Citation
The human Type 5, tartrate-resistant acid phosphatase

Material Information

Title:
The human Type 5, tartrate-resistant acid phosphatase purification, characterization and molecular cloning
Creator:
Ketcham, Catherine Mary, 1959-
Publication Date:
Language:
English
Physical Description:
xiv, 165 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Amino acids ( jstor )
Antibodies ( jstor )
Cattle ( jstor )
Complementary DNA ( jstor )
Enzymes ( jstor )
Gels ( jstor )
pH ( jstor )
Phosphatases ( jstor )
Purification ( jstor )
Spleen ( jstor )
Acid Phosphatase -- isolation & purification ( mesh )
Biochemistry and Molecular Biology thesis Ph.D ( mesh )
Dissertations, Academic -- Biochemistry and Molecular Biology -- UF ( mesh )
Isoenzymes -- biosynthesis ( mesh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 1988.
Bibliography:
Bibliography: leaves 150-164.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Catherine Mary Ketcham.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
001031877 ( ALEPH )
20429296 ( OCLC )
AFB4055 ( NOTIS )

Downloads

This item has the following downloads:


Full Text












THE HUMAN TYPE 5, TARTRATE-RESISTANT ACID PHOSPHATASE:
PURIFICATION, CHARACTERIZATION AND MOLECULAR CLONING
















By

CATHERINE MARY KETCHAM


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY



UNIVERSITY OF FLORIDA


1988




THE HUMAN TYPE 5, TARTRATE-RESISTANT ACID PHOSPHATASE
PURIFICATION, CHARACTERIZATION AND MOLECULAR CLONING
By
CATHERINE MARY KETCHAM
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1988


ACKNOWLEDGMENTS
My sincere thanks are extended to the members of my supervisory
committee for their guidance and encouragement: Dr. R. Michael Roberts,
Dr. Harry S. Nick, Dr. Daniel L. Purich, Dr. Peter M. McGuire, Dr.
Michael S. Kilberg, and Dr. Fuller W. Bazer. I especially thank Dr. R.
Michael Roberts for convincing me that I could earn a Ph.D., and for his
continued support over all of the years that we worked together. I am
indebted to Dr. Harry S. Nick for allowing me to be a part of his
laboratory. I would like to express my gratitude to Dr. Richard P.
Boyce, Graduate Coordinator--a graduate student's best friend.
Warm thanks are extended to the many helpful scientists from
laboratories of Dr. Roberts and Dr. Bazer, especially Dr. George A.
Baumbach, Dr. William C. Buhi, Dr. Phillipa T.K. Saunders and Dr. Mary
K. Murray. I am also indebted to my fellow graduate students in the
laboratory of Dr. Nick. A number of undergraduate assistants and
laboratory technicians have been helpful to me. I would specifically
like to express my appreciation to Joy Whitman, Samantha Roberts,
Penelope Edwards and Carol Ann Harper.
I am grateful to Dr. Raul Braylan for providing the human spleens;
and to Dr. Rosalia C. M. Simmen for the generous gift of two porcine
uteroferrin clones. I sincerely thank Liz Dampier, who cheerfully typed
every word of this dissertation.
ii


A special word of thanks goes to my parents, Alfred and Antoinette
Scopa, and to my husband's parents, Sigurd and Valerie Martin. Their
loyalty and approval have always been very important to me.
I wish to express my greatest appreciation to my dear husband,
Glenn. His patience and unfailing love have been the keys to my success.
iii


TABLE OF CONTENTS
page
ACKNOWLEDGMENTS ii
LIST OF TABLES vii
LIST OF FIGURES ix
ABBREVIATIONS xi
ABSTRACT xiii
CHAPTERS
1 INTRODUCTION 1
The Tartrate-resistant Acid Phosphatases 1
Uteroferrin 1
Uteroferrin is Synthesized by the Uterine
Endometrium Under the Influence of Progesterone 2
The Purification of Uteroferrin from Uterine
Secretions 3
Uteroferrin is an Iron-containing Acid
Phosphatase 5
Uteroferrin Contains Two Iron-binding Sites 6
A Proposed Reaction Mechanism for Uteroferrin 8
Uteroferrin Contains at Least One High
Mannose Oligosaccharide Chain 9
The Function of Uteroferrin 11
Other Purple, Iron-containing Acid Phosphatases 12
Human Acid Phosphatases 15
Characterization of the Human Acid Phosphatases 15
Hairy Cell Leukemia 17
Tartrate-resistant Acid Phosphatase Levels in
Other Diseases 18
Purification and Characterization of the
Type 5 Isozyme 19
2 THE HUMAN TYPE 5, TARTRATE-RESISTANT ACID PHOSPHATASE FROM
SPLEEN OF HUMANS WITH HAIRY CELL LEUKEMIA. PURIFICATION,
PROPERTIES, IMMUNOLOGICAL CHARACTERIZATION AND COMPARISON
WITH PORCINE UTEROFERRIN 22
Introduction 22
iv


Materials and Methods 24
Materials 24
Methods 25
Results 37
Purification of Uteroferrin 37
Purification of the Human Type 5 Acid Phosphatase
from Hairy Cell Spleen 40
Purification of the Type 5 Isozyme from Normal
Human Spleen 49
Purification of the Type 5 Phosphatase from
Human Placenta 49
Purification of the Bovine Spleen, Bovine Uterine
and Rat Spleen Phosphatases 50
pH Optima of the Type 5 Phosphatases 50
Glycoprotein Nature of the Type 5 Phosphatases 50
Iron Content of the Type 5 Phosphatases 54
Activation by Reducing Agents 54
Effects of Inhibitors on Phosphatase Activity 56
Substrate Specificity for Phosphatase Activity 59
Immunological Cross-reactivity 63
The Production of Monoclonal Antibodies against
Porcine Uteroferrin 63
The Production of Monoclonal Antibodies against
the Hairy Cell Spleen Enzyme 67
The Binding of the Monoclonal Antibodies to Other
Tartrate-resistant Acid Phosphatases 70
Inhibition of Enzymatic Activity by the Binding
of Monoclonal Antibodies 74
Discussion 74
3 MOLECULAR CLONING OF THE TYPE 5, TARTRATE-RESISTANT
ACID PHOSPHATASE FROM HUMAN PLACENTA AND ITS EXPRESSION
IN LEUKEMIA CELLS 82
Introduction 82
Materials and Methods 84
Materials 84
Methods 84
Results 104
The Identity of the Positive Clones Obtained by
Immunoscreening the Human Placenta cDNA Library 104
Dot Blot Analysis of Uteroferrin and Fibronectin
with Anti-Uteroferrin Ill
Results from Screening the Mouse Spleen
cDNA Library Ill
Results from Screening the Porcine Uterine
Endometrium cDNA Library 117
The Molecular Cloning of a cDNA Coding for
the Human Type 5, Tartrate-resistant
Acid Phosphatase 118
cDNA Sequences 125
Characteristics of the Deduced Amino Acid Sequence 125
v


Northern Analysis 128
Induction of Tartrate-resistant Acid Phosphatase
by TPA 133
The Effects of Hemin on Acid Phosphatase Expression 135
Discussion 135
4 CONCLUSIONS AND FUTURE DIRECTIONS 143
REFERENCES 150
BIOGRAPHICAL SKETCH 165
vi


LIST OF TABLES
Table page
2-1 Tartrate insensitivity and activation by
2-mercaptoethanol of acid phosphatase activity
in spleen homogenates from a patient with hairy
cell leukemia and from an individual with a
normal spleen 41
2-2 Purification of tartrate-resistant acid
phosphatase from spleen of a patient with
hairy cell leukemia 46
2-3 Levels of tartrate-resistant acid phosphatase
activity in various tissues 52
2-4 pH optima for the tartrate-resistant acid phosphatases .. 53
2-5 The iron content of the tartrate-resistant
acid phosphatases 55
2-6 Activation of purified human hairy cell phosphatase
by 2-mercaptoethanol 57
2-7 Action of various potential inhibitors on the
hairy cell acid phosphatase, uteroferrin, bovine spleen
and bovine uterine acid phosphatases 58
2-8 Comparison of substrate specificities of hairy cell
phosphatase, uteroferrin, bovine spleen and
bovine uterine phosphatases 62
2-9 Dissociation constants (Kp values) for binding of
monoclonal antibodies to uteroferrin, the human spleen
enzyme, the rat spleen enzyme, the bovine spleen and
uterine enzymes 73
2-10 Inhibition of acid phosphatase activity of uteroferrin by
monoclonal antibodies 75
3-1 The clones employed for generation of the complete
sequence of the human tartrate-resistant
acid phosphatase 124
vii


3-2
Tartrate-resistant acid phosphatase levels in K562 and
JURKAT cells maintained on 10"M TPA and K562 cells
maintained on 60/iM hemin 134
3-3 Potential epitopes common to porcine uteroferrin and
human fibronectin 137
viii


LIST OF FIGURES
Figure page
2-1 Purification of uteroferrin from allantoic fluid
of a day 67 pregnant pig 39
2-2 Purification of human spleen phosphatase 44
2-3 SDS-polyacrylamide gel electrophoresis of purified
uteroferrin and hairy cell phosphatase 47
2-4 Polyacrylamide gel electrophoresis of acid
phosphatases at pH 5.4 in p-alanine buffer 48
2-5 SDS-polyacrylamide gel electrophoresis of uteroferrin,
the phosphatase from human spleen and the phosphatase from
placenta 51
2-6 Lineweaver-Burk plots of uteroferrin and hairy cell
phosphatase activities in the presence of 2-mercap-
toethanol and various inhibitors 61
2-7 Solid phase radiobinding assay of whole mouse
antiserum from mice immunized with human spleen
phosphatase (upper panel) or uteroferrin (lower panel) ... 65
2-8 Competitive binding of anti-uteroferrin monoclonal
antibodies to uteroferrin adsorbed to flexvinyl
microtiter wells 69
2-9 Binding of four monoclonal antibodies to uteroferrin
and to the immunoaffinity purified phosphatases
from human, bovine and rat spleens 72
3-1 The nucleotide sequences of the cDNA clones coding for
porcine uteroferrin used for screening the human placenta
cDNA library and their deduced amino acid sequences 90
3-2 The sequences of the redundant oligonucleotides used for
Southern blot analysis and their deduced amino
acid sequences 96
3-3 Nitrocellulose filters containing immunoreactive fusion
proteins produced by recombinant lambda gtll phage from
a human placenta cDNA library which was screened with
anti-uteroferrin antibodies 106
ix


3-4 Agarose gel electrophoresis of DNA from six positive
clones obtained by immunoscreening human placenta and
mouse spleen cDNA libraries and Southern analysis of
the clones probed with HP6.1 107
3-5 Southern blot analysis of clone HP 6.1 probed with
radiolabeled oligonucleotide KM28 109
3-6 Polyacrylamide gel electrophoresis of clone HP 6.1
restriction fragments obtained with Alu I and Hae III ....110
3-7 The nucleotide and inferred amino acid sequences of
clone HP 6.1, which codes for human fibronectin 113
3-8 Dot blot analysis of the binding of polyclonal and
monoclonal antibodies against porcine uteroferrin to
uteroferrin and human fibronectin 116
3-9 Two positive clones, 2a and 6a, identified by screening
the human placenta cDNA library with the cDNAs coding for
porcine uteroferrin 119
3-10 Agarose gel electrophoresis of EcoR I digests DNA from
two positive clones, 2a and 6a 120
3-11 Polyacrylamide gel electrophoresis of the restriction
fragments obtained by the digestion of clones 2a and 6a
with Alu I, Hae III and Msp I 122
3-12 Subcloning and sequencing strategy for clone 6a, the
cDNA encoding the human Type 5, tartrate-resistant acid
phosphatase 123
3-13 The nucleotide sequence of the cDNA clone 6a and the
deduced amino acid sequence of the human Type 5,
tartrate-resistant acid phosphatase 127
3-14 Comparison of the deduced amino acid sequence of the
human tartrate-resistant acid phosphatase with the
amino acid sequences of porcine uteroferrin and the
bovine spleen acid phosphatase 130
3-15 Expression of tartrate-resistant acid phosphatase mRNA
and its induction by TPA 132
x


ABBREVIATIONS
bp, base pairs
BSA, bovine serum albumin
cDNA, complementary DNA
CM-cellulose, carboxymethyl cellulose
ConA, Concanavalin A
DME, Dulbecco's Modified Eagle's Medium
DME-HAT, DME with hypoxanthine, aminopterin and thymidine
DNase, deoxyribonuclease
DTT, dithiothreitol
EBV, Epstein-Barr Virus
EDTA, ethylenediaminetetraacetic acid
GlcNAc, N-acetylglucosamine
GTC, guanidinium thiocyanate solution
IgG, immunoglobulin G
i.p., intraperitoneally
IPTG, isopropylthio-/?-D-galactopyr ano side
kb, kilobases
Kp, dissociation constant
MOPS, 3-(N-morpholino)propanesulfonic acid
Mr, relative molecular mass
PAGE, polyacrylamide gel electrophoresis
PBS, phosphate buffered saline
Phosphodiesterase, N-acetylglucosamine-l-phosphodiester oc-N-acetyl -
glucosaminidase
Phosphotransferase, UDP-N-acetylglucosamine:lysosomal enzyme
N-acetylglucosamine 1-phosphate transferase
PMSF, phenylmethylsulfonylfluoride
pNPP, p-nitrophenylphosphate
RNase, ribonuclease
SDS, sodium dodecyl sulfate
xi


SDS-PAGE, polyacrylamide gel electrophoresis with sodium dodecyl sulfate
SP2/0, SP2/0-Agl4
SSC, standard sodium citrate buffer
TE, Tris-HCl with EDTA
TPA, 12-0-tetradecanoylphorbol 13-acetate
TR-AP, tartrate resistant acid phosphatase (Type 5 isozyme)
Tris, tris(hydroxymethyl)aminomethane
Uf, uteroferrin
X-gal, 5-chloro-4-bromo-3-indolyl /3-D-galactopyranoside
xii


Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
THE HUMAN TYPE 5, TARTRATE-RESISTANT ACID PHOSPHATASE:
PURIFICATION, CHARACTERIZATION AND MOLECULAR CLONING
By
Catherine Mary Ketcham
August, 1988
Chairman: Dr. R. Michael Roberts
Major Department: Biochemistry and Molecular Biology
The spleens of patients with hairy cell leukemia contain high levels
of a tartrate-resistant cationic acid phosphatase, known as the Type 5
isozyme. This enzyme is also present in small quantities in normal
spleen and term placenta. This phosphatase has been purified from these
three sources by a procedure which involves only two chromatographic
steps: CM-cellulose chromatography and immunoaffinity chromatography on
a column of anti-uteroferrin antibodies. Uteroferrin is an abundant
purple, iron-containing acid phosphatase that can be easily purified
from porcine uterine secretions. Like uteroferrin, the human enzyme is
an iron-containing glycoprotein of apparent molecular weight 34,000.
The human phosphatase and uteroferrin also resemble each other closely
in electrophoretic mobility, substrate specificity, and response to a
variety of activators and inhibitors. Three anti-uteroferrin monoclonal
antibodies which bind with high affinities to distinct sites on the
uteroferrin molecule also recognize the human spleen enzyme, but bind to
xiii


it with much lower affinities. These antibodies also recognize purple,
iron-containing acid phosphatases from bovine and rat spleens and the
bovine uterus. A 1412-base pair cDNA has been cloned from human
placenta which encodes the entire human tartrate-resistant, Type 5
isozyme. This cDNA contains an open reading frame of 969 base pairs,
corresponding to a protein of 323 amino acids. A putative signal
sequence of 19 amino acids and two potential glycosylation sites are
present. The deduced amino acid sequence of the human enzyme is 85%
identical to that of porcine uteroferrin and 82% identical to the
corresponding regions of a partial amino acid sequence of the bovine
spleen enzyme. Northern blotting techniques employing a radiolabeled
cDNA probe coding for the human enzyme revealed the presence of a 1.5 kb
transcript in leukemic hairy cells, an Epstein-Barr virus-transformed
B-cell line, and the erythroleukemia cell line K562. Culture of K562
cells in the presence of 10'M 12-0-tetradecanoylphorbol 13-acetate
enhanced tartrate-resistant acid phosphatase activity about 30-fold and
led to a corresponding increase in Type 5 isozyme mRNA levels.
xiv


CHAPTER 1
INTRODUCTION
The Tartrate-resistant Acid Phosphatases
The tartrate-resistant acid phosphatases have been studied
extensively by various research groups with different objectives. The
most abundant enzyme in this family, porcine uteroferrin, has been well
characterized physically and enzymatically, yet much of the research on
this protein has involved the determination of its role in iron
metabolism in the mid-pregnant pig. The beef spleen acid phosphatase
was first identified over 25 years ago, and while its physical
characteristics as a metalloprotein are well known, its function remains
obscure. The human tartrate-resistant acid phosphatase was first
described by researchers interested in the clinical significance of
phosphatase levels in normal and pathological tissue. Few reports have
been published on the characterization of this human enzyme. It is
clear, however, that all of the above proteins share several unusual
features, and that the clinically relevant human enzyme is worthy of
further study.
Uteroferrin
The uterine secretions of pigs contain a purple, basic, iron-
containing glycoprotein with acid phosphatase activity known as
uteroferrin. Uteroferrin has been well characterized since it was first
described in 1972 by Murray et al. Its enzymatic characteristics have
1


2
been studied by our laboratory, and its interesting spectral properties
have been the subject of numerous publications by many different
researchers. Our laboratory has also determined the likely function of
uteroferrin in the pregnant pig.
Uteroferrin is Synthesized by the Uterine Endometrium Under the
Influence of Progesterone
One of the major goals of our laboratory has been to purify and
characterize the proteins secreted by the porcine uterus. The quantity
and variety of proteins produced depend on the hormonal state of the
animal. Knight et al. (1974) described the collection of uterine fluids
from ovariectomized gilts which had been treated with estradiol 17-/3,
progesterone, progesterone plus estradiol 17-/J, or corn oil (control),
for 15 days. It was demonstrated that progesterone or progesterone plus
estradiol treatment caused a highly significant increase in the amount
of total protein that could be recovered relative to corn oil control or
estradiol treatment alone. Estradiol alone promoted neither increased
protein accumulation nor the appearance of novel proteins, but it acted
synergistically with progesterone to stimulate uterine secretory
activity when given at low dosage. A variety of proteins were thus
shown to be secreted by the porcine uterus under the influence of
progesterone. A protein now known as uteroferrin accounted for about
10-15% of the total protein in the uterine secretions of progesterone
treated animals (Schlosnagle et al., 1974).
Simmen et al. (1988) compared the biosynthetic rate of uteroferrin
to uteroferrin mRNA levels throughout pregnancy in the pig. Synthesis
of uteroferrin begins to increase markedly after day 30 of pregnancy in
association with a decline in maternal estrogen levels. Uteroferrin


3
biosynthesis reaches a maximum between days 60 and 75 (Basha et al.,
1979), and then declines towards term, which is about day 115 (Bazer et
al., 1975). The progesterone to estrogen ratios are highest between
days 35 to 75, which coincides well with maximal uteroferrin production
(Roberts and Bazer, 1980). Levels of uteroferrin in allantoic fluid
during pregnancy reach a maximum at a similar time (Roberts and Bazer,
1980). In comparison, highest levels of mRNA coding for uteroferrin
were detected during mid- and late-pregnancy. The mRNA levels at days
45-60 were comparable to those at days 90-110 (Simmen et al., 1988).
Thus, the amount of uteroferrin mRNA as determined by Northern analysis
does not appear to reflect the rate of uteroferrin biosynthesis as
determined by the incorporation of radioactive leucine. The regulation
of uteroferrin synthesis may therefore involve transcriptional and post-
transcriptional control. These results support the earlier theory that
although progesterone is essential for uteroferrin production, estrogens
may have an important modulating role, due to the fact that uteroferrin
synthesis is highest when the ratio of progesterone to estrogen is
highest (Roberts and Bazer, 1980).
The Purification of Uteroferrin from Uterine Secretions
Uteroferrin is most conveniently purified from the uterine flushes
of pseudopregnant animals (Basha et al., 1980), or from the allantoic
fluid of mid-pregnant pigs (Bazer et al., 1975). Pseudopregnancy can be
induced in sows by administering estradiol-17/3 daily between days 11-14
after estrus (Frank et al., 1978). The injected estradiol appears to
mimic an estrogen burst from the blastocyst which is believed to be the
signal to the sow which indicates she is pregnant (Bazer and Thatcher,


4
1977) Secretions of a day 60 pseudopregnant animal are comparable in
quality and quantity to those of an ovariectomized animal given daily
doses of progesterone for two months. Uteroferrin can be purified from
allantoic fluid after day 30 of pregnancy. However, uteroferrin in
sterile allantoic fluid is rapidly degraded, even when stored at 4C.
Therefore, the allantoic fluid must be frozen after collection or used
immediately, and the purification of uteroferrin must be carried out
quickly.
Because uteroferrin is available in gram quantities, and because of
its purple color, the development of a purification protocol for
uteroferrin was quite straightforward. Since uteroferrin is a very
basic protein, it binds to carboxymethyl cellulose even at high pH
values. A combination of ion exchange chromatography and gel filtration
on Sephadex G-100 is sufficient to yield pure uteroferrin of Mr 35,000,
as determined by SDS polyacrylamide gel electrophoresis (Chen et al.,
1973). Interestingly, uterine flushes and allantoic fluid obtained from
animals during early pregnancy (days 45-60) also contain a high
molecular weight (Mr=80,000), pink form of uteroferrin (Bazer et al.,
1975). It is now known that this protein consists of a molecule of
uteroferrin non-covalently associated with another, antigenically
unrelated protein (Baumbach et al., 1986). The reason for the
association of uteroferrin with this second protein is unknown.
A number of other interesting proteins, though none as abundant as
uteroferrin, can also be purified from porcine uterine secretions (see
Roberts and Bazer, 1988). These proteins include a family of
trypsin/plasmin protease inhibitors ( Mullins et al., 1980; Fazleabas et


5
al., 1982), and a group of retinol binding proteins (Adams et al.,
1981).
Uteroferrin is an Iron-containing Acid Phosphatase
Schlosnagle et al. (1974) demonstrated that the abundant, basic,
purple glycoprotein from porcine uterine secretions was an iron-
containing acid phosphatase. They reported a pH optimum of 4.9 and a Km
of 2.2mM for the enzyme's preferred substrate, p-nitrophenylphosphate.
Weak reducing agents, such as 2-mercaptoethanol enhanced activity 2- to
4-fold, without changing the Km. Uteroferrin's phosphatase activity
could be inhibited by fluoride, arsenate, phosphate and molybdate
(Schlosnagle et al., 1976). Sodium dithionite caused an immediate loss
of enzymatic activity and bleaching of color, although activity could be
restored with Fe^+ salts (Schlosnagle et al., 1976). Oxidizing agents,
and reagents which interact with sulfhydryl groups also inhibited
uteroferrin (Schlosnagle et al., 1976). Uf was not inhibited by
tartrate, an unusual feature in an acid phosphatase. The substrate
specificity of uteroferrin was also unusual. It readily hydrolyzed
compounds with strong leaving groups, such as p-nitrophenylphosphate and
ATP, but had little or no activity towards aliphatic phosphates such as
/3-glycerol phosphate, or hexose phosphates such as D-glucose 6-phosphate
(Schlosnagle et al., 1974). Uteroferrin also displayed phosphoprotein
phosphatase activity (Roberts and Bazer, 1976).
Uteroferrin, as purified, is predominantly purple and enzymatically
inactive. This purple coloration originates from a broad absorption
band centered around 545nm. However, when uteroferrin is activated by
2-mercaptoethanol, the extinction maximum changes from 545nm (purple) to


6
508nm (pink) (Schlosnagle et al., 1974). The reverse reaction (pink to
purple) is promoted by oxidizing agents. When purified, uteroferrin
consists of an equilibrium mixture of the reduced (pink) and oxidized
(purple) forms, with the latter predominating. The equilibrium between
the pink and purple forms may depend on the redox state of the fluid
sample from which the protein was recovered. In contrast, the stable
pink, high molecular weight form of uteroferrin does not require
reducing agents for activity, it is fully active as purified (Baumbach
et al., 1986). It is not clear how non-covalent association with a
second, unrelated protein stabilizes the active form of the enzyme.
Uteroferrin Contains Two Iron-binding Sites
The amount of iron bound to uteroferrin has been the subject of
controversy. Early reports (Roberts and Bazer, 1980) indicated that
uteroferrin contained a monoferric site. However, it is now clear that
each molecule of uteroferrin can bind up to two iron atoms, although
only one of these iron atoms is necessary for the purple/pink
coloration. It has been demonstrated that the iron at the more labile,
non-chromophoric site can be replaced by a variety of other metals
including zinc, copper and mercury (Beck et al., 1984). The apparent
lower content of iron (less than two atoms per molecule) consistently
noted in some samples of uteroferrin (see Baumbach et al., 1986) may
have resulted from a partial absence of iron at the non-chromophoric
site and its replacement by other metals.
A number of methods have been employed to study the iron binding
sites in uteroferrin and the related beef spleen purple phosphatase.
EPR, Mossbauer, NMR and magnetic susceptibility studies are consistent


7
with a model in which the iron atoms occupy two distinct but adjacent
sites which are sufficiently close so that the two atoms are
magnetically coupled (Davis and Averill, 1982; Debranner et al., 1983;
Lauffer et al., 1983). Purple, enzymatically inactive uteroferrin is
believed to contain two ferric ions. This form of uteroferrin gives no
EPR signal, presumably because the spins of the two ferric ions are
antiferromagnetically coupled, with a net spin of zero. When purple
(Emax=545nm) uteroferrin is treated with mild reducing agents and turns
pink (Emax=508nm), it contains a ferric-ferrous iron pair, which gives
rise to an intense g'=1.74 EPR signal at liquid helium temperatures
(Antanaitis and Aisen, 1983). The naturally occurring, high molecular
weight pink form of uteroferrin gives rise to the same g'=1.74 EPR
signal without the addition of reducing agents (Baumbach et al., 1986).
At present there is no adequate model to describe the iron binding
sites of uteroferrin. Resonance-Raman studies have shown that the
purple-pink color most likely arises from coordination of iron to
tyrosine residues (Gaber et al., 1979). The iron atom involved is
probably the less labile one at the Fe(III) site on pink reduced
uteroferrin, since the molar extinction coefficient does not change when
the protein is reduced from its purple to its pink form. However, the
color change from purple to pink most likely represents disulfide
reduction rather than reduction of iron (Schlosnagle et al., 1976).
Histidine has also been implicated as a ligand for the iron atoms
(Lauffer et al., 1983), and an oxygen atom has been suggested to bridge
the iron sites (Mockler et al., 1983). Orthophosphate is coordinated
with the iron center on purple uteroferrin (Antanaitis and Aisen, 1983).


8
The amino acid sequence of uteroferrin revealed that the iron binding
sites must be non-identical, because the protein contains no internal
repeats with histidine and tyrosine residues in identical spacial
relationships. It is not clear which of the 10 histidine and 10
tyrosine residues which are conserved in uteroferrin and the beef spleen
enzyme could be ligands for the metals (Hunt et al., 1987).
A Proposed Reaction Mechanism for Uteroferrin
Unlike the alkaline phosphatases where the role of the Zn(II) is
fairly well understood, the function of the iron atoms in catalytic
activity of uteroferrin and the other purple acid phosphatases is
unknown. Competitive inhibitors such as phosphate and arsenate interact
with the paramagnetic centers on these proteins, which suggest that the
metal contributes to substrate binding (Davis and Averill, 1982, Kawabe
et al., 1984). Such substrate-iron complexes would probably be stable
around pH 5.0, and may explain the acid pH optimum. The iron, by virtue
of its strong electron withdrawing properties, could therefore promote
catalysis.
It is well documented that the reaction mechanism of the zinc-
containing alkaline phosphatases involves a phosphoryl-enzyme
intermediate (Levine et al., 1969). Previous experimental evidence
obtained with a variety of acid phosphatases also indicated the
formation of a phosphoryl-enzyme intermediate, with a double
displacement reaction mechanism (Hickey and VanEtten, 1972; Igarashi et
al., 1970; Feldman and Butler, 1969). Kinetic evaluation of bovine
purple acid phosphatases indicated that these uteroferrin-like enzymes
undergo a pseudo Uni Bi hydrolytic transfer reaction mechanism (Lau et


9
al., 1987; Davis et al., 1981). This theory is supported by the fact
that transition state analogs of phosphate such as vanadate, molybdate
and fluoride are potent inhibitors of uteroferrin and the other purple,
iron-containing acid phosphatases. Lack of inhibition by p-nitrophenol
suggests that the hydrolysis reaction proceeds via sequential release of
p-nitrophenol and phosphate (Davis et al., 1981):
E + pNPP ,r^ E- pNPP ^E-Pi-pNPP
pNP
: E Pi:
E + Pi
Uteroferrin Contains at Least One High Mannose Oligosaccharide
Chen et al. (1973) reported that the progesterone-induced purple
protein of the porcine uterus was a glycoprotein, and that the
oligosaccharide contained significant amounts of mannose. The structure
of the triantennary 5 or 6 mannose oligosaccharide has been determined
(Saunders et al., 1985), for uteroferrin purified from allantoic fluid
and uterine flushes from pseudopregnant animals.
Man
vcl,6
Man
\ 1,6
'1.3 \
Man Man ^ ^.GlcNAc y GlcNAc
/l, 3
(Man oc-'- Man '
The biosynthesis of uteroferrin's oligosaccharide chain has been
studied in vitro with explants of uterine endometrium. When [^p] was
provided to such cultures, the label became incorporated into the high


10
mannose oligosaccharide chains of uteroferrin (Baumbach et al., 1984).
Approximately one-third of the oligosaccharide chains cleaved from
uteroferrin by endoglycosidase H had phosphorylated carbohydrate groups:
Thus, uteroferrin, a secreted acid phosphatase, carries the lysosomal
recognition marker, mannose 6-phosphate, considered to be responsible
for the intracellular targeting of acid hydrolyses from the Golgi
complex to the lysosomes (Shephard et al., 1983). These results implied
that uteroferrin is a substrate in vivo for the first of the two enzymes
responsible for the addition of phosphate to terminal mannosyl residues
on lysosomal enzymes. UDP-N-acetylglucosamine: lysosomal enzyme
N-acetylglucosamine 1-phosphate transferase (phosphotransferase) adds
N-acetylglucosamine 1-phosphate from the nucleotide sugar UDP-N-acetyl-
glucosamine to the 6-position of terminal mannose residues. Then
N-acetylglucosamine-l-phosphodiester oc-N-acetylglucosaminidase
(phosphodiesterase) cleaves the resulting phosphodiester bond adjacent
to the N-acetylglucosamine residue (Goldberg and Kornfeld, 1983).
Receptors for mannose 6-phosphate then transport these enzymes from the
Golgi to lysosomes (Shephard et al., 1983). It was also demonstrated
that uteroferrin is an excellent substrate for the phosphotransferase in
vitro (Lang et al., 1984), in fact, it was the best substrate of those
tested so far.
Why is uteroferrin secreted rather than directed to lysosomes?
There are a number of possible explanations. Although uteroferrin is a
good substrate for the phosphotransferase, the covering N-acetyl
glucosamine is not efficiently removed by the phosphodiesterase, thus
masking the mannose 6-phosphate (Baumbach et al., 1984), and such


11
phosphodiesters are poor substrates for both mannose 6-phosphate
receptors (Hoflack et al., 1987). The presence of only one
phosphorylated mannose residue on uteroferrin's oligosaccharide may also
make it a poor ligand for the mannose 6-phosphate receptors (S.
Kornfeld, personal communication). The most likely explanation,
however, is that the rate of uteroferrin synthesis in the pregnant
uterus outstrips the intracellular targeting mechanism. Finally, it is
also possible that the primary amino acid sequence of uteroferrin
contains targeting information that directs it to secretory granules
despite the fact that it carries phosphorylated mannose residues.
The Function of Uteroferrin
Roberts and Bazer (1980) have proposed that the primary function of
uteroferrin is not phosphate ester hydrolysis, but in iron metabolism.
Uteroferrin's high Km, unusual substrate specificity and lack of
activity at the pH of the fluid environment in which it is found argues
against an enzymatic role. The uterus of a mid-pregnant pig can produce
more than two grams of uteroferrin per day (Basha et al., 1979), an
amount far exceeding that which could conceivably be used for enzymatic
purposes. Since large quantities of uteroferrin are known to cross the
pig placenta, and the iron from [59 Fe] labeled uteroferrin is used for
fetal erythropoiesis (Buhi et al., 1982a; Ducsay et al., 1982; Renegar
et al., 1982), the role of uteroferrin in the pregnant pig is proposed
to be in iron transport.
The pig has a non-invasive type of placentation, and at no time
during pregnancy is the uterine epithelium eroded. The conceptus
therefore relies upon the secretion of macromolecular products by the


12
mother for a large part of pregnancy. Using a variety of immunochemical
and radiotracer techniques, the path of uteroferrin movement from the
mother to the fetus has been determined in the pig (Buhi et al., 1982a;
Ducsay et al., 1982; Renegar et al., 1982; Ducsay et al., 1984; Roberts
et al., 1986b). Uteroferrin is synthesized in the uterine glands
(Renegar et al., 1982), each of which is covered by a special region of
the chorion (fetal placenta) called an areola. This structure is made
up of specialized absorptive cells filled with large endocytotic
vacuoles. Uteroferrin has been identified in these structures by
immunogold staining (Roberts et al., 1986a) and within the venous
drainage of the placenta. It is cleared from the bloodstream in part by
the fetal liver, which is the major site of fetal hematopoiesis, and
also by the kidney where it enters the urinary filtrate and is voided
into the allantoic sac (Renegar et al., 1982). Uteroferrin in the
allantoic fluid loses its iron to fetal transferrin, which in turn
transports the iron to the fetal liver (Buhi et al., 1982a).
Uteroferrin's synthesis in the porcine uterus and its turnover in
the fetal liver could theoretically supply developing fetuses with
enough iron until day 75 of pregnancy. However, uteroferrin synthesis
appears to fall in late pregnancy, just when iron demand for
erythropoiesis is at a maximum (Roberts and Bazer, 1980). Therefore,
other mechanisms of iron transport may be necessary in order to supply
these needs.
Other Purple. Iron-containing Acid Phosphatases
Several other tartrate-resistant acid phosphatases have been
purified from a variety of sources. A uteroferrin-like purple acid


13
phosphatase has been purified from the uterine secretions of mares in
prolonged diestrus (Zavy et al., 1978; McDowell et al., 1982). An acid
phosphatase has also been partially purified from the uterine secretions
of cows treated with progesterone (Dixon and Gibbons, 1979). These
discoveries were not unexpected, because the pig, the cow and the mare
have similar types of non-invasive placentation.
In 1960, a basic, purple phosphoprotein phosphatase was identified
in beef spleen (Revel and Racker, 1960; Glomset and Porath, 1960) and
was later shown to contain iron (Campbell and Zerner, 1973). Like
uteroferrin, this enzyme showed intense absorption in the range 510-
545nm, and contained two iron binding sites (Davis et al., 1981). Davis
et al. also demonstrated that the substrate specificities, sensitivity
to inhibitors and activation by reducing agents exhibited by the beef
spleen enzyme were similar to those of uteroferrin. However, the beef
spleen enzyme (Mr=40,000) was reported to be made up of two subunits
(Mr=24,000 and 15,000), while uteroferrin is a monomeric enzyme (Mr=
35,000). The beef spleen enzyme has been well characterized with regard
to its iron binding sites, which are virtually identical to those of
uteroferrin (discussed earlier). Thus, the bovine spleen enzyme's iron
cluster is an asymmetrical complex containing two Fe(III) ions, one of
which is reduced to Fe(II) by reductive activation of the enzymes (Davis
and Averill, 1982; Antanaitis and Aisen, 1983; Debranner et al., 1983;
Antanaitis and Aisen, 1982).
The function of the beef spleen enzyme has been addressed only
recently. Schindelmeiser et al. (1987) have localized the enzyme to
lysosomal-like organelles of cells of the reticulo-phagocytic system.


14
The phagocytosing cells that contained the phosphatase were frequently
found in close contact with clusters of aged and deformed erythrocytes.
The authors hypothesized that the enzyme is involved either in the
breakdown of erythrocyte membrane and cytoskeletal phosphoproteins, or
in the metabolism of iron from these erythrocytes.
There have been reports of a bovine skeletal tartrate-resistant acid
phosphatase, assumed to be distinct from the bovine spleen enzyme (Lau
et al., 1985, 1987). This bovine skeletal enzyme resembles the bovine
spleen enzyme and porcine uteroferrin in its molecular weight, pH
optimum, substrate specificities and sensitivity to inhibitors. Like
uteroferrin, and unlike the bovine spleen enzyme, the bovine skeletal
enzyme is reported to be monomeric. The authors chose to stress the
phosphotyrosine phosphatase activity of the enzyme and postulated that
the skeletal acid phosphatase functions in the regulation of
proliferation and differentiation. The authors have not yet described a
physiologic substrate for this phosphoryrosyl-specific protein
phosphatase, and have not demonstrated that it plays an important role
in cell growth. Thus, the function of the acid phosphatase in bone
remains unknown.
Purple, iron-containing acid phosphatases have been purified from
rat spleen (Hara et al., 1984) and rat bone (Kato et al., 1986; Anderson
and Toverud, 1986), and an immunologically related phosphatase was
purified in small quantities from rat epidermis (Hara et al., 1985).
These monomeric enzymes also resembled uteroferrin in molecular weight,
substrate specificities and sensitivity to inhibitors. Hara et al.
(1984, 1985) believe that the spleen and epidermis enzymes may play a


15
role in nucleotide metabolism and that the bone enzyme may be acting as
a phosphoprotein phosphatase in vivo. Although Anderson and Toverud
(1986) have indicated that studies were underway to determine the
function of the rat bone enzyme, the functions of the rat enzymes also
remain obscure.
Human Acid Phosphatases
The human acid phosphatases were first characterized by researchers
interested in the clinical significance of acid phosphatase levels in
normal and pathological tissue. One of the human enzymes, a cationic,
tartrate-resistant enzyme known as the Type 5 phosphatase, was of
interest to us because it seemed as though it might be related to the
well characterized abundant acid phosphatase, porcine uteroferrin.
Characterization of the Human Acid Phosphatases
Li et al. (1970) described electrophoretic separation of human
leukocyte acid phosphatases on 7.5% polyacrylamide gels at pH 4.0, which
were then stained for acid phosphatase activity. They detected six
isozymes of acid phosphatase, varying in electrophoretic mobility. Band
0 did not enter the gel. Band 1 was the slowest migrating form, band 5
the fastest and most basic. The various isozymes could also be
distinguished by their substrate specificities and sensitivity to
inhibitors.
Lam et al. (1973) described in detail the distribution of acid
phosphatases in normal human tissue. Isozymes 1 and 3 were the most
widely distributed and most active forms. Higher type 2 levels were
characteristic of the prostate. Type 5 was the least common and least


16
abundant isozyme, detected in only small quantities in spleen, kidney
and liver.
These researchers noticed differences in acid phosphatase levels and
in relative isozyme ratios in normal plasma and leukocytes versus those
from patients with certain diseases. In normal leukocytes, band 1 was
the strongest, bands 2, 3 and 4 were of moderate strength and band 5 was
very weak (Yam et al., 1971). Patients with infectious mononucleosis,
for example, exhibited elevated levels of isozymes 1, 3 and 5 in
leukocytes (Li et al., 1973). Isozyme 2 was found to be elevated in the
plasma of patients with prostatic cancer (Lam et al., 1973). Perhaps
the most striking isozyme pattern was evident in the leukocytes and
spleen homogenate (but not plasma) of patients with hairy cell leukemia.
The leukemic white cells of these patients produced very small amounts
of isozymes 1 through 4, and large quantities of isozyme 5 (Yam et al.,
1971).
Yam et al. (1971) also determined that while acid phosphatase
isozymes 1,2,3 and 4 were completely inhibited by 50mM L-(+)-tartrate,
isozyme 5 was unaffected by this reagent. (Recall that uteroferrin is
resistant to inhibition by tartrate). This observation made it easier
to detect the presence of elevated levels of the Type 5 isozyme in hairy
cell leukemia and allowed cytochemical localization of only this isozyme
in leukocytes and tissue sections. The presence of tartrate-resistant
acid phosphatase activity in the hairy cells in blood smears is the
major method of diagnosis of hairy cell leukemia today (Nanba et al.,
1977; Janckila et al., 1978; Braylan et al., 1979).


17
Hairy Cell Leukemia
The origin of hairy cells has been a subject of controversy for a
number of years. Surface marker studies done with monoclonal antibodies
have revealed hairy cells with properties common to both B-cells and
T-cells (Burns et al., 1980; Worman et al., 1983; Armitage et al.,
1985). Hairy cells have been shown to phagocytose latex particles,
properties which indicated a common origin with monocytes or histiocytes
(Rosenszajn et al., 1976). However, most researchers now agree that
hairy cells have originated from B-lymphocytes, possibly splenic white
pulp marginal zone lymphocytes (Van der Oord et al., 1985). More
specifically, hairy cells may originate from a lymphocyte in a terminal
stage of differentiation, at the point of switching from an IgM-bearing
small lymphocyte to a mature plasma cell (Jansen et al., 1979).
Recently it was proposed that the hairy cell may represent the
terminally differentiated B-lymphocyte (Robinson et al., 1985; Gazitt
and Polliack, 1987).
Clinically, hairy cell leukemia is represented by a slow insidious
onset, splenomegaly, anemia and the appearance of leukemic hairy cells
in the spleen, bone marrow and peripheral blood (Nanba et al., 1977).
Significant quantities of tartrate-resistant acid phosphatase are
contained in the reticulum and epithelioid cells of the patients'
spleens. In the past splenectomy was often performed in order to reduce
the tumor load. More recently, it has been demonstrated that
oc-interferon treatment is successful in causing remission in hairy cell
leukemia patients (see Porzsolt, 1986).


18
Tartrate-resistant Acid Phosphatase Levels in Other Diseases
Tartrate-resistant acid phosphatase levels are elevated in several
types of leukemia other than hairy cell leukemia but not in a consistent
manner. Drexler et al. (1985, 1986) have studied acid phosphatase
levels in a variety of human leukemia cell lines and in fresh leukemia
cells obtained directly from patients. These researchers found that the
few leukemia cell lines which did express the phosphatase were those
which represented lymphocytes arrested late in differentiation. Many
researchers now believe that tartrate-resistant acid phosphatase may be
useful as an enzymatic marker for B-lymphocyte differentiation (Drexler
et al., 1985) and that measurement of its activity may have prognostic
value (Pieters and Veerman, 1987) .
Measurement of serum acid phosphatase levels may also be of clinical
significance. While the Type 5, tartrate resistant acid phosphatase is
not detected at high levels in the plasma of patients with hairy cell
leukemia, plasma levels of this isozyme are high in patients with
diseases which involve bone reabsorption and regeneration, and in
patients with malignancies metastasized to bone (Lam et al., 1978).
These diseases include Paget's disease, which is a type of bone tumor,
and osteoporosis (Li et al., 1973). Tartrate-resistant acid phosphatase
activity is also elevated in the plasma of children during bone growth
(Chen et al., 1979). Plasma levels of the Type 5 phosphatase are also
high in patients with Gaucher's disease, which is an inherited
glycosphingolipid storage disease characterized by /3-glucocerebrosidase
deficiency. The phosphatase in Gaucher's disease is believed by some


19
researchers to be of osteoclast origin, and most likely a secondary
phenomenon indicative of bone involvement (Choy, 1985).
It is interesting to note that while the acid phosphatase of hairy
cells is intracellular, confined to discrete inclusion bodies resembling
lysosomes (Lam et al., 1976), osteoclasts secrete this enzyme under the
influence of parathyroid hormone (Miller, 1985; Braidman et al., 1986;
Chambers et al., 1987). It is not clear whether the secreted osteoclast
and lysosomal spleen Type 5 phosphatases are distinct enzymes.
Purification and Characterization of the Human Type 5 Isozyme
In all of the studies described above, acid phosphatase levels were
measured by histochemical methods or by enzymatic staining of non
denaturing polyacrylamide gels. There are a few reports in the
literature of attempts to purify and characterize the human tartrate-
resistant acid phosphatase. Although these reports contain some
contradictory information, one fact becomes apparent: This human Type
5, tartrate-resistant acid phosphatase has a number of properties
reminiscent of porcine uteroferrin.
An attempt was made by Lam and Yam (1977) to purify this human Type
5 acid phosphatase from the spleen of a patient with hairy cell
leukemia. They were not able to purify the enzyme to homogeneity.
Although the authors reported an Mr of 64,000, which is almost twice
that of uteroferrin, many of the characteristics they reported for the
enzyme were reminiscent of the characteristics of uteroferrin and the
other purple, iron-containing acid phosphatases. The human hairy cell
enzyme, like uteroferrin, was a very basic protein. This human enzyme,


20
also like uteroferrin, hydrolyzed p-nitrophenylphosphate, ATP and
pyrophosphate but was virtually inactive towards hexose phosphates,
/?-glycerol phosphate and AMP. The human enzyme was also activated by
mild reducing agents and very sensitive to inhibition by molybdate.
A tartrate-resistant acid phosphatase was also purified from a
Gaucher's disease spleen (Robinson and Glew, 1980; 1981). This enzyme
was believed to be distinct from the hairy cell spleen enzyme. Like
uteroferrin and the other purple, iron-containing acid phosphatases,
this enzyme was reported to have an Mr of 33,000. It bound avidly to
Concanavalin A Sepharose, indicating its glycoprotein nature. It, too,
was sensitive to inhibition by molybdate, fluoride and dithionite.
However, this enzyme had a number of features which were unlike the
hairy cell enzyme. It was reported that the Gaucher enzyme was made up
of two subunits of Mr 20,000 and 16,000, did not hydrolyze
pyrophosphate, and was not activated by reducing agents. Thus, it was
not clear whether the Gaucher spleen and hairy cell spleen enzymes were
the same protein. Efstratiatis and Moss (1985) partially purified an
Mr=37,000 tartrate-resistant, molybdate-sensitive acid phosphatase from
lung, and detected an apparently identical enzyme in osteoclasts. It is
not known whether the lung/osteoclast tartrate-resistant acid
phosphatase is identical to either of the spleen enzymes.
Although it was once believed that uteroferrin was uniquely
associated with the uterus (Roberts and Bazer, 1980), it is now clear
that there is a growing family of purple, iron-containing acid
phosphatases. The human tartrate-resistant acid phosphatase may belong
to this enzyme family. Because of the clinical significance of the


21
human Type 5 phosphatase, it seemed to be a subject worthy of further
study. In Chapter 2, the purification of the human tartrate-resistant
acid phosphatase to homogeneity is described, and its physical
properties are clearly defined. The enzymatic characteristics of the
phosphatase are described in detail, and the immunologic relationship of
the human enzyme to the purple, iron-containing acid phosphatases is
investigated. Chapter 3 deals with the molecular cloning of a cDNA
coding for the human tartrate-resistant acid phosphatase, the
characteristics of the deduced amino acid sequence, and the expression
of the enzyme in leukemia cells.


CHAPTER 2
THE TYPE 5, TARTRATE-RESISTANT ACID PHOSPHATASE FROM SPLEEN OF HUMANS
WITH HAIRY CELL LEUKEMIA. PURIFICATION, PROPERTIES, IMMUNOLOGICAL
CHARACTERIZATION, AND COMPARISON WITH PORCINE UTEROFERRIN.
Introduction
Measurement of serum and tissue levels of acid phosphatase can prove
useful in the diagnosis of several human disease states (Gutman et al.,
1936; Yam et al., 1980; Drexler and Gaedicke, 1983; Yam et al., 1983;
Allhoff et al., 1983). At least six isozymes of acid phosphatase have
been identified by their relative electrophoretic mobilities towards the
cathode at low pH. The most basic, a minor isozyme known as Type 5, is
elevated in the circulating white cells and enlarged spleens of patients
with hairy cell leukemia (Lam et al., 1980; Yam et al., 1983; Yam et
al., 1971; Lam and Yam, 1977) and in spleens and sera of patients with
Gaucher's disease (Choy, 1983). This same isozyme also appears to be a
secretory product of osteoclasts (Minkin, 1982; Chen et al., 1979;
Stepan et al., 1983), and of osteoclastic bone tumors (Chen et al.,
1979; Tavassoli et al., 1980). The Type 5 phosphatase can be
distinguished from the other isozymes, not only by its basic nature, but
also because it is not inhibited by L-(+)-tartrate. Indeed, the
cytohistochemical demonstration of a tartrate-resistant acid phosphatase
within leukemic hairy cells is currently the most usual method of
diagnosing this rare form of leukemia (Nanba et al., 1977; Janckila et
al., 1978; Braylan et al., 1979).
22


23
The enzyme produced by the spleen histiocytes of patients with
Gaucher's disease has been purified in very small quantities by Robinson
and Glew (1980). This phosphatase was activated by reducing agents and
had high catalytic activity towards a variety of substrates, both
artificial and natural, which had strong leaving groups, but had very
low activity towards aliphatic phosphate esters. It was also a
phosphoprotein phosphatase. A similar enzyme has been isolated from the
spleen of a patient with hairy cell leukemia (Lam and Yam, 1977).
However, the latter enzyme appeared to differ from the Gaucher
phosphatase in a number of respects, including its response to reducing
agents, its molecular weight and its substrate specificity. Moreover
its specific activity was about 10-fold lower than that of the Gaucher
enzyme.
The enzymatic properties of the Type 5 human isozyme are very
similar to those of a well characterized, abundant acid phosphatase
known as uteroferrin. This unusual molecule is a purple colored, iron-
containing glycoprotein that was first purified from uterine secretions
of pigs (Chen et al., 1973). Its synthesis, which occurs within the
glandular epithelium of the uterus (Renegar et al., 1982), is under
progesterone control (Roberts and Bazer, 1980). During pregnancy
approximately 2g of the protein are produced daily (Basha et al., 1979).
It has been shown to be taken up by the overlying placenta and to enter
the fetal blood stream (Renegar et al., 1982). Its iron is then rapidly
utilized in fetal erythropoiesis (Ducsay et al., 1982; Buhi et al.,
1982a). A role for uteroferrin in transplacental iron transport has
been proposed (Roberts and Bazer, 1980; Buhi et al., 1982a). However,


24
the fact that uteroferrin, particularly when activated with mild
reducing agents such as ascorbate or mercaptoethanol, is a potent acid
phosphatase (Schlosnagle et al., 1974; 1976) has raised questions as to
whether iron transport is the major or only function of the protein
(Davis et al., 1981). In this regard, acid phosphatases which are
clearly similar to uteroferrin in their spectral properties, molecular
weight, and iron content have been isolated from a variety of sources
(Antanaitis and Aisen, 1983). In addition, there are several
descriptions of acid phosphatases, including the Type 5 human isozyme,
which resemble uteroferrin in their enzymatic properties, but which have
either not been purified or else have been isolated in such small
quantities that they have not been fully characterized (Roberts and
Bazer, 1976). For the above reasons it has been proposed that
uteroferrin may be but one member of a broad class of acid phosphatases
which has a wide distribution (Roberts and Bazer, 1980; 1976).
Chapter 2 contains the description of a simple method for the
purification of the enzyme from human spleen by making use of antibodies
to the readily available uteroferrin. It is demonstrated conclusively
that this human isozyme belongs to the class of iron-containing acid
phosphatase best illustrated by uteroferrin. Monoclonal antibodies have
been prepared against both uteroferrin and the human enzyme which appear
to have broad reactivity towards this class of enzyme.
Materials and Methods
Materials
CM-cellulose was obtained from Whatman, Sephadex G-100 and
Sepharose-4B from Pharmacia, and Triton X-100 from Rohm and Haas Co.


25
All substrates, activators, and inhibitors (except anions) used for acid
phosphatase assays, cyanogen bromide, protein standards, Fast Garnet GBC
salt, buffers and protease inhibitors were purchased from Sigma.
Reagents for the Bradford protein assay were purchased from Bio-Rad.
Isozyme standards from serum (for human acid phosphatase activity) were
obtained from Calbiochem-Behring. All other chemicals (reagent grade or
better) were obtained from Fisher.
Methods
Purification of uteroferrin. Uteroferrin was purified from the
uterine secretions of pseudopregnant pigs or from allantoic fluid as
previously described (Schosnagle et al., 1974; Roberts and Bazer 1980).
Allantoic fluid was dialyzed overnight at 4C against 0.01M Tris-HCl,
pH 8.2. A slurry of carboxymethyl-cellulose (CM-cellulose; 100ml of
settled resin per 4L allantoic fluid) was added in the same buffer.
This mixture was stirred for 1 hour, then packed into a column and
washed with the above buffer. The bound, basic proteins were eluted in
one step by a high salt buffer (0.01M Tris-HCl, pH 8.2, 0.5M NaCl). The
proteins were dialyzed against 0.01M Tris-HCl, pH 8.2 and applied to a
Sephadex G-100 column (5 x 90 cm) which had been previously equilibrated
in 0.1M sodium acetate, pH 4.9 and 0.33M NaCl. (Uterine secretions of
pseudopregnant animals were loaded directly onto the Sephadex G-100
column after centrifugation at 10,000xg at 4C for 30 minutes.) The
pink, high molecular weight uteroferrin peak, which immediately preceded
the purple peak, was pooled and used without further purification. The
uteroferrin peak, purple in color, was pooled and dialyzed against 0.01M
Tris-HCl, pH 8.2. The uteroferrin was then loaded onto a column of


26
CM-cellulose and eluted with a linear salt gradient (0.01-0.5M NaCl).
Uteroferrin eluted as a symmetrical peak between 0.20 and 0.25M NaCl.
The final preparations of uteroferrin had A280/A545 ratios of less than
14 and gave a single band of apparent Mr=35,000 upon polyacrylamide gel
electrophoresis (PAGE) in the presence of sodium dodecyl sulfate (SDS).
Purification of acid phosphatase from human spleen. Spleen tissue was
used from a male aged 52 who was diagnosed as having hairy cell
leukemia. The weight of the spleen was 2.3kg. The normal control
spleen from an accident victim weighed 0.22kg. Tissue was cut into
slices, the outer fascia removed, and the slices diced into small cubes.
These were homogenized at 4C in extraction buffer [0.05M Tris acetate,
pH 7.5, 2% (v/v) Nonidet P-40, 0.02% (w/v) sodium azide, ImM
phenylmethanesulfonyl fluoride (PMSF), ImM EDTA, and aprotinin (1
trypsin inhibitory unit/ml)] by means of a Teckmar Model SDT homogenizer
(half-full setting) with the largest probe until a homogeneous
preparation was obtained. A volume of 150ml of extraction buffer was
used for each lOOg of tissue. The homogenate was centrifuged (30,000xg;
20 minutes) and the supernatant fraction dialyzed overnight against
0.01M Tris-HCl buffer, pH 8.2. A slurry (50ml) of CM-cellulose was
added to the retenate and stirred for 1 hour. This material was
collected on a Whatman No. 4 filter paper on a Buchner funnel. After it
was washed several times with 0.01M Tris-HCl buffer, pH 8.2, the CM-
cellulose was suspended in the same buffer and loaded into a glass
column. Proteins which had remained bound were eluted with 0.5M NaCl.
In initial experiments, the eluted material was dialyzed and loaded onto
a column of CM-cellulose (1 x 5cm) in 0.01M Tris-HCl buffer, pH 8.2.


27
Elution was performed by means of a gradient (180ml; 0.01-0.5M) of NaCl
at pH 8.2. Fractions which contained the enzyme were pooled, dialyzed,
and freeze-dried, and then subjected to gel filtration on a column (2.5
x 80cm) of Sephadex G-100 which was equilibrated with 0.01M sodium
acetate buffer, pH 4.9, containing 0.33M NaCl. Elution of the protein
was followed by its absorbance at 280nm and by measuring acid
phosphatase activity (see below). Fractions which contained the
phosphatase were pooled and loaded directly onto an anti-uteroferrin
immunoaffinity column (see below).
After the immunoaffinty column had been washed thoroughly with
loading buffer (0.01M Tris-HCl, pH 8.2, containing 0.3M NaCl), the bound
enzyme was eluted with 0.05M glycine-HCl buffer containing 0.15M NaCl,
pH 2.3. It was collected in 1ml fractions. Each fraction was
immediately neutralized with 0.1ml of 1M Tris-HCl, pH 8.2.
More recently, enzyme which had been eluted form the CM-cellulose
column with 0.5M NaCl was loaded directly onto the immunoaffinity column
without including intervening ion exchange and gel filtration steps.
Purification of acid phosphatase from human placenta. A normal term
placenta, weighing 630g was employed to purify the acid phosphatase by
exactly the same procedure described for human spleen. An alternative
method of enzyme purification was employed for a second normal term
placenta weighing 650g. The second placenta was homogenized in 1300ml
of a lysis buffer which consisted of 0.3M KC1, 2% (v/v) Nonidet P-40,
ImM PMSF and 0.2% (w/v) sodium azide. After centrifugation at 30,000xg
for 20 minutes at 4C, protamine sulfate was added to the supernatant
fraction to 0.1% (w/v). The solution was stirred for 1 hour at 4C,


28
then centrifuged at 30,000xg for 15 minutes. The resulting supernatant
fraction was dialyzed overnight against 0.01M Tris-HCl, pH 8.2. A
slurry of CM-cellulose (50ml) was added and the mixture stirred for 1
hour at 4C. The bound proteins were eluted from the CM-cellulose as
described for uteroferrin. The entire pool of basic proteins was then
subjected to immunoaffinity chromatography as described for the human
spleen enzyme.
Purification of the bovine spleen acid phosphatase. The procedure
described for the human spleen enzyme was also employed for the bovine
spleen enzyme. Approximately 200g of beef spleen tissue were used.
Purification of the rat spleen phosphatase. The spleens of three
rats (approximately 2g) were homogenized as described for the human
enzyme. After centrifugation at 30,000xg, the supernatant fraction was
loaded directly onto the immunoaffinity column. Elution was performed
as described for the human enzyme.
Purification of the bovine uterine acid phosphatase. Bovine uterine
fluids were obtained from the ligated uterine horn of day 270
unilaterally pregnant cattle (Bartol, 1983). Approximately 400ml of
bovine uterine fluids were dialyzed overnight against 4 liters of 0.01M
Tris-HCl, pH 8.2. The solution was centrifuged (30,000xg; 20 minutes)
to remove particulate matter and passed through a column (lx 5cm) of
CM-cellulose equilibrated in the same buffer. After washing the column,
proteins which had bound were eluted with 0.5M NaCl in 0.01M Tris-HCl,
pH 8.2. These basic proteins were then subjected to gel filtration on a
column (2.5 x 80cm) of Sephadex G-100 which had been equilibrated with
0.01M acetate buffer, pH 4.9 containing 0.33M NaCl. Protein


29
concentration was monitored by absorbance at 280nm, and acid phosphatase
activity monitored by p-nitrophenylphosphatase activity (see below).
Measurement of p-nitrophenvlphosphatase activity. The standard
colorimetric assay utilized an appropriately diluted sample of enzyme,
20mM p-nitrophenylphosphate and 0.1M sodium acetate buffer (pH 4.9 for
uteroferrin, pH 5.3 for the human and rat enzymes, pH 6.0 for the beef
spleen enzyme and pH 4.5 for the bovine uterine enzyme) in a final
volume of 1ml. The enzymes were assayed in the presence of 0.1M
2-mercaptoethanol except where stated in the text. The reaction was
allowed to proceed at 37C for 10 minutes and stopped by the addition
of 1ml of 1M NaOH. The absorbance was then read at 410nm. Activity is
expressed as units, where one unit is the release of l^mol p-nitro-
phenol/minute.
Hydrolysis of other substrates. With the exception of phosvitin,
other substrates were assayed at a final concentration of 5mM. The
release of orthophosphate was measured spectrophotometrically by the
method of Bartlett (1959), which involves the reduction of
phosphomolybdate to a blue color (Emax=830nm). Blanks without enzyme
were run for each substrate. The release of orthophosphate from
phosvitin (10mg/ml) was measured as described by Roberts and Bazer
(1976).
pH optima. The pH optima of the acid phosphatases were determined
with the use of 0.1M sodium acetate, pH 3.0-5.4, 0.1M Tris acetate, pH
5.6-6.5, and 0.1M Tris-HCl, pH 7.0-7.5 as buffers. The substrate used
was p-nitrophenylphosphate.


30
Protein determination. Protein concentration was determined by the
method of Lowry et al. (1951) with crystalline bovine serum albumin as a
standard. In order to measure low amounts of protein (less than 10/g)
the method of Bradford (1976) was employed with lysozyme as a standard
(see Bio-Rad Bulletin 1069, February 1979).
Determination of iron. Iron was measured by the method of Cameron
(1965) as modified by Campbell and Zerner (1973). All glassware was
soaked in 4M HC1 and rinsed several times with iron-free water to remove
metal contaminants. Protein samples, blanks and ferrous ammonium
sulfate standards were treated with 70% (v/v) perchloric acid for 30
minutes at room temperature to release iron from the protein. A
solution of 10% (w/v) hydroxylamine hydrochloride was added, and the
samples were left at room temperature for 30 minutes. Finally, batho-
phenantroline solution (4mg/ml), pyridine, and iron free water were
added successively to each sample and the solutions mixed thoroughly.
The absorbance of the solutions was measured at 536nm. The
concentration of iron in the protein was obtained from a plot of
absorbance versus iron concentration of the standards, which was linear
over a range of 0-4 ng.
Immunoaffinitv chromatography. Sepharose CL-4B, purchased in its
cyanogen bromide activated form, was prepared according to the
instructions of the manufacturer. Protein was coupled to the matrix in
0.1M sodium carbonate, pH 8.5 and 0.5M NaCl at 4C on a tube turner.
Alternatively, Sepharose 4B was activated for 30 minutes at 0C in 1M
potassium phosphate, pH 12, using cyanogen bromide (Cuatrecacas et al.,
1968) dissolved in N', N' dimethyl formamide. The gel was washed with


31
0.1M sodium bicarbonate, pH 8.9. Proteins were coupled at 4C overnight
on a tube turner in a buffer of 0.1M sodium bicarbonate, pH 8.9 and 0.5M
NaCl. Unreacted sites on the matrices were blocked with 1M
ethanolamine, pH 8.9 for 4 hours at 4C, after washing out unbound
protein with the coupling buffer. Finally, the gel was washed with
0.05M sodium acetate, pH 4.0, plus 1M NaCl, followed by 0.05M sodium
borate, pH 8.9, plus 1M NaCl.
Uteroferrin (10mg/ml) purified as described above was coupled to the
matrix with a 30-50% coupling efficiency. When stored at 4C in the
presence of 0.1% (w/v) sodium azide, it retained its purple coloration
and acid phosphatase activity for over a year. The uteroferrin-
Sepharose matrix was employed to purify anti-uteroferrin polyclonal
antibodies (see below). Anti-uteroferrin polyclonal antibodies were
then coupled to the matrix at a concentration of lOmg protein per ml of
gel. This anti-uteroferrin immunoaffinity matrix was employed to bind
the various spleen enzymes.
Preparation of polyclonal antibodies against uteroferrin. Samples
of uteroferrin (up to lOmg) were mixed with 5ml of Freund's Complete
Adjuvant to form an emulsion and injected intradermally over the
shoulder, rear leg and abdominal regions of one side of a female lamb.
Seven days later the procedure was repeated on the other side of the
lamb. A third injection was given seven days after the second. One
month after the first injection, serum was collected by jugular
venipuncture. The serum was allowed to clot at 4C overnight.
Following centrifugation at lOOOxg for 20 minutes, the serum was frozen
in small aliquots.


32
Polyacrylamide pel electrophoresis. SDS-polyacrylamide gel
electrophoresis (SDS-PAGE) was carried out in 12.5% (w/v) gels according
to the method of Laemmli (1970). Protein samples were solubilized in 5%
(w/v) SDS, 5mM Tris-HCl, pH 6.8, and 5% (v/v) 2-mercaptoethanol. Gels
were stained with 0.125% (w/v) Coomassie Brilliant Blue.
Electrophoresis was carried out under non-denaturing conditions
according to the method of Reisfield et al. (1962) as modified by Basha
et al. (1979). Basic proteins were resuspended in 5mM Tris-HCl, pH 6.8
and 10% (v/v) glycerol. The samples were subjected to electrophoresis
in 7.5% (w/v) polyacrylamide gels, pH 4.0 (which did not contain SDS) in
a /3-alanine buffer, pH 4.5. Proteins with acid phosphatase activity
were visualized with oc-naphthylphosphate substrate and fast Garnet GBC
as the coupling dye.
Binding to Concanavalin A-Sepharose (Con A-Sepharose). Enzyme
samples in 0.3M NaCl were adjusted to pH 6.5 and loaded onto a column of
Con A-Sepharose (approximately 5ml bed volume). The column was washed
with 3 volumes of 0.1M Tris-HCl, pH 8.2, 0.3M NaCl, ImM CaCl2, ImM MnCl
and 0.02% (w/v) sodium azide. Bound protein was eluted with warm (50-
60C) 0.01M oc-methyl-D-mannoside or 0.1M acetic acid (Baumbach et al.,
1984).
Immunization of mice. Female Balb/c mice at 8-48 weeks of age were
injected with 17.5/ug of antigen intraperitoneally (i.p.; Katzmann et
al., 1981) with antigen emulsified in 100//1 Freund's Complete Adjuvant.
A subsequent injection of 17.5 /ig was performed as above with Freund's
Incomplete Adjuvant, 10 days later. On day 17, a final injection was
administered in normal saline (0.9%, w/v) via the tail vein. The


33
antigens employed were as follows: For fusion 5, high molecular weight
uteroferrin was employed. This fusion was outlined in detail by
Baumbach (1984) and was carried out in collaboration with George
Baumbach. For fusion 6, uteroferrin (purple, Mr=35,000) was employed.
For fusion 13 the human hairy cell acid phosphatase was used.
Generation of monoclonal antibodies. The SP2/0-Ag 14 (SP2/0;
Schulman et al., 1978) non-secreting myeloma cell line was cultured in
Dulbecco's Modified Eagle's medium (DME) containing 10% (v/v) each of
heat inactivated fetal calf serum and agammaglobulinemic horse serum;
antibiotic solution (10/g/ml penicillin, 10/ig/ml streptomycin, 0.25/ig/ml
amphotericin B), and 2mM glutamine. One day-old (conditioned) medium
from logarithmic cultures was harvested and used for hybridoma medium
supplementation.
The method of splenocyte fusion and propagation of the resulting
hybrid cells was by established methodologies (Kennet et al., 1980; Oi
and Herzenberg, 1980). Two mice were anaesthetized with ether and the
spleens excised aseptically, trimmed of fat and then minced with sterile
scalpel blades in 20ml of DME. The tissue was then triturated several
times and the large debris allowed to settle. The splenocytes in the
supernatant fluid were then collected by centrifugation at lOOOxg for 5
minutes at room temperature, washed in 15ml of DME, and resuspended in a
final volume of 5ml DME and kept at room temperature. Approximately 10
SP2/0 cells were mixed and centrifuged at lOOOxg for 5 minutes. The
mixture of cells was resuspended in 1ml of 50% (w/v) polyethylene glycol
1000 in DME for 1 minute, then diluted to 31ml by the addition of 6ml
each minute for 5 minutes of DME-HAT (DME with hypoxanthine, O.lmM;


34
aminopterin, 0.8iM; thymidine, 16tM; Littlefield, 1964) supplemented
with 10% (v/v) each of fetal calf serum and heat-inactivated
agammaglobulinemic horse serum, 40% (v/v) conditioned medium and 2mM
glutamine. Aliquots (100/xl) were seeded into 96 well microtiter culture
dishes and incubated in an atmosphere of 5% CO2 at 37C.
Two weeks later, the culture supernatant fluid was withdrawn and
assayed for specific binding to uteroferrin using a solid phase binding
assay (see below). Positive cultures were resuspended in 500/il of DME-
HAT supplemented as described above and placed in 48 well cluster
dishes. When a culture was confluent, the cells were transferred to
O
25cm!L culture flasks and maintained in the medium described for SP2/0
cells. When cultures were growing well, cell densities were counted
with a hemacytometer and the cells cloned by limiting dilution (Rennet
et al., 1980). The cells were diluted to yield an average of 5, 1 or 0.1
cells per 100/il. Thirty-two wells were seeded with each dilution, and
the initial cell density which subsequently had less than 33% of the
wells with growth was rescreened for antibody production. Hybridoma
cells were maintained as described for SP2/0 cells and were frozen in
the standard growth medium with 30% (v/v) fetal calf serum and 10% (v/v)
glycerol or 10% (v/v) dimethyl sulfoxide.
Purification of mouse antibodies. Immune sera from mice were
collected immediately prior to splenectomy by cutting the descending
aorta aspirating the blood into a hypodermic syringe. Nonimmune
(normal) mouse sera were collected from uninjected, healthy,
anaesthetized animals.


35
Culture medium from growing hybridoma cells was used as a source of
monoclonal antibody in some instances. In other cases ascites fluid was
prepared by growing cloned hybridoma cells (1 x 10^) in the peritoneal
cavity 5 days after 2 i.p. injections of 0.5ml pristane (2,6,10,14-
tetramethylpentadecane) spaced 10 days apart. The ascites fluid was
harvested after the tumor had grown sufficiently, about 10-14 days. The
sample was allowed to clot at 4C, centrifuged at 1000xg for 20 minutes,
and sodium azide was added to 0.02% (w/v).
Iodination of antibodies. Iodination was performed according to the
method of Markwell and Fox (1978) and Markwell (Pierce Chemical Company
bulletin, 1978). Glass tubes were coated with 100/ig Iodogen (1,3,4,6-
tetrachloro-3oc-6oc-diphenylglycolluril) by evaporation of methylene
chloride. Mouse antibodies against uteroferrin or the human enzyme
(100/xg) in 1ml of buffer (0.02M sodium barbital, pH 7.5, 0.4M NaCl) were
added to the Iodogen coated tube. Carrier-free Na^^I (lOO^iCi) was
added and the tube shaken gently every minute for 15 minutes. The
iodinated protein was separated from unreacted ^~>I by dialysis (0.01M
Tris-HCl, pH 8.2) or gel filtration on a column of Sephadex G-50 (0.01M
Tris-HCl, pH 8.2, 0.2M NaCl).
Assay of antibodies. Antigen was dialyzed overnight against
phosphate-buffered saline (PBS; 0.14M NaCl, 1.5mM KH2PO4, 8mM Na2HPC>4,
3mM KC1, 0.5mM MgCl2, ImM CaCl2, pH 7.4) and adjusted to a concentration
of 50/ig/ml. Antigen was passively adsorbed overnight at 4C to
polyvinylchloride microtiter flex plates as outlined by Tsu and
Herzenberg (1980). The plates were washed three times with PBS
containing 1% (w/v) bovine serum albumin (BSA) and 0.02% (w/v) sodium


36
azide. Hybridoma culture medium (0.05ml) or diluted mouse antisera were
added and allowed to bind for 1 hour at room temperature. The plates
IOC
were washed as above and 50,000cpm of -L*-JI-labeled anti-mouse IgG in
50ml were added and allowed to bind for 1 hour. The plates were washed
as above, the wells cut out and bound radioactivity measured in a gamma
counter. Immune and non-immune sera were replicate tested six times,
and culture media were tested in duplicate.
Affinities of antibodies. Monoclonal antibodies against uteroferrin
or the spleen enzyme were affinity purified from either cell growth
medium or from ascites fluid on uteroferrin immobilized on Sepharose 4B.
The procedure was identical to that described earlier. The purified
antibodies were serially diluted in PBS containing BSA (lmg/ml) over a
range of concentrations extending from 10'^ to lO'^M. Uteroferrin or
the spleen acid phosphatases were plated out into wells on flexvinyl
plates as described in the previous section. After the wells were
washed and the remaining adsorption sites were blocked with BSA, the
plates were dried. Appropriately diluted solutions of antibody (0.05ml)
were then added to the wells and after 1 hour they were withdrawn and
the plates were washed. The amount of antibody that bound at each
dilution was then measured by addition of a constant amount of a second
labeled antibody. This antibody was ^5j_labeled sheep anti-mouse IgG
(see below). Its specific activity was approximately 10^ cpm//ig. After
1 hour, this solution was withdrawn, the plates were washed and each
well was analyzed for radioactivity separately in a gamma counter. All
determinations were carried out in duplicate. Controls were described
in the previous section. The binding affinities of each monoclonal


37
antibody to the different antigens were calculated by the method of
Scatchard (1949).
Competitive binding of monoclonal antibodies. In order to determine
whether various monoclonal antibodies bound to the same or different
sites on uteroferrin, a competitive binding assay was employed.
Uteroferrin was adsorbed to the wells of flexvinyl plates as described
IOC
earlier. Monoclonal antibodies were iodinated with cJI to a specific
activity of approximately 10^ cpm/pg. Samples of antibody (0.05ml;
50,000cpm) were added to each well in presence of increasing
concentrations (10 -10^M) of the second unlabeled antibody. If this
second antibody failed to compete or competed poorly with the labeled
antibody for binding to uteroferrin, it was assumed to occupy a distinct
site on the protein. Three monoclonal antibodies (5.122.10, 6.21.2, and
6.22.1), which bound to uteroferrin with high affinity, appeared to
compete only poorly with each other in the above assay.
Results
Purification of Uteroferrin
Figure 2-lA shows the fractionation on Sephadex G-100 of the basic
proteins obtained from one sample (4 liters) of allantoic fluid obtained
from a day 67 pregnant pig. Three major protein fractions were apparent
and designated FUI, FIV and FV by previous convention (Murray et al.,
1972; Chen et al., 1973). The average molecular weights of these
fractions were calculated to be approximately 80,000, 35,000 and 15,000
respectively. Fraction V contained lysozyme (Roberts et al., 1976) and
a group of trypsin/plasmin inhibitors (Mullins et al., 1980; Fazleabas
et al., 1982) and will not be discussed further. Fraction IV, purple in


Fig. 2-1 Purification of uteroferrin from allantoic fluid of a day 67
pregnant pig. A, Sephadex G-100 chromatography. Allantoic fluid (approximately
4L) from a day 67 pregnant pig was dialyzed and then stirred with CM-cellulose
at pH 8.2. Basic proteins were eluted with 0.5M NaCl, and then loaded onto a
5 x 90cm column of Sephadex G-100. Protein was monitored by absorbance at
280nm (A280) The peaks are labeled FUI, FIV and FV as explained in the text.
B, CM-cellulose ion exchange chromatography. Fill proteins obtained by
Sephadex G-100 chromatography (in A) were dialyzed and applied to a 1.5 x 10cm
column of CM-cellulose. Elution was performed with a 250ml gradient (0.01-
0.5M) of NaCl. Protein was monitored by absorbance at 280nm (A280) and purple
coloration by absorbance at 545nm (A545). Uteroferrin eluted as a single peak
between 0.20 and 0.25M NaCl.


A
FRACTION
A 280 <>
B


40
color, contained uteroferrin. When FIV was pooled, dialyzed, loaded
onto a column of CM-cellulose, and eluted with a linear sodium chloride
gradient, uteroferrin eluted as a single symmetrical peak (Fig. 2-1B).
Samples with an A280/A545 ratio of less than 14.0 were pooled and
considered to be pure uteroferrin (Buhi, 1982). In this typical
preparation of uteroferrin from allantoic fluid, about 135mg of pure
uteroferrin were obtained, which is considered to be an average yield
(Roberts and Bazer, 1980). Fraction III had an obvious pink color and
was demonstrated to be a high molecular weight form of uteroferrin,
consisting of uteroferrin non-covalently associated with a second
protein whose function is unknown (Baumbach et al., 1986). The yield of
the high molecular weight uteroferrin, pooled immediately after the gel
filtration step, was 47mg. The amount of Fill obtained varies greatly
between animals, with uterine secretions from early pregnancy or
pseudopregnancy containing more Fill than those from late pregnancy or
pseudopregnancy (Baumbach et al., 1986). The specific activities of
uteroferrin and high molecular weight uteroferrin from this preparation
were shown to be approximately 230 units/mg protein and 106 units/mg
protein, respectively. The total recoverable acid phosphatase activity
from the allantoic fluid of this day 67 pregnant pig was greater than
3.6 x 10^ units.
Purification of the Human Type 5 Acid Phosphatase from Hairy Cell Spleen
Levels of acid phosphatase in spleens from a patient with hairy cell
leukemia and from a normal individual are presented in Table 2-1. Note
that the spleen of the patient with hairy cell leukemia was greatly
enlarged. In addition, the specific activity of the extract from the


41
TABLE 2-1
phosphatase activity
in spleen homoeenates from a patient with hairy
cell
leukemia
and from an individual with a normal spleen
Weight
of
Addition to
Patient
Spleen
Phosphatase Assay
Specific Activity
kg
units/mg protein
1
2.3
None
0.453
0.01M NaK tartrate
0.483
0.1M 2-mercaptoethanol
0.662
None
0.011
2
0.22
0.01M NaK tartrate
0.007
0.1M 2-mercaptoethanol
0.012
Results from spleen 1 (weight 2.3kg) were obtained from 30,000xg
supernatant fraction of a slice (250g) of tissue that had been frozen
(-80C) for 2 weeks prior to assay. Results from spleen 2 were obtained
from the 30,000xg supernatant fraction from freshly homogenized tissue
of the entire organ which weighed 0.22kg. NaK tartrate is Rochelle's
salt and corresponds with the L-(+)-form of tartrate.


42
large hairy cell spleen was about 40-fold higher than that from the
normal spleen. Moreover, the acid phosphatase activity from this spleen
was unaffected by the addition of lOmM tartrate but was stimulated by
the presence of 0.1M 2-mecaptoethanol. By contrast, tartrate caused
almost a 40% inhibition of the total acid phosphatase activity in the
extract of normal spleen, and there was only a slight activation with
2-mercaptoethanol.
Two procedures have been employed for purification of the tartrate-
resistant acid phosphatase in the extract from the hairy cell spleen.
The first is illustrated in Fig. 2-2 and employed a gradient salt
elution from a column of CM-cellulose (Fig.2-2A), gel filtration on
Sephadex G-100 (Fig. 2-2B) and, as a final step, immunoaffinity
chromatography (Fig. 2-2C). The acid phosphatase, which is very basic,
was eluted from CM-cellulose at a salt concentration of 0.25M. Upon gel
filtration the enzyme emerged as a peak of apparent Mr=34,000, about one
fraction behind the elution position of highly purified uteroferrin.
The fractions containing the enzyme were pooled and loaded directly onto
an immunoaffinity column consisting of anti-uteroferrin antibodies
covalently linked to Sepharose 4B. All of the phosphatase activity
bound and could be quantitatively eluted using low pH buffer.
In the second procedure, the dialyzed extract of the spleen was
applied batchwise to CM-cellulose at pH 8.2 and the acid phosphatase
activity was eluted with 0.5M NaCl. Rather than subjecting the enzyme
which had bound to further CM-cellulose ion exchange chromatography and
gel filtration, the preparation was loaded directly onto the anti-
uteroferrin immunoaffinity column. This abbreviated procedure provided


Fig. 2-2 Purification of human spleen phosphatase. A, CM-cellulose ion
exchange chromatography. Post mitochondrial supernatant fraction was dialyzed
and then stirred with CM-cellulose at pH 8.2. The enzyme was eluted with 0.5M
NaCl; the resulting eluate was dialyzed and then reapplied to a 1.5 x 10cm
column of CM-cellulose. Elution was performed with a 250ml gradient
(0.01-0.5 M) of NaCl. Acid phosphatase activity eluted between 0.25 and 0.35M
NaCl. Units of enzyme ( ) are here represented by absorption values at 410nm
obtained by incubation of 2.5 /a.1 samples in 1ml of 0.1M acetate buffer, pH 5.3,
containing 20mM p-nitrophenylphosphate at 37C for 10 minutes. Protein (0) was
monitored by absorbance at 280nm (A280) B, Sephadex G-100 chromatography.
Enzyme, partially purified by CM-cellulose ion exchange chromatography, was
loaded onto a 1.5 x 80cm column of Sephadex G-100. Enzyme and protein were
assayed as in A. C, immunoaffinity chromatography. Enzyme from the Sephadex
column was loaded onto the anti-uteroferrin antibody affinity column. The
phosphatase was eluted with glycine buffer, pH 2.3. The beginning of the
elution is indicated by an arrowhead. Enzyme and protein were assayed as in A.


A 280
O o O
UNITS OF ENZYME()
A 280
A 280


45
a greater than 500-fold purification from the extract of the hairy cell
spleen within 24 hours (Table 2-2). The final specific activities have
varied between about 100 and 500 units/mg of protein.
Major losses of activity occurred whichever procedure was employed.
Collection of the enzyme on CM-cellulose was particularly inefficient.
However, if this step was repeated several more times (results not
shown) the percent of recovery of enzyme from the original extract could
be increased to over 40%. The phosphatase activity in the 30,000xg
supernatant fraction from the spleen extract was relatively unstable.
Storage at 4C led to a complete loss of activity within 48 hours.
Samples kept at -20C lost over 60% of their activity in 20 days. The
purified enzyme, on the other hand, appeared to relatively more stable
when frozen at -20C, and samples have been stored successfully for up
to 2 months with retention of most of their original activity.
When the immunoaffinity-purified enzyme was analyzed by SDS-PAGE it
gave a major protein band of apparent Mr=34,000 and two minor bands of
about Mr=20,000 and 14,000 (Fig. 2-3). The relative amounts of the
higher molecular weight species and the two lower molecular weight bands
varied between preparations from the same spleen (results not shown).
The purified enzyme was also examined by electrophoresis under
nondenaturing conditions (Fig. 2-4). The gels were then "stained" for
acid phosphatase activity. The hairy cell enzyme (lane 3) gave two
bands of activity, a minor fast migrating species and a dominant slower
band. Uteroferrin also gave 2 bands, but the slower migrating band in
this case was scarcely visible (lane 2). A commercial standard for


46
TABLE 2-2
Purification of tartrate-resistant acid phosphatase from
spleen of a patient with hairy cell leukemia
Purification
Step
Total
Protein
Total
Activity
Recovery
Specific
Activitv
Fold
Purification
mg
units
%
units/mg
X
30,OOOxg
5,060
3,230
100
0.64
CM-cellulose
3.4
674
20.9
198
309
Affinitv column 0.41
145
4.2
358
560
A 212g piece of a 2.4kg spleen was homogenized in lysis buffer. The
homogenate was centrifuged at 30,000xg and the enzyme was purified from
the supernatant fraction. Activities represent enzyme activated with
0.1M 2-mercaptoethanol at pH 5.3 for 10 minutes.


47
Fig. 2-3 SDS-polyacrylamide gel electrophoresis of purified
uteroferrin and hairy cell phosphatase. The scale on the left is
molecular weight x 10"^. Lane 1, molecular weight standards; lane 2,
purified uteroferrin; lane 3, hairy cell phosphatase following
immunoaffinity chromatography. The gel was 10% (w/v) polyacrylamide; it
was stained with Coomassie Blue. Note that the hairy cell enzyme gave
major bands at 34,000, 20,000 and 14,000.


48
1 2 3
Fig. 2-4 Polyacrylamide gel electrophoresis of acid phosphatases at pH
5.4 in /3-alanine buffer. Gels were stained with phosphatase substrate,
oc-naphthylphospbate, and hydrolysis product coupled with Fast Garnet GBC
salt. Lane 1, Type 5 isozyme electrophoretic standard from Calbiochem-
Behring; lane 2, uteroferrin; lane 3, hairy cell enzyme immunoaffinity
purified from spleen. Note that a standard isozyme 5, uteroferrin, and
the hairy cell phosphatase gave similar, but not identical,
electrophoretic patterns. Migration (towards the cathode) was from the
top to bottom.


49
human isozyme 5 is shown in lane 1. Its pattern resembled that of
uteroferrin.
Purification of the Type 5 Isozyme from Normal Human Spleen
An isozyme with a high cathodal mobility has been detected in
extracts of normal spleen by others (Lam et al., 1973). In addition,
the extract of spleen described in Table 2-1 contained significant
amounts of a tartrate-resistant acid phosphatase activity. Therefore an
attempt was made to isolate the enzyme from the total extract of a
normal spleen by means of procedure 2. Approximately 16 units of enzyme
activity bound to CM-cellulose at pH 8.2. This represented less than 5%
of the total acid phosphatase activity in the extract. A total of 6
units were recovered from the immunoaffinity column. This final
preparation was insensitive to L-(+)-tartrate and was activatable by 2-
mercaptoethanol. Upon electrophoresis in nondenaturing gels it gave two
cathodally migrating bands of activity. These were identical to the
bands of activity seen with the hairy cell enzyme (results not shown).
The results confirm that the Type 5 phosphatase is present as a minor
component of spleens of normal individuals.
Purification of the Type 5 Phosphatase from Human Placenta
Because of the difficulty in obtaining human spleens, it was
necessary to determine whether other tissues could be used as a source
of the human tartrate-resistant acid phosphatase. Human placenta can be
obtained fresh, in large quantities, at any time. Therefore, this
tissue was tested for the presence of the enzyme. Two placentas were
studied, and a slightly different purification protocol was used for
each one. A tartrate-resistant acid phosphatase was purified from each


50
placenta. Figure 2-5 shows that the placenta enzyme, like the spleen
enzyme, has an apparent Mr of 34,000. Interestingly, the two minor
bands found associated with the placenta enzyme are of different
apparent Mr values than those associated with the spleen enzyme. Human
placenta can contain about as much Type 5 phosphatase as normal human
spleen (Table 2-3) when measured per gram of tissue. Note that human
hairy cell spleen contains at least 20-fold more Type 5 isozyme per gram
of tissue than the other sources of the human enzyme.
Purification of the Bovine Spleen. Bovine Uterine and Rat Spleen
Phosphatases
Table 2-3 also shows the yields of the purple, iron-containing
phosphatases from other sources. Davis et al. (1981) claim that they
can purify up to 2mg of purple phosphatase per 2kg of beef spleen, but
that the yield varied greatly between animals. The yields obtained in
this study were consistently lower than 0.5mg/kg (data not shown). The
yield of the bovine uterine enzyme was considerably less than that of
the porcine enzyme on a per animal basis (Table 2-3). The yield of the
rat spleen enzyme was quite high (Table 2-3) and comparable to that of
Hara et al. (1984).
pH Optima of the Type 5 Phosphatases
The pH optima for the various Type 5 phosphatases are listed in
Table 2-4. The values range from pH 4.2 for the bovine uterine enzyme
to pH 6.0 for the bovine spleen enzyme.
Glycoprotein Nature of the Type 5 Phosphatases
Porcine uteroferrin is known to contain a single high-mannose
oligosaccharide chain (Saunders et al., 1985). The rat spleen enzyme
(Hara et al., 1984), and the bovine spleen enzyme (Davis et al., 1984)


51
1
2
3
4
Fig. 2-5 SDS polyacrylamide gel electrophoresis of uteroferrin, the
phosphatase from human spleen and the phosphatase from placenta. The
molecular weight standards are shown in lane 1. Note that the spleen
enzyme (lane 2) gave major bands at 34,000, 20,000 and 15,000, while the
placenta (lane 4) gave major bands at 34,000, 16,000 and 13,000.
Uteroferrin (lane 3) has an apparent Mr of 35,000. Approximately 20yug
of protein were present in each lane. Gels were stained with Coomassie
blue. The gel was composed of 12.5% (w/v) polyacrylamide. The scale on
the left is molecular weight x 10^.


52
TABLE 2-3
Levels of tartrate-resistant acid phosphatase
acitivitv in various tissues
Source of Enzvme
Units of Enzyme
Activity
Units of Enzyme Activity
per 1002 Tissue
Human
placenta 1 (630g)
19
3.0
Human
placenta 2 (650g)
7
1.1
Normal human
spleen (220g)
6
2.7
Hairy cell spleen
(212g)a
145
68.3
Beef spleen (200g)a
4.5
4.5
Rat spleen (2g)^
0.74
37
Bovine uterine fluids
(400ml)c
224
-
Porcine allantoic
fluids (4L)C
36,400
Approximately one-tenth the total tissue mass
^Obtained from three animals
cObtained from one animal
Purified enzymes were incubated with 0.1M 2-mercaptoethanol and
assayed at their pH optima with 20mM p-nitrophenylphosphate. One unit
of enzyme hydrolyzes the release of 1/nnol of p-nitrophenol per minute.


53
TABLE 2-4
pH optima for the tartrate-resistant acid phosphatases
Enzvme
dH Optimum
Porcine uteroferrin
4.9
Human hairy cell enzyme
5.3
Bovine spleen enzyme
6.0
Bovine uterine enzyme
4.2
Rat spleen enzymea
5.0-5.8
a Hara et al., 1984
Enzymes were assayed with 0.1M sodium acetate, pH 3.0-5.4, 0.1M
Tris acetate, pH 5.6-6.5, 0.1M Tris-HCl, pH 7.0-7.5, buffers in the
presence of 0.1M 2-meracaptoethanol with 20mM p-nitrophenylphosphate
substrate.
as


54
were demonstrated to be glycoproteins. In this study it was
demonstrated that the human spleen and placenta enzymes bind avidly to
Con A-Sepharose. The enzymes could be eluted with lOmM oc-methyl -
mannoside at 50-60C or with 0.1M acetic acid. These results indicate
that the human Type 5 phosphatase, along with the purple, iron-contain
ing phosphatases, contain high mannose or hybrid-type oligosaccharide
chains.
Iron Content of the Type 5 Phosphatases
It has been demonstrated that the bovine spleen enzyme (Davis et
al., 1981) and rat spleen enzyme (Hara et al., 1984) contain two atoms
of iron per molecule of protein. However, Buhi et al. (1982b)
consistently demonstrated that certain preparations of uteroferrin bound
about 1 mol Fe/mol protein. Table 2-5 compares the iron contents of
pink, high molecular weight uteroferrin, purple uteroferrin, the bovine
uterine enzyme, the rat spleen enzyme, the bovine spleen enzyme and the
human spleen enzyme. While pink, high molecular weight uteroferrin
contains two atoms of iron per molecule of uteroferrin, purple
uteroferrin preparations contain considerably less iron. Triplicate
determinations on a single purified sample of the human enzyme revealed
that it contained 2.2 + 0.4 atoms of iron/molecule of protein.
Activation by Reducing Agents
Reports on the effect of reducing agents such as ascorbate and
2-mercaptoethanol on the activities of the Type 5 isozyme of human
spleen have been at variance (Lam et at., 1977; Robinson and Glew,
1980). The degree of activation has been unpredictable throughout the
course of this study. With partially purified enzyme


55
TABLE 2-5
The Iron content of the tartrate-resistant acid phosphatases
Source of Enzvme
mmol Fe/mmol Protein
d65 allantoic fluid,
purple porcine Uf
1.2a
d65 allantoic fluid,
pink Mr=80,000 Uf
2.0a
dllO pseudopregnant fluid,
purple porcine Uf
1.5a
dllO pseudopregnant fluid,
pink Mr=80,000 Uf
2.3a
Human hairy cell spleen
2.2
Bovine spleen
2. lb
Bovine uterine fluid
1.4
Rat spleen
1.9-2.0C
aBaumbach et al., 1986
^Davis et al., 1981; Campbell et al., 1978
cHara et al., 1984
The iron content was determined by the method of Cameron (1985)
modified by Campbell and Zerner (1973). Approximately 50-100/ig of
protein were used.
as


56
(post-CM-cellulose) a 2-3-fold activation was usually observed when
enzyme was incubated with 0.1M 2-mercaptoethanol for 10 minutes at
pH 5.3 before being assayed for activity. The degree of activation of
crude enzyme (Table 2-2) was usually less than two-fold. However, some
preparations of affinity-purified enzyme have shown negligible activity
in the absence of reducing agent while other, more inherently active
preparations were only stimulated about two-fold. The results with one
purified preparation are summarized in Table 2-6. The extent of
activation was clearly dependent upon the concentration of
mercaptoethanol. Results with ascorbic acid (not shown) were similar.
Activation by mercaptoethanol leads to an increase in V rather than
a change in Km for both the human spleen enzyme and uteroferrin (Fig. 2-
6A). Note that the Km values for both enzymes at their pH optima (pH
5.3 and 4.9, respectively) are similar. Values for Km between 0.75 and
3 mM have been reported for the spleen enzyme. V is also variable, the
more active preparations giving values greater than 500 units/mg protein
when pretreated with 2-mercaptoethanol.
Interestingly, pink, high molecular weight uteroferrin does not
require pretreatment with 2-mercaptoethanol in order to exhibit maximal
activity (data not shown).
Effects of Inhibitors on Phosphate Activity
The effects of a range of inhibitors on the human spleen enzyme and
uteroferrin are very similar (Table 2-7). Both enzymes are completely
inhibited by 0.1M dithionite, a reagent which is known to cause release
of Fe from uteroferrin (Schlosnagle et al., 1976). Hydrogen peroxide
and agents which interact with -SH groups also inhibit. The chelators


57
TABLE 2-6
Activation of purified human hairy cell phosphatase by 2-mercaptoethanol
2-Mercaptoethanol
Concentration
Activity
M
% control
0
100
0.01
240
0.05
300
0.10
360
0.25
440
Enzyme was incubated with 2-mercaptoethanol for 20 minutes at pH 5.3
in 0.1M sodium acetate buffer prior to assay.


58
TABLE 2-7
Action of various potential inhibitors on the hairy cell acid
phosphatase, uteroferrin. bovine spleen and
bovine uterine acid phosphatases
Compound Concentration
Acid Phosphatase
Human Porcine Bovine Bovine
Hairy Cell Uteroferrin Spleen Uterine
% control
Na dithionite
10'1 M
0
0
12
9
h2o2
0.01%(v/v)
75
73
37
67
Na iodacetate
io -3m
72
85
NDa
ND
Na iodoacetamide
io*3m
70
78
60
73
p-mercuribenzoate
1
O
T1
42
57
ND
50
FeCl2
10'5M
45
58
ND
ND
NaEDTA
103M
100
100
66
52
bipyridine
103M
100
100
ND
ND
o-phenanthroline
10'3M
ND
100
60
52
NaK tartrate
102
100
100
95
100
NaK tartrate
103M
100
100
ND
ND
Na phosphate
5x103M
5
5
ND
ND
Na phosphate
io*3m
40
37
43
28
Na phosphate
1
o
73
71
ND
ND
Na arsenate
10 3M
18
8
ND
ND
Na arsenate
5x10*4M
36
19
ND
ND
Na arsenate
5x10'5M
83
74
67
29
Na molybdate
10 *4m
8
0
ND
ND
Na molybdate
10'5M
4
12
ND
ND
Na molybdate
5x10'7M
38
63
76
41
Na fluoride
10'3M
60
67
53
ND
Na fluoride
5xl0'4
80
78
ND
ND
a ND, not determined
The enzymes were assayed in triplicate with p-nitrophenylphosphate as
substrate (concentration 20mM). The enzymes were assayed at their pH
optima (see Table 2-4). All activities are presented as per cent of a
control assay performed simultaneously with no added inhibitor.


59
EDTA and bipyridine have no effect. Tartrate does not inhibit either
phosphatase. Inhibition is observed with phosphate, arsenate,
molybdate, and fluoride, however. Molybdate is the most effective,
inhibiting strongly even at concentrations below 10'^M; it appears to
inhibit both enzymes in a noncompetitive manner (Fig. 2-6B).
Arsenate and phosphate are competitive inhibitors (Fig. 2-6C).
Inhibition with 10 M fluoride (results not shown) is complex, and
curvilinear Lineweaver-Burk plots are observed.
The effects of these inhibitors on pink, high molecular weight
uteroferrin (data not shown) and the bovine uterine and spleen enzymes
were quite similar to the results obtained for uteroferrin (Table 2-7).
Substrate Specificity for Phosphatase Activity
The substrate specificities of the human spleen enzyme and
uteroferrin are quite similar (Table 2-8). p-Nitrophenylphosphate was
the best substrate tested, but oc-naphthylphosphate, pyrophosphate, and
nucleotide tri- and di-phosphates are also hydrolyzed. Both enzymes
hydrolyze ADP more effectively than ATP, whereas AMP is a poor
substrate. Hexose phosphates are only very slowly hydrolyzed, if at
all.
Both enzymes are phosphoprotein phosphatases and can release
orthophosphate from the egg yolk protein phosvitin. The human spleen
enzyme (1/ig) had the ability to release 2.lnmol of orthophosphate from
phosphvitin (10mg/ml) per minute at 37C. The value for uteroferrin
assayed identically was 1.5nmol of orthophosphate released per minute.
The substrate specificities of pink, high molecular weight
uteroferrin (data not shown) and the bovine emzymes (Table 2-8) were


Fig. 2-6 Lineweaver-Burk plots of uteroferrin and hairy cell phosphatase
activities in the presence of 2-mercaptoethanol and various inhibitors. A,
activation of enzyme by 2-mercaptoethanol. In this experiment enzymes were
activated with 0.1M 2-mercaptoethanol at pH 7.0 (uteroferrin) or 5.3 (hairy
cell enzyme) for 10 min. Uteroferrin or hairy cell enzymes (0.15 /t_g) were
assayed over a range of p-nitrophenylphosphate concentrations with the use of
the standard assays with (0) and without () activation. B, effect of
molybdate on acid phosphatase activity. Enzymes activated with 2-mercap-
toethanol, were assayed as in A, either in the presence () or absence (0) of
10sodium molybdate. C, effect of arsenate and phosphate on acid
phosphatase activity. Enzymes activated with 2-mercaptoethanol, were assayed
as in A, except the amount of uteroferrin was less (0.05 Ag/assay). Assays
were carried out in the presence of either 5 x 10^M phosphate (A) or 5 x 10'^M
arsenate () or without inhibitors (0). Each point represents the average of
three replicates. In A, B, and C assays with the hairy cell enzyme were
carried out with purified enzyme that had been stored at -20C for 3 weeks and
which had lost about 50% of its initial activity. Upper panels represent
results obtained with uteroferrin, lower panels with hairy cell phosphatase.


o mercaptoethanol
control
molybdate
a phosphate
arsenate


62
TABLE 2-8
Comparison of substrate specificities of hairy cell phosphatase.
uteroferrin. bovine spleen and bovine uterine phosphatases
Substrate
Human Hairy
Cell
Acid Phosphatase
Porcine Bovine
Uteroferrin Soleen
Bovine
Uterine
% control
p-nitrophenylphosphate
100
100
100
100
a-naphthylphosphate
71
26
23
84
sodium pyrophosphate
24
52
7
45
ATP
49
36
20
3
ADP
92
81
18
87
AMP
4
2
3
10
D-glucose 6-phosphate
3
0
D-mannose 6-phosphate
0
3
D-fructose 6-phosphate
4
0
All compounds were
assayed at a concentration of
4mM at
the pH
optima of the enzymes.


63
generally similar to the results obtained with uteroferrin. However,
the bovine uterine enzyme did not hydrolyze ATP well, and the bovine
spleen enzyme was virtually inactive against pyrophosphate. The fact
that each bovine enzyme was tested at its pH optimum (pH 6.0 for the
spleen enzyme and pH 4.2 for the uterine enzyme) rather than at the same
pH, may have influenced the results.
Immunological Cross-reactivity
The human spleen enzyme clearly shows at least some immunological
cross-reactivity with uteroferrin since it bound to anti-uteroferrin
immunoglobulins immobilized on Sepharose (Fig. 2-2C). The extent of
this cross-reactivity has been measured in a solid phase immunobinding
assay which employed whole antiserum from mice, which had been immunized
with either spleen enzyme (Fig. 2-7A) or uteroferrin (Fig. 2-7B). The
antiserum to the spleen enzyme clearly bound to uteroferrin but binding
was reduced by 50% when the antiserum was diluted 1:80. No binding
could be detected below a 320-fold dilution. The titer towards the
spleen enzyme was clearly much higher, with half-maximal binding
occurring at an antiserum dilution of 1:1280.
When whole mouse antiserum raised against uteroferrin was employed,
little antibody binding to the spleen enzyme was detectable at an
antiserum dilution below 1:320. By contrast, binding to uteroferrin
remained high down to an antibody dilution of 1:10,240. Therefore, the
two proteins show only partial immunological cross-reactivity.
The Production of Monoclonal Antibodies Against Porcine Uteroferrin
The mice for fusion 5 were injected with high molecular weight pink
uteroferrin. The results of this fusion, which was done in


Fig. 2-7 Solid phase radiobinding assay of whole mouse antiserum
from mice immunized with human spleen phosphatase (upper panel) or
uteroferrin (lower panel). Antibody was diluted serially and
tested for binding to either uteroferrin (), human spleen
phosphatase (O) or bovine serum albumin (A) Binding was
measured by means of affinity purified -*-^I-sheep anti-mouse IgG.


40
25
10
100
80
60
40
65
ute roferr in
ospleen phosphatase
a bovine serum albumin


66
collaboration with George Baumbach, are outlined in detail in Baumbach
(1984).
The mice for fusion 6 were injected with pure uteroferrin. Upon
initial screening with uteroferrin as the antigen, 26 out of the 199
colonies screened were identified as positive. After each of these
positive colonies was cloned by the limiting dilution method, 11 of the
original colonies contained positive clones.
Three clones from fusion 5 and three from fusion 6 were chosen for
further studies. These hybridomas, 5.58.1, 5.122.10, 5.127.3, 6.21.2,
6.22.1 and 6.37.4, were used to produce large quantities of antibody in
mouse ascites fluid or culture media.
These antibodies were tested for binding to uteroferrin and pink,
high molecular weight uteroferrin. All of the antibodies bound with
high affinity to pink, high molecular weight uteroferrin. Only one
antibody, 5.58.1, did not bind to uteroferrin. It appeared that 5.58.1
recognized the second, antigenically unrelated protein in Fill. This
antibody will not be discussed further.
In order to determine which of these antibodies recognized the same
epitope on the uteroferrin molecule (i.e., would compete with one
another for binding to uteroferrin) and which recognized different
epitopes (did not compete with one another for binding to porcine
uteroferrin), competitive radiobinding assays were carried out.
Each of the five monoclonal antibodies was iodinated to a specific
activity of approximately 10^ cpm/pg. Each iodinated monoclonal
antibody was tested in a competitive binding assay with the same,
unlabeled antibody. This was done to ensure that the binding abilities


67
of antibodies were not destroyed by iodination. Each labeled antibody
was then tested with each remaining unlabeled antibody. The results of
several of the competitive binding assays are shown in Fig. 2-8.
Antibodies 5.122.10, 5.127.3 and 6.37.4 compete with one another for
binding to porcine uteroferrin, even at very low concentrations of
unlabelled antibody. Thus, these three monoclonal antibodies presumably
interact with the same site on the uteroferrin molecule. Monoclonal
antibodies 6.21.2 and 6.22.1 do not compete with each other, nor do they
compete with 5.122.10, for binding to porcine uteroferrin. Each of
these antibodies presumably recognizes a different site on the
uteroferrin molecule.
The Production of Monoclonal Antibodies Against the Hairy Cell Spleen
Enzyme
Hybridoma colonies derived from a mouse which had been immunized
with the human spleen enzyme were screened for the production of
antibodies which were able to bind both the spleen enzyme and to
uteroferrin. From 200 wells containing live cells, 44 positive colonies
were selected. When these positive colonies were rescreened, 29
remained positive. Only two of these colonies, 13.15 and 13.122,
produced antibodies which bound as well or better to uteroferrin than to
the human spleen enzyme. The dissociation constants for the binding of
antibody 13.15 to the human enzyme and uteroferrin, respectively, were
22 and 16nM. The dissociation constants for the binding of antibody
13.122 to the human enzyme and uteroferrin, respectively, were 40 and
12nM. These two antibodies did not compete with one another for binding
the porcine uteroferrin.


