUSK\ HW DO 0XUSK\ HW DO f $OWKRXJK WKHVH ,VXSSUHVVRU IDFWRUV KDYH EHHQ VHURORJLFDOO\ GHILQHG DWWHPSWV WR LVRODWH DQG ELRFKHPLFDOO\ FKDUDFWHUL]H WKHP KDYH IDLOHG 7KH H[LVWHQFH RI WKH ,% DQG ,& VXEUHJLRQV ZHUH EDVHG HQWLUHO\ RQ UHJXODWRU\ HIIHFWV RQ LPPXQH UHVSRQVLYHQHVV 7KH ,% VXEUHJLRQ ZDV RULJLQDOO\ GHILQHG E\ /HLEHUPDQ HW DO f IRU LWV DELOLW\ WR UHJXODWH WKH DQWLERG\ UHVSRQVH WR DQ DOORW\SLF GHWHUPLQDQW RQ WKH P\HORPD SURWHLQ 023& ,PPXQH UHVSRQVHV WR DW OHDVW RWKHU DQWLJHQV KDYH EHHQ DWWULEXWHG WR WKH % UHJLRQ LQFOXGLQJ ODFWDWH GHK\GURJHQDVH % 0HOFKHUV HW DO f VWDSK\ORFRFFDO QXFOHDVH /R]QHU HW DO f R[D]RORQH )DFKHW DQG $QGR f +< DQWLJHQ +XUPH HW DO f DQG WULQLWURSKHQ\ODWHG PRXVH VHUXP DOEXPLQ 8UED DQG +LOGHPDQQ f 1R SURWHLQ SURGXFW KDV HYHU EHHQ GHWHFWHG IURP WKH ,% VXEUHJLRQ DQG LWV HIIHFWV FDQ EH H[SODLQHG E\ WKH FRPSOLPHQWDWLRQ RI JHQH SURGXFWV IURP ERWK WKH ,$ DQG ,( VXEUHJLRQV 'RUI DQG %HQDFHUUDI .OHLQ HW DO f 7KH & ORFXV ZDV ILUVW GLVFRYHUHG ZLWK +KDQWL+K DQWLVHUXP 'DYLG DQG 6KUHIIOHU f 5LFK HW DO D Ef VXEVHTXHQWO\ SURGXFHG DQWLVHUD FRQWDLQLQJ & VSHFLILF DQWLERGLHV WKDW UHDFWHG ZLWK D VXSSUHVVRU IDFWRU SURGXFHG LQ

PAGE 22

DOORJHQHLF PL[HG O\PSKRF\WH UHDFWLRQV 0DSSLQJ RI WKH & VXEUHJLRQ XVLQJ UHFRPELQDQW LQEUHG VWUDLQV VXJJHVWHG D SRVLWLRQ WHORPHULF WR WKH (D ORFXV DQG FHQWURPHULF WR & $V IRU WKH % VXEUHJLRQ QR SURWHLQ SURGXFW KDV HYHU EHHQ IRXQG 7KH DGYHQW RI PROHFXODU JHQHWLF DQDO\VLV KDV DOORZHG WKH HOXFLGDWLRQ RI D PROHFXODU PDS RI WKH ,UHJLRQ 6WHLQPHW] HW DO f SURYLGHG WKH ILUVW HYLGHQFH DW WKH PROHFXODU OHYHO RI WKH H[DFW OLQNDJH RI FODVV ,, JHQHV E\ FORQLQJ D VWUHWFK RI FRQWLJXRXV EDVH SDLUV IURP WKH ,UHJLRQ RI D %$/%F PRXVH 7KLV VWXG\ LGHQWLILHG RI WKH ELRFKHPLFDOO\ GHILQHG FODVV ,, JHQHV $E (E DQG (D DQG (E GHVLJQDWHG D SVHXGRJHQH EHFDXVH LW GLG QRW K\EULGL]H WR D n SUREH 6RXWKHUQ EORW DQDO\VLV RI WKH %$/%F JHQRPH VXJJHVWHG WKDW WKH ,UHJLRQ FRQWDLQV D FKDLQ JHQHV DQG IURP WR VL[ E FKDLQ JHQHV D FRQFOXVLRQ ODWHU FRQILUPHG E\ WKH ZRUN RI :LGHUD DQG )ODYHOO f 6WHLQPHW] HW DO f DOVR VKRZHG WKDW WKH (D DQG (E JHQHV DUH LQ IDFW SUHVHQW LQ VWUDLQV QRW H[SUHVVLQJ DQ ( PROHFXOH 7KXV WKH IDLOXUH WR H[SUHVV DQ ( PROHFXOH LV QRW D FRQVHTXHQFH RI WKH GHOHWLRQ RI WKH HQWLUH JHQH EXW UDWKHU PXVW RFFXU DW WKH OHYHO RI WUDQVFULSWLRQ RU WUDQVODWLRQ 6XEVHTXHQW H[SHULPHQWV LQYROYLQJ WKH VFUHHQLQJ RI FRVPLG OLEUDULHV E\ 'DYLV HW DO f OHDG WR WKH LGHQWLILFDWLRQ RI WKH $D JHQH DQG LW ZDV PDSSHG MXVW WHORPHULF WR WKH $E ORFXV

PAGE 23

&RPSDULVRQ RI WKH PROHFXODU PDS RI WKH ,UHJLRQ ZLWK WKH JHQHWLF PDS KDV FRQILUPHG WKH ORFDWLRQ RI WKH $D DQG $E JHQHV LQ WKH ,$ VXEUHJLRQ DQG WKH ORFDWLRQ RI WKH (D JHQH LQ WKH ,( VXEUHJLRQ 7KH (E JHQH KRZHYHU LV ORFDWHG ZLWK LWV n HQG LQ WKH ,$ VXEUHJLRQ DQG LWV n HQG LQ WKH ,( VXEUHJLRQ 7KLV FRQILQHV WKH ,DQG ,% VXEUHJLRQV WR OHVV WKDQ .E RI '1$ DW WKH n HQG RI WKH (E JHQH 6WHLQPHW] HW DO f 6HTXHQFH DQDO\VLV RI WKLV '1$ IUDJPHQW GHILQLWLYHO\ VKRZHG WKDW QR JHQH FRXOG HQFRGH IRU ,LQ WKLV VHJPHQW .RERUL HW DO f \ 7ZR RWKHU FODVV ,, JHQHV KDYH VXEVHTXHQWO\ EHHQ GLVFRYHUHG DQG GHWHUPLQHG WR EH SVHXGRJHQHV /DUKDPPHU HW DO Df LGHQWLILHG WKH $E JHQH DQG PDSSHG LW DSSUR[LPDWHO\ .E FHQWURPHULF WR WKH $E JHQH 6HTXHQFH DQDO\VLV RI WKH $E JHQH DQG DQ $E F'1$ FORQH VKRZV WKH H[RQLQWURQ RUJDQL]DWLRQ WR EH WKH VDPH DV RWKHU FODVV ,, E JHQHV /DUKDPPHU HW D Ef 7KH SUHGLFWHG DPLQR DFLG VHTXHQFH RI $E VKRZV RQO\ DERXW b KRPRORJ\ WR RWKHU E FKDLQV ,Q FRQWUDVW WKH W\SLFDO KRPRORJ\ DPRQJ RWKHU E FKDLQV LQ KXPDQ DQG PRXVH LV DURXQG b WKXV LQGLFDWLQJ WKDW $E LV WKH PRVW GLYHUJHQW PHPEHU RI WKH IDPLO\ 'HWHFWLRQ RI LQFRPSOHWHO\ VSOLFHG $E P51$ DQG WKH ILQGLQJ RI DQ F'1$ FORQH FRQWDLQLQJ LQWURQ VHTXHQFHV VXJJHVWV WKDW $E WUDQVFULSWV DUH QRW SURSHUO\ SURFHVVHG 1R FHOO VXUIDFH SURGXFW KDV EHHQ LVRODWHG IURP WKH $E ORFXV +\EULGL]DWLRQ WR UHVWULFWLRQ HQ]\PHGLJHVWHG JHQRPLF '1$ RI GLIIHUHQW

PAGE 24

LQEUHG VWUDLQV ZLWK $E SUREHV LQGLFDWHG WKDW WKLV JHQH GLVSOD\V D OHVVHU GHJUHH RI SRO\PRUSKLVP WKDQ $E :LGHUD DQG )ODYHOO f LVRODWHG WKH $E JHQH ,W VKRZV b QXFOHRWLGH KRPRORJ\ ZLWK WKH KXPDQ 6%E JHQH DQG VWURQJ KRPRORJ\ ZLWK RWKHU FODVV ,, E JHQHV +RZHYHU DQ QXFOHRWLGH GHOHWLRQ PDNHV WKH WUDQVODWLRQ RI WKLV JHQH LQWR D IXQFWLRQDO SURWHLQ DQ LPSRVVLELOLW\ 7KH SRVLWLRQ RI WKH $E JHQH LV .E WHORPHULF WKH JHQH :LGHUD DQG )ODYHOO f 6WHLQPHW] HW DO f VXEVHTXHQWO\ OLQNHG WKH $E JHQH IURP WKH %$/%F PRXVH WR WKH UHVW RI WKH ,UHJLRQ WKHUHE\ SURYLGLQJ D FRQWLJXRXV NLOREDVH PDS RI WKH DQG UHJLRQV RI WKH 0KF 7KH RUJDQL]DWLRQ RI WKH ,UHJLRQ LV VKRZQ LQ )LJXUH 7KH JHQHV DUH DUUDQJHG FHQWURPHULFDOO\ LQ WKH RUGHU RI $E $E $E $D (E (E DQG (D DQG VSDQ DSSUR[LPDWHO\ NLOREDVHV RI '1$ ZLWK WKH IXQFWLRQDO JHQHV FRQILQHG WR D NLOREDVH UHJLRQ +RPRORJRXV 5HFRPELQDWLRQ :LWKLQ WKH 0KF 7KH PROHFXODU FORQLQJ DQG FKDUDFWHUL]DWLRQ RI ODUJH VHJPHQWV RI WKH 0KF KDV PDGH LW SRVVLEOH WR PDS PHLRWLF UHFRPELQDWLRQDO EUHDNSRLQWV DW WKH QXFOHRWLGH OHYHO 6WHLQPHW] HW DO Df LQLWLDOO\ DQDO\]HG LQWUD, UHJLRQ UHFRPELQDQW PRXVH VWUDLQV DQG IRXQG WKDW DOO WKH UHFRPELQDWLRQDO HYHQWV PDS WR D NLOREDVH VHJPHQW RI '1$ FRYHULQJ SDUW RI WKH (E JHQH 6XEVHTXHQW VRXWKHUQ EORW DQG

PAGE 25

? )LJXUH 7KH PROHFXODU PDS RI WKH PXULQH AUHJLRQ 7KH RUJDQL]DWLRQ RI 0KF FODVV ,, JHQHV WKHLU WUDQVFULSWLRQDO RULHQWDWLRQ DQG WKHLU SRVLWLRQ UHODWLYH WR WKH UHJLRQ LV LOOXVWUDWHG $GDSWHG IURP 6WHLQPHW] HW DO f

PAGE 26

6&$/( I U $I3 $S $D (S (IS (D ‘ ‘ ‘ ‘ ‘‘ NE +

PAGE 27

VHTXHQFH DQDO\VLV UHYHDOHG WKDW RI WKH UHFRPELQDWLRQDO HYHQWV RFFXUUHG ZLWKLQ D NLOREDVH UHJLRQ RI '1$ LQ WKH LQWURQ EHWZHHQ WKH (EO DQG (E H[RQV .RERUL HW D-/ f 6HYHUDO VXFFHHGLQJ VWXGLHV KDYH LGHQWLILHG PRUH LQWUD, UHJLRQ UHFRPELQDQWV LQ ZKLFK WKH EUHDNSRLQWV PDS WR WKLV UHFRPELQDWLRQDO KRWVSRW 6DKD DQG &XOOHQ D E /DIXVH DQG 'DYLG f 7KH ILQGLQJ RI KLJKO\ ORFDOL]HG PHLRWLF UHFRPELQDWLRQ SRLQWV LQ WKH PRXVH 0KF LQGLFDWHV WKDW UHFRPELQDWLRQ LV KLJKO\ IRFDO DQG WKH JHQHWLF DQG SK\VLFDO PDSV ZRXOG QRW EH FRQJUXHQW \ )XUWKHU VWXGLHV KDYH UHYHDOHG DGGLWLRQDO UHFRPELQDWLRQDO KRWVSRWV ZLWKLQ WKH 0KF 7KHVH PDS WR f D NLOREDVH VWUHWFK RI '1$ EHWZHHQ WKH DQG $ ORFL 6WHLQPHW] HW DO 6KLURVKL HW DO f f $ NLOREDVH UHJLRQ RI '1$ EHWZHHQ WKH $E DQG $E ORFL 6WHLQPHW] HW D7 f )XUWKHU DQDO\VLV RI WKLV UHFRPELQDWLRQDO KRWVSRW E\ 8HPDWVX HW DO f UHYHDOHG WKDW DOO WKH EUHDNSRLQWV ZHUH FRQILQHG WR D NLOREDVH VWUHWFK RI '1$ $OO WKH EUHDNSRLQWV H[DPLQHG VKRZHG KRPRORJRXV UHFRPELQDWLRQ ZLWKRXW DQ\ '1$ VHTXHQFHV GXSOLFDWHG RU GHOHWHG EHWZHHQ WKH SDUHQWDO DQG UHFRPELQDQW KDSORW\SHV f 6HYHQ EUHDNSRLQWV KDYH EHHQ FKDUDFWHUL]HG PDSSLQJ WR D NLOREDVH UHJLRQ FHQWURPHULF WR WKH (D JHQH /DIXVH DQG 'DYLG f f $QRWKHU UHFRPELQDWLRQDO KRWVSRW ZDV LGHQWLILHG E\ 7DUQX]]HU f WKDW PDSV WR D NLOREDVH VWUHWFK RI '1$ DSSUR[LPDWHO\

PAGE 28

NLOREDVHV WHORPHULF WR WKH $D JHQH 7KHVH REVHUYDWLRQV LQGLFDWH WKDW PRVW RI WKH UHFRPELQDWLRQV ZLWKLQ WKH + FRPSOH[ RFFXU LQ FOXVWHUV GHILQLQJ UHFRPELQDWLRQDO KRWVSRWV VKRZQ LQ )LJXUH $OO WKH UHFRPELQDWLRQDO KRWVSRWV LQ + KDYH WKUHH FKDUDFWHULVWLFV LQ FRPPRQ f KLJK IUHTXHQF\ RI KRPRORJRXV UHFRPELQDWLRQ f ORFDOL]DWLRQ WR D VPDOO VWUHWFK RI '1$ DQG f KDSORW\SH VSHFLILFLW\ 6WHLQPHW] HW DO f )XUWKHUPRUH ZKHQ WKH UHFRPELQDWLRQDO KRWVSRWV DUH SUHVHQW WKH\ DFW LQ D GRPLQDQW IDVKLRQ 6WHLQPHW] DQG 8HPDWVX f 7KH VWUXFWXUDO EDVLV RI WKH UHFRPELQDWLRQDO KRWVSRWV ZLWKLQ WKH 0KF LV XQNQRZQ 6WHLQPHW] HW DO f 5HSHWLWLYH VHTXHQFHV KDYH EHHQ LGHQWLILHG LQ WKH SUR[LPLW\ RI WKH $E$E DQG (E KRWVSRWV 6WHLQPHW] HW DO 8HPDWVX HW DO f 7KHVH UHSHWLWLYH VHTXHQFHV KDYH EHHQ VXJJHVWHG WR SOD\ D UROH EDVHG RQ WKHLU VLPLODULW\ WR &KL D UHFRPELQDWLRQDO KRWVSRW LQ SKDJH ODPEGD DQG KXPDQ K\SHUYDULDEOH PLQLVDWHOOLWH VHTXHQFHV FRQVWLWXWLQJ SUHVXPHG KRWVSRWV LQ PDQ 7KHVH VLPLODULWLHV PD\ WKHUHIRUH LQGLFDWH WKDW WKH EDVLF PHFKDQLVP RI KRPRORJRXV UHFRPELQDWLRQ PD\EH VLPLODU LQ SURNDU\RWHV DQG HXNDU\RWHV 'LPHQVLRQDO 6WUXFWXUH RI 0KF 0ROHFXOHV $ PDMRU DGYDQFH LQ WKH XQGHUVWDQGLQJ RI 0KF PROHFXOHV FDPH ZLWK WKH HOXFLGDWLRQ RI WKH GLPHQVLRQDO VWUXFWXUH RI WKH FODVV +/$$ PROHFXOH %MRUNPDQ HW DO Df 3ODVPD

PAGE 29

)LJXUH 'LDJUDP LOOXVWUDWLQJ WKH ORFDWLRQ RI UHFRPELQDWLRQDO KRWVSRWV 5+6f ZLWKLQ WKH + FRPSOH[

PAGE 30

6&$/( U R . *(1(6 f§(. 5(&20%,1$7,21$/ +2763276 $_" $" $D (M6 (S(D , ‘ $L $ NE WR

PAGE 31

PHPEUDQHV IURP WKH KRPR]\JRXV KXPDQ O\PSKREODVWRLG FHOO OLQH -< ZHUH GLJHVWHG ZLWK SDSDLQ WR UHPRYH WKH WUDQVPHPEUDQH DQFKRU RI WKH +/$$ PROHFXOH 7KH VROXEOH IUDJPHQW FRQWDLQLQJ WKH DO D D DQG 0 GRPDLQV ZDV FU\VWDOOL]HG DQG WKH VWUXFWXUH ZDV WKHQ GHWHUPLQHG IURP $r ;UD\ FU\VWDOORJUDSKLF DQDO\VLV 7KH PROHFXOH LV FRPSULVHG RI WZR VWUXFWXUDOO\ VLPLODU GRPDLQV DO DQG D KDYH WKH VDPH WHUWLDU\ IROGV DQG OLNHZLVH D DQG 0 KDYH WKH VDPH WHUWLDU\ IROGV 7KH D DQG 0 GRPDLQV DUH ERWK VDQGZLFK VWUXFWXUHV FRPSRVHG RI DQWLSDUDOOHO SOHDWHG VKHHWV RQH ZLWK VWUDQGV DQG RQH ZLWK VWUDQGV 7KHVH WZR VKHHWV DUH FRQQHFWHG E\ D GLVXOILGH ERQG 7KLV WHUWLDU\ VWUXFWXUH KDV EHHQ GHVFULEHG IRU WKH FRQVWDQW UHJLRQ RI LPPXQRJOREXOLQ PROHFXOHV DQG LV FRQVLVWHQW ZLWK WKH DPLQR DFLG KRPRORJ\ EHWZHHQ WKH PROHFXOHV 2UU HW DO f 7KH DO DQG D GRPDLQV LQWHUDFW V\PPHWULFDOO\ WR FRPSRVH WKH DQWLJHQ ELQGLQJ VLWH %MRUNPDQ HW DO Df ,W LV ORFDWHG RQ WKH WRS VXUIDFH RI WKH PROHFXOH GLVWDO IURP WKH PHPEUDQH LQ D SRVLWLRQ DFFHVVLEOH IRU UHFRJQLWLRQ E\ UHFHSWRUV IURP WKH VXUIDFH RI DQRWKHU FHOO 7KH VWUXFWXUH FRQVLVWV RI WZR SDUDOOHO DKHOLFHV HDFK VSDQ D SODWIRUP FRPSRVHG RI DQ VWUDQG DQWLSDUDOOHO SOHDWHG VKHHW VWUXFWXUH 7KH DQWLJHQ ELQGLQJ VLWH LV WKH JURRYH WKDW OLHV EHWZHHQ WKH WZR DKHOLFHV DQG DWRS WKH SOHDWHG VKHHW 7KH GLPHQVLRQV RI WKH DQWLJHQ ELQGLQJ VLWH $%6f JURRYH DUH

PAGE 32

DSSUR[LPDWHO\ $r ORQJ $r ZLGH DQG $r GHHS 7KLV ZRXOG DFFRPPRGDWH DQ DPLQR DFLG IUDJPHQW LQ D OLQHDU FRQIRUPDWLRQ RU DPLQR DFLGV LQ DQ DKHOLFDO FRQILUPDWLRQ 7KH LQWHULRU RI WKH DQWLJHQ ELQGLQJ VLWH LV OLQHG ZLWK ERWK SRODU DQG QRQSRODU DPLQR DFLG VLGH FKDLQV DQG PDQ\ RI WKH KLJKO\ SRO\PRUSKLF DPLQR DFLGV UHVSRQVLEOH IRU KDSORW\SHVSHFLILF DVVRFLDWLRQV ZLWK DQWLJHQ DUH ORFDWHG LQ WKH VLWH %MRUNPDQ HW DO Ef $ ODUJH FRQWLQXRXV UHJLRQ RI HOHFWURQ GHQVLW\ WKDW LV QRW DFFRXQWHG IRU E\ WKH SRO\SHSWLGH FKDLQ RI WKH +/$$ PROHFXOH ZDV REVHUYHG LQ WKH $%6 %MRUNPDQ HW D Df ,W VHHPV OLNHO\ WKDW WKLV H[WUD GHQVLW\ LV IURP D SHSWLGH RU PL[WXUH RI SHSWLGHV WKDW FRFU\VWDOOL]HG ZLWK WKH 0KF PROHFXOH 5HFHQWO\ WKH VWUXFWXUH RI +/$$Z UHILQHG WR D UHVROXWLRQ RI $r ZDV UHSRUWHG *DUUHWW HW DO f 7KH EDFNERQH VWUXFWXUH RI WKH WZR +/$ FODVV PROHFXOHV ZDV YHU\ VLPLODU H[FOXGLQJ WKH DPLQR DFLG GLIIHUHQFHV RI ZKLFK DUH LQ DPLQR DFLG SRVLWLRQV WKDW IDFH LQ WKH DQWLJHQ ELQGLQJ FOHIW 7KHVH DPLQR DFLG GLIIHUHQFHV LQGLYLGXDOO\ FDXVH RQO\ ORFDO VWUXFWXUDO FKDQJHV EXW RYHUDOO VXEVWDQWLDOO\ WUDQVIRUP WKH $%6 )RU LQVWDQFH FRPSDULVRQ RI WKH VWUXFWXUH IURP WKH DOOHOHV LOOXVWUDWHV WKDW YDULRXV VXEVLWHV RI WKH JURRYH KDYH FRQWRXU DQG FKDUJHGLVWULEXWLRQ FKDQJHV )XUWKHUPRUH WKH SK\VLFDO FKDUDFWHULVWLFV RI SRFNHWV ZKLFK H[WHQG EHWZHHQ WKH DKHOL[

PAGE 33

DQG SOHDWHG VKHHWV DQG DUH WKRXJKW WR SOD\ D FULWLFDO UROH LQ GHWHUPLQLQJ SHSWLGH ELQGLQJ SURSHUWLHV FDQ EH KLJKO\ GLYHUVLILHG EHWZHHQ WKH DOOHOHV 7KLV LV GXH WR SRO\PRUSKLVPV WKDW UHVXOW LQ DPLQR DFLG VLGH FKDLQ FKDQJHV GLIIHUHQFHV WKDW XOWLPDWHO\ GLFWDWH SK\VLFDO ELQGLQJ SURSHUWLHV 7KH QXPEHU RI DPLQR DFLG GLIIHUHQFHV EHWZHHQ +/$$ DQG +/$$Z LV DSSUR[LPDWHO\ HTXDO WR WKH DYHUDJH QXPEHU RI VLWH GLIIHUHQFHV EHWZHHQ SDLUV RI +/$ DOOHOHV 7KHUHIRUH WKH VDPH GHJUHH RI VWUXFWXUDO FKDQJHV LQ ORFDO SRFNHWV DQG VXEVLWHV VKRXOG EH REVHUYHG LQ RWKHU DOOHOHV $ PRGHO RI WKH 0KF FODVV ,, $%6 KDV EHHQ SURSRVHG EDVHG RQ WKH FODVV VWUXFWXUH DQG WKH SDWWHUQ RI SRO\PRUSKLVP RI KXPDQ DQG PRXVH FODVV ,, DOOHOHV %URZQ HW DO f 7KH EDVLF GLPHQVLRQDO VWUXFWXUH LV WKH VDPH WKH WZR DKHOLFHV O\LQJ DWRS DQ VWUDQG SOHDWHG VKHHW )LJXUH f %RWK WKH D FKDLQ DQG WKH E FKDLQ FRQWULEXWH DQ DKHOL[ DQG VWUDQGV RI WKH SOHDWHG VKHHW 7KHUH DUH UHJLRQV RI WKH PRGHO KRZHYHU ZKRVH WHUWLDU\ VWUXFWXUH FDQQRW EH DFFXUDWHO\ SUHGLFWHG 7KHVH DUHDV LQ WKH E FKDLQ DUH f WKH ORRS EHWZHHQ VWUDQG RQH DQG VWUDQG WZR f WKH FHQWUDO DKHOL[ DQG f WKH n VHJPHQW 7KH XQGHILQHG SDUWV RI WKH D FKDLQ DUH f WKH ORRSV EHWZHHQ VWUDQG DQG DQG EHWZHHQ VWUDQGV DQG DQG f WKH n DKHOL[ VHJPHQW $QDO\VLV RI WKH VHFRQGDU\ VWUXFWXUH RI FODVV ,, PROHFXOHV E\ SK\VLFDO FULWHULD VXFK DV )RXULHU WUDQVIRUP LQIUDUHG DQG FLUFXODU GLFKURLVP VSHFWURVFRS\ DUH FRQVLVWHQW

PAGE 34

VLWH WKH )LJXUH +\SRWKHWLFDO 0KF FODVV ,, PROHFXOH DQWLJHQ ELQGLQJ 'RWWHG UHFWDQJOH LQGLFDWHV UHJLRQV RI SUHGLFWHG GHYLDWLRQV IURP FODVV PRGHO $GDSWHG IURP %URZQ HW DO f

PAGE 36

ZLWK WKH FODVV ,, PRGHO SURSRVHG E\ %URZQ HW DO f *RUJD HW DO f )XUWKHUPRUH WKH FODVV ,, $%6 PRGHO LV FRQVLVWHQW ZLWK D YDULHW\ RI VWUXFWXUDO DQG IXQFWLRQDO VWXGLHV $OOHQ HW DO %XXV HW DO f *HQHUDWLRQ RI 0KF &ODVV ,, *HQH 3RO\PRUSKLVP 7KH PRVW RXWVWDQGLQJ IHDWXUH RI 0KF JHQHV LV WKHLU XQSUHFHGHQWHG JHQHWLF SRO\PRUSKLVP 1R RWKHU YHUWHEUDWH JHQHV H[KLELW VXFK D KLJK GHJUHH RI GLYHUVLW\ .OHLQ f 6HURORJLFDO VWXGLHV WU\SWLF SHSWLGH PDSSLQJ DQG PROHFXODU FKDUDFWHUL]DWLRQ KDYH HVWLPDWHG WKDW JUHDWHU WKDQ DOOHOHV RI VRPH 0KF ORFL H[LVW LQ QDWXUDO SRSXODWLRQV RI 0XV :DNHODQG DQG .OHLQ 'XQFDQ HW DO D *RW]H HW DO .OHLQ DQG )LJXHURD f 0DQ\ RI WKH DOOHOHV DUH JOREDOO\GLVWULEXWHG ZLWK IUHTXHQFLHV UDQJLQJ IURP b LQ ZLOG PRXVH SRSXODWLRQV *RW]H HW DO 1DGHDX HW DO f ,Q DGGLWLRQ JUHDWHU WKDQ b RI ZLOG PLFH DUH KHWHUR]\JRXV DW + 'XQFDQ HW DO Ef DQ REVHUYDWLRQ IXOO\ FRQVLVWHQW ZLWK WKH KLJK GHJUHH RI GLYHUVLW\ RI 0KF JHQHV 5HVWULFWLRQ IUDJPHQW OHQJWK SRO\PRUSKLVP 5)/3f DQDO\VLV ZLWK VLQJOH FRS\ SUREHV VSDQQLQJ WKH ,UHJLRQ UHYHDOV YDULDEOH DQG FRQVHUYHG WUDFWV RI '1$ 6WHLQPHW] HW DO 7DUQX]]HU f 7KH FHQWURPHULF KDOI RI WKH UHJLRQ WKDW HQFRGHV WKH $E $D DQG n SRUWLRQ RI WKH (E

PAGE 37

JHQH VKRZV H[WHQVLYH SRO\PRUSKLVP DQG DOOHOLF YDULDELOLW\ 2Q WKH RWKHU KDQG WKH WHORPHULF SRUWLRQ RI WKH ,UHJLRQ HQFRGLQJ WKH n SRUWLRQ RI WKH (E JHQH (E DQG (D GLVSOD\V OLWWOH SRO\PRUSKLVP 7KH ERXQGDU\ UXQV WKURXJK WKH (E JHQH FORVH WR DQG SHUKDSV RYHUODSSLQJ ZLWK WKH UHFRPELQDWLRQDO KRWVSRW LQ WKH LQWURQ EHWZHHQ (EO DQG (E H[RQV 1XFOHRWLGH VHTXHQFH FRPSDULVRQV RI WKH IRXU IXQFWLRQDO FODVV ,, JHQHV GHULYHG IURP ODERUDWRU\ VWUDLQV RI PLFH LV FRQVLVWHQW ZLWK WKH REVHUYDWLRQV PDGH DW WKH 5)/3 OHYHO $E $D DQG (E DUH SRO\PRUSKLF ZKHUHDV (D LV QRW %HQRLVW HW DO D E &KRL HW DO 0DOLVVHQ HW DO 0HQJOH*DZ DQG 0F'HYLWW (VWHVV HW DO f $OOHOLF QXFOHRWLGH VHTXHQFH YDULDWLRQ FDQ EH H[WHQVLYH DOOHOHV RI $E RU $D FRPPRQO\ GLIIHU E\ b RI WKHLU QXFOHRWLGH VHTXHQFH %HQRLVW HW DO E (VWHVV HW DO f 7KXV WKH 5)/3 DQG QXFOHRWLGH VHTXHQFH GDWD VXJJHVW WKDW WKH GLYHUVLW\ LV LQGHHG JUHDWHU LQ ERWK WKH FRGLQJ DQG QRQn FRGLQJ UHJLRQV RI WKH YDULDEOH WUDFW DV FRPSDUHG WR WKH FRQVHUYHG WUDFW RI WKH ,UHJLRQ 1XFOHRWLGH VHTXHQFH DQDO\VLV RI WKH $E $D DQG (E JHQHV IURP GLIIHUHQW ODERUDWRU\ VWUDLQV RI PLFH DOO LQGLFDWH WKDW WKH PDMRULW\ RI WKH GLYHUVLW\ LV ORFDOL]HG LQ WKH DPLQR WHUPLQXV RI WKH PROHFXOH VSHFLILFDOO\ WKH DO DQG EO H[RQV &KRL HW DO %HQRLVW HW DO E (VWHVV HW DO f 7KHVH DUH WKH H[RQV WKDW HQFRGH WKH DQWLJHQ ELQGLQJ

