Citation
Analysis of the sequences required for transcriptional regulation of a human H4 histone gene in vivo

Material Information

Title:
Analysis of the sequences required for transcriptional regulation of a human H4 histone gene in vivo
Creator:
Kroeger, Paul Edmond, 1960-
Publication Date:
Language:
English
Physical Description:
viii, 200 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Boxes ( jstor )
Cell lines ( jstor )
DNA ( jstor )
Genes ( jstor )
Histones ( jstor )
In vitro fertilization ( jstor )
Messenger RNA ( jstor )
Plasmids ( jstor )
Promoter regions ( jstor )
RNA ( jstor )
Dissertations, Academic -- Immunology and Medical Microbiology -- UF ( mesh )
Genes, Regulator ( mesh )
Immunology and Medical Microbiology thesis Ph.D ( mesh )
Transcription Factors ( mesh )
Transcription, Genetic ( mesh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 1988.
Bibliography:
Bibliography: leaves 184-199.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Paul Edmond Kroeger.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
001031878 ( ALEPH )
20429224 ( OCLC )
AFB4056 ( NOTIS )

Downloads

This item has the following downloads:


Full Text

















ANALYSIS OF THE SEQUENCES REQUIRED FOR TRANSCRIPTIONAL
REGULATION OF A HUMAN H4 HISTONE GENE IN VIVO















By

PAUL EDMOND KROEGER


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


1988




ANALYSIS OF THE SEQUENCES REQUIRED FOR TRANSCRIPTIONAL
REGULATION OF A HUMAN H4 HISTONE GENE IN VIVO
By
PAUL EDMOND KROEGER
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1988


ACKNOWLEDGEMENTS
I would like to thank Janet and Gary Stein for the opportunity to
work in their laboratory and explore molecular biology from a great
many perspectives. I also appreciate the advice and encouragement of
my other committee members, Drs. Ostrer, Hauswirth and Moyer.
The Stein's laboratory has been filled with many characters over
these last six years and I owe thanks to all of them. I would like to
thank Farhad Marashi, Mark Plumb, and Linda Green (especially Linda)
for their technical expertise and friendship. My fellow graduate
students Gerard Zambetti, Dave Collart, Andr van Wijnen, and Anna
Ramsey, I thank for their comradeship during the preceding years. The
laboratory would not have been the same without Charles Stewart, Urs
Pauli, and Sue Chrysogelos all of whom have given me new perspectives
on life and science. I thank Tim Morris for his constant good nature,
advice, and stimulating conversions (although we did not always
agree). I would particularly like to thank Ken Wright for our many
successful collaborative adventures in the laboratory, his friendship,
and generosity when it was most needed.
Finally I thank my wife Carol, and our new son, Alan, who have
given me constant inspiration to continue down what has been a long and
unusual path through graduate school. My parents have also been a
constant source of advice and encouragement, and I thank them for their
unending interest.
ii


TABLE OF CONTENTS
page
ACKNOWLEDGEMENTS ii
ABBREVIATIONS v
ABSTRACT vii
CHAPTERS
1 INTRODUCTION 1
Viral model systems 4
Chromatin Studies 5
In vitro transcription 9
Enhancers and Silencers 17
Histone genes 25
2 MATERIALS AND METHODS 37
3 HISTONE H4 5' REGULATORY SEQUENCES 63
Cell line Construction 67
Initiation of Transcription and Basal 68
Regulation
Distal Transcriptional Regulatory 108
Elements
Distal-Proximal Positive Element 129
Enhancer Element 131
Nuclear Run-on Analysis of H4 Transcription.... 139
4 PLASMID INTEGRATION SITES, INTEGRITY, AND 141
PROTEIN/DNA INTERACTIONS
Integrity of Flanking Sequences 142
Location of pSV2neo Plasmid Sequences 153
Compatibility of Mouse and Human Regulatory.... 158
Proteins and Sequences
5 DISCUSSION AND CONCLUSIONS 168
APPENDICES
A SAMPLE COPY NUMBER CALCULATION 181
iii


B SAMPLE CALCULATION OF HUMAN H4 EXPRESSION 182
C TABLE OF CONSTRUCTS 1.83
REFERENCES 184
BIOGRAPHICAL SKETCH 200
iv


KEY TO ABBREVIATIONS
ATP:
Adenosine 5triphosphate
bp:
Base pair
C:
Centigrade
CIP:
Calf intestinal phosphatase
CTP :
Cytidine 5'-triphosphate
DEPC:
Diethylpyrocarbonate
DNA:
Deoxyribonucleic acid
DNase I:
Deoxyribonuclease I
DU:
Densitometry units
EDTA:
Disodium Ethylenediaminetetraacetate
EGTA:
Ethylenebis(oxyethylenenitrilo)tetraacetic acid
GTP:
Guanosine 5'-triphosphate
Hepes:
N-2-hydroxyethylpiperizine-N'-2-ethanesulfonic acid
HU:
Hydroxyurea
1:
Liter
M:
Molar
pCi:
Microcurie
mg:
Milligram
Pg:
Microgram
ml:
Milliliter
/xl:
Microliter
v


mM:
Millimolar
mRNA:
Messenger ribonucleic acid
nm:
Nanometer
nt:
Nucleotides
OD:
Optical density
Pipes:
[1,4-piperazinebis(ethanesulfonic
acid)]
PVS:
Polyvinylsulfate
RNA:
Ribonucleic acid
RNaseA:
Ribonuclease A
rpm:
Revolutions per minute
SDS:
Sodium dodecyl sulfate
SV40
Simian virus 40
TCA:
Trichloroacetic acid
Tris:
Tris(hydroxymethyl)aminomethane +
Hydrochloric acid
TTP:
Thymidine 5triphosphate
VI


Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
ANALYSIS OF THE SEQUENCES REQUIRED FOR TRANSCRIPTIONAL
REGULATION OF A HUMAN H4 HISTONE GENE IN VIVO
By
Paul Edmond Kroeger
August 1988
Chairman: Janet Stein
Major Department: Immunology and Medical Microbiology
We have characterized the sequences required for the
transcriptional regulation of the FO108 human H4 histone gene in vivo.
Recombinant cell lines that contained deletion constructs of the H4
promoter region were prepared in mouse C127 cells, and the level of
human H4 histone gene expression was measured by SI nuclease analysis.
We found that the minimal sequences required for the initiation of
transcription from this gene were contained within the 73 nucleotides
5' to the initiation site of transcription. Within this region are
located an n vivo protein binding site (Site II), the GGTCC element
and the TATA box. Deletion of the distal half of Site II abolished site
specific initiation of transcription and demonstrated that the TATA box
and GGTCC element were not sufficient for initiation in vivo. Extension
of the H4 promoter to -100 base pairs resulted in a significant
increase in transcription and this increase correlated with the
Vll


presence of an Spl site in the proximal half of the upstream protein
binding site, Site I. If the promoter region was lengthened to -410
nucleotides, there was a two-fold increase in the level of
transcription. Deletion analysis suggested that the "distal-proximal"
positive element was located from in the region from -210 to -330 base
pairs 5' to the cap site. We investigated the functionality of a
previously identified enhancer-like element located very far upstream
in the pF0116 fragment of A HHG 41 and demonstrated that although it
functioned in HeLa cells it was not functional in mouse C127 cell
lines.
SI analysis of distal deletion constructs supported the idea that a
negative regulatory element of H4 gene transcription was located
between nucleotides -730 and -1010. Analysis of the region
demonstrated consensus sequences for a topoisomerase II site, nuclear
matrix attachment sites, and a very high A/T content (70%) suggestive
of bent DNA. Taken together this set of results implied that the DNA
topology of this region might be important for H4 gene regulation.
Additional studies demonstrated that Alu repetitive sequences in
the histone deletion constructs could mediate specific integration into
the mouse chromosome and that high copy number was possible.
viii


CHAPTER I
INTRODUCTION
The goal of this study has been to assess the contribution of
promoter sequences in the F0108 human H4 histone gene 5' flanking
region to transcriptional regulation of the gene. We have endeavored
to define the sequences necessary for the initiation and augmentation
of transcription. The TATA box, GGTCC element, "CAAT box," "CCAAT box,"
and Spl site have been implicated in transcriptional regulation and are
reviewed below. We have also investigated a putative enhancer-like
element and negative regulatory sequence and so these sequences are
also discussed below.
Historical Background
The concepts governing gene regulation, as we know them today, have
their foundations in the work of many biochemists and geneticists who
introduced the ideas of positive and negative regulation in prokaryotic
gene expression. The observations of many, that the total genetic
potential of a cell was never expressed simultaneously, referred to as
"genetic adaptation," led Jacob and Monod (1961) to address the
question of what controls this phenomenon. In their seminal paper the
"operon model" was proposed. This model described how structural genes
expressed themselves and how that expression was regulated. It had
been known for some time that bacteria could respond to various
1


2
nutrients by synthesizing new metabolic enzymes, so Jacob and Monod
investigated the lactose metabolic pathway of Escherichia coll (E.
coli). Their work was encouraged by many earlier investigators,
including Demerac (1956), who made the observation that genes coding
for similar enzymatic function were located in localized regions of the
Salmonella chromosome. Demerac was able to conclude that the genes he
had investigated were in a nonrandom distribution and that perhaps this
conferred an evolutionary advantage to the organism.
The lac operon is one of the most well studied genetic systems in
all of prokaryotic and eukaryotic molecular biology. The many
intuitive observations and predictions of Jacob and Monod and
colleagues led to the identification of the components of the lac
operon: the repressor, produced by the lac I gene; the lac operator,
promoter, and three linked structural genes. The interplay of inducer
and repressor was demonstrated, and Jacob and Monod proposed that the
lac operon was subject to negative regulation. An initial observation
of Jacob and Monod (1961) was that the control gene would make
repressors that would turn off the structural genes. The isolation of
nonsense mutations in the lac I gene (Bourgeois et al., 1965) provided
convincing evidence for the nature of repressors. Suppression of the
nonsense mutation restored repressor function and demonstrated that
repressor genes encoded repressor proteins. The final proof was the
isolation of the lac repressor by Gilbert and Mller-Hill (1966). In
addition it was demonstrated that the lac operon and others were under
more general control by catabolite activator protein and 3'5'-cyclic-


AMP as it was shown that both are required, in addition to the inducing
molecule, for the operon to be transcribed (Emmer et al., 1970).
The ensuing years have led to refinement of the operon model as
well as its acceptance as one of the general organizational patterns
characteristic of prokaryotes. In particular, the concepts of
protein/DNA interactions, repression, and positive and negative
regulation have carried over into eukaryotic molecular biology and
have served as a basis for unraveling the complexity of the eukaryotic
cell. The extension of these ideas has allowed considerable progress;
however, the original view that all genes, prokaryotic and eukaryotic,
would have similar regulatory and organizational patterns has not been
borne out. In fact there is a great diversity in the regulatory
mechanisms that govern both prokaryotic and eukaryotic gene
expression.
The control of eukaryotic gene regulation has been of obvious
interest, but research has been slower than in prokaryotes because of
the complexity and technical difficulties encountered when working with
the eukaryotic cell. Two avenues of study have predominated in
eukaryotic molecular biology: the investigation of viral models such
as adenovirus and SV40 (as was done with the prokaryotic phages lambda
and T7) and the characterization of cellular genes and the proteins
that regulate their expression.
Eukaryotic molecular biologists have had to develop the appropriate
technology because many of the advantageous prokaryotic techniques are
not directly applicable to eukaryotic systems. Two of the most
important discoveries that have revolutionized molecular biology are


restriction enzymes (reviewed by Nathans and Smith, 1975) and DNA
ligase (Modrich et al., 1973; Weiss and Richardson, 1967). With these
new enzymatic tools the ability to manipulate DNA fragments developed
quickly and was responsible for the present state of advancement.
Viral Model Systems
The utilization of viral model systems for the characterization of
eukaryotic regulatory mechanisms was a logical extension of the work
done in prokaryotes. In particular, adenovirus and SV40 have provided
considerable insights into eukaryotic gene regulation. Without an
understanding of the exact mechanisms involved in the various processes
of RNA transcription and DNA replication, it was obvious to early
investigators that viruses, such as SV40, could invade and eventually
kill the host cell and yet were extremely dependent on the cell's
enzymatic machinery to accomplish their replicative cycle.
Adenoviruses were first isolated by Rowe et al. (1953) as the
agent responsible for the degeneration of human adenoid tissue in
culture. The adenovirus life cycle in human cells has been examined
with respect to the virus specific proteins produced, replication of
viral DNA, transcription of viral genes, and effect on the host cell
(Reviewed in Tooze, 1980). Initial studies demonstrated that there
were two phases--early and late--in the expression of adenovirus genes
(Lindberg et al., 1972). As a measure of the impact of infection on the
cell, adenovirus mRNA comprises almost all the mRNA bound to
polyribosomes by the end of the replicative cycle (Thomas and Green,
1966). The early viral mRNA was detected and mapped to precise
locations on the adenovirus genome by R-loop mapping (Thomas et al.,


1976) and hybridization to restriction endonuclease fragments of
adenovirus DNA (Sharp et al., 1975). Restriction enzymes permitted the
mapping and orientation of DNA fragments and transcription units on the
SV40 genome as well (Khoury et al., 1973; Sambrook et al., 1973).
Several laboratories utilized adenovirus/SV40 recombinant hybrids
to define essential genomic regions of each. In particular, the hybrid
viruses were useful in the determination of the functional "helper"
domain of the SV40 T antigen, as adenovirus requires "help" to grow in
nonpermissive cells (Fey et al., 1979). With the mRNA coding regions
mapped on the adenovirus and SV40 genomes, a more informative analysis
and interpretation were initiated which have begun to elucidate the
complex nature of transcriptional regulation in these viruses. The
promoter structure and presence of enhancing/silencing elements in
these viruses have served as continuing models for studies of cellular
promoters and regulatory sequences. Additionally, although not
discussed here, both adenovirus and SV40 were utilized in the discovery
of mRNA splicing (Berk and Sharp, 1977, 1978), which has revolutionized
our concepts of gene regulation and expression.
Chromatin Studies
At the same time that the viral model systems were beginning to be
reasonably well understood, there were a number of investigators
pursuing the characterization of cellular genes and transcriptional
mechanisms. Although restriction enzymes had been discovered (Smith
and Wilcox, 1970) and their applicability realized, it was several
years before their purification and recombinant DNA technology were
worked out to make them sufficiently useful. This lag did not deter a


number of investigators from direct examination of the transcriptional
process in eukaryotic cells. As early as 1962 isolated pea embryo
chromatin had been utilized as a template for transcription (Huang and
Bonner, 1962). Isolated chromatin was incubated with bacterial RNA
polymerase (the purification of eukaryotic RNA polymerases had not been
achieved at this time) and the four ribonucleoside triphosphates. A
comparative analysis of transcription from chromatin and deproteinized
DNA of the same source indicated that the chromatin was less able to
support transcription (Huang and Bonner, 1962). It was postulated that
part of the chromatin was repressed, perhaps due to the presence of
histone proteins bound to the DNA. The amount of transcription
possible from a known quantity of chromatin was referred to as its
template capacity. The determination of template capacity in chick
oviduct, a steroid responsive tissue, led to the observation that the
level of transcription was modulated with the addition of hormone
(Dahmus and Bonner, 1965). The amount of template capacity also
correlated with the various developmental stages of sea urchin growth
(Johnson and Hnilica, 1970). Another more accurate measure of the
"transcriptional capacity" of a sample of chromatin was the number of
RNA polymerase initiation sites. Cedar and Felsenfeld (1973) first
measured the number of E. coli RNA polymerase initiation sites on
chromatin by incubating chromatin and RNA polymerase together in the
absence of ribonucleoside triphosphates. Next, the addition of the
ribonucleoside triphosphates with high levels of ammonium sulfate
permitted elongation but not reinitiation. One of the major criticisms
of this early work was that the use of bacterial RNA polymerase made an


7
accurate interpretation in doubt. Comparative studies were performed
by Mandel and Chambn (1970) and Tsai et al. (1976). These
investigators demonstrated that there was no competition for either
SV40 DNA or calf thymus DNA by the bacterial or eukaryotic RNA
polymerase. However, when Tsai et al. (1976) compared hen oviduct and
E. coli RNA polymerase initiation sites on chick DNA or chick oviduct
chromatin, they found no competition on the DNA, but direct competition
in the chromatin sample. Thus it appeared that chromosomal proteins
could modify the initiation specificity such that both enzymes were
competing for similar sites. To establish this point conclusively, the
product mRNAs had to be examined. Filter hybridization techniques were
developed that permitted the detection of reiterated gene transcripts
and particularly abundant mRNAs. At the level of sensitivity possible
with this methodology, in vitro chromatin transcription appeared to
reflect an accurate view of the transcriptional status in vivo
(Bacheler and Smith, 1976).
The next major advance was the fractionation of chromosomal
proteins in an effort to reconstitute transcriptionally competent DNA
into chromatin in vitro. The first attempts to reconstitute chromatin
were studies by Paul and Gilmour (1966, 1968) and Bekhor et al. (1969)
in which they fractionated chromatin proteins in an attempt to
discover what group of proteins controlled transcriptional. Their
results indicated that the non-histone chromosomal protein (NHCP)
fraction was probably responsible. The role of NHCP in the expression


8
of several genes has been reviewed (Stein et al., 1974; Simpson,
1973).
Experiments became more refined as exemplified by the studies of
Tsai et al. (1976) who examined the inducible ovalbumin gene in the
chick oviduct system. The role of NHCP was established, and through a
series of competition assays with induced and uninduced NHCPs it was
demonstrated that in vitro expression of the ovalbumin gene was
stimulated by the appearance, upon steroid induction, of a positive
regulatory factor. Histones, a moderately reiterated family of genes
(Stein et al., 1984), were also studied in a similar manner to examine
the role of NHCPs. Several studies indicated that NHCPs were involved
in the increased expression of the histone genes during S-phase of the
cell cycle (Park et al., 1976; Stein et al., 1975). Kleinsmith et al.
(1976) extended the characterization and demonstrated that
phosphorylation of the NHCP was necessary for optimal in vitro
expression of the histone genes. When the NHCPs were treated with
phosphatase before addition to the reaction, there was a decrease in
the number of transcription initiation sites.
The role of the histone proteins in transcription has been of great
interest because they form such a close association with the DNA.
Studies with either electron microscopy or nuclease digestion have
demonstrated that there is either a change in the histone/DNA ratio or
a conformational change in the nucleosomes associated with genes
undergoing active transcription (Weintraub and Groudine, 1976). The
chromatin structure of specific genes has also been shown to be
conformationally altered only in tissues where they are


expressed. Examples include the /3-globin gene in chick embryo red
blood cell nuclei and the ovalbumin gene in chick oviduct nuclei
(Garel and Axel, 1976). Also, several investigators have proposed that
nucleosomes might be "phased" on the chromosome so as to render
particular areas of the DNA accessible, or inaccessible, to
transcription factors (Gottschling and Cech, 1984; Linxweiler and Horz,
1985). Thus, at this juncture, it became more realistic to assume that
the chromatin structure of active genes in comparison to silent loci
was a more open and dynamic conformation, yet not necessarily devoid of
histones as had been postulated.
In Vitro Transcription
During the early 1970s, several investigators actively pursued the
activity (or activities) responsible for the synthesis of the various
eukaryotic mRNAs. Almost simultaneously several laboratories were able
to isolate multiple RNA polymerase activities on DEAE-Sephadex columns
(Chambn, 1975; Roeder, 1976). Each peak of activity exhibited a
different susceptibility to the inhibitor amanitin (Kedinger, 1970).
There were differences in the results they obtained as evidenced by the
diverse number of variant RNA polymerase activities that were
originally identified (Roeder, 1976). As the purity of the RNA
polymerase activity increased it became more obvious that there were
three distinct RNA polymerase activities present in eukaryotic cells
(Roeder, 1976). It was very difficult for early investigators to make
progress toward understanding the relationship between the various
eukaryotic RNA polymerases and their respective function in the


10
expression of genes, because adequate templates for transcription in
vitro were not available. The predominant templates used were either
homopolymers, bacteriophage DNA, or fractions of genomic DNA enriched
in either ribosomal or satellite DNA (Chambn, 1975). These proved
unsatisfactory, and the results were often confusing. Several lines of
evidence suggested that ancillary factors were necessary in order for
RNA polymerase, in particular RNA polymerase II, to exhibit template
specific transcription (Chambn, 1975). The application of restriction
enzymes to the manipulation of DNA led to the cloning of specific genes
that were then suitable as templates for in vitro transcription
systems (Nathans and Smith, 1975).
The biological implications of the viral model systems that had
been studied .in vivo. and the new DNA cloning technology, prompted
several investigators to develop cell free transcription systems. It
was obvious that it would be advantageous to work with an in vitro
system to dissect the various components of the eukaryotic
transcriptional apparatus. The first in vitro transcription systems
were developed for RNA polymerase III, and shortly thereafter, RNA
polymerase II. RNA polymerase III is responsible for the synthesis of
5S ribosomal RNA (Ng et al., 1979), tRNAs, and a few viral RNAs
including the adenovirus VAI and VAII RNAs (Fowlkes and Shenk, 1980).
Cell free transcription of the Xenopus 5S rRNA gene by RNA polymerase
III was first demonstrated by Birkenmeier et al. (1978) in nuclear
extracts of Xenopus oocytes. At the same time it was shown that
cytoplasmic extracts of human KB cells (Wu, 1978; Weil et al., 1979)
were able to transcribe selectively cloned 5S rRNA, tRNA, and


11
adenovirus VA RNA genes. The cytoplasmic extracts were shown to
contain a majority of the RNA polymerase III activity (Weil et al.,
1979) that had apparently leaked from the nucleus during preparation of
the extract. With respect to RNA polymerase II, Manley et al. (1980)
prepared a concentrated HeLa cell extract that was able to initiate
transcription accurately in vitro at a variety of adenovirus RNA
polymerase II transcriptional control regions.
In vitro transcription was and is a powerful technique for the
investigation of eukaryotic promoter function. The concomitant
development of various molecular techniques for the mutation and
reassortment of DNA sequences was fortuitous, and in a relatively short
period of time the basic sequence requirements of the RNA polymerase II
promoter were delineated (Efstratiadis et al., 1980). Although
considerable refinement has occurred in our knowledge of these
sequences, the basic elements have not changed. One of the first
sequences to be implicated because of similarity to prokaryotic
promoter sequences was the "TATAA" box (Goldberg-Hogness). This A-T
rich stretch is located -25 to -35 bp upstream of the mRNA start site
in RNA polymerase II promoters and is remarkably similar to the Pribnow
box (TATAAT) described for the promoters of prokaryotic genes (Pribnow,
1975). The only real difference is the location of the Pribnow box,
which is at -10 bp from the start of transcription (Rosenberg and
Court, 1979). It should be noted that the comparison of the Pribnow box
with the Hogness box has revealed variations in sequence and some
difference in function. Principally, the Pribnow box is absolutely
required for transcription to occur in prokaryotes; however, as


12
discussed below, the Hogness box is not as stringently required. The
second sequence that has been retained with equally remarkable
similarity is the "CAAT" box. The consensus sequence for this element
is 5'-GGCtCAATCT-3' (Efstratiadis et al., 1980; Dynan and Tjian, 1985)
and is usually located -70 to -80 bp from the mRNA start site.
Although the TATA box and CAAT box have been found in a majority of
RNA polymerase II promoters and appear to be the framework around which
gene specific variations in regulatory sequences occur, there have been
some genes described that have no TATA box (Contreras and Fiers, 1981;
Melton et al., 1986; Reynolds et al., 1984). A subset of these genes
that have instead a highly G-C rich promoter and in general lack the
strict structure created by consensus RNA polymerase II sequences.
Examples include enzymes such as mouse dihydrofolate reductase (Farnham
and Schimke, 1985), hamster 3-hydroxy 3-methylglutaryl coenzyme A
reductase (Reynolds et al., 1984), and human phosphoglycerate kinase
(Singer-Sam et al., 1984). These genes are often constitutive and hence
have been described as "housekeeping genes." Because the TATAA and
CAAT homologies were found in many genes, it was thought that they
might function in the regulation of transcription. Early in vitro
transcription experiments done by Wasylyk et al. (1980) indicated that
the promoter of the conalbumin gene could be deleted to -44 bp from the
mRNA start site without any effect on the transcription of the gene.
However, when these same investigators introduced even a single base
change into the TATAA box, there was a 10 fold decrease in the amount


13
of transcription. Similar results were obtained with the adenovirus 2
major late control region (Corden et al., 1980; Hu and Manley, 1981;
Concino et al., 1984).
In contrast to the in vitro results, it was noticed that the TATAA
box, in general, was not essential for transcription in vivo. Benoist
and Chambn (1980) made an SV40 deletion mutant that lacked the TATAA
box preceding the early transcription unit. This mutant was capable of
synthesizing T antigen and transforming rat cells. Similar results were
obtained with the polyoma virus early transcription unit (Bendig et
al., 1980). It was also established that the TATAA box preceding the
sea urchin H2A transcription unit was not necessary for function in
vivo (Grosschedl and Birnstiel, 1980a). The deletion mutants that
Grosschedl made were assayed by injection into Xenonus
oocytes. A 54 bp deletion that included the TATAA box lowered the level
of transcription 5 fold but did not abolish activity.
If the TATAA box is not absolutely essential in vivo for
transcription, then what is the function of this highly conserved
sequence? The answer came from a series of SV40 early promoter mutants
in which the TATAA box was deleted (Gluzman et al., 1980). From this
set of mutants it was demonstrated that in vivo the initiation of SV40
early transcription occurred downstream of the normal site. Also it was
established by Gluzman et al. (1980) that when there were deletions
between the start of transcription and the TATAA box the site of
initiation remained a constant 25 bp + 2 bp downstream. This
demonstrated that regardless of the deletion, the mRNA cap site was
determined by the position of the TATAA box. Grosschedl and Birstiel


14
(1980b) found that multiple initiation sites were utilized in vivo
when the TATAA box was deleted from the sea urchin H2A gene. Since the
lack of a TATAA box caused heterogeneity in the start site of
transcription for several genes, it is now considered that the TATAA
box functions in vivo to specify the correct mRNA initiation site.
Early in vitro transcription studies did not directly discern
whether the CAAT box was necessary for transcription (reviewed in
Shenk, 1981). However, more recent and detailed studies have determined
that the CAAT box does play a role in transcriptional regulation.
Detailed mutagenesis studies by McKnight and Kingsbury (1982); McKnight
et al. (1984) and Myers et al. (1986) elegantly demonstrated the need
for the CAAT box. Initially the studies of McKnight and Kingsbury
(1982), dissected the Herpes Simplex thymidine kinase gene (HSVtk) into
discrete areas required for expression: these included the TATAA box
and two upstream regions referred to as distal signal I (dsl) and
distal signal II (dsll). To pinpoint these small regions accurately
they developed a technique called "linker-scanning" mutagenesis which
introduces clustered sets of point mutations in a short sequence of
DNA. Specifically, these mutations were constructed by ligation of a
series of complementary 3' and 5' deletions joined via a synthetic
linker (BamHI). The mutants that McKnight and Kingsbury created spanned
the proximal 120 bp 5' to the mRNA start site and thus they were able
to assign a boundary to all the sequences required for HSV tk gene
expression after microinjection into Xenopus oocytes. In subsequent
studies dsl and dsll of the HSV tk gene have been shown to interact


specifically with a cellular protein (Jones et al., 1985). This
protein, Spl, was initially purified by Dynan and Tjian (1983a) from
HeLa cells because of its affinity for the SV40 early promoter--later
identified as the G-C rich sequences of the 21 bp repeats. Once the
sequence of the binding site (GGGCGG) on SV40 was confirmed by various
in vitro methods (e.g., DNasel footprinting), the purified protein was
tested for binding on a variety of other genes that contain a G-C rich
sequence(s), including the mouse Dihydrofolate reductase gene (Dynan et
al., 1986) and more recently the rat insulin-like growth factor gene by
Evans et al. (1988). Both of these genes contain several Spl binding
sites, identified in vitro by DNase I footprinting, and the sites in
the rat insulin-like growth factor gene are of varying affinity
depending on the sequence.
Subsequent to the purification of Spl several groups reported the
identification a cellular protein that interacts with the CAAT box
sequence and has been referred to as either CAAT box transcription
factor (CTF) by Jones et al. (1985) or CAAT box binding protein (CBP)
by Graves et al. (1986). Jones et al. (1985) demonstrated an
interaction in dsll of the HSV tk promoter between Spl and CTF, thus
indicating that distinct transcription factors may interact to regulate
expression. The identification of CTF prompted the search for other
putative transcription factors, and although the evidence is somewhat
preliminary, there appear to be at least 3-4 different CAAT box
binding activities depending on the source of the material used to
purify the activity and the criteria used for analysis (Dorn et al.,
1987). CBP and CTF differ from each other in their heat stability


(McKnight and Tjian, 1986). A CAAT box binding factor isolated from
HeLa cells in our laboratory (van Wijnen et al., 1988), termed HiNF-B,
is yet another addition to this growing family of proteins, with
properties that distinguish it from previous isolated CAAT box-binding
factors.
The most sophisticated study to date on the subject of
transcriptional regulatory sequences was done recently by Myers et al.
(1986). These investigators developed a quick method for the
introduction of single point mutations in a small region of DNA. They
mutated nearly every base from -1 to -101 bp of the mouse /J-globin
promoter. With a battery of over 100 clones, each with a single base
change in the promoter, they were able to assay the expression of the
mutant constructs in vivo in a short term transient assay. Therefore,
they could assign functional limits to consensus regulatory sequences
and discover any minor, or as yet unnoticed, contributing nucleotides.
In addition, transversions and transitions were measured to assess any
effects on expression. They demonstrated a requirement for the TATAA
box (-25 bp) and the CAAT box (-75 bp) as well as an upstream sequence
characteristic of the /?-globin genes, CACCC (-96 bp), in /3-globin
transcription. Significantly, an "up" promoter mutation was discovered
when the two bases, GG, immediately 5' to the CCAAT box were changed to
AA. The result of this mutation was a 3-4 fold increase in the level
of message. The implications of this result are that a CAAT box
transcription factor is able to bind more tightly or more specifically
and therefore perform its function more efficiently. With the number
of CAAT box binding factors that are being found in various systems, it


is also possible that the "up" mutation results in the binding of an
alternative, as yet unidentified, protein that carries out the same
function, just more efficiently.
In addition, there are temporal and tissue-specific sequences that
are found in the promoters of some genes and regulate expression at the
transcriptional level. Many of these elements fall into a category of
modulatory sequences referred to as enhancers, negative elements, and
silencers.
Enhancers and Silencers
The promoter of a gene has generally been defined as the minimal
sequences necessary for the initiation and maintenance of a basal level
of specific transcription. Additional elements that modify the
expression of a gene either during development, temporally, in a tissue
specific manner, or as a result of an inducer, would seem a necessity
if adequate regulation in the eukaryotic cell is to be achieved. In the
preceding 5-10 years a number of investigators have provided
considerable evidence for the existence of positive regulatory
sequences referred to as enhancers (Reviewed in Serfling et al., 1985;
Maniatis et al., 1987). The properties of an enhancer are that 1)
there is strong activation of the linked gene from the correct
initiation site, 2) it exhibits independence of orientation, 3) it is
operative at long distances whether 3' or 5', and 4) it preferentially
stimulates transcription from the closest promoter, if they are
tandemly arranged (Serfling et al., 1985). The prototype enhancer
elements are the 72 bp repeats of SV40, which have been extensively


characterized (Benoist and Chambn, 1980; Fromm and Berg, 1982;
Treisman and Maniatis, 1985). Several experiments in which the SV40
enhancer has been fused to the mouse /3-glob in promoter have
demonstrated the relationships that exist between an enhancer and
promoter. Banerji et al. (1981) demonstrated that the SV40 enhancer
could promote hundred-fold higher levels of rabbit /3-glob in
transcription whether located 1400 or 3300 base pairs away. Treisman
and Maniatis (1985) demonstrated that SV40 enhanced transcription of
the mouse /3-globin gene depended on the presence of a functional
promoter. Point mutations in the upstream promoter elements (UPE) of
the /3-globin promoter abolished transcription almost totally. In
conjunction with these results, Treisman et al. (1985) demonstrated
that when the /3-globin promoter was deleted, and the SV40 enhancer was
moved to a proximal position, transcription returned to a high level.
It would then appear that enhancers are like promoters but not vice
versa. Bienz and Pelham (1986) demonstrated that the tandem
duplication of transcriptional control sequences could result in
enhancing ability. They found that the duplication of a heat shock
regulatory element (HSE) could function as an enhancer (distance
activation) whereas a single HSE was inactive at a distance. So one of
the major differences between enhancers and promoters (action at a
distance) may be due to the number of "promoter" elements present with
some accompanying specific sequences (Maniatis et al., 1987). The
importance of the specific sequences should not be down-played, as a
consensus core sequence, 5'-GTGGAAAG-3', has been identified in viral
and cellular enhancers (Khoury and Gruss, 1983).


19
Differences may also be the result of the arrangement of
transcriptional regulatory sequences. Why do an increased number of
regulatory sequences in many cases stimulate transcription so
dramatically? It has been proposed that the resulting protein-protein
complexes that arise from the juxtaposition of regulatory sequences
result in increased transcription. Therefore since most enhancers
contain repeated elements it is possible that they function in
organization of the transcriptional apparatus. Exceptions to this
exist of course; tandem duplication of the CCAAT box does not lead to
a DNA fragment with enhancer qualities (Bienz and Pelham, 1986), i.e.
no enhancement at a distance. Perhaps this result is also a reflection
of the idea that some "transcription" factors bind to the DNA but do
not act directly. Instead they function through their association with
adjacent proteins (Maniatis et al., 1987). An example is that CTF has
been shown to associate closely with Spl protein in the Herpes virus tk
gene (Jones et al., 1985). Significantly, it has recently become
apparent that the mechanism of transcriptional activation by upstream
activation sites (UASs) in yeast is conserved in mammals. Several
studies over the last year have demonstrated 1) that activator
proteins in yeast are composed of a DNA binding domain in the amino
terminus of the protein and a transcriptional activator in the carboxy
terminus, and 2) that when the yeast proteins are expressed in
mammalian cells (with the appropriate binding site present in the
promoter of the target gene) they can activate transcription (Kakidani
and Ptashne, 1988; Webster et al., 1988; Hope and Struhl, 1986). Taken
together with what is known about transcriptional regulation in higher


eukaryotes, it appears that the separation of the DNA binding domain
and the transcriptional activation domain of regulatory proteins may be
conserved from yeast to mammals. In addition the mechanism is probably
conserved as well.
Several of the more well characterized enhancer sequences are part
of a group related by tissue specificity of expression. The
Immunoglobulin (Ig) enhancer of the heavy chain locus is located
several thousand bps 3' to the variable region promoter. This enhancer
sequence, in its entirety, is only active in cells of the lymphoid
lineage (Gillies et al., 1983; and Banerji et al., 1983). As has been
found for the SV40 enhancer, the Ig enhancer is composed of several
distinct elements that interact with specific proteins in vivo (Church
et al. 1985). One of the core elements of the Ig enhancer is the
"octamer" sequence, 5'-ATGCAAAT-3'. It is of special interest as it
also appears in the promoter of a few cellular genes, including histone
H2B (Harvey et al., 1982) and (2'-5') oligo-A synthetase (Benech et
al., 1985). How this element contributes to tissue specificity in one
context (Ig enhancer) and not in another (histone H2B) remains to be
determined. Recent in vitro binding studies of proteins that interact
with the SV40 "octamer" sequence have demonstrated that there are both
general and tissue specific factors present that bind this sequence,
and this may relate to its role in tissue specific regulation (Rosales
et al., 1987). Also, careful mapping of the binding of HeLa and B cell
nuclear proteins to the SV40 enhancer has revealed subtle differences
in the extent to which various motifs are protected which is indicative
of differential protein/DNA interactions (Davidson et- al., 1986).


Enhancers should not be mistaken for promoters with additional
sequence attached or interspersed. In many cases they exhibit
exceptional cell-type and temporal specificity with respect to
transcriptional activation. Deletion analysis has indicated that
certain core sequences of the IgH enhancer may function in non-lymphoid
cells to shut off the enhancer action (Wasylyk and Wasylyk, 1986;
Kadesh et al., 1986).
The implication of a negative regulatory mechanism for the control
of IgH enhancer action presents a confusing picture of tissue specific
and temporal gene regulation. At first it was thought that the absence
of necessary factors for enhancer action was the reason for
differential activity in various tissues (Maniatis et al., 1987).
However, this has been shown to be somewhat incorrect as many of the
factors found in B cell extracts are also in other types of cells. So,
it is either a case of inaccessibility of the DNA binding sites in
nonlymphoid cells, or that there must be an interaction with a B cell
specific protein (Maniatis et al., 1987). Recently Sen and Baltimore
(1986) discovered a factor present in many cell types, NF-kB, that
interacts with the kappa-chain gene enhancer, but only after
modification to an active form in B-cells.
Negative regulation of gene expression is an old subject for
prokaryotic molecular biologists, but is relatively new to eukaryotic
gene regulation. The first description of the SV40 enhancer element
caused everyone to search for similar elements in other genes, and the
identification of negative regulatory sequences, especially in viral
enhancers, has had a similar effect. It is important to understand that


22
negative regulatory sequences can be divided into two groups, 1) those
sequences that shut off activity of another regulatory element (such as
an enhancer) and have been found to exist within the confines of the
enhancer element, and 2) sequences that act independently of other
regulatory elements to control the level of gene expression. This
latter type of element is the newest discovered and as such is less
well characterized. An interesting distinction can be made in that
some negative regulatory elements can act in either orientation and
with some distance independence and as such have been called either
dehancers or silencers (Baniahmad et al., 1987; Laimins et al., 1986;
Remmers et al., 1986).
Negative regulation of viral enhancer elements is best typified by
the IgH enhancer in which Wasylyk and Wasylyk (1986) have shown that
sequences on either side of the central core sequence down regulate
expression in fibroblasts as compared to B-cells. It is obvious that,
as mentioned above, there must be a mechanism by which the appropriate
genes are expressed at the right times in the right tissues. This may
occur through the regulation of many protein factors, but more likely
there is one protein that regulates the organization of the other
transcriptional factors. It seems apparent that the complexity of the
eukaryotic promoter would in many cases permit great specificity of
expression but could be a regulatory nightmare for the cell. An
exquisite example of coordinate regulation of many genes is found in
the Adenovirus system and the Ela protein. Ela, one of the immediate
early proteins produced in early infection, coordinates the expression


23
of several other genes (Yee et al., 1987) and also represses the
expression of other elements, such as the SV40 enhancer.
A particularly interesting example of negative regulation, which
relates to Ela regulation, has been described for embryonal carcinoma
cells (EC). SV40, polyoma virus, or Moloney murine leukemia virus are
unable to express their genomes when transfected into undifferentiated
EC cells. The induction of differentiation removes the block on the
expression of both viral and cellular genes (Gorman et al., 1985).
Mutants of polyoma virus were isolated that could replicate in the
undifferentiated EC cells, and it was found that the mutations occurred
predominantly in the promoter and enhancer regions of the early genes.
Alternatively, it has been found that the adenoviruses replicate well
in undifferentiated EC cells. In conjunction it was discovered that
mutants in the Ela region could grow in undifferentiated, but not
differentiated EC cells. Taken together with previous evidence about
the function of the Ela protein, it has been suggested that EC cells
contain an Ela like protein that negatively regulates gene expression
until differentiation is induced (Gorman et al., 1985). Gorman et al.
(1985) have demonstrated that when the SV40 early promoter is
introduced by infection it is inactive in EC cells, but when introduced
by CaP04 transfection it is expressed in an enhancer-independent
fashion. This result strongly suggests that the large number of
molecules present in the transiently transfected cell are able to
titrate out the negative factor (or factors) and thus allow expression
from some of the genomes present. Gorman et al. (1985) have also shown
that the negative factors in EC cells have different relative


affinities for the various enhancers, and surprisingly the affinity of
the interaction did not necessarily relate to the level of expression.
A number of cellular genes have been shown to contain negative
regulatory elements although their specific mode of action has not been
characterized. These genes include mouse /3-interferon (Goodbourn et
al., 1986), mouse c-myc (Remmers et al., 1986), rat insulin 1 gene
(Laimins et al., 1986), chicken lysozyme (Baniahmad et al., 1987),
mouse p53 tumor antigen (Bienz-Tadmoor et al., 1985), chicken
ovalbumin (Gaub et al., 1987), and rat o-fetoprotein (Muglia and
Rothman-Denes, 1986). This list includes genes in which the negative
element is situated within an enhancer (mouse /3-interferon) and those
in which it is interspersed between other promoter elements (chicken
lysozyme and rat q-fetoprotein). The most well characterized of these
are the chicken lysozyme and mouse /3-interferon genes in which the
sequences responsible for the negative effect have been identified
(Goodbourn et al., 1986, Baniahmad et al., 1987). The chicken lysozyme
gene is particularly of interest because it contains several possible
negative regulatory sequences located at -0.25, -1.0 and -2.4 kb from
the start of transcription and they are well separated from the
enhancer element identified 7 kb upstream (Theisen et al., 1986).
Additionally, it is interesting that both the chicken lysozyme and the
rat insulin 1 gene negative regulatory elements are contained within
repetitive elements. The chicken lysozyme element is found within the
CR1 repeat, which is a middle repetitive sequence and has limited
homology to the mammalian Alu-type sequences. Additionally, the CR1
repeats near the chicken ovalbumin gene are found in areas where there


is a change in the DNasel sensitivity when the ovalbumin gene is
induced, perhaps indicative of a protein/DNA interaction (Stumph et
al., 1984). The rat insulin 1 element is a member of the family of long
interspersed rat repetitive sequences (LINES) that are present in
about 50,000 copies per cell (Laimins et al., 1986). The fact that
some of the negative regulatory elements identified so far are
associated with middle repetitive sequences has attracted attention.
Some investigators have proposed that the function of this arrangement
may be to coordinate transcriptional domains. The isolation of a domain
by blocking it off with repetitive elements would be consistent with
the structure of eukaryotic chromatin as we understand it today, and
would allow for coordinate control of a gene or set of genes of related
function (Laimins et al., 1986). Negative regulatory elements are
still awaiting the identification of factors that interact with them
and characterization of the protein/DNA and protein/protein
interactions that result in the negative regulation of transcription.
Histone Genes
Histone proteins have been known for a considerable time and their
composition has been the subject of much investigation (reviewed in
Isenberg, 1979). Little was known however about the genes encoding
these acidic proteins until the late 1960s and the 1970s when many
investigators took advantage of the size of the histone messages, and
their relative abundance to investigate the regulation of this set of
genes. The histone genes have many characteristics that make them an


attractive model system for the investigation of regulation. They are
coordinately expressed during S-phase of the cell cycle, and this
expression is the result of both transcriptional and
posttranscriptional processes. Additionally, their small size and basic
structure (no introns, minimal processing) make them an easy system to
manipulate and study (Maxson et al., 1983). If we can understand how
the highly coupled expression of the histone genes is controlled,
perhaps we can then understand how other genes are expressed
coordinately and otherwise.
Historical background. One of the initial observations regarding
histone proteins was that they are present in a relatively invariant
1:1 molar ratio with DNA in the cell (Prescott, 1966). It was further
demonstrated that the amount of histone protein present in a cell
doubled during S-phase of the cell cycle (Bloch et al., 1967). Such
results suggested a possible coupling between these two metabolic
events. Borun et al. (1967) were able to demonstrate that a class of
polyribosomes (7-9S) were selectively enriched during S phase of the
HeLa cell cycle and that they coded for histone-like polypeptides in
vitro, thus giving more credence to the relationship that had been
demonstrated earlier. Borun et al. also noted several properties of
these small mRNAs that have become the foundation of present day
theory about histone mRNA regulation: 1) the addition of cytosine
arabinoside caused a fourfold increase in the "histone" mRNA
destabilization rate as compared to actinomycin D treated cells; 2) the
newly synthesized 7-9S RNA, at the Gl-S boundary, became associated
with polyribosomes thus beginning histone synthesis; and 3) two hours


27
before the end of DNA synthesis in synchronized HeLa cells 7-9S mRNA
transcription ceased and the remaining 7-9S mRNA decayed with
approximately a one hour half life. Borun et al. proposed, somewhat
incorrectly, that the control of histone mRNA levels was through
transcriptional regulation. The refinement of molecular techniques has
allowed later investigators to define the degree to which
transcriptional and posttranscriptional mechanisms regulate histone
mRNA metabolism. Butler and Mueller (1973) repeated and extended the
results of Borun by demonstrating several basic facts. First,
cycloheximide was able to stabilize histone mRNA in the presence of
hydroxyurea, a potent inhibitor of DNA synthesis. When added to
synchronized HeLa Cells, hydroxyurea causes a very rapid
destabilization of almost all histone mRNAs (90%) via the complete
shutdown of DNA synthesis (Baumbach et al., 1984; Heintz et al., 1983;
Sittman et al., 1983). This suggests that a protein(s) is (are)
necessary for the destabilization process to occur. The 10% of histone
message that remains is insensitive to hydroxyurea and probably
represents replication independent histone gene mRNAs (Wells and Kedes,
1985; Wu and Bonner, 1982). Second, transcription is not necessary for
the production of this putative destabilization factor as the addition
of a transcription inhibitor has no effect on the subsequent
destabilization of histone mRNA. Third, Butler and Mueller (1973)
demonstrated a transient increase in the pool of free histone proteins
for 20 minutes after treatment with hydroxyurea. They suggested in
their regulatory model that the free histone proteins might
autogenously regulate the translation of their own message and/or the


28
stability of the remaining message following the cessation of DNA
synthesis. Nearly 15 years later, the idea of autogenous regulation
has gained popularity, since Ross and coworkers (1986, 1987) have so
aptly demonstrated the specific degradation of histone mRNA in vitro.
and the isolation of a nuclease activity that degrades poly A minus
messages from the 3' end.
The histone enriched environment of the sea urchin genome allowed
for their early isolation by equilibrium centrifugation and
subsequently the characterization of the coding and spacer region base
composition (Birnstiel, 1974). The sea urchin genes have been
successfully used as probes for the isolation of histone genes from
several species, including vertebrates such as Xenopus (Moorman et
al., 1980) and mouse (Seiler-Tuyns and Birnstiel, 1981). The higher
vertebrate histone genes were then used to expedite the isolation of
the human histone genes (Clark et al., 1981; Heintz et al., 1981;
Sierra et al., 1982). The replication dependent histone genes, which
comprise the majority of expressed histone genes, are characterized by
a lack of introns and an extremely well conserved 3' end sequence that
consists of an 15 bp stem and loop structure.
Human histone gene organization. The isolation of the human histone
genes, which had previously been so intensively studied, permitted the
proposed regulatory hypotheses to be tested. The organizational
pattern of the human histone genes was uncovered by restriction enzyme
analysis, and Southern blot hybridization (Southern, 1975) of
restricted phage clones demonstrated that, unlike the tandem repeats of
the lower eukaryotes, the human genes were clustered but had no obvious


29
organizational pattern (Sierra et al., 1982; Heintz et al., 1981 and
Clark et al., 1981). Sierra et al. (1982) were able to isolate lambda
Charon 4A phage clones representative of three families or clusters.
Unlike the lower eukaryotic organization, none of these clustered
groups of human histone genes contained a human HI gene. By using a
chicken HI specific probe Carozzi et al. (1984) isolated a clone that
had all 5 human histone genes including an HI histone. Recently,
several human histone genes have been localized to different
chromosomes (Triputti et al., 1986, Green et al., 1986). This
suggests that coordinate control of human histone gene expression might
not be as easily regulated as in lower eukaryotes.
Another question that had not been addressed up to this time was
whether different histone mRNAs were the product of different histone
genes. Lichtler et al. (1982) demonstrated convincingly that seven
species of human H4 histone mRNA were encoded by at least 3 separate
genes, thereby establishing that the human histone genes are a
repetitive family of genes, but not redundant. Lichtler et al. (1982)
also strengthened the possibility that different histone genes might be
subject to diverse regulation since it was obvious that certain H4
mRNAs were present at higher levels than others.
Transcriptional and Posttranscriptional regulation. Our knowledge
about these two steps in the regulation of histone mRNA metabolism has
been strengthened by the studies of Heintz et al. (1983); Sittman et
al. (1983) and Plumb et al. (1983a,b). Plumb et al. (1983b) utilized
HeLa cells synchronized by double thymidine block and hybrid selection
of pulse labelled histone mRNA. This technique permitted several


species of histone mRNA to be isolated on acrylamide gels. These
experiments demonstrated that the histone genes are transcribed in the
early part of S-phase, approximately 2-3 hours post release from double
thymidine block. The increase in the histone mRNA transcription was 3-
5 fold during this period. Baumbach et al. (1987) demonstrated a
similar increase in the level of histone gene transcription at the
beginning of S-phase with nuclear run-on analysis. However, one of the
anomalies of histone gene expression is that if one follows the total
increase in the amount of histone mRNA, the actual elevation is from
10-25 fold (Plumb et al., 1983b; Heintz et al., 1983). The actual
differences in histone mRNA levels have varied from one report to
another and this is probably the result of the various synchronization
and analysis techniques utilized. Conservatively, the level of
transcription increases 3 fold during the first 2-4 hours of S phase,
and the stability of histone mRNA rises 10-20 times during S-phase.
*
Outside of S phase or after the artificial cessation of DNA synthesis
by drug treatment, the half-life of histone mRNA is approximately 10-15
mins. (Sittman et al., 1983; Plumb et al., 1983a).
Nuclease sensitivity and Protein/DNA interaction. Historically, a
hallmark of an active gene has been the presence of nuclease
hypersensitive sites in the promoter region of the gene. Chrysogelos et
al. (1985) and Moreno et al. (1986) have extensively characterized the
nuclease sensitivities of the flanking and coding regions of the F0108
human H4 histone gene. Together, their results demonstrate that the 5'
region of the F0108 H4 gene is a dynamic area of varying sensitivity to
DNase I, micrococcal and SI nuclease. Since the histone genes are cell


31
cycle regulated with respect to transcription and total message levels,
Chrysogelos et al. (1985) were able to correlate the size of the DNase
I hypersensitive site with the stage of the cell cycle. As mentioned
earlier, the appearance of a DNasel hypersensitive site is indicative
of protein/DNA interactions in the region. Pauli et al. (1987)
utilized the technique of genomic sequencing to visualize the in vivo
protein/DNA interactions in the promoter of the F0108 human H4 histone
gene. They demonstrated that there are two binding sites in the
proximal promoter region which have been designated Site I (-122 bp to
-89 bp) and Site II (-64 bp to -23 bp). Site I contains a putative Spl
site and a possible CAAT box. Site II contains the GGTCC element (see
below) and the TATAA box. The protein/DNA complexes at Site I and Site
II are present throughout the cell cycle and presumably these
interactions in the promoter region are involved in the basal and
increased level of transcription demonstrated at the onset of S-phase.
Perhaps the interactions that regulate the level of transcription at
the start of S-phase occur through protein/protein interactions since
there is no apparent change in the protein/DNA interactions during the
cell cycle. In studies done by Heintz and Roeder (1984), it was
demonstrated that the pHuH4 histone gene was transcribed in vitro to a
greater extent in S-phase extracts than in G-phase extracts. It would
be important to know whether there is a new protein that appears at
the onset of S-phase that acts either directly to augment
transcription by interacting with the DNA or through a protein/protein
interaction. Since the identification of protein/DNA interactions in
the promoter of the F0108 H4 gene, it has been of great interest to


us to ascertain if there is any functionality in the interaction and
this is addressed to some extent in this work.
Other histone genes, from a variety of species, have been
characterized with respect to the contribution of 5' flanking sequences
in transcriptional regulation. Notably, the human H2B gene has been
extensively characterized with in vitro transcription by Sive et al.
(1986). They demonstrated that the transcription of the H2B gene is
dependent on a number of sequences 5' to the TATA box including the H2B
octamer element and CCAAT box. Recently, the emphasis has been placed
on identification of the sequences responsible for the periodic
increase in histone gene transcription during the cell cycle.
Artishevsky et al. (1987) have demonstrated, although not convincingly,
that the sequences responsible for the S-phase increase in
transcription of a hamster H3 gene are located in the proximal
promoter region (-150 bp); however they were not explicitly defined.
The authors propose that this region of the hamster H3 gene bears
similarity to the sequence, 5'-GCGAAA-3', that has been shown to
regulate the cell cycle expression of the HO genes of yeast (Nasmyth,
1985). Taken as a whole, these many results support the idea that the
histone genes are controlled at the transcriptional level by promoters
that are composed of many elements that interact with different and
specific proteins. Though not dealt with here, van Wijnen et al.
(1987, 1988) have shown that the promoter region of several cloned
human histone genes can interact with nuclear proteins in a specific
manner.


Sequence analysis. Only a few histone genes have been sequenced
extensively enough to permit a comparative analysis of 5' flanking
sequences. The majority of sequencing information concerning histone
genes has revolved around the coding sequences. Comparative analysis of
these protein sequences has revealed remarkable homogeneity from
species to species, especially with respect to histones H3 and H4
(Wells, 1986). Unfortunately little 5' flanking sequence for H4 histone
genes has been published, and most sequences extend only 80-120
nucleotides upstream (Wells, 1986). A comparison of the F0108A H4
histone gene (Sierra et al., 1983), which my studies have involved,
and the human H4 histone gene independently isolated by Heintz et al.
(1981), suggests that some of the sequences in the 5' proximal promoter
region are conserved--the TATA and GGTCC boxes. The TATA box is, of
course, a canonical RNA polymerase II transcription sequence and the
GGTCC box has been associated with many H4 gene promoters from sea
urchin to human (Hentschel and Birnstiel, 1981, Wells, 1986).
Comparison of the F0108 gene to the mouse H4 gene isolated by Seiler-
Tuyns and Birnstiel (1981) reveals extensive similarity between the
promoters, especially the TATA box, GGTCC element, and the CAAT
sequence that is found as either a single or double copy located just
5' to the GGTCC element in many H4 histone genes (Wells, 1986). The
significance of the H4 "CAAT" sequence is somewhat questionable as it
was originally thought to represent a the "CCAAT" box that is
associated with many RNA polymerase II promoters. There have been
several CCAAT box factors isolated, and all of them require, for good
binding, the sequence 5'-CCAAT-3' (Dorn et al. 1987)-. The H4


histone gene with which we are working, F0108, does have two CCAAT
boxes located several hundred basepairs upstream and the possible
functionality of both the proximal CAAT boxes and the distal CCAAT
boxes is discussed in the work presented here.
The functionality of these and other sequences in the promoter of
histone genes has been one of the focuses of our work. Also, the
Heintz and Roeder laboratory have investigated the functionality of
promoter sequences in the human H4 gene they isolated. In vitro
transcription analysis of Bal 31 deletion mutants of the F0108 H4 gene
by Sierra et al. (1983) demonstrated, in whole cell extracts, that
promoter sequences could be deleted to within 50 bp of the cap site
without loss of transcription. These sequences include only the TATA
box and GGTCC element, but are apparently sufficient for accurate in
vitro transcription to occur. In vitro transcription analysis by Hanly
et al. (1985) demonstrated very similar effects. When only the TATA
box remained as the sole RNA polymerase II consensus element,
transcription was accurate but at a reduced level. Hanly et al.
(1985) have suggested that the sequences extending to -110 bp are
sufficient for maximal transcription of the human H4 histone gene in
vitro.
The analysis of histone gene transcription in vitro has contributed
to our understanding of the minimal requirements for 5' sequence;
however, it has been demonstrated previously that the requirements for
initiation of mRNA synthesis in vitro and in vivo are different in many
instances. One might reasonably assume that the chromatin structure of


an integrated gene would affect its regulation and intrinsic
accessibility to regulatory proteins. We felt it was necessary to
extend these in vitro studies into stable cell lines for the reasons
outlined above and discussed in Materials and Methods (Chapter 2). A
logical extension of many in vitro studies has been to manipulate the
promoter or coding region of a gene in vitro and to replace it in vivo
and hopefully measure the affect of the manipulation on expression.
Perhaps this has been most successfully accomplished in yeast, where
the reintroduction of the manipulated gene can be done with precision
into the exact locus from which it came originally (Szostak et al.,
1983). This is a goal shared by many molecular biologists as it would
be a more accurate way to assess structure/function relationships.
Histone genes have been transiently expressed in a number of
different cell types (Kroeger et al., 1987; Capasso and Heintz, 1985;
Green et al., 1986; Bendig and Hentschel, 1983; Marashi et al., 1986).
The transient assay affords a reasonably quick way to examine the
effects of DNA manipulation. The results have suggested that
heterologous or homologous systems can be used to express transfected
genes. In probably one of the more radical transfection experiments,
Bendig and Hentschel (1983) introduced the embryonic histone gene
repeat of the sea urchin Psammechinus miliaris transiently into HeLa
cells. Correct 5' mRNA start sites were detected for all 5 genes of the
cluster, but the termination of transcription was generally aberrant
with the exception of the H2B gene. This set of results is suggestive
that heterologous systems may share many regulatory components that
allow them to transcribe foreign genes correctly, but- may have--in


36
this case 3' processing--parts of the regulatory machinery that are
incompatible. This particular subject is discussed in the work
presented here. At the point where our work began, the only stable cell
lines created with an integrated human H4 histone gene were by Capasso
and Heintz (1985). They utilized one construct, pHuH4, to assess the
level of H4 histone gene regulation in mouse Ltk" cells. In vivo SI
nuclease analysis of this single construct permitted them to conclude
that mouse cells could accurately transcribe the human H4 gene. Green
et al. (1986) demonstrated that the F0108 human H4 histone gene was
expressed in mouse C127 lung fibroblasts. In these experiments the
F0108 gene was carried episomally on a construct made from the 69%
transforming fragment of Bovine papilloma virus.
With this understanding and background we initiated studies with
the human H4 histone gene F0108 (Sierra et al., 1982) to ascertain the
in vivo functionality of sequences in the 5' promoter region.


CHAPTER 2
MATERIALS AND METHODS
Experimental rationale and commentary. Of particular importance,
for histone and other eukaryotic genes, is the identification of
regulatory sequences and molecules that mediate transcriptional
control. Several laboratories, including our own, have conducted in
vitro and in vivo experiments to assess the functionality of the
histone gene coding region and flanking sequences in the regulation of
expression (van Wijnen et al., 1987; Sierra et al., 1983; Heintz et
al., 1983; Pauli et al., 1987; Dailey et al., 1986; Green et al.,
1986).
We felt that an in vivo approach, via the introduction of modified
genes by transfection, had the advantage that the integrated gene was
packaged as chromatin and presumably transcription factors, such as
RNA polymerase II, CTF, and Spl were present in proper and localized
concentrations due to the structural integrity of the nucleus.
Therefore the results would be a more accurate reflection of the actual
in vivo situation. The results were still cautiously interpreted in the
context of the experimental parameters present, such as copy number.
Some of our experiments have been done in a transient assay system and
the expression of the human H4 gene under these conditions was somewhat
different than when stably integrated. Presumably there were
37


38
differences in chromatin structure and factor to DNA ratios and this
may have been reflected in the results. Previous work has demonstrated
that the human H4 histone gene, with which we have worked, has a
defined chromatin structure that includes an extensive DNasel
hypersensitive site, and that this site fluctuates in size during the
cell cycle, which may be the result of the interaction of
transcriptional control factors (Chrysogelos et al., 1985).
An in vivo experiment with a transfected gene requires an assay and
experimental approach that will allow for the detection of the
introduced gene. Several options were available for us to pursue. The
most commonly used have been 1) the promoter of a gene was linked to a
reporter gene such as chloramphenicol-acetyl-transferase (CAT) (Gorman
et al., 1982), or 2) the whole gene, coding and flanking regions, was
introduced into a heterologous environment (e.g. a human gene into a
mouse cell) (Capasso and Heintz, 1985, Marashi et al., 1986). Several
groups, including our own, have utilized such heterologous systems
because they allow for the easy detection, by SI nuclease analysis, of
the mRNA of interest with little or no background. We decided that it
would be better to leave the H4 promoter attached to the H4 gene and
express these constructs in mouse cells.
The histone constructs we cotransfected with the pSV2neo plasmid
were expressed and detectable with SI nuclease analysis in mouse cells.
We realized that the histone promoter deletion constructs could be
compared to one another and the differences in the steady state level
of histone mRNA from one construct to another were a direct reflection
of transcription. We concluded this because the coding region of all


39
the constructs had remained intact. Messenger RNA turnover was
presumably the same for each construct and any differences in the
steady-state level of histone mRNA were therefore a result of
transcription.
We included a mouse H4 control in each of our SI nuclease assays to
permit the quantitation of the total amount of mRNA and particularly
the amount of histone mRNA. In retrospect, this has helped us to
understand more about the interaction of transcription factors with the
H4 histone genes and in some cases has been an adequate internal
control. Because of the competition phenomenon we uncovered (described
in Chapter 4) the mouse H4 became a less than perfect internal control.
Originally we tried to incorporate the mouse 18S ribosomal RNA gene
into our SI nuclease assay but were unable to find adequate
hybridization conditions for both histone and-ribosomal probes. Ideally
another mouse histone gene in conjunction with the mouse H4 should have
been used.
Materials and general laboratory procedures. All chemicals were of
the highest quality available. Phenol was redistilled and stored frozen
with the addition of 0.1 % (w/v) 8-hydroxyquinoline at -20C. The
frozen phenol was equilibrated first with 100 mM Tris-HCl (pH 8.0) and
subsequently with 10 mM Tris-HCl and 1 mM EDTA (pH 8.0) until the pH
was between 6.0 and 7.0. Phenol/Chloroform extraction refers to the
addition of one volume of equilibrated phenol and one volume of
Chloroform/isoamyl alcohol (24:1) to a solution, mixing, and
separation of the phases by a brief centrifugation step. Next, at least
one volume of chloroform/isoamyl alcohol is added and the above


40
centrifugation step repeated. Hereafter precipitation refers to the
addition of 2-3 volumes of 95% ethanol, l/10th volume 3M Sodium Acetate .
(pH 5.0), to a solution of DNA or RNA. This was subsequently placed at
-20 or -70C for a sufficient time to allow precipitation of the
O O
nucleic acids. Radioactively labelled nucleotides, [7- P]ATP ( 600
Ci/mmol) and [a-^^P]dCTP (- 3000 Ci/mmol), were purchased from Amersham
and ICN. X-ray film, Cronex and XAR-5, were obtained from Dupont and
Eastman Kodak respectively. For all experiments that involved RNA the
solutions were pretreated with 0.01% diethylpyrocarbonate (DEPC) and
glassware was treated with 0.1% DEPC. After a 30 min. treatment the
solutions and glassware were autoclaved for thirty minutes to remove
any traces of DEPC.
Plasmid growth and preparation. L-broth (Maniatis et al., 1982) was
prepared by mixing lOg/1 Bacto tryptone (Difco), 5 g/1 yeast extract
(Difco) 5 g/1 NaCl.and 2 ml/1 1M NaOH in 1 L of dd^O (double
distilled water). The medium was then autoclaved for 30 min. in order
to sterilize it. Ten milliliter starter cultures of bacteria were
prepared in sterile conical tubes and grown overnight at 37C. These
were supplemented with sterile 20% glucose (100 /xl) 1M MgS04 (10 /l) ,
and 50 ng/ml ampicillin (Sigma). Small inocula were removed from
glycerol stocks or colonies were picked from plates and placed in the
starter culture overnight. Large scale (500 ml) preparations were then
completed with 5 ml 20% glucose, 0.5 ml MgS04 and 50 pg/ml ampicillin.
Cultures were grown at 37C until they reached an optical density
(595nm) of 0.4 to 0.5. At this point 4.25 ml of 20 mg/ml
chloramphenicol were added and the cultures were allowed to grow for an


41
additional 16-18 hrs. If the bacteria contained a pUC plasmid or
derivative, the amplification step was omitted. The cells were
harvested and the plasmid DNA was prepared essentially as described by
Maniatis et al. (1982). The pellet was resuspended in 10 ml of
Solution 1 (50 mM glucose, 25 mM Tris-HCl pH 8.0, 10 mM EDTA, and 5
mg/ml lysozyme (Cooper Biomedical)) and incubated at room temperature
for 5 min. Next, 20 ml of Solution 2 (0.2 N NaOH, 1% SDS) was added and
the cells were placed on ice for 10 min. Fifteen ml of Solution 3 (5M
KAc, pH 4.8) was added and incubated on ice for 10 min. The cells were
then centrifuged at 10k rpm for 20 min., 4C. The supernatants from all
tubes were pooled and precipitated with 0.6 volume of isopropanol for
15 min. at room temperature. The precipitate was recovered by
centrifugation at 10k rpm for 30 min. The pellet was dried and
resuspended in 8 ml of 10 mM Tris-HCl pH 8.0, 1 mM EDTA (TE). Eight
grams of CsCl and 640 /I of 10 mg/ml ethidium bromide were added and
the preparation was centrifuged for 36 hrs at 45k rpm in Beckman heat
sealed tubes in a Beckman Ti50 rotor. The DNA band was visualized by
ultraviolet illumination and recovered by side puncture with a 20
gauge hypodermic needle. The DNA was then either placed over a small
Dowex AG 50W-X8 column or butanol extracted 5X to remove the ethidium
bromide. The sample was then dialyzed extensively against TE. The DNA
was recovered by ethanol precipitation and subsequent centrifugation.
Quantitation of the yield was done spectrophotometrically (Beckman) at
260 nm.
Plasmid preparation with TB. The method is similar to that outlined
above for L-Broth except that the TB medium was used. TB was prepared


as described by Tartof and Hobbs (1987). Bacto tryptone (6.65 gr.),
13.3 gr. of yeast extract, and 2.2 ml of glycerol were prepared in 450
ml of ddH20. The medium was sterilized in the autoclave for 30 min. To
the sterile solution was added 55.5 ml of sterile 0.17M KH2PO4, 0.72M
K2HPO4. This medium was inoculated and bacteria were grown as above.
Because the medium is very rich, the yields were often large so
bacteria that contained pBR322 plasmids were not induced with
chloramphenicol. The DNA was prepared by the same method except that
the original volume of cells was split into two aliquots at the
beginning of the isolation procedure. This was found to be essential
and greatly facilitated lysis and subsequent isolation of the plasmid
DNA. For comparative purposes, 500 ml of TB can produce 4-5 mg of
total plasmid DNA in comparison to 1 mg with L-Broth with
amplification.
Production of unidirectional deletions with Exonuclease III. This
method was carried out essentially as described by Stratagene (San
Diego, CA) from which the reagents were purchased. The method takes
advantage of the fact that Exonuclease III cannot digest 3' single
strand overhangs. For our purposes the pF0005 insert was cloned into
the Pstl/Hindlll sites of Bluescript M13+. The Hindlll site is adjacent
to an Apal site in the vector. To produce the deletions in which we
were interested, the pF0005 Bluescript clone was digested with Hindlll
(5' overhang) and Apal (3' overhang) to completion. We then mixed three
/jg of digested DNA, 25 /il of 2X Exonuclease III buffer (100 mM Tris-HCl
pH 8.0, 10 mM MgCl2, 20 pg/ml tRNA), 5 /il of freshly prepared 200 mM 2-
mercaptoethanol, 30 units of Exonuclease III, and enough dd^O to make


43
the final volume 50 pi. The reaction conditions were established
through a series of titration experiments to determine the extent of
deletion with time. After the addition of the enzyme (added last) 10 pi
aliquots were removed every minute for 5 min., diluted with 80 pi IX
Mung Bean nuclease buffer (5X = 150 mM NaOAc, pH 5.0, 250 mM NaCl, 5
mM ZnCl2, 25% glycerol) and heated to 68C for 15 min. Once the
deletion reactions had been stopped 9 units of Mung Bean nuclease in
dilution buffer (IX = 10 mM NaOAc, pH 5.0, 0.1 mM ZnOAc, 1 mM cysteine,
0.001% Triton X-100, 50% glycerol) were added and the reaction allowed
to proceed at 30C for 30 min. The reaction was stopped by the addition
of 100 pi of phenol/chloroform and extracted. The aqueous layer was
removed and precipitated with 10 pi of 3 M NaOAc pH 7.0 and 2.5 volumes
of 95% ethanol. The DNA was recovered by centrifugation, ligated and
transfected as described below. This procedure worked very poorly and
resulted in very few positive clones. The deletions that were obtained
were characterized by run-off transcription from the T3 promoter of
each clone. The DNA was digested with Ncol and transcription reactions
carried out exactly as described by Stratagene. The transcripts were
electrophoresed on a 6% acrylamide, 8.3M urea gel and the extent of
deletion determined by comparison to run-off transcription from the
parental construct pF0005BS.
DNA Fragment Elution. After restriction enzyme digestion DNA
fragments were usually electrophoresed in low percentage agarose gels
(0.7 to 1.0%) with IX TBE (10X = 500 mM Tris-HCl pH 8.3, 500 mM boric
acid, 10 mM EDTA) and visualized by long wave ultraviolet illumination
of the ethidium bromide stained band (2 pg/ml for 15 min.). The band of


44
interest was excised from the gel. The Fragment Eluter (IBI) was first
run for 30 min. with low salt buffer (20mM Tris-HCl, pH 8.0; 5 mM NaCl;
and 0.2 mM EDTA) at 125 volts. The gel fragment was then placed in the
well and the V-channel filled with 100 ti of high salt buffer (3M
NaOAc, 5% glycerol, 0.01% Bromophenol Blue). It was important that the
gel slice remain in the same orientation as it had been run previously
to facilitate the removal of the band. The band was electroeluted at
150 V for 15-20 min. after which the high salt buffer was carefully
removed in 100 1 aliquots. A total of 4, 100 ti aliquots were removed
from each channel. Five micrograms of glycogen (Boehringer-Mannheim)
were added and the sample was precipitated with 1 ml of 95% ethanol at
-70C for 30 min. The DNA fragment was then recovered by centrifugation
at 10k rpm for 30 min. Fragments isolated in this manner were found to
be directly suitable for ligation reactions or probe preparation.
DNA ligation. The ligation of DNA fragments was done with T4 DNA
ligase (New England Biolabs) and essentially as described by King and
Blakesley (1986). DNA fragments were digested with the appropriate
enzymes dictated by the cloning scheme and fragments and vectors were
mixed in 10 1 of IX ligation buffer (5X = 250 mM Tris-HCl pH 7.6, 50
mM MgCl2, 25% (w/v) polyethylene glycol 8000 (Eastman Kodak), 5 mM ATP,
5 mM dithiothreitol). Usually the vector (a pUC plasmid) was treated
with phosphatase prior to the reaction and therefore the vector to
insert ratio was 3:1. Blunt end ligations were carried out with less
than 20 g/ml of total DNA. Sticky ligations were done at 20-40 tg/ml
and diluted after 4 hrs at room temperature. Generally 10-20 units of
ligase were added for sticky end ligations and 200-40-0 units for blunt


end ligations. After 4 hours the reactions were diluted 1:2 with IX
ligase buffer and an additional aliquot of ligase added to the
reaction. The reactions were then incubated overnight at 14C (sticky
end) and 4C (blunt end). The reactions were diluted 1:2 with TE and
transfected into DH5 bacteria as described by the methods of Bethesda
Research Laboratories, and Hanahan (1983).
Preparation of competent bacterial cells for transformation.
Bacteria, either DH5 or HB101, were grown in 100 ml of Luria broth to
an OD590 = 0.375. The cells were divided between two sterile 50 ml
conical tubes and placed on ice for 10 min. All subsequent procedures
were carried out at 4C. The cells were then harvested by
centrifugation for 5 min. at 5k rpm. The supernatant was removed and
the cells gently resuspended in 10 ml of CaCl2 buffer (60 mM CaCl2, 10
mM PIPES pH 7.0, 15% glycerol). The cells were then centrifuged for 5
min. at 5k rpm and gently resuspended again in CaCl2 buffer. They were
then placed on ice for 30 min. and centrifuged at 2.5k rpm for 5 min.
The cells were resuspended in 2 ml each of CaCl2 buffer and dispensed
into 200 pi aliquots and frozen at -70C until needed.
Transformation of bacteria with plasmid DNA. Competent bacterial
cells, either DH5 or HB101, were thawed on ice and 5-10 pi of the
ligation were added and incubated with the cells for 30 min. on ice.
The DH5 cells were heat shocked at 42C, and the HB101 cells at 37C.
The cells were briefly placed on ice and then diluted with 900 pi of
room temperature S.O.C. (2% Bactotryptone, 0.5% yeast extract, 10 mM
NaCl, 2.5 mM KC1, 10 mM MgCl2, 10 mM MgSO^). The cells were incubated
at 37C for 1 hour and then plated on TYN (1% Tryptone, 1% yeast


extract, 0.5% NaCl) medium with ampicillin. If detection of insertion
of a DNA fragment was possible (DH5 cells and pUC plasmids) then 30 /1
of 2% X-gal (5-bromo-4-chloro-3-indolyl-/3-D-galactoside) and 20 /I of
100 mM IPTG (Isopropyl-/3-D-thiogalactopyranoside) were included with
the bacteria spread on the plate. Resistant colonies grew up overnight
and white colonies, indicative of a disrupted lac Z gene, were picked
for further analysis.
Rapid plasmid preparation. The method is essentially as described
by Ish-Horowicz and Burke (1981) with some modifications. One
milliliter of saturated overnight culture, grown in TYN or L-broth,
was centrifuged for 20 sec. in an Eppendorf microfuge. The solutions
for preparation of DNA were the same as for the large scale preparation
described above. The cells were resuspended in 100 /il Solution 1 and
incubated for 5 min. at room temperature. Solution 2 (200 /il) was
added and incubated on ice for 5 min. Solution 3 (150 /il) was added
and incubated on ice for 5 min. The cells were then centrifuged for 5
min. and the supernatant extracted with phenol/chloroform. The
supernatant was then precipitated with 2 volumes of 95% ethanol at room
temperature. DNA was then suitable for restriction enzyme digestion and
agarose gel analysis.
Growth and preparation of cell lines. C127 cells were utilized in
all transfections and were grown in 10 cm tissue culture dishes as
monolayer cultures. The medium used in all experiments was Dulbecco's
modified essential medium (Gibco) supplemented with 5% calf serum
(Gibco), 5% horse serum (Gibco), 2 mM L-glutamine, and 100 U/ml
penicillin, 100 ug/ml streptomycin. To initiate a cell line (histone


47
plasmid and pSV2neo) or transient (histone plasmid only) transfection
the cells were refed with 10 ml of medium 2-4 hours before application
of the DNA precipitate. Stable cell lines were initiated by the
cotransfection of the histone plasmid and pSV2neo in a 10:1 ratio. This
was done essentially as described by Graham and van der Eb (1973) and
Gorman et al. (1982). Plasmid DNA, usually 10 /g/construct, was
diluted to 450 /I with 1 mM Tris-HCl pH 7.9, 0.1 mM EDTA. This was then
mixed with 50 il of 2.5 M CaCl2- The DNA solution was then added
dropwise to 500 /xl of 2X Hepes Buffered Saline (280 mM NaCl, 50 mM
HEPES, 1.5 mM Na2P04, pH 7.12 + 0.05) in a sterile 15 ml conical tube
while the tube was vortexed. The precipitates were allowed to stand for
20 min. and were grey and cloudy in appearance. A poor precipitate was
obvious as settling out occurred during the 20 min. incubation. The DNA
precipitates were added to the plates dropwise under sterile conditions
with gentle swirling. After 4 hours the medium was removed and the
cells were shocked for 1-2 min with 15% glycerol in medium. This was
removed, the cells washed with 10 ml of incomplete medium and refed
with 20 ml of complete medium. For transient transfections the cells
were incubated for 24-48 hours and then harvested (80-90% confluency)
as described below.
Cell lines were initiated by growing the cells to confluency,
approximately 2-3 days. At this point the cells were split 1:5 into
five plates and the medium was supplemented with 500 /g/ml of Geneticin
(G418, Gibco). The aminoglycoside phosphotransferase 3'(II) gene
carried on the pSV2neo plasmid confers resistance to this antibiotic
and therefore permits cell growth if present. Cells were refed with


48
medium + G418 every 3-4 days until resistant colonies were apparent
and most of the other cells had died. This usually took approximately
2-3 weeks. All the colonies on an individual plate were pooled and
subsequently passaged in drug-free medium--these were referred to as
polyclonal cell lines. The clone name for a cell line contains several
designations. For example: pF0003pl, the pFO designates this construct
as originally derived from the AHHG 41 clone isolated by Sierra et al.
(1982), 003 describes the deletion construct, and pi refers to
polyclone number 1. When an "m" is used instead of a "p" this indicates
a monoclonal cell line. To produce monoclonal cell lines, 12
individual colonies, 2-3 from each plate, were picked with a cotton
plugged sterile pasteur pipette and grown in 24 well cell plates
(Corning). After these cells had expanded they were grown in 6 and 10
cm dishes as described above.
Cell lines and C127 cells were frozen down periodically in medium
supplemented with 20% foetal calf serum (Gibco) and 10% glycerol. Cells
were washed off the plate in Puck's Saline + 0.02% EDTA, centrifuged at
1500 rpm for 2 min, resuspended in freezing medium in Nunc Cryotubes,
and placed at -70C.
Southern blot analysis. This method has been used to determine the
copy number of the individual monoclonal cell lines and the status of
the integrated constructs with respect to flanking sequences and mode
of integration. In general, DNAs from individual monoclonal cell lines
were digested to completion with restriction enzymes in the buffer
recommended by the supplier. The restriction enzyme reactions were
stopped by the addition of 1/10 volume of running dye- (IX TBE, 50%


49
glycerol, 0.2% sodium dodecyl sulfate, 0.01% bromophenol blue, and
0.01% xylene cyanol) and heated to 65C for 15 min. The DNA was then
loaded onto 1% agarose gels and run 16-18 hours at 70 V. Gels were
stained in ddH20 with 5 ug/ml ethidium bromide. Next, the gels were
soaked in 25 mM HC1 for 10 min. to cause strand breaks that permit
better transfer and then transferred to Zetabind nylon membranes (AMF-
Cuno) as described by Southern (1975) except that the transfer buffer
was 0.4 M NaOH (methodology kindly provided by Dr. Harry Ostrer,
University of Florida, Department of Pediatric Genetics). Transfer was
complete in 20-24 hrs. The filters were gently washed in 2X SSC (20X
SSC 3M NaCl, 0.3M Sodium Citrate, pH 7.0) 3 times for 15 min. each.
The filters were briefly air dried and then washed in 0.1X SSC, 0.5%
SDS for 1 hr at 65 C. At this point filters were stored at 4"C in
plastic Seal-a-meal bags. Blots were prehybridized in 5X SSPE (15X SSPE
= 2.69 M NaCl, 150 mM NaH2P04, 15 mM EDTA, pH 7.7), 0.1% SDS, and 1.0%
non-fat dry milk (Carnation) at 67-68C for 4-6 hrs. Hybridizations
were performed in the above solution with the addition of either
denatured nick-translated or oligolabelled probe. For blots probed with
histone H4 sequences 1-2 x 10^ cpm/ml of probe were used in the
hybridization. For mouse 18S ribosomal RNA hybridizations, 1-2 x 10"*
cpm/ml of the pUC974 insert probe were utilized. The specific activity
ft
of all probes was at least 1 x 10 cpm/ug. The length of hybridization
was from 18 20 hrs at 67-68C. Filters were washed 3 times at room
temperature with agitation in 5 mM NaP04 pH 7.0, 2 mM EDTA, and 0.2 %
SDS. Each wash was 30 min in length. After a brief drying period the
filters were sealed in plastic bags (to prevent dehydration and


facilitate the subsequent removal of probe fragments) and exposed to
preflashed XAR-5 film (Kodak) at -70C.
50
Preparation of DNA from monoclonal and polyclonal cell lines. The
medium from each plate was removed and 2 ml of Puck's saline (Gibco)
with 0.02% EDTA were added. The cells were physically removed from the
plate by scraping with a rubber spatula and placed in a sterile 15 ml
Corex tube. The cells were pelleted by centrifugation at 1500 rpm for
2 min. at 4C in an IEC-International centrifuge. At this point the
supernatant was removed and the cells were snap frozen on dry ice.
Frozen pellets were quickly resuspended in 1 ml of 0.1X SSC, 1.0% SDS,
and 200 /g/ml proteinase K (Sigma Chemical Company) and incubated for 4
hrs to overnight at 37C. This mixture was then extracted 2 times and
precipitated with 2 volumes of 95% ethanol at -20C overnight. The
precipitated nucleic acids were recovered by centrifugation at 10K rpm
for 10 min. at 4C. The pellet was dried briefly and resuspended in 1
ml of TE and RNaseA (Sigma) was added to a final concentration of 50
/jg/ml. Digestion proceeded for 1 hr at 37C and was stopped by the
addition of SDS to 0.5% and phenol/chloroform extraction. DNA was then
precipitated with 2 volumes of 95% ethanol, centrifuged at 10K for 10
min, and the pellet resuspended in 500 /I of TE and stored at 4C.
Copy number analysis. Approximately 30 ug of genomic DNA from an
individual cell line were diluted to 50 1 with TE. Digestions were
carried out in EcoRI buffer (Boehringer-Mannheim) with the following
regime: 1 unit/ug of EcoRI and Xbal were added and incubated at 37C
for 4-8 hrs, at which point an additional 1 unit/ug was added and the
digestion proceeded overnight (16-18 hrs). The DNA was quantitated by


51
diluting 5 p 1 of the digestion into 1 ml of TE and determining the
O260- The completion of digestion was determined by gel
electrophoresis of a small aliquot of the digestion on a 1% agarose
minigel (Bio-Rad). Ten micrograms of digested DNA were electrophoresed
and blotted as above (Southern Blotting). The probes used for the copy
number determination were either the EcoRI/Xbal fragment from pF0002
(for the human H4 histone genes) or the BamHI/Sall fragment from p974
(mouse 18S ribosomal gene for quantitation). The probes were labelled
by either nick-translation or oligolabelling (see below). The copy
number quantitation of the human H4 histone gene was done by
densitometric scanning of multiple autoradiograms. The exact amount of
DNA in each lane was determined by reprobing the Southern blots with
the mouse 18S ribosomal gene. This gene served as an internal control
for variations in the actual amount of DNA loaded and any loss during
the process. The copy number of the mouse 18S ribosomal gene should be
invariant and all densitometric values for the human H4 histone genes
were corrected to account for the actual amount of DNA in the lane
based on the internal control.
Labelling of DNA fragments using Klenow fragment. This was done as
described by Maniatis et al. (1982). Two hundred nanograms of plasmid
or A phage DNA were digested to completion with the restriction enzymes
of choice. One to two microcuries of [a-^^P]dCTP were added with 0.5
units of the large fragment of E. coli DNA polymerase I (Klenow
fragment, BRL). The reaction was incubated for 10 min. at room
temperature. Then 2 pi of 0.2M EDTA, 100 pi of 0.3M sodium acetate,
and 20 pg of yeast tRNA were added to stop the reaction. The labelled


DNA fragments were recovered by precipitation with 95% ethanol at -
70C. The DNA was recovered by centrifugation and resuspended in 100 /I
of TE.
Nick translation and oligolabelling. Both of these methods were
utilized for the production of DNA hybridization probes. Nick
translation was done as described by Rigby et al. (1977). For the copy
number experiments the EcoRI/Xbal fragment of pF0002 was isolated with
the IBI fragment eluter and 250 ng were used in the reaction. A 25 /I
reaction was composed of 2.5 ¡il of 10X buffer (500 mM Tris-HCl pH 7.5,
50 mM MgCl2, 1 mg/ml bovine serum albumin (BSA, Sigma Fraction V)),
2.5 /j.1 of 10X nucleotides (330 tM each of dATP, dGTP, dTTP), 40-80 /Ci
of a-^P-dCTP, 2.5 units of E. coli DNA polymerase I (BRL) 1 /tl of a 1
x 10'^ dilution of DNasel (stored in 10 mM HC1 at 1 mg/ml) activated at
1:100 for 1-2 hours on ice in 10 mM Tris-HCl pH 7.5, 5 mM MgCl2, 1
mg/ml BSA. The reaction was begun with the final addition of the DNasel
and incubated at 14C for 45 min. The reaction was stopped by dilution
with TE and the probe purified over a pipette (10 mm x 100 mm, Fisher)
column of Biogel Al.5m in TE. The sample was applied to the column in a
200 /I aliquot and 200 /I fractions were collected. The labelled DNA
usually came off in fractions 6-10. These were pooled and quantitated
in the scintillation counter. The specific activity of these probes was
always greater than 1 x 10^ cpm/ug. Oligo-labelling was done as
described by Feinberg and Vogelstein (1983) The DNA fragment (100 to
200 ng) was added to a 1.5 ml Eppendorf tube and ddH20 added to make
the final volume after addition of the other components either 12.5 nl
or 25 /j1. This tube was then heated to 95-100C for two minutes and


53
placed on ice. To this denatured DNA fragment was added 10 /I of 2X
oligolabelling buffer (2X = 500 mM Hepes pH 6.6, 50 /xM each of dATP,
dGTP, dTTP; 125 mM Tris-HCl pH 8.0, 25 mM 2-mercaptoethanol, 0.55 mg/ml
mixed bexanucleotides (Pharmacia)). We added 25-50 /xCi of [a-^P]dCTP
and 2.5 units of Klenow fragment (BRL). The reaction was allowed to
proceed for 2 hours to overnight and purified as described above for
the nick translation reaction. Specific activity of these probes
O
usually exceeded 2-4 x 10 cpm//xg.
Preparation of total cellular RNA. Because of the sensitivity of
histone mRNA to degradation following the cessation of DNA synthesis,
it was important that the initial steps of this protocol be carried out
as quickly as possible.
The medium from 2-4 plates was removed and 1 ml of cold Puck's
saline (Gibco) + 0.02% EDTA was added and the cells were immediately
scraped from the dish and transferred to a sterile, DEPC treated, corex
tube. The cells were pelleted in the clinical centrifuge at a setting
of five for 2 min., the supernatant was removed and the cells were
frozen on dry ice and subsequently stored at -20C for no more than a
few days. Degradation can occur quickly and therefore it was necessary
to prepare the RNA as soon after harvesting as possible. The cell
pellet was resuspended in 1 ml of 2mM Tris HC1 pH 7.4, 1 mM EDTA, and
10 xg/ml polyvinylsulfate (PVS, Eastman Kodak). SDS (10%) was added to
a final concentration of 1% and proteinase K added to 200 /xg/ml.
Incubation was at 37C for 30 min. at which point 5M NaCl was added to
a final concentration of 500 mM and the incubation continued for an
additional 15 min. The total nucleic acids were extracted with 2


volumes of phenol/chloroform, 2 times, and with 3 volumes of
chloroform 1 time. The total nucleic acid was then precipitated by the
addition of 60 /il of 3M NaAc and 2.5 vols of 95% ethanol (-20C
overnight). The nucleic acids were recovered by centrifugation at 10K
rpm for 15 min. at 4C. The pellet was resuspended in 500 n1 of 10 mM
Tris HC1 (pH 7.4), 2 mM CaCl2, and 10 mM MgCl2 with the addition of 25
¡il of proteinase K treated DNase I (see below for preparation) and
digested at 37C until it was completely suspended (this usually
required from 30 min. to 1 hr., intermittent vortexing helped to
disrupt the pellet). When the pellet was no longer visible, SDS and
NaCl were added to a final concentration of 0.5% and 250 mM,
respectively. The solution was extracted 2 times with phenol/chloroform
and 1 time with chloroform, and precipitated with 3 vols of 95% ethanol
overnight. RNA was either stored in water at -70C or in ethanol at -
20C. Ethanol suspensions needed to be vigorously mixed to avoid
quantitation problems with the RNA aliquots. RNA stored in water was
also mixed before removal.
Preparation of RNase free DNasel. Deoxyribonuclease I (Sigma)(1
mg/ml in 20 mM Tris-HCl pH 7.4, 10 mM CaCl2) was preincubated at 37C
for 20 min. and then further incubated for 2 hrs. at 37 C in the
presence of 0.1 volumes of proteinase K (1 mg/ml in 20 mM Tris-HCl pH
7.4, 10 mM CaCl2) to digest any contaminating ribonuclease activity as
described by Tullis and Rubin (1980) This preparation was stable on
ice for several hours to overnight.
SI nuclease protection assay. This method is essentially as
described by Berk and Sharp (1977) with modifications-. In order to


detect the human histone H4 mRNAs 25 pg of total cellular RNA from a
C127 cell line containing an integrated human H4 histone gene construct
were added to a DEPC treated 1.5 ml Eppendorf tube. Sufficient human
and mouse probe, labelled with [y-^pjATP, was added to provide an
excess (5 to 10 ng) of protected fragment in the reaction. Probe excess
was either determined by titration of the probes with a stock C127 or
HeLa RNA sample or by addition of twice the amount of probe to some
reactions. One twentieth volume of 5M NaCl and 3 volumes of 95% ethanol
were added and the solution was placed on dry ice for 15-30 min. The
precipitated RNA and probes were recovered by centrifugation at 10K
rpm for 15 min. at 4C. The pellet was briefly dried in a Savant Speed
Vac (1-2 min.). Four microliters of 5X hybridization buffer (2M NaCl,
0,2 M Pipes pH 6.4, and 5 mM EDTA) were added followed by 16 pi of
recrystallized formamide (Specialty Biochemicals). The buffer was added
first to the pellet to facilitate rehydration. The final volume, 20 pi,
was vortexed vigorously to resuspend the precipitated RNA and probe.
The tubes were placed at 90C for 10 min. and then transferred
immediately to a 55C water bath and incubated for 12-18 hrs
(overnight). Each tube was removed individually from the water bath and
the reaction diluted immediately with 8 volumes of ice-cold SI
digestion buffer (280 mM NaCl, 50 mM NaOAc, pH 4.5, and 5 mM ZnS04) and
placed briefly on ice. SI nuclease (Boehringer-Mannheim) was added to a
final concentration of 3 units/pl and digestion was then done at 24-
26C for one hour and at 4C for 15 min. (the tubes were placed on
ice). Ten microliters each of 10% SDS and 5M NH4OH were added and the
reaction was extracted and precipitated with 3 volumes of 95% ethanol.


56
The length of precipitation was from 3-12 hours at -20C. (The
precipitations should not be done at -70C as this will cause the
formation of formamide crystals). The precipitated probe fragment was
recovered by centrifugation at 10K rpm for 30 min. The pellet was
briefly dried and resuspended in 2-4 ¡J.Y of loading buffer (80%
formamide, IX TBE, 0.01% Bromophenol Blue, and 0.01% Xylene Cyanol).
Samples were denatured at 100C for 3 min. and placed immediately on
dry ice until loaded. Samples were electrophoresed on a 6%
polyacrylamide, 8,3 H urea gel at a 50W constant power for 3-4 hours
(the acrylamide to bisacrylamide ratio was 20:1). Gels were dried and
exposed to preflashed XAR-5 film (Kodak) at -70C with Dupont Cronex
Lightning Plus Screens.
DNA sequencing. All sequencing reactions were carried out exactly
as described by Maxam and Gilbert (1980) and so will not be detailed
here. For each fragment that was sequenced the G (Dimethyl Sulfate,
(DMS)); G+A (Formic acid); C+T (Hydrazine); C only (Hydrazine in high
salt); and A>C (1.2 N NaOH) reactions were done. Single end labelled
fragments were prepared as follows: plasmid DNAs were digested with an
appropriate restriction endonuclease, treated with phosphatase, and
labelled as described below. After the DNA was labelled it was digested
with a second restriction enzyme to produce two single end labelled
fragments. To purify the fragment of interest for analysis we
electrophoresed the DNA on a native 4% acrylamide gel. The location of
each labelled DNA band on the gel was determined by exposure to Cronex
(Dupont) X-ray film. After alignment of the film and the gel we excised
the bands of interest and eluted them in 500 /iL of 500 mM ammonium


acetate, 10 mM MgCl2, 0.5% SDS, overnight at 37C as described by
Maxara and Gilbert (1980) The acrylamide gel slice was ground with a
siliconized glass rod in a 1.5 ml Eppendorf tube prior to addition of
the elution buffer. After the overnight incubation the acrylamide was
centrifuged to the bottom of the tube at 10K rpm for 5 min. The
supernatant was removed and the pellet resuspended in 200-400 /j.1 of
elution buffer, centrifuged, and the supernatant removed. This
procedure routinely resulted in recoveries of 80-90% of the labelled
DNA fragment. The pooled supernatants were then precipitated twice in
succession with 3M Sodium Acetate and 95% ethanol. These fragments were
then used in the sequencing reactions noted above. After the reactions
were carried out and the DNA was cleaved with piperidine and
lyophilized, it was electrophoresed (50W constant power) on a 6%
acrylamide, 8.3M urea gel (45 cm x 30cm x 0.5mm). The samples were
resuspended in 6 il of SI loading buffer and divided into two, 3 /I
aliquots. These were boiled for 3 min. and placed on dry ice. To
maximize the amount of the sequence we could read, two loadings of the
reactions were done. The first 3 1 sample of each reaction was loaded
and electrophoresed for 5-6 hours or until the Bromophenol Blue reached
the bottom of the gel. The second sample was then loaded and
electrophoresed for an additional 5-6 hours. The gel was then dried and
exposed to either Cronex or XAR-5 film at room temperature overnight.
SI nuclease analysis probe preparation. Two probes were routinely
used to quantitate the amount of human and mouse histone H4 mRNA
present in cell line samples. The human probe was prepared by digestion
of 50-100 g of pF0005 or pF0002 with Ncol. This digestion was then


58
extracted, precipitated, and the DNA recovered by centrifugation at
10k rpm for 15 min. The pelleted DNA was resuspended in 50 /iL of 50 mM
Tris-HCl pH 8.0, 0.1 mM EDTA, 1 unit of calf intestinal phosphatase
(CIP) was added and the mixture was incubated at 37C for 30 min. An
additional aliquot of enzyme was added and the DNA incubated for 30
min. The reaction was stopped by the addition of EGTA (ethyleneglycol-
bis-(/3-aminoethyl ether)-N,N,N',N',-tetraacetic acid) to 10 mM and
heated to 65C for 20 min. The DNA was then extracted and precipitated.
The DNA was resuspended in 10 /J.L of y-^P-ATP (100 /Ci) and 1 /iL of 10X
Kinase buffer (500 mM Tris-HCl pH 7.6, 100 mM MgCl2, 100 mM 2-
mercaptoethanol). After resuspension, 15 units of T4 polynucleotide
kinase (United States Biochemical Corporation) were added and the
reaction incubated at 37C for 45 min. The reaction was stopped by
extraction followed by precipitation. The DNA was recovered,
resuspended and digested with Hindlll to produce a probe fragment
labelled at the Ncol site in the human H4 gene. The reaction was was
electrophoresed on a 1.0% agarose gel in IX TBE and the 695 bp
Ncol/Hindlll fragment, labelled at the Ncol site purified with the IBI
fragment eluter as described by IBI. The mouse H4 probe was produced in
a similar manner from the plasmid pBR-mus-hi-l-H4-HinfI (Seiler-Tuyns
and Birnstiel, 1981) digested with BstNI. The labelled 1000 bp BstNI
fragment was isolated and used as a control in each SI nuclease
protection assay. Although this probe was not single end labelled, we
had no ambiguities because of this fact. To make the probe shorter and
single end labelled would have possibly obscured the protected fragment
of the human H4 gene (280 nt). Both the human and mouse H4 SI nuclease


59
probes were quantitated on agarose gels stained with ethidium bromide
and exposed to Cronex X-ray film to judge the relative strength of
each. Generally a large amount of probe (several micrograms) was
prepared simultaneously and SI nuclease analysis was done on many
samples to ensure that the expression was measured with the same
strength probe in each case. Variation in the mouse and human probe
specific activity did occur; however, the data presented in this work
were prepared primarily from a large set of SI nuclease assays in
which many cell lines were assayed side by side with the same mouse and
human probe preparation. When additional cell lines were subsequently
measured, samples assayed previously were included to ensure that the
results could be related to results from previous assays.
Densitometry and data analysis. Densitometry of autoradiograms
was done to quantitate the SI nuclease analysis experiments of H4 gene
expression and the copy number of the cell lines. Several films of
different length exposure were utilized to determine the intensity of
the SI protected fragment signal. Two densitometers were used, a Zeineh
laser densitometer and an LKB-Pharmacia high intensity laser
densitometer. Comparison of the capabilities of each densitometer
demonstrated that for most films either one was adequate; however for
particularly low intensity signals the LKB machine gave more
reproducible results. The data collected by both densitometers were
computer processed with either the Videophoresis II (Zeineh, Biomed
Instruments) or the GelScan XL programs (LKB-Pharmacia). Each program
was successfully used to analyze the intensity of radioactive signals
for expression and copy number. The areas under the curve for the SI


60
nuclease analysis (mouse and human) and the copy number blots (H4 and
18S ribosomal) were integrated and expressed as an amount of absorbance
units. To calculate the expression of a particular construct, the human
expression value was divided by the mouse value and expressed as a
ratio. Sample calculations for copy number are presented in Appendix A
and for SI nuclease analysis in Appendix B.
Agarose and acrylamide gel electrophoresis. Agarose (Bio-Rad
molecular biology grade) gels were prepared as described by Maniatis et
al. (1982). The buffer was IX TBE and the buffer in the reservoir was
also IX TBE. 20 x 25 cm gels were used for large scale fragment
purification and Southern blot analysis of cell line DNAs. Minigels
were used for checking the extent of digestion and analysis of rapid
and other plasmid preparations. Acrylamide gels were routinely run for
Si nuclease analysis and consisted of 6% acrylamide (20:1 acrylamide to
bis acrylamide), 8.3 M urea, and IX TBE. The gel solution (75 ml) was
polymerized with the addition of 750 /j1 of 10% ammonium persulfate and
20 fil of N,N,N',N',-tetra methylethylenediamine. It was immediately
poured, the comb put into place and allowed to harden for 1 hour.
Before use the wells were rinsed with buffer and the gel was
preelectrophoresed for 30 min. at 50W constant power. The samples were
loaded and electrophoresed at 50W constant power.
Genomic sequencing. This technique was done as described by Church
and Gilbert (1984). Monoclonal cell lines pF0003ml, 5, and 6 were grown
in 15 cm plates (10 per construct). Seven of the 10 were treated with
0.5% DMS in 2-3 mis of medium for 1-2 minutes. Three were left
untreated, the DNA purified, and treated with DMS in vitro as a


61
control. The DMS was removed from the plate and the cells washed twice
in phosphate buffered saline (PBS = 150 mM NaPO/,., 150 NaCl, pH 7.2, 60
mM Tris-HCl, pH 7.4). The DMS treated cells were scraped from the plate
and the DNA purified by incubation with proteinase K as described above
and extraction. To purify high molecular weight DNA only, 95% ethanol
was slowly added to the tube while swirling the solution with a
siliconized glass rod. The DNA was washed off the rod with TE and
quantitated spectrophotometrically. The purified DNA (30 fig) was
restricted with Hie II, treated with piperidine and lyophilized as
described by the sequencing protocol of Maxam and Gilbert (1980). The
samples were then separated in a 6% acrylamide gel, with 8 M urea and
electrotransferred to a nylon membrane (Genescreen). The hybridization
probe was prepared as described by Pauli et al. (1987) with primer
extension of a fragment cloned into M13. In our experiments
hybridization was performed with the Hie II 5' upper strand probe at
65C for 16 hrs, followed by eight 5 min. washes at 65C (1 mM EDTA, 40
mM NaHP04, pH 7.2, 1% SDS). The membrane was then exposed to preflashed
XAR-5 film at -70 C. In these experiments I was responsible for the
growth of the cells and Dr. Urs Pauli performed the rest of the
experiment, with my constant encouragement, and occasional
intervention.
Statistical analysis. The analysis of the SI nuclease and copy
number data that we accumulated was suggested by Dr. Mike Conlon of the
University of Florida Biostatistics Unit. After he had examined the
data and gained an understanding of the complexities involved, he
advised that we employ a ranking test, the Wilcoxon Rank Sum Test. This


62
test makes the null assumption that two groups of data that are
compared came from the same random distribution. The members of each
group are assigned a rank (i.e. 1, 2, 3, ...) from highest to lowest
in both groups. For example if we had two sets of data, A = 1, 2, 4,
6, and 12 and B = 10, 14, 16, 19, and 25, the members of group A and B
would be ranked in order of increasing value. The absolute values of
the data are ignored and only the rank is examined.
Group A:(l, 2, 4, 6, 12) is converted to Ranks =1, 2, 3, 4, 6.
Group B:(10, 14, 16, 16, 25) is converted to Ranks =5, 7, 8, 9, 10.
We have 5 members in each group with only one point of overlap
between the two groups at ranks 5 and 6. The Rank Sum for group A = 17
and for group B = 39. To determine if the difference of the Rank sums
is significant, statistical tables of probability for this test were
employed. These two groups of data are not significantly different at
p < 0.05. The reason is the small sample size. With only five members
in each group the fact that one of the members of each group falls into
the range of the other group precludes any significance. As the groups
become larger the overlap allowed for significance becomes greater. I
have found with some of my data that larger sample sizes would have
been necessary to employ this test in all cases.


CHAPTER 3
HISTONE H4 5' REGULATORY SEQUENCES
It has been established that the steady state level of histone mRNA
during the cell cycle is a function of both transcription and message
stability. These two components of histone mRNA metabolism have been
studied in a number of different ways. Earlier studies by Plumb et al.
(1983a, b) utilized pulsed incorporation of ^H-uridine to determine the
contribution of transcription to the increase in histone mRNA levels
during the S-phase of the cell cycle. Later, Baumbach et al. (1987)
used nuclear run-on transcription to measure transcription of the
histone genes directly during the cell cycle. The increase in
transcription during early S-phase was determined to be 3-5 fold by
both Baumbach et al. (1987) and Plumb et al. (1983b). In the studies
of Baumbach et al. (1987), message stability was eliminated as a
variable in the experiments, and therefore they were able to determine
that histone gene transcription occurred throughout the cell cycle at a
basal level. Instead of an "on/off" mechanism for transcriptional
control an "enhancement" was apparent during the first 4 hours of S-
phase. The 3-5 fold enhancement in the histone gene transcription
level has been duplicated in various systems and by different methods
during the last 5 years (Sittman et al., 1983; Heintz et al., 1983;
Artishevsky et al., 1987).
63


64
The implications are that protein/DNA or protein/protein
interactions occur that stimulate the increased level of
transcription. Evidence for specific protein/DNA interactions has been
gathered by Artishevsky et al. (1987). They demonstrated, at the end
of G1 and the beginning of S phase, the presence of a factor that
interacted with the proximal promoter region of the hamster H3
promoter. The F0108 H4 gene, with which my work has been done, also
demonstrates protein/DNA interactions in the proximal promoter region
(Pauli et al., 1987, van Wijnen et al., 1987); however, there are no
detectable changes in these interactions during the cell cycle. Since
it has been demonstrated that transcription of the F0108 H4 histone
gene proceeds throughout the cell cycle at a basal level, it was of
interest to discover what sequences are necessary for basal and
enhanced expression. The promoter of the F0108 H4 histone gene is
potentially extensive and so deletions that encompass the entire 6.5 kb
of possible promoter sequence were prepared and analyzed. In the
proximal region of the promoter we were interested to understand the
functionality of elements such as the TATAA box, GGTCC element, Spl
binding site, and putative CAAT boxes. More distal elements have also
been examined and these included possible enhancer and negative
regulatory element located thousands of base pairs upstream.
As mentioned in the introduction, the differences encountered in in
vivo and in vitro transcription systems have sometimes been
considerable. In order to ascertain the functional in vivo promoter
sequences of the F0108 human H4 histone gene, we constructed a series
of mouse C127 cell lines each containing a different H4 promoter


Figure 3-1
Schematic diagram of some of the human H4 histone gene
deletion constructs.
At the top of the figure is the original AHHG41 phage clone isolated by
Sierra et al. (1982). The five Bal 31 deletions of pF0108A are noted
(Sierra et al., 1983). The distance from the end of the histone promoter
sequence to the cap site is indicated to the right of each construct.
F0001, F0006, F0004, and F0004R are fusions of the proximal promoter
region and coding sequences to distal fragments and the dotted line
indicates the extent of the deletion that occurred between the two
fragments. The scale at the bottom is 2 kb on the AHHG41 schematic and 1
kb on all others. The pertinent restriction enzyme sites are denoted
EcoRI, E; BamHl, B; HindIII, H; Xbal, X; Ncol, N. The most commonly
used SI nuclease probe is designated at the bottom of the figure
labelled at the Ncol site.


X HHG41
H3
H PX
111
H H
H4e|e| BB
4S3 ll 11.1-1-
E X
l L.
P X
L L.
H 4
E HEH B
l 1 1 I L.
. E
-6.5 kb
scale


67
deletion construct. As described in the prologue to the Materials and
Methods section, we decided that this was the best way to proceed. We
hoped that stable integration into the chromosome would give the most
accurate information about the function of H4 promoter sequences.
Cell line construction
The first step in these experiments was to construct the cell
lines. The mouse C127 cell line was chosen because it was a
heterologous host and had been previously used to support the stable
expression of the F0108 human H4 gene in an episomal form (Green et
al., 1986). Many of the histone H4 plasmid DNA constructs were
available already (Figure 3-1), although as the work progressed several
more were prepared to answer various questions that arose. The
constructs are all products of subclones of the original A human
histone gene clone 41 (AHHG41) isolated by Sierra et al. (1982) and
this is diagramed at the top of Figure 3-1. The proximal deletion
constructs J67, J56, J50, K8, and L14 (Figure 3-1) were all available
and had been made by Bal31 deletion of pF0108A (Sierra et al., 1983).
The precise determination of each deletion point will be outlined later
in the chapter. A subclone of pF0108, pF0108A, prepared by Sierra et
al. (1983) deleted some 3' sequences including an Alu repeat. Plasmid
pF0005 was made by A. van Wijnen from a Hindlll digestion of pF0002.
Plasmid pF0002 was prepared from a BamHl, PstI digest of AHHG41 to
obtain a fragment with 1065 bp of 5' flanking sequence. Plasmid pF0003
was prepared from an Xbal digest of AHHG41 and has 6.5 kb of 5'
flanking sequence. Additional clones will be described as they pertain


to subjects under discussion later in the chapter--positive and
negative regulatory elements.
Initiation of Transcription and Basal Regulation
The initiation of transcription by RNA polymerase II and the
sequences required for it have been studied in considerable detail in a
number of genes, as outlined in the introduction (Reviewed in Shenk,
1981). The importance of the TATA box has been established in vitro
and in vivo. and it is thought to be primarily responsible for the
specification of the transcription initiation site. We constructed
cell lines with several of the short proximal deletion constructs in
order to ascertain what sequences in the F0108 H4 histone gene were
necessary for the initiation of transcription. The general protocol
for DNA transfection and the subsequent selection and expansion process
is outlined in Figure 3-2. The constructs were cotransfected into C127
cells with the plasmid pSV2neo. The inclusion of the pSV2neo plasmid
permitted selection for expression with the antibiotic Geneticin
(G418). Once resistant cells were present as distinct colonies the
plates were either pooled and passaged (polyclones) or picked and
expanded as monoclonal cell lines. The specific method is described in
the Materials and Methods section I
To determine the level of transcription from each of the proximal
deletion constructs, we analyzed cell lines early in passage. The
results from SI nuclease analysis of total cellular RNA from polyclonal
cell lines 108A, L14, K8, J50, J56, and J67 is presented in Figure 3-3.
RNA was prepared from each cell line as described and hybridized to two
probes, human and mouse, at 55C for 8-16 hours as described in


Figure 3-2 Flow diagram for the production of both polyclonal and
monoclonal mouse cell lines that contain stable
integrated human histone H4 genes.
The method relies on the cotransfection of the histone plasmid with a
selectable marker, pSV2neo. This plasmid carries the gene that confers
resistance to a derivative of neomycin. The cotransfection procedure
permitted the pSV2neo plasmid to be taken up with the histone plasmid
into the mouse C127 cells. These stable cell lines were utilized to
study human H4 gene, expression. The specific protocol is outlined in
materials and methods.


10:1
C1?7 (40%)
cells
4 hr
glycerol shock
J 2 days
split 1:5 G418
/ \
polyclones monoclones
2-3wks
I
pool -G418 pick
i 24well
passage
j 1-2wks
expand
passage


71
Figure 3-3 SI nuclease analysis of proximal deletion polyclonal
cell lines.
SI nuclease analysis was done as described in Materials and Methods and
quantitated by densitometry. Lanes: the cell line name is denoted above
the lane. For example polyclonal cell line pF0108A number 1 is denoted
as 108Apl; C, C127 total cellular RNA and H, HeLa total cellular RNA
incubated with both human and mouse SI probes as a positive control for
the size of the mouse and human SI protected fragments, respectively;
M, pBR322 Hpall marker labelled with a-^P-dCTP and Klenow fragment.
Both human (280 nt) and mouse (110 nt) protected fragments are noted at
the right.


Materials and Methods. The mouse H4 histone probe was included as an
internal control in each SI nuclease assay not only for the intactness
of the RNA preparation, but also as an indicator of the amount of
histone mRNA present in the sample. The half-life of a histone mRNA
after the cessation of DNA synthesis is very short (Plumb et al.,
1983a, Sittman et al., 1983), and therefore the growth conditions of
the cells and temperature at the time of harvested are critical for the
adequate recovery of histone mRNA.
We particularly wanted to determine if there was a minimal amount
of promoter that could initiate transcription in vivo and if this was
different than that seen in vitro. Previously the shortest Bal31
deletion, J67, had been shown to initiate mRNA synthesis accurately in
vitro in a whole cell extract (Sierra et al., 1983). As shown in figure
3-3, the construct J67, which we later learned has only the TATA box
and the GGTCC element, produced no correctly initiated transcripts.
The only transcription products detectable from the J67 construct were
inititated upstream of the normal mRNA start site. These are denoted
with arrows in Figure 3-3, and occur in the cell lines with J50, J56,
and J67 integrated. The upstream transcription start sites map
primarily to the TATA box (-30 bp) and the deletion end points. The
"deletion end point transcripts" originate from outside of the histone
flanking sequences either in the plasmid or surrounding chromosomal DNA
and are detected by virtue of the lack of homology between the probe
and the mRNA past the deletion point.
The possibility that J67 was unable to express correctly initiated
H4 mRNA was based on a single polyclonal cell line. To assure
ourselves that this was not a result of a spurious integration event we


73
o g o
1 234 567 89 10 HM
Figure 3-4 Southern blot analysis of polyclonal cell lines:
Intactness of 5' flanking regions and copy number of the
constructs in each cell line.
Genomic DNA purified from each cell line was digested with EcoRl and
Xbal, electrophoresed, blotted, probed, and quantitated as described in
Materials and Methods. Lanes: 1, pF0108Apl, 2, pF0108Ap2, 3, L14p2, 4,
L14p3, 5, K8pl, 6, K8p2, 7, J50pl, 8, J56pl (passage 4), 9, J56pl
(passage 8), 10, J67pla. Histone plasmid markers (EcoRI/Xbal digested
pF0002) were included on the blot equal to 1.3 (10 pg), 6.5 (50 pg),
and 13 (100 pg) gene equivalents per diploid genome in order to
quantitate the human histone H4 copy number. H, HeLa DNA digested with
EcoRl and Xbal as a positive control for the 1070 bp fragment. M, A DNA
digested with EcoRl and Hindlll and Klenow labelled. Pertinent sizes
are denoted to the right in kilobases. The probe for this experiment
was the EcoRI/Xbal fragment of pF0002 that had been nick-translated as
described in Materials and Methods.


determined the intactness of the flanking and coding sequences for each
of the constructs J67, J56, J50, K8, L14 and 108A in Figure 3-4. This
experiment also permitted us to determine the copy number of each cell
line. Ten micrograms of genomic DNA from each cell line was digested
to completion with EcoRl and Xbal and electrophoresed on a 1% agarose
gel, blotted and probed as described in Materials and Methods. In
order to quantitate the copy number of each cell line the gel also
contained plasmid DNAs of known amounts digested with both EcoRl and
Xbal. Ten, 50 and 100 pg correspond to 1.3, 6.5 and 13 gene
equivalents per diploid genome respectively as designated in Figure 3-
4. Several exposures of the autoradiogram were scanned with a Zeineh
laser densitometer and quantitated in comparison to the controls.
Additionally, the Southern blot in Figure 3-4 was quantitated for the
actual amount of DNA by densitometrically scanning a photographic
negative of the gel prior to transfer, and differences in DNA amounts
have been taken into account in the copy number calculation. Later,
copy number blots for other constructs were reprobed with a clone of
the mouse 18S ribosomal gene kindly provided by the Dr. David
Schlessinger (Washington Univ., St Louis) to allow exact determination
of the amount of DNA loaded in each lane and subsequently transferred.
A sample copy number calculation in which the ribosomal probe was
utilized is presented in Appendix A.
The Southern blot analysis demonstrated not only the copy number of
each cell line, but permitted us to conclude that the flanking region
of most constructs was intact. The mode of integration for the histone
plasmids is described further in chapter 4.


Table 3-1
Quantitation of Polyclonal Cell Line Expression.
Cell Line
Human/Mouse Exp
Codv number
Exd/Copv number
108Apl
0.016
1
0.016
108Ap2
0.040
13
0.003
L14p2
0.018
1
0.018
L14p3
0.017
4
0.004
K8pl
0.028
3
0.009
K8p2
0.029
2
0.014
J50pl
0.034
1
0.034
J56pl
0.019
50
0.0004
A quantitative summary of the expression data from the polyclonal cell
lines of the proximal deletion constructs. The human/mouse expression
ratio was determined by densitometry of the SI nuclease protected
fragments in Figure 3-3. Copy number for each cell line was determined
from the Southern blot in Figure 3-4. Since these data were derived
from polyclonal cell lines it is not possible to interpret the results
strictly, and we would like to note that copy number in a polyclonal
cell line is somewhat ambiguous. Expression is denoted as Exp.


76
The results of the SI nuclease analysis and copy number
determination are presented in Table 3-1. The SI nuclease assay was
similarly quantitated with the densitometer and the results are
expressed as a ratio of the mouse and human signals. The results,
although of a few individual cell lines, have been repeated several
times. The SI nuclease analysis results from the proximal deletion
polyclones suggested that J67 (-47bp) was unable to correctly initiate
histone mRNA transcription. Only when the promoter was extended in J56
(-73 bp) was correct initiation observed (Figure 3-3). It can be seen
from the data in Table 3-1 that the expression per copy of the J56
construct (-73 bp) is quite low in vivo (expression/copy = 0.0004), and
as noted later this may be somewhat a reflection of the copy number and
not the amount of 5' sequence present in the construct. When the
flanking sequences are extended to -100 bp in the construct J50 there
is an apparent 80 fold increase in the expression/copy ratio (0.034).
The expression/copy ratio of the remaining deletion constructs
stabilizes at a value of 0.02 to 0.01 with increased length of 5'
sequence. This 25-50 fold increase is probably exaggerated because of
copy number differences between J56 and the longer constructs. This
phenomenon (expression versus copy number) will be discussed later in
the chapter. Still it is likely that the difference in the
expression/copy ratio is 10 fold. These data are supported by the
results of Ken Wright in our laboratory, who has utilized in vitro
transcription to define the functionality of proximal promoter elements
and demonstrated that in nuclear extracts the transcription of J50


*108A *L14
AGCCCGGTTGGGATCTGAATTCTCCCGGGGACCGTTGCGTAGGCGTTAAAAAAAAAAAAG
-200
TCGGGCCAACCCTAGACTTAAGAGGGCCCCTGGCAACGCATCCGCAATTTTTTTTTTTTC
*K8
AGTGAGAGGGACCTGAGCAGAGTGGAGGAGGAGGGAGAGGAAAACAGAAAAGAAATGACG
-150
TCACTCTCCCTGGACTCGTCTCACCTCCTCCTCCCTCTCCTTTTGTCTTTTCTTTACTGC
*J50 *J56
AAATGTCGAGAGGGCGGGGACAATTGAGAACGCTTCCCGCCGGCGCGCTTTCGGTTTTCA
-100 ....
TTTACAGCTCTCCCGCCCCTGTTAACTCTTGCGAAGGGCGGCCGCGCGAAAGCCAAAAGT
*J67
ATCTGGTCCGATACTCTTGTATATCAGGGGAAGACGGTGCTCGCCTTGACAGAAGCTGTC
-50 +1
TAGACCAGGCTATGAGAACATATAGTCCCCTTCTGCCACGAGCGGAACTGTCTTCGACAG
TATCGGGCTCCAGCGGTCATGTCCGGCAGAGGAAAGGGCGGAAAAGGCTTAGGCAAAGGG
+50
ATAGCCCGAGGTCGCCAGTACAGGCCGTCTCCTTTCCCGCCTTTTCCGAATCCGTTTCCC
Figure 3-5 Schematic diagram of the proximal human histone H4
Bal31 deletion mutants: Sequence analysis of the
deletion points.
Each construct was sequenced according to the protocol of Maxam and
Gilbert (1980) and as described in Materials and Methods. The deletion
point of each construct is denoted with an asterisk over the last
nucleotide included in the sequence of that construct. For reference
the ATG codon, TATA box, GGTCC element, CAAT boxes and Spl site have
been underlined. The two bolded regions of the promoter correspond to
Site I and Site II, the DNAsel protected regions of protein/DNA
interaction as defined by Pauli et al. (1987).


(-100 bp) is several fold higher than J56 (-73 bp) ( Ken Wright,
personal communication).
Previously, the deletion points of the Bal 31 deletions had been
determined by restriction enzyme analysis and electrophoresis on high
percentage agarose gels (Sierra et al., 1983). To determine exactly
the deletion point, each construct was sequenced by the method of Maxam
and Gilbert (1980). Ken Wright and I collaborated in this effort and
the approach we undertook is described in Materials and Methods.
Importantly, the strategy permitted us to sequence across the deletion
point in each construct and to determine the exact end of Bal31
digestion. The deletion points we determined are denoted in Figure 3-
5.
When we examined the sequence of the J67 (-47bp) deletion, it was
obvious that the GGTCC element and TATA box were still present and the
proximal CAAT box (-53 bp) was absent. Our SI nuclease analysis
suggested that this was not sufficient promoter sequence for correct in
vivo transcription initiation. To ensure that this was indeed the
case, we prepared 5 additional polyclonal cell lines of J67 and
demonstrated that they all contained integrated constructs (Figure 3-
6b,c); however, none expressed a correctly initiated histone H4 mRNA
(Figure 3-6a). The absence of a detectable SI protected fragment in
the J67 polyclonal cell lines was repeated several times. Upstream
initiation of transcription was sometimes detectable although this was
not consistent. The importance these results became apparent when
Drs. Urs Pauli and Susan Chrysogelos of our laboratory demonstrated the
binding of proteins to the proximal promoter region of this H4 gene in


Figure 3-6 SI nuclease and Southern Blot analysis of J67 polyclonal
cell lines for correct human H4 expression and copy
number.
Additional J67 polyclonal cell lines were made to confirm that this
construct was unable to initiate human H4 mRNA transcription correctly.
A. SI nuclease analysis of 25 /g total cellular RNA from 5 new J67
polyclonal lines and the one tested previously, J67pla. Also shown are
polyclonal lines 108Ap4 and 108Xp2. H, HeLa total cellular RNA. C,
C127 total cellular RNA. M, pBR322 Hpall markers. The human H4 SI
protected fragment (280 nt) is noted with an arrow at the left. There
was no detectable human H4 signal in any of the J67 lanes even upon
repetition and long exposure. B. Southern blot analysis of J67
polyclonal cell line for copy number determination. J67 polyclones 1-5
and pF0108Aml2 are shown. The position of 1070 bp is noted and the
arrow indicates the size of the deletion EcoRI/Xbal fragment from J67.
Plasmid DNAs in the amount of 10, 50, and 100 pg were included for copy
number quantitation as described in Fig 3-4. H, HeLa cell DNA digested
with EcoRI and Xbal; C, C127 cell DNA digested with EcoRI and Xbal. C.
The blot in B was reprobed with the 18S mouse ribosomal fragment for
quantitation of the amount of DNA in each lane. The size of the 18S
band, 1.3 kb, is noted at the right. Quantitation was done as described
in Materials and Methods and Appendix A.


* I
ro
f ti tilth /
#
if * mt
if i i
Hlf

I N i mif
Ut
* \ \ W M V
>
a
108Am12
10
50
100
O


vivo (Pauli et al., 1987). The specific areas of protein/DNA
interaction as defined by DNase I protection are outlined in Figure 3-5
with the construct deletion end points. Interestingly, the J67
deletion point is located in the middle of Site II and leaves the
proximal portion with the GGTCC element and TATA box intact. It would
appear that the absence of Site I and the presence of only half of Site
II are insufficient for transcription initiation in vivo. However,
when all of Site II is present in the of construct J56 a low but
detectable level of transcription is present (Figure 3-3 and Table 3-
1). The large increase in the expression/copy ratio of the J50 (-100
bp) construct is apparently the result of remarkable similarity to the
Spl (Dynan and Tjian, 1983b) binding site as described by Briggs et al.
(1985) and Evans et al. (1988). Although we have not proven that the
protein/DNA interaction at this site is the result of Spl, it seems a
strong possibility that it could be Spl or a similar protein. J50 also
includes a putative CAAT box, however the functionality of this
sequence is in question because it lacks the necessary homology to the
consensus sequence. Additionally, this CAAT box is not entirely
included in the protein binding domain of Site I as described by Pauli
et al. (1987) and it is therefore unlikely that it functions in the
same capacity. It should be mentioned that Spl has been shown to
interact with CTF in the HSVtk promoter (Jones et al., 1985), and
possible interaction in the histone promoter should not be ruled out
immediately, however it is unlikely. The CAAT sequence is well
conserved evolutionarily in conjunction with the GGTCC element (Wells,


82
1986) and our results suggest that the removal of this element in the
distal half of Site II prevents correct transcription initiation.
We investigated the whether any diatl promoter elements had an
effect on the transcription of the F0108 human H4 histone gene.
Polyclonal cell lines were prepared from constructs pF0005 (-417 bp),
pF0004 (-6.0 to -7.5 kb), pF0002 (-1065 bp), and pF0003 (-6.5 kb). The
results of the SI nuclease analysis and limited copy number analysis on
these cell lines suggested that upstream sequences beyond those already
examined might contribute to an increased level of expression (data not
shown). Upon reflection, it is likely that in most cases, the
increased level of expression we noted was the result of high copy
number, and not necessarily because of a strong promoter sequence such
as an enhancer. These results, although limited at the time, prompted
us to examine in a more rigorous way the distal 5' promoter sequences
of the F0108 H4 histone gene for possible regulatory areas that control
expression.
Transfection of the constructs pF0005 (-417 bp), pF0002 (-1065 bp),
and pF0003 (-6.5kb) into mouse C127 cells was done to assess any distal
contributions to the expression level of this H4 gene. As stated
previously enhancer and silencer/negative regulatory elements can be
located at considerable distances from the promoter of a gene and still
accentuate or depress expression of the linked gene (Maniatis et al.,
1987, Theisen et al., 1986, Baniahmad et al., 1987). The new cell
lines were grown primarily as monoclones, and for continuity with the
previous studies, monoclonal cell lines of pF0108A and K8 were also
prepared.


I will state now that we have found that there is a competition
between the transfected human H4 histone genes and the endogenous mouse
H4 gene for regulatory factors and this is discussed later and in
chapter 4. The interpretation of expression from each construct is
affected by this competition phenomenon, and becomes rather confusing.
We bring this up here only to make the reader aware that this situation
exists, and the results have been interpreted several ways, sometimes
with this taken into account. It has been extremely difficult to
understand the relationship that exists between the endogenous mouse H4
genes and the transfected human H4 genes. We have analyzed the
expression/copy data carefully to decipher any trends. The results of
this analysis are also reviewed in chapter 4. The choice of the mouse
H4 as an internal control for the SI nuclease analysis was both
fortunate and detrimental to our interpretation. In short, the entire
expression analysis is presented here, but because of the realization
later in the course of this work about copy number and competition for
transcription factors, only some of the data will be incorporated into
the final synopsis.
The monoclonal cell lines were analyzed for the level of expression
and copy number present. The SI nuclease analysis of the pF0003
monoclonal cell lines is presented in Figure 3-7 and was done as
described in Materials and Methods. Almost all of the monoclones were
positive for expression of the human H4 histone gene with the exception
of pF0003ml8. We utilized several exposures to determine,
densitometrically, the level of expression from each cell line. The
expression data are presented as a ratio of the human and mouse


84
Figure 3-7 SI nuclease analysis of pF0003 monoclonal cell lines.
SI nuclease assays were performed as described in Materials and
Methods. Almost all 15 clones shown here are positive for expression
of the human H4 gene. The exception is pF0003ml8. H, HeLa total
cellular RNA. C, C127 total cellular RNA. M, pBR322 digested with Hpall
and labelled with a-^P-dCTP and Klenow fragment. Dilutions of the
marker are noted as 1:4, 1:8, 1:16 and 1:32 for densitometry purposes.
The human (280 nt) and mouse (110 nt) protected fragments are denoted
with labels and arrows at the left. The clone numbers appear above the
individual lanes to which they correspond.


Figure 3-8 Southern blot analysis of pF0003 monoclonal cell lines.
Southern blot analysis was performed as described in Materials and
Methods. 10 fig of DNA from each cell line were analyzed with nick
translated EcoRI/Xbal fragment from pF0002. A. pF0003 cell line DNA
probed with H4 sequences. B. The histone probe was removed and the blot
was reprobed with the mouse 18S ribosomal fragment. Densitometry of the
1070 bp band specified by the arrow in A and the 18S ribosomal band in
B permitted quantitation of the copy number through normalization to
the amount of DNA actually loaded and transferred as described in the
Materials and Methods. The figure in A is a composite of several
exposures that reflects the actual copy number and accounts for
original quantitation errors. The plasmid controls for quantitation are
labelled 10, 50 and 100 designating the number of pg loaded. C, C127
cellular DNA. H, HeLa cellular DNA. M, X DNA digested with EcoRI and
Hind III and labelled with a-^P-dCTP and Klenow fragment. The number
of each clone is designated above the lane.


86
A.
nn?
B.
0.9


87
Figure 3-9 Si nuclease analysis of pF0108A and pF0002 monoclonal
cell lines.
SI nuclease assays were performed as described in and Materials and
Methods. The left panel is representative of results obtained from
F0108A cell lines; the right panel with total cellular RNA from pF0002
cell lines. The human and mouse protected fragments are designated with
labels and arrows. The markers, M, are pBR322 digested with Hpall and
important sizes are noted. The number above each lane corresponds to
the clone number of that construct. The markers were diluted Ml:4 and
Ml:8 for densitometry quantitation purposes. H, HeLa total cellular
RNA. C, C127 total cellular RNA.


Figure 3-10 Copy number analysis of pF0002 and pFOl08A monoclonal
cell lines.
Southern blot analysis was performed as described in Materials and
Methods. 10 /g of DNA from each cell line were analyzed with nick
translated EcoRI/Xbal fragment from pF0002. A. pF0108A and pF0002 cell
line DNA probed with H4 sequences. B. The histone probe was removed and
the blot was reprobed with the mouse 18S ribosomal fragment.
Densitometry of the 1070 bp band specified by the arrow in A and the
18S ribosomal band in B permitted quantitation of the copy number
through normalization to the amount of DNA actually loaded and
transferred as described in the Materials and Methods. The figure in A
is a composite of several exposures that reflects the actual copy
number and accounts for original quantitation errors. The plasmid
controls for quantitation are labelled 10, 50 and 100 designating the
number of pg loaded. C, C127 cellular DNA. H, HeLa cellular DNA. M,
A DNA digested with EcoRI and Hind III and labelled with a-^P-dCTP and
Klenow fragment. Each set of clones is designated with the black bar
and the number of the individual clones is above the lane.


89
A.
002 108A
M 2 3 781 2 5 7 8 9 10 14CH 2S2m
B.
002<^ ^^108^^^^^
23781 25789 10 14 CH


90
densitometry signals in Table 3-2 (p. 103). The average expression of
nine pF0003 monoclonal cell lines, for which copy number was later
determined, was 2.29 2.43.
It was obvious that these results varied, so the copy number of
each cell line was determined from the southern blots in Figufe 3-8a,b.
The Southern blots of pF0003 monoclonal cell line genomic DNA, digested
with EcoRI and Xbal, were prepared as detailed earlier and in Materials
and Methods. The hybridization probe was the 1070 bp EcoRI/Xbal
fragment isolated from pF0002 and nick-translated. The actual copy
number of each cell line was determined by densitometric analysis of
the 1070 bp EcoRI/Xbal band with normalization for the amount of DNA
actually loaded. The amount of DNA in each lane was determined by
removal of the histone probe at 80C in 0.1XSSC and subsequent
hybridization with the oligo-labelled BamHI/Sall fragment of the mouse
18S ribosomal gene. Densitometry of the 18S ribosomal band (Figure 3-
8b) permitted normalization of the histone H4 copy numbers and
comparison to the plasmid controls for copy number (see Appendix A for
sample calculation of copy number).
The copy number data helps to explain some of the variation seen
with the original expression determination for each cell line. When
pF0003 copy number is taken into account for the expression data in
Table 3-2, the expression/copy ratio for all of the cell lines is
lowered and the average expression/copy is 0.094 0.091. It is
apparent from the data in Table 3-2 that as copy number increases, the
expression/copy increases until approximately 20-40 copies are present,
after which it declines. The pF0003M15 cell line is perhaps lower than


91
expected with respect to expression because of an unusual or
deleterious integration site. The threshold of expression at 20-40
copies indicated that a limited number of human histone genes could be
integrated and expressed in any one cell. This phenomenon has been
investigated further and is discussed later in light of genomic
sequencing data presented in Chapter 4. Overall the pF0003 monoclonal
cell lines had higher expression levels than other cell lines (compare
*v
expression values with others in Table 3-2) but the expression/copy
was similar. Since copy number was implicated in the level of
expression, we also calculated the average copy number of each group of
monoclonal cell lines and this is presented in Table 3-2. The level of
expression, as we have determined it here (Table 3-2), is a direct
reflection of the copy number.
The results of the SI analysis of the pF0108A and pF0002 monoclonal
cell lines are presented in Figure 3-9. Both cell lines expressed at a
relatively low level and the numerical data are presented in Table 3-2.
The average level of expression/copy for pF0108A is .079 .061 and for
pF0002 is 0.045 0.053. The data collected for the pF0108A monoclones
were previously divided into two groups. Originally, there was a
construct, designated J40, that after sequencing of the deletion points
was found to be identical to pF0108A. Therefore, these data were
incorporated into the 108A data base. It is interesting to note that
pF0108A and J40 were thought to have different lengths of 5' sequence
and yet their expression was shown to be almost identical. This
separation of the original observations lends a measure of confidence
to the analysis process that has been used in these studies.


Full Text
UNIVERSITY OF FLORIDA



PAGE 1

$1$/<6,6 2) 7+( 6(48(1&(6 5(48,5(' )25 75$16&5,37,21$/ 5(*8/$7,21 2) $ +80$1 + +,6721( *(1( ,1 9,92 %\ 3$8/ ('021' .52(*(5 $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

$&.12:/('*(0(176 ZRXOG OLNH WR WKDQN -DQHW DQG *DU\ 6WHLQ IRU WKH RSSRUWXQLW\ WR ZRUN LQ WKHLU ODERUDWRU\ DQG H[SORUH PROHFXODU ELRORJ\ IURP D JUHDW PDQ\ SHUVSHFWLYHV DOVR DSSUHFLDWH WKH DGYLFH DQG HQFRXUDJHPHQW RI P\ RWKHU FRPPLWWHH PHPEHUV 'UV 2VWUHU +DXVZLUWK DQG 0R\HU 7KH 6WHLQnV ODERUDWRU\ KDV EHHQ ILOOHG ZLWK PDQ\ FKDUDFWHUV RYHU WKHVH ODVW VL[ \HDUV DQG RZH WKDQNV WR DOO RI WKHP ZRXOG OLNH WR WKDQN )DUKDG 0DUDVKL 0DUN 3OXPE DQG /LQGD *UHHQ HVSHFLDOO\ /LQGDf IRU WKHLU WHFKQLFDO H[SHUWLVH DQG IULHQGVKLS 0\ IHOORZ JUDGXDWH VWXGHQWV *HUDUG =DPEHWWL 'DYH &ROODUW $QGU YDQ :LMQHQ DQG $QQD 5DPVH\ WKDQN IRU WKHLU FRPUDGHVKLS GXULQJ WKH SUHFHGLQJ \HDUV 7KH ODERUDWRU\ ZRXOG QRW KDYH EHHQ WKH VDPH ZLWKRXW &KDUOHV 6WHZDUW 8UV 3DXOL DQG 6XH &KU\VRJHORV DOO RI ZKRP KDYH JLYHQ PH QHZ SHUVSHFWLYHV RQ OLIH DQG VFLHQFH WKDQN 7LP 0RUULV IRU KLV FRQVWDQW JRRG QDWXUH DGYLFH DQG VWLPXODWLQJ FRQYHUVLRQV DOWKRXJK ZH GLG QRW DOZD\V DJUHHf ZRXOG SDUWLFXODUO\ OLNH WR WKDQN .HQ :ULJKW IRU RXU PDQ\ VXFFHVVIXO FROODERUDWLYH DGYHQWXUHV LQ WKH ODERUDWRU\ KLV IULHQGVKLS DQG JHQHURVLW\ ZKHQ LW ZDV PRVW QHHGHG )LQDOO\ WKDQN P\ ZLIH &DURO DQG RXU QHZ VRQ $ODQ ZKR KDYH JLYHQ PH FRQVWDQW LQVSLUDWLRQ WR FRQWLQXH GRZQ ZKDW KDV EHHQ D ORQJ DQG XQXVXDO SDWK WKURXJK JUDGXDWH VFKRRO 0\ SDUHQWV KDYH DOVR EHHQ D FRQVWDQW VRXUFH RI DGYLFH DQG HQFRXUDJHPHQW DQG WKDQN WKHP IRU WKHLU XQHQGLQJ LQWHUHVW LL

PAGE 3

7$%/( 2) &217(176 SDJH $&.12:/('*(0(176 LL $%%5(9,$7,216 Y $%675$&7 YLL &+$37(56 ,1752'8&7,21 9LUDO PRGHO V\VWHPV &KURPDWLQ 6WXGLHV ,Q YLWUR WUDQVFULSWLRQ (QKDQFHUV DQG 6LOHQFHUV +LVWRQH JHQHV 0$7(5,$/6 $1' 0(7+2'6 +,6721( + n 5(*8/$725< 6(48(1&(6 &HOO OLQH &RQVWUXFWLRQ ,QLWLDWLRQ RI 7UDQVFULSWLRQ DQG %DVDO 5HJXODWLRQ 'LVWDO 7UDQVFULSWLRQDO 5HJXODWRU\ (OHPHQWV 'LVWDO3UR[LPDO 3RVLWLYH (OHPHQW (QKDQFHU (OHPHQW 1XFOHDU 5XQRQ $QDO\VLV RI + 7UDQVFULSWLRQ 3/$60,' ,17(*5$7,21 6,7(6 ,17(*5,7< $1' 3527(,1'1$ ,17(5$&7,216 ,QWHJULW\ RI )ODQNLQJ 6HTXHQFHV /RFDWLRQ RI S69QHR 3ODVPLG 6HTXHQFHV &RPSDWLELOLW\ RI 0RXVH DQG +XPDQ 5HJXODWRU\ 3URWHLQV DQG 6HTXHQFHV ',6&866,21 $1' &21&/86,216 $33(1',&(6 $ 6$03/( &23< 180%(5 &$/&8/$7,21 LLL

PAGE 4

% 6$03/( &$/&8/$7,21 2) +80$1 + (;35(66,21 & 7$%/( 2) &216758&76 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ LY

PAGE 5

.(< 72 $%%5(9,$7,216 $73 $GHQRVLQH WULSKRVSKDWH ES %DVH SDLU & &HQWLJUDGH &,3 &DOI LQWHVWLQDO SKRVSKDWDVH &73 &\WLGLQH nWULSKRVSKDWH '(3& 'LHWK\OS\URFDUERQDWH '1$ 'HR[\ULERQXFOHLF DFLG '1DVH 'HR[\ULERQXFOHDVH '8 'HQVLWRPHWU\ XQLWV ('7$ 'LVRGLXP (WK\OHQHGLDPLQHWHWUDDFHWDWH (*7$ (WK\OHQHELVR[\HWK\OHQHQLWULORfWHWUDDFHWLF DFLG *73 *XDQRVLQH nWULSKRVSKDWH +HSHV 1K\GUR[\HWK\OSLSHUL]LQH1nHWKDQHVXOIRQLF DFLG +8 +\GUR[\XUHD /LWHU 0 0RODU S&L 0LFURFXULH PJ 0LOOLJUDP 3J 0LFURJUDP PO 0LOOLOLWHU [O 0LFUROLWHU Y

PAGE 6

P0 0LOOLPRODU P51$ 0HVVHQJHU ULERQXFOHLF DFLG QP 1DQRPHWHU QW 1XFOHRWLGHV 2' 2SWLFDO GHQVLW\ 3LSHV >SLSHUD]LQHELVHWKDQHVXOIRQLF DFLGf@ 396 3RO\YLQ\OVXOIDWH 51$ 5LERQXFOHLF DFLG 51DVH$ 5LERQXFOHDVH $ USP 5HYROXWLRQV SHU PLQXWH 6'6 6RGLXP GRGHF\O VXOIDWH 69 6LPLDQ YLUXV 7&$ 7ULFKORURDFHWLF DFLG 7ULV 7ULVK\GUR[\PHWK\OfDPLQRPHWKDQH +\GURFKORULF DFLG 773 7K\PLGLQH WULSKRVSKDWH 9,

PAGE 7

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ $1$/<6,6 2) 7+( 6(48(1&(6 5(48,5(' )25 75$16&5,37,21$/ 5(*8/$7,21 2) $ +80$1 + +,6721( *(1( ,1 9,92 %\ 3DXO (GPRQG .URHJHU $XJXVW &KDLUPDQ -DQHW 6WHLQ 0DMRU 'HSDUWPHQW ,PPXQRORJ\ DQG 0HGLFDO 0LFURELRORJ\ :H KDYH FKDUDFWHUL]HG WKH VHTXHQFHV UHTXLUHG IRU WKH WUDQVFULSWLRQDO UHJXODWLRQ RI WKH )2 KXPDQ + KLVWRQH JHQH LQ YLYR 5HFRPELQDQW FHOO OLQHV WKDW FRQWDLQHG GHOHWLRQ FRQVWUXFWV RI WKH + SURPRWHU UHJLRQ ZHUH SUHSDUHG LQ PRXVH & FHOOV DQG WKH OHYHO RI KXPDQ + KLVWRQH JHQH H[SUHVVLRQ ZDV PHDVXUHG E\ 6, QXFOHDVH DQDO\VLV :H IRXQG WKDW WKH PLQLPDO VHTXHQFHV UHTXLUHG IRU WKH LQLWLDWLRQ RI WUDQVFULSWLRQ IURP WKLV JHQH ZHUH FRQWDLQHG ZLWKLQ WKH QXFOHRWLGHV n WR WKH LQLWLDWLRQ VLWH RI WUDQVFULSWLRQ :LWKLQ WKLV UHJLRQ DUH ORFDWHG DQ Q YLYR SURWHLQ ELQGLQJ VLWH 6LWH ,,f WKH **7&& HOHPHQW DQG WKH 7$7$ ER[ 'HOHWLRQ RI WKH GLVWDO KDOI RI 6LWH ,, DEROLVKHG VLWH VSHFLILF LQLWLDWLRQ RI WUDQVFULSWLRQ DQG GHPRQVWUDWHG WKDW WKH 7$7$ ER[ DQG **7&& HOHPHQW ZHUH QRW VXIILFLHQW IRU LQLWLDWLRQ LQ YLYR ([WHQVLRQ RI WKH + SURPRWHU WR EDVH SDLUV UHVXOWHG LQ D VLJQLILFDQW LQFUHDVH LQ WUDQVFULSWLRQ DQG WKLV LQFUHDVH FRUUHODWHG ZLWK WKH 9OO

PAGE 8

SUHVHQFH RI DQ 6SO VLWH LQ WKH SUR[LPDO KDOI RI WKH XSVWUHDP SURWHLQ ELQGLQJ VLWH 6LWH ,I WKH SURPRWHU UHJLRQ ZDV OHQJWKHQHG WR QXFOHRWLGHV WKHUH ZDV D WZRIROG LQFUHDVH LQ WKH OHYHO RI WUDQVFULSWLRQ 'HOHWLRQ DQDO\VLV VXJJHVWHG WKDW WKH GLVWDOSUR[LPDO SRVLWLYH HOHPHQW ZDV ORFDWHG IURP LQ WKH UHJLRQ IURP WR EDVH SDLUV n WR WKH FDS VLWH :H LQYHVWLJDWHG WKH IXQFWLRQDOLW\ RI D SUHYLRXVO\ LGHQWLILHG HQKDQFHUOLNH HOHPHQW ORFDWHG YHU\ IDU XSVWUHDP LQ WKH S) IUDJPHQW RI $ ++* DQG GHPRQVWUDWHG WKDW DOWKRXJK LW IXQFWLRQHG LQ +H/D FHOOV LW ZDV QRW IXQFWLRQDO LQ PRXVH & FHOO OLQHV 6, DQDO\VLV RI GLVWDO GHOHWLRQ FRQVWUXFWV VXSSRUWHG WKH LGHD WKDW D QHJDWLYH UHJXODWRU\ HOHPHQW RI + JHQH WUDQVFULSWLRQ ZDV ORFDWHG EHWZHHQ QXFOHRWLGHV DQG $QDO\VLV RI WKH UHJLRQ GHPRQVWUDWHG FRQVHQVXV VHTXHQFHV IRU D WRSRLVRPHUDVH ,, VLWH QXFOHDU PDWUL[ DWWDFKPHQW VLWHV DQG D YHU\ KLJK $7 FRQWHQW bf VXJJHVWLYH RI EHQW '1$ 7DNHQ WRJHWKHU WKLV VHW RI UHVXOWV LPSOLHG WKDW WKH '1$ WRSRORJ\ RI WKLV UHJLRQ PLJKW EH LPSRUWDQW IRU + JHQH UHJXODWLRQ $GGLWLRQDO VWXGLHV GHPRQVWUDWHG WKDW $OX UHSHWLWLYH VHTXHQFHV LQ WKH KLVWRQH GHOHWLRQ FRQVWUXFWV FRXOG PHGLDWH VSHFLILF LQWHJUDWLRQ LQWR WKH PRXVH FKURPRVRPH DQG WKDW KLJK FRS\ QXPEHU ZDV SRVVLEOH YLLL

PAGE 9

&+$37(5 ,1752'8&7,21 7KH JRDO RI WKLV VWXG\ KDV EHHQ WR DVVHVV WKH FRQWULEXWLRQ RI SURPRWHU VHTXHQFHV LQ WKH ) KXPDQ + KLVWRQH JHQH n IODQNLQJ UHJLRQ WR WUDQVFULSWLRQDO UHJXODWLRQ RI WKH JHQH :H KDYH HQGHDYRUHG WR GHILQH WKH VHTXHQFHV QHFHVVDU\ IRU WKH LQLWLDWLRQ DQG DXJPHQWDWLRQ RI WUDQVFULSWLRQ 7KH 7$7$ ER[ **7&& HOHPHQW &$$7 ER[ &&$$7 ER[ DQG 6SO VLWH KDYH EHHQ LPSOLFDWHG LQ WUDQVFULSWLRQDO UHJXODWLRQ DQG DUH UHYLHZHG EHORZ :H KDYH DOVR LQYHVWLJDWHG D SXWDWLYH HQKDQFHUOLNH HOHPHQW DQG QHJDWLYH UHJXODWRU\ VHTXHQFH DQG VR WKHVH VHTXHQFHV DUH DOVR GLVFXVVHG EHORZ +LVWRULFDO %DFNJURXQG 7KH FRQFHSWV JRYHUQLQJ JHQH UHJXODWLRQ DV ZH NQRZ WKHP WRGD\ KDYH WKHLU IRXQGDWLRQV LQ WKH ZRUN RI PDQ\ ELRFKHPLVWV DQG JHQHWLFLVWV ZKR LQWURGXFHG WKH LGHDV RI SRVLWLYH DQG QHJDWLYH UHJXODWLRQ LQ SURNDU\RWLF JHQH H[SUHVVLRQ 7KH REVHUYDWLRQV RI PDQ\ WKDW WKH WRWDO JHQHWLF SRWHQWLDO RI D FHOO ZDV QHYHU H[SUHVVHG VLPXOWDQHRXVO\ UHIHUUHG WR DV JHQHWLF DGDSWDWLRQ OHG -DFRE DQG 0RQRG f WR DGGUHVV WKH TXHVWLRQ RI ZKDW FRQWUROV WKLV SKHQRPHQRQ ,Q WKHLU VHPLQDO SDSHU WKH RSHURQ PRGHO ZDV SURSRVHG 7KLV PRGHO GHVFULEHG KRZ VWUXFWXUDO JHQHV H[SUHVVHG WKHPVHOYHV DQG KRZ WKDW H[SUHVVLRQ ZDV UHJXODWHG ,W KDG EHHQ NQRZQ IRU VRPH WLPH WKDW EDFWHULD FRXOG UHVSRQG WR YDULRXV

PAGE 10

QXWULHQWV E\ V\QWKHVL]LQJ QHZ PHWDEROLF HQ]\PHV VR -DFRE DQG 0RQRG LQYHVWLJDWHG WKH ODFWRVH PHWDEROLF SDWKZD\ RI (VFKHULFKLD FROO ( FROLf 7KHLU ZRUN ZDV HQFRXUDJHG E\ PDQ\ HDUOLHU LQYHVWLJDWRUV LQFOXGLQJ 'HPHUDF f ZKR PDGH WKH REVHUYDWLRQ WKDW JHQHV FRGLQJ IRU VLPLODU HQ]\PDWLF IXQFWLRQ ZHUH ORFDWHG LQ ORFDOL]HG UHJLRQV RI WKH 6DOPRQHOOD FKURPRVRPH 'HPHUDF ZDV DEOH WR FRQFOXGH WKDW WKH JHQHV KH KDG LQYHVWLJDWHG ZHUH LQ D QRQUDQGRP GLVWULEXWLRQ DQG WKDW SHUKDSV WKLV FRQIHUUHG DQ HYROXWLRQDU\ DGYDQWDJH WR WKH RUJDQLVP 7KH ODF RSHURQ LV RQH RI WKH PRVW ZHOO VWXGLHG JHQHWLF V\VWHPV LQ DOO RI SURNDU\RWLF DQG HXNDU\RWLF PROHFXODU ELRORJ\ 7KH PDQ\ LQWXLWLYH REVHUYDWLRQV DQG SUHGLFWLRQV RI -DFRE DQG 0RQRG DQG FROOHDJXHV OHG WR WKH LGHQWLILFDWLRQ RI WKH FRPSRQHQWV RI WKH ODF RSHURQ WKH UHSUHVVRU SURGXFHG E\ WKH ODF JHQH WKH ODF RSHUDWRU SURPRWHU DQG WKUHH OLQNHG VWUXFWXUDO JHQHV 7KH LQWHUSOD\ RI LQGXFHU DQG UHSUHVVRU ZDV GHPRQVWUDWHG DQG -DFRE DQG 0RQRG SURSRVHG WKDW WKH ODF RSHURQ ZDV VXEMHFW WR QHJDWLYH UHJXODWLRQ $Q LQLWLDO REVHUYDWLRQ RI -DFRE DQG 0RQRG f ZDV WKDW WKH FRQWURO JHQH ZRXOG PDNH UHSUHVVRUV WKDW ZRXOG WXUQ RII WKH VWUXFWXUDO JHQHV 7KH LVRODWLRQ RI QRQVHQVH PXWDWLRQV LQ WKH ODF JHQH %RXUJHRLV HW DO f SURYLGHG FRQYLQFLQJ HYLGHQFH IRU WKH QDWXUH RI UHSUHVVRUV 6XSSUHVVLRQ RI WKH QRQVHQVH PXWDWLRQ UHVWRUHG UHSUHVVRU IXQFWLRQ DQG GHPRQVWUDWHG WKDW UHSUHVVRU JHQHV HQFRGHG UHSUHVVRU SURWHLQV 7KH ILQDO SURRI ZDV WKH LVRODWLRQ RI WKH ODF UHSUHVVRU E\ *LOEHUW DQG 0OOHU+LOO f ,Q DGGLWLRQ LW ZDV GHPRQVWUDWHG WKDW WKH ODF RSHURQ DQG RWKHUV ZHUH XQGHU PRUH JHQHUDO FRQWURO E\ FDWDEROLWH DFWLYDWRU SURWHLQ DQG nnF\FOLF

PAGE 11

$03 DV LW ZDV VKRZQ WKDW ERWK DUH UHTXLUHG LQ DGGLWLRQ WR WKH LQGXFLQJ PROHFXOH IRU WKH RSHURQ WR EH WUDQVFULEHG (PPHU HW DO f 7KH HQVXLQJ \HDUV KDYH OHG WR UHILQHPHQW RI WKH RSHURQ PRGHO DV ZHOO DV LWV DFFHSWDQFH DV RQH RI WKH JHQHUDO RUJDQL]DWLRQDO SDWWHUQV FKDUDFWHULVWLF RI SURNDU\RWHV ,Q SDUWLFXODU WKH FRQFHSWV RI SURWHLQ'1$ LQWHUDFWLRQV UHSUHVVLRQ DQG SRVLWLYH DQG QHJDWLYH UHJXODWLRQ KDYH FDUULHG RYHU LQWR HXNDU\RWLF PROHFXODU ELRORJ\ DQG KDYH VHUYHG DV D EDVLV IRU XQUDYHOLQJ WKH FRPSOH[LW\ RI WKH HXNDU\RWLF FHOO 7KH H[WHQVLRQ RI WKHVH LGHDV KDV DOORZHG FRQVLGHUDEOH SURJUHVV KRZHYHU WKH RULJLQDO YLHZ WKDW DOO JHQHV SURNDU\RWLF DQG HXNDU\RWLF ZRXOG KDYH VLPLODU UHJXODWRU\ DQG RUJDQL]DWLRQDO SDWWHUQV KDV QRW EHHQ ERUQH RXW ,Q IDFW WKHUH LV D JUHDW GLYHUVLW\ LQ WKH UHJXODWRU\ PHFKDQLVPV WKDW JRYHUQ ERWK SURNDU\RWLF DQG HXNDU\RWLF JHQH H[SUHVVLRQ 7KH FRQWURO RI HXNDU\RWLF JHQH UHJXODWLRQ KDV EHHQ RI REYLRXV LQWHUHVW EXW UHVHDUFK KDV EHHQ VORZHU WKDQ LQ SURNDU\RWHV EHFDXVH RI WKH FRPSOH[LW\ DQG WHFKQLFDO GLIILFXOWLHV HQFRXQWHUHG ZKHQ ZRUNLQJ ZLWK WKH HXNDU\RWLF FHOO 7ZR DYHQXHV RI VWXG\ KDYH SUHGRPLQDWHG LQ HXNDU\RWLF PROHFXODU ELRORJ\ WKH LQYHVWLJDWLRQ RI YLUDO PRGHOV VXFK DV DGHQRYLUXV DQG 69 DV ZDV GRQH ZLWK WKH SURNDU\RWLF SKDJHV ODPEGD DQG 7f DQG WKH FKDUDFWHUL]DWLRQ RI FHOOXODU JHQHV DQG WKH SURWHLQV WKDW UHJXODWH WKHLU H[SUHVVLRQ (XNDU\RWLF PROHFXODU ELRORJLVWV KDYH KDG WR GHYHORS WKH DSSURSULDWH WHFKQRORJ\ EHFDXVH PDQ\ RI WKH DGYDQWDJHRXV SURNDU\RWLF WHFKQLTXHV DUH QRW GLUHFWO\ DSSOLFDEOH WR HXNDU\RWLF V\VWHPV 7ZR RI WKH PRVW LPSRUWDQW GLVFRYHULHV WKDW KDYH UHYROXWLRQL]HG PROHFXODU ELRORJ\ DUH

PAGE 12

UHVWULFWLRQ HQ]\PHV UHYLHZHG E\ 1DWKDQV DQG 6PLWK f DQG '1$ OLJDVH 0RGULFK HW DO :HLVV DQG 5LFKDUGVRQ f :LWK WKHVH QHZ HQ]\PDWLF WRROV WKH DELOLW\ WR PDQLSXODWH '1$ IUDJPHQWV GHYHORSHG TXLFNO\ DQG ZDV UHVSRQVLEOH IRU WKH SUHVHQW VWDWH RI DGYDQFHPHQW 9LUDO 0RGHO 6\VWHPV 7KH XWLOL]DWLRQ RI YLUDO PRGHO V\VWHPV IRU WKH FKDUDFWHUL]DWLRQ RI HXNDU\RWLF UHJXODWRU\ PHFKDQLVPV ZDV D ORJLFDO H[WHQVLRQ RI WKH ZRUN GRQH LQ SURNDU\RWHV ,Q SDUWLFXODU DGHQRYLUXV DQG 69 KDYH SURYLGHG FRQVLGHUDEOH LQVLJKWV LQWR HXNDU\RWLF JHQH UHJXODWLRQ :LWKRXW DQ XQGHUVWDQGLQJ RI WKH H[DFW PHFKDQLVPV LQYROYHG LQ WKH YDULRXV SURFHVVHV RI 51$ WUDQVFULSWLRQ DQG '1$ UHSOLFDWLRQ LW ZDV REYLRXV WR HDUO\ LQYHVWLJDWRUV WKDW YLUXVHV VXFK DV 69 FRXOG LQYDGH DQG HYHQWXDOO\ NLOO WKH KRVW FHOO DQG \HW ZHUH H[WUHPHO\ GHSHQGHQW RQ WKH FHOOnV HQ]\PDWLF PDFKLQHU\ WR DFFRPSOLVK WKHLU UHSOLFDWLYH F\FOH $GHQRYLUXVHV ZHUH ILUVW LVRODWHG E\ 5RZH HW DO f DV WKH DJHQW UHVSRQVLEOH IRU WKH GHJHQHUDWLRQ RI KXPDQ DGHQRLG WLVVXH LQ FXOWXUH 7KH DGHQRYLUXV OLIH F\FOH LQ KXPDQ FHOOV KDV EHHQ H[DPLQHG ZLWK UHVSHFW WR WKH YLUXV VSHFLILF SURWHLQV SURGXFHG UHSOLFDWLRQ RI YLUDO '1$ WUDQVFULSWLRQ RI YLUDO JHQHV DQG HIIHFW RQ WKH KRVW FHOO 5HYLHZHG LQ 7RR]H f ,QLWLDO VWXGLHV GHPRQVWUDWHG WKDW WKHUH ZHUH WZR SKDVHVHDUO\ DQG ODWHLQ WKH H[SUHVVLRQ RI DGHQRYLUXV JHQHV /LQGEHUJ HW DO f $V D PHDVXUH RI WKH LPSDFW RI LQIHFWLRQ RQ WKH FHOO DGHQRYLUXV P51$ FRPSULVHV DOPRVW DOO WKH P51$ ERXQG WR SRO\ULERVRPHV E\ WKH HQG RI WKH UHSOLFDWLYH F\FOH 7KRPDV DQG *UHHQ f 7KH HDUO\ YLUDO P51$ ZDV GHWHFWHG DQG PDSSHG WR SUHFLVH ORFDWLRQV RQ WKH DGHQRYLUXV JHQRPH E\ 5ORRS PDSSLQJ 7KRPDV HW DO

PAGE 13

f DQG K\EULGL]DWLRQ WR UHVWULFWLRQ HQGRQXFOHDVH IUDJPHQWV RI DGHQRYLUXV '1$ 6KDUS HW DO f 5HVWULFWLRQ HQ]\PHV SHUPLWWHG WKH PDSSLQJ DQG RULHQWDWLRQ RI '1$ IUDJPHQWV DQG WUDQVFULSWLRQ XQLWV RQ WKH 69 JHQRPH DV ZHOO .KRXU\ HW DO 6DPEURRN HW DO f 6HYHUDO ODERUDWRULHV XWLOL]HG DGHQRYLUXV69 UHFRPELQDQW K\EULGV WR GHILQH HVVHQWLDO JHQRPLF UHJLRQV RI HDFK ,Q SDUWLFXODU WKH K\EULG YLUXVHV ZHUH XVHIXO LQ WKH GHWHUPLQDWLRQ RI WKH IXQFWLRQDO KHOSHU GRPDLQ RI WKH 69 7 DQWLJHQ DV DGHQRYLUXV UHTXLUHV KHOS WR JURZ LQ QRQSHUPLVVLYH FHOOV )H\ HW DO f :LWK WKH P51$ FRGLQJ UHJLRQV PDSSHG RQ WKH DGHQRYLUXV DQG 69 JHQRPHV D PRUH LQIRUPDWLYH DQDO\VLV DQG LQWHUSUHWDWLRQ ZHUH LQLWLDWHG ZKLFK KDYH EHJXQ WR HOXFLGDWH WKH FRPSOH[ QDWXUH RI WUDQVFULSWLRQDO UHJXODWLRQ LQ WKHVH YLUXVHV 7KH SURPRWHU VWUXFWXUH DQG SUHVHQFH RI HQKDQFLQJVLOHQFLQJ HOHPHQWV LQ WKHVH YLUXVHV KDYH VHUYHG DV FRQWLQXLQJ PRGHOV IRU VWXGLHV RI FHOOXODU SURPRWHUV DQG UHJXODWRU\ VHTXHQFHV $GGLWLRQDOO\ DOWKRXJK QRW GLVFXVVHG KHUH ERWK DGHQRYLUXV DQG 69 ZHUH XWLOL]HG LQ WKH GLVFRYHU\ RI P51$ VSOLFLQJ %HUN DQG 6KDUS f ZKLFK KDV UHYROXWLRQL]HG RXU FRQFHSWV RI JHQH UHJXODWLRQ DQG H[SUHVVLRQ &KURPDWLQ 6WXGLHV $W WKH VDPH WLPH WKDW WKH YLUDO PRGHO V\VWHPV ZHUH EHJLQQLQJ WR EH UHDVRQDEO\ ZHOO XQGHUVWRRG WKHUH ZHUH D QXPEHU RI LQYHVWLJDWRUV SXUVXLQJ WKH FKDUDFWHUL]DWLRQ RI FHOOXODU JHQHV DQG WUDQVFULSWLRQDO PHFKDQLVPV $OWKRXJK UHVWULFWLRQ HQ]\PHV KDG EHHQ GLVFRYHUHG 6PLWK DQG :LOFR[ f DQG WKHLU DSSOLFDELOLW\ UHDOL]HG LW ZDV VHYHUDO \HDUV EHIRUH WKHLU SXULILFDWLRQ DQG UHFRPELQDQW '1$ WHFKQRORJ\ ZHUH ZRUNHG RXW WR PDNH WKHP VXIILFLHQWO\ XVHIXO 7KLV ODJ GLG QRW GHWHU D

PAGE 14

QXPEHU RI LQYHVWLJDWRUV IURP GLUHFW H[DPLQDWLRQ RI WKH WUDQVFULSWLRQDO SURFHVV LQ HXNDU\RWLF FHOOV $V HDUO\ DV LVRODWHG SHD HPEU\R FKURPDWLQ KDG EHHQ XWLOL]HG DV D WHPSODWH IRU WUDQVFULSWLRQ +XDQJ DQG %RQQHU f ,VRODWHG FKURPDWLQ ZDV LQFXEDWHG ZLWK EDFWHULDO 51$ SRO\PHUDVH WKH SXULILFDWLRQ RI HXNDU\RWLF 51$ SRO\PHUDVHV KDG QRW EHHQ DFKLHYHG DW WKLV WLPHf DQG WKH IRXU ULERQXFOHRVLGH WULSKRVSKDWHV $ FRPSDUDWLYH DQDO\VLV RI WUDQVFULSWLRQ IURP FKURPDWLQ DQG GHSURWHLQL]HG '1$ RI WKH VDPH VRXUFH LQGLFDWHG WKDW WKH FKURPDWLQ ZDV OHVV DEOH WR VXSSRUW WUDQVFULSWLRQ +XDQJ DQG %RQQHU f ,W ZDV SRVWXODWHG WKDW SDUW RI WKH FKURPDWLQ ZDV UHSUHVVHG SHUKDSV GXH WR WKH SUHVHQFH RI KLVWRQH SURWHLQV ERXQG WR WKH '1$ 7KH DPRXQW RI WUDQVFULSWLRQ SRVVLEOH IURP D NQRZQ TXDQWLW\ RI FKURPDWLQ ZDV UHIHUUHG WR DV LWV WHPSODWH FDSDFLW\ 7KH GHWHUPLQDWLRQ RI WHPSODWH FDSDFLW\ LQ FKLFN RYLGXFW D VWHURLG UHVSRQVLYH WLVVXH OHG WR WKH REVHUYDWLRQ WKDW WKH OHYHO RI WUDQVFULSWLRQ ZDV PRGXODWHG ZLWK WKH DGGLWLRQ RI KRUPRQH 'DKPXV DQG %RQQHU f 7KH DPRXQW RI WHPSODWH FDSDFLW\ DOVR FRUUHODWHG ZLWK WKH YDULRXV GHYHORSPHQWDO VWDJHV RI VHD XUFKLQ JURZWK -RKQVRQ DQG +QLOLFD f $QRWKHU PRUH DFFXUDWH PHDVXUH RI WKH WUDQVFULSWLRQDO FDSDFLW\ RI D VDPSOH RI FKURPDWLQ ZDV WKH QXPEHU RI 51$ SRO\PHUDVH LQLWLDWLRQ VLWHV &HGDU DQG )HOVHQIHOG f ILUVW PHDVXUHG WKH QXPEHU RI ( FROL 51$ SRO\PHUDVH LQLWLDWLRQ VLWHV RQ FKURPDWLQ E\ LQFXEDWLQJ FKURPDWLQ DQG 51$ SRO\PHUDVH WRJHWKHU LQ WKH DEVHQFH RI ULERQXFOHRVLGH WULSKRVSKDWHV 1H[W WKH DGGLWLRQ RI WKH ULERQXFOHRVLGH WULSKRVSKDWHV ZLWK KLJK OHYHOV RI DPPRQLXP VXOIDWH SHUPLWWHG HORQJDWLRQ EXW QRW UHLQLWLDWLRQ 2QH RI WKH PDMRU FULWLFLVPV RI WKLV HDUO\ ZRUN ZDV WKDW WKH XVH RI EDFWHULDO 51$ SRO\PHUDVH PDGH DQ

PAGE 15

DFFXUDWH LQWHUSUHWDWLRQ LQ GRXEW &RPSDUDWLYH VWXGLHV ZHUH SHUIRUPHG E\ 0DQGHO DQG &KDPEQ f DQG 7VDL HW DO f 7KHVH LQYHVWLJDWRUV GHPRQVWUDWHG WKDW WKHUH ZDV QR FRPSHWLWLRQ IRU HLWKHU 69 '1$ RU FDOI WK\PXV '1$ E\ WKH EDFWHULDO RU HXNDU\RWLF 51$ SRO\PHUDVH +RZHYHU ZKHQ 7VDL HW DO f FRPSDUHG KHQ RYLGXFW DQG ( FROL 51$ SRO\PHUDVH LQLWLDWLRQ VLWHV RQ FKLFN '1$ RU FKLFN RYLGXFW FKURPDWLQ WKH\ IRXQG QR FRPSHWLWLRQ RQ WKH '1$ EXW GLUHFW FRPSHWLWLRQ LQ WKH FKURPDWLQ VDPSOH 7KXV LW DSSHDUHG WKDW FKURPRVRPDO SURWHLQV FRXOG PRGLI\ WKH LQLWLDWLRQ VSHFLILFLW\ VXFK WKDW ERWK HQ]\PHV ZHUH FRPSHWLQJ IRU VLPLODU VLWHV 7R HVWDEOLVK WKLV SRLQW FRQFOXVLYHO\ WKH SURGXFW P51$V KDG WR EH H[DPLQHG )LOWHU K\EULGL]DWLRQ WHFKQLTXHV ZHUH GHYHORSHG WKDW SHUPLWWHG WKH GHWHFWLRQ RI UHLWHUDWHG JHQH WUDQVFULSWV DQG SDUWLFXODUO\ DEXQGDQW P51$V $W WKH OHYHO RI VHQVLWLYLW\ SRVVLEOH ZLWK WKLV PHWKRGRORJ\ LQ YLWUR FKURPDWLQ WUDQVFULSWLRQ DSSHDUHG WR UHIOHFW DQ DFFXUDWH YLHZ RI WKH WUDQVFULSWLRQDO VWDWXV LQ YLYR %DFKHOHU DQG 6PLWK f 7KH QH[W PDMRU DGYDQFH ZDV WKH IUDFWLRQDWLRQ RI FKURPRVRPDO SURWHLQV LQ DQ HIIRUW WR UHFRQVWLWXWH WUDQVFULSWLRQDOO\ FRPSHWHQW '1$ LQWR FKURPDWLQ LQ YLWUR 7KH ILUVW DWWHPSWV WR UHFRQVWLWXWH FKURPDWLQ ZHUH VWXGLHV E\ 3DXO DQG *LOPRXU f DQG %HNKRU HW DO f LQ ZKLFK WKH\ IUDFWLRQDWHG FKURPDWLQ SURWHLQV LQ DQ DWWHPSW WR GLVFRYHU ZKDW JURXS RI SURWHLQV FRQWUROOHG WUDQVFULSWLRQDO 7KHLU UHVXOWV LQGLFDWHG WKDW WKH QRQKLVWRQH FKURPRVRPDO SURWHLQ 1+&3f IUDFWLRQ ZDV SUREDEO\ UHVSRQVLEOH 7KH UROH RI 1+&3 LQ WKH H[SUHVVLRQ

PAGE 16

RI VHYHUDO JHQHV KDV EHHQ UHYLHZHG 6WHLQ HW DO 6LPSVRQ f ([SHULPHQWV EHFDPH PRUH UHILQHG DV H[HPSOLILHG E\ WKH VWXGLHV RI 7VDL HW DO f ZKR H[DPLQHG WKH LQGXFLEOH RYDOEXPLQ JHQH LQ WKH FKLFN RYLGXFW V\VWHP 7KH UROH RI 1+&3 ZDV HVWDEOLVKHG DQG WKURXJK D VHULHV RI FRPSHWLWLRQ DVVD\V ZLWK LQGXFHG DQG XQLQGXFHG 1+&3V LW ZDV GHPRQVWUDWHG WKDW LQ YLWUR H[SUHVVLRQ RI WKH RYDOEXPLQ JHQH ZDV VWLPXODWHG E\ WKH DSSHDUDQFH XSRQ VWHURLG LQGXFWLRQ RI D SRVLWLYH UHJXODWRU\ IDFWRU +LVWRQHV D PRGHUDWHO\ UHLWHUDWHG IDPLO\ RI JHQHV 6WHLQ HW DO f ZHUH DOVR VWXGLHG LQ D VLPLODU PDQQHU WR H[DPLQH WKH UROH RI 1+&3V 6HYHUDO VWXGLHV LQGLFDWHG WKDW 1+&3V ZHUH LQYROYHG LQ WKH LQFUHDVHG H[SUHVVLRQ RI WKH KLVWRQH JHQHV GXULQJ 6SKDVH RI WKH FHOO F\FOH 3DUN HW DO 6WHLQ HW DO f .OHLQVPLWK HW DO f H[WHQGHG WKH FKDUDFWHUL]DWLRQ DQG GHPRQVWUDWHG WKDW SKRVSKRU\ODWLRQ RI WKH 1+&3 ZDV QHFHVVDU\ IRU RSWLPDO LQ YLWUR H[SUHVVLRQ RI WKH KLVWRQH JHQHV :KHQ WKH 1+&3V ZHUH WUHDWHG ZLWK SKRVSKDWDVH EHIRUH DGGLWLRQ WR WKH UHDFWLRQ WKHUH ZDV D GHFUHDVH LQ WKH QXPEHU RI WUDQVFULSWLRQ LQLWLDWLRQ VLWHV 7KH UROH RI WKH KLVWRQH SURWHLQV LQ WUDQVFULSWLRQ KDV EHHQ RI JUHDW LQWHUHVW EHFDXVH WKH\ IRUP VXFK D FORVH DVVRFLDWLRQ ZLWK WKH '1$ 6WXGLHV ZLWK HLWKHU HOHFWURQ PLFURVFRS\ RU QXFOHDVH GLJHVWLRQ KDYH GHPRQVWUDWHG WKDW WKHUH LV HLWKHU D FKDQJH LQ WKH KLVWRQH'1$ UDWLR RU D FRQIRUPDWLRQDO FKDQJH LQ WKH QXFOHRVRPHV DVVRFLDWHG ZLWK JHQHV XQGHUJRLQJ DFWLYH WUDQVFULSWLRQ :HLQWUDXE DQG *URXGLQH f 7KH FKURPDWLQ VWUXFWXUH RI VSHFLILF JHQHV KDV DOVR EHHQ VKRZQ WR EH FRQIRUPDWLRQDOO\ DOWHUHG RQO\ LQ WLVVXHV ZKHUH WKH\ DUH

PAGE 17

H[SUHVVHG ([DPSOHV LQFOXGH WKH JORELQ JHQH LQ FKLFN HPEU\R UHG EORRG FHOO QXFOHL DQG WKH RYDOEXPLQ JHQH LQ FKLFN RYLGXFW QXFOHL *DUHO DQG $[HO f $OVR VHYHUDO LQYHVWLJDWRUV KDYH SURSRVHG WKDW QXFOHRVRPHV PLJKW EH SKDVHG RQ WKH FKURPRVRPH VR DV WR UHQGHU SDUWLFXODU DUHDV RI WKH '1$ DFFHVVLEOH RU LQDFFHVVLEOH WR WUDQVFULSWLRQ IDFWRUV *RWWVFKOLQJ DQG &HFK /LQ[ZHLOHU DQG +RU] f 7KXV DW WKLV MXQFWXUH LW EHFDPH PRUH UHDOLVWLF WR DVVXPH WKDW WKH FKURPDWLQ VWUXFWXUH RI DFWLYH JHQHV LQ FRPSDULVRQ WR VLOHQW ORFL ZDV D PRUH RSHQ DQG G\QDPLF FRQIRUPDWLRQ \HW QRW QHFHVVDULO\ GHYRLG RI KLVWRQHV DV KDG EHHQ SRVWXODWHG ,Q 9LWUR 7UDQVFULSWLRQ 'XULQJ WKH HDUO\ V VHYHUDO LQYHVWLJDWRUV DFWLYHO\ SXUVXHG WKH DFWLYLW\ RU DFWLYLWLHVf UHVSRQVLEOH IRU WKH V\QWKHVLV RI WKH YDULRXV HXNDU\RWLF P51$V $OPRVW VLPXOWDQHRXVO\ VHYHUDO ODERUDWRULHV ZHUH DEOH WR LVRODWH PXOWLSOH 51$ SRO\PHUDVH DFWLYLWLHV RQ '($(6HSKDGH[ FROXPQV &KDPEQ 5RHGHU f (DFK SHDN RI DFWLYLW\ H[KLELWHG D GLIIHUHQW VXVFHSWLELOLW\ WR WKH LQKLELWRU DPDQLWLQ .HGLQJHU f 7KHUH ZHUH GLIIHUHQFHV LQ WKH UHVXOWV WKH\ REWDLQHG DV HYLGHQFHG E\ WKH GLYHUVH QXPEHU RI YDULDQW 51$ SRO\PHUDVH DFWLYLWLHV WKDW ZHUH RULJLQDOO\ LGHQWLILHG 5RHGHU f $V WKH SXULW\ RI WKH 51$ SRO\PHUDVH DFWLYLW\ LQFUHDVHG LW EHFDPH PRUH REYLRXV WKDW WKHUH ZHUH WKUHH GLVWLQFW 51$ SRO\PHUDVH DFWLYLWLHV SUHVHQW LQ HXNDU\RWLF FHOOV 5RHGHU f ,W ZDV YHU\ GLIILFXOW IRU HDUO\ LQYHVWLJDWRUV WR PDNH SURJUHVV WRZDUG XQGHUVWDQGLQJ WKH UHODWLRQVKLS EHWZHHQ WKH YDULRXV HXNDU\RWLF 51$ SRO\PHUDVHV DQG WKHLU UHVSHFWLYH IXQFWLRQ LQ WKH

PAGE 18

H[SUHVVLRQ RI JHQHV EHFDXVH DGHTXDWH WHPSODWHV IRU WUDQVFULSWLRQ LQ YLWUR ZHUH QRW DYDLODEOH 7KH SUHGRPLQDQW WHPSODWHV XVHG ZHUH HLWKHU KRPRSRO\PHUV EDFWHULRSKDJH '1$ RU IUDFWLRQV RI JHQRPLF '1$ HQULFKHG LQ HLWKHU ULERVRPDO RU VDWHOOLWH '1$ &KDPEQ f 7KHVH SURYHG XQVDWLVIDFWRU\ DQG WKH UHVXOWV ZHUH RIWHQ FRQIXVLQJ 6HYHUDO OLQHV RI HYLGHQFH VXJJHVWHG WKDW DQFLOODU\ IDFWRUV ZHUH QHFHVVDU\ LQ RUGHU IRU 51$ SRO\PHUDVH LQ SDUWLFXODU 51$ SRO\PHUDVH ,, WR H[KLELW WHPSODWH VSHFLILF WUDQVFULSWLRQ &KDPEQ f 7KH DSSOLFDWLRQ RI UHVWULFWLRQ HQ]\PHV WR WKH PDQLSXODWLRQ RI '1$ OHG WR WKH FORQLQJ RI VSHFLILF JHQHV WKDW ZHUH WKHQ VXLWDEOH DV WHPSODWHV IRU LQ YLWUR WUDQVFULSWLRQ V\VWHPV 1DWKDQV DQG 6PLWK f 7KH ELRORJLFDO LPSOLFDWLRQV RI WKH YLUDO PRGHO V\VWHPV WKDW KDG EHHQ VWXGLHG LQ YLYR DQG WKH QHZ '1$ FORQLQJ WHFKQRORJ\ SURPSWHG VHYHUDO LQYHVWLJDWRUV WR GHYHORS FHOO IUHH WUDQVFULSWLRQ V\VWHPV ,W ZDV REYLRXV WKDW LW ZRXOG EH DGYDQWDJHRXV WR ZRUN ZLWK DQ LQ YLWUR V\VWHP WR GLVVHFW WKH YDULRXV FRPSRQHQWV RI WKH HXNDU\RWLF WUDQVFULSWLRQDO DSSDUDWXV 7KH ILUVW LQ YLWUR WUDQVFULSWLRQ V\VWHPV ZHUH GHYHORSHG IRU 51$ SRO\PHUDVH ,,, DQG VKRUWO\ WKHUHDIWHU 51$ SRO\PHUDVH ,, 51$ SRO\PHUDVH ,,, LV UHVSRQVLEOH IRU WKH V\QWKHVLV RI 6 ULERVRPDO 51$ 1J HW DO f W51$V DQG D IHZ YLUDO 51$V LQFOXGLQJ WKH DGHQRYLUXV 9$, DQG 9$,, 51$V )RZONHV DQG 6KHQN f &HOO IUHH WUDQVFULSWLRQ RI WKH ;HQRSXV 6 U51$ JHQH E\ 51$ SRO\PHUDVH ,,, ZDV ILUVW GHPRQVWUDWHG E\ %LUNHQPHLHU HW DO f LQ QXFOHDU H[WUDFWV RI ;HQRSXV RRF\WHV $W WKH VDPH WLPH LW ZDV VKRZQ WKDW F\WRSODVPLF H[WUDFWV RI KXPDQ .% FHOOV :X :HLO HW DO f ZHUH DEOH WR WUDQVFULEH VHOHFWLYHO\ FORQHG 6 U51$ W51$ DQG

PAGE 19

DGHQRYLUXV 9$ 51$ JHQHV 7KH F\WRSODVPLF H[WUDFWV ZHUH VKRZQ WR FRQWDLQ D PDMRULW\ RI WKH 51$ SRO\PHUDVH ,,, DFWLYLW\ :HLO HW DO f WKDW KDG DSSDUHQWO\ OHDNHG IURP WKH QXFOHXV GXULQJ SUHSDUDWLRQ RI WKH H[WUDFW :LWK UHVSHFW WR 51$ SRO\PHUDVH ,, 0DQOH\ HW DO f SUHSDUHG D FRQFHQWUDWHG +H/D FHOO H[WUDFW WKDW ZDV DEOH WR LQLWLDWH WUDQVFULSWLRQ DFFXUDWHO\ LQ YLWUR DW D YDULHW\ RI DGHQRYLUXV 51$ SRO\PHUDVH ,, WUDQVFULSWLRQDO FRQWURO UHJLRQV ,Q YLWUR WUDQVFULSWLRQ ZDV DQG LV D SRZHUIXO WHFKQLTXH IRU WKH LQYHVWLJDWLRQ RI HXNDU\RWLF SURPRWHU IXQFWLRQ 7KH FRQFRPLWDQW GHYHORSPHQW RI YDULRXV PROHFXODU WHFKQLTXHV IRU WKH PXWDWLRQ DQG UHDVVRUWPHQW RI '1$ VHTXHQFHV ZDV IRUWXLWRXV DQG LQ D UHODWLYHO\ VKRUW SHULRG RI WLPH WKH EDVLF VHTXHQFH UHTXLUHPHQWV RI WKH 51$ SRO\PHUDVH ,, SURPRWHU ZHUH GHOLQHDWHG (IVWUDWLDGLV HW DO f $OWKRXJK FRQVLGHUDEOH UHILQHPHQW KDV RFFXUUHG LQ RXU NQRZOHGJH RI WKHVH VHTXHQFHV WKH EDVLF HOHPHQWV KDYH QRW FKDQJHG 2QH RI WKH ILUVW VHTXHQFHV WR EH LPSOLFDWHG EHFDXVH RI VLPLODULW\ WR SURNDU\RWLF SURPRWHU VHTXHQFHV ZDV WKH 7$7$$ ER[ *ROGEHUJ+RJQHVVf 7KLV $7 ULFK VWUHWFK LV ORFDWHG WR ES XSVWUHDP RI WKH P51$ VWDUW VLWH LQ 51$ SRO\PHUDVH ,, SURPRWHUV DQG LV UHPDUNDEO\ VLPLODU WR WKH 3ULEQRZ ER[ 7$7$$7f GHVFULEHG IRU WKH SURPRWHUV RI SURNDU\RWLF JHQHV 3ULEQRZ f 7KH RQO\ UHDO GLIIHUHQFH LV WKH ORFDWLRQ RI WKH 3ULEQRZ ER[ ZKLFK LV DW ES IURP WKH VWDUW RI WUDQVFULSWLRQ 5RVHQEHUJ DQG &RXUW f ,W VKRXOG EH QRWHG WKDW WKH FRPSDULVRQ RI WKH 3ULEQRZ ER[ ZLWK WKH +RJQHVV ER[ KDV UHYHDOHG YDULDWLRQV LQ VHTXHQFH DQG VRPH GLIIHUHQFH LQ IXQFWLRQ 3ULQFLSDOO\ WKH 3ULEQRZ ER[ LV DEVROXWHO\ UHTXLUHG IRU WUDQVFULSWLRQ WR RFFXU LQ SURNDU\RWHV KRZHYHU DV

PAGE 20

GLVFXVVHG EHORZ WKH +RJQHVV ER[ LV QRW DV VWULQJHQWO\ UHTXLUHG 7KH VHFRQG VHTXHQFH WKDW KDV EHHQ UHWDLQHG ZLWK HTXDOO\ UHPDUNDEOH VLPLODULW\ LV WKH &$$7 ER[ 7KH FRQVHQVXV VHTXHQFH IRU WKLV HOHPHQW LV n**&W&$$7&7n (IVWUDWLDGLV HW DO '\QDQ DQG 7MLDQ f DQG LV XVXDOO\ ORFDWHG WR ES IURP WKH P51$ VWDUW VLWH $OWKRXJK WKH 7$7$ ER[ DQG &$$7 ER[ KDYH EHHQ IRXQG LQ D PDMRULW\ RI 51$ SRO\PHUDVH ,, SURPRWHUV DQG DSSHDU WR EH WKH IUDPHZRUN DURXQG ZKLFK JHQH VSHFLILF YDULDWLRQV LQ UHJXODWRU\ VHTXHQFHV RFFXU WKHUH KDYH EHHQ VRPH JHQHV GHVFULEHG WKDW KDYH QR 7$7$ ER[ &RQWUHUDV DQG )LHUV 0HOWRQ HW DO 5H\QROGV HW DO f $ VXEVHW RI WKHVH JHQHV WKDW KDYH LQVWHDG D KLJKO\ *& ULFK SURPRWHU DQG LQ JHQHUDO ODFN WKH VWULFW VWUXFWXUH FUHDWHG E\ FRQVHQVXV 51$ SRO\PHUDVH ,, VHTXHQFHV ([DPSOHV LQFOXGH HQ]\PHV VXFK DV PRXVH GLK\GURIRODWH UHGXFWDVH )DUQKDP DQG 6FKLPNH f KDPVWHU K\GUR[\ PHWK\OJOXWDU\O FRHQ]\PH $ UHGXFWDVH 5H\QROGV HW DO f DQG KXPDQ SKRVSKRJO\FHUDWH NLQDVH 6LQJHU6DP HW DO f 7KHVH JHQHV DUH RIWHQ FRQVWLWXWLYH DQG KHQFH KDYH EHHQ GHVFULEHG DV KRXVHNHHSLQJ JHQHV %HFDXVH WKH 7$7$$ DQG &$$7 KRPRORJLHV ZHUH IRXQG LQ PDQ\ JHQHV LW ZDV WKRXJKW WKDW WKH\ PLJKW IXQFWLRQ LQ WKH UHJXODWLRQ RI WUDQVFULSWLRQ (DUO\ LQ YLWUR WUDQVFULSWLRQ H[SHULPHQWV GRQH E\ :DV\O\N HW DO f LQGLFDWHG WKDW WKH SURPRWHU RI WKH FRQDOEXPLQ JHQH FRXOG EH GHOHWHG WR ES IURP WKH P51$ VWDUW VLWH ZLWKRXW DQ\ HIIHFW RQ WKH WUDQVFULSWLRQ RI WKH JHQH +RZHYHU ZKHQ WKHVH VDPH LQYHVWLJDWRUV LQWURGXFHG HYHQ D VLQJOH EDVH FKDQJH LQWR WKH 7$7$$ ER[ WKHUH ZDV D IROG GHFUHDVH LQ WKH DPRXQW

PAGE 21

RI WUDQVFULSWLRQ 6LPLODU UHVXOWV ZHUH REWDLQHG ZLWK WKH DGHQRYLUXV PDMRU ODWH FRQWURO UHJLRQ &RUGHQ HW DO +X DQG 0DQOH\ &RQFLQR HW DO f ,Q FRQWUDVW WR WKH LQ YLWUR UHVXOWV LW ZDV QRWLFHG WKDW WKH 7$7$$ ER[ LQ JHQHUDO ZDV QRW HVVHQWLDO IRU WUDQVFULSWLRQ LQ YLYR %HQRLVW DQG &KDPEQ f PDGH DQ 69 GHOHWLRQ PXWDQW WKDW ODFNHG WKH 7$7$$ ER[ SUHFHGLQJ WKH HDUO\ WUDQVFULSWLRQ XQLW 7KLV PXWDQW ZDV FDSDEOH RI V\QWKHVL]LQJ 7 DQWLJHQ DQG WUDQVIRUPLQJ UDW FHOOV 6LPLODU UHVXOWV ZHUH REWDLQHG ZLWK WKH SRO\RPD YLUXV HDUO\ WUDQVFULSWLRQ XQLW %HQGLJ HW DO f ,W ZDV DOVR HVWDEOLVKHG WKDW WKH 7$7$$ ER[ SUHFHGLQJ WKH VHD XUFKLQ +$ WUDQVFULSWLRQ XQLW ZDV QRW QHFHVVDU\ IRU IXQFWLRQ LQ YLYR *URVVFKHGO DQG %LUQVWLHO Df 7KH GHOHWLRQ PXWDQWV WKDW *URVVFKHGO PDGH ZHUH DVVD\HG E\ LQMHFWLRQ LQWR ;HQRQXV RRF\WHV $ ES GHOHWLRQ WKDW LQFOXGHG WKH 7$7$$ ER[ ORZHUHG WKH OHYHO RI WUDQVFULSWLRQ IROG EXW GLG QRW DEROLVK DFWLYLW\ ,I WKH 7$7$$ ER[ LV QRW DEVROXWHO\ HVVHQWLDO LQ YLYR IRU WUDQVFULSWLRQ WKHQ ZKDW LV WKH IXQFWLRQ RI WKLV KLJKO\ FRQVHUYHG VHTXHQFH" 7KH DQVZHU FDPH IURP D VHULHV RI 69 HDUO\ SURPRWHU PXWDQWV LQ ZKLFK WKH 7$7$$ ER[ ZDV GHOHWHG *OX]PDQ HW DO f )URP WKLV VHW RI PXWDQWV LW ZDV GHPRQVWUDWHG WKDW LQ YLYR WKH LQLWLDWLRQ RI 69 HDUO\ WUDQVFULSWLRQ RFFXUUHG GRZQVWUHDP RI WKH QRUPDO VLWH $OVR LW ZDV HVWDEOLVKHG E\ *OX]PDQ HW DO f WKDW ZKHQ WKHUH ZHUH GHOHWLRQV EHWZHHQ WKH VWDUW RI WUDQVFULSWLRQ DQG WKH 7$7$$ ER[ WKH VLWH RI LQLWLDWLRQ UHPDLQHG D FRQVWDQW ES ES GRZQVWUHDP 7KLV GHPRQVWUDWHG WKDW UHJDUGOHVV RI WKH GHOHWLRQ WKH P51$ FDS VLWH ZDV GHWHUPLQHG E\ WKH SRVLWLRQ RI WKH 7$7$$ ER[ *URVVFKHGO DQG %LUVWLHO

PAGE 22

Ef IRXQG WKDW PXOWLSOH LQLWLDWLRQ VLWHV ZHUH XWLOL]HG LQ YLYR ZKHQ WKH 7$7$$ ER[ ZDV GHOHWHG IURP WKH VHD XUFKLQ +$ JHQH 6LQFH WKH ODFN RI D 7$7$$ ER[ FDXVHG KHWHURJHQHLW\ LQ WKH VWDUW VLWH RI WUDQVFULSWLRQ IRU VHYHUDO JHQHV LW LV QRZ FRQVLGHUHG WKDW WKH 7$7$$ ER[ IXQFWLRQV LQ YLYR WR VSHFLI\ WKH FRUUHFW P51$ LQLWLDWLRQ VLWH (DUO\ LQ YLWUR WUDQVFULSWLRQ VWXGLHV GLG QRW GLUHFWO\ GLVFHUQ ZKHWKHU WKH &$$7 ER[ ZDV QHFHVVDU\ IRU WUDQVFULSWLRQ UHYLHZHG LQ 6KHQN f +RZHYHU PRUH UHFHQW DQG GHWDLOHG VWXGLHV KDYH GHWHUPLQHG WKDW WKH &$$7 ER[ GRHV SOD\ D UROH LQ WUDQVFULSWLRQDO UHJXODWLRQ 'HWDLOHG PXWDJHQHVLV VWXGLHV E\ 0F.QLJKW DQG .LQJVEXU\ f 0F.QLJKW HW DO f DQG 0\HUV HW DO f HOHJDQWO\ GHPRQVWUDWHG WKH QHHG IRU WKH &$$7 ER[ ,QLWLDOO\ WKH VWXGLHV RI 0F.QLJKW DQG .LQJVEXU\ f GLVVHFWHG WKH +HUSHV 6LPSOH[ WK\PLGLQH NLQDVH JHQH +69WNf LQWR GLVFUHWH DUHDV UHTXLUHG IRU H[SUHVVLRQ WKHVH LQFOXGHG WKH 7$7$$ ER[ DQG WZR XSVWUHDP UHJLRQV UHIHUUHG WR DV GLVWDO VLJQDO GVOf DQG GLVWDO VLJQDO ,, GVOOf 7R SLQSRLQW WKHVH VPDOO UHJLRQV DFFXUDWHO\ WKH\ GHYHORSHG D WHFKQLTXH FDOOHG OLQNHUVFDQQLQJ PXWDJHQHVLV ZKLFK LQWURGXFHV FOXVWHUHG VHWV RI SRLQW PXWDWLRQV LQ D VKRUW VHTXHQFH RI '1$ 6SHFLILFDOO\ WKHVH PXWDWLRQV ZHUH FRQVWUXFWHG E\ OLJDWLRQ RI D VHULHV RI FRPSOHPHQWDU\ n DQG n GHOHWLRQV MRLQHG YLD D V\QWKHWLF OLQNHU %DP+,f 7KH PXWDQWV WKDW 0F.QLJKW DQG .LQJVEXU\ FUHDWHG VSDQQHG WKH SUR[LPDO ES n WR WKH P51$ VWDUW VLWH DQG WKXV WKH\ ZHUH DEOH WR DVVLJQ D ERXQGDU\ WR DOO WKH VHTXHQFHV UHTXLUHG IRU +69 WN JHQH H[SUHVVLRQ DIWHU PLFURLQMHFWLRQ LQWR ;HQRSXV RRF\WHV ,Q VXEVHTXHQW VWXGLHV GVO DQG GVOO RI WKH +69 WN JHQH KDYH EHHQ VKRZQ WR LQWHUDFW

PAGE 23

VSHFLILFDOO\ ZLWK D FHOOXODU SURWHLQ -RQHV HW DO f 7KLV SURWHLQ 6SO ZDV LQLWLDOO\ SXULILHG E\ '\QDQ DQG 7MLDQ Df IURP +H/D FHOOV EHFDXVH RI LWV DIILQLW\ IRU WKH 69 HDUO\ SURPRWHUODWHU LGHQWLILHG DV WKH *& ULFK VHTXHQFHV RI WKH ES UHSHDWV 2QFH WKH VHTXHQFH RI WKH ELQGLQJ VLWH ***&**f RQ 69 ZDV FRQILUPHG E\ YDULRXV LQ YLWUR PHWKRGV HJ '1DVHO IRRWSULQWLQJf WKH SXULILHG SURWHLQ ZDV WHVWHG IRU ELQGLQJ RQ D YDULHW\ RI RWKHU JHQHV WKDW FRQWDLQ D *& ULFK VHTXHQFHVf LQFOXGLQJ WKH PRXVH 'LK\GURIRODWH UHGXFWDVH JHQH '\QDQ HW DO f DQG PRUH UHFHQWO\ WKH UDW LQVXOLQOLNH JURZWK IDFWRU JHQH E\ (YDQV HW DO f %RWK RI WKHVH JHQHV FRQWDLQ VHYHUDO 6SO ELQGLQJ VLWHV LGHQWLILHG LQ YLWUR E\ '1DVH IRRWSULQWLQJ DQG WKH VLWHV LQ WKH UDW LQVXOLQOLNH JURZWK IDFWRU JHQH DUH RI YDU\LQJ DIILQLW\ GHSHQGLQJ RQ WKH VHTXHQFH 6XEVHTXHQW WR WKH SXULILFDWLRQ RI 6SO VHYHUDO JURXSV UHSRUWHG WKH LGHQWLILFDWLRQ D FHOOXODU SURWHLQ WKDW LQWHUDFWV ZLWK WKH &$$7 ER[ VHTXHQFH DQG KDV EHHQ UHIHUUHG WR DV HLWKHU &$$7 ER[ WUDQVFULSWLRQ IDFWRU &7)f E\ -RQHV HW DO f RU &$$7 ER[ ELQGLQJ SURWHLQ &%3f E\ *UDYHV HW DO f -RQHV HW DO f GHPRQVWUDWHG DQ LQWHUDFWLRQ LQ GVOO RI WKH +69 WN SURPRWHU EHWZHHQ 6SO DQG &7) WKXV LQGLFDWLQJ WKDW GLVWLQFW WUDQVFULSWLRQ IDFWRUV PD\ LQWHUDFW WR UHJXODWH H[SUHVVLRQ 7KH LGHQWLILFDWLRQ RI &7) SURPSWHG WKH VHDUFK IRU RWKHU SXWDWLYH WUDQVFULSWLRQ IDFWRUV DQG DOWKRXJK WKH HYLGHQFH LV VRPHZKDW SUHOLPLQDU\ WKHUH DSSHDU WR EH DW OHDVW GLIIHUHQW &$$7 ER[ ELQGLQJ DFWLYLWLHV GHSHQGLQJ RQ WKH VRXUFH RI WKH PDWHULDO XVHG WR SXULI\ WKH DFWLYLW\ DQG WKH FULWHULD XVHG IRU DQDO\VLV 'RUQ HW DO f &%3 DQG &7) GLIIHU IURP HDFK RWKHU LQ WKHLU KHDW VWDELOLW\

PAGE 24

0F.QLJKW DQG 7MLDQ f $ &$$7 ER[ ELQGLQJ IDFWRU LVRODWHG IURP +H/D FHOOV LQ RXU ODERUDWRU\ YDQ :LMQHQ HW DO f WHUPHG +L1)% LV \HW DQRWKHU DGGLWLRQ WR WKLV JURZLQJ IDPLO\ RI SURWHLQV ZLWK SURSHUWLHV WKDW GLVWLQJXLVK LW IURP SUHYLRXV LVRODWHG &$$7 ER[ELQGLQJ IDFWRUV 7KH PRVW VRSKLVWLFDWHG VWXG\ WR GDWH RQ WKH VXEMHFW RI WUDQVFULSWLRQDO UHJXODWRU\ VHTXHQFHV ZDV GRQH UHFHQWO\ E\ 0\HUV HW DO f 7KHVH LQYHVWLJDWRUV GHYHORSHG D TXLFN PHWKRG IRU WKH LQWURGXFWLRQ RI VLQJOH SRLQW PXWDWLRQV LQ D VPDOO UHJLRQ RI '1$ 7KH\ PXWDWHG QHDUO\ HYHU\ EDVH IURP WR ES RI WKH PRXVH -JORELQ SURPRWHU :LWK D EDWWHU\ RI RYHU FORQHV HDFK ZLWK D VLQJOH EDVH FKDQJH LQ WKH SURPRWHU WKH\ ZHUH DEOH WR DVVD\ WKH H[SUHVVLRQ RI WKH PXWDQW FRQVWUXFWV LQ YLYR LQ D VKRUW WHUP WUDQVLHQW DVVD\ 7KHUHIRUH WKH\ FRXOG DVVLJQ IXQFWLRQDO OLPLWV WR FRQVHQVXV UHJXODWRU\ VHTXHQFHV DQG GLVFRYHU DQ\ PLQRU RU DV \HW XQQRWLFHG FRQWULEXWLQJ QXFOHRWLGHV ,Q DGGLWLRQ WUDQVYHUVLRQV DQG WUDQVLWLRQV ZHUH PHDVXUHG WR DVVHVV DQ\ HIIHFWV RQ H[SUHVVLRQ 7KH\ GHPRQVWUDWHG D UHTXLUHPHQW IRU WKH 7$7$$ ER[ ESf DQG WKH &$$7 ER[ ESf DV ZHOO DV DQ XSVWUHDP VHTXHQFH FKDUDFWHULVWLF RI WKH "JORELQ JHQHV &$&&& ESf LQ JORELQ WUDQVFULSWLRQ 6LJQLILFDQWO\ DQ XS SURPRWHU PXWDWLRQ ZDV GLVFRYHUHG ZKHQ WKH WZR EDVHV ** LPPHGLDWHO\ n WR WKH &&$$7 ER[ ZHUH FKDQJHG WR $$ 7KH UHVXOW RI WKLV PXWDWLRQ ZDV D IROG LQFUHDVH LQ WKH OHYHO RI PHVVDJH 7KH LPSOLFDWLRQV RI WKLV UHVXOW DUH WKDW D &$$7 ER[ WUDQVFULSWLRQ IDFWRU LV DEOH WR ELQG PRUH WLJKWO\ RU PRUH VSHFLILFDOO\ DQG WKHUHIRUH SHUIRUP LWV IXQFWLRQ PRUH HIILFLHQWO\ :LWK WKH QXPEHU RI &$$7 ER[ ELQGLQJ IDFWRUV WKDW DUH EHLQJ IRXQG LQ YDULRXV V\VWHPV LW

PAGE 25

LV DOVR SRVVLEOH WKDW WKH XS PXWDWLRQ UHVXOWV LQ WKH ELQGLQJ RI DQ DOWHUQDWLYH DV \HW XQLGHQWLILHG SURWHLQ WKDW FDUULHV RXW WKH VDPH IXQFWLRQ MXVW PRUH HIILFLHQWO\ ,Q DGGLWLRQ WKHUH DUH WHPSRUDO DQG WLVVXHVSHFLILF VHTXHQFHV WKDW DUH IRXQG LQ WKH SURPRWHUV RI VRPH JHQHV DQG UHJXODWH H[SUHVVLRQ DW WKH WUDQVFULSWLRQDO OHYHO 0DQ\ RI WKHVH HOHPHQWV IDOO LQWR D FDWHJRU\ RI PRGXODWRU\ VHTXHQFHV UHIHUUHG WR DV HQKDQFHUV QHJDWLYH HOHPHQWV DQG VLOHQFHUV (QKDQFHUV DQG 6LOHQFHUV 7KH SURPRWHU RI D JHQH KDV JHQHUDOO\ EHHQ GHILQHG DV WKH PLQLPDO VHTXHQFHV QHFHVVDU\ IRU WKH LQLWLDWLRQ DQG PDLQWHQDQFH RI D EDVDO OHYHO RI VSHFLILF WUDQVFULSWLRQ $GGLWLRQDO HOHPHQWV WKDW PRGLI\ WKH H[SUHVVLRQ RI D JHQH HLWKHU GXULQJ GHYHORSPHQW WHPSRUDOO\ LQ D WLVVXH VSHFLILF PDQQHU RU DV D UHVXOW RI DQ LQGXFHU ZRXOG VHHP D QHFHVVLW\ LI DGHTXDWH UHJXODWLRQ LQ WKH HXNDU\RWLF FHOO LV WR EH DFKLHYHG ,Q WKH SUHFHGLQJ \HDUV D QXPEHU RI LQYHVWLJDWRUV KDYH SURYLGHG FRQVLGHUDEOH HYLGHQFH IRU WKH H[LVWHQFH RI SRVLWLYH UHJXODWRU\ VHTXHQFHV UHIHUUHG WR DV HQKDQFHUV 5HYLHZHG LQ 6HUIOLQJ HW DO 0DQLDWLV HW DO f 7KH SURSHUWLHV RI DQ HQKDQFHU DUH WKDW f WKHUH LV VWURQJ DFWLYDWLRQ RI WKH OLQNHG JHQH IURP WKH FRUUHFW LQLWLDWLRQ VLWH f LW H[KLELWV LQGHSHQGHQFH RI RULHQWDWLRQ f LW LV RSHUDWLYH DW ORQJ GLVWDQFHV ZKHWKHU n RU n DQG f LW SUHIHUHQWLDOO\ VWLPXODWHV WUDQVFULSWLRQ IURP WKH FORVHVW SURPRWHU LI WKH\ DUH WDQGHPO\ DUUDQJHG 6HUIOLQJ HW DO f 7KH SURWRW\SH HQKDQFHU HOHPHQWV DUH WKH ES UHSHDWV RI 69 ZKLFK KDYH EHHQ H[WHQVLYHO\

PAGE 26

FKDUDFWHUL]HG %HQRLVW DQG &KDPEQ )URPP DQG %HUJ 7UHLVPDQ DQG 0DQLDWLV f 6HYHUDO H[SHULPHQWV LQ ZKLFK WKH 69 HQKDQFHU KDV EHHQ IXVHG WR WKH PRXVH JORE LQ SURPRWHU KDYH GHPRQVWUDWHG WKH UHODWLRQVKLSV WKDW H[LVW EHWZHHQ DQ HQKDQFHU DQG SURPRWHU %DQHUML HW DO f GHPRQVWUDWHG WKDW WKH 69 HQKDQFHU FRXOG SURPRWH KXQGUHGIROG KLJKHU OHYHOV RI UDEELW JORE LQ WUDQVFULSWLRQ ZKHWKHU ORFDWHG RU EDVH SDLUV DZD\ 7UHLVPDQ DQG 0DQLDWLV f GHPRQVWUDWHG WKDW 69 HQKDQFHG WUDQVFULSWLRQ RI WKH PRXVH JORELQ JHQH GHSHQGHG RQ WKH SUHVHQFH RI D IXQFWLRQDO SURPRWHU 3RLQW PXWDWLRQV LQ WKH XSVWUHDP SURPRWHU HOHPHQWV 83(f RI WKH JORELQ SURPRWHU DEROLVKHG WUDQVFULSWLRQ DOPRVW WRWDOO\ ,Q FRQMXQFWLRQ ZLWK WKHVH UHVXOWV 7UHLVPDQ HW DO f GHPRQVWUDWHG WKDW ZKHQ WKH JORELQ SURPRWHU ZDV GHOHWHG DQG WKH 69 HQKDQFHU ZDV PRYHG WR D SUR[LPDO SRVLWLRQ WUDQVFULSWLRQ UHWXUQHG WR D KLJK OHYHO ,W ZRXOG WKHQ DSSHDU WKDW HQKDQFHUV DUH OLNH SURPRWHUV EXW QRW YLFH YHUVD %LHQ] DQG 3HOKDP f GHPRQVWUDWHG WKDW WKH WDQGHP GXSOLFDWLRQ RI WUDQVFULSWLRQDO FRQWURO VHTXHQFHV FRXOG UHVXOW LQ HQKDQFLQJ DELOLW\ 7KH\ IRXQG WKDW WKH GXSOLFDWLRQ RI D KHDW VKRFN UHJXODWRU\ HOHPHQW +6(f FRXOG IXQFWLRQ DV DQ HQKDQFHU GLVWDQFH DFWLYDWLRQf ZKHUHDV D VLQJOH +6( ZDV LQDFWLYH DW D GLVWDQFH 6R RQH RI WKH PDMRU GLIIHUHQFHV EHWZHHQ HQKDQFHUV DQG SURPRWHUV DFWLRQ DW D GLVWDQFHf PD\ EH GXH WR WKH QXPEHU RI SURPRWHU HOHPHQWV SUHVHQW ZLWK VRPH DFFRPSDQ\LQJ VSHFLILF VHTXHQFHV 0DQLDWLV HW DO f 7KH LPSRUWDQFH RI WKH VSHFLILF VHTXHQFHV VKRXOG QRW EH GRZQSOD\HG DV D FRQVHQVXV FRUH VHTXHQFH n*7**$$$*n KDV EHHQ LGHQWLILHG LQ YLUDO DQG FHOOXODU HQKDQFHUV .KRXU\ DQG *UXVV f

PAGE 27

'LIIHUHQFHV PD\ DOVR EH WKH UHVXOW RI WKH DUUDQJHPHQW RI WUDQVFULSWLRQDO UHJXODWRU\ VHTXHQFHV :K\ GR DQ LQFUHDVHG QXPEHU RI UHJXODWRU\ VHTXHQFHV LQ PDQ\ FDVHV VWLPXODWH WUDQVFULSWLRQ VR GUDPDWLFDOO\" ,W KDV EHHQ SURSRVHG WKDW WKH UHVXOWLQJ SURWHLQSURWHLQ FRPSOH[HV WKDW DULVH IURP WKH MX[WDSRVLWLRQ RI UHJXODWRU\ VHTXHQFHV UHVXOW LQ LQFUHDVHG WUDQVFULSWLRQ 7KHUHIRUH VLQFH PRVW HQKDQFHUV FRQWDLQ UHSHDWHG HOHPHQWV LW LV SRVVLEOH WKDW WKH\ IXQFWLRQ LQ RUJDQL]DWLRQ RI WKH WUDQVFULSWLRQDO DSSDUDWXV ([FHSWLRQV WR WKLV H[LVW RI FRXUVH WDQGHP GXSOLFDWLRQ RI WKH &&$$7 ER[ GRHV QRW OHDG WR D '1$ IUDJPHQW ZLWK HQKDQFHU TXDOLWLHV %LHQ] DQG 3HOKDP f LH QR HQKDQFHPHQW DW D GLVWDQFH 3HUKDSV WKLV UHVXOW LV DOVR D UHIOHFWLRQ RI WKH LGHD WKDW VRPH WUDQVFULSWLRQ IDFWRUV ELQG WR WKH '1$ EXW GR QRW DFW GLUHFWO\ ,QVWHDG WKH\ IXQFWLRQ WKURXJK WKHLU DVVRFLDWLRQ ZLWK DGMDFHQW SURWHLQV 0DQLDWLV HW DO f $Q H[DPSOH LV WKDW &7) KDV EHHQ VKRZQ WR DVVRFLDWH FORVHO\ ZLWK 6SO SURWHLQ LQ WKH +HUSHV YLUXV WN JHQH -RQHV HW DO f 6LJQLILFDQWO\ LW KDV UHFHQWO\ EHFRPH DSSDUHQW WKDW WKH PHFKDQLVP RI WUDQVFULSWLRQDO DFWLYDWLRQ E\ XSVWUHDP DFWLYDWLRQ VLWHV 8$6Vf LQ \HDVW LV FRQVHUYHG LQ PDPPDOV 6HYHUDO VWXGLHV RYHU WKH ODVW \HDU KDYH GHPRQVWUDWHG f WKDW DFWLYDWRU SURWHLQV LQ \HDVW DUH FRPSRVHG RI D '1$ ELQGLQJ GRPDLQ LQ WKH DPLQR WHUPLQXV RI WKH SURWHLQ DQG D WUDQVFULSWLRQDO DFWLYDWRU LQ WKH FDUER[\ WHUPLQXV DQG f WKDW ZKHQ WKH \HDVW SURWHLQV DUH H[SUHVVHG LQ PDPPDOLDQ FHOOV ZLWK WKH DSSURSULDWH ELQGLQJ VLWH SUHVHQW LQ WKH SURPRWHU RI WKH WDUJHW JHQHf WKH\ FDQ DFWLYDWH WUDQVFULSWLRQ .DNLGDQL DQG 3WDVKQH :HEVWHU HW DO +RSH DQG 6WUXKO f 7DNHQ WRJHWKHU ZLWK ZKDW LV NQRZQ DERXW WUDQVFULSWLRQDO UHJXODWLRQ LQ KLJKHU

PAGE 28

HXNDU\RWHV LW DSSHDUV WKDW WKH VHSDUDWLRQ RI WKH '1$ ELQGLQJ GRPDLQ DQG WKH WUDQVFULSWLRQDO DFWLYDWLRQ GRPDLQ RI UHJXODWRU\ SURWHLQV PD\ EH FRQVHUYHG IURP \HDVW WR PDPPDOV ,Q DGGLWLRQ WKH PHFKDQLVP LV SUREDEO\ FRQVHUYHG DV ZHOO 6HYHUDO RI WKH PRUH ZHOO FKDUDFWHUL]HG HQKDQFHU VHTXHQFHV DUH SDUW RI D JURXS UHODWHG E\ WLVVXH VSHFLILFLW\ RI H[SUHVVLRQ 7KH ,PPXQRJOREXOLQ ,Jf HQKDQFHU RI WKH KHDY\ FKDLQ ORFXV LV ORFDWHG VHYHUDO WKRXVDQG ESV n WR WKH YDULDEOH UHJLRQ SURPRWHU 7KLV HQKDQFHU VHTXHQFH LQ LWV HQWLUHW\ LV RQO\ DFWLYH LQ FHOOV RI WKH O\PSKRLG OLQHDJH *LOOLHV HW DO DQG %DQHUML HW DO f $V KDV EHHQ IRXQG IRU WKH 69 HQKDQFHU WKH ,J HQKDQFHU LV FRPSRVHG RI VHYHUDO GLVWLQFW HOHPHQWV WKDW LQWHUDFW ZLWK VSHFLILF SURWHLQV LQ YLYR &KXUFK HW DO f 2QH RI WKH FRUH HOHPHQWV RI WKH ,J HQKDQFHU LV WKH RFWDPHU VHTXHQFH n$7*&$$$7n ,W LV RI VSHFLDO LQWHUHVW DV LW DOVR DSSHDUV LQ WKH SURPRWHU RI D IHZ FHOOXODU JHQHV LQFOXGLQJ KLVWRQH +% +DUYH\ HW DO f DQG nnf ROLJR$ V\QWKHWDVH %HQHFK HW DO f +RZ WKLV HOHPHQW FRQWULEXWHV WR WLVVXH VSHFLILFLW\ LQ RQH FRQWH[W ,J HQKDQFHUf DQG QRW LQ DQRWKHU KLVWRQH +%f UHPDLQV WR EH GHWHUPLQHG 5HFHQW LQ YLWUR ELQGLQJ VWXGLHV RI SURWHLQV WKDW LQWHUDFW ZLWK WKH 69 RFWDPHU VHTXHQFH KDYH GHPRQVWUDWHG WKDW WKHUH DUH ERWK JHQHUDO DQG WLVVXH VSHFLILF IDFWRUV SUHVHQW WKDW ELQG WKLV VHTXHQFH DQG WKLV PD\ UHODWH WR LWV UROH LQ WLVVXH VSHFLILF UHJXODWLRQ 5RVDOHV HW DO f $OVR FDUHIXO PDSSLQJ RI WKH ELQGLQJ RI +H/D DQG % FHOO QXFOHDU SURWHLQV WR WKH 69 HQKDQFHU KDV UHYHDOHG VXEWOH GLIIHUHQFHV LQ WKH H[WHQW WR ZKLFK YDULRXV PRWLIV DUH SURWHFWHG ZKLFK LV LQGLFDWLYH RI GLIIHUHQWLDO SURWHLQ'1$ LQWHUDFWLRQV 'DYLGVRQ HW DO f

PAGE 29

(QKDQFHUV VKRXOG QRW EH PLVWDNHQ IRU SURPRWHUV ZLWK DGGLWLRQDO VHTXHQFH DWWDFKHG RU LQWHUVSHUVHG ,Q PDQ\ FDVHV WKH\ H[KLELW H[FHSWLRQDO FHOOW\SH DQG WHPSRUDO VSHFLILFLW\ ZLWK UHVSHFW WR WUDQVFULSWLRQDO DFWLYDWLRQ 'HOHWLRQ DQDO\VLV KDV LQGLFDWHG WKDW FHUWDLQ FRUH VHTXHQFHV RI WKH ,J+ HQKDQFHU PD\ IXQFWLRQ LQ QRQO\PSKRLG FHOOV WR VKXW RII WKH HQKDQFHU DFWLRQ :DV\O\N DQG :DV\O\N .DGHVK HW DO f 7KH LPSOLFDWLRQ RI D QHJDWLYH UHJXODWRU\ PHFKDQLVP IRU WKH FRQWURO RI ,J+ HQKDQFHU DFWLRQ SUHVHQWV D FRQIXVLQJ SLFWXUH RI WLVVXH VSHFLILF DQG WHPSRUDO JHQH UHJXODWLRQ $W ILUVW LW ZDV WKRXJKW WKDW WKH DEVHQFH RI QHFHVVDU\ IDFWRUV IRU HQKDQFHU DFWLRQ ZDV WKH UHDVRQ IRU GLIIHUHQWLDO DFWLYLW\ LQ YDULRXV WLVVXHV 0DQLDWLV HW DO f +RZHYHU WKLV KDV EHHQ VKRZQ WR EH VRPHZKDW LQFRUUHFW DV PDQ\ RI WKH IDFWRUV IRXQG LQ % FHOO H[WUDFWV DUH DOVR LQ RWKHU W\SHV RI FHOOV 6R LW LV HLWKHU D FDVH RI LQDFFHVVLELOLW\ RI WKH '1$ ELQGLQJ VLWHV LQ QRQO\PSKRLG FHOOV RU WKDW WKHUH PXVW EH DQ LQWHUDFWLRQ ZLWK D % FHOO VSHFLILF SURWHLQ 0DQLDWLV HW DO f 5HFHQWO\ 6HQ DQG %DOWLPRUH f GLVFRYHUHG D IDFWRU SUHVHQW LQ PDQ\ FHOO W\SHV 1)N% WKDW LQWHUDFWV ZLWK WKH NDSSDFKDLQ JHQH HQKDQFHU EXW RQO\ DIWHU PRGLILFDWLRQ WR DQ DFWLYH IRUP LQ %FHOOV 1HJDWLYH UHJXODWLRQ RI JHQH H[SUHVVLRQ LV DQ ROG VXEMHFW IRU SURNDU\RWLF PROHFXODU ELRORJLVWV EXW LV UHODWLYHO\ QHZ WR HXNDU\RWLF JHQH UHJXODWLRQ 7KH ILUVW GHVFULSWLRQ RI WKH 69 HQKDQFHU HOHPHQW FDXVHG HYHU\RQH WR VHDUFK IRU VLPLODU HOHPHQWV LQ RWKHU JHQHV DQG WKH LGHQWLILFDWLRQ RI QHJDWLYH UHJXODWRU\ VHTXHQFHV HVSHFLDOO\ LQ YLUDO HQKDQFHUV KDV KDG D VLPLODU HIIHFW ,W LV LPSRUWDQW WR XQGHUVWDQG WKDW

PAGE 30

QHJDWLYH UHJXODWRU\ VHTXHQFHV FDQ EH GLYLGHG LQWR WZR JURXSV f WKRVH VHTXHQFHV WKDW VKXW RII DFWLYLW\ RI DQRWKHU UHJXODWRU\ HOHPHQW VXFK DV DQ HQKDQFHUf DQG KDYH EHHQ IRXQG WR H[LVW ZLWKLQ WKH FRQILQHV RI WKH HQKDQFHU HOHPHQW DQG f VHTXHQFHV WKDW DFW LQGHSHQGHQWO\ RI RWKHU UHJXODWRU\ HOHPHQWV WR FRQWURO WKH OHYHO RI JHQH H[SUHVVLRQ 7KLV ODWWHU W\SH RI HOHPHQW LV WKH QHZHVW GLVFRYHUHG DQG DV VXFK LV OHVV ZHOO FKDUDFWHUL]HG $Q LQWHUHVWLQJ GLVWLQFWLRQ FDQ EH PDGH LQ WKDW VRPH QHJDWLYH UHJXODWRU\ HOHPHQWV FDQ DFW LQ HLWKHU RULHQWDWLRQ DQG ZLWK VRPH GLVWDQFH LQGHSHQGHQFH DQG DV VXFK KDYH EHHQ FDOOHG HLWKHU GHKDQFHUV RU VLOHQFHUV %DQLDKPDG HW DO /DLPLQV HW DO 5HPPHUV HW DO f 1HJDWLYH UHJXODWLRQ RI YLUDO HQKDQFHU HOHPHQWV LV EHVW W\SLILHG E\ WKH ,J+ HQKDQFHU LQ ZKLFK :DV\O\N DQG :DV\O\N f KDYH VKRZQ WKDW VHTXHQFHV RQ HLWKHU VLGH RI WKH FHQWUDO FRUH VHTXHQFH GRZQ UHJXODWH H[SUHVVLRQ LQ ILEUREODVWV DV FRPSDUHG WR %FHOOV ,W LV REYLRXV WKDW DV PHQWLRQHG DERYH WKHUH PXVW EH D PHFKDQLVP E\ ZKLFK WKH DSSURSULDWH JHQHV DUH H[SUHVVHG DW WKH ULJKW WLPHV LQ WKH ULJKW WLVVXHV 7KLV PD\ RFFXU WKURXJK WKH UHJXODWLRQ RI PDQ\ SURWHLQ IDFWRUV EXW PRUH OLNHO\ WKHUH LV RQH SURWHLQ WKDW UHJXODWHV WKH RUJDQL]DWLRQ RI WKH RWKHU WUDQVFULSWLRQDO IDFWRUV ,W VHHPV DSSDUHQW WKDW WKH FRPSOH[LW\ RI WKH HXNDU\RWLF SURPRWHU ZRXOG LQ PDQ\ FDVHV SHUPLW JUHDW VSHFLILFLW\ RI H[SUHVVLRQ EXW FRXOG EH D UHJXODWRU\ QLJKWPDUH IRU WKH FHOO $Q H[TXLVLWH H[DPSOH RI FRRUGLQDWH UHJXODWLRQ RI PDQ\ JHQHV LV IRXQG LQ WKH $GHQRYLUXV V\VWHP DQG WKH (OD SURWHLQ (OD RQH RI WKH LPPHGLDWH HDUO\ SURWHLQV SURGXFHG LQ HDUO\ LQIHFWLRQ FRRUGLQDWHV WKH H[SUHVVLRQ

PAGE 31

RI VHYHUDO RWKHU JHQHV
PAGE 32

DIILQLWLHV IRU WKH YDULRXV HQKDQFHUV DQG VXUSULVLQJO\ WKH DIILQLW\ RI WKH LQWHUDFWLRQ GLG QRW QHFHVVDULO\ UHODWH WR WKH OHYHO RI H[SUHVVLRQ $ QXPEHU RI FHOOXODU JHQHV KDYH EHHQ VKRZQ WR FRQWDLQ QHJDWLYH UHJXODWRU\ HOHPHQWV DOWKRXJK WKHLU VSHFLILF PRGH RI DFWLRQ KDV QRW EHHQ FKDUDFWHUL]HG 7KHVH JHQHV LQFOXGH PRXVH LQWHUIHURQ *RRGERXUQ HW DO f PRXVH FP\F 5HPPHUV HW DO f UDW LQVXOLQ JHQH /DLPLQV HW DO f FKLFNHQ O\VR]\PH %DQLDKPDG HW DO f PRXVH S WXPRU DQWLJHQ %LHQ]7DGPRRU HW DO f FKLFNHQ RYDOEXPLQ *DXE HW DO f DQG UDW RIHWRSURWHLQ 0XJOLD DQG 5RWKPDQ'HQHV f 7KLV OLVW LQFOXGHV JHQHV LQ ZKLFK WKH QHJDWLYH HOHPHQW LV VLWXDWHG ZLWKLQ DQ HQKDQFHU PRXVH LQWHUIHURQf DQG WKRVH LQ ZKLFK LW LV LQWHUVSHUVHG EHWZHHQ RWKHU SURPRWHU HOHPHQWV FKLFNHQ O\VR]\PH DQG UDW TIHWRSURWHLQf 7KH PRVW ZHOO FKDUDFWHUL]HG RI WKHVH DUH WKH FKLFNHQ O\VR]\PH DQG PRXVH LQWHUIHURQ JHQHV LQ ZKLFK WKH VHTXHQFHV UHVSRQVLEOH IRU WKH QHJDWLYH HIIHFW KDYH EHHQ LGHQWLILHG *RRGERXUQ HW DO %DQLDKPDG HW DO f 7KH FKLFNHQ O\VR]\PH JHQH LV SDUWLFXODUO\ RI LQWHUHVW EHFDXVH LW FRQWDLQV VHYHUDO SRVVLEOH QHJDWLYH UHJXODWRU\ VHTXHQFHV ORFDWHG DW DQG NE IURP WKH VWDUW RI WUDQVFULSWLRQ DQG WKH\ DUH ZHOO VHSDUDWHG IURP WKH HQKDQFHU HOHPHQW LGHQWLILHG NE XSVWUHDP 7KHLVHQ HW DO f $GGLWLRQDOO\ LW LV LQWHUHVWLQJ WKDW ERWK WKH FKLFNHQ O\VR]\PH DQG WKH UDW LQVXOLQ JHQH QHJDWLYH UHJXODWRU\ HOHPHQWV DUH FRQWDLQHG ZLWKLQ UHSHWLWLYH HOHPHQWV 7KH FKLFNHQ O\VR]\PH HOHPHQW LV IRXQG ZLWKLQ WKH &5 UHSHDW ZKLFK LV D PLGGOH UHSHWLWLYH VHTXHQFH DQG KDV OLPLWHG KRPRORJ\ WR WKH PDPPDOLDQ $OXW\SH VHTXHQFHV $GGLWLRQDOO\ WKH &5 UHSHDWV QHDU WKH FKLFNHQ RYDOEXPLQ JHQH DUH IRXQG LQ DUHDV ZKHUH WKHUH

PAGE 33

LV D FKDQJH LQ WKH '1DVHO VHQVLWLYLW\ ZKHQ WKH RYDOEXPLQ JHQH LV LQGXFHG SHUKDSV LQGLFDWLYH RI D SURWHLQ'1$ LQWHUDFWLRQ 6WXPSK HW DO f 7KH UDW LQVXOLQ HOHPHQW LV D PHPEHU RI WKH IDPLO\ RI ORQJ LQWHUVSHUVHG UDW UHSHWLWLYH VHTXHQFHV /,1(6f WKDW DUH SUHVHQW LQ DERXW FRSLHV SHU FHOO /DLPLQV HW DO f 7KH IDFW WKDW VRPH RI WKH QHJDWLYH UHJXODWRU\ HOHPHQWV LGHQWLILHG VR IDU DUH DVVRFLDWHG ZLWK PLGGOH UHSHWLWLYH VHTXHQFHV KDV DWWUDFWHG DWWHQWLRQ 6RPH LQYHVWLJDWRUV KDYH SURSRVHG WKDW WKH IXQFWLRQ RI WKLV DUUDQJHPHQW PD\ EH WR FRRUGLQDWH WUDQVFULSWLRQDO GRPDLQV 7KH LVRODWLRQ RI D GRPDLQ E\ EORFNLQJ LW RII ZLWK UHSHWLWLYH HOHPHQWV ZRXOG EH FRQVLVWHQW ZLWK WKH VWUXFWXUH RI HXNDU\RWLF FKURPDWLQ DV ZH XQGHUVWDQG LW WRGD\ DQG ZRXOG DOORZ IRU FRRUGLQDWH FRQWURO RI D JHQH RU VHW RI JHQHV RI UHODWHG IXQFWLRQ /DLPLQV HW DO f 1HJDWLYH UHJXODWRU\ HOHPHQWV DUH VWLOO DZDLWLQJ WKH LGHQWLILFDWLRQ RI IDFWRUV WKDW LQWHUDFW ZLWK WKHP DQG FKDUDFWHUL]DWLRQ RI WKH SURWHLQ'1$ DQG SURWHLQSURWHLQ LQWHUDFWLRQV WKDW UHVXOW LQ WKH QHJDWLYH UHJXODWLRQ RI WUDQVFULSWLRQ +LVWRQH *HQHV +LVWRQH SURWHLQV KDYH EHHQ NQRZQ IRU D FRQVLGHUDEOH WLPH DQG WKHLU FRPSRVLWLRQ KDV EHHQ WKH VXEMHFW RI PXFK LQYHVWLJDWLRQ UHYLHZHG LQ ,VHQEHUJ f /LWWOH ZDV NQRZQ KRZHYHU DERXW WKH JHQHV HQFRGLQJ WKHVH DFLGLF SURWHLQV XQWLO WKH ODWH V DQG WKH V ZKHQ PDQ\ LQYHVWLJDWRUV WRRN DGYDQWDJH RI WKH VL]H RI WKH KLVWRQH PHVVDJHV DQG WKHLU UHODWLYH DEXQGDQFH WR LQYHVWLJDWH WKH UHJXODWLRQ RI WKLV VHW RI JHQHV 7KH KLVWRQH JHQHV KDYH PDQ\ FKDUDFWHULVWLFV WKDW PDNH WKHP DQ

PAGE 34

DWWUDFWLYH PRGHO V\VWHP IRU WKH LQYHVWLJDWLRQ RI UHJXODWLRQ 7KH\ DUH FRRUGLQDWHO\ H[SUHVVHG GXULQJ 6SKDVH RI WKH FHOO F\FOH DQG WKLV H[SUHVVLRQ LV WKH UHVXOW RI ERWK WUDQVFULSWLRQDO DQG SRVWWUDQVFULSWLRQDO SURFHVVHV $GGLWLRQDOO\ WKHLU VPDOO VL]H DQG EDVLF VWUXFWXUH QR LQWURQV PLQLPDO SURFHVVLQJf PDNH WKHP DQ HDV\ V\VWHP WR PDQLSXODWH DQG VWXG\ 0D[VRQ HW DO f ,I ZH FDQ XQGHUVWDQG KRZ WKH KLJKO\ FRXSOHG H[SUHVVLRQ RI WKH KLVWRQH JHQHV LV FRQWUROOHG SHUKDSV ZH FDQ WKHQ XQGHUVWDQG KRZ RWKHU JHQHV DUH H[SUHVVHG FRRUGLQDWHO\ DQG RWKHUZLVH +LVWRULFDO EDFNJURXQG 2QH RI WKH LQLWLDO REVHUYDWLRQV UHJDUGLQJ KLVWRQH SURWHLQV ZDV WKDW WKH\ DUH SUHVHQW LQ D UHODWLYHO\ LQYDULDQW PRODU UDWLR ZLWK '1$ LQ WKH FHOO 3UHVFRWW f ,W ZDV IXUWKHU GHPRQVWUDWHG WKDW WKH DPRXQW RI KLVWRQH SURWHLQ SUHVHQW LQ D FHOO GRXEOHG GXULQJ 6SKDVH RI WKH FHOO F\FOH %ORFK HW DO f 6XFK UHVXOWV VXJJHVWHG D SRVVLEOH FRXSOLQJ EHWZHHQ WKHVH WZR PHWDEROLF HYHQWV %RUXQ HW DO f ZHUH DEOH WR GHPRQVWUDWH WKDW D FODVV RI SRO\ULERVRPHV 6f ZHUH VHOHFWLYHO\ HQULFKHG GXULQJ 6 SKDVH RI WKH +H/D FHOO F\FOH DQG WKDW WKH\ FRGHG IRU KLVWRQHOLNH SRO\SHSWLGHV LQ YLWUR WKXV JLYLQJ PRUH FUHGHQFH WR WKH UHODWLRQVKLS WKDW KDG EHHQ GHPRQVWUDWHG HDUOLHU %RUXQ HW DO DOVR QRWHG VHYHUDO SURSHUWLHV RI WKHVH VPDOO P51$V WKDW KDYH EHFRPH WKH IRXQGDWLRQ RI SUHVHQW GD\ WKHRU\ DERXW KLVWRQH P51$ UHJXODWLRQ f WKH DGGLWLRQ RI F\WRVLQH DUDELQRVLGH FDXVHG D IRXUIROG LQFUHDVH LQ WKH KLVWRQH P51$ GHVWDELOL]DWLRQ UDWH DV FRPSDUHG WR DFWLQRP\FLQ WUHDWHG FHOOV f WKH QHZO\ V\QWKHVL]HG 6 51$ DW WKH *O6 ERXQGDU\ EHFDPH DVVRFLDWHG ZLWK SRO\ULERVRPHV WKXV EHJLQQLQJ KLVWRQH V\QWKHVLV DQG f WZR KRXUV

PAGE 35

EHIRUH WKH HQG RI '1$ V\QWKHVLV LQ V\QFKURQL]HG +H/D FHOOV 6 P51$ WUDQVFULSWLRQ FHDVHG DQG WKH UHPDLQLQJ 6 P51$ GHFD\HG ZLWK DSSUR[LPDWHO\ D RQH KRXU KDOI OLIH %RUXQ HW DO SURSRVHG VRPHZKDW LQFRUUHFWO\ WKDW WKH FRQWURO RI KLVWRQH P51$ OHYHOV ZDV WKURXJK WUDQVFULSWLRQDO UHJXODWLRQ 7KH UHILQHPHQW RI PROHFXODU WHFKQLTXHV KDV DOORZHG ODWHU LQYHVWLJDWRUV WR GHILQH WKH GHJUHH WR ZKLFK WUDQVFULSWLRQDO DQG SRVWWUDQVFULSWLRQDO PHFKDQLVPV UHJXODWH KLVWRQH P51$ PHWDEROLVP %XWOHU DQG 0XHOOHU f UHSHDWHG DQG H[WHQGHG WKH UHVXOWV RI %RUXQ E\ GHPRQVWUDWLQJ VHYHUDO EDVLF IDFWV )LUVW F\FORKH[LPLGH ZDV DEOH WR VWDELOL]H KLVWRQH P51$ LQ WKH SUHVHQFH RI K\GUR[\XUHD D SRWHQW LQKLELWRU RI '1$ V\QWKHVLV :KHQ DGGHG WR V\QFKURQL]HG +H/D &HOOV K\GUR[\XUHD FDXVHV D YHU\ UDSLG GHVWDELOL]DWLRQ RI DOPRVW DOO KLVWRQH P51$V bf YLD WKH FRPSOHWH VKXWGRZQ RI '1$ V\QWKHVLV %DXPEDFK HW DO +HLQW] HW DO 6LWWPDQ HW DO f 7KLV VXJJHVWV WKDW D SURWHLQVf LV DUHf QHFHVVDU\ IRU WKH GHVWDELOL]DWLRQ SURFHVV WR RFFXU 7KH b RI KLVWRQH PHVVDJH WKDW UHPDLQV LV LQVHQVLWLYH WR K\GUR[\XUHD DQG SUREDEO\ UHSUHVHQWV UHSOLFDWLRQ LQGHSHQGHQW KLVWRQH JHQH P51$V :HOOV DQG .HGHV :X DQG %RQQHU f 6HFRQG WUDQVFULSWLRQ LV QRW QHFHVVDU\ IRU WKH SURGXFWLRQ RI WKLV SXWDWLYH GHVWDELOL]DWLRQ IDFWRU DV WKH DGGLWLRQ RI D WUDQVFULSWLRQ LQKLELWRU KDV QR HIIHFW RQ WKH VXEVHTXHQW GHVWDELOL]DWLRQ RI KLVWRQH P51$ 7KLUG %XWOHU DQG 0XHOOHU f GHPRQVWUDWHG D WUDQVLHQW LQFUHDVH LQ WKH SRRO RI IUHH KLVWRQH SURWHLQV IRU PLQXWHV DIWHU WUHDWPHQW ZLWK K\GUR[\XUHD 7KH\ VXJJHVWHG LQ WKHLU UHJXODWRU\ PRGHO WKDW WKH IUHH KLVWRQH SURWHLQV PLJKW DXWRJHQRXVO\ UHJXODWH WKH WUDQVODWLRQ RI WKHLU RZQ PHVVDJH DQGRU WKH

PAGE 36

VWDELOLW\ RI WKH UHPDLQLQJ PHVVDJH IROORZLQJ WKH FHVVDWLRQ RI '1$ V\QWKHVLV 1HDUO\ \HDUV ODWHU WKH LGHD RI DXWRJHQRXV UHJXODWLRQ KDV JDLQHG SRSXODULW\ VLQFH 5RVV DQG FRZRUNHUV f KDYH VR DSWO\ GHPRQVWUDWHG WKH VSHFLILF GHJUDGDWLRQ RI KLVWRQH P51$ LQ YLWUR DQG WKH LVRODWLRQ RI D QXFOHDVH DFWLYLW\ WKDW GHJUDGHV SRO\ $ PLQXV PHVVDJHV IURP WKH n HQG 7KH KLVWRQH HQULFKHG HQYLURQPHQW RI WKH VHD XUFKLQ JHQRPH DOORZHG IRU WKHLU HDUO\ LVRODWLRQ E\ HTXLOLEULXP FHQWULIXJDWLRQ DQG VXEVHTXHQWO\ WKH FKDUDFWHUL]DWLRQ RI WKH FRGLQJ DQG VSDFHU UHJLRQ EDVH FRPSRVLWLRQ %LUQVWLHO f 7KH VHD XUFKLQ JHQHV KDYH EHHQ VXFFHVVIXOO\ XVHG DV SUREHV IRU WKH LVRODWLRQ RI KLVWRQH JHQHV IURP VHYHUDO VSHFLHV LQFOXGLQJ YHUWHEUDWHV VXFK DV ;HQRSXV 0RRUPDQ HW DO f DQG PRXVH 6HLOHU7X\QV DQG %LUQVWLHO f 7KH KLJKHU YHUWHEUDWH KLVWRQH JHQHV ZHUH WKHQ XVHG WR H[SHGLWH WKH LVRODWLRQ RI WKH KXPDQ KLVWRQH JHQHV &ODUN HW DO +HLQW] HW DO 6LHUUD HW DO f 7KH UHSOLFDWLRQ GHSHQGHQW KLVWRQH JHQHV ZKLFK FRPSULVH WKH PDMRULW\ RI H[SUHVVHG KLVWRQH JHQHV DUH FKDUDFWHUL]HG E\ D ODFN RI LQWURQV DQG DQ H[WUHPHO\ ZHOO FRQVHUYHG n HQG VHTXHQFH WKDW FRQVLVWV RI DQ ES VWHP DQG ORRS VWUXFWXUH +XPDQ KLVWRQH JHQH RUJDQL]DWLRQ 7KH LVRODWLRQ RI WKH KXPDQ KLVWRQH JHQHV ZKLFK KDG SUHYLRXVO\ EHHQ VR LQWHQVLYHO\ VWXGLHG SHUPLWWHG WKH SURSRVHG UHJXODWRU\ K\SRWKHVHV WR EH WHVWHG 7KH RUJDQL]DWLRQDO SDWWHUQ RI WKH KXPDQ KLVWRQH JHQHV ZDV XQFRYHUHG E\ UHVWULFWLRQ HQ]\PH DQDO\VLV DQG 6RXWKHUQ EORW K\EULGL]DWLRQ 6RXWKHUQ f RI UHVWULFWHG SKDJH FORQHV GHPRQVWUDWHG WKDW XQOLNH WKH WDQGHP UHSHDWV RI WKH ORZHU HXNDU\RWHV WKH KXPDQ JHQHV ZHUH FOXVWHUHG EXW KDG QR REYLRXV

PAGE 37

RUJDQL]DWLRQDO SDWWHUQ 6LHUUD HW DO +HLQW] HW DO DQG &ODUN HW DO f 6LHUUD HW DO f ZHUH DEOH WR LVRODWH ODPEGD &KDURQ $ SKDJH FORQHV UHSUHVHQWDWLYH RI WKUHH IDPLOLHV RU FOXVWHUV 8QOLNH WKH ORZHU HXNDU\RWLF RUJDQL]DWLRQ QRQH RI WKHVH FOXVWHUHG JURXSV RI KXPDQ KLVWRQH JHQHV FRQWDLQHG D KXPDQ +, JHQH %\ XVLQJ D FKLFNHQ +, VSHFLILF SUREH &DUR]]L HW DO f LVRODWHG D FORQH WKDW KDG DOO KXPDQ KLVWRQH JHQHV LQFOXGLQJ DQ +, KLVWRQH 5HFHQWO\ VHYHUDO KXPDQ KLVWRQH JHQHV KDYH EHHQ ORFDOL]HG WR GLIIHUHQW FKURPRVRPHV 7ULSXWWL HW DO *UHHQ HW DO f 7KLV VXJJHVWV WKDW FRRUGLQDWH FRQWURO RI KXPDQ KLVWRQH JHQH H[SUHVVLRQ PLJKW QRW EH DV HDVLO\ UHJXODWHG DV LQ ORZHU HXNDU\RWHV $QRWKHU TXHVWLRQ WKDW KDG QRW EHHQ DGGUHVVHG XS WR WKLV WLPH ZDV ZKHWKHU GLIIHUHQW KLVWRQH P51$V ZHUH WKH SURGXFW RI GLIIHUHQW KLVWRQH JHQHV /LFKWOHU HW DO f GHPRQVWUDWHG FRQYLQFLQJO\ WKDW VHYHQ VSHFLHV RI KXPDQ + KLVWRQH P51$ ZHUH HQFRGHG E\ DW OHDVW VHSDUDWH JHQHV WKHUHE\ HVWDEOLVKLQJ WKDW WKH KXPDQ KLVWRQH JHQHV DUH D UHSHWLWLYH IDPLO\ RI JHQHV EXW QRW UHGXQGDQW /LFKWOHU HW DO f DOVR VWUHQJWKHQHG WKH SRVVLELOLW\ WKDW GLIIHUHQW KLVWRQH JHQHV PLJKW EH VXEMHFW WR GLYHUVH UHJXODWLRQ VLQFH LW ZDV REYLRXV WKDW FHUWDLQ + P51$V ZHUH SUHVHQW DW KLJKHU OHYHOV WKDQ RWKHUV 7UDQVFULSWLRQDO DQG 3RVWWUDQVFULSWLRQDO UHJXODWLRQ 2XU NQRZOHGJH DERXW WKHVH WZR VWHSV LQ WKH UHJXODWLRQ RI KLVWRQH P51$ PHWDEROLVP KDV EHHQ VWUHQJWKHQHG E\ WKH VWXGLHV RI +HLQW] HW DO f 6LWWPDQ HW DO f DQG 3OXPE HW DO DEf 3OXPE HW DO Ef XWLOL]HG +H/D FHOOV V\QFKURQL]HG E\ GRXEOH WK\PLGLQH EORFN DQG K\EULG VHOHFWLRQ RI SXOVH ODEHOOHG KLVWRQH P51$ 7KLV WHFKQLTXH SHUPLWWHG VHYHUDO

PAGE 38

VSHFLHV RI KLVWRQH P51$ WR EH LVRODWHG RQ DFU\ODPLGH JHOV 7KHVH H[SHULPHQWV GHPRQVWUDWHG WKDW WKH KLVWRQH JHQHV DUH WUDQVFULEHG LQ WKH HDUO\ SDUW RI 6SKDVH DSSUR[LPDWHO\ KRXUV SRVW UHOHDVH IURP GRXEOH WK\PLGLQH EORFN 7KH LQFUHDVH LQ WKH KLVWRQH P51$ WUDQVFULSWLRQ ZDV IROG GXULQJ WKLV SHULRG %DXPEDFK HW DO f GHPRQVWUDWHG D VLPLODU LQFUHDVH LQ WKH OHYHO RI KLVWRQH JHQH WUDQVFULSWLRQ DW WKH EHJLQQLQJ RI 6SKDVH ZLWK QXFOHDU UXQRQ DQDO\VLV +RZHYHU RQH RI WKH DQRPDOLHV RI KLVWRQH JHQH H[SUHVVLRQ LV WKDW LI RQH IROORZV WKH WRWDO LQFUHDVH LQ WKH DPRXQW RI KLVWRQH P51$ WKH DFWXDO HOHYDWLRQ LV IURP IROG 3OXPE HW DO E +HLQW] HW DO f 7KH DFWXDO GLIIHUHQFHV LQ KLVWRQH P51$ OHYHOV KDYH YDULHG IURP RQH UHSRUW WR DQRWKHU DQG WKLV LV SUREDEO\ WKH UHVXOW RI WKH YDULRXV V\QFKURQL]DWLRQ DQG DQDO\VLV WHFKQLTXHV XWLOL]HG &RQVHUYDWLYHO\ WKH OHYHO RI WUDQVFULSWLRQ LQFUHDVHV IROG GXULQJ WKH ILUVW KRXUV RI 6 SKDVH DQG WKH VWDELOLW\ RI KLVWRQH P51$ ULVHV WLPHV GXULQJ 6SKDVH r 2XWVLGH RI 6 SKDVH RU DIWHU WKH DUWLILFLDO FHVVDWLRQ RI '1$ V\QWKHVLV E\ GUXJ WUHDWPHQW WKH KDOIOLIH RI KLVWRQH P51$ LV DSSUR[LPDWHO\ PLQV 6LWWPDQ HW DO 3OXPE HW DO Df 1XFOHDVH VHQVLWLYLW\ DQG 3URWHLQ'1$ LQWHUDFWLRQ +LVWRULFDOO\ D KDOOPDUN RI DQ DFWLYH JHQH KDV EHHQ WKH SUHVHQFH RI QXFOHDVH K\SHUVHQVLWLYH VLWHV LQ WKH SURPRWHU UHJLRQ RI WKH JHQH &KU\VRJHORV HW DO f DQG 0RUHQR HW DO f KDYH H[WHQVLYHO\ FKDUDFWHUL]HG WKH QXFOHDVH VHQVLWLYLWLHV RI WKH IODQNLQJ DQG FRGLQJ UHJLRQV RI WKH ) KXPDQ + KLVWRQH JHQH 7RJHWKHU WKHLU UHVXOWV GHPRQVWUDWH WKDW WKH n UHJLRQ RI WKH ) + JHQH LV D G\QDPLF DUHD RI YDU\LQJ VHQVLWLYLW\ WR '1DVH PLFURFRFFDO DQG 6, QXFOHDVH 6LQFH WKH KLVWRQH JHQHV DUH FHOO

PAGE 39

F\FOH UHJXODWHG ZLWK UHVSHFW WR WUDQVFULSWLRQ DQG WRWDO PHVVDJH OHYHOV &KU\VRJHORV HW DO f ZHUH DEOH WR FRUUHODWH WKH VL]H RI WKH '1DVH K\SHUVHQVLWLYH VLWH ZLWK WKH VWDJH RI WKH FHOO F\FOH $V PHQWLRQHG HDUOLHU WKH DSSHDUDQFH RI D '1DVHO K\SHUVHQVLWLYH VLWH LV LQGLFDWLYH RI SURWHLQ'1$ LQWHUDFWLRQV LQ WKH UHJLRQ 3DXOL HW DO f XWLOL]HG WKH WHFKQLTXH RI JHQRPLF VHTXHQFLQJ WR YLVXDOL]H WKH LQ YLYR SURWHLQ'1$ LQWHUDFWLRQV LQ WKH SURPRWHU RI WKH ) KXPDQ + KLVWRQH JHQH 7KH\ GHPRQVWUDWHG WKDW WKHUH DUH WZR ELQGLQJ VLWHV LQ WKH SUR[LPDO SURPRWHU UHJLRQ ZKLFK KDYH EHHQ GHVLJQDWHG 6LWH ES WR ESf DQG 6LWH ,, ES WR ESf 6LWH FRQWDLQV D SXWDWLYH 6SO VLWH DQG D SRVVLEOH &$$7 ER[ 6LWH ,, FRQWDLQV WKH **7&& HOHPHQW VHH EHORZf DQG WKH 7$7$$ ER[ 7KH SURWHLQ'1$ FRPSOH[HV DW 6LWH DQG 6LWH ,, DUH SUHVHQW WKURXJKRXW WKH FHOO F\FOH DQG SUHVXPDEO\ WKHVH LQWHUDFWLRQV LQ WKH SURPRWHU UHJLRQ DUH LQYROYHG LQ WKH EDVDO DQG LQFUHDVHG OHYHO RI WUDQVFULSWLRQ GHPRQVWUDWHG DW WKH RQVHW RI 6SKDVH 3HUKDSV WKH LQWHUDFWLRQV WKDW UHJXODWH WKH OHYHO RI WUDQVFULSWLRQ DW WKH VWDUW RI 6SKDVH RFFXU WKURXJK SURWHLQSURWHLQ LQWHUDFWLRQV VLQFH WKHUH LV QR DSSDUHQW FKDQJH LQ WKH SURWHLQ'1$ LQWHUDFWLRQV GXULQJ WKH FHOO F\FOH ,Q VWXGLHV GRQH E\ +HLQW] DQG 5RHGHU f LW ZDV GHPRQVWUDWHG WKDW WKH S+X+ KLVWRQH JHQH ZDV WUDQVFULEHG LQ YLWUR WR D JUHDWHU H[WHQW LQ 6SKDVH H[WUDFWV WKDQ LQ *SKDVH H[WUDFWV ,W ZRXOG EH LPSRUWDQW WR NQRZ ZKHWKHU WKHUH LV D QHZ SURWHLQ WKDW DSSHDUV DW WKH RQVHW RI 6SKDVH WKDW DFWV HLWKHU GLUHFWO\ WR DXJPHQW WUDQVFULSWLRQ E\ LQWHUDFWLQJ ZLWK WKH '1$ RU WKURXJK D SURWHLQSURWHLQ LQWHUDFWLRQ 6LQFH WKH LGHQWLILFDWLRQ RI SURWHLQ'1$ LQWHUDFWLRQV LQ WKH SURPRWHU RI WKH ) + JHQH LW KDV EHHQ RI JUHDW LQWHUHVW WR

PAGE 40

XV WR DVFHUWDLQ LI WKHUH LV DQ\ IXQFWLRQDOLW\ LQ WKH LQWHUDFWLRQ DQG WKLV LV DGGUHVVHG WR VRPH H[WHQW LQ WKLV ZRUN 2WKHU KLVWRQH JHQHV IURP D YDULHW\ RI VSHFLHV KDYH EHHQ FKDUDFWHUL]HG ZLWK UHVSHFW WR WKH FRQWULEXWLRQ RI n IODQNLQJ VHTXHQFHV LQ WUDQVFULSWLRQDO UHJXODWLRQ 1RWDEO\ WKH KXPDQ +% JHQH KDV EHHQ H[WHQVLYHO\ FKDUDFWHUL]HG ZLWK LQ YLWUR WUDQVFULSWLRQ E\ 6LYH HW DO f 7KH\ GHPRQVWUDWHG WKDW WKH WUDQVFULSWLRQ RI WKH +% JHQH LV GHSHQGHQW RQ D QXPEHU RI VHTXHQFHV n WR WKH 7$7$ ER[ LQFOXGLQJ WKH +% RFWDPHU HOHPHQW DQG &&$$7 ER[ 5HFHQWO\ WKH HPSKDVLV KDV EHHQ SODFHG RQ LGHQWLILFDWLRQ RI WKH VHTXHQFHV UHVSRQVLEOH IRU WKH SHULRGLF LQFUHDVH LQ KLVWRQH JHQH WUDQVFULSWLRQ GXULQJ WKH FHOO F\FOH $UWLVKHYVN\ HW DO f KDYH GHPRQVWUDWHG DOWKRXJK QRW FRQYLQFLQJO\ WKDW WKH VHTXHQFHV UHVSRQVLEOH IRU WKH 6SKDVH LQFUHDVH LQ WUDQVFULSWLRQ RI D KDPVWHU + JHQH DUH ORFDWHG LQ WKH SUR[LPDO SURPRWHU UHJLRQ ESf KRZHYHU WKH\ ZHUH QRW H[SOLFLWO\ GHILQHG 7KH DXWKRUV SURSRVH WKDW WKLV UHJLRQ RI WKH KDPVWHU + JHQH EHDUV VLPLODULW\ WR WKH VHTXHQFH n*&*$$$n WKDW KDV EHHQ VKRZQ WR UHJXODWH WKH FHOO F\FOH H[SUHVVLRQ RI WKH +2 JHQHV RI \HDVW 1DVP\WK f 7DNHQ DV D ZKROH WKHVH PDQ\ UHVXOWV VXSSRUW WKH LGHD WKDW WKH KLVWRQH JHQHV DUH FRQWUROOHG DW WKH WUDQVFULSWLRQDO OHYHO E\ SURPRWHUV WKDW DUH FRPSRVHG RI PDQ\ HOHPHQWV WKDW LQWHUDFW ZLWK GLIIHUHQW DQG VSHFLILF SURWHLQV 7KRXJK QRW GHDOW ZLWK KHUH YDQ :LMQHQ HW DO f KDYH VKRZQ WKDW WKH SURPRWHU UHJLRQ RI VHYHUDO FORQHG KXPDQ KLVWRQH JHQHV FDQ LQWHUDFW ZLWK QXFOHDU SURWHLQV LQ D VSHFLILF PDQQHU

PAGE 41

6HTXHQFH DQDO\VLV 2QO\ D IHZ KLVWRQH JHQHV KDYH EHHQ VHTXHQFHG H[WHQVLYHO\ HQRXJK WR SHUPLW D FRPSDUDWLYH DQDO\VLV RI n IODQNLQJ VHTXHQFHV 7KH PDMRULW\ RI VHTXHQFLQJ LQIRUPDWLRQ FRQFHUQLQJ KLVWRQH JHQHV KDV UHYROYHG DURXQG WKH FRGLQJ VHTXHQFHV &RPSDUDWLYH DQDO\VLV RI WKHVH SURWHLQ VHTXHQFHV KDV UHYHDOHG UHPDUNDEOH KRPRJHQHLW\ IURP VSHFLHV WR VSHFLHV HVSHFLDOO\ ZLWK UHVSHFW WR KLVWRQHV + DQG + :HOOV f 8QIRUWXQDWHO\ OLWWOH n IODQNLQJ VHTXHQFH IRU + KLVWRQH JHQHV KDV EHHQ SXEOLVKHG DQG PRVW VHTXHQFHV H[WHQG RQO\ QXFOHRWLGHV XSVWUHDP :HOOV f $ FRPSDULVRQ RI WKH )$ + KLVWRQH JHQH 6LHUUD HW DO f ZKLFK P\ VWXGLHV KDYH LQYROYHG DQG WKH KXPDQ + KLVWRQH JHQH LQGHSHQGHQWO\ LVRODWHG E\ +HLQW] HW DO f VXJJHVWV WKDW VRPH RI WKH VHTXHQFHV LQ WKH n SUR[LPDO SURPRWHU UHJLRQ DUH FRQVHUYHGWKH 7$7$ DQG **7&& ER[HV 7KH 7$7$ ER[ LV RI FRXUVH D FDQRQLFDO 51$ SRO\PHUDVH ,, WUDQVFULSWLRQ VHTXHQFH DQG WKH **7&& ER[ KDV EHHQ DVVRFLDWHG ZLWK PDQ\ + JHQH SURPRWHUV IURP VHD XUFKLQ WR KXPDQ +HQWVFKHO DQG %LUQVWLHO :HOOV f &RPSDULVRQ RI WKH ) JHQH WR WKH PRXVH + JHQH LVRODWHG E\ 6HLOHU 7X\QV DQG %LUQVWLHO f UHYHDOV H[WHQVLYH VLPLODULW\ EHWZHHQ WKH SURPRWHUV HVSHFLDOO\ WKH 7$7$ ER[ **7&& HOHPHQW DQG WKH &$$7 VHTXHQFH WKDW LV IRXQG DV HLWKHU D VLQJOH RU GRXEOH FRS\ ORFDWHG MXVW n WR WKH **7&& HOHPHQW LQ PDQ\ + KLVWRQH JHQHV :HOOV f 7KH VLJQLILFDQFH RI WKH + &$$7 VHTXHQFH LV VRPHZKDW TXHVWLRQDEOH DV LW ZDV RULJLQDOO\ WKRXJKW WR UHSUHVHQW D WKH &&$$7 ER[ WKDW LV DVVRFLDWHG ZLWK PDQ\ 51$ SRO\PHUDVH ,, SURPRWHUV 7KHUH KDYH EHHQ VHYHUDO &&$$7 ER[ IDFWRUV LVRODWHG DQG DOO RI WKHP UHTXLUH IRU JRRG ELQGLQJ WKH VHTXHQFH n&&$$7n 'RUQ HW DO f 7KH +

PAGE 42

KLVWRQH JHQH ZLWK ZKLFK ZH DUH ZRUNLQJ ) GRHV KDYH WZR &&$$7 ER[HV ORFDWHG VHYHUDO KXQGUHG EDVHSDLUV XSVWUHDP DQG WKH SRVVLEOH IXQFWLRQDOLW\ RI ERWK WKH SUR[LPDO &$$7 ER[HV DQG WKH GLVWDO &&$$7 ER[HV LV GLVFXVVHG LQ WKH ZRUN SUHVHQWHG KHUH 7KH IXQFWLRQDOLW\ RI WKHVH DQG RWKHU VHTXHQFHV LQ WKH SURPRWHU RI KLVWRQH JHQHV KDV EHHQ RQH RI WKH IRFXVHV RI RXU ZRUN $OVR WKH +HLQW] DQG 5RHGHU ODERUDWRU\ KDYH LQYHVWLJDWHG WKH IXQFWLRQDOLW\ RI SURPRWHU VHTXHQFHV LQ WKH KXPDQ + JHQH WKH\ LVRODWHG ,Q YLWUR WUDQVFULSWLRQ DQDO\VLV RI %DO GHOHWLRQ PXWDQWV RI WKH ) + JHQH E\ 6LHUUD HW DO f GHPRQVWUDWHG LQ ZKROH FHOO H[WUDFWV WKDW SURPRWHU VHTXHQFHV FRXOG EH GHOHWHG WR ZLWKLQ ES RI WKH FDS VLWH ZLWKRXW ORVV RI WUDQVFULSWLRQ 7KHVH VHTXHQFHV LQFOXGH RQO\ WKH 7$7$ ER[ DQG **7&& HOHPHQW EXW DUH DSSDUHQWO\ VXIILFLHQW IRU DFFXUDWH LQ YLWUR WUDQVFULSWLRQ WR RFFXU ,Q YLWUR WUDQVFULSWLRQ DQDO\VLV E\ +DQO\ HW DO f GHPRQVWUDWHG YHU\ VLPLODU HIIHFWV :KHQ RQO\ WKH 7$7$ ER[ UHPDLQHG DV WKH VROH 51$ SRO\PHUDVH ,, FRQVHQVXV HOHPHQW WUDQVFULSWLRQ ZDV DFFXUDWH EXW DW D UHGXFHG OHYHO +DQO\ HW DO f KDYH VXJJHVWHG WKDW WKH VHTXHQFHV H[WHQGLQJ WR ES DUH VXIILFLHQW IRU PD[LPDO WUDQVFULSWLRQ RI WKH KXPDQ + KLVWRQH JHQH LQ YLWUR 7KH DQDO\VLV RI KLVWRQH JHQH WUDQVFULSWLRQ LQ YLWUR KDV FRQWULEXWHG WR RXU XQGHUVWDQGLQJ RI WKH PLQLPDO UHTXLUHPHQWV IRU n VHTXHQFH KRZHYHU LW KDV EHHQ GHPRQVWUDWHG SUHYLRXVO\ WKDW WKH UHTXLUHPHQWV IRU LQLWLDWLRQ RI P51$ V\QWKHVLV LQ YLWUR DQG LQ YLYR DUH GLIIHUHQW LQ PDQ\ LQVWDQFHV 2QH PLJKW UHDVRQDEO\ DVVXPH WKDW WKH FKURPDWLQ VWUXFWXUH RI

PAGE 43

DQ LQWHJUDWHG JHQH ZRXOG DIIHFW LWV UHJXODWLRQ DQG LQWULQVLF DFFHVVLELOLW\ WR UHJXODWRU\ SURWHLQV :H IHOW LW ZDV QHFHVVDU\ WR H[WHQG WKHVH LQ YLWUR VWXGLHV LQWR VWDEOH FHOO OLQHV IRU WKH UHDVRQV RXWOLQHG DERYH DQG GLVFXVVHG LQ 0DWHULDOV DQG 0HWKRGV &KDSWHU f $ ORJLFDO H[WHQVLRQ RI PDQ\ LQ YLWUR VWXGLHV KDV EHHQ WR PDQLSXODWH WKH SURPRWHU RU FRGLQJ UHJLRQ RI D JHQH LQ YLWUR DQG WR UHSODFH LW LQ YLYR DQG KRSHIXOO\ PHDVXUH WKH DIIHFW RI WKH PDQLSXODWLRQ RQ H[SUHVVLRQ 3HUKDSV WKLV KDV EHHQ PRVW VXFFHVVIXOO\ DFFRPSOLVKHG LQ \HDVW ZKHUH WKH UHLQWURGXFWLRQ RI WKH PDQLSXODWHG JHQH FDQ EH GRQH ZLWK SUHFLVLRQ LQWR WKH H[DFW ORFXV IURP ZKLFK LW FDPH RULJLQDOO\ 6]RVWDN HW DO f 7KLV LV D JRDO VKDUHG E\ PDQ\ PROHFXODU ELRORJLVWV DV LW ZRXOG EH D PRUH DFFXUDWH ZD\ WR DVVHVV VWUXFWXUHIXQFWLRQ UHODWLRQVKLSV +LVWRQH JHQHV KDYH EHHQ WUDQVLHQWO\ H[SUHVVHG LQ D QXPEHU RI GLIIHUHQW FHOO W\SHV .URHJHU HW DO &DSDVVR DQG +HLQW] *UHHQ HW DO %HQGLJ DQG +HQWVFKHO 0DUDVKL HW DO f 7KH WUDQVLHQW DVVD\ DIIRUGV D UHDVRQDEO\ TXLFN ZD\ WR H[DPLQH WKH HIIHFWV RI '1$ PDQLSXODWLRQ 7KH UHVXOWV KDYH VXJJHVWHG WKDW KHWHURORJRXV RU KRPRORJRXV V\VWHPV FDQ EH XVHG WR H[SUHVV WUDQVIHFWHG JHQHV ,Q SUREDEO\ RQH RI WKH PRUH UDGLFDO WUDQVIHFWLRQ H[SHULPHQWV %HQGLJ DQG +HQWVFKHO f LQWURGXFHG WKH HPEU\RQLF KLVWRQH JHQH UHSHDW RI WKH VHD XUFKLQ 3VDPPHFKLQXV PLOLDULV WUDQVLHQWO\ LQWR +H/D FHOOV &RUUHFW n P51$ VWDUW VLWHV ZHUH GHWHFWHG IRU DOO JHQHV RI WKH FOXVWHU EXW WKH WHUPLQDWLRQ RI WUDQVFULSWLRQ ZDV JHQHUDOO\ DEHUUDQW ZLWK WKH H[FHSWLRQ RI WKH +% JHQH 7KLV VHW RI UHVXOWV LV VXJJHVWLYH WKDW KHWHURORJRXV V\VWHPV PD\ VKDUH PDQ\ UHJXODWRU\ FRPSRQHQWV WKDW DOORZ WKHP WR WUDQVFULEH IRUHLJQ JHQHV FRUUHFWO\ EXW PD\ KDYHLQ

PAGE 44

WKLV FDVH n SURFHVVLQJSDUWV RI WKH UHJXODWRU\ PDFKLQHU\ WKDW DUH LQFRPSDWLEOH 7KLV SDUWLFXODU VXEMHFW LV GLVFXVVHG LQ WKH ZRUN SUHVHQWHG KHUH $W WKH SRLQW ZKHUH RXU ZRUN EHJDQ WKH RQO\ VWDEOH FHOO OLQHV FUHDWHG ZLWK DQ LQWHJUDWHG KXPDQ + KLVWRQH JHQH ZHUH E\ &DSDVVR DQG +HLQW] f 7KH\ XWLOL]HG RQH FRQVWUXFW S+X+ WR DVVHVV WKH OHYHO RI + KLVWRQH JHQH UHJXODWLRQ LQ PRXVH /WN FHOOV ,Q YLYR 6, QXFOHDVH DQDO\VLV RI WKLV VLQJOH FRQVWUXFW SHUPLWWHG WKHP WR FRQFOXGH WKDW PRXVH FHOOV FRXOG DFFXUDWHO\ WUDQVFULEH WKH KXPDQ + JHQH *UHHQ HW DO f GHPRQVWUDWHG WKDW WKH ) KXPDQ + KLVWRQH JHQH ZDV H[SUHVVHG LQ PRXVH & OXQJ ILEUREODVWV ,Q WKHVH H[SHULPHQWV WKH ) JHQH ZDV FDUULHG HSLVRPDOO\ RQ D FRQVWUXFW PDGH IURP WKH b WUDQVIRUPLQJ IUDJPHQW RI %RYLQH SDSLOORPD YLUXV :LWK WKLV XQGHUVWDQGLQJ DQG EDFNJURXQG ZH LQLWLDWHG VWXGLHV ZLWK WKH KXPDQ + KLVWRQH JHQH ) 6LHUUD HW DO f WR DVFHUWDLQ WKH LQ YLYR IXQFWLRQDOLW\ RI VHTXHQFHV LQ WKH n SURPRWHU UHJLRQ

PAGE 45

&+$37(5 0$7(5,$/6 $1' 0(7+2'6 ([SHULPHQWDO UDWLRQDOH DQG FRPPHQWDU\ 2I SDUWLFXODU LPSRUWDQFH IRU KLVWRQH DQG RWKHU HXNDU\RWLF JHQHV LV WKH LGHQWLILFDWLRQ RI UHJXODWRU\ VHTXHQFHV DQG PROHFXOHV WKDW PHGLDWH WUDQVFULSWLRQDO FRQWURO 6HYHUDO ODERUDWRULHV LQFOXGLQJ RXU RZQ KDYH FRQGXFWHG LQ YLWUR DQG LQ YLYR H[SHULPHQWV WR DVVHVV WKH IXQFWLRQDOLW\ RI WKH KLVWRQH JHQH FRGLQJ UHJLRQ DQG IODQNLQJ VHTXHQFHV LQ WKH UHJXODWLRQ RI H[SUHVVLRQ YDQ :LMQHQ HW DO 6LHUUD HW DO +HLQW] HW DO 3DXOL HW DO 'DLOH\ HW DO *UHHQ HW DO f :H IHOW WKDW DQ LQ YLYR DSSURDFK YLD WKH LQWURGXFWLRQ RI PRGLILHG JHQHV E\ WUDQVIHFWLRQ KDG WKH DGYDQWDJH WKDW WKH LQWHJUDWHG JHQH ZDV SDFNDJHG DV FKURPDWLQ DQG SUHVXPDEO\ WUDQVFULSWLRQ IDFWRUV VXFK DV 51$ SRO\PHUDVH ,, &7) DQG 6SO ZHUH SUHVHQW LQ SURSHU DQG ORFDOL]HG FRQFHQWUDWLRQV GXH WR WKH VWUXFWXUDO LQWHJULW\ RI WKH QXFOHXV 7KHUHIRUH WKH UHVXOWV ZRXOG EH D PRUH DFFXUDWH UHIOHFWLRQ RI WKH DFWXDO LQ YLYR VLWXDWLRQ 7KH UHVXOWV ZHUH VWLOO FDXWLRXVO\ LQWHUSUHWHG LQ WKH FRQWH[W RI WKH H[SHULPHQWDO SDUDPHWHUV SUHVHQW VXFK DV FRS\ QXPEHU 6RPH RI RXU H[SHULPHQWV KDYH EHHQ GRQH LQ D WUDQVLHQW DVVD\ V\VWHP DQG WKH H[SUHVVLRQ RI WKH KXPDQ + JHQH XQGHU WKHVH FRQGLWLRQV ZDV VRPHZKDW GLIIHUHQW WKDQ ZKHQ VWDEO\ LQWHJUDWHG 3UHVXPDEO\ WKHUH ZHUH

PAGE 46

GLIIHUHQFHV LQ FKURPDWLQ VWUXFWXUH DQG IDFWRU WR '1$ UDWLRV DQG WKLV PD\ KDYH EHHQ UHIOHFWHG LQ WKH UHVXOWV 3UHYLRXV ZRUN KDV GHPRQVWUDWHG WKDW WKH KXPDQ + KLVWRQH JHQH ZLWK ZKLFK ZH KDYH ZRUNHG KDV D GHILQHG FKURPDWLQ VWUXFWXUH WKDW LQFOXGHV DQ H[WHQVLYH '1DVHO K\SHUVHQVLWLYH VLWH DQG WKDW WKLV VLWH IOXFWXDWHV LQ VL]H GXULQJ WKH FHOO F\FOH ZKLFK PD\ EH WKH UHVXOW RI WKH LQWHUDFWLRQ RI WUDQVFULSWLRQDO FRQWURO IDFWRUV &KU\VRJHORV HW DO f $Q LQ YLYR H[SHULPHQW ZLWK D WUDQVIHFWHG JHQH UHTXLUHV DQ DVVD\ DQG H[SHULPHQWDO DSSURDFK WKDW ZLOO DOORZ IRU WKH GHWHFWLRQ RI WKH LQWURGXFHG JHQH 6HYHUDO RSWLRQV ZHUH DYDLODEOH IRU XV WR SXUVXH 7KH PRVW FRPPRQO\ XVHG KDYH EHHQ f WKH SURPRWHU RI D JHQH ZDV OLQNHG WR D UHSRUWHU JHQH VXFK DV FKORUDPSKHQLFRODFHW\OWUDQVIHUDVH &$7f *RUPDQ HW DO f RU f WKH ZKROH JHQH FRGLQJ DQG IODQNLQJ UHJLRQV ZDV LQWURGXFHG LQWR D KHWHURORJRXV HQYLURQPHQW HJ D KXPDQ JHQH LQWR D PRXVH FHOOf &DSDVVR DQG +HLQW] 0DUDVKL HW DO f 6HYHUDO JURXSV LQFOXGLQJ RXU RZQ KDYH XWLOL]HG VXFK KHWHURORJRXV V\VWHPV EHFDXVH WKH\ DOORZ IRU WKH HDV\ GHWHFWLRQ E\ 6, QXFOHDVH DQDO\VLV RI WKH P51$ RI LQWHUHVW ZLWK OLWWOH RU QR EDFNJURXQG :H GHFLGHG WKDW LW ZRXOG EH EHWWHU WR OHDYH WKH + SURPRWHU DWWDFKHG WR WKH + JHQH DQG H[SUHVV WKHVH FRQVWUXFWV LQ PRXVH FHOOV 7KH KLVWRQH FRQVWUXFWV ZH FRWUDQVIHFWHG ZLWK WKH S69QHR SODVPLG ZHUH H[SUHVVHG DQG GHWHFWDEOH ZLWK 6, QXFOHDVH DQDO\VLV LQ PRXVH FHOOV :H UHDOL]HG WKDW WKH KLVWRQH SURPRWHU GHOHWLRQ FRQVWUXFWV FRXOG EH FRPSDUHG WR RQH DQRWKHU DQG WKH GLIIHUHQFHV LQ WKH VWHDG\ VWDWH OHYHO RI KLVWRQH P51$ IURP RQH FRQVWUXFW WR DQRWKHU ZHUH D GLUHFW UHIOHFWLRQ RI WUDQVFULSWLRQ :H FRQFOXGHG WKLV EHFDXVH WKH FRGLQJ UHJLRQ RI DOO

PAGE 47

WKH FRQVWUXFWV KDG UHPDLQHG LQWDFW 0HVVHQJHU 51$ WXUQRYHU ZDV SUHVXPDEO\ WKH VDPH IRU HDFK FRQVWUXFW DQG DQ\ GLIIHUHQFHV LQ WKH VWHDG\VWDWH OHYHO RI KLVWRQH P51$ ZHUH WKHUHIRUH D UHVXOW RI WUDQVFULSWLRQ :H LQFOXGHG D PRXVH + FRQWURO LQ HDFK RI RXU 6, QXFOHDVH DVVD\V WR SHUPLW WKH TXDQWLWDWLRQ RI WKH WRWDO DPRXQW RI P51$ DQG SDUWLFXODUO\ WKH DPRXQW RI KLVWRQH P51$ ,Q UHWURVSHFW WKLV KDV KHOSHG XV WR XQGHUVWDQG PRUH DERXW WKH LQWHUDFWLRQ RI WUDQVFULSWLRQ IDFWRUV ZLWK WKH + KLVWRQH JHQHV DQG LQ VRPH FDVHV KDV EHHQ DQ DGHTXDWH LQWHUQDO FRQWURO %HFDXVH RI WKH FRPSHWLWLRQ SKHQRPHQRQ ZH XQFRYHUHG GHVFULEHG LQ &KDSWHU f WKH PRXVH + EHFDPH D OHVV WKDQ SHUIHFW LQWHUQDO FRQWURO 2ULJLQDOO\ ZH WULHG WR LQFRUSRUDWH WKH PRXVH 6 ULERVRPDO 51$ JHQH LQWR RXU 6, QXFOHDVH DVVD\ EXW ZHUH XQDEOH WR ILQG DGHTXDWH K\EULGL]DWLRQ FRQGLWLRQV IRU ERWK KLVWRQH DQGULERVRPDO SUREHV ,GHDOO\ DQRWKHU PRXVH KLVWRQH JHQH LQ FRQMXQFWLRQ ZLWK WKH PRXVH + VKRXOG KDYH EHHQ XVHG 0DWHULDOV DQG JHQHUDO ODERUDWRU\ SURFHGXUHV $OO FKHPLFDOV ZHUH RI WKH KLJKHVW TXDOLW\ DYDLODEOH 3KHQRO ZDV UHGLVWLOOHG DQG VWRUHG IUR]HQ ZLWK WKH DGGLWLRQ RI b ZYf K\GUR[\TXLQROLQH DW r& 7KH IUR]HQ SKHQRO ZDV HTXLOLEUDWHG ILUVW ZLWK P0 7ULV+&O S+ f DQG VXEVHTXHQWO\ ZLWK P0 7ULV+&O DQG P0 ('7$ S+ f XQWLO WKH S+ ZDV EHWZHHQ DQG 3KHQRO&KORURIRUP H[WUDFWLRQ UHIHUV WR WKH DGGLWLRQ RI RQH YROXPH RI HTXLOLEUDWHG SKHQRO DQG RQH YROXPH RI &KORURIRUPLVRDP\O DOFRKRO f WR D VROXWLRQ PL[LQJ DQG VHSDUDWLRQ RI WKH SKDVHV E\ D EULHI FHQWULIXJDWLRQ VWHS 1H[W DW OHDVW RQH YROXPH RI FKORURIRUPLVRDP\O DOFRKRO LV DGGHG DQG WKH DERYH

PAGE 48

FHQWULIXJDWLRQ VWHS UHSHDWHG +HUHDIWHU SUHFLSLWDWLRQ UHIHUV WR WKH DGGLWLRQ RI YROXPHV RI b HWKDQRO OWK YROXPH 0 6RGLXP $FHWDWH S+ f WR D VROXWLRQ RI '1$ RU 51$ 7KLV ZDV VXEVHTXHQWO\ SODFHG DW RU r& IRU D VXIILFLHQW WLPH WR DOORZ SUHFLSLWDWLRQ RI WKH 2 2 QXFOHLF DFLGV 5DGLRDFWLYHO\ ODEHOOHG QXFOHRWLGHV > 3@$73 f§ &LPPROf DQG >DAA3@G&73 &LPPROf ZHUH SXUFKDVHG IURP $PHUVKDP DQG ,&1 ;UD\ ILOP &URQH[ DQG ;$5 ZHUH REWDLQHG IURP 'XSRQW DQG (DVWPDQ .RGDN UHVSHFWLYHO\ )RU DOO H[SHULPHQWV WKDW LQYROYHG 51$ WKH VROXWLRQV ZHUH SUHWUHDWHG ZLWK b GLHWK\OS\URFDUERQDWH '(3&f DQG JODVVZDUH ZDV WUHDWHG ZLWK b '(3& $IWHU D PLQ WUHDWPHQW WKH VROXWLRQV DQG JODVVZDUH ZHUH DXWRFODYHG IRU WKLUW\ PLQXWHV WR UHPRYH DQ\ WUDFHV RI '(3& 3ODVPLG JURZWK DQG SUHSDUDWLRQ /EURWK 0DQLDWLV HW DO f ZDV SUHSDUHG E\ PL[LQJ O2J %DFWR WU\SWRQH 'LIFRf J \HDVW H[WUDFW 'LIFRf J 1D&ODQG PO 0 1D2+ LQ / RI GGA2 GRXEOH GLVWLOOHG ZDWHUf 7KH PHGLXP ZDV WKHQ DXWRFODYHG IRU PLQ LQ RUGHU WR VWHULOL]H LW 7HQ PLOOLOLWHU VWDUWHU FXOWXUHV RI EDFWHULD ZHUH SUHSDUHG LQ VWHULOH FRQLFDO WXEHV DQG JURZQ RYHUQLJKW DW r& 7KHVH ZHUH VXSSOHPHQWHG ZLWK VWHULOH b JOXFRVH [Of 0 0J6 Of DQG QJPO DPSLFLOOLQ 6LJPDf 6PDOO LQRFXOD ZHUH UHPRYHG IURP JO\FHURO VWRFNV RU FRORQLHV ZHUH SLFNHG IURP SODWHV DQG SODFHG LQ WKH VWDUWHU FXOWXUH RYHUQLJKW /DUJH VFDOH POf SUHSDUDWLRQV ZHUH WKHQ FRPSOHWHG ZLWK PO b JOXFRVH PO 0J6 DQG SJPO DPSLFLOOLQ &XOWXUHV ZHUH JURZQ DW r& XQWLO WKH\ UHDFKHG DQ RSWLFDO GHQVLW\ QPf RI WR $W WKLV SRLQW PO RI PJPO FKORUDPSKHQLFRO ZHUH DGGHG DQG WKH FXOWXUHV ZHUH DOORZHG WR JURZ IRU DQ

PAGE 49

DGGLWLRQDO KUV ,I WKH EDFWHULD FRQWDLQHG D S8& SODVPLG RU GHULYDWLYH WKH DPSOLILFDWLRQ VWHS ZDV RPLWWHG 7KH FHOOV ZHUH KDUYHVWHG DQG WKH SODVPLG '1$ ZDV SUHSDUHG HVVHQWLDOO\ DV GHVFULEHG E\ 0DQLDWLV HW DO f 7KH SHOOHW ZDV UHVXVSHQGHG LQ PO RI 6ROXWLRQ P0 JOXFRVH P0 7ULV+&O S+ P0 ('7$ DQG PJPO O\VR]\PH &RRSHU %LRPHGLFDOff DQG LQFXEDWHG DW URRP WHPSHUDWXUH IRU PLQ 1H[W PO RI 6ROXWLRQ 1 1D2+ b 6'6f ZDV DGGHG DQG WKH FHOOV ZHUH SODFHG RQ LFH IRU PLQ )LIWHHQ PO RI 6ROXWLRQ 0 .$F S+ f ZDV DGGHG DQG LQFXEDWHG RQ LFH IRU PLQ 7KH FHOOV ZHUH WKHQ FHQWULIXJHG DW N USP IRU PLQ r& 7KH VXSHUQDWDQWV IURP DOO WXEHV ZHUH SRROHG DQG SUHFLSLWDWHG ZLWK YROXPH RI LVRSURSDQRO IRU PLQ DW URRP WHPSHUDWXUH 7KH SUHFLSLWDWH ZDV UHFRYHUHG E\ FHQWULIXJDWLRQ DW N USP IRU PLQ 7KH SHOOHW ZDV GULHG DQG UHVXVSHQGHG LQ PO RI P0 7ULV+&O S+ P0 ('7$ 7(f (LJKW JUDPV RI &V&O DQG , RI PJPO HWKLGLXP EURPLGH ZHUH DGGHG DQG WKH SUHSDUDWLRQ ZDV FHQWULIXJHG IRU KUV DW N USP LQ %HFNPDQ KHDW VHDOHG WXEHV LQ D %HFNPDQ 7L URWRU 7KH '1$ EDQG ZDV YLVXDOL]HG E\ XOWUDYLROHW LOOXPLQDWLRQ DQG UHFRYHUHG E\ VLGH SXQFWXUH ZLWK D JDXJH K\SRGHUPLF QHHGOH 7KH '1$ ZDV WKHQ HLWKHU SODFHG RYHU D VPDOO 'RZH[ $* :; FROXPQ RU EXWDQRO H[WUDFWHG ; WR UHPRYH WKH HWKLGLXP EURPLGH 7KH VDPSOH ZDV WKHQ GLDO\]HG H[WHQVLYHO\ DJDLQVW 7( 7KH '1$ ZDV UHFRYHUHG E\ HWKDQRO SUHFLSLWDWLRQ DQG VXEVHTXHQW FHQWULIXJDWLRQ 4XDQWLWDWLRQ RI WKH \LHOG ZDV GRQH VSHFWURSKRWRPHWULFDOO\ %HFNPDQf DW QP 3ODVPLG SUHSDUDWLRQ ZLWK 7% 7KH PHWKRG LV VLPLODU WR WKDW RXWOLQHG DERYH IRU /%URWK H[FHSW WKDW WKH 7% PHGLXP ZDV XVHG 7% ZDV SUHSDUHG

PAGE 50

DV GHVFULEHG E\ 7DUWRI DQG +REEV f %DFWR WU\SWRQH JUf JU RI \HDVW H[WUDFW DQG PO RI JO\FHURO ZHUH SUHSDUHG LQ PO RI GG+ 7KH PHGLXP ZDV VWHULOL]HG LQ WKH DXWRFODYH IRU PLQ 7R WKH VWHULOH VROXWLRQ ZDV DGGHG PO RI VWHULOH 0 .+32 0 .+32 7KLV PHGLXP ZDV LQRFXODWHG DQG EDFWHULD ZHUH JURZQ DV DERYH %HFDXVH WKH PHGLXP LV YHU\ ULFK WKH \LHOGV ZHUH RIWHQ ODUJH VR EDFWHULD WKDW FRQWDLQHG S%5 SODVPLGV ZHUH QRW LQGXFHG ZLWK FKORUDPSKHQLFRO 7KH '1$ ZDV SUHSDUHG E\ WKH VDPH PHWKRG H[FHSW WKDW WKH RULJLQDO YROXPH RI FHOOV ZDV VSOLW LQWR WZR DOLTXRWV DW WKH EHJLQQLQJ RI WKH LVRODWLRQ SURFHGXUH 7KLV ZDV IRXQG WR EH HVVHQWLDO DQG JUHDWO\ IDFLOLWDWHG O\VLV DQG VXEVHTXHQW LVRODWLRQ RI WKH SODVPLG '1$ )RU FRPSDUDWLYH SXUSRVHV PO RI 7% FDQ SURGXFH PJ RI WRWDO SODVPLG '1$ LQ FRPSDULVRQ WR PJ ZLWK /%URWK ZLWK DPSOLILFDWLRQ 3URGXFWLRQ RI XQLGLUHFWLRQDO GHOHWLRQV ZLWK ([RQXFOHDVH ,,, 7KLV PHWKRG ZDV FDUULHG RXW HVVHQWLDOO\ DV GHVFULEHG E\ 6WUDWDJHQH 6DQ 'LHJR &$f IURP ZKLFK WKH UHDJHQWV ZHUH SXUFKDVHG 7KH PHWKRG WDNHV DGYDQWDJH RI WKH IDFW WKDW ([RQXFOHDVH ,,, FDQQRW GLJHVW n VLQJOH VWUDQG RYHUKDQJV )RU RXU SXUSRVHV WKH S) LQVHUW ZDV FORQHG LQWR WKH 3VWO+LQGOOO VLWHV RI %OXHVFULSW 0 7KH +LQGOOO VLWH LV DGMDFHQW WR DQ $SDO VLWH LQ WKH YHFWRU 7R SURGXFH WKH GHOHWLRQV LQ ZKLFK ZH ZHUH LQWHUHVWHG WKH S) %OXHVFULSW FORQH ZDV GLJHVWHG ZLWK +LQGOOO n RYHUKDQJf DQG $SDO n RYHUKDQJf WR FRPSOHWLRQ :H WKHQ PL[HG WKUHH MJ RI GLJHVWHG '1$ LO RI ; ([RQXFOHDVH ,,, EXIIHU P0 7ULV+&O S+ P0 0J&O SJPO W51$f LO RI IUHVKO\ SUHSDUHG P0 PHUFDSWRHWKDQRO XQLWV RI ([RQXFOHDVH ,,, DQG HQRXJK GGA2 WR PDNH

PAGE 51

WKH ILQDO YROXPH SL 7KH UHDFWLRQ FRQGLWLRQV ZHUH HVWDEOLVKHG WKURXJK D VHULHV RI WLWUDWLRQ H[SHULPHQWV WR GHWHUPLQH WKH H[WHQW RI GHOHWLRQ ZLWK WLPH $IWHU WKH DGGLWLRQ RI WKH HQ]\PH DGGHG ODVWf SL DOLTXRWV ZHUH UHPRYHG HYHU\ PLQXWH IRU PLQ GLOXWHG ZLWK SL ,; 0XQJ %HDQ QXFOHDVH EXIIHU ; P0 1D2$F S+ P0 1D&O P0 =Q&O b JO\FHUROf DQG KHDWHG WR r& IRU PLQ 2QFH WKH GHOHWLRQ UHDFWLRQV KDG EHHQ VWRSSHG XQLWV RI 0XQJ %HDQ QXFOHDVH LQ GLOXWLRQ EXIIHU ,; P0 1D2$F S+ P0 =Q2$F P0 F\VWHLQH b 7ULWRQ ; b JO\FHUROf ZHUH DGGHG DQG WKH UHDFWLRQ DOORZHG WR SURFHHG DW r& IRU PLQ 7KH UHDFWLRQ ZDV VWRSSHG E\ WKH DGGLWLRQ RI SL RI SKHQROFKORURIRUP DQG H[WUDFWHG 7KH DTXHRXV OD\HU ZDV UHPRYHG DQG SUHFLSLWDWHG ZLWK SL RI 0 1D2$F S+ DQG YROXPHV RI b HWKDQRO 7KH '1$ ZDV UHFRYHUHG E\ FHQWULIXJDWLRQ OLJDWHG DQG WUDQVIHFWHG DV GHVFULEHG EHORZ 7KLV SURFHGXUH ZRUNHG YHU\ SRRUO\ DQG UHVXOWHG LQ YHU\ IHZ SRVLWLYH FORQHV 7KH GHOHWLRQV WKDW ZHUH REWDLQHG ZHUH FKDUDFWHUL]HG E\ UXQRII WUDQVFULSWLRQ IURP WKH 7 SURPRWHU RI HDFK FORQH 7KH '1$ ZDV GLJHVWHG ZLWK 1FRO DQG WUDQVFULSWLRQ UHDFWLRQV FDUULHG RXW H[DFWO\ DV GHVFULEHG E\ 6WUDWDJHQH 7KH WUDQVFULSWV ZHUH HOHFWURSKRUHVHG RQ D b DFU\ODPLGH 0 XUHD JHO DQG WKH H[WHQW RI GHOHWLRQ GHWHUPLQHG E\ FRPSDULVRQ WR UXQRII WUDQVFULSWLRQ IURP WKH SDUHQWDO FRQVWUXFW S)%6 '1$ )UDJPHQW (OXWLRQ $IWHU UHVWULFWLRQ HQ]\PH GLJHVWLRQ '1$ IUDJPHQWV ZHUH XVXDOO\ HOHFWURSKRUHVHG LQ ORZ SHUFHQWDJH DJDURVH JHOV WR bf ZLWK ,; 7%( ; P0 7ULV+&O S+ P0 ERULF DFLG P0 ('7$f DQG YLVXDOL]HG E\ ORQJ ZDYH XOWUDYLROHW LOOXPLQDWLRQ RI WKH HWKLGLXP EURPLGH VWDLQHG EDQG SJPO IRU PLQf 7KH EDQG RI

PAGE 52

LQWHUHVW ZDV H[FLVHG IURP WKH JHO 7KH )UDJPHQW (OXWHU ,%,f ZDV ILUVW UXQ IRU PLQ ZLWK ORZ VDOW EXIIHU P0 7ULV+&O S+ P0 1D&O DQG P0 ('7$f DW YROWV 7KH JHO IUDJPHQW ZDV WKHQ SODFHG LQ WKH ZHOO DQG WKH 9FKDQQHO ILOOHG ZLWK WL RI KLJK VDOW EXIIHU 0 1D2$F b JO\FHURO b %URPRSKHQRO %OXHf ,W ZDV LPSRUWDQW WKDW WKH JHO VOLFH UHPDLQ LQ WKH VDPH RULHQWDWLRQ DV LW KDG EHHQ UXQ SUHYLRXVO\ WR IDFLOLWDWH WKH UHPRYDO RI WKH EDQG 7KH EDQG ZDV HOHFWURHOXWHG DW 9 IRU PLQ DIWHU ZKLFK WKH KLJK VDOW EXIIHU ZDV FDUHIXOO\ UHPRYHG LQ  DOLTXRWV $ WRWDO RI WL DOLTXRWV ZHUH UHPRYHG IURP HDFK FKDQQHO )LYH PLFURJUDPV RI JO\FRJHQ %RHKULQJHU0DQQKHLPf ZHUH DGGHG DQG WKH VDPSOH ZDV SUHFLSLWDWHG ZLWK PO RI b HWKDQRO DW r& IRU PLQ 7KH '1$ IUDJPHQW ZDV WKHQ UHFRYHUHG E\ FHQWULIXJDWLRQ DW N USP IRU PLQ )UDJPHQWV LVRODWHG LQ WKLV PDQQHU ZHUH IRXQG WR EH GLUHFWO\ VXLWDEOH IRU OLJDWLRQ UHDFWLRQV RU SUREH SUHSDUDWLRQ '1$ OLJDWLRQ 7KH OLJDWLRQ RI '1$ IUDJPHQWV ZDV GRQH ZLWK 7 '1$ OLJDVH 1HZ (QJODQG %LRODEVf DQG HVVHQWLDOO\ DV GHVFULEHG E\ .LQJ DQG %ODNHVOH\ f '1$ IUDJPHQWV ZHUH GLJHVWHG ZLWK WKH DSSURSULDWH HQ]\PHV GLFWDWHG E\ WKH FORQLQJ VFKHPH DQG IUDJPHQWV DQG YHFWRUV ZHUH PL[HG LQ  RI ,; OLJDWLRQ EXIIHU ; P0 7ULV+&O S+ P0 0J&O b ZYf SRO\HWK\OHQH JO\FRO (DVWPDQ .RGDNf P0 $73 P0 GLWKLRWKUHLWROf 8VXDOO\ WKH YHFWRU D S8& SODVPLGf ZDV WUHDWHG ZLWK SKRVSKDWDVH SULRU WR WKH UHDFWLRQ DQG WKHUHIRUH WKH YHFWRU WR LQVHUW UDWLR ZDV f§ %OXQW HQG OLJDWLRQV ZHUH FDUULHG RXW ZLWK OHVV WKDQ JPO RI WRWDO '1$ 6WLFN\ OLJDWLRQV ZHUH GRQH DW WJPO DQG GLOXWHG DIWHU KUV DW URRP WHPSHUDWXUH *HQHUDOO\ XQLWV RI OLJDVH ZHUH DGGHG IRU VWLFN\ HQG OLJDWLRQV DQG XQLWV IRU EOXQW

PAGE 53

HQG OLJDWLRQV $IWHU KRXUV WKH UHDFWLRQV ZHUH GLOXWHG ZLWK ,; OLJDVH EXIIHU DQG DQ DGGLWLRQDO DOLTXRW RI OLJDVH DGGHG WR WKH UHDFWLRQ 7KH UHDFWLRQV ZHUH WKHQ LQFXEDWHG RYHUQLJKW DW r& VWLFN\ HQGf DQG r& EOXQW HQGf 7KH UHDFWLRQV ZHUH GLOXWHG ZLWK 7( DQG WUDQVIHFWHG LQWR '+ EDFWHULD DV GHVFULEHG E\ WKH PHWKRGV RI %HWKHVGD 5HVHDUFK /DERUDWRULHV DQG +DQDKDQ f 3UHSDUDWLRQ RI FRPSHWHQW EDFWHULDO FHOOV IRU WUDQVIRUPDWLRQ %DFWHULD HLWKHU '+ RU +% ZHUH JURZQ LQ PO RI /XULD EURWK WR DQ 2' 7KH FHOOV ZHUH GLYLGHG EHWZHHQ WZR VWHULOH PO FRQLFDO WXEHV DQG SODFHG RQ LFH IRU PLQ $OO VXEVHTXHQW SURFHGXUHV ZHUH FDUULHG RXW DW r& 7KH FHOOV ZHUH WKHQ KDUYHVWHG E\ FHQWULIXJDWLRQ IRU PLQ DW N USP 7KH VXSHUQDWDQW ZDV UHPRYHG DQG WKH FHOOV JHQWO\ UHVXVSHQGHG LQ PO RI &D&O EXIIHU P0 &D&O P0 3,3(6 S+ b JO\FHUROf 7KH FHOOV ZHUH WKHQ FHQWULIXJHG IRU PLQ DW N USP DQG JHQWO\ UHVXVSHQGHG DJDLQ LQ &D&O EXIIHU 7KH\ ZHUH WKHQ SODFHG RQ LFH IRU PLQ DQG FHQWULIXJHG DW N USP IRU PLQ 7KH FHOOV ZHUH UHVXVSHQGHG LQ PO HDFK RI &D&O EXIIHU DQG GLVSHQVHG LQWR SL DOLTXRWV DQG IUR]HQ DW r& XQWLO QHHGHG 7UDQVIRUPDWLRQ RI EDFWHULD ZLWK SODVPLG '1$ &RPSHWHQW EDFWHULDO FHOOV HLWKHU '+ RU +% ZHUH WKDZHG RQ LFH DQG SL RI WKH OLJDWLRQ ZHUH DGGHG DQG LQFXEDWHG ZLWK WKH FHOOV IRU PLQ RQ LFH 7KH '+ FHOOV ZHUH KHDW VKRFNHG DW r& DQG WKH +% FHOOV DW r& 7KH FHOOV ZHUH EULHIO\ SODFHG RQ LFH DQG WKHQ GLOXWHG ZLWK SL RI URRP WHPSHUDWXUH 62& b %DFWRWU\SWRQH b \HDVW H[WUDFW P0 1D&O P0 .& P0 0J&O P0 0J62Af 7KH FHOOV ZHUH LQFXEDWHG DW r& IRU KRXU DQG WKHQ SODWHG RQ 7<1 b 7U\SWRQH b \HDVW

PAGE 54

H[WUDFW b 1D&Of PHGLXP ZLWK DPSLFLOOLQ ,I GHWHFWLRQ RI LQVHUWLRQ RI D '1$ IUDJPHQW ZDV SRVVLEOH '+ FHOOV DQG S8& SODVPLGVf WKHQ  RI b ;JDO EURPRFKORURLQGRO\O'JDODFWRVLGHf DQG , RI P0 ,37* ,VRSURS\O'WKLRJDODFWRS\UDQRVLGHf ZHUH LQFOXGHG ZLWK WKH EDFWHULD VSUHDG RQ WKH SODWH 5HVLVWDQW FRORQLHV JUHZ XS RYHUQLJKW DQG ZKLWH FRORQLHV LQGLFDWLYH RI D GLVUXSWHG ODF = JHQH ZHUH SLFNHG IRU IXUWKHU DQDO\VLV 5DSLG SODVPLG SUHSDUDWLRQ 7KH PHWKRG LV HVVHQWLDOO\ DV GHVFULEHG E\ ,VK+RURZLF] DQG %XUNH f ZLWK VRPH PRGLILFDWLRQV 2QH PLOOLOLWHU RI VDWXUDWHG RYHUQLJKW FXOWXUH JURZQ LQ 7<1 RU /EURWK ZDV FHQWULIXJHG IRU VHF LQ DQ (SSHQGRUI PLFURIXJH 7KH VROXWLRQV IRU SUHSDUDWLRQ RI '1$ ZHUH WKH VDPH DV IRU WKH ODUJH VFDOH SUHSDUDWLRQ GHVFULEHG DERYH 7KH FHOOV ZHUH UHVXVSHQGHG LQ LO 6ROXWLRQ DQG LQFXEDWHG IRU PLQ DW URRP WHPSHUDWXUH 6ROXWLRQ LOf ZDV DGGHG DQG LQFXEDWHG RQ LFH IRU PLQ 6ROXWLRQ LOf ZDV DGGHG DQG LQFXEDWHG RQ LFH IRU PLQ 7KH FHOOV ZHUH WKHQ FHQWULIXJHG IRU PLQ DQG WKH VXSHUQDWDQW H[WUDFWHG ZLWK SKHQROFKORURIRUP 7KH VXSHUQDWDQW ZDV WKHQ SUHFLSLWDWHG ZLWK YROXPHV RI b HWKDQRO DW URRP WHPSHUDWXUH '1$ ZDV WKHQ VXLWDEOH IRU UHVWULFWLRQ HQ]\PH GLJHVWLRQ DQG DJDURVH JHO DQDO\VLV *URZWK DQG SUHSDUDWLRQ RI FHOO OLQHV & FHOOV ZHUH XWLOL]HG LQ DOO WUDQVIHFWLRQV DQG ZHUH JURZQ LQ FP WLVVXH FXOWXUH GLVKHV DV PRQROD\HU FXOWXUHV 7KH PHGLXP XVHG LQ DOO H[SHULPHQWV ZDV 'XOEHFFRnV PRGLILHG HVVHQWLDO PHGLXP *LEFRf VXSSOHPHQWHG ZLWK b FDOI VHUXP *LEFRf b KRUVH VHUXP *LEFRf P0 /JOXWDPLQH DQG 8PO SHQLFLOOLQ XJPO VWUHSWRP\FLQ 7R LQLWLDWH D FHOO OLQH KLVWRQH

PAGE 55

SODVPLG DQG S69QHRf RU WUDQVLHQW KLVWRQH SODVPLG RQO\f WUDQVIHFWLRQ WKH FHOOV ZHUH UHIHG ZLWK PO RI PHGLXP KRXUV EHIRUH DSSOLFDWLRQ RI WKH '1$ SUHFLSLWDWH 6WDEOH FHOO OLQHV ZHUH LQLWLDWHG E\ WKH FRWUDQVIHFWLRQ RI WKH KLVWRQH SODVPLG DQG S69QHR LQ D UDWLR 7KLV ZDV GRQH HVVHQWLDOO\ DV GHVFULEHG E\ *UDKDP DQG YDQ GHU (E f DQG *RUPDQ HW DO f 3ODVPLG '1$ XVXDOO\ JFRQVWUXFW ZDV GLOXWHG WR , ZLWK P0 7ULV+&O S+ P0 ('7$ 7KLV ZDV WKHQ PL[HG ZLWK LO RI 0 &D&O 7KH '1$ VROXWLRQ ZDV WKHQ DGGHG GURSZLVH WR [O RI ; +HSHV %XIIHUHG 6DOLQH P0 1D&O P0 +(3(6 P0 1D3 S+ f LQ D VWHULOH PO FRQLFDO WXEH ZKLOH WKH WXEH ZDV YRUWH[HG 7KH SUHFLSLWDWHV ZHUH DOORZHG WR VWDQG IRU PLQ DQG ZHUH JUH\ DQG FORXG\ LQ DSSHDUDQFH $ SRRU SUHFLSLWDWH ZDV REYLRXV DV VHWWOLQJ RXW RFFXUUHG GXULQJ WKH PLQ LQFXEDWLRQ 7KH '1$ SUHFLSLWDWHV ZHUH DGGHG WR WKH SODWHV GURSZLVH XQGHU VWHULOH FRQGLWLRQV ZLWK JHQWOH VZLUOLQJ $IWHU KRXUV WKH PHGLXP ZDV UHPRYHG DQG WKH FHOOV ZHUH VKRFNHG IRU PLQ ZLWK b JO\FHURO LQ PHGLXP 7KLV ZDV UHPRYHG WKH FHOOV ZDVKHG ZLWK PO RI LQFRPSOHWH PHGLXP DQG UHIHG ZLWK PO RI FRPSOHWH PHGLXP )RU WUDQVLHQW WUDQVIHFWLRQV WKH FHOOV ZHUH LQFXEDWHG IRU KRXUV DQG WKHQ KDUYHVWHG b FRQIOXHQF\f DV GHVFULEHG EHORZ &HOO OLQHV ZHUH LQLWLDWHG E\ JURZLQJ WKH FHOOV WR FRQIOXHQF\ DSSUR[LPDWHO\ GD\V $W WKLV SRLQW WKH FHOOV ZHUH VSOLW LQWR ILYH SODWHV DQG WKH PHGLXP ZDV VXSSOHPHQWHG ZLWK JPO RI *HQHWLFLQ *LEFRf 7KH DPLQRJO\FRVLGH SKRVSKRWUDQVIHUDVH n,,f JHQH FDUULHG RQ WKH S69QHR SODVPLG FRQIHUV UHVLVWDQFH WR WKLV DQWLELRWLF DQG WKHUHIRUH SHUPLWV FHOO JURZWK LI SUHVHQW &HOOV ZHUH UHIHG ZLWK

PAGE 56

PHGLXP HYHU\ GD\V XQWLO UHVLVWDQW FRORQLHV ZHUH DSSDUHQW DQG PRVW RI WKH RWKHU FHOOV KDG GLHG 7KLV XVXDOO\ WRRN DSSUR[LPDWHO\ ZHHNV $OO WKH FRORQLHV RQ DQ LQGLYLGXDO SODWH ZHUH SRROHG DQG VXEVHTXHQWO\ SDVVDJHG LQ GUXJIUHH PHGLXPWKHVH ZHUH UHIHUUHG WR DV SRO\FORQDO FHOO OLQHV 7KH FORQH QDPH IRU D FHOO OLQH FRQWDLQV VHYHUDO GHVLJQDWLRQV )RU H[DPSOH S)SO WKH S)2 GHVLJQDWHV WKLV FRQVWUXFW DV RULJLQDOO\ GHULYHG IURP WKH $++* FORQH LVRODWHG E\ 6LHUUD HW DO f GHVFULEHV WKH GHOHWLRQ FRQVWUXFW DQG SL UHIHUV WR SRO\FORQH QXPEHU :KHQ DQ P LV XVHG LQVWHDG RI D S WKLV LQGLFDWHV D PRQRFORQDO FHOO OLQH 7R SURGXFH PRQRFORQDO FHOO OLQHV LQGLYLGXDO FRORQLHV IURP HDFK SODWH ZHUH SLFNHG ZLWK D FRWWRQ SOXJJHG VWHULOH SDVWHXU SLSHWWH DQG JURZQ LQ ZHOO FHOO SODWHV &RUQLQJf $IWHU WKHVH FHOOV KDG H[SDQGHG WKH\ ZHUH JURZQ LQ DQG FP GLVKHV DV GHVFULEHG DERYH &HOO OLQHV DQG & FHOOV ZHUH IUR]HQ GRZQ SHULRGLFDOO\ LQ PHGLXP VXSSOHPHQWHG ZLWK b IRHWDO FDOI VHUXP *LEFRf DQG b JO\FHURO &HOOV ZHUH ZDVKHG RII WKH SODWH LQ 3XFNnV 6DOLQH b ('7$ FHQWULIXJHG DW USP IRU PLQ UHVXVSHQGHG LQ IUHH]LQJ PHGLXP LQ 1XQF &U\RWXEHV DQG SODFHG DW r& 6RXWKHUQ EORW DQDO\VLV 7KLV PHWKRG KDV EHHQ XVHG WR GHWHUPLQH WKH FRS\ QXPEHU RI WKH LQGLYLGXDO PRQRFORQDO FHOO OLQHV DQG WKH VWDWXV RI WKH LQWHJUDWHG FRQVWUXFWV ZLWK UHVSHFW WR IODQNLQJ VHTXHQFHV DQG PRGH RI LQWHJUDWLRQ ,Q JHQHUDO '1$V IURP LQGLYLGXDO PRQRFORQDO FHOO OLQHV ZHUH GLJHVWHG WR FRPSOHWLRQ ZLWK UHVWULFWLRQ HQ]\PHV LQ WKH EXIIHU UHFRPPHQGHG E\ WKH VXSSOLHU 7KH UHVWULFWLRQ HQ]\PH UHDFWLRQV ZHUH VWRSSHG E\ WKH DGGLWLRQ RI YROXPH RI UXQQLQJ G\H ,; 7%( b

PAGE 57

JO\FHURO b VRGLXP GRGHF\O VXOIDWH b EURPRSKHQRO EOXH DQG b [\OHQH F\DQROf DQG KHDWHG WR r& IRU PLQ 7KH '1$ ZDV WKHQ ORDGHG RQWR b DJDURVH JHOV DQG UXQ KRXUV DW 9 *HOV ZHUH VWDLQHG LQ GG+ ZLWK XJPO HWKLGLXP EURPLGH 1H[W WKH JHOV ZHUH VRDNHG LQ P0 +& IRU PLQ WR FDXVH VWUDQG EUHDNV WKDW SHUPLW EHWWHU WUDQVIHU DQG WKHQ WUDQVIHUUHG WR =HWDELQG Q\ORQ PHPEUDQHV $0) &XQRf DV GHVFULEHG E\ 6RXWKHUQ f H[FHSW WKDW WKH WUDQVIHU EXIIHU ZDV 0 1D2+ PHWKRGRORJ\ NLQGO\ SURYLGHG E\ 'U +DUU\ 2VWUHU 8QLYHUVLW\ RI )ORULGD 'HSDUWPHQW RI 3HGLDWULF *HQHWLFVf 7UDQVIHU ZDV FRPSOHWH LQ KUV 7KH ILOWHUV ZHUH JHQWO\ ZDVKHG LQ ; 66& ; 66& f§ 0 1D&O 0 6RGLXP &LWUDWH S+ f WLPHV IRU PLQ HDFK 7KH ILOWHUV ZHUH EULHIO\ DLU GULHG DQG WKHQ ZDVKHG LQ ; 66& b 6'6 IRU KU DW & $W WKLV SRLQW ILOWHUV ZHUH VWRUHG DW & LQ SODVWLF 6HDODPHDO EDJV %ORWV ZHUH SUHK\EULGL]HG LQ ; 663( ; 663( 0 1D&O P0 1D+3 P0 ('7$ S+ f b 6'6 DQG b QRQIDW GU\ PLON &DUQDWLRQf DW r& IRU KUV +\EULGL]DWLRQV ZHUH SHUIRUPHG LQ WKH DERYH VROXWLRQ ZLWK WKH DGGLWLRQ RI HLWKHU GHQDWXUHG QLFNWUDQVODWHG RU ROLJRODEHOOHG SUREH )RU EORWV SUREHG ZLWK KLVWRQH + VHTXHQFHV [ A FSPPO RI SUREH ZHUH XVHG LQ WKH K\EULGL]DWLRQ )RU PRXVH 6 ULERVRPDO 51$ K\EULGL]DWLRQV [ r FSPPO RI WKH S8& LQVHUW SUREH ZHUH XWLOL]HG 7KH VSHFLILF DFWLYLW\ IW RI DOO SUREHV ZDV DW OHDVW [ r FSPXJ 7KH OHQJWK RI K\EULGL]DWLRQ ZDV IURP KUV DW r& )LOWHUV ZHUH ZDVKHG WLPHV DW URRP WHPSHUDWXUH ZLWK DJLWDWLRQ LQ P0 1D3 S+ P0 ('7$ DQG b 6'6 (DFK ZDVK ZDV PLQ LQ OHQJWK $IWHU D EULHI GU\LQJ SHULRG WKH ILOWHUV ZHUH VHDOHG LQ SODVWLF EDJV WR SUHYHQW GHK\GUDWLRQ DQG

PAGE 58

IDFLOLWDWH WKH VXEVHTXHQW UHPRYDO RI SUREH IUDJPHQWVf DQG H[SRVHG WR SUHIODVKHG ;$5 ILOP .RGDNf DW r& 3UHSDUDWLRQ RI '1$ IURP PRQRFORQDO DQG SRO\FORQDO FHOO OLQHV 7KH PHGLXP IURP HDFK SODWH ZDV UHPRYHG DQG PO RI 3XFNnV VDOLQH *LEFRf ZLWK b ('7$ ZHUH DGGHG 7KH FHOOV ZHUH SK\VLFDOO\ UHPRYHG IURP WKH SODWH E\ VFUDSLQJ ZLWK D UXEEHU VSDWXOD DQG SODFHG LQ D VWHULOH PO &RUH[ WXEH 7KH FHOOV ZHUH SHOOHWHG E\ FHQWULIXJDWLRQ DW USP IRU PLQ DW r& LQ DQ ,(&,QWHUQDWLRQDO FHQWULIXJH $W WKLV SRLQW WKH VXSHUQDWDQW ZDV UHPRYHG DQG WKH FHOOV ZHUH VQDS IUR]HQ RQ GU\ LFH )UR]HQ SHOOHWV ZHUH TXLFNO\ UHVXVSHQGHG LQ PO RI ; 66& b 6'6 DQG JPO SURWHLQDVH 6LJPD &KHPLFDO &RPSDQ\f DQG LQFXEDWHG IRU KUV WR RYHUQLJKW DW r& 7KLV PL[WXUH ZDV WKHQ H[WUDFWHG WLPHV DQG SUHFLSLWDWHG ZLWK YROXPHV RI b HWKDQRO DW r& RYHUQLJKW 7KH SUHFLSLWDWHG QXFOHLF DFLGV ZHUH UHFRYHUHG E\ FHQWULIXJDWLRQ DW USP IRU PLQ DW r& 7KH SHOOHW ZDV GULHG EULHIO\ DQG UHVXVSHQGHG LQ PO RI 7( DQG 51DVH$ 6LJPDf ZDV DGGHG WR D ILQDO FRQFHQWUDWLRQ RI MJPO 'LJHVWLRQ SURFHHGHG IRU KU DW r& DQG ZDV VWRSSHG E\ WKH DGGLWLRQ RI 6'6 WR b DQG SKHQROFKORURIRUP H[WUDFWLRQ '1$ ZDV WKHQ SUHFLSLWDWHG ZLWK YROXPHV RI b HWKDQRO FHQWULIXJHG DW IRU PLQ DQG WKH SHOOHW UHVXVSHQGHG LQ , RI 7( DQG VWRUHG DW r& &RS\ QXPEHU DQDO\VLV $SSUR[LPDWHO\ XJ RI JHQRPLF '1$ IURP DQ LQGLYLGXDO FHOO OLQH ZHUH GLOXWHG WR ZLWK 7( 'LJHVWLRQV ZHUH FDUULHG RXW LQ (FR5, EXIIHU %RHKULQJHU0DQQKHLPf ZLWK WKH IROORZLQJ UHJLPH XQLWXJ RI (FR5, DQG ;EDO ZHUH DGGHG DQG LQFXEDWHG DW r& IRU KUV DW ZKLFK SRLQW DQ DGGLWLRQDO XQLWXJ ZDV DGGHG DQG WKH GLJHVWLRQ SURFHHGHG RYHUQLJKW KUVf 7KH '1$ ZDV TXDQWLWDWHG E\

PAGE 59

GLOXWLQJ S RI WKH GLJHVWLRQ LQWR PO RI 7( DQG GHWHUPLQLQJ WKH 2 7KH FRPSOHWLRQ RI GLJHVWLRQ ZDV GHWHUPLQHG E\ JHO HOHFWURSKRUHVLV RI D VPDOO DOLTXRW RI WKH GLJHVWLRQ RQ D b DJDURVH PLQLJHO %LR5DGf 7HQ PLFURJUDPV RI GLJHVWHG '1$ ZHUH HOHFWURSKRUHVHG DQG EORWWHG DV DERYH 6RXWKHUQ %ORWWLQJf 7KH SUREHV XVHG IRU WKH FRS\ QXPEHU GHWHUPLQDWLRQ ZHUH HLWKHU WKH (FR5,;EDO IUDJPHQW IURP S) IRU WKH KXPDQ + KLVWRQH JHQHVf RU WKH %DP+,6DOO IUDJPHQW IURP S PRXVH 6 ULERVRPDO JHQH IRU TXDQWLWDWLRQf 7KH SUREHV ZHUH ODEHOOHG E\ HLWKHU QLFNWUDQVODWLRQ RU ROLJRODEHOOLQJ VHH EHORZf 7KH FRS\ QXPEHU TXDQWLWDWLRQ RI WKH KXPDQ + KLVWRQH JHQH ZDV GRQH E\ GHQVLWRPHWULF VFDQQLQJ RI PXOWLSOH DXWRUDGLRJUDPV 7KH H[DFW DPRXQW RI '1$ LQ HDFK ODQH ZDV GHWHUPLQHG E\ UHSURELQJ WKH 6RXWKHUQ EORWV ZLWK WKH PRXVH 6 ULERVRPDO JHQH 7KLV JHQH VHUYHG DV DQ LQWHUQDO FRQWURO IRU YDULDWLRQV LQ WKH DFWXDO DPRXQW RI '1$ ORDGHG DQG DQ\ ORVV GXULQJ WKH SURFHVV 7KH FRS\ QXPEHU RI WKH PRXVH 6 ULERVRPDO JHQH VKRXOG EH LQYDULDQW DQG DOO GHQVLWRPHWULF YDOXHV IRU WKH KXPDQ + KLVWRQH JHQHV ZHUH FRUUHFWHG WR DFFRXQW IRU WKH DFWXDO DPRXQW RI '1$ LQ WKH ODQH EDVHG RQ WKH LQWHUQDO FRQWURO /DEHOOLQJ RI '1$ IUDJPHQWV XVLQJ .OHQRZ IUDJPHQW 7KLV ZDV GRQH DV GHVFULEHG E\ 0DQLDWLV HW DO f 7ZR KXQGUHG QDQRJUDPV RI SODVPLG RU $ SKDJH '1$ ZHUH GLJHVWHG WR FRPSOHWLRQ ZLWK WKH UHVWULFWLRQ HQ]\PHV RI FKRLFH 2QH WR WZR PLFURFXULHV RI >DAA3@G&73 ZHUH DGGHG ZLWK XQLWV RI WKH ODUJH IUDJPHQW RI ( FROL '1$ SRO\PHUDVH .OHQRZ IUDJPHQW %5/f 7KH UHDFWLRQ ZDV LQFXEDWHG IRU PLQ DW URRP WHPSHUDWXUH 7KHQ SL RI 0 ('7$ SL RI 0 VRGLXP DFHWDWH DQG SJ RI \HDVW W51$ ZHUH DGGHG WR VWRS WKH UHDFWLRQ 7KH ODEHOOHG

PAGE 60

'1$ IUDJPHQWV ZHUH UHFRYHUHG E\ SUHFLSLWDWLRQ ZLWK b HWKDQRO DW r& 7KH '1$ ZDV UHFRYHUHG E\ FHQWULIXJDWLRQ DQG UHVXVSHQGHG LQ , RI 7( 1LFN WUDQVODWLRQ DQG ROLJRODEHOOLQJ %RWK RI WKHVH PHWKRGV ZHUH XWLOL]HG IRU WKH SURGXFWLRQ RI '1$ K\EULGL]DWLRQ SUREHV 1LFN WUDQVODWLRQ ZDV GRQH DV GHVFULEHG E\ 5LJE\ HW DO f )RU WKH FRS\ QXPEHU H[SHULPHQWV WKH (FR5,;EDO IUDJPHQW RI S) ZDV LVRODWHG ZLWK WKH ,%, IUDJPHQW HOXWHU DQG QJ ZHUH XVHG LQ WKH UHDFWLRQ $ , UHDFWLRQ ZDV FRPSRVHG RI cLO RI ; EXIIHU P0 7ULV+&O S+ P0 0J&O PJPO ERYLQH VHUXP DOEXPLQ %6$ 6LJPD )UDFWLRQ 9ff M RI ; QXFOHRWLGHV W0 HDFK RI G$73 G*73 G773f &L RI DA3G&73 XQLWV RI ( FROL '1$ SRO\PHUDVH %5/f WO RI D [ nA GLOXWLRQ RI '1DVHO VWRUHG LQ P0 +& DW PJPOf DFWLYDWHG DW IRU KRXUV RQ LFH LQ P0 7ULV+&O S+ P0 0J&O PJPO %6$ 7KH UHDFWLRQ ZDV EHJXQ ZLWK WKH ILQDO DGGLWLRQ RI WKH '1DVHO DQG LQFXEDWHG DW r& IRU PLQ 7KH UHDFWLRQ ZDV VWRSSHG E\ GLOXWLRQ ZLWK 7( DQG WKH SUREH SXULILHG RYHU D SLSHWWH PP [ PP )LVKHUf FROXPQ RI %LRJHO $OP LQ 7( 7KH VDPSOH ZDV DSSOLHG WR WKH FROXPQ LQ D , DOLTXRW DQG , IUDFWLRQV ZHUH FROOHFWHG 7KH ODEHOOHG '1$ XVXDOO\ FDPH RII LQ IUDFWLRQV 7KHVH ZHUH SRROHG DQG TXDQWLWDWHG LQ WKH VFLQWLOODWLRQ FRXQWHU 7KH VSHFLILF DFWLYLW\ RI WKHVH SUREHV ZDV DOZD\V JUHDWHU WKDQ [ A FSPXJ 2OLJRODEHOOLQJ ZDV GRQH DV GHVFULEHG E\ )HLQEHUJ DQG 9RJHOVWHLQ f 7KH '1$ IUDJPHQW WR QJf ZDV DGGHG WR D PO (SSHQGRUI WXEH DQG GG+ DGGHG WR PDNH WKH ILQDO YROXPH DIWHU DGGLWLRQ RI WKH RWKHU FRPSRQHQWV HLWKHU QO RU M 7KLV WXEH ZDV WKHQ KHDWHG WR r& IRU WZR PLQXWHV DQG

PAGE 61

SODFHG RQ LFH 7R WKLV GHQDWXUHG '1$ IUDJPHQW ZDV DGGHG , RI ; ROLJRODEHOOLQJ EXIIHU ; P0 +HSHV S+ [0 HDFK RI G$73 G*73 G773 P0 7ULV+&O S+ P0 PHUFDSWRHWKDQRO PJPO PL[HG EH[DQXFOHRWLGHV 3KDUPDFLDff :H DGGHG [&L RI >DA3@G&73 DQG XQLWV RI .OHQRZ IUDJPHQW %5/f 7KH UHDFWLRQ ZDV DOORZHG WR SURFHHG IRU KRXUV WR RYHUQLJKW DQG SXULILHG DV GHVFULEHG DERYH IRU WKH QLFN WUDQVODWLRQ UHDFWLRQ 6SHFLILF DFWLYLW\ RI WKHVH SUREHV 2 XVXDOO\ H[FHHGHG [ r FSP[J 3UHSDUDWLRQ RI WRWDO FHOOXODU 51$ %HFDXVH RI WKH VHQVLWLYLW\ RI KLVWRQH P51$ WR GHJUDGDWLRQ IROORZLQJ WKH FHVVDWLRQ RI '1$ V\QWKHVLV LW ZDV LPSRUWDQW WKDW WKH LQLWLDO VWHSV RI WKLV SURWRFRO EH FDUULHG RXW DV TXLFNO\ DV SRVVLEOH 7KH PHGLXP IURP SODWHV ZDV UHPRYHG DQG PO RI FROG 3XFNnV VDOLQH *LEFRf b ('7$ ZDV DGGHG DQG WKH FHOOV ZHUH LPPHGLDWHO\ VFUDSHG IURP WKH GLVK DQG WUDQVIHUUHG WR D VWHULOH '(3& WUHDWHG FRUH[ WXEH 7KH FHOOV ZHUH SHOOHWHG LQ WKH FOLQLFDO FHQWULIXJH DW D VHWWLQJ RI ILYH IRU PLQ WKH VXSHUQDWDQW ZDV UHPRYHG DQG WKH FHOOV ZHUH IUR]HQ RQ GU\ LFH DQG VXEVHTXHQWO\ VWRUHG DW r& IRU QR PRUH WKDQ D IHZ GD\V 'HJUDGDWLRQ FDQ RFFXU TXLFNO\ DQG WKHUHIRUH LW ZDV QHFHVVDU\ WR SUHSDUH WKH 51$ DV VRRQ DIWHU KDUYHVWLQJ DV SRVVLEOH 7KH FHOO SHOOHW ZDV UHVXVSHQGHG LQ PO RI P0 7ULV +& S+ P0 ('7$ DQG [JPO SRO\YLQ\OVXOIDWH 396 (DVWPDQ .RGDNf 6'6 bf ZDV DGGHG WR D ILQDO FRQFHQWUDWLRQ RI b DQG SURWHLQDVH DGGHG WR [JPO ,QFXEDWLRQ ZDV DW r& IRU PLQ DW ZKLFK SRLQW 0 1D&O ZDV DGGHG WR D ILQDO FRQFHQWUDWLRQ RI P0 DQG WKH LQFXEDWLRQ FRQWLQXHG IRU DQ DGGLWLRQDO PLQ 7KH WRWDO QXFOHLF DFLGV ZHUH H[WUDFWHG ZLWK

PAGE 62

YROXPHV RI SKHQROFKORURIRUP WLPHV DQG ZLWK YROXPHV RI FKORURIRUP WLPH 7KH WRWDO QXFOHLF DFLG ZDV WKHQ SUHFLSLWDWHG E\ WKH DGGLWLRQ RI LO RI 0 1D$F DQG YROV RI b HWKDQRO r& RYHUQLJKWf 7KH QXFOHLF DFLGV ZHUH UHFRYHUHG E\ FHQWULIXJDWLRQ DW USP IRU PLQ DW r& 7KH SHOOHW ZDV UHVXVSHQGHG LQ Q RI P0 7ULV +& S+ f P0 &D&O DQG P0 0J&O ZLWK WKH DGGLWLRQ RI cLO RI SURWHLQDVH WUHDWHG '1DVH VHH EHORZ IRU SUHSDUDWLRQf DQG GLJHVWHG DW r& XQWLO LW ZDV FRPSOHWHO\ VXVSHQGHG WKLV XVXDOO\ UHTXLUHG IURP PLQ WR KU LQWHUPLWWHQW YRUWH[LQJ KHOSHG WR GLVUXSW WKH SHOOHWf :KHQ WKH SHOOHW ZDV QR ORQJHU YLVLEOH 6'6 DQG 1D&O ZHUH DGGHG WR D ILQDO FRQFHQWUDWLRQ RI b DQG P0 UHVSHFWLYHO\ 7KH VROXWLRQ ZDV H[WUDFWHG WLPHV ZLWK SKHQROFKORURIRUP DQG WLPH ZLWK FKORURIRUP DQG SUHFLSLWDWHG ZLWK YROV RI b HWKDQRO RYHUQLJKW 51$ ZDV HLWKHU VWRUHG LQ ZDWHU DW r& RU LQ HWKDQRO DW r& (WKDQRO VXVSHQVLRQV QHHGHG WR EH YLJRURXVO\ PL[HG WR DYRLG TXDQWLWDWLRQ SUREOHPV ZLWK WKH 51$ DOLTXRWV 51$ VWRUHG LQ ZDWHU ZDV DOVR PL[HG EHIRUH UHPRYDO 3UHSDUDWLRQ RI 51DVH IUHH '1DVHO 'HR[\ULERQXFOHDVH 6LJPDf PJPO LQ P0 7ULV+&O S+ P0 &D&Of ZDV SUHLQFXEDWHG DW r& IRU PLQ DQG WKHQ IXUWKHU LQFXEDWHG IRU KUV DW r& LQ WKH SUHVHQFH RI YROXPHV RI SURWHLQDVH PJPO LQ P0 7ULV+&O S+ P0 &D&Of WR GLJHVW DQ\ FRQWDPLQDWLQJ ULERQXFOHDVH DFWLYLW\ DV GHVFULEHG E\ 7XOOLV DQG 5XELQ f 7KLV SUHSDUDWLRQ ZDV VWDEOH RQ LFH IRU VHYHUDO KRXUV WR RYHUQLJKW 6, QXFOHDVH SURWHFWLRQ DVVD\ 7KLV PHWKRG LV HVVHQWLDOO\ DV GHVFULEHG E\ %HUN DQG 6KDUS f ZLWK PRGLILFDWLRQV ,Q RUGHU WR

PAGE 63

GHWHFW WKH KXPDQ KLVWRQH + P51$V SJ RI WRWDO FHOOXODU 51$ IURP D & FHOO OLQH FRQWDLQLQJ DQ LQWHJUDWHG KXPDQ + KLVWRQH JHQH FRQVWUXFW ZHUH DGGHG WR D '(3& WUHDWHG PO (SSHQGRUI WXEH 6XIILFLHQW KXPDQ DQG PRXVH SUREH ODEHOOHG ZLWK >\ASM$73 ZDV DGGHG WR SURYLGH DQ H[FHVV WR QJf RI SURWHFWHG IUDJPHQW LQ WKH UHDFWLRQ 3UREH H[FHVV ZDV HLWKHU GHWHUPLQHG E\ WLWUDWLRQ RI WKH SUREHV ZLWK D VWRFN & RU +H/D 51$ VDPSOH RU E\ DGGLWLRQ RI WZLFH WKH DPRXQW RI SUREH WR VRPH UHDFWLRQV 2QH WZHQWLHWK YROXPH RI 0 1D&O DQG YROXPHV RI b HWKDQRO ZHUH DGGHG DQG WKH VROXWLRQ ZDV SODFHG RQ GU\ LFH IRU PLQ 7KH SUHFLSLWDWHG 51$ DQG SUREHV ZHUH UHFRYHUHG E\ FHQWULIXJDWLRQ DW USP IRU PLQ DW r& 7KH SHOOHW ZDV EULHIO\ GULHG LQ D 6DYDQW 6SHHG 9DF PLQf )RXU PLFUROLWHUV RI ; K\EULGL]DWLRQ EXIIHU 0 1D&O 0 3LSHV S+ DQG P0 ('7$f ZHUH DGGHG IROORZHG E\ SL RI UHFU\VWDOOL]HG IRUPDPLGH 6SHFLDOW\ %LRFKHPLFDOVf 7KH EXIIHU ZDV DGGHG ILUVW WR WKH SHOOHW WR IDFLOLWDWH UHK\GUDWLRQ 7KH ILQDO YROXPH SL ZDV YRUWH[HG YLJRURXVO\ WR UHVXVSHQG WKH SUHFLSLWDWHG 51$ DQG SUREH 7KH WXEHV ZHUH SODFHG DW r& IRU PLQ DQG WKHQ WUDQVIHUUHG LPPHGLDWHO\ WR D r& ZDWHU EDWK DQG LQFXEDWHG IRU KUV RYHUQLJKWf (DFK WXEH ZDV UHPRYHG LQGLYLGXDOO\ IURP WKH ZDWHU EDWK DQG WKH UHDFWLRQ GLOXWHG LPPHGLDWHO\ ZLWK YROXPHV RI LFHFROG 6, GLJHVWLRQ EXIIHU P0 1D&O P0 1D2$F S+ DQG P0 =Q6f DQG SODFHG EULHIO\ RQ LFH 6, QXFOHDVH %RHKULQJHU0DQQKHLPf ZDV DGGHG WR D ILQDO FRQFHQWUDWLRQ RI XQLWVSO DQG GLJHVWLRQ ZDV WKHQ GRQH DW r& IRU RQH KRXU DQG DW r& IRU PLQ WKH WXEHV ZHUH SODFHG RQ LFHf 7HQ PLFUROLWHUV HDFK RI b 6'6 DQG 0 1+2+ ZHUH DGGHG DQG WKH UHDFWLRQ ZDV H[WUDFWHG DQG SUHFLSLWDWHG ZLWK YROXPHV RI b HWKDQRO

PAGE 64

7KH OHQJWK RI SUHFLSLWDWLRQ ZDV IURP KRXUV DW r& 7KH SUHFLSLWDWLRQV VKRXOG QRW EH GRQH DW r& DV WKLV ZLOO FDXVH WKH IRUPDWLRQ RI IRUPDPLGH FU\VWDOVf 7KH SUHFLSLWDWHG SUREH IUDJPHQW ZDV UHFRYHUHG E\ FHQWULIXJDWLRQ DW USP IRU PLQ 7KH SHOOHW ZDV EULHIO\ GULHG DQG UHVXVSHQGHG LQ c-< RI ORDGLQJ EXIIHU b IRUPDPLGH ,; 7%( b %URPRSKHQRO %OXH DQG b ;\OHQH &\DQROf 6DPSOHV ZHUH GHQDWXUHG DW r& IRU PLQ DQG SODFHG LPPHGLDWHO\ RQ GU\ LFH XQWLO ORDGHG 6DPSOHV ZHUH HOHFWURSKRUHVHG RQ D b SRO\DFU\ODPLGH + XUHD JHO DW D : FRQVWDQW SRZHU IRU KRXUV WKH DFU\ODPLGH WR ELVDFU\ODPLGH UDWLR ZDV f *HOV ZHUH GULHG DQG H[SRVHG WR SUHIODVKHG ;$5 ILOP .RGDNf DW r& ZLWK 'XSRQW &URQH[ /LJKWQLQJ 3OXV 6FUHHQV '1$ VHTXHQFLQJ $OO VHTXHQFLQJ UHDFWLRQV ZHUH FDUULHG RXW H[DFWO\ DV GHVFULEHG E\ 0D[DP DQG *LOEHUW f DQG VR ZLOO QRW EH GHWDLOHG KHUH )RU HDFK IUDJPHQW WKDW ZDV VHTXHQFHG WKH 'LPHWK\O 6XOIDWH '06ff *$ )RUPLF DFLGf &7 +\GUD]LQHf & RQO\ +\GUD]LQH LQ KLJK VDOWf DQG $!& 1 1D2+f UHDFWLRQV ZHUH GRQH 6LQJOH HQG ODEHOOHG IUDJPHQWV ZHUH SUHSDUHG DV IROORZV SODVPLG '1$V ZHUH GLJHVWHG ZLWK DQ DSSURSULDWH UHVWULFWLRQ HQGRQXFOHDVH WUHDWHG ZLWK SKRVSKDWDVH DQG ODEHOOHG DV GHVFULEHG EHORZ $IWHU WKH '1$ ZDV ODEHOOHG LW ZDV GLJHVWHG ZLWK D VHFRQG UHVWULFWLRQ HQ]\PH WR SURGXFH WZR VLQJOH HQG ODEHOOHG IUDJPHQWV 7R SXULI\ WKH IUDJPHQW RI LQWHUHVW IRU DQDO\VLV ZH HOHFWURSKRUHVHG WKH '1$ RQ D QDWLYH b DFU\ODPLGH JHO 7KH ORFDWLRQ RI HDFK ODEHOOHG '1$ EDQG RQ WKH JHO ZDV GHWHUPLQHG E\ H[SRVXUH WR &URQH[ 'XSRQWf ;UD\ ILOP $IWHU DOLJQPHQW RI WKH ILOP DQG WKH JHO ZH H[FLVHG WKH EDQGV RI LQWHUHVW DQG HOXWHG WKHP LQ L/ RI P0 DPPRQLXP

PAGE 65

DFHWDWH P0 0J&O b 6'6 RYHUQLJKW DW r& DV GHVFULEHG E\ 0D[DUD DQG *LOEHUW f 7KH DFU\ODPLGH JHO VOLFH ZDV JURXQG ZLWK D VLOLFRQL]HG JODVV URG LQ D PO (SSHQGRUI WXEH SULRU WR DGGLWLRQ RI WKH HOXWLRQ EXIIHU $IWHU WKH RYHUQLJKW LQFXEDWLRQ WKH DFU\ODPLGH ZDV FHQWULIXJHG WR WKH ERWWRP RI WKH WXEH DW USP IRU PLQ 7KH VXSHUQDWDQW ZDV UHPRYHG DQG WKH SHOOHW UHVXVSHQGHG LQ M RI HOXWLRQ EXIIHU FHQWULIXJHG DQG WKH VXSHUQDWDQW UHPRYHG 7KLV SURFHGXUH URXWLQHO\ UHVXOWHG LQ UHFRYHULHV RI b RI WKH ODEHOOHG '1$ IUDJPHQW 7KH SRROHG VXSHUQDWDQWV ZHUH WKHQ SUHFLSLWDWHG WZLFH LQ VXFFHVVLRQ ZLWK 0 6RGLXP $FHWDWH DQG b HWKDQRO 7KHVH IUDJPHQWV ZHUH WKHQ XVHG LQ WKH VHTXHQFLQJ UHDFWLRQV QRWHG DERYH $IWHU WKH UHDFWLRQV ZHUH FDUULHG RXW DQG WKH '1$ ZDV FOHDYHG ZLWK SLSHULGLQH DQG O\RSKLOL]HG LW ZDV HOHFWURSKRUHVHG : FRQVWDQW SRZHUf RQ D b DFU\ODPLGH 0 XUHD JHO FP [ FP [ PPf 7KH VDPSOHV ZHUH UHVXVSHQGHG LQ LO RI 6, ORDGLQJ EXIIHU DQG GLYLGHG LQWR WZR , DOLTXRWV 7KHVH ZHUH ERLOHG IRU PLQ DQG SODFHG RQ GU\ LFH 7R PD[LPL]H WKH DPRXQW RI WKH VHTXHQFH ZH FRXOG UHDG WZR ORDGLQJV RI WKH UHDFWLRQV ZHUH GRQH 7KH ILUVW  VDPSOH RI HDFK UHDFWLRQ ZDV ORDGHG DQG HOHFWURSKRUHVHG IRU KRXUV RU XQWLO WKH %URPRSKHQRO %OXH UHDFKHG WKH ERWWRP RI WKH JHO 7KH VHFRQG VDPSOH ZDV WKHQ ORDGHG DQG HOHFWURSKRUHVHG IRU DQ DGGLWLRQDO KRXUV 7KH JHO ZDV WKHQ GULHG DQG H[SRVHG WR HLWKHU &URQH[ RU ;$5 ILOP DW URRP WHPSHUDWXUH RYHUQLJKW 6, QXFOHDVH DQDO\VLV SUREH SUHSDUDWLRQ 7ZR SUREHV ZHUH URXWLQHO\ XVHG WR TXDQWLWDWH WKH DPRXQW RI KXPDQ DQG PRXVH KLVWRQH + P51$ SUHVHQW LQ FHOO OLQH VDPSOHV 7KH KXPDQ SUREH ZDV SUHSDUHG E\ GLJHVWLRQ RI J RI S) RU S) ZLWK 1FRO 7KLV GLJHVWLRQ ZDV WKHQ

PAGE 66

H[WUDFWHG SUHFLSLWDWHG DQG WKH '1$ UHFRYHUHG E\ FHQWULIXJDWLRQ DW N USP IRU PLQ 7KH SHOOHWHG '1$ ZDV UHVXVSHQGHG LQ L/ RI P0 7ULV+&O S+ P0 ('7$ XQLW RI FDOI LQWHVWLQDO SKRVSKDWDVH &,3f ZDV DGGHG DQG WKH PL[WXUH ZDV LQFXEDWHG DW r& IRU PLQ $Q DGGLWLRQDO DOLTXRW RI HQ]\PH ZDV DGGHG DQG WKH '1$ LQFXEDWHG IRU PLQ 7KH UHDFWLRQ ZDV VWRSSHG E\ WKH DGGLWLRQ RI (*7$ HWK\OHQHJO\FRO ELVDPLQRHWK\O HWKHUf111n1nWHWUDDFHWLF DFLGf WR P0 DQG KHDWHG WR r& IRU PLQ 7KH '1$ ZDV WKHQ H[WUDFWHG DQG SUHFLSLWDWHG 7KH '1$ ZDV UHVXVSHQGHG LQ -/ RI \A3$73 &Lf DQG L/ RI ; .LQDVH EXIIHU P0 7ULV+&O S+ P0 0J&O P0 PHUFDSWRHWKDQROf $IWHU UHVXVSHQVLRQ XQLWV RI 7 SRO\QXFOHRWLGH NLQDVH 8QLWHG 6WDWHV %LRFKHPLFDO &RUSRUDWLRQf ZHUH DGGHG DQG WKH UHDFWLRQ LQFXEDWHG DW r& IRU PLQ 7KH UHDFWLRQ ZDV VWRSSHG E\ H[WUDFWLRQ IROORZHG E\ SUHFLSLWDWLRQ 7KH '1$ ZDV UHFRYHUHG UHVXVSHQGHG DQG GLJHVWHG ZLWK +LQGOOO WR SURGXFH D SUREH IUDJPHQW ODEHOOHG DW WKH 1FRO VLWH LQ WKH KXPDQ + JHQH 7KH UHDFWLRQ ZDV ZDV HOHFWURSKRUHVHG RQ D b DJDURVH JHO LQ ,; 7%( DQG WKH ES 1FRO+LQGOOO IUDJPHQW ODEHOOHG DW WKH 1FRO VLWH SXULILHG ZLWK WKH ,%, IUDJPHQW HOXWHU DV GHVFULEHG E\ ,%, 7KH PRXVH + SUREH ZDV SURGXFHG LQ D VLPLODU PDQQHU IURP WKH SODVPLG S%5PXVKLO++LQI, 6HLOHU7X\QV DQG %LUQVWLHO f GLJHVWHG ZLWK %VW1, 7KH ODEHOOHG ES %VW1, IUDJPHQW ZDV LVRODWHG DQG XVHG DV D FRQWURO LQ HDFK 6, QXFOHDVH SURWHFWLRQ DVVD\ $OWKRXJK WKLV SUREH ZDV QRW VLQJOH HQG ODEHOOHG ZH KDG QR DPELJXLWLHV EHFDXVH RI WKLV IDFW 7R PDNH WKH SUREH VKRUWHU DQG VLQJOH HQG ODEHOOHG ZRXOG KDYH SRVVLEO\ REVFXUHG WKH SURWHFWHG IUDJPHQW RI WKH KXPDQ + JHQH QWf %RWK WKH KXPDQ DQG PRXVH + 6, QXFOHDVH

PAGE 67

SUREHV ZHUH TXDQWLWDWHG RQ DJDURVH JHOV VWDLQHG ZLWK HWKLGLXP EURPLGH DQG H[SRVHG WR &URQH[ ;UD\ ILOP WR MXGJH WKH UHODWLYH VWUHQJWK RI HDFK *HQHUDOO\ D ODUJH DPRXQW RI SUREH VHYHUDO PLFURJUDPVf ZDV SUHSDUHG VLPXOWDQHRXVO\ DQG 6, QXFOHDVH DQDO\VLV ZDV GRQH RQ PDQ\ VDPSOHV WR HQVXUH WKDW WKH H[SUHVVLRQ ZDV PHDVXUHG ZLWK WKH VDPH VWUHQJWK SUREH LQ HDFK FDVH 9DULDWLRQ LQ WKH PRXVH DQG KXPDQ SUREH VSHFLILF DFWLYLW\ GLG RFFXU KRZHYHU WKH GDWD SUHVHQWHG LQ WKLV ZRUN ZHUH SUHSDUHG SULPDULO\ IURP D ODUJH VHW RI 6, QXFOHDVH DVVD\V LQ ZKLFK PDQ\ FHOO OLQHV ZHUH DVVD\HG VLGH E\ VLGH ZLWK WKH VDPH PRXVH DQG KXPDQ SUREH SUHSDUDWLRQ :KHQ DGGLWLRQDO FHOO OLQHV ZHUH VXEVHTXHQWO\ PHDVXUHG VDPSOHV DVVD\HG SUHYLRXVO\ ZHUH LQFOXGHG WR HQVXUH WKDW WKH UHVXOWV FRXOG EH UHODWHG WR UHVXOWV IURP SUHYLRXV DVVD\V 'HQVLWRPHWU\ DQG GDWD DQDO\VLV 'HQVLWRPHWU\ RI DXWRUDGLRJUDPV ZDV GRQH WR TXDQWLWDWH WKH 6, QXFOHDVH DQDO\VLV H[SHULPHQWV RI + JHQH H[SUHVVLRQ DQG WKH FRS\ QXPEHU RI WKH FHOO OLQHV 6HYHUDO ILOPV RI GLIIHUHQW OHQJWK H[SRVXUH ZHUH XWLOL]HG WR GHWHUPLQH WKH LQWHQVLW\ RI WKH 6, SURWHFWHG IUDJPHQW VLJQDO 7ZR GHQVLWRPHWHUV ZHUH XVHG D =HLQHK ODVHU GHQVLWRPHWHU DQG DQ /.%3KDUPDFLD KLJK LQWHQVLW\ ODVHU GHQVLWRPHWHU &RPSDULVRQ RI WKH FDSDELOLWLHV RI HDFK GHQVLWRPHWHU GHPRQVWUDWHG WKDW IRU PRVW ILOPV HLWKHU RQH ZDV DGHTXDWH KRZHYHU IRU SDUWLFXODUO\ ORZ LQWHQVLW\ VLJQDOV WKH /.% PDFKLQH JDYH PRUH UHSURGXFLEOH UHVXOWV 7KH GDWD FROOHFWHG E\ ERWK GHQVLWRPHWHUV ZHUH FRPSXWHU SURFHVVHG ZLWK HLWKHU WKH 9LGHRSKRUHVLV ,, =HLQHK %LRPHG ,QVWUXPHQWVf RU WKH *HO6FDQ ;/ SURJUDPV /.%3KDUPDFLDf (DFK SURJUDP ZDV VXFFHVVIXOO\ XVHG WR DQDO\]H WKH LQWHQVLW\ RI UDGLRDFWLYH VLJQDOV IRU H[SUHVVLRQ DQG FRS\ QXPEHU 7KH DUHDV XQGHU WKH FXUYH IRU WKH 6,

PAGE 68

QXFOHDVH DQDO\VLV PRXVH DQG KXPDQf DQG WKH FRS\ QXPEHU EORWV + DQG 6 ULERVRPDOf ZHUH LQWHJUDWHG DQG H[SUHVVHG DV DQ DPRXQW RI DEVRUEDQFH XQLWV 7R FDOFXODWH WKH H[SUHVVLRQ RI D SDUWLFXODU FRQVWUXFW WKH KXPDQ H[SUHVVLRQ YDOXH ZDV GLYLGHG E\ WKH PRXVH YDOXH DQG H[SUHVVHG DV D UDWLR 6DPSOH FDOFXODWLRQV IRU FRS\ QXPEHU DUH SUHVHQWHG LQ $SSHQGL[ $ DQG IRU 6, QXFOHDVH DQDO\VLV LQ $SSHQGL[ % $JDURVH DQG DFU\ODPLGH JHO HOHFWURSKRUHVLV $JDURVH %LR5DG PROHFXODU ELRORJ\ JUDGHf JHOV ZHUH SUHSDUHG DV GHVFULEHG E\ 0DQLDWLV HW DO f 7KH EXIIHU ZDV ,; 7%( DQG WKH EXIIHU LQ WKH UHVHUYRLU ZDV DOVR ,; 7%( [ FP JHOV ZHUH XVHG IRU ODUJH VFDOH IUDJPHQW SXULILFDWLRQ DQG 6RXWKHUQ EORW DQDO\VLV RI FHOO OLQH '1$V 0LQLJHOV ZHUH XVHG IRU FKHFNLQJ WKH H[WHQW RI GLJHVWLRQ DQG DQDO\VLV RI UDSLG DQG RWKHU SODVPLG SUHSDUDWLRQV $FU\ODPLGH JHOV ZHUH URXWLQHO\ UXQ IRU 6L QXFOHDVH DQDO\VLV DQG FRQVLVWHG RI b DFU\ODPLGH DFU\ODPLGH WR ELV DFU\ODPLGHf 0 XUHD DQG ,; 7%( 7KH JHO VROXWLRQ POf ZDV SRO\PHUL]HG ZLWK WKH DGGLWLRQ RI M RI b DPPRQLXP SHUVXOIDWH DQG ILO RI 111n1nWHWUD PHWK\OHWK\OHQHGLDPLQH ,W ZDV LPPHGLDWHO\ SRXUHG WKH FRPE SXW LQWR SODFH DQG DOORZHG WR KDUGHQ IRU KRXU %HIRUH XVH WKH ZHOOV ZHUH ULQVHG ZLWK EXIIHU DQG WKH JHO ZDV SUHHOHFWURSKRUHVHG IRU PLQ DW : FRQVWDQW SRZHU 7KH VDPSOHV ZHUH ORDGHG DQG HOHFWURSKRUHVHG DW : FRQVWDQW SRZHU *HQRPLF VHTXHQFLQJ 7KLV WHFKQLTXH ZDV GRQH DV GHVFULEHG E\ &KXUFK DQG *LOEHUW f 0RQRFORQDO FHOO OLQHV S)PO DQG ZHUH JURZQ LQ FP SODWHV SHU FRQVWUXFWf 6HYHQ RI WKH ZHUH WUHDWHG ZLWK b '06 LQ PLV RI PHGLXP IRU PLQXWHV 7KUHH ZHUH OHIW XQWUHDWHG WKH '1$ SXULILHG DQG WUHDWHG ZLWK '06 LQ YLWUR DV D

PAGE 69

FRQWURO 7KH '06 ZDV UHPRYHG IURP WKH SODWH DQG WKH FHOOV ZDVKHG WZLFH LQ SKRVSKDWH EXIIHUHG VDOLQH 3%6 P0 1D32 1D&O S+ P0 7ULV+&O S+ f 7KH '06 WUHDWHG FHOOV ZHUH VFUDSHG IURP WKH SODWH DQG WKH '1$ SXULILHG E\ LQFXEDWLRQ ZLWK SURWHLQDVH DV GHVFULEHG DERYH DQG H[WUDFWLRQ 7R SXULI\ KLJK PROHFXODU ZHLJKW '1$ RQO\ b HWKDQRO ZDV VORZO\ DGGHG WR WKH WXEH ZKLOH VZLUOLQJ WKH VROXWLRQ ZLWK D VLOLFRQL]HG JODVV URG 7KH '1$ ZDV ZDVKHG RII WKH URG ZLWK 7( DQG TXDQWLWDWHG VSHFWURSKRWRPHWULFDOO\ 7KH SXULILHG '1$ ILJf ZDV UHVWULFWHG ZLWK +LH ,, WUHDWHG ZLWK SLSHULGLQH DQG O\RSKLOL]HG DV GHVFULEHG E\ WKH VHTXHQFLQJ SURWRFRO RI 0D[DP DQG *LOEHUW f 7KH VDPSOHV ZHUH WKHQ VHSDUDWHG LQ D b DFU\ODPLGH JHO ZLWK 0 XUHD DQG HOHFWURWUDQVIHUUHG WR D Q\ORQ PHPEUDQH *HQHVFUHHQf 7KH K\EULGL]DWLRQ SUREH ZDV SUHSDUHG DV GHVFULEHG E\ 3DXOL HW DO f ZLWK SULPHU H[WHQVLRQ RI D IUDJPHQW FORQHG LQWR 0 ,Q RXU H[SHULPHQWV K\EULGL]DWLRQ ZDV SHUIRUPHG ZLWK WKH +LH ,, n XSSHU VWUDQG SUREH DW r& IRU KUV IROORZHG E\ HLJKW PLQ ZDVKHV DW r& P0 ('7$ P0 1D+3 S+ b 6'6f 7KH PHPEUDQH ZDV WKHQ H[SRVHG WR SUHIODVKHG ;$5 ILOP DW & ,Q WKHVH H[SHULPHQWV ZDV UHVSRQVLEOH IRU WKH JURZWK RI WKH FHOOV DQG 'U 8UV 3DXOL SHUIRUPHG WKH UHVW RI WKH H[SHULPHQW ZLWK P\ FRQVWDQW HQFRXUDJHPHQW DQG RFFDVLRQDO LQWHUYHQWLRQ 6WDWLVWLFDO DQDO\VLV 7KH DQDO\VLV RI WKH 6, QXFOHDVH DQG FRS\ QXPEHU GDWD WKDW ZH DFFXPXODWHG ZDV VXJJHVWHG E\ 'U 0LNH &RQORQ RI WKH 8QLYHUVLW\ RI )ORULGD %LRVWDWLVWLFV 8QLW $IWHU KH KDG H[DPLQHG WKH GDWD DQG JDLQHG DQ XQGHUVWDQGLQJ RI WKH FRPSOH[LWLHV LQYROYHG KH DGYLVHG WKDW ZH HPSOR\ D UDQNLQJ WHVW WKH :LOFR[RQ 5DQN 6XP 7HVW 7KLV

PAGE 70

WHVW PDNHV WKH QXOO DVVXPSWLRQ WKDW WZR JURXSV RI GDWD WKDW DUH FRPSDUHG FDPH IURP WKH VDPH UDQGRP GLVWULEXWLRQ 7KH PHPEHUV RI HDFK JURXS DUH DVVLJQHG D UDQN LH f IURP KLJKHVW WR ORZHVW LQ ERWK JURXSV )RU H[DPSOH LI ZH KDG WZR VHWV RI GDWD $ DQG DQG % DQG WKH PHPEHUV RI JURXS $ DQG % ZRXOG EH UDQNHG LQ RUGHU RI LQFUHDVLQJ YDOXH 7KH DEVROXWH YDOXHV RI WKH GDWD DUH LJQRUHG DQG RQO\ WKH UDQN LV H[DPLQHG *URXS $O f LV FRQYHUWHG WR 5DQNV *URXS % f LV FRQYHUWHG WR 5DQNV :H KDYH PHPEHUV LQ HDFK JURXS ZLWK RQO\ RQH SRLQW RI RYHUODS EHWZHHQ WKH WZR JURXSV DW UDQNV DQG 7KH 5DQN 6XP IRU JURXS $ DQG IRU JURXS % 7R GHWHUPLQH LI WKH GLIIHUHQFH RI WKH 5DQN VXPV LV VLJQLILFDQW VWDWLVWLFDO WDEOHV RI SUREDELOLW\ IRU WKLV WHVW ZHUH HPSOR\HG 7KHVH WZR JURXSV RI GDWD DUH QRW VLJQLILFDQWO\ GLIIHUHQW DW S 7KH UHDVRQ LV WKH VPDOO VDPSOH VL]H :LWK RQO\ ILYH PHPEHUV LQ HDFK JURXS WKH IDFW WKDW RQH RI WKH PHPEHUV RI HDFK JURXS IDOOV LQWR WKH UDQJH RI WKH RWKHU JURXS SUHFOXGHV DQ\ VLJQLILFDQFH $V WKH JURXSV EHFRPH ODUJHU WKH RYHUODS DOORZHG IRU VLJQLILFDQFH EHFRPHV JUHDWHU KDYH IRXQG ZLWK VRPH RI P\ GDWD WKDW ODUJHU VDPSOH VL]HV ZRXOG KDYH EHHQ QHFHVVDU\ WR HPSOR\ WKLV WHVW LQ DOO FDVHV

PAGE 71

&+$37(5 +,6721( + n 5(*8/$725< 6(48(1&(6 ,W KDV EHHQ HVWDEOLVKHG WKDW WKH VWHDG\ VWDWH OHYHO RI KLVWRQH P51$ GXULQJ WKH FHOO F\FOH LV D IXQFWLRQ RI ERWK WUDQVFULSWLRQ DQG PHVVDJH VWDELOLW\ 7KHVH WZR FRPSRQHQWV RI KLVWRQH P51$ PHWDEROLVP KDYH EHHQ VWXGLHG LQ D QXPEHU RI GLIIHUHQW ZD\V (DUOLHU VWXGLHV E\ 3OXPE HW DO D Ef XWLOL]HG SXOVHG LQFRUSRUDWLRQ RI A+XULGLQH WR GHWHUPLQH WKH FRQWULEXWLRQ RI WUDQVFULSWLRQ WR WKH LQFUHDVH LQ KLVWRQH P51$ OHYHOV GXULQJ WKH 6SKDVH RI WKH FHOO F\FOH /DWHU %DXPEDFK HW DO f XVHG QXFOHDU UXQRQ WUDQVFULSWLRQ WR PHDVXUH WUDQVFULSWLRQ RI WKH KLVWRQH JHQHV GLUHFWO\ GXULQJ WKH FHOO F\FOH 7KH LQFUHDVH LQ WUDQVFULSWLRQ GXULQJ HDUO\ 6SKDVH ZDV GHWHUPLQHG WR EH IROG E\ ERWK %DXPEDFK HW DO f DQG 3OXPE HW DO Ef ,Q WKH VWXGLHV RI %DXPEDFK HW DO f PHVVDJH VWDELOLW\ ZDV HOLPLQDWHG DV D YDULDEOH LQ WKH H[SHULPHQWV DQG WKHUHIRUH WKH\ ZHUH DEOH WR GHWHUPLQH WKDW KLVWRQH JHQH WUDQVFULSWLRQ RFFXUUHG WKURXJKRXW WKH FHOO F\FOH DW D EDVDO OHYHO ,QVWHDG RI DQ RQRII PHFKDQLVP IRU WUDQVFULSWLRQDO FRQWURO DQ HQKDQFHPHQW ZDV DSSDUHQW GXULQJ WKH ILUVW KRXUV RI 6 SKDVH 7KH IROG HQKDQFHPHQW LQ WKH KLVWRQH JHQH WUDQVFULSWLRQ OHYHO KDV EHHQ GXSOLFDWHG LQ YDULRXV V\VWHPV DQG E\ GLIIHUHQW PHWKRGV GXULQJ WKH ODVW \HDUV 6LWWPDQ HW DO +HLQW] HW DO $UWLVKHYVN\ HW DO f

PAGE 72

7KH LPSOLFDWLRQV DUH WKDW SURWHLQ'1$ RU SURWHLQSURWHLQ LQWHUDFWLRQV RFFXU WKDW VWLPXODWH WKH LQFUHDVHG OHYHO RI WUDQVFULSWLRQ (YLGHQFH IRU VSHFLILF SURWHLQ'1$ LQWHUDFWLRQV KDV EHHQ JDWKHUHG E\ $UWLVKHYVN\ HW DO f 7KH\ GHPRQVWUDWHG DW WKH HQG RI DQG WKH EHJLQQLQJ RI 6 SKDVH WKH SUHVHQFH RI D IDFWRU WKDW LQWHUDFWHG ZLWK WKH SUR[LPDO SURPRWHU UHJLRQ RI WKH KDPVWHU + SURPRWHU 7KH ) + JHQH ZLWK ZKLFK P\ ZRUN KDV EHHQ GRQH DOVR GHPRQVWUDWHV SURWHLQ'1$ LQWHUDFWLRQV LQ WKH SUR[LPDO SURPRWHU UHJLRQ 3DXOL HW DO YDQ :LMQHQ HW DO f KRZHYHU WKHUH DUH QR GHWHFWDEOH FKDQJHV LQ WKHVH LQWHUDFWLRQV GXULQJ WKH FHOO F\FOH 6LQFH LW KDV EHHQ GHPRQVWUDWHG WKDW WUDQVFULSWLRQ RI WKH ) + KLVWRQH JHQH SURFHHGV WKURXJKRXW WKH FHOO F\FOH DW D EDVDO OHYHO LW ZDV RI LQWHUHVW WR GLVFRYHU ZKDW VHTXHQFHV DUH QHFHVVDU\ IRU EDVDO DQG HQKDQFHG H[SUHVVLRQ 7KH SURPRWHU RI WKH ) + KLVWRQH JHQH LV SRWHQWLDOO\ H[WHQVLYH DQG VR GHOHWLRQV WKDW HQFRPSDVV WKH HQWLUH NE RI SRVVLEOH SURPRWHU VHTXHQFH ZHUH SUHSDUHG DQG DQDO\]HG ,Q WKH SUR[LPDO UHJLRQ RI WKH SURPRWHU ZH ZHUH LQWHUHVWHG WR XQGHUVWDQG WKH IXQFWLRQDOLW\ RI HOHPHQWV VXFK DV WKH 7$7$$ ER[ **7&& HOHPHQW 6SO ELQGLQJ VLWH DQG SXWDWLYH &$$7 ER[HV 0RUH GLVWDO HOHPHQWV KDYH DOVR EHHQ H[DPLQHG DQG WKHVH LQFOXGHG £ SRVVLEOH HQKDQFHU DQG QHJDWLYH UHJXODWRU\ HOHPHQW ORFDWHG WKRXVDQGV RI EDVH SDLUV XSVWUHDP $V PHQWLRQHG LQ WKH LQWURGXFWLRQ WKH GLIIHUHQFHV HQFRXQWHUHG LQ LQ YLYR DQG LQ YLWUR WUDQVFULSWLRQ V\VWHPV KDYH VRPHWLPHV EHHQ FRQVLGHUDEOH ,Q RUGHU WR DVFHUWDLQ WKH IXQFWLRQDO LQ YLYR SURPRWHU VHTXHQFHV RI WKH ) KXPDQ + KLVWRQH JHQH ZH FRQVWUXFWHG D VHULHV RI PRXVH & FHOO OLQHV HDFK FRQWDLQLQJ D GLIIHUHQW + SURPRWHU

PAGE 73

)LJXUH 6FKHPDWLF GLDJUDP RI VRPH RI WKH KXPDQ + KLVWRQH JHQH GHOHWLRQ FRQVWUXFWV $W WKH WRS RI WKH ILJXUH LV WKH RULJLQDO $++* SKDJH FORQH LVRODWHG E\ 6LHUUD HW DO f 7KH ILYH %DO GHOHWLRQV RI S)$ DUH QRWHG 6LHUUD HW DO f 7KH GLVWDQFH IURP WKH HQG RI WKH KLVWRQH SURPRWHU VHTXHQFH WR WKH FDS VLWH LV LQGLFDWHG WR WKH ULJKW RI HDFK FRQVWUXFW ) ) ) DQG )5 DUH IXVLRQV RI WKH SUR[LPDO SURPRWHU UHJLRQ DQG FRGLQJ VHTXHQFHV WR GLVWDO IUDJPHQWV DQG WKH GRWWHG OLQH LQGLFDWHV WKH H[WHQW RI WKH GHOHWLRQ WKDW RFFXUUHG EHWZHHQ WKH WZR IUDJPHQWV 7KH VFDOH DW WKH ERWWRP LV NE RQ WKH $++* VFKHPDWLF DQG NE RQ DOO RWKHUV 7KH SHUWLQHQW UHVWULFWLRQ HQ]\PH VLWHV DUH GHQRWHG (FR5, ( %DP+O % +LQG,,, + ;EDO ; 1FRO 1 7KH PRVW FRPPRQO\ XVHG 6, QXFOHDVH SUREH LV GHVLJQDWHG DW WKH ERWWRP RI WKH ILJXUH ODEHOOHG DW WKH 1FRO VLWH

PAGE 74

; ++* + + 3; ‘ + + +H_H_ %% 6 OO ( ; O / 3 ; / / + ( +(+ % O / ( NE VFDOH

PAGE 75

GHOHWLRQ FRQVWUXFW $V GHVFULEHG LQ WKH SURORJXH WR WKH 0DWHULDOV DQG 0HWKRGV VHFWLRQ ZH GHFLGHG WKDW WKLV ZDV WKH EHVW ZD\ WR SURFHHG :H KRSHG WKDW VWDEOH LQWHJUDWLRQ LQWR WKH FKURPRVRPH ZRXOG JLYH WKH PRVW DFFXUDWH LQIRUPDWLRQ DERXW WKH IXQFWLRQ RI + SURPRWHU VHTXHQFHV &HOO OLQH FRQVWUXFWLRQ 7KH ILUVW VWHS LQ WKHVH H[SHULPHQWV ZDV WR FRQVWUXFW WKH FHOO OLQHV 7KH PRXVH & FHOO OLQH ZDV FKRVHQ EHFDXVH LW ZDV D KHWHURORJRXV KRVW DQG KDG EHHQ SUHYLRXVO\ XVHG WR VXSSRUW WKH VWDEOH H[SUHVVLRQ RI WKH ) KXPDQ + JHQH LQ DQ HSLVRPDO IRUP *UHHQ HW DO f 0DQ\ RI WKH KLVWRQH + SODVPLG '1$ FRQVWUXFWV ZHUH DYDLODEOH DOUHDG\ )LJXUH f DOWKRXJK DV WKH ZRUN SURJUHVVHG VHYHUDO PRUH ZHUH SUHSDUHG WR DQVZHU YDULRXV TXHVWLRQV WKDW DURVH 7KH FRQVWUXFWV DUH DOO SURGXFWV RI VXEFORQHV RI WKH RULJLQDO $ KXPDQ KLVWRQH JHQH FORQH $++*f LVRODWHG E\ 6LHUUD HW DO f DQG WKLV LV GLDJUDPHG DW WKH WRS RI )LJXUH 7KH SUR[LPDO GHOHWLRQ FRQVWUXFWV DQG / )LJXUH f ZHUH DOO DYDLODEOH DQG KDG EHHQ PDGH E\ %DO GHOHWLRQ RI S)$ 6LHUUD HW DO f 7KH SUHFLVH GHWHUPLQDWLRQ RI HDFK GHOHWLRQ SRLQW ZLOO EH RXWOLQHG ODWHU LQ WKH FKDSWHU $ VXEFORQH RI S) S)$ SUHSDUHG E\ 6LHUUD HW DO f GHOHWHG VRPH n VHTXHQFHV LQFOXGLQJ DQ $OX UHSHDW 3ODVPLG S) ZDV PDGH E\ $ YDQ :LMQHQ IURP D +LQGOOO GLJHVWLRQ RI S) 3ODVPLG S) ZDV SUHSDUHG IURP D %DP+O 3VW, GLJHVW RI $++* WR REWDLQ D IUDJPHQW ZLWK ES RI n IODQNLQJ VHTXHQFH 3ODVPLG S) ZDV SUHSDUHG IURP DQ ;EDO GLJHVW RI $++* DQG KDV NE RI n IODQNLQJ VHTXHQFH $GGLWLRQDO FORQHV ZLOO EH GHVFULEHG DV WKH\ SHUWDLQ

PAGE 76

WR VXEMHFWV XQGHU GLVFXVVLRQ ODWHU LQ WKH FKDSWHUSRVLWLYH DQG QHJDWLYH UHJXODWRU\ HOHPHQWV ,QLWLDWLRQ RI 7UDQVFULSWLRQ DQG %DVDO 5HJXODWLRQ 7KH LQLWLDWLRQ RI WUDQVFULSWLRQ E\ 51$ SRO\PHUDVH ,, DQG WKH VHTXHQFHV UHTXLUHG IRU LW KDYH EHHQ VWXGLHG LQ FRQVLGHUDEOH GHWDLO LQ D QXPEHU RI JHQHV DV RXWOLQHG LQ WKH LQWURGXFWLRQ 5HYLHZHG LQ 6KHQN f 7KH LPSRUWDQFH RI WKH 7$7$ ER[ KDV EHHQ HVWDEOLVKHG LQ YLWUR DQG LQ YLYR DQG LW LV WKRXJKW WR EH SULPDULO\ UHVSRQVLEOH IRU WKH VSHFLILFDWLRQ RI WKH WUDQVFULSWLRQ LQLWLDWLRQ VLWH :H FRQVWUXFWHG FHOO OLQHV ZLWK VHYHUDO RI WKH VKRUW SUR[LPDO GHOHWLRQ FRQVWUXFWV LQ RUGHU WR DVFHUWDLQ ZKDW VHTXHQFHV LQ WKH ) + KLVWRQH JHQH ZHUH QHFHVVDU\ IRU WKH LQLWLDWLRQ RI WUDQVFULSWLRQ 7KH JHQHUDO SURWRFRO IRU '1$ WUDQVIHFWLRQ DQG WKH VXEVHTXHQW VHOHFWLRQ DQG H[SDQVLRQ SURFHVV LV RXWOLQHG LQ )LJXUH 7KH FRQVWUXFWV ZHUH FRWUDQVIHFWHG LQWR & FHOOV ZLWK WKH SODVPLG S69QHR 7KH LQFOXVLRQ RI WKH S69QHR SODVPLG SHUPLWWHG VHOHFWLRQ IRU H[SUHVVLRQ ZLWK WKH DQWLELRWLF *HQHWLFLQ *f 2QFH UHVLVWDQW FHOOV ZHUH SUHVHQW DV GLVWLQFW FRORQLHV WKH SODWHV ZHUH HLWKHU SRROHG DQG SDVVDJHG SRO\FORQHVf RU SLFNHG DQG H[SDQGHG DV PRQRFORQDO FHOO OLQHV 7KH VSHFLILF PHWKRG LV GHVFULEHG LQ WKH 0DWHULDOV DQG 0HWKRGV VHFWLRQ 7R GHWHUPLQH WKH OHYHO RI WUDQVFULSWLRQ IURP HDFK RI WKH SUR[LPDO GHOHWLRQ FRQVWUXFWV ZH DQDO\]HG FHOO OLQHV HDUO\ LQ SDVVDJH 7KH UHVXOWV IURP 6, QXFOHDVH DQDO\VLV RI WRWDO FHOOXODU 51$ IURP SRO\FORQDO FHOO OLQHV $ / DQG LV SUHVHQWHG LQ )LJXUH 51$ ZDV SUHSDUHG IURP HDFK FHOO OLQH DV GHVFULEHG DQG K\EULGL]HG WR WZR SUREHV KXPDQ DQG PRXVH DW r& IRU KRXUV DV GHVFULEHG LQ

PAGE 77

)LJXUH )ORZ GLDJUDP IRU WKH SURGXFWLRQ RI ERWK SRO\FORQDO DQG PRQRFORQDO PRXVH FHOO OLQHV WKDW FRQWDLQ VWDEOH LQWHJUDWHG KXPDQ KLVWRQH + JHQHV 7KH PHWKRG UHOLHV RQ WKH FRWUDQVIHFWLRQ RI WKH KLVWRQH SODVPLG ZLWK D VHOHFWDEOH PDUNHU S69QHR 7KLV SODVPLG FDUULHV WKH JHQH WKDW FRQIHUV UHVLVWDQFH WR D GHULYDWLYH RI QHRP\FLQ 7KH FRWUDQVIHFWLRQ SURFHGXUH SHUPLWWHG WKH S69QHR SODVPLG WR EH WDNHQ XS ZLWK WKH KLVWRQH SODVPLG LQWR WKH PRXVH & FHOOV 7KHVH VWDEOH FHOO OLQHV ZHUH XWLOL]HG WR VWXG\ KXPDQ + JHQH H[SUHVVLRQ 7KH VSHFLILF SURWRFRO LV RXWOLQHG LQ PDWHULDOV DQG PHWKRGV

PAGE 78

&" bf FHOOV KU JO\FHURO VKRFN GD\V VSOLW ? SRO\FORQHV PRQRFORQHV ZNV SRRO SLFN L ZHOO SDVVDJH M ZNV H[SDQG SDVVDJH

PAGE 79

)LJXUH 6, QXFOHDVH DQDO\VLV RI SUR[LPDO GHOHWLRQ SRO\FORQDO FHOO OLQHV 6, QXFOHDVH DQDO\VLV ZDV GRQH DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV DQG TXDQWLWDWHG E\ GHQVLWRPHWU\ /DQHV WKH FHOO OLQH QDPH LV GHQRWHG DERYH WKH ODQH )RU H[DPSOH SRO\FORQDO FHOO OLQH S)$ QXPEHU LV GHQRWHG DV $SO & & WRWDO FHOOXODU 51$ DQG + +H/D WRWDO FHOOXODU 51$ LQFXEDWHG ZLWK ERWK KXPDQ DQG PRXVH 6, SUREHV DV D SRVLWLYH FRQWURO IRU WKH VL]H RI WKH PRXVH DQG KXPDQ 6, SURWHFWHG IUDJPHQWV UHVSHFWLYHO\ 0 S%5 +SDOO PDUNHU ODEHOOHG ZLWK DA3G&73 DQG .OHQRZ IUDJPHQW %RWK KXPDQ QWf DQG PRXVH QWf SURWHFWHG IUDJPHQWV DUH QRWHG DW WKH ULJKW

PAGE 80

0DWHULDOV DQG 0HWKRGV 7KH PRXVH + KLVWRQH SUREH ZDV LQFOXGHG DV DQ LQWHUQDO FRQWURO LQ HDFK 6, QXFOHDVH DVVD\ QRW RQO\ IRU WKH LQWDFWQHVV RI WKH 51$ SUHSDUDWLRQ EXW DOVR DV DQ LQGLFDWRU RI WKH DPRXQW RI KLVWRQH P51$ SUHVHQW LQ WKH VDPSOH 7KH KDOIOLIH RI D KLVWRQH P51$ DIWHU WKH FHVVDWLRQ RI '1$ V\QWKHVLV LV YHU\ VKRUW 3OXPE HW DO D 6LWWPDQ HW DO f DQG WKHUHIRUH WKH JURZWK FRQGLWLRQV RI WKH FHOOV DQG WHPSHUDWXUH DW WKH WLPH RI KDUYHVWHG DUH FULWLFDO IRU WKH DGHTXDWH UHFRYHU\ RI KLVWRQH P51$ :H SDUWLFXODUO\ ZDQWHG WR GHWHUPLQH LI WKHUH ZDV D PLQLPDO DPRXQW RI SURPRWHU WKDW FRXOG LQLWLDWH WUDQVFULSWLRQ LQ YLYR DQG LI WKLV ZDV GLIIHUHQW WKDQ WKDW VHHQ LQ YLWUR 3UHYLRXVO\ WKH VKRUWHVW %DO GHOHWLRQ KDG EHHQ VKRZQ WR LQLWLDWH P51$ V\QWKHVLV DFFXUDWHO\ LQ YLWUR LQ D ZKROH FHOO H[WUDFW 6LHUUD HW DO f $V VKRZQ LQ ILJXUH WKH FRQVWUXFW ZKLFK ZH ODWHU OHDUQHG KDV RQO\ WKH 7$7$ ER[ DQG WKH **7&& HOHPHQW SURGXFHG QR FRUUHFWO\ LQLWLDWHG WUDQVFULSWV 7KH RQO\ WUDQVFULSWLRQ SURGXFWV GHWHFWDEOH IURP WKH FRQVWUXFW ZHUH LQLWLWDWHG XSVWUHDP RI WKH QRUPDO P51$ VWDUW VLWH 7KHVH DUH GHQRWHG ZLWK DUURZV LQ )LJXUH DQG RFFXU LQ WKH FHOO OLQHV ZLWK DQG LQWHJUDWHG 7KH XSVWUHDP WUDQVFULSWLRQ VWDUW VLWHV PDS SULPDULO\ WR WKH 7$7$ ER[ ESf DQG WKH GHOHWLRQ HQG SRLQWV 7KH GHOHWLRQ HQG SRLQW WUDQVFULSWV RULJLQDWH IURP RXWVLGH RI WKH KLVWRQH IODQNLQJ VHTXHQFHV HLWKHU LQ WKH SODVPLG RU VXUURXQGLQJ FKURPRVRPDO '1$ DQG DUH GHWHFWHG E\ YLUWXH RI WKH ODFN RI KRPRORJ\ EHWZHHQ WKH SUREH DQG WKH P51$ SDVW WKH GHOHWLRQ SRLQW 7KH SRVVLELOLW\ WKDW ZDV XQDEOH WR H[SUHVV FRUUHFWO\ LQLWLDWHG + P51$ ZDV EDVHG RQ D VLQJOH SRO\FORQDO FHOO OLQH 7R DVVXUH RXUVHOYHV WKDW WKLV ZDV QRW D UHVXOW RI D VSXULRXV LQWHJUDWLRQ HYHQW ZH

PAGE 81

R J R +0 )LJXUH 6RXWKHUQ EORW DQDO\VLV RI SRO\FORQDO FHOO OLQHV ,QWDFWQHVV RI n IODQNLQJ UHJLRQV DQG FRS\ QXPEHU RI WKH FRQVWUXFWV LQ HDFK FHOO OLQH *HQRPLF '1$ SXULILHG IURP HDFK FHOO OLQH ZDV GLJHVWHG ZLWK (FR5O DQG ;EDO HOHFWURSKRUHVHG EORWWHG SUREHG DQG TXDQWLWDWHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV /DQHV S)$SO S)$S /S /S .SO .S -SO -SO SDVVDJH f -SO SDVVDJH f -SOD +LVWRQH SODVPLG PDUNHUV (FR5,;EDO GLJHVWHG S)f ZHUH LQFOXGHG RQ WKH EORW HTXDO WR SJf SJf DQG SJf JHQH HTXLYDOHQWV SHU GLSORLG JHQRPH LQ RUGHU WR TXDQWLWDWH WKH KXPDQ KLVWRQH + FRS\ QXPEHU + +H/D '1$ GLJHVWHG ZLWK (FR5O DQG ;EDO DV D SRVLWLYH FRQWURO IRU WKH ES IUDJPHQW 0 $ '1$ GLJHVWHG ZLWK (FR5O DQG +LQGOOO DQG .OHQRZ ODEHOOHG 3HUWLQHQW VL]HV DUH GHQRWHG WR WKH ULJKW LQ NLOREDVHV 7KH SUREH IRU WKLV H[SHULPHQW ZDV WKH (FR5,;EDO IUDJPHQW RI S) WKDW KDG EHHQ QLFNWUDQVODWHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV

PAGE 82

GHWHUPLQHG WKH LQWDFWQHVV RI WKH IODQNLQJ DQG FRGLQJ VHTXHQFHV IRU HDFK RI WKH FRQVWUXFWV / DQG $ LQ )LJXUH 7KLV H[SHULPHQW DOVR SHUPLWWHG XV WR GHWHUPLQH WKH FRS\ QXPEHU RI HDFK FHOO OLQH 7HQ PLFURJUDPV RI JHQRPLF '1$ IURP HDFK FHOO OLQH ZDV GLJHVWHG WR FRPSOHWLRQ ZLWK (FR5O DQG ;EDO DQG HOHFWURSKRUHVHG RQ D b DJDURVH JHO EORWWHG DQG SUREHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV ,Q RUGHU WR TXDQWLWDWH WKH FRS\ QXPEHU RI HDFK FHOO OLQH WKH JHO DOVR FRQWDLQHG SODVPLG '1$V RI NQRZQ DPRXQWV GLJHVWHG ZLWK ERWK (FR5O DQG ;EDO 7HQ DQG SJ FRUUHVSRQG WR DQG JHQH HTXLYDOHQWV SHU GLSORLG JHQRPH UHVSHFWLYHO\ DV GHVLJQDWHG LQ )LJXUH 6HYHUDO H[SRVXUHV RI WKH DXWRUDGLRJUDP ZHUH VFDQQHG ZLWK D =HLQHK ODVHU GHQVLWRPHWHU DQG TXDQWLWDWHG LQ FRPSDULVRQ WR WKH FRQWUROV $GGLWLRQDOO\ WKH 6RXWKHUQ EORW LQ )LJXUH ZDV TXDQWLWDWHG IRU WKH DFWXDO DPRXQW RI '1$ E\ GHQVLWRPHWULFDOO\ VFDQQLQJ D SKRWRJUDSKLF QHJDWLYH RI WKH JHO SULRU WR WUDQVIHU DQG GLIIHUHQFHV LQ '1$ DPRXQWV KDYH EHHQ WDNHQ LQWR DFFRXQW LQ WKH FRS\ QXPEHU FDOFXODWLRQ /DWHU FRS\ QXPEHU EORWV IRU RWKHU FRQVWUXFWV ZHUH UHSUREHG ZLWK D FORQH RI WKH PRXVH 6 ULERVRPDO JHQH NLQGO\ SURYLGHG E\ WKH 'U 'DYLG 6FKOHVVLQJHU :DVKLQJWRQ 8QLY 6W /RXLVf WR DOORZ H[DFW GHWHUPLQDWLRQ RI WKH DPRXQW RI '1$ ORDGHG LQ HDFK ODQH DQG VXEVHTXHQWO\ WUDQVIHUUHG $ VDPSOH FRS\ QXPEHU FDOFXODWLRQ LQ ZKLFK WKH ULERVRPDO SUREH ZDV XWLOL]HG LV SUHVHQWHG LQ $SSHQGL[ $ 7KH 6RXWKHUQ EORW DQDO\VLV GHPRQVWUDWHG QRW RQO\ WKH FRS\ QXPEHU RI HDFK FHOO OLQH EXW SHUPLWWHG XV WR FRQFOXGH WKDW WKH IODQNLQJ UHJLRQ RI PRVW FRQVWUXFWV ZDV LQWDFW 7KH PRGH RI LQWHJUDWLRQ IRU WKH KLVWRQH SODVPLGV LV GHVFULEHG IXUWKHU LQ FKDSWHU

PAGE 83

7DEOH 4XDQWLWDWLRQ RI 3RO\FORQDO &HOO /LQH ([SUHVVLRQ &HOO /LQH +XPDQ0RXVH ([S &RGY QXPEHU ([G&RSY QXPEHU $SO $S /S /S .SO .S -SO -SO $ TXDQWLWDWLYH VXPPDU\ RI WKH H[SUHVVLRQ GDWD IURP WKH SRO\FORQDO FHOO OLQHV RI WKH SUR[LPDO GHOHWLRQ FRQVWUXFWV 7KH KXPDQPRXVH H[SUHVVLRQ UDWLR ZDV GHWHUPLQHG E\ GHQVLWRPHWU\ RI WKH 6, QXFOHDVH SURWHFWHG IUDJPHQWV LQ )LJXUH &RS\ QXPEHU IRU HDFK FHOO OLQH ZDV GHWHUPLQHG IURP WKH 6RXWKHUQ EORW LQ )LJXUH 6LQFH WKHVH GDWD ZHUH GHULYHG IURP SRO\FORQDO FHOO OLQHV LW LV QRW SRVVLEOH WR LQWHUSUHW WKH UHVXOWV VWULFWO\ DQG ZH ZRXOG OLNH WR QRWH WKDW FRS\ QXPEHU LQ D SRO\FORQDO FHOO OLQH LV VRPHZKDW DPELJXRXV ([SUHVVLRQ LV GHQRWHG DV ([S

PAGE 84

7KH UHVXOWV RI WKH 6, QXFOHDVH DQDO\VLV DQG FRS\ QXPEHU GHWHUPLQDWLRQ DUH SUHVHQWHG LQ 7DEOH 7KH 6, QXFOHDVH DVVD\ ZDV VLPLODUO\ TXDQWLWDWHG ZLWK WKH GHQVLWRPHWHU DQG WKH UHVXOWV DUH H[SUHVVHG DV D UDWLR RI WKH PRXVH DQG KXPDQ VLJQDOV 7KH UHVXOWV DOWKRXJK RI D IHZ LQGLYLGXDO FHOO OLQHV KDYH EHHQ UHSHDWHG VHYHUDO WLPHV 7KH 6, QXFOHDVH DQDO\VLV UHVXOWV IURP WKH SUR[LPDO GHOHWLRQ SRO\FORQHV VXJJHVWHG WKDW ESf ZDV XQDEOH WR FRUUHFWO\ LQLWLDWH KLVWRQH P51$ WUDQVFULSWLRQ 2QO\ ZKHQ WKH SURPRWHU ZDV H[WHQGHG LQ ESf ZDV FRUUHFW LQLWLDWLRQ REVHUYHG )LJXUH f ,W FDQ EH VHHQ IURP WKH GDWD LQ 7DEOH WKDW WKH H[SUHVVLRQ SHU FRS\ RI WKH FRQVWUXFW ESf LV TXLWH ORZ LQ YLYR H[SUHVVLRQFRS\ f DQG DV QRWHG ODWHU WKLV PD\ EH VRPHZKDW D UHIOHFWLRQ RI WKH FRS\ QXPEHU DQG QRW WKH DPRXQW RI n VHTXHQFH SUHVHQW LQ WKH FRQVWUXFW :KHQ WKH IODQNLQJ VHTXHQFHV DUH H[WHQGHG WR ES LQ WKH FRQVWUXFW WKHUH LV DQ DSSDUHQW IROG LQFUHDVH LQ WKH H[SUHVVLRQFRS\ UDWLR f 7KH H[SUHVVLRQFRS\ UDWLR RI WKH UHPDLQLQJ GHOHWLRQ FRQVWUXFWV VWDELOL]HV DW D YDOXH RI WR ZLWK LQFUHDVHG OHQJWK RI n VHTXHQFH 7KLV IROG LQFUHDVH LV SUREDEO\ H[DJJHUDWHG EHFDXVH RI FRS\ QXPEHU GLIIHUHQFHV EHWZHHQ DQG WKH ORQJHU FRQVWUXFWV 7KLV SKHQRPHQRQ H[SUHVVLRQ YHUVXV FRS\ QXPEHUf ZLOO EH GLVFXVVHG ODWHU LQ WKH FKDSWHU 6WLOO LW LV OLNHO\ WKDW WKH GLIIHUHQFH LQ WKH H[SUHVVLRQFRS\ UDWLR LV IROG 7KHVH GDWD DUH VXSSRUWHG E\ WKH UHVXOWV RI .HQ :ULJKW LQ RXU ODERUDWRU\ ZKR KDV XWLOL]HG LQ YLWUR WUDQVFULSWLRQ WR GHILQH WKH IXQFWLRQDOLW\ RI SUR[LPDO SURPRWHU HOHPHQWV DQG GHPRQVWUDWHG WKDW LQ QXFOHDU H[WUDFWV WKH WUDQVFULSWLRQ RI -

PAGE 85

r$ r/ $*&&&**77***$7&7*$$77&7&&&****$&&*77*&*7$**&*77$$$$$$$$$$$$* 7&***&&$$&&&7$*$&77$$*$***&&&&7**&$$&*&$7&&*&$$777777777777& r. $*7*$*$***$&&7*$*&$*$*7**$**$**$***$*$**$$$$&$*$$$$*$$$7*$&* 7&$&7&7&&&7**$&7&*7&7&$&&7&&7&&7&&&7&7&&7777*7&7777&777$&7*& rr$$$7*7&*$*$***&****$&$$77*$*$$&*&77&&&*&&**&*&*&777&**7777&$ 777$&$*&7&7&&&*&&&&7*77$$&7&77*&*$$***&**&&*&*&*$$$*&&$$$$*7 r$7&7**7&&*$7$&7&77*7$7$7&$****$$*$&**7*&7&*&&77*$&$*$$*&7*7& n f 7$*$&&$**&7$7*$*$$&$7$7$*7&&&&77&7*&&$&*$*&**$$&7*7&77&*$&$* 7$7&***&7&&$*&**7&$7*7&&**&$*$**$$$***&**$$$$**&77$**&$$$*** $7$*&&&*$**7&*&&$*7$&$**&&*7&7&&777&&&*&&7777&&*$$7&&*777&&& )LJXUH 6FKHPDWLF GLDJUDP RI WKH SUR[LPDO KXPDQ KLVWRQH + %DO GHOHWLRQ PXWDQWV 6HTXHQFH DQDO\VLV RI WKH GHOHWLRQ SRLQWV (DFK FRQVWUXFW ZDV VHTXHQFHG DFFRUGLQJ WR WKH SURWRFRO RI 0D[DP DQG *LOEHUW f DQG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH GHOHWLRQ SRLQW RI HDFK FRQVWUXFW LV GHQRWHG ZLWK DQ DVWHULVN RYHU WKH ODVW QXFOHRWLGH LQFOXGHG LQ WKH VHTXHQFH RI WKDW FRQVWUXFW )RU UHIHUHQFH WKH $7* FRGRQ 7$7$ ER[ **7&& HOHPHQW &$$7 ER[HV DQG 6SO VLWH KDYH EHHQ XQGHUOLQHG 7KH WZR EROGHG UHJLRQV RI WKH SURPRWHU FRUUHVSRQG WR 6LWH DQG 6LWH ,, WKH '1$VHO SURWHFWHG UHJLRQV RI SURWHLQ'1$ LQWHUDFWLRQ DV GHILQHG E\ 3DXOL HW DO f

PAGE 86

ESf LV VHYHUDO IROG KLJKHU WKDQ ESf .HQ :ULJKW SHUVRQDO FRPPXQLFDWLRQf 3UHYLRXVO\ WKH GHOHWLRQ SRLQWV RI WKH %DO GHOHWLRQV KDG EHHQ GHWHUPLQHG E\ UHVWULFWLRQ HQ]\PH DQDO\VLV DQG HOHFWURSKRUHVLV RQ KLJK SHUFHQWDJH DJDURVH JHOV 6LHUUD HW DO f 7R GHWHUPLQH H[DFWO\ WKH GHOHWLRQ SRLQW HDFK FRQVWUXFW ZDV VHTXHQFHG E\ WKH PHWKRG RI 0D[DP DQG *LOEHUW f .HQ :ULJKW DQG FROODERUDWHG LQ WKLV HIIRUW DQG WKH DSSURDFK ZH XQGHUWRRN LV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV ,PSRUWDQWO\ WKH VWUDWHJ\ SHUPLWWHG XV WR VHTXHQFH DFURVV WKH GHOHWLRQ SRLQW LQ HDFK FRQVWUXFW DQG WR GHWHUPLQH WKH H[DFW HQG RI %DO GLJHVWLRQ 7KH GHOHWLRQ SRLQWV ZH GHWHUPLQHG DUH GHQRWHG LQ )LJXUH :KHQ ZH H[DPLQHG WKH VHTXHQFH RI WKH ESf GHOHWLRQ LW ZDV REYLRXV WKDW WKH **7&& HOHPHQW DQG 7$7$ ER[ ZHUH VWLOO SUHVHQW DQG WKH SUR[LPDO &$$7 ER[ ESf ZDV DEVHQW 2XU 6, QXFOHDVH DQDO\VLV VXJJHVWHG WKDW WKLV ZDV QRW VXIILFLHQW SURPRWHU VHTXHQFH IRU FRUUHFW LQ YLYR WUDQVFULSWLRQ LQLWLDWLRQ 7R HQVXUH WKDW WKLV ZDV LQGHHG WKH FDVH ZH SUHSDUHG DGGLWLRQDO SRO\FORQDO FHOO OLQHV RI DQG GHPRQVWUDWHG WKDW WKH\ DOO FRQWDLQHG LQWHJUDWHG FRQVWUXFWV )LJXUH EFf KRZHYHU QRQH H[SUHVVHG D FRUUHFWO\ LQLWLDWHG KLVWRQH + P51$ )LJXUH Df 7KH DEVHQFH RI D GHWHFWDEOH 6, SURWHFWHG IUDJPHQW LQ WKH SRO\FORQDO FHOO OLQHV ZDV UHSHDWHG VHYHUDO WLPHV 8SVWUHDP LQLWLDWLRQ RI WUDQVFULSWLRQ ZDV VRPHWLPHV GHWHFWDEOH DOWKRXJK WKLV ZDV QRW FRQVLVWHQW 7KH LPSRUWDQFH WKHVH UHVXOWV EHFDPH DSSDUHQW ZKHQ 'UV 8UV 3DXOL DQG 6XVDQ &KU\VRJHORV RI RXU ODERUDWRU\ GHPRQVWUDWHG WKH ELQGLQJ RI SURWHLQV WR WKH SUR[LPDO SURPRWHU UHJLRQ RI WKLV + JHQH LQ

PAGE 87

)LJXUH 6, QXFOHDVH DQG 6RXWKHUQ %ORW DQDO\VLV RI SRO\FORQDO FHOO OLQHV IRU FRUUHFW KXPDQ + H[SUHVVLRQ DQG FRS\ QXPEHU $GGLWLRQDO SRO\FORQDO FHOO OLQHV ZHUH PDGH WR FRQILUP WKDW WKLV FRQVWUXFW ZDV XQDEOH WR LQLWLDWH KXPDQ + P51$ WUDQVFULSWLRQ FRUUHFWO\ $ 6, QXFOHDVH DQDO\VLV RI J WRWDO FHOOXODU 51$ IURP QHZ SRO\FORQDO OLQHV DQG WKH RQH WHVWHG SUHYLRXVO\ -SOD $OVR VKRZQ DUH SRO\FORQDO OLQHV $S DQG ;S + +H/D WRWDO FHOOXODU 51$ & & WRWDO FHOOXODU 51$ 0 S%5 +SDOO PDUNHUV 7KH KXPDQ + 6, SURWHFWHG IUDJPHQW QWf LV QRWHG ZLWK DQ DUURZ DW WKH OHIW 7KHUH ZDV QR GHWHFWDEOH KXPDQ + VLJQDO LQ DQ\ RI WKH ODQHV HYHQ XSRQ UHSHWLWLRQ DQG ORQJ H[SRVXUH % 6RXWKHUQ EORW DQDO\VLV RI SRO\FORQDO FHOO OLQH IRU FRS\ QXPEHU GHWHUPLQDWLRQ SRO\FORQHV DQG S)$PO DUH VKRZQ 7KH SRVLWLRQ RI ES LV QRWHG DQG WKH DUURZ LQGLFDWHV WKH VL]H RI WKH GHOHWLRQ (FR5,;EDO IUDJPHQW IURP 3ODVPLG '1$V LQ WKH DPRXQW RI DQG SJ ZHUH LQFOXGHG IRU FRS\ QXPEHU TXDQWLWDWLRQ DV GHVFULEHG LQ )LJ + +H/D FHOO '1$ GLJHVWHG ZLWK (FR5, DQG ;EDO & & FHOO '1$ GLJHVWHG ZLWK (FR5, DQG ;EDO & 7KH EORW LQ % ZDV UHSUREHG ZLWK WKH 6 PRXVH ULERVRPDO IUDJPHQW IRU TXDQWLWDWLRQ RI WKH DPRXQW RI '1$ LQ HDFK ODQH 7KH VL]H RI WKH 6 EDQG NE LV QRWHG DW WKH ULJKW 4XDQWLWDWLRQ ZDV GRQH DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV DQG $SSHQGL[ $

PAGE 88

r UR I r WL WLOWK m LI f r A ‘r f§PW LI L r L +OI f } 1m r L m PLI 8W r ? ? : 0 9 D $P 2

PAGE 89

YLYR 3DXOL HW DO f 7KH VSHFLILF DUHDV RI SURWHLQ'1$ LQWHUDFWLRQ DV GHILQHG E\ '1DVH SURWHFWLRQ DUH RXWOLQHG LQ )LJXUH ZLWK WKH FRQVWUXFW GHOHWLRQ HQG SRLQWV ,QWHUHVWLQJO\ WKH GHOHWLRQ SRLQW LV ORFDWHG LQ WKH PLGGOH RI 6LWH ,, DQG OHDYHV WKH SUR[LPDO SRUWLRQ ZLWK WKH **7&& HOHPHQW DQG 7$7$ ER[ LQWDFW ,W ZRXOG DSSHDU WKDW WKH DEVHQFH RI 6LWH DQG WKH SUHVHQFH RI RQO\ KDOI RI 6LWH ,, DUH LQVXIILFLHQW IRU WUDQVFULSWLRQ LQLWLDWLRQ LQ YLYR +RZHYHU ZKHQ DOO RI 6LWH ,, LV SUHVHQW LQ WKH RI FRQVWUXFW D ORZ EXW GHWHFWDEOH OHYHO RI WUDQVFULSWLRQ LV SUHVHQW )LJXUH DQG 7DEOH f 7KH ODUJH LQFUHDVH LQ WKH H[SUHVVLRQFRS\ UDWLR RI WKH ESf FRQVWUXFW LV DSSDUHQWO\ WKH UHVXOW RI UHPDUNDEOH VLPLODULW\ WR WKH 6SO '\QDQ DQG 7MLDQ Ef ELQGLQJ VLWH DV GHVFULEHG E\ %ULJJV HW DO f DQG (YDQV HW DO f $OWKRXJK ZH KDYH QRW SURYHQ WKDW WKH SURWHLQ'1$ LQWHUDFWLRQ DW WKLV VLWH LV WKH UHVXOW RI 6SO LW VHHPV D VWURQJ SRVVLELOLW\ WKDW LW FRXOG EH 6SO RU D VLPLODU SURWHLQ DOVR LQFOXGHV D SXWDWLYH &$$7 ER[ KRZHYHU WKH IXQFWLRQDOLW\ RI WKLV VHTXHQFH LV LQ TXHVWLRQ EHFDXVH LW ODFNV WKH QHFHVVDU\ KRPRORJ\ WR WKH FRQVHQVXV VHTXHQFH $GGLWLRQDOO\ WKLV &$$7 ER[ LV QRW HQWLUHO\ LQFOXGHG LQ WKH SURWHLQ ELQGLQJ GRPDLQ RI 6LWH DV GHVFULEHG E\ 3DXOL HW DO f DQG LW LV WKHUHIRUH XQOLNHO\ WKDW LW IXQFWLRQV LQ WKH VDPH FDSDFLW\ ,W VKRXOG EH PHQWLRQHG WKDW 6SO KDV EHHQ VKRZQ WR LQWHUDFW ZLWK &7) LQ WKH +69WN SURPRWHU -RQHV HW DO f DQG SRVVLEOH LQWHUDFWLRQ LQ WKH KLVWRQH SURPRWHU VKRXOG QRW EH UXOHG RXW LPPHGLDWHO\ KRZHYHU LW LV XQOLNHO\ 7KH &$$7 VHTXHQFH LV ZHOO FRQVHUYHG HYROXWLRQDULO\ LQ FRQMXQFWLRQ ZLWK WKH **7&& HOHPHQW :HOOV

PAGE 90

f DQG RXU UHVXOWV VXJJHVW WKDW WKH UHPRYDO RI WKLV HOHPHQW LQ WKH GLVWDO KDOI RI 6LWH ,, SUHYHQWV FRUUHFW WUDQVFULSWLRQ LQLWLDWLRQ :H LQYHVWLJDWHG WKH ZKHWKHU DQ\ GLDWO SURPRWHU HOHPHQWV KDG DQ HIIHFW RQ WKH WUDQVFULSWLRQ RI WKH ) KXPDQ + KLVWRQH JHQH 3RO\FORQDO FHOO OLQHV ZHUH SUHSDUHG IURP FRQVWUXFWV S) ESf S) WR NEf S) ESf DQG S) NEf 7KH UHVXOWV RI WKH 6, QXFOHDVH DQDO\VLV DQG OLPLWHG FRS\ QXPEHU DQDO\VLV RQ WKHVH FHOO OLQHV VXJJHVWHG WKDW XSVWUHDP VHTXHQFHV EH\RQG WKRVH DOUHDG\ H[DPLQHG PLJKW FRQWULEXWH WR DQ LQFUHDVHG OHYHO RI H[SUHVVLRQ GDWD QRW VKRZQf 8SRQ UHIOHFWLRQ LW LV OLNHO\ WKDW LQ PRVW FDVHV WKH LQFUHDVHG OHYHO RI H[SUHVVLRQ ZH QRWHG ZDV WKH UHVXOW RI KLJK FRS\ QXPEHU DQG QRW QHFHVVDULO\ EHFDXVH RI D VWURQJ SURPRWHU VHTXHQFH VXFK DV DQ HQKDQFHU 7KHVH UHVXOWV DOWKRXJK OLPLWHG DW WKH WLPH SURPSWHG XV WR H[DPLQH LQ D PRUH ULJRURXV ZD\ WKH GLVWDO n SURPRWHU VHTXHQFHV RI WKH ) + KLVWRQH JHQH IRU SRVVLEOH UHJXODWRU\ DUHDV WKDW FRQWURO H[SUHVVLRQ 7UDQVIHFWLRQ RI WKH FRQVWUXFWV S) ESf S) ESf DQG S) NEf LQWR PRXVH & FHOOV ZDV GRQH WR DVVHVV DQ\ GLVWDO FRQWULEXWLRQV WR WKH H[SUHVVLRQ OHYHO RI WKLV + JHQH $V VWDWHG SUHYLRXVO\ HQKDQFHU DQG VLOHQFHUQHJDWLYH UHJXODWRU\ HOHPHQWV FDQ EH ORFDWHG DW FRQVLGHUDEOH GLVWDQFHV IURP WKH SURPRWHU RI D JHQH DQG VWLOO DFFHQWXDWH RU GHSUHVV H[SUHVVLRQ RI WKH OLQNHG JHQH 0DQLDWLV HW DO 7KHLVHQ HW DO %DQLDKPDG HW DO f 7KH QHZ FHOO OLQHV ZHUH JURZQ SULPDULO\ DV PRQRFORQHV DQG IRU FRQWLQXLW\ ZLWK WKH SUHYLRXV VWXGLHV PRQRFORQDO FHOO OLQHV RI S)$ DQG ZHUH DOVR SUHSDUHG

PAGE 91

, ZLOO VWDWH QRZ WKDW ZH KDYH IRXQG WKDW WKHUH LV D FRPSHWLWLRQ EHWZHHQ WKH WUDQVIHFWHG KXPDQ + KLVWRQH JHQHV DQG WKH HQGRJHQRXV PRXVH + JHQH IRU UHJXODWRU\ IDFWRUV DQG WKLV LV GLVFXVVHG ODWHU DQG LQ FKDSWHU 7KH LQWHUSUHWDWLRQ RI H[SUHVVLRQ IURP HDFK FRQVWUXFW LV DIIHFWHG E\ WKLV FRPSHWLWLRQ SKHQRPHQRQ DQG EHFRPHV UDWKHU FRQIXVLQJ :H EULQJ WKLV XS KHUH RQO\ WR PDNH WKH UHDGHU DZDUH WKDW WKLV VLWXDWLRQ H[LVWV DQG WKH UHVXOWV KDYH EHHQ LQWHUSUHWHG VHYHUDO ZD\V VRPHWLPHV ZLWK WKLV WDNHQ LQWR DFFRXQW ,W KDV EHHQ H[WUHPHO\ GLIILFXOW WR XQGHUVWDQG WKH UHODWLRQVKLS WKDW H[LVWV EHWZHHQ WKH HQGRJHQRXV PRXVH + JHQHV DQG WKH WUDQVIHFWHG KXPDQ + JHQHV :H KDYH DQDO\]HG WKH H[SUHVVLRQFRS\ GDWD FDUHIXOO\ WR GHFLSKHU DQ\ WUHQGV 7KH UHVXOWV RI WKLV DQDO\VLV DUH DOVR UHYLHZHG LQ FKDSWHU 7KH FKRLFH RI WKH PRXVH + DV DQ LQWHUQDO FRQWURO IRU WKH 6, QXFOHDVH DQDO\VLV ZDV ERWK IRUWXQDWH DQG GHWULPHQWDO WR RXU LQWHUSUHWDWLRQ ,Q VKRUW WKH HQWLUH H[SUHVVLRQ DQDO\VLV LV SUHVHQWHG KHUH EXW EHFDXVH RI WKH UHDOL]DWLRQ ODWHU LQ WKH FRXUVH RI WKLV ZRUN DERXW FRS\ QXPEHU DQG FRPSHWLWLRQ IRU WUDQVFULSWLRQ IDFWRUV RQO\ VRPH RI WKH GDWD ZLOO EH LQFRUSRUDWHG LQWR WKH ILQDO V\QRSVLV 7KH PRQRFORQDO FHOO OLQHV ZHUH DQDO\]HG IRU WKH OHYHO RI H[SUHVVLRQ DQG FRS\ QXPEHU SUHVHQW 7KH 6, QXFOHDVH DQDO\VLV RI WKH S) PRQRFORQDO FHOO OLQHV LV SUHVHQWHG LQ )LJXUH DQG ZDV GRQH DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV $OPRVW DOO RI WKH PRQRFORQHV ZHUH SRVLWLYH IRU H[SUHVVLRQ RI WKH KXPDQ + KLVWRQH JHQH ZLWK WKH H[FHSWLRQ RI S)PO :H XWLOL]HG VHYHUDO H[SRVXUHV WR GHWHUPLQH GHQVLWRPHWULFDOO\ WKH OHYHO RI H[SUHVVLRQ IURP HDFK FHOO OLQH 7KH H[SUHVVLRQ GDWD DUH SUHVHQWHG DV D UDWLR RI WKH KXPDQ DQG PRXVH

PAGE 92

)LJXUH 6, QXFOHDVH DQDO\VLV RI S) PRQRFORQDO FHOO OLQHV 6, QXFOHDVH DVVD\V ZHUH SHUIRUPHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV $OPRVW DOO FORQHV VKRZQ KHUH DUH SRVLWLYH IRU H[SUHVVLRQ RI WKH KXPDQ + JHQH 7KH H[FHSWLRQ LV S)PO + +H/D WRWDO FHOOXODU 51$ & & WRWDO FHOOXODU 51$ 0 S%5 GLJHVWHG ZLWK +SDOO DQG ODEHOOHG ZLWK DA3G&73 DQG .OHQRZ IUDJPHQW 'LOXWLRQV RI WKH PDUNHU DUH QRWHG DV DQG IRU GHQVLWRPHWU\ SXUSRVHV 7KH KXPDQ QWf DQG PRXVH QWf SURWHFWHG IUDJPHQWV DUH GHQRWHG ZLWK ODEHOV DQG DUURZV DW WKH OHIW 7KH FORQH QXPEHUV DSSHDU DERYH WKH LQGLYLGXDO ODQHV WR ZKLFK WKH\ FRUUHVSRQG

PAGE 93

)LJXUH 6RXWKHUQ EORW DQDO\VLV RI S) PRQRFORQDO FHOO OLQHV 6RXWKHUQ EORW DQDO\VLV ZDV SHUIRUPHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV ILJ RI '1$ IURP HDFK FHOO OLQH ZHUH DQDO\]HG ZLWK QLFN WUDQVODWHG (FR5,;EDO IUDJPHQW IURP S) $ S) FHOO OLQH '1$ SUREHG ZLWK + VHTXHQFHV % 7KH KLVWRQH SUREH ZDV UHPRYHG DQG WKH EORW ZDV UHSUREHG ZLWK WKH PRXVH 6 ULERVRPDO IUDJPHQW 'HQVLWRPHWU\ RI WKH ES EDQG VSHFLILHG E\ WKH DUURZ LQ $ DQG WKH 6 ULERVRPDO EDQG LQ % SHUPLWWHG TXDQWLWDWLRQ RI WKH FRS\ QXPEHU WKURXJK QRUPDOL]DWLRQ WR WKH DPRXQW RI '1$ DFWXDOO\ ORDGHG DQG WUDQVIHUUHG DV GHVFULEHG LQ WKH 0DWHULDOV DQG 0HWKRGV 7KH ILJXUH LQ $ LV D FRPSRVLWH RI VHYHUDO H[SRVXUHV WKDW UHIOHFWV WKH DFWXDO FRS\ QXPEHU DQG DFFRXQWV IRU RULJLQDO TXDQWLWDWLRQ HUURUV 7KH SODVPLG FRQWUROV IRU TXDQWLWDWLRQ DUH ODEHOOHG DQG GHVLJQDWLQJ WKH QXPEHU RI SJ ORDGHG & & FHOOXODU '1$ + +H/D FHOOXODU '1$ 0 ; '1$ GLJHVWHG ZLWK (FR5, DQG +LQG ,,, DQG ODEHOOHG ZLWK DA3G&73 DQG .OHQRZ IUDJPHQW 7KH QXPEHU RI HDFK FORQH LV GHVLJQDWHG DERYH WKH ODQH

PAGE 94

$ QQ" %

PAGE 95

)LJXUH 6L QXFOHDVH DQDO\VLV RI S)$ DQG S) PRQRFORQDO FHOO OLQHV 6, QXFOHDVH DVVD\V ZHUH SHUIRUPHG DV GHVFULEHG LQ DQG 0DWHULDOV DQG 0HWKRGV 7KH OHIW SDQHO LV UHSUHVHQWDWLYH RI UHVXOWV REWDLQHG IURP )$ FHOO OLQHV WKH ULJKW SDQHO ZLWK WRWDO FHOOXODU 51$ IURP S) FHOO OLQHV 7KH KXPDQ DQG PRXVH SURWHFWHG IUDJPHQWV DUH GHVLJQDWHG ZLWK ODEHOV DQG DUURZV 7KH PDUNHUV 0 DUH S%5 GLJHVWHG ZLWK +SDOO DQG LPSRUWDQW VL]HV DUH QRWHG 7KH QXPEHU DERYH HDFK ODQH FRUUHVSRQGV WR WKH FORQH QXPEHU RI WKDW FRQVWUXFW 7KH PDUNHUV ZHUH GLOXWHG 0O DQG 0O IRU GHQVLWRPHWU\ TXDQWLWDWLRQ SXUSRVHV + +H/D WRWDO FHOOXODU 51$ & & WRWDO FHOOXODU 51$

PAGE 96

)LJXUH &RS\ QXPEHU DQDO\VLV RI S) DQG S)2O$ PRQRFORQDO FHOO OLQHV 6RXWKHUQ EORW DQDO\VLV ZDV SHUIRUPHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV J RI '1$ IURP HDFK FHOO OLQH ZHUH DQDO\]HG ZLWK QLFN WUDQVODWHG (FR5,;EDO IUDJPHQW IURP S) $ S)$ DQG S) FHOO OLQH '1$ SUREHG ZLWK + VHTXHQFHV % 7KH KLVWRQH SUREH ZDV UHPRYHG DQG WKH EORW ZDV UHSUREHG ZLWK WKH PRXVH 6 ULERVRPDO IUDJPHQW 'HQVLWRPHWU\ RI WKH ES EDQG VSHFLILHG E\ WKH DUURZ LQ $ DQG WKH 6 ULERVRPDO EDQG LQ % SHUPLWWHG TXDQWLWDWLRQ RI WKH FRS\ QXPEHU WKURXJK QRUPDOL]DWLRQ WR WKH DPRXQW RI '1$ DFWXDOO\ ORDGHG DQG WUDQVIHUUHG DV GHVFULEHG LQ WKH 0DWHULDOV DQG 0HWKRGV 7KH ILJXUH LQ $ LV D FRPSRVLWH RI VHYHUDO H[SRVXUHV WKDW UHIOHFWV WKH DFWXDO FRS\ QXPEHU DQG DFFRXQWV IRU RULJLQDO TXDQWLWDWLRQ HUURUV 7KH SODVPLG FRQWUROV IRU TXDQWLWDWLRQ DUH ODEHOOHG DQG GHVLJQDWLQJ WKH QXPEHU RI SJ ORDGHG & & FHOOXODU '1$ + +H/D FHOOXODU '1$ 0 $ '1$ GLJHVWHG ZLWK (FR5, DQG +LQG ,,, DQG ODEHOOHG ZLWK DA3G&73 DQG .OHQRZ IUDJPHQW (DFK VHW RI FORQHV LV GHVLJQDWHG ZLWK WKH EODFN EDU DQG WKH QXPEHU RI WKH LQGLYLGXDO FORQHV LV DERYH WKH ODQH

PAGE 97

$ $ 0 &+ 6P % A AAAAAAA &+

PAGE 98

GHQVLWRPHWU\ VLJQDOV LQ 7DEOH S f 7KH DYHUDJH H[SUHVVLRQ RI QLQH S) PRQRFORQDO FHOO OLQHV IRU ZKLFK FRS\ QXPEHU ZDV ODWHU GHWHUPLQHG ZDV s ,W ZDV REYLRXV WKDW WKHVH UHVXOWV YDULHG VR WKH FRS\ QXPEHU RI HDFK FHOO OLQH ZDV GHWHUPLQHG IURP WKH VRXWKHUQ EORWV LQ )LJXIH DE 7KH 6RXWKHUQ EORWV RI S) PRQRFORQDO FHOO OLQH JHQRPLF '1$ GLJHVWHG ZLWK (FR5, DQG ;EDO ZHUH SUHSDUHG DV GHWDLOHG HDUOLHU DQG LQ 0DWHULDOV DQG 0HWKRGV 7KH K\EULGL]DWLRQ SUREH ZDV WKH ES (FR5,;EDO IUDJPHQW LVRODWHG IURP S) DQG QLFNWUDQVODWHG 7KH DFWXDO FRS\ QXPEHU RI HDFK FHOO OLQH ZDV GHWHUPLQHG E\ GHQVLWRPHWULF DQDO\VLV RI WKH ES (FR5,;EDO EDQG ZLWK QRUPDOL]DWLRQ IRU WKH DPRXQW RI '1$ DFWXDOO\ ORDGHG 7KH DPRXQW RI '1$ LQ HDFK ODQH ZDV GHWHUPLQHG E\ UHPRYDO RI WKH KLVWRQH SUREH DW r& LQ ;66& DQG VXEVHTXHQW K\EULGL]DWLRQ ZLWK WKH ROLJRODEHOOHG %DP+,6DOO IUDJPHQW RI WKH PRXVH 6 ULERVRPDO JHQH 'HQVLWRPHWU\ RI WKH 6 ULERVRPDO EDQG )LJXUH Ef SHUPLWWHG QRUPDOL]DWLRQ RI WKH KLVWRQH + FRS\ QXPEHUV DQG FRPSDULVRQ WR WKH SODVPLG FRQWUROV IRU FRS\ QXPEHU VHH $SSHQGL[ $ IRU VDPSOH FDOFXODWLRQ RI FRS\ QXPEHUf 7KH FRS\ QXPEHU GDWD KHOSV WR H[SODLQ VRPH RI WKH YDULDWLRQ VHHQ ZLWK WKH RULJLQDO H[SUHVVLRQ GHWHUPLQDWLRQ IRU HDFK FHOO OLQH :KHQ S) FRS\ QXPEHU LV WDNHQ LQWR DFFRXQW IRU WKH H[SUHVVLRQ GDWD LQ 7DEOH WKH H[SUHVVLRQFRS\ UDWLR IRU DOO RI WKH FHOO OLQHV LV ORZHUHG DQG WKH DYHUDJH H[SUHVVLRQFRS\ LV s ,W LV DSSDUHQW IURP WKH GDWD LQ 7DEOH WKDW DV FRS\ QXPEHU LQFUHDVHV WKH H[SUHVVLRQFRS\ LQFUHDVHV XQWLO DSSUR[LPDWHO\ FRSLHV DUH SUHVHQW DIWHU ZKLFK LW GHFOLQHV 7KH S)0 FHOO OLQH LV SHUKDSV ORZHU WKDQ

PAGE 99

H[SHFWHG ZLWK UHVSHFW WR H[SUHVVLRQ EHFDXVH RI DQ XQXVXDO RU GHOHWHULRXV LQWHJUDWLRQ VLWH 7KH WKUHVKROG RI H[SUHVVLRQ DW FRSLHV LQGLFDWHG WKDW D OLPLWHG QXPEHU RI KXPDQ KLVWRQH JHQHV FRXOG EH LQWHJUDWHG DQG H[SUHVVHG LQ DQ\ RQH FHOO 7KLV SKHQRPHQRQ KDV EHHQ LQYHVWLJDWHG IXUWKHU DQG LV GLVFXVVHG ODWHU LQ OLJKW RI JHQRPLF VHTXHQFLQJ GDWD SUHVHQWHG LQ &KDSWHU 2YHUDOO WKH S) PRQRFORQDO FHOO OLQHV KDG KLJKHU H[SUHVVLRQ OHYHOV WKDQ RWKHU FHOO OLQHV FRPSDUH rY H[SUHVVLRQ YDOXHV ZLWK RWKHUV LQ 7DEOH f EXW WKH H[SUHVVLRQFRS\ ZDV VLPLODU 6LQFH FRS\ QXPEHU ZDV LPSOLFDWHG LQ WKH OHYHO RI H[SUHVVLRQ ZH DOVR FDOFXODWHG WKH DYHUDJH FRS\ QXPEHU RI HDFK JURXS RI PRQRFORQDO FHOO OLQHV DQG WKLV LV SUHVHQWHG LQ 7DEOH 7KH OHYHO RI H[SUHVVLRQ DV ZH KDYH GHWHUPLQHG LW KHUH 7DEOH f LV D GLUHFW UHIOHFWLRQ RI WKH FRS\ QXPEHU 7KH UHVXOWV RI WKH 6, DQDO\VLV RI WKH S)$ DQG S) PRQRFORQDO FHOO OLQHV DUH SUHVHQWHG LQ )LJXUH %RWK FHOO OLQHV H[SUHVVHG DW D UHODWLYHO\ ORZ OHYHO DQG WKH QXPHULFDO GDWD DUH SUHVHQWHG LQ 7DEOH 7KH DYHUDJH OHYHO RI H[SUHVVLRQFRS\ IRU S)$ LV s DQG IRU S) LV s 7KH GDWD FROOHFWHG IRU WKH S)$ PRQRFORQHV ZHUH SUHYLRXVO\ GLYLGHG LQWR WZR JURXSV 2ULJLQDOO\ WKHUH ZDV D FRQVWUXFW GHVLJQDWHG WKDW DIWHU VHTXHQFLQJ RI WKH GHOHWLRQ SRLQWV ZDV IRXQG WR EH LGHQWLFDO WR S)$ 7KHUHIRUH WKHVH GDWD ZHUH LQFRUSRUDWHG LQWR WKH $ GDWD EDVH ,W LV LQWHUHVWLQJ WR QRWH WKDW S)$ DQG ZHUH WKRXJKW WR KDYH GLIIHUHQW OHQJWKV RI n VHTXHQFH DQG \HW WKHLU H[SUHVVLRQ ZDV VKRZQ WR EH DOPRVW LGHQWLFDO 7KLV VHSDUDWLRQ RI WKH RULJLQDO REVHUYDWLRQV OHQGV D PHDVXUH RI FRQILGHQFH WR WKH DQDO\VLV SURFHVV WKDW KDV EHHQ XVHG LQ WKHVH VWXGLHV

PAGE 100

W +&00 )LJXUH 6, QXFOHDVH DQDO\VLV RI S) PRQRFORQDO FHOO OLQHV 7ZHQW\ ILYH PLFURJUDPV RI WRWDO FHOOXODU 51$ IURP HDFK RI WKH FHOO OLQHV ZHUH WUHDWHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV DQG WKH DXWRUDGLRJUDSK RI WKH 6, QXFOHDVH DQDO\VLV ZDV TXDQWLWDWHG E\ GHQVLWRPHWU\ /DQHV DUH GHVLJQDWHG ZLWK WKH FORQH QXPEHU RI WKH FHOO OLQH +H/D FHOO WRWDO 51$ K\EULGL]HG WR ERWK KXPDQ DQG PRXVH SUREHV + & 51$ K\EULGL]HG WR ERWK KXPDQ DQG PRXVH SUREHV & S%5 +SDOO PDUNHUV ODEHOOHG ZLWK DAA3G&73 DQG .OHQRZ IUDJPHQW 0 2QH IRXUWK WKH DPRXQW RI PDUNHU ZDV HOHFWURSKRUHVHG IRU TXDQWLWDWLRQ SXUSRVHV 0O 7KH FRQVWUXFW QDPH S) LV GLVSOD\HG DERYH WKH EODFN OLQH %RWK KXPDQ DQG PRXVH QW DQG QW UHVSHFWLYHO\f SURWHFWHG IUDJPHQWV DUH QRWHG DW WKH ULJKW

PAGE 101

)LJXUH &RS\ QXPEHU DQDO\VLV RI S) PRQRFORQDO FHOO OLQHV 6RXWKHUQ EORW DQDO\VLV ZDV GRQH DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV $OO DEEUHYLDWLRQV DUH DV GHVLJQDWHG LQ )LJXUH 7KH TXDQWLWDWLRQ RI WKH KLVWRQH + EORW $f DQG WKH PRXVH 6 ULERVRPDO SUREHG EORW %f DUH DV EHIRUH LQ )LJ DQG 0DWHULDOV DQG 0HWKRGV

PAGE 102

6 $ ! PP % 0 & + 0

PAGE 103

7KH H[SUHVVLRQ GDWD IRU S) PRQRFORQHV DQG ZHUH GHWHUPLQHG 7DEOH f KRZHYHU ZKHQ WKH FRS\ QXPEHU ZDV GHWHUPLQHG WKHUH ZDV QR FRUUHFW EDQG DW ES RU DQ\ DGGLWLRQDO EDQGV WKDW FRUUHVSRQGHG WR WKH (FR5O;EDO IUDJPHQW GDWD QRW VKRZQf 7KH FRS\ QXPEHU RI WKH S) DQG S)$ FHOO OLQHV )LJXUHV DEf ZDV GHWHUPLQHG DV GHVFULEHG IRU S) DQG LQ 0DWHULDOV DQG 0HWKRGV :LWK UHVSHFW WR S)P DQG ZH DVVXPH WKDW HLWKHU WKH FRQVWUXFW ZDV ORVW LQ WKH WLPH EHWZHHQ WKH KDUYHVWLQJ RI FHOOV IRU WKH SXULILFDWLRQ RI 51$ DQG VXEVHTXHQWO\ '1$ RU WKDW WKH LQWHJUDWLRQ HYHQW GHVWUR\HG RQH RI WKH UHVWULFWLRQ VLWHV PDNLQJ GHWHFWLRQ LPSRVVLEOH 7KLV ZDV WKH RQO\ FDVH ZKHUH H[SUHVVLRQ RI WKH KXPDQ + KLVWRQH JHQH ZDV GHWHFWHG EXW QR FRSLHV ZHUH GHWHFWDEOH 'XH WR WKH FRQVWUDLQWV RI WKH WLVVXH FXOWXUH V\VWHP ZH XVXDOO\ SUHSDUHG VHYHUDO SODWHV RI FHOOV IRU WKH LVRODWLRQ RI 51$ DQG WKHQ RU SDVVDJHV ODWHU ZDV DEOH WR KDUYHVW FHOOV IRU LVRODWLRQ RI '1$ 7KH ODQHV RI WKH S) 6RXWKHUQ EORW H[KLELWHG QR RWKHU EDQGV WKDW PLJKW KDYH FRUUHVSRQGHG WR WKH LQWHJUDWHG S) FRQVWUXFW 6, QXFOHDVH DQDO\VLV DQG FRS\ QXPEHU GHWHUPLQDWLRQ ZHUH DOVR GRQH IRU WKH S) PRQRFORQDO FHOO OLQHV DQG WKH UHVXOWV DUH SUHVHQWHG LQ )LJXUHV DQG DE S) H[KLELWHG WKH PRVW FRQVLVWHQF\ LQ WKH OHYHO RI H[SUHVVLRQ s f DQG QHDUO\ HYHU\ PRQRFORQDO OLQH ZDV SRVLWLYH IRU H[SUHVVLRQ RI WKH KXPDQ + JHQH 7KH H[SUHVVLRQFRS\ UDWLR ZDV s 7KH VKRUWHVW GHOHWLRQ FRQVWUXFW IRU ZKLFK PRQRFORQDO FHOO OLQHV ZHUH PDGH ZDV DQ RULJLQDO %DO GHOHWLRQ 6LHUUD HW DO f 7KH H[SUHVVLRQ IURP DOO VL[ PRQRFORQHV PHDVXUDEOH ZDV UHODWLYHO\ ORZ

PAGE 104

)LJXUH 6, QXFOHDVH DQDO\VLV RI PRQRFORQDO FHOO OLQHV 6L QXFOHDVH DVVD\V ZHUH GRQH DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH FORQH QXPEHU RI HDFK FHOO OLQH LV GHQRWHG DERYH WKH ODQH 0 S%5 GLJHVWHG ZLWK +SDOO DQG ODEHOOHG ZLWK .OHQRZ + +H/D WRWDO FHOOXODU 51$ & & WRWDO FHOOXODU 51$ 'LOXWLRQV RI WKH PDUNHU DUH VSHFLILHG DQG +XPDQ DQG PRXVH + SURWHFWHG IUDJPHQWV DUH VSHFLILHG

PAGE 105

)LJXUH &RS\ QXPEHU DQDO\VLV RI PRQRFORQDO FHOO OLQHV 6RXWKHUQ EORW DQDO\VLV ZDV SHUIRUPHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH (FR5,;EDO IUDJPHQW LV VKRUWHU GXH WR WKH %DO GHOHWLRQ DQG LV GHVLJQDWHG ZLWK DQ DUURZ DW WKH OHIW 7KH VDPH FRQWUROV DV LQ )LJXUH KDYH EHHQ LQFOXGHG 4XDQWLWDWLRQ RI $ KLVWRQH + SUREHf DQG % UHSUREHG ZLWK PRXVH 6 ULERVRPDOf ZDV DV GHVFULEHG LQ )LJXUH DQG 0DWHULDOV DQG 0HWKRGV 1RQHVVHQWLDO ODQHV LQ % KDYH EHHQ GHOHWHG

PAGE 106

%

PAGE 107

7DEOH ([SUHVVLRQ s ([SUHVVLRQ&RS\ QXPEHU s f ,Q DGGLWLRQ WKHUH ZHUH VHYHUDO PRQRFORQHV LQFOXGLQJ .PO DQG LQ ZKLFK WKHUH ZDV DQ 6, QXFOHDVH SURWHFWHG IUDJPHQW SUHVHQW E\ YLVXDO LQVSHFWLRQ EXW WKH OHYHO ZDV EHORZ WKDW GHWHFWDEOH ZLWK WKH GHQVLWRPHWHU 7KH 6L QXFOHDVH SURWHFWLRQ DVVD\ DQG 6RXWKHUQ EORW DQDO\VLV DUH SUHVHQWHG LQ )LJXUH DQG DE 7KHVH UHVXOWV ZHUH LQ DJUHHPHQW ZLWK WKH SUHYLRXV SRO\FORQDO FHOO OLQH UHVXOWV WKDW ZH KDG REWDLQHG WKDW VXJJHVWHG WKDW DQ LQFUHDVH LQ WKH OHQJWK RI WKH + SURPRWHU UHVXOWHG LQ LQFUHDVHG H[SUHVVLRQ :H ZHUH DOVR FRQFHUQHG WKDW GLIIHUHQFHV LQ WKH n HQG RI VRPH RI RXU FRQVWUXFWV PLJKW DIIHFW WKH OHYHO RI H[SUHVVLRQ 7KH GLIIHUHQFHV LQ WKH n HQGV RI WKH FRQVWUXFWV ZHUH QRW LQWHQWLRQDO EXW DURVH DV D UHVXOW RI WKH FORQLQJ VWUDWHJLHV HPSOR\HG WR SURGXFH WKH n GHOHWLRQV 7R DGGUHVV WKLV TXHVWLRQ ZH SUHSDUHG WKH FRQVWUXFW S); VHH $SSHQGL[ &f 7KLV FRQVWUXFW KDV ES RI n IODQNLQJ VHTXHQFH EXW WKH ;EDO+LQGOOO IUDJPHQW DW WKH n HQG KDV EHHQ GHOHWHG IURP S)$ $OVR WKLV FRQVWUXFW ZDV PDGH LQ S8&O 7KLV n GHOHWLRQ HIIHFWLYHO\ UHPRYHV ES IURP WKH n IODQNLQJ UHJLRQ RI WKH S)$ + JHQH 0RQRFORQDO FHOO OLQHV RI S); ZHUH SUHSDUHG DQG DVVD\HG IRU H[SUHVVLRQ DQG FRS\ QXPEHU DV EHIRUH 7KH UHVXOWV RI WKH DQDO\VLV DUH SUHVHQWHG LQ )LJXUHV DQG DE DQG WKH H[SUHVVLRQ OHYHOV DUH FDOFXODWHG LQ 7DEOH 7KH H[SUHVVLRQ RI S); ZDV QRW VLJQLILFDQWO\ GLIIHUHQW WKDQ WKDW RI S)$ WKHVH UHVXOWV VXJJHVW WKDW WKH QXFOHRWLGHV IURP WKH ;EDO ES f VLWH WR WKH +LQGOOO ESf VLWH UHPRYHG IURP WKH n HQG LQ S); KDG OLWWOH LI DQ\ HIIHFW RQ WKH OHYHO RI WUDQVFULSWLRQ 7KH FRQVWUXFW S) ZDV DOVR

PAGE 108

; )LJXUH 6, QXFOHDVH DQDO\VLV RI S) DQG S)2O; PRQRFORQDO FHOO OLQHV 6, DQDO\VLV RI S)P DQG S);P DUH SUHVHQWHG ]J RI WRWDO FHOOXODU 51$ IURP ORJ SKDVH FHOOV ZDV PL[HG ZLWK DQ H[FHVV RI KXPDQ DQG PRXVH + KLVWRQH SUREHV DQG 6, QXFOHDVH UHDFWLRQV HOHFWURSKRUHVLV DQG GHQVLWRPHWU\ ZHUH GRQH DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH KXPDQ DQG PRXVH VLJQDOV QW DQG QW UHVSHFWLYHO\f DUH QRWHG RQ WKH ULJKW 7KH PDUNHUV 0 DQG S%5 GLJHVWHG ZLWK +SDOO DQG ODEHOOHG ZLWK .OHQRZ IUDJPHQW DQG 4A3G&73 7KH QXPEHU DERYH WKH ODQH GHVLJQDWHV WKH FORQH QXPEHU DQG WKH EODFN OLQH GHILQHV WKH FRQVWUXFW

PAGE 109

)LJXUH &RS\ QXPEHU DQDO\VLV RI S) DQG S); PRQRFORQDO FHOO OLQHV 6RXWKHUQ EORW DQDO\VLV ZDV GRQH DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 4XDQWLWDWLRQ RI $ DQG % $ SUREHG ZLWK KXPDQ + KLVWRQH % SUREHG ZLWK PRXVH 6 ULERVRPDO JHQHf ZDV DV GHVFULEHG EHIRUH LQ )LJXUH $OO GHVLJQDWLRQV DUH DV GHVFULEHG HDUOLHU LQ )LJXUH

PAGE 110

$ ; f§ n } X R R R L P 0  M % BA;BB & f 6 0 0 0

PAGE 111

7DEOH 4XDQWLWDWLRQ RI 0RQRFORQDO &HOO /LQH ([SUV VLRQ &/21(D (;3E &1F (;3&1G &/21( (;3 L 21 (;3&1 .PO P 1' .PO PO 1' .PO P .PO P .P P .P P $9*H $9* 67'I 67' $P PO $PO PO $P P $P P $PO PO $PO UDO $P P $P PO $PO PO $9* $9* 67' 67' PO PO 1' PO P 1' P P 1' POO P 1' P P 1' P PO 1' PO PO 1' PO PO $9* PO 67' P $9* 67'

PAGE 112

7DEOH FRQWLQXHG &/21( (;3 &1 (;3&1 ;P ;P ;P ;P ;P $9* 67' P P 1' P 1' POO 1' $9*i &/21( (;3 &1 (;3&1 P PO P P POO PO PO PO $9* 67' 5P 1' 5P 1' 5P 1' 5P 1' 5PO 1' $9* 67' $XWRUDGLRJUDPV ZHUH VFDQQHG ZLWK D ODVHU GHQVLWRPHWHU DV GHVFULEHG LQ &KDSWHU DQG WKH OHYHO RI H[SUHVVLRQ KDV EHHQ GHWHUPLQHG DQG SUHVHQWHG KHUH DV D UDWLR RI WKH KXPDQ DQG PRXVH 6, VLJQDOV D 7KH FRQVWUXFW XVHG WR PDNH WKH FHOO OLQH DQG WKH FORQH QXPEHU WKDW GHVLJQDWHV WKDW FHOO OLQH E ([SUHVVLRQ (;3f D UDWLR RI WKH KXPDQ DQG PRXVH 6, SURWHFWHG IUDJPHQWV DV GHWHUPLQHG E\ GHQVLWRPHWU\ )XUWKHU GHVFULSWLRQ RI WKH FDOFXODWLRQ DQG GHQVLWRPHWU\ SURFHGXUHV DUH JLYHQ LQ WKH 0DWHULDOV DQG 0HWKRGV VHFWLRQ F 7KH FRS\ QXPEHU &1f RI WKH FHOO OLQH DV GHWHUPLQHG E\ 6RXWKHUQ EORW DQDO\VLV G ([SUHVVLRQ GLYLGHG E\ WKH FRS\ QXPEHU RI WKH FHOO OLQH (;3&1f 7KH QXPEHU UHSUHVHQWV WKH OHYHO RI H[SUHVVLRQ SHU FRS\ RI WKH FRQVWUXFW LQWHJUDWHG H $9* WKH DYHUDJH RI HLWKHU (;3 RU (;3&1 I 67' WKH VWDQGDUG GHYLDWLRQ RI WKH DYHUDJH YDOXH f J 7KH GDWD IURP P ZHUH QRW LQFOXGHG LQ WKH DYHUDJH FDOFXODWLRQ

PAGE 113

DVVD\HG ZLWK WKH S); EXW ZLOO EH GLVFXVVHG ODWHU LQ WKH FKDSWHU ZLWK UHVSHFW WR D SXWDWLYH HQKDQFHU HOHPHQW 7KH GDWD FROOHFWHG LQ 7DEOH ZHUH DUUDQJHG DQG WKH FRQVWUXFWV SODFHG LQWR D UDQN RUGHU LQ FRPSDULVRQ ZLWK RQH DQRWKHU 7KLV LV JUDSKLFDOO\ SUHVHQWHG LQ )LJXUH %RWK WKH DYHUDJH OHYHO RI H[SUHVVLRQ DQG H[SUHVVLRQFRS\ DUH SUHVHQWHG ZLWK WKH VWDQGDUG GHYLDWLRQ RI HDFK FDOFXODWLRQ 7KH ILUVW REVHUYDWLRQ LV WKDW DV WKH DPRXQW RI n VHTXHQFH LV H[WHQGHG RXW WR ES LQ FRQVWUXFW S) WKH OHYHO RI H[SUHVVLRQ LQFUHDVHV DSSUR[LPDWHO\ IROG DERYH WKDW RI S)$ 7KHUH DUH VLJQLILFDQW GLIIHUHQFHV EHWZHHQ H[SUHVVLRQ DQG H[SUHVVLRQFRS\ 7KLV LV PRVW HDVLO\ VHHQ ZKHQ FRS\ QXPEHU LV LQFOXGHG LQ WKH H[SUHVVLRQ YDOXH IRU S) 7KHUH LV REYLRXVO\ D ODUJH VWDQGDUG GHYLDWLRQ LQ WKHVH UHVXOWV DQG WKLV LV SUREDEO\ D UHIOHFWLRQ RI WKH LQDFFXUDFLHV LQKHUHQW LQ WKH V\VWHP DYDLODEOH 7KHUH DUH VWDWLVWLFDO GLIIHUHQFHV LQ VSLWH RI WKH KLJK YDULDELOLW\ HQFRXQWHUHG LQ WKLV DVVD\ V\VWHP 7R DQDO\]H WKH GDWD VWDWLVWLFDOO\ ZH HPSOR\HG WKH VHUYLFHV RI WKH 8QLYHUVLW\ RI )ORULGD %LRVWDWLVWLFV 8QLW DQG 'U 0LNH &RQORQ ,W ZDV GHFLGHG WKDW WKH PRVW SRZHUIXO VWDWLVWLFDO WHVW WKDW FRXOG EH HPSOR\HG RQ WKHVH GDWD ZDV WKH :LOFR[RQ 5DQN 6XP WHVW 7KLV WHVW DQG WKH DQDO\VHV KDYH EHHQ GHVFULEHG LQ WKH 0DWHULDOV DQG 0HWKRGV VHFWLRQ RI WKLV ZRUN 3UHYLRXVO\ ZH GHPRQVWUDWHG WKDW WKH PRQRFORQHV ESf DQG WKH S)$ PRQRFORQHV ESf ZHUH QRW VLJQLILFDQWO\ GLIIHUHQW WKHVH UHVXOWV VXJJHVWHG WKDW WKHUH ZDV OLWWOH FRQWULEXWLRQ IURP WKH VHTXHQFH EHWZHHQ ES DQG ES WR WKH OHYHO RI WUDQVFULSWLRQ :KHQ WKH GDWD IRU WKH S) PRQRFORQHV ZHUH FRPSDUHG WR WKH PRQRFORQHV WKH

PAGE 114

5HODWLYH ([SUHVVLRQ + 'HOHWLRQ &RQVWUXFWV $YHUDJH ([SUHVVLRQ DQG ([SUHVVLRQ&RS\ QXPEHU )LJXUH *UDSKLF DQDO\VLV RI KXPDQ + KLVWRQH JHQH H[SUHVVLRQ LQ PRXVH & FHOOV 7KH DYHUDJH H[SUHVVLRQ IRU HDFK JURXS RI PRQRFORQHV LV SORWWHG 7KH DYHUDJH H[SUHVVLRQ (;3f DQG H[SUHVVLRQFRS\ (;3&1f ZHUH FDOFXODWHG LQ 7DEOH DQG DUH SORWWHG KHUH ZLWK WKH VWDQGDUG GHYLDWLRQ IRU HDFK DYHUDJH YDOXH VKRZQ DV D RQHZD\ HUURU EDU

PAGE 115

GLIIHUHQFH LQ WKH DYHUDJH H[SUHVVLRQFRS\ S) YHUVXV f ZDV VLJQLILFDQW DW S 7KLV VXJJHVWHG WKH H[LVWHQFH RI D SRVLWLYH UHJXODWRU\ HOHPHQW LQ WKH VHTXHQFHV IURP ES WR ES 3UHYLRXV SRO\FORQDO FHOO OLQH DQDO\VLV KDG GHPRQVWUDWHG D GLIIHUHQFH EHWZHHQ S) DQG WKH VKRUWHU GHOHWLRQV KRZHYHU WKH QXPEHU RI VDPSOHV ZDV VPDOO DQG SUHFOXGHG DQ\ VWDWLVWLFDO DQDO\VLV 6LQFH FRS\ QXPEHU KDG EHHQ GHPRQVWUDWHG WR EH DQ LPSRUWDQW YDULDEOH ZH FRPSDUHG WKH S)$ DQG S) PRQRFORQDO FHOO OLQHV ZLWK FRS\ QXPEHUV OHVV WKDQ LQ WKH :LOFR[RQ 5DQN 6XP WHVW DQG IRXQG WKDW LQ WKLV JURXS RI GDWD S)2 ZDV VLJQLILFDQWO\ S f KLJKHU LQ H[SUHVVLRQ WKDQ S)$ ,I WKH HQWLUH GDWD EDVH ZDV XWLOL]HG WKHQ WKH WZR FRQVWUXFWV ZHUH QRW VLJQLILFDQWO\ GLIIHUHQW S f 7KLV ZDV SUHVXPDEO\ WKH UHVXOW RI VHYHUDO KLJK FRS\ QXPEHU FHOO OLQHV WKDW VNHZHG WKH JURXS 7KH GDWD ZHUH FRQVLVWHQW ZLWK WKH LGHD WKDW D JUDGXDO LQFUHDVH LQ WKH n IODQNLQJ VHTXHQFHV FRQWULEXWHV WR DQ LQFUHDVH LQ WKH OHYHO RI KXPDQ + KLVWRQH JHQH H[SUHVVLRQ 7KH GDWD DOVR VXJJHVWHG WKDW WKHUH PLJKW EH D SRVLWLYH UHJXODWRU\ HOHPHQW EHWZHHQ ES S)$f DQG ES S)f DOWKRXJK LW ZDV QRW FOHDUO\ GHILQDEOH 3URWHLQ'1$ LQWHUDFWLRQV LQ WKLV UHJLRQ RI WKH SURPRWHU ZHUH GHWHFWHG LQ YLWUR E\ YDQ :LMQHQ HW DO f XQIRUWXQDWHO\ WKHVH VWXGLHV ZHUH QRW SXUVXHG ,Q YLYR WKHUH ZHUH QR GHWHFWDEOH SURWHLQ'1$ LQWHUDFWLRQV LQ WKH ES WR ES UHJLRQ 3DXOL HW DO f RI WKH SURPRWHU :H KDYH GRQH SUHOLPLQDU\ LQYHVWLJDWLRQ LQWR WKH SXWDWLYH SRVLWLYH HOHPHQW DQG RXU VWXGLHV DUH GHWDLOHG EHORZ ,Q DGGLWLRQ WKH GDWD SUHVHQWHG LQ 7DEOH ZHUH UHHYDOXDWHG ZLWK UHVSHFW WR WKH HIIHFW RI FRS\ QXPEHU RQ H[SUHVVLRQ WKH ORZ FRS\

PAGE 116

QXPEHU GDWD ZKLFK ZHUH PRVW UHSUHVHQWDWLYH RI WKH UHVXOWV DQG OHDVW DIIHFWHG E\ WKH FRPSHWLWLRQ SKHQRPHQRQ PHQWLRQHG HDUOLHU DUH GLVFXVVHG DQG DQDO\]HG LQ FKDSWHU 'LVWDO 7UDQVFULSWLRQDO 5HJXODWRU\ (OHPHQWV ,QVSHFWLRQ RI WKH GDWD LQ 7DEOH DQG JUDSKLFDOO\ SUHVHQWHG LQ )LJXUH GHPRQVWUDWHV WZR SRLQWV )LUVW DV WKH OHQJWK RI WKH + SURPRWHU VHTXHQFH LQFUHDVHV WR ES WKH DYHUDJH OHYHO RI H[SUHVVLRQ ULVHV 7KH GLIIHUHQFH LQ H[SUHVVLRQ EHWZHHQ WKH PRQRFORQDO FHOO OLQHV RI S)$ DQG S) LV VWDWLVWLFDOO\ VLJQLILFDQW S f 7KH VHFRQG SRLQW LV WKDW WKH H[SUHVVLRQ RI S)2 LV VLJQLILFDQWO\ ORZHU WKDQ S) 7KLV UHVXOW LV EDVHG RQ WKH FRPSDULVRQ RI RQO\ RI WKH PRQRFORQDO FHOO OLQHV ZKLFK ZHUH SRVLWLYH IRU H[SUHVVLRQ 8QIRUWXQDWHO\ WZR RI WKH S) PRQRFORQHV S)P DQG S)PO2f KDG QR GHWHFWDEOH (FR5,;EDO IUDJPHQW LQ WKH FRS\ QXPEHU H[SHULPHQW :H VKRXOG QRWH WKDW LI RQH DVVXPHV WKDW WKHVH FHOO OLQHV KDGRQO\ FRS\ RI WKH + JHQH LQWHJUDWHG DQG LQFRUSRUDWHV DOO PRQRFORQDO FHOO OLQHV LQWR WKH GDWD EDVH WKH GLIIHUHQFH LQ H[SUHVVLRQ EHWZHHQ S) DQG S) LV VWLOO VWDWLVWLFDOO\ VLJQLILFDQW 7KH IDFW WKDW S) ESf ZDV ORZHU LQ H[SUHVVLRQ WKDQ S) ESf VXJJHVWHG WKDW WKHUH PLJKW EH D QHJDWLYH UHJXODWRU\ HOHPHQW LQ WKH PRUH GLVWDO VHTXHQFHV RI WKH + SURPRWHU 7KH REMHFWLYH RI WKH QH[W H[SHULPHQWV ZDV WR GHWHUPLQH LI WKHUH ZDV D QHJDWLYH UHJXODWRU\ HOHPHQW ORFDWHG EHWZHHQ DQG ES LQ WKH KXPDQ + KLVWRQH JHQH SURPRWHU 7KHUH ZHUH VHYHUDO RWKHU OLQHV RI HYLGHQFH WKDW VXJJHVWHG WKDW VHTXHQFHV XSVWUHDP RI ES PLJKW LQIOXHQFH WKH H[SUHVVLRQ RI WKLV JHQH LQ D QHJDWLYH IDVKLRQ :KHQ ZH

PAGE 117

)LJXUH 6WUDWHJ\ XWLOL]HG WR GHWHUPLQH WKH VHTXHQFH RI WKH %DP+, ESf(FR5, f IUDJPHQW XSVWUHDP RI WKH ) + KLVWRQH JHQH 7KH SHUWLQHQW UHVWULFWLRQ HQ]\PH VLWHV DUH GHVLJQDWHG 7KH DUURZV LQGLFDWH WKDW WKH '1$ ZDV UHVWULFWHG DW WKH RULJLQ RI WKH DUURZ DQG VHTXHQFHG IURP WKDW SRLQW LQ WKH GLUHFWLRQ RI WKH DUURZ DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV

PAGE 118

f f %DP+, %DLO +LQGOOO (FR5, , R

PAGE 119

)LJXUH $QQRWDWHG VHTXHQFH RI WKH S) n IODQNLQJ VHTXHQFH %RWK VWUDQGV RI WKH VHTXHQFH DUH VKRZQ IURP ES WR ES &RQVWUXFW GHOHWLRQ SRLQWV DUH GHQRWHG ZLWK DQ DVWHULVN RYHU WKH ODVW EDVH LQ WKH FORQH DQG WKH FORQH QDPH $ QXPEHU RI KRPRORJLHV WR YDULRXV HOHPHQWV KDYH EHHQ GHVLJQDWHG 7KH SUR[LPDO ES KDYH WKH $7* 7$7$ &$$7 DQG **7&& HOHPHQWV XQGHUOLQHG $OVR 6LWH DQG 6LWH ,, DUH EROGHG )URP WR ES D '1DVHO K\SHUVHQVLWLYH VLWH LV GHQRWHG ZLWK D VWULQJ RI DVWHULVNV DERYH WKH VHTXHQFH 3XWDWLYH QXFOHDU PDWUL[ DWWDFKPHQW VLWHV XQGHUOLQHG DUH ORFDWHG DW ES DQG ES EDVHV WKDW GR QRW PDWFK WKH FRQVHQVXV VHTXHQFH DUH EROGHGf $ SXWDWLYH WRSRLVRPHUVH ,, VLWH LV IRXQG DW ES WR ES DQG KDV EHHQ FRQILUPHG E\ 'U 7 5RZH SHUVRQDO FRPPXQLFDWLRQf 1XFOHDU PDWUL[ DVVRFLDWHG 7ER[HV DUH XQGHUOLQHG DW DQG ES 7ZR SXWDWLYH QHJDWLYH UHJXODWRU\ HOHPHQWV DUH XQGHUOLQHG DW DQG ES

PAGE 120

r ESf *&$*$$7$7&&&7&$*7&77&7&7$7*7$*&$**&&&7&&$7$7$&*&***77&&&&$$* &*7&77$7$***$*7&$*$$*$*$7$&$7&*7&&***$**7$7$7*&*&&&$$****77& r' $&&*$$$$7$77$$$&$$$7*$$777&777777$$$$$$$$*7$&$$&$$$$*$7$*7$$ 7**&7777$7$$777*777$&77$$$*$$$$$$77777777&$7*77*7777&7$7&$77 DDDWDDDDDFDJWDWDDFDDWWDFWWDFDWDJFWWWDFDFDFWJJDWWJJWJWWFJDDJW WWWDWWWWWJWFDWDWWJWWDDWJDDWJWDWFJDDDWJWJWJDFFWDDFFDFDDJFWWFD $$777*$*&77$777$$$*7$&$&***$**$7*7*&$7$*77$7*7*&$$$7$&7$&&&& 77$$$&7&*$$7$$$777&$7*7*&&&7&&7$&$&*7$7&$$7$&$&*777$7*$7**** r( $&777&7$7*$*$*$&77*$*&$$&&7*$7777**7$7&**&*****&&&7*$&&$$7&& 7*$$$*$7$&7&7&7*$$&7&*77**$&7$$$$&&$7$*&&*&&&&&***$&7**77$** &&7&7&$*77&7$&&*$***$*$$&7*7777*777&77&&*&$&**&777*$&&*$&$*7 **$*$*7&$$*$7**&7&&&7&77*$&$$$$&$$$*$$**&*7*&&*$$$&7**&7*7&$ *7*77***$77&*&7**$&&$7*$*$$$*&77**&$*&$7*&7*7*$&&**7777&&&$* &$&$$&&&7$$*&*$&&7**7$&7&777&*$$&&*7&*7$&*$&$&7**&&$$$$***7& r **&&$*$$77&7&&7*7*7*$*&7$$$$7$&$*7**&7&**7&&$$&$$$$&$*$*&&7* &&**7&77$$*$**$&$&$&7&*$7777$7*7&$&&*$*&&$**77*7777*7&7&**$& *$*&&$**$$77$7**&*$$&&7*&7&&&7&&*7&&7&&77&**&*$$*$7&&&7**&*& &7&**7&&77$$7$&&*&77**$&*$***$**&$**$**$$*&&*&77&7$***$&&*&* r *&*7&&77*$**7&*&&77&**7*77*$&&7&$7&*7&**$$&**&*&77&&7*$$*&77 &*&$**$$&7&&$*&**$$*&&$&$$&7**$*7$*&$*&&77*&&*&*$$**$&77&*$$

PAGE 121

7$7$7$$*&$&**&7&7*$$7&&*&7&*7&**$77$$$7&&7*&*&7**&*7&&7*&&$* $7$7$77&*7*&&*$*$&77$**&*$*&$*&&7$$777$**$&*&*$&&*&$**$&**7& 7&7&7&*&7&&$777*&7&77&&7*$**&7&&&7&&$*$*$&&777&&&77$*&&7&$*7 $*$*$*&*$**7$$$&*$*$$**$&7&&*$***$**7&7&7**$$$***$$7&**$*7&$ *&*$$7*&77&&***&*7&&7&$*$$&&$*$*&$&$*&&$$$*&&$&7$&$*$$7&&**$ &*&77$&*$$**&&&*&$**$*7&77**7&7&*7*7&**777&**7*$7*7&77$**&&7 r$ r/ $*&&&**77***$7&7*$$77&7&&&****$&&*77*&*7$**&*77$$$$$$$$$$$$* 7&***&&$$&&&7$*$&77$$*$***&&&&7**&$$&*&$7&&*&$$777777777777& r. $*7*$*$***$&&7*$*&$*$*7**$**$**$***$*$**$$$$&$*$$$$*$$$7*$&* 7&$&7&7&&&7**$&7&*7&7&$&&7&&7&&7&&&7&7&&7777*7&7777&777$&7*& rr$$$7*7&*$*$***&****$&$$77*$*$$&*&77&&&*&&**&*&*&777&**7777&$ 777$&$*&7&7&&&*&&&&7*77$$&7&77*&*$$***&**&&*&*&*$$$*&&$$$$*7 r$7&7**7&&*$7$&7&77*7$7$7&$****$$*$&**7*&7&*&&77*$&$*$$*&7*7& f ‘ 7$*$&&$**&7$7*$*$$&$7$7$*7&&&&77&7*&&$&*$*&**$$&7*7&77&*$&$* 7$7&***&7&&$*&**7&$7*7&&**&$*$**$$$***&**$$$$**&77$**&$$$*** $7$*&&&*$**7&*&&$*7$&$**&&*7&7&&777&&&*&&7777&&*$$7&&*777&&& )LJXUH FRQWLQXHG

PAGE 122

WULHG WR PDNH FHOO OLQHV ZLWK WKH FRQVWUXFW S)222O DQ LQWHUQDO GHOHWLRQ IURP WR ES VHH )LJXUH f ZH IRXQG YHU\ IHZ FHOO OLQHV WKDW H[SUHVVHG WKH WUDQVIHFWHG KXPDQ + JHQH 2QO\ RI SRO\FORQDO OLQHV DQG RI PRQRFORQDO OLQHV ZHUH SRVLWLYH IRU H[SUHVVLRQ DQG WKHVH ZHUH EDUHO\ GHWHFWDEOH GDWD QRW VKRZQf 7KLV UHVXOW VXSSRUWHG WKH LGHD WKDW WKHUH ZDV D SRVLWLYH UHJXODWRU\ HOHPHQW LQ WKH UHJLRQ EHWZHHQ DQG ES DQG VLQFH WKH H[SUHVVLRQ ZDV YHU\ ORZ SHUKDSV D QHJDWLYH HOHPHQW XSVWUHDP RI ES ,Q DGGLWLRQ SRO\FORQDO OLQHV RI S) DSSHDUHG WR KDYH ORZHU H[SUHVVLRQ WKDQ SRO\FORQDO OLQHV RI S) GDWD QRW VKRZQf 7R DGGUHVV WKH SRVVLELOLW\ RI D QHJDWLYH UHJXODWRU\ HOHPHQW ZH ILUVW GHFLGHG WR VHTXHQFH WKH UHJLRQ RI WKH SURPRWHU IURP ES WR ES S) '1$ ZDV GLJHVWHG ZLWK HLWKHU %DP+, (FR5, RU +LQGOOO WUHDWHG ZLWK SKRVSKDWDVH DQG ODEHOOHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV DQG WKH SURWRFRO RI 0D[DP DQG *LOEHUW f )LJXUH VFKHPDWLFDOO\ GLVSOD\V WKH VWUDWHJ\ XWLOL]HG WR GHWHUPLQH WKH VHTXHQFH RI WKH XSVWUHDP UHJLRQ 7KH VHTXHQFH KDV VHYHUDO XQXVXDO FKDUDFWHULVWLFV DQG LV SUHVHQWHG DV SDUW RI WKH HQWLUH S) VHTXHQFH LQ )LJXUH 7KH GLVWDO HQG RI WKH IUDJPHQW IURP ES WR ES LV YHU\ $7 ULFK bf ZLWK VHYHUDO KRPRSRO\PHULF UXQV RI HDFK ,Q DGGLWLRQ D VHDUFK RI WKH UHJLRQ UHYHDOHG WZR VHTXHQFHV ZLWK VWURQJ VLPLODULW\ WR QXFOHDU PDWUL[ DWWDFKPHQW VLWHV ES DQG ESf DQG DVVRFLDWHG 7ER[HV ES DQG ES ERWWRP VWUDQGf*DVVHU DQG /DHPPOL f 1HDU WKH XSVWUHDP PDWUL[ VLWH D SXWDWLYH WRSRLVRPHUDVH VLWH ESf ZDV LGHQWLILHG 7KH SUHVHQFH RI WKLV WRSRLVRPHUDVH VLWH KDV EHHQ FRQILUPHG LQ YLWUR E\ 'U7RP 5RZH

PAGE 123

SHUVRQDO FRPPXQLFDWLRQf $GGLWLRQDOO\ 'U 6XVDQ &KU\VRJHORV RI RXU ODERUDWRU\ GHPRQVWUDWHG WKH SUHVHQFH RI D '1$VHO K\SHUVHQVLWLYH VLWH WR ESf EHWZHHQ WKH WZR SXWDWLYH QXFOHDU PDWUL[ DWWDFKPHQW VLWHV SHUVRQDO FRPPXQLFDWLRQf 7KLV DUUDQJHPHQW RI FKURPDWLQ VWUXFWXUH QXFOHDU PDWUL[ VLWHV IODQNLQJ D QXFOHDVH K\SHUVHQVLWLYH VLWH LV YHU\ VLPLODU WR WKDW GHPRQVWUDWHG SUHYLRXVO\ E\ *DVVHU DQG /DHPPOL f DQG ZDV DW OHDVW FLUFXPVWDQWLDO HYLGHQFH WKDW WKLV UHJLRQ PLJKW EH LQYROYHG LQ DWWDFKPHQW WR WKH QXFOHDU PDWUL[ :H FRPSDUHG WKH HQWLUH n IODQNLQJ VHTXHQFH RI WKH ) + KLVWRQH JHQH WR ESf ZLWK WKH FRQVHQVXV VHTXHQFHV IRU VHYHUDO JURXSV RI QHJDWLYH UHJXODWRU\ HOHPHQWV DV GHVFULEHG E\ %DQLDKPDG HW DO f 7KH\ FRPSDUHG WKH SURPRWHU VHTXHQFHV RI D QXPEHU RI JHQHV VXEMHFW WR QHJDWLYH UHJXODWLRQ DQG GHWHUPLQHG WZR FRQVHQVXV HOHPHQWV 7KHVH HOHPHQWV ZHUH WHUPHG %R[ n$1&&7&7&&nf DQG %R[ n $17&7&&7&&nf *RRG KRPRORJLHV WR ERWK HOHPHQWV ZHUH IRXQG LQ WKH + KLVWRQH XSVWUHDP UHJLRQ DW ES %R[ f DQG ES %R[ f DV GHVLJQDWHG LQ )LJXUH 'U 6XVDQ &KU\VRJHORV RI RXU ODERUDWRU\ GHPRQVWUDWHG WKDW WKH UHJLRQ RI WKH + SURPRWHU IURP WR ES KDV PLGGOH UHSHWLWLYH FKDUDFWHU SHUVRQDO FRPPXQLFDWLRQf $V PHQWLRQHG LQ WKH LQWURGXFWLRQ /DLPLQV HW DO f DVVRFLDWHG PLGGOH UHSHWLWLYH FKDUDFWHU ZLWK VRPH QHJDWLYH UHJXODWRU\ HOHPHQWV FKLFNHQ O\VR]\PH JHQH DQG UDW LQVXOLQ OLNH JURZWK JHQHf 7R LQYHVWLJDWH ZKHWKHU WKHUH ZDV DQ\ IXQFWLRQDOLW\ DVVRFLDWHG ZLWK WKH WZR SXWDWLYH QHJDWLYH UHJXODWRU\ HOHPHQWV WKDW ZHUH LPSOLFDWHG YLD VLPLODULW\ WR SUHYLRXVO\ LGHQWLILHG QHJDWLYH HOHPHQWV ZH FRQVWUXFWHG WZR GHOHWLRQ PXWDQWV RI S) LQ WKH ES %DP+,(FR5, IUDJPHQW

PAGE 124

)LJXUH 'HOHWLRQV IRU LQYHVWLJDWLRQ RI SXWDWLYH QHJDWLYH UHJXODWRU\ HOHPHQW LQ XSVWUHDP UHJLRQ RI + SURPRWHU 7ZR GHOHWLRQV RI S) ZHUH PDGH E\ VWDQGDUG FORQLQJ SURFHGXUHV DV RXWOLQHG LQ 0DWHULDOV DQG 0HWKRGV DQG FORQHG LQWR S8&O 7KH FRQVWUXFW S)'O LV D 'UDO3VW, IUDJPHQW WKDW GHOHWHV QXFOHRWLGHV IURP WKH n HQG RI S) LQ WKH UHJLRQ RI LQWHUHVW S)( LV DQ (FR;EDO IUDJPHQW WKDW GHOHWHV QXFOHRWLGHV 7KH UHVWULFWLRQ HQ]\PH VLWHV DUH GHQRWHG DV %DP+, % 'UDO (FR ( (FR5O ( +LQGL +H ;EDO ; DQG 3VW, 3 7KH GLUHFWLRQ RI WUDQVFULSWLRQ LV VSHFLILHG ZLWK WKH DUURZ

PAGE 125

S) % ( ,f§,f§-/ ( + ( U S)' (0( /f§Lf§f§-f§f§ ( ( + WPZLnL=UY U cVU]nA S)( +H ; 3

PAGE 126

)LJXUH f 7KH ILUVW GHOHWLRQ S)'O ZDV PDGH E\ GLJHVWLRQ RI S) ZLWK 3VW, DQG WKHQ D SDUWLDO GLJHVWLRQ ZLWK 'UDO 7KH 'UDO3VW, NEf IUDJPHQW ZDV LVRODWHG DQG FORQHG LQWR WKH 6PDO VLWH LQ S8& %HIRUH OLJDWLRQ WKH '1$ ZDV WUHDWHG ZLWK .OHQRZ IUDJPHQW WR EOXQW WKH HQGV RI WKH LQVHUW PROHFXOH 7KLV FRQVWUXFW HIIHFWLYHO\ GHOHWHV ES RI WKH n VHTXHQFH IURP WR ES 7KH VHFRQG GHOHWLRQ S)( ZDV SUHSDUHG LQ D VLPLODU PDQQHU H[FHSW WKH LQLWLDO GLJHVWLRQ ZDV ZLWK ;EDO 7KH SDUWLDO GLJHVWLRQ ZDV DIWHU WKH EOXQW HQG UHDFWLRQ ZLWK .OHQRZf ZLWK (FR 7KH ES (FR3VWO IUDJPHQW ZDV SXULILHG DQG WKH IUDJPHQW ZDV OLJDWHG WR S8& GLJHVWHG ZLWK 6PDO XQGHU EOXQW HQG FRQGLWLRQV DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV S)( f GHOHWHV ES IURP WKH n HQG RI S) -XVW SULRU WR WKH FRQVWUXFWLRQ RI S)'O DQG ( ZH PDGH WKH FRQVWUXFW S) E\ DQ (FR5, SDUWLDO GLJHVWLRQ RI S) OLQHDUL]HG ZLWK 3VW, 7KH NE 3VWO(FR5, IUDJPHQW ZDV FORQHG LQWR S8& )LJXUH f 7KLV FRQVWUXFW ZDV PDGH WR DVVHVV WKH FRQWULEXWLRQ RI WKH ES EHWZHHQ S)f DQG ,W ZDV GHFLGHG WKDW LQVWHDG RI PDNLQJ VWDEOH FHOO OLQHV ZKLFK KDG EHHQ D FRQIXVLQJ HQGHDYRU XS WR WKLV SRLQW ZH ZRXOG WUDQVLHQWO\ WUDQVIHFW & FHOOV ZLWK WKHVH FRQVWUXFWV WR DVVHVV DQ\ SRVVLEOH QHJDWLYH UHJXODWRU\ HIIHFWV 7KH WUDQVIHFWLRQV RI S) S)'O S)( S) S) S)$ DQG S)222O ZHUH GRQH DFFRUGLQJ WR WKH SURWRFRO GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7ZR RI WKH 6, QXFOHDVH DVVD\V SHUIRUPHG RQ 51$ LVRODWHG IURP WKH WUDQVIHFWHG FHOOV DUH SUHVHQWHG LQ )LJXUH %RWK & FHOOV DQG /WN FHOOV ZHUH XWLOL]HG LQ WKLV VHULHV RI H[SHULPHQWV 7KH GDWD IURP WKH VHULHV RI WUDQVIHFWLRQV LQ WRWDO DUH SUHVHQWHG LQ 7DEOH 7KHUH ZDV

PAGE 127

)LJXUH 6, QXFOHDVH DQDO\VLV RI WUDQVLHQWO\ WUDQVIHFWHG & DQG /WNn FHOOV 'HWHUPLQDWLRQ RI SXWDWLYH QHJDWLYH UHJXODWRU\ HOHPHQW SRVLWLRQ LQ GLVWDO SURPRWHU VHTXHQFH RI WKH ) + KLVWRQH JHQH 6, QXFOHDVH DQDO\VLV ZDV SHUIRUPHG RQ WRWDO FHOOXODU 51$ RI ERWK & DQG /WN DIWHU WUDQVIHFWLRQ ZLWK J RI HDFK KLVWRQH GHOHWLRQ FRQVWUXFW DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV MJ RI WRWDO FHOOXODU 51$ ZDV XVHG IRU HDFK K\EULGL]DWLRQ UHDFWLRQ 7KH UHVXOWV RI WZR WUDQVIHFWLRQV DUH SUHVHQWHG 7KH KXPDQ QWf DQG PRXVH QWf SURWHFWHG IUDJPHQWV DUH GHVLJQDWHG DW WKH ULJKW 0DUNHUV 0f S%5 GLJHVWHG ZLWK +SDOO ODEHOOHG ZLWK DAA3G&73 DQG .OHQRZ IUDJPHQW DQG SHUWLQHQW VL]HV DUH VKRZQ 'HQVLWRPHWU\ RI WKH KXPDQ DQG PRXVH VLJQDOV IURP DXWRUDGLRJUDPV SHUPLWWHG WKH TXDQWLWDWLRQ RI H[SUHVVLRQ IURP HDFK FRQVWUXFW 7KH FORQHV WUDQVIHFWHG LQWR HLWKHU & FHOOV OHIW SDQHOf RU /WNn FHOOV ULJKW SDQHOf DUH VSHFLILHG DERYH HDFK ODQH 7KHVH WZR DXWRUDGLRJUDPV DUH UHSUHVHQWDWLYH RI WKH H[SHULPHQWV WKDW ZHUH SHUIRUPHG $Q DQDO\VLV RI WKH GDWD LV SUHVHQWHG LQ 7DEOH DQG )LJXUH

PAGE 128

UR &2 R! ‘X R UR R UR UR L L r r f f f f f f ( W n f f f f f f f f i $ ( $ 0 +H/D W = R W ; H UR R &

PAGE 129

7DEOH 6XPPDU\ RI 7UDQVLHQW ([SUHVVLRQ 'DWD ([SHULPHQW &HOO 7\SH & /WNn /WN & /WN & &RQVWUXFW $YJ 6' S) S)'O S)( S) S) S)222O 1' 1' 1' S)$ 1' 1' 1' (DFK FRQVWUXFW ZDV WUDQVIHFWHG LQWR ERWK & RU /WN FHOOV DQG DQDO\]HG E\ GHQVLWRPHWU\ RI WKH DXWRUDGLRJUDPV 7KH DPRXQW RI WUDQVFULSWLRQ LV H[SUHVVHG LQ SHUFHQW RI S)( H[SUHVVLRQ VLQFH LW ZDV FRQVLVWHQWO\ WKH KLJKHVW H[SUHVVHG FRQVWUXFW 7KH LQGLYLGXDO YDOXHV IRU HDFK H[SHULPHQW DUH OLVWHG DQG WKH DYHUDJH H[SUHVVLRQ $YJf IRU WKH FRQVWUXFW WKH VWDQGDUG GHYLDWLRQ 6'f LV OLVWHG DW WKH ULJKW 2QO\ WUDQVIHFWLRQV RI S) ZHUH GRQH WKHUHIRUH WKHUH LV QR YDOXH IRU H[SHULPHQW 1' QRW GHWHUPLQHG 'HQVLWRPHWU\ ZDV RQO\ GRQH RQ WKUHH RI WKH H[SHULPHQWV LQ ZKLFK S)222O DQG S)$ ZHUH LQFOXGHG

PAGE 130

$YHUDJH RI 7UDQVLHQW $VVD\V F R nZ 9f &' LB 4B ; R FQ / &0 R R 0f§ R DV ( )LJXUH &RPSLODWLRQ DQDO\VLV RI WUDQVLHQW DVVD\V ZLWK KLVWRQH + GHOHWLRQ FRQVWUXFWV DQDO\VLV RI SXWDWLYH QHJDWLYH UHJXODWRU\ HOHPHQW 7KH GDWD IURP DOO VL[ WUDQVLHQW WUDQVIHFWLRQ H[SHULPHQWV ZDV DYHUDJHG IRU HDFK FRQVWUXFW DQG SORWWHG ZLWK VWDQGDUG GHYLDWLRQ EDUV 7KH GDWD DV LQ 7DEOH DUH FDOFXODWHG DV WKH SHUFHQW RI S)2( H[SUHVVLRQ S) S)'O S)( S) DQG S) DUH LQFOXGHG

PAGE 131

YDULDELOLW\ IURP H[SHULPHQW WR H[SHULPHQW DQG WKH DYHUDJH RI H[SHULPHQWV LV SORWWHG JUDSKLFDOO\ LQ )LJXUH 3ODVPLG '1$V ZHUH H[DPLQHG RQ DJDURVH JHOV WR GHWHUPLQH WKH SHUFHQW RI )RUP DQG WR HQVXUH WKDW WKH TXDQWLWDWLRQ ZDV DFFXUDWH ,Q ERWK 7DEOH DQG )LJXUH WKH YDOXHV IRU S) S)'O S) DQG S) DUH H[SUHVVHG DV WKH SHUFHQWDJH RI S)( ZKLFK ZDV FRQVLVWHQWO\ KLJKHVW WKURXJKRXW WKH H[SHULPHQWV 7KH GDWD IRU S)222O DQG S)$ ZHUH QRW LQFOXGHG LQ )LJXUH DV WKH\ ZHUH FRQVLGHUDEO\ ORZHU WKDQ DQ\ RI WKH RWKHU FRQVWUXFWV KRZHYHU WKH GDWD DUH SUHVHQWHG LQ 7DEOH 2XU ILUVW REVHUYDWLRQ ZDV WKDW WKH OHYHO RI S) H[SUHVVLRQ ZDV YHU\ VLPLODU WR WKDW RI S) LQ DSSDUHQW FRQWUDVW WR WKH GDWD IURP WKH VWDEOH FHOO OLQHV 7DEOH f ZKHUH S) ESf KDG D IROG KLJKHU OHYHO RI H[SUHVVLRQ WKDQ S) ESf 7KH PRVW OLNHO\ H[SODQDWLRQ IRU WKLV DSSHDUV WR UHODWH WR GLIIHUHQFHV EHWZHHQ H[SUHVVLRQ IURP VWDEO\ LQWHJUDWHG DQG HSLVRPDO '1$ PROHFXOHV 7KLV GLIIHUHQFH LQ WKH VWDWH RI WKH '1$ PD\ DOVR KDYH DIIHFWHG WKH OHYHO RI H[SUHVVLRQ IURP S)222O DQG S)2O26$ GLVFXVVHG EHORZf 7KH RULJLQDO K\SRWKHVLV ZDV WKDW WKH FRQVHQVXV QHJDWLYH UHJXODWRU\ VHTXHQFHV GHVFULEHG HDUOLHU %R[ DQG %R[ %DQLDKPDG HW DO f ZHUH UHVSRQVLEOH IRU WKH GHFUHDVH LQ H[SUHVVLRQ RI WKH S) FRQVWUXFW 2XU UHVXOWV GHPRQVWUDWHG WKDW ERWK RI WKH FRQVHQVXV QHJDWLYH UHJXODWRU\ HOHPHQWV %R[ ES DQG %R[ ESf ZHUH ORFDWHG LQ WKH VHTXHQFHV LQFOXGHG LQ WKH FRQVWUXFW S)( DQG LW ZDV WKH PRVW KLJKO\ H[SUHVVHG FRQVWUXFW RI WKH JURXS 7KLV UHVXOW GLVSURYHV WKH LGHD WKDW WKH GHFUHDVH LQ H[SUHVVLRQ LV GXH WR WKH SURSRVHG QHJDWLYH UHJXODWRU\ VHTXHQFHV +RZHYHU ZKHQ DGGLWLRQDO VHTXHQFHV DUH DGGHG LQ S)'O

PAGE 132

)LJXUH 6, QXFOHDVH DQDO\VLV &RPSDULVRQ RI S) DQG S) PRQRFORQDO FHOO OLQHV $QDO\VLV RI WRWDO FHOOXODU 51$ IURP HDFK FHOO OLQH ZDV DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV /DQHV DUH ODEHOOHG DV LQ SUHYLRXV 6, DQDO\VLV ILJXUHV 0 S%5 +SDOO PDUNHU S) DQG S) PRQRFORQDO FHOO OLQH QXPEHUV DUH GHQRWHG DERYH WKH ODQH + +H/D 51$ & & 51$ %RWK KXPDQ DQG PRXVH 6, QXFOHDVH SURWHFWHG IUDJPHQWV DUH GHQRWHG WR WKH ULJKW

PAGE 133

DQG S) WKH H[SUHVVLRQ LV ORZHU ,I WKHUH LV D QHJDWLYH HOHPHQW DQG WKLV HYLGHQFH LV DJDLQ RQO\ VXJJHVWLYH IRU RQH LW SUREDEO\ OLHV LQ WKH VHTXHQFHV EHWZHHQ WKH 'UDO VLWH f DQG WKH (FR VLWH f ,QWHUHVWLQJO\ ERWK WKH WRSRLVRPHUDVH ,, VLWH ESf DQG WKH '1DVHO K\SHUVHQVLWLYH VLWH WR ESf DUH LQFOXGHG LQ WKLV UHJLRQ RI WKH SURPRWHU ,Q DGGLWLRQ ZH FDQ VWDWH WKDW WKH VHTXHQFHV LQFOXGHG LQ WKH FRQVWUXFW S) WR ESf GR QRW FRQWULEXWH WR WKH OHYHO RI H[SUHVVLRQ ,Q WKH WUDQVLHQW DVVD\V WKH H[SUHVVLRQ IURP S) DQG S) ZDV QHDUO\ LGHQWLFDO )LJXUH DQG 7DEOH f 7KH S) FRQVWUXFW ZDV DOVR WUDQVIHFWHG LQWR & FHOOV DQG PRQRFORQDO FHOO OLQHV SUHSDUHG :H FRPSDUHG WKH OHYHO RI H[SUHVVLRQ RI WKH WZR FRQVWUXFWV DQG IRXQG QR VLJQLILFDQW GLIIHUHQFH 7KH 6, QXFOHDVH DQDO\VLV LV SUHVHQWHG LQ )LJXUH DQG WKH H[SUHVVLRQ GDWD ZHUH FDOFXODWHG DV EHIRUH DQG GLVSOD\HG LQ 7DEOH 7KH FRQVWUXFW S)( ZDV FRQVLVWHQWO\ H[SUHVVHG DW D KLJKHU OHYHO WKDQ DQ\ RI WKH RWKHU FRQVWUXFWV $Q H[DPLQDWLRQ RI WKH DGGLWLRQDO VHTXHQFH LQFOXGHG LQ WKH FRQVWUXFW S)( UHYHDOHG D SXWDWLYH &&$$7 ER[ ESf ZKLFK PDWFKHV WKH FRQVHQVXV VHTXHQFH LGHQWLFDOO\ 3HUKDSV WKLV HOHPHQW LV UHVSRQVLEOH IRU WKH IROG LQFUHDVH LQ WKH OHYHO RI H[SUHVVLRQ +RZ WKH &&$$7 ER[ QRUPDOO\ D SUR[LPDO SURPRWHU HOHPHQW PLJKW IXQFWLRQ LQ WKLV SDUWLFXODU SRVLWLRQ LV XQNQRZQ KRZHYHU WKHUH LV SUHFHGHQFH IRU WKH DFWLRQ RI GLVWDO UHJXODWRU\ HOHPHQWV WKURXJK EHQGLQJ RI WKH '1$ PROHFXOH 3WDVKQH f 7KH UHVXOWV ZH KDYH SUHVHQWHG KHUH DUH SUHOLPLQDU\ EXW VLPLODU UHVXOWV KDYH EHHQ VKRZQ E\ .HQ :ULJKW RI RXU ODERUDWRU\ ZLWK LQ YLWUR WUDQVFULSWLRQ RI

PAGE 134

WKH VDPH GHOHWLRQ FRQVWUXFWV IURP FLUFXODU WHPSODWHV LQ QXFOHDU H[WUDFWV SHUVRQDO FRPPXQLFDWLRQf ,Q WKH VWDEOH FHOO OLQHV WKH H[SUHVVLRQ RI D SDUWLFXODU FRQVWUXFW ZDV DSSDUHQWO\ GHWHUPLQHG E\ WKH KLVWRQH n VHTXHQFHV DQG WKH QXPEHU RI FRSLHV LQWHJUDWHG ,Q WKH WUDQVLHQW DVVD\V WKHUH ZDV D GHSUHVVLRQ LQ H[SUHVVLRQ RI S)222O DQG S)$ 7DEOH f DV FRPSDUHG WR S) 7KLV ZDV FRQVLVWHQW ZLWK WKH UHVXOWV RI WKH VWDEOH FHOO OLQHV KRZHYHU WKH HIIHFW ZDV PRUH GUDPDWLF LQ WKH HSLVRPDO V\VWHP S)222O H[SUHVVLRQ ZDV ORZ DQG XVXDOO\ LPSHUFHSWLEOH LQ VWDEOH FHOO OLQHV DQG FRQVLVWHQW ZLWK WKLV UHVXOW ZDV H[SUHVVHG RQO\ DW D ORZ OHYHO LQ WKH WUDQVLHQW WUDQVIHFWLRQV (YHQ ZLWK WKH DGGLWLRQDO n VHTXHQFH WKDW S)222O LQFOXGHV WKH LQWHUQDO GHOHWLRQ RI WKH (FR5, f(FR5, f IUDJPHQW DJDLQ VXJJHVWHG WKDW WKHUH ZDV D SRVLWLYH HOHPHQW LQ WKH ES EHWZHHQ DQG QW $Q DOWHUQDWLYH H[SODQDWLRQ IRU WKHVH UHVXOWV KRZHYHU LV SRVVLEOH S)222O DQG S)$ DUH GLIIHUHQW IURP WKH RWKHU GHOHWLRQ FRQVWUXFWV LQ WKDW WKH\ DUH ERWK S%5 FORQHV ZKHUHDV WKH RWKHUV DUH DOO GHULYDWLYHV RI S8& SODVPLGV 3HUKDSV WKLV GLIIHUHQFH LQ WKH OHQJWK DQG FRPSRVLWLRQ RI WKH YHFWRU ZDV PRUH GUDPDWLFDOO\ DFFHQWXDWHG LQ WKH WUDQVLHQW DVVD\ V\VWHP ,Q VWDEOH FHOO OLQHV D FRPSDULVRQ RI WKH n GHOHWLRQV S)$ DQG S); UHYHDOHG QR VLJQLILFDQW GLIIHUHQFHV S f LQ WKH OHYHO RI H[SUHVVLRQ 7DEOH f ,I DQ\WKLQJ S); ZDV VOLJKWO\ ORZHU LQ H[SUHVVLRQ DQG LV D S8& FORQH 3HUKDSV WKH IXQFWLRQDOLW\ RI WKHVH XSVWUHDP HOHPHQWV UHOLHV RQ D SDUWLFXODU FKURPDWLQ VWUXFWXUH RI WKH UHJLRQ ZKLFK LV RQO\ REWDLQHG ZKHQ WKH FRQVWUXFWV DUH LQWHJUDWHG

PAGE 135

)LJXUH 6FKHPDWLF GLDJUDP IRU WKH SURGXFWLRQ RI XQLGLUHFWLRQDO GHOHWLRQV ZLWK ([RQXFOHDVH ,,, DQG 0XQJ %HDQ 1XFOHDVH 7KH RULJLQDO FRQVWUXFW S)% ZDV PDGH E\ LQVHUWLRQ RI WKH S) LQVHUW LQWR WKH 3VW, DQG +LQGOOO VLWHV RI %OXHVFULSW 0 7KLV FRQVWUXFW ZDV GLJHVWHG ZLWK $SDO ZKLFK SURGXFHV D n RYHUKDQJ DQG +LQGOOO D n RYHUKDQJ DV VKRZQ 1H[W XQLWV RI ([RQXFOHDVH ,,, ZHUH DGGHG DQG DOLTXRWV UHPRYHG HYHU\ PLQXWH IRU PLQXWHV 7KH '1$ DOLTXRWV ZHUH GLOXWHG LQ 0XQJ %HDQ QXFOHDVH EXIIHU DQG XQLWV RI 0XQJ EHDQ QXFOHDVH ZDV DGGHG 7KH '1$ ZDV WKHQ OLJDWHG XQGHU EOXQW HQG FRQGLWLRQV DQG WUDQVIHFWHG LQWR FRPSHWHQW '+ FHOOV 7KH FRPSOHWH SURWRFRO LV GHWDLOHG LQ 0DWHULDOV DQG 0HWKRGV 7KH UHVXOWLQJ SURGXFWV RI WKLV UHDFWLRQ DUH XQLGLUHFWLRQDO GHOHWLRQV EHFDXVH ([RQXFOHDVH ,,, LV XQDEOH WR GLJHVW D nVLQJOH VWUDQG RYHUKDQJ $SDOf 5HVWULFWLRQ HQ]\PH VLWHV DUH GHVLJQDWHG DV 3VW, 3 (FR5, ( +LQGOOO + $SDO $ DQG .SQO .

PAGE 136

([R ,,, 0XQJ %HDQ

PAGE 137

'LVWDOSUR[LPDO SRVLWLYH HOHPHQW 2XU UHVXOWV LQGLFDWHG WKDW WKH VHTXHQFHV IURP WR ES PLJKW HQKDQFH WKH OHYHO RI + JHQH H[SUHVVLRQ 7R DGGUHVV WKLV TXHVWLRQ GHOHWLRQ PXWDQWV RI S) ZHUH SUHSDUHG 7KH S) LQVHUW ZDV VXEFORQHG LQWR WKH %OXHVFULSW 0 YHFWRU DQG GHOHWLRQV ZLWK ([RQXFOHDVH ,,, ZHUH SUHSDUHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH SURFHGXUH LV VFKHPDWLFDOO\ GLVSOD\HG LQ )LJXUH ,GHDOO\ WKH SURWRFRO VKRXOG KDYH SURGXFHG XQLGLUHFWLRQDO GHOHWLRQV IURP WKH +LQGOOO VLWH DW ES WRZDUG WKH (FR5, VLWH DW ES 7KLV PHWKRG UHOLHG RQ WKH LQDELOLW\ RI ([RQXFOHDVH ,,, WR GLJHVW D n RYHUKDQJ $SDOf +RZHYHU WKH SURWRFRO ZRUNHG YHU\ SRRUO\ DQG RQO\ GHOHWLRQV ZHUH REWDLQHG LQ WKH UHJLRQ RI LQWHUHVW WR QWf 7KHVH ZHUH GHQRWHG S)%6GHO ESf DQG S)%6GHO ESf 0RQRFORQDO FHOO OLQHV RI S)%6 S)%6GHO f DQG S)%6GHO f ZHUH SUHSDUHG DQG DVVD\HG E\ 6, QXFOHDVH DQDO\VLV )RXU RI PRQRFORQHV ZHUH SRVLWLYH IRU S)2226%6 )LYH RI DQG RI ZHUH SRVLWLYH IRU DQG UHVSHFWLYHO\ 7KH 6, DQDO\VLV RI WKHVH FHOO OLQHV )LJXUH f ZDV UHSHDWHG WLPHV DQG WKH DYHUDJH H[SUHVVLRQ IURP ERWK S)%6 DQG ZDV LGHQWLFDO s f 7KLV YDOXH UHSUHVHQWV RQO\ WKH DEVROXWH DPRXQW RI WKH KXPDQ 6, SURWHFWHG IUDJPHQW DV PHDVXUHG E\ WKH GHQVLWRPHWHU DYHUDJHG IRU HDFK FRQVWUXFW 6LQFH RQO\ D VLQJOH PRQRFORQH ZDV SRVLWLYH IRU LW ZDV QRW LQFOXGHG LQ WKH DQDO\VLV 7KH PRXVH + 6, SURWHFWHG IUDJPHQW SUHVHQWHG DQ XQXVXDO SDWWHUQ HYHQ XSRQ UHSHWLWLRQ DQG ZDV QRW LQFOXGHG LQ WKH DQDO\VLV 7KH FRQWURO 6, QXFOHDVH DQDO\VLV RI & 51$ ZRUNHG ZHOO )LJXUH f EXW WKH VDPSOH & SURWHFWHG EDQGV ZHUH DOZD\V

PAGE 138

)LJXUH 6, DQDO\VLV RI S)%6 DQG ([RQXFOHDVH ,,, GHOHWLRQV 6, QXFOHDVH DVVD\V ZHUH GRQH DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH FORQH QXPEHU RI HDFK FHOO OLQH LV GHQRWHG DERYH WKH ODQH 0 S%5 GLJHVWHG ZLWK +SDOO DQG ODEHOOHG ZLWK DA3G&73 DQG .OHQRZ IUDJPHQW + +H/D WRWDO FHOOXODU 51$ & & WRWDO FHOOXODU 51$ 7KH KXPDQ QWf DQG PRXVH QWf 6, QXFOHDVH SURWHFWHG IUDJPHQWV DUH GHQRWHG DW WKH OHIW

PAGE 139

ORZHU RU QRW GHWHFWDEOH HYHQ ZKHQ WKH KXPDQ + SURWHFWHG IUDJPHQW ZDV HDVLO\ VHHQ :H KDYH QRWLFHG WKLV RFFDVLRQDOO\ EXW QHYHU LQ VR PDQ\ VDPSOHV DW RQFH 2FFDVLRQDOO\ KLJK FRS\ QXPEHU FHOO OLQHV RU WKH +H/D WRWDO FHOOXODU 51$ FRQWURO KDYH H[KLELWHG D VLPLODU SDWWHUQ RI K\EULGL]DWLRQ EXW WKHUH KDV EHHQ QR FRQVLVWHQF\ 7KH UHVXOWV RI WUDQVLHQW DVVD\V RI S)%6 DQG ZHUH LQFRQVLVWHQW GXH WR TXDQWLWDWLRQ SUREOHPV ZLWK WKH SODVPLG '1$V WKDW ZHUH QRW GLVFRYHUHG XQWLO DIWHU WKH FRPSOHWLRQ RI WKH DQDO\VLV (YHQ ZLWK WKHVH SUREOHPV WKH UHVXOWV RI WKH WUDQVLHQW DVVD\V VXSSRUWHG WKH LGHD WKDW S) DQG S)%6 ZHUH WKH VDPH ZLWK UHVSHFW WR WKH OHYHO RI H[SUHVVLRQ GDWD QRW VKRZQf (YHQ WKRXJK PRUH '1$ ZDV DGGHG LQ WKH WUDQVIHFWLRQ WKDQ RULJLQDOO\ WKRXJKW ZH ZHUH DEOH WR FRQFOXGH WKDW ESf ZDV QRW VLJQLILFDQWO\ GLIIHUHQW WKDQ S)%6 RU S) 8QIRUWXQDWHO\ ZH ZHUH QRW DEOH WR PDNH DQ\ FRQFOXVLRQV DERXW WKH FRQVWUXFW IURP WKH WUDQVLHQW DVVD\V :H FDQ RQO\ VD\ WKDW LQ VWDEOH FHOO OLQHV LW ZDV H[SUHVVHG DW D ORZ OHYHO LQ WKH VLQJOH PRQRFORQH RI WKDW ZDV SRVLWLYH 7KH UHVXOWV VXSSRUW WKH FRQWHQWLRQ WKDW UHPRYDO RI ES f IURP S) KDV OLWWOH HIIHFW RQ WKH OHYHO RI H[SUHVVLRQ 7KH WUDQVFULSWLRQDO DQDO\VLV RI WKHVH GHOHWLRQV KDV EHHQ UHSHDWHG E\ .HQ :ULJKW ZLWK +H/D QXFOHDU H[WUDFWV LQ YLWUR +H KDV UHDFKHG VLPLODU UHVXOWV WR WKRVH SUHVHQWHG KHUH SHUVRQDO FRPPXQLFDWLRQf (QKDQFHU (OHPHQW 'U 6KHUURQ +HOPV RI RXU ODERUDWRU\ KDG SUHYLRXVO\ LGHQWLILHG WKH GLVWDO (FR5,(FR5, IUDJPHQW WR NEf GHVLJQDWHG S) RI WKH $ ++* FORQH DV D SRVVLEOH HQKDQFHU HOHPHQW +HOPV HW DO f

PAGE 140

0+& )LJXUH 6, QXFOHDVH DQDO\VLV RI S) PRQRFORQDO FHOO OLQHV 6L QXFOHDVH DVVD\V ZHUH SHUIRUPHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH QXPEHU RI HDFK FORQH LV GLVSOD\HG DERYH WKH ODQH DQG EHORZ WKH FRQVWUXFW GHVLJQDWLRQ OLQH 0 S%5 GLJHVWHG ZLWK +SDOO DQG ODEHOOHG ZLWK DA3G&73 DQG .OHQRZ IUDJPHQW + +H/D WRWDO FHOOXODU 51$ & & WRWDO FHOOXODU 51$ %RWK KXPDQ QWf DQG PRXVH QWf + SURWHFWHG IUDJPHQWV DUH GHVLJQDWHG 3HUWLQHQW PDUNHUV DUH QRWHG

PAGE 141

)LJXUH 6, QXFOHDVH DQDO\VLV RI S)5 PRQRFORQDO FHOO OLQHV 6, QXFOHDVH DVVD\V ZHUH SHUIRUPHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 0 S%5 '1$ GLJHVWHG ZLWK +SDOO DQG ODEHOOHG DA3G&73 DQG .OHQRZ IUDJPHQW + +H/D WRWDO FHOOXODU 51$ & & WRWDO FHOOXODU 51$ &ORQH QXPEHUV f DUH GHVLJQDWHG DERYH HDFK ODQH %RWK KXPDQ DQG PRXVH + SURWHFWHG IUDJPHQWV DUH QRWHG DW WKH ULJKW

PAGE 142

)LJXUH &RS\ QXPEHU DQDO\VLV RI S) PRQRFORQDO FHOO OLQHV 6RXWKHUQ EORW DQDO\VLV ZDV SHUIRUPHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV [J RI '1$ IURP HDFK FHOO OLQH ZHUH DQDO\]HG ZLWK QLFN WUDQVODWHG (FR5,;EDO IUDJPHQW IURP S) $ S) FHOO OLQH '1$ SUREHG ZLWK + VHTXHQFHV % 7KH KLVWRQH SUREH ZDV UHPRYHG DQG WKH EORW ZDV UHSUREHG ZLWK WKH PRXVH 6 ULERVRPDO IUDJPHQW 'HQVLWRPHWU\ RI WKH ES EDQG VSHFLILHG E\ WKH DUURZ LQ $ DQG WKH 6 ULERVRPDO EDQG LQ % SHUPLWWHG TXDQWLWDWLRQ RI WKH FRS\ QXPEHU WKURXJK QRUPDOL]DWLRQ WR WKH DPRXQW RI '1$ DFWXDOO\ ORDGHG DQG WUDQVIHUUHG DV GHVFULEHG LQ WKH 0DWHULDOV DQG 0HWKRGV 7KH ILJXUH LQ $ LV D FRPSRVLWH RI VHYHUDO H[SRVXUHV WKDW UHIOHFWV WKH DFWXDO FRS\ QXPEHU DQG DFFRXQWV IRU RULJLQDO TXDQWLWDWLRQ HUURUV 7KH SODVPLG FRQWUROV IRU TXDQWLWDWLRQ DUH ODEHOOHG DQG GHVLJQDWLQJ WKH QXPEHU RI SJ ORDGHG & & FHOOXODU '1$ + +H/D FHOOXODU '1$ 0 $ '1$ GLJHVWHG ZLWK (FR5, DQG +LQG ,,, DQG ODEHOOHG DAA3G&73 DQG .OHQRZ IUDJPHQW &ORQHV DUH GHVLJQDWHG ZLWK WKHLU QXPEHU DERYH HDFK ODQH 1RQHVVHQWLDO ODQHV LQ % KDYH EHHQ RPLWWHG

PAGE 143

$ % 0O & +

PAGE 144

6KH GHPRQVWUDWHG WKDW OLQNDJH RI WKLV IUDJPHQW WR WKH n HQG RI WKH &$7 JHQH LQ S69,&$7 *RUPDQ HW DO f LQFUHDVHG WKH H[SUHVVLRQ RI WKH &$7 JHQH WR WLPHV LQ WUDQVLHQWO\ WUDQVIHFWHG +H/D FHOOV (QKDQFHUV FDQ EH ORFDWHG DW FRQVLGHUDEOH GLVWDQFHV IURP WKH JHQH WKDW WKH\ HIIHFW 7KH FKLFNHQ O\VR]\PH JHQH HQKDQFHU LV ORFDWHG NE XSVWUHDP RI WKH JHQH 7KHLVHQ HW DO f 7R LQYHVWLJDWH WKLV UHVXOW IXUWKHU D VHULHV RI FRQVWUXFWV ZHUH PDGH DQG DVVD\HG LQ VWDEOH FHOO OLQHV 7KH FRQVWUXFWV S) S)5 DQG S) DUH GHSLFWHG VFKHPDWLFDOO\ LQ )LJXUH DQG ZHUH FRQVWUXFWHG E\ VWDQGDUG FORQLQJ SURFHGXUHV S) IXVHG WKH S) IUDJPHQW WR WKH S)3 FRQVWUXFW LQ WKH JHQRPLF RULHQWDWLRQ 7KH FRQVWUXFW S)5 ZDV PDGH WR UHYHUVH WKH RULHQWDWLRQ DQG S) OLQNHG WKH ES (FR5,;EDO IUDJPHQW RI S) WR S); 7KH FRQVWUXFWV ZHUH WUDQVIHFWHG LQWR PRXVH & FHOOV DQG VHOHFWHG IRU WKH JURZWK RI PRQRFORQDO FHOO OLQHV 7KH 6, QXFOHDVH DQDO\VLV RI S) S)5 S) DQG WKH FRQWURO FHOO OLQH S); DUH SUHVHQWHG LQ )LJXUHV DQG UHVSHFWLYHO\ 7KH H[SUHVVLRQ GDWD DUH SUHVHQWHG LQ 7DEOH 7KH RQO\ FHOO OLQHV ZLWK VLJQLILFDQWO\ KLJKHU OHYHOV RI H[SUHVVLRQ WKDQ S); FRQWDLQHG WKH S) FRQVWUXFW 7R GHWHUPLQH LI WKLV ZDV WUXO\ WKH UHVXOW RI DQ HQKDQFHPHQW RU D SKHQRPHQRQ RI FRS\ QXPEHU WKH ODWWHU ZDV GHWHUPLQHG E\ 6RXWKHUQ EORW DQDO\VLV )LJXUH f DV GHVFULEHG SUHYLRXVO\ LQ 0DWHULDOV DQG 0HWKRGV :KHQ WKH S) FHOO OLQH FRS\ QXPEHUV ZHUH LQFOXGHG LQ WKH H[SUHVVLRQFRS\ UDWLR WKH OHYHO RI H[SUHVVLRQ GURSSHG WR FRQWURO S);f OHYHO 6LQFH QHLWKHU S)5 QRU S) KDG D VLJQLILFDQW GLIIHUHQFH LQ H[SUHVVLRQ IURP S)2O; WKH FRS\ QXPEHU IRU WKHVH FHOO

PAGE 145

OLQHV ZDV QRW GHWHUPLQHG H[FHSW IRU S)P 7KLV FHOO OLQH SUHVHQWHG WKH XQXVXDO PRXVH 6, QXFOHDVH SURWHFWHG IUDJPHQW VHHQ ZLWK WKH S)%6 FHOO OLQHV DQG WKHUHIRUH KDG KLJK H[SUHVVLRQ 7KH FRS\ QXPEHU ZDV GHWHUPLQHG WR H[FOXGH WKH SRVVLELOLW\ WKDW WKLV ZDV DQ HQKDQFHU HIIHFW S)P ZDV LQFOXGHG RQ WKH S); FRS\ QXPEHU EORW )LJXUH f DQG IURP WKLV EORW LW ZDV GHWHUPLQHG WKDW S)P KDV DSSUR[LPDWHO\ LQWHJUDWHG FRSLHV ZKLFK DFFRXQWHG IRU WKH KLJKHU OHYHO RI H[SUHVVLRQ 7KH ODFN RI DQ HQKDQFHU HIIHFW E\ S)OO ZDV VXUSULVLQJ LQ OLJKW RI WKH SUHYLRXV GHPRQVWUDWLRQ RI WKH HIIHFWV RQ &$7 JHQH H[SUHVVLRQ 7KH VHTXHQFH IRU WKH HQWLUH S) IUDJPHQW ZDV GHWHUPLQHG E\ .HQ :ULJKW DQG 8UV 3DXOL RI RXU ODERUDWRU\ DQG WKH SUR[LPDO (FR5,;EDO IUDJPHQW FRQWDLQV WKUHH VHTXHQFHV ZLWK VLPLODULW\ WR WKH FRQVHQVXV FRUH HQKDQFHU HOHPHQW n7*7**$$$nf DV GHVFULEHG IRU WKH ,J KHDY\ FKDLQ DQG 69 HQKDQFHUV :DV\O\N DQG :DV\O\N .KRXU\ DQG *UXVV f 7KH SUHVHQFH RI WKLV VHTXHQFH KDV EHHQ VKRZQ QRW WR EH VROHO\ VXIILFLHQW RU QHFHVVDU\ IRU HQKDQFHU DFWLYLW\ LQ WKH ,J+ HQKDQFHU :DV\O\N DQG :DV\O\N .DGHVK HW DO f 7KH UHDVRQV IRU D ODFN RI DFWLYLW\ LQ PRXVH & FHOOV DQG DFWLYLW\ LQ +H/D FHOOV LV SXUHO\ VSHFXODWLYH &HUWDLQO\ GLIIHUHQFHV LQ WKH SURWHLQV WKDW LQWHUDFW ZLWK HQKDQFHUV LQ GLIIHUHQW WLVVXH W\SHV KDYH EHHQ GRFXPHQWHG 0DQLDWLV HW DO 'DYLGVRQ HW DO f 7KH HYLGHQFH IURP WKH VWDEOH FHOO OLQHV ZH KDYH SUHSDUHG GRHV QRW VXSSRUW WKH LGHD WKDW WKH S) IUDJPHQW HQKDQFHV RU DXJPHQWV WKH H[SUHVVLRQ RI WKH ) + KLVWRQH JHQH ZKHQ VWDEO\ LQWHJUDWHG LQ D PRXVH FHOO 7KH IDFW WKDW WKH S) PRQRFORQDO FHOO OLQHV KDG VXFK D KLJK DYHUDJH FRS\ QXPEHU KDV EHHQ

PAGE 146

LQYHVWLJDWHG IXUWKHU LQ &KDSWHU ZLWK UHVSHFW WR VSHFLILFLW\ DQG PRGH RI LQWHJUDWLRQ .HQ :ULJKW RI RXU ODERUDWRU\ KDV DOVR GHPRQVWUDWHG WKDW WKH S) IUDJPHQW LV XQDEOH WR HQKDQFH WKH WUDQVFULSWLRQ LQ YLWUR RI WKH KXPDQ + JHQH SHUVRQDO FRPPXQLFDWLRQf 7KH FRQWULEXWLRQ RI SURPRWHU VHTXHQFHV WR WKH H[SUHVVLRQ RI WKH ) + KLVWRQH JHQH KDV EHHQ GHWHUPLQHG LQ VWDEOH FHOO OLQHV ,QLWLDOO\ WKLV DSSURDFK DSSHDUHG WR EH WKH PRVW DFFXUDWH ZD\ WR GHWHUPLQH IXQFWLRQDOLW\ KRZHYHU LQ UHWURVSHFW WKHUH DUH D QXPEHU RI YDULDEOHV ZKLFK FDQ QRW EH DFFRXQWHG IRU $ EULHI FRPSDULVRQ RI WKH UHVXOWV IURP WKH WUDQVLHQW DVVD\V GRQH WR DVVHVV WKH QHJDWLYH UHJXODWRU\ HOHPHQW K\SRWKHVLV LQGLFDWHV WKH KHWHURJHQHLW\ WKDW FDQ RFFXU LQ WKH UHVXOWV DQG WKHLU LQWHUSUHWDWLRQ DV D UHVXOW RI WKH PHWKRGRORJ\ XWLOL]HG WR SHUIRUP WKH H[SHULPHQW :H RULJLQDOO\ WKRXJKW WKDW WKH PRXVH + 6, QXFOHDVH SUREH ZRXOG EH WKH LGHDO LQWHUQDO FRQWURO EXW VXEVHTXHQWO\ ZH KDYH UHDOL]HG WKDW LW KDV IDXOWV IRU ZKLFK ZH FDQQRW FRUUHFW LQ RXU LQWHUSUHWDWLRQ RI WKH UHVXOWV 7KH SRVVLELOLW\ H[LVWV WKDW OLPLWLQJ WUDQVFULSWLRQ IDFWRUV DUH SUHVHQW LQ RQO\ VXIILFLHQW DPRXQWV WR WUDQVFULEH WKH PRXVH + JHQHV SUHVHQW LQ WKH FHOO 7KH LQWURGXFWLRQ RI WKH KXPDQ + JHQHV LQWR WKH JHQRPH RI WKH PRXVH FHOO OLNHO\ GLVWXUEV WKLV HTXLOLEULXP 7KH SRVVLELOLWLHV IRU PLVLQWHUSUHWDWLRQ DUH FRQVLGHUDEOH ,I DW ORZ FRS\ QXPEHU WKH KXPDQ + JHQHV GR QRW HIIHFWLYHO\ FRPSHWH IRU PRXVH WUDQVFULSWLRQ IDFWRUV WKHQ ZH KDYH SUREDEO\ XQGHUHVWLPDWHG WKHLU UHODWLYH H[SUHVVLRQ $W KLJK FRS\ QXPEHU LW LV TXLWH DSSDUHQW WKDW WKH H[SUHVVLRQFRS\ UDWLR GHFUHDVHV %DVHG RQ ZKDW ZH KDYH SUHVHQWHG KHUH DQG ODWHU LQ &KDSWHU ZH ZLOO IRUPDOO\ DVVHVV WKH UHVXOWV RI WKH WUDQVFULSWLRQ GDWD LQ

PAGE 147

&KDSWHU ZLWK UHVSHFW WR WKH ORZ FRS\ QXPEHU FHOO OLQHV RQO\ $OWKRXJK WKLV OLPLWHG P\ GDWD EDVH LW DSSHDUHG WR EH WKH RQO\ UHDVRQDEOH ZD\ WR SURFHHG LQ RUGHU WR IDLUO\ HYDOXDWH WKH GDWD ZH KDYH FROOHFWHG 1XFOHDU UXQRQ DQDO\VLV RI + WUDQVFULSWLRQ 7KLV VHFWLRQ RI WKH UHVXOWV LV DGGHG SXUHO\ DV D QRWH WR WKRVH ZKR PLJKW WU\ VLPLODU H[SHULPHQWV DV GHVFULEHG EHORZ 1RQH RI WKH H[SHULPHQWV ZH KDYH GHVFULEHG DERYH GLUHFWO\ DVVHVV WKH OHYHO RI WUDQVFULSWLRQ 'LIIHUHQFHV LQ WKH n UHJLRQ RI WKH SURPRWHU ZHUH DVVD\HG LQ ORJ SKDVH FHOOV XQGHU WKH DVVXPSWLRQ WKDW WKH P51$ ZDV WKH VDPH IRU DOO FRQVWUXFWV WKHUHIRUH DQ\ GLIIHUHQFHV LQ WKH OHYHO RI P51$ ZHUH D UHIOHFWLRQ RI WUDQVFULSWLRQ 7KLV LQWHUSUHWDWLRQ LV ILQH DQG KROGV XS UHDVRQDEO\ ZHOO ZKHQ GHOHWLRQ FRQVWUXFWV DUH FRPSDUHG WR RQH DQRWKHU +RZHYHU WR H[DPLQH WUDQVFULSWLRQ GLUHFWO\ LW LV QHFHVVDU\ WR HOLPLQDWH WKH P51$ VWDELOLW\ YDULDEOH LQ KLVWRQH JHQH PHWDEROLVP 2XU ODERUDWRU\ KDV XWLOL]HG QXFOHDU UXQRQ WUDQVFULSWLRQ WR LGHQWLI\ WKH WLPH DQG H[WHQW RI KXPDQ KLVWRQH JHQH WUDQVFULSWLRQ GXULQJ WKH FHOO F\FOH %DXPEDFK HW DO f :H IHOW WKDW RXU PRQRFORQDO FHOO OLQHV ZRXOG EH LGHDO FDQGLGDWHV IRU VXFK DQ DQDO\VLV DQG WKDW ZH FRXOG GHWHUPLQH WKH UHJLRQ RI WKH SURPRWHU UHVSRQVLEOH IRU WKH IROG LQFUHDVH LQ WKH OHYHO RI WUDQVFULSWLRQ GXULQJ 6SKDVH RI WKH FHOO F\FOH %ULHIO\ QXFOHL ZHUH LVRODWHG IURP WKH FHOOV DW r& DQG WUDQVFULSWLRQ DOORZHG WR FRQWLQXH LQ WKH SUHVHQFH RI D AS873 IRU PLQXWHV 7KH ODEHOOHG 51$ ZDV SXULILHG DQG XVHG WR SUREH EORWV WKDW KDG SODVPLG '1$V LPPRELOL]HG H[FHVV '1$ K\EULGL]DWLRQf ,Q VKRUW UHJDUGOHVV RI WKH WHPSHUDWXUH VDOW FRQFHQWUDWLRQ RU DTXHRXV VWDWH RI

PAGE 148

WKH K\EULGL]DWLRQ UHDFWLRQ ZH ZHUH DEOH WR REVHUYH RQO\ PRXVH + P51$ FURVV K\EULGL]DWLRQ WR WKH KXPDQ + SODVPLG '1$ GDWD QRW VKRZQf $Q DOWHUQDWLYH DSSURDFK WR WKH GHWHFWLRQ SUREOHP ZDV WULHG ZKDW ZH FDOOHG D UHYHUVH 6L DQDO\VLV 7KH ODEHOOHG QXFOHDU UXQRQ WUDQVFULSWV ZHUH LQFXEDWHG ZLWK FROG SUREH 51$ PDGH IURP WKH 7 SURPRWHU RI D %OXHVFULSW FORQH RI S) 7KLV ZDV WKHQ GLJHVWHG ZLWK 6, QXFOHDVH HOHFWURSKRUHVHG DQG YLVXDOL]HG DV XVXDO $V D FRQWURO WKH SUREH S) 51$ ZDV ODEHOOHG ZLWK TAA3873 DQG K\EULGL]HG WR +H/D WRWDO FHOOXODU 51$ 7KH FRQWURO ZRUNHG ZHOO EXW WKH WHVW UHDFWLRQ ZDV RQO\ D VPHDU GDWD QRW VKRZQf 7KLV UHVXOW KDG SUHYLRXVO\ EHHQ SUHGLFWHG E\ P\ RXWVLGH H[DPLQHU 'U%DUEDUD 6ROOQHU:HEE 6KH IHOW WKDW WKH WHFKQLTXH ZRXOG QRW ZRUN EHFDXVH RI VWDEOH GRXEOH VWUDQGHG ULERVRPDO 51$ WKDW ZRXOG EH ODEHOOHG DQG REVFXUH WKH KLVWRQH VLJQDO :H GHFLGHG WKDW XQIRUWXQDWHO\ WKLV DSSURDFK ZDV QRW SRVVLEOH LQ RXU V\VWHP

PAGE 149

&+$37(5 3/$60,' ,17(*5$7,21 6,7(6 ,17(*5,7< $1' 3527(,1'1$ ,17(5$&7,216 2QH JRDO RI PRGHUQ PROHFXODU ELRORJ\ LV WR XQGHUVWDQG WKH PROHFXODU HYHQWV WKDW RFFXU GXULQJ WKH LQWHJUDWLRQ RI H[RJHQRXV '1$ LQWR WKH FKURPRVRPH RI D FHOO 7KHVH SURFHVVHV KDYH EHHQ H[DPLQHG LQ GHWDLO E\ VHYHUDO LQYHVWLJDWRUV DQG DUH LPSRUWDQW IRU WKH VWXG\ RI ELRORJLFDO SUREOHPV LQ HXNDU\RWLF FHOOV /R\WHU HW DO 3HUXFKR HW DO )ROJHU HW DO /LQ DQG 6WHUQEHUJ f 7KH SUREOHP RI ZKDW KDSSHQV WR WKH '1$ PROHFXOHV RQFH WKH\ HQWHU WKH FHOO LV LQWULJXLQJ DV LW JLYHV D JOLPSVH RI WKH FRPSOLFDWHG UHFRPELQDWLRQDO SURFHVVHV WKDW RFFXU LQVLGH WKH FHOO /R\WHU HW DO f GHPRQVWUDWHG WKDW WKHUH ZDV D OLPLW WR WKH DPRXQW RI '1$ D SODWH RI FHOOV FRXOG WDNH XS DQG WKDW RQO\ D VPDOO SHUFHQWDJH RI WKH '1$ WKDW HQWHUHG WKH F\WRSODVP VXEVHTXHQWO\ HQWHUHG WKH QXFOHXV 3UHYLRXV ZRUN E\ 3HUXFKR HW DO f GHPRQVWUDWHG WKDW DV IRUHLJQ '1$ HJ SODVPLG '1$ ZLWK D JHQH RI LQWHUHVWf HQWHUHG WKH QXFOHXV RI D FHOO LW EHFDPH UHFRPELQDWLRQDOO\ DFWLYH %HFDXVH WKHUH LV XVXDOO\ OLWWOH RU QR KRPRORJ\ EHWZHHQ WKH IRUHLJQ '1$ DQG WKH FHOOXODU '1$ WKH ILUVW UHFRPELQDWLRQ HYHQWV WKDW RFFXU DUH EHWZHHQ WKH SODVPLG '1$ PROHFXOHV DQG FDUULHU '1$ &RLQWHJUDWHV IRUP LQ WKH QXFOHXV VKRUWO\ DIWHU WKH LQWURGXFWLRQ RI WKH '1$ LQWR WKH FHOOV 7KHVH YHU\ ODUJH FLUFXODU PROHFXOHV FRQWDLQ PDQ\ SODVPLG PROHFXOHV DUUDQJHG LQ D KHDGWRWDLO

PAGE 150

PDQQHU :KHQ LQWHJUDWLRQ LQWR WKH KRVW FKURPRVRPH GRHV RFFXU D ODUJH QXPEHU RI SODVPLG PROHFXOHV DUH OLNHO\ WR LQWHJUDWH VWDEO\ LQ D KHDG WRWDLO IDVKLRQ DW D VLQJOH ORFDWLRQ 3HUXFKR HW DO f )RU P\ SXUSRVHV LW ZDV QHFHVVDU\ WR DVVHVV WKH LQWHJULW\ RI WKH LQWHJUDWHG KLVWRQH GHOHWLRQ FRQVWUXFWV WKH VWUXFWXUDO UHODWLRQVKLS WR WKH FRWUDQVIHFWHG SODVPLG S69QHR DQG WKH PRGH RI LQWHJUDWLRQ ,QWHJULW\ RI )ODQNLQJ 6HTXHQFHV 7R DVVHVV WKH LQWDFWQHVV RI WKH SUR[LPDO IODQNLQJ VHTXHQFHV ZH H[DPLQHG WKH FRS\ QXPEHU EORWV RI WKH FRQVWUXFWV ZLWK ES RU OHVV R n IODQNLQJ VHTXHQFH ,Q WKH FRQVWUXFWV ESf ESf ESf ESf / ESf DQG S)$ ESf )LJXUHV f WKH (FR5,;EDO IUDJPHQW UHSUHVHQWV WKH HQWLUH FRGLQJ DQG n IODQNLQJ VHTXHQFHV 7KH (FR5,;EDO GLJHVW ZDV RULJLQDOO\ FKRVHQ EHFDXVH LW LV D IUDJPHQW FRPPRQ WR DOO WKH FRQVWUXFWV XVHG LQ WKH VWXG\ ,W ZDV HDVLO\ GHWHUPLQHG E\ LQVSHFWLRQ RI WKHVH 6RXWKHUQ EORWV WKDW DOO RU QHDUO\ DOO RI WKH + FRQVWUXFWV ZHUH LQWHJUDWHG LQ D PDQQHU WKDW SHUPLWWHG GHWHFWLRQ RI WKH KXPDQ + LQVHUW VHTXHQFHV RI WKH RULJLQDO SODVPLG 7KH LQWHJULW\ RI ORQJHU FRQVWUXFWV VXFK DV S) DQG S) ZDV QRW PHDVXUDEOH WKLV ZD\ 7R DVVHVV WKH LQWHJULW\ RI WKH S) IODQNLQJ VHTXHQFHV WKH JHQRPLF '1$ IURP D SRO\FORQDO FHOO OLQH S)S ZDV GLJHVWHG ZLWK ;EDO 7KLV GLJHVWLRQ GHILQHV WKH HQWLUH NE LQVHUW 7KH UHVWULFWHG '1$ ZDV HOHFWURSKRUHVHG RQ D b DJDURVH JHO EORWWHG DQG SUREHG ZLWK WKH (FR5,;EDO IUDJPHQW IURP S) 7KH UHVXOWV SUHVHQWHG LQ )LJXUH OD ODQH GHPRQVWUDWH WKH SUHGRPLQDQFH RI D NE EDQG WKDW FRUUHVSRQGV WR WKH SUHVHQFH RI WKH HQWLUH S) LQVHUW *HQRPLF '1$

PAGE 151

$ % )LJXUH 6RXWKHUQ %ORW DQDO\VLV RI JHQRPLF '1$ IURP SRO\FORQDO FHOO OLQHV DVVHVVPHQW RI IODQNLQJ DQG FRGLQJ VHTXHQFH LQWHJULW\ LQ S) DQG S) 7HQ PLFURJUDPV RI JHQRPLF '1$ IURP SRO\FORQDO FHOO OLQHV S)S DQG S)S ZHUH GLJHVWHG ZLWK HLWKHU ;KRO RU ;EDO HOHFWURSKRUHVHG EORWWHG DQG SUREHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV $ /DQH $ '1$ GLJHVWHG ZLWK +LQGOOO DQG ODEHOOHG ZLWK DA3G&73 DQG .OHQRZ IUDJPHQW /DQH ;KRO GLJHVWHG S)S '1$ /DQH ;KRO GLJHVWHG S)S '1$ /DQH ;EDO GLJHVWHG S)S '1$ /DQH ;EDO GLJHVWHG S)S '1$ 7KH EORW ZDV SUREHG ZLWK WKH KLVWRQH + (FR5,;EDO IUDJPHQW SXULILHG IURP S) DQG QLFN WUDQVODWHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV ,Q ODQHV DQG WKH H[SHFWHG VL]H IUDJPHQWV DUH QRWHG ZLWK DUURZV DW WKH ULJKW % /DQHV DUH WKH VDPH DV LQ $ /DQH $ '1$ GLJHVWHG ZLWK +LQGOOO DQG ODEHOOHG ZLWK DA3G&73 DQG .OHQRZ IUDJPHQW 7KH EORW LQ % ZDV SUREHG ZLWK QLFN WUDQVODWHG S8& '1$ 7KH NE EDQG LQ ODQH S)Sf LV OLQHDU S8&

PAGE 152

IURP D SRO\FORQDO FHOO OLQH RI S) ZDV GLJHVWHG ZLWK ;EDO DQG LW ZDV HVWDEOLVKHG WKDW D ODUJH SHUFHQWDJH RI WKH NE ;EDO;EDO IUDJPHQW WKDW LQFOXGHV WKH FRGLQJ UHJLRQ DQG PXFK RI WKH IODQNLQJ VHTXHQFHV ZDV GHWHFWDEOH DV DQ LQWDFW IUDJPHQW )LJXUH OD ODQH f 7R GHWHUPLQH WKDW WKH '1$ ZDV LQGHHG LQWHJUDWHG ZH GLJHVWHG ERWK S)S DQG S)S ZLWK ;KRO DQ HQ]\PH WKDW KDV QR VLWHV ZLWKLQ HLWKHU SODVPLG )LJXUH ODQHV DQG GHPRQVWUDWH WKDW ZKHQ WKH '1$ LV GLJHVWHG ZLWK ;KRO DOPRVW DOO RI WKH K\EULGL]DWLRQ WR WKH KXPDQ KLVWRQH SUREH LV LQ WKH UHJLRQ RI WKH EORW WKDW FRUUHVSRQGV WR YHU\ KLJK PROHFXODU ZHLJKW '1$ (YLGHQFH IRU WDQGHP LQWHJUDWLRQ ZDV IRXQG ZKHQ WKH EORW LQ OD ZDV UHSUREHG ZLWK S8& '1$ ,Q )LJXUH OE ODQHV DQG VWLOO GHPRQVWUDWH KLJK PROHFXODU ZHLJKW '1$ DV H[SHFWHG /DQH KDV D SUHGRPLQDQW NE EDQG WKDW LV SUREDEO\ S8& 7KH IDFW WKDW ERWK WKH S) LQVHUW NEf DQG YHFWRU NEf EDQGV ZHUH VR UHDGLO\ GHWHFWDEOH ZDV LQGLFDWLYH RI WDQGHP LQWHJUDWLRQ 8QH[SHFWHGO\ WKH S)S '1$ GLG QRW KDYH D VLPLODU NE EDQG ,QVWHDG WKHUH ZDV D KHWHURJHQHRXV SDWWHUQ RI K\EULGL]DWLRQ WR WKH S8& '1$ REVHUYHG LQ )LJXUH OE ODQH 7KHVH H[SHULPHQWV ZHUH SXUVXHG IXUWKHU WR HVWDEOLVK WKH PRGH RI LQWHJUDWLRQ WKDW KDG RFFXUUHG LQ WKH PRQRFORQDO FHOO OLQHV 7KLV LQIRUPDWLRQ ZRXOG DOORZ RQH SHUKDSV WR XQGHUVWDQG KRZ RU LI WKH DUUDQJHPHQW RI KLVWRQH LQVHUW VHTXHQFHV ZLWK UHVSHFW WR HDFK RWKHU DIIHFWV H[SUHVVLRQ 2XU FRQFHUQ KDV EHHQ KRZ WR LQWHUSUHW WKH FRS\ QXPEHU GDWD ZLWK UHVSHFW WR H[SUHVVLRQ 7KH SRVVLELOLWLHV DUH FRQVLGHUDEOH WKDW WDQGHP LQWHJUDWLRQ IRU H[DPSOH PLJKW SURWHFW LQWHUQDO LQWHJUDWHV IURP FKURPRVRPDO HIIHFWV LQ FLV ,V LW SRVVLEOH WR

PAGE 153

DVVXPH WKDW DOO WKH JHQHV LQWHJUDWHG LQ D FOXVWHU DUH JRLQJ WR IXQFWLRQ HTXDOO\ ZHOO" :KHQ SRO\FORQDO FHOO OLQH '1$ IURP $S ZDV GLJHVWHG ZLWK 3VW, DQG DQDO\]HG E\ 6RXWKHUQ EORWWLQJ LW ZDV HYLGHQW WKDW D VLQJOH EDQG RI NE ZDV SUHVHQW DQG FRUUHVSRQGHG WR IXOO OHQJWK SODVPLG '1$ GDWD QRW VKRZQf 7KHUHIRUH LQWHJUDWLRQ DSSHDUHG WR KDYH RFFXUUHG LQ D WDQGHP IDVKLRQ 7KH GHWHFWLRQ RI VXFK D KLJK SHUFHQWDJH RI WKH (FR5,;EDO IUDJPHQW LQ WKH FRS\ QXPEHU EORWV PHQWLRQHG DERYH DOVR GHPRQVWUDWHG WKDW WDQGHP LQWHJUDWLRQ ZDV SUREDEO\ WKH SDWKZD\ XWLOL]HG :H DQDO\]HG VHYHUDO RWKHU PRQRFORQDO FHOO OLQHV ZLWK GLIIHUHQW UHVWULFWLRQ HQ]\PHV DQG 6RXWKHUQ EORW DQDO\VLV WR HVWDEOLVK WKDW WDQGHP LQWHJUDWLRQ ZDV D JHQHUDO SKHQRPHQRQ ,Q )LJXUH ODQHV DQG GHPRQVWUDWH WKDW ZKHQ JHQRPLF '1$ IURP WKH PRQRFORQDO FHOO OLQH S)PO ZDV GLJHVWHG ZLWK 3VW, D SUHGRPLQDQW NE EDQG ZDV GHWHFWHG IROORZLQJ K\EULGL]DWLRQ ZLWK DQ ROLJRODEHOOHG n QRQFRGLQJ ;EDO+LQF,, IUDJPHQW RI S) /DQH LV MXVW D OLJKWHU H[SRVXUH RI ODQH :H FRQFOXGHG WKDW WDQGHP LQWHJUDWLRQ ZDV DSSDUHQWO\ WKH PHFKDQLVP XVHG E\ PRVW FRQVWUXFWV 7KLV KXPDQ + KLVWRQH JHQH n SUREH SHUPLWWHG GHWHFWLRQ RI RQO\ KXPDQ KLVWRQH VHTXHQFHV VLQFH LW FRQWDLQHG QR FRGLQJ UHJLRQ ,Q )LJXUH ODQH S)P JHQRPLF '1$ ZDV GLJHVWHG ZLWK %DP+, DJDLQ DQ HQ]\PH WKDW OLQHDUL]HV WKH FRQVWUXFW 7ZR EDQGV ZHUH GHWHFWHG ZLWK WKH KLVWRQH n SUREH OLQHDU S) NEf DQG D VOLJKWO\ KLJKHU EDQG WKDW ZDV QRW LGHQWLILHG 7KLV SRLQWHG WRZDUG WDQGHP LQWHJUDWLRQ DQG OLPLWHG KHWHURJHQHLW\ RI LQWHJUDWLRQ VLWHV 'LJHVWLRQ RI S)$PO2 JHQRPLF '1$ ZLWK %DP+, )LJXUH ODQH f GHPRQVWUDWHG PRUH KHWHURJHQHLW\ DOWKRXJK WKH FRUUHFW VL]H

PAGE 154

)LJXUH 6RXWKHUQ %ORW DQDO\VLV RI PRQRFORQDO FHOO OLQH LQWHJUDWLRQ SDWWHUQ DQG ORFDWLRQ RI S69QHR VHTXHQFHV 7KLV ILJXUH LV D FRPSRVLWH RI WKH VDPH EORW WKDW KDV EHHQ SUREHG ZLWK WZR GLIIHUHQW '1$ IUDJPHQWV 7KH EORW ZDV ILUVW SUREHG ZLWK D n IUDJPHQW IURP WKH ) + KLVWRQH JHQH DV GHVFULEHG LQ WKH WH[W DQG 0DWHULDO DQG 0HWKRGV 7KLV SUREH ZDV UHPRYHG DQG WKH EORW ZDV SUREHG IRU D VHFRQG WLPH ZLWK D IUDJPHQW WKDW FRQWDLQV WKH 69 HQKDQFHU 7KH FRPSOHPHQWDU\ ODQHV IURP HDFK DQDO\VLV KDYH EHHQ SODFHG QH[W WR HDFK RWKHU WR IDFLOLWDWH FRPSDULVRQ RI WKH GDWD /DQHV DQG ZHUH DOO SUREHG ZLWK WKH n KLVWRQH + IUDJPHQW /DQHV DQG ZHUH SUREHG ZLWK WKH 69 IUDJPHQW /DQHV $ '1$ GLJHVWHG ZLWK +LQGOOO(FR5, DQG .OHQRZ ODEHOOHG +H/D '1$ GLJHVWHG ZLWK ;EDO DQG D NE EDQG LV GHWHFWHG /DQHV DQG S)PO '1$ GLJHVWHG ZLWK 3VWO 7KH NE OLQHDU S) PROHFXOH LV GHQRWHG DW WKH OHIW LV D VKRUWHU H[SRVXUH RI ODQH f /DQH S)PO '1$ GLJHVWHG ZLWK 3VWO DQG WKH NE 3VWO S69QHR IUDJPHQW LV LQGLFDWHG DW WKH ULJKW E\ DQ DUURZ /DQHV DQG S)0OO '1$ GLJHVWHG ZLWK 3VW $ NE OLQHDU EDQG LV GHWHFWHG DQG LQGLFDWHG ODQH LV D VKRUWHU H[SRVXUH RI ODQH f /DQH S)POO '1$ GLJHVWHG ZLWK 3VWO 7KH NE 3VWO IUDJPHQW RI S69QHR LV GHQRWHG /DQHV DQG S)P '1$ GLJHVWHG ZLWK %DP+O ,Q ODQH D NE OLQHDU S) EDQG LV GHQRWHG ,Q ODQH WKH OLQHDU NE S69QHR EDQG LV LQGLFDWHG /DQHV DQG S)P '1$ GLJHVWHG ZLWK 3VWO ,Q ODQH D NE EDQG FRUUHVSRQGLQJ WR WKH HQWLUH S) LQVHUW LV GHWHFWHG ,Q ODQH WKH NE 3VWO IUDJPHQW RI S69QHR LV QRWHG /DQHV DQG S)2O$PO '1$ GLJHVWHG ZLWK %DP+O ,Q ODQH WKH NE EDQG RI OLQHDU S)$ LV QRWHG ,Q ODQH WKH NE S69QHR EDQG LV QRWHG /DQHV DQG S)$P GLJHVWHG ZLWK 3VWO ,Q ODQH WKH NE EDQG FRUUHVSRQGLQJ WR PRVW RI WKH S)$ LQVHUW LV GHWHFWHG ,Q ODQH D NE S69QHR EDQG LV GHWHFWHG DV H[SHFWHG

PAGE 156

OLQHDU IUDJPHQW ZDV GHWHFWDEOH NEf :KHQ S)POO DQG S)$PO2 '1$ ZHUH GLJHVWHG ZLWK 3VW, D IUDJPHQW RI WKH H[SHFWHG VL]H ZDV UHDGLO\ GHWHFWDEOH )LJXUH ODQHV DQG UHVSHFWLYHO\f 7KHVH UHVXOWV ZHUH FRQVLVWHQW ZLWK WDQGHP LQWHJUDWLRQ SHUKDSV LQ VHYHUDO ORFDWLRQV :H QRWLFHG HDUO\ LQ WKHVH VWXGLHV WKDW FHOO OLQHV WKDW FRQWDLQHG WKH FRQVWUXFW S) KDG D KHWHURJHQHRXV SDWWHUQ RI LQWHJUDWLRQ :KHQ S)POO JHQRPLF '1$ ZDV GLJHVWHG ZLWK 3VW, DQ HQ]\PH WKDW OLQHDUL]HV WKH FRQVWUXFW WKHUH ZHUH IHZHU OLQHDU PROHFXOHV NEf GHWHFWDEOH )LJXUH ODQHV DQG /DQH LV D OLJKWHU H[SRVXUH RI ODQH 7KLV LQFUHDVH LQ WKH KHWHURJHQHLW\ RI LQWHJUDWLRQ ZDV DVVRFLDWHG ZLWK WKH SUHVHQFH RI DQ $OX UHSHDW VHTXHQFH LQ WKH n IODQNLQJ UHJLRQ RI WKLV FRQVWUXFW :H H[DPLQHG WKH FRS\ QXPEHU GDWD DQG FDOFXODWHG WKH DYHUDJH FRS\ QXPEHU RI HDFK W\SH RI FHOO OLQH 7DEOH f DQG ZHUH DEOH WR FRUUHODWH WKH SUHVHQFH RI UHSHDWHG VHTXHQFHV ZLWK LQFUHDVHG DYHUDJH FRS\ QXPEHU 3UHYLRXV ZRUN RQ UHSHDWHG VHTXHQFHV DVVRFLDWHG ZLWK KLVWRQH JHQH FOXVWHUV &ROODUW HW DO f KDG GHPRQVWUDWHG WKH SUHVHQFH RI D VWURQJ $OX UHSHDW LQ WKH PRVW GLVWDO (FR5O;EDO IUDJPHQW WR NEf RI WKH SXWDWLYH + SURPRWHU VHTXHQFHV DQG WR D OHVVHU H[WHQW PLQRU UHSHDWHG VHTXHQFHV ORFDWHG EHWZHHQ WKH %DP+, VLWH NEf DQG WKH (FR5, VLWH DW NE 7KH IDFW WKDW WKH S)PO FHOO OLQH KDG D VLJQLILFDQW SURSRUWLRQ RI LWV '1$ WDQGHPO\ LQWHJUDWHG DV VKRZQ LQ )LJXUH ODQH VXJJHVWHG WKDW ZKLOH WKH PLQRU UHSHDWV ORFDWHG LQ LWV IODQNLQJ VHTXHQFH KDYH FRQWULEXWHG WR LQFUHDVHG FRS\ QXPEHU WKH\ KDYH QRW FDXVHG DV PXFK KHWHURJHQHLW\ LQ WKH LQWHJUDWLRQ VLWHV DV WKH $OX UHSHDW LQ S)

PAGE 157

$ % f§ f§ ;ED 3VW ;EDO 3VW )LJXUH 6SHFLILFLW\ RI S) LQWHJUDWLRQ 6RXWKHUQ EORW DQDO\VLV ZDV GRQH DFFRUGLQJ WR WKH SURFHGXUHV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV $ 6L[ S) FHOO OLQHV S)SO S)PO S)LQ S)PO2 3)POO DQG S)PO ZHUH GLJHVWHG ZLWK HLWKHU ;EDO ODQHV f RU 3VW, ODQHV f 7KH EORW ZDV SUREHG ZLWK ROLJR ODEHOOHG ;EDO+LQF,, IUDJPHQW RI S) DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH NE LQVHUW EDQG RI S) LV GHVLJQDWHG WR WKH OHIW RI WKH ILJXUH % 7KH KLVWRQH n SUREH ZDV UHPRYHG DQG WKH EORW ZDV UHSUREHG ZLWK ROLJRODEHOOHG ES 69 HQKDQFHU IUDJPHQW DV GHVFULEHG HDUOLHU 7KH ODQHV LQ % DUH LGHQWLFDO WR WKRVH LQ $ 7KH SRVLWLRQ RI PDUNHU IUDJPHQWV LV GHVLJQDWHG EHWZHHQ $ DQG % LQ NLOREDVHV 7KH UHVWULFWLRQ HQ]\PH GLJHVW LV LQGLFDWHG EHORZ HDFK ODQH

PAGE 158

7KH SUHYLRXV GHPRQVWUDWLRQ ZLWK WKH S)SO FHOO OLQH WKDW D VLJQLILFDQW SRUWLRQ RI WKH LQVHUW ZDV GHWHFWDEOH DQG LQWDFW )LJXUH ODQH f VXJJHVWHG WKDW WKHVH FRQWUDVWLQJ UHVXOWV PLJKW EH WKH FRQVHTXHQFH RI VSHFLILF LQWHJUDWLRQ 7R GHWHUPLQH ZKHWKHU WKH DELOLW\ WR GHWHFW WKH S) LQVHUW IUDJPHQW LQ JHQRPLF '1$ ZDV OLPLWHG WR WKH VLQJOH SRO\FORQDO FHOO OLQH ZH KDG H[DPLQHG ZH UHSHDWHG WKH H[SHULPHQW ZLWK WKH S)SO FHOO OLQH DQG PRQRFORQDO FHOO OLQHV &HOO OLQHV ZLWK UHDVRQDEO\ KLJK FRS\ QXPEHU ZHUH XWLOL]HG WR DLG GHWHFWLRQ DQG DVVHVV WKH HIIHFW RI LQWHJUDWLRQ RQ LQWDFWQHVV RI WKH IODQNLQJ VHTXHQFHV 7KH UHVXOWV SUHVHQWHG LQ )LJXUH D ODQHV GHPRQVWUDWH WKDW LQ HYHU\ FHOO OLQH WKH NE ;EDO;EDO IUDJPHQW ZDV GHWHFWDEOH DQG FRQVWLWXWHG D FRQVLGHUDEOH SRUWLRQ RI WKH VLJQDO SUHVHQW LQ HDFK ODQH ,I WKH VDPH S) PRQRFORQDO FHOO OLQH '1$V ZHUH GLJHVWHG ZLWK 3VW, DQG SUREHG IRU WKH SUHVHQFH RI OLQHDU S) PROHFXOHV )LJXUH D ODQHV f WKHUH ZDV KHWHURJHQHLW\ LQ LQWHJUDWLRQ DQG YHU\ OLWWOH OLQHDU NEf S) ZDV GHWHFWDEOH ,I VR PXFK RI WKH LQVHUW ;EDO;EDO IUDJPHQW ZDV GHWHFWDEOH DQG VR OLWWOH OLQHDU WKHUH PXVW KDYH EHHQ DQ XQXVXDO LQWHJUDWLRQ HYHQW WKDW RFFXUUHG WR JLYH ERWK UHVXOWV ,W DSSHDUHG D VWURQJ SRVVLELOLW\ WKDW WKH $OX VHTXHQFH LQ WKH n IODQNLQJ UHJLRQ ZDV D VLWH ZKHUH VSHFLILF LQWHJUDWLRQ PLJKW RFFXU 7R WHVW WKLV K\SRWKHVLV ZH GLJHVWHG WKUHH RI WKH S) PRQRFORQDO FHOO OLQH '1$V ZLWK 1FRO 7KLV HQ]\PH KDV WZR VLWHV RI GLJHVWLRQ RQH DW ES DQG RQH LQ WKH YHU\ GLVWDO ESV RI WKH n IODQNLQJ VHTXHQFH NE )LJXUH Ef 7KLV GLJHVW SURGXFHV WZR '1$ IUDJPHQWV RI NE DQG NE 7KH $OX VHTXHQFH LV ORFDWHG LQ WKH NE 1FRO IUDJPHQW ,W LV LPSRUWDQW WR UHFDOO WKDW

PAGE 159

$ % m ( ( ( V VVX R R R 0 ;EDO 3VW 1FRO )LJXUH 6RXWKHUQ EORW DQDO\VLV RI S) LQWHJUDWLRQ 1FRO GLJHVWLRQ RI JHQRPLF '1$ 7KH DQDO\VLV ZDV GRQH DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV $ J RI '1$ IURP PRQRFORQDO OLQHV S)P DQG ZHUH GLJHVWHG WR FRPSOHWLRQ ZLWK 1FRO 7KH EORW ZDV SUREHG ZLWK WKH (FR5,;EDO IUDJPHQW IURP S) 7KLV SUREH GHWHFWV ERWK WKH NE DQG NE EDQGV % 6\QRSVLV RI WKH K\EULGL]DWLRQ WR WKH (FR5,;EDO SUREH 7KLV ILJXUH SUHVXPHV WKDW WZR S) PROHFXOHV KDYH LQWHJUDWHG WDQGHPO\ KHDG WR WDLO WKURXJK RQH RI WKH $OX UHSHDWV S) ZKHQ GLJHVWHG ZLWK ;EDO SURGXFHV D KRPRJHQHRXV NE EDQG DQG FRSLHV DUH GHWHFWDEOH 'LJHVWLRQ ZLWK 3VW, SURGXFHV D VLQJOH GHWHFWDEOH OLQHDU PROHFXOH RI NE DQG LQ WKLV FDVH RQH HQG IUDJPHQW GHVLJQDWHG E\ WKH GRWWHG OLQH DQG WKH DUURZ 7KH GDWD IURP SDUW $ RI WKLV ILJXUH VXSSRUWV WKH IDFW WKDW NE DQG NE IUDJPHQW ZRXOG EH GHWHFWDEOH IURP WKLV GRXEOH LQWHJUDWH

PAGE 160

ZKHQ WKH S) PRQRFORQDO '1$V ZHUH GLJHVWHG ZLWK ;EDO XQLIRUPO\ D NE IUDJPHQW ZDV GHWHFWDEOH WKDW LQGLFDWHG WKDW WKH IODQNLQJ VHTXHQFHV XS WR ES ZHUH LQWDFW DQG LQWHJUDWLRQ KDG QRW RFFXUUHG EHWZHHQ WKH WZR ;EDO VLWHV 7KH RQO\ RWKHU UHJLRQV DYDLODEOH IRU LQWHJUDWLRQ ZHUH WKH ;EDO(FR5, IUDJPHQW WR ESf DQG WKH S8& YHFWRU VHTXHQFHV %HFDXVH DOO FRQVWUXFWV VKDUH VLPLODU YHFWRU VHTXHQFHV LW ZDV XQOLNHO\ WR EH WKLV UHJLRQ WKDW GLIIHUHQWLDWHG WKH S) FRQVWUXFW IURP RWKHUV LQ LQWHJUDWLYH PRGH 7KH S) 1FRO GLJHVWLRQ H[SHULPHQW ZDV SUREHG ZLWK WKH (FR5,;EDO IUDJPHQW RI S) ZKLFK GHWHFWV ERWK WKH DQG NE 1FRO IUDJPHQWV 7KH UHVXOWV RI WKH 1FRO GLJHVWLRQ 6RXWKHUQ EORW DUH SUHVHQWHG LQ )LJXUH D 6HYHUDO H[SRVXUHV ZHUH VFDQQHG GHQVLWRPHWULFDOO\ WR GHWHUPLQH WKH UDWLR RI NE WR NE IUDJPHQW ,Q WKH WKUHH FHOOV OLQHV WKH UDWLR RI WKH NE DQG NE 1FRO IUDJPHQWV ZDV DSSUR[LPDWHO\ 7R H[SODLQ WKLV DQG SUHYLRXV UHVXOWV RXU FXUUHQW K\SRWKHVLV LV WKDW WKH S) SODVPLG '1$ LQWHJUDWHG WKURXJK WKH $OX VHTXHQFH LQ QR PRUH WKDW WZR RU WKUHH FRSLHV SHU LQWHJUDWLRQ VLWH 7KLV K\SRWKHVLV H[SODLQV DV GLDJUDPPHG LQ )LJXUH E WKDW ZKHQ WZR FRSLHV RI S) DUH LQWHJUDWHG WKURXJK WKH $OX VHTXHQFH f WKH ;EDO;EDO IUDJPHQWV WKHUH DUH f DUH ERWK GHWHFWDEOH f RQO\ RQH RI WKH WZR LQWHJUDWHG FRQVWUXFWV LV GHWHFWDEOH ZKHQ WKH 3VW, GLJHVWLRQ LV GRQH DQG f WKH 1FRO GLJHVWLRQ SURGXFHV WZR NE DQG RQH NE IUDJPHQWV DV VHHQ H[SHULPHQWO\ )LJXUH Df $OWKRXJKQRW FRQFOXVLYH LW VXJJHVWV VRPH SUHIHUHQWLDO LQWHJUDWLRQ YLD WKH $OX VHTXHQFH 7KLV VSHFLILFLW\ RI LQWHJUDWLRQ WKURXJK WKH $OX UHSHDW DFFRXQWV IRU WKH KHWHURJHQHLW\ LQ LQWHJUDWLRQ VLWHV REVHUYHG 3UHYLRXVO\ LW ZDV WKRXJKW WKDW LQWHJUDWLRQ

PAGE 161

RI SODVPLG '1$ LQ D VLQJOH HXNDU\RWLF FHOO RFFXUUHG ILUVW DW WKH FRLQWHJUDWH VWDJH WKHQ DW D VLQJOH VLWH LQ WKH FKURPRVRPH 3HUXFKR HW DO f 7KLV LV SODXVLEOH EHFDXVH XVXDOO\ WKHUH LV UHODWLYHO\ OLWWOH KRPRORJ\ EHWZHHQ WKH WUDQVIHFWHG '1$ PROHFXOHV DQG WKH FHOOXODU '1$ +RZHYHU LW LV DSSDUHQW IURP RXU UHVXOWV WKDW UHSHDWHG VHTXHQFHV VXFK DV WKH $OX UHSHDW ZKLFK DUH ZHOO FRQVHUYHG IURP VSHFLHV WR VSHFLHV PD\ PHGLDWH VSHFLILF DQG KLJKHU OHYHOV RI LQWHJUDWLRQ WKDQ QRUPDOO\ SRVVLEOH /RFDWLRQ RI S69QHR 3ODVPLG 6HTXHQFHV 7KH VHFRQG SRLQW WR EH DGGUHVVHG LQ WKHVH H[SHULPHQWV ZDV ZKHWKHU WKH S69QHR SODVPLG ZDV ORFDWHG LQ WKH SUR[LPLW\ RI WKH KXPDQ KLVWRQH + JHQH FRQVWUXFWV ,Q RUGHU WR FUHDWH WKH FHOO OLQHV ZH KDYH XVHG LQ WKLV VWXG\ LW ZDV QHFHVVDU\ WR FRWUDQVIHFW ZLWK WKH SODVPLG S69QHR 2XU SULPDU\ FRQFHUQ ZDV WR HVWDEOLVK WR ZKDW H[WHQW WKH 69 HQKDQFHU PLJKW DVVRFLDWH ZLWK WKH KLVWRQH SURPRWHU GHOHWLRQ FRQVWUXFWV DQG DIIHFW WKH H[SUHVVLRQ RI WKH + FRQVWUXFWV LQ D FLV PDQQHU 6LQFH WKHUH LV VLPLODULW\ EHWZHHQ WKH S%5 SRUWLRQV RI WKHVH YDULRXV SODVPLGV ZH LQYHVWLJDWHG WKH SRVVLELOLW\ WKDW S69QHR DQG KLVWRQH GHOHWLRQ SODVPLGV ZHUH ORFDWHG DGMDFHQW WR HDFK RWKHU $Q HDUO\ REVHUYDWLRQ ZLWK UHJDUG WR WKLV SUREOHP ZDV WKDW FRQVWUXFWV VXFK DV DQG RWKHU VKRUW GHOHWLRQ FRQVWUXFWV RI WKH + SURPRWHU GHPRQVWUDWHG OLWWOH RU QR WUDQVFULSWLRQ ZKHQ LQWHJUDWHG VWDEO\ 7KLV UHVXOW SUREDEO\ PRUH WKDQ DQ\ RWKHU GHPRQVWUDWHG WKDW WKH S69QHR SODVPLG KDG OLWWOH RU QR LQIOXHQFH RQ H[SUHVVLRQ RI WKH FRWUDQVIHFWHG KLVWRQH SODVPLGV ,W ZDV UHDVRQDEOH WR VXSSRVH WKDW WKH LQWHJUDWLRQ RI WKH KXPDQ + KLVWRQH JHQHV RFFXUUHG DW D VXIILFLHQW

PAGE 162

GLVWDQFH IURP WKH LQIOXHQFH RI DQ\ HQGRJHQRXV VWURQJ SURPRWHU HIIHFWV ,W ZDV DOVR XQOLNHO\ WKDW WKH S69QHR FRWUDQVIHFWHG PROHFXOHV KDG DQ\ VXEVWDQWLDO HIIHFW RQ WKH H[SUHVVLRQ RI WKH WUDQVIHFWHG + KLVWRQH JHQHV 7R LQLWLDOO\ DGGUHVV WKH ORFDWLRQ ZLWK UHVSHFW WR KXPDQ KLVWRQH + VHTXHQFHV RI WKH S69QHR SODVPLG LQ WKH PRQRFORQDO FHOO OLQHV ZH UHSUREHG PRQRFORQDO FHOO OLQH 6RXWKHUQ EORWV VKRZQ LQ )LJXUH ZLWK DQ ROLJRODEHOOHG (FR5,(FR5, IUDJPHQW WKDW FRQWDLQHG WKH HQWLUH 69 HQKDQFHU VHTXHQFH $ S8& FORQH RI WKH ES (FR5,(FR5, IUDJPHQW ZDV NLQGO\ SURYLGHG WR PH E\ *HUDUG =DPEHWWL RI RXU ODERUDWRU\ DQG FRQWDLQV ERWK ES UHSHDWV RULJLQDOO\ GHULYHG IURP S'* D JLIW RI 'U 6KHUPDQ :HLVVPDQf )LJXUH LV D FRPSRVLWH RI LGHQWLFDO ODQHV SUREHG ZLWK HLWKHU WKH KLVWRQH n SUREH DV GHWDLOHG HDUOLHU RU WKH 69 HQKDQFHU IUDJPHQW :H IHOW LW ZRXOG EH HDVLHU IRU FRPSDULVRQ LI WKH ODQHV ZHUH SODFHG DGMDFHQW WR HDFK RWKHU LQVWHDG RI RQ VHSDUDWH ILJXUHV ,Q )LJXUH ODQHV S)POf S)POOf S)Pf DQG S)$f DUH LGHQWLFDO WR WKH DGMDFHQW ODQHV DQG $ 3VW, GLJHVW RI S69QHR SURGXFHV WKUHH IUDJPHQWV DQG WKH 69 SUREH GHWHFWV WKH NE IUDJPHQW WKDW FRQWDLQV SDUW RI WKH QHRP\FLQ UHVLVWDQFH JHQH WKH 69 SURPRWHUHQKDQFHU DQG VRPH S%5 VHTXHQFH :KHQ JHQRPLF '1$ LV GLJHVWHG ZLWK %DP+, WKH S69QHR '1$ LV OLQHDUL]HG DQG LI WDQGHPO\ LQWHJUDWHG D NE EDQG VKRXOG EH GHWHFWDEOH ,Q )LJXUH ODQH WKH S)PO '1$ FXW ZLWK 3VW, GHPRQVWUDWHG D SURPLQHQW NE EDQG DV H[SHFWHG EXW DOVR KDV EDQGV LQ WKH UHJLRQ RI WKH KLVWRQH VLJQDO GHWHFWHG SUHYLRXVO\ NEf LQ ODQHV DQG 7KH DELOLW\ WR GHWHFW D VXEVWDQWLDO DPRXQW RI ERWK WKH NE

PAGE 163

S) '1$ DQG WKH NE S69QHR IUDJPHQW VXJJHVWV WKDW WKHUH LV QRW D VXEVWDQWLDO PL[LQJ RI WKH WZR PROHFXOHV LQ WKH S) LQWHJUDWLRQ VLWH 7KH VPDOOHU IUDJPHQWV GHWHFWHG LQ ODQH SUREDEO\ UHSUHVHQW HQG IUDJPHQWV RI HDFK LQWHJUDWLRQ HYHQW $Q HQG IUDJPHQW LV GHWHFWHG EHFDXVH LW LV WKH PRVW GLVWDO SODVPLG VHTXHQFH RQ HLWKHU VLGH RI WKH LQWHJUDWLRQ HYHQW ,Q WKH FDVH RI S)PO WKH '1$ LV FXW ZLWK 3VWO 7KH S) '1$ PROHFXOHV LQWHJUDWHG DW HDFK HQG RI WKH WDQGHP DUUD\ ZLOO EH VXEMHFW WR FXWWLQJ LQWHUQDOO\ ZLWK 3VWO RQFH DQG DW VRPH XQNQRZQ GLVWDQFH LQWR WKH FHOOXODU '1$ DW WKH QH[W DYDLODEOH 3VWO VLWH 6LQFH WKLV QH[W 3VWO VLWH LV RI DQ XQGHWHUPLQHG ORFDWLRQ RQ ERWK HQGV RI WKH LQWHJUDWLRQ HYHQW IRU HYHU\ LQWHJUDWLRQ VLWH WKHUH ZLOO XVXDOO\ EH WZR HQG IUDJPHQWV RI XQNQRZQ OHQJWK GHWHFWDEOH 7KH QXPEHU RI HQG IUDJPHQWV FDQ LQGLFDWH WKH QXPEHU RI GLIIHUHQW VLWHV LQWR ZKLFK WKH FRQVWUXFW KDV LQWHJUDWHG S)PO KDV RU PRUH IUDJPHQWV LQ DGGLWLRQ WR WKH PDLQ EDQG DW NE 7KLV FRXOG EH LQWHUSUHWHG DV UHIOHFWLQJ LQWHJUDWLRQ VLWHV LQ WKLV PRQRFORQDO FHOO OLQH RU SHUKDSV WKH LQFOXVLRQ RI S69QHR EHWZHHQ WDQGHPO\ UHSHDWHG S) PROHFXOHV FDXVHV SHULRGLF LQWHUUXSWLRQV 7KH GLJHVWLRQ RI S)POO ZLWK 3VWO )LJXUH ODQH f DOVR GHPRQVWUDWHV WKDW WKH NE S69QHR IUDJPHQW LV GHWHFWDEOH DQG FRQVWLWXWHV D FRQVLGHUDEOH SRUWLRQ RI WKH VLJQDO LQ ODQH $ FRPSDULVRQ RI WKLV ODQH K\EULGL]HG WR KLVWRQH n VHTXHQFHV ODQH f DQG K\EULGL]HG WR WKH 69 HQKDQFHU IUDJPHQW GHPRQVWUDWHV WKDW YHU\ IHZ RI WKH EDQGV GHWHFWDEOH ZLWK WKH KLVWRQH VHTXHQFH SUREH DUH DOVR GHWHFWHG ZLWK WKH 69 HQKDQFHU SUREH 7KLV ODFN RI FRQJUXLW\ SRLQWHG WR VRPH VHSDUDWLRQ RI WKH S69QHR DQG S)2 VHULHV SODVPLGV XSRQ LQWHJUDWLRQ

PAGE 164

7KH FRQVWUXFW S) ZKHQ GLJHVWHG ZLWK %DUD+, LQ )LJXUH ODQH \LHOGV D NE OLQHDU IUDJPHQW ZKHQ K\EULGL]HG WR KLVWRQH n IODQNLQJ VHTXHQFHV :KHQ K\EULGL]HG WR WKH 69 IUDJPHQW D NE EDQG FRUUHVSRQGLQJ WR OLQHDU S69QHR LV GHWHFWHG ODQH f 7KH DELOLW\ WR GHWHFW D PDMRULW\ RI WKH S69QHR '1$ DV D OLQHDU PROHFXOH FRQILUPV WKH LGHD WKDW LQ PDQ\ LQVWDQFHV WKH S69QHR SODVPLG KDV LQWHJUDWHG SULPDULO\ LQ D VLWH DSDUW IURP WKH KLVWRQH FRQVWUXFWV 7KH EDQG DERYH WKH NE ODQH f DQG EHORZ NE ODQH f DSSDUHQWO\ FRQWDLQV ERWK KLVWRQH DQG 69 VHTXHQFHV 7KH FRQVWUXFW S)2O$PO2 ZKHQ GLJHVWHG ZLWK HLWKHU %DP+O OLQHDUL]HV FRQVWUXFW NEf ODQH f RU 3VW, NE IUDJPHQWf ODQH f DQG SUREHG ZLWK WKH KLVWRQH n VHTXHQFHV UHVXOWHG LQ WKH GHWHFWLRQ RI PDQ\ IUDJPHQWV :KHQ K\EULGL]HG ZLWK WKH 69 HQKDQFHU IUDJPHQW WKHUH LV D NE EDQG LQ ODQH DQG D NE EDQG LQ ODQH DORQJ ZLWK VHYHUDO DGGLWLRQDO EDQGV ERWK ODUJHU DQG VPDOOHU ,Q VRPH LQVWDQFHV WKHUH LV LGHQWLW\ EHWZHHQ WKH IUDJPHQWV GHWHFWHG E\ WKH WZR SUREHV VR LW LV SRVVLEOH WKH\ DUH ORFDWHG LQ FORVH SUR[LPLW\ RU OLQNHG RQ UHVWULFWLRQ IUDJPHQWV 6WLOO DW WKLV SRLQW LW ZDV GLIILFXOW WR GHWHUPLQH WKH UHODWLRQVKLS EHWZHHQ WKH WZR WUDQVIHFWHG SODVPLGV KLVWRQH DQG S69QHR ,W ZDV DSSDUHQW WKDW LQ VRPH FDVHV WKHUH ZDV D UHDVRQ WR EHOLHYH WKDW WKH WZR SODVPLGV ZHUH QRW FRPSOHWHO\ PL[HG GXULQJ WKH LQWHJUDWLRQ HYHQWV 7R GHWHUPLQH WKH UHODWLRQVKLS LQ D GLIIHUHQW ZD\ ZH UHSUREHG WKH EORW LQ )LJXUH D ZLWK WKH 69 HQKDQFHU IUDJPHQW DIWHU UHPRYDO RI WKH KLVWRQH SUREH 7KH LGHD LQ WKLV H[SHULPHQW ZDV WKDW WKH S69QHR SODVPLG FRQWDLQV QR ;EDO UHVWULFWLRQ VLWHV 7KHUHIRUH WKH GLJHVWLRQ ZLWK ;EDO ZKLFK UHOHDVHG JUHDWHU WKDQ b RI WKH S) VHTXHQFHV DV D

PAGE 165

NE EDQG VKRXOG GHWHUPLQH ZKHWKHU WKHUH ZDV DQ\ PL[LQJ EHWZHHQ WKH S69QHR DQG S) SODVPLG XSRQ LQWHJUDWLRQ 7KH SUHVHQFH RI D NE RU ODUJHU EDQG ZRXOG EH LQGLFDWLYH RI PL[LQJ DQG UHOHDVH XSRQ ;EDO GLJHVWLRQ $V FDQ EH VHHQ LQ )LJXUH E WKH ;EDO GLJHVWHG S) PRQRFORQDO FHOO OLQHV ODQHV f K\EULGL]HG WR WKH 69 HQKDQFHU IUDJPHQW LQ D GLIIXVH PDQQHU DQG SULPDULO\ LQ WKH XSSHU UHJLRQ RI WKH EORW WKDW ZDV LQGLFDWLYH RI ODUJH '1$ PROHFXOHV $ IHZ EDQGV ZHUH GHWHFWDEOH LQ WKH S)PO FHOO OLQH DQG LW VKRXOG EH QRWHG WKDW WKLV FHOO OLQH KDV D YHU\ KLJK FRS\ QXPEHU DQG D JUHDW GHDO RI KHWHURJHQHRXV LQWHJUDWLRQ 7KH VDPH S) PRQRFORQDO FHOO OLQHV ZKHQ GLJHVWHG ZLWK 3VW, )LJXUH E ODQHV f GHPRQVWUDWHG WKDW WKH S69QHR VHTXHQFHV DUH SUHVHQW DQG GHWHFWDEOH DV D NE EDQG 7KH S) PRQRFORQDO FHOO OLQHV GLJHVWHG ZLWK ;EDO DQG SUREHG ZLWK WKH 69 VHTXHQFHV VXJJHVW WKDW WKH S69QHR SODVPLG '1$ LV QRW LQWHUVSHUVHG LQ WKH LQWHJUDWHG S) SODVPLG '1$V ,I WKH S69QHR SODVPLG KDG EHHQ UHOHDVHG E\ ;EDO GLJHVWLRQ ZH ZRXOG KDYH H[SHFWHG D VWURQJ EDQGVf LQ WKH KLJK PROHFXODU ZHLJKW UHJLRQ RI WKH EORW 7KH GLIIXVH K\EULGL]DWLRQ WKURXJKRXW WKH ODQH LV VRPHZKDW FRQIXVLQJ DQG XQIRUWXQDWHO\ D & '1$ FRQWURO ZDV QRW LQFOXGHG RQ WKLV JHO 7KHUH LV WKH SRVVLELOLW\ WKDW WKH '1$ IUDJPHQWV WKDW FRQWDLQHG WKH S69QHR SODVPLG PROHFXOHV ZHUH YHU\ ODUJH DQG GLG QRW WUDQVIHU ZHOO IURP WKH JHO *LYHQ WKH IDFWV SUHVHQWHG DQG NQRZQ DERXW HQKDQFHUV SDUWLFXODUO\ WKH 69 HQKDQFHU LW VHHPV UHDVRQDEOH WR FRQFOXGH WKDW WKLV SRWHQW HQKDQFHU KDV OLWWOH RU QR HIIHFW RQ WKH KXPDQ + KLVWRQH VHTXHQFH LQWHJUDWHG LQ WKHVH PRXVH FHOOV %HFDXVH RI WKH LQWHQVLW\ RI WKH

PAGE 166

S69QHR EDQGV NEf GHWHFWDEOH LQ )LJXUH DQG )LJXUH LW ZDV OLNHO\ WKDW WKH FRS\ QXPEHU RI WKH S69QHR SODVPLG LQ WKHVH FHOO OLQHV ZDV YHU\ KLJK 7KLV ZDV FHUWDLQO\ WKH UHVXOW RI LQWHJUDWLRQ DQG DPSOLILFDWLRQ XQGHU WKH VHOHFWLYH SUHVVXUH RI %HFDXVH RI WKH VHOHFWLYH SUHVVXUH XQGHU ZKLFK WKHVH FHOO OLQHV ZHUH JURZQ LW ZDV LPSRVVLEOH WR GHWHUPLQH WKH DEVROXWH S69QHR FRS\ QXPEHU RULJLQDOO\ SUHVHQW LQ WKH FHOO &RPSDWLELOLW\ RI 0RXVH DQG +XPDQ 5HJXODWRU\ 3URWHLQV DQG 6HTXHQFHV ([DPLQDWLRQ RI WKH FRS\ QXPEHU GDWD SUHVHQWHG LQ 7DEOH UHYHDOHG WKDW DV WKH FRS\ QXPEHU RI D FHOO OLQH LQFUHDVHG WKH H[SUHVVLRQFRS\ GHFUHDVHG 7KLV LV JUDSKLFDOO\ GHWDLOHG LQ )LJXUH ZKHUH VHYHUDO FHOO OLQHV KDYH EHHQ FRPSDUHG WR RQH DQRWKHU IRU WKLV HIIHFW 7KH REYLRXV WUHQG ZDV W\SLILHG E\ S) :KHQ FHOO OLQHV ZLWK IHZHU WKDQ FRSLHV DUH SORWWHG WKH H[SUHVVLRQFRS\ ZDV KLJK f EXW ZKHQ FRS\ QXPEHU URVH DERYH WKH H[SUHVVLRQFRS\ UDWLR GHFUHDVHG GUDPDWLFDOO\ $OWKRXJK WKH H[SUHVVLRQFRS\ UDWLR IRU WKH RWKHU FRQVWUXFWV SUHVHQWHG ZDV JHQHUDOO\ ORZHU WKDQ IRU S) WKH GHFUHDVH ZLWK LQFUHDVHG FRS\ QXPEHU ZDV VWLOO DSSDUHQW 7KLV HIIHFW SUHVHQWHG VHYHUDO SUREOHPV f LV LW WKHQ DSSURSULDWH WR DQDO\]H RQO\ WKH ORZ FRS\ QXPEHU FHOO OLQHV IRU GLIIHUHQFHV IURP FRQVWUXFW WR FRQVWUXFW" DQG f GRHV WKLV LQGLFDWH WKDW WKH KXPDQ DQG PRXVH + JHQHV DUH LQ FRPSHWLWLRQ ZLWK HDFK RWKHU IRU QHFHVVDU\ WUDQVFULSWLRQ IDFWRUV" ,Q FKDSWHU ZH DOOXGHG WR WKH IDFW WKDW WKHUH ZDV D FRPSHWLWLRQ SKHQRPHQRQ $W WKDW SRLQW ZH LQWHUSUHWHG WKH S)$ DQG S) GDWD LQ WKH FRQWH[W RI FRS\ QXPEHU 7R GHWHUPLQH ZKHWKHU WKHVH FRQFHUQV ZHUH YDOLG ZH SHUIRUPHG DQ DQDO\VLV RI WKH SURWHLQ'1$ LQWHUDFWLRQV LQ WKH n SURPRWHU VHTXHQFHV

PAGE 167

+ 'HOHWLRQ &RQVWUXFWV $YHUDJH ([SUHVVLRQ&RS\ 1XPEHU YV &RS\ 1XPEHU )LJXUH (IIHFW RI FHOO OLQH FRS\ QXPEHU RQ WKH H[SUHVVLRQ RI WKH KXPDQ + KLVWRQH JHQH $ SORW RI DYHUDJH H[SUHVVLRQFRS\ YHUVXV WKH FHOO OLQH FRS\ QXPEHU 'DWD IURP 7DEOH ZDV DYHUDJHG IRU S)2$ S) S) DQG S) 7KH DYHUDJH H[SUHVVLRQ IURP DOO FHOO OLQHV LQ D JURXS ZLWK WKH VDPH FRS\ QXPEHU DUH SUHVHQWHG DV VLQJOH SRLQWV 0RVW SRLQWV DUH UHSUHVHQWDWLYH RI WKH YDOXH IRU D VLQJOH PRQRFORQH DQG QRW DYHUDJHG ZLWK RWKHUV 7KH OHJHQG LQ WKH ILJXUH GHVLJQDWHV HDFK FXUYH

PAGE 168

RI WKH ) + KLVWRQH JHQH ,I SURPRWHU FRPSHWLWLRQ IRU WUDQVFULSWLRQ IDFWRUV RFFXUUHG WKHQ ZH IHOW LW PLJKW EH SRVVLEOH WR GHWHFW WKH HIIHFW RI KLJK FRS\ QXPEHU RQ WKH ELQGLQJ RI WUDQVFULSWLRQ IDFWRUV ,Q FROODERUDWLRQ ZLWK 'U 8UV 3DXOL RI RXU ODERUDWRU\ ZH FKDUDFWHUL]HG WKH SURWHLQ'1$ LQWHUDFWLRQV LQ WKH SUR[LPDO SURPRWHU UHJLRQ RI WKUHH PRQRFORQDO FHOO OLQHV FRQWDLQLQJ WKH FRQVWUXFW S) :H ZHUH LQWHUHVWHG WR NQRZ ZKHWKHU 6LWH DQG 6LWH ,, ZHUH SUHVHQW LQ WKH SUR[LPDO SURPRWHU RI WKH KXPDQ + KLVWRQH JHQH ZKHQ LQWHJUDWHG LQ D PRXVH FHOO DQG LI WKH SURWHLQ'1$ FRQWDFW SRLQWV ZHUH WKH VDPH 7KH S) FHOO OLQHV ZHUH FKRVHQ IRU VHYHUDO UHDVRQV 7KH\ KDG D ZLGH UDQJH RI FRS\ QXPEHU DYDLODEOH DQG ZH IHOW WKDW WKH H[WHQVLYH n IODQNLQJ UHJLRQ NEf ZDV PRUH OLNHO\ WR DVVXPH D FKURPDWLQ VWUXFWXUH OLNH WKDW IRXQG LQ D KXPDQ FHOO &HOO OLQHV ZHUH JURZQ XQWLO b FRQIOXHQW DQG WUHDWHG ZLWK '06 LQ YLYR DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV *HQRPLF '1$ IURP HDFK FHOO OLQH ZDV SUHSDUHG GLJHVWHG ZLWK +LQGL HOHFWURSKRUHVHG DQG EORWWHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH ILOWHU ZLWK LPPRELOL]HG '1$ ZDV WKHQ K\EULGL]HG ZLWK WKH n +LQGL XSSHU VWUDQG SUREH )LJXUH Df 7KLV SUREH ZDV XVHG EHFDXVH WKH XSSHU VWUDQG RI WKH '1$ FRQWDLQHG *V VWURQJO\ SURWHFWHG IURP '06 WUHDWPHQW ZKHUHDV WKH ORZHU VWUDQG FRQWDLQHG RQO\ PLQRU SURWHFWLRQV 3DXOL HW DO f $OO WKH UHVLGXHV WKDW H[KLELW SURWHFWLRQ DUH QRWHG RQ WKH VLGH RI )LJXUH 7KH ERXQGDULHV RI 6LWH DQG 6LWH ,, DUH GHQRWHG WR WKH ULJKW RI )LJXUH E 7KHVH ZHUH GHWHUPLQHG E\ 3DXOL HW DO f E\ '1DVHO SURWHFWLRQ 7KHUHIRUH ZH ZHUH DEOH WR HDVLO\ GHWHFW DQ\ GLIIHUHQFHV

PAGE 169

)LJXUH *HQRPLF VHTXHQFLQJ DQDO\VLV SURWHLQ'1$ LQWHUDFWLRQV LQ WKH SUR[LPDO SURPRWHU RI WKH ) + KLVWRQH JHQH VWDEO\ LQWHJUDWHG LQWR PRXVH & FHOOV $V GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV WKH JHQRPLF '1$ IURP VHYHUDO GLIIHUHQW PRQRFORQDO FHOO OLQHV RI S) ZDV WUHDWHG ZLWK '06 LQ YLYR 7KH '1$ ZDV WKHQ SXULILHG WUHDWHG ZLWK SLSHULGLQH UHVWULFWHG ZLWK +LQGL HOHFWURSKRUHVHG EORWWHG DQG SUREHG ZLWK WKH XSVWUHDP n +LQGL SUREH $ 6FKHPDWLF GLDJUDP RI WKH SUR[LPDO UHJLRQ RI WKH ) + KLVWRQH JHQH 7KH VLQJOH VWUDQG +LQGLf SUREH WKDW ZDV XWLOL]HG LQ WKHVH H[SHULPHQWV LV GHVLJQDWHG ZLWK WKH ODUJH DUURZ 5HVWULFWLRQ HQ]\PH VLWHV DUH GHQRWHG DV (FR5, ( +LQGL +H +LQG,,, + 1FRO 1 7KH ODUJH ER[ LV WKH + FRGLQJ DQG OHDGHU VHTXHQFH %RWK 6LWH DQG 6LWH ,, DUH GHVLJQDWHG DERYH WKH GLDJUDP % *HQRPLF VHTXHQFLQJ DQDO\VLV RI SURWHLQ FRQWDFW SRLQWV LQ 6LWH DQG 6LWH ,, RI WKH KXPDQ + SUR[LPDO SURPRWHU UHJLRQ /DQHV FRQWURO +H/D '1$ SXULILHG GHSURWHLQL]HG DQG WKHQ WUHDWHG ZLWK '06 +H/D '1$ WKDW ZDV WUHDWHG LQ YLYR WR GHPRQVWUDWH WKH SRVLWLRQV RI 6LWH WR ESf DQG VLWH ,, WR ESf $W WKH OHIW WKH VPDOO DUURZV LQGLFDWH WKH SURWHLQ'1$ LQWHUDFWLRQV DV GHWHFWHG E\ '06 PHWK\ODWLRQ LQWHUIHUHQFH 3DXOL HW DO f /DQH S)P FHOO OLQH '1$ FRS\ QXPEHU f§ f WUHDWHG LQ YLYR ZLWK '06 7KH WKUHH UHVLGXHV DW DSSUR[LPDWHO\ WR ES DUH SURWHFWHG DQG GHQRWHG RQ WKH ILJXUH ZLWK DQ DUURZ /DQH FRQWURO GHSURWHLQL]HG S)P '1$ /DQH +H/D FRQWURO '1$ GHSURWHLQL]HG DQG '06 WUHDWHG /DQH S)0 FRS\ QXPEHU f '1$ WUHDWHG LQ YLYR ZLWK '06 7KH SURWHFWHG UHVLGXHV DW WR ES DUH QRWHG ZLWK DQ DUURZ RQ WKH ILJXUH /DQH S)0O FRS\ QXPEHU f '1$ WUHDWHG LQ YLYR ZLWK '06 7KH UHVLGXHV DUH QRW SURWHFWHG DW ES $W QR WLPH ZDV WKHUH DQ\ GHWHFWDEOH SURWHLQ '1$ LQWHUDFWLRQ LQ S)P P RU PO DW 6LWH ,, RU WKH GLVWDO SDUW RI 6LWH /DQH S) SODVPLG '1$ WUHDWHG ZLWK '06 DV D FRQWURO IRU WKH UHVLGXH VHTXHQFLQJ SDWWHUQ 7KH RQO\ GHWHFWDEOH SURWHLQ ELQGLQJ RFFXUV LQ 6LWH RI S)P DQG P DW WKH SXWDWLYH 6SO VLWH

PAGE 171

LQ WKH SURWHLQ'1$ LQWHUDFWLRQV LQ WKH KHWHURORJRXV PRXVH V\VWHP 7KH UHVXOWV SUHVHQWHG LQ )LJXUH E ODQH VXJJHVWHG WKDW LQ D FHOO OLQH ZLWK ORZ FRS\ QXPEHU S)P FRSLHVf D VLJQLILFDQW SRUWLRQ DSSUR[LPDWHO\ bf RI WKH JHQHV KDG SURWHLQ ERXQG WR WKH SUR[LPDO VLGH RI 6LWH WKH SXWDWLYH 6SO VLWH UHVLGXHV WR SURWHFWHG LQ YLYRf EXW WKHUH ZDV DSSDUHQWO\ QR SURWHLQ ERXQG WR VLWH ,, :KHQ WKH FRS\ QXPEHU RI WKH FHOO OLQH LQFUHDVHG WR S)P WKHUH ZDV VWLOO SURWHLQ'1$ LQWHUDFWLRQ GHWHFWDEOH DW 6LWH EXW QRW DW 6LWH ,, ODQH f )LQDOO\ ZKHQ FRSLHV RI WKH KXPDQ KLVWRQH JHQH ZHUH SUHVHQW S)PO WKHUH ZDV QR GHWHFWDEOH SURWHLQ LQWHUDFWLRQ DW 6LWH RU 6LWH ,, ODQH f $V D FRQWURO IRU WKH SUHVHQFH DQG ORFDWLRQ RI 6LWH DQG 6LWH ,, V\QFKURQL]HG +H/D FHOOV HDUO\ LQ 6 SKDVH ZHUH WUHDWHG ZLWK '06 DW WKH VDPH WLPH DQG VXEMHFWHG WR WKH VDPH SURWRFRO DV WKH S) FHOO OLQHV ODQH f S) SODVPLG '1$ DQG GHSURWHLQL]HG +H/D '1$ ZHUH '06 WUHDWHG DV D FRQWURO ODQHV DQG UHVSHFWLYHO\f IRU WKH H[SHFWHG VHTXHQFH SDWWHUQ RI WKH UHVLGXHV 7KH UHVXOWV VXEVWDQWLDWHG WKH FHOO OLQH H[SUHVVLRQ GDWD WKDW D OLPLWLQJ IDFWRUVf ZDV QHFHVVDU\ IRU WKH WUDQVFULSWLRQ RI KLVWRQH JHQHV 7KH UHVXOWV DOVR VXSSRUW WKH FRQWHQWLRQ WKDW WKH PRXVH DQG KXPDQ WUDQVFULSWLRQDO SURWHLQV DUH QRW QHFHVVDULO\ LGHQWLFDO 3UHYLRXV VWXGLHV LQFOXGLQJ WKLV ZRUN KDYH GHPRQVWUDWHG WKDW WKH PRXVH FHOO LV DEOH WR FRUUHFWO\ H[SUHVV LQWURGXFHG KXPDQ KLVWRQH JHQHV *UHHQ HW DO &DSDVVR DQG +HLQW] f ,Q PDQ\ RWKHU UHVSHFWV WKH PRXVH FHOO LV FDSDEOH RI WKH UHJXODWLRQ RI KXPDQ KLVWRQH P51$ LQ D PDQQHU LGHQWLFDO WR WKDW RI WKH KXPDQ FHOO :H KDYH GHPRQVWUDWHG WKDW WKH SURFHVVHG n HQGV RI WKH KXPDQ KLVWRQH + P51$ DUH LGHQWLFDO LQ PRXVH

PAGE 172

DQG KXPDQ FHOOV DQG WKDW WKH WUDQVFULSWLRQ LQLWLDWLRQ VLWHV DUH DOVR LGHQWLFDO GDWD QRW VKRZQf +RZHYHU RXU IDLOXUH WR GHWHFW SURWHLQ ERXQG WR WKH GLVWDO VLGH RI 6LWH DQG WR DOO RI 6LWH ,, HYHQ DW ORZ FRS\ QXPEHU LQGLFDWHG WKDW WKHUH ZHUH GLIIHUHQFHV LQ WKH IDFWRUV WKDW ELQG WKHUH &RQILUPDWLRQ RI WKHLU H[LVWHQFH DQG ELQGLQJ LQ YLWUR KDV EHHQ GHPRQVWUDWHG E\ YDQ :LMQHQ HW DO DQG SHUVRQDO FRPPXQLFDWLRQf 3HUKDSV WKHUH DUH VXEWOH SURWHLQ VHTXHQFH YDULDWLRQV WKDW SUHFOXGH GHWHFWLRQ ZLWK JHQRPLF VHTXHQFLQJ 3UHYLRXVO\ YDQ :LMQHQ HW DO f GHPRQVWUDWHG WKDW WKHUH ZHUH IDFWRUV WKDW ERXQG WR WKH UHJLRQ RI WKH + SURPRWHU IURP WR ES KRZHYHU WKHVH SURWHLQV ZHUH QRW GHWHFWHG LQ YLYR E\ JHQRPLF VHTXHQFLQJ (LWKHU WKHVH SURWHLQ'1$ FRPSOH[HV ZHUH DUWLIDFWV RI WKH LQ YLWUR DVVD\ V\VWHP XWLOL]HG RU VRPH SURWHLQ'1$ LQWHUDFWLRQV DUH VLPSO\ QRW GHWHFWDEOH ZLWK JHQRPLF VHTXHQFLQJ :H VKRXOG QRWH WKDW 'U 3DXOL H[DPLQHG WKH UHJLRQ IURP WR ES ZLWK ERWK '1DVHO DQG '06 SURWHFWLRQ '1DVHO LV OLNHO\ WR GHWHFW D PDMRULW\ RI WKH LQWHUDFWLRQV ZKHUHDV '06 PLJKW QRW SLFN XS HYHU\ LQWHUDFWLRQ 'U 3DXOL SHUVRQDO FRPPXQLFDWLRQf :H UHDQDO\]HG WKH FRS\ QXPEHU DQG H[SUHVVLRQ GDWD LQ OLJKW RI WKH JHQRPLF VHTXHQFLQJ UHVXOWV DQG IRXQG WKDW LQ PRVW EXW QRW DOO FDVHV WKH KXPDQ DQG PRXVH DEVROXWH GHQVLWRPHWU\ VLJQDOV LQYHUWHG DV WKH FRS\ QXPEHU LQFUHDVHG 7KLV LV JUDSKLFDOO\ SUHVHQWHG LQ )LJXUH IRU VHYHUDO FHOO OLQHV LQFOXGLQJ S) :H FDOFXODWHG WKH SHUFHQW RI WKH WRWDO 6, QXFOHDVH SURWHFWHG IUDJPHQW VLJQDO PHDVXUHG GHQVLWRPHWULFDOO\ PRXVH + KXPDQ +f WKDW ZDV UHSUHVHQWDWLYH RI WKH PRXVH + JHQH DQG SORWWHG WKLV YHUVXV WKH FRS\ QXPEHU RI HDFK PRQRFORQDO FHOO OLQH ,W

PAGE 173

0RXVH 6 6LJQDO b RI 7RWDO 6 6LJQDO (IIHFW RI &RS\ QXPEHU RQ 0RXVH + ([SUHVVLRQ 0RQRFORQDO &HOO /LQH &RS\ 1XPEHU )LJXUH (IIHFW RI +XPDQ + JHQH FRS\ QXPEHU RQ 0RXVH + JHQH H[SUHVVLRQ 6L QXFOHDVH SURWHFWLRQ GDWD IRU VHYHUDO FHOO OLQHV ZDV DQDO\]HG WR GHWHUPLQH WKH HIIHFW RI WKH KXPDQ + JHQH RQ WKH H[SUHVVLRQ RI WKH PRXVH + JHQH 7KH KXPDQ DQG PRXVH 6, QXFOHDVH DVVD\ GHQVLWRPHWU\ YDOXHV ZHUH WRWDOHG DQG WKH SHUFHQW RI WKH WRWDO VLJQDO WKDW ZDV PRXVH ZDV SORWWHG YHUVXV WKH FRS\ QXPEHU RI WKH KXPDQ + LQ HDFK FHOO OLQH 'DWD IURP S) S)2226 DQG 3)$ DUH VKRZQ WR LOOXVWUDWH WKH SRLQW WKDW DV KXPDQ + FRS\ QXPEHU LQFUHDVHV WKH H[SUHVVLRQ RI WKH PRXVH JHQH GHFUHDVHV

PAGE 174

+ 'HOHWLRQ &RQVWUXFWV $YHUDJH ([SUHVVLRQ&RS\ 1XPEHU )LJXUH 5HDVVHVVPHQW RI KXPDQ + KLVWRQH JHQH H[SUHVVLRQ ORZ FRS\ QXPEHU GDWD 7KH VDPH FHOO OLQHV WKDW ZHUH GHSLFWHG LQ )LJXUH DUH VKRZQ KHUH 2QO\ GDWD IURP ORZ FRS\ QXPEHU FHOO OLQHV KDV EHHQ LQFOXGHG 7KLV LQ JHQHUDO FRUUHVSRQGV WR OHVV WKDQ FRSLHVFHOO ([SUHVVLRQFRS\ QXPEHU LV SORWWHG ZLWK WKH VWDQGDUG GHYLDWLRQ RI WKH PHDQ DV D RQH ZD\ HUURU EDU

PAGE 175

ZDV REYLRXV WKDW DV WKH KXPDQ + FRS\ QXPEHU LQFUHDVHG WKH SHUFHQW RI WRWDO PRXVH 6, VLJQDO GHFUHDVHG SURSRUWLRQDOO\ 7KLV UHVXOW UHTXLUHV VRPH TXDOLILFDWLRQV :H KDG H[SHFWHG WKDW DV WKH KXPDQ + FRS\ QXPEHU LQFUHDVHG WKH H[SUHVVLRQ ZRXOG DOVR LQFUHDVH ,I WKHUH ZDV QR FRPSHWLWLRQ EHWZHHQ WKH WZR VHWV RI JHQHV WKDQ WKH PRXVH VLJQDO VKRXOG KDYH EHHQ XQDIIHFWHG DQG UHPDLQHG VWDEOH VLQFH WKH PRXVH FRS\ QXPEHUGRHV QRW FKDQJH ,I WKDW ORJLF LV IROORZHG DQ DGGLWLRQDO VWHS WKDQ WKH PRXVH VLJQDO VKRXOG KDYH GHFUHDVHG ZLWK KXPDQ FRS\ QXPEHU ZKHQ PHDVXUHG DV D UDWLR +RZHYHU WKH KXPDQ + H[SUHVVLRQ GLG QRW FRQWLQXH WR ULVH ZLWK WKH KXPDQ + FRS\ QXPEHU (IIHFWLYHO\ WKH LQFUHDVH LQ WKH KXPDQ + JHQH FRS\ QXPEHU DSSHDUV WR KDYH ORZHUHG WKH PRXVH JHQH H[SUHVVLRQ DQG WKHUHIRUH DUWLILFLDOO\ UDLVHG WKH KXPDQ JHQH H[SUHVVLRQ 7KH UHVXOW RI WKLV SKHQRPHQRQ LV WKDW WKH RULJLQDO KXPDQ +PRXVH + UDWLR WKDW ZDV FDOFXODWHG LV FHUWDLQO\ LQDFFXUDWH LQ KLJK FRS\ QXPEHU FHOO OLQHV :H KDYH QRWLFHG WKDW LQ YHU\ KLJK FRS\ QXPEHU FHOO OLQHV VXFK DV S)PO ERWK WKH KXPDQ DQG PRXVH + JHQHV DUH H[SUHVVHG DW ORZ OHYHOV )LJXUH f 7KLV LV SUREDEO\ WKH UHVXOW RI IDFWRU GLVWULEXWLRQ EHWZHHQ WKH SRVVLEOH WUDQVFULSWLRQ XQLWV LQ VXFK D PDQQHU WKDW QRQH RI WKH JHQHV KDV D IXOO FRPSOHPHQW RI SURWHLQV QHFHVVDU\ IRU H[SUHVVLRQ 2XU UHDVVHVVPHQW RI WKH H[SUHVVLRQ GDWD LV SUHVHQWHG )LJXUH DQG RQO\ LQFRUSRUDWHV GDWD IURP HDFK FHOO OLQH LQ ZKLFK WKH FRPSHWLWLRQ SKHQRPHQRQ JHQHUDOO\ ORZ FRS\ QXPEHU FHOO OLQHVf ZDV QRW UHDGLO\ DSSDUHQW 7KH H[SUHVVLRQFRS\ ZDV SORWWHG DV EHIRUH LQ )LJXUH 7KH VWDWLVWLFDO GLIIHUHQFHV EHWZHHQ FRQVWUXFWV WKDW ZHUH GHWDLOHG HDUOLHU LV VWLOO YDOLG IRU WKLV SDUW RI WKH GDWD

PAGE 176

&+$37(5 ',6&866,21 $1' &21&/86,216 2XU VWXGLHV RYHU WKH ODVW VHYHUDO \HDUV KDYH FRQWULEXWHG WR WKH JHQHUDO XQGHUVWDQGLQJ RI KLVWRQH JHQH H[SUHVVLRQ DQG RI WKH H[SUHVVLRQ RI KXPDQ JHQHV LQ D KHWHURORJRXV V\VWHP 7KH KLVWRQH JHQHV KDYH EHHQ VWXGLHG LQWHQVHO\ IRU GHFDGHV DQG RQO\ QRZ DUH EHJLQQLQJ WR EH XQGHUVWRRG )URP WKH ZRUN ZH KDYH SUHVHQWHG KHUH DQG WKH ZRUN GRQH E\ RWKHUV +DQOH\ HW DO 6LHUUD HW DO 'DLOH\ HW DO YDQ :LMQHQ HW DO f LW LV FOHDU WKDW WKH KLVWRQH + SURPRWHU LV FRPSRVHG RI VHYHUDO GLVFUHWH '1$ VHTXHQFH HOHPHQWV LQFOXGLQJ WKH 7$7$ ER[ &$$7 ER[ 6SO VLWH n**&***nf DQG **7&& HOHPHQW :H KDYH DOVR GHPRQVWUDWHG WKDW PRUH GLVWDO VHTXHQFHV PD\ KDYH ERWK D SRVLWLYH DQG QHJDWLYH HIIHFW RQ WKH WUDQVFULSWLRQDO UHJXODWLRQ RI WKH ) KXPDQ + KLVWRQH JHQH :H LQLWLDOO\ ZDQWHG WR GHPRQVWUDWH ZKDW VHTXHQFHV ZHUH VXIILFLHQW IRU FDS VLWH LQLWLDWLRQ RI WUDQVFULSWLRQ LQ YLYR 3UHYLRXVO\ 6LHUUD HW DO f KDG GHPRQVWUDWHG ZLWK D VHULHV RI %DO GHOHWLRQV WKDW VHTXHQFHV FRQWDLQHG LQ WKH FRQVWUXFW ESf LQFOXGLQJ WKH 7$7$ ER[ ESf DQG **7&& HOHPHQW ESf ZHUH VXIILFLHQW IRU FRUUHFW LQLWLDWLRQ RI WUDQVFULSWLRQ LQ YLWUR ,Q RUGHU WR DVFHUWDLQ ZKHWKHU WKHVH VHTXHQFHV ZHUH VXIILFLHQW LQ YLYR ZH FRQVWUXFWHG D VHULHV RI SRO\FORQDO FHOO OLQHV LQ PRXVH & FHOOV ZLWK WKH %DO GHOHWLRQ FRQVWUXFWV DV GHVFULEHG LQ &KDSWHU 7UDQVFULSWLRQ IURP HDFK

PAGE 177

FRQVWUXFW ZDV PHDVXUHG E\ 6, QXFOHDVH DQDO\VLV DQG WKH H[SUHVVLRQ OHYHO SHU FRS\ GHWHUPLQHG 6L[ SRO\FORQDO FHOO OLQHV RI WKH FRQVWUXFW ESf ZHUH SUHSDUHG DQG DOWKRXJK DOO FHOO OLQHV FRQWDLQHG GHWHFWDEOH FRSLHV RI WKH FRQVWUXFW DV GHWHUPLQHG E\ 6RXWKHUQ EORW DQDO\VLV QRQH RI WKH FHOO OLQHV LQLWLDWHG KXPDQ + WUDQVFULSWLRQ FRUUHFWO\ $Q H[DPLQDWLRQ RI WKH LQ YLYR SURWHLQ'1$ LQWHUDFWLRQV ZLWKLQ WKH SUR[LPDO SURPRWHU UHJLRQ RI WKH KXPDQ + JHQH 3DXOL HW DO f KDG SUHYLRXVO\ UHYHDOHG WZR VLWHV RI LQWHUDFWLRQ 6LWH ES WR ESf DQG 6LWH ,, ES WR ESf :H EHOLHYH WKDW WKH ODFN RI FRUUHFW LQ YLYR WUDQVFULSWLRQ LQLWLDWLRQ IURP WKH FRQVWUXFW ESf LV WKH UHVXOW RI WKH GHOHWLRQ RI 6LWH DQG WKH GLVWDO KDOI RI 6LWH ,, (YHQ WKRXJK WKH **7&& HOHPHQW ESf DQG WKH 7$7$ ER[ ESf DUH VWLOO SUHVHQW LQ WKH FRQVWUXFW WKH\ DUH DSSDUHQWO\ LQVXIILFLHQW IRU VLWH VSHFLILF WUDQVFULSWLRQ LQLWLDWLRQ LQ YLYR 7KH **7&& HOHPHQW WKDW UHPDLQV LQ WKH FRQVWUXFW LV SUREDEO\ LQFDSDEOH RI ELQGLQJ LWV UHVSHFWLYH SURWHLQ 3DXOL HW DO f KDYH GHPRQVWUDWHG WKDW WKH LQ YLYR IDFWRU LQWHUDFWLRQ ZLWK WKH **7&& HOHPHQW RFFXUV V\PPHWULFDOO\ DW WKUHH UHVLGXHV RQ ERWK '1$ VWUDQGV 7KH GHOHWLRQ GLVUXSWV WKH V\PPHWU\ RI WKLV ELQGLQJ WKURXJK GHOHWLRQ RI WKH GLVWDO UHVLGXH RQ WKH ERWWRP VWUDQG $GGLWLRQDOO\ WKH &$$7ES**7&& PRWLI WKDW LV ZHOO FRQVHUYHG LQ PDQ\ + KLVWRQH JHQHV :HOOV f LV GLVUXSWHG E\ WKH GHOHWLRQ VXJJHVWLQJ WKDW LW PD\ DOVR EH LPSRUWDQW IRU WUDQVFULSWLRQDO UHJXODWLRQ 2XU UHVXOWV VXJJHVW WKDW PXOWLSOH WUDQVFULSWLRQ IDFWRUV DUH UHTXLUHG IRU + WUDQVFULSWLRQ LQLWLDWLRQ DQG LQ VXSSRUW RI WKLV K\SRWKHVLV YDQ :LMQHQ HW DO f KDYH GHPRQVWUDWHG VSHFLILF SURWHLQ ELQGLQJ UHJLRQV ZLWKLQ 6LWH ,

PAGE 178

DQG 6LWH ,, RI WKH ) + KLVWRQH JHQH LQ YLWUR :H ZHUH DEOH WR GHPRQVWUDWH WKH QHFHVVLW\ IRU DOO RI WKH 6LWH ,, SURWHLQ'1$ LQWHUDFWLRQV VLQFH FRUUHFW LQLWLDWLRQ RI WUDQVFULSWLRQ ZDV REVHUYHG ZLWK WKH FRQVWUXFW ESf WKDW LQFOXGHV DOO RI 6LWH ,, ,Q FRQWUDVW WR WKH LQ YLWUR WUDQVFULSWLRQ UHVXOWV RI 6LHUUD HW DO f ZH KDYH GHPRQVWUDWHG WKDW VHTXHQFHV EHWZHHQ DQG ES LQFOXGHG LQ WKH FRQVWUXFW ESf DUH UHTXLUHG IRU + KLVWRQH WUDQVFULSWLRQ LQLWLDWLRQ LQ YLYR 7KH SURWHLQ'1$ LQWHUDFWLRQV DW 6LWH ES WR ESf ZHUH VKRZQ E\ 3DXOL HW DO f WR RYHUODS D SXWDWLYH 6SO ELQGLQJ VLWH n****&****&nf DV GHVFULEHG E\ %ULJJV HW DO f :H ZHUH LQWHUHVWHG WR NQRZ ZKHWKHU WKLV 6SO VLWH ZDV IXQFWLRQDO DQG FRQWULEXWHG WR WKH WUDQVFULSWLRQDO UHJXODWLRQ RI WKH ) KXPDQ + KLVWRQH JHQH $ FHOO OLQH WKDW FRQWDLQHG WKH %DO GHOHWLRQ FRQVWUXFW ESf ZDV SUHSDUHG DQG DVVD\HG E\ 6, QXFOHDVH DQDO\VLV :LWK WKLV FHOO OLQH ZH GHPRQVWUDWHG WKDW WKH DGGLWLRQDO VHTXHQFHV EHWZHHQ DQG ES LQFOXGHG LQ WKH FRQVWUXFW LQFUHDVHG WKH OHYHO RI LQ YLYR WUDQVFULSWLRQ DW OHDVW IROG DERYH WKH FRQVWUXFW ESf 2XU UHVXOW LV FRQVLVWHQW ZLWK LQWHUDFWLRQ RI 6SO RU DQ 6SOOLNH SURWHLQ ZLWK WKLV VHTXHQFH DQG WKDW WKLV LV UHVSRQVLEOH IRU WKH LQFUHDVH LQ WUDQVFULSWLRQ ZH KDYH QRWHG $GGLWLRQDOO\ ZH KDYH EHHQ DEOH WR GHPRQVWUDWH ZLWK JHQRPLF VHTXHQFLQJ &KXUFK DQG *LOEHUW f WKDW WKHUH LV D IDFWRU LQ PRXVH & FHOOV WKDW ELQGV WR WKH 6SO UHFRJQLWLRQ VHTXHQFH LQ YLYR DOWKRXJK ZH FDQQRW FRQFOXGH WKDW LW LV LQGHHG 6SO 7DNHQ WRJHWKHU RXU UHVXOWV DQG WKRVH RI 3DXOL HW DO f DQG YDQ

PAGE 179

:LMQHQ HW DO f LPSOLFDWH 6SO DV D SRVLWLYH WUDQVFULSWLRQ IDFWRU LQ WKH UHJXODWLRQ RI WKLV KXPDQ + KLVWRQH JHQH %HFDXVH WKH n IODQNLQJ UHJLRQ RI WKH ) + KLVWRQH JHQH LV YHU\ H[WHQVLYH ZH FKDUDFWHUL]HG WKH FRQWULEXWLRQ RI PRUH GLVWDO n IODQNLQJ VHTXHQFHV WR WKH WUDQVFULSWLRQDO UHJXODWLRQ RI WKLV + KLVWRQH JHQH LQ YLYR :H ILUVW HVWDEOLVKHG WKDW ZKHQ DOO RI 6LWH DQG 6LWH ,, ZHUH SUHVHQW LQ FHOO OLQHV WKDW FRQWDLQHG WKH FRQVWUXFW ESf QR IXUWKHU LQFUHDVH LQ WKH OHYHO RI WUDQVFULSWLRQ ZDV GHWHFWHG ([WHQVLRQ RI WKH SURPRWHU VHTXHQFHV WR ES LQ WKH FRQVWUXFW S)$ GHPRQVWUDWHG WKDW LQ YLYR VHTXHQFHV IURP 6LWH ESf WR ES GLG QRW LQIOXHQFH WKH OHYHO RI WUDQVFULSWLRQ 7KHVH UHVXOWV ZHUH GHWHUPLQHG IURP H[SHULPHQWV ZLWK ERWK SRO\FORQDO DQG PRQRFORQDO FHOO OLQHV RI DQG S)$ 7KH LQFOXVLRQ RI VHTXHQFHV XS WR ES LQ WKH FRQVWUXFW S) UHVXOWHG LQ D IROG LQFUHDVH LQ WKH OHYHO RI WUDQVFULSWLRQ DERYH WKDW GHPRQVWUDWHG ZLWK WKH S)2O$ FRQVWUXFW FHOO OLQHV 3UHYLRXV DQDO\VLV RI WKLV UHJLRQ E\ 3DXOL HW DO f KDG UHYHDOHG QR GHWHFWDEOH LQ YLYR SURWHLQ'1$ LQWHUDFWLRQV ,Q RUGHU WR GHWHUPLQH PRUH SUHFLVHO\ WKH ORFDWLRQ RI WKH SRVLWLYH WUDQVFULSWLRQ HOHPHQW WZR GHOHWLRQV RI WKH S) FRQVWUXFW ZHUH SUHSDUHG ZLWK ([RQXFOHDVH ,,, DQG DVVD\HG LQ PRQRFORQDO FHOO OLQHV DQG VKRUW WHUP WUDQVLHQW H[SUHVVLRQ H[SHULPHQWV 7KH GHOHWLRQV KDYH EHHQ GHQRWHG S)%6GHO ESf DQG S)%6GHO ESf 2XU UHVXOWV IURP WKH PRQRFORQDO FHOO OLQHV FRQVWUXFWHG VXSSRUW WKH LGHD WKDW WKH SRVLWLYH WUDQVFULSWLRQ HOHPHQW LQ S) LV ORFDWHG LQ WKH VHTXHQFHV IURP ES S)$f WR ES S)%6GHO f &RPSDULVRQ RI WKH OHYHO RI WUDQVFULSWLRQ IURP WKH

PAGE 180

S)%6 FRQVWUXFW ESf DQG S)%6GHO ESf GHPRQVWUDWHG WKDW WKH GHOHWLRQ a ESf KDG QRW DIIHFWHG WKH OHYHO RI WUDQVFULSWLRQ 2QO\ D VLQJOH PRQRFORQDO FHOO OLQH ZDV REWDLQHG ZLWK WKH FRQVWUXFW S)%6GHO ESf DQG WKH OHYHO RI WUDQVFULSWLRQ ZDV VKRZQ WR EH ORZHU WKDQ S)%6 %HFDXVH RI WKH ODFN RI DSSURSULDWH FHOO OLQHV ZH ZHUH XQDEOH WR DVVHVV WKH HIIHFW RI WKLV GHOHWLRQ RQ WKH OHYHO RI + KLVWRQH JHQH WUDQVFULSWLRQ .HQ :ULJKW RI RXU ODERUDWRU\ KDV GHPRQVWUDWHG VLPLODU WUDQVFULSWLRQ UHVXOWV LQ DQ LQ YLWUR WUDQVFULSWLRQ V\VWHP ZLWK WKHVH FRQVWUXFWV SHUVRQDO FRPPXQLFDWLRQf 3UHOLPLQDU\ DQDO\VLV RI WKH VHTXHQFHV IURP ES WR ES VXJJHVWHG WKDW VHFRQGDU\ VWUXFWXUH PLJKW EH UHVSRQVLEOH IRU WKH IXQFWLRQ RI WKLV UHJLRQ 7KHUH DUH WZR SRVVLEOH LQYHUWHG UHSHDWV ZLWKLQ WKH UHJLRQ WKDW PD\ IRUP VWDEOH VWHP DQG ORRS VWUXFWXUHV 6WDEOH FHOO OLQHV DQG VKRUW WHUP WUDQVLHQW H[SUHVVLRQ H[SHULPHQWV ZLWK WKH FRQVWUXFW S)222O NE LQWHUQDO GHOHWLRQ ES WR ESf DOVR VXSSRUW WKH FRQWHQWLRQ WKDW WKH VHTXHQFHV IURP ES WR ES S)f FRQWDLQ D SRVLWLYH WUDQVFULSWLRQ HOHPHQW ,Q SRO\FORQDO DQG PRQRFORQDO FHOO OLQHV WKH S)222O FRQVWUXFW LV H[SUHVVHG DW D VLJQLILFDQWO\ ORZHU OHYHO WKDQ S) DQG S)$ 7KLV UHVXOW ZDV GXSOLFDWHG LQ WKH WUDQVLHQW H[SUHVVLRQ H[SHULPHQWV GHVFULEHG LQ FKDSWHU :H H[DPLQHG HYHQ PRUH GLVWDO VHTXHQFHV DQG GHPRQVWUDWHG WKDW LQ VWDEOH PRQRFORQDO FHOO OLQHV DQG VKRUW WHUP WUDQVLHQW H[SUHVVLRQ DVVD\V WKH FRQVWUXFW S) ESf H[KLELWV WKH VDPH OHYHO RI H[SUHVVLRQ DV S) ESf ,I VHTXHQFHV H[WHQGLQJ WR ES ZHUH LQFOXGHG S)f WKHUH ZDV D VLJQLILFDQW IROGf GHFUHDVH LQ WKH OHYHO RI

PAGE 181

WUDQVFULSWLRQ %DVHG RQ WKLV REVHUYDWLRQ ZH SURSRVHG WKDW WKHUH ZDV D QHJDWLYH UHJXODWRU\ HOHPHQW EHWZHHQ ES DQG ES LQ WKH KLVWRQH + SURPRWHU 7KH UHJLRQ ZDV VHTXHQFHG E\ WKH PHWKRG RI 0D[DP DQG *LOEHUW f LQ RUGHU KHOS WR LGHQWLI\ DQ\ SRVVLEOH VHTXHQFH HOHPHQWV WKDW PLJKW EH UHVSRQVLEOH IRU WKH GHFUHDVH LQ WUDQVFULSWLRQ 2XU DQDO\VLV IRXQG WZR FDQGLGDWH VHTXHQFHV %R[ ES n7&&&&7&7&$* nf DQG %R[ ES n$77&7&&7*7nf ZLWK KRPRORJ\ WR QHJDWLYH UHJXODWRU\ HOHPHQWV DV GHVFULEHG E\ %DQLDKPDG HW DO f IRU WKH FKLFNHQ O\VR]\PH JHQH 7R GHWHUPLQH LI WKHVH HOHPHQWV KDG DQ\ IXQFWLRQDOLW\ ZH FRQVWUXFWHG WZR GHOHWLRQV LQ WKH ES %DP+,(FR5, IUDJPHQW RI S) GHVLJQDWHG S)'O ESf DQG S)2( ESf 7KHVH FRQVWUXFWV ZHUH DVVD\HG LQ FRPSDULVRQ WR S) S) S) S)222O DQG S)$ IRU H[SUHVVLRQ RI WKH ) + KLVWRQH JHQH LQ WUDQVLHQWO\ WUDQVIHFWHG & DQG /WNn PRXVH FHOOV ,Q ERWK FHOO W\SHV ZH GHPRQVWUDWHG WKDW WKH VHTXHQFHV ZH KDG SURSRVHG EDVHG RQ VLPLODULW\ ZHUH QRW UHVSRQVLEOH IRU WKH REVHUYHG QHJDWLYH UHJXODWLRQ %RWK %R[ DQG %R[ ZHUH LQFOXGHG LQ WKH FRQVWUXFW S)( ZKLFK ZDV WKH PRVW KLJKO\ H[SUHVVHG FRQVWUXFW RI WKH JURXS %HFDXVH S)( ZDV H[SUHVVHG DW D OHYHO DSSUR[LPDWHO\ IROG KLJKHU WKDQ S) ZH SURSRVHG WKDW WKHUH ZDV D SRVLWLYH HOHPHQW ORFDWHG EHWZHHQ ES DQG ES 7KH RQO\ REYLRXV FDQGLGDWH VHTXHQFH SUHVHQW LQ WKH UHJLRQ ZDV D &&$$7 ER[ ORFDWHG DW ES :H FDQQRW FRQFOXGH WKDW WKLV VHTXHQFH LV UHVSRQVLEOH IRU WKH LQFUHDVH LQ WKH WUDQVFULSWLRQDO OHYHO RI S)( KRZHYHU LW KDV EHHQ ZHOO GRFXPHQWHG WKDW ZKHQ ORFDWHG LQ WKH SUR[LPDO SURPRWHU UHJLRQ RI PDQ\ JHQHV WKH &&$$7 ER[ IXQFWLRQV LQ WKH UHJXODWLRQ RI WUDQVFULSWLRQ LQ FRQMXQFWLRQ ZLWK RWKHU '1$ VHTXHQFHV

PAGE 182

'RUQ HW DO 0F.QLJKW DQG .LQJVEXU\ 0F.QLJKW HW DO 0F.QLJKW DQG 7MLDQ f 2XU H[SHULPHQWV GLG LQGLFDWH WKH H[LVWHQFH RI D QHJDWLYH UHJXODWRU\ HOHPHQW ZKHQ ZH H[DPLQHG S) ESf DQG S)'O ESf :H GHPRQVWUDWHG WKDW WKHVH FRQVWUXFWV ZHUH H[SUHVVHG DW D VLJQLILFDQWO\ ORZHU OHYHO LQ WKH VKRUW WHUP WUDQVLHQW DVVD\V WKDQ S)( ESf :H WKHUHIRUH FRQFOXGHG WKDW WKH QHJDWLYH UHJXODWRU\ HOHPHQW VXJJHVWHG E\ SUHYLRXV H[SHULPHQWV PRUH OLNHO\ UHVLGHG LQ WKH VHTXHQFHV EHWZHHQ ES DQG ES 'U &KU\VRJHORV RI RXU ODERUDWRU\ LGHQWLILHG D QXFOHDVH VHQVLWLYH UHJLRQ '1DVH DQG 6Lf ORFDWHG EHWZHHQ ES WR ES WKDW PD\ UHSUHVHQW D SURWHLQ'1$ LQWHUDFWLRQ 'U 6XVDQ &KU\VRJHORV SHUVRQDO FRPPXQLFDWLRQf 7KH VHTXHQFH RI WKLV UHJLRQ FRQWDLQV D VWUHWFK IURP ES WR ES ZDV YHU\ $7 ULFK bf :H IRXQG WKDW WKH UHJLRQ IURP WR ES FRQWDLQHG WZR H[FHOOHQW KRPRORJLHV WR 0$5V PDWUL[ DWWDFKPHQW UHJLRQVf DV GHVFULEHG E\ *DVVHU DQG /DHPPOL f DQG D WRSRLVRPHUDVH ,, VLWH 6DQGHU DQG +VLHK f 7KLV WRSRLVRPHUDVH ,, VLWH ZDV FRQILUPHG LQ YLWUR ZLWK SXULILHG HQ]\PH E\ 'U 7RP 5RZH SHUVRQDO FRPPXQLFDWLRQf 0DWUL[ DWWDFKPHQW VLWHV RQ WKH HXNDU\RWLF FKURPRVRPH DUH WKRXJKW WR IXQFWLRQ LQ WKH UHJXODWLRQ RI JHQH H[SUHVVLRQ WKURXJK UHFRJQLWLRQ RI FKURPDWLQ GRPDLQV DQG DWWDFKPHQW WR WKH QXFOHDU PDWUL[ DV KDV EHHQ GHPRQVWUDWHG IRU D QXPEHU RI JHQHV LQFOXGLQJ 'URVRSKLOD KLVWRQH JHQHV *DVVHU DQG /DHPPOL f 6LQFH WKH KLVWRQH JHQHV RI KLJKHU HXNDU\RWHV DUH FOXVWHUHG LW LV SRVVLEOH WKDW WKH\ PD\ EH GLYLGHG LQWR IXQFWLRQDO GRPDLQV RQ FKURPDWLQ ORRSV &RFNHULOO HW DO f GHPRQVWUDWHG WKDW 0$5V ZHUH DSSUR[LPDWHO\ ES LQ OHQJWK DQG b $7 7KH\ DOVR

PAGE 183

GHPRQVWUDWHG SRVVLEOH ELQGLQJ VLWHV IRU WRSRLVRPHUDVH ,, DV GHVFULEHG E\ 6DQGHU DQG +VLHK f 7KH XSVWUHDP UHJLRQ RI WKH ) JHQH IURP WR LV b $7 DQG FRQWDLQV DW OHDVW RQH FRQILUPHG WRSRLVRPHUDVH ,, VLWH 7KLV HYLGHQFH VXJJHVWV WKDW ELQGLQJ WR WKH QXFOHDU PDWUL[ DQG '1$ WRSRORJ\ PD\ IXQFWLRQ LQ WKH UHJXODWLRQ RI KLVWRQH + JHQH H[SUHVVLRQ $GGLWLRQDOO\ ZH GHPRQVWUDWHG WKDW S) DQG S) ZHUH H[SUHVVHG DW QHDUO\ WKH VDPH OHYHO LQ WUDQVLHQWO\ WUDQVIHFWHG FHOOV ZKHUH WKH '1$ ZDV SUHVXPDEO\ HSLVRPDO +RZHYHU LQ VWDEOH FHOO OLQHV S) ZDV H[SUHVVHG D VLJQLILFDQWO\ KLJKHU OHYHO IROGf WKDQ S) 7KHVH UHVXOWV VXJJHVW WKDW WKH VWDWH RI WKH '1$ HSLVRPDO RU LQWHJUDWHG DIIHFWV WKH IXQFWLRQ RI FHUWDLQ '1$ HOHPHQWV 7KLV LV FRQVLVWHQW ZLWK RXU K\SRWKHVLV WKDW DWWDFKPHQW WR WKH QXFOHDU PDWUL[ DQG '1$ WRSRORJ\ KDYH D UROH LQ WKH UHJXODWLRQ RI WKH ) KXPDQ + KLVWRQH JHQH :H KDYH DOVR QRWHG WKDW PDQ\ RI WKH QHJDWLYH UHJXODWRU\ HOHPHQWV SUHYLRXVO\ GHVFULEHG DUH ORFDWHG DW D FRQVLGHUDEOH GLVWDQFH IURP WKH JHQH WKH\ DUH DVVRFLDWHG ZLWK DQG WKLV LV FRQVLVWHQW ZLWK RXU W K\SRWKHVLV %DQLDKPDG HW DO /DLPLQV HW DO f $GGLWLRQDOO\ H[SHULPHQWV SHUIRUPHG E\ 'U 3DXOL RI RXU ODERUDWRU\ VXJJHVWHG WKDW KLVWRQH +, DQG D NG QXFOHDU DFLGLF SURWHLQ QRQn KLVWRQHf ERXQG VSHFLILFDOO\ WR WKLV UHJLRQ 'U 8UV 3DXOL SHUVRQDO FRPPXQLFDWLRQf ,W KDV EHHQ SUHYLRXVO\ VXJJHVWHG WKDW KLVWRQH +, PLJKW EH D JHQHUDO QHJDWLYH UHJXODWRU\ IDFWRU IRU WUDQVFULSWLRQ :HLQWUDXE f $QRWKHU SRVVLELOLW\ WKDW ZH KDYH FRQVLGHUHG LV WKDW WKH VWULQJV RI SRO\ $Q DQG SRO\ 7Q PD\ KDYH DQ XQXVXDO VHFRQGDU\ VWUXFWXUH LQ WKH

PAGE 184

XSVWUHDP UHJLRQ RI WKH + SURPRWHU $OWKRXJK ZH KDYH QRW EHHQ DEOH WR SHUIRUP DQ\ GLUHFW DQDO\VLV LW VHHPV SRVVLEOH WKDW XQGHU FHUWDLQ FLUFXPVWDQFHV WKLV VHJPHQW RI '1$ PLJKW DVVXPH D EHQW FRQIRUPDWLRQ DV GHVFULEHG E\ .RR HW DO f DQG 7UDYHUV f ,W KDV EHHQ HOHJDQWO\ GHPRQVWUDWHG LQ D QXPEHU RI V\VWHPV ERWK SURNDU\RWLF DQG HXNDU\RWLF WKDW '1$ FDQ EHQG LQWULQVLFDOO\ LI WKH QHFHVVDU\ EDVHV DUH SUHVHQW RU FDQ EHQG LQ UHVSRQVH WR WKH LQWHUDFWLRQ RI D SURWHLQ 6DOYR DQG *ULQGOH\ .RR HW DO f %HQGLQJ RI '1$ UHTXLUHV WKDW WKHUH EH SURSHU VSDFLQJ EHWZHHQ WKH $$ GLQXFOHRWLGH SDLUV DQG SRO\ $ WUDFWV 7KLV VSDFLQJ FRUUHVSRQGV WR DSSUR[LPDWHO\ ES RU D VLQJOH WXUQ RI WKH KHOL[ .RR HW DO f 6HYHUDO RI WKH SRO\ $Q WUDFWV LQ WKH XSVWUHDP UHJLRQ RI WKH + JHQH IURP ES WR ES DSSHDU DSSURSULDWHO\ VSDFHG 7KLV HYLGHQFH VXJJHVWV WKDW WKH XSVWUHDP UHJLRQ RI WKH + SURPRWHU KDV XQXVXDO VWUXFWXUH DQG PLJKW EH UHVSRQVLEOH IRU WKH QHJDWLYH UHJXODWLRQ ZH GHPRQVWUDWHG :H KDG SUHYLRXVO\ LPSOLFDWHG DQ DGGLWLRQDO SRVLWLYH UHJXODWRU\ HOHPHQW LQ WKH GLVWDO UHJLRQ RI WKH + SURPRWHU 3UHOLPLQDU\ SRO\FORQDO FHOO OLQH H[SHULPHQWV VXJJHVWHG WKDW WKH S)OO IUDJPHQW WR NEf RI $ ++* ZDV DEOH WR HQKDQFH WKH OHYHO RI WUDQVFULSWLRQ VHYHUDO IROG +HOPV HW DO f KDG VKRZQ WKDW WKLV IUDJPHQW FRXOG VWLPXODWH &$7 JHQH H[SUHVVLRQ WLPHV LQ +H/D FHOOV ZKHQ ORFDWHG DW WKH n HQG RI WKH JHQH 7KHLU H[SHULPHQWV VXJJHVWHG WKDW WKH HOHPHQW PLJKW KDYH WKH SURSHUWLHV RI HQKDQFHU :H H[DPLQHG WKLV SRVVLELOLW\ IXUWKHU WKURXJK WKH FRQVWUXFWLRQ RI D QXPEHU RI YDULDQW HQKDQFHU FRQVWUXFWV :H PDGH S) S)5 DQG S) DV GHVFULEHG LQ FKDSWHU WR WHVW WKH K\SRWKHVLV WKDW WKLV HOHPHQW KDG WKH

PAGE 185

GLVWDQFH DQG RULHQWDWLRQ LQGHSHQGHQW SURSHUWLHV RI DQ HQKDQFHU HOHPHQW :H H[DPLQHG D QXPEHU RI PRQRFORQDO FHOO OLQHV SUHSDUHG ZLWK HDFK FRQVWUXFW DQG HVWDEOLVKHG WKDW WKH S) IUDJPHQW GLG QRW FRQFOXVLYHO\ HQKDQFH WKH OHYHO RI H[SUHVVLRQ RI WKH + JHQH LQ PRXVH & FHOOV DERYH WKDW IRXQG ZLWK S)$ RU S); 7KH FRQVWUXFW S) ZDV KLJKO\ H[SUHVVHG LQ D QXPEHU RI FHOO OLQHV KRZHYHU WKLV ZDV DSSDUHQWO\ WKH UHVXOW RI KLJK FRS\ QXPEHU DQG QRW HQKDQFHPHQW RI H[SUHVVLRQ 7KH UHJLRQ ZDV VHTXHQFHG E\ .HQ :ULJKW DQG 'U 8UV 3DXOL DQG WKH\ IRXQG WKDW WKH S) IUDJPHQW H[KLELWHG WKUHH VHTXHQFHV LQ WKH ES (FR5, NEf;ED, NEf VHFWLRQ ZLWK VWURQJ VLPLODULW\ WR WKH FRQVHQVXV FRUH VHTXHQFH RI WKH 69 DQG ,J KHDY\ FKDLQ HQKDQFHUV 0DQLDWLV HW DO .KRXU\ DQG *UXVV f :H FDQ RQO\ VSHFXODWH WKDW WKH ODFN RI HQKDQFHU DFWLYLW\ LQ PRXVH & FHOOV D ILEUREODVW FHOO OLQH LV GXH WR WKH SUHVHQFH RI QHJDWLYH UHJXODWRU\ IDFWRUV RU WKH DEVHQFH RI SRVLWLYH IDFWRUV UHTXLUHG IRU DFWLYLW\ &RQVLVWHQW ZLWK WKLV LGHD :DV\O\N DQG :DV\O\N f GHPRQVWUDWHG WKDW WKH ,J KHDY\ FKDLQ HQKDQFHU ZDV QHJDWLYHO\ UHJXODWHG LQ ILEUREODVWV EXW WUDQVFULSWLRQ FRXOG EH VWLPXODWHG LQ WKHVH FHOOV LI FHUWDLQ VHTXHQFHV ZHUH GHOHWHG )LQHU DQDO\VLV RI WKH S)OO IUDJPHQW LQ GLIIHUHQW FHOO W\SHV VKRXOG UHYHDO LI WKLV HOHPHQW LV UHJXODWHG LQ VXFK D PDQQHU 2XU VWXGLHV RI WKH S) FRQVWUXFW DOORZHG XV WR DVVRFLDWH UHSHWLWLYH VHTXHQFHV ZLWK KLJKHU FRS\ QXPEHU RI WKH PRQRFORQDO FHOO OLQHV DQG ZLWK VSHFLILF LQWHJUDWLRQ 0RVW RI RXU FRQVWUXFWV LQWHJUDWHG YLD WKH SDWKZD\ GHVFULEHG E\ 3HUXFKR HW DO f 7KHUH ZDV D FRLQWHJUDWH VWDJH IROORZHG E\ LQWHJUDWLRQ DW D OLPLWHG QXPEHU RI VLWHV

PAGE 186

,Q WKH FHOOXODU FKURPDWLQ :H IRXQG WKDW PLQRU UHSHDWHG VHTXHQFHV ZLWK VRPH KRPRORJ\ WR WKH $OX UHSHDW &ROODUW HW DO f ORFDWHG LQ WKH GLVWDO n IODQNLQJ RI S) ZHUH UHVSRQVLEOH IRU WKH KLJKHU FRS\ QXPEHU LQ WKHVH FHOO OLQHV 7KH S) FRQVWUXFWV KDG D FRQVLGHUDEOH DPRXQW RI WDQGHP LQWHJUDWLRQ WKDW DOVR VXJJHVWHG WKDW WKH PLQRU UHSHDWV GLG QRW SHUWXUE WKH LQWHJUDWLRQ SDWKZD\ S) ZDV VWXGLHG LQ PRUH GHWDLO DQG ZH FRQFOXGHG WKDW WKH KLJK FRS\ QXPEHU DQG KHWHURJHQHRXV LQWHJUDWLRQ REVHUYHG ZDV GXH WR VSHFLILF LQWHJUDWLRQ YLD WKH $OX UHSHDW ORFDWHG LQ WKH S) IUDJPHQW NEf ,W KDV EHHQ SUHYLRXVO\ GHPRQVWUDWHG WKDW WKH KXPDQ KLVWRQH JHQHV DUH LQWHUVSHUVHG ZLWK YDULRXV UHSHDWHG VHTXHQFHV DQG RIWHQ IODQNHG E\ $OX UHSHDWV &ROODUW HW DO f 3HUKDSV WKLV XQXVXDO VHTXHQFH RUJDQL]DWLRQ DFFRXQWV IRU WKH FOXVWHUHG EXW UDQGRP RUJDQL]DWLRQDO SDWWHUQ RI WKLV IDPLO\ RI JHQHV :KHQ ZH H[DPLQHG WKH H[SUHVVLRQ RI WKH KXPDQ +$ KLVWRQH JHQH LQ WKH KHWHURORJRXV & FHOOV ZH IRXQG WKDW RQO\ D OLPLWHG QXPEHU RI FRSLHV ZHUH H[SUHVVHG ,Q DGGLWLRQ ZH IRXQG WKDW DV FRS\ QXPEHU RI WKH KXPDQ +$ JHQH LQFUHDVHG WKH H[SUHVVLRQ RI WKH PRXVH +$ JHQH GHFUHDVHG 7KLV REVHUYDWLRQ KDV EHHQ PDGH SUHYLRXVO\ E\ &DSDVVR DQG +HLQW] f LQ ZKLFK WKH\ IRXQG WKDW LQ D FHOO OLQH ZLWK D KLJK FRS\ QXPEHU RI WKH KXPDQ +$ JHQH S+X+$ FRSLHVf WKH HQGRJHQRXV PRXVH +$ JHQHV ZHUH FRPSOHWHO\ VKXW RII 2XU UHVXOWV DUH VLPLODU DQG VXJJHVWHG FRPSHWLWLRQ IRU WUDQVFULSWLRQ IDFWRUV +RZHYHU ZKHQ WKH KXPDQ +$ JHQH ZDV SUHVHQW LQ YHU\ KLJK FRS\ QXPEHU FHOO OLQHV S)222$PO FRSLHV DQG S)PO FRSLHVf QHLWKHU WKH PRXVH QRU KXPDQ +$ JHQHV ZHUH H[SUHVVHG WR DQ\ VLJQLILFDQW H[WHQW :H IHHO WKDW LW LV OLNHO\ WKDW

PAGE 187

WKH UHJXODWRU\ PROHFXOHV QHFHVVDU\ IRU WUDQVFULSWLRQDO FRQWURO DUH OLPLWHG DQG ZKHQ VSUHDG DPRQJ D ODUJH QXPEHU RI WUDQVFULSWLRQ XQLWV QRQH RI WKH XQLWV KDV D IXOO FRPSOHPHQW 'XULQJ WKH FRXUVH RI RXU VWXGLHV ZH KDYH GHPRQVWUDWHG WKDW WKH HQGRJHQRXV PRXVH + DQG WUDQVIHFWHG KXPDQ + KLVWRQH JHQHV DUH LQ GLUHFW FRPSHWLWLRQ IRU D OLPLWHG WUDQVFULSWLRQ IDFWRU *HQRPLF VHTXHQFLQJ H[SHULPHQWV GHVFULEHG LQ FKDSWHU GHPRQVWUDWHG WKDW ZH FRXOG GHWHFW ELQGLQJ Q YLYR RI D SURWHLQ WR WKH 6SO VLWH ESf ORFDWHG LQ 6LWH :H ZHUH QHYHU DEOH WR GHPRQVWUDWH LQ YLYR ELQGLQJ WR 6LWH ,, DOWKRXJK WKH H[LVWHQFH RI WKH IDFWRUV LQ PRXVH FHOOV KDV EHHQ GHPRQVWUDWHG LQ YLWUR E\ $QGU YDQ :LMQHQ SHUVRQDO FRPPXQLFDWLRQf 7KH JHQRPLF VHTXHQFLQJ H[SHULPHQWV WKDW ZH KDYH GHVFULEHG DOVR GHPRQVWUDWHG WKDW WKH ELQGLQJ WR WKH 6SO VLWH ZDV WLWUDWDEOH ZLWK LQFUHDVHG FRS\ QXPEHU RI WKH S) FRQVWUXFW %LQGLQJ ZDV GHWHFWHG LQ FHOO OLQHV S)0 f§ FRSLHVf DQG S)0 FRSLHVf EXW QRW LQ S)0O FRSLHVf 7KLV VXJJHVWHG WKDW WKH LQWHUDFWLRQ DW WKH 6SO VLWH ZDV WLWUDWDEOH HYHQ WKRXJK 6SO LV NQRZQ WR EH DQ DEXQGDQW WUDQVFULSWLRQ IDFWRU '\QDQ DQG 7MLDQ f 3HUKDSV WKH ELQGLQJ RI 6SO WR WKLV VHTXHQFH LV GHSHQGHQW RQ WKH LQWHUDFWLRQ ZLWK DGMDFHQW KLVWRQH VSHFLILF WUDQVFULSWLRQ IDFWRUV WKDW ZH KDYH EHHQ XQDEOH WR GHWHFW ZLWK JHQRPLF VHTXHQFLQJ 2XU LQDELOLW\ WR GHWHFW WKH SURWHLQ'1$ LQHUDFWLRQV DW 6LWH LQ WKH PRXVH FHOO OLQHV PD\ VLPSO\ UHIOHFW PLQRU GLIIHUHQFHV LQ DQDORJRXV ELQGLQJ SURWHLQV EHWZHHQ WKH PRXVH DQG KXPDQ FHOOV 7KHVH H[SHULPHQWV VXSSRUW WKH FRQWHQWLRQ WKDW WKH + KLVWRQH JHQHV LQ WKH PRXVH FHOO OLQHV GLUHFWO\ FRPSHWHG IRU D OLPLWLQJ WUDQVFULSWLRQ IDFWRU RU IDFWRUV WKDW IXQFWLRQ LQ WKH UHJXODWLRQ RI + KLVWRQH JHQH H[SUHVVLRQ LQ YLYR

PAGE 188

,Q FRQFOXVLRQ RXU VWXGLHV KDYH GHVFULEHG WKH IXQFWLRQDO UROH RI WUDQVFULSWLRQ IDFWRU LQWHUDFWLRQV VHHQ DW ERWK 6LWH DQG 6LWH ,, 6LWH ,, ZDV UHTXLUHG IRU LQLWLDWLRQ RI WUDQVFULSWLRQ DQG 6LWH DXJPHQWHG WKH OHYHO RI WUDQVFULSWLRQ LQ D SRVLWLYH PDQQHU :H FRQFOXGHG WKDW LQ PRXVH & FHOOV DQ HQKDQFHUOLNH HOHPHQW LQ WKH IDU XSVWUHDP UHJLRQ RI WKH + SURPRWHU ZDV QRW DFWLYH 7KH SRVVLELOLW\ RI D QHJDWLYH UHJXODWRU\ HOHPHQW ZDV LQYHVWLJDWHG DQG RXU UHVXOWV VXJJHVW WKDW WKH VHTXHQFHV XSVWUHDP RI ES DUH UHVSRQVLEOH 7KH VHTXHQFHV IURP WR ES ZHUH VKRZQ WR EH b $7 DQG FRQWDLQ SXWDWLYH QXFOHDU PDWUL[ DWWDFKPHQW DQG WRSRLVRPHUDVH ,, VLWHV 7KH UHVXOWV RI RXU VWXGLHV VXJJHVW WKDW WKH SURPRWHU RI WKH ) + KLVWRQH JHQH DV GHILQHG LQ YLYR PD\ EH PRUH H[WHQVLYH WKDQ SUHYLRXVO\ WKRXJKW )XUWKHU GHOHWLRQ DQDO\VLV DQG LQYHVWLJDWLRQ ZLOO GHVFULEH WKH VSHFLILF VHTXHQFHV UHVSRQVLEOH IRU WKH WUDQVFULSWLRQDO UHJXODWLRQ RI WKLV JHQH LQ YLYR

PAGE 189

$33(1',; $ 6$03/( &23< 180%(5 &$/&8/$7,21 7R GHWHUPLQH WKH FRS\ QXPEHU RI HDFK PRQRFORQDO FHOO OLQH WKH KXPDQ + JHQH VLJQDO PRXVH 6 ULERVRPDO VLJQDO DQG SODVPLG '1$ VWDQGDUGV ZHUH VXEMHFW WR GHQVLWRPHWULF DQDO\VLV DV GHVFULEHG LQ &KDSWHU ,, 2QFH FRPSOHWHG DOO WKH FRS\ QXPEHU EORWV ZHUH FRPSDUHG WR HDFK RWKHU YLVXDOO\ DQG RQ HDFK EORW RI HTXLYDOHQW OHQJWK H[SRVXUH DQ 6 ULERVRPDO EDQG ZDV DV WKH VWDQGDUG IRU WKDW H[SHULPHQW 7KLV GHFLVLRQ LQYROYHG FRPSDULVRQ RI PDQ\ ILOPV DQG WKH SKRWRJUDSKV RI WKH JHOV SULRU WR WUDQVIHU (YHU\ HIIRUW ZDV PDGH WR HQVXUH WKDW HTXLYDOHQW VWDQGDUGV ZHUH SLFNHG IURP WKH GLIIHUHQW H[SHULPHQWV $Q H[DPSOH FDOFXODWLRQ LV JLYHQ EHORZ IRU WKH FHOO OLQH S)$P 7KH GHQVLWRPHWULF YDOXHV GHWHUPLQHG DUH OLVWHG EHORZ IRU HDFK YDULDEOH 5LERVRPDO 6WDQGDUG 5VWGf GHQVLWRPHWU\ XQLWV '8f S)$ 5LERVRPDO YDOXH 65VWGf '8 S)$ KXPDQ YDOXH +9f '8 SJ FRSLHVGLSORLG JHQRPHf FRQWURO '8 '8FRS\ SJ FRSLHVGLSORLG JHQRPHf FRQWURO '8 '8FRS\ SJ FRSLHVGLSORLG JHQRPHf FRQWURO '8 '8FRS\ S)$P FRS\ QXPEHU 5VWG [ +9 [ 65VWG SODVPLG FRQWURO

PAGE 190

$33(1',; % 6$03/( &$/&8/$7,21 2) +80$1 + (;35(66,21 7KLV H[DPSOH VHUYHV WR LOOXVWUDWH KRZ WKH PRXVH + LQWHUQDO FRQWURO DQG WKH SODVPLG '1$ PDUNHUV ZHUH XVHG WR FDOFXODWH WKH OHYHO RI KXPDQ + H[SUHVVLRQ 7KH H[DPSOH SUHVHQWHG KHUH LV IRU WKH FHOO OLQH S)P 3HUWLQHQW QXPEHUV DUH OLVWHG DQG WKHQ WKH FDOFXODWLRQ LV GRQH %HFDXVH RI WKH GLIIHUHQFHV LQ WKH LQWHQVLWLHV RI 6, SURWHFWHG IUDJPHQWV WKH PRXVH DQG KXPDQ + YDOXHV KDG WR EH GHWHUPLQHG IURP GLIIHUHQW OHQJWK H[SRVXUHV +XPDQ + GHQVLWRPHWU\ YDOXH GD\ H[SRVXUHf '8 0RXVH + GHQVLWRPHWU\ YDOXH KRXU H[SRVXUHf '8 S%5+SD,, PDUNHU EDQG KRXU H[SRVXUHf '8 S%5+SD,, PDUNHU EDQG GLOXWLRQ GD\ H[SRVXUHf '8 &DOFXODWLRQ f [ XQLWV f WKH IROG GLIIHUHQFH IURP KRXUV WR GD\V H[SRVXUHf f > [ @ KXPDQPRXVH H[SUHVVLRQ UDWLR

PAGE 191

$33(1',; & 7$%/( 2) &216758&76 &RQVWUXFW nVHDXHQFH ESf 9HFWRU &RPPHQWV S%5 %DO GHOHWLRQ RI S)$ S%5 %DO GHOHWLRQ RI S)$ S%5 %DO GHOHWLRQ RI S)2$ S%5 %DO GHOHWLRQ RI S)2O$ / S%5 %DO GHOHWLRQ RI S)2O$ S)$ S%5 n VLWH +LQGL,, f S); S8& n VLWH ;EDO f S) S8& n VLWH 3VW, f S) S8& n VLWH ;EDO S)( S8& n VLWH ;EDO S)'O S8& n VLWH 3VW, S) S8& n VLWH 3VW, S)222O WR S%5 ,QWHUQDO GHOHWLRQ RI S) S) S8& n VLWH ;EDO S) S) S8& VDPH RULHQWDWLRQ DV JHQRPLF S)5 S) S8& RSSRVLWH RULHQWDWLRQ S) ES S8& VDPH RULHQWDWLRQ DV JHQRPLF (FR5,;EDO IUDJPHQW IURP S) S)%6 %OXHVFULSW 0 S)%6GHO %OXHVFULSW 0 ([RQXFOHDVH ,,, GHOHWLRQ S)%6GHO %OXHVFULSW 0 ([RQXFOHDVH ,,, GHOHWLRQ

PAGE 192

5()(5(1&(6 $UWLVKHYVN\ $ :RRGHQ 6 6KDUPD $ 5HVHQGH] -U ( /HH $ &HOOF\FOH UHJXODWRU\ VHTXHQFHV LQ D KDPVWHU KLVWRQH SURPRWHU DQG WKHLU LQWHUDFWLRQV ZLWK FHOOXODU IDFWRUV 1DWXUH %DFKHOHU / 7 6PLWK 7UDQVFULSWLRQ RI LVRODWHG PRXVH OLYHU FKURPDWLQ %LRFKHPLVWU\ %DQHUML 2OVRQ / 6FKDIIQHU : $ O\PSKRF\WH HQKDQFHU LV ORFDWHG GRZQVWUHDP RI WKH MRLQLQJ UHJLRQ LQ WKH LPPXQRJOREXOLQ KHDY\ FKDLQ JHQHV &HOO %DQHUML 5XVFRQL 6 6FKDIIQHU : ([SUHVVLRQ RI D c JORELQ JHQH LV HQKDQFHG E\ UHPRWH 69 '1$ VHTXHQFHV &HOO %DQLDKPDG $ 0XOOHU 0 6WHLQHU &K 5HQNDZLW] 5 $FWLYLW\ RI WZR GLIIHUHQW VLOHQFHU HOHPHQWV RI WKH FKLFNHQ O\VR]\PH JHQH FDQ EH FRPSHQVDWHG E\ HQKDQFHU HOHPHQWV (0%2 %DXPEDFK / 0DUDVKL ) 3OXPE 0 6WHLQ 6WHLQ ,QKLELWLRQ RI '1$ UHSOLFDWLRQ FRRUGLQDWHO\ UHGXFHV FHOOXODU OHYHOV RI FRUH DQG +L KLVWRQH P51$V UHTXLUHPHQW IRU SURWHLQ V\QWKHVLV %LRFKHPLVWU\ %DXPEDFK / 6WHLQ 6WHLQ 5HJXODWLRQ RI KXPDQ KLVWRQH JHQH H[SUHVVLRQ WKH FRQWULEXWLRQV RI WUDQVFULSWLRQDO DQG SRVW WUDQVFULSWLRQDO FRQWURO WR WKH FRXSOLQJ RI KLVWRQH P51$ VWDELOLW\ ZLWK '1$ UHSOLFDWLRQ %LRFKHPLVWU\ %HNKRU 5XQJ 0 %RQQHU 6HTXHQFHVSHFLILF LQWHUDFWLRQV RI '1$ DQG FKURPRVRPDO SURWHLQV 0RO %LRO %HQGLJ 0 0 +HQWVFKHO & & 7UDQVFULSWLRQ RI VHD XUFKLQ KLVWRQH JHQHV LQ +H/D FHOOV 1XFO $FLGV 5HV %HQGLJ 0 0 7KRPDV 7 )RON : 5 5HJXODWRU\ PXWDQWV RI SRO\RPD YLUXV GHIHFWLYH LQ '1$ UHSOLFDWLRQ DQG WKH V\QWKHVLV RI HDUO\ SURWHLQV &HOO %HQHFK 3 0RU\ < 5HYHO 0 &KHEDWK 6WUXFWXUH RI WZR IRUPV RI WKH LQWHUIHURQLQGXFHG nnfROLJR $ V\QWKHWDVH RI KXPDQ FHOOV EDVHG RQ F'1$V DQG JHQH VHTXHQFHV (0%2

PAGE 193

%HQRLVW & &KDPEQ 3 'HOHWLRQV FRYHULQJ WKH SXWDWLYH SURPRWHU UHJLRQ RI HDUO\ P51$V RI VLPLDQ YLUXV GR QRW DEROLVK 7 DQWLJHQ H[SUHVVLRQ 3URF 1DWO $FDG 6FL 86$ %HUN $ 6KDUS 3 $ 6L]LQJ DQG PDSSLQJ RI HDUO\ DGHQRYLUXV P51$V E\ JHO HOHFWURSKRUHVLV RI 6, HQGRQXFOHDVH GLJHVWHG K\EULGV &HOO %HUN $ 6KDUS 3 $ 6SOLFHG HDUO\ P51$6 RI VLPLDQ YLUXV 3URF 1DWO $FDG 6FL 86$ %LHQ] 0 3HOKDP + 5 % +HDW VKRFN UHJXODWRU\ HOHPHQWV IXQFWLRQ DV DQ LQGXFLEOH HQKDQFHU LQ WKH [HQRSXV KVS JHQH DQG ZKHQ OLQNHG WR D KHWHURORJRXV SURPRWHU &HOO %LHQ]7DGPRU % =DNXW+RXUL 5 /LEUHVFR 6 *LYRO 2UHQ 0 7KH n UHJLRQ RI WKH S JHQH HYROXWLRQDU\ FRQVHUYDWLRQ DQG HYLGHQFH IRU D QHJDWLYH UHJXODWRU\ HOHPHQW (0%2 %LUNHQPHLHU ( + %URZQ ' -RUGDQ ( $ QXFOHDU H[WUDFW RI ;HQRSXV ODHYLV RRF\WHV WKDW DFFXUDWHO\ WUDQVFULEHV 6 51$ JHQHV &HOO %ORFK 3 0DFTXLJJ 5 $ %UDFN 6 :X -5 7KH V\QWKHVLV RI GHR[\ULERQXFOHLF DFLG DQG KLVWRQH LQ WKH RQLRQ URRW PHULVWHP &HOO %LRO %RUXQ 7 : 6FKDUII 0 5REELQV ( 5DSLGO\ ODEHOHG SRO\ULERVRPHDVVRFLDWHG 51$ KDYLQJ WKH SURSHUWLHV RI KLVWRQH PHVVHQJHU 3URF 1DWO $FDG 6FL 86$ %RXUJHRLV 6 &RKQ 0 2UJHO / ( 6XSSUHVVLRQ RI DQG FRPSOHPHQWDWLRQ DPRQJ PXWDQWV RI WKH UHJXODWRU\ JHQH RI WKH ODFWRVH RSHURQ RI (VFKHULFKLD FROL 0RO %LRO %UHDWKQDFK 5 &KDPEQ 3 2UJDQL]DWLRQ DQG H[SUHVVLRQ RI HXNDU\RWLF VSOLW JHQHV FRGLQJ IRU SURWHLQV $QQ 5HY %LRFKHP %ULJJV 0 .DGRQDJD %HOO 6 7MLDQ 5 3XULILFDWLRQ DQG ELRFKHPLFDO FKDUDFWHUL]DWLRQ RI WKH SURPRWHUVSHFLILF WUDQVFULSWLRQ IDFWRU 6SO 6FLHQFH %XVVOLQJHU 0 3RUWPDQQ 0 ,UPLQJHU %LUQVWLHO 0 8ELTXLWRXV DQG JHQHVSHFLILF UHJXODWRU\ n VHTXHQFHV LQ VHD XUFKLQ KLVWRQH '1$ FORQH FRGLQJ IRU KLVWRQH SURWHLQ YDULDQWV 1XFO $FLGV 5HV %XWOHU : % 0XHOOHU & &RQWURO RI KLVWRQH V\QWKHVLV LQ +H/D FHOOV %LRFKHP %LRSK\V $FWD

PAGE 194

&DSDVVR +HLQW] 1 5HJXODWHG H[SUHVVLRQ RI PDPPDOLDQ KLVWRQH + JHQHV LQ YLYR UHTXLUHV D WUDQVDFWLQJ WUDQVFULSWLRQ IDFWRU 3URF 1DWO $FDG 6FL 86$ &DUR]]L 1 0DUDVKL ) 3OXPE 0 =LPPHUPDQ 6 =LPPHUPDQ $ :HOOV 5 ( 6WHLQ 6WHLQ &OXVWHULQJ RI KXPDQ +, DQG FRUH KXPDQ KLVWRQH JHQHV 6FLHQFH &DVH\ / 'L -HVR % 5DR . 5RXDXOW 7 $ .ODXVQHU 5 +DUIRUG % 'HOHWLRQDO DQDO\VLV RI WKH SURPRWHU UHJLRQ RI WKH KXPDQ WUDQVIHUULQ UHFHSWRU JHQH 1XFO $FLGV 5HV &HGDU + )HOVHQIHOG 7UDQVFULSWLRQ RI FKURPDWLQ LQ YLWUR 0RO %LRO &KDPEQ 3 (XNDU\RWLF QXFOHDU 51$ SRO\PHUDVHV $QQ 5HY %LRFKHP &KU\VRJHORV 6 5LOH\ ( 6WHLQ 6WHLQ $ KXPDQ KLVWRQH + JHQH H[KLELWV FHOO F\FOH GHSHQGHQW FKDQJHV LQ FKURPDWLQ VWUXFWXUH FRUUHODWLQJ ZLWK LWV H[SUHVVLRQ 3URF 1DWO $FDG 6FL 86$ &KXUFK (SKUXVVL $ *LOEHUW : 7RQHJDZD 6 &HOOW\SH VSHFLILF FRQWDFWV WR LPPXQRJOREXOLQ HQKDQFHUV LQ QXFOHL 1DWXUH &KXUFK *LOEHUW : *HQRPLF 6HTXHQFLQJ 3URF 1DWO $FDG 6FL 86$ &ODUN 6 .UHLJ 3 $ :HOOV 5 ( ,VRODWLRQ RI D FORQH FRQWDLQLQJ KXPDQ KLVWRQH JHQHV 1XFO $FLGV 5HV &RFNHULOO 3 1 *DUUDUG : 7 &KURPRVRPDO ORRS DQFKRUDJH RI WKH NDSSD LPPXQRJOREXOLQ JHQH RFFXUV QH[W WR WKH HQKDQFHU LQ D UHJLRQ FRQWDLQLQJ WRSRLVRPHUDVH ,, VLWHV &HOO &ROODUW 6WHLQ 6 6WHLQ $ VHULHV RI UHSHWLWLYH '1$ VHTXHQFHV DUH DVVRFLDWHG ZLWK KXPDQ FRUH DQG +, KLVWRQH JHQHV 0RO &HOO %LRFKHP &RQFLQR 0 /HH 5 ) 0HUU\ZHDWKHU 3 DQG :HLQPDQQ 5 7KH DGHQRYLUXV PDMRU ODWH SURPRWHU 7$7$ ER[ DQG LQLWLDWLRQ VLWH DUH ERWK QHFHVVDU\ IRU WUDQVFULSWLRQ LQ YLWUR 1XF $FLGV 5HV &RQWUHUDV 5 DQG )LHUV : ,QLWLDWLRQ RI WUDQVFULSWLRQ LQ SHUPHDEOH 69LQIHFWHG RU QRQLQIHFWHG &9 FHOOV HYLGHQFH IRU PXOWLSOH SURPRWHUV RI 69 ODWH WUDQVFULSWLRQ 1XF $FLGV 5HV

PAGE 195

&RUGHQ :DV\O\N % %XFKZDOGHU $ 6DVVRQH&RUVL 3 .HGLQJHU & &KDPEQ 3 3URPRWHU VHTXHQFHV RI HXNDU\RWLF SURWHLQn FRGLQJ JHQHV 6FLHQFH 'DKPXV 0 ( DQG %RQQHU ,QFUHDVHG WHPSODWH DFWLYLW\ RI OLYHU FKURPDWLQ D UHVXOW RI K\GURFRUWLVRQH DGPLQLVWUDWLRQ 3URF 1DWO $FDG 6FL 86$ 'DLOH\ / +DQOH\ 6 0 5RHGHU 5 +HLQW] 1 'LVWLQFW WUDQVFULSWLRQDO IDFWRUV ELQG VSHFLILFDOO\ WR WZR UHJLRQV RI WKH KXPDQ KLVWRQH + SURPRWHU 3URF 1DWO $FDG 6FL 86$ 'DYLGVRQ )URPHQWDO & $XJHUHDX 3 :LOGHPDQ $ =HQNH 0 &KDPEQ 3 &HOOW\SH VSHFLILF SURWHLQ ELQGLQJ WR WKH HQKDQFHU RI VLPLDQ YLUXV LQ QXFOHDU H[WUDFWV 1DWXUH 'HPHUDF 0 $ FRPSDUDWLYH VWXG\ RI FHUWDLQ ORFL LQ 6DOPRQHOOD &ROG 6SUJ +DUE 6\PS 4XDQW %LRO 'RUQ $ %ROOHNHQV 6WDXE $ %HQRLVW & 0DWKLV $ PXOWLSOLFLW\ RI &&$$7 ER[ELQGLQJ SURWHLQV &HOO '\QDQ : 6 6D]HU 6 7MLDQ 5 6FKLPNH 5 7 7KH WUDQVFULSWLRQ IDFWRU 6SO UHFRJQL]HV D '1$ VHTXHQFH LQ PRXVH GLK\GURIRODWH UHGXFWDVH SURPRWHU 1DWXUH '\QDQ : 6 7MLDQ 5 D ,VRODWLRQ RI WUDQVFULSWLRQ IDFWRUV WKDW GLVFULPLQDWH EHWZHHQ GLIIHUHQW SURPRWHUV UHFRJQL]HG E\ 51$ SRO\PHUDVH ,, &HOO '\QDQ : 6 7MLDQ 5 E 7KH SURPRWHUVSHFLILF WUDQVFULSWLRQ IDFWRU 6SO ELQGV WR XSVWUHDP VHTXHQFHV LQ WKH 69 HDUO\ SURPRWHU &HOO '\QDQ : 6 7MLDQ 5 &RQWURO RI HXNDU\RWLF PHVVHQJHU 51$ V\QWKHVLV E\ VHTXHQFHVSHFLILF '1$ ELQGLQJ SURWHLQV 1DWXUH (IVWUDWLDGLV $ 3RVDNRQ\ 0DQLDWLV 7 /DZQ 5 2n&RQQHOO & 6SLULW] 5 'H5LHO )RUJHW % :HLVVPDQ 6 6OLJKWRP %OHFKO $ 6PLWKLHV %DUDOOH 5 6KRXOGHUV & 3URXGIRRW 1 7KH VWUXFWXUH DQG HYROXWLRQ RI WKH KXPDQ JORELQ JHQH IDPLO\ &HOO (PPHU 0 GH &URPEUXJJKH % 3DVWDQ DQG 3HUOPDQ 5 &\FOLF $03 UHFHSWRU SURWHLQ RI ( FROL ,WV UROH LQ WKH V\QWKHVLV RI LQGXFLEOH HQ]\PHV 3URF 1DWO $FDG 6FL 86$

PAGE 196

(YDQV 7 'H&KLDUD 7 (IVWUDWLDGLV $ $ SURPRWHU RI WKH UDW LQVXOLQOLNH JURZWK IDFWRU ,, JHQH FRQVLVWV RI PLQLPDO FRQWURO HOHPHQWV 0RO %LRO )DUQKDP 3 6FKLPNH 5 7 7UDQVFULSWLRQDO UHJXODWLRQ RI PRXVH GLK\GURIRODWH UHGXFWDVH LQ WKH FHOO F\FOH %LRO &KHP )HLQEHUJ $ 9RJHOVWHLQ % $ WHFKQLTXH IRU UDGLRODEHOOLQJ '1$ UHVWULFWLRQ HQGRQXFOHDVH IUDJPHQWV WR KLJK VSHFLILF DFWLYLW\ $QDO %LRFKHP )H\ /HZLV % *URG]LFNHU 7 %RWKZHOO $ &KDUDFWHUL]DWLRQ RI D IXVHG SURWHLQ VSHFLILHG E\ WKH DGHQRYLUXV VLPLDQ YLUXV K\EULG $G1'OGS 9LURO )ROJHU 5 :RQJ ( $ :DKO &DSHFFKL 0 5 3DWWHUQV RI LQWHJUDWLRQ RI '1$ PLFURLQMHFWHG LQ FXOWXUHG PDPPDOLDQ FHOOV HYLGHQFH IRU KRPRORJRXV UHFRPELQDWLRQ EHWZHHQ LQMHFWHG SODVPLG '1$ PROHFXOHV 0RO &HOO %LRO )RZONHV 0 6KHQN 7 7UDQVFULSWLRQDO FRQWURO UHJLRQV RI WKH DGHQRYLUXV 9$, 51$ JHQH &HOO )URPP 0 %HUJ 3 'HOHWLRQ PDSSLQJ RI '1$ UHJLRQV UHTXLUHG IRU 69 HDUO\ UHJLRQ SURPRWHU IXQFWLRQ LQ YLYR 0RO $SSO *HQHW *DUHO $ $[HO 5 6HOHFWLYH GLJHVWLRQ RI WUDQVFULSWLRQDOO\ DFWLYH RYDOEXPLQ JHQHV IURP RYLGXFW QXFOHL 3URF 1DWO $FDG 6FL 86$ *DVVHU 6 0 /DHPPOL 8 $ JOLPSVH DW FKURPRVRPDO RUGHU 7UHQGV *HQHW *DXE 0 'LHULFK $ $VWLQRWWL 7RXLWRX &KDPEQ 3 7KH FKLFNHQ RYDOEXPLQ SURPRWHU LV XQGHU QHJDWLYH FRQWURO ZKLFK LV UHOLHYHG E\ VWHURLG KRUPRQHV (0%2 *LOEHUW : 0OOHU+LOO % ,VRODWLRQ RI WKH ODF UHSUHVVRU 3URF 1DWO $FDG 6FL 86$ *LOOLHV 6 0RUULVRQ 6 / 2L 9 7 7RQHJDZD 6 $ WLVVXH VSHFLILF HQKDQFHU HOHPHQW LV ORFDWHG LQ WKH PDMRU LQWURQ RI D UHDUUDQJHG LPPXQRJOREXOLQ KHDY\ FKDLQ JHQH &HOO *LOPRXU 5 6 3DXO 5ROH RI QRQKLVWRQH FRPSRQHQWV LQ GHWHUPLQLQJ RUJDQ VSHFLILFLW\ RI UDEELW FKURPDWLQV )(%6 /HWW

PAGE 197

*LOPRXU 5 6 3DXO 51$ WUDQVFULEHG IURP UHFRQVWLWXWHG QXFOHDU SURWHLQ LV VLPLODU WR QDWXUDO 51$ 0RO %LRO *OX]PDQ < 6DPEURRN ) )ULVTXH 5 ([SUHVVLRQ RI HDUO\ JHQHV RI RULJLQGHIHFWLYH PXWDQWV RI 69 3URF 1DWO $FDG 6FL 86$ *RRGERXUQ 6 %XUVWHLQ + 0DQLDWLV 7 7KH KXPDQ S LQWHUIHURQ JHQH HQKDQFHU LV XQGHU QHJDWLYH FRQWURO &HOO *RUPDQ & 0 0RIIDW / ) +RZDUG % + 5HFRPELQDQW JHQRPHV ZKLFK H[SUHVV FKORUDPSKHQLFRO DFHW\OWUDQVIHUDVH LQ PDPPDOLDQ FHOOV 0RO &HOO %LRO *RUPDQ & 0 5LJE\ 3 : /DQH 3 1HJDWLYH UHJXODWLRQ RI YLUDO HQKDQFHUV LQ XQGLIIHUHQWLDWHG HPEU\RQLF VWHP FHOOV &HOO *RWWVFKOLQJ ( &HFK 7 5 &KURPDWLQ VWUXFWXUH RI WKH PROHFXODU HQGV RI 2[\WULFKD PDFURQXFOHDU '1$ SKDVHG QXFOHRVRPHV DQG D WHORPHULF FRPSOH[ &HOO *UDKDP ) YDQ GHU (E $ $ QHZ WHFKQLTXH IRU WKH DVVD\ RI LQIHFWLYLW\ RI DGHQRYLUXV '1$ 9LURO *UDYHV % -RKQVRQ 3 ) 0F.QLJKW 6 / +RPRORJRXV UHFRJQLWLRQ RI D SURPRWHU GRPDLQ FRPPRQ WR WKH 069 /75 DQG WKH +69 WN JHQH &HOO *UHHQ / 9DQ $QWZHUSHQ 5 6WHLQ 6WHLQ 7ULSXWWL 3 (PDQXHO % 6HOGHQ &URFH & $ PDMRU KXPDQ KLVWRQH JHQH FOXVWHU RQ WKH ORQJ DUP RI FKURPRVRPH 6FLHQFH *UHHQ / 6FKODIIHU :ULJKW 0RUHQR / %HUDQG +DJHU 6WHLQ 6WHLQ &HOO F\FOH GHSHQGHQW H[SUHVVLRQ RI D VWDEOH HSLVRPDO KXPDQ KLVWRQH JHQH LV D PRXVH FHOO 3URF 1DWO $FDG 6FL 86$ *URVVFKHGO 5 %LUQVWLHO 0 D 6SDFHU '1$ VHTXHQFHV XSVWUHDP RI WKH 7$7$$$7$ VHTXHQFH DUH HVVHQWLDO IRU SURPRWLRQ RI +$ KLVWRQH JHQH WUDQVFULSWLRQ 3URF 1DWO $FDG 6FL 86$ *URVVFKHGO 5 %LUQVWLHO 0 / E ,GHQWLILFDWLRQ RI UHJXODWRU\ VHTXHQFHV LQ WKH SUHOXGH VHTXHQFHV RI DQ +$ KLVWRQH JHQH E\ WKH VWXG\ RI VSHFLILF GHOHWLRQ PXWDQWV LQ YLYR 3URF 1DWO $FDG 6FL 86$ +DQDKDQ 6WXGLHV RQ WUDQVIRUPDWLRQ RI (VFKHULFKLD FROL ZLWK SODVPLGV 0RO %LRO

PAGE 198

+DQOH\ 6 0 %OHHFNHU & +HLQW] 1 ,GHQWLILFDWLRQ RI SURPRWHU HOHPHQWV QHFHVVDU\ IRU WUDQVFULSWLRQDO UHJXODWLRQ RI D KXPDQ KLVWRQH + JHQH LQ YLWUR 0RO &HOO %LRO +DUYH\ 5 3 5RELQV $ DQG :HOOV 5 ( ,QGHSHQGHQWO\ HYROYLQJ FKLFNHQ KLVWRQH +E JHQHV LGHQWLILFDWLRQ RI D XELTXLWRXV +EVSHFLILF n HOHPHQW 1XF $FLGV 5HV +HLQW] 1 =HUQLN 0 5RHGHU 5 7KH VWUXFWXUH RI WKH KXPDQ KLVWRQH JHQHV FOXVWHUHG EXW QRW WDQGHPO\ UHSHDWHG &HOO +HLQW] 1 6LYH + / 5RHGHU 5 5HJXODWLRQ RI KXPDQ KLVWRQH JHQH H[SUHVVLRQ .LQHWLFV RI DFFXPXODWLRQ DQG FKDQJHV LQ WKH UDWH RI V\QWKHVLV DQG LQ WKH KDOIOLYHV RI LQGLYLGXDO KLVWRQH P51$V GXULQJ WKH +H/D FHOO F\FOH 0RO &HOO %LRO +HLQW] 1 5RHGHU 5 7UDQVFULSWLRQ RI KXPDQ KLVWRQH JHQHV LQ H[WUDFWV IURP V\QFKURQL]HG +H/D FHOOV 3URF 1DWO $FDG 6FL 86$ +HOPV 6 5 YDQ :LMQHQ $ .URHJHU 3 6KLHOV $ 6WHZDUW & 6WHLQ / 6WHLQ 6 ,GHQWLILFDWLRQ RI DQ HQKDQFHUn OLNH HOHPHQW XSVWUHDP IURP D FHOO F\FOH GHSHQGHQW KXPDQ + KLVWRQH JHQH &HOO 3K\V +HQWVFKHO & %LUQVWLHO 0 / 7KH RUJDQL]DWLRQ DQG H[SUHVVLRQ RI KLVWRQH JHQH IDPLOLHV &HOO +RSH $ 6WUXKO )XQFWLRQDO GLVVHFWLRQ RI D HXNDU\RWLF WUDQVFULSWLRQDO DFWLYDWRU SURWHLQ *&1 RI \HDVW &HOO +X 6/ 0DQOH\ '1$ VHTXHQFH UHTXLUHG IRU LQLWLDWLRQ RI WUDQVFULSWLRQ LQ YLWUR IURP WKH PDMRU SURPRWRU RI DGHQRYLUXV 3URF 1DWO $FDG 6FL 86$ +XDQJ 5 & & %RQQHU +LVWRQH D VXSSUHVVRU RI FKURPRVRPDO 51$ V\QWKHVLV 3URF 1DWO $FDG 6FL 86$ ,VHQEHUJ +LVWRQHV $QQ 5HY %LRFKHP ,VK+RURZLF] %XUNH ) 5DSLG DQG HIILFLHQW FRVPLG FORQLQJ 1XF $FLGV 5HV -DFRE ) 0RQRG *HQHWLF UHJXODWRU\ PHFKDQLVPV LQ WKH V\QWKHVLV RI SURWHLQV 0RO %LRO -RKQVRQ $ : +QLOLFD / 6 ,Q YLWUR 51$ V\QWKHVLV DQG QXFOHDU SURWHLQV RI LVRODWHG VHD XUFKLQ HPEU\R QXFOHL %LRFKLP %LRSK\V $FWD

PAGE 199

-RQHV $
PAGE 200

/DUVHQ 3 5 +DUQH\ : 0RRUH ' 5HSUHVVLRQ PHGLDWHV FHOOW\SHVSHFLILF H[SUHVVLRQ RI WKH UDW JURZWK KRUPRQH JHQH 3URF 1DWO $FDG 6FL 86$ /LFKWOHU $ & 6LHUUD ) &ODUN 6 :HOOV 5 ( 6WHLQ 6 6WHLQ / 7KH PXOWLSOH + KLVWRQH P51$V RI +H/D FHOOV DUH HQFRGHG LQ GLIIHUHQW JHQHV 1DWXUH /LQ )/ 6WHUQEHUJ 1 +RPRORJRXV UHFRPELQDWLRQ EHWZHHQ RYHUODSSLQJ WK\PLGLQH NLQDVH JHQH IUDJPHQWV VWDEO\ LQVHUWHG LQWR D PRXVH FHOO JHQRPH 0RO &HOO %LRO /LQGEHUJ 8 3HUVVRQ 7 3KLOLSVRQ / ,VRODWLRQ DQG FKDUDFWHUL]DWLRQ RI DGHQRYLUXV P51$ LQ SURGXFWLYH LQIHFWLRQ 9LURO /LQ[ZHLOHU : +RU] : 5HFRQVWLWXWLRQ H[SHULPHQWV VKRZ WKDW VHTXHQFH VSHFLILF KLVWRQH'1$ LQWHUDFWLRQV DUH WKH EDVLV IRU WKH QXFOHRVRPH SKDVLQJ RQ PRXVH VDWHOOLWH '1$ &HOO /R\WHU $ 6FDQJRV $ 5XGGOH ) + 0HFKDQLVPV RI '1$ XSWDNH E\ PDPPDOLDQ FHOOV )DWH RI H[RJHQRXVO\ DGGHG '1$ PRQLWRUHG E\ WKH XVH RI IOXRUHVFHQW G\HV 3URF 1DWO $FDG 6FL 86$ 0DQGHO / &KDPEQ 3 $QLPDO '1$GHSHQGHQW 51$ SRO\PHUDVHV $QDO\VLV RI WKH 51$V V\QWKHVL]HG RQ 6LPLDQ 9LUXV VXSHUFRLOHG '1$ E\ PDPPDOLDQ 51$ SRO\PHUDVHV $, DQG % (XU %LRFKHP 0DQLDWLV 5 )ULWVFK ( ) 6DPEURRN ,Q 0ROHFXODU FORQLQJ &ROG 6SULQJ +DUERU /DERUDWRU\ &ROG 6SULQJ +DUERU 1< 0DQLDWLV 7 *RRGERXUQ 6 )LVFKHU 5HJXODWLRQ RI LQGXFLEOH DQG WLVVXHVSHFLILF JHQH H[SUHVVLRQ 6FLHQFH 0DQOH\ / )LUH $ &DQR $ 6KDUS 3 $ *HIWHU 0 / '1$GHSHQGHQW WUDQVFULSWLRQ RI DGHQRYLUXV JHQHV LQ D VROXEOH ZKROH FHOO H[WUDFW 3URF 1DWO $FDG $FL 86$ 0DUDVKL ) +HOPV 6 6KLHOV $ 6LOYHUVWHLQ 6 *UHHQVSDQ 6WHLQ 6WHLQ (QKDQFHUIDFLOLWDWHG H[SUHVVLRQ RI SURNDU\RWLF DQG HXNDU\RWLF JHQHV XVLQJ KXPDQ KLVWRQH JHQH n UHJXODWRU\ VHTXHQFHV %LRFKHP &HOO %LRO 0D[DP $ 0 *LOEHUW : 6HTXHQFLQJ HQGODEHOOHG '1$ ZLWK EDVH VSHFLILF FKHPLFDO FOHDYDJHV 0HWK (Q]\PRO 0D[VRQ 5 &RKQ 5 .HGHV / 0RKXQ 7 ([SUHVVLRQ DQG RUJDQL]DWLRQ RI KLVWRQH JHQHV $QQX 5HY %LRFKHP

PAGE 201

0F.QLJKW 6 / .LQJVEXU\ 5 7UDQVFULSWLRQDO FRQWURO VLJQDOV RI D HXNDU\RWLF SURWHLQFRGLQJ JHQH 6FLHQFH 0F.QLJKW 6 7MLDQ 5 7UDQVFULSWLRQDO VHOHFWLYLW\ RI YLUDO JHQHV LQ PDPPDOLDQ FHOOV &HOO 0F.QLJKW 6 / .LQJVEXU\ 5 & 6SHQFH $ 6PLWK 0 7KH GLVWDO WUDQVFULSWLRQ VLJQDOV RI WKH KHUSHVYLUXV WN JHQH VKDUH D FRPPRQ KH[DQXFOHRWLGH FRQWURO VHTXHQFH &HOO 0HOWRQ : 0F(ZDQ & 0F.LH $ % 5HLG $ 0 ([SUHVVLRQ RI WKH PRXVH +357 JHQH GHOHWLRQDO DQDO\VLV RI WKH SURPRWHU UHJLRQ RI DQ ;FKURPRVRPH OLQNHG KRXVHNHHSLQJ JHQH &HOO 0LWFKHOO 3 :DQJ & 7MLDQ 5 3RVLWLYH DQG QHJDWLYH UHJXODWLRQ RI WUDQVFULSWLRQ LQ YLWUR (QKDQFHUELQGLQJ SURWHLQ $3 LV LQKLELWHG E\ 69 7 DQWLJHQ &HOO 0RGULFK 3 $QUDNX < /HKPDQ 5 'HR[\ULERQXFOHLF DFLG OLJDVH ,VRODWLRQ DQG SK\VLFDO FKDUDFWHUL]DWLRQ RI WKH KRPRJHQHRXV HQ]\PH IURP (VFKHULFKLD FDOL %LRO &KHP 0RRUPDQ $ ) 0 GH/DDI 5 7 0 'HVWUHH + 7HOIRUG %LUQVWLHO 0 / +LVWRQH JHQHV IURP ;HQRSXV ODHYLV PROHFXODU FORQLQJ DQG LQLWLDO FKDUDFWHUL]DWLRQ *HQH 0RUHQR / &KU\VRJHORV 6 $ 6WHLQ 6 6WHLQ / 5HYHUVLEOH FKDQJHV LQ WKH QXFOHRVRPDO RUJDQL]DWLRQ RI D KXPDQ + KLVWRQH JHQH GXULQJ WKH FHOO F\FOH %LRFKHPLVWU\ 0XJOLD / 5RWKPDQ'HQHV / &HOO W\SHVSHFLILF QHJDWLYH UHJXODWRU\ HOHPHQW LQ WKH FRQWURO UHJLRQ RI WKH UDW DOSKD IHWRSURWHLQ JHQH 3URF 1DWO $FDG 6FL 86$ 0\HUV 5 0 7LOO\ 0DQLDWLV 7 )LQH VWUXFWXUH JHQHWLF DQDO\VLV RI D JORELQ SURPRWHU 6FLHQFH 1DVP\WK $ UHSHWLWLYH '1$ VHTXHQFH WKDW FRQIHUV FHOOF\FOH 67$57 &'&fGHSHQGHQW WUDQVFULSWLRQ RI WKH +2 JHQH LQ \HDVW &HOO 1DWKDQV 6PLWK + 5HVWULFWLRQ HQGRQXFOHDVHV LQ WKH DQDO\VLV DQG UHVWUXFWXULQJ RI '1$ PROHFXOHV $QQ 5HY %LRFKHP 1J 6 < 3DUNHU & 6 5RHGHU 5 7UDQVFULSWLRQ RI FORQHG ;HQRSXV 6 51$ JHQHV E\ ;cB ODHYLV 51$ SRO\PHUDVH ,,, LQ UHFRQVWLWXWHG V\VWHPV 3URF 1DWO $FDG 6FL 86$

PAGE 202

1LU 8 :DONHU 0 5XWWHU : 5HJXODWLRQ RI UDW LQVXOLQ JHQH H[SUHVVLRQ HYLGHQFH IRU QHJDWLYH UHJXODWLRQ LQ QRQSDQFUHDWLF FHOOV 3URF 1DWO $FDG 6FL 86$ 3DUN : 6WHLQ / 6WHLQ 6 $FWLYDWLRQ RI LQ YLWUR KLVWRQH JHQH WUDQVFULSWLRQ IURP +H/D 6 FKURPDWLQ E\ VSKDVH QRQKLVWRQH FKURPRVRPDO SURWHLQV %LRFKHPLVWU\ 3DXO *LOPRXU 5 6 7HPSODWH DFWLYLW\ RI '1$ LV UHVWULFWHG LQ FKURPDWLQ 0RO %LRO 3DXO *LOPRXU 5 6 2UJDQVSHFLILF UHVWULFWLRQ RI WUDQVFULSWLRQ LQ PDPPDOLDQ FKURPDWLQ 0RO %LRO 3DXOL 8 &KU\VRJHORV 6 6WHLQ 6WHLQ 1LFN + 3URWHLQ'1$ LQWHUDFWLRQV LQ YLYR XSVWUHDP RI D FHOO F\FOHUHJXODWHG KXPDQ + KLVWRQH JHQH 6FLHQFH 3HUXFKR 0 +DQDKDQ :LJOHU 0 *HQHWLF DQG SK\VLFDO OLQNDJH RI H[RJHQRXV VHTXHQFHV LQ WUDQVIRUPHG FHOOV &HOO 3HUXFKR 0 :LJOHU 0 /LQNDJH DQG H[SUHVVLRQ RI IRUHLJQ '1$ LQ FXOWXUHG DQLPDO FHOOV &ROG 6SULQJ +DUERU 6\PS 4XDQW %LRO 3LFDUG 6FKDIIQHU : $ O\PSKRF\WHVSHFLILF HQKDQFHU LQ WKH PRXVH LPPXQRJOREXOLQ NDSSD JHQH 1DWXUH 3OXPE 0 $ 6WHLQ / 6WHLQ D ,QIOXHQFH RI '1$ V\QWKHVLV LQKLELWLRQ RQ WKH FRRUGLQDWH H[SUHVVLRQ RI FRUH KXPDQ KLVWRQH JHQHV GXULQJ 6 SKDVH 1XFO $FLGV 5HV 3OXPE 0 6WHLQ 6WHLQ E &RRUGLQDWH UHJXODWLRQ RI PXOWLSOH KLVWRQH P51$V GXULQJ WKH FHOO F\FOH LQ +H/D FHOOV 1XFO $FLGV 5HV 3UHVFRWW 0 7KH V\QWKHVLV RI WRWDO PDFURQXFOHDU SURWHLQ KLVWRQH DQG '1$ GXULQJ WKH FHOO F\FOH LQ (XSORWHV HU\VWRPXV &HOO %LR 3ULEQRZ %DFWHULRSKDJH 7 HDUO\ SURPRWHUV QXFOHRWLGH VHTXHQFHV RI WZR 51$ SRO\PHUDVH ELQGLQJ VLWHV 0RO %LRO 3WDVKQH 0 *HQH UHJXODWLRQ E\ SURWHLQV DFWLQJ QHDUE\ DQG DW D GLVWDQFH 1DWXUH 3XOP : .QLSSHUV 5 7UDQVIHFWLRQ RI PRXVH ILEUREODVW FHOOV ZLWK D SURPRWHUOHVV +HUSHV 6LPSOH[ 9LUXV WK\PLGLQH NLQDVH JHQH QXPEHU RI LQWHJUDWHG JHQH FRSLHV DQG VWUXFWXUH RI VLQJOH DQG DPSOLILHG JHQH VHTXHQFHV 0RO &HOO %LRO

PAGE 203

5HPPHUV ( )
PAGE 204

6DZDGDJR 0 6 5RHGHU 5 )DFWRUV LQYROYHG LQ VSHFLILF WUDQVFULSWLRQ E\ KXPDQ SRO\PHUDVH ,, DQDO\VLV E\ D UDSLG DQG TXDQWLWDWLYH LQ YLWUR DVVD\ 3URF 1DWO $FDG 6FL 86$ 6HLOHU7X\QV $ %LUQVWLHO 0 / 6WUXFWXUH DQG H[SUHVVLRQ LQ /FHOOV RI D FORQHG + KLVWRQH JHQH RI WKH PRXVH 0RO %LRO 6HQ 5 %DOWLPRUH 0XOWLSOH QXFOHDU IDFWRUV LQWHUDFW ZLWK WKH LPPXQRJOREXOLQ HQKDQFHU VHTXHQFHV &HOO 6HUIOLQJ ( -DVLQ 0 6FKDIIQHU : (QKDQFHUV DQG HXNDU\RWLF JHQH WUDQVFULSWLRQ 7UHQGV *HQHW 6KDUS 3 $ *DOOLPRUH 3 + )OLQW 6 0DSSLQJ RI DGHQRYLUXV 51$ VHTXHQFHV LQ O\WLFDOO\ LQIHFWHG FHOOV DQG WUDQVIRUPHG FHOO OLQHV &ROG 6SULQJ +DUERU 6\PS 4XDQW %LRO 6KHQN 7 7UDQVFULSWLRQDO FRQWURO UHJLRQV QXFOHRWLGH VHTXHQFH UHTXLUHPHQWV IRU LQLWLDWLRQ E\ 51$ SRO\PHUDVH ,, DQG ,,, &XUUHQW 7RSLFV LQ 0LFURELRORJ\ DQG ,PPXQRORJ\ 6LHUUD ) /LFKWHU $ 0DUDVKL ) 5LFNLHV 5 9DQ '\NH 7 &ODUN 6 :HOOV 6WHLQ 6WHLQ 2UJDQL]DWLRQ RI KXPDQ KLVWRQH JHQHV 3URF 1DWO $FDG 6FL 86$ 6LHUUD ) 6WHLQ 6WHLQ 6WUXFWXUH DQG LQ YLWUR WUDQVFULSWLRQ RI D KXPDQ + KLVWRQH JHQH 1XFO $FLGV 5HV 6LPSVRQ 5 6WUXFWXUH DQG IXQFWLRQ RI FKURPDWLQ $GY (Q]\PRO 6LQJHU6DP .HLWK + 7DQL 6LPPHU 5 / 6KLYHO\ / /LQGVD\ 6
PAGE 205

6RXWKHUQ ( + 'HWHFWLRQ RI VSHFLILF VHTXHQFHV DPRQJ '1$ IUDJPHQWV VHSDUDWHG E\ JHQ HOHFWURSKRUHVLV 0RO %LRO 6RXWKHUQ 3 %HUJ 3 7UDQVIRUPDWLRQ RI DQLPDO FHOOV WR DQWLELRWLF UHVLVWDQFH ZLWK D EDFWHULDO JHQH XQGHU FRQWURO RI WKH 69 HDUO\ UHJLRQ SURPRWHU 0RO $SSO *HQHW 6WHLQ 6 6SHOVEHUJ 7 & .OHLQVPLWK / 1RQKLVWRQH FKURPRVRPDO SURWHLQV DQG JHQH UHJXODWLRQ 6FLHQFH 6WHLQ 3DUN : 7KUDOO & 0DQV 5 6WHLQ 5HJXODWLRQ RI FHOO F\FOH VWDJHVSHFLILF WUDQVFULSWLRQ RI KLVWRQH JHQHV IURP FKURPDWLQ E\ QRQKLVWRQH FKURPRVRPDO SURWHLQV 1DWXUH 6WHLQ 6 6LHUUD ) 6WHLQ / 3OXPE 0 $ 0DUDVKL ) &DUR]]L 1 3URNRSS %DXPEDFK / 2UJDQL]DWLRQ DQG H[SUHVVLRQ RI KXPDQ KLVWRQH JHQHV ,Q +LVWRQH *HQHV SS -RKQ :LOH\ DQG 6RQV 1HZ
PAGE 206

7RR]H 0ROHFXODU %LRORJ\ RI 7XPRU 9LUXVHV '1$ 7XPRU 9LUXVHV QG (G SDUW UHYLVHGf &ROG 6SUJ +DUE &ROG 6SULQJ +DUERU /DERUDWRU\ 7UDYHUV $ $ '1$ EHQGLQJ DQG QXFOHRVRPH SRVLWLRQLQJ 7UHQGV %LRFKHP 6FL 7UHLVPDQ 5 0DQLDWLV 7 6LPLDQ YLUXV HQKDQFHU LQFUHDVHV WKH QXPEHU RI 51$ SRO\PHUDVH ,, PROHFXOHV RQ OLQNHG '1$ 1DWXUH 7ULSXWWL 3 (PDQXHO % &URFH & *UHHQ / 6WHLQ 6WHLQ +XPDQ KLVWRQH JHQHV PDS WR PXOWLSOH FKURPRVRPHV 3URF 1DWO $FDG 6FL 86$ 7VDL 0 7RZOH + & +DUULV 6 ( 2n0DOOH\ % : (IIHFW RI HVWURJHQ RQ JHQH H[SUHVVLRQ LQ WKH FKLFN RYLGXFW &RPSDUDWLYH DVSHFWV RI 51$ FKDLQ LQLWLDWLRQ LQ FKURPDWLQ XVLQJ KRPRORJRXV YHUVXV (VFKHULFKLD FROL 51$ SRO\PHUDVH %LRO &KHP 7XOOLV 5 + 5XELQ + &DOFLXP SURWHFWV '1DVHO IURP SURWHLQDVH $ QHZ PHWKRG IRU WKH UHPRYDO RI FRQWDPQDWLQJ 51DVH IURP '1$VHO $QDO %LRFKHP YDQ :LMQHQ $ 6WHLQ 6 6WHLQ / $ QXFOHDU SURWHLQ ZLWK DIILQLW\ IRU WKH n IODQNLQJ UHJLRQ RI D FHOO F\FOH GHSHQGHQW KXPDQ KLVWRQH + JHQH LQ YLWUR 1XFO $FLGV 5HV YDQ :LMQHQ $ :ULJKW / 0DVVXQJ 5 ) *HUUHWVHQ 6WHLQ / 6WHLQ 6 7ZR WDUJHW VLWHV IRU SURWHLQ ELQGLQJ LQ WKH SURPRWHU UHJLRQ RI D FHOO F\FOH UHJXODWHG KXPDQ +, KLVWRQH JHQH 1XFO $FLGV 5HV :DV\O\N % 'HUE\VKLUH 5 *X\ $ 0RONR 5RJHW $ 7HROXH 5 &KDPEQ 3 6SHFLILF LQ YLWUR WUDQVFULSWLRQ RI FRQDOEXPLQ JHQH LV GUDVWLFDOO\ GHFUHDVHG E\ D VLQJOHSRLQW PXWDWLRQ LQ 7$7$ ER[ KRPRORJ\ VHTXHQFH 3URF 1DWO $FDG 6FL 86$ :DV\O\N & :DV\O\N % 7KH LPPXQRJOREXOLQ KHDY\FKDLQ % O\PSKRF\WH HQKDQFHU HIILFLHQWO\ VWLPXODWHV WUDQVFULSWLRQ LQ QRQn O\PSKRLG FHOOV (0%2 :HEVWHU 1 -LQ 5 *UHHQ 6 +ROOLV 0 &KDPEQ 3 7KH \HDVW 8$6J LV D WUDQVFULSWLRQDO HQKDQFHU LQ KXPDQ KHOD FHOOV LQ WKH SUHVHQFH RI WKH *$/ WUDQVDFWLYDWRU &HOO :HLO 3 $ 6HJDOO +DUULV % 1J 6< 5RHGHU 5 )DLWKIXO WUDQVFULSWLRQ RI HXNDU\RWLF JHQHV E\ 51$ SRO\PHUDVH ,,, LQ V\VWHPV UHFRQVWLWXWHG ZLWK SXULILHG '1$ WHPSODWHV %LRO &KHP

PAGE 207

:HLQWUDXE + *URXGLQH 0 &KURPRVRPDO VXEXQLWV LQ DFWLYH JHQHV KDYH DQ DOWHUHG FRQIRUPDWLRQ *ORELQ JHQHV DUH GLJHVWHG E\ GHR[\ULERQXFOHDVH LQ UHG EORRG FHOO QXFOHL EXW QRW LQ ILEUREODVW QXFOHL 6FLHQFH :HLQWUDXE + $VVHPEO\ DQG SURSDJDWLRQ RI UHSUHVVHG DQG GHUHSUHVVHG FKURPRVRPDO VWDWHV &HOO :HLVV % 5LFKDUGVRQ & & (Q]\PDWLF EUHDNDJH DQG MRLQLQJ RI GHR[\ULERQXFOHLF DFLG 5HSDLU RI VLQJOHVWUDQG EUHDNV LQ '1$ E\ DQ HQ]\PH V\VWHP IURP ( FROL LQIHFWHG ZLWK 7 EDFWHULRSKDJH 3URF 1DWO $FDG 6FL 86$ :HOOV .HGHV / 6WUXFWXUH RI D KXPDQ KLVWRQH F'1$ HYLGHQFH WKDW EDVDOO\ H[SUHVVHG KLVWRQH JHQHV KDYH LQWHUYHQLQJ VHTXHQFHV DQG HQFRGH SRO\DGHQ\ODWHG P51$V 3URF 1DWO $FDG 6FL 86$ :HOOV ( &RPSLODWLRQ DQDO\VLV RI KLVWRQHV DQG KLVWRQH JHQHV 1XFO $FLGV 5HV :X $GHQRYLUXV '1$GLUHFWHG WUDQVFULSWLRQ RI 6 51$ LQ YLWUR 3URF 1DWO $FDG 6FL 86$ :X 5 6 %RQQHU : 0 3DWWHUQV RI KLVWRQH YDULDQW V\QWKHVLV FDQ GLVWLQJXLVK *R IURP FHOOV &HOO
PAGE 208

%,2*5$3+,&$/ 6.(7&+ 3DXO (GPRQG .URHJHU ZDV ERUQ LQ /RXLVYLOOH .< RQ -DQXDU\ +H ZDV DEOH WR VHH PXFK RI WKH 8QLWHG 6WDWHV EHIRUH WKH DJH RI ZKHQ KLV IDPLO\ ILQDOO\ VHWWOHG LQ :LQVWRQ6DOHP 1& +H DWWHQGHG 5 5H\QROGV 6HQLRU +LJK 6FKRRO ZKHUH KH JUDGXDWHG LQ WKH VSULQJ RI +H HQWHUHG :DNH )RUHVW 8QLYHUVLW\ LQ WKH IDOO RI DQG JUDGXDWHG ZLWK D %$ LQ ELRORJ\ LQ ,Q WKH IDOO RI KH HQWHUHG WKH JUDGXDWH SURJUDP LQ WKH 'HSDUWPHQW RI ,PPXQRORJ\ DQG 0HGLFDO 0LFURELRORJ\ DQG ZDV SDUWLDOO\ VXSSRUWHG LQ KLV VWXGLHV E\ D WUDLQLQJ JUDQW IURP WKH 1DWLRQDO ,QVWLWXWHV RI +HDOWK +H VSHQW DQG D KDOI \HDUV LQ WKH ODE RI 'U :LOOLDP +ROORPDQ VWXG\LQJ HXNDU\RWLF UHFRPELQDWLRQ DQG WKH UHPDLQGHU RI KLV WLPH LQ WKH ODE RI -DQHW DQG *DU\ 6WHLQ SXUVXLQJ KLV WKHVLV SURMHFW ,Q WKH IDOO RI KH PDUULHG &DURO :DUG DQG WKH\ SURGXFHG D JRUJHRXV VRQ $ODQ 6FRWW .URHJHU WKH IROORZLQJ VSULQJ $IWHU JUDGXDWLRQ KH ZLOO SXUVXH D SRVWGRFWRUDO IHOORZVKLS ZLWK 'U 7KRPDV 5RZH LQ WKH 'HSDUWPHQW RI 3KDUPDFRORJ\ DW WKH 8QLYHUVLW\ RI )ORULGD

PAGE 209

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ -D£HW / 6WHLQ &KDLU 3URIHVVRU RI ,PPXQRORJ\ DQG 0HGLFDO 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRL\ WKH GADUHH RI 'RFWRU RI 3KLORVRSK\ DU\ 6 6WHA 3URIHVVRU RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WLKVA GHJUHH RI 'RFWRU RI 3KLORVRSK\ 5LFKDUG : 0R\HU 3URIHVVRU ,PPXQRO 0HGLFDO 0LFURELROR DQG FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQnDQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ I \ :LOOLDP : n+DXVZLUWK 3URIHVVRU RI ,PPXQRORJ\ DQG 0HGLFDO 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ D +DUU\ 2VW[H $VVLVWDQW 3URIHVVRU RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\

PAGE 210

7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI 0HGLFLQH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ $XJXVW 'HDQ &ROOHJH RI 0HGLFLQH 'HDQ *UDGXDWH 6FKRRO

PAGE 211

81,9(56,7< 2) )/25,'$


ANALYSIS OF THE SEQUENCES REQUIRED FOR TRANSCRIPTIONAL
REGULATION OF A HUMAN H4 HISTONE GENE IN VIVO
By
PAUL EDMOND KROEGER
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1988

ACKNOWLEDGEMENTS
I would like to thank Janet and Gary Stein for the opportunity to
work in their laboratory and explore molecular biology from a great
many perspectives. I also appreciate the advice and encouragement of
my other committee members, Drs. Ostrer, Hauswirth and Moyer.
The Stein's laboratory has been filled with many characters over
these last six years and I owe thanks to all of them. I would like to
thank Farhad Marashi, Mark Plumb, and Linda Green (especially Linda)
for their technical expertise and friendship. My fellow graduate
students Gerard Zambetti, Dave Collart, André van Wijnen, and Anna
Ramsey, I thank for their comradeship during the preceding years. The
laboratory would not have been the same without Charles Stewart, Urs
Pauli, and Sue Chrysogelos all of whom have given me new perspectives
on life and science. I thank Tim Morris for his constant good nature,
advice, and stimulating conversions (although we did not always
agree). I would particularly like to thank Ken Wright for our many
successful collaborative adventures in the laboratory, his friendship,
and generosity when it was most needed.
Finally I thank my wife Carol, and our new son, Alan, who have
given me constant inspiration to continue down what has been a long and
unusual path through graduate school. My parents have also been a
constant source of advice and encouragement, and I thank them for their
unending interest.
ii

TABLE OF CONTENTS
page
ACKNOWLEDGEMENTS ii
ABBREVIATIONS v
ABSTRACT vii
CHAPTERS
1 INTRODUCTION 1
Viral model systems 4
Chromatin Studies 5
In vitro transcription 9
Enhancers and Silencers 17
Histone genes 25
2 MATERIALS AND METHODS 37
3 HISTONE H4 5' REGULATORY SEQUENCES 63
Cell line Construction 67
Initiation of Transcription and Basal 68
Regulation
Distal Transcriptional Regulatory 108
Elements
Distal-Proximal Positive Element 129
Enhancer Element 131
Nuclear Run-on Analysis of H4 Transcription.... 139
4 PLASMID INTEGRATION SITES, INTEGRITY, AND 141
PROTEIN/DNA INTERACTIONS
Integrity of Flanking Sequences 142
Location of pSV2neo Plasmid Sequences 153
Compatibility of Mouse and Human Regulatory.... 158
Proteins and Sequences
5 DISCUSSION AND CONCLUSIONS 168
APPENDICES
A SAMPLE COPY NUMBER CALCULATION 181
iii

B SAMPLE CALCULATION OF HUMAN H4 EXPRESSION 182
C TABLE OF CONSTRUCTS 1.83
REFERENCES 184
BIOGRAPHICAL SKETCH 200
iv

KEY TO ABBREVIATIONS
ATP:
Adenosine 5triphosphate
bp:
Base pair
C:
Centigrade
CIP:
Calf intestinal phosphatase
CTP :
Cytidine 5'-triphosphate
DEPC:
Diethylpyrocarbonate
DNA:
Deoxyribonucleic acid
DNase I:
Deoxyribonuclease I
DU:
Densitometry units
EDTA:
Disodium Ethylenediaminetetraacetate
EGTA:
Ethylenebis(oxyethylenenitrilo)tetraacetic acid
GTP:
Guanosine 5'-triphosphate
Hepes:
N-2-hydroxyethylpiperizine-N'-2-ethanesulfonic acid
HU:
Hydroxyurea
1:
Liter
M:
Molar
pCi:
Microcurie
nig:
Milligram
Pg:
Microgram
ml:
Milliliter
/j1:
Microliter
v

mM:
Millimolar
mRNA:
Messenger ribonucleic acid
nm:
Nanometer
nt:
Nucleotides
OD:
Optical density
Pipes:
[1,4-piperazinebis(ethanesulfonic
acid)]
PVS:
Polyvinylsulfate
RNA:
Ribonucleic acid
RNaseA:
Ribonuclease A
rpm:
Revolutions per minute
SDS:
Sodium dodecyl sulfate
SV40
Simian virus 40
TCA:
Trichloroacetic acid
Tris:
Tris(hydroxymethyl)aminomethane +
Hydrochloric acid
TTP:
Thymidine 5triphosphate
VI

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
ANALYSIS OF THE SEQUENCES REQUIRED FOR TRANSCRIPTIONAL
REGULATION OF A HUMAN H4 HISTONE GENE IN VIVO
By
Paul Edmond Kroeger
August 1988
Chairman: Janet Stein
Major Department: Immunology and Medical Microbiology
We have characterized the sequences required for the
transcriptional regulation of the FO108 human H4 histone gene in vivo.
Recombinant cell lines that contained deletion constructs of the H4
promoter region were prepared in mouse C127 cells, and the level of
human H4 histone gene expression was measured by SI nuclease analysis.
We found that the minimal sequences required for the initiation of
transcription from this gene were contained within the 73 nucleotides
5' to the initiation site of transcription. Within this region are
located an in vivo protein binding site (Site II), the GGTCC element
and the TATA box. Deletion of the distal half of Site II abolished site
specific initiation of transcription and demonstrated that the TATA box
and GGTCC element were not sufficient for initiation in vivo. Extension
of the H4 promoter to -100 base pairs resulted in a significant
increase in transcription and this increase correlated with the
Vll

presence of an Spl site in the proximal half of the upstream protein
binding site, Site I. If the promoter region was lengthened to -410
nucleotides, there was a two-fold increase in the level of
transcription. Deletion analysis suggested that the "distal-proximal"
positive element was located from in the region from -210 to -330 base
pairs 5' to the cap site. We investigated the functionality of a
previously identified enhancer-like element located very far upstream
in the pF0116 fragment of A HHG 41 and demonstrated that although it
functioned in HeLa cells it was not functional in mouse C127 cell
lines.
SI analysis of distal deletion constructs supported the idea that a
negative regulatory element of H4 gene transcription was located
between nucleotides -730 and -1010. Analysis of the region
demonstrated consensus sequences for a topoisomerase II site, nuclear
matrix attachment sites, and a very high A/T content (70%) suggestive
of bent DNA. Taken together this set of results implied that the DNA
topology of this region might be important for H4 gene regulation.
Additional studies demonstrated that Alu repetitive sequences in
the histone deletion constructs could mediate specific integration into
the mouse chromosome and that high copy number was possible.
viii

CHAPTER I
INTRODUCTION
The goal of this study has been to assess the contribution of
promoter sequences in the F0108 human H4 histone gene 5' flanking
region to transcriptional regulation of the gene. We have endeavored
to define the sequences necessary for the initiation and augmentation
of transcription. The TATA box, GGTCC element, "CAAT box," "CCAAT box,"
and Spl site have been implicated in transcriptional regulation and are
reviewed below. We have also investigated a putative enhancer-like
element and negative regulatory sequence and so these sequences are
also discussed below.
Historical Background
The concepts governing gene regulation, as we know them today, have
their foundations in the work of many biochemists and geneticists who
introduced the ideas of positive and negative regulation in prokaryotic
gene expression. The observations of many, that the total genetic
potential of a cell was never expressed simultaneously, referred to as
"genetic adaptation," led Jacob and Monod (1961) to address the
question of what controls this phenomenon. In their seminal paper the
"operon model" was proposed. This model described how structural genes
expressed themselves and how that expression was regulated. It had
been known for some time that bacteria could respond to various
1

2
nutrients by synthesizing new metabolic enzymes, so Jacob and Monod
investigated the lactose metabolic pathway of Escherichia coll (E.
coli). Their work was encouraged by many earlier investigators,
including Demerac (1956), who made the observation that genes coding
for similar enzymatic function were located in localized regions of the
Salmonella chromosome. Demerac was able to conclude that the genes he
had investigated were in a nonrandom distribution and that perhaps this
conferred an evolutionary advantage to the organism.
The lac operon is one of the most well studied genetic systems in
all of prokaryotic and eukaryotic molecular biology. The many
intuitive observations and predictions of Jacob and Monod and
colleagues led to the identification of the components of the lac
operon: the repressor, produced by the lac I gene; the lac operator,
promoter, and three linked structural genes. The interplay of inducer
and repressor was demonstrated, and Jacob and Monod proposed that the
lac operon was subject to negative regulation. An initial observation
of Jacob and Monod (1961) was that the control gene would make
repressors that would turn off the structural genes. The isolation of
nonsense mutations in the lac I gene (Bourgeois et al., 1965) provided
convincing evidence for the nature of repressors. Suppression of the
nonsense mutation restored repressor function and demonstrated that
repressor genes encoded repressor proteins. The final proof was the
isolation of the lac repressor by Gilbert and Müller-Hill (1966). In
addition it was demonstrated that the lac operon and others were under
more general control by catabolite activator protein and 3'5'-cyclic-

AMP as it was shown that both are required, in addition to the inducing
molecule, for the operon to be transcribed (Emmer et al., 1970).
The ensuing years have led to refinement of the operon model as
well as its acceptance as one of the general organizational patterns
characteristic of prokaryotes. In particular, the concepts of
protein/DNA interactions, repression, and positive and negative
regulation have carried over into eukaryotic molecular biology and
have served as a basis for unraveling the complexity of the eukaryotic
cell. The extension of these ideas has allowed considerable progress;
however, the original view that all genes, prokaryotic and eukaryotic,
would have similar regulatory and organizational patterns has not been
borne out. In fact there is a great diversity in the regulatory
mechanisms that govern both prokaryotic and eukaryotic gene
expression.
The control of eukaryotic gene regulation has been of obvious
interest, but research has been slower than in prokaryotes because of
the complexity and technical difficulties encountered when working with
the eukaryotic cell. Two avenues of study have predominated in
eukaryotic molecular biology: the investigation of viral models such
as adenovirus and SV40 (as was done with the prokaryotic phages lambda
and T7) and the characterization of cellular genes and the proteins
that regulate their expression.
Eukaryotic molecular biologists have had to develop the appropriate
technology because many of the advantageous prokaryotic techniques are
not directly applicable to eukaryotic systems. Two of the most
important discoveries that have revolutionized molecular biology are

restriction enzymes (reviewed by Nathans and Smith, 1975) and DNA
ligase (Modrich et al., 1973; Weiss and Richardson, 1967). With these
new enzymatic tools the ability to manipulate DNA fragments developed
quickly and was responsible for the present state of advancement.
Viral Model Systems
The utilization of viral model systems for the characterization of
eukaryotic regulatory mechanisms was a logical extension of the work
done in prokaryotes. In particular, adenovirus and SV40 have provided
considerable insights into eukaryotic gene regulation. Without an
understanding of the exact mechanisms involved in the various processes
of RNA transcription and DNA replication, it was obvious to early
investigators that viruses, such as SV40, could invade and eventually
kill the host cell and yet were extremely dependent on the cell's
enzymatic machinery to accomplish their replicative cycle.
Adenoviruses were first isolated by Rowe et al. (1953) as the
agent responsible for the degeneration of human adenoid tissue in
culture. The adenovirus life cycle in human cells has been examined
with respect to the virus - specific proteins produced, replication of
viral DNA, transcription of viral genes, and effect on the host cell
(Reviewed in Tooze, 1980). Initial studies demonstrated that there
were two phases--early and late--in the expression of adenovirus genes
(Lindberg et al., 1972). As a measure of the impact of infection on the
cell, adenovirus mRNA comprises almost all the mRNA bound to
polyribosomes by the end of the replicative cycle (Thomas and Green,
1966) . The early viral mRNA was detected and mapped to precise
locations on the adenovirus genome by R-loop mapping (Thomas et al.,

1976) and hybridization to restriction endonuclease fragments of
adenovirus DNA (Sharp et al., 1975). Restriction enzymes permitted the
mapping and orientation of DNA fragments and transcription units on the
SV40 genome as well (Khoury et al., 1973; Sambrook et al., 1973).
Several laboratories utilized adenovirus/SV40 recombinant hybrids
to define essential genomic regions of each. In particular, the hybrid
viruses were useful in the determination of the functional "helper"
domain of the SV40 T antigen, as adenovirus requires "help" to grow in
nonpermissive cells (Fey et al., 1979). With the mRNA coding regions
mapped on the adenovirus and SV40 genomes, a more informative analysis
and interpretation were initiated which have begun to elucidate the
complex nature of transcriptional regulation in these viruses. The
promoter structure and presence of enhancing/silencing elements in
these viruses have served as continuing models for studies of cellular
promoters and regulatory sequences. Additionally, although not
discussed here, both adenovirus and SV40 were utilized in the discovery
of mRNA splicing (Berk and Sharp, 1977, 1978), which has revolutionized
our concepts of gene regulation and expression.
Chromatin Studies
At the same time that the viral model systems were beginning to be
reasonably well understood, there were a number of investigators
pursuing the characterization of cellular genes and transcriptional
mechanisms. Although restriction enzymes had been discovered (Smith
and Wilcox, 1970) and their applicability realized, it was several
years before their purification and recombinant DNA technology were
worked out to make them sufficiently useful. This lag did not deter a

number of investigators from direct examination of the transcriptional
process in eukaryotic cells. As early as 1962 isolated pea embryo
chromatin had been utilized as a template for transcription (Huang and
Bonner, 1962). Isolated chromatin was incubated with bacterial RNA
polymerase (the purification of eukaryotic RNA polymerases had not been
achieved at this time) and the four ribonucleoside triphosphates. A
comparative analysis of transcription from chromatin and deproteinized
DNA of the same source indicated that the chromatin was less able to
support transcription (Huang and Bonner, 1962). It was postulated that
part of the chromatin was repressed, perhaps due to the presence of
histone proteins bound to the DNA. The amount of transcription
possible from a known quantity of chromatin was referred to as its
template capacity. The determination of template capacity in chick
oviduct, a steroid responsive tissue, led to the observation that the
level of transcription was modulated with the addition of hormone
(Dahmus and Bonner, 1965). The amount of template capacity also
correlated with the various developmental stages of sea urchin growth
(Johnson and Hnilica, 1970). Another more accurate measure of the
"transcriptional capacity" of a sample of chromatin was the number of
RNA polymerase initiation sites. Cedar and Felsenfeld (1973) first
measured the number of E. coli RNA polymerase initiation sites on
chromatin by incubating chromatin and RNA polymerase together in the
absence of ribonucleoside triphosphates. Next, the addition of the
ribonucleoside triphosphates with high levels of ammonium sulfate
permitted elongation but not reinitiation. One of the major criticisms
of this early work was that the use of bacterial RNA polymerase made an

7
accurate interpretation in doubt. Comparative studies were performed
by Mandel and Chambón (1970) and Tsai et al. (1976). These
investigators demonstrated that there was no competition for either
SV40 DNA or calf thymus DNA by the bacterial or eukaryotic RNA
polymerase. However, when Tsai et al. (1976) compared hen oviduct and
E. coli RNA polymerase initiation sites on chick DNA or chick oviduct
chromatin, they found no competition on the DNA, but direct competition
in the chromatin sample. Thus it appeared that chromosomal proteins
could modify the initiation specificity such that both enzymes were
competing for similar sites. To establish this point conclusively, the
product mRNAs had to be examined. Filter hybridization techniques were
developed that permitted the detection of reiterated gene transcripts
and particularly abundant mRNAs. At the level of sensitivity possible
with this methodology, in vitro chromatin transcription appeared to
reflect an accurate view of the transcriptional status in vivo
(Bacheler and Smith, 1976).
The next major advance was the fractionation of chromosomal
proteins in an effort to reconstitute transcriptionally competent DNA
into chromatin in vitro. The first attempts to reconstitute chromatin
were studies by Paul and Gilmour (1966, 1968) and Bekhor et al. (1969)
in which they fractionated chromatin proteins in an attempt to
discover what group of proteins controlled transcriptional. Their
results indicated that the non-histone chromosomal protein (NHCP)
fraction was probably responsible. The role of NHCP in the expression

8
of several genes has been reviewed (Stein et al., 1974; Simpson,
1973).
Experiments became more refined as exemplified by the studies of
Tsai et al. (1976) who examined the inducible ovalbumin gene in the
chick oviduct system. The role of NHCP was established, and through a
series of competition assays with induced and uninduced NHCPs it was
demonstrated that in vitro expression of the ovalbumin gene was
stimulated by the appearance, upon steroid induction, of a positive
regulatory factor. Histones, a moderately reiterated family of genes
(Stein et al., 1984), were also studied in a similar manner to examine
the role of NHCPs. Several studies indicated that NHCPs were involved
in the increased expression of the histone genes during S-phase of the
cell cycle (Park et al., 1976; Stein et al., 1975). Kleinsmith et al.
(1976) extended the characterization and demonstrated that
phosphorylation of the NHCP was necessary for optimal in vitro
expression of the histone genes. When the NHCPs were treated with
phosphatase before addition to the reaction, there was a decrease in
the number of transcription initiation sites.
The role of the histone proteins in transcription has been of great
interest because they form such a close association with the DNA.
Studies with either electron microscopy or nuclease digestion have
demonstrated that there is either a change in the histone/DNA ratio or
a conformational change in the nucleosomes associated with genes
undergoing active transcription (Weintraub and Groudine, 1976). The
chromatin structure of specific genes has also been shown to be
conformationally altered only in tissues where they are

expressed. Examples include the /3-globin gene in chick embryo red
blood cell nuclei and the ovalbumin gene in chick oviduct nuclei
(Garel and Axel, 1976). Also, several investigators have proposed that
nucleosomes might be "phased" on the chromosome so as to render
particular areas of the DNA accessible, or inaccessible, to
transcription factors (Gottschling and Cech, 1984; Linxweiler and Horz,
1985). Thus, at this juncture, it became more realistic to assume that
the chromatin structure of active genes in comparison to silent loci
was a more open and dynamic conformation, yet not necessarily devoid of
histones as had been postulated.
In Vitro Transcription
During the early 1970s, several investigators actively pursued the
activity (or activities) responsible for the synthesis of the various
eukaryotic mRNAs. Almost simultaneously several laboratories were able
to isolate multiple RNA polymerase activities on DEAE-Sephadex columns
(Chambón, 1975; Roeder, 1976). Each peak of activity exhibited a
different susceptibility to the inhibitor amanitin (Kedinger, 1970).
There were differences in the results they obtained as evidenced by the
diverse number of variant RNA polymerase activities that were
originally identified (Roeder, 1976). As the purity of the RNA
polymerase activity increased it became more obvious that there were
three distinct RNA polymerase activities present in eukaryotic cells
(Roeder, 1976). It was very difficult for early investigators to make
progress toward understanding the relationship between the various
eukaryotic RNA polymerases and their respective function in the

10
expression of genes, because adequate templates for transcription in
vitro were not available. The predominant templates used were either
homopolymers, bacteriophage DNA, or fractions of genomic DNA enriched
in either ribosomal or satellite DNA (Chambón, 1975). These proved
unsatisfactory, and the results were often confusing. Several lines of
evidence suggested that ancillary factors were necessary in order for
RNA polymerase, in particular RNA polymerase II, to exhibit template
specific transcription (Chambón, 1975). The application of restriction
enzymes to the manipulation of DNA led to the cloning of specific genes
that were then suitable as templates for in vitro transcription
systems (Nathans and Smith, 1975).
The biological implications of the viral model systems that had
been studied in vivo. and the new DNA cloning technology, prompted
several investigators to develop cell free transcription systems. It
was obvious that it would be advantageous to work with an in vitro
system to dissect the various components of the eukaryotic
transcriptional apparatus. The first in vitro transcription systems
were developed for RNA polymerase III, and shortly thereafter, RNA
polymerase II. RNA polymerase III is responsible for the synthesis of
5S ribosomal RNA (Ng et al., 1979), tRNAs, and a few viral RNAs
including the adenovirus VAI and VAII RNAs (Fowlkes and Shenk, 1980).
Cell free transcription of the Xenopus 5S rRNA gene by RNA polymerase
III was first demonstrated by Birkenmeier et al. (1978) in nuclear
extracts of Xenopus oocytes. At the same time it was shown that
cytoplasmic extracts of human KB cells (Wu, 1978; Weil et al., 1979)
were able to transcribe selectively cloned 5S rRNA, tRNA, and

11
adenovirus VA RNA genes. The cytoplasmic extracts were shown to
contain a majority of the RNA polymerase III activity (Weil et al.,
1979) that had apparently leaked from the nucleus during preparation of
the extract. With respect to RNA polymerase II, Manley et al. (1980)
prepared a concentrated HeLa cell extract that was able to initiate
transcription accurately in vitro at a variety of adenovirus RNA
polymerase II transcriptional control regions.
In vitro transcription was and is a powerful technique for the
investigation of eukaryotic promoter function. The concomitant
development of various molecular techniques for the mutation and
reassortment of DNA sequences was fortuitous, and in a relatively short
period of time the basic sequence requirements of the RNA polymerase II
promoter were delineated (Efstratiadis et al., 1980). Although
considerable refinement has occurred in our knowledge of these
sequences, the basic elements have not changed. One of the first
sequences to be implicated because of similarity to prokaryotic
promoter sequences was the "TATAA" box (Goldberg-Hogness). This A-T
rich stretch is located -25 to -35 bp upstream of the mRNA start site
in RNA polymerase II promoters and is remarkably similar to the Pribnow
box (TATAAT) described for the promoters of prokaryotic genes (Pribnow,
1975). The only real difference is the location of the Pribnow box,
which is at -10 bp from the start of transcription (Rosenberg and
Court, 1979). It should be noted that the comparison of the Pribnow box
with the Hogness box has revealed variations in sequence and some
difference in function. Principally, the Pribnow box is absolutely
required for transcription to occur in prokaryotes; however, as

12
discussed below, the Hogness box is not as stringently required. The
second sequence that has been retained with equally remarkable
similarity is the "CAAT" box. The consensus sequence for this element
is 5'-GGCtCAATCT-3' (Efstratiadis et al., 1980; Dynan and Tjian, 1985)
and is usually located -70 to -80 bp from the mRNA start site.
Although the TATA box and CAAT box have been found in a majority of
RNA polymerase II promoters and appear to be the framework around which
gene specific variations in regulatory sequences occur, there have been
some genes described that have no TATA box (Contreras and Fiers, 1981;
Melton et al., 1986; Reynolds et al., 1984). A subset of these genes
that have instead a highly G-C rich promoter and in general lack the
strict structure created by consensus RNA polymerase II sequences.
Examples include enzymes such as mouse dihydrofolate reductase (Farnham
and Schimke, 1985), hamster 3-hydroxy 3-methylglutaryl coenzyme A
reductase (Reynolds et al., 1984), and human phosphoglycerate kinase
(Singer-Sam et al., 1984). These genes are often constitutive and hence
have been described as "housekeeping genes." Because the TATAA and
CAAT homologies were found in many genes, it was thought that they
might function in the regulation of transcription. Early in vitro
transcription experiments done by Wasylyk et al. (1980) indicated that
the promoter of the conalbumin gene could be deleted to -44 bp from the
mRNA start site without any effect on the transcription of the gene.
However, when these same investigators introduced even a single base
change into the TATAA box, there was a 10 fold decrease in the amount

13
of transcription. Similar results were obtained with the adenovirus 2
major late control region (Corden et al., 1980; Hu and Manley, 1981;
Concino et al., 1984).
In contrast to the in vitro results, it was noticed that the TATAA
box, in general, was not essential for transcription in vivo. Benoist
and Chambón (1980) made an SV40 deletion mutant that lacked the TATAA
box preceding the early transcription unit. This mutant was capable of
synthesizing T antigen and transforming rat cells. Similar results were
obtained with the polyoma virus early transcription unit (Bendig et
al., 1980). It was also established that the TATAA box preceding the
sea urchin H2A transcription unit was not necessary for function in
vivo (Grosschedl and Birnstiel, 1980a). The deletion mutants that
Grosschedl made were assayed by injection into Xenonus
oocytes. A 54 bp deletion that included the TATAA box lowered the level
of transcription 5 fold but did not abolish activity.
If the TATAA box is not absolutely essential in vivo for
transcription, then what is the function of this highly conserved
sequence? The answer came from a series of SV40 early promoter mutants
in which the TATAA box was deleted (Gluzman et al., 1980). From this
set of mutants it was demonstrated that in vivo the initiation of SV40
early transcription occurred downstream of the normal site. Also it was
established by Gluzman et al. (1980) that when there were deletions
between the start of transcription and the TATAA box the site of
initiation remained a constant 25 bp + 2 bp downstream. This
demonstrated that regardless of the deletion, the mRNA cap site was
determined by the position of the TATAA box. Grosschedl and Birstiel

14
(1980b) found that multiple initiation sites were utilized in vivo
when the TATAA box was deleted from the sea urchin H2A gene. Since the
lack of a TATAA box caused heterogeneity in the start site of
transcription for several genes, it is now considered that the TATAA
box functions in vivo to specify the correct mRNA initiation site.
Early in vitro transcription studies did not directly discern
whether the CAAT box was necessary for transcription (reviewed in
Shenk, 1981). However, more recent and detailed studies have determined
that the CAAT box does play a role in transcriptional regulation.
Detailed mutagenesis studies by McKnight and Kingsbury (1982); McKnight
et al. (1984) and Myers et al. (1986) elegantly demonstrated the need
for the CAAT box. Initially the studies of McKnight and Kingsbury
(1982), dissected the Herpes Simplex thymidine kinase gene (HSVtk) into
discrete areas required for expression: these included the TATAA box
and two upstream regions referred to as distal signal I (dsl) and
distal signal II (dsll). To pinpoint these small regions accurately
they developed a technique called "linker-scanning" mutagenesis which
introduces clustered sets of point mutations in a short sequence of
DNA. Specifically, these mutations were constructed by ligation of a
series of complementary 3' and 5' deletions joined via a synthetic
linker (BamHI). The mutants that McKnight and Kingsbury created spanned
the proximal 120 bp 5' to the mRNA start site and thus they were able
to assign a boundary to all the sequences required for HSV tk gene
expression after microinjection into Xenopus oocytes. In subsequent
studies dsl and dsll of the HSV tk gene have been shown to interact

specifically with a cellular protein (Jones et al., 1985). This
protein, Spl, was initially purified by Dynan and Tjian (1983a) from
HeLa cells because of its affinity for the SV40 early promoter--later
identified as the G-C rich sequences of the 21 bp repeats. Once the
sequence of the binding site (GGGCGG) on SV40 was confirmed by various
in vitro methods (e.g., DNasel footprinting), the purified protein was
tested for binding on a variety of other genes that contain a G-C rich
sequence(s), including the mouse Dihydrofolate reductase gene (Dynan et
al., 1986) and more recently the rat insulin-like growth factor gene by
Evans et al. (1988). Both of these genes contain several Spl binding
sites, identified in vitro by DNase I footprinting, and the sites in
the rat insulin-like growth factor gene are of varying affinity
depending on the sequence.
Subsequent to the purification of Spl several groups reported the
identification a cellular protein that interacts with the CAAT box
sequence and has been referred to as either CAAT box transcription
factor (CTF) by Jones et al. (1985) or CAAT box binding protein (CBP)
by Graves et al. (1986). Jones et al. (1985) demonstrated an
interaction in dsll of the HSV tk promoter between Spl and CTF, thus
indicating that distinct transcription factors may interact to regulate
expression. The identification of CTF prompted the search for other
putative transcription factors, and although the evidence is somewhat
preliminary, there appear to be at least 3-4 different CAAT box
binding activities depending on the source of the material used to
purify the activity and the criteria used for analysis (Dorn et al.,
1987). CBP and CTF differ from each other in their heat stability

(McKnight and Tjian, 1986). A CAAT box binding factor isolated from
HeLa cells in our laboratory (van Wijnen et al., 1988), termed HiNF-B,
is yet another addition to this growing family of proteins, with
properties that distinguish it from previous isolated CAAT box-binding
factors.
The most sophisticated study to date on the subject of
transcriptional regulatory sequences was done recently by Myers et al.
(1986). These investigators developed a quick method for the
introduction of single point mutations in a small region of DNA. They
mutated nearly every base from -1 to -101 bp of the mouse /J-globin
promoter. With a battery of over 100 clones, each with a single base
change in the promoter, they were able to assay the expression of the
mutant constructs in vivo in a short term transient assay. Therefore,
they could assign functional limits to consensus regulatory sequences
and discover any minor, or as yet unnoticed, contributing nucleotides.
In addition, transversions and transitions were measured to assess any
effects on expression. They demonstrated a requirement for the TATAA
box (-25 bp) and the CAAT box (-75 bp) as well as an upstream sequence
characteristic of the /?-globin genes, CACCC (-96 bp), in /3-globin
transcription. Significantly, an "up" promoter mutation was discovered
when the two bases, GG, immediately 5' to the CCAAT box were changed to
AA. The result of this mutation was a 3-4 fold increase in the level
of message. The implications of this result are that a CAAT box
transcription factor is able to bind more tightly or more specifically
and therefore perform its function more efficiently. With the number
of CAAT box binding factors that are being found in various systems, it

is also possible that the "up" mutation results in the binding of an
alternative, as yet unidentified, protein that carries out the same
function, just more efficiently.
In addition, there are temporal and tissue-specific sequences that
are found in the promoters of some genes and regulate expression at the
transcriptional level. Many of these elements fall into a category of
modulatory sequences referred to as enhancers, negative elements, and
silencers.
Enhancers and Silencers
The promoter of a gene has generally been defined as the minimal
sequences necessary for the initiation and maintenance of a basal level
of specific transcription. Additional elements that modify the
expression of a gene either during development, temporally, in a tissue
specific manner, or as a result of an inducer, would seem a necessity
if adequate regulation in the eukaryotic cell is to be achieved. In the
preceding 5-10 years a number of investigators have provided
considerable evidence for the existence of positive regulatory
sequences referred to as enhancers (Reviewed in Serfling et al., 1985;
Maniatis et al., 1987). The properties of an enhancer are that 1)
there is strong activation of the linked gene from the correct
initiation site, 2) it exhibits independence of orientation, 3) it is
operative at long distances whether 3' or 5', and 4) it preferentially
stimulates transcription from the closest promoter, if they are
tandemly arranged (Serfling et al., 1985). The prototype enhancer
elements are the 72 bp repeats of SV40, which have been extensively

characterized (Benoist and Chambón, 1980; Fromm and Berg, 1982;
Treisman and Maniatis, 1985). Several experiments in which the SV40
enhancer has been fused to the mouse /3-glob in promoter have
demonstrated the relationships that exist between an enhancer and
promoter. Banerji et al. (1981) demonstrated that the SV40 enhancer
could promote hundred-fold higher levels of rabbit /3-glob in
transcription whether located 1400 or 3300 base pairs away. Treisman
and Maniatis (1985) demonstrated that SV40 enhanced transcription of
the mouse /3-globin gene depended on the presence of a functional
promoter. Point mutations in the upstream promoter elements (UPE) of
the /3-globin promoter abolished transcription almost totally. In
conjunction with these results, Treisman et al. (1985) demonstrated
that when the /3-globin promoter was deleted, and the SV40 enhancer was
moved to a proximal position, transcription returned to a high level.
It would then appear that enhancers are like promoters but not vice
versa. Bienz and Pelham (1986) demonstrated that the tandem
duplication of transcriptional control sequences could result in
enhancing ability. They found that the duplication of a heat shock
regulatory element (HSE) could function as an enhancer (distance
activation) whereas a single HSE was inactive at a distance. So one of
the major differences between enhancers and promoters (action at a
distance) may be due to the number of "promoter" elements present with
some accompanying specific sequences (Maniatis et al., 1987). The
importance of the specific sequences should not be down-played, as a
consensus core sequence, 5'-GTGGAAAG-3', has been identified in viral
and cellular enhancers (Khoury and Gruss, 1983).

19
Differences may also be the result of the arrangement of
transcriptional regulatory sequences. Why do an increased number of
regulatory sequences in many cases stimulate transcription so
dramatically? It has been proposed that the resulting protein-protein
complexes that arise from the juxtaposition of regulatory sequences
result in increased transcription. Therefore since most enhancers
contain repeated elements it is possible that they function in
organization of the transcriptional apparatus. Exceptions to this
exist of course; tandem duplication of the CCAAT box does not lead to
a DNA fragment with enhancer qualities (Bienz and Pelham, 1986), i.e.
no enhancement at a distance. Perhaps this result is also a reflection
of the idea that some "transcription" factors bind to the DNA but do
not act directly. Instead they function through their association with
adjacent proteins (Maniatis et al., 1987). An example is that CTF has
been shown to associate closely with Spl protein in the Herpes virus tk
gene (Jones et al., 1985). Significantly, it has recently become
apparent that the mechanism of transcriptional activation by upstream
activation sites (UASs) in yeast is conserved in mammals. Several
studies over the last year have demonstrated 1) that activator
proteins in yeast are composed of a DNA binding domain in the amino
terminus of the protein and a transcriptional activator in the carboxy
terminus, and 2) that when the yeast proteins are expressed in
mammalian cells (with the appropriate binding site present in the
promoter of the target gene) they can activate transcription (Kakidani
and Ptashne, 1988; Webster et al., 1988; Hope and Struhl, 1986). Taken
together with what is known about transcriptional regulation in higher

eukaryotes, it appears that the separation of the DNA binding domain
and the transcriptional activation domain of regulatory proteins may be
conserved from yeast to mammals. In addition the mechanism is probably
conserved as well.
Several of the more well characterized enhancer sequences are part
of a group related by tissue specificity of expression. The
Immunoglobulin (Ig) enhancer of the heavy chain locus is located
several thousand bps 3' to the variable region promoter. This enhancer
sequence, in its entirety, is only active in cells of the lymphoid
lineage (Gillies et al., 1983; and Banerji et al., 1983). As has been
found for the SV40 enhancer, the Ig enhancer is composed of several
distinct elements that interact with specific proteins in vivo (Church
et al., 1985). One of the core elements of the Ig enhancer is the
"octamer" sequence, 5'-ATGCAAAT-3'. It is of special interest as it
also appears in the promoter of a few cellular genes, including histone
H2B (Harvey et al., 1982) and (2'-5') oligo-A synthetase (Benech et
al. , 1985). How this element contributes to tissue specificity in one
context (Ig enhancer) and not in another (histone H2B) remains to be
determined. Recent in vitro binding studies of proteins that interact
with the SV40 "octamer" sequence have demonstrated that there are both
general and tissue specific factors present that bind this sequence,
and this may relate to its role in tissue specific regulation (Rosales
et al., 1987). Also, careful mapping of the binding of HeLa and B cell
nuclear proteins to the SV40 enhancer has revealed subtle differences
in the extent to which various motifs are protected which is indicative
of differential protein/DNA interactions (Davidson et- al., 1986).

Enhancers should not be mistaken for promoters with additional
sequence attached or interspersed. In many cases they exhibit
exceptional cell-type and temporal specificity with respect to
transcriptional activation. Deletion analysis has indicated that
certain core sequences of the IgH enhancer may function in non-lymphoid
cells to shut off the enhancer action (Wasylyk and Wasylyk, 1986;
Kadesh et al., 1986).
The implication of a negative regulatory mechanism for the control
of IgH enhancer action presents a confusing picture of tissue specific
and temporal gene regulation. At first it was thought that the absence
of necessary factors for enhancer action was the reason for
differential activity in various tissues (Maniatis et al., 1987).
However, this has been shown to be somewhat incorrect as many of the
factors found in B cell extracts are also in other types of cells. So,
it is either a case of inaccessibility of the DNA binding sites in
nonlymphoid cells, or that there must be an interaction with a B cell
specific protein (Maniatis et al., 1987). Recently Sen and Baltimore
(1986) discovered a factor present in many cell types, NF-kB, that
interacts with the kappa-chain gene enhancer, but only after
modification to an active form in B-cells.
Negative regulation of gene expression is an old subject for
prokaryotic molecular biologists, but is relatively new to eukaryotic
gene regulation. The first description of the SV40 enhancer element
caused everyone to search for similar elements in other genes, and the
identification of negative regulatory sequences, especially in viral
enhancers, has had a similar effect. It is important to understand that

22
negative regulatory sequences can be divided into two groups, 1) those
sequences that shut off activity of another regulatory element (such as
an enhancer) and have been found to exist within the confines of the
enhancer element, and 2) sequences that act independently of other
regulatory elements to control the level of gene expression. This
latter type of element is the newest discovered and as such is less
well characterized. An interesting distinction can be made in that
some negative regulatory elements can act in either orientation and
with some distance independence and as such have been called either
dehancers or silencers (Baniahmad et al., 1987; Laimins et al., 1986;
Remmers et al., 1986).
Negative regulation of viral enhancer elements is best typified by
the IgH enhancer in which Wasylyk and Wasylyk (1986) have shown that
sequences on either side of the central core sequence down regulate
expression in fibroblasts as compared to B-cells. It is obvious that,
as mentioned above, there must be a mechanism by which the appropriate
genes are expressed at the right times in the right tissues. This may
occur through the regulation of many protein factors, but more likely
there is one protein that regulates the organization of the other
transcriptional factors. It seems apparent that the complexity of the
eukaryotic promoter would in many cases permit great specificity of
expression but could be a regulatory nightmare for the cell. An
exquisite example of coordinate regulation of many genes is found in
the Adenovirus system and the Ela protein. Ela, one of the immediate
early proteins produced in early infection, coordinates the expression

23
of several other genes (Yee et al., 1987) and also represses the
expression of other elements, such as the SV40 enhancer.
A particularly interesting example of negative regulation, which
relates to Ela regulation, has been described for embryonal carcinoma
cells (EC). SV40, polyoma virus, or Moloney murine leukemia virus are
unable to express their genomes when transfected into undifferentiated
EC cells. The induction of differentiation removes the block on the
expression of both viral and cellular genes (Gorman et al., 1985).
Mutants of polyoma virus were isolated that could replicate in the
undifferentiated EC cells, and it was found that the mutations occurred
predominantly in the promoter and enhancer regions of the early genes.
Alternatively, it has been found that the adenoviruses replicate well
in undifferentiated EC cells. In conjunction it was discovered that
mutants in the Ela region could grow in undifferentiated, but not
differentiated EC cells. Taken together with previous evidence about
the function of the Ela protein, it has been suggested that EC cells
contain an Ela like protein that negatively regulates gene expression
until differentiation is induced (Gorman et al., 1985). Gorman et al.
(1985) have demonstrated that when the SV40 early promoter is
introduced by infection it is inactive in EC cells, but when introduced
by CaP04 transfection it is expressed in an enhancer-independent
fashion. This result strongly suggests that the large number of
molecules present in the transiently transfected cell are able to
titrate out the negative factor (or factors) and thus allow expression
from some of the genomes present. Gorman et al. (1985) have also shown
that the negative factors in EC cells have different relative

affinities for the various enhancers, and surprisingly the affinity of
the interaction did not necessarily relate to the level of expression.
A number of cellular genes have been shown to contain negative
regulatory elements although their specific mode of action has not been
characterized. These genes include mouse /3-interferon (Goodbourn et
al., 1986), mouse c-myc (Remmers et al., 1986), rat insulin 1 gene
(Laimins et al., 1986), chicken lysozyme (Baniahmad et al., 1987),
mouse p53 tumor antigen (Bienz-Tadmoor et al., 1985), chicken
ovalbumin (Gaub et al., 1987), and rat a-fetoprotein (Muglia and
Rothman-Denes, 1986). This list includes genes in which the negative
element is situated within an enhancer (mouse /3-interferon) and those
in which it is interspersed between other promoter elements (chicken
lysozyme and rat q-fetoprotein). The most well characterized of these
are the chicken lysozyme and mouse /3-interferon genes in which the
sequences responsible for the negative effect have been identified
(Goodbourn et al., 1986, Baniahmad et al., 1987). The chicken lysozyme
gene is particularly of interest because it contains several possible
negative regulatory sequences located at -0.25, -1.0 and -2.4 kb from
the start of transcription and they are well separated from the
enhancer element identified 7 kb upstream (Theisen et al., 1986).
Additionally, it is interesting that both the chicken lysozyme and the
rat insulin 1 gene negative regulatory elements are contained within
repetitive elements. The chicken lysozyme element is found within the
CR1 repeat, which is a middle repetitive sequence and has limited
homology to the mammalian Alu-type sequences. Additionally, the CR1
repeats near the chicken ovalbumin gene are found in areas where there

is a change in the DNasel sensitivity when the ovalbumin gene is
induced, perhaps indicative of a protein/DNA interaction (Stumph et
al., 1984). The rat insulin 1 element is a member of the family of long
interspersed rat repetitive sequences (LINES) that are present in
about 50,000 copies per cell (Laimins et al., 1986). The fact that
some of the negative regulatory elements identified so far are
associated with middle repetitive sequences has attracted attention.
Some investigators have proposed that the function of this arrangement
may be to coordinate transcriptional domains. The isolation of a domain
by blocking it off with repetitive elements would be consistent with
the structure of eukaryotic chromatin as we understand it today, and
would allow for coordinate control of a gene or set of genes of related
function (Laimins et al., 1986). Negative regulatory elements are
still awaiting the identification of factors that interact with them
and characterization of the protein/DNA and protein/protein
interactions that result in the negative regulation of transcription.
Histone Genes
Histone proteins have been known for a considerable time and their
composition has been the subject of much investigation (reviewed in
Isenberg, 1979). Little was known however about the genes encoding
these acidic proteins until the late 1960s and the 1970s when many
investigators took advantage of the size of the histone messages, and
their relative abundance to investigate the regulation of this set of
genes. The histone genes have many characteristics that make them an

attractive model system for the investigation of regulation. They are
coordinately expressed during S-phase of the cell cycle, and this
expression is the result of both transcriptional and
posttranscriptional processes. Additionally, their small size and basic
structure (no introns, minimal processing) make them an easy system to
manipulate and study (Maxson et al., 1983). If we can understand how
the highly coupled expression of the histone genes is controlled,
perhaps we can then understand how other genes are expressed
coordinately and otherwise.
Historical background. One of the initial observations regarding
histone proteins was that they are present in a relatively invariant
1:1 molar ratio with DNA in the cell (Prescott, 1966). It was further
demonstrated that the amount of histone protein present in a cell
doubled during S-phase of the cell cycle (Bloch et al., 1967). Such
results suggested a possible coupling between these two metabolic
events. Borun et al. (1967) were able to demonstrate that a class of
polyribosomes (7-9S) were selectively enriched during S phase of the
HeLa cell cycle and that they coded for histone-like polypeptides in
vitro, thus giving more credence to the relationship that had been
demonstrated earlier. Borun et al. also noted several properties of
these small mRNAs that have become the foundation of present day
theory about histone mRNA regulation: 1) the addition of cytosine
arabinoside caused a fourfold increase in the "histone" mRNA
destabilization rate as compared to actinomycin D treated cells; 2) the
newly synthesized 7-9S RNA, at the Gl-S boundary, became associated
with polyribosomes thus beginning histone synthesis; and 3) two hours

27
before the end of DNA synthesis in synchronized HeLa cells 7-9S mRNA
transcription ceased and the remaining 7-9S mRNA decayed with
approximately a one hour half life. Borun et al. proposed, somewhat
incorrectly, that the control of histone mRNA levels was through
transcriptional regulation. The refinement of molecular techniques has
allowed later investigators to define the degree to which
transcriptional and posttranscriptional mechanisms regulate histone
mRNA metabolism. Butler and Mueller (1973) repeated and extended the
results of Borun by demonstrating several basic facts. First,
cycloheximide was able to stabilize histone mRNA in the presence of
hydroxyurea, a potent inhibitor of DNA synthesis. When added to
synchronized HeLa Cells, hydroxyurea causes a very rapid
destabilization of almost all histone mRNAs (90%) via the complete
shutdown of DNA synthesis (Baumbach et al., 1984; Heintz et al., 1983;
Sittman et al., 1983). This suggests that a protein(s) is (are)
necessary for the destabilization process to occur. The 10% of histone
message that remains is insensitive to hydroxyurea and probably
represents replication independent histone gene mRNAs (Wells and Kedes,
1985; Wu and Bonner, 1982). Second, transcription is not necessary for
the production of this putative destabilization factor as the addition
of a transcription inhibitor has no effect on the subsequent
destabilization of histone mRNA. Third, Butler and Mueller (1973)
demonstrated a transient increase in the pool of free histone proteins
for 20 minutes after treatment with hydroxyurea. They suggested in
their regulatory model that the free histone proteins might
autogenously regulate the translation of their own message and/or the

28
stability of the remaining message following the cessation of DNA
synthesis. Nearly 15 years later, the idea of autogenous regulation
has gained popularity, since Ross and coworkers (1986, 1987) have so
aptly demonstrated the specific degradation of histone mRNA in vitro.
and the isolation of a nuclease activity that degrades poly A minus
messages from the 3' end.
The histone enriched environment of the sea urchin genome allowed
for their early isolation by equilibrium centrifugation and
subsequently the characterization of the coding and spacer region base
composition (Birnstiel, 1974). The sea urchin genes have been
successfully used as probes for the isolation of histone genes from
several species, including vertebrates such as Xenopus (Moorman et
al., 1980) and mouse (Seiler-Tuyns and Birnstiel, 1981). The higher
vertebrate histone genes were then used to expedite the isolation of
the human histone genes (Clark et al., 1981; Heintz et al., 1981;
Sierra et al., 1982). The replication dependent histone genes, which
comprise the majority of expressed histone genes, are characterized by
a lack of introns and an extremely well conserved 3' end sequence that
consists of an 15 bp stem and loop structure.
Human histone gene organization. The isolation of the human histone
genes, which had previously been so intensively studied, permitted the
proposed regulatory hypotheses to be tested. The organizational
pattern of the human histone genes was uncovered by restriction enzyme
analysis, and Southern blot hybridization (Southern, 1975) of
restricted phage clones demonstrated that, unlike the tandem repeats of
the lower eukaryotes, the human genes were clustered but had no obvious

29
organizational pattern (Sierra et al., 1982; Heintz et al., 1981 and
Clark et al., 1981). Sierra et al. (1982) were able to isolate lambda
Charon 4A phage clones representative of three families or clusters.
Unlike the lower eukaryotic organization, none of these clustered
groups of human histone genes contained a human HI gene. By using a
chicken HI specific probe Carozzi et al. (1984) isolated a clone that
had all 5 human histone genes including an HI histone. Recently,
several human histone genes have been localized to different
chromosomes (Triputti et al., 1986, Green et al., 1986). This
suggests that coordinate control of human histone gene expression might
not be as easily regulated as in lower eukaryotes.
Another question that had not been addressed up to this time was
whether different histone mRNAs were the product of different histone
genes. Lichtler et al. (1982) demonstrated convincingly that seven
species of human H4 histone mRNA were encoded by at least 3 separate
genes, thereby establishing that the human histone genes are a
repetitive family of genes, but not redundant. Lichtler et al. (1982)
also strengthened the possibility that different histone genes might be
subject to diverse regulation since it was obvious that certain H4
mRNAs were present at higher levels than others.
Transcriptional and Posttranscriptional regulation. Our knowledge
about these two steps in the regulation of histone mRNA metabolism has
been strengthened by the studies of Heintz et al. (1983); Sittman et
al. (1983) and Plumb et al. (1983a,b). Plumb et al. (1983b) utilized
HeLa cells synchronized by double thymidine block and hybrid selection
of pulse labelled histone mRNA. This technique permitted several

species of histone mRNA to be isolated on acrylamide gels. These
experiments demonstrated that the histone genes are transcribed in the
early part of S-phase, approximately 2-3 hours post release from double
thymidine block. The increase in the histone mRNA transcription was 3-
5 fold during this period. Baumbach et al. (1987) demonstrated a
similar increase in the level of histone gene transcription at the
beginning of S-phase with nuclear run-on analysis. However, one of the
anomalies of histone gene expression is that if one follows the total
increase in the amount of histone mRNA, the actual elevation is from
10-25 fold (Plumb et al., 1983b; Heintz et al., 1983). The actual
differences in histone mRNA levels have varied from one report to
another and this is probably the result of the various synchronization
and analysis techniques utilized. Conservatively, the level of
transcription increases 3 fold during the first 2-4 hours of S phase,
and the stability of histone mRNA rises 10-20 times during S-phase.
*
Outside of S phase or after the artificial cessation of DNA synthesis
by drug treatment, the half-life of histone mRNA is approximately 10-15
mins. (Sittman et al., 1983; Plumb et al., 1983a).
Nuclease sensitivity and Protein/DNA interaction. Historically, a
hallmark of an active gene has been the presence of nuclease
hypersensitive sites in the promoter region of the gene. Chrysogelos et
al. (1985) and Moreno et al. (1986) have extensively characterized the
nuclease sensitivities of the flanking and coding regions of the F0108
human H4 histone gene. Together, their results demonstrate that the 5'
region of the F0108 H4 gene is a dynamic area of varying sensitivity to
DNase I, micrococcal and SI nuclease. Since the histone genes are cell

31
cycle regulated with respect to transcription and total message levels,
Chrysogelos et al. (1985) were able to correlate the size of the DNase
I hypersensitive site with the stage of the cell cycle. As mentioned
earlier, the appearance of a DNasel hypersensitive site is indicative
of protein/DNA interactions in the region. Pauli et al. (1987)
utilized the technique of genomic sequencing to visualize the in vivo
protein/DNA interactions in the promoter of the F0108 human H4 histone
gene. They demonstrated that there are two binding sites in the
proximal promoter region which have been designated Site I (-122 bp to
-89 bp) and Site II (-64 bp to -23 bp). Site I contains a putative Spl
site and a possible CAAT box. Site II contains the GGTCC element (see
below) and the TATAA box. The protein/DNA complexes at Site I and Site
II are present throughout the cell cycle and presumably these
interactions in the promoter region are involved in the basal and
increased level of transcription demonstrated at the onset of S-phase.
Perhaps the interactions that regulate the level of transcription at
the start of S-phase occur through protein/protein interactions since
there is no apparent change in the protein/DNA interactions during the
cell cycle. In studies done by Heintz and Roeder (1984), it was
demonstrated that the pHuH4 histone gene was transcribed in vitro to a
greater extent in S-phase extracts than in G-phase extracts. It would
be important to know whether there is a new protein that appears at
the onset of S-phase that acts either directly to augment
transcription by interacting with the DNA or through a protein/protein
interaction. Since the identification of protein/DNA interactions in
the promoter of the F0108 H4 gene, it has been of great interest to

us to ascertain if there is any functionality in the interaction and
this is addressed to some extent in this work.
Other histone genes, from a variety of species, have been
characterized with respect to the contribution of 5' flanking sequences
in transcriptional regulation. Notably, the human H2B gene has been
extensively characterized with in vitro transcription by Sive et al.
(1986). They demonstrated that the transcription of the H2B gene is
dependent on a number of sequences 5' to the TATA box including the H2B
octamer element and CCAAT box. Recently, the emphasis has been placed
on identification of the sequences responsible for the periodic
increase in histone gene transcription during the cell cycle.
Artishevsky et al. (1987) have demonstrated, although not convincingly,
that the sequences responsible for the S-phase increase in
transcription of a hamster H3 gene are located in the proximal
promoter region (-150 bp); however they were not explicitly defined.
The authors propose that this region of the hamster H3 gene bears
similarity to the sequence, 5'-GCGAAA-3', that has been shown to
regulate the cell cycle expression of the HO genes of yeast (Nasmyth,
1985). Taken as a whole, these many results support the idea that the
histone genes are controlled at the transcriptional level by promoters
that are composed of many elements that interact with different and
specific proteins. Though not dealt with here, van Wijnen et al.
(1987, 1988) have shown that the promoter region of several cloned
human histone genes can interact with nuclear proteins in a specific
manner.

Sequence analysis. Only a few histone genes have been sequenced
extensively enough to permit a comparative analysis of 5' flanking
sequences. The majority of sequencing information concerning histone
genes has revolved around the coding sequences. Comparative analysis of
these protein sequences has revealed remarkable homogeneity from
species to species, especially with respect to histones H3 and H4
(Wells, 1986). Unfortunately little 5' flanking sequence for H4 histone
genes has been published, and most sequences extend only 80-120
nucleotides upstream (Wells, 1986). A comparison of the F0108A H4
histone gene (Sierra et al., 1983), which my studies have involved,
and the human H4 histone gene independently isolated by Heintz et al.
(1981), suggests that some of the sequences in the 5' proximal promoter
region are conserved-- the TATA and GGTCC boxes. The TATA box is, of
course, a canonical RNA polymerase II transcription sequence and the
GGTCC box has been associated with many H4 gene promoters from sea
urchin to human (Hentschel and Birnstiel, 1981, Wells, 1986).
Comparison of the F0108 gene to the mouse H4 gene isolated by Seiler-
Tuyns and Birnstiel (1981) reveals extensive similarity between the
promoters, especially the TATA box, GGTCC element, and the CAAT
sequence that is found as either a single or double copy located just
5' to the GGTCC element in many H4 histone genes (Wells, 1986). The
significance of the H4 "CAAT" sequence is somewhat questionable as it
was originally thought to represent a the "CCAAT" box that is
associated with many RNA polymerase II promoters. There have been
several CCAAT box factors isolated, and all of them require, for good
binding, the sequence 5'-CCAAT-3' (Dorn et al. , 1987)-. The H4

histone gene with which we are working, F0108, does have two CCAAT
boxes located several hundred basepairs upstream and the possible
functionality of both the proximal CAAT boxes and the distal CCAAT
boxes is discussed in the work presented here.
The functionality of these and other sequences in the promoter of
histone genes has been one of the focuses of our work. Also, the
Heintz and Roeder laboratory have investigated the functionality of
promoter sequences in the human H4 gene they isolated. In vitro
transcription analysis of Bal 31 deletion mutants of the F0108 H4 gene
by Sierra et al. (1983) demonstrated, in whole cell extracts, that
promoter sequences could be deleted to within 50 bp of the cap site
without loss of transcription. These sequences include only the TATA
box and GGTCC element, but are apparently sufficient for accurate in
vitro transcription to occur. In vitro transcription analysis by Hanly
et al. (1985) demonstrated very similar effects. When only the TATA
box remained as the sole RNA polymerase II consensus element,
transcription was accurate but at a reduced level. Hanly et al.
(1985) have suggested that the sequences extending to -110 bp are
sufficient for maximal transcription of the human H4 histone gene in
vitro.
The analysis of histone gene transcription in vitro has contributed
to our understanding of the minimal requirements for 5' sequence;
however, it has been demonstrated previously that the requirements for
initiation of mRNA synthesis in vitro and in vivo are different in many
instances. One might reasonably assume that the chromatin structure of

an integrated gene would affect its regulation and intrinsic
accessibility to regulatory proteins. We felt it was necessary to
extend these in vitro studies into stable cell lines for the reasons
outlined above and discussed in Materials and Methods (Chapter 2). A
logical extension of many in vitro studies has been to manipulate the
promoter or coding region of a gene in vitro and to replace it in vivo
and hopefully measure the affect of the manipulation on expression.
Perhaps this has been most successfully accomplished in yeast, where
the reintroduction of the manipulated gene can be done with precision
into the exact locus from which it came originally (Szostak et al.,
1983) . This is a goal shared by many molecular biologists as it would
be a more accurate way to assess structure/function relationships.
Histone genes have been transiently expressed in a number of
different cell types (Kroeger et al., 1987; Capasso and Heintz, 1985;
Green et al., 1986; Bendig and Hentschel, 1983; Marashi et al., 1986).
The transient assay affords a reasonably quick way to examine the
effects of DNA manipulation. The results have suggested that
heterologous or homologous systems can be used to express transfected
genes. In probably one of the more radical transfection experiments,
Bendig and Hentschel (1983) introduced the embryonic histone gene
repeat of the sea urchin Psammechinus miliaris transiently into HeLa
cells. Correct 5' mRNA start sites were detected for all 5 genes of the
cluster, but the termination of transcription was generally aberrant
with the exception of the H2B gene. This set of results is suggestive
that heterologous systems may share many regulatory components that
allow them to transcribe foreign genes correctly, but- may have--in

36
this case 3' processing--parts of the regulatory machinery that are
incompatible. This particular subject is discussed in the work
presented here. At the point where our work began, the only stable cell
lines created with an integrated human H4 histone gene were by Capasso
and Heintz (1985). They utilized one construct, pHuH4, to assess the
level of H4 histone gene regulation in mouse Ltk" cells. In vivo SI
nuclease analysis of this single construct permitted them to conclude
that mouse cells could accurately transcribe the human H4 gene. Green
et al. (1986) demonstrated that the F0108 human H4 histone gene was
expressed in mouse C127 lung fibroblasts. In these experiments the
F0108 gene was carried episomally on a construct made from the 69%
transforming fragment of Bovine papilloma virus.
With this understanding and background we initiated studies with
the human H4 histone gene F0108 (Sierra et al., 1982) to ascertain the
in vivo functionality of sequences in the 5' promoter region.

CHAPTER 2
MATERIALS AND METHODS
Experimental rationale and commentary. Of particular importance,
for histone and other eukaryotic genes, is the identification of
regulatory sequences and molecules that mediate transcriptional
control. Several laboratories, including our own, have conducted in
vitro and in vivo experiments to assess the functionality of the
histone gene coding region and flanking sequences in the regulation of
expression (van Wijnen et al., 1987; Sierra et al., 1983; Heintz et
al., 1983; Pauli et al., 1987; Dailey et al., 1986; Green et al.,
1986).
We felt that an in vivo approach, via the introduction of modified
genes by transfection, had the advantage that the integrated gene was
packaged as chromatin and presumably transcription factors, such as
RNA polymerase II, CTF, and Spl were present in proper and localized
concentrations due to the structural integrity of the nucleus.
Therefore the results would be a more accurate reflection of the actual
in vivo situation. The results were still cautiously interpreted in the
context of the experimental parameters present, such as copy number.
Some of our experiments have been done in a transient assay system and
the expression of the human H4 gene under these conditions was somewhat
different than when stably integrated. Presumably there were
37

38
differences in chromatin structure and factor to DNA ratios and this
may have been reflected in the results. Previous work has demonstrated
that the human H4 histone gene, with which we have worked, has a
defined chromatin structure that includes an extensive DNasel
hypersensitive site, and that this site fluctuates in size during the
cell cycle, which may be the result of the interaction of
transcriptional control factors (Chrysogelos et al., 1985).
An in vivo experiment with a transfected gene requires an assay and
experimental approach that will allow for the detection of the
introduced gene. Several options were available for us to pursue. The
most commonly used have been 1) the promoter of a gene was linked to a
reporter gene such as chloramphenicol-acetyl-transferase (CAT) (Gorman
et al., 1982), or 2) the whole gene, coding and flanking regions, was
introduced into a heterologous environment (e.g. a human gene into a
mouse cell) (Capasso and Heintz, 1985, Marashi et al., 1986). Several
groups, including our own, have utilized such heterologous systems
because they allow for the easy detection, by SI nuclease analysis, of
the mRNA of interest with little or no background. We decided that it
would be better to leave the H4 promoter attached to the H4 gene and
express these constructs in mouse cells.
The histone constructs we cotransfected with the pSV2neo plasmid
were expressed and detectable with SI nuclease analysis in mouse cells.
We realized that the histone promoter deletion constructs could be
compared to one another and the differences in the steady state level
of histone mRNA from one construct to another were a direct reflection
of transcription. We concluded this because the coding region of all

39
the constructs had remained intact. Messenger RNA turnover was
presumably the same for each construct and any differences in the
steady-state level of histone mRNA were therefore a result of
transcription.
We included a mouse H4 control in each of our SI nuclease assays to
permit the quantitation of the total amount of mRNA and particularly
the amount of histone mRNA. In retrospect, this has helped us to
understand more about the interaction of transcription factors with the
H4 histone genes and in some cases has been an adequate internal
control. Because of the competition phenomenon we uncovered (described
in Chapter 4) the mouse H4 became a less than perfect internal control.
Originally we tried to incorporate the mouse 18S ribosomal RNA gene
into our SI nuclease assay but were unable to find adequate
hybridization conditions for both histone and-ribosomal probes. Ideally
another mouse histone gene in conjunction with the mouse H4 should have
been used.
Materials and general laboratory procedures. All chemicals were of
the highest quality available. Phenol was redistilled and stored frozen
with the addition of 0.1 % (w/v) 8-hydroxyquinoline at -20°C. The
frozen phenol was equilibrated first with 100 mM Tris-HCl (pH 8.0) and
subsequently with 10 mM Tris-HCl and 1 mM EDTA (pH 8.0) until the pH
was between 6.0 and 7.0. Phenol/Chloroform extraction refers to the
addition of one volume of equilibrated phenol and one volume of
Chloroform/isoamyl alcohol (24:1) to a solution, mixing, and
separation of the phases by a brief centrifugation step. Next, at least
one volume of chloroform/isoamyl alcohol is added and the above

40
centrifugation step repeated. Hereafter precipitation refers to the
addition of 2-3 volumes of 95% ethanol, l/10th volume 3M Sodium Acetate .
(pH 5.0), to a solution of DNA or RNA. This was subsequently placed at
-20 or -70°C for a sufficient time to allow precipitation of the
O O
nucleic acids. Radioactively labelled nucleotides, [7-JZP]ATP (— 600
Ci/mmol) and [a-^^P]dCTP (- 3000 Ci/mmol), were purchased from Amersham
and ICN. X-ray film, Cronex and XAR-5, were obtained from Dupont and
Eastman Kodak respectively. For all experiments that involved RNA the
solutions were pretreated with 0.01% diethylpyrocarbonate (DEPC) and
glassware was treated with 0.1% DEPC. After a 30 min. treatment the
solutions and glassware were autoclaved for thirty minutes to remove
any traces of DEPC.
Plasmid growth and preparation. L-broth (Maniatis et al., 1982) was
prepared by mixing lOg/1 Bacto tryptone (Difco), 5 g/1 yeast extract
(Difco) , 5 g/1 NaCl.and 2 ml/1 1M NaOH in 1 L of dd^O (double
distilled water). The medium was then autoclaved for 30 min. in order
to sterilize it. Ten milliliter starter cultures of bacteria were
prepared in sterile conical tubes and grown overnight at 37°C. These
were supplemented with sterile 20% glucose (100 /xl) , 1M MgS04 (10 /xl) ,
and 50 Mg/ml ampicillin (Sigma). Small inocula were removed from
glycerol stocks or colonies were picked from plates and placed in the
starter culture overnight. Large scale (500 ml) preparations were then
completed with 5 ml 20% glucose, 0.5 ml MgS04 and 50 ¿xg/ml ampicillin.
Cultures were grown at 37°C until they reached an optical density
(595nm) of 0.4 to 0.5. At this point 4.25 ml of 20 mg/ml
chloramphenicol were added and the cultures were allowed to grow for an

41
additional 16-18 hrs. If the bacteria contained a pUC plasmid or
derivative, the amplification step was omitted. The cells were
harvested and the plasmid DNA was prepared essentially as described by
Maniatis et al. (1982). The pellet was resuspended in 10 ml of
Solution 1 (50 mM glucose, 25 mM Tris-HCl pH 8.0, 10 mM EDTA, and 5
mg/ml lysozyme (Cooper Biomedical)) and incubated at room temperature
for 5 min. Next, 20 ml of Solution 2 (0.2 N NaOH, 1% SDS) was added and
the cells were placed on ice for 10 min. Fifteen ml of Solution 3 (5M
KAc, pH 4.8) was added and incubated on ice for 10 min. The cells were
then centrifuged at 10k rpm for 20 min., 4°C. The supernatants from all
tubes were pooled and precipitated with 0.6 volume of isopropanol for
15 min. at room temperature. The precipitate was recovered by
centrifugation at 10k rpm for 30 min. The pellet was dried and
resuspended in 8 ml of 10 mM Tris-HCl pH 8.0, 1 mM EDTA (TE). Eight
grams of CsCl and 640 /¿I of 10 mg/ml ethidium bromide were added and
the preparation was centrifuged for 36 hrs at 45k rpm in Beckman heat
sealed tubes in a Beckman Ti50 rotor. The DNA band was visualized by
ultraviolet illumination and recovered by side puncture with a 20
gauge hypodermic needle. The DNA was then either placed over a small
Dowex AG 50W-X8 column or butanol extracted 5X to remove the ethidium
bromide. The sample was then dialyzed extensively against TE. The DNA
was recovered by ethanol precipitation and subsequent centrifugation.
Quantitation of the yield was done spectrophotometrically (Beckman) at
260 nm.
Plasmid preparation with TB. The method is similar to that outlined
above for L-Broth except that the TB medium was used. TB was prepared

as described by Tartof and Hobbs (1987). Bacto tryptone (6.65 gr.),
13.3 gr. of yeast extract, and 2.2 ml of glycerol were prepared in 450
ml of ddH20. The medium was sterilized in the autoclave for 30 min. To
the sterile solution was added 55.5 ml of sterile 0.17M KH2PO4, 0.72M
K2HPO4. This medium was inoculated and bacteria were grown as above.
Because the medium is very rich, the yields were often large so
bacteria that contained pBR322 plasmids were not induced with
chloramphenicol. The DNA was prepared by the same method except that
the original volume of cells was split into two aliquots at the
beginning of the isolation procedure. This was found to be essential
and greatly facilitated lysis and subsequent isolation of the plasmid
DNA. For comparative purposes, 500 ml of TB can produce 4-5 mg of
total plasmid DNA in comparison to 1 mg with L-Broth with
amplification.
Production of unidirectional deletions with Exonuclease III. This
method was carried out essentially as described by Stratagene (San
Diego, CA) from which the reagents were purchased. The method takes
advantage of the fact that Exonuclease III cannot digest 3' single
strand overhangs. For our purposes the pF0005 insert was cloned into
the Pstl/Hindlll sites of Bluescript M13+. The Hindlll site is adjacent
to an Apal site in the vector. To produce the deletions in which we
were interested, the pF0005 Bluescript clone was digested with Hindlll
(5' overhang) and Apal (3' overhang) to completion. We then mixed three
/ig of digested DNA, 25 /il of 2X Exonuclease III buffer (100 mM Tris-HCl
pH 8.0, 10 mM MgCl2, 20 pg/ml tRNA), 5 /il of freshly prepared 200 mM 2-
mercaptoethanol, 30 units of Exonuclease III, and enough dd^O to make

43
the final volume 50 pi. The reaction conditions were established
through a series of titration experiments to determine the extent of
deletion with time. After the addition of the enzyme (added last) 10 pi
aliquots were removed every minute for 5 min., diluted with 80 pi IX
Mung Bean nuclease buffer (5X = 150 mM NaOAc, pH 5.0, 250 mM NaCl, 5
mM ZnCl2, 25% glycerol) and heated to 68°C for 15 min. Once the
deletion reactions had been stopped 9 units of Mung Bean nuclease in
dilution buffer (IX = 10 mM NaOAc, pH 5.0, 0.1 mM ZnOAc, 1 mM cysteine,
0.001% Triton X-100, 50% glycerol) were added and the reaction allowed
to proceed at 30°C for 30 min. The reaction was stopped by the addition
of 100 pi of phenol/chloroform and extracted. The aqueous layer was
removed and precipitated with 10 pi of 3 M NaOAc pH 7.0 and 2.5 volumes
of 95% ethanol. The DNA was recovered by centrifugation, ligated and
transfected as described below. This procedure worked very poorly and
resulted in very few positive clones. The deletions that were obtained
were characterized by run-off transcription from the T3 promoter of
each clone. The DNA was digested with Ncol and transcription reactions
carried out exactly as described by Stratagene. The transcripts were
electrophoresed on a 6% acrylamide, 8.3M urea gel and the extent of
deletion determined by comparison to run-off transcription from the
parental construct pF0005BS.
DNA Fragment Elution. After restriction enzyme digestion DNA
fragments were usually electrophoresed in low percentage agarose gels
(0.7 to 1.0%) with IX TBE (10X = 500 mM Tris-HCl pH 8.3, 500 mM boric
acid, 10 mM EDTA) and visualized by long wave ultraviolet illumination
of the ethidium bromide stained band (2 pg/ml for 15 min.). The band of

44
interest was excised from the gel. The Fragment Eluter (IBI) was first
run for 30 min. with low salt buffer (20mM Tris-HCl, pH 8.0; 5 mM NaCl;
and 0.2 mM EDTA) at 125 volts. The gel fragment was then placed in the
well and the V-channel filled with 100 ¿ti of high salt buffer (3M
NaOAc, 5% glycerol, 0.01% Bromophenol Blue). It was important that the
gel slice remain in the same orientation as it had been run previously
to facilitate the removal of the band. The band was electroeluted at
150 V for 15-20 min. after which the high salt buffer was carefully
removed in 100 ¿¿1 aliquots. A total of 4, 100 ¿ti aliquots were removed
from each channel. Five micrograms of glycogen (Boehringer-Mannheim)
were added and the sample was precipitated with 1 ml of 95% ethanol at
-70°C for 30 min. The DNA fragment was then recovered by centrifugation
at 10k rpm for 30 min. Fragments isolated in this manner were found to
be directly suitable for ligation reactions or probe preparation.
DNA ligation. The ligation of DNA fragments was done with T4 DNA
ligase (New England Biolabs) and essentially as described by King and
Blakesley (1986). DNA fragments were digested with the appropriate
enzymes dictated by the cloning scheme and fragments and vectors were
mixed in 10 ¿¿1 of IX ligation buffer (5X = 250 mM Tris-HCl pH 7.6, 50
mM MgCl2, 25% (w/v) polyethylene glycol 8000 (Eastman Kodak), 5 mM ATP,
5 mM dithiothreitol). Usually the vector (a pUC plasmid) was treated
with phosphatase prior to the reaction and therefore the vector to
insert ratio was - 3:1. Blunt end ligations were carried out with less
than 20 ¿íg/ml of total DNA. Sticky ligations were done at 20-40 ¿tg/ml
and diluted after 4 hrs at room temperature. Generally 10-20 units of
ligase were added for sticky end ligations and 200-40-0 units for blunt

end ligations. After 4 hours the reactions were diluted 1:2 with IX
ligase buffer and an additional aliquot of ligase added to the
reaction. The reactions were then incubated overnight at 14°C (sticky
end) and 4°C (blunt end). The reactions were diluted 1:2 with TE and
transfected into DH5 bacteria as described by the methods of Bethesda
Research Laboratories, and Hanahan (1983).
Preparation of competent bacterial cells for transformation.
Bacteria, either DH5 or HB101, were grown in 100 ml of Luria broth to
an OD590 = 0.375. The cells were divided between two sterile 50 ml
conical tubes and placed on ice for 10 min. All subsequent procedures
were carried out at 4°C. The cells were then harvested by
centrifugation for 5 min. at 5k rpm. The supernatant was removed and
the cells gently resuspended in 10 ml of CaCl2 buffer (60 mM CaCl2, 10
mM PIPES pH 7.0, 15% glycerol). The cells were then centrifuged for 5
min. at 5k rpm and gently resuspended again in CaCl2 buffer. They were
then placed on ice for 30 min. and centrifuged at 2.5k rpm for 5 min.
The cells were resuspended in 2 ml each of CaCl2 buffer and dispensed
into 200 pi aliquots and frozen at -70°C until needed.
Transformation of bacteria with plasmid DNA. Competent bacterial
cells, either DH5 or HB101, were thawed on ice and 5-10 pi of the
ligation were added and incubated with the cells for 30 min. on ice.
The DH5 cells were heat shocked at 42°C, and the HB101 cells at 37°C.
The cells were briefly placed on ice and then diluted with 900 pi of
room temperature S.O.C. (2% Bactotryptone, 0.5% yeast extract, 10 mM
NaCl, 2.5 mM KC1, 10 mM MgCl2, 10 mM MgSO^). The cells were incubated
at 37°C for 1 hour and then plated on TYN (1% Tryptone, 1% yeast

extract, 0.5% NaCl) medium with ampicillin. If detection of insertion
of a DNA fragment was possible (DH5 cells and pUC plasmids) then 30 /¿1
of 2% X-gal (5-bromo-4-chloro-3-indolyl-/3-D-galactoside) and 20 /¿I of
100 mM IPTG (Isopropyl-/3-D-thiogalactopyranoside) were included with
the bacteria spread on the plate. Resistant colonies grew up overnight
and white colonies, indicative of a disrupted lac Z gene, were picked
for further analysis.
Rapid plasmid preparation. The method is essentially as described
by Ish-Horowicz and Burke (1981) with some modifications. One
milliliter of saturated overnight culture, grown in TYN or L-broth,
was centrifuged for 20 sec. in an Eppendorf microfuge. The solutions
for preparation of DNA were the same as for the large scale preparation
described above. The cells were resuspended in 100 /il Solution 1 and
incubated for 5 min. at room temperature. Solution 2 (200 ¿¿1) was
added and incubated on ice for 5 min. Solution 3 (150 /il) was added
and incubated on ice for 5 min. The cells were then centrifuged for 5
min. and the supernatant extracted with phenol/chloroform. The
supernatant was then precipitated with 2 volumes of 95% ethanol at room
temperature. DNA was then suitable for restriction enzyme digestion and
agarose gel analysis.
Growth and preparation of cell lines. C127 cells were utilized in
all transfections and were grown in 10 cm tissue culture dishes as
monolayer cultures. The medium used in all experiments was Dulbecco's
modified essential medium (Gibco) supplemented with 5% calf serum
(Gibco), 5% horse serum (Gibco), 2 mM L-glutamine, and 100 U/ml
penicillin, 100 ug/ml streptomycin. To initiate a cell line (histone

47
plasmid and pSV2neo) or transient (histone plasmid only) transfection
the cells were refed with 10 ml of medium 2-4 hours before application
of the DNA precipitate. Stable cell lines were initiated by the
cotransfection of the histone plasmid and pSV2neo in a 10:1 ratio. This
was done essentially as described by Graham and van der Eb (1973) and
Gorman et al. (1982). Plasmid DNA, usually 10 /¿g/construct, was
diluted to 450 /¿I with 1 mM Tris-HCl pH 7.9, 0.1 mM EDTA. This was then
mixed with 50 ¿il of 2.5 M CaCl2- The DNA solution was then added
dropwise to 500 /xl of 2X Hepes Buffered Saline (280 mM NaCl, 50 mM
HEPES, 1.5 mM Na2PÜ4, pH 7.12 + 0.05) in a sterile 15 ml conical tube
while the tube was vortexed. The precipitates were allowed to stand for
20 min. and were grey and cloudy in appearance. A poor precipitate was
obvious as settling out occurred during the 20 min. incubation. The DNA
precipitates were added to the plates dropwise under sterile conditions
with gentle swirling. After 4 hours the medium was removed and the
cells were shocked for 1-2 min with 15% glycerol in medium. This was
removed, the cells washed with 10 ml of incomplete medium and refed
with 20 ml of complete medium. For transient transfections the cells
were incubated for 24-48 hours and then harvested (80-90% confluency)
as described below.
Cell lines were initiated by growing the cells to confluency,
approximately 2-3 days. At this point the cells were split 1:5 into
five plates and the medium was supplemented with 500 /¿g/ml of Geneticin
(G418, Gibco). The aminoglycoside phosphotransferase 3'(II) gene
carried on the pSV2neo plasmid confers resistance to this antibiotic
and therefore permits cell growth if present. Cells were refed with

48
medium + G418 every 3-4 days until resistant colonies were apparent
and most of the other cells had died. This usually took approximately
2-3 weeks. All the colonies on an individual plate were pooled and
subsequently passaged in drug-free medium--these were referred to as
polyclonal cell lines. The clone name for a cell line contains several
designations. For example: pF0003pl, the pFO designates this construct
as originally derived from the AHHG 41 clone isolated by Sierra et al.
(1982), 003 describes the deletion construct, and pi refers to
polyclone number 1. When an "m" is used instead of a "p" this indicates
a monoclonal cell line. To produce monoclonal cell lines, 12
individual colonies, 2-3 from each plate, were picked with a cotton
plugged sterile pasteur pipette and grown in 24 well cell plates
(Corning). After these cells had expanded they were grown in 6 and 10
cm dishes as described above.
Cell lines and C127 cells were frozen down periodically in medium
supplemented with 20% foetal calf serum (Gibco) and 10% glycerol. Cells
were washed off the plate in Puck's Saline + 0.02% EDTA, centrifuged at
1500 rpm for 2 min, resuspended in freezing medium in Nunc Cryotubes,
and placed at -70°C.
Southern blot analysis. This method has been used to determine the
copy number of the individual monoclonal cell lines and the status of
the integrated constructs with respect to flanking sequences and mode
of integration. In general, DNAs from individual monoclonal cell lines
were digested to completion with restriction enzymes in the buffer
recommended by the supplier. The restriction enzyme reactions were
stopped by the addition of 1/10 volume of running dye- (IX TBE, 50%

49
glycerol, 0.2% sodium dodecyl sulfate, 0.01% bromophenol blue, and
0.01% xylene cyanol) and heated to 65°C for 15 min. The DNA was then
loaded onto 1% agarose gels and run 16-18 hours at 70 V. Gels were
stained in ddH20 with 5 ug/ml ethidium bromide. Next, the gels were
soaked in 25 mM HC1 for 10 min. to cause strand breaks that permit
better transfer and then transferred to Zetabind nylon membranes (AMF-
Cuno) as described by Southern (1975) except that the transfer buffer
was 0.4 M NaOH (methodology kindly provided by Dr. Harry Ostrer,
University of Florida, Department of Pediatric Genetics). Transfer was
complete in 20-24 hrs. The filters were gently washed in 2X SSC (20X
SSC — 3M NaCl, 0.3M Sodium Citrate, pH 7.0) 3 times for 15 min. each.
The filters were briefly air dried and then washed in 0.1X SSC, 0.5%
SDS for 1 hr at 65 C. At this point filters were stored at 4"C in
plastic Seal-a-meal bags. Blots were prehybridized in 5X SSPE (15X SSPE
= 2.69 M NaCl, 150 mM NaH2P04, 15 mM EDTA, pH 7.7), 0.1% SDS, and 1.0%
non-fat dry milk (Carnation) at 67-68°C for 4-6 hrs. Hybridizations
were performed in the above solution with the addition of either
denatured nick-translated or oligolabelled probe. For blots probed with
histone H4 sequences 1-2 x 10^ cpm/ml of probe were used in the
hybridization. For mouse 18S ribosomal RNA hybridizations, 1-2 x 10"*
cpm/ml of the pUC974 insert probe were utilized. The specific activity
ft
of all probes was at least 1 x 10° cpm/ug. The length of hybridization
was from 18 - 20 hrs at 67-68°C. Filters were washed 3 times at room
temperature with agitation in 5 mM NaP04 pH 7.0, 2 mM EDTA, and 0.2 %
SDS. Each wash was 30 min in length. After a brief drying period the
filters were sealed in plastic bags (to prevent dehydration and

facilitate the subsequent removal of probe fragments) and exposed to
preflashed XAR-5 film (Kodak) at -70°C.
50
Preparation of DNA from monoclonal and polyclonal cell lines. The
medium from each plate was removed and 2 ml of Puck's saline (Gibco)
with 0.02% EDTA were added. The cells were physically removed from the
plate by scraping with a rubber spatula and placed in a sterile 15 ml
Corex tube. The cells were pelleted by centrifugation at 1500 rpm for
2 min. at 4°C in an IEC-International centrifuge. At this point the
supernatant was removed and the cells were snap frozen on dry ice.
Frozen pellets were quickly resuspended in 1 ml of 0.1X SSC, 1.0% SDS,
and 200 /¿g/ml proteinase K (Sigma Chemical Company) and incubated for 4
hrs to overnight at 37°C. This mixture was then extracted 2 times and
precipitated with 2 volumes of 95% ethanol at -20°C overnight. The
precipitated nucleic acids were recovered by centrifugation at 10K rpm
for 10 min. at 4°C. The pellet was dried briefly and resuspended in 1
ml of TE and RNaseA (Sigma) was added to a final concentration of 50
/jg/ml. Digestion proceeded for 1 hr at 37°C and was stopped by the
addition of SDS to 0.5% and phenol/chloroform extraction. DNA was then
precipitated with 2 volumes of 95% ethanol, centrifuged at 10K for 10
min, and the pellet resuspended in 500 /¿I of TE and stored at 4°C.
Copy number analysis. Approximately 30 ug of genomic DNA from an
individual cell line were diluted to 50 1 with TE. Digestions were
carried out in EcoRI buffer (Boehringer-Mannheim) with the following
regime: 1 unit/ug of EcoRI and Xbal were added and incubated at 37°C
for 4-8 hrs, at which point an additional 1 unit/ug was added and the
digestion proceeded overnight (16-18 hrs). The DNA was quantitated by

51
diluting 5 p 1 of the digestion into 1 ml of IE and determining the
OD260- The completion of digestion was determined by gel
electrophoresis of a small aliquot of the digestion on a 1% agarose
minigel (Bio-Rad). Ten micrograms of digested DNA were electrophoresed
and blotted as above (Southern Blotting). The probes used for the copy
number determination were either the EcoRI/Xbal fragment from pF0002
(for the human H4 histone genes) or the BamHI/Sall fragment from p974
(mouse 18S ribosomal gene for quantitation). The probes were labelled
by either nick-translation or oligolabelling (see below). The copy
number quantitation of the human H4 histone gene was done by
densitometric scanning of multiple autoradiograms. The exact amount of
DNA in each lane was determined by reprobing the Southern blots with
the mouse 18S ribosomal gene. This gene served as an internal control
for variations in the actual amount of DNA loaded and any loss during
the process. The copy number of the mouse 18S ribosomal gene should be
invariant and all densitometric values for the human H4 histone genes
were corrected to account for the actual amount of DNA in the lane
based on the internal control.
Labelling of DNA fragments using Klenow fragment. This was done as
described by Maniatis et al. (1982). Two hundred nanograms of plasmid
or A phage DNA were digested to completion with the restriction enzymes
of choice. One to two microcuries of [a-^^P]dCTP were added with - 0.5
units of the large fragment of E. coli DNA polymerase I (Klenow
fragment, BRL). The reaction was incubated for 10 min. at room
temperature. Then 2 pi of 0.2M EDTA, 100 pi of 0.3M sodium acetate,
and 20 pg of yeast tRNA were added to stop the reaction. The labelled

52
DNA fragments were recovered by precipitation with 95% ethanol at -
70°C. The DNA was recovered by centrifugation and resuspended in 100 /¿I .
of TE.
Nick translation and oligolabelling. Both of these methods were
utilized for the production of DNA hybridization probes. Nick
translation was done as described by Rigby et al. (1977). For the copy
number experiments the EcoRI/Xbal fragment of pF0002 was isolated with
the IBI fragment eluter and 250 ng were used in the reaction. A 25 /¿I
reaction was composed of 2.5 /¿I of 10X buffer (500 mM Tris-HCl pH 7.5,
50 mM MgCl2, 1 mg/ml bovine serum albumin (BSA, Sigma Fraction V)),
2.5 ¿tl of 10X nucleotides (330 /tM each of dATP, dGTP, dTTP), 40-80 /¿Ci
of a-^^P-dCTP, 2.5 units of E. coli DNA polymerase I (BRL), 1 /tl of a 1
x 10'^ dilution of DNasel (stored in 10 mM HC1 at 1 mg/ml) activated at
1:100 for 1-2 hours on ice in 10 mM Tris-HCl pH 7.5, 5 mM MgCl2, 1
mg/ml BSA. The reaction was begun with the final addition of the DNasel
and incubated at 14°C for 45 min. The reaction was stopped by dilution
with TE and the probe purified over a pipette (10 mm x 100 mm, Fisher)
column of Biogel Al.5m in TE. The sample was applied to the column in a
200 /tl aliquot and 200 /tl fractions were collected. The labelled DNA
usually came off in fractions 6-10. These were pooled and quantitated
in the scintillation counter. The specific activity of these probes was
always greater than 1 x 10^ cpm/ug. Oligo-labelling was done as
described by Feinberg and Vogelstein (1983). The DNA fragment (100 to
200 ng) was added to a 1.5 ml Eppendorf tube and ddH20 added to make
the final volume after addition of the other components either 12.5 /il
or 25 /j1. This tube was then heated to 95-100°C for two minutes and

53
placed on ice. To this denatured DNA fragment was added 10 /¿I of 2X
oligolabelling buffer (2X = 500 mM Hepes pH 6.6, 50 /xM each of dATP,
dGTP, dTTP; 125 mM Tris-HCl pH 8.0, 25 mM 2-mercaptoethanol, 0.55 mg/ml
mixed bexanucleotides (Pharmacia)). We added 25-50 /xCi of [a-^P]dCTP
and 2.5 units of Klenow fragment (BRL). The reaction was allowed to
proceed for 2 hours to overnight and purified as described above for
the nick translation reaction. Specific activity of these probes
O
usually exceeded 2-4 x 10° cpm//xg.
Preparation of total cellular RNA. Because of the sensitivity of
histone mRNA to degradation following the cessation of DNA synthesis,
it was important that the initial steps of this protocol be carried out
as quickly as possible.
The medium from 2-4 plates was removed and 1 ml of cold Puck's
saline (Gibco) + 0.02% EDTA was added and the cells were immediately
scraped from the dish and transferred to a sterile, DEPC treated, corex
tube. The cells were pelleted in the clinical centrifuge at a setting
of five for 2 min., the supernatant was removed and the cells were
frozen on dry ice and subsequently stored at -20°C for no more than a
few days. Degradation can occur quickly and therefore it was necessary
to prepare the RNA as soon after harvesting as possible. The cell
pellet was resuspended in 1 ml of 2mM Tris HC1 pH 7.4, 1 mM EDTA, and
10 ng/ml polyvinylsulfate (PVS, Eastman Kodak). SDS (10%) was added to
a final concentration of 1% and proteinase K added to 200 /xg/ml.
Incubation was at 37°C for 30 min. at which point 5M NaCl was added to
a final concentration of 500 mM and the incubation continued for an
additional 15 min. The total nucleic acids were extracted with 2

volumes of phenol/chloroform, 2 times, and with 3 volumes of
chloroform 1 time. The total nucleic acid was then precipitated by the
addition of 60 /il of 3M NaAc and 2.5 vols of 95% ethanol (-20°C
overnight). The nucleic acids were recovered by centrifugation at 10K
rpm for 15 min. at 4°C. The pellet was resuspended in 500 n1 of 10 mM
Tris HC1 (pH 7.4), 2 mM CaCl2, and 10 mM MgCl2 with the addition of 25
fil of proteinase K treated DNase I (see below for preparation) and
digested at 37°C until it was completely suspended (this usually
required from 30 min. to 1 hr., intermittent vortexing helped to
disrupt the pellet). When the pellet was no longer visible, SDS and
NaCl were added to a final concentration of 0.5% and 250 mM,
respectively. The solution was extracted 2 times with phenol/chloroform
and 1 time with chloroform, and precipitated with 3 vols of 95% ethanol
overnight. RNA was either stored in water at -70°C or in ethanol at -
20°C. Ethanol suspensions needed to be vigorously mixed to avoid
quantitation problems with the RNA aliquots. RNA stored in water was
also mixed before removal.
Preparation of RNase free DNasel. Deoxyribonuclease I (Sigma)(1
mg/ml in 20 mM Tris-HCl pH 7.4, 10 mM CaCl2) was preincubated at 37°C
for 20 min. and then further incubated for 2 hrs. at 37 °C in the
presence of 0.1 volumes of proteinase K (1 mg/ml in 20 mM Tris-HCl pH
7.4, 10 mM CaCl2) to digest any contaminating ribonuclease activity as
described by Tullis and Rubin (1980) . This preparation was stable on
ice for several hours to overnight.
SI nuclease protection assay. This method is essentially as
described by Berk and Sharp (1977) with modifications-. In order to

detect the human histone H4 mRNAs 25 pg of total cellular RNA from a
C127 cell line containing an integrated human H4 histone gene construct
were added to a DEPC treated 1.5 ml Eppendorf tube. Sufficient human
and mouse probe, labelled with [y-^pjATP, was added to provide an
excess (5 to 10 ng) of protected fragment in the reaction. Probe excess
was either determined by titration of the probes with a stock C127 or
HeLa RNA sample or by addition of twice the amount of probe to some
reactions. One twentieth volume of 5M NaCl and 3 volumes of 95% ethanol
were added and the solution was placed on dry ice for 15-30 min. The
precipitated RNA and probes were recovered by centrifugation at 10K
rpm for 15 min. at 4°C. The pellet was briefly dried in a Savant Speed
Vac (1-2 min.). Four microliters of 5X hybridization buffer (2M NaCl,
0,2 M Pipes pH 6.4, and 5 mM EDTA) were added followed by 16 pi of
recrystallized formamide (Specialty Biochemicals). The buffer was added
first to the pellet to facilitate rehydration. The final volume, 20 pi,
was vortexed vigorously to resuspend the precipitated RNA and probe.
The tubes were placed at 90°C for 10 min. and then transferred
immediately to a 55°C water bath and incubated for 12-18 hrs
(overnight). Each tube was removed individually from the water bath and
the reaction diluted immediately with 8 volumes of ice-cold SI
digestion buffer (280 mM NaCl, 50 mM NaOAc, pH 4.5, and 5 mM ZnS04) and
placed briefly on ice. SI nuclease (Boehringer-Mannheim) was added to a
final concentration of 3 units/pl and digestion was then done at 24-
26°C for one hour and at 4°C for 15 min. (the tubes were placed on
ice). Ten microliters each of 10% SDS and 5M NH4OH were added and the
reaction was extracted and precipitated with 3 volumes of 95% ethanol.

56
The length of precipitation was from 3-12 hours at -20°C. (The
precipitations should not be done at -70°C as this will cause the
formation of formamide crystals). The precipitated probe fragment was
recovered by centrifugation at 10K rpm for 30 min. The pellet was
briefly dried and resuspended in 2-4 ¡J.Y of loading buffer (80%
formamide, IX TBE, 0.01% Bromophenol Blue, and 0.01% Xylene Cyanol).
Samples were denatured at 100°C for 3 min. and placed immediately on
dry ice until loaded. Samples were electrophoresed on a 6%
polyacrylamide, 8.3 M urea gel at a 50W constant power for 3-4 hours
(the acrylamide to bisacrylamide ratio was 20:1). Gels were dried and
exposed to preflashed XAR-5 film (Kodak) at -70°C with Dupont Cronex
Lightning Plus Screens.
DNA sequencing. All sequencing reactions were carried out exactly
as described by Maxam and Gilbert (1980) and so will not be detailed
here. For each fragment that was sequenced the G (Dimethyl Sulfate,
(DMS)); G+A (Formic acid); C+T (Hydrazine); C only (Hydrazine in high
salt); and A>C (1.2 N NaOH) reactions were done. Single end labelled
fragments were prepared as follows: plasmid DNAs were digested with an
appropriate restriction endonuclease, treated with phosphatase, and
labelled as described below. After the DNA was labelled it was digested
with a second restriction enzyme to produce two single end labelled
fragments. To purify the fragment of interest for analysis we
electrophoresed the DNA on a native 4% acrylamide gel. The location of
each labelled DNA band on the gel was determined by exposure to Cronex
(Dupont) X-ray film. After alignment of the film and the gel we excised
the bands of interest and eluted them in 500 /iL of 500 mM ammonium

acetate, 10 mM MgCl2, 0.5% SDS, overnight at 37°C as described by
Maxara and Gilbert (1980) . The acrylamide gel slice was ground with a
siliconized glass rod in a 1.5 ml Eppendorf tube prior to addition of
the elution buffer. After the overnight incubation the acrylamide was
centrifuged to the bottom of the tube at 10K rpm for 5 min. The
supernatant was removed and the pellet resuspended in 200-400 /j.1 of
elution buffer, centrifuged, and the supernatant removed. This
procedure routinely resulted in recoveries of 80-90% of the labelled
DNA fragment. The pooled supernatants were then precipitated twice in
succession with 3M Sodium Acetate and 95% ethanol. These fragments were
then used in the sequencing reactions noted above. After the reactions
were carried out and the DNA was cleaved with piperidine and
lyophilized, it was electrophoresed (50W constant power) on a 6%
acrylamide, 8.3M urea gel (45 cm x 30cm x 0.5mm). The samples were
resuspended in 6 ¿il of SI loading buffer and divided into two, 3 ¿¿1
aliquots. These were boiled for 3 min. and placed on dry ice. To
maximize the amount of the sequence we could read, two loadings of the
reactions were done. The first 3 ¿¿1 sample of each reaction was loaded
and electrophoresed for 5-6 hours or until the Bromophenol Blue reached
the bottom of the gel. The second sample was then loaded and
electrophoresed for an additional 5-6 hours. The gel was then dried and
exposed to either Cronex or XAR-5 film at room temperature overnight.
SI nuclease analysis probe preparation. Two probes were routinely
used to quantitate the amount of human and mouse histone H4 mRNA
present in cell line samples. The human probe was prepared by digestion
of 50-100 ¿¿g of pF0005 or pF0002 with Ncol. This digestion was then

58
extracted, precipitated, and the DNA recovered by centrifugation at
10k rpm for 15 min. The pelleted DNA was resuspended in 50 /¿L of 50 mM
Tris-HCl pH 8.0, 0.1 mM EDTA, 1 unit of calf intestinal phosphatase
(CIP) was added and the mixture was incubated at 37°C for 30 min. An
additional aliquot of enzyme was added and the DNA incubated for 30
min. The reaction was stopped by the addition of EGTA (ethyleneglycol-
bis-(/3-aminoethyl ether)-N,N,N',N',-tetraacetic acid) to 10 mM and
heated to 65°C for 20 min. The DNA was then extracted and precipitated.
The DNA was resuspended in 10 fj.L of y-^P-ATP (100 /¿Ci) and 1 /iL of 10X
Kinase buffer (500 mM Tris-HCl pH 7.6, 100 mM MgCl2, 100 mM 2-
mercaptoethanol). After resuspension, 15 units of T4 polynucleotide
kinase (United States Biochemical Corporation) were added and the
reaction incubated at 37°C for 45 min. The reaction was stopped by
extraction followed by precipitation. The DNA was recovered,
resuspended and digested with Hindlll to produce a probe fragment
labelled at the Ncol site in the human H4 gene. The reaction was was
electrophoresed on a 1.0% agarose gel in IX TBE and the 695 bp
Ncol/Hindlll fragment, labelled at the Ncol site purified with the IBI
fragment eluter as described by IBI. The mouse H4 probe was produced in
a similar manner from the plasmid pBR-mus-hi-l-H4-HinfI (Seiler-Tuyns
and Birnstiel, 1981) digested with BstNI. The labelled 1000 bp BstNI
fragment was isolated and used as a control in each SI nuclease
protection assay. Although this probe was not single end labelled, we
had no ambiguities because of this fact. To make the probe shorter and
single end labelled would have possibly obscured the protected fragment
of the human H4 gene (280 nt). Both the human and mouse H4 SI nuclease

59
probes were quantitated on agarose gels stained with ethidium bromide
and exposed to Cronex X-ray film to judge the relative strength of
each. Generally a large amount of probe (several micrograms) was
prepared simultaneously and SI nuclease analysis was done on many
samples to ensure that the expression was measured with the same
strength probe in each case. Variation in the mouse and human probe
specific activity did occur; however, the data presented in this work
were prepared primarily from a large set of SI nuclease assays in
which many cell lines were assayed side by side with the same mouse and
human probe preparation. When additional cell lines were subsequently
measured, samples assayed previously were included to ensure that the
results could be related to results from previous assays.
Densitometry and data analysis. Densitometry of autoradiograms
was done to quantitate the SI nuclease analysis experiments of H4 gene
expression and the copy number of the cell lines. Several films of
different length exposure were utilized to determine the intensity of
the SI protected fragment signal. Two densitometers were used, a Zeineh
laser densitometer and an LKB-Pharmacia high intensity laser
densitometer. Comparison of the capabilities of each densitometer
demonstrated that for most films either one was adequate; however for
particularly low intensity signals the LKB machine gave more
reproducible results. The data collected by both densitometers were
computer processed with either the Videophoresis II (Zeineh, Biomed
Instruments) or the GelScan XL programs (LKB-Pharmacia). Each program
was successfully used to analyze the intensity of radioactive signals
for expression and copy number. The areas under the curve for the SI

60
nuclease analysis (mouse and human) and the copy number blots (H4 and
18S ribosomal) were integrated and expressed as an amount of absorbance
units. To calculate the expression of a particular construct, the human
expression value was divided by the mouse value and expressed as a
ratio. Sample calculations for copy number are presented in Appendix A
and for SI nuclease analysis in Appendix B.
Agarose and acrylamide gel electrophoresis. Agarose (Bio-Rad
molecular biology grade) gels were prepared as described by Maniatis et
al. (1982). The buffer was IX TBE and the buffer in the reservoir was
also IX TBE. 20 x 25 cm gels were used for large scale fragment
purification and Southern blot analysis of cell line DNAs. Minigels
were used for checking the extent of digestion and analysis of rapid
and other plasmid preparations. Acrylamide gels were routinely run for
Si nuclease analysis and consisted of 6% acrylamide (20:1 acrylamide to
bis acrylamide), 8.3 M urea, and IX TBE. The gel solution (75 ml) was
polymerized with the addition of 750 /j1 of 10% ammonium persulfate and
20 fil of N,N,N',N',-tetra methylethylenediamine. It was immediately
poured, the comb put into place and allowed to harden for 1 hour.
Before use the wells were rinsed with buffer and the gel was
preelectrophoresed for 30 min. at 50W constant power. The samples were
loaded and electrophoresed at 50W constant power.
Genomic sequencing. This technique was done as described by Church
and Gilbert (1984). Monoclonal cell lines pF0003ml, 5, and 6 were grown
in 15 cm plates (10 per construct). Seven of the 10 were treated with
0.5% DMS in 2-3 mis of medium for 1-2 minutes. Three were left
untreated, the DNA purified, and treated with DMS in vitro as a

61
control. The DMS was removed from the plate and the cells washed twice
in phosphate buffered saline (PBS = 150 mM NaPO/,., 150 NaCl, pH 7.2, 60
mM Tris-HCl, pH 7.4). The DMS treated cells were scraped from the plate
and the DNA purified by incubation with proteinase K as described above
and extraction. To purify high molecular weight DNA only, 95% ethanol
was slowly added to the tube while swirling the solution with a
siliconized glass rod. The DNA was washed off the rod with TE and
quantitated spectrophotometrically. The purified DNA (30 fig) was
restricted with Hiñe II, treated with piperidine and lyophilized as
described by the sequencing protocol of Maxam and Gilbert (1980). The
samples were then separated in a 6% acrylamide gel, with 8 M urea and
electrotransferred to a nylon membrane (Genescreen). The hybridization
probe was prepared as described by Pauli et al. (1987) with primer
extension of a fragment cloned into M13. In our experiments
hybridization was performed with the Hiñe II 5' upper strand probe at
65°C for 16 hrs, followed by eight 5 min. washes at 65°C (1 mM EDTA, 40
mM NaHP04, pH 7.2, 1% SDS). The membrane was then exposed to preflashed
XAR-5 film at -70 C. In these experiments I was responsible for the
growth of the cells and Dr. Urs Pauli performed the rest of the
experiment, with my constant encouragement, and occasional
intervention.
Statistical analysis. The analysis of the SI nuclease and copy
number data that we accumulated was suggested by Dr. Mike Conlon of the
University of Florida Biostatistics Unit. After he had examined the
data and gained an understanding of the complexities involved, he
advised that we employ a ranking test, the Wilcoxon Rank Sum Test. This

62
test makes the null assumption that two groups of data that are
compared came from the same random distribution. The members of each
group are assigned a rank (i.e. 1, 2, 3, . ..) from highest to lowest
in both groups. For example if we had two sets of data, A ** 1, 2, 4,
6, and 12 and B = 10, 14, 16, 19, and 25, the members of group A and B
would be ranked in order of increasing value. The absolute values of
the data are ignored and only the rank is examined.
Group A:(l, 2, 4, 6, 12) is converted to Ranks =1, 2, 3, 4, 6.
Group B:(10, 14, 16, 16, 25) is converted to Ranks =5, 7, 8, 9, 10.
We have 5 members in each group with only one point of overlap
between the two groups at ranks 5 and 6. The Rank Sum for group A = 17
and for group B = 39. To determine if the difference of the Rank sums
is significant, statistical tables of probability for this test were
employed. These two groups of data are not significantly different at
p < 0.05. The reason is the small sample size. With only five members
in each group the fact that one of the members of each group falls into
the range of the other group precludes any significance. As the groups
become larger the overlap allowed for significance becomes greater. I
have found with some of my data that larger sample sizes would have
been necessary to employ this test in all cases.

CHAPTER 3
HISTONE H4 5' REGULATORY SEQUENCES
It has been established that the steady state level of histone mRNA
during the cell cycle is a function of both transcription and message
stability. These two components of histone mRNA metabolism have been
studied in a number of different ways. Earlier studies by Plumb et al.
(1983a, b) utilized pulsed incorporation of ^H-uridine to determine the
contribution of transcription to the increase in histone mRNA levels
during the S-phase of the cell cycle. Later, Baumbach et al. (1987)
used nuclear run-on transcription to measure transcription of the
histone genes directly during the cell cycle. The increase in
transcription during early S-phase was determined to be 3-5 fold by
both Baumbach et al. (1987) and Plumb et al. (1983b). In the studies
of Baumbach et al. (1987), message stability was eliminated as a
variable in the experiments, and therefore they were able to determine
that histone gene transcription occurred throughout the cell cycle at a
basal level. Instead of an "on/off" mechanism for transcriptional
control an "enhancement" was apparent during the first 4 hours of S-
phase. The 3-5 fold enhancement in the histone gene transcription
level has been duplicated in various systems and by different methods
during the last 5 years (Sittman et al., 1983; Heintz et al., 1983;
Artishevsky et al., 1987).
63

64
The implications are that protein/DNA or protein/protein
interactions occur that stimulate the increased level of
transcription. Evidence for specific protein/DNA interactions has been
gathered by Artishevsky et al. (1987). They demonstrated, at the end
of G1 and the beginning of S phase, the presence of a factor that
interacted with the proximal promoter region of the hamster H3
promoter. The F0108 H4 gene, with which my work has been done, also
demonstrates protein/DNA interactions in the proximal promoter region
(Pauli et al., 1987, van Wijnen et al., 1987); however, there are no
detectable changes in these interactions during the cell cycle. Since
it has been demonstrated that transcription of the F0108 H4 histone
gene proceeds throughout the cell cycle at a basal level, it was of
interest to discover what sequences are necessary for basal and
enhanced expression. The promoter of the F0108 H4 histone gene is
potentially extensive and so deletions that encompass the entire 6.5 kb
of possible promoter sequence were prepared and analyzed. In the
proximal region of the promoter we were interested to understand the
functionality of elements such as the TATAA box, GGTCC element, Spl
binding site, and putative CAAT boxes. More distal elements have also
been examined and these included a possible enhancer and negative
regulatory element located thousands of base pairs upstream.
As mentioned in the introduction, the differences encountered in in
vivo and in vitro transcription systems have sometimes been
considerable. In order to ascertain the functional in vivo promoter
sequences of the F0108 human H4 histone gene, we constructed a series
of mouse C127 cell lines each containing a different H4 promoter

Figure 3-1
Schematic diagram of some of the human H4 histone gene
deletion constructs.
At the top of the figure is the original AHHG41 phage clone isolated by
Sierra et al. (1982). The five Bal 31 deletions of pF0108A are noted
(Sierra et al., 1983). The distance from the end of the histone promoter
sequence to the cap site is indicated to the right of each construct.
F0001, F0006, F0004, and F0004R are fusions of the proximal promoter
region and coding sequences to distal fragments and the dotted line
indicates the extent of the deletion that occurred between the two
fragments. The scale at the bottom is 2 kb on the AHHG41 schematic and 1
kb on all others. The pertinent restriction enzyme sites are denoted
EcoRI, E; BamHl, B; HindIII, H; Xbal, X; Ncol, N. The most commonly
used SI nuclease probe is designated at the bottom of the figure
labelled at the Ncol site.

X HHG41
H3
H H
h px H4e|e| BB
i i i ^ 11T1 i I
E X
l L.
P . X
L L.
H 4
E H E H B B
1-11 I I I—
. E
-6.5 kb
scale

67
deletion construct. As described in the prologue to the Materials and
Methods section, we decided that this was the best way to proceed. We
hoped that stable integration into the chromosome would give the most
accurate information about the function of H4 promoter sequences.
Cell line construction
The first step in these experiments was to construct the cell
lines. The mouse C127 cell line was chosen because it was a
heterologous host and had been previously used to support the stable
expression of the F0108 human H4 gene in an episomal form (Green et
al., 1986). Many of the histone H4 plasmid DNA constructs were
available already (Figure 3-1), although as the work progressed several
more were prepared to answer various questions that arose. The
constructs are all products of subclones of the original A human
histone gene clone 41 (AHHG41) isolated by Sierra et al. (1982) and
this is diagramed at the top of Figure 3-1. The proximal deletion
constructs J67, J56, J50, K8, and L14 (Figure 3-1) were all available
and had been made by Bal31 deletion of pF0108A (Sierra et al., 1983).
The precise determination of each deletion point will be outlined later
in the chapter. A subclone of pF0108, pF0108A, prepared by Sierra et
al. (1983) deleted some 3' sequences including an Alu repeat. Plasmid
pF0005 was made by A. van Wijnen from a Hindlll digestion of pF0002.
Plasmid pF0002 was prepared from a BamHl, PstI digest of AHHG41 to
obtain a fragment with 1065 bp of 5' flanking sequence. Plasmid pF0003
was prepared from an Xbal digest of AHHG41 and has 6.5 kb of 5'
flanking sequence. Additional clones will be described as they pertain

to subjects under discussion later in the chapter--positive and
negative regulatory elements.
Initiation of Transcription and Basal Regulation
The initiation of transcription by RNA polymerase II and the
sequences required for it have been studied in considerable detail in a
number of genes, as outlined in the introduction (Reviewed in Shenk,
1981). The importance of the TATA box has been established in vitro
and in vivo. and it is thought to be primarily responsible for the
specification of the transcription initiation site. We constructed
cell lines with several of the short proximal deletion constructs in
order to ascertain what sequences in the F0108 H4 histone gene were
necessary for the initiation of transcription. The general protocol
for DNA transfection and the subsequent selection and expansion process
is outlined in Figure 3-2. The constructs were cotransfected into C127
cells with the plasmid pSV2neo. The inclusion of the pSV2neo plasmid
permitted selection for expression with the antibiotic Geneticin
(G418). Once resistant cells were present as distinct colonies the
plates were either pooled and passaged (polyclones) or picked and
expanded as monoclonal cell lines. The specific method is described in
the Materials and Methods section I
To determine the level of transcription from each of the proximal
deletion constructs, we analyzed cell lines early in passage. The
results from SI nuclease analysis of total cellular RNA from polyclonal
cell lines 108A, L14, K8, J50, J56, and J67 is presented in Figure 3-3.
RNA was prepared from each cell line as described and hybridized to two
probes, human and mouse, at 55°C for 8-16 hours as described in

Figure 3-2 Flow diagram for the production of both polyclonal and
monoclonal mouse cell lines that contain stable
integrated human histone H4 genes.
The method relies on the cotransfection of the histone plasmid with a
selectable marker, pSV2neo. This plasmid carries the gene that confers
resistance to a derivative of neomycin. The cotransfection procedure
permitted the pSV2neo plasmid to be taken up with the histone plasmid
into the mouse C127 cells. These stable cell lines were utilized to
study human H4 gene, expression. The specific protocol is outlined in
materials and methods.

10:1
C1?7 (40%)
cells
4 hr
glycerol shock
J 2 days
split 1:5 G418
/ \
polyclones monoclones
2-3wks
I
pool -G418 pick
i 24well
passage
j 1-2wks
expand
passage

71
Figure 3-3 SI nuclease analysis of proximal deletion polyclonal
cell lines.
SI nuclease analysis was done as described in Materials and Methods and
quantitated by densitometry. Lanes: the cell line name is denoted above
the lane. For example polyclonal cell line pF0108A number 1 is denoted
as 108Apl; C, C127 total cellular RNA and H, HeLa total cellular RNA
incubated with both human and mouse SI probes as a positive control for
the size of the mouse and human SI protected fragments, respectively;
M, pBR322 Hpall marker labelled with a-^P-dCTP and Klenow fragment.
Both human (280 nt) and mouse (110 nt) protected fragments are noted at
the right.

Materials and Methods. The mouse H4 histone probe was included as an
internal control in each SI nuclease assay not only for the intactness
of the RNA preparation, but also as an indicator of the amount of
histone mRNA present in the sample. The half-life of a histone mRNA
after the cessation of DNA synthesis is very short (Plumb et al.,
1983a, Sittman et al., 1983), and therefore the growth conditions of
the cells and temperature at the time of harvested are critical for the
adequate recovery of histone mRNA.
We particularly wanted to determine if there was a minimal amount
of promoter that could initiate transcription in vivo and if this was
different than that seen in vitro. Previously the shortest Bal31
deletion, J67, had been shown to initiate mRNA synthesis accurately in
vitro in a whole cell extract (Sierra et al., 1983). As shown in figure
3-3, the construct J67, which we later learned has only the TATA box
and the GGTCC element, produced no correctly initiated transcripts.
The only transcription products detectable from the J67 construct were
inititated upstream of the normal mRNA start site. These are denoted
with arrows in Figure 3-3, and occur in the cell lines with J50, J56,
and J67 integrated. The upstream transcription start sites map
primarily to the TATA box (-30 bp) and the deletion end points. The
"deletion end point transcripts" originate from outside of the histone
flanking sequences either in the plasmid or surrounding chromosomal DNA
and are detected by virtue of the lack of homology between the probe
and the mRNA past the deletion point.
The possibility that J67 was unable to express correctly initiated
H4 mRNA was based on a single polyclonal cell line. To assure
ourselves that this was not a result of a spurious integration event we

73
Figure 3-4 Southern blot analysis of polyclonal cell lines:
Intactness of 5' flanking regions and copy number of the
constructs in each cell line.
Genomic DNA purified from each cell line was digested with EcoRl and
Xbal, electrophoresed, blotted, probed, and quantitated as described in
Materials and Methods. Lanes: 1, pF0108Apl, 2, pF0108Ap2, 3, L14p2, 4,
L14p3, 5, K8pl, 6, K8p2, 7, J50pl, 8, J56pl (passage 4), 9, J56pl
(passage 8), 10, J67pla. Histone plasmid markers (EcoRI/Xbal digested
pF0002) were included on the blot equal to 1.3 (10 pg), 6.5 (50 pg),
and 13 (100 pg) gene equivalents per diploid genome in order to
quantitate the human histone H4 copy number. H, HeLa DNA digested with
EcoRl and Xbal as a positive control for the 1070 bp fragment. M, A DNA
digested with EcoRl and Hindlll and Klenow labelled. Pertinent sizes
are denoted to the right in kilobases. The probe for this experiment
was the EcoRI/Xbal fragment of pF0002 that had been nick-translated as
described in Materials and Methods.

determined the intactness of the flanking and coding sequences for each
of the constructs J67, J56, J50, K8, L14 and 108A in Figure 3-4. This
experiment also permitted us to determine the copy number of each cell
line. Ten micrograms of genomic DNA from each cell line was digested
to completion with EcoRl and Xbal and electrophoresed on a 1% agarose
gel, blotted and probed as described in Materials and Methods. In
order to quantitate the copy number of each cell line the gel also
contained plasmid DNAs of known amounts digested with both EcoRl and
Xbal. Ten, 50 and 100 pg correspond to 1.3, 6.5 and 13 gene
equivalents per diploid genome respectively as designated in Figure 3-
4. Several exposures of the autoradiogram were scanned with a Zeineh
laser densitometer and quantitated in comparison to the controls.
Additionally, the Southern blot in Figure 3-4 was quantitated for the
actual amount of DNA by densitometrically scanning a photographic
negative of the gel prior to transfer, and differences in DNA amounts
have been taken into account in the copy number calculation. Later,
copy number blots for other constructs were reprobed with a clone of
the mouse 18S ribosomal gene kindly provided by the Dr. David
Schlessinger (Washington Univ., St Louis) to allow exact determination
of the amount of DNA loaded in each lane and subsequently transferred.
A sample copy number calculation in which the ribosomal probe was
utilized is presented in Appendix A.
The Southern blot analysis demonstrated not only the copy number of
each cell line, but permitted us to conclude that the flanking region
of most constructs was intact. The mode of integration for the histone
plasmids is described further in chapter 4.

Table 3-1
Quantitation of Polyclonal Cell Line Expression.
Cell Line
Human/Mouse Exd
Codv number
Exd/Copv number
108Apl
0.016
1
0.016
108Ap2
0.040
13
0.003
L14p2
0.018
1
0.018
L14p3
0.017
4
0.004
K8pl
0.028
3
0.009
K8p2
0.029
2
0.014
J50pl
0.034
1
0.034
J56pl
0.019
50
0.0004
A quantitative summary of the expression data from the polyclonal cell
lines of the proximal deletion constructs. The human/mouse expression
ratio was determined by densitometry of the SI nuclease protected
fragments in Figure 3-3. Copy number for each cell line was determined
from the Southern blot in Figure 3-4. Since these data were derived
from polyclonal cell lines it is not possible to interpret the results
strictly, and we would like to note that copy number in a polyclonal
cell line is somewhat ambiguous. Expression is denoted as Exp.

76
The results of the SI nuclease analysis and copy number
determination are presented in Table 3-1. The SI nuclease assay was
similarly quantitated with the densitometer and the results are
expressed as a ratio of the mouse and human signals. The results,
although of a few individual cell lines, have been repeated several
times. The SI nuclease analysis results from the proximal deletion
polyclones suggested that J67 (-47bp) was unable to correctly initiate
histone mRNA transcription. Only when the promoter was extended in J56
(-73 bp) was correct initiation observed (Figure 3-3). It can be seen
from the data in Table 3-1 that the expression per copy of the J56
construct (-73 bp) is quite low in vivo (expression/copy = 0.0004), and
as noted later this may be somewhat a reflection of the copy number and
not the amount of 5' sequence present in the construct. When the
flanking sequences are extended to -100 bp in the construct J50 there
is an apparent 80 fold increase in the expression/copy ratio (0.034).
The expression/copy ratio of the remaining deletion constructs
stabilizes at a value of 0.02 to 0.01 with increased length of 5'
sequence. This 25-50 fold increase is probably exaggerated because of
copy number differences between J56 and the longer constructs. This
phenomenon (expression versus copy number) will be discussed later in
the chapter. Still it is likely that the difference in the
expression/copy ratio is 10 fold. These data are supported by the
results of Ken Wright in our laboratory, who has utilized in vitro
transcription to define the functionality of proximal promoter elements
and demonstrated that in nuclear extracts the transcription of J50

*108A *L14
AGCCCGGTTGGGATCTGAATTCTCCCGGGGACCGTTGCGTAGGCGTTAAAAAAAAAAAAG
-200
TCGGGCCAACCCTAGACTTAAGAGGGCCCCTGGCAACGCATCCGCAATTTTTTTTTTTTC
*K8
AGTGAGAGGGACCTGAGCAGAGTGGAGGAGGAGGGAGAGGAAAACAGAAAAGAAATGACG
-150
TCACTCTCCCTGGACTCGTCTCACCTCCTCCTCCCTCTCCTTTTGTCTTTTCTTTACTGC
*J50 *J56
AAATGTCGAGAGGGCGGGGACAATTGAGAACGCTTCCCGCCGGCGCGCTTTCGGTTTTCA
-100 ....
TTTACAGCTCTCCCGCCCCTGTTAACTCTTGCGAAGGGCGGCCGCGCGAAAGCCAAAAGT
*J67
ATCTGGTCCGATACTCTTGTATATCAGGGGAAGACGGTGCTCGCCTTGACAGAAGCTGTC
-50 ' • +1
TAGACCAGGCTATGAGAACATATAGTCCCCTTCTGCCACGAGCGGAACTGTCTTCGACAG
TATCGGGCTCCAGCGGTCATGTCCGGCAGAGGAAAGGGCGGAAAAGGCTTAGGCAAAGGG
+50
ATAGCCCGAGGTCGCCAGTACAGGCCGTCTCCTTTCCCGCCTTTTCCGAATCCGTTTCCC
Figure 3-5 Schematic diagram of the proximal human histone H4
Bal31 deletion mutants: Sequence analysis of the
deletion points.
Each construct was sequenced according to the protocol of Maxam and
Gilbert (1980) and as described in Materials and Methods. The deletion
point of each construct is denoted with an asterisk over the last
nucleotide included in the sequence of that construct. For reference
the ATG codon, TATA box, GGTCC element, CAAT boxes and Spl site have
been underlined. The two bolded regions of the promoter correspond to
Site I and Site II, the DNAsel protected regions of protein/DNA
interaction as defined by Pauli et al. (1987).

(-100 bp) is several fold higher than J56 (-73 bp) ( Ken Wright,
personal communication).
Previously, the deletion points of the Bal 31 deletions had been
determined by restriction enzyme analysis and electrophoresis on high
percentage agarose gels (Sierra et al., 1983). To determine exactly
the deletion point, each construct was sequenced by the method of Maxam
and Gilbert (1980). Ken Wright and I collaborated in this effort and
the approach we undertook is described in Materials and Methods.
Importantly, the strategy permitted us to sequence across the deletion
point in each construct and to determine the exact end of Bal31
digestion. The deletion points we determined are denoted in Figure 3-
5.
When we examined the sequence of the J67 (-47bp) deletion, it was
obvious that the GGTCC element and TATA box were still present and the
proximal CAAT box (-53 bp) was absent. Our SI nuclease analysis
suggested that this was not sufficient promoter sequence for correct in
vivo transcription initiation. To ensure that this was indeed the
case, we prepared 5 additional polyclonal cell lines of J67 and
demonstrated that they all contained integrated constructs (Figure 3-
6b,c); however, none expressed a correctly initiated histone H4 mRNA
(Figure 3-6a). The absence of a detectable SI protected fragment in
the J67 polyclonal cell lines was repeated several times. Upstream
initiation of transcription was sometimes detectable although this was
not consistent. The importance these results became apparent when
Drs. Urs Pauli and Susan Chrysogelos of our laboratory demonstrated the
binding of proteins to the proximal promoter region of this H4 gene in

Figure 3-6 SI nuclease and Southern Blot analysis of J67 polyclonal
cell lines for correct human H4 expression and copy
number.
Additional J67 polyclonal cell lines were made to confirm that this
construct was unable to initiate human H4 mRNA transcription correctly.
A. SI nuclease analysis of 25 /¿g total cellular RNA from 5 new J67
polyclonal lines and the one tested previously, J67pla. Also shown are
polyclonal lines 108Ap4 and 108Xp2. H, HeLa total cellular RNA. C,
C127 total cellular RNA. M, pBR322 Hpall markers. The human H4 SI
protected fragment (280 nt) is noted with an arrow at the left. There
was no detectable human H4 signal in any of the J67 lanes even upon
repetition and long exposure. B. Southern blot analysis of J67
polyclonal cell line for copy number determination. J67 polyclones 1-5
and pF0108Aml2 are shown. The position of 1070 bp is noted and the
arrow indicates the size of the deletion EcoRI/Xbal fragment from J67.
Plasmid DNAs in the amount of 10, 50, and 100 pg were included for copy
number quantitation as described in Fig 3-4. H, HeLa cell DNA digested
with EcoRI and Xbal; C, C127 cell DNA digested with EcoRI and Xbal. C.
The blot in B was reprobed with the 18S mouse ribosomal fragment for
quantitation of the amount of DNA in each lane. The size of the 18S
band, 1.3 kb, is noted at the right. Quantitation was done as described
in Materials and Methods and Appendix A.

80

vivo (Pauli et al., 1987). The specific areas of protein/DNA
interaction as defined by DNase I protection are outlined in Figure 3-5
with the construct deletion end points. Interestingly, the J67
deletion point is located in the middle of Site II and leaves the
proximal portion with the GGTCC element and TATA box intact. It would
appear that the absence of Site I and the presence of only half of Site
II are insufficient for transcription initiation in vivo. However,
when all of Site II is present in the of construct J56 a low but
detectable level of transcription is present (Figure 3-3 and Table 3-
1). The large increase in the expression/copy ratio of the J50 (-100
bp) construct is apparently the result of remarkable similarity to the
Spl (Dynan and Tjian, 1983b) binding site as described by Briggs et al.
(1985) and Evans et al. (1988). Although we have not proven that the
protein/DNA interaction at this site is the result of Spl, it seems a
strong possibility that it could be Spl or a similar protein. J50 also
includes a putative CAAT box, however the functionality of this
sequence is in question because it lacks the necessary homology to the
consensus sequence. Additionally, this CAAT box is not entirely
included in the protein binding domain of Site I as described by Pauli
et al. (1987) and it is therefore unlikely that it functions in the
same capacity. It should be mentioned that Spl has been shown to
interact with CTF in the HSVtk promoter (Jones et al., 1985), and
possible interaction in the histone promoter should not be ruled out
immediately, however it is unlikely. The CAAT sequence is well
conserved evolutionarily in conjunction with the GGTCC element (Wells,

82
1986) and our results suggest that the removal of this element in the
distal half of Site II prevents correct transcription initiation.
We investigated the whether any diatl promoter elements had an
effect on the transcription of the F0108 human H4 histone gene.
Polyclonal cell lines were prepared from constructs pF0005 (-417 bp),
pF0004 (-6.0 to -7.5 kb), pF0002 (-1065 bp), and pF0003 (-6.5 kb). The
results of the SI nuclease analysis and limited copy number analysis on
these cell lines suggested that upstream sequences beyond those already
examined might contribute to an increased level of expression (data not
shown). Upon reflection, it is likely that in most cases, the
increased level of expression we noted was the result of high copy
number, and not necessarily because of a strong promoter sequence such
as an enhancer. These results, although limited at the time, prompted
us to examine in a more rigorous way the distal 5' promoter sequences
of the F0108 H4 histone gene for possible regulatory areas that control
expression.
Transfection of the constructs pF0005 (-417 bp), pF0002 (-1065 bp),
and pF0003 (-6.5kb) into mouse C127 cells was done to assess any distal
contributions to the expression level of this H4 gene. As stated
previously enhancer and silencer/negative regulatory elements can be
located at considerable distances from the promoter of a gene and still
accentuate or depress expression of the linked gene (Maniatis et al.,
1987, Theisen et al., 1986, Baniahmad et al., 1987). The new cell
lines were grown primarily as monoclones, and for continuity with the
previous studies, monoclonal cell lines of pF0108A and K8 were also
prepared.

I will state now that we have found that there is a competition
between the transfected human H4 histone genes and the endogenous mouse
H4 gene for regulatory factors and this is discussed later and in
chapter 4. The interpretation of expression from each construct is
affected by this competition phenomenon, and becomes rather confusing.
We bring this up here only to make the reader aware that this situation
exists, and the results have been interpreted several ways, sometimes
with this taken into account. It has been extremely difficult to
understand the relationship that exists between the endogenous mouse H4
genes and the transfected human H4 genes. We have analyzed the
expression/copy data carefully to decipher any trends. The results of
this analysis are also reviewed in chapter 4. The choice of the mouse
H4 as an internal control for the SI nuclease analysis was both
fortunate and detrimental to our interpretation. In short, the entire
expression analysis is presented here, but because of the realization
later in the course of this work about copy number and competition for
transcription factors, only some of the data will be incorporated into
the final synopsis.
The monoclonal cell lines were analyzed for the level of expression
and copy number present. The SI nuclease analysis of the pF0003
monoclonal cell lines is presented in Figure 3-7 and was done as
described in Materials and Methods. Almost all of the monoclones were
positive for expression of the human H4 histone gene with the exception
of pF0003ml8. We utilized several exposures to determine,
densitometrically, the level of expression from each cell line. The
expression data are presented as a ratio of the human and mouse

84
Figure 3-7 SI nuclease analysis of pF0003 monoclonal cell lines.
SI nuclease assays were performed as described in Materials and
Methods. Almost all 15 clones shown here are positive for expression
of the human H4 gene. The exception is pF0003ml8. H, HeLa total
cellular RNA. C, C127 total cellular RNA. M, pBR322 digested with Hpall
and labelled with a-^P-dCTP and Klenow fragment. Dilutions of the
marker are noted as 1:4, 1:8, 1:16 and 1:32 for densitometry purposes.
The human (280 nt) and mouse (110 nt) protected fragments are denoted
with labels and arrows at the left. The clone numbers appear above the
individual lanes to which they correspond.

Figure 3-8 Southern blot analysis of pF0003 monoclonal cell lines.
Southern blot analysis was performed as described in Materials and
Methods. 10 fig of DNA from each cell line were analyzed with nick
translated EcoRI/Xbal fragment from pF0002. A. pF0003 cell line DNA
probed with H4 sequences. B. The histone probe was removed and the blot
was reprobed with the mouse 18S ribosomal fragment. Densitometry of the
1070 bp band specified by the arrow in A and the 18S ribosomal band in
B permitted quantitation of the copy number through normalization to
the amount of DNA actually loaded and transferred as described in the
Materials and Methods. The figure in A is a composite of several
exposures that reflects the actual copy number and accounts for
original quantitation errors. The plasmid controls for quantitation are
labelled 10, 50 and 100 designating the number of pg loaded. C, C127
cellular DNA. H, HeLa cellular DNA. M, X DNA digested with EcoRI and
Hind III and labelled with a-^P-dCTP and Klenow fragment. The number
of each clone is designated above the lane.

86
A.
nn?
B.
0.9

87
Figure 3-9 Si nuclease analysis of pF0108A and pF0002 monoclonal
cell lines.
SI nuclease assays were performed as described in and Materials and
Methods. The left panel is representative of results obtained from
F0108A cell lines; the right panel with total cellular RNA from pF0002
cell lines. The human and mouse protected fragments are designated with
labels and arrows. The markers, M, are pBR322 digested with Hpall and
important sizes are noted. The number above each lane corresponds to
the clone number of that construct. The markers were diluted Ml:4 and
Ml:8 for densitometry quantitation purposes. H, HeLa total cellular
RNA. C, C127 total cellular RNA.

Figure 3-10 Copy number analysis of pF0002 and pF0108A monoclonal
cell lines.
Southern blot analysis was performed as described in Materials and
Methods. 10 //g of DNA from each cell line were analyzed with nick
translated EcoRI/Xbal fragment from pF0002. A. pF0108A and pF0002 cell
line DNA probed with H4 sequences. B. The histone probe was removed and
the blot was reprobed with the mouse 18S ribosomal fragment.
Densitometry of the 1070 bp band specified by the arrow in A and the
18S ribosomal band in B permitted quantitation of the copy number
through normalization to the amount of DNA actually loaded and
transferred as described in the Materials and Methods. The figure in A
is a composite of several exposures that reflects the actual copy
number and accounts for original quantitation errors. The plasmid
controls for quantitation are labelled 10, 50 and 100 designating the
number of pg loaded. C, C127 cellular DNA. H, HeLa cellular DNA. M,
A DNA digested with EcoRI and Hind III and labelled with a-^P-dCTP and
Klenow fragment. Each set of clones is designated with the black bar
and the number of the individual clones is above the lane.

89
B.
5—
23781 25789 10 14 CH

90
densitometry signals in Table 3-2 (p. 103). The average expression of
nine pF0003 monoclonal cell lines, for which copy number was later
determined, was 2.29 ± 2.43.
It was obvious that these results varied, so the copy number of
each cell line was determined from the southern blots in Figufe 3-8a,b.
The Southern blots of pF0003 monoclonal cell line genomic DNA, digested
with EcoRI and Xbal, were prepared as detailed earlier and in Materials
and Methods. The hybridization probe was the 1070 bp EcoRI/Xbal
fragment isolated from pF0002 and nick-translated. The actual copy
number of each cell line was determined by densitometric analysis of
the 1070 bp EcoRI/Xbal band with normalization for the amount of DNA
actually loaded. The amount of DNA in each lane was determined by
removal of the histone probe at 80°C in 0.1XSSC and subsequent
hybridization with the oligo-labelled BamHI/Sall fragment of the mouse
18S ribosomal gene. Densitometry of the 18S ribosomal band (Figure 3-
8b) permitted normalization of the histone H4 copy numbers and
comparison to the plasmid controls for copy number (see Appendix A for
sample calculation of copy number).
The copy number data helps to explain some of the variation seen
with the original expression determination for each cell line. When
pF0003 copy number is taken into account for the expression data in
Table 3-2, the expression/copy ratio for all of the cell lines is
lowered and the average expression/copy is 0.094 ± 0.091. It is
apparent from the data in Table 3-2 that as copy number increases, the
expression/copy increases until approximately 20-40 copies are present,
after which it declines. The pF0003M15 cell line is perhaps lower than

91
expected with respect to expression because of an unusual or
deleterious integration site. The threshold of expression at 20-40
copies indicated that a limited number of human histone genes could be
integrated and expressed in any one cell. This phenomenon has been
investigated further and is discussed later in light of genomic
sequencing data presented in Chapter 4. Overall the pF0003 monoclonal
cell lines had higher expression levels than other cell lines (compare
*v
expression values with others in Table 3-2) , but the expression/copy
was similar. Since copy number was implicated in the level of
expression, we also calculated the average copy number of each group of
monoclonal cell lines and this is presented in Table 3-2. The level of
expression, as we have determined it here (Table 3-2), is a direct
reflection of the copy number.
The results of the SI analysis of the pF0108A and pF0002 monoclonal
cell lines are presented in Figure 3-9. Both cell lines expressed at a
relatively low level and the numerical data are presented in Table 3-2.
The average level of expression/copy for pF0108A is .079 ± .061 and for
pF0002 is 0.045 ± 0.053. The data collected for the pF0108A monoclones
were previously divided into two groups. Originally, there was a
construct, designated J40, that after sequencing of the deletion points
was found to be identical to pF0108A. Therefore, these data were
incorporated into the 108A data base. It is interesting to note that
pF0108A and J40 were thought to have different lengths of 5' sequence
and yet their expression was shown to be almost identical. This
separation of the original observations lends a measure of confidence
to the analysis process that has been used in these studies.

92
t 005
HCMM356789 101112131416 171819 20
0
Figure 3-11 SI nuclease analysis of pF0005 monoclonal cell lines.
Twenty five micrograms of total cellular RNA from each of the cell
lines were treated as described in Materials and Methods and the
autoradiograph of the SI nuclease analysis was quantitated by
densitometry. Lanes are designated with the clone number of the cell
line. HeLa cell total RNA hybridized to both human and mouse probes, H.
C127 RNA hybridized to both human and mouse probes, C. pBR322 Hpall
markers labelled with a-^^P-dCTP and Klenow fragment, M. One fourth the
amount of marker was electrophoresed for quantitation purposes, Ml:4.
The construct name, pF0005, is displayed above the black line. Both
human and mouse (280 nt and 110 nt respectively) protected fragments
are noted at the right.

Figure 3-12
Copy number analysis of pF0005 monoclonal cell lines.
Southern blot analysis was done as described in Materials and Methods.
All abbreviations are as designated in Figure3-10. The quantitation of
the histone H4 blot (A) and the mouse 18S ribosomal probed blot (B) are
as before in Fig 3-10 and Materials and Methods.

94
B.
005
M 3 5 6 7 11131416171819 C H M
z

95
The expression data for pF0002 monoclones 9 and 10 were determined
(Table 3-2); however, when the copy number was determined there was no
correct band at 1070 bp or any additional bands that corresponded to
the EcoRl/Xbal fragment (data not shown). The copy number of the
pF0002 and pF0108A cell lines (Figures 3-10a,b) was determined as
described for pF0003 and in Materials and Methods. With respect to
pF0002m9 and 10, we assume that either the construct was lost in the
time between the harvesting of cells for the purification of RNA and
subsequently DNA, or that the integration event destroyed one of the
restriction sites making detection impossible. This was the only case
where expression of the human H4 histone gene was detected but no
copies were detectable. Due to the constraints of the tissue culture
system we usually prepared several plates of cells for the isolation of
RNA, and then 1 or 2 passages later was able to harvest cells for
isolation of DNA. The lanes of the pF0002 Southern blot exhibited no
other bands that might have corresponded to the integrated pF0002
construct.
SI nuclease analysis and copy number determination were also done
for the pF0005 monoclonal cell lines and the results are presented in
Figures 3-11, and 3-12a,b. pF0005 exhibited the most consistency in
the level of expression (0.546 ± 0.354) and nearly every monoclonal
line was positive for expression of the human H4 gene. The
expression/copy ratio was 0.201 ± 0.140.
The shortest deletion construct for which monoclonal cell lines
were made was K8, an original Bal31 deletion (Sierra et al., 1983).
The expression from all six monoclones measurable was relatively low

96
Figure 3-13 SI nuclease analysis of K8 monoclonal cell lines.
Si nuclease assays were done as described in Materials and Methods. The
clone number of each cell line is denoted above the lane. M, pBR322
digested with Hpall and labelled with Klenow. H, HeLa total cellular
RNA. C, C127 total cellular RNA. Dilutions of the marker are specified
1:4 and 1:8. Human and mouse H4 protected fragments are specified.

Figure 3-14 Copy number analysis of K8 monoclonal cell lines.
Southern blot analysis was performed as described in Materials and
Methods. The K8 EcoRI/Xbal fragment is shorter due to the Bal 31
deletion and is designated with an arrow at the left. The same controls
as in Figure 3-10 have been included. Quantitation of A (histone H4
probe) and B (reprobed with mouse 18S ribosomal) was as described in
Figure 3-10 and Materials and Methods. Nonessential lanes in B have
been deleted.

98
B.

99
(Table 3-2. Expression = 0.114 ± 0.066, Expression/Copy number = 0.075
± 0.077). In addition, there were several K8 monoclones, including
K8ml2, 19, and 20, in which there was an SI nuclease protected
fragment present by visual inspection, but the level was below that
detectable with the densitometer. The Si nuclease protection assay and
Southern blot analysis are presented in Figure 3-13 and 3-14a,b.
These results were in agreement with the previous polyclonal cell line
results that we had obtained that suggested that an increase in the
length of the H4 promoter resulted in increased expression.
We were also concerned that differences in the 3' end of some of
our constructs might affect the level of expression. The differences
in the 3' ends of the constructs were not intentional, but arose as a
result of the cloning strategies employed to produce the 5' deletions.
To address this question we prepared the construct pF0108X (see
Appendix C). This construct has -210 bp of 5' flanking sequence, but
the Xbal/Hindlll fragment at the 3' end has been deleted from pF0108A.
Also, this construct was made in pUCl9. This 3' deletion effectively
removes 770 bp from the 3' flanking region of the pF0108A H4 gene.
Monoclonal cell lines of pF0108X were prepared and assayed for
expression and copy number as before. The results of the analysis are
presented in Figures 3-15 and 3-16a,b and the expression levels are
calculated in Table 3-2. The expression of pF0108X was not
significantly different than that of pF0108A ; these results suggest
that the nucleotides from the Xbal (+1107 bp ) site to the Hindlll
(+1877 bp) site, removed from the 3' end in pF0108X, had little if any
effect on the level of transcription. The construct pF0006 was also

100
006 108X
—Mouse
Figure 3-15 SI nuclease analysis of pF0006 and pFOl08X monoclonal
cell lines.
SI analysis of pF0006m3,4,6,8,11 and pF0108Xm2,3,5,6,9 are presented.
25/zg of total cellular RNA from log phase cells was mixed with an
excess of human and mouse H4 histone probes and SI nuclease reactions
electrophoresis, and densitometry were done as described in Materials
and Methods. The human and mouse signals (280 nt and 110 nt
respectively) are noted on the right. The markers, M, and pBR322
digested with Hpall and labelled with Klenow fragment and Q-3^P-dCTP.
The number above the lane designates the clone number, and the black
line defines the construct.

Figure 3-16 Copy number analysis of pF0006 and pF0108X monoclonal
cell lines.
Southern blot analysis was done as described in Materials and Methods
Quantitation of A and B (A, probed with human H4 histone; B, probed
with mouse 18S ribosomal gene) was as described before in Figure 3-10
All designations are as described earlier in Figure 3-10.

102
A.
006 108X 5 J
— ' *■ 34 2356901
21.2
5.1
It
i
j
2.0
1.4
0.9
B.
006 _J08)^_
3423569C
I
m i.3
18S M M M

103
Table 3-2
. Quantitation of
Monoclonal Cell Line
Exprés
sion
CLONEa
EXPb
CNc
EXP/CNd
CLONE
EXP
CN EXP/CN
K8ml3
.091
1
.091
002m9
.036
ND
K8ml7
.180
1
.180
002ml0
.135
ND
K8ml4
.170
1
.170
002m2
.135
1
.135
K8ml8
.030
5
.006
002m3
.175
7
.025
K8m8
.032
13
.002
002m8
.179
14
.013
K8m9
.180
28
.002
002m7
.084
16
.005
AVGe
.114
8
.075
AVG
.124
10
.045
STDf
.066
.077
STD
.050
.053
108Am7
.123
1
.123
003ml7
.100
4
.025
108Aml
.013
1
.013
003ml3
.300
8
.038
108Am5
.056
1
.056
003m4
1.800
10
.180
108Am9
.210
1
.210
003m5
.500
13
.038
108Aml0
.110
1
.110
003ml4
1.770
21
.084
108Aml2
.143
4
.036
003ml6
6.780
23
.291
108Am8
.410
4
.103
003m2
6.500
41
.159
108Am2
.940
19
.049
003ml5
.400
44
.009
108Aml4
.240
30
.008
003ml
2.500
139
.018
AVG
.249
7
.079
AVG
2.286
34
.094
STD
.268
.061
STD
2.433
.091
005ml4
.450
1
.450
007ml
.234
ND
005ml6
.310
1
.310
007m2
.208
ND
005m7
.120
1
.120
007m4
.142
ND
005mll
.380
2
.190
007m8
.034
ND
005m6
.160
2
.080
007m9
.135
ND
005m3
.780
2
.390
007ml0
.123
ND
005ml3
.970
3
.323
007ml2
.957
ND
005ml8
.810
5
.162
005ml7
.430
5
.086
AVG
.261
005ml9
.630
22
.029
STD
.313
005m5
1.280
31
.041
AVG
.546
6
.201
STD
.354
.140

104
Table 3-2 continued
CLONE
EXP
CN
EXP/CN
108Xm2
.086
1
.086
108Xm3
.021
1
.021
108Xm9
.021
1
.021
108Xm5
.226
2
.113
108Xm6
.208
30
.006
AVG
.112
7
.049
STD
.089
.042
006m3
5.050
30
.168
006m6
.013
ND
006m8
.158
ND
006mll
.102
ND
AVG§
.091
CLONE
EXP
CN
EXP/CN
004m6
.075
1
.075
004ml4
.250
1
.250
004m2
.050
11
.005
004m8
2.38
38
.063
004mll
.125
90
.001
004ml0
.175
154
.001
004ml9
5.4
188
.029
004ml
1.27
252
.005
AVG
1.22
- 92
.054
STD
1.76
.079
004Rm3
.020
ND
004Rm4
.040
ND
004Rm7
.110
ND
004Rm9
.045
ND
004Rml0
.040
ND
AVG
.057
STD
.031
Autoradiograms were scanned with a laser densitometer as described in
Chapter 2 and the level of expression has been determined and
presented here as a ratio of the human and mouse SI signals.
a. The construct used to make the cell line and the clone number that
designates that cell line.
b. Expression (EXP): a ratio of the human and mouse SI protected
fragments as determined by densitometry. Further description of the
calculation and densitometry procedures are given in the Materials
and Methods section.
c. The copy number (CN) of the cell line as determined by Southern
blot analysis.
d. Expression divided by the copy number of the cell line (EXP/CN).
The number represents the level of expression per copy of the
construct integrated.
e. AVG, the average of either EXP or EXP/CN.
f. STD, the standard deviation of the average value. •
g. The data from 006m3 were not included in the average calculation.

105
assayed with the pF0108X, but will be discussed later in the chapter
with respect to a putative enhancer element.
The data collected in Table 3-2 were arranged and the constructs
placed into a rank order in comparison with one another. This is
graphically presented in Figure 3-17. Both the average level of
expression and expression/copy are presented with the standard
deviation of each calculation. The first observation is that as the
amount of 5' sequence is extended out to -410 bp in construct pF0005
the level of expression increases approximately 3 fold above that of
pF0108A. There are significant differences between expression and
expression/copy. This is most easily seen when copy number is included
in the expression value for pF0003. There is obviously a large
standard deviation in these results and this is probably a reflection
of the inaccuracies inherent in the system available.
There are statistical differences in spite of the high variability
encountered in this assay system. To analyze the data statistically we
employed the services of the University of Florida Biostatistics Unit
and Dr. Mike Conlon. It was decided that the most powerful statistical
test that could be employed on these data was the Wilcoxon Rank Sum
test. This test and the analyses have been described in the Materials
and Methods section of this work.
Previously we demonstrated that the K8 monoclones (-155 bp) and the
pF0108A monoclones (-215 bp) were not significantly different; these
results suggested that there was little contribution from the sequence
between -155 bp and -215 bp to the level of transcription. When the
data for the pF0005 monoclones were compared to the K8 monoclones, the

Relative Expression
106
H4 Deletion Constructs
Average Expression and Expression/Copy number
Figure 3-17 Graphic analysis of human H4 histone gene expression in
mouse C127 cells.
The average expression for each group of monoclones is plotted. The
average expression (EXP) and expression/copy (EXP/CN) were calculated
in Table 2 and are plotted here with the standard deviation for each
average value shown as a one-way error bar.

107
difference in the average expression/copy (pF0005 = 0.201 versus K8 =
0.075) was significant at p < 0.05. This suggested the existence of a
positive regulatory element in the sequences from -215 bp to -417 bp.
Previous polyclonal cell line analysis had demonstrated a
difference between pF0005 and the shorter deletions however the number
of samples was small and precluded any statistical analysis. Since
copy number had been demonstrated to be an important variable, we
compared the pF0108A and pF0005 monoclonal cell lines with copy numbers
less than 10 in the Wilcoxon Rank Sum test, and found that in this
group of data, pFO005 was significantly (p < 0.05) higher in expression
than pF0108A. If the entire data base was utilized, then the two
constructs were not significantly different (p < 0.1). This was
presumably the result of several high copy number cell lines that
skewed the group. The data were consistent with the idea that a gradual
increase in the 5' flanking sequences contributes to an increase in the
level of human H4 histone gene expression. The data also suggested
that there might be a positive regulatory element between -210 bp
(pF0108A) and -410 bp (pF0005) although it was not clearly definable.
Protein/DNA interactions in this region of the promoter were
detected in vitro by van Wijnen et al. (1987), unfortunately these
studies were not pursued. In vivo, there were no detectable
protein/DNA interactions in the -210 bp to -410 bp region (Pauli et
al., 1987) of the promoter. We have done preliminary investigation
into the putative positive element and our studies are detailed below.
In addition, the data presented in Table 3-2 were reevaluated with
respect to the effect of copy number on expression; the low copy

108
number data, which were most representative of the results and least
affected by the competition phenomenon mentioned earlier, are
discussed and analyzed in chapter 5.
Distal Transcriptional Regulatory Elements
Inspection of the data in Table 3-2 and graphically presented in
Figure 3-17 demonstrates two points. First, as the length of the H4
promoter sequence increases to -410 bp the average level of expression
rises. The difference in expression between the monoclonal cell lines
of pF0108A and pF0005 is statistically significant (p < 0.05). The
second point is that the expression of pFO002 is significantly lower
than pF0005. This result is based on the comparison of only 4 of the
6 monoclonal cell lines which were positive for expression.
Unfortunately, two of the pF0002 monoclones (pF0002m9 and pF0002mlO)
had no detectable EcoRI/Xbal fragment in the copy number experiment.
We should note that if one assumes that these cell lines had-only 1
copy of the H4 gene integrated and incorporates all 6 monoclonal cell
lines into the data base, the difference in expression between pF0005
and pF0002 is still statistically significant. The fact that pF0002
(-1065 bp) was lower in expression than pF0005 (-417 bp) suggested that
there might be a negative regulatory element in the more distal
sequences of the H4 promoter.
The objective of the next experiments was to determine if there
was a negative regulatory element located between -410 and -1065 bp in
the human H4 histone gene promoter. There were several other lines of
evidence that suggested that sequences upstream of -410 bp might
influence the expression of this gene in a negative fashion. When we

Figure 3-18
Strategy utilized to determine the sequence of the
BamHI (-1065 bp)/EcoRI (-610) fragment upstream of the
F0108 H4 histone gene.
The pertinent restriction enzyme sites are designated. The arrows
indicate that the DNA was restricted at the origin of the arrow and
sequenced from that point in the direction of the arrow as described in
Materials and Methods.

(-1065)
(-610)
BamHI
Bañil
Hindlll EcoRI
I
1
1 1
o

Figure 3-19 Annotated sequence of the pF0002 5' flanking sequence.
Both strands of the sequence are shown from +70 bp to -1010 bp.
Construct deletion points are denoted with an asterisk over the last
base in the clone and the clone name. A number of homologies to various
elements have been designated. The proximal 210 bp have the ATG, TATA,
CAAT, and GGTCC elements underlined. Also Site I and Site II are
bolded. From -720 to -820 bp a DNasel hypersensitive site is denoted
with a string of asterisks above the sequence. Putative nuclear matrix
attachment sites, underlined, are located at -680 bp and -940 bp
(bases that do not match the consensus sequence are bolded). A putative
topoisomerse II site is found at -881 bp to -895 bp and has been
confirmed by Dr. T. Rowe (personal communication). Nuclear matrix
associated T-boxes are underlined at -925 and -885 bp. Two putative
negative regulatory elements are underlined at -580 and -710 bp.

*002 (-55bp)
GCAGAATATCCCTCAGTCTTCTCTATGTAGCAGGCCCTCCATATACGCGGGTTCCCCAAG
-1000 ....
CGTCTTATAGGGAGTCAGAAGAGATACATCGTCCGGGAGGTATATGCGCCCAAGGGGTTC
*002D1
ACCGAAAATATTAAACAAATGAATTTCTTTTTTAAAAAAAAGTACAACAAAAGATAGTAA
-950 .... -900
TGGCTTTTATAATTTGTTTACTTAAAGAAAAAATTTTTTTTCATGTTGTTTTCTATCATT
aaataaaaacagtataacaattacttacatagctttacacactggattggtgttcgaagt
-850
TTTATTTTTGTCATATTGTTAATGAATGTATCGAAATGTGTGACCTAACCACAAGCTTCA
AATTTGAGCTTATTTAAAGTACACGGGAGGATGTGCATAGTTATGTGCAAATACTACCCC
-800
TTAAACTCGAATAAATTTCATGTGCCCTCCTACACGTATCAATACACGTTTATGATGGGG
*002E9
ick'k'k'fcfck'kick'k'tck'fck'k'k'k'k'k'k'k'k'k'k'k'k'i'e'k'k'k'k'k'k'k'jcit'k'k'kic&'fc'k'k'k&'k'k'k'k'k
ACTTTCTATGAGAGACTTGAGCAACCTGATTTTGGTATCGGCGGGGGCCCTGACCAATCC
-750
TGAAAGATACTCTCTGAACTCGTTGGACTAAAACCATAGCCGCCCCCGGGACTGGTTAGG
CCTCTCAGTTCTACCGAGGGAGAACTGTTTTGTTTCTTCCGCACGGCTTTGACCGACAGT
-700 ....
GGAGAGTCAAGATGGCTCCCTCTTGACAAAACAAAGAAGGCGTGCCGAAACTGGCTGTCA
GTGTTGGGATTCGCTGGACCATGAGAAAGCTTGGCAGCATGCTGTGACCGGTTTTCCCAG
-650 .... -600
CACAACCCTAAGCGACCTGGTACTCTTTCGAACCGTCGTACGACACTGGCCAAAAGGGTC
*007
GGCCAGAATTCTCCTGTGTGAGCTAAAATACAGTGGCTCGGTCCAACAAAACAGAGCCTG
-550
CCGGTCTTAAGAGGACACACTCGATTTTATGTCACCGAGCCAGGTTGTTTTGTCTCGGAC
GAGCCAGGAATTATGGCGAACCTGCTCCCTCCGTCCTCCTTCGGCGAAGATCCCTGGCGC
-500
CTCGGTCCTTAATACCGCTTGGACGAGGGAGGCAGGAGGAAGCCGCTTCTAGGGACCGCG
*005
GCGTCCTTGAGGTCGCCTTCGGTGTTGACCTCATCGTCGGAACGGCGCTTCCTGAAGCTT
-450
CGCAGGAACTCCAGCGGAAGCCACAACTGGAGTAGCAGCCTTGCCGCGAAGGACTTCGAA

TATATAAGCACGGCTCTGAATCCGCTCGTCGGATTAAATCCTGCGCTGGCGTCCTGCCAG
-400 ....
ATATATTCGTGCCGAGACTTAGGCGAGCAGCCTAATTTAGGACGCGACCGCAGGACGGTC
TCTCTCGCTCCATTTGCTCTTCCTGAGGCTCCCTCCAGAGACCTTTCCCTTAGCCTCAGT
-350 .... .300
AGAGAGCGAGGTAAACGAGAAGGACTCCGAGGGAGGTCTCTGGAAAGGGAATCGGAGTCA
GCGAATGCTTCCGGGCGTCCTCAGAACCAGAGCACAGCCAAAGCCACTACAGAATCCGGA
-250
CGCTTACGAAGGCCCGCAGGAGTCTTGGTCTCGTGTCGGTTTCGGTGATGTCTTAGGCCT
*108A *L14
AGCCCGGTTGGGATCTGAATTCTCCCGGGGACCGTTGCGTAGGCGTTAAAAAAAAAAAAG
-200
TCGGGCCAACCCTAGACTTAAGAGGGCCCCTGGCAACGCATCCGCAATTTTTTTTTTTTC
*K8
AGTGAGAGGGACCTGAGCAGAGTGGAGGAGGAGGGAGAGGAAAACAGAAAAGAAATGACG
-150
TCACTCTCCCTGGACTCGTCTCACCTCCTCCTCCCTCTCCTTTTGTCTTTTCTTTACTGC
*J50 *J56
AAATGTCGAGAGGGCGGGGACAATTGAGAACGCTTCCCGCCGGCGCGCTTTCGGTTTTCA
-100
TTTACAGCTCTCCCGCCCCTGTTAACTCTTGCGAAGGGCGGCCGCGCGAAAGCCAAAAGT
*J67
ATCTGGTCCGATACTCTTGTATATCAGGGGAAGACGGTGCTCGCCTTGACAGAAGCTGTC
-50 • • +1
TAGACCAGGCTATGAGAACATATAGTCCCCTTCTGCCACGAGCGGAACTGTCTTCGACAG
TATCGGGCTCCAGCGGTCATGTCCGGCAGAGGAAAGGGCGGAAAAGGCTTAGGCAAAGGG
+50
ATAGCCCGAGGTCGCCAGTACAGGCCGTCTCCTTTCCCGCCTTTTCCGAATCCGTTTCCC
Figure 3-19 continued

114
tried to make cell lines with the construct pFOOOl (an internal
deletion from -210 to -610 bp, see Figure 3-1), we found very few cell
lines that expressed the transfected human H4 gene. Only 1 of 10
polyclonal lines and 2 of 12 monoclonal lines were positive for
expression, and these were barely detectable (data not shown). This
result supported the idea that there was a positive regulatory element
in the region between -210 and -417 bp and, since the expression was
very low perhaps a negative element upstream of -586 bp. In addition,
polyclonal lines of pF0002 appeared to have lower expression than
polyclonal lines of pF0005 (data not shown).
To address the possibility of a negative regulatory element we
first decided to sequence the region of the promoter from -610 bp to
-1065 bp. pF0002 DNA was digested with either BamHI, EcoRI, or
Hindlll, treated with phosphatase and labelled as described in
Materials and Methods and the protocol of Maxam and Gilbert (1980).
Figure 3-18 schematically displays the strategy utilized to determine
the sequence of the upstream region. The sequence has several unusual
characteristics and is presented as part of the entire pF0002 sequence
in Figure 3-19. The distal end of the fragment, from -800 bp to -960
bp is very A/T rich (70%) with several homopolymeric runs of each. In
addition a search of the region revealed two sequences with strong
similarity to nuclear matrix attachment sites (-940 bp and -680 bp) and
associated T-boxes (-925 bp and -890 bp, bottom strand)(Gasser and
Laemmli, 1987). Near the upstream matrix site a putative
topoisomerase site (-890 bp) was identified. The presence of this
topoisomerase site has been confirmed in vitro by Dr.-Tom Rowe

115
(personal communication). Additionally, Dr. Susan Chrysogelos of our
laboratory demonstrated the presence of a DNAsel hypersensitive site
(-720 to -820 bp) between the two putative nuclear matrix attachment
sites (personal communication). This arrangement of chromatin
structure, nuclear matrix sites flanking a nuclease hypersensitive
site, is very similar to that demonstrated previously by Gasser and
Laemmli (1986) and was at least circumstantial evidence that this
region might be involved in attachment to the nuclear matrix.
We compared the entire 5' flanking sequence of the F0108 H4
histone gene (-1 to -1065 bp) with the consensus sequences for several
groups of negative regulatory elements as described by Baniahmad et
al. (1987). They compared the promoter sequences of a number of genes
subject to negative regulation and determined two consensus elements.
These elements were termed Box 1 (5'-ANCCTCTCC-3') and Box 2 (5'-
ANTCTCCTCC-3'). Good homologies to both elements were found in the H4
histone upstream region at -710 bp (Box 1) and -580 bp (Box 2) as
designated in Figure 3-19. Dr. Susan Chrysogelos, of our laboratory,
demonstrated that the region of the H4 promoter from -585 to -1065 bp
has middle repetitive character (personal communication). As mentioned
in the introduction Laimins et al. (1986) associated middle repetitive
character with some negative regulatory elements (chicken lysozyme gene
and rat insulin like growth gene).
To investigate whether there was any functionality associated with
the two putative negative regulatory elements that were implicated via
similarity to previously identified negative elements we constructed
two deletion mutants of pF0002 in the 460 bp BamHI/EcoRI fragment

Figure 3-20 Deletions for investigation of putative negative
regulatory element in upstream region of H4 promoter.
Two deletions of pF0002 were made by standard cloning procedures as
outlined in Materials and Methods and cloned into pUCl9. The construct
pF0002Dl is a Dral/PstI fragment that deletes 130 nucleotides from the
5' end of pF0002 in the region of interest. pF0002E9 is an Eco0109/Xbal
fragment that deletes 315 nucleotides. The restriction enzyme sites are
denoted as BamHI, B; Dral, D; Eco0109, E9; EcoRl, E; Hindi, He; Xbal, X
and PstI, P. The direction of transcription is specified with the arrow

pF0002
H E
ii ac^aact .L
pF0002
B D E9 E H E
pF0002D1
D EME
pF0002E9
E9 E H E
X
.1
He
X
JL
p
m
J
x
d
117

118
(Figure 3-20). The first deletion, pF0002Dl, was made by digestion of
pF0002 with PstI and then a partial digestion with Dral. The Dral/PstI .
(2.16 kb) fragment was isolated and cloned into the Smal site in pUC19.
Before ligation the DNA was treated with Klenow fragment to blunt the
ends of the insert molecule. This construct effectively deletes 145 bp
of the 5' sequence from -1065 to -920 bp. The second deletion,
pF0002E9, was prepared in a similar manner except the initial digestion
was with Xbal. The partial digestion was (after the blunt end reaction
with Klenow) with Eco0109. The 1630 bp Eco0109/Pstl fragment was
purified and the fragment was ligated to pUC19 digested with Smal under
blunt end conditions as described in Materials and Methods. pF0002E9
(-730) deletes 335 bp from the 5' end of pF0002. Just prior to the
construction of pF0002Dl and E9 we made the construct pF0007 by an
EcoRI partial digestion of pF0003 linearized with PstI. The 1.84 kb
Pstl/EcoRI fragment was cloned into pUC19 (Figure 3-1). This construct
was made to assess the contribution of the 200 bp between -410 (pF0005)
and -610. It was decided that instead of making stable cell lines,
which had been a confusing endeavor up to this point, we would
transiently transfect C127 cells with these constructs to assess any
possible negative regulatory effects. The transfections of pF0002,
pF0002Dl, pF0002E9, pF0007, pF0005, pF0108A, and pFOOOl were done
according to the protocol described in Materials and Methods. Two of
the SI nuclease assays performed on RNA isolated from the transfected
cells are presented in Figure 3-21. Both C127 cells and Ltk" cells
were utilized in this series of experiments. The data from the series
of transfections, 6 in total, are presented in Table -3-3. There was

Figure 3-21 SI nuclease analysis of transiently transfected C127
and Ltk' cells: Determination of putative negative
regulatory element position in distal promoter sequence
of the F0108 H4 histone gene.
SI nuclease analysis was performed on total cellular RNA of both C127
and Ltk" after transfection with 10 /¿g of each histone deletion
construct as described in Materials and Methods. 50 /jg of total
cellular RNA was used for each hybridization reaction. The results of
two transfections are presented. The human (280 nt) and mouse (110 nt)
protected fragments are designated at the right. Markers (M), pBR322
digested with Hpall, labelled with a-^^P-dCTP and Klenow fragment, and
pertinent sizes are shown. Densitometry of the human and mouse signals
from autoradiograms permitted the quantitation of expression from each
construct. The clones transfected into either C127 cells (left panel)
or Ltk' cells (right panel) are specified above each lane. These two
autoradiograms are representative of the 6 experiments that were
performed. An analysis of the data is presented in Table 3 and Figure
3-22.

to
u
o>
â– u
o
ro
o
ro
(O
ro
001
002
002D1
002E9
007
005
108A
M
HeLa
C127
Ltk-
001
002
002D
002E
007
005
108A
M
HeLa
t
Z
o
t
X
e
I
3
ro
o
C127

121
Table 3-3 Summary of Transient Expression Data.
Experiment
1
2
3
4
5
6
Cell Type
C127
Ltk'
Ltk"
C127
Ltk"
C127
Construct
Avg
+
SD
pF0002
56
57
66
54
26
54
52.1
+
13.5
pF0002Dl
12
25
19
53
34
48
31.8
+
16.2
pF0002E9
100
100
100
100
100
100
100.0
pF0007
68
34
14
42
56
42.8
+
20.7
pF0005
9
72
42
49
23
52
41.1
+
22.3
pFOOOl
ND
0.5
1
0.5
ND
ND
0.66
+
0.3
pF0108A
ND
2
4
2
ND
ND
2.6
+
1.1
Each construct was transfected into both C127 or Ltk" cells and
analyzed by densitometry of the autoradiograms. The amount of
transcription is expressed in percent of pF0002E9 expression since it
was consistently the highest expressed construct. The individual values
for each experiment are listed and the average expression (Avg) for the
construct + the standard deviation (SD) is listed at the right. Only 5
transfections of pF0007 were done; therefore there is no value for
experiment #5. ND, not determined. Densitometry was only done on three
of the experiments in which pFOOOl and pF0108A were included.

122
Average of 6 Transient Assays
c
o
'w
V)
CD
i_
Q_
X
o
cn
LJ
CM
o
o
o
as
002 002D1 002E9 007 005
Figure 3-22 Compilation analysis of 6 transient assays with histone
H4 deletion constructs: analysis of putative negative
regulatory element.
The data from all six transient transfection experiments was averaged
for each construct and plotted with standard deviation bars. The data,
as in Table 3-3, are calculated as the percent of pFO002E9 expression.
pF0002, pF0002Dl, pF0002E9, pF0007, and pF0005 are included.

123
variability from experiment to experiment and the average of 6
experiments is plotted graphically in Figure 3-22. Plasmid DNAs were
examined on agarose gels to determine the percent of Form I and to
ensure that the quantitation was accurate. In both Table 3-3 and
Figure 3-22 the values for pF0002, pF0002Dl, pF0007 and pF0005 are
expressed as the percentage of pF0002E9, which was consistently highest
throughout the 6 experiments. The data for pFOOOl and pF0108A were not
included in Figure 3-22 as they were considerably lower than any of the
other constructs; however the data are presented in Table 3-3.
Our first observation was that the level of pF0005 expression was
very similar to that of pF0002 in apparent contrast to the data from
the stable cell lines (Table 3-2) where pF0005 (-417 bp) had a 3 fold
higher level of expression than pF0002 (-1065 bp). The most likely
explanation for this appears to relate to differences between
expression from stably integrated and episomal DNA molecules. This
difference in the state of the DNA may also have affected the level of
expression from pFOOOl and pFOlOSA (discussed below). The original
hypothesis was that the consensus negative regulatory sequences
described earlier, Box 1 and Box 2 (Baniahmad et al., 1987), were
responsible for the decrease in expression of the pF0002 construct.
Our results demonstrated that both of the consensus negative regulatory
elements (Box 1, -710 bp and Box 2, -580 bp) were located in the
sequences included in the construct pF0002E9 and it was the most highly
expressed construct of the group. This result disproves the idea that
the decrease in expression is due to the proposed negative regulatory
sequences. However, when additional sequences are added in pF0002Dl

124
Figure 3-23 SI nuclease analysis: Comparison of pF0007 and pF0005
monoclonal cell lines.
Analysis of total cellular RNA from each cell line was as described in
Materials and Methods. Lanes are labelled as in previous SI analysis
figures: M, pBR322 Hpall marker; pF0007 and pF0005 monoclonal cell line
numbers are denoted above the lane; H, HeLa RNA; C, C127 RNA. Both
human and mouse SI nuclease protected fragments are denoted to the
right.

125
and pF0002 the expression is lower. If there is a negative element,
and this evidence is again only suggestive for one, it probably lies in
the sequences between the Dral site (-920) and the Eco0109 site (-730).
Interestingly both the topoisomerase II site (-890 bp) and the DNasel
hypersensitive site (-720 to -820 bp) are included in this region of
the promoter.
In addition, we can state that the sequences included in the
construct pF0007 (-410 to -610 bp) do not contribute to the level of
expression. In the transient assays the expression from pF0005 and
pF0007 was nearly identical (Figure 3-22 and Table 3-3). The pF0007
construct was also transfected into C127 cells and monoclonal cell
lines prepared. We compared the level of expression of the two
constructs and found no significant difference. The SI nuclease
analysis is presented in Figure 3-23 and the expression data were
calculated as before and displayed in Table 3-2.
The construct pF0002E9 was consistently expressed at a higher level
than any of the other constructs. An examination of the additional
sequence included in the construct pF0002E9 revealed a putative CCAAT
box (-700 bp) which matches the consensus sequence identically.
Perhaps this element is responsible for the 2 fold increase in the
level of expression. How the CCAAT box, normally a proximal promoter
element, might function in this particular position is unknown; however
there is precedence for the action of distal regulatory elements
through bending of the DNA molecule (Ptashne, 1986). The results we
have presented here are preliminary, but similar results have been
shown by Ken Wright of our laboratory with in vitro transcription of

126
the same deletion constructs from circular templates in nuclear
extracts (personal communication).
In the stable cell lines, the expression of a particular construct
was apparently determined by the histone 5' sequences and the number of
copies integrated. In the transient assays, there was a depression in
expression of pFOOOl and pF0108A (Table 3-3) as compared to pF0005.
This was consistent with the results of the stable cell lines, however
the effect was more dramatic in the episomal system. pFOOOl expression
was low and usually imperceptible in stable cell lines, and consistent
with this result was expressed only at a low level in the transient
transfections. Even with the additional 5' sequence that pFOOOl
includes the internal deletion of the EcoRI (-210)/EcoRI (-610)
fragment again suggested that there was a positive element in the 200
bp between -210 and -410 nt. An alternative explanation for these
results however is possible. pFOOOl and pF0108A are different from the
other deletion constructs in that they are both pBR322 clones whereas
the others are all derivatives of pUC plasmids. Perhaps this
difference in the length and composition of the vector was more
dramatically accentuated in the transient assay system. In stable cell
lines, a comparison of the 3' deletions pF0108A and pF0108X revealed no
significant differences (p < 0.1) in the level of expression (Table 3-
2). If anything, pF0108X was slightly lower in expression and is a
pUC19 clone. Perhaps the functionality of these upstream elements
relies on a particular chromatin structure of the region which is only
obtained when the constructs are integrated.

Figure 3-24 Schematic diagram for the production of unidirectional
deletions with Exonuclease III and Mung Bean Nuclease.
The original construct pF0005B5 was made by insertion of the pF0005
insert into the PstI and Hindlll sites of Bluescript M13+. This
construct was digested with Apal which produces a 3' overhang and
Hindlll, a 5' overhang as shown. Next 30 units of Exonuclease III were
added and aliquots removed every minute for 5 minutes. The DNA aliquots
were diluted in Mung Bean nuclease buffer and 9 units of Mung bean
nuclease was added. The DNA was then ligated under blunt end conditions
and transfected into competent DH5 cells. The complete protocol is
detailed in Materials and Methods. The resulting products of this
reaction are unidirectional deletions, because Exonuclease III is
unable to digest a 3'single strand overhang (Apal). Restriction enzyme
sites are designated as PstI, P; EcoRI, E; Hindlll, H; Apal, A; and
Kpnl, K.

128
Exo III
Mung Bean

129
Distal-proximal positive element
Our results indicated that the sequences from -210 to -410 bp might
enhance the level of H4 gene expression. To address this question
deletion mutants of pF0005 were prepared. The pF0005 insert was
subcloned into the Bluescript M13+ vector and deletions with
Exonuclease III were prepared as described in Materials and Methods.
The procedure is schematically displayed in Figure 3-24. Ideally, the
protocol should have produced unidirectional deletions from the Hindlll
site at -410 bp toward the EcoRI site at -210 bp. This method relied
on the inability of Exonuclease III to digest a 3' overhang (Apal).
However the protocol worked very poorly, and only 2 deletions were
obtained in the region of interest (-210 to -410 nt). These were
denoted pF0005BSdel2-6 (-285 bp) and pF0005BSdel2-10 (-335 bp).
Monoclonal cell lines of pF0005BS, pF0005BSdel2-10 (2-10), and
pF0005BSdel2-6 (2-6) were prepared and assayed by SI nuclease analysis.
Four of 12 monoclones were positive for pFOOOSBS. Five of 12 and 1 of
12 were positive for 2-10 and 2-6 respectively. The SI analysis of
these cell lines (Figure 3-25) was repeated 2 times and the average
expression from both pF0005BS and 2-10 was identical (1.5 ± 1.4). This
value represents only the absolute amount of the human SI protected
fragment, as measured by the densitometer, averaged for each
construct. Since only a single monoclone was positive for 2-6 it was
not included in the analysis. The mouse H4 SI protected fragment
presented an unusual pattern even upon repetition and was not included
in the analysis. The control SI nuclease analysis of C127 RNA worked
well (Figure 3-25) but the sample C127 protected bands were always

130
in
E
ID
«#••••§§••,*f
:.... :• .: st
* 9
â– A
Figure 3-25 SI analysis of pF0005BS and Exonuclease III deletions.
SI nuclease assays were done as described in Materials and Methods. The
clone number of each cell line is denoted above the lane. M, pBR322
digested with Hpall and labelled with a-^P-dCTP and Klenow fragment.
H, HeLa total cellular RNA. C, C127 total cellular RNA. The human (280
nt) and mouse (110 nt) SI nuclease protected fragments are denoted at
the left.

131
lower or not detectable even when the human H4 protected fragment was
easily seen. We have noticed this occasionally, but never in so many
samples at once. Occasionally, high copy number cell lines or the HeLa
total cellular RNA control have exhibited a similar pattern of
hybridization, but there has been no consistency.
The results of transient assays of pF0005BS, 2-10, and 2-6 were
inconsistent due to quantitation problems with the plasmid DNAs that
were not discovered until after the completion of the analysis. Even
with these problems the results of the transient assays supported the
idea that pF0005 and pF0005BS were the same with respect to the level
of expression (data not shown). Even though more DNA was added in the
transfection than originally thought, we were able to conclude that 2-
10 (-335 bp) was not significantly different than pF0005BS or pF0005.
Unfortunately, we were not able to make any conclusions about the 2-6
construct from the transient assays. We can only say that in stable
cell lines it was expressed at a low level in the single monoclone of
12 that was positive. The results support the contention that removal
of 80 bp (2-10) from pF0005 has little effect on the level of
expression. The transcriptional analysis of these deletions has been
repeated by Ken Wright with HeLa nuclear extracts in vitro. He has
reached similar results to those presented here (personal
communication).
Enhancer Element
Dr. Sherron Helms of our laboratory had previously identified the
distal EcoRI/EcoRI fragment (-6.0 to -7.5 kb), designated pF0116, of
the A HHG41 clone as a possible enhancer element (Helms et al., 1987).

132
004
MHC 1 2 6789 10 1112 13 14 15 18 19 20
Figure 3-26 SI nuclease analysis of pF0004 monoclonal cell lines.
Si nuclease assays were performed as described in Materials and
Methods. The number of each clone is displayed above the lane and
below the construct designation line. M, pBR322 digested with Hpall
and labelled with a--^P-dCTP and Klenow fragment. H, HeLa total
cellular RNA. C, C127 total cellular RNA. Both human (280 nt) and mouse
(110 nt) H4 protected fragments are designated. Pertinent markers are
noted.

133
Figure 3-27 SI nuclease analysis of pF0004R monoclonal cell lines.
SI nuclease assays were performed as described in Materials and
Methods. M, pBR322 DNA digested with Hpall and labelled a-^P-dCTP and
Klenow fragment. H, HeLa total cellular RNA. C, C127 total cellular
RNA. Clone numbers (1-10) are designated above each lane. Both human
and mouse H4 protected fragments are noted at the right.

Figure 3-28 Copy number analysis of pF0004 monoclonal cell lines.
Southern blot analysis was performed as described in Materials and
Methods. 10 pg of DNA from each cell line were analyzed with nick
translated EcoRI/Xbal fragment from pF0002. A. pF0004 cell line DNA
probed with H4 sequences. B. The histone probe was removed and the blot
was reprobed with the mouse 18S ribosomal fragment. Densitometry of the
1070 bp band specified by the arrow in A and the 18S ribosomal band in
B permitted quantitation of the copy number through normalization to
the amount of DNA actually loaded and transferred as described in the
Materials and Methods. The figure in A is a composite of several
exposures that reflects the actual copy number and accounts for
original quantitation errors. The plasmid controls for quantitation are
labelled 10, 50 and 100 designating the number of pg loaded. C, C127
cellular DNA. H, HeLa cellular DNA. M, A DNA digested with EcoRI and
Hind III and labelled a-^^P-dCTP and Klenow fragment. Clones are
designated with their number above each lane. Nonessential lanes in B
have been omitted.

135
A.
004
Ml 6 8 10 11 14 16 C H ® S ?
B.
Ml 6 8 10 1114 16 C H
M * •
Mini
M « fl >4
18S
1.3

136
She demonstrated that linkage of this fragment to the 3' end of the
CAT gene in pSVICAT (Gorman et al., 1982) increased the expression of
the CAT gene 4 to 5 times in transiently transfected HeLa cells.
Enhancers can be located at considerable distances from the gene that
they effect. The chicken lysozyme gene enhancer is located 7 kb
upstream of the gene (Theisen et al., 1986). To investigate this
result further a series of constructs were made and assayed in stable
cell lines. The constructs pF0004, pF004R, and pF0006 are depicted
schematically in Figure 3-1 and were constructed by standard cloning
procedures. pF0004 fused the pF0116 fragment to the pF0108P construct
in the genomic orientation. The construct pF0004R was made to reverse
the orientation, and pF0006 linked the 500 bp EcoRI/Xbal fragment of
pF0116 to pF0108X.
The constructs were transfected into mouse C127 cells and selected
for the growth of monoclonal cell lines. The SI nuclease analysis of
pF0004, pF0004R, pF0006 and the control cell line pF0108X are presented
in Figures 3-26, 3-27, and 3-15 respectively. The expression data are
presented in Table 3-2. The only cell lines with significantly higher
levels of expression than pF0108X contained the pF0004 construct. To
determine if this was truly the result of an enhancement or a
phenomenon of copy number, the latter was determined by Southern blot
analysis (Figure 3-28) as described previously in Materials and
Methods. When the pF0004 cell line copy numbers were included in the
expression/copy ratio, the level of expression dropped to control
(pF0108X) level. Since neither pF0004R nor pF0006 had a significant
difference in expression from pFOl08X, the copy number for these cell

137
lines was not determined except for pF0006m3. This cell line
presented the unusual mouse SI nuclease protected fragment seen with
the pF0005BS cell lines and therefore had high expression. The copy
number was determined to exclude the possibility that this was an
enhancer effect. pF0006m3 was included on the pF0108X copy number blot
(Figure 3-16), and from this blot it was determined that pF0006m3 has
approximately 30 integrated copies, which accounted for the higher
level of expression.
The lack of an enhancer effect by pF0ll6 was surprising in light of
the previous demonstration of the effects on CAT gene expression. The
sequence for the entire pF0116 fragment was determined by Ken Wright
and Urs Pauli of our laboratory and the proximal EcoRI/Xbal fragment
contains three sequences with similarity to the consensus core enhancer
element (5'-TGTGGAAA-3') as described for the Ig heavy chain and SV40
enhancers (Wasylyk and Wasylyk, 1987; Khoury and Gruss, 1983). The
presence of this sequence has been shown not to be solely sufficient or
necessary for enhancer activity in the IgH enhancer (Wasylyk and
Wasylyk, 1987; Kadesh et al., 1986). The reasons for a lack of
activity in mouse C127 cells, and activity in HeLa cells, is purely
speculative. Certainly differences in the proteins that interact with
enhancers in different tissue types have been documented (Maniatis et
al., 1987; Davidson et al., 1986). The evidence from the stable cell
lines we have prepared does not support the idea that the pF0116
fragment enhances or augments the expression of the F0108 H4 histone
gene when stably integrated in a mouse cell. The fact that the pF0004
monoclonal cell lines had such a high average copy number has been

138
investigated further in Chapter 4 with respect to specificity and mode
of integration. Ken Wright of our laboratory has also demonstrated
that the pF0116 fragment is unable to enhance the transcription in
vitro of the human H4 gene (personal communication).
The contribution of promoter sequences to the expression of the
F0108 H4 histone gene has been determined in stable cell lines.
Initially this approach appeared to be the most accurate way to
determine functionality; however, in retrospect there are a number of
variables which can not be accounted for. A brief comparison of the
results from the transient assays done to assess the negative
regulatory element hypothesis indicates the heterogeneity that can
occur in the results and their interpretation as a result of the
methodology utilized to perform the experiment. We originally thought
that the mouse H4 SI nuclease probe would be the ideal internal
control, but subsequently we have realized that it has faults for which
we cannot correct in our interpretation of the results. The
possibility exists that limiting transcription factors are present in
only sufficient amounts to transcribe the mouse H4 genes present in the
cell. The introduction of the human H4 genes into the genome of the
mouse cell likely disturbs this equilibrium. The possibilities for
misinterpretation are considerable. If, at low copy number, the human
H4 genes do not effectively compete for mouse transcription factors
then we have probably underestimated their relative expression. At
high copy number it is quite apparent that the expression/copy ratio
decreases. Based on what we have presented here and later in Chapter 4
we will formally assess the results of the transcription data in

139
Chapter 5 with respect to the low copy number cell lines only.
Although this limited my data base it appeared to be the only
reasonable way to proceed in order to fairly evaluate the data we have
collected.
Nuclear run-on analysis of H4 transcription
This section of the results is added purely as a note to those who
might try similar experiments as described below. None of the
experiments we have described above directly assess the level of
transcription. Differences in the 5' region of the promoter were
assayed in log phase cells under the assumption that the mRNA was the
same for all constructs, therefore any differences in the level of mRNA
were a reflection of transcription. This interpretation is fine and
holds up reasonably well when deletion constructs are compared to one
another. However, to examine transcription directly it is necessary to
eliminate the mRNA stability variable in histone gene metabolism. Our
laboratory has utilized nuclear run-on transcription to identify the
time and extent of human histone gene transcription during the cell
cycle (Baumbach et al., 1987). We felt that our monoclonal cell lines
would be ideal candidates for such an analysis and that we could
determine the region of the promoter responsible for the 3-5 fold
increase in the level of transcription during S-phase of the cell
cycle. Briefly, nuclei were isolated from the cells at 4°C and
transcription allowed to continue in the presence of a- ^p-UTP for 30
minutes. The labelled RNA was purified and used to probe blots that
had plasmid DNAs immobilized (excess DNA hybridization). In short,
regardless of the temperature, salt concentration, or- aqueous state of

140
the hybridization reaction we were able to observe only mouse H4 mRNA
cross hybridization to the human H4 plasmid DNA (data not shown). An
alternative approach to the detection problem was tried -- what we
called a "reverse Si analysis". The labelled nuclear run-on
transcripts were incubated with cold probe RNA made from the T3
promoter of a Bluescript clone of pF0002. This was then digested with
SI nuclease, electrophoresed, and visualized as usual. As a control,
the probe pF0002 RNA was labelled with q-^^P-UTP and hybridized to HeLa
total cellular RNA. The control worked well, but the test reaction was
only a smear (data not shown). This result had previously been
predicted by my outside examiner Dr.Barbara Sollner-Webb. She felt that
the technique would not work because of stable double stranded
ribosomal RNA that would be labelled and obscure the histone signal.
We decided that unfortunately this approach was not possible in our
system.

CHAPTER 4
PLASMID INTEGRATION SITES, INTEGRITY AND PROTEIN/DNA INTERACTIONS
One goal of modern molecular biology is to understand the molecular
events that occur during the integration of exogenous DNA into the
chromosome of a cell. These processes have been examined in detail by
several investigators and are important for the study of biological
problems in eukaryotic cells (Loyter et al., 1982, Perucho et al.,
1980, Folger et al., 1982, Lin and Sternberg, 1984). The problem of
what happens to the DNA molecules once they enter the cell is
intriguing as it gives a glimpse of the complicated recombinational
processes that occur inside the cell. Loyter et al. (1982),
demonstrated that there was a limit to the amount of DNA a plate of
cells could take up, and that only a small percentage of the DNA that
entered the cytoplasm subsequently entered the nucleus. Previous work
by Perucho et al. (1980, 1981) demonstrated that as foreign DNA (e.g.
plasmid DNA with a gene of interest) entered the nucleus of a cell it
became recombinationally active. Because there is usually little or no
homology between the foreign DNA and the cellular DNA the first
recombination events that occur are between the plasmid DNA molecules
and carrier DNA. Cointegrates form in the nucleus shortly after the
introduction of the DNA into the cells. These very large circular
molecules contain many plasmid molecules arranged in a head-to-tail
141

manner. When integration into the host chromosome does occur, a large
number of plasmid molecules are likely to integrate stably in a head-
to-tail fashion at a single location (Perucho et al., 1980). For my
purposes it was necessary to assess the integrity of the integrated
histone deletion constructs, the structural relationship to the
cotransfected plasmid pSV2neo, and the mode of integration.
Integrity of Flanking Sequences
To assess the intactness of the proximal flanking sequences, we
examined the copy number blots of the constructs with 210 bp or less o
5' flanking sequence. In the constructs J67 (-47 bp), J56 (-73 bp),
J50 (-100 bp), K8 (-155 bp), L14 (-185 bp) and pF0108A (-215 bp)
(Figures 3-4, 3-6, 3-10, 3-14) the EcoRI/Xbal fragment represents the
entire coding and 5' flanking sequences. The EcoRI/Xbal digest was
originally chosen because it is a fragment common to all the
constructs used in the study. It was easily determined by inspection
of these Southern blots that all or nearly all of the H4 constructs
were integrated in a manner that permitted detection of the human H4
insert sequences of the original plasmid. The integrity of longer
constructs such as pF0003 and pF0004 was not measurable this way. To
assess the integrity of the pF0003 flanking sequences the genomic DNA
from a polyclonal cell line pF0003p3 was digested with Xbal. This
digestion defines the entire 7.5 kb insert. The restricted DNA was
electrophoresed on a 1% agarose gel, blotted, and probed with the
EcoRI/Xbal fragment from pF0002. The results, presented in Figure 4-
la, lane 4, demonstrate the predominance of a 7.5 kb band that
corresponds to the presence of the entire pF0003 insert. Genomic DNA

143
A. B.
1 2345 12345
Figure 4-1 Southern Blot analysis of genomic DNA from polyclonal
cell lines: assessment of flanking and coding sequence
integrity in pF0003 and pF0004.
Ten micrograms of genomic DNA from polyclonal cell lines pF0003p3 and
pF0004p2 were digested with either Xhol or Xbal, electrophoresed,
blotted, and probed as described in Materials and Methods. A. Lane 1, A
DNA digested with Hindlll and labelled with a-^P-dCTP and Klenow
fragment; Lane 2, Xhol digested pF0003p3 DNA; Lane 3, Xhol digested
pF0004p2 DNA; Lane 4, Xbal digested pF0003p3 DNA; Lane 5, Xbal digested
pF0004p2 DNA. The blot was probed with the histone H4 EcoRI/Xbal
fragment purified from pF0002 and nick translated as described in
Materials and Methods. In lanes 4 and 5 the expected size fragments are
noted with arrows at the right. B. Lanes 1-4 are the same as 2-5 in A.
Lane 5, A DNA digested with Hindlll and labelled with a-^P-dCTP and
Klenow fragment. The blot in B was probed with nick translated pUC8
DNA. The 2.7 kb band in lane 3 (pF0003p3) is linear pUC8.

144
from a polyclonal cell line of pF0004 was digested with Xbal and it was
established that a large percentage of the 1.6 kb Xbal/Xbal fragment
that includes the coding region and much of the flanking sequences was
detectable as an intact fragment (Figure 4-la, lane 5). To determine
that the DNA was indeed integrated we digested both pF0003p3 and
pF0004p2 with Xhol, an enzyme that has no sites within either plasmid.
Figure 4-1, lanes 2 and 3, demonstrate that when the DNA is digested
with Xhol almost all of the hybridization to the human histone probe is
in the region of the blot that corresponds to very high molecular
weight DNA. Evidence for tandem integration was found when the blot in
4-la was reprobed with pUC8 DNA. In Figure 4-lb, lanes 1 and 2 still
demonstrate high molecular weight DNA as expected. Lane 3 has a
predominant 2.7 kb band that is probably pUC13. The fact that both the
pF0003 insert (7.5 kb) and vector (2.7 kb) bands were so readily
detectable was indicative of tandem integration. Unexpectedly the
pF0004p2 DNA did not have a similar 2.7 kb band. Instead there was a
heterogeneous pattern of hybridization to the pUC8 DNA observed in
Figure 4-lb, lane 5.
These experiments were pursued further to establish the mode of
integration that had occurred in the monoclonal cell lines. This
information would allow one perhaps to understand how, or if, the
arrangement of histone insert sequences with respect to each other
affects expression. Our concern has been how to interpret the copy
number data with respect to expression. The possibilities are
considerable that tandem integration, for example, might "protect"
internal integrates from chromosomal effects in cis. Is it possible to

145
assume that all the genes integrated in a cluster are going to
function equally well? When polyclonal cell line DNA from 108Ap2 was
digested with PstI and analyzed by Southern blotting, it was evident
that a single band of 6.2 kb was present and corresponded to full
length plasmid DNA (data not shown). Therefore integration appeared to
have occurred in a tandem fashion. The detection of such a high
percentage of the EcoRI/Xbal fragment in the copy number blots
mentioned above also demonstrated that tandem integration was probably
the pathway utilized.
We analyzed several other monoclonal cell lines with different
restriction enzymes and Southern blot analysis to establish that tandem
integration was a general phenomenon. In Figure 4-2, lanes 3 and 4
demonstrate that when genomic DNA from the monoclonal cell line
pF0003ml was digested with PstI a predominant 10.2 kb band was detected
following hybridization with an oligo-labelled 3' noncoding Xbal/HincII
fragment of pF0002. Lane 3 is just a lighter exposure of lane 4. We
concluded that tandem integration was apparently the mechanism used by
most constructs. This human H4 histone gene 3' probe permitted
detection of only human histone sequences since it contained no coding
region. In Figure 4-2, lane 9, pF0005m5 genomic DNA was digested with
BamHI, again an enzyme that linearizes the construct. Two bands were
detected with the histone 3' probe, linear pF0005 (4.3 kb) and a
slightly higher band that was not identified. This pointed toward
tandem integration, and limited heterogeneity of integration sites.
Digestion of pF0108AmlO genomic DNA with BamHI (Figure 4-2, lane 13)
demonstrated more heterogeneity although the correct size

Figure 4-2 Southern Blot analysis of monoclonal cell line
integration pattern and location of pSV2neo sequences.
This figure is a composite of the same blot that has been probed with
two different DNA fragments. The blot was first probed with a 3'
fragment from the F0108 H4 histone gene as described in the text, and
Material and Methods. This probe was removed and the blot was probed
for a second time with a fragment that contains the SV40 enhancer. The
complementary lanes from each analysis have been placed next to each
other to facilitate comparison of the data. Lanes 2-4, 6, 7, 9, 11, 13,
and 15 were all probed with the 3' histone H4 fragment. Lanes 5, 8, 10,
12, 14 and 16 were probed with the SV40 fragment. Lanes: 1, A DNA
digested with Hindlll/EcoRI and Klenow labelled; 2, HeLa DNA digested
with Xbal and a 7.5 kb band is detected. Lanes 3 and 4, pF0003ml DNA
digested with Pstl. The 10.2 kb linear pF0003 molecule is denoted at
the left (3 is a shorter exposure of lane 4). Lane 5, pF0003ml DNA
digested with Pstl and the 2.3 kb Pstl pSV2neo fragment is indicated at
the right by an arrow. Lanes 6 and 7, pF0004Mll DNA digested with Pst
1. A 5.7 kb linear band is detected and indicated (lane 6 is a shorter
exposure of lane 7). Lane 8, pF0004mll DNA digested with Pstl. The 2.3
kb Pstl fragment of pSV2neo is denoted. Lanes 9 and 10, pF0005m5 DNA
digested with BamHl. In lane 9 a 4.3 kb linear pF0005 band is denoted.
In lane 10, the linear 5.5 kb pSV2neo band is indicated. Lanes 11 and
12, pF0005m5 DNA digested with Pstl. In lane 11 a 1.7 kb band
corresponding to the entire pF0005 insert is detected. In lane 12, the
2.3 kb Pstl fragment of pSV2neo is noted. Lanes 13 and 14, pFOl08Aml0
DNA digested with BamHl. In lane 13 the 6.2 kb band of linear pF0108A
is noted. In lane 14 the 5.5 kb pSV2neo band is noted. Lanes 15 and 16,
pF0108Am!0 digested with Pstl. In lane 15 the 2.2 kb band corresponding
to most of the pF0108A insert is detected. In lane 16 a 2.3 kb pSV2neo
band is detected as expected.

147

148
linear fragment was detectable (6.2 kb). When pF0005mll and
pF0108AmlO DNA were digested with PstI, a fragment of the expected size
was readily detectable (Figure 4-2, lanes 11 and 15, respectively).
These results were consistent with tandem integration, perhaps in
several locations.
We noticed early in these studies that cell lines that contained
the construct pF0004 had a heterogeneous pattern of integration. When
pF0004mll genomic DNA was digested with PstI, an enzyme that linearizes
the construct, there were fewer linear molecules (5.7 kb) detectable,
Figure 4-2, lanes 6 and 7. Lane 6 is a lighter exposure of lane 7.
This increase in the heterogeneity of integration was associated with
the presence of an Alu repeat sequence in the 5' flanking region of
this construct. We examined the copy number data and calculated the
average copy number of each type of cell line (Table 3-2) and were able
to correlate the presence of repeated sequences with increased average
copy number. Previous work on repeated sequences associated with
histone gene clusters (Collart et al., 1985) had demonstrated the
presence of a strong Alu repeat in the most distal EcoRl/Xbal fragment
(-5.5 to -6.5 kb) of the putative H4 promoter sequences, and, to a
lesser extent, minor repeated sequences located between the BamHI site
(-1.65 kb) and the EcoRI site at -5.5 kb. The fact that the pF0003ml
cell line had a significant proportion of its DNA tandemly integrated
as shown in Figure 4-2, lane 3, suggested that while the minor repeats
located in its flanking sequence have contributed to increased copy
number, they have not caused as much heterogeneity in the integration
sites as the Alu repeat in pF0004.

149
Figure 4-3 Specificity of pF0004 integration.
Southern blot analysis was done according to the procedures described
in Materials and Methods. A. Six pF0004 cell lines: pF0004pl, pF0004ml.
pF0004in8, pF0004mlO, PF0004mll, and pF0004ml9 were digested with either
Xbal (lanes 1-6) or PstI (lanes 7-12). The blot was probed with oligo
labelled Xbal/HincII fragment of pF0002 as described in Materials and
Methods. The 1.6 kb insert band of pF0004 is designated to the left of
the figure. B. The histone 3' probe was removed and the blot was
reprobed with oligolabelled 264 bp SV40 enhancer fragment as described
earlier. The lanes in B are identical to those in A. The position of
marker fragments is designated between A and B in kilobases. The
restriction enzyme digest is indicated below each lane.

150
The previous demonstration with the pF0004pl cell line that a
significant portion of the insert was detectable and intact (Figure 4-
1, lane 5) suggested that these contrasting results might be the
consequence of specific integration. To determine whether the ability
to detect the pF0004 insert fragment in genomic DNA was limited to the
single polyclonal cell line we had examined, we repeated the experiment
with the pF0004pl cell line and 5 monoclonal cell lines. Cell lines
with reasonably high copy number were utilized to aid detection and
assess the effect of integration on intactness of the flanking
sequences. The results, presented in Figure 4-3a, lanes 1-6,
demonstrate that in every cell line the 1.6 kb Xbal/Xbal fragment was
detectable and constituted a considerable portion of the signal present
in each lane. If the same pF0004 monoclonal cell line DNAs were
digested with PstI and probed for the presence of linear pF0004
molecules (Figure 4-3a, lanes 7-12) there was heterogeneity in
integration and very little linear (5.7 kb) pF0004 was detectable. If
so much of the insert Xbal/Xbal fragment was detectable, and so little
linear, there must have been an unusual integration event that occurred
to give both results. It appeared a strong possibility that the Alu
sequence in the 5' flanking region was a site where specific
integration might occur. To test this hypothesis we digested three of
the pF0004 monoclonal cell line DNAs with Ncol. This enzyme has two
sites of digestion, one at +280 bp and one in the very distal 100 bps
of the 5' flanking sequence (-1.6 kb, Figure 4-4b). This digest
produces two DNA fragments of 1.9 kb and 3.8 kb. The Alu sequence is
located in the 1.9 kb Ncol fragment. It is important to recall that

151
Xbal
Pst I
Ncol
1.6
16
5.7
3.8
1.9 3.8
Figure 4-4 Southern blot analysis of pF0004 integration: Ncol
digestion of genomic DNA.
The analysis was done as described in Materials and Methods. A. 10 /¿g
of DNA from monoclonal lines pF0004m8, 11, and 19 were digested to
completion with Ncol. The blot was probed with the EcoRI/Xbal fragment
from pF0002. This probe detects both the 1.9 kb and 3.8 kb bands. B.
Synopsis of the hybridization to the EcoRI/Xbal probe. This figure
presumes that two pF0004 molecules have integrated tandemly head to
tail through one of the Alu repeats. pF0004, when digested with Xbal,
produces a homogeneous 1.6 kb band and 2 copies are detectable.
Digestion with PstI produces a single detectable linear molecule of 5.7
kb and in this case one end fragment designated by the dotted line and
the arrow. The data from part A of this figure supports the fact that
2, 3.8 kb, and 1, 1.9 kb fragment would be detectable from this double
integrate.

152
when the pF0004 monoclonal DNAs were digested with Xbal, uniformly a
1.6 kb fragment was detectable that indicated that the flanking
sequences up to -715 bp were intact and integration had not occurred
between the two Xbal sites. The only other regions available for
integration were the Xbal/EcoRI fragment (-750 to -1750 bp) and the
pUC13 vector sequences. Because all constructs share similar vector
sequences it was unlikely to be this region that differentiated the
pF0004 construct from others in integrative mode. The pF0004 Ncol
digestion experiment was probed with the EcoRI/Xbal fragment of pF0002
which detects both the 1.9 and 3.8 kb Ncol fragments. The results of
the Ncol digestion Southern blot are presented in Figure 4-4a. Several
exposures were scanned densitometrically to determine the ratio of 3.8
kb to 1.9 kb fragment. In the three cells lines the ratio of the 3.8
kb and 1.9 kb Ncol fragments was approximately 2:1.
To explain this and previous results our current hypothesis is that
the pF0004 plasmid DNA integrated through the Alu sequence in no more
that two or three copies per integration site. This hypothesis
explains, as diagrammed in Figure 4-4b, that when two copies of pF0004
are integrated through the Alu sequence: 1) the Xbal/Xbal fragments
(there are 2) are both detectable, 2) only one of the two integrated
constructs is detectable when the PstI digestion is done, and 3) the
Ncol digestion produces two 3.8 kb and one 1.9 kb fragments as seen
experimently (Figure 4-4a). Althoughnot conclusive it suggests some
preferential integration via the Alu sequence. This specificity of
integration through the Alu repeat accounts for the heterogeneity in
integration sites observed. Previously it was thought that integration

153
of plasmid DNA, in a single eukaryotic cell, occurred first at the
cointegrate stage, then at a single site in the chromosome (Perucho et
al. , 1980). This is plausible because usually there is relatively
little homology between the transfected DNA molecules and the cellular
DNA. However, it is apparent from our results that repeated sequences,
such as the Alu repeat, which are well conserved from species to
species may mediate specific and higher levels of integration than
normally possible.
Location of pSV2neo Plasmid Sequences
The second point to be addressed in these experiments was whether
the pSV2neo plasmid was located in the proximity of the human histone
H4 gene constructs. In order to create the cell lines we have used in
this study, it was necessary to cotransfect with the plasmid pSV2neo.
Our primary concern was to establish to what extent the SV40 enhancer
might associate with the histone promoter deletion constructs and
affect the expression of the H4 constructs in a cis manner. Since
there is similarity between the pBR322 portions of these various
plasmids we investigated the possibility that pSV2neo and histone
deletion plasmids were located adjacent to each other.
An early observation with regard to this problem was that
constructs such as J67 and other short deletion constructs of the H4
promoter demonstrated little or no transcription when integrated
stably. This result, probably more than any other, demonstrated that
the pSV2neo plasmid had little or no influence on expression of the
cotransfected histone plasmids. It was reasonable to suppose that the
integration of the human H4 histone genes occurred at a sufficient

154
distance from the influence of any endogenous strong promoter effects.
It was also unlikely that the pSV2neo cotransfected molecules had any
substantial effect on the expression of the transfected H4 histone
genes.
To initially address the location with respect to human histone H4
sequences of the pSV2neo plasmid in the monoclonal cell lines, we
reprobed monoclonal cell line Southern blots shown in Figure 4-2 with
an oligo-labelled EcoRI/EcoRI fragment that contained the entire SV40
enhancer sequence. A pUC8 clone of the 264 bp EcoRI/EcoRI fragment was
kindly provided to me by Gerard Zambetti of our laboratory and contains
both 72 bp repeats (originally derived from pDG014, a gift of Dr.
Sherman Weissman). Figure 4-2 is a composite of identical lanes
probed with either the histone 3' probe as detailed earlier or the SV40
enhancer fragment. We felt it would be easier for comparison if the
lanes were placed adjacent to each other instead of on separate
figures. In Figure 4-2 lanes 5 (pF0003ml), 8 (pF0004mll), 12
(pF0005m5), and 16 (pF0108A) are identical to the adjacent lanes 4, 7,
11, and 15. A PstI digest of pSV2neo produces three fragments and the
SV40 probe detects the 2.3 kb fragment that contains part of the
neomycin resistance gene, the SV40 promoter/enhancer, and some pBR322
sequence. When genomic DNA is digested with BamHI the pSV2neo DNA is
linearized, and if tandemly integrated, a 5.5 kb band should be
detectable. In Figure 4-2, lane 5, the pF0003ml DNA cut with PstI
demonstrated a prominent 2.3 kb band as expected, but also has bands in
the region of the histone signal detected previously (10 kb) in lanes 3
and 4. The ability to detect a substantial amount of both the 10.2 kb

155
pF0003 DNA and the 2.3 kb pSV2neo fragment suggests that there is not
a substantial mixing of the two molecules in the pF0003 integration
site. The smaller fragments detected in lane 4 probably represent
"end" fragments of each integration event. An end fragment is detected
because it is the most distal plasmid sequence on either side of the
integration event. In the case of pF0003ml, the DNA is cut with Pstl.
The pF0003 DNA molecules integrated at each end of the tandem array
will be subject to cutting internally with Pstl once, and at some
unknown distance into the cellular DNA at the next available Pstl site.
Since this next Pstl site is of an undetermined location on both ends
of the integration event, for every integration site there will usually
be two end fragments of unknown length detectable. The number of end
fragments can indicate the number of different sites into which the
construct has integrated. pF0003ml has 10 or more fragments in
addition to the main band at 10 kb. This could be interpreted as
reflecting 5 integration sites in this monoclonal cell line or perhaps
the inclusion of pSV2neo between tandemly repeated pF0003 molecules
causes periodic interruptions.
The digestion of pF0004mll with Pstl (Figure 4-2, lane 8) also
demonstrates that the 2.3 kb pSV2neo fragment is detectable and
constitutes a considerable portion of the signal in lane 8. A
comparison of this lane hybridized to histone 3' sequences (lane 7) and
hybridized to the SV40 enhancer fragment demonstrates that very few of
the bands detectable with the histone sequence probe are also detected
with the SV40 enhancer probe. This lack of congruity pointed to some
separation of the pSV2neo and pFO series plasmids upon integration.

156
The construct, pF0005, when digested with BaraHI in Figure 4-2, lane 9,
yields a 4.3 kb linear fragment when hybridized to histone 3' flanking
sequences. When hybridized to the SV40 fragment, a 5.5 kb band
corresponding to linear pSV2neo is detected (lane 10). The ability to
detect a majority of the pSV2neo DNA as a linear molecule confirms the
idea that in many instances the pSV2neo plasmid has integrated
primarily in a site apart from the histone constructs. The band above
the 4.3 kb (lane 9) and below 5.5 kb (lane 10) apparently contains both
histone and SV40 sequences. The construct pFOl08AmlO, when digested
with either BamHl (linearizes construct, 6.2 kb) (lane 13) or PstI (2.2
kb fragment) (lane 15), and probed with the histone 3' sequences
resulted in the detection of many fragments. When hybridized with the
SV40 enhancer fragment, there is a 5.5 kb band in lane 14 and a 2.3 kb
band in lane 16, along with several additional bands, both larger and
smaller. In some instances there is identity between the fragments
detected by the two probes, so it is possible they are located in close
proximity or linked on restriction fragments.
Still, at this point it was difficult to determine the
relationship between the two transfected plasmids, histone and pSV2neo.
It was apparent that in some cases there was a reason to believe that
the two plasmids were not completely mixed during the integration
events. To determine the relationship in a different way, we reprobed
the blot in Figure 4-3a with the SV40 enhancer fragment after removal
of the histone probe. The idea in this experiment was that the pSV2neo
plasmid contains no Xbal restriction sites. Therefore, the digestion
with Xbal, which released greater than 90% of the pF0004 sequences as a

157
1.6 kb band, should determine whether there was any mixing between the
pSV2neo and pF0004 plasmid upon integration. The presence of a 5.5 kb
or larger band would be indicative of mixing and release upon Xbal
digestion. As can be seen in Figure 4-3b the Xbal digested pF0004
monoclonal cell lines (lanes 1-6) hybridized to the SV40 enhancer
fragment in a diffuse manner and primarily in the upper region of the
blot that was indicative of large DNA molecules. A few bands were
detectable in the pF0004ml9 cell line and it should be noted that this
cell line has a very high copy number and a great deal of heterogeneous
integration. The same pF0004 monoclonal cell lines when digested with
PstI (Figure 4-3b, lanes 7-12) demonstrated that the pSV2neo sequences
are present and detectable as a 2.3 kb band. The pF0004 monoclonal
cell lines digested with Xbal and probed with the SV40 sequences
suggest that the pSV2neo plasmid DNA is not interspersed in the
integrated pF0004 plasmid DNAs. If the pSV2neo plasmid had been
released by Xbal digestion we would have expected a strong band(s) in
the high molecular weight region of the blot. The diffuse
hybridization throughout the lane is somewhat confusing and
unfortunately a C127 DNA control was not included on this gel. There
is the possibility that the DNA fragments that contained the pSV2neo
plasmid molecules were very large and did not transfer well from the
gel.
Given the facts presented and known about enhancers, particularly
the SV40 enhancer, it seems reasonable to conclude that this potent
enhancer has little or no effect on the human H4 histone sequence
integrated in these mouse cells. Because of the intensity of the

158
pSV2neo bands (2.3 kb) detectable in Figure 4-2 and Figure 4-3 it was
likely that the copy number of the pSV2neo plasmid in these cell lines
was very high. This was certainly the result of integration and
amplification under the selective pressure of G418. Because of the
selective pressure under which these cell lines were grown it was
impossible to determine the absolute pSV2neo copy number originally
present in the cell.
Compatibility of Mouse and Human Regulatory Proteins and Sequences
Examination of the copy number data presented in Table 3-2 revealed
that as the copy number of a cell line increased the expression/copy
decreased. This is graphically detailed in Figure 4-5 where several
cell lines have been compared to one another for this effect. The
obvious trend was typified by pF0005. When cell lines with fewer than
5 copies are plotted the expression/copy was high (0.3), but when copy
number rose above 5 the expression/copy ratio decreased dramatically.
Although the expression/copy ratio for the other constructs presented
was generally lower than for pF0005, the decrease with increased copy
number was still apparent. This effect presented several problems: 1)
is it then appropriate to analyze only the low copy number cell lines
for differences from construct to construct? and 2) does this indicate
that the human and mouse H4 genes are in competition with each other
for necessary transcription factors? In chapter 3 we alluded to the
fact that there was a competition phenomenon. At that point we
interpreted the pF0108A and pF0005 data in the context of copy number.
To determine whether these concerns were valid, we performed an
analysis of the protein/DNA interactions in the 5' promoter sequences

159
H4 Deletion Constructs
Average Expression/Copy Number vs. Copy Number
Figure 4-5 Effect of cell line copy number on the expression of the
human H4 histone gene.
A plot of average expression/copy versus the cell line copy number.
Data from Table 3-2 was averaged for K8, pFO108A, pF0005, pF0002, and
pF0003. The average expression from all cell lines in a group with the
same copy number are presented as single points. Most points are
representative of the value for a single monoclone and not averaged
with others. The legend in the figure designates each curve.

160
of the F0108 H4 histone gene. If promoter competition for
transcription factors occurred then we felt it might be possible to
detect the effect of high copy number on the binding of transcription
factors.
In collaboration with Dr. Urs Pauli, of our laboratory, we
characterized the protein/DNA interactions in the proximal promoter
region of three monoclonal cell lines containing the construct pF0003.
We were interested to know whether Site I and Site II were present in
the proximal promoter of the human H4 histone gene when integrated in a
mouse cell and if the protein/DNA contact points were the same. The
pF0003 cell lines were chosen for several reasons. They had a wide
range of copy number available and we felt that the extensive 5'
flanking region (-6.5 kb) was more likely to assume a chromatin
structure like that found in a human cell. Cell lines were grown until
80-90% confluent and treated with DMS in vivo as described in
Materials and Methods. Genomic DNA from each cell line was prepared,
digested with Hindi, electrophoresed, and blotted as described in
Materials and Methods. The filter with immobilized DNA was then
hybridized with the 5' Hindi upper strand probe (Figure 4-6a). This
probe was used because the upper strand of the DNA contained 13 Gs
strongly protected from DMS treatment whereas the lower strand
contained only 3 minor protections (Pauli et al., 1987). All the G
residues that exhibit protection are noted on the side of Figure 4-6.
The boundaries of Site I and Site II are denoted to the right of Figure
4-6b. These were determined by Pauli et al. (1987) by DNasel
protection. Therefore, we were able to easily detect any differences

Figure 4-6 Genomic sequencing analysis: protein/DNA interactions
in the proximal promoter of the F0108 H4 histone gene
stably integrated into mouse C127 cells.
As described in Materials and Methods the genomic DNA from several
different monoclonal cell lines of pF0003 was treated with DMS in vivo.
The DNA was then purified, treated with piperidine, restricted with
Hindi, electrophoresed, blotted and probed with the upstream 5' Hindi
probe. A. Schematic diagram of the proximal region of the F0108 H4
histone gene. The single strand (Hindi) probe that was utilized in
these experiments is designated with the large arrow. Restriction
enzyme sites are denoted as EcoRI, E; Hindi, He; HindIII, H; Ncol, N.
The large box is the H4 coding and leader sequence. Both Site I and
Site II are designated above the diagram. B. Genomic sequencing
analysis of protein contact points in Site I and Site II of the human
H4 proximal promoter region. Lanes: 1, control HeLa DNA, purified,
deproteinized, and then treated with DMS. 2, HeLa DNA that was treated
in vivo to demonstrate the positions of Site I (-123 to -89 bp) and
site II (-63 to -23 bp). At the left, the small arrows indicate the
protein/DNA interactions as detected by DMS methylation interference
(Pauli et al., 1987). Lane 3, pF0003m5 cell line DNA (copy number = 13)
treated in vivo with DMS. The three G residues at approximately -98 to
-100 bp are protected and denoted on the figure with an arrow. Lane 4,
control deproteinized pF0003m5 DNA. Lane 5, HeLa control DNA,
deproteinized and DMS treated. Lane 6, pF0003M6 (copy number = 20) DNA
treated in vivo with DMS. The protected G residues at -98 to -100 bp
are noted with an arrow on the figure. Lane 7, pF0003Ml (copy number =
140) DNA treated in vivo with DMS. The G residues are not protected
at -98 bp. At no time was there any detectable protein DNA interaction
in pF0003m5, m6, or ml at Site II or the distal part of Site I. Lane 8,
pF0003 plasmid DNA treated with DMS as a control for the G residue
sequencing pattern. The only detectable protein binding occurs in Site
I of pF0003m5 and m6 at the putative Spl site.

162

163
in the protein/DNA interactions in the heterologous mouse system. The
results presented in Figure 4-6b, lane 3, suggested that in a cell line .
with low copy number, pF0003m5 (13 copies), a significant portion
(approximately 70%) of the genes had protein bound to the proximal side
of Site I (the putative Spl site G residues -98 to -100 protected in
vivo), but there was apparently no protein bound to site II. When the
copy number of the cell line increased to 20, pF0003m6, there was still
protein/DNA interaction detectable at Site I, but not at Site II (lane
7). Finally when 140 copies of the human histone gene were present,
pF0003ml, there was no detectable protein interaction at Site I or Site
II (lane 7). As a control for the presence and location of Site I and
Site II, synchronized HeLa cells, early in S phase, were treated with
DMS at the same time and subjected to the same protocol as the pF0003
cell lines (lane 2). pF0003 plasmid DNA and deproteinized HeLa DNA
were DMS treated as a control (lanes 8 and 1 respectively) for the
expected sequence pattern of the G residues.
The results substantiated the cell line expression data that a
limiting factor(s) was necessary for the transcription of histone
genes. The results also support the contention that the mouse and
human transcriptional proteins are not necessarily identical. Previous
studies, including this work, have demonstrated that the mouse cell is
able to correctly express introduced human histone genes (Green et al.,
1986, Capasso and Heintz, 1985). In many other respects the mouse cell
is capable of the regulation of human histone mRNA in a manner
identical to that of the human cell. We have demonstrated that the
processed 3' ends of the human histone H4 mRNA are identical in mouse

164
and human cells and that the transcription initiation sites are also
identical (data not shown). However, our failure to detect protein
bound to the distal side of Site I and to all of Site II, even at low
copy number, indicated that there were differences in the factors that
bind there. Confirmation of their existence and binding in vitro has
been demonstrated by van Wijnen et al. (1988, and personal
communication). Perhaps there are subtle protein sequence variations
that preclude detection with genomic sequencing. Previously, van
Wijnen et al. (1987) demonstrated that there were factors that bound to
the region of the H4 promoter from -210 to -410 bp, however these
proteins were not detected in vivo by genomic sequencing. Either these
protein/DNA complexes were artifacts of the in vitro assay system
utilized or some protein/DNA interactions are simply not detectable
with genomic sequencing. We should note that Dr. Pauli examined the
region from -210 to -410 bp with both DNasel and DMS protection.
DNasel is likely to detect a majority of the interactions, whereas DMS
might not pick up every interaction (Dr. Pauli, personal
communication).
We reanalyzed the copy number and expression data in light of the
genomic sequencing results and found that in most, but not all cases,
the human and mouse absolute densitometry signals inverted as the copy
number increased. This is graphically presented in Figure 4-7 for
several cell lines including pF0003. We calculated the percent of the
total SI nuclease protected fragment signal measured densitometrically
(mouse H4 + human H4) that was representative of the mouse H4 gene and
plotted this versus the copy number of each monoclonal cell line. It

Mouse S1 Signal - % of Total S1 Signal
165
Effect of Copy number on Mouse H4 Expression
Monoclonal Cell Line Copy Number
Figure 4-7 Effect of Human H4 gene copy number on Mouse H4 gene
expression.
Si nuclease protection data for several cell lines was analyzed to
determine the effect of the human H4 gene on the expression of the
mouse H4 gene. The human and mouse SI nuclease assay densitometry
values were totaled and the percent of the total signal that was mouse
was plotted versus the copy number of the human H4 in each cell line.
Data from pF0003, pFOOOS, and PF0108A are shown to illustrate the point
that as human H4 copy number increases the expression of the mouse gene
decreases.

166
H4 Deletion Constructs
Average Expression/Copy Number
Figure 4-8 Reassessment of human H4 histone gene expression: low
copy number data.
The same cell lines that were depicted in Figure 3-17 are shown here.
Only data from low copy number cell lines has been included. This in
general corresponds to less than 20 copies/cell. Expression/copy number
is plotted with the standard deviation of the mean as a one way error
bar.

167
was obvious that as the human H4 copy number increased the percent of
total mouse SI signal decreased proportionally. This result requires
some qualifications. We had expected that as the human H4 copy number
increased the expression would also increase. If there was no
competition between the two sets of genes than the mouse signal should
have been unaffected and remained stable since the mouse copy
numberdoes not change. If that logic is followed an additional step
than the mouse signal should have decreased with human copy number when
measured as a ratio. However, the human H4 expression did not continue
to rise with the human H4 copy number. Effectively, the increase in
the human H4 gene copy number appears to have lowered the mouse gene
expression and therefore artificially raised the human gene
expression. The result of this phenomenon is that the original human
H4/mouse H4 ratio that was calculated is certainly inaccurate in high
copy number cell lines. We have noticed that in very high copy number
cell lines, such as pF0004ml, both the human and mouse H4 genes are
expressed at low levels (Figure 3-27). This is probably the result of
factor distribution between the possible transcription units in such a
manner that none of the genes has a full complement of proteins
necessary for expression. Our reassessment of the expression data is
presented Figure 4-8, and only incorporates data from each cell line in
which the competition phenomenon (generally low copy number cell lines)
was not readily apparent. The expression/copy was plotted as before in
Figure 3-17. The statistical differences between constructs that were
detailed earlier is still valid for this part of the data.

CHAPTER 5
DISCUSSION AND CONCLUSIONS
Our studies over the last several years have contributed to the
general understanding of histone gene expression and of the expression
of human genes in a heterologous system. The histone genes have been
studied intensely for decades and only now are beginning to be
understood. From the work we have presented here and the work done by
others (Hanley et al., 1985; Sierra et al., 1983; Dailey et al., 1986;
van Wijnen et al., 1987) it is clear that the histone H4 promoter is
composed of several discrete DNA sequence elements, including the TATA
box, CAAT box, Spl site (5'-GGCGGG-3'), and GGTCC element. We have
also demonstrated that more distal sequences may have both a positive
and negative effect on the transcriptional regulation of the F0108
human H4 histone gene.
We initially wanted to demonstrate what sequences were sufficient
for cap site initiation of transcription in vivo. Previously, Sierra
et al. (1983) had demonstrated with a series of Bal31 deletions, that
sequences contained in the construct J67 (-47 bp), including the TATA
box (-30 bp) and GGTCC element (-47 bp), were sufficient for correct
initiation of transcription in vitro. In order to ascertain whether
these sequences were sufficient in vivo we constructed a series of
polyclonal cell lines in mouse C127 cells with the Bal 31 deletion
constructs as described in Chapter 3. Transcription from each
168

169
construct was measured by SI nuclease analysis and the expression level
per copy determined. Six polyclonal cell lines of the construct J67 (-
47 bp) were prepared and, although all cell lines contained detectable
copies of the J67 construct as determined by Southern blot analysis,
none of the cell lines initiated human H4 transcription correctly.
An examination of the in vivo protein/DNA interactions within the
proximal promoter region of the human H4 gene (Pauli et al., 1987) had
previously revealed two sites of interaction, Site I (-124 bp to -89
bp) and Site II (-64 bp to -23 bp). We believe that the lack of
correct in vivo transcription initiation from the J67 construct (-47
bp) is the result of the deletion of Site I and the distal half of Site
II. Even though the GGTCC element (-47 bp) and the TATA box (-32 bp)
are still present in the J67 construct, they are apparently
insufficient for site specific transcription initiation in vivo. The
GGTCC element that remains in the J67 construct is probably incapable
of binding its respective protein. Pauli et al. (1987) have
demonstrated that the in vivo factor interaction with the GGTCC element
occurs symmetrically at three G residues on both DNA strands. The J67
deletion disrupts the symmetry of this binding through deletion of the
distal G residue on the bottom strand. Additionally, the
CAAT..2bp..GGTCC motif that is well conserved in many H4 histone genes
(Wells, 1986) is disrupted by the J67 deletion, suggesting that it may
also be important for transcriptional regulation. Our results suggest
that multiple transcription factors are required for H4 transcription
initiation and, in support of this hypothesis, van Wijnen et al. (1987,
1988) have demonstrated specific protein binding regions within Site I

170
and Site II of the F0108 H4 histone gene in vitro. We were able to
demonstrate the necessity for all of the Site II protein/DNA
interactions since correct initiation of transcription was observed
with the construct J56 (-73 bp) that includes all of Site II. In
contrast to the in vitro transcription results of Sierra et al.
(1983), we have demonstrated that sequences between -47 and -73 bp,
included in the construct J56 (-73 bp), are required for H4 histone
transcription initiation in vivo.
The protein/DNA interactions at Site I (-124 bp to -89 bp) were
shown by Pauli et al. (1987) to overlap a putative Spl binding site
(5'-GGGGCGGGGC-3') as described by Briggs et al. (1986). We were
interested to know whether this Spl site was functional and contributed
to the transcriptional regulation of the F0108 human H4 histone gene.
A cell line that contained the Bal 31 deletion construct J50 (-100 bp)
was prepared and assayed by SI nuclease analysis. With this cell line
we demonstrated that the additional sequences between -73 and -100 bp,
included in the construct J50, increased the level of in vivo
transcription at least 10 fold above the construct J56 (-73 bp). Our
result is consistent with interaction of Spl or an Spl-like protein
with this sequence and that this is responsible for the increase in
transcription we have noted. Additionally, we have been able to
demonstrate with genomic sequencing (Church and Gilbert, 1984) that
there is a factor in mouse C127 cells that binds to the Spl recognition
sequence in vivo. although we cannot conclude that it is indeed Spl.
Taken together, our results, and those of Pauli et al. (1987) and van

171
Wijnen et al. (1987, 1988) implicate Spl as a positive transcription
factor in the regulation of this human H4 histone gene.
Because the 5' flanking region of the F0108 H4 histone gene is very-
extensive, we characterized the contribution of more distal 5' flanking
sequences to the transcriptional regulation of this H4 histone gene in
vivo. We first established that when all of Site I and Site II were
present in cell lines that contained the construct K8 (-155 bp) no
further increase in the level of transcription was detected. Extension
of the promoter sequences to -215 bp in the construct pF0108A
demonstrated that in vivo sequences from Site I (-124 bp) to -215 bp
did not influence the level of transcription. These results were
determined from experiments with both polyclonal and monoclonal cell
lines of K8 and pF0108A.
The inclusion of sequences up to -417 bp in the construct pF0005
resulted in a 2-fold increase in the level of transcription above that
demonstrated with the pFOl08A construct cell lines. Previous analysis
of this region by Pauli et al. (1987) had revealed no detectable in
vivo protein/DNA interactions. In order to determine more precisely
the location of the positive transcription element, two deletions of
the pF0005 construct were prepared with Exonuclease III and assayed in
monoclonal cell lines and short term transient expression experiments.
The deletions have been denoted pF0005BSdel2-6 (-285 bp) and
pF0005BSdel2-10 (-335 bp). Our results from the monoclonal cell lines
constructed support the idea that the positive transcription element in
pF0005 is located in the sequences from -215 bp (pF0108A) to -335 bp
(pF0005BSdel 2-10). Comparison of the level of transcription from the

172
pF0005BS construct (-417 bp) and pF0005BSdel2-10 (-335 bp) demonstrated
that the deletion (~ 80 bp) had not affected the level of
transcription. Only a single monoclonal cell line was obtained with
the construct pF0005BSdel2-6 (-285 bp) and the level of transcription
was shown to be lower than pF0005BS. Because of the lack of
appropriate cell lines we were unable to assess the effect of this
deletion on the level of H4 histone gene transcription. Ken Wright of
our laboratory has demonstrated similar transcription results in an in
vitro transcription system with these constructs (personal
communication). Preliminary analysis of the sequences from -215 bp to
-335 bp suggested that secondary structure might be responsible for the
function of this region. There are two possible inverted repeats
within the region that may form stable stem and loop structures.
Stable cell lines and short term transient expression experiments with
the construct pFOOOl (-3.3 kb, internal deletion -586 bp to -215 bp)
also support the contention that the sequences from -417 bp to -215 bp
(pF0005) contain a positive transcription element. In polyclonal and
monoclonal cell lines the pFOOOl construct is expressed at a
significantly lower level than pF0005 and pF0108A. This result was
duplicated in the transient expression experiments described in chapter
3.
We examined even more distal sequences and demonstrated that in
stable monoclonal cell lines and short term transient expression assays
the construct pF0007 (-586 bp) exhibits the same level of expression
as pF0005 (-417 bp). If sequences extending to -1065 bp were included
(pF0002), there was a significant (2-3 fold) decrease in the level of

173
transcription. Based on this observation we proposed that there was a
negative regulatory element between -586 bp and -1065 bp in the histone
H4 promoter. The region was sequenced by the method of Maxam and
Gilbert (1980) in order help to identify any possible sequence elements
that might be responsible for the decrease in transcription. Our
analysis found two candidate sequences, Box 1 (-710 bp, 5'-TCCCCTCTCAG-
3') and Box 2 (-580 bp, 5'-ATTCTCCTGT-3'), with homology to negative
regulatory elements as described by Baniahmad et al. (1987) for the
chicken lysozyme gene. To determine if these elements had any
functionality we constructed two deletions in the 460 bp BamHI/EcoRI
fragment of pF0002 designated pF0002Dl (-920 bp) and pFO002E9 (-730
bp). These constructs were assayed in comparison to pF0002, pF0007,
pF0005, pFOOOl, and pF0108A for expression of the F0108 H4 histone gene
in transiently transfected C127 and Ltk' mouse cells. In both cell
types we demonstrated that the sequences we had proposed based on
similarity were not responsible for the observed negative regulation.
Both Box 1 and Box 2 were included in the construct pF0002E9, which was
the most highly expressed construct of the group. Because pF0002E9 was
expressed at a level approximately 2.5 fold higher than pF0007 we
proposed that there was a positive element located between -586 bp and
-730 bp. The only obvious candidate sequence present in the region was
a CCAAT box located at -718 bp. We cannot conclude that this sequence
is responsible for the increase in the transcriptional level of
pF0002E9; however, it has been well documented that when located in the
proximal promoter region of many genes the CCAAT box functions in the
regulation of transcription in conjunction with other DNA sequences

174
(Dorn et al., 1987; McKnight and Kingsbury, 1982; McKnight et al. 1984;
McKnight and Tjian, 1987).
Our experiments did indicate the existence of a negative regulatory
element when we examined pF0002 (-1065 bp) and pF0002Dl (-920 bp). We
demonstrated that these constructs were expressed at a significantly
lower level in the short term transient assays than pF0002E9 (-730 bp).
We therefore concluded that the negative regulatory element suggested
by previous experiments more likely resided in the sequences between
-730 bp and -920 bp. Dr. Chrysogelos, of our laboratory, identified a
nuclease sensitive region (DNase I and Si) located between -720 bp to
-820 bp that may represent a protein/DNA interaction (Dr. Susan
Chrysogelos, personal communication). The sequence of this region
contains a stretch from -800 bp to -960 bp was very A/T rich (70%).
We found that the region from -580 to -1010 bp contained two
excellent homologies to MARs (matrix attachment regions) as described
by Gasser and Laemmli (1987) and a topoisomerase II site (Sander and
Hsieh, 1985). This topoisomerase II site was confirmed in vitro with
purified enzyme by Dr. Tom Rowe (personal communication). Matrix
attachment sites on the eukaryotic chromosome are thought to function
in the regulation of gene expression through recognition of chromatin
domains and attachment to the nuclear matrix as has been demonstrated
for a number of genes, including Drosophila histone genes (Gasser and
Laemmli, 1987). Since the histone genes of higher eukaryotes are
clustered, it is possible that they may be divided into functional
domains on chromatin loops. Cockerill et al. (1986) demonstrated that
MARs were approximately 200 bp in length and 74% A/T.- They also

175
demonstrated possible binding sites for topoisomerase II as described
by Sander and Hsieh (1985). The upstream region of the F0108 gene from
-800 to -960 is 70% A/T and contains at least one confirmed
topoisomerase II site. This evidence suggests that binding to the
nuclear matrix and DNA topology may function in the regulation of
histone H4 gene expression.
Additionally, we demonstrated that pF0002 and pF0005 were expressed
at nearly the same level in transiently transfected cells where the
DNA was presumably episomal. However, in stable cell lines, pF0005 was
expressed a significantly higher level (- 3 fold) than pF0002. These
results suggest that the state of the DNA, episomal or integrated,
affects the function of certain DNA elements. This is consistent with
our hypothesis that attachment to the nuclear matrix and DNA topology
have a role in the regulation of the F0108 human H4 histone gene.
We have also noted that many of the negative regulatory elements
previously described are located at a considerable distance from the
gene they are associated with and this is consistent with our
»
hypothesis (Baniahmad et al., 1987; Laimins et al., 1986).
Additionally, experiments performed by Dr. Pauli, of our laboratory,
suggested that histone HI, and a 43 kd nuclear acidic protein (non¬
histone) bound specifically to this region (Dr. Urs Pauli, personal
communication). It has been previously suggested that histone HI might
be a general negative regulatory factor for transcription (Weintraub,
1985).
Another possibility that we have considered is that the strings of
poly An and poly Tn may have an unusual secondary structure in the

176
upstream region of the H4 promoter. Although we have not been able to
perform any direct analysis, it seems possible that under certain
circumstances this segment of DNA might assume a "bent" conformation as
described by Koo et al. (1986) and Travers (1987). It has been
elegantly demonstrated in a number of systems, both prokaryotic and
eukaryotic, that DNA can bend intrinsically if the necessary bases are
present or can bend in response to the interaction of a protein (Salvo
and Grindley, 1987; Koo et al., 1986). Bending of DNA requires that
there be proper spacing between the AA dinucleotide pairs and poly A
tracts. This spacing corresponds to approximately 10 bp, or a single
turn of the helix (Koo et al., 1986). Several of the poly An tracts in
the upstream region of the H4 gene from -945 bp to -880 bp appear
appropriately spaced. This evidence suggests that the upstream region
of the H4 promoter has unusual structure and might be responsible for
the negative regulation we demonstrated.
We had previously implicated an additional positive regulatory
element in the distal region of the H4 promoter. Preliminary
polyclonal cell line experiments suggested that the pF0ll6 fragment
(-6.0 to -7.5 kb) of A HHG41 was able to enhance the level of
transcription several fold. Helms et al. (1987) had shown that this
fragment could stimulate CAT gene expression 4-5 times in HeLa cells
when located at the 3' end of the gene. Their experiments suggested
that the element might have the properties of enhancer. We examined
this possibility further through the construction of a number of
variant enhancer constructs. We made pF0004, pF0004R, and pF0006 as
described in chapter 3 to test the hypothesis that this element had the

177
distance and orientation independent properties of an enhancer element.
We examined a number of monoclonal cell lines prepared with each
construct and established that the pF0116 fragment did not conclusively
enhance the level of expression of the H4 gene in mouse C127 cells
above that found with pF0108A or pF0108X. The construct pF0004 was
highly expressed in a number of cell lines; however, this was
apparently the result of high copy number and not enhancement of
expression. The region was sequenced by Ken Wright and Dr. Urs Pauli
and they found that the pF0116 fragment exhibited three sequences in
the 500 bp EcoRI (-6.0 kb)/XbaI (-6.5 kb) section with strong
similarity to the consensus core sequence of the SV40 and Ig heavy
chain enhancers (Maniatis et al., 1987; Khoury and Gruss, 1983). We
can only speculate that the lack of enhancer activity in mouse C127
cells, a fibroblast cell line, is due to the presence of negative
regulatory factors or the absence of positive factors required for
activity. Consistent with this idea, Wasylyk and Wasylyk (1986)
demonstrated that the Ig heavy chain enhancer was negatively regulated
in fibroblasts, but transcription could be stimulated in these cells if
certain sequences were deleted. Finer analysis of the pF0ll6 fragment
in different cell types should reveal if this element is regulated in
such a manner.
Our studies of the pF0004 construct allowed us to associate
repetitive sequences with higher copy number of the monoclonal cell
lines and with specific integration. Most of our constructs integrated
via the pathway described by Perucho et al. (1980). There was a
cointegrate stage followed by integration at a limited number of sites

178
in the cellular chromatin. We found that minor repeated sequences,
with some homology to the Alu repeat (Collart et al., 1985), located
in the distal 5' flanking of pF0003 were responsible for the higher
copy number in these cell lines. The pF0003 constructs had a
considerable amount of tandem integration that also suggested that the
minor repeats did not perturb the integration pathway. pF0004 was
studied in more detail, and we concluded that the high copy number and
heterogeneous integration observed was due to specific integration via
the Alu repeat located in the pF0116 fragment (~ -7.0 kb). It has been
previously demonstrated that the human histone genes are interspersed
with various repeated sequences and often flanked by Alu repeats
(Collart et al., 1985). Perhaps this unusual sequence organization
accounts for the clustered but random organizational pattern of this
family of genes.
When we examined the expression of the human H4 histone gene in the
heterologous C127 cells we found that only a limited number of copies
were expressed. In addition, we found that as copy number of the human
H4 gene increased, the expression of the mouse H4 gene decreased. This
observation has been made previously by Capasso and Heintz (1985) in
which they found that in a cell line with a high copy number of the
human H4 gene, pHuH4 (120 copies), the endogenous mouse H4 genes were
completely shut off. Our results are similar and suggested competition
for transcription factors. However, when the human H4 gene was present
in very high copy number (cell lines pF0004ml, - 250 copies and
pF0003ml, - 139 copies) neither the mouse nor human H4 genes were
expressed to any significant extent. We feel that it is likely that

179
the regulatory molecules necessary for transcriptional control are
limited, and when spread among a large number of transcription units,
none of the units has a full complement. During the course of our
studies we have demonstrated that the endogenous mouse H4 and
transfected human H4 histone genes are in direct competition for a
limited transcription factor. Genomic sequencing experiments described
in chapter 4 demonstrated that we could detect binding ¿n vivo of a
protein to the Spl site (-100 bp) located in Site I. We were never
able to demonstrate in vivo binding to Site II although the existence
of the factors in mouse cells has been demonstrated in vitro by André
van Wijnen (personal communication). The genomic sequencing
experiments that we have described also demonstrated that the binding
to the Spl site was titratable with increased copy number of the pF0003
construct. Binding was detected in cell lines pF0003M5 (— 15 copies)
and pF0003M6 (- 25 copies) but not in pF0003Ml (- 140 copies). This
suggested that the interaction at the Spl site was titratable even
though Spl is known to be an abundant transcription factor (Dynan and
Tjian, 1985). Perhaps the binding of Spl to this sequence is dependent
on the interaction with adjacent histone specific transcription factors
that we have been unable to detect with genomic sequencing. Our
inability to detect the protein/DNA ineractions at Site I in the mouse
cell lines may simply reflect minor differences in analogous binding
proteins between the mouse and human cells. These experiments support
the contention that the H4 histone genes in the mouse cell lines
directly competed for a limiting transcription factor or factors that
function in the regulation of H4 histone gene expression in vivo.

180
In conclusion, our studies have described the functional role of
transcription factor interactions seen at both Site I and Site II.
Site II was required for initiation of transcription and Site I
augmented the level of transcription in a positive manner. We
concluded that in mouse C127 cells, an enhancer-like element in the far
upstream region of the H4 promoter was not active. The possibility of
a negative regulatory element was investigated and our results suggest
that the sequences upstream of -730 bp are responsible. The sequences
from -800 to -960 bp were shown to be 70% A/T and contain putative
nuclear matrix attachment and topoisomerase II sites. The results of
our studies suggest that the promoter of the F0108 H4 histone gene, as
defined in vivo. may be more extensive than previously thought. Further
deletion analysis and investigation will describe the specific
sequences responsible for the transcriptional regulation of this gene
in vivo.

APPENDIX A
SAMPLE COPY NUMBER CALCULATION
To determine the copy number of each monoclonal cell line the human
H4 gene signal, mouse 18S ribosomal signal, and plasmid DNA standards
were subject to densitometric analysis as described in Chapter II. Once
completed, all the copy number blots were compared to each other
visually and on each blot of equivalent length exposure an 18S
ribosomal band was as the standard for that experiment. This decision
involved comparison of many films and the photographs of the gels prior
to transfer. Every effort was made to ensure that equivalent standards
were picked from the different experiments.
An example calculation is given below for the cell line pF0108Am2.
The densitometric values determined are listed below for each variable:
Ribosomal Standard (Rstd) = 6309 densitometry units (DU).
pF0108A Ribosomal value (SRstd) = 5891 DU.
pF0108A human value (HV) = 5138 DU.
10 pg (1.3 copies/diploid genome) control = 820 DU = 630 DU/copy.
50 pg (6.5 copies/diploid genome) control = 1923 DU = 295 DU/copy.
50 pg (13 copies/diploid genome) control = 3938 DU = 302 DU/copy.
pF0108Am2 copy number = Rstd x HV = 6309 x 5138 = 19
SRstd 5891
plasmid control 295
181

APPENDIX B
SAMPLE CALCULATION OF HUMAN H4 EXPRESSION
This example serves to illustrate how the mouse H4 internal control
and the plasmid DNA markers were used to calculate the level of human
H4 expression. The example presented here is for the cell line
pF0005m6. Pertinent numbers are listed and then the calculation is
done. Because of the differences in the intensities of SI protected
fragments the mouse and human H4 values had to be determined from
different length exposures.
Human H4 densitometry value (17 day exposure) = 2840 DU.
Mouse H4 densitometry value (16 hour exposure) = 1397 DU.
pBR322/HpaII marker band #1 (16 hour exposure) = 1701 DU.
pBR322/HpaII marker band #1, 1:4 dilution (17 day exposure) = 5510 DU.
Calculation:
1) 5510 x 4 = 20040 units.
2) 20040 / 1701 = 12.95 (the fold difference from 16 hours to 17 days
exposure).
3) 2840 / [1397 x 12.95] = 0.16 = human/mouse expression ratio.
182

APPENDIX C
TABLE OF CONSTRUCTS
Construct
5'seauence (bp)
Vector
Comments
J67
-47
pBR322
Bal 31 deletion of pF0108A
J56
-73
pBR322
Bal 31 deletion of pF0108A
J50
-100
pBR322
Bal 31 deletion of pFO108A
K8
-155
pBR322
Bal 31 deletion of pFOl08A
L14
-185
pBR322
Bal 31 deletion of pFOl08A
pF0108A
-215
pBR322
3' site = HindiII (+1877)
pF0108X
-215
pUC19
3' site = Xbal (+1107)
pF0005
-417
pUC13
3' site = PstI (+1677)
pF0007
-586
pUC19
3' site = Xbal
pF0002E9
-730
pUC19
3' site = Xbal
pF0002Dl
-920
pUC19
3' site = PstI
pF0002
-1065
pUC8
3' site = PstI
pFOOOl
-215/-586 to -3300
pBR322
Internal deletion of pF0919
pF0003
-6500
pUC13
3' site = Xbal
pF0004
-215 + pF0116
pUC8
same orientation as genomic
pF0004R
-215 + pF0116
pUC8
opposite orientation
pF0006
-215 + 500 bp
pUC19
same orientation as genomic
EcoRI/Xbal fragment
from pF0116
pF0005BS
-417
Bluescript M13+
pF0005BSdel2-10
-335
Bluescript M13+
Exonuclease III
deletion
pF0005BSdel2-6
-285
Bluescript M13+
Exonuclease III
deletion
183

REFERENCES
Artishevsky, A., Wooden. S., Sharma, A., Resendez, Jr., E., Lee, A.
1987. Cell-cycle regulatory sequences in a hamster histone
promoter and their interactions with cellular factors. Nature.
328: 823-827.
Bacheler, L. T., Smith, K. D. 1976. Transcription of isolated mouse
liver chromatin. Biochemistry. 15: 3281-3290.
Banerji, J., Olson, L, Schaffner, W. 1983. A lymphocyte enhancer is
located downstream of the joining region in the immunoglobulin
heavy chain genes. Cell. 33: 729-740.
Banerji, J., Rusconi, S., Schaffner, W. 1981. Expression of a ¡3-
globin gene is enhanced by remote SV40 DNA sequences. Cell. 27:
299-308.
Baniahmad, A., Muller, M., Steiner, Ch., Renkawitz, R. 1987. Activity
of two different silencer elements of the chicken lysozyme gene can
be compensated by enhancer elements. EMBO J. 6: 2297-2303.
Baumbach, L., Marashi, F., Plumb, M., Stein, G., Stein, J. 1984.
Inhibition of DNA replication coordinately reduces cellular levels
of core and Hi histone mRNAs: requirement for protein synthesis.
Biochemistry. 23: 1618-1625.
Baumbach, L., Stein, G., Stein, J. 1987. Regulation of human histone
gene expression: the contributions of transcriptional and post-
transcriptional control to the coupling of histone mRNA stability
with DNA replication. Biochemistry. 26: 6178-6187.
Bekhor, I., Rung, G. M., Bonner J. 1969. Sequence-specific
interactions of DNA and chromosomal proteins. J. Mol. Biol. 39:
351-64.
Bendig, M. M., Hentschel, C. C. 1983. Transcription of sea urchin
histone genes in HeLa cells. Nucl. Acids Res. 11: 2337-2346.
Bendig, M. M., Thomas, T., Folk, W. R. 1980. Regulatory mutants of
polyoma virus defective in DNA replication and the synthesis of
early proteins. Cell. 20: 401-409.
Benech, P., Mory, Y., Revel, M., Chebath, J. 1985. Structure of two
forms of the interferon-induced (2'-5')oligo A synthetase of human
cells based on cDNAs and gene sequences. EMBO J. 4: 2249-2256.
184

185
Benoist, C., Chambón, P. 1980. Deletions covering the putative
promoter region of early mRNAs of simian virus 40 do not abolish T
antigen expression. Proc. Natl. Acad. Sci. USA. 77: 3865-3869.
Berk, A. J., Sharp, P. A. 1977. Sizing and mapping of early
adenovirus mRNAs by gel electrophoresis of SI endonuclease digested
hybrids. Cell. 12: 721-732.
Berk, A. J., Sharp, P. A. 1978. Spliced early mRNAS of simian virus
40. Proc. Natl. Acad. Sci. USA. 75: 1274-1278.
Bienz, M., Pelham, H. R. B. 1986. Heat shock regulatory elements
function as an inducible enhancer in the xenopus hsp 70 gene and
when linked to a heterologous promoter. Cell. 45: 753-760.
Bienz-Tadmor, B., Zakut-Houri, R., Libresco, S., Givol, D., Oren, M.
1985. The 5' region of the p53 gene: evolutionary conservation
and evidence for a negative regulatory element. EMBO J. 4: 3209-
3213.
Birkenmeier, E. H., Brown, D. D., Jordan, E. 1978. A nuclear extract
of Xenopus laevis oocytes that accurately transcribes 5S RNA genes.
Cell. 15: 1077-1086.
Bloch, D. P., Macquigg, R. A., Brack, S. D., Wu, J-R. 1967. The
synthesis of deoxyribonucleic acid and histone in the onion root
meristem. J. Cell. Biol. 33: 451-466.
Borun, T. W., Scharff, M. D., Robbins, E. 1967. Rapidly labeled,
polyribosome-associated RNA having the properties of histone
messenger. Proc. Natl. Acad. Sci. USA. 58: 1977-1983.
Bourgeois, S., Cohn, M., Orgel, L. E. 1965. Suppression of and
complementation among mutants of the regulatory gene of the lactose
operon of Escherichia coli. J. Mol. Biol. 14: 300-302.
Breathnach, R., Chambón, P. 1981. Organization and expression of
eukaryotic split genes coding for proteins. Ann. Rev. Biochem.
50: 349-383.
Briggs, M., Kadonaga, J., Bell, S., Tjian, R. 1986. Purification and
biochemical characterization of the promoter-specific transcription
factor, Spl. Science. 234: 47-52.
Busslinger, M. Portmann, M., Irminger, J., Birnstiel, M. 1980.
Ubiquitous and gene-specific regulatory 5' sequences in sea urchin
histone DNA clone coding for histone protein variants. Nucl. Acids
Res. 8: 957-977.
Butler, W. B., Mueller, G. C. 1973. Control of histone synthesis in
HeLa cells. Biochem. Biophys. Acta 294: 481-496.

186
Capasso, 0. , Heintz, N. 1985. Regulated expression of mammalian
histone H4 genes in vivo requires a trans-acting transcription
factor. Proc. Natl. Acad. Sci. USA. 82: 5622-5626.
Carozzi, N., Marashi, F., Plumb, M. , Zimmerman, S., Zimmerman, A.,
Wells, J. R. E., Stein, G., Stein, J. 1984. Clustering of human
HI and core human histone genes. Science 224: 1115-1117.
Casey, J. L., Di Jeso, B., Rao, K. K., Rouault, T. A., Klausner, R. D.,
Harford, J. B. 1988. Deletional analysis of the promoter region
of the human transferrin receptor gene. Nucl. Acids Res. 16: 629-
646.
Cedar, H., Felsenfeld, G. 1973. Transcription of chromatin in vitro.
J. Mol. Biol. 77:237-254.
Chambón, P. 1975. Eukaryotic nuclear RNA polymerases. Ann. Rev.
Biochem. 44: 613-638.
Chrysogelos, S., Riley, D. E. Stein, G., Stein, J. 1985. A human
histone H4 gene exhibits cell cycle dependent changes in chromatin
structure correlating with its expression. Proc. Natl. Acad. Sci.
USA. 82: 7535-7539.
Church, G., Ephrussi, A., Gilbert, W., Tonegawa, S. 1985. Cell-type-
specific contacts to immunoglobulin enhancers in nuclei. Nature.
313: 798-801.
Church, G., Gilbert, W. 1984. Genomic Sequencing. Proc. Natl. Acad.
Sci. USA. 81: 1991-1995.
Clark, S. J., Kreig, P. A., Wells, J. R. E. 1981. Isolation of a
clone containing human histone genes. Nucl. Acids Res. 9: 1583-
1590.
Cockerill, P. N., Garrard, W. T. 1986. Chromosomal loop anchorage of
the kappa immunoglobulin gene occurs next to the enhancer in a
region containing topoisomerase II sites. Cell. 44: 273-282.
Collart, D., Stein, G. S., Stein, J. 1985. A series of repetitive DNA
sequences are associated with human core and HI histone genes.
Mol. Cell. Biochem. 67: 161-170.
Concino, M., Lee, R. F., Merryweather, J. P., and Weinmann, R. 1984.
The adenovirus major late promoter TATA box and initiation site are
both necessary for transcription in vitro. Nuc. Acids Res. 12:7423-
7433.
Contreras, R. and Fiers, W. 1981. Initiation of transcription in
permeable, SV40-infected or noninfected CV1 cells: evidence for
multiple promoters of SV40 late transcription. Nuc. Acids Res.
9:215-236.

Corden, J., Wasylyk, B., Buchwalder, A., Sassone-Corsi, P., Kedinger,
C., Chambón, P. 1980. Promoter sequences of eukaryotic protein¬
coding genes. Science. 209: 1406-1414.
Dahmus, M. E., and Bonner J. 1965. Increased template activity of
liver chromatin, a result of hydrocortisone administration. Proc.
Natl. Acad. Sci. USA. 54: 1298-1302.
Dailey, L., Hanley, S. M., Roeder, R. G., Heintz, N. 1986. Distinct
transcriptional factors bind specifically to two regions of the
human histone H4 promoter. Proc. Natl. Acad. Sci. USA. 83: 7241-
7245.
Davidson, I., Fromental, C., Augereau, P., Wildeman, A., Zenke, M.,
Chambón, P. 1986. Cell-type specific protein binding to the
enhancer of simian virus 40 in nuclear extracts. Nature. 323:
544-548.
Demerac, M. 1956. A comparative study of certain loci in Salmonella,
Cold Sprg. Harb. Symp. Quant. Biol. 21: 113-120.
Dorn, A., Bollekens, J., Staub, A., Benoist, C., Mathis, D. 1987. A
multiplicity of CCAAT box-binding proteins. Cell. 50: 863-872.
Dynan, W. S., Sazer, S., Tjian, R. Schimke, R. T. 1986. The
transcription factor Spl recognizes a DNA sequence in mouse
dihydrofolate reductase promoter. Nature. 319: 246-248.
Dynan, W. S., Tjian, R., 1983a. Isolation of transcription factors
that discriminate between different promoters recognized by RNA
polymerase II. Cell. 32: 669-680.
Dynan, W. S., Tjian, R. 1983b. The promoter-specific transcription
factor Spl binds to upstream sequences in the SV40 early promoter.
Cell. 35: 79-87.
Dynan, W. S., Tjian, R. 1985. Control of eukaryotic messenger RNA
synthesis by sequence-specific DNA binding proteins. Nature. 316
774-778.
Efstratiadis, A., Posakony, J., Maniatis, T., Lawn, R., O'Connell, C.,
Spiritz, R., DeRiel, J., Forget, B., Weissman, S., Slightom, J.,
Blechl, A., Smithies, 0., Baralle, R., Shoulders, C., Proudfoot, N
1980. The structure and evolution of the human /9-globin gene
family. Cell. 21: 653-668.
Emmer, M., de Crombrugghe, B., Pastan, I., and Perlman, R. 1970.
Cyclic AMP receptor protein of E. coli: Its role in the synthesis
of inducible enzymes. Proc. Natl. Acad. Sci. USA. 66: 480-487.

188
Evans, T., DeChiara, T., Efstratiadis, A. 1988. A promoter of the rat
insulin-like growth factor II gene consists of minimal control
elements. J. Mol. Biol. 199: 61-81.
Farnham, P. J., Schimke, R. T. 1985. Transcriptional regulation of
mouse dihydrofolate reductase in the cell cycle. J. Biol. Chem.
260: 7675-7680.
Feinberg, A., Vogelstein, B. 1983. A technique for radiolabelling DNA
restriction endonuclease fragments to high specific activity. Anal.
Biochem. 132: 6-13.
Fey, G., Lewis, J. B., Grodzicker, T. Bothwell, A. 1979.
Characterization of a fused protein specified by the adenovirus 2-
simian virus 40 hybrid Ad2+NDldp2. J. Virol. 30: 201-217.
Folger, K. R., Wong, E. A., Wahl, G., Capecchi, M. R. 1982. Patterns
of integration of DNA microinjected in cultured mammalian cells:
evidence for homologous recombination between injected plasmid DNA
molecules. Mol. Cell. Biol. 2: 1372-1387.
Fowlkes, D. M., Shenk, T. 1980 Transcriptional control regions of the
adenovirus VAI RNA gene. Cell. 22: 405-413.
Fromm, M., Berg, P. 1982. Deletion mapping of DNA regions required
for SV40 early region promoter function in vivo. J. Mol. Appl.
Genet. 1: 457-481.
Garel, A., Axel, R. 1976. Selective digestion of transcriptionally
active ovalbumin genes from oviduct nuclei. Proc. Natl. Acad. Sci.
USA. 73: 3966-70.
Gasser, S. M., Laemmli, U. K. 1987. A glimpse at chromosomal order.
Trends Genet. 3: 16-22.
Gaub, M., Dierich, A., Astinotti, D., Touitou, I., Chambón, P. 1987.
The chicken ovalbumin promoter is under negative control which is
relieved by steroid hormones. EMBO J. 6: 2313-2320.
Gilbert, W., Müller-Hill, B. 1966. Isolation of the lac repressor.
Proc. Natl. Acad. Sci. USA. 56: 1891-1898.
Gillies, S. D., Morrison, S. L., Oi, V. T., Tonegawa, S. 1983. A
tissue specific enhancer element is located in the major intron of
a rearranged immunoglobulin heavy chain gene. Cell. 33: 717-728.
Gilmour, R. S., Paul, J. 1970. Role of non-histone components in
determining organ specificity of rabbit chromatins. FEBS Lett. 9:
242-44.

189
Gilmour, R. S., Paul J. 1969. RNA transcribed from reconstituted
nuclear protein is similar to natural RNA. J. Mol. Biol. 40: 137-
39.
Gluzman, Y., Sambrook, J. F., Frisque, R. J. 1980. Expression of
early genes of origin-defective mutants of SV40. Proc. Natl. Acad.
Sci. USA. 77: 3898-3902.
Goodbourn, S., Burstein, H., Maniatis, T. 1986. The human p-
interferon gene enhancer is under negative control. Cell. 45:
601-610.
Gorman, C. M., Moffat, L. F., Howard, B. H. 1982. Recombinant genomes
which express chloramphenicol acetyltransferase in mammalian cells.
Mol. Cell. Biol. 2: 1044-1051
Gorman, C. M., Rigby, P. W., Lane, D. P. 1985. Negative regulation of
viral enhancers in undifferentiated embryonic stem cells. Cell.
42: 519-526.
Gottschling, D. E., Cech, T. R., 1984. Chromatin structure of the
molecular ends of Oxytricha macronuclear DNA: phased nucleosomes
and a telomeric complex. Cell. 38: 501-510.
Graham, F., van der Eb, A. 1973. A new technique for the assay of
infectivity of adenovirus 5 DNA. Virol. 52: 456-457.
Graves, B. J., Johnson, P. F., McKnight, S. L. 1986. Homologous
recognition of a promoter domain common to the MSV LTR and the HSV
tk gene. Cell. 44: 565-576.
Green, L., Van Antwerpen, R., Stein, J., Stein, G., Triputti, P.,
Emanuel, B., Selden, J., Croce, C. 1984. A major human histone
gene cluster on the long arm of chromosome 1. Science. 226: 838-
840.
Green, L., Schlaffer, I., Wright, K., Moreno, J. L., Berand, D., Hager,
G., Stein, J., Stein, G. 1986. Cell cycle dependent expression of
a stable episomal human histone gene is a mouse cell. Proc. Natl.
Acad. Sci. USA. 83: 2315-2319.
Grosschedl, R., Birnstiel, M. 1980a. Spacer DNA sequences upstream of
the TATAAATA sequence are essential for promotion of H2A histone
gene transcription. Proc. Natl. Acad. Sci. USA. 7102-7106.
Grosschedl, R., Birnstiel, M. L. 1980b. Identification of regulatory
sequences in the prelude sequences of an H2A histone gene by the
study of specific deletion mutants in vivo. Proc. Natl. Acad. Sci.
USA. 77: 1432-1436.
Hanahan, D. 1983. Studies on transformation of Escherichia coli with
plasmids. J. Mol. Biol. 166: 557-580.

190
Hanley, S. M., Bleecker, G. C., Heintz, N. 1985. Identification of
promoter elements necessary for transcriptional regulation of a
human histone H4 gene in vitro. Mol. Cell. Biol. 5: 380-389.
Harvey, R. P., Robins, A. J., and Wells, J. R. E. 1982. Independently
evolving chicken histone H2b genes: identification of a ubiquitous
H2b-specific 5' element. Nuc. Acids Res. 10:7851-7863.
Heintz, N., Zernik, M., Roeder, R. G. 1981. The structure of the
human histone genes: clustered but not tandemly repeated. Cell.
24: 661-668.
Heintz, N., Sive, H. L., Roeder, R. G. 1983. Regulation of human
histone gene expression: Kinetics of accumulation and changes in
the rate of synthesis and in the half-lives of individual histone
mRNAs during the HeLa cell cycle. Mol. Cell. Biol. 3: 539-550.
Heintz, N., Roeder, R. G. 1984. Transcription of human histone genes
in extracts from synchronized HeLa cells. Proc. Natl. Acad. Sci.
USA. 81: 1713-1717.
Helms, S. R., van Wijnen, A. J., Kroeger, P., Shiels, A., Stewart, C.,
Stein, J. L., Stein, G. S. 1987. Identification of an enhancer¬
like element upstream from a cell cycle dependent human H4 histone
gene. J. Cell. Phys. 132: 552-558.
Hentschel, C., Birnstiel, M. L. 1981. The organization and expression
of histone gene families. Cell. 225: 301-313.
Hope, I. A., Struhl, K. 1986. Functional dissection of a eukaryotic
transcriptional activator protein, GCN4 of yeast. Cell. 46: 885-
894.
Hu, S-L., Manley, J. 1981. DNA sequence required for initiation of
transcription in vitro from the major promotor of adenovirus-2.
Proc. Natl. Acad. Sci. USA. 78: 820-824.
Huang, R. C. C., Bonner, J. 1962. Histone, a suppressor of
chromosomal RNA synthesis Proc. Natl. Acad. Sci. USA. 48: 1216-
22.
Isenberg, I. 1979. Histones. Ann. Rev. Biochem. 48: 159-191.
Ish-Horowicz, D., Burke, D. F. 1981. Rapid and efficient cosmid
cloning. Nuc. Acids Res. 9: 2989-2998.
Jacob, F., Monod, J. 1961. Genetic regulatory mechanisms in the
synthesis of proteins. J. Mol. Biol. 3: 318-356.
Johnson, A. W., Hnilica, L. S. 1970. In vitro RNA synthesis and
nuclear proteins of isolated sea urchin embryo nuclei. Biochim.
Biophys. Acta. 224: 518-30.

191
Jones, K. A., Yamamoto, K. R., Tjian, R. 1985. Two distinct
transcription factors bind to the HSV thymidine kinase promoter in
vitro. Cell. 42: 559-572.
Jones, K., Kadonaga, J., Rosenfeld, P., Kelly, T., Tjian, R. 1987. A
cellular DNA-binding protein that activates eukaryotic
transcription and DNA replication. Cell. 48: 79-89.
Kadesh, T., Zervos, P., Ruezinsky, D. 1986. Functional analysis of
the murine IgH enhancer: evidence for negative control of cell-
type specificity. Nucl. Acids Res. 14: 8209-8221.
Kakidani, H., Ptashne, M. 1988. GAL4 activates gene expression in
mammalian cells. Cell. 52: 161-167.
Kedinger, C., Gniazdowski, M., Mandel, Jr., J. L., Gissinger, F.,
Chambón, P. 1970. a-amantin: a specific inhibitor of one of two
DNA-dependent RNA polymerase activities from calf thymus. Biochem.
Biophys. Res. Comm. 38: 165-171.
Khoury, G., Martin, M. A., Lee, T. N. H., Danna, K. J. Nathans, D.
1973. A map of SV40 transcription sites expressed in productively
infected cells, J. Mol. Biol. 78: 377-389.
Khoury, G., Gruss, P. 1983. Enhancer elements. Cell. 33:313-314.
King. P. V. , Blakesley, R. W., 1986. Optimizing DNA ligations for
transformation. Focus. 8:1-3.
Klein, S., Gerster, T., Picard, D., Radbruch, A., Schaffner, W. 1986.
Evidence for transient requirement of the IgH enhancer. Nucl.
Acids Res. 13: 8901-8912.
Kleinsmith, L., J. Stein, J., Stein, G. 1976. Dephosphorylation of
nonhistone proteins specifically alters the pattern of gene
transcription in reconstituted chromatin, Proc. Natl. Acad. Sci.
USA. 73: 1174-78
Koo, H., Wu, H., Crothers, D. M. 1986. DNA bending at adenine-thymine
tracts. Nature. 320: 501-506.
Kroeger, P., Stewart, C., Schaap, T., van Wijnen, A., Hirshman, J.,
Helms, S., Stein, G., Stein, J. 1987. Proximal and distal
regulatory elements that influence in vivo expression of a cell
cycle-dependent human H4 histone gene. Proc. Natl. Acad. Sci. USA.
84:3982-3986.
Laimins, L., Holmgren-Konig, M., Khoury, G. 1986. Transcriptional
"silencer" element in rat repetitive sequences associated with the
rat insulin 1 gene locus. Proc. Natl. Acad. Sci. USA. 83: 3151-
3155.

192
Larsen, P. R., Harney, J. W., Moore, D. D. 1986. Repression mediates
cell-type-specific expression of the rat growth hormone gene.
Proc. Natl. Acad. Sci. USA. 83: 8283-8287.
Lichtler, A. C., Sierra, F., Clark, S., Wells, J. R. E., Stein, G. S.,
Stein J. L. 1982. The multiple H4 histone mRNAs of HeLa cells are
encoded in different genes. Nature. 298: 195-198.
Lin, F-L., Sternberg, N. 1984. Homologous recombination between
overlapping thymidine kinase gene fragments stably inserted into a
mouse cell genome. Mol. Cell. Biol. 4: 853-861.
Lindberg, U., Persson, T., Philipson, L. 1972. Isolation and
characterization of adenovirus mRNA in productive infection. J.
Virol. 10: 909-919.
Linxweiler, W., Horz, W. 1985. Reconstitution experiments show that
sequence specific histone-DNA interactions are the basis for the
nucleosome phasing on mouse satellite DNA. Cell. 42:281-290.
Loyter, A., Scangos, G. A., Ruddle, F. H. 1982. Mechanisms of DNA
uptake by mammalian cells: Fate of exogenously added DNA monitored
by the use of fluorescent dyes. Proc. Natl. Acad. Sci. USA. 79:
422-426.
Mandel, J. L., Chambón, P. 1970. Animal DNA-dependent RNA
polymerases. Analysis of the RNAs synthesized on Simian Virus 40
supercoiled DNA by mammalian RNA polymerases AI and B. Eur. J.
Biochem. 41: 379-95.
Maniatis, R. Fritsch, E. F., Sambrook, J. 1982. In Molecular cloning.
Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
Maniatis, T., Goodbourn, S., Fischer, J. 1987. Regulation of
inducible and tissue-specific gene expression. Science. 236:
1237-1245.
Manley, J. L., Fire, A., Cano, A., Sharp, P. A., Gefter, M. L. 1980.
DNA-dependent transcription of adenovirus genes in a soluble whole-
cell extract. Proc. Natl. Acad. Aci. USA. 77: 3855-3859.
Marashi, F., Helms, S., Shiels, A., Silverstein, S., Greenspan, D.,
Stein, G., Stein, J. 1986. Enhancer-facilitated expression of
prokaryotic and eukaryotic genes using human histone gene 5'
regulatory sequences. Biochem. Cell. Biol. 64: 277-289.
Maxam, A. M., Gilbert, W. 1980. Sequencing end-labelled DNA with base
specific chemical cleavages. Meth. Enzymol. 65: 499-560.
Maxson, R., Cohn, R., Kedes, L., Mohun, T. 1983. Expression and
organization of histone genes. Annu. Rev. Biochem. 17: 239-277.

193
McKnight, S. L., Kingsbury, R. 1982. Transcriptional control signals
of a eukaryotic protein-coding gene. Science. 217: 316-324.
McKnight, S., Tjian, R. 1986. Transcriptional selectivity of viral
genes in mammalian cells. Cell. 46: 795-805.
McKnight, S. L., Kingsbury, R. C., Spence, A., Smith, M. 1984. The
distal transcription signals of the herpesvirus tk gene share a
common hexanucleotide control sequence. Cell. 37: 253-262.
Melton, D. W., McEwan, C., McKie, A. B., Reid, A. M. 1986. Expression
of the mouse HPRT gene: deletional analysis of the promoter region
of an X-chromosome linked house-keeping gene. Cell. 44: 319-328.
Mitchell, P. J., Wang, C., Tjian, R. 1987. Positive and negative
regulation of transcription in vitro: Enhancer-binding protein AP-
2 is inhibited by SV40 T antigen. Cell. 50: 847-861.
Modrich, P., Anraku, Y., Lehman, I. R. 1973. Deoxyribonucleic acid
ligase: Isolation and physical characterization of the homogeneous
enzyme from Escherichia coli. J. Biol. Chem. 248: 7495-7501.
Moorman, A. F. M., deLaaf, R. T. M., Destree, 0. H. J., Telford, J.,
Birnstiel, M. L. 1980. Histone genes from Xenopus laevis:
molecular cloning and initial characterization. Gene. 10: 185-
193.
Moreno, J. L., Chrysogelos, S. A., Stein, G. S., Stein, J. L. 1986.
Reversible changes in the nucleosomal organization of a human H4
histone gene during the cell cycle. Biochemistry. 25: 5364-5370.
Muglia, L., Rothman-Denes, L. 1986. Cell type-specific negative
regulatory element in the control region of the rat alpha-
fetoprotein gene. Proc. Natl. Acad. Sci. USA. 83: 7653-7657.
Myers, R. M., Tilly, K., Maniatis, T. 1986. Fine structure genetic
analysis of a /3-globin promoter. Science. 232: 613-618.
Nasmyth, K. 1985. A repetitive DNA sequence that confers cell-cycle
START (CDC-28)-dependent transcription of the HO gene in yeast.
Cell. 42: 225-235.
Nathans, D., Smith, H. 1975. Restriction endonucleases in the
analysis and restructuring of DNA molecules. Ann. Rev. Biochem.
44: 273-293.
Ng, S. Y., Parker, C. S., Roeder, R. G. 1979. Transcription of cloned
Xenopus 5S RNA genes by X¡_ laevis RNA polymerase III in
reconstituted systems. Proc. Natl. Acad. Sci. USA. 76: 136-140.

194
Nir., U., Walker, M. D., Rutter, W. J. 1986. Regulation of rat
insulin 1 gene expression: evidence for negative regulation in
nonpancreatic cells. Proc. Natl. Acad. Sci. USA. 83: 3180-3184.
Park, W. D., Stein, J. L., Stein, G. S. 1976. Activation of in vitro
histone gene transcription from HeLa S3 chromatin by s-phase
nonhistone chromosomal proteins. Biochemistry 15: 3297-3300.
Paul, J., Gilmour, R. S. 1966. Template activity of DNA is restricted
in chromatin. J. Mol. Biol. 16: 242-44.
Paul, J., Gilmour, R. S. 1968. Organ-specific restriction of
transcription in mammalian chromatin. J. Mol. Biol. 34: 305-16.
Pauli, U., Chrysogelos, S., Stein, G., Stein, J., Nick, H. 1987.
Protein-DNA interactions in vivo upstream of a cell cycle-regulated
human H4 histone gene. Science. 236: 1308-1311.
Perucho, M., Hanahan, D., Wigler, M. 1980. Genetic and physical
linkage of exogenous sequences in transformed cells. Cell 22: 309-
317.
Perucho, M., Wigler, M. 1981. Linkage and expression of foreign DNA
in cultured animal cells. Cold Spring Harbor Symp. Quant. Biol. 45:
829-838.
Picard, D., Schaffner, W. 1984. A lymphocyte-specific enhancer in the
mouse immunoglobulin kappa gene. Nature. 307: 80-82.
Plumb, M. A., Stein, J. L., Stein, G. 1983a. Influence of DNA
synthesis inhibition on the coordinate expression of core human
histone genes during S phase. Nucl. Acids Res. 11: 7927-7945.
Plumb, M., Stein, J., Stein, G. 1983b. Coordinate regulation of
multiple histone mRNAs during the cell cycle in HeLa cells. Nucl.
Acids Res. 11: 2391-2410.
Prescott, D. M. 1966. The synthesis of total macronuclear protein,
histone and DNA during the cell cycle in Euplotes erystomus. J.
Cell. Bio. 31: 1-9.
Pribnow, D. 1975. Bacteriophage T7 early promoters: nucleotide
sequences of two RNA polymerase binding sites. J. Mol. Biol. 99:
419-443.
Ptashne, M. 1986. Gene regulation by proteins acting nearby and at a
distance. Nature. 322: 697-701.
Pulm, W., Knippers, R. 1985. Transfection of mouse fibroblast cells
with a promoterless Herpes Simplex Virus thymidine kinase gene:
number of integrated gene copies and structure of single and
amplified gene sequences. Mol. Cell. Biol. 5: 295-304.

Remmers, E. F., Yang, J. Q., Marcu, K. B. 1986. A negative
transcriptional control element located upstream of the murine c-
myc gene. EMBO J. 5: 899-904.
Reynolds, G. A., Baser, S. K., Osborne, T. F., Chin, D. J., Gill, G.,
Brown, M. S., Goldstein, J. L., Luskey, K. L. 1984. HMG coA
Reductase: a negatively regulated gene with unusual promoter and
5' untranslated regions. Cell. 38: 275-285.
Rigby, P. W. J., Dieckman, M., Rhodes, C., Berg, P. 1977. Labeling
deoxyribonucleic acid to high specific activity in vitro by nick
translation with DNA polymerase I. J. Mol. Biol. 113: 237-251.
Roeder, R. G. 1976. Eukaryotic nuclear RNA polymerase. In: Losick,
R., Chamberlin (eds) RNA Polymerase, Cold Spring Harbor, New York
Rosales, R., Vigneron, M., Macchi, M., Davidson, I., Xiao, J. H.,
Chambón, P. 1987. In vitro binding of cell-specific and
ubiquitous nuclear proteins to the octamer motif of the SV40
enhancer and related motifs present in other promoters and
enhancers. EMBO J. 6: 3015-3025.
Rosenberg, M., Court, D. 1979. Regulatory sequences involved in the
promotion and termination of RNA transcription. Ann. Rev.
Genetics. 13: 319-353.
Ross, J., Peltz, S., Kobs, G., Brewer, G. 1986. Histone mRNA
degradation in vivo: the first detectable step occurs at or near
the 3' terminus. Mol. Cell. Biol. 6: 4362-4371.
Ross, J., Kobs, G., Brewer, G., Peltz, S. 1987. Properties of the
exonuclease activity that degrades H4 histone mRNA. J. Biol. Chem
262: 9374-9381.
Rowe, W. P., Huebner, R. J., Gillmore, L. K., Parrott, R. H., Ward, T.
G. 1953. Isolation of a cytogenic agent from human adenoids
undergoing spontaneous degeneration in tissue culture. Pros. Soc.
Exp. Biol. Med. 84: 570-573.
Salvo, J., Grindley, N. 1987. Helical phasing between DNA bends and
the determination of bend direction. Nucl. Acids Res. 15: 9771-
9779.
Sambrook, J., Sugden, B., Keller, W., Sharp, P. A. 1973.
Transcription of simian virus 40. III. Mapping of "early" and
"late" species of RNA. Proc. Natl. Acad. Sci. USA. 70: 3711-3715
Sander, M., Hsieh, T. S., 1985. Drosophila topoisomerase II double¬
strand DNA cleavage: analysis of DNA sequence homology at the
cleavage site. Nuc. Acids Res. 13: 1057-1072.

196
Sawadago, M. S., Roeder, R. G. 1985. Factors involved in specific
transcription by human polymerase II: analysis by a rapid and
quantitative in vitro assay. Proc. Natl. Acad. Sci. USA. 82:
4394-4398.
Seiler-Tuyns, A., Birnstiel, M. L. 1981. Structure and expression in
L-cells of a cloned H4 histone gene of the mouse. J. Mol. Biol.
151: 607-625.
Sen, R., Baltimore, D. 1986. Multiple nuclear factors interact with
the immunoglobulin enhancer sequences. Cell. 46: 705-716.
Serfling, E. Jasin, M., Schaffner, W. 1985. Enhancers and eukaryotic
gene transcription. Trends Genet. 1: 224-230.
Sharp, P. A., Gallimore, P. H., Flint, S. J. 1975. Mapping of
adenovirus 2 RNA sequences in lytically infected cells and
transformed cell lines. Cold Spring Harbor Symp. Quant. Biol. 39:
457-474.
Shenk, T. 1981. Transcriptional control regions: nucleotide sequence
requirements for initiation by RNA polymerase II and III. Current
Topics in Microbiology and Immunology. 93: 25-46.
Sierra, F., Lichter, A., Marashi, F., Rickies, R., Van Dyke, T., Clark,
S., Wells, J., Stein, G., Stein J. 1982. Organization of human
histone genes. Proc. Natl. Acad. Sci. USA. 79: 1795-1799.
Sierra, F., Stein, G., Stein, J. 1983. Structure and in vitro
transcription of a human H4 histone gene. Nucl. Acids. Res. 11
7069-7086.
Simpson, R. J. 1973. Structure and function of chromatin. Adv.
Enzymol. 38: 41-108.
Singer-Sam, J., Keith, D. H. Tani, K., Simmer, R. L., Shively, L.,
Lindsay, S., Yoshida, A., Riggs, A. D. 1984. Sequence of the
promoter of the gene for human X-linked 3-phosphoglycerate kinase.
Gene. 32: 409-417.
Sittman, D. B., Graves, R. A., Marzluff, W. F. 1983. Histone mRNA
concentrations are regulated at the level of transcription and mRNA
degradation. Proc. Natl. Acad. Sci. USA. 80: 1849-1853.
Sive, H. L., Heintz, N., Roeder, R. G. 1986. Multiple sequence
elements are required for maximal in vitro transcription of a human
histone H2B gene. Mol. Cell. Biol. 6: 3329-3340.
Smith, H. 0., Wilcox, K. W. 1970. A restriction enzyme from
Hemophilus influenzae. I. Purification and general properties.
J. Mol. Biol. 51: 379-391.

197
Southern, E. H. 1975. Detection of specific sequences among DNA
fragments separated by gen electrophoresis. J. Mol. Biol. 98:
503-517.
Southern, P. J., Berg, P. 1982. Transformation of animal cells to
antibiotic resistance with a bacterial gene under control of the
SV40 early region promoter. J. Mol. Appl. Genet. 1: 327-341.
Stein, G. S., Spelsberg, T. C., Kleinsmith, L. J. 1974. Nonhistone
chromosomal proteins and gene regulation. Science 183: 817-24.
Stein, G., Park, W., Thrall, C., Mans, R., Stein, J. 1975. Regulation
of cell cycle stage-specific transcription of histone genes from
chromatin by nonhistone chromosomal proteins. Nature 257: 764-67.
Stein, G. S., Sierra, F., Stein, J. L., Plumb, M. A., Marashi, F.,
Carozzi, N., Prokopp, K., Baumbach, L. 1984. Organization and
expression of human histone genes. In Histone Genes pp. 397-455,
John Wiley and Sons, New York.
Stein, G., Stein, J. 1984. Is human histone gene expression
autogenously regulated? Mol. and Cell. Biochem. 64: 105-110.
Stumph, W. E., Hodgson, C. P., Tsai. M. J., O'Malley, B. W. 1984.
Genomic structure and possible retroviral origin of the chicken CR1
repetitive DNA sequence family. Proc. Natl. Acad. Sci. USA. 81:
6667-6671.
Sugarman, B. J., Dodgson, J. and Engel, J. D. 1983. Genomic
organization, DNA sequence and expression of chicken embryonic
histone genes. J. Biol. Chem. 258: 9005-9016.
Szostak, J. W., Orr-Weaver, T. L., Rothstein, R. J., Stahl, F. W.
1983. The double-strand-break repair model for recombination.
Cell. 33: 25-35.
Tartof, K. D., Hobbs, C. A. 1987. Improved media for growing plasmid
and cosmid clones. Focus 9:12.
Theisen, M., Stief, A., Sippel, A. E. 1986. The lysozyme enhancer:
cell-specific activation of the chicken lysozyme gene by a far-
upstream DNA element. EMBO J. 5: 719-724.
Thomas, M., White, R. L., and Davis, R. W. 1976. Hybridization of RNA
to double-stranded DNA: Formation of R-loops. Proc. Natl. Acad.
Sci. USA. 73: 2294-2298.
Thomas, D. C., and Green, M. 1966. Biochemical studies on adenovirus
multiplication. XI. Evidence for a cytoplasmic site for the
synthesis of viral coded proteins. Proc. Natl. Acad. Sci. USA.
56: 243-246.

198
Tooze, J. 1980. Molecular Biology of Tumor Viruses: DNA Tumor
Viruses (2nd Ed. part 2 revised). Cold Sprg. Harb. Cold Spring
Harbor Laboratory.
Travers, A. A. 1987. DNA bending and nucleosome positioning. Trends
Biochem. Sci. 12: 108-113.
Treisman, R., Maniatis, T. 1985. Simian virus 40 enhancer increases
the number of RNA polymerase II molecules on linked DNA. Nature.
315: 72-75.
Triputti, P., Emanuel, B., Croce, C., Green, L., Stein, G., Stein J.
1986. Human histone genes map to multiple chromosomes Proc. Natl.
Acad. Sci. USA. 83: 3185-3188.
Tsai, M. J., Towle, H. C., Harris, S. E., O'Malley, B. W. 1976.
Effect of estrogen on gene expression in the chick oviduct.
Comparative aspects of RNA chain initiation in chromatin using
homologous versus Escherichia coli RNA polymerase. J. Biol. Chem.
251: 1960-68.
Tullis, R. H., Rubin, H. 1980. Calcium protects DNasel from
proteinase K: A new method for the removal of contamnating RNase
from DNAsel. Anal. Biochem. 107: 260-264.
van Wijnen, A. J., Stein, G. S., Stein J. L. 1987. A nuclear protein
with affinity for the 5' flanking region of a cell cycle dependent
human histone H4 gene in vitro. Nucl. Acids Res. 15: 1679-1698.
van Wijnen, A. J., Wright, K. L., Massung, R. F., Gerretsen, J., Stein,
J. L., Stein, G. S. 1988. Two target sites for protein binding in
the promoter region of a cell cycle regulated human HI histone
gene. Nucl. Acids Res. 16: 571-592.
Wasylyk B., Derbyshire, R., Guy, A., Molko, D., Roget, A., Teolue, R.,
Chambón, P. 1980. Specific in vitro transcription of conalbumin
gene is drastically decreased by a single-point mutation in TATA
box homology sequence. Proc. Natl. Acad. Sci. USA. 77: 7024-7028.
Wasylyk, C., Wasylyk, B. 1986. The immunoglobulin heavy-chain B
lymphocyte enhancer efficiently stimulates transcription in non¬
lymphoid cells. EMBO J. 5: 553-560.
Webster, N., Jin, J. R., Green, S., Hollis, M., Chambón, P. 1988. The
yeast UASg is a transcriptional enhancer in human hela cells in the
presence of the GAL4 trans-activator. Cell. 52: 169-178.
Weil, P. A., Segall, J., Harris, B., Ng S-Y, Roeder, R. G. 1979.
Faithful transcription of eukaryotic genes by RNA polymerase III in
systems reconstituted with purified DNA templates. J. Biol. Chem.
254: 6163-6173.

199
Weintraub, H., Groudine, M. 1976. Chromosomal subunits in active
genes have an altered conformation. Globin genes are digested by
deoxyribonuclease I in red blood cell nuclei but not in fibroblast
nuclei. Science. 193: 848-56.
Weintraub, H. 1985. Assembly and propagation of repressed and
derepressed chromosomal states. Cell. 42: 705-711.
Weiss, B., Richardson, C. C. 1967. Enzymatic breakage and joining of
deoxyribonucleic acid. I. Repair of single-strand breaks in DNA
by an enzyme system from E, coli infected with T4 bacteriophage.
Proc. Natl. Acad. Sci. USA. 57: 1021-1028.
Wells, D., Kedes, L. 1985. Structure of a human histone cDNA:
evidence that basally expressed histone genes have intervening
sequences and encode polyadenylated mRNAs. Proc. Natl. Acad. Sci.
USA. 82: 2834-2838.
Wells, D. E. 1986. Compilation analysis of histones and histone
genes. Nucl Acids Res. 14: 119-149.
Wu, G. J. 1978. Adenovirus DNA-directed transcription of 5.5S RNA in
vitro. Proc. Natl. Acad. Sci. USA. 75: 2175-2179.
Wu, R. S., Bonner, W. M. 1982. Patterns of histone variant synthesis
can distinguish Go from G1 cells. Cell. 31: 367-374.
Yee., A. S., Reichel, R., Kovesdi, I., Nevins, J. R. 1987. Promoter
interaction of the ElA-inducible factor E2F and its potential role
in the formation of a multi-component complex. EMBO J. 6: 2061-
2068.
Zhong, R., Roeder, R. G., Heintz, N. 1983. The primary structure and
expression of four cloned human histone genes. Nucleic Acids Res.
11: 7409-7425.

BIOGRAPHICAL SKETCH
Paul Edmond Kroeger was born in Louisville KY, on January 7, 1960.
He was able to see much of the United States before the age of 13 when
his family finally settled in Winston-Salem, NC. He attended R. J.
Reynolds Senior High School where he graduated in the spring of 1978.
He entered Wake Forest University in the fall of 1978 and graduated
with a B.A. in biology in 1982. In the fall of 1982 he entered the
graduate program in the Department of Immunology and Medical
Microbiology and was partially supported in his studies by a training
grant from the National Institutes of Health. He spent 2 and a half
years in the lab of Dr. William Holloman studying eukaryotic
recombination, and the remainder of his time in the lab of Janet and
Gary Stein pursuing his thesis project. In the fall of 1987 he married
Carol Ward and they produced a gorgeous son, Alan Scott Kroeger, the
following spring. After graduation he will pursue a postdoctoral
fellowship with Dr. Thomas Rowe in the Department of Pharmacology at
the University of Florida.
200

I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is fully
adequate, in scope and quality, as a dissertation for the degree of
Doctor of Philosophy.
Jaáet L. Stein, Chair
Professor of Immunology and
Medical Microbiology
I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is fully
adequate, in scope and quality, as a dissertation for/the d^aree of
Doctor of Philosophy.
ary S. Ste^
Professor of Biochemistry
and Molecular Biology
I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is fully
adequate, in scope and quality, as a dissertation for tihs^ degree of
Doctor of Philosophy.
Richard W. Moyer
Professor Immunol
Medical Microbiolo
and
I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation'and is fully
adequate, in scope and quality, as a dissertation for the degree of
Doctor of Philosophy. f y //
William W. 'Hauswirth
Professor of Immunology and
Medical Microbiology
I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is fully
adequate, in scope and quality, as a dissertation for the degree of
Doctor of Philosophy.
a
Harry Ostxe
Assistant Professor of
Biochemistry and Molecular
Biology

This dissertation was submitted to the Graduate Faculty of the
College of Medicine and to the Graduate School and was accepted as
partial fulfillment of the requirements for the degree of Doctor of
Philosophy.
August 1988
Dean, College of Medicine
Dean, Graduate School

UNIVERSITY OF FLORIDA