Fig. 2-8 Competitive binding of anti-uteroferrin monoclonal antibodies to
uteroferrin adsorbed to flexvinyl microtiter wells. Uteroferrin (50 /^g/ml;
0.05ml) was absorbed to the wells of flexvinyl plates. A sample of antibody
5.122.10 or 5.127.3 which had been iodinated to a specific activity of 10^
cpm/ eg was added to each well (0.05ml; 50,000 cpm). Samples of unlabeled
antibodies were then added over a range of dilutions. The amount of which
bound to the adsorbed uteroferrin was then measured. Results show that A,
unlabeled 5.122.10 and 5.127.3 displaced the binding of radiolabeled 5.122.10;
B, unlabeled 5.122.10 and 5.127.3 displaced the binding of radiolabeled
5.127.3; and C, 6.21.2 failed to compete with 5.122.10 for binding to
uteroferrin.


I BOUND(x103cpm)
C
A
o oos o.io o oos o 10
UNLABELED ANTIBODY ADDED (i*g)
vQ


70
The Binding of the Monoclonal Antibodies to Other Tartrate-resistant
Acid Phosphatases
In Fig. 2-9 the three monoclonal antibodies raised against porcine
uteroferrin have been compared on the basis of their binding to
uteroferrin, the human enzyme, and the purple, iron-containing rat
spleen and bovine spleen acid phosphatases. All three antibodies bound
to uteroferrin with very high affinity (Fig. 2-9 and Table 2-9) but
bound relatively weakly to the beef spleen and human enzymes. The rat
enzyme had an intermediate affinity (Kj)=33nM) for antibody 6.21.2 and a
relatively high affinity (8nM) for antibody 6.22.1. The binding of the
anti-uteroferrin antibodies were also tested for binding to pink, high
molecular weight uteroferrin and the bovine uterine enzyme. There is no
difference in the binding of these monoclonal antibodies to uteroferrin
and pink, high molecular weight uteroferrin (data not shown). The
bovine uterine enzyme had a high affinity for antibody 5.122.10 (13nM)
and low affinities for the remaining monoclonal antibodies. The bovine
uterine enzyme clearly differs from the bovine spleen enzyme in its
affinity for antibody 5.122.10 (13nM versus 120nM). Thus, the five
phosphatases showed some immunological crossreactivities when tested in
this manner, but the epitopes recognized by any one of the antibodies
were clearly not identical.
Antibody 13.122, raised against the human spleen enzyme, was tested
for its binding to the five phosphatases. Figure 2-9 and Table 2-9 show
that this antibody had a slightly lower affinity towards the human
enzyme (the antigen against which it had been raised) than towards
uteroferrin or the rat spleen enzyme. The antibody bound as well to the
bovine uterine enzyme as it did to the human enzyme, and bound most


Fig. 2-9 Binding of four monoclonal antibodies to uteroferrin and to the
immunoaffinity purified phosphatases from human, bovine, and rat spleens. The
enzymes (50 g/ml; 0.05ml) were allowed to adsorb to the wells of flexvinyl
plates. Purified 5.121.10, 6.21.2, 6.22.1, which had been raised against
uteroferrin, and 13.122, which had been raised against human spleen enzyme were
diluted over a range of concentrations from about 10to 10^M and added to
the wells. Binding in this experiment was assessed by means of ^^1-labeled
sheep anti-mouse IgG as described under "Materials and Methods." The graphs
show the amount of antibody bound plotted against antibody concentration for
the four enzymes. Uteroferrin, ; human spleen phosphatase A ; bovine spleen
phosphatase 0; rat spleen phosphatase A The antibody used in each series of
experiments (5.122.10, 6.21.2, 6.22.1, and 13.122) is shown on each graph.


Antibody bound (jjg x 10*)
ZL


73
TABLE 2-9
Dissociation constants (Kp values) for binding of monoclonal antibodies
to uteroferrin. the human spleen enzyme, the rat spleen enzyme.
the bovine spleen and uterine enzymes
Antigen
Monoclonal Antibody
5.122.10
6.21.2
6.22.2
13.122
kd,
nM
Uteroferrin
o
I1
1.2
2.7
12
Enzyme from hairy cell spleen
145
600
270
40
Enzyme from rat spleen
33
8
13
Enzyme from beef spleen
120
130
125
80
Enzvme from cow uterus
13
117
75
40
Monoclonal antibodies 5.122.10, 6.21.2 and 6.22.1 were produced by
hybridoma clones which orginated from a mouse immunized with
uteroferrin. They were selected by their ability to bind uteroferrin
with high affinity in a solid phase radiobinding assay. Monoclonal
antibody 13.122 was produced by a hybridoma clone which originated from
a mouse immunized with the enzyme purified from human spleen. It was
selected because of its ability to bind uteroferrin and the human spleen
enzyme with approximately similar affinities.


74
weakly to the beef spleen enzyme (Table 2-9). However, the Kp values
for all five phosphatases were not markedly different, a result which
suggests that antibody 13.122 recognized a relatively conserved site.
Inhibition of Enzymatic Activity by the Binding of Monoclonal Antibodies
The acid phosphatase activity of uteroferrin was measured (without
the addition of 2-mercaptoethanol) after each of the monoclonal
antibodies had been allowed to bind to the enzyme at pH 7.0 for 1 hour.
Table 2-10 demonstrates that antibody 5.127.3 effectively inhibited acid
phosphatase activity when a 2-4-fold molar excess of antibody was added.
Monoclonal antibody 6.22.1 inhibited the enzyme activity slightly at
lower concentrations, while antibody 6.21.2 did not inhibit activity at
all. Monoclonal antibody 13.122 inhibited the phosphatase activity
about 30% at all concentrations tested. None of these antibodies were
able to inhibit the human, rat or bovine spleen enzymes at the
concentrations tested (data not shown).
Discussion
Tartrate-resistant acid phosphatases from various tissue sources can
be purified by a procedure which closely resembles the fast, convenient
purification protocol for porcine uteroferrin. This is particularly
important in the case of the human enzyme, where previous attempts at
purification to homogeneity were either not successful (Lam et al.,
1977) or involved a large number of time-consuming steps (Robinson and
Glew, 1980).
Three properties allowed the hairy cell phosphatase to be purified
readily from extracts of spleen. The high isoelectric point ensured
that it bound to CM-cellulose at high pH. Its immunological


75
TABLE 2-10
Inhibition of acid phosphatase activity of uteroferrln
by monoclonal antibodies
Antibody
Molar Ratio,
Antibody: Uteroferrin
Acid Phosphatase Activity
% control
5.127.3
i-1
in
o
53
2:1
22
4:1
24
8:1
42
6.21.2
0.5:1
97
2:1
86
4:1
109
8:1
138
6.22.1
0.5:1
71
2:1
68
4:1
90
8:1
111
13.122
0.5:1
79
2:1
73
4:1
73
H
CO
72
Uteroferrin (0.06mg) was incubated for 1 hour at room tempeature
with the antibody specified, then assayed in triplicate for acid
phosphatase activity with 20mM p-nitrophenylphosphate as substrate and
without the addition of 2-mercaptoethanol. All activities are presented
as percent of a control assay performed simultaneously.


76
cross-reactivity with anti-uteroferrin antibodies permitted it to be
adsorbed to the immunoaffinity column. Finally, it was relatively
stable to the conditions of elution, namely a brief exposure to pH 2.3
glycine buffer. It is conceivable that some of the losses that occurred
at the immunoaffinity step did result from the elution conditions.
Uteroferrin, although relatively stable to low pH, does begin to lose
its phosphatase activity and presumably its bound iron if maintained
below pH 3.0 (Campbell and Zerner, 1973). However, the major loss of
yield occurred during the binding to CM-cellulose, a step which rarely
provided more than 20% recovery of enzyme. This failure of the cation
exchanger to bind all of the enzyme was not the result of its binding
capacity being exceeded nor to the presence of enzyme variants of lower
isoelectric point. Neither was it related to the presence of detergent.
Possibly the enzyme remains complexed with some soluble, strongly
anionic component in the homogenate. Whatever the basis of the
phenomenon, repeated treatment with CM-cellulose does provide a much
improved yield, with up to 40% of the total phosphatase activity of the
spleen extract eventually binding.
When enzyme was purified from human placenta, protamine sulfate was
added in order to bind various anionic components in the homogenate.
This procedure was first employed by Glomset and Porath for purification
of the bovine spleen enzyme (1960) and was also used by Anderson and
Toverud in purification of the rat bone enzyme (1986). Protamine
sulfate precipitation of anionic components is now routinely empolyed by
our laboratory for the purification of tartrate-resistant acid
phosphatases (see Allen et al., in press).


77
Despite the fact that the spleen was homogenized in a buffer which
contained a wide range of protease inhibitors, there was evidence to
suggest that much of the enzyme may have been cleaved into "subunits"
during or prior to purification. Activity was lost, for example, if the
homogenate was not rapidly processed, and the relative yield of 34,000
monomer and of the two subunits varied from preparation to preparation.
Moreover, the final enzyme, although exhibiting a symmetrical peak of
protein and enzyme activity of apparent Mr=34,000 during gel filtration
on Sephadex G-100 always displayed some subunits during SDS-PAGE.
Robinson and Glew (1981), working with the closely similar Gaucher
spleen enzyme, have shown that the presence of the two lower molecular
weight polypeptides could be minimized, but not prevented, if a protease
inhibitor was included in the homogenizing buffer. In addition, when
uteroferrin was treated with low concentrations of trypsin or
chymotrypsin (Buhi, 1981) or incubated in allantoic fluid (Buhi et al.,
1982b) an active enzyme with subunits of apparent Mr=20,000 and 15,000
was produced. Presumably both proteins possess a region of peptide
which is sensitive to proteases. The reports that the closely similar
beef spleen enzyme, which we have shown to crossreact immunologically
with uteroferrin, possesses two such subunits (Davis et al., 1981;
Campbell et al., 1978) implies that the bovine enzyme might also become
cleaved proteolytically either during normal in vitro processing or
during its isolation from the spleen homogenate. In contrast, the
bovine bone enzyme (Lau et al., 1985, 1987) and the bovine uterine
enzyme do not seem to be as sensitive to this proteolysis, they appear
as intact monomers after purification. The human bone enzyme, unlike


78
the human spleen and placenta enzymes, is also easily purified without
evidence of proteolytic products (Allen et al., in press).
The earlier report that the hairy cell enzyme is not activated by
reducing agents (Lam et al., 1977) can probably be explained by the
observation that activation was transient and varied between
preparations. Similar observations have been made with uteroferrin.
The differences in molecular weight (64,000 versus 34,000) can in turn
by attributed to the fact that hemoglobin was employed as a standard in
the earlier work (Lam et al., 1977) and assumed to maintain the
molecular weight of the tetramer during sucrose density gradient
centrifugation. The variability in kinetic parameters (particularly Km
and V) are probably best explained by the sensitivity of these enzymes
to a variety of inhibitors, including sulfhydryl agents, anions, heavy
metals, and oxidizing agents. The properties of the hairy cell enzyme
do, however, differ somewhat from those reported for the tartrate-
insensitive phosphatase isolated by Robinson and Glew (1980) from
spleens of patients with Gaucher's disease. That phosphatase, despite
the fact that it appeared to crossreact immunologically with the hairy
cell enzyme (Lam et al., 1981), failed to utilize pyrophosphate as a
substrate and hydrolyzed ATP considerably better than ADP (Robinson and
Glew, 1980). It is still not clear, therefore, whether or not the
Gaucher phosphatase and the one from hairy cell spleen are identical
proteins.
The experiments with whole antiserum and with the different
monoclonal antibodies to uteroferrin and the human spleen enzyme
emphasize that the two proteins must have cross-reacting and presumably


79
structurally related determinants (epitopes) on their surfaces.
Monoclonal antibody 13.122, for example, was selected for its ability to
bind to both uteroferrin and to the spleen enzyme. Its binding
characteristics towards both proteins and towards the rat spleen, bovine
spleen and bovine uterine enzymes appeared fairly similar, suggesting
that the epitope it recognized was relatively conserved. On the other
hand, the monoclonal antibodies 5.122.10, 6.21.2 and 6.22.2 bound to the
human, rat, and bovine spleen enzymes and the bovine uterine enzyme with
much lower affinity than to uteroferrin. It can be concluded that all
of the enzymes carry structurally homologous epitopes on their
respective surface, but these sites are not equally conserved.
Nevertheless, the ability to generate both polyclonal and monoclonal
antibodies which have broad immunological crossreactivity should prove
useful in further studies on the biosynthesis and localization of this
class of acid phosphatase. These antibodies may have diagnostic value
both for identifying leukemic hairy cells immunocytochemically and for
measuring the level of the Type 5 isozyme in plasma by immunoassay. The
latter procedure may be particularly useful for assessing osteoclast
activity in individuals exhibiting abnormal bone metabolism (Minkin,
1982; Chen et al., 1975; Stepan et al., 1983) or in patients with
osteoclastic tumors (Tavassoli et al., 1980).
The results of this study clearly demonstrate that uteroferrin, the
purple-colored acid phosphatases from rat spleen, bovine spleen and the
bovine uterus, and the enzyme from the spleens of human patients with
hairy cell leukemia are closely related proteins. In addition to their
immunological cross-reactivity, they are similar in kinetic properties,


80
in their substrate specificities, and in their sensitivities to a broad
range of inhibitors. They also resemble each other in molecular size,
isoelectric point, glycoprotein nature, and iron content. One obvious
difference, however, between uterine enzymes and the spleen enzymes
studied in this chapter is that the uterine enzymes are secreted
glycoproteins whereas the others are principally intracellular.
Nevertheless, even this paradox may be resolved as there is now
considerable evidence that uteroferrin may represent a hypersecreted
lysosomal enzyme (Baumbach et al., 1984). It is, for example, a
substrate for the transferase which is specifically responsible for the
selective phosphorylation of mannose residues on lysosomal enzymes (Lang
et al., 1984). Uteroferrin is also secreted with the so-called
lysosomal recognition marker, mannose 6-phosphate, present on its
carbohydrate chain (Baumbach et al., 1984). Possibly all members of
this class of acid phosphatase have the properties of lysosomal enzymes.
Certainly many of them appear to reside intracellularly in inclusion
bodies resembling lysosomes (Baumbach et al., 1984; Yam et al., 1971;
Schindelmeiser et al., 1987).
The two bovine enzymes which were employed for comparative purposes
in this study should perhaps be studied in more detail. Under the
influence of progesterone, the bovine uterus secretes a uteroferrin-like
protein which appears to be quite distinct from the bovine spleen
enzyme, which is lysosomal. It has been demonstrated that the bovine
uterine and spleen enzymes differ in a number of ways: pH optima (4.2
and 6.0, respectively), Mr (32,000 and 40,000), ability to hydrolyze
pyrophosphate, and cross-reactivity with monoclonal antibody 5.122.10


81
(Kps 17 and 130nM). It would be interesting to determine whether
differential targeting is due to variation in the enzymes' primary
sequences. An alternative approach to study targeting of the purple
phosphatases would involve the isolation and characterization of a
porcine spleen enzyme which would presumably be lysosomal. It appears
that such an enzyme exists, and is distinct from uteroferrin (M. Kazemi
and R.M. Roberts, unpublished results).
In conclusion, it is proposed that the Type 5 human isozyme belongs
to the growing class of iron-containing phosphatases of which
uteroferrin and the phosphoprotein phosphatase of beef spleen are the
best characterized. It remains to be determined whether the human
enzyme possesses the purple color and characteristic g'=1.74 ESR iron
signal which is exhibited by uteroferrin (Antanaitis et al., 1983) and
the bovine spleen phosphatase (Davis and Averill, 1982). Why the Type 5
isozyme accumulates in the leukemic hairy cell and in the spleen
histiocytes of patients with Gaucher's disease is unknown. Both these
cell types are capable of phagocytosing erythrocytes (Robinson and Glew,
1980; Nanba et al., 1977), and the Gaucher cell is known to accumulate
large amounts of iron (Robinson and Glew, 1980). Possibly the elevation
of the Type 5 phosphatase is a reflection of abnormal iron metabolism in
these cells.


CHAPTER 3
MOLECULAR CLONING OF THE TYPE 5, TARTRATE-RESISTANT ACID PHOSPHATASE
FROM HUMAN PLACENTA AND ITS EXPRESSION IN LEUKEMIA CELLS
Introduction
There are at least six distinct types of acid phosphatase in human
leukocytes which can be distinguished by electrophoretic and other
characteristics (Li et al., 1979; Lam et al., 1973; Li et al., 1973).
The Type 5 isozyme is the most cationic of the acid phosphatases and is
the only isozyme insensitive to inhibition by L-(+)-tartrate. It has
been detected in spleen, lung, liver and bone as a minor isozyme (Lam et
al., 1973; Yam et al., 1971). However, it can become the dominant
isozyme in certain pathological states. High tartrate-resistant acid
phosphatase levels are often found within the spleen (Robinson and Glew,
1980) and monocytes (Troy et al., 1985) of patients with Gaucher's
disease; the splenocytes and circulating white cells of patients with
hairy cell leukemia (Yam et al., 1971); the spleens of patients with
Hodgkin's disease (Drexler et al., 1986); and the sera of individuals
undergoing active bone turnover (Yam, 1974). Elevated levels of this
isozyme are also associated with various B-cell and T-cell leukemias
(Drexler et al., 1986). In systematic studies of leukemia cell lines,
it appeared that the tartrate-resistant, Type 5 acid phosphatase was not
generally expressed in immature lymphoid cells, but rather by cells
arrested in later stages of differentiation (Drexler et al., 1985,
1987a).
82


83
In the previous chapter the purification and characterization of
this Type 5 acid phosphatase from human hairy cell spleen, normal spleen
and placenta were reported. It was demonstrated that this human enzyme
is remarkably similar to an abundant tartrate-resistant acid phosphatase
secreted by the porcine uterus under the influence of progesterone,
known as uteroferrin. Both the human enzyme and uteroferrin are iron-
containing glycoproteins, and resemble each other closely in
electrophoretic mobility, substrate specificity and sensitivity to a
variety of activators and inhibitors. The two proteins are also
immunologically related. While uteroferrin is believed to function in
iron metabolism (see Roberts and Bazer, 1985; 1988), the function of the
human enzyme is unknown.
In view of the clinical significance of the human tartrate-resistant
acid phosphatase, further studies on its transcriptional control seemed
warranted. A human placenta cDNA library was screened with polyclonal
antibodies against porcine uteroferrin. However, these antibodies
failed to detect a cDNA coding for the human tartrate-resistant acid
phosphatase. Accordingly, two short cDNA clones coding for porcine
uteroferrin were employed to isolate a cDNA coding for the human enzyme.
In this chapter, the molecular cloning of a 1412 bp cDNA which covers
the complete coding region of the human tartrate-resistant acid
phosphatase is described, and the deduced amino acid sequence of the
human enzyme is compared to the amino acid sequences of porcine
uteroferrin and a related bovine spleen acid phosphatase. The
expression of this human phosphatase in human leukemia cells is


84
demonstrated, and its regulation studied in the human erythroleukemia
cell line K562.
Materials and Methods
Materials
The human placenta cDNA library, mouse spleen cDNA library and human
placenta poly (A)+ RNA were obtained from Clontech. Goat anti-rabbit
and goat anti-mouse antibodies coupled to horseradish peroxidase were
from Bio-Rad. All restriction endonucleases, the large fragment of E.
coli DNA polymerase, T4 DNA ligase, and the RNA ladder were from
Bethesda Research Laboratories. The [a--^P]-dATP was purchased from New
England Nuclear Corp. The 2'-deoxynucleotide triphosphate/2'3'-
dideoxynucleotide triphosphate sequencing mixes were from New England
BioLabs. Heparin-Agarose, hemin and TPA were from Sigma. Fetal bovine
serum and RPMI 1640 were obtained from Gibco-BRL. Oligodeoxyhexamer for
random primer extension probes was from Pharmacia. All other chemicals,
reagent grade or better, were from Sigma or Fisher.
Methods
Preparation of antisera for immunoscreening. Adult New Zealand
White rabbits were immunized with 0.2 to 0.5mg of uteroferrin mixed with
Freund's complete adjuvant and then injected subcutaneously at multiple
sites (Herbert, 1973). Booster injections of 0.2 to 0.5mg of antigen in
incomplete adjuvant were administered monthly. Bleedings of 20 to 40ml
were taken 10 days after injections. The samples were allowed to clot
overnight at 4C and then centrifuged to separate the serum from the
clot. In some cases the antisera were affinity purified on anti-
uteroferrin Sepharose as outlined in Chapter 2. In other cases the


85
antisera were run through a column of E. coli proteins which had been
coupled to Sepharose, in order to remove antibodies against E. coli
proteins (Huynh et al., 1984).
Screening of the lambda gtll libraries with anti-uteroferrin
antibodies. A human placenta cDNA library prepared by Millan (1985) was
purchased from Clontech. This library contains 1 x 10^ independent
clones, with 96% recombinant phage. The insert sizes range from 0.8-
3.6 kb, and the average insert size is 1.8 kb. A mouse spleen cDNA
library was purchased from Clontech. This library contains 1 x 10^
independent clones, with 93% recombinant phage. The average insert size
is 1.0 kb. The porcine uterine endometrium cDNA library was prepared by
George Baumbach and Patrick Gillevet at the University of Florida. The
method used for screening was developed by Young and Davis (1983a,b) and
Huynh et al. (1984) and modified by deWet et al. (1984).
E. coli strain Y1090 was grown overnight in LB medium [1% (w/v)
tryptone, 0.5% (w/v) yeast extract, 0.5% (w/v) NaCl] plus 0.2% (w/v)
maltose and 50/xg/ml ampicillin at 37C with good aeration. The next
morning, the bacteria were centrifuged at 1500xg at room temperature for
10 minutes, and resuspended in one-fifth original volume of SM buffer
[0.01M Tris-HCl, pH 7.5, 0.01M MgCl2, O.lmM EDTA, 0.2% (w/v) gelatin].
An appropriate number of phage were mixed with either 75/il of bacteria
(for 100mm dishes) or 300/il bacteria (for 150mm dishes). The bacteria
and phage were incubated at 37C for 15 minutes to allow the phage to
adhere to the bacteria. The phage and bacteria were then mixed with
either 3 ml (for 100mm dishes) or 7.5ml (for 150mm dishes) of melted LB
containing 0.7% (w/v) agarose, which had been kept at 45C. The mixture


Full Text
THE HUMAN TYPE 5, TARTRATE-RESISTANT ACID PHOSPHATASE
PURIFICATION, CHARACTERIZATION AND MOLECULAR CLONING
By
CATHERINE MARY KETCHAM
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1988

ACKNOWLEDGMENTS
My sincere thanks are extended to the members of my supervisory
committee for their guidance and encouragement: Dr. R. Michael Roberts,
Dr. Harry S. Nick, Dr. Daniel L. Purich, Dr. Peter M. McGuire, Dr.
Michael S. Kilberg, and Dr. Fuller W. Bazer. I especially thank Dr. R.
Michael Roberts for convincing me that I could earn a Ph.D., and for his
continued support over all of the years that we worked together. I am
indebted to Dr. Harry S. Nick for allowing me to be a part of his
laboratory. I would like to express my gratitude to Dr. Richard P.
Boyce, Graduate Coordinator--a graduate student's best friend.
Warm thanks are extended to the many helpful scientists from
laboratories of Dr. Roberts and Dr. Bazer, especially Dr. George A.
Baumbach, Dr. William C. Buhi, Dr. Phillipa T.K. Saunders and Dr. Mary
K. Murray. I am also indebted to my fellow graduate students in the
laboratory of Dr. Nick. A number of undergraduate assistants and
laboratory technicians have been helpful to me. I would specifically
like to express my appreciation to Joy Whitman, Samantha Roberts,
Penelope Edwards and Carol Ann Harper.
I am grateful to Dr. Raul Braylan for providing the human spleens;
and to Dr. Rosalia C. M. Simmen for the generous gift of two porcine
uteroferrin clones. I sincerely thank Liz Dampier, who cheerfully typed
every word of this dissertation.
ii

A special word of thanks goes to my parents, Alfred and Antoinette
Scopa, and to my husband's parents, Sigurd and Valerie Martin. Their
loyalty and approval have always been very important to me.
I wish to express my greatest appreciation to my dear husband,
Glenn. His patience and unfailing love have been the keys to my success.
iii

TABLE OF CONTENTS
page
ACKNOWLEDGMENTS ii
LIST OF TABLES vii
LIST OF FIGURES ix
ABBREVIATIONS xi
ABSTRACT xiii
CHAPTERS
1 INTRODUCTION 1
The Tartrate-resistant Acid Phosphatases 1
Uteroferrin 1
Uteroferrin is Synthesized by the Uterine
Endometrium Under the Influence of Progesterone 2
The Purification of Uteroferrin from Uterine
Secretions 3
Uteroferrin is an Iron-containing Acid
Phosphatase 5
Uteroferrin Contains Two Iron-binding Sites 6
A Proposed Reaction Mechanism for Uteroferrin 8
Uteroferrin Contains at Least One High
Mannose Oligosaccharide Chain 9
The Function of Uteroferrin 11
Other Purple, Iron-containing Acid Phosphatases 12
Human Acid Phosphatases 15
Characterization of the Human Acid Phosphatases 15
Hairy Cell Leukemia 17
Tartrate-resistant Acid Phosphatase Levels in
Other Diseases 18
Purification and Characterization of the
Type 5 Isozyme 19
2 THE HUMAN TYPE 5, TARTRATE-RESISTANT ACID PHOSPHATASE FROM
SPLEEN OF HUMANS WITH HAIRY CELL LEUKEMIA. PURIFICATION,
PROPERTIES, IMMUNOLOGICAL CHARACTERIZATION AND COMPARISON
WITH PORCINE UTEROFERRIN 22
Introduction 22
iv

Materials and Methods 24
Materials 24
Methods 25
Results 37
Purification of Uteroferrin 37
Purification of the Human Type 5 Acid Phosphatase
from Hairy Cell Spleen 40
Purification of the Type 5 Isozyme from Normal
Human Spleen 49
Purification of the Type 5 Phosphatase from
Human Placenta 49
Purification of the Bovine Spleen, Bovine Uterine
and Rat Spleen Phosphatases 50
pH Optima of the Type 5 Phosphatases 50
Glycoprotein Nature of the Type 5 Phosphatases 50
Iron Content of the Type 5 Phosphatases 54
Activation by Reducing Agents 54
Effects of Inhibitors on Phosphatase Activity 56
Substrate Specificity for Phosphatase Activity 59
Immunological Cross-reactivity 63
The Production of Monoclonal Antibodies against
Porcine Uteroferrin 63
The Production of Monoclonal Antibodies against
the Hairy Cell Spleen Enzyme 67
The Binding of the Monoclonal Antibodies to Other
Tartrate-resistant Acid Phosphatases 70
Inhibition of Enzymatic Activity by the Binding
of Monoclonal Antibodies 74
Discussion 74
3 MOLECULAR CLONING OF THE TYPE 5, TARTRATE-RESISTANT
ACID PHOSPHATASE FROM HUMAN PLACENTA AND ITS EXPRESSION
IN LEUKEMIA CELLS 82
Introduction 82
Materials and Methods 84
Materials 84
Methods 84
Results 104
The Identity of the Positive Clones Obtained by
Immunoscreening the Human Placenta cDNA Library 104
Dot Blot Analysis of Uteroferrin and Fibronectin
with Anti-Uteroferrin Ill
Results from Screening the Mouse Spleen
cDNA Library Ill
Results from Screening the Porcine Uterine
Endometrium cDNA Library 117
The Molecular Cloning of a cDNA Coding for
the Human Type 5, Tartrate-resistant
Acid Phosphatase 118
cDNA Sequences 125
Characteristics of the Deduced Amino Acid Sequence 125
v

Northern Analysis 128
Induction of Tartrate-resistant Acid Phosphatase
by TPA 133
The Effects of Hemin on Acid Phosphatase Expression 135
Discussion 135
4 CONCLUSIONS AND FUTURE DIRECTIONS 143
REFERENCES 150
BIOGRAPHICAL SKETCH 165
vi

LIST OF TABLES
Table page
2-1 Tartrate insensitivity and activation by
2-mercaptoethanol of acid phosphatase activity
in spleen homogenates from a patient with hairy
cell leukemia and from an individual with a
normal spleen 41
2-2 Purification of tartrate-resistant acid
phosphatase from spleen of a patient with
hairy cell leukemia 46
2-3 Levels of tartrate-resistant acid phosphatase
activity in various tissues 52
2-4 pH optima for the tartrate-resistant acid phosphatases .. 53
2-5 The iron content of the tartrate-resistant
acid phosphatases 55
2-6 Activation of purified human hairy cell phosphatase
by 2-mercaptoethanol 57
2-7 Action of various potential inhibitors on the
hairy cell acid phosphatase, uteroferrin, bovine spleen
and bovine uterine acid phosphatases 58
2-8 Comparison of substrate specificities of hairy cell
phosphatase, uteroferrin, bovine spleen and
bovine uterine phosphatases 62
2-9 Dissociation constants (Kp values) for binding of
monoclonal antibodies to uteroferrin, the human spleen
enzyme, the rat spleen enzyme, the bovine spleen and
uterine enzymes 73
2-10 Inhibition of acid phosphatase activity of uteroferrin by
monoclonal antibodies 75
3-1 The clones employed for generation of the complete
sequence of the human tartrate-resistant
acid phosphatase 124
vii

3-2
Tartrate-resistant acid phosphatase levels in K562 and
JURKAT cells maintained on 10"®M TPA and K562 cells
maintained on 60/iM hemin 134
3-3 Potential epitopes common to porcine uteroferrin and
human fibronectin 137
viii

LIST OF FIGURES
Figure page
2-1 Purification of uteroferrin from allantoic fluid
of a day 67 pregnant pig 39
2-2 Purification of human spleen phosphatase 44
2-3 SDS-polyacrylamide gel electrophoresis of purified
uteroferrin and hairy cell phosphatase 47
2-4 Polyacrylamide gel electrophoresis of acid
phosphatases at pH 5.4 in p-alanine buffer 48
2-5 SDS-polyacrylamide gel electrophoresis of uteroferrin,
the phosphatase from human spleen and the phosphatase from
placenta 51
2-6 Lineweaver-Burk plots of uteroferrin and hairy cell
phosphatase activities in the presence of 2-mercap-
toethanol and various inhibitors 61
2-7 Solid phase radiobinding assay of whole mouse
antiserum from mice immunized with human spleen
phosphatase (upper panel) or uteroferrin (lower panel) ... 65
2-8 Competitive binding of anti-uteroferrin monoclonal
antibodies to uteroferrin adsorbed to flexvinyl
microtiter wells 69
2-9 Binding of four monoclonal antibodies to uteroferrin
and to the immunoaffinity purified phosphatases
from human, bovine and rat spleens 72
3-1 The nucleotide sequences of the cDNA clones coding for
porcine uteroferrin used for screening the human placenta
cDNA library and their deduced amino acid sequences 90
3-2 The sequences of the redundant oligonucleotides used for
Southern blot analysis and their deduced amino
acid sequences 96
3-3 Nitrocellulose filters containing immunoreactive fusion
proteins produced by recombinant lambda gtll phage from
a human placenta cDNA library which was screened with
anti-uteroferrin antibodies 106
ix

3-4 Agarose gel electrophoresis of DNA from six positive
clones obtained by immunoscreening human placenta and
mouse spleen cDNA libraries and Southern analysis of
the clones probed with HP6.1 107
3-5 Southern blot analysis of clone HP 6.1 probed with
radiolabeled oligonucleotide KM28 109
3-6 Polyacrylamide gel electrophoresis of clone HP 6.1
restriction fragments obtained with Alu I and Hae III ....110
3-7 The nucleotide and inferred amino acid sequences of
clone HP 6.1, which codes for human fibronectin 113
3-8 Dot blot analysis of the binding of polyclonal and
monoclonal antibodies against porcine uteroferrin to
uteroferrin and human fibronectin 116
3-9 Two positive clones, 2a and 6a, identified by screening
the human placenta cDNA library with the cDNAs coding for
porcine uteroferrin 119
3-10 Agarose gel electrophoresis of EcoR I digests DNA from
two positive clones, 2a and 6a 120
3-11 Polyacrylamide gel electrophoresis of the restriction
fragments obtained by the digestion of clones 2a and 6a
with Alu I, Hae III and Msp I 122
3-12 Subcloning and sequencing strategy for clone 6a, the
cDNA encoding the human Type 5, tartrate-resistant acid
phosphatase 123
3-13 The nucleotide sequence of the cDNA clone 6a and the
deduced amino acid sequence of the human Type 5,
tartrate-resistant acid phosphatase 127
3-14 Comparison of the deduced amino acid sequence of the
human tartrate-resistant acid phosphatase with the
amino acid sequences of porcine uteroferrin and the
bovine spleen acid phosphatase 130
3-15 Expression of tartrate-resistant acid phosphatase mRNA
and its induction by TPA 132
x

ABBREVIATIONS
bp, base pairs
BSA, bovine serum albumin
cDNA, complementary DNA
CM-cellulose, carboxymethyl cellulose
ConA, Concanavalin A
DME, Dulbecco's Modified Eagle's Medium
DME-HAT, DME with hypoxanthine, aminopterin and thymidine
DNase, deoxyribonuclease
DTT, dithiothreitol
EBV, Epstein-Barr Virus
EDTA, ethylenediaminetetraacetic acid
GlcNAc, N-acetylglucosamine
GTC, guanidinium thiocyanate solution
IgG, immunoglobulin G
i.p., intraperitoneally
IPTG, isopropylthio-/3-D-galactopyranoside
kb, kilobases
Kp, dissociation constant
MOPS, 3-(N-morpholino)propanesulfonic acid
Mr, relative molecular mass
PAGE, polyacrylamide gel electrophoresis
PBS, phosphate buffered saline
Phosphodiesterase, N-acetylglucosamine-l-phosphodiester oc-N-acetyl -
glucosaminidase
Phosphotransferase, UDP-N-acetylglucosamine:lysosomal enzyme
N-acetylglucosamine 1-phosphate transferase
PMSF, phenylmethylsulfonylfluoride
pNPP, p-nitrophenylphosphate
RNase, ribonuclease
SDS, sodium dodecyl sulfate
xi

SDS-PAGE, polyacrylamide gel electrophoresis with sodium dodecyl sulfate
SP2/0, SP2/0-Agl4
SSC, standard sodium citrate buffer
TE, Tris-HCl with EDTA
TPA, 12-0-tetradecanoylphorbol 13-acetate
TR-AP, tartrate resistant acid phosphatase (Type 5 isozyme)
Tris, tris(hydroxymethyl)aminomethane
Uf, uteroferrin
X-gal, 5-chloro-4-bromo-3-indolyl /3-D-galactopyranoside
xii

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
THE HUMAN TYPE 5, TARTRATE-RESISTANT ACID PHOSPHATASE:
PURIFICATION, CHARACTERIZATION AND MOLECULAR CLONING
By
Catherine Mary Ketcham
August, 1988
Chairman: Dr. R. Michael Roberts
Major Department: Biochemistry and Molecular Biology
The spleens of patients with hairy cell leukemia contain high levels
of a tartrate-resistant cationic acid phosphatase, known as the Type 5
isozyme. This enzyme is also present in small quantities in normal
spleen and term placenta. This phosphatase has been purified from these
three sources by a procedure which involves only two chromatographic
steps: CM-cellulose chromatography and immunoaffinity chromatography on
a column of anti-uteroferrin antibodies. Uteroferrin is an abundant
purple, iron-containing acid phosphatase that can be easily purified
from porcine uterine secretions. Like uteroferrin, the human enzyme is
an iron-containing glycoprotein of apparent molecular weight 34,000.
The human phosphatase and uteroferrin also resemble each other closely
in electrophoretic mobility, substrate specificity, and response to a
variety of activators and inhibitors. Three anti-uteroferrin monoclonal
antibodies which bind with high affinities to distinct sites on the
uteroferrin molecule also recognize the human spleen enzyme, but bind to
xiii

it with much lower affinities. These antibodies also recognize purple,
iron-containing acid phosphatases from bovine and rat spleens and the
bovine uterus. A 1412-base pair cDNA has been cloned from human
placenta which encodes the entire human tartrate-resistant, Type 5
isozyme. This cDNA contains an open reading frame of 969 base pairs,
corresponding to a protein of 323 amino acids. A putative signal
sequence of 19 amino acids and two potential glycosylation sites are
present. The deduced amino acid sequence of the human enzyme is 85%
identical to that of porcine uteroferrin and 82% identical to the
corresponding regions of a partial amino acid sequence of the bovine
spleen enzyme. Northern blotting techniques employing a radiolabeled
cDNA probe coding for the human enzyme revealed the presence of a 1.5 kb
transcript in leukemic hairy cells, an Epstein-Barr virus-transformed
B-cell line, and the erythroleukemia cell line K562. Culture of K562
cells in the presence of 10'®M 12-0-tetradecanoylphorbol 13-acetate
enhanced tartrate-resistant acid phosphatase activity about 30-fold and
led to a corresponding increase in Type 5 isozyme mRNA levels.
xiv

CHAPTER 1
INTRODUCTION
The Tartrate-resistant Acid Phosphatases
The tartrate-resistant acid phosphatases have been studied
extensively by various research groups with different objectives. The
most abundant enzyme in this family, porcine uteroferrin, has been well
characterized physically and enzymatically, yet much of the research on
this protein has involved the determination of its role in iron
metabolism in the mid-pregnant pig. The beef spleen acid phosphatase
was first identified over 25 years ago, and while its physical
characteristics as a metalloprotein are well known, its function remains
obscure. The human tartrate-resistant acid phosphatase was first
described by researchers interested in the clinical significance of
phosphatase levels in normal and pathological tissue. Few reports have
been published on the characterization of this human enzyme. It is
clear, however, that all of the above proteins share several unusual
features, and that the clinically relevant human enzyme is worthy of
further study.
Uteroferrin
The uterine secretions of pigs contain a purple, basic, iron-
containing glycoprotein with acid phosphatase activity known as
uteroferrin. Uteroferrin has been well characterized since it was first
described in 1972 by Murray et al. Its enzymatic characteristics have
1

2
been studied by our laboratory, and its interesting spectral properties
have been the subject of numerous publications by many different
researchers. Our laboratory has also determined the likely function of
uteroferrin in the pregnant pig.
Uteroferrin is Synthesized by the Uterine Endometrium Under the
Influence of Progesterone
One of the major goals of our laboratory has been to purify and
characterize the proteins secreted by the porcine uterus. The quantity
and variety of proteins produced depend on the hormonal state of the
animal. Knight et al. (1974) described the collection of uterine fluids
from ovariectomized gilts which had been treated with estradiol 17-/3,
progesterone, progesterone plus estradiol 17-/J, or corn oil (control),
for 15 days. It was demonstrated that progesterone or progesterone plus
estradiol treatment caused a highly significant increase in the amount
of total protein that could be recovered relative to corn oil control or
estradiol treatment alone. Estradiol alone promoted neither increased
protein accumulation nor the appearance of novel proteins, but it acted
synergistically with progesterone to stimulate uterine secretory
activity when given at low dosage. A variety of proteins were thus
shown to be secreted by the porcine uterus under the influence of
progesterone. A protein now known as uteroferrin accounted for about
10-15% of the total protein in the uterine secretions of progesterone
treated animals (Schlosnagle et al., 1974).
Simmen et al. (1988) compared the biosynthetic rate of uteroferrin
to uteroferrin mRNA levels throughout pregnancy in the pig. Synthesis
of uteroferrin begins to increase markedly after day 30 of pregnancy in
association with a decline in maternal estrogen levels. Uteroferrin

3
biosynthesis reaches a maximum between days 60 and 75 (Basha et al.,
1979), and then declines towards term, which is about day 115 (Bazer et
al., 1975). The progesterone to estrogen ratios are highest between
days 35 to 75, which coincides well with maximal uteroferrin production
(Roberts and Bazer, 1980). Levels of uteroferrin in allantoic fluid
during pregnancy reach a maximum at a similar time (Roberts and Bazer,
1980). In comparison, highest levels of mRNA coding for uteroferrin
were detected during mid- and late-pregnancy. The mRNA levels at days
45-60 were comparable to those at days 90-110 (Simmen et al., 1988).
Thus, the amount of uteroferrin mRNA as determined by Northern analysis
does not appear to reflect the rate of uteroferrin biosynthesis as
determined by the incorporation of radioactive leucine. The regulation
of uteroferrin synthesis may therefore involve transcriptional and post-
transcriptional control. These results support the earlier theory that
although progesterone is essential for uteroferrin production, estrogens
may have an important modulating role, due to the fact that uteroferrin
synthesis is highest when the ratio of progesterone to estrogen is
highest (Roberts and Bazer, 1980).
The Purification of Uteroferrin from Uterine Secretions
Uteroferrin is most conveniently purified from the uterine flushes
of pseudopregnant animals (Basha et al., 1980), or from the allantoic
fluid of mid-pregnant pigs (Bazer et al., 1975). Pseudopregnancy can be
induced in sows by administering estradiol-17/3 daily between days 11-14
after estrus (Frank et al., 1978). The injected estradiol appears to
mimic an estrogen burst from the blastocyst which is believed to be the
signal to the sow which indicates she is pregnant (Bazer and Thatcher,

4
1977) . Secretions of a day 60 pseudopregnant animal are comparable in
quality and quantity to those of an ovariectomized animal given daily
doses of progesterone for two months. Uteroferrin can be purified from
allantoic fluid after day 30 of pregnancy. However, uteroferrin in
sterile allantoic fluid is rapidly degraded, even when stored at 4°C.
Therefore, the allantoic fluid must be frozen after collection or used
immediately, and the purification of uteroferrin must be carried out
quickly.
Because uteroferrin is available in gram quantities, and because of
its purple color, the development of a purification protocol for
uteroferrin was quite straightforward. Since uteroferrin is a very
basic protein, it binds to carboxymethyl cellulose even at high pH
values. A combination of ion exchange chromatography and gel filtration
on Sephadex G-100 is sufficient to yield pure uteroferrin of Mr 35,000,
as determined by SDS polyacrylamide gel electrophoresis (Chen et al.,
1973). Interestingly, uterine flushes and allantoic fluid obtained from
animals during early pregnancy (days 45-60) also contain a high
molecular weight (Mr=80,000), pink form of uteroferrin (Bazer et al.,
1975). It is now known that this protein consists of a molecule of
uteroferrin non-covalently associated with another, antigenically
unrelated protein (Baumbach et al., 1986). The reason for the
association of uteroferrin with this second protein is unknown.
A number of other interesting proteins, though none as abundant as
uteroferrin, can also be purified from porcine uterine secretions (see
Roberts and Bazer, 1988). These proteins include a family of
trypsin/plasmin protease inhibitors ( Mullins et al., 1980; Fazleabas et

5
al., 1982), and a group of retinol binding proteins (Adams et al.,
1981).
Uteroferrin is an Iron-containing Acid Phosphatase
Schlosnagle et al. (1974) demonstrated that the abundant, basic,
purple glycoprotein from porcine uterine secretions was an iron-
containing acid phosphatase. They reported a pH optimum of 4.9 and a Km
of 2.2mM for the enzyme's preferred substrate, p-nitrophenylphosphate.
Weak reducing agents, such as 2-mercaptoethanol enhanced activity 2- to
4-fold, without changing the Km. Uteroferrin's phosphatase activity
could be inhibited by fluoride, arsenate, phosphate and molybdate
(Schlosnagle et al., 1976). Sodium dithionite caused an immediate loss
of enzymatic activity and bleaching of color, although activity could be
restored with Fe^+ salts (Schlosnagle et al., 1976). Oxidizing agents,
and reagents which interact with sulfhydryl groups also inhibited
uteroferrin (Schlosnagle et al., 1976). Uf was not inhibited by
tartrate, an unusual feature in an acid phosphatase. The substrate
specificity of uteroferrin was also unusual. It readily hydrolyzed
compounds with strong leaving groups, such as p-nitrophenylphosphate and
ATP, but had little or no activity towards aliphatic phosphates such as
/3-glycerol phosphate, or hexose phosphates such as D-glucose 6-phosphate
(Schlosnagle et al., 1974). Uteroferrin also displayed phosphoprotein
phosphatase activity (Roberts and Bazer, 1976).
Uteroferrin, as purified, is predominantly purple and enzymatically
inactive. This purple coloration originates from a broad absorption
band centered around 545nm. However, when uteroferrin is activated by
2-mercaptoethanol, the extinction maximum changes from 545nm (purple) to

6
508nm (pink) (Schlosnagle et al., 1974). The reverse reaction (pink to
purple) is promoted by oxidizing agents. When purified, uteroferrin
consists of an equilibrium mixture of the reduced (pink) and oxidized
(purple) forms, with the latter predominating. The equilibrium between
the pink and purple forms may depend on the redox state of the fluid
sample from which the protein was recovered. In contrast, the stable
pink, high molecular weight form of uteroferrin does not require
reducing agents for activity, it is fully active as purified (Baumbach
et al., 1986). It is not clear how non-covalent association with a
second, unrelated protein stabilizes the active form of the enzyme.
Uteroferrin Contains Two Iron-binding Sites
The amount of iron bound to uteroferrin has been the subject of
controversy. Early reports (Roberts and Bazer, 1980) indicated that
uteroferrin contained a monoferric site. However, it is now clear that
each molecule of uteroferrin can bind up to two iron atoms, although
only one of these iron atoms is necessary for the purple/pink
coloration. It has been demonstrated that the iron at the more labile,
non-chromophoric site can be replaced by a variety of other metals
including zinc, copper and mercury (Beck et al., 1984). The apparent
lower content of iron (less than two atoms per molecule) consistently
noted in some samples of uteroferrin (see Baumbach et al., 1986) may
have resulted from a partial absence of iron at the non-chromophoric
site and its replacement by other metals.
A number of methods have been employed to study the iron binding
sites in uteroferrin and the related beef spleen purple phosphatase.
EPR, Mossbauer, NMR and magnetic susceptibility studies are consistent

7
with a model in which the iron atoms occupy two distinct but adjacent
sites which are sufficiently close so that the two atoms are
magnetically coupled (Davis and Averill, 1982; Debranner et al., 1983;
Lauffer et al., 1983). Purple, enzymatically inactive uteroferrin is
believed to contain two ferric ions. This form of uteroferrin gives no
EPR signal, presumably because the spins of the two ferric ions are
antiferromagnetically coupled, with a net spin of zero. When purple
(Emax=545nm) uteroferrin is treated with mild reducing agents and turns
pink (Emax=508nm), it contains a ferric-ferrous iron pair, which gives
rise to an intense g'=1.74 EPR signal at liquid helium temperatures
(Antanaitis and Aisen, 1983). The naturally occurring, high molecular
weight pink form of uteroferrin gives rise to the same g'=1.74 EPR
signal without the addition of reducing agents (Baumbach et al., 1986).
At present there is no adequate model to describe the iron binding
sites of uteroferrin. Resonance-Raman studies have shown that the
purple-pink color most likely arises from coordination of iron to
tyrosine residues (Gaber et al., 1979). The iron atom involved is
probably the less labile one at the Fe(III) site on pink reduced
uteroferrin, since the molar extinction coefficient does not change when
the protein is reduced from its purple to its pink form. However, the
color change from purple to pink most likely represents disulfide
reduction rather than reduction of iron (Schlosnagle et al., 1976).
Histidine has also been implicated as a ligand for the iron atoms
(Lauffer et al., 1983), and an oxygen atom has been suggested to bridge
the iron sites (Mockler et al., 1983). Orthophosphate is coordinated
with the iron center on purple uteroferrin (Antanaitis and Aisen, 1983).

8
The amino acid sequence of uteroferrin revealed that the iron binding
sites must be non-identical, because the protein contains no internal
repeats with histidine and tyrosine residues in identical spacial
relationships. It is not clear which of the 10 histidine and 10
tyrosine residues which are conserved in uteroferrin and the beef spleen
enzyme could be ligands for the metals (Hunt et al., 1987).
A Proposed Reaction Mechanism for Uteroferrin
Unlike the alkaline phosphatases where the role of the Zn(II) is
fairly well understood, the function of the iron atoms in catalytic
activity of uteroferrin and the other purple acid phosphatases is
unknown. Competitive inhibitors such as phosphate and arsenate interact
with the paramagnetic centers on these proteins, which suggest that the
metal contributes to substrate binding (Davis and Averill, 1982, Kawabe
et al., 1984). Such substrate-iron complexes would probably be stable
around pH 5.0, and may explain the acid pH optimum. The iron, by virtue
of its strong electron withdrawing properties, could therefore promote
catalysis.
It is well documented that the reaction mechanism of the zinc-
containing alkaline phosphatases involves a phosphoryl-enzyme
intermediate (Levine et al., 1969). Previous experimental evidence
obtained with a variety of acid phosphatases also indicated the
formation of a phosphoryl-enzyme intermediate, with a double
displacement reaction mechanism (Hickey and VanEtten, 1972; Igarashi et
al., 1970; Feldman and Butler, 1969). Kinetic evaluation of bovine
purple acid phosphatases indicated that these uteroferrin-like enzymes
undergo a pseudo Uni Bi hydrolytic transfer reaction mechanism (Lau et

al., 1987; Davis et al., 1981). This theory is supported by the fact
that transition state analogs of phosphate such as vanadate, molybdate
and fluoride are potent inhibitors of uteroferrin and the other purple,
9
iron-containing acid phosphatases. Lack of inhibition by p-nitrophenol
suggests that the hydrolysis reaction proceeds via sequential release of
p-nitrophenol and phosphate (Davis et al., 1981):
E + pNPP ,r—^ E- pNPP ^±E-Pi-pNPP
pNP
: E • Pi:
E + Pi
Uteroferrin Contains at Least One High Mannose Oligosaccharide
Chen et al. (1973) reported that the progesterone-induced purple
protein of the porcine uterus was a glycoprotein, and that the
oligosaccharide contained significant amounts of mannose. The structure
of the triantennary 5 or 6 mannose oligosaccharide has been determined
(Saunders et al., 1985), for uteroferrin purified from allantoic fluid
and uterine flushes from pseudopregnant animals.
Man
v°cl,6
Man
\ «1,6
/ocl, 3 \
Man Man ^ ^.GlcNAc —y GlcNAc
/“l»3
(Man oc-'- • Man '
The biosynthesis of uteroferrin's oligosaccharide chain has been
studied in vitro with explants of uterine endometrium. When [^p] Was
provided to such cultures, the label became incorporated into the high

10
mannose oligosaccharide chains of uteroferrin (Baumbach et al., 1984).
Approximately one-third of the oligosaccharide chains cleaved from
uteroferrin by endoglycosidase H had phosphorylated carbohydrate groups:
Thus, uteroferrin, a secreted acid phosphatase, carries the lysosomal
recognition marker, mannose 6-phosphate, considered to be responsible
for the intracellular targeting of acid hydrolyses from the Golgi
complex to the lysosomes (Shephard et al., 1983). These results implied
that uteroferrin is a substrate in vivo for the first of the two enzymes
responsible for the addition of phosphate to terminal mannosyl residues
on lysosomal enzymes. UDP-N-acetylglucosamine: lysosomal enzyme
N-acetylglucosamine 1-phosphate transferase (phosphotransferase) adds
N-acetylglucosamine 1-phosphate from the nucleotide sugar UDP-N-acetyl-
glucosamine to the 6-position of terminal mannose residues. Then
N-acetylglucosamine-l-phosphodiester oc-N-acetylglucosaminidase
(phosphodiesterase) cleaves the resulting phosphodiester bond adjacent
to the N-acetylglucosamine residue (Goldberg and Kornfeld, 1983).
Receptors for mannose 6-phosphate then transport these enzymes from the
Golgi to lysosomes (Shephard et al., 1983). It was also demonstrated
that uteroferrin is an excellent substrate for the phosphotransferase in
vitro (Lang et al., 1984), in fact, it was the best substrate of those
tested so far.
Why is uteroferrin secreted rather than directed to lysosomes?
There are a number of possible explanations. Although uteroferrin is a
good substrate for the phosphotransferase, the covering N-acetyl¬
glucosamine is not efficiently removed by the phosphodiesterase, thus
masking the mannose 6-phosphate (Baumbach et al., 1984), and such

11
phosphodiesters are poor substrates for both mannose 6-phosphate
receptors (Hoflack et al., 1987). The presence of only one
phosphorylated mannose residue on uteroferrin's oligosaccharide may also
make it a poor ligand for the mannose 6-phosphate receptors (S.
Kornfeld, personal communication). The most likely explanation,
however, is that the rate of uteroferrin synthesis in the pregnant
uterus outstrips the intracellular targeting mechanism. Finally, it is
also possible that the primary amino acid sequence of uteroferrin
contains targeting information that directs it to secretory granules
despite the fact that it carries phosphorylated mannose residues.
The Function of Uteroferrin
Roberts and Bazer (1980) have proposed that the primary function of
uteroferrin is not phosphate ester hydrolysis, but in iron metabolism.
Uteroferrin's high Km, unusual substrate specificity and lack of
activity at the pH of the fluid environment in which it is found argues
against an enzymatic role. The uterus of a mid-pregnant pig can produce
more than two grams of uteroferrin per day (Basha et al., 1979), an
amount far exceeding that which could conceivably be used for enzymatic
purposes. Since large quantities of uteroferrin are known to cross the
pig placenta, and the iron from [59 Fe] labeled uteroferrin is used for
fetal erythropoiesis (Buhi et al., 1982a; Ducsay et al., 1982; Renegar
et al., 1982), the role of uteroferrin in the pregnant pig is proposed
to be in iron transport.
The pig has a non-invasive type of placentation, and at no time
during pregnancy is the uterine epithelium eroded. The conceptus
therefore relies upon the secretion of macromolecular products by the

12
mother for a large part of pregnancy. Using a variety of immunochemical
and radiotracer techniques, the path of uteroferrin movement from the
mother to the fetus has been determined in the pig (Buhi et al., 1982a;
Ducsay et al., 1982; Renegar et al., 1982; Ducsay et al., 1984; Roberts
et al., 1986b). Uteroferrin is synthesized in the uterine glands
(Renegar et al., 1982), each of which is covered by a special region of
the chorion (fetal placenta) called an areola. This structure is made
up of specialized absorptive cells filled with large endocytotic
vacuoles. Uteroferrin has been identified in these structures by
immunogold staining (Roberts et al., 1986a) and within the venous
drainage of the placenta. It is cleared from the bloodstream in part by
the fetal liver, which is the major site of fetal hematopoiesis, and
also by the kidney where it enters the urinary filtrate and is voided
into the allantoic sac (Renegar et al., 1982). Uteroferrin in the
allantoic fluid loses its iron to fetal transferrin, which in turn
transports the iron to the fetal liver (Buhi et al., 1982a).
Uteroferrin's synthesis in the porcine uterus and its turnover in
the fetal liver could theoretically supply developing fetuses with
enough iron until day 75 of pregnancy. However, uteroferrin synthesis
appears to fall in late pregnancy, just when iron demand for
erythropoiesis is at a maximum (Roberts and Bazer, 1980). Therefore,
other mechanisms of iron transport may be necessary in order to supply
these needs.
Other Purple. Iron-containing Acid Phosphatases
Several other tartrate-resistant acid phosphatases have been
purified from a variety of sources. A uteroferrin-like purple acid

13
phosphatase has been purified from the uterine secretions of mares in
prolonged diestrus (Zavy et al., 1978; McDowell et al., 1982). An acid
phosphatase has also been partially purified from the uterine secretions
of cows treated with progesterone (Dixon and Gibbons, 1979). These
discoveries were not unexpected, because the pig, the cow and the mare
have similar types of non-invasive placentation.
In 1960, a basic, purple phosphoprotein phosphatase was identified
in beef spleen (Revel and Racker, 1960; Glomset and Porath, 1960) and
was later shown to contain iron (Campbell and Zerner, 1973). Like
uteroferrin, this enzyme showed intense absorption in the range 510-
545nm, and contained two iron binding sites (Davis et al., 1981). Davis
et al. also demonstrated that the substrate specificities, sensitivity
to inhibitors and activation by reducing agents exhibited by the beef
spleen enzyme were similar to those of uteroferrin. However, the beef
spleen enzyme (Mr=40,000) was reported to be made up of two subunits
(Mr=24,000 and 15,000), while uteroferrin is a monomeric enzyme (Mr=
35,000). The beef spleen enzyme has been well characterized with regard
to its iron binding sites, which are virtually identical to those of
uteroferrin (discussed earlier). Thus, the bovine spleen enzyme's iron
cluster is an asymmetrical complex containing two Fe(III) ions, one of
which is reduced to Fe(II) by reductive activation of the enzymes (Davis
and Averill, 1982; Antanaitis and Aisen, 1983; Debranner et al., 1983;
Antanaitis and Aisen, 1982).
The function of the beef spleen enzyme has been addressed only
recently. Schindelmeiser et al. (1987) have localized the enzyme to
lysosomal-like organelles of cells of the reticulo-phagocytic system.

14
The phagocytosing cells that contained the phosphatase were frequently
found in close contact with clusters of aged and deformed erythrocytes.
The authors hypothesized that the enzyme is involved either in the
breakdown of erythrocyte membrane and cytoskeletal phosphoproteins, or
in the metabolism of iron from these erythrocytes.
There have been reports of a bovine skeletal tartrate-resistant acid
phosphatase, assumed to be distinct from the bovine spleen enzyme (Lau
et al., 1985, 1987). This bovine skeletal enzyme resembles the bovine
spleen enzyme and porcine uteroferrin in its molecular weight, pH
optimum, substrate specificities and sensitivity to inhibitors. Like
uteroferrin, and unlike the bovine spleen enzyme, the bovine skeletal
enzyme is reported to be monomeric. The authors chose to stress the
phosphotyrosine phosphatase activity of the enzyme and postulated that
the skeletal acid phosphatase functions in the regulation of
proliferation and differentiation. The authors have not yet described a
physiologic substrate for this phosphoryrosyl-specific protein
phosphatase, and have not demonstrated that it plays an important role
in cell growth. Thus, the function of the acid phosphatase in bone
remains unknown.
Purple, iron-containing acid phosphatases have been purified from
rat spleen (Hara et al., 1984) and rat bone (Kato et al., 1986; Anderson
and Toverud, 1986), and an immunologically related phosphatase was
purified in small quantities from rat epidermis (Hara et al., 1985).
These monomeric enzymes also resembled uteroferrin in molecular weight,
substrate specificities and sensitivity to inhibitors. Hara et al.
(1984, 1985) believe that the spleen and epidermis enzymes may play a

15
role in nucleotide metabolism and that the bone enzyme may be acting as
a phosphoprotein phosphatase in vivo. Although Anderson and Toverud
(1986) have indicated that studies were underway to determine the
function of the rat bone enzyme, the functions of the rat enzymes also
remain obscure.
Human Acid Phosphatases
The human acid phosphatases were first characterized by researchers
interested in the clinical significance of acid phosphatase levels in
normal and pathological tissue. One of the human enzymes, a cationic,
tartrate-resistant enzyme known as the Type 5 phosphatase, was of
interest to us because it seemed as though it might be related to the
well characterized abundant acid phosphatase, porcine uteroferrin.
Characterization of the Human Acid Phosphatases
Li et al. (1970) described electrophoretic separation of human
leukocyte acid phosphatases on 7.5% polyacrylamide gels at pH 4.0, which
were then stained for acid phosphatase activity. They detected six
isozymes of acid phosphatase, varying in electrophoretic mobility. Band
0 did not enter the gel. Band 1 was the slowest migrating form, band 5
the fastest and most basic. The various isozymes could also be
distinguished by their substrate specificities and sensitivity to
inhibitors.
Lam et al. (1973) described in detail the distribution of acid
phosphatases in normal human tissue. Isozymes 1 and 3 were the most
widely distributed and most active forms. Higher type 2 levels were
characteristic of the prostate. Type 5 was the least common and least

16
abundant isozyme, detected in only small quantities in spleen, kidney
and liver.
These researchers noticed differences in acid phosphatase levels and
in relative isozyme ratios in normal plasma and leukocytes versus those
from patients with certain diseases. In normal leukocytes, band 1 was
the strongest, bands 2, 3 and 4 were of moderate strength and band 5 was
very weak (Yam et al., 1971). Patients with infectious mononucleosis,
for example, exhibited elevated levels of isozymes 1, 3 and 5 in
leukocytes (Li et al., 1973). Isozyme 2 was found to be elevated in the
plasma of patients with prostatic cancer (Lam et al., 1973). Perhaps
the most striking isozyme pattern was evident in the leukocytes and
spleen homogenate (but not plasma) of patients with hairy cell leukemia.
The leukemic white cells of these patients produced very small amounts
of isozymes 1 through 4, and large quantities of isozyme 5 (Yam et al.,
1971).
Yam et al. (1971) also determined that while acid phosphatase
isozymes 1,2,3 and 4 were completely inhibited by 50mM L-(+)-tartrate,
isozyme 5 was unaffected by this reagent. (Recall that uteroferrin is
resistant to inhibition by tartrate). This observation made it easier
to detect the presence of elevated levels of the Type 5 isozyme in hairy
cell leukemia and allowed cytochemical localization of only this isozyme
in leukocytes and tissue sections. The presence of tartrate-resistant
acid phosphatase activity in the hairy cells in blood smears is the
major method of diagnosis of hairy cell leukemia today (Nanba et al.,
1977; Janckila et al., 1978; Braylan et al., 1979).

17
Hairy Cell Leukemia
The origin of hairy cells has been a subject of controversy for a
number of years. Surface marker studies done with monoclonal antibodies
have revealed hairy cells with properties common to both B-cells and
T-cells (Burns et al., 1980; Worman et al., 1983; Armitage et al.,
1985). Hairy cells have been shown to phagocytose latex particles,
properties which indicated a common origin with monocytes or histiocytes
(Rosenszajn et al., 1976). However, most researchers now agree that
hairy cells have originated from B-lymphocytes, possibly splenic white
pulp marginal zone lymphocytes (Van der Oord et al., 1985). More
specifically, hairy cells may originate from a lymphocyte in a terminal
stage of differentiation, at the point of switching from an IgM-bearing
small lymphocyte to a mature plasma cell (Jansen et al., 1979).
Recently it was proposed that the hairy cell may represent the
terminally differentiated B-lymphocyte (Robinson et al., 1985; Gazitt
and Polliack, 1987).
Clinically, hairy cell leukemia is represented by a slow insidious
onset, splenomegaly, anemia and the appearance of leukemic hairy cells
in the spleen, bone marrow and peripheral blood (Nanba et al., 1977).
Significant quantities of tartrate-resistant acid phosphatase are
contained in the reticulum and epithelioid cells of the patients'
spleens. In the past splenectomy was often performed in order to reduce
the tumor load. More recently, it has been demonstrated that
oc-interferon treatment is successful in causing remission in hairy cell
leukemia patients (see Porzsolt, 1986).

18
Tartrate-resistant Acid Phosphatase Levels in Other Diseases
Tartrate-resistant acid phosphatase levels are elevated in several
types of leukemia other than hairy cell leukemia but not in a consistent
manner. Drexler et al. (1985, 1986) have studied acid phosphatase
levels in a variety of human leukemia cell lines and in fresh leukemia
cells obtained directly from patients. These researchers found that the
few leukemia cell lines which did express the phosphatase were those
which represented lymphocytes arrested late in differentiation. Many
researchers now believe that tartrate-resistant acid phosphatase may be
useful as an enzymatic marker for B-lymphocyte differentiation (Drexler
et al., 1985) and that measurement of its activity may have prognostic
value (Pieters and Veerman, 1987) .
Measurement of serum acid phosphatase levels may also be of clinical
significance. While the Type 5, tartrate resistant acid phosphatase is
not detected at high levels in the plasma of patients with hairy cell
leukemia, plasma levels of this isozyme are high in patients with
diseases which involve bone reabsorption and regeneration, and in
patients with malignancies metastasized to bone (Lam et al., 1978).
These diseases include Paget's disease, which is a type of bone tumor,
and osteoporosis (Li et al., 1973). Tartrate-resistant acid phosphatase
activity is also elevated in the plasma of children during bone growth
(Chen et al., 1979). Plasma levels of the Type 5 phosphatase are also
high in patients with Gaucher's disease, which is an inherited
glycosphingolipid storage disease characterized by /3-glucocerebrosidase
deficiency. The phosphatase in Gaucher's disease is believed by some

19
researchers to be of osteoclast origin, and most likely a secondary
phenomenon indicative of bone involvement (Choy, 1985).
It is interesting to note that while the acid phosphatase of hairy
cells is intracellular, confined to discrete inclusion bodies resembling
lysosomes (Lam et al., 1976), osteoclasts secrete this enzyme under the
influence of parathyroid hormone (Miller, 1985; Braidman et al., 1986;
Chambers et al., 1987). It is not clear whether the secreted osteoclast
and lysosomal spleen Type 5 phosphatases are distinct enzymes.
Purification and Characterization of the Human Type 5 Isozyme
In all of the studies described above, acid phosphatase levels were
measured by histochemical methods or by enzymatic staining of non¬
denaturing polyacrylamide gels. There are a few reports in the
literature of attempts to purify and characterize the human tartrate-
resistant acid phosphatase. Although these reports contain some
contradictory information, one fact becomes apparent: This human Type
5, tartrate-resistant acid phosphatase has a number of properties
reminiscent of porcine uteroferrin.
An attempt was made by Lam and Yam (1977) to purify this human Type
5 acid phosphatase from the spleen of a patient with hairy cell
leukemia. They were not able to purify the enzyme to homogeneity.
Although the authors reported an Mr of 64,000, which is almost twice
that of uteroferrin, many of the characteristics they reported for the
enzyme were reminiscent of the characteristics of uteroferrin and the
other purple, iron-containing acid phosphatases. The human hairy cell
enzyme, like uteroferrin, was a very basic protein. This human enzyme,

20
also like uteroferrin, hydrolyzed p-nitrophenylphosphate, ATP and
pyrophosphate but was virtually inactive towards hexose phosphates,
¿?-glycerol phosphate and AMP. The human enzyme was also activated by
mild reducing agents and very sensitive to inhibition by molybdate.
A tartrate-resistant acid phosphatase was also purified from a
Gaucher's disease spleen (Robinson and Glew, 1980; 1981). This enzyme
was believed to be distinct from the hairy cell spleen enzyme. Like
uteroferrin and the other purple, iron-containing acid phosphatases,
this enzyme was reported to have an Mr of 33,000. It bound avidly to
Concanavalin A Sepharose, indicating its glycoprotein nature. It, too,
was sensitive to inhibition by molybdate, fluoride and dithionite.
However, this enzyme had a number of features which were unlike the
hairy cell enzyme. It was reported that the Gaucher enzyme was made up
of two subunits of Mr 20,000 and 16,000, did not hydrolyze
pyrophosphate, and was not activated by reducing agents. Thus, it was
not clear whether the Gaucher spleen and hairy cell spleen enzymes were
the same protein. Efstratiatis and Moss (1985) partially purified an
Mr=37,000 tartrate-resistant, molybdate-sensitive acid phosphatase from
lung, and detected an apparently identical enzyme in osteoclasts. It is
not known whether the lung/osteoclast tartrate-resistant acid
phosphatase is identical to either of the spleen enzymes.
Although it was once believed that uteroferrin was uniquely
associated with the uterus (Roberts and Bazer, 1980), it is now clear
that there is a growing family of purple, iron-containing acid
phosphatases. The human tartrate-resistant acid phosphatase may belong
to this enzyme family. Because of the clinical significance of the

21
human Type 5 phosphatase, it seemed to be a subject worthy of further
study. In Chapter 2, the purification of the human tartrate-resistant
acid phosphatase to homogeneity is described, and its physical
properties are clearly defined. The enzymatic characteristics of the
phosphatase are described in detail, and the immunologic relationship of
the human enzyme to the purple, iron-containing acid phosphatases is
investigated. Chapter 3 deals with the molecular cloning of a cDNA
coding for the human tartrate-resistant acid phosphatase, the
characteristics of the deduced amino acid sequence, and the expression
of the enzyme in leukemia cells.

CHAPTER 2
THE TYPE 5, TARTRATE-RESISTANT ACID PHOSPHATASE FROM SPLEEN OF HUMANS
WITH HAIRY CELL LEUKEMIA. PURIFICATION, PROPERTIES, IMMUNOLOGICAL
CHARACTERIZATION, AND COMPARISON WITH PORCINE UTEROFERRIN.
Introduction
Measurement of serum and tissue levels of acid phosphatase can prove
useful in the diagnosis of several human disease states (Gutman et al.,
1936; Yam et al., 1980; Drexler and Gaedicke, 1983; Yam et al., 1983;
Allhoff et al., 1983). At least six isozymes of acid phosphatase have
been identified by their relative electrophoretic mobilities towards the
cathode at low pH. The most basic, a minor isozyme known as Type 5, is
elevated in the circulating white cells and enlarged spleens of patients
with hairy cell leukemia (Lam et al., 1980; Yam et al., 1983; Yam et
al., 1971; Lam and Yam, 1977) and in spleens and sera of patients with
Gaucher's disease (Choy, 1983). This same isozyme also appears to be a
secretory product of osteoclasts (Minkin, 1982; Chen et al., 1979;
Stepan et al., 1983), and of osteoclastic bone tumors (Chen et al.,
1979; Tavassoli et al., 1980). The Type 5 phosphatase can be
distinguished from the other isozymes, not only by its basic nature, but
also because it is not inhibited by L-(+)-tartrate. Indeed, the
cytohistochemical demonstration of a tartrate-resistant acid phosphatase
within leukemic hairy cells is currently the most usual method of
diagnosing this rare form of leukemia (Nanba et al., 1977; Janckila et
al., 1978; Braylan et al., 1979).
22

23
The enzyme produced by the spleen histiocytes of patients with
Gaucher's disease has been purified in very small quantities by Robinson
and Glew (1980). This phosphatase was activated by reducing agents and
had high catalytic activity towards a variety of substrates, both
artificial and natural, which had strong leaving groups, but had very
low activity towards aliphatic phosphate esters. It was also a
phosphoprotein phosphatase. A similar enzyme has been isolated from the
spleen of a patient with hairy cell leukemia (Lam and Yam, 1977).
However, the latter enzyme appeared to differ from the Gaucher
phosphatase in a number of respects, including its response to reducing
agents, its molecular weight and its substrate specificity. Moreover
its specific activity was about 10-fold lower than that of the Gaucher
enzyme.
The enzymatic properties of the Type 5 human isozyme are very
similar to those of a well characterized, abundant acid phosphatase
known as uteroferrin. This unusual molecule is a purple colored, iron-
containing glycoprotein that was first purified from uterine secretions
of pigs (Chen et al., 1973). Its synthesis, which occurs within the
glandular epithelium of the uterus (Renegar et al., 1982), is under
progesterone control (Roberts and Bazer, 1980). During pregnancy
approximately 2g of the protein are produced daily (Basha et al., 1979).
It has been shown to be taken up by the overlying placenta and to enter
the fetal blood stream (Renegar et al., 1982). Its iron is then rapidly
utilized in fetal erythropoiesis (Ducsay et al., 1982; Buhi et al.,
1982a). A role for uteroferrin in transplacental iron transport has
been proposed (Roberts and Bazer, 1980; Buhi et al., 1982a). However,

24
the fact that uteroferrin, particularly when activated with mild
reducing agents such as ascorbate or mercaptoethanol, is a potent acid
phosphatase (Schlosnagle et al., 1974; 1976) has raised questions as to
whether iron transport is the major or only function of the protein
(Davis et al., 1981). In this regard, acid phosphatases which are
clearly similar to uteroferrin in their spectral properties, molecular
weight, and iron content have been isolated from a variety of sources
(Antanaitis and Aisen, 1983). In addition, there are several
descriptions of acid phosphatases, including the Type 5 human isozyme,
which resemble uteroferrin in their enzymatic properties, but which have
either not been purified or else have been isolated in such small
quantities that they have not been fully characterized (Roberts and
Bazer, 1976). For the above reasons it has been proposed that
uteroferrin may be but one member of a broad class of acid phosphatases
which has a wide distribution (Roberts and Bazer, 1980; 1976).
Chapter 2 contains the description of a simple method for the
purification of the enzyme from human spleen by making use of antibodies
to the readily available uteroferrin. It is demonstrated conclusively
that this human isozyme belongs to the class of iron-containing acid
phosphatase best illustrated by uteroferrin. Monoclonal antibodies have
been prepared against both uteroferrin and the human enzyme which appear
to have broad reactivity towards this class of enzyme.
Materials and Methods
Materials
CM-cellulose was obtained from Whatman, Sephadex G-100 and
Sepharose-4B from Pharmacia, and Triton X-100 from Rohm and Haas Co.

25
All substrates, activators, and inhibitors (except anions) used for acid
phosphatase assays, cyanogen bromide, protein standards, Fast Garnet GBC
salt, buffers and protease inhibitors were purchased from Sigma.
Reagents for the Bradford protein assay were purchased from Bio-Rad.
Isozyme standards from serum (for human acid phosphatase activity) were
obtained from Calbiochem-Behring. All other chemicals (reagent grade or
better) were obtained from Fisher.
Methods
Purification of uteroferrin. Uteroferrin was purified from the
uterine secretions of pseudopregnant pigs or from allantoic fluid as
previously described (Schosnagle et al., 1974; Roberts and Bazer 1980).
Allantoic fluid was dialyzed overnight at 4°C against 0.01M Tris-HCl,
pH 8.2. A slurry of carboxymethyl-cellulose (CM-cellulose; 100ml of
settled resin per 4L allantoic fluid) was added in the same buffer.
This mixture was stirred for 1 hour, then packed into a column and
washed with the above buffer. The bound, basic proteins were eluted in
one step by a high salt buffer (0.01M Tris-HCl, pH 8.2, 0.5M NaCl). The
proteins were dialyzed against 0.01M Tris-HCl, pH 8.2 and applied to a
Sephadex G-100 column (5 x 90 cm) which had been previously equilibrated
in 0.1M sodium acetate, pH 4.9 and 0.33M NaCl. (Uterine secretions of
pseudopregnant animals were loaded directly onto the Sephadex G-100
column after centrifugation at 10,000xg at 4°C for 30 minutes.) The
pink, high molecular weight uteroferrin peak, which immediately preceded
the purple peak, was pooled and used without further purification. The
uteroferrin peak, purple in color, was pooled and dialyzed against 0.01M
Tris-HCl, pH 8.2. The uteroferrin was then loaded onto a column of

26
CM-cellulose and eluted with a linear salt gradient (0.01-0.5M NaCl).
Uteroferrin eluted as a symmetrical peak between 0.20 and 0.25M NaCl.
The final preparations of uteroferrin had A280/A545 ratios of less than
14 and gave a single band of apparent Mr=35,000 upon polyacrylamide gel
electrophoresis (PAGE) in the presence of sodium dodecyl sulfate (SDS).
Purification of acid phosphatase from human spleen. Spleen tissue was
used from a male aged 52 who was diagnosed as having hairy cell
leukemia. The weight of the spleen was 2.3kg. The normal control
spleen from an accident victim weighed 0.22kg. Tissue was cut into
slices, the outer fascia removed, and the slices diced into small cubes.
These were homogenized at 4°C in extraction buffer [0.05M Tris acetate,
pH 7.5, 2% (v/v) Nonidet P-40, 0.02% (w/v) sodium azide, ImM
phenylmethanesulfonyl fluoride (PMSF), ImM EDTA, and aprotinin (1
trypsin inhibitory unit/ml)] by means of a Teckmar Model SDT homogenizer
(half-full setting) with the largest probe until a homogeneous
preparation was obtained. A volume of 150ml of extraction buffer was
used for each lOOg of tissue. The homogenate was centrifuged (30,000xg;
20 minutes) and the supernatant fraction dialyzed overnight against
0.01M Tris-HCl buffer, pH 8.2. A slurry (50ml) of CM-cellulose was
added to the reteníate and stirred for 1 hour. This material was
collected on a Whatman No. 4 filter paper on a Buchner funnel. After it
was washed several times with 0.01M Tris-HCl buffer, pH 8.2, the CM-
cellulose was suspended in the same buffer and loaded into a glass
column. Proteins which had remained bound were eluted with 0.5M NaCl.
In initial experiments, the eluted material was dialyzed and loaded onto
a column of CM-cellulose (1 x 5cm) in 0.01M Tris-HCl buffer, pH 8.2.

27
Elution was performed by means of a gradient (180ml; 0.01-0.5M) of NaCl
at pH 8.2. Fractions which contained the enzyme were pooled, dialyzed,
and freeze-dried, and then subjected to gel filtration on a column (2.5
x 80cm) of Sephadex G-100 which was equilibrated with 0.01M sodium
acetate buffer, pH 4.9, containing 0.33M NaCl. Elution of the protein
was followed by its absorbance at 280nm and by measuring acid
phosphatase activity (see below). Fractions which contained the
phosphatase were pooled and loaded directly onto an anti-uteroferrin
immunoaffinity column (see below).
After the immunoaffinty column had been washed thoroughly with
loading buffer (0.01M Tris-HCl, pH 8.2, containing 0.3M NaCl), the bound
enzyme was eluted with 0.05M glycine-HCl buffer containing 0.15M NaCl,
pH 2.3. It was collected in 1ml fractions. Each fraction was
immediately neutralized with 0.1ml of 1M Tris-HCl, pH 8.2.
More recently, enzyme which had been eluted form the CM-cellulose
column with 0.5M NaCl was loaded directly onto the immunoaffinity column
without including intervening ion exchange and gel filtration steps.
Purification of acid phosphatase from human placenta. A normal term
placenta, weighing 630g was employed to purify the acid phosphatase by
exactly the same procedure described for human spleen. An alternative
method of enzyme purification was employed for a second normal term
placenta weighing 650g. The second placenta was homogenized in 1300ml
of a lysis buffer which consisted of 0.3M KC1, 2% (v/v) Nonidet P-40,
ImM PMSF and 0.2% (w/v) sodium azide. After centrifugation at 30,000xg
for 20 minutes at 4°C, protamine sulfate was added to the supernatant
fraction to 0.1% (w/v). The solution was stirred for 1 hour at 4°C,

28
then centrifuged at 30,000xg for 15 minutes. The resulting supernatant
fraction was dialyzed overnight against 0.01M Tris-HCl, pH 8.2. A
slurry of CM-cellulose (50ml) was added and the mixture stirred for 1
hour at 4°C. The bound proteins were eluted from the CM-cellulose as
described for uteroferrin. The entire pool of basic proteins was then
subjected to immunoaffinity chromatography as described for the human
spleen enzyme.
Purification of the bovine spleen acid phosphatase. The procedure
described for the human spleen enzyme was also employed for the bovine
spleen enzyme. Approximately 200g of beef spleen tissue were used.
Purification of the rat spleen phosphatase. The spleens of three
rats (approximately 2g) were homogenized as described for the human
enzyme. After centrifugation at 30,000xg, the supernatant fraction was
loaded directly onto the immunoaffinity column. Elution was performed
as described for the human enzyme.
Purification of the bovine uterine acid phosphatase. Bovine uterine
fluids were obtained from the ligated uterine horn of day 270
unilaterally pregnant cattle (Bartol, 1983). Approximately 400ml of
bovine uterine fluids were dialyzed overnight against 4 liters of 0.01M
Tris-HCl, pH 8.2. The solution was centrifuged (30,000xg; 20 minutes)
to remove particulate matter and passed through a column (lx 5cm) of
CM-cellulose equilibrated in the same buffer. After washing the column,
proteins which had bound were eluted with 0.5M NaCl in 0.01M Tris-HCl,
pH 8.2. These basic proteins were then subjected to gel filtration on a
column (2.5 x 80cm) of Sephadex G-100 which had been equilibrated with
0.01M acetate buffer, pH 4.9 containing 0.33M NaCl. Protein

29
concentration was monitored by absorbance at 280nm, and acid phosphatase
activity monitored by p-nitrophenylphosphatase activity (see below).
Measurement of p-nitrophenvlphosphatase activity. The standard
colorimetric assay utilized an appropriately diluted sample of enzyme,
20mM p-nitrophenylphosphate and 0.1M sodium acetate buffer (pH 4.9 for
uteroferrin, pH 5.3 for the human and rat enzymes, pH 6.0 for the beef
spleen enzyme and pH 4.5 for the bovine uterine enzyme) in a final
volume of 1ml. The enzymes were assayed in the presence of 0.1M
2-mercaptoethanol except where stated in the text. The reaction was
allowed to proceed at 37°C for 10 minutes and stopped by the addition
of 1ml of 1M NaOH. The absorbance was then read at 410nm. Activity is
expressed as units, where one unit is the release of l¿¿mol p-nitro-
phenol/minute.
Hydrolysis of other substrates. With the exception of phosvitin,
other substrates were assayed at a final concentration of 5mM. The
release of orthophosphate was measured spectrophotometrically by the
method of Bartlett (1959), which involves the reduction of
phosphomolybdate to a blue color (Emax=830nm). Blanks without enzyme
were run for each substrate. The release of orthophosphate from
phosvitin (10mg/ml) was measured as described by Roberts and Bazer
(1976).
pH optima. The pH optima of the acid phosphatases were determined
with the use of 0.1M sodium acetate, pH 3.0-5.4, 0.1M Tris acetate, pH
5.6-6.5, and 0.1M Tris-HCl, pH 7.0-7.5 as buffers. The substrate used
was p-nitrophenylphosphate.

30
Protein determination. Protein concentration was determined by the
method of Lowry et al. (1951) with crystalline bovine serum albumin as a
standard. In order to measure low amounts of protein (less than 10/¿g)
the method of Bradford (1976) was employed with lysozyme as a standard
(see Bio-Rad Bulletin 1069, February 1979).
Determination of iron. Iron was measured by the method of Cameron
(1965) as modified by Campbell and Zerner (1973). All glassware was
soaked in 4M HC1 and rinsed several times with iron-free water to remove
metal contaminants. Protein samples, blanks and ferrous ammonium
sulfate standards were treated with 70% (v/v) perchloric acid for 30
minutes at room temperature to release iron from the protein. A
solution of 10% (w/v) hydroxylamine hydrochloride was added, and the
samples were left at room temperature for 30 minutes. Finally, batho-
phenantroline solution (4mg/ml), pyridine, and iron free water were
added successively to each sample and the solutions mixed thoroughly.
The absorbance of the solutions was measured at 536nm. The
concentration of iron in the protein was obtained from a plot of
absorbance versus iron concentration of the standards, which was linear
over a range of 0-4 ng.
Immunoaffinitv chromatography. Sepharose CL-4B, purchased in its
cyanogen bromide activated form, was prepared according to the
instructions of the manufacturer. Protein was coupled to the matrix in
0.1M sodium carbonate, pH 8.5 and 0.5M NaCl at 4°C on a tube turner.
Alternatively, Sepharose 4B was activated for 30 minutes at 0°C in 1M
potassium phosphate, pH 12, using cyanogen bromide (Cuatrecacas et al.,
1968) dissolved in N', N' dimethyl formamide. The gel was washed with

31
0.1M sodium bicarbonate, pH 8.9. Proteins were coupled at 4°C overnight
on a tube turner in a buffer of 0.1M sodium bicarbonate, pH 8.9 and 0.5M
NaCl. Unreacted sites on the matrices were blocked with 1M
ethanolamine, pH 8.9 for 4 hours at 4°C, after washing out unbound
protein with the coupling buffer. Finally, the gel was washed with
0.05M sodium acetate, pH 4.0, plus 1M NaCl, followed by 0.05M sodium
borate, pH 8.9, plus 1M NaCl.
Uteroferrin (10mg/ml) purified as described above was coupled to the
matrix with a 30-50% coupling efficiency. When stored at 4°C in the
presence of 0.1% (w/v) sodium azide, it retained its purple coloration
and acid phosphatase activity for over a year. The uteroferrin-
Sepharose matrix was employed to purify anti-uteroferrin polyclonal
antibodies (see below). Anti-uteroferrin polyclonal antibodies were
then coupled to the matrix at a concentration of lOmg protein per ml of
gel. This anti-uteroferrin immunoaffinity matrix was employed to bind
the various spleen enzymes.
Preparation of polyclonal antibodies against uteroferrin. Samples
of uteroferrin (up to lOmg) were mixed with 5ml of Freund's Complete
Adjuvant to form an emulsion and injected intradermally over the
shoulder, rear leg and abdominal regions of one side of a female lamb.
Seven days later the procedure was repeated on the other side of the
lamb. A third injection was given seven days after the second. One
month after the first injection, serum was collected by jugular
venipuncture. The serum was allowed to clot at 4°C overnight.
Following centrifugation at lOOOxg for 20 minutes, the serum was frozen
in small aliquots.

32
Polyacrylamide pel electrophoresis. SDS-polyacrylamide gel
electrophoresis (SDS-PAGE) was carried out in 12.5% (w/v) gels according
to the method of Laemmli (1970). Protein samples were solubilized in 5%
(w/v) SDS, 5mM Tris-HCl, pH 6.8, and 5% (v/v) 2-mercaptoethanol. Gels
were stained with 0.125% (w/v) Coomassie Brilliant Blue.
Electrophoresis was carried out under non-denaturing conditions
according to the method of Reisfield et al. (1962) as modified by Basha
et al. (1979). Basic proteins were resuspended in 5mM Tris-HCl, pH 6.8
and 10% (v/v) glycerol. The samples were subjected to electrophoresis
in 7.5% (w/v) polyacrylamide gels, pH 4.0 (which did not contain SDS) in
a /3-alanine buffer, pH 4.5. Proteins with acid phosphatase activity
were visualized with oc-naphthylphosphate substrate and fast Garnet GBC
as the coupling dye.
Binding to Concanavalin A-Sepharose (Con A-Sepharose). Enzyme
samples in 0.3M NaCl were adjusted to pH 6.5 and loaded onto a column of
Con A-Sepharose (approximately 5ml bed volume). The column was washed
with 3 volumes of 0.1M Tris-HCl, pH 8.2, 0.3M NaCl, ImM CaCl2, ImM MnCl
and 0.02% (w/v) sodium azide. Bound protein was eluted with warm (50-
60°C) 0.01M oc-methyl-D-mannoside or 0.1M acetic acid (Baumbach et al.,
1984).
Immunization of mice. Female Balb/c mice at 8-48 weeks of age were
injected with 17.5/ug of antigen intraperitoneally (i.p.; Katzmann et
al., 1981) with antigen emulsified in 100//1 Freund's Complete Adjuvant.
A subsequent injection of 17.5 /ig was performed as above with Freund's
Incomplete Adjuvant, 10 days later. On day 17, a final injection was
administered in normal saline (0.9%, w/v) via the tail vein. The

33
antigens employed were as follows: For fusion 5, high molecular weight
uteroferrin was employed. This fusion was outlined in detail by
Baumbach (1984) and was carried out in collaboration with George
Baumbach. For fusion 6, uteroferrin (purple, Mr=35,000) was employed.
For fusion 13 the human hairy cell acid phosphatase was used.
Generation of monoclonal antibodies. The SP2/0-Ag 14 (SP2/0;
Schulman et al., 1978) non-secreting myeloma cell line was cultured in
Dulbecco's Modified Eagle's medium (DME) containing 10% (v/v) each of
heat inactivated fetal calf serum and agammaglobulinemic horse serum;
antibiotic solution (10/¿g/ml penicillin, 10/ig/ml streptomycin, 0.25jug/ml
amphotericin B), and 2mM glutamine. One day-old (conditioned) medium
from logarithmic cultures was harvested and used for hybridoma medium
supplementation.
The method of splenocyte fusion and propagation of the resulting
hybrid cells was by established methodologies (Kennet et al., 1980; Oi
and Herzenberg, 1980). Two mice were anaesthetized with ether and the
spleens excised aseptically, trimmed of fat and then minced with sterile
scalpel blades in 20ml of DME. The tissue was then triturated several
times and the large debris allowed to settle. The splenocytes in the
supernatant fluid were then collected by centrifugation at lOOOxg for 5
minutes at room temperature, washed in 15ml of DME, and resuspended in a
final volume of 5ml DME and kept at room temperature. Approximately 10®
SP2/0 cells were mixed and centrifuged at lOOOxg for 5 minutes. The
mixture of cells was resuspended in 1ml of 50% (w/v) polyethylene glycol
1000 in DME for 1 minute, then diluted to 31ml by the addition of 6ml
each minute for 5 minutes of DME-HAT (DME with hypoxanthine, O.lmM;

34
aminopterin, 0.8/iM; thymidine, 16/iM; Littlefield, 1964) supplemented
with 10% (v/v) each of fetal calf serum and heat-inactivated
agammaglobulinemic horse serum, 40% (v/v) conditioned medium and 2mM
glutamine. Aliquots (100/xl) were seeded into 96 well microtiter culture
dishes and incubated in an atmosphere of 5% CO2 at 37°C.
Two weeks later, the culture supernatant fluid was withdrawn and
assayed for specific binding to uteroferrin using a solid phase binding
assay (see below). Positive cultures were resuspended in 500/il of DME-
HAT supplemented as described above and placed in 48 well cluster
dishes. When a culture was confluent, the cells were transferred to
O
25cm'i culture flasks and maintained in the medium described for SP2/0
cells. When cultures were growing well, cell densities were counted
with a hemacytometer and the cells cloned by limiting dilution (Rennet
et al., 1980). The cells were diluted to yield an average of 5, 1 or 0.1
cells per 100/il. Thirty-two wells were seeded with each dilution, and
the initial cell density which subsequently had less than 33% of the
wells with growth was rescreened for antibody production. Hybridoma
cells were maintained as described for SP2/0 cells and were frozen in
the standard growth medium with 30% (v/v) fetal calf serum and 10% (v/v)
glycerol or 10% (v/v) dimethyl sulfoxide.
Purification of mouse antibodies. Immune sera from mice were
collected immediately prior to splenectomy by cutting the descending
aorta aspirating the blood into a hypodermic syringe. Nonimmune
(normal) mouse sera were collected from uninjected, healthy,
anaesthetized animals.

35
Culture medium from growing hybridoma cells was used as a source of
monoclonal antibody in some instances. In other cases ascites fluid was
prepared by growing cloned hybridoma cells (1 x 10^) in the peritoneal
cavity 5 days after 2 i.p. injections of 0.5ml pristane (2,6,10,14-
tetramethylpentadecane) spaced 10 days apart. The ascites fluid was
harvested after the tumor had grown sufficiently, about 10-14 days. The
sample was allowed to clot at 4°C, centrifuged at 1000xg for 20 minutes,
and sodium azide was added to 0.02% (w/v).
Iodination of antibodies. Iodination was performed according to the
method of Markwell and Fox (1978) and Markwell (Pierce Chemical Company
bulletin, 1978). Glass tubes were coated with 100/ig Iodogen (1,3,4,6-
tetrachloro-3oc-6oc-diphenylglycolluril) by evaporation of methylene
chloride. Mouse antibodies against uteroferrin or the human enzyme
(100/ig) in 1ml of buffer (0.02M sodium barbital, pH 7.5, 0.4M NaCl) were
added to the Iodogen coated tube. Carrier-free Na^^I (lOO^iCi) was
added and the tube shaken gently every minute for 15 minutes. The
iodinated protein was separated from unreacted ^~>I by dialysis (0.01M
Tris-HCl, pH 8.2) or gel filtration on a column of Sephadex G-50 (0.01M
Tris-HCl, pH 8.2, 0.2M NaCl).
Assay of antibodies. Antigen was dialyzed overnight against
phosphate-buffered saline (PBS; 0.14M NaCl, 1.5mM KH2PO4, 8mM Na2HPC>4,
3mM KC1, 0.5mM MgCl2, ImM CaCl2, pH 7.4) and adjusted to a concentration
of 50/ig/ml. Antigen was passively adsorbed overnight at 4°C to
polyvinylchloride microtiter flex plates as outlined by Tsu and
Herzenberg (1980). The plates were washed three times with PBS
containing 1% (w/v) bovine serum albumin (BSA) and 0.02% (w/v) sodium

36
azide. Hybridoma culture medium (0.05ml) or diluted mouse antisera were
added and allowed to bind for 1 hour at room temperature. The plates
IOC
were washed as above and 50,000cpm of -L*-JI-labeled anti-mouse IgG in
50ml were added and allowed to bind for 1 hour. The plates were washed
as above, the wells cut out and bound radioactivity measured in a gamma
counter. Immune and non-immune sera were replicate tested six times,
and culture media were tested in duplicate.
Affinities of antibodies. Monoclonal antibodies against uteroferrin
or the spleen enzyme were affinity purified from either cell growth
medium or from ascites fluid on uteroferrin immobilized on Sepharose 4B.
The procedure was identical to that described earlier. The purified
antibodies were serially diluted in PBS containing BSA (lmg/ml) over a
range of concentrations extending from 10'^ to lO'^M. Uteroferrin or
the spleen acid phosphatases were plated out into wells on flexvinyl
plates as described in the previous section. After the wells were
washed and the remaining adsorption sites were blocked with BSA, the
plates were dried. Appropriately diluted solutions of antibody (0.05ml)
were then added to the wells and after 1 hour they were withdrawn and
the plates were washed. The amount of antibody that bound at each
dilution was then measured by addition of a constant amount of a second
labeled antibody. This antibody was ^5j_labeled sheep anti-mouse IgG
(see below). Its specific activity was approximately 10^ cpm//ig. After
1 hour, this solution was withdrawn, the plates were washed and each
well was analyzed for radioactivity separately in a gamma counter. All
determinations were carried out in duplicate. Controls were described
in the previous section. The binding affinities of each monoclonal

37
antibody to the different antigens were calculated by the method of
Scatchard (1949).
Competitive binding of monoclonal antibodies. In order to determine
whether various monoclonal antibodies bound to the same or different
sites on uteroferrin, a competitive binding assay was employed.
Uteroferrin was adsorbed to the wells of flexvinyl plates as described
IOC
earlier. Monoclonal antibodies were iodinated with cJI to a specific
activity of approximately 10^ cpm/pg. Samples of antibody (0.05ml;
50,000cpm) were added to each well in presence of increasing
concentrations (10‘ -10‘^M) of the second unlabeled antibody. If this
second antibody failed to compete or competed poorly with the labeled
antibody for binding to uteroferrin, it was assumed to occupy a distinct
site on the protein. Three monoclonal antibodies (5.122.10, 6.21.2, and
6.22.1), which bound to uteroferrin with high affinity, appeared to
compete only poorly with each other in the above assay.
Results
Purification of Uteroferrin
Figure 2-lA shows the fractionation on Sephadex G-100 of the basic
proteins obtained from one sample (4 liters) of allantoic fluid obtained
from a day 67 pregnant pig. Three major protein fractions were apparent
and designated FUI, FIV and FV by previous convention (Murray et al.,
1972; Chen et al., 1973). The average molecular weights of these
fractions were calculated to be approximately 80,000, 35,000 and 15,000
respectively. Fraction V contained lysozyme (Roberts et al., 1976) and
a group of trypsin/plasmin inhibitors (Mullins et al., 1980; Fazleabas
et al., 1982) and will not be discussed further. Fraction IV, purple in

Fig. 2-1 Purification of uteroferrin from allantoic fluid of a day 67
pregnant pig. A, Sephadex G-100 chromatography. Allantoic fluid (approximately
4L) from a day 67 pregnant pig was dialyzed and then stirred with CM-cellulose
at pH 8.2. Basic proteins were eluted with 0.5M NaCl, and then loaded onto a
5 x 90cm column of Sephadex G-100. Protein was monitored by absorbance at
280nm (A280) . The peaks are labeled FUI, FIV and FV as explained in the text.
B, CM-cellulose ion exchange chromatography. Fill proteins obtained by
Sephadex G-100 chromatography (in A) were dialyzed and applied to a 1.5 x 10cm
column of CM-cellulose. Elution was performed with a 250ml gradient (0.01-
0.5M) of NaCl. Protein was monitored by absorbance at 280nm (A280) and purple
coloration by absorbance at 545nm (A545). Uteroferrin eluted as a single peak
between 0.20 and 0.25M NaCl.

A
FRACTION
A 280 <•>
B

40
color, contained uteroferrin. When FIV was pooled, dialyzed, loaded
onto a column of CM-cellulose, and eluted with a linear sodium chloride
gradient, uteroferrin eluted as a single symmetrical peak (Fig. 2-1B).
Samples with an A280/A545 ratio of less than 14.0 were pooled and
considered to be pure uteroferrin (Buhi, 1982). In this typical
preparation of uteroferrin from allantoic fluid, about 135mg of pure
uteroferrin were obtained, which is considered to be an average yield
(Roberts and Bazer, 1980). Fraction III had an obvious pink color and
was demonstrated to be a high molecular weight form of uteroferrin,
consisting of uteroferrin non-covalently associated with a second
protein whose function is unknown (Baumbach et al., 1986). The yield of
the high molecular weight uteroferrin, pooled immediately after the gel
filtration step, was 47mg. The amount of Fill obtained varies greatly
between animals, with uterine secretions from early pregnancy or
pseudopregnancy containing more Fill than those from late pregnancy or
pseudopregnancy (Baumbach et al., 1986). The specific activities of
uteroferrin and high molecular weight uteroferrin from this preparation
were shown to be approximately 230 units/mg protein and 106 units/mg
protein, respectively. The total recoverable acid phosphatase activity
from the allantoic fluid of this day 67 pregnant pig was greater than
3.6 x 10^ units.
Purification of the Human Type 5 Acid Phosphatase from Hairy Cell Spleen
Levels of acid phosphatase in spleens from a patient with hairy cell
leukemia and from a normal individual are presented in Table 2-1. Note
that the spleen of the patient with hairy cell leukemia was greatly
enlarged. In addition, the specific activity of the extract from the

41
TABLE 2-1
phosphatase activity
in spleen homoeenates from a patient with hairy
cell
leukemia
and from an individual with a normal spleen
Weight
of
Addition to
Patient
Spleen
Phosphatase Assay
Specific Activity
kg
units/mg protein
1
2.3
None
0.453
0.01M NaK tartrate
0.483
0.1M 2-mercaptoethanol
0.662
None
0.011
2
0.22
0.01M NaK tartrate
0.007
0.1M 2-mercaptoethanol
0.012
Results from spleen 1 (weight 2.3kg) were obtained from 30,000xg
supernatant fraction of a slice (250g) of tissue that had been frozen
(-80°C) for 2 weeks prior to assay. Results from spleen 2 were obtained
from the 30,000xg supernatant fraction from freshly homogenized tissue
of the entire organ which weighed 0.22kg. NaK tartrate is Rochelle's
salt and corresponds with the L-(+)-form of tartrate.

42
large hairy cell spleen was about 40-fold higher than that from the
normal spleen. Moreover, the acid phosphatase activity from this spleen
was unaffected by the addition of lOmM tartrate but was stimulated by
the presence of 0.1M 2-mecaptoethanol. By contrast, tartrate caused
almost a 40% inhibition of the total acid phosphatase activity in the
extract of normal spleen, and there was only a slight activation with
2-mercaptoethanol.
Two procedures have been employed for purification of the tartrate-
resistant acid phosphatase in the extract from the hairy cell spleen.
The first is illustrated in Fig. 2-2 and employed a gradient salt
elution from a column of CM-cellulose (Fig.2-2A), gel filtration on
Sephadex G-100 (Fig. 2-2B) and, as a final step, immunoaffinity
chromatography (Fig. 2-2C). The acid phosphatase, which is very basic,
was eluted from CM-cellulose at a salt concentration of 0.25M. Upon gel
filtration the enzyme emerged as a peak of apparent Mr=34,000, about one
fraction behind the elution position of highly purified uteroferrin.
The fractions containing the enzyme were pooled and loaded directly onto
an immunoaffinity column consisting of anti-uteroferrin antibodies
covalently linked to Sepharose 4B. All of the phosphatase activity
bound and could be quantitatively eluted using low pH buffer.
In the second procedure, the dialyzed extract of the spleen was
applied batchwise to CM-cellulose at pH 8.2 and the acid phosphatase
activity was eluted with 0.5M NaCl. Rather than subjecting the enzyme
which had bound to further CM-cellulose ion exchange chromatography and
gel filtration, the preparation was loaded directly onto the anti-
uteroferrin immunoaffinity column. This abbreviated procedure provided

Fig. 2-2 Purification of human spleen phosphatase. A, CM-cellulose ion
exchange chromatography. Post mitochondrial supernatant fraction was dialyzed
and then stirred with CM-cellulose at pH 8.2. The enzyme was eluted with 0.5M
NaCl; the resulting eluate was dialyzed and then reapplied to a 1.5 x 10cm
column of CM-cellulose. Elution was performed with a 250ml gradient
(0.01-0.5 M) of NaCl. Acid phosphatase activity eluted between 0.25 and 0.35M
NaCl. Units of enzyme (• ) are here represented by absorption values at 410nm
obtained by incubation of 2.5 ,ul samples in 1ml of 0.1M acetate buffer, pH 5.3,
containing 20mM p-nitrophenylphosphate at 37°C for 10 minutes. Protein (0) was
monitored by absorbance at 280nm (A280)• B, Sephadex G-100 chromatography.
Enzyme, partially purified by CM-cellulose ion exchange chromatography, was
loaded onto a 1.5 x 80cm column of Sephadex G-100. Enzyme and protein were
assayed as in A. C, immunoaffinity chromatography. Enzyme from the Sephadex
column was loaded onto the anti-uteroferrin antibody affinity column. The
phosphatase was eluted with glycine buffer, pH 2.3. The beginning of the
elution is indicated by an arrowhead. Enzyme and protein were assayed as in A.

A 280
O o O o
—» ISJ uu •*'
UNITS OF ENZYME(•)
A 280
A 280

45
a greater than 500-fold purification from the extract of the hairy cell
spleen within 24 hours (Table 2-2). The final specific activities have
varied between about 100 and 500 units/mg of protein.
Major losses of activity occurred whichever procedure was employed.
Collection of the enzyme on CM-cellulose was particularly inefficient.
However, if this step was repeated several more times (results not
shown) the percent of recovery of enzyme from the original extract could
be increased to over 40%. The phosphatase activity in the 30,000xg
supernatant fraction from the spleen extract was relatively unstable.
Storage at 4°C led to a complete loss of activity within 48 hours.
Samples kept at -20°C lost over 60% of their activity in 20 days. The
purified enzyme, on the other hand, appeared to relatively more stable
when frozen at -20°C, and samples have been stored successfully for up
to 2 months with retention of most of their original activity.
When the immunoaffinity-purified enzyme was analyzed by SDS-PAGE it
gave a major protein band of apparent Mr=34,000 and two minor bands of
about Mr=20,000 and 14,000 (Fig. 2-3). The relative amounts of the
higher molecular weight species and the two lower molecular weight bands
varied between preparations from the same spleen (results not shown).
The purified enzyme was also examined by electrophoresis under
nondenaturing conditions (Fig. 2-4). The gels were then "stained" for
acid phosphatase activity. The hairy cell enzyme (lane 3) gave two
bands of activity, a minor fast migrating species and a dominant slower
band. Uteroferrin also gave 2 bands, but the slower migrating band in
this case was scarcely visible (lane 2). A commercial standard for

46
TABLE 2-2
Purification of tartrate-resistant acid phosphatase from
spleen of a patient with hairy cell leukemia
Purification
Step
Total
Protein
Total
Activity
Recovery
Specific
Activitv
Fold
Purification
mg
units
%
units/mg
X
30,OOOxg
5,060
3,230
100
0.64
CM-cellulose
3.4
674
20.9
198
309
Affinitv column 0.41
145
4.2
358
560
A 212g piece of a 2.4kg spleen was homogenized in lysis buffer. The
homogenate was centrifuged at 30,000xg and the enzyme was purified from
the supernatant fraction. Activities represent enzyme activated with
0.1M 2-mercaptoethanol at pH 5.3 for 10 minutes.

47
Fig. 2-3 SDS-polyacrylamide gel electrophoresis of purified
uteroferrin and hairy cell phosphatase. The scale on the left is
molecular weight x 10"^. Lane 1, molecular weight standards; lane 2,
purified uteroferrin; lane 3, hairy cell phosphatase following
immunoaffinity chromatography. The gel was 10% (w/v) polyacrylamide; it
was stained with Coomassie Blue. Note that the hairy cell enzyme gave
major bands at 34,000, 20,000 and 14,000.

48
1 2 3
Fig. 2-4 Polyacrylamide gel electrophoresis of acid phosphatases at pH
5.4 in /3-alanine buffer. Gels were stained with phosphatase substrate,
oc-naphthylphospbate, and hydrolysis product coupled with Fast Garnet GBC
salt. Lane 1, Type 5 isozyme electrophoretic standard from Calbiochem-
Behring; lane 2, uteroferrin; lane 3, hairy cell enzyme immunoaffinity
purified from spleen. Note that a standard isozyme 5, uteroferrin, and
the hairy cell phosphatase gave similar, but not identical,
electrophoretic patterns. Migration (towards the cathode) was from the
top to bottom.

49
human isozyme 5 is shown in lane 1. Its pattern resembled that of
uteroferrin.
Purification of the Type 5 Isozyme from Normal Human Spleen
An isozyme with a high cathodal mobility has been detected in
extracts of normal spleen by others (Lam et al., 1973). In addition,
the extract of spleen described in Table 2-1 contained significant
amounts of a tartrate-resistant acid phosphatase activity. Therefore an
attempt was made to isolate the enzyme from the total extract of a
normal spleen by means of procedure 2. Approximately 16 units of enzyme
activity bound to CM-cellulose at pH 8.2. This represented less than 5%
of the total acid phosphatase activity in the extract. A total of 6
units were recovered from the immunoaffinity column. This final
preparation was insensitive to L-(+)-tartrate and was activatable by 2-
mercaptoethanol. Upon electrophoresis in nondenaturing gels it gave two
cathodally migrating bands of activity. These were identical to the
bands of activity seen with the hairy cell enzyme (results not shown).
The results confirm that the Type 5 phosphatase is present as a minor
component of spleens of normal individuals.
Purification of the Type 5 Phosphatase from Human Placenta
Because of the difficulty in obtaining human spleens, it was
necessary to determine whether other tissues could be used as a source
of the human tartrate-resistant acid phosphatase. Human placenta can be
obtained fresh, in large quantities, at any time. Therefore, this
tissue was tested for the presence of the enzyme. Two placentas were
studied, and a slightly different purification protocol was used for
each one. A tartrate-resistant acid phosphatase was purified from each

50
placenta. Figure 2-5 shows that the placenta enzyme, like the spleen
enzyme, has an apparent Mr of 34,000. Interestingly, the two minor
bands found associated with the placenta enzyme are of different
apparent Mr values than those associated with the spleen enzyme. Human
placenta can contain about as much Type 5 phosphatase as normal human
spleen (Table 2-3) when measured per gram of tissue. Note that human
hairy cell spleen contains at least 20-fold more Type 5 isozyme per gram
of tissue than the other sources of the human enzyme.
Purification of the Bovine Spleen. Bovine Uterine and Rat Spleen
Phosphatases
Table 2-3 also shows the yields of the purple, iron-containing
phosphatases from other sources. Davis et al. (1981) claim that they
can purify up to 2mg of purple phosphatase per 2kg of beef spleen, but
that the yield varied greatly between animals. The yields obtained in
this study were consistently lower than 0.5mg/kg (data not shown). The
yield of the bovine uterine enzyme was considerably less than that of
the porcine enzyme on a per animal basis (Table 2-3). The yield of the
rat spleen enzyme was quite high (Table 2-3) and comparable to that of
Hara et al. (1984).
pH Optima of the Type 5 Phosphatases
The pH optima for the various Type 5 phosphatases are listed in
Table 2-4. The values range from pH 4.2 for the bovine uterine enzyme
to pH 6.0 for the bovine spleen enzyme.
Glycoprotein Nature of the Type 5 Phosphatases
Porcine uteroferrin is known to contain a single high-mannose
oligosaccharide chain (Saunders et al., 1985). The rat spleen enzyme
(Hara et al., 1984), and the bovine spleen enzyme (Davis et al., 1984)

51
1
2
3
4
Fig. 2-5 SDS polyacrylamide gel electrophoresis of uteroferrin, the
phosphatase from human spleen and the phosphatase from placenta. The
molecular weight standards are shown in lane 1. Note that the spleen
enzyme (lane 2) gave major bands at 34,000, 20,000 and 15,000, while the
placenta (lane 4) gave major bands at 34,000, 16,000 and 13,000.
Uteroferrin (lane 3) has an apparent Mr of 35,000. Approximately 20yug
of protein were present in each lane. Gels were stained with Coomassie
blue. The gel was composed of 12.5% (w/v) polyacrylamide. The scale on
the left is molecular weight x 10^.

52
TABLE 2-3
Levels of tartrate-resistant acid phosphatase
acitivitv in various tissues
Source of Enzvme
Units of Enzyme
Activity
Units of Enzyme Activity
per 1002 Tissue
Human
placenta 1 (630g)
19
3.0
Human
placenta 2 (650g)
7
1.1
Normal human
spleen (220g)
6
2.7
Hairy cell spleen
(212g)a
145
68.3
Beef spleen (200g)a
4.5
4.5
Rat spleen (2g)^
0.74
37
Bovine uterine fluids
(400ml)c
224
-
Porcine allantoic
fluids (4L)C
36,400
Approximately one-tenth the total tissue mass
^Obtained from three animals
cObtained from one animal
Purified enzymes were incubated with 0.1M 2-mercaptoethanol and
assayed at their pH optima with 20mM p-nitrophenylphosphate. One unit
of enzyme hydrolyzes the release of 1/rnio 1 of p-nitrophenol per minute.

53
TABLE 2-4
pH optima for the tartrate-resistant acid phosphatases
Enzvme
dH Optimum
Porcine uteroferrin
4.9
Human hairy cell enzyme
5.3
Bovine spleen enzyme
6.0
Bovine uterine enzyme
4.2
Rat spleen enzymea
5.0-5.8
a Hara et al., 1984
Enzymes were assayed with 0.1M sodium acetate, pH 3.0-5.4, 0.1M
Tris acetate, pH 5.6-6.5, 0.1M Tris-HCl, pH 7.0-7.5, buffers in the
presence of 0.1M 2-meracaptoethanol with 20mM p-nitrophenylphosphate
substrate.
as

54
were demonstrated to be glycoproteins. In this study it was
demonstrated that the human spleen and placenta enzymes bind avidly to
Con A-Sepharose. The enzymes could be eluted with lOmM oc-methyl-
mannoside at 50-60°C or with 0.1M acetic acid. These results indicate
that the human Type 5 phosphatase, along with the purple, iron-contain¬
ing phosphatases, contain high mannose or hybrid-type oligosaccharide
chains.
Iron Content of the Type 5 Phosphatases
It has been demonstrated that the bovine spleen enzyme (Davis et
al., 1981) and rat spleen enzyme (Hara et al., 1984) contain two atoms
of iron per molecule of protein. However, Buhi et al. (1982b)
consistently demonstrated that certain preparations of uteroferrin bound
about 1 mol Fe/mol protein. Table 2-5 compares the iron contents of
pink, high molecular weight uteroferrin, purple uteroferrin, the bovine
uterine enzyme, the rat spleen enzyme, the bovine spleen enzyme and the
human spleen enzyme. While pink, high molecular weight uteroferrin
contains two atoms of iron per molecule of uteroferrin, purple
uteroferrin preparations contain considerably less iron. Triplicate
determinations on a single purified sample of the human enzyme revealed
that it contained 2.2 + 0.4 atoms of iron/molecule of protein.
Activation by Reducing Agents
Reports on the effect of reducing agents such as ascorbate and
2-mercaptoethanol on the activities of the Type 5 isozyme of human
spleen have been at variance (Lam et at., 1977; Robinson and Glew,
1980). The degree of activation has been unpredictable throughout the
course of this study. With partially purified enzyme

55
TABLE 2-5
The Iron content of the tartrate-resistant acid phosphatases
Source of Enzvme
mmol Fe/mmol Protein
d65 allantoic fluid,
purple porcine Uf
1.2a
d65 allantoic fluid,
pink Mr=80,000 Uf
2.0a
dllO pseudopregnant fluid,
purple porcine Uf
1.5a
dllO pseudopregnant fluid,
pink Mr=80,000 Uf
2.3a
Human hairy cell spleen
2.2
Bovine spleen
2. lb
Bovine uterine fluid
1.4
Rat spleen
1.9-2.0C
aBaumbach et al., 1986
^Davis et al., 1981; Campbell et al., 1978
cHara et al., 1984
The iron content was determined by the method of Cameron (1985)
modified by Campbell and Zerner (1973). Approximately 50-100/ig of
protein were used.
as

56
(post-CM-cellulose) a 2-3-fold activation was usually observed when
enzyme was incubated with 0.1M 2-mercaptoethanol for 10 minutes at
pH 5.3 before being assayed for activity. The degree of activation of
crude enzyme (Table 2-2) was usually less than two-fold. However, some
preparations of affinity-purified enzyme have shown negligible activity
in the absence of reducing agent while other, more inherently active
preparations were only stimulated about two-fold. The results with one
purified preparation are summarized in Table 2-6. The extent of
activation was clearly dependent upon the concentration of
mercaptoethanol. Results with ascorbic acid (not shown) were similar.
Activation by mercaptoethanol leads to an increase in V rather than
a change in Km for both the human spleen enzyme and uteroferrin (Fig. 2-
6A). Note that the Km values for both enzymes at their pH optima (pH
5.3 and 4.9, respectively) are similar. Values for Km between 0.75 and
3 mM have been reported for the spleen enzyme. V is also variable, the
more active preparations giving values greater than 500 units/mg protein
when pretreated with 2-mercaptoethanol.
Interestingly, pink, high molecular weight uteroferrin does not
require pretreatment with 2-mercaptoethanol in order to exhibit maximal
activity (data not shown).
Effects of Inhibitors on Phosphate Activity
The effects of a range of inhibitors on the human spleen enzyme and
uteroferrin are very similar (Table 2-7). Both enzymes are completely
inhibited by 0.1M dithionite, a reagent which is known to cause release
of Fe from uteroferrin (Schlosnagle et al., 1976). Hydrogen peroxide
and agents which interact with -SH groups also inhibit. The chelators

57
TABLE 2-6
Activation of purified human hairy cell phosphatase by 2-mercaptoethanol
2-Mercaptoethanol
Concentration
Activity
M
% control
0
100
0.01
240
0.05
300
0.10
360
0.25
440
Enzyme was incubated with 2-mercaptoethanol for 20 minutes at pH 5.3
in 0.1M sodium acetate buffer prior to assay.

58
TABLE 2-7
Action of various potential inhibitors on the hairy cell acid
phosphatase, uteroferrin. bovine spleen and
bovine uterine acid phosphatases
Compound Concentration
Acid Phosphatase
Human Porcine Bovine Bovine
Hairy Cell Uteroferrin Spleen Uterine
% control
Na dithionite
10"1 M
0
0
12
9
h2o2
0.01%(v/v)
75
73
37
67
Na iodacetate
io -3m
72
85
NDa
ND
Na iodoacetamide
io*3m
70
78
60
73
p-mercuribenzoate
1
O
T—1
42
57
ND
50
FeCl2
10'5M
45
58
ND
ND
NaEDTA
10‘3M
100
100
66
52
bipyridine
10‘3M
100
100
ND
ND
o-phenanthroline
10'3M
ND
100
60
52
NaK tartrate
10‘2
100
100
95
100
NaK tartrate
10’3M
100
100
ND
ND
Na phosphate
5x10‘3M
5
5
ND
ND
Na phosphate
io*3m
40
37
43
28
Na phosphate
1
o
73
71
ND
ND
Na arsenate
10 ‘3M
18
8
ND
ND
Na arsenate
5x10*4M
36
19
ND
ND
Na arsenate
5x10'5M
83
74
67
29
Na molybdate
10 *4m
8
0
ND
ND
Na molybdate
10‘5M
4
12
ND
ND
Na molybdate
5x10'7M
38
63
76
41
Na fluoride
10'3M
60
67
53
ND
Na fluoride
5xl0'4
80
78
ND
ND
a ND, not determined
The enzymes were assayed in triplicate with p-nitrophenylphosphate as
substrate (concentration 20mM). The enzymes were assayed at their pH
optima (see Table 2-4). All activities are presented as per cent of a
control assay performed simultaneously with no added inhibitor.

59
EDTA and bipyridine have no effect. Tartrate does not inhibit either
phosphatase. Inhibition is observed with phosphate, arsenate,
molybdate, and fluoride, however. Molybdate is the most effective,
inhibiting strongly even at concentrations below 10'^M; it appears to
inhibit both enzymes in a noncompetitive manner (Fig. 2-6B).
Arsenate and phosphate are competitive inhibitors (Fig. 2-6C).
Inhibition with 10'JM fluoride (results not shown) is complex, and
curvilinear Lineweaver-Burk plots are observed.
The effects of these inhibitors on pink, high molecular weight
uteroferrin (data not shown) and the bovine uterine and spleen enzymes
were quite similar to the results obtained for uteroferrin (Table 2-7).
Substrate Specificity for Phosphatase Activity
The substrate specificities of the human spleen enzyme and
uteroferrin are quite similar (Table 2-8). p-Nitrophenylphosphate was
the best substrate tested, but oc-naphthylphosphate, pyrophosphate, and
nucleotide tri- and di-phosphates are also hydrolyzed. Both enzymes
hydrolyze ADP more effectively than ATP, whereas AMP is a poor
substrate. Hexose phosphates are only very slowly hydrolyzed, if at
all.
Both enzymes are phosphoprotein phosphatases and can release
orthophosphate from the egg yolk protein phosvitin. The human spleen
enzyme (1/ig) had the ability to release 2.lnmol of orthophosphate from
phosphvitin (10mg/ml) per minute at 37°C. The value for uteroferrin
assayed identically was 1.5nmol of orthophosphate released per minute.
The substrate specificities of pink, high molecular weight
uteroferrin (data not shown) and the bovine emzymes (Table 2-8) were

Fig. 2-6 Lineweaver-Burk plots of uteroferrin and hairy cell phosphatase
activities in the presence of 2-mercaptoethanol and various inhibitors. A,
activation of enzyme by 2-mercaptoethanol. In this experiment enzymes were
activated with 0.1M 2-mercaptoethanol at pH 7.0 (uteroferrin) or 5.3 (hairy
cell enzyme) for 10 min. Uteroferrin or hairy cell enzymes (0.15 xg) were
assayed over a range of p-nitrophenylphosphate concentrations with the use of
the standard assays with (0) and without (•) activation. B, effect of
molybdate on acid phosphatase activity. Enzymes activated with 2-mercap-
toethanol, were assayed as in A, either in the presence (•) or absence (0) of
10‘sodium molybdate. C, effect of arsenate and phosphate on acid
phosphatase activity. Enzymes activated with 2-mercaptoethanol, were assayed
as in A, except the amount of uteroferrin was less (0.05 Ag/assay). Assays
were carried out in the presence of either 5 x 10‘^M phosphate (A) or 5 x 10*^M
arsenate (•) or without inhibitors (0). Each point represents the average of
three replicates. In A, B, and C assays with the hairy cell enzyme were
carried out with purified enzyme that had been stored at -20°C for 3 weeks and
which had lost about 50% of its initial activity. Upper panels represent
results obtained with uteroferrin, lower panels with hairy cell phosphatase.

o mercaptoetHanoi
• control
• molybdate
a phosphate
• arsenate

62
TABLE 2-8
Comparison of substrate specificities of hairy cell phosphatase.
uteroferrin. bovine spleen and bovine uterine phosphatases
Substrate
Human Hairy
Cell
Acid Phosphatase
Porcine Bovine
Uteroferrin Soleen
Bovine
Uterine
% control
p-nitrophenylphosphate
100
100
100
100
oc-naphthylphosphate
71
26
23
84
sodium pyrophosphate
24
52
7
45
ATP
49
36
20
3
ADP
92
81
18
87
AMP
4
2
3
10
D-glucose 6-phosphate
3
0
D-mannose 6-phosphate
0
3
D-fructose 6-phosphate
4
0
All compounds were
assayed at a concentration of
4mM at
the pH
optima of the enzymes.

63
generally similar to the results obtained with uteroferrin. However,
the bovine uterine enzyme did not hydrolyze ATP well, and the bovine
spleen enzyme was virtually inactive against pyrophosphate. The fact
that each bovine enzyme was tested at its pH optimum (pH 6.0 for the
spleen enzyme and pH 4.2 for the uterine enzyme) rather than at the same
pH, may have influenced the results.
Immunological Cross-reactivity
The human spleen enzyme clearly shows at least some immunological
cross-reactivity with uteroferrin since it bound to anti-uteroferrin
immunoglobulins immobilized on Sepharose (Fig. 2-2C). The extent of
this cross-reactivity has been measured in a solid phase immunobinding
assay which employed whole antiserum from mice, which had been immunized
with either spleen enzyme (Fig. 2-7A) or uteroferrin (Fig. 2-7B). The
antiserum to the spleen enzyme clearly bound to uteroferrin but binding
was reduced by 50% when the antiserum was diluted 1:80. No binding
could be detected below a 320-fold dilution. The titer towards the
spleen enzyme was clearly much higher, with half-maximal binding
occurring at an antiserum dilution of 1:1280.
When whole mouse antiserum raised against uteroferrin was employed,
little antibody binding to the spleen enzyme was detectable at an
antiserum dilution below 1:320. By contrast, binding to uteroferrin
remained high down to an antibody dilution of 1:10,240. Therefore, the
two proteins show only partial immunological cross-reactivity.
The Production of Monoclonal Antibodies Against Porcine Uteroferrin
The mice for fusion 5 were injected with high molecular weight pink
uteroferrin. The results of this fusion, which was done in

Fig. 2-7 Solid phase radiobinding assay of whole mouse antiserum
from mice immunized with human spleen phosphatase (upper panel) or
uteroferrin (lower panel). Antibody was diluted serially and
tested for binding to either uteroferrin (•), human spleen
phosphatase (O) , or bovine serum albumin (A.). Binding was
measured by means of affinity purified ^^I-sheep anti-mouse IgG.

40
25
10
100
80
60
40
65
• ute roferr in
ospleen phosphatase
a bovine serum albumin

66
collaboration with George Baumbach, are outlined in detail in Baumbach
(1984).
The mice for fusion 6 were injected with pure uteroferrin. Upon
initial screening with uteroferrin as the antigen, 26 out of the 199
colonies screened were identified as positive. After each of these
positive colonies was cloned by the limiting dilution method, 11 of the
original colonies contained positive clones.
Three clones from fusion 5 and three from fusion 6 were chosen for
further studies. These hybridomas, 5.58.1, 5.122.10, 5.127.3, 6.21.2,
6.22.1 and 6.37.4, were used to produce large quantities of antibody in
mouse ascites fluid or culture media.
These antibodies were tested for binding to uteroferrin and pink,
high molecular weight uteroferrin. All of the antibodies bound with
high affinity to pink, high molecular weight uteroferrin. Only one
antibody, 5.58.1, did not bind to uteroferrin. It appeared that 5.58.1
recognized the second, antigenically unrelated protein in Fill. This
antibody will not be discussed further.
In order to determine which of these antibodies recognized the same
epitope on the uteroferrin molecule (i.e., would compete with one
another for binding to uteroferrin) and which recognized different
epitopes (did not compete with one another for binding to porcine
uteroferrin), competitive radiobinding assays were carried out.
Each of the five monoclonal antibodies was iodinated to a specific
activity of approximately 10^ cpm/^g. Each iodinated monoclonal
antibody was tested in a competitive binding assay with the same,
unlabeled antibody. This was done to ensure that the binding abilities

67
of antibodies were not destroyed by iodination. Each labeled antibody
was then tested with each remaining unlabeled antibody. The results of
several of the competitive binding assays are shown in Fig. 2-8.
Antibodies 5.122.10, 5.127.3 and 6.37.4 compete with one another for
binding to porcine uteroferrin, even at very low concentrations of
unlabelled antibody. Thus, these three monoclonal antibodies presumably
interact with the same site on the uteroferrin molecule. Monoclonal
antibodies 6.21.2 and 6.22.1 do not compete with each other, nor do they
compete with 5.122.10, for binding to porcine uteroferrin. Each of
these antibodies presumably recognizes a different site on the
uteroferrin molecule.
The Production of Monoclonal Antibodies Against the Hairy Cell Spleen
Enzyme
Hybridoma colonies derived from a mouse which had been immunized
with the human spleen enzyme were screened for the production of
antibodies which were able to bind both the spleen enzyme and to
uteroferrin. From 200 wells containing live cells, 44 positive colonies
were selected. When these positive colonies were rescreened, 29
remained positive. Only two of these colonies, 13.15 and 13.122,
produced antibodies which bound as well or better to uteroferrin than to
the human spleen enzyme. The dissociation constants for the binding of
antibody 13.15 to the human enzyme and uteroferrin, respectively, were
22 and 16nM. The dissociation constants for the binding of antibody
13.122 to the human enzyme and uteroferrin, respectively, were 40 and
12nM. These two antibodies did not compete with one another for binding
the porcine uteroferrin.

Fig. 2-8 Competitive binding of anti-uteroferrin monoclonal antibodies to
uteroferrin adsorbed to flexvinyl microtiter wells. Uteroferrin (50 /^g/ml;
0.05ml) was absorbed to the wells of flexvinyl plates. A sample of antibody
5.122.10 or 5.127.3 which had been iodinated to a specific activity of 10^
cpm/ ¿eg was added to each well (0.05ml; 50,000 cpm). Samples of unlabeled
antibodies were then added over a range of dilutions. The amount of which
bound to the adsorbed uteroferrin was then measured. Results show that A,
unlabeled 5.122.10 and 5.127.3 displaced the binding of radiolabeled 5.122.10;
B, unlabeled 5.122.10 and 5.127.3 displaced the binding of radiolabeled
5.127.3; and C, 6.21.2 failed to compete with 5.122.10 for binding to
uteroferrin.

I BOUND(x103cpm)
C
A
o oos o.io o oos o 10
UNLABELED ANTIBODY ADDED (og)
vO

70
The Binding of the Monoclonal Antibodies to Other Tartrate-resistant
Acid Phosphatases
In Fig. 2-9 the three monoclonal antibodies raised against porcine
uteroferrin have been compared on the basis of their binding to
uteroferrin, the human enzyme, and the purple, iron-containing rat
spleen and bovine spleen acid phosphatases. All three antibodies bound
to uteroferrin with very high affinity (Fig. 2-9 and Table 2-9) but
bound relatively weakly to the beef spleen and human enzymes. The rat
enzyme had an intermediate affinity (Kj)=33nM) for antibody 6.21.2 and a
relatively high affinity (8nM) for antibody 6.22.1. The binding of the
anti-uteroferrin antibodies were also tested for binding to pink, high
molecular weight uteroferrin and the bovine uterine enzyme. There is no
difference in the binding of these monoclonal antibodies to uteroferrin
and pink, high molecular weight uteroferrin (data not shown). The
bovine uterine enzyme had a high affinity for antibody 5.122.10 (13nM)
and low affinities for the remaining monoclonal antibodies. The bovine
uterine enzyme clearly differs from the bovine spleen enzyme in its
affinity for antibody 5.122.10 (13nM versus 120nM). Thus, the five
phosphatases showed some immunological crossreactivities when tested in
this manner, but the epitopes recognized by any one of the antibodies
were clearly not identical.
Antibody 13.122, raised against the human spleen enzyme, was tested
for its binding to the five phosphatases. Figure 2-9 and Table 2-9 show
that this antibody had a slightly lower affinity towards the human
enzyme (the antigen against which it had been raised) than towards
uteroferrin or the rat spleen enzyme. The antibody bound as well to the
bovine uterine enzyme as it did to the human enzyme, and bound most

Fig. 2-9 Binding of four monoclonal antibodies to uteroferrin and to the
immunoaffinity purified phosphatases from human, bovine, and rat spleens. The
enzymes (50 g/ml; 0.05ml) were allowed to adsorb to the wells of flexvinyl
plates. Purified 5.121.10, 6.21.2, 6.22.1, which had been raised against
uteroferrin, and 13.122, which had been raised against human spleen enzyme were
diluted over a range of concentrations from about 10to 10 "^M and added to
the wells. Binding in this experiment was assessed by means of ^¡>1-labeled
sheep anti-mouse IgG as described under "Materials and Methods." The graphs
show the amount of antibody bound plotted against antibody concentration for
the four enzymes. Uteroferrin, •; human spleen phosphatase A ; bovine spleen
phosphatase 0; rat spleen phosphatase & . The antibody used in each series of
experiments (5.122.10, 6.21.2, 6.22.1, and 13.122) is shown on each graph.

Antibody bound Cpg x 10*)
ZL

73
TABLE 2-9
Dissociation constants (Kp values) for binding of monoclonal antibodies
to uteroferrin. the human spleen enzyme, the rat spleen enzyme.
the bovine spleen and uterine enzymes
Antigen
Monoclonal Antibody
5.122.10
6.21.2
6.22.2
13.122
kd.
nM
Uteroferrin
o
1—1
1.2
2.7
12
Enzyme from hairy cell spleen
145
600
270
40
Enzyme from rat spleen
33
8
13
Enzyme from beef spleen
120
130
125
80
Enzvme from cow uterus
13
117
75
40
Monoclonal antibodies 5.122.10, 6.21.2 and 6.22.1 were produced by
hybridoma clones which orginated from a mouse immunized with
uteroferrin. They were selected by their ability to bind uteroferrin
with high affinity in a solid phase radiobinding assay. Monoclonal
antibody 13.122 was produced by a hybridoma clone which originated from
a mouse immunized with the enzyme purified from human spleen. It was
selected because of its ability to bind uteroferrin and the human spleen
enzyme with approximately similar affinities.

74
weakly to the beef spleen enzyme (Table 2-9). However, the Kp values
for all five phosphatases were not markedly different, a result which
suggests that antibody 13.122 recognized a relatively conserved site.
Inhibition of Enzymatic Activity by the Binding of Monoclonal Antibodies
The acid phosphatase activity of uteroferrin was measured (without
the addition of 2-mercaptoethanol) after each of the monoclonal
antibodies had been allowed to bind to the enzyme at pH 7.0 for 1 hour.
Table 2-10 demonstrates that antibody 5.127.3 effectively inhibited acid
phosphatase activity when a 2-4-fold molar excess of antibody was added.
Monoclonal antibody 6.22.1 inhibited the enzyme activity slightly at
lower concentrations, while antibody 6.21.2 did not inhibit activity at
all. Monoclonal antibody 13.122 inhibited the phosphatase activity
about 30% at all concentrations tested. None of these antibodies were
able to inhibit the human, rat or bovine spleen enzymes at the
concentrations tested (data not shown).
Discussion
Tartrate-resistant acid phosphatases from various tissue sources can
be purified by a procedure which closely resembles the fast, convenient
purification protocol for porcine uteroferrin. This is particularly
important in the case of the human enzyme, where previous attempts at
purification to homogeneity were either not successful (Lam et al.,
1977) or involved a large number of time-consuming steps (Robinson and
Glew, 1980).
Three properties allowed the hairy cell phosphatase to be purified
readily from extracts of spleen. The high isoelectric point ensured
that it bound to CM-cellulose at high pH. Its immunological

75
TABLE 2-10
Inhibition of acid phosphatase activity of uteroferrln
by monoclonal antibodies
Antibody
Molar Ratio,
Antibody: Uteroferrin
Acid Phosphatase Activity
% control
5.127.3
i-1
in
o
53
2:1
22
4:1
24
8:1
42
6.21.2
0.5:1
97
2:1
86
4:1
109
8:1
138
6.22.1
0.5:1
71
2:1
68
4:1
90
8:1
111
13.122
0.5:1
79
2:1
73
4:1
73
H
CO
72
Uteroferrin (0.06mg) was incubated for 1 hour at room tempeature
with the antibody specified, then assayed in triplicate for acid
phosphatase activity with 20mM p-nitrophenylphosphate as substrate and
without the addition of 2-mercaptoethanol. All activities are presented
as percent of a control assay performed simultaneously.

76
cross-reactivity with anti-uteroferrin antibodies permitted it to be
adsorbed to the immunoaffinity column. Finally, it was relatively
stable to the conditions of elution, namely a brief exposure to pH 2.3
glycine buffer. It is conceivable that some of the losses that occurred
at the immunoaffinity step did result from the elution conditions.
Uteroferrin, although relatively stable to low pH, does begin to lose
its phosphatase activity and presumably its bound iron if maintained
below pH 3.0 (Campbell and Zerner, 1973). However, the major loss of
yield occurred during the binding to CM-cellulose, a step which rarely
provided more than 20% recovery of enzyme. This failure of the cation
exchanger to bind all of the enzyme was not the result of its binding
capacity being exceeded nor to the presence of enzyme variants of lower
isoelectric point. Neither was it related to the presence of detergent.
Possibly the enzyme remains complexed with some soluble, strongly
anionic component in the homogenate. Whatever the basis of the
phenomenon, repeated treatment with CM-cellulose does provide a much
improved yield, with up to 40% of the total phosphatase activity of the
spleen extract eventually binding.
When enzyme was purified from human placenta, protamine sulfate was
added in order to bind various anionic components in the homogenate.
This procedure was first employed by Glomset and Porath for purification
of the bovine spleen enzyme (1960) and was also used by Anderson and
Toverud in purification of the rat bone enzyme (1986). Protamine
sulfate precipitation of anionic components is now routinely empolyed by
our laboratory for the purification of tartrate-resistant acid
phosphatases (see Allen et al., in press).

77
Despite the fact that the spleen was homogenized in a buffer which
contained a wide range of protease inhibitors, there was evidence to
suggest that much of the enzyme may have been cleaved into "subunits"
during or prior to purification. Activity was lost, for example, if the
homogenate was not rapidly processed, and the relative yield of 34,000
monomer and of the two subunits varied from preparation to preparation.
Moreover, the final enzyme, although exhibiting a symmetrical peak of
protein and enzyme activity of apparent Mr=34,000 during gel filtration
on Sephadex G-100 always displayed some subunits during SDS-PAGE.
Robinson and Glew (1981), working with the closely similar Gaucher
spleen enzyme, have shown that the presence of the two lower molecular
weight polypeptides could be minimized, but not prevented, if a protease
inhibitor was included in the homogenizing buffer. In addition, when
uteroferrin was treated with low concentrations of trypsin or
chymotrypsin (Buhi, 1981) or incubated in allantoic fluid (Buhi et al.,
1982b) an active enzyme with subunits of apparent Mr=20,000 and 15,000
was produced. Presumably both proteins possess a region of peptide
which is sensitive to proteases. The reports that the closely similar
beef spleen enzyme, which we have shown to crossreact immunologically
with uteroferrin, possesses two such subunits (Davis et al., 1981;
Campbell et al., 1978) implies that the bovine enzyme might also become
cleaved proteolytically either during normal in vitro processing or
during its isolation from the spleen homogenate. In contrast, the
bovine bone enzyme (Lau et al., 1985, 1987) and the bovine uterine
enzyme do not seem to be as sensitive to this proteolysis, they appear
as intact monomers after purification. The human bone enzyme, unlike

78
the human spleen and placenta enzymes, is also easily purified without
evidence of proteolytic products (Allen et al., in press).
The earlier report that the hairy cell enzyme is not activated by
reducing agents (Lam et al., 1977) can probably be explained by the
observation that activation was transient and varied between
preparations. Similar observations have been made with uteroferrin.
The differences in molecular weight (64,000 versus 34,000) can in turn
by attributed to the fact that hemoglobin was employed as a standard in
the earlier work (Lam et al., 1977) and assumed to maintain the
molecular weight of the tetramer during sucrose density gradient
centrifugation. The variability in kinetic parameters (particularly Km
and V) are probably best explained by the sensitivity of these enzymes
to a variety of inhibitors, including sulfhydryl agents, anions, heavy
metals, and oxidizing agents. The properties of the hairy cell enzyme
do, however, differ somewhat from those reported for the tartrate-
insensitive phosphatase isolated by Robinson and Glew (1980) from
spleens of patients with Gaucher's disease. That phosphatase, despite
the fact that it appeared to crossreact immunologically with the hairy
cell enzyme (Lam et al., 1981), failed to utilize pyrophosphate as a
substrate and hydrolyzed ATP considerably better than ADP (Robinson and
Glew, 1980). It is still not clear, therefore, whether or not the
Gaucher phosphatase and the one from hairy cell spleen are identical
proteins.
The experiments with whole antiserum and with the different
monoclonal antibodies to uteroferrin and the human spleen enzyme
emphasize that the two proteins must have cross-reacting and presumably

79
structurally related determinants (epitopes) on their surfaces.
Monoclonal antibody 13.122, for example, was selected for its ability to
bind to both uteroferrin and to the spleen enzyme. Its binding
characteristics towards both proteins and towards the rat spleen, bovine
spleen and bovine uterine enzymes appeared fairly similar, suggesting
that the epitope it recognized was relatively conserved. On the other
hand, the monoclonal antibodies 5.122.10, 6.21.2 and 6.22.2 bound to the
human, rat, and bovine spleen enzymes and the bovine uterine enzyme with
much lower affinity than to uteroferrin. It can be concluded that all
of the enzymes carry structurally homologous epitopes on their
respective surface, but these sites are not equally conserved.
Nevertheless, the ability to generate both polyclonal and monoclonal
antibodies which have broad immunological crossreactivity should prove
useful in further studies on the biosynthesis and localization of this
class of acid phosphatase. These antibodies may have diagnostic value
both for identifying leukemic hairy cells immunocytochemically and for
measuring the level of the Type 5 isozyme in plasma by immunoassay. The
latter procedure may be particularly useful for assessing osteoclast
activity in individuals exhibiting abnormal bone metabolism (Minkin,
1982; Chen et al., 1975; Stepan et al., 1983) or in patients with
osteoclastic tumors (Tavassoli et al., 1980).
The results of this study clearly demonstrate that uteroferrin, the
purple-colored acid phosphatases from rat spleen, bovine spleen and the
bovine uterus, and the enzyme from the spleens of human patients with
hairy cell leukemia are closely related proteins. In addition to their
immunological cross-reactivity, they are similar in kinetic properties,

80
in their substrate specificities, and in their sensitivities to a broad
range of inhibitors. They also resemble each other in molecular size,
isoelectric point, glycoprotein nature, and iron content. One obvious
difference, however, between uterine enzymes and the spleen enzymes
studied in this chapter is that the uterine enzymes are secreted
glycoproteins whereas the others are principally intracellular.
Nevertheless, even this paradox may be resolved as there is now
considerable evidence that uteroferrin may represent a hypersecreted
lysosomal enzyme (Baumbach et al., 1984). It is, for example, a
substrate for the transferase which is specifically responsible for the
selective phosphorylation of mannose residues on lysosomal enzymes (Lang
et al., 1984). Uteroferrin is also secreted with the so-called
lysosomal recognition marker, mannose 6-phosphate, present on its
carbohydrate chain (Baumbach et al., 1984). Possibly all members of
this class of acid phosphatase have the properties of lysosomal enzymes.
Certainly many of them appear to reside intracellularly in inclusion
bodies resembling lysosomes (Baumbach et al., 1984; Yam et al., 1971;
Schindelmeiser et al., 1987).
The two bovine enzymes which were employed for comparative purposes
in this study should perhaps be studied in more detail. Under the
influence of progesterone, the bovine uterus secretes a uteroferrin-like
protein which appears to be quite distinct from the bovine spleen
enzyme, which is lysosomal. It has been demonstrated that the bovine
uterine and spleen enzymes differ in a number of ways: pH optima (4.2
and 6.0, respectively), Mr (32,000 and 40,000), ability to hydrolyze
pyrophosphate, and cross-reactivity with monoclonal antibody 5.122.10

81
(Kps 17 and 130nM). It would be interesting to determine whether
differential targeting is due to variation in the enzymes' primary
sequences. An alternative approach to study targeting of the purple
phosphatases would involve the isolation and characterization of a
porcine spleen enzyme which would presumably be lysosomal. It appears
that such an enzyme exists, and is distinct from uteroferrin (M. Kazemi
and R.M. Roberts, unpublished results).
In conclusion, it is proposed that the Type 5 human isozyme belongs
to the growing class of iron-containing phosphatases of which
uteroferrin and the phosphoprotein phosphatase of beef spleen are the
best characterized. It remains to be determined whether the human
enzyme possesses the purple color and characteristic g'=1.74 ESR iron
signal which is exhibited by uteroferrin (Antanaitis et al., 1983) and
the bovine spleen phosphatase (Davis and Averill, 1982). Why the Type 5
isozyme accumulates in the leukemic hairy cell and in the spleen
histiocytes of patients with Gaucher's disease is unknown. Both these
cell types are capable of phagocytosing erythrocytes (Robinson and Glew,
1980; Nanba et al., 1977), and the Gaucher cell is known to accumulate
large amounts of iron (Robinson and Glew, 1980). Possibly the elevation
of the Type 5 phosphatase is a reflection of abnormal iron metabolism in
these cells.

CHAPTER 3
MOLECULAR CLONING OF THE TYPE 5, TARTRATE-RESISTANT ACID PHOSPHATASE
FROM HUMAN PLACENTA AND ITS EXPRESSION IN LEUKEMIA CELLS
Introduction
There are at least six distinct types of acid phosphatase in human
leukocytes which can be distinguished by electrophoretic and other
characteristics (Li et al., 1979; Lam et al., 1973; Li et al., 1973).
The Type 5 isozyme is the most cationic of the acid phosphatases and is
the only isozyme insensitive to inhibition by L-(+)-tartrate. It has
been detected in spleen, lung, liver and bone as a minor isozyme (Lam et
al., 1973; Yam et al., 1971). However, it can become the dominant
isozyme in certain pathological states. High tartrate-resistant acid
phosphatase levels are often found within the spleen (Robinson and Glew,
1980) and monocytes (Troy et al., 1985) of patients with Gaucher's
disease; the splenocytes and circulating white cells of patients with
hairy cell leukemia (Yam et al., 1971); the spleens of patients with
Hodgkin's disease (Drexler et al., 1986); and the sera of individuals
undergoing active bone turnover (Yam, 1974). Elevated levels of this
isozyme are also associated with various B-cell and T-cell leukemias
(Drexler et al., 1986). In systematic studies of leukemia cell lines,
it appeared that the tartrate-resistant, Type 5 acid phosphatase was not
generally expressed in immature lymphoid cells, but rather by cells
arrested in later stages of differentiation (Drexler et al., 1985,
1987a).
82

83
In the previous chapter the purification and characterization of
this Type 5 acid phosphatase from human hairy cell spleen, normal spleen
and placenta were reported. It was demonstrated that this human enzyme
is remarkably similar to an abundant tartrate-resistant acid phosphatase
secreted by the porcine uterus under the influence of progesterone,
known as uteroferrin. Both the human enzyme and uteroferrin are iron-
containing glycoproteins, and resemble each other closely in
electrophoretic mobility, substrate specificity and sensitivity to a
variety of activators and inhibitors. The two proteins are also
immunologically related. While uteroferrin is believed to function in
iron metabolism (see Roberts and Bazer, 1985; 1988), the function of the
human enzyme is unknown.
In view of the clinical significance of the human tartrate-resistant
acid phosphatase, further studies on its transcriptional control seemed
warranted. A human placenta cDNA library was screened with polyclonal
antibodies against porcine uteroferrin. However, these antibodies
failed to detect a cDNA coding for the human tartrate-resistant acid
phosphatase. Accordingly, two short cDNA clones coding for porcine
uteroferrin were employed to isolate a cDNA coding for the human enzyme.
In this chapter, the molecular cloning of a 1412 bp cDNA which covers
the complete coding region of the human tartrate-resistant acid
phosphatase is described, and the deduced amino acid sequence of the
human enzyme is compared to the amino acid sequences of porcine
uteroferrin and a related bovine spleen acid phosphatase. The
expression of this human phosphatase in human leukemia cells is

84
demonstrated, and its regulation studied in the human erythroleukemia
cell line K562.
Materials and Methods
Materials
The human placenta cDNA library, mouse spleen cDNA library and human
placenta poly (A)+ RNA were obtained from Clontech. Goat anti-rabbit
and goat anti-mouse antibodies coupled to horseradish peroxidase were
from Bio-Rad. All restriction endonucleases, the large fragment of E.
coli DNA polymerase, T4 DNA ligase, and the RNA ladder were from
Bethesda Research Laboratories. The [a--^P]-dATP was purchased from New
England Nuclear Corp. The 2'-deoxynucleotide triphosphate/2'3'-
dideoxynucleotide triphosphate sequencing mixes were from New England
BioLabs. Heparin-Agarose, hemin and TPA were from Sigma. Fetal bovine
serum and RPMI 1640 were obtained from Gibco-BRL. Oligodeoxyhexamer for
random primer extension probes was from Pharmacia. All other chemicals,
reagent grade or better, were from Sigma or Fisher.
Methods
Preparation of antisera for immunoscreening. Adult New Zealand
White rabbits were immunized with 0.2 to 0.5mg of uteroferrin mixed with
Freund's complete adjuvant and then injected subcutaneously at multiple
sites (Herbert, 1973). Booster injections of 0.2 to 0.5mg of antigen in
incomplete adjuvant were administered monthly. Bleedings of 20 to 40ml
were taken 10 days after injections. The samples were allowed to clot
overnight at 4°C and then centrifuged to separate the serum from the
clot. In some cases the antisera were affinity purified on anti-
uteroferrin Sepharose as outlined in Chapter 2. In other cases the

85
antisera were run through a column of E. coli proteins which had been
coupled to Sepharose, in order to remove antibodies against E. coli
proteins (Huynh et al., 1984).
Screening of the lambda gtll libraries with anti-uteroferrin
antibodies. A human placenta cDNA library prepared by Millan (1985) was
purchased from Clontech. This library contains 1 x 10^ independent
clones, with 96% recombinant phage. The insert sizes range from 0.8-
3.6 kb, and the average insert size is 1.8 kb. A mouse spleen cDNA
library was purchased from Clontech. This library contains 1 x 10^
independent clones, with 93% recombinant phage. The average insert size
is 1.0 kb. The porcine uterine endometrium cDNA library was prepared by
George Baumbach and Patrick Gillevet at the University of Florida. The
method used for screening was developed by Young and Davis (1983a,b) and
Huynh et al. (1984) and modified by deWet et al. (1984).
E. coli strain Y1090 was grown overnight in LB medium [1% (w/v)
tryptone, 0.5% (w/v) yeast extract, 0.5% (w/v) NaCl] plus 0.2% (w/v)
maltose and 50/xg/ml ampicillin at 37°C with good aeration. The next
morning, the bacteria were centrifuged at 1500xg at room temperature for
10 minutes, and resuspended in one-fifth original volume of SM buffer
[0.01M Tris-HCl, pH 7.5, 0.01M MgCl2, O.lmM EDTA, 0.2% (w/v) gelatin].
An appropriate number of phage were mixed with either 75/il of bacteria
(for 100mm dishes) or 300/il bacteria (for 150mm dishes). The bacteria
and phage were incubated at 37°C for 15 minutes to allow the phage to
adhere to the bacteria. The phage and bacteria were then mixed with
either 3 ml (for 100mm dishes) or 7.5ml (for 150mm dishes) of melted LB
containing 0.7% (w/v) agarose, which had been kept at 45°C. The mixture

86
was poured onto plates containing LB with 1.5% (w/v) agar, which had
been pre-warmed to 37°C. The plates were then placed in an incubator at
42 °C for 3 to 4 hours, or until plaques began to appear on a confluent
lawn of bacteria. Nitrocellulose filters, which had been soaking in
lOmM isopropyl y9-D-thiogalactopyranoside (IPTG) were then placed on the
plates. The plates were incubated at 37°C for 4 hours which allowed a
/3-galactosidase fusion protein to be formed, which adhered to the
filter.
After the filters had been removed, the plates were saved at 4°C
until needed. The filters were washed three times with Tris buffered
saline (TBS; 0.1M Tris-HCl, pH 8.0, 0.15M NaCl) and placed in antibody
solution containing a 1:100 dilution of antisera in TBS with 3% (w/v)
bovine serum albumin (BSA). The filters were incubated in antibody
solution overnight at 4°C on a rocking platform at low speed.
The next day, the antibody solution was removed, filter sterilized
through a Millipore 0.2pm filter, and stored at 4°C. (Each antibody
preparation was used up to five times.) The filters were washed
thoroughly with three changes of TBS. The additional protein binding
sites on the nitrocellulose were blocked by incubation in TBS plus 3%
(w/v) BSA. The filters were then treated with goat anti-rabbit
antibody coupled to horseradish peroxidase diluted in TBS plus 3% (w/v)
BSA at dilutions 3- to 5-fold more concentrated than the manufacturer's
suggested dilution for Western blotting. The filters were incubated in
the second antibody solution for 2 hours at room temperature on a
rocking platform at low speed. The antibody was then removed and
discarded, and the filters washed thoroughly as before.

87
The substrate solution used to detect inununoreactive fusion proteins
colorimetrically was 0.33 mg/ml 4-chloro-l-naphthol in TBS plus 0.015%
(v/v) hydrogen peroxide. When this solution was poured onto the washed
filters, inununoreactive fusion proteins appeared as bright purple rings
in less than 30 minutes.
Each time plaques were immunoscreened, dot blot positive controls
were also tested. Dots of 1/xl containing lpg, lOOng, 10ng, lng and
O.lng of uteroferrin were placed on a strip of nitrocellulose. These
dot blots were treated exactly as the nitrocellulose filter lifts from
plates. A good primary antibody with fresh secondary antibody could
routinely detect O.lng of uteroferrin.
Plaques producing inununoreactive fusion proteins were removed as
agarose plugs from the plates with sterile Pasteur pipettes or
microcapillary tubes. Each plug was placed in 1ml of SM plus 50¿il of
chloroform and stored at 4°C. An appropriate volume of the phage in SM
was rescreened as described as above. (An individual plaque typically
contains 10^-10^ phage.) This process was continued until all plaques
on a plate were positive.
General methods-handling DNA and RNA. DNA and RNA concentrations
were estimated at 260nm assuming (E) 1%=250 and 200, respectively.
Ethanol precipitation-DNA was precipitated at -70°C for at least 15
minutes in the presence of 2.5M ammonium acetate, pH 7.5 and three
volumes of 100% ethanol. Preipitates were collected by centrifugation
(14,000xg; 15 minutes). RNA was precipitated for at least 1 hour at
-20°C in the presence of 0.2M sodium acetate, pH 5.2 and two volumes of

88
100% ethanol. Precipitates were collected by centrifugation (14,000xg;
15 minutes).
Phenol/chloroform extration refers to the phase separation of a
nucleic acid solution by emulsification with 1 volume of phenol,
followed by re-emulsification in 0.5 volume of phenol and 0.5 volume of
chloroform: isoamyl alcohol (24:1), and finally 1 volume of chloroform:
isoamyl alcohol (24:1). The aqueous phase was collected each time by
centrifugation (14,000xg; 15 minutes).
All solutions and materials that came in contact with RNA were
autoclaved (when appropriate). Prior to autoclaving, the solutions were
pretreated for 1 hour with a solution of 0.01% (v/v)
diethylpyrocarbonate to inhibit RNases.
Screening of lambda gtll libraries with cDNA probes. The human
placenta cDNA library from Clontech (see above) was screened with two
cDNA probes, 13.1 and 4a3, which code for amino acids 157-186 and 218-
260 of uteroferrin, respectively. The isolation and sequence analysis
of these short clones have been described elsewhere (Simmen et al.,
1988). The sequences of these cDNAs, and the inferred amino acid
sequences, are shown in Fig. 3-1.
The screening method employed was that of Maniatis et al. (1982).
An appropriate number of phage were plated as described above. The
plates were incubated overnight at 37°C. The next day, nitrocellulose
filters were placed on the plate, left for 1-3 minutes, then carefully
removed. The DNA which had bound to the filters was denatured in
solution of 0.5M NaOH and 1.5M NaCl. The filters were neutralized in
0.5M Tris-HCl, pH 8.0 containing 1.5M NaCl, followed by a wash in IX SSC

Fig. 3-1 The nucleotide sequences of the cDNA clones coding for
porcine uteroferrin used for screening the human placenta cDNA
library and their deduced amino acid sequences. Numbers refer to
the nucleotide position in the cDNA (top) or amino acid position
in mature uteroferrin (bottom).

90
Uf Clone 13.1
1
CTG
GCG
CTG
GCC
CGC
AGA
CAG
CTG
GCC
TGG
ATC
AAG
AAG
CAG
157
L
A
L
A
R
T
Q
L
A
W
I
K
K
Q
43
CTG
GCG
GCA
GCA
AAG
GAG
GAC
TAT
GTG
CTG
GTG
GCC
GGC
CAC
171
L
A
A
A
K
E
D
Y
V
L
V
A
G
H
85
TAT
CCT
185
Y
P
Clone 4a3
1
GGC
CAC
GAC
CAC
AAC
CTG
CAG
TAC
CTT
CAG
GAT
GAG
AAT
GGC
218
G
H
D
H
W
L
Q
Y
L
Q
D
E
N
G
43
TTG
GGC
TTT
GTG
CTG
AGC
GGG
GCC
GGG
AAC
TTC
ATG
GAC
CCC
232
L
G
F
V
L
S
G
A
G
N
F
M
D
P
85
TCC
AAG
AAG
CAC
CTG
CGC
AAG
GTC
CCC
AAC
GGC
TAC
246
S
K
K
H
L
R
K
V
P
N
G
T

91
(0.15M NaCl, 0.015M sodium citrate, pH 7.0). The DNA was baked onto the
filters in a vacuum oven at 80°C for 2 hours. The filters were washed
at 60°C in a solution of 0.05M Tris-HCl, pH 8.0 with 1M NaCl, ImM EDTA
and 0.1% (w/v) SDS for 30 minutes. Following the washings,
prehybridization was carried out at 60°C in a solution containing 0.05M
Tris-HCl, pH 7.5, 1M NaCl, lOmM EDTA, 0.1% (w/v) SDS, 0.2% (w/v)
polyvinylpyrrolione, 0.2% (w/v) Ficoll type 400, 0.2% (w/v) BSA and
100/ig/ml denatured, sheared salmon sperm DNA. The cDNA probes, labeled
by the random primer extension method (see below), were allowed to
hybridize to the DNA on the filters overnight at 60°C in the
prehybridization buffer. Following hybridization, the filters were
washed at 60°C with IX SSC which contained 0.1% (w/v) SDS.
Autoradiography was carried out at -70°C with DuPont Cronex Lighting
Plus intensifying screens.
Generation of random primer extension probes. The -^P-labeled CDNA
probes used for screening the library were generated by the random
primer extension method (Feinberg and Vogelstein, 1983). Isolated cDNA
inserts (20-100ng), purified as described below, were boiled for 3
minutes to denature the DNA. The DNA was allowed to anneal to 25-50/ig
of a randomly generated oligodeoxyhexamer. The cDNA and primer were
resuspended in a buffer containing 0.2M Hepes, pH 6.60, 5mM MgCl2, 0.01M
2-mercaptoethanol, 0.05M Tris-HCl, pH 8.0, and 40/ig/ml BSA. The
deoxynucleotides dCTP, dTTP and dGTP were added at a concentration of
20^M, followed by the addition of 50-100/iCi of [^^P]-dATP (800 Ci/mmol).
The reaction was allowed to proceed overnight at room temperature. The
following day, the reaction mixture was loaded onto a column

92
(1.5 x 25cm) of Sephadex G-50 in a buffer containing 0.05M Tris-HCl, pH
8.0 and 0.2M NaCl in order to separate unincorporated nucleotide from
the radiolabeled probe.
Preparation of DNA from positive lambda gtll clones. The plate
lysate method of Fritsch was employed (Maniatis et al., 1982) for
isolation of phage DNA. Approximately 10-* plaque forming units of a
plaque pure positive phage were plated with E coli strain Y1088 and 0.8%
(w/v) top agarose on each 150mm Petri dish containing NZYCM [1% (w/v)
NZ-amine, 0.1% (w/v) casamino acids, 0.5% (w/v) yeast extract, 0.5%
(w/v)NaCl, 0.2% MgCl2, pH 7.5] with 1.5% (w/v) agarose. The plates were
incubated at 37°C overnight. Lysis of greater than 90% of the bacteria
was evident the next day. The plates were incubated at room temperature
for 2 hours with 10ml SM in order to elute the phage from the agarose.
The SM buffer was removed and the solution centrifuged at 10,000xg for
20 minutes to remove debris. The supernatant fraction, containing
viable phage in protein coats, was incubated with 1/ig/ml DNase I and
1/ig/ml RNase A at 37°C for 1 hour. An equal volume of a solution of 20%
(w/v) polyethylene glycol and 2M NaCl was added to the sample and left
on ice for 1 hour. Precipitated phage were collected by centrifugation
at 10,000xg for 30 minutes at 4°C.
The phage pellet was resuspended in 0.01M Tris-HCl, pH 8.0 and ImM
EDTA (TE) and SDS added to 1% (w/v) and EDTA to lOmM. The sample was
incubated at 68°C for 15 minutes, then phenol/chloroform extracted
(described above). The phage DNA was precipitated with isopropanol
(described above). The DNA was resuspended in TE and stored at 4°C or

93
-20°C. The cDNA inserts were excised from lambda gtll by digestion with
EcoR 1 in a buffer of 0.05M Tris-HCl, pH 8.0, 0.01M MgCl2 and 0.1M NaCl.
After electrophoresis on a 1% (w/v) agarose gel, the cDNA inserts were
electroeluted from the gel.
Subcloning of cDNA inserts into nUC 19. The procedure employed was
that of Hanahan (1983). A 3-fold molar excess of cDNA was added to
lOOng of pUC 19 which had been previously digested with EcoR I. The
cDNA were inserted into the EcoR I site and ligated for 2 hours at room
temperature in a buffer containing 0.05M Tris-HCl, pH 7.8, 0.01M MgCl2,
0.02M dithiothreitol, ImM ATP, lmg/ml BSA and 1 unit of T4 DNA ligase.
One microliter of the ligation mixture was incubated with 100/il
competent E.coli JM 83 (see below). After a 45 minute incubation on
ice, and a subsequent 3 minute incubation at 42°C, the samples were
spread on a plate of YT [0.8% (w/v) tryptone, 0.5% (w/v) yeast extract,
0.5% (w/v) NaCl] containing 1.5% (w/v) agarose with 50/ig/ml ampicillin,
0.025% (w/v) IPTG and 0.025% (w/v) 5-bromo-4-chloro-3indolyl /?-D-
galacto-pyranoside (x-gal). The plates were incubated overnight at
37°C. Only bacteria which contained plasmid grew on the plates because
ampicillin was included; and colonies with cDNA inserts were white,
those without inserts, blue.
Competent cells for transformation were prepared as follows: A log
phase culture of E. coli strain JM83 was centrifuged at 1500xg for 10
minutes. The bacteria were resuspended in 1/5 volume of ice cold 0.05M
CaCl2 and incubated on ice for 45 minutes. The cells were centrifuged
as before, and resuspended in 1/10 volume of ice cold 0.05M CaCl2- The
cells were aged at least one hour before being used for transformations.

94
Isolation of pUC 19 recombinant plasmids. The method of Ish-
Horowicz and Burke (1981) was employed for isolating plasmid of interest
from 5ml, 50ml and 1L cultures of E.coli JM83 containing that plasmid.
The bacteria were pelleted at 1500xg for 10-30 minutes. The bacteria
were resuspended in a solution of 0.05M glucose, 0.025M Tris-HCl, pH 8.0
and 0.01M EDTA. After a 10 minute incubation at room temperature, a
solution of 0.2M NaOH and 1% (w/v) SDS was added to the bacteria. The
samples were allowed to sit on ice for 10 minutes. A solution of 5M
potassium acetate, pH 4.8 was added, and the samples centrifuged at
15,000xg for 30 minutes. The supernatant fraction, which contained the
plasmid, was treated with l//g/ml RNase A for 1 hour at 37°C. The
samples were extracted with phenol/chloroform and the DNA ethanol
precipitated.
Southern blots of DNA. Samples of DNA were subjected to
electrophoresis on 1% (w/v) agarose gels as described above. The gel
was treated with 0.2M HC1 followed by 0.5M NaOH, then equilibrated in
0.05M Tris-Borate buffer, pH 8.0 with ImM EDTA (TBE). The DNA was
transferred to Gene Screen membrane by the method of Southern (1972).
After a 16 hour transfer, the DNA was cross-linked to the membrane with
UV light (Church and Gilbert, 1984).
Generation of oligonucleotide probes. Two redundant
oligonucleotides which code for amino acids 11-16 and 241-245 of porcine
uteroferrin were synthesized (see Fig. 3-2). Approximately lOOpmol of
oligonucleotide were suspended in a buffer of 0.1M Tris-HCl, pH 7.6,
0.05M MgCl2, 5mM dithiothreitol, ImM spermidine and 0.2mM EDTA. Ten
units of T4 polynucleotide kinase and 200pmol [)'-^^P]-ATP (1.4mCi, 7000

Fig. 3-2 The sequences of the redundant oligonucleotides used
for Southern blot analysis and their deduced amino acid
sequences. Oligonucleotides coding for amino acids 11-16 of
porcine uteroferrin and the beef spleen enzyme (KM28) and amino
acids 240-245 of the same proteins (KM29) were synthesized at the
University of Missouri DNA synthesis facility and purified by
ethanol precipitation. Probe KM28 is 128-fold redundant, with an
average GC content of 65% and a predicted Tm of 70°C; probe KM29
is 32-fold redundant, with an average GC content of 40% and a
predicted Tm of 60°C. The sequence of human fibronectin was
obtained from Kornblihtt et al. (1985).

96
Uteroferrin:
Probe KM28:
11 16
Ala-Val-Gly-Asp-Trp-Gly
T
GCN GTN GGN GAC TGG GG
Uteroferrin:
2 4 0 2 4 5
Gly-Asn-Phe-Met-Asp-Pro
Probe KM29:
T
GGN A A C
T
T T C A T G
G A
Probe KM28:
T
GCNGTNGGNGAC
GCCGUUGGAGAU
TGG
G Al G
Fibronectin:
(3660-3676)
n h

97
Ci/mmol) were added and the reaction allowed to proceed at 37°C for 1
hour. Unincorporated -ATP was removed by ethanol precipitation.
Probe KM28 had a Tm of 70°C and probe KM29 had a Tm of 60°C.
Hybridization was carried out at Tm-25°C. The radiolabeled
oligonucleotides were employed as probes for Southern blots of clone HP
6.1.
The Southern blots were prehybridized and hybridized in sodium
phosphate buffer, pH 7.2 containing 7% (w/v) SDS, ImM EDTA and 1% (w/v)
BSA, at the appropriate temperatures. The blots were washed in 0.076M
sodium phosphate buffer, pH 7.2 with 1% (w/v) SDS and ImM EDTA, at the
appropriate temperatures (Tm-25°C).
Cloning of cDNA inserts into M13. Competent E. coli strain TG-1 was
prepared as described earlier for JM83. The cDNA inserts from positive
clones were cloned into the EcoR I site of Ml3mpl8 (Messing, 1983;
Messing et al., 1977) as described earlier for pUC 19. Restriction
fragments of the cDNA inserts were prepared as follows: The cDNA inserts
were digested with Alu I, Msp I or Rsa I in a buffer containing 0.05M
Tris HCl, pH 8.0 and 0.01M MgCl2 with 10 units of enzyme/mg DNA; when
restricted with Hae III, the buffer used was 0.05M Tris-HCl, pH 8.0,
0.01M MgCl2 and 0.05M NaCl. In some cases the entire assortment of
restriction fragments from each individual digest was cloned into the
Sma I site of M13mpl9, a procedure known as "shotgun" cloning. In other
cases, the restriction fragments were separated on a 6% (w/v)
polyacrylamide gel (Maniatis et al., 1982), and the restriction
fragments 100 bp or larger cut out of the gel and electroeluted. Each
fragment was then cloned into the Sma I site of Ml3mpl8 individually.

98
One microliter of the ligation mix was incubated with competent
E.coli TG-1 as described earlier for cloning into pUC19. The bacteria
and phage were added to a mixture YT with 0.7% (w/v) agarose at 45°C,
containing 0.025%(w/v) x-gal, 0.025% (w/v) IPTG and 100/il log phase E.
coli TG-1. The mixture was poured onto a 100mm Petri dish containing YT
with 1.5% (w/v) agar. Plates were incubated at 37°C overnight.
The white plaques, made by phage which contained inserted cDNAs,
were removed as an agar plug, placed into a tube (4ml) of YT and 100/il
log phase E. coli TG-1, and allowed to grow overnight at 37°C. The
cultures were centrifuged at 1000xg for 10 minutes. The bacterial
pellets were discarded, and the phage particles in the supernatant
fraction, which contained single stranded DNA, were precipitated by
addition of 1/5 volume of 20% (w/v) polyethylene glycol and 2M NaCl.
After an incubation of 1 hour on ice, the phage were collected by
centrifugation at 10,000xg for 30 minutes at 4°C. The phage were
resuspended in a solution of TE containing 1% (w/v) SDS and the samples
were extracted with phenol/chloroform. The single stranded DNA was then
ethanol precipitated.
DNA sequencing. DNA was sequenced according to the method of Sanger
et al. (1977) as outlined in the New England BioLabs technical bulletin.
The 17-mer universal primer (2ng) was allowed to anneal with purified,
single-stranded M13 DNA (1/ig) at 50°C in a sequencing buffer containing
0.01M Tris-HCl, pH 7.5, 5mM MgCl2 and 7.5mM dithiothreitol. Meanwhile,
the "enzyme mix" was prepared, containing 6U large fragment of E. coli
DNA polymerase and 80/iCi (800 Ci/mmol) [a-]-dATP in the sequencing
buffer described above. The "enzyme mix" was then added to each of the

99
tubes containing M13 DNA and the annealed primer. For each clone, this
mixture of phage, primer and enzyme mix was evenly divided into four
tubes labeled "G", "A", "T", and "C". To the "G" tubes for each clone,
the "G" sequencing mix was added; to the "A", tubes, "A" sequencing mix
and so on. The compositions of the sequencing mixes are as follows:
"G", 150/tm dideoxy GTP (ddGTP) , 1.7/tm dATP, 40/iM dCTP, 4.2/tM dGTP, and
40/iM dTTP; "A", 60/jm ddATP, 1.7/im dATP, 30/iM dCTP, 30/tM dGTP and 30/jM
dTTP; "T”, 150/iM ddTTP, 1.7/iM dATP, 40/iM dCTP, 40/iM dGTP, and 1.7/xM
dTTP; "C", 150/iM ddCTP, 1.7/xM dATP, 4.2/xM dCTP, 40/xM dGTP and 40/xM dTTP;
each sequencing mix was in the sequencing buffer described above. The
primer-template mixture plus enzyme mix and sequencing mixes were
allowed to remain at room temperature for 15 minutes. A chase solution
containing 0.25mM deoxynucleotides was added to the sequencing
reactions, and the samples remained at room temperature for 15 minutes.
The reactions were terminated by the addition of a solution of deionized
formamide containing 0.3% (w/v) xylene cyanol FF, 0.3% (w/v) bromphenol
blue, and 0.37% (w/v) EDTA, pH 7.0.
The sequencing reactions were subjected to electrophoresis on thin
gels (0.04 cm), 40 x 65cm, consisting of 6% (w/v) polyacrylamide, 7M
urea and 0.05M TBE. The gels were dried immediately after
electrophoresis, and exposed to Kodak XAR film at room temperature. The
sequence was analyzed with the aid of the Beckman MicroGenie program.
Heparin-Agarose affinity chromatography. Heparin-Agarose (800/ig
heparin/ml gel; 4mg) was equilibrated in a buffer of 0.01M Tris HC1, pH
7.5 with 0.010M NaCl. A bed volume of approximately 5ml was used.
Approximately 6mg of uteroferrin in the same buffer was applied to the

100
column. The column was washed with 3 column volumes of the same buffer,
and the uteroferrin eluted step-wise with 0.1, 0.25 and 0.5M NaCl in
0.01M Tris HC1, pH 7.5.
Tissue culture techniques. The cell lines employed were as follows:
The human erythroleukemia cell line K562 (Lozzio and Lozzio, 1975), the
human T-cell line, JURKAT, also known as JM (see Nagasawa et al., 1986),
and the Epstein-Barr virus (EBV)-transformed B-cell line 1799ZR1.3
(Smith et al., 1987). The cells were maintained in RPMI 1640 medium
with Hepes buffer, supplemented with 10% (v/v) heat inactivated fetal
bovine serian, 2mM glutamine and antibiotic solution (10pg/ml penicillin,
10/ig/ml streptomycin, 0.25/¿g/ml amphotericin B). The K562 cells and
JURKAT cells were maintained at 37°C in a 5% CO2 atmosphere; the
1799ZR1.3 cells, at 37°C in a 7% CO2 atmosphere. Cells were maintained
at a density of 2.5 x 10^-8.0 x 10^ cells/ml. Only cells that were at
least 98% viable as determined by Trypan blue exclusion were used for
experiments, except where stated in the text. The normal human
leukocytes and leukemic hairy cells (the generous gift of M.A. Gross and
R. Weiner) were prepared for cryopreservation after collection (Weiner
et al., 1979) and thawed immediately before use.
A solution of 12-tetradecanoylphorbol 13-acetate (TPA) was prepared
as a 1.6mM stock in dimethyl sulfoxide and stored frozen. For each
experiment, a fresh stock of 10'^M was prepared in the growth medium
described above.
O
Hemin (4 x 10'stock) was prepared according to the method of
Rutherford and Weatherall (1979). Thirteen milligrams of hemin were
dissolved in 200¿il of 0.5M NaOH, then neutralized with 250/il 1M

101
Tris-HCl, pH 7.8 and brought up to 5ml with deionized distilled water.
The stock was made fresh and used immediately.
Isolation of RNA from tissue culture cells. RNA was isolated
according to the method of Chomczynski and Sacchi (1987). Tissue
culture cells were centrifuged at 1500xg for 10 minutes at room
temperature. For each 10^ cells in the cell pellet, 100^1 of GTC
solution was added (4M guanidinium thiocyanate; 0.025M sodium citrate,
pH 7.0; 0.5% (w/v) sarcosyl; 0.1M 2-mercaptoethanol). The sample was
vortexed immediately, and the cells broken in a dounce homogenizer. An
equal volume of water-saturated phenol was added, followed by an
addition of 0.1 volume 2M sodium acetate pH 4.0, and 0.2 volumes of
chloroform: isoamyl alcohol, 49:1. The samples were shaken vigorously
and placed on ice for 15 minutes. The samples were centrifuged at
10,000xg for 30 minutes. RNA remained in the aqueous phase, DNA was at
the interface between the two phases, and most other cellular components
were in the organic phase. The aqueous phase was carefully collected,
and the RNA precipitated with isopropanol. The RNA pellet was
resuspended in GTC, and precipitated with isopropanol a second time.
The RNA was then precipitated with ethanol, and the pellet resuspended
in RNase-free water.
Electrophoresis of RNA. RNA samples were subjected to
electrophoresis in a gel consisting of 1% (w/v) agarose, 0.04M
morpholiropropanesulfonic acid (MOPS), pH7.0, 0.01M sodium acetate, 2.2M
formaldehyde and ImM EDTA (Lehrach et al., 1977). RNA samples were
dissolved in the above buffer containing 50% (v/v) formamide, 0.5% (w/v)

102
bromphenol blue and 0.5% (w/v) xylene cyanol FF. RNA was detected by
staining with 0.1/ig/ml of ethidium bromide for 10 minutes.
Northern blotting. Northern blotting of formaldehyde-agarose gels
was carried out according to Maniatis et al. (1982). The gel was soaked
in 50mM NaOH, 0.01M NaCl, followed by neutralization in 1.0M Tris-HCl,
pH 7.5. Transfer of the RNA to GeneScreen was allowed to proceed by
capillary action overnight in 20X SSC. After a brief wash in 0.05M TBE,
the blot was UV-irradiated in order to cross-link the RNA to the
membrane (Church and Gilbert, 1984).
Preparation of a single-stranded probe for Northern analysis. A
[P]-labeled single-stranded probe which hybridizes to mRNA coding for
the human tartrate-resistant acid phosphatase was prepared in the
following manner (Church and Gilbert, 1984): Approximately 2.5/ig of
single stranded M13 DNA containing the coding strand of the clone coding
for the human phosphatase were allowed to anneal with 18ng of M13
sequencing primer at 50°C in a buffer containing 0.05M Tris-HCl, pH 8.0
and 0.3M NaCl. After 40 minutes, the deoxynucleotides dCTP, dGTP and
dTTP were added to a concentration of 0.066mM, in a solution containing
5mM MgCl2, 0.01M 2-mercaptoethanol, 0.3mg/ml BSA and 100/xCi (800
Ci/mmol) [oc-32P]-dATP. After 40 minutes at room temperature, the
reaction was terminated by the addition of a solution of 50% (v/v)
formamide, 0.03% (w/v) xylene cyanol FF, 0.3% (w/v) bromophenol blue and
0.037% (w/v) EDTA. The sample was subjected to electrophoresis in a 6%
(w/v) polyacrylamide gel with 7M urea in 0.05M TBE in order to separate
the radiolabeled probe for the M13 template. The gel was placed in
contact with Polaroid Type 57 film in order to determine how far the

103
radiolabeled probe had migrated. The radioactive band was cut from the
gel, crushed with a glass rod, and then mixed with hybridization
solution of 1M sodium phosphate buffer, pH 7.2, 7% (w/v) SDS, ImM EDTA
and 1% (w/v) BSA. The probe was shaken at 50°C for 2 hours.
Hybridization was then carried out for 16 hours at 65°C. The blots were
washed with 1 liter (5 x 200ml) of a wash buffer consisting of 0.076M
sodium phosphate buffer pH 7.2 with ImM EDTA and 0.1% (w/v) SDS at 65°C.
Autoradiography was performed at -70°C with Kodak XAR film and DuPont
Cronex Lightning Plus intensifying screens.
The fl-actin probe for Northern blotting. A human /3-actin cDNA
(Gunning et al., 1983; Ponte et al., 1984) in the Okayama-Berg
expression vector (Okayama and Berg; 1983) was used as an internal
control in Northern analysis. The cDNA insert was isolated as a BamH I
restriction fragment. The /3-actin cDNA was radiolabeled by the random
primer extension method described previously. Hybridization and washing
conditions were as described for the tartrate-resistant acid phosphatase
probe.
Preparation of cell lysates. Cells in culture were centrifuged at
1500xg for 10 minutes at room temperature. The culture medium was
frozen at -70°C. The cells were lysed in the lysis buffer (described in
Chapter 2) which had been used for isolation of the acid phosphatase
from human spleen. The cells were broken in a dounce homogenizer, then
centrifuged at 14,000xg for 10 minutes. The pellet was discarded, and
the supernatant fraction frozen immediately at -70°C.
Measurement of acid phosphatase activity. Acid phosphatase activity
in both the cell lysates and the culture medium was determined in the

104
presence of 0.1M tartrate and 0.1M 2-mercaptoethanol at pH 5.3 with the
substrate p-nitrophenylphosphate as described in Chapter 2.
Results
The Identity of the Positive Clones Obtained by Immunoscreening the
Human Placenta Library
When polyclonal antisera raised against porcine uteroferrin were used to
immunoscreen 3 x 10^ plaques of the human placenta cDNA library in
lambda gtll, 12 positive clones were obtained. Each of these clones
produced a fusion protein recognized by three independent lots of rabbit
antisera. Filters from the immunoscreening are shown in Fig. 3-3. Of
the twelve positive clones, three could be described as generating very
strong immunoreactive fusion proteins, seven generated moderate
reactions, one gave a weak reaction, and one appeared to be a false
positive but was isolated nevertheless. Each of these lambda gtll
clones except the suspected false positive (clone HP 1.1) continued to
give rise to immunoreactive fusion proteins throughout the course of
plaque purification.
The three very strong positive clones, HP 5.1, HP 5.2 and HP 6.1
were chosen for further analysis. The lambda gtll DNA was purified from
these clones and treated with EcoR I, and the sizes of the cDNA inserts
were determined (Fig. 3-4A). Clone HP 6.1 was approximately 1400 base
pairs (bp); clone HP 5.2, 1200 bp; and HP 5.1, 1000 bp. When the insert
HP 6.1 was radiolabeled by the random primer extension method, it
hybridized to both HP 5.1 and HP 5.2 (Fig. 3-4B), as determined by
Southern blot analysis carried out at very high stringency. This same
probe hybridized to DNA from plaques produced by 10 of the 11 remaining
positive clones (data not shown). Only clone HP 1.1, the suspected

Fig. 3-3 Nitrocellulose filters containing immunoreactive fusion proteins
produced by recombinant lambda gtll phage from a human placenta cDNA library
which was screened with anti-uteroferrin antibodies. Each filter contains
fusion proteins from approximately 2000 recombinant phage, which had been
enriched for positive clones by one round of plaque purification. The filters
were incubated with rabbit antibodies against porcine uteroferrin, followed by
goat-anti-rabbit conjugated to horseradish peroxidase. Immunoreactive fusion
proteins were visualized by incubation with substrate [0.015% (w/v) H2O2] and
coupling dye (4-chloro-l-naphthol, 0.33mg/ml). A, clone HP5.2; B, clone
HP5.2, screened with antisera from a different rabbit; C, clone HP6.1; D,
clone HP5.1. The filters in panels C and D were tested with the same antisera
used for the filter in panel A.

106

107
7 2 3 4 5 6
723 456
Fig. 3-4 Agarose gel electrophoresis of DNA from six positive clones
obtained by immunoscreening human placenta and mouse spleen cDNA
libraries and Southern analysis of the clones probed with HP 6.1. A,
Approximately 20/¿g of lambda gtll DNA containing the following cDNA
inserts were digested with EcoR I and subjected to electrophoresis in a
1% (w/v) agarose gel: HP 5.1 (lane 1), HP 5.2 (lane 2), HP 6.1(lane 3),
MS 4.4 (lane 4), MS 5.1 (lane 5) and MS 6.1 (lane 6). DNA was
visualized with ethidium bromide. The cDNA inserts are the lower, less
intense bands of varying size. B, Approximately 1/xg of lambda gtll DNA
containing the same cDNA inserts were treated as in panel A. Lanes 1-6
contain the same samples as described above. The DNA was blotted onto
Gene-Screen and probed with radiolabeled HP 6.1 insert as described in
"Materials and Methods". Autoradiography was carried out for 10 minutes
(lanes 1-3) or 16 hours (lanes 4-6).

108
false positive, failed to hybridize to the radiolabeled cDNA insert HP
6.1.
Southern blots of the positive clone HP 6.1 in pUC19 and Msp I
restriction fragments of that cDNA, both in pUC19 and as isolated
insert, were probed with radiolabeled redundant oligonucleotides which
code for porcine uteroferrin (see Fig. 3-2 for the sequences of the
oligonucleotides). Probe KM29 did not hybridize to the cDNA HP 6.1.
However, under conditions of fairly high stringency, oligonucleotide
KM28, which codes for amino acids 11-16 of uteroferrin, hybridized
specifically to a 400 bp Msp I fragment of clone HP 6.1 (see Fig. 3-5).
Taken together, these data indicated that clone HP 6.1 coded for the
human tartrate-resistant acid phosphatase. A cDNA of 1300 bp could
entirely encode a protein of apparent molecular weight 34,000 (about 300
amino acids). Three different lots of monospecific antisera raised
against porcine uteroferrin consistently and specifically recognized
fusion proteins from 11 different cDNA clones which were known to
hybridize to HP 6.1. Finally, an oligonucleotide coding for porcine
uteroferrin hybridized specifically to HP 6.1.
The cDNA insert of clone HP 6.1 was digested with Alu I and Hae III.
The results of this digest are shown in Fig. 3-6. Each digest was
cloned into the sequencing vector M13mpl9 ("shotgun" cloning), and
clones were chosen at random and sequenced. When the sequence of clone
HP 6.1 was analyzed by the Beckman MicroGenie program, it was revealed
that this clone actually codes for human fibronectin rather than a
uteroferrin-like polypeptide. Clone HP 6.1 covers nucleotides 2324-3798
(1475 bp) of human fibronectin (Kornblihtt et at., 1984) which codes for

109
Fig. 3-5 Southern blot analysis of clone HP 6.1 with radiolabeled
oligonucleotide KM28. Plasmid pUC19 containing cDNA insert HP 6.1 (1/ig)
was cut with EcoR I and/or Msp I and subjected to electrophoresis on a
1% (w/v) agarose gel and transferred to Gene-Screen as described in
"Materials and Methods". The blot was probed with radiolabeled KM28,
which codes for amino acids 11-16 of porcine uteroferrin. The
hybridization and washing conditions are explained in the text. A,
pUC19 (1/ig). B, pUC19 containing the cDNA insert HP 6.1. C, Msp I
digest of pUC19 containing the cDNA insert HP 6.1. D, EcoR I digest of
pUC19 containing the cDNA insert HP 6.1. E, Msp I digest of the insert
HP 6.1, which had been isolated from an EcoR I digest of pUC19
containing the cDNA and electroluted from a 1% (w/v) agarose gel. The
plasmid pUC19 contains 13 Msp I sites, the cDNA insert contains 2 Msp I
sites.

110
1 2 3
A H A H A H
Fig. 3-6 Polyacrylamide gel electrophoresis of clone HP 6.1
restriction fragments obtained by digestion with Alu I and Hae III.
Approximately 2/¿g of HP 6.1 cDNA insert were digested with Alu I (A) or
Hae III (H) as described in "Materials and Methods". The insert was
obtained from pUC19 clone HP 6.1-3 (lanes 1A and H), pUC19 clone HP 6.1-
9 (lanes 2A and H) and lambda gtll clone HP 6.1 (lanes 3A and H). The
digests were subjected to electrophoresis in a 6% (w/v) acrylamide gel
and the DNA visualized with ethidium bromide.

Ill
amino acids 1709-2201 of the mature protein (see Fig. 3-7; Kornblihtt et
al., 1985). Furthermore, nucleotides 3660-3676 of human fibronectin
match probe KM28 (which codes for amino acids 11-16 of uteroferrin) at
14 out of 17 residues (Fig. 3-2).
Dot Blot Analysis of Uteroferrin and Fibronectin with Anti-Uteroferrin
Antibodies
Uteroferrin, human fibronectin, leucine aminopeptidase and
copper/zinc superoxide dismutase were bound to nitrocellulose and tested
for cross-reactivity with rabbit polyclonal antibodies raised against
porcine uteroferrin. Figure 3-8 reveals that the polyclonal antibodies
cross-reacted with human fibronectin as well as with porcine
uteroferrin, with binding apparent down to O.lng of protein. There was
no detectable binding to 1/ig samples of leucine aminopeptidase or
superoxide dismutase under identical conditions. The four monoclonal
antibodies discussed in detail in Chapter 2 were then tested for binding
to human fibronectin. Monoclonal antibodies 6.21.2 and 5.127.3 cross-
reacted weakly human fibronectin (detection limit lOOng), while
monoclonal antibodies 6.22.1 and 13.122 did not.
Results from Screening of the Mouse Spleen cDNA Library
About 2.1 x 10"* plaques from a mouse spleen cDNA library in lambda
gtll were screened with the anti-uteroferrin polyclonal antibodies.
Seventeen positive clones were identified. Two clones generated
immunoreactive fusion proteins rated as very strong; seven were rated
moderately strong, six were weakly positive, and two were suspected to
be false positives. The two strongest positive clones, MS 5.1 and MS
6.1, and one moderately positive clone, MS 4.4 were chosen for further
study. The cDNA inserts were excised with EcoR I and subjected to

Fig. 3-7 The nucleotide and inferred amino acid sequence of
clone HP 6.1, which codes for human fibronectin. The nucleotide
sequence of a full-length cDNA coding for human fibronectin is
shown below, and the region which matches clone HP 6.1 is
underlined. The inferred amino acid sequence of human
fibronectin is listed above, with the deduced amino acid sequence
of clone HP 6.1 in brackets. The cDNA sequence and inferred
amino acid sequence are from Kornblihtt et al. (1985, 1986).

lrre«yr*v*MO»l*«»LT*oaTTic-. c a * t * g p
.(.i;c(Mjoooi*c*occc3cra.>cr’<»Tr»c'”c*AAarcrTToci»orQAoccArGOOAOcoAC*oc»*occrcraAcrQCTCA4C*aAC *c r- z? J 20 «o jo «o ’0 to to too no :ro
vKET0trw¿wtM'A»,»A3I*0rACTV3L'A^0a*Aarnv.'G
ffCTCAATGAAACTaArrSTACTCTCCT05TCAaATaaACTC:ACrT:30aCCCAaAr(»ACAOOATACCOACrQACCOrCOOCCTTACCCOAAQAOGCCAOCCCAOOCACTACAArOTOC
130 140 130 Ito ¡70 :to IfC 200 210 220 230 240
• fVftYAu»*- a-A3E',TySl.VA:ilON9CSAKATayF»TL
-TCCCTCTOT'CTCC/VACTACCCCC-CAOGAATCTcaAaCCTOCArCTGAGTACACC37ArC2CTCOTCOCCArAAAOOOCAACCAAOAOAG22CCAAAOCCACTOOAGTCTTTACCACAC
* 230 :t0 270 :tO 290 300 310 320 330 340 330 3«0
- »ats:*ArN*,evTETT i v i T*TAAA*?or*i.ov*A*Qaa
.0cÍoCCrCGOAOC'CTArTCCACC’TACA*CACCOAOaTOACTOAGACCACCATCOT3A^CACAT30ACOCCraCTCCAAOAArroarTTTAAOCTaOOraTA:aACCAAOCCAOOGAO
370 300 390 400 «tO 420 430 440 430 4*0 «70 «10
fAAtevTtesGstov33L*Aawevv»TiawL»30oet0AA
-•3A30CACCACaAGAAaTO»;TTCAOACTCAGGAAGCArCGTT3rG’C2CCCT*GACTCrAGGAGTAGAAT»COTCTACACCATCCAAGTCCTOAGAGATaaACAOOAAAOAOAroCOC
* «90 300 3:0 320 323 340 330 360 370 360 300 tOO
|VN4WWrAU3A»TNLHi.EA9ADra vL7wSMe6SrTAD|Ta
^(MlT70TAAACAAAaT'aGT0ACACCA7'0TCTCCACCAACAAAC*T0CATCraGAriGCAAACCCT0ACACT'GGAaTacrCACAGTCTC27 0OGAOAOOAGCACCACCCCA0ACATTACTG
CO 620 833 S«0 S30 360 370 860 ttO 700 710 720
T*rT-T*rMaaaGNSi.€SvywAD0SiCTrQ*L6*aLi7*o
••f T4T AGAA 7 *ACCACAACLCC TACAAACQQCC AGC AGGGAAA 7 TC TT’GOAAGAAG T0G *CCA TQCTGATCAOAGCTCC TQCACT7TTOA TAACC70A0TCCC0QCC’GOAOTACAA 7Q
?30 740 730 ’60 770 7«0 7*0 800 6l0 *20 *30 140
fVrTyHOOUCSVA l 2 0 7 r ! AAgAAA*OL*A TwIOAOTntV
•;A0707rTACACTOrCAAOGATOACAAG3AAAGTC72CCTA'CTCTGAT4CCArCATCCCAOCTOrrCCrCCTCCCAC’'OACCTOCOATTCACCAACArrOOTCCAOACACCAraCOTG
CO **0 *73 910 990 900 910 120 *30 *40 *30 »*0
r * A *■ A * 5 I OC’HFLVH S A V * N C C O V A E I» * I 3A00NAWUL
fCACC7aCGCr,CCACCC2CA7CCA770ATT’AACCAAC’’CCr0G7GCa7rACTCACCT0TGAAAAAT3AGGAAOATQr'r0CAOAaTT0rCAATrTCTCCTTCA0ACAAr0CA0 70O7CT
3'0 3*0 3*0 1000 :0:0 1020 1030 1040 IOSO 10*0 1070 10*0
•■íwL’G’C OVS 3 3 W V c a M E * T A I. « 0 » 3 « T 0 t 0 • A T 0 I 0
• 4ACAAATC TCC’OCC'GG'ACAGAA 7A7QT AQ’3AC’G’CTCCAO T3rC 7 ACGAACAAC ATGAQA0CACACCTC7T AGAGQAAGACAGAAAACAQOTCTTQATTCCCCAACTQOCAtrO
10*0 1100 :U0 (120 1130 1140 1130 .1*0 1170 11*0 11*0 1200
7*3lTAA*r»v-«A:AA,»AT|»’3r*l*MHAeHr»q**»fO*
ACT*rTC''GATATr*CTCC:A-CTcrTT»*Cro-GCAC’C5ATTGC*2CT2aAOCCACCArCAC’'GaC’ACAOOATCCaCCArCA’’CCCOAOCACTTCAOTOOOAOACCTCOAOAAOArc
Í 210 1223 1230 .240 1230 -.2*2 2’0 i 2*0 12*0 1300 13J0 1320
vAH*49S:TLr*4 1.TAa*CY'Jw3tOAi.AG*EE9AULl0aa3
OaOTaCCCCACTC’CGGAA'"CCATCACCCT'2ACCAAC2’CACTC:ACS:ACAGAG’A’’G'CJOTCA3CATCGTTQCT'C',TAA’,OOCAOAOACOAAAaTCCCTTATTOATTMCCAACAAT
• 330 1340 1330 1360 1370 1360 13C0 1400 1410 1420 1430 1440
rwfOOAAOtSVWAArAT»'. i,|i4 0AAAWTy*YV*tTYOET
:4ACAOT*'';’CArG7',:COAOOOACCTGOAAGTTOr»'OC*OCCACcC2CACCAGCC7ACTGArCAOC7GGGATOCTCCTOCTaTCACAOTOAGATATTACA 1430 «80 1470 1430 :«30 .300 l3«0 1320 1330 1340 1330 ;3*0
SONSA vaEr7w»'JS^S'ATfSaW4AOVOYTlTgYAV7a*3
CAGGAOOAAATAacCC’'GTC:AOCAOr'CACTG70CCTGOGAOCAAaTC7ACAOCTACCA'CAOCOSCC7T(ww»cCT,OOAOTrOATrATACCArCAC7070TArQC7aTCACTaoCCOTa
1370 13*0 .330 1*00 *10 1*20 1*30 1*40 1*30 1**0 :*70 11*0
C«»*9*4AtiiM''»rci0«*3a«3v70va0<4*tfv*yt.**
9A®ACA0CCCC0CAAOCAGCAA0CCAATTTCCA7 TAATTACCCAACAQAAAT T0ACAAACCATCCCAGA’GCAAQ7QACC0A 7QTTCAOOACAACAQCA 7 TAQ TQTCAAQ TQQC73CCTT
; 7*0 :700 1710 1720 1700 1740 1730 1760 1770 l7*0 l7*0 1*00
S*Ay»Or*v/TTTA*KOAaATllTATAOA99TCATI|Ol.a*7
:4AO'"CCCC*GrTAC’OOrTACAOAaTAACCACCACrCCCAAAAATOOACCAaaACCAACAAAAACTAAAACTOCACaTCCAOArCAAACAGAAArOACTATTOAAOOCrTOCAGCCCA
1*10 1*20 1*30 1*40 1*30 11*0 1*70 t**0 16*0 1*00 1*10 1*20
''E',YV*wrAaNA*OCSa*l.warAWTNIOAA«OUArrOWOV
2'lGTOQAQT ATQTQQ T T4G TQTCTATQC TCAQAA TCCAAOCOOAQAOAOTCAQCCTC TOOT TCAOAC TGCAG 7 AACCAACA T TQATCOCCC 7 AAAGGAC TOOCAT TCACT0ATQTQ0A7Q
:"30 .*40 1*90 1**0 1*70 1**0 Uto 2000 2010 2020 2030 2040
o* t* t*Yt*AaoawfAT4vTYS9»coa ihcuaaaaooeco
'CGATTCCATCAAAA ttoC* TQOGAAAQCCCACAOOQGCAAGTTTCCAOGT ACAQQG TQACC TAC rCQAGCC2 TQAGQA TQQAATCCAT0AQC7AT TCCC TOCACC TQA TGQTQAAQAAQ
2030 20*0 2?-' 20*0 20*0 2100 2110 2120 2130 2140 2130 21*0
* lh.30t*Aa*frrv*wwALH0DAE»«ALl0Ta«T~A|AAA
•CACTOCAGAOCTOCAAOGCCTCAGACCOOaTTCTOAOTACACAOTCAaTOroOTTOCCTTOCACOATOArATOOAOAGCCAOCCCCTOATTOOAACCCAOTCCACAOCTATTCCTOCAC
2170 21*0 21*0 2200 2210 2220 2230 2240 2230 22*0 2270 22*0
r8^«rravTA-*L*rAa*«rAA(«waLT0r»g*v»TAR|«TaAA
CAACTGACCTQAAflT^CACTCAflqTCACACCCACAAOCCTaAOCaCCCAOTOOACACCACCCAArarrCAOCTCACTOOATATCOAOTOCOOOTOACCCCCAAOOAOAAOACCOOACCAA
2300 2310 2320 2330 2340 2090 23*0 2370 23*0 23»0 2400
. * t!"L*'0***wwV*GLAWAT«YCV>*VrAL40TLT*»AAa
^AAAflAAA TCAACCT^QC TCC TpACAOCTCATCCOTOOTTQTATCAOOAC T t4T0QTQQCCACCAAA 7AT0AAC TOAOTqTCTATOCTCTTAAQQACACTTTQACAAOCAQACCAOCTC
2110. 2JU0 2JUL. Zllfl Iftlfi 1AM IMS llflfi 24»q 2900 2910 232Q

114
C7C07aTOACAOA70C7*C70*IACCACCA7CACCAT7•OC70aAOAACCAAOAC7aAaACOA7CAC7QaCTTrr,
2570 25*0 2300 2000 2010 2020 2030 —
-21*
*4^rro4iraccoTrcc»occ 2030 2000 2070 2000 2000 2700 27*.0 2720 2730 2740 2730 n*.
v t 3 *• * • 3 3 P V V 1 0 A
ccT’a/uiTOACiMTacTccoí»ocrccccTC'jCtcatcoacccc'
7770 C’OO 2790 2000
cae
*oao:'C7::< ' C7>»33*»7Eww7i*»'»»0'vrc*':Tai.
CACGTacc»oc 7300 C200 :3’.C 2320 2030 C3«0 CISC 2300 C370 COCO 2300
E -
00a*c
22S$
CTCr-irviAtOor 1 n 9 * * * !
Caa0AACC0AArAT»CAA’'T'»aT0TCATT0CCC’'CAAGAA^AArCACAA3A0CaA0CCCCTGA''
: '10 3020 3030 30*0 3030 30C0
â–¼
â–  GAACGAAAAAGAC AQACGAOC T 'CCCCAAC TGOTAACCC w "CCACACCCCA4*;'
3070 3000 3000 3100 3110 JtjQ
► aafiuOwajTwonraryrMaororaAGiaL^OTfoaa».
TrCA’OGACCAaAOArc7TCaA*3T*CCT’'2CACAa',TCAAAAGACCCCTTTCaTCACCCACCCrOGGrATOACAC70GAAATOOTAT’CAGC*'7CCroOCACTTCTOaTCAOCAAC-C*
3130 31«C 3130 3130 3 1 7Q 3140 3130 3200 2210 3220 3230 3^
wa33":FCtH0^f»'?T'aa»r(»r*i»HAaA»ra*nu^ae»
QraTraoacAACAAA73ArcTrTOAaaAACA'’sarrrTAGacQaACCACACcac2CACAAcaaccAcccccArAAaGCArAaoccAAOACCArAcccacc3A«raTAaoACA*GA*GC’’c^
3 230 3200 3270 3200 3230 3300 3313 3320 3330 3340 3330 33^
COTTílyaArao'ser 1 CSCM*yOTOCfAi.a*»VAQT*T|
TCTCTCAOACAACCA*C-CArOOOCCCCATTCCAOOACACTTCTa»GTACATCArTTCATGTCATCCT37700CAC7GAT3AAOAACCC7T*CAOTrCAOOOTTCCTOGAACTTCT*ceil
3 70 3300 3300 3*00 3*10 3*20 3430 3440 3450 3 400 3470 34*1
A r L 7 a ■- ’ • O a • y H I l V C A U 4 O 3 O 4 M K V»CCUVrwO*4VNf
C 'OCCAC7C70ACA3aCC’CACCAaAOOr3CCACCT4CA4CATCA7*c’OOAGGCAC70AAAQACCAGCAOAGGCArA»GGT*COOGAAQAOaTTOTT4CCOTOOOCAACTCTaTC44CO
3 - 00 3300 33:0 3320 3530 3340 3330 3300 337Q 3300 3300 3000
ai.Na4TO03c*0Ar’v3*rAvaoc*c»*«»fsar4LLC«cc
4AOOCTTOAACCAACCrACOOArQ<»CTCCTGC7'T34CCCCTACACAOrr7CCCAT'rATOCC07TOOAaAr3*a7303A4COAArOTCTOAArCAOOCTrT* V 3010 3020 3030 3040 3430 3000 30 70 3000 3000 37QQ 3710 3720,
3r04aHr4C0»3>»yc>40NQyNr« 1 aQftxOaaoCNOaAAie
7AOOCr’"’OOAAOT30TCATTrC»a<|TarGArTCATCTAOATOGTOCCATQ4CAArOC7aT3AACTACAAOArrOOAGAOA40rGOOACCarCAOQOAOAA44rOOCCAOAr04rQilOCT
3 7-30 3740 3730 3 700 377q 3^ 10 3->30 30 0 0 30 1 0 3 0 2 0 3030 3040
T Cl0N(|ll(lCrKC0»HC*7»v08aK~VMVQf9MaoCtL8At
OCACATOTCT''aOOA4M:GOAA4AOGAOAAT'CAAa70TOACCCTCATOAGOCAACaTa7»ACGA'aaroOGAAGACAT4CCACO’AOOAGAACA0 7COCAOA400A4T4rCTCOGTOCC4
3030 3000 3070 3000 3000 3000 3310 3020 3030 3040 3030 3004
cocTc*ooa»ai4<»co'*c»7»OGC73*EaTraa3rNar444
TrTocTccrocACArocT*TaoAooccAocoooocToocQCTOTOACAAcroccocAaAccT3ooG07GAAcccAaTcccGAAaocAc*AcraoccAQrccrACAAccAOT4TTcrcAM
3070 3000 3000 4000 4010 4020 «030 4040 4030 4000 4070 4000
TM347*rxvNC7TfC*"4L0waA04E3344
GATACCA TC4QA0AACAAACAC 7AATQTT AATTCCCCAA 7 TGAQT3C 7 7CA 7QCC 7 * TAQA 7Q7 ACAGOC 7QACAQAQAAOA7 TCCCOAOAO TAAATCATC77TCCAA TCCAQA00A4CA
«C30 4100 41 10 4120 I V 30 4 140 4130 4140 4 170 4100 4100 4204
AaCA*0TCTC7C*aCCAAOA7CCA’,C7AAACTOOAa7OAT0T7AaCAOACCCAOC77AaA077CrTC7TTCTrTCr»ft*OCCC777GC7C7GOAaOAAO77C7CCAOC77CAOC7CAAC7
4210 4220 4230 4240 4230 4240 4270 4200 4200 4300 4310 4320
C 4CA0C7 7CTCCAA0CA7CACCC73G0AGT 7TCC73AOOG 77 7TC7CA7 AAA73AQOGC 70CACA7 *3CC7Q7TG 7QC T 7JGAA07 A77CAA7ACCOC 7CA0TATTT7AAA 7GA6Q7QAT
4330 4340 4330 4300 4370 4300 4300 4400 4410 4420 4430 4440
7C',AAOArrTaarT7aOOA7CAA7AOaAAAaCA7ArOCAaCeAACCA*OA70CAA*73rTrraAAA7aA7«raACCAAAA7rTTAAQTAOaAAAa7CACeCA«ACAC77C7QCr77CACr
4430 4400 4470 4*00 4*90 *300 4310 *320 *330 *340 *330 *300
'AAO707C’,0OCCC0CAA7*C7O7AaOAACAA0CA',QA7CTT0T7*C70''aATA7T7-|UU»7ATCCACAa7AC7CACTTTT7CCAAA7QATCC7A0TAA7TaCC7 4OAAA7a7CT77C7C
4370 4300 4300 4000 40lO *020 4030 40*0 *030 *000 *070 «400
7TACCTG77HTTT A 7CAA7TTT *CCCAC7A7T”TTA7 ACQOAAAAAA* 73 7(47 7QAAAAC AC 77 4074 7(JC A07 T 3A 7 AAQAOOAA 77 TQO T AT 447 TA TQOTaQO 7QA 7 TA7T7TTT47
*000 4700 4710 «720 «730 «740 4 730 4 700 «770 4700 4 7f0 «400
4410 «020 «030 «040 «890 4040 4070 «000 «000
Fig. 3-7--continued

Fig. 3-8 Dot blot analysis of the binding of polyclonal and monoclonal
antibodies against porcine uteroferrin to uteroferrin and human fibronectin.
Serial ten-fold dilutions of protein, from 1 /^g/ 1 to 0.1ng/Al, were bound to
nitrocellulose filters (1 1 dots). The proteins employed were Uf, uteroferrin;
Fn, fibronectin; LAP, leucine aminopeptidase; and Cu/Zn SOD, copper/zinc
superoxide dismutase. After additional protein binding sites on the
nitrocellulose were blocked with BSA, the blots were incubated with the source
of antibody indicated: Rb Uf, rabbit anti-uteroferrin 1/100 dilution;
6.22.1, that monoclonal antibody, 10i/g/ml; 6.21.2, 10jug/ml; 5.127.3,
8(>g/ml; 13.122, 8/ or goat anti-mouse) was incubated with the blots at the manufacturer's
recommended dilution. Immunoreactive proteins were detected with H2O2 (0.015%,
v/v) and 4-chloro-l-napthol (0.33mg/ml). This figure is a reproduction of the
original dot blot, which had faded with time.

Rb <* Uf
Uf
Fn
LAP
Cu/Zn SOD
Uf
Fn
LAP
Cu/Zn SOD
• •
• •
e
•
• •
lug
> O.lng
6.22.1
• •
• • o
•
•
• 1 « •
e
lug -
> O.lng
13.122
%
• • • ♦
Uf
Fn
LAP
Cu/Zn SOD
Uf
Fn
LAP
Cu/Zn SOD
lug
^ O.lng
lug
^ O.lng
116

117
electrophoresis on a 1% (w/v) agarose gel (Fig. 3-4A). The approximate
sizes of the cDNA clones were as follows: MS 4.4, 575 bp; MS 5.1, 240
bp; and MS 6.1, 300 bp. These cDNA inserts were also on the Southern
blot in Fig. 3-4B. Note that HP 6.1, which codes for human fibronectin,
did not hybridize to these cDNA inserts.
The largest cDNA clone, MS 4.4, was chosen for further study. An
agarose gel of an EcoR I digest of a larger quantity of DNA from this
clone revealed the presence of an additional insert of about 250 bp
(data not shown). Both the 575 bp and 250 bp cDNAs were subcloned into
M13mpl8 and sequenced. The sequences of the cDNAs showed no homology to
fibronectin, nor were they homologous to any other DNA sequences in
GenBank. The inferred amino acid sequences of the clones showed no
similarity to the amino acid sequence of porcine uteroferrin. No
further studies were carried out with the mouse cDNA clones obtained by
immunoscreening.
Results from Screening the Porcine Uterine Endometrium cDNA Library
Approximately 3 x 10-* plaques from a porcine uterine endometrium
library (the generous gift of George Baumbach) were screened with the
anti-uteroferrin antibodies. No positive clones were obtained.
However, when this library was immunoscreened with antibodies raised
against the uteroferrin-associated protein mentioned in Chapters 1 and
2, several positive clones were obtained (M.K. Murray, unpublished
results). It is not clear why a cDNA insert coding for porcine
uteroferrin could not be isolated from this library by immunoscreening.

118
The Molecular Cloning of a cDNA Coding for the Human Type 5. Tartrate-
resistant Acid Phosphatase
Approximately 3 x 10-* plaques from the human placenta cDNA library were
screened with two short cDNA probes which code for porcine uteroferrin
(Fig. 3-1). These cDNA clones, 13.1 and 4a3, were obtained by Rosalia
Simmen (Ohio State University) upon immunoscreening a porcine uterine
endometrium library. The synthesis of the library and isolation of the
positive clones are described elsewhere (Simmen et al., 1988). Upon
screening the human placenta cDNA library with uteroferrin cDNA 4a3,
eight positive clones were identified. Two of these positive clones 2a,
and 6a, were rated as strong positives; three as moderately strong
positives; and three as weak positives. When these positive clones were
rescreened with cDNA 4a3, only the two strong positives hybridized to
the probe. The cDNA 13.1, when used as a probe, hybridized to both of
these strong positives, 2a and 6a (Fig. 3-9). The cDNA inserts were
excised from lambda gtll clones 2a and 6a with EcoR I and subjected to
electrophoresis on a 1% (w/v) agarose gel. The cDNA 2a appeared to be
approximately 900 bp; the cDNA 6a, about 1400 bp (Fig. 3-10).
The cDNA clones 2a and 6a were digested with Alu I, Hae III, Msp I
and Rsa I, and the digests subjected to electrophoresis on 6% (w/v)
polyacrylamide gels (Fig. 3-11). The fragments larger than 100 bp were
electroeluted from the gels, and subcloned individually into M13mpl8.
The subcloning and sequencing strategy is shown in Fig. 3-12. The
restriction fragments that were sequenced and their locations in clone
6a are listed in Table 3-1.

119
l
Fig. 3-9 Two positive clones, 2a and 6a, identified by screening the
human placenta cDNA library with the cDNAs coding for porcine
uteroferrin. Duplicate filters were obtained containing DNA from
approximately 1 x 10^ plaques (6a, top) or 600 plaques (2a, bottom) at
an intermediate stage in plaque purification of the two positive clones
(see "Materials and Methods"). The filters were hybridized to
radiolabeled cDNAs coding for 13.1 (left) or 4a3 (right) as described in
the text.

120
Fig.3-10 Agarose gel electrophoresis of EcoR I digests of DNA from two
positive clones, 2a and 6a. DNA isolated from lambda gtll positive
clones (10/ig; lanes 2 and 4) and a pUC19 subclone (2/ig; lane 5) which
had been digested with EcoR I were subjected to electrophoresis on a 1%
(w/v) agarose gel. Isolated cDNA inserts which had been electroeluted
from a similar gel (lOOng) were also subjected to electrophoresis on
this agarose gel (lanes 3 and 6). Molecular weight markers (lane 1)
were EcoR I and Hind III digests of phage DNA (top to bottom; 21226,
5148, 4973, 4277, 3530, 2027, 1904, 1584, 1340, 983, 831 and 564 bp).
The sizes of cDNA inserts 2a (lanes 2 and 3) and 6a (lanes 4-6) were
estimated to be 900 and 1400 bp, respectively.

Fig.3-11 Polyacrylamide gel electrophoresis of the restriction fragments
obtained by the digestion of clones 2a and 6a with Alu I, Hae III and Msp I.
Clone 2a (left) was digested with Alu I (incomplete digest, lane 1) Hae III
(lane 2) or Msp I (lane 3). Molecular weight markers (lane 4) consisted of an
Msp I digest of pUC19 (from top to bottom; 501, 489, 331, 242, 190, 147, 111-
110 doublet, 67 and 34 bp, respectively). Clone 6a (right) was digested with
Alu I (lane 2), Hae III (lane 3) or Msp I (lane 4). Molecular weight markers
(lane 1) were the same as described for 2a. The samples were subjected to
electrophoresis in a non-denaturing 6% (w/v) polyacrylamide gel. The
restriction fragments were visualized with ethidium bromide.

¡imiíini
-
* «MI [[ ,
i
>0
K>
a
i ir u
o
irt; iik i
i
II J
Os
Q
ZZl

123
1
I
200
I
400 600
I I
800
I
1000 1200 1400
I I I
H
1
RM 2a
11 T
A H AH R
1 1 111
A AMA
1 111
M
1
r
Fig.3-12 Subcloning and sequencing strategy for clone 6a, the cDNA
encoding the human Type 5, tartrate-resistant acid phosphatase. The
restriction map displays only relevant restriction endonuclease sites.
The solid bar represents the protein coding region, the thin line the
untranslated sequences. The direction and extent of the sequence
determinations are shown by horizontal arrows. A, Alu I; H, Hae III; M,
Msp I, R, Rsa I; 2a, the limits of the shorter cDNA clone 2a.

124
TABLE 3-1
The clones employed for generation of the complete
sequence of the human
tartrate-resistant acid phosphatase
Clone
Strand
Nucleotides
2al,2a3,2a4
L
1215-1367
2a2
U
482-657
6al,6a5
U
1-89
6a2, 6a3, 6a4
L
1298-1412
al.l,al.3,al.4,r2
. 3,r2.4,r2.6
U
1-220
al.2, a3.3
L
1083-1173
al.4, h4.2, sh6 ,
r2e, r2k
U
449-621
a2.1
U
778-916
a2.3
L
802-978
a2.6
L
913-972
a3.1
L
987-1076
a3.4
U
1002-1087
a3.5
L
633-758
a3.7
L
986-1081
hi. 1
U
1118-1281
hi. 2
L
1269-1412
hl.4(6a)
U
239-406
h2.1, h3.2, h3.4
U
808-949
h2.2, h3.3(2a)
L
895-1011
h2.1, h2.2, h2.3,
h3.3(6a)
L
105-220
h2.6
L
77-196
h3.1, h3.3
L
897-993
h3. la
L
554-612
h3. lb
U
697-764
h3.5
L
896-1012
h3.6
L
118-226
h4.2
L
1-76
h5.1
L
1060-1091
ml.2, ml.3, ml.5
L
964-1117
ml.3(6a)
U
554-604
m2.1, m2.11, sml,
sm5
L
230-418
m2.2
L
112-230
ml.2, m2.1, m2.2,
m2.3
U
482-639
m2.4
L
992-1112
m3.1
L
601-721
m4.2, m4.3
U
1309-1412
r2a
U
407-581
r2c, r2d, r2h
L
204-406
r2hal
L
731-764
r2ha2
L
771-805
r2hd
U
396-477
ralu a,c,i
U
763-823
ralu b, d, g, h
U
640-660
ralu e
L
666-752
ralu f
U
672-756
sa5
U
755-919
Clones which generated coding-strand sequence are designated U
(upper strand); those which generated sequence from the anti-sense
strand, L (lower strand). Nucleotides refers to the position of the
clone in the complete sequence.

125
cDNA Sequences
Figure 3-13 shows the 1412 nucleotide sequence of the clone 6a, and
the inferred amino acid sequence of the human tartrate-resistant acid
phosphatase. The shorter clone, 2a, is identical to nucleotides 482-
1367 of clone 6a.
The translational initiation site can be assigned to either of two
in-frame ATG codons, both of which lie downstream of an in-frame
termination codon, TGA, at nucleotides 70-72. The 5' untranslated
sequence is 93 bp, followed by an open reading frame of 969 bp
corresponding to a protein of 323 residues. The codon specifying
proline 304 is followed immediately by the translational termination
codon TGA at nucleotides 1063-1065. The 3' untranslated sequence is 347
nucleotides in length, with residues 1381-1386 composing a potential
polyadenylation signal AATAAA, which lies 21 residues upstream of the
presumed poly(A) tail.
Characteristics of the Deduced Amino Acid Sequence
The first amino acid of the mature protein is assigned as the
aspartate coded by nucleotides 151-153. this assignment was determined
by application of the (-3, -1) rule of Von Heijne (1983, 1986), but
remains tentative since the N-terminal sequence of the human enzyme has
not been established.
The mature human tartrate-resistant acid phosphatase most probably
consists of 304 amino acids, with an unglycosylated relative molecular
mass of 34,193. This enzyme contains two potential attachment sites for
N-linked oligosaccharides. The sequence asparagine-valine-serine occurs
twice, at amino acids 97-99 and 128-130 (Fig. 3-13).

Fig.3-13 The nucleotide sequence of the cDNA clone 6a and the
deduced amino acid sequence of the human Type 5, tartrate-
resistant acid phosphatase. The initiation and termination
codons are underlined. The putative signal peptidase cleavage
site is indicated with an arrow. The two potential attachment
sites for N-linked oligosaccharides are boxed. The putative
polyadenylation signal (AATAAA) is also underlined.

127
70
CCCCACCCAATAAACCCTCACCGACCGCCACTTCTACTCT ACACCCCACCACCCTCTCACACCCTCCCCT
71 150
OCTCCCCTCTCTCTCCCCC7CC ¿JC. GAC ATC TCC ACC CCC CTC CTC ATC CTC CAA CCC TTC TTC CTA CCC TCC CTC GCT
SI
MDMWTALL I tOAlLlPSLA^
151 225
CAT CCT CCC ACC CCT CCC CTC CCC TTT CTA CCC CTC CCT CAC TCC CCA CCC CTC CCC AAT CCC CCA TTC CAC ACC
1 25
D CATPALRFVAVCOWCCVPNAPFHT
226 300
CCC CCC CAA ATC CCC AAT CCC AAC CAC ATC CCT CCC ACT CTC CAC ATC CTC CCT CCA CAC TTC ATC CTC TCT CTA
26 50
C PEMANAKE I A R T V Q I LCADF I LSL
301 375
CCC CAC AAT TTT TAC TTC ACT CCT CTC CAA CAC ATC AAT CAC AAC ACC TTC CAC GAC ACC TTT GAC GAC CTA TTC
51 75
C DNFYFTCVQDINDKRFOETFEDVF
376 450
TCT CAC CCC TCC CTT CCC AAA CTC CCC TCC TAC CTC CTA CCC CCA AAC CAT CAC CAC CTT CCC AAT CTC TCT CCC
76
S
N
N
100
A
451 525
CAC ATT CCA TAC TCT AAC ATC TCC AAC CCC TCC AAC TTC CCC ACC CCT TTC TAC CCC CTC CAC TTC AAC ATC CCA
101 125
0 iayskiskrwnfpspfyrlhfkip
526 600
CAC ACC AAT CTC TCT CTC CCC ATT TTT ATC CTC GAC ACA CTC ACA CTA TCT CCC AAC TCA GAT CAC TTC CTC ACC
126
0
N
I
N
150
l S
601 675
CAC CAC CCT CAC ACC CCC CCA CTA ACT CCC CCC ACA CAC CTC TCC TCC CTC AAC AAA CAC CTC CCC CCC CCC ACC
151 175
0 OPERPRLTARTQLSWLKKQIAAAR
676 750
CAC CAC TAC CTC CTC CTC CCT CCC CAC TAC CCC CTC TCC TCC ATA CCC CAC CAC CCC CCT ACC CAC TCC CTC CTC
176 200
E DYVLVACHYPVWS I AEHGPTHCLV
751 825
AAC CAC CTA CCC CCA CTC CTC CCC ACA TAC CCC CTC ACT CCC TAC CTC TCC CCC CAC CAT CAC AAT CTC CAC TAC
201 225
K olrpllatycvtaylcchdhnloy
826 900
CTC CAA CAT CAC AAT CCC CTC CCC TAC CTC CTC ACT CCC CCT CCC AAT TTC ATC CAC CCC TCA AAC CCC CAC CAC
226 250
L ODENCVCYVLSCACNFMDPSKRHQ
901 975
CCC AAC CTC CCC AAC CCC TAT CTC CCC TTC CAC TAT CCC ACT CAA GAC TCA CTC CCT CCC TTT CCC TAT CTC CAC
251 275
R KVPNCYLRFHYCTEDSLCCFAYVE
976 1050
ATC ACC TCC AAA CAC ATC ACT CTC ACT TAC ATC GAC CCC TCC CCC AAC TCC CTC TTT AAC ACC ACC CTC CCC ACC
276 300
I SSKEMTVTY I EASCKSLFKTRLPR
1051 1145
CCA CCC ACC CCC ILAACTCCCATCACTCCCCACCTCTCACCCCCCATCTCCACTCTTCCCTCCCTCCCCTCCCCCCACCCTCCTCACACCCACCC
301 304
R A R P
1146 1245
TTTTCCTCCAACCTCTCCCCCTCCACCACCCCACOACCCCAAACACACCT CAT CAACTGTCCTCCCACAT GACCTTCTCCCACACATCCCACTATCTCA
1246 1345
ACACACATCCACATCTCTCCACCACACTCTATCCTCTTCCTCTCCCTCACCCTTTCCTCACTTCCCCCCTCCAATCGCCCACCCACCCACCCAAACCTTC
1346 1410
CTCCTAAATCAACCATCTTTCTCTTACTCATCTTCAATAA«a JWTACCTTCCCAACCCTCAAAAAA

128
In Fig. 3-14, the deduced amino acid sequence of the human enzyme is
compared to the amino acid sequences of porcine uteroferrin and the
bovine spleen tartrate-resistant acid phosphatase. Overall, there is
85% identity between the human enzyme and porcine uteroferrin. The
similarity increases to 89% when only non-conservative substitutions are
considered (Dayhoff, 1972). There is 82% identity between the human
enzyme and the portions of the bovine enzyme which have been sequenced.
A search of GenBank and the Protein Data Bank revealed no significant
similarities between the cDNA sequence or inferred amino acid sequence
of the human tartrate-resistant acid phosphatase and any other known DNA
or protein sequences.
Northern Analysis
Northern analysis was carried out in order to determine the size of
the mRNA coding for the human Type 5 phosphatase and to study the
distribution of the enzyme in leukemic cells. A radiolabeled, single-
stranded cDNA probe coding for the anti-sense strand of clone 6a was
employed to analyze blots of RNA isolated from human placenta, normal
human leukocytes, the leukocytes obtained from a patient with hairy cell
leukemia, the human erythroleukemia cell line K562, the T-cell line
JURKAT and the EBV-transformed B-cell line 1799ZR1.3 (Fig. 3-15). The
probe detected a single transcript of approximately 1.5 kb in K562 cells
(Fig. 3-15A and B) and 1799ZR1.3 cells (Fig 3-15C). The transcript
detected in the hairy cells appeared to be slightly larger (Fig. 3-15A).
This probe was also able to detect a 1.7 kb transcript in RNA isolated
from the uterine endometrium of a day 60 pregnant pig (P.V. Malathy and
R.M. Roberts, unpublished results). The transcript was not detected in

Fig.3-14 Comparison of the deduced amino acid sequence of the human tartrate-
resistant acid phosphatase with the amino acid sequences of porcine uteroferrin
and the bovine spleen acid phosphatase. Boxed regions indicate differences in
the sequences. Blanks are unknown amino acid residues, X stands for either
leucine or isoleucine in the beef spleen sequence; (-) indicates that adjacent
residues are connected in the sequence; asterisks indicate potential
glycosylation sites. The Asn at position 97 is known to be glycosylated in
uteroferrin (Hunt et al., 1987). Most of the amino acid sequence for
uteroferrin and all of the sequence for the beef spleen TR-AP is from (Hunt et
al., 1987). Some regions in the porcine uteroferrin sequence (underlined) were
deduced or interconnected from information obtained from uteroferrin cDNA
clones (Simmen et al. , 1988 and R. Simmen, unpublished results). A uteroferrin
peptide sequence (KKILKR) placed tentatively after position 104 in Hunt et al.
(1987) was not represented in the cDNA sequence. Its origin is unclear,
although it is similar to the sequence SKISKR assigned to residues 105-110.

1 25 50
n
G A
T
P A
L
R
F
V
A
V
G
D
W
G
G
V
P
N
A
P
F
H T
G
p
E
M
A
N
A
K
E
1
A
P
T
V
Q
1
L
G
A
0
F
1
L
S L
Fluman Placenta
T
A P
T
P
1
L
R
F
V
A
V
G
D
w
G
G
V
P
N
A
P
F
H T
A
R
E
M
A
N
A
K
A
1
A
T
T
V
K
T
L
G
A
D
F
1
L
S L
Uteroferrin
T
P A
P
M
-
L
R
F
V
A
V
G
D
w
G
G
V
P
N
A
P
F
Y S
A
E
M
A
N
A
K
A
X
A
T
V
K
X
X
G
A
D
F
V
X
S
Reef Spleen
75
100
G
D N
F
Y
F
T
G
V
0
D
I
N
D
K
P
F
Q
E
T
F
E
0
V F
S
n
R
S
L
R
K
V
P
W
Y
V
L
A
G
N
H
D
H
L
G
N
V
S A
Human Placenta
G
D N
F
Y
F
T
G
V
H
D
A
K
n
K
R
F
0
E
T
F
E
D
V F
S
D
P
S
L
R
N
V
P
W
H
V
L
A
G
N
H
D
H
L
G
N
V
S A
Uteroferrin
G
D N
F
Y
F
S
F
Q
E
T
F
E
0
V F
s
A
S
P
X
R
S
V
P
W
X
A
G
N
H
0
H
X
G
N
V
S
Reef Spleen
125
150
Q
I A
Y
S
K
I
S
K
R
W
N
F
P
S
P
F
Y
R
L
H
F
K
1 P
Q T
N
V
S
V
A
I
F
M
L
0
T
V
T
L
C
G
N
S
0
0
F
L S
Human Placenta
Q
I A
Y
S
K
I
S
K
R
W
N
F
P
s
P
Y
Y
R
L
R
F
K
I P
R
s
N
V
s
V
A
1
F
M
L
n
T
V
T
L
C
G
N
S
D
D
F
V s.
Uteroferrin
5
K
X
5
K
R
W
K
F
P
s
P
Y
Y
R
X
R
F
K
X P
R
SIT
-
T
R 7
X
F
M
X
0
T
V
T
X
C
G
N
S
D
D
F
V
Reef Spleen
175
200
0
Q P
E
R
P
R
l.
T
A
R
T
Q
L
s
W
L
K
K
Q
L
A
A
A R
E
D
Y
V
L
V
A
G
H
Y
P
V
W
S
1
A
E
H
G
P
T
H
C
L V
Human Placenta
Q
Q P
E
R
N
L
A
L
A
R
T
0
L
A
w
I
K
K
Q
L
A
A
A K
E
D
Y
V
L
V
A
G
H
Y
P
V
w
S
1
A
E
H
G
P
T
H
C
L V
Uteroferrin
A
R
T
Q
X
A
w
X
K
K
0
X
A
A
A K
E
n
Y
V
X
V
A
G
H
Y
P
V
w
S
X
A
E
H
G
V
V
H
C
X V
Reef Spleen
225
250
K Q L
R
P
L
L
A
T
Y
G
V
T
A
Y
L
c
G
H
0
H
N
L
Q Y
L
0 n
E
N
G
V
G
Y
V
L
s
G
A
G
N
F
M
D
p
S
K
R
H 0
Human Placenta
K Q L
L
P
L
L
T
T
H
K
V
T
A
Y
L
Q
G
H
D
H
N
L
0 Y
L
Q 0
E
N
G
L
G
F
V
L
s
G
A
G
N
F
N
D
p
s
K
K
H L
Uteroferrin
K Q X
X
P
X
X
N
A
H
K
V
T
A
Y
X
c
('.
H
D
H
N
X
Q Y
X
0 Q
t
N
C
X
G
F
V
X
s
G
A
G
N
F
M
0
p
s
K
K
H
Reef Spleen
275
300
R
K V
P
N
G
Y
L
R
F
H
Y
G
T
E
0
s
L
G
G
F
A
Y
V E
I
s
S
K
E
M
T
V
T
Y
I
1
A
S
G
K
S
L
F
K
T
R
L
P P
Human Placenta
R
K V
P
N
G
Y
L
R
F
H
F
G
A
E
N
s
L
G
G
F
A
Y
V E
1
T
P
K
E
M
S
V
T
Y
I
F
A
S
G
K
S
L
F
K
T
K
L
P R
Uteroferrin
Q V
P
[)
G
Y
X
R
F
H
Y
G
A
E
N
s
X
G
G
F
A
Y
V E
X
S
P
K
E
M
S
V
T
Y
X
F
A
s
A
N
S
X
F
K
T
R
X
P R
Reef Spleen
R
A RÍ
p
1
Human Placenta
R
A R|
s
H
A
Uteroferrin
( ) Reef Spleen
130

Fig. 3-15 Expression of tartrate-resistant acid phosphatase mRNA and its
induction by TPA. Total RNA was isolated from the leukocytes of a normal
individual and a patient with hairy cell leukemia; and from the cell lines
K562, JURKAT and 1799ZR1.3. When indicated, the cell lines were cultured in
the presence of 10*®M 12-tetradecanoylphorbol 13-acetate as in Table 3-2.
Northern blots of total RNA (40/-g/lane) were hybridized to radiolabeled cDNA
probes coding for either the human tartrate-resistant acid phosphatase
(TR-AP) or fb -actin (described in Materials and Methods). The size of the TR-AP
mRNA is 1.5 kb and the /2>-actin mRNA is 2.0 kb as determined by comparison with
RNA molecular weight standards. A, RNA was isolated from normal human
leukocytes (lane 1), leukocytes of a patient with hairy cell leukemia (lane 2),
K562 cells (lane 3) and K562 cells treated with TPA for 72 hours (lane 4). The
Northern blot was probed with the cDNA coding for TR-AP. B, Lanes 1-7,
respectively, contain RNA isolated from K562 cells treated with TPA for 0, 12,
24, 48, 72, 96 and 120 hours (see Table 3-2). In panel a, the Northern blot
was probed with the cDNA coding for TR-AP; in panel b, the same blot was probed
with the cDNA coding for /S-actin. C, RNA was isolated from JURKAT cells (lane
1), JURKAT cells grown in the presence of TPA (lane 2) and the lymphoblastoid
cell line 1799ZR1.3 (lane 3). In panel a, the Northern blot was probed with
the cDNA coding for TR-AP; in panel b, the same blot was probed with the cDNA
coding for fb -actin.

132
<

133
normal human leukocytes (Fig. 3-15A) or placenta (data not shown)
although leukocytes and placenta are known to contain the protein.
Neither was the transcript apparent in the JURKAT cells (Fig. 3-15C), a
T-cell acute lymphoblastoma leukemia cell line which does not express
the Type 5 phosphatase (Drexler et al., 1987a).
Induction of the Tartrate-resistant Acid Phosphatase by TPA
When K562 cells were grown in the presence of 10'^M TPA for 72
hours, a 30-fold increase in total acid phosphatase activity was
observed (Table 3-2). The intracellular enzyme levels increased 25-fold
by 72 hours, and declined thereafter. A change in morphology was also
noted. With increased exposure to the phorbol ester, the cells
increased in size and became irregular in shape.
Figure 3-15B shows that levels of mRNA coding for the human
tartrate-resistant acid phosphatase increased dramatically after a 24
hour exposure to the phorbol ester and began to decline after 72 hours.
Densitometry revealed that the mRNA was maximally induced 30-fold 72
hours after addition of the TPA. Clearly the increased expression of
tartrate-resistant acid phosphatase activity in response to the phorbol
ester is closely correlated with increased levels of mRNA coding for the
enzyme. The signal for ^-actin mRNA remained relatively unchanged as
the time of exposure to the tumor promoter was extended.
The JURKAT cell line, which had undetectable levels of mRNA coding
for the tartrate-resistant acid phosphatase (Fig. 3-15C), was also
tested for tartrate-resistant acid phosphatase activity with and without
the addition of TPA to the culture medium. Relatively low levels of
tartrate-resistant acid phosphatase were detected in the cell lysates

134
TABLE 3-2
Tartrate-resistant acid phosphatase levels in K562 and JURKAT cells
maintained on 10 ~ 8 TPA and K562 cells maintained on 60uM hemin
Cells
Treatment
Time (hours)
Units of Activity (mU/10-3
Total Activitv Cells
cells)
Medium
K562
None
0
0.84
0.57
0.27
K562
10‘8M TPA
12
0.96
0.77
0.14
K562
10"8M TPA
24
2.9
2.2
0.7
K562
10'8M TPA
48
11.0
9.1
1.9
K562
10'8M TPA
72
21.0
16.6
4.4
K562
10"8M TPA
96
12.0
8.8
3.2
K562
10*8M TPA
120
10.0
1.6
4.4
K562
60/iM hemin
48
1.6
0.50
1.1
K562
60/iM hemin
72
0.68
0.34
0.34
JURKAT
None
0
2.6
2.6
0
JURKAT
10'8M TPA
72
2.6
1.1
1.5
Cells (108) were harvested at each time point and acid phosphatase
activity measured in triplicate samples of medium and cell extracts from
10^ cells. Each culture was maintained separately at a density of
approximately 5 x 10-* cells/ml by addition of fresh medium (see
"Materials and Methods") containing 10"8M phorbol ester or 60/^M hemin
when necessary. Cells were exposed to high salt/detergent buffer
(Chapter 2), broken by dounce homogenization and the supension
centrifuged at 14,000xg for 10 minutes. Activity in the cell lysate
(supernatant fraction) and the culture medium was assayed with p-
nitrophenylphosphate (20mM) as substrate in the presence of 2-
mercaptoethanol (0.1M) and L-(+)-tartrate (0.1M). Results are expressed
as milliunits (nmol substrate hydrolyzed 1 min. at 37°C) per 10-* cells.
The medium was not changed during the course of the experiment and so
represents accumulated activity.

135
but not culture medium of JURKAT cells when TPA was not added to the
culture (Table 3-2). However, 58% of the acid phosphatase activity
appeared in the culture medium after 72 hours treatment with TPA,
although the total amount of acid phosphatase activity did not change.
The Effects of Hemin on Acid Phosphatase Expression
When hemin is added to the culture medium of K562 cells, the cells
express fetal and embryonic hemoglobins, and differentiate into
erythrocyte-like cells (Rutherford et al., 1979). Since the tartrate-
resistant acid phosphatase is expressed at relatively high levels in
K562 cells, but is not found in erythrocytes, the effect of hemin on the
expression of the Type 5 acid phosphatase in K562 cells was studied.
The effects of hemin were determined 48 and 72 hours after its
addition to the medium. The cells changed drastically in morphology
even 24 hours after hemin was added. K562 cells are normally spherical,
regular in size and do not attach to the flask. In the presence of
hemin the cells took on an irregular appearance, and there was some
adherence to the flask. While the viability of log phase cultures of
K562 cells, even in the presence of TPA, was always greater than 98%,
the viability of K562 cells in the presence of hemin was consistently
90-95%. However, this loss of viability is unlikely to have influenced
the results. Significantly, both the tartrate-resistant acid
phosphatase activity (Table 3-2) and the mRNA level for the enzyme (data
not shown) declined 72 hours after the addition of hemin.
Discussion
There may be several reasons why antibodies raised against porcine
uteroferrin recognize human fibronectin. However, the possibility that

136
porcine fibronectin has contaminated uteroferrin preparations can be
ruled out. Fibronectin is not a basic protein and its molecular weight
is greater than 250,000, features which make it seem unlikely that
fibronectin would co-purify with uteroferrin. Also, fibronectin has not
been identified in the uterine secretions of pigs, at least in any
appreciable quantity. Perhaps the most persuasive argument against
fibronectin contamination, however, is the fact that two of the four
monoclonal antibodies raised against tartrate-resistant acid
phosphatases also recognized human fibronectin. Interestingly, when
porcine uterine endometrium libraries were screened with anti-
uteroferrin antibodies, fibronectin clones were never obtained. In
contrast, all of the positive clones obtained by immunoscreening the
human placenta cDNA library coded for fibronectin.
When the inferred amino acid sequence of fibronectin is compared to
that of porcine uteroferrin, there are no obvious sequence similarities
over long stretches of amino acids. There are, however, several regions
of four to six amino acids which are common to both uteroferrin and
fibronectin. It is possible that as few as four amino acids define a
common epitope (see Atassi, 1976; 1983). These potential epitopes are
shown in Table 3-3. It is interesting to note that of 13 potential
epitopes, 9 of them are found in the 491 amino acid sequence coded by
clone HP 6.1, and the remaining 4 epitopes are found in the 1834 amino
acids not contained in HP 6.1.
The possibility that there is a structural feature common to both
uteroferrin and fibronectin, not apparent by comparison of primary
sequences, was examined. The domains encoded by amino acids 1709-2201

137
TABLE 3-3
Potential epitopes common to porcine uteroferrin and human flbronectin
Amino Acid Residue Numbers
Amino Acid
Sequence
Fibronectin
Uteroferrin
Fibronectin
Uteroferrin
1723-1729
274-280
VRVTPKE
veitpke
1736-1740
154-158
EINLA
ERNLA
1764-1769
136-140
LKDTLT
L DTVT
1780-1784
95-99
LENVS
LGNVS
1786-1790
298-303
PRRAR
PRRAR
1824-1828
4-8
TPIQR
TPILR
1878-1882
7-11
LRFLA
LRFVA
2064-2069
65-72
FQDTSE
FQETFE
2154-2157
11-14
AVGD
AVGD
39-42
95-98
LGNV
LGNV
32-36
151-155
QQPWR
QQPER
305-312
95-101
LGNGVSCQ
LGN VSAQ
1655-1660
213-218
TAELQG
TAYLQG
1693-1697
2-6
APTDL
APTPI

138
are made up of two types of repeats found in fibronectin. Clone HP 6.1
codes for 5 type III repeats and 2 type I repeats. This region of the
protein is known to contain the heparin binding domain (Kornblihtt et
al., 1985). The possibility that uteroferrin also contain a heparin
binding domain was considered. Uteroferrin appeared to bind to heparin-
agarose in a low salt buffer (0.01M NaCl), but could be eluted with a
buffer containing 0.25M NaCl. True heparin binding proteins, such as
the heparin-binding growth factors, elute only at very high salt
concentrations, 1.0 to 1.6M (Lobb et al., 1986). Therefore,
uteroferrin is not a true heparin binding protein, and it is not clear
why anti-uteroferrin antibodies bind to human fibronectin.
When cDNA clones coding for porcine uteroferrin were employed to
screen the same human placenta cDNA library, two cDNA clones coding for
the human tartrate-resistant acid phosphatase were obtained. One of
these clones, 6a, appears to be essentially full length. Examination of
the 5'end of the sequence of 6a reveals two potential translation
initiation sites (Fig. 3-13). The first site encountered, at
nucleotides 91-97, is TGGATGG. This site, with the preferred G at
position +4, is an initiation site of moderate strength (Kozak, 1986).
The second site, at nucleotides 97-103, is GACATGT. This site has the
preferred purine at position -3, and is also an initiation site of
moderate strength (Kozak, 1986). Most likely both sites are employed;
it cannot be assumed that initiation of translation occurs exclusively
at the first ATG encountered (M. Kozak, personal communication).
The first amino acid of the mature protein is assigned as the
aspartate residue coded by nucleotides 151-153, as predicted by Von

139
Heijne analysis (1983, 1985). The residue in position -1 (relative to
aspartate +1) is the preferred alanine, and the serine at position -3 is
the preferred small, neutral amino acid. Cleavage at this predicted
point (marked by an arrow in Fig. 3-13) would infer a signal sequence of
17-19 amino acids, depending an which initiation codon was employed.
Eukaryotic signal sequences typically range from 15-25 residues, with 19
amino acids the average length (Von Heijne, 1986). Cleavage before
aspartate +1 would also produce a mature protein in closest agreement
with the amino acid sequences of porcine uteroferrin and the bovine
spleen enzyme (Fig. 3-14). Since the N-terminal sequence of the human
tartrate-resistant acid phosphatase has not been determined, this
assignment is tentative.
The mature human Type 5, tartrate-resistant acid phosphatase most
likely consists of 304 amino acids, with an unglycosylated relative
molecular mass of 34,193. This relative molecular mass is in good
agreement with the apparent Mr of 34,000 for the mature protein, as
determined by SDS-PAGE (Chapter 2). The apparent molecular weight of
unglycosylated uteroferrin is 33,000, as measured by SDS-PAGE (Baumbach
et al., 1984).
The human enzyme contains two potential attachment sites for N-
linked oligosaccharides (boxed in Fig. 3-13). Both of these sites are
conserved in porcine uteroferrin, but only one of them is found in the
bovine spleen enzyme (Fig. 3-14). Each of these enzymes is known to be
glycosylated (see Chapters 1 and 2).
The glycosylation site at Asn 97 of uteroferrin is known to be used
in the Mr=35,000 form of the enzyme purified from allantoic fluid and

140
uterine flushes (Hunt et al., 1987). The second site, at Asn 128, may
be employed in an Mr=37,000 form of uteroferrin which can be purified
from uterine explant cultures and is found in the pink, high molecular
weight uteroferrin heterodimer (Baumbach et al., 1986; Baumbach et al.,
manuscript in preparation). The extent of glycosylation of the human
enzyme has not been determined, but the enzyme is known to be a
glycoprotein (Chapter 2).
The tartrate-resistant acid phosphatases are known to contain two
asymmetrical iron binding sites (see Chapters 1 and 2). It has been
proposed that the iron atoms in these enzymes are coordinated to
tyrosine and histidine residues (Gaber et al., 1979; Lauffer et al.,
1983). Internal repeats containing histidine and tyrosine residues in
identical spacial arrangements are not present in any of these
phosphatases, which is consistent with non-identical environments for
the iron atoms (Hunt et al., 1987). The residues that are ligands for
the iron atoms cannot be assigned at this time, since the primary
sequences of these iron-containing acid phosphatases contain several
conserved histidine and tyrosine residues.
In order to study the distribution of the human tartrate-resistant
acid phosphatase, Northern analysis was performed on three human
leukocyte cell lines. A 1.5 kb transcript coding for this enzyme was
detected in the human erythroleukemia line K562 and in the human B-cell
line 1799ZR1.3. This transcript was not apparent in the human T-cell
line JURKAT. These results are in good agreement with the work of
Drexler et al. (1985, 1986, 1987a,b), who studied levels of tartrate-
resistant acid phosphatase in a wide variety of leukemia cell lines by

141
means of isoelectric focusing. They determined that the tartrate-
resistant acid phosphatase is generally expressed only in cells arrested
late in differentiation. These researchers detected moderately high
levels of tartrate-resistant acid phosphatase in K562 cells, but the
enzyme was not detectable in JURKAT cells. Drexler et al. did not study
the B-cell line 1799ZR1.3, but since it represents a B-cell in the later
stages of differentiation (L. Smith, personal communication), it was
expected that the cells would produce the enzyme. Of five EBV-
transformed, late B-cell lines studied (the generous gift of Dr. Linda
Smith), three produced high levels of the tartrate-resistant acid
phosphatase (data not shown). These results are also in agreement with
the work of Drexler et al. (1986).
The tumor-promoting phorbol ester TPA causes permanently established
leukemia cell lines to differentiate to more mature stages (Kiss et al.,
1987; Gazitt et al., 1987; Theil et al., 1987; Koeffler et al., 1981).
The in vitro and in vivo effects of TPA are most probably mediated
through the activation of protein kinase C and subsequent
phosphorylation of cellular proteins (for a review, see Nishizuka,
1984). If expression of the tartrate-resistant acid phosphatase is
indeed a differentiation-related event, its expression may be under the
control of TPA and protein kinase C.
The effect of 10'TPA on acid phosphatase levels in K562 cells was
studied. K562 cells, unlike the closely related KG-1 cells, do not
terminally differentiate into macrophage-like cells in the presence of
TPA (Koeffler et al., 1981). Instead, they partially differentiate into
megakaryoblastoid cells (Alitalo et al., 1988). Drexler et al. (1986)

142
have demonstrated qualitatively that K562 cells show a significant
increase in tartrate-resistant acid phosphatase activity (as determined
by isoelectric focusing) when treated with TPA for 72 hours. Thus, TPA
may induce differentiation to a stage, or activation to a certain
status, where acid phosphatase levels are elevated. It has been
demonstrated in this chapter that TPA causes a marked increase in the
quantity of tartrate-resistant acid phosphatase in K562 cells, both at
the RNA and protein levels, although the effect is slow and possibly
indirect. Interestingly, Gazitt and Polliack (1987) have demonstrated
that a number of leukemia cell lines which were sensitive to the
differentiating effect of TPA could be induced to differentiate
terminally into cells reminiscent of hairy cells. They proposed that
hairy cells (which are known to contain extremely high levels of the
tartrate-resistant acid phosphatase) represent the terminally
differentiated B-cell. Leukemia can be thought of as a disorder of
differentiation. If the tartrate-resistant acid phosphatase is truly a
marker of B-cell differentiation, the study of this enzyme's function
and regulation may not only enhance our understanding of normal B-cell
differentiation, it may also help to elucidate the relationships between
the various leukemias.

CHAPTER 4
CONCLUSIONS AND FUTURE DIRECTIONS
The experiments discussed in Chapters 2 and 3 clearly demonstrate
that the human Type 5, tartrate-resistant acid phosphatase (TR-AP)
belongs to the family of purple, iron-containing acid phosphatases, best
characterized by porcine uteroferrin. In Chapter 2 a relatively simple
protocol was described for the purification of the human enzyme. This
protocol, based on the method established for the purification porcine
uteroferrin (Chen et al., 1973), was also used to purify related enzymes
from a variety of other sources. It would be interesting to determine
whether the purple, manganese-containing acid phosphatases of plants
could be purified by this method.
Much of the confusion about the properties of the human TR-AP
(discussed in Chapter 1) has been resolved by the experiments in
Chapters 2 and 3. The discrepancies about the activation of the enzyme
with 2-mercaptoethanol and about the apparent molecular weight were
adequately explained in Chapter 2. Apparently, uteroferrin and the
other TR-APs exist as equilibrium mixtures of active (reduced) and
inactive (oxidized) forms, and this equilibrium depends on the redox
state of the fluid environment in which the enzymes are found. If this
is the case, it is not surprising that the extent of activation of the
TR-AP enzymes varied so much between preparations and throughout the
purification process. It is interesting to note that while a stable,
pink, high molecular weight, fully active form of uteroferrin exists,
143

144
there is no evidence of high molecular weight, fully active TR-AP
enzymes from other sources such as rat, human or bovine spleen. The
controversy over the enzymes' apparent "subunits" (found only in some
cases) can be attributed to proteolytic degradation, since both
uteroferrin and the beef spleen enzymes are single polypeptide chains
(Hunt et al., 1987), and the human enzyme is coded for by a single mRNA
species (Chapter 3). Unfortunately, the differences in substrate
specificities between the Gaucher's spleen enzyme (Robinson and Glew,
1980; 1981) and the hairy cell spleen enzyme cannot be explained. The
possibility that there are two or more genes coding for distinct TR-APs
in the human cannot be ruled out, although chromosomal localization
studies, carried out by means of in situ hybridization, revealed that
the cDNA coding for the human placenta enzyme hybridized only to the
long arm of chromosome 15 (B. Allen, C. Ketcham, H. Nick, unpublished
results). The human bone (osteoclast) TR-AP has been purified by our
laboratory (S. Allen et al., in press), and when N-terminal amino acid
sequence is available, we will know whether the bone enzyme is identical
to the placenta enzyme described in Chapter 3.
In Chapter 2, the production of monoclonal antibodies against both
uteroferrin and the human enzyme was described. It was demonstrated
that these antibodies cross-reacted with a wide variety of purple, iron-
containing phosphatases. Furthermore, the four antibodies studied in
detail did not compete with each other for binding to porcine
uteroferrin, a result which indicated that each one recognized a
different epitope. It is probable that four unique antibody binding
sites do not represent the entire immunogenic repertoire of the native

145
uteroferrin molecule. Most likely, a mouse would not produce an
antibody against a domain that its own TR-AP possesses, although one
monoclonal antibody, 13.122, seemed to recognize a conserved epitope
found on the TR-AP isozyme (see Chapter 2). From previous experience
with a wide variety of proteins, Atassi (1976) proposed that a maximum
of one immunogenic domain exists per 50 amino acids (about 5,000
daltons). Therefore, uteroferrin, a 307 amino acid protein with an
unglycosylated apparent molecular weight of 33,000, could contain six or
seven major immunogenic domains.
One set of competing monoclonal antibodies, represented by 5.122.10,
5.127.3 and 6.37.4, recognized an epitope that may be near the active
site, since binding of the monoclonal antibody 5.127.3 inhibited
uteroferrin's enzymatic activity. Perhaps this antibody could be useful
in the identification of the peptide sequences around the active site.
While it is believed that the iron atoms may be involved in substrate
binding, and that a phosphoryl-enzyme intermediate may exist (see
Chapter 1), the amino acid residues that make up the active site are
unknown.
The monoclonal and polyclonal antibodies raised against uteroferrin
were employed for the immunocytochemical localization of the human
enzyme in placenta, bone tumors and white cells from patients with
various types of leukemia. While our laboratory had been successful in
localizing uteroferrin to the glandular epithelium in the porcine uterus
(Fazleabas et al., 1984), we were unable to localize the human enzyme
(C. Ketcham, M.K. Murray, T. Raub, R.M. Roberts, unpublished results).
We consistently detected very little immunoreactive protein in the human

146
tissues and staining often appeared non-specific or diffuse. At least
part of the problem may involve the fact that the polyclonal antibodies
and some of the monoclonal antibodies cross-react with human
fibronectin. The lack of success may also be attributed to the fact
that the antibodies have a much lower affinity for the human enzyme than
for uteroferrin.
Antibodies against the TR-APs may be useful for a number of
clinically related projects. For example, the immunocytochemical
identification of hairy cells with a polyclonal antibody raised against
the human enzyme may be more specific and more sensitive than the
histocytochemical methods now used. The antibodies may also be valuable
diagnostically in the measurement of the levels of the TR-AP isozyme in
plasma, by immunoassay. Echetebu et al. (1987) have demonstrated that
anti-uteroferrin antibodies can be employed for the measurement of TR-AP
levels in the sera of patients with Paget's disease and osteoporosis.
These researchers were also able to detect the enzyme in human lung and
Gaucher's spleen homogenates (but they could not detect the enzyme in
placenta homogenate). Susan Allen, in collaboration with R.M. Roberts,
has raised a monospecific polyclonal antibody against the human enzyme,
and plans to develop a sensitive immunoassay for the detection of TR-AP
in the sera of patients with osteoporosis.
The monoclonal antibodies were also tested as potential inhibitors
of the phosphotransferase (discussed in Chapter 1) which transfers
GlcNAc 1-phosphate to certain mannose residues of lysosomal enzymes.
Unfortunately, none of the monoclonal antibodies, when bound to
uteroferrin, were able to inhibit the phosphorylation of uteroferrin's

147
high mannose oligosaccharide chain (L. Lang, R.M. Roberts and S.
Kornfeld, unpublished results). The region of uteroferrin (or any
lysosomal enzyme) which is recognized by the phosphotransferase is still
unknown. Identification of this region will be a major contribution to
the field of lysosomal enzyme trafficking.
Despite the failure of the monoclonal antibodies to identify the
region of uteroferrin recognized by the phosphotransferase, the TR-APs
may still be useful for the study of the trafficking of lysosomal
enzymes. The lysosomal bovine spleen enzyme is very similar in sequence
to the secreted porcine uterine enzyme (Hunt et al., 1987; and Chapter
3). The most dissimilarity is noted around the N-terminal region and
the second glycosylation site. It would be interesting to compare the
sequences of cDNAs coding for the lysosomal versus secreted forms of the
TR-AP enzyme in a single species (the cow or the pig, see Chapter 2).
Perhaps the primary sequences of the secreted enzymes contain targeting
information which directs them to secretory granules despite the fact
that the phosphotransferase recognizes them as lysosomal enzymes, thus
phosphorylating their high mannose oligosaccharides. The targeting of
both secreted and lysosomal forms of TR-AP can be studied by
transfection of their respective cDNAs into mammalian cell lines. Site
directed mutagenesis can then be employed in an effort to redirect the
enzymes, thus revealing the signals necessary for differential
targeting.
An important topic which has not yet been addressed experimentally
is the function of the human TR-AP. The persuasive evidence that
uteroferrin functions in iron metabolism was presented in Chapter 1.

148
Although other functions have been proposed for other TR-APs, as a
general phosphoprotein phosphatase (Davis et al., 1981) as a specific
phosphotyrosyl phosphatase (Lau et al., 1985; 1987), or in nucleotide
metabolism (Hara et al., 1984; 1985), there is little evidence to
support these theories. Since it is believed that uteroferrin may
function in iron metabolism, Shindelmeiser et al. (1987) considered the
possibility that the bovine spleen enzyme might be involved in iron
metabolism as well. Maybe the human TR-AP is also involved in iron
metabolism. Some preliminary experiments could be done to determine
whether or not this is the case.
The ideal cell line for these studies would be the human
erythroleukemia K562 cells. Iron metabolism has been studied, to some
extent, in these cells. They are known to synthesize both ferritin
(Bottomley et al., 1985) and hemoglobin (Rutherford et al., 1979), and
they express transferrin receptors (Van Rensounde et al., 1982). As
shown in Chapter 3, these cells also express considerable amounts of
TR-AP. Bottomley et al. (1985) have demonstrated that when K562 cells
were incubated with [^Fe] transferrin, up to 30% of the label could not
be accounted for in hemoglobin, ferritin, or transferrin. Furthermore,
the [-^Fe] from transferrin appeared in ferritin at a very slow rate,
indicating that the iron taken up may have passed through one or more
intermediates. Perhaps TR-AP is one of these intermediates.
It is widely believed that iron plays a critical role in cellular
differentiation, cell growth and malignant transformation (see Gambari
et al., 1986; Petraki et al., 1986). In K562 cells, differentiating
agents caused a loss of transferrin receptors from the cell surface

149
(Petraki et al., 1986) and an increase in iron stores in ferritin
(Mattia et al., 1986). The theory that TR-AP is a marker of lymphocyte
differentiation was discussed in Chapter 3. It would be interesting to
study the effects of perturbants of iron metabolism (such as chelators)
and differentiating agents on TR-AP levels to determine whether there is
any connection between TR-AP levels, iron metabolism and the
differentiated state of the cells.
In conclusion, there is little doubt that uteroferrin and the other
TR-APs will continue to be of interest to a wide variety of researchers.
The unusual spectral properties of these proteins are currently being
studied by physical biochemists interested in metalloprotein structure.
The possible role of TR-APs in iron metabolism is presently being
investigated by at least two groups of physiologists. Other clinically
oriented laboratories are interested in the significance of TR-AP levels
in osteoporosis and other bone disorders. Cell biologists will be
interested in the differential targeting of the lysosomal versus
secreted TR-APs. The regulation of uteroferrin's biosynthesis by
steroid hormones is being studied by reproductive biologists and
molecular biologists. It is therefore likely that the cDNA coding for
the human TR-AP will be useful for future studies involving the
distribution, function and regulation of the various TR-AP enzymes.

REFERENCES
Adams, K.L., Bazer, F.W. and Roberts, R.M. (1981). Progesterone-
induced Secretion of a Retinol-Binding Protein in the Pig Uterus. J.
Reprod. Fert. 62, 39-47.
Alitalo, R., Makela, T.P. Koskinen, P., Anderson, L.C. and Alitalo, K.
(1988) . Enhanced Expression of Transforming Growth Factor B During
Megakaryoblastic Differentiation of K562 Leukemia Cells. Blood 71(4),
899-906.
Allen, S.H., Nuttleman, P.R., Ketcham, C.M. and Roberts, R.M., in press.
Purification and Properties of the Tartrate-resistant Acid Phosphatase
from Human Bone. J. Bone and Mineral Res.
Allhoff, E.P., Proppe, K.H., Chapman, C.F., Lin, C.W. and Prout, G.R.
(1983). Evaluation of Prostate Specific Acid Phosphatase and Prostate
Specific Antigen in Identification of Prostatic Cancer. J. Urol. 129,
315-318.
Anderson, T.R. and Toverud, S.V. (1986). Purification and
Characterization of Purple Acid Phosphatase from Developing Rat Bone.
Arch. Biochem. Biophys. 247(1), 131-139.
Antanaitis, B.C. and Aisen, P. (1983). Uteroferrin and the Purple Acid
Phosphatases. In: Advances in Inorganic Biochemistry, Theil, E.C.,
Eichorn G.L., and Marzilli L., eds. (Elsevier, New York) 111-136.
Antanaitis, B.C., Aisen, P. and Lilienthal, H.R. (1983). Physical
Characterization of Two-iron Uteroferrin. Evidence for a Spin-coupled
Binuclear Iron Cluster. J. Biol. Chem. 258, 3166-3172.
Antanaitis, B.C., Aisen, P. and Lilienthal, H.R., Roberts R.M. and Bazer
F.W. (1980). The Novel "g' — 1.74" EPR Spectrum of Pink and Purple
Uteroferrin. J. Biol. Chem. 255(23), 11204-11209.
Armitage, R.J., Worman C.P., Galvin, M.C. and Cawley, J.C. (1985).
Hairy Cell Leukemia with Hybrid B-T Features: A Study with a Panel of
Monoclonal Antibodies. Am. J. Hematol. 18, 335-344.
Atassi, M.Z. (1975). Antigenic Structure of Myoglobin: The Complete
Immunochemical Anatomy of a Protein and Conclusions Relating in
Antigenic Structures of Proteins. Immunochemistry 12, 423-438.
Atassi, M.Z. (1984). Antigenic Structures of Proteins. Eur. J. Biochem
145, 1-20.
150

151
Bartlett, G.R. (1959). Phosphorous Assay in Column Chromatography. J.
Biol. Chem. 234, 466-468.
Bartol, F. (1983). Ph.D. Dissertation, University of Florida,
Gainesville.
Basha, S.M.M., Bazer, F.W., Geisert, R.D. and Roberts, R.M. (1980).
Progesterone-induced Uterine Secretions in Pigs: Recovery from
Pseudopregnant and Unilaterally Pregnant Gilts. J. Anim. Sci. 50, 113-
123.
Basha, S.M.M., Bazer, F.W. and Roberts, R.M. (1979). The Secretion of a
Uterine Specific, Purple Phosphatase by Cultured Explants of Porcine
Endometrium. Dependency upon the State of Pregnancy of the Donor
Animal. Biol. Reprod. 20, 431-441.
Baumbach, G.A. (1984). Ph.D. Dissertation, University of Florida,
Gainesville.
Baumbach, G.A., Ketcham, C.M., Richardson, D.E., Bazer, F.W. and
Roberts, R.M. (1986). Isolation and Characterization of a High
Molecular Weight Stable Pink Form of Uteroferrin from the Uterine
Secretions and Allantoic Fluid of Pigs. J. Biol. Chem. 261(27), 12869-
12878.
Baumbach, G.A., Saunders, P.T.K., Bazer, F.W. and Roberts, R.M. (1984).
Uteroferrin has N-Asparagine-Linked High-Mannose-Type Oligosaccharides
that Contain Mannose 6-Phosphate. Proc. Natl. Acad. Sci. U.S.A. 81,
2985-2989.
Baumbach, G.A., Saunders, P.T.K., Ketcham, C.M., Bazer, F.W. and
Roberts, R.M. Studies on the in vitro Biosynthesis and Glycosylation of
Uteroferrin. Manuscript in preparation.
Bazer, F.W., Chen, T.T., Knight, J.W., Schlosnagle, D.C., Baldwin, N.J.
and Roberts, R.M. (1975). Presence of a Progesterone Induced, Uterine
Specific Acid Phosphatase in Allantoic Fluid of Gilts. J. Anim. Sci.
41, 1112-1119.
Bazer, F.W. and Thatcher, W.W. (1977). Theory of Maternal Recognition
of Pregnancy in Swine Based on Estrogen Controlled Endocrine Versus
Exocrine Secretion of Prostaglandins F2 « by the Uterine Endometrium.
Prostaglandins 14, 397-408.
Beck, J.L. Keough, D.T., de Jersey, J. and Zerner, B. (1984).
Enzymatically Active Zinc, Copper and Mercury Derivatives of the One-
iron Form of Pig Allantoic Acid Phosphatase. Biochim. Biophys. Acta
791, 357-363.
Bottomley, S.S., Wolfe, L.C. and Bridges, K.R. (1985). Iron Metabolism
in K562 Erythroleukemic Cells. J. Biol. Chem. 260(1), 6811-6815.

152
Bradford, M.M. (1976). A Rapid and Sensitive Method for the
Quantitation of Microgram Quantities of Protein Utilizing the Principle
of Protein-Dye Binding. Anal. Biochem. 72, 248-259.
Braidman, I.P., St. John, J.G., Anderson, D.C. and Robertson, W.R.
(1986). Effects of Physiological Concentrations of Parathyroid Hormone
on Acid Phosphatase Activity in Cultured Rat Bone Cells. J. Endocr.
Ill, 17-26.
Braylan, R.C. and Burke, J.S. (1979). Hairy Cell Leukemia. Ann. Rev.
Med. 30, 17-24.
Buhi, W.C. (1981). Further Characterization and Function of Uteroferrin
from Uterine Flushings and Allantoic Fluid of Pigs. Ph.D. Dissertation,
University of Florida, Gainesville.
Buhi, W.C., Ducsay, C.A., Bazer, F.W. and Roberts, R.M. (1982a). Iron
Transfer Between the Purple Phosphatase Uteroferrin and Transferrin and
its Possible Role in Iron Metabolism of the Fetal Pig. J. Biol. Chem.
257(4), 1712-1723.
Buhi, W.C., Gray, W.J., Mansfield, E.A., Chun, P.W., Ducsay, C.A.,
Bazer, F.W. and Roberts, R.M. (1982b). Iron Content and Molecular
Weight of Uteroferrin and Comparison of its Iron and Copper Forms.
Biochem. Biophys. Acta 701, 32-38.
Burns, J.F., Worman, C.P. and Cawley, J.C. (1980). Fluctuations in the
T and B Cell Characteristics of T-cell Hairy Cell Leukemia. Clin. Exp.
Immunol. 39, 76-82.
Cameron, B.F. (1965). Determination of Iron in Heme Compounds II,
Hemoglobin and Myoglobin. Anal. Biochem. 11, 164-169.
Campbell, H.D., Dionysius, D.A., Keough, D.T., Wilson, B.E., de Jersey,
J. and Zerner, B. (1978). Iron-containing Acid Phosphatases:
Comparison of the Enzymes for Beef Spleen and Allantoic Fluid. Biophys.
Biochem. Res. Commun. 82, 615-620.
Campbell, H.D. and Zerner, B. (1973). A Low Molecular Weight Acid
Phosphatase which Contains Iron. Biochem. Biophys. Res. Commun. 54,
1498-1503.
Chambers, T.J., Fuller, K. and Darby, J.A. (1987). Hormonal Regulation
of Acid Phosphatase Release by Osteoclasts Disaggreagated from Neonatal
Rat Bone. J. Cell. Physiol. 132, 90-96.
Chen, J., Yam, L.T., Janckila, A.J., Li, C.Y. and Lam, K.W. (1979).
Significance of "High" Acid Phosphatase Activity in the Sera of Normal
Children. Clin. Chem. 25, 719-722.

153
Chen, T.T., Bazer, F.W., Cetorelli, J.J., Pollard, W.E. and Roberts,
R.M. (1973). Purification and Properties of a Progesterone Induced
Basic Glycoprotein from the Uterine Fluid of Pigs. J. Biol. Chem.
248(24), 8560-8566.
Chomczynski, P. and Sacchi, N. (1987). Single-step Method of RNA
Isolation by Acid Guanidinium Thiocyanate-Phenol-Chloroform Extraction.
Anal. Biochem. 162, 156-159.
Choy, E.Y.M. (1985). Gaucher Disease: Comparative Study of Acid
Phosphatase and Glucocerebrosidase in Normal and Type-1 Gaucher Tissues.
Am. J. Med. Genet. 21, 519-528.
Church, G.M. and Gilbert, W. (1984). Genomic Sequencing. Proc. Natl.
Acad. Sci. U.S.A. 81, 1991-1995.
Cloe, L., McNab, A., Hubbell, H.R., Meo, P., Curtis, P. and Rovera, G.
(1981). Differential Expression of the Globin Genes in Human Leukemia
K562 (S) Cells Induced to Differentiate by Hemin or Butyric Acid.
Cancer Res. 41, 237-243.
Cuatrecacas, P., Wilchek, M. and Anfinsen, C.B. (1968). Selective
Enzyme Purification by Affinity Chromatography. Proc. Natl. Acad. Sci.
USA 61, 636-643.
Davis, J.C. and Averill, B.A. (1982). Evidence for a Spin-coupled
Binuclear Iron Unit at the Active Site of the Purple Acid Phosphatase
from Beef Spleen. Proc. Natl. Acad. Sci. USA 79, 4623-4627.
Davis, J.C., Lin, S.S., and Averill B.C. (1981). Kinetics and Optical
Spectroscopic Studies on the Purple Acid Phosphatase from Beef Spleen.
Biochemistry 20, 4062--4067.
Dayhoff, M.O. (1972). Atlas of Protein Sequence and Structure. Natl.
Biomed. Res. Found., Washington, D.C.
Debranner, P.G., Hendrich, M.P., DeJersey, J., Keough, D.T., Sage, T.
and Zerner, B. (1983). Mossbauer and EPR Study of the Binuclear Iron
Centre in Purple Acid Phosphatase. Biochim. Biophys. Acta 745, 103-106.
de Wet, J.R., Fukushima, H., Dejwi, N.N., Wilcox, E., O'Brien, J.S. and
Helsinki, D.R. (1984). Chromogenic Immunogenic Immunodetection of Human
Serum Albumin and oc-L-Fucosidase in a Human Hepatoma cDNA Expression
Library. DNA 3(6), 437-447.
Dixon, S.W. and Gibbons, R.A., (1979). Proteins in the Uterine
Secretions of the Cow. J. Reprod. Fert. 56, 119-127.
Drexler, H.G. and Gaedicke, G. (1983). Analysis of Isoenzyme Patterns
of Acid Phosphatase in Acute Leukemias. Blut 47, 105-113.

154
Drexler, H.G., Gaedicke, G. and Minowada, J. (1985). Isoenzyme Studies
in Human Leukemia-Lymphoma Cell Lines. II. Acid phosphatase. Leuk.
Res. 9(5), 537-548.
Drexler, H.G., Gaedicke, G. and Minowada, J. (1986). Occurence of
Particular Isozymes in Fresh and Cultured Leukemia-lymphoma Cells. I.
Tartrate-resistant Acid Phosphatase Isozyme. Cancer 57, 1776-1782.
Drexler, H.G., Gaedicke, G. and Minowada, J. (1987a). T-cell Leukemia
Lines CCRF-CEM, HPB-All, JM and MOLT-4: Changes in Isoenzyme Profiles
During Induction of Differentiation. Blut 54, 79-87.
Drexler, H.G., Menon, M., Gaedicke, G. and Minowada, J. (1987b).
Expression of FMC7 Antigen and Tartrate-resistant Acid Phosphatase
Isoenzyme in Cases of B-lymphoproliferative Diseases. Eur. J. Cancer
Clin. Oncol. 23(1), 61-68.
Ducsay, C.A., Buhi, W.C., Bazer, F.W. and Roberts, R.M. (1982). Role of
Uteroferrin in Iron Transport and Macromolecular Uptake by Allantoic
Epithelium of the Procine Conceptus. Biol. Reprod. 26, 729-743.
Ducsay, C.A., Buhi, W.C., Bazer, F.W., Roberts, R.M. and Combs, G.E.
(1984). Role of Uteroferrin in Placental Iron Transport. II. Effect of
Maternal Iron Treatment on Fetal Iron and Uteroferrin Content and
Neonatal Hemoglobin. J. Anim. Sci. 54, 1303-1308.
Echetebu, Z.O., Cox, T.M. and Moss, D.W. (1987). Antibodies to Porcine
Uteroferrin Used in Measurement of Human Tartrate-resistant Acid
Phosphatase. Clin. Chem. 33(10), 1832-1836.
Efstratiadis, T. and Moss, D.W. (1985). Tartrate-resistant Acid
Phosphatase of Human Lung: Apparent Identity with Osteoclastic Acid
Phosphatase. Enzyme 33, 34-40.
Fazleabas, A.T., Bazer, F.W., Hansen, P.J., Geisert, R.D. and Roberts,
R.M. (1984). Differential Patterns of Secretory Protein Localization
Within the Pig Uterine Endometrium in Response to Progesterone.
Endocrinology 116, 240-245.
Fazleabas, A.T., Bazer, F.W. and Roberts, R.M. (1982). Purification and
Properties of a Progesterone-induced Plasmin/Trypsin Inhibitor from
Uterine Secretions of Pigs and Its Immunocytochemical Localization in
the Pregnant Uterus. J. Biol. Chem. 257, 6886-6897.
Feinberg, A.P. and Vogelstein, B. (1983). A Technique for Radiolabeling
DNA Restriction Endonuclease Fragments to High Specific Activity. Anal.
Biochem. 132, 6-13.
Feldman, F. and Butler, L.G. (1969). Detection and Characterization of
the Phosphorylated form of Microsomal Glucose 6-Phosphatase. Biochem.
Biophys. Res. Comm. 36, 119-125.

155
Frank, M., Bazer, F.W., Thatcher, W.W. and Wilcox, C.J. (1978). A Study
of Prostaglandin F2 « as the Luteolysin in Swine: IV. An Explanation
for the Luteotrophic Effect of Estradiol. Prostaglandins 15, 151-160.
Gaber, B.D., Sheridan, J.P., Bazer, F.W. and Roberts, R.M. (1979).
Resonance Raman Scattering from Uteroferrin, the Purple Glycoprotein of
the Porcine Uterus. J. Biol. Chem. 254, 8340-8342.
Gambari, R., Barbieri, R., Buzzoni, D., Bernardi, F., Marchetti, G.,
Amelotti, F., Piva, R., Viola, L. and del Senno, L. (1986). Human
Leukemic K562 Cells: Suppression of Hemoglobin Accumulation by a
Monoclonal Antibody to Human Transferrin Receptor. Biochimica et
Biophysica Acta 203-213.
Gazitt, Y. and Polliack, A. (1987). Phorbol Ester Induction of
Plasmacytoid and Hairy Cell Leukemia Features in B-type Lymphocytic
Leukemias: The Relation to B-cell Differentiation and Maturation.
Blood Cells 12, 413-436.
Glomset, J. and Porath, J. (1960). Some Properties of a Phosphatase
from Bovine Spleen. Biochim. Biophys. Acta 39, 1-8.
Goldberg, D.E. and Kornfeld, S. (1983). Evidence for Extensive
Subcellular Organization of Asparagine-linked Oligosaccharide Processing
and Lysosomal Enzyme Phosphorylation. J. Biol. Chem. 258, 3159-3165.
Goldstein, I.J., Hollerman, C.E. and Smith, E.E. (1965). Protein-
Carbohydrate Interaction. II. Inhibition Studies on the Interaction of
Concanavalin A with Polysaccharides. Biochemistry 4, 876-883.
Gunning, P., Ponte, P., Okayama, H., Engel, J., Blau, H. and Kedes, L.
(1983). Isolation and Characterization of Full-length cDNA Clones for
Human oc-, and r-actin mRNAs: Skeletal but not Cytoplasmic Actins
have an Amino-terminal Cysteine that is Subsequently Removed. Mol.
Cell. Biol. 3, 787-795.
Gutman, E.B., Spoul, E.E. and Gutman, A.B. (1936). Significance of
Increased Phosphatase Acitvity of Bone at the Site of Osteoplastic
Metastases Secondary to Carcinoma of the Prostate Gland. Am. J. Cancer
28, 485-495.
Hanahan, D. (1983). Studies on Transformation of E. Coli with Plasmids.
J. Mol. Biol. 166, 557-580.
Hara, A., Kato, T., Sawada, H., Fukuyama, K. and Epstein, W.L. (1985).
Characterization of Fe^+-activated Acid Phosphatase in Rat Epidermis.
Comp. Biochem. Physiol. 82B(2), 269-274.
Hara, A., Sawada, H., Kato, T., Nakayama, T., Yamamoto, H. and
Matsumoto, Y. (1984). Purification and Characterization of a Purple
Acid Phosphatase from Rat Spleen. J. Biochem. 95, 67-74.

156
Herbert, W.J. (1973). Mineral Oil Adjuvants and the Immunization of
Laboratory Animals. In: Handbook of Experimental Immunology, ed.
Weir, D.M. (Scientific Publications, Oxford) Vol. Ill, A3.l-A3.15.
Hickey, M.E. and Van Etten, R.L. (1972). Stoichiometric Trapping of a
Covalent Phosphoryl-enzyme Intermediate Occuring in Reactions Catalyzed
by an Acid Phosphatase. Arch. Biochem. Biophys. 152, 423-425.
Hoflack, B., Fujimoto, K. and Korfeld, S. (1987). The Interaction of
Phosphorylated Oligosaccharides and Lysosomal Enzymes with Bovine Liver
Cation-dependent Mannose 6-Phosphate Receptor. J. Biol. Chem. 262, 123-
129.
Hunt, D.F., Yates, J.R., Shabanowitz, J., Zhu, N.-Z., Zirino, T.,
Averill, B.A., Durat,-Larroque, S.T., Shewale, J.G., Roberts, R.M. and
Brew, K. (1987). Sequence Homology in the Metalloproteins; Purple Acid
Phosphatase from Beef Spleen and Uteroferrin from Porcine Uterus.
Biochem. Biophys. Res. Comm. 144(3), 1154-1160.
Huynh, T.V., Young, R.A. and Davis, R.W. (1984). Constructing and
Screening cDNA Libraries in Lambda gtlO and Lambda gtll. In: DNA
Cloning Techniques: A Practical Approach, ed. David Glover (IRL Press,
Oxford).
Igarashi, M., Takahashi, H. and Tsuyama, N. (1970). Acid Phosphatase
from Rat Liver, Studies on the Active Center. Biochim. Biophys. Acta.
220, 85-92.
Ish-Horowicz and Burke (1981). Rapid and Efficient Cosmid Cloning.
Nucl. Acids Res. 9, 2989-2998.
Janckila, A.J., Li, C.-Y., Lam, K.W. and Yam, L.T. (1978). The
Cytochemistry of Tartrate-resistant Acid Phosphatase. I. Technical
Considerations. Amer. J. Clin. Pathol. 70, 45-55.
Jansen, J., Schuit, H.R.E., Van Zwet, T.L., Leijer, C.J.L.M. and
Hijmans, W. (1979). Hairy Cell Leukemia. A B-Lymophocytic Disorder.
Br. J. Haematol. 42, 21-33.
Kato, T., Hara, A., Nakayana, T., Sawada, H., Hamatake, M. and
Matsumoto, Y. (1986). Purification and Characterization of Purple Acid
Phosphatase from Rat Bone. Comp. Biochem. Physiol. 83B(4), 813-817.
Katzmann, J.A., Nesheim, M.E., Hibbard, L.S. and Mann, K.G. (1981).
Isolation of Functional Human Coagulation Factor V by using a Hybridoma
Antibody. Proc. Natl. Acad. Sci. USA 78, 162-166.
Kawabe, H., Sugiura, Y., Terauchi, S.M. and Tanaka, H. (1984).
Properties of Fe(III)-Substituted Enzyme and Function of Mn(II) and
Fe(III) in Plant and Mammallian Acid Phosphatase. Biochim. Biophys.
Acta. 784, 81-89.

157
Kennet, R.H., McKearn, T.J. and Bechtol, B. (1980). Monoclonal
Antibodies. (Plenum Press, New York).
Kiss, Z., Deli, E., Vogler, W.R. and Kuo, J.F. (1987). Antileukemic
Agent Alkyllysophospholipid Regulates Phosphorylation of Distinct
Proteins in HL60 and K562 Cells and Differentiation of HL60 Cells
Promoted by Phorbol Ester. Biochem. Biophys. Res. Comm. 142(3), 661-
666.
Knight, J.W., Bazer, F.W. and Wallace, H.D. (1973). Effects of
Superovulation and Unilateral Ovariectomy-Hystorectomy on Porcine
Uterine Protein Secretions. J. Anim. Sci. 36, 61-65.
Knight, J.W., Bazer, F.W., Wallace, H.D. and Wilcox, C.J. (1974). Dose-
Response Relationships Between Exogenous Progestrone and Estadiol and
Porcine Uterine Protein Secretions. J. Anim. Sci. 39, 747-751.
Koeffler, F.P., Bar-Eli, M. and Territo, M. (1981). Phorbol Ester
Effect on Differentiation of Human Myeloid Leukemia Cell Lines Blocked
at Different Stages of Differentiation. Cancer Res. 41, 919-926.
Kohler, G. and Milstein, G. (1975). Continous Cultures of Fused Cells
Secreting Antibody of Predifined Specificity. Nature 256, 495-497.
Kornblihtt, A.R., Umezawa, K., Vibe-Pedersen, K. and Baralle, F.E.
(1985). Primary Structure of Human Fibronectin: Differential Splicing
May Generate at Least 10 Polypeptides form a Single Gene. EMBO J. 4(7),
1755-1759.
Kornblihtt, A.R., Vibe-Pedersen, K. and Baralle, F.E. (1984). Human
Fibronectin: Cell Specific Alternative mRNA Splicing Generates
Polypeptide Chains Differing in the Number of Internal Repeats. Nuc.
Acids Res. 12(14), 5853-5868.
Kozak, M. (1986). Point Mutations Define a Sequence Clanking the AUG
Initiator Codon that Modulates Translation by Eukaryotic Ribosomes.
Cell 44, 283-292.
Laemmli, U.K. (1970). Cleavage of Structural Proteins during the
Assembly of the Head of Bacteriophage T4. Nature (London) 227, 680-685.
Lam, K.W., Dannaher, C., Letchford, S., Eastlund, T., Li, C.Y. and Yam,
L.T. (1984). Tartrate-resistant Acid Phosphatase in Serum of Cancer
Patients. Clin.Chem. 30(3), 457-459.
Lam. K.W., Dekker, P.T., Castleman, J. and Yam, L.T. (1976). Studies of
Intracellular Distribution of Acid Phosphatase 5 in the Spleen Cells of
Leukemic Reticuloendotheliosis by Isopycnic Gradient Centrifugation.
Clin. Chim. Acta. 70, 289-295.

158
Lam. K.W., Eastlund, T., Li, C.Y. and Yam, L.T. (1978). Biochemical
Properties of Tartrate-resistant Acid Phosphatase in Serum of Adults and
Children. Clin. Chem. 24, 1105-1108.
Lam, K.W., Li, 0., Li, C.Y. and Yam, L.T. (1973). Biochemical
Properties of Human Prostatic Acid Phosphatase. Clin. Chem. 19(5), 483-
487.
Lam, K.W., Li, C.Y., Yam, L.T. and Desnick, R.J. (1981). Resistant Acid
Phosphatase in Gaucher's Disease and Leukemia Reticoloendotheliosis.
Clin. Biochem. 14, 177-181.
Lam, K.W. and Yam, L.T. (1977). Biochemical Characterization of the
Tartrate-resistant Acid Phosphatase of Human Spleen with Leukemic
Reticuloendotheliosis as a Pyrophosphatase. Clin. Chem. 23(1), 89-94.
Lam, K.W., Yam, L.T., Wilbur, H.T., Taft, E. and Li, C.Y. (1979).
Comparison of Acid Phosphatase Isozymes of Human Seminal Fluid Prostate
and Leukocytes. Clin. Chem. 25, 1285-1289.
Lang, L., Reitman, M., Tang, J., Roberts, R.M. and Kornfeld, S. (1984).
Lysosomal Enzyme Phosphorylation. Recognition of a Protein-dependent
Determinant Allows Specific Phorphorylation of Oligosaccharides Present
on Lysosomal Enzymes. J. Biol. Chem. 259, 14663-14671.
Lau, K.-H.W., Farley, J.R. and Baylink, D.J. (1985). Phosphotyrosyl-
specific Protein Phosphatase Activity of a Bovine Skeletal Acid
Phosphatase Isoenzyme. J. Biol. Chem. 260(8), 4653-4660, 1985.
Lau, K.-H.W., Freeman, T.K. and Baylink, D.J. (1987). Purification and
Characterization of an Acid Phosphatase that Displays Phosphotyrosyl-
protein Phosphatase Activity from Bovine Cortical Bone Matrix. J. Biol.
Chem. 262(3), 1389-1397.
Lauffer, R.B.N., Antanaitis, B.C., Aisen, P. and Que, L. (1983). ^H NMR
Studies on Porcine Uteroferrin. Magnetic Interactions and Active Site
Structure. J. Biol. Chem. 258, 14212-14218.
Lehrach, H., Diamond, D., Wozney, J.M. and Boedtker, H., (1977). RNA
Molecular Weight Determinations under Denaturing Conditions, a Critical
Reexamination. Biochemistry 16, 4743-4751.
Levine, D., Reid, T. and Wilson, I. (1969). The Free Energy of
Hydrolysis of the Phosphoryl-enzyme Intermediate in Allealine
Phosphatase Catalyzed Reactions. Biochemistry 8, 2374-2380.
Li, C.Y., Chuda, R.A., Lam, K.W. and Yam, L.T. (1973). Acid
Phosphatases in Human Plasma. J. Lab. Clin. Med. 82(3), 446-460.
Li, C.Y., Yam, L.T. and Lam, K.W. (1970). Acid Phosphatase Isoenzyme in
Human Leukocytes in Normal and Pathologic Conditions. J. Histochem.
Cytochem. 19(7), 473-481.

159
Littlefield, J.W. (1964). Selection of Hybrids from Matings of
Fibroblasts in vitro and their Presumed Recombinants. Science 145, 709-
710.
Lobb, R.R., Harper, J.W. and Fett, J.W. (1986). Purification of
Heparin-Binding Growth Factors. Anal. Biochem. 154, 1-14.
Lowry, O.H., Rosebrough, N.J., Farr, A.L. and Randall, P.J. (1951).
Protein Measurement with the Folin Phenol Reagent. J. Biol. Chem. 193,
265-275.
Lozzio, C.B. and Lozzio, B.B. (1979). Human Chronic Myelogenous
Leukemia Cell Line with Positive Philadelphia Chromosome. Blood 45,
321-334.
Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982). In: Molecular
Cloning, a Laboratory Manual. (Cold Spring Harbor Laboratory, Cold
Spring Harbor, New York).
Markwell, M.A.K. and Fox, c.F. (1978). Surface-specific Iodination of
Membrane Proteins of Viruses and Eucaryotic Cells Using 1, 3, 4, 6-
Tetrachloro-3a, 6oc-diphenylglycouril. Biochemistry 17, 4807-4817.
Mattia, E. Josic, D., Ashwell, G., Klausner, R. and Van Renswoude, J.
(1986). Regulation of Intracellular Iron Distribution in K562 Human
Erythroleukemia Cells. J. Biol. Chem. 261(10), 4587-4593.
McDowell, K.J., Sharp, D.C., Fazleabas, A., Roberts, R.M. and Bazer,
F.W. (1982). Partial Characterization of the Equine Uteroferrin-like
Protein. J. Reprod. Fert., Suppl. 32, 329-334.
Messing, J. (1983). New M13 Vectors for Cloning. Methods Enzymol. 101,
20-78.
Messing, J., Gronenborn, B., Muller-Hill, B. and Hofschneider, P.H.
(1977). Filamentous Coliphage M13 as a Cloning Vehicle: Insertion of a
Hind III Fragment of the Lac Regulatory Region in M13 Replicative form
in vitro. Proc. Nat'l. Acad. Sci. USA 74(9), 3642-3646.
Millan, J.L. (1986). Molecular Cloning and Sequence Analysis of Human
Placental Alkaline Phosphatase. J. Biol. Chem. 261(7), 3112-3115.
Miller, S.C. (1985). The Rapid Appearance of Acid Phosphatase Activity
at the Developing Ruffled Boarder of Parathyroid Hormone Activated
Medullary Bone Osteoclasts. Calcif. Tissue Int. 37, 526-529.
Minkin, C. (1982). Bone Acid Phosphatase: Tartrate-resistant Acid
Phosphatase as a Marker of Osteoclast Function. Calcif, Tissue Int. 34,
285-290.
«

160
Mockler, G.M., de Jersey, J., Zerner, B., O'Connor, C.J. and Sinn, E.
(1983). Active Site of Allantoic Purple Acid Phosphatase and a Model
Complex for Strongly coupled Di-iron Sites. J. Am. Chem. Soc. 105,
1981-1983.
Mullins, D.E., Bazer, F.W. and Roberts, R.M. (1980). Secretion of a
Progesterone-induced Inhibitor of Plasminogen Activator by the Porcine
Uterus. Cell 20, 865-872.
Murray, F.A., Bazer, F.W., Wallace, H.D. and Warnick, A.C. (1972).
Quantitative and Qualitative Variation in the Secretion of Protein by
the Porcine Uterus During the Estrous Cycle. Biol. Reprod. 7, 314-320.
Nagasawa, K., Howatson, A. and Mak, T.W. (1981). Induction of Human
Malignant T-Lymphoblastic Cell Lines MOLT-3 and Jurkat by 12-0-
tetradecanoyl-phorbol 13-acetate: Biochemical, Physical and
Morphological Characterization. J. Cell. Physiol. 109, 181-192.
Nanba, K., Jaffee, E.S., Shoban, E.J., Braylan, R.C. and Berard, C.W.
(1977). Hairy Cell Leukemia. Cancer 39(6), 2323-2336.
Nishizuka, Y. (1984). The Role of Protein Kinase C in Cell Surface
Signal Transduction and Tumor Promotion. Nature 308, 693-698.
Oi, V. and Herzenberg, L.A. (1980). In: Selected Methods In Cellular
Immunology, Mishell, B.B. and Shiigi, S.M., eds. (W.H. Freeman and Co.,
San Francisco), 351-372.
Okayama, H. and Berg, P. (1983). A cDNA Cloning Vector that Permits
Expression of cDNA Inserts in Mammalian Cells. Mol. Cell. Biol. 3, 280-
289.
Petraki, H., Ioannides, C.G., Filli, S. Papamichal, M. (1986). Loss and
Reappearance of Transferrin Receptors in Human Leukemic Cell Lines.
Exptl. Cell Biol. 54, 80-88.
Pieters, R. and Veerman, A.J.P. (1987). Prognostic Significance of Acid
Alpha-naphthyl Acetate Esterase and Acid Phosphatase in Childhood Acute
Lymphoblastic Leukemia. Leuk. Res. 11(11), 995-999.
Ponte, P., Ng, S.Y., Engel, J., Gunning, P. and Kedes, L. (1984).
Evolutionary Conservation in the Untranslated Regions of Actin mRNAs:
DNA Sequence of a Human Beta-actin cDNA. Nucl. Acids Res. 12 (3), 1687-
1696.
Porzsolt, F. (1986). Report on the Second International Conference on
Hairy Cell Leukemia. Blut 53, 443-445.
Reisfeld, R.D., Lewis, V.J. and Williams, D.E. (1962). Disc
Electrophoresis of Basic Proteins and Peptides on Polyacrylamide Gels.
Nature 195, 281-283.

161
Renegar, R.H., Bazer, F.W. and Roberts, R.M. (1982). Placental
Transport and Distribution of Uteroferrin in the Fetal Pig. Biol.
Reprod. 27, 1247-1260.
Revel, H.R. and Racker, E. (1960). Studies on a Phosphoprotein
Phosphatase Derived from Beef Spleen. Biochim. Biophys. Acta 43, 465-
467.
Roberts, R.M., Baumbach, G.A., Saunders, P.T.K., Raub, T.J., Renegar,
R.H. Bazer, F.W. (1986a). Possible Function of Carbohydrate on
Glycoproteins Secreted by the Pig Uterus During Pregnancy. Mol. Cell.
Biochem. 72, 67-79.
Roberts, R.M. and Bazer, F.W. (1976). Phosphoprotein Phosphatase
Activity of the Progesterone-induced Purple Glycoprotein of the Porcine
Uterus. Biochem. Biophys. Res. Commun. 68(2), 450-455.
Roberts, R.M. and Bazer, F.W. (1980). The Properties, Function and
Hormonal Control of Uteroferrin, the Purple Protein of the Pig Uterus.
In: Steroid Induced Proteins, Beato, M., ed. (Amsterdam, Elsevier-
North Holland) 133-149.
Roberts, R.M. and Bazer, F.W. (1985). Uteroferrin: A Protein in Search
of a Function. BioEssays 1(1), 8-11.
Roberts, R.M. and Bazer, F.W. (1988). The Functions of Uterine
Secretions. J. Reprod. Fert. 82, 875-892.
Roberts, R.M., Bazer, F.W., Baldwin, N. and Pollard, W.E. (1976).
Progesterone Induction of Lysozyme and Peptidase Activities in the
Porcine Uterus. Arch. Biochem. Biophys. 177, 499-507.
Roberts, R.M., Raub, T.J. and Bazer, F.W. (1986b). Rode of Uteroferrin
in Transplacental Iron Transport in the Pig. Federation Proc. 45, 2513-
2518.
Robinson, D.B. and Glew, R.H. (1980). A Tartrate-resistant Acid
Phosphatase from Gaucher Spleen. J. Biol. Chem. 255(12), 5864-5870.
Robinson, D.B. and Glew, R.H. (1981). Substrate Specificity of Gaucher
Spleen Phosphoprotein Phosphatase. Arch. Biochem. Biophys. 210, 186-
199.
Robinson, D.F.S., Posner, D.N., Zola, H. and Catovsky, D. (1985).
Normal Counterparts of Hairy Cells and B-prolymphocytes in the
Peripheral Blood. An Ultrastructural Study with Monoclonal Antibodies
and the Immunogold Method. Leuk. Res. 9, 335-348.
Rozenszajn, L.A., Gutman, A., Radnay, J., Ben David, E. and Shoham, D.
(1976). A Study of the Nature of "Hairy" Cells with Emphasis on
Enzymatic Markers. Am. J. Clin. Pathol. 66, 432-441.

162
Rutherford, T.R., Clegg, J.B. and Weatherall, D.J. (1979). K562 Human
Leukemic Cells Synthesize Embryonic Haemoglobin in Response to Haemin.
Nature 280, 164-165.
Rutherford, T.R. and Weatherall, D.J. (1979). Deficient Heme Synthesis
as the Cause of Noninducibility of Hemoglobin Synthesis in a Friend
Erythroleukemia Cell Line. Cell 16, 415-423.
Sanger, F., Nicklen, S. and Coulson, A.R. (1977). DNA Sequencing with
Chain Terminating Inhibitors. Proc. Natl. Acad. Sci. U.S.A. 74(12),
5463-5467.
Saunders, P.T.K., Renegar, R.H., Raub, T.J., Baumbach, G.A., Atkinson,
P.H., Bazer, F.W. and Roberts, R.M. (1985). The Carbohydrate Structure
of Porcine Uteroferrin and the Role of High Mannose Chains in Promoting
Uptake by the Reticuloendothelial Cells of the Fetal Liver. J. Biol.
Chem. 260, 160-164.
Scatchard, G. (1949). The Attractions of Proteins for Small Molecules
and Ions. Ann. N.Y. Acad. Sci. 51, 660-668.
Schindelmeiser, J., Munstermann, D. and Witzel, H. (1987).
Histochemical Investigations on the Localization of the Purple Acid
Phosphatase in the Bovine Spleen. Histochemistry 87, 13-19.
Schlosnagle, D.C., Bazer, F.W., Tsibris, J.C.M. and Roberts, R.M.
(1974). An Iron-containing Phosphatase Induced by Progesterone in the
Uterine Fluid of Pigs. J. Biol. Chem. 240(23), 7574-7579.
Schlosnagle, D.C., Sander, E.C., Bazer, F.W. and Roberts R.M. (1976).
Requirement of an Essential Thiol Group and Ferric Iron for the Activity
of the Progesterone-induced Porcine Uterine Purple Phosphatase. J.
Biol. Chem. 251(5), 4680-4685.
Schulman, U., Wilder, C.D. and Kohler, G. (1978). A Better Cell Line
for Making Hybridomas Secreting Specific Antibodies. Nature 276, 269-
270.
Shephard, V. , Schlesinger, P. and Stahl, P. (1983). Receptors for
Lysosomal Enzymes and Glycoproteins. Curr. Topics Membrane Transport
18, 317-338.
Simmen, R.C.M., Baumbach, G.A. and Roberts, R.M. (1988). Molecular
Cloning and Temporal Expression During Pregnancy of the Messenger
Ribonucleic Acid Encoding Uteroferrin, a Progesterone-induced Uterine
Secretory Protein. Mol. Endocrinol. 2(3), 253-262.
Smith, L.J., Braylan, R.C., Edmundson, K.B., Nutkis, J.E. and Wakeland,
E.K. (1987). In vitro Transformation of Human B-cell Follicular
Lymphoma Cells by Epstein-Barr Virus. Cancer. Res. 47, 2062-2066.

163
Southern, E. (1975). Detection of Specific Sequences among DNA
Fragments Separated by Gel Electrophoresis. J. Mol. Biol. 98, 503-517.
Stepan, J., Silinkova-Maikova, E., Havrarek, T., Formankova, J.,
Zichova, M., Lachmanova, J., Strakova, M., Brovlik, P. and Pacovsky, V.
(1983). Relationship of Plasma Tartrate-resistant Acid Phosphatase to
the Bone Isoenzyme of Serum Alkaline Phosphatase in Hyperparathyroidism.
Clin Chim. Acta 133, 189-200.
Tavassoli, M., Rizo, M. and Yam, L.T. (1980). Elevation of Serum Acid
Phosphatase in Cancers with Bone Metastesis. Cancer 45, 2400-2403.
Thiel, E., Pachmann, K., Dorken, B., Gaedicke, G. and Zeigler-Heitbrock,
H.W.L. (1987). Phenotypic Modulation of Chronic Lymphocytic,
Prolymphocytic, and Lymphoplasmacytic Leukemia Cells by TPA: Induction
of TRAP Isoenzyme 5 and HD6 (CD22) Antigen and Enhancement of IgM
Messenger RNA. Blood Cells 12, 365-383.
Thomas, P.S. (1980). Hybridization of Denatured RNA and Small DNA
Fragments Transferred to Nitrocellulose. Proc. Natl. Acad. Sci. U.S.A.
77(9), 5201-5205.
Troy, K., Cuttner, J., Reilly, M., Grabowski, G. and Desnick, R. (1985).
Tartrate-resistant Acid Phosphatase Staining of Monocytes in Gaucher
Disease. Amer. J. Hematol. 19, 237-244.
Tsu, T.T. and Herzenberg, L.A. (1980). In: Selected Methods in
Cellular Immunology (Mishell, B.B. and Shiigi, S.M., eds.) W.H. Freeman
& Co., San Francisco, pp. 373-397.
van den Oord, J.J., de Wolf-Peeters, C. and Desmet, V.J. (1985). Hairy
Cell Leukemia: A B Lymphocytic Disorder Derived from Splenic Marginal
Zone Lymphocytes? Blut 50, 191-194.
Van Renswoude, J., Bridges, K.R., Harford, J.B. and Klausner, R.D.
(1982). Receptor-mediated Endocytosis of Transferrin and the Uptake of
Fe in K562 Cells: Identification of a Non-Lysosomal Acidic Compartment.
Proc. Natl. Acad. Sci. U.S.A. 79, 6186-6190.
Von Heijne, G. (1983). Patterns of Amino Acids Near Signal-sequence
Cleavage Sites. Eur. J. Biochem. 133, 17-21.
Von Heijne, G. (1985). Signal Sequences. The Limits of Variation. J.
Mol. Biol. 184, 99-105.
Von Heijne, G. (1986). A New Method for Producting Signal Sequence
Cleavage Sites. Nuc. Acids Res. 14(11), 4683-4690.
Weiner, R.S., Richman, C.M. and Yankee, R.A. (1979). Dilution
Techniques for Optimum Recovery of Cryopreserved Bone Marrow Cells.
Exptl. Hematol. 7(Suppl.5), 1-6.

164
Woman, C.P., Brooks, D.A. , Hogg, N. , Zola, H. , Beverly, P.C.L. and
Cawley, J.C. (1983). The Nature of Hairy Cells - A Study with a Panel
of Monoclonal Antibodies. Scand. J. Hematol. 30, 223-226.
Yam, L.T., Janckila, A.J., Li, C.Y., and Lam, W.K.W. (1987).
Cytochemistry of Tartrate-resistant Acid Phosphatases: 15 Years
Experience. Leukemia 1(4), 285-288.
Yam, L.T., Li, C.Y. and Lam, K.W. (1971). Tartrate-resistant Acid
Phosphatase Isoenzyme in the Reticulum Cells of Leukemic
Reticuloendotheliosis. New Eng. J. Med. 284(7), 357-360.
Yam, L.T., Winkler, C.F., Janckila, A.J., Li, C.Y. and Lam, K.W. (1983).
Prostatic Cancer Presenting as Metastatic Adenocarcinoma of Undetermined
Origin. Immunodiagnosis by Prostatic Acid Phosphatase. Cancer 51, 283-
287.
Yeh, L.-C.C., Lee, A.J., Lee, N.E., Lam, K.-W. and Lee, J.C. (1987).
Molecular Cloning of cDNA for Human Prostatic Acid Phosphatase. Gene
60, 191-196.
Young, R.A. and Davis, R.W. (1983a). Efficient Isolation of Genes Using
Anitbody Probes. Proc. Nat'l. Acad. Sci. USA 80, 1194-1198.
Young, R.A. and Davis, R.W. (1983b). Yeast RNA Polymerase II Genes:
Isolation with Antibody Probes. Science 222, 778-780.
Zavy, M.T., Bazer, F.W., Sharp, D.C. and Wilcox, C.J. (1979). Uterine
Luminal Proteins in the Cycling Mare. Biol. Reprod. 20, 689-698.

BIOGRAPHICAL SKETCH
Catherine Mary Scopa was born on April 23, 1959, in Patchogue, New
York. She is the fourth of the six children of Alfred and Antoinette
Scopa. She grew up in nearby Port Jefferson, New York, where she
attended a parochial elementary school and graduated from Earl L.
Vandermuelen High School in 1977. Catherine attended Long Island
University in Southampton, New York, and received a Bachelor of Arts
degree in biology in 1981.
Later that year, she married Glenn Ketcham of Woodstock, New York.
They moved to Gainesville, Florida, where Glenn pursued a graduate
degree at the University of Florida, and Catherine obtained a technical
position in the laboratory of Dr. R. Michael Roberts in the Department
of Biochemistry and Molecular Biology.
In 1985, Catherine began her graduate studies under the supervision
of Dr. Roberts. When Dr. Roberts left for the University of Missouri,
Catherine completed her work in the laboratory of Dr. Harry S. Nick.
After Catherine completes the requirements for the Ph.D. degree,
Catherine and Glenn will move to St. Louis, where Catherine will be a
postdoctoral associate in the laboratory of Dr. Stuart Kornfeld at
Washington University School of Medicine.
165

I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is fully
adequate, in scope and quality, as a dissertation for the degree of
Doctor of Philosophy.
R. Michael Roberts, Chairman
Professor of Biochemistry and
Molecular Biology
I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is fully
adequate, in scope and quality, as a dissertation for the degree of
Doctor of Philosophy.
Harry S./lUck, Cochairman
Assistant Professor of Biochemistry
and Molecular Biology
I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is fully
adequate, in scope and quality, as a dissertation for the degree of
Doctor of Philosophy.
/J-
Professor of Animal Science
'uller W. Bazer
1 certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is fully
adequate, in scope and quality, as a dissertation for the degree of
Doctor of Philosophy.
/~\
j-zLv \. li\1 /V1,0
Peter M. McGuire
Assistant Professor of Biochemistry
and Molecular Biology
I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is fully
adequate, in scope and quality, as a dissertation for the degree of
Doctor of Philosophy.
Daniel L. Purich
Professor & Chairman of Biochemistry
and Molecular Biology

I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is fully
adequate, in scope and quality, as a dissertation for the degree of
Doctor of Philosophy.
Micr
Ass
and Molecular Biology
hemistry
This dissertation was submitted to the Graduate Faculty of the
College of Medicine and to the Graduate School and was accepted as
partial fulfillment of the requirements for the degree of Doctor of
Philosophy.
August, 1988
Dean, College of Medicine

UNIVERSITY OF FLORIDA
3 1262 08554 3915




PAGE 1

7+( +80$1 7<3( 7$575$7(5(6,67$17 $&,' 3+263+$7$6( 385,),&$7,21 &+$5$&7(5,=$7,21 $1' 02/(&8/$5 &/21,1* %\ &$7+(5,1( 0$5< .(7&+$0 $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

$&.12:/('*0(176 0\ VLQFHUH WKDQNV DUH H[WHQGHG WR WKH PHPEHUV RI P\ VXSHUYLVRU\ FRPPLWWHH IRU WKHLU JXLGDQFH DQG HQFRXUDJHPHQW 'U 5 0LFKDHO 5REHUWV 'U +DUU\ 6 1LFN 'U 'DQLHO / 3XULFK 'U 3HWHU 0 0F*XLUH 'U 0LFKDHO 6 .LOEHUJ DQG 'U )XOOHU : %D]HU HVSHFLDOO\ WKDQN 'U 5 0LFKDHO 5REHUWV IRU FRQYLQFLQJ PH WKDW FRXOG HDUQ D 3K' DQG IRU KLV FRQWLQXHG VXSSRUW RYHU DOO RI WKH \HDUV WKDW ZH ZRUNHG WRJHWKHU DP LQGHEWHG WR 'U +DUU\ 6 1LFN IRU DOORZLQJ PH WR EH D SDUW RI KLV ODERUDWRU\ ZRXOG OLNH WR H[SUHVV P\ JUDWLWXGH WR 'U 5LFKDUG 3 %R\FH *UDGXDWH &RRUGLQDWRUD JUDGXDWH VWXGHQWnV EHVW IULHQG :DUP WKDQNV DUH H[WHQGHG WR WKH PDQ\ KHOSIXO VFLHQWLVWV IURP ODERUDWRULHV RI 'U 5REHUWV DQG 'U %D]HU HVSHFLDOO\ 'U *HRUJH $ %DXPEDFK 'U :LOOLDP & %XKL 'U 3KLOOLSD 7. 6DXQGHUV DQG 'U 0DU\ 0XUUD\ DP DOVR LQGHEWHG WR P\ IHOORZ JUDGXDWH VWXGHQWV LQ WKH ODERUDWRU\ RI 'U 1LFN $ QXPEHU RI XQGHUJUDGXDWH DVVLVWDQWV DQG ODERUDWRU\ WHFKQLFLDQV KDYH EHHQ KHOSIXO WR PH ZRXOG VSHFLILFDOO\ OLNH WR H[SUHVV P\ DSSUHFLDWLRQ WR -R\ :KLWPDQ 6DPDQWKD 5REHUWV 3HQHORSH (GZDUGV DQG &DURO $QQ +DUSHU DP JUDWHIXO WR 'U 5DXO %UD\ODQ IRU SURYLGLQJ WKH KXPDQ VSOHHQV DQG WR 'U 5RVDOLD & 0 6LPPHQ IRU WKH JHQHURXV JLIW RI WZR SRUFLQH XWHURIHUULQ FORQHV VLQFHUHO\ WKDQN /L] 'DPSLHU ZKR FKHHUIXOO\ W\SHG HYHU\ ZRUG RI WKLV GLVVHUWDWLRQ LL

PAGE 3

$ VSHFLDO ZRUG RI WKDQNV JRHV WR P\ SDUHQWV $OIUHG DQG $QWRLQHWWH 6FRSD DQG WR P\ KXVEDQGnV SDUHQWV 6LJXUG DQG 9DOHULH 0DUWLQ 7KHLU OR\DOW\ DQG DSSURYDO KDYH DOZD\V EHHQ YHU\ LPSRUWDQW WR PH ZLVK WR H[SUHVV P\ JUHDWHVW DSSUHFLDWLRQ WR P\ GHDU KXVEDQG *OHQQ +LV SDWLHQFH DQG XQIDLOLQJ ORYH KDYH EHHQ WKH NH\V WR P\ VXFFHVV LLL

PAGE 4

7$%/( 2) &217(176 SDJH $&.12:/('*0(176 LL /,67 2) 7$%/(6 YLL /,67 2) ),*85(6 L[ $%%5(9,$7,216 [L $%675$&7 [LLL &+$37(56 ,1752'8&7,21 7KH 7DUWUDWHUHVLVWDQW $FLG 3KRVSKDWDVHV 8WHURIHUULQ 8WHURIHUULQ LV 6\QWKHVL]HG E\ WKH 8WHULQH (QGRPHWULXP 8QGHU WKH ,QIOXHQFH RI 3URJHVWHURQH 7KH 3XULILFDWLRQ RI 8WHURIHUULQ IURP 8WHULQH 6HFUHWLRQV 8WHURIHUULQ LV DQ ,URQFRQWDLQLQJ $FLG 3KRVSKDWDVH 8WHURIHUULQ &RQWDLQV 7ZR ,URQELQGLQJ 6LWHV $ 3URSRVHG 5HDFWLRQ 0HFKDQLVP IRU 8WHURIHUULQ 8WHURIHUULQ &RQWDLQV DW /HDVW 2QH +LJK 0DQQRVH 2OLJRVDFFKDULGH &KDLQ 7KH )XQFWLRQ RI 8WHURIHUULQ 2WKHU 3XUSOH ,URQFRQWDLQLQJ $FLG 3KRVSKDWDVHV +XPDQ $FLG 3KRVSKDWDVHV &KDUDFWHUL]DWLRQ RI WKH +XPDQ $FLG 3KRVSKDWDVHV +DLU\ &HOO /HXNHPLD 7DUWUDWHUHVLVWDQW $FLG 3KRVSKDWDVH /HYHOV LQ 2WKHU 'LVHDVHV 3XULILFDWLRQ DQG &KDUDFWHUL]DWLRQ RI WKH 7\SH ,VR]\PH 7+( +80$1 7<3( 7$575$7(5(6,67$17 $&,' 3+263+$7$6( )520 63/((1 2) +80$16 :,7+ +$,5< &(// /(8.(0,$ 385,),&$7,21 3523(57,(6 ,00812/2*,&$/ &+$5$&7(5,=$7,21 $1' &203$5,621 :,7+ 325&,1( 87(52)(55,1 ,QWURGXFWLRQ LY

PAGE 5

0DWHULDOV DQG 0HWKRGV 0DWHULDOV 0HWKRGV 5HVXOWV 3XULILFDWLRQ RI 8WHURIHUULQ 3XULILFDWLRQ RI WKH +XPDQ 7\SH $FLG 3KRVSKDWDVH IURP +DLU\ &HOO 6SOHHQ 3XULILFDWLRQ RI WKH 7\SH ,VR]\PH IURP 1RUPDO +XPDQ 6SOHHQ 3XULILFDWLRQ RI WKH 7\SH 3KRVSKDWDVH IURP +XPDQ 3ODFHQWD 3XULILFDWLRQ RI WKH %RYLQH 6SOHHQ %RYLQH 8WHULQH DQG 5DW 6SOHHQ 3KRVSKDWDVHV S+ 2SWLPD RI WKH 7\SH 3KRVSKDWDVHV *O\FRSURWHLQ 1DWXUH RI WKH 7\SH 3KRVSKDWDVHV ,URQ &RQWHQW RI WKH 7\SH 3KRVSKDWDVHV $FWLYDWLRQ E\ 5HGXFLQJ $JHQWV (IIHFWV RI ,QKLELWRUV RQ 3KRVSKDWDVH $FWLYLW\ 6XEVWUDWH 6SHFLILFLW\ IRU 3KRVSKDWDVH $FWLYLW\ ,PPXQRORJLFDO &URVVUHDFWLYLW\ 7KH 3URGXFWLRQ RI 0RQRFORQDO $QWLERGLHV DJDLQVW 3RUFLQH 8WHURIHUULQ 7KH 3URGXFWLRQ RI 0RQRFORQDO $QWLERGLHV DJDLQVW WKH +DLU\ &HOO 6SOHHQ (Q]\PH 7KH %LQGLQJ RI WKH 0RQRFORQDO $QWLERGLHV WR 2WKHU 7DUWUDWHUHVLVWDQW $FLG 3KRVSKDWDVHV ,QKLELWLRQ RI (Q]\PDWLF $FWLYLW\ E\ WKH %LQGLQJ RI 0RQRFORQDO $QWLERGLHV 'LVFXVVLRQ 02/(&8/$5 &/21,1* 2) 7+( 7<3( 7$575$7(5(6,67$17 $&,' 3+263+$7$6( )520 +80$1 3/$&(17$ $1' ,76 (;35(66,21 ,1 /(8.(0,$ &(//6 ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 0DWHULDOV 0HWKRGV 5HVXOWV 7KH ,GHQWLW\ RI WKH 3RVLWLYH &ORQHV 2EWDLQHG E\ ,PPXQRVFUHHQLQJ WKH +XPDQ 3ODFHQWD F'1$ /LEUDU\ 'RW %ORW $QDO\VLV RI 8WHURIHUULQ DQG )LEURQHFWLQ ZLWK $QWL8WHURIHUULQ ,OO 5HVXOWV IURP 6FUHHQLQJ WKH 0RXVH 6SOHHQ F'1$ /LEUDU\ ,OO 5HVXOWV IURP 6FUHHQLQJ WKH 3RUFLQH 8WHULQH (QGRPHWULXP F'1$ /LEUDU\ 7KH 0ROHFXODU &ORQLQJ RI D F'1$ &RGLQJ IRU WKH +XPDQ 7\SH 7DUWUDWHUHVLVWDQW $FLG 3KRVSKDWDVH F'1$ 6HTXHQFHV &KDUDFWHULVWLFV RI WKH 'HGXFHG $PLQR $FLG 6HTXHQFH Y

PAGE 6

1RUWKHUQ $QDO\VLV ,QGXFWLRQ RI 7DUWUDWHUHVLVWDQW $FLG 3KRVSKDWDVH E\ 73$ 7KH (IIHFWV RI +HPLQ RQ $FLG 3KRVSKDWDVH ([SUHVVLRQ 'LVFXVVLRQ &21&/86,216 $1' )8785( ',5(&7,216 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ YL

PAGE 7

/,67 2) 7$%/(6 7DEOH SDJH 7DUWUDWH LQVHQVLWLYLW\ DQG DFWLYDWLRQ E\ PHUFDSWRHWKDQRO RI DFLG SKRVSKDWDVH DFWLYLW\ LQ VSOHHQ KRPRJHQDWHV IURP D SDWLHQW ZLWK KDLU\ FHOO OHXNHPLD DQG IURP DQ LQGLYLGXDO ZLWK D QRUPDO VSOHHQ 3XULILFDWLRQ RI WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH IURP VSOHHQ RI D SDWLHQW ZLWK KDLU\ FHOO OHXNHPLD /HYHOV RI WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH DFWLYLW\ LQ YDULRXV WLVVXHV S+ RSWLPD IRU WKH WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVHV 7KH LURQ FRQWHQW RI WKH WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVHV $FWLYDWLRQ RI SXULILHG KXPDQ KDLU\ FHOO SKRVSKDWDVH E\ PHUFDSWRHWKDQRO $FWLRQ RI YDULRXV SRWHQWLDO LQKLELWRUV RQ WKH KDLU\ FHOO DFLG SKRVSKDWDVH XWHURIHUULQ ERYLQH VSOHHQ DQG ERYLQH XWHULQH DFLG SKRVSKDWDVHV &RPSDULVRQ RI VXEVWUDWH VSHFLILFLWLHV RI KDLU\ FHOO SKRVSKDWDVH XWHURIHUULQ ERYLQH VSOHHQ DQG ERYLQH XWHULQH SKRVSKDWDVHV 'LVVRFLDWLRQ FRQVWDQWV .S YDOXHVf IRU ELQGLQJ RI PRQRFORQDO DQWLERGLHV WR XWHURIHUULQ WKH KXPDQ VSOHHQ HQ]\PH WKH UDW VSOHHQ HQ]\PH WKH ERYLQH VSOHHQ DQG XWHULQH HQ]\PHV ,QKLELWLRQ RI DFLG SKRVSKDWDVH DFWLYLW\ RI XWHURIHUULQ E\ PRQRFORQDO DQWLERGLHV 7KH FORQHV HPSOR\HG IRU JHQHUDWLRQ RI WKH FRPSOHWH VHTXHQFH RI WKH KXPDQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH YLL

PAGE 8

7DUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH OHYHOV LQ DQG -85.$7 FHOOV PDLQWDLQHG RQ p0 73$ DQG FHOOV PDLQWDLQHG RQ L0 KHPLQ 3RWHQWLDO HSLWRSHV FRPPRQ WR SRUFLQH XWHURIHUULQ DQG KXPDQ ILEURQHFWLQ YLLL

PAGE 9

/,67 2) ),*85(6 )LJXUH SDJH 3XULILFDWLRQ RI XWHURIHUULQ IURP DOODQWRLF IOXLG RI D GD\ SUHJQDQW SLJ 3XULILFDWLRQ RI KXPDQ VSOHHQ SKRVSKDWDVH 6'6SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV RI SXULILHG XWHURIHUULQ DQG KDLU\ FHOO SKRVSKDWDVH 3RO\DFU\ODPLGH JHO HOHFWURSKRUHVLV RI DFLG SKRVSKDWDVHV DW S+ LQ SDODQLQH EXIIHU 6'6SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV RI XWHURIHUULQ WKH SKRVSKDWDVH IURP KXPDQ VSOHHQ DQG WKH SKRVSKDWDVH IURP SODFHQWD /LQHZHDYHU%XUN SORWV RI XWHURIHUULQ DQG KDLU\ FHOO SKRVSKDWDVH DFWLYLWLHV LQ WKH SUHVHQFH RI PHUFDS WRHWKDQRO DQG YDULRXV LQKLELWRUV 6ROLG SKDVH UDGLRELQGLQJ DVVD\ RI ZKROH PRXVH DQWLVHUXP IURP PLFH LPPXQL]HG ZLWK KXPDQ VSOHHQ SKRVSKDWDVH XSSHU SDQHOf RU XWHURIHUULQ ORZHU SDQHOf &RPSHWLWLYH ELQGLQJ RI DQWLXWHURIHUULQ PRQRFORQDO DQWLERGLHV WR XWHURIHUULQ DGVRUEHG WR IOH[YLQ\O PLFURWLWHU ZHOOV %LQGLQJ RI IRXU PRQRFORQDO DQWLERGLHV WR XWHURIHUULQ DQG WR WKH LPPXQRDIILQLW\ SXULILHG SKRVSKDWDVHV IURP KXPDQ ERYLQH DQG UDW VSOHHQV 7KH QXFOHRWLGH VHTXHQFHV RI WKH F'1$ FORQHV FRGLQJ IRU SRUFLQH XWHURIHUULQ XVHG IRU VFUHHQLQJ WKH KXPDQ SODFHQWD F'1$ OLEUDU\ DQG WKHLU GHGXFHG DPLQR DFLG VHTXHQFHV 7KH VHTXHQFHV RI WKH UHGXQGDQW ROLJRQXFOHRWLGHV XVHG IRU 6RXWKHUQ EORW DQDO\VLV DQG WKHLU GHGXFHG DPLQR DFLG VHTXHQFHV 1LWURFHOOXORVH ILOWHUV FRQWDLQLQJ LPPXQRUHDFWLYH IXVLRQ SURWHLQV SURGXFHG E\ UHFRPELQDQW ODPEGD JWOO SKDJH IURP D KXPDQ SODFHQWD F'1$ OLEUDU\ ZKLFK ZDV VFUHHQHG ZLWK DQWLXWHURIHUULQ DQWLERGLHV L[