PAGE 38

VLWH %URZQ HW DO f &ORVHU LQVSHFWLRQ RI WKH QXFOHRWLGH VHTXHQFH YDULDWLRQ RI WKH $E $D DQG (E JHQHV UHYHDOV WKDW PRVW RI WKH VXEVWLWXWLRQV DUH FOXVWHUHG LQWR UHJLRQV RI K\SHUYDULDELOLW\ %HQRLVW HW DO E 0HQJOH *DZ DQG 0F'HYLWW (VWHVV HW DO f 7KLV GLYHUVLW\ LV DOVR VHHQ DW WKH DPLQR DFLG OHYHO )RU LQVWDQFH D .DEDW DQG :X YDULDELOLW\ SORW .DEDW DQG :X f RI WKH $D DOOHOHV VHTXHQFHG E\ %HQRLVW HW DO Ef LOOXVWUDWHV WKDW WKH DPLQR DFLG VXEVWLWXWLRQV IDOO LQWR WZR K\SHUYDULDEOH UHJLRQV DW UHVLGXHV DQG UHVLGXHV +XJKHV DQG 1HL KDYH H[DPLQHG WKH SDWWHUQV RI QXFOHRWLGH VXEVWLWXWLRQV DW ERWK WKH FODVV ORFL Df DQG WKH FODVV ,, ORFL f RI ERWK KXPDQV DQG PRXVH 7KH UDWHV RI QRQV\QRQ\PRXV UHSODFHPHQWf VXEVWLWXWLRQV YHUVXV V\QRQ\PRXV VLOHQWf VXEVWLWXWLRQV ZDV PHDVXUHG IRU WKH YDULRXV GRPDLQV RI WKH 0KF PROHFXOHV ,Q ERWK FODVV DQG FODVV ,, ORFL WKH PHPEUDQH GLVWDO GRPDLQV HQFRGLQJ WKH DQWLJHQ ELQGLQJ VLWH KDG D PXFK KLJKHU UDWH RI QRQV\QRQ\PRXV YHUVXV V\QRQ\PRXV VXEVWLWXWLRQV 7KLV ZDV FRQWUDVWHG E\ WKH RWKHU SDUWV RI WKH PROHFXOHV ZKHUH WKH UHYHUVH ZDV REVHUYHG WKH UDWH RI V\QRQ\PRXV VXEVWLWXWLRQV H[FHHGHG WKDW RI QRQV\QRQ\PRXV VXEVWLWXWLRQV 7KHVH REVHUYDWLRQV LOOXVWUDWH WKH H[WHQVLYH SRO\PRUSKLVP RI 0KF FODVV ,, JHQHV DQG LPSO\ WKDW WKLV JHQHWLF GLYHUVLW\ UHIOHFWV D XQLTXH DQG LPSRUWDQW ELRORJLFDO UROH IRU WKHVH PROHFXOHV 7KH IXQFWLRQDO VLJQLILFDQFH RI

PAGE 39

WKLV SRO\PRUSKLVP LV VWLOO XQFOHDU DOWKRXJK LW LV WKRXJKW WR GLUHFWO\ UHODWH WR GLVHDVH VXVFHSWLELOLW\ ,Q DGGLWLRQ WKH HYROXWLRQDU\ RULJLQ RI 0KF DOOHOLF GLYHUVLW\ LV XQNQRZQ KRZHYHU WZR K\SRWKHVHV GRPLQDWH VSHFXODWLRQV UHWHQWLRQ RI DQFHVWUDO SRO\PRUSKLVPV .OHLQ f DQG K\SHUPXWDWLRQDO GLYHUVLILFDWLRQ 3HDVH f 5HWHQWLRQ RI $QFHVWUDO 3RO\PRUSKLVPV .OHLQ f ILUVW SRVWXODWHG WKDW WKH H[WHQVLYH GLYHUVLILFDWLRQ RI 0KF DOOHOHV FRXOG EH H[SODLQHG E\ WUDQVn VSHFLHV HYROXWLRQ WKH K\SRWKHVLV WKDW PRVW 0KF DOOHOHV GLYHUJHG SULRU WR WKH RULJLQ RI WKH VSHFLHV LQ ZKLFK WKH\ DUH SUHVHQWO\ IRXQG 7KH GLYHUJHQFH RI FRQWHPSRUDU\ 0KF DOOHOHV WKHUHIRUH UHIOHFWV WKH VWHDG\ DFFXPXODWLRQ RI PXWDWLRQV RYHU ORQJ HYROXWLRQDU\ WLPHVSDQV UDWKHU WKDQ K\SHUPXWDWLRQDO GLYHUVLILFDWLRQ VXEVHTXHQW WR VSHFLDWLRQ 7KH K\SRWKHVLV RI UHWHQWLRQ RI DQFHVWUDO SRO\PRUSKLVPV SRVWXODWHV WKDW DOOHOLF OLQHDJHV RI 0KF JHQHV DUH PDLQWDLQHG IRU H[WUHPHO\ ORQJ HYROXWLRQDU\ SHULRGV LQ QDWXUDO SRSXODWLRQV LQGHSHQGHQW RI VSHFLDWLRQ HYHQWV )LJXUH f 7KLV SUHGLFWV WKDW VHOHFWLRQ PD\ DFW WR PDLQWDLQ VSHFLILF VHWV RI DOOHOHV ZLWK VSHFLILF DQWLJHQ ELQGLQJ VLWHV DQG FRQVHTXHQWO\ ELQGLQJ SURSHUWLHV 7KH PRVW FRPPRQ DOOHOLF OLQHDJHV ZRXOG HQFRGH DQWLJHQ ELQGLQJ VLWHV ZKLFK DUH RSWLPDO IRU WKH SUHVHQWDWLRQ RI WKH DQWLJHQLFLW\ H[SUHVVHG E\ WKH SUHYDOHQW HQGHPLF SDWKRJHQV

PAGE 40

)LJXUH $ GLDJUDPPDWLF LOOXVWUDWLRQ FRQWUDVWLQJ WKH HYROXWLRQDU\ KLVWRULHV RI QXFOHDU JHQHV $f DQG 0KF JHQHV %f 7KH FURVVKDWFKHG YHUWLFDO OLQHV UHSUHVHQW VSHFLDWLRQ HYHQWV 9HUWLFDO OLQHV UHSUHVHQW DOOHOHV RU OLQHDJHV RI DOOHOHV ,Q WKH FDVH RI QXFOHDU JHQHV DOO WKH GLYHUVLW\ ZLWKLQ D VSHFLHV ZDV JHQHUDWHG DIWHU VSHFLDWLRQ HYHQWV 0KF JHQHV RQ WKH RWKHU KDQG KDYH LQKHULWHG PXOWLSOH DOOHOHV RU OLQHDJHV RI DOOHOHV DW WKH WLPH RI LQFHSWLRQ RI D VSHFLHV WKHUHE\ LOOXVWUDWLQJ WKH UHWHQWLRQ RI DQFHVWUDO SRO\PRUSKLVPV 6RPH DOOHOHV LQ ERWK H[DPSOHV KDYH EHHQ ORVW SUHVXPDEO\ WR UDQGRP JHQHWLF GULIW

PAGE 41

UYYYYYAL $QFHVWUDO $ 086 $QFHVWUDO % 086 /2 /2

PAGE 42

7KH ILUVW H[SHULPHQWDO VXSSRUW IRU WKLV K\SRWKHVLV GHPRQVWUDWHG WKDW 0KF FODVV PROHFXOHV GHULYHG IURP GLIIHUHQW VXEVSHFLHV RI WKH 0XV PXVFXOXV FRPSOH[ KDG LGHQWLFDO VHURORJLFDO UHDFWLYLWLHV DQG WU\SWLF SHSWLGH PDSV $UGHQ DQG .OHLQ f 'LUHFW HYLGHQFH IXUWKHU LOOXVWUDWLQJ WKH DQWLTXLW\ RI 0KF JHQHV ZDV UHSRUWHG E\ 0F&RQQHOO HW DO f 7KLV VWXG\ DQDO\]HG $E JHQH SRO\PRUSKLVP E\ 5)/3 DQDO\VLV DQG UHYHDOHG WKDW JUHDWHU WKDQ b RI WKH DOOHOHV H[DPLQHG FRXOG EH RUJDQL]HG LQWR WZR HYROXWLRQDU\ OLQHDJHV EDVHG RQ WKH SUHVHQFH RU DEVHQFH RI DQ EDVHSDLU UHWURSRVRQ LQVHUWLRQ LQWR WKH LQWURQ EHWZHHQ WKH $EO DQG $E H[RQV 7KH IODQNLQJ GLUHFW UHSHDWV RI KRVW GHULYHG VHTXHQFHV RQ HLWKHU VLGH RI WKH UHWURSRVRQ LQGLFDWH WKDW WKH LQVHUWLRQ LQWR WKLV SRVLWLRQ ZDV D UDQGRP HYHQW GXULQJ WKH HYROXWLRQDU\ GLYHUJHQFH RI $E $E DOOHOHV ZLWK DQG ZLWKRXW WKH UHWURSRVRQ LQVHUWLRQ ZHUH IRXQG LQ VSHFLHV DQG VXEVSHFLHV RI WKH JHQXV 0XV GHPRQVWUDWLQJ WKDW WKLV SRO\PRUSKLVP DURVH LQ WKH DQFHVWRUV RI PRGHUQ 0XV VSHFLHV DQG ZDV PDLQWDLQHG DV D SRO\PRUSKLVP DFURVV PXOWLSOH VSHFLDWLRQ HYHQWV 7KHVH ILQGLQJV KDYH VXEVHTXHQWO\ EHHQ H[WHQGHG WR LQGHSHQGHQWO\ GHULYHG $E DOOHOHV UHSUHVHQWLQJ GLIIHUHQW VSHFLHV RU VXEVSHFLHV RI WKH JHQXV 0XV $E DOOHOHV IURP ERWK OLQHDJHV DUH SUHVHQW LQ 0XV FDUROL GHPRQVWUDWLQJ WKDW DOOHOHV LQ WKHVH WZR OLQHDJHV GLYHUJHG DW OHDVW PLOOLRQ \HDUV DJR )LJXUH f/X HW DO f

PAGE 43

)LJXUH $Q LOOXVWUDWLRQ RI WKH HYROXWLRQDU\ RULJLQV RI WKH WKUHH HYROXWLRQDU\ OLQHDJHV RI $E DOOHOHV 7KH VROLG OLQH UHSUHVHQWV HYROXWLRQDU\ OLQHDJH 7KH VWLSSOHG OLQH UHSUHVHQWV HYROXWLRQDU\ OLQHDJH ZKLFK ZDV IRUPHG E\ D UHWURSRVRQ LQVHUWLRQ LQWR D OLQHDJH DOOHOH EHIRUH WKH VHSDUDWLRQ RI WKH 0XV VSHFLHV DVVD\HG (YROXWLRQDU\ OLQHDJH LV UHSUHVHQWHG E\ WKH FURVVKDWFKHG OLQH DQG ZDV IRUPHG E\ DQ DGGLWLRQDO LQVHUWLRQ LQWR D OLQHDJH DOOHOH VXEVHTXHQW WR WKH LQFHSWLRQ RI WKH 0XV PXVFXOXV FRPSOH[ /X HW DO f

PAGE 44

$QFHVWUDO 0XV /LQHDJH ,QVHUWLRQ LQ $A! SURGXFHV /LQHDJH ,QVHUWLRQ LQ /LQHDJH SURGXFHV /LQHDJH 0RGHUQ 0XV PGRP PPXV PFDV _SWG KRUW VSUHWXV HHU\ FRRNL FDUROL +L" 7HVWHG

PAGE 45

1XFOHRWLGH VHTXHQFH DQDO\VLV RI $E DOOHOHV KDV UHYHDOHG WKDW VRPH RI WKHVH JHQHV KDYH D GHOHWLRQ RI WZR FRGRQV ZKLOH RWKHUV GR QRW &KRL HW DO (VWHVV HW DO f 7KH GHOHWLRQV RFFXU LQ H[RQ DW DPLQR DFLG SRVLWLRQV DQG )LJXHURD HW DO f UHSRUW $E VSHFLILF PRQRFORQDO DQWLERGLHV WKDW FRUUHODWH SHUIHFWO\ ZLWK WKH WZR W\SHV RI $E JHQHV 7KH +$P DQWLERG\ UHDFWV ZLWK WKH $E FKDLQV WKDW KDYH WKH WZR GHOHWLRQV DQG WKH +$P DQWLERG\ UHDFWV ZLWK $E FKDLQV WKDW DUH XQGHOHWHG 6WUDLQV WKDW DUH KRPR]\JRXV IRU $E VKRZ D SHUIHFWO\ DQWLWKHWLFDO UHODWLRQVKLS EHWZHHQ WKH GHWHUPLQDQWV WKDW WKHVH DQWLERGLHV GHWHFW WKH\ DUH HLWKHU PSRVLWLYH DQG PQHJDWLYH RU YLFD YHUVD 1R PROHFXOH KDV EHHQ IRXQG WKDW UHDFWV ZLWK ERWK DQWLERGLHV DQG RQO\ RQH PROHFXOH UHDFWV ZLWK QHLWKHU RI WKH WZR DQWLERGLHV 8WLOL]LQJ WKHVH WZR DQWLERGLHV DQG 1RUWKHUQ EORW K\EULGL]DWLRQ ZLWK DOOHOHVSHFLILF ROLJRQXFOHRWLGHV )LJXHURD HW DO f ZKHUH DEOH WR GHPRQVWUDWH WKH SUHVHQFH RU DEVHQFH RI WKH DPLQR DFLG SRVLWLRQ GHOHWLRQ SRO\PRUSKLVP LQ VSHFLHV DQG VXEVSHFLHV RI WKH JHQXV 0XV LQ DGGLWLRQ WR 5DWWXV QRUYHRLFXV 7KLV GDWD LQGLFDWHV WKDW WKH GHOHWLRQ SRO\PRUSKLVP DOUHDG\ H[LVWHG LQ WKH ODVW FRPPRQ DQFHVWRU RI PLFH DQG UDWV $ QXPEHU RI GLIIHUHQW PXWDWLRQV DIIHFWLQJ ERWK WKH D DQG E FKDLQV RI WKH ( PROHFXOH FDQ UHVXOW LQ ( PROHFXOH QRQn H[SUHVVLRQ -RQHV HW D f 7KHVH PXWDWLRQV ZLOO EH GLVFXVVHG DW JUHDWHU GHSWK LQ WKH IROORZLQJ VHFWLRQV RI WKLV

PAGE 46

OLWHUDWXUH UHYLHZf 0DQ\ RI WKHVH PXWDWLRQV FDQ EH LGHQWLILHG LQ PLFH IURP PXOWLSOH VSHFLHV DQG VXEVSHFLHV RI WKH JHQXV 0XV LQGLFDWLQJ WKDW WKH PXWDWLRQV ZHUH DOUHDG\ SUHVHQW LQ QDVFHQW VSHFLHV DQG VXUYLYHG PXOWLSOH VSHFLDWLRQ HYHQWV 7KH IDFW WKDW PDQ\ RI WKHVH SRO\PRUSKLVPV DUH IRXQG LQ PXOWLSOH VSHFLHV UHTXLUHV WKDW WKH GLIIHUHQW DOOHOHV EH SUHVHQW DW UHODWLYHO\ KLJK IUHTXHQFLHV LQ WKH VSHFLHVn IRXQGLQJ SRSXODWLRQV 7KHVH IRXQGLQJ SRSXODWLRQV PXVW DOVR KDYH EHHQ RI UHDVRQDEO\ ODUJH VL]HV ,I HLWKHU RI WKHVH WZR FULWHULRQ KDG QRW EHHQ PHW WKHUH ZRXOG EH D KLJK OLNHOLKRRG RI ORVLQJ WKH SRO\PRUSKLVP E\ UDQGRP GULIW SDUWLFXODUO\ WKH UHWURSRVRQ SRO\PRUSKLVP LQ WKH LQWURQ RI $E ZKHUH VHOHFWLRQ ZRXOG SUHVXPDEO\ DFW DW D PLQLPXP 1HL f 7KHVH ILQGLQJV WRJHWKHU ZLWK VLPLODU UHVXOWV IRU SULPDWHV /DZOHU HW DO 3DUKDP HW DO *\OOHQVWHQ DQG (UOLFK 0D\HU HW DO f GHPRQVWUDWH WKDW WKH UHWHQWLRQ RI DQFHVWUDO SRO\PRUSKLVPV RYHU H[WUHPHO\ ORQJ HYROXWLRQDU\ SHULRGV FDQ DFFRXQW IRU WKH H[WHQVLYH GLYHUVLW\ VHHQ LQ PRGHUQ 0KF DOOHOHV LQ QDWXUDO SRSXODWLRQV RI URGHQWV +YRHUPXWDWLRQDO 'LYHUVLILFDWLRQ RI &ODVV ,, *HQHV 7KH SUHVHQFH RI K\SHUYDULDEOH UHJLRQV RI '1$ ZLWKLQ FODVV ,, JHQHV VXJJHVWV WKDW K\SHUPXWDWLRQDO PHFKDQLVPV VXFK DV JHQH FRQYHUVLRQ RU VHJPHQWDO H[FKDQJH PD\ EH RSHUDWLQJ WR

PAGE 47

UDSLGO\ GLYHUVLI\ WKH UHJLRQV RI 0KF JHQHV UHVSRQVLEOH IRU LPPXQH UHVSRQVLYHQHVV 7KLV K\SRWKHVLV SUHGLFWV WKDW PRVW RI WKH SRO\PRUSKLVP ZLOO EH JHQHUDWHG ZLWKLQ WKH OLIHWLPH RI D VSHFLHV SRWHQWLDOO\ DOORZLQJ DOOHOHV WR UDSLGO\ DGDSW WR FKDQJHV LQ WKH DQWLJHQLFLW\ RI HQGHPLF SDWKRJHQV 3HDVH f *HQH FRQYHUVLRQ RU VHJPHQWDO H[FKDQJH ZDV RULJLQDOO\ GHILQHG LQ IXQJL 5DGGLQJ HW DO f DQG LV D PHFKDQLVP E\ ZKLFK '1$ VHTXHQFH LV FRSLHG RU WUDQVIHUUHG IURP RQH JHQH WR DQRWKHU $OWKRXJK WKH '1$ VHTXHQFHV FDQ EH WUDQVIHUUHG g WR DQG IURP JHQHV DQ\ZKHUH LQ WKH JHQRPH LW LV PRUH FRPPRQ WR RFFXU ZLWKLQ PXOWLJHQLF RU PXOWLDOOHOLF IDPLOLHV %DOWLPRUH 5REHUWVRQ 6OLJKWRP HW DO f *HQH FRQYHUVLRQ LV GHILQHG E\ WKH '1$ WUDQVIHU EHWZHHQ GLVFUHWH ORFL ZKHUHDV LQWUDJHQLF VHJPHQWDO H[FKDQJH RFFXUV EHWZHHQ DOOHOHV RI D SDUWLFXODU ORFXV 3DLULQJ EHWZHHQ SDUWLDOO\ KRPRORJRXV VHTXHQFHV GXULQJ PHLRVLV RU PLWRVLV LV IROORZHG E\ PLVPDWFK UHSDLU WKHUHE\ FRQYHUWLQJ SDUW RI RQH VHTXHQFH WR WKDW RI DQRWKHU 7KH SULPDU\ HYLGHQFH IRU JHQH FRQYHUVLRQ HYHQWV LV WKH FOXVWHULQJ RI QXFOHRWLGH VXEVWLWXWLRQV 7KLV SDWWHUQ RI GLYHUVLW\ LV FOHDUO\ GRFXPHQWHG LQ 0KF FODVV JHQHV 0HOORU HW DO :HLVV HW DO 1DWKHQVRQ HW D-/ *HOLHEWHU DQG 1DWKHQVRQ f 'LUHFW HYLGHQFH IRU JHQH FRQYHUVLRQ LQ 0KF FODVV ,, JHQHV KDV EHHQ UHSRUWHG E\ 0HQJOH*DZ HW DO f ZKHUH

PAGE 48

DQ DOORUHDFWLYH 7 FHOO FORQH UHFRJQL]HG D GHWHUPLQDWH SUHVHQW RQ ERWK WKH (E DQG $EEPOOILROHFXOHV 1XFOHRWLGH VHTXHQFH FRPSDULVRQV EHWZHHQ $E $E DQG (E &KRL HW DO 0F,QW\UH DQG 6HLGPDQ f UHYHDOHG WKDW WKH $E AVHTXHQFH LV LGHQWLFDO WR (E LQ WKH UHJLRQ ZKHUH LW GLIIHUV IURP $EE 7KH UHJLRQ H[FKDQJHG PXVW KDYH HQFRPSDVVHG D PLQLPXP RI QXFOHRWLGHV EHFDXVH WKH QXFOHRWLGH FKDQJHV RFFXUUHG LQ WKLV EDVH SDLU VWUHWFK 7KH DUHD RI H[FKDQJH LV IODQNHG E\ UHJLRQV RI H[DFW KRPRORJ\ H[WHQGLQJ IRU QXFOHRWLGHV n DQG QXFOHRWLGHV n 0F&RQQHOO HW DO f GHPRQVWUDWHG HYLGHQFH IRU VHJPHQWDO H[FKDQJH RFFXUULQJ LQ 0KF FODVV ,, JHQHV %\ H[DPLQLQJ WKH QXFOHRWLGH VHTXHQFH RI HLJKW DOOHOHV RI $E WKH VHTXHQFH RI WKH $E H[RQ RI DOO DOOHOHV FRUUHVSRQGHG WR WKH DSSURSULDWH JHQRPLF HYROXWLRQDU\ OLQHDJH DV GHILQHG E\ WKH UHWURSRVRQ LQVHUWLRQ +RZHYHU WKH QXFOHRWLGH VHTXHQFH RI WKH $EO H[RQ RI WZR RI WKH DOOHOHV $E DQG QUO $E GLG QRW UHIOHFW WKHLU HYROXWLRQDU\ OLQHDJH DQG WKHUHIRUH UHIOHFWV WKH H[FKDQJH RI VHTXHQFH E\ VHJPHQWDO H[FKDQJH IURP DOOHOHV RI D GLIIHUHQW HYROXWLRQDU\ OLQHDJH )LJXUH f $W SUHVHQW WKH UHODWLYH LPSRUWDQFH RI UHFRPELQDWLRQDO PHFKDQLVPV YHUVXV WKH DFFXPXODWLRQ RI SRLQW PXWDWLRQV RYHU ORQJ HYROXWLRQDU\ SHULRGV LQ WKH JHQHUDWLRQ RI 0KF FODVV ,, JHQH GLYHUVLW\ KDV \HW WR EH GHWHUPLQHG 7KLV LV RQH WKH JRDOV RI WKLV GLVVHUWDWLRQ

PAGE 49

)LJXUH $ GLDJUDP VXPPDUL]LQJ WKH UHODWLRQVKLSV RI WKH VHTXHQFH SRO\PRUSKLVPV LQ WKH $EO DQG $E H[RQV ZLWK WKH UHWURSRVRQ SRO\PRUSKLVPV ZKLFK RFFXU LQ WKH LQWURQ EHWZHHQ WKHP 6L[ RI WKH HLJKW $EO DOOHOHV KDYH H[RQ VHTXHQFH SRO\PRUSKLVPV WKDW DUH DVVRFLDWHG ZLWK WKH UHWURSRVRQ SRO\PRUSKLVP 7KH UHPDLQLQJ WZR DOOHOHV $ DQG $EQRG DSSHDU WR KDYH EHHQ SURGXFHG E\ LQWUDJHQLF VHJPHQWDO H[FKDQJH HYHQWV $GDSWHG IURP 0F&RQQHOO HW DO f

PAGE 50

$6f $ /LQHDJH $OOHOH ([RQ E QRG LQWURQ LQVHUWLRQV $ ([RQ ,QWUDJHQLF VHJPHQWDO H[FKDQJH

PAGE 51

)XQFWLRQDO 5ROH RI 0KF 3RO\PRUSKLVP 5HJXODWRU\ 7 O\PSKRF\WHV DUH UHVSRQVLEOH IRU LQLWLDWLQJ DQG FRRUGLQDWLQJ DQWLJHQ VSHFLILF LPPXQH UHVSRQVHV $FWLYDWLRQ RI YLUJLQ 7 UHJXODWRU\ FHOOV RU UHJXODWRU\ 7 FHOOV WKDW KDYH QRW FRPH LQWR FRQWDFW ZLWK WKHLU VSHFLILF OLJDQG LV GHSHQGDQW XSRQ D VHW RI VLJQDOV GHOLYHUHG E\ WKH DQWLJHQ SUHVHQWLQJ FHOO 7KLV VWULQJHQF\ LV GHVLJQHG WR PDLQWDLQ WKH VSHFLILFLW\ RI WKH UHVXOWDQW LPPXQH UHVSRQVH DQG HQVXUH WKH LQDFWLYLW\ RI DXWRUHDFWLYH 7 FHOOV )LUVW UHJXODWRU\ 7 O\PSKRF\WHV PXVW UHFRJQL]H SURFHVVHG SHSWLGH DQWLJHQ ERXQG WR PROHFXOHV HQFRGHG E\ WKH ,UHJLRQ RI WKH PDMRU KLVWRFRPSDWLELOLW\ FRPSOH[ 7KLV UHFRJQLWLRQ LV DFKLHYHG YLD 7 FHOO VXUIDFH VWUXFWXUHV LQFOXGLQJ WKH FORQDOO\ GLVWULEXWHG 7 FHOO DQWLJHQ UHFHSWRU DQG WKH FRn UHFHSWRU PROHFXOH &' 6HFRQG WKH DQWLJHQ SUHVHQWLQJ FHOO PXVW SURYLGH D FRVWLPXODWRU\ VLJQDO VXFK DV WKH PHPEUDQH IRUP RI LQWHUOHXNLQ 7KH UHJXODWRU\ 7 FHOO PXVW UHFHLYH ERWK RI WKHVH VLJQDOV LQ WDQGHP (LWKHU VLJQDO DORQH LV QRW VXIILFLHQW WR LQGXFH 7 O\PSKRF\WH DFWLYDWLRQ RU WKH VXEVHTXHQW LPPXQH UHVSRQVH WR WKH DQWLJHQ IURP ZKLFK WKH SHSWLGH ZDV GHULYHG &ODVV ,, PROHFXOHV SOD\ D FUXFLDO UROH LQ WKLV DQWLJHQ SUHVHQWLQJ FHOO7 FHOO LQWHUDFWLRQ 7KHLU IXQFWLRQ LV WR

PAGE 52

DFW DV SURPLVFXRXV UHFHSWRUV IRU DQWLJHQ IUDJPHQWV WKHUHE\ PDNLQJ WKHP UHFRJQL]DEOH WR 7 O\PSKRF\WHV 7KHVH WZR HYHQWV DQWLJHQ ELQGLQJ E\ FODVV ,, PROHFXOHV DQG UHJXODWRU\ 7 O\PSKRF\WH UHFRJQLWLRQ RI WKH UHVXOWDQW ELPROHFXODU FRPSOH[ QRW RQO\ IRUPV WKH EDVLV IRU DQWLJHQ VSHFLILF LPPXQH UHVSRQVLYHQHVV EXW LQ DGGLWLRQ GHWHUPLQHV WR D ODUJH H[WHQW WKH LQWHQVLW\ RI WKH HQVXLQJ LPPXQH UHVSRQVH 5HJXODWLRQ RI ([SUHVVLRQ RI &ODVV ,, 0ROHFXOHV &RQVLVWHQW ZLWK WKHLU IXQFWLRQ WR ELQG DQG SUHVHQW DQWLJHQ WR UHJXODWRU\ 7 O\PSKRF\WHV WKH H[SUHVVLRQ RI FODVV ,, PROHFXOHV LV UHVWULFWHG WR WKH DQWLJHQ SUHVHQWLQJ FHOOV RI WKH ERG\ 7KHVH DQWLJHQ SUHVHQWLQJ FHOO W\SHV LQFOXGH PDFURSKDJH GHQGULWLF FHOOV % O\PSKRF\WHV DQG WK\PLF HSLWKHOLDO FHOOV 0DFURSKDJH DUH WKH SULPDU\ DQWLJHQ SUHVHQWLQJ FHOO LQ WKH ERG\ 8QDQXH DQG $OOHQ f DQG DV VXFK KDYH WKH XQLTXH DELOLW\ WR WULJJHU YLUJLQ 7 FHOOV /DVVLOD HW DO f +RZHYHU UHVWLQJ PDFURSKDJH GR QRW FRQVWLWXWLYHO\ H[SUHVV FODVV ,, PROHFXOHV RQ WKHLU VXUIDFH UDWKHU FHOO VXUIDFH H[SUHVVLRQ LV XQGHU ERWK SRVLWLYH DQG QHJDWLYH FRQWURO 6WHLQPDQ HW DO 6Q\GHU HW DO f 6XSHUQDWDQWV RI PLWRJHQ DFWLYDWHG 7 FHOOV LQGXFH WKH FHOO VXUIDFH H[SUHVVLRQ RI FODVV ,, PROHFXOHV RQ PDFURSKDJH 0F1LFKROV f %LRFKHPLFDO DQDO\VLV RI WKH LQGXFLQJ FRPSRQHQW RI WKHVH VXSHUQDWDQWV KDYH GHWHUPLQHG WKH IDFWRU

PAGE 53

WR EH JDPPDLQWHUIHURQ 6WHHJ HW DO .LQJ DQG -RQHV f *DPPDLQWHUIHURQ LQFUHDVHV WKH FHOO VXUIDFH H[SUHVVLRQ RI ERWK WKH $ DQG ( PROHFXOHV DV ZHOO DV FODVV PROHFXOHV 7KLV FRQWURO DSSHDUV WR DFW DW WKH OHYHO RI WUDQVFULSWLRQ VXFK WKDW WKHUH LV D FRRUGLQDWH LQFUHDVH LQ WKH OHYHO RI P51$ RI DOO IRXU FODVV ,, FKDLQV ZLWKLQ KRXUV RI WUHDWPHQW ZLWK JDPPDLQWHUIHURQ 3DXOQRFN.LQJ HW DO f 3URVWRJODQGLQV JOXFRFRUWLFRLGV DQG WKH EDFWHULDO HQGRWR[LQ /36 KDYH DOO EHHQ VKRZQ WR KDYH D QHJDWLYH HIIHFW RQ WKH FHOO VXUIDFH H[SUHVVLRQ RI FODVV ,, PROHFXOHV 6Q\GHU HW DO $EHUHU HW DO 6WHHJ HW DO f 3UHFXUVRU % O\PSKRF\WHV GR QRW H[SUHVV FODVV ,, PROHFXOHV KRZHYHU PDWXUH % FHOOV DQG SODVPD FHOOV VKRZ KHWHURORJRXV FRQVWLWXWLYH OHYHOV RI FODVV ,, RQ WKHLU VXUIDFH 0RQG HW D0RQURH DQG &DPELHU f 7KH OHYHOV RI FODVV ,, H[SUHVVLRQ RQ UHVWLQJ % FHOOV FDQ EH DXJPHQWHG E\ LQFXEDWLRQ ZLWK PLWRJHQ DFWLYDWHG 7 FHOO VXSHUQDWDQWV 5RHKP HW DO f DQG VXEVHTXHQW VWXGLHV KDYH VKRZQ WKH IDFWRU UHVSRQVLEOH IRU WKLV WR EH LQWHUOHXNLQ %6)f1RHOOH MHW DO f ,QWHUOHXNLQ FDQ LQGXFH WKH OHYHOV RI FODVV ,, P51$ ZLWKLQ RQH KRXU DQG FHOO VXUIDFH H[SUHVVLRQ OHYHOV DV HDUO\ DV WZR KRXUV DIWHU LQFXEDWLRQ RI % FHOOV 3ROOD HW DO f % O\PSKRF\WHV GR QRW KDYH WKH DELOLW\ WR DFWLYDWH YLUJLQ 7 FHOOV /DVVLOD HW DO f +RZHYHU WKH\ PD\ SOD\ DQ LQWHJUDO UROH LQ DQWLJHQ SUHVHQWDWLRQ GXULQJ D VHFRQGDU\ 7 FHOO UHVSRQVH

PAGE 54

EHFDXVH RI WKHLU DELOLW\ WR SLFN XS DQG GLVSOD\ PLQXWH TXDQWLWLHV RI DQWLJHQ /DQ]DYHFFKLD f 7KHVH LQGXFWLRQ PHFKDQLVPV IRU FODVV ,, PROHFXOH H[SUHVVLRQ LOOXVWUDWHV WKH LPSRUWDQFH RI FODVV ,, PROHFXOH FHOO VXUIDFH H[SUHVVLRQ WR WKH LQWHUDFWLRQ RI UHJXODWRU\ 7 O\PSKRF\WHV DQG DQWLJHQ SUHVHQWLQJ FHOOV UHVXOWLQJ LQ DQ LPPXQH UHVSRQVH )XUWKHUPRUH WKLV H[SUHVVLRQ RI FODVV ,, PROHFXOHV RQ OLPLWHG FHOO W\SHV HQVXUHV UHJXODWRU\ 7 FHOO UHDFWLYLW\ FDQ WDNH SODFH RQO\ ZKLOH LQWHUDFWLQJ ZLWK VHOHFWHG FHOOV RI WKH ERG\ 7KLV LQWURGXFHV D FRQWURO PHFKDQLVP WR HQVXUH WKH LQDFWLYLW\ RI DXWRUHDFWLYH 7 FHOOV 7KH )XQFWLRQDO ([SUHVVLRQ RI &ODVV ,, 0ROHFXOHV ,QLWLDO VHURORJLFDO DQG ELRFKHPLFDO FKDUDFWHUL]DWLRQ RI 0KF FODVV ,, PROHFXOHV UHYHDOHG D KHWHURGLPHULF JO\FRSURWHLQ UHTXLULQJ WKH DVVRFLDWLRQ RI ERWK WKH D DQG E FKDLQV -RQHV e -RQHV HW DO f 6HURORJLFDO DQDO\VLV RI FODVV ,, PROHFXOHV H[SUHVVHG LQ LQEUHG DQG ZLOG PLFH KDV VKRZQ WKH $ PROHFXOH H[SUHVVHG LQ DOO SRSXODWLRQV RI PLFH H[DPLQHG +RZHYHU IRXU RI HOHYHQ LQEUHG VWUDLQV DQG b RI ZLOG KDSORW\SH PLFH IDLO WR H[SUHVV DQ ( PROHFXOH RQ WKH FHOO VXUIDFH -RQHV HW DO 1L]HWLF HW DO f $QDO\VLV RI WKH (D DQG (E SRO\SHSWLGHV RI WKH IRXU LQEUHG (VWUDLQV E\ GLPHQVLRQDO JHO HOHFWURSKRUHVLV UHYHDOHG WKDW WKH +E DQG WKH +6 PLFH V\QWKHVL]H QRUPDO (E FKDLQV EXW GR QRW H[SUHVV (D FKDLQV ZKHUHDV WKH +I DQG +A PLFH GR QRW

PAGE 55

V\QWKHVL]H HLWKHU (D RU (E FKDLQV -RQHV HW D -RQHV HW DO f 5HFHQWO\ WKH PROHFXODU GHIHFWV UHVXOWLQJ LQ ( PROHFXOH QRQH[SUHVVLRQ KDYH EHHQ LGHQWLILHG DQG WKXV IDU VHYHQ LQGHSHQGHQW GHIHFWV KDYH EHHQ GHWHFWHG -RQHV HW DO f F B 7KH (D JHQH RI WKH + DQG + KDSORW\SHV KDYH D EDVH SDLU GHOHWLRQ HQFRPSDVVLQJ WKH SURPRWHU DQG ILUVW H[RQ 0DWKLV HW DO f 7KH (DT JHQH KDV D VLQJOH QXFOHRWLGH LQVHUWLRQ LQ FRGRQ FDXVLQJ D IUDPHVKLIW OHDGLQJ WR D I VWRS FRGRQ DW SRVLWLRQ 9X HW DO f 7KH (D JHQH DOVR KDV D VLQJOH QXFOHRWLGH LQVHUWLRQ EXW DW FRGRQ WKHUHE\ JHQHUDWLQJ D GRZQVWUHDP VWRS FRGRQ 9X HW D f 7KH (E PXWDWLRQ RI WKH +ZAQG +ZKDSORW\SHV LV D VLQJOH QXFOHRWLGH VXEVWLWXWLRQ DW FRGRQ JHQHUDWLQJ D VWRS FRGRQ 7KHUH DUH DOVR WZR LQGHSHQGHQW PXWDWLRQV RFFXUULQJ LQ WKH 51$ GRQRU VSOLFH VLWH DW WKH ILUVW H[RQLQWURQ ERUGHU RI WKH (E JHQH 7DFFKLQL&RWWLHU DQG -RQHV 9X HW DO f %RWK RI WKHVH PXWDWLRQV OHDG WR DEHUUDQW 51$ SURFHVVLQJ -RQHV HW DO f DOVR UHSRUW DQRWKHU (E PXWDWLRQ GLVWLQFW IURP WKH ILUVW WKUHH EXW KDYH QRW DV \HW PROHFXODUO\ FKDUDFWHUL]HG LW $OO WKH GHIHFWV GHVFULEHG FDXVLQJ ( PROHFXOH QRQH[SUHVVLRQ ZLWK WKH H[FHSWLRQ RI WKH I LQVHUWLRQ DIIHFWLQJ WKH (D JHQH RI + KDYH DOVR EHHQ IRXQG LQ YDULRXV ZLOG PRXVH KDSORW\SHV -RQHV HW DO 'HPELF HW DO f 7KH ODUJH QXPEHU RI PLFH QRW

PAGE 56

H[SUHVVLQJ DQ ( PROHFXOH PD\ LQGLFDWH WKDW WKH WZR 0KF FODVV ,, PROHFXOHV DUH QRW IXQFWLRQDOO\ HTXLYDOHQW &KDLQ $VVRFLDWLRQ RI &ODVV ,, 0ROHFXOHV 7KH H[WHQVLYH SRO\PRUSKLVP RI 0KF FODVV ,, PROHFXOHV WRJHWKHU ZLWK WKH FULWLFDO QDWXUH RI WKHLU IXQFWLRQ RI ELQGLQJ DQWLJHQ DOORZLQJ 7 O\PSKRF\WH UHFRJQLWLRQ VXJJHVWV WKDW LQGLYLGXDOV H[SUHVVLQJ D JUHDWHU YDULDQFH RI FODVV ,, PROHFXOHV RQ WKH FHOO VXUIDFH RI DQ DQWLJHQ SUHVHQWLQJ FHOO ZRXOG EH DW D VHOHFWLYH DGYDQWDJH )DWKPDQ DQG .LPRWR f REVHUYHG WKDW WKH D DQG E FKDLQV RI D JLYHQ LVRW\SH FDQ WUDQVDVVRFLDWH LQ KHWHUR]\JRWHV 7KHVH ILQGLQJV JDYH ULVH WR WKH QRWLRQ RI IUHH DVVRFLDWLRQ RI DOOHOLF YDULHQWV ZLWKLQ DQ LVRW\SH VXJJHVWLQJ WKDW W\SHV RI FODVV ,, KHWHURGLPHUV ZLOO IRUP LQ D KHWHUR]\JRWH ,Q FRQWUDVW FURVVLVRW\SH SDLULQJ RI $ DQG ( PROHFXOH SRO\SHSWLGH FKDLQV GRHV QRW RFFXU H[FHSW LQ DUWLILFLDO H[SHULPHQWDO V\VWHPV 0XUSK\ HW DO f 3UHIHUHQWLDO LVRW\SLF SDLULQJ LV GXH WR D VWURQJ LQFUHDVHG DIILQLW\ IRU WKH DVVRFLDWLRQ RI LVRW\SH PDWFKHG SDLUV RI SRO\SHSWLGHV 6DQW DQG *HUPDLQ f 1XPHURXV REVHUYDWLRQV QRZ VXJJHVW WKDW SUHIHUHQWLDO SDLULQJ RI FHUWDLQ DOOHOLF $ PROHFXOH SRO\SHSWLGH FKDLQV OLPLWV WKH DPRXQW RI WUDQVDVVRFLDWHG $ PROHFXOHV WKDW FDQ EH IRUPHG 7U\SWLF SHSWLGH DQDO\VLV IURP VHURORJLFDOO\ UHODWHG JURXSV RI PLFH :DNHODQG DQG .OHLQ f VKRZ WKH $D DQG $E

PAGE 57

SRO\SHSWLGHV IURP WKHVH VWUDLQV GLIIHU E\ OHVV WKDQ b RI WKHLU WU\SWLF SHSWLGHV :DNHODQG DQG 'DUE\ f 5HVWULFWLRQ IUDJPHQW OHQJWK SRO\PRUSKLVP DQDO\VLV RI WKH $D DQG $E FKDLQ JHQHV IURP WKLV VDPH DOOHOLF IDPLO\ FRUURERUDWHV WKLV REVHUYDWLRQ DW WKH '1$ OHYHO 7DUQX]]HU 0F&RQQHOO HW DO f 7KHVH REVHUYDWLRQV VXJJHVW WKDW WKH $D DQG $E JHQHV RQ WKH VDPH FKURPRVRPH DFFXPXODWH PXWDWLRQV LQ D FRRUGLQDWH PDQQHU WKHUHE\ HQVXULQJ WKHLU DELOLW\ WR IXQFWLRQDOO\ DVVRFLDWH *HQH WUDQVIHFWLRQ H[SHULPHQWV E\ *HUPDLQ HW DO f FOHDUO\ LOOXVWUDWHG WKDW DOOHOLF YDULDWLRQ FDQ GUDPDWLFDOO\ DIIHFW WKH DELOLW\ RI $ PROHFXOH VXEXQLWV WR DVVHPEOH FRUUHFWO\ DQG EH H[SUHVVHG RQ WKH FHOO VXUIDFH 7KHVH VWXGLHV VKRZHG WKDW KDSORW\SH PLVPDWFKHG FKDLQV FDQQRW DVVRFLDWH DV HIILFLHQWO\ DV KDSORW\SH PDWFKHG FKDLQV DQG WKHUHIRUH DUH QRW H[SUHVVHG DW DSSUHFLDEOH OHYHOV )XUWKHU U DQDO\VLV LQGLFDWHG WKDW SRO\PRUSKLVPV LQ WKH DPLQR WHUPLQDO KDOI RI WKH $EO GRPDLQ FRQVLVWHQWO\ FRQWUROOHG D DQG E FKDLQ LQWHUDFWLRQV %UDXQVWHLQ DQG *HUPDLQ f %XHUVWHGGH HW DO f XVLQJ VLWHGLUHFWHG PXWDJHQHVLV DQG '1$ PHGLDWHG JHQH WUDQVIHU KDYH VKRZQ WKDW DPLQR DFLG SRVLWLRQV DQG RI WKH $EO H[RQ DUH UHVSRQVLEOH IRU SURSHU FKDLQ DVVRFLDWLRQ DQG FHOO VXUIDFH H[SUHVVLRQ IRU WKH + 9 } f f f DQG + KDSORW\SHV H[DPLQHG 7KH DPLQR DFLG SRVLWLRQV DQG EHLQJ SDUWLFXODUO\ VLJQLILFDQW IRU SURSHU DVVRFLDWLRQ

PAGE 58

7KHVH VWXGLHV VXJJHVW WKDW LQ RUGHU IRU SURSHU VXEXQLW DVVRFLDWLRQ DQG FHOO VXUIDFH H[SUHVVLRQ WKH D DQG E FKDLQV RI WKH $ PROHFXOH QHHG WR EH FRDGDSWHG DQG WKHUHIRUH EH IURP WKH VDPH RU VLPLODU KDSORW\SH )LJXUH f 7KH DELOLW\ RI SRO\SHSWLGH FKDLQV RI WKH ( PROHFXOH WR DVVRFLDWH LV XQGHU GLIIHUHQW VHOHFWLYH SUHVVXUHV ,Q WKH FDVH RI WKH ( PROHFXOH RQO\ WKH (E FKDLQ LV KLJKO\ GLYHUVLILHG ZKLOH (D H[KLELWV YHU\ ORZ OHYHOV RI GLYHUVLW\ 7KHUHIRUH WKH GLYHUVLILFDWLRQ RI (E LV RQO\ FRQVWUDLQHG E\ WKH UHTXLUHPHQW WR DVVRFLDWH ZLWK DQ HVVHQWLDOO\ PRQRPRUSKLF (D )LJXUH f 7KLV GLVFUHSDQF\ LQ VHOHFWLYH SUHVVXUHV RI WKH YDULRXV FODVV ,, JHQHV WR SURSHUO\ DVVRFLDWH PD\ EH GXH LQ SDUW WR WKH SUHVHQFH RI D UHFRPELQDWLRQDO KRWVSRW LQ WKH VHFRQG LQWURQ RI (E +RPRORJRXV UHFRPELQDWLRQ DW WKLV SRVLWLRQ ZRXOG QRW DOORZ FRHYROXWLRQ RI WKH WZR JHQHV 7KH 5ROH RI WKH ,QYDULDQW &KDLQ LQ &ODVV ,, 0ROHFXOH ([SUHVVLRQ 0KF FODVV ,, PROHFXOHV DUH DVVRFLDWHG LQWUDFHOOXODUO\ ZLWK D WKLUG JO\FRSURWHLQ FDOOHG WKH LQYDULDQW FKDLQ ,Lf ZKLFK GLVSOD\V OLWWOH DOOHOLF YDULDWLRQ DPRQJ WKH GLIIHUHQW VWUDLQV RI PLFH H[DPLQHG -RQHV HW DO f 7KH LQYDULDQW FKDLQ LV D EDVLF SRO\SHSWLGH RI GDOWRQV WKDW LV FRSUHFLSLWDWHG ZLWK FODVV ,, PROHFXOHV LQ LPPXQRSUHFLSLWDWLRQV XVLQJ DQWLOD DQWLVHUD RI PRQRFORQDO DQWLERGLHV ,W QRQFRYDOHQWO\ DVVRFLDWHV ZLWK FODVV ,,

PAGE 59

)LJXUH $f 'LDJUDP LOOXVWUDWLQJ WKH LPSRUWDQFH RI PDLQWDLQLQJ $ PROHFXOH VXEXQLWV WKDW FDQ WUDQVDVVRFLDWH &KDLQ DVVRFLDWLRQ RI WZR FODVV ,, $ PROHFXOHV LV VKRZQ +DSORW\SH PLVPDWFKHG DE FKDLQ SDLUV DUH WUDQVFULEHG DQG WUDQVODWHG QRUPDOO\ EXW IDLO WR DVVRFLDWH LQ WKH F\WRSODVP D VWHS QHFHVVDU\ IRU WKH H[SUHVVLRQ RI WKH PROHFXOH RQ WKH FHOO VXUIDFH %f 'LDJUDP LOOXVWUDWLQJ WKH LPSRUWDQFH RI PDLQWDLQLQJ D PRQRPRUSKLF IRUP RI WKH (D FKDLQ IRU WKH SURSHU H[SUHVVLRQ RI WKH FODVV ,, ( PROHFXOH %RWK WKH D DQG E FKDLQV FDQ DOZD\V SURSHUO\ DVVRFLDWH GXH WR WKH DELOLW\ RI WKH PRQRPRUSKLF D FKDLQ WR DVVRFLDWH ZLWK DOO E FKDLQV

PAGE 60

WR

PAGE 61

PROHFXOHV LQ WKH PHPEUDQHV RI WKH HQGRSODVPLF UHWLFXOXP EXW KDV QRW EHHQ GHWHFWHG RQ WKH FHOO VXUIDFH LQ DVVRFLDWLRQ ZLWK FODVV ,, PROHFXOHV 6XQJ DQG -RQHV f ,W KDV EHHQ GHPRQVWUDWHG WKDW WKH LQYDULDQW FKDLQ LV FRRUGLQDWHO\ UHJXODWHG ZLWK FODVV ,, PROHFXOHV .RFK HW DO 3DXOQRFN.LQJ HW DO f $OWKRXJK WKH IXQFWLRQ RI WKH LQYDULDQW FKDLQ LV XQFOHDU LW KDV EHHQ VXJJHVWHG WKDW LW SOD\V D UROH LQ WKH DVVHPEO\ DQG LQWUDFHOOXODU WUDQVSRUW RI FODVV ,, PROHFXOHV WR WKH FHOO VXUIDFH 6XQJ DQG -RQHV -RQHV HW DO f 7KH 3UHVHQWDWLRQ RI $QWLJHQ E\ &ODVV ,, 0ROHFXOHV 5HJXODWRU\ 7 O\PSKRF\WHV UHFRJQL]H WKH ELPROHFXODU OLJDQG RI IRUHLJQ DQWLJHQ DQG D VHOI FODVV ,, PROHFXOH RQ WKH VXUIDFH RI DQWLJHQ SUHVHQWLQJ FHOOV +RZHYHU XQOLNH % O\PSKRF\WHV ZKLFK GLUHFWO\ LQWHUDFW ZLWK DQWLJHQ PRVW 7 O\PSKRF\WHV RQO\ UHFRJQL]H D QRQQDWLYH IRUP RI WKH DQWLJHQ 6FKZDUW] f 7KH FRQYHUVLRQ RI DQ DQWLJHQ IURP D QDWLYH WR D QRQQDWLYH IRUP KDV EHHQ WHUPHG DQWLJHQ SURFHVVLQJ DQG LV SHUIRUPHG E\ DQWLJHQ SUHVHQWLQJ FHOOV ZKLFK H[SUHVV FODVV ,, PROHFXOHV RQ WKHLU VXUIDFH $OWKRXJK PXFK LV VWLOO XQNQRZQ DERXW WKH LQWULFDFLHV RI DQWLJHQ SURFHVVLQJ WKH IROORZLQJ LV D VXPPDU\ RI HYHQWV :HUGHOLQ HW DO *HUPDLQ f 7KH ILUVW VWHS LQYROYHG LQ DQWLJHQ SURFHVVLQJ LV LQJHVWLRQ RI WKH DQWLJHQ 0DFURSKDJH DFFRPSOLVK WKLV E\

PAGE 62

FRQVWLWXWLYH HQGRF\WRVLV ZKHUHDV % O\PSKRF\WHV E\ YLUWXH RI WKHLU LPPXQRJOREXOLQ UHFHSWRU XWLOL]H UHFHSWRUPHGLDWHG HQGRF\WRVLV 7KH LQJHVWHG DQWLJHQ LV WUDQVSRUWHG LQWR WKH LQWHULRU RI WKH FHOO LQ DQ HQGRF\WLF YDFXROH 7KH VHFRQG VWHS RI WKH SURFHVV WDNHV SODFH ZKHQ WKH HQGRF\WLF YDFXROH EHFRPHV DFLGLILHG DQG SURWHRO\WLF HQ]\PHV ZLWK DQ DFLG RSWLPXP EHFRPH DFWLYDWHG 7KLV UHVXOWV LQ WKH SDUWLDO GHJUDGDWLRQ RI WKH DQWLJHQ KHQFH WKH DQWLJHQ LV EURNHQ GRZQ LQWR SHSWLGH IUDJPHQWV 7KH WKLUG VWHS LQ DQWLJHQ SURFHVVLQJ LV WKH ELQGLQJ RI DQWLJHQLF IUDJPHQWV WR 0KF FODVV ,, PROHFXOHV 7KLV SUHVXPDEO\ RFFXUV LQ DQ LQWUDFHOOXODU FRPSDUWPHQW EXW H[DFWO\ ZKHUH LQ WKH FHOO WKLV RFFXUV LV QRW NQRZQ 2QFH DQ DQWLJHQLF IUDJPHQW LV ERXQG WR D FODVV ,, PROHFXOH LW LV SURWHFWHG IURP FRPSOHWH SURWHRO\WLF GHVWUXFWLRQ +RZHYHU SDUWV RI WKH DQWLJHQ IUDJPHQWV ZKLFK DUH RXWVLGH WKH DQWLJHQ ELQGLQJ VLWH PD\ QRW EH SURWHFWHG DJDLQVW IXUWKHU GHJUDGDWLRQ 7KH IRXUWK VWHS FRQVLVWV RI WUDQVSRUWLQJ WKH FODVV ,, PROHFXOHSURFHVVHG DQWLJHQ IUDJPHQW FRPSOH[ EDFN WR WKH VXUIDFH RI WKH DQWLJHQ SUHVHQWLQJ FHOO 2QFH WKHUH WKH FODVV ,, PROHFXOH DFWV WR NHHS WKH DQWLJHQ IUDJPHQW LQ D FRQVWDQW RULHQWDWLRQ ZLWK D VWDEOH FRQIRUPDWLRQ WKHUHE\ DOORZLQJ UHFRJQLWLRQ E\ D 7 O\PSKRF\WH 7KH SURFHVVLQJ UHTXLUHPHQWV PD\ YDU\ ZLWK HDFK SDUWLFXODU DQWLJHQ GHSHQGLQJ RQ WKH FRQGLWLRQV UHTXLUHG WR

PAGE 63

LQGXFH WKH FRQIRUPDWLRQDO IOH[LELOLW\ QHHGHG IRU WKH DQWLJHQ WR ELQG D FODVV ,, PROHFXOH $OOHQ f )RU LQVWDQFH VRPH SURWHLQV PD\ UHTXLUH QR SURFHVVLQJ EHFDXVH DW OHDVW D SRUWLRQ RI WKH SURWHLQ KDV HQRXJK IUHHGRP LQ LWV QDWLYH VWDWH WR EHFRPH VWDEO\ ERXQG WR D FODVV ,, PROHFXOH 2WKHU SURWHLQV PD\ VLPSO\ QHHG GHQDWXUDWLRQ VXFK DV D UHGXFWLRQ DQG DON\ODWLRQ RI GLVXOILGH ERQGV WR UHYHDO SHSWLGH IUDJPHQWV DEOH WR ELQG WR FODVV ,, PROHFXOHV 7KH PRVW VWULQJHQW DQWLJHQ SURFHVVLQJ ZRXOG UHTXLUH SURWHRO\WLF FOHDYDJH RI WKH QDWLYH SURWHLQ ,UUHVSHFWLYH RI WKH W\SH RI DQWLJHQ SURFHVVLQJ QHFHVVDU\ WKH LPPXQRJHQLF SHSWLGH PXVW SRVVHVV WZR GLVWLQFW IHDWXUHV )LUVW LW PXVW EH DEOH WR ELQG WR D FODVV ,, PROHFXOH DQG WKH FODVV ,, PROHFXOH FRQWDFW VLWHV RI DQ LPPXQRJHQLF SHSWLGH LV FDOOHG DQ DJUHWRSH +DEHU.DW] HW DG f 7KH LPPXQRJHQLF SHSWLGH PXVW DOVR PDNH FRQWDFW ZLWK WKH 7 FHOO DQWLJHQ UHFHSWRU DQG WKLV VLWH RQ WKH SHSWLGH LV WHUPHG DQ HSLWRSH 7KH ILUVW GLUHFW HYLGHQFH IRU SHSWLGHFODVV ,, PROHFXOH DVVRFLDWLRQ FDPH IURP %DEELWW HW DO f XVLQJ DQ HTXLOLEULXP GLDO\VLV PHWKRG HPSOR\LQJ SXULILHG FODVV ,, PROHFXOHV DQG SHSWLGH IUDJPHQWV 7KHVH H[SHULPHQWV VKRZHG D SHSWLGH IURP KHQ HJJ O\VR]\PH +(/ SUHYLRXVO\ N G GHPRQVWUDWHG WR EH LPPXQRJHQLF IRU + DQG QRW IRU + N G ERXQG VSHFLILFDOO\ WR $ PROHFXOHV EXW QRW WR PROHFXOHV LQ D VDWXUDEOH SURFHVV ZLWK DQ DIILQLW\ LQ WKH PLFURPRODU UDQJH 7KLV GLUHFW FRUUHODWLRQ EHWZHHQ DQWLJHQFODVV ,,

PAGE 64

PROHFXOH LQWHUDFWLRQ DQG 0KF UHVWULFWLRQ ZDV VXEVHTXHQWO\ H[WHQGHG IRU QXPHURXV RWKHU DQWLJHQV %XXV HW UO D E *XLOOHW HW DO f )XUWKHUPRUH LQKLELWLRQ DQDO\VLV LOOXVWUDWHG WKDW SHSWLGHV UHVWULFWHG WR D SDUWLFXODU FODVV ,, PROHFXOH FRPSHWLWLYHO\ LQKLELWHG RQH DQRWKHU IURP ELQGLQJ 7KLV VXJJHVWHG WKDW D FODVV ,, PROHFXOH FRQWDLQHG MXVW D VLQJOH DQWLJHQ ELQGLQJ VLWH %XVV HW DO %DEELWW HW DA *XLOOHW HW DO f DQ REVHUYDWLRQ LQ DJUHHPHQW ZLWK ;UD\ FU\VWDOORJUDSKLF DQDO\VLV %MRUNPDQ HW DO Df 8WLOL]LQJ D JHO ILOWUDWLRQ V\VWHP HQDEOLQJ FRPSOH[HV RI DQWLJHQLF SHSWLGHV DQG FODVV ,, PROHFXOHV WR EH VHSDUDWHG IURP XQERXQG SHSWLGH %XXV HW DO Ef ZHUH DEOH WR VWXG\ WKH NLQHWLFV RI DVVRFLDWLRQ DQG GLVDVVRFLDWLRQ RI WKHVH FRPSOH[HV 7KHVH H[SHULPHQWV XVLQJ WKH RYDOEXPLQ M SHSWLGH$ V\VWHP LOOXVWUDWHG WKDW WKH UDWH RI FRPSOH[ IRUPDWLRQ LV YHU\ VORZ .D 0,V -GML RQFH IRUPHG WKH FODVV ,, PROHFXOH SHSWLGH FRPSOH[ LV UHPDUNDEO\ VWDEOH .G [OaVa O f 7KLV VXJJHVWV WKDW WKH DVVRFLDWLRQ RI FODVV ,, PROHFXOHV ZLWK DQWLJHQ IUDJPHQWV PRVW OLNHO\ RFFXUV LQ DQ LQWUDFHOOXODU YHVLFXODU FRPSDUWPHQW DV RSSRVHG WR WKH SODVPD PHPEUDQH VLQFH WKLV ZRXOG SUHYHQW VROXEOH SURFHVVHG DQWLJHQ IURP GLIIXVLQJ DZD\ IURP WKH PHPEUDQH ERXQG FODVV ,, PROHFXOH 7KLV LQWUDFHOOXODU FRPSDUWPHQW ZRXOG SUREDEO\ KDYH D QHXWUDO S+ EDVHG RQ D IROG VORZHU UDWH RI FRPSOH[ IRUPDWLRQ DW S+ FRPSDUHG ZLWK S+ DQG WKH ODELOLW\

PAGE 65

RI SUHIRUPHG FRPSOH[HV WR DFLG S+ 7KLV SHSWLGHFODVV ,, PROHFXOH FRPSOH[ VHQVLWLYLW\ WR DFLG S+ PD\ UHSUHVHQW D PHFKDQLVP E\ ZKLFK FODVV ,, PROHFXOHV FRXOG ULG LWVHOI RI FRPSOH[HG SHSWLGH DQG EH DYDLODEOH WR ELQG QHZO\ SURFHVVHG DQWLJHQ 5HF\FOLQJ RI FODVV ,, PROHFXOHV 3HUQLV f WRJHWKHU ZLWK ELRV\QWKHVLV +DUGLQJ HW D-/ f FRXOG HIIHFWLYHO\ SUHYHQW SRWHQWLDOO\ FRQVWDQW VDWXUDWLRQ RI FODVV ,, PROHFXOH ELQGLQJ VLWHV ZLWK SHSWLGHV GHULYHG IURP VHOIn SURWHLQV %DEELWW HW DO f ILUVW REVHUYHG WKDW FODVV ,, PROHFXOHV FDQ ELQG DQWLJHQLF IUDJPHQWV RI VHOISURWHLQV /RUHQ] DQG $OOHQ f IXUWKHU FKDUDFWHUL]HG WKH DELOLW\ RI FODVV ,, PROHFXOHV WR ELQG VHOISHSWLGHV 7KHVH VWXGLHV SURYLGHG GLUHFW IXQFWLRQDO SURRI LQ YLYR WKDW VHOI SURWHLQV DUH SURFHVVHG FRQVWLWXWLYHO\ DQG FDQ EH SUHVHQWHG LQ D IDVKLRQ VLPLODU WR WKDW E\ ZKLFK IRUHLJQ DQWLJHQV DUH SUHVHQWHG ,Q DGGLWLRQ H[SHULPHQWV E\ $GRULQL HW DO f GHPRQVWUDWH WKDW SHSWLGHV RI IRUHLJQ DQWLJHQV JHQHUDWHG E\ SURFHVVLQJ HYHQWV PXVW FRPSHWH IRU ELQGLQJ WR FODVV ,, PROHFXOHV ZLWK SHSWLGHV JHQHUDWHG IURP VHOIn DQWLJHQV LQ YLYR 7KXV VHOIWROHUDQFH GRHV QRW RFFXU DW WKH OHYHO RI WKH DQWLJHQ SUHVHQWLQJ FHOO EHFDXVH DQWLJHQ SUHVHQWDWLRQ GRHV QRW GLVFULPLQDWH VHOI IURP QRQVHOI 5DWKHU LW RFFXUV DW WKH OHYHO RI WKH UHJXODWRU\ 7 O\PSKRF\WH HLWKHU WKURXJK IXQFWLRQDO RU SK\VLFDO GHOHWLRQ RI VHOIUHDFWLYH 7 FHOOV

PAGE 66

$Q\ JLYHQ FODVV ,, PROHFXOH FDQ ELQG D ZLGH YDULHW\ RI SHSWLGHV KRZHYHU GLIIHUHQW FODVV ,, PROHFXOHV VKRZ GLVWLQFW EURDG VSHFLILFLW\ SDWWHUQV 7KLV LV UHIOHFWHG LQ WKH YDULDWLRQ EHWZHHQ DOOHOHV LQ WKHLU FDSDFLW\ WR SUHVHQW GLIIHUHQW SHSWLGHV WR WKH LPPXQH V\VWHP )RU LQVWDQFH ZKHQ RYHUODSSLQJ SHSWLGHV FRPSULVLQJ DQ HQWLUH SURWHLQ KDYH EHHQ DQDO\]HG IRU UHDFWLYLW\ GLIIHUHQW 0KF FODVV ,, PROHFXOHV KDYH EHHQ IRXQG WR SUHVHQW GLIIHUHQW SHSWLGH GHWHUPLQDQWV WR 7 O\PSKRF\WHV 5R\ HW DBO $OOHQ HW DO f )XUWKHUPRUH FODVV PROHFXOHV RQO\ ELQG D VXEVHW RI SHSWLGHV GHULYHG IURP QDWLYH SURWHLQ %UDFLDOH HW DO f DQG WKHUH LV D GHILQLWH KLHUDUFK\ RI SHSWLGH GHWHUPLQDQWV WKDW DUH LPPXQRGRPLQDQW IRU SDUWLFXODU DOOHOLF IRUPV RI 0KF JHQH SURGXFWV 5LD HW DO 5R\ HW DO %HU]RIVN\ HW DO f :KLFK LPPXQRGRPLQDQW UHJLRQ RI WKH QDWLYH SURWHLQ LV XOWLPDWHO\ UHFRJQL]HG E\ 7 O\PSKRF\WHV LV SUHGRPLQDQWO\ LQIOXHQFHG E\ WKH SDUWLFXODU 0KF FODVV ,, DOOHOH H[SUHVVHG 7KLV LQIOXHQFH UHIOHFWV WKH DELOLW\ RI SURFHVVHG IUDJPHQWV WR ELQG WR D SDUWLFXODU FODVV ,, PROHFXOH DQG GHPRQVWUDWHV WKH DIIHFW 0KF FODVV ,, PROHFXOH SRO\PRUSKLVPV KDYH LQ FRQWUROOLQJ DQ LPPXQH UHVSRQVH %HQDFHUUDI %DEELWW HW DO %XXV HW DO f ,Q FRQFOXVLRQ WKHVH VWXGLHV RI 0KF PROHFXOHDQWLJHQ LQWHUDFWLRQ LOOXVWUDWH WKH EURDG VSHFLILFLW\ RI WKH FODVV ,, PROHFXOH DQWLJHQ ELQGLQJ VLWH $OWKRXJK WKH LQWHUDFWLRQ LV JHQHUDOO\ SHUPLVVLYH WKH GLUHFW FRUUHODWLRQ RI SHSWLGH

PAGE 67

ELQGLQJ DQG 0KF UHVWULFWLRQ SRZHUIXOO\ LOOXVWUDWHV WKH FUXFLDO UROH FODVV ,, PROHFXOHV SOD\ LQ WKH LQLWLDWLRQ RI D 7 FHOO GHSHQGHQW LPPXQH UHVSRQVH :LOG 0LFH 7KH JRDOV RI WKLV GLVVHUWDWLRQ DUH WR HOXFLGDWH WKH HYROXWLRQDU\ PHFKDQLVPV UHVSRQVLEOH IRU JHQHUDWLQJ 0KF FODVV ,, JHQH SRO\PRUSKLVP DQG H[DPLQH WKH UROH VHOHFWLRQ SOD\V LQ GULYLQJ WKLV H[WHQVLYH GLYHUVLILFDWLRQ 3UHYLRXV VWXGLHV DGGUHVVLQJ WKHVH TXHVWLRQV XWLOL]HG WHFKQLTXHV VXFK DV VHURORJ\ DQG WU\SWLF SHSWLGH PDSSLQJ ZKLFK KDYH D OLPLWHG FDSDFLW\ WR DQVZHU WKHVH TXHVWLRQV DV FRPSDUHG WR REWDLQLQJ WKH '1$ VHTXHQFH RI WKH JHQHV 7KH QXFOHRWLGH VHTXHQFH RI D OLPLWHG QXPEHU RI 0KF FODVV ,, JHQHV KDV EHHQ REWDLQHG RQO\ IURP D IHZ VWDQGDUG LQEUHG ODERUDWRU\ VWUDLQV RI PLFH $VLGH IURP KDYLQJ XQFHUWDLQ JHQHWLF RULJLQV LQEUHG VWUDLQV RI PLFH ZHUH GHULYHG IURP D OLPLWHG QXPEHU RI VRXUFHV WKDW ZHUH JHQHUDWHG E\ D KLJK GHJUHH RI LQEUHHGLQJ 7KLV UHSUHVHQWV D ELDVHG VDPSOLQJ RI WKH PRXVH SRSXODWLRQ DQG DQ DUWLILFLDO FROOHFWLRQ RI FRQVLGHUDEOH KRPRJHQHLW\ )HUULV HW DO .OHLQ f :LOG PLFH DUH XQFRQILQHG DQLPDOV ZKRVH EUHHGLQJ LV QRW FRQWUROOHG E\ PDQ %UXHOO f DQG DV VXFK UHSUHVHQW D FROOHFWLRQ RI ,UHJLRQ KDSORW\SHV RI VLJQLILFDQW KHWHURJHQHLW\ SDUWLFXODUO\ ZKHQ FRPSDUHG WR VWDQGDUG

PAGE 68

ODERUDWRU\ LQEUHG VWUDLQV RI PLFH $ QXPEHU RI IHDWXUHV PDNH WKH VWXG\ RI WKH HYROXWLRQDU\ G\QDPLFV RI WKH ZLOG PRXVH 0KF SDUWLFXODUO\ DWWUDFWLYH 1DWXUDO SRSXODWLRQV RI ZLOG PLFH DUH DEXQGDQW DQG WKHLU SK\ORJHQHWLF UHODWLRQVKLSV KDYH EHHQ H[WHQVLYHO\ FKDUDFWHUL]HG )XUWKHUPRUH WKHVH PLFH UHSUHVHQW WKH SURGXFW RI HYROXWLRQDU\ SURFHVVHV ZKHUH WKH ,UHJLRQ KDSORW\SHV DUH IL[HG DQG PDLQWDLQHG WKURXJK QDWXUDO VHOHFWLRQ 1DWXUDO +LVWRU\ RI :LOG 0LFH :LOG PLFH FDQ EH GLYLGHG LQWR FDWHJRULHV RI DQLPDOV GHSHQGLQJ RQ WKHLU DVVRFLDWLRQ ZLWK PDQ DERULJLQDO FRPPHQVDO DQG IHUDO 6DJH f $ERULJLQDO PLFH DUH JHQXLQHO\ ZLOG ZLWK HVVHQWLDOO\ QR LQWHUDFWLRQ ZLWK PDQ :LWK WKH H[FHSWLRQ RI RQH VXEVSHFLHV WKDW LV LQGLJHQRXV WR QRUWKZHVW $IULFD DERULJLQDO PLFH DUH IRXQG RQO\ RQ WKH (XUDVLDQ FRQWLQHQW 7\SLFDOO\ WKH\ DUH GU\DUHD DQLPDOV DQG IHHG RQ JUDVV VHHGV DQG JUDLQ &RPPHQVDO PLFH RQ WKH RWKHU KDQG OLYH LQ FORVH DVVRFLDWLRQ ZLWK PDQ DQG UHO\ RQ PDQ IRU WKHLU PDLQ VRXUFH RI IRRG DQG VKHOWHU 0DUVKDOO f GLVWLQJXLVKHV FRPPHQVDO VXEVSHFLHV RI 0XV PXVFXOXV 0 P GRPHVWLFXV 0 P PXVFXOXV 0 P FDVWDQHXV DQG 0 P PRORVVLQXV &RPPHQVDO PLFH OLNH DERULJLQDO PLFH DUH DOVR LQGLJHQRXV WR (XUDVLD DQG LQ DGGLWLRQ KDYH UDGLDWHG WR KDELWDWV WKURXJKRXW WKH ZRUOG 7KH\ KDYH VXFFHVVIXOO\ DGDSWHG WR WKH

PAGE 69

H[WUHPHO\ YDULHG FOLPDWLF FRQGLWLRQV RI HQYLURQPHQWV UDQJLQJ IURP (XURSH WKH $PHULFDV $XVWUDOLD $IULFD DQG VHYHUDO VRXWK 3DFLILF LVODQGV )HUULV HW DO f HVWLPDWH WKDW WKH FRPPHQVDO UHODWLRQVKLS EHWZHHQ PRXVH DQG PDQ KDV H[LVWHG IRU DSSUR[LPDWHO\ PLOOLRQ \HDUV 7KLV LV EDVHG RQ IRVVLO HYLGHQFH QXFOHDU '1$ YDULDWLRQ DQG PLWRFKRQGULDO '1$ YDULDWLRQ )HUDO PLFH ZHUH RQFH FRPPHQVDOV RI PDQ EXW UHYHUWHG WR D PRUH DERULJLQDO H[LVWHQFH %UXHOO f 7KH\ DUH IRXQG LQ DUHDV VXFK DV DJULFXOWXUDO ILHOGV RSHQ JUDVVODQGV PDUVKHV VDQGKLOOV DQG FRDVWDO LVODQGV DQG IHHG RQ JUDVV DQG JUDLQ 6DJH f 3HUPDQHQW UHYHUVLRQ WR IHUDO KDELWV SULPDULO\ RFFXUV RQO\ LQ GU\ FOLPDWLF ]RQHV 0XV PXVFXOXV GRPHVWLFXV LV SUHVHQWO\ IRXQG WKURXJKRXW WKH ZRUOG +RZHYHU LW RULJLQDWHG LQ ZHVWHUQ (XURSH DQG VXEVHJXHQWO\ VSUHDG WR WKH $PHULFDV DQG $XVWUDOLD LQ DVVRFLDWLRQ WR WKH JOREDO PRYHPHQWV RI (XURSHDQV %RQKRPPH Df 0XV PXVFXOXV PXVFXOXV LV HQGHPLF WR QRUWKHDVWHUQ (XURSH DQG FHQWUDO $VLD 6DJH f 0XV PXVFXOXV FDVWDQHRXV LV IRXQG LQ 0DOD\D +DUULVRQ f ,QGLD 6ULYDVWYD DQG :DWWHO f ,QGRQHVLD +DGL HW DO f DQG 1HSDO DQG 7KDLODQG 0DUVKDOO f 7KH QDWLYH UDQJH RI 0XV PXVFXOXV PRORVVLQXV LV HDVWHUQ $VLD SDUWLFXODUO\ -DSDQ DQG .RUHD +DPLMLPD -RQHV DQG -RKQVRQ f 0XV VSUHWXV LV D IHUDO VSHFLHV HQGHPLF WR WKH ZHVWHUQ ULP RI WKH 0HGLWHUUHDQ 6HD %RQKRPPH Ef 0XV VRHFLOHDXV DUH WKH DERULJLQDO

PAGE 70

PRXQGEXLOGLQJ PLFH IRXQG LQ WKH VWHSSH RI HDVWHUQ (XURSH 3HWURY f 0XV VSUHWRLGHV LV IRXQG LQ HDVWHUQ (XURSH WKH %DONDQ SHQQLQVXOD &\SUHVV DQG 7XUNH\ %RQKRPPH HW DO f 0XV FRRNLL 0XV FHUYLFRORU DQG 0XV FDUROL DUH DOO HQGHPLF WR VRXWKHDVW $VLD 0DUVKDOO f 7KH QDWXUDO UDQJH RI 0XV SODWYWKUL[ LV ,QGLD 0DUVKDOO f 3K\ORJHQHWLF 5HODWLRQVKLSV LQ WKH *HQXV 0XV 7KH SK\ORJHQHWLF UHODWLRQVKLSV RI WKH YDULRXV VSHFLHV ZLWKLQ WKH JHQXV 0XV KDYH EHHQ H[WHQVLYHO\ VWXGLHG %RQKRPPH Df DQG D JHQHUDO XQGHUVWDQGLQJ RI WKHLU UHODWLRQVKLSV FDQ EH LQIHUUHG 6KH HW D f 'LIIHUHQW VSHFLHV DUH GLVWLQJXLVKHG IURP VXEVSHFLHV EDVHG RQ WKH SUHVHQFH RI UHSURGXFWLYH EDUULHUV LQ QDWXUDO SRSXODWLRQV 7KHUHIRUH 0 P GRPHVWLFXV DQG 0 P PXVFXOXV FDQ LQWHUEUHHG LQ QDWXUDO KDELWDWV DQG LQ UHJLRQV ZKHUH WKH\ FRPH LQWR FRQWDFW VXFK DV FHQWUDO (XURSH IRUP D WLJKWO\ GHILQHG K\EULG ]RQH ,Q FRQWUDVW GLIIHUHQW VSHFLHV ZLWK RYHUODSSLQJ UDQJHV VXFK DV 0 P GRPHVWLFXV DQG 0 VSUHWXV GR QRW LQWHUEUHHG LQ QDWXUDO SRSXODWLRQV $OWKRXJK WKHVH WZR VSHFLHV FDQ EH EUHG LQ DQ ODERUDWRU\ HQYLURQPHQW WKH UHVXOWDQW PDOH K\EULGV DUH FRPPRQO\ VWHULOH 7KH WKUHH PDMRU PROHFXODU WHFKQLTXHV HPSOR\HG IRU ELRFKHPLFDO V\VWHPDWLFV LQFOXGH SURWHLQ HOHFWURSKRUHVLV VLQJOH FRS\ QXFOHDU '1$ VHQ '1$f K\EULGL]DWLRQ DQG PLWRFKRQGULDO PWf '1$ UHVWULFWLRQ IUDJPHQW OHQJWK

PAGE 71

SRO\PRUSKLVP 5)/3f DQDO\VLV 6KH HW DO f 3URWHLQ HOHFWURSKRUHVLV DVVD\V RQO\ WKH SRO\PRUSKLVP LQ WKH FRGLQJ UHJLRQV RI WKH JHQRPH DQG WKHUHIRUH LV OLNHO\ WR EH FRQVWUDLQHG E\ QDWXUDO VHOHFWLRQ 6HQ K\EULGL]DWLRQ VWXGLHV UHYHDO GLIIHUHQFHV EHWZHHQ WZR JHQRPHV RI DOO VLQJOH FRS\ '1$ LQFOXGLQJ H[RQV LQWURQV DQG IODQNLQJ VHTXHQFHV 0LWRFKRQGULDO '1$ 5)/3 DQDO\VLV RQ WKH RWKHU KDQG DVVD\V WKH F\WRSODVPLF JHQRPH ZKLFK KDV VHYHUDO XQLTXH FKDUDFWHULVWLFV VXFK DV D KLJK HYROXWLRQDU\ UDWH VWULFWO\ PDWHUQDO LQKHULWDQFH SDWWHUQV DQG DQ DEVHQFH RI UHFRPELQDWLRQ )LJXUH LOOXVWUDWHV WKH SK\ORJHQHWLF UHODWLRQVKLS ZLWKLQ WKH JHQXV 0XV DQG 5DWWXV DV GHWHUPLQHG E\ '1$'1$ K\EULGL]DWLRQ VWXGLHV 6KH HW DO f 6LPLODU SK\ORJHQHWLF UHODWLRQVKLSV DUH REWDLQHG ZKHQ WKHVH VSHFLHV DUH FRPSDUHG E\ RWKHU WHFKQLTXHV KRZHYHU WKH HVWLPDWHV RI WKH H[DFW JHQHWLF GLVWDQFH DPRQJ WKH 0XV VSHFLHV YDU\ GHSHQGLQJ XSRQ WKH WHFKQLTXH XVHG ,Q FRPSDULQJ VSHFLHV RI 0XV VXEVSHFLHV RI 0XV PXVFXOXV DQG VSHFLHV IURP WKH JHQXV 5DWWXV WKHUH DUH VHYHQ OHYHOV RI GLYHUJHQFH DPRQJ WKH VSHFLHV UDQJLQJ IURP PLOOLRQ \HDUV 0XV PXVFXOXV FRPSOH[f WR PLOOLRQ \HDUV GLYHUJHQFH EHWZHHQ VSHFLHV ZLWKLQ WKH JHQXV 0XV DQG WKH JHQXV 5DWWXVf /XFNHWW DQG +DUWHQEHUJHU 6KH HW DO f %\ DQDO\]LQJ WKH 0KF FODVV ,, JHQH QXFOHRWLGH VHTXHQFH IURP ZLOGGHULYHG DOOHOHV IURP D QXPEHU RI GLIIHUHQW VSHFLHV

PAGE 72

DQG VXEVSHFLHV RI WKH JHQXV 0XV DQG 5DWWXV LW VKRXOG EH SRVVLEOH WR REWDLQ DQ HYROXWLRQDU\ SHUVSHFWLYH RI WKH IRUFHV DFWLQJ WR GLYHUVLI\ DQG PDLQWDLQ FRQWHPSRUDU\ 0KF DOOHOHV

PAGE 73

)LJXUH 7KH SK\ORJHQHWLF UHODWLRQVKLSV ZLWKLQ WKH JHQXV 0XV DQG 5DWWXV 7KH SHUFHQWDJH RI '1$ GLYHUJHQFH DV GHWHFWHG E\ '1$'1$ K\EULGL]DWLRQ VWXGLHV LV VKRZQ RQ WKH OHIW D[LV 7KH HVWLPDWHG WLPH LQWHUYDO VLQFH VSHFLDWLRQ LV OLVWHG RQ WKH ULJKW D[LV $GDSWHG IURP 6KH HW DO f

PAGE 74

b '1$ 'LYHUJHQFH 0LOOLRQ
PAGE 75

&+$37(5 ,,, 0$7(5,$/6 $1' 0(7+2'6 ,VRODWLRQ RI *HQRPLF '1$ *HQRPLF '1$ ZDV LVRODWHG IURP OLYHU RU NLGQH\ WLVVXH E\ D 3URWHDVH .6'6 PHWKRG DV GHWDLOHG LQ 0DQLDWLV HW DO f 7KH H[WUDFWLRQ ZDV SHUIRUPHG RQ D $ $SSOLHG %LRV\VWHPV ,QF )RVWHU &LW\ &$f QXFOHLF DFLGV H[WUDFWRU Y )UR]HQ WLVVXHV DUHnJURXQG LQ D PRUWDU FRQWDLQLQJ OLTXLG 1 WR D ILQH SRZGHU DQG DGGHG WR PO VROXWLRQ RI O\VLV EXIIHU $SSOLHG %LRV\VWHPV ,QF )RVWHU &LW\ &$f DQG 3URWHDVH ILQDO FRQFHQWUDWLRQ RI PJPOf $SSOLHG %LRV\VWHPV ,QF )RVWHU &LW\ &$f 7KH VROXWLRQ ZDV LQFXEDWHG RYHUQLJKW DW r& 7KH UHPDLQGHU RI WKH H[WUDFWLRQ ZDV SHUIRUPHG E\ WKH PDFKLQH %ULHIO\ WKH '1$ VROXWLRQ ZDV H[WUDFWHG WZR WLPHV ZLWK D 7ULV HTXLOLEUDWHG SKHQRO S+ fFKORURIRUPLVRDP\O DOFRKRO VROXWLRQ YYf DQG RQH WLPH ZLWK MXVW WKH FKORURIRUPLVRDP\O DOFRKRO VROXWLRQ 7KH JHQRPLF '1$ ZDV WKHQ HWKDQRO SUHFLSLWDWHG ZDVKHG LQ b HWKDQRO DQG UHVXVSHQGHG LQ 7( EXIIHU P0 7ULV +&/ S+ P0 ('7$f DQG GLDO\]HG RYHUQLJKW DW r& DJDLQVW 7( EXIIHU 7KH UHVXOWLQJ '1$ VROXWLRQV ZHUH

PAGE 76

HOHFWURSKRUHVHG RQ D b DJDURVH JHO IRU TXDQWLILFDWLRQ DQG WR FRQILUP WKHLU KLJK PROHFXODU ZHLJKW 3RO\PHUDVH &KDLQ 5HDFWLRQ $PSOLILFDWLRQ &ORQLQJ DQG 6HTXHQFLQJ $PSOLILFDWLRQ RI $E H[RQ WZR ZDV DFKLHYHG YLD WKH SRO\PHUDVH FKDLQ UHDFWLRQ 3&5f GHVFULEHG E\ 6DLNL HW DO f ZLWK VOLJKW PRGLILFDWLRQ 7KH LQLWLDO Q UHDFWLRQ PL[WXUH FRQWDLQHG J RI JHQRPLF '1$ P0 .& P0 WULV S+ f P0 0J&O b JHODWLQ b '062 YYf DQG P0 RI HDFK G173 G$73 G&73 G*73 DQG G773f SPROHV RI HDFK ROLJRQXFOHRWLGH SULPHU ZKLFK DUH FRPSOHPHQWDU\ WR VWDEOH LQWURQ VHTXHQFHV ZHUH DOVR LQFOXGHG PRXVH &$&**&&&*&&*&*&7&&&*& PRXVH &***&7*$&&*&*7&&*7&&*&$* 6DPSOHV ZHUH WKHQ ERLOHG IRU WHQ PLQXWHV TXHQFKHG RQ LFH DQG 8 7DT '1$ SRO\PHUDVH 3HUNLQ(OPHU &HWXV 1RUZDON &7f ZDV DGGHG 7KH ILUVW ILYH DPSOLILFDWLRQ URXQGV FRQVLVWHG RI PLQXWH GHQDWXULQJ DW r& PLQXWHV DQQHDOLQJ DW r& DQG PLQXWHV H[WHQVLRQ DW r& $W WKLV SRLQW MXO RI G+ b '062 YYf ZDV DGGHG ZLWK DQ DGGLWLRQDO 8 7DT '1$ SRO\PHUDVH 7KH DPSOLILFDWLRQ SURWRFRO IRU WKH HQVXLQJ F\FOHV FRQVLVWHG RI PLQXWH r& PLQXWHV r& DQG PLQXWHV r& ,PPHGLDWHO\ IROORZLQJ WKH ODVW F\FOH ZDV D PLQXWH r& FKDVH WR HQVXUH IXOO H[WHQVLRQ RI DOO DPSOLILHG IUDJPHQWV

PAGE 77

7KH VDPSOHV ZHUH WKHQ HWKDQRO SUHFLSLWDWHG DQG HOHFWURSKRUHVHG WKURXJK D b QRQGHQDWXULQJ DFU\ODPLGH JHO 7KH IUDJPHQW RI LQWHUHVW ZDV WKHQ H[FLVHG DQG HOXWHG LQWR PO RI HOXWLRQ EXIIHU 0 DPPRQLXP DFHWDWH b 6'6 DQG P0 ('7$ DW r& RYHUQLJKW 7KH PL[WXUH ZDV WKHQ FHQWULIXJHG DW USP IRU PLQXWHV WKH VXSHUQDWDQW ZDV HWKDQRO SUHFLSLWDWHG WKH SHOOHW ZDV ZDVKHG ZLWK b HWKDQRO GULHG DQG UHVXVSHQGHG LQ  RI G+ 7KH DPSOLILHG IUDJPHQW ZDV WKHQ OLJDWHG ZLWK 6PD GLJHVWHG 0PSO RYHUQLJKW DW r& XQGHU FRQGLWLRQV GHVFULEHG E\ WKH VXSSOLHU %HWKHVGD 5HVHDUFK /DERUDWRULHV %HWKHVGD 0'f ,QVHUWSRVLWLYH SODTXHV ZHUH VHTXHQFHG YLD WKH 6DQJHU GLGHR[\ULERQXFOHRVLGH PHWKRG HPSOR\LQJ WKH 6HTXHQDVH SURWRFRO 8QLWHG 6WDWHV %LRFKHPLFDO &OHYHODQG 2+f 7R HOLPLQDWH SRWHQWLDO HUURUV LQWURGXFHG E\ WKH 3&5 DW OHDVW FORQHV SHU VHTXHQFH ZHUH DQDO\]HG 6SOHHQ &HOO ,VRODWLRQ ,PPXQRVWDLQLQT DQG )ORZ &\WRPHWULF $QDO\VLV )UHVKO\ H[SODQWHG VSOHHQV ZHUH PLQFHG WKURXJK ZLUH VFUHHQV WR PDNH D VLQJOH FHOO VXVSHQVLRQ 5HG EORRG FHOOV ZHUH O\VHG E\ LQFXEDWLQJ WKH FHOOV LQ D ,; DPPRQLXP FKORULGH VROXWLRQ IRU PLQXWHV DW r& 7KH UHPDLQLQJ VSOHHQ FHOOV ZHUH ZDVKHG WKRURXJKO\ ZLWK ,; 3%6 [ FHOOV ZHUH UHVXVSHQGHG LQ , ,; 3%6 b 1D1 VROXWLRQ DQG WKHQ

PAGE 78

LQFXEDWHG LQ D GLOXWLRQ RI WKH PRQRFORQDO DQWLERG\ FXOWXUH VXSHUQDWDQW IRU PLQXWHV DW r& 7KH VDPSOHV ZHUH ZDVKHG WLPHV ZLWK ,; 3%6 DQG LQFXEDWHG LQ D , YROXPH RI D GLOXWLRQ RI ),7& $FFXUDWH &KHPLFDO DQG 6FLHQWLILF &RUS :HVWEXU\ 1
PAGE 79

&+$37(5 ,9 5(68/76 7KH *HQHUDWLRQ RI 0KF &ODVV ,, $E *HQH 3RO\PRUSKLVP LQ 5RGHQWV 7KH PHFKDQLVPV UHVSRQVLEOH IRU JHQHUDWLQJ DQWLJHQ ELQGLQJ VLWH SRO\PRUSKLVPV LQ URGHQWV KDV EHHQ D SX]]OH WR LPPXQRJHQHWLFLVWV IRU PDQ\ \HDUV ,Q DQ DWWHPSW WR DVVHVV WKH UROHV PXWDWLRQDO DQG UHFRPELQDWLRQDO SURFHVVHV SOD\ LQ GLYHUVLI\LQJ 0+& FODVV ,, JHQHV WKH QXFOHRWLGH VHTXHQFH RI DOOHOHV RI $E H[RQ $EO H[RQf ZDV GHWHUPLQHG DQG WKH SDWWHUQV RI GLYHUVLILFDWLRQ H[DPLQHG 7KLV LV WKH PRVW SRO\PRUSKLF H[RQ DQG LW FRQWDLQV WKH DQWLJHQ ELQGLQJ VLWH 7KHVH DOOHOHV ZHUH REWDLQHG IURP D SDQHO RI URGHQWV FRQWDLQLQJ 0XV VSHFLHV DQG VXEVSHFLHV DQG VSHFLHV RI 5DWWXV WKXV SURYLGLQJ DOOHOHV GHULYHG IURP VSHFLHV GLYHUJHG IRU LQFUHDVLQJ DPRXQWV RI HYROXWLRQDU\ WLPH XS WR PLOOLRQ \HDUV

PAGE 80

$QLPDOV 7KH '1$ DQDO\]HG LQ WKLV VWXG\ ZDV LVRODWHG IURP IUHVK WLVVXHV RU HWKDQRO SUHVHUYHG WLVVXHV IURP YDULRXV VSHFLHV RI URGHQWV 7KH VWDQGDUG ODERUDWRU\ LQEUHG PLFH ZHUH IURP WKH PRXVH FRORQ\ LQ WKH 7XPRU %LRORJ\ 8QLW DW WKH 'HSDUWPHQW RI 3DWKRORJ\ DQG /DERUDWRU\ 0HGLFLQH 8QLYHUVLW\ RI )ORULGD + KRPR]\JRXV ZLOG PLFH ZKRVH RULJLQV DQG FKDUDFWHULVWLFV KDYH EHHQ GHVFULEHG SUHYLRXVO\ :DNHODQG HW DO f DUH IURP RXU ZLOG PRXVH FRORQ\ ORFDWHG DW WKH $QLPDO &DUH )DFLOLW\ 8QLYHUVLW\ RI )ORULGD 6RPH ZLOGPRXVH GHULYHG VWUDLQV ZHUH VXSSOLHG E\ ) %RQKRPPHnV ODERUDWRU\ LQ 0RQWSHOOLHU )UDQFH 7KUHH LQGLYLGXDOV RI 5DWWXV UDWWXV ZHUH WUDSSHG ORFDOO\ LQ *DLQHVYLOOH )ORULGD 7KH VWUDLQV LQFOXGHG LQ WKLV SRUWLRQ RI WKH DQDO\VLV DUH OLVWHG LQ 7DEOH 1XFOHRWLGH 'LYHUVLW\ :LWKLQ WKH $EO ([RQ 7KH SRO\PHUDVH FKDLQ UHDFWLRQ FRXSOHG ZLWK '1$ VHTXHQFLQJ WHFKQRORJ\ ZDV HPSOR\HG WR REWDLQ WKH QXFOHRWLGH VHTXHQFH RI DOOHOHV RI WKH $EO H[RQ DOOHOHV VHTXHQFHG E\ 6$% VHTXHQFHG E\ -; 6KHf 7KHVH VHTXHQFHV ZHUH FRPELQHG ZLWK SUHYLRXVO\ UHSRUWHG ODERUDWRU\ PRXVH DQG UDW VHTXHQFHV WR SURYLGH D GDWD EDVH RI VHTXHQFHV 0DOLVVHQ HW DO /DUKDPPHU HW DO D (FFOHV DQG 0F0DVWHU (VWHVV HW DO $FKD2UEHD DQG 0F'HYLWW

PAGE 81

7DEOH /LVW RI $E $OOHOHV $QDO\]HG $OOHOH 6SHF L HV 6WUDLQ *HRJUDSKLF 2ULJLQ $EK + P GRPHVWLFXV &%, /DE LQEUHG $EG + P GRPHVWLFXV %$/%& /DE LQEUHG $W + P GRPHVWLFXV %+ /DE LQEUHG $Er + P GRPHVWLFXV %%5 /DE LQEUHG $W + P GRPHVWLFXV &+1% /DE LQEUHG $Er + P GRPHVWLFXV %5 /DE LQEUHG $En + P GRPHVWLFXV %5,,, /DE LQEUHG $E + P GRPHVWLFXV $68 /DE LQEUHG $Ef + P GRPHVWLFXV %3/ /DE LQEUHG $E: + P GRPHVWLFXV 1 /DE LQEUHG +XGR$E + P GRPHVWLFXV '5 )ORULGD 0XGR$Enf + P GRPHVWLFXV %&$$ +LFKLJDQ +XGR$E 0 P GRPHVWLFXV %67& +LFKLJDQ +XGR$E + P GRPHVWLFXV %6$$ +LFKLJDQ +XGR$E + P GRPHVWLFXV %67& +LFKLJDQ +XGR$E + P GRPHVWLFXV %%8$ +LFKLJDQ +XGR$E 0 P GRPHVWLFXV (5)8' +RURFFR $E + P GRPHVWLFXV $=58 +RURFFR 0XGR$E + P GRPHVWLFXV $=528 +RURFFR +XGR$Er + P GRPHVWLFXV +(7.9,&
PAGE 82

)LJXUH 7KH FRQVHQVXV DQG DOOHOLF QXFOHRWLGH VHTXHQFHV RI $E H[RQ 'DVKHG OLQHV UHSUHVHQW LGHQWLW\ ZLWK WKH FRQVHQVXV VHTXHQFH GLIIHUHQFHV DUH QRWHG $VWHULVNV UHSUHVHQW GHOHWLRQV RI WKRVH QXFOHRWLGHV

PAGE 83

&216(1686 **&$,7;&*, *7$&&$*77& $$***&*$*7 *&7$&77&$& &$$&***$&* &$*&*&$7$& **&,&*7*$& &$*$7$&$7& 7$&$$&&*** $**$*7$&*7 *&*&77&*$& $*&*$&*7** *&*$*7$&&* &*&**7*$&& $EU $EG $? $EN $E3 $EO $EU $En $Ef $EPY 0XGR$E 0XGR$E 0XG R$E 0XGR$O 0XGR$E 0XGR$E 0XGR$E 0XGR$E 0XGR$E 0XGR$E 7 $7$7 0XGR$En 0XGR$En 0XGR$En 0XGR$En 0XGR$E 0XUQX$E 0XPX$E 0XPX$E0XUQX$EA 0XPX$S 0XPX$E 0XFD$E 0XFD$EA 0XPR$E 0XVS$E 0XVS$E 0XVS$E 0XVL$E 0XVL$E 0XVL$E 0XVL$En 0XVL$E 0XVL$E 0XVW$E 0XFR$E 0XFH$E 0XFU$E 0XF U $E 0XSO$E 57 57 5DUD 5DUD *7 & &f§ *& *& &f§&&77& $7&7*$ 7 7 $7&7 $ $7&7 $ 7 7 *7 &f§ *& *& *& & &&&77& $7&7 $7$7 *$ *7 &f§&&77& f§77&f§ $7&7 f§$ $7&7 $ $7&7 $ $7&7 $ 7 *& &f§&&77& &f§&&77& *&* & $f§& 7 *& 77&7 $7&7f§$ 7 f§f§7 $7&7 *$ * $7&7 $7&7 f§7 *& f§7 f§ &f§&&77& * &f§ 7 $*&7f§*$ $7$7 $7&7 $ &f§&77& 7& f§7f§ *&f§ $7&7 *$ 7 7 $7$7 $7*7 $ &f§&&77& f§ &&&77& *7 &f§&&77& &&&77& 7&7f§*$ 7 *& &&&77& f§ 7&77& $$7f§ $**7& ** ** & & f§& f§& **f§ **f§ ** **f§ & & **f§ 7$ 7 & 7$ 7 f§ f§& f§ & **f§ ** ** ** 7$ f§ & f§& 7$ ** f§ f§& 7& f§& 7*f§ **f§ $ *$ 7$7& *$ 8L

PAGE 84

&216(1686 *$*&7****& **&&$*$&*& &*$*7$&7** $$&$*&&$*& &**$*$7&&7 **$*&*$$&* &***&&*$*& 7**$&$&**7 *7*&$*$&$& $$&7$&*$** **&&**$*$& &&$&$&&7&& &7*&**&**& 77* .E $W $EN $E3 $Em $EU $E $Ef $EA 0XGR$EA 0XGR$EA 0XGR$E F $& f§ Df§ F f§*7 & 0XGR$E 0XGR$EA 0XGR$EA 0XGR$E 0XGR$E-WI 0XGR$EA 0XGR$EAf 0XGR$EA 0XGR$EL0XPX$EA 0XPX$Ef 0XPX$EA 0XQ7X$Err 0XPX$E0XFD$Er 0X[QR$EA 0XVS$EA 0XVS$E 0XVS$EA 0XVL$Er 0XVL$EA 0XVL$E0XVL$EA 0XVL$E 0XVL$E 0XVW$EA 0XFR$EA 0XFH$EA 0XFU$EA f§ f§ I f§ LW LWIW f§ f§ f§ -rrr F $ 0XSO$E 57Ur 57Of 5DUDA 5DUD f§ &* $*$ $ & 7 f§ $$ f§&7f§rrr $ $ ** & 7 7$ $ 7$ &

PAGE 85

)LJXHURD HW DO f %\ DOLJQLQJ DOO WKH VHTXHQFHV LQ RXU SDQHO LW ZDV REVHUYHG WKDW WKH WZR FRGRQ GHOHWLRQ DW DPLQR DFLG SRVLWLRQV DQG ZHUH HUURQHRXVO\ SODFHG SUHYLRXVO\ LQ WKH OLWHUDWXUH (VWHVV HW DO f 6KLIWLQJ WKH SRVLWLRQ RI WKH WZR GHOHWLRQV WR QXFOHRWLGH SRVLWLRQV DQG UHVXOWV LQ WZR OHVV QXFOHRWLGH PLVn PDWFKHV EHWZHHQ WKH WZR IRUPV RI $EO 7KH QXFOHRWLGH VHTXHQFH RI DOO WKH DOOHOHV LV VKRZQ LQ )LJXUH '1$ VHTXHQFH DQDO\VLV RI WKHVH VHTXHQFHV UHYHDOHG GLIIHUHQW DOOHOHV LQ WKH GDWD VHW SDLUV RI LGHQWLFDO DOOHOHV ZHUH IRXQG LQ LQGHSHQGHQW VDPSOHV IURP WKH 0XV PXVFXOXV FRPSOH[ 7KH QXFOHRWLGH GLYHUVLW\ EHWZHHQ DOOHOHV ZDV FRPSXWHG XVLQJ 1HL DQG -LQnV SURJUDP f 0RVW DOOHOLF FRPSDULVRQV UHYHDOHG b VHTXHQFH GLYHUVLW\ LQ WKH $EO H[RQ DOWKRXJK VRPH DOOHOHV GLIIHUHG E\ DV PXFK DV b LQ FRPSDULVRQV ERWK ZLWKLQ DQG EHWZHHQ PRXVH VSHFLHV 7KH PD[LPXP YDOXH RI VHTXHQFH GLYHUJHQFH ZDV b DQG RFFXUUHG EHWZHHQ D UDW DOOHOH 5DUD f DQG D PRXVH DOOHOH 0XGR$E f 7KH PHDQ QXFOHRWLGH VHTXHQFH GLYHUVLW\ DPRQJ DOOHOHV ZLWKLQ D 0XV VSHFLHV s bf ZDV FRPSDUDEOH WR WKDW REVHUYHG EHWZHHQ VSHFLHV s bf DQG EHWZHHQ DOO DOOHOHV LQ WKH JHQXV s bf 7KHVH UHVXOWV LQGLFDWH WKDW WKH GLYHUVLILFDWLRQ RI 0+& JHQHV LV LQGHSHQGHQW RI WKH SK\ORJHQHWLF UHODWLRQVKLSV ZLWKLQ WKH JHQXV 0XV DQG FRQWUDVWV GLYHUVLILFDWLRQ SDWWHUQV RI RWKHU QXFOHDU JHQHV 6KH HW DO f

PAGE 86

3K\ORJHQHWLF 5HODWLRQVKLSV RI WKH $EO $OOHOHV 7KH SK\ORJHQHWLF UHODWLRQVKLSV RI WKHVH $EO DOOHOHV ZHUH DQDO\]HG XVLQJ ERWK SK\QHWLF RU GLVWDQFH PHWKRGV VXFK DV QHLJKERUMRLQLQJ DQG 83*0$ 6DLWRX DQG 1HL 6RNDO DQG 6QHDWK f DQG SDUVLPRQ\ DQDO\VLV '1$3$56 SURJUDP LQ 3+
PAGE 87

)LJXUH $ SKHQRJUDP FRQVWUXFWHG E\ WKH 83*0$ PHWKRG VKRZLQJ WKH UHODWLRQVKLSV EHWZHHQ DOOHOHV EDVHG RQ WKHLU VLPLODULW\ LQ H[RQ RI $E

PAGE 88

3 0XGRO 0XGR 0XGR 0XGR T 0XGR 0XVS 0XGRO 0XGRO V 0XFD I 0XVc 0XGR E 0XVSO 0XPX 0XFDO G 0XFU 0XPX 0XVc 0XGR U 0XGR 0XPRO 0XGR 0XGRO X N 0XGRO2 0XVS QRG 0XPX 0XVLO 0XVL 0XVL 0XVL 0XVWO 0XGR 0XFRO 0XFUO 0XPX 0XFHO 0XSO 57 E 5DUDO 5DUD 5DUD 57 X 0XGR O L L L L L L O , O O , , , , , b RI QXFOHRWLGH GLYHUJHQFH

PAGE 89

FRQWDLQLQJ OHVV WKDQ b QXFOHRWLGH GLYHUJHQFH LQ WKH $EO H[RQ VHSDUDWH VLQJOHWRQ DOOHOHV UHPDLQHG 7KLV LQGLFDWHV WKDW PRVW RI WKH OLQHDJHV GHILQHG LQ WKH DQDO\VLV DUH QRW UHWDLQHG DV VWDEOH SRO\PRUSKLVPV IRU PRUH WKDQ PLOOLRQ \HDUV 7KLV REVHUYDWLRQ VKDUSO\ FRQWUDVWV WKH UHVXOWV UHSRUWHG E\ *\OOHQVWHQ DQG (UOLFK f IRU SRO\PRUSKLVPV RI WKH SULPDWH FODVV ,, '4D JHQH 3DUVLPRQ\ DQDO\VLV UHYHDOHG D VHFRQG LQWHUHVWLQJ IHDWXUH RI WKH GLYHUVLILFDWLRQ SDWWHUQV DPRQJ WKHVH DOOHOHV 7KH PRVW SDUVLPRQLRXV QHWZRUN IRU DOO DOOHOHV UHTXLUHG FKDUDFWHU FKDQJHV DQG RQO\ RI WKH bf LQIRUPDWLYH VLWHV QXFOHRWLGH SRVLWLRQV H[KLELWLQJ DW OHDVW FKDUDFWHU VWDWHV UHSUHVHQWHG E\ RU PRUH DOOHOHV LQ WKH GDWD VHWf ZHUH FRPSDWLEOH ZLWK WKH JHQHDORJ\ 7KHVH UHVXOWV LQGLFDWH WKDW WKH DPRXQW RI KRPRSODV\ RU UHYHUVH SDUDOOHO RU FRQYHUJHQW PXWDWLRQV LV H[FHVVLYH DQG VXJJHVWV WKDW WKH REVHUYHG HYROXWLRQDU\ UHODWLRQVKLSV DUH QRW UHOLDEOH $Q H[DPSOH RI WKH KRPRSODV\ LQ WKH GDWD VHW LV LOOXVWUDWHG LQ O )LJXUH 7KH DFWXDO DQDO\VLV ZDV GRQH ZLWK QXFOHRWLGH VHTXHQFHV EXW WKH SUHVHQWDWLRQ RI WKH UHVXOWV LV VLPSOLILHG E\ VKRZLQJ WKH SURWHLQ VHTXHQFH 7KH FDUER[\O WHUPLQDO UHJLRQV RI WKH $EA DQG 0XPX$E DOOHOHV XQGHUOLQHGf DUH LGHQWLFDO WR WKDW RI $EQ XDOWKRXJK WKH UHPDLQGHU RI WKHLU VHTXHQFHV DUH FOHDUO\ GLIIHUHQW 7KHVH UHVXOWV PLJKW EH H[SODLQHG E\ FRQYHUJHQW HYROXWLRQ EXW WKH DPRXQW DQG WKH SDWWHUQV RI KRPRSODV\ REVHUYHG DUH EHVW H[SODLQHG E\

PAGE 90

)LJXUH ([DPSOHV RI KRPRSODV\ DPRQJ DOOHOHV RI $E H[RQ RUJDQL]HG LQWR OLQHDJHV E\ SDUVLPRQ\ DQDO\VLV 7KH XQGHUOLQHG VHTXHQFHV DUH UHJLRQV RI REYLRXV KRPRSODV\

PAGE 91

$PLQR $FLG 6HTXHQFHV (QFRGHG E\ $E ([RQ $E $OOHOHV +)9<4).*( &<)71*745, 5/975<,<15 ((<95)'6'9 *(<5$97(/* 53'$(<:1.4 r
PAGE 92

SRVWXODWLQJ LQWUDH[RQLF UHFRPELQDWLRQDO HYHQWV DPRQJ WKH DOOHOHV 7KH $EO ([RQ &RQVLVWV RI )LYH 3RO\PRUSKLF 6XE'RPDLQV 7KH PDMRULW\ RI SRO\PRUSKLVPV LQ WKH $EO H[RQ RFFXUV LQ VSHFLILF UHJLRQV WHUPHG SRO\PRUSKLF VHJPHQWV 7KHVH VHJPHQWV FRQWDLQ RI WKH bf LQIRUPDWLYH VLWHV IRU SDUVLPRQ\ DQDO\VLV DQG DUH LGHQWLILHG LQ )LJXUH (DFK SRO\PRUSKLF VHJPHQWV HQFRGHV D VSHFLILF HOHPHQW RI WKH K\SRWKHWLFDO FODVV ,, DQWLJHQ ELQGLQJ VLWH DV VKRZQ LQ )LJXUH 7KH %6 %6 DQG %6 VHJPHQWV DUH ORFDWHG ZLWKLQ WKH UHJLRQ RI WKH $EO H[RQ WKDW HQFRGHV WKH SOHDWHG VKHHWV RI WKH DQWLJHQ ELQGLQJ VLWH WKH DKHOL[ VHJPHQW LV ORFDWHG LQ WKH n HQG RI WKH UHJLRQ WKDW HQFRGHV WKH DKHOL[ RI WKH $%6 DQG WKH n VHJPHQW LV ORFDWHG DW WKH HQG RI WKH $EO H[RQ LQ D UHJLRQ WKDW HQFRGHV D SRUWLRQ RI $E ZKRVH VWUXFWXUH FDQQRW EH FXUUHQWO\ SUHGLFWHG 7KH $EO H[RQ ZDV GLYLGHG LQWR VXEGRPDLQV EDVHG RQ WKH ORFDWLRQV RI WKHVH SRO\PRUSKLF VHJPHQWV DQG HDFK VXEGRPDLQ ZDV DQDO\]HG VHSDUDWHO\ E\ SDUVLPRQ\ DQDO\VLV 7KLV UHYHDOHG WKDW WKH DOOHOHV LQ HDFK VXEGRPDLQ FRXOG EH RUJDQL]HG LQWR D VHULHV RI KLJKO\ GLYHUJHQW OLQHDJHV )XUWKHUPRUH WKH WRWDO QXPEHU RI PXWDWLRQV QHHGHG WR SURGXFH DOO RI WKH OLQHDJHV LQ DOO RI WKH VXEGRPDLQV ZDV WZRIROG ORZHU WKDQ WKDW UHTXLUHG IRU OLQHDJHV FRQVWUXFWHG IURP WKH HQWLUH H[RQ 7KLV LQGLFDWHV WKDW WKHVH VXEGRPDLQ OLQHDJHV KDYH PXFK ORZHU OHYHOV RI

PAGE 93

)LJXUH /RFDWLRQV RI SRO\PRUSKLF VHJPHQWV ZLWKLQ $E H[RQ

PAGE 94

/ " 70&<7&
PAGE 95

)LJXUH $ PRGHO PROHFXOH DV SURSRVHG DUHDV HQFRGHG E\ WKH RI WKH DQWLJHQ ELQGLQJ VLWH RI D 0KF FODVV ,, E\ %URZQ HW DO f 7KH JUH\ ]RQHV UHSUHVHQW SRO\PRUSKLF VHJPHQWV

PAGE 96

fVHJPHQW

PAGE 97

KRPRSODV\ DQG VXJJHVWV WKDW HDFK SRO\PRUSKLF VHJPHQW LV HYROYLQJ LQGHSHQGHQWO\ 7KH $EO ([RQ 6XE'RPDLQ /LQHDJHV 5HSUHVHQW $QFHVWUDO 3RO\PRUSKLVPV 3DUVLPRQ\ DQDO\VLV LGHQWLILHG GLVWLQFW OLQHDJHV LQ HDFK VXEGRPDLQ SULPDULO\ GHILQHG E\ SRLQW PXWDWLRQV RFFXUULQJ LQ WKH SRO\PRUSKLF VHJPHQWV 7KH FRQVHQVXV VHTXHQFHV RI WKHVH OLQHDJHV DUH SUHVHQWHG LQ 7DEOH 7KHVH KLJKO\ GLYHUVLILHG SRO\PRUSKLF VHJPHQWV RIWHQ GLIIHU LQ b RI WKHLU QXFOHRWLGH VHTXHQFHV 7KH PDMRULW\ RI WKH GLYHUVLW\ EHWZHHQ SRO\PRUSKLF VHJPHQWV DSSHDUV WR UHVXOW IURP WKH DFFXPXODWLRQ RI SRLQW PXWDWLRQV RYHU ORQJ HYROXWLRQDU\ SHULRGV $V LOOXVWUDWHG LQ )LJXUH HDFK VXEGRPDLQ OLQHDJH FRQWDLQV DOOHOHV GHULYHG IURP PXOWLSOH PRXVH VSHFLHV RU HYHQ ERWK PRXVH DQG UDW 7KH GDWD LQ 7DEOH LOOXVWUDWHV WKDW DOOHOHV LQ WKH VDPH VXEGRPDLQ OLQHDJH RIWHQ KDYH LGHQWLFDO RU YHU\ VLPLODU QXFOHRWLGH VHTXHQFHV \HW PD\ EH GHULYHG IURP HYROXWLRQDU\ GLVWDQW URGHQW VSHFLHV )RU H[DPSOH VRPH SRO\PRUSKLF VHJPHQWV DUH LGHQWLFDO LQ DOOHOHV GHULYHG IURP PRXVH DQG UDW LQGLFDWLQJ WKH\ KDYH EHHQ UHWDLQHG DV SRO\PRUSKLVPV IRU D PLQLPXP RI PLOOLRQ \HDUV 7KHVH UHVXOWV LQGLFDWH WKDW WKH SRO\PRUSKLF VHJPHQWV LQ WKH VXEGRPDLQV RI WKH $EO H[RQ DUH H[WUHPHO\ VWDEOH SRO\PRUSKLVPV VRPH RI ZKLFK ILUVW DURVH SULRU WR WKH GLYHUJHQFH RI PLFH DQG UDWV

PAGE 98

7DEOH 7KH QXFOHRWLGH VHTXHQFHV RI SRO\PRUSKLF VHJPHQWV LQ ILYH VXEGRPDLQV r 7KH VHTXHQFHV RQ WKH WRS RI HDFK VXEGRPDLQ DUH FRQVHQVXV VHTXHQFHV EDVHG RQ DOO DOOHOHV g LQGLFDWHV WKH WRWDO QXPEHU RI DOOHOHV WKDW VKDUH WKH VDPH SRO\PRUSKLF VHJPHQW e 6SHFLHV OLVWV DOO WKH VSHFLHV ZKLFK FRQWDLQ DW OHDVW RQH DOOHOH LQ WKDW OLQHDJH 6SHFLHV DUH QXPEHUHG DV IROORZLQJ 0 P GRPHVWLFXV 0 P PXVFXOXV 0 VSUHWXV 0 P FDVWDQHXV 0 P PRORVVLQXV 0 VSLFLOHJXV 0 VSUHWRLGHV 0 FHUYLFRORU 0 FRRNLL 0 FDUROL 0 SODWKYWUL[ 5DWWXV UDWWXV 5 QRUYHJLFXV‘

PAGE 99

/LO DJ 7DEOH 1XFOHRWLGH 1XPEHU RI 6SHF LHV r g n 6HTXHQFHV $OOHOHV 7$&&$*77&$$***&*$* &&&77& *& * &7 *7 &**&7&*7 *$&&$*$7 $&$7 & $7&7f§$ $7&7 f§ *$ $7$7 $7$7&*$ 7 f§ 7 f§$7f§*f§7 f§$*7 f§ *$ f§ &*7 7$$ 7$&*7*&*&77& ** & $ $ 7$ & $ &&$*$&*&&*$*7$&7**$$&$*&&$*&&**$*$7& $&7rrr$7rrr &7&$ 7rrr$7rrr &$&$ ** 7$$7 *7** &* $$ *7 $ ***&&**$*$&&&$&$&&7 &&&7 *&**&**&77 $$ *7& f§*7 $$$ & 7 & rrr 7 & *77f§7 7$77 rrrrr7777 $ & f§$ &* $ *7 rrr

PAGE 100

7DEOH 5HSUHVHQWDWLYH DOOHOLF VHTXHQFHV LQ WKH %6 DQG DKHOL[ VXEGRPDLQ OLQHDJHV LOOXVWUDWLQJ WKH FRQVHUYDWLRQ RI VHTXHQFH VHJPHQWV r 7KH VHTXHQFHV SUHVHQWHG DUH IURP %6 QXFOHRWLGH SRVLWLRQV DQG DKHOL[ QXFOHRWLGH SRVLWLRQV

PAGE 101

7DEOH 6XEGRPDLQ /LQHDJH $OOHOHV 6XEGRPDLQ VHTXHQFHVf 0XVW$E 0XGR$E 0XVL$E 0XFR$E $EX 0XVS$E 0XPX$E 0XSO$E *&$777&*7*7$&&$*77&$$***&*$*7*&7$&77& Ff§&&77& $ &f§&&77& $ *& &f§&&77& $ *7 7&77& $ 7f§*7 &f§&&77& F F77& &f§&&77& & &7 &&77& %6 0XGR$E *& 0XPX$E *& 0XVL$E *& 5DUD 578 $EG *7 $ 0XVL$E *7 $ DKHOL[ *&&$*$&*&&*$*7$&7**$$&$*&&$*&&**$*$7& 0XVW$E 7 $&f§7rrr $7rrr 0XFU$Ef 7 $&f§7rrr $7rrr 0XFD$E $&f§7rrr $7rrr 0XPX$E &$ 7&f§7rrr $7rrr 0XVL$E &$ f§7&f§7rrr $7rrr 0XVL$E 7 7&f§7rrr $7rrr 0XFR$E 7&f§7rrr D7rrr 0XVS$E $ &f§7rrr D7rrr 0XPR$E 7 7rrr $7rrr 0XFH$E 7rrr $7rrr 0XVS$E 7 7rrr D7rrr 0XGR$E $EA 57OE 0XPX$E f§$&7&$ f§$&7&$n &7&$ &$&$ 7rrr D7rrr $&f§7rrr D7rrr 7rrr $7rrr ‘7&f§7rrr D7rrr 0XFU$E 0XGR$E & 0XFD$E & 0XSO$E 7 $

PAGE 102

$PSOLILFDWLRQ RI $E 'LYHUVLW\ E\ ,QWUD([RQLF 5HFRPELQDWLRQ 7KH VSHFLILF DVVRFLDWLRQ RI WKH SRO\PRUSKLF VHJPHQW OLQHDJHV LQ WKH YDULRXV VXEGRPDLQV FRPSULVLQJ WKH $EO H[RQ RFFXUV LQ QXPHURXV FRPELQDWLRQV 7KLV LQGLFDWHV WKDW LQWUD H[RQLF UHFRPELQDWLRQ KDV RFFXUUHG GXULQJ WKH GLYHUVLILFDWLRQ RI WKH H[RQ DQG LV LOOXVWUDWHG LQ )LJXUH )RU H[DPSOH WKH 0XPX$E 0XFU$E DQG 0XFH$E DOOHOHV DOO KDYH VHTXHQFHV IURP OLQHDJH RI WKH %6 VXEGRPDLQ EXW KDYH VHTXHQFHV LQ OLQHDJHV DQG UHVSHFWLYHO\ IRU WKH %6 VXEGRPDLQ )LJXUH $f 6LPLODU UDQGRP DVVRFLDWLRQV DUH IRXQG IRU DOO WKH OLQHDJHV LQ DOO WKH VXEGRPDLQV LQGLFDWLQJ WKDW VKXIIOLQJ WKH SRO\PRUSKLF VHJPHQWV LQ HDFK VXEGRPDLQ WR JHQHUDWH QRYHO QHZ DOOHOHV KDV EHHQ D SULPDU\ HYROXWLRQDU\ PHFKDQLVP IRU $EO H[RQ GLYHUVLILFDWLRQ $OOHOHV GHULYHG IURP SK\ORJHQHWLFDOO\ GLVWDQW VSHFLHV FRPPRMLO\ RQO\ VKDUH RQH RU WZR SRO\PRUSKLF VHJPHQWV LQGLFDWLQJ WKDW VHYHUDO LQWUDH[RQLF UHFRPELQDWLRQDO HYHQWV KDYH DFFXPXODWHG GXULQJ WKHLU HYROXWLRQDU\ GLYHUJHQFH 7KLV VKXIIOLQJ SURFHVV DFFRXQWV IRU WKH IRUPDWLRQ RI DQ DUUD\ RI KLJKO\ GLYHUJHQW DOOHOHV ZKLFK PD\ GLIIHU LQ JUHDWHU WKDQ b RI WKHLU QXFOHRWLGH VHTXHQFH LQ WKH $EO H[RQ 'HVSLWH WKLV H[WHQVLYH UHFRPELQDWLRQ VWDEOH DVVRFLDWLRQV RI $EO VXEGRPDLQ OLQHDJHV FRXOG EH IRXQG DPRQJ DOOHOHV GHULYHG IURP WKH VDPH VSHFLHV RU VXEVSHFLHV RU FORVHO\ UHODWHG VSHFLHV ([DPSOHV RI VXFK DOOHOHV DUH VKRZQ

PAGE 103

LQ )LJXUH % DQG LV FRQVLVWHQW ZLWK WKH ILQGLQJ RI FORVHO\ UHODWHG FOXVWHUV RI DOOHOHV GHILQHG E\ 83*0$ DQDO\VLV LQ )LJXUH $QDO\VLV RI WKH HQWLUH GDWD VHW UHYHDOHG RI WKH VHTXHQFHV FRXOG EH RUJDQL]HG LQWR JURXSV RQ WKH EDVLV RI VKDULQJ RU PRUH FRQWLJXRXV VXE GRPDLQ OLQHDJHV $OO RI WKHVH JURXSV RQO\ FRQWDLQHG DOOHOHV GHULYHG IURP WKH VDPH VSHFLHV RI VSHFLHV WKDW KDYH GLYHUJHG OHVV WKDQ PLOOLRQ \HDUV 7KHVH UHVXOWV VXJJHVW WKDW PDQ\ VXEGRPDLQ OLQHDJH FRPELQDWLRQV DUH VWDEOH RYHU UHODWLYHO\ VKRUW HYROXWLRQDU\ WLPH VSDQV DQG WKDW LQWUD H[RQLF UHFRPELQDWLRQDO HYHQWV LQ WKH $EO H[RQ DFFXPXODWH VORZO\ RYHU HYROXWLRQDU\ SHULRGV $OWKRXJK LQWUDH[RQLF UHFRPELQDWLRQDO HYHQWV DFW WR VKXIIOH WKH SRO\PRUSKLF VHJPHQWV WKLV GRHV QRW LPSO\ WKDW WKH UHFRPELQDWLRQDO EUHDNSRLQWV RQO\ RFFXU DW VSHFLILF VLWHV LQ WKH $EO H[RQ 5DWKHU WKHVH HYHQWV RFFXU WKURXJKRXW WKH H[RQ ZLWK QR REYLRXV SDWWHUQ 7KLV LV LOOXVWUDWHG E\ WKH GLVWULEXWLRQ RI WKH SKHQRW\SLFDOO\ VLOHQW $f WR 7 WUDQVYHUVLRQ VXEVWLWXWLRQ DW QXFOHRWLGH SRVLWLRQ DPRQJ OLQHDJHV RI WKH %6 VXEGRPDLQ 7KH $ QXFOHRWLGH LV SUHVHQW LQ DOO DOOHOHV IURP OLQHDJHV DQG WKH 7 QXFOHRWLGH LV SUHVHQW LQ DOO OLQHDJH DOOHOHV 7KH $ DQG WKH 7 LV D SRO\PRUSKLVP LQ OLQHDJH DOOHOHV 7DEOH f 7KLV GLVWULEXWLRQ SDWWHUQ LV PRVW HDVLO\ H[SODLQHG E\ SRVWXODWLQJ WKDW WKH UHFRPELQDWLRQDO EUHDNSRLQWV KDYH RFFXUUHG RQ ERWK VLGHV RI QXFOHRWLGH SRVLWLRQ GXULQJ WKH

PAGE 104

)LJXUH $ VFKHPDWLF GLDJUDP RI $E H[RQ VWUXFWXUH RI VRPH UHSUHVHQWDWLYH DOOHOHV /LQHDJHV RI SRO\PRUSKLF VHJPHQWV DUH UHSUHVHQWHG E\ GLIIHUHQW ILOO SDWWHUQV $f $OOHOHV GHULYHG IURP GLVWDQWO\ UHODWHG VSHFLHV VKDULQJ RQO\ VXEGRPDLQV WKXV LOOXVWUDWLQJ WKH VKXIIOLQJ RI VXEGRPDLQ OLQHDJHV E\ LQWUDH[RQLF UHFRPELQDWLRQ %f $OOHOHV GHULYHG IURP WKH VDPH VSHFLHV RU FORVHO\ UHODWHG VSHFLHV VKDULQJ LGHQWLFDO VXEGRPDLQV

PAGE 105

$ 0XS0 0XPX 0XFUO 0XFRO 0XFHO 0XPX %6 %6 %6 DKHOL[ f VHJPHQW / [[[[[[ G L PP L 3 9n 9 Q L t L D D Ir ‘ ’ O O W r $ $ $ $ % 0XPXO 0XGR 0XVc 0XVWO /LQHDJH /LQHDJH /LQHDJH .;;;!G /LQHDJH /LQHDJH 9V999 /LQHDTH /LQHDTH /LQHDJH

PAGE 106

HYROXWLRQ RI WKH H[RQ 6XFK D SURFHVV ZRXOG UHVXOW LQ WKH VKXIIOLQJ RI WKLV VLOHQW SRO\PRUSKLVP DPRQJ OLQHDJHV RI $EO 0DQ\ RWKHU H[DPSOHV RI ZDQGHULQJ VLQJOH QXFOHRWLGH SRO\PRUSKLVPV FDQ EH IRXQG WKURXJKRXW WKH H[RQ LH SRVLWLRQV f ,Q DGGLWLRQ VHYHUDO UHFRPELQDWLRQDO HYHQWV KDYH RFFXUUHG ZLWKLQ D SRO\PRUSKLF VHJPHQW )RU H[DPSOH WKH QXFOHRWLGHV &$&$ DW SRVLWLRQV LQ WKH DKHOL[ LV IRXQG LQ DOOHOHV ZLWK WKH WZR f FRGRQ GHOHWLRQV 0XGR$E f DV ZHOO DV LQ XQGHOHWHG DOOHOHV 0XPX$E f 7KHVH UHVXOWV WKHUHIRUH LQGLFDWH WKDW \ UHFRPELQDWLRQDO EUHDNSRLQWV GR QRW UHSHDWHGO\ RFFXU DW WKH VDPH SRVLWLRQV ZLWKLQ WKH H[RQ ,Q FRQFOXVLRQ WKH GDWD LQGLFDWHV WKDW VSHFLILF VHFWLRQV RI WKH $EO H[RQ RU WKH SRO\PRUSKLF VHJPHQWV FRQWDLQ PDQ\ KLJKO\ GLYHUJHQW DOOHOLF IRUPV WKDW DUH VWDEOH RYHU ORQJ HYROXWLRQDU\ SHULRGV 7KH HQWLUH H[RQ KRZHYHU GRHV QRW HYROYH DV D VLQJOH HQWLW\ GXH WR UHSHDWHG LQWUD H[RQLF UHFRPELQDWLRQV $V D UHVXOW WKH H[WHQVLYH GLYHUVLW\ EHWZHHQ DOOHOHV SUHGRPLQDQWO\ DULVHV IURP WKH UHFRPELQDWLRQDO VKXIIOLQJ RI WKHVH KLJKO\ GLYHUJHQW SRO\PRUSKLF VHJPHQWV LQWR D YDULHW\ RI QRYHO FRPELQDWLRQV

PAGE 107

7KH ,PSDFW RI 0KF &ODVV ,, $E *HQH 3RO\PRUSKLVPV RQ WKH 6WUXFWXUH RI WKH $QWLJHQ %LQGLQJ 6LWH ,Q DQ HIIRUW WR GHWHUPLQH ZKHWKHU WKH H[WHQVLYH GLYHUVLW\ RI WKH 0KF $E JHQH ZDV JHQHUDWHG DQG PDLQWDLQHG YLD VHOHFWLYH SUHVVXUHV DFWLQJ WR GLYHUVLI\ WKH DQWLJHQ ELQGLQJ VLWH WKH LPSDFW RI WKH SRO\PRUSKLVP RQ WKH VWUXFWXUH RI WKH DQWLJHQ ELQGLQJ VLWH ZDV DQDO\]HG 7KH K\SRWKHWLFDO GLPHQVLRQDO PRGHO RI 0KF FODVV ,, PROHFXOHV SURSRVHG E\ %URZQ HW DO f SURYLGHV D IUDPHZRUN LQ ZKLFK WR DVVHVV WKH SRWHQWLDO LPSDFW RI WKHVH SRO\PRUSKLVPV RQ WKH IXQFWLRQDO SURSHUWLHV RI $E )RUW\HLJKW GLIIHUHQW 0XVGHULYHG DOOHOHV ZHUH H[DPLQHG LQ WKLV SRUWLRQ RI WKH VWXG\ DQG WKH DOOHOHV DUH OLVWHG LQ 7DEOH 7KH DQWLJHQ ELQGLQJ VLWH ZDV GLYLGHG LQWR VHJPHQWV EDVHG RQ WKH K\SRWKHWLFDO PRGHO %URZQ HW DO f VWUXFWXUDO IHDWXUHV DQG SDWWHUQV RI SRO\PRUSKLVP SOHDWHG VKHHWV DQG %6 %6 DQG %6f DUH HQFRGHG E\ DPLQR DFLGV DQG UHVSHFWLYHO\ DKHOL[ H[WHQGV IURP DPLQR DFLG WR DPLQR DFLG SRVLWLRQ b RI WKH DOOHOHV FRQWDLQ D SUROLQH DW SRVLWLRQ DQG b RI WKH DOOHOHV KDYH D FRGRQ GHOHWLRQ DW WKLV SRVLWLRQ 7KH DKHOL[ SRUWLRQ RI WKH DQWLJHQ ELQGLQJ VLWH H[WHQGV IURP DPLQR DFLG SRVLWLRQ WR (YHU\ DOOHOH VHTXHQFHG HQFRGHV F\VWHLQH DW SRVLWLRQV DQG DQG WKHVH UHVLGXHV IRUP D GLVXOILGH ERQG WKDW SUREDEO\ DFWV WR DQFKRU WKH DKHOL[ WR WKH SOHDWHG VKHHW

PAGE 108

7DEOH /LVW RI $E $OOHOHV $QDO\]HG $OOHOH 6SHFLHV 6WUDLQ *HRJUDSKLF 2ULJLQ $E 0 P GRPHVWLFXV &%, /DE LQEUHG NEG 0 P GRPHVWLFXV %$/%& /DE LQEUHG $E 0 P GRPHVWLFXV %0 /DE LQEUHG $En 0 P GRPHVWLFXV %:% /DE LQEUHG $Er 0 P GRPHVWLFXV %%5 /DE LQEUHG $O 0 P GRPHVWLFXV &+1% /DE LQEUHG $E" 0 P GRPHVWLFXV %5 /DE LQEUHG $EU 0 P GRPHVWLFXV %5, /DE LQEUHG $Er 0 P GRPHVWLFXV $68 /DE LQEUHG $Ef 0 P GRPHVWLFXV %3/ /DE LQEUHG $Efn 0 P GRPHVWLFXV 12' /DE LQEUHG 0XGR$E 0 P GRPHVWLFXV '5 )ORULGD 0XGR$E 0 P GRPHVWLFXV %&$$ 0LFKLJDQ 0XGR$E0 P GRPHVWLFXV %67& 0LFKLJDQ 0XGR$EA 0 P GRPHVWLFXV %6$$ 0LFKLJDQ 0XGR$E 0 P GRPHVWLFXV %67& 0LFKLJDQ 0XGR$E 0 P GRPHVWLFXV %%8$ 0LFKLJDQ 0XGR$E + P GRPHVWLFXV (5)28' 0RURFFR $EH 0 P GRPHVWLFXV $=58 0RURFFR 0XGR$E 0 P GRPHVWLFXV $=528 0RURFFR 0XGR$E 0 P GRPHVWLFXV 0(7.9,&
PAGE 109

VWUXFWXUH 7KH DKHOL[ VHFWLRQ H[WHQGV IURP DPLQR DFLG WR DPLQR DFLG 7KH PRVW FRPPRQ DPLQR DFLG DW SRVLWLRQ LV SUROLQH DQG LQ FRQWUDVW WR WKH SUROLQH DW UHVLGXH ZKLFK PRVW OLNHO\ NLQNV WKH DKHOL[ WKH SUROLQH DW SRVLWLRQ SUREDEO\ GHVWUR\V WKH VHFRQGDU\ DKHOLFDO VWUXFWXUH 7KH 'LVWULEXWLRQ RI $PLQR $FLG 'LYHUVLW\ 7KH DPLQR DFLG VHTXHQFHV SUHGLFWHG IURP WKH QXFOHRWLGH VHTXHQFHV RI 0XVGHULYHG DOOHOHV RI $E H[RQ DUH SUHVHQWHG LQ )LJXUH 7KH DOOHOHV LQ WKH SDQHO GLIIHU E\ DQ DYHUDJH RI DPLQR DFLGV DQG PRVW RI WKLV GLYHUVLW\ LV ORFDOL]HG ZLWKLQ GLVFUHWH VHJPHQWV RI WKH H[RQ 7KLV LV LOOXVWUDWHG E\ DQDO\VLV RI WKH SURWHLQ VHTXHQFH YDULDELOLW\ E\ WKH FRQYHQWLRQ RI .DEDW DQG :X :X DQG 5DEDW f)LJXUH DQG 7DEOH f 7KHUH DUH HOHYHQ SRVLWLRQV ZLWK KLJK YDULDELOLW\ 9 f DQG WHQ SRVLWLRQV ZLWK PRGHUDWH YDULDELOLW\ 9 f DQG DOO WKHVH UHVLGXHV DUH ORFDWHG LQ VHJPHQWV WKDW FRPSULVH GLVWLQFW SRUWLRQV RI WKH DQWLJHQ ELQGLQJ VLWH )LJXUH f 7KHVH DQWLJHQ ELQGLQJ VLWH VHJPHQWV DUH WKH SOHDWHG VKHHWV WKDW IRUP WKH IORRU RI WKH DQWLJHQ ELQGLQJ VLWH DQG WKH DKHOL[ WKDW IRUPV WKH VLGH RI WKH ELQGLQJ VLWH JURRYH ,W VKRXOG EH QRWHG WKDW WKH DPLQR DFLG UHVLGXHV SUHGLFWHG E\ %URZQ HW DO f WR GLUHFWO\ FRQWDFW DQWLJHQLF IUDJPHQWV PDUNHG E\ DUURZV LQ )LJXUH f UHSUHVHQW RQO\ RI WKH PRVW SRO\PRUSKLF UHVLGXHV 7KLV VXJJHVWV WKDW DPLQR DFLG SRVLWLRQV RWKHU

PAGE 110

)LJXUH 7KH FRQVHQVXV DQG DOOHOLF DPLQR DFLG VHTXHQFHV SUHGLFWHG IURP WKH QXFOHRWLGH VHTXHQFH RI $E H[RQ 'DVKHG OLQHV UHSUHVHQW LGHQWLW\ ZLWK WKH FRQVHQVXV VHTXHQFH GLIIHUHQFHV DUH QRWHG $VWHULVNV UHSUHVHQW GHOHWLRQV RI WKRVH UHVLGXHV %ROG DQG XQGHUOLQHG DPLQR DFLGV LQ WKH FRQVHQVXV VHTXHQFH KDYH 5DEDW DQG :X LQGLFHV JUHDWHU WKDQ EROG DPLQR DFLGV KDYH LQGLFHV EHWZHHQ DQG

PAGE 111

FRQVHQVXV 0XPX$E 0XGR $ En 0XGR$Er 0XGR $ Err 0XGR $ EA 0XGR$En 0XGR$EA 0XLQX$EA 0XGR$E 0XGR$En 0XGR$E 0XGR$E 0XGR$E 0XGR$E 0XGR$E 0XPL$Ef 0XMQX$En 0XLRX$Enn 0XPX$EA 0XV L$En 0XV L$E 0XVW$En 0XFR$En 0XFH$En 0XFU$En 0XFU$Ea 0XSO$En +)9<4).*( &<)71*745, 5/975<,<15 ((<95)'6'9 *(<5$97(/* 53'$(<:1.4 r<}/(575$( /'79&5+1<( *7(7376/55 / + 6 3(, 6 3(, 9$ 3+ 36 9 6$ +43) f§/943) + $ $/ f§ $/f§ + 6' / 6 < 61 )0 ) 9 4. 9 3+ f§ 61 : 6 3(, 9 (9 f§ /< 3< 6' / < 4 < /
PAGE 112

)LJXUH $ YDULDELOLW\ SORW RI WKH DPLQ ADFLG SRVLWLRQV HQFRGHG LQ $E H[RQ DFFRUGLQJ WR WKH PHWKRG RI :X DQG .DEDW f 7KH OLQHV XQGHUQHDWK WKH EDU JUDSK LQGLFDWH WKH SRVLWLRQV RI VSHFLILF HOHPHQWV RI WKH DQWLJHQ ELQGLQJ VLWH 7KH DUURZV LGHQWLI\ SRVLWLRQV ZKLFK HQFRGH FRQWDFW DPLQR DFLGV DFFRUGLQJ WR %URZQ HW DO f

PAGE 113

9$5,$%,/,7< %6 %6%6 $+ $+ $+ $0,12 $&,' 2 2O

PAGE 114

7DEOH 5DEDW DQG :X YDULDELOLW\ GDWD IRU $E H[RQ $PLQR $FLG 5DEDW DQG :X 9DOXH 3RVLWLRQ $OOHOHV f f 9f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f

PAGE 115

WKDQ WKRVH SUHGLFWHG WR EH FRQWDFW DPLQR DFLGV PD\ SOD\ D SURPLQHQW UROH LQ GHWHUPLQLQJ DOOHOLF ELQGLQJ FDSDFLW\ $V LOOXVWUDWHG LQ )LJXUH WKH PRVW SRO\PRUSKLF UHVLGXHV LQ VWUDQGV DQG GR QRW H[DFWO\ FRLQFLGH ZLWK WKH FHQWUDO IORRU RI WKH DQWLJHQ ELQGLQJ VLWH ,QWHUHVWLQJO\ AVWUDQG LV VHSDUDWHG IURP VWUDQGV DQG E\ D WXUQ VHJPHQW ZKRVH H[DFW VWUXFWXUH FDQQRW EH GHILQLWLYHO\ GHWHUPLQHG IURP WKH FODVV PRGHO 3HUKDSV WKH WXUQ LQ WKLV VHJPHQW LV PRUH DEUXSW WKDQ SURSRVHG E\ %URZQ HW DO f &RQVHTXHQWO\ WKLV ZRXOG KDYH WKH HIIHFW WR PRUH SUHFLVHO\ DOLJQ WKH PRVW SRO\PRUSKLF DPLQR DFLGV RI VWUDQGV DQG ZLWK WKH LQQHU IORRU RI WKH DQWLJHQ ELQGLQJ VLWH $OWHUQDWLYHO\ LI VWUDQGV DQG DUH SURSHUO\ DOLJQHG LQ WKH K\SRWKHWLFDO PRGHO VRPH RI WKH PRVW SRO\PRUSKLF DPLQR DFLGV VXFK DV SRVLWLRQV DQG FRXOG IRUP KLJKO\ GLYHUVLILHG SRFNHWV XSRQ LQWHUDFWLRQ ZLWK WKH D KHOLFDO UHVLGXHV ,W LV LQWHUHVWLQJ WR QRWH WKDW DPLQR DFLG SRVLWLRQ LV KLJKO\ YDULDEOH 9 f ZLWK VL[ GLIIHUHQW DPLQR DFLGV GHWHFWHG DPRQJ WKH DOOHOHV H[DPLQHG 3RO\PRUSKLVPV RI SRVLWLRQ ZHUH SUHYLRXVO\ VXJJHVWHG WR LQFUHDVH VXVFHSWLELOLW\ WR GLDEHWHV 7RGG HW DBO f )RUW\WKUHH SHUFHQW f RI WKH DPLQR DFLGV WKDW FRPSULVH $E H[RQ DUH FRQVHUYHG 9 f DPRQJ WKH DOOHOHV LQ WKH GDWD VHW )LJXUH DQG 7DEOH f 7ZHOYH RI WKHVH FRQVHUYHG UHVLGXHV DUH ORFDWHG ZLWKLQ WKH DQWLJHQ

PAGE 116

ELQGLQJ VLWH LQ WKH SOHDWHG VKHHW VHJPHQWV DQG DUH VFDWWHUHG WKURXJKRXW WKH DKHOLFDO UHJLRQ LQ QR GLVWLQJXLVKDEOH SDWWHUQ )LJXUH f 7KUHH RI WKHVH FRQVHUYHG UHVLGXHV SOD\ FULWLFDO UROHV LQ PDLQWDLQLQJ SURSHU WHUWLDU\ VWUXFWXUH RI WKH $EO GRPDLQ )RU LQVWDQFH UHVLGXHV DQG ERWK HQFRGH IRU F\VWHLQH DQG IRUP WKH GLVXOILGH ERQG VWDELOL]LQJ WKH VWUXFWXUH RI WKH PROHFXOH ,Q DGGLWLRQ WKH 1OLQNHG JO\FRV\ODWLRQ VLWH DW UHVLGXH LV FRQVHUYHG 6L[W\RQH SHUFHQW f RI WKH FRQVHUYHG DPLQR DFLGV DUH ORFDWHG LQ WKH SOHDWHG VKHHWV RXWVLGH WKH DQWLJHQ ELQGLQJ VLWH RU IRUP WKH WXUQV 2YHUDOO WKHVH UHVXOWV LQGLFDWH WKDW H[WHQVLYH DPLQR DFLG GLYHUVLW\ LV RQO\ SHUPLWWHG LQ SDUWV RI WKH PROHFXOH WKDW FDQ DOWHU DQWLJHQ ELQGLQJ FDSDFLW\ VXFK DV WKH DQWLJHQ ELQGLQJ VLWH ,Q FRQWUDVW D FHUWDLQ DPRXQW RI DPLQR DFLG FRQVHUYDWLRQ LV UHTXLUHG WR PDLQWDLQ WKH VWUXFWXUDO LQWHJULW\ RI WKH $EO GRPDLQ 6HOHFWLYH 'LYHUVLILFDWLRQ RI $QWLJHQ %LQGLQJ 6LWH &RGRQV 7R LQYHVWLJDWH WKH SRVVLELOLW\ WKDW GLYHUVLI\LQJ VHOHFWLRQ ZDV LQYROYHG LQ WKH GHYHORSPHQW RI DQWLJHQ ELQGLQJ VLWH YDULDELOLW\ WKH IUHTXHQFLHV RI QRQV\QRQ\PRXV GQ DPLQR DFLG UHSODFHPHQWf DQG V\QRQ\PRXV GV VLOHQWf VXEVWLWXWLRQV ZDV PHDVXUHG DV GHVFULEHG E\ +XJKHV DQG 1HL f DQG SHUIRUPHG RQ WKH DOOHOHV RI RXU GDWD VHW $V VKRZQ LQ 7DEOH DQ\ WZR $E H[RQ VHTXHQFHV LQ WKH GDWD

PAGE 117

)LJXUH +\SRWKHWLFDO GLPHQVLRQDO PRGHO RI WKH 0KF FODVV ,, DQWLJHQ ELQGLQJ VLWH %URZQ HW DO f $E UHVLGXHV ZLWK KLJK YDULDELOLW\ .DEDW DQG :X LQGLFHV f DUH GHSLFWHG ZLWK VROLG ILOO UHVLGXHV ZLWK PRGHUDWH YDULDELOLW\ 9 f ZLWK JUH\ ILOO DQG FRQVHUYHG UHVLGXHV 9 f LQ WKH DQWLJHQ ELQGLQJ VLWH VHJPHQWV RQO\ DUH FURVVKDWFKHG

PAGE 119

6WDWLVWLFDO $QDO\VLV RI WKH 1XFOHRWLGH 6XEVWLWXWLRQV %HWZHHQ $OOHOHV RI $" ([RQ r $ ([RQ &RGRQV 1XPEHU RI &RGRQV b RI 6XEVWLWXWLRQV GB Gf V Q G fG Qn V Gf Gf Q V :KROH H[RQ s s 1RQDQWLJHQ ELQGLQJ VLWH s s $QWLJHQ ELQGLQJ VLWH s s $PLQR WHUPLQXV s s VKHHW s n s WXUQ s s VKHHW s s WXUQ s s VKHHW s s WXUQ VKHHW s s DKHOL[ s s DKHOL[ s s DKHOL[ s s &DUER[\ WHUPLQXV s s &RQWDFW DPLQR DFLGV s s r 0HDQ QXPEHU RI QXFOHRWLGH VXEVWLWXWLRQV SHU V\QRQ\PRXV GVf DQG QRQV\QRQ\PRXV GQf VLWHV H[SUHVVHG DV SHUFHQWDJHV ZLWK WKHLU VWDQGDUG HUURUV ,OO

PAGE 120

)LJXUH 3ORW RI WKH IUHTXHQFLHV RI QRQV\QRQ\PRXV PXWDWLRQV PLQXV WKH IUHTXHQFLHV RI V\QRQ\PRXV PXWDWLRQV IRU WKH $E H[RQ VHJPHQWV 1+ DPLQR WHUPLQXV f %6 VWUDQG f %7 WXUQ f %6 VKHHW f %7 WXUQ f %6 SVKHHW f %7 WXUQ VKHHW f $+, DKHOL[ f $+ DKHOL[ f $+ DKHOL[ f DQG &22+ FDUER[\O WHUPLQXV RI WKH $EO GRPDLQ f

PAGE 121

'Q'V f $%6 6(*0(17 QK %6 %7 %6 %7 %6 %7 $+ $+ $+ &22+ 'V 'Q 'Q'V A

PAGE 122

VHW GLIIHU RQ DYHUDJH E\ b QRQV\QRQ\PRXV VXEVWLWXWLRQV 7KLV LV LQ FRQWUDVW WR WKH DYHUDJH SHUFHQWDJH RI V\QRQ\PRXV FKDQJHV EHWZHHQ DOOHOHV ZKLFK LV b 6LQFH WKH PDMRULW\ RI VXEVWLWXWLRQV LQ HXNDU\RWLF DQG SURNDU\RWLF JHQHV DUH V\QRQ\PRXV WKH UDWLR RI QRQV\QRQ\PRXV WR V\QRQ\PRXV VXEVWLWXWLRQV GQGVfFDQ EH XVHG DV D PHDVXUHPHQW RI WKH GHJUHH RI GLYHUVLI\LQJ VHOHFWLRQ 7KHVH GDWD SURYLGH HYLGHQFH WKDW $E H[RQ LV VHOHFWLYHO\ GLYHUVLILHG GQGV f $V LOOXVWUDWHG LQ 7DEOH DQG )LJXUH WKH FRGRQV IRUPLQJ WKH DQWLJHQ ELQGLQJ VLWH DUH H[SHULHQFLQJ PRUH QRQV\QRQ\PRXV VXEVWLWXWLRQV DQG IHZHU V\QRQ\PRXV VXEVWLWXWLRQV GQGV f WKDQ QRQDQWLJHQ ELQGLQJ VLWH FRGRQV LQ H[RQ RU DQ\ FRGRQV LQ H[RQ GQGV DQG UHVSHFWLYHO\f $QDO\VLV RI HDFK LQGLYLGXDO DQWLJHQ ELQGLQJ VLWH VHJPHQW VHSDUDWHO\ VKRZV ZLWK WKH H[FHSWLRQ RI WKH DKHOL[ SRUWLRQ ZKLFK KDV D YHU\ KLJK IUHTXHQF\ RI V\QRQ\PRXV PXWDWLRQV D PXFK KLJKHU IUHTXHQF\ RI QRQV\QRQ\PRXV VXEVWLWXWLRQV WKDQ V\QRQ\PRXV VXEVWLWXWLRQV 7KLV SDWWHUQ LV SDUWLFXODUO\ DSSDUHQW IRU WKH FRGRQV SUHGLFWHG WR HQFRGH DPLQR DFLGV WKDW FRQWDFW DQWLJHQLF IUDJPHQWV GLUHFWO\ GQGV f7DEOH f%URZQ HW DO f 7KHVH UHVXOWV VWURQJO\ VXSSRUW WKH FRQFOXVLRQ WKDW GLYHUVLI\LQJ VHOHFWLRQ LV SUHGRPLQDQWO\ UHVSRQVLEOH IRU DQWLJHQ ELQGLQJ VLWH GLYHUVLW\

PAGE 123

&RGRQ 'HOHWLRQV RI WKH $EO 'RPDLQ 7KH DKHOL[ DQG FDUER[\O WHUPLQXV VHJPHQW RI WKH $EO GRPDLQ RFFXUV LQ GLIIHUHQW OHQJWKV DPRQJ WKH $E DOOHOHV DQDO\]HG ,Q DGGLWLRQ WR WKH XQGHOHWHG DQG GHOHWLRQ IRUPV IRXQG LQ ODERUDWRU\ PRXVH VWUDLQV &KRL HW DO (VWHVV HW DO f DOOHOHV ZLWK FRGRQ GHOHWLRQV RI SRVLWLRQV DQG ZHUH GHWHFWHG )LJXUHV DQG f 7KH LPSDFW RI WKHVH YDULRXV FRGRQ GHOHWLRQV RQ WKH VWUXFWXUH RI WKH DQWLJHQ ELQGLQJ VLWH PD\ QRW EH HTXLYDOHQW )RU LQVWDQFH WKH GHOHWLRQV RI DPLQR DFLGV DQG WKH GHOHWLRQ RI DPLQR DFLG ZDV f IRXQG LQ RQO\ DOOHOH 0XGR$E f RFFXU LQ WKH n VHFWLRQ RI WKH DKHOL[ ZKHUHDV WKH FRGRQ GHOHWLRQV RI DPLQR DFLGV DQG RFFXU n WKH VWDELOL]LQJ GLVXOILGH ERQG LQ WKH VHJPHQW FRQQHFWLQJ WKH $EO DQG $E GRPDLQV 7KH FRGRQ GHOHWLRQV RI DPLQR DFLGV DQG ZRXOG EH SUHGLFWHG WR FKDQJH WKH RULHQWDWLRQ RI DPLQR DFLGV LQ WKH DKHOL[ VHJPHQWV DGMDFHQW WR WKH GHOHWLRQV UHODWLYH WR WKH XQGHOHWHG DOOHOHV &RQVHTXHQWO\ WKHVH FRGRQ GHOHWLRQV VKRXOG FKDQJH WKH SRVLWLRQV RI VRPH FRQWDFW DPLQR DFLGV ZLWK 5 JURXSV RULHQWDWHG LQWR WKH DQWLJHQ ELQGLQJ VLWH WKHUHE\ SURIRXQGO\ PRGLI\LQJ WKH LQWHULRU VWUXFWXUH RI DW OHDVW D SRUWLRQ RI WKH ELQGLQJ VLWH ,Q DGGLWLRQ DOO WKH DOOHOHV WKDW GR QRW GHOHWH DPLQR DFLGV DQG ZLWK WKH H[FHSWLRQ RI WKH 0XSO$E DOOHOH KDYH D SUROLQH UHVLGXH DW SRVLWLRQ 7KLV ZRXOG PRVW OLNHO\ LQWURGXFH D NLQN LQWR WKH D

PAGE 124

)LJXUH +\SRWKHWLFDO GLPHQVLRQDO PRGHO RI WKH 0KF FODVV ,, DQWLJHQ ELQGLQJ VLWH DV SURSRVHG E\ %URZQ HW DO f VKRZLQJ WKH SRVLWLRQ RI WKH DPLQR DFLG GHOHWLRQV RFFXUULQJ LQ WKH DKHOL[ DQG FDUER[\O WHUPLQDO VHJPHQWV

PAGE 126

KHOL[ VWUXFWXUH 7KXV WKH WZR IRUPV RI DKHOLFHV KDYH YHU\ GLIIHUHQW VWUXFWXUHV DQG PRVW OLNHO\ KDYH VRPH GLIIHUHQW DPLQR DFLG VLGH FKDLQV IDFLQJ LQWR WKH LQWHULRU RI WKH DQWLJHQ ELQGLQJ VLWH 7R WHVW WKH SRVVLELOLW\ WKDW WKH SDWWHUQV RI DPLQR DFLG YDULDELOLW\ PLJKW FKDQJH GXH WR VWURQJ GLYHUVLI\LQJ VHOHFWLRQ DFWLQJ RQ WKH FRQWDFW DPLQR DFLGV 7DEOH f WKH YDULDELOLW\ RI DKHOL[ VHJPHQWV DQG IURP XQGHOHWHG DQG GHOHWHG DOOHOHV ZHUH PHDVXUHG VHSDUDWHO\ $V VKRZQ LQ )LJXUH DQG 7DEOH YDULDEOH SRVLWLRQV DUH XQLTXH WR WKH XQGHOHWHG DOOHOHV DQG YDULDEOH SRVLWLRQV DUH XQLTXH WR WKH GHOHWHG DOOHOHV 7KH PRVW VWULNLQJ GLIIHUHQFH EHWZHHQ WKH WZR DOOHOHV LV DW SRVLWLRQ RI WKH GHOHWHG DOOHOHV 7KH KLJK YDULDELOLW\ RI SRVLWLRQ VXJJHVWV WKDW WKH FRGRQ GHOHWLRQV URWDWH WKH DKHOL[ LQ VXFK D PDQQHU WKDW WKH VLGH FKDLQ RI DPLQR DFLG EHFRPHV D FRQWDFW DPLQR DFLG DQG WKHUHIRUH XQGHUJRHV VWURQJ GLYHUVLI\LQJ VHOHFWLRQ )XUWKHUPRUH DPLQR DFLG LV DOVR XQLTXHO\ GLYHUVLILHG LQ WKH GHOHWHG DOOHOHV DGGLWLRQDOO\ VXJJHVWLQJ WKDW WKH GHOHWLRQV FKDQJH WKH RULHQWDWLRQ RI WKH DKHOL[ IXUWKHU 2YHUDOO WKHVH UHVXOWV LQGLFDWH WKDW GLYHUVLI\LQJ VHOHFWLRQ RSHUDWHV RQ GLIIHUHQW DPLQR DFLG SRVLWLRQV LQ WKHVH DOOHOHV RI WKH D KHOL[ 7KLV VXJJHVWV WKDW WKH FRGRQ GHOHWLRQV LQ WKH n SRUWLRQ RI WKH DKHOL[ PD\ FKDQJH WKH SRVLWLRQ RI VRPH FRQWDFW DPLQR DFLGV DQG FRQVHTXHQWO\ GUDPDWLFDOO\ HIIHFW

PAGE 127

)LJXUH .DEDW DQG :X YDULDELOLW\ SORW RI WKH DKHOL[ VHJPHQWV DQG RI XQGHOHWHG DOOHOHV DQG DOOHOHV GHOHWHG DW SRVLWLRQV DQG $UURZV UHSUHVHQW SRVLWLRQV XQLTXHO\ GLYHUVLILHG IRU HDFK DKHOL[ DOOHOH

PAGE 128

9$5,$%,/,7< $0,12 $&,'

PAGE 129

7DEOH .DEDW DQG :X YDULDELOLW\ GDWD IRU XQGHOHWHG DQG DPLQR DFLG SRVLWLRQ DQG GHOHWHG DOOHOHV .DEDW DQG :X 9DOXH $PLQR $FLG 8QGHOHWHG 'HOHWHG 3RVLWLRQ $OOHOHV ` $OOHOHV ` r r r r r r r r r GHQRWHV XQLTXHO\ GLYHUVLILHG SRVLWLRQ IRU WKDW DKHOL[ DOOHOH

PAGE 130

ELQGLQJ SURSHUWLHV RI WKH DQWLJHQ ELQGLQJ VLWH LQ D VLQJOH VWHS 7KH FRGRQ GHOHWLRQV DW SRVLWLRQV DQG SUREDEO\ GR QRW HIIHFW WKH DKHOLFDO VWUXFWXUH RI WKH DQWLJHQ ELQGLQJ VLWH 7KLV LV SUHGLFWHG EHFDXVH WKHVH GHOHWLRQV RFFXU n WKH GLVXOILGH ERQG EHWZHHQ DPLQR DFLGV DQG ZKLFK SUHVXPDEO\ DQFKRUV WKH DKHOL[ WR WKH ASOHDWHG VKHHW ,Q DGGLWLRQ b f RI WKH DOOHOHV GHOHWHG DW SRVLWLRQ KDYH D SUROLQH UHVLGXH MXVW n ZKLFK ZRXOG SUREDEO\ DFW DV DQ DKHOL[ EUHDNHU LQ WKLV SRUWLRQ RI WKH PROHFXOH +RZHYHU WKH KLJK IUHTXHQF\ RI DOOHOHV ZLWK GHOHWLRQV LQ WKH FDUER[\O WHUPLQXV RI WKH $EO GRPDLQ bf DQG WKH SUHVHQFH RI WKH GHOHWLRQ DW SRVLWLRQ LQ PXOWLSOH VSHFLHV 0 P GRPHVWLFXV DQG 0 VSHFLOHDXVf PD\ VXJJHVW WKDW GHOHWLRQV LQ WKLV SRUWLRQ RI WKH PROHFXOH GR KDYH VRPH IXQFWLRQDO LPSDFW 3HUKDSV WKH\ VXEWO\ DOWHU WKH SODQH RI WKH DQWLJHQ ELQGLQJ VLWH $OWHUQDWLYHO\ WKHVH n GHOHWLRQV PD\ KDYH QR IXQFWLRQDO YDOXH WR WKH PROHFXOH DQG PD\ VLPSO\ EH KLWFKKLNLQJ PXWDWLRQV ,W LV LQWHUHVWLQJ WR QRWH WKDW WKH DKHOL[ DQG FDUER[\O WHUPLQXV VHJPHQWV RI WKH $EO GRPDLQ FRPH LQ WKUHH EDVLF IRUPV 7KHVH IRUPV DUH GHSHQGHQW XSRQ WKH SRVLWLRQ DQGRU SUHVHQFH RI D SUROLQH UHVLGXH 7KH SUROLQH LV IRXQG HLWKHU DW SRVLWLRQ RU DQG PRVW OLNHO\ DFWV WR GHVWUR\ WKH DKHOLFDO VWUXFWXUH n DV WKH $EO GRPDLQ H[WHQGV WRZDUG WKH $E GRPDLQ 2Q WKH RWKHU KDQG b f RI WKH

PAGE 131

DOOHOHV GR QRW KDYH DQ\ SUROLQH UHVLGXH LQ WKLV VHFWLRQ RI WKH PROHFXOH WKHUHE\ DOORZLQJ DKHOLFDO VHFRQGDU\ VWUXFWXUH WR FRQWLQXH XQWLO WKH SRO\SHSWLGH FRQQHFWV ZLWK WKH $E GRPDLQ $GGLWLRQDOO\ WKH DKHOL[ VHJPHQW LV H[WUHPHO\ SRO\PRUSKLF FRQWDLQLQJ RI WKH PRVW GLYHUVLILHG DPLQR DFLG SRVLWLRQV DQG f LQ $E H[RQ )LJXUH 7DEOH f )XUWKHUPRUH WKLV VHJPHQW KDV XQGHUJRQH VWURQJ GLYHUVLI\LQJ VHOHFWLRQ GQGV f)LJXUH 7DEOH f 7KHVH UHVXOWV VXJJHVW WKDW WKLV SRUWLRQ RI WKH PROHFXOH FDQ VWURQJO\ LQIOXHQFH DQWLJHQ ELQGLQJ FDSDFLW\ DQG LPPXQH UHVSRQVLYHQHVV 1RQFRQVHUYDWLYH $PLQR $FLG 6XEVWLWXWLRQV LQ WKH $QWLJHQ %LQGLQJ 6LWH 3URWHLQ SDUVLPRQ\ DQDO\VLV )HOVHQVWHLQ f ZDV XVHG WR REWDLQ DOOHOLF OLQHDJHV IRU HDFK RI WKH GHILQHG DQWLJHQ ELQGLQJ VLWH VHJPHQWV %HWZHHQ DQG OLQHDJHV ZHUH GLVFHUQHG DW HDFK DQWLJHQ ELQGLQJ VLWH VHJPHQW 7KH PRVW FRPPRQ PRWLI ZDV XVHG DV WKH SURWRW\SLFDO OLQHDJH PRWLI DQG ZDV DOZD\V IRXQG LQ PXOWLSOH DOOHOHV VKRZQ LQ 7DEOHV f &RPSDULVRQV RI WKH SURWRW\SLF PRWLIV IURP HDFK OLQHDJH UHYHDOHG WKDW RQ DYHUDJH WKHVH DOOHOLF IRUPV GLIIHUHG E\ b s b RI WKHLU DPLQR DFLGV 6XUSULVLQJO\ b s b RI WKHVH VXEVWLWXWLRQV UHVXOW LQ QRQFRQVHUYDWLYH DPLQR DFLG FKDQJHV LH FKDQJHV EHWZHHQ DFLGLF EDVLF XQFKDUJHG SRODU RU QRQSRODU UHVLGXHVf

PAGE 132

7DEOH $OOHOLF OLQHDJHV RI WKH SOHDWHG VKHHW SRUWLRQ RI WKH DQWLJHQ ELQGLQJ VLWH FRQWDLQLQJ DPLQR DFLGV $PLQR $FLG 0RWLI 1XPEHU RI $OOHOHV <4).*( f 43) $f§43) +f§43) 9f§43) f $/ $ f ) )/ )/f§$ f 9 + f f§/ f§/0f§ f $ 6$ f§/6$ f 0f§ 0$ )4' 9/6) 9f§)4

PAGE 133

7DEOH $OOHOLF OLQHDJHV RI WKH ASOHDWHG VKHHW SRUWLRQ RI WKH DQWLJHQ ELQGLQJ VLWH FRQWDLQLQJ DPLQR DFLGV $PLQR $FLG 0RWLI 1XPEHU RI $OOHOHV /975<, f & f 61 6 &1 61) f f§, I f 6' $' f < + f f§61 f§$1 f§6 6 1 < 1 */ 9

PAGE 134

7DEOH $OOHOLF OLQHDJHV RI WKH ASOHDWHG VKHHW SRUWLRQ RI WKH DQWLJHQ ELQGLQJ VLWH FRQWDLQLQJ DPLQR DFLGV $PLQR $FLG 0RWLI 1XPEHU RI $OOHOHV <95) f : :f§< f /f§ f )0f§ ) )/f§ f / f /< f <

PAGE 135

7DEOH $OOHOLF OLQHDJHV RI WKH DKHOL[ SRUWLRQ RI WKH DQWLJHQ ELQGLQJ VLWH FRQWDLQLQJ DPLQR DFLGV $PLQR $FLG 0RWLI 1XPEHU RI $OOHOHV 3'$(<:1.4r f 63 5 63 7f§1f§63 f§* V3 f 6 < f f f§3f§< f ) 4 ) 6 ) 7 ) f f§9 +6 ( &

PAGE 136

7DEOH $OOHOLF OLQHDJHV RI WKH DKHOL[ SRUWLRQ RI WKH DQWLJHQ ELQGLQJ VLWH FRQWDLQLQJ DPLQR DFLGV $PLQR $FLG 0RWLI 1XPEHU RI $OOHOHV < r /(575$( /'79& f (O 9 (, Yf§$ (, 910f§ (, (, 5 (, .f§: f S r f 4 4.f§$9 4. 9 4 49 T $ f \ $ ( $ $ f

PAGE 137

7DEOH $OOHOLF OLQHDJHV RI WKH DKHOL[ SRUWLRQ RI WKH DQWLJHQ ELQGLQJ VLWH FRQWDLQLQJ DPLQR DFLGV $PLQR $FLG 0RWLI 1XPEHU RI $OOHOHV 5+1<(*7(73 f 3f§+ 3f§6 < 3f§+ .3f§+ 3*+ 6f§+ f Yf§+ 9 f 9f§6 9f§5 f f (f§9 < (f§9 f / 4/ 9/ 5 ,/,rr 36<

PAGE 138

7KHVH QRQFRQVHUYDWLYH DPLQR DFLG FKDQJHV ZRXOG LQGLYLGXDOO\ EH H[SHFWHG WR FDXVH VXEVLWH DOWHUDWLRQV LQ FKHPLFDO DQG FKDUJHGLVWULEXWLRQ FKDUDFWHULVWLFV 7KLV VXJJHVWV WKDW DQWLJHQ ELQGLQJ VLWHV FRPSRVHG RI GLIIHUHQW DOOHOLF VHJPHQWV ZRXOG SRVVHVV KLJKO\ GLYHUJHQW FKHPLFDO SURSHUWLHV 7KLV LV LOOXVWUDWHG LQ )LJXUH $ DQG % 7KHVH PRGHOV GLVWLQJXLVK WKH FKHPLFDO FODVVLILFDWLRQ RI WKH DPLQR DFLGV DW HDFK RI WKH PRVW YDULDEOH UHVLGXHV LQ WKH DQWLJHQ ELQGLQJ VLWH ZLWK GLIIHUHQW ILOO SDWWHUQV 0XGR$E DQG 0XGR$E DUH WZR 0 P GRPHVWLFXV DOOHOHV WKDW VKDUH RQO\ RQH DOOHOLF VHJPHQW RI WKH DQWLJHQ ELQGLQJ VLWH 7KHVH $E DOOHOHV GLIIHU E\ DPLQR DFLG VXEVWLWXWLRQV DQG RI WKHVH VXEVWLWXWLRQV DUH QRQFRQVHUYDWLYH LQGLFDWLQJ WKDW WKH\ HQFRGH DQWLJHQ ELQGLQJ VLWHV ZLWK IXQGDPHQWDOO\ GLIIHUHQW VWUXFWXUDO DQG SUHVXPDEO\ ELQGLQJf SURSHUWLHV 7KH 5ROH RI ,QWUD([RQLF 5HFRPELQDWLRQ LQ 'LYHUVLI\LQJ WKH $QWLJHQ %LQGLQJ 6LWH ,QWHUDOOHOLF VKXIIOLQJ RI GLVFUHWH DQWLJHQ ELQGLQJ VLWH VHJPHQWV YLD LQWUDH[RQLF UHFRPELQDWLRQ ZRXOG EH SUHGLFWHG WR SURGXFH UHFRPELQDQW DOOHOHV ZLWK DQWLJHQ ELQGLQJ VLWH SURSHUWLHV PDUNHGO\ GLIIHUHQW IURP HLWKHU SDUHQWDO DOOHOH RI DOOHOHV LQ WKH GDWD VHW GLIIHU E\ DW OHDVW RQH DQWLJHQ ELQGLQJ VLWH DOOHOLF VHJPHQW LQGLFDWLQJ WKDW LQWUDH[RQLF UHFRPELQDWLRQDO HYHQWV KDYH EHHQ LQYROYHG LQ WKH GLYHUJHQFH RI DOPRVW DOO WKH DOOHOHV

PAGE 139

$Q LOOXVWUDWLRQ RI WKH HIIHFW RI WKLV UHFRPELQDWLRQ RQ WKH DQWLJHQ ELQGLQJ VLWH VWUXFWXUHV LV VKRZQ LQ )LJXUH & 0XGR$EUHSUHVHQWV DQ $E OLQHDJH WKDW FRXOG KDYH EHHQ SURGXFHG E\ D VLQJOH LQWUDH[RQLF UHFRPELQDWLRQ EHWZHHQ SDUHQWDO DOOHOHV VLPLODU WR 0XGR$E DQG 0XGR$E UHFRPELQDWLRQDO EUHDNSRLQW EHWZHHQ %6 DQG DKHOL[ f $V D UHVXOW RI WKLV VLQJOH K\SRWKHWLFDO UHFRPELQDWLRQDO HYHQW WKH DQWLJHQ ELQGLQJ VLWH RI 0XGR$EGLIIHUV IURP WKRVH RI HLWKHU SDUHQW E\ DPLQR DFLG VXEVWLWXWLRQV RU QRQn FRQVHUYDWLYHf 7KXV LQWUDH[RQLF UHFRPELQDWLRQ EHWZHHQ DOOHOHV FRPSRVHG RI KLJKO\ GLYHUJHQW DQWLJHQ ELQGLQJ VLWH VHJPHQWV KDV WKH DELOLW\ WR UDSLGO\ FUHDWH DOOHOHV ZLWK XQLTXH DQWLJHQ ELQGLQJ VLWH FKDUDFWHULVWLFV 7KH H[WHQW RI GLYHUVLW\ EHWZHHQ DOOHOLF VHJPHQWV RI WKH DQWLJHQ ELQGLQJ VLWH FRXSOHG ZLWK WKH DPRXQW RI LQWUDH[RQLF UHFRPELQDWLRQ GHWHFWHG DPRQJ WKH DOOHOHV LQ WKH GDWD VHW VWURQJO\ VXJJHVWV WKDW WKLV PHFKDQLVP KDV FRQWULEXWHG JUHDWO\ WR WKH IRUPDWLRQ RI DOOHOHV ZLWK KLJKO\ GLYHUJHQW IXQFWLRQDO SURSHUWLHV 7KH GDWD GLVFXVVHG LQ WKLV VHFWLRQ VXSSRUW WKH YLHZ WKDW WKHUH KDV EHHQ SRVLWLYH VHOHFWLRQ IRU PXWDWLRQV WKDW FUHDWH DQWLJHQ ELQGLQJ VLWH GLYHUVLW\ 7KHVH PXWDWLRQV PD\ VLPSO\ EH SRLQW PXWDWLRQV LQ WKH QXFOHRWLGH VHTXHQFH WKDW PD\ OHDG WR D QRQV\QRQ\PRXV VXEVWLWXWLRQ DQG TXLWH SRVVLEO\ FKDQJH WKH ELRFKHPLFDO FODVV RI DPLQR DFLG $GGLWLRQDOO\ PXWDWLRQV VXFK DV FRGRQ GHOHWLRQV DQGRU LQWUDH[RQLF UHFRPELQDWLRQ HYHQWV FDQ UDSLGO\ FKDQJH WKH VWUXFWXUH DQG

PAGE 140

)LJXUH 7KH ELQGLQJ VLWH RI WKUHH 0XV PXVFXOXV GRPHVWLFXV DOOHOHV ZLWK GLIIHUHQW ILOO SDWWHUQV UHSUHVHQWLQJ WKH ELRFKHPLFDO FODVV RI DPLQR DFLG &URVVKDWFKHG GHSLFWV XQFKDUJHG SRODU UHVLGXHV KDWFKHG EDVLF UHVLGXHV GHQVHO\ GRWWHG QRQSRODU UHVLGXHV VSDUVHO\ GRWWHG DFLGLF UHVLGXHV DQG VROLG ILOO UHSUHVHQWV GHOHWHG DPLQR DFLGV $f 0XGR$E %f 0XGR$E &f 0XGR$E

PAGE 141

$ /

PAGE 143

ELQGLQJ SURSHUWLHV RI WKH DQWLJHQ ELQGLQJ VLWH $OO RI WKHVH PHFKDQLVPV KDYH LQWHUDFWHG RYHU HYROXWLRQDU\ WLPH WR FUHDWH D GLYHUVH DUUD\ RI DQWLJHQ ELQGLQJ VLWHV LQ QDWXUDO PRXVH SRSXODWLRQV 6HURORJLFDO &KDUDFWHUL]DWLRQ RI WKH 0KF &ODVV ,, $ 0ROHFXOH ,Q DQ HIIRUW WR H[DPLQH WKH VWUXFWXUDO SRO\PRUSKLVPV RI WKH 0KF FODVV ,, $ PROHFXOH DQG DWWHPSW WR PDS VHURORJLFDO HSLWRSHV RQ WKH $E FKDLQ D VHURORJLFDO DQDO\VLV HPSOR\LQJ PRQRFORQDO DQWLERGLHV ZDV XQGHUWDNHQ $ SDQHO RI WZHOYH PRQRFORQDO DQWLERGLHV ZHUH XVHG LQ WKH VWXG\ )LYH PRQRFORQDO DQWLERGLHV DUH UHSRUWHGO\ VSHFLILF IRU WKH $E FKDLQ ILYH PRQRFORQDO DQWLERGLHV DUH VSHFLILF IRU WKH $D FKDLQ DQG WZR PRQRFORQDO DQWLERGLHV HLWKHU UHDFW ZLWK DQ HSLWRSH GHWHUPLQHG E\ WKH LQWHUDFWLRQ RI ERWK FKDLQV RU KDYH QRW EHHQ GHILQLWLYHO\ PDSSHG WR UHDFW ZLWK HLWKHU FKDLQ 2L HW DO 3LHUUHV HW DO +DSSLHU HW DO %UDXQVWHLQ DQG *HUPDLQ f 7DEOH SUHVHQWV WKH PRQRFORQDO DQWLERGLHV XVHG LQ WKLV VWXG\ DQG VKRZV WKHLU UHDFWLYLW\ SDWWHUQV ZLWK ODERUDWRU\ LQEUHG VWUDLQV RI PLFH 0LFH $OO WKH PLFH XVHG LQ WKLV VWXG\ ZHUH IURP PRXVH FRORQ\ LQ WKH 7XPRU %LRORJ\ 8QLW RI WKH 'HSDUWPHQW RI 3DWKRORJ\ DQG /DERUDWRU\ 0HGLFLQH 8QLYHUVLW\ RI )ORULGD RU IURP RXU ZLOG

PAGE 144

7DEOH /LVW RI 0RQRFORQDO $QWLERGLHV 8VHG WR $QDO\]H 6WUXFWXUDO 3RO\PRUSKLVPV RI WKH $ 0ROHFXOH 0212&/21$/ $17,%2'< ,1%5(' 675$,1 5($&7,9,7< % E N X U M Y + AG E N X I 0.' M\MG T X U S V I Y QRG 0GETSY 08P $JN X U M V W QRG ) 0NnXI -3 $IOE N T X U S M A I Y $Drf ) $DN $-E N T X U M S L & Y $DG M W Y QRG

PAGE 145

PRXVH FRORQ\ ORFDWHG DW WKH $QLPDO &DUH )DFLOLW\ 8QLYHUVLW\ RI )ORULGD 7KH ZLOGGHULYHG PRXVH VWUDLQV DUH KRPR]\JRXV DW WKH + FRPSOH[ DQG DUH PDLQWDLQHG E\ VLEOLQJ PDWLQJV 7KH ZLOGGHULYHG PLFH DUH IURP VXEVSHFLHV RI 0XV PXVFXOXV 0 P GRPHVWLFXV DQG 0 P PXVFXOXV DQG DUH RULJLQDOO\ IURP GLYHUVH JHRJUDSKLF RULJLQV 7KH PLFH DQDO\]HG LQ WKLV VWXG\ DUH OLVWHG LQ 7DEOH 6HURORJLFDO &KDUDFWHUL]DWLRQ RI WKH $ 0ROHFXOH 7KH WZR $ PROHFXOH VSHFLILF PRQRFORQDO DQWLERGLHV % DQG + FDQ GLVWLQJXLVK DOOHOHV RI WKH $ PROHFXOH 7DEOH f 7KH $D FKDLQ VSHFLILF PRQRFORQDO DQWLERGLHV -3 ) DQG FDQ GLVWLQJXLVK GLIIHUHQW $D DOOHOHV 7DEOH f ,Q DGGLWLRQ WKH PRQRFORQDO DQWLERGLHV -3 DQG DSSHDU WR UHFRJQL]H WKH VDPH RU D VLPLODU GHWHUPLQDQW RQ WKH $D FKDLQ RI WKH VWUDLQV H[DPLQHG EHFDXVH WKH\ KDYH LGHQWLFDO UHDFWLYLW\ SDWWHUQV 7KH $E FKDLQ VSHFLILF PRQRFORQDO DQWLERGLHV 0.' DQG ) FDQ GLVWLQJXLVK GLIIHUHQW $E DOOHOHV 7DEOH f 0DSSLQJ RI $E 6SHFLILF 6HURORJLFDO (SLWRSHV 7KUHH $E VSHFLILF PRQRFORQDO DQWLERGLHV DSSDUHQWO\ PDS WR WKH VDPH RU VLPLODU HSLWRSH DQG KDYH WKH

PAGE 146

7DEOH /LVW RI 6WUDLQV 8VHG LQ WKH 6HURORJLFDO $QDO\VLV RI WKH $ 0ROHFXOH 675$,1 68%63(&,(6 *(2*5$3+,&$/ 25,*,16 &% 0 P GRP ODERUDWRU\ LQEUHG %$/%& 0 P GRP ODERUDWRU\ LQEUHG %,2 0 0 P GRP ODERUDWRU\ LQEUHG %:% 0 P GRP ODERUDWRU\ LQEUHG %%5 0 P GRP ODERUDWRU\ LQEUHG &+1% 0 P GRP ODERUDWRU\ LQEUHG %5 0 P GRP ODERUDWRU\ LQEUHG %5,,, 0 P GRP ODERUDWRU\ LQEUHG $6: 0 P GRP ODERUDWRU\ LQEUHG %,23/ 0 P GRP ODERUDWRU\ LQEUHG %60 0 P GRP ODERUDWRU\ LQEUHG 12' 0 P GRP ODERUDWRU\ LQEUHG 121 0 P GRP ODERUDWRU\ LQEUHG %&$$ 0 P GRP 0LFKLJDQ %6$$ 0 P GRP 0LFKLJDQ %8$ 0 P GRP 0LFKLJDQ '5 0 P GRP )ORULGD -(5 0 P GRP ,VUDHO -(5 0 P GRP ,VUDHO $=528 0 P GRP 0RURFFR $=528 0 P GRP 0RURFFR (5)28' 0 P GRP 0RURFFR (5)28' 0 P GRP 0RURFFR 0(7, 0 P GRP
PAGE 147

7DEOH 5HDFWLYLW\ RI $ 0ROHFXOH 6SHFLILF 0RQRFORQDO $QWLERGLHV 675$,1 0212&/21$/ % $17,%2'< + 68% 63(&,(6 + *(2*5$3+,&$/ 25,*,1 %$/%& GRP G LQEUHG % GRP E LQEUHG %%5 GRP N LQEUHG %,23/ GRP X LQEUHG %:% GRP M LQEUHG 121 GRP QRQ LQEUHG -(5 GRP 0XGR ,VUDHO -(5 GRP 0XGR ,VUDHO $=528 GRP 0XGR 0RURFFR $=528 GRP 0XG R 0RURFFR 0(7, f" GRP 0XGR
PAGE 148

7DEOH 5HDFWLYLW\ RI $D &KDLQ 6SHFLILF 0RQRFORQDO $QWLERGLHV 675$,1 0212&/21$/ $17,%2'< -3 ) . &% f§ %5 f§ %,23/ &+1% %60 121 0(7 $=528 $=528 '5 (5)28' %&$$ %6$$ -(5 %51 9,%285* f§ f§ f§ %,2 0 f§ f§ %:% -(5 (5)28' %8$ f§ f§ %5,,, f§ f§ $6: 0(7, f§ f§ %$/%& 12' f§ f§ f§ f§ %%5 f§ )$<,80

PAGE 149

7DEOH 5HDFWLYLW\ RI $e &KDLQ 6SHFLILF 0RQRFORQDO $QWLERGLHV 675$,1 0212&/21$/ $17,%2'< 0.' 2) %5,,, (5)28' 12' %8$ 0(7, f§ f§ %,23/ f§ f§ %,2 0 121 M $=528 f§ f§ $6: f§ f§ f§ f§ %:% -(5 f§ f§ f§ f§ %,2%5 f§ f§ f§ )$<,80 f§ f§ f§ %$/%& f§ %5 %60 &+1% 0(7 '5 %6$$ 9,%285* %51 f§ f§ %&$$ f§ f§ f§ &% $=528 f§ f§ -(5 (5)28'

PAGE 150

VDPH UHDFWLYLW\ SDWWHUQV $QG WKHVH WZR PRQRFORQDO DQWLERGLHV ZLWK WKH H[FOXVLRQ RI WKH VWUDLQ (5)8' KDYH DQ DQWLWKHWLFDO UHODWLRQVKLS ZLWK WKH PRQRFORQDO DQWLERG\ 7KH JURXSLQJ RI $E DOOHOHV GHSHQGHQW XSRQ WKHVH PRQRFORQDO DQWLERG\ UHDFWLYLWLHV LOOXVWUDWHV WKDW WKHVH DQWLERGLHV UHFRJQL]H WKH GLIIHUHQW DOOHOHV RI WKH DKHOL[ )LJXUH f 7KH fDOOHOHV DOO KDYH WKH DPLQR DFLG GHOHWLRQV DW SRVLWLRQV DQG ,Q GLUHFW FRQWUDVW DOOHOHV WKDW DUH DQG DUH DOO XQGHOHWHG DQG KDYH D SUROLQH DW SRVLWLRQ $OWKRXJK LW LV LPSRVVLEOH WR GHILQLWLYHO\ PDS ZKHUH RQ WKH DKHOL[ WKHVH PRQRFORQDO DQWLERGLHV ELQG WKLV GDWD LOOXVWUDWHV WKDW WKHVH PRQRFORQDO DQWLERGLHV FDQ GLVWLQJXLVK EHWZHHQ WZR YHU\ GLIIHUHQW IRUPV RI WKH DKHOL[ 7KLV GDWD LV FRQVLVWHQW ZLWK WKDW RI )LJXHURD HW DO f LQ FRPSDULQJ WKH DOOHOHV LQ FRPPRQ ZLWK WKH WZR DQDO\VHV $OOHOHV WKDW DUH DQG a DUH +$P DQG +$PB &RQYHUVHO\ WKH UHFLSURFDO LV REVHUYHG DOOHOHV WKDW DUH a DQG DUH +$P DQG +$Pa 7KH HSLWRSHV IRU WKH RWKHU WZR $E FKDLQ VSHFLILF PRQRFORQDO DQWLERGLHV GR QRW FRUUHODWH ZLWK DQ\ VWUXFWXUDO IHDWXUHV HQFRGHG ZLWKLQ $E H[RQ 7KXV WKH HSLWRSHV IRU 0.' DQG 2) PD\ PDS WR WKH $E GRPDLQ EXW WKLV LV KLJKO\ XQOLNHO\ GXH WR WKH OLPLWHG SKHQRW\SLF YDULDELOLW\ HQFRGHG E\ WKLV GRPDLQ $OWHUQDWLYHO\ LW LV SRVVLEOH WKH HSLWRSHV

PAGE 151

)LJXUH 7KH DPLQR DFLG VHTXHQFHV RI $E H[RQ RI WKH DOOHOHV VHURORJLFDOO\ DQDO\]HG 7KH VHTXHQFHV DUH JURXSHG DFFRUGLQJ WR WKHLU UHDFWLYLW\ SDWWHUQV ZLWK WKH PRQRFORQDO DQWLERGLHV DQG

PAGE 152

FRQV +)9<4).*( &<)71*745, 5/975<,<15 ((<95)'6'9 *(<5$97(/* 53'$(<:1.4 r
PAGE 153

UHFRJQL]HG E\ WKHVH WZR PRQRFORQDO DQWLERGLHV DUH GHSHQGHQW XSRQ $D FKDLQ LQWHUDFWLRQ DV RSSRVHG WR VWULFWO\ $E HQFRGHG SRO\PRUSKLVPV )LQDOO\ WKHLU HSLWRSHV PD\ KDYH EHHQ LQFRUUHFWO\ PDSSHG WR WKH $E FKDLQ

PAGE 154

&+$37(5 9 ',6&866,21 7KH JHQHUDWLRQ RI 0KF SRO\PRUSKLVP LV D WZR VWHS SURFHVV LQYROYLQJ WKH SURGXFWLRQ RI YDULDQW DOOHOHV E\ PXWDJHQLF HYHQWV IROORZHG E\ VXEVHTXHQW VHOHFWLRQ DQG PDLQWHQDQFH 7KH DOOHOHV H[DPLQHG LQ WKLV VWXG\ KDYH VXUYLYHG WKLV SURFHVV $GGLWLRQDOO\ E\ VWXG\LQJ DOOHOHV GHULYHG IURP PXOWLSOH URGHQW VSHFLHV D FOHDUHU XQGHUVWDQGLQJ RI WKH HYROXWLRQDU\ SURFHVVHV LQYROYHG LQ 0KF JHQH GLYHUVLILFDWLRQ DQG VHOHFWLRQ FDQ EH HOXFLGDWHG 8QIRUWXQDWHO\ ZKDW FDQQRW EH DVFHUWDLQHG E\ DQDO\]LQJ DOOHOHV WKDW KDYH DOUHDG\ XQGHUJRQH WKH SURFHVVHV RI VHOHFWLRQ DQG PDLQWHQDQFH LV WKH VSHFWUXP RI YDULDQWV XSRQ ZKLFK VHOHFWLRQ RSHUDWHV 1HYHUWKHOHVV WKLV FDQ EH LQIHUUHG E\ VWXG\LQJ WKH SDWWHUQV RI GLYHUVLILFDWLRQ 7KH *HQHWLF 0HFKDQLVPV RI 0KF *HQH 'LYHUVLILFDWLRQ 7KH UHVXOWV RI WKLV GLVVHUWDWLRQ LOOXVWUDWH WKDW YDULDWLRQ LV LQWURGXFHG LQWR VLQJOH DOOHOHV SUHGRPLQDQWO\ E\ SRLQW PXWDWLRQV DQG WR D OHVVHU H[WHQW FRGRQ GHOHWLRQV 1RYHO FRPELQDWLRQV RI VSHFLILF DQWLJHQ ELQGLQJ VLWH VHJPHQWV DUH FRQVWDQWO\ EHLQJ IRUPHG DOEHLW DW D YHU\ VORZ UDWH E\ UHFRPELQDWLRQDO PHFKDQLVPV 7KXV WKH H[WHQVLYH GLYHUVLW\

PAGE 155

RI 0KF FODVV ,, $E LV JHQHUDWHG E\ PXOWLVWHS PXWDWLRQDO SURFHVVHV LQFRUSRUDWLQJ ERWK WKH UHWHQWLRQ RI DQFHVWUDO SRO\PRUSKLVPV DQG UHFRPELQDWLRQDO HYHQWV 7KH H[WHQW RI UHFRPELQDWLRQ LQ WKH DOOHOHV H[DPLQHG LQ WKLV VWXG\ FRQFOXVLYHO\ LOOXVWUDWH LWV FHQWUDO UROH LQ WKH GLYHUVLILFDWLRQ SURFHVV RYHU HYROXWLRQDU\ WLPH VSDQV 7KH H[DFW UHFRPELQDWLRQDO PHFKDQLVP HPSOR\HG ZDV QRW DGGUHVVHG E\ WKHVH H[SHULPHQWV DOWKRXJK WKH DQDO\VLV GRHV LQGLFDWH WKDW VLWH VSHFLILF K\SHUUHFRPELQDWLRQDO PHFKDQLVPV DUH QRW LQYROYHG LQ WKLV SURFHVV (LWKHU KRPRORJRXV UHFRPELQDWLRQ RU VHJPHQWDO H[FKDQJH FRXOG EH HTXDOO\ UHVSRQVLEOH IRU WKH SDWWHUQV RI GLYHUVLW\ REVHUYHG $QDO\VLV RI '1$ VHTXHQFHV IODQNLQJ $E H[RQ VXFK DV $E H[RQ DQG '1$ VHJPHQWV LQ $E LQWURQV DQG LQGLFDWH WKDW LQ FRQWUDVW WR $E H[RQ WKH IODQNLQJ VHTXHQFH SRO\PRUSKLVPV FRUUHODWH ZLWK HDFK RWKHU DQG WKH UHWURSRVRQ SRO\PRUSKLVP LQ LQWURQ RI $E -; 6KH XQSXEOLVKHG REVHUYDWLRQVf 7KLV VWURQJO\ VXJJHVWV WKDW VHJPHQWDO H[FKDQJH HYHQWV VSHFLILF IRU $E H[RQ DUH UHVSRQVLEOH IRU WKH VKXIIOLQJ RI DOOHOLF DQWLJHQ ELQGLQJ VLWH VHJPHQWV &RPELQDWRULDO $VVRFLDWLRQ RI WKH $D DQG $E &KDLQV 7KH H[WHQVLYH DPLQR DFLG GLYHUVLW\ RI $E H[RQ FRPELQHG ZLWK WKH H[WHQW RI UHFRPELQDWLRQ REVHUYHG DPRQJ WKH DOOHOHV LQ WKH GDWD VHW PDNH WKH K\SRWKHVLV RI FRHYROXWLRQ

PAGE 156

RI WKH $D DQG $E FKDLQV KLJKO\ XQOLNHO\ 7KLV LV HYHQ PRUH DSSDUHQW ZKHQ WKH GLYHUVLW\ RI WKH SURWHLQ VHJPHQWV WKRXJKW WR EH UHVSRQVLEOH IRU FKDLQ DVVRFLDWLRQ DUH FRQVLGHUHG )RU LQVWDQFH WKHUH DUH GLIIHUHQW IRUPV RI $E ASOHDWHG VKHHW DPRQJ WKH DOOHOHV LQ WKH GDWD VHW $Q DWWHPSW WR FRUUHODWH WKH DOOHOLF $E %6 IRUPV ZLWK %6 IRUPV RI WKH $D SXEOLVKHG VHTXHQFHV -RQHV HW D f UHYHDOV QR DVVRFLDWLRQV )XUWKHUPRUH WKHUH LV YHU\ VWURQJ GLYHUVLI\LQJ VHOHFWLRQ DFWLQJ RQ WKH $E SOHDWHG VKHHW DQWLJHQ ELQGLQJ VLWH VHJPHQW GQGV f %\ H[DPLQDWLRQ RI WKH K\SRWKHWLFDO GLPHQVLRQDO PRGHO RI WKH 0KF FODVV ,, DQWLJHQ ELQGLQJ VLWH %URZQ HW DO f LW LV WHPSWLQJ WR VSHFXODWH D FODVV ,, JHQH VSHFLILF LQWHUDFWLRQ EHWZHHQ WKH n VHJPHQW RI WKH $E RKHOL[ DQG WKH n VHJPHQW RI WKH $D DKHOL[ %RWK UHJLRQV KDYH DQ XQGHILQHG WHUWLDU\ VWUXFWXUH EDVHG RQ WKH FODVV PRGHO +RZHYHU WKHUH LV DOVR QR FRUUHODWLRQ WR EH PDGH EHWZHHQ $E DQG $D SURWHLQ VHTXHQFH SRO\PRUSKLVPV LQ WKLV UHJLRQ $GGLWLRQDOO\ WKHUH LV DOVR VWURQJ GLYHUVLI\LQJ VHOHFWLRQ DFWLQJ RQ WKLV $E VHJPHQW GQG f 7KHVH REVHUYDWLRQV VXJJHVW WKDW 0KF FODVV ,, $ PROHFXOH VXEXQLW DVVRFLDWLRQ LV D PRUH FRPSOH[ SURFHVV WKDQ UHFHQW H[SHULPHQWDO HYLGHQFH RXWOLQHG DQG SHUKDSV LQIHUV D PRUH FHQWUDO UROH IRU WKH LQYDULDQW FKDLQ ,Lf LQ VXEXQLW SDLULQJ )RU LQVWDQFH LQ SDLUV RI FKDLQV WKDW KDYH D KLJK HIILFLHQF\ RI DVVRFLDWLRQ WKH UROH RI WKH LQYDULDQW FKDLQ WR

PAGE 157

VWDELOL]H WKH UHVXOWDQW PROHFXOH PD\ EH PLQLPDO +RZHYHU LQ FDVHV RI ORZHU FKDLQ DVVRFLDWLRQ HIILFLHQF\ SRVVLEO\ GXH WR QRQV\QRQ\PRXV SRLQW PXWDWLRQV RI FULWLFDO FKDLQ SDLULQJ UHVLGXHV RU LQWUDH[RQLF UHFRPELQDWLRQ WKH UROH RI WKH LQYDULDQW FKDLQ WR SDLU VXEXQLWV PD\ EHFRPH PRUH FULWLFDO WR VXEVHTXHQW FHOO VXUIDFH H[SUHVVLRQ 7KLV VFKHPH GRHV UDLVH WKH TXHVWLRQ RI WKH QXPEHU RI FODVV ,, $ PROHFXOHV WKDW PD\ EH H[SUHVVHG RQ WKH FHOO VXUIDFH RI KHWHUR]\JRWHV HLWKHU RU PROHFXOHVf 7KH DQVZHU PD\ OLH ZLWK HDFK VSHFLILF KHWHUR]\JRWH FRPELQDWLRQ DQG WKH HIILFLHQF\ RI HDFK LQGLYLGXDO FKDLQ WR DVVRFLDWH ZLWK RWKHUV DQG SURSHUO\ IRUP D IXQFWLRQDO PROHFXOH 7KLV PRGHO SUHVXPHV WKDW DOO $ PROHFXOH VXEXQLW DVVRFLDWLRQV ZRXOG RFFXU PRUH IUHHO\ WKDQ LQWHULVRW\SLF SDLULQJ RI FODVV ,, PROHFXOH VXEXQLWV 0KF ,QIOXHQFH RQ ,PPXQH 5HVSRQVLYHQHVV 7KH SK\VLRORJLFDO UROH RI 0KF PROHFXOHV LV WR ELQG IUDJPHQWV RI SURFHVVHG DQWLJHQ WKHUHE\ PDNLQJ WKHP UHFRJQL]DEOH WR 7 O\PSKRF\WHV 6KRZQ LQ )LJXUH f 0KF FODVV ,, PROHFXOHV FDQ LQIOXHQFH LPPXQH UHVSRQVLYHQHVV LQ LPSRUWDQW ZD\V )LUVW FODVV ,, PROHFXOHV PXVW EH DEOH WR ELQG IUDJPHQWV RI IRUHLJQ DQWLJHQ WR PDNH WKHP UHFRJQL]DEOH WR UHJXODWRU\ 7 O\PSKRF\WHV 7KLV LQWHUDFWLRQ ZLOO VXEVHTXHQWO\ LQLWLDWH D VSHFLILF LPPXQH UHVSRQVH WRZDUG WKH IRUHLJQ DQWLJHQ 0KF FODVV ,, PROHFXOHV DUH DOVR WKH IRFDO

PAGE 158

)LJXUH $ GLDJUDPPDWLF UHSUHVHQWDWLRQ RI WKH WULPROHFXODU 7 O\PSKRF\WH DFWLYDWLRQ FRPSOH[ FRPSULVHG RI WKH 7 FHOO UHFHSWRU PROHFXOH DQWLJHQ DQG WKH 0KF PROHFXOH DO D D DQG E UHSUHVHQW WKH WKUHH FODVV FKDLQ UHJLRQV DQG PLFURJOREXOLQ IRU FODVV PROHFXOHV RU WKH DO EO D DQG E GRPDLQV IRU FODVV ,, PROHFXOHVf $GDSWHG IURP .XPDU HW DO

PAGE 159

US UD 7&HOO 5HFHSWRU $QWLJHQ 0+& PROHFXODU FRPSOH[ $QWLJHQSUHVHQWLQJ FHOO $3&f

PAGE 160

SRLQW RI UHJXODWRU\ 7 O\PSKRF\WH DQWLJHQ UHFHSWRU UHSHUWRLUH VHOHFWLRQ HYHQWV LQ WKH WK\PXV 7KH 7 O\PSKRF\WH DQWLJHQ UHFHSWRU PXVW EH DEOH WR LQWHUDFW LQ VRPH PDQQHU ZLWK D FODVV ,, PROHFXOH LQ RUGHU WR UHFRJQL]H ERXQG DQWLJHQLF IUDJPHQWV +RZHYHU ERWK WKH 7 FHOO UHFHSWRU ELQGLQJ UHJLRQV DQG 0KF FODVV ,, PROHFXOHV DUH H[WUHPHO\ YDULDQW ZLWKLQ D VSHFLHV DQG DUH JHQHWLFDOO\ XQOLQNHG ORFL 7KLV QHFHVVLWDWHV WKH LQGLYLGXDO VHOHFWLRQ RI 7 O\PSKRF\WHV H[SUHVVLQJ DQWLJHQ UHFHSWRUV WKDW FDQ LQWHUDFW ZLWK RQHnV FODVV ,, PROHFXOHV SRVLWLYH VHOHFWLRQf EXW ZLOO QRW UHDFW f‘IW ZLWK RQHnV FODVV ,, PROHFXOH ERXQG WR IUDJPHQWV RI VHOIn DQWLJHQ QHJDWLYH VHOHFWLRQf5HYLHZHG E\ 6FKZDUW] f 7KXV WKH VHFRQG ZD\ 0KF FODVV ,, PROHFXOHV FDQ LQIOXHQFH LPPXQH UHVSRQVLYHQHVV LV WKURXJK SRVLWLYH VHOHFWLRQ RI WKH 7 O\PSKRF\WH DQWLJHQ UHFHSWRU UHSHUWRLUH $QG WKH WKLUG LPPXQH UHVSRQVH LQIOXHQFLQJ PHFKDQLVP LV WKH SUHVHQWDWLRQ RI VHOIDQWLJHQV OHDGLQJ WR QHJDWLYH VHOHFWLRQ RI WKH 7 FHOO UHSHUWRLUH 7KHUHIRUH UHVLGXHV WKDW GHWHUPLQH DQWLJHQ ELQGLQJ ERWK VHOI DQG QRQVHOIf DQG 7 O\PSKRF\WH FRQWDFW UHVLGXHV RQ WKH FODVV ,, PROHFXOH SUHVXPDEO\ RQ WKH D KHOL[f FDQ SRZHUIXOO\ VKDSH DQ LQGLYLGXDOV LPPXQH UHVSRQVH FKDUDFWHULVWLFV

PAGE 161

7KH 6HOHFWLYH 0DLQWHQDQFH RI $QWLJHQ %LQGLQJ 6LWH 'LYHUVLW\ $ YDULHW\ RI GDWD LQGLFDWHV WKDW 0KF SRO\PRUSKLVP LV PDLQWDLQHG E\ VRPH W\SH RI EDODQFLQJ VHOHFWLRQ DOWKRXJK WKH SUHFLVH PHFKDQLVPV LQYROYHG KDYH UHPDLQHG FRQWURYHUVLDO 2YHUGRPLQDQFH KHWHUR]\JRWH DGYDQWDJHf DQG IUHTXHQF\ GHSHQGHQW VHOHFWLRQ UDUH DOOHOH DGYDQWDJHf KDYH JHQHUDOO\ EHHQ WKRXJKW WR EH WKH PRVW OLNHO\ FDQGLGDWHV RI EDODQFLQJ VHOHFWLRQ %RGPHU +XJKHV DQG 1HL f 7KH PDLQWHQDQFH RI 0KF SRO\PRUSKLVPV E\ RYHUGRPLQDQFH LV EDVHG RQ WKH H[SHULPHQWDO REVHUYDWLRQ WKDW 0KFLQNHG LPPXQH UHVSRQVLYHQHVV LV D GRPLQDQW RU FRGRPLQDQW JHQHWLF WUDLW %HQDFHUUDI DQG *HUPDLQ f 0KF KHWHUR]\JRWHV DUH FDSDEOH RI UHVSRQGLQJ WR DQ\ RI WKH DQWLJHQV UHFRJQL]HG E\ HLWKHU SDUHQWDO KDSORW\SH EHFDXVH 0KF PROHFXOHV HQFRGHG E\ ERWK 0KF KDSORW\SHV DUH H[SUHVVHG RQ WKH VXUIDFH RI DQWLJHQ SUHVHQWLQJ FHOOV 7KHUHIRUH LPPXQH UHVSRQVH RYHUGRPLQDQFH SURSRVHV WKDW WKH DELOLW\ RI 0KF KHWHUR]\JRWHV WR ELQG DQG SUHVHQW D ZLGHU UDQJH RI IRUHLJQ DQWLJHQV ZLOO HQKDQFH WKHLU DELOLW\ WR UHVLVW LQIHFWLRXV GLVHDVHV WKHUHE\ LQFUHDVLQJ WKHLU UHODWLYH ILWQHVV LQ D SRSXODWLRQ 7KH DELOLW\ RI RYHUGRPLQDQW VHOHFWLRQ WR PDLQWDLQ H[WHQVLYH SRO\PRUSKLVPV KDV EHHQ HVWDEOLVKHG E\ ERWK WKHRUHWLFDO WUHDWPHQWV DQG H[SHULPHQWDO REVHUYDWLRQV 1HL f 7KH K\SRWKHVLV RI UDUH DOOHOH DGYDQWDJH LV EDVHG RQ WKH LGHD WKDW HQGHPLF SDWKRJHQV ZKLFK HYROYH PXFK PRUH UDSLGO\

PAGE 162

WKDQ WKHLU HQGHPLF KRVWV ZLOO WHQG WR DGDSW WKHLU DQWLJHQLFLW\ WR PLQLPL]H LPPXQH UHFRJQLWLRQ E\ WKH PRVW SUHYDOHQW 0KF JHQRW\SHV LQ D SRSXODWLRQ &RQVHTXHQWO\ QHZ RU UDUH 0KF DOOHOHV ZKRVH LPPXQH UHVSRQVH SURSHUWLHV GLIIHU IURP WKH FRPPRQ DOOHOHV ZLOO KDYH D SRVVLEOH VHOHFWLYH DGYDQWDJH GXH WR LQFUHDVHG UHVLVWDQFH WR WKH SUHYDOHQW SDWKRJHQV 7KLV W\SH RI VHOHFWLRQ SUHGLFWV F\FOLF IOXFWXDWLRQV LQ WKH IUHTXHQFLHV RI 0KF DOOHOHV DV SDWKRJHQV DUH GULYHQ WR HYROYH WKHLU DQWLJHQLFLW\ WRZDUG HYDGLQJ WKH LPPXQH UHVSRQVH FKDUDFWHULVWLFV RI SUHYDOHQW 0KF DOOHOHV 7KXV UDUH DOOHOH DGYDQWDJH OHDGV WR WKH PDLQWHQDQFH RI 0KF SRO\PRUSKLVPV E\ UHVFXLQJ UDUH DOOHOHV IURP H[WLQFWLRQ 7KHUH LV QR HPSLULFDO HYLGHQFH KRZHYHU WR LQGLFDWH WKDW WKLV PRGH RI VHOHFWLRQ RSHUDWHV WR PDLQWDLQ 0KF SRO\PRUSKLVP 'LYHUJHQW $OOHOH $GYDQWDJH 7KH H[WHQVLYH VWUXFWXUDO GLYHUVLW\ RI WKH DQWLJHQ ELQGLQJ VLWH RI WKH 0KF FODVV ,, $E JHQH LQGLFDWHV WKDW DQRWKHU VHOHFWLYH PHFKDQLVP PXVW EH RSHUDWLQJ WR VSHFLILFDOO\ PDLQWDLQ WKH YDVW DUUD\ RI KLJKO\ GLYHUJHQW DOOHOHV 7KLV VSHFLILF W\SH RI VHOHFWLRQ WHUPHG GLYHUJHQW DOOHOH DGYDQWDJH PD\ DFW LQ FRQFHUW ZLWK WKH RWKHU IRUPV RI EDODQFLQJ VHOHFWLRQ FRPPRQO\ WKRXJKW WR RSHUDWH RQ 0KF JHQHV %RGPHU =LQNHUQDJHO DQG 'RXJKHUW\ f $OO WKUHH PRGHV RI VHOHFWLRQ ZRXOG FRQWULEXWH WR WKH PDLQWHQDQFH RI

PAGE 163

0KF SRO\PRUSKLVPV EXW GLYHUJHQW DOOHOH DGYDQWDJH ZRXOG SUHIHUHQWLDOO\ IDYRU WKH PDLQWHQDQFH RI KLJKO\ GLYHUJHQW DOOHOHV ZLWKLQ SRSXODWLRQV 7KH UHVXOWV RI WKLV GLVVHUWDWLRQ FOHDUO\ LOOXVWUDWH WKDW WKH YDULRXV $E DOOHOLF DQWLJHQ ELQGLQJ VLWHV KDYH YHU\ GLYHUJHQW VWUXFWXUHV 7KHVH VWUXFWXUDO SRO\PRUSKLVPV VWURQJO\ LPSDFW RQ WKH IXQFWLRQDO SURSHUWLHV RI 0KF FODVV ,, PROHFXOHV DQG VXEVHTXHQWO\ LPSDFW RQ LPPXQH UHVSRQVLYHQHVV WR IRUHLJQ DQWLJHQ ,PPXQH 5HVSRQVH 9DULDWLRQ %HWZHHQ 'LYHUJHQW 0KF $OOHOHV (DFK 0KF FODVV ,, DOOHOH KDV WKH FDSDFLW\ WR ELQG DQG SUHVHQW D YDULHG \HW VSHFLILF VHW RI SHSWLGHV GHULYHG IURP SURFHVVHG DQWLJHQV 7KH LQDELOLW\ RI D VSHFLILF FODVV ,, DOOHOH WR ELQG DQG SUHVHQW D IUDJPHQW IURP SURFHVVHG DQWLJHQ UHVXOWV LQ WKH ORVV RI LPPXQH UHVSRQVLYHQHVV IRU WKDW DQWLJHQ LQ LQGLYLGXDOV KRPR]\JRXV IRU WKDW 0KF DOOHOH %XXV HW DO *XLOOHW HW DO f 7KHVH 0KFOLQNHG GHIHFWV LQ LPPXQH UHVSRQVLYHQHVV WHUPHG ,U JHQH GHIHFWV HLWKHU UHIOHFW WKH VSHFWUXP RI SHSWLGHV WKDW DUH QRW ERXQG E\ SURGXFWV RI VSHFLILF 0KF JHQRW\SHV RU UHIOHFW WKH IXQFWLRQDO GHOHWLRQ RI FHUWDLQ 7 O\PSKRF\WHV ZLWK SDUWLFXODU DQWLJHQ UHFHSWRUV GXULQJ 7 O\PSKRF\WH RQWRJHQ\ ,I DOO WKH ,U JHQH GHIHFWV LQ D VSHFLHV ZHUH FRPELQHG WKH\ ZRXOG UHSUHVHQW WKH LPPXQH UHVSRQVH YRLG IRU WKDW VSHFLHV GLDJUDPPHG LQ )LJXUH f (QGHPLF SDWKRJHQV RI WKDW

PAGE 164

)LJXUH $ PRGHO LOOXVWUDWLQJ D SRVVLEOH LPPXQRORJLFDO EDVLV IRU GLYHUJHQW DOOHOH DGYDQWDJH 7KH LPPXQH UHVSRQVH YRLG IRU D VSHFLHV H[LVWV ZLWKLQ WKH ODUJH RYDO

PAGE 166

VSHFLHV ZRXOG WHQG WR HYROYH DQWLJHQLFLW\ IRFXVVHG ZLWKLQ WKLV YRLG (DFK 0KF DOOHOH ZRXOG EH FDSDEOH RI LQLWLDWLQJ LPPXQH UHVSRQVHV DJDLQVW D VSHFLILF VXEVHW RI WKH DQWLJHQLFLW\ RI WKH YRLG 7KLV FRQFHSW LV LOOXVWUDWHG IRU OLQHDJHV RI 0KF DOOHOHV LQ )LJXUH 0KF DOOHOHV ZLWK KLJKO\ GLYHUJHQW IRUPV RI WKH DQWLJHQ ELQGLQJ VLWH ZRXOG FRYHU UHODWLYHO\ XQLTXH VHFWLRQV RI WKH YRLG LH VHSDUDWH SDWWHUQV DURXQG /, OLQHDJH DOOHOHVf DQG / OLQHDJH DOOHOHVf LQ )LJXUH f $OOHOHV ZLWK VLPLODU DQWLJHQ ELQGLQJ VLWHV DQGWKHUHIRUH SUHVXPDEO\ ELQGLQJ SURSHUWLHV ZRXOG FRYHU RYHUODSSLQJ VHJPHQWV RI WKH LPPXQH UHVSRQVH YRLG FLUFOHV VXUURXQGLQJ HLWKHU /, RU / LQ )LJXUH f 6HOHFWLRQ ZLOO FRQVHTXHQWO\ IDYRU WKH PDLQWHQDQFH RI DOOHOHV ZLWK KLJKO\ GLYHUJHQW DQWLJHQ ELQGLQJ VLWHV EHFDXVH VXFK DOOHOHV ZLOO GHWHFW QRQRYHUODSSLQJ VXEVHWV RI SDWKRJHQ DQWLJHQLFLW\ 0KF FODVV ,, PROHFXOHV ZLWK DQWLJHQ ELQGLQJ VLWHV DOWHUHG E\ SRZHUIXO VLQJOHVWHS PXWDJHQLF HYHQWV VXFK DV LQWUDH[RQLF UHFRPELQDWLRQ EHWZHHQ DOOHOHV FRPSRVHG RI KLJKO\ GLYHUJHQW DQWLJHQ ELQGLQJ VLWH VHJPHQWV DQG FRGRQ GHOHWLRQV ZRXOG EH IDYRUHG E\ VHOHFWLRQ 7KLV LV EHFDXVH VXFK QRYHO DOOHOHV ZRXOG GHWHFW VHJPHQWV RI WKH LPPXQH UHVSRQVH YRLG WKDW GR QRW RYHUODS ZLWK WKRVH VHJPHQWV RI WKH YRLG DOUHDG\ FRYHUHG E\ H[LVWLQJ 0KF DOOHOHV 'LYHUJHQW DOOHOH DGYDQWDJH FRXOG LQWHUDFW V\QHUJLVWLFDOO\ ZLWK RYHUGRPLQDQFH UHVXOWLQJ LQ WKH SUHIHUHQWLDO PDLQWHQDQFH RI DOOHOHV ZLWK YHU\ GLIIHUHQW

PAGE 167

DQWLJHQ ELQGLQJ SURSHUWLHV 6LQFH LPPXQH UHVSRQVH RYHUGRPLQDQFH LV EDVHG RQ WKH HQKDQFHG FDSDFLW\ RI 0KF KHWHUR]\JRWHV WR UHVSRQG WR D JUHDWHU VSHFWUXP RI IRUHLJQ DQWLJHQV KHWHUR]\JRWHV ZLWK DOOHOHV GHULYHG IURP GLIIHUHQW OLQHDJHV // DV RSSRVHG WR /O/OnfFRXOG SUHVHQW D EURDGHU DUUD\ RI DQWLJHQLF SHSWLGHV WKDQ WZR DOOHOHV GHULYHG IRUP /, RU / &RQVHTXHQWO\ // KHWHUR]\JRWHV ZRXOG EH IDYRUHG RYHU HLWKHU /O/O RU // KHWHUR]\JRWHV DQG KRPR]\JRWHV 'LYHUJHQW DOOHOH DGYDQWDJH FDQ LQWHUDFW ZLWK UDUH DOOHOH DGYDQWDJH WR PDLQWDLQ 0KF SRO\PRUSKLVP E\ SUHIHUHQWLDOO\ IDYRULQJ UDUH DOOHOHV ZLWK XQLTXH ELQGLQJ SURSHUWLHV )RU H[DPSOH FRQVLGHU D SRSXODWLRQ LQ ZKLFK /, DOOHOHV DUH SUHYDOHQW WKH HQGHPLF SDWKRJHQV ZLOO HYROYH DQWLJHQLFLW\ WKDW DOORZV WKHP WR WDNH DGYDQWDJH RI WKH ,U JHQH GHIHFWV LQKHUHQW LQ DOOHOHV RI WKLV OLQHDJH $V D UHVXOW DOOHOHV LQ / ZRXOG EH PRUH OLNHO\ WR KDYH DQWLJHQ ELQGLQJ VLWHV ZLWK SURSHUWLHV FDSDEOH RI SUHVHQWLQJ QHZO\ HYROYHG DQWLJHQV WKDW H[SORLW /, ,U GHIHFWV WKDQ DQRWKHU DQWLJHQ ELQGLQJ VLWH VWUXFWXUDOO\ UHODWHG /, DOOHOH 7KXV GLYHUJHQW DOOHOH DGYDQWDJH FRXOG LQWHUDFW ZLWK UDUH DOOHOH DGYDQWDJH WR SUHIHUHQWLDOO\ PDLQWDLQ DOOHOHV ZLWK KLJKO\ GLYHUJHQW DQWLJHQ ELQGLQJ WUDLWV 'LVHDVH UHVLVWDQFH LV D PXOWLJHQLF WUDLW DQG FRQVHTXHQWO\ WKH PRGHO GHVFULEHG DERYH UHSUHVHQWV D VLPSOLILFDWLRQ RI KRVWSDWKRJHQ LQWHUDFWLRQ ,Q DGGLWLRQ WKH 0KF LV D WLJKWO\OLQNHG PXOWLJHQLF IDPLO\ UDWKHU WKDQ D

PAGE 168

VLQJOH JHQH 7KLV ZRXOG WHQG WR ZHDNHQ WKH VWUHQJWK RI VHOHFWLRQ DW DQ\ VLQJOH ORFXV 1HYHUWKHOHVV WKH VDPH PRGHO ZRXOG KROG LI WKH OLQHDJHV RI DOOHOHV GHSLFWHG LQ )LJXUH ZHUH UHSODFHG ZLWK 0KF KDSORW\SHV

PAGE 169

/,7(5$785( &,7(' $EHUHU : 6WLQJO / 3RJDQWVFK 6 DQG 6WLQJO ,PPXQRO $FKD2UEHD + DQG 0F'HYLWW +2 3URF 1DWO $FDG 6FL 86$ $GRULQL / 0XOOHU 6 &DUGLQDX[ ) /HKPDQQ 39 )DOFLRQL ) DQG 1DJ\ =$ 1DWXUH $GRULQL / DQG 1DJ\ =$ ,PPXQRO 7RGD\ $OOHQ 30 ,PPXQRO 7RGD\ $OOHQ 30 %DEELWW %3 DQG 8QDQXH (5 ,PPXQRO 5HYA $UGHQ % DQG .OHLQ 3URF 1DWO $FDG 6FL 86$ %DEELWW %3 $OOHQ 30 0DWVXHGD +DEHU ( DQG 8QDQXH (5 1DWXUH %DEELWW %3 0DWVXHGD +DEHU ( 8QDQXH (5 DQG $OOHQ 30 3URF 1DWO $FDG 6FL 86$ %DOWLPRUH &HOO %HQDFHUUDI % ,PPXQRO %HQDFHUUDI % DQG *HUPDLQ 51 ,PPXQRO 5HY %HQDFHUUDI % DQG 0F'HYLWW +2 6FLHQFH %HQRLVW &2 0DWKLV '.DQWHU 05 :LOOLDPV 9( DQG 0F'HYLWW +2 D 3URF 1DWO $FDG 6FL 86$ %HQRLVW &2 0DWKLV '.DQWHU 05 :LOOLDPV 9( DQG 0F'HYLWW +2 E &HOO %HU]RIVN\ -$ %UHWW 66WUHLFKHU += DQG 7DNDKDVKL + ,PPXQRO 5HY

PAGE 170

%MRUNPDQ 36DSHU 0$ 6DPUDRXL 6WURPLQJHU -/ DQG :LOH\ '& % %HQQHWW :6 D 1DWXUH %MRUNPDQ 36DSHU 6WURPLQJHU -/ 0$ 6DPUDRXL % %HQQHW :6 DQG :LOH\ '& E 1DWXUH %RGPHU :) 1DWXUH %RQKRPPH ) D 7KH :LOG 0RXVH LQ ,PPXQRORJ\ S 3RWWHU 0 1DGHDX -+ DQG &DQFUR 03 HGV 6SULQJHU9HUODJ 1HZ
PAGE 171

'DYLV 00 &RKHQ ', 1LHOVHQ ($ 6WHLQPHW] 0$ 3DXO :( DQG +RRG / 3URF 1DWO $FDG 6FL 86$ 'DYLG &6 DQG 6KUHIIOHU '& 7UDQVSODQWDWLRQ 'HPELF = 6LQJHU 3$ DQG .OHLQ (0%2 'RUI 0( DQG %HQDFHUUDI % 3URF 1DWO $FDG 6FL 86$ 'XQFDQ :5 :DNHODQG (. DQG .OHLQ D ,PPXQRJHQHWLFV 'XQFDQ :5 :DNHODQG (. DQG .OHLQ E 1DWXUH (FFOHV 3 DQG 0F0DVWHU :5 ,PPXQRJHQHWLFV (VWHVV 3 %HJRYLFK $% .RR 0 -RQHV 33 DQG 0F'HYLWW +2 3URF 1DWO $FDG 6FL 86$ )DFKHW DQG $QGR (XU ,PPXQRO )DWKPDQ &* DQG .LPRWR 0 ,PPXQRO 5HY )HOVHQVWHLQ $QQ 5HY *HQHW )HOVHQVWHLQ 3+
PAGE 172

*HOLHEWHU DQG 1DWKHQVRQ 6* 7UHQGV LQ *HQHW *HUPDLQ 51 &HOO *HUPDLQ 51 %HQWO\ '0 DQG 4XLOO + &HOO *RUHU 3$ %U ([S 3DWKRO *RUHU 3$ 3DWKRO %DFWHULRO *RUJD -& 'RQJ $ 0DQQLQJ 0& :RRG\ 5: &DXJKH\ :6 DQG 6WURPLQJHU -/ 3URF 1DWO $FDG 6FL 86$ *RW]H 1DGHDX :DNHODQG (. %HUU\ 5%RQKRPPH ) (JRURY -. +LUWK -3 +RRJVWUDDO + 9LYHV :LQNLQJ + DQG .OHLQ ,PPXQRO *XLOOHW -* /DL 0= %ULQHU 7%XXV 6 6HWWH $ *UH\ +0 6PLWK -$ DQG *HIWHU 0/ 6FLHQFH *\OOHQVWHQ 8% DQG (UOLFK +$ 3URF 1DWO $FDG 6FL 86$ +DEHU.DW] ( +DPVEXUJ DQG 6FKZDUW] 5+ 0RO &HOO ,PPXQRO +DGL -5 6WDIIRUG (( 6XNDHUL ) DQG 5LEHUX : 6RXWKHDVW $VLDQ 7URS 0HG 3XEOLF +HDOWK +DPDMLPD ) .\XVKX 'DLRDNX 1RRDNXEX *DNXTHL =DVVKL +DUGLQJ &9 5RRI 5: DQG 8QDQXH (5 3URF 1DWO $FDG 6FL 86$ +DUULVRQ -/ 3URF =RRO 6RF /RQGRQ +RRG / 6WHLQPHW] 0 DQG *RRGHQRZ 5 &HOO +XJKHV $/ DQG 1HL 0 1DWXUH +XJKHV $/ DQG 1HL 0 3URF 1DWO $FDG 6FL 86$

PAGE 173

+XUPH 0 &KDQGOHU 35 +HWHULQJWRQ &0 DQG 6LPSVRQ ( ([S 0HG -RQHV -. -U DQG -RKQVRQ '+ 8QLY .DQV 3XEO 0XV 1DW +LVW -RQHV 33 ([S 0HG -RQHV 33 %HJRYLFK $% 7DFFKLQL&RWWLHU )0 DQG 9X 7+ ,PPXQRORJLFDO 5HVHDUFK /RQJ ( HG LQ SUHVVf -RQHV 33 0XUSK\ '% 0RO ,PPXQRO +HZJLOO DQG 0F'HYLWW +2 -RQHV 33 0XUSK\ '% DQG 0F'HYLWW +2 ([S 0HG -RQHV 33 0XUSK\ '% DQG 0F'HYLWW +2 ,PPXQRJHQHWLFV .DSSOHU -: 6NLGPRUH % :KLWH DQG 0DUUDFN 3 ([S 0HG .LQJ '3 DQG -RQHV 33 ,PPXQRO .OHLQ $QQ 5HY *HQHW .OHLQ %LRORJ\ RI WKH 0RXVH +LVWRFRPSDWLELOLWY &RPSOH[ 6SULQJHU9HUODJ 1HZ
PAGE 174

.RFK 1 :RQJ *+: 6FKUDGHU -: ,PPXQRO .XPDU 9 .RQR '+ 8UEDQ -/ DQG +RRG / $QQ 5HY ,PPXQRO /DIXVH :3 DQG 'DYLG &6 ,PPXQRJHQHWLFV /DQ]DYHFFKLD $ 1DWXUH /DUKDPPHU +DPPHUOLQJ 8 'HQDUR 0 /XQG 7 )ODYHOO 5$ 5DVN / DQG 3HWHUVRQ 3$ D &HOO /DUKDPPHU +\OGLJ1LHOVHQ -6HUYHQLXV % $QGHUVVRQ 5DVN / DQG 3HWHUVRQ 3$ E 3URF 1DWO $FDG 6FL 86$ /DVVLOD 9DLQLR DQG 0DW]LQJHU 3 1DWXUH /DZORU '$ :DUG )( (QQLV 3' -DFNVRQ $3 DQG 3DUKDP 3 1DWXUH /LHEHUPDQ 5 3DXO :( ([S 0HG +XPSKUH\ : 6WLPSKOLQJ -+ /LWWOH && DQG 7\]]HU (( 0HG 5HV /RUHQ] 5* DQG $OOHQ 86$ 30 3URF 1DWO $FDG 6FL /RUHQ] 5* DQG $OOHQ 30 ,PPXQRO 5HY /R]QHU (& 6DFKV '+ DQG 6KHDUHU *0 ([S 0HG /X &&
PAGE 175

0DUVKDOO -7 %XOO $P 0XV 1DW +LVW 0DUVKDOO -7 7KH 0RXVH LQ %LRPHGLFDO 5HVHDUFK 9RO S )RVWHU + / 6PDOO -' DQG )R[ -* HGV $FDGHPLF 3UHVV 1HZ
PAGE 176

0RQG -.HVVOHU 6 .XQJ DQG )LQNHOPDQ )' ,PPXQRO 0RQURH -* DQG &DPELHU -& ,PPXQRO 0XOOHU 8 -RQJHQHHO &9 1HGRVSDVRY 6$ )LVKHU /LQGDKO DQG 6WHLQPHW] 0 1DWXUH 0XUSK\ '% +HU]HQEHUJ /$ 2NXPXUD DQG 0F'HYLWW +2 ([S 0HG 0XUSK\ '% -RQHV 33 /RNHQ 05 DQG 0F'HYLWW +2 3URF 1DWO $FDG 6FL 86$ 1DGHDX -+ :DNHODQG (. *RW]H DQG .OHLQ *HQ 5HV &DPE 1DWKHQVRQ 6* *HOLHEWHU 3IDIIHQEDFK *0 DQG =HII 5$ ,PPXQRO 5HY 1HL 0 0ROHFXODU (YROXWLRQDU\ *HQHWLFV &ROXPELD 8QLYHUVLW\ 3UHVV 1HZ
PAGE 177

3LHUUHV 0 .RXULOVN\ )0 5HERXDK -3 'RVVHWWR 0 DQG &DLOORO (XU ,PPXQRO 3ROOD %6 3ROMDN $ 2KDUD 3DXO :( DQG *OLPFKHU /+ ,PPXQRO 5DGGLQJ &0 $QQ 5HY %LRFKHP 5LD ) &KDQ %0& 6FKHUHU 07 6PLWK -$ DQG *HIWHU 0/ 1DWXUH 5LFK 66 'DYLG &6 DQG 5LFK 55 D ([S 0HG 5LFK 55 6XGEHUU\ '$ .DVWQHU '/ DQG &KX / E ([S 0HG 5REHUWVRQ 0 1DWXUH 5RHKP 1: /HLEVRQ +=ORWQLN $ .DSSOHU 0DUUDFN 3 DQG &DPELHU -& ([S 0HG 5R\ 6 6FKHUHU 07 %ULQHU 76PLWK -$ DQG *HIWHU 0/ 6FLHQFH 6DJH 5' 7KH 0RXVH LQ %LRPHGLFDO 5HVHDUFK 9RO )RVWHU +/ 6PDOO -' DQG )R[ -* HGV $FDGHPLF 3UHVV 1HZ
PAGE 178

6KLURLVKL 7 6DJDL 7 DQG 0RULZDNL 1DWXUH 6OLJKWRP %OHFKO $( DQG 6PLWKLHV &HOO 6Q\GHU '6 %HOOHU ', DQG 8QDQXH (5 1DWXUH 6RNDO 55 DQG 6QHDWK 3+$ 3ULQFLSOHV RI 1XPHULFDO 7D[RQRP\ )UHHPDQ 3UHVV 6DQ )UDQVLVFR 6ULYDVWYD 63 DQG :DWWHO %/ ,QGLDQ (QWRPRO 6WHHJ 36 0RRUH 51 -RKQVRQ +0 DQG 2SSHQKHLP -([S 0HG 6WHLQPDQ 50 1RJXHLUD 1 :LWPHU 0' 7\GLQJV -* DQG 0HOOPDQ ,6 ([S 0HG 6WHLQPHW] 0 0DOLVVHQ 0 +RRG / 2UQ $ 0DNL *5 'DVWRRUQLNRR *5 6WHSKDQ *LEE ( DQG 5RPDQLXN 5 (0%2 6WHLQPHW] 0 0LQDUG +RUYDWK 6 0F1LFKRODV )UHOLQJHU :DNH & /RQJ ( 0DFK % DQG +RRG / E 1DWXUH 6WHLQPHW] 0 )UHOLQJHU -* )LVKHU +XQNDSLOODU 7 3HUHLUD :HLVVPDQ 60 8HKDUD + 1DWKHQVRQ 6 DQG +RRG / D &HOO 6WHLQPHW] 0 6WHSKDQ DQG )LVKHU /LQGDKO &HOO 6WHLQPHW] 0 DQG 8HPDWVX < + $QWLJHQV *HQHV 0ROHFXOHV )XQFWLRQ 'DYLG &6 HG 3OHQXP 3UHVV 1HZ
PAGE 179

8HPDWVX < )LVKHU /LQGDKO DQG 6WHLQPHW] 0 (0%2 8QDQXH (5 DQG $OOHQ 30 6FLHQFH 9X 7+ %HJRYLFK $% 7DFFKLQL&RWWLHU )0 DQG -RQHV 33 ,PPXQRO 9X 7+ 7DFFKLQL&RWWLHU )0 'D\ &( %HJRYLFK $% DQG -RQHV 33 ,PPXQRO :DNHODQG (. DQG 'DUE\ %5 ,PPXQRO :DNHODQG (. DQG .OHLQ ,PPXQRJHQHWLFV :DNHODQG (. DQG .OHLQ ,PPXQRO :DNHODQG (. 3ULFH/DIDFH 0 +HQVRQ 9 DQG 3HFN $% ,PPXQRJHQHWLFV :HLVV (+ 0HOORU $ *ROGHQ / )DKUQHU 6LPSVRQ ( +XUVW DQG )ODYHOO 5$ 1DWXUH :HUGHOLQ 2 0RXULWVHQ 6 /DXE 3HWHUVHQ % 6HWWH $ DQG %XXV 6 ,PPXQRO 5HY :LGHUD DQG )ODYHOO 5$ 3URF 1DWO $FDG 6FL 86$ :LQRWR $ 6WHLQPHW] 0 DQG +RRG / 3URF 1DWO $FDG 6FL 86$ :X 77 DQG .DEDW ($ ([S 0HG =LQNHUQDJHO 50 $QQ 5HY 0LFURELRO =LQNHUQDJHO 50 DQG 'RKHUW\ 3& 1DWXUH

PAGE 180

%,2*5$3+,&$/ 6.(7&+ 6WHIHQ $ %RHKPH ZDV ERUQ RQ 6HSWHPEHU LQ (QJOHZRRG 1HZ -HUVH\ +H JUHZ XS ZLWK KLV IDPLO\ LQ WKH QRUWKHUQ 1HZ -HUVH\ VXEXUE RI 5LYHU 9DOH $IWHU JUDGXDWLQJ IURP 3DVFDFN 9DOOH\ +LJK VFKRRO LQ KH DWWHQGHG 0XKOHQEHUJ &ROOHJH LQ $OOHQWRZQ 3HQQV\OYDQLD DQG HDUQHG D %DFKHORU RI 6FLHQFH GHJUHH LQ ELRORJ\ LQ +H EHJDQ WKH JUDGXDWH SURJUDP LQ WKH 'HSDUWPHQW RI 3DWKRORJ\ DQG /DERUDWRU\ 0HGLFLQH DW WKH 8QLYHUVLW\ RI )ORULGD LQ $XJXVW RI +H UHFHLYHG KLV 'RFWRU RI 3KLORVRSK\ GHJUHH IURP WKH 'HSDUWPHQW RI 3DWKRORJ\ DQG /DERUDWRU\ 0HGLFLQH DW WKH 8QLYHUVLW\ RI )ORULGD LQ

PAGE 181

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ (GZDUG :DNHODQG &KDLUPDQ 3URIHVVRU RI 3DWKRORJ\ DQG /DERUDWRU\ 0HGLFLQH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU JUI 3KLORVRSK\ :K; :LOOLDP +DXVWIL9WK 3URIHVVRU RI ,PPXQRORJ\ DQG 0HGLFDO 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 09P F£ +DUU\ 1LTA $VVRFLDWH 3URIHVVRU RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ /LQGD 6PLWK $VVLVWDQW 3URIHVVRU RI 3DWKRORJ\ DQG /DERUDWRU\ 0HGLFLQH

PAGE 182

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ +RZDUG 0 -RKQVRQ *UDGXDWH 5HVHDUFK 3URIHVVRU RI 3DWKRORJ\ DQG /DERUDWRU\ 0HGLFLQH 7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI 0HGLFLQH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ $XJXVW 'HDQ *UDGXDWH 6FKRRO

PAGE 183

81,9(56,7< 2) )/25,'$