Citation
In vitro excision of adeno-associated virus DNA from recombinant plasmids

Material Information

Title:
In vitro excision of adeno-associated virus DNA from recombinant plasmids isolation of an enzyme fraction from HeLa cells that cleaves DNA at polypurine-polypyrimidine sequences rich in GC base pairs
Creator:
Gottlieb, H. Jonathan
Publication Date:
Language:
English
Physical Description:
ixx, 153 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Digestion ( jstor )
DNA ( jstor )
DNA replication ( jstor )
Enzymes ( jstor )
Gels ( jstor )
In vitro fertilization ( jstor )
Molecules ( jstor )
Nucleotides ( jstor )
Plasmids ( jstor )
Substrate specificity ( jstor )
DNA, Recombinant ( mesh )
Dependovirus ( mesh )
Dissertations, Academic -- Immunology and Medical Microbiology -- UF ( mesh )
Genetic Engineering ( mesh )
Immunology and Medical Microbiology thesis Ph.D ( mesh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 1988.
Bibliography:
Bibliography: leaves 145-152.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by H. Jonathan Gottlieb.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
030425460 ( ALEPH )
20674908 ( OCLC )
AFB9806 ( NOTIS )

Downloads

This item has the following downloads:


Full Text











IN VITRO EXCISION OF ADENO-ASSOCIATED VIRUS DNA FROM
RECOMBINANT PLASMIDS: ISOLATION OF AN ENZYME FRACTION
FROM HELA CELLS THAT CLEAVES DNA AT POLYPURINE-
POLYPYRIMIDINE SEQUENCES RICH IN GC BASE PAIRS











BY

H. JONATHAN GOTTLIEB


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN
PARTIAL FULFILLMENT OF THE REQUIREMENTS
FOR THE DEGREE OF DOCTOR OF PHILOSOPHY


UNIVERSITY OF FLORIDA


1988




IN VITRO EXCISION OF ADENO-ASSOCIATED VIRUS DNA FROM
RECOMBINANT PLASMIDS: ISOLATION OF AN ENZYME FRACTION
FROM HELA CELLS THAT CLEAVES DNA AT POLYPURINE-
POLYPYRIMIDINE SEQUENCES RICH IN GC BASE PAIRS
BY
H. JONATHAN GOTTLIEB
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN
PARTIAL FULFILLMENT OF THE REQUIREMENTS
FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1988


To my family
Digitized by the Internet Archive
in 2011 with funding from
University of Florida, George A. Smathers Libraries with support from LYRASIS and the Sloan Foundation
http://www.archive.org/details/invitroexcisionoOOgott


ACKNOWLEDGEMENTS
I would like to express my sincerest appreciation to my mentor and
friend, Dr. Nicholas Muzyczka, for the unique opportunity to work with
him during the last several years. In addition, I would like to thank
the members of my graduate committee at the University of Florida and
Drs. Kenneth Berns and William Holloman for their helpful suggestions
and encouragement.
I am grateful to members of the Muzyczka laboratory in New York
and in Florida for their advice, conversation and friendship. Special
thanks are extended to Deirdre Lawe and to my co-defendant, Susan
McLaughlin.
iii


TABLE OF CONTENTS
Page
ACKNOWLEDGMENTS iii
LIST OF TABLES vi
LIST OF FIGURES vii
KEY TO ABBREVIATIONS ix
ABSTRACT xi
CHAPTER
I. INTRODUCTION 1
Introduction 1
AAV DNA Replication 1
Rescue of Latent AAV Provirus 4
General Aim of the Studies 6
II. MATERIALS AND METHODS 7
Cell Culture and Viruses 7
Recombinant Clones and Enzyme Substrates 7
Purification of Endo R 10
Nuclease Assays 11
DNA Labeling, Sequencing and
Primer Extension 12
Gel Electrophoresis 14
Estimation of the Isoelectric Point 15
Chromatographic Media, Enzymes
and Materials 15
Other Methods 16
Estimate of In Vivo Excision Frequency 16
III.PURIFICATION OF ENDO R 17
Detection of a Site-Specific Endonuclease
Activity in Crude Nuclear Extracts 17
Purification of Endo R 20
The Endo R Agarose Gel Assay 25
Molecular Size and Purity of Endo R 25
iv


Page
IV. RESCUE OF AAV SEQUENCES 35
Localization of the Site of Cleavage to
the AAV/Vector Junction 35
Either AAV/Vector Junction Can Be Cleaved
Independently of the Other 38
Cleavage of AAV Terminal Mutants 39
Minor Endo R Cleavage Sites 46
AAV Excision In Vivo 48
Replication of Endo R Products 51
V. ENZYME RECOGNITION 53
Isolation of the Cleavage Site 53
Sequence at the Site of Cleavage 63
Is Endo R a Site Specific Single-
Stranded Nuclease 76
VI. PROPERTIES OF ENDO R 85
Reaction Conditions for Double-Stranded
Cleavage 85
Alternate Cleavage Specificity in the
Presence of Mn^ Ions 89
Endo R Specific Cleavage is of a
Double-Stranded Nature 94
Effect of Nucleotides and Polynucleotides
on the Cleavage Activity 100
Are Stoichiometric Amounts of Enzyme
Required for Cleavage Ill
Characterization of the Ends of the
Reaction Products Ill
Is Endo R a Human Topoisomerase 120
VII.DISCUSSION AND CONCLUSIONS 121
Purification of Endo R 121
Excision of AAV Sequences In Vitro 122
Is Endo R Responsible for the Rescue of
AAV Sequences In Vivo 123
Enzyme Recognition 129
Evidence for a Contaminating Nuclease 137
Other Mammalian Endonucleases 138
What Does Endo R Do for the Cell 140
REFERENCES 145
BIOGRAPHICAL SKETCH 153
v


LIST OF TABLES
Table Page
I. PURIFICATION OF ENDO R 21
II.RECOGNITION SITE FOR ENDO R IN AAV
PLASMIDS 40
III. MINOR CLEAVAGE SITES 47
IV. SUBCLONED CLEAVAGE SITES 58
V. DIVALENT METAL REQUIREMENTS FOR ACTIVITY 86
VI. NUCLEOTIDE INHIBITION AND STIMULATION 102
VII. END LABELING OF ENDO R PRODUCTS 113
vi


LIST OF FIGURES
Figure Page
1-1. Model for AAV DNA Replication 3
3-1. Endo R Agarose Gel Assay 19
3-2. Enzyme Titration of Fractions I, II
and III 23
3-3. Enzyme Titration of Fraction III 27
3-4. Sedimentation Analysis of Endo R by
Glycerol Gradient Centrifugation 30
3-5. Molecular Weight and Purity of Endo R 32
4-1. Identification of AAV-Specific and pBR-
Specific Fragments in the Endo R
Reaction 37
4-2. Cleavage of Substrates That Contain Only
One Copy of the AAV Terminal Repeat 42
4-3. Cleavage of AAV Plasmids That Contain
Deletions in the Terminal Repeat 45
4-4. Cleavage of AAV Plasmids In Vivo 50
5-1. Oligomer Clone Cleavage 55
5-2. Oligomer Clone Gel Assay 57
5-3. Endo R Cleavage of pGA38 and pEV136 62
5-4. Sequence at the Site of Cleavage-
Dideoxy Method 67
5-5. Sequence at the Site of Cleavage-
Maxam and Gilbert Method 72
5-6. Sequence at the Site of Endo R Cleavage-
Summary of the Cleavage Sites 74
5-7. SI and Endo R Nuclease Digestion of pSM620 78
vii


Page
Figure
5-8. SI and Endo R Activity on Single-Stranded
DNA 82
5-9. Endo R Activity on Single-Stranded
Circular DNA 84
6-1. Sodium and Potassium Inhibition of Endo R 88
6-2. Cleavage of Form I and Form III Plasmid
Substrate 91
6-3. Specificity of Endo R With Mg^+ and Mn^+ 93
6-4. Cleavage Reaction Time Course 96
6-5. Single-Stranded Specificity of Endo R 99
6-6. ATP Inhibition of Endo R Activity 104
6-7. Polynucleotide Competition of Double-
Stranded Cleavage Activity 107
6-8. Stoichiometry of the Endo R Cleavage
Reaction 110
6-9. Ligation of Endo R Products 116
6-10. 5' End Labeling of Endo R Products 118
7-1. Model for the Excision of AAV DNA from
Recombinant Plasmids 126
viii


KEY TO ABBREVIATIONS
ATP
adenosine-5'-triphosphate
bp
base pairs
BSA
bovine serum albumin
CTP
cytosine-5'-triphosphate
d
daltons
dATP
deoxyadenosine-5'-triphosphate
dCTP
deoxycytosine-5'-triphosphate
DEAE
die thy1aminoe thy1
dGTP
deoxyguanosine-5'-triphosphate
DNA
deoxyribonucleic acid
DTT
dithiothreitol
dTTP
thymidine- 5'- triphosphate
E. coli
Escherichia coli
EDTA
ethylenediamine tetra-acetic acid
form I
superhelical plasmid DNA
form II
nicked circular DNA
form III
linear duplex DNA
G: C
double-stranded poly(dG):poly(dC)
GTP
guanosine-5'-triphosphate
kb
kilobase
kd
kilodaltons
PMSF
phenylmethylsulfonylfluoride
ix


POLY(dA)
polydeoxyadenylic acid
POLY(dC)
polydeoxycytidylic acid
POLY(dG)
polydeoxyguanylic acid
POLY(dT)
polydeoxythymidylic acid
RNA
ribonucleic acid
rpm
revolutions per minute
SDS
sodium dodecyl sulfate
ssb
E. coli single-stranded binding protein
telomerase
telomere terminal transferase
Z-DNA
left-handed helical double-stranded DNA
X


Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
IN VITRO EXCISION OF ADENO-ASSOCIATED VIRUS DNA FROM
RECOMBINANT PLASMIDS: ISOLATION OF AN ENZYME FRACTION
FROM HELA CELLS THAT CLEAVES DNA AT POLYPURINE-
POLYPYRIMIDINE SEQUENCES RICH IN GC BASE PAIRS
By
H. Jonathan Gottlieb
August 1988
Chairman: Nicholas Muzyczka
Major Department: Immunology and Medical Microbiology
When circular recombinant plasmids containing adeno-associated
virus (AAV) DNA sequences are transfected into human cells, the AAV
provirus is rescued. Using these circular AAV plasmids as substrates, a
cellular site-specific endonuclease, endo R, was isolated from HeLa cell
nuclei on the basis of its ability to excise intact AAV sequences in
vitro from the vector DNA and produce linear DNA products. The enzyme
recognizes and cleaves polypurine-polypyrimidine sequences which are at
least 9 residues long and rich in GC base pairs. Such sequences occur
naturally in non-coding regions of higher eucaryotes, are present in AAV
recombinant plasmids as part of the first 15 bp of the AAV terminal
repeat and, in some cases, are present at the AAV/vector junction as the
result of cloning by GC tailing. Plasmid DNA that is transfected into
tissue culture cells is cleaved in vivo to produce a pattern of DNA
fragments similar to that seen with purified enzyme in vitro. The level
xi


of specific cleavage in the standard assay depends on the type and
length of the recognition signal in the substrate. Generally, longer
and more homogeneous stretches of poly(dG):poly(dC) are better
substrates for double-stranded cleavage. The enzyme apparently
recognizes the secondary structure characteristic of G-rich polypurine
sequences in duplex DNA. Sequence analysis of the cut site suggests
that double-stranded cleavage occurs through a series of concerted
single-stranded nicks of the substrate throughout the enzyme recognition
site.
The molecular weight of the active form of endo R was estimated by
gel filtration and sedimentation in glycerol gradients to be
approximately 125,000. The enzyme, which requires magnesium as a
cofactor, does not have significant endonucleolytic activity on single-
stranded DNA, but is equally active on closed circular and linear duplex
DNA substrates. The properties of endo R are consistent with it playing
a role in the rescue of integrated AAV sequences. The enzyme's function
in cellular DNA metabolism is less obvious, but its properties suggest
that it may have a role in cellular DNA replication and recombination.
xii


CHAPTER I
INTRODUCTION
Introduction
A major obstacle in the characterization of cellular factors
involved in mammalian DNA metabolism lies in establishing a
biochemically and genetically defined system. For the most part, the
complexity of cellular processes and the lack of genetic analysis in
higher eucaryotes prevent accurate characterization of these processes.
This problem has been partially circumvented with the use of well
characterized mammalian viral systems as probes for cellular functions
(Challberg and Kelly, 1979; Li and Kelly, 1984; Murakami et al.. 1986).
In this regard, adeno-associated virus (AAV) is ideal. AAV has been
well characterized genetically (Hermonat et al.. 1984), and because of
its small size, is largely dependent on cellular functions for viral
multiplication (Berns et al., 1985) .
AAV DNA Replication
The current model for AAV DNA replication is a modified version of
a general model for the replication of eucaryotic DNA molecules first
proposed by Cavalier-Smith (Cavalier-Smith, 1974; Hauswirth and Berns,
1977; Straus et al.. 1976). AAV contains a 4.7 kb single-stranded
linear genome consisting of an internal nonrepetitive sequence which is
flanked at each end by inverted terminal repeats that are palindromic
(Lusby et al.. 1980). DNA replication proceeds by leading strand
1


Figure 1-1. Model for AAV DNA Replication.
The model for AAV DNA replication is a modified version of the model for
eukaryotic DNA replication first described by Cavalier-Smith (1974). i)
Single or double-stranded specific cleavage at the AAV/pBR322 junction
is necessary to allow formation of the hairpin primer in the palindromic
region of the termini. Site specific cleavage must occur at the other
AAV/vector junction either before or during DNA synthesis to separate
AAV and vector sequences. ii) DNA replication proceeds from the 3' end
of the primer to the other end of the molecule and includes synthesis of
the distal terminal repeat. iii) A specific nick is required on the
parental strand directly across from the original 3' end of the primer
to allow repair of the parental terminal sequences (iv). Both the
parental and progeny strands are now capable of initiating another DNA
replication cycle.


3
I Site-Specific
Cleavage
Ln
~u
RF Resolution


4
synthesis from the hairpin primer formed in the palindromic region of
the terminal repeat (Figure 1-1). Strand elongation proceeds from the
3' end of the primer, in a 5' to 3' direction, to the other end of the
molecule. A specific nick is required in the parental strand at a point
directly across from the original 3' terminal base to allow repair of
the parental terminal sequences and to produce a full-length duplex
replicative intermediate. Subsequently, both the parental and progeny
strands are capable of initiating a second round of DNA replication and
displacing a progeny single-stranded DNA molecule.
Rescue of Latent AAV Provirus
AAV is a defective parvovirus and requires the presence of a co
infecting helper virus for a productive viral infection. Virtually any
member of the adenovirus or herpes virus family can supply the helper
functions (Atchison et al.. 1965; Buller et al.. 1981; McPherson et al..
1985). In the absence of a helper virus, AAV readily integrates into
the host DNA (Hoggan et al.. 1972; Berns et al.. 1975; Handa et al..
1977), either as a single proviral copy or more often as a tandem head
to tail array of several AAV genomes (Cheung et al., 1980; Laughlin et
al., 1986; McLaughlin et al.. 1988). Super-infection of latently
infected cells with helper virus results in the rescue of integrated
provirus and normal AAV replication (Hoggan et al.. 1972).
In many proviral cell lines the yield of replicative intermediates
and virus produced by superinfection with helper virus are identical to
those obtained from exogenous AAV infections (Laughlin et al.. 1986;
McLaughlin et al.. 1988). This suggested that the rescue of AAV
sequences from chromatin is a rapid event initiated by specific cleavage


5
within the AAV termini. Additional evidence that AAV rescue involves a
site-specific nuclease comes from the study of recombinant AAV plasmids
which, presumably, rescue by a mechanism similar to that used by
proviruses integrated into chromatin (Samulski et al.. 1982). When AAV-
pBR322 plasmids are transfected into human cells in the presence of
adenovirus, free linear duplex AAV DNA, the major replicative form
(Straus et al.. 1976; Hauswirth and Berns, 1977), is seen within 24
hours (Samulski et al.. 1982). However, when viable terminal deletion
mutants are transfected into adenovirus infected cells, the formation of
replicative forms (RF) is delayed (Samulski et al.. 1983; Lefebvre et
al., 1984, Samulski et al.. 1987), indicating that either gene
conversion of the terminal deletion causes a delay in DNA synthesis, or
that AAV sequences at the termini are required for excision. Studies
with the AAV mutant, psub201+, in which the terminal 13 bp have been
deleted from both ends, suggest that the delay in RF formation is due to
a defect in rescue (Samulski et al., 1987) and that the signal for AAV
excision resides in the terminal sequences. AAV DNA replication in
adenovirus infected cells transfected with psub201+ was eight-fold more
efficient when the AAV sequences were cleaved from the vector sequences
prior to transfection (Samulski et al.. 1987). Presumably, cleavage of
the plasmid bypassed the excision step which must normally precede DNA
replication.
In principle, the duplex replicative intermediate can be generated
from the covalently closed form I plasmid DNA in one of two ways.
Either the AAV sequences are separated from the plasmid by precise
excision or a single-stranded DNA molecule is generated by AAV-specific
replication. (See Samulski et al.. 1983, and Senepathy et al.. 1984,


6
for examples of the second mechanism.) Because the AAV termini are also
the origins for AAV DNA replication (Hauswirth and Berns, 1977; Samulski
et al. 1983; Senepathy et al.. 1984), it is difficult to distinguish
between the two mechanisms. Both mechanisms, however, require either a
specific nick or a double-stranded cut at an AAV/vector junction in the
input plasmid DNA (Figure 1-1). Thus, it should be possible to use AAV
recombinant plasmids as substrates for an in vitro excision assay and to
screen cellular extracts for an activity that produces either single-
stranded nicks or double-stranded cuts at the AAV/vector junctions.
General Aim of the Studies
Using the recombinant AAV plasmids as substrates, an enzyme
fraction was isolated from HeLa cell nuclear extracts that rescued
intact AAV DNA from vector DNA in vitro and produced linear DNA
products. The double-stranded cleavage activity has been called endo R
because of its ability to rescue AAV sequences. The activity was of
cellular origin and was stimulated approximately 5 fold by Ad2 infection
in the presence of hydroxyurea.
In the following chapters, the purification and properties of the
enzyme are discussed and the activity observed in vitro is compared with
what is observed in vivo. In addition, the behavior of the enzyme
suggests that it may be involved in cellular DNA metabolism, and these
properties are discussed as well.


CHAPTER II
MATERIALS AND METHODS
Cell Culture and Viruses
HeLa S3 cells were maintained at 37C in suspension culture in
Eagles minimal essential medium supplemented with 5% calf serum, 1%
glutamine, penicillin and streptomycin. Wild type adenovirus 2 (Ad2)
was prepared from a freeze/thaw lysate of HeLa S3 cells as previously
described (Samulski et al.. 1983). HeLa monolayer cells were
transfected with 5.0 /g DNA by the DEAE-dextran method (McCutchan and
Pagano, 1968) as described (Muzyczka, 1980), and infected with Ad2 virus
at a multiplicity of infection (moi) of 10. Low molecular DNA was
isolated from the cells by the method of Hirt (1967) as described
(Muzyczka, 1980).
Recombinant Clones and Enzyme Substrates
All recombinant clones were maintained in either the recA host
HB101 (Boyer, 1969) or the recBC. recF. sbcB host JC8111 (Boissy and
Astell, 1985), a gift from Peter Tattersall. This was to prevent
variation in the size of the G:C tails and other repetitive inserts
(Hauswirth et al., 1984) and to prevent deletion of the palindromic AAV
terminal repeat (Samulski et al.. 1982).
The AAV wild-type plasmid pSM620 contains a full copy of the AAV
genome inserted by GC tailing into the PstI site of pBR322 (Bolivar et
al., 1979). The plasmid contains 18 bp of poly(dG):poly(dC) (G:C) at
7


8
the left pBR322/AAV junction and 28 bp of G:C at the right junction
(Samulski et al.. 1983). The AAV terminal mutant clone, pSM703, was
isolated by Samulski et al. (1983) and was sequenced as part of this
study. It contains 100 bp deletions in both AAV terminal sequences, 38
bp of G:C tail at the right AAV/pBR junction, and 36 bp G:C at the left
junction. The plasmids pGM620C and pGM620D contain either the left or
the right terminal PstI fragment, respectively, of the wild-type AAV
plasmid, pSM620 (Samulski et al.. 1983), subcloned into the PstI site of
pBR322 (Bolivar et al., 1979). Both clones contain the original
poly(dG)-poly(dC) tails that are present in pSM620. The plasmid pGM1008
was constructed by removing the Pstl-BssHII fragment (AAV nucleotides
4254 to 4657) from pGM620D and religating the molecule after producing
blunt ends with the Klenow fragment of DNA polymerase I. The plasmid
contains the parental poly(dG)-poly(dC) tail plus the terminal 21 bp of
the AAV sequence up to the BssHII site at nucleotide 4657.
The plasmids pGM913, pGM1116, pGM1505, pGM1635, pGM1228, pGM1344
and pGM1483 were constructed by inserting chemically synthesized
oligonucleotides (Systec) into a unique restriction site in pBR322. To
construct these clones, 2 pmol of single-stranded oligomer was boiled
with an equal amount of the appropriate complementary strand in 20 /il of
water for 5 minutes. The reaction was then cooled slowly to room
temperature to allow the formation of duplex molecules. Ligation
reaction mixtures containing 2 pmol of annealed oligomer, 0.2 pmol of
PstI linearized pBR322 and 400 units of T4 DNA Ligase (New England
BioLabs) were incubated at 15C for 12-24 hours. The 5' ends of the
single-stranded oligomers were phosphorylated only when multiple tandem
copies of the insert were desired. Dephosphorylation of the vector was


9
generally not required under these conditions. Positive clones retained
tetracycline resistance, but were sensitive to ampicillin.
The plasmids PGM913 and pGM1116 contain 13 and 9 base pairs of G:C
homopolymer, respectively. PGM1635 contains 20 bp of alternating
copolymer GC, and pGMl505 contains the Dictyostelium telomeric repeat
sequence (C2-6^5 (^hampay ejt_al. 1984). Two plasmids contain the
sequence of the terminal 21 bp of AAV (ggCCaCTCCCTCTCTgCgCgC), in either
a monomer form (pGM1228) or as an inverted dimer (pGM1344). All of the
above clones were constructed by inserting the oligomers into the PstI
site of pBR322. Additionally, the plasmid pGM1483 contains an insert of
the Tetrahymena telomeric sequence, (0^2)3 (Blackburn and Szostak,
1984), chemically synthesized and inserted into the EagI site of pBR322.
In each case, both strands of the oligonucleotides were synthesized so
that the restriction enzyme recognition site was maintained after the
two strands of each oligonucleotide were annealed and ligated into
pBR322. The inserts and pBR322 flanking sequences of these plasmids
were confirmed by DNA sequencing.
The plasmid pGA38, a gift from Todd Evans, contains an insert of
the alternating co-polymer (GA^g, cloned into the EcoRI site of pUC9
(Evans and Efstratiatis, 1986). PGA11 is a subclone of pGA38 and
contains an insert of (GA)-q cloned into the EcoRI site of pUC9. The
plasmid pEV136, a gift from Eckhardt Wimmer, is an infectious polio
clone and contains an 18 bp G:C insert at the EcoRI site, as well as an
84 bp stretch of poly(dA):poly(dT) (Semler et al.. 1984).


10
Purification of Endo R
All operations were carried out at 0-4C. To minimize the effects
of proteolysis, all buffers contained 0.1 mM phenylmethylsulfonyl-
fluoride (PMSF) and the time between chromatographic steps was kept to a
minimum. Nuclei from eight liters of adenovirus infected HeLa S3 cells,
grown in the presence of 10 mM hydroxyurea (Sigma Chemical Co.), were
isolated as described by Challberg and Kelly (1979). Frozen nuclei were
thawed on ice and 5 M NaCl was added to a final concentration of 0.2 M.
After incubation on ice for 2 hours, the nuclei were pelleted by
centrifugation at 3000 x g for 15 minutes, the pellet was discarded and
the supernatant was dialyzed against 25 mM Tris-HCl pH 8.0, 10 mM KC1,
0.1 mM EDTA, 5 mM 2-mercaptoethanol, 0.1 mM PMSF and 20% glycerol
(Buffer A). Any insoluble precipitate in the nuclear extract was
removed by centrifugation at 12000 x g for 20 minutes and the
supernatant was retained as fraction I. Fraction I contained 34.2 mg/ml
protein, as determined by the Bradford protein concentration assay
(Bradford, 1976), in a volume of 25 ml.
Fraction I was loaded onto a 15 ml DEAE cellulose column
previously equilibrated with buffer A, pH 8.0. The column was then
washed with 3 column volumes of buffer A and eluted in the same buffer
with a 150 ml linear gradient containing 0.01 to 0.5 M KC1. Fractions
emerging between 0.1 and 0.25 M KCl were pooled to form fraction II and
contained 2.7 mg/ml protein a total volume of 60 mis. Fraction II was
dialyzed against two 1-liter changes of buffer B (10 mM sodium
phosphate, pH 6.5, 5 mM 2-mercaptoethanol, 10% glycerol and 0.1 mM PMSF)
containing 0.01 M NaCl and loaded onto a 7 ml phosphocellulose column
pre-washed with 21 mis of the same buffer. The column was eluted with a


11
70 ml linear gradient from 0.01 to 1 M NaCl in buffer B. Active
fractions emerged about halfway through the gradient and were pooled to
form fraction III. Fraction III contained 0.16 mg/ml protein in 45 ml
and had a specific endo R activity of approximately 3000 units/mg.
Fraction III was split into 2 aliquots and each aliquot was concentrated
about 55 fold using an Amicon Centriflo 25 spin concentrator, yielding a
final protein concentration of 18 mg/ml in 2.0 ml. The two 1.0 ml
aliquots of concentrated fraction III were passed separately through a
36 ml (1.5 x 45 cm) column of Sephadex G200 equilibrated with buffer B,
pH 6.5, 250 mM NaCl. Fractions containing endo R activity were pooled
(fraction IV), dialyzed against buffer B containing 0.01 M NaCl and
loaded onto a 3 ml poly(dG) agarose column equilibrated in buffer B, 10
mM NaCl. The column was washed with 3 bed volumes of the same buffer
and eluted with a 30 ml linear gradient from 0.01-1.0 M NaCl. Active
fractions were pooled (fraction V) and dialyzed into 25 mM Tris-HCl, pH
7.5, 50% glycerol, 0.1 mM DTT. Fraction V was stable for at least 2
months at -20C without measurable loss of activity.
Nuclease Assays
The standard endo R reaction mixtures of 25 /I contained 20 mM
Tris-HCl (pH 7.5), 5 mM MgC^, 1 mM dithiothreitol, 0.2 pmol form I
plasmid substrate and 0.1-5.0 units of endo R (see below). After
incubation at 37C, the reaction products were phenol extracted, ethanol
precipitated and digested with either BstEII at 60C for 1 hour or with
SphI at 37C for 3 hours. The reaction products were then fractionated
by electrophoresis on 1.4% agarose gels. One unit of endo R activity is
defined as that amount of protein that is required to cleave 50% of


12
pGM620D substrate under standard conditions. During early stages of the
purification, it was necessary to treat the reaction products with 0.25
mg/ml proteinase K (Sigma) for 1 hour at 37C prior to phenol extraction
and gel electrophoresis. When indicated, endo R cleavage reactions were
terminated with the addition of an equal volume of a 2x proteinase K
stop solution, containing 0.5 mg/ml Proteinase K, 1% SDS and 20 mM EDTA.
After addition of the stop solution, incubation was continued at 37C
for at least 1 hour.
Single-stranded nuclease assays contained 5.0 pg of heat-denatured
^H-labeled E. coli chromosomal DNA (1 x 10^ cpm/pg) in 250 pi. For SI
nuclease, the mixtures contained 50 mM sodium acetate (pH 4.5), 0.3 M
NaCl, 10 mM ZnC^, and 1.25 units of SI, while the endo R reaction was
under standard reaction conditions. Twenty-five microliter portions
were removed at the indicated times and added to 2ml of 10%
trichloroacetic acid (TCA) containing 200 pg/ml BSA. The precipitates
were collected on nitrocellulose filters (Schleicher and Schuell type
BA85), washed with TCA and ethanol and then counted. E.coli DNA was
O
labeled with H-thymidine (6.7 Ci/mmole, ICN) and isolated as described
(Holloman et al., 1981).
DNA Labeling. Sequencing and Primer Extension
Nucleotide sequences were determined by the method of Maxam and
Gilbert (1977) and by the dideoxy method (Sanger et al.. 1977). For
Maxam and Gilbert sequencing of the pGM clones, 10 pg of DNA was
linearized with Seal. dephosphorylated with calf intestine alkaline
phosphatase (CIAP) and labeled at the 5' end with polynucleotide kinase
o o 30
and 7 P-ATP or labeled at the 3' end with the Klenow fragment, a P-


13
dCTP and 80 /iM each of dGTP, dATP and TTP. Five micrograms of the
labeled DNA was further digested with BamHI and the 5' or 3' labeled
Scal-BamHI fragments were isolated from 1.2% low melting agarose prior
to sequencing. Endo R cleavage fragments were prepared by incubating
the remaining 5 /tg of 5' or 3' labeled DNA with 10 units of fraction V
endo R under standard reaction conditions and isolating the labeled endo
R/Scal fragments from a 4% non-denaturing acrylamide gel as described
(Maniatis et al.. 1982). The sequence at the site of cleavage was
determined directly from the sequencing gels by comparing the mobility
of the endo R fragments and the sequence markers.
For primer extension of endo R products, 2 /ig of plasmid DNA was
incubated with endo R in a standard reaction mixture of 50 /il. The form
III product was then isolated from 1.2% low melting agarose and
dissolved in 10 /il of water and 4 /tl of 5x reaction buffer (0.3 M Tris-
HC1, pH 8.3; 0.375 M NaCl; 37.5 mM MgCl2 and 2.5 mM DTT). The reaction
mixtures were divided into two 7 /il portions and 1 /il of either upper or
lower strand pBR322/PstI primers (2 pmol//il) was added to each portion.
The solutions were heated to 100C for 5 minutes under parafin oil and
immediately frozen in a dry ice/ethanol bath. After thawing on ice, 1
/tl each of stock solutions containing 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM
TTP, 0.02 mM dATP; 10 /iCi//il a32P-dATP (>3000 Ci/mM) and 10 units//il AMV
reverse transcriptase (IBI) were added to each portion to produce a
final reaction volume of 10 /il. After incubation at 42C for 10
minutes, 2 /il of chase solution (0.25 mM each of dGTP, dATP, dCTP and
TTP) was added and incubation was continued at 42C for an additional 10
minutes. The reaction was terminated with the addition of 7 /il of stop
buffer containing 1.6 /il 0.25 M EDTA; 2 /tl 3 M sodium acetate; 0.2 /il 2


14
mg/ml tRNA and 3.2 pi water. After ethanol precipitation with 3 volumes
of 95% ethanol, the primer extension products were redissolved in 5 pi
of sequence gel running buffer (Maxam and Gilbert, 1977) and heated to
100C for 3 minutes prior to gel electrophoresis. The sequence at the
site of endo R cleavage was determined by comparing the mobility of the
primer extension products with dideoxy sequencing ladders produced using
identical single-stranded primers.
Gel Electrophoresis
Electrophoresis in the presence of sodium dodecyl sulfate was done
according to Laemmli (1970) in slab gels of 7.5% acrylamide, 0.2% N,N'-
methylene-bisacrylamide. The gels were fixed in 50% methanol overnight
and silver stained as described (Switzer et al.. 1979).
Neutral polyacrylamide and agarose gel electrophoresis of DNA was
as described (Muzyczka, 1980). DNA fractionated on agarose gels were
transferred to nitrocellulose filters (Southern, 1975) and hybridized to
o o o
P-nick translated DNA probe (>2x10 cpm/pg) as described (Muzyczka,
1980).
Denaturing polyacrylamide-urea gels were as described (Maxam and
Gilbert, 1977). All sequencing gels were run at 55-60C to prevent
compression of palindromic sequences (Lusby et al.. 1980).
For denaturing agarose gels, 1.5% horizontal agarose gels were
poured in 50mM NaCl and allowed to equilibrate in excess running buffer
(30 mM NaOH, 1 mM EDTA) for at least 1 hour. Samples were incubated for
5 minutes in gel running buffer (Maniatis et al.. 1982) containing 0.2 N
NaOH prior to electrophoresis at 30 volts for at least 24 hours.


15
Estimation of the Isoelectric Point
Estimation of the pi of endo R was performed by a modified version
of the method by Yang and Langer (1987). Eight 100 /il aliquots of
packed DEAE-cellulose (Whatman DE32) was equilibrated in 0.1 M Tris-HCl
at pH 7.0, 7.5, 8.0 or 8.5 or in 0.1 M 2, 2'-Bis(hydroxymethyl)-
2,2',2''-nitrilo triethanol (Bis-Tris) at pH 5.5, 6.0, 6.5 or 7.0. This
required several changes of buffer until no change in the pH of the
supernatant was observed. After equilibration, the cellulose was packed
by centrifugation at 1000 x g for 1 minute and the supernatant was
decanted. Mixtures of 20 /il of fraction III endo R and 80 /il of 0.1 M
Tris or 0.1 M Bis-Tris buffer, at the appropriate pH, were added to the
packed resin and the samples were incubated on ice for 30 minutes with
frequent mixing to allow the protein to adsorb to the resin. After
pelleting at 1000 x g for 1 minute, the supernatant was removed and
assayed for endo R double-stranded cleavage activity as described above.
The pi was determined to be equal to the lowest pH at which all the
activity had been adsorbed from the supernatant.
Chromatographic Media. Enzymes and Materials
DEAE-cellulose (DE32) and phosphocellulose (P-11) were purchased
from Whatman. Sephadex G200, poly(dG) agarose, and calf intestine
alkaline phosphatase (CIAP) were from Sigma and Bio-Gel A1.5M was
purchased from BioRad. All restriction endonucleases, T4 DNA ligase and
polynucleotide kinase were purchased from New England Biolabs. The
labeled nucleotides, a^^P-dNTPs and y^P-ATP (>3000 Ci/mmol) were from
New England Nuclear and H-thymidine (6.7 Ci/mmol) was from ICN.


16
Other Methods
Protein concentrations were determined by the procedure of
Bradford (1976). The Biogel A1.5M (45.5 x 0.7 cm) and the Sephadex G200
(45.5 x 1.0 cm) columns were calibrated in 10 mM NaP04, pH6.5; 0.25 M
NaCl; 10% glycerol and 5 mM 2-mercaptoethanol. The excluded volume was
determined with the use of Blue Dextran 2000 (molecular weight >2
million, Sigma) and the column was calibrated with the use of B-amylase
(200 kd), alcohol dehydrogenase (150 kd), BSA (66 kd), carbonic
anhydrase (29 kd) and cytochrome C (12.4 kd) as molecular weight
standards (Sigma Chem. Co.).
Estimate of In Vivo Excision Frequency
A typical transfection uses 0.1-10 /ig of plasmid DNA per 10 cm
dish or approximately 3xlO^-3xloH molecules per dish. Assuming 10^
3 5
competent cells per dish, each competent cell will have 3x10 -3x10
molecules of plasmid DNA. This agrees reasonably well with the amount
of plasmid DNA recovered from transfected cells as measured by filter
hybridization. If the in vitro frequency of cleavage by endo R at an
outboard site of AAV is 1%, cleavage at both outboard sites to produce
an intact replicative form would be 0.01%. This would produce 0.3 to 30
molecules of excised AAV per transfected cell.


CHAPTER III
PURIFICATION OF ENDO R
Detection of a Site-Specific Endonuclease Activity
in Crude Nuclear Extracts
The results from studies of AAV replication in vivo from latently
infected cells and transfected AAV plasmids suggest that rescue from
chromatin and from recombinant plasmids occurs by a similar mechanism
(Samulski et al., 1982) and that the sequences at or near the AAV
termini are essential for this excision activity (Samulski et al.,
1987). Taking these observations into account, the wild type AAV
plasmid, pSM620, was used as a substrate to assay for an activity that
would specifically excise AAV sequences from the plasmid. The plasmid
pSM620 contains the entire AAV genome cloned into the PstI site of
pBR322 by GC tailing (Samulski et al.. 1982). To detect site-specific
cleavage at the AAV/vector junction, form I supercoiled DNA was treated
with cell-free extract and digested with a one-cut restriction enzyme
that cleaves either in the AAV sequences (BstEII) or in vector DNA
(SphI). The products of the assay were then fractionated by agarose gel
electrophoresis. Figure 3-1 illustrates the fragments that would be
produced if cleavage occurs at either the left or right AAV/pBR
junction. For example, cleavage with cellular extract at the right
junction would generate a linear plasmid DNA molecule which, after
BstEII digestion, would produce a 3.0 kb fragment which consists
exclusively of AAV DNA and a reciprocal 6.1 kb band that contains both
AAV and pBR sequences.
17


Figure 3-1. Endo R Agarose Gel Assay.
The figure illustrates the products that would result from partial
digestion by endo R and complete digestion by BstEII (left pathway) or
Sohl (right pathway) when the wild type plasmid, pSM620, is used as
substrate. The thick line represents AAV DNA; the thin line represents
pBR322 DNA; vertical lines represent cleavage sites of BstEII (B) SphI
(S), and endo R (R). The filled squares represent the AAV terminal
sequences. AAV cleavage occurs at the junction between the AAV termini
and the vector DNA.


19
R+Bst
i
3.0
1.7 B 7.4
1.7 9 3.0
e.o S 3#1
M--1
1.3 S 3.1
4.4
4.7


20
Using the agarose gel assay, crude extracts prepared from Ad2
infected, Ad2/AAV co-infected and uninfected HeLa cell nuclei were
screened for the ability to cut near the AAV/vector junctions and the
products were visualized by transfer to nitrocellulose filters and
hybridization to AAV specific probe (Southern, 1975). Specific double-
stranded cleavage activity was observed in uninfected and Ad/AAV co-
infected cells at comparable levels. However, a 5-fold stimulation was
observed in extracts from Ad2 infected cells treated with hydroxyurea.
Whole cell extracts and extracts prepared from a 0.2 M NaCl wash of
freeze-fractured nuclei (Challberg and Kelly, 1979) contained
approximately equal amounts of activity, while nuclear extracts usually
contained fewer contaminating nucleases. For these reasons, nuclear
extracts from Ad2-infected HeLa cells treated with hydroxyurea were used
as the primary source of activity.
Purification of Endo R
In the procedure outlined in Table I, crude nuclear extracts
(fraction I) were prepared from Ad2-infected HeLa S3 cells, grown in the
presence of lOmM hydroxyurea, and harvested at 21 hours post-infection
(Challberg and Kelly, 1979). Due to the high level of contaminating
endonucleases and cellular DNA (Figure 3-2), specific double-stranded
cleavage activity could be detected at this stage only by Southern
hybridization (Southern, 1975). Fraction I was applied to a column of
DEAE cellulose and the activity that was eluted from the column was
essentially free of nucleic acid and separated from at least one
nonspecific cellular nuclease which did not bind to the column.
Fraction II endo R activity (and the activity in subsequent fractions)


21
TABLE I
PURIFICATION OF ENDO R
Fraction
Volume
Activity
Protein3
Specific
Activity
ml
units
mg
units/mg
I.
Nuclear Extract
25.0
60000
855.0
70
II.
DEAE-cellulose
60.0
60000
159.6
376
III.
Phosphocellulose
47.5
48000
38.5
1247
IV.
Sephadex G200
19.8
10000
9.1
1099
V.
Poly(dG) agarose
3.6
9000
2.9
3103
aProtein concentrations were determined by the method of Bradford (1976).


Figure 3-2. Enzyme Titration of Fractions I, II and III.
Standard reaction mixtures of 25 /I contained 0.1 pmol of pSM620 form I
plasmid and the indicated amounts (/l) of nuclear extract (NE, Fraction
I), DEAE-cellulose fractions (DEAE, Fraction II) or phosphocellulose
fractions (Pcell, Fraction III). Reactions were terminated at 1 hour
with the addition of proteinase K stop solution (see Chapter II), phenol
extracted, ethanol precipitated and digested with BstEII. The samples
were fractionated on a 1.4% agarose gel, transferred to a nitrocellulose
filter and hybridized to AAV-specific probe.


23
NE DEAE | -* Pee 11 *
1.0 2.5 5.0 7.5 0.5 1.0 2.5 5.0 7.5 0.3 0.5 1.0 2.5 5.0 7.5 10


24
could be detected directly by ethidium bromide staining of the gel assay
(Figure 3-2). Active fractions from DEAE cellulose chromatography
usually contained an overlapping peak of nonspecific nucleolytic
activity. Further fractionation on a column of phosphocellulose
produced an activity (fraction III) that exhibited substantially more
specific cleavage with little evidence of contaminating nucleolytic
activity at low enzyme concentrations (Figure 3-2). Nevertheless, high
levels of fraction III enzyme resulted in non-specific degradation of
the DNA substrate (data not shown). In order to separate the remaining
contaminating nucleolytic activities from endo R, fraction III was
further purified by chromatography on Sephadex G200 (fraction IV) and
poly(dG) agarose (fraction V). Endo R activity emerged from the
Sephadex G200 column just behind the void volume. This step resulted in
a substantial loss of total endo R activity, but has been retained as
part of the purification protocol for qualitative purposes. Endo R
emerges from the final column, poly(dG) agarose, as a single symmetrical
peak, when eluted with a linear increasing salt gradient, with little
additional loss of activity.
Fraction IV endo R is stable for at least 2 months at
-20C without measurable loss of activity. The stability of the enzyme
is greatly reduced when the concentration of protein falls below 200
/ig/ml. For this reason, fraction V enzyme is dialyzed into buffer
containing 50% glycerol and supplemented with 200 /ig/ml enzyme grade BSA
for periods of storage of up to 2 months at -20C.


25
The Endo R Agarose Gel Assay
For the purposes of the gel assay, endo R can be thought of as a
restriction enzyme with two sites in pSM620 (Figure 3-1). The products
of endo R digestion can be seen as the products of a partial digestion
of the substrate at either of the AAV/vector junctions. Further
digestion of endo R products with the restriction enzyme BstEII. which
cuts once asymmetrically in the AAV sequences, produces 6.1 and 3.0 kb
fragments from endo R cleavage at the right AAV/pBR322 junction and 7.4
and 1.7 kb fragments from cleavage at the left junction. The formation
of endo R products, using the plasmid pSM620 as substrate, is
illustrated in figure 3-3 with the titration of partially purified
enzyme (fraction III). As the reaction nears completion, most of the
AAV/vector junctions are cleaved and produce the fragments expected from
cleavage by BstEII and endo R. Linear fragments (form III) are the
result of BstEII digestion of unreacted substrate. In further
discussion, the production of the 3.0 and 1.7 kb fragments, which are
easily monitored, is used to quantitate the amount of cleavage at the
right and left junctions, respectively.
Molecular Size and Purity of Endo R
Estimates of the molecular weight of the native protein were made
by chromatography of endo R on gel filtration columns and by
centrifugation in glycerol gradients. The peak of endo R activity
emerges from a Bio-Gel A1.5M column (see Chapter II: Materials and
Methods) behind the 150 kdal alcohol dehydrogenase molecular weight
marker with an apparent molecular weight of 120-125 kdal (data not
shown). This is in good agreement with the observed behavior in a


Figure 3-3. Enzyme Titration of Fraction III.
The numbers at the top refer to the number of units of endo R used in a
each reaction (see Chapter II: Materials and Methods). The sizes of the
major cleavage fragments are indicated on the right. Standard endo R
reaction mixtures (25 1) contained 0.5 ng of form I pSM620 plasmid DNA,
5 mM MgCl2, 20 mM Tris-HCl (pH 7.5), 1 mM DTT, and the indicated amount
of fraction III enzyme. After incubation for 1 hour at 37C, the
reaction products were treated with phenol, precipitated with ethanol,
and digested with BstEII. The reaction mixture was then fractionated on
a 1.4% agarose gel, transferred to a nitrocellulose filter and
hybridized to nick-translated ^P-AAV DNA.


27
-1.7


28
glycerol gradient (Figure 3-4A), in which the peak of double-stranded
cleavage activity sedimented slightly more slowly than the 150 kdal
marker. The sedimentation results correspond to an empirically
determined sedimentation coefficient (S20 w) of 6.8 (Figure 3-4B) and a
molecular weight of 115 kd, assuming a spherical structure of the
enzyme.
Pooled fractions from the poly(dG) agarose column, fraction V
(Figure 3-5A, fractions 15-21), contain one major and 4 minor protein
bands when analyzed by SDS polyacrylamide gel electrophoresis and silver
staining. However, when individual fractions across the peak of endo R
activity were analyzed on SDS gels (Figure 3-5B) and compared with the
activity profile in the agarose gel assay (Figure 3-5A), the pattern of
the major 100,000 molecular weight band was most consistent with the
profile of specific cleavage activity. In addition, two other proteins
of minor intensity, with molecular weights of 56 and 89 kd, appeared in
a subset of the active fractions in a pattern not inconsistent with the
activity profile (Figure 3-5C). As a result, it is possible that these
peptides are responsible for the cleavage activity or contribute either
as minor subunits or accessory peptides. It is also possible that the
56 and 89 kd peptides are proteolytic breakdown products of the major
100 kd protein. Attempts to purify endo R further or to isolate an
active form from a non-denaturing acrylamide gel have been unsuccessful,
probably due to the instability of the protein at low concentrations or
to the loss of subunits and/or accessory proteins.


Figure 3-4. Sedimentation Analysis of Endo R by Glycerol Gradient
Centrifugation.
A. Glycerol gradients (20-40%), in 0.1 M Tris-HCl, pH 7.5, 0.1 mM DTT
were prepared in 5 ml polyallomer ultracentrifuge tubes. One milligram
of fraction III endo R was combined with 0.25 mg of alcohol
dehydrogenase, in 0.2 ml 0.1 M Tris-HCl, pH 7.5, 0.1 mM DTT. The
mixture was layered on top of a glycerol gradient and the tube was
centrifuged for 30 hours at 45,000 rpm and 4C in a Beckman SW 50.1
rotor. Three other gradients containing endo R fraction III alone, a
mixture of the molecular weight standards B-amylase (200 kd) and BSA (66
kd), or alcohol dehydrogenase (150 kd) were run in parallel. Fractions
were collected from the bottom of the tube and the absorbance at 280nm
was determined (open circles). Fractions from gradients containing endo
R were also assayed for double-stranded cleavage activity using the
standard excision assay (filled squares). Sedimentation is from right
to left. B. The sedimentation coefficient (S20 y) of endo R was
determined from a plot of the mobility of each protein, represented as a
fraction of the total gradient length, against the S20 y literature
values (CRC Handbook of Biochem., 1979) of the following protein
standards: B-amylase (sweet potato, 8.9), alcohol dehydrogenase (yeast,
7.61), bovine serum albumin (4.41).


Absorbance (280nm)
30
Activity (


Figure 3-5. Molecular Weight and Purity of Endo R.
A) Agarose gel assay of peak fractions from poly(dG) agarose (Fraction
V). Reaction mixtures of 25 pi containing 0.1 pmols of BstEII digested
pSM620 DNA were incubated with 5 pi of the fraction indicated under
standard reaction conditions. The reactions were stopped after 1 hour
with the addition of 1/10 volume of gel running dye containing 0.2 M
EDTA and 1% SDS and then fractionated on a 1.4% agarose gel. B) SDS
polyacrylamide gel electrophoresis of peak fractions from poly(dG)
agarose. A constant volume (20 /il) of the fractions indicated were
added to an equal volume of 2X sample buffer, heated to 100C for 3
minutes and separated on an SDS acrylamide gel as described in Chapter
II: Materials and Methods. A parallel slot contained the following
protein standards: B-amylase (205 kd), alcohol dehydrogenase (116 kd),
phosphorylase b (97 kd), bovine serum albumin (66 kd), egg albumin (45
kd), and carbonic anhydrase (29 kd). C) Molecular weights of the
peptides in Fraction V endo R. Poly(dG) agarose fractions 15-23 were
pooled to form fraction V and the molecular weights of the protein
species present were determined from their relative mobilities on an SDS
gel. Open circles represent the molecular weight standards described
for B; filled circles are endo R fraction V proteins.


32
11 13 15 17 19 21 23 25 27 29 31


33
11 13 15 17 19 21 23 25 27 29 31 M
- 205
45
Figure 3-5 (continued), part B


Molecular Weight x10
Figure 3-5 (continued)
part C


CHAPTER IV
RESCUE OF AAV SEQUENCES
Localization of the Site of Cleavage to the AAV/Vector Junction
The excision of AAV sequences by a site specific endonuclease must
be rather precise in order to produce substrate forms that are capable
of replication without further modification. While minor deletions of
the terminal sequences incurred during rescue can be repaired through
gene conversion (Samulski et al.. 1983), a major deviation in the site
of cleavage would produce replicative forms that either lacked the
ability to self-prime, or contained extraneous vector DNA that would
have to be further processed prior to DNA replication. Therefore, an
enzyme postulated to be responsible for AAV rescue in vivo must take
these constraints on the site of cleavage into account.
To demonstrate that the site of cleavage was at the AAV/pBR322
junction, the products of the endo R reaction were hybridized to AAV-
and pBR322-specific probes (Figure 4-1). Specific cleavage occurring
precisely at the AAV/vector junction would produce a subset of fragments
that consisted of AAV or pBR322 sequences exclusively, and these could
be identified by probing duplicate Southern blots (Southern, 1975) with
AAV or pBR322 DNA (Figure 4-1, right panel). In this experiment,
reaction conditions were chosen to cleave 90% of the substrate (form I
pSM620) at least once. When the products of the reaction were examined
by ethidium bromide staining without further digestion with a
restriction enzyme, most of the product formed was linear plasmid DNA
35


Figure 4-1. Identification of AAV-Specific and pBR-Specific Fragments
in the Endo R Reaction.
PSM620 substrate was incubated with fraction IV enzyme in a standard
endo R reaction (R). Where indicated the reaction products were also
digested with BstEII or SphI. The products were fractionated in
duplicate on 1.4% agarose gels, transferred to nitrocellulose filters,
and hybridized to either AAV-specific or pBR-specific probe (right
panel). The endo R plus BstEII and endo R plus SphI fragment sizes are
indicated to the left and right of the right panel, respectively. The
left panel illustrates the reaction products stained with ethidium
bromide. Also indicated in the left panel are the sizes and positions
of the marker bands (M) and pSM620 relaxed circular (II) and linear
(III) plasmid DNA. The two unidentified lines to the right of each
panel indicate the position of linear AAV (upper) and linear pBR (lower)
DNA.


37
4
1=1
(/>
Q.
CD
C/)

-
o:
r
Bst
9.1 .
7.4
6.1 '
AAV
pBR
N
N
03 CO
+ +
a: cr tr
x:
a.
CO

03
+ +
a: cc ce
-Pa8 "
Sph
9.1
_7.8
-6-0
3.0 -
-3.1
J.3


38
(Figure 4-1, left panel, lane R). In addition, approximately 3% of the
products consisted of two fragments, 4.7 and 4.4 kb in length, which
were the sizes expected for excised duplex AAV and linear pBR322 DNA.
These were produced from double-stranded cleavage at both of the AAV/pBR
junctions. The identity of these fragments was confirmed by Southern
hybridization with selective probes. The slower migrating 4.7 kb
fragment hybridized exclusively to AAV-specific probe and the 4.4 kb
linear fragment hybridized only to pBR-specific probe (Figure 4-1, right
panel, R lanes). The fragments generated by further digestion of the
endo R products with either BstEII or SphI (see Figure 3-1) produced a
set of fragments consistent with endo R cleavage at either one or the
other of the AAV/pBR322 junctions. The 3.0 and 1.7 kb fragments
produced from BstEII digestion of endo R products contained only AAV
sequences and, therefore, hybridized only to AAV-specific probe.
Conversely, the digestion of endo R products with SphI generated 3.1 and
1.3 kb fragments, which consist entirely of pBR322 DNA, and were
detected only with pBR322-specific DNA probe. As expected, the higher
molecular weight fragments contain both AAV and pBR sequences and,
therefore, hybridize to both probes. These results, limited by the
sensitivity of hybridization, placed the position of the cleavage site
to within 25 bp of either AAV/vector junction.
Either AAV/Vector Junction Can Be Cleaved Independently of the Other
One proposed mechanism for gene conversion of AAV terminal mutants
to the wild type form requires the interaction between the two terminal
repeats (Lusby et al.. 1980; Samulski et al.. 1983). It was therefore
possible that cleavage by endo R required this type of interaction. To


39
determine if this was the case, subclones of pSM620, pGM620C and pGM620D
were constructed which contained either the left or right terminal
repeat of AAV, respectively (Figure 4-2C). In addition to the 145 bp
terminal sequence, both plasmids contained approximately 350 bp of
flanking AAV DNA. Both pGM620C and pGM620D were efficiently cleaved by
endo R and produced fragments of the expected size and sequence
composition when the endo R products were digested with SphI (Figure 4-
2, A and B). It was, therefore, concluded that either AAV/vector
junction could be cleaved independently of the other and that the
recognition sequence was contained within the terminal 500 bp of AAV.
Figure 4-2 also demonstrates that vector DNA, pBR322, is a poor
substrate for endo R.
Cleavage of AAV Terminal Mutants
A number of mutant AAV clones with deletions in the terminal
sequences were fortuitously produced during the course of constructing a
viable AAV recombinant clone (Samulski et al., 1983) To identify the
endo R recognition signal more precisely, the sequences at the
AAV/vector junctions for several of the mutant AAV plasmids were
determined and the relative frequencies of cleavage were compared
(Figure 4-3 and Table II). The conclusion from these studies was that
there were three sets of sequences near the AAV/vector junctions that
could serve as endo R recognition sites. The first was a stretch of
poly(dG) residues that was present at many of the junctions and was a
result of plasmid construction by GC tailing. A second sequence, which
was called the AAV recognition signal, consists of nucleotides 3 to 15
of the AAV terminal repeat and contains the sequence CCaCTCCCTCTCT.


40
TABLE II
RECOGNITION SITES FOR ENDO R
IN AAV PLASMIDS3
Junction
Relative
Frequency'3
(g)n + CCaCTCCCTCTCT
pSM620(L)
Vector- (g)19
CCaCTCCCTCTCTgCgCg -AAV
100
pSM620(R)
Vector- (g)29
CCaCTCCCTCTCTgCgCg -AAV
100
pSM621(R)
Vector- (g)29
CCaCTCCCTCTCTgCgCg -AAV
100
pSM703(R)
Vector- (g)38
CCaCTCCCTC|aCTaggg -AAV
150
pSM609(R)
Vector- (g)10
|CTCCCTCTCTgCgCgCTC -AAV
50
CCaCTCCCTCTCT
pSM621(L)
AAV- CCaCTCCCTCTCTgC|agC -Vector
1
pSM704(L)
AAV- CCaCTCCCTCTCTgC|agC -Vector
1
pSM609(L)
AAV- CCaCTCCCTCTCTgC|agC -Vector
1
(g)n
pSM703(L)
Vector- (g)36
|agTggCCaaCTCCaTCaC -AAV
150
aThe table lists the sequences at the AAV/vector junctions
and the frequency of cleavage of the AAV clones used to
determine the recognition site for endo R. The first two
bases of the AAV sequence in pSM620 (gg) are counted as
part of the poly(dG):poly(dC) tail. A vertical line (|)
indicates the position of the deletion in a mutant clone.
pSM704(R) and both pAVl plasmid junctions were not sequenced.
(R) and (L) depict the right and left AAV/vector junctions,
respectively. pSM620 and pSM609 had been previously
sequenced (Samulski, et al.. 1983) and the sequence of
pSM609(L), which was found to be incorrect, is changed
here. The remaining plasmids were sequenced as part of
this study.
^Indicates the approximate yield of the fragment resulting
from cleavage at the indicated site (Figure 4-3), where 100%
cleavage has been defined as the cleavage seen at pSM620(R)
No attempt was made to distinguish between the level of
cleavage observed at the junctions in each category.


Figure 4-2. Cleavage of Substrates That Contain Only One Copy of the
AAV Terminal Repeat.
C) Restriction maps of pGM620C and pGM620D. pGM620C contains the 513 bp
left terminal PstI fragment of the wild type AAV plasmid pSM620,
including the left AAV terminal repeat and the 19 bp poly(dG) tail.
PGM620D includes the right terminal repeat of AAV and the 29 bp GC tail
in a 445 bp PstI fragment subcloned from pSM620. Thick lines represent
AAV DNA, thin lines are pBR DNA, and the solid boxes are the AAV
terminal repeats. Also indicated are the positions of the endo R (R)
and SphI sites. A and B) 0.5 /g of pGM620C, pGM620D or pBR322
supercoiled plasmid DNA were incubated with fraction III enzyme as
described in the legend for Figure 3-3 and digested with SphI. The
reaction products were fractionated in a 1.4% agarose gel, stained with
ethidium bromide (panel A), transferred to a nitrocellulose filter and
hybridized to nick-translated AAV DNA probe (panel B). The position of
the marker bands (M) and the SphI digested endo R product bands are
indicated to the left and right of panel A, respectively. The 620 lanes
contain forms I, II, and III pSM620 plasmid DNA.


pGM 620 C pGM620 D
o
JO
ro (j) ^ oi
Oi (ji <7> 1
i i ill
ii ii
CH OI
OI CD 1
M
620
620 C
620 D
pBR
>
#
I
t
t I
M
620
620 C
0D
620 D
pBR
N)


43
Because the AAV terminal repeat is a palindrome, this sequence occurs
twice within each wild type terminal repeat, at nucleotides 3 to 15 and
109 to 121 (Lusby et al., 1980). The two copies have been designated the
outboard and inboard recognition sequences, respectively. The presence
of the inboard copy of this sequence accounts for the minor cleavage
band derived from the left end of AAV and seen at the 1.6 kb position in
virtually all of the plasmids shown in Figure 4-3. It is essentially
the 1.7 kb Endo R/BstEII fragment minus the first 100 bp of AAV DNA,
which is the distance between the outboard and inboard copies of the AAV
recognition sequence. In 3 junctions (pSM621(L), PSM704(L), and
pSM609(L); Figure 4-3 and Table II), the AAV cleavage site was the only
recognition sequence present because the deletion in these plasmids has
removed the poly(dG) tail and placed the inboard copy of the sequence
adjacent to vector DNA. Accordingly, the 1.6 kb band was the only
fragment seen in these plasmids as the result of cleavage at the left
end. Endo R cleavage of the left junction of the wild type clone,
pSM620(L), produced both the 1.6 and 1.7 kb bands because both the
inboard and outboard copies of the AAV recognition sequence were
present. Presumably, the inboard site at the right end of AAV was also
cleaved, but the separation in this region of the gel was not sufficient
for resolution of the 2.9 kb fragment (Figure 4-3).
The relative intensities of the 1.7 and 1.6 kb band produced from
pSM620(L) cleavage reflect the presence of the poly(dG)^g sequences
adjacent to the outboard site. In general, the homopolymeric poly(dG)
tail sequence was approximately 20 to 100 fold more likely to be cut
than the heteropolymeric AAV recognition sequence (Table II). In
contrast to pSM620, another wild type AAV clone, pAVl, contains no GC


Figure 4-3. Cleavage of AAV Plasmids That Contain Deletions in the
Terminal Repeats.
The various AAV mutant substrates were incubated with fraction III
enzyme and digested with BstEII as described for Figure 3-3. The
reaction products were transferred to nitrocellulose and probed with
P-labeled AAV DNA. The molecular weights of the endo R/BstEII
products are indicated at the left of the figure. The sequence at each
AAV/pBR322 junction is listed in Table II. The figure was over-exposed
to visualize minor cleavage bands.


?*
t
Ol
-2.3
oj
b
i
f
*
C7) -Ni d>
4^
1 i i
EX. 1
609
:X!l
620
. i: x l
62 1
r #
- 4 <
703
"ii 1
704
1
p AVI
M
M
1 III
m

M
1 1
OJ Ol M M
0> Ol
i
w
.p
Ol


46
tail and cleavage was directed exclusively by the AAV terminal
recognition site. As a result, cleavage at the inboard and outboard
sites occurs with approximately equal efficiency to produce two junction
bands from each end of equal intensity (Figure 4-3, pAVl; the fragment
sizes are 3.0, 2.9, 1.7 and 1.6 kb). The fact that poly(dG)n alone was
sufficient to act as a recognition sequence was further demonstrated by
cleavage of pSM703(L). This plasmid contains a deletion which has
removed both the inboard and outboard AAV recognition sites, but retains
a poly(dG) stretch that is 36 bp long. The poly(dG) stretch was
sufficient to promote cleavage and produced a band of approximately 1.6
kb. The slightly slower mobility of the 1.6 kb fragment generated from
pSM703(L) cleavage is attributed to the addition of the sizable poly(dG)
tail.
Minor Endo R Cleavage Sites
Cleavage by endo R appeared to require a sequence that was at
least 10 bp long and consisted of a polypurine-polypyrimidine tract that
was relatively rich in GC base pairs. These requirements were confirmed
by the identification of some of the minor cleavage fragments observed
in Figure 4-3, which had been predicted on the basis of this sequence.
It was noticed that a number of minor bands appeared consistently in
digests of all of the AAV variant plasmids. Because the size of the
minor fragments did not vary with the size of the terminal deletion,
these fragments must have been generated from cleavage within AAV
sequences (If the fragments had been generated from cleavage within
pBR322, they would have spanned the pBR/AAV junction and their size
would have varied depending on the size of the terminal deletion).