PAGE 10

$JDURVH JHO HOHFWURSKRUHVLV RI '1$ IURP VL[ SRVLWLYH FORQHV REWDLQHG E\ LPPXQRVFUHHQLQJ KXPDQ SODFHQWD DQG PRXVH VSOHHQ F'1$ OLEUDULHV DQG 6RXWKHUQ DQDO\VLV RI WKH FORQHV SUREHG ZLWK +3 6RXWKHUQ EORW DQDO\VLV RI FORQH +3 SUREHG ZLWK UDGLRODEHOHG ROLJRQXFOHRWLGH .0 3RO\DFU\ODPLGH JHO HOHFWURSKRUHVLV RI FORQH +3 UHVWULFWLRQ IUDJPHQWV REWDLQHG ZLWK $OX DQG +DH ,,, 7KH QXFOHRWLGH DQG LQIHUUHG DPLQR DFLG VHTXHQFHV RI FORQH +3 ZKLFK FRGHV IRU KXPDQ ILEURQHFWLQ 'RW EORW DQDO\VLV RI WKH ELQGLQJ RI SRO\FORQDO DQG PRQRFORQDO DQWLERGLHV DJDLQVW SRUFLQH XWHURIHUULQ WR XWHURIHUULQ DQG KXPDQ ILEURQHFWLQ 7ZR SRVLWLYH FORQHV D DQG D LGHQWLILHG E\ VFUHHQLQJ WKH KXPDQ SODFHQWD F'1$ OLEUDU\ ZLWK WKH F'1$V FRGLQJ IRU SRUFLQH XWHURIHUULQ $JDURVH JHO HOHFWURSKRUHVLV RI (FR5 GLJHVWV '1$ IURP WZR SRVLWLYH FORQHV D DQG D 3RO\DFU\ODPLGH JHO HOHFWURSKRUHVLV RI WKH UHVWULFWLRQ IUDJPHQWV REWDLQHG E\ WKH GLJHVWLRQ RI FORQHV D DQG D ZLWK $OX +DH ,,, DQG 0VS 6XEFORQLQJ DQG VHTXHQFLQJ VWUDWHJ\ IRU FORQH D WKH F'1$ HQFRGLQJ WKH KXPDQ 7\SH WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH 7KH QXFOHRWLGH VHTXHQFH RI WKH F'1$ FORQH D DQG WKH GHGXFHG DPLQR DFLG VHTXHQFH RI WKH KXPDQ 7\SH WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH &RPSDULVRQ RI WKH GHGXFHG DPLQR DFLG VHTXHQFH RI WKH KXPDQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH ZLWK WKH DPLQR DFLG VHTXHQFHV RI SRUFLQH XWHURIHUULQ DQG WKH ERYLQH VSOHHQ DFLG SKRVSKDWDVH ([SUHVVLRQ RI WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH P51$ DQG LWV LQGXFWLRQ E\ 73$ [

PAGE 11

$%%5(9,$7,216 ES EDVH SDLUV %6$ ERYLQH VHUXP DOEXPLQ F'1$ FRPSOHPHQWDU\ '1$ &0FHOOXORVH FDUER[\PHWK\O FHOOXORVH &RQ$ &RQFDQDYDOLQ $ '0( 'XOEHFFRnV 0RGLILHG (DJOHnV 0HGLXP '0(+$7 '0( ZLWK K\SR[DQWKLQH DPLQRSWHULQ DQG WK\PLGLQH '1DVH GHR[\ULERQXFOHDVH '77 GLWKLRWKUHLWRO (%9 (SVWHLQ%DUU 9LUXV ('7$ HWK\OHQHGLDPLQHWHWUDDFHWLF DFLG *OF1$F 1DFHW\OJOXFRVDPLQH *7& JXDQLGLQLXP WKLRF\DQDWH VROXWLRQ ,J* LPPXQRJOREXOLQ LS LQWUDSHULWRQHDOO\ ,37* LVRSURS\OWKLR"'JDODFWRS\U DQR VLGH NE NLOREDVHV .S GLVVRFLDWLRQ FRQVWDQW 0236 1PRUSKROLQRfSURSDQHVXOIRQLF DFLG 0U UHODWLYH PROHFXODU PDVV 3$*( SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV 3%6 SKRVSKDWH EXIIHUHG VDOLQH 3KRVSKRGLHVWHUDVH 1DFHW\OJOXFRVDPLQHOSKRVSKRGLHVWHU RF1DFHW\O JOXFRVDPLQLGDVH 3KRVSKRWUDQVIHUDVH 8'31DFHW\OJOXFRVDPLQHO\VRVRPDO HQ]\PH 1DFHW\OJOXFRVDPLQH SKRVSKDWH WUDQVIHUDVH 306) SKHQ\OPHWK\OVXOIRQ\OIOXRULGH S133 SQLWURSKHQ\OSKRVSKDWH 51DVH ULERQXFOHDVH 6'6 VRGLXP GRGHF\O VXOIDWH [L

PAGE 12

6'63$*( SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV ZLWK VRGLXP GRGHF\O VXOIDWH 63 63$JO 66& VWDQGDUG VRGLXP FLWUDWH EXIIHU 7( 7ULV+&O ZLWK ('7$ 73$ WHWUDGHFDQR\OSKRUERO DFHWDWH 75$3 WDUWUDWH UHVLVWDQW DFLG SKRVSKDWDVH 7\SH LVR]\PHf 7ULV WULVK\GUR[\PHWK\OfDPLQRPHWKDQH 8I XWHURIHUULQ ;JDO FKORUREURPRLQGRO\O 'JDODFWRS\UDQRVLGH [LL

PAGE 13

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ 7+( +80$1 7<3( 7$575$7(5(6,67$17 $&,' 3+263+$7$6( 385,),&$7,21 &+$5$&7(5,=$7,21 $1' 02/(&8/$5 &/21,1* %\ &DWKHULQH 0DU\ .HWFKDP $XJXVW &KDLUPDQ 'U 5 0LFKDHO 5REHUWV 0DMRU 'HSDUWPHQW %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ 7KH VSOHHQV RI SDWLHQWV ZLWK KDLU\ FHOO OHXNHPLD FRQWDLQ KLJK OHYHOV RI D WDUWUDWHUHVLVWDQW FDWLRQLF DFLG SKRVSKDWDVH NQRZQ DV WKH 7\SH LVR]\PH 7KLV HQ]\PH LV DOVR SUHVHQW LQ VPDOO TXDQWLWLHV LQ QRUPDO VSOHHQ DQG WHUP SODFHQWD 7KLV SKRVSKDWDVH KDV EHHQ SXULILHG IURP WKHVH WKUHH VRXUFHV E\ D SURFHGXUH ZKLFK LQYROYHV RQO\ WZR FKURPDWRJUDSKLF VWHSV &0FHOOXORVH FKURPDWRJUDSK\ DQG LPPXQRDIILQLW\ FKURPDWRJUDSK\ RQ D FROXPQ RI DQWLXWHURIHUULQ DQWLERGLHV 8WHURIHUULQ LV DQ DEXQGDQW SXUSOH LURQFRQWDLQLQJ DFLG SKRVSKDWDVH WKDW FDQ EH HDVLO\ SXULILHG IURP SRUFLQH XWHULQH VHFUHWLRQV /LNH XWHURIHUULQ WKH KXPDQ HQ]\PH LV DQ LURQFRQWDLQLQJ JO\FRSURWHLQ RI DSSDUHQW PROHFXODU ZHLJKW 7KH KXPDQ SKRVSKDWDVH DQG XWHURIHUULQ DOVR UHVHPEOH HDFK RWKHU FORVHO\ LQ HOHFWURSKRUHWLF PRELOLW\ VXEVWUDWH VSHFLILFLW\ DQG UHVSRQVH WR D YDULHW\ RI DFWLYDWRUV DQG LQKLELWRUV 7KUHH DQWLXWHURIHUULQ PRQRFORQDO DQWLERGLHV ZKLFK ELQG ZLWK KLJK DIILQLWLHV WR GLVWLQFW VLWHV RQ WKH XWHURIHUULQ PROHFXOH DOVR UHFRJQL]H WKH KXPDQ VSOHHQ HQ]\PH EXW ELQG WR [LLL

PAGE 14

LW ZLWK PXFK ORZHU DIILQLWLHV 7KHVH DQWLERGLHV DOVR UHFRJQL]H SXUSOH LURQFRQWDLQLQJ DFLG SKRVSKDWDVHV IURP ERYLQH DQG UDW VSOHHQV DQG WKH ERYLQH XWHUXV $ EDVH SDLU F'1$ KDV EHHQ FORQHG IURP KXPDQ SODFHQWD ZKLFK HQFRGHV WKH HQWLUH KXPDQ WDUWUDWHUHVLVWDQW 7\SH LVR]\PH 7KLV F'1$ FRQWDLQV DQ RSHQ UHDGLQJ IUDPH RI EDVH SDLUV FRUUHVSRQGLQJ WR D SURWHLQ RI DPLQR DFLGV $ SXWDWLYH VLJQDO VHTXHQFH RI DPLQR DFLGV DQG WZR SRWHQWLDO JO\FRV\ODWLRQ VLWHV DUH SUHVHQW 7KH GHGXFHG DPLQR DFLG VHTXHQFH RI WKH KXPDQ HQ]\PH LV b LGHQWLFDO WR WKDW RI SRUFLQH XWHURIHUULQ DQG b LGHQWLFDO WR WKH FRUUHVSRQGLQJ UHJLRQV RI D SDUWLDO DPLQR DFLG VHTXHQFH RI WKH ERYLQH VSOHHQ HQ]\PH 1RUWKHUQ EORWWLQJ WHFKQLTXHV HPSOR\LQJ D UDGLRODEHOHG F'1$ SUREH FRGLQJ IRU WKH KXPDQ HQ]\PH UHYHDOHG WKH SUHVHQFH RI D NE WUDQVFULSW LQ OHXNHPLF KDLU\ FHOOV DQ (SVWHLQ%DUU YLUXVWUDQVIRUPHG %FHOO OLQH DQG WKH HU\WKUROHXNHPLD FHOO OLQH &XOWXUH RI FHOOV LQ WKH SUHVHQFH RI np0 WHWUDGHFDQR\OSKRUERO DFHWDWH HQKDQFHG WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH DFWLYLW\ DERXW IROG DQG OHG WR D FRUUHVSRQGLQJ LQFUHDVH LQ 7\SH LVR]\PH P51$ OHYHOV [LY

PAGE 15

&+$37(5 ,1752'8&7,21 7KH 7DUWUDWHUHVLVWDQW $FLG 3KRVSKDWDVHV 7KH WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVHV KDYH EHHQ VWXGLHG H[WHQVLYHO\ E\ YDULRXV UHVHDUFK JURXSV ZLWK GLIIHUHQW REMHFWLYHV 7KH PRVW DEXQGDQW HQ]\PH LQ WKLV IDPLO\ SRUFLQH XWHURIHUULQ KDV EHHQ ZHOO FKDUDFWHUL]HG SK\VLFDOO\ DQG HQ]\PDWLFDOO\ \HW PXFK RI WKH UHVHDUFK RQ WKLV SURWHLQ KDV LQYROYHG WKH GHWHUPLQDWLRQ RI LWV UROH LQ LURQ PHWDEROLVP LQ WKH PLGSUHJQDQW SLJ 7KH EHHI VSOHHQ DFLG SKRVSKDWDVH ZDV ILUVW LGHQWLILHG RYHU \HDUV DJR DQG ZKLOH LWV SK\VLFDO FKDUDFWHULVWLFV DV D PHWDOORSURWHLQ DUH ZHOO NQRZQ LWV IXQFWLRQ UHPDLQV REVFXUH 7KH KXPDQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH ZDV ILUVW GHVFULEHG E\ UHVHDUFKHUV LQWHUHVWHG LQ WKH FOLQLFDO VLJQLILFDQFH RI SKRVSKDWDVH OHYHOV LQ QRUPDO DQG SDWKRORJLFDO WLVVXH )HZ UHSRUWV KDYH EHHQ SXEOLVKHG RQ WKH FKDUDFWHUL]DWLRQ RI WKLV KXPDQ HQ]\PH ,W LV FOHDU KRZHYHU WKDW DOO RI WKH DERYH SURWHLQV VKDUH VHYHUDO XQXVXDO IHDWXUHV DQG WKDW WKH FOLQLFDOO\ UHOHYDQW KXPDQ HQ]\PH LV ZRUWK\ RI IXUWKHU VWXG\ 8WHURIHUULQ 7KH XWHULQH VHFUHWLRQV RI SLJV FRQWDLQ D SXUSOH EDVLF LURQ FRQWDLQLQJ JO\FRSURWHLQ ZLWK DFLG SKRVSKDWDVH DFWLYLW\ NQRZQ DV XWHURIHUULQ 8WHURIHUULQ KDV EHHQ ZHOO FKDUDFWHUL]HG VLQFH LW ZDV ILUVW GHVFULEHG LQ E\ 0XUUD\ HW DO ,WV HQ]\PDWLF FKDUDFWHULVWLFV KDYH

PAGE 16

EHHQ VWXGLHG E\ RXU ODERUDWRU\ DQG LWV LQWHUHVWLQJ VSHFWUDO SURSHUWLHV KDYH EHHQ WKH VXEMHFW RI QXPHURXV SXEOLFDWLRQV E\ PDQ\ GLIIHUHQW UHVHDUFKHUV 2XU ODERUDWRU\ KDV DOVR GHWHUPLQHG WKH OLNHO\ IXQFWLRQ RI XWHURIHUULQ LQ WKH SUHJQDQW SLJ 8WHURIHUULQ LV 6\QWKHVL]HG E\ WKH 8WHULQH (QGRPHWULXP 8QGHU WKH ,QIOXHQFH RI 3URJHVWHURQH 2QH RI WKH PDMRU JRDOV RI RXU ODERUDWRU\ KDV EHHQ WR SXULI\ DQG FKDUDFWHUL]H WKH SURWHLQV VHFUHWHG E\ WKH SRUFLQH XWHUXV 7KH TXDQWLW\ DQG YDULHW\ RI SURWHLQV SURGXFHG GHSHQG RQ WKH KRUPRQDO VWDWH RI WKH DQLPDO .QLJKW HW DO f GHVFULEHG WKH FROOHFWLRQ RI XWHULQH IOXLGV IURP RYDULHFWRPL]HG JLOWV ZKLFK KDG EHHQ WUHDWHG ZLWK HVWUDGLRO SURJHVWHURQH SURJHVWHURQH SOXV HVWUDGLRO RU FRUQ RLO FRQWUROf IRU GD\V ,W ZDV GHPRQVWUDWHG WKDW SURJHVWHURQH RU SURJHVWHURQH SOXV HVWUDGLRO WUHDWPHQW FDXVHG D KLJKO\ VLJQLILFDQW LQFUHDVH LQ WKH DPRXQW RI WRWDO SURWHLQ WKDW FRXOG EH UHFRYHUHG UHODWLYH WR FRUQ RLO FRQWURO RU HVWUDGLRO WUHDWPHQW DORQH (VWUDGLRO DORQH SURPRWHG QHLWKHU LQFUHDVHG SURWHLQ DFFXPXODWLRQ QRU WKH DSSHDUDQFH RI QRYHO SURWHLQV EXW LW DFWHG V\QHUJLVWLFDOO\ ZLWK SURJHVWHURQH WR VWLPXODWH XWHULQH VHFUHWRU\ DFWLYLW\ ZKHQ JLYHQ DW ORZ GRVDJH $ YDULHW\ RI SURWHLQV ZHUH WKXV VKRZQ WR EH VHFUHWHG E\ WKH SRUFLQH XWHUXV XQGHU WKH LQIOXHQFH RI SURJHVWHURQH $ SURWHLQ QRZ NQRZQ DV XWHURIHUULQ DFFRXQWHG IRU DERXW b RI WKH WRWDO SURWHLQ LQ WKH XWHULQH VHFUHWLRQV RI SURJHVWHURQH WUHDWHG DQLPDOV 6FKORVQDJOH HW DO f 6LPPHQ HW DO f FRPSDUHG WKH ELRV\QWKHWLF UDWH RI XWHURIHUULQ WR XWHURIHUULQ P51$ OHYHOV WKURXJKRXW SUHJQDQF\ LQ WKH SLJ 6\QWKHVLV RI XWHURIHUULQ EHJLQV WR LQFUHDVH PDUNHGO\ DIWHU GD\ RI SUHJQDQF\ LQ DVVRFLDWLRQ ZLWK D GHFOLQH LQ PDWHUQDO HVWURJHQ OHYHOV 8WHURIHUULQ

PAGE 17

ELRV\QWKHVLV UHDFKHV D PD[LPXP EHWZHHQ GD\V DQG %DVKD HW DO f DQG WKHQ GHFOLQHV WRZDUGV WHUP ZKLFK LV DERXW GD\ %D]HU HW DO f 7KH SURJHVWHURQH WR HVWURJHQ UDWLRV DUH KLJKHVW EHWZHHQ GD\V WR ZKLFK FRLQFLGHV ZHOO ZLWK PD[LPDO XWHURIHUULQ SURGXFWLRQ 5REHUWV DQG %D]HU f /HYHOV RI XWHURIHUULQ LQ DOODQWRLF IOXLG GXULQJ SUHJQDQF\ UHDFK D PD[LPXP DW D VLPLODU WLPH 5REHUWV DQG %D]HU f ,Q FRPSDULVRQ KLJKHVW OHYHOV RI P51$ FRGLQJ IRU XWHURIHUULQ ZHUH GHWHFWHG GXULQJ PLG DQG ODWHSUHJQDQF\ 7KH P51$ OHYHOV DW GD\V ZHUH FRPSDUDEOH WR WKRVH DW GD\V 6LPPHQ HW DO f 7KXV WKH DPRXQW RI XWHURIHUULQ P51$ DV GHWHUPLQHG E\ 1RUWKHUQ DQDO\VLV GRHV QRW DSSHDU WR UHIOHFW WKH UDWH RI XWHURIHUULQ ELRV\QWKHVLV DV GHWHUPLQHG E\ WKH LQFRUSRUDWLRQ RI UDGLRDFWLYH OHXFLQH 7KH UHJXODWLRQ RI XWHURIHUULQ V\QWKHVLV PD\ WKHUHIRUH LQYROYH WUDQVFULSWLRQDO DQG SRVW WUDQVFULSWLRQDO FRQWURO 7KHVH UHVXOWV VXSSRUW WKH HDUOLHU WKHRU\ WKDW DOWKRXJK SURJHVWHURQH LV HVVHQWLDO IRU XWHURIHUULQ SURGXFWLRQ HVWURJHQV PD\ KDYH DQ LPSRUWDQW PRGXODWLQJ UROH GXH WR WKH IDFW WKDW XWHURIHUULQ V\QWKHVLV LV KLJKHVW ZKHQ WKH UDWLR RI SURJHVWHURQH WR HVWURJHQ LV KLJKHVW 5REHUWV DQG %D]HU f 7KH 3XULILFDWLRQ RI 8WHURIHUULQ IURP 8WHULQH 6HFUHWLRQV 8WHURIHUULQ LV PRVW FRQYHQLHQWO\ SXULILHG IURP WKH XWHULQH IOXVKHV RI SVHXGRSUHJQDQW DQLPDOV %DVKD HW DO f RU IURP WKH DOODQWRLF IOXLG RI PLGSUHJQDQW SLJV %D]HU HW DO f 3VHXGRSUHJQDQF\ FDQ EH LQGXFHG LQ VRZV E\ DGPLQLVWHULQJ HVWUDGLRO GDLO\ EHWZHHQ GD\V DIWHU HVWUXV )UDQN HW DO f 7KH LQMHFWHG HVWUDGLRO DSSHDUV WR PLPLF DQ HVWURJHQ EXUVW IURP WKH EODVWRF\VW ZKLFK LV EHOLHYHG WR EH WKH VLJQDO WR WKH VRZ ZKLFK LQGLFDWHV VKH LV SUHJQDQW %D]HU DQG 7KDWFKHU

PAGE 18

f 6HFUHWLRQV RI D GD\ SVHXGRSUHJQDQW DQLPDO DUH FRPSDUDEOH LQ TXDOLW\ DQG TXDQWLW\ WR WKRVH RI DQ RYDULHFWRPL]HG DQLPDO JLYHQ GDLO\ GRVHV RI SURJHVWHURQH IRU WZR PRQWKV 8WHURIHUULQ FDQ EH SXULILHG IURP DOODQWRLF IOXLG DIWHU GD\ RI SUHJQDQF\ +RZHYHU XWHURIHUULQ LQ VWHULOH DOODQWRLF IOXLG LV UDSLGO\ GHJUDGHG HYHQ ZKHQ VWRUHG DW r& 7KHUHIRUH WKH DOODQWRLF IOXLG PXVW EH IUR]HQ DIWHU FROOHFWLRQ RU XVHG LPPHGLDWHO\ DQG WKH SXULILFDWLRQ RI XWHURIHUULQ PXVW EH FDUULHG RXW TXLFNO\ %HFDXVH XWHURIHUULQ LV DYDLODEOH LQ JUDP TXDQWLWLHV DQG EHFDXVH RI LWV SXUSOH FRORU WKH GHYHORSPHQW RI D SXULILFDWLRQ SURWRFRO IRU XWHURIHUULQ ZDV TXLWH VWUDLJKWIRUZDUG 6LQFH XWHURIHUULQ LV D YHU\ EDVLF SURWHLQ LW ELQGV WR FDUER[\PHWK\O FHOOXORVH HYHQ DW KLJK S+ YDOXHV $ FRPELQDWLRQ RI LRQ H[FKDQJH FKURPDWRJUDSK\ DQG JHO ILOWUDWLRQ RQ 6HSKDGH[ LV VXIILFLHQW WR \LHOG SXUH XWHURIHUULQ RI 0U DV GHWHUPLQHG E\ 6'6 SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV &KHQ HW DO f ,QWHUHVWLQJO\ XWHULQH IOXVKHV DQG DOODQWRLF IOXLG REWDLQHG IURP DQLPDOV GXULQJ HDUO\ SUHJQDQF\ GD\V f DOVR FRQWDLQ D KLJK PROHFXODU ZHLJKW 0U f SLQN IRUP RI XWHURIHUULQ %D]HU HW DO f ,W LV QRZ NQRZQ WKDW WKLV SURWHLQ FRQVLVWV RI D PROHFXOH RI XWHURIHUULQ QRQFRYDOHQWO\ DVVRFLDWHG ZLWK DQRWKHU DQWLJHQLFDOO\ XQUHODWHG SURWHLQ %DXPEDFK HW DO f 7KH UHDVRQ IRU WKH DVVRFLDWLRQ RI XWHURIHUULQ ZLWK WKLV VHFRQG SURWHLQ LV XQNQRZQ $ QXPEHU RI RWKHU LQWHUHVWLQJ SURWHLQV WKRXJK QRQH DV DEXQGDQW DV XWHURIHUULQ FDQ DOVR EH SXULILHG IURP SRUFLQH XWHULQH VHFUHWLRQV VHH 5REHUWV DQG %D]HU f 7KHVH SURWHLQV LQFOXGH D IDPLO\ RI WU\SVLQSODVPLQ SURWHDVH LQKLELWRUV 0XOOLQV HW DO )D]OHDEDV HW

PAGE 19

DO f DQG D JURXS RI UHWLQRO ELQGLQJ SURWHLQV $GDPV HW DO f 8WHURIHUULQ LV DQ ,URQFRQWDLQLQJ $FLG 3KRVSKDWDVH 6FKORVQDJOH HW DO f GHPRQVWUDWHG WKDW WKH DEXQGDQW EDVLF SXUSOH JO\FRSURWHLQ IURP SRUFLQH XWHULQH VHFUHWLRQV ZDV DQ LURQ FRQWDLQLQJ DFLG SKRVSKDWDVH 7KH\ UHSRUWHG D S+ RSWLPXP RI DQG D .P RI P0 IRU WKH HQ]\PHnV SUHIHUUHG VXEVWUDWH SQLWURSKHQ\OSKRVSKDWH :HDN UHGXFLQJ DJHQWV VXFK DV PHUFDSWRHWKDQRO HQKDQFHG DFWLYLW\ WR IROG ZLWKRXW FKDQJLQJ WKH .P 8WHURIHUULQnV SKRVSKDWDVH DFWLYLW\ FRXOG EH LQKLELWHG E\ IOXRULGH DUVHQDWH SKRVSKDWH DQG PRO\EGDWH 6FKORVQDJOH HW DO f 6RGLXP GLWKLRQLWH FDXVHG DQ LPPHGLDWH ORVV RI HQ]\PDWLF DFWLYLW\ DQG EOHDFKLQJ RI FRORU DOWKRXJK DFWLYLW\ FRXOG EH UHVWRUHG ZLWK )HA VDOWV 6FKORVQDJOH HW DO f 2[LGL]LQJ DJHQWV DQG UHDJHQWV ZKLFK LQWHUDFW ZLWK VXOIK\GU\O JURXSV DOVR LQKLELWHG XWHURIHUULQ 6FKORVQDJOH HW DO f 8I ZDV QRW LQKLELWHG E\ WDUWUDWH DQ XQXVXDO IHDWXUH LQ DQ DFLG SKRVSKDWDVH 7KH VXEVWUDWH VSHFLILFLW\ RI XWHURIHUULQ ZDV DOVR XQXVXDO ,W UHDGLO\ K\GURO\]HG FRPSRXQGV ZLWK VWURQJ OHDYLQJ JURXSV VXFK DV SQLWURSKHQ\OSKRVSKDWH DQG $73 EXW KDG OLWWOH RU QR DFWLYLW\ WRZDUGV DOLSKDWLF SKRVSKDWHV VXFK DV JO\FHURO SKRVSKDWH RU KH[RVH SKRVSKDWHV VXFK DV 'JOXFRVH SKRVSKDWH 6FKORVQDJOH HW DO f 8WHURIHUULQ DOVR GLVSOD\HG SKRVSKRSURWHLQ SKRVSKDWDVH DFWLYLW\ 5REHUWV DQG %D]HU f 8WHURIHUULQ DV SXULILHG LV SUHGRPLQDQWO\ SXUSOH DQG HQ]\PDWLFDOO\ LQDFWLYH 7KLV SXUSOH FRORUDWLRQ RULJLQDWHV IURP D EURDG DEVRUSWLRQ EDQG FHQWHUHG DURXQG QP +RZHYHU ZKHQ XWHURIHUULQ LV DFWLYDWHG E\ PHUFDSWRHWKDQRO WKH H[WLQFWLRQ PD[LPXP FKDQJHV IURP QP SXUSOHf WR

PAGE 20

QP SLQNf 6FKORVQDJOH HW DO f 7KH UHYHUVH UHDFWLRQ SLQN WR SXUSOHf LV SURPRWHG E\ R[LGL]LQJ DJHQWV :KHQ SXULILHG XWHURIHUULQ FRQVLVWV RI DQ HTXLOLEULXP PL[WXUH RI WKH UHGXFHG SLQNf DQG R[LGL]HG SXUSOHf IRUPV ZLWK WKH ODWWHU SUHGRPLQDWLQJ 7KH HTXLOLEULXP EHWZHHQ WKH SLQN DQG SXUSOH IRUPV PD\ GHSHQG RQ WKH UHGR[ VWDWH RI WKH IOXLG VDPSOH IURP ZKLFK WKH SURWHLQ ZDV UHFRYHUHG ,Q FRQWUDVW WKH VWDEOH SLQN KLJK PROHFXODU ZHLJKW IRUP RI XWHURIHUULQ GRHV QRW UHTXLUH UHGXFLQJ DJHQWV IRU DFWLYLW\ LW LV IXOO\ DFWLYH DV SXULILHG %DXPEDFK HW DO f ,W LV QRW FOHDU KRZ QRQFRYDOHQW DVVRFLDWLRQ ZLWK D VHFRQG XQUHODWHG SURWHLQ VWDELOL]HV WKH DFWLYH IRUP RI WKH HQ]\PH 8WHURIHUULQ &RQWDLQV 7ZR ,URQELQGLQJ 6LWHV 7KH DPRXQW RI LURQ ERXQG WR XWHURIHUULQ KDV EHHQ WKH VXEMHFW RI FRQWURYHUV\ (DUO\ UHSRUWV 5REHUWV DQG %D]HU f LQGLFDWHG WKDW XWHURIHUULQ FRQWDLQHG D PRQRIHUULF VLWH +RZHYHU LW LV QRZ FOHDU WKDW HDFK PROHFXOH RI XWHURIHUULQ FDQ ELQG XS WR WZR LURQ DWRPV DOWKRXJK RQO\ RQH RI WKHVH LURQ DWRPV LV QHFHVVDU\ IRU WKH SXUSOHSLQN FRORUDWLRQ ,W KDV EHHQ GHPRQVWUDWHG WKDW WKH LURQ DW WKH PRUH ODELOH QRQFKURPRSKRULF VLWH FDQ EH UHSODFHG E\ D YDULHW\ RI RWKHU PHWDOV LQFOXGLQJ ]LQF FRSSHU DQG PHUFXU\ %HFN HW DO f 7KH DSSDUHQW ORZHU FRQWHQW RI LURQ OHVV WKDQ WZR DWRPV SHU PROHFXOHf FRQVLVWHQWO\ QRWHG LQ VRPH VDPSOHV RI XWHURIHUULQ VHH %DXPEDFK HW DO f PD\ KDYH UHVXOWHG IURP D SDUWLDO DEVHQFH RI LURQ DW WKH QRQFKURPRSKRULF VLWH DQG LWV UHSODFHPHQW E\ RWKHU PHWDOV $ QXPEHU RI PHWKRGV KDYH EHHQ HPSOR\HG WR VWXG\ WKH LURQ ELQGLQJ VLWHV LQ XWHURIHUULQ DQG WKH UHODWHG EHHI VSOHHQ SXUSOH SKRVSKDWDVH (35 0RVVEDXHU 105 DQG PDJQHWLF VXVFHSWLELOLW\ VWXGLHV DUH FRQVLVWHQW

PAGE 21

ZLWK D PRGHO LQ ZKLFK WKH LURQ DWRPV RFFXS\ WZR GLVWLQFW EXW DGMDFHQW VLWHV ZKLFK DUH VXIILFLHQWO\ FORVH VR WKDW WKH WZR DWRPV DUH PDJQHWLFDOO\ FRXSOHG 'DYLV DQG $YHULOO 'HEUDQQHU HW DO /DXIIHU HW DO f 3XUSOH HQ]\PDWLFDOO\ LQDFWLYH XWHURIHUULQ LV EHOLHYHG WR FRQWDLQ WZR IHUULF LRQV 7KLV IRUP RI XWHURIHUULQ JLYHV QR (35 VLJQDO SUHVXPDEO\ EHFDXVH WKH VSLQV RI WKH WZR IHUULF LRQV DUH DQWLIHUURPDJQHWLFDOO\ FRXSOHG ZLWK D QHW VSLQ RI ]HUR :KHQ SXUSOH (PD[ QPf XWHURIHUULQ LV WUHDWHG ZLWK PLOG UHGXFLQJ DJHQWV DQG WXUQV SLQN (PD[ QPf LW FRQWDLQV D IHUULFIHUURXV LURQ SDLU ZKLFK JLYHV ULVH WR DQ LQWHQVH Jn (35 VLJQDO DW OLTXLG KHOLXP WHPSHUDWXUHV $QWDQDLWLV DQG $LVHQ f 7KH QDWXUDOO\ RFFXUULQJ KLJK PROHFXODU ZHLJKW SLQN IRUP RI XWHURIHUULQ JLYHV ULVH WR WKH VDPH Jn (35 VLJQDO ZLWKRXW WKH DGGLWLRQ RI UHGXFLQJ DJHQWV %DXPEDFK HW DO f $W SUHVHQW WKHUH LV QR DGHTXDWH PRGHO WR GHVFULEH WKH LURQ ELQGLQJ VLWHV RI XWHURIHUULQ 5HVRQDQFH5DPDQ VWXGLHV KDYH VKRZQ WKDW WKH SXUSOHSLQN FRORU PRVW OLNHO\ DULVHV IURP FRRUGLQDWLRQ RI LURQ WR W\URVLQH UHVLGXHV *DEHU HW DO f 7KH LURQ DWRP LQYROYHG LV SUREDEO\ WKH OHVV ODELOH RQH DW WKH )H,,,f VLWH RQ SLQN UHGXFHG XWHURIHUULQ VLQFH WKH PRODU H[WLQFWLRQ FRHIILFLHQW GRHV QRW FKDQJH ZKHQ WKH SURWHLQ LV UHGXFHG IURP LWV SXUSOH WR LWV SLQN IRUP +RZHYHU WKH FRORU FKDQJH IURP SXUSOH WR SLQN PRVW OLNHO\ UHSUHVHQWV GLVXOILGH UHGXFWLRQ UDWKHU WKDQ UHGXFWLRQ RI LURQ 6FKORVQDJOH HW DO f +LVWLGLQH KDV DOVR EHHQ LPSOLFDWHG DV D OLJDQG IRU WKH LURQ DWRPV /DXIIHU HW DO f DQG DQ R[\JHQ DWRP KDV EHHQ VXJJHVWHG WR EULGJH WKH LURQ VLWHV 0RFNOHU HW DO f 2UWKRSKRVSKDWH LV FRRUGLQDWHG ZLWK WKH LURQ FHQWHU RQ SXUSOH XWHURIHUULQ $QWDQDLWLV DQG $LVHQ f

PAGE 22

7KH DPLQR DFLG VHTXHQFH RI XWHURIHUULQ UHYHDOHG WKDW WKH LURQ ELQGLQJ VLWHV PXVW EH QRQLGHQWLFDO EHFDXVH WKH SURWHLQ FRQWDLQV QR LQWHUQDO UHSHDWV ZLWK KLVWLGLQH DQG W\URVLQH UHVLGXHV LQ LGHQWLFDO VSDFLDO UHODWLRQVKLSV ,W LV QRW FOHDU ZKLFK RI WKH KLVWLGLQH DQG W\URVLQH UHVLGXHV ZKLFK DUH FRQVHUYHG LQ XWHURIHUULQ DQG WKH EHHI VSOHHQ HQ]\PH FRXOG EH OLJDQGV IRU WKH PHWDOV +XQW HW DO f $ 3URSRVHG 5HDFWLRQ 0HFKDQLVP IRU 8WHURIHUULQ 8QOLNH WKH DONDOLQH SKRVSKDWDVHV ZKHUH WKH UROH RI WKH =Q,,f LV IDLUO\ ZHOO XQGHUVWRRG WKH IXQFWLRQ RI WKH LURQ DWRPV LQ FDWDO\WLF DFWLYLW\ RI XWHURIHUULQ DQG WKH RWKHU SXUSOH DFLG SKRVSKDWDVHV LV XQNQRZQ &RPSHWLWLYH LQKLELWRUV VXFK DV SKRVSKDWH DQG DUVHQDWH LQWHUDFW ZLWK WKH SDUDPDJQHWLF FHQWHUV RQ WKHVH SURWHLQV ZKLFK VXJJHVW WKDW WKH PHWDO FRQWULEXWHV WR VXEVWUDWH ELQGLQJ 'DYLV DQG $YHULOO .DZDEH HW DO f 6XFK VXEVWUDWHLURQ FRPSOH[HV ZRXOG SUREDEO\ EH VWDEOH DURXQG S+ DQG PD\ H[SODLQ WKH DFLG S+ RSWLPXP 7KH LURQ E\ YLUWXH RI LWV VWURQJ HOHFWURQ ZLWKGUDZLQJ SURSHUWLHV FRXOG WKHUHIRUH SURPRWH FDWDO\VLV ,W LV ZHOO GRFXPHQWHG WKDW WKH UHDFWLRQ PHFKDQLVP RI WKH ]LQF FRQWDLQLQJ DONDOLQH SKRVSKDWDVHV LQYROYHV D SKRVSKRU\OHQ]\PH LQWHUPHGLDWH /HYLQH HW DO f 3UHYLRXV H[SHULPHQWDO HYLGHQFH REWDLQHG ZLWK D YDULHW\ RI DFLG SKRVSKDWDVHV DOVR LQGLFDWHG WKH IRUPDWLRQ RI D SKRVSKRU\OHQ]\PH LQWHUPHGLDWH ZLWK D GRXEOH GLVSODFHPHQW UHDFWLRQ PHFKDQLVP +LFNH\ DQG 9DQ(WWHQ ,JDUDVKL HW DO )HOGPDQ DQG %XWOHU f .LQHWLF HYDOXDWLRQ RI ERYLQH SXUSOH DFLG SKRVSKDWDVHV LQGLFDWHG WKDW WKHVH XWHURIHUULQOLNH HQ]\PHV XQGHUJR D SVHXGR 8QL %L K\GURO\WLF WUDQVIHU UHDFWLRQ PHFKDQLVP /DX HW

PAGE 23

DO 'DYLV HW DO f 7KLV WKHRU\ LV VXSSRUWHG E\ WKH IDFW WKDW WUDQVLWLRQ VWDWH DQDORJV RI SKRVSKDWH VXFK DV YDQDGDWH PRO\EGDWH DQG IOXRULGH DUH SRWHQW LQKLELWRUV RI XWHURIHUULQ DQG WKH RWKHU SXUSOH LURQFRQWDLQLQJ DFLG SKRVSKDWDVHV /DFN RI LQKLELWLRQ E\ SQLWURSKHQRO VXJJHVWV WKDW WKH K\GURO\VLV UHDFWLRQ SURFHHGV YLD VHTXHQWLDO UHOHDVH RI SQLWURSKHQRO DQG SKRVSKDWH 'DYLV HW DO f ( S133 Uf§A ( S133 As(3LS133 S13 ( f 3L ( 3L 8WHURIHUULQ &RQWDLQV DW /HDVW 2QH +LJK 0DQQRVH 2OLJRVDFFKDULGH &KHQ HW DO f UHSRUWHG WKDW WKH SURJHVWHURQHLQGXFHG SXUSOH SURWHLQ RI WKH SRUFLQH XWHUXV ZDV D JO\FRSURWHLQ DQG WKDW WKH ROLJRVDFFKDULGH FRQWDLQHG VLJQLILFDQW DPRXQWV RI PDQQRVH 7KH VWUXFWXUH RI WKH WULDQWHQQDU\ RU PDQQRVH ROLJRVDFFKDULGH KDV EHHQ GHWHUPLQHG 6DXQGHUV HW DO f IRU XWHURIHUULQ SXULILHG IURP DOODQWRLF IOXLG DQG XWHULQH IOXVKHV IURP SVHXGRSUHJQDQW DQLPDOV 0DQ YrFO 0DQ ? m nm ? 0DQ 0DQ f§ A A*OF1$F f§\ *OF1$F fO 0DQ RFn f 0DQ n 7KH ELRV\QWKHVLV RI XWHURIHUULQnV ROLJRVDFFKDULGH FKDLQ KDV EHHQ VWXGLHG LQ YLWUR ZLWK H[SODQWV RI XWHULQH HQGRPHWULXP :KHQ >AS@ ZDV SURYLGHG WR VXFK FXOWXUHV WKH ODEHO EHFDPH LQFRUSRUDWHG LQWR WKH KLJK

PAGE 24

PDQQRVH ROLJRVDFFKDULGH FKDLQV RI XWHURIHUULQ %DXPEDFK HW DO f $SSUR[LPDWHO\ RQHWKLUG RI WKH ROLJRVDFFKDULGH FKDLQV FOHDYHG IURP XWHURIHUULQ E\ HQGRJO\FRVLGDVH + KDG SKRVSKRU\ODWHG FDUERK\GUDWH JURXSV 7KXV XWHURIHUULQ D VHFUHWHG DFLG SKRVSKDWDVH FDUULHV WKH O\VRVRPDO UHFRJQLWLRQ PDUNHU PDQQRVH SKRVSKDWH FRQVLGHUHG WR EH UHVSRQVLEOH IRU WKH LQWUDFHOOXODU WDUJHWLQJ RI DFLG K\GURO\VHV IURP WKH *ROJL FRPSOH[ WR WKH O\VRVRPHV 6KHSKDUG HW DO f 7KHVH UHVXOWV LPSOLHG WKDW XWHURIHUULQ LV D VXEVWUDWH LQ YLYR IRU WKH ILUVW RI WKH WZR HQ]\PHV UHVSRQVLEOH IRU WKH DGGLWLRQ RI SKRVSKDWH WR WHUPLQDO PDQQRV\O UHVLGXHV RQ O\VRVRPDO HQ]\PHV 8'31DFHW\OJOXFRVDPLQH O\VRVRPDO HQ]\PH 1DFHW\OJOXFRVDPLQH SKRVSKDWH WUDQVIHUDVH SKRVSKRWUDQVIHUDVHf DGGV 1DFHW\OJOXFRVDPLQH SKRVSKDWH IURP WKH QXFOHRWLGH VXJDU 8'31DFHW\O JOXFRVDPLQH WR WKH SRVLWLRQ RI WHUPLQDO PDQQRVH UHVLGXHV 7KHQ 1DFHW\OJOXFRVDPLQHOSKRVSKRGLHVWHU RF1DFHW\OJOXFRVDPLQLGDVH SKRVSKRGLHVWHUDVHf FOHDYHV WKH UHVXOWLQJ SKRVSKRGLHVWHU ERQG DGMDFHQW WR WKH 1DFHW\OJOXFRVDPLQH UHVLGXH *ROGEHUJ DQG .RUQIHOG f 5HFHSWRUV IRU PDQQRVH SKRVSKDWH WKHQ WUDQVSRUW WKHVH HQ]\PHV IURP WKH *ROJL WR O\VRVRPHV 6KHSKDUG HW DO f ,W ZDV DOVR GHPRQVWUDWHG WKDW XWHURIHUULQ LV DQ H[FHOOHQW VXEVWUDWH IRU WKH SKRVSKRWUDQVIHUDVH LQ YLWUR /DQJ HW DO f LQ IDFW LW ZDV WKH EHVW VXEVWUDWH RI WKRVH WHVWHG VR IDU :K\ LV XWHURIHUULQ VHFUHWHG UDWKHU WKDQ GLUHFWHG WR O\VRVRPHV" 7KHUH DUH D QXPEHU RI SRVVLEOH H[SODQDWLRQV $OWKRXJK XWHURIHUULQ LV D JRRG VXEVWUDWH IRU WKH SKRVSKRWUDQVIHUDVH WKH FRYHULQJ 1DFHW\On JOXFRVDPLQH LV QRW HIILFLHQWO\ UHPRYHG E\ WKH SKRVSKRGLHVWHUDVH WKXV PDVNLQJ WKH PDQQRVH SKRVSKDWH %DXPEDFK HW DO f DQG VXFK

PAGE 25

SKRVSKRGLHVWHUV DUH SRRU VXEVWUDWHV IRU ERWK PDQQRVH SKRVSKDWH UHFHSWRUV +RIODFN HW DO f 7KH SUHVHQFH RI RQO\ RQH SKRVSKRU\ODWHG PDQQRVH UHVLGXH RQ XWHURIHUULQnV ROLJRVDFFKDULGH PD\ DOVR PDNH LW D SRRU OLJDQG IRU WKH PDQQRVH SKRVSKDWH UHFHSWRUV 6 .RUQIHOG SHUVRQDO FRPPXQLFDWLRQf 7KH PRVW OLNHO\ H[SODQDWLRQ KRZHYHU LV WKDW WKH UDWH RI XWHURIHUULQ V\QWKHVLV LQ WKH SUHJQDQW XWHUXV RXWVWULSV WKH LQWUDFHOOXODU WDUJHWLQJ PHFKDQLVP )LQDOO\ LW LV DOVR SRVVLEOH WKDW WKH SULPDU\ DPLQR DFLG VHTXHQFH RI XWHURIHUULQ FRQWDLQV WDUJHWLQJ LQIRUPDWLRQ WKDW GLUHFWV LW WR VHFUHWRU\ JUDQXOHV GHVSLWH WKH IDFW WKDW LW FDUULHV SKRVSKRU\ODWHG PDQQRVH UHVLGXHV 7KH )XQFWLRQ RI 8WHURIHUULQ 5REHUWV DQG %D]HU f KDYH SURSRVHG WKDW WKH SULPDU\ IXQFWLRQ RI XWHURIHUULQ LV QRW SKRVSKDWH HVWHU K\GURO\VLV EXW LQ LURQ PHWDEROLVP 8WHURIHUULQnV KLJK .P XQXVXDO VXEVWUDWH VSHFLILFLW\ DQG ODFN RI DFWLYLW\ DW WKH S+ RI WKH IOXLG HQYLURQPHQW LQ ZKLFK LW LV IRXQG DUJXHV DJDLQVW DQ HQ]\PDWLF UROH 7KH XWHUXV RI D PLGSUHJQDQW SLJ FDQ SURGXFH PRUH WKDQ WZR JUDPV RI XWHURIHUULQ SHU GD\ %DVKD HW DO f DQ DPRXQW IDU H[FHHGLQJ WKDW ZKLFK FRXOG FRQFHLYDEO\ EH XVHG IRU HQ]\PDWLF SXUSRVHV 6LQFH ODUJH TXDQWLWLHV RI XWHURIHUULQ DUH NQRZQ WR FURVV WKH SLJ SODFHQWD DQG WKH LURQ IURP > )H@ ODEHOHG XWHURIHUULQ LV XVHG IRU IHWDO HU\WKURSRLHVLV %XKL HW DO D 'XFVD\ HW DO 5HQHJDU HW DO f WKH UROH RI XWHURIHUULQ LQ WKH SUHJQDQW SLJ LV SURSRVHG WR EH LQ LURQ WUDQVSRUW 7KH SLJ KDV D QRQLQYDVLYH W\SH RI SODFHQWDWLRQ DQG DW QR WLPH GXULQJ SUHJQDQF\ LV WKH XWHULQH HSLWKHOLXP HURGHG 7KH FRQFHSWXV WKHUHIRUH UHOLHV XSRQ WKH VHFUHWLRQ RI PDFURPROHFXODU SURGXFWV E\ WKH

PAGE 26

PRWKHU IRU D ODUJH SDUW RI SUHJQDQF\ 8VLQJ D YDULHW\ RI LPPXQRFKHPLFDO DQG UDGLRWUDFHU WHFKQLTXHV WKH SDWK RI XWHURIHUULQ PRYHPHQW IURP WKH PRWKHU WR WKH IHWXV KDV EHHQ GHWHUPLQHG LQ WKH SLJ %XKL HW DO D 'XFVD\ HW DO 5HQHJDU HW DO 'XFVD\ HW DO 5REHUWV HW DO Ef 8WHURIHUULQ LV V\QWKHVL]HG LQ WKH XWHULQH JODQGV 5HQHJDU HW DO f HDFK RI ZKLFK LV FRYHUHG E\ D VSHFLDO UHJLRQ RI WKH FKRULRQ IHWDO SODFHQWDf FDOOHG DQ DUHROD 7KLV VWUXFWXUH LV PDGH XS RI VSHFLDOL]HG DEVRUSWLYH FHOOV ILOOHG ZLWK ODUJH HQGRF\WRWLF YDFXROHV 8WHURIHUULQ KDV EHHQ LGHQWLILHG LQ WKHVH VWUXFWXUHV E\ LPPXQRJROG VWDLQLQJ 5REHUWV HW DO Df DQG ZLWKLQ WKH YHQRXV GUDLQDJH RI WKH SODFHQWD ,W LV FOHDUHG IURP WKH EORRGVWUHDP LQ SDUW E\ WKH IHWDO OLYHU ZKLFK LV WKH PDMRU VLWH RI IHWDO KHPDWRSRLHVLV DQG DOVR E\ WKH NLGQH\ ZKHUH LW HQWHUV WKH XULQDU\ ILOWUDWH DQG LV YRLGHG LQWR WKH DOODQWRLF VDF 5HQHJDU HW DO f 8WHURIHUULQ LQ WKH DOODQWRLF IOXLG ORVHV LWV LURQ WR IHWDO WUDQVIHUULQ ZKLFK LQ WXUQ WUDQVSRUWV WKH LURQ WR WKH IHWDO OLYHU %XKL HW DO Df 8WHURIHUULQnV V\QWKHVLV LQ WKH SRUFLQH XWHUXV DQG LWV WXUQRYHU LQ WKH IHWDO OLYHU FRXOG WKHRUHWLFDOO\ VXSSO\ GHYHORSLQJ IHWXVHV ZLWK HQRXJK LURQ XQWLO GD\ RI SUHJQDQF\ +RZHYHU XWHURIHUULQ V\QWKHVLV DSSHDUV WR IDOO LQ ODWH SUHJQDQF\ MXVW ZKHQ LURQ GHPDQG IRU HU\WKURSRLHVLV LV DW D PD[LPXP 5REHUWV DQG %D]HU f 7KHUHIRUH RWKHU PHFKDQLVPV RI LURQ WUDQVSRUW PD\ EH QHFHVVDU\ LQ RUGHU WR VXSSO\ WKHVH QHHGV 2WKHU 3XUSOH ,URQFRQWDLQLQJ $FLG 3KRVSKDWDVHV 6HYHUDO RWKHU WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVHV KDYH EHHQ SXULILHG IURP D YDULHW\ RI VRXUFHV $ XWHURIHUULQOLNH SXUSOH DFLG

PAGE 27

SKRVSKDWDVH KDV EHHQ SXULILHG IURP WKH XWHULQH VHFUHWLRQV RI PDUHV LQ SURORQJHG GLHVWUXV =DY\ HW DO 0F'RZHOO HW DO f $Q DFLG SKRVSKDWDVH KDV DOVR EHHQ SDUWLDOO\ SXULILHG IURP WKH XWHULQH VHFUHWLRQV RI FRZV WUHDWHG ZLWK SURJHVWHURQH 'L[RQ DQG *LEERQV f 7KHVH GLVFRYHULHV ZHUH QRW XQH[SHFWHG EHFDXVH WKH SLJ WKH FRZ DQG WKH PDUH KDYH VLPLODU W\SHV RI QRQLQYDVLYH SODFHQWDWLRQ ,Q D EDVLF SXUSOH SKRVSKRSURWHLQ SKRVSKDWDVH ZDV LGHQWLILHG LQ EHHI VSOHHQ 5HYHO DQG 5DFNHU *ORPVHW DQG 3RUDWK f DQG ZDV ODWHU VKRZQ WR FRQWDLQ LURQ &DPSEHOO DQG =HUQHU f /LNH XWHURIHUULQ WKLV HQ]\PH VKRZHG LQWHQVH DEVRUSWLRQ LQ WKH UDQJH QP DQG FRQWDLQHG WZR LURQ ELQGLQJ VLWHV 'DYLV HW DO f 'DYLV HW DO DOVR GHPRQVWUDWHG WKDW WKH VXEVWUDWH VSHFLILFLWLHV VHQVLWLYLW\ WR LQKLELWRUV DQG DFWLYDWLRQ E\ UHGXFLQJ DJHQWV H[KLELWHG E\ WKH EHHI VSOHHQ HQ]\PH ZHUH VLPLODU WR WKRVH RI XWHURIHUULQ +RZHYHU WKH EHHI VSOHHQ HQ]\PH 0U f ZDV UHSRUWHG WR EH PDGH XS RI WZR VXEXQLWV 0U DQG f ZKLOH XWHURIHUULQ LV D PRQRPHULF HQ]\PH 0U f 7KH EHHI VSOHHQ HQ]\PH KDV EHHQ ZHOO FKDUDFWHUL]HG ZLWK UHJDUG WR LWV LURQ ELQGLQJ VLWHV ZKLFK DUH YLUWXDOO\ LGHQWLFDO WR WKRVH RI XWHURIHUULQ GLVFXVVHG HDUOLHUf 7KXV WKH ERYLQH VSOHHQ HQ]\PHnV LURQ FOXVWHU LV DQ DV\PPHWULFDO FRPSOH[ FRQWDLQLQJ WZR )H,,,f LRQV RQH RI ZKLFK LV UHGXFHG WR )H,,f E\ UHGXFWLYH DFWLYDWLRQ RI WKH HQ]\PHV 'DYLV DQG $YHULOO $QWDQDLWLV DQG $LVHQ 'HEUDQQHU HW DO $QWDQDLWLV DQG $LVHQ f 7KH IXQFWLRQ RI WKH EHHI VSOHHQ HQ]\PH KDV EHHQ DGGUHVVHG RQO\ UHFHQWO\ 6FKLQGHOPHLVHU HW DO f KDYH ORFDOL]HG WKH HQ]\PH WR O\VRVRPDOOLNH RUJDQHOOHV RI FHOOV RI WKH UHWLFXORSKDJRF\WLF V\VWHP

PAGE 28

7KH SKDJRF\WRVLQJ FHOOV WKDW FRQWDLQHG WKH SKRVSKDWDVH ZHUH IUHTXHQWO\ IRXQG LQ FORVH FRQWDFW ZLWK FOXVWHUV RI DJHG DQG GHIRUPHG HU\WKURF\WHV 7KH DXWKRUV K\SRWKHVL]HG WKDW WKH HQ]\PH LV LQYROYHG HLWKHU LQ WKH EUHDNGRZQ RI HU\WKURF\WH PHPEUDQH DQG F\WRVNHOHWDO SKRVSKRSURWHLQV RU LQ WKH PHWDEROLVP RI LURQ IURP WKHVH HU\WKURF\WHV 7KHUH KDYH EHHQ UHSRUWV RI D ERYLQH VNHOHWDO WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH DVVXPHG WR EH GLVWLQFW IURP WKH ERYLQH VSOHHQ HQ]\PH /DX HW DO f 7KLV ERYLQH VNHOHWDO HQ]\PH UHVHPEOHV WKH ERYLQH VSOHHQ HQ]\PH DQG SRUFLQH XWHURIHUULQ LQ LWV PROHFXODU ZHLJKW S+ RSWLPXP VXEVWUDWH VSHFLILFLWLHV DQG VHQVLWLYLW\ WR LQKLELWRUV /LNH XWHURIHUULQ DQG XQOLNH WKH ERYLQH VSOHHQ HQ]\PH WKH ERYLQH VNHOHWDO HQ]\PH LV UHSRUWHG WR EH PRQRPHULF 7KH DXWKRUV FKRVH WR VWUHVV WKH SKRVSKRW\URVLQH SKRVSKDWDVH DFWLYLW\ RI WKH HQ]\PH DQG SRVWXODWHG WKDW WKH VNHOHWDO DFLG SKRVSKDWDVH IXQFWLRQV LQ WKH UHJXODWLRQ RI SUROLIHUDWLRQ DQG GLIIHUHQWLDWLRQ 7KH DXWKRUV KDYH QRW \HW GHVFULEHG D SK\VLRORJLF VXEVWUDWH IRU WKLV SKRVSKRU\URV\OVSHFLILF SURWHLQ SKRVSKDWDVH DQG KDYH QRW GHPRQVWUDWHG WKDW LW SOD\V DQ LPSRUWDQW UROH LQ FHOO JURZWK 7KXV WKH IXQFWLRQ RI WKH DFLG SKRVSKDWDVH LQ ERQH UHPDLQV XQNQRZQ 3XUSOH LURQFRQWDLQLQJ DFLG SKRVSKDWDVHV KDYH EHHQ SXULILHG IURP UDW VSOHHQ +DUD HW DO f DQG UDW ERQH .DWR HW DO $QGHUVRQ DQG 7RYHUXG f DQG DQ LPPXQRORJLFDOO\ UHODWHG SKRVSKDWDVH ZDV SXULILHG LQ VPDOO TXDQWLWLHV IURP UDW HSLGHUPLV +DUD HW DO f 7KHVH PRQRPHULF HQ]\PHV DOVR UHVHPEOHG XWHURIHUULQ LQ PROHFXODU ZHLJKW VXEVWUDWH VSHFLILFLWLHV DQG VHQVLWLYLW\ WR LQKLELWRUV +DUD HW DO f EHOLHYH WKDW WKH VSOHHQ DQG HSLGHUPLV HQ]\PHV PD\ SOD\ D

PAGE 29

UROH LQ QXFOHRWLGH PHWDEROLVP DQG WKDW WKH ERQH HQ]\PH PD\ EH DFWLQJ DV D SKRVSKRSURWHLQ SKRVSKDWDVH LQ YLYR $OWKRXJK $QGHUVRQ DQG 7RYHUXG f KDYH LQGLFDWHG WKDW VWXGLHV ZHUH XQGHUZD\ WR GHWHUPLQH WKH IXQFWLRQ RI WKH UDW ERQH HQ]\PH WKH IXQFWLRQV RI WKH UDW HQ]\PHV DOVR UHPDLQ REVFXUH +XPDQ $FLG 3KRVSKDWDVHV 7KH KXPDQ DFLG SKRVSKDWDVHV ZHUH ILUVW FKDUDFWHUL]HG E\ UHVHDUFKHUV LQWHUHVWHG LQ WKH FOLQLFDO VLJQLILFDQFH RI DFLG SKRVSKDWDVH OHYHOV LQ QRUPDO DQG SDWKRORJLFDO WLVVXH 2QH RI WKH KXPDQ HQ]\PHV D FDWLRQLF WDUWUDWHUHVLVWDQW HQ]\PH NQRZQ DV WKH 7\SH SKRVSKDWDVH ZDV RI LQWHUHVW WR XV EHFDXVH LW VHHPHG DV WKRXJK LW PLJKW EH UHODWHG WR WKH ZHOO FKDUDFWHUL]HG DEXQGDQW DFLG SKRVSKDWDVH SRUFLQH XWHURIHUULQ &KDUDFWHUL]DWLRQ RI WKH +XPDQ $FLG 3KRVSKDWDVHV /L HW DO f GHVFULEHG HOHFWURSKRUHWLF VHSDUDWLRQ RI KXPDQ OHXNRF\WH DFLG SKRVSKDWDVHV RQ b SRO\DFU\ODPLGH JHOV DW S+ ZKLFK ZHUH WKHQ VWDLQHG IRU DFLG SKRVSKDWDVH DFWLYLW\ 7KH\ GHWHFWHG VL[ LVR]\PHV RI DFLG SKRVSKDWDVH YDU\LQJ LQ HOHFWURSKRUHWLF PRELOLW\ %DQG GLG QRW HQWHU WKH JHO %DQG ZDV WKH VORZHVW PLJUDWLQJ IRUP EDQG WKH IDVWHVW DQG PRVW EDVLF 7KH YDULRXV LVR]\PHV FRXOG DOVR EH GLVWLQJXLVKHG E\ WKHLU VXEVWUDWH VSHFLILFLWLHV DQG VHQVLWLYLW\ WR LQKLELWRUV /DP HW DO f GHVFULEHG LQ GHWDLO WKH GLVWULEXWLRQ RI DFLG SKRVSKDWDVHV LQ QRUPDO KXPDQ WLVVXH ,VR]\PHV DQG ZHUH WKH PRVW ZLGHO\ GLVWULEXWHG DQG PRVW DFWLYH IRUPV +LJKHU W\SH OHYHOV ZHUH FKDUDFWHULVWLF RI WKH SURVWDWH 7\SH ZDV WKH OHDVW FRPPRQ DQG OHDVW

PAGE 30

DEXQGDQW LVR]\PH GHWHFWHG LQ RQO\ VPDOO TXDQWLWLHV LQ VSOHHQ NLGQH\ DQG OLYHU 7KHVH UHVHDUFKHUV QRWLFHG GLIIHUHQFHV LQ DFLG SKRVSKDWDVH OHYHOV DQG LQ UHODWLYH LVR]\PH UDWLRV LQ QRUPDO SODVPD DQG OHXNRF\WHV YHUVXV WKRVH IURP SDWLHQWV ZLWK FHUWDLQ GLVHDVHV ,Q QRUPDO OHXNRF\WHV EDQG ZDV WKH VWURQJHVW EDQGV DQG ZHUH RI PRGHUDWH VWUHQJWK DQG EDQG ZDV YHU\ ZHDN
PAGE 31

+DLU\ &HOO /HXNHPLD 7KH RULJLQ RI KDLU\ FHOOV KDV EHHQ D VXEMHFW RI FRQWURYHUV\ IRU D QXPEHU RI \HDUV 6XUIDFH PDUNHU VWXGLHV GRQH ZLWK PRQRFORQDO DQWLERGLHV KDYH UHYHDOHG KDLU\ FHOOV ZLWK SURSHUWLHV FRPPRQ WR ERWK %FHOOV DQG 7FHOOV %XUQV HW DO :RUPDQ HW DO $UPLWDJH HW DO f +DLU\ FHOOV KDYH EHHQ VKRZQ WR SKDJRF\WRVH ODWH[ SDUWLFOHV SURSHUWLHV ZKLFK LQGLFDWHG D FRPPRQ RULJLQ ZLWK PRQRF\WHV RU KLVWLRF\WHV 5RVHQV]DMQ HW DO f +RZHYHU PRVW UHVHDUFKHUV QRZ DJUHH WKDW KDLU\ FHOOV KDYH RULJLQDWHG IURP %O\PSKRF\WHV SRVVLEO\ VSOHQLF ZKLWH SXOS PDUJLQDO ]RQH O\PSKRF\WHV 9DQ GHU 2RUG HW DO f 0RUH VSHFLILFDOO\ KDLU\ FHOOV PD\ RULJLQDWH IURP D O\PSKRF\WH LQ D WHUPLQDO VWDJH RI GLIIHUHQWLDWLRQ DW WKH SRLQW RI VZLWFKLQJ IURP DQ ,J0EHDULQJ VPDOO O\PSKRF\WH WR D PDWXUH SODVPD FHOO -DQVHQ HW DO f 5HFHQWO\ LW ZDV SURSRVHG WKDW WKH KDLU\ FHOO PD\ UHSUHVHQW WKH WHUPLQDOO\ GLIIHUHQWLDWHG %O\PSKRF\WH 5RELQVRQ HW DO *D]LWW DQG 3ROOLDFN f &OLQLFDOO\ KDLU\ FHOO OHXNHPLD LV UHSUHVHQWHG E\ D VORZ LQVLGLRXV RQVHW VSOHQRPHJDO\ DQHPLD DQG WKH DSSHDUDQFH RI OHXNHPLF KDLU\ FHOOV LQ WKH VSOHHQ ERQH PDUURZ DQG SHULSKHUDO EORRG 1DQED HW DO f 6LJQLILFDQW TXDQWLWLHV RI WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH DUH FRQWDLQHG LQ WKH UHWLFXOXP DQG HSLWKHOLRLG FHOOV RI WKH SDWLHQWVn VSOHHQV ,Q WKH SDVW VSOHQHFWRP\ ZDV RIWHQ SHUIRUPHG LQ RUGHU WR UHGXFH WKH WXPRU ORDG 0RUH UHFHQWO\ LW KDV EHHQ GHPRQVWUDWHG WKDW RFLQWHUIHURQ WUHDWPHQW LV VXFFHVVIXO LQ FDXVLQJ UHPLVVLRQ LQ KDLU\ FHOO OHXNHPLD SDWLHQWV VHH 3RU]VROW f

PAGE 32

7DUWUDWHUHVLVWDQW $FLG 3KRVSKDWDVH /HYHOV LQ 2WKHU 'LVHDVHV 7DUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH OHYHOV DUH HOHYDWHG LQ VHYHUDO W\SHV RI OHXNHPLD RWKHU WKDQ KDLU\ FHOO OHXNHPLD EXW QRW LQ D FRQVLVWHQW PDQQHU 'UH[OHU HW DO f KDYH VWXGLHG DFLG SKRVSKDWDVH OHYHOV LQ D YDULHW\ RI KXPDQ OHXNHPLD FHOO OLQHV DQG LQ IUHVK OHXNHPLD FHOOV REWDLQHG GLUHFWO\ IURP SDWLHQWV 7KHVH UHVHDUFKHUV IRXQG WKDW WKH IHZ OHXNHPLD FHOO OLQHV ZKLFK GLG H[SUHVV WKH SKRVSKDWDVH ZHUH WKRVH ZKLFK UHSUHVHQWHG O\PSKRF\WHV DUUHVWHG ODWH LQ GLIIHUHQWLDWLRQ 0DQ\ UHVHDUFKHUV QRZ EHOLHYH WKDW WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH PD\ EH XVHIXO DV DQ HQ]\PDWLF PDUNHU IRU %O\PSKRF\WH GLIIHUHQWLDWLRQ 'UH[OHU HW DO f DQG WKDW PHDVXUHPHQW RI LWV DFWLYLW\ PD\ KDYH SURJQRVWLF YDOXH 3LHWHUV DQG 9HHUPDQ f 0HDVXUHPHQW RI VHUXP DFLG SKRVSKDWDVH OHYHOV PD\ DOVR EH RI FOLQLFDO VLJQLILFDQFH :KLOH WKH 7\SH WDUWUDWH UHVLVWDQW DFLG SKRVSKDWDVH LV QRW GHWHFWHG DW KLJK OHYHOV LQ WKH SODVPD RI SDWLHQWV ZLWK KDLU\ FHOO OHXNHPLD SODVPD OHYHOV RI WKLV LVR]\PH DUH KLJK LQ SDWLHQWV ZLWK GLVHDVHV ZKLFK LQYROYH ERQH UHDEVRUSWLRQ DQG UHJHQHUDWLRQ DQG LQ SDWLHQWV ZLWK PDOLJQDQFLHV PHWDVWDVL]HG WR ERQH /DP HW DO f 7KHVH GLVHDVHV LQFOXGH 3DJHWnV GLVHDVH ZKLFK LV D W\SH RI ERQH WXPRU DQG RVWHRSRURVLV /L HW DO f 7DUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH DFWLYLW\ LV DOVR HOHYDWHG LQ WKH SODVPD RI FKLOGUHQ GXULQJ ERQH JURZWK &KHQ HW DO f 3ODVPD OHYHOV RI WKH 7\SH SKRVSKDWDVH DUH DOVR KLJK LQ SDWLHQWV ZLWK *DXFKHUnV GLVHDVH ZKLFK LV DQ LQKHULWHG JO\FRVSKLQJROLSLG VWRUDJH GLVHDVH FKDUDFWHUL]HG E\ JOXFRFHUHEURVLGDVH GHILFLHQF\ 7KH SKRVSKDWDVH LQ *DXFKHUnV GLVHDVH LV EHOLHYHG E\ VRPH

PAGE 33

UHVHDUFKHUV WR EH RI RVWHRFODVW RULJLQ DQG PRVW OLNHO\ D VHFRQGDU\ SKHQRPHQRQ LQGLFDWLYH RI ERQH LQYROYHPHQW &KR\ f ,W LV LQWHUHVWLQJ WR QRWH WKDW ZKLOH WKH DFLG SKRVSKDWDVH RI KDLU\ FHOOV LV LQWUDFHOOXODU FRQILQHG WR GLVFUHWH LQFOXVLRQ ERGLHV UHVHPEOLQJ O\VRVRPHV /DP HW DO f RVWHRFODVWV VHFUHWH WKLV HQ]\PH XQGHU WKH LQIOXHQFH RI SDUDWK\URLG KRUPRQH 0LOOHU %UDLGPDQ HW DO &KDPEHUV HW DO f ,W LV QRW FOHDU ZKHWKHU WKH VHFUHWHG RVWHRFODVW DQG O\VRVRPDO VSOHHQ 7\SH SKRVSKDWDVHV DUH GLVWLQFW HQ]\PHV 3XULILFDWLRQ DQG &KDUDFWHUL]DWLRQ RI WKH +XPDQ 7\SH ,VR]\PH ,Q DOO RI WKH VWXGLHV GHVFULEHG DERYH DFLG SKRVSKDWDVH OHYHOV ZHUH PHDVXUHG E\ KLVWRFKHPLFDO PHWKRGV RU E\ HQ]\PDWLF VWDLQLQJ RI QRQn GHQDWXULQJ SRO\DFU\ODPLGH JHOV 7KHUH DUH D IHZ UHSRUWV LQ WKH OLWHUDWXUH RI DWWHPSWV WR SXULI\ DQG FKDUDFWHUL]H WKH KXPDQ WDUWUDWH UHVLVWDQW DFLG SKRVSKDWDVH $OWKRXJK WKHVH UHSRUWV FRQWDLQ VRPH FRQWUDGLFWRU\ LQIRUPDWLRQ RQH IDFW EHFRPHV DSSDUHQW 7KLV KXPDQ 7\SH WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH KDV D QXPEHU RI SURSHUWLHV UHPLQLVFHQW RI SRUFLQH XWHURIHUULQ $Q DWWHPSW ZDV PDGH E\ /DP DQG
PAGE 34

DOVR OLNH XWHURIHUULQ K\GURO\]HG SQLWURSKHQ\OSKRVSKDWH $73 DQG S\URSKRVSKDWH EXW ZDV YLUWXDOO\ LQDFWLYH WRZDUGV KH[RVH SKRVSKDWHV "JO\FHURO SKRVSKDWH DQG $03 7KH KXPDQ HQ]\PH ZDV DOVR DFWLYDWHG E\ PLOG UHGXFLQJ DJHQWV DQG YHU\ VHQVLWLYH WR LQKLELWLRQ E\ PRO\EGDWH $ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH ZDV DOVR SXULILHG IURP D *DXFKHUnV GLVHDVH VSOHHQ 5RELQVRQ DQG *OHZ f 7KLV HQ]\PH ZDV EHOLHYHG WR EH GLVWLQFW IURP WKH KDLU\ FHOO VSOHHQ HQ]\PH /LNH XWHURIHUULQ DQG WKH RWKHU SXUSOH LURQFRQWDLQLQJ DFLG SKRVSKDWDVHV WKLV HQ]\PH ZDV UHSRUWHG WR KDYH DQ 0U RI ,W ERXQG DYLGO\ WR &RQFDQDYDOLQ $ 6HSKDURVH LQGLFDWLQJ LWV JO\FRSURWHLQ QDWXUH ,W WRR ZDV VHQVLWLYH WR LQKLELWLRQ E\ PRO\EGDWH IOXRULGH DQG GLWKLRQLWH +RZHYHU WKLV HQ]\PH KDG D QXPEHU RI IHDWXUHV ZKLFK ZHUH XQOLNH WKH KDLU\ FHOO HQ]\PH ,W ZDV UHSRUWHG WKDW WKH *DXFKHU HQ]\PH ZDV PDGH XS RI WZR VXEXQLWV RI 0U DQG GLG QRW K\GURO\]H S\URSKRVSKDWH DQG ZDV QRW DFWLYDWHG E\ UHGXFLQJ DJHQWV 7KXV LW ZDV QRW FOHDU ZKHWKHU WKH *DXFKHU VSOHHQ DQG KDLU\ FHOO VSOHHQ HQ]\PHV ZHUH WKH VDPH SURWHLQ (IVWUDWLDWLV DQG 0RVV f SDUWLDOO\ SXULILHG DQ 0U WDUWUDWHUHVLVWDQW PRO\EGDWHVHQVLWLYH DFLG SKRVSKDWDVH IURP OXQJ DQG GHWHFWHG DQ DSSDUHQWO\ LGHQWLFDO HQ]\PH LQ RVWHRFODVWV ,W LV QRW NQRZQ ZKHWKHU WKH OXQJRVWHRFODVW WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH LV LGHQWLFDO WR HLWKHU RI WKH VSOHHQ HQ]\PHV $OWKRXJK LW ZDV RQFH EHOLHYHG WKDW XWHURIHUULQ ZDV XQLTXHO\ DVVRFLDWHG ZLWK WKH XWHUXV 5REHUWV DQG %D]HU f LW LV QRZ FOHDU WKDW WKHUH LV D JURZLQJ IDPLO\ RI SXUSOH LURQFRQWDLQLQJ DFLG SKRVSKDWDVHV 7KH KXPDQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH PD\ EHORQJ WR WKLV HQ]\PH IDPLO\ %HFDXVH RI WKH FOLQLFDO VLJQLILFDQFH RI WKH

PAGE 35

KXPDQ 7\SH SKRVSKDWDVH LW VHHPHG WR EH D VXEMHFW ZRUWK\ RI IXUWKHU VWXG\ ,Q &KDSWHU WKH SXULILFDWLRQ RI WKH KXPDQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH WR KRPRJHQHLW\ LV GHVFULEHG DQG LWV SK\VLFDO SURSHUWLHV DUH FOHDUO\ GHILQHG 7KH HQ]\PDWLF FKDUDFWHULVWLFV RI WKH SKRVSKDWDVH DUH GHVFULEHG LQ GHWDLO DQG WKH LPPXQRORJLF UHODWLRQVKLS RI WKH KXPDQ HQ]\PH WR WKH SXUSOH LURQFRQWDLQLQJ DFLG SKRVSKDWDVHV LV LQYHVWLJDWHG &KDSWHU GHDOV ZLWK WKH PROHFXODU FORQLQJ RI D F'1$ FRGLQJ IRU WKH KXPDQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH WKH FKDUDFWHULVWLFV RI WKH GHGXFHG DPLQR DFLG VHTXHQFH DQG WKH H[SUHVVLRQ RI WKH HQ]\PH LQ OHXNHPLD FHOOV

PAGE 36

&+$37(5 7+( 7<3( 7$575$7(5(6,67$17 $&,' 3+263+$7$6( )520 63/((1 2) +80$16 :,7+ +$,5< &(// /(8.(0,$ 385,),&$7,21 3523(57,(6 ,00812/2*,&$/ &+$5$&7(5,=$7,21 $1' &203$5,621 :,7+ 325&,1( 87(52)(55,1 ,QWURGXFWLRQ 0HDVXUHPHQW RI VHUXP DQG WLVVXH OHYHOV RI DFLG SKRVSKDWDVH FDQ SURYH XVHIXO LQ WKH GLDJQRVLV RI VHYHUDO KXPDQ GLVHDVH VWDWHV *XWPDQ HW DO
PAGE 37

7KH HQ]\PH SURGXFHG E\ WKH VSOHHQ KLVWLRF\WHV RI SDWLHQWV ZLWK *DXFKHUnV GLVHDVH KDV EHHQ SXULILHG LQ YHU\ VPDOO TXDQWLWLHV E\ 5RELQVRQ DQG *OHZ f 7KLV SKRVSKDWDVH ZDV DFWLYDWHG E\ UHGXFLQJ DJHQWV DQG KDG KLJK FDWDO\WLF DFWLYLW\ WRZDUGV D YDULHW\ RI VXEVWUDWHV ERWK DUWLILFLDO DQG QDWXUDO ZKLFK KDG VWURQJ OHDYLQJ JURXSV EXW KDG YHU\ ORZ DFWLYLW\ WRZDUGV DOLSKDWLF SKRVSKDWH HVWHUV ,W ZDV DOVR D SKRVSKRSURWHLQ SKRVSKDWDVH $ VLPLODU HQ]\PH KDV EHHQ LVRODWHG IURP WKH VSOHHQ RI D SDWLHQW ZLWK KDLU\ FHOO OHXNHPLD /DP DQG
PAGE 38

WKH IDFW WKDW XWHURIHUULQ SDUWLFXODUO\ ZKHQ DFWLYDWHG ZLWK PLOG UHGXFLQJ DJHQWV VXFK DV DVFRUEDWH RU PHUFDSWRHWKDQRO LV D SRWHQW DFLG SKRVSKDWDVH 6FKORVQDJOH HW DO f KDV UDLVHG TXHVWLRQV DV WR ZKHWKHU LURQ WUDQVSRUW LV WKH PDMRU RU RQO\ IXQFWLRQ RI WKH SURWHLQ 'DYLV HW DO f ,Q WKLV UHJDUG DFLG SKRVSKDWDVHV ZKLFK DUH FOHDUO\ VLPLODU WR XWHURIHUULQ LQ WKHLU VSHFWUDO SURSHUWLHV PROHFXODU ZHLJKW DQG LURQ FRQWHQW KDYH EHHQ LVRODWHG IURP D YDULHW\ RI VRXUFHV $QWDQDLWLV DQG $LVHQ f ,Q DGGLWLRQ WKHUH DUH VHYHUDO GHVFULSWLRQV RI DFLG SKRVSKDWDVHV LQFOXGLQJ WKH 7\SH KXPDQ LVR]\PH ZKLFK UHVHPEOH XWHURIHUULQ LQ WKHLU HQ]\PDWLF SURSHUWLHV EXW ZKLFK KDYH HLWKHU QRW EHHQ SXULILHG RU HOVH KDYH EHHQ LVRODWHG LQ VXFK VPDOO TXDQWLWLHV WKDW WKH\ KDYH QRW EHHQ IXOO\ FKDUDFWHUL]HG 5REHUWV DQG %D]HU f )RU WKH DERYH UHDVRQV LW KDV EHHQ SURSRVHG WKDW XWHURIHUULQ PD\ EH EXW RQH PHPEHU RI D EURDG FODVV RI DFLG SKRVSKDWDVHV ZKLFK KDV D ZLGH GLVWULEXWLRQ 5REHUWV DQG %D]HU f &KDSWHU FRQWDLQV WKH GHVFULSWLRQ RI D VLPSOH PHWKRG IRU WKH SXULILFDWLRQ RI WKH HQ]\PH IURP KXPDQ VSOHHQ E\ PDNLQJ XVH RI DQWLERGLHV WR WKH UHDGLO\ DYDLODEOH XWHURIHUULQ ,W LV GHPRQVWUDWHG FRQFOXVLYHO\ WKDW WKLV KXPDQ LVR]\PH EHORQJV WR WKH FODVV RI LURQFRQWDLQLQJ DFLG SKRVSKDWDVH EHVW LOOXVWUDWHG E\ XWHURIHUULQ 0RQRFORQDO DQWLERGLHV KDYH EHHQ SUHSDUHG DJDLQVW ERWK XWHURIHUULQ DQG WKH KXPDQ HQ]\PH ZKLFK DSSHDU WR KDYH EURDG UHDFWLYLW\ WRZDUGV WKLV FODVV RI HQ]\PH 0DWHULDOV DQG 0HWKRGV 0DWHULDOV &0FHOOXORVH ZDV REWDLQHG IURP :KDWPDQ 6HSKDGH[ DQG 6HSKDURVH% IURP 3KDUPDFLD DQG 7ULWRQ ; IURP 5RKP DQG +DDV &R

PAGE 39

$OO VXEVWUDWHV DFWLYDWRUV DQG LQKLELWRUV H[FHSW DQLRQVf XVHG IRU DFLG SKRVSKDWDVH DVVD\V F\DQRJHQ EURPLGH SURWHLQ VWDQGDUGV )DVW *DUQHW *%& VDOW EXIIHUV DQG SURWHDVH LQKLELWRUV ZHUH SXUFKDVHG IURP 6LJPD 5HDJHQWV IRU WKH %UDGIRUG SURWHLQ DVVD\ ZHUH SXUFKDVHG IURP %LR5DG ,VR]\PH VWDQGDUGV IURP VHUXP IRU KXPDQ DFLG SKRVSKDWDVH DFWLYLW\f ZHUH REWDLQHG IURP &DOELRFKHP%HKULQJ $OO RWKHU FKHPLFDOV UHDJHQW JUDGH RU EHWWHUf ZHUH REWDLQHG IURP )LVKHU 0HWKRGV 3XULILFDWLRQ RI XWHURIHUULQ 8WHURIHUULQ ZDV SXULILHG IURP WKH XWHULQH VHFUHWLRQV RI SVHXGRSUHJQDQW SLJV RU IURP DOODQWRLF IOXLG DV SUHYLRXVO\ GHVFULEHG 6FKRVQDJOH HW DO 5REHUWV DQG %D]HU f $OODQWRLF IOXLG ZDV GLDO\]HG RYHUQLJKW DW r& DJDLQVW 0 7ULV+&O S+ $ VOXUU\ RI FDUER[\PHWK\OFHOOXORVH &0FHOOXORVH PO RI VHWWOHG UHVLQ SHU / DOODQWRLF IOXLGf ZDV DGGHG LQ WKH VDPH EXIIHU 7KLV PL[WXUH ZDV VWLUUHG IRU KRXU WKHQ SDFNHG LQWR D FROXPQ DQG ZDVKHG ZLWK WKH DERYH EXIIHU 7KH ERXQG EDVLF SURWHLQV ZHUH HOXWHG LQ RQH VWHS E\ D KLJK VDOW EXIIHU 0 7ULV+&O S+ 0 1D&Of 7KH SURWHLQV ZHUH GLDO\]HG DJDLQVW 0 7ULV+&O S+ DQG DSSOLHG WR D 6HSKDGH[ FROXPQ [ FPf ZKLFK KDG EHHQ SUHYLRXVO\ HTXLOLEUDWHG LQ 0 VRGLXP DFHWDWH S+ DQG 0 1D&O 8WHULQH VHFUHWLRQV RI SVHXGRSUHJQDQW DQLPDOV ZHUH ORDGHG GLUHFWO\ RQWR WKH 6HSKDGH[ FROXPQ DIWHU FHQWULIXJDWLRQ DW [J DW r& IRU PLQXWHVf 7KH SLQN KLJK PROHFXODU ZHLJKW XWHURIHUULQ SHDN ZKLFK LPPHGLDWHO\ SUHFHGHG WKH SXUSOH SHDN ZDV SRROHG DQG XVHG ZLWKRXW IXUWKHU SXULILFDWLRQ 7KH XWHURIHUULQ SHDN SXUSOH LQ FRORU ZDV SRROHG DQG GLDO\]HG DJDLQVW 0 7ULV+&O S+ 7KH XWHURIHUULQ ZDV WKHQ ORDGHG RQWR D FROXPQ RI

PAGE 40

&0FHOOXORVH DQG HOXWHG ZLWK D OLQHDU VDOW JUDGLHQW 0 1D&Of 8WHURIHUULQ HOXWHG DV D V\PPHWULFDO SHDN EHWZHHQ DQG 0 1D&O 7KH ILQDO SUHSDUDWLRQV RI XWHURIHUULQ KDG $$ UDWLRV RI OHVV WKDQ DQG JDYH D VLQJOH EDQG RI DSSDUHQW 0U XSRQ SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV 3$*(f LQ WKH SUHVHQFH RI VRGLXP GRGHF\O VXOIDWH 6'6f 3XULILFDWLRQ RI DFLG SKRVSKDWDVH IURP KXPDQ VSOHHQ 6SOHHQ WLVVXH ZDV XVHG IURP D PDOH DJHG ZKR ZDV GLDJQRVHG DV KDYLQJ KDLU\ FHOO OHXNHPLD 7KH ZHLJKW RI WKH VSOHHQ ZDV NJ 7KH QRUPDO FRQWURO VSOHHQ IURP DQ DFFLGHQW YLFWLP ZHLJKHG NJ 7LVVXH ZDV FXW LQWR VOLFHV WKH RXWHU IDVFLD UHPRYHG DQG WKH VOLFHV GLFHG LQWR VPDOO FXEHV 7KHVH ZHUH KRPRJHQL]HG DW r& LQ H[WUDFWLRQ EXIIHU >0 7ULV DFHWDWH S+ b YYf 1RQLGHW 3 b ZYf VRGLXP D]LGH ,P0 SKHQ\OPHWKDQHVXOIRQ\O IOXRULGH 306)f ,P0 ('7$ DQG DSURWLQLQ WU\SVLQ LQKLELWRU\ XQLWPOf@ E\ PHDQV RI D 7HFNPDU 0RGHO 6'7 KRPRJHQL]HU KDOIIXOO VHWWLQJf ZLWK WKH ODUJHVW SUREH XQWLO D KRPRJHQHRXV SUHSDUDWLRQ ZDV REWDLQHG $ YROXPH RI PO RI H[WUDFWLRQ EXIIHU ZDV XVHG IRU HDFK O22J RI WLVVXH 7KH KRPRJHQDWH ZDV FHQWULIXJHG [J PLQXWHVf DQG WKH VXSHUQDWDQW IUDFWLRQ GLDO\]HG RYHUQLJKW DJDLQVW 0 7ULV+&O EXIIHU S+ $ VOXUU\ POf RI &0FHOOXORVH ZDV DGGHG WR WKH UHWHQDWH DQG VWLUUHG IRU KRXU 7KLV PDWHULDO ZDV FROOHFWHG RQ D :KDWPDQ 1R ILOWHU SDSHU RQ D %XFKQHU IXQQHO $IWHU LW ZDV ZDVKHG VHYHUDO WLPHV ZLWK 0 7ULV+&O EXIIHU S+ WKH &0 FHOOXORVH ZDV VXVSHQGHG LQ WKH VDPH EXIIHU DQG ORDGHG LQWR D JODVV FROXPQ 3URWHLQV ZKLFK KDG UHPDLQHG ERXQG ZHUH HOXWHG ZLWK 0 1D&O ,Q LQLWLDO H[SHULPHQWV WKH HOXWHG PDWHULDO ZDV GLDO\]HG DQG ORDGHG RQWR D FROXPQ RI &0FHOOXORVH [ FPf LQ 0 7ULV+&O EXIIHU S+

PAGE 41

(OXWLRQ ZDV SHUIRUPHG E\ PHDQV RI D JUDGLHQW PO 0f RI 1D&O DW S+ )UDFWLRQV ZKLFK FRQWDLQHG WKH HQ]\PH ZHUH SRROHG GLDO\]HG DQG IUHH]HGULHG DQG WKHQ VXEMHFWHG WR JHO ILOWUDWLRQ RQ D FROXPQ [ FPf RI 6HSKDGH[ ZKLFK ZDV HTXLOLEUDWHG ZLWK 0 VRGLXP DFHWDWH EXIIHU S+ FRQWDLQLQJ 0 1D&O (OXWLRQ RI WKH SURWHLQ ZDV IROORZHG E\ LWV DEVRUEDQFH DW QP DQG E\ PHDVXULQJ DFLG SKRVSKDWDVH DFWLYLW\ VHH EHORZf )UDFWLRQV ZKLFK FRQWDLQHG WKH SKRVSKDWDVH ZHUH SRROHG DQG ORDGHG GLUHFWO\ RQWR DQ DQWLXWHURIHUULQ LPPXQRDIILQLW\ FROXPQ VHH EHORZf $IWHU WKH LPPXQRDIILQW\ FROXPQ KDG EHHQ ZDVKHG WKRURXJKO\ ZLWK ORDGLQJ EXIIHU 0 7ULV+&O S+ FRQWDLQLQJ 0 1D&Of WKH ERXQG HQ]\PH ZDV HOXWHG ZLWK 0 JO\FLQH+&O EXIIHU FRQWDLQLQJ 0 1D&O S+ ,W ZDV FROOHFWHG LQ PO IUDFWLRQV (DFK IUDFWLRQ ZDV LPPHGLDWHO\ QHXWUDOL]HG ZLWK PO RI 0 7ULV+&O S+ 0RUH UHFHQWO\ HQ]\PH ZKLFK KDG EHHQ HOXWHG IRUP WKH &0FHOOXORVH FROXPQ ZLWK 0 1D&O ZDV ORDGHG GLUHFWO\ RQWR WKH LPPXQRDIILQLW\ FROXPQ ZLWKRXW LQFOXGLQJ LQWHUYHQLQJ LRQ H[FKDQJH DQG JHO ILOWUDWLRQ VWHSV 3XULILFDWLRQ RI DFLG SKRVSKDWDVH IURP KXPDQ SODFHQWD $ QRUPDO WHUP SODFHQWD ZHLJKLQJ J ZDV HPSOR\HG WR SXULI\ WKH DFLG SKRVSKDWDVH E\ H[DFWO\ WKH VDPH SURFHGXUH GHVFULEHG IRU KXPDQ VSOHHQ $Q DOWHUQDWLYH PHWKRG RI HQ]\PH SXULILFDWLRQ ZDV HPSOR\HG IRU D VHFRQG QRUPDO WHUP SODFHQWD ZHLJKLQJ J 7KH VHFRQG SODFHQWD ZDV KRPRJHQL]HG LQ PO RI D O\VLV EXIIHU ZKLFK FRQVLVWHG RI 0 .& b YYf 1RQLGHW 3 ,P0 306) DQG b ZYf VRGLXP D]LGH $IWHU FHQWULIXJDWLRQ DW [J IRU PLQXWHV DW r& SURWDPLQH VXOIDWH ZDV DGGHG WR WKH VXSHUQDWDQW IUDFWLRQ WR b ZYf 7KH VROXWLRQ ZDV VWLUUHG IRU KRXU DW r&

PAGE 42

WKHQ FHQWULIXJHG DW [J IRU PLQXWHV 7KH UHVXOWLQJ VXSHUQDWDQW IUDFWLRQ ZDV GLDO\]HG RYHUQLJKW DJDLQVW 0 7ULV+&O S+ $ VOXUU\ RI &0FHOOXORVH POf ZDV DGGHG DQG WKH PL[WXUH VWLUUHG IRU KRXU DW r& 7KH ERXQG SURWHLQV ZHUH HOXWHG IURP WKH &0FHOOXORVH DV GHVFULEHG IRU XWHURIHUULQ 7KH HQWLUH SRRO RI EDVLF SURWHLQV ZDV WKHQ VXEMHFWHG WR LPPXQRDIILQLW\ FKURPDWRJUDSK\ DV GHVFULEHG IRU WKH KXPDQ VSOHHQ HQ]\PH 3XULILFDWLRQ RI WKH ERYLQH VSOHHQ DFLG SKRVSKDWDVH 7KH SURFHGXUH GHVFULEHG IRU WKH KXPDQ VSOHHQ HQ]\PH ZDV DOVR HPSOR\HG IRU WKH ERYLQH VSOHHQ HQ]\PH $SSUR[LPDWHO\ J RI EHHI VSOHHQ WLVVXH ZHUH XVHG 3XULILFDWLRQ RI WKH UDW VSOHHQ SKRVSKDWDVH 7KH VSOHHQV RI WKUHH UDWV DSSUR[LPDWHO\ Jf ZHUH KRPRJHQL]HG DV GHVFULEHG IRU WKH KXPDQ HQ]\PH $IWHU FHQWULIXJDWLRQ DW [J WKH VXSHUQDWDQW IUDFWLRQ ZDV ORDGHG GLUHFWO\ RQWR WKH LPPXQRDIILQLW\ FROXPQ (OXWLRQ ZDV SHUIRUPHG DV GHVFULEHG IRU WKH KXPDQ HQ]\PH 3XULILFDWLRQ RI WKH ERYLQH XWHULQH DFLG SKRVSKDWDVH %RYLQH XWHULQH IOXLGV ZHUH REWDLQHG IURP WKH OLJDWHG XWHULQH KRUQ RI GD\ XQLODWHUDOO\ SUHJQDQW FDWWOH %DUWRO f $SSUR[LPDWHO\ PO RI ERYLQH XWHULQH IOXLGV ZHUH GLDO\]HG RYHUQLJKW DJDLQVW OLWHUV RI 0 7ULV+&O S+ 7KH VROXWLRQ ZDV FHQWULIXJHG [J PLQXWHVf WR UHPRYH SDUWLFXODWH PDWWHU DQG SDVVHG WKURXJK D FROXPQ O[ FPf RI &0FHOOXORVH HTXLOLEUDWHG LQ WKH VDPH EXIIHU $IWHU ZDVKLQJ WKH FROXPQ SURWHLQV ZKLFK KDG ERXQG ZHUH HOXWHG ZLWK 0 1D&O LQ 0 7ULV+&O S+ 7KHVH EDVLF SURWHLQV ZHUH WKHQ VXEMHFWHG WR JHO ILOWUDWLRQ RQ D FROXPQ [ FPf RI 6HSKDGH[ ZKLFK KDG EHHQ HTXLOLEUDWHG ZLWK 0 DFHWDWH EXIIHU S+ FRQWDLQLQJ 0 1D&O 3URWHLQ

PAGE 43

FRQFHQWUDWLRQ ZDV PRQLWRUHG E\ DEVRUEDQFH DW QP DQG DFLG SKRVSKDWDVH DFWLYLW\ PRQLWRUHG E\ SQLWURSKHQ\OSKRVSKDWDVH DFWLYLW\ VHH EHORZf 0HDVXUHPHQW RI SQLWURSKHQYOSKRVSKDWDVH DFWLYLW\ 7KH VWDQGDUG FRORULPHWULF DVVD\ XWLOL]HG DQ DSSURSULDWHO\ GLOXWHG VDPSOH RI HQ]\PH P0 SQLWURSKHQ\OSKRVSKDWH DQG 0 VRGLXP DFHWDWH EXIIHU S+ IRU XWHURIHUULQ S+ IRU WKH KXPDQ DQG UDW HQ]\PHV S+ IRU WKH EHHI VSOHHQ HQ]\PH DQG S+ IRU WKH ERYLQH XWHULQH HQ]\PHf LQ D ILQDO YROXPH RI PO 7KH HQ]\PHV ZHUH DVVD\HG LQ WKH SUHVHQFH RI 0 PHUFDSWRHWKDQRO H[FHSW ZKHUH VWDWHG LQ WKH WH[W 7KH UHDFWLRQ ZDV DOORZHG WR SURFHHG DW r& IRU PLQXWHV DQG VWRSSHG E\ WKH DGGLWLRQ RI PO RI 0 1D2+ 7KH DEVRUEDQFH ZDV WKHQ UHDG DW QP $FWLYLW\ LV H[SUHVVHG DV XQLWV ZKHUH RQH XQLW LV WKH UHOHDVH RI OAPRO SQLWUR SKHQROPLQXWH +\GURO\VLV RI RWKHU VXEVWUDWHV :LWK WKH H[FHSWLRQ RI SKRVYLWLQ RWKHU VXEVWUDWHV ZHUH DVVD\HG DW D ILQDO FRQFHQWUDWLRQ RI P0 7KH UHOHDVH RI RUWKRSKRVSKDWH ZDV PHDVXUHG VSHFWURSKRWRPHWULFDOO\ E\ WKH PHWKRG RI %DUWOHWW f ZKLFK LQYROYHV WKH UHGXFWLRQ RI SKRVSKRPRO\EGDWH WR D EOXH FRORU (PD[ QPf %ODQNV ZLWKRXW HQ]\PH ZHUH UXQ IRU HDFK VXEVWUDWH 7KH UHOHDVH RI RUWKRSKRVSKDWH IURP SKRVYLWLQ PJPOf ZDV PHDVXUHG DV GHVFULEHG E\ 5REHUWV DQG %D]HU f S+ RSWLPD 7KH S+ RSWLPD RI WKH DFLG SKRVSKDWDVHV ZHUH GHWHUPLQHG ZLWK WKH XVH RI 0 VRGLXP DFHWDWH S+ 0 7ULV DFHWDWH S+ DQG 0 7ULV+&O S+ DV EXIIHUV 7KH VXEVWUDWH XVHG ZDV SQLWURSKHQ\OSKRVSKDWH

PAGE 44

3URWHLQ GHWHUPLQDWLRQ 3URWHLQ FRQFHQWUDWLRQ ZDV GHWHUPLQHG E\ WKH PHWKRG RI /RZU\ HW DO f ZLWK FU\VWDOOLQH ERYLQH VHUXP DOEXPLQ DV D VWDQGDUG ,Q RUGHU WR PHDVXUH ORZ DPRXQWV RI SURWHLQ OHVV WKDQ Jf WKH PHWKRG RI %UDGIRUG f ZDV HPSOR\HG ZLWK O\VR]\PH DV D VWDQGDUG VHH %LR5DG %XOOHWLQ )HEUXDU\ f 'HWHUPLQDWLRQ RI LURQ ,URQ ZDV PHDVXUHG E\ WKH PHWKRG RI &DPHURQ f DV PRGLILHG E\ &DPSEHOO DQG =HUQHU f $OO JODVVZDUH ZDV VRDNHG LQ 0 +& DQG ULQVHG VHYHUDO WLPHV ZLWK LURQIUHH ZDWHU WR UHPRYH PHWDO FRQWDPLQDQWV 3URWHLQ VDPSOHV EODQNV DQG IHUURXV DPPRQLXP VXOIDWH VWDQGDUGV ZHUH WUHDWHG ZLWK b YYf SHUFKORULF DFLG IRU PLQXWHV DW URRP WHPSHUDWXUH WR UHOHDVH LURQ IURP WKH SURWHLQ $ VROXWLRQ RI b ZYf K\GUR[\ODPLQH K\GURFKORULGH ZDV DGGHG DQG WKH VDPSOHV ZHUH OHIW DW URRP WHPSHUDWXUH IRU PLQXWHV )LQDOO\ EDWKR SKHQDQWUROLQH VROXWLRQ PJPOf S\ULGLQH DQG LURQ IUHH ZDWHU ZHUH DGGHG VXFFHVVLYHO\ WR HDFK VDPSOH DQG WKH VROXWLRQV PL[HG WKRURXJKO\ 7KH DEVRUEDQFH RI WKH VROXWLRQV ZDV PHDVXUHG DW QP 7KH FRQFHQWUDWLRQ RI LURQ LQ WKH SURWHLQ ZDV REWDLQHG IURP D SORW RI DEVRUEDQFH YHUVXV LURQ FRQFHQWUDWLRQ RI WKH VWDQGDUGV ZKLFK ZDV OLQHDU RYHU D UDQJH RI QJ ,PPXQRDIILQLWY FKURPDWRJUDSK\ 6HSKDURVH &/% SXUFKDVHG LQ LWV F\DQRJHQ EURPLGH DFWLYDWHG IRUP ZDV SUHSDUHG DFFRUGLQJ WR WKH LQVWUXFWLRQV RI WKH PDQXIDFWXUHU 3URWHLQ ZDV FRXSOHG WR WKH PDWUL[ LQ 0 VRGLXP FDUERQDWH S+ DQG 0 1D&O DW r& RQ D WXEH WXUQHU $OWHUQDWLYHO\ 6HSKDURVH % ZDV DFWLYDWHG IRU PLQXWHV DW r& LQ 0 SRWDVVLXP SKRVSKDWH S+ XVLQJ F\DQRJHQ EURPLGH &XDWUHFDFDV HW DO f GLVVROYHG LQ 1n 1n GLPHWK\O IRUPDPLGH 7KH JHO ZDV ZDVKHG ZLWK

PAGE 45

0 VRGLXP ELFDUERQDWH S+ 3URWHLQV ZHUH FRXSOHG DW r& RYHUQLJKW RQ D WXEH WXUQHU LQ D EXIIHU RI 0 VRGLXP ELFDUERQDWH S+ DQG 0 1D&O 8QUHDFWHG VLWHV RQ WKH PDWULFHV ZHUH EORFNHG ZLWK 0 HWKDQRODPLQH S+ IRU KRXUV DW r& DIWHU ZDVKLQJ RXW XQERXQG SURWHLQ ZLWK WKH FRXSOLQJ EXIIHU )LQDOO\ WKH JHO ZDV ZDVKHG ZLWK 0 VRGLXP DFHWDWH S+ SOXV 0 1D&O IROORZHG E\ 0 VRGLXP ERUDWH S+ SOXV 0 1D&O 8WHURIHUULQ PJPOf SXULILHG DV GHVFULEHG DERYH ZDV FRXSOHG WR WKH PDWUL[ ZLWK D b FRXSOLQJ HIILFLHQF\ :KHQ VWRUHG DW r& LQ WKH SUHVHQFH RI b ZYf VRGLXP D]LGH LW UHWDLQHG LWV SXUSOH FRORUDWLRQ DQG DFLG SKRVSKDWDVH DFWLYLW\ IRU RYHU D \HDU 7KH XWHURIHUULQ 6HSKDURVH PDWUL[ ZDV HPSOR\HG WR SXULI\ DQWLXWHURIHUULQ SRO\FORQDO DQWLERGLHV VHH EHORZf $QWLXWHURIHUULQ SRO\FORQDO DQWLERGLHV ZHUH WKHQ FRXSOHG WR WKH PDWUL[ DW D FRQFHQWUDWLRQ RI O2PJ SURWHLQ SHU PO RI JHO 7KLV DQWLXWHURIHUULQ LPPXQRDIILQLW\ PDWUL[ ZDV HPSOR\HG WR ELQG WKH YDULRXV VSOHHQ HQ]\PHV 3UHSDUDWLRQ RI SRO\FORQDO DQWLERGLHV DJDLQVW XWHURIHUULQ 6DPSOHV RI XWHURIHUULQ XS WR O2PJf ZHUH PL[HG ZLWK PO RI )UHXQGnV &RPSOHWH $GMXYDQW WR IRUP DQ HPXOVLRQ DQG LQMHFWHG LQWUDGHUPDOO\ RYHU WKH VKRXOGHU UHDU OHJ DQG DEGRPLQDO UHJLRQV RI RQH VLGH RI D IHPDOH ODPE 6HYHQ GD\V ODWHU WKH SURFHGXUH ZDV UHSHDWHG RQ WKH RWKHU VLGH RI WKH ODPE $ WKLUG LQMHFWLRQ ZDV JLYHQ VHYHQ GD\V DIWHU WKH VHFRQG 2QH PRQWK DIWHU WKH ILUVW LQMHFWLRQ VHUXP ZDV FROOHFWHG E\ MXJXODU YHQLSXQFWXUH 7KH VHUXP ZDV DOORZHG WR FORW DW r& RYHUQLJKW )ROORZLQJ FHQWULIXJDWLRQ DW O222[J IRU PLQXWHV WKH VHUXP ZDV IUR]HQ LQ VPDOO DOLTXRWV

PAGE 46

3RO\DFU\ODPLGH SHO HOHFWURSKRUHVLV 6'6SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV 6'63$*(f ZDV FDUULHG RXW LQ b ZYf JHOV DFFRUGLQJ WR WKH PHWKRG RI /DHPPOL f 3URWHLQ VDPSOHV ZHUH VROXELOL]HG LQ b ZYf 6'6 P0 7ULV+&O S+ DQG b YYf PHUFDSWRHWKDQRO *HOV ZHUH VWDLQHG ZLWK b ZYf &RRPDVVLH %ULOOLDQW %OXH (OHFWURSKRUHVLV ZDV FDUULHG RXW XQGHU QRQGHQDWXULQJ FRQGLWLRQV DFFRUGLQJ WR WKH PHWKRG RI 5HLVILHOG HW DO f DV PRGLILHG E\ %DVKD HW DO f %DVLF SURWHLQV ZHUH UHVXVSHQGHG LQ P0 7ULV+&O S+ DQG b YYf JO\FHURO 7KH VDPSOHV ZHUH VXEMHFWHG WR HOHFWURSKRUHVLV LQ b ZYf SRO\DFU\ODPLGH JHOV S+ ZKLFK GLG QRW FRQWDLQ 6'6f LQ D DODQLQH EXIIHU S+ 3URWHLQV ZLWK DFLG SKRVSKDWDVH DFWLYLW\ ZHUH YLVXDOL]HG ZLWK RFQDSKWK\OSKRVSKDWH VXEVWUDWH DQG IDVW *DUQHW *%& DV WKH FRXSOLQJ G\H %LQGLQJ WR &RQFDQDYDOLQ $6HSKDURVH &RQ $6HSKDURVHf (Q]\PH VDPSOHV LQ 0 1D&O ZHUH DGMXVWHG WR S+ DQG ORDGHG RQWR D FROXPQ RI &RQ $6HSKDURVH DSSUR[LPDWHO\ PO EHG YROXPHf 7KH FROXPQ ZDV ZDVKHG ZLWK YROXPHV RI 0 7ULV+&O S+ 0 1D&O ,P0 &D&O ,P0 0Q&O DQG b ZYf VRGLXP D]LGH %RXQG SURWHLQ ZDV HOXWHG ZLWK ZDUP r&f 0 RFPHWK\O'PDQQRVLGH RU 0 DFHWLF DFLG %DXPEDFK HW DO f ,PPXQL]DWLRQ RI PLFH )HPDOH %DOEF PLFH DW ZHHNV RI DJH ZHUH LQMHFWHG ZLWK XJ RI DQWLJHQ LQWUDSHULWRQHDOO\ LS .DW]PDQQ HW DO f ZLWK DQWLJHQ HPXOVLILHG LQ )UHXQGnV &RPSOHWH $GMXYDQW $ VXEVHTXHQW LQMHFWLRQ RI LJ ZDV SHUIRUPHG DV DERYH ZLWK )UHXQGnV ,QFRPSOHWH $GMXYDQW GD\V ODWHU 2Q GD\ D ILQDO LQMHFWLRQ ZDV DGPLQLVWHUHG LQ QRUPDO VDOLQH b ZYf YLD WKH WDLO YHLQ 7KH

PAGE 47

DQWLJHQV HPSOR\HG ZHUH DV IROORZV )RU IXVLRQ KLJK PROHFXODU ZHLJKW XWHURIHUULQ ZDV HPSOR\HG 7KLV IXVLRQ ZDV RXWOLQHG LQ GHWDLO E\ %DXPEDFK f DQG ZDV FDUULHG RXW LQ FROODERUDWLRQ ZLWK *HRUJH %DXPEDFK )RU IXVLRQ XWHURIHUULQ SXUSOH 0U f ZDV HPSOR\HG )RU IXVLRQ WKH KXPDQ KDLU\ FHOO DFLG SKRVSKDWDVH ZDV XVHG *HQHUDWLRQ RI PRQRFORQDO DQWLERGLHV 7KH 63$J 63 6FKXOPDQ HW DO f QRQVHFUHWLQJ P\HORPD FHOO OLQH ZDV FXOWXUHG LQ 'XOEHFFRnV 0RGLILHG (DJOHnV PHGLXP '0(f FRQWDLQLQJ b YYf HDFK RI KHDW LQDFWLYDWHG IHWDO FDOI VHUXP DQG DJDPPDJOREXOLQHPLF KRUVH VHUXP DQWLELRWLF VROXWLRQ JPO SHQLFLOOLQ LJPO VWUHSWRP\FLQ LJPO DPSKRWHULFLQ %f DQG P0 JOXWDPLQH 2QH GD\ROG FRQGLWLRQHGf PHGLXP IURP ORJDULWKPLF FXOWXUHV ZDV KDUYHVWHG DQG XVHG IRU K\EULGRPD PHGLXP VXSSOHPHQWDWLRQ 7KH PHWKRG RI VSOHQRF\WH IXVLRQ DQG SURSDJDWLRQ RI WKH UHVXOWLQJ K\EULG FHOOV ZDV E\ HVWDEOLVKHG PHWKRGRORJLHV .HQQHW HW DO 2L DQG +HU]HQEHUJ f 7ZR PLFH ZHUH DQDHVWKHWL]HG ZLWK HWKHU DQG WKH VSOHHQV H[FLVHG DVHSWLFDOO\ WULPPHG RI IDW DQG WKHQ PLQFHG ZLWK VWHULOH VFDOSHO EODGHV LQ PO RI '0( 7KH WLVVXH ZDV WKHQ WULWXUDWHG VHYHUDO WLPHV DQG WKH ODUJH GHEULV DOORZHG WR VHWWOH 7KH VSOHQRF\WHV LQ WKH VXSHUQDWDQW IOXLG ZHUH WKHQ FROOHFWHG E\ FHQWULIXJDWLRQ DW O222[J IRU PLQXWHV DW URRP WHPSHUDWXUH ZDVKHG LQ PO RI '0( DQG UHVXVSHQGHG LQ D ILQDO YROXPH RI PO '0( DQG NHSW DW URRP WHPSHUDWXUH $SSUR[LPDWHO\ p 63 FHOOV ZHUH PL[HG DQG FHQWULIXJHG DW O222[J IRU PLQXWHV 7KH PL[WXUH RI FHOOV ZDV UHVXVSHQGHG LQ PO RI b ZYf SRO\HWK\OHQH JO\FRO LQ '0( IRU PLQXWH WKHQ GLOXWHG WR PO E\ WKH DGGLWLRQ RI PO HDFK PLQXWH IRU PLQXWHV RI '0(+$7 '0( ZLWK K\SR[DQWKLQH 2OP0

PAGE 48

DPLQRSWHULQ L0 WK\PLGLQH W0 /LWWOHILHOG f VXSSOHPHQWHG ZLWK b YYf HDFK RI IHWDO FDOI VHUXP DQG KHDWLQDFWLYDWHG DJDPPDJOREXOLQHPLF KRUVH VHUXP b YYf FRQGLWLRQHG PHGLXP DQG P0 JOXWDPLQH $OLTXRWV [Of ZHUH VHHGHG LQWR ZHOO PLFURWLWHU FXOWXUH GLVKHV DQG LQFXEDWHG LQ DQ DWPRVSKHUH RI b &2 DW r& 7ZR ZHHNV ODWHU WKH FXOWXUH VXSHUQDWDQW IOXLG ZDV ZLWKGUDZQ DQG DVVD\HG IRU VSHFLILF ELQGLQJ WR XWHURIHUULQ XVLQJ D VROLG SKDVH ELQGLQJ DVVD\ VHH EHORZf 3RVLWLYH FXOWXUHV ZHUH UHVXVSHQGHG LQ LO RI '0( +$7 VXSSOHPHQWHG DV GHVFULEHG DERYH DQG SODFHG LQ ZHOO FOXVWHU GLVKHV :KHQ D FXOWXUH ZDV FRQIOXHQW WKH FHOOV ZHUH WUDQVIHUUHG WR 2 FPf/ FXOWXUH IODVNV DQG PDLQWDLQHG LQ WKH PHGLXP GHVFULEHG IRU 63 FHOOV :KHQ FXOWXUHV ZHUH JURZLQJ ZHOO FHOO GHQVLWLHV ZHUH FRXQWHG ZLWK D KHPDF\WRPHWHU DQG WKH FHOOV FORQHG E\ OLPLWLQJ GLOXWLRQ 5HQQHW HW DO f 7KH FHOOV ZHUH GLOXWHG WR \LHOG DQ DYHUDJH RI RU FHOOV SHU LO 7KLUW\WZR ZHOOV ZHUH VHHGHG ZLWK HDFK GLOXWLRQ DQG WKH LQLWLDO FHOO GHQVLW\ ZKLFK VXEVHTXHQWO\ KDG OHVV WKDQ b RI WKH ZHOOV ZLWK JURZWK ZDV UHVFUHHQHG IRU DQWLERG\ SURGXFWLRQ +\EULGRPD FHOOV ZHUH PDLQWDLQHG DV GHVFULEHG IRU 63 FHOOV DQG ZHUH IUR]HQ LQ WKH VWDQGDUG JURZWK PHGLXP ZLWK b YYf IHWDO FDOI VHUXP DQG b YYf JO\FHURO RU b YYf GLPHWK\O VXOIR[LGH 3XULILFDWLRQ RI PRXVH DQWLERGLHV ,PPXQH VHUD IURP PLFH ZHUH FROOHFWHG LPPHGLDWHO\ SULRU WR VSOHQHFWRP\ E\ FXWWLQJ WKH GHVFHQGLQJ DRUWD DVSLUDWLQJ WKH EORRG LQWR D K\SRGHUPLF V\ULQJH 1RQLPPXQH QRUPDOf PRXVH VHUD ZHUH FROOHFWHG IURP XQLQMHFWHG KHDOWK\ DQDHVWKHWL]HG DQLPDOV

PAGE 49

&XOWXUH PHGLXP IURP JURZLQJ K\EULGRPD FHOOV ZDV XVHG DV D VRXUFH RI PRQRFORQDO DQWLERG\ LQ VRPH LQVWDQFHV ,Q RWKHU FDVHV DVFLWHV IOXLG ZDV SUHSDUHG E\ JURZLQJ FORQHG K\EULGRPD FHOOV [ Af LQ WKH SHULWRQHDO FDYLW\ GD\V DIWHU LS LQMHFWLRQV RI PO SULVWDQH WHWUDPHWK\OSHQWDGHFDQHf VSDFHG GD\V DSDUW 7KH DVFLWHV IOXLG ZDV KDUYHVWHG DIWHU WKH WXPRU KDG JURZQ VXIILFLHQWO\ DERXW GD\V 7KH VDPSOH ZDV DOORZHG WR FORW DW r& FHQWULIXJHG DW [J IRU PLQXWHV DQG VRGLXP D]LGH ZDV DGGHG WR b ZYf ,RGLQDWLRQ RI DQWLERGLHV ,RGLQDWLRQ ZDV SHUIRUPHG DFFRUGLQJ WR WKH PHWKRG RI 0DUNZHOO DQG )R[ f DQG 0DUNZHOO 3LHUFH &KHPLFDO &RPSDQ\ EXOOHWLQ f *ODVV WXEHV ZHUH FRDWHG ZLWK LJ ,RGRJHQ WHWUDFKORURRFRFGLSKHQ\OJO\FROOXULOf E\ HYDSRUDWLRQ RI PHWK\OHQH FKORULGH 0RXVH DQWLERGLHV DJDLQVW XWHURIHUULQ RU WKH KXPDQ HQ]\PH [Jf LQ PO RI EXIIHU 0 VRGLXP EDUELWDO S+ 0 1D&Of ZHUH DGGHG WR WKH ,RGRJHQ FRDWHG WXEH &DUULHUIUHH 1DAA, O22AL&Lf ZDV DGGHG DQG WKH WXEH VKDNHQ JHQWO\ HYHU\ PLQXWH IRU PLQXWHV 7KH LRGLQDWHG SURWHLQ ZDV VHSDUDWHG IURP XQUHDFWHG Aa!, E\ GLDO\VLV 0 7ULV+&O S+ f RU JHO ILOWUDWLRQ RQ D FROXPQ RI 6HSKDGH[ 0 7ULV+&O S+ 0 1D&Of $VVD\ RI DQWLERGLHV $QWLJHQ ZDV GLDO\]HG RYHUQLJKW DJDLQVW SKRVSKDWHEXIIHUHG VDOLQH 3%6 0 1D&O P0 .+32 P0 1D+3&! P0 .& P0 0J&O ,P0 &D&O S+ f DQG DGMXVWHG WR D FRQFHQWUDWLRQ RI LJPO $QWLJHQ ZDV SDVVLYHO\ DGVRUEHG RYHUQLJKW DW r& WR SRO\YLQ\OFKORULGH PLFURWLWHU IOH[ SODWHV DV RXWOLQHG E\ 7VX DQG +HU]HQEHUJ f 7KH SODWHV ZHUH ZDVKHG WKUHH WLPHV ZLWK 3%6 FRQWDLQLQJ b ZYf ERYLQH VHUXP DOEXPLQ %6$f DQG b ZYf VRGLXP

PAGE 50

D]LGH +\EULGRPD FXOWXUH PHGLXP POf RU GLOXWHG PRXVH DQWLVHUD ZHUH DGGHG DQG DOORZHG WR ELQG IRU KRXU DW URRP WHPSHUDWXUH 7KH SODWHV ,2& ZHUH ZDVKHG DV DERYH DQG FSP RI /r-,ODEHOHG DQWLPRXVH ,J* LQ PO ZHUH DGGHG DQG DOORZHG WR ELQG IRU KRXU 7KH SODWHV ZHUH ZDVKHG DV DERYH WKH ZHOOV FXW RXW DQG ERXQG UDGLRDFWLYLW\ PHDVXUHG LQ D JDPPD FRXQWHU ,PPXQH DQG QRQLPPXQH VHUD ZHUH UHSOLFDWH WHVWHG VL[ WLPHV DQG FXOWXUH PHGLD ZHUH WHVWHG LQ GXSOLFDWH $IILQLWLHV RI DQWLERGLHV 0RQRFORQDO DQWLERGLHV DJDLQVW XWHURIHUULQ RU WKH VSOHHQ HQ]\PH ZHUH DIILQLW\ SXULILHG IURP HLWKHU FHOO JURZWK PHGLXP RU IURP DVFLWHV IOXLG RQ XWHURIHUULQ LPPRELOL]HG RQ 6HSKDURVH % 7KH SURFHGXUH ZDV LGHQWLFDO WR WKDW GHVFULEHG HDUOLHU 7KH SXULILHG DQWLERGLHV ZHUH VHULDOO\ GLOXWHG LQ 3%6 FRQWDLQLQJ %6$ OPJPOf RYHU D UDQJH RI FRQFHQWUDWLRQV H[WHQGLQJ IURP nA WR O2nA0 8WHURIHUULQ RU WKH VSOHHQ DFLG SKRVSKDWDVHV ZHUH SODWHG RXW LQWR ZHOOV RQ IOH[YLQ\O SODWHV DV GHVFULEHG LQ WKH SUHYLRXV VHFWLRQ $IWHU WKH ZHOOV ZHUH ZDVKHG DQG WKH UHPDLQLQJ DGVRUSWLRQ VLWHV ZHUH EORFNHG ZLWK %6$ WKH SODWHV ZHUH GULHG $SSURSULDWHO\ GLOXWHG VROXWLRQV RI DQWLERG\ POf ZHUH WKHQ DGGHG WR WKH ZHOOV DQG DIWHU KRXU WKH\ ZHUH ZLWKGUDZQ DQG WKH SODWHV ZHUH ZDVKHG 7KH DPRXQW RI DQWLERG\ WKDW ERXQG DW HDFK GLOXWLRQ ZDV WKHQ PHDVXUHG E\ DGGLWLRQ RI D FRQVWDQW DPRXQW RI D VHFRQG ODEHOHG DQWLERG\ 7KLV DQWLERG\ ZDV AMBODEHOHG VKHHS DQWLPRXVH ,J* VHH EHORZf ,WV VSHFLILF DFWLYLW\ ZDV DSSUR[LPDWHO\ A FSPLJ $IWHU KRXU WKLV VROXWLRQ ZDV ZLWKGUDZQ WKH SODWHV ZHUH ZDVKHG DQG HDFK ZHOO ZDV DQDO\]HG IRU UDGLRDFWLYLW\ VHSDUDWHO\ LQ D JDPPD FRXQWHU $OO GHWHUPLQDWLRQV ZHUH FDUULHG RXW LQ GXSOLFDWH &RQWUROV ZHUH GHVFULEHG LQ WKH SUHYLRXV VHFWLRQ 7KH ELQGLQJ DIILQLWLHV RI HDFK PRQRFORQDO

PAGE 51

DQWLERG\ WR WKH GLIIHUHQW DQWLJHQV ZHUH FDOFXODWHG E\ WKH PHWKRG RI 6FDWFKDUG f &RPSHWLWLYH ELQGLQJ RI PRQRFORQDO DQWLERGLHV ,Q RUGHU WR GHWHUPLQH ZKHWKHU YDULRXV PRQRFORQDO DQWLERGLHV ERXQG WR WKH VDPH RU GLIIHUHQW VLWHV RQ XWHURIHUULQ D FRPSHWLWLYH ELQGLQJ DVVD\ ZDV HPSOR\HG 8WHURIHUULQ ZDV DGVRUEHG WR WKH ZHOOV RI IOH[YLQ\O SODWHV DV GHVFULEHG ,2& HDUOLHU 0RQRFORQDO DQWLERGLHV ZHUH LRGLQDWHG ZLWK F-, WR D VSHFLILF DFWLYLW\ RI DSSUR[LPDWHO\ A FSPSJ 6DPSOHV RI DQWLERG\ PO FSPf ZHUH DGGHG WR HDFK ZHOO LQ SUHVHQFH RI LQFUHDVLQJ FRQFHQWUDWLRQV f fA0f RI WKH VHFRQG XQODEHOHG DQWLERG\ ,I WKLV VHFRQG DQWLERG\ IDLOHG WR FRPSHWH RU FRPSHWHG SRRUO\ ZLWK WKH ODEHOHG DQWLERG\ IRU ELQGLQJ WR XWHURIHUULQ LW ZDV DVVXPHG WR RFFXS\ D GLVWLQFW VLWH RQ WKH SURWHLQ 7KUHH PRQRFORQDO DQWLERGLHV DQG f ZKLFK ERXQG WR XWHURIHUULQ ZLWK KLJK DIILQLW\ DSSHDUHG WR FRPSHWH RQO\ SRRUO\ ZLWK HDFK RWKHU LQ WKH DERYH DVVD\ 5HVXOWV 3XULILFDWLRQ RI 8WHURIHUULQ )LJXUH O$ VKRZV WKH IUDFWLRQDWLRQ RQ 6HSKDGH[ RI WKH EDVLF SURWHLQV REWDLQHG IURP RQH VDPSOH OLWHUVf RI DOODQWRLF IOXLG REWDLQHG IURP D GD\ SUHJQDQW SLJ 7KUHH PDMRU SURWHLQ IUDFWLRQV ZHUH DSSDUHQW DQG GHVLJQDWHG )8, ),9 DQG )9 E\ SUHYLRXV FRQYHQWLRQ 0XUUD\ HW DO &KHQ HW DO f 7KH DYHUDJH PROHFXODU ZHLJKWV RI WKHVH IUDFWLRQV ZHUH FDOFXODWHG WR EH DSSUR[LPDWHO\ DQG UHVSHFWLYHO\ )UDFWLRQ 9 FRQWDLQHG O\VR]\PH 5REHUWV HW DO f DQG D JURXS RI WU\SVLQSODVPLQ LQKLELWRUV 0XOOLQV HW DO )D]OHDEDV HW DO f DQG ZLOO QRW EH GLVFXVVHG IXUWKHU )UDFWLRQ ,9 SXUSOH LQ

PAGE 52

)LJ 3XULILFDWLRQ RI XWHURIHUULQ IURP DOODQWRLF IOXLG RI D GD\ SUHJQDQW SLJ $ 6HSKDGH[ FKURPDWRJUDSK\ $OODQWRLF IOXLG DSSUR[LPDWHO\ /f IURP D GD\ SUHJQDQW SLJ ZDV GLDO\]HG DQG WKHQ VWLUUHG ZLWK &0FHOOXORVH DW S+ %DVLF SURWHLQV ZHUH HOXWHG ZLWK 0 1D&O DQG WKHQ ORDGHG RQWR D [ FP FROXPQ RI 6HSKDGH[ 3URWHLQ ZDV PRQLWRUHG E\ DEVRUEDQFH DW QP $f 7KH SHDNV DUH ODEHOHG )8, ),9 DQG )9 DV H[SODLQHG LQ WKH WH[W % &0FHOOXORVH LRQ H[FKDQJH FKURPDWRJUDSK\ )LOO SURWHLQV REWDLQHG E\ 6HSKDGH[ FKURPDWRJUDSK\ LQ $f ZHUH GLDO\]HG DQG DSSOLHG WR D [ FP FROXPQ RI &0FHOOXORVH (OXWLRQ ZDV SHUIRUPHG ZLWK D PO JUDGLHQW 0f RI 1D&O 3URWHLQ ZDV PRQLWRUHG E\ DEVRUEDQFH DW QP $f DQG SXUSOH FRORUDWLRQ E\ DEVRUEDQFH DW QP $f 8WHURIHUULQ HOXWHG DV D VLQJOH SHDN EHWZHHQ DQG 0 1D&O

PAGE 53

$ )5$&7,21 $ f! %

PAGE 54

FRORU FRQWDLQHG XWHURIHUULQ :KHQ ),9 ZDV SRROHG GLDO\]HG ORDGHG RQWR D FROXPQ RI &0FHOOXORVH DQG HOXWHG ZLWK D OLQHDU VRGLXP FKORULGH JUDGLHQW XWHURIHUULQ HOXWHG DV D VLQJOH V\PPHWULFDO SHDN )LJ %f 6DPSOHV ZLWK DQ $$ UDWLR RI OHVV WKDQ ZHUH SRROHG DQG FRQVLGHUHG WR EH SXUH XWHURIHUULQ %XKL f ,Q WKLV W\SLFDO SUHSDUDWLRQ RI XWHURIHUULQ IURP DOODQWRLF IOXLG DERXW PJ RI SXUH XWHURIHUULQ ZHUH REWDLQHG ZKLFK LV FRQVLGHUHG WR EH DQ DYHUDJH \LHOG 5REHUWV DQG %D]HU f )UDFWLRQ ,,, KDG DQ REYLRXV SLQN FRORU DQG ZDV GHPRQVWUDWHG WR EH D KLJK PROHFXODU ZHLJKW IRUP RI XWHURIHUULQ FRQVLVWLQJ RI XWHURIHUULQ QRQFRYDOHQWO\ DVVRFLDWHG ZLWK D VHFRQG SURWHLQ ZKRVH IXQFWLRQ LV XQNQRZQ %DXPEDFK HW DO f 7KH \LHOG RI WKH KLJK PROHFXODU ZHLJKW XWHURIHUULQ SRROHG LPPHGLDWHO\ DIWHU WKH JHO ILOWUDWLRQ VWHS ZDV PJ 7KH DPRXQW RI )LOO REWDLQHG YDULHV JUHDWO\ EHWZHHQ DQLPDOV ZLWK XWHULQH VHFUHWLRQV IURP HDUO\ SUHJQDQF\ RU SVHXGRSUHJQDQF\ FRQWDLQLQJ PRUH )LOO WKDQ WKRVH IURP ODWH SUHJQDQF\ RU SVHXGRSUHJQDQF\ %DXPEDFK HW DO f 7KH VSHFLILF DFWLYLWLHV RI XWHURIHUULQ DQG KLJK PROHFXODU ZHLJKW XWHURIHUULQ IURP WKLV SUHSDUDWLRQ ZHUH VKRZQ WR EH DSSUR[LPDWHO\ XQLWVPJ SURWHLQ DQG XQLWVPJ SURWHLQ UHVSHFWLYHO\ 7KH WRWDO UHFRYHUDEOH DFLG SKRVSKDWDVH DFWLYLW\ IURP WKH DOODQWRLF IOXLG RI WKLV GD\ SUHJQDQW SLJ ZDV JUHDWHU WKDQ [ A XQLWV 3XULILFDWLRQ RI WKH +XPDQ 7\SH $FLG 3KRVSKDWDVH IURP +DLU\ &HOO 6SOHHQ /HYHOV RI DFLG SKRVSKDWDVH LQ VSOHHQV IURP D SDWLHQW ZLWK KDLU\ FHOO OHXNHPLD DQG IURP D QRUPDO LQGLYLGXDO DUH SUHVHQWHG LQ 7DEOH 1RWH WKDW WKH VSOHHQ RI WKH SDWLHQW ZLWK KDLU\ FHOO OHXNHPLD ZDV JUHDWO\ HQODUJHG ,Q DGGLWLRQ WKH VSHFLILF DFWLYLW\ RI WKH H[WUDFW IURP WKH

PAGE 55

7$%/( SKRVSKDWDVH DFWLYLW\ LQ VSOHHQ KRPRHHQDWHV IURP D SDWLHQW ZLWK KDLU\ FHOO OHXNHPLD DQG IURP DQ LQGLYLGXDO ZLWK D QRUPDO VSOHHQ :HLJKW RI $GGLWLRQ WR 3DWLHQW 6SOHHQ 3KRVSKDWDVH $VVD\ 6SHFLILF $FWLYLW\ NJ XQLWVPJ SURWHLQ 1RQH 0 1D. WDUWUDWH 0 PHUFDSWRHWKDQRO 1RQH 0 1D. WDUWUDWH 0 PHUFDSWRHWKDQRO 5HVXOWV IURP VSOHHQ ZHLJKW NJf ZHUH REWDLQHG IURP [J VXSHUQDWDQW IUDFWLRQ RI D VOLFH Jf RI WLVVXH WKDW KDG EHHQ IUR]HQ r&f IRU ZHHNV SULRU WR DVVD\ 5HVXOWV IURP VSOHHQ ZHUH REWDLQHG IURP WKH [J VXSHUQDWDQW IUDFWLRQ IURP IUHVKO\ KRPRJHQL]HG WLVVXH RI WKH HQWLUH RUJDQ ZKLFK ZHLJKHG NJ 1D. WDUWUDWH LV 5RFKHOOHnV VDOW DQG FRUUHVSRQGV ZLWK WKH /fIRUP RI WDUWUDWH

PAGE 56

ODUJH KDLU\ FHOO VSOHHQ ZDV DERXW IROG KLJKHU WKDQ WKDW IURP WKH QRUPDO VSOHHQ 0RUHRYHU WKH DFLG SKRVSKDWDVH DFWLYLW\ IURP WKLV VSOHHQ ZDV XQDIIHFWHG E\ WKH DGGLWLRQ RI O2P0 WDUWUDWH EXW ZDV VWLPXODWHG E\ WKH SUHVHQFH RI 0 PHFDSWRHWKDQRO %\ FRQWUDVW WDUWUDWH FDXVHG DOPRVW D b LQKLELWLRQ RI WKH WRWDO DFLG SKRVSKDWDVH DFWLYLW\ LQ WKH H[WUDFW RI QRUPDO VSOHHQ DQG WKHUH ZDV RQO\ D VOLJKW DFWLYDWLRQ ZLWK PHUFDSWRHWKDQRO 7ZR SURFHGXUHV KDYH EHHQ HPSOR\HG IRU SXULILFDWLRQ RI WKH WDUWUDWH UHVLVWDQW DFLG SKRVSKDWDVH LQ WKH H[WUDFW IURP WKH KDLU\ FHOO VSOHHQ 7KH ILUVW LV LOOXVWUDWHG LQ )LJ DQG HPSOR\HG D JUDGLHQW VDOW HOXWLRQ IURP D FROXPQ RI &0FHOOXORVH )LJ$f JHO ILOWUDWLRQ RQ 6HSKDGH[ )LJ %f DQG DV D ILQDO VWHS LPPXQRDIILQLW\ FKURPDWRJUDSK\ )LJ &f 7KH DFLG SKRVSKDWDVH ZKLFK LV YHU\ EDVLF ZDV HOXWHG IURP &0FHOOXORVH DW D VDOW FRQFHQWUDWLRQ RI 0 8SRQ JHO ILOWUDWLRQ WKH HQ]\PH HPHUJHG DV D SHDN RI DSSDUHQW 0U DERXW RQH IUDFWLRQ EHKLQG WKH HOXWLRQ SRVLWLRQ RI KLJKO\ SXULILHG XWHURIHUULQ 7KH IUDFWLRQV FRQWDLQLQJ WKH HQ]\PH ZHUH SRROHG DQG ORDGHG GLUHFWO\ RQWR DQ LPPXQRDIILQLW\ FROXPQ FRQVLVWLQJ RI DQWLXWHURIHUULQ DQWLERGLHV FRYDOHQWO\ OLQNHG WR 6HSKDURVH % $OO RI WKH SKRVSKDWDVH DFWLYLW\ ERXQG DQG FRXOG EH TXDQWLWDWLYHO\ HOXWHG XVLQJ ORZ S+ EXIIHU ,Q WKH VHFRQG SURFHGXUH WKH GLDO\]HG H[WUDFW RI WKH VSOHHQ ZDV DSSOLHG EDWFKZLVH WR &0FHOOXORVH DW S+ DQG WKH DFLG SKRVSKDWDVH DFWLYLW\ ZDV HOXWHG ZLWK 0 1D&O 5DWKHU WKDQ VXEMHFWLQJ WKH HQ]\PH ZKLFK KDG ERXQG WR IXUWKHU &0FHOOXORVH LRQ H[FKDQJH FKURPDWRJUDSK\ DQG JHO ILOWUDWLRQ WKH SUHSDUDWLRQ ZDV ORDGHG GLUHFWO\ RQWR WKH DQWL XWHURIHUULQ LPPXQRDIILQLW\ FROXPQ 7KLV DEEUHYLDWHG SURFHGXUH SURYLGHG

PAGE 57

)LJ 3XULILFDWLRQ RI KXPDQ VSOHHQ SKRVSKDWDVH $ &0FHOOXORVH LRQ H[FKDQJH FKURPDWRJUDSK\ 3RVW PLWRFKRQGULDO VXSHUQDWDQW IUDFWLRQ ZDV GLDO\]HG DQG WKHQ VWLUUHG ZLWK &0FHOOXORVH DW S+ 7KH HQ]\PH ZDV HOXWHG ZLWK 0 1D&O WKH UHVXOWLQJ HOXDWH ZDV GLDO\]HG DQG WKHQ UHDSSOLHG WR D [ FP FROXPQ RI &0FHOOXORVH (OXWLRQ ZDV SHUIRUPHG ZLWK D PO JUDGLHQW 0f RI 1D&O $FLG SKRVSKDWDVH DFWLYLW\ HOXWHG EHWZHHQ DQG 0 1D&O 8QLWV RI HQ]\PH f f DUH KHUH UHSUHVHQWHG E\ DEVRUSWLRQ YDOXHV DW QP REWDLQHG E\ LQFXEDWLRQ RI D VDPSOHV LQ PO RI 0 DFHWDWH EXIIHU S+ FRQWDLQLQJ P0 SQLWURSKHQ\OSKRVSKDWH DW r& IRU PLQXWHV 3URWHLQ f ZDV PRQLWRUHG E\ DEVRUEDQFH DW QP $ff % 6HSKDGH[ FKURPDWRJUDSK\ (Q]\PH SDUWLDOO\ SXULILHG E\ &0FHOOXORVH LRQ H[FKDQJH FKURPDWRJUDSK\ ZDV ORDGHG RQWR D [ FP FROXPQ RI 6HSKDGH[ (Q]\PH DQG SURWHLQ ZHUH DVVD\HG DV LQ $ & LPPXQRDIILQLW\ FKURPDWRJUDSK\ (Q]\PH IURP WKH 6HSKDGH[ FROXPQ ZDV ORDGHG RQWR WKH DQWLXWHURIHUULQ DQWLERG\ DIILQLW\ FROXPQ 7KH SKRVSKDWDVH ZDV HOXWHG ZLWK JO\FLQH EXIIHU S+ 7KH EHJLQQLQJ RI WKH HOXWLRQ LV LQGLFDWHG E\ DQ DUURZKHDG (Q]\PH DQG SURWHLQ ZHUH DVVD\HG DV LQ $

PAGE 58

$ 2 R 2 81,76 2) (1=<0(ff $ $

PAGE 59

D JUHDWHU WKDQ IROG SXULILFDWLRQ IURP WKH H[WUDFW RI WKH KDLU\ FHOO VSOHHQ ZLWKLQ KRXUV 7DEOH f 7KH ILQDO VSHFLILF DFWLYLWLHV KDYH YDULHG EHWZHHQ DERXW DQG XQLWVPJ RI SURWHLQ 0DMRU ORVVHV RI DFWLYLW\ RFFXUUHG ZKLFKHYHU SURFHGXUH ZDV HPSOR\HG &ROOHFWLRQ RI WKH HQ]\PH RQ &0FHOOXORVH ZDV SDUWLFXODUO\ LQHIILFLHQW +RZHYHU LI WKLV VWHS ZDV UHSHDWHG VHYHUDO PRUH WLPHV UHVXOWV QRW VKRZQf WKH SHUFHQW RI UHFRYHU\ RI HQ]\PH IURP WKH RULJLQDO H[WUDFW FRXOG EH LQFUHDVHG WR RYHU b 7KH SKRVSKDWDVH DFWLYLW\ LQ WKH [J VXSHUQDWDQW IUDFWLRQ IURP WKH VSOHHQ H[WUDFW ZDV UHODWLYHO\ XQVWDEOH 6WRUDJH DW r& OHG WR D FRPSOHWH ORVV RI DFWLYLW\ ZLWKLQ KRXUV 6DPSOHV NHSW DW r& ORVW RYHU b RI WKHLU DFWLYLW\ LQ GD\V 7KH SXULILHG HQ]\PH RQ WKH RWKHU KDQG DSSHDUHG WR UHODWLYHO\ PRUH VWDEOH ZKHQ IUR]HQ DW r& DQG VDPSOHV KDYH EHHQ VWRUHG VXFFHVVIXOO\ IRU XS WR PRQWKV ZLWK UHWHQWLRQ RI PRVW RI WKHLU RULJLQDO DFWLYLW\ :KHQ WKH LPPXQRDIILQLW\SXULILHG HQ]\PH ZDV DQDO\]HG E\ 6'63$*( LW JDYH D PDMRU SURWHLQ EDQG RI DSSDUHQW 0U DQG WZR PLQRU EDQGV RI DERXW 0U DQG )LJ f 7KH UHODWLYH DPRXQWV RI WKH KLJKHU PROHFXODU ZHLJKW VSHFLHV DQG WKH WZR ORZHU PROHFXODU ZHLJKW EDQGV YDULHG EHWZHHQ SUHSDUDWLRQV IURP WKH VDPH VSOHHQ UHVXOWV QRW VKRZQf 7KH SXULILHG HQ]\PH ZDV DOVR H[DPLQHG E\ HOHFWURSKRUHVLV XQGHU QRQGHQDWXULQJ FRQGLWLRQV )LJ f 7KH JHOV ZHUH WKHQ VWDLQHG IRU DFLG SKRVSKDWDVH DFWLYLW\ 7KH KDLU\ FHOO HQ]\PH ODQH f JDYH WZR EDQGV RI DFWLYLW\ D PLQRU IDVW PLJUDWLQJ VSHFLHV DQG D GRPLQDQW VORZHU EDQG 8WHURIHUULQ DOVR JDYH EDQGV EXW WKH VORZHU PLJUDWLQJ EDQG LQ WKLV FDVH ZDV VFDUFHO\ YLVLEOH ODQH f $ FRPPHUFLDO VWDQGDUG IRU

PAGE 60

7$%/( 3XULILFDWLRQ RI WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH IURP VSOHHQ RI D SDWLHQW ZLWK KDLU\ FHOO OHXNHPLD 3XULILFDWLRQ 6WHS 7RWDO 3URWHLQ 7RWDO $FWLYLW\ 5HFRYHU\ 6SHFLILF $FWLYLWY )ROG 3XULILFDWLRQ PJ XQLWV b XQLWVPJ ; 222[J &0FHOOXORVH $IILQLWY FROXPQ $ J SLHFH RI D NJ VSOHHQ ZDV KRPRJHQL]HG LQ O\VLV EXIIHU 7KH KRPRJHQDWH ZDV FHQWULIXJHG DW [J DQG WKH HQ]\PH ZDV SXULILHG IURP WKH VXSHUQDWDQW IUDFWLRQ $FWLYLWLHV UHSUHVHQW HQ]\PH DFWLYDWHG ZLWK 0 PHUFDSWRHWKDQRO DW S+ IRU PLQXWHV

PAGE 61

)LJ 6'6SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV RI SXULILHG XWHURIHUULQ DQG KDLU\ FHOO SKRVSKDWDVH 7KH VFDOH RQ WKH OHIW LV PROHFXODU ZHLJKW [ A /DQH PROHFXODU ZHLJKW VWDQGDUGV ODQH SXULILHG XWHURIHUULQ ODQH KDLU\ FHOO SKRVSKDWDVH IROORZLQJ LPPXQRDIILQLW\ FKURPDWRJUDSK\ 7KH JHO ZDV b ZYf SRO\DFU\ODPLGH LW ZDV VWDLQHG ZLWK &RRPDVVLH %OXH 1RWH WKDW WKH KDLU\ FHOO HQ]\PH JDYH PDMRU EDQGV DW DQG

PAGE 62

)LJ 3RO\DFU\ODPLGH JHO HOHFWURSKRUHVLV RI DFLG SKRVSKDWDVHV DW S+ LQ DODQLQH EXIIHU *HOV ZHUH VWDLQHG ZLWK SKRVSKDWDVH VXEVWUDWH RFQDSKWK\OSKRVSEDWH DQG K\GURO\VLV SURGXFW FRXSOHG ZLWK )DVW *DUQHW *%& VDOW /DQH 7\SH LVR]\PH HOHFWURSKRUHWLF VWDQGDUG IURP &DOELRFKHP %HKULQJ ODQH XWHURIHUULQ ODQH KDLU\ FHOO HQ]\PH LPPXQRDIILQLW\ SXULILHG IURP VSOHHQ 1RWH WKDW D VWDQGDUG LVR]\PH XWHURIHUULQ DQG WKH KDLU\ FHOO SKRVSKDWDVH JDYH VLPLODU EXW QRW LGHQWLFDO HOHFWURSKRUHWLF SDWWHUQV 0LJUDWLRQ WRZDUGV WKH FDWKRGHf ZDV IURP WKH WRS WR ERWWRP

PAGE 63

KXPDQ LVR]\PH LV VKRZQ LQ ODQH ,WV SDWWHUQ UHVHPEOHG WKDW RI XWHURIHUULQ 3XULILFDWLRQ RI WKH 7\SH ,VR]\PH IURP 1RUPDO +XPDQ 6SOHHQ $Q LVR]\PH ZLWK D KLJK FDWKRGDO PRELOLW\ KDV EHHQ GHWHFWHG LQ H[WUDFWV RI QRUPDO VSOHHQ E\ RWKHUV /DP HW DO f ,Q DGGLWLRQ WKH H[WUDFW RI VSOHHQ GHVFULEHG LQ 7DEOH FRQWDLQHG VLJQLILFDQW DPRXQWV RI D WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH DFWLYLW\ 7KHUHIRUH DQ DWWHPSW ZDV PDGH WR LVRODWH WKH HQ]\PH IURP WKH WRWDO H[WUDFW RI D QRUPDO VSOHHQ E\ PHDQV RI SURFHGXUH $SSUR[LPDWHO\ XQLWV RI HQ]\PH DFWLYLW\ ERXQG WR &0FHOOXORVH DW S+ 7KLV UHSUHVHQWHG OHVV WKDQ b RI WKH WRWDO DFLG SKRVSKDWDVH DFWLYLW\ LQ WKH H[WUDFW $ WRWDO RI XQLWV ZHUH UHFRYHUHG IURP WKH LPPXQRDIILQLW\ FROXPQ 7KLV ILQDO SUHSDUDWLRQ ZDV LQVHQVLWLYH WR /fWDUWUDWH DQG ZDV DFWLYDWDEOH E\ PHUFDSWRHWKDQRO 8SRQ HOHFWURSKRUHVLV LQ QRQGHQDWXULQJ JHOV LW JDYH WZR FDWKRGDOO\ PLJUDWLQJ EDQGV RI DFWLYLW\ 7KHVH ZHUH LGHQWLFDO WR WKH EDQGV RI DFWLYLW\ VHHQ ZLWK WKH KDLU\ FHOO HQ]\PH UHVXOWV QRW VKRZQf 7KH UHVXOWV FRQILUP WKDW WKH 7\SH SKRVSKDWDVH LV SUHVHQW DV D PLQRU FRPSRQHQW RI VSOHHQV RI QRUPDO LQGLYLGXDOV 3XULILFDWLRQ RI WKH 7\SH 3KRVSKDWDVH IURP +XPDQ 3ODFHQWD %HFDXVH RI WKH GLIILFXOW\ LQ REWDLQLQJ KXPDQ VSOHHQV LW ZDV QHFHVVDU\ WR GHWHUPLQH ZKHWKHU RWKHU WLVVXHV FRXOG EH XVHG DV D VRXUFH RI WKH KXPDQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH +XPDQ SODFHQWD FDQ EH REWDLQHG IUHVK LQ ODUJH TXDQWLWLHV DW DQ\ WLPH 7KHUHIRUH WKLV WLVVXH ZDV WHVWHG IRU WKH SUHVHQFH RI WKH HQ]\PH 7ZR SODFHQWDV ZHUH VWXGLHG DQG D VOLJKWO\ GLIIHUHQW SXULILFDWLRQ SURWRFRO ZDV XVHG IRU HDFK RQH $ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH ZDV SXULILHG IURP HDFK

PAGE 64

SODFHQWD )LJXUH VKRZV WKDW WKH SODFHQWD HQ]\PH OLNH WKH VSOHHQ HQ]\PH KDV DQ DSSDUHQW 0U RI ,QWHUHVWLQJO\ WKH WZR PLQRU EDQGV IRXQG DVVRFLDWHG ZLWK WKH SODFHQWD HQ]\PH DUH RI GLIIHUHQW DSSDUHQW 0U YDOXHV WKDQ WKRVH DVVRFLDWHG ZLWK WKH VSOHHQ HQ]\PH +XPDQ SODFHQWD FDQ FRQWDLQ DERXW DV PXFK 7\SH SKRVSKDWDVH DV QRUPDO KXPDQ VSOHHQ 7DEOH f ZKHQ PHDVXUHG SHU JUDP RI WLVVXH 1RWH WKDW KXPDQ KDLU\ FHOO VSOHHQ FRQWDLQV DW OHDVW IROG PRUH 7\SH LVR]\PH SHU JUDP RI WLVVXH WKDQ WKH RWKHU VRXUFHV RI WKH KXPDQ HQ]\PH 3XULILFDWLRQ RI WKH %RYLQH 6SOHHQ %RYLQH 8WHULQH DQG 5DW 6SOHHQ 3KRVSKDWDVHV 7DEOH DOVR VKRZV WKH \LHOGV RI WKH SXUSOH LURQFRQWDLQLQJ SKRVSKDWDVHV IURP RWKHU VRXUFHV 'DYLV HW DO f FODLP WKDW WKH\ FDQ SXULI\ XS WR PJ RI SXUSOH SKRVSKDWDVH SHU NJ RI EHHI VSOHHQ EXW WKDW WKH \LHOG YDULHG JUHDWO\ EHWZHHQ DQLPDOV 7KH \LHOGV REWDLQHG LQ WKLV VWXG\ ZHUH FRQVLVWHQWO\ ORZHU WKDQ PJNJ GDWD QRW VKRZQf 7KH \LHOG RI WKH ERYLQH XWHULQH HQ]\PH ZDV FRQVLGHUDEO\ OHVV WKDQ WKDW RI WKH SRUFLQH HQ]\PH RQ D SHU DQLPDO EDVLV 7DEOH f 7KH \LHOG RI WKH UDW VSOHHQ HQ]\PH ZDV TXLWH KLJK 7DEOH f DQG FRPSDUDEOH WR WKDW RI +DUD HW DO f S+ 2SWLPD RI WKH 7\SH 3KRVSKDWDVHV 7KH S+ RSWLPD IRU WKH YDULRXV 7\SH SKRVSKDWDVHV DUH OLVWHG LQ 7DEOH 7KH YDOXHV UDQJH IURP S+ IRU WKH ERYLQH XWHULQH HQ]\PH WR S+ IRU WKH ERYLQH VSOHHQ HQ]\PH *O\FRSURWHLQ 1DWXUH RI WKH 7\SH 3KRVSKDWDVHV 3RUFLQH XWHURIHUULQ LV NQRZQ WR FRQWDLQ D VLQJOH KLJKPDQQRVH ROLJRVDFFKDULGH FKDLQ 6DXQGHUV HW DO f 7KH UDW VSOHHQ HQ]\PH +DUD HW DO f DQG WKH ERYLQH VSOHHQ HQ]\PH 'DYLV HW DO f

PAGE 65

)LJ 6'6 SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV RI XWHURIHUULQ WKH SKRVSKDWDVH IURP KXPDQ VSOHHQ DQG WKH SKRVSKDWDVH IURP SODFHQWD 7KH PROHFXODU ZHLJKW VWDQGDUGV DUH VKRZQ LQ ODQH 1RWH WKDW WKH VSOHHQ HQ]\PH ODQH f JDYH PDMRU EDQGV DW DQG ZKLOH WKH SODFHQWD ODQH f JDYH PDMRU EDQGV DW DQG 8WHURIHUULQ ODQH f KDV DQ DSSDUHQW 0U RI $SSUR[LPDWHO\ \XJ RI SURWHLQ ZHUH SUHVHQW LQ HDFK ODQH *HOV ZHUH VWDLQHG ZLWK &RRPDVVLH EOXH 7KH JHO ZDV FRPSRVHG RI b ZYf SRO\DFU\ODPLGH 7KH VFDOH RQ WKH OHIW LV PROHFXODU ZHLJKW [ A

PAGE 66

7$%/( /HYHOV RI WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH DFLWLYLWY LQ YDULRXV WLVVXHV 6RXUFH RI (Q]YPH 8QLWV RI (Q]\PH $FWLYLW\ 8QLWV RI (Q]\PH $FWLYLW\ SHU 7LVVXH +XPDQ SODFHQWD Jf +XPDQ SODFHQWD Jf 1RUPDO KXPDQ VSOHHQ Jf +DLU\ FHOO VSOHHQ JfD %HHI VSOHHQ JfD 5DW VSOHHQ JfA %RYLQH XWHULQH IOXLGV POfF 3RUFLQH DOODQWRLF IOXLGV /f& $SSUR[LPDWHO\ RQHWHQWK WKH WRWDO WLVVXH PDVV A2EWDLQHG IURP WKUHH DQLPDOV F2EWDLQHG IURP RQH DQLPDO 3XULILHG HQ]\PHV ZHUH LQFXEDWHG ZLWK 0 PHUFDSWRHWKDQRO DQG DVVD\HG DW WKHLU S+ RSWLPD ZLWK P0 SQLWURSKHQ\OSKRVSKDWH 2QH XQLW RI HQ]\PH K\GURO\]HV WKH UHOHDVH RI QQRO RI SQLWURSKHQRO SHU PLQXWH

PAGE 67

7$%/( S+ RSWLPD IRU WKH WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVHV (Q]YPH G+ 2SWLPXP 3RUFLQH XWHURIHUULQ +XPDQ KDLU\ FHOO HQ]\PH %RYLQH VSOHHQ HQ]\PH %RYLQH XWHULQH HQ]\PH 5DW VSOHHQ HQ]\PHD D +DUD HW DO (Q]\PHV ZHUH DVVD\HG ZLWK 0 VRGLXP DFHWDWH S+ 0 7ULV DFHWDWH S+ 0 7ULV+&O S+ EXIIHUV LQ WKH SUHVHQFH RI 0 PHUDFDSWRHWKDQRO ZLWK P0 SQLWURSKHQ\OSKRVSKDWH VXEVWUDWH DV

PAGE 68

ZHUH GHPRQVWUDWHG WR EH JO\FRSURWHLQV ,Q WKLV VWXG\ LW ZDV GHPRQVWUDWHG WKDW WKH KXPDQ VSOHHQ DQG SODFHQWD HQ]\PHV ELQG DYLGO\ WR &RQ $6HSKDURVH 7KH HQ]\PHV FRXOG EH HOXWHG ZLWK O2P0 RFPHWK\O PDQQRVLGH DW r& RU ZLWK 0 DFHWLF DFLG 7KHVH UHVXOWV LQGLFDWH WKDW WKH KXPDQ 7\SH SKRVSKDWDVH DORQJ ZLWK WKH SXUSOH LURQFRQWDLQn LQJ SKRVSKDWDVHV FRQWDLQ KLJK PDQQRVH RU K\EULGW\SH ROLJRVDFFKDULGH FKDLQV ,URQ &RQWHQW RI WKH 7\SH 3KRVSKDWDVHV ,W KDV EHHQ GHPRQVWUDWHG WKDW WKH ERYLQH VSOHHQ HQ]\PH 'DYLV HW DO f DQG UDW VSOHHQ HQ]\PH +DUD HW DO f FRQWDLQ WZR DWRPV RI LURQ SHU PROHFXOH RI SURWHLQ +RZHYHU %XKL HW DO Ef FRQVLVWHQWO\ GHPRQVWUDWHG WKDW FHUWDLQ SUHSDUDWLRQV RI XWHURIHUULQ ERXQG DERXW PRO )HPRO SURWHLQ 7DEOH FRPSDUHV WKH LURQ FRQWHQWV RI SLQN KLJK PROHFXODU ZHLJKW XWHURIHUULQ SXUSOH XWHURIHUULQ WKH ERYLQH XWHULQH HQ]\PH WKH UDW VSOHHQ HQ]\PH WKH ERYLQH VSOHHQ HQ]\PH DQG WKH KXPDQ VSOHHQ HQ]\PH :KLOH SLQN KLJK PROHFXODU ZHLJKW XWHURIHUULQ FRQWDLQV WZR DWRPV RI LURQ SHU PROHFXOH RI XWHURIHUULQ SXUSOH XWHURIHUULQ SUHSDUDWLRQV FRQWDLQ FRQVLGHUDEO\ OHVV LURQ 7ULSOLFDWH GHWHUPLQDWLRQV RQ D VLQJOH SXULILHG VDPSOH RI WKH KXPDQ HQ]\PH UHYHDOHG WKDW LW FRQWDLQHG DWRPV RI LURQPROHFXOH RI SURWHLQ $FWLYDWLRQ E\ 5HGXFLQJ $JHQWV 5HSRUWV RQ WKH HIIHFW RI UHGXFLQJ DJHQWV VXFK DV DVFRUEDWH DQG PHUFDSWRHWKDQRO RQ WKH DFWLYLWLHV RI WKH 7\SH LVR]\PH RI KXPDQ VSOHHQ KDYH EHHQ DW YDULDQFH /DP HW DW 5RELQVRQ DQG *OHZ f 7KH GHJUHH RI DFWLYDWLRQ KDV EHHQ XQSUHGLFWDEOH WKURXJKRXW WKH FRXUVH RI WKLV VWXG\ :LWK SDUWLDOO\ SXULILHG HQ]\PH

PAGE 69

7$%/( 7KH ,URQ FRQWHQW RI WKH WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVHV 6RXUFH RI (Q]YPH PPRO )HPPRO 3URWHLQ G DOODQWRLF IOXLG SXUSOH SRUFLQH 8I D G DOODQWRLF IOXLG SLQN 0U 8I D GOO2 SVHXGRSUHJQDQW IOXLG SXUSOH SRUFLQH 8I D GOO2 SVHXGRSUHJQDQW IOXLG SLQN 0U 8I D +XPDQ KDLU\ FHOO VSOHHQ %RYLQH VSOHHQ OE %RYLQH XWHULQH IOXLG 5DW VSOHHQ & D%DXPEDFK HW DO A'DYLV HW DO &DPSEHOO HW DO F+DUD HW DO 7KH LURQ FRQWHQW ZDV GHWHUPLQHG E\ WKH PHWKRG RI &DPHURQ f PRGLILHG E\ &DPSEHOO DQG =HUQHU f $SSUR[LPDWHO\ LJ RI SURWHLQ ZHUH XVHG DV

PAGE 70

SRVW&0FHOOXORVHf D IROG DFWLYDWLRQ ZDV XVXDOO\ REVHUYHG ZKHQ HQ]\PH ZDV LQFXEDWHG ZLWK 0 PHUFDSWRHWKDQRO IRU PLQXWHV DW S+ EHIRUH EHLQJ DVVD\HG IRU DFWLYLW\ 7KH GHJUHH RI DFWLYDWLRQ RI FUXGH HQ]\PH 7DEOH f ZDV XVXDOO\ OHVV WKDQ WZRIROG +RZHYHU VRPH SUHSDUDWLRQV RI DIILQLW\SXULILHG HQ]\PH KDYH VKRZQ QHJOLJLEOH DFWLYLW\ LQ WKH DEVHQFH RI UHGXFLQJ DJHQW ZKLOH RWKHU PRUH LQKHUHQWO\ DFWLYH SUHSDUDWLRQV ZHUH RQO\ VWLPXODWHG DERXW WZRIROG 7KH UHVXOWV ZLWK RQH SXULILHG SUHSDUDWLRQ DUH VXPPDUL]HG LQ 7DEOH 7KH H[WHQW RI DFWLYDWLRQ ZDV FOHDUO\ GHSHQGHQW XSRQ WKH FRQFHQWUDWLRQ RI PHUFDSWRHWKDQRO 5HVXOWV ZLWK DVFRUELF DFLG QRW VKRZQf ZHUH VLPLODU $FWLYDWLRQ E\ PHUFDSWRHWKDQRO OHDGV WR DQ LQFUHDVH LQ 9 UDWKHU WKDQ D FKDQJH LQ .P IRU ERWK WKH KXPDQ VSOHHQ HQ]\PH DQG XWHURIHUULQ )LJ $f 1RWH WKDW WKH .P YDOXHV IRU ERWK HQ]\PHV DW WKHLU S+ RSWLPD S+ DQG UHVSHFWLYHO\f DUH VLPLODU 9DOXHV IRU .P EHWZHHQ DQG P0 KDYH EHHQ UHSRUWHG IRU WKH VSOHHQ HQ]\PH 9 LV DOVR YDULDEOH WKH PRUH DFWLYH SUHSDUDWLRQV JLYLQJ YDOXHV JUHDWHU WKDQ XQLWVPJ SURWHLQ ZKHQ SUHWUHDWHG ZLWK PHUFDSWRHWKDQRO ,QWHUHVWLQJO\ SLQN KLJK PROHFXODU ZHLJKW XWHURIHUULQ GRHV QRW UHTXLUH SUHWUHDWPHQW ZLWK PHUFDSWRHWKDQRO LQ RUGHU WR H[KLELW PD[LPDO DFWLYLW\ GDWD QRW VKRZQf (IIHFWV RI ,QKLELWRUV RQ 3KRVSKDWH $FWLYLW\ 7KH HIIHFWV RI D UDQJH RI LQKLELWRUV RQ WKH KXPDQ VSOHHQ HQ]\PH DQG XWHURIHUULQ DUH YHU\ VLPLODU 7DEOH f %RWK HQ]\PHV DUH FRPSOHWHO\ LQKLELWHG E\ 0 GLWKLRQLWH D UHDJHQW ZKLFK LV NQRZQ WR FDXVH UHOHDVH RI )H IURP XWHURIHUULQ 6FKORVQDJOH HW DO f +\GURJHQ SHUR[LGH DQG DJHQWV ZKLFK LQWHUDFW ZLWK 6+ JURXSV DOVR LQKLELW 7KH FKHODWRUV

PAGE 71

7$%/( $FWLYDWLRQ RI SXULILHG KXPDQ KDLU\ FHOO SKRVSKDWDVH E\ PHUFDSWRHWKDQRO 0HUFDSWRHWKDQRO &RQFHQWUDWLRQ $FWLYLW\ 0 b FRQWURO (Q]\PH ZDV LQFXEDWHG ZLWK PHUFDSWRHWKDQRO IRU PLQXWHV DW S+ LQ 0 VRGLXP DFHWDWH EXIIHU SULRU WR DVVD\

PAGE 72

7$%/( $FWLRQ RI YDULRXV SRWHQWLDO LQKLELWRUV RQ WKH KDLU\ FHOO DFLG SKRVSKDWDVH XWHURIHUULQ ERYLQH VSOHHQ DQG ERYLQH XWHULQH DFLG SKRVSKDWDVHV &RPSRXQG &RQFHQWUDWLRQ $FLG 3KRVSKDWDVH +XPDQ 3RUFLQH %RYLQH %RYLQH +DLU\ &HOO 8WHURIHUULQ 6SOHHQ 8WHULQH b FRQWURO 1D GLWKLRQLWH n 0 KR bYYf 1D LRGDFHWDWH LR P 1'D 1' 1D LRGRDFHWDPLGH LRrP SPHUFXULEHQ]RDWH 2 7f§ 1' )H&O n0 1' 1' 1D('7$ f0 ELS\ULGLQH f0 1' 1' RSKHQDQWKUROLQH n0 1' 1D. WDUWUDWH f 1D. WDUWUDWH f0 1' 1' 1D SKRVSKDWH [f0 1' 1' 1D SKRVSKDWH LRrP 1D SKRVSKDWH R 1' 1' 1D DUVHQDWH f0 1' 1' 1D DUVHQDWH [r0 1' 1' 1D DUVHQDWH [n0 1D PRO\EGDWH rP 1' 1' 1D PRO\EGDWH n0 1' 1' 1D PRO\EGDWH [n0 1D IOXRULGH n0 1' 1D IOXRULGH [On 1' 1' D 1' QRW GHWHUPLQHG 7KH HQ]\PHV ZHUH DVVD\HG LQ WULSOLFDWH ZLWK SQLWURSKHQ\OSKRVSKDWH DV VXEVWUDWH FRQFHQWUDWLRQ P0f 7KH HQ]\PHV ZHUH DVVD\HG DW WKHLU S+ RSWLPD VHH 7DEOH f $OO DFWLYLWLHV DUH SUHVHQWHG DV SHU FHQW RI D FRQWURO DVVD\ SHUIRUPHG VLPXOWDQHRXVO\ ZLWK QR DGGHG LQKLELWRU

PAGE 73

('7$ DQG ELS\ULGLQH KDYH QR HIIHFW 7DUWUDWH GRHV QRW LQKLELW HLWKHU SKRVSKDWDVH ,QKLELWLRQ LV REVHUYHG ZLWK SKRVSKDWH DUVHQDWH PRO\EGDWH DQG IOXRULGH KRZHYHU 0RO\EGDWH LV WKH PRVW HIIHFWLYH LQKLELWLQJ VWURQJO\ HYHQ DW FRQFHQWUDWLRQV EHORZ nA0 LW DSSHDUV WR LQKLELW ERWK HQ]\PHV LQ D QRQFRPSHWLWLYH PDQQHU )LJ %f $UVHQDWH DQG SKRVSKDWH DUH FRPSHWLWLYH LQKLELWRUV )LJ &f ,QKLELWLRQ ZLWK 0 IOXRULGH UHVXOWV QRW VKRZQf LV FRPSOH[ DQG FXUYLOLQHDU /LQHZHDYHU%XUN SORWV DUH REVHUYHG 7KH HIIHFWV RI WKHVH LQKLELWRUV RQ SLQN KLJK PROHFXODU ZHLJKW XWHURIHUULQ GDWD QRW VKRZQf DQG WKH ERYLQH XWHULQH DQG VSOHHQ HQ]\PHV ZHUH TXLWH VLPLODU WR WKH UHVXOWV REWDLQHG IRU XWHURIHUULQ 7DEOH f 6XEVWUDWH 6SHFLILFLW\ IRU 3KRVSKDWDVH $FWLYLW\ 7KH VXEVWUDWH VSHFLILFLWLHV RI WKH KXPDQ VSOHHQ HQ]\PH DQG XWHURIHUULQ DUH TXLWH VLPLODU 7DEOH f S1LWURSKHQ\OSKRVSKDWH ZDV WKH EHVW VXEVWUDWH WHVWHG EXW RFQDSKWK\OSKRVSKDWH S\URSKRVSKDWH DQG QXFOHRWLGH WUL DQG GLSKRVSKDWHV DUH DOVR K\GURO\]HG %RWK HQ]\PHV K\GURO\]H $'3 PRUH HIIHFWLYHO\ WKDQ $73 ZKHUHDV $03 LV D SRRU VXEVWUDWH +H[RVH SKRVSKDWHV DUH RQO\ YHU\ VORZO\ K\GURO\]HG LI DW DOO %RWK HQ]\PHV DUH SKRVSKRSURWHLQ SKRVSKDWDVHV DQG FDQ UHOHDVH RUWKRSKRVSKDWH IURP WKH HJJ \RON SURWHLQ SKRVYLWLQ 7KH KXPDQ VSOHHQ HQ]\PH LJf KDG WKH DELOLW\ WR UHOHDVH OQPRO RI RUWKRSKRVSKDWH IURP SKRVSKYLWLQ PJPOf SHU PLQXWH DW r& 7KH YDOXH IRU XWHURIHUULQ DVVD\HG LGHQWLFDOO\ ZDV QPRO RI RUWKRSKRVSKDWH UHOHDVHG SHU PLQXWH 7KH VXEVWUDWH VSHFLILFLWLHV RI SLQN KLJK PROHFXODU ZHLJKW XWHURIHUULQ GDWD QRW VKRZQf DQG WKH ERYLQH HP]\PHV 7DEOH f ZHUH

PAGE 74

)LJ /LQHZHDYHU%XUN SORWV RI XWHURIHUULQ DQG KDLU\ FHOO SKRVSKDWDVH DFWLYLWLHV LQ WKH SUHVHQFH RI PHUFDSWRHWKDQRO DQG YDULRXV LQKLELWRUV $ DFWLYDWLRQ RI HQ]\PH E\ PHUFDSWRHWKDQRO ,Q WKLV H[SHULPHQW HQ]\PHV ZHUH DFWLYDWHG ZLWK 0 PHUFDSWRHWKDQRO DW S+ XWHURIHUULQf RU KDLU\ FHOO HQ]\PHf IRU PLQ 8WHURIHUULQ RU KDLU\ FHOO HQ]\PHV WBJf ZHUH DVVD\HG RYHU D UDQJH RI SQLWURSKHQ\OSKRVSKDWH FRQFHQWUDWLRQV ZLWK WKH XVH RI WKH VWDQGDUG DVVD\V ZLWK f DQG ZLWKRXW ff DFWLYDWLRQ % HIIHFW RI PRO\EGDWH RQ DFLG SKRVSKDWDVH DFWLYLW\ (Q]\PHV DFWLYDWHG ZLWK PHUFDS WRHWKDQRO ZHUH DVVD\HG DV LQ $ HLWKHU LQ WKH SUHVHQFH ff RU DEVHQFH f RI fVRGLXP PRO\EGDWH & HIIHFW RI DUVHQDWH DQG SKRVSKDWH RQ DFLG SKRVSKDWDVH DFWLYLW\ (Q]\PHV DFWLYDWHG ZLWK PHUFDSWRHWKDQRO ZHUH DVVD\HG DV LQ $ H[FHSW WKH DPRXQW RI XWHURIHUULQ ZDV OHVV $JDVVD\f $VVD\V ZHUH FDUULHG RXW LQ WKH SUHVHQFH RI HLWKHU [ fA0 SKRVSKDWH $f RU [ nA0 DUVHQDWH ff RU ZLWKRXW LQKLELWRUV f (DFK SRLQW UHSUHVHQWV WKH DYHUDJH RI WKUHH UHSOLFDWHV ,Q $ % DQG & DVVD\V ZLWK WKH KDLU\ FHOO HQ]\PH ZHUH FDUULHG RXW ZLWK SXULILHG HQ]\PH WKDW KDG EHHQ VWRUHG DW r& IRU ZHHNV DQG ZKLFK KDG ORVW DERXW b RI LWV LQLWLDO DFWLYLW\ 8SSHU SDQHOV UHSUHVHQW UHVXOWV REWDLQHG ZLWK XWHURIHUULQ ORZHU SDQHOV ZLWK KDLU\ FHOO SKRVSKDWDVH

PAGE 75

R PHUFDSWRHWKDQRO f FRQWURO f PRO\EGDWH D SKRVSKDWH f DUVHQDWH

PAGE 76

7$%/( &RPSDULVRQ RI VXEVWUDWH VSHFLILFLWLHV RI KDLU\ FHOO SKRVSKDWDVH XWHURIHUULQ ERYLQH VSOHHQ DQG ERYLQH XWHULQH SKRVSKDWDVHV 6XEVWUDWH +XPDQ +DLU\ &HOO $FLG 3KRVSKDWDVH 3RUFLQH %RYLQH 8WHURIHUULQ 6ROHHQ %RYLQH 8WHULQH b FRQWURO SQLWURSKHQ\OSKRVSKDWH DQDSKWK\OSKRVSKDWH VRGLXP S\URSKRVSKDWH $73 $'3 $03 'JOXFRVH SKRVSKDWH 'PDQQRVH SKRVSKDWH 'IUXFWRVH SKRVSKDWH $OO FRPSRXQGV ZHUH DVVD\HG DW D FRQFHQWUDWLRQ RI P0 DW WKH S+ RSWLPD RI WKH HQ]\PHV

PAGE 77

JHQHUDOO\ VLPLODU WR WKH UHVXOWV REWDLQHG ZLWK XWHURIHUULQ +RZHYHU WKH ERYLQH XWHULQH HQ]\PH GLG QRW K\GURO\]H $73 ZHOO DQG WKH ERYLQH VSOHHQ HQ]\PH ZDV YLUWXDOO\ LQDFWLYH DJDLQVW S\URSKRVSKDWH 7KH IDFW WKDW HDFK ERYLQH HQ]\PH ZDV WHVWHG DW LWV S+ RSWLPXP S+ IRU WKH VSOHHQ HQ]\PH DQG S+ IRU WKH XWHULQH HQ]\PHf UDWKHU WKDQ DW WKH VDPH S+ PD\ KDYH LQIOXHQFHG WKH UHVXOWV ,PPXQRORJLFDO &URVVUHDFWLYLW\ 7KH KXPDQ VSOHHQ HQ]\PH FOHDUO\ VKRZV DW OHDVW VRPH LPPXQRORJLFDO FURVVUHDFWLYLW\ ZLWK XWHURIHUULQ VLQFH LW ERXQG WR DQWLXWHURIHUULQ LPPXQRJOREXOLQV LPPRELOL]HG RQ 6HSKDURVH )LJ &f 7KH H[WHQW RI WKLV FURVVUHDFWLYLW\ KDV EHHQ PHDVXUHG LQ D VROLG SKDVH LPPXQRELQGLQJ DVVD\ ZKLFK HPSOR\HG ZKROH DQWLVHUXP IURP PLFH ZKLFK KDG EHHQ LPPXQL]HG ZLWK HLWKHU VSOHHQ HQ]\PH )LJ $f RU XWHURIHUULQ )LJ %f 7KH DQWLVHUXP WR WKH VSOHHQ HQ]\PH FOHDUO\ ERXQG WR XWHURIHUULQ EXW ELQGLQJ ZDV UHGXFHG E\ b ZKHQ WKH DQWLVHUXP ZDV GLOXWHG 1R ELQGLQJ FRXOG EH GHWHFWHG EHORZ D IROG GLOXWLRQ 7KH WLWHU WRZDUGV WKH VSOHHQ HQ]\PH ZDV FOHDUO\ PXFK KLJKHU ZLWK KDOIPD[LPDO ELQGLQJ RFFXUULQJ DW DQ DQWLVHUXP GLOXWLRQ RI :KHQ ZKROH PRXVH DQWLVHUXP UDLVHG DJDLQVW XWHURIHUULQ ZDV HPSOR\HG OLWWOH DQWLERG\ ELQGLQJ WR WKH VSOHHQ HQ]\PH ZDV GHWHFWDEOH DW DQ DQWLVHUXP GLOXWLRQ EHORZ %\ FRQWUDVW ELQGLQJ WR XWHURIHUULQ UHPDLQHG KLJK GRZQ WR DQ DQWLERG\ GLOXWLRQ RI 7KHUHIRUH WKH WZR SURWHLQV VKRZ RQO\ SDUWLDO LPPXQRORJLFDO FURVVUHDFWLYLW\ 7KH 3URGXFWLRQ RI 0RQRFORQDO $QWLERGLHV $JDLQVW 3RUFLQH 8WHURIHUULQ 7KH PLFH IRU IXVLRQ ZHUH LQMHFWHG ZLWK KLJK PROHFXODU ZHLJKW SLQN XWHURIHUULQ 7KH UHVXOWV RI WKLV IXVLRQ ZKLFK ZDV GRQH LQ

PAGE 78

)LJ 6ROLG SKDVH UDGLRELQGLQJ DVVD\ RI ZKROH PRXVH DQWLVHUXP IURP PLFH LPPXQL]HG ZLWK KXPDQ VSOHHQ SKRVSKDWDVH XSSHU SDQHOf RU XWHURIHUULQ ORZHU SDQHOf $QWLERG\ ZDV GLOXWHG VHULDOO\ DQG WHVWHG IRU ELQGLQJ WR HLWKHU XWHURIHUULQ ff KXPDQ VSOHHQ SKRVSKDWDVH 2f RU ERYLQH VHUXP DOEXPLQ $f %LQGLQJ ZDV PHDVXUHG E\ PHDQV RI DIILQLW\ SXULILHG rA,VKHHS DQWLPRXVH ,J*

PAGE 79

f XWH URIHUU LQ RVSOHHQ SKRVSKDWDVH D ERYLQH VHUXP DOEXPLQ

PAGE 80

FROODERUDWLRQ ZLWK *HRUJH %DXPEDFK DUH RXWOLQHG LQ GHWDLO LQ %DXPEDFK f 7KH PLFH IRU IXVLRQ ZHUH LQMHFWHG ZLWK SXUH XWHURIHUULQ 8SRQ LQLWLDO VFUHHQLQJ ZLWK XWHURIHUULQ DV WKH DQWLJHQ RXW RI WKH FRORQLHV VFUHHQHG ZHUH LGHQWLILHG DV SRVLWLYH $IWHU HDFK RI WKHVH SRVLWLYH FRORQLHV ZDV FORQHG E\ WKH OLPLWLQJ GLOXWLRQ PHWKRG RI WKH RULJLQDO FRORQLHV FRQWDLQHG SRVLWLYH FORQHV 7KUHH FORQHV IURP IXVLRQ DQG WKUHH IURP IXVLRQ ZHUH FKRVHQ IRU IXUWKHU VWXGLHV 7KHVH K\EULGRPDV DQG ZHUH XVHG WR SURGXFH ODUJH TXDQWLWLHV RI DQWLERG\ LQ PRXVH DVFLWHV IOXLG RU FXOWXUH PHGLD 7KHVH DQWLERGLHV ZHUH WHVWHG IRU ELQGLQJ WR XWHURIHUULQ DQG SLQN KLJK PROHFXODU ZHLJKW XWHURIHUULQ $OO RI WKH DQWLERGLHV ERXQG ZLWK KLJK DIILQLW\ WR SLQN KLJK PROHFXODU ZHLJKW XWHURIHUULQ 2QO\ RQH DQWLERG\ GLG QRW ELQG WR XWHURIHUULQ ,W DSSHDUHG WKDW UHFRJQL]HG WKH VHFRQG DQWLJHQLFDOO\ XQUHODWHG SURWHLQ LQ )LOO 7KLV DQWLERG\ ZLOO QRW EH GLVFXVVHG IXUWKHU ,Q RUGHU WR GHWHUPLQH ZKLFK RI WKHVH DQWLERGLHV UHFRJQL]HG WKH VDPH HSLWRSH RQ WKH XWHURIHUULQ PROHFXOH LH ZRXOG FRPSHWH ZLWK RQH DQRWKHU IRU ELQGLQJ WR XWHURIHUULQf DQG ZKLFK UHFRJQL]HG GLIIHUHQW HSLWRSHV GLG QRW FRPSHWH ZLWK RQH DQRWKHU IRU ELQGLQJ WR SRUFLQH XWHURIHUULQf FRPSHWLWLYH UDGLRELQGLQJ DVVD\V ZHUH FDUULHG RXW (DFK RI WKH ILYH PRQRFORQDO DQWLERGLHV ZDV LRGLQDWHG WR D VSHFLILF DFWLYLW\ RI DSSUR[LPDWHO\ A FSPSJ (DFK LRGLQDWHG PRQRFORQDO DQWLERG\ ZDV WHVWHG LQ D FRPSHWLWLYH ELQGLQJ DVVD\ ZLWK WKH VDPH XQODEHOHG DQWLERG\ 7KLV ZDV GRQH WR HQVXUH WKDW WKH ELQGLQJ DELOLWLHV

PAGE 81

RI DQWLERGLHV ZHUH QRW GHVWUR\HG E\ LRGLQDWLRQ (DFK ODEHOHG DQWLERG\ ZDV WKHQ WHVWHG ZLWK HDFK UHPDLQLQJ XQODEHOHG DQWLERG\ 7KH UHVXOWV RI VHYHUDO RI WKH FRPSHWLWLYH ELQGLQJ DVVD\V DUH VKRZQ LQ )LJ $QWLERGLHV DQG FRPSHWH ZLWK RQH DQRWKHU IRU ELQGLQJ WR SRUFLQH XWHURIHUULQ HYHQ DW YHU\ ORZ FRQFHQWUDWLRQV RI XQODEHOOHG DQWLERG\ 7KXV WKHVH WKUHH PRQRFORQDO DQWLERGLHV SUHVXPDEO\ LQWHUDFW ZLWK WKH VDPH VLWH RQ WKH XWHURIHUULQ PROHFXOH 0RQRFORQDO DQWLERGLHV DQG GR QRW FRPSHWH ZLWK HDFK RWKHU QRU GR WKH\ FRPSHWH ZLWK IRU ELQGLQJ WR SRUFLQH XWHURIHUULQ (DFK RI WKHVH DQWLERGLHV SUHVXPDEO\ UHFRJQL]HV D GLIIHUHQW VLWH RQ WKH XWHURIHUULQ PROHFXOH 7KH 3URGXFWLRQ RI 0RQRFORQDO $QWLERGLHV $JDLQVW WKH +DLU\ &HOO 6SOHHQ (Q]\PH +\EULGRPD FRORQLHV GHULYHG IURP D PRXVH ZKLFK KDG EHHQ LPPXQL]HG ZLWK WKH KXPDQ VSOHHQ HQ]\PH ZHUH VFUHHQHG IRU WKH SURGXFWLRQ RI DQWLERGLHV ZKLFK ZHUH DEOH WR ELQG ERWK WKH VSOHHQ HQ]\PH DQG WR XWHURIHUULQ )URP ZHOOV FRQWDLQLQJ OLYH FHOOV SRVLWLYH FRORQLHV ZHUH VHOHFWHG :KHQ WKHVH SRVLWLYH FRORQLHV ZHUH UHVFUHHQHG UHPDLQHG SRVLWLYH 2QO\ WZR RI WKHVH FRORQLHV DQG SURGXFHG DQWLERGLHV ZKLFK ERXQG DV ZHOO RU EHWWHU WR XWHURIHUULQ WKDQ WR WKH KXPDQ VSOHHQ HQ]\PH 7KH GLVVRFLDWLRQ FRQVWDQWV IRU WKH ELQGLQJ RI DQWLERG\ WR WKH KXPDQ HQ]\PH DQG XWHURIHUULQ UHVSHFWLYHO\ ZHUH DQG Q0 7KH GLVVRFLDWLRQ FRQVWDQWV IRU WKH ELQGLQJ RI DQWLERG\ WR WKH KXPDQ HQ]\PH DQG XWHURIHUULQ UHVSHFWLYHO\ ZHUH DQG Q0 7KHVH WZR DQWLERGLHV GLG QRW FRPSHWH ZLWK RQH DQRWKHU IRU ELQGLQJ WKH SRUFLQH XWHURIHUULQ

PAGE 82

)LJ &RPSHWLWLYH ELQGLQJ RI DQWLXWHURIHUULQ PRQRFORQDO DQWLERGLHV WR XWHURIHUULQ DGVRUEHG WR IOH[YLQ\O PLFURWLWHU ZHOOV 8WHURIHUULQ AJPO POf ZDV DEVRUEHG WR WKH ZHOOV RI IOH[YLQ\O SODWHV $ VDPSOH RI DQWLERG\ RU ZKLFK KDG EHHQ LRGLQDWHG WR D VSHFLILF DFWLYLW\ RI A FSP HJ ZDV DGGHG WR HDFK ZHOO PO FSPf 6DPSOHV RI XQODEHOHG DQWLERGLHV ZHUH WKHQ DGGHG RYHU D UDQJH RI GLOXWLRQV 7KH DPRXQW RI ZKLFK ERXQG WR WKH DGVRUEHG XWHURIHUULQ ZDV WKHQ PHDVXUHG 5HVXOWV VKRZ WKDW $ XQODEHOHG DQG GLVSODFHG WKH ELQGLQJ RI UDGLRODEHOHG % XQODEHOHG DQG GLVSODFHG WKH ELQGLQJ RI UDGLRODEHOHG DQG & IDLOHG WR FRPSHWH ZLWK IRU ELQGLQJ WR XWHURIHUULQ

PAGE 83

, %281'[FSPf & $ R RRV RLR R RRV R 81/$%(/(' $17,%2'< $''(' LrJf Y4

PAGE 84

7KH %LQGLQJ RI WKH 0RQRFORQDO $QWLERGLHV WR 2WKHU 7DUWUDWHUHVLVWDQW $FLG 3KRVSKDWDVHV ,Q )LJ WKH WKUHH PRQRFORQDO DQWLERGLHV UDLVHG DJDLQVW SRUFLQH XWHURIHUULQ KDYH EHHQ FRPSDUHG RQ WKH EDVLV RI WKHLU ELQGLQJ WR XWHURIHUULQ WKH KXPDQ HQ]\PH DQG WKH SXUSOH LURQFRQWDLQLQJ UDW VSOHHQ DQG ERYLQH VSOHHQ DFLG SKRVSKDWDVHV $OO WKUHH DQWLERGLHV ERXQG WR XWHURIHUULQ ZLWK YHU\ KLJK DIILQLW\ )LJ DQG 7DEOH f EXW ERXQG UHODWLYHO\ ZHDNO\ WR WKH EHHI VSOHHQ DQG KXPDQ HQ]\PHV 7KH UDW HQ]\PH KDG DQ LQWHUPHGLDWH DIILQLW\ .Mf Q0f IRU DQWLERG\ DQG D UHODWLYHO\ KLJK DIILQLW\ Q0f IRU DQWLERG\ 7KH ELQGLQJ RI WKH DQWLXWHURIHUULQ DQWLERGLHV ZHUH DOVR WHVWHG IRU ELQGLQJ WR SLQN KLJK PROHFXODU ZHLJKW XWHURIHUULQ DQG WKH ERYLQH XWHULQH HQ]\PH 7KHUH LV QR GLIIHUHQFH LQ WKH ELQGLQJ RI WKHVH PRQRFORQDO DQWLERGLHV WR XWHURIHUULQ DQG SLQN KLJK PROHFXODU ZHLJKW XWHURIHUULQ GDWD QRW VKRZQf 7KH ERYLQH XWHULQH HQ]\PH KDG D KLJK DIILQLW\ IRU DQWLERG\ Q0f DQG ORZ DIILQLWLHV IRU WKH UHPDLQLQJ PRQRFORQDO DQWLERGLHV 7KH ERYLQH XWHULQH HQ]\PH FOHDUO\ GLIIHUV IURP WKH ERYLQH VSOHHQ HQ]\PH LQ LWV DIILQLW\ IRU DQWLERG\ Q0 YHUVXV Q0f 7KXV WKH ILYH SKRVSKDWDVHV VKRZHG VRPH LPPXQRORJLFDO FURVVUHDFWLYLWLHV ZKHQ WHVWHG LQ WKLV PDQQHU EXW WKH HSLWRSHV UHFRJQL]HG E\ DQ\ RQH RI WKH DQWLERGLHV ZHUH FOHDUO\ QRW LGHQWLFDO $QWLERG\ UDLVHG DJDLQVW WKH KXPDQ VSOHHQ HQ]\PH ZDV WHVWHG IRU LWV ELQGLQJ WR WKH ILYH SKRVSKDWDVHV )LJXUH DQG 7DEOH VKRZ WKDW WKLV DQWLERG\ KDG D VOLJKWO\ ORZHU DIILQLW\ WRZDUGV WKH KXPDQ HQ]\PH WKH DQWLJHQ DJDLQVW ZKLFK LW KDG EHHQ UDLVHGf WKDQ WRZDUGV XWHURIHUULQ RU WKH UDW VSOHHQ HQ]\PH 7KH DQWLERG\ ERXQG DV ZHOO WR WKH ERYLQH XWHULQH HQ]\PH DV LW GLG WR WKH KXPDQ HQ]\PH DQG ERXQG PRVW

PAGE 85

)LJ %LQGLQJ RI IRXU PRQRFORQDO DQWLERGLHV WR XWHURIHUULQ DQG WR WKH LPPXQRDIILQLW\ SXULILHG SKRVSKDWDVHV IURP KXPDQ ERYLQH DQG UDW VSOHHQV 7KH HQ]\PHV JPO POf ZHUH DOORZHG WR DGVRUE WR WKH ZHOOV RI IOH[YLQ\O SODWHV 3XULILHG ZKLFK KDG EHHQ UDLVHG DJDLQVW XWHURIHUULQ DQG ZKLFK KDG EHHQ UDLVHG DJDLQVW KXPDQ VSOHHQ HQ]\PH ZHUH GLOXWHG RYHU D UDQJH RI FRQFHQWUDWLRQV IURP DERXW WR fA0 DQG DGGHG WR WKH ZHOOV %LQGLQJ LQ WKLV H[SHULPHQW ZDV DVVHVVHG E\ PHDQV RI AAODEHOHG VKHHS DQWLPRXVH ,J* DV GHVFULEHG XQGHU 0DWHULDOV DQG 0HWKRGV 7KH JUDSKV VKRZ WKH DPRXQW RI DQWLERG\ ERXQG SORWWHG DJDLQVW DQWLERG\ FRQFHQWUDWLRQ IRU WKH IRXU HQ]\PHV 8WHURIHUULQ f KXPDQ VSOHHQ SKRVSKDWDVH $ ERYLQH VSOHHQ SKRVSKDWDVH UDW VSOHHQ SKRVSKDWDVH $ 7KH DQWLERG\ XVHG LQ HDFK VHULHV RI H[SHULPHQWV DQG f LV VKRZQ RQ HDFK JUDSK

PAGE 86

$QWLERG\ ERXQG MMJ [ rf =/

PAGE 87

7$%/( 'LVVRFLDWLRQ FRQVWDQWV .S YDOXHVf IRU ELQGLQJ RI PRQRFORQDO DQWLERGLHV WR XWHURIHUULQ WKH KXPDQ VSOHHQ HQ]\PH WKH UDW VSOHHQ HQ]\PH WKH ERYLQH VSOHHQ DQG XWHULQH HQ]\PHV $QWLJHQ 0RQRFORQDO $QWLERG\ NG Q0 8WHURIHUULQ R ,f§ (Q]\PH IURP KDLU\ FHOO VSOHHQ (Q]\PH IURP UDW VSOHHQ (Q]\PH IURP EHHI VSOHHQ (Q]YPH IURP FRZ XWHUXV 0RQRFORQDO DQWLERGLHV DQG ZHUH SURGXFHG E\ K\EULGRPD FORQHV ZKLFK RUJLQDWHG IURP D PRXVH LPPXQL]HG ZLWK XWHURIHUULQ 7KH\ ZHUH VHOHFWHG E\ WKHLU DELOLW\ WR ELQG XWHURIHUULQ ZLWK KLJK DIILQLW\ LQ D VROLG SKDVH UDGLRELQGLQJ DVVD\ 0RQRFORQDO DQWLERG\ ZDV SURGXFHG E\ D K\EULGRPD FORQH ZKLFK RULJLQDWHG IURP D PRXVH LPPXQL]HG ZLWK WKH HQ]\PH SXULILHG IURP KXPDQ VSOHHQ ,W ZDV VHOHFWHG EHFDXVH RI LWV DELOLW\ WR ELQG XWHURIHUULQ DQG WKH KXPDQ VSOHHQ HQ]\PH ZLWK DSSUR[LPDWHO\ VLPLODU DIILQLWLHV

PAGE 88

ZHDNO\ WR WKH EHHI VSOHHQ HQ]\PH 7DEOH f +RZHYHU WKH .S YDOXHV IRU DOO ILYH SKRVSKDWDVHV ZHUH QRW PDUNHGO\ GLIIHUHQW D UHVXOW ZKLFK VXJJHVWV WKDW DQWLERG\ UHFRJQL]HG D UHODWLYHO\ FRQVHUYHG VLWH ,QKLELWLRQ RI (Q]\PDWLF $FWLYLW\ E\ WKH %LQGLQJ RI 0RQRFORQDO $QWLERGLHV 7KH DFLG SKRVSKDWDVH DFWLYLW\ RI XWHURIHUULQ ZDV PHDVXUHG ZLWKRXW WKH DGGLWLRQ RI PHUFDSWRHWKDQROf DIWHU HDFK RI WKH PRQRFORQDO DQWLERGLHV KDG EHHQ DOORZHG WR ELQG WR WKH HQ]\PH DW S+ IRU KRXU 7DEOH GHPRQVWUDWHV WKDW DQWLERG\ HIIHFWLYHO\ LQKLELWHG DFLG SKRVSKDWDVH DFWLYLW\ ZKHQ D IROG PRODU H[FHVV RI DQWLERG\ ZDV DGGHG 0RQRFORQDO DQWLERG\ LQKLELWHG WKH HQ]\PH DFWLYLW\ VOLJKWO\ DW ORZHU FRQFHQWUDWLRQV ZKLOH DQWLERG\ GLG QRW LQKLELW DFWLYLW\ DW DOO 0RQRFORQDO DQWLERG\ LQKLELWHG WKH SKRVSKDWDVH DFWLYLW\ DERXW b DW DOO FRQFHQWUDWLRQV WHVWHG 1RQH RI WKHVH DQWLERGLHV ZHUH DEOH WR LQKLELW WKH KXPDQ UDW RU ERYLQH VSOHHQ HQ]\PHV DW WKH FRQFHQWUDWLRQV WHVWHG GDWD QRW VKRZQf 'LVFXVVLRQ 7DUWUDWHUHVLVWDQW DFLG SKRVSKDWDVHV IURP YDULRXV WLVVXH VRXUFHV FDQ EH SXULILHG E\ D SURFHGXUH ZKLFK FORVHO\ UHVHPEOHV WKH IDVW FRQYHQLHQW SXULILFDWLRQ SURWRFRO IRU SRUFLQH XWHURIHUULQ 7KLV LV SDUWLFXODUO\ LPSRUWDQW LQ WKH FDVH RI WKH KXPDQ HQ]\PH ZKHUH SUHYLRXV DWWHPSWV DW SXULILFDWLRQ WR KRPRJHQHLW\ ZHUH HLWKHU QRW VXFFHVVIXO /DP HW DO f RU LQYROYHG D ODUJH QXPEHU RI WLPHFRQVXPLQJ VWHSV 5RELQVRQ DQG *OHZ f 7KUHH SURSHUWLHV DOORZHG WKH KDLU\ FHOO SKRVSKDWDVH WR EH SXULILHG UHDGLO\ IURP H[WUDFWV RI VSOHHQ 7KH KLJK LVRHOHFWULF SRLQW HQVXUHG WKDW LW ERXQG WR &0FHOOXORVH DW KLJK S+ ,WV LPPXQRORJLFDO

PAGE 89

7$%/( ,QKLELWLRQ RI DFLG SKRVSKDWDVH DFWLYLW\ RI XWHURIHUUOQ E\ PRQRFORQDO DQWLERGLHV $QWLERG\ 0RODU 5DWLR $QWLERG\ 8WHURIHUULQ $FLG 3KRVSKDWDVH $FWLYLW\ b FRQWURO L LQ R + &2 8WHURIHUULQ PJf ZDV LQFXEDWHG IRU KRXU DW URRP WHPSHDWXUH ZLWK WKH DQWLERG\ VSHFLILHG WKHQ DVVD\HG LQ WULSOLFDWH IRU DFLG SKRVSKDWDVH DFWLYLW\ ZLWK P0 SQLWURSKHQ\OSKRVSKDWH DV VXEVWUDWH DQG ZLWKRXW WKH DGGLWLRQ RI PHUFDSWRHWKDQRO $OO DFWLYLWLHV DUH SUHVHQWHG DV SHUFHQW RI D FRQWURO DVVD\ SHUIRUPHG VLPXOWDQHRXVO\

PAGE 90

FURVVUHDFWLYLW\ ZLWK DQWLXWHURIHUULQ DQWLERGLHV SHUPLWWHG LW WR EH DGVRUEHG WR WKH LPPXQRDIILQLW\ FROXPQ )LQDOO\ LW ZDV UHODWLYHO\ VWDEOH WR WKH FRQGLWLRQV RI HOXWLRQ QDPHO\ D EULHI H[SRVXUH WR S+ JO\FLQH EXIIHU ,W LV FRQFHLYDEOH WKDW VRPH RI WKH ORVVHV WKDW RFFXUUHG DW WKH LPPXQRDIILQLW\ VWHS GLG UHVXOW IURP WKH HOXWLRQ FRQGLWLRQV 8WHURIHUULQ DOWKRXJK UHODWLYHO\ VWDEOH WR ORZ S+ GRHV EHJLQ WR ORVH LWV SKRVSKDWDVH DFWLYLW\ DQG SUHVXPDEO\ LWV ERXQG LURQ LI PDLQWDLQHG EHORZ S+ &DPSEHOO DQG =HUQHU f +RZHYHU WKH PDMRU ORVV RI \LHOG RFFXUUHG GXULQJ WKH ELQGLQJ WR &0FHOOXORVH D VWHS ZKLFK UDUHO\ SURYLGHG PRUH WKDQ b UHFRYHU\ RI HQ]\PH 7KLV IDLOXUH RI WKH FDWLRQ H[FKDQJHU WR ELQG DOO RI WKH HQ]\PH ZDV QRW WKH UHVXOW RI LWV ELQGLQJ FDSDFLW\ EHLQJ H[FHHGHG QRU WR WKH SUHVHQFH RI HQ]\PH YDULDQWV RI ORZHU LVRHOHFWULF SRLQW 1HLWKHU ZDV LW UHODWHG WR WKH SUHVHQFH RI GHWHUJHQW 3RVVLEO\ WKH HQ]\PH UHPDLQV FRPSOH[HG ZLWK VRPH VROXEOH VWURQJO\ DQLRQLF FRPSRQHQW LQ WKH KRPRJHQDWH :KDWHYHU WKH EDVLV RI WKH SKHQRPHQRQ UHSHDWHG WUHDWPHQW ZLWK &0FHOOXORVH GRHV SURYLGH D PXFK LPSURYHG \LHOG ZLWK XS WR b RI WKH WRWDO SKRVSKDWDVH DFWLYLW\ RI WKH VSOHHQ H[WUDFW HYHQWXDOO\ ELQGLQJ :KHQ HQ]\PH ZDV SXULILHG IURP KXPDQ SODFHQWD SURWDPLQH VXOIDWH ZDV DGGHG LQ RUGHU WR ELQG YDULRXV DQLRQLF FRPSRQHQWV LQ WKH KRPRJHQDWH 7KLV SURFHGXUH ZDV ILUVW HPSOR\HG E\ *ORPVHW DQG 3RUDWK IRU SXULILFDWLRQ RI WKH ERYLQH VSOHHQ HQ]\PH f DQG ZDV DOVR XVHG E\ $QGHUVRQ DQG 7RYHUXG LQ SXULILFDWLRQ RI WKH UDW ERQH HQ]\PH f 3URWDPLQH VXOIDWH SUHFLSLWDWLRQ RI DQLRQLF FRPSRQHQWV LV QRZ URXWLQHO\ HPSRO\HG E\ RXU ODERUDWRU\ IRU WKH SXULILFDWLRQ RI WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVHV VHH $OOHQ HW DO LQ SUHVVf

PAGE 91

'HVSLWH WKH IDFW WKDW WKH VSOHHQ ZDV KRPRJHQL]HG LQ D EXIIHU ZKLFK FRQWDLQHG D ZLGH UDQJH RI SURWHDVH LQKLELWRUV WKHUH ZDV HYLGHQFH WR VXJJHVW WKDW PXFK RI WKH HQ]\PH PD\ KDYH EHHQ FOHDYHG LQWR VXEXQLWV GXULQJ RU SULRU WR SXULILFDWLRQ $FWLYLW\ ZDV ORVW IRU H[DPSOH LI WKH KRPRJHQDWH ZDV QRW UDSLGO\ SURFHVVHG DQG WKH UHODWLYH \LHOG RI PRQRPHU DQG RI WKH WZR VXEXQLWV YDULHG IURP SUHSDUDWLRQ WR SUHSDUDWLRQ 0RUHRYHU WKH ILQDO HQ]\PH DOWKRXJK H[KLELWLQJ D V\PPHWULFDO SHDN RI SURWHLQ DQG HQ]\PH DFWLYLW\ RI DSSDUHQW 0U GXULQJ JHO ILOWUDWLRQ RQ 6HSKDGH[ DOZD\V GLVSOD\HG VRPH VXEXQLWV GXULQJ 6'63$*( 5RELQVRQ DQG *OHZ f ZRUNLQJ ZLWK WKH FORVHO\ VLPLODU *DXFKHU VSOHHQ HQ]\PH KDYH VKRZQ WKDW WKH SUHVHQFH RI WKH WZR ORZHU PROHFXODU ZHLJKW SRO\SHSWLGHV FRXOG EH PLQLPL]HG EXW QRW SUHYHQWHG LI D SURWHDVH LQKLELWRU ZDV LQFOXGHG LQ WKH KRPRJHQL]LQJ EXIIHU ,Q DGGLWLRQ ZKHQ XWHURIHUULQ ZDV WUHDWHG ZLWK ORZ FRQFHQWUDWLRQV RI WU\SVLQ RU FK\PRWU\SVLQ %XKL f RU LQFXEDWHG LQ DOODQWRLF IOXLG %XKL HW DO Ef DQ DFWLYH HQ]\PH ZLWK VXEXQLWV RI DSSDUHQW 0U DQG ZDV SURGXFHG 3UHVXPDEO\ ERWK SURWHLQV SRVVHVV D UHJLRQ RI SHSWLGH ZKLFK LV VHQVLWLYH WR SURWHDVHV 7KH UHSRUWV WKDW WKH FORVHO\ VLPLODU EHHI VSOHHQ HQ]\PH ZKLFK ZH KDYH VKRZQ WR FURVVUHDFW LPPXQRORJLFDOO\ ZLWK XWHURIHUULQ SRVVHVVHV WZR VXFK VXEXQLWV 'DYLV HW DO &DPSEHOO HW DO f LPSOLHV WKDW WKH ERYLQH HQ]\PH PLJKW DOVR EHFRPH FOHDYHG SURWHRO\WLFDOO\ HLWKHU GXULQJ QRUPDO LQ YLWUR SURFHVVLQJ RU GXULQJ LWV LVRODWLRQ IURP WKH VSOHHQ KRPRJHQDWH ,Q FRQWUDVW WKH ERYLQH ERQH HQ]\PH /DX HW DO f DQG WKH ERYLQH XWHULQH HQ]\PH GR QRW VHHP WR EH DV VHQVLWLYH WR WKLV SURWHRO\VLV WKH\ DSSHDU DV LQWDFW PRQRPHUV DIWHU SXULILFDWLRQ 7KH KXPDQ ERQH HQ]\PH XQOLNH

PAGE 92

WKH KXPDQ VSOHHQ DQG SODFHQWD HQ]\PHV LV DOVR HDVLO\ SXULILHG ZLWKRXW HYLGHQFH RI SURWHRO\WLF SURGXFWV $OOHQ HW DO LQ SUHVVf 7KH HDUOLHU UHSRUW WKDW WKH KDLU\ FHOO HQ]\PH LV QRW DFWLYDWHG E\ UHGXFLQJ DJHQWV /DP HW DO f FDQ SUREDEO\ EH H[SODLQHG E\ WKH REVHUYDWLRQ WKDW DFWLYDWLRQ ZDV WUDQVLHQW DQG YDULHG EHWZHHQ SUHSDUDWLRQV 6LPLODU REVHUYDWLRQV KDYH EHHQ PDGH ZLWK XWHURIHUULQ 7KH GLIIHUHQFHV LQ PROHFXODU ZHLJKW YHUVXV f FDQ LQ WXUQ E\ DWWULEXWHG WR WKH IDFW WKDW KHPRJORELQ ZDV HPSOR\HG DV D VWDQGDUG LQ WKH HDUOLHU ZRUN /DP HW DO f DQG DVVXPHG WR PDLQWDLQ WKH PROHFXODU ZHLJKW RI WKH WHWUDPHU GXULQJ VXFURVH GHQVLW\ JUDGLHQW FHQWULIXJDWLRQ 7KH YDULDELOLW\ LQ NLQHWLF SDUDPHWHUV SDUWLFXODUO\ .P DQG 9f DUH SUREDEO\ EHVW H[SODLQHG E\ WKH VHQVLWLYLW\ RI WKHVH HQ]\PHV WR D YDULHW\ RI LQKLELWRUV LQFOXGLQJ VXOIK\GU\O DJHQWV DQLRQV KHDY\ PHWDOV DQG R[LGL]LQJ DJHQWV 7KH SURSHUWLHV RI WKH KDLU\ FHOO HQ]\PH GR KRZHYHU GLIIHU VRPHZKDW IURP WKRVH UHSRUWHG IRU WKH WDUWUDWH LQVHQVLWLYH SKRVSKDWDVH LVRODWHG E\ 5RELQVRQ DQG *OHZ f IURP VSOHHQV RI SDWLHQWV ZLWK *DXFKHUnV GLVHDVH 7KDW SKRVSKDWDVH GHVSLWH WKH IDFW WKDW LW DSSHDUHG WR FURVVUHDFW LPPXQRORJLFDOO\ ZLWK WKH KDLU\ FHOO HQ]\PH /DP HW DO f IDLOHG WR XWLOL]H S\URSKRVSKDWH DV D VXEVWUDWH DQG K\GURO\]HG $73 FRQVLGHUDEO\ EHWWHU WKDQ $'3 5RELQVRQ DQG *OHZ f ,W LV VWLOO QRW FOHDU WKHUHIRUH ZKHWKHU RU QRW WKH *DXFKHU SKRVSKDWDVH DQG WKH RQH IURP KDLU\ FHOO VSOHHQ DUH LGHQWLFDO SURWHLQV 7KH H[SHULPHQWV ZLWK ZKROH DQWLVHUXP DQG ZLWK WKH GLIIHUHQW PRQRFORQDO DQWLERGLHV WR XWHURIHUULQ DQG WKH KXPDQ VSOHHQ HQ]\PH HPSKDVL]H WKDW WKH WZR SURWHLQV PXVW KDYH FURVVUHDFWLQJ DQG SUHVXPDEO\

PAGE 93

VWUXFWXUDOO\ UHODWHG GHWHUPLQDQWV HSLWRSHVf RQ WKHLU VXUIDFHV 0RQRFORQDO DQWLERG\ IRU H[DPSOH ZDV VHOHFWHG IRU LWV DELOLW\ WR ELQG WR ERWK XWHURIHUULQ DQG WR WKH VSOHHQ HQ]\PH ,WV ELQGLQJ FKDUDFWHULVWLFV WRZDUGV ERWK SURWHLQV DQG WRZDUGV WKH UDW VSOHHQ ERYLQH VSOHHQ DQG ERYLQH XWHULQH HQ]\PHV DSSHDUHG IDLUO\ VLPLODU VXJJHVWLQJ WKDW WKH HSLWRSH LW UHFRJQL]HG ZDV UHODWLYHO\ FRQVHUYHG 2Q WKH RWKHU KDQG WKH PRQRFORQDO DQWLERGLHV DQG ERXQG WR WKH KXPDQ UDW DQG ERYLQH VSOHHQ HQ]\PHV DQG WKH ERYLQH XWHULQH HQ]\PH ZLWK PXFK ORZHU DIILQLW\ WKDQ WR XWHURIHUULQ ,W FDQ EH FRQFOXGHG WKDW DOO RI WKH HQ]\PHV FDUU\ VWUXFWXUDOO\ KRPRORJRXV HSLWRSHV RQ WKHLU UHVSHFWLYH VXUIDFH EXW WKHVH VLWHV DUH QRW HTXDOO\ FRQVHUYHG 1HYHUWKHOHVV WKH DELOLW\ WR JHQHUDWH ERWK SRO\FORQDO DQG PRQRFORQDO DQWLERGLHV ZKLFK KDYH EURDG LPPXQRORJLFDO FURVVUHDFWLYLW\ VKRXOG SURYH XVHIXO LQ IXUWKHU VWXGLHV RQ WKH ELRV\QWKHVLV DQG ORFDOL]DWLRQ RI WKLV FODVV RI DFLG SKRVSKDWDVH 7KHVH DQWLERGLHV PD\ KDYH GLDJQRVWLF YDOXH ERWK IRU LGHQWLI\LQJ OHXNHPLF KDLU\ FHOOV LPPXQRF\WRFKHPLFDOO\ DQG IRU PHDVXULQJ WKH OHYHO RI WKH 7\SH LVR]\PH LQ SODVPD E\ LPPXQRDVVD\ 7KH ODWWHU SURFHGXUH PD\ EH SDUWLFXODUO\ XVHIXO IRU DVVHVVLQJ RVWHRFODVW DFWLYLW\ LQ LQGLYLGXDOV H[KLELWLQJ DEQRUPDO ERQH PHWDEROLVP 0LQNLQ &KHQ HW DO 6WHSDQ HW DO f RU LQ SDWLHQWV ZLWK RVWHRFODVWLF WXPRUV 7DYDVVROL HW DO f 7KH UHVXOWV RI WKLV VWXG\ FOHDUO\ GHPRQVWUDWH WKDW XWHURIHUULQ WKH SXUSOHFRORUHG DFLG SKRVSKDWDVHV IURP UDW VSOHHQ ERYLQH VSOHHQ DQG WKH ERYLQH XWHUXV DQG WKH HQ]\PH IURP WKH VSOHHQV RI KXPDQ SDWLHQWV ZLWK KDLU\ FHOO OHXNHPLD DUH FORVHO\ UHODWHG SURWHLQV ,Q DGGLWLRQ WR WKHLU LPPXQRORJLFDO FURVVUHDFWLYLW\ WKH\ DUH VLPLODU LQ NLQHWLF SURSHUWLHV

PAGE 94

LQ WKHLU VXEVWUDWH VSHFLILFLWLHV DQG LQ WKHLU VHQVLWLYLWLHV WR D EURDG UDQJH RI LQKLELWRUV 7KH\ DOVR UHVHPEOH HDFK RWKHU LQ PROHFXODU VL]H LVRHOHFWULF SRLQW JO\FRSURWHLQ QDWXUH DQG LURQ FRQWHQW 2QH REYLRXV GLIIHUHQFH KRZHYHU EHWZHHQ XWHULQH HQ]\PHV DQG WKH VSOHHQ HQ]\PHV VWXGLHG LQ WKLV FKDSWHU LV WKDW WKH XWHULQH HQ]\PHV DUH VHFUHWHG JO\FRSURWHLQV ZKHUHDV WKH RWKHUV DUH SULQFLSDOO\ LQWUDFHOOXODU 1HYHUWKHOHVV HYHQ WKLV SDUDGR[ PD\ EH UHVROYHG DV WKHUH LV QRZ FRQVLGHUDEOH HYLGHQFH WKDW XWHURIHUULQ PD\ UHSUHVHQW D K\SHUVHFUHWHG O\VRVRPDO HQ]\PH %DXPEDFK HW DO f ,W LV IRU H[DPSOH D VXEVWUDWH IRU WKH WUDQVIHUDVH ZKLFK LV VSHFLILFDOO\ UHVSRQVLEOH IRU WKH VHOHFWLYH SKRVSKRU\ODWLRQ RI PDQQRVH UHVLGXHV RQ O\VRVRPDO HQ]\PHV /DQJ HW DO f 8WHURIHUULQ LV DOVR VHFUHWHG ZLWK WKH VRFDOOHG O\VRVRPDO UHFRJQLWLRQ PDUNHU PDQQRVH SKRVSKDWH SUHVHQW RQ LWV FDUERK\GUDWH FKDLQ %DXPEDFK HW DO f 3RVVLEO\ DOO PHPEHUV RI WKLV FODVV RI DFLG SKRVSKDWDVH KDYH WKH SURSHUWLHV RI O\VRVRPDO HQ]\PHV &HUWDLQO\ PDQ\ RI WKHP DSSHDU WR UHVLGH LQWUDFHOOXODUO\ LQ LQFOXVLRQ ERGLHV UHVHPEOLQJ O\VRVRPHV %DXPEDFK HW DO
PAGE 95

.SV DQG Q0f ,W ZRXOG EH LQWHUHVWLQJ WR GHWHUPLQH ZKHWKHU GLIIHUHQWLDO WDUJHWLQJ LV GXH WR YDULDWLRQ LQ WKH HQ]\PHVn SULPDU\ VHTXHQFHV $Q DOWHUQDWLYH DSSURDFK WR VWXG\ WDUJHWLQJ RI WKH SXUSOH SKRVSKDWDVHV ZRXOG LQYROYH WKH LVRODWLRQ DQG FKDUDFWHUL]DWLRQ RI D SRUFLQH VSOHHQ HQ]\PH ZKLFK ZRXOG SUHVXPDEO\ EH O\VRVRPDO ,W DSSHDUV WKDW VXFK DQ HQ]\PH H[LVWV DQG LV GLVWLQFW IURP XWHURIHUULQ 0 .D]HPL DQG 50 5REHUWV XQSXEOLVKHG UHVXOWVf ,Q FRQFOXVLRQ LW LV SURSRVHG WKDW WKH 7\SH KXPDQ LVR]\PH EHORQJV WR WKH JURZLQJ FODVV RI LURQFRQWDLQLQJ SKRVSKDWDVHV RI ZKLFK XWHURIHUULQ DQG WKH SKRVSKRSURWHLQ SKRVSKDWDVH RI EHHI VSOHHQ DUH WKH EHVW FKDUDFWHUL]HG ,W UHPDLQV WR EH GHWHUPLQHG ZKHWKHU WKH KXPDQ HQ]\PH SRVVHVVHV WKH SXUSOH FRORU DQG FKDUDFWHULVWLF Jn (65 LURQ VLJQDO ZKLFK LV H[KLELWHG E\ XWHURIHUULQ $QWDQDLWLV HW DO f DQG WKH ERYLQH VSOHHQ SKRVSKDWDVH 'DYLV DQG $YHULOO f :K\ WKH 7\SH LVR]\PH DFFXPXODWHV LQ WKH OHXNHPLF KDLU\ FHOO DQG LQ WKH VSOHHQ KLVWLRF\WHV RI SDWLHQWV ZLWK *DXFKHUnV GLVHDVH LV XQNQRZQ %RWK WKHVH FHOO W\SHV DUH FDSDEOH RI SKDJRF\WRVLQJ HU\WKURF\WHV 5RELQVRQ DQG *OHZ 1DQED HW DO f DQG WKH *DXFKHU FHOO LV NQRZQ WR DFFXPXODWH ODUJH DPRXQWV RI LURQ 5RELQVRQ DQG *OHZ f 3RVVLEO\ WKH HOHYDWLRQ RI WKH 7\SH SKRVSKDWDVH LV D UHIOHFWLRQ RI DEQRUPDO LURQ PHWDEROLVP LQ WKHVH FHOOV

PAGE 96

&+$37(5 02/(&8/$5 &/21,1* 2) 7+( 7<3( 7$575$7(5(6,67$17 $&,' 3+263+$7$6( )520 +80$1 3/$&(17$ $1' ,76 (;35(66,21 ,1 /(8.(0,$ &(//6 ,QWURGXFWLRQ 7KHUH DUH DW OHDVW VL[ GLVWLQFW W\SHV RI DFLG SKRVSKDWDVH LQ KXPDQ OHXNRF\WHV ZKLFK FDQ EH GLVWLQJXLVKHG E\ HOHFWURSKRUHWLF DQG RWKHU FKDUDFWHULVWLFV /L HW DO /DP HW DO /L HW DO f 7KH 7\SH LVR]\PH LV WKH PRVW FDWLRQLF RI WKH DFLG SKRVSKDWDVHV DQG LV WKH RQO\ LVR]\PH LQVHQVLWLYH WR LQKLELWLRQ E\ /fWDUWUDWH ,W KDV EHHQ GHWHFWHG LQ VSOHHQ OXQJ OLYHU DQG ERQH DV D PLQRU LVR]\PH /DP HW DO
PAGE 97

,Q WKH SUHYLRXV FKDSWHU WKH SXULILFDWLRQ DQG FKDUDFWHUL]DWLRQ RI WKLV 7\SH DFLG SKRVSKDWDVH IURP KXPDQ KDLU\ FHOO VSOHHQ QRUPDO VSOHHQ DQG SODFHQWD ZHUH UHSRUWHG ,W ZDV GHPRQVWUDWHG WKDW WKLV KXPDQ HQ]\PH LV UHPDUNDEO\ VLPLODU WR DQ DEXQGDQW WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH VHFUHWHG E\ WKH SRUFLQH XWHUXV XQGHU WKH LQIOXHQFH RI SURJHVWHURQH NQRZQ DV XWHURIHUULQ %RWK WKH KXPDQ HQ]\PH DQG XWHURIHUULQ DUH LURQ FRQWDLQLQJ JO\FRSURWHLQV DQG UHVHPEOH HDFK RWKHU FORVHO\ LQ HOHFWURSKRUHWLF PRELOLW\ VXEVWUDWH VSHFLILFLW\ DQG VHQVLWLYLW\ WR D YDULHW\ RI DFWLYDWRUV DQG LQKLELWRUV 7KH WZR SURWHLQV DUH DOVR LPPXQRORJLFDOO\ UHODWHG :KLOH XWHURIHUULQ LV EHOLHYHG WR IXQFWLRQ LQ LURQ PHWDEROLVP VHH 5REHUWV DQG %D]HU f WKH IXQFWLRQ RI WKH KXPDQ HQ]\PH LV XQNQRZQ ,Q YLHZ RI WKH FOLQLFDO VLJQLILFDQFH RI WKH KXPDQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH IXUWKHU VWXGLHV RQ LWV WUDQVFULSWLRQDO FRQWURO VHHPHG ZDUUDQWHG $ KXPDQ SODFHQWD F'1$ OLEUDU\ ZDV VFUHHQHG ZLWK SRO\FORQDO DQWLERGLHV DJDLQVW SRUFLQH XWHURIHUULQ +RZHYHU WKHVH DQWLERGLHV IDLOHG WR GHWHFW D F'1$ FRGLQJ IRU WKH KXPDQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH $FFRUGLQJO\ WZR VKRUW F'1$ FORQHV FRGLQJ IRU SRUFLQH XWHURIHUULQ ZHUH HPSOR\HG WR LVRODWH D F'1$ FRGLQJ IRU WKH KXPDQ HQ]\PH ,Q WKLV FKDSWHU WKH PROHFXODU FORQLQJ RI D ES F'1$ ZKLFK FRYHUV WKH FRPSOHWH FRGLQJ UHJLRQ RI WKH KXPDQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH LV GHVFULEHG DQG WKH GHGXFHG DPLQR DFLG VHTXHQFH RI WKH KXPDQ HQ]\PH LV FRPSDUHG WR WKH DPLQR DFLG VHTXHQFHV RI SRUFLQH XWHURIHUULQ DQG D UHODWHG ERYLQH VSOHHQ DFLG SKRVSKDWDVH 7KH H[SUHVVLRQ RI WKLV KXPDQ SKRVSKDWDVH LQ KXPDQ OHXNHPLD FHOOV LV

PAGE 98

GHPRQVWUDWHG DQG LWV UHJXODWLRQ VWXGLHG LQ WKH KXPDQ HU\WKUROHXNHPLD FHOO OLQH 0DWHULDOV DQG 0HWKRGV 0DWHULDOV 7KH KXPDQ SODFHQWD F'1$ OLEUDU\ PRXVH VSOHHQ F'1$ OLEUDU\ DQG KXPDQ SODFHQWD SRO\ $f 51$ ZHUH REWDLQHG IURP &ORQWHFK *RDW DQWLUDEELW DQG JRDW DQWLPRXVH DQWLERGLHV FRXSOHG WR KRUVHUDGLVK SHUR[LGDVH ZHUH IURP %LR5DG $OO UHVWULFWLRQ HQGRQXFOHDVHV WKH ODUJH IUDJPHQW RI ( FROL '1$ SRO\PHUDVH 7 '1$ OLJDVH DQG WKH 51$ ODGGHU ZHUH IURP %HWKHVGD 5HVHDUFK /DERUDWRULHV 7KH >DA3@G$73 ZDV SXUFKDVHG IURP 1HZ (QJODQG 1XFOHDU &RUS 7KH nGHR[\QXFOHRWLGH WULSKRVSKDWHnn GLGHR[\QXFOHRWLGH WULSKRVSKDWH VHTXHQFLQJ PL[HV ZHUH IURP 1HZ (QJODQG %LR/DEV +HSDULQ$JDURVH KHPLQ DQG 73$ ZHUH IURP 6LJPD )HWDO ERYLQH VHUXP DQG 530, ZHUH REWDLQHG IURP *LEFR%5/ 2OLJRGHR[\KH[DPHU IRU UDQGRP SULPHU H[WHQVLRQ SUREHV ZDV IURP 3KDUPDFLD $OO RWKHU FKHPLFDOV UHDJHQW JUDGH RU EHWWHU ZHUH IURP 6LJPD RU )LVKHU 0HWKRGV 3UHSDUDWLRQ RI DQWLVHUD IRU LPPXQRVFUHHQLQJ $GXOW 1HZ =HDODQG :KLWH UDEELWV ZHUH LPPXQL]HG ZLWK WR PJ RI XWHURIHUULQ PL[HG ZLWK )UHXQGnV FRPSOHWH DGMXYDQW DQG WKHQ LQMHFWHG VXEFXWDQHRXVO\ DW PXOWLSOH VLWHV +HUEHUW f %RRVWHU LQMHFWLRQV RI WR PJ RI DQWLJHQ LQ LQFRPSOHWH DGMXYDQW ZHUH DGPLQLVWHUHG PRQWKO\ %OHHGLQJV RI WR PO ZHUH WDNHQ GD\V DIWHU LQMHFWLRQV 7KH VDPSOHV ZHUH DOORZHG WR FORW RYHUQLJKW DW r& DQG WKHQ FHQWULIXJHG WR VHSDUDWH WKH VHUXP IURP WKH FORW ,Q VRPH FDVHV WKH DQWLVHUD ZHUH DIILQLW\ SXULILHG RQ DQWL XWHURIHUULQ 6HSKDURVH DV RXWOLQHG LQ &KDSWHU ,Q RWKHU FDVHV WKH

PAGE 99

DQWLVHUD ZHUH UXQ WKURXJK D FROXPQ RI ( FROL SURWHLQV ZKLFK KDG EHHQ FRXSOHG WR 6HSKDURVH LQ RUGHU WR UHPRYH DQWLERGLHV DJDLQVW ( FROL SURWHLQV +X\QK HW DO f 6FUHHQLQJ RI WKH ODPEGD JWOO OLEUDULHV ZLWK DQWLXWHURIHUULQ DQWLERGLHV $ KXPDQ SODFHQWD F'1$ OLEUDU\ SUHSDUHG E\ 0LOODQ f ZDV SXUFKDVHG IURP &ORQWHFK 7KLV OLEUDU\ FRQWDLQV [ A LQGHSHQGHQW FORQHV ZLWK b UHFRPELQDQW SKDJH 7KH LQVHUW VL]HV UDQJH IURP NE DQG WKH DYHUDJH LQVHUW VL]H LV NE $ PRXVH VSOHHQ F'1$ OLEUDU\ ZDV SXUFKDVHG IURP &ORQWHFK 7KLV OLEUDU\ FRQWDLQV [ A LQGHSHQGHQW FORQHV ZLWK b UHFRPELQDQW SKDJH 7KH DYHUDJH LQVHUW VL]H LV NE 7KH SRUFLQH XWHULQH HQGRPHWULXP F'1$ OLEUDU\ ZDV SUHSDUHG E\ *HRUJH %DXPEDFK DQG 3DWULFN *LOOHYHW DW WKH 8QLYHUVLW\ RI )ORULGD 7KH PHWKRG XVHG IRU VFUHHQLQJ ZDV GHYHORSHG E\ b ZYf WU\SWRQH b ZYf \HDVW H[WUDFW b ZYf 1D&O@ SOXV b ZYf PDOWRVH DQG [JPO DPSLFLOOLQ DW r& ZLWK JRRG DHUDWLRQ 7KH QH[W PRUQLQJ WKH EDFWHULD ZHUH FHQWULIXJHG DW [J DW URRP WHPSHUDWXUH IRU PLQXWHV DQG UHVXVSHQGHG LQ RQHILIWK RULJLQDO YROXPH RI 60 EXIIHU >0 7ULV+&O S+ 0 0J&O 2OP0 ('7$ b ZYf JHODWLQ@ $Q DSSURSULDWH QXPEHU RI SKDJH ZHUH PL[HG ZLWK HLWKHU LO RI EDFWHULD IRU PP GLVKHVf RU LO EDFWHULD IRU PP GLVKHVf 7KH EDFWHULD DQG SKDJH ZHUH LQFXEDWHG DW r& IRU PLQXWHV WR DOORZ WKH SKDJH WR DGKHUH WR WKH EDFWHULD 7KH SKDJH DQG EDFWHULD ZHUH WKHQ PL[HG ZLWK HLWKHU PO IRU PP GLVKHVf RU PO IRU PP GLVKHVf RI PHOWHG /% FRQWDLQLQJ b ZYf DJDURVH ZKLFK KDG EHHQ NHSW DW r& 7KH PL[WXUH

PAGE 100

ZDV SRXUHG RQWR SODWHV FRQWDLQLQJ /% ZLWK b ZYf DJDU ZKLFK KDG EHHQ SUHZDUPHG WR r& 7KH SODWHV ZHUH WKHQ SODFHG LQ DQ LQFXEDWRU DW r& IRU WR KRXUV RU XQWLO SODTXHV EHJDQ WR DSSHDU RQ D FRQIOXHQW ODZQ RI EDFWHULD 1LWURFHOOXORVH ILOWHUV ZKLFK KDG EHHQ VRDNLQJ LQ O2P0 LVRSURS\O 'WKLRJDODFWRS\UDQRVLGH ,37*f ZHUH WKHQ SODFHG RQ WKH SODWHV 7KH SODWHV ZHUH LQFXEDWHG DW r& IRU KRXUV ZKLFK DOORZHG D JDODFWRVLGDVH IXVLRQ SURWHLQ WR EH IRUPHG ZKLFK DGKHUHG WR WKH ILOWHU $IWHU WKH ILOWHUV KDG EHHQ UHPRYHG WKH SODWHV ZHUH VDYHG DW r& XQWLO QHHGHG 7KH ILOWHUV ZHUH ZDVKHG WKUHH WLPHV ZLWK 7ULV EXIIHUHG VDOLQH 7%6 0 7ULV+&O S+ 0 1D&Of DQG SODFHG LQ DQWLERG\ VROXWLRQ FRQWDLQLQJ D GLOXWLRQ RI DQWLVHUD LQ 7%6 ZLWK b ZYf ERYLQH VHUXP DOEXPLQ %6$f 7KH ILOWHUV ZHUH LQFXEDWHG LQ DQWLERG\ VROXWLRQ RYHUQLJKW DW r& RQ D URFNLQJ SODWIRUP DW ORZ VSHHG 7KH QH[W GD\ WKH DQWLERG\ VROXWLRQ ZDV UHPRYHG ILOWHU VWHULOL]HG WKURXJK D 0LOOLSRUH SP ILOWHU DQG VWRUHG DW r& (DFK DQWLERG\ SUHSDUDWLRQ ZDV XVHG XS WR ILYH WLPHVf 7KH ILOWHUV ZHUH ZDVKHG WKRURXJKO\ ZLWK WKUHH FKDQJHV RI 7%6 7KH DGGLWLRQDO SURWHLQ ELQGLQJ VLWHV RQ WKH QLWURFHOOXORVH ZHUH EORFNHG E\ LQFXEDWLRQ LQ 7%6 SOXV b ZYf %6$ 7KH ILOWHUV ZHUH WKHQ WUHDWHG ZLWK JRDW DQWLUDEELW DQWLERG\ FRXSOHG WR KRUVHUDGLVK SHUR[LGDVH GLOXWHG LQ 7%6 SOXV b ZYf %6$ DW GLOXWLRQV WR IROG PRUH FRQFHQWUDWHG WKDQ WKH PDQXIDFWXUHUnV VXJJHVWHG GLOXWLRQ IRU :HVWHUQ EORWWLQJ 7KH ILOWHUV ZHUH LQFXEDWHG LQ WKH VHFRQG DQWLERG\ VROXWLRQ IRU KRXUV DW URRP WHPSHUDWXUH RQ D URFNLQJ SODWIRUP DW ORZ VSHHG 7KH DQWLERG\ ZDV WKHQ UHPRYHG DQG GLVFDUGHG DQG WKH ILOWHUV ZDVKHG WKRURXJKO\ DV EHIRUH

PAGE 101

7KH VXEVWUDWH VROXWLRQ XVHG WR GHWHFW LQXQXQRUHDFWLYH IXVLRQ SURWHLQV FRORULPHWULFDOO\ ZDV PJPO FKORUROQDSKWKRO LQ 7%6 SOXV b YYf K\GURJHQ SHUR[LGH :KHQ WKLV VROXWLRQ ZDV SRXUHG RQWR WKH ZDVKHG ILOWHUV LQXQXQRUHDFWLYH IXVLRQ SURWHLQV DSSHDUHG DV EULJKW SXUSOH ULQJV LQ OHVV WKDQ PLQXWHV (DFK WLPH SODTXHV ZHUH LPPXQRVFUHHQHG GRW EORW SRVLWLYH FRQWUROV ZHUH DOVR WHVWHG 'RWV RI [O FRQWDLQLQJ OSJ O22QJ QJ OQJ DQG 2OQJ RI XWHURIHUULQ ZHUH SODFHG RQ D VWULS RI QLWURFHOOXORVH 7KHVH GRW EORWV ZHUH WUHDWHG H[DFWO\ DV WKH QLWURFHOOXORVH ILOWHU OLIWV IURP SODWHV $ JRRG SULPDU\ DQWLERG\ ZLWK IUHVK VHFRQGDU\ DQWLERG\ FRXOG URXWLQHO\ GHWHFW 2OQJ RI XWHURIHUULQ 3ODTXHV SURGXFLQJ LQXQXQRUHDFWLYH IXVLRQ SURWHLQV ZHUH UHPRYHG DV DJDURVH SOXJV IURP WKH SODWHV ZLWK VWHULOH 3DVWHXU SLSHWWHV RU PLFURFDSLOODU\ WXEHV (DFK SOXJ ZDV SODFHG LQ PO RI 60 SOXV LO RI FKORURIRUP DQG VWRUHG DW r& $Q DSSURSULDWH YROXPH RI WKH SKDJH LQ 60 ZDV UHVFUHHQHG DV GHVFULEHG DV DERYH $Q LQGLYLGXDO SODTXH W\SLFDOO\ FRQWDLQV AA SKDJHf 7KLV SURFHVV ZDV FRQWLQXHG XQWLO DOO SODTXHV RQ D SODWH ZHUH SRVLWLYH *HQHUDO PHWKRGVKDQGOLQJ '1$ DQG 51$ '1$ DQG 51$ FRQFHQWUDWLRQV ZHUH HVWLPDWHG DW QP DVVXPLQJ (f b DQG UHVSHFWLYHO\ (WKDQRO SUHFLSLWDWLRQ'1$ ZDV SUHFLSLWDWHG DW r& IRU DW OHDVW PLQXWHV LQ WKH SUHVHQFH RI 0 DPPRQLXP DFHWDWH S+ DQG WKUHH YROXPHV RI b HWKDQRO 3UHLSLWDWHV ZHUH FROOHFWHG E\ FHQWULIXJDWLRQ [J PLQXWHVf 51$ ZDV SUHFLSLWDWHG IRU DW OHDVW KRXU DW r& LQ WKH SUHVHQFH RI 0 VRGLXP DFHWDWH S+ DQG WZR YROXPHV RI

PAGE 102

b HWKDQRO 3UHFLSLWDWHV ZHUH FROOHFWHG E\ FHQWULIXJDWLRQ [J PLQXWHVf 3KHQROFKORURIRUP H[WUDWLRQ UHIHUV WR WKH SKDVH VHSDUDWLRQ RI D QXFOHLF DFLG VROXWLRQ E\ HPXOVLILFDWLRQ ZLWK YROXPH RI SKHQRO IROORZHG E\ UHHPXOVLILFDWLRQ LQ YROXPH RI SKHQRO DQG YROXPH RI FKORURIRUP LVRDP\O DOFRKRO f DQG ILQDOO\ YROXPH RI FKORURIRUP LVRDP\O DOFRKRO f 7KH DTXHRXV SKDVH ZDV FROOHFWHG HDFK WLPH E\ FHQWULIXJDWLRQ [J PLQXWHVf $OO VROXWLRQV DQG PDWHULDOV WKDW FDPH LQ FRQWDFW ZLWK 51$ ZHUH DXWRFODYHG ZKHQ DSSURSULDWHf 3ULRU WR DXWRFODYLQJ WKH VROXWLRQV ZHUH SUHWUHDWHG IRU KRXU ZLWK D VROXWLRQ RI b YYf GLHWK\OS\URFDUERQDWH WR LQKLELW 51DVHV 6FUHHQLQJ RI ODPEGD JWOO OLEUDULHV ZLWK F'1$ SUREHV 7KH KXPDQ SODFHQWD F'1$ OLEUDU\ IURP &ORQWHFK VHH DERYHf ZDV VFUHHQHG ZLWK WZR F'1$ SUREHV DQG D ZKLFK FRGH IRU DPLQR DFLGV DQG RI XWHURIHUULQ UHVSHFWLYHO\ 7KH LVRODWLRQ DQG VHTXHQFH DQDO\VLV RI WKHVH VKRUW FORQHV KDYH EHHQ GHVFULEHG HOVHZKHUH 6LPPHQ HW DO f 7KH VHTXHQFHV RI WKHVH F'1$V DQG WKH LQIHUUHG DPLQR DFLG VHTXHQFHV DUH VKRZQ LQ )LJ 7KH VFUHHQLQJ PHWKRG HPSOR\HG ZDV WKDW RI 0DQLDWLV HW DO f $Q DSSURSULDWH QXPEHU RI SKDJH ZHUH SODWHG DV GHVFULEHG DERYH 7KH SODWHV ZHUH LQFXEDWHG RYHUQLJKW DW r& 7KH QH[W GD\ QLWURFHOOXORVH ILOWHUV ZHUH SODFHG RQ WKH SODWH OHIW IRU PLQXWHV WKHQ FDUHIXOO\ UHPRYHG 7KH '1$ ZKLFK KDG ERXQG WR WKH ILOWHUV ZDV GHQDWXUHG LQ VROXWLRQ RI 0 1D2+ DQG 0 1D&O 7KH ILOWHUV ZHUH QHXWUDOL]HG LQ 0 7ULV+&O S+ FRQWDLQLQJ 0 1D&O IROORZHG E\ D ZDVK LQ ,; 66&

PAGE 103

)LJ 7KH QXFOHRWLGH VHTXHQFHV RI WKH F'1$ FORQHV FRGLQJ IRU SRUFLQH XWHURIHUULQ XVHG IRU VFUHHQLQJ WKH KXPDQ SODFHQWD F'1$ OLEUDU\ DQG WKHLU GHGXFHG DPLQR DFLG VHTXHQFHV 1XPEHUV UHIHU WR WKH QXFOHRWLGH SRVLWLRQ LQ WKH F'1$ WRSf RU DPLQR DFLG SRVLWLRQ LQ PDWXUH XWHURIHUULQ ERWWRPf

PAGE 104

8I &ORQH &7* *&* &7* *&& &*& $*$ &$* &7* *&& 7** $7& $$* $$* &$* / $ / $ 5 7 4 / $ : . 4 &7* *&* *&$ *&$ $$* *$* *$& 7$7 *7* &7* *7* *&& **& &$& / $ $ $ ( < 9 / 9 $ + 7$7 &&7 < 3 &ORQH D **& &$& *$& &$& $$& &7* &$* 7$& &77 &$* *$7 *$* $$7 **& + + : / 4 < / 4 ( 1 77* **& 777 *7* &7* $*& *** *&& *** $$& 77& $7* *$& &&& / ) 9 / 6 $ 1 ) 0 3 7&& $$* $$* &$& &7* &*& $$* *7& &&& $$& **& 7$& 6 . + / 5 9 3 1 7

PAGE 105

0 1D&O 0 VRGLXP FLWUDWH S+ f 7KH '1$ ZDV EDNHG RQWR WKH ILOWHUV LQ D YDFXXP RYHQ DW r& IRU KRXUV 7KH ILOWHUV ZHUH ZDVKHG DW r& LQ D VROXWLRQ RI 0 7ULV+&O S+ ZLWK 0 1D&O ,P0 ('7$ DQG b ZYf 6'6 IRU PLQXWHV )ROORZLQJ WKH ZDVKLQJV SUHK\EULGL]DWLRQ ZDV FDUULHG RXW DW r& LQ D VROXWLRQ FRQWDLQLQJ 0 7ULV+&O S+ 0 1D&O O2P0 ('7$ b ZYf 6'6 b ZYf SRO\YLQ\OS\UUROLRQH b ZYf )LFROO W\SH b ZYf %6$ DQG LJPO GHQDWXUHG VKHDUHG VDOPRQ VSHUP '1$ 7KH F'1$ SUREHV ODEHOHG E\ WKH UDQGRP SULPHU H[WHQVLRQ PHWKRG VHH EHORZf ZHUH DOORZHG WR K\EULGL]H WR WKH '1$ RQ WKH ILOWHUV RYHUQLJKW DW r& LQ WKH SUHK\EULGL]DWLRQ EXIIHU )ROORZLQJ K\EULGL]DWLRQ WKH ILOWHUV ZHUH ZDVKHG DW r& ZLWK ,; 66& ZKLFK FRQWDLQHG b ZYf 6'6 $XWRUDGLRJUDSK\ ZDV FDUULHG RXW DW r& ZLWK 'X3RQW &URQH[ /LJKWLQJ 3OXV LQWHQVLI\LQJ VFUHHQV *HQHUDWLRQ RI UDQGRP SULPHU H[WHQVLRQ SUREHV 7KH A3ODEHOHG &'1$ SUREHV XVHG IRU VFUHHQLQJ WKH OLEUDU\ ZHUH JHQHUDWHG E\ WKH UDQGRP SULPHU H[WHQVLRQ PHWKRG )HLQEHUJ DQG 9RJHOVWHLQ f ,VRODWHG F'1$ LQVHUWV QJf SXULILHG DV GHVFULEHG EHORZ ZHUH ERLOHG IRU PLQXWHV WR GHQDWXUH WKH '1$ 7KH '1$ ZDV DOORZHG WR DQQHDO WR LJ RI D UDQGRPO\ JHQHUDWHG ROLJRGHR[\KH[DPHU 7KH F'1$ DQG SULPHU ZHUH UHVXVSHQGHG LQ D EXIIHU FRQWDLQLQJ 0 +HSHV S+ P0 0J&O 0 PHUFDSWRHWKDQRO 0 7ULV+&O S+ DQG LJPO %6$ 7KH GHR[\QXFOHRWLGHV G&73 G773 DQG G*73 ZHUH DGGHG DW D FRQFHQWUDWLRQ RI A0 IROORZHG E\ WKH DGGLWLRQ RI M&L RI >AA3@G$73 &LPPROf 7KH UHDFWLRQ ZDV DOORZHG WR SURFHHG RYHUQLJKW DW URRP WHPSHUDWXUH 7KH IROORZLQJ GD\ WKH UHDFWLRQ PL[WXUH ZDV ORDGHG RQWR D FROXPQ

PAGE 106

[ FPf RI 6HSKDGH[ LQ D EXIIHU FRQWDLQLQJ 0 7ULV+&O S+ DQG 0 1D&O LQ RUGHU WR VHSDUDWH XQLQFRUSRUDWHG QXFOHRWLGH IURP WKH UDGLRODEHOHG SUREH 3UHSDUDWLRQ RI '1$ IURP SRVLWLYH ODPEGD JWOO FORQHV 7KH SODWH O\VDWH PHWKRG RI )ULWVFK ZDV HPSOR\HG 0DQLDWLV HW DO f IRU LVRODWLRQ RI SKDJH '1$ $SSUR[LPDWHO\ r SODTXH IRUPLQJ XQLWV RI D SODTXH SXUH SRVLWLYH SKDJH ZHUH SODWHG ZLWK ( FROL VWUDLQ < DQG b ZYf WRS DJDURVH RQ HDFK PP 3HWUL GLVK FRQWDLQLQJ 1=<&0 >b ZYf 1=DPLQH b ZYf FDVDPLQR DFLGV b ZYf \HDVW H[WUDFW b ZYf1D&O b 0J&O S+ @ ZLWK b ZYf DJDURVH 7KH SODWHV ZHUH LQFXEDWHG DW r& RYHUQLJKW /\VLV RI JUHDWHU WKDQ b RI WKH EDFWHULD ZDV HYLGHQW WKH QH[W GD\ 7KH SODWHV ZHUH LQFXEDWHG DW URRP WHPSHUDWXUH IRU KRXUV ZLWK PO 60 LQ RUGHU WR HOXWH WKH SKDJH IURP WKH DJDURVH 7KH 60 EXIIHU ZDV UHPRYHG DQG WKH VROXWLRQ FHQWULIXJHG DW [J IRU PLQXWHV WR UHPRYH GHEULV 7KH VXSHUQDWDQW IUDFWLRQ FRQWDLQLQJ YLDEOH SKDJH LQ SURWHLQ FRDWV ZDV LQFXEDWHG ZLWK LJPO '1DVH DQG LJPO 51DVH $ DW r& IRU KRXU $Q HTXDO YROXPH RI D VROXWLRQ RI b ZYf SRO\HWK\OHQH JO\FRO DQG 0 1D&O ZDV DGGHG WR WKH VDPSOH DQG OHIW RQ LFH IRU KRXU 3UHFLSLWDWHG SKDJH ZHUH FROOHFWHG E\ FHQWULIXJDWLRQ DW [J IRU PLQXWHV DW r& 7KH SKDJH SHOOHW ZDV UHVXVSHQGHG LQ 0 7ULV+&O S+ DQG ,P0 ('7$ 7(f DQG 6'6 DGGHG WR b ZYf DQG ('7$ WR O2P0 7KH VDPSOH ZDV LQFXEDWHG DW r& IRU PLQXWHV WKHQ SKHQROFKORURIRUP H[WUDFWHG GHVFULEHG DERYHf 7KH SKDJH '1$ ZDV SUHFLSLWDWHG ZLWK LVRSURSDQRO GHVFULEHG DERYHf 7KH '1$ ZDV UHVXVSHQGHG LQ 7( DQG VWRUHG DW r& RU

PAGE 107

r& 7KH F'1$ LQVHUWV ZHUH H[FLVHG IURP ODPEGD JWOO E\ GLJHVWLRQ ZLWK (FR5 LQ D EXIIHU RI 0 7ULV+&O S+ 0 0J&O DQG 0 1D&O $IWHU HOHFWURSKRUHVLV RQ D b ZYf DJDURVH JHO WKH F'1$ LQVHUWV ZHUH HOHFWURHOXWHG IURP WKH JHO 6XEFORQLQJ RI F'1$ LQVHUWV LQWR S8& 7KH SURFHGXUH HPSOR\HG ZDV WKDW RI +DQDKDQ f $ IROG PRODU H[FHVV RI F'1$ ZDV DGGHG WR O22QJ RI S8& ZKLFK KDG EHHQ SUHYLRXVO\ GLJHVWHG ZLWK (FR5 7KH F'1$ ZHUH LQVHUWHG LQWR WKH (FR5 VLWH DQG OLJDWHG IRU KRXUV DW URRP WHPSHUDWXUH LQ D EXIIHU FRQWDLQLQJ 0 7ULV+&O S+ 0 0J&O 0 GLWKLRWKUHLWRO ,P0 $73 OPJPO %6$ DQG XQLW RI 7 '1$ OLJDVH 2QH PLFUROLWHU RI WKH OLJDWLRQ PL[WXUH ZDV LQFXEDWHG ZLWK LO FRPSHWHQW (FROL -0 VHH EHORZf $IWHU D PLQXWH LQFXEDWLRQ RQ LFH DQG D VXEVHTXHQW PLQXWH LQFXEDWLRQ DW r& WKH VDPSOHV ZHUH VSUHDG RQ D SODWH RI <7 >b ZYf WU\SWRQH b ZYf \HDVW H[WUDFW b ZYf 1D&O@ FRQWDLQLQJ b ZYf DJDURVH ZLWK LJPO DPSLFLOOLQ b ZYf ,37* DQG b ZYf EURPRFKORURLQGRO\O "' JDODFWRS\UDQRVLGH [JDOf 7KH SODWHV ZHUH LQFXEDWHG RYHUQLJKW DW r& 2QO\ EDFWHULD ZKLFK FRQWDLQHG SODVPLG JUHZ RQ WKH SODWHV EHFDXVH DPSLFLOOLQ ZDV LQFOXGHG DQG FRORQLHV ZLWK F'1$ LQVHUWV ZHUH ZKLWH WKRVH ZLWKRXW LQVHUWV EOXH &RPSHWHQW FHOOV IRU WUDQVIRUPDWLRQ ZHUH SUHSDUHG DV IROORZV $ ORJ SKDVH FXOWXUH RI ( FROL VWUDLQ -0 ZDV FHQWULIXJHG DW [J IRU PLQXWHV 7KH EDFWHULD ZHUH UHVXVSHQGHG LQ YROXPH RI LFH FROG 0 &D&O DQG LQFXEDWHG RQ LFH IRU PLQXWHV 7KH FHOOV ZHUH FHQWULIXJHG DV EHIRUH DQG UHVXVSHQGHG LQ YROXPH RI LFH FROG 0 &D&O 7KH FHOOV ZHUH DJHG DW OHDVW RQH KRXU EHIRUH EHLQJ XVHG IRU WUDQVIRUPDWLRQV

PAGE 108

,VRODWLRQ RI S8& UHFRPELQDQW SODVPLGV 7KH PHWKRG RI ,VK +RURZLF] DQG %XUNH f ZDV HPSOR\HG IRU LVRODWLQJ SODVPLG RI LQWHUHVW IURP PO PO DQG / FXOWXUHV RI (FROL -0 FRQWDLQLQJ WKDW SODVPLG 7KH EDFWHULD ZHUH SHOOHWHG DW [J IRU PLQXWHV 7KH EDFWHULD ZHUH UHVXVSHQGHG LQ D VROXWLRQ RI 0 JOXFRVH 0 7ULV+&O S+ DQG 0 ('7$ $IWHU D PLQXWH LQFXEDWLRQ DW URRP WHPSHUDWXUH D VROXWLRQ RI 0 1D2+ DQG b ZYf 6'6 ZDV DGGHG WR WKH EDFWHULD 7KH VDPSOHV ZHUH DOORZHG WR VLW RQ LFH IRU PLQXWHV $ VROXWLRQ RI 0 SRWDVVLXP DFHWDWH S+ ZDV DGGHG DQG WKH VDPSOHV FHQWULIXJHG DW [J IRU PLQXWHV 7KH VXSHUQDWDQW IUDFWLRQ ZKLFK FRQWDLQHG WKH SODVPLG ZDV WUHDWHG ZLWK OJPO 51DVH $ IRU KRXU DW r& 7KH VDPSOHV ZHUH H[WUDFWHG ZLWK SKHQROFKORURIRUP DQG WKH '1$ HWKDQRO SUHFLSLWDWHG 6RXWKHUQ EORWV RI '1$ 6DPSOHV RI '1$ ZHUH VXEMHFWHG WR HOHFWURSKRUHVLV RQ b ZYf DJDURVH JHOV DV GHVFULEHG DERYH 7KH JHO ZDV WUHDWHG ZLWK 0 +& IROORZHG E\ 0 1D2+ WKHQ HTXLOLEUDWHG LQ 0 7ULV%RUDWH EXIIHU S+ ZLWK ,P0 ('7$ 7%(f 7KH '1$ ZDV WUDQVIHUUHG WR *HQH 6FUHHQ PHPEUDQH E\ WKH PHWKRG RI 6RXWKHUQ f $IWHU D KRXU WUDQVIHU WKH '1$ ZDV FURVVOLQNHG WR WKH PHPEUDQH ZLWK 89 OLJKW &KXUFK DQG *LOEHUW f *HQHUDWLRQ RI ROLJRQXFOHRWLGH SUREHV 7ZR UHGXQGDQW ROLJRQXFOHRWLGHV ZKLFK FRGH IRU DPLQR DFLGV DQG RI SRUFLQH XWHURIHUULQ ZHUH V\QWKHVL]HG VHH )LJ f $SSUR[LPDWHO\ O22SPRO RI ROLJRQXFOHRWLGH ZHUH VXVSHQGHG LQ D EXIIHU RI 0 7ULV+&O S+ 0 0J&O P0 GLWKLRWKUHLWRO ,P0 VSHUPLGLQH DQG P0 ('7$ 7HQ XQLWV RI 7 SRO\QXFOHRWLGH NLQDVH DQG SPRO >fnAA3@$73 P&L

PAGE 109

)LJ 7KH VHTXHQFHV RI WKH UHGXQGDQW ROLJRQXFOHRWLGHV XVHG IRU 6RXWKHUQ EORW DQDO\VLV DQG WKHLU GHGXFHG DPLQR DFLG VHTXHQFHV 2OLJRQXFOHRWLGHV FRGLQJ IRU DPLQR DFLGV RI SRUFLQH XWHURIHUULQ DQG WKH EHHI VSOHHQ HQ]\PH .0f DQG DPLQR DFLGV RI WKH VDPH SURWHLQV .0f ZHUH V\QWKHVL]HG DW WKH 8QLYHUVLW\ RI 0LVVRXUL '1$ V\QWKHVLV IDFLOLW\ DQG SXULILHG E\ HWKDQRO SUHFLSLWDWLRQ 3UREH .0 LV IROG UHGXQGDQW ZLWK DQ DYHUDJH *& FRQWHQW RI b DQG D SUHGLFWHG 7P RI r& SUREH .0 LV IROG UHGXQGDQW ZLWK DQ DYHUDJH *& FRQWHQW RI b DQG D SUHGLFWHG 7P RI r& 7KH VHTXHQFH RI KXPDQ ILEURQHFWLQ ZDV REWDLQHG IURP .RUQEOLKWW HW DO f

PAGE 110

8WHURIHUULQ 3UREH .0 $OD9DO*O\$VS7US*O\ 7 *&1 *71 **1 *$& 7** ** 8WHURIHUULQ *O\$VQ3KH0HW$VS3UR 3UREH .0 7 **1 $ $ & 7 7 7 & $ 7 * $ 3UREH .0 7 *&1*71**1*$& *&&*88**$*$8 7** $O )LEURQHFWLQ f Q K

PAGE 111

&LPPROf ZHUH DGGHG DQG WKH UHDFWLRQ DOORZHG WR SURFHHG DW r& IRU KRXU 8QLQFRUSRUDWHG $73 ZDV UHPRYHG E\ HWKDQRO SUHFLSLWDWLRQ 3UREH .0 KDG D 7P RI r& DQG SUREH .0 KDG D 7P RI r& +\EULGL]DWLRQ ZDV FDUULHG RXW DW 7Pr& 7KH UDGLRODEHOHG ROLJRQXFOHRWLGHV ZHUH HPSOR\HG DV SUREHV IRU 6RXWKHUQ EORWV RI FORQH +3 7KH 6RXWKHUQ EORWV ZHUH SUHK\EULGL]HG DQG K\EULGL]HG LQ VRGLXP SKRVSKDWH EXIIHU S+ FRQWDLQLQJ b ZYf 6'6 ,P0 ('7$ DQG b ZYf %6$ DW WKH DSSURSULDWH WHPSHUDWXUHV 7KH EORWV ZHUH ZDVKHG LQ 0 VRGLXP SKRVSKDWH EXIIHU S+ ZLWK b ZYf 6'6 DQG ,P0 ('7$ DW WKH DSSURSULDWH WHPSHUDWXUHV 7Pr&f &ORQLQJ RI F'1$ LQVHUWV LQWR 0 &RPSHWHQW ( FROL VWUDLQ 7* ZDV SUHSDUHG DV GHVFULEHG HDUOLHU IRU -0 7KH F'1$ LQVHUWV IURP SRVLWLYH FORQHV ZHUH FORQHG LQWR WKH (FR5 VLWH RI 0OPSO 0HVVLQJ 0HVVLQJ HW DO f DV GHVFULEHG HDUOLHU IRU S8& 5HVWULFWLRQ IUDJPHQWV RI WKH F'1$ LQVHUWV ZHUH SUHSDUHG DV IROORZV 7KH F'1$ LQVHUWV ZHUH GLJHVWHG ZLWK $OX 0VS RU 5VD LQ D EXIIHU FRQWDLQLQJ 0 7ULV +&O S+ DQG 0 0J&O ZLWK XQLWV RI HQ]\PHPJ '1$ ZKHQ UHVWULFWHG ZLWK +DH ,,, WKH EXIIHU XVHG ZDV 0 7ULV+&O S+ 0 0J&O DQG 0 1D&O ,Q VRPH FDVHV WKH HQWLUH DVVRUWPHQW RI UHVWULFWLRQ IUDJPHQWV IURP HDFK LQGLYLGXDO GLJHVW ZDV FORQHG LQWR WKH 6PD VLWH RI 0PSO D SURFHGXUH NQRZQ DV VKRWJXQ FORQLQJ ,Q RWKHU FDVHV WKH UHVWULFWLRQ IUDJPHQWV ZHUH VHSDUDWHG RQ D b ZYf SRO\DFU\ODPLGH JHO 0DQLDWLV HW DO f DQG WKH UHVWULFWLRQ IUDJPHQWV ES RU ODUJHU FXW RXW RI WKH JHO DQG HOHFWURHOXWHG (DFK IUDJPHQW ZDV WKHQ FORQHG LQWR WKH 6PD VLWH RI 0OPSO LQGLYLGXDOO\

PAGE 112

2QH PLFUROLWHU RI WKH OLJDWLRQ PL[ ZDV LQFXEDWHG ZLWK FRPSHWHQW (FROL 7* DV GHVFULEHG HDUOLHU IRU FORQLQJ LQWR S8& 7KH EDFWHULD DQG SKDJH ZHUH DGGHG WR D PL[WXUH <7 ZLWK b ZYf DJDURVH DW r& FRQWDLQLQJ bZYf [JDO b ZYf ,37* DQG LO ORJ SKDVH ( FROL 7* 7KH PL[WXUH ZDV SRXUHG RQWR D PP 3HWUL GLVK FRQWDLQLQJ <7 ZLWK b ZYf DJDU 3ODWHV ZHUH LQFXEDWHG DW r& RYHUQLJKW 7KH ZKLWH SODTXHV PDGH E\ SKDJH ZKLFK FRQWDLQHG LQVHUWHG F'1$V ZHUH UHPRYHG DV DQ DJDU SOXJ SODFHG LQWR D WXEH POf RI <7 DQG LO ORJ SKDVH ( FROL 7* DQG DOORZHG WR JURZ RYHUQLJKW DW r& 7KH FXOWXUHV ZHUH FHQWULIXJHG DW [J IRU PLQXWHV 7KH EDFWHULDO SHOOHWV ZHUH GLVFDUGHG DQG WKH SKDJH SDUWLFOHV LQ WKH VXSHUQDWDQW IUDFWLRQ ZKLFK FRQWDLQHG VLQJOH VWUDQGHG '1$ ZHUH SUHFLSLWDWHG E\ DGGLWLRQ RI YROXPH RI b ZYf SRO\HWK\OHQH JO\FRO DQG 0 1D&O $IWHU DQ LQFXEDWLRQ RI KRXU RQ LFH WKH SKDJH ZHUH FROOHFWHG E\ FHQWULIXJDWLRQ DW [J IRU PLQXWHV DW r& 7KH SKDJH ZHUH UHVXVSHQGHG LQ D VROXWLRQ RI 7( FRQWDLQLQJ b ZYf 6'6 DQG WKH VDPSOHV ZHUH H[WUDFWHG ZLWK SKHQROFKORURIRUP 7KH VLQJOH VWUDQGHG '1$ ZDV WKHQ HWKDQRO SUHFLSLWDWHG '1$ VHTXHQFLQJ '1$ ZDV VHTXHQFHG DFFRUGLQJ WR WKH PHWKRG RI 6DQJHU HW DO f DV RXWOLQHG LQ WKH 1HZ (QJODQG %LR/DEV WHFKQLFDO EXOOHWLQ 7KH PHU XQLYHUVDO SULPHU QJf ZDV DOORZHG WR DQQHDO ZLWK SXULILHG VLQJOHVWUDQGHG 0 '1$ LJf DW r& LQ D VHTXHQFLQJ EXIIHU FRQWDLQLQJ 0 7ULV+&O S+ P0 0J&O DQG P0 GLWKLRWKUHLWRO 0HDQZKLOH WKH HQ]\PH PL[ ZDV SUHSDUHG FRQWDLQLQJ 8 ODUJH IUDJPHQW RI ( FROL '1$ SRO\PHUDVH DQG L&L &LPPROf >D@G$73 LQ WKH VHTXHQFLQJ EXIIHU GHVFULEHG DERYH 7KH HQ]\PH PL[ ZDV WKHQ DGGHG WR HDFK RI WKH

PAGE 113

WXEHV FRQWDLQLQJ 0 '1$ DQG WKH DQQHDOHG SULPHU )RU HDFK FORQH WKLV PL[WXUH RI SKDJH SULPHU DQG HQ]\PH PL[ ZDV HYHQO\ GLYLGHG LQWR IRXU WXEHV ODEHOHG $ 7 DQG & 7R WKH WXEHV IRU HDFK FORQH WKH VHTXHQFLQJ PL[ ZDV DGGHG WR WKH $ WXEHV $ VHTXHQFLQJ PL[ DQG VR RQ 7KH FRPSRVLWLRQV RI WKH VHTXHQFLQJ PL[HV DUH DV IROORZV WP GLGHR[\ *73 GG*73f WP G$73 L0 G&73 L0 G*73 DQG W0 G773 $ MP GG$73 LP G$73 L0 G&73 L0 G*73 DQG L0 G773 7f L0 GG773 L0 G$73 L0 G&73 L0 G*73 DQG L0 G773 & L0 GG&73 L0 G$73 L0 G&73 L0 G*73 DQG L0 G773 HDFK VHTXHQFLQJ PL[ ZDV LQ WKH VHTXHQFLQJ EXIIHU GHVFULEHG DERYH 7KH SULPHUWHPSODWH PL[WXUH SOXV HQ]\PH PL[ DQG VHTXHQFLQJ PL[HV ZHUH DOORZHG WR UHPDLQ DW URRP WHPSHUDWXUH IRU PLQXWHV $ FKDVH VROXWLRQ FRQWDLQLQJ P0 GHR[\QXFOHRWLGHV ZDV DGGHG WR WKH VHTXHQFLQJ UHDFWLRQV DQG WKH VDPSOHV UHPDLQHG DW URRP WHPSHUDWXUH IRU PLQXWHV 7KH UHDFWLRQV ZHUH WHUPLQDWHG E\ WKH DGGLWLRQ RI D VROXWLRQ RI GHLRQL]HG IRUPDPLGH FRQWDLQLQJ b ZYf [\OHQH F\DQRO )) b ZYf EURPSKHQRO EOXH DQG b ZYf ('7$ S+ 7KH VHTXHQFLQJ UHDFWLRQV ZHUH VXEMHFWHG WR HOHFWURSKRUHVLV RQ WKLQ JHOV FPf [ FP FRQVLVWLQJ RI b ZYf SRO\DFU\ODPLGH 0 XUHD DQG 0 7%( 7KH JHOV ZHUH GULHG LPPHGLDWHO\ DIWHU HOHFWURSKRUHVLV DQG H[SRVHG WR .RGDN ;$5 ILOP DW URRP WHPSHUDWXUH 7KH VHTXHQFH ZDV DQDO\]HG ZLWK WKH DLG RI WKH %HFNPDQ 0LFUR*HQLH SURJUDP +HSDULQ$JDURVH DIILQLW\ FKURPDWRJUDSK\ +HSDULQ$JDURVH LJ KHSDULQPO JHO PJf ZDV HTXLOLEUDWHG LQ D EXIIHU RI 0 7ULV +& S+ ZLWK 0 1D&O $ EHG YROXPH RI DSSUR[LPDWHO\ PO ZDV XVHG $SSUR[LPDWHO\ PJ RI XWHURIHUULQ LQ WKH VDPH EXIIHU ZDV DSSOLHG WR WKH

PAGE 114

FROXPQ 7KH FROXPQ ZDV ZDVKHG ZLWK FROXPQ YROXPHV RI WKH VDPH EXIIHU DQG WKH XWHURIHUULQ HOXWHG VWHSZLVH ZLWK DQG 0 1D&O LQ 0 7ULV +& S+ 7LVVXH FXOWXUH WHFKQLTXHV 7KH FHOO OLQHV HPSOR\HG ZHUH DV IROORZV 7KH KXPDQ HU\WKUROHXNHPLD FHOO OLQH /R]]LR DQG /R]]LR f WKH KXPDQ 7FHOO OLQH -85.$7 DOVR NQRZQ DV -0 VHH 1DJDVDZD HW DO f DQG WKH (SVWHLQ%DUU YLUXV (%9fWUDQVIRUPHG %FHOO OLQH =5 6PLWK HW DO f 7KH FHOOV ZHUH PDLQWDLQHG LQ 530, PHGLXP ZLWK +HSHV EXIIHU VXSSOHPHQWHG ZLWK b YYf KHDW LQDFWLYDWHG IHWDO ERYLQH VHULDQ P0 JOXWDPLQH DQG DQWLELRWLF VROXWLRQ [JPO SHQLFLOOLQ SJPO VWUHSWRP\FLQ JPO DPSKRWHULFLQ %f 7KH FHOOV DQG -85.$7 FHOOV ZHUH PDLQWDLQHG DW r& LQ D b &2 DWPRVSKHUH WKH =5 FHOOV DW r& LQ D b &2 DWPRVSKHUH &HOOV ZHUH PDLQWDLQHG DW D GHQVLW\ RI [ A [ A FHOOVPO 2QO\ FHOOV WKDW ZHUH DW OHDVW b YLDEOH DV GHWHUPLQHG E\ 7U\SDQ EOXH H[FOXVLRQ ZHUH XVHG IRU H[SHULPHQWV H[FHSW ZKHUH VWDWHG LQ WKH WH[W 7KH QRUPDO KXPDQ OHXNRF\WHV DQG OHXNHPLF KDLU\ FHOOV WKH JHQHURXV JLIW RI 0$ *URVV DQG 5 :HLQHUf ZHUH SUHSDUHG IRU FU\RSUHVHUYDWLRQ DIWHU FROOHFWLRQ :HLQHU HW DO f DQG WKDZHG LPPHGLDWHO\ EHIRUH XVH $ VROXWLRQ RI WHWUDGHFDQR\OSKRUERO DFHWDWH 73$f ZDV SUHSDUHG DV D P0 VWRFN LQ GLPHWK\O VXOIR[LGH DQG VWRUHG IUR]HQ )RU HDFK H[SHULPHQW D IUHVK VWRFN RI nA0 ZDV SUHSDUHG LQ WKH JURZWK PHGLXP GHVFULEHG DERYH 2 +HPLQ [ nVWRFNf ZDV SUHSDUHG DFFRUGLQJ WR WKH PHWKRG RI 5XWKHUIRUG DQG :HDWKHUDOO f 7KLUWHHQ PLOOLJUDPV RI KHPLQ ZHUH GLVVROYHG LQ LO RI 0 1D2+ WKHQ QHXWUDOL]HG ZLWK SO 0

PAGE 115

7ULV+&O S+ DQG EURXJKW XS WR PO ZLWK GHLRQL]HG GLVWLOOHG ZDWHU 7KH VWRFN ZDV PDGH IUHVK DQG XVHG LPPHGLDWHO\ ,VRODWLRQ RI 51$ IURP WLVVXH FXOWXUH FHOOV 51$ ZDV LVRODWHG DFFRUGLQJ WR WKH PHWKRG RI &KRPF]\QVNL DQG 6DFFKL f 7LVVXH FXOWXUH FHOOV ZHUH FHQWULIXJHG DW [J IRU PLQXWHV DW URRP WHPSHUDWXUH )RU HDFK A FHOOV LQ WKH FHOO SHOOHW A RI *7& VROXWLRQ ZDV DGGHG 0 JXDQLGLQLXP WKLRF\DQDWH 0 VRGLXP FLWUDWH S+ b ZYf VDUFRV\O 0 PHUFDSWRHWKDQROf 7KH VDPSOH ZDV YRUWH[HG LPPHGLDWHO\ DQG WKH FHOOV EURNHQ LQ D GRXQFH KRPRJHQL]HU $Q HTXDO YROXPH RI ZDWHUVDWXUDWHG SKHQRO ZDV DGGHG IROORZHG E\ DQ DGGLWLRQ RI YROXPH 0 VRGLXP DFHWDWH S+ DQG YROXPHV RI FKORURIRUP LVRDP\O DOFRKRO 7KH VDPSOHV ZHUH VKDNHQ YLJRURXVO\ DQG SODFHG RQ LFH IRU PLQXWHV 7KH VDPSOHV ZHUH FHQWULIXJHG DW [J IRU PLQXWHV 51$ UHPDLQHG LQ WKH DTXHRXV SKDVH '1$ ZDV DW WKH LQWHUIDFH EHWZHHQ WKH WZR SKDVHV DQG PRVW RWKHU FHOOXODU FRPSRQHQWV ZHUH LQ WKH RUJDQLF SKDVH 7KH DTXHRXV SKDVH ZDV FDUHIXOO\ FROOHFWHG DQG WKH 51$ SUHFLSLWDWHG ZLWK LVRSURSDQRO 7KH 51$ SHOOHW ZDV UHVXVSHQGHG LQ *7& DQG SUHFLSLWDWHG ZLWK LVRSURSDQRO D VHFRQG WLPH 7KH 51$ ZDV WKHQ SUHFLSLWDWHG ZLWK HWKDQRO DQG WKH SHOOHW UHVXVSHQGHG LQ 51DVHIUHH ZDWHU (OHFWURSKRUHVLV RI 51$ 51$ VDPSOHV ZHUH VXEMHFWHG WR HOHFWURSKRUHVLV LQ D JHO FRQVLVWLQJ RI b ZYf DJDURVH 0 PRUSKROLURSURSDQHVXOIRQLF DFLG 0236f S+ 0 VRGLXP DFHWDWH 0 IRUPDOGHK\GH DQG ,P0 ('7$ /HKUDFK HW DO f 51$ VDPSOHV ZHUH GLVVROYHG LQ WKH DERYH EXIIHU FRQWDLQLQJ b YYf IRUPDPLGH b ZYf

PAGE 116

EURPSKHQRO EOXH DQG b ZYf [\OHQH F\DQRO )) 51$ ZDV GHWHFWHG E\ VWDLQLQJ ZLWK AJPO RI HWKLGLXP EURPLGH IRU PLQXWHV 1RUWKHUQ EORWWLQJ 1RUWKHUQ EORWWLQJ RI IRUPDOGHK\GHDJDURVH JHOV ZDV FDUULHG RXW DFFRUGLQJ WR 0DQLDWLV HW DO f 7KH JHO ZDV VRDNHG LQ P0 1D2+ 0 1D&O IROORZHG E\ QHXWUDOL]DWLRQ LQ 0 7ULV+&O S+ 7UDQVIHU RI WKH 51$ WR *HQH6FUHHQ ZDV DOORZHG WR SURFHHG E\ FDSLOODU\ DFWLRQ RYHUQLJKW LQ ; 66& $IWHU D EULHI ZDVK LQ 0 7%( WKH EORW ZDV 89LUUDGLDWHG LQ RUGHU WR FURVVOLQN WKH 51$ WR WKH PHPEUDQH &KXUFK DQG *LOEHUW f 3UHSDUDWLRQ RI D VLQJOHVWUDQGHG SUREH IRU 1RUWKHUQ DQDO\VLV $ >3@ODEHOHG VLQJOHVWUDQGHG SUREH ZKLFK K\EULGL]HV WR P51$ FRGLQJ IRU WKH KXPDQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH ZDV SUHSDUHG LQ WKH IROORZLQJ PDQQHU &KXUFK DQG *LOEHUW f $SSUR[LPDWHO\ LJ RI VLQJOH VWUDQGHG 0 '1$ FRQWDLQLQJ WKH FRGLQJ VWUDQG RI WKH FORQH FRGLQJ IRU WKH KXPDQ SKRVSKDWDVH ZHUH DOORZHG WR DQQHDO ZLWK QJ RI 0 VHTXHQFLQJ SULPHU DW r& LQ D EXIIHU FRQWDLQLQJ 0 7ULV+&O S+ DQG 0 1D&O $IWHU PLQXWHV WKH GHR[\QXFOHRWLGHV G&73 G*73 DQG G773 ZHUH DGGHG WR D FRQFHQWUDWLRQ RI P0 LQ D VROXWLRQ FRQWDLQLQJ P0 0J&O 0 PHUFDSWRHWKDQRO PJPO %6$ DQG [&L &LPPROf >RF3@G$73 $IWHU PLQXWHV DW URRP WHPSHUDWXUH WKH UHDFWLRQ ZDV WHUPLQDWHG E\ WKH DGGLWLRQ RI D VROXWLRQ RI b YYf IRUPDPLGH b ZYf [\OHQH F\DQRO )) b ZYf EURPRSKHQRO EOXH DQG b ZYf ('7$ 7KH VDPSOH ZDV VXEMHFWHG WR HOHFWURSKRUHVLV LQ D b ZYf SRO\DFU\ODPLGH JHO ZLWK 0 XUHD LQ 0 7%( LQ RUGHU WR VHSDUDWH WKH UDGLRODEHOHG SUREH IRU WKH 0 WHPSODWH 7KH JHO ZDV SODFHG LQ FRQWDFW ZLWK 3RODURLG 7\SH ILOP LQ RUGHU WR GHWHUPLQH KRZ IDU WKH

PAGE 117

UDGLRODEHOHG SUREH KDG PLJUDWHG 7KH UDGLRDFWLYH EDQG ZDV FXW IURP WKH JHO FUXVKHG ZLWK D JODVV URG DQG WKHQ PL[HG ZLWK K\EULGL]DWLRQ VROXWLRQ RI 0 VRGLXP SKRVSKDWH EXIIHU S+ b ZYf 6'6 ,P0 ('7$ DQG b ZYf %6$ 7KH SUREH ZDV VKDNHQ DW r& IRU KRXUV +\EULGL]DWLRQ ZDV WKHQ FDUULHG RXW IRU KRXUV DW r& 7KH EORWV ZHUH ZDVKHG ZLWK OLWHU [ POf RI D ZDVK EXIIHU FRQVLVWLQJ RI 0 VRGLXP SKRVSKDWH EXIIHU S+ ZLWK ,P0 ('7$ DQG b ZYf 6'6 DW r& $XWRUDGLRJUDSK\ ZDV SHUIRUPHG DW r& ZLWK .RGDN ;$5 ILOP DQG 'X3RQW &URQH[ /LJKWQLQJ 3OXV LQWHQVLI\LQJ VFUHHQV 7KH IODFWLQ SUREH IRU 1RUWKHUQ EORWWLQJ $ KXPDQ DFWLQ F'1$ *XQQLQJ HW DO 3RQWH HW DO f LQ WKH 2ND\DPD%HUJ H[SUHVVLRQ YHFWRU 2ND\DPD DQG %HUJ f ZDV XVHG DV DQ LQWHUQDO FRQWURO LQ 1RUWKHUQ DQDO\VLV 7KH F'1$ LQVHUW ZDV LVRODWHG DV D %DP+ UHVWULFWLRQ IUDJPHQW 7KH DFWLQ F'1$ ZDV UDGLRODEHOHG E\ WKH UDQGRP SULPHU H[WHQVLRQ PHWKRG GHVFULEHG SUHYLRXVO\ +\EULGL]DWLRQ DQG ZDVKLQJ FRQGLWLRQV ZHUH DV GHVFULEHG IRU WKH WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH SUREH 3UHSDUDWLRQ RI FHOO O\VDWHV &HOOV LQ FXOWXUH ZHUH FHQWULIXJHG DW [J IRU PLQXWHV DW URRP WHPSHUDWXUH 7KH FXOWXUH PHGLXP ZDV IUR]HQ DW r& 7KH FHOOV ZHUH O\VHG LQ WKH O\VLV EXIIHU GHVFULEHG LQ &KDSWHU f ZKLFK KDG EHHQ XVHG IRU LVRODWLRQ RI WKH DFLG SKRVSKDWDVH IURP KXPDQ VSOHHQ 7KH FHOOV ZHUH EURNHQ LQ D GRXQFH KRPRJHQL]HU WKHQ FHQWULIXJHG DW [J IRU PLQXWHV 7KH SHOOHW ZDV GLVFDUGHG DQG WKH VXSHUQDWDQW IUDFWLRQ IUR]HQ LPPHGLDWHO\ DW r& 0HDVXUHPHQW RI DFLG SKRVSKDWDVH DFWLYLW\ $FLG SKRVSKDWDVH DFWLYLW\ LQ ERWK WKH FHOO O\VDWHV DQG WKH FXOWXUH PHGLXP ZDV GHWHUPLQHG LQ WKH

PAGE 118

SUHVHQFH RI 0 WDUWUDWH DQG 0 PHUFDSWRHWKDQRO DW S+ ZLWK WKH VXEVWUDWH SQLWURSKHQ\OSKRVSKDWH DV GHVFULEHG LQ &KDSWHU 5HVXOWV 7KH ,GHQWLW\ RI WKH 3RVLWLYH &ORQHV 2EWDLQHG E\ ,PPXQRVFUHHQLQJ WKH +XPDQ 3ODFHQWD /LEUDU\ :KHQ SRO\FORQDO DQWLVHUD UDLVHG DJDLQVW SRUFLQH XWHURIHUULQ ZHUH XVHG WR LPPXQRVFUHHQ [ A SODTXHV RI WKH KXPDQ SODFHQWD F'1$ OLEUDU\ LQ ODPEGD JWOO SRVLWLYH FORQHV ZHUH REWDLQHG (DFK RI WKHVH FORQHV SURGXFHG D IXVLRQ SURWHLQ UHFRJQL]HG E\ WKUHH LQGHSHQGHQW ORWV RI UDEELW DQWLVHUD )LOWHUV IURP WKH LPPXQRVFUHHQLQJ DUH VKRZQ LQ )LJ 2I WKH WZHOYH SRVLWLYH FORQHV WKUHH FRXOG EH GHVFULEHG DV JHQHUDWLQJ YHU\ VWURQJ LPPXQRUHDFWLYH IXVLRQ SURWHLQV VHYHQ JHQHUDWHG PRGHUDWH UHDFWLRQV RQH JDYH D ZHDN UHDFWLRQ DQG RQH DSSHDUHG WR EH D IDOVH SRVLWLYH EXW ZDV LVRODWHG QHYHUWKHOHVV (DFK RI WKHVH ODPEGD JWOO FORQHV H[FHSW WKH VXVSHFWHG IDOVH SRVLWLYH FORQH +3 f FRQWLQXHG WR JLYH ULVH WR LPPXQRUHDFWLYH IXVLRQ SURWHLQV WKURXJKRXW WKH FRXUVH RI SODTXH SXULILFDWLRQ 7KH WKUHH YHU\ VWURQJ SRVLWLYH FORQHV +3 +3 DQG +3 ZHUH FKRVHQ IRU IXUWKHU DQDO\VLV 7KH ODPEGD JWOO '1$ ZDV SXULILHG IURP WKHVH FORQHV DQG WUHDWHG ZLWK (FR5 DQG WKH VL]HV RI WKH F'1$ LQVHUWV ZHUH GHWHUPLQHG )LJ $f &ORQH +3 ZDV DSSUR[LPDWHO\ EDVH SDLUV ESf FORQH +3 ES DQG +3 ES :KHQ WKH LQVHUW +3 ZDV UDGLRODEHOHG E\ WKH UDQGRP SULPHU H[WHQVLRQ PHWKRG LW K\EULGL]HG WR ERWK +3 DQG +3 )LJ %f DV GHWHUPLQHG E\ 6RXWKHUQ EORW DQDO\VLV FDUULHG RXW DW YHU\ KLJK VWULQJHQF\ 7KLV VDPH SUREH K\EULGL]HG WR '1$ IURP SODTXHV SURGXFHG E\ RI WKH UHPDLQLQJ SRVLWLYH FORQHV GDWD QRW VKRZQf 2QO\ FORQH +3 WKH VXVSHFWHG

PAGE 119

)LJ 1LWURFHOOXORVH ILOWHUV FRQWDLQLQJ LPPXQRUHDFWLYH IXVLRQ SURWHLQV SURGXFHG E\ UHFRPELQDQW ODPEGD JWOO SKDJH IURP D KXPDQ SODFHQWD F'1$ OLEUDU\ ZKLFK ZDV VFUHHQHG ZLWK DQWLXWHURIHUULQ DQWLERGLHV (DFK ILOWHU FRQWDLQV IXVLRQ SURWHLQV IURP DSSUR[LPDWHO\ UHFRPELQDQW SKDJH ZKLFK KDG EHHQ HQULFKHG IRU SRVLWLYH FORQHV E\ RQH URXQG RI SODTXH SXULILFDWLRQ 7KH ILOWHUV ZHUH LQFXEDWHG ZLWK UDEELW DQWLERGLHV DJDLQVW SRUFLQH XWHURIHUULQ IROORZHG E\ JRDWDQWLUDEELW FRQMXJDWHG WR KRUVHUDGLVK SHUR[LGDVH ,PPXQRUHDFWLYH IXVLRQ SURWHLQV ZHUH YLVXDOL]HG E\ LQFXEDWLRQ ZLWK VXEVWUDWH >b ZYf +2@ DQG FRXSOLQJ G\H FKORUROQDSKWKRO PJPOf $ FORQH +3 % FORQH +3 VFUHHQHG ZLWK DQWLVHUD IURP D GLIIHUHQW UDEELW & FORQH +3 FORQH +3 7KH ILOWHUV LQ SDQHOV & DQG ZHUH WHVWHG ZLWK WKH VDPH DQWLVHUD XVHG IRU WKH ILOWHU LQ SDQHO $

PAGE 121

% )LJ $JDURVH JHO HOHFWURSKRUHVLV RI '1$ IURP VL[ SRVLWLYH FORQHV REWDLQHG E\ LPPXQRVFUHHQLQJ KXPDQ SODFHQWD DQG PRXVH VSOHHQ F'1$ OLEUDULHV DQG 6RXWKHUQ DQDO\VLV RI WKH FORQHV SUREHG ZLWK +3 $ $SSUR[LPDWHO\ J RI ODPEGD JWOO '1$ FRQWDLQLQJ WKH IROORZLQJ F'1$ LQVHUWV ZHUH GLJHVWHG ZLWK (FR5 DQG VXEMHFWHG WR HOHFWURSKRUHVLV LQ D b ZYf DJDURVH JHO +3 ODQH f +3 ODQH f +3 ODQH f 06 ODQH f 06 ODQH f DQG 06 ODQH f '1$ ZDV YLVXDOL]HG ZLWK HWKLGLXP EURPLGH 7KH F'1$ LQVHUWV DUH WKH ORZHU OHVV LQWHQVH EDQGV RI YDU\LQJ VL]H % $SSUR[LPDWHO\ [J RI ODPEGD JWOO '1$ FRQWDLQLQJ WKH VDPH F'1$ LQVHUWV ZHUH WUHDWHG DV LQ SDQHO $ /DQHV FRQWDLQ WKH VDPH VDPSOHV DV GHVFULEHG DERYH 7KH '1$ ZDV EORWWHG RQWR *HQH6FUHHQ DQG SUREHG ZLWK UDGLRODEHOHG +3 LQVHUW DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV $XWRUDGLRJUDSK\ ZDV FDUULHG RXW IRU PLQXWHV ODQHV f RU KRXUV ODQHV f

PAGE 122

IDOVH SRVLWLYH IDLOHG WR K\EULGL]H WR WKH UDGLRODEHOHG F'1$ LQVHUW +3 6RXWKHUQ EORWV RI WKH SRVLWLYH FORQH +3 LQ S8& DQG 0VS UHVWULFWLRQ IUDJPHQWV RI WKDW F'1$ ERWK LQ S8& DQG DV LVRODWHG LQVHUW ZHUH SUREHG ZLWK UDGLRODEHOHG UHGXQGDQW ROLJRQXFOHRWLGHV ZKLFK FRGH IRU SRUFLQH XWHURIHUULQ VHH )LJ IRU WKH VHTXHQFHV RI WKH ROLJRQXFOHRWLGHVf 3UREH .0 GLG QRW K\EULGL]H WR WKH F'1$ +3 +RZHYHU XQGHU FRQGLWLRQV RI IDLUO\ KLJK VWULQJHQF\ ROLJRQXFOHRWLGH .0 ZKLFK FRGHV IRU DPLQR DFLGV RI XWHURIHUULQ K\EULGL]HG VSHFLILFDOO\ WR D ES 0VS IUDJPHQW RI FORQH +3 VHH )LJ f 7DNHQ WRJHWKHU WKHVH GDWD LQGLFDWHG WKDW FORQH +3 FRGHG IRU WKH KXPDQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH $ F'1$ RI ES FRXOG HQWLUHO\ HQFRGH D SURWHLQ RI DSSDUHQW PROHFXODU ZHLJKW DERXW DPLQR DFLGVf 7KUHH GLIIHUHQW ORWV RI PRQRVSHFLILF DQWLVHUD UDLVHG DJDLQVW SRUFLQH XWHURIHUULQ FRQVLVWHQWO\ DQG VSHFLILFDOO\ UHFRJQL]HG IXVLRQ SURWHLQV IURP GLIIHUHQW F'1$ FORQHV ZKLFK ZHUH NQRZQ WR K\EULGL]H WR +3 )LQDOO\ DQ ROLJRQXFOHRWLGH FRGLQJ IRU SRUFLQH XWHURIHUULQ K\EULGL]HG VSHFLILFDOO\ WR +3 7KH F'1$ LQVHUW RI FORQH +3 ZDV GLJHVWHG ZLWK $OX DQG +DH ,,, 7KH UHVXOWV RI WKLV GLJHVW DUH VKRZQ LQ )LJ (DFK GLJHVW ZDV FORQHG LQWR WKH VHTXHQFLQJ YHFWRU 0PSO VKRWJXQ FORQLQJf DQG FORQHV ZHUH FKRVHQ DW UDQGRP DQG VHTXHQFHG :KHQ WKH VHTXHQFH RI FORQH +3 ZDV DQDO\]HG E\ WKH %HFNPDQ 0LFUR*HQLH SURJUDP LW ZDV UHYHDOHG WKDW WKLV FORQH DFWXDOO\ FRGHV IRU KXPDQ ILEURQHFWLQ UDWKHU WKDQ D XWHURIHUULQOLNH SRO\SHSWLGH &ORQH +3 FRYHUV QXFOHRWLGHV ESf RI KXPDQ ILEURQHFWLQ .RUQEOLKWW HW DW f ZKLFK FRGHV IRU

PAGE 123

$%2'( L A % )LJ 6RXWKHUQ EORW DQDO\VLV RI FORQH +3 ZLWK UDGLRODEHOHG ROLJRQXFOHRWLGH .0 3ODVPLG S8& FRQWDLQLQJ F'1$ LQVHUW +3 LJf ZDV FXW ZLWK (FR5 DQGRU 0VS DQG VXEMHFWHG WR HOHFWURSKRUHVLV RQ D b ZYf DJDURVH JHO DQG WUDQVIHUUHG WR *HQH6FUHHQ DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH EORW ZDV SUREHG ZLWK UDGLRODEHOHG .0 ZKLFK FRGHV IRU DPLQR DFLGV RI SRUFLQH XWHURIHUULQ 7KH K\EULGL]DWLRQ DQG ZDVKLQJ FRQGLWLRQV DUH H[SODLQHG LQ WKH WH[W $ S8& LJf % S8& FRQWDLQLQJ WKH F'1$ LQVHUW +3 & 0VS GLJHVW RI S8& FRQWDLQLQJ WKH F'1$ LQVHUW +3 (FR5 GLJHVW RI S8& FRQWDLQLQJ WKH F'1$ LQVHUW +3 ( 0VS GLJHVW RI WKH LQVHUW +3 ZKLFK KDG EHHQ LVRODWHG IURP DQ (FR5 GLJHVW RI S8& FRQWDLQLQJ WKH F'1$ DQG HOHFWUROXWHG IURP D b ZYf DJDURVH JHO 7KH SODVPLG S8& FRQWDLQV 0VS VLWHV WKH F'1$ LQVHUW FRQWDLQV 0VS VLWHV

PAGE 124

$ + $ + $ + ? )LJ 3RO\DFU\ODPLGH JHO HOHFWURSKRUHVLV RI FORQH +3 UHVWULFWLRQ IUDJPHQWV REWDLQHG E\ GLJHVWLRQ ZLWK $OX DQG +DH ,,, $SSUR[LPDWHO\ J RI +3 F'1$ LQVHUW ZHUH GLJHVWHG ZLWK $OX $f RU +DH ,,, +f DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 7KH LQVHUW ZDV REWDLQHG IURP S8& FORQH +3 ODQHV $ DQG +f S8& FORQH +3 ODQHV $ DQG +f DQG ODPEGD JWOO FORQH +3 ODQHV $ DQG +f 7KH GLJHVWV ZHUH VXEMHFWHG WR HOHFWURSKRUHVLV LQ D b ZYf DFU\ODPLGH JHO DQG WKH '1$ YLVXDOL]HG ZLWK HWKLGLXP EURPLGH

PAGE 125

,OO DPLQR DFLGV RI WKH PDWXUH SURWHLQ VHH )LJ .RUQEOLKWW HW DO f )XUWKHUPRUH QXFOHRWLGHV RI KXPDQ ILEURQHFWLQ PDWFK SUREH .0 ZKLFK FRGHV IRU DPLQR DFLGV RI XWHURIHUULQf DW RXW RI UHVLGXHV )LJ f 'RW %ORW $QDO\VLV RI 8WHURIHUULQ DQG )LEURQHFWLQ ZLWK $QWL8WHURIHUULQ $QWLERGLHV 8WHURIHUULQ KXPDQ ILEURQHFWLQ OHXFLQH DPLQRSHSWLGDVH DQG FRSSHU]LQF VXSHUR[LGH GLVPXWDVH ZHUH ERXQG WR QLWURFHOOXORVH DQG WHVWHG IRU FURVVUHDFWLYLW\ ZLWK UDEELW SRO\FORQDO DQWLERGLHV UDLVHG DJDLQVW SRUFLQH XWHURIHUULQ )LJXUH UHYHDOV WKDW WKH SRO\FORQDO DQWLERGLHV FURVVUHDFWHG ZLWK KXPDQ ILEURQHFWLQ DV ZHOO DV ZLWK SRUFLQH XWHURIHUULQ ZLWK ELQGLQJ DSSDUHQW GRZQ WR 2OQJ RI SURWHLQ 7KHUH ZDV QR GHWHFWDEOH ELQGLQJ WR LJ VDPSOHV RI OHXFLQH DPLQRSHSWLGDVH RU VXSHUR[LGH GLVPXWDVH XQGHU LGHQWLFDO FRQGLWLRQV 7KH IRXU PRQRFORQDO DQWLERGLHV GLVFXVVHG LQ GHWDLO LQ &KDSWHU ZHUH WKHQ WHVWHG IRU ELQGLQJ WR KXPDQ ILEURQHFWLQ 0RQRFORQDO DQWLERGLHV DQG FURVV UHDFWHG ZHDNO\ KXPDQ ILEURQHFWLQ GHWHFWLRQ OLPLW O22QJf ZKLOH PRQRFORQDO DQWLERGLHV DQG GLG QRW 5HVXOWV IURP 6FUHHQLQJ RI WKH 0RXVH 6SOHHQ F'1$ /LEUDU\ $ERXW [ r SODTXHV IURP D PRXVH VSOHHQ F'1$ OLEUDU\ LQ ODPEGD JWOO ZHUH VFUHHQHG ZLWK WKH DQWLXWHURIHUULQ SRO\FORQDO DQWLERGLHV 6HYHQWHHQ SRVLWLYH FORQHV ZHUH LGHQWLILHG 7ZR FORQHV JHQHUDWHG LPPXQRUHDFWLYH IXVLRQ SURWHLQV UDWHG DV YHU\ VWURQJ VHYHQ ZHUH UDWHG PRGHUDWHO\ VWURQJ VL[ ZHUH ZHDNO\ SRVLWLYH DQG WZR ZHUH VXVSHFWHG WR EH IDOVH SRVLWLYHV 7KH WZR VWURQJHVW SRVLWLYH FORQHV 06 DQG 06 DQG RQH PRGHUDWHO\ SRVLWLYH FORQH 06 ZHUH FKRVHQ IRU IXUWKHU VWXG\ 7KH F'1$ LQVHUWV ZHUH H[FLVHG ZLWK (FR5 DQG VXEMHFWHG WR

PAGE 126

)LJ 7KH QXFOHRWLGH DQG LQIHUUHG DPLQR DFLG VHTXHQFH RI FORQH +3 ZKLFK FRGHV IRU KXPDQ ILEURQHFWLQ 7KH QXFOHRWLGH VHTXHQFH RI D IXOOOHQJWK F'1$ FRGLQJ IRU KXPDQ ILEURQHFWLQ LV VKRZQ EHORZ DQG WKH UHJLRQ ZKLFK PDWFKHV FORQH +3 LV XQGHUOLQHG 7KH LQIHUUHG DPLQR DFLG VHTXHQFH RI KXPDQ ILEURQHFWLQ LV OLVWHG DERYH ZLWK WKH GHGXFHG DPLQR DFLG VHTXHQFH RI FORQH +3 LQ EUDFNHWV 7KH F'1$ VHTXHQFH DQG LQIHUUHG DPLQR DFLG VHTXHQFH DUH IURP .RUQEOLKWW HW DO f

PAGE 127

OUUHm\U£Y602}Wrm}/7rRD77LFBF}r71WA UL&}2224L}&r2&&&&UD!&7f}UU}&&r$$D7&7U72&r2U4$2&&$U*22$2&2$&r2&}r2&&UFUD$&74&7&$$&r$&8}&&$:}&7&D$72&7&&&$&7r$&&7&&r47 rF U mR MR LR fR WR WR WRR QR UR WIr(7'6799:f}}$,r*<}OYn$r$DU}m!n* I&7&07*$$$&7D$n7&7$&7*7&&7D7*$D$7*2$&f&$&&7DD&&&}DrU$r&:\.r&2$&72$&&47&*D&&77$&&&2$$*$2*&&$2&&&}DD&r&7r&r$7272* ,WR c ,I& f i96YWLW1Lr$6(nn7Y6O9$OOO41&6$LW$7\)77/ 7&&&7&727n&7&&9$*7$&&&&&&$**$$7&7&*$D&&72&$7&7*$*7$&$&&6A$7&(&7&27&2&&$7$0N222&$$&&$$2$2$**&&&$$$2&&$&722$*7&U77$&&$&$& r UDR WR M"R WR VR LR MRR }DWVr$U1rHYUH77LYLUU$$$}IrALY$)VD* f DFƒR&& r*$&n& 7$ < <&&$&& 7< $&$$&$& **$47*$&72$*$&&$&&$7&*7$7&$&$7*$&*&&7&<&&$$2$$7<4* 777 <$$*& 7444*7$&$&&$$*&&$44*$* mW2 m m mW2 I$$WF Y UWHVDV W Y Y/r$DYFYY}7LDZL}RH}$$ f$D&$&&$&D$4$$D72$77&$2$&7&$**$$*&$U&*77U*f&&&&7r*$&7&U$**$*7$*$$7$&27&7$&$&&$7&&$$&7&&72$*$*$7D2$&$22$$$2$2$UR&2& r m W2 r m M\$9\<3nB6 UMt7747$$$&$$$*7D*7*$&$&&$ n&7 & 2 m $$71W+X($1$274 9/786 &$&&$$&$$$&r&$7&UD*$UL&$$$&&&7$&$&7**$*7D&7&$&$*7&7&&7 r 6 W2 mW2 D X&69:0$D66&7U1/}$4/&}1: n& 77f*2$$*$$* 7* r&&$ 74&7*$7&$2$*&7&& &$&7777$ 7 $$&&4$&&&&&f*2$*7$&$$ 7D m m m m Wm :U7Jm$&:$ W 2 < U rr:}$)}n28n})7K2$27$r9 f$D777$&$&72U&$$2*$U2$&$$*D$$$*7&&&&7$n&7&7*$7$&&$U&$7&&&$2&727U&&U&&7&&&$&$&&72&2m77&$&&$$&$UU227&&$2$&$&&$UD&27* & 2 m r m < r $ r‘ $ r 6 ,+)/9} 6 $ 9 m 1 e ( 2 9 $ ( ,} $1$:8/ I&$&&D&*&Un&&$&&&&&$&&$7$U7}IW$&&$$&n7&&7**&D7U$&7&$&&77*$$$$$7$**$$2$74UnU&$2$D77U&$$777&7&&77&$$&$$U&$ 2&7 n2 ?? O262 Z / ‘r 7 & 2 9 62\&O0(7$/ $.7/'$7W f $$&$$$7& \FF 72&&n**n$&$*$$ $47 $4f*$& *&7&&$2 UU& $&*$$&$$& $7*$2$2&$&$&&7&77 $*$2*$$*$&$4$$$$&$*27& 7 74$77&&&&$$& 742& $n74 f O 2 WL]R OOm 862 7$$)n\ $3LDULrUO++$&f)$$& SF7f7UFnn*$7$77$&7&&$&7FU77}$&UR*&$&fVD$UU*FrF7D$RFF$&&$UF$&fn*DFn$&$22$7FFDFF$7&$ffFFFR$RF$&77&$27RRR$2$&&7FR$2$$2$UF =L2 7f2 L Y$+nm67/Ur 73Dr(
PAGE 128

f 972$7O77W7_Or}Um7&7O7U 7&2727,::PL$URFA72UI0$&&$&&A7&$&&$77$2&72D$2$$&&$$2$&7D$D$&2$7&$&74DF77 n 2 m r rrRUUDLUDFFR77FF}RFF0L7RRFF}D$FUFFX7FFrZP$$&&}7FXNRFFm0WRUF}2$$RF7rF$&0ff&$&$RD777L}FMX}FFrRRFN&7RA7rFL0KR}UF7FF72n}& r Or O121r56}99 FFWfVDDWJDFDDWTFWFJRDFFWFFFFWFrJFWFDWFJDFFFFn f FDF &$&&72&&&O7r&&22&7O&O7&&7mfn$&&&7*&D7&7&&7&&LDL2$O*7D27&&&7&2&&&&&&&&&7*&U&D&O&&7&7$77}&724&Fr m &2 F DrF r6 &7IUr_9LLWLL3 m V U &4$$&&+7$7 $&$$ 97r$747&$ 77&&& $$*$$ U $7&$*$$$&&&&& 72$ n n r & ‘*$$&4$$$$$*$&$4$&*$2& 7 7&&&&$$& 7*27$$&&& r f&&$&$&&&&$$rn W2 -WM4 RLLL/2\$VUXD$7$UYU05R\RURLR-RWLDUVRDR} 77&$n4O&&$DLO$UF\7*D$nn7r&&7fn&$&$Dnn7&$$$O&$&&&&777&7&$&&$&&&UR&U$7&$&22OOO727$7f&$*&rn&&U2&O&77&77&$&$$&&r F 4 A ZD)(W+AI}n"7f}$U7}UrL}+$$L}}\$rQZADH} 4727 744&$$&$7$ 7&777$4$&$777 7 $*4&44$&&$&$&&4& &$&$$&22&&$&&&&&$7 $$**&$7$44&&$$4$&&$7 $&&&4&&2$$747 44$&$$*$$&& r &77}\$$UDrnVHU W6&+mYRU2(&5LO}Y}DU7_ 77&7&$4$&$$&&$r&n&$7242&&&&$77&&$42$&$&77&7D$27$&$7&$777&$7*7&$7&&77fU22&$&7D$7$$2$&&&7U$&$277&$22477&&722$$&77&7$&W$ m r $ 7 / U D ‘ f f D r < 0 > O 9 e $ / } 0 m 9}He99\21O9}, & n2&&$&7&$&$&&f&$&&$D$227&&$&&7$&$$&$7&$<*f22$**&$&U2$$$2$&&$*&$2$**&$U$$D*7r&22*$$2$2D77277$&&27222&$$&7&727&$$&2 WR 4 +IO DXO72&r5
PAGE 129

)LJ 'RW EORW DQDO\VLV RI WKH ELQGLQJ RI SRO\FORQDO DQG PRQRFORQDO DQWLERGLHV DJDLQVW SRUFLQH XWHURIHUULQ WR XWHURIHUULQ DQG KXPDQ ILEURQHFWLQ 6HULDO WHQIROG GLOXWLRQV RI SURWHLQ IURP AJ WR QJ$O ZHUH ERXQG WR QLWURFHOOXORVH ILOWHUV GRWVf 7KH SURWHLQV HPSOR\HG ZHUH 8I XWHURIHUULQ )Q ILEURQHFWLQ /$3 OHXFLQH DPLQRSHSWLGDVH DQG &X=Q 62' FRSSHU]LQF VXSHUR[LGH GLVPXWDVH $IWHU DGGLWLRQDO SURWHLQ ELQGLQJ VLWHV RQ WKH QLWURFHOOXORVH ZHUH EORFNHG ZLWK %6$ WKH EORWV ZHUH LQFXEDWHG ZLWK WKH VRXUFH RI DQWLERG\ LQGLFDWHG 5E 8I UDEELW DQWLXWHURIHUULQ GLOXWLRQ WKDW PRQRFORQDO DQWLERG\ LJPO MXJPO I\JPO JPO 7KH DSSURSULDWH VHFRQGDU\ DQWLERG\ JRDW DQWLUDEELW RU JRDW DQWLPRXVHf ZDV LQFXEDWHG ZLWK WKH EORWV DW WKH PDQXIDFWXUHUnV UHFRPPHQGHG GLOXWLRQ ,PPXQRUHDFWLYH SURWHLQV ZHUH GHWHFWHG ZLWK +2 b YYf DQG FKORUROQDSWKRO PJPOf 7KLV ILJXUH LV D UHSURGXFWLRQ RI WKH RULJLQDO GRW EORW ZKLFK KDG IDGHG ZLWK WLPH

PAGE 130

5E r 8I 8I )Q /$3 &X=Q 62' 8I )Q /$3 &X=Q 62' f f f f H f f f OXJ 2OQJ f f f f R f f f m f H OXJ 2OQJ b f f f f 8I )Q /$3 &X=Q 62' 8I )Q /$3 &X=Q 62' OXJ 2OQJ OXJ A 2OQJ

PAGE 131

HOHFWURSKRUHVLV RQ D b ZYf DJDURVH JHO )LJ $f 7KH DSSUR[LPDWH VL]HV RI WKH F'1$ FORQHV ZHUH DV IROORZV 06 ES 06 ES DQG 06 ES 7KHVH F'1$ LQVHUWV ZHUH DOVR RQ WKH 6RXWKHUQ EORW LQ )LJ % 1RWH WKDW +3 ZKLFK FRGHV IRU KXPDQ ILEURQHFWLQ GLG QRW K\EULGL]H WR WKHVH F'1$ LQVHUWV 7KH ODUJHVW F'1$ FORQH 06 ZDV FKRVHQ IRU IXUWKHU VWXG\ $Q DJDURVH JHO RI DQ (FR5 GLJHVW RI D ODUJHU TXDQWLW\ RI '1$ IURP WKLV FORQH UHYHDOHG WKH SUHVHQFH RI DQ DGGLWLRQDO LQVHUW RI DERXW ES GDWD QRW VKRZQf %RWK WKH ES DQG ES F'1$V ZHUH VXEFORQHG LQWR 0PSO DQG VHTXHQFHG 7KH VHTXHQFHV RI WKH F'1$V VKRZHG QR KRPRORJ\ WR ILEURQHFWLQ QRU ZHUH WKH\ KRPRORJRXV WR DQ\ RWKHU '1$ VHTXHQFHV LQ *HQ%DQN 7KH LQIHUUHG DPLQR DFLG VHTXHQFHV RI WKH FORQHV VKRZHG QR VLPLODULW\ WR WKH DPLQR DFLG VHTXHQFH RI SRUFLQH XWHURIHUULQ 1R IXUWKHU VWXGLHV ZHUH FDUULHG RXW ZLWK WKH PRXVH F'1$ FORQHV REWDLQHG E\ LPPXQRVFUHHQLQJ 5HVXOWV IURP 6FUHHQLQJ WKH 3RUFLQH 8WHULQH (QGRPHWULXP F'1$ /LEUDU\ $SSUR[LPDWHO\ [ A SODTXHV IURP D SRUFLQH XWHULQH HQGRPHWULXP OLEUDU\ WKH JHQHURXV JLIW RI *HRUJH %DXPEDFKf ZHUH VFUHHQHG ZLWK WKH DQWLXWHURIHUULQ DQWLERGLHV 1R SRVLWLYH FORQHV ZHUH REWDLQHG +RZHYHU ZKHQ WKLV OLEUDU\ ZDV LPPXQRVFUHHQHG ZLWK DQWLERGLHV UDLVHG DJDLQVW WKH XWHURIHUULQDVVRFLDWHG SURWHLQ PHQWLRQHG LQ &KDSWHUV DQG VHYHUDO SRVLWLYH FORQHV ZHUH REWDLQHG 0. 0XUUD\ XQSXEOLVKHG UHVXOWVf ,W LV QRW FOHDU ZK\ D F'1$ LQVHUW FRGLQJ IRU SRUFLQH XWHURIHUULQ FRXOG QRW EH LVRODWHG IURP WKLV OLEUDU\ E\ LPPXQRVFUHHQLQJ

PAGE 132

7KH 0ROHFXODU &ORQLQJ RI D F'1$ &RGLQJ IRU WKH +XPDQ 7\SH 7DUWUDWH UHVLVWDQW $FLG 3KRVSKDWDVH $SSUR[LPDWHO\ [ r SODTXHV IURP WKH KXPDQ SODFHQWD F'1$ OLEUDU\ ZHUH VFUHHQHG ZLWK WZR VKRUW F'1$ SUREHV ZKLFK FRGH IRU SRUFLQH XWHURIHUULQ )LJ f 7KHVH F'1$ FORQHV DQG D ZHUH REWDLQHG E\ 5RVDOLD 6LPPHQ 2KLR 6WDWH 8QLYHUVLW\f XSRQ LPPXQRVFUHHQLQJ D SRUFLQH XWHULQH HQGRPHWULXP OLEUDU\ 7KH V\QWKHVLV RI WKH OLEUDU\ DQG LVRODWLRQ RI WKH SRVLWLYH FORQHV DUH GHVFULEHG HOVHZKHUH 6LPPHQ HW DO f 8SRQ VFUHHQLQJ WKH KXPDQ SODFHQWD F'1$ OLEUDU\ ZLWK XWHURIHUULQ F'1$ D HLJKW SRVLWLYH FORQHV ZHUH LGHQWLILHG 7ZR RI WKHVH SRVLWLYH FORQHV D DQG D ZHUH UDWHG DV VWURQJ SRVLWLYHV WKUHH DV PRGHUDWHO\ VWURQJ SRVLWLYHV DQG WKUHH DV ZHDN SRVLWLYHV :KHQ WKHVH SRVLWLYH FORQHV ZHUH UHVFUHHQHG ZLWK F'1$ D RQO\ WKH WZR VWURQJ SRVLWLYHV K\EULGL]HG WR WKH SUREH 7KH F'1$ ZKHQ XVHG DV D SUREH K\EULGL]HG WR ERWK RI WKHVH VWURQJ SRVLWLYHV D DQG D )LJ f 7KH F'1$ LQVHUWV ZHUH H[FLVHG IURP ODPEGD JWOO FORQHV D DQG D ZLWK (FR5 DQG VXEMHFWHG WR HOHFWURSKRUHVLV RQ D b ZYf DJDURVH JHO 7KH F'1$ D DSSHDUHG WR EH DSSUR[LPDWHO\ ES WKH F'1$ D DERXW ES )LJ f 7KH F'1$ FORQHV D DQG D ZHUH GLJHVWHG ZLWK $OX +DH ,,, 0VS DQG 5VD DQG WKH GLJHVWV VXEMHFWHG WR HOHFWURSKRUHVLV RQ b ZYf SRO\DFU\ODPLGH JHOV )LJ f 7KH IUDJPHQWV ODUJHU WKDQ ES ZHUH HOHFWURHOXWHG IURP WKH JHOV DQG VXEFORQHG LQGLYLGXDOO\ LQWR 0PSO 7KH VXEFORQLQJ DQG VHTXHQFLQJ VWUDWHJ\ LV VKRZQ LQ )LJ 7KH UHVWULFWLRQ IUDJPHQWV WKDW ZHUH VHTXHQFHG DQG WKHLU ORFDWLRQV LQ FORQH D DUH OLVWHG LQ 7DEOH

PAGE 133

O )LJ 7ZR SRVLWLYH FORQHV D DQG D LGHQWLILHG E\ VFUHHQLQJ WKH KXPDQ SODFHQWD F'1$ OLEUDU\ ZLWK WKH F'1$V FRGLQJ IRU SRUFLQH XWHURIHUULQ 'XSOLFDWH ILOWHUV ZHUH REWDLQHG FRQWDLQLQJ '1$ IURP DSSUR[LPDWHO\ [ A SODTXHV D WRSf RU SODTXHV D ERWWRPf DW DQ LQWHUPHGLDWH VWDJH LQ SODTXH SXULILFDWLRQ RI WKH WZR SRVLWLYH FORQHV VHH 0DWHULDOV DQG 0HWKRGVf 7KH ILOWHUV ZHUH K\EULGL]HG WR UDGLRODEHOHG F'1$V FRGLQJ IRU OHIWf RU D ULJKWf DV GHVFULEHG LQ WKH WH[W

PAGE 134

)LJ $JDURVH JHO HOHFWURSKRUHVLV RI (FR5 GLJHVWV RI '1$ IURP WZR SRVLWLYH FORQHV D DQG D '1$ LVRODWHG IURP ODPEGD JWOO SRVLWLYH FORQHV LJ ODQHV DQG f DQG D S8& VXEFORQH LJ ODQH f ZKLFK KDG EHHQ GLJHVWHG ZLWK (FR5 ZHUH VXEMHFWHG WR HOHFWURSKRUHVLV RQ D b ZYf DJDURVH JHO ,VRODWHG F'1$ LQVHUWV ZKLFK KDG EHHQ HOHFWURHOXWHG IURP D VLPLODU JHO O22QJf ZHUH DOVR VXEMHFWHG WR HOHFWURSKRUHVLV RQ WKLV DJDURVH JHO ODQHV DQG f 0ROHFXODU ZHLJKW PDUNHUV ODQH f ZHUH (FR5 DQG +LQG ,,, GLJHVWV RI SKDJH '1$ WRS WR ERWWRP DQG ESf 7KH VL]HV RI F'1$ LQVHUWV D ODQHV DQG f DQG D ODQHV f ZHUH HVWLPDWHG WR EH DQG ES UHVSHFWLYHO\

PAGE 135

)LJ 3RO\DFU\ODPLGH JHO HOHFWURSKRUHVLV RI WKH UHVWULFWLRQ IUDJPHQWV REWDLQHG E\ WKH GLJHVWLRQ RI FORQHV D DQG D ZLWK $OX +DH ,,, DQG 0VS &ORQH D OHIWf ZDV GLJHVWHG ZLWK $OX LQFRPSOHWH GLJHVW ODQH f +DH ,,, ODQH f RU 0VS ODQH f 0ROHFXODU ZHLJKW PDUNHUV ODQH f FRQVLVWHG RI DQ 0VS GLJHVW RI S8& IURP WRS WR ERWWRP GRXEOHW DQG ES UHVSHFWLYHO\f &ORQH D ULJKWf ZDV GLJHVWHG ZLWK $OX ODQH f +DH ,,, ODQH f RU 0VS ODQH f 0ROHFXODU ZHLJKW PDUNHUV ODQH f ZHUH WKH VDPH DV GHVFULEHG IRU D 7KH VDPSOHV ZHUH VXEMHFWHG WR HOHFWURSKRUHVLV LQ D QRQGHQDWXULQJ b ZYf SRO\DFU\ODPLGH JHO 7KH UHVWULFWLRQ IUDJPHQWV ZHUH YLVXDOL]HG ZLWK HWKLGLXP EURPLGH

PAGE 136

cL TL FQLWL MM c,, >> WR D L >L D R LQKH L L O M 9 L D LnOO OLW L F

PAGE 137

, , , , + 50 D + $ + $+ 5 $ $0$ 0 U )LJ 6XEFORQLQJ DQG VHTXHQFLQJ VWUDWHJ\ IRU FORQH D WKH F'1$ HQFRGLQJ WKH KXPDQ 7\SH WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH 7KH UHVWULFWLRQ PDS GLVSOD\V RQO\ UHOHYDQW UHVWULFWLRQ HQGRQXFOHDVH VLWHV 7KH VROLG EDU UHSUHVHQWV WKH SURWHLQ FRGLQJ UHJLRQ WKH WKLQ OLQH WKH XQWUDQVODWHG VHTXHQFHV 7KH GLUHFWLRQ DQG H[WHQW RI WKH VHTXHQFH GHWHUPLQDWLRQV DUH VKRZQ E\ KRUL]RQWDO DUURZV $ $OX + +DH ,,, 0 0VS 5 5VD D WKH OLPLWV RI WKH VKRUWHU F'1$ FORQH D

PAGE 138

7$%/( 7KH FORQHV HPSOR\HG IRU JHQHUDWLRQ RI WKH FRPSOHWH VHTXHQFH RI WKH KXPDQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH &ORQH 6WUDQG 1XFOHRWLGHV DODD / D 8 DOD 8 D D D / DOODODOU UU 8 DO D / DO K VK UH UN 8 D 8 D / D / D / D 8 D / D / KL 8 KL / KODf 8 K K K 8 K KDf / K K K KDf / K / K K / K OD / K OE 8 K / K / K / K / PO PO PO / PODf 8 P P VPO VP / P / PO P P P 8 P / P / P P 8 UD 8 UF UG UK / UKDO / UKD / UKG 8 UDOX DFL 8 UDOX E G J K 8 UDOX H / UDOX I 8 VD 8 &ORQHV ZKLFK JHQHUDWHG FRGLQJVWUDQG VHTXHQFH DUH GHVLJQDWHG 8 XSSHU VWUDQGf WKRVH ZKLFK JHQHUDWHG VHTXHQFH IURP WKH DQWLVHQVH VWUDQG / ORZHU VWUDQGf 1XFOHRWLGHV UHIHUV WR WKH SRVLWLRQ RI WKH FORQH LQ WKH FRPSOHWH VHTXHQFH

PAGE 139

F'1$ 6HTXHQFHV )LJXUH VKRZV WKH QXFOHRWLGH VHTXHQFH RI WKH FORQH D DQG WKH LQIHUUHG DPLQR DFLG VHTXHQFH RI WKH KXPDQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH 7KH VKRUWHU FORQH D LV LGHQWLFDO WR QXFOHRWLGHV RI FORQH D 7KH WUDQVODWLRQDO LQLWLDWLRQ VLWH FDQ EH DVVLJQHG WR HLWKHU RI WZR LQIUDPH $7* FRGRQV ERWK RI ZKLFK OLH GRZQVWUHDP RI DQ LQIUDPH WHUPLQDWLRQ FRGRQ 7*$ DW QXFOHRWLGHV 7KH n XQWUDQVODWHG VHTXHQFH LV ES IROORZHG E\ DQ RSHQ UHDGLQJ IUDPH RI ES FRUUHVSRQGLQJ WR D SURWHLQ RI UHVLGXHV 7KH FRGRQ VSHFLI\LQJ SUROLQH LV IROORZHG LPPHGLDWHO\ E\ WKH WUDQVODWLRQDO WHUPLQDWLRQ FRGRQ 7*$ DW QXFOHRWLGHV 7KH n XQWUDQVODWHG VHTXHQFH LV QXFOHRWLGHV LQ OHQJWK ZLWK UHVLGXHV FRPSRVLQJ D SRWHQWLDO SRO\DGHQ\ODWLRQ VLJQDO $$7$$$ ZKLFK OLHV UHVLGXHV XSVWUHDP RI WKH SUHVXPHG SRO\$f WDLO &KDUDFWHULVWLFV RI WKH 'HGXFHG $PLQR $FLG 6HTXHQFH 7KH ILUVW DPLQR DFLG RI WKH PDWXUH SURWHLQ LV DVVLJQHG DV WKH DVSDUWDWH FRGHG E\ QXFOHRWLGHV WKLV DVVLJQPHQW ZDV GHWHUPLQHG E\ DSSOLFDWLRQ RI WKH f UXOH RI 9RQ +HLMQH f EXW UHPDLQV WHQWDWLYH VLQFH WKH 1WHUPLQDO VHTXHQFH RI WKH KXPDQ HQ]\PH KDV QRW EHHQ HVWDEOLVKHG 7KH PDWXUH KXPDQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH PRVW SUREDEO\ FRQVLVWV RI DPLQR DFLGV ZLWK DQ XQJO\FRV\ODWHG UHODWLYH PROHFXODU PDVV RI 7KLV HQ]\PH FRQWDLQV WZR SRWHQWLDO DWWDFKPHQW VLWHV IRU 1OLQNHG ROLJRVDFFKDULGHV 7KH VHTXHQFH DVSDUDJLQHYDOLQHVHULQH RFFXUV WZLFH DW DPLQR DFLGV DQG )LJ f

PAGE 140

)LJ 7KH QXFOHRWLGH VHTXHQFH RI WKH F'1$ FORQH D DQG WKH GHGXFHG DPLQR DFLG VHTXHQFH RI WKH KXPDQ 7\SH WDUWUDWH UHVLVWDQW DFLG SKRVSKDWDVH 7KH LQLWLDWLRQ DQG WHUPLQDWLRQ FRGRQV DUH XQGHUOLQHG 7KH SXWDWLYH VLJQDO SHSWLGDVH FOHDYDJH VLWH LV LQGLFDWHG ZLWK DQ DUURZ 7KH WZR SRWHQWLDO DWWDFKPHQW VLWHV IRU 1OLQNHG ROLJRVDFFKDULGHV DUH ER[HG 7KH SXWDWLYH SRO\DGHQ\ODWLRQ VLJQDO $$7$$$f LV DOVR XQGHUOLQHG

PAGE 141

&&&&$&&&$$7$$$&&&7&$&&*$&&*&&$&77&7$&7&7 $&$&&&&$&&$&&&7&7&$&$&&&7&&&&7 *$&7&&&&7&7&7&7&&&&&&& -& *$& $7& 7&& $&& &&& &7& &7& $7& &7& &$$ &&& 77& 77& &7$ &&& 7&& &7& *&7 6, 0'0:7$/O W2$//O36/$A &$7 &&7 &&& $&& &&7 &&& &7& &&& 777 &7$ &&& &7& &&7 &$& 7&& &&$ &&& &7& &&& $$7 &&& &&$ 77& &$& $&& &$73$/5)9$9&2:&&931$3)+7 &&& &&& &$$ $7& &&& $$7 &&& $$& &$& $7& &&7 &&& $&7 &7& &$& $7& &7& &&7 &&$ &$& 77& $7& &7& 7&7 &7$ & 3(0$1$.( $ 5 7 9 4 /&$') /6/ &&& &$& $$7 777 7$& 77& $&7 &&7 &7& &$$ &$& $7& $$7 &$& $$& $&& 77& &$& *$& $&& 777 *$& *$& &7$ 77& & '1)<)7&94',1'.5)4(7)('9) 7&7 &$& &&& 7&& &77 &&& $$$ &7& &&& 7&& 7$& &7& &7$ &&& &&$ $$& &$7 &$& &$& &77 &&& $$7 &7& 7&7 &&& 6 1 1 $ &$& $77 &&$ 7$& 7&7 $$& $7& 7&& $$& &&& 7&& $$& 77& &&& $&& &&7 77& 7$& &&& &7& &$& 77& $$& $7& &&$ LD\VNLVNUZQISVSI\UOKINLS &$& $&& $$7 &7& 7&7 &7& &&& $77 777 $7& &7& *$& $&$ &7& $&$ &7$ 7&7 &&& $$& 7&$ *$7 &$& 77& &7& $&& 1 1 O 6 &$& &$& &&7 &$& $&& &&& &*$ &7$ $&7 &&& &&& $&$ &$& &7& 7&& 7&& &7& $$& $$$ &$& &7& &&& &&& &&& $&& 23(535/7$574/6:/..4,$$$5 *$& *$& 7$& &7& &7& &7& &&7 &&& &$& 7$& &&& &7& 7&& 7&& $7$ &&& &$& &$& &&& &&7 $&& &$& 7&& &7& &7& ( '<9/9$&+<39:6 $(+*37+&/9 $$& &$& &7$ &&& &&$ &7& &7& &&& $&$ 7$& &&& &7& $&7 &&& 7$& &7& 7&& &&& &$& &$7 &$& $$7 &7& &$& 7$& ROUSOODW\FYWD\OFFKGKQOR\ &7& &$$ &$7 *$& $$7 &*& &7& &&& 7$& &7& &7& $&7 &&& &&7 &&& $$7 77& $7& &$& &&& 7&$ $$& &&& &$& &$& / 4'(1&9&<9/6&$&1)0'36.5+4 &&& $$& &7& &&& $$& &&& 7$7 &7& &&& 77& &$& 7$7 &&& $&7 &$$ *$& 7&$ &7& &&7 &&& 777 &&& 7$7 &7& *$& 5 .931&
PAGE 142

,Q )LJ WKH GHGXFHG DPLQR DFLG VHTXHQFH RI WKH KXPDQ HQ]\PH LV FRPSDUHG WR WKH DPLQR DFLG VHTXHQFHV RI SRUFLQH XWHURIHUULQ DQG WKH ERYLQH VSOHHQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH 2YHUDOO WKHUH LV b LGHQWLW\ EHWZHHQ WKH KXPDQ HQ]\PH DQG SRUFLQH XWHURIHUULQ 7KH VLPLODULW\ LQFUHDVHV WR b ZKHQ RQO\ QRQFRQVHUYDWLYH VXEVWLWXWLRQV DUH FRQVLGHUHG 'D\KRII f 7KHUH LV b LGHQWLW\ EHWZHHQ WKH KXPDQ HQ]\PH DQG WKH SRUWLRQV RI WKH ERYLQH HQ]\PH ZKLFK KDYH EHHQ VHTXHQFHG $ VHDUFK RI *HQ%DQN DQG WKH 3URWHLQ 'DWD %DQN UHYHDOHG QR VLJQLILFDQW VLPLODULWLHV EHWZHHQ WKH F'1$ VHTXHQFH RU LQIHUUHG DPLQR DFLG VHTXHQFH RI WKH KXPDQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH DQG DQ\ RWKHU NQRZQ '1$ RU SURWHLQ VHTXHQFHV 1RUWKHUQ $QDO\VLV 1RUWKHUQ DQDO\VLV ZDV FDUULHG RXW LQ RUGHU WR GHWHUPLQH WKH VL]H RI WKH P51$ FRGLQJ IRU WKH KXPDQ 7\SH SKRVSKDWDVH DQG WR VWXG\ WKH GLVWULEXWLRQ RI WKH HQ]\PH LQ OHXNHPLF FHOOV $ UDGLRODEHOHG VLQJOH VWUDQGHG F'1$ SUREH FRGLQJ IRU WKH DQWLVHQVH VWUDQG RI FORQH D ZDV HPSOR\HG WR DQDO\]H EORWV RI 51$ LVRODWHG IURP KXPDQ SODFHQWD QRUPDO KXPDQ OHXNRF\WHV WKH OHXNRF\WHV REWDLQHG IURP D SDWLHQW ZLWK KDLU\ FHOO OHXNHPLD WKH KXPDQ HU\WKUROHXNHPLD FHOO OLQH WKH 7FHOO OLQH -85.$7 DQG WKH (%9WUDQVIRUPHG %FHOO OLQH =5 )LJ f 7KH SUREH GHWHFWHG D VLQJOH WUDQVFULSW RI DSSUR[LPDWHO\ NE LQ FHOOV )LJ $ DQG %f DQG =5 FHOOV )LJ &f 7KH WUDQVFULSW GHWHFWHG LQ WKH KDLU\ FHOOV DSSHDUHG WR EH VOLJKWO\ ODUJHU )LJ $f 7KLV SUREH ZDV DOVR DEOH WR GHWHFW D NE WUDQVFULSW LQ 51$ LVRODWHG IURP WKH XWHULQH HQGRPHWULXP RI D GD\ SUHJQDQW SLJ 39 0DODWK\ DQG 50 5REHUWV XQSXEOLVKHG UHVXOWVf 7KH WUDQVFULSW ZDV QRW GHWHFWHG LQ

PAGE 143

)LJ &RPSDULVRQ RI WKH GHGXFHG DPLQR DFLG VHTXHQFH RI WKH KXPDQ WDUWUDWH UHVLVWDQW DFLG SKRVSKDWDVH ZLWK WKH DPLQR DFLG VHTXHQFHV RI SRUFLQH XWHURIHUULQ DQG WKH ERYLQH VSOHHQ DFLG SKRVSKDWDVH %R[HG UHJLRQV LQGLFDWH GLIIHUHQFHV LQ WKH VHTXHQFHV %ODQNV DUH XQNQRZQ DPLQR DFLG UHVLGXHV ; VWDQGV IRU HLWKHU OHXFLQH RU LVROHXFLQH LQ WKH EHHI VSOHHQ VHTXHQFH f LQGLFDWHV WKDW DGMDFHQW UHVLGXHV DUH FRQQHFWHG LQ WKH VHTXHQFH DVWHULVNV LQGLFDWH SRWHQWLDO JO\FRV\ODWLRQ VLWHV 7KH $VQ DW SRVLWLRQ LV NQRZQ WR EH JO\FRV\ODWHG LQ XWHURIHUULQ +XQW HW DO f 0RVW RI WKH DPLQR DFLG VHTXHQFH IRU XWHURIHUULQ DQG DOO RI WKH VHTXHQFH IRU WKH EHHI VSOHHQ 75$3 LV IURP +XQW HW DO f 6RPH UHJLRQV LQ WKH SRUFLQH XWHURIHUULQ VHTXHQFH XQGHUOLQHGf ZHUH GHGXFHG RU LQWHUFRQQHFWHG IURP LQIRUPDWLRQ REWDLQHG IURP XWHURIHUULQ F'1$ FORQHV 6LPPHQ HW DO DQG 5 6LPPHQ XQSXEOLVKHG UHVXOWVf $ XWHURIHUULQ SHSWLGH VHTXHQFH ..,/.5f SODFHG WHQWDWLYHO\ DIWHU SRVLWLRQ LQ +XQW HW DO f ZDV QRW UHSUHVHQWHG LQ WKH F'1$ VHTXHQFH ,WV RULJLQ LV XQFOHDU DOWKRXJK LW LV VLPLODU WR WKH VHTXHQFH 6.,6.5 DVVLJQHG WR UHVLGXHV

PAGE 144

Q $ 7 3 $ / 5 ) 9 $ 9 : * 9 3 1 $ 3 ) + 7 S ( 0 $ 1 $ ( $ 3 7 9 4 / $ 3 ) / 6 / )OXPDQ 3ODFHQWD 7 $ 3 7 3 / 5 ) 9 $ 9 Z * 9 3 1 $ 3 ) + 7 $ 5 ( 0 $ 1 $ $ $ 7 7 9 7 / $ ) / 6 / 8WHURIHUULQ 7 3 $ 3 0 / 5 ) 9 $ 9 Z * 9 3 1 $ 3 ) < 6 $ ( 0 $ 1 $ $ ; $ 7 9 ; ; $ ) 9 ; 6 5HHI 6SOHHQ 1 ) < ) 7 9 1 3 ) 4 ( 7 ) ( 9 ) 6 Q 3 6 / 5 9 3 : < 9 / $ 1 + + / 1 9 6 $ +XPDQ 3ODFHQWD 1 ) < ) 7 9 + $ Q 5 ) 4 ( 7 ) ( 9 ) 6 3 6 / 5 1 9 3 : + 9 / $ 1 + 3 + / 1 9 6 $ 8WHURIHUULQ 1 ) < ) 6 ) 4 ( 7 ) ( 9 ) V $ 6 3 ; 5 6 9 3 : ; $ 1 + 3 + ; 1 9 6 5HHI 6SOHHQ 4 $ < 6 6 5 : 1 ) 3 6 3 ) < 5 / + ) 3 4 7 1 9 6 9 $ ) 0 / 7 9 7 / & 1 V 3 ) / 6 +XPDQ 3ODFHQWD 4 $ < 6 6 5 : 1 ) 3 V 3 < < 5 / 5 ) 3 5 V 1 9 V 9 $ ) 0 / Q 7 9 7 / & 1 V ) 9 V 8WHURIHUULQ ; 5 : ) 3 V 3 < < 5 ; 5 ) ; 3 5 6, 7 5 9 ; ) 0 ; Q 7 9 7 ; & 1 V 5 3 ) 9 5HHI 6SOHHQ 4 3 ( 5 3 5 O 7 $ 5 7 4 / V : / . 4 / $ $ $ 5 ( < 9 / 9 $ + < 3 9 : 6 $ ( + S 7 + & / 9 +XPDQ 3ODFHQWD 4 3 ( 5 1 / $ / $ 5 7 / $ : . 4 / $ $ $ ( < 9 / 9 $ + < 3 9 Z V $ ( + S 7 + & / 9 8WHURIHUULQ $ 5 7 4 ; $ Z ; . 4 ; $ $ $ ( Q < 9 ; 9 $ + < 3 9 Z V ; $ ( + 9 9 + & ; 9 5HHI 6SOHHQ 4 / 5 3 / / $ 7 < 9 7 $ < / F + + 1 / 4 < / Q ( 1 9 < 9 / V $ 1 ) 0 S 6 5 + +XPDQ 3ODFHQWD 4 / / 3 / / 7 7 + 9 7 $ < / 4 + + 1 / < / 4 ( 1 / ) 9 / V $ 1 ) 1 3 S V . + / 8WHURIHUULQ 4 ; ; 3 ; ; 1 $ + 9 7 $ < ; F + + 0 ; 4 < ; 4 W 1 IL ; ) 9 ; V $ 1 ) 0 S V . + 5HHI 6SOHHQ 5 9 3 1 < / 5 ) + < 7 ( 3 V / * ) $ < 9 ( V 6 ( 0 7 9 7 < ( $ 6 6 / ) 7 5 / 3 5 +XPDQ 3ODFHQWD 5 9 3 1 < / 5 ) + ) $ ( 1 V / * ) $ < 9 ( 7 3 ( 0 6 9 7 < ) $ V 6 / ) 7 / 3 5 8WHURIHUULQ 4 9 3 >f < ; 5 ) + < $ ( 1 V ; * ) $ < 9 ( ; 6 3 ( 0 6 9 7 < ; ) $ V $ 1 6 ; ) 7 5 ; 3 5 5HHI 6SOHHQ 5 $ 5 S +XPDQ 3ODFHQWD 5 $ 5_ V + $ 8WHURIHUULQ f 5HHI 6SOHHQ

PAGE 145

)LJ ([SUHVVLRQ RI WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH P51$ DQG LWV LQGXFWLRQ E\ 73$ 7RWDO 51$ ZDV LVRODWHG IURP WKH OHXNRF\WHV RI D QRUPDO LQGLYLGXDO DQG D SDWLHQW ZLWK KDLU\ FHOO OHXNHPLD DQG IURP WKH FHOO OLQHV -85.$7 DQG =5 :KHQ LQGLFDWHG WKH FHOO OLQHV ZHUH FXOWXUHG LQ WKH SUHVHQFH RI rp0 WHWUDGHFDQR\OSKRUERO DFHWDWH DV LQ 7DEOH 1RUWKHUQ EORWV RI WRWDO 51$ JODQHf ZHUH K\EULGL]HG WR UDGLRODEHOHG F'1$ SUREHV FRGLQJ IRU HLWKHU WKH KXPDQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH 75$3f RU ME DFWLQ GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGVf 7KH VL]H RI WKH 75$3 P51$ LV NE DQG WKH !DFWLQ P51$ LV NE DV GHWHUPLQHG E\ FRPSDULVRQ ZLWK 51$ PROHFXODU ZHLJKW VWDQGDUGV $ 51$ ZDV LVRODWHG IURP QRUPDO KXPDQ OHXNRF\WHV ODQH f OHXNRF\WHV RI D SDWLHQW ZLWK KDLU\ FHOO OHXNHPLD ODQH f FHOOV ODQH f DQG FHOOV WUHDWHG ZLWK 73$ IRU KRXUV ODQH f 7KH 1RUWKHUQ EORW ZDV SUREHG ZLWK WKH F'1$ FRGLQJ IRU 75$3 % /DQHV UHVSHFWLYHO\ FRQWDLQ 51$ LVRODWHG IURP FHOOV WUHDWHG ZLWK 73$ IRU DQG KRXUV VHH 7DEOH f ,Q SDQHO D WKH 1RUWKHUQ EORW ZDV SUREHG ZLWK WKH F'1$ FRGLQJ IRU 75$3 LQ SDQHO E WKH VDPH EORW ZDV SUREHG ZLWK WKH F'1$ FRGLQJ IRU 6DFWLQ & 51$ ZDV LVRODWHG IURP -85.$7 FHOOV ODQH f -85.$7 FHOOV JURZQ LQ WKH SUHVHQFH RI 73$ ODQH f DQG WKH O\PSKREODVWRLG FHOO OLQH =5 ODQH f ,Q SDQHO D WKH 1RUWKHUQ EORW ZDV SUREHG ZLWK WKH F'1$ FRGLQJ IRU 75$3 LQ SDQHO E WKH VDPH EORW ZDV SUREHG ZLWK WKH F'1$ FRGLQJ IRU IE DFWLQ

PAGE 147

QRUPDO KXPDQ OHXNRF\WHV )LJ $f RU SODFHQWD GDWD QRW VKRZQf DOWKRXJK OHXNRF\WHV DQG SODFHQWD DUH NQRZQ WR FRQWDLQ WKH SURWHLQ 1HLWKHU ZDV WKH WUDQVFULSW DSSDUHQW LQ WKH -85.$7 FHOOV )LJ &f D 7FHOO DFXWH O\PSKREODVWRPD OHXNHPLD FHOO OLQH ZKLFK GRHV QRW H[SUHVV WKH 7\SH SKRVSKDWDVH 'UH[OHU HW DO Df ,QGXFWLRQ RI WKH 7DUWUDWHUHVLVWDQW $FLG 3KRVSKDWDVH E\ 73$ :KHQ FHOOV ZHUH JURZQ LQ WKH SUHVHQFH RI nA0 73$ IRU KRXUV D IROG LQFUHDVH LQ WRWDO DFLG SKRVSKDWDVH DFWLYLW\ ZDV REVHUYHG 7DEOH f 7KH LQWUDFHOOXODU HQ]\PH OHYHOV LQFUHDVHG IROG E\ KRXUV DQG GHFOLQHG WKHUHDIWHU $ FKDQJH LQ PRUSKRORJ\ ZDV DOVR QRWHG :LWK LQFUHDVHG H[SRVXUH WR WKH SKRUERO HVWHU WKH FHOOV LQFUHDVHG LQ VL]H DQG EHFDPH LUUHJXODU LQ VKDSH )LJXUH % VKRZV WKDW OHYHOV RI P51$ FRGLQJ IRU WKH KXPDQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH LQFUHDVHG GUDPDWLFDOO\ DIWHU D KRXU H[SRVXUH WR WKH SKRUERO HVWHU DQG EHJDQ WR GHFOLQH DIWHU KRXUV 'HQVLWRPHWU\ UHYHDOHG WKDW WKH P51$ ZDV PD[LPDOO\ LQGXFHG IROG KRXUV DIWHU DGGLWLRQ RI WKH 73$ &OHDUO\ WKH LQFUHDVHG H[SUHVVLRQ RI WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH DFWLYLW\ LQ UHVSRQVH WR WKH SKRUERO HVWHU LV FORVHO\ FRUUHODWHG ZLWK LQFUHDVHG OHYHOV RI P51$ FRGLQJ IRU WKH HQ]\PH 7KH VLJQDO IRU ADFWLQ P51$ UHPDLQHG UHODWLYHO\ XQFKDQJHG DV WKH WLPH RI H[SRVXUH WR WKH WXPRU SURPRWHU ZDV H[WHQGHG 7KH -85.$7 FHOO OLQH ZKLFK KDG XQGHWHFWDEOH OHYHOV RI P51$ FRGLQJ IRU WKH WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH )LJ &f ZDV DOVR WHVWHG IRU WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH DFWLYLW\ ZLWK DQG ZLWKRXW WKH DGGLWLRQ RI 73$ WR WKH FXOWXUH PHGLXP 5HODWLYHO\ ORZ OHYHOV RI WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH ZHUH GHWHFWHG LQ WKH FHOO O\VDWHV

PAGE 148

7$%/( 7DUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH OHYHOV LQ DQG -85.$7 FHOOV PDLQWDLQHG RQ a 73$ DQG FHOOV PDLQWDLQHG RQ X0 KHPLQ &HOOV 7UHDWPHQW 7LPH KRXUVf 8QLWV RI $FWLYLW\ P8 7RWDO $FWLYLWY &HOOV FHOOVf 0HGLXP 1RQH n0 73$ 0 73$ n0 73$ n0 73$ 0 73$ r0 73$ L0 KHPLQ L0 KHPLQ -85.$7 1RQH -85.$7 n0 73$ &HOOV f ZHUH KDUYHVWHG DW HDFK WLPH SRLQW DQG DFLG SKRVSKDWDVH DFWLYLW\ PHDVXUHG LQ WULSOLFDWH VDPSOHV RI PHGLXP DQG FHOO H[WUDFWV IURP A FHOOV (DFK FXOWXUH ZDV PDLQWDLQHG VHSDUDWHO\ DW D GHQVLW\ RI DSSUR[LPDWHO\ [ r FHOOVPO E\ DGGLWLRQ RI IUHVK PHGLXP VHH 0DWHULDOV DQG 0HWKRGVf FRQWDLQLQJ 0 SKRUERO HVWHU RU A0 KHPLQ ZKHQ QHFHVVDU\ &HOOV ZHUH H[SRVHG WR KLJK VDOWGHWHUJHQW EXIIHU &KDSWHU f EURNHQ E\ GRXQFH KRPRJHQL]DWLRQ DQG WKH VXSHQVLRQ FHQWULIXJHG DW [J IRU PLQXWHV $FWLYLW\ LQ WKH FHOO O\VDWH VXSHUQDWDQW IUDFWLRQf DQG WKH FXOWXUH PHGLXP ZDV DVVD\HG ZLWK S QLWURSKHQ\OSKRVSKDWH P0f DV VXEVWUDWH LQ WKH SUHVHQFH RI PHUFDSWRHWKDQRO 0f DQG /fWDUWUDWH 0f 5HVXOWV DUH H[SUHVVHG DV PLOOLXQLWV QPRO VXEVWUDWH K\GURO\]HG PLQ DW r&f SHU r FHOOV 7KH PHGLXP ZDV QRW FKDQJHG GXULQJ WKH FRXUVH RI WKH H[SHULPHQW DQG VR UHSUHVHQWV DFFXPXODWHG DFWLYLW\

PAGE 149

EXW QRW FXOWXUH PHGLXP RI -85.$7 FHOOV ZKHQ 73$ ZDV QRW DGGHG WR WKH FXOWXUH 7DEOH f +RZHYHU b RI WKH DFLG SKRVSKDWDVH DFWLYLW\ DSSHDUHG LQ WKH FXOWXUH PHGLXP DIWHU KRXUV WUHDWPHQW ZLWK 73$ DOWKRXJK WKH WRWDO DPRXQW RI DFLG SKRVSKDWDVH DFWLYLW\ GLG QRW FKDQJH 7KH (IIHFWV RI +HPLQ RQ $FLG 3KRVSKDWDVH ([SUHVVLRQ :KHQ KHPLQ LV DGGHG WR WKH FXOWXUH PHGLXP RI FHOOV WKH FHOOV H[SUHVV IHWDO DQG HPEU\RQLF KHPRJORELQV DQG GLIIHUHQWLDWH LQWR HU\WKURF\WHOLNH FHOOV 5XWKHUIRUG HW DO f 6LQFH WKH WDUWUDWH UHVLVWDQW DFLG SKRVSKDWDVH LV H[SUHVVHG DW UHODWLYHO\ KLJK OHYHOV LQ FHOOV EXW LV QRW IRXQG LQ HU\WKURF\WHV WKH HIIHFW RI KHPLQ RQ WKH H[SUHVVLRQ RI WKH 7\SH DFLG SKRVSKDWDVH LQ FHOOV ZDV VWXGLHG 7KH HIIHFWV RI KHPLQ ZHUH GHWHUPLQHG DQG KRXUV DIWHU LWV DGGLWLRQ WR WKH PHGLXP 7KH FHOOV FKDQJHG GUDVWLFDOO\ LQ PRUSKRORJ\ HYHQ KRXUV DIWHU KHPLQ ZDV DGGHG FHOOV DUH QRUPDOO\ VSKHULFDO UHJXODU LQ VL]H DQG GR QRW DWWDFK WR WKH IODVN ,Q WKH SUHVHQFH RI KHPLQ WKH FHOOV WRRN RQ DQ LUUHJXODU DSSHDUDQFH DQG WKHUH ZDV VRPH DGKHUHQFH WR WKH IODVN :KLOH WKH YLDELOLW\ RI ORJ SKDVH FXOWXUHV RI FHOOV HYHQ LQ WKH SUHVHQFH RI 73$ ZDV DOZD\V JUHDWHU WKDQ b WKH YLDELOLW\ RI FHOOV LQ WKH SUHVHQFH RI KHPLQ ZDV FRQVLVWHQWO\ b +RZHYHU WKLV ORVV RI YLDELOLW\ LV XQOLNHO\ WR KDYH LQIOXHQFHG WKH UHVXOWV 6LJQLILFDQWO\ ERWK WKH WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH DFWLYLW\ 7DEOH f DQG WKH P51$ OHYHO IRU WKH HQ]\PH GDWD QRW VKRZQf GHFOLQHG KRXUV DIWHU WKH DGGLWLRQ RI KHPLQ 'LVFXVVLRQ 7KHUH PD\ EH VHYHUDO UHDVRQV ZK\ DQWLERGLHV UDLVHG DJDLQVW SRUFLQH XWHURIHUULQ UHFRJQL]H KXPDQ ILEURQHFWLQ +RZHYHU WKH SRVVLELOLW\ WKDW

PAGE 150

SRUFLQH ILEURQHFWLQ KDV FRQWDPLQDWHG XWHURIHUULQ SUHSDUDWLRQV FDQ EH UXOHG RXW )LEURQHFWLQ LV QRW D EDVLF SURWHLQ DQG LWV PROHFXODU ZHLJKW LV JUHDWHU WKDQ IHDWXUHV ZKLFK PDNH LW VHHP XQOLNHO\ WKDW ILEURQHFWLQ ZRXOG FRSXULI\ ZLWK XWHURIHUULQ $OVR ILEURQHFWLQ KDV QRW EHHQ LGHQWLILHG LQ WKH XWHULQH VHFUHWLRQV RI SLJV DW OHDVW LQ DQ\ DSSUHFLDEOH TXDQWLW\ 3HUKDSV WKH PRVW SHUVXDVLYH DUJXPHQW DJDLQVW ILEURQHFWLQ FRQWDPLQDWLRQ KRZHYHU LV WKH IDFW WKDW WZR RI WKH IRXU PRQRFORQDO DQWLERGLHV UDLVHG DJDLQVW WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVHV DOVR UHFRJQL]HG KXPDQ ILEURQHFWLQ ,QWHUHVWLQJO\ ZKHQ SRUFLQH XWHULQH HQGRPHWULXP OLEUDULHV ZHUH VFUHHQHG ZLWK DQWL XWHURIHUULQ DQWLERGLHV ILEURQHFWLQ FORQHV ZHUH QHYHU REWDLQHG ,Q FRQWUDVW DOO RI WKH SRVLWLYH FORQHV REWDLQHG E\ LPPXQRVFUHHQLQJ WKH KXPDQ SODFHQWD F'1$ OLEUDU\ FRGHG IRU ILEURQHFWLQ :KHQ WKH LQIHUUHG DPLQR DFLG VHTXHQFH RI ILEURQHFWLQ LV FRPSDUHG WR WKDW RI SRUFLQH XWHURIHUULQ WKHUH DUH QR REYLRXV VHTXHQFH VLPLODULWLHV RYHU ORQJ VWUHWFKHV RI DPLQR DFLGV 7KHUH DUH KRZHYHU VHYHUDO UHJLRQV RI IRXU WR VL[ DPLQR DFLGV ZKLFK DUH FRPPRQ WR ERWK XWHURIHUULQ DQG ILEURQHFWLQ ,W LV SRVVLEOH WKDW DV IHZ DV IRXU DPLQR DFLGV GHILQH D FRPPRQ HSLWRSH VHH $WDVVL f 7KHVH SRWHQWLDO HSLWRSHV DUH VKRZQ LQ 7DEOH ,W LV LQWHUHVWLQJ WR QRWH WKDW RI SRWHQWLDO HSLWRSHV RI WKHP DUH IRXQG LQ WKH DPLQR DFLG VHTXHQFH FRGHG E\ FORQH +3 DQG WKH UHPDLQLQJ HSLWRSHV DUH IRXQG LQ WKH DPLQR DFLGV QRW FRQWDLQHG LQ +3 7KH SRVVLELOLW\ WKDW WKHUH LV D VWUXFWXUDO IHDWXUH FRPPRQ WR ERWK XWHURIHUULQ DQG ILEURQHFWLQ QRW DSSDUHQW E\ FRPSDULVRQ RI SULPDU\ VHTXHQFHV ZDV H[DPLQHG 7KH GRPDLQV HQFRGHG E\ DPLQR DFLGV

PAGE 151

7$%/( 3RWHQWLDO HSLWRSHV FRPPRQ WR SRUFLQH XWHURIHUULQ DQG KXPDQ IOEURQHFWLQ $PLQR $FLG 5HVLGXH 1XPEHUV $PLQR $FLG 6HTXHQFH )LEURQHFWLQ 8WHURIHUULQ )LEURQHFWLQ 8WHURIHUULQ 95973.( YHLWSNH (,1/$ (51/$ /.'7/7 / '797 /(196 /*196 355$5 355$5 73,45 73,/5 /5)/$ /5)9$ )4'76( )4(7)( $9*' $9*' /*19 /*19 443:5 443(5 /*1*96&4 /*1 96$4 7$(/4* 7$
PAGE 152

DUH PDGH XS RI WZR W\SHV RI UHSHDWV IRXQG LQ ILEURQHFWLQ &ORQH +3 FRGHV IRU W\SH ,,, UHSHDWV DQG W\SH UHSHDWV 7KLV UHJLRQ RI WKH SURWHLQ LV NQRZQ WR FRQWDLQ WKH KHSDULQ ELQGLQJ GRPDLQ .RUQEOLKWW HW DO f 7KH SRVVLELOLW\ WKDW XWHURIHUULQ DOVR FRQWDLQ D KHSDULQ ELQGLQJ GRPDLQ ZDV FRQVLGHUHG 8WHURIHUULQ DSSHDUHG WR ELQG WR KHSDULQ DJDURVH LQ D ORZ VDOW EXIIHU 0 1D&Of EXW FRXOG EH HOXWHG ZLWK D EXIIHU FRQWDLQLQJ 0 1D&O 7UXH KHSDULQ ELQGLQJ SURWHLQV VXFK DV WKH KHSDULQELQGLQJ JURZWK IDFWRUV HOXWH RQO\ DW YHU\ KLJK VDOW FRQFHQWUDWLRQV WR 0 /REE HW DO f 7KHUHIRUH XWHURIHUULQ LV QRW D WUXH KHSDULQ ELQGLQJ SURWHLQ DQG LW LV QRW FOHDU ZK\ DQWLXWHURIHUULQ DQWLERGLHV ELQG WR KXPDQ ILEURQHFWLQ :KHQ F'1$ FORQHV FRGLQJ IRU SRUFLQH XWHURIHUULQ ZHUH HPSOR\HG WR VFUHHQ WKH VDPH KXPDQ SODFHQWD F'1$ OLEUDU\ WZR F'1$ FORQHV FRGLQJ IRU WKH KXPDQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH ZHUH REWDLQHG 2QH RI WKHVH FORQHV D DSSHDUV WR EH HVVHQWLDOO\ IXOO OHQJWK ([DPLQDWLRQ RI WKH nHQG RI WKH VHTXHQFH RI D UHYHDOV WZR SRWHQWLDO WUDQVODWLRQ LQLWLDWLRQ VLWHV )LJ f 7KH ILUVW VLWH HQFRXQWHUHG DW QXFOHRWLGHV LV 7**$7** 7KLV VLWH ZLWK WKH SUHIHUUHG DW SRVLWLRQ LV DQ LQLWLDWLRQ VLWH RI PRGHUDWH VWUHQJWK .R]DN f 7KH VHFRQG VLWH DW QXFOHRWLGHV LV *$&$7*7 7KLV VLWH KDV WKH SUHIHUUHG SXULQH DW SRVLWLRQ DQG LV DOVR DQ LQLWLDWLRQ VLWH RI PRGHUDWH VWUHQJWK .R]DN f 0RVW OLNHO\ ERWK VLWHV DUH HPSOR\HG LW FDQQRW EH DVVXPHG WKDW LQLWLDWLRQ RI WUDQVODWLRQ RFFXUV H[FOXVLYHO\ DW WKH ILUVW $7* HQFRXQWHUHG 0 .R]DN SHUVRQDO FRPPXQLFDWLRQf 7KH ILUVW DPLQR DFLG RI WKH PDWXUH SURWHLQ LV DVVLJQHG DV WKH DVSDUWDWH UHVLGXH FRGHG E\ QXFOHRWLGHV DV SUHGLFWHG E\ 9RQ

PAGE 153

+HLMQH DQDO\VLV f 7KH UHVLGXH LQ SRVLWLRQ UHODWLYH WR DVSDUWDWH f LV WKH SUHIHUUHG DODQLQH DQG WKH VHULQH DW SRVLWLRQ LV WKH SUHIHUUHG VPDOO QHXWUDO DPLQR DFLG &OHDYDJH DW WKLV SUHGLFWHG SRLQW PDUNHG E\ DQ DUURZ LQ )LJ f ZRXOG LQIHU D VLJQDO VHTXHQFH RI DPLQR DFLGV GHSHQGLQJ DQ ZKLFK LQLWLDWLRQ FRGRQ ZDV HPSOR\HG (XNDU\RWLF VLJQDO VHTXHQFHV W\SLFDOO\ UDQJH IURP UHVLGXHV ZLWK DPLQR DFLGV WKH DYHUDJH OHQJWK 9RQ +HLMQH f &OHDYDJH EHIRUH DVSDUWDWH ZRXOG DOVR SURGXFH D PDWXUH SURWHLQ LQ FORVHVW DJUHHPHQW ZLWK WKH DPLQR DFLG VHTXHQFHV RI SRUFLQH XWHURIHUULQ DQG WKH ERYLQH VSOHHQ HQ]\PH )LJ f 6LQFH WKH 1WHUPLQDO VHTXHQFH RI WKH KXPDQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH KDV QRW EHHQ GHWHUPLQHG WKLV DVVLJQPHQW LV WHQWDWLYH 7KH PDWXUH KXPDQ 7\SH WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH PRVW OLNHO\ FRQVLVWV RI DPLQR DFLGV ZLWK DQ XQJO\FRV\ODWHG UHODWLYH PROHFXODU PDVV RI 7KLV UHODWLYH PROHFXODU PDVV LV LQ JRRG DJUHHPHQW ZLWK WKH DSSDUHQW 0U RI IRU WKH PDWXUH SURWHLQ DV GHWHUPLQHG E\ 6'63$*( &KDSWHU f 7KH DSSDUHQW PROHFXODU ZHLJKW RI XQJO\FRV\ODWHG XWHURIHUULQ LV DV PHDVXUHG E\ 6'63$*( %DXPEDFK HW DO f 7KH KXPDQ HQ]\PH FRQWDLQV WZR SRWHQWLDO DWWDFKPHQW VLWHV IRU 1 OLQNHG ROLJRVDFFKDULGHV ER[HG LQ )LJ f %RWK RI WKHVH VLWHV DUH FRQVHUYHG LQ SRUFLQH XWHURIHUULQ EXW RQO\ RQH RI WKHP LV IRXQG LQ WKH ERYLQH VSOHHQ HQ]\PH )LJ f (DFK RI WKHVH HQ]\PHV LV NQRZQ WR EH JO\FRV\ODWHG VHH &KDSWHUV DQG f 7KH JO\FRV\ODWLRQ VLWH DW $VQ RI XWHURIHUULQ LV NQRZQ WR EH XVHG LQ WKH 0U IRUP RI WKH HQ]\PH SXULILHG IURP DOODQWRLF IOXLG DQG

PAGE 154

XWHULQH IOXVKHV +XQW HW DO f 7KH VHFRQG VLWH DW $VQ PD\ EH HPSOR\HG LQ DQ 0U IRUP RI XWHURIHUULQ ZKLFK FDQ EH SXULILHG IURP XWHULQH H[SODQW FXOWXUHV DQG LV IRXQG LQ WKH SLQN KLJK PROHFXODU ZHLJKW XWHURIHUULQ KHWHURGLPHU %DXPEDFK HW DO %DXPEDFK HW DO PDQXVFULSW LQ SUHSDUDWLRQf 7KH H[WHQW RI JO\FRV\ODWLRQ RI WKH KXPDQ HQ]\PH KDV QRW EHHQ GHWHUPLQHG EXW WKH HQ]\PH LV NQRZQ WR EH D JO\FRSURWHLQ &KDSWHU f 7KH WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVHV DUH NQRZQ WR FRQWDLQ WZR DV\PPHWULFDO LURQ ELQGLQJ VLWHV VHH &KDSWHUV DQG f ,W KDV EHHQ SURSRVHG WKDW WKH LURQ DWRPV LQ WKHVH HQ]\PHV DUH FRRUGLQDWHG WR W\URVLQH DQG KLVWLGLQH UHVLGXHV *DEHU HW DO /DXIIHU HW DO f ,QWHUQDO UHSHDWV FRQWDLQLQJ KLVWLGLQH DQG W\URVLQH UHVLGXHV LQ LGHQWLFDO VSDFLDO DUUDQJHPHQWV DUH QRW SUHVHQW LQ DQ\ RI WKHVH SKRVSKDWDVHV ZKLFK LV FRQVLVWHQW ZLWK QRQLGHQWLFDO HQYLURQPHQWV IRU WKH LURQ DWRPV +XQW HW DO f 7KH UHVLGXHV WKDW DUH OLJDQGV IRU WKH LURQ DWRPV FDQQRW EH DVVLJQHG DW WKLV WLPH VLQFH WKH SULPDU\ VHTXHQFHV RI WKHVH LURQFRQWDLQLQJ DFLG SKRVSKDWDVHV FRQWDLQ VHYHUDO FRQVHUYHG KLVWLGLQH DQG W\URVLQH UHVLGXHV ,Q RUGHU WR VWXG\ WKH GLVWULEXWLRQ RI WKH KXPDQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH 1RUWKHUQ DQDO\VLV ZDV SHUIRUPHG RQ WKUHH KXPDQ OHXNRF\WH FHOO OLQHV $ NE WUDQVFULSW FRGLQJ IRU WKLV HQ]\PH ZDV GHWHFWHG LQ WKH KXPDQ HU\WKUROHXNHPLD OLQH DQG LQ WKH KXPDQ %FHOO OLQH =5 7KLV WUDQVFULSW ZDV QRW DSSDUHQW LQ WKH KXPDQ 7FHOO OLQH -85.$7 7KHVH UHVXOWV DUH LQ JRRG DJUHHPHQW ZLWK WKH ZRUN RI 'UH[OHU HW DO DEf ZKR VWXGLHG OHYHOV RI WDUWUDWH UHVLVWDQW DFLG SKRVSKDWDVH LQ D ZLGH YDULHW\ RI OHXNHPLD FHOO OLQHV E\

PAGE 155

PHDQV RI LVRHOHFWULF IRFXVLQJ 7KH\ GHWHUPLQHG WKDW WKH WDUWUDWH UHVLVWDQW DFLG SKRVSKDWDVH LV JHQHUDOO\ H[SUHVVHG RQO\ LQ FHOOV DUUHVWHG ODWH LQ GLIIHUHQWLDWLRQ 7KHVH UHVHDUFKHUV GHWHFWHG PRGHUDWHO\ KLJK OHYHOV RI WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH LQ FHOOV EXW WKH HQ]\PH ZDV QRW GHWHFWDEOH LQ -85.$7 FHOOV 'UH[OHU HW DO GLG QRW VWXG\ WKH %FHOO OLQH =5 EXW VLQFH LW UHSUHVHQWV D %FHOO LQ WKH ODWHU VWDJHV RI GLIIHUHQWLDWLRQ / 6PLWK SHUVRQDO FRPPXQLFDWLRQf LW ZDV H[SHFWHG WKDW WKH FHOOV ZRXOG SURGXFH WKH HQ]\PH 2I ILYH (%9 WUDQVIRUPHG ODWH %FHOO OLQHV VWXGLHG WKH JHQHURXV JLIW RI 'U /LQGD 6PLWKf WKUHH SURGXFHG KLJK OHYHOV RI WKH WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH GDWD QRW VKRZQf 7KHVH UHVXOWV DUH DOVR LQ DJUHHPHQW ZLWK WKH ZRUN RI 'UH[OHU HW DO f 7KH WXPRUSURPRWLQJ SKRUERO HVWHU 73$ FDXVHV SHUPDQHQWO\ HVWDEOLVKHG OHXNHPLD FHOO OLQHV WR GLIIHUHQWLDWH WR PRUH PDWXUH VWDJHV .LVV HW DO *D]LWW HW DO 7KHLO HW DO .RHIIOHU HW DO f 7KH LQ YLWUR DQG LQ YLYR HIIHFWV RI 73$ DUH PRVW SUREDEO\ PHGLDWHG WKURXJK WKH DFWLYDWLRQ RI SURWHLQ NLQDVH & DQG VXEVHTXHQW SKRVSKRU\ODWLRQ RI FHOOXODU SURWHLQV IRU D UHYLHZ VHH 1LVKL]XND f ,I H[SUHVVLRQ RI WKH WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH LV LQGHHG D GLIIHUHQWLDWLRQUHODWHG HYHQW LWV H[SUHVVLRQ PD\ EH XQGHU WKH FRQWURO RI 73$ DQG SURWHLQ NLQDVH & 7KH HIIHFW RI nb 73$ RQ DFLG SKRVSKDWDVH OHYHOV LQ FHOOV ZDV VWXGLHG FHOOV XQOLNH WKH FORVHO\ UHODWHG .* FHOOV GR QRW WHUPLQDOO\ GLIIHUHQWLDWH LQWR PDFURSKDJHOLNH FHOOV LQ WKH SUHVHQFH RI 73$ .RHIIOHU HW DO f ,QVWHDG WKH\ SDUWLDOO\ GLIIHUHQWLDWH LQWR PHJDNDU\REODVWRLG FHOOV $OLWDOR HW DO f 'UH[OHU HW DO f

PAGE 156

KDYH GHPRQVWUDWHG TXDOLWDWLYHO\ WKDW FHOOV VKRZ D VLJQLILFDQW LQFUHDVH LQ WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH DFWLYLW\ DV GHWHUPLQHG E\ LVRHOHFWULF IRFXVLQJf ZKHQ WUHDWHG ZLWK 73$ IRU KRXUV 7KXV 73$ PD\ LQGXFH GLIIHUHQWLDWLRQ WR D VWDJH RU DFWLYDWLRQ WR D FHUWDLQ VWDWXV ZKHUH DFLG SKRVSKDWDVH OHYHOV DUH HOHYDWHG ,W KDV EHHQ GHPRQVWUDWHG LQ WKLV FKDSWHU WKDW 73$ FDXVHV D PDUNHG LQFUHDVH LQ WKH TXDQWLW\ RI WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH LQ FHOOV ERWK DW WKH 51$ DQG SURWHLQ OHYHOV DOWKRXJK WKH HIIHFW LV VORZ DQG SRVVLEO\ LQGLUHFW ,QWHUHVWLQJO\ *D]LWW DQG 3ROOLDFN f KDYH GHPRQVWUDWHG WKDW D QXPEHU RI OHXNHPLD FHOO OLQHV ZKLFK ZHUH VHQVLWLYH WR WKH GLIIHUHQWLDWLQJ HIIHFW RI 73$ FRXOG EH LQGXFHG WR GLIIHUHQWLDWH WHUPLQDOO\ LQWR FHOOV UHPLQLVFHQW RI KDLU\ FHOOV 7KH\ SURSRVHG WKDW KDLU\ FHOOV ZKLFK DUH NQRZQ WR FRQWDLQ H[WUHPHO\ KLJK OHYHOV RI WKH WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVHf UHSUHVHQW WKH WHUPLQDOO\ GLIIHUHQWLDWHG %FHOO /HXNHPLD FDQ EH WKRXJKW RI DV D GLVRUGHU RI GLIIHUHQWLDWLRQ ,I WKH WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH LV WUXO\ D PDUNHU RI %FHOO GLIIHUHQWLDWLRQ WKH VWXG\ RI WKLV HQ]\PHnV IXQFWLRQ DQG UHJXODWLRQ PD\ QRW RQO\ HQKDQFH RXU XQGHUVWDQGLQJ RI QRUPDO %FHOO GLIIHUHQWLDWLRQ LW PD\ DOVR KHOS WR HOXFLGDWH WKH UHODWLRQVKLSV EHWZHHQ WKH YDULRXV OHXNHPLDV

PAGE 157

&+$37(5 &21&/86,216 $1' )8785( ',5(&7,216 7KH H[SHULPHQWV GLVFXVVHG LQ &KDSWHUV DQG FOHDUO\ GHPRQVWUDWH WKDW WKH KXPDQ 7\SH WDUWUDWHUHVLVWDQW DFLG SKRVSKDWDVH 75$3f EHORQJV WR WKH IDPLO\ RI SXUSOH LURQFRQWDLQLQJ DFLG SKRVSKDWDVHV EHVW FKDUDFWHUL]HG E\ SRUFLQH XWHURIHUULQ ,Q &KDSWHU D UHODWLYHO\ VLPSOH SURWRFRO ZDV GHVFULEHG IRU WKH SXULILFDWLRQ RI WKH KXPDQ HQ]\PH 7KLV SURWRFRO EDVHG RQ WKH PHWKRG HVWDEOLVKHG IRU WKH SXULILFDWLRQ SRUFLQH XWHURIHUULQ &KHQ HW DO f ZDV DOVR XVHG WR SXULI\ UHODWHG HQ]\PHV IURP D YDULHW\ RI RWKHU VRXUFHV ,W ZRXOG EH LQWHUHVWLQJ WR GHWHUPLQH ZKHWKHU WKH SXUSOH PDQJDQHVHFRQWDLQLQJ DFLG SKRVSKDWDVHV RI SODQWV FRXOG EH SXULILHG E\ WKLV PHWKRG 0XFK RI WKH FRQIXVLRQ DERXW WKH SURSHUWLHV RI WKH KXPDQ 75$3 GLVFXVVHG LQ &KDSWHU f KDV EHHQ UHVROYHG E\ WKH H[SHULPHQWV LQ &KDSWHUV DQG 7KH GLVFUHSDQFLHV DERXW WKH DFWLYDWLRQ RI WKH HQ]\PH ZLWK PHUFDSWRHWKDQRO DQG DERXW WKH DSSDUHQW PROHFXODU ZHLJKW ZHUH DGHTXDWHO\ H[SODLQHG LQ &KDSWHU $SSDUHQWO\ XWHURIHUULQ DQG WKH RWKHU 75$3V H[LVW DV HTXLOLEULXP PL[WXUHV RI DFWLYH UHGXFHGf DQG LQDFWLYH R[LGL]HGf IRUPV DQG WKLV HTXLOLEULXP GHSHQGV RQ WKH UHGR[ VWDWH RI WKH IOXLG HQYLURQPHQW LQ ZKLFK WKH HQ]\PHV DUH IRXQG ,I WKLV LV WKH FDVH LW LV QRW VXUSULVLQJ WKDW WKH H[WHQW RI DFWLYDWLRQ RI WKH 75$3 HQ]\PHV YDULHG VR PXFK EHWZHHQ SUHSDUDWLRQV DQG WKURXJKRXW WKH SXULILFDWLRQ SURFHVV ,W LV LQWHUHVWLQJ WR QRWH WKDW ZKLOH D VWDEOH SLQN KLJK PROHFXODU ZHLJKW IXOO\ DFWLYH IRUP RI XWHURIHUULQ H[LVWV

PAGE 158

WKHUH LV QR HYLGHQFH RI KLJK PROHFXODU ZHLJKW IXOO\ DFWLYH 75$3 HQ]\PHV IURP RWKHU VRXUFHV VXFK DV UDW KXPDQ RU ERYLQH VSOHHQ 7KH FRQWURYHUV\ RYHU WKH HQ]\PHVn DSSDUHQW VXEXQLWV IRXQG RQO\ LQ VRPH FDVHVf FDQ EH DWWULEXWHG WR SURWHRO\WLF GHJUDGDWLRQ VLQFH ERWK XWHURIHUULQ DQG WKH EHHI VSOHHQ HQ]\PHV DUH VLQJOH SRO\SHSWLGH FKDLQV +XQW HW DO f DQG WKH KXPDQ HQ]\PH LV FRGHG IRU E\ D VLQJOH P51$ VSHFLHV &KDSWHU f 8QIRUWXQDWHO\ WKH GLIIHUHQFHV LQ VXEVWUDWH VSHFLILFLWLHV EHWZHHQ WKH *DXFKHUnV VSOHHQ HQ]\PH 5RELQVRQ DQG *OHZ f DQG WKH KDLU\ FHOO VSOHHQ HQ]\PH FDQQRW EH H[SODLQHG 7KH SRVVLELOLW\ WKDW WKHUH DUH WZR RU PRUH JHQHV FRGLQJ IRU GLVWLQFW 75$3V LQ WKH KXPDQ FDQQRW EH UXOHG RXW DOWKRXJK FKURPRVRPDO ORFDOL]DWLRQ VWXGLHV FDUULHG RXW E\ PHDQV RI LQ VLWX K\EULGL]DWLRQ UHYHDOHG WKDW WKH F'1$ FRGLQJ IRU WKH KXPDQ SODFHQWD HQ]\PH K\EULGL]HG RQO\ WR WKH ORQJ DUP RI FKURPRVRPH % $OOHQ & .HWFKDP + 1LFN XQSXEOLVKHG UHVXOWVf 7KH KXPDQ ERQH RVWHRFODVWf 75$3 KDV EHHQ SXULILHG E\ RXU ODERUDWRU\ 6 $OOHQ HW DO LQ SUHVVf DQG ZKHQ 1WHUPLQDO DPLQR DFLG VHTXHQFH LV DYDLODEOH ZH ZLOO NQRZ ZKHWKHU WKH ERQH HQ]\PH LV LGHQWLFDO WR WKH SODFHQWD HQ]\PH GHVFULEHG LQ &KDSWHU ,Q &KDSWHU WKH SURGXFWLRQ RI PRQRFORQDO DQWLERGLHV DJDLQVW ERWK XWHURIHUULQ DQG WKH KXPDQ HQ]\PH ZDV GHVFULEHG ,W ZDV GHPRQVWUDWHG WKDW WKHVH DQWLERGLHV FURVVUHDFWHG ZLWK D ZLGH YDULHW\ RI SXUSOH LURQ FRQWDLQLQJ SKRVSKDWDVHV )XUWKHUPRUH WKH IRXU DQWLERGLHV VWXGLHG LQ GHWDLO GLG QRW FRPSHWH ZLWK HDFK RWKHU IRU ELQGLQJ WR SRUFLQH XWHURIHUULQ D UHVXOW ZKLFK LQGLFDWHG WKDW HDFK RQH UHFRJQL]HG D GLIIHUHQW HSLWRSH ,W LV SUREDEOH WKDW IRXU XQLTXH DQWLERG\ ELQGLQJ VLWHV GR QRW UHSUHVHQW WKH HQWLUH LPPXQRJHQLF UHSHUWRLUH RI WKH QDWLYH

PAGE 159

XWHURIHUULQ PROHFXOH 0RVW OLNHO\ D PRXVH ZRXOG QRW SURGXFH DQ DQWLERG\ DJDLQVW D GRPDLQ WKDW LWV RZQ 75$3 SRVVHVVHV DOWKRXJK RQH PRQRFORQDO DQWLERG\ VHHPHG WR UHFRJQL]H D FRQVHUYHG HSLWRSH IRXQG RQ WKH 75$3 LVR]\PH VHH &KDSWHU f )URP SUHYLRXV H[SHULHQFH ZLWK D ZLGH YDULHW\ RI SURWHLQV $WDVVL f SURSRVHG WKDW D PD[LPXP RI RQH LPPXQRJHQLF GRPDLQ H[LVWV SHU DPLQR DFLGV DERXW GDOWRQVf 7KHUHIRUH XWHURIHUULQ D DPLQR DFLG SURWHLQ ZLWK DQ XQJO\FRV\ODWHG DSSDUHQW PROHFXODU ZHLJKW RI FRXOG FRQWDLQ VL[ RU VHYHQ PDMRU LPPXQRJHQLF GRPDLQV 2QH VHW RI FRPSHWLQJ PRQRFORQDO DQWLERGLHV UHSUHVHQWHG E\ DQG UHFRJQL]HG DQ HSLWRSH WKDW PD\ EH QHDU WKH DFWLYH VLWH VLQFH ELQGLQJ RI WKH PRQRFORQDO DQWLERG\ LQKLELWHG XWHURIHUULQnV HQ]\PDWLF DFWLYLW\ 3HUKDSV WKLV DQWLERG\ FRXOG EH XVHIXO LQ WKH LGHQWLILFDWLRQ RI WKH SHSWLGH VHTXHQFHV DURXQG WKH DFWLYH VLWH :KLOH LW LV EHOLHYHG WKDW WKH LURQ DWRPV PD\ EH LQYROYHG LQ VXEVWUDWH ELQGLQJ DQG WKDW D SKRVSKRU\OHQ]\PH LQWHUPHGLDWH PD\ H[LVW VHH &KDSWHU f WKH DPLQR DFLG UHVLGXHV WKDW PDNH XS WKH DFWLYH VLWH DUH XQNQRZQ 7KH PRQRFORQDO DQG SRO\FORQDO DQWLERGLHV UDLVHG DJDLQVW XWHURIHUULQ ZHUH HPSOR\HG IRU WKH LPPXQRF\WRFKHPLFDO ORFDOL]DWLRQ RI WKH KXPDQ HQ]\PH LQ SODFHQWD ERQH WXPRUV DQG ZKLWH FHOOV IURP SDWLHQWV ZLWK YDULRXV W\SHV RI OHXNHPLD :KLOH RXU ODERUDWRU\ KDG EHHQ VXFFHVVIXO LQ ORFDOL]LQJ XWHURIHUULQ WR WKH JODQGXODU HSLWKHOLXP LQ WKH SRUFLQH XWHUXV )D]OHDEDV HW DO f ZH ZHUH XQDEOH WR ORFDOL]H WKH KXPDQ HQ]\PH & .HWFKDP 0. 0XUUD\ 7 5DXE 50 5REHUWV XQSXEOLVKHG UHVXOWVf :H FRQVLVWHQWO\ GHWHFWHG YHU\ OLWWOH LPPXQRUHDFWLYH SURWHLQ LQ WKH KXPDQ

PAGE 160

WLVVXHV DQG VWDLQLQJ RIWHQ DSSHDUHG QRQVSHFLILF RU GLIIXVH $W OHDVW SDUW RI WKH SUREOHP PD\ LQYROYH WKH IDFW WKDW WKH SRO\FORQDO DQWLERGLHV DQG VRPH RI WKH PRQRFORQDO DQWLERGLHV FURVVUHDFW ZLWK KXPDQ ILEURQHFWLQ 7KH ODFN RI VXFFHVV PD\ DOVR EH DWWULEXWHG WR WKH IDFW WKDW WKH DQWLERGLHV KDYH D PXFK ORZHU DIILQLW\ IRU WKH KXPDQ HQ]\PH WKDQ IRU XWHURIHUULQ $QWLERGLHV DJDLQVW WKH 75$3V PD\ EH XVHIXO IRU D QXPEHU RI FOLQLFDOO\ UHODWHG SURMHFWV )RU H[DPSOH WKH LPPXQRF\WRFKHPLFDO LGHQWLILFDWLRQ RI KDLU\ FHOOV ZLWK D SRO\FORQDO DQWLERG\ UDLVHG DJDLQVW WKH KXPDQ HQ]\PH PD\ EH PRUH VSHFLILF DQG PRUH VHQVLWLYH WKDQ WKH KLVWRF\WRFKHPLFDO PHWKRGV QRZ XVHG 7KH DQWLERGLHV PD\ DOVR EH YDOXDEOH GLDJQRVWLFDOO\ LQ WKH PHDVXUHPHQW RI WKH OHYHOV RI WKH 75$3 LVR]\PH LQ SODVPD E\ LPPXQRDVVD\ (FKHWHEX HW DO f KDYH GHPRQVWUDWHG WKDW DQWLXWHURIHUULQ DQWLERGLHV FDQ EH HPSOR\HG IRU WKH PHDVXUHPHQW RI 75$3 OHYHOV LQ WKH VHUD RI SDWLHQWV ZLWK 3DJHWnV GLVHDVH DQG RVWHRSRURVLV 7KHVH UHVHDUFKHUV ZHUH DOVR DEOH WR GHWHFW WKH HQ]\PH LQ KXPDQ OXQJ DQG *DXFKHUnV VSOHHQ KRPRJHQDWHV EXW WKH\ FRXOG QRW GHWHFW WKH HQ]\PH LQ SODFHQWD KRPRJHQDWHf 6XVDQ $OOHQ LQ FROODERUDWLRQ ZLWK 50 5REHUWV KDV UDLVHG D PRQRVSHFLILF SRO\FORQDO DQWLERG\ DJDLQVW WKH KXPDQ HQ]\PH DQG SODQV WR GHYHORS D VHQVLWLYH LPPXQRDVVD\ IRU WKH GHWHFWLRQ RI 75$3 LQ WKH VHUD RI SDWLHQWV ZLWK RVWHRSRURVLV 7KH PRQRFORQDO DQWLERGLHV ZHUH DOVR WHVWHG DV SRWHQWLDO LQKLELWRUV RI WKH SKRVSKRWUDQVIHUDVH GLVFXVVHG LQ &KDSWHU f ZKLFK WUDQVIHUV *OF1$F SKRVSKDWH WR FHUWDLQ PDQQRVH UHVLGXHV RI O\VRVRPDO HQ]\PHV 8QIRUWXQDWHO\ QRQH RI WKH PRQRFORQDO DQWLERGLHV ZKHQ ERXQG WR XWHURIHUULQ ZHUH DEOH WR LQKLELW WKH SKRVSKRU\ODWLRQ RI XWHURIHUULQnV

PAGE 161

KLJK PDQQRVH ROLJRVDFFKDULGH FKDLQ / /DQJ 50 5REHUWV DQG 6 .RUQIHOG XQSXEOLVKHG UHVXOWVf 7KH UHJLRQ RI XWHURIHUULQ RU DQ\ O\VRVRPDO HQ]\PHf ZKLFK LV UHFRJQL]HG E\ WKH SKRVSKRWUDQVIHUDVH LV VWLOO XQNQRZQ ,GHQWLILFDWLRQ RI WKLV UHJLRQ ZLOO EH D PDMRU FRQWULEXWLRQ WR WKH ILHOG RI O\VRVRPDO HQ]\PH WUDIILFNLQJ 'HVSLWH WKH IDLOXUH RI WKH PRQRFORQDO DQWLERGLHV WR LGHQWLI\ WKH UHJLRQ RI XWHURIHUULQ UHFRJQL]HG E\ WKH SKRVSKRWUDQVIHUDVH WKH 75$3V PD\ VWLOO EH XVHIXO IRU WKH VWXG\ RI WKH WUDIILFNLQJ RI O\VRVRPDO HQ]\PHV 7KH O\VRVRPDO ERYLQH VSOHHQ HQ]\PH LV YHU\ VLPLODU LQ VHTXHQFH WR WKH VHFUHWHG SRUFLQH XWHULQH HQ]\PH +XQW HW DO DQG &KDSWHU f 7KH PRVW GLVVLPLODULW\ LV QRWHG DURXQG WKH 1WHUPLQDO UHJLRQ DQG WKH VHFRQG JO\FRV\ODWLRQ VLWH ,W ZRXOG EH LQWHUHVWLQJ WR FRPSDUH WKH VHTXHQFHV RI F'1$V FRGLQJ IRU WKH O\VRVRPDO YHUVXV VHFUHWHG IRUPV RI WKH 75$3 HQ]\PH LQ D VLQJOH VSHFLHV WKH FRZ RU WKH SLJ VHH &KDSWHU f 3HUKDSV WKH SULPDU\ VHTXHQFHV RI WKH VHFUHWHG HQ]\PHV FRQWDLQ WDUJHWLQJ LQIRUPDWLRQ ZKLFK GLUHFWV WKHP WR VHFUHWRU\ JUDQXOHV GHVSLWH WKH IDFW WKDW WKH SKRVSKRWUDQVIHUDVH UHFRJQL]HV WKHP DV O\VRVRPDO HQ]\PHV WKXV SKRVSKRU\ODWLQJ WKHLU KLJK PDQQRVH ROLJRVDFFKDULGHV 7KH WDUJHWLQJ RI ERWK VHFUHWHG DQG O\VRVRPDO IRUPV RI 75$3 FDQ EH VWXGLHG E\ WUDQVIHFWLRQ RI WKHLU UHVSHFWLYH F'1$V LQWR PDPPDOLDQ FHOO OLQHV 6LWH GLUHFWHG PXWDJHQHVLV FDQ WKHQ EH HPSOR\HG LQ DQ HIIRUW WR UHGLUHFW WKH HQ]\PHV WKXV UHYHDOLQJ WKH VLJQDOV QHFHVVDU\ IRU GLIIHUHQWLDO WDUJHWLQJ $Q LPSRUWDQW WRSLF ZKLFK KDV QRW \HW EHHQ DGGUHVVHG H[SHULPHQWDOO\ LV WKH IXQFWLRQ RI WKH KXPDQ 75$3 7KH SHUVXDVLYH HYLGHQFH WKDW XWHURIHUULQ IXQFWLRQV LQ LURQ PHWDEROLVP ZDV SUHVHQWHG LQ &KDSWHU

PAGE 162

$OWKRXJK RWKHU IXQFWLRQV KDYH EHHQ SURSRVHG IRU RWKHU 75$3V DV D JHQHUDO SKRVSKRSURWHLQ SKRVSKDWDVH 'DYLV HW DO f DV D VSHFLILF SKRVSKRW\URV\O SKRVSKDWDVH /DX HW DO f RU LQ QXFOHRWLGH PHWDEROLVP +DUD HW DO f WKHUH LV OLWWOH HYLGHQFH WR VXSSRUW WKHVH WKHRULHV 6LQFH LW LV EHOLHYHG WKDW XWHURIHUULQ PD\ IXQFWLRQ LQ LURQ PHWDEROLVP 6KLQGHOPHLVHU HW DO f FRQVLGHUHG WKH SRVVLELOLW\ WKDW WKH ERYLQH VSOHHQ HQ]\PH PLJKW EH LQYROYHG LQ LURQ PHWDEROLVP DV ZHOO 0D\EH WKH KXPDQ 75$3 LV DOVR LQYROYHG LQ LURQ PHWDEROLVP 6RPH SUHOLPLQDU\ H[SHULPHQWV FRXOG EH GRQH WR GHWHUPLQH ZKHWKHU RU QRW WKLV LV WKH FDVH 7KH LGHDO FHOO OLQH IRU WKHVH VWXGLHV ZRXOG EH WKH KXPDQ HU\WKUROHXNHPLD FHOOV ,URQ PHWDEROLVP KDV EHHQ VWXGLHG WR VRPH H[WHQW LQ WKHVH FHOOV 7KH\ DUH NQRZQ WR V\QWKHVL]H ERWK IHUULWLQ %RWWRPOH\ HW DO f DQG KHPRJORELQ 5XWKHUIRUG HW DO f DQG WKH\ H[SUHVV WUDQVIHUULQ UHFHSWRUV 9DQ 5HQVRXQGH HW DO f $V VKRZQ LQ &KDSWHU WKHVH FHOOV DOVR H[SUHVV FRQVLGHUDEOH DPRXQWV RI 75$3 %RWWRPOH\ HW DO f KDYH GHPRQVWUDWHG WKDW ZKHQ FHOOV ZHUH LQFXEDWHG ZLWK >A)H@ WUDQVIHUULQ XS WR b RI WKH ODEHO FRXOG QRW EH DFFRXQWHG IRU LQ KHPRJORELQ IHUULWLQ RU WUDQVIHUULQ )XUWKHUPRUH WKH >A)H@ IURP WUDQVIHUULQ DSSHDUHG LQ IHUULWLQ DW D YHU\ VORZ UDWH LQGLFDWLQJ WKDW WKH LURQ WDNHQ XS PD\ KDYH SDVVHG WKURXJK RQH RU PRUH LQWHUPHGLDWHV 3HUKDSV 75$3 LV RQH RI WKHVH LQWHUPHGLDWHV ,W LV ZLGHO\ EHOLHYHG WKDW LURQ SOD\V D FULWLFDO UROH LQ FHOOXODU GLIIHUHQWLDWLRQ FHOO JURZWK DQG PDOLJQDQW WUDQVIRUPDWLRQ VHH *DPEDUL HW DO 3HWUDNL HW DO f ,Q FHOOV GLIIHUHQWLDWLQJ DJHQWV FDXVHG D ORVV RI WUDQVIHUULQ UHFHSWRUV IURP WKH FHOO VXUIDFH

PAGE 163

3HWUDNL HW DO f DQG DQ LQFUHDVH LQ LURQ VWRUHV LQ IHUULWLQ 0DWWLD HW DO f 7KH WKHRU\ WKDW 75$3 LV D PDUNHU RI O\PSKRF\WH GLIIHUHQWLDWLRQ ZDV GLVFXVVHG LQ &KDSWHU ,W ZRXOG EH LQWHUHVWLQJ WR VWXG\ WKH HIIHFWV RI SHUWXUEDQWV RI LURQ PHWDEROLVP VXFK DV FKHODWRUVf DQG GLIIHUHQWLDWLQJ DJHQWV RQ 75$3 OHYHOV WR GHWHUPLQH ZKHWKHU WKHUH LV DQ\ FRQQHFWLRQ EHWZHHQ 75$3 OHYHOV LURQ PHWDEROLVP DQG WKH GLIIHUHQWLDWHG VWDWH RI WKH FHOOV ,Q FRQFOXVLRQ WKHUH LV OLWWOH GRXEW WKDW XWHURIHUULQ DQG WKH RWKHU 75$3V ZLOO FRQWLQXH WR EH RI LQWHUHVW WR D ZLGH YDULHW\ RI UHVHDUFKHUV 7KH XQXVXDO VSHFWUDO SURSHUWLHV RI WKHVH SURWHLQV DUH FXUUHQWO\ EHLQJ VWXGLHG E\ SK\VLFDO ELRFKHPLVWV LQWHUHVWHG LQ PHWDOORSURWHLQ VWUXFWXUH 7KH SRVVLEOH UROH RI 75$3V LQ LURQ PHWDEROLVP LV SUHVHQWO\ EHLQJ LQYHVWLJDWHG E\ DW OHDVW WZR JURXSV RI SK\VLRORJLVWV 2WKHU FOLQLFDOO\ RULHQWHG ODERUDWRULHV DUH LQWHUHVWHG LQ WKH VLJQLILFDQFH RI 75$3 OHYHOV LQ RVWHRSRURVLV DQG RWKHU ERQH GLVRUGHUV &HOO ELRORJLVWV ZLOO EH LQWHUHVWHG LQ WKH GLIIHUHQWLDO WDUJHWLQJ RI WKH O\VRVRPDO YHUVXV VHFUHWHG 75$3V 7KH UHJXODWLRQ RI XWHURIHUULQnV ELRV\QWKHVLV E\ VWHURLG KRUPRQHV LV EHLQJ VWXGLHG E\ UHSURGXFWLYH ELRORJLVWV DQG PROHFXODU ELRORJLVWV ,W LV WKHUHIRUH OLNHO\ WKDW WKH F'1$ FRGLQJ IRU WKH KXPDQ 75$3 ZLOO EH XVHIXO IRU IXWXUH VWXGLHV LQYROYLQJ WKH GLVWULEXWLRQ IXQFWLRQ DQG UHJXODWLRQ RI WKH YDULRXV 75$3 HQ]\PHV

PAGE 164

5()(5(1&(6 $GDPV ./ %D]HU ): DQG 5REHUWV 50 f 3URJHVWHURQH LQGXFHG 6HFUHWLRQ RI D 5HWLQRO%LQGLQJ 3URWHLQ LQ WKH 3LJ 8WHUXV 5HSURG )HUW $OLWDOR 5 0DNHOD 73 .RVNLQHQ 3 $QGHUVRQ /& DQG $OLWDOR f (QKDQFHG ([SUHVVLRQ RI 7UDQVIRUPLQJ *URZWK )DFWRU % 'XULQJ 0HJDNDU\REODVWLF 'LIIHUHQWLDWLRQ RI /HXNHPLD &HOOV %ORRG f $OOHQ 6+ 1XWWOHPDQ 35 .HWFKDP &0 DQG 5REHUWV 50 LQ SUHVV 3XULILFDWLRQ DQG 3URSHUWLHV RI WKH 7DUWUDWHUHVLVWDQW $FLG 3KRVSKDWDVH IURP +XPDQ %RQH %RQH DQG 0LQHUDO 5HV $OOKRII (3 3URSSH .+ &KDSPDQ &) /LQ &: DQG 3URXW *5 f (YDOXDWLRQ RI 3URVWDWH 6SHFLILF $FLG 3KRVSKDWDVH DQG 3URVWDWH 6SHFLILF $QWLJHQ LQ ,GHQWLILFDWLRQ RI 3URVWDWLF &DQFHU 8URO $QGHUVRQ 75 DQG 7RYHUXG 69 f 3XULILFDWLRQ DQG &KDUDFWHUL]DWLRQ RI 3XUSOH $FLG 3KRVSKDWDVH IURP 'HYHORSLQJ 5DW %RQH $UFK %LRFKHP %LRSK\V f $QWDQDLWLV %& DQG $LVHQ 3 f 8WHURIHUULQ DQG WKH 3XUSOH $FLG 3KRVSKDWDVHV ,Q $GYDQFHV LQ ,QRUJDQLF %LRFKHPLVWU\ 7KHLO (& (LFKRUQ */ DQG 0DU]LOOL / HGV (OVHYLHU 1HZ
PAGE 165

%DUWOHWW *5 f 3KRVSKRURXV $VVD\ LQ &ROXPQ &KURPDWRJUDSK\ %LRO &KHP %DUWRO ) f 3K' 'LVVHUWDWLRQ 8QLYHUVLW\ RI )ORULGD *DLQHVYLOOH %DVKD 600 %D]HU ): *HLVHUW 5' DQG 5REHUWV 50 f 3URJHVWHURQHLQGXFHG 8WHULQH 6HFUHWLRQV LQ 3LJV 5HFRYHU\ IURP 3VHXGRSUHJQDQW DQG 8QLODWHUDOO\ 3UHJQDQW *LOWV $QLP 6FL %DVKD 600 %D]HU ): DQG 5REHUWV 50 f 7KH 6HFUHWLRQ RI D 8WHULQH 6SHFLILF 3XUSOH 3KRVSKDWDVH E\ &XOWXUHG ([SODQWV RI 3RUFLQH (QGRPHWULXP 'HSHQGHQF\ XSRQ WKH 6WDWH RI 3UHJQDQF\ RI WKH 'RQRU $QLPDO %LRO 5HSURG %DXPEDFK *$ f 3K' 'LVVHUWDWLRQ 8QLYHUVLW\ RI )ORULGD *DLQHVYLOOH %DXPEDFK *$ .HWFKDP &0 5LFKDUGVRQ '( %D]HU ): DQG 5REHUWV 50 f ,VRODWLRQ DQG &KDUDFWHUL]DWLRQ RI D +LJK 0ROHFXODU :HLJKW 6WDEOH 3LQN )RUP RI 8WHURIHUULQ IURP WKH 8WHULQH 6HFUHWLRQV DQG $OODQWRLF )OXLG RI 3LJV %LRO &KHP f %DXPEDFK *$ 6DXQGHUV 37. %D]HU ): DQG 5REHUWV 50 f 8WHURIHUULQ KDV 1$VSDUDJLQH/LQNHG +LJK0DQQRVH7\SH 2OLJRVDFFKDULGHV WKDW &RQWDLQ 0DQQRVH 3KRVSKDWH 3URF 1DWO $FDG 6FL 86$ %DXPEDFK *$ 6DXQGHUV 37. .HWFKDP &0 %D]HU ): DQG 5REHUWV 50 6WXGLHV RQ WKH LQ YLWUR %LRV\QWKHVLV DQG *O\FRV\ODWLRQ RI 8WHURIHUULQ 0DQXVFULSW LQ SUHSDUDWLRQ %D]HU ): &KHQ 77 .QLJKW -: 6FKORVQDJOH '& %DOGZLQ 1DQG 5REHUWV 50 f 3UHVHQFH RI D 3URJHVWHURQH ,QGXFHG 8WHULQH 6SHFLILF $FLG 3KRVSKDWDVH LQ $OODQWRLF )OXLG RI *LOWV $QLP 6FL %D]HU ): DQG 7KDWFKHU :: f 7KHRU\ RI 0DWHUQDO 5HFRJQLWLRQ RI 3UHJQDQF\ LQ 6ZLQH %DVHG RQ (VWURJHQ &RQWUROOHG (QGRFULQH 9HUVXV ([RFULQH 6HFUHWLRQ RI 3URVWDJODQGLQV ) m E\ WKH 8WHULQH (QGRPHWULXP 3URVWDJODQGLQV %HFN -/ .HRXJK '7 GH -HUVH\ DQG =HUQHU % f (Q]\PDWLFDOO\ $FWLYH =LQF &RSSHU DQG 0HUFXU\ 'HULYDWLYHV RI WKH 2QH LURQ )RUP RI 3LJ $OODQWRLF $FLG 3KRVSKDWDVH %LRFKLP %LRSK\V $FWD %RWWRPOH\ 66 :ROIH /& DQG %ULGJHV .5 f ,URQ 0HWDEROLVP LQ (U\WKUROHXNHPLF &HOOV %LRO &KHP f

PAGE 166

%UDGIRUG 00 f $ 5DSLG DQG 6HQVLWLYH 0HWKRG IRU WKH 4XDQWLWDWLRQ RI 0LFURJUDP 4XDQWLWLHV RI 3URWHLQ 8WLOL]LQJ WKH 3ULQFLSOH RI 3URWHLQ'\H %LQGLQJ $QDO %LRFKHP %UDLGPDQ ,3 6W -RKQ -* $QGHUVRQ '& DQG 5REHUWVRQ :5 f (IIHFWV RI 3K\VLRORJLFDO &RQFHQWUDWLRQV RI 3DUDWK\URLG +RUPRQH RQ $FLG 3KRVSKDWDVH $FWLYLW\ LQ &XOWXUHG 5DW %RQH &HOOV (QGRFU ,OO %UD\ODQ 5& DQG %XUNH -6 f +DLU\ &HOO /HXNHPLD $QQ 5HY 0HG %XKL :& f )XUWKHU &KDUDFWHUL]DWLRQ DQG )XQFWLRQ RI 8WHURIHUULQ IURP 8WHULQH )OXVKLQJV DQG $OODQWRLF )OXLG RI 3LJV 3K' 'LVVHUWDWLRQ 8QLYHUVLW\ RI )ORULGD *DLQHVYLOOH %XKL :& 'XFVD\ &$ %D]HU ): DQG 5REHUWV 50 Df ,URQ 7UDQVIHU %HWZHHQ WKH 3XUSOH 3KRVSKDWDVH 8WHURIHUULQ DQG 7UDQVIHUULQ DQG LWV 3RVVLEOH 5ROH LQ ,URQ 0HWDEROLVP RI WKH )HWDO 3LJ %LRO &KHP f %XKL :& *UD\ :0DQVILHOG ($ &KXQ 3: 'XFVD\ &$ %D]HU ): DQG 5REHUWV 50 Ef ,URQ &RQWHQW DQG 0ROHFXODU :HLJKW RI 8WHURIHUULQ DQG &RPSDULVRQ RI LWV ,URQ DQG &RSSHU )RUPV %LRFKHP %LRSK\V $FWD %XUQV -) :RUPDQ &3 DQG &DZOH\ -& f )OXFWXDWLRQV LQ WKH 7 DQG % &HOO &KDUDFWHULVWLFV RI 7FHOO +DLU\ &HOO /HXNHPLD &OLQ ([S ,PPXQRO &DPHURQ %) f 'HWHUPLQDWLRQ RI ,URQ LQ +HPH &RPSRXQGV ,, +HPRJORELQ DQG 0\RJORELQ $QDO %LRFKHP &DPSEHOO +' 'LRQ\VLXV '$ .HRXJK '7 :LOVRQ %( GH -HUVH\ DQG =HUQHU % f ,URQFRQWDLQLQJ $FLG 3KRVSKDWDVHV &RPSDULVRQ RI WKH (Q]\PHV IRU %HHI 6SOHHQ DQG $OODQWRLF )OXLG %LRSK\V %LRFKHP 5HV &RPPXQ &DPSEHOO +' DQG =HUQHU % f $ /RZ 0ROHFXODU :HLJKW $FLG 3KRVSKDWDVH ZKLFK &RQWDLQV ,URQ %LRFKHP %LRSK\V 5HV &RPPXQ &KDPEHUV 7)XOOHU DQG 'DUE\ -$ f +RUPRQDO 5HJXODWLRQ RI $FLG 3KRVSKDWDVH 5HOHDVH E\ 2VWHRFODVWV 'LVDJJUHDJDWHG IURP 1HRQDWDO 5DW %RQH &HOO 3K\VLRO &KHQ
PAGE 167

&KHQ 77 %D]HU ): &HWRUHOOL -3ROODUG :( DQG 5REHUWV 50 f 3XULILFDWLRQ DQG 3URSHUWLHV RI D 3URJHVWHURQH ,QGXFHG %DVLF *O\FRSURWHLQ IURP WKH 8WHULQH )OXLG RI 3LJV %LRO &KHP f &KRPF]\QVNL 3 DQG 6DFFKL 1 f 6LQJOHVWHS 0HWKRG RI 51$ ,VRODWLRQ E\ $FLG *XDQLGLQLXP 7KLRF\DQDWH3KHQRO&KORURIRUP ([WUDFWLRQ $QDO %LRFKHP &KR\ (<0 f *DXFKHU 'LVHDVH &RPSDUDWLYH 6WXG\ RI $FLG 3KRVSKDWDVH DQG *OXFRFHUHEURVLGDVH LQ 1RUPDO DQG 7\SH *DXFKHU 7LVVXHV $P 0HG *HQHW &KXUFK *0 DQG *LOEHUW : f *HQRPLF 6HTXHQFLQJ 3URF 1DWO $FDG 6FL 86$ &ORH / 0F1DE $ +XEEHOO +5 0HR 3 &XUWLV 3 DQG 5RYHUD f 'LIIHUHQWLDO ([SUHVVLRQ RI WKH *ORELQ *HQHV LQ +XPDQ /HXNHPLD 6f &HOOV ,QGXFHG WR 'LIIHUHQWLDWH E\ +HPLQ RU %XW\ULF $FLG &DQFHU 5HV &XDWUHFDFDV 3 :LOFKHN 0 DQG $QILQVHQ &% f 6HOHFWLYH (Q]\PH 3XULILFDWLRQ E\ $IILQLW\ &KURPDWRJUDSK\ 3URF 1DWO $FDG 6FL 86$ 'DYLV -& DQG $YHULOO %$ f (YLGHQFH IRU D 6SLQFRXSOHG %LQXFOHDU ,URQ 8QLW DW WKH $FWLYH 6LWH RI WKH 3XUSOH $FLG 3KRVSKDWDVH IURP %HHI 6SOHHQ 3URF 1DWO $FDG 6FL 86$ 'DYLV -& /LQ 66 DQG $YHULOO %& f .LQHWLFV DQG 2SWLFDO 6SHFWURVFRSLF 6WXGLHV RQ WKH 3XUSOH $FLG 3KRVSKDWDVH IURP %HHI 6SOHHQ %LRFKHPLVWU\ 'D\KRII 02 f $WODV RI 3URWHLQ 6HTXHQFH DQG 6WUXFWXUH 1DWO %LRPHG 5HV )RXQG :DVKLQJWRQ '& 'HEUDQQHU 3* +HQGULFK 03 'H-HUVH\ .HRXJK '7 6DJH 7 DQG =HUQHU % f 0RVVEDXHU DQG (35 6WXG\ RI WKH %LQXFOHDU ,URQ &HQWUH LQ 3XUSOH $FLG 3KRVSKDWDVH %LRFKLP %LRSK\V $FWD GH :HW -5 )XNXVKLPD + 'HMZL 11 :LOFR[ ( 2n%ULHQ -6 DQG +HOVLQNL '5 f &KURPRJHQLF ,PPXQRJHQLF ,PPXQRGHWHFWLRQ RI +XPDQ 6HUXP $OEXPLQ DQG RF/)XFRVLGDVH LQ D +XPDQ +HSDWRPD F'1$ ([SUHVVLRQ /LEUDU\ '1$ f 'L[RQ 6: DQG *LEERQV 5$ f 3URWHLQV LQ WKH 8WHULQH 6HFUHWLRQV RI WKH &RZ 5HSURG )HUW 'UH[OHU +* DQG *DHGLFNH f $QDO\VLV RI ,VRHQ]\PH 3DWWHUQV RI $FLG 3KRVSKDWDVH LQ $FXWH /HXNHPLDV %OXW

PAGE 168

'UH[OHU +* *DHGLFNH DQG 0LQRZDGD f ,VRHQ]\PH 6WXGLHV LQ +XPDQ /HXNHPLD/\PSKRPD &HOO /LQHV ,, $FLG SKRVSKDWDVH /HXN 5HV f 'UH[OHU +* *DHGLFNH DQG 0LQRZDGD f 2FFXUHQFH RI 3DUWLFXODU ,VR]\PHV LQ )UHVK DQG &XOWXUHG /HXNHPLDO\PSKRPD &HOOV 7DUWUDWHUHVLVWDQW $FLG 3KRVSKDWDVH ,VR]\PH &DQFHU 'UH[OHU +* *DHGLFNH DQG 0LQRZDGD Df 7FHOO /HXNHPLD /LQHV &&5)&(0 +3%$OO -0 DQG 02/7 &KDQJHV LQ ,VRHQ]\PH 3URILOHV 'XULQJ ,QGXFWLRQ RI 'LIIHUHQWLDWLRQ %OXW 'UH[OHU +* 0HQRQ 0 *DHGLFNH DQG 0LQRZDGD Ef ([SUHVVLRQ RI )0& $QWLJHQ DQG 7DUWUDWHUHVLVWDQW $FLG 3KRVSKDWDVH ,VRHQ]\PH LQ &DVHV RI %O\PSKRSUROLIHUDWLYH 'LVHDVHV (XU &DQFHU &OLQ 2QFRO f 'XFVD\ &$ %XKL :& %D]HU ): DQG 5REHUWV 50 f 5ROH RI 8WHURIHUULQ LQ ,URQ 7UDQVSRUW DQG 0DFURPROHFXODU 8SWDNH E\ $OODQWRLF (SLWKHOLXP RI WKH 3URFLQH &RQFHSWXV %LRO 5HSURG 'XFVD\ &$ %XKL :& %D]HU ): 5REHUWV 50 DQG &RPEV *( f 5ROH RI 8WHURIHUULQ LQ 3ODFHQWDO ,URQ 7UDQVSRUW ,, (IIHFW RI 0DWHUQDO ,URQ 7UHDWPHQW RQ )HWDO ,URQ DQG 8WHURIHUULQ &RQWHQW DQG 1HRQDWDO +HPRJORELQ $QLP 6FL (FKHWHEX =2 &R[ 70 DQG 0RVV ': f $QWLERGLHV WR 3RUFLQH 8WHURIHUULQ 8VHG LQ 0HDVXUHPHQW RI +XPDQ 7DUWUDWHUHVLVWDQW $FLG 3KRVSKDWDVH &OLQ &KHP f (IVWUDWLDGLV 7 DQG 0RVV ': f 7DUWUDWHUHVLVWDQW $FLG 3KRVSKDWDVH RI +XPDQ /XQJ $SSDUHQW ,GHQWLW\ ZLWK 2VWHRFODVWLF $FLG 3KRVSKDWDVH (Q]\PH )D]OHDEDV $7 %D]HU ): +DQVHQ 3*HLVHUW 5' DQG 5REHUWV 50 f 'LIIHUHQWLDO 3DWWHUQV RI 6HFUHWRU\ 3URWHLQ /RFDOL]DWLRQ :LWKLQ WKH 3LJ 8WHULQH (QGRPHWULXP LQ 5HVSRQVH WR 3URJHVWHURQH (QGRFULQRORJ\ )D]OHDEDV $7 %D]HU ): DQG 5REHUWV 50 f 3XULILFDWLRQ DQG 3URSHUWLHV RI D 3URJHVWHURQHLQGXFHG 3ODVPLQ7U\SVLQ ,QKLELWRU IURP 8WHULQH 6HFUHWLRQV RI 3LJV DQG ,WV ,PPXQRF\WRFKHPLFDO /RFDOL]DWLRQ LQ WKH 3UHJQDQW 8WHUXV %LRO &KHP )HLQEHUJ $3 DQG 9RJHOVWHLQ % f $ 7HFKQLTXH IRU 5DGLRODEHOLQJ '1$ 5HVWULFWLRQ (QGRQXFOHDVH )UDJPHQWV WR +LJK 6SHFLILF $FWLYLW\ $QDO %LRFKHP )HOGPDQ ) DQG %XWOHU /* f 'HWHFWLRQ DQG &KDUDFWHUL]DWLRQ RI WKH 3KRVSKRU\ODWHG IRUP RI 0LFURVRPDO *OXFRVH 3KRVSKDWDVH %LRFKHP %LRSK\V 5HV &RPP

PAGE 169

)UDQN 0 %D]HU ): 7KDWFKHU :: DQG :LOFR[ &f $ 6WXG\ RI 3URVWDJODQGLQ ) rF DV WKH /XWHRO\VLQ LQ 6ZLQH ,9 $Q ([SODQDWLRQ IRU WKH /XWHRWURSKLF (IIHFW RI (VWUDGLRO 3URVWDJODQGLQV *DEHU %' 6KHULGDQ -3 %D]HU ): DQG 5REHUWV 50 f 5HVRQDQFH 5DPDQ 6FDWWHULQJ IURP 8WHURIHUULQ WKH 3XUSOH *O\FRSURWHLQ RI WKH 3RUFLQH 8WHUXV %LRO &KHP *DPEDUL 5 %DUELHUL 5 %X]]RQL %HUQDUGL ) 0DUFKHWWL $PHORWWL ) 3LYD 5 9LROD / DQG GHO 6HQQR / f +XPDQ /HXNHPLF &HOOV 6XSSUHVVLRQ RI +HPRJORELQ $FFXPXODWLRQ E\ D 0RQRFORQDO $QWLERG\ WR +XPDQ 7UDQVIHUULQ 5HFHSWRU %LRFKLPLFD HW %LRSK\VLFD $FWD *D]LWW < DQG 3ROOLDFN $ f 3KRUERO (VWHU ,QGXFWLRQ RI 3ODVPDF\WRLG DQG +DLU\ &HOO /HXNHPLD )HDWXUHV LQ %W\SH /\PSKRF\WLF /HXNHPLDV 7KH 5HODWLRQ WR %FHOO 'LIIHUHQWLDWLRQ DQG 0DWXUDWLRQ %ORRG &HOOV *ORPVHW DQG 3RUDWK f 6RPH 3URSHUWLHV RI D 3KRVSKDWDVH IURP %RYLQH 6SOHHQ %LRFKLP %LRSK\V $FWD *ROGEHUJ '( DQG .RUQIHOG 6 f (YLGHQFH IRU ([WHQVLYH 6XEFHOOXODU 2UJDQL]DWLRQ RI $VSDUDJLQHOLQNHG 2OLJRVDFFKDULGH 3URFHVVLQJ DQG /\VRVRPDO (Q]\PH 3KRVSKRU\ODWLRQ %LRO &KHP *ROGVWHLQ ,+ROOHUPDQ &( DQG 6PLWK (( f 3URWHLQ &DUERK\GUDWH ,QWHUDFWLRQ ,, ,QKLELWLRQ 6WXGLHV RQ WKH ,QWHUDFWLRQ RI &RQFDQDYDOLQ $ ZLWK 3RO\VDFFKDULGHV %LRFKHPLVWU\ *XQQLQJ 3 3RQWH 3 2ND\DPD + (QJHO %ODX + DQG .HGHV / f ,VRODWLRQ DQG &KDUDFWHUL]DWLRQ RI )XOOOHQJWK F'1$ &ORQHV IRU +XPDQ RF DQG UDFWLQ P51$V 6NHOHWDO EXW QRW &\WRSODVPLF $FWLQV KDYH DQ $PLQRWHUPLQDO &\VWHLQH WKDW LV 6XEVHTXHQWO\ 5HPRYHG 0RO &HOO %LRO *XWPDQ (% 6SRXO (( DQG *XWPDQ $% f 6LJQLILFDQFH RI ,QFUHDVHG 3KRVSKDWDVH $FLWYLW\ RI %RQH DW WKH 6LWH RI 2VWHRSODVWLF 0HWDVWDVHV 6HFRQGDU\ WR &DUFLQRPD RI WKH 3URVWDWH *ODQG $P &DQFHU +DQDKDQ f 6WXGLHV RQ 7UDQVIRUPDWLRQ RI ( &ROL ZLWK 3ODVPLGV 0RO %LRO +DUD $ .DWR 7 6DZDGD + )XNX\DPD DQG (SVWHLQ :/ f &KDUDFWHUL]DWLRQ RI )HADFWLYDWHG $FLG 3KRVSKDWDVH LQ 5DW (SLGHUPLV &RPS %LRFKHP 3K\VLRO %f +DUD $ 6DZDGD + .DWR 7 1DND\DPD 7
PAGE 170

+HUEHUW :f 0LQHUDO 2LO $GMXYDQWV DQG WKH ,PPXQL]DWLRQ RI /DERUDWRU\ $QLPDOV ,Q +DQGERRN RI ([SHULPHQWDO ,PPXQRORJ\ HG :HLU '0 6FLHQWLILF 3XEOLFDWLRQV 2[IRUGf 9RO ,OO $O$ +LFNH\ 0( DQG 9DQ (WWHQ 5/ f 6WRLFKLRPHWULF 7UDSSLQJ RI D &RYDOHQW 3KRVSKRU\OHQ]\PH ,QWHUPHGLDWH 2FFXULQJ LQ 5HDFWLRQV &DWDO\]HG E\ DQ $FLG 3KRVSKDWDVH $UFK %LRFKHP %LRSK\V +RIODFN % )XMLPRWR DQG .RUIHOG 6 f 7KH ,QWHUDFWLRQ RI 3KRVSKRU\ODWHG 2OLJRVDFFKDULGHV DQG /\VRVRPDO (Q]\PHV ZLWK %RYLQH /LYHU &DWLRQGHSHQGHQW 0DQQRVH 3KRVSKDWH 5HFHSWRU %LRO &KHP +XQW ')
PAGE 171

.HQQHW 5+ 0F.HDUQ 7DQG %HFKWRO % f 0RQRFORQDO $QWLERGLHV 3OHQXP 3UHVV 1HZ
PAGE 172

/DP .: (DVWOXQG 7 /L &< DQG
PAGE 173

/LWWOHILHOG -: f 6HOHFWLRQ RI +\EULGV IURP 0DWLQJV RI )LEUREODVWV LQ YLWUR DQG WKHLU 3UHVXPHG 5HFRPELQDQWV 6FLHQFH /REE 55 +DUSHU -: DQG )HWW -: f 3XULILFDWLRQ RI +HSDULQ%LQGLQJ *URZWK )DFWRUV $QDO %LRFKHP /RZU\ 2+ 5RVHEURXJK 1)DUU $/ DQG 5DQGDOO 3f 3URWHLQ 0HDVXUHPHQW ZLWK WKH )ROLQ 3KHQRO 5HDJHQW %LRO &KHP /R]]LR &% DQG /R]]LR %% f +XPDQ &KURQLF 0\HORJHQRXV /HXNHPLD &HOO /LQH ZLWK 3RVLWLYH 3KLODGHOSKLD &KURPRVRPH %ORRG 0DQLDWLV 7 )ULWVFK () DQG 6DPEURRN f ,Q 0ROHFXODU &ORQLQJ D /DERUDWRU\ 0DQXDO &ROG 6SULQJ +DUERU /DERUDWRU\ &ROG 6SULQJ +DUERU 1HZ
PAGE 174

0RFNOHU *0 GH -HUVH\ =HUQHU % 2n&RQQRU &DQG 6LQQ ( f $FWLYH 6LWH RI $OODQWRLF 3XUSOH $FLG 3KRVSKDWDVH DQG D 0RGHO &RPSOH[ IRU 6WURQJO\ FRXSOHG 'LLURQ 6LWHV $P &KHP 6RF 0XOOLQV '( %D]HU ): DQG 5REHUWV 50 f 6HFUHWLRQ RI D 3URJHVWHURQHLQGXFHG ,QKLELWRU RI 3ODVPLQRJHQ $FWLYDWRU E\ WKH 3RUFLQH 8WHUXV &HOO 0XUUD\ )$ %D]HU ): :DOODFH +' DQG :DUQLFN $& f 4XDQWLWDWLYH DQG 4XDOLWDWLYH 9DULDWLRQ LQ WKH 6HFUHWLRQ RI 3URWHLQ E\ WKH 3RUFLQH 8WHUXV 'XULQJ WKH (VWURXV &\FOH %LRO 5HSURG 1DJDVDZD +RZDWVRQ $ DQG 0DN 7: f ,QGXFWLRQ RI +XPDQ 0DOLJQDQW 7/\PSKREODVWLF &HOO /LQHV 02/7 DQG -XUNDW E\ WHWUDGHFDQR\OSKRUERO DFHWDWH %LRFKHPLFDO 3K\VLFDO DQG 0RUSKRORJLFDO &KDUDFWHUL]DWLRQ &HOO 3K\VLRO 1DQED -DIIHH (6 6KREDQ (%UD\ODQ 5& DQG %HUDUG &: f +DLU\ &HOO /HXNHPLD &DQFHU f 1LVKL]XND < f 7KH 5ROH RI 3URWHLQ .LQDVH & LQ &HOO 6XUIDFH 6LJQDO 7UDQVGXFWLRQ DQG 7XPRU 3URPRWLRQ 1DWXUH 2L 9 DQG +HU]HQEHUJ /$ f ,Q 6HOHFWHG 0HWKRGV ,Q &HOOXODU ,PPXQRORJ\ 0LVKHOO %% DQG 6KLLJL 60 HGV :+ )UHHPDQ DQG &R 6DQ )UDQFLVFRf 2ND\DPD + DQG %HUJ 3 f $ F'1$ &ORQLQJ 9HFWRU WKDW 3HUPLWV ([SUHVVLRQ RI F'1$ ,QVHUWV LQ 0DPPDOLDQ &HOOV 0RO &HOO %LRO 3HWUDNL + ,RDQQLGHV &* )LOOL 6 3DSDPLFKDO 0 f /RVV DQG 5HDSSHDUDQFH RI 7UDQVIHUULQ 5HFHSWRUV LQ +XPDQ /HXNHPLF &HOO /LQHV ([SWO &HOO %LRO 3LHWHUV 5 DQG 9HHUPDQ $-3 f 3URJQRVWLF 6LJQLILFDQFH RI $FLG $OSKDQDSKWK\O $FHWDWH (VWHUDVH DQG $FLG 3KRVSKDWDVH LQ &KLOGKRRG $FXWH /\PSKREODVWLF /HXNHPLD /HXN 5HV f 3RQWH 3 1J 6< (QJHO *XQQLQJ 3 DQG .HGHV / f (YROXWLRQDU\ &RQVHUYDWLRQ LQ WKH 8QWUDQVODWHG 5HJLRQV RI $FWLQ P51$V '1$ 6HTXHQFH RI D +XPDQ %HWDDFWLQ F'1$ 1XFO $FLGV 5HV f 3RU]VROW ) f 5HSRUW RQ WKH 6HFRQG ,QWHUQDWLRQDO &RQIHUHQFH RQ +DLU\ &HOO /HXNHPLD %OXW 5HLVIHOG 5' /HZLV 9DQG :LOOLDPV '( f 'LVF (OHFWURSKRUHVLV RI %DVLF 3URWHLQV DQG 3HSWLGHV RQ 3RO\DFU\ODPLGH *HOV 1DWXUH

PAGE 175

5HQHJDU 5+ %D]HU ): DQG 5REHUWV 50 f 3ODFHQWDO 7UDQVSRUW DQG 'LVWULEXWLRQ RI 8WHURIHUULQ LQ WKH )HWDO 3LJ %LRO 5HSURG 5HYHO +5 DQG 5DFNHU ( f 6WXGLHV RQ D 3KRVSKRSURWHLQ 3KRVSKDWDVH 'HULYHG IURP %HHI 6SOHHQ %LRFKLP %LRSK\V $FWD 5REHUWV 50 %DXPEDFK *$ 6DXQGHUV 37. 5DXE 75HQHJDU 5+ %D]HU ): Df 3RVVLEOH )XQFWLRQ RI &DUERK\GUDWH RQ *O\FRSURWHLQV 6HFUHWHG E\ WKH 3LJ 8WHUXV 'XULQJ 3UHJQDQF\ 0RO &HOO %LRFKHP 5REHUWV 50 DQG %D]HU ): f 3KRVSKRSURWHLQ 3KRVSKDWDVH $FWLYLW\ RI WKH 3URJHVWHURQHLQGXFHG 3XUSOH *O\FRSURWHLQ RI WKH 3RUFLQH 8WHUXV %LRFKHP %LRSK\V 5HV &RPPXQ f 5REHUWV 50 DQG %D]HU ): f 7KH 3URSHUWLHV )XQFWLRQ DQG +RUPRQDO &RQWURO RI 8WHURIHUULQ WKH 3XUSOH 3URWHLQ RI WKH 3LJ 8WHUXV ,Q 6WHURLG ,QGXFHG 3URWHLQV %HDWR 0 HG $PVWHUGDP (OVHYLHU 1RUWK +ROODQGf 5REHUWV 50 DQG %D]HU ): f 8WHURIHUULQ $ 3URWHLQ LQ 6HDUFK RI D )XQFWLRQ %LR(VVD\V f 5REHUWV 50 DQG %D]HU ): f 7KH )XQFWLRQV RI 8WHULQH 6HFUHWLRQV 5HSURG )HUW 5REHUWV 50 %D]HU ): %DOGZLQ 1 DQG 3ROODUG :( f 3URJHVWHURQH ,QGXFWLRQ RI /\VR]\PH DQG 3HSWLGDVH $FWLYLWLHV LQ WKH 3RUFLQH 8WHUXV $UFK %LRFKHP %LRSK\V 5REHUWV 50 5DXE 7DQG %D]HU ): Ef 5RGH RI 8WHURIHUULQ LQ 7UDQVSODFHQWDO ,URQ 7UDQVSRUW LQ WKH 3LJ )HGHUDWLRQ 3URF 5RELQVRQ '% DQG *OHZ 5+ f $ 7DUWUDWHUHVLVWDQW $FLG 3KRVSKDWDVH IURP *DXFKHU 6SOHHQ %LRO &KHP f 5RELQVRQ '% DQG *OHZ 5+ f 6XEVWUDWH 6SHFLILFLW\ RI *DXFKHU 6SOHHQ 3KRVSKRSURWHLQ 3KRVSKDWDVH $UFK %LRFKHP %LRSK\V 5RELQVRQ ')6 3RVQHU '1 =ROD + DQG &DWRYVN\ f 1RUPDO &RXQWHUSDUWV RI +DLU\ &HOOV DQG %SURO\PSKRF\WHV LQ WKH 3HULSKHUDO %ORRG $Q 8OWUDVWUXFWXUDO 6WXG\ ZLWK 0RQRFORQDO $QWLERGLHV DQG WKH ,PPXQRJROG 0HWKRG /HXN 5HV 5R]HQV]DMQ /$ *XWPDQ $ 5DGQD\ %HQ 'DYLG ( DQG 6KRKDP f $ 6WXG\ RI WKH 1DWXUH RI +DLU\ &HOOV ZLWK (PSKDVLV RQ (Q]\PDWLF 0DUNHUV $P &OLQ 3DWKRO

PAGE 176

5XWKHUIRUG 75 &OHJJ -% DQG :HDWKHUDOO 'f +XPDQ /HXNHPLF &HOOV 6\QWKHVL]H (PEU\RQLF +DHPRJORELQ LQ 5HVSRQVH WR +DHPLQ 1DWXUH 5XWKHUIRUG 75 DQG :HDWKHUDOO 'f 'HILFLHQW +HPH 6\QWKHVLV DV WKH &DXVH RI 1RQLQGXFLELOLW\ RI +HPRJORELQ 6\QWKHVLV LQ D )ULHQG (U\WKUROHXNHPLD &HOO /LQH &HOO 6DQJHU ) 1LFNOHQ 6 DQG &RXOVRQ $5 f '1$ 6HTXHQFLQJ ZLWK &KDLQ 7HUPLQDWLQJ ,QKLELWRUV 3URF 1DWO $FDG 6FL 86$ f 6DXQGHUV 37. 5HQHJDU 5+ 5DXE 7%DXPEDFK *$ $WNLQVRQ 3+ %D]HU ): DQG 5REHUWV 50 f 7KH &DUERK\GUDWH 6WUXFWXUH RI 3RUFLQH 8WHURIHUULQ DQG WKH 5ROH RI +LJK 0DQQRVH &KDLQV LQ 3URPRWLQJ 8SWDNH E\ WKH 5HWLFXORHQGRWKHOLDO &HOOV RI WKH )HWDO /LYHU %LRO &KHP 6FDWFKDUG f 7KH $WWUDFWLRQV RI 3URWHLQV IRU 6PDOO 0ROHFXOHV DQG ,RQV $QQ 1< $FDG 6FL 6FKLQGHOPHLVHU 0XQVWHUPDQQ DQG :LW]HO + f +LVWRFKHPLFDO ,QYHVWLJDWLRQV RQ WKH /RFDOL]DWLRQ RI WKH 3XUSOH $FLG 3KRVSKDWDVH LQ WKH %RYLQH 6SOHHQ +LVWRFKHPLVWU\ 6FKORVQDJOH '& %D]HU ): 7VLEULV -&0 DQG 5REHUWV 50 f $Q ,URQFRQWDLQLQJ 3KRVSKDWDVH ,QGXFHG E\ 3URJHVWHURQH LQ WKH 8WHULQH )OXLG RI 3LJV %LRO &KHP f 6FKORVQDJOH '& 6DQGHU (& %D]HU ): DQG 5REHUWV 50 f 5HTXLUHPHQW RI DQ (VVHQWLDO 7KLRO *URXS DQG )HUULF ,URQ IRU WKH $FWLYLW\ RI WKH 3URJHVWHURQHLQGXFHG 3RUFLQH 8WHULQH 3XUSOH 3KRVSKDWDVH %LRO &KHP f 6FKXOPDQ 8 :LOGHU &' DQG .RKOHU f $ %HWWHU &HOO /LQH IRU 0DNLQJ +\EULGRPDV 6HFUHWLQJ 6SHFLILF $QWLERGLHV 1DWXUH 6KHSKDUG 9 6FKOHVLQJHU 3 DQG 6WDKO 3 f 5HFHSWRUV IRU /\VRVRPDO (Q]\PHV DQG *O\FRSURWHLQV &XUU 7RSLFV 0HPEUDQH 7UDQVSRUW 6LPPHQ 5&0 %DXPEDFK *$ DQG 5REHUWV 50 f 0ROHFXODU &ORQLQJ DQG 7HPSRUDO ([SUHVVLRQ 'XULQJ 3UHJQDQF\ RI WKH 0HVVHQJHU 5LERQXFOHLF $FLG (QFRGLQJ 8WHURIHUULQ D 3URJHVWHURQHLQGXFHG 8WHULQH 6HFUHWRU\ 3URWHLQ 0RO (QGRFULQRO f 6PLWK /%UD\ODQ 5& (GPXQGVRQ .% 1XWNLV -( DQG :DNHODQG (. f ,Q YLWUR 7UDQVIRUPDWLRQ RI +XPDQ %FHOO )ROOLFXODU /\PSKRPD &HOOV E\ (SVWHLQ%DUU 9LUXV &DQFHU 5HV

PAGE 177

6RXWKHUQ ( f 'HWHFWLRQ RI 6SHFLILF 6HTXHQFHV DPRQJ '1$ )UDJPHQWV 6HSDUDWHG E\ *HO (OHFWURSKRUHVLV 0RO %LRO 6WHSDQ 6LOLQNRYD0DLNRYD ( +DYUDUHN 7 )RUPDQNRYD =LFKRYD 0 /DFKPDQRYD 6WUDNRYD 0 %URYOLN 3 DQG 3DFRYVN\ 9 f 5HODWLRQVKLS RI 3ODVPD 7DUWUDWHUHVLVWDQW $FLG 3KRVSKDWDVH WR WKH %RQH ,VRHQ]\PH RI 6HUXP $ONDOLQH 3KRVSKDWDVH LQ +\SHUSDUDWK\URLGLVP &OLQ &KLP $FWD 7DYDVVROL 0 5L]R 0 DQG
PAGE 178

:RUPDQ &3 %URRNV '$ +RJJ 1 =ROD + %HYHUO\ 3&/ DQG &DZOH\ -& f 7KH 1DWXUH RI +DLU\ &HOOV $ 6WXG\ ZLWK D 3DQHO RI 0RQRFORQDO $QWLERGLHV 6FDQG +HPDWRO
PAGE 179

%,2*5$3+,&$/ 6.(7&+ &DWKHULQH 0DU\ 6FRSD ZDV ERUQ RQ $SULO LQ 3DWFKRJXH 1HZ
PAGE 180

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 5 0LFKDHO 5REHUWV &KDLUPDQ 3URIHVVRU RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ +DUU\ 61LFN &RFKDLUPDQ $VVLVWDQW 3URIHVVRU RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ a? >/Y ? n -8// M 4 3HWHU 0 0F*XLUH $VVLVWDQW 3URIHVVRU RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 'DQLHO / 3XULFK 3URIHVVRU t &KDLUPDQ RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\

PAGE 181

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 0LFU $VV DQG 0ROHFXODU %LRORJ\ KHPLVWU\ 7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI 0HGLFLQH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ $XJXVW 'HDQ &ROOHJH RI 0HGLFLQH

PAGE 182

81,9(56,7< 2) )/25,'$


UNIVERSITY OF FLORIDA
3 1262 08554 3915