47
TABLE III
MINOR CLEAVAGE SITES3
Computer-Predicted Fragments Observed
Sequence
Nucleotide
kb
%C
kb
CCCCTCTCCCCTC
4089
2.39
10/13
2.4
CCaCTCCCTCTCT
4678
3.00
8/13
3.0
CCaCTCCCTCTCT
4562
2.86
8/13
NC
CCaCTCCCTCTCT
3
1.70
8/13
1.7
CCaCTCCCTCTCT
121
1.59
8/13
1.6
CTCCaCCCCTCC
157
1.54
9/12
NC
CTaCagCaCCCCTT
3026
1.33
7/14
1.3
CCCTgCCCaCCT
2947
1.25
8/12
1.2
CagCagCCCCCTCT
2775
1.08
8/14
1.1
CCagaCTCCTCCTC
2661
0.96
8/14
ND
CCCgCCTCCggCgCC
753
0.95
10/15
ND
CCCCTCCTCCCaCC
1461
0.24
11/14
TS
aThe table lists the cleavage fragments predicted by a computer
search of the plasmid pSM620 using polyCdC)-^ as the search
sequence and allowing for 60% homology between compared sequences.
The sequence at which cleavage would presumably occur and the number
of C residues in each sequence (%C) are tabulated with the size of
the predicted fragment, which was derived by assuming that endo R
cleavage occurred 3' to the poly(dG) sequence. The predicted
fragment sizes are compared with the sizes of the fragments observed
in the agarose gel assay. All fragment sizes are the result of BstEII
digestion of endo R products. NC = Not clear; ND Not detected;
TS = Too small to be resolved on a 1.4% agarose gel.


48
Using a computer and allowing for substitutions within the predicted
consensus sequence, poly(dG)^g, or the complementary sequence
poly(dC)^g, internal AAV sequences were searched for potential endo R
recognition sites. Table III compares the computer predicted cleavage
sites and fragments with the observed fragments. The results show a
good correspondence between the computer-predicted cleavage pattern and
the fragments seen in endo R digests. In fact, all of the observed
fragments that were believed to be the result of cleavage in AAV DNA
were predicted by the computer search. In particular, the best matches
found were with a sequence at nucleotide 4089, which produced the 2.4 kb
minor cleavage fragment, and with both the inboard and outboard AAV
terminal recognition sequences.
AAV Excision In Vivo
A demonstration that endo R was capable of excising AAV sequences
in vivo in a manner similar to that observed in vitro would add
credibility to the hypothesis that this was the enzyme involved in AAV
DNA replication. When AAV plasmids were transfected into tissue culture
cells, the bulk of the input DNA was found in the form of nicked
circular (form II) or linear (form III) plasmid species (Samulski et
al., 1982, 1983; Hermonat and Muzyczka, 1984). This was true regardless
of whether the input AAV DNA was capable of DNA replication. To
determine if the linear plasmid DNA (form III) produced in vivo was the
result of cleavage at a specific sequence, transfected DNA was isolated
after 21 hours, digested with BstEII and hybridized with AAV probe
(Figure 4-4). The 1.7 and 3.0 kb bands were readily seen in cells
infected with adenovirus and transfected with the wild type plasmid,


Figure 4-4. Cleavage of AAV Plasmids In Vivo.
Five micrograms of PSM620 and pSM703 DNA were transfected into Ad-
infected HeLa cells (Chapter II: Material and Methods). At 21 hours
after transfection, low molecular weight DNA was isolated by the method
of Hirt (1967), digested with BstEII, fractionated by agarose gel
electrophoresis and hybridized to AAV-specific probe as described for
Figure 3-3.


-nI
CD
no
3-0
620/Ad
703/Ad
ro
co
ui
o


51
pSM620. In this case the fragments were presumably derived from
replicating AAV DNA. However, bands of the same size were seen at
reduced levels in cells transfected with pSM620 in the absence of
adenovirus or in the presence of adenovirus and hydroxyurea (data not
shown). In addition, two minor bands were seen in cells transfected
with pSM620 which apparently were not amplified by DNA replication.
These were identical to the minor 2.4 kb and 1.6 kb bands observed in
vitro.
Cleavage fragments generated from pSM703 transfection were
expected to be approximately 100 bp shorter than those seen with the
wild type plasmid due to the deletions in both termini (compare with
Figure 4-3). These bands were readily seen in cells transfected with
pSM703 DNA (Figure 4-4) and because pSM703 is an ori~ mutant (Samulski
et al. 1983), the 1.6 and 2.9 kb fragments must have been produced from
the input plasmid sequences. As expected, pSM703 also generated a minor
2.4 kb band. It was concluded, therefore, that a substantial amount of
input plasmid DNA was cleaved at the AAV/vector junction in vivo and
that AAV DNA replication is not necessary for cleavage to occur.
Moreover, the pattern of cleavage was essentially the same in vivo and
in vitro. The remaining input DNA was apparently cleaved randomly as
judged by the background radioactivity.
Replication of Endo R Products
When the products of an in vitro endo R digestion of pSM620 were
transfected into Ad-infected HeLa cells, DNA replication of the AAV
sequences occurred at levels that were indistinguishable from the
transfection of the form I plasmid (not shown). This was true even at


52
times early after transfection. Differences in the production of
replicated AAV DNA would presumably occur early in the replication
cycle, but only if the excision of AAV sequences was a rate limiting
step in DNA replication. Therefore, endo R products were substrates for
DNA replication in vivo, but cleavage of AAV plasmids in vitro prior to
transfection did not provide a selective advantage for DNA replication.
Endo R products of pSM620 cleavage were also substrates for DNA
Polymerase I in vitro. The products of endo R digestion were heat
denatured and cooled rapidly to favor the formation of the hairpin
primer over renaturation of duplex molecules. In these experiments, a
significant amount of radioactivity was incorporated when these
substrates were incubated with DNA Pol I (not shown). Thus, the
products of endo R cleavage will support DNA replication both in vitro
and in vivo,


CHAPTER V
ENZYME RECOGNITION
Isolation of the Cleavage Site
In previous experiments, a consensus cleavage site was defined on
the basis of commonly occurring sequences found in AAV recombinant
plasmids. These sequences contained homopurine-homopyrimidine stretches
of at least 10 nucleotides which were rich in G:C base pairs. However,
it remained possible that the endo R recognition signal was at a
separate location from the cleavage site, possibly at an internal AAV
sequence. In this case, enzyme recognition would occur at a distant
site and result in cleavage at the nearest available stretch of
homopurine-homopyrimidine sequences. To rule out this possibility and
to further characterize the recognition sequence, several clones
containing subsets of the sequences present at the AAV/vector junctions
were constructed and their ability to act as substrates for endo R
specific cleavage was evaluated. The level of cleavage in several of
these clones is illustrated in Figures 5-1 and 5-2 and the insert
sequence and frequency of cleavage are listed in Table IV. The first
plasmid, pGM1008, is a subclone of pGM620D and contains sequences from
the right AAV/pBR322 junction, including the first 21 bp of AAV and the
31 bp G:C tail. This plasmid was cleaved with approximately the same
frequency as the parental junction in pSM620D (Figure 4-4). Two other
plasmids, pGM913 and pGM1116, contained poly(dG)-poly(dC) stretches of 9
and 13 bp, respectively, inserted at the PstI site of pBR322.
53


Figure 5-1. Oligomer Clone Excision
A) Standard reaction mixtures of 25 /l, containing 0.4 pmol of the pGM
clones indicated, were digested with endo R at 37C for 1 hour. The
reactions were terminated with the addition of proteinase K stop
solution (see Chapter II: Materials and Methods), phenol extracted,
ethanol precipitated and digested with EcoRI. B) EcoRI digestion of
endo R cleaved substrate produces 0.8 and 3.6 kb bands from pGM clones
containing oligomer inserts in the PstI site of pBR322, while 1.0 and
3.4 kb fragments are produced from clones which contain inserts in the
EagI site (see Figure 5-6 for the sequence of the inserts). E = EcoRI
site, R = endo R site, filled square = oligonucleotide insert (See
Chapter II for a description of the clones).


0.8
>
to u A
ui oj b) >
i i ill
s;
2:
PstD
1008
913
1116
pBR
1476
1483
1505
ui
ui


Figure 5-2. Oligomer Clone Gel Assay.
Standard reactions of 25 pi, containing 0.4 pmol of the substrates
indicated, were digested with endo R at 37C for 1 hour. Reactions were
terminated with proteinase K stop solution (Chapter II), phenol
extracted, ethanol precipitated and digested with EcoRI. The assays were
fractionated on a 1.7% agarose gel, transferred to nitrocellulose
(Southern, 1975) and probed with nick translated pBR322 DNA (>1 x 10
cpm//g). Light and dark exposures (top and bottom, respectively) of the
0.8 kb fragments produced from endo R and EcoRI digestion are shown to
illustrate the relative frequency of cutting in the different
substrates.


CD
O
bo
i
3.6-
1008
913
1116
1228
pBR
1344
1505


TABLE IV
SUBCLONED CLEAVAGE SITES3
Clone
Inserted Sequence^
Frequency
pGM1008
(g) 29
CCaCTCCCTCTCTgCgCg
100
pGM913
(g) 13
30
pGM1116
(g)g
20
pBR322c
6
0
pGM1228
(g) 2
CCaCTCCCTCTCTgCgCg
1
pGM1344d
(g) 2
(CCaCTCCCTCTCTgCgCg)2
5
pGA38
(ga)38
10
pGAll
(ga)n
3
pGM1635
(gc)20
0
pGM1483
(^4a2) 3
30
pGM1505
(C2-6T)5
30
aThe construction of the clones is described in detail
in Chapter II: Materials and Methods. The sequences are
listed as they appear in the clone on the clockwise
strand in a 5' to 3' direction. The frequency of cleavage
is defined as the percent of starting substrate cleaved in
a standard assay with 1 unit of endo R. The amount of
cleavage for pGM1008 was arbitrarily set to 100%.
^The complete sequence of the inserts are listed in Figure 5-6.
cNatural poly(dG) stretches of 6 bp occur in pBR322 at
nucleotides 2550 and 2797.
dThe sequences for pGM1344 are repeated in an inverted
orientation


59
No AAV sequences were present in either plasmid. Specific cleavage was
observed with these substrates as well. However, the level of cleavage
was significantly reduced with both substrates. PGM913 (13 bp of G:C)
was cleaved at 30% and pGM1116 (9 bp of G:C) was cleaved at 20% of the
level observed with clones that contained all of the parental AAV/vector
junction (pGM620D, pGM1008, Figures 5-1 and 5-2, Table IV). These
clones approach the limit of enzyme recognition, since the naturally
occurring stretches of poly(dG)g in pBR322 (Figures 5-1, 5-2 and Table
IV) and poly(dG)y in lambda phage DNA (not shown) were not detectably
cleaved. These results, in conjunction with those obtained with the
pSM609(R) junction (Table II), suggested that a minimum of 9 G residues
are sufficient for cleavage, while the frequency of cleavage increases
in direct proportion to the length of the homopolymer chain. Thus, AAV
plasmids that contain GC tails at the AAV/vector junction are ideal
substrates for endo R.
The apparent strong affinity of endo R for long stretches of
poly(dG) and the observed cleavage of G-rich sites that did not contain
homopolymers of G:C (Figure 4-3, pAVl, pSM609(L), pSM621(L) and
pSM704(L)) raised some important questions concerning alternative enzyme
recognition sites and, particularly, what effect substitutions in the
poly(dG) chain have on cleavage activity. To determine what type of
substitutions were tolerated by endo R, a number of plasmid substrates
containing a variety of repeating polymeric sequences were tested. The
first of these was the plasmid pEV136, an infectious polio clone which
contains 18 bp of poly(dG) at the 5' end and an 84 bp stretch of
poly(dA) at the distal end. When incubated with endo R, pEV136 produced
fragments which were the result of cleavage exclusively at the poly(dG)


60
site. No detectable cleavage was observed at the poly(dA) site (Figure
5-3). However, clones that contained an insert of the alternating co
polymer (GA>2g and (GA)-q (pGA38 and pGAll, respectively) were cleaved
by endo R at a reduced frequency (Table IV and Figure 5-3). Thus,
homopolymers of (dA) were not recognized as substrates for cleavage, but
substitutions of (dA) in long stretches of poly(dG) were tolerated and
resulted in a decrease in activity. This was not the case with
alternating polymers of GC that can potentially form altered secondary
structures of left-handed Z-DNA (Peck and Wang, 1983; Singleton et al..
1983). Clones containing inserts of (GC)-^q and (GC^q were not
detectably digested by endo R (pGM1635, Table IV).
More complex sequences with less symmetrical substitutions of the
poly(dG) sequence are also substrates for endo R. This is exemplified
by two clones, pGM1483 and pGM1505, that contain generic forms of the
Tetrahymena (C4A2) and Dictyostelium (^2-6^ telomeric sequences,
respectively (Blackburn and Szostak, 1984; Shampay et al.. 1984). These
substrates were cleaved at a level approaching the frequency observed
with the homopolymeric clone pGM913 (Figure 5-1 and Table IV).
Integrated AAV provirus exists in two basic forms in chromatin, as
well as in plasmids. The first of these consists of at least two tandem
head to tail copies of AAV, each separated by two copies of terminal
sequences in an inverted orientation (McLaughlin et al.. 1988).
Presumably, this would place two copies of the endo R recognition site
in an inverted orientation, adjacent to each other. The plasmid
equivalent of this contained one copy of the AAV terminal repeat
adjacent to a GC tail and was cleaved with high frequency (e.g. pGM1008,
Figure 5-1). The second type of integrated form occurs less frequently


Figure 5-3. Endo R Cleavage of pGA38 and pEV136.
A) One microgram of either pGA38 or pEV136 was incubated with 1 unit of
fraction V endo R under standard reaction conditions in a volume of 25
pi. After phenol extraction and ethanol precipitation, one half of each
reaction was further digested with either Seal (pGA38) or Bgl2 (pEV136)
and both the endo R treated (R) and the restriction enzyme digested-endo
R treated (RS) samples were fractionated on 1.4% agarose gels. B)
Restriction maps of pGA38 and pEV136. Filled boxes represent the
poly(GA) insert for pGA38 (GA) and the poly(dG) and poly(dA) inserts for
pEV136 (G and A, respectively). The molecular weights (kb) indicate the
size of the products that would be expected from a restriction enzyme
digest of endo R products cleaved at GA in pGA38, and at G plus A in
pEV136.


62
pGA38
p E V1 3 6
R
RS
M
M
R
RS
a
-Fm2
I
5
M
KH |

-Fm3
Fm2- |
m
I _
- 4.4
4.4 -

5.7
Fm3
- 2.7
2.4 ~
-
Fm 1 -
**
M
- 1.8

1.5 -

- .94
1.8
3.8


63
in chromatin and contains single or multiple copies of AAV separated by
a single copy of the AAV terminal repeat (McLaughlin et al.. 1988).
Plasmids that contain this type of arrangement were cleaved at a low
frequency in vitro (e.g. pAVl, Figure 4-3).
To determine if the terminal 23 nucleotides of AAV contained a
recognition signal for endo R and what effect the number of copies and
orientation of these sequences had on activity, two clones containing
either a single copy or two inverted copies of the AAV terminal
recognition sequence (ggCCaCTCCCTCTCTgCgCgC) were constructed. The
plasmid pGM1228 contains a single copy of this sequence and pGM1344
contains two inverted copies of the same sequence, both inserted into
the PstI site of pBR322. Both of these constructs were cleaved by endo
R (Figure 5-2). However, the level of cleavage observed with pGM1228
was approximately 1% of that observed with pGM1008 and could only be
visualized by Southern hybridization. In contrast, the plasmid that
contained two inverted copies of the recognition sequence was cut at a
level at least 5 times greater than that of the single copy plasmid,
while still only about 5% of that seen with the parental junction
plasmids. Thus, the presence of tandem inverted copies of the AAV
recognition signal improves the yield of specifically cleaved product in
vitro. This arrangement may be representative of the preferred
situation in chromatin.
Sequence at the Site of Cleavage
Previous experiments have already shown that endo R makes double-
stranded specific cuts and that cleavage of the substrate occurs at the
recognition signal. In addition, it was possible that cleavage at the


64
insert/vector junction would produce long single-stranded overhangs at
the ends of the fragments. Conceivably, the ends of these fragments
could anneal and effectively reduce the observed amount of specifically
cleaved product. However, no increase in the amount of specifically
cleaved product was observed after the reaction products were phenol
extracted and heated, indicating that the cleaved fragments did not have
extensive 5' or 3' protruding ends capable of hybridization (not shown).
Several questions remained, however, concerning the mechanism and
pattern of endo R cleavage. For example, it was not known whether endo
R cleavage occurred at one or several sites within the recognition
sequence or whether there was a difference in the cleavage pattern
between substrates that contained different types of recognition
signals. Additionally, it was possible that the separate strands of the
recognition sequence were cleaved in a dissimilar manner. To address
these questions, the sequence at the site of cleavage was determined for
several substrates containing various lengths of poly(dG):poly(dC),
alternating copolymers of GA, telomeric sequences and the AAV
recognition sequences (Figure 5-6). In these studies, the mobility of
the primer extension products of endo R fragments were compared with the
sequence of the insert and flanking regions of the substrate clone on
denaturing acrylamide gels. The sequence of the substrate was
determined by the dideoxy sequencing method (Sanger et al., 1977) using
the same single-stranded primer used for primer extension (Figures 5-4
A-D, see Chapter II: Materials and Methods). These results were
confirmed independently by comparison of the mobility of 5' and 3'
labeled endo R products with the chemically sequenced plasmid insert
(Figure 5-5).


65
The conclusion from the analysis of the cleavage sites of clones
containing homopolymers of poly(dG) was that cleavage could occur
throughout the G:C insert (Figure 5-4A, Figure 5-6). A slight
preference for cleavage at the 3' end of both strands was observed in
all the homopolymeric clones. This effect was especially pronounced at
the 3' end of the poly(dG) strand in the plasmid pGM1008, which contains
the AAV recognition signal 5' to the G:C insert (Figure 5-6). Cleavage
of the G-strand was particularly strong at the G:C/AAV junction and
continued into the AAV sequences, while cutting in the C-strand in this
clone appears to be more uniform, with only a slight preference for the
3' end. The site of cleavage in clones that contained only
poly(dG):poly(dC) inserts and no AAV sequences (pGM913, pGM1116, Figure
5-6) was also slightly skewed toward the 3' end of both strands, while
cleavage was confined almost entirely to the G:C insert. In substrates
that contained the alternating copolymer (GA)-j^ and (GA)^ (Figure 5-
4B), cutting occurred throughout the polymer insert between the G and A
residues on the lower strand and between the C and T residues on the
upper strand. In these clones, cleavage was evenly distributed within
the CT strand, but more pronounced at the 5' and 3' insert/vector
junctions in the GA strand.
The cleavage pattern observed with plasmids containing telomeric
sequences exhibited more periodicity. In the plasmid pGMl505 (Figure 5-
4C) which contains the sequence (C2-6^5 cleavage of the CT-strand
occurred throughout the insert with a particularly strong cut occurring
at regular intervals immediately after the first C residue of every
repeat. A preference for cleavage at the 3' end of the CT-strand was
observed, corresponding to the region containing 6 continuous G:C base


Figure 5-4. Sequence at the Site of Endo R Cleavage Dideoxy Method.
A) Nucleotide sequence determined by the dideoxy method (Sanger, 1977)
and primer extension products of endo R digestions for substrates
containing: A) poly(dG) inserts; pGM1008 (left) and pGM913 (right), B)
alternating copolymers of GA; pGAll (left) and pGA38 (right), C)
telomeric sequences; pGM1505 (left) and pGM1483 (right), and D) a single
copy (pGM1228, left) or two tandem inverted copies (pGM1344, right) of
the AAV recognition site. The plasmid sequence (GCAT) was determined
for each strand of the substrate using either a clockwise (cw) or
counterclockwise (ccw) oligonucleotide primer and 1 /g of plasmid. The
endo R primer extension products (R) were synthesized from 1 /g of endo
R digested substrate with the primer used to generate the corresponding
sequence markers (see Chapter II).


67
1008
cw ccw
GCATR RGCAT
913
CW ccw
GCATR GCATR


68
pGA38
cw ccw
GCATR RGCAT
:
Figure 5-4 (continued), part B


69
1483
cw ccw
GCATR RGCAT
S
Figure 5-4 (continued), part C


70
1228
cw ccw
GCATR G CATR
1344
Figure 5-4 (continued), part D


Figure 5-5. Sequence at the Site of Endo R Cleavage Maxam and Gilbert
Method.
Fine mapping of the endo R cleavage products of pGM620D (PstD). The G+A
and C+T sequencing reactions were as described (Maxam and Gilbert,
1977). 1 /g of pGM620D labeled at the Seal site at either the 5' or 3'
end was digested with endo R (R) and fractionated on a 8% acrylamide -
urea gel in parallel with sequence markers labeled at the same site.
The poly(dG)2g:poly(dC)2g tail and the direction of the AAV and pBR322
sequences are indicated in the figure. A detailed description of the
sequencing protocol and of PGM620D is included in Chapter II.


72


Figure 5-6. Sequence at the Site of Endo R Cleavage Summary of the Cleavage Sites.
The sequence data in Figures 5-4 (A-D) are summarized in this figure. Only the sequence
of the oligomer insert and a few bases of the flanking vector regions are shown. The
sequences are listed as they appear in the clones, where the top strand runs in a 5' to 3'
direction. Long arrows represent major cleavage sites and short arrows represent minor
sites (usually about 25-50% of the intensity of the major bands). The relative
intensities apply only within the same strand and no attempt was made to compare the
intensity in opposite strands or between clones (see Table IV for the frequency of
cleavage in these substrates).


pGM1008
pGM913
(G),3
pGM1116
(G),
pGM1505
(C2-6T)5
pGM1483
(C4A2) 3
pGA1 1
(GA)n
pGM1228
(AAVter),
pGM1344
(AAVter) 2
iMUMnmMmmummmMilHhii
ATTGCCGCGCAGAGAGGGCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCTGCAGGCAT
TAACGGCGCGTCTCTCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGACGTCCGTA
t ttttt U fff*****1111111111111111111111
ATTGCTGCAGCCCCCCCCCCCCCTGCAGGCAT
TAACGACGTCGGGGGGGGGGGGGACGTCCGTA
Mil***4
III I I I I 111
ATTGCTGCAGCCCCCCCCCTGCAGGCAT
TAACGACGTCGGGGGGGGGACGTCCGTA
nuimi
I III I TI I1 I IT I I I III1 1I I II
ATTGCTGCACCTCCCTCCCCTCCCCCTCCCCCCTGCAGGCAT
TAACGACGTGGAGGGAGGGGAGGGGGAGGGGGGACGTCCGTA
lUM|i ti||i 111 111
/ I II I II II ill ill \
CGGCCGCCCCAACCCCAACCCCAACCCCGGCCG
GCCGGCGGGGTTGGGGTTGGGGTTGGGGCCGGC
\
It! I
It! Ill
/
II I I I I I I I I I I III 11
GGCCAGTGAATTCGGCTCTCTCTCTCTCTCTCTCTCTCCCGAATTCCCG
CCGGTCACTTAAGCCGAGAGAGAGAGAGAGAGAGAGAGGGCTTAAGGGC
|| I I M 1 k i 1 i i i i i i it I I
ll I III I II
ATTGCTGCAGGCCACTCCCTCTCTGCGCGCTGCAGGCAT
TAACGACGTCCGGTGAGGGAGAGACGCGCGACGTCCGTA
I! t! II! I
I I I ITll I I
ATTGCTGCAGAGCGCGCAGAGAGGGAGTGGCCATGGCCACTCCCTCTCTGCGCGCTCTGCAGCAAT
TAACGACGTCTCGCGCGTCTCTCCCTCACCGGTACCGGTGAGGGAGAGACGCGCGAGACGTCGTTA
I I!* I
-0


75
pairs (Figure 5-6). Curiously, a strong preference for cutting was seen
at the 3' end of the GA strand, even though the longest stretches of G:C
base pairs are at the 5' end of this strand. In contrast, the pattern
of cutting observed with the plasmid pGM1483, which contains the
sequence exhibited little preference for either end of the
insert (Figure 5-4C). The cleavage pattern for this clone was
repetitive and symmetrical throughout the oligonucleotide insert (Figure
5-6). Cleavage appeared to occur in directly opposite positions on each
strand immediately before the A residues on the CA strand.
Cleavage of the plasmids pGMl228 and pGM1344, which contain single
and inverted double copies of the AAV terminal sequences, respectively,
was contained within the C-rich region of the AAV recognition sequence
and showed a preference for the 3' end of each strand (Figure 5-4D,
Figure 5-6). This is especially noticeable in pGM1344, where the cut
sites are localized exclusively within the C-rich region of each strand
and would appear to produce sizable 3' overhangs.
The results from the sequence studies indicated that cleavage
occurred throughout the recognition sequence and frequently extended
into the flanking vector sequences. A preference for cleavage at the 3'
end of both strands was observed in most substrates, while cutting in
the C-strand had a tendency to be more uniform. In addition, the
nucleotide order had no affect on the site of cleavage, where cutting
occurred between every base combination. These observations, in
conjunction with the observed frequency of cutting with different
substrates, suggest that cleavage at the nucleotide level is structural
rather than sequence dependent.


76
Is Endo R a Site Specific Single-Stranded Nuclease
A number of single-stranded endonucleases will cleave polypurine-
polypyrimidine stretches that are present in duplex DNA. The activity
has been demonstrated for SI, mung bean, and Neurospora endonucleases as
well as for snake venom phosphodiesterase (Evans and Efstradiatis, 1986;
Cantor and Efstradiatis, 1984; Schon et al.. 1983; Pulleyblank et al..
1985). One important difference between these activities and endo R is
that the single-stranded nucleases require supercoiling in substrates
that contain short polypurine stretches. In contrast, endo R readily
cleaves linear substrates which contain 13 bp of poly(dG) (data not
shown). However, there is enough similarity in sequence recognition to
suspect that endo R may have properties common to single-stranded
endonucleases.
To determine if Endo R was a single-stranded DNA endonuclease, the
products of SI and endo R digestions of pSM620 were compared. SI
produced a cleavage pattern similar to that seen with endo R. However,
unlike endo R, SI did not seem to discriminate between the inboard and
outboard ends of the AAV terminal palindrome. It apparently cut equally
well at both ends of the terminal repeat, producing a full length pBR322
linear DNA molecule (4.4 kb) and the shorter 1.6 and 2.9 kb AAV
fragments (Figure 5-7). The 100 bp deletion resulting from the loss of
the AAV terminal sequences is especially noticeable when comparing the
1.7 kb endo R products with the 1.6 kb fragments produced by SI. It is
not known whether the loss of the AAV terminal sequences was due to
selective degradation of the palindrome or to specific cleavage at both
the inboard and outboard recognition sites. Similar experiments with
mung bean endonuclease did not produce discrete bands (not shown).


Figure 5-7. SI and Endo R Nuclease Digestions of pSM620.
One microgram (0.2 pmol) of pSM620 DNA was titrated with SI nuclease or
fraction IV endo R in a 50 pi reaction volume under standard conditions
for each enzyme (see Chapter II: Materials and Methods). Numbers at the
top indicate the number of units of each enzyme used.


78
SI EndoR


79
SI nuclease typically releases acid soluble oligo- and mono
nucleotides as products of the reaction (Vogt, 1973). After normalizing
endo R and SI activities on duplex substrates, the activities on single-
3
stranded H-labeled E.coli DNA were compared by measuring the release of
acid soluble radioactivity (Figure 5-8). When equivalent amounts of SI
o
and endo R (as measured on duplex DNA) were incubated with H-labeled
single-stranded E.Coli DNA, SI converted 70% of the DNA to acid soluble
product within 30 minutes, while endo R produced no acid soluble
products after 2 hours. The results were similar regardless of whether
the reactions were carried out at pH 6.0 for both enzymes, or whether
each enzyme was assayed at its own pH optimum (pH 4.5 for SI and pH 7.5
for endo R). On the basis of this assay, it was estimated that endo R
was approximately 50-100 fold less active on single-stranded DNA than
SI.
The ability of endo R and Si to degrade single-stranded circular
DNA was also compared. Under standard reaction conditions, single-
stranded circular X and M13 DNA are degraded to oligonucleotides of
200-400 base pairs in length (Figure 5-9). When assayed by gel
mobility, endo R cut single-stranded circular DNA at a rate 20 fold
lower than SI (not shown). This was also true in reactions which
contained standard amounts of plasmid substrate in addition to X DNA
(not shown). In these experiments, 50% of the plasmid substrate was
cleaved specifically, while activity on single-stranded circles was
similar to that observed without plasmid substrate. It was concluded
from these experiments that endo R was clearly not a typical single-
stranded nuclease. However, it was not clear whether endo R activity on


80
single-stranded circles was an intrinsic property of endo R or the
result of a residual contaminating endonuclease.


Figure 5-8. SI and Endo R Activity on Single-Stranded DNA.
Five micrograms of single-stranded, uniformly H-labeled E. coli DNA was
incubated with SI nuclease (1.25 units) or endo R (5.0 units) in a 250
/I reaction at 37C under standard reaction conditions for each enzyme
(see Materials and Methods). Equivalent amounts of double-stranded
cleavage activity for both enzymes were used for each reaction (See
Figure 5-7). At the indicated times, 25 il portions of each reaction
mixture were acid precipitated and counted. The percent (%) acid-
precipitable counts remaining at each time point is plotted. Closed
circles, endo R; open circles, SI.


82


Figure 5-9. Endo R Activity on Single-Stranded Circular DNA.
A standard reaction mixture of 125 /il contained 5 /jg of X single-
stranded circular DNA and 2.5 units of endo R. At the indicated times,
25 /il portions were removed, the reaction was terminated with the
addition of 0.1% SDS and 20 mM EDTA, and the reaction products were
fractionated on a 1.4% agarose gel.


84
Circles -
Linears ~


CHAPTER VI
PROPERTIES OF ENDO R
Reaction Conditions for Double-Stranded Cleavage
2+
Purified endo R requires Mg cations at 5-10 raM for optimal
O i
cleavage activity (Table V). Calcium ions (Ca ) at 0.1-1.0 mM can
o^-
substitute for Mg but only about half of the activity is achieved
2-f
under these conditions. No activity is observed with Zn alone at any
2+ 2+
concentration, and both Ca and Zn are inhibitory at higher
2+ 2+
concentrations in the presence of Mg When Mn is substituted for
2+
Mg a different specificity of cleavage is observed at concentrations
below 0.1 mM, while greater concentrations result in non-specific
degradation of the substrate.
Endo R is extremely salt sensitive (Figure 6-1). A 50% inhibition
was observed with NaCl or KC1 at concentrations of 10 mM. Because of
this sensitivity, fractions emerging from columns eluted with salt
gradients were dialyzed before being assayed.
Endo R is active over a wide pH range, from pH 6 to pH 9, in Tris-
HC1, sodium acetate or sodium phosphate buffers (not shown). The pi of
endo R was estimated to be between pH 6.5 and 7.0. This was determined
by observing the binding characteristics of the enzyme to DEAE cellulose
at different pHs (see Chapter II: Materials and Methods). No increase
in the rate of the reaction was observed with temperatures above 37C,
while temperatures below 37C resulted in a decreased rate of cleavage.
85


86
TABLE V
DIVALENT METAL CATION
REQUIREMENTS FOR ENDO Ra
MgCl2
MnCl2a
CaCl2
Z11CI2
% Double
Stranded
(mM)
('mM)
(mM)
(mM)
Cleavaee
0
-
_
_
0
1.0
-
-
-
50
5.0
-
-
-
100
10.0
-
-
-
100
15.0
-
-
-
80
_
0
_
_
0
-
0.1
-
-
100
-
>0.5
-
-
0
_
_
0.1
_
50
-
-
0.5
-
50
-
-
1.0
-
50
-
-
5.0
-
5
-
-
10.0
-
<1
5.0
_
0.1-1.0
_
100
5.0
-
5.0
-
50
5.0
-
10.0
-
40
_
_
0-10.0
0
5.0
-
-
0.1
40
5.0
-
-
>0.1
0
aBstEII linearized pSM620 (0.2 pmol) was incubated with 1 unit
of fraction V endo R under standard reaction conditions with
the amount of divalent metal cation indicated in the table.
The reaction products were fractionated on 1.4% agarose gels,
stained with ethidium bromide and photographed. The amount of
double-stranded cleavage was determined from densitometer
tracings of the 3.0 and 1.7 kbp endo R/BstEII products as
described in the legend to figure 6-1.
^Concentrations of MnCl2 >0.1 mM result in nonspecific degradation
of substrate DNA, while concentrations between 0.01 and 0.10 mM
produce a different cleavage specificity (see Figure 6-3).


Figure 6-1. Sodium and Potassium Inhibition of Endo R.
Standard reactions containing 0.2 pmol of BstEII linearized PSM620 were
incubated with 1 unit of fraction V endo R with increasing
concentrations of NaCl or KCl for 1 hour at 37C. The products of the
reaction were fractionated on a 1.4% agarose gel, stained with ethidium
bromide and photographed with Polaroid Type 55 film, which produces a
negative and a positive print. The intensity of the 3.0 kbp product was
measured from the negative using the LKB ultrascan XL densitometer and
the LKB gel scan program, version 1.0. The percent activity is plotted
against the concentration of Na and K chloride in the reaction. The
amount of cleavage at 1 mM NaCl (the salt contribution from the
extracts) is assigned 100% activity.


Full Text
UNIVERSITY OF FLORIDA
3 1262 08554 3956



PAGE 1

,1 9,752 (;&,6,21 2) $'(12$662&,$7(' 9,586 '1$ )520 5(&20%,1$17 3/$60,'6 ,62/$7,21 2) $1 (1=<0( )5$&7,21 )520 +(/$ &(//6 7+$7 &/($9(6 '1$ $7 32/<385,1( 32/<3<5,0,',1( 6(48(1&(6 5,&+ ,1 *& %$6( 3$,56 %< + -21$7+$1 *277/,(% $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

7R P\ IDPLO\ 'LJLWL]HG E\ WKH ,QWHUQHW $UFKLYH LQ ZLWK IXQGLQJ IURP 8QLYHUVLW\ RI )ORULGD *HRUJH $ 6PDWKHUV /LEUDULHV ZLWK VXSSRUW IURP /<5$6,6 DQG WKH 6ORDQ )RXQGDWLRQ KWWSZZZDUFKLYHRUJGHWDLOVLQYLWURH[FLVLRQR22JRWW

PAGE 3

$&.12:/('*(0(176 ZRXOG OLNH WR H[SUHVV P\ VLQFHUHVW DSSUHFLDWLRQ WR P\ PHQWRU DQG IULHQG 'U 1LFKRODV 0X]\F]ND IRU WKH XQLTXH RSSRUWXQLW\ WR ZRUN ZLWK KLP GXULQJ WKH ODVW VHYHUDO \HDUV ,Q DGGLWLRQ ZRXOG OLNH WR WKDQN WKH PHPEHUV RI P\ JUDGXDWH FRPPLWWHH DW WKH 8QLYHUVLW\ RI )ORULGD DQG 'UV .HQQHWK %HUQV DQG :LOOLDP +ROORPDQ IRU WKHLU KHOSIXO VXJJHVWLRQV DQG HQFRXUDJHPHQW DP JUDWHIXO WR PHPEHUV RI WKH 0X]\F]ND ODERUDWRU\ LQ 1HZ
PAGE 4

7$%/( 2) &217(176 3DJH $&.12:/('*0(176 LLL /,67 2) 7$%/(6 YL /,67 2) ),*85(6 YLL .(< 72 $%%5(9,$7,216 L[ $%675$&7 [L &+$37(5 ,1752'8&7,21 ,QWURGXFWLRQ $$9 '1$ 5HSOLFDWLRQ 5HVFXH RI /DWHQW $$9 3URYLUXV *HQHUDO $LP RI WKH 6WXGLHV ,, 0$7(5,$/6 $1' 0(7+2'6 &HOO &XOWXUH DQG 9LUXVHV 5HFRPELQDQW &ORQHV DQG (Q]\PH 6XEVWUDWHV 3XULILFDWLRQ RI (QGR 5 1XFOHDVH $VVD\V '1$ /DEHOLQJ 6HTXHQFLQJ DQG 3ULPHU ([WHQVLRQ *HO (OHFWURSKRUHVLV (VWLPDWLRQ RI WKH ,VRHOHFWULF 3RLQW &KURPDWRJUDSKLF 0HGLD (Q]\PHV DQG 0DWHULDOV 2WKHU 0HWKRGV (VWLPDWH RI ,Q 9LYR ([FLVLRQ )UHTXHQF\ ,,,385,),&$7,21 2) (1'2 5 'HWHFWLRQ RI D 6LWH6SHFLILF (QGRQXFOHDVH $FWLYLW\ LQ &UXGH 1XFOHDU ([WUDFWV 3XULILFDWLRQ RI (QGR 5 7KH (QGR 5 $JDURVH *HO $VVD\ 0ROHFXODU 6L]H DQG 3XULW\ RI (QGR 5 LY

PAGE 5

3DJH ,9 5(6&8( 2) $$9 6(48(1&(6 /RFDOL]DWLRQ RI WKH 6LWH RI &OHDYDJH WR WKH $$99HFWRU -XQFWLRQ (LWKHU $$99HFWRU -XQFWLRQ &DQ %H &OHDYHG ,QGHSHQGHQWO\ RI WKH 2WKHU &OHDYDJH RI $$9 7HUPLQDO 0XWDQWV 0LQRU (QGR 5 &OHDYDJH 6LWHV $$9 ([FLVLRQ ,Q 9LYR 5HSOLFDWLRQ RI (QGR 5 3URGXFWV 9 (1=<0( 5(&2*1,7,21 ,VRODWLRQ RI WKH &OHDYDJH 6LWH 6HTXHQFH DW WKH 6LWH RI &OHDYDJH ,V (QGR 5 D 6LWH 6SHFLILF 6LQJOH 6WUDQGHG 1XFOHDVH 9, 3523(57,(6 2) (1'2 5 5HDFWLRQ &RQGLWLRQV IRU 'RXEOH6WUDQGHG &OHDYDJH $OWHUQDWH &OHDYDJH 6SHFLILFLW\ LQ WKH 3UHVHQFH RI 0QA ,RQV (QGR 5 6SHFLILF &OHDYDJH LV RI D 'RXEOH6WUDQGHG 1DWXUH (IIHFW RI 1XFOHRWLGHV DQG 3RO\QXFOHRWLGHV RQ WKH &OHDYDJH $FWLYLW\ $UH 6WRLFKLRPHWULF $PRXQWV RI (Q]\PH 5HTXLUHG IRU &OHDYDJH ,OO &KDUDFWHUL]DWLRQ RI WKH (QGV RI WKH 5HDFWLRQ 3URGXFWV ,OO ,V (QGR 5 D +XPDQ 7RSRLVRPHUDVH 9,,',6&866,21 $1' &21&/86,216 3XULILFDWLRQ RI (QGR 5 ([FLVLRQ RI $$9 6HTXHQFHV ,Q 9LWUR ,V (QGR 5 5HVSRQVLEOH IRU WKH 5HVFXH RI $$9 6HTXHQFHV ,Q 9LYR (Q]\PH 5HFRJQLWLRQ (YLGHQFH IRU D &RQWDPLQDWLQJ 1XFOHDVH 2WKHU 0DPPDOLDQ (QGRQXFOHDVHV :KDW 'RHV (QGR 5 'R IRU WKH &HOO 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ Y

PAGE 6

/,67 2) 7$%/(6 7DEOH 3DJH 385,),&$7,21 2) (1'2 5 ,,5(&2*1,7,21 6,7( )25 (1'2 5 ,1 $$9 3/$60,'6 ,,, 0,125 &/($9$*( 6,7(6 ,9 68%&/21(' &/($9$*( 6,7(6 9 ',9$/(17 0(7$/ 5(48,5(0(176 )25 $&7,9,7< 9, 18&/(27,'( ,1+,%,7,21 $1' 67,08/$7,21 9,, (1' /$%(/,1* 2) (1'2 5 352'8&76 YL

PAGE 7

/,67 2) ),*85(6 )LJXUH 3DJH 0RGHO IRU $$9 '1$ 5HSOLFDWLRQ (QGR 5 $JDURVH *HO $VVD\ (Q]\PH 7LWUDWLRQ RI )UDFWLRQV ,, DQG ,,, (Q]\PH 7LWUDWLRQ RI )UDFWLRQ ,,, 6HGLPHQWDWLRQ $QDO\VLV RI (QGR 5 E\ *O\FHURO *UDGLHQW &HQWULIXJDWLRQ 0ROHFXODU :HLJKW DQG 3XULW\ RI (QGR 5 ,GHQWLILFDWLRQ RI $$96SHFLILF DQG S%5 6SHFLILF )UDJPHQWV LQ WKH (QGR 5 5HDFWLRQ &OHDYDJH RI 6XEVWUDWHV 7KDW &RQWDLQ 2QO\ 2QH &RS\ RI WKH $$9 7HUPLQDO 5HSHDW &OHDYDJH RI $$9 3ODVPLGV 7KDW &RQWDLQ 'HOHWLRQV LQ WKH 7HUPLQDO 5HSHDW &OHDYDJH RI $$9 3ODVPLGV ,Q 9LYR 2OLJRPHU &ORQH &OHDYDJH 2OLJRPHU &ORQH *HO $VVD\ (QGR 5 &OHDYDJH RI S*$ DQG S(9 6HTXHQFH DW WKH 6LWH RI &OHDYDJH 'LGHR[\ 0HWKRG 6HTXHQFH DW WKH 6LWH RI &OHDYDJH 0D[DP DQG *LOEHUW 0HWKRG 6HTXHQFH DW WKH 6LWH RI (QGR 5 &OHDYDJH 6XPPDU\ RI WKH &OHDYDJH 6LWHV 6, DQG (QGR 5 1XFOHDVH 'LJHVWLRQ RI S60 YLL

PAGE 8

3DJH )LJXUH 6, DQG (QGR 5 $FWLYLW\ RQ 6LQJOH6WUDQGHG '1$ (QGR 5 $FWLYLW\ RQ 6LQJOH6WUDQGHG &LUFXODU '1$ 6RGLXP DQG 3RWDVVLXP ,QKLELWLRQ RI (QGR 5 &OHDYDJH RI )RUP DQG )RUP ,,, 3ODVPLG 6XEVWUDWH 6SHFLILFLW\ RI (QGR 5 :LWK 0JA DQG 0QA &OHDYDJH 5HDFWLRQ 7LPH &RXUVH 6LQJOH6WUDQGHG 6SHFLILFLW\ RI (QGR 5 $73 ,QKLELWLRQ RI (QGR 5 $FWLYLW\ 3RO\QXFOHRWLGH &RPSHWLWLRQ RI 'RXEOH 6WUDQGHG &OHDYDJH $FWLYLW\ 6WRLFKLRPHWU\ RI WKH (QGR 5 &OHDYDJH 5HDFWLRQ /LJDWLRQ RI (QGR 5 3URGXFWV n (QG /DEHOLQJ RI (QGR 5 3URGXFWV 0RGHO IRU WKH ([FLVLRQ RI $$9 '1$ IURP 5HFRPELQDQW 3ODVPLGV YLLL

PAGE 9

.(< 72 $%%5(9,$7,216 $73 DGHQRVLQHnWULSKRVSKDWH ES EDVH SDLUV %6$ ERYLQH VHUXP DOEXPLQ &73 F\WRVLQHnWULSKRVSKDWH G GDOWRQV G$73 GHR[\DGHQRVLQHnWULSKRVSKDWH G&73 GHR[\F\WRVLQHnWULSKRVSKDWH '($( GLH WK\DPLQRH WK\ G*73 GHR[\JXDQRVLQHnWULSKRVSKDWH '1$ GHR[\ULERQXFOHLF DFLG '77 GLWKLRWKUHLWRO G773 WK\PLGLQH n WULSKRVSKDWH ( FROL (VFKHULFKLD FROL ('7$ HWK\OHQHGLDPLQH WHWUDDFHWLF DFLG IRUP VXSHUKHOLFDO SODVPLG '1$ IRUP ,, QLFNHG FLUFXODU '1$ IRUP ,,, OLQHDU GXSOH[ '1$ & GRXEOHVWUDQGHG SRO\G*fSRO\G&f *73 JXDQRVLQHnWULSKRVSKDWH NE NLOREDVH NG NLORGDOWRQV 306) SKHQ\OPHWK\OVXOIRQ\OIOXRULGH L[

PAGE 10

32/
PAGE 11

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ ,1 9,752 (;&,6,21 2) $'(12$662&,$7(' 9,586 '1$ )520 5(&20%,1$17 3/$60,'6 ,62/$7,21 2) $1 (1=<0( )5$&7,21 )520 +(/$ &(//6 7+$7 &/($9(6 '1$ $7 32/<385,1( 32/<3<5,0,',1( 6(48(1&(6 5,&+ ,1 *& %$6( 3$,56 %\ + -RQDWKDQ *RWWOLHE $XJXVW &KDLUPDQ 1LFKRODV 0X]\F]ND 0DMRU 'HSDUWPHQW ,PPXQRORJ\ DQG 0HGLFDO 0LFURELRORJ\ :KHQ FLUFXODU UHFRPELQDQW SODVPLGV FRQWDLQLQJ DGHQRDVVRFLDWHG YLUXV $$9f '1$ VHTXHQFHV DUH WUDQVIHFWHG LQWR KXPDQ FHOOV WKH $$9 SURYLUXV LV UHVFXHG 8VLQJ WKHVH FLUFXODU $$9 SODVPLGV DV VXEVWUDWHV D FHOOXODU VLWHVSHFLILF HQGRQXFOHDVH HQGR 5 ZDV LVRODWHG IURP +H/D FHOO QXFOHL RQ WKH EDVLV RI LWV DELOLW\ WR H[FLVH LQWDFW $$9 VHTXHQFHV LQ YLWUR IURP WKH YHFWRU '1$ DQG SURGXFH OLQHDU '1$ SURGXFWV 7KH HQ]\PH UHFRJQL]HV DQG FOHDYHV SRO\SXULQHSRO\S\ULPLGLQH VHTXHQFHV ZKLFK DUH DW OHDVW UHVLGXHV ORQJ DQG ULFK LQ *& EDVH SDLUV 6XFK VHTXHQFHV RFFXU QDWXUDOO\ LQ QRQFRGLQJ UHJLRQV RI KLJKHU HXFDU\RWHV DUH SUHVHQW LQ $$9 UHFRPELQDQW SODVPLGV DV SDUW RI WKH ILUVW ES RI WKH $$9 WHUPLQDO UHSHDW DQG LQ VRPH FDVHV DUH SUHVHQW DW WKH $$9YHFWRU MXQFWLRQ DV WKH UHVXOW RI FORQLQJ E\ *& WDLOLQJ 3ODVPLG '1$ WKDW LV WUDQVIHFWHG LQWR WLVVXH FXOWXUH FHOOV LV FOHDYHG LQ YLYR WR SURGXFH D SDWWHUQ RI '1$ IUDJPHQWV VLPLODU WR WKDW VHHQ ZLWK SXULILHG HQ]\PH LQ YLWUR 7KH OHYHO [L

PAGE 12

RI VSHFLILF FOHDYDJH LQ WKH VWDQGDUG DVVD\ GHSHQGV RQ WKH W\SH DQG OHQJWK RI WKH UHFRJQLWLRQ VLJQDO LQ WKH VXEVWUDWH *HQHUDOO\ ORQJHU DQG PRUH KRPRJHQHRXV VWUHWFKHV RI SRO\G*fSRO\G&f DUH EHWWHU VXEVWUDWHV IRU GRXEOHVWUDQGHG FOHDYDJH 7KH HQ]\PH DSSDUHQWO\ UHFRJQL]HV WKH VHFRQGDU\ VWUXFWXUH FKDUDFWHULVWLF RI *ULFK SRO\SXULQH VHTXHQFHV LQ GXSOH[ '1$ 6HTXHQFH DQDO\VLV RI WKH FXW VLWH VXJJHVWV WKDW GRXEOHVWUDQGHG FOHDYDJH RFFXUV WKURXJK D VHULHV RI FRQFHUWHG VLQJOHVWUDQGHG QLFNV RI WKH VXEVWUDWH WKURXJKRXW WKH HQ]\PH UHFRJQLWLRQ VLWH 7KH PROHFXODU ZHLJKW RI WKH DFWLYH IRUP RI HQGR 5 ZDV HVWLPDWHG E\ JHO ILOWUDWLRQ DQG VHGLPHQWDWLRQ LQ JO\FHURO JUDGLHQWV WR EH DSSUR[LPDWHO\ 7KH HQ]\PH ZKLFK UHTXLUHV PDJQHVLXP DV D FRIDFWRU GRHV QRW KDYH VLJQLILFDQW HQGRQXFOHRO\WLF DFWLYLW\ RQ VLQJOH VWUDQGHG '1$ EXW LV HTXDOO\ DFWLYH RQ FORVHG FLUFXODU DQG OLQHDU GXSOH[ '1$ VXEVWUDWHV 7KH SURSHUWLHV RI HQGR 5 DUH FRQVLVWHQW ZLWK LW SOD\LQJ D UROH LQ WKH UHVFXH RI LQWHJUDWHG $$9 VHTXHQFHV 7KH HQ]\PHnV IXQFWLRQ LQ FHOOXODU '1$ PHWDEROLVP LV OHVV REYLRXV EXW LWV SURSHUWLHV VXJJHVW WKDW LW PD\ KDYH D UROH LQ FHOOXODU '1$ UHSOLFDWLRQ DQG UHFRPELQDWLRQ [LL

PAGE 13

&+$37(5 ,1752'8&7,21 ,QWURGXFWLRQ $ PDMRU REVWDFOH LQ WKH FKDUDFWHUL]DWLRQ RI FHOOXODU IDFWRUV LQYROYHG LQ PDPPDOLDQ '1$ PHWDEROLVP OLHV LQ HVWDEOLVKLQJ D ELRFKHPLFDOO\ DQG JHQHWLFDOO\ GHILQHG V\VWHP )RU WKH PRVW SDUW WKH FRPSOH[LW\ RI FHOOXODU SURFHVVHV DQG WKH ODFN RI JHQHWLF DQDO\VLV LQ KLJKHU HXFDU\RWHV SUHYHQW DFFXUDWH FKDUDFWHUL]DWLRQ RI WKHVH SURFHVVHV 7KLV SUREOHP KDV EHHQ SDUWLDOO\ FLUFXPYHQWHG ZLWK WKH XVH RI ZHOO FKDUDFWHUL]HG PDPPDOLDQ YLUDO V\VWHPV DV SUREHV IRU FHOOXODU IXQFWLRQV &KDOOEHUJ DQG .HOO\ /L DQG .HOO\ 0XUDNDPL HW DO f ,Q WKLV UHJDUG DGHQRDVVRFLDWHG YLUXV $$9f LV LGHDO $$9 KDV EHHQ ZHOO FKDUDFWHUL]HG JHQHWLFDOO\ +HUPRQDW HW DO f DQG EHFDXVH RI LWV VPDOO VL]H LV ODUJHO\ GHSHQGHQW RQ FHOOXODU IXQFWLRQV IRU YLUDO PXOWLSOLFDWLRQ %HUQV HW DO f $$9 '1$ 5HSOLFDWLRQ 7KH FXUUHQW PRGHO IRU $$9 '1$ UHSOLFDWLRQ LV D PRGLILHG YHUVLRQ RI D JHQHUDO PRGHO IRU WKH UHSOLFDWLRQ RI HXFDU\RWLF '1$ PROHFXOHV ILUVW SURSRVHG E\ &DYDOLHU6PLWK &DYDOLHU6PLWK +DXVZLUWK DQG %HUQV 6WUDXV HW DO f $$9 FRQWDLQV D NE VLQJOHVWUDQGHG OLQHDU JHQRPH FRQVLVWLQJ RI DQ LQWHUQDO QRQUHSHWLWLYH VHTXHQFH ZKLFK LV IODQNHG DW HDFK HQG E\ LQYHUWHG WHUPLQDO UHSHDWV WKDW DUH SDOLQGURPLF /XVE\ HW DO f '1$ UHSOLFDWLRQ SURFHHGV E\ OHDGLQJ VWUDQG

PAGE 14

)LJXUH 0RGHO IRU $$9 '1$ 5HSOLFDWLRQ 7KH PRGHO IRU $$9 '1$ UHSOLFDWLRQ LV D PRGLILHG YHUVLRQ RI WKH PRGHO IRU HXNDU\RWLF '1$ UHSOLFDWLRQ ILUVW GHVFULEHG E\ &DYDOLHU6PLWK f Lf 6LQJOH RU GRXEOHVWUDQGHG VSHFLILF FOHDYDJH DW WKH $$9S%5 MXQFWLRQ LV QHFHVVDU\ WR DOORZ IRUPDWLRQ RI WKH KDLUSLQ SULPHU LQ WKH SDOLQGURPLF UHJLRQ RI WKH WHUPLQL 6LWH VSHFLILF FOHDYDJH PXVW RFFXU DW WKH RWKHU $$9YHFWRU MXQFWLRQ HLWKHU EHIRUH RU GXULQJ '1$ V\QWKHVLV WR VHSDUDWH $$9 DQG YHFWRU VHTXHQFHV LLf '1$ UHSOLFDWLRQ SURFHHGV IURP WKH n HQG RI WKH SULPHU WR WKH RWKHU HQG RI WKH PROHFXOH DQG LQFOXGHV V\QWKHVLV RI WKH GLVWDO WHUPLQDO UHSHDW LLLf $ VSHFLILF QLFN LV UHTXLUHG RQ WKH SDUHQWDO VWUDQG GLUHFWO\ DFURVV IURP WKH RULJLQDO n HQG RI WKH SULPHU WR DOORZ UHSDLU RI WKH SDUHQWDO WHUPLQDO VHTXHQFHV LYf %RWK WKH SDUHQWDO DQG SURJHQ\ VWUDQGV DUH QRZ FDSDEOH RI LQLWLDWLQJ DQRWKHU '1$ UHSOLFDWLRQ F\FOH

PAGE 15

, 6LWH6SHFLILF &OHDYDJH /Q aX 5) 5HVROXWLRQ

PAGE 16

V\QWKHVLV IURP WKH KDLUSLQ SULPHU IRUPHG LQ WKH SDOLQGURPLF UHJLRQ RI WKH WHUPLQDO UHSHDW )LJXUH f 6WUDQG HORQJDWLRQ SURFHHGV IURP WKH n HQG RI WKH SULPHU LQ D n WR n GLUHFWLRQ WR WKH RWKHU HQG RI WKH PROHFXOH $ VSHFLILF QLFN LV UHTXLUHG LQ WKH SDUHQWDO VWUDQG DW D SRLQW GLUHFWO\ DFURVV IURP WKH RULJLQDO n WHUPLQDO EDVH WR DOORZ UHSDLU RI WKH SDUHQWDO WHUPLQDO VHTXHQFHV DQG WR SURGXFH D IXOOOHQJWK GXSOH[ UHSOLFDWLYH LQWHUPHGLDWH 6XEVHTXHQWO\ ERWK WKH SDUHQWDO DQG SURJHQ\ VWUDQGV DUH FDSDEOH RI LQLWLDWLQJ D VHFRQG URXQG RI '1$ UHSOLFDWLRQ DQG GLVSODFLQJ D SURJHQ\ VLQJOHVWUDQGHG '1$ PROHFXOH 5HVFXH RI /DWHQW $$9 3URYLUXV $$9 LV D GHIHFWLYH SDUYRYLUXV DQG UHTXLUHV WKH SUHVHQFH RI D FRn LQIHFWLQJ KHOSHU YLUXV IRU D SURGXFWLYH YLUDO LQIHFWLRQ 9LUWXDOO\ DQ\ PHPEHU RI WKH DGHQRYLUXV RU KHUSHV YLUXV IDPLO\ FDQ VXSSO\ WKH KHOSHU IXQFWLRQV $WFKLVRQ HW DO %XOOHU HW DO 0F3KHUVRQ HW DO f ,Q WKH DEVHQFH RI D KHOSHU YLUXV $$9 UHDGLO\ LQWHJUDWHV LQWR WKH KRVW '1$ +RJJDQ HW DO %HUQV HW DO +DQGD HW DO f HLWKHU DV D VLQJOH SURYLUDO FRS\ RU PRUH RIWHQ DV D WDQGHP KHDG WR WDLO DUUD\ RI VHYHUDO $$9 JHQRPHV &KHXQJ HW DO /DXJKOLQ HW DO 0F/DXJKOLQ HW DO f 6XSHULQIHFWLRQ RI ODWHQWO\ LQIHFWHG FHOOV ZLWK KHOSHU YLUXV UHVXOWV LQ WKH UHVFXH RI LQWHJUDWHG SURYLUXV DQG QRUPDO $$9 UHSOLFDWLRQ +RJJDQ HW DO f ,Q PDQ\ SURYLUDO FHOO OLQHV WKH \LHOG RI UHSOLFDWLYH LQWHUPHGLDWHV DQG YLUXV SURGXFHG E\ VXSHULQIHFWLRQ ZLWK KHOSHU YLUXV DUH LGHQWLFDO WR WKRVH REWDLQHG IURP H[RJHQRXV $$9 LQIHFWLRQV /DXJKOLQ HW DO 0F/DXJKOLQ HW DO f 7KLV VXJJHVWHG WKDW WKH UHVFXH RI $$9 VHTXHQFHV IURP FKURPDWLQ LV D UDSLG HYHQW LQLWLDWHG E\ VSHFLILF FOHDYDJH

PAGE 17

ZLWKLQ WKH $$9 WHUPLQL $GGLWLRQDO HYLGHQFH WKDW $$9 UHVFXH LQYROYHV D VLWHVSHFLILF QXFOHDVH FRPHV IURP WKH VWXG\ RI UHFRPELQDQW $$9 SODVPLGV ZKLFK SUHVXPDEO\ UHVFXH E\ D PHFKDQLVP VLPLODU WR WKDW XVHG E\ SURYLUXVHV LQWHJUDWHG LQWR FKURPDWLQ 6DPXOVNL HW DO f :KHQ $$9 S%5 SODVPLGV DUH WUDQVIHFWHG LQWR KXPDQ FHOOV LQ WKH SUHVHQFH RI DGHQRYLUXV IUHH OLQHDU GXSOH[ $$9 '1$ WKH PDMRU UHSOLFDWLYH IRUP 6WUDXV HW DO +DXVZLUWK DQG %HUQV f LV VHHQ ZLWKLQ KRXUV 6DPXOVNL HW DO f +RZHYHU ZKHQ YLDEOH WHUPLQDO GHOHWLRQ PXWDQWV DUH WUDQVIHFWHG LQWR DGHQRYLUXV LQIHFWHG FHOOV WKH IRUPDWLRQ RI UHSOLFDWLYH IRUPV 5)f LV GHOD\HG 6DPXOVNL HW DO /HIHEYUH HW DO 6DPXOVNL HW DO f LQGLFDWLQJ WKDW HLWKHU JHQH FRQYHUVLRQ RI WKH WHUPLQDO GHOHWLRQ FDXVHV D GHOD\ LQ '1$ V\QWKHVLV RU WKDW $$9 VHTXHQFHV DW WKH WHUPLQL DUH UHTXLUHG IRU H[FLVLRQ 6WXGLHV ZLWK WKH $$9 PXWDQW SVXE LQ ZKLFK WKH WHUPLQDO ES KDYH EHHQ GHOHWHG IURP ERWK HQGV VXJJHVW WKDW WKH GHOD\ LQ 5) IRUPDWLRQ LV GXH WR D GHIHFW LQ UHVFXH 6DPXOVNL HW DO f DQG WKDW WKH VLJQDO IRU $$9 H[FLVLRQ UHVLGHV LQ WKH WHUPLQDO VHTXHQFHV $$9 '1$ UHSOLFDWLRQ LQ DGHQRYLUXV LQIHFWHG FHOOV WUDQVIHFWHG ZLWK SVXE ZDV HLJKWIROG PRUH HIILFLHQW ZKHQ WKH $$9 VHTXHQFHV ZHUH FOHDYHG IURP WKH YHFWRU VHTXHQFHV SULRU WR WUDQVIHFWLRQ 6DPXOVNL HW DO f 3UHVXPDEO\ FOHDYDJH RI WKH SODVPLG E\SDVVHG WKH H[FLVLRQ VWHS ZKLFK PXVW QRUPDOO\ SUHFHGH '1$ UHSOLFDWLRQ ,Q SULQFLSOH WKH GXSOH[ UHSOLFDWLYH LQWHUPHGLDWH FDQ EH JHQHUDWHG IURP WKH FRYDOHQWO\ FORVHG IRUP SODVPLG '1$ LQ RQH RI WZR ZD\V (LWKHU WKH $$9 VHTXHQFHV DUH VHSDUDWHG IURP WKH SODVPLG E\ SUHFLVH H[FLVLRQ RU D VLQJOHVWUDQGHG '1$ PROHFXOH LV JHQHUDWHG E\ $$9VSHFLILF UHSOLFDWLRQ 6HH 6DPXOVNL HW DO DQG 6HQHSDWK\ HW DO

PAGE 18

IRU H[DPSOHV RI WKH VHFRQG PHFKDQLVPf %HFDXVH WKH $$9 WHUPLQL DUH DOVR WKH RULJLQV IRU $$9 '1$ UHSOLFDWLRQ +DXVZLUWK DQG %HUQV 6DPXOVNL HW DO 6HQHSDWK\ HW DO f LW LV GLIILFXOW WR GLVWLQJXLVK EHWZHHQ WKH WZR PHFKDQLVPV %RWK PHFKDQLVPV KRZHYHU UHTXLUH HLWKHU D VSHFLILF QLFN RU D GRXEOHVWUDQGHG FXW DW DQ $$9YHFWRU MXQFWLRQ LQ WKH LQSXW SODVPLG '1$ )LJXUH f 7KXV LW VKRXOG EH SRVVLEOH WR XVH $$9 UHFRPELQDQW SODVPLGV DV VXEVWUDWHV IRU DQ LQ YLWUR H[FLVLRQ DVVD\ DQG WR VFUHHQ FHOOXODU H[WUDFWV IRU DQ DFWLYLW\ WKDW SURGXFHV HLWKHU VLQJOH VWUDQGHG QLFNV RU GRXEOHVWUDQGHG FXWV DW WKH $$9YHFWRU MXQFWLRQV *HQHUDO $LP RI WKH 6WXGLHV 8VLQJ WKH UHFRPELQDQW $$9 SODVPLGV DV VXEVWUDWHV DQ HQ]\PH IUDFWLRQ ZDV LVRODWHG IURP +H/D FHOO QXFOHDU H[WUDFWV WKDW UHVFXHG LQWDFW $$9 '1$ IURP YHFWRU '1$ LQ YLWUR DQG SURGXFHG OLQHDU '1$ SURGXFWV 7KH GRXEOHVWUDQGHG FOHDYDJH DFWLYLW\ KDV EHHQ FDOOHG HQGR 5 EHFDXVH RI LWV DELOLW\ WR UHVFXH $$9 VHTXHQFHV 7KH DFWLYLW\ ZDV RI FHOOXODU RULJLQ DQG ZDV VWLPXODWHG DSSUR[LPDWHO\ IROG E\ $G LQIHFWLRQ LQ WKH SUHVHQFH RI K\GUR[\XUHD ,Q WKH IROORZLQJ FKDSWHUV WKH SXULILFDWLRQ DQG SURSHUWLHV RI WKH HQ]\PH DUH GLVFXVVHG DQG WKH DFWLYLW\ REVHUYHG LQ YLWUR LV FRPSDUHG ZLWK ZKDW LV REVHUYHG LQ YLYR ,Q DGGLWLRQ WKH EHKDYLRU RI WKH HQ]\PH VXJJHVWV WKDW LW PD\ EH LQYROYHG LQ FHOOXODU '1$ PHWDEROLVP DQG WKHVH SURSHUWLHV DUH GLVFXVVHG DV ZHOO

PAGE 19

&+$37(5 ,, 0$7(5,$/6 $1' 0(7+2'6 &HOO &XOWXUH DQG 9LUXVHV +H/D 6 FHOOV ZHUH PDLQWDLQHG DW r& LQ VXVSHQVLRQ FXOWXUH LQ (DJOHV PLQLPDO HVVHQWLDO PHGLXP VXSSOHPHQWHG ZLWK b FDOI VHUXP b JOXWDPLQH SHQLFLOOLQ DQG VWUHSWRP\FLQ :LOG W\SH DGHQRYLUXV $Gf ZDV SUHSDUHG IURP D IUHH]HWKDZ O\VDWH RI +H/D 6 FHOOV DV SUHYLRXVO\ GHVFULEHG 6DPXOVNL HW DO f +H/D PRQROD\HU FHOOV ZHUH WUDQVIHFWHG ZLWK J '1$ E\ WKH '($(GH[WUDQ PHWKRG 0F&XWFKDQ DQG 3DJDQR f DV GHVFULEHG 0X]\F]ND f DQG LQIHFWHG ZLWK $G YLUXV DW D PXOWLSOLFLW\ RI LQIHFWLRQ PRLf RI /RZ PROHFXODU '1$ ZDV LVRODWHG IURP WKH FHOOV E\ WKH PHWKRG RI +LUW f DV GHVFULEHG 0X]\F]ND f 5HFRPELQDQW &ORQHV DQG (Q]\PH 6XEVWUDWHV $OO UHFRPELQDQW FORQHV ZHUH PDLQWDLQHG LQ HLWKHU WKH UHF$ KRVW +% %R\HU f RU WKH UHF%& UHF) VEF% KRVW -& %RLVV\ DQG $VWHOO f D JLIW IURP 3HWHU 7DWWHUVDOO 7KLV ZDV WR SUHYHQW YDULDWLRQ LQ WKH VL]H RI WKH *& WDLOV DQG RWKHU UHSHWLWLYH LQVHUWV +DXVZLUWK HW DO f DQG WR SUHYHQW GHOHWLRQ RI WKH SDOLQGURPLF $$9 WHUPLQDO UHSHDW 6DPXOVNL HW DO f 7KH $$9 ZLOGW\SH SODVPLG S60 FRQWDLQV D IXOO FRS\ RI WKH $$9 JHQRPH LQVHUWHG E\ *& WDLOLQJ LQWR WKH 3VW, VLWH RI S%5 %ROLYDU HW DO f 7KH SODVPLG FRQWDLQV ES RI SRO\G*fSRO\G&f *&f DW

PAGE 20

WKH OHIW S%5$$9 MXQFWLRQ DQG ES RI *& DW WKH ULJKW MXQFWLRQ 6DPXOVNL HW DO f 7KH $$9 WHUPLQDO PXWDQW FORQH S60 ZDV LVRODWHG E\ 6DPXOVNL HW DO f DQG ZDV VHTXHQFHG DV SDUW RI WKLV VWXG\ ,W FRQWDLQV ES GHOHWLRQV LQ ERWK $$9 WHUPLQDO VHTXHQFHV ES RI *& WDLO DW WKH ULJKW $$9S%5 MXQFWLRQ DQG ES *& DW WKH OHIW MXQFWLRQ 7KH SODVPLGV S*0& DQG S*0' FRQWDLQ HLWKHU WKH OHIW RU WKH ULJKW WHUPLQDO 3VW, IUDJPHQW UHVSHFWLYHO\ RI WKH ZLOGW\SH $$9 SODVPLG S60 6DPXOVNL HW DO f VXEFORQHG LQWR WKH 3VW, VLWH RI S%5 %ROLYDU HW DO f %RWK FORQHV FRQWDLQ WKH RULJLQDO SRO\G*fSRO\G&f WDLOV WKDW DUH SUHVHQW LQ S60 7KH SODVPLG S*0 ZDV FRQVWUXFWHG E\ UHPRYLQJ WKH 3VWO%VV+,, IUDJPHQW $$9 QXFOHRWLGHV WR f IURP S*0' DQG UHOLJDWLQJ WKH PROHFXOH DIWHU SURGXFLQJ EOXQW HQGV ZLWK WKH .OHQRZ IUDJPHQW RI '1$ SRO\PHUDVH 7KH SODVPLG FRQWDLQV WKH SDUHQWDO SRO\G*fSRO\G&f WDLO SOXV WKH WHUPLQDO ES RI WKH $$9 VHTXHQFH XS WR WKH %VV+,, VLWH DW QXFOHRWLGH 7KH SODVPLGV S*0 S*0 S*0 S*0 S*0 S*0 DQG S*0 ZHUH FRQVWUXFWHG E\ LQVHUWLQJ FKHPLFDOO\ V\QWKHVL]HG ROLJRQXFOHRWLGHV 6\VWHFf LQWR D XQLTXH UHVWULFWLRQ VLWH LQ S%5 7R FRQVWUXFW WKHVH FORQHV SPRO RI VLQJOHVWUDQGHG ROLJRPHU ZDV ERLOHG ZLWK DQ HTXDO DPRXQW RI WKH DSSURSULDWH FRPSOHPHQWDU\ VWUDQG LQ LO RI ZDWHU IRU PLQXWHV 7KH UHDFWLRQ ZDV WKHQ FRROHG VORZO\ WR URRP WHPSHUDWXUH WR DOORZ WKH IRUPDWLRQ RI GXSOH[ PROHFXOHV /LJDWLRQ UHDFWLRQ PL[WXUHV FRQWDLQLQJ SPRO RI DQQHDOHG ROLJRPHU SPRO RI 3VW, OLQHDUL]HG S%5 DQG XQLWV RI 7 '1$ /LJDVH 1HZ (QJODQG %LR/DEVf ZHUH LQFXEDWHG DW r& IRU KRXUV 7KH n HQGV RI WKH VLQJOHVWUDQGHG ROLJRPHUV ZHUH SKRVSKRU\ODWHG RQO\ ZKHQ PXOWLSOH WDQGHP FRSLHV RI WKH LQVHUW ZHUH GHVLUHG 'HSKRVSKRU\ODWLRQ RI WKH YHFWRU ZDV

PAGE 21

JHQHUDOO\ QRW UHTXLUHG XQGHU WKHVH FRQGLWLRQV 3RVLWLYH FORQHV UHWDLQHG WHWUDF\FOLQH UHVLVWDQFH EXW ZHUH VHQVLWLYH WR DPSLFLOOLQ 7KH SODVPLGV 3*0 DQG S*0 FRQWDLQ DQG EDVH SDLUV RI *& KRPRSRO\PHU UHVSHFWLYHO\ 3*0 FRQWDLQV ES RI DOWHUQDWLQJ FRSRO\PHU *& DQG S*0O FRQWDLQV WKH 'LFW\RVWHOLXP WHORPHULF UHSHDW VHTXHQFH &A AKDPSD\ HMWBDO f 7ZR SODVPLGV FRQWDLQ WKH VHTXHQFH RI WKH WHUPLQDO ES RI $$9 JJ&&D&7&&&7&7&7J&J&J&f LQ HLWKHU D PRQRPHU IRUP S*0f RU DV DQ LQYHUWHG GLPHU S*0f $OO RI WKH DERYH FORQHV ZHUH FRQVWUXFWHG E\ LQVHUWLQJ WKH ROLJRPHUV LQWR WKH 3VW, VLWH RI S%5 $GGLWLRQDOO\ WKH SODVPLG S*0 FRQWDLQV DQ LQVHUW RI WKH 7HWUDK\PHQD WHORPHULF VHTXHQFH Af %ODFNEXUQ DQG 6]RVWDN f FKHPLFDOO\ V\QWKHVL]HG DQG LQVHUWHG LQWR WKH (DJ, VLWH RI S%5 ,Q HDFK FDVH ERWK VWUDQGV RI WKH ROLJRQXFOHRWLGHV ZHUH V\QWKHVL]HG VR WKDW WKH UHVWULFWLRQ HQ]\PH UHFRJQLWLRQ VLWH ZDV PDLQWDLQHG DIWHU WKH WZR VWUDQGV RI HDFK ROLJRQXFOHRWLGH ZHUH DQQHDOHG DQG OLJDWHG LQWR S%5 7KH LQVHUWV DQG S%5 IODQNLQJ VHTXHQFHV RI WKHVH SODVPLGV ZHUH FRQILUPHG E\ '1$ VHTXHQFLQJ 7KH SODVPLG S*$ D JLIW IURP 7RGG (YDQV FRQWDLQV DQ LQVHUW RI WKH DOWHUQDWLQJ FRSRO\PHU *$AJ FORQHG LQWR WKH (FR5, VLWH RI S8& (YDQV DQG (IVWUDWLDWLV f 3*$ LV D VXEFORQH RI S*$ DQG FRQWDLQV DQ LQVHUW RI *$fT FORQHG LQWR WKH (FR5, VLWH RI S8& 7KH SODVPLG S(9 D JLIW IURP (FNKDUGW :LPPHU LV DQ LQIHFWLRXV SROLR FORQH DQG FRQWDLQV DQ ES *& LQVHUW DW WKH (FR5, VLWH DV ZHOO DV DQ ES VWUHWFK RI SRO\G$fSRO\G7f 6HPOHU HW DO f

PAGE 22

3XULILFDWLRQ RI (QGR 5 $OO RSHUDWLRQV ZHUH FDUULHG RXW DW r& 7R PLQLPL]H WKH HIIHFWV RI SURWHRO\VLV DOO EXIIHUV FRQWDLQHG P0 SKHQ\OPHWK\OVXOIRQ\O IOXRULGH 306)f DQG WKH WLPH EHWZHHQ FKURPDWRJUDSKLF VWHSV ZDV NHSW WR D PLQLPXP 1XFOHL IURP HLJKW OLWHUV RI DGHQRYLUXV LQIHFWHG +H/D 6 FHOOV JURZQ LQ WKH SUHVHQFH RI P0 K\GUR[\XUHD 6LJPD &KHPLFDO &Rf ZHUH LVRODWHG DV GHVFULEHG E\ &KDOOEHUJ DQG .HOO\ f )UR]HQ QXFOHL ZHUH WKDZHG RQ LFH DQG 0 1D&O ZDV DGGHG WR D ILQDO FRQFHQWUDWLRQ RI 0 $IWHU LQFXEDWLRQ RQ LFH IRU KRXUV WKH QXFOHL ZHUH SHOOHWHG E\ FHQWULIXJDWLRQ DW [ J IRU PLQXWHV WKH SHOOHW ZDV GLVFDUGHG DQG WKH VXSHUQDWDQW ZDV GLDO\]HG DJDLQVW P0 7ULV+&O S+ P0 .& P0 ('7$ P0 PHUFDSWRHWKDQRO P0 306) DQG b JO\FHURO %XIIHU $f $Q\ LQVROXEOH SUHFLSLWDWH LQ WKH QXFOHDU H[WUDFW ZDV UHPRYHG E\ FHQWULIXJDWLRQ DW [ J IRU PLQXWHV DQG WKH VXSHUQDWDQW ZDV UHWDLQHG DV IUDFWLRQ )UDFWLRQ FRQWDLQHG PJPO SURWHLQ DV GHWHUPLQHG E\ WKH %UDGIRUG SURWHLQ FRQFHQWUDWLRQ DVVD\ %UDGIRUG f LQ D YROXPH RI PO )UDFWLRQ ZDV ORDGHG RQWR D PO '($( FHOOXORVH FROXPQ SUHYLRXVO\ HTXLOLEUDWHG ZLWK EXIIHU $ S+ 7KH FROXPQ ZDV WKHQ ZDVKHG ZLWK FROXPQ YROXPHV RI EXIIHU $ DQG HOXWHG LQ WKH VDPH EXIIHU ZLWK D PO OLQHDU JUDGLHQW FRQWDLQLQJ WR 0 .& )UDFWLRQV HPHUJLQJ EHWZHHQ DQG 0 .&O ZHUH SRROHG WR IRUP IUDFWLRQ ,, DQG FRQWDLQHG PJPO SURWHLQ D WRWDO YROXPH RI PLV )UDFWLRQ ,, ZDV GLDO\]HG DJDLQVW WZR OLWHU FKDQJHV RI EXIIHU % P0 VRGLXP SKRVSKDWH S+ P0 PHUFDSWRHWKDQRO b JO\FHURO DQG P0 306)f FRQWDLQLQJ 0 1D&O DQG ORDGHG RQWR D PO SKRVSKRFHOOXORVH FROXPQ SUHZDVKHG ZLWK PLV RI WKH VDPH EXIIHU 7KH FROXPQ ZDV HOXWHG ZLWK D

PAGE 23

PO OLQHDU JUDGLHQW IURP WR 0 1D&O LQ EXIIHU % $FWLYH IUDFWLRQV HPHUJHG DERXW KDOIZD\ WKURXJK WKH JUDGLHQW DQG ZHUH SRROHG WR IRUP IUDFWLRQ ,,, )UDFWLRQ ,,, FRQWDLQHG PJPO SURWHLQ LQ PO DQG KDG D VSHFLILF HQGR 5 DFWLYLW\ RI DSSUR[LPDWHO\ XQLWVPJ )UDFWLRQ ,,, ZDV VSOLW LQWR DOLTXRWV DQG HDFK DOLTXRW ZDV FRQFHQWUDWHG DERXW IROG XVLQJ DQ $PLFRQ &HQWULIOR VSLQ FRQFHQWUDWRU \LHOGLQJ D ILQDO SURWHLQ FRQFHQWUDWLRQ RI PJPO LQ PO 7KH WZR PO DOLTXRWV RI FRQFHQWUDWHG IUDFWLRQ ,,, ZHUH SDVVHG VHSDUDWHO\ WKURXJK D PO [ FPf FROXPQ RI 6HSKDGH[ HTXLOLEUDWHG ZLWK EXIIHU % S+ P0 1D&O )UDFWLRQV FRQWDLQLQJ HQGR 5 DFWLYLW\ ZHUH SRROHG IUDFWLRQ ,9f GLDO\]HG DJDLQVW EXIIHU % FRQWDLQLQJ 0 1D&O DQG ORDGHG RQWR D PO SRO\G*f DJDURVH FROXPQ HTXLOLEUDWHG LQ EXIIHU % P0 1D&O 7KH FROXPQ ZDV ZDVKHG ZLWK EHG YROXPHV RI WKH VDPH EXIIHU DQG HOXWHG ZLWK D PO OLQHDU JUDGLHQW IURP 0 1D&O $FWLYH IUDFWLRQV ZHUH SRROHG IUDFWLRQ 9f DQG GLDO\]HG LQWR P0 7ULV+&O S+ b JO\FHURO P0 '77 )UDFWLRQ 9 ZDV VWDEOH IRU DW OHDVW PRQWKV DW r& ZLWKRXW PHDVXUDEOH ORVV RI DFWLYLW\ 1XFOHDVH $VVD\V 7KH VWDQGDUG HQGR 5 UHDFWLRQ PL[WXUHV RI , FRQWDLQHG P0 7ULV+&O S+ f P0 0J&A P0 GLWKLRWKUHLWRO SPRO IRUP SODVPLG VXEVWUDWH DQG XQLWV RI HQGR 5 VHH EHORZf $IWHU LQFXEDWLRQ DW r& WKH UHDFWLRQ SURGXFWV ZHUH SKHQRO H[WUDFWHG HWKDQRO SUHFLSLWDWHG DQG GLJHVWHG ZLWK HLWKHU %VW(,, DW r& IRU KRXU RU ZLWK 6SK, DW r& IRU KRXUV 7KH UHDFWLRQ SURGXFWV ZHUH WKHQ IUDFWLRQDWHG E\ HOHFWURSKRUHVLV RQ b DJDURVH JHOV 2QH XQLW RI HQGR 5 DFWLYLW\ LV GHILQHG DV WKDW DPRXQW RI SURWHLQ WKDW LV UHTXLUHG WR FOHDYH b RI

PAGE 24

S*0' VXEVWUDWH XQGHU VWDQGDUG FRQGLWLRQV 'XULQJ HDUO\ VWDJHV RI WKH SXULILFDWLRQ LW ZDV QHFHVVDU\ WR WUHDW WKH UHDFWLRQ SURGXFWV ZLWK PJPO SURWHLQDVH 6LJPDf IRU KRXU DW r& SULRU WR SKHQRO H[WUDFWLRQ DQG JHO HOHFWURSKRUHVLV :KHQ LQGLFDWHG HQGR 5 FOHDYDJH UHDFWLRQV ZHUH WHUPLQDWHG ZLWK WKH DGGLWLRQ RI DQ HTXDO YROXPH RI D [ SURWHLQDVH VWRS VROXWLRQ FRQWDLQLQJ PJPO 3URWHLQDVH b 6'6 DQG P0 ('7$ $IWHU DGGLWLRQ RI WKH VWRS VROXWLRQ LQFXEDWLRQ ZDV FRQWLQXHG DW r& IRU DW OHDVW KRXU 6LQJOHVWUDQGHG QXFOHDVH DVVD\V FRQWDLQHG SJ RI KHDWGHQDWXUHG A+ODEHOHG ( FROL FKURPRVRPDO '1$ [ A FSPSJf LQ SL )RU 6, QXFOHDVH WKH PL[WXUHV FRQWDLQHG P0 VRGLXP DFHWDWH S+ f 0 1D&O P0 =Q&A DQG XQLWV RI 6, ZKLOH WKH HQGR 5 UHDFWLRQ ZDV XQGHU VWDQGDUG UHDFWLRQ FRQGLWLRQV 7ZHQW\ILYH PLFUROLWHU SRUWLRQV ZHUH UHPRYHG DW WKH LQGLFDWHG WLPHV DQG DGGHG WR PO RI b WULFKORURDFHWLF DFLG 7&$f FRQWDLQLQJ SJPO %6$ 7KH SUHFLSLWDWHV ZHUH FROOHFWHG RQ QLWURFHOOXORVH ILOWHUV 6FKOHLFKHU DQG 6FKXHOO W\SH %$f ZDVKHG ZLWK 7&$ DQG HWKDQRO DQG WKHQ FRXQWHG (FROL '1$ ZDV 2 ODEHOHG ZLWK +WK\PLGLQH &LPPROH ,&1f DQG LVRODWHG DV GHVFULEHG +ROORPDQ HW DO f '1$ /DEHOLQJ 6HTXHQFLQJ DQG 3ULPHU ([WHQVLRQ 1XFOHRWLGH VHTXHQFHV ZHUH GHWHUPLQHG E\ WKH PHWKRG RI 0D[DP DQG *LOEHUW f DQG E\ WKH GLGHR[\ PHWKRG 6DQJHU HW DO f )RU 0D[DP DQG *LOEHUW VHTXHQFLQJ RI WKH S*0 FORQHV SJ RI '1$ ZDV OLQHDUL]HG ZLWK 6HDO GHSKRVSKRU\ODWHG ZLWK FDOI LQWHVWLQH DONDOLQH SKRVSKDWDVH &,$3f DQG ODEHOHG DW WKH n HQG ZLWK SRO\QXFOHRWLGH NLQDVH R R DQG 3$73 RU ODEHOHG DW WKH n HQG ZLWK WKH .OHQRZ IUDJPHQW D 3

PAGE 25

G&73 DQG L0 HDFK RI G*73 G$73 DQG 773 )LYH PLFURJUDPV RI WKH ODEHOHG '1$ ZDV IXUWKHU GLJHVWHG ZLWK %DP+, DQG WKH n RU n ODEHOHG 6FDO%DP+, IUDJPHQWV ZHUH LVRODWHG IURP b ORZ PHOWLQJ DJDURVH SULRU WR VHTXHQFLQJ (QGR 5 FOHDYDJH IUDJPHQWV ZHUH SUHSDUHG E\ LQFXEDWLQJ WKH UHPDLQLQJ WJ RI n RU n ODEHOHG '1$ ZLWK XQLWV RI IUDFWLRQ 9 HQGR 5 XQGHU VWDQGDUG UHDFWLRQ FRQGLWLRQV DQG LVRODWLQJ WKH ODEHOHG HQGR 56FDO IUDJPHQWV IURP D b QRQGHQDWXULQJ DFU\ODPLGH JHO DV GHVFULEHG 0DQLDWLV HW DO f 7KH VHTXHQFH DW WKH VLWH RI FOHDYDJH ZDV GHWHUPLQHG GLUHFWO\ IURP WKH VHTXHQFLQJ JHOV E\ FRPSDULQJ WKH PRELOLW\ RI WKH HQGR 5 IUDJPHQWV DQG WKH VHTXHQFH PDUNHUV )RU SULPHU H[WHQVLRQ RI HQGR 5 SURGXFWV LJ RI SODVPLG '1$ ZDV LQFXEDWHG ZLWK HQGR 5 LQ D VWDQGDUG UHDFWLRQ PL[WXUH RI LO 7KH IRUP ,,, SURGXFW ZDV WKHQ LVRODWHG IURP b ORZ PHOWLQJ DJDURVH DQG GLVVROYHG LQ LO RI ZDWHU DQG WO RI [ UHDFWLRQ EXIIHU 0 7ULV +& S+ 0 1D&O P0 0J&O DQG P0 '77f 7KH UHDFWLRQ PL[WXUHV ZHUH GLYLGHG LQWR WZR LO SRUWLRQV DQG LO RI HLWKHU XSSHU RU ORZHU VWUDQG S%53VW, SULPHUV SPROLOf ZDV DGGHG WR HDFK SRUWLRQ 7KH VROXWLRQV ZHUH KHDWHG WR r& IRU PLQXWHV XQGHU SDUDILQ RLO DQG LPPHGLDWHO\ IUR]HQ LQ D GU\ LFHHWKDQRO EDWK $IWHU WKDZLQJ RQ LFH WO HDFK RI VWRFN VROXWLRQV FRQWDLQLQJ P0 G*73 P0 G&73 P0 773 P0 G$73 L&LLO D3G$73 &LP0f DQG XQLWVLO $09 UHYHUVH WUDQVFULSWDVH ,%,f ZHUH DGGHG WR HDFK SRUWLRQ WR SURGXFH D ILQDO UHDFWLRQ YROXPH RI LO $IWHU LQFXEDWLRQ DW r& IRU PLQXWHV LO RI FKDVH VROXWLRQ P0 HDFK RI G*73 G$73 G&73 DQG 773f ZDV DGGHG DQG LQFXEDWLRQ ZDV FRQWLQXHG DW r& IRU DQ DGGLWLRQDO PLQXWHV 7KH UHDFWLRQ ZDV WHUPLQDWHG ZLWK WKH DGGLWLRQ RI LO RI VWRS EXIIHU FRQWDLQLQJ LO 0 ('7$ WO 0 VRGLXP DFHWDWH LO

PAGE 26

PJPO W51$ DQG SL ZDWHU $IWHU HWKDQRO SUHFLSLWDWLRQ ZLWK YROXPHV RI b HWKDQRO WKH SULPHU H[WHQVLRQ SURGXFWV ZHUH UHGLVVROYHG LQ SL RI VHTXHQFH JHO UXQQLQJ EXIIHU 0D[DP DQG *LOEHUW f DQG KHDWHG WR r& IRU PLQXWHV SULRU WR JHO HOHFWURSKRUHVLV 7KH VHTXHQFH DW WKH VLWH RI HQGR 5 FOHDYDJH ZDV GHWHUPLQHG E\ FRPSDULQJ WKH PRELOLW\ RI WKH SULPHU H[WHQVLRQ SURGXFWV ZLWK GLGHR[\ VHTXHQFLQJ ODGGHUV SURGXFHG XVLQJ LGHQWLFDO VLQJOHVWUDQGHG SULPHUV *HO (OHFWURSKRUHVLV (OHFWURSKRUHVLV LQ WKH SUHVHQFH RI VRGLXP GRGHF\O VXOIDWH ZDV GRQH DFFRUGLQJ WR /DHPPOL f LQ VODE JHOV RI b DFU\ODPLGH b 11n PHWK\OHQHELVDFU\ODPLGH 7KH JHOV ZHUH IL[HG LQ b PHWKDQRO RYHUQLJKW DQG VLOYHU VWDLQHG DV GHVFULEHG 6ZLW]HU HW DO f 1HXWUDO SRO\DFU\ODPLGH DQG DJDURVH JHO HOHFWURSKRUHVLV RI '1$ ZDV DV GHVFULEHG 0X]\F]ND f '1$ IUDFWLRQDWHG RQ DJDURVH JHOV ZHUH WUDQVIHUUHG WR QLWURFHOOXORVH ILOWHUV 6RXWKHUQ f DQG K\EULGL]HG WR R R R 3QLFN WUDQVODWHG '1$ SUREH ![ FSPSJf DV GHVFULEHG 0X]\F]ND f 'HQDWXULQJ SRO\DFU\ODPLGHXUHD JHOV ZHUH DV GHVFULEHG 0D[DP DQG *LOEHUW f $OO VHTXHQFLQJ JHOV ZHUH UXQ DW r& WR SUHYHQW FRPSUHVVLRQ RI SDOLQGURPLF VHTXHQFHV /XVE\ HW DO f )RU GHQDWXULQJ DJDURVH JHOV b KRUL]RQWDO DJDURVH JHOV ZHUH SRXUHG LQ P0 1D&O DQG DOORZHG WR HTXLOLEUDWH LQ H[FHVV UXQQLQJ EXIIHU P0 1D2+ P0 ('7$f IRU DW OHDVW KRXU 6DPSOHV ZHUH LQFXEDWHG IRU PLQXWHV LQ JHO UXQQLQJ EXIIHU 0DQLDWLV HW DO f FRQWDLQLQJ 1 1D2+ SULRU WR HOHFWURSKRUHVLV DW YROWV IRU DW OHDVW KRXUV

PAGE 27

(VWLPDWLRQ RI WKH ,VRHOHFWULF 3RLQW (VWLPDWLRQ RI WKH SL RI HQGR 5 ZDV SHUIRUPHG E\ D PRGLILHG YHUVLRQ RI WKH PHWKRG E\
PAGE 28

2WKHU 0HWKRGV 3URWHLQ FRQFHQWUDWLRQV ZHUH GHWHUPLQHG E\ WKH SURFHGXUH RI %UDGIRUG f 7KH %LRJHO $0 [ FPf DQG WKH 6HSKDGH[ [ FPf FROXPQV ZHUH FDOLEUDWHG LQ P0 1D3 S+ 0 1D&O b JO\FHURO DQG P0 PHUFDSWRHWKDQRO 7KH H[FOXGHG YROXPH ZDV GHWHUPLQHG ZLWK WKH XVH RI %OXH 'H[WUDQ PROHFXODU ZHLJKW PLOOLRQ 6LJPDf DQG WKH FROXPQ ZDV FDOLEUDWHG ZLWK WKH XVH RI %DP\ODVH NGf DOFRKRO GHK\GURJHQDVH NGf %6$ NGf FDUERQLF DQK\GUDVH NGf DQG F\WRFKURPH & NGf DV PROHFXODU ZHLJKW VWDQGDUGV 6LJPD &KHP &Rf (VWLPDWH RI ,Q 9LYR ([FLVLRQ )UHTXHQF\ $ W\SLFDO WUDQVIHFWLRQ XVHV LJ RI SODVPLG '1$ SHU FP GLVK RU DSSUR[LPDWHO\ [O2A[OR+ PROHFXOHV SHU GLVK $VVXPLQJ A FRPSHWHQW FHOOV SHU GLVK HDFK FRPSHWHQW FHOO ZLOO KDYH [ [ PROHFXOHV RI SODVPLG '1$ 7KLV DJUHHV UHDVRQDEO\ ZHOO ZLWK WKH DPRXQW RI SODVPLG '1$ UHFRYHUHG IURP WUDQVIHFWHG FHOOV DV PHDVXUHG E\ ILOWHU K\EULGL]DWLRQ ,I WKH LQ YLWUR IUHTXHQF\ RI FOHDYDJH E\ HQGR 5 DW DQ RXWERDUG VLWH RI $$9 LV b FOHDYDJH DW ERWK RXWERDUG VLWHV WR SURGXFH DQ LQWDFW UHSOLFDWLYH IRUP ZRXOG EH b 7KLV ZRXOG SURGXFH WR PROHFXOHV RI H[FLVHG $$9 SHU WUDQVIHFWHG FHOO

PAGE 29

&+$37(5 ,,, 385,),&$7,21 2) (1'2 5 'HWHFWLRQ RI D 6LWH6SHFLILF (QGRQXFOHDVH $FWLYLW\ LQ &UXGH 1XFOHDU ([WUDFWV 7KH UHVXOWV IURP VWXGLHV RI $$9 UHSOLFDWLRQ LQ YLYR IURP ODWHQWO\ LQIHFWHG FHOOV DQG WUDQVIHFWHG $$9 SODVPLGV VXJJHVW WKDW UHVFXH IURP FKURPDWLQ DQG IURP UHFRPELQDQW SODVPLGV RFFXUV E\ D VLPLODU PHFKDQLVP 6DPXOVNL HW DO f DQG WKDW WKH VHTXHQFHV DW RU QHDU WKH $$9 WHUPLQL DUH HVVHQWLDO IRU WKLV H[FLVLRQ DFWLYLW\ 6DPXOVNL HW DO f 7DNLQJ WKHVH REVHUYDWLRQV LQWR DFFRXQW WKH ZLOG W\SH $$9 SODVPLG S60 ZDV XVHG DV D VXEVWUDWH WR DVVD\ IRU DQ DFWLYLW\ WKDW ZRXOG VSHFLILFDOO\ H[FLVH $$9 VHTXHQFHV IURP WKH SODVPLG 7KH SODVPLG S60 FRQWDLQV WKH HQWLUH $$9 JHQRPH FORQHG LQWR WKH 3VW, VLWH RI S%5 E\ *& WDLOLQJ 6DPXOVNL HW DO f 7R GHWHFW VLWHVSHFLILF FOHDYDJH DW WKH $$9YHFWRU MXQFWLRQ IRUP VXSHUFRLOHG '1$ ZDV WUHDWHG ZLWK FHOOIUHH H[WUDFW DQG GLJHVWHG ZLWK D RQHFXW UHVWULFWLRQ HQ]\PH WKDW FOHDYHV HLWKHU LQ WKH $$9 VHTXHQFHV %VW(,,f RU LQ YHFWRU '1$ 6SK,f 7KH SURGXFWV RI WKH DVVD\ ZHUH WKHQ IUDFWLRQDWHG E\ DJDURVH JHO HOHFWURSKRUHVLV )LJXUH LOOXVWUDWHV WKH IUDJPHQWV WKDW ZRXOG EH SURGXFHG LI FOHDYDJH RFFXUV DW HLWKHU WKH OHIW RU ULJKW $$9S%5 MXQFWLRQ )RU H[DPSOH FOHDYDJH ZLWK FHOOXODU H[WUDFW DW WKH ULJKW MXQFWLRQ ZRXOG JHQHUDWH D OLQHDU SODVPLG '1$ PROHFXOH ZKLFK DIWHU %VW(,, GLJHVWLRQ ZRXOG SURGXFH D NE IUDJPHQW ZKLFK FRQVLVWV H[FOXVLYHO\ RI $$9 '1$ DQG D UHFLSURFDO NE EDQG WKDW FRQWDLQV ERWK $$9 DQG S%5 VHTXHQFHV

PAGE 30

)LJXUH (QGR 5 $JDURVH *HO $VVD\ 7KH ILJXUH LOOXVWUDWHV WKH SURGXFWV WKDW ZRXOG UHVXOW IURP SDUWLDO GLJHVWLRQ E\ HQGR 5 DQG FRPSOHWH GLJHVWLRQ E\ %VW(,, OHIW SDWKZD\f RU 6RKO ULJKW SDWKZD\f ZKHQ WKH ZLOG W\SH SODVPLG S60 LV XVHG DV VXEVWUDWH 7KH WKLFN OLQH UHSUHVHQWV $$9 '1$ WKH WKLQ OLQH UHSUHVHQWV S%5 '1$ YHUWLFDO OLQHV UHSUHVHQW FOHDYDJH VLWHV RI %VW(,, %f 6SK, 6f DQG HQGR 5 5f 7KH ILOOHG VTXDUHV UHSUHVHQW WKH $$9 WHUPLQDO VHTXHQFHV $$9 FOHDYDJH RFFXUV DW WKH MXQFWLRQ EHWZHHQ WKH $$9 WHUPLQL DQG WKH YHFWRU '1$

PAGE 31

5%VW L % HR 6 0 6

PAGE 32

8VLQJ WKH DJDURVH JHO DVVD\ FUXGH H[WUDFWV SUHSDUHG IURP $G LQIHFWHG $G$$9 FRLQIHFWHG DQG XQLQIHFWHG +H/D FHOO QXFOHL ZHUH VFUHHQHG IRU WKH DELOLW\ WR FXW QHDU WKH $$9YHFWRU MXQFWLRQV DQG WKH SURGXFWV ZHUH YLVXDOL]HG E\ WUDQVIHU WR QLWURFHOOXORVH ILOWHUV DQG K\EULGL]DWLRQ WR $$9 VSHFLILF SUREH 6RXWKHUQ f 6SHFLILF GRXEOH VWUDQGHG FOHDYDJH DFWLYLW\ ZDV REVHUYHG LQ XQLQIHFWHG DQG $G$$9 FR LQIHFWHG FHOOV DW FRPSDUDEOH OHYHOV +RZHYHU D IROG VWLPXODWLRQ ZDV REVHUYHG LQ H[WUDFWV IURP $G LQIHFWHG FHOOV WUHDWHG ZLWK K\GUR[\XUHD :KROH FHOO H[WUDFWV DQG H[WUDFWV SUHSDUHG IURP D 0 1D&O ZDVK RI IUHH]HIUDFWXUHG QXFOHL &KDOOEHUJ DQG .HOO\ f FRQWDLQHG DSSUR[LPDWHO\ HTXDO DPRXQWV RI DFWLYLW\ ZKLOH QXFOHDU H[WUDFWV XVXDOO\ FRQWDLQHG IHZHU FRQWDPLQDWLQJ QXFOHDVHV )RU WKHVH UHDVRQV QXFOHDU H[WUDFWV IURP $GLQIHFWHG +H/D FHOOV WUHDWHG ZLWK K\GUR[\XUHD ZHUH XVHG DV WKH SULPDU\ VRXUFH RI DFWLYLW\ 3XULILFDWLRQ RI (QGR 5 ,Q WKH SURFHGXUH RXWOLQHG LQ 7DEOH FUXGH QXFOHDU H[WUDFWV IUDFWLRQ ,f ZHUH SUHSDUHG IURP $GLQIHFWHG +H/D 6 FHOOV JURZQ LQ WKH SUHVHQFH RI O2P0 K\GUR[\XUHD DQG KDUYHVWHG DW KRXUV SRVWLQIHFWLRQ &KDOOEHUJ DQG .HOO\ f 'XH WR WKH KLJK OHYHO RI FRQWDPLQDWLQJ HQGRQXFOHDVHV DQG FHOOXODU '1$ )LJXUH f VSHFLILF GRXEOHVWUDQGHG FOHDYDJH DFWLYLW\ FRXOG EH GHWHFWHG DW WKLV VWDJH RQO\ E\ 6RXWKHUQ K\EULGL]DWLRQ 6RXWKHUQ f )UDFWLRQ ZDV DSSOLHG WR D FROXPQ RI '($( FHOOXORVH DQG WKH DFWLYLW\ WKDW ZDV HOXWHG IURP WKH FROXPQ ZDV HVVHQWLDOO\ IUHH RI QXFOHLF DFLG DQG VHSDUDWHG IURP DW OHDVW RQH QRQVSHFLILF FHOOXODU QXFOHDVH ZKLFK GLG QRW ELQG WR WKH FROXPQ )UDFWLRQ ,, HQGR 5 DFWLYLW\ DQG WKH DFWLYLW\ LQ VXEVHTXHQW IUDFWLRQVf

PAGE 33

7$%/( 385,),&$7,21 2) (1'2 5 )UDFWLRQ 9ROXPH $FWLYLW\ 3URWHLQ 6SHFLILF $FWLYLW\ PO XQLWV PJ XQLWVPJ 1XFOHDU ([WUDFW ,, '($(FHOOXORVH ,,, 3KRVSKRFHOOXORVH ,9 6HSKDGH[ 9 3RO\G*f DJDURVH D3URWHLQ FRQFHQWUDWLRQV ZHUH GHWHUPLQHG E\ WKH PHWKRG RI %UDGIRUG f

PAGE 34

)LJXUH (Q]\PH 7LWUDWLRQ RI )UDFWLRQV ,, DQG ,,, 6WDQGDUG UHDFWLRQ PL[WXUHV RI , FRQWDLQHG SPRO RI S60 IRUP SODVPLG DQG WKH LQGLFDWHG DPRXQWV Of RI QXFOHDU H[WUDFW 1( )UDFWLRQ ,f '($(FHOOXORVH IUDFWLRQV '($( )UDFWLRQ ,,f RU SKRVSKRFHOOXORVH IUDFWLRQV 3FHOO )UDFWLRQ ,,,f 5HDFWLRQV ZHUH WHUPLQDWHG DW KRXU ZLWK WKH DGGLWLRQ RI SURWHLQDVH VWRS VROXWLRQ VHH &KDSWHU ,,f SKHQRO H[WUDFWHG HWKDQRO SUHFLSLWDWHG DQG GLJHVWHG ZLWK %VW(,, 7KH VDPSOHV ZHUH IUDFWLRQDWHG RQ D b DJDURVH JHO WUDQVIHUUHG WR D QLWURFHOOXORVH ILOWHU DQG K\EULGL]HG WR $$9VSHFLILF SUREH

PAGE 35

1( f§f§'($(f§ r 3HH rf

PAGE 36

FRXOG EH GHWHFWHG GLUHFWO\ E\ HWKLGLXP EURPLGH VWDLQLQJ RI WKH JHO DVVD\ )LJXUH f $FWLYH IUDFWLRQV IURP '($( FHOOXORVH FKURPDWRJUDSK\ XVXDOO\ FRQWDLQHG DQ RYHUODSSLQJ SHDN RI QRQVSHFLILF QXFOHRO\WLF DFWLYLW\ )XUWKHU IUDFWLRQDWLRQ RQ D FROXPQ RI SKRVSKRFHOOXORVH SURGXFHG DQ DFWLYLW\ IUDFWLRQ ,,,f WKDW H[KLELWHG VXEVWDQWLDOO\ PRUH VSHFLILF FOHDYDJH ZLWK OLWWOH HYLGHQFH RI FRQWDPLQDWLQJ QXFOHRO\WLF DFWLYLW\ DW ORZ HQ]\PH FRQFHQWUDWLRQV )LJXUH f 1HYHUWKHOHVV KLJK OHYHOV RI IUDFWLRQ ,,, HQ]\PH UHVXOWHG LQ QRQVSHFLILF GHJUDGDWLRQ RI WKH '1$ VXEVWUDWH GDWD QRW VKRZQf ,Q RUGHU WR VHSDUDWH WKH UHPDLQLQJ FRQWDPLQDWLQJ QXFOHRO\WLF DFWLYLWLHV IURP HQGR 5 IUDFWLRQ ,,, ZDV IXUWKHU SXULILHG E\ FKURPDWRJUDSK\ RQ 6HSKDGH[ IUDFWLRQ ,9f DQG SRO\G*f DJDURVH IUDFWLRQ 9f (QGR 5 DFWLYLW\ HPHUJHG IURP WKH 6HSKDGH[ FROXPQ MXVW EHKLQG WKH YRLG YROXPH 7KLV VWHS UHVXOWHG LQ D VXEVWDQWLDO ORVV RI WRWDO HQGR 5 DFWLYLW\ EXW KDV EHHQ UHWDLQHG DV SDUW RI WKH SXULILFDWLRQ SURWRFRO IRU TXDOLWDWLYH SXUSRVHV (QGR 5 HPHUJHV IURP WKH ILQDO FROXPQ SRO\G*f DJDURVH DV D VLQJOH V\PPHWULFDO SHDN ZKHQ HOXWHG ZLWK D OLQHDU LQFUHDVLQJ VDOW JUDGLHQW ZLWK OLWWOH DGGLWLRQDO ORVV RI DFWLYLW\ )UDFWLRQ ,9 HQGR 5 LV VWDEOH IRU DW OHDVW PRQWKV DW r& ZLWKRXW PHDVXUDEOH ORVV RI DFWLYLW\ 7KH VWDELOLW\ RI WKH HQ]\PH LV JUHDWO\ UHGXFHG ZKHQ WKH FRQFHQWUDWLRQ RI SURWHLQ IDOOV EHORZ LJPO )RU WKLV UHDVRQ IUDFWLRQ 9 HQ]\PH LV GLDO\]HG LQWR EXIIHU FRQWDLQLQJ b JO\FHURO DQG VXSSOHPHQWHG ZLWK LJPO HQ]\PH JUDGH %6$ IRU SHULRGV RI VWRUDJH RI XS WR PRQWKV DW r&

PAGE 37

7KH (QGR 5 $JDURVH *HO $VVD\ )RU WKH SXUSRVHV RI WKH JHO DVVD\ HQGR 5 FDQ EH WKRXJKW RI DV D UHVWULFWLRQ HQ]\PH ZLWK WZR VLWHV LQ S60 )LJXUH f 7KH SURGXFWV RI HQGR 5 GLJHVWLRQ FDQ EH VHHQ DV WKH SURGXFWV RI D SDUWLDO GLJHVWLRQ RI WKH VXEVWUDWH DW HLWKHU RI WKH $$9YHFWRU MXQFWLRQV )XUWKHU GLJHVWLRQ RI HQGR 5 SURGXFWV ZLWK WKH UHVWULFWLRQ HQ]\PH %VW(,, ZKLFK FXWV RQFH DV\PPHWULFDOO\ LQ WKH $$9 VHTXHQFHV SURGXFHV DQG NE IUDJPHQWV IURP HQGR 5 FOHDYDJH DW WKH ULJKW $$9S%5 MXQFWLRQ DQG DQG NE IUDJPHQWV IURP FOHDYDJH DW WKH OHIW MXQFWLRQ 7KH IRUPDWLRQ RI HQGR 5 SURGXFWV XVLQJ WKH SODVPLG S60 DV VXEVWUDWH LV LOOXVWUDWHG LQ ILJXUH ZLWK WKH WLWUDWLRQ RI SDUWLDOO\ SXULILHG HQ]\PH IUDFWLRQ ,,,f $V WKH UHDFWLRQ QHDUV FRPSOHWLRQ PRVW RI WKH $$9YHFWRU MXQFWLRQV DUH FOHDYHG DQG SURGXFH WKH IUDJPHQWV H[SHFWHG IURP FOHDYDJH E\ %VW(,, DQG HQGR 5 /LQHDU IUDJPHQWV IRUP ,,,f DUH WKH UHVXOW RI %VW(,, GLJHVWLRQ RI XQUHDFWHG VXEVWUDWH ,Q IXUWKHU GLVFXVVLRQ WKH SURGXFWLRQ RI WKH DQG NE IUDJPHQWV ZKLFK DUH HDVLO\ PRQLWRUHG LV XVHG WR TXDQWLWDWH WKH DPRXQW RI FOHDYDJH DW WKH ULJKW DQG OHIW MXQFWLRQV UHVSHFWLYHO\ 0ROHFXODU 6L]H DQG 3XULW\ RI (QGR 5 (VWLPDWHV RI WKH PROHFXODU ZHLJKW RI WKH QDWLYH SURWHLQ ZHUH PDGH E\ FKURPDWRJUDSK\ RI HQGR 5 RQ JHO ILOWUDWLRQ FROXPQV DQG E\ FHQWULIXJDWLRQ LQ JO\FHURO JUDGLHQWV 7KH SHDN RI HQGR 5 DFWLYLW\ HPHUJHV IURP D %LR*HO $0 FROXPQ VHH &KDSWHU ,, 0DWHULDOV DQG 0HWKRGVf EHKLQG WKH NGDO DOFRKRO GHK\GURJHQDVH PROHFXODU ZHLJKW PDUNHU ZLWK DQ DSSDUHQW PROHFXODU ZHLJKW RI NGDO GDWD QRW VKRZQf 7KLV LV LQ JRRG DJUHHPHQW ZLWK WKH REVHUYHG EHKDYLRU LQ D

PAGE 38

)LJXUH (Q]\PH 7LWUDWLRQ RI )UDFWLRQ ,,, 7KH QXPEHUV DW WKH WRS UHIHU WR WKH QXPEHU RI XQLWV RI HQGR 5 XVHG LQ D HDFK UHDFWLRQ VHH &KDSWHU ,, 0DWHULDOV DQG 0HWKRGVf 7KH VL]HV RI WKH PDMRU FOHDYDJH IUDJPHQWV DUH LQGLFDWHG RQ WKH ULJKW 6WDQGDUG HQGR 5 UHDFWLRQ PL[WXUHV f FRQWDLQHG QJ RI IRUP S60 SODVPLG '1$ P0 0J&O P0 7ULV+&O S+ f P0 '77 DQG WKH LQGLFDWHG DPRXQW RI IUDFWLRQ ,,, HQ]\PH $IWHU LQFXEDWLRQ IRU KRXU DW r& WKH UHDFWLRQ SURGXFWV ZHUH WUHDWHG ZLWK SKHQRO SUHFLSLWDWHG ZLWK HWKDQRO DQG GLJHVWHG ZLWK %VW(,, 7KH UHDFWLRQ PL[WXUH ZDV WKHQ IUDFWLRQDWHG RQ D b DJDURVH JHO WUDQVIHUUHG WR D QLWURFHOOXORVH ILOWHU DQG K\EULGL]HG WR QLFNWUDQVODWHG A3$$9 '1$

PAGE 40

JO\FHURO JUDGLHQW )LJXUH $f LQ ZKLFK WKH SHDN RI GRXEOHVWUDQGHG FOHDYDJH DFWLYLW\ VHGLPHQWHG VOLJKWO\ PRUH VORZO\ WKDQ WKH NGDO PDUNHU 7KH VHGLPHQWDWLRQ UHVXOWV FRUUHVSRQG WR DQ HPSLULFDOO\ GHWHUPLQHG VHGLPHQWDWLRQ FRHIILFLHQW 6 Zf RI )LJXUH %f DQG D PROHFXODU ZHLJKW RI NG DVVXPLQJ D VSKHULFDO VWUXFWXUH RI WKH HQ]\PH 3RROHG IUDFWLRQV IURP WKH SRO\G*f DJDURVH FROXPQ IUDFWLRQ 9 )LJXUH $ IUDFWLRQV f FRQWDLQ RQH PDMRU DQG PLQRU SURWHLQ EDQGV ZKHQ DQDO\]HG E\ 6'6 SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV DQG VLOYHU VWDLQLQJ +RZHYHU ZKHQ LQGLYLGXDO IUDFWLRQV DFURVV WKH SHDN RI HQGR 5 DFWLYLW\ ZHUH DQDO\]HG RQ 6'6 JHOV )LJXUH %f DQG FRPSDUHG ZLWK WKH DFWLYLW\ SURILOH LQ WKH DJDURVH JHO DVVD\ )LJXUH $f WKH SDWWHUQ RI WKH PDMRU PROHFXODU ZHLJKW EDQG ZDV PRVW FRQVLVWHQW ZLWK WKH SURILOH RI VSHFLILF FOHDYDJH DFWLYLW\ ,Q DGGLWLRQ WZR RWKHU SURWHLQV RI PLQRU LQWHQVLW\ ZLWK PROHFXODU ZHLJKWV RI DQG NG DSSHDUHG LQ D VXEVHW RI WKH DFWLYH IUDFWLRQV LQ D SDWWHUQ QRW LQFRQVLVWHQW ZLWK WKH DFWLYLW\ SURILOH )LJXUH &f $V D UHVXOW LW LV SRVVLEOH WKDW WKHVH SHSWLGHV DUH UHVSRQVLEOH IRU WKH FOHDYDJH DFWLYLW\ RU FRQWULEXWH HLWKHU DV PLQRU VXEXQLWV RU DFFHVVRU\ SHSWLGHV ,W LV DOVR SRVVLEOH WKDW WKH DQG NG SHSWLGHV DUH SURWHRO\WLF EUHDNGRZQ SURGXFWV RI WKH PDMRU NG SURWHLQ $WWHPSWV WR SXULI\ HQGR 5 IXUWKHU RU WR LVRODWH DQ DFWLYH IRUP IURP D QRQGHQDWXULQJ DFU\ODPLGH JHO KDYH EHHQ XQVXFFHVVIXO SUREDEO\ GXH WR WKH LQVWDELOLW\ RI WKH SURWHLQ DW ORZ FRQFHQWUDWLRQV RU WR WKH ORVV RI VXEXQLWV DQGRU DFFHVVRU\ SURWHLQV

PAGE 41

)LJXUH 6HGLPHQWDWLRQ $QDO\VLV RI (QGR 5 E\ *O\FHURO *UDGLHQW &HQWULIXJDWLRQ $ *O\FHURO JUDGLHQWV bf LQ 0 7ULV+&O S+ P0 '77 ZHUH SUHSDUHG LQ PO SRO\DOORPHU XOWUDFHQWULIXJH WXEHV 2QH PLOOLJUDP RI IUDFWLRQ ,,, HQGR 5 ZDV FRPELQHG ZLWK PJ RI DOFRKRO GHK\GURJHQDVH LQ PO 0 7ULV+&O S+ P0 '77 7KH PL[WXUH ZDV OD\HUHG RQ WRS RI D JO\FHURO JUDGLHQW DQG WKH WXEH ZDV FHQWULIXJHG IRU KRXUV DW USP DQG r& LQ D %HFNPDQ 6: URWRU 7KUHH RWKHU JUDGLHQWV FRQWDLQLQJ HQGR 5 IUDFWLRQ ,,, DORQH D PL[WXUH RI WKH PROHFXODU ZHLJKW VWDQGDUGV %DP\ODVH NGf DQG %6$ NGf RU DOFRKRO GHK\GURJHQDVH NGf ZHUH UXQ LQ SDUDOOHO )UDFWLRQV ZHUH FROOHFWHG IURP WKH ERWWRP RI WKH WXEH DQG WKH DEVRUEDQFH DW QP ZDV GHWHUPLQHG RSHQ FLUFOHVf )UDFWLRQV IURP JUDGLHQWV FRQWDLQLQJ HQGR 5 ZHUH DOVR DVVD\HG IRU GRXEOHVWUDQGHG FOHDYDJH DFWLYLW\ XVLQJ WKH VWDQGDUG H[FLVLRQ DVVD\ ILOOHG VTXDUHVf 6HGLPHQWDWLRQ LV IURP ULJKW WR OHIW % 7KH VHGLPHQWDWLRQ FRHIILFLHQW 6 \f RI HQGR 5 ZDV GHWHUPLQHG IURP D SORW RI WKH PRELOLW\ RI HDFK SURWHLQ UHSUHVHQWHG DV D IUDFWLRQ RI WKH WRWDO JUDGLHQW OHQJWK DJDLQVW WKH 6 \ OLWHUDWXUH YDOXHV &5& +DQGERRN RI %LRFKHP f RI WKH IROORZLQJ SURWHLQ VWDQGDUGV %DP\ODVH VZHHW SRWDWR f DOFRKRO GHK\GURJHQDVH \HDVW f ERYLQH VHUXP DOEXPLQ f

PAGE 42

$EVRUEDQFH QPf $FWLYLW\

PAGE 43

)LJXUH 0ROHFXODU :HLJKW DQG 3XULW\ RI (QGR 5 $f $JDURVH JHO DVVD\ RI SHDN IUDFWLRQV IURP SRO\G*f DJDURVH )UDFWLRQ 9f 5HDFWLRQ PL[WXUHV RI SL FRQWDLQLQJ SPROV RI %VW(,, GLJHVWHG S60 '1$ ZHUH LQFXEDWHG ZLWK SL RI WKH IUDFWLRQ LQGLFDWHG XQGHU VWDQGDUG UHDFWLRQ FRQGLWLRQV 7KH UHDFWLRQV ZHUH VWRSSHG DIWHU KRXU ZLWK WKH DGGLWLRQ RI YROXPH RI JHO UXQQLQJ G\H FRQWDLQLQJ 0 ('7$ DQG b 6'6 DQG WKHQ IUDFWLRQDWHG RQ D b DJDURVH JHO %f 6'6 SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV RI SHDN IUDFWLRQV IURP SRO\G*f DJDURVH $ FRQVWDQW YROXPH LOf RI WKH IUDFWLRQV LQGLFDWHG ZHUH DGGHG WR DQ HTXDO YROXPH RI ; VDPSOH EXIIHU KHDWHG WR r& IRU PLQXWHV DQG VHSDUDWHG RQ DQ 6'6 DFU\ODPLGH JHO DV GHVFULEHG LQ &KDSWHU ,, 0DWHULDOV DQG 0HWKRGV $ SDUDOOHO VORW FRQWDLQHG WKH IROORZLQJ SURWHLQ VWDQGDUGV %DP\ODVH NGf DOFRKRO GHK\GURJHQDVH NGf SKRVSKRU\ODVH E NGf ERYLQH VHUXP DOEXPLQ NGf HJJ DOEXPLQ NGf DQG FDUERQLF DQK\GUDVH NGf &f 0ROHFXODU ZHLJKWV RI WKH SHSWLGHV LQ )UDFWLRQ 9 HQGR 5 3RO\G*f DJDURVH IUDFWLRQV ZHUH SRROHG WR IRUP IUDFWLRQ 9 DQG WKH PROHFXODU ZHLJKWV RI WKH SURWHLQ VSHFLHV SUHVHQW ZHUH GHWHUPLQHG IURP WKHLU UHODWLYH PRELOLWLHV RQ DQ 6'6 JHO 2SHQ FLUFOHV UHSUHVHQW WKH PROHFXODU ZHLJKW VWDQGDUGV GHVFULEHG IRU % ILOOHG FLUFOHV DUH HQGR 5 IUDFWLRQ 9 SURWHLQV

PAGE 45

0 )LJXUH FRQWLQXHGf SDUW %

PAGE 46

0ROHFXODU :HLJKW [f )LJXUH FRQWLQXHGf SDUW &

PAGE 47

&+$37(5 ,9 5(6&8( 2) $$9 6(48(1&(6 /RFDOL]DWLRQ RI WKH 6LWH RI &OHDYDJH WR WKH $$99HFWRU -XQFWLRQ 7KH H[FLVLRQ RI $$9 VHTXHQFHV E\ D VLWH VSHFLILF HQGRQXFOHDVH PXVW EH UDWKHU SUHFLVH LQ RUGHU WR SURGXFH VXEVWUDWH IRUPV WKDW DUH FDSDEOH RI UHSOLFDWLRQ ZLWKRXW IXUWKHU PRGLILFDWLRQ :KLOH PLQRU GHOHWLRQV RI WKH WHUPLQDO VHTXHQFHV LQFXUUHG GXULQJ UHVFXH FDQ EH UHSDLUHG WKURXJK JHQH FRQYHUVLRQ 6DPXOVNL HW DO f D PDMRU GHYLDWLRQ LQ WKH VLWH RI FOHDYDJH ZRXOG SURGXFH UHSOLFDWLYH IRUPV WKDW HLWKHU ODFNHG WKH DELOLW\ WR VHOISULPH RU FRQWDLQHG H[WUDQHRXV YHFWRU '1$ WKDW ZRXOG KDYH WR EH IXUWKHU SURFHVVHG SULRU WR '1$ UHSOLFDWLRQ 7KHUHIRUH DQ HQ]\PH SRVWXODWHG WR EH UHVSRQVLEOH IRU $$9 UHVFXH LQ YLYR PXVW WDNH WKHVH FRQVWUDLQWV RQ WKH VLWH RI FOHDYDJH LQWR DFFRXQW 7R GHPRQVWUDWH WKDW WKH VLWH RI FOHDYDJH ZDV DW WKH $$9S%5 MXQFWLRQ WKH SURGXFWV RI WKH HQGR 5 UHDFWLRQ ZHUH K\EULGL]HG WR $$9 DQG S%5VSHFLILF SUREHV )LJXUH f 6SHFLILF FOHDYDJH RFFXUULQJ SUHFLVHO\ DW WKH $$9YHFWRU MXQFWLRQ ZRXOG SURGXFH D VXEVHW RI IUDJPHQWV WKDW FRQVLVWHG RI $$9 RU S%5 VHTXHQFHV H[FOXVLYHO\ DQG WKHVH FRXOG EH LGHQWLILHG E\ SURELQJ GXSOLFDWH 6RXWKHUQ EORWV 6RXWKHUQ f ZLWK $$9 RU S%5 '1$ )LJXUH ULJKW SDQHOf ,Q WKLV H[SHULPHQW UHDFWLRQ FRQGLWLRQV ZHUH FKRVHQ WR FOHDYH b RI WKH VXEVWUDWH IRUP S60f DW OHDVW RQFH :KHQ WKH SURGXFWV RI WKH UHDFWLRQ ZHUH H[DPLQHG E\ HWKLGLXP EURPLGH VWDLQLQJ ZLWKRXW IXUWKHU GLJHVWLRQ ZLWK D UHVWULFWLRQ HQ]\PH PRVW RI WKH SURGXFW IRUPHG ZDV OLQHDU SODVPLG '1$

PAGE 48

)LJXUH ,GHQWLILFDWLRQ RI $$96SHFLILF DQG S%56SHFLILF )UDJPHQWV LQ WKH (QGR 5 5HDFWLRQ 360 VXEVWUDWH ZDV LQFXEDWHG ZLWK IUDFWLRQ ,9 HQ]\PH LQ D VWDQGDUG HQGR 5 UHDFWLRQ 5f :KHUH LQGLFDWHG WKH UHDFWLRQ SURGXFWV ZHUH DOVR GLJHVWHG ZLWK %VW(,, RU 6SK, 7KH SURGXFWV ZHUH IUDFWLRQDWHG LQ GXSOLFDWH RQ b DJDURVH JHOV WUDQVIHUUHG WR QLWURFHOOXORVH ILOWHUV DQG K\EULGL]HG WR HLWKHU $$9VSHFLILF RU S%5VSHFLILF SUREH ULJKW SDQHOf 7KH HQGR 5 SOXV %VW(,, DQG HQGR 5 SOXV 6SK, IUDJPHQW VL]HV DUH LQGLFDWHG WR WKH OHIW DQG ULJKW RI WKH ULJKW SDQHO UHVSHFWLYHO\ 7KH OHIW SDQHO LOOXVWUDWHV WKH UHDFWLRQ SURGXFWV VWDLQHG ZLWK HWKLGLXP EURPLGH $OVR LQGLFDWHG LQ WKH OHIW SDQHO DUH WKH VL]HV DQG SRVLWLRQV RI WKH PDUNHU EDQGV 0f DQG S60 UHOD[HG FLUFXODU ,,f DQG OLQHDU ,,,f SODVPLG '1$ 7KH WZR XQLGHQWLILHG OLQHV WR WKH ULJKW RI HDFK SDQHO LQGLFDWH WKH SRVLWLRQ RI OLQHDU $$9 XSSHUf DQG OLQHDU S%5 ORZHUf '1$

PAGE 49

} 4 &' &f A R U %VW n $$9 S%5 1 1 f &/ &2 f D FU WU [ D &2 f D FF FH 3D f 6SK B -

PAGE 50

)LJXUH OHIW SDQHO ODQH 5f ,Q DGGLWLRQ DSSUR[LPDWHO\ b RI WKH SURGXFWV FRQVLVWHG RI WZR IUDJPHQWV DQG NE LQ OHQJWK ZKLFK ZHUH WKH VL]HV H[SHFWHG IRU H[FLVHG GXSOH[ $$9 DQG OLQHDU S%5 '1$ 7KHVH ZHUH SURGXFHG IURP GRXEOHVWUDQGHG FOHDYDJH DW ERWK RI WKH $$9S%5 MXQFWLRQV 7KH LGHQWLW\ RI WKHVH IUDJPHQWV ZDV FRQILUPHG E\ 6RXWKHUQ K\EULGL]DWLRQ ZLWK VHOHFWLYH SUREHV 7KH VORZHU PLJUDWLQJ NE IUDJPHQW K\EULGL]HG H[FOXVLYHO\ WR $$9VSHFLILF SUREH DQG WKH NE OLQHDU IUDJPHQW K\EULGL]HG RQO\ WR S%5VSHFLILF SUREH )LJXUH ULJKW SDQHO 5 ODQHVf 7KH IUDJPHQWV JHQHUDWHG E\ IXUWKHU GLJHVWLRQ RI WKH HQGR 5 SURGXFWV ZLWK HLWKHU %VW(,, RU 6SK, VHH )LJXUH f SURGXFHG D VHW RI IUDJPHQWV FRQVLVWHQW ZLWK HQGR 5 FOHDYDJH DW HLWKHU RQH RU WKH RWKHU RI WKH $$9S%5 MXQFWLRQV 7KH DQG NE IUDJPHQWV SURGXFHG IURP %VW(,, GLJHVWLRQ RI HQGR 5 SURGXFWV FRQWDLQHG RQO\ $$9 VHTXHQFHV DQG WKHUHIRUH K\EULGL]HG RQO\ WR $$9VSHFLILF SUREH &RQYHUVHO\ WKH GLJHVWLRQ RI HQGR 5 SURGXFWV ZLWK 6SK, JHQHUDWHG DQG NE IUDJPHQWV ZKLFK FRQVLVW HQWLUHO\ RI S%5 '1$ DQG ZHUH GHWHFWHG RQO\ ZLWK S%5VSHFLILF '1$ SUREH $V H[SHFWHG WKH KLJKHU PROHFXODU ZHLJKW IUDJPHQWV FRQWDLQ ERWK $$9 DQG S%5 VHTXHQFHV DQG WKHUHIRUH K\EULGL]H WR ERWK SUREHV 7KHVH UHVXOWV OLPLWHG E\ WKH VHQVLWLYLW\ RI K\EULGL]DWLRQ SODFHG WKH SRVLWLRQ RI WKH FOHDYDJH VLWH WR ZLWKLQ ES RI HLWKHU $$9YHFWRU MXQFWLRQ (LWKHU $$99HFWRU -XQFWLRQ &DQ %H &OHDYHG ,QGHSHQGHQWO\ RI WKH 2WKHU 2QH SURSRVHG PHFKDQLVP IRU JHQH FRQYHUVLRQ RI $$9 WHUPLQDO PXWDQWV WR WKH ZLOG W\SH IRUP UHTXLUHV WKH LQWHUDFWLRQ EHWZHHQ WKH WZR WHUPLQDO UHSHDWV /XVE\ HW DO 6DPXOVNL HW DO f ,W ZDV WKHUHIRUH SRVVLEOH WKDW FOHDYDJH E\ HQGR 5 UHTXLUHG WKLV W\SH RI LQWHUDFWLRQ 7R

PAGE 51

GHWHUPLQH LI WKLV ZDV WKH FDVH VXEFORQHV RI S60 S*0& DQG S*0' ZHUH FRQVWUXFWHG ZKLFK FRQWDLQHG HLWKHU WKH OHIW RU ULJKW WHUPLQDO UHSHDW RI $$9 UHVSHFWLYHO\ )LJXUH &f ,Q DGGLWLRQ WR WKH ES WHUPLQDO VHTXHQFH ERWK SODVPLGV FRQWDLQHG DSSUR[LPDWHO\ ES RI IODQNLQJ $$9 '1$ %RWK S*0& DQG S*0' ZHUH HIILFLHQWO\ FOHDYHG E\ HQGR 5 DQG SURGXFHG IUDJPHQWV RI WKH H[SHFWHG VL]H DQG VHTXHQFH FRPSRVLWLRQ ZKHQ WKH HQGR 5 SURGXFWV ZHUH GLJHVWHG ZLWK 6SK, )LJXUH $ DQG %f ,W ZDV WKHUHIRUH FRQFOXGHG WKDW HLWKHU $$9YHFWRU MXQFWLRQ FRXOG EH FOHDYHG LQGHSHQGHQWO\ RI WKH RWKHU DQG WKDW WKH UHFRJQLWLRQ VHTXHQFH ZDV FRQWDLQHG ZLWKLQ WKH WHUPLQDO ES RI $$9 )LJXUH DOVR GHPRQVWUDWHV WKDW YHFWRU '1$ S%5 LV D SRRU VXEVWUDWH IRU HQGR 5 &OHDYDJH RI $$9 7HUPLQDO 0XWDQWV $ QXPEHU RI PXWDQW $$9 FORQHV ZLWK GHOHWLRQV LQ WKH WHUPLQDO VHTXHQFHV ZHUH IRUWXLWRXVO\ SURGXFHG GXULQJ WKH FRXUVH RI FRQVWUXFWLQJ D YLDEOH $$9 UHFRPELQDQW FORQH 6DPXOVNL HW DO f 7R LGHQWLI\ WKH HQGR 5 UHFRJQLWLRQ VLJQDO PRUH SUHFLVHO\ WKH VHTXHQFHV DW WKH $$9YHFWRU MXQFWLRQV IRU VHYHUDO RI WKH PXWDQW $$9 SODVPLGV ZHUH GHWHUPLQHG DQG WKH UHODWLYH IUHTXHQFLHV RI FOHDYDJH ZHUH FRPSDUHG )LJXUH DQG 7DEOH ,,f 7KH FRQFOXVLRQ IURP WKHVH VWXGLHV ZDV WKDW WKHUH ZHUH WKUHH VHWV RI VHTXHQFHV QHDU WKH $$9YHFWRU MXQFWLRQV WKDW FRXOG VHUYH DV HQGR 5 UHFRJQLWLRQ VLWHV 7KH ILUVW ZDV D VWUHWFK RI SRO\G*f UHVLGXHV WKDW ZDV SUHVHQW DW PDQ\ RI WKH MXQFWLRQV DQG ZDV D UHVXOW RI SODVPLG FRQVWUXFWLRQ E\ *& WDLOLQJ $ VHFRQG VHTXHQFH ZKLFK ZDV FDOOHG WKH $$9 UHFRJQLWLRQ VLJQDO FRQVLVWV RI QXFOHRWLGHV WR RI WKH $$9 WHUPLQDO UHSHDW DQG FRQWDLQV WKH VHTXHQFH &&D&7&&&7&7&7

PAGE 52

7$%/( ,, 5(&2*1,7,21 6,7(6 )25 (1'2 5 ,1 $$9 3/$60,'6 -XQFWLRQ 5HODWLYH )UHTXHQF\n JfQ &&D&7&&&7&7&7 S60/f 9HFWRU Jf &&D&7&&&7&7&7J&J&J $$9 S605f 9HFWRU Jf &&D&7&&&7&7&7J&J&J $$9 S605f 9HFWRU Jf &&D&7&&&7&7&7J&J&J $$9 S605f 9HFWRU Jf &&D&7&&&7&_D&7DJJJ $$9 S605f 9HFWRU Jf _&7&&&7&7&7J&J&J&7& $$9 &&D&7&&&7&7&7 S60/f $$9 &&D&7&&&7&7&7J&_DJ& 9HFWRU S60/f $$9 &&D&7&&&7&7&7J&_DJ& 9HFWRU S60/f $$9 &&D&7&&&7&7&7J&_DJ& 9HFWRU JfQ S60/f 9HFWRU Jf _DJ7JJ&&DD&7&&D7&D& $$9 D7KH WDEOH OLVWV WKH VHTXHQFHV DW WKH $$9YHFWRU MXQFWLRQV DQG WKH IUHTXHQF\ RI FOHDYDJH RI WKH $$9 FORQHV XVHG WR GHWHUPLQH WKH UHFRJQLWLRQ VLWH IRU HQGR 5 7KH ILUVW WZR EDVHV RI WKH $$9 VHTXHQFH LQ S60 JJf DUH FRXQWHG DV SDUW RI WKH SRO\G*fSRO\G&f WDLO $ YHUWLFDO OLQH _f LQGLFDWHV WKH SRVLWLRQ RI WKH GHOHWLRQ LQ D PXWDQW FORQH S605f DQG ERWK S$9O SODVPLG MXQFWLRQV ZHUH QRW VHTXHQFHG 5f DQG /f GHSLFW WKH ULJKW DQG OHIW $$9YHFWRU MXQFWLRQV UHVSHFWLYHO\ S60 DQG S60 KDG EHHQ SUHYLRXVO\ VHTXHQFHG 6DPXOVNL HW DO f DQG WKH VHTXHQFH RI S60/f ZKLFK ZDV IRXQG WR EH LQFRUUHFW LV FKDQJHG KHUH 7KH UHPDLQLQJ SODVPLGV ZHUH VHTXHQFHG DV SDUW RI WKLV VWXG\ A,QGLFDWHV WKH DSSUR[LPDWH \LHOG RI WKH IUDJPHQW UHVXOWLQJ IURP FOHDYDJH DW WKH LQGLFDWHG VLWH )LJXUH f ZKHUH b FOHDYDJH KDV EHHQ GHILQHG DV WKH FOHDYDJH VHHQ DW S605f 1R DWWHPSW ZDV PDGH WR GLVWLQJXLVK EHWZHHQ WKH OHYHO RI FOHDYDJH REVHUYHG DW WKH MXQFWLRQV LQ HDFK FDWHJRU\

PAGE 53

)LJXUH &OHDYDJH RI 6XEVWUDWHV 7KDW &RQWDLQ 2QO\ 2QH &RS\ RI WKH $$9 7HUPLQDO 5HSHDW &f 5HVWULFWLRQ PDSV RI S*0& DQG S*0' S*0& FRQWDLQV WKH ES OHIW WHUPLQDO 3VW, IUDJPHQW RI WKH ZLOG W\SH $$9 SODVPLG S60 LQFOXGLQJ WKH OHIW $$9 WHUPLQDO UHSHDW DQG WKH ES SRO\G*f WDLO 3*0' LQFOXGHV WKH ULJKW WHUPLQDO UHSHDW RI $$9 DQG WKH ES *& WDLO LQ D ES 3VW, IUDJPHQW VXEFORQHG IURP S60 7KLFN OLQHV UHSUHVHQW $$9 '1$ WKLQ OLQHV DUH S%5 '1$ DQG WKH VROLG ER[HV DUH WKH $$9 WHUPLQDO UHSHDWV $OVR LQGLFDWHG DUH WKH SRVLWLRQV RI WKH HQGR 5 5f DQG 6SK, VLWHV $ DQG %f J RI S*0& S*0' RU S%5 VXSHUFRLOHG SODVPLG '1$ ZHUH LQFXEDWHG ZLWK IUDFWLRQ ,,, HQ]\PH DV GHVFULEHG LQ WKH OHJHQG IRU )LJXUH DQG GLJHVWHG ZLWK 6SK, 7KH UHDFWLRQ SURGXFWV ZHUH IUDFWLRQDWHG LQ D b DJDURVH JHO VWDLQHG ZLWK HWKLGLXP EURPLGH SDQHO $f WUDQVIHUUHG WR D QLWURFHOOXORVH ILOWHU DQG K\EULGL]HG WR QLFNWUDQVODWHG $$9 '1$ SUREH SDQHO %f 7KH SRVLWLRQ RI WKH PDUNHU EDQGV 0f DQG WKH 6SK, GLJHVWHG HQGR 5 SURGXFW EDQGV DUH LQGLFDWHG WR WKH OHIW DQG ULJKW RI SDQHO $ UHVSHFWLYHO\ 7KH ODQHV FRQWDLQ IRUPV ,, DQG ,,, S60 SODVPLG '1$

PAGE 54

S*0 & S*0 R f§ -2 f§ UR Mf A RL 2L ML • L L LOO LL LL f§ f§ &+ 2, 2, &' f§ • 0 & S%5 f W W 0 & ' S%5 1f

PAGE 55

%HFDXVH WKH $$9 WHUPLQDO UHSHDW LV D SDOLQGURPH WKLV VHTXHQFH RFFXUV WZLFH ZLWKLQ HDFK ZLOG W\SH WHUPLQDO UHSHDW DW QXFOHRWLGHV WR DQG WR /XVE\ HW DO f 7KH WZR FRSLHV KDYH EHHQ GHVLJQDWHG WKH RXWERDUG DQG LQERDUG UHFRJQLWLRQ VHTXHQFHV UHVSHFWLYHO\ 7KH SUHVHQFH RI WKH LQERDUG FRS\ RI WKLV VHTXHQFH DFFRXQWV IRU WKH PLQRU FOHDYDJH EDQG GHULYHG IURP WKH OHIW HQG RI $$9 DQG VHHQ DW WKH NE SRVLWLRQ LQ YLUWXDOO\ DOO RI WKH SODVPLGV VKRZQ LQ )LJXUH ,W LV HVVHQWLDOO\ WKH NE (QGR 5%VW(,, IUDJPHQW PLQXV WKH ILUVW ES RI $$9 '1$ ZKLFK LV WKH GLVWDQFH EHWZHHQ WKH RXWERDUG DQG LQERDUG FRSLHV RI WKH $$9 UHFRJQLWLRQ VHTXHQFH ,Q MXQFWLRQV S60/f 360/f DQG S60/f )LJXUH DQG 7DEOH ,,f WKH $$9 FOHDYDJH VLWH ZDV WKH RQO\ UHFRJQLWLRQ VHTXHQFH SUHVHQW EHFDXVH WKH GHOHWLRQ LQ WKHVH SODVPLGV KDV UHPRYHG WKH SRO\G*f WDLO DQG SODFHG WKH LQERDUG FRS\ RI WKH VHTXHQFH DGMDFHQW WR YHFWRU '1$ $FFRUGLQJO\ WKH NE EDQG ZDV WKH RQO\ IUDJPHQW VHHQ LQ WKHVH SODVPLGV DV WKH UHVXOW RI FOHDYDJH DW WKH OHIW HQG (QGR 5 FOHDYDJH RI WKH OHIW MXQFWLRQ RI WKH ZLOG W\SH FORQH S60/f SURGXFHG ERWK WKH DQG NE EDQGV EHFDXVH ERWK WKH LQERDUG DQG RXWERDUG FRSLHV RI WKH $$9 UHFRJQLWLRQ VHTXHQFH ZHUH SUHVHQW 3UHVXPDEO\ WKH LQERDUG VLWH DW WKH ULJKW HQG RI $$9 ZDV DOVR FOHDYHG EXW WKH VHSDUDWLRQ LQ WKLV UHJLRQ RI WKH JHO ZDV QRW VXIILFLHQW IRU UHVROXWLRQ RI WKH NE IUDJPHQW )LJXUH f 7KH UHODWLYH LQWHQVLWLHV RI WKH DQG NE EDQG SURGXFHG IURP S60/f FOHDYDJH UHIOHFW WKH SUHVHQFH RI WKH SRO\G*fAJ VHTXHQFHV DGMDFHQW WR WKH RXWERDUG VLWH ,Q JHQHUDO WKH KRPRSRO\PHULF SRO\G*f WDLO VHTXHQFH ZDV DSSUR[LPDWHO\ WR IROG PRUH OLNHO\ WR EH FXW WKDQ WKH KHWHURSRO\PHULF $$9 UHFRJQLWLRQ VHTXHQFH 7DEOH ,,f ,Q FRQWUDVW WR S60 DQRWKHU ZLOG W\SH $$9 FORQH S$9O FRQWDLQV QR *&

PAGE 56

)LJXUH &OHDYDJH RI $$9 3ODVPLGV 7KDW &RQWDLQ 'HOHWLRQV LQ WKH 7HUPLQDO 5HSHDWV 7KH YDULRXV $$9 PXWDQW VXEVWUDWHV ZHUH LQFXEDWHG ZLWK IUDFWLRQ ,,, HQ]\PH DQG GLJHVWHG ZLWK %VW(,, DV GHVFULEHG IRU )LJXUH 7KH UHDFWLRQ SURGXFWV ZHUH WUDQVIHUUHG WR QLWURFHOOXORVH DQG SUREHG ZLWK 3ODEHOHG $$9 '1$ 7KH PROHFXODU ZHLJKWV RI WKH HQGR 5%VW(,, SURGXFWV DUH LQGLFDWHG DW WKH OHIW RI WKH ILJXUH 7KH VHTXHQFH DW HDFK $$9S%5 MXQFWLRQ LV OLVWHG LQ 7DEOH ,, 7KH ILJXUH ZDV RYHUH[SRVHG WR YLVXDOL]H PLQRU FOHDYDJH EDQGV

PAGE 57

"r W 2O RM E L I r &f 1L G! f§ A f§ L L (; ;O L [ O ‘f U f m ‘ A LL f S $9, 0 0 ,,, P f 0 r 22O 0 0 2O L Z S} 2O

PAGE 58

WDLO DQG FOHDYDJH ZDV GLUHFWHG H[FOXVLYHO\ E\ WKH $$9 WHUPLQDO UHFRJQLWLRQ VLWH $V D UHVXOW FOHDYDJH DW WKH LQERDUG DQG RXWERDUG VLWHV RFFXUV ZLWK DSSUR[LPDWHO\ HTXDO HIILFLHQF\ WR SURGXFH WZR MXQFWLRQ EDQGV IURP HDFK HQG RI HTXDO LQWHQVLW\ )LJXUH S$9O WKH IUDJPHQW VL]HV DUH DQG NEf 7KH IDFW WKDW SRO\G*fQ DORQH ZDV VXIILFLHQW WR DFW DV D UHFRJQLWLRQ VHTXHQFH ZDV IXUWKHU GHPRQVWUDWHG E\ FOHDYDJH RI S60/f 7KLV SODVPLG FRQWDLQV D GHOHWLRQ ZKLFK KDV UHPRYHG ERWK WKH LQERDUG DQG RXWERDUG $$9 UHFRJQLWLRQ VLWHV EXW UHWDLQV D SRO\G*f VWUHWFK WKDW LV ES ORQJ 7KH SRO\G*f VWUHWFK ZDV VXIILFLHQW WR SURPRWH FOHDYDJH DQG SURGXFHG D EDQG RI DSSUR[LPDWHO\ NE 7KH VOLJKWO\ VORZHU PRELOLW\ RI WKH NE IUDJPHQW JHQHUDWHG IURP S60/f FOHDYDJH LV DWWULEXWHG WR WKH DGGLWLRQ RI WKH VL]DEOH SRO\G*f WDLO 0LQRU (QGR 5 &OHDYDJH 6LWHV &OHDYDJH E\ HQGR 5 DSSHDUHG WR UHTXLUH D VHTXHQFH WKDW ZDV DW OHDVW ES ORQJ DQG FRQVLVWHG RI D SRO\SXULQHSRO\S\ULPLGLQH WUDFW WKDW ZDV UHODWLYHO\ ULFK LQ *& EDVH SDLUV 7KHVH UHTXLUHPHQWV ZHUH FRQILUPHG E\ WKH LGHQWLILFDWLRQ RI VRPH RI WKH PLQRU FOHDYDJH IUDJPHQWV REVHUYHG LQ )LJXUH ZKLFK KDG EHHQ SUHGLFWHG RQ WKH EDVLV RI WKLV VHTXHQFH ,W ZDV QRWLFHG WKDW D QXPEHU RI PLQRU EDQGV DSSHDUHG FRQVLVWHQWO\ LQ GLJHVWV RI DOO RI WKH $$9 YDULDQW SODVPLGV %HFDXVH WKH VL]H RI WKH PLQRU IUDJPHQWV GLG QRW YDU\ ZLWK WKH VL]H RI WKH WHUPLQDO GHOHWLRQ WKHVH IUDJPHQWV PXVW KDYH EHHQ JHQHUDWHG IURP FOHDYDJH ZLWKLQ $$9 VHTXHQFHV ,I WKH IUDJPHQWV KDG EHHQ JHQHUDWHG IURP FOHDYDJH ZLWKLQ S%5 WKH\ ZRXOG KDYH VSDQQHG WKH S%5$$9 MXQFWLRQ DQG WKHLU VL]H ZRXOG KDYH YDULHG GHSHQGLQJ RQ WKH VL]H RI WKH WHUPLQDO GHOHWLRQf

PAGE 59

7$%/( ,,, 0,125 &/($9$*( 6,7(6 &RPSXWHU3UHGLFWHG )UDJPHQWV 2EVHUYHG 6HTXHQFH 1XFOHRWLGH NE b& NE &&&&7&7&&&&7& &&D&7&&&7&7&7 &&D&7&&&7&7&7 1& &&D&7&&&7&7&7 &&D&7&&&7&7&7 &7&&D&&&&7&& 1& &7D&DJ&D&&&&77 &&&7J&&&D&&7 &DJ&DJ&&&&&7&7 &&DJD&7&&7&&7& 1' &&&J&&7&&JJ&J&& 1' &&&&7&&7&&&D&& 76 D7KH WDEOH OLVWV WKH FOHDYDJH IUDJPHQWV SUHGLFWHG E\ D FRPSXWHU VHDUFK RI WKH SODVPLG S60 XVLQJ SRO\&G&fA DV WKH VHDUFK VHTXHQFH DQG DOORZLQJ IRU b KRPRORJ\ EHWZHHQ FRPSDUHG VHTXHQFHV 7KH VHTXHQFH DW ZKLFK FOHDYDJH ZRXOG SUHVXPDEO\ RFFXU DQG WKH QXPEHU RI & UHVLGXHV LQ HDFK VHTXHQFH b&f DUH WDEXODWHG ZLWK WKH VL]H RI WKH SUHGLFWHG IUDJPHQW ZKLFK ZDV GHULYHG E\ DVVXPLQJ WKDW HQGR 5 FOHDYDJH RFFXUUHG n WR WKH SRO\G*f VHTXHQFH 7KH SUHGLFWHG IUDJPHQW VL]HV DUH FRPSDUHG ZLWK WKH VL]HV RI WKH IUDJPHQWV REVHUYHG LQ WKH DJDURVH JHO DVVD\ $OO IUDJPHQW VL]HV DUH WKH UHVXOW RI %VW(,, GLJHVWLRQ RI HQGR 5 SURGXFWV 1& 1RW FOHDU 1' 1RW GHWHFWHG 76 7RR VPDOO WR EH UHVROYHG RQ D b DJDURVH JHO

PAGE 60

8VLQJ D FRPSXWHU DQG DOORZLQJ IRU VXEVWLWXWLRQV ZLWKLQ WKH SUHGLFWHG FRQVHQVXV VHTXHQFH SRO\G*fAJ RU WKH FRPSOHPHQWDU\ VHTXHQFH SRO\G&fAJ LQWHUQDO $$9 VHTXHQFHV ZHUH VHDUFKHG IRU SRWHQWLDO HQGR 5 UHFRJQLWLRQ VLWHV 7DEOH ,,, FRPSDUHV WKH FRPSXWHU SUHGLFWHG FOHDYDJH VLWHV DQG IUDJPHQWV ZLWK WKH REVHUYHG IUDJPHQWV 7KH UHVXOWV VKRZ D JRRG FRUUHVSRQGHQFH EHWZHHQ WKH FRPSXWHUSUHGLFWHG FOHDYDJH SDWWHUQ DQG WKH IUDJPHQWV VHHQ LQ HQGR 5 GLJHVWV ,Q IDFW DOO RI WKH REVHUYHG IUDJPHQWV WKDW ZHUH EHOLHYHG WR EH WKH UHVXOW RI FOHDYDJH LQ $$9 '1$ ZHUH SUHGLFWHG E\ WKH FRPSXWHU VHDUFK ,Q SDUWLFXODU WKH EHVW PDWFKHV IRXQG ZHUH ZLWK D VHTXHQFH DW QXFOHRWLGH ZKLFK SURGXFHG WKH NE PLQRU FOHDYDJH IUDJPHQW DQG ZLWK ERWK WKH LQERDUG DQG RXWERDUG $$9 WHUPLQDO UHFRJQLWLRQ VHTXHQFHV $$9 ([FLVLRQ ,Q 9LYR $ GHPRQVWUDWLRQ WKDW HQGR 5 ZDV FDSDEOH RI H[FLVLQJ $$9 VHTXHQFHV LQ YLYR LQ D PDQQHU VLPLODU WR WKDW REVHUYHG LQ YLWUR ZRXOG DGG FUHGLELOLW\ WR WKH K\SRWKHVLV WKDW WKLV ZDV WKH HQ]\PH LQYROYHG LQ $$9 '1$ UHSOLFDWLRQ :KHQ $$9 SODVPLGV ZHUH WUDQVIHFWHG LQWR WLVVXH FXOWXUH FHOOV WKH EXON RI WKH LQSXW '1$ ZDV IRXQG LQ WKH IRUP RI QLFNHG FLUFXODU IRUP ,,f RU OLQHDU IRUP ,,,f SODVPLG VSHFLHV 6DPXOVNL HW DO +HUPRQDW DQG 0X]\F]ND f 7KLV ZDV WUXH UHJDUGOHVV RI ZKHWKHU WKH LQSXW $$9 '1$ ZDV FDSDEOH RI '1$ UHSOLFDWLRQ 7R GHWHUPLQH LI WKH OLQHDU SODVPLG '1$ IRUP ,,,f SURGXFHG LQ YLYR ZDV WKH UHVXOW RI FOHDYDJH DW D VSHFLILF VHTXHQFH WUDQVIHFWHG '1$ ZDV LVRODWHG DIWHU KRXUV GLJHVWHG ZLWK %VW(,, DQG K\EULGL]HG ZLWK $$9 SUREH )LJXUH f 7KH DQG NE EDQGV ZHUH UHDGLO\ VHHQ LQ FHOOV LQIHFWHG ZLWK DGHQRYLUXV DQG WUDQVIHFWHG ZLWK WKH ZLOG W\SH SODVPLG

PAGE 61

)LJXUH &OHDYDJH RI $$9 3ODVPLGV ,Q 9LYR )LYH PLFURJUDPV RI 360 DQG S60 '1$ ZHUH WUDQVIHFWHG LQWR $G LQIHFWHG +H/D FHOOV &KDSWHU ,, 0DWHULDO DQG 0HWKRGVf $W KRXUV DIWHU WUDQVIHFWLRQ ORZ PROHFXODU ZHLJKW '1$ ZDV LVRODWHG E\ WKH PHWKRG RI +LUW f GLJHVWHG ZLWK %VW(,, IUDFWLRQDWHG E\ DJDURVH JHO HOHFWURSKRUHVLV DQG K\EULGL]HG WR $$9VSHFLILF SUREH DV GHVFULEHG IRU )LJXUH

PAGE 62

Q, &' QR $G $G UR FR XL R

PAGE 63

S60 ,Q WKLV FDVH WKH IUDJPHQWV ZHUH SUHVXPDEO\ GHULYHG IURP UHSOLFDWLQJ $$9 '1$ +RZHYHU EDQGV RI WKH VDPH VL]H ZHUH VHHQ DW UHGXFHG OHYHOV LQ FHOOV WUDQVIHFWHG ZLWK S60 LQ WKH DEVHQFH RI DGHQRYLUXV RU LQ WKH SUHVHQFH RI DGHQRYLUXV DQG K\GUR[\XUHD GDWD QRW VKRZQf ,Q DGGLWLRQ WZR PLQRU EDQGV ZHUH VHHQ LQ FHOOV WUDQVIHFWHG ZLWK S60 ZKLFK DSSDUHQWO\ ZHUH QRW DPSOLILHG E\ '1$ UHSOLFDWLRQ 7KHVH ZHUH LGHQWLFDO WR WKH PLQRU NE DQG NE EDQGV REVHUYHG LQ YLWUR &OHDYDJH IUDJPHQWV JHQHUDWHG IURP S60 WUDQVIHFWLRQ ZHUH H[SHFWHG WR EH DSSUR[LPDWHO\ ES VKRUWHU WKDQ WKRVH VHHQ ZLWK WKH ZLOG W\SH SODVPLG GXH WR WKH GHOHWLRQV LQ ERWK WHUPLQL FRPSDUH ZLWK )LJXUH f 7KHVH EDQGV ZHUH UHDGLO\ VHHQ LQ FHOOV WUDQVIHFWHG ZLWK S60 '1$ )LJXUH f DQG EHFDXVH S60 LV DQ RULa PXWDQW 6DPXOVNL HW DO f WKH DQG NE IUDJPHQWV PXVW KDYH EHHQ SURGXFHG IURP WKH LQSXW SODVPLG VHTXHQFHV $V H[SHFWHG S60 DOVR JHQHUDWHG D PLQRU NE EDQG ,W ZDV FRQFOXGHG WKHUHIRUH WKDW D VXEVWDQWLDO DPRXQW RI LQSXW SODVPLG '1$ ZDV FOHDYHG DW WKH $$9YHFWRU MXQFWLRQ LQ YLYR DQG WKDW $$9 '1$ UHSOLFDWLRQ LV QRW QHFHVVDU\ IRU FOHDYDJH WR RFFXU 0RUHRYHU WKH SDWWHUQ RI FOHDYDJH ZDV HVVHQWLDOO\ WKH VDPH LQ YLYR DQG LQ YLWUR 7KH UHPDLQLQJ LQSXW '1$ ZDV DSSDUHQWO\ FOHDYHG UDQGRPO\ DV MXGJHG E\ WKH EDFNJURXQG UDGLRDFWLYLW\ 5HSOLFDWLRQ RI (QGR 5 3URGXFWV :KHQ WKH SURGXFWV RI DQ LQ YLWUR HQGR 5 GLJHVWLRQ RI S60 ZHUH WUDQVIHFWHG LQWR $GLQIHFWHG +H/D FHOOV '1$ UHSOLFDWLRQ RI WKH $$9 VHTXHQFHV RFFXUUHG DW OHYHOV WKDW ZHUH LQGLVWLQJXLVKDEOH IURP WKH WUDQVIHFWLRQ RI WKH IRUP SODVPLG QRW VKRZQf 7KLV ZDV WUXH HYHQ DW

PAGE 64

WLPHV HDUO\ DIWHU WUDQVIHFWLRQ 'LIIHUHQFHV LQ WKH SURGXFWLRQ RI UHSOLFDWHG $$9 '1$ ZRXOG SUHVXPDEO\ RFFXU HDUO\ LQ WKH UHSOLFDWLRQ F\FOH EXW RQO\ LI WKH H[FLVLRQ RI $$9 VHTXHQFHV ZDV D UDWH OLPLWLQJ VWHS LQ '1$ UHSOLFDWLRQ 7KHUHIRUH HQGR 5 SURGXFWV ZHUH VXEVWUDWHV IRU '1$ UHSOLFDWLRQ LQ YLYR EXW FOHDYDJH RI $$9 SODVPLGV LQ YLWUR SULRU WR WUDQVIHFWLRQ GLG QRW SURYLGH D VHOHFWLYH DGYDQWDJH IRU '1$ UHSOLFDWLRQ (QGR 5 SURGXFWV RI S60 FOHDYDJH ZHUH DOVR VXEVWUDWHV IRU '1$ 3RO\PHUDVH LQ YLWUR 7KH SURGXFWV RI HQGR 5 GLJHVWLRQ ZHUH KHDW GHQDWXUHG DQG FRROHG UDSLGO\ WR IDYRU WKH IRUPDWLRQ RI WKH KDLUSLQ SULPHU RYHU UHQDWXUDWLRQ RI GXSOH[ PROHFXOHV ,Q WKHVH H[SHULPHQWV D VLJQLILFDQW DPRXQW RI UDGLRDFWLYLW\ ZDV LQFRUSRUDWHG ZKHQ WKHVH VXEVWUDWHV ZHUH LQFXEDWHG ZLWK '1$ 3RO QRW VKRZQf 7KXV WKH SURGXFWV RI HQGR 5 FOHDYDJH ZLOO VXSSRUW '1$ UHSOLFDWLRQ ERWK LQ YLWUR DQG LQ YLYR

PAGE 65

&+$37(5 9 (1=<0( 5(&2*1,7,21 ,VRODWLRQ RI WKH &OHDYDJH 6LWH ,Q SUHYLRXV H[SHULPHQWV D FRQVHQVXV FOHDYDJH VLWH ZDV GHILQHG RQ WKH EDVLV RI FRPPRQO\ RFFXUULQJ VHTXHQFHV IRXQG LQ $$9 UHFRPELQDQW SODVPLGV 7KHVH VHTXHQFHV FRQWDLQHG KRPRSXULQHKRPRS\ULPLGLQH VWUHWFKHV RI DW OHDVW QXFOHRWLGHV ZKLFK ZHUH ULFK LQ *& EDVH SDLUV +RZHYHU LW UHPDLQHG SRVVLEOH WKDW WKH HQGR 5 UHFRJQLWLRQ VLJQDO ZDV DW D VHSDUDWH ORFDWLRQ IURP WKH FOHDYDJH VLWH SRVVLEO\ DW DQ LQWHUQDO $$9 VHTXHQFH ,Q WKLV FDVH HQ]\PH UHFRJQLWLRQ ZRXOG RFFXU DW D GLVWDQW VLWH DQG UHVXOW LQ FOHDYDJH DW WKH QHDUHVW DYDLODEOH VWUHWFK RI KRPRSXULQHKRPRS\ULPLGLQH VHTXHQFHV 7R UXOH RXW WKLV SRVVLELOLW\ DQG WR IXUWKHU FKDUDFWHUL]H WKH UHFRJQLWLRQ VHTXHQFH VHYHUDO FORQHV FRQWDLQLQJ VXEVHWV RI WKH VHTXHQFHV SUHVHQW DW WKH $$9YHFWRU MXQFWLRQV ZHUH FRQVWUXFWHG DQG WKHLU DELOLW\ WR DFW DV VXEVWUDWHV IRU HQGR 5 VSHFLILF FOHDYDJH ZDV HYDOXDWHG 7KH OHYHO RI FOHDYDJH LQ VHYHUDO RI WKHVH FORQHV LV LOOXVWUDWHG LQ )LJXUHV DQG DQG WKH LQVHUW VHTXHQFH DQG IUHTXHQF\ RI FOHDYDJH DUH OLVWHG LQ 7DEOH ,9 7KH ILUVW SODVPLG S*0 LV D VXEFORQH RI S*0' DQG FRQWDLQV VHTXHQFHV IURP WKH ULJKW $$9S%5 MXQFWLRQ LQFOXGLQJ WKH ILUVW ES RI $$9 DQG WKH ES *& WDLO 7KLV SODVPLG ZDV FOHDYHG ZLWK DSSUR[LPDWHO\ WKH VDPH IUHTXHQF\ DV WKH SDUHQWDO MXQFWLRQ LQ S60' )LJXUH f 7ZR RWKHU SODVPLGV S*0 DQG S*0 FRQWDLQHG SRO\G*fSRO\G&f VWUHWFKHV RI DQG ES UHVSHFWLYHO\ LQVHUWHG DW WKH 3VW, VLWH RI S%5

PAGE 66

)LJXUH 2OLJRPHU &ORQH ([FLVLRQ $f 6WDQGDUG UHDFWLRQ PL[WXUHV RI O FRQWDLQLQJ SPRO RI WKH S*0 FORQHV LQGLFDWHG ZHUH GLJHVWHG ZLWK HQGR 5 DW r& IRU KRXU 7KH UHDFWLRQV ZHUH WHUPLQDWHG ZLWK WKH DGGLWLRQ RI SURWHLQDVH VWRS VROXWLRQ VHH &KDSWHU ,, 0DWHULDOV DQG 0HWKRGVf SKHQRO H[WUDFWHG HWKDQRO SUHFLSLWDWHG DQG GLJHVWHG ZLWK (FR5, %f (FR5, GLJHVWLRQ RI HQGR 5 FOHDYHG VXEVWUDWH SURGXFHV DQG NE EDQGV IURP S*0 FORQHV FRQWDLQLQJ ROLJRPHU LQVHUWV LQ WKH 3VW, VLWH RI S%5 ZKLOH DQG NE IUDJPHQWV DUH SURGXFHG IURP FORQHV ZKLFK FRQWDLQ LQVHUWV LQ WKH (DJ, VLWH VHH )LJXUH IRU WKH VHTXHQFH RI WKH LQVHUWVf ( (FR5, VLWH 5 HQGR 5 VLWH ILOOHG VTXDUH ROLJRQXFOHRWLGH LQVHUW 6HH &KDSWHU ,, IRU D GHVFULSWLRQ RI WKH FORQHVf

PAGE 67

! WR X $ XL RM Ef L L LOO V 3VW' S%5 XL XL

PAGE 68

)LJXUH 2OLJRPHU &ORQH *HO $VVD\ 6WDQGDUG UHDFWLRQV RI SL FRQWDLQLQJ SPRO RI WKH VXEVWUDWHV LQGLFDWHG ZHUH GLJHVWHG ZLWK HQGR 5 DW r& IRU KRXU 5HDFWLRQV ZHUH WHUPLQDWHG ZLWK SURWHLQDVH VWRS VROXWLRQ &KDSWHU ,,f SKHQRO H[WUDFWHG HWKDQRO SUHFLSLWDWHG DQG GLJHVWHG ZLWK (FR5, 7KH DVVD\V ZHUH IUDFWLRQDWHG RQ D b DJDURVH JHO WUDQVIHUUHG WR QLWURFHOOXORVH 6RXWKHUQ f DQG SUREHG ZLWK QLFN WUDQVODWHG S%5 '1$ [ r FSPJf /LJKW DQG GDUN H[SRVXUHV WRS DQG ERWWRP UHVSHFWLYHO\f RI WKH NE IUDJPHQWV SURGXFHG IURP HQGR 5 DQG (FR5, GLJHVWLRQ DUH VKRZQ WR LOOXVWUDWH WKH UHODWLYH IUHTXHQF\ RI FXWWLQJ LQ WKH GLIIHUHQW VXEVWUDWHV

PAGE 69

&' 2 ER L S%5

PAGE 70

7$%/( ,9 68%&/21(' &/($9$*( 6,7(6 &ORQH ,QVHUWHG 6HTXHQFHA )UHTXHQF\ S*0 Jf &&D&7&&&7&7&7J&J&J S*0 Jf S*0 JfJ S%5F J! S*0 Jf &&D&7&&&7&7&7J&J&J S*0G Jf &&D&7&&&7&7&7J&J&Jf S*$ JDf S*$OO JDfQ S*0 JFf S*0 ADf S*0 &7f D7KH FRQVWUXFWLRQ RI WKH FORQHV LV GHVFULEHG LQ GHWDLO LQ &KDSWHU ,, 0DWHULDOV DQG 0HWKRGV 7KH VHTXHQFHV DUH OLVWHG DV WKH\ DSSHDU LQ WKH FORQH RQ WKH FORFNZLVH VWUDQG LQ D n WR n GLUHFWLRQ 7KH IUHTXHQF\ RI FOHDYDJH LV GHILQHG DV WKH SHUFHQW RI VWDUWLQJ VXEVWUDWH FOHDYHG LQ D VWDQGDUG DVVD\ ZLWK XQLW RI HQGR 5 7KH DPRXQW RI FOHDYDJH IRU S*0 ZDV DUELWUDULO\ VHW WR b A7KH FRPSOHWH VHTXHQFH RI WKH LQVHUWV DUH OLVWHG LQ )LJXUH F1DWXUDO SRO\G*f VWUHWFKHV RI ES RFFXU LQ S%5 DW QXFOHRWLGHV DQG G7KH VHTXHQFHV IRU S*0 DUH UHSHDWHG LQ DQ LQYHUWHG RULHQWDWLRQ

PAGE 71

1R $$9 VHTXHQFHV ZHUH SUHVHQW LQ HLWKHU SODVPLG 6SHFLILF FOHDYDJH ZDV REVHUYHG ZLWK WKHVH VXEVWUDWHV DV ZHOO +RZHYHU WKH OHYHO RI FOHDYDJH ZDV VLJQLILFDQWO\ UHGXFHG ZLWK ERWK VXEVWUDWHV 3*0 ES RI *&f ZDV FOHDYHG DW b DQG S*0 ES RI *&f ZDV FOHDYHG DW b RI WKH OHYHO REVHUYHG ZLWK FORQHV WKDW FRQWDLQHG DOO RI WKH SDUHQWDO $$9YHFWRU MXQFWLRQ S*0' S*0 )LJXUHV DQG 7DEOH ,9f 7KHVH FORQHV DSSURDFK WKH OLPLW RI HQ]\PH UHFRJQLWLRQ VLQFH WKH QDWXUDOO\ RFFXUULQJ VWUHWFKHV RI SRO\G*fJ LQ S%5 )LJXUHV DQG 7DEOH ,9f DQG SRO\G*f\ LQ ODPEGD SKDJH '1$ QRW VKRZQf ZHUH QRW GHWHFWDEO\ FOHDYHG 7KHVH UHVXOWV LQ FRQMXQFWLRQ ZLWK WKRVH REWDLQHG ZLWK WKH S605f MXQFWLRQ 7DEOH ,,f VXJJHVWHG WKDW D PLQLPXP RI UHVLGXHV DUH VXIILFLHQW IRU FOHDYDJH ZKLOH WKH IUHTXHQF\ RI FOHDYDJH LQFUHDVHV LQ GLUHFW SURSRUWLRQ WR WKH OHQJWK RI WKH KRPRSRO\PHU FKDLQ 7KXV $$9 SODVPLGV WKDW FRQWDLQ *& WDLOV DW WKH $$9YHFWRU MXQFWLRQ DUH LGHDO VXEVWUDWHV IRU HQGR 5 7KH DSSDUHQW VWURQJ DIILQLW\ RI HQGR 5 IRU ORQJ VWUHWFKHV RI SRO\G*f DQG WKH REVHUYHG FOHDYDJH RI *ULFK VLWHV WKDW GLG QRW FRQWDLQ KRPRSRO\PHUV RI *& )LJXUH S$9O S60/f S60/f DQG S60/ff UDLVHG VRPH LPSRUWDQW TXHVWLRQV FRQFHUQLQJ DOWHUQDWLYH HQ]\PH UHFRJQLWLRQ VLWHV DQG SDUWLFXODUO\ ZKDW HIIHFW VXEVWLWXWLRQV LQ WKH SRO\G*f FKDLQ KDYH RQ FOHDYDJH DFWLYLW\ 7R GHWHUPLQH ZKDW W\SH RI VXEVWLWXWLRQV ZHUH WROHUDWHG E\ HQGR 5 D QXPEHU RI SODVPLG VXEVWUDWHV FRQWDLQLQJ D YDULHW\ RI UHSHDWLQJ SRO\PHULF VHTXHQFHV ZHUH WHVWHG 7KH ILUVW RI WKHVH ZDV WKH SODVPLG S(9 DQ LQIHFWLRXV SROLR FORQH ZKLFK FRQWDLQV ES RI SRO\G*f DW WKH n HQG DQG DQ ES VWUHWFK RI SRO\G$f DW WKH GLVWDO HQG :KHQ LQFXEDWHG ZLWK HQGR 5 S(9 SURGXFHG IUDJPHQWV ZKLFK ZHUH WKH UHVXOW RI FOHDYDJH H[FOXVLYHO\ DW WKH SRO\G*f

PAGE 72

VLWH 1R GHWHFWDEOH FOHDYDJH ZDV REVHUYHG DW WKH SRO\G$f VLWH )LJXUH f +RZHYHU FORQHV WKDW FRQWDLQHG DQ LQVHUW RI WKH DOWHUQDWLQJ FRn SRO\PHU *$!J DQG *$fT S*$ DQG S*$OO UHVSHFWLYHO\f ZHUH FOHDYHG E\ HQGR 5 DW D UHGXFHG IUHTXHQF\ 7DEOH ,9 DQG )LJXUH f 7KXV KRPRSRO\PHUV RI G$f ZHUH QRW UHFRJQL]HG DV VXEVWUDWHV IRU FOHDYDJH EXW VXEVWLWXWLRQV RI G$f LQ ORQJ VWUHWFKHV RI SRO\G*f ZHUH WROHUDWHG DQG UHVXOWHG LQ D GHFUHDVH LQ DFWLYLW\ 7KLV ZDV QRW WKH FDVH ZLWK DOWHUQDWLQJ SRO\PHUV RI *& WKDW FDQ SRWHQWLDOO\ IRUP DOWHUHG VHFRQGDU\ VWUXFWXUHV RI OHIWKDQGHG ='1$ 3HFN DQG :DQJ 6LQJOHWRQ HW DO f &ORQHV FRQWDLQLQJ LQVHUWV RI *&fAT DQG *&AT ZHUH QRW GHWHFWDEO\ GLJHVWHG E\ HQGR 5 S*0 7DEOH ,9f 0RUH FRPSOH[ VHTXHQFHV ZLWK OHVV V\PPHWULFDO VXEVWLWXWLRQV RI WKH SRO\G*f VHTXHQFH DUH DOVR VXEVWUDWHV IRU HQGR 5 7KLV LV H[HPSOLILHG E\ WZR FORQHV S*0 DQG S*0 WKDW FRQWDLQ JHQHULF IRUPV RI WKH 7HWUDK\PHQD &$f DQG 'LFW\RVWHOLXP AA WHORPHULF VHTXHQFHV UHVSHFWLYHO\ %ODFNEXUQ DQG 6]RVWDN 6KDPSD\ HW DO f 7KHVH VXEVWUDWHV ZHUH FOHDYHG DW D OHYHO DSSURDFKLQJ WKH IUHTXHQF\ REVHUYHG ZLWK WKH KRPRSRO\PHULF FORQH S*0 )LJXUH DQG 7DEOH ,9f ,QWHJUDWHG $$9 SURYLUXV H[LVWV LQ WZR EDVLF IRUPV LQ FKURPDWLQ DV ZHOO DV LQ SODVPLGV 7KH ILUVW RI WKHVH FRQVLVWV RI DW OHDVW WZR WDQGHP KHDG WR WDLO FRSLHV RI $$9 HDFK VHSDUDWHG E\ WZR FRSLHV RI WHUPLQDO VHTXHQFHV LQ DQ LQYHUWHG RULHQWDWLRQ 0F/DXJKOLQ HW DO f 3UHVXPDEO\ WKLV ZRXOG SODFH WZR FRSLHV RI WKH HQGR 5 UHFRJQLWLRQ VLWH LQ DQ LQYHUWHG RULHQWDWLRQ DGMDFHQW WR HDFK RWKHU 7KH SODVPLG HTXLYDOHQW RI WKLV FRQWDLQHG RQH FRS\ RI WKH $$9 WHUPLQDO UHSHDW DGMDFHQW WR D *& WDLO DQG ZDV FOHDYHG ZLWK KLJK IUHTXHQF\ HJ S*0 )LJXUH f 7KH VHFRQG W\SH RI LQWHJUDWHG IRUP RFFXUV OHVV IUHTXHQWO\

PAGE 73

)LJXUH (QGR 5 &OHDYDJH RI S*$ DQG S(9 $f 2QH PLFURJUDP RI HLWKHU S*$ RU S(9 ZDV LQFXEDWHG ZLWK XQLW RI IUDFWLRQ 9 HQGR 5 XQGHU VWDQGDUG UHDFWLRQ FRQGLWLRQV LQ D YROXPH RI SL $IWHU SKHQRO H[WUDFWLRQ DQG HWKDQRO SUHFLSLWDWLRQ RQH KDOI RI HDFK UHDFWLRQ ZDV IXUWKHU GLJHVWHG ZLWK HLWKHU 6HDO S*$f RU %JO S(9f DQG ERWK WKH HQGR 5 WUHDWHG 5f DQG WKH UHVWULFWLRQ HQ]\PH GLJHVWHGHQGR 5 WUHDWHG 56f VDPSOHV ZHUH IUDFWLRQDWHG RQ b DJDURVH JHOV %f 5HVWULFWLRQ PDSV RI S*$ DQG S(9 )LOOHG ER[HV UHSUHVHQW WKH SRO\*$f LQVHUW IRU S*$ *$f DQG WKH SRO\G*f DQG SRO\G$f LQVHUWV IRU S(9 DQG $ UHVSHFWLYHO\f 7KH PROHFXODU ZHLJKWV NEf LQGLFDWH WKH VL]H RI WKH SURGXFWV WKDW ZRXOG EH H[SHFWHG IURP D UHVWULFWLRQ HQ]\PH GLJHVW RI HQGR 5 SURGXFWV FOHDYHG DW *$ LQ S*$ DQG DW SOXV $ LQ S(9

PAGE 74

S*$ S ( 9 5 56 0 0 5 56 D )P 0 .+ f§ )P )P P B f§ f )Pf a )P rr 0 f f§

PAGE 75

LQ FKURPDWLQ DQG FRQWDLQV VLQJOH RU PXOWLSOH FRSLHV RI $$9 VHSDUDWHG E\ D VLQJOH FRS\ RI WKH $$9 WHUPLQDO UHSHDW 0F/DXJKOLQ HW DO f 3ODVPLGV WKDW FRQWDLQ WKLV W\SH RI DUUDQJHPHQW ZHUH FOHDYHG DW D ORZ IUHTXHQF\ LQ YLWUR HJ S$9O )LJXUH f 7R GHWHUPLQH LI WKH WHUPLQDO QXFOHRWLGHV RI $$9 FRQWDLQHG D UHFRJQLWLRQ VLJQDO IRU HQGR 5 DQG ZKDW HIIHFW WKH QXPEHU RI FRSLHV DQG RULHQWDWLRQ RI WKHVH VHTXHQFHV KDG RQ DFWLYLW\ WZR FORQHV FRQWDLQLQJ HLWKHU D VLQJOH FRS\ RU WZR LQYHUWHG FRSLHV RI WKH $$9 WHUPLQDO UHFRJQLWLRQ VHTXHQFH JJ&&D&7&&&7&7&7J&J&J&f ZHUH FRQVWUXFWHG 7KH SODVPLG S*0 FRQWDLQV D VLQJOH FRS\ RI WKLV VHTXHQFH DQG S*0 FRQWDLQV WZR LQYHUWHG FRSLHV RI WKH VDPH VHTXHQFH ERWK LQVHUWHG LQWR WKH 3VW, VLWH RI S%5 %RWK RI WKHVH FRQVWUXFWV ZHUH FOHDYHG E\ HQGR 5 )LJXUH f +RZHYHU WKH OHYHO RI FOHDYDJH REVHUYHG ZLWK S*0 ZDV DSSUR[LPDWHO\ b RI WKDW REVHUYHG ZLWK S*0 DQG FRXOG RQO\ EH YLVXDOL]HG E\ 6RXWKHUQ K\EULGL]DWLRQ ,Q FRQWUDVW WKH SODVPLG WKDW FRQWDLQHG WZR LQYHUWHG FRSLHV RI WKH UHFRJQLWLRQ VHTXHQFH ZDV FXW DW D OHYHO DW OHDVW WLPHV JUHDWHU WKDQ WKDW RI WKH VLQJOH FRS\ SODVPLG ZKLOH VWLOO RQO\ DERXW b RI WKDW VHHQ ZLWK WKH SDUHQWDO MXQFWLRQ SODVPLGV 7KXV WKH SUHVHQFH RI WDQGHP LQYHUWHG FRSLHV RI WKH $$9 UHFRJQLWLRQ VLJQDO LPSURYHV WKH \LHOG RI VSHFLILFDOO\ FOHDYHG SURGXFW LQ YLWUR 7KLV DUUDQJHPHQW PD\ EH UHSUHVHQWDWLYH RI WKH SUHIHUUHG VLWXDWLRQ LQ FKURPDWLQ 6HTXHQFH DW WKH 6LWH RI &OHDYDJH 3UHYLRXV H[SHULPHQWV KDYH DOUHDG\ VKRZQ WKDW HQGR 5 PDNHV GRXEOH VWUDQGHG VSHFLILF FXWV DQG WKDW FOHDYDJH RI WKH VXEVWUDWH RFFXUV DW WKH UHFRJQLWLRQ VLJQDO ,Q DGGLWLRQ LW ZDV SRVVLEOH WKDW FOHDYDJH DW WKH

PAGE 76

LQVHUWYHFWRU MXQFWLRQ ZRXOG SURGXFH ORQJ VLQJOHVWUDQGHG RYHUKDQJV DW WKH HQGV RI WKH IUDJPHQWV &RQFHLYDEO\ WKH HQGV RI WKHVH IUDJPHQWV FRXOG DQQHDO DQG HIIHFWLYHO\ UHGXFH WKH REVHUYHG DPRXQW RI VSHFLILFDOO\ FOHDYHG SURGXFW +RZHYHU QR LQFUHDVH LQ WKH DPRXQW RI VSHFLILFDOO\ FOHDYHG SURGXFW ZDV REVHUYHG DIWHU WKH UHDFWLRQ SURGXFWV ZHUH SKHQRO H[WUDFWHG DQG KHDWHG LQGLFDWLQJ WKDW WKH FOHDYHG IUDJPHQWV GLG QRW KDYH H[WHQVLYH n RU n SURWUXGLQJ HQGV FDSDEOH RI K\EULGL]DWLRQ QRW VKRZQf 6HYHUDO TXHVWLRQV UHPDLQHG KRZHYHU FRQFHUQLQJ WKH PHFKDQLVP DQG SDWWHUQ RI HQGR 5 FOHDYDJH )RU H[DPSOH LW ZDV QRW NQRZQ ZKHWKHU HQGR 5 FOHDYDJH RFFXUUHG DW RQH RU VHYHUDO VLWHV ZLWKLQ WKH UHFRJQLWLRQ VHTXHQFH RU ZKHWKHU WKHUH ZDV D GLIIHUHQFH LQ WKH FOHDYDJH SDWWHUQ EHWZHHQ VXEVWUDWHV WKDW FRQWDLQHG GLIIHUHQW W\SHV RI UHFRJQLWLRQ VLJQDOV $GGLWLRQDOO\ LW ZDV SRVVLEOH WKDW WKH VHSDUDWH VWUDQGV RI WKH UHFRJQLWLRQ VHTXHQFH ZHUH FOHDYHG LQ D GLVVLPLODU PDQQHU 7R DGGUHVV WKHVH TXHVWLRQV WKH VHTXHQFH DW WKH VLWH RI FOHDYDJH ZDV GHWHUPLQHG IRU VHYHUDO VXEVWUDWHV FRQWDLQLQJ YDULRXV OHQJWKV RI SRO\G*fSRO\G&f DOWHUQDWLQJ FRSRO\PHUV RI *$ WHORPHULF VHTXHQFHV DQG WKH $$9 UHFRJQLWLRQ VHTXHQFHV )LJXUH f ,Q WKHVH VWXGLHV WKH PRELOLW\ RI WKH SULPHU H[WHQVLRQ SURGXFWV RI HQGR 5 IUDJPHQWV ZHUH FRPSDUHG ZLWK WKH VHTXHQFH RI WKH LQVHUW DQG IODQNLQJ UHJLRQV RI WKH VXEVWUDWH FORQH RQ GHQDWXULQJ DFU\ODPLGH JHOV 7KH VHTXHQFH RI WKH VXEVWUDWH ZDV GHWHUPLQHG E\ WKH GLGHR[\ VHTXHQFLQJ PHWKRG 6DQJHU HW DO f XVLQJ WKH VDPH VLQJOHVWUDQGHG SULPHU XVHG IRU SULPHU H[WHQVLRQ )LJXUHV $' VHH &KDSWHU ,, 0DWHULDOV DQG 0HWKRGVf 7KHVH UHVXOWV ZHUH FRQILUPHG LQGHSHQGHQWO\ E\ FRPSDULVRQ RI WKH PRELOLW\ RI n DQG n ODEHOHG HQGR 5 SURGXFWV ZLWK WKH FKHPLFDOO\ VHTXHQFHG SODVPLG LQVHUW )LJXUH f

PAGE 77

7KH FRQFOXVLRQ IURP WKH DQDO\VLV RI WKH FOHDYDJH VLWHV RI FORQHV FRQWDLQLQJ KRPRSRO\PHUV RI SRO\G*f ZDV WKDW FOHDYDJH FRXOG RFFXU WKURXJKRXW WKH *& LQVHUW )LJXUH $ )LJXUH f $ VOLJKW SUHIHUHQFH IRU FOHDYDJH DW WKH n HQG RI ERWK VWUDQGV ZDV REVHUYHG LQ DOO WKH KRPRSRO\PHULF FORQHV 7KLV HIIHFW ZDV HVSHFLDOO\ SURQRXQFHG DW WKH n HQG RI WKH SRO\G*f VWUDQG LQ WKH SODVPLG S*0 ZKLFK FRQWDLQV WKH $$9 UHFRJQLWLRQ VLJQDO n WR WKH *& LQVHUW )LJXUH f &OHDYDJH RI WKH *VWUDQG ZDV SDUWLFXODUO\ VWURQJ DW WKH *&$$9 MXQFWLRQ DQG FRQWLQXHG LQWR WKH $$9 VHTXHQFHV ZKLOH FXWWLQJ LQ WKH &VWUDQG LQ WKLV FORQH DSSHDUV WR EH PRUH XQLIRUP ZLWK RQO\ D VOLJKW SUHIHUHQFH IRU WKH n HQG 7KH VLWH RI FOHDYDJH LQ FORQHV WKDW FRQWDLQHG RQO\ SRO\G*fSRO\G&f LQVHUWV DQG QR $$9 VHTXHQFHV S*0 S*0 )LJXUH f ZDV DOVR VOLJKWO\ VNHZHG WRZDUG WKH n HQG RI ERWK VWUDQGV ZKLOH FOHDYDJH ZDV FRQILQHG DOPRVW HQWLUHO\ WR WKH *& LQVHUW ,Q VXEVWUDWHV WKDW FRQWDLQHG WKH DOWHUQDWLQJ FRSRO\PHU *$fMA DQG *$fA )LJXUH %f FXWWLQJ RFFXUUHG WKURXJKRXW WKH SRO\PHU LQVHUW EHWZHHQ WKH DQG $ UHVLGXHV RQ WKH ORZHU VWUDQG DQG EHWZHHQ WKH & DQG 7 UHVLGXHV RQ WKH XSSHU VWUDQG ,Q WKHVH FORQHV FOHDYDJH ZDV HYHQO\ GLVWULEXWHG ZLWKLQ WKH &7 VWUDQG EXW PRUH SURQRXQFHG DW WKH n DQG n LQVHUWYHFWRU MXQFWLRQV LQ WKH *$ VWUDQG 7KH FOHDYDJH SDWWHUQ REVHUYHG ZLWK SODVPLGV FRQWDLQLQJ WHORPHULF VHTXHQFHV H[KLELWHG PRUH SHULRGLFLW\ ,Q WKH SODVPLG S*0O )LJXUH &f ZKLFK FRQWDLQV WKH VHTXHQFH &Af FOHDYDJH RI WKH &7VWUDQG RFFXUUHG WKURXJKRXW WKH LQVHUW ZLWK D SDUWLFXODUO\ VWURQJ FXW RFFXUULQJ DW UHJXODU LQWHUYDOV LPPHGLDWHO\ DIWHU WKH ILUVW & UHVLGXH RI HYHU\ UHSHDW $ SUHIHUHQFH IRU FOHDYDJH DW WKH n HQG RI WKH &7VWUDQG ZDV REVHUYHG FRUUHVSRQGLQJ WR WKH UHJLRQ FRQWDLQLQJ FRQWLQXRXV *& EDVH

PAGE 78

)LJXUH 6HTXHQFH DW WKH 6LWH RI (QGR 5 &OHDYDJH 'LGHR[\ 0HWKRG $f 1XFOHRWLGH VHTXHQFH GHWHUPLQHG E\ WKH GLGHR[\ PHWKRG 6DQJHU f DQG SULPHU H[WHQVLRQ SURGXFWV RI HQGR 5 GLJHVWLRQV IRU VXEVWUDWHV FRQWDLQLQJ $f SRO\G*f LQVHUWV S*0 OHIWf DQG S*0 ULJKWf %f DOWHUQDWLQJ FRSRO\PHUV RI *$ S*$OO OHIWf DQG S*$ ULJKWf &f WHORPHULF VHTXHQFHV S*0 OHIWf DQG S*0 ULJKWf DQG 'f D VLQJOH FRS\ S*0 OHIWf RU WZR WDQGHP LQYHUWHG FRSLHV S*0 ULJKWf RI WKH $$9 UHFRJQLWLRQ VLWH 7KH SODVPLG VHTXHQFH *&$7f ZDV GHWHUPLQHG IRU HDFK VWUDQG RI WKH VXEVWUDWH XVLQJ HLWKHU D FORFNZLVH FZf RU FRXQWHUFORFNZLVH FFZf ROLJRQXFOHRWLGH SULPHU DQG J RI SODVPLG 7KH HQGR 5 SULPHU H[WHQVLRQ SURGXFWV 5f ZHUH V\QWKHVL]HG IURP J RI HQGR 5 GLJHVWHG VXEVWUDWH ZLWK WKH SULPHU XVHG WR JHQHUDWH WKH FRUUHVSRQGLQJ VHTXHQFH PDUNHUV VHH &KDSWHU ,,f

PAGE 79

FZ FFZ *&$75 5*&$7 &: FFZ *&$75 *&$75

PAGE 80

S*$ FZ FFZ *&$75 5*&$7 )LJXUH FRQWLQXHGf SDUW %

PAGE 81

FZ FFZ *&$75 5*&$7 6 )LJXUH FRQWLQXHGf SDUW &

PAGE 82

FZ FFZ *&$75 &$75 )LJXUH FRQWLQXHGf SDUW '

PAGE 83

)LJXUH 6HTXHQFH DW WKH 6LWH RI (QGR 5 &OHDYDJH 0D[DP DQG *LOEHUW 0HWKRG )LQH PDSSLQJ RI WKH HQGR 5 FOHDYDJH SURGXFWV RI S*0' 3VW'f 7KH *$ DQG &7 VHTXHQFLQJ UHDFWLRQV ZHUH DV GHVFULEHG 0D[DP DQG *LOEHUW f J RI S*0' ODEHOHG DW WKH 6HDO VLWH DW HLWKHU WKH n RU n HQG ZDV GLJHVWHG ZLWK HQGR 5 5f DQG IUDFWLRQDWHG RQ D b DFU\ODPLGH XUHD JHO LQ SDUDOOHO ZLWK VHTXHQFH PDUNHUV ODEHOHG DW WKH VDPH VLWH 7KH SRO\G*fJSRO\G&fJ WDLO DQG WKH GLUHFWLRQ RI WKH $$9 DQG S%5 VHTXHQFHV DUH LQGLFDWHG LQ WKH ILJXUH $ GHWDLOHG GHVFULSWLRQ RI WKH VHTXHQFLQJ SURWRFRO DQG RI 3*0' LV LQFOXGHG LQ &KDSWHU ,,

PAGE 85

)LJXUH 6HTXHQFH DW WKH 6LWH RI (QGR 5 &OHDYDJH 6XPPDU\ RI WKH &OHDYDJH 6LWHV 7KH VHTXHQFH GDWD LQ )LJXUHV $'f DUH VXPPDUL]HG LQ WKLV ILJXUH 2QO\ WKH VHTXHQFH RI WKH ROLJRPHU LQVHUW DQG D IHZ EDVHV RI WKH IODQNLQJ YHFWRU UHJLRQV DUH VKRZQ 7KH VHTXHQFHV DUH OLVWHG DV WKH\ DSSHDU LQ WKH FORQHV ZKHUH WKH WRS VWUDQG UXQV LQ D n WR n GLUHFWLRQ /RQJ DUURZV UHSUHVHQW PDMRU FOHDYDJH VLWHV DQG VKRUW DUURZV UHSUHVHQW PLQRU VLWHV XVXDOO\ DERXW b RI WKH LQWHQVLW\ RI WKH PDMRU EDQGVf 7KH UHODWLYH LQWHQVLWLHV DSSO\ RQO\ ZLWKLQ WKH VDPH VWUDQG DQG QR DWWHPSW ZDV PDGH WR FRPSDUH WKH LQWHQVLW\ LQ RSSRVLWH VWUDQGV RU EHWZHHQ FORQHV VHH 7DEOH ,9 IRU WKH IUHTXHQF\ RI FOHDYDJH LQ WKHVH VXEVWUDWHVf

PAGE 86

S*0 S*0 *f S*0 *f S*0 &7f S*0 &$f S*$ *$fQ S*0 $$9WHUf S*0 $$9WHUf L080QP0PPXPPP0LO+KLL $77*&&*&*&$*$*$***&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&7*&$**&$7 7$$&**&*&*7&7&7&&&*******************************$&*7&&*7$ fW WWWWW 8 IIIrrrrr $77*&7*&$*&&&&&&&&&&&&&7*&$**&$7 7$$&*$&*7&*************$&*7&&*7$ 0LOrrr ,,, , , $77*&7*&$*&&&&&&&&&7*&$**&$7 7$$&*$&*7&*********$&*7&&*7$ QXLPL ,,, 7, , ,7 , ,,, , ,, $77*&7*&$&&7&&&7&&&&7&&&&&7&&&&&&7*&$**&$7 7$$&*$&*7**$***$****$*****$******$&*7&&*7$ O80_L WL__L ,, ,, ,, LOO LOO ? &**&&*&&&&$$&&&&$$&&&&$$&&&&**&&* *&&**&****77****77****77****&&**& ? ,W ,W ,OO ,, , , , , , ,,, **&&$*7*$$77&**&7&7&7&7&7&7&7&7&7&7&7&&&*$$77&&&* &&**7&$&77$$*&&*$*$*$*$*$*$*$*$*$*$*$***&77$$***& __ , 0 N L L L L L L L LW , OO ,,, ,, $77*&7*&$**&&$&7&&&7&7&7*&*&*&7*&$**&$7 7$$&*$&*7&&**7*$***$*$*$&*&*&*$&*7&&*7$ W ,, , , ,7OO , $77*&7*&$*$*&*&*&$*$*$***$*7**&&$7**&&$&7&&&7&7&7*&*&*&7&7*&$*&$$7 7$$&*$&*7&7&*&*&*7&7&7&&&7&$&&**7$&&**7*$***$*$*$&*&*&*$*$&*7&*77$ ,ƒfr

PAGE 87

SDLUV )LJXUH f &XULRXVO\ D VWURQJ SUHIHUHQFH IRU FXWWLQJ ZDV VHHQ DW WKH n HQG RI WKH *$ VWUDQG HYHQ WKRXJK WKH ORQJHVW VWUHWFKHV RI *& EDVH SDLUV DUH DW WKH n HQG RI WKLV VWUDQG ,Q FRQWUDVW WKH SDWWHUQ RI FXWWLQJ REVHUYHG ZLWK WKH SODVPLG S*0 ZKLFK FRQWDLQV WKH VHTXHQFH H[KLELWHG OLWWOH SUHIHUHQFH IRU HLWKHU HQG RI WKH LQVHUW )LJXUH &f 7KH FOHDYDJH SDWWHUQ IRU WKLV FORQH ZDV UHSHWLWLYH DQG V\PPHWULFDO WKURXJKRXW WKH ROLJRQXFOHRWLGH LQVHUW )LJXUH f &OHDYDJH DSSHDUHG WR RFFXU LQ GLUHFWO\ RSSRVLWH SRVLWLRQV RQ HDFK VWUDQG LPPHGLDWHO\ EHIRUH WKH $ UHVLGXHV RQ WKH &$ VWUDQG &OHDYDJH RI WKH SODVPLGV S*0O DQG S*0 ZKLFK FRQWDLQ VLQJOH DQG LQYHUWHG GRXEOH FRSLHV RI WKH $$9 WHUPLQDO VHTXHQFHV UHVSHFWLYHO\ ZDV FRQWDLQHG ZLWKLQ WKH &ULFK UHJLRQ RI WKH $$9 UHFRJQLWLRQ VHTXHQFH DQG VKRZHG D SUHIHUHQFH IRU WKH n HQG RI HDFK VWUDQG )LJXUH )LJXUH f 7KLV LV HVSHFLDOO\ QRWLFHDEOH LQ S*0 ZKHUH WKH FXW VLWHV DUH ORFDOL]HG H[FOXVLYHO\ ZLWKLQ WKH &ULFK UHJLRQ RI HDFK VWUDQG DQG ZRXOG DSSHDU WR SURGXFH VL]DEOH n RYHUKDQJV 7KH UHVXOWV IURP WKH VHTXHQFH VWXGLHV LQGLFDWHG WKDW FOHDYDJH RFFXUUHG WKURXJKRXW WKH UHFRJQLWLRQ VHTXHQFH DQG IUHTXHQWO\ H[WHQGHG LQWR WKH IODQNLQJ YHFWRU VHTXHQFHV $ SUHIHUHQFH IRU FOHDYDJH DW WKH n HQG RI ERWK VWUDQGV ZDV REVHUYHG LQ PRVW VXEVWUDWHV ZKLOH FXWWLQJ LQ WKH &VWUDQG KDG D WHQGHQF\ WR EH PRUH XQLIRUP ,Q DGGLWLRQ WKH QXFOHRWLGH RUGHU KDG QR DIIHFW RQ WKH VLWH RI FOHDYDJH ZKHUH FXWWLQJ RFFXUUHG EHWZHHQ HYHU\ EDVH FRPELQDWLRQ 7KHVH REVHUYDWLRQV LQ FRQMXQFWLRQ ZLWK WKH REVHUYHG IUHTXHQF\ RI FXWWLQJ ZLWK GLIIHUHQW VXEVWUDWHV VXJJHVW WKDW FOHDYDJH DW WKH QXFOHRWLGH OHYHO LV VWUXFWXUDO UDWKHU WKDQ VHTXHQFH GHSHQGHQW

PAGE 88

,V (QGR 5 D 6LWH 6SHFLILF 6LQJOH6WUDQGHG 1XFOHDVH $ QXPEHU RI VLQJOHVWUDQGHG HQGRQXFOHDVHV ZLOO FOHDYH SRO\SXULQH SRO\S\ULPLGLQH VWUHWFKHV WKDW DUH SUHVHQW LQ GXSOH[ '1$ 7KH DFWLYLW\ KDV EHHQ GHPRQVWUDWHG IRU 6, PXQJ EHDQ DQG 1HXURVSRUD HQGRQXFOHDVHV DV ZHOO DV IRU VQDNH YHQRP SKRVSKRGLHVWHUDVH (YDQV DQG (IVWUDGLDWLV &DQWRU DQG (IVWUDGLDWLV 6FKRQ HW DO 3XOOH\EODQN HW DO f 2QH LPSRUWDQW GLIIHUHQFH EHWZHHQ WKHVH DFWLYLWLHV DQG HQGR 5 LV WKDW WKH VLQJOHVWUDQGHG QXFOHDVHV UHTXLUH VXSHUFRLOLQJ LQ VXEVWUDWHV WKDW FRQWDLQ VKRUW SRO\SXULQH VWUHWFKHV ,Q FRQWUDVW HQGR 5 UHDGLO\ FOHDYHV OLQHDU VXEVWUDWHV ZKLFK FRQWDLQ ES RI SRO\G*f GDWD QRW VKRZQf +RZHYHU WKHUH LV HQRXJK VLPLODULW\ LQ VHTXHQFH UHFRJQLWLRQ WR VXVSHFW WKDW HQGR 5 PD\ KDYH SURSHUWLHV FRPPRQ WR VLQJOHVWUDQGHG HQGRQXFOHDVHV 7R GHWHUPLQH LI (QGR 5 ZDV D VLQJOHVWUDQGHG '1$ HQGRQXFOHDVH WKH SURGXFWV RI 6, DQG HQGR 5 GLJHVWLRQV RI S60 ZHUH FRPSDUHG 6, SURGXFHG D FOHDYDJH SDWWHUQ VLPLODU WR WKDW VHHQ ZLWK HQGR 5 +RZHYHU XQOLNH HQGR 5 6, GLG QRW VHHP WR GLVFULPLQDWH EHWZHHQ WKH LQERDUG DQG RXWERDUG HQGV RI WKH $$9 WHUPLQDO SDOLQGURPH ,W DSSDUHQWO\ FXW HTXDOO\ ZHOO DW ERWK HQGV RI WKH WHUPLQDO UHSHDW SURGXFLQJ D IXOO OHQJWK S%5 OLQHDU '1$ PROHFXOH NEf DQG WKH VKRUWHU DQG NE $$9 IUDJPHQWV )LJXUH f 7KH ES GHOHWLRQ UHVXOWLQJ IURP WKH ORVV RI WKH $$9 WHUPLQDO VHTXHQFHV LV HVSHFLDOO\ QRWLFHDEOH ZKHQ FRPSDULQJ WKH NE HQGR 5 SURGXFWV ZLWK WKH NE IUDJPHQWV SURGXFHG E\ 6, ,W LV QRW NQRZQ ZKHWKHU WKH ORVV RI WKH $$9 WHUPLQDO VHTXHQFHV ZDV GXH WR VHOHFWLYH GHJUDGDWLRQ RI WKH SDOLQGURPH RU WR VSHFLILF FOHDYDJH DW ERWK WKH LQERDUG DQG RXWERDUG UHFRJQLWLRQ VLWHV 6LPLODU H[SHULPHQWV ZLWK PXQJ EHDQ HQGRQXFOHDVH GLG QRW SURGXFH GLVFUHWH EDQGV QRW VKRZQf

PAGE 89

)LJXUH 6, DQG (QGR 5 1XFOHDVH 'LJHVWLRQV RI S60 2QH PLFURJUDP SPROf RI S60 '1$ ZDV WLWUDWHG ZLWK 6, QXFOHDVH RU IUDFWLRQ ,9 HQGR 5 LQ D SL UHDFWLRQ YROXPH XQGHU VWDQGDUG FRQGLWLRQV IRU HDFK HQ]\PH VHH &KDSWHU ,, 0DWHULDOV DQG 0HWKRGVf 1XPEHUV DW WKH WRS LQGLFDWH WKH QXPEHU RI XQLWV RI HDFK HQ]\PH XVHG

PAGE 90

6, (QGR5

PAGE 91

6, QXFOHDVH W\SLFDOO\ UHOHDVHV DFLG VROXEOH ROLJR DQG PRQRn QXFOHRWLGHV DV SURGXFWV RI WKH UHDFWLRQ 9RJW f $IWHU QRUPDOL]LQJ HQGR 5 DQG 6, DFWLYLWLHV RQ GXSOH[ VXEVWUDWHV WKH DFWLYLWLHV RQ VLQJOH VWUDQGHG +ODEHOHG (FROL '1$ ZHUH FRPSDUHG E\ PHDVXULQJ WKH UHOHDVH RI DFLG VROXEOH UDGLRDFWLYLW\ )LJXUH f :KHQ HTXLYDOHQW DPRXQWV RI 6, R DQG HQGR 5 DV PHDVXUHG RQ GXSOH[ '1$f ZHUH LQFXEDWHG ZLWK +ODEHOHG VLQJOHVWUDQGHG (&ROL '1$ 6, FRQYHUWHG b RI WKH '1$ WR DFLG VROXEOH SURGXFW ZLWKLQ PLQXWHV ZKLOH HQGR 5 SURGXFHG QR DFLG VROXEOH SURGXFWV DIWHU KRXUV 7KH UHVXOWV ZHUH VLPLODU UHJDUGOHVV RI ZKHWKHU WKH UHDFWLRQV ZHUH FDUULHG RXW DW S+ IRU ERWK HQ]\PHV RU ZKHWKHU HDFK HQ]\PH ZDV DVVD\HG DW LWV RZQ S+ RSWLPXP S+ IRU 6, DQG S+ IRU HQGR 5f 2Q WKH EDVLV RI WKLV DVVD\ LW ZDV HVWLPDWHG WKDW HQGR 5 ZDV DSSUR[LPDWHO\ IROG OHVV DFWLYH RQ VLQJOHVWUDQGHG '1$ WKDQ 6, 7KH DELOLW\ RI HQGR 5 DQG 6L WR GHJUDGH VLQJOHVWUDQGHG FLUFXODU '1$ ZDV DOVR FRPSDUHG 8QGHU VWDQGDUG UHDFWLRQ FRQGLWLRQV VLQJOH VWUDQGHG FLUFXODU !; DQG 0 '1$ DUH GHJUDGHG WR ROLJRQXFOHRWLGHV RI EDVH SDLUV LQ OHQJWK )LJXUH f :KHQ DVVD\HG E\ JHO PRELOLW\ HQGR 5 FXW VLQJOHVWUDQGHG FLUFXODU '1$ DW D UDWH IROG ORZHU WKDQ 6, QRW VKRZQf 7KLV ZDV DOVR WUXH LQ UHDFWLRQV ZKLFK FRQWDLQHG VWDQGDUG DPRXQWV RI SODVPLG VXEVWUDWH LQ DGGLWLRQ WR !; '1$ QRW VKRZQf ,Q WKHVH H[SHULPHQWV b RI WKH SODVPLG VXEVWUDWH ZDV FOHDYHG VSHFLILFDOO\ ZKLOH DFWLYLW\ RQ VLQJOHVWUDQGHG FLUFOHV ZDV VLPLODU WR WKDW REVHUYHG ZLWKRXW SODVPLG VXEVWUDWH ,W ZDV FRQFOXGHG IURP WKHVH H[SHULPHQWV WKDW HQGR 5 ZDV FOHDUO\ QRW D W\SLFDO VLQJOH VWUDQGHG QXFOHDVH +RZHYHU LW ZDV QRW FOHDU ZKHWKHU HQGR 5 DFWLYLW\ RQ

PAGE 92

VLQJOHVWUDQGHG FLUFOHV ZDV DQ LQWULQVLF SURSHUW\ RI HQGR 5 RU WKH UHVXOW RI D UHVLGXDO FRQWDPLQDWLQJ HQGRQXFOHDVH

PAGE 93

)LJXUH 6, DQG (QGR 5 $FWLYLW\ RQ 6LQJOH6WUDQGHG '1$ )LYH PLFURJUDPV RI VLQJOHVWUDQGHG XQLIRUPO\ +ODEHOHG ( FROL '1$ ZDV LQFXEDWHG ZLWK 6, QXFOHDVH XQLWVf RU HQGR 5 XQLWVf LQ D , UHDFWLRQ DW r& XQGHU VWDQGDUG UHDFWLRQ FRQGLWLRQV IRU HDFK HQ]\PH VHH 0DWHULDOV DQG 0HWKRGVf (TXLYDOHQW DPRXQWV RI GRXEOHVWUDQGHG FOHDYDJH DFWLYLW\ IRU ERWK HQ]\PHV ZHUH XVHG IRU HDFK UHDFWLRQ 6HH )LJXUH f $W WKH LQGLFDWHG WLPHV LO SRUWLRQV RI HDFK UHDFWLRQ PL[WXUH ZHUH DFLG SUHFLSLWDWHG DQG FRXQWHG 7KH SHUFHQW bf DFLG SUHFLSLWDEOH FRXQWV UHPDLQLQJ DW HDFK WLPH SRLQW LV SORWWHG &ORVHG FLUFOHV HQGR 5 RSHQ FLUFOHV 6,

PAGE 95

)LJXUH (QGR 5 $FWLYLW\ RQ 6LQJOH6WUDQGHG &LUFXODU '1$ $ VWDQGDUG UHDFWLRQ PL[WXUH RI LO FRQWDLQHG MJ RI I!; VLQJOH VWUDQGHG FLUFXODU '1$ DQG XQLWV RI HQGR 5 $W WKH LQGLFDWHG WLPHV LO SRUWLRQV ZHUH UHPRYHG WKH UHDFWLRQ ZDV WHUPLQDWHG ZLWK WKH DGGLWLRQ RI b 6'6 DQG P0 ('7$ DQG WKH UHDFWLRQ SURGXFWV ZHUH IUDFWLRQDWHG RQ D b DJDURVH JHO

PAGE 96

&LUFOHV /LQHDUV a

PAGE 97

&+$37(5 9, 3523(57,(6 2) (1'2 5 5HDFWLRQ &RQGLWLRQV IRU 'RXEOH6WUDQGHG &OHDYDJH 3XULILHG HQGR 5 UHTXLUHV 0J FDWLRQV DW UD0 IRU RSWLPDO 2 L FOHDYDJH DFWLYLW\ 7DEOH 9f &DOFLXP LRQV &D f DW P0 FDQ RA VXEVWLWXWH IRU 0J EXW RQO\ DERXW KDOI RI WKH DFWLYLW\ LV DFKLHYHG In XQGHU WKHVH FRQGLWLRQV 1R DFWLYLW\ LV REVHUYHG ZLWK =Q DORQH DW DQ\ FRQFHQWUDWLRQ DQG ERWK &D DQG =Q DUH LQKLELWRU\ DW KLJKHU FRQFHQWUDWLRQV LQ WKH SUHVHQFH RI 0J :KHQ 0Q LV VXEVWLWXWHG IRU 0J D GLIIHUHQW VSHFLILFLW\ RI FOHDYDJH LV REVHUYHG DW FRQFHQWUDWLRQV EHORZ P0 ZKLOH JUHDWHU FRQFHQWUDWLRQV UHVXOW LQ QRQVSHFLILF GHJUDGDWLRQ RI WKH VXEVWUDWH (QGR 5 LV H[WUHPHO\ VDOW VHQVLWLYH )LJXUH f $ b LQKLELWLRQ ZDV REVHUYHG ZLWK 1D&O RU .& DW FRQFHQWUDWLRQV RI P0 %HFDXVH RI WKLV VHQVLWLYLW\ IUDFWLRQV HPHUJLQJ IURP FROXPQV HOXWHG ZLWK VDOW JUDGLHQWV ZHUH GLDO\]HG EHIRUH EHLQJ DVVD\HG (QGR 5 LV DFWLYH RYHU D ZLGH S+ UDQJH IURP S+ WR S+ LQ 7ULV +& VRGLXP DFHWDWH RU VRGLXP SKRVSKDWH EXIIHUV QRW VKRZQf 7KH SL RI HQGR 5 ZDV HVWLPDWHG WR EH EHWZHHQ S+ DQG 7KLV ZDV GHWHUPLQHG E\ REVHUYLQJ WKH ELQGLQJ FKDUDFWHULVWLFV RI WKH HQ]\PH WR '($( FHOOXORVH DW GLIIHUHQW S+V VHH &KDSWHU ,, 0DWHULDOV DQG 0HWKRGVf 1R LQFUHDVH LQ WKH UDWH RI WKH UHDFWLRQ ZDV REVHUYHG ZLWK WHPSHUDWXUHV DERYH r& ZKLOH WHPSHUDWXUHV EHORZ r& UHVXOWHG LQ D GHFUHDVHG UDWH RI FOHDYDJH

PAGE 98

7$%/( 9 ',9$/(17 0(7$/ &$7,21 5(48,5(0(176 )25 (1'2 5D 0J&O 0Q&OD &D&O =&, b 'RXEOH 6WUDQGHG P0f nP0f P0f P0f &OHDYDHH B B B B B B B B B B B B D%VW(,, OLQHDUL]HG S60 SPROf ZDV LQFXEDWHG ZLWK XQLW RI IUDFWLRQ 9 HQGR 5 XQGHU VWDQGDUG UHDFWLRQ FRQGLWLRQV ZLWK WKH DPRXQW RI GLYDOHQW PHWDO FDWLRQ LQGLFDWHG LQ WKH WDEOH 7KH UHDFWLRQ SURGXFWV ZHUH IUDFWLRQDWHG RQ b DJDURVH JHOV VWDLQHG ZLWK HWKLGLXP EURPLGH DQG SKRWRJUDSKHG 7KH DPRXQW RI GRXEOHVWUDQGHG FOHDYDJH ZDV GHWHUPLQHG IURP GHQVLWRPHWHU WUDFLQJV RI WKH DQG NES HQGR 5%VW(,, SURGXFWV DV GHVFULEHG LQ WKH OHJHQG WR ILJXUH A&RQFHQWUDWLRQV RI 0Q&O P0 UHVXOW LQ QRQVSHFLILF GHJUDGDWLRQ RI VXEVWUDWH '1$ ZKLOH FRQFHQWUDWLRQV EHWZHHQ DQG P0 SURGXFH D GLIIHUHQW FOHDYDJH VSHFLILFLW\ VHH )LJXUH f

PAGE 99

)LJXUH 6RGLXP DQG 3RWDVVLXP ,QKLELWLRQ RI (QGR 5 6WDQGDUG UHDFWLRQV FRQWDLQLQJ SPRO RI %VW(,, OLQHDUL]HG 360 ZHUH LQFXEDWHG ZLWK XQLW RI IUDFWLRQ 9 HQGR 5 ZLWK LQFUHDVLQJ FRQFHQWUDWLRQV RI 1D&O RU .&O IRU KRXU DW r& 7KH SURGXFWV RI WKH UHDFWLRQ ZHUH IUDFWLRQDWHG RQ D b DJDURVH JHO VWDLQHG ZLWK HWKLGLXP EURPLGH DQG SKRWRJUDSKHG ZLWK 3RODURLG 7\SH ILOP ZKLFK SURGXFHV D QHJDWLYH DQG D SRVLWLYH SULQW 7KH LQWHQVLW\ RI WKH NES SURGXFW ZDV PHDVXUHG IURP WKH QHJDWLYH XVLQJ WKH /.% XOWUDVFDQ ;/ GHQVLWRPHWHU DQG WKH /.% JHO VFDQ SURJUDP YHUVLRQ 7KH SHUFHQW DFWLYLW\ LV SORWWHG DJDLQVW WKH FRQFHQWUDWLRQ RI 1D DQG FKORULGH LQ WKH UHDFWLRQ 7KH DPRXQW RI FOHDYDJH DW P0 1D&O WKH VDOW FRQWULEXWLRQ IURP WKH H[WUDFWVf LV DVVLJQHG b DFWLYLW\

PAGE 101

5HGXFLQJ DJHQWV VXFK DV PHUFDSWRHWKDQRO DQG GLWKLRWKUHLWRO KDG OLWWOH RU QR HIIHFW RQ DFWLYLW\ QRW VKRZQf 6XEVWUDWH FRQFHQWUDWLRQV EHWZHHQ DQG QJPO ZHUH RSWLPDO IRU GRXEOHVWUDQGHG FOHDYDJH 3XULILHG HQ]\PH H[KLELWHG QR SUHIHUHQFH IRU IRUP RU IRUP ,,, SODVPLG VXEVWUDWHV DQG ERWK ZHUH FOHDYHG DW HTXDO UDWHV :KHQ WKH DSSHDUDQFH RI HQGR 5 GLJHVWHG SURGXFWV ZDV FRPSDUHG RYHU WLPH WKH DPRXQW RI SURGXFW IRUPDWLRQ ZDV LGHQWLFDO IRU ERWK W\SHV RI LQSXW SODVPLG )LJXUH f 7KLV VXJJHVWV WKDW WKH FRQYHUVLRQ RI IRUP VXEVWUDWH WR IRUP ,,, ZDV QRW WKH UDWH OLPLWLQJ VWHS LQ WKH SURGXFWLRQ RI VSHFLILFDOO\ FOHDYHG SURGXFWV DQG WKDW VXSHUFRLOHG RU WRUVLRQDOO\ VWUHVVHG VXEVWUDWHV ZHUH QRW UHTXLUHG IRU HQGR 5 VSHFLILF FOHDYDJH 7DNLQJ WKHVH IDFWRUV LQ DFFRXQW VWDQGDUG UHDFWLRQ PL[WXUHV RI 0O ZHUH LQFXEDWHG DW r& IRU KRXU DQG FRQWDLQHG P0 7ULV+&O S+ P0 0J&A P0 '77 SPRO IRUP SODVPLG VXEVWUDWH DQG XQLW RI HQGR 5 2QH XQLW RI HQGR 5 DFWLYLW\ LV GHILQHG DV WKH DPRXQW RI SURWHLQ WKDW LV UHTXLUHG WR FOHDYH b RI S*0' VXEVWUDWH XQGHU VWDQGDUG UHDFWLRQ FRQGLWLRQV B/ $OWHUQDWH &OHDYDJH 6SHFLILFLW\ LQ WKH 3UHVHQFH RI 0Qf§ ,RQV :KHQ PDQJDQHVH LV XVHG DV PHWDO LRQ FRIDFWRU FRPSOHWH GHJUDGDWLRQ RI WKH VXEVWUDWH RFFXUV ZLWK VWDQGDUG OHYHOV RI HQ]\PH DQG D GLIIHUHQW VSHFLILFLW\ LV REVHUYHG ZLWK ORZ FRQFHQWUDWLRQ RI 0Q RU HQ]\PH ,Q )LJXUH SHDN IUDFWLRQV HPHUJLQJ IURP D %LR*HO 0 FROXPQ IUDFWLRQ ,9f ZHUH DVVD\HG LQ DQ LGHQWLFDO VHULHV RI UHDFWLRQV XVLQJ HLWKHU 0J RI 0Q DV WKH FRIDFWRU &RPSDULVRQ RI WKH DFWLYLW\ SURILOHV UHYHDOHG WKDW WKH GLIIHUHQW VSHFLILFLWLHV ZHUH FRLQFLGHQWDO +LJK FRQFHQWUDWLRQV RI HQ]\PH UHVXOWHG LQ KLJK OHYHOV RI VSHFLILF FOHDYDJH ZLWK 0J EXW

PAGE 102

)LJXUH &OHDYDJH RI )RUP DQG )RUP ,,, 3ODVPLG 6XEVWUDWH 7ZR DQG RQHKDOI PLFURJUDPV RI VXSHUFRLOHG )POf RU %VW(,, OLQHDUL]HG )Pf S60 VXEVWUDWH ZDV LQFXEDWHG ZLWK XQLWV RI IUDFWLRQ 9 HQGR 5 LQ UHDFWLRQ YROXPHV RI ILO XQGHU VWDQGDUG UHDFWLRQ FRQGLWLRQV $W WKH LQGLFDWHG WLPHV Q SRUWLRQV ZHUH UHPRYHG DQG WUHDWHG ZLWK SURWHLQDVH VWRS VROXWLRQ DV GHVFULEHG LQ WKH OHJHQG WR )LJXUH $IWHU SKHQRO H[WUDFWLRQ DQG HWKDQRO SUHFLSLWDWLRQ WKH HQGR 5 SURGXFWV RI WKH IRUP VXEVWUDWH ZHUH GLJHVWHG ZLWK %VW(,, IRU KRXU DW r& %RWK WKH %VW(,, GLJHVWHG DQG XQGLJHVWHG UHDFWLRQ SURGXFWV ZHUH HOHFWURSKRUHVHG RQ D b DJDURVH JHO

PAGE 103

, )P )P

PAGE 104

)LJXUH 6SHFLILFLW\ RI (QGR 5 ZLWK 0J DQG 0Q 6WDQGDUG UHDFWLRQ PL[WXUHV RI SL FRQWDLQLQJ SJ RI S60 VXEVWUDWH P0 0J&A RU 0Q&A DQG SL RI WKH LQGLFDWHG IUDFWLRQ IURP D %LR*HO $O0 FROXPQ )UDFWLRQ ,9 HQGR 5f ZHUH LQFXEDWHG DW r& IRU KRXU 7KH VDPSOHV ZHUH SKHQRO H[WUDFWHG HWKDQRO SUHFLSLWDWHG GLJHVWHG ZLWK %VW(,, DQG IUDFWLRQDWHG RQ D b DJDURVH JHO

PAGE 105

0J 0Q 0 0 )P

PAGE 106

GHJUDGHG WKH VXEVWUDWH HQWLUHO\ LQ WKH SUHVHQFH RI 0Q &RQYHUVHO\ ORZ HQ]\PH FRQFHQWUDWLRQV SUHVHQW LQ IUDFWLRQV DURXQG WKH SHULPHWHU RI WKH SHDN UHVXOWHG LQ DQ DOWHUHG VSHFLILFLW\ ZLWK 0Q DV FRIDFWRU DQG D UHGXFHG HQGR 5 FOHDYDJH ZLWK 0J 7KHVH UHVXOWV VXJJHVW WKDW WKH GLIIHUHQW VSHFLILFLWLHV UHVLGH RQ WKH VDPH SURWHLQ DQG DUH LQWULQVLF SURSHUWLHV RI HQGR 5 REVHUYHG XQGHU GLIIHUHQW FRQGLWLRQV (QGR 5 6SHFLILF &OHDYDJH LV RI D 'RXEOH6WUDQGHG 1DWXUH $QDO\VLV RI WKH HQGR 5 SURGXFWV DW VHYHUDO WLPH SRLQWV GXULQJ WKH UHDFWLRQ EHIRUH GLJHVWLRQ ZLWK %VW(,, )LJXUH $f UHYHDOHG WKDW WKH VXSHUFRLOHG LQSXW SODVPLG ZDV TXLFNO\ FRQYHUWHG WR WKH QLFNHG FLUFXODU SODVPLG IRUP /LQHDU S60 PROHFXOHV ZKLFK DUH IRUPHG IURP RQH GRXEOHVWUDQGHG EUHDN ZHUH SURGXFHG DV HDUO\ DV WKUHH PLQXWHV LQWR WKH UHDFWLRQ ZKLOH WKH SURGXFWLRQ RI $$9 DQG S%5 OLQHDUV ZKLFK UHTXLUH WZR GRXEOHVWUDQGHG EUHDNV ZHUH GHWHFWHG DW PLQXWHV &RPSDULVRQ RI WKH %VW(,, GLJHVWHG SURGXFWV )LJXUH %f ZLWK XQGLJHVWHG VDPSOHV UHYHDOHG WKDW VSHFLILF FOHDYDJH DW WKH $$9S%5 MXQFWLRQV SDUDOOHOHG WKH SURGXFWLRQ RI IRUP ,,, SODVPLG DQG $$9 DQG S%5 PRQRPHUV 7KH DFFXPXODWLRQ RI OLQHDU PROHFXOHV DQG VSHFLILFDOO\ FOHDYHG SURGXFWV FRUUHODWHG ZHOO ZLWK WKH GHFUHDVH LQ IRUP ,, PROHFXOHV 7KLV UHODWLRQVKLS LV GLVSOD\HG JUDSKLFDOO\ LQ ILJXUH & 3UHYLRXV UHVXOWV LQGLFDWHG WKDW HQGR 5 ZDV HTXDOO\ DFWLYH RQ VXSHUFRLOHG DQG OLQHDU IRUPV RI LQSXW SODVPLG DQG WKDW WKH UDWH RI IRUPDWLRQ RI VSHFLILFDOO\ FOHDYHG GRXEOHVWUDQGHG SURGXFWV SDUDOOHOHG WKH UDWH RI IRUPDWLRQ RI OLQHDU PROHFXOHV ,W ZDV SRVVLEOH KRZHYHU WKDW WKH SURGXFWLRQ RI OLQHDU PROHFXOHV ZDV SUHFHGHG E\ D QLFNHG FLUFXODU LQWHUPHGLDWH DV DQ REOLJDWRU\ VWHS DQG WKDW WKH IRUP ,,

PAGE 107

)LJXUH &OHDYDJH 5HDFWLRQ 7LPH &RXUVH 7ZR SLFDPROHV RI IRUP S60 ZDV LQFXEDWHG ZLWK XQLWV RI IUDFWLRQ 9 HQ]\PH DW r& LQ D UHDFWLRQ YROXPH RI PO WO SRUWLRQV ZHUH UHPRYHG DW WKH LQGLFDWHG WLPHV DQG WKH UHDFWLRQV ZHUH WHUPLQDWHG ZLWK WKH DGGLWLRQ RI DQ HTXDO YROXPH RI VWRS VROXWLRQ PJPO SURWHLQDVH P0 ('7$ b 6'6f SKHQRO H[WUDFWHG DQG HWKDQRO SUHFLSLWDWHG 2QH KDOI RI HDFK WLPH SRLQW ZDV GLJHVWHG ZLWK %VW(,, DQG ERWK WKH XQFXW $f DQG %VW(,, GLJHVWHG %f VDPSOHV ZHUH IUDFWLRQDWHG RQ D b DJDURVH JHO )P OLQHDU SODVPLG $ DQG 3 DUH OLQHDU PRQRPHU $$9 DQG S%5 PROHFXOHV UHVSHFWLYHO\ &f 7KH FRQYHUVLRQ RI WKH XQGLJHVWHG SODVPLG IRUPV LQ $ ), DQG )f WR OLQHDU HQGR 5 SURGXFWV )f DUH SORWWHG DV D IXQFWLRQ RI WLPH 7KH DSSHDUDQFH RI WKH NE .f IUDJPHQW IURP %VW(,, GLJHVWLRQ RI HQGR 5 SURGXFWV ZDV XVHG DV D PHDVXUH RI WKH OHYHO RI VSHFLILF FOHDYDJH RI WKH VXSHUFRLOHG VXEVWUDWH 7KH OHYHO RI FOHDYDJH DW PLQXWHV ZDV DVVLJQHG b

PAGE 108

K)P % U L

PAGE 109

)LJXUH FRQWLQXHGf SDUW &

PAGE 110

)LJXUH 6LQJOH6WUDQGHG 6SHFLILFLW\ RI (QGR 5 $ UHDFWLRQ PL[WXUH RI , FRQWDLQLQJ SPRO RI S*0 LQ VWDQGDUG UHDFWLRQ EXIIHU ZDV LQFXEDWHG ZLWK XQLWV RI HQGR 5 IUDFWLRQ 9f DW r& $W WKH LQGLFDWHG WLPHV ILO DOLTXRWV ZHUH UHPRYHG DQG WUHDWHG DV GHVFULEHG IRU ILJXUH 2QH KDOI RI HDFK WLPH SRLQW ZDV GLJHVWHG ZLWK (FR5, GHQDWXUHG ZLWK WKH DGGLWLRQ RI YROXPH RI 1 1D2+ DQG IUDFWLRQDWHG RQ D b GHQDWXULQJ DJDURVH JHO %f DV GHVFULEHG LQ &KDSWHU ,, 0DWHULDOV DQG 0HWKRGV 7LPH SRLQWV QRW GLJHVWHG ZLWK (FR5, ZHUH IUDFWLRQDWHG RQ D b QRQGHQDWXULQJ DJDURVH JHO $f 7KH DQG NLOREDVH IUDJPHQWV DUH SURGXFHG E\ HLWKHU VLQJOH RU GRXEOHVWUDQGHG FOHDYDJH E\ HQGR 5 DQG IXUWKHU GLJHVWLRQ ZLWK (FR5,

PAGE 112

PROHFXOHV ZHUH SURGXFHG E\ VLWH VSHFLILF VLQJOHVWUDQGHG FOHDYDJH RI WKH LQSXW SODVPLG 'LJHVWLRQ RI D VSHFLILFDOO\ FOHDYHG IRUP ,, LQWHUPHGLDWH ZLWK D RQHFXW UHVWULFWLRQ HQ]\PH ZRXOG \LHOG QLFNHG IRUP ,,, PROHFXOHV WKDW ZRXOG EH LQGLVWLQJXLVKDEOH IURP XQUHDFWHG PDWHULDO RQ QDWLYH DJDURVH JHOV EXW ZRXOG SURGXFH GLVFUHWH EDQGV RQ D GHQDWXULQJ DJDURVH JHO ,Q DGGLWLRQ QLFNHG FLUFXODU SURGXFWV ZHUH REVHUYHG HDUO\ LQ WKH UHDFWLRQ DQG ZRXOG UHVXOW LQ WKH HDUO\ DFFXPXODWLRQ RI VSHFLILFDOO\ FOHDYHG SURGXFWV 7KHVH FRXOG EH HDVLO\ GLVWLQJXLVKHG IURP SURGXFWV IRUPHG IURP GRXEOHVWUDQGHG FXWV ZKLFK RFFXUUHG UHODWLYHO\ ODWH LQ WKH UHDFWLRQ 7R GHWHFW WKH SUHVHQFH RI VLWH VSHFLILF VLQJOHVWUDQGHG EUHDNV WKH SODVPLG S*0 ZDV LQFXEDWHG ZLWK HQGR 5 DQG WKH SURGXFWV RI WKH UHDFWLRQ ZHUH DQDO\]HG DW VHYHUDO WLPH SRLQWV E\ IUDFWLRQDWLRQ RQ ERWK QHXWUDO DQG GHQDWXULQJ DJDURVH JHOV )LJXUHV $ DQG % UHVSHFWLYHO\f $V FDQ EH VHHQ IURP WKHVH H[SHULPHQWV WKH SURGXFWLRQ RI WKH NE IUDJPHQW SURGXFHG IURP WKH (FR5, GLJHVWLRQ RI HQGR 5 SURGXFWV )LJXUH %f SURFHHGHG VORZO\ DQG FRUUHVSRQGHG FORVHO\ WR WKH DFFXPXODWLRQ RI IRUP ,,, LQ XQGLJHVWHG SURGXFWV )LJXUH $f 7KLV LQGLFDWHV WKDW WKH IRUPDWLRQ RI QLFNHG FLUFXODU '1$ YHU\ HDUO\ LQ WKH UHDFWLRQ ZDV WKH UHVXOW RI UDQGRP QLFNLQJ RI WKH VXEVWUDWH DQG WKDW VSHFLILF GRXEOHVWUDQGHG FOHDYDJH RFFXUV DW D PXFK VORZHU UDWH (IIHFW RI 1XFOHRWLGHV DQG 3RO\QXFOHRWLGHV RQ WKH &OHDYDJH $FWLYLW\ 7KH DGGLWLRQ RI VXEVWDQFHV WKDW VWLPXODWH RU LQKLELW DFWLYLW\ FDQ RIWHQ UHYHDO LPSRUWDQW DVSHFWV RI HQ]\PDWLF PHFKDQLVPV :LWK D QXFOHDVH VXFK DV HQGR 5 LW ZDV ORJLFDO WR ORRN DW WKH HIIHFW WKDW WKH DGGLWLRQ RI QXFOHRWLGHV DQG QXFOHRWLGH SRO\PHUV ZRXOG KDYH RQ VSHFLILF FOHDYDJH DFWLYLW\

PAGE 113

7KH DGGLWLRQ RI D PL[WXUH RI WKH GHR[\ULERQXFOHRVLGH WULSKRVSKDWHV G173f DW FRQFHQWUDWLRQV EHWZHHQ DQG P0 KDG QR REVHUYDEOH HIIHFW RQ WKH HQGR 5 FOHDYDJH UHDFWLRQ 7DEOH 9,f +RZHYHU ZKHQ DGGHG VHSDUDWHO\ G*73 DQG G$73 VWLPXODWHG FOHDYDJH IROG DW FRQFHQWUDWLRQV EHWZHHQ DQG P0 ,Q FRQWUDVW WKH DGGLWLRQ RI G&73 RU G773 KDG QR REVHUYDEOH HIIHFW RQ DFWLYLW\ &RQYHUVHO\ D PL[WXUH RI WKH ULERQXFOHRVLGH WULSKRVSKDWHV U173f ZDV VOLJKWO\ LQKLELWRU\ DW P0 &73 DQG 873 GLG QRW DIIHFW DFWLYLW\ ZKHQ DGGHG VHSDUDWHO\ ZKLOH *73 RI $73 FRPSOHWHO\ LQKLELWHG GRXEOH VWUDQGHG FOHDYDJH DW FRQFHQWUDWLRQV JUHDWHU WKDQ P0 &XULRXVO\ WKH DGGLWLRQ RI $73 DW FRQFHQWUDWLRQV JUHDWHU WKDQ P0 SURGXFHG D SURQRXQFHG LQKLELWLRQ )LJXUH f 0RUHRYHU WKH DGGLWLRQ RI DQ $73 JHQHUDWLQJ V\VWHP FUHDWLQH SKRVSKDWH DQG FUHDWLQH SKRVSKRNLQDVHf LQ WKH SUHVHQFH RI P0 $73 FRPSOHWHO\ LQKLELWHG GRXEOHVWUDQGHG FOHDYDJH +RZHYHU HQGR 5 KDV VKRZQ QR DIILQLW\ IRU *73 RU $73OLQNHG DJDURVH UHVLQV LQ WKH SUHVHQFH RI 0J LRQV DQG QR RWKHU LQGLFDWLRQ RI ELQGLQJ EHWZHHQ HQGR 5 DQG $73 RU *73 FRXOG EH GHPRQVWUDWHG ,Q FUXGH SUHSDUDWLRQV RI HQGR 5 WKH DGGLWLRQ RI GXSOH[ FDOI WK\PXV '1$ DQG $73 UHVXOWHG LQ D VWLPXODWLRQ RI VSHFLILF FOHDYDJH 6XEVHTXHQW H[SHULPHQWV ZLWK PRUH SXULILHG SUHSDUDWLRQV RI HQ]\PH KDYH VKRZQ WKDW WKLV HIIHFW ZDV SUREDEO\ GXH WR LQKLELWLRQ RI LQWHUIHULQJ DFWLYLWLHV LH FRQWDPLQDWLQJ QXFOHDVHVf UDWKHU WKDQ WR D GLUHFW VWLPXODWLRQ RI HQGR 5 ,Q DGGLWLRQ HQGR 5 2 IUDFWLRQV ,,, ,9 RU 9f GLG QRW K\GURO\]H +$73 XQGHU VWDQGDUG FOHDYDJH UHDFWLRQ FRQGLWLRQV 1R $73DVH DFWLYLW\ FRXOG EH GHWHFWHG LQ WKHVH IUDFWLRQV ZLWK RU ZLWKRXW WKH DGGLWLRQ RI VXEVWUDWH '1$ QRW VKRZQf

PAGE 114

7$%/( 9, 18&/(27,'( ,1+,%,7,21 $1' 67,08/$7,21 &RQFHQWUDWLRQ $FWLYLW\ LJUDO b G173 G*73 G&73 G$73 G773 U173 *73 &73 $73 873 D6WDQGDUG UHDFWLRQ PL[WXUHV Of FRQWDLQLQJ SPRO RI %VW(,, GLJHVWHG S60 ZDV LQFXEDWHG ZLWK XQLW RI HQGR 5 DW r& IRU KRXU ZLWK WKH LQGLFDWHG FRQFHQWUDWLRQ RI QXFOHRWLGH 7KH UHDFWLRQ SURGXFWV ZHUH IUDFWLRQDWHG RQ b DJDURVH JHOV DQG WKH UHODWLYH DFWLYLW\ ZDV HVWLPDWHG IURP SKRWRJUDSKV DQG GHQVLWRPHWHU WUDFLQJV DV GHVFULEHG IRU )LJXUH G173 DOO IRXU GHR[\ULERQXFOHRWLGH WULSKRVSKDWHV U173 DOO IRXU ULERQXFOHRWLGH WULSKRVSKDWHV

PAGE 115

)LJXUH $73 ,QKLELWLRQ RI (QGR 5 $FWLYLW\ $73 DW FRQFHQWUDWLRQV RI DQG P0 ZDV DGGHG WR VWDQGDUG HQGR 5 FOHDYDJH UHDFWLRQV Mf FRQWDLQLQJ QJ RI %VW(,, GLJHVWHG S60 VXEVWUDWH 7KH TXDQWLW\ RI SURGXFW IRUPHG ZDV GHWHUPLQHG DV GHVFULEHG IRU )LJXUH XVLQJ WKH /.% XOWUDVFDQ GHQVLWRPHWHU

PAGE 117

7KH UHVXOWV RI DVVD\V LQ ZKLFK KRPRSRO\PHUV ZHUH DGGHG WR WKH UHDFWLRQ LQGLFDWHG WKDW HQGR 5 KDG D VWURQJ DIILQLW\ IRU SRO\PHUV RI VLQJOHVWUDQGHG SRO\G*f RYHU RWKHU '1$ IRUPV ,Q WKHVH H[SHULPHQWV VWDQGDUG HQGR 5 UHDFWLRQV FRQWDLQLQJ LJPO S60 VXEVWUDWH ZHUH WLWUDWHG ZLWK VLQJOHVWUDQGHG SRO\G*fA! VLQJOHVWUDQGHG SRO\G&fA! QDWLYH (FROL '1$ KHDWGHQDWXUHG (FROL '1$ RU ZLWK GRXEOHVWUDQGHG SRO\G*fSrO\G&f)LJXUH $f 7KH UHVXOWV FOHDUO\ VKRZHG WKDW VLQJOHVWUDQGHG SRO\G*f '1$ ZDV WKH PRVW SRWHQW LQKLELWRU RI HQGR 5 DFWLYLW\ DQG FRPSOHWHO\ LQKLELWHG FOHDYDJH DW DOO FRQFHQWUDWLRQV WHVWHG 7KH TXDQWLW\ RI SRO\G*f UHTXLUHG IRU FRPSOHWH LQKLELWLRQ LV IROG OHVV WKDQ WKH FRQFHQWUDWLRQV UHTXLUHG RI WKH RWKHU FRPSHWLWRU '1$V DQG DW OHDVW IRXU WLPHV OHVV WKDQ WKH QXPEHU RI PROHV RI QXFOHRWLGHV LQ WKH VXEVWUDWH 'RXEOHVWUDQGHG SRO\G*fSRO\G&f WRWDO FHOOXODU 51$ QRW VKRZQf DQG QDWLYH QRW VKRZQf RU GHQDWXUHG (FROL '1$ LQKLELWHG WKH FOHDYDJH UHDFWLRQ DW DSSUR[LPDWHO\ HTXDO FRQFHQWUDWLRQV $SSUR[LPDWHO\ JPO RI HDFK ZHUH UHTXLUHG WR DFKLHYH b LQKLELWLRQ )LJXUH %f ZKLFK FRUUHVSRQGV WR PROHV RI QXFOHRWLGH LQKLELWRU SHU PROH RI QXFOHRWLGH VXEVWUDWH 7KH DGGLWLRQ RI W51$ RU SRO\PHUV RI EURPLQDWHG SRO\*&f ZKLFK IRUPV D OHIWKDQGHG ='1$ FRQIRUPDWLRQ KDG QR HIIHFW RQ FOHDYDJH DFWLYLW\ DW DQ\ RI WKH FRQFHQWUDWLRQV WHVWHG JPOf 7KH DIILQLW\ RI HQGR 5 IRU VLQJOH VWUDQGHG SRO\G*f ZDV FRQILUPHG E\ FKURPDWRJUDSKLF UHVXOWV ZKHUH RQO\ PLQLPDO DPRXQWV RI DFWLYLW\ ERXQG WR VLQJOHVWUDQGHG '1$ DJDURVH ZKLOH DOO RI WKH FOHDYDJH DFWLYLW\ ERXQG WLJKWO\ WR VLQJOHVWUDQGHG SRO\G*f DJDURVH FROXPQV RI FRPSDUDEOH FDSDFLW\

PAGE 118

)LJXUH 3RO\QXFOHRWLGH &RPSHWLWLRQ RI 'RXEOH6WUDQGHG &OHDYDJH $FWLYLW\ $f 6WDQGDUG UHDFWLRQV PL[WXUHV Of FRQWDLQLQJ JPO %VW(,, GLJHVWHG S60 XQLW RI IUDFWLRQ 9 HQGR 5 DQG RU LJPO '1$ FRPSHWLWRU ZHUH LQFXEDWHG IRU KRXU DW r& 7KH SURGXFWV ZHUH HOHFWURSKRUHVHG RQ D b DJDURVH JHO DQG WKH OHYHO RI HQGR 5 DFWLYLW\ ZDV PHDVXUHG DV GHVFULEHG IRU )LJXUH G* VLQJOHVWUDQGHG SRO\G*fA! G& VLQJOHVWUDQGHG SRO\G&fA! *& GRXEOHVWUDQGHG SRO\G*fLSrO\G&fA DQG 66 KHDW GHQDWXUHG (FROL '1$ %f 7KH FOHDYDJH DFWLYLW\ LV SORWWHG DJDLQVW WKH DPRXQW RI FRPSHWLWRU '1$ DGGHG WR WKH UHDFWLRQ 7KH DFWLYLW\ SURILOH IRU GRXEOHVWUDQGHG (FROL '1$ DQG VLQJOHVWUDQGHG (FROL '1$ ZHUH YLUWXDOO\ LGHQWLFDO DQG RQO\ WKH GDWD IRU WKH VLQJOHVWUDQGHG FRPSHWLWRU LV VKRZQ KHUH

PAGE 119

G* G& G*G& VV'1$ )P Am b

PAGE 120

)LJXUH FRQWLQXHGf SDUW %

PAGE 121

)LJXUH 6WRLFKLRPHWU\ RI WKH (QGR 5 &OHDYDJH 5HDFWLRQ $ UHDFWLRQ PL[WXUH FRQWDLQLQJ SPRO RI S60 LQ , ZDV LQFXEDWHG ZLWK XQLW RI IUDFWLRQ 9 HQGR 5 XQGHU VWDQGDUG UHDFWLRQ FRQGLWLRQV $W PLQXWHV WKH UHDFWLRQ ZDV VSOLW LQWR WZR SRUWLRQV WKH UHDFWLRQ WHUPLQDWHG LQ RQH SRUWLRQ ZLWK WKH DGGLWLRQ RI DQ HTXDO YROXPH RI PJPO SURWHLQDVH P0 ('7$ b 6'6 DQG LQFXEDWLRQ DW r& IRU KRXU SPROV RI S60 ZDV DGGHG WR WKH UHPDLQLQJ SRUWLRQ LQFXEDWLRQ DW r& ZDV FRQWLQXHG IRU DQ DGGLWLRQDO PLQXWHV DQG WKH UHDFWLRQ ZDV WHUPLQDWHG DV DERYH $IWHU SKHQRO H[WUDFWLRQ DQG HWKDQRO SUHFLSLWDWLRQ ERWK DOLTXRWV ZHUH GLJHVWHG ZLWK %VW(,, DQG IUDFWLRQDWHG RQ D b DJDURVH JHO 7KH NE IUDJPHQW LV LQGLFDWLYH RI WKH DPRXQW RI S60 FOHDYDJH ZKLOH WKH NE EDQG LQGLFDWHV WKH DPRXQW RI S60 FOHDYDJH

PAGE 122

UR &' K

PAGE 123

,OO $UH 6WRLFKLRPHWULF $PRXQWV RI (Q]\PH 5HTXLUHG IRU &OHDYDJH 7R GHWHUPLQH LI HQGR 5 ZDV UHTXLUHG LQ VWRLFKLRPHWULF DPRXQWV IRU FOHDYDJH WZR GLIIHUHQW VXEVWUDWHV ZKLFK FRXOG EH GLIIHUHQWLDWHG RQ WKH EDVLV RI WKH VL]H RI WKH FOHDYDJH SURGXFWV ZHUH DGGHG VHTXHQWLDOO\ WR WKH UHDFWLRQ PL[WXUH )LJXUH f :KHQ D IROG H[FHVV RI S60 ZDV LQFXEDWHG ZLWK HQGR 5 DQG GLJHVWHG ZLWK %VW(,, RQO\ D VPDOO IUDFWLRQ RI WKH VXEVWUDWH KDG UHDFWHG DW PLQXWHV LQGLFDWLQJ WKDW WKH UHDFWLRQ ZDV VDWXUDWHG ZLWK VXEVWUDWH 7KH DGGLWLRQ RI DQ HTXDO DPRXQW RI S60 WR WKH UHDFWLRQ IROORZHG E\ LQFXEDWLRQ IRU DQ DGGLWLRQDO PLQXWHV UHVXOWHG LQ WKH FRQWLQXHG FOHDYDJH RI ERWK VXEVWUDWHV DW D PD[LPXP UDWH &OHDYDJH RI WKH S60 VXEVWUDWH FDQ EH GLIIHUHQWLDWHG IURP S60 FOHDYDJH E\ YLUWXH RI WKH EDVH SDLU GHOHWLRQV LQ WKH $$9 WHUPLQDO VHTXHQFHV LQ WKH S60 FORQH %VW(,, GLJHVWLRQ RI HQGR 5 SURGXFWV SURGXFHV D NE IUDJPHQW IURP FOHDYDJH DW WKH OHIW S60 MXQFWLRQ ZKLFK LV HDVLO\ GLVWLQJXLVKHG IURP WKH NE IUDJPHQW JHQHUDWHG E\ FOHDYDJH DW WKH OHIW S60 MXQFWLRQ UHIHU WR )LJXUH f 7KHVH UHVXOWV LQGLFDWHG D GLVWULEXWLYH RU QRQVWRLFKLRPHWULF PRGH RI GRXEOH VWUDQGHG FOHDYDJH E\ HQGR 5 &KDUDFWHUL]DWLRQ RI WKH (QGV RI WKH 5HDFWLRQ 3URGXFWV .QRZOHGJH RI WKH SRVLWLRQ RI WKH SKRVSKRPRQRHVWHU DQG K\GUR[\O JURXSV RQ WKH SURGXFWV RI QXFOHRO\WLF GLJHVWLRQ LV XVHIXO IRU FRPSDULVRQ ZLWK RWKHU QXFOHDVHV 7KH SRVLWLRQV RI WKHVH JURXSV ZHUH GHWHUPLQHG LQGHSHQGHQWO\ E\ WKH OLJDWLRQ RI HQGR 5 SURGXFWV DQG E\ n DQG n ODEHOLQJ H[SHULPHQWV 7KH SODVPLG S*0 ZDV XVHG DV WKH VXEVWUDWH IRU HQGR 5 OLJDWLRQ VWXGLHV 3*0 LV FOHDYHG E\ IUDFWLRQ 9 HQGR 5 DW D IUHTXHQF\ HTXDO WR WKDW RI S60 7DEOH ,9f 7KH LQLWLDO SURGXFWV RI

PAGE 124

HQGR 5 GLJHVWLRQ RI S*0 FRQVLVWHG RI DSSUR[LPDWHO\ HTXDO SRUWLRQV RI IRUP ,, DQG IRUP ,,, '1$ DQG LQFOXGHG D EDFNJURXQG VPHDU ZKLFK ZDV SUHVXPDEO\ WKH FRPELQHG UHVXOW RI HQGR 5 FOHDYDJH DW PLQRU VLWHV DQG QRQVSHFLILF GHJUDGDWLRQ RI WKH VXEVWUDWH )LJXUH ODQH 5f :KHQ WKHVH SURGXFWV ZHUH WUHDWHG ZLWK 7 '1$ OLJDVH JUHDWHU WKDQ b RI WKH OLQHDU PROHFXOHV FRXOG EH OLJDWHG WR KLJKHU PROHFXODU ZHLJKW IRUPV )LJXUH ODQH 5/f 1R LQFUHDVH LQ WKH \LHOG RI KLJKHU PROHFXODU ZHLJKW SURGXFWV ZDV REVHUYHG ZLWK FRQWLQXHG OLJDWLRQ RU DIWHU WUHDWPHQW RI HQGR 5 SURGXFWV ZLWK WKH .OHQRZ IUDJPHQW WR SURGXFH EOXQW HQGV SULRU WR OLJDWLRQ QRW VKRZQf 7KHVH UHVXOWV LQGLFDWHG WKDW D PDMRULW\ RI HQGR 5 SURGXFWV FRQWDLQHG HQGV ZLWK n SKRVSKDWHV DQG n K\GUR[\OV DQG ZHUH WKHUHIRUH VXEVWUDWHV IRU '1$ OLJDVH +RZHYHU D VLJQLILFDQW DPRXQW RI WKH IRUP ,,, SURGXFW ZDV QRW OLJDWDEOH 7KLV PD\ UHIOHFW D KHWHURJHQHRXV QDWXUH RI WKH HQGV SURGXFHG E\ HQGR 5 ZKHUH RQO\ D IUDFWLRQ RI WKH UHDFWLRQ SURGXFWV ZHUH OLJDWDEOH IRUPV WKDW GLG QRW FRQWDLQ JDSV RU RYHUKDQJV LQ WKH K\EULGL]HG PROHFXOH *HQHUDWLQJ EOXQW HQGV SULRU WR OLJDWLRQ PD\ SURGXFH PRUH OLJDWDEOH IRUPV EXW DOVR UHGXFHV WKH RYHUDOO HIILFLHQF\ RI OLJDWLRQ ,W ZDV DOVR SRVVLEOH KRZHYHU WKDW LQFRPSOHWH OLJDWLRQ UHIOHFWHG WKH SUHVHQFH RI FRQWDPLQDWLQJ QXFOHRO\WLF RU SKRVSKDWDVH DFWLYLWLHV LQ WKH HQ]\PH H[WUDFWV 7KH n SRVLWLRQ RI WKH SKRVSKRPRQRHVWHU JURXS ZDV IXUWKHU YHULILHG E\ n HQG ODEHOLQJ H[SHULPHQWV 7DEOH 9,,f ,Q WKHVH VWXGLHV HQGR 5 WUHDWHG VDPSOHV WKDW KDG EHHQ GHSKRVSKRU\ODWHG ZLWK FDOI LQWHVWLQH DONDOLQH SKRVSKDWDVH &,$3f SULRU WR HQG ODEHOLQJ LQFRUSRUDWHG IROG PRUH UDGLRDFWLYLW\ WKDQ WKH XQWUHDWHG FRQWURO VDPSOHV +RZHYHU D VLJQLILFDQW DPRXQW RI LQFRUSRUDWLRQ ZDV GHWHFWHG LQ HQGR 5 SURGXFWV WKDW

PAGE 125

7$%/( 9,, (1' /$%(/,1* 2) (1'2 5 352'8&76 5HDFWLRQ &RQGLWLRQV ,QFRUSRUDWLRQ FSP [ f 1R (QGR 5 1R &,$3 1R (QGR 5 &,$3 (QGR 5 1R &,$3 (QGR 5 &,$3 S%5 [ (FR5, D5HDFWLRQ PL[WXUHV SLf FRQWDLQLQJ SPROV RI WKH SODVPLG S*0 ZHUH LQFXEDWHG ZLWK XQLWV RI IUDFWLRQ 9 HQGR 5 XQGHU VWDQGDUG UHDFWLRQ FRQGLWLRQV IRU KRXU DW r& 7KH UHDFWLRQV ZHUH VSOLW LQWR WZR HTXDO SRUWLRQV DQG SRUWLRQ ZDV WUHDWHG ZLWK FDOI LQWHVWLQH DONDOLQH SKRVSKDWDVH &,$3f %RWK WKH SKRVSKDWDVHG DQG SKRVSKRU\ODWHG VDPSOHV DQG WZR LGHQWLFDO FRQWURO VDPSOHV ZKLFK KDG QRW EHHQ WUHDWHG ZLWK HQGR 5 ZHUH nHQG ODEHOHG ZLWK SRO\n QXFOHRWLGH NLQDVH DQG A3$73 DV GHVFULEHG LQ &KDSWHU ,, 7KH NLQDVLQJ UHDFWLRQV SLf ZHUH WHUPLQDWHG ZLWK WKH DGGLWLRQ RI SL RI 0 ('7$ D SL DOLTXRW RI HDFK ZDV SUHFLSLWDWHG LQ b 7&$ PJPO %6$ DQG WKH DFLG SUHFLSLWDEOH UDGLRDFWLYLW\ RI HDFK IUDFWLRQ ZDV GHWHUPLQHG

PAGE 126

ZHUH QRW GHSKRVSKRU\ODWHG FRUUHVSRQGLQJ WR DERXW IROG OHVV WKDQ WKH LQFRUSRUDWLRQ REVHUYHG ZLWK WKH &,$3WUHDWHG SURGXFWV ,W ZDV SRVVLEOH WKDW WKLV LQFRUSRUDWLRQ ZDV GXH WR D NLQDVH H[FKDQJH UHDFWLRQ +RZHYHU LW PD\ DOVR UHIOHFW WKH SUHVHQFH RI DQ DGGLWLRQDO QXFOHRO\WLF RU SKRVSKDWDVH DFWLYLW\ LQ WKH H[WUDFWV 7R GHWHUPLQH LI HQGR 5 H[WUDFWV FRQWDLQHG FRQWDPLQDWLQJ QXFOHRO\WLF DQG SKRVSKDWDVH DFWLYLWLHV D SRUWLRQ RI WKH SURGXFWV RI WKH HQGODEHOLQJ UHDFWLRQ ZDV GLJHVWHG ZLWK (FR5, DQG ERWK WKH XQGLJHVWHG )LJXUH $f DQG (FR5, GLJHVWHG )LJXUH %f VDPSOHV ZHUH IUDFWLRQDWHG RQ DJDURVH JHOV 7KH UHVXOWV LQ )LJXUH $ VKRZ WKDW PRVW RI WKH ODEHO LQ WKH SKRVSKDWDVHG HQGR 5 WUHDWHG VDPSOHV ZDV LQFRUSRUDWHG LQWR IRUP ,,, DQG IRUP ,, SODVPLG '1$ :KHQ WKHVH SURGXFWV ZHUH IXUWKHU GLJHVWHG ZLWK (FR5, WKH PDMRULW\ RI WKH ODEHO ZDV UHWDLQHG HLWKHU LQ WKH VSHFLILFDOO\ FOHDYHG IUDJPHQWV RU LQ XQUHDFWHG VXEVWUDWH )LJXUH % ULJKW SDQHOf 6DPSOHV QRW GHSKRVSKRU\ODWHG EHIRUH HQG ODEHOLQJ GLVSOD\HG D VLPLODU SDWWHUQ RI LQFRUSRUDWLRQ EXW DW D PXFK UHGXFHG OHYHO ,W LV XQOLNHO\ WKDW WKH VDPH QXFOHRO\WLF DFWLYLW\ ZRXOG SURGXFH WZR W\SHV RI HQGV /DVNRZVNL f 7KHUHIRUH WKH UDGLRDFWLYLW\ LQFRUSRUDWHG LQWR HQGR 5 SURGXFWV QRW WUHDWHG ZLWK &,$3 PD\ EH WKH UHVXOW RI D NLQDVH H[FKDQJH UHDFWLRQ RU PD\ UHIOHFW WKH SUHVHQFH RI DQ DVVRFLDWHG SKRVSKDWDVH DFWLYLW\ LQ WKH HQ]\PH H[WUDFWV )LQDOO\ WKHUH LV QR HYLGHQFH WR VXSSRUW WKH SUHVHQFH RI D FRQWDPLQDWLQJ HQGRQXFOHDVH VLQFH WKH SDWWHUQ RI LQFRUSRUDWLRQ ZDV WKH VDPH UHJDUGOHVV RI ZKHWKHU WKH VDPSOHV ZHUH GHSKRVSKRU\ODWHG SULRU WR HQG ODEHOLQJ +RZHYHU WKH UHVXOWV GR QRW H[FOXGH WKH SRVVLELOLW\ WKDW D VPDOO DPRXQW RI FRQWDPLQDWLQJ H[RQXFOHRO\WLF DFWLYLW\ LV SUHVHQW LQ WKH H[WUDFWV 2YHUDOO WKH UHVXOWV IURP WKHVH VWXGLHV LQGLFDWH WKDW WKH PDMRULW\ RI

PAGE 127

)LJXUH /LJDWLRQ RI (QGR 5 3URGXFWV $ VWDQGDUG UHDFWLRQ PL[WXUH RI WO FRQWDLQLQJ SPRO RI IRUP S60 VXEVWUDWH ZDV LQFXEDWHG ZLWK XQLWV RI IUDFWLRQ 9 HQGR 5 IRU KRXU DW r& 7KH UHDFWLRQ ZDV SKHQRO H[WUDFWHG DQG HWKDQRO SUHFLSLWDWHG DQG WKH GU\ '1$ SHOOHW ZDV UHGLVVROYHG LQ LO RI 7 '1$ OLJDVH EXIIHU P0 7ULV+&O S+ P0 0J&A P0 '77 DQG P0 $73f 7KH PL[WXUH ZDV GLYLGHG LQWR HTXDO SRUWLRQV DQG XQLWV RI 7 '1$ OLJDVH ZHUH DGGHG WR RQH RI WKH SRUWLRQV 7KH OLJDWLRQ UHDFWLRQ ZDV LQFXEDWHG DW r& IRU KRXUV DQG ERWK WKH OLJDWHG 5/f DQG XQOLJDWHG 5f HQGR 5 SURGXFWV ZHUH IUDFWLRQDWHG RQ D b DJDURVH JHO 7KH SRVLWLRQ RI QLFNHG FLUFXODU )Pf DQG OLQHDU )Pf SODVPLG '1$ LV LQGLFDWHG QH[W WR WKH PDUNHU ODQH

PAGE 128

0 5 5/ )P )P

PAGE 129

)LJXUH n (QG /DEHOLQJ RI (QGR 5 3URGXFWV 3*0 VXEVWUDWH SPROf ZDV LQFXEDWHG ZLWK XQLWV RI IUDFWLRQ 9 HQGR 5 LQ D VWDQGDUG UHDFWLRQ RI O $ VHFRQG LGHQWLFDO FRQWURO UHDFWLRQ ZDV QRW WUHDWHG ZLWK HQGR 5 7KH UHDFWLRQ PL[WXUHV ZHUH SKHQRO H[WUDFWHG DQG HWKDQRO SUHFLSLWDWHG DQG WKH SHOOHWV ZHUH UHGLVVROYHG LQ ILO RI 0 7ULV+&O S+ DQG b 6'6 2QH KDOI RI HDFK PL[WXUH ZDV GHSKRVSKRU\ODWHG ZLWK WKH DGGLWLRQ RI XQLW RI FDOI LQWHVWLQH DONDOLQH SKRVSKDWDVH &,$3f DQG LQFXEDWLRQ DW URRP WHPSHUDWXUH IRU KRXUV $OO VDPSOHV ZHUH SKHQRO DQG FKORURIRUP H[WUDFWHG HWKDQRO SUHFLSLWDWHG DQG WKH SHOOHWV ZHUH UHGLVVROYHG LQ SL SRO\QXFOHRWLGH NLQDVH EXIIHU P0 7ULV+&O S+ P0 0J&A P0 '77f FRQWDLQLQJ L&L RI 3$73 DQG XQLWV NLQDVH $IWHU LQFXEDWLRQ DW r& IRU PLQXWHV D LO DOLTXRW RI HDFK VDPSOH ZDV SUHFLSLWDWHG LQ b 7&$ PJPO %6$ DQG WKH DPRXQW RI DFLG SUHFLSLWDEOH FRXQWV ZDV GHWHUPLQHG QR HQGR 5 2& QR HQGR 5 SOXV &,$3 5 HQGR 5 WUHDWHG 5& HQGR 5 WUHDWHG SOXV &,$3 $f $XWRUDGLRJUDSK RI XQGLJHVWHG SURGXFWV %f (WKLGLXP VWDLQHG JHO OHIW SDQHOf DQG DXWRUDGLRJUDSK ULJKW SDQHOf RI (FR5, GLJHVWHG nHQG ODEHOHG VDPSOHV

PAGE 131

)LJXUH FRQWLQXHGf SDUW %

PAGE 132

HQGV RI WKH IUDJPHQWV SURGXFHG E\ HQGR 5 VSHFLILF FOHDYDJH FRQWDLQ n SKRVSKDWH DQG n K\GUR[\O JURXSV ,V (QGR 5 D +XPDQ 7RSRLVRPHUDVH 7KH SURSHUWLHV RI HQGR 5 VKDUH D IHZ VLPLODULWLHV ZLWK WKRVH RI PDPPDOLDQ WRSRLVRPHUDVHV 7KH PRVW LQWULJXLQJ LV WKH FDSDFLW\ RI ERWK W\SH DQG W\SH ,, WRSRLVRPHUDVHV WR LQWURGXFH WUDQVLHQW EUHDNV LQ '1$ /LX HW DO f ,W ZDV QDWXUDO WR VSHFXODWH WKHQ WKDW HQGR 5 FOHDYDJH LV DFWXDOO\ GXH WR LQWHUUXSWLRQ RI WKH UHOD[DWLRQ SURFHVV RI D VXSHUFRLOHG VXEVWUDWH 7KLV LV HVSHFLDOO\ WUXH RI W\SH ,, WRSRLVRPHUDVHV ZKHUH GRXEOHVWUDQGHG FOHDYDJH KDV EHHQ IXQFWLRQDOO\ VHSDUDWHG IURP WKH UHMRLQLQJ VWHS ZLWK WKH XVH RI VSHFLILF LQKLELWRUV &KHQ HW DO 1HOVRQ HW DO
PAGE 133

&+$37(5 9,, ',6&866,21 $1' &21&/86,216 3XULILFDWLRQ RI (QGR 5 (QGR 5 LV DQ HQ]\PH RI FHOOXODU RULJLQ +RZHYHU VSHFLILF FOHDYDJH DFWLYLW\ LV HQKDQFHG DSSUR[LPDWHO\ IROG LQ QXFOHDU H[WUDFWV SUHSDUHG IURP $G LQIHFWHG FHOOV JURZQ LQ WKH SUHVHQFH RI K\GUR[\XUHD +\GUR[\XUHD LV D SRWHQW UHYHUVLEOH LQKLELWRU RI ULERQXFOHRWLGH UHGXFWDVH DQG LQKLELWV '1$ UHSOLFDWLRQ E\ EORFNLQJ WKH SURGXFWLRQ RI GHR[\ULER QXFOHRWLGHV IURP ULERQXFOHRWLGH SUHFXUVRUV 7LPVRQ f 7KXV WKH REVHUYHG VWLPXODWLRQ RI DFWLYLW\ LV SUHVXPDEO\ WKH UHVXOW RI $G HDUO\ JHQH H[SUHVVLRQ ZKLFK GRHV QRW UHTXLUH '1$ UHSOLFDWLRQ *UHHQ HW DO f DQG LV WKHUHIRUH XQDIIHFWHG E\ WKH DGGLWLRQ RI K\GUR[\XUHD ,W LV QRW FOHDU KRZHYHU ZKHWKHU WKH VWLPXODWLRQ UHVXOWV IURP HQ]\PH PRGLILFDWLRQ RU IURP D GLUHFW HQKDQFHPHQW RI HQGR 5 JHQH H[SUHVVLRQ 7KHUH UHPDLQV D VLJQLILFDQW GLIIHUHQFH EHWZHHQ WKH PROHFXODU ZHLJKWV GHWHUPLQHG IRU QDWLYH DQG GHQDWXUHG SURWHLQ 7KH JHO ILOWUDWLRQ DQG VHGLPHQWDWLRQ GDWD LQGLFDWH D QDWLYH PROHFXODU ZHLJKW RI DSSUR[LPDWHO\ NG ZKLOH WKH UHVXOWV IURP 6'6 JHO DQDO\VLV LQGLFDWH WKDW HQGR 5 LV D VOLJKWO\ VPDOOHU SURWHLQ RI DSSUR[LPDWHO\ GDO 7KLV W\SH RI GLVFUHSDQF\ LV QRW XQFRPPRQ DQG FRXOG EH H[SODLQHG E\ SRVWXODWLQJ DQ DV\PPHWULF QRQVSKHULFDO VKDSH IRU QDWLYH HQGR 5 ,W VKRXOG EH QRWHG KRZHYHU WKDW HQGR 5 KDV QRW EHHQ SXULILHG WR KRPRJHQHLW\ 7KHUHIRUH LW LV SRVVLEOH WKDW WKH PLQRU SHSWLGHV LQ WKH HQ]\PH SUHSDUDWLRQ FRQWULEXWH VLJQLILFDQWO\ WR FOHDYDJH DFWLYLW\

PAGE 134

([FLVLRQ RI $$9 6HTXHQFHV ,Q 9LWUR :KHQ FUXGH QXFOHDU H[WUDFWV ZHUH DVVD\HG IRU VSHFLILF FOHDYDJH DFWLYLW\ RQ $$9 SODVPLG VXEVWUDWHV RQO\ b RI WKH VWDUWLQJ PDWHULDO ZDV FOHDYHG DW HLWKHU $$9YHFWRU MXQFWLRQ DQG WKH SURGXFWV FRXOG EH YLVXDOL]HG RQO\ E\ 6RXWKHUQ f K\EULGL]DWLRQ )XUWKHU SXULILFDWLRQ RI HQGR 5 KDV VLPSOLILHG WKH JHO DVVD\ DQG JUHDWO\ LQFUHDVHG WKH \LHOG RI VSHFLILFDOO\ FOHDYHG SURGXFW 7KLV KDV DOORZHG WKH GHWDLOHG VWXG\ RI $$9 H[FLVLRQ LQ YLWUR DQG KDV OHG WR D EHWWHU XQGHUVWDQGLQJ RI WKH FKDUDFWHULVWLFV RI HQGR 5 QXFOHRO\WLF DFWLYLW\ 7KH ZLOG W\SH $$9 SODVPLG S60 FRQWDLQV WZR PDMRU HQGR 5 VLWHV DW HLWKHU $$9YHFWRU MXQFWLRQ 7KH PDMRU SURGXFW RI WKH UHDFWLRQ ZDV D OLQHDU SODVPLG PROHFXOH SURGXFHG E\ LQGHSHQGHQW FOHDYDJH DW RQH RU WKH RWKHU MXQFWLRQ 7KHUHIRUH WKH IUDJPHQWV REVHUYHG LQ WKH DJDURVH JHO DVVD\ ZHUH WKH UHVXOW RI D SDUWLDO GLJHVWLRQ ZLWK HQGR 5 IROORZHG E\ FRPSOHWH GLJHVWLRQ ZLWK %VW(,, 2Q RFFDVLRQ KRZHYHU ERWK $$9YHFWRU MXQFWLRQV ZHUH FOHDYHG VLPXOWDQHRXVO\ DFFRXQWLQJ IRU DSSUR[LPDWHO\ b RI WKH SURGXFW DQG \LHOGLQJ OLQHDU $$9 DQG S%5 PROHFXOHV 7KH VLWH RI FOHDYDJH LQ S60 ZDV ORFDOL]HG WR ZLWKLQ ES RI WKH $$9YHFWRU MXQFWLRQ E\ K\EULGL]LQJ WKH UHDFWLRQ SURGXFWV WR HLWKHU $$9 RI S%5 VSHFLILF SUREHV ,Q DGGLWLRQ LW ZDV GHPRQVWUDWHG WKDW LQWHUDFWLRQ EHWZHHQ WKH WZR $$9 WHUPLQDO UHSHDWV ZDV QRW UHTXLUHG DQG WKDW HLWKHU $$9YHFWRU MXQFWLRQ FRXOG EH FOHDYHG LQGHSHQGHQWO\ RI WKH RWKHU 6XEFORQHV WKDW FRQWDLQHG HLWKHU WKH OHIW RU ULJKW $$9S%5 MXQFWLRQ ZHUH FOHDYHG ZLWK HTXDO HIILFLHQF\ ZKHQ FRPSDUHG WR FOHDYDJH RI WKH SDUHQWDO FORQH (QGR 5 FOHDYDJH RI PXWDQW $$9 FORQHV LQ ZKLFK WKH $$9YHFWRU MXQFWLRQV KDG EHHQ VHTXHQFHG DLGHG LQ WKH LGHQWLILFDWLRQ RI D

PAGE 135

UHFRJQLWLRQ VLJQDO IRU WKH HQ]\PH 7KH FRQFOXVLRQ IURP WKHVH H[SHULPHQWV ZDV WKDW HQGR 5 UHFRJQL]HG SRO\SXULQHSRO\S\ULPLGLQH VHTXHQFHV ULFK LQ *& EDVH SDLUV 7KLV ZDV YHULILHG IXUWKHU E\ WKH LGHQWLILFDWLRQ RI PLQRU IUDJPHQWV SURGXFHG IURP FOHDYDJH ZLWKLQ LQWHUQDO $$9 VHTXHQFHV $ FRPSXWHU VHDUFK XVLQJ D FRQVHQVXV VHTXHQFH GHULYHG IURP WKHVH H[SHULPHQWV UHOLDEO\ SUHGLFWHG WKH SUHVHQFH RI PRVW RI WKH IUDJPHQWV REVHUYHG IURP HQGR 5 FOHDYDJH RI WKH $$9 VXEVWUDWHV ,V (QGR 5 UHVSRQVLEOH IRU WKH 5HVFXH RI $$9 6HTXHQFHV ,Q 9LYR :KHQ $$9 SODVPLGV DUH WUDQVIHFWHG LQWR KXPDQ FHOOV PRVW RI WKH LQSXW SODVPLG '1$ LV FRQYHUWHG WR UHOD[HG FLUFXODU DQG OLQHDU SODVPLG '1$ 7KLV LV WUXH UHJDUGOHVV RI ZKHWKHU WKH SODVPLG FRQWDLQV DQ $$9 JHQRPH FDSDEOH RI DXWRQRPRXV UHSOLFDWLRQ +HUPRQDW HW DO 6DPXOVNL HW DO /DXJKOLQ HW DO f RU ZKHWKHU WKH WUDQVIHFWLRQ LV GRQH LQ WKH SUHVHQFH RI K\GUR[\XUHD 'LJHVWLRQ RI WKH UHFRYHUHG LQSXW '1$ ZLWK UHVWULFWLRQ HQ]\PHV LQGLFDWHV WKDW D ODUJH IUDFWLRQ RI WKH LQSXW '1$ KDV EHHQ FOHDYHG DW RQH RU WKH RWKHU $$9 MXQFWLRQ ZLWK YHFWRU '1$ $GGLWLRQDO IUDJPHQWV VHHQ LQ YLYR VXJJHVW WKDW VSHFLILF FOHDYDJH DOVR RFFXUV DW WKH LQERDUG FRSLHV RI WKH $$9 WHUPLQXV WKH VHTXHQFH &&D&7&&&7&7&7f DQG DW DQ LQWHUQDO VHTXHQFH WR SURGXFH IUDJPHQWV RI DQG NE 7KLV PHDQV WKDW VSHFLILF $$9 VHTXHQFHV DUH VXEVWUDWHV IRU D KRVWHQFRGHG HQGRQXFOHDVH DFWLYLW\ DQG WKDW WKLV DFWLYLW\ GRHV QRW UHTXLUH '1$ UHSOLFDWLRQ $OO RI WKHVH LQ YLYR REVHUYDWLRQV DUH FRQVLVWHQW ZLWK WKH SURSHUWLHV RI HQGR 5 LQ YLWUR ,Q DGGLWLRQ FOHDYDJH E\ HQGR 5 RFFXUV LQ D UHJLRQ LQ $$9 VXEVWUDWHV WKDW LV FRQVLVWHQW ZLWK ZKDW LV SUHGLFWHG E\ WKH PRGHO IRU $$9 '1$ UHSOLFDWLRQ 7KLV LV VXSSRUWHG E\ WKH REVHUYDWLRQ WKDW HQGR 5 SURGXFWV

PAGE 136

ZHUH VXEVWUDWHV IRU '1$ UHSOLFDWLRQ LQ YLYR DQG LQ YLWUR +RZHYHU ZLWKRXW WKH EHQHILW RI D FHOOXODU PXWDWLRQ LQ HQGR 5 LW FDQ QRW EH FRQFOXGHG WKDW WKLV DFWLYLW\ LV UHTXLUHG IRU $$9 UHVFXH ,I HQGR 5 UHSUHVHQWV D PDMRU SDWKZD\ IRU $$9 UHVFXH WKHQ H[FLVLRQ RI $$9 VHTXHQFHV E\ HQGR 5 PXVW H[SODLQ QRW RQO\ KRZ ZLOG W\SH $$9 VHTXHQFHV DUH UHVFXHG EXW DOVR KRZ PXWDQWV ZKLFK FRQWDLQ WHUPLQDO GHOHWLRQV DUH UHVFXHG ,Q YLHZ RI WKH VHTXHQFH VSHFLILFLW\ RI HQGR 5 WKH IROORZLQJ PRGHO FDQ EH RIIHUHG IRU UHVFXH RI ZLOG W\SH DQG PXWDQW VHTXHQFHV )LJXUH f 1RUPDO $$9 UHVFXH RFFXUV E\ HQGR 5 FOHDYDJH DW WKH WZR RXWERDUG $$9 UHFRJQLWLRQ VLWHV WR GLUHFWO\ SURGXFH DQ $$9 UHSOLFDWLYH LQWHUPHGLDWH 7KLV FDQ RFFXU ZKHQ WKH ZLOG W\SH SODVPLGV S60 RU S$9O DUH WUDQVIHFWHG LQWR PDPPDOLDQ FHOOV &OHDYDJH FRXOG EH GLUHFWHG WRZDUG WKH RXWERDUG VLWHV E\ WDQGHP FRSLHV RI WKH $$9 WHUPLQDO VHTXHQFHV EHWZHHQ LQWHJUDWHG SURYLUXV RU LI $$9 LQWHJUDWHV LQWR WKH KRVW JHQRPH LQ D UHJLRQ ULFK LQ *& EDVH SDLUV ,Q VRPH PROHFXOHV FOHDYDJH FDQ RFFXU DW DQ RXWERDUG VLWH LQ RQH HQG DQG RQO\ DW DQ LQERDUG VLWH DW WKH RWKHU HQG S60 S60f 7KHVH PROHFXOHV FDQ JHQHUDWH DQ $$9 UHSOLFDWLYH LQWHUPHGLDWH E\ VXEVHTXHQW FRUUHFWLRQ RI WKH PLVVLQJ RUL VHTXHQFH 6DPXOVNL HW DO f +RZHYHU PROHFXOHV WKDW KDYH EHHQ FOHDYHG DW ERWK LQERDUG HQGR 5 VLWHV DUH RUL DQG LQFDSDEOH RI '1$ UHSOLFDWLRQ 6XFK PROHFXOHV ZRXOG KDYH WR UHFRPELQH ZLWK XQFOHDYHG LQSXW SODVPLG PROHFXOHV WR UHFRYHU D IXQFWLRQDO RULJLQ VHTXHQFH $ SUHGLFWLRQ RI WKLV PRGHO LV WKDW WKH GHOHWLRQ RI WKH WHUPLQDO ES RI $$9 IURP ERWK HQGV LH GHOHWLRQ RI ERWK RXWERDUG UHFRJQLWLRQ VLWHVf VKRXOG VLJQLILFDQWO\ UHGXFH WKH LQIHFWLYLW\ RI $$9 SODVPLGV 7KLV LV LQ IDFW FRQVLVWHQW ZLWK WKH EHKDYLRU RI DQ $$9 PXWDQW SODVPLG SVXEf UHFHQWO\ UHSRUWHG E\ 6DPXOVNL HW DO f LQ ZKLFK WKH

PAGE 137

)LJXUH 0RGHO IRU WKH ([FLVLRQ RI $$9 '1$ IURP 5HFRPELQDQW 3ODVPLGV 6ROLG OLQH LQGLFDWHV LQWHUQDO $$9 VHTXHQFHV GRWWHG OLQH LQGLFDWHV IODQNLQJ SODVPLG VHTXHQFHV RSHQ ER[HV LQGLFDWH WKH $$9 RULJLQV ZKLFK FRQVLVW RI WKH WHUPLQDO ES SDOLQGURPLF UHSHDWV 9HUWLFDO OLQHV DQG DUURZV LQGLFDWH WKH LQERDUG DQG RXWERDUG $$9 UHFRJQLWLRQ VHTXHQFHV DQG HQGR 5 FOHDYDJH VLWHV

PAGE 138

L f L L 2 (QGR 5 f§ f§F I RUL f§ U RUL RU f

PAGE 139

ILUVW ES IURP DUH PLVVLQJ ERWK HQGV :LWK WKLV SODVPLG '1$ UHSOLFDWLRQ LV IROG PRUH HIILFLHQW LI WKH $$9 VHTXHQFHV DUH FOHDYHG DZD\ IURP WKH YHFWRU VHTXHQFHV EHIRUH WUDQVIHFWLRQ LQWR $GLQIHFWHG FHOOV 7KH IUHTXHQF\ RI HQGR 5 H[FLVLRQ RI $$9 SODVPLGV LV DOVR FRQVLVWHQW ZLWK ZKDW LV VHHQ LQ YLYR %DVHG RQ WKH REVHUYHG IUHTXHQF\ RI FOHDYDJH LQ YLWUR LW ZRXOG EH H[SHFWHG WKDW RQO\ b RI WKH LQSXW S60 PROHFXOHV ZRXOG EH FXW DW ERWK MXQFWLRQV WR SURGXFH RUL $$9 GXSOH[ '1$ ,Q D W\SLFDO WUDQVIHFWLRQ H[SHULPHQW QJ RI SODVPLG '1$ SHU FP GLVKf DQ HVWLPDWHG H[FLVLRQ IUHTXHQF\ RI b ZRXOG SURGXFH $$9 GXSOH[ '1$ PROHFXOHV LQ HDFK WUDQVIHFWHG FHOO 6HH &KDSWHU ,, IRU WKH FDOFXODWLRQf 7KLV LV DSSUR[LPDWHO\ WKH OLPLW RI GHWHFWLRQ LQ PRVW WUDQVIHFWLRQ H[SHULPHQWV +RZHYHU LI WKLV IUHTXHQF\ LV FRUUHFW WKHQ WKHUH VKRXOG EH D OLQHDU UHODWLRQVKLS EHWZHHQ WKH \LHOG RI UHSOLFDWLYH IRUP '1$ SURGXFHG LQ WUDQVIHFWHG FHOOV DQG WKH DPRXQW RI LQSXW SODVPLG '1$ XVHG LQ WKH WUDQVIHFWLRQ ,Q DJUHHPHQW ZLWK WKLV 6DPXOVNL HW DO f KDYH VKRZQ WKDW WKH \LHOG RI $$9 '1$ LV OLQHDU ZLWK WKH DPRXQW RI LQSXW '1$ LQ WKH UDQJH EHWZHHQ DQG MJ RI SODVPLG '1$ SHU FP GLVK ,Q XVLQJ WKH UHFRPELQDQW SODVPLGV DV VXEVWUDWHV IRU LQ YLWUR H[FLVLRQ LW ZDV DVVXPHG WKDW WKHVH SODVPLGV ZHUH PRGHOV IRU $$9 SURYLUXVHV LQWHJUDWHG LQWR FKURPDWLQ 7\SLFDOO\ D FHOO OLQH FDUU\LQJ $$9 SURYLUXVHV FRQWDLQV WDQGHP FRSLHV RI WKH $$9 JHQRPH &KHXQJ HW DO /DXJKOLQ HW DO 0F/DXJKOLQ HW DO f 7KH MXQFWLRQ RI WZR WDQGHP $$9 FRSLHV ZRXOG FRQWDLQ HLWKHU D VLQJOH FRS\ RI WKH VHTXHQFH JJ&&D&7&&&7&7&7 RU WZR FRSLHV RI WKH VDPH VHTXHQFH LQ DQ LQYHUWHG RULHQWDWLRQ SURGXFLQJ WKH SDOLQGURPLF VHTXHQFH

PAGE 140

DJDJDJJJDJ7JJ&&JJ&&D&7&&&7&7&7 3ODVPLGV FRQWDLQLQJ D VLQJOH S*0f RU D GRXEOH LQYHUWHG FRS\ S*0f RI WKLV VHTXHQFH ZHUH FOHDYHG E\ HQGR 5 DQG WKH FORQH FRQWDLQLQJ WZR FRSLHV RI WKH $$9 UHFRJQLWLRQ VLJQDO ZDV FOHDYHG DSSUR[LPDWHO\ IROG PRUH HIILFLHQWO\ 7KLV VHTXHQFH ZKLFK LV DFWXDOO\ D VWUHWFK RI SRO\SXULQH UHVLGXHV IROORZHG E\ D SRO\S\ULPLGLQH VWUHWFK LV DOVR D GHULYDWLYH RI WKH VHTXHQFH DW WKH MXQFWLRQ RI S%5 DQG $$9 LQ S60 JQ&&D&7&&&7&7&7f DQG WKLV VXEVWUDWH LV FOHDYHG DW KLJK IUHTXHQF\ 7KLV W\SH RI UHFRJQLWLRQ VHTXHQFH FRXOG EH JHQHUDWHG LI $$9 LQWHJUDWHG LQWR D *& ULFK UHJLRQ LQ WKH KRVW '1$ 4XDOLWDWLYHO\ KRZHYHU WKHUH PXVW EH DW OHDVW WZR PDMRU GLIIHUHQFHV EHWZHHQ UHVFXH IURP FKURPDWLQ DQG UHVFXH IURP UHFRPELQDQW R SODVPLGV )LUVW ZKHUHDV DSSUR[LPDWHO\ &) PROHFXOHV RI $$9 SODVPLG '1$ DUH UHTXLUHG SHU FHOO WR VHH PD[LPXP SURGXFWLRQ RI $$9 YLULRQV LQ D WUDQVIHFWLRQ H[SHULPHQW HQGRJHQRXV $$9 SURYLUXVHV DUH XVXDOO\ SUHVHQW DW OHVV WKDQ FRSLHV SHU FHOO 7KHUH DSSHDUV WR EH WKHQ DW OHDVW RUGHUV RI PDJQLWXGH GLIIHUHQFH EHWZHHQ H[FLVLRQ IUHTXHQFLHV IURP FKURPDWLQ DQG QDNHG '1$ 7KLV PD\ UHIOHFW WKH SUHVHQFH RI DGGLWLRQDO FRPSRQHQWV UHTXLUHG IRU H[FLVLRQ IURP FKURPDWLQ ,Q WKLV UHJDUG LW LV ZRUWK QRWLQJ WKDW WKH HIILFLHQF\ RI FOHDYDJH DW WKH ULJKW $$9YHFWRU MXQFWLRQ LQ S$9O ZDV VLJQLILFDQWO\ EHWWHU LQ FUXGH H[WUDFWV QRW VKRZQf WKDQ ZLWK SXULILHG HQ]\PH SUHSDUDWLRQV )LJXUH f 2QH SRVVLEOH H[SODQDWLRQ IRU WKLV REVHUYDWLRQ LV WKDW DFFHVVRU\ SURWHLQV PD\ KDYH EHHQ ORVW GXULQJ WKH SXULILFDWLRQ $ VHFRQG LVVXH LV WKH DSSDUHQW VWDELOLW\ RI $$9 SURYLUXVHV LQ WKH DEVHQFH RI KHOSHU YLUXV &KHXQJ HW DO f $OWKRXJK H[WUDFKURPRVRPDO FRSLHV RI $$9 DUH RFFDVLRQDOO\ JHQHUDWHG GXULQJ SDVVDJH

PAGE 141

RI ODWHQWO\ LQIHFWHG FHOOV PRVW SURYLUDO FRSLHV DUH VWDEOH LQGHILQLWHO\ XQOHVV WKH FHOO LV VXSHULQIHFWHG ZLWK KHOSHU YLUXV &KHXQJ HW DO 0F/DXJKOLQ HW DO f 7KXV $$9 SURYLUDO WHUPLQL DUH QRW XVXDOO\ D WDUJHW IRU HQGR 5 3RVVLEOH H[SODQDWLRQV IRU WKLV DUH WKDW HLWKHU WKH WHUPLQL DUH LQDFFHVVLEOH GXH WR WKH VHFRQGDU\ VWUXFWXUH RI FKURPDWLQ RU WKDW HQGR 5 DFWLYLW\ LV WLJKWO\ UHJXODWHG LQ WKH FHOO ,Q WKLV UHJDUG /DUVHQ DQG :HLQWUDXE f KDYH VKRZQ WKDW WKH 6, VHQVLWLYLW\ RI KRPRSXULQHKRPRS\ULPLGLQH VHTXHQFHV XSVWUHDP RI WKH FKLFNHQ EHWD $ JORELQ JHQH LQ FKURPDWLQ GHSHQGV RQ ZKHWKHU RU QRW WKH FKURPDWLQ ZDV LVRODWHG IURP FHOOV WKDW ZHUH DFWLYHO\ H[SUHVVLQJ WKH JORELQ JHQH 7KXV WKH LQLWLDWLRQ RI $$9 UHVFXH E\ DGHQRYLUXV VXSHULQIHFWLRQ PD\ EH GXH WR WKH DFWLYDWLRQ RI $$9 JHQH H[SUHVVLRQ E\ DGHQRYLUXV JHQH SURGXFWV /DXJKOLQ HW DO 5LFKDUGVRQ DQG :HVWSKDO f (Q]\PH 5HFRJQLWLRQ ,Q JHQHUDO WKH OHYHO RI FXWWLQJ E\ HQGR 5 GHSHQGV RQ WKH OHQJWK RI WKH UHFRJQLWLRQ VHTXHQFH DQG WKH DPRXQW RI VXEVWLWXWLRQV LQ WKH RU &f VWUDQG LQ D JLYHQ OHQJWK 3ODVPLGV WKDW FRQWDLQ KRPRSRO\PHULF VWUHWFKHV RI SRO\G*fSRO\G&f DUH WKH LGHDO VXEVWUDWHV IRU HQGR 5 (QGR 5 FOHDYDJH H[SHULPHQWV XVLQJ FORQHV WKDW FRQWDLQHG VWUHWFKHV RI SRO\G*f RI YDU\LQJ OHQJWK LQGLFDWHG WKDW D PLQLPXP RI EDVHV RI UHVLGXHV ZHUH UHTXLUHG IRU FOHDYDJH DQG WKDW WKH IUHTXHQF\ RI FOHDYDJH LQFUHDVHG LQ GLUHFW SURSRUWLRQ WR WKH OHQJWK RI WKH KRPRSRO\PHULF FKDLQ WR D PD[LPXP RI DSSUR[LPDWHO\ EDVH SDLUV 6XEVWLWXWLRQV RU YDULDWLRQV LQ WKH LGHDO VHTXHQFH UHGXFHG WKH OHYHO RI FOHDYDJH ZKHUH WKH RYHUDOO IUHTXHQF\ GHSHQGHG RQ WKH OHQJWK RI WKH UHFRJQLWLRQ VHTXHQFH

PAGE 142

DQG WKH DPRXQW RI VXEVWLWXWLRQ 7DEOH ,9f )RU H[DPSOH VXEVWUDWHV WKDW FRQWDLQHG WKH DOWHUQDWLQJ FRSRO\PHU SRO\*$fJ b *& EDVH SDLUVf ZHUH FOHDYHG DW b RI WKH OHYHO REVHUYHG LQ VXEVWUDWHV FRQWDLQLQJ ES RI SRO\G*fSRO\G&f 7KLV UHIOHFWHG WKH HIIHFW RI VXEVWLWXWLRQ RI UHVLGXHV ZLWK $ UHVLGXHV ,Q DGGLWLRQ WKH OHYHO RI FOHDYDJH VHHQ ZLWK SODVPLGV FRQWDLQLQJ SRO\*$fJJ ZDV PRUH WKDQ IROG JUHDWHU WKDQ WKH OHYHO RI FOHDYDJH REVHUYHG ZLWK VXEVWUDWHV WKDW FRQWDLQHG UHSHDWV RI WKH VDPH DOWHUQDWLQJ FRSRO\PHU SRO\*$fAf LQGLFDWLQJ WKDW WKH OHQJWK RI WKH VXEVWLWXWHG SRO\PHU DOVR DIIHFWHG WKH OHYHO RI FOHDYDJH 0RUHRYHU WKH KRPRSRO\PHU SRO\G$fJJSRO\G7fJJ ZDV QRW D VXEVWUDWH IRU HQGR 5 QRW VKRZQf 7KHVH UHVXOWV VXJJHVWHG WKDW WKH IUHTXHQF\ RI FOHDYDJH GHSHQGHG RQ WKH OHQJWK RI WKH UHFRJQLWLRQ VLJQDO DQG WKH SHUFHQWDJH RI *& EDVH SDLUV LQ WKLV VHTXHQFH 7KH W\SH RI VXEVWLWXWLRQ LQ WKH *& SRO\PHU ZDV DOVR LPSRUWDQW 6XEVWLWXWLRQ RI UHVLGXHV ZLWK $ ZDV WROHUDWHG EXW UHVXOWHG LQ VLJQLILFDQWO\ ORZHU FOHDYDJH IUHTXHQFLHV +RZHYHU VXEVWLWXWLRQV RI ZLWK & UHVLGXHV LQ WKH DOWHUQDWLQJ FRSRO\PHU SRO\L*&AJ FRPSOHWHO\ LQKLELWHG GRXEOHVWUDQGHG FOHDYDJH S*0 7DEOH ,9f 2Q WKH VXUIDFH WKLV PD\ VHHP WR LQGLFDWH WKDW D WUDQVLWLRQ EHWZHHQ SXULQHV DQG EHWZHHQ S\ULPLGLQHV ZDV DOORZHG ZKLOH VXEVWLWXWLRQV RI S\ULPLGLQHV IRU SXULQHV DQG SXULQHV IRU S\ULPLGLQHV ZDV QRW +RZHYHU WKH FRPSDULVRQ RI WKH OHYHO RI FOHDYDJH EHWZHHQ FORQHV WKDW FRQWDLQHG PL[HG SXULQH DQG S\UPLGLQH UHFRJQLWLRQ VLJQDOV ZLWK WKRVH WKDW ZHUH KRPRSXULQLF LQGLFDWHG WKDW WKLV ZDV QRW WKH FDVH 6XEVWUDWHV WKDW FRQWDLQHG WKH 'LFW\RVWHOLXP WHORPHULF VHTXHQFH eA f ZKLFK LV D SRO\S\ULPLGLQHSRO\SXULQH FKDLQ b &f RU WKH 7HWUDK\PHQD WHORPHULF VHTXHQFH &AAf` LQ ZKLFK SXULQHV DUH PL[HG ZLWK S\ULPLGLQHV b &f ZHUH FOHDYHG DW

PAGE 143

DSSUR[LPDWHO\ WKH VDPH IUHTXHQF\ 7DEOH ,9f FRUUHVSRQGLQJ WR DERXW b RI WKH OHYHO REVHUYHG ZLWK WKH SDUHQWDO SRO\LG*fA FORQH ,Q DGGLWLRQ WKH $$9 UHFRJQLWLRQ VHTXHQFH &&D&7&&&7&7&7f ZKLFK FRQWDLQV & UHVLGXHV LQ D EDVH S\ULPLGLQHULFK VHTXHQFH b &f ZDV FOHDYHG DW b RI WKH OHYHO REVHUYHG ZLWK WKH SRO\LG*fA FORQH 7KXV WKH OHQJWK RI WKH UHFRJQLWLRQ VHTXHQFH DQG WKH GHJUHH RI GHYLDWLRQ IURP WKH LGHDO SRO\G*fSRO\G&f VHTXHQFH ZHUH PDMRU FRQVLGHUDWLRQV IRU WKH OHYHO RI FOHDYDJH DFWLYLW\ +RZHYHU WKH W\SH RI EDVH VXEVWLWXWLRQ ZDV DOVR LPSRUWDQW LQ FHUWDLQ FDVHV 7KLV ZDV HVSHFLDOO\ WUXH LQ FOHDYDJH DVVD\V ZLWK WKH DOWHUQDWLQJ FRSRO\PHU *&AT ZKLFK FDQ H[LVW LQ D OHIW KDQGHG ='1$ FRQILJXUDWLRQ 3HFN DQG :DQJ 6LQJOHWRQ HW DO f DQG ZDV QRW FOHDYHG E\ HQGR 5 7KHVH UHVXOWV VXJJHVWHG WKDW HQGR 5 FOHDYDJH IUHTXHQFLHV FRXOG EH EHWWHU H[SODLQHG LQ WKH FRQWH[W RI WKH VWUXFWXUDO SURSHUWLHV RI WKH UHFRJQLWLRQ VLJQDO UDWKHU WKDQ VWULFWO\ RQ D VHTXHQFH EDVLV (YLGHQFH IURP QXFOHDVH GLJHVWLRQ H[SHULPHQWV 'UHZ &DQWRU DQG (IVWUDGLDWLV 'UHZ DQG 7UDYHUV 3XOOH\EODQN HW DO (YDQV HW DO f LQGLFDWH WKDW GXSOH[ FKDLQV RI SRO\G*fSRO\G&f H[KLELW D QRQ% QRQ= '1$ FRQIRUPDWLRQ ZKLFK LV VLPLODU EXW QRW LGHQWLFDO WR $W\SH '1$ $UQRWW HW DO f 7KH FRQIRUPDWLRQ RI WKHVH SRO\PHUV LQ VROXWLRQ DUH FKDUDFWHUL]HG E\ D ZLGH DQG VKDOORZ PLQRU JURRYH DQG D GHHS DQG FDYHUQRXV K\GUDWHG PDMRU JURRYH 0F&DOO HW DO f 7KH ORQJHU KHOLFDO UHSHDW RI DSSUR[LPDWHO\ EDVHV DQG WKH ODUJHU KHOLFDO UDGLXV DUH PRUH W\SLFDO RI GRXEOHVWUDQGHG 51$ WKDQ %'1$ %UDP f 8QGHU WRUVLRQDO VWUHVV RU ZKHQ IODQNHG E\ %'1$ WKHVH VHTXHQFHV DUH OLNHO\ WR H[LVW LQ D ODGGHUOLNH VWUXFWXUH UHVXOWLQJ IURP WKH VWDFNLQJ RI WKH JXDQRVLQH EDVHV ZKLOH WKH &VWUDQG

PAGE 144

SDVVLYHO\ VZLYHOV DURXQG WKH VWDFNHG *VWUDQG 0F&DOO HW DO f ,Q DGGLWLRQ WKH n IODQNLQJ UHJLRQ RI WKH SRO\G*f VWUDQG VHHPHG WR H[LVW LQ DQ XQSDLUHG FRQIRUPDWLRQ LQ WRUVLRQDOO\ VWUHVV PROHFXOHV .RKZL 6KLJHPDWVX HW DO f 7KH FOHDYDJH EHKDYLRU RI HQGR 5 ZLWK WKH YDULRXV ROLJRPHU VXEVWUDWHV FDQ EH EHWWHU H[SODLQHG LQ WKH FRQWH[W RI WKHVH VWUXFWXUDO REVHUYDWLRQV 7KHVH REVHUYDWLRQV VXJJHVW WKDW WKH LPSRUWDQFH RI WKH VHTXHQFH DW WKH VLWH RI UHFRJQLWLRQ PD\ EH VHFRQGDU\ WR WKDW RI '1$ FRQIRUPDWLRQ 7KLV ZRXOG H[SODLQ ZK\ KRPRSRO\PHUV RI SRO\G*f DUH WKH LGHDO VXEVWUDWHV DQG ZK\ FHUWDLQ YDULDWLRQV RI WKLV VHTXHQFH DUH WROHUDWHG ZKLOH RWKHUV DUH QRW 9DULDWLRQV LQ WKH UHFRJQLWLRQ VHTXHQFH UHVXOW LQ WKH GLVUXSWLRQ RI JXDQRVLQH VWDFNLQJ RQ WKH *VWUDQG WR GLIIHUHQW GHJUHHV 'XSOH[ PROHFXOHV FRQWDLQLQJ WKH DOWHUQDWLQJ FRSRO\PHU *$f PDLQWDLQ WKH XQXVXDO VWDFNLQJ FRQIRUPDWLRQ RI KRPRSRO\PHULF *& FKDLQV WR D OHVVRU GHJUHH WKURXJK SXULQHSXULQH VWDFNLQJ (YDQV HW DO f ,Q FRQWUDVW LQ VXEVWUDWHV FRQWDLQLQJ DOWHUQDWLQJ *& UHVLGXHV WKH VHFRQGDU\ VWUXFWXUH FKDUDFWHULVWLF RI SRO\*f VHHPV WR KDYH EHHQ GLVUXSWHG E\ WKH &UHVLGXHV DQG XQGHU FHUWDLQ VDOW FRQGLWLRQV WKH *& FRSRO\PHU PD\ H[LVW LQ D OHIWKDQGHG = '1$ FRQIRUPDWLRQ 3HFN DQG :DQJ 6LQJOHWRQ HW DO f WKDW GLIIHUV PDUNHGO\ IURP WKH VWUXFWXUH RI SRO\G*fSRO\G&f 7KHVH REVHUYDWLRQV LQGLFDWH WKDW WKH PL[LQJ RI SXULQH DQG S\ULPLGLQH UHVLGXHV LQ WKH UHFRJQLWLRQ VHTXHQFH LV QRW DV LPSRUWDQW DV WKH PDLQWHQDQFH RI WKH SRO\G*f FRQIRUPDWLRQ 7KLV ZRXOG H[SODLQ ZK\ WKH WHORPHULF VHTXHQFHV Af DQG AA f ZHUH FOHDYHG DW DSSUR[LPDWHO\ WKH VDPH IUHTXHQF\ %RWK VHTXHQFHV SUHVXPDEO\ PDLQWDLQ HQRXJK RI WKH SRO\G*f VWUXFWXUH ZLWK ORQJ LQWHUUXSWHG VWUHWFKHV RI *& EDVH SDLUV DQG

PAGE 145

QHLWKHU FRQWDLQ ORQJ VWUHWFKHV RI DOWHUQDWLQJ *& UHVLGXHV ZKLFK FRXOG GLVUXSW WKLV FRQIRUPDWLRQ ,Q VXPPDU\ HQGR 5 VHHPV WR UHFRJQL]H DQ DOWHUQDWH '1$ VWUXFWXUH FKDUDFWHULVWLF RI KRPRSRO\PHUV FRQWDLQLQJ SRO\G*fSRO\G&f 7KH OHQJWK DQG YDULDWLRQ RI WKLV VHTXHQFH LV LPSRUWDQW RQO\ LQ WKH FRQWH[W RI KRZ LW DIIHFWV WKH '1$ VHFRQGDU\ VWUXFWXUH 7KH VXEVWLWXWLRQ RI ZLWK $ RU 7 UHVLGXHV SUHVXPDEO\ UHVXOWV LQ WKH JUDGXDO GLVUXSWLRQ RI WKLV DOWHUHG FRQIRUPDWLRQ ZKLOH WKH LQWURGXFWLRQ RI DOWHUQDWLQJ *& UHVLGXHV FKDQJHV WKH '1$ VHFRQGDU\ VWUXFWXUH WR D IRUP QRW UHFRJQL]HG E\ HQGR 5 7KH DQDO\VLV RI HQGR 5 FOHDYDJH VLWHV DW WKH VHTXHQFH OHYHO VXSSRUWHG WKH YLHZ WKDW HQ]\PH UHFRJQLWLRQ ZDV WKH UHVXOW RI VHFRQGDU\ VWUXFWXUH LQ WKH '1$ PROHFXOH :KLOH WKH IUHTXHQF\ RI FOHDYDJH ZDV VKRZQ WR EH GLUHFWO\ SURSRUWLRQDO WR WKH OHQJWK DQG *& EDVH SDLU FRQWHQW RI WKH UHFRJQLWLRQ VLJQDO WKH FOHDYDJH VLWHV ZHUH GLVWULEXWHG IRU WKH PRVW SDUW LQ D SDWWHUQ WKDW ZDV PRUH FRQVLVWHQW ZLWK VWUXFWXUDO GLIIHUHQFHV EHWZHHQ WKH YDULRXV LQVHUWV WKDQ ZLWK WKH LQVHUW VHTXHQFH :LWK VXEVWUDWHV WKDW FRQWDLQHG D KLJK SHUFHQWDJH RI *& EDVH SDLUV S*0 S*0 S*0 S*0 )LJXUH f FOHDYDJH RFFXUUHG EHWZHHQ HYHU\ EDVH RI WKH LQVHUW SUHVXPDEO\ EHFDXVH PLQRU VXEVWLWXWLRQV RI UHVLGXHV GLG QRW FDXVH D VLJQLILFDQW DOWHUDWLRQ RI WKH VHFRQGDU\ VWUXFWXUH ,Q PRUH KLJKO\ VXEVWLWXWHG LQVHUWV S*0 S*$ S*$OO S*0f WKH FOHDYDJH SDWWHUQ DSSDUHQWO\ UHIOHFWHG DOWHUDWLRQV RI WKH *& FRQIRUPDWLRQ UHVXOWLQJ LQ D PRUH VSHFLILF RU SHULRGLF DUUD\ RI FOHDYDJH VLWHV )RU H[DPSOH FOHDYDJH RI WKH VHTXHQFH Af RFFXUUHG DW UHJXODU LQWHUYDOV RQ ERWK VWUDQGV LPPHGLDWHO\ n WR WKH 7 UHVLGXHV RQ WKH *7 VWUDQG S*0 )LJXUH & )LJXUH f 7KLV VXJJHVWHG WKDW WKH SRO\G*f VWUXFWXUH ZDV ORFDOO\ GLVUXSWHG E\ WKH LQVHUWLRQ RI

PAGE 146

WZR 7 UHVLGXHV ZKLOH WKH RYHUDOO FRQIRUPDWLRQ RI WKH LQVHUW ZDV XQFKDQJHG 7KHUHIRUH HQGR 5 VHHPHG WR KDYH WKH DELOLW\ WR UHFRJQL]H WKH VHFRQGDU\ VWUXFWXUH RI WKH HQWLUH LQVHUW LQ VSLWH RI ORFDO GLVUXSWLRQV VLQFH QRQH RI WKH XQLQWHUUXSWHG VWUHWFKHV RI SRO\G*f LQ S*0 ZHUH ORQJ HQRXJK WR EH HQGR 5 UHFRJQLWLRQ VLWHV E\ WKHPVHOYHV 7KLV HIIHFW ZDV HYHQ PRUH SURQRXQFHG LQ WKH DOWHUQDWLQJ SRO\*$f FORQHV S*$ S*$OO )LJXUH % )LJXUH f ZKHUH FOHDYDJH RFFXUUHG DW HYHU\ RWKHU EDVH LQ WKH UHFRJQLWLRQ VHTXHQFH n WR HYHU\ $ UHVLGXH DQG & UHVLGXHf 7KLV FOHDYDJH SDWWHUQ SUHVXPDEO\ UHIOHFWHG ORFDO SHUWXUEDWLRQV LQ JXDQRVLQH EDVH VWDFNLQJ ZKLOH SXULQH EDVH LQWHUDFWLRQV PDLQWDLQHG DQ DOWHUQDWH '1$ VWUXFWXUH LQ WKH LQVHUW WKDW ZDV VWLOO UHFRJQL]HG E\ HQGR 5 7KH DELOLW\ RI HQGR 5 WR UHFRJQL]H WKH VHFRQGDU\ VWUXFWXUH DV D ZKROH PD\ H[SODLQ ZK\ WKH VWURQJHU FOHDYDJH VLWHV LQ WKH *$ VWUDQG RI S*$OO DQG S*$ )LJXUH f RFFXUUHG DW WKH HQGV RI WKH LQVHUW 7KH FOHDYDJH SDWWHUQ REVHUYHG LQ S*0 ZKLFK FRQWDLQV D VLQJOH FRS\ RI WKH $$9 UHFRJQLWLRQ VHTXHQFH )LJXUH )LJXUH f FDQ DOVR EH H[SODLQHG LQ WHUPV RI WKH VHFRQGDU\ VWUXFWXUH RI WKH LQVHUW ,Q WKLV FORQH FOHDYDJH RFFXUUHG DW D ORZ IUHTXHQF\ DQG ZDV FRQILQHG WR D VPDOO UHJLRQ ULFK LQ UHVLGXHV 7KH VKRUW OHQJWK DQG UHODWLYHO\ KLJK VXEVWLWXWLRQ RI UHVLGXHV LQ WKLV UHJLRQ DSSDUHQWO\ SURGXFHG D VHFRQGDU\ VWUXFWXUH WKDW ZDV RQO\ PDUJLQDOO\ UHFRJQL]HG E\ HQGR 5 6HTXHQFH DQDO\VLV RI WKH HQGR 5 FXW VLWHV LQGLFDWHG WKDW FOHDYDJH RFFXUUHG WKURXJKRXW WKH UHJLRQV ULFK LQ *& EDVH SDLUV +RZHYHU WKH SDWWHUQ RI FXWWLQJ LQ WKH *ULFK RU &ULFK VWUDQGV ZDV QRW LGHQWLFDO DQG VXJJHVWHG WKDW HQGR 5 FOHDYDJH RI WKH VXEVWUDWH PD\ RFFXU WKURXJK D VHULHV RI FRQFHUWHG VLQJOHVWUDQGHG QLFNV RQ RSSRVLWH VWUDQGV UDWKHU WKDQ E\ GRXEOHVWUDQGHG FOHDYDJH 7KLV ZDV VXSSRUWHG E\ WKH UHVXOWV

PAGE 147

IURP HQGR 5 WLPH FRXUVH H[SHULPHQWV ZKLFK LQGLFDWHG WKDW WKH VSHFLILFDOO\ FOHDYHG IUDJPHQWV ZHUH WKH SURGXFW RI GRXEOHVWUDQGHG EUHDNV ZKLOH VLWH VSHFLILF VLQJOHVWUDQGHG QLFNV LQ WKH VXEVWUDWHV ZHUH QRW GHWHFWHG 7DNHQ WRJHWKHU WKHVH REVHUYDWLRQV LPSO\ WKDW WKH HQ]\PH UDSLGO\ SURGXFHV VLQJOHVWUDQGHG EUHDNV RQ ERWK VWUDQGV RI WKH PROHFXOH ZKLFK HYHQWXDOO\ UHVXOW LQ D GRXEOHVWUDQGHG EUHDNV 7KH SDWWHUQ RI FOHDYDJH LQ VHYHUDO RI WKH FORQHV S*0 S*0 S*0 S*0 S*0 DQG S*0 )LJXUH f GHSLFWHG D GLVWULEXWLRQ WKDW ZDV VNHZHG WRZDUG WKH n HQG RI HDFK VWUDQG )LJXUH f 7KLV VXJJHVWHG WKDW D VLJQLILFDQW DPRXQW RI PROHFXOHV PLJKW FRQWDLQ VL]DEOH n SURWUXGLQJ HQGV FRQVLVWLQJ RI &ULFK DQG *ULFK VHTXHQFHV 2YHUKDQJV RI WKLV QDWXUH ZRXOG WHQG WR K\EULGL]H WRJHWKHU DQG LQ HIIHFW UHGXFH WKH DPRXQW RI REVHUYDEOH VSHFLILFDOO\ FOHDYHG SURGXFWV LQ WKH HQGR 5 UHDFWLRQV 7KH H[SHULPHQWDO GDWD KRZHYHU GLG QRW VXSSRUW WKLV FRQFOXVLRQ 3KHQRO H[WUDFWLRQ DQG KHDWLQJ RI WKH UHDFWLRQ SURGXFWV EHIRUH HOHFWURSKRUHVLV GLG QRW LQFUHDVH WKH \LHOG RI VSHFLILFDOO\ FOHDYHG SURGXFW +RZHYHU LQWUDPROHFXODU DJJUHJDWLRQ DQG EDVHSDLULQJ EHWZHHQ JXDQLQH UHVLGXHV LQ VLQJOHVWUDQGHG RYHUKDQJV KDV EHHQ VKRZQ WR EH D WKHUPRG\QDPLF SRVVLELOLW\ +HQGHUVRQ HW DO f ,W LV SRVVLEOH WKHQ WKDW EDVHSDLULQJ EHWZHHQ UHVLGXHV RQ RQH RI WKH n RYHUKDQJV IRUP KDLUSLQ VWUXFWXUHV WKDW ZRXOG SUHYHQW K\EULGL]DWLRQ RI WKH *ULFK DQG &ULFK RYHUKDQJV ,W ZDV DOVR SRVVLEOH WKDW WKH SURGXFWV RI HQGR 5 FOHDYDJH FRQWDLQHG EOXQW HQGV RU VKRUW n RYHUKDQJV WKDW ZHUH QRW OLNHO\ WR K\EULGL]H %\ WKLV PHFKDQLVP HQGR 5 ZRXOG SURGXFH D GRXEOHVWUDQGHG EUHDN LQ HDFK PROHFXOH E\ PDNLQJ VLQJOHVWUDQGHG QLFNV DW RSSRVLQJ SRVLWLRQV LQ HDFK VWUDQG 7KH GLVWULEXWLRQ RI VLWHV WKURXJKRXW WKH

PAGE 148

UHFRJQLWLRQ VHTXHQFH VXJJHVWHG WKDW YHU\ IHZ QLFNV ZHUH PDGH LQ HDFK VWUDQG EHIRUH D GRXEOHVWUDQGHG EUHDN RFFXUUHG 7KH FOHDYDJH SDWWHUQ REVHUYHG LQ WKH FORQHV FRQWDLQLQJ WKH WHORPHULF VHTXHQFH cAf S*0 )LJXUH & )LJXUH f DQG WKH DOWHUQDWLQJ FRSRO\PHU *$fT S*$OO )LJXUH % )LJXUH f VXSSRUW WKLV K\SRWKHVLV &OHDYDJH LQ WKHVH VXEVWUDWHV RFFXUUHG DW UHJXODU LQWHUYDOV DQG DW RSSRVLQJ SRVLWLRQV LQ HDFK VWUDQG &RQWLQXHG FOHDYDJH RU GHJUDGDWLRQ RI HLWKHU VWUDQG LQ D n WR n GLUHFWLRQ ZRXOG DFFRXQW IRU WKH LQFUHDVHG GLVWULEXWLRQ RI FOHDYDJH VLWHV DW WKH n HQG RI WKH LQVHUW MXQFWLRQ REVHUYHG LQ VHYHUDO RI WKH VXEVWUDWHV 7KXV WKH REVHUYHG GLVWULEXWLRQ RI FOHDYDJH VLWHV PD\ UHIOHFW D SRSXODWLRQ RI PROHFXOHV WKDW DUH FOHDYHG D PLQLPXP QXPEHU RI WLPHV DQ\ZKHUH ZLWKLQ WKH UHFRJQLWLRQ VHTXHQFH 'RXEOHVWUDQGHG EUHDNV ZRXOG WKHQ EH WKH UHVXOW RI FRQFHUWHG VLQJOHVWUDQGHG QLFNV LQ RSSRVLQJ SRVLWLRQV RQ HDFK VWUDQG SURGXFLQJ PROHFXOHV ZLWK VKRUW n2+ RYHUKDQJV RU EOXQW HQGV 7KH KLJKHU IUHTXHQF\ RI FOHDYDJH VLWHV DW WKH n HQG RI HDFK VWUDQG PD\ EH H[SODLQHG DV DQ DUWLIDFW RI DGGLWLRQDO FOHDYDJH RU GHJUDGDWLRQ RI WKH FOHDYHG PROHFXOHV 7KH DFWLYLW\ SURILOH RI HQGR 5 LV VWULNLQJO\ VLPLODU WR WKH DFWLYLW\ RI D QXPEHU RI VLQJOHVWUDQGHG '1$ HQGRQXFOHDVHV 7KLV LV HVSHFLDOO\ WUXH RI 6, QXFOHDVH ZKHUH LW VHHPV FOHDU WKDW WKH HQ]\PH DOVR UHFRJQL]HV WKH DOWHUHG VHFRQGDU\ VWUXFWXUH LQ GXSOH[ '1$ FRQVLVWLQJ RI VWUHWFKHV RI SRO\SXULQHSRO\S\ULPLGLQH (YDQV DQG (IVWUDGLDWLV 3XOOH\EODQN HW DO &DQWRU DQG (IVWUDGLDWLV f +RZHYHU LPSRUWDQW GLIIHUHQFHV EHWZHHQ WKHVH DFWLYLWLHV LQGLFDWH WKDW HQGR 5 LV QRW D FODVVLFDO VLQJOHVWUDQGHG QXFOHDVH )LUVW ZKHUHDV HQGR 5 ZLOO FOHDYH VKRUW OLQHDUL]HG SRO\SXULQHSRO\S\ULPLGLQH VHTXHQFHV 6, UHTXLUHV VXSHUFRLOLQJ RI WKHVH VXEVWUDWHV 7KLV SUHVXPDEO\ UHIOHFWV WKH QHHG IRU

PAGE 149

D WRUVLRQDOO\ VWUHVVHG PROHFXOH &DQWRU DQG (IVWUDWLDGLV f DQG PD\ LQGLFDWH WKDW DQ DOWHUHG VWUXFWXUH RI WKH SRO\PHU IODQNLQJ UHJLRQV LV QHFHVVDU\ IRU FOHDYDJH E\ 6, .RKZL6KLJHPDWVX DQG .RKZL f 6HFRQGO\ HQGR 5 VSHFLILFLW\ IRU VLQJOHVWUDQGHG '1$ FRXOG QRW EH GHPRQVWUDWHG E\ DQ\ FODVVLFDO PHDQV LQFOXGLQJ DFLG VROXELOL]DWLRQ RI +(FROL '1$ RU E\ FRPSHWLWLRQ DVVD\V ZLWK VLQJOHVWUDQGHG '1$ (QGR 5 FOHDYDJH RI I!; VLQJOHVWUDQGHG FLUFOHV PD\ EH DWWULEXWHG WR DQ LQWULQVLF DFWLYLW\ RU PD\ EH GXH WR WKH SUHVHQFH RI D FRQWDPLQDWLQJ QXFOHDVH (YLGHQFH IRU D &RQWDPLQDWLQJ 1XFOHDVH 6HYHUDO OLQHV RI HYLGHQFH VXJJHVW WKDW HQGR 5 SUHSDUDWLRQV FRQWDLQ D FRQWDPLQDWLQJ QXFOHDVH RU D VHFRQG DFWLYLW\ SRVVLEO\ DV DQ LQWULQVLF SDUW RI WKH VDPH HQ]\PH )RU H[DPSOH EDFNJURXQG VPHDULQJ LQ WKH VWDQGDUG JHO DVVD\ LQGLFDWHG WKDW WKH VXEVWUDWH ZDV EHLQJ QRQVSHFLILFDOO\ GHJUDGHG 7KLV HIIHFW ZDV REVHUYHG ZLWK HYHQ WKH SXUHVW SUHSDUDWLRQV RI HQGR 5 DQG EHFDPH SURQRXQFHG ZKHQ ODUJH DPRXQWV RI HQ]\PH ZHUH DGGHG RU ZLWK SURORQJHG LQFXEDWLRQ WLPHV ,Q DGGLWLRQ D VLJQLILFDQW DPRXQW WKH VSHFLILFDOO\ FOHDYHG OLQHDU SURGXFWV ZHUH QRW VXEVWUDWHV IRU 7 '1$ OLJDVH DQG FRXOG EH n HQG ODEHOHG ZLWKRXW SULRU WUHDWPHQW ZLWK &,$3 7KLV LQGLFDWHG WKDW WZR W\SHV RI HQGV ZHUH EHLQJ SURGXFHG RQ HQGR 5 SURGXFWV 0RUHRYHU H[DPLQDWLRQ RI HQGR 5 SURGXFWV HDUO\ LQ WKH UHDFWLRQ UHYHDOHG WKDW WKH IRUP ,, PROHFXOHV SURGXFHG ZHUH UDQGRPO\ QLFNHG $ VLPLODU UDQGRP QLFNLQJ DFWLYLW\ ZDV REVHUYHG RQ VLQJOHVWUDQGHG I!; FLUFOHV 7KHVH REVHUYDWLRQV PD\ LQGLFDWH WKDW D VHSDUDWH XQUHODWHG QXFOHRO\WLF DFWLYLW\ ZDV SUHVHQW LQ HQGR 5 H[WUDFWV $OWHUQDWLYHO\ DOO RI WKHVH UHVXOWV FDQ EH H[SODLQHG E\ DQ DOWHUQDWH

PAGE 150

VSHFLILFLW\ RI HQGR 5 UDWKHU WKDQ WKH SUHVHQFH RI D FRQWDPLQDWLQJ QXFOHRO\WLF DFWLYLW\ $Q DOWHUQDWH VSHFLILFLW\ ZDV GHPRQVWUDWHG IRU HQGR 5 XQGHU UHDFWLRQ FRQGLWLRQV ZKHUH 0Q ZDV VXEVWLWXWHG IRU 0J DV PHWDO FRIDFWRU 8QGHU WKHVH FRQGLWLRQV ZLWK VWDQGDUG DPRXQWV RI HQ]\PH WKH VXEVWUDWH ZDV GHJUDGHG QRQVSHFLILFDOO\ )LJXUH f ,W LV SRVVLEOH WKDW WKH QRQVSHFLILF DFWLYLW\ FRH[LVWV DW D ORZ OHYHO ZLWK WKH VSHFLILF DFWLYLW\ XQGHU UHDFWLRQ FRQGLWLRQV WKDW IDYRU GRXEOHVWUDQGHG VSHFLILF FOHDYDJH 7KLV ZRXOG H[SODLQ WKH QRQVSHFLILF GHJUDGDWLRQ RI WKH VXEVWUDWH DV ZHOO DV WKH UDQGRP QLFNLQJ RI IRUP ,, SODVPLG '1$ DQG VLQJOHVWUDQGHG FLUFXODU '1$ $ VHFRQG LVVXH LV WKH LQDELOLW\ RI D SRUWLRQ RI WKH HQGR 5 UHDFWLRQ SURGXFWV WR EH OLJDWHG DQG WKH IDFW WKDW DSSUR[LPDWHO\ SHUFHQW RI WKH VSHFLILFDOO\ FOHDYHG SURGXFWV FDQ EH n HQG ODEHOHG ZLWKRXW WUHDWPHQW ZLWK DONDOLQH SKRVSKDWDVH 7KHVH REVHUYDWLRQV LQGLFDWH WKDW D SRUWLRQ RI WKH SURGXFW PROHFXOHV FRQWDLQ n K\GUR[\O JURXSV ,W LV XQOLNHO\ KRZHYHU WKDW WKLV LV WKH UHVXOW RI D VHSDUDWH QXFOHRO\WLF DFWLYLW\ VLQFH ERWK WKH SKRVSKRU\ODWHG DQG GHSKRVSKRU\ODWHG HQGV RFFXU RQ VSHFLILFDOO\ FOHDYHG PROHFXOHV )LJXUH %f ,W LV SRVVLEOH WKDW GHSKRVSKRU\ODWLRQ RI WKH VSHFLILFDOO\ FOHDYHG PROHFXOHV LV GXH WR DQ DVVRFLDWHG RU FRQWDPLQDWLQJ SKRVSKDWDVH DFWLYLW\ RU WKDW D VPDOO DPRXQW RI H[RQXFOHRO\WLF DFWLYLW\ ZKLFK OHDYHV n K\GUR[\O JURXSV LV SUHVHQW LQ WKH H[WUDFWV 2WKHU 0DPPDOLDQ (QGRQXFOHDVHV 7KH FKDUDFWHUL]DWLRQ RI VLWHVSHFLILF HQGRQXFOHDVHV ZKLFK UHFRJQL]H VSHFLILF '1$ VHTXHQFHV RU PLQRU GLVWRUWLRQV LQ WKH '1$ KHOL[

PAGE 151

KDV PRVWO\ EHHQ FRQILQHG WR WKRVH REWDLQHG IURP SURFDU\RWLF VRXUFHV 5HFHQWO\ KRZHYHU D QXPEHU RI ODERUDWRULHV KDYH LVRODWHG HQGRQXFOHDVH IURP HXFDU\RWLF FHOOV WKDW VKRZ DW OHDVW VRPH VSHFLILFLW\ IRU UHVLGXHV 0F.HQQD HW DO 'HVLGHULR DQG %DOWLPRUH .DWDRND HW DO 5XL]&DULOOR DQG 5HQDXG f ,Q VRPH UHVSHFWV HQGR 5 LV GLIIHUHQW IURP DOO RI WKHVH DFWLYLWLHV )RU H[DPSOH WKH QRQUDQGRP HQGRQXFOHDVH LVRODWHG E\ 0F.HQQD HW DO f DSSHDUV WR EH D GHJUDGDWLYH HQ]\PH ZKLFK GLJHVWV DGHQRYLUXV DQG 69 '1$ DQG LQLWLDOO\ SURGXFHV GLVFUHWH IUDJPHQWV ZKLFK DUH UHGXFHG WR VKRUW ROLJRQXFOHRWLGHV ZLWK IXUWKHU GLJHVWLRQ 7KH IUDJPHQWV SURGXFHG KDYH SUHGRPLQDQWO\ UHVLGXHV DW WKHLU HQGV ,Q FRQWUDVW HQGR 5 KDV OLWWOH LI DQ\ DFWLYLW\ RQ $G DQG 69 '1$ 6LPLODUO\ DQ HQGRQXFOHRO\WLF DFWLYLW\ ZKLFK FOHDYHV QHDU WKH UHFRPELQDWLRQ VLWH RI LPPXQRJOREXOLQ VHJPHQWV .DWDRND HW DO f DOVR FOHDYHV VLWHV LQ S%5 WKDW FRQVLVW RI VKRUW SRO\G*f VWUHWFKHV UHVLGXHVf ZKLOH HQGR 5 GRHV QRW GHWHFWDEO\ FOHDYH WKHVH VKRUW SRO\G*f VHTXHQFHV 7KH DFWLYLW\ PRVW VLPLODU WR HQGR 5 LV WKH RQH UHFHQWO\ GHVFULEHG E\ 5XL]&DULOOR DQG 5HQDXG f ZKLFK WKH\ KDYH FDOOHG HQGR (QGR ZDV LVRODWHG IURP FKLFNHQ HU\WKURF\WHV DQG DSSHDUV WR FOHDYH H[FOXVLYHO\ DW VWUHWFKHV RI SRO\G*fSRO\G&f ZKLFK KDYH D PLQLPXP OHQJWK RI ES 8QOLNH HQGR 5 HQGR GRHV QRW DSSHDU WR FOHDYH DOWHUQDWLQJ KRPRSXULQHKRPRS\ULPLGLQH VWUHWFKHV SRO\JDfSRO\&7f ,Q VSLWH RI WKHVH GLIIHUHQFHV LW LV SRVVLEOH WKDW HQGR 5 LV UHODWHG WR VRPH DQG SHUKDSV DOO RI WKHVH SUHYLRXVO\ GHVFULEHG HQ]\PHV 1RQH RI WKHVH HQ]\PHV KDYH EHHQ SXULILHG WR KRPRJHQHLW\ DQG WKHLU SURSHUWLHV PD\ FKDQJH VLJQLILFDQWO\ GXULQJ WKH FRXUVH RI SXULILFDWLRQ %\ DQDORJ\ ZLWK WKH UHF%& HQGRQXFOHDVH 5RVDPRQG HW DO 7D\ORU DQG 6PLWK 0XVNDYLWFK DQG /LQQ

PAGE 152

7D\ORU HW DO f LW LV SRVVLEOH WKDW DOO RI WKHVH HQGRQXFOHDVHV VKDUH D FRPPRQ FRUH DFWLYLW\ ZKRVH VSHFLILFLW\ LV PRGLILHG E\ LQKLELWRU\ RU DFFHVVRU\ SURWHLQV RU WKH FRQGLWLRQV RI WKH UHDFWLRQ :KDW 'RHV (QGR 5 'R IRU WKH &HOO 7KH LVRODWLRQ RI DQ HQ]\PH IURP +H/D FHOOV ZKRVH VROH DFWLYLW\ DSSHDUV WR EH FOHDYDJH DW KRPRSXULQHKRPRS\ULPLGLQH VHTXHQFHV UDLVHV WKH TXHVWLRQ RI WKH UROH RI WKHVH VHTXHQFHV LQ FHOOXODU '1$ (QGR 5 LV RQH RI WKUHH PDMRU HQGRQXFOHRO\WLF DFWLYLWLHV WKDW ZHUH GHWHFWHG LQ +H/D FHOO QXFOHL +RZHYHU EHFDXVH RI WKH VSHFLILFLW\ RI HQGR 5 LW LV XQOLNHO\ WKDW LW SOD\V D GHJUDGDWLYH UROH LQ WKH FHOO )XUWKHUPRUH WKH UHVXOWV RI /DUVHQ DQG :HLQWUDXE f VXJJHVW WKDW PRVW SRO\G*f RU SRO\*$f VHTXHQFHV LQ FKURPDWLQ ZRXOG EH SURWHFWHG IURP FOHDYDJH XQOHVV WKH\ DUH XQGHUJRLQJ WUDQVFULSWLRQ RU UHSOLFDWLRQ 7KH GLVWULEXWLRQ RI KRPRSXULQHKRPRS\ULPLGLQH VHTXHQFHV DSSHDUV WR EH SUHGRPLQDQWO\ LQ QRQFRGLQJ VHTXHQFHV 1DNDPXUD HW DO +RIIPDQ/LHEHUPDQ HW DO -HIIUH\V HW DO f EXW WKHLU GLVWULEXWLRQ GRHV QRW VXJJHVW DQ\ REYLRXV UROH ,Q VRPH FDVHV WKHVH VHTXHQFHV KDYH EHHQ IRXQG QHDU FRGLQJ UHJLRQV +HQWVFKHO *OLNHQ HW DO 5LFKDUGV HW DO 0DFH HW DO )LHOG HW DO *HURQGDNLV HW DO 6KLK HW DO 0F*KHH HW DO 'D\ HW DO f $Q LQWULJXLQJ DVSHFW RI WKHVH VHTXHQFHV LV WKDW LQ PDQ\ FDVHV WKH\ KDYH EHHQ IRXQG LQ UHJLRQV RI JHQHWLF LQVWDELOLW\ HLWKHU DV SDUW RI VDWHOOLWH '1$ )RZOHU DQG 6NLQQHU f RU DV SDUW RI PRGHUDWHO\ UHSHDWHG WDQGHP DUUD\V ZKLFK YDU\ LQ WKH QXPEHU RI UHSHDW XQLWV -HIIUH\V HW DO 1DNDPXUD HW DO +RIIPDQ/LHEHUPDQQ HW DO f 6RPH RI WKH YDULDEOH QXPEHU WDQGHP UHSHDW XQLWV 9175nVf

PAGE 153

KDYH EHHQ IRXQG QHDU FRGLQJ JHQHV DV LQ WKH FDVH RI WKH LQVXOLQ JHQH %HOO HW DO f DQG WKH P\RJORELQ JHQH -HIIUH\V HW DO f 2QH FRPPRQO\ SURSRVHG PHFKDQLVP IRU DPSOLI\LQJ RU UHGXFLQJ WKH QXPEHU RI UHSHDWV LQ D WDQGHP DUUD\ LV XQHTXDO KRPRORJRXV UHFRPELQDWLRQ 7KLV KDV OHG WR WKH VXJJHVWLRQ WKDW 9175 VHTXHQFHV PD\ FRQWDLQ KRWVSRWV IRU UHFRPELQDWLRQ -HIIUH\V HW DO f $OWKRXJK WKHUH LV QR GLUHFW HYLGHQFH WR VXSSRUW WKLV LW LV VWULNLQJ WKDW PDQ\ RI WKH 9175nV KDYH KRPRSXULQHKRPRS\ULPLGLQH VWUHWFKHV VLPLODU WR WKRVH IRXQG LQ $$9 -HIIUH\V HW DO f FRQFOXGHG WKDW WKH FRPPRQ FRUH VHTXHQFH LQ WKHLU UHSHDWV ZDV &[7&&7J&&& 1DNDPXUD HW DO f GHGXFHG D VRPHZKDW GLIIHUHQW FRUH VHTXHQFH &&&&D&QQ&&& 6SHFLILF H[DPSOHV RI VHTXHQFHV WKDW KDYH EHHQ DVVRFLDWHG ZLWK YDULDEOH QXPEHUV RI WDQGHP UHSHDWV DUH WKH LQVXOLQ JHQH &&&&D&D&&&& %HOO HW DO f WKH P\RJORELQ JHQH &&7&&D&&&J7&&77 -HIIUH\V HW DO f DQG WKH '5 UHSHDW RI WKH KHUSHV VLPSOH[ WHUPLQDO VHTXHQFH &7&&7&&&&&& 0RNDUVNL DQG 5RL]PDQ f ,W LV SRVVLEOH WKHQ WKDW HQGR 5 UHFRJQL]HV WKH VHFRQGDU\ VWUXFWXUH RI WKH 9175 VHTXHQFHV DQG LV LQYROYHG LQ RQH RI WKH FHOOXODU SDWKZD\V IRU UHFRPELQDWLRQ ,I LQ IDFW $$9 WHUPLQL FRQWDLQ D UHFRJQLWLRQ VHTXHQFH IRU FHOOXODU UHFRPELQDWLRQ WKHQ WKLV PLJKW H[SODLQ KRZ $$9 SURYLUXVHV DUH ERWK LQWHJUDWHG DQG UHVFXHG 7KH VHTXHQFH UHFRJQLWLRQ RI HQGR 5 LV UHPLQLVFHQW RI WKH SURSHUWLHV RI WHORPHUH WHUPLQDO WUDQVIHUDVH WHORPHUDVHf IURP 7HWUDK\PHQD +HQGHUVRQ HW DO f $OWKRXJK VRPH YDULDWLRQ H[LVWV LQ WKH FRQVHQVXV VHTXHQFH DOO NQRZQ QXFOHDU WHORPHUHV FRQVLVW RI *ULFK DQG &ULFK FRPSOHPHQWDU\ VWUDQGV %ODFNEXUQ f 6HYHUDO YDULDWLRQV RI WKLV VHTXHQFH DUH UHFRJQL]HG DV WHORPHUHV LQ \HDVW VXJJHVWLQJ WKDW DOO RI WKHVH VHTXHQFHV PDLQWDLQ D FRPPRQ VHFRQGDU\ VWUXFWXUH UHFRJQL]HG

PAGE 154

E\ WHORPHUDVH 6]RVWDN DQG %ODFNEXUQ 0XUUD\ DQG 6]RVWDN 6KDPSD\ HW DO %ODFNEXUQ DQG 6]RVWDN f ,Q DGGLWLRQ HORQJDWLRQ E\ WHORPHUDVH UHTXLUHV WHORPHULF VHTXHQFHV DW OHDVW ES LQ OHQJWK WKDW FRQWDLQ n SURWUXGLQJ HQGV ULFK LQ *UHVLGXHV %ODFNEXUQ +HQGHUVRQ HW DO f ,W LV FRQFHLYDEOH WKDW HQGR 5 DOVR SOD\V D UROH LQ WKH PDLQWHQDQFH RI FKURPRVRPDO HQGV 7ZR YDULDWLRQV RI WHORPHULF VHTXHQFHV ZHUH VXEVWUDWHV IRU HQGR 5 FOHDYDJH S*0 DQG S*0 )LJXUH & )LJXUH f DQG LW LV OLNHO\ WKDW DOO WKH YDULDWLRQV RI WKHVH VHTXHQFHV ZRXOG DOVR EH UHFRJQL]HG DQG FOHDYHG E\ HQGR 5 DV ZHOO ,Q DGGLWLRQ WKH VHTXHQFH DQDO\VLV RI HQGR 5 FOHDYDJH VLWHV VXJJHVWHG WKDW WKH HQ]\PH OHIW n SURWUXGLQJ HQGV $ SRUWLRQ RI WKHVH ZRXOG EH ULFK LQ UHVLGXHV DQG ZRXOG WKHUHIRUH EH VXEVWUDWHV IRU WKH QRQWHPSODWHG DGGLWLRQ RI VHTXHQFHV E\ WHORPHUDVH 7KXV HQGR 5 FOHDYDJH RI WHORPHULF VHTXHQFHV GXULQJ '1$ UHSOLFDWLRQ FRXOG DOORZ WKH UHVROXWLRQ RI WKH HQGV RI WKH UHSOLFDWHG FKURPRVRPH DQG DW WKH VDPH WLPH SUHSDUH WHORPHULF VHTXHQFHV IRU VWUDQG HORQJDWLRQ E\ WHORPHUDVH 7KH UHVXOWV IURP VWXGLHV RI WKH HIIHFW RI QXFOHRWLGHV DQG SRO\QXFOHRWLGHV RQ HQGR 5 DFWLYLW\ VXJJHVW WKDW HQGR 5 FOHDYDJH LQ YLYR PD\ EH WLJKWO\ UHJXODWHG (QGR 5 GLVSOD\HG D VWURQJ DIILQLW\ IRU KRPRSRO\PHUV RI VLQJOHVWUDQGHG SRO\G*f LQ '1$ FRPSHWLWLRQ H[SHULPHQWV 7KLV VXSSRUWHG WKH FRQFOXVLRQ WKDW WKH PDMRU VXEVWUDWH IRU HQGR 5 ZDV SRO\G*f +RZHYHU WKH LQKLELWLRQ E\ SRO\G*f PD\ DOVR UHIOHFW DXWRUHJXODWRU\ SURSHUWLHV RI WKH HQ]\PH 7KH DFFXPXODWLRQ RI VPDOO ROLJRQXFOHRWLGHV RI SRO\G*f SURGXFHG IURP HQGR 5 FOHDYDJH FRXOG VHUYH WR LQKLELW RU QHJDWLYHO\ PRGXODWH WKH FOHDYDJH UHDFWLRQ 7KXV WKH DPRXQW RI FOHDYDJH E\ HQGR 5 PD\ EH OLPLWHG E\ HQGSURGXFW LQKLELWLRQ

PAGE 155

$GGLWLRQDO HYLGHQFH VXJJHVWV WKDW HQGR 5 DFWLYLW\ PD\ EH DOORVWHULFDOO\ PRGXODWHG E\ ULER DQG GHR[\ULERQXFOHRWLGHV &OHDYDJH DFWLYLW\ ZDV VWLPXODWHG IROG ZLWK WKH DGGLWLRQ RI G*73 DQG G$73 ZKLOH WKH DFWLYLW\ ZDV VWURQJO\ LQKLELWHG ZLWK WKH DGGLWLRQ RI $73 DQG *73 +RZHYHU HQGR 5 GLG QRW ELQG WR $73 RU *73OLQNHG DJDURVH FROXPQV DQG LW LV SRVVLEOH WKDW WKH ELQGLQJ RI WKHVH FRPSRXQGV E\ HQGR 5 UHTXLUHV WKH SUHVHQFH RI VXEVWUDWH '1$ 7KHVH REVHUYDWLRQV VXJJHVW WKDW WKHUH DUH WZR VHSDUDWH ELQGLQJ VLWHV RQ WKH HQ]\PH 2QH VLWH PD\ UHFRJQL]H DQG ELQG '1$ VHFRQGDU\ VWUXFWXUH ZKLOH DQRWKHU VLWH PD\ ELQG VXEVWDQFHV WKDW HIIHFW FOHDYDJH DFWLYLW\ LQGLUHFWO\ SRVVLEO\ E\ FDXVLQJ FRQIRUPDWLRQDO FKDQJHV RI WKH HQ]\PH 7KLV OHYHO RI FRQWURO PD\ EH QHFHVVDU\ WR SUHYHQW WKH FOHDYDJH RI KRPRSXULQHKRPRS\ULPLGLQH VHTXHQFHV QHDU WKH FRGLQJ UHJLRQV RI WUDQVFULSWLRQDOO\ DFWLYH JHQHV ZKHQ WKH FRQFHQWUDWLRQ RI ULERQXFOHRWLGHV LV UHODWLYHO\ KLJK DQG WKH VHTXHQFHV IODQNLQJ WKH FRGLQJ UHJLRQV DUH H[SRVHG /DUVHQ DQG :HLQWUDXE f 'XULQJ FHOOXODU '1$ UHSOLFDWLRQ KRZHYHU KLJKHU ORFDO FRQFHQWUDWLRQV RI GHR[\ULERQXFOHRWLGHV PD\ VWLPXODWH HQGR 5 FOHDYDJH DFWLYLW\ ,Q FRQFOXVLRQ HQGR 5 LV D KXPDQ FHOOXODU HQ]\PH PRVW OLNHO\ FRQVLVWLQJ RI D VLQJOH SHSWLGH ZLWK D QDWLYH PROHFXODU ZHLJKW RI DSSUR[LPDWHO\ NG 7KH HQ]\PH DSSDUHQWO\ UHFRJQL]HV WKH VHFRQGDU\ VWUXFWXUH FKDUDFWHULVWLF RI SRO\SXULQHSRO\S\ULPLGLQH VHTXHQFHV ULFK LQ *& EDVH SDLUV 6HTXHQFH DQDO\VLV RI WKH FOHDYDJH VLWH VXJJHVWV WKDW HQGR 5 SURGXFHV GRXEOHVWUDQGHG EUHDNV LQ WKH VXEVWUDWH WKURXJK D VHULHV RI FRQFHUWHG VLQJOHVWUDQGHG QLFNV RFFXUULQJ WKURXJKRXW WKH UHFRJQLWLRQ VLWH 7KH SURSHUWLHV RI WKH HQ]\PH DQG WKH GLVWULEXWLRQ RI QDWXUDOO\

PAGE 156

RFFXUULQJ UHFRJQLWLRQ VHTXHQFHV LQ FKURPRVRPDO '1$ VXJJHVW WKDW (QGR 5 FOHDYDJH DFWLYLW\ PD\ SOD\ D UROH LQ JHQHWLF UHFRPELQDWLRQ DQG FHOOXODU '1$ UHSOLFDWLRQ

PAGE 157

5()(5(1&(6 $UQRWW 6 &KDQGUDVHNDUDQ 5 +DOO ,+ DQG 3XLJMDQHU /& f +HWHURQRUDRXV '1$ 1XFO $FLGV 5HV $WFKLVRQ 5: &DVWR %& DQG +DPPRQG :0F' f $GHQRYLUXV DVVRFLDWHG GHIHFWLYH YLUXV SDUWLFOHV 6FLHQFH %HOO *, 6HOE\ 0DQG 5XWWHU :f 7KH KLJKO\ SRO\PRUSKLF UHJLRQ QHDU WKH KXPDQ LQVXOLQ JHQH LV FRPSRVHG RI VLPSOH WDQGHPO\ UHSHDWLQJ VHTXHQFHV 1DWXUH %HUQV ., 0X]\F]ND 1 DQG +DXVZLUWK :: f 5HSOLFDWLRQ RI SDUYRYLUXVHV LQ 9LURORJ\ %HUQDUG )LHOGV HG 5DYHQ 3UHVV 1HZ
PAGE 158

%UDP 6 f 3RO\QXFOHRWLGH SRO\PRUSKLVP LQ VROXWLRQ 1DWXUH 1HZ %LRO %XOOHU 50 -DQLN -( 6HEULQJ (' DQG 5RVH -$ f +HUSHV VLPSOH[ YLUXV W\SHV DQG FRPSOHWHO\ KHOS DGHQRYLUXVDVVRFLDWHG YLUXV UHSOLFDWLRQ 9LURO &DQWRU &5 DQG (IVWUDGLDWLV $ f 3RVVLEOH 6WUXFWXUHV RI KRPRSXULQHKRPRS\ULPLGLQH 6OK\SHUVHQVLWLYH VLWHV 1XF $FLGV 5HV &DYDOLHU6PLWK 7 f 3DOLQGURPLF EDVH VHTXHQFHV DQG UHSOLFDWLRQ RI HXNDU\RWLF FKURPRVRPH HQGV 1DWXUH &KDOOEHUJ 0' DQG .HOO\ 7f $GHQRYLUXV '1$ UHSOLFDWLRQ LQ YLWUR 3URF 1DWO $FDG 6FL 86$ &KHQ */
PAGE 159

*HURQGDNLV 6 &RU\ 6 DQG $GDPV -0 f 7UDQVORFDWLRQ RI WKH P\F FHOOXODU RQFRJHQH WR WKH LPPXQRJOREXOLQ KHDY\ FKDLQ ORFXV LQ PXULQH SODVPDF\WRPDV LV DQ LPSUHFLVH UHFLSURFDO H[FKDQJH &HOO *OLNLQ *& *DUJLXOR 5HQD'HVFDO]L / DQG :RUFHO $ f (VFKHULFKLD FROL VLQJOHVWUDQG ELQGLQJ SURWHLQ VWDELOL]HV VSHFLILF GHQDWXUHG VLWHV LQ VXSHUKHOLFDO '1$ 1DWXUH *UHHQ 0 3DUVRQV -7 3LQD 0 )XMLQDJX &DIILQ $ DQG /DQGJUDI/HDUV 0 f 7UDQVFULSWLRQ RI DGHQRYLUXV JHQHV LQ SURGXFWLYHO\ LQIHFWHG DQG WUDQVIRUPHG FHOOV &ROG 6SULQJ +DUERU 6\PS 4XDQW %LRO +DQGD + 6KLURNL DQG 6KLPRMR + f (VWDEOLVKPHQW DQG FKDUDFWHUL]DWLRQ RI .% FHOO OLQHV ODWHQWO\ LQIHFWHG ZLWK DGHQR DVVRFLDWHG YLUXV W\SH 9LURORJ\ +DXVZLUWK :: DQG %HUQV ., f 2ULJLQ DQG WHUPLQDWLRQ RI DGHQR DVVRFLDWHG YLUXV '1$ UHSOLFDWLRQ 9LURORJ\ +DXVZLUWK :: YDQ GH :DOOH 0/DLSLV 3DQG 2OLYR 3' f +HWHURJHQHRXV PLWRFKRQGULDO '1$ 'ORRS VHTXHQFHV LQ ERYLQH WLVVXH &HOO +HQGHUVRQ ( +DUGLQ && :DON 6. 7LQRFR -U DQG %ODFNEXUQ (+ f 7HORPHULF '1$ ROLJRQXFOHRWLGHV IRUP QRYHO LQWUDPROHFXODU VWUXFWXUHV FRQWDLQLQJ JXDQLQHJXDQLQH EDVH SDLUV &HOO +HQWVFKHO && f +RPRFRSRO\PHU VHTXHQFHV LQ WKH VSDFHU RI D VHD XUFKLQ KLVWRQH JHQH UHSHDW DUH VHQVLWLYH WR 6, QXFOHDVH 1DWXUH +HUPRQDW 3/ DQG 0X]\F]ND 1 f 8VH RI DGHQRDVVRFLDWHG YLUXV DV D PDPPDOLDQ '1$ FORQLQJ YHFWRU 7UDQVGXFWLRQ RI QHRP\FLQ UHVLVWDQFH LQWR PDPPDOLDQ WLVVXH FXOWXUH FHOOV 3URF 1DWO $FDG 6FL 86$ +HUPRQDW 3/ /DERZ 0$ :ULJKW 5 %HUQV ., DQG 0X]\F]ND 1 f *HQHWLFV RI DGHQRDVVRFLDWHG YLUXV LVRODWLRQ DQG SUHOLPLQDU\ FKDUDFWHUL]DWLRQ RI DGHQRDVVRFLDWHG YLUXV W\SH PXWDQWV -9LURO +LUW % f 6HOHFWLYH H[WUDFWLRQ RI SRO\RPD '1$ IURP LQIHFWHG PRXVH FHOO FXOWXUHV 0RO %LRO +RIIPDQ/LHEHUPDQQ % +RIIPDQ/LHEHUPDQQ 7URXWW $ .HGHV /+ DQG &RKHQ61 f +XPDQ KRPRORJV RI 78 WUDQVSRVRQ 6HTXHQFHV 3RO\SXULQH3RO\S\ULPLGLQH VHTXHQFH HOHPHQWV WKDW FDQ DOWHU '1$ FRQIRUPDWLRQ LQ YLWUR DQG LQ YLYR 0RO &HOO %LRO

PAGE 160

+RJJDQ 0' 7KRPDV *) 7KRPDV )% DQG -RKQVRQ )% f &RQWLQXRXV FDUULDJH RI DGHQRYLUXV DVVRFLDWHG YLUXV JHQRPH LQ FHOO FXOWXUH LQ WKH DEVHQFH RI KHOSHU DGHQRYLUXV ,Q 3URFHHGLQJV RI WKH IRXUWK OHSHWLWH FROORTXLXP &RFR\DF 0H[LFR 1RUWK+ROODQG 3XEOLVKLQJ &RPSDQ\ $PVWHUGDP S +ROORPDQ :. 5RZH 7& DQG 5XVFKH -5 f 6WXGLHV RQ 1XFOHDVH DOSKD IURP 8VWLODJR PD\GLV %LRO &KHP -HIIUH\V $:LOVRQ 9 DQG 7KHLQ 6/ f +\SHUYDULDEOH PLQLVDWHOOLWH UHJLRQV LQ KXPDQ '1$ 1DWXUH .DWDRND 7 .RQGR6 1LVKL 0 .RGDLUD 0 DQG +RQMR 7 f ,VRODWLRQ DQG FKDUDFWHUL]DWLRQ RI HQGRQXFOHDVH D VHTXHQFH VSHFLILF HQGRQXFOHDVH FOHDYLQJ LPPXQRJOREXOLQ JHQHV 1XF $FLGV 5HV .RKZL6KLJHPDWVX 7 DQG .RKZL < f 3RO\G*f3RO\G&f VHTXHQFHV XQGHU WRUVLRQDO VWUHVV LQGXFH DQ DOWHUHG '1$ FRQIRUPDWLRQ XSRQ QHLJKERULQJ '1$ VHTXHQFHV &HOO /DHPPOL 8. f &OHDYDJH RI VWUXFWXUDO SURWHLQV GXULQJ WKH DVVHPEO\ RI WKH KHDG RI EDFWHULRSKDJH 7 1DWXUH /RQGRQf /DUVHQ ( DQG :HLQWUDXE + f $Q DOWHUHG '1$ FRQIRUPDWLRQ GHWHFWHG E\ 6, 1XFOHDVH RFFXUV DW VSHFLILF UHJLRQV LQ DFWLYH FKLFN JORELQ FKURPDWLQ &HOO /DVNRZVNL 6U 0 f 1XFOHDVHV +LVWRULFDO 3HUVSHFWLYHV LQ 1XFOHDVHV /LQQ 0/ DQG 5REHUWV 5HG &ROG 6SULQJ +DUERU /DERUDWRU\ SS /DXJKOLQ &$ &DUGHOOLFKLR &% DQG &RRQ +& f /DWHQW LQIHFWLRQ RI .% FHOOV ZLWK DGHQRDVVRFLDWHG YLUXV W\SH 9LURO /DXJKOLQ &$ -RQHV 1 DQG &DUWHU %f (IIHFW RI GHOHWLRQV LQ DGHQRYLUXV UHJLRQ JHQHV XSRQ UHSOLFDWLRQ RI DGHQRDVVRFLDWHG YLUXV 9LURO /DXJKOLQ &$ 7UDWVFKLQ -' &RRQ + DQG &DUWHU %f &ORQLQJ RI LQIHFWLRXV DGHQRDVVRFLDWHG YLUXV JHQRPHV LQ EDFWHULDO SODVPLGV *HQH /HIHEYUH 5% 5LYD 6 DQG %HUQV ., f &RQIRUPDWLRQ WDNHV SUHFHGHQFH RYHU VHTXHQFH LQ DGHQRDVVRFLDWHG YLUXV '1$ UHSOLFDWLRQ 0RO &HOO %LRO /L -DQG .HOO\ 7f 6LPLDQ YLUXV '1$ UHSOLFDWLRQ LQ YLWUR 3URF 1DWO $FDG 6FL 86$ /LX /) DQG 'DYLV -/ f 1RYHO WRSRORJLFDOO\ NQRWWHG '1$ IURP EDFWHULRSKDJH 3 FDSVLGV 6WXGLHV ZLWK '1$ WRSRLVRPHUDVHV 1XFO $FLGV 5HV

PAGE 161

/LX /) /LX && DQG $OEHUWV %0 f 7\SH ,, '1$ WRSRLVRPHUDVHV (Q]\PHV WKDW FDQ XQNQRW D WRSRORJLFDOO\ NQRWWHG '1$ PROHFXOH YLD D UHYHUVLEOH GRXEOHVWUDQGHG EUHDN &HOO /LX /) 5RZH 7&
PAGE 162

0XUDNDPL < (NL 7
PAGE 163

6DPXOVNL 5&KDQJ /6 DQG 6KHQN 7 f $ UHFRPELQDQW SODVPLG IURP ZKLFK DQ LQIHFWLRXV $GHQR$VVRFLDWHG 9LUXV JHQRPH FDQ EH H[FLVHG LQ YLWUR DQG LWV XVH WR VWXG\ YLUDO UHFRPELQDWLRQ 9LURO 6DPXOVNL 56ULYDVWDYD $ %HUQV ., DQG 0X]\F]ND 1 f 5HVFXH RI DGHQRDVVRFLDWHG YLUXV IURP UHFRPELQDQW SODVPLGV *HQH FRUUHFWLRQ ZLWKLQ WKH WHUPLQDO UHSHDWV RI $$9 &HOO 6DQJHU ) 1LFNOHQ 6 DQG &RXOVRQ $5 f '1$ VHTXHQFLQJ ZLWK FKDLQWHUPLQDWLQJ LQKLELWRUV 3URF 1DW $FDG 6FL 86$ 6FKRQ ( (YDQV 7 :HOVK DQG (IVWUDGLDWLV $ f &RQIRUPDWLRQ RI 3URPRWHU '1$ ILQH PDSSLQJ RI 6,K\SHUVHQVLWLYH VLWHV &HOO 6HPOHU %/ 'RUQHU $DQG :LPPHU ( f 3URGXFWLRQ RI LQIHFWLRXV SROLRYLUXV FORQHG F'1$ LV GUDPDWLFDOO\ LQFUHDVHG E\ 69 WUDQVFULSWLRQ DQG UHSOLFDWLRQ VLJQDOV 1XFO $FLGV 5HV 6HQDSDWK\ 3 7UDWVFKLQ -' DQG &DUWHU %f 5HSOLFDWLRQ RI DGHQRDVVRFLDWHG YLUXV '1$ &RPSOHPHQWDWLRQ RI QDWXUDOO\ RFFXUULQJ UHS PXWDQWV E\ D ZLOGW\SH JHQRPH RU DQ RUL PXWDQW DQG FRUUHFWLRQ RI WHUPLQDO SDOLQGURPH GHOHWLRQV 0RO %LRO 6KDPSD\ 6]RVWDN -: DQG %ODFNEXUQ (+ f '1$ 6HTXHQFHV RI WHORPHUHV PDLQWDLQHG LQ \HDVW 1DWXUH 6KLK &. /LQLDO 0 *RRGHQRZ 00 DQG +D\ZDUG :6 f 1XFOHRWLGH VHTXHQFH n RI WKH FKLFNHQ FP\F FRGLQJ UHJLRQ /RFDOL]DWLRQ RI D QRQFRGLQJ H[RQ WKDW LV DEVHQW IURP P\F WUDQVFULSWV LQ PRVW DYLDQ OHXNRVLV YLUXVLQGXFHG O\PSKRPDV 3URF 1DWO $FDG 6FL 86$ 6LQJOHWRQ &. .OXSLN DQG :HOOV 5' f &RQIRUPDWLRQDO IOH[LELOLW\ RI MXQFWLRQV EHWZHHQ FRQWLJXRXV % DQG ='1$ LQ VXSHUFRLOHG SODVPLGV 3URF 1DWO $FDG 6FL 86$ 6RXWKHUQ (0 f 'HWHFWLRQ RI VSHFLILF VHTXHQFHV DPRQJ '1$ IUDJPHQWV VHSDUDWHG E\ JHO HOHFWURSKRUHVLV 0RO %LRO 6ULYDVWDYD $ /XVE\ (: DQG %HUQV ., f 1XFOHRWLGH VHTXHQFH DQG RUJDQL]DWLRQ RI WKH DGHQRDVVRFLDWHG YLUXV JHQRPH 9LURO 6WUDXV 6( 6HEULQJ (' DQG 5RVH -$ f &RQFDWHPHUV RI DOWHUQDWLQJ SOXV DQG PLQXV VWUDQGV DUH LQWHUPHGLDWHV LQ DGHQRYLUXVDVVRFLDWHG '1$ V\QWKHVLV 3URF 1DWO $FDG 6FL 86$

PAGE 164

6ZLW]HU 5& 0XULO &5 DQG 6KLIULQ 6 f $ KLJKO\ VHQVLWLYH VLOYHU VWDLQ IRU GHWHFWLQJ SURWHLQV DQG SHSWLGHV LQ DFU\ODPLGH JHOV $QDO %LRFKHP 6]RVWDN -: DQG %ODFNEXUQ (+ f &ORQLQJ \HDVW WHORPHUHV RQ OLQHDU SODVPLG YHFWRUV &HOO 7D\ORU $) DQG 6PLWK *5 f 8QZLQGLQJ DQG UHZLQGLQJ RI '1$ E\ WKH UHF%& HQ]\PH &HOO 7D\ORU $) 6FKXOW] ': 3RQWLFHOOL $6 DQG 6PLWK *5 f 5HF%& HQ]\PH QLFNLQJ DW FKL VLWHV GXULQJ '1$ XQZLQGLQJ /RFDWLRQ DQG RULHQWDWLRQ GHSHQGHQFH RI FXWWLQJ &HOO 7LPVRQ f +\GUR[\XUHD 5HYLHZf 0XWDWLRQ 5HVHDUFK 9RJW 9 f 3XULILFDWLRQ DQG IXUWKHU SURSHUWLHV RI VLQJOHVWUDQGHG VSHFLILF QXFOHDVH IURP $VSHUJLOOXV RU\]DH (XU %LRFKHP
PAGE 165

%,2*5$3+,&$/ 6.(7&+ -RQDWKDQ ZDV ERUQ LQ 1HZ
PAGE 166

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ I8 F;WWOV8n f§ 1LFKRODV 0X]\F]ND 3N\X &KDLUPDQ $VVRFLDWH 3URIHVVRU RI ,PPXQRORJ\ DQG 0HGLFDO 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ (GZDUG :DNHODQG 3K' $VVRFLDWH 3URIHVVRU RI 3DWKRORJ\ DQG /DERUDWRU\ 0HGLFLQH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ :LOOLDP : +DXVZLUWK 3K' 3URIHVVRU RI ,PPXQRORJ\ DQG 0HGLFDO 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 3KDUPDFRORJ\ DQG 7KHUDSHXWLFV

PAGE 167

7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI 0HGLFLQH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ $XJXVW 'HDQ *UDGXDWH 6FKRRO

PAGE 168

81,9(56,7< 2) )/25,'$


IN VITRO EXCISION OF ADENO-ASSOCIATED VIRUS DNA FROM
RECOMBINANT PLASMIDS: ISOLATION OF AN ENZYME FRACTION
FROM HELA CELLS THAT CLEAVES DNA AT POLYPURINE-
POLYPYRIMIDINE SEQUENCES RICH IN GC BASE PAIRS
BY
H. JONATHAN GOTTLIEB
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN
PARTIAL FULFILLMENT OF THE REQUIREMENTS
FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1988

To my family
Digitized by the Internet Archive
in 2011 with funding from
University of Florida, George A. Smathers Libraries with support from LYRASIS and the Sloan Foundation
http://www.archive.org/details/invitroexcisionoOOgott

ACKNOWLEDGEMENTS
I would like to express my sincerest appreciation to my mentor and
friend, Dr. Nicholas Muzyczka, for the unique opportunity to work with
him during the last several years. In addition, I would like to thank
the members of my graduate committee at the University of Florida and
Drs. Kenneth Berns and William Holloman for their helpful suggestions
and encouragement.
I am grateful to members of the Muzyczka laboratory in New York
and in Florida for their advice, conversation and friendship. Special
thanks are extended to Deirdre Lawe and to my co-defendant, Susan
McLaughlin.
iii

TABLE OF CONTENTS
Page
ACKNOWLEDGMENTS iii
LIST OF TABLES vi
LIST OF FIGURES vii
KEY TO ABBREVIATIONS ix
ABSTRACT xi
CHAPTER
I. INTRODUCTION 1
Introduction 1
AAV DNA Replication 1
Rescue of Latent AAV Provirus 4
General Aim of the Studies 6
II. MATERIALS AND METHODS 7
Cell Culture and Viruses 7
Recombinant Clones and Enzyme Substrates 7
Purification of Endo R 10
Nuclease Assays 11
DNA Labeling, Sequencing and
Primer Extension 12
Gel Electrophoresis 14
Estimation of the Isoelectric Point 15
Chromatographic Media, Enzymes
and Materials 15
Other Methods 16
Estimate of In Vivo Excision Frequency 16
III.PURIFICATION OF ENDO R 17
Detection of a Site-Specific Endonuclease
Activity in Crude Nuclear Extracts 17
Purification of Endo R 20
The Endo R Agarose Gel Assay 25
Molecular Size and Purity of Endo R 25
iv

Page
IV. RESCUE OF AAV SEQUENCES 35
Localization of the Site of Cleavage to
the AAV/Vector Junction 35
Either AAV/Vector Junction Can Be Cleaved
Independently of the Other 38
Cleavage of AAV Terminal Mutants 39
Minor Endo R Cleavage Sites 46
AAV Excision In Vivo 48
Replication of Endo R Products 51
V. ENZYME RECOGNITION 53
Isolation of the Cleavage Site 53
Sequence at the Site of Cleavage 63
Is Endo R a Site Specific Single-
Stranded Nuclease 76
VI. PROPERTIES OF ENDO R 85
Reaction Conditions for Double-Stranded
Cleavage 85
Alternate Cleavage Specificity in the
Presence of Mn^ Ions 89
Endo R Specific Cleavage is of a
Double-Stranded Nature 94
Effect of Nucleotides and Polynucleotides
on the Cleavage Activity 100
Are Stoichiometric Amounts of Enzyme
Required for Cleavage Ill
Characterization of the Ends of the
Reaction Products Ill
Is Endo R a Human Topoisomerase 120
VII.DISCUSSION AND CONCLUSIONS 121
Purification of Endo R 121
Excision of AAV Sequences In Vitro 122
Is Endo R Responsible for the Rescue of
AAV Sequences In Vivo 123
Enzyme Recognition 129
Evidence for a Contaminating Nuclease 137
Other Mammalian Endonucleases 138
What Does Endo R Do for the Cell 140
REFERENCES 145
BIOGRAPHICAL SKETCH 153
v

LIST OF TABLES
Table Page
I. PURIFICATION OF ENDO R 21
II.RECOGNITION SITE FOR ENDO R IN AAV
PLASMIDS 40
III. MINOR CLEAVAGE SITES 47
IV. SUBCLONED CLEAVAGE SITES 58
V. DIVALENT METAL REQUIREMENTS FOR ACTIVITY 86
VI. NUCLEOTIDE INHIBITION AND STIMULATION 102
VII. END LABELING OF ENDO R PRODUCTS 113
vi

LIST OF FIGURES
Figure Page
1-1. Model for AAV DNA Replication 3
3-1. Endo R Agarose Gel Assay 19
3-2. Enzyme Titration of Fractions I, II
and III 23
3-3. Enzyme Titration of Fraction III 27
3-4. Sedimentation Analysis of Endo R by
Glycerol Gradient Centrifugation 30
3-5. Molecular Weight and Purity of Endo R 32
4-1. Identification of AAV-Specific and pBR-
Specific Fragments in the Endo R
Reaction 37
4-2. Cleavage of Substrates That Contain Only
One Copy of the AAV Terminal Repeat 42
4-3. Cleavage of AAV Plasmids That Contain
Deletions in the Terminal Repeat 45
4-4. Cleavage of AAV Plasmids In Vivo 50
5-1. Oligomer Clone Cleavage 55
5-2. Oligomer Clone Gel Assay 57
5-3. Endo R Cleavage of pGA38 and pEV136 62
5-4. Sequence at the Site of Cleavage-
Dideoxy Method 67
5-5. Sequence at the Site of Cleavage-
Maxam and Gilbert Method 72
5-6. Sequence at the Site of Endo R Cleavage-
Summary of the Cleavage Sites 74
5-7. SI and Endo R Nuclease Digestion of pSM620 78
vii

Page
Figure
5-8. SI and Endo R Activity on Single-Stranded
DNA 82
5-9. Endo R Activity on Single-Stranded
Circular DNA 84
6-1. Sodium and Potassium Inhibition of Endo R 88
6-2. Cleavage of Form I and Form III Plasmid
Substrate 91
6-3. Specificity of Endo R With Mg^+ and Mn^+ 93
6-4. Cleavage Reaction Time Course 96
6-5. Single-Stranded Specificity of Endo R 99
6-6. ATP Inhibition of Endo R Activity 104
6-7. Polynucleotide Competition of Double-
Stranded Cleavage Activity 107
6-8. Stoichiometry of the Endo R Cleavage
Reaction 110
6-9. Ligation of Endo R Products 116
6-10. 5' End Labeling of Endo R Products 118
7-1. Model for the Excision of AAV DNA from
Recombinant Plasmids 126
viii

KEY TO ABBREVIATIONS
ATP
adenosine-5'-triphosphate
bp
base pairs
BSA
bovine serum albumin
CTP
cytosine-5'-triphosphate
d
daltons
dATP
deoxyadenosine-5'-triphosphate
dCTP
deoxycytosine-5'-triphosphate
DEAE
die thy1aminoe thy1
dGTP
deoxyguanosine-5'-triphosphate
DNA
deoxyribonucleic acid
DTT
dithiothreitol
dTTP
thymidine - 5'- triphosphate
E. coli
Escherichia coli
EDTA
ethylenediamine tetra-acetic acid
form I
superhelical plasmid DNA
form II
nicked circular DNA
form III
linear duplex DNA
G: C
double-stranded poly(dG):poly(dC)
GTP
guanosine-5'-triphosphate
kb
kilobase
kd
kilodaltons
PMSF
phenylmethylsulfonylfluoride
ix

POLY(dA)
polydeoxyadenylic acid
POLY(dC)
polydeoxycytidylic acid
POLY(dG)
polydeoxyguanylic acid
POLY(dT)
polydeoxythymidylic acid
RNA
ribonucleic acid
rpm
revolutions per minute
SDS
sodium dodecyl sulfate
ssb
E. coli single-stranded binding protein
telomerase
telomere terminal transferase
Z-DNA
left-handed helical double-stranded DNA
X

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
IN VITRO EXCISION OF ADENO-ASSOCIATED VIRUS DNA FROM
RECOMBINANT PLASMIDS: ISOLATION OF AN ENZYME FRACTION
FROM HELA CELLS THAT CLEAVES DNA AT POLYPURINE-
POLYPYRIMIDINE SEQUENCES RICH IN GC BASE PAIRS
By
H. Jonathan Gottlieb
August 1988
Chairman: Nicholas Muzyczka
Major Department: Immunology and Medical Microbiology
When circular recombinant plasmids containing adeno-associated
virus (AAV) DNA sequences are transfected into human cells, the AAV
provirus is rescued. Using these circular AAV plasmids as substrates, a
cellular site-specific endonuclease, endo R, was isolated from HeLa cell
nuclei on the basis of its ability to excise intact AAV sequences in
vitro from the vector DNA and produce linear DNA products. The enzyme
recognizes and cleaves polypurine-polypyrimidine sequences which are at
least 9 residues long and rich in GC base pairs. Such sequences occur
naturally in non-coding regions of higher eucaryotes, are present in AAV
recombinant plasmids as part of the first 15 bp of the AAV terminal
repeat and, in some cases, are present at the AAV/vector junction as the
result of cloning by GC tailing. Plasmid DNA that is transfected into
tissue culture cells is cleaved in vivo to produce a pattern of DNA
fragments similar to that seen with purified enzyme in vitro. The level
xi

of specific cleavage in the standard assay depends on the type and
length of the recognition signal in the substrate. Generally, longer
and more homogeneous stretches of poly(dG):poly(dC) are better
substrates for double-stranded cleavage. The enzyme apparently
recognizes the secondary structure characteristic of G-rich polypurine
sequences in duplex DNA. Sequence analysis of the cut site suggests
that double-stranded cleavage occurs through a series of concerted
single-stranded nicks of the substrate throughout the enzyme recognition
site.
The molecular weight of the active form of endo R was estimated by
gel filtration and sedimentation in glycerol gradients to be
approximately 125,000. The enzyme, which requires magnesium as a
cofactor, does not have significant endonucleolytic activity on single-
stranded DNA, but is equally active on closed circular and linear duplex
DNA substrates. The properties of endo R are consistent with it playing
a role in the rescue of integrated AAV sequences. The enzyme's function
in cellular DNA metabolism is less obvious, but its properties suggest
that it may have a role in cellular DNA replication and recombination.
xii

CHAPTER I
INTRODUCTION
Introduction
A major obstacle in the characterization of cellular factors
involved in mammalian DNA metabolism lies in establishing a
biochemically and genetically defined system. For the most part, the
complexity of cellular processes and the lack of genetic analysis in
higher eucaryotes prevent accurate characterization of these processes.
This problem has been partially circumvented with the use of well
characterized mammalian viral systems as probes for cellular functions
(Challberg and Kelly, 1979; Li and Kelly, 1984; Murakami et al.. 1986).
In this regard, adeno-associated virus (AAV) is ideal. AAV has been
well characterized genetically (Hermonat et al.. 1984), and because of
its small size, is largely dependent on cellular functions for viral
multiplication (Berns et al., 1985) .
AAV DNA Replication
The current model for AAV DNA replication is a modified version of
a general model for the replication of eucaryotic DNA molecules first
proposed by Cavalier-Smith (Cavalier-Smith, 1974; Hauswirth and Berns,
1977; Straus et al.. 1976). AAV contains a 4.7 kb single-stranded
linear genome consisting of an internal nonrepetitive sequence which is
flanked at each end by inverted terminal repeats that are palindromic
(Lusby et al.. 1980). DNA replication proceeds by leading strand
1

Figure 1-1. Model for AAV DNA Replication.
The model for AAV DNA replication is a modified version of the model for
eukaryotic DNA replication first described by Cavalier-Smith (1974). i)
Single or double-stranded specific cleavage at the AAV/pBR322 junction
is necessary to allow formation of the hairpin primer in the palindromic
region of the termini. Site specific cleavage must occur at the other
AAV/vector junction either before or during DNA synthesis to separate
AAV and vector sequences. ii) DNA replication proceeds from the 3' end
of the primer to the other end of the molecule and includes synthesis of
the distal terminal repeat. iii) A specific nick is required on the
parental strand directly across from the original 3' end of the primer
to allow repair of the parental terminal sequences (iv). Both the
parental and progeny strands are now capable of initiating another DNA
replication cycle.

3
(Site—Specific
Cleavage
Lil
“u
RF Resolution

4
synthesis from the hairpin primer formed in the palindromic region of
the terminal repeat (Figure 1-1). Strand elongation proceeds from the
3' end of the primer, in a 5' to 3' direction, to the other end of the
molecule. A specific nick is required in the parental strand at a point
directly across from the original 3' terminal base to allow repair of
the parental terminal sequences and to produce a full-length duplex
replicative intermediate. Subsequently, both the parental and progeny
strands are capable of initiating a second round of DNA replication and
displacing a progeny single-stranded DNA molecule.
Rescue of Latent AAV Provirus
AAV is a defective parvovirus and requires the presence of a co¬
infecting helper virus for a productive viral infection. Virtually any
member of the adenovirus or herpes virus family can supply the helper
functions (Atchison et al.. 1965; Buller et al.. 1981; McPherson et al..
1985). In the absence of a helper virus, AAV readily integrates into
the host DNA (Hoggan et al.. 1972; Berns et al.. 1975; Handa et al..
1977), either as a single proviral copy or more often as a tandem head
to tail array of several AAV genomes (Cheung et al., 1980; Laughlin et
al., 1986; McLaughlin et al.. 1988). Super-infection of latently
infected cells with helper virus results in the rescue of integrated
provirus and normal AAV replication (Hoggan et al.. 1972).
In many proviral cell lines the yield of replicative intermediates
and virus produced by superinfection with helper virus are identical to
those obtained from exogenous AAV infections (Laughlin et al.. 1986;
McLaughlin et al.. 1988). This suggested that the rescue of AAV
sequences from chromatin is a rapid event initiated by specific cleavage

5
within the AAV termini. Additional evidence that AAV rescue involves a
site-specific nuclease comes from the study of recombinant AAV plasmids
which, presumably, rescue by a mechanism similar to that used by
proviruses integrated into chromatin (Samulski et al.. 1982). When AAV-
pBR322 plasmids are transfected into human cells in the presence of
adenovirus, free linear duplex AAV DNA, the major replicative form
(Straus et al.. 1976; Hauswirth and Berns, 1977), is seen within 24
hours (Samulski et al.. 1982). However, when viable terminal deletion
mutants are transfected into adenovirus infected cells, the formation of
replicative forms (RF) is delayed (Samulski et al.. 1983; Lefebvre et
al., 1984, Samulski et al.. 1987), indicating that either gene
conversion of the terminal deletion causes a delay in DNA synthesis, or
that AAV sequences at the termini are required for excision. Studies
with the AAV mutant, psub201+, in which the terminal 13 bp have been
deleted from both ends, suggest that the delay in RF formation is due to
a defect in rescue (Samulski et al., 1987) and that the signal for AAV
excision resides in the terminal sequences. AAV DNA replication in
adenovirus infected cells transfected with psub201+ was eight-fold more
efficient when the AAV sequences were cleaved from the vector sequences
prior to transfection (Samulski et al.. 1987). Presumably, cleavage of
the plasmid bypassed the excision step which must normally precede DNA
replication.
In principle, the duplex replicative intermediate can be generated
from the covalently closed form I plasmid DNA in one of two ways.
Either the AAV sequences are separated from the plasmid by precise
excision or a single-stranded DNA molecule is generated by AAV-specific
replication. (See Samulski et al.. 1983, and Senepathy et al.. 1984,

6
for examples of the second mechanism.) Because the AAV termini are also
the origins for AAV DNA replication (Hauswirth and Berns, 1977; Samulski
et al. . 1983; Senepathy et al.. 1984), it is difficult to distinguish
between the two mechanisms. Both mechanisms, however, require either a
specific nick or a double-stranded cut at an AAV/vector junction in the
input plasmid DNA (Figure 1-1). Thus, it should be possible to use AAV
recombinant plasmids as substrates for an in vitro excision assay and to
screen cellular extracts for an activity that produces either single-
stranded nicks or double-stranded cuts at the AAV/vector junctions.
General Aim of the Studies
Using the recombinant AAV plasmids as substrates, an enzyme
fraction was isolated from HeLa cell nuclear extracts that rescued
intact AAV DNA from vector DNA in vitro and produced linear DNA
products. The double-stranded cleavage activity has been called endo R
because of its ability to rescue AAV sequences. The activity was of
cellular origin and was stimulated approximately 5 fold by Ad2 infection
in the presence of hydroxyurea.
In the following chapters, the purification and properties of the
enzyme are discussed and the activity observed in vitro is compared with
what is observed in vivo. In addition, the behavior of the enzyme
suggests that it may be involved in cellular DNA metabolism, and these
properties are discussed as well.

CHAPTER II
MATERIALS AND METHODS
Cell Culture and Viruses
HeLa S3 cells were maintained at 37°C in suspension culture in
Eagles minimal essential medium supplemented with 5% calf serum, 1%
glutamine, penicillin and streptomycin. Wild type adenovirus 2 (Ad2)
was prepared from a freeze/thaw lysate of HeLa S3 cells as previously
described (Samulski et al.. 1983). HeLa monolayer cells were
transfected with 5.0 /¿g DNA by the DEAE-dextran method (McCutchan and
Pagano, 1968) as described (Muzyczka, 1980), and infected with Ad2 virus
at a multiplicity of infection (moi) of 10. Low molecular DNA was
isolated from the cells by the method of Hirt (1967) as described
(Muzyczka, 1980).
Recombinant Clones and Enzyme Substrates
All recombinant clones were maintained in either the recA host
HB101 (Boyer, 1969) or the recBC. recF. sbcB host JC8111 (Boissy and
Astell, 1985), a gift from Peter Tattersall. This was to prevent
variation in the size of the G:C tails and other repetitive inserts
(Hauswirth et al., 1984) and to prevent deletion of the palindromic AAV
terminal repeat (Samulski et al.. 1982).
The AAV wild-type plasmid pSM620 contains a full copy of the AAV
genome inserted by GC tailing into the PstI site of pBR322 (Bolivar et
al., 1979). The plasmid contains 18 bp of poly(dG):poly(dC) (G:C) at
7

8
the left pBR322/AAV junction and 28 bp of G:C at the right junction
(Samulski et al.. 1983). The AAV terminal mutant clone, pSM703, was
isolated by Samulski et al. (1983) and was sequenced as part of this
study. It contains 100 bp deletions in both AAV terminal sequences, 38
bp of G:C tail at the right AAV/pBR junction, and 36 bp G:C at the left
junction. The plasmids pGM620C and pGM620D contain either the left or
the right terminal PstI fragment, respectively, of the wild-type AAV
plasmid, pSM620 (Samulski et al.. 1983), subcloned into the PstI site of
pBR322 (Bolivar et al., 1979). Both clones contain the original
poly(dG)-poly(dC) tails that are present in pSM620. The plasmid pGM1008
was constructed by removing the Pstl-BssHII fragment (AAV nucleotides
4254 to 4657) from pGM620D and religating the molecule after producing
blunt ends with the Klenow fragment of DNA polymerase I. The plasmid
contains the parental poly(dG)-poly(dC) tail plus the terminal 21 bp of
the AAV sequence up to the BssHII site at nucleotide 4657.
The plasmids pGM913, pGM1116, pGM1505, pGM1635, pGM1228, pGM1344
and pGM1483 were constructed by inserting chemically synthesized
oligonucleotides (Systec) into a unique restriction site in pBR322. To
construct these clones, 2 pmol of single-stranded oligomer was boiled
with an equal amount of the appropriate complementary strand in 20 /il of
water for 5 minutes. The reaction was then cooled slowly to room
temperature to allow the formation of duplex molecules. Ligation
reaction mixtures containing 2 pmol of annealed oligomer, 0.2 pmol of
PstI linearized pBR322 and 400 units of T4 DNA Ligase (New England
BioLabs) were incubated at 15°C for 12-24 hours. The 5' ends of the
single-stranded oligomers were phosphorylated only when multiple tandem
copies of the insert were desired. Dephosphorylation of the vector was

9
generally not required under these conditions. Positive clones retained
tetracycline resistance, but were sensitive to ampicillin.
The plasmids PGM913 and pGM1116 contain 13 and 9 base pairs of G:C
homopolymer, respectively. PGM1635 contains 20 bp of alternating
copolymer GC, and pGMl505 contains the Dictyostelium telomeric repeat
sequence (C2-6^5 (Shampay et al. . 1984). Two plasmids contain the
sequence of the terminal 21 bp of AAV (ggCCaCTCCCTCTCTgCgCgC), in either
a monomer form (pGM1228) or as an inverted dimer (pGM1344). All of the
above clones were constructed by inserting the oligomers into the PstI
site of pBR322. Additionally, the plasmid pGM1483 contains an insert of
the Tetrahymena telomeric sequence, (0^2)3 (Blackburn and Szostak,
1984), chemically synthesized and inserted into the EagI site of pBR322.
In each case, both strands of the oligonucleotides were synthesized so
that the restriction enzyme recognition site was maintained after the
two strands of each oligonucleotide were annealed and ligated into
pBR322. The inserts and pBR322 flanking sequences of these plasmids
were confirmed by DNA sequencing.
The plasmid pGA38, a gift from Todd Evans, contains an insert of
the alternating co-polymer (GA^g, cloned into the EcoRI site of pUC9
(Evans and Efstratiatis, 1986). PGA11 is a subclone of pGA38 and
contains an insert of (GA)-q cloned into the EcoRI site of pUC9. The
plasmid pEV136, a gift from Eckhardt Wimmer, is an infectious polio
clone and contains an 18 bp G:C insert at the EcoRI site, as well as an
84 bp stretch of poly(dA):poly(dT) (Semler et al.. 1984).

10
Purification of Endo R
All operations were carried out at 0-4°C. To minimize the effects
of proteolysis, all buffers contained 0.1 mM phenylmethylsulfonyl-
fluoride (PMSF) and the time between chromatographic steps was kept to a
minimum. Nuclei from eight liters of adenovirus infected HeLa S3 cells,
grown in the presence of 10 mM hydroxyurea (Sigma Chemical Co.), were
isolated as described by Challberg and Kelly (1979). Frozen nuclei were
thawed on ice and 5 M NaCl was added to a final concentration of 0.2 M.
After incubation on ice for 2 hours, the nuclei were pelleted by
centrifugation at 3000 x g for 15 minutes, the pellet was discarded and
the supernatant was dialyzed against 25 mM Tris-HCl pH 8.0, 10 mM KC1,
0.1 mM EDTA, 5 mM 2-mercaptoethanol, 0.1 mM PMSF and 20% glycerol
(Buffer A). Any insoluble precipitate in the nuclear extract was
removed by centrifugation at 12000 x g for 20 minutes and the
supernatant was retained as fraction I. Fraction I contained 34.2 mg/ml
protein, as determined by the Bradford protein concentration assay
(Bradford, 1976), in a volume of 25 ml.
Fraction I was loaded onto a 15 ml DEAE cellulose column
previously equilibrated with buffer A, pH 8.0. The column was then
washed with 3 column volumes of buffer A and eluted in the same buffer
with a 150 ml linear gradient containing 0.01 to 0.5 M KC1. Fractions
emerging between 0.1 and 0.25 M KCl were pooled to form fraction II and
contained 2.7 mg/ml protein a total volume of 60 mis. Fraction II was
dialyzed against two 1-liter changes of buffer B (10 mM sodium
phosphate, pH 6.5, 5 mM 2-mercaptoethanol, 10% glycerol and 0.1 mM PMSF)
containing 0.01 M NaCl and loaded onto a 7 ml phosphocellulose column
pre-washed with 21 mis of the same buffer. The column was eluted with a

11
70 ml linear gradient from 0.01 to 1 M NaCl in buffer B. Active
fractions emerged about halfway through the gradient and were pooled to
form fraction III. Fraction III contained 0.16 mg/ml protein in 45 ml
and had a specific endo R activity of approximately 3000 units/mg.
Fraction III was split into 2 aliquots and each aliquot was concentrated
about 55 fold using an Amicon Centriflo 25 spin concentrator, yielding a
final protein concentration of 18 mg/ml in 2.0 ml. The two 1.0 ml
aliquots of concentrated fraction III were passed separately through a
36 ml (1.5 x 45 cm) column of Sephadex G200 equilibrated with buffer B,
pH 6.5, 250 mM NaCl. Fractions containing endo R activity were pooled
(fraction IV), dialyzed against buffer B containing 0.01 M NaCl and
loaded onto a 3 ml poly(dG) agarose column equilibrated in buffer B, 10
mM NaCl. The column was washed with 3 bed volumes of the same buffer
and eluted with a 30 ml linear gradient from 0.01-1.0 M NaCl. Active
fractions were pooled (fraction V) and dialyzed into 25 mM Tris-HCl, pH
7.5, 50% glycerol, 0.1 mM DTT. Fraction V was stable for at least 2
months at -20°C without measurable loss of activity.
Nuclease Assays
The standard endo R reaction mixtures of 25 /¿I contained 20 mM
Tris-HCl (pH 7.5), 5 mM MgC^, 1 mM dithiothreitol, 0.2 pmol form I
plasmid substrate and 0.1-5.0 units of endo R (see below). After
incubation at 37°C, the reaction products were phenol extracted, ethanol
precipitated and digested with either BstEII at 60°C for 1 hour or with
SphI at 37°C for 3 hours. The reaction products were then fractionated
by electrophoresis on 1.4% agarose gels. One unit of endo R activity is
defined as that amount of protein that is required to cleave 50% of

12
pGM620D substrate under standard conditions. During early stages of the
purification, it was necessary to treat the reaction products with 0.25
mg/ml proteinase K (Sigma) for 1 hour at 37°C prior to phenol extraction
and gel electrophoresis. When indicated, endo R cleavage reactions were
terminated with the addition of an equal volume of a 2x proteinase K
stop solution, containing 0.5 mg/ml Proteinase K, 1% SDS and 20 mM EDTA.
After addition of the stop solution, incubation was continued at 37°C
for at least 1 hour.
Single-stranded nuclease assays contained 5.0 pg of heat-denatured
^H-labeled E. coli chromosomal DNA (1 x 10^ cpm/pg) in 250 pi. For SI
nuclease, the mixtures contained 50 mM sodium acetate (pH 4.5), 0.3 M
NaCl, 10 mM ZnC^, and 1.25 units of SI, while the endo R reaction was
under standard reaction conditions. Twenty-five microliter portions
were removed at the indicated times and added to 2ml of 10%
trichloroacetic acid (TCA) containing 200 pg/ml BSA. The precipitates
were collected on nitrocellulose filters (Schleicher and Schuell type
BA85), washed with TCA and ethanol and then counted. E.coli DNA was
O
labeled with H-thymidine (6.7 Ci/mmole, ICN) and isolated as described
(Holloman et al., 1981).
DNA Labeling. Sequencing and Primer Extension
Nucleotide sequences were determined by the method of Maxam and
Gilbert (1977) and by the dideoxy method (Sanger et al.. 1977). For
Maxam and Gilbert sequencing of the pGM clones, 10 pg of DNA was
linearized with Seal. dephosphorylated with calf intestine alkaline
phosphatase (CIAP) and labeled at the 5' end with polynucleotide kinase
o o 30
and 7 P-ATP or labeled at the 3' end with the Klenow fragment, a P-

13
dCTP and 80 /tM each of dGTP, dATP and TTP. Five micrograms of the
labeled DNA was further digested with BamHI and the 5' or 3' labeled
Scal-BamHI fragments were isolated from 1.2% low melting agarose prior
to sequencing. Endo R cleavage fragments were prepared by incubating
the remaining 5 /tg of 5' or 3' labeled DNA with 10 units of fraction V
endo R under standard reaction conditions and isolating the labeled endo
R/Scal fragments from a 4% non-denaturing acrylamide gel as described
(Maniatis et al.. 1982). The sequence at the site of cleavage was
determined directly from the sequencing gels by comparing the mobility
of the endo R fragments and the sequence markers.
For primer extension of endo R products, 2 /ig of plasmid DNA was
incubated with endo R in a standard reaction mixture of 50 /il. The form
III product was then isolated from 1.2% low melting agarose and
dissolved in 10 /il of water and 4 /tl of 5x reaction buffer (0.3 M Tris-
HC1, pH 8.3; 0.375 M NaCl; 37.5 mM MgCl2 and 2.5 mM DTT). The reaction
mixtures were divided into two 7 /il portions and 1 /il of either upper or
lower strand pBR322/PstI primers (2 pmol//il) was added to each portion.
The solutions were heated to 100°C for 5 minutes under parafin oil and
immediately frozen in a dry ice/ethanol bath. After thawing on ice, 1
/il each of stock solutions containing 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM
TTP, 0.02 mM dATP; 10 /iCi//il a32P-dATP (>3000 Ci/mM) and 10 units//il AMV
reverse transcriptase (IBI) were added to each portion to produce a
final reaction volume of 10 /il. After incubation at 42°C for 10
minutes, 2 /il of chase solution (0.25 mM each of dGTP, dATP, dCTP and
TTP) was added and incubation was continued at 42°C for an additional 10
minutes. The reaction was terminated with the addition of 7 /il of stop
buffer containing 1.6 /il 0.25 M EDTA; 2 /tl 3 M sodium acetate; 0.2 /tl 2

14
mg/ml tRNA and 3.2 pi water. After ethanol precipitation with 3 volumes
of 95% ethanol, the primer extension products were redissolved in 5 pi
of sequence gel running buffer (Maxam and Gilbert, 1977) and heated to
100°C for 3 minutes prior to gel electrophoresis. The sequence at the
site of endo R cleavage was determined by comparing the mobility of the
primer extension products with dideoxy sequencing ladders produced using
identical single-stranded primers.
Gel Electrophoresis
Electrophoresis in the presence of sodium dodecyl sulfate was done
according to Laemmli (1970) in slab gels of 7.5% acrylamide, 0.2% N,N'-
methylene-bisacrylamide. The gels were fixed in 50% methanol overnight
and silver stained as described (Switzer et al.. 1979).
Neutral polyacrylamide and agarose gel electrophoresis of DNA was
as described (Muzyczka, 1980). DNA fractionated on agarose gels were
transferred to nitrocellulose filters (Southern, 1975) and hybridized to
o o o
¿P-nick translated DNA probe (>2x10 cpm/pg) as described (Muzyczka,
1980).
Denaturing polyacrylamide-urea gels were as described (Maxam and
Gilbert, 1977). All sequencing gels were run at 55-60°C to prevent
compression of palindromic sequences (Lusby et al.. 1980).
For denaturing agarose gels, 1.5% horizontal agarose gels were
poured in 50mM NaCl and allowed to equilibrate in excess running buffer
(30 mM NaOH, 1 mM EDTA) for at least 1 hour. Samples were incubated for
5 minutes in gel running buffer (Maniatis et al.. 1982) containing 0.2 N
NaOH prior to electrophoresis at 30 volts for at least 24 hours.

15
Estimation of the Isoelectric Point
Estimation of the pi of endo R was performed by a modified version
of the method by Yang and Langer (1987). Eight 100 /il aliquots of
packed DEAE-cellulose (Whatman DE32) was equilibrated in 0.1 M Tris-HCl
at pH 7.0, 7.5, 8.0 or 8.5 or in 0.1 M 2, 2'-Bis(hydroxymethyl)-
2,2',2''-nitrilo triethanol (Bis-Tris) at pH 5.5, 6.0, 6.5 or 7.0. This
required several changes of buffer until no change in the pH of the
supernatant was observed. After equilibration, the cellulose was packed
by centrifugation at 1000 x g for 1 minute and the supernatant was
decanted. Mixtures of 20 /il of fraction III endo R and 80 /il of 0.1 M
Tris or 0.1 M Bis-Tris buffer, at the appropriate pH, were added to the
packed resin and the samples were incubated on ice for 30 minutes with
frequent mixing to allow the protein to adsorb to the resin. After
pelleting at 1000 x g for 1 minute, the supernatant was removed and
assayed for endo R double-stranded cleavage activity as described above.
The pi was determined to be equal to the lowest pH at which all the
activity had been adsorbed from the supernatant.
Chromatographic Media. Enzymes and Materials
DEAE-cellulose (DE32) and phosphocellulose (P-11) were purchased
from Whatman. Sephadex G200, poly(dG) agarose, and calf intestine
alkaline phosphatase (CIAP) were from Sigma and Bio-Gel A1.5M was
purchased from BioRad. All restriction endonucleases, T4 DNA ligase and
polynucleotide kinase were purchased from New England Biolabs. The
labeled nucleotides, a^P-dNTPs and y^P-ATP (>3000 Ci/mmol) were from
New England Nuclear and H-thymidine (6.7 Ci/mmol) was from ICN.

16
Other Methods
Protein concentrations were determined by the procedure of
Bradford (1976). The Biogel A1.5M (45.5 x 0.7 cm) and the Sephadex G200
(45.5 x 1.0 cm) columns were calibrated in 10 mM NaP04, pH6.5; 0.25 M
NaCl; 10% glycerol and 5 mM 2-mercaptoethanol. The excluded volume was
determined with the use of Blue Dextran 2000 (molecular weight >2
million, Sigma) and the column was calibrated with the use of B-amylase
(200 kd), alcohol dehydrogenase (150 kd), BSA (66 kd), carbonic
anhydrase (29 kd) and cytochrome C (12.4 kd) as molecular weight
standards (Sigma Chem. Co.).
Estimate of In Vivo Excision Frequency
A typical transfection uses 0.1-10 /¿g of plasmid DNA per 10 cm
dish or approximately 3xlO^-3xloH molecules per dish. Assuming 10^
3 5
competent cells per dish, each competent cell will have 3x10 -3x10
molecules of plasmid DNA. This agrees reasonably well with the amount
of plasmid DNA recovered from transfected cells as measured by filter
hybridization. If the in vitro frequency of cleavage by endo R at an
outboard site of AAV is 1%, cleavage at both outboard sites to produce
an intact replicative form would be 0.01%. This would produce 0.3 to 30
molecules of excised AAV per transfected cell.

CHAPTER III
PURIFICATION OF ENDO R
Detection of a Site-Specific Endonuclease Activity
in Crude Nuclear Extracts
The results from studies of AAV replication in vivo from latently
infected cells and transfected AAV plasmids suggest that rescue from
chromatin and from recombinant plasmids occurs by a similar mechanism
(Samulski et al., 1982) and that the sequences at or near the AAV
termini are essential for this excision activity (Samulski et al.,
1987). Taking these observations into account, the wild type AAV
plasmid, pSM620, was used as a substrate to assay for an activity that
would specifically excise AAV sequences from the plasmid. The plasmid
pSM620 contains the entire AAV genome cloned into the PstI site of
pBR322 by GC tailing (Samulski et al.. 1982). To detect site-specific
cleavage at the AAV/vector junction, form I supercoiled DNA was treated
with cell-free extract and digested with a one-cut restriction enzyme
that cleaves either in the AAV sequences (BstEII) or in vector DNA
(SphI). The products of the assay were then fractionated by agarose gel
electrophoresis. Figure 3-1 illustrates the fragments that would be
produced if cleavage occurs at either the left or right AAV/pBR
junction. For example, cleavage with cellular extract at the right
junction would generate a linear plasmid DNA molecule which, after
BstEII digestion, would produce a 3.0 kb fragment which consists
exclusively of AAV DNA and a reciprocal 6.1 kb band that contains both
AAV and pBR sequences.
17

Figure 3-1. Endo R Agarose Gel Assay.
The figure illustrates the products that would result from partial
digestion by endo R and complete digestion by BstEII (left pathway) or
Sohl (right pathway) when the wild type plasmid, pSM620, is used as
substrate. The thick line represents AAV DNA; the thin line represents
pBR322 DNA; vertical lines represent cleavage sites of BstEII (B) , SphI
(S), and endo R (R). The filled squares represent the AAV terminal
sequences. AAV cleavage occurs at the junction between the AAV termini
and the vector DNA.

19
R+Bst
i
3.0
1.7 B 7.4
1.7 9 3.0
e.o S 3#1
U—l
1.3 S 3.1
4.4
4.7

20
Using the agarose gel assay, crude extracts prepared from Ad2
infected, Ad2/AAV co-infected and uninfected HeLa cell nuclei were
screened for the ability to cut near the AAV/vector junctions and the
products were visualized by transfer to nitrocellulose filters and
hybridization to AAV specific probe (Southern, 1975). Specific double-
stranded cleavage activity was observed in uninfected and Ad/AAV co-
infected cells at comparable levels. However, a 5-fold stimulation was
observed in extracts from Ad2 infected cells treated with hydroxyurea.
Whole cell extracts and extracts prepared from a 0.2 M NaCl wash of
freeze-fractured nuclei (Challberg and Kelly, 1979) contained
approximately equal amounts of activity, while nuclear extracts usually
contained fewer contaminating nucleases. For these reasons, nuclear
extracts from Ad2-infected HeLa cells treated with hydroxyurea were used
as the primary source of activity.
Purification of Endo R
In the procedure outlined in Table I, crude nuclear extracts
(fraction I) were prepared from Ad2-infected HeLa S3 cells, grown in the
presence of lOmM hydroxyurea, and harvested at 21 hours post-infection
(Challberg and Kelly, 1979). Due to the high level of contaminating
endonucleases and cellular DNA (Figure 3-2), specific double-stranded
cleavage activity could be detected at this stage only by Southern
hybridization (Southern, 1975). Fraction I was applied to a column of
DEAE cellulose and the activity that was eluted from the column was
essentially free of nucleic acid and separated from at least one
nonspecific cellular nuclease which did not bind to the column.
Fraction II endo R activity (and the activity in subsequent fractions)

21
TABLE I
PURIFICATION OF ENDO R
Fraction
Volume
Activity
Protein3
Specific
Activity
ml
units
mg
units/mg
I.
Nuclear Extract
25.0
60000
855.0
70
II.
DEAE-cellulose
60.0
60000
159.6
376
III.
Phosphocellulose
47.5
48000
38.5
1247
IV.
Sephadex G200
19.8
10000
9.1
1099
V.
Poly(dG) agarose
3.6
9000
2.9
3103
aProtein concentrations were determined by the method of Bradford (1976).

Figure 3-2. Enzyme Titration of Fractions I, II and III.
Standard reaction mixtures of 25 /¿I contained 0.1 pmol of pSM620 form I
plasmid and the indicated amounts (/¿l) of nuclear extract (NE, Fraction
I), DEAE-cellulose fractions (DEAE, Fraction II) or phosphocellulose
fractions (Pcell, Fraction III). Reactions were terminated at 1 hour
with the addition of proteinase K stop solution (see Chapter II), phenol
extracted, ethanol precipitated and digested with BstEII. The samples
were fractionated on a 1.4% agarose gel, transferred to a nitrocellulose
filter and hybridized to AAV-specific probe.

23

24
could be detected directly by ethidium bromide staining of the gel assay
(Figure 3-2). Active fractions from DEAE cellulose chromatography
usually contained an overlapping peak of nonspecific nucleolytic
activity. Further fractionation on a column of phosphocellulose
produced an activity (fraction III) that exhibited substantially more
specific cleavage with little evidence of contaminating nucleolytic
activity at low enzyme concentrations (Figure 3-2). Nevertheless, high
levels of fraction III enzyme resulted in non-specific degradation of
the DNA substrate (data not shown). In order to separate the remaining
contaminating nucleolytic activities from endo R, fraction III was
further purified by chromatography on Sephadex G200 (fraction IV) and
poly(dG) agarose (fraction V). Endo R activity emerged from the
Sephadex G200 column just behind the void volume. This step resulted in
a substantial loss of total endo R activity, but has been retained as
part of the purification protocol for qualitative purposes. Endo R
emerges from the final column, poly(dG) agarose, as a single symmetrical
peak, when eluted with a linear increasing salt gradient, with little
additional loss of activity.
Fraction IV endo R is stable for at least 2 months at
-20°C without measurable loss of activity. The stability of the enzyme
is greatly reduced when the concentration of protein falls below 200
/ig/ml. For this reason, fraction V enzyme is dialyzed into buffer
containing 50% glycerol and supplemented with 200 /ig/ml enzyme grade BSA
for periods of storage of up to 2 months at -20°C.

25
The Endo R Agarose Gel Assay
For the purposes of the gel assay, endo R can be thought of as a
restriction enzyme with two sites in pSM620 (Figure 3-1). The products
of endo R digestion can be seen as the products of a partial digestion
of the substrate at either of the AAV/vector junctions. Further
digestion of endo R products with the restriction enzyme BstEII. which
cuts once asymmetrically in the AAV sequences, produces 6.1 and 3.0 kb
fragments from endo R cleavage at the right AAV/pBR322 junction and 7.4
and 1.7 kb fragments from cleavage at the left junction. The formation
of endo R products, using the plasmid pSM620 as substrate, is
illustrated in figure 3-3 with the titration of partially purified
enzyme (fraction III). As the reaction nears completion, most of the
AAV/vector junctions are cleaved and produce the fragments expected from
cleavage by BstEII and endo R. Linear fragments (form III) are the
result of BstEII digestion of unreacted substrate. In further
discussion, the production of the 3.0 and 1.7 kb fragments, which are
easily monitored, is used to quantitate the amount of cleavage at the
right and left junctions, respectively.
Molecular Size and Purity of Endo R
Estimates of the molecular weight of the native protein were made
by chromatography of endo R on gel filtration columns and by
centrifugation in glycerol gradients. The peak of endo R activity
emerges from a Bio-Gel A1.5M column (see Chapter II: Materials and
Methods) behind the 150 kdal alcohol dehydrogenase molecular weight
marker with an apparent molecular weight of 120-125 kdal (data not
shown). This is in good agreement with the observed behavior in a

Figure 3-3. Enzyme Titration of Fraction III.
The numbers at the top refer to the number of units of endo R used in a
each reaction (see Chapter II: Materials and Methods). The sizes of the
major cleavage fragments are indicated on the right. Standard endo R
reaction mixtures (25 ¿¿1) contained 0.5 ng of form I pSM620 plasmid DNA,
5 mM MgCl2, 20 mM Tris-HCl (pH 7.5), 1 mM DTT, and the indicated amount
of fraction III enzyme. After incubation for 1 hour at 37°C, the
reaction products were treated with phenol, precipitated with ethanol,
and digested with BstEII. The reaction mixture was then fractionated on
a 1.4% agarose gel, transferred to a nitrocellulose filter and
hybridized to nick-translated ^P-AAV DNA.

27
-1.7

28
glycerol gradient (Figure 3-4A), in which the peak of double-stranded
cleavage activity sedimented slightly more slowly than the 150 kdal
marker. The sedimentation results correspond to an empirically
determined sedimentation coefficient (S20 w) of 6.8 (Figure 3-4B) and a
molecular weight of 115 kd, assuming a spherical structure of the
enzyme.
Pooled fractions from the poly(dG) agarose column, fraction V
(Figure 3-5A, fractions 15-21), contain one major and 4 minor protein
bands when analyzed by SDS polyacrylamide gel electrophoresis and silver
staining. However, when individual fractions across the peak of endo R
activity were analyzed on SDS gels (Figure 3-5B) and compared with the
activity profile in the agarose gel assay (Figure 3-5A), the pattern of
the major 100,000 molecular weight band was most consistent with the
profile of specific cleavage activity. In addition, two other proteins
of minor intensity, with molecular weights of 56 and 89 kd, appeared in
a subset of the active fractions in a pattern not inconsistent with the
activity profile (Figure 3-5C). As a result, it is possible that these
peptides are responsible for the cleavage activity or contribute either
as minor subunits or accessory peptides. It is also possible that the
56 and 89 kd peptides are proteolytic breakdown products of the major
100 kd protein. Attempts to purify endo R further or to isolate an
active form from a non-denaturing acrylamide gel have been unsuccessful,
probably due to the instability of the protein at low concentrations or
to the loss of subunits and/or accessory proteins.

Figure 3-4. Sedimentation Analysis of Endo R by Glycerol Gradient
Centrifugation.
A. Glycerol gradients (20-40%), in 0.1 M Tris-HCl, pH 7.5, 0.1 mM DTT
were prepared in 5 ml polyallomer ultracentrifuge tubes. One milligram
of fraction III endo R was combined with 0.25 mg of alcohol
dehydrogenase, in 0.2 ml 0.1 M Tris-HCl, pH 7.5, 0.1 mM DTT. The
mixture was layered on top of a glycerol gradient and the tube was
centrifuged for 30 hours at 45,000 rpm and 4°C in a Beckman SW 50.1
rotor. Three other gradients containing endo R fraction III alone, a
mixture of the molecular weight standards B-amylase (200 kd) and BSA (66
kd), or alcohol dehydrogenase (150 kd) were run in parallel. Fractions
were collected from the bottom of the tube and the absorbance at 280nm
was determined (open circles). Fractions from gradients containing endo
R were also assayed for double-stranded cleavage activity using the
standard excision assay (filled squares). Sedimentation is from right
to left. B. The sedimentation coefficient (S20 y) of endo R was
determined from a plot of the mobility of each protein, represented as a
fraction of the total gradient length, against the S20 y literature
values (CRC Handbook of Biochem., 1979) of the following protein
standards: B-amylase (sweet potato, 8.9), alcohol dehydrogenase (yeast,
7.61), bovine serum albumin (4.41).

Absorbance (280nm)
30
Activity (

Figure 3-5. Molecular Weight and Purity of Endo R.
A) Agarose gel assay of peak fractions from poly(dG) agarose (Fraction
V). Reaction mixtures of 25 pi containing 0.1 pmols of BstEII digested
pSM620 DNA were incubated with 5 pi of the fraction indicated under
standard reaction conditions. The reactions were stopped after 1 hour
with the addition of 1/10 volume of gel running dye containing 0.2 M
EDTA and 1% SDS and then fractionated on a 1.4% agarose gel. B) SDS
polyacrylamide gel electrophoresis of peak fractions from poly(dG)
agarose. A constant volume (20 /il) of the fractions indicated were
added to an equal volume of 2X sample buffer, heated to 100°C for 3
minutes and separated on an SDS acrylamide gel as described in Chapter
II: Materials and Methods. A parallel slot contained the following
protein standards: B-amylase (205 kd), alcohol dehydrogenase (116 kd),
phosphorylase b (97 kd), bovine serum albumin (66 kd), egg albumin (45
kd), and carbonic anhydrase (29 kd). C) Molecular weights of the
peptides in Fraction V endo R. Poly(dG) agarose fractions 15-23 were
pooled to form fraction V and the molecular weights of the protein
species present were determined from their relative mobilities on an SDS
gel. Open circles represent the molecular weight standards described
for B; filled circles are endo R fraction V proteins.

32
11 13 15 17 19 21 23 25 27 29 31
Fm3-

33
1 1
Figure 3
13 15 17 19 21 23 25 27 29 31 M
- 205
- 116
- 97
- 66
5 (continued), part B

Molecular Weight x10“
Figure 3-5 (continued)
part C

CHAPTER IV
RESCUE OF AAV SEQUENCES
Localization of the Site of Cleavage to the AAV/Vector Junction
The excision of AAV sequences by a site specific endonuclease must
be rather precise in order to produce substrate forms that are capable
of replication without further modification. While minor deletions of
the terminal sequences incurred during rescue can be repaired through
gene conversion (Samulski et al.. 1983), a major deviation in the site
of cleavage would produce replicative forms that either lacked the
ability to self-prime, or contained extraneous vector DNA that would
have to be further processed prior to DNA replication. Therefore, an
enzyme postulated to be responsible for AAV rescue in vivo must take
these constraints on the site of cleavage into account.
To demonstrate that the site of cleavage was at the AAV/pBR322
junction, the products of the endo R reaction were hybridized to AAV-
and pBR322-specific probes (Figure 4-1). Specific cleavage occurring
precisely at the AAV/vector junction would produce a subset of fragments
that consisted of AAV or pBR322 sequences exclusively, and these could
be identified by probing duplicate Southern blots (Southern, 1975) with
AAV or pBR322 DNA (Figure 4-1, right panel). In this experiment,
reaction conditions were chosen to cleave 90% of the substrate (form I
pSM620) at least once. When the products of the reaction were examined
by ethidium bromide staining without further digestion with a
restriction enzyme, most of the product formed was linear plasmid DNA
35

Figure 4-1. Identification of AAV-Specific and pBR-Specific Fragments
in the Endo R Reaction.
PSM620 substrate was incubated with fraction IV enzyme in a standard
endo R reaction (R). Where indicated the reaction products were also
digested with BstEII or SphI. The products were fractionated in
duplicate on 1.4% agarose gels, transferred to nitrocellulose filters,
and hybridized to either AAV-specific or pBR-specific probe (right
panel). The endo R plus BstEII and endo R plus SphI fragment sizes are
indicated to the left and right of the right panel, respectively. The
left panel illustrates the reaction products stained with ethidium
bromide. Also indicated in the left panel are the sizes and positions
of the marker bands (M) and pSM620 relaxed circular (II) and linear
(III) plasmid DNA. The two unidentified lines to the right of each
panel indicate the position of linear AAV (upper) and linear pBR (lower)
DNA.

37
4-
CO
Q.
CD
cn
♦
+
o:
(T
AAV
pBR
m
N
<0 D.
03 CO
+• +
o: cr tr
-C
Q.
co
u>
03
+• +
o: cc cc
Bst
9.1 _
7.4-
6.1 ~
"-ü!!5 "*
Sph
9.1
* -7.8
-6-0
3.0 -
-3.1
J.3

38
(Figure 4-1, left panel, lane R). In addition, approximately 3% of the
products consisted of two fragments, 4.7 and 4.4 kb in length, which
were the sizes expected for excised duplex AAV and linear pBR322 DNA.
These were produced from double-stranded cleavage at both of the AAV/pBR
junctions. The identity of these fragments was confirmed by Southern
hybridization with selective probes. The slower migrating 4.7 kb
fragment hybridized exclusively to AAV-specific probe and the 4.4 kb
linear fragment hybridized only to pBR-specific probe (Figure 4-1, right
panel, R lanes). The fragments generated by further digestion of the
endo R products with either BstEII or SphI (see Figure 3-1) produced a
set of fragments consistent with endo R cleavage at either one or the
other of the AAV/pBR322 junctions. The 3.0 and 1.7 kb fragments
produced from BstEII digestion of endo R products contained only AAV
sequences and, therefore, hybridized only to AAV-specific probe.
Conversely, the digestion of endo R products with SphI generated 3.1 and
1.3 kb fragments, which consist entirely of pBR322 DNA, and were
detected only with pBR322-specific DNA probe. As expected, the higher
molecular weight fragments contain both AAV and pBR sequences and,
therefore, hybridize to both probes. These results, limited by the
sensitivity of hybridization, placed the position of the cleavage site
to within 25 bp of either AAV/vector junction.
Either AAV/Vector Junction Can Be Cleaved Independently of the Other
One proposed mechanism for gene conversion of AAV terminal mutants
to the wild type form requires the interaction between the two terminal
repeats (Lusby et al.. 1980; Samulski et al.. 1983). It was therefore
possible that cleavage by endo R required this type of interaction. To

39
determine if this was the case, subclones of pSM620, pGM620C and pGM620D
were constructed which contained either the left or right terminal
repeat of AAV, respectively (Figure 4-2C). In addition to the 145 bp
terminal sequence, both plasmids contained approximately 350 bp of
flanking AAV DNA. Both pGM620C and pGM620D were efficiently cleaved by
endo R and produced fragments of the expected size and sequence
composition when the endo R products were digested with SphI (Figure 4-
2, A and B). It was, therefore, concluded that either AAV/vector
junction could be cleaved independently of the other and that the
recognition sequence was contained within the terminal 500 bp of AAV.
Figure 4-2 also demonstrates that vector DNA, pBR322, is a poor
substrate for endo R.
Cleavage of AAV Terminal Mutants
A number of mutant AAV clones with deletions in the terminal
sequences were fortuitously produced during the course of constructing a
viable AAV recombinant clone (Samulski et al., 1983) . To identify the
endo R recognition signal more precisely, the sequences at the
AAV/vector junctions for several of the mutant AAV plasmids were
determined and the relative frequencies of cleavage were compared
(Figure 4-3 and Table II). The conclusion from these studies was that
there were three sets of sequences near the AAV/vector junctions that
could serve as endo R recognition sites. The first was a stretch of
poly(dG) residues that was present at many of the junctions and was a
result of plasmid construction by GC tailing. A second sequence, which
was called the AAV recognition signal, consists of nucleotides 3 to 15
of the AAV terminal repeat and contains the sequence CCaCTCCCTCTCT.

40
TABLE II
RECOGNITION SITES FOR ENDO R
IN AAV PLASMIDS3
Junction
Relative
Frequency^
(g)n + CCaCTCCCTCTCT
pSM620(L)
Vector- (g)19
CCaCTCCCTCTCTgCgCg -AAV
100
pSM620(R)
Vector- (g)29
CCaCTCCCTCTCTgCgCg -AAV
100
pSM621(R)
Vector- (g)29
CCaCTCCCTCTCTgCgCg -AAV
100
pSM703(R)
Vector- (g)38
CCaCTCCCTC|aCTaggg -AAV
150
pSM609(R)
Vector- (g)10
|CTCCCTCTCTgCgCgCTC -AAV
50
CCaCTCCCTCTCT
pSM621(L)
AAV- CCaCTCCCTCTCTgC|agC -Vector
1
pSM704(L)
AAV- CCaCTCCCTCTCTgC|agC -Vector
1
pSM609(L)
AAV- CCaCTCCCTCTCTgC|agC -Vector
1
(g)n
pSM703(L)
Vector- (g)36
|agTggCCaaCTCCaTCaC -AAV
150
aThe table lists the sequences at the AAV/vector junctions
and the frequency of cleavage of the AAV clones used to
determine the recognition site for endo R. The first two
bases of the AAV sequence in pSM620 (gg) are counted as
part of the poly(dG):poly(dC) tail. A vertical line (|)
indicates the position of the deletion in a mutant clone.
pSM704(R) and both pAVl plasmid junctions were not sequenced.
(R) and (L) depict the right and left AAV/vector junctions,
respectively. pSM620 and pSM609 had been previously
sequenced (Samulski, et al.. 1983) and the sequence of
pSM609(L), which was found to be incorrect, is changed
here. The remaining plasmids were sequenced as part of
this study.
^Indicates the approximate yield of the fragment resulting
from cleavage at the indicated site (Figure 4-3), where 100%
cleavage has been defined as the cleavage seen at pSM620(R)
No attempt was made to distinguish between the level of
cleavage observed at the junctions in each category.

Figure 4-2. Cleavage of Substrates That Contain Only One Copy of the
AAV Terminal Repeat.
C) Restriction maps of pGM620C and pGM620D. pGM620C contains the 513 bp
left terminal PstI fragment of the wild type AAV plasmid pSM620,
including the left AAV terminal repeat and the 19 bp poly(dG) tail.
PGM620D includes the right terminal repeat of AAV and the 29 bp GC tail
in a 445 bp PstI fragment subcloned from pSM620. Thick lines represent
AAV DNA, thin lines are pBR DNA, and the solid boxes are the AAV
terminal repeats. Also indicated are the positions of the endo R (R)
and SphI sites. A and B) 0.5 /¿g of pGM620C, pGM620D or pBR322
supercoiled plasmid DNA were incubated with fraction III enzyme as
described in the legend for Figure 3-3 and digested with SphI. The
reaction products were fractionated in a 1.4% agarose gel, stained with
ethidium bromide (panel A), transferred to a nitrocellulose filter and
hybridized to nick-translated AAV DNA probe (panel B). The position of
the marker bands (M) and the SphI digested endo R product bands are
indicated to the left and right of panel A, respectively. The 620 lanes
contain forms I, II, and III pSM620 plasmid DNA.

pGM 620 C pGM620 D
oj
o
— ro oj 4^ cn
Ol (Ji (7) 4* Ó1
l i ill
II li
— — Ol Oi
OJ CD — Ó1
M
620
620 C
620 D
pBR
>
620 D
pBR
N)

43
Because the AAV terminal repeat is a palindrome, this sequence occurs
twice within each wild type terminal repeat, at nucleotides 3 to 15 and
109 to 121 (Lusby et al., 1980). The two copies have been designated the
outboard and inboard recognition sequences, respectively. The presence
of the inboard copy of this sequence accounts for the minor cleavage
band derived from the left end of AAV and seen at the 1.6 kb position in
virtually all of the plasmids shown in Figure 4-3. It is essentially
the 1.7 kb Endo R/BstEII fragment minus the first 100 bp of AAV DNA,
which is the distance between the outboard and inboard copies of the AAV
recognition sequence. In 3 junctions (pSM621(L), PSM704(L), and
pSM609(L); Figure 4-3 and Table II), the AAV cleavage site was the only
recognition sequence present because the deletion in these plasmids has
removed the poly(dG) tail and placed the inboard copy of the sequence
adjacent to vector DNA. Accordingly, the 1.6 kb band was the only
fragment seen in these plasmids as the result of cleavage at the left
end. Endo R cleavage of the left junction of the wild type clone,
pSM620(L), produced both the 1.6 and 1.7 kb bands because both the
inboard and outboard copies of the AAV recognition sequence were
present. Presumably, the inboard site at the right end of AAV was also
cleaved, but the separation in this region of the gel was not sufficient
for resolution of the 2.9 kb fragment (Figure 4-3).
The relative intensities of the 1.7 and 1.6 kb band produced from
pSM620(L) cleavage reflect the presence of the poly(dG)^g sequences
adjacent to the outboard site. In general, the homopolymeric poly(dG)
tail sequence was approximately 20 to 100 fold more likely to be cut
than the heteropolymeric AAV recognition sequence (Table II). In
contrast to pSM620, another wild type AAV clone, pAVl, contains no GC

Figure 4-3. Cleavage of AAV Plasmids That Contain Deletions in the
Terminal Repeats.
The various AAV mutant substrates were incubated with fraction III
enzyme and digested with BstEII as described for Figure 3-3. The
reaction products were transferred to nitrocellulose and probed with
P-labeled AAV DNA. The molecular weights of the endo R/BstEII
products are indicated at the left of the figure. The sequence at each
AAV/pBR322 junction is listed in Table II. The figure was over-exposed
to visualize minor cleavage bands.

T<
I
Ol
-2.3
609
620
62 1
703
704
p AVI
M
M
Ol

46
tail and cleavage was directed exclusively by the AAV terminal
recognition site. As a result, cleavage at the inboard and outboard
sites occurs with approximately equal efficiency to produce two junction
bands from each end of equal intensity (Figure 4-3, pAVl; the fragment
sizes are 3.0, 2.9, 1.7 and 1.6 kb). The fact that poly(dG)n alone was
sufficient to act as a recognition sequence was further demonstrated by
cleavage of pSM703(L). This plasmid contains a deletion which has
removed both the inboard and outboard AAV recognition sites, but retains
a poly(dG) stretch that is 36 bp long. The poly(dG) stretch was
sufficient to promote cleavage and produced a band of approximately 1.6
kb. The slightly slower mobility of the 1.6 kb fragment generated from
pSM703(L) cleavage is attributed to the addition of the sizable poly(dG)
tail.
Minor Endo R Cleavage Sites
Cleavage by endo R appeared to require a sequence that was at
least 10 bp long and consisted of a polypurine-polypyrimidine tract that
was relatively rich in GC base pairs. These requirements were confirmed
by the identification of some of the minor cleavage fragments observed
in Figure 4-3, which had been predicted on the basis of this sequence.
It was noticed that a number of minor bands appeared consistently in
digests of all of the AAV variant plasmids. Because the size of the
minor fragments did not vary with the size of the terminal deletion,
these fragments must have been generated from cleavage within AAV
sequences (If the fragments had been generated from cleavage within
pBR322, they would have spanned the pBR/AAV junction and their size
would have varied depending on the size of the terminal deletion).

47
TABLE III
MINOR CLEAVAGE SITES3
Computer-Predicted Fragments Observed
Sequence
Nucleotide
kb
%C
kb
CCCCTCTCCCCTC
4089
2.39
10/13
2.4
CCaCTCCCTCTCT
4678
3.00
8/13
3.0
CCaCTCCCTCTCT
4562
2.86
8/13
NC
CCaCTCCCTCTCT
3
1.70
8/13
1.7
CCaCTCCCTCTCT
121
1.59
8/13
1.6
CTCCaCCCCTCC
157
1.54
9/12
NC
CTaCagCaCCCCTT
3026
1.33
7/14
1.3
CCCTgCCCaCCT
2947
1.25
8/12
1.2
CagCagCCCCCTCT
2775
1.08
8/14
1.1
CCagaCTCCTCCTC
2661
0.96
8/14
ND
CCCgCCTCCggCgCC
753
0.95
10/15
ND
CCCCTCCTCCCaCC
1461
0.24
11/14
TS
aThe table lists the cleavage fragments predicted by a computer
search of the plasmid pSM620 using polyCdC)-^ as the search
sequence and allowing for 60% homology between compared sequences.
The sequence at which cleavage would presumably occur and the number
of C residues in each sequence (%C) are tabulated with the size of
the predicted fragment, which was derived by assuming that endo R
cleavage occurred 3' to the poly(dG) sequence. The predicted
fragment sizes are compared with the sizes of the fragments observed
in the agarose gel assay. All fragment sizes are the result of BstEII
digestion of endo R products. NC = Not clear; ND - Not detected;
TS = Too small to be resolved on a 1.4% agarose gel.

48
Using a computer and allowing for substitutions within the predicted
consensus sequence, poly(dG)^g, or the complementary sequence
poly(dC)^g, internal AAV sequences were searched for potential endo R
recognition sites. Table III compares the computer predicted cleavage
sites and fragments with the observed fragments. The results show a
good correspondence between the computer-predicted cleavage pattern and
the fragments seen in endo R digests. In fact, all of the observed
fragments that were believed to be the result of cleavage in AAV DNA
were predicted by the computer search. In particular, the best matches
found were with a sequence at nucleotide 4089, which produced the 2.4 kb
minor cleavage fragment, and with both the inboard and outboard AAV
terminal recognition sequences.
AAV Excision In Vivo
A demonstration that endo R was capable of excising AAV sequences
in vivo in a manner similar to that observed in vitro would add
credibility to the hypothesis that this was the enzyme involved in AAV
DNA replication. When AAV plasmids were transfected into tissue culture
cells, the bulk of the input DNA was found in the form of nicked
circular (form II) or linear (form III) plasmid species (Samulski et
al. , 1982, 1983; Hermonat and Muzyczka, 1984). This was true regardless
of whether the input AAV DNA was capable of DNA replication. To
determine if the linear plasmid DNA (form III) produced in vivo was the
result of cleavage at a specific sequence, transfected DNA was isolated
after 21 hours, digested with BstEII and hybridized with AAV probe
(Figure 4-4). The 1.7 and 3.0 kb bands were readily seen in cells
infected with adenovirus and transfected with the wild type plasmid,

Figure 4-4. Cleavage of AAV Plasmids In Vivo.
Five micrograms of PSM620 and pSM703 DNA were transfected into Ad-
infected HeLa cells (Chapter II: Material and Methods). At 21 hours
after transfection, low molecular weight DNA was isolated by the method
of Hirt (1967), digested with BstEII, fractionated by agarose gel
electrophoresis and hybridized to AAV-specific probe as described for
Figure 3-3.

-nI
3-0
¿620/Ad
703/Ad
no
CD
U1
o

51
pSM620. In this case the fragments were presumably derived from
replicating AAV DNA. However, bands of the same size were seen at
reduced levels in cells transfected with pSM620 in the absence of
adenovirus or in the presence of adenovirus and hydroxyurea (data not
shown). In addition, two minor bands were seen in cells transfected
with pSM620 which apparently were not amplified by DNA replication.
These were identical to the minor 2.4 kb and 1.6 kb bands observed in
vitro.
Cleavage fragments generated from pSM703 transfection were
expected to be approximately 100 bp shorter than those seen with the
wild type plasmid due to the deletions in both termini (compare with
Figure 4-3). These bands were readily seen in cells transfected with
pSM703 DNA (Figure 4-4) and because pSM703 is an ori~ mutant (Samulski
et al. . 1983), the 1.6 and 2.9 kb fragments must have been produced from
the input plasmid sequences. As expected, pSM703 also generated a minor
2.4 kb band. It was concluded, therefore, that a substantial amount of
input plasmid DNA was cleaved at the AAV/vector junction in vivo and
that AAV DNA replication is not necessary for cleavage to occur.
Moreover, the pattern of cleavage was essentially the same in vivo and
in vitro. The remaining input DNA was apparently cleaved randomly as
judged by the background radioactivity.
Replication of Endo R Products
When the products of an in vitro endo R digestion of pSM620 were
transfected into Ad-infected HeLa cells, DNA replication of the AAV
sequences occurred at levels that were indistinguishable from the
transfection of the form I plasmid (not shown). This was true even at

52
times early after transfection. Differences in the production of
replicated AAV DNA would presumably occur early in the replication
cycle, but only if the excision of AAV sequences was a rate limiting
step in DNA replication. Therefore, endo R products were substrates for
DNA replication in vivo, but cleavage of AAV plasmids in vitro prior to
transfection did not provide a selective advantage for DNA replication.
Endo R products of pSM620 cleavage were also substrates for DNA
Polymerase I in vitro. The products of endo R digestion were heat
denatured and cooled rapidly to favor the formation of the hairpin
primer over renaturation of duplex molecules. In these experiments, a
significant amount of radioactivity was incorporated when these
substrates were incubated with DNA Pol I (not shown). Thus, the
products of endo R cleavage will support DNA replication both in vitro
and in vivo,

CHAPTER V
ENZYME RECOGNITION
Isolation of the Cleavage Site
In previous experiments, a consensus cleavage site was defined on
the basis of commonly occurring sequences found in AAV recombinant
plasmids. These sequences contained homopurine-homopyrimidine stretches
of at least 10 nucleotides which were rich in G:C base pairs. However,
it remained possible that the endo R recognition signal was at a
separate location from the cleavage site, possibly at an internal AAV
sequence. In this case, enzyme recognition would occur at a distant
site and result in cleavage at the nearest available stretch of
homopurine-homopyrimidine sequences. To rule out this possibility and
to further characterize the recognition sequence, several clones
containing subsets of the sequences present at the AAV/vector junctions
were constructed and their ability to act as substrates for endo R
specific cleavage was evaluated. The level of cleavage in several of
these clones is illustrated in Figures 5-1 and 5-2 and the insert
sequence and frequency of cleavage are listed in Table IV. The first
plasmid, pGM1008, is a subclone of pGM620D and contains sequences from
the right AAV/pBR322 junction, including the first 21 bp of AAV and the
31 bp G:C tail. This plasmid was cleaved with approximately the same
frequency as the parental junction in pSM620D (Figure 4-4). Two other
plasmids, pGM913 and pGM1116, contained poly(dG)-poly(dC) stretches of 9
and 13 bp, respectively, inserted at the PstI site of pBR322.
53

Figure 5-1. Oligomer Clone Excision
A) Standard reaction mixtures of 25 /¿l, containing 0.4 pmol of the pGM
clones indicated, were digested with endo R at 37°C for 1 hour. The
reactions were terminated with the addition of proteinase K stop
solution (see Chapter II: Materials and Methods), phenol extracted,
ethanol precipitated and digested with EcoRI. B) EcoRI digestion of
endo R cleaved substrate produces 0.8 and 3.6 kb bands from pGM clones
containing oligomer inserts in the PstI site of pBR322, while 1.0 and
3.4 kb fragments are produced from clones which contain inserts in the
EagI site (see Figure 5-6 for the sequence of the inserts). E = EcoRI
site, R = endo R site, filled square = oligonucleotide insert (See
Chapter II for a description of the clones).

0.8
>
—fc K) U A
ui oj b) >
i i ill
s:
2:
PstD
1008
913
1116
pBR
1476
1483
1505
ui
ui

Figure 5-2. Oligomer Clone Gel Assay.
Standard reactions of 25 /il, containing 0.4 pmol of the substrates
indicated, were digested with endo R at 37°C for 1 hour. Reactions were
terminated with proteinase K stop solution (Chapter II), phenol
extracted, ethanol precipitated and digested with EcoRI. The assays were
fractionated on a 1.7% agarose gel, transferred to nitrocellulose
(Southern, 1975) and probed with nick translated pBR322 DNA (>1 x 10°
cpm//¿g). Light and dark exposures (top and bottom, respectively) of the
0.8 kb fragments produced from endo R and EcoRI digestion are shown to
illustrate the relative frequency of cutting in the different
substrates.

CD
O O
bo bo
i i
3.6-
1008
913
1116
1228
pBR
1344
1505

TABLE IV
SUBCLONED CLEAVAGE SITES3
Clone
Inserted Sequence^
Frequency
pGM1008
(g) 29
CCaCTCCCTCTCTgCgCg
100
pGM913
(g) 13
30
pGM1116
(g)q
20
pBR322c
6
0
pGM1228
(g) 2
CCaCTCCCTCTCTgCgCg
1
pGM1344d
(g) 2
(CCaCTCCCTCTCTgCgCg)2
5
pGA38
(ga)38
10
pGAll
(ga)n
3
pGM1635
(gc)20
0
pGM1483
(^4a2) 3
30
pGM1505
(C2-6T)5
30
aThe construction of the clones is described in detail
in Chapter II: Materials and Methods. The sequences are
listed as they appear in the clone on the clockwise
strand in a 5' to 3' direction. The frequency of cleavage
is defined as the percent of starting substrate cleaved in
a standard assay with 1 unit of endo R. The amount of
cleavage for pGM1008 was arbitrarily set to 100%.
^The complete sequence of the inserts are listed in Figure 5-6.
cNatural poly(dG) stretches of 6 bp occur in pBR322 at
nucleotides 2550 and 2797.
dThe sequences for pGM1344 are repeated in an inverted
orientation

59
No AAV sequences were present in either plasmid. Specific cleavage was
observed with these substrates as well. However, the level of cleavage
was significantly reduced with both substrates. PGM913 (13 bp of G:C)
was cleaved at 30% and pGM1116 (9 bp of G:C) was cleaved at 20% of the
level observed with clones that contained all of the parental AAV/vector
junction (pGM620D, pGM1008, Figures 5-1 and 5-2, Table IV). These
clones approach the limit of enzyme recognition, since the naturally
occurring stretches of poly(dG)g in pBR322 (Figures 5-1, 5-2 and Table
IV) and poly(dG)y in lambda phage DNA (not shown) were not detectably
cleaved. These results, in conjunction with those obtained with the
pSM609(R) junction (Table II), suggested that a minimum of 9 G residues
are sufficient for cleavage, while the frequency of cleavage increases
in direct proportion to the length of the homopolymer chain. Thus, AAV
plasmids that contain GC tails at the AAV/vector junction are ideal
substrates for endo R.
The apparent strong affinity of endo R for long stretches of
poly(dG) and the observed cleavage of G-rich sites that did not contain
homopolymers of G:C (Figure 4-3, pAVl, pSM609(L), pSM621(L) and
pSM704(L)) raised some important questions concerning alternative enzyme
recognition sites and, particularly, what effect substitutions in the
poly(dG) chain have on cleavage activity. To determine what type of
substitutions were tolerated by endo R, a number of plasmid substrates
containing a variety of repeating polymeric sequences were tested. The
first of these was the plasmid pEV136, an infectious polio clone which
contains 18 bp of poly(dG) at the 5' end and an 84 bp stretch of
poly(dA) at the distal end. When incubated with endo R, pEV136 produced
fragments which were the result of cleavage exclusively at the poly(dG)

60
site. No detectable cleavage was observed at the poly(dA) site (Figure
5-3). However, clones that contained an insert of the alternating co¬
polymer (GA>2g and (GA)-q (pGA38 and pGAll, respectively) were cleaved
by endo R at a reduced frequency (Table IV and Figure 5-3). Thus,
homopolymers of (dA) were not recognized as substrates for cleavage, but
substitutions of (dA) in long stretches of poly(dG) were tolerated and
resulted in a decrease in activity. This was not the case with
alternating polymers of GC that can potentially form altered secondary
structures of left-handed Z-DNA (Peck and Wang, 1983; Singleton et al..
1983). Clones containing inserts of (GC)-^q and (GC^q were not
detectably digested by endo R (pGM1635, Table IV).
More complex sequences with less symmetrical substitutions of the
poly(dG) sequence are also substrates for endo R. This is exemplified
by two clones, pGM1483 and pGM1505, that contain generic forms of the
Tetrahymena (C4A2) and Dictyostelium (^2-6^ telomeric sequences,
respectively (Blackburn and Szostak, 1984; Shampay et al.. 1984). These
substrates were cleaved at a level approaching the frequency observed
with the homopolymeric clone pGM913 (Figure 5-1 and Table IV).
Integrated AAV provirus exists in two basic forms in chromatin, as
well as in plasmids. The first of these consists of at least two tandem
head to tail copies of AAV, each separated by two copies of terminal
sequences in an inverted orientation (McLaughlin et al.. 1988).
Presumably, this would place two copies of the endo R recognition site
in an inverted orientation, adjacent to each other. The plasmid
equivalent of this contained one copy of the AAV terminal repeat
adjacent to a GC tail and was cleaved with high frequency (e.g. pGM1008,
Figure 5-1). The second type of integrated form occurs less frequently

Figure 5-3. Endo R Cleavage of pGA38 and pEV136.
A) One microgram of either pGA38 or pEV136 was incubated with 1 unit of
fraction V endo R under standard reaction conditions in a volume of 25
pi. After phenol extraction and ethanol precipitation, one half of each
reaction was further digested with either Seal (pGA38) or Bgl2 (pEV136)
and both the endo R treated (R) and the restriction enzyme digested-endo
R treated (RS) samples were fractionated on 1.4% agarose gels. B)
Restriction maps of pGA38 and pEV136. Filled boxes represent the
poly(GA) insert for pGA38 (GA) and the poly(dG) and poly(dA) inserts for
pEV136 (G and A, respectively). The molecular weights (kb) indicate the
size of the products that would be expected from a restriction enzyme
digest of endo R products cleaved at GA in pGA38, and at G plus A in
pEV136.

62
pGA38
R RS M
Fm2- |
I “ “ 4.4
Fm3-
MS - 2.7
Fm 1 -
ftM* - 1.8
“
- .94
p E V1 3 6
M R RS
2.4 - —
1.5 - —
1.8
3.8

63
in chromatin and contains single or multiple copies of AAV separated by
a single copy of the AAV terminal repeat (McLaughlin et al.. 1988).
Plasmids that contain this type of arrangement were cleaved at a low
frequency in vitro (e.g. pAVl, Figure 4-3).
To determine if the terminal 23 nucleotides of AAV contained a
recognition signal for endo R and what effect the number of copies and
orientation of these sequences had on activity, two clones containing
either a single copy or two inverted copies of the AAV terminal
recognition sequence (ggCCaCTCCCTCTCTgCgCgC) were constructed. The
plasmid pGM1228 contains a single copy of this sequence and pGM1344
contains two inverted copies of the same sequence, both inserted into
the PstI site of pBR322. Both of these constructs were cleaved by endo
R (Figure 5-2). However, the level of cleavage observed with pGM1228
was approximately 1% of that observed with pGM1008 and could only be
visualized by Southern hybridization. In contrast, the plasmid that
contained two inverted copies of the recognition sequence was cut at a
level at least 5 times greater than that of the single copy plasmid,
while still only about 5% of that seen with the parental junction
plasmids. Thus, the presence of tandem inverted copies of the AAV
recognition signal improves the yield of specifically cleaved product in
vitro. This arrangement may be representative of the preferred
situation in chromatin.
Sequence at the Site of Cleavage
Previous experiments have already shown that endo R makes double-
stranded specific cuts and that cleavage of the substrate occurs at the
recognition signal. In addition, it was possible that cleavage at the

64
insert/vector junction would produce long single-stranded overhangs at
the ends of the fragments. Conceivably, the ends of these fragments
could anneal and effectively reduce the observed amount of specifically
cleaved product. However, no increase in the amount of specifically
cleaved product was observed after the reaction products were phenol
extracted and heated, indicating that the cleaved fragments did not have
extensive 5' or 3' protruding ends capable of hybridization (not shown).
Several questions remained, however, concerning the mechanism and
pattern of endo R cleavage. For example, it was not known whether endo
R cleavage occurred at one or several sites within the recognition
sequence or whether there was a difference in the cleavage pattern
between substrates that contained different types of recognition
signals. Additionally, it was possible that the separate strands of the
recognition sequence were cleaved in a dissimilar manner. To address
these questions, the sequence at the site of cleavage was determined for
several substrates containing various lengths of poly(dG):poly(dC),
alternating copolymers of GA, telomeric sequences and the AAV
recognition sequences (Figure 5-6). In these studies, the mobility of
the primer extension products of endo R fragments were compared with the
sequence of the insert and flanking regions of the substrate clone on
denaturing acrylamide gels. The sequence of the substrate was
determined by the dideoxy sequencing method (Sanger et al., 1977) using
the same single-stranded primer used for primer extension (Figures 5-4
A-D, see Chapter II: Materials and Methods). These results were
confirmed independently by comparison of the mobility of 5' and 3'
labeled endo R products with the chemically sequenced plasmid insert
(Figure 5-5).

65
The conclusion from the analysis of the cleavage sites of clones
containing homopolymers of poly(dG) was that cleavage could occur
throughout the G:C insert (Figure 5-4A, Figure 5-6). A slight
preference for cleavage at the 3' end of both strands was observed in
all the homopolymeric clones. This effect was especially pronounced at
the 3' end of the poly(dG) strand in the plasmid pGM1008, which contains
the AAV recognition signal 5' to the G:C insert (Figure 5-6). Cleavage
of the G-strand was particularly strong at the G:C/AAV junction and
continued into the AAV sequences, while cutting in the C-strand in this
clone appears to be more uniform, with only a slight preference for the
3' end. The site of cleavage in clones that contained only
poly(dG):poly(dC) inserts and no AAV sequences (pGM913, pGM1116, Figure
5-6) was also slightly skewed toward the 3' end of both strands, while
cleavage was confined almost entirely to the G:C insert. In substrates
that contained the alternating copolymer (GA)-j^ and (GA)^ (Figure 5-
4B), cutting occurred throughout the polymer insert between the G and A
residues on the lower strand and between the C and T residues on the
upper strand. In these clones, cleavage was evenly distributed within
the CT strand, but more pronounced at the 5' and 3' insert/vector
junctions in the GA strand.
The cleavage pattern observed with plasmids containing telomeric
sequences exhibited more periodicity. In the plasmid pGMl505 (Figure 5-
4C) , which contains the sequence (C2-6^5’ cleavage of the CT-strand
occurred throughout the insert with a particularly strong cut occurring
at regular intervals immediately after the first C residue of every
repeat. A preference for cleavage at the 3' end of the CT-strand was
observed, corresponding to the region containing 6 continuous G:C base

Figure 5-4. Sequence at the Site of Endo R Cleavage - Dideoxy Method.
A) Nucleotide sequence determined by the dideoxy method (Sanger, 1977)
and primer extension products of endo R digestions for substrates
containing: A) poly(dG) inserts; pGM1008 (left) and pGM913 (right), B)
alternating copolymers of GA; pGAll (left) and pGA38 (right), C)
telomeric sequences; pGM1505 (left) and pGM1483 (right), and D) a single
copy (pGM1228, left) or two tandem inverted copies (pGM1344, right) of
the AAV recognition site. The plasmid sequence (GCAT) was determined
for each strand of the substrate using either a clockwise (cw) or
counterclockwise (ccw) oligonucleotide primer and 1 /¿g of plasmid. The
endo R primer extension products (R) were synthesized from 1 /¿g of endo
R digested substrate with the primer used to generate the corresponding
sequence markers (see Chapter II).

71
67
1008
cw ccw
GCATR RGCAT
913
CW ccw
GCATR GCATR

68
pGA1 1
cw ccw
GCATR RGCAT
pGA38
cw ccw
GCATR RGCAT
m
Figure 5-4 (continued), part B

69
1483
cw ccw
GCATR RGCAT
Figure 5-4 (continued), part C

1228
1344
Figure 5-4 (continued), part D

Figure 5-5. Sequence at the Site of Endo R Cleavage - Maxam and Gilbert
Method.
Fine mapping of the endo R cleavage products of pGM620D (PstD). The G+A
and C+T sequencing reactions were as described (Maxam and Gilbert,
1977). 1 /¿g of pGM620D labeled at the Seal site at either the 5' or 3'
end was digested with endo R (R) and fractionated on a 8% acrylamide -
urea gel in parallel with sequence markers labeled at the same site.
The poly(dG)2g:poly(dC)2g tail and the direction of the AAV and pBR322
sequences are indicated in the figure. A detailed description of the
sequencing protocol and of PGM620D is included in Chapter II.

72

Figure 5-6. Sequence at the Site of Endo R Cleavage - Summary of the Cleavage Sites.
The sequence data in Figures 5-4 (A-D) are summarized in this figure. Only the sequence
of the oligomer insert and a few bases of the flanking vector regions are shown. The
sequences are listed as they appear in the clones, where the top strand runs in a 5' to 3'
direction. Long arrows represent major cleavage sites and short arrows represent minor
sites (usually about 25-50% of the intensity of the major bands). The relative
intensities apply only within the same strand and no attempt was made to compare the
intensity in opposite strands or between clones (see Table IV for the frequency of
cleavage in these substrates).

pGM1008
pGM913
(0,3
pGM1116
(G)9
pGM1505
(C2-6T)5
pGM1483
(C4A2) 3
pGA1 1
(GA)n
pGM1228
(AAVter),
pGM1344
(AAVter) 2
IMMMMmMMMMMMMMMMMHIlm
ATTGCCGCGCAGAGAGGGCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCTGCAGGCAT
TAACGGCGCGTCTCTCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGACGTCCGTA
4! till!44 fff ***MAHt!llllllililiilliil
mimiIHUii
ATTGCTGCAGCCCCCCCCCCCCCTGCAGGCAT
TAACGACGTCGGGGGGGGGGGGGACGTCCGTA
‘ HI4"4
III I I I I 111
ATTGCTGCAGCCCCCCCCCTGCAGGCAT
TAACGACGTCGGGGGGGGGACGTCCGTA
11||111 11
I III III I1 I III I I III H I I IT
ATTGCTGCACCTCCCTCCCCTCCCCCTCCCCCCTGCAGGCAT
TAACGACGTGGAGGGAGGGGAGGGGGAGGGGGGACGTCCGTA
lUll|iii||i ill til
/ I II I II II ill ill \
CGGCCGCCCCAACCCCAACCCCAACCCCGGCCG
GCCGGCGGGGTTGGGGTTGGGGTTGGGGCCGGC
\
It! I
It! Ill
/
II I I I I I I I I I I III 11
GGCCAGTGAATTCGGCTCTCTCTCTCTCTCTCTCTCTCCCGAATTCCCG
CCGGTCACTTAAGCCGAGAGAGAGAGAGAGAGAGAGAGGGCTTAAGGGC
|| I I 1 1 1 1 1 1 1 1 1 1 1 1 11 I I
ll lili I II
ATTGCTGCAGGCCACTCCCTCTCTGCGCGCTGCAGGCAT
TAACGACGTCCGGTGAGGGAGAGACGCGCGACGTCCGTA
I! t! II! I
I I I ITll I I
ATTGCTGCAGAGCGCGCAGAGAGGGAGTGGCCATGGCCACTCCCTCTCTGCGCGCTCTGCAGCAAT
TAACGACGTCTCGCGCGTCTCTCCCTCACCGGTACCGGTGAGGGAGAGACGCGCGAGACGTCGTTA
I I 4 I 44 4 I
-0
4^

75
pairs (Figure 5-6). Curiously, a strong preference for cutting was seen
at the 3' end of the GA strand, even though the longest stretches of G:C
base pairs are at the 5' end of this strand. In contrast, the pattern
of cutting observed with the plasmid pGM1483, which contains the
sequence (C^A^Jj, exhibited little preference for either end of the
insert (Figure 5-4C). The cleavage pattern for this clone was
repetitive and symmetrical throughout the oligonucleotide insert (Figure
5-6). Cleavage appeared to occur in directly opposite positions on each
strand immediately before the A residues on the CA strand.
Cleavage of the plasmids pGMl228 and pGM1344, which contain single
and inverted double copies of the AAV terminal sequences, respectively,
was contained within the C-rich region of the AAV recognition sequence
and showed a preference for the 3' end of each strand (Figure 5-4D,
Figure 5-6). This is especially noticeable in pGM1344, where the cut
sites are localized exclusively within the C-rich region of each strand
and would appear to produce sizable 3' overhangs.
The results from the sequence studies indicated that cleavage
occurred throughout the recognition sequence and frequently extended
into the flanking vector sequences. A preference for cleavage at the 3'
end of both strands was observed in most substrates, while cutting in
the C-strand had a tendency to be more uniform. In addition, the
nucleotide order had no affect on the site of cleavage, where cutting
occurred between every base combination. These observations, in
conjunction with the observed frequency of cutting with different
substrates, suggest that cleavage at the nucleotide level is structural
rather than sequence dependent.

76
Is Endo R a Site Specific Single-Stranded Nuclease
A number of single-stranded endonucleases will cleave polypurine-
polypyrimidine stretches that are present in duplex DNA. The activity
has been demonstrated for SI, mung bean, and Neurospora endonucleases as
well as for snake venom phosphodiesterase (Evans and Efstradiatis, 1986;
Cantor and Efstradiatis, 1984; Schon et al.. 1983; Pulleyblank et al..
1985). One important difference between these activities and endo R is
that the single-stranded nucleases require supercoiling in substrates
that contain short polypurine stretches. In contrast, endo R readily
cleaves linear substrates which contain 13 bp of poly(dG) (data not
shown). However, there is enough similarity in sequence recognition to
suspect that endo R may have properties common to single-stranded
endonucleases.
To determine if Endo R was a single-stranded DNA endonuclease, the
products of SI and endo R digestions of pSM620 were compared. SI
produced a cleavage pattern similar to that seen with endo R. However,
unlike endo R, SI did not seem to discriminate between the inboard and
outboard ends of the AAV terminal palindrome. It apparently cut equally
well at both ends of the terminal repeat, producing a full length pBR322
linear DNA molecule (4.4 kb) and the shorter 1.6 and 2.9 kb AAV
fragments (Figure 5-7). The 100 bp deletion resulting from the loss of
the AAV terminal sequences is especially noticeable when comparing the
1.7 kb endo R products with the 1.6 kb fragments produced by SI. It is
not known whether the loss of the AAV terminal sequences was due to
selective degradation of the palindrome or to specific cleavage at both
the inboard and outboard recognition sites. Similar experiments with
mung bean endonuclease did not produce discrete bands (not shown).

Figure 5-7. SI and Endo R Nuclease Digestions of pSM620.
One microgram (0.2 pmol) of pSM620 DNA was titrated with SI nuclease or
fraction IV endo R in a 50 pi reaction volume under standard conditions
for each enzyme (see Chapter II: Materials and Methods). Numbers at the
top indicate the number of units of each enzyme used.

78
SI EndoR

79
SI nuclease typically releases acid soluble oligo- and mono¬
nucleotides as products of the reaction (Vogt, 1973). After normalizing
endo R and SI activities on duplex substrates, the activities on single-
3
stranded H-labeled E.coli DNA were compared by measuring the release of
acid soluble radioactivity (Figure 5-8). When equivalent amounts of SI
o
and endo R (as measured on duplex DNA) were incubated with H-labeled
single-stranded E.Coli DNA, SI converted 70% of the DNA to acid soluble
product within 30 minutes, while endo R produced no acid soluble
products after 2 hours. The results were similar regardless of whether
the reactions were carried out at pH 6.0 for both enzymes, or whether
each enzyme was assayed at its own pH optimum (pH 4.5 for SI and pH 7.5
for endo R). On the basis of this assay, it was estimated that endo R
was approximately 50-100 fold less active on single-stranded DNA than
SI.
The ability of endo R and Si to degrade single-stranded circular
DNA was also compared. Under standard reaction conditions, single-
stranded circular X and M13 DNA are degraded to oligonucleotides of
200-400 base pairs in length (Figure 5-9). When assayed by gel
mobility, endo R cut single-stranded circular DNA at a rate 20 fold
lower than SI (not shown). This was also true in reactions which
contained standard amounts of plasmid substrate in addition to X DNA
(not shown). In these experiments, 50% of the plasmid substrate was
cleaved specifically, while activity on single-stranded circles was
similar to that observed without plasmid substrate. It was concluded
from these experiments that endo R was clearly not a typical single-
stranded nuclease. However, it was not clear whether endo R activity on

80
single-stranded circles was an intrinsic property of endo R or the
result of a residual contaminating endonuclease.

Figure 5-8. SI and Endo R Activity on Single-Stranded DNA.
Five micrograms of single-stranded, uniformly H-labeled E. coli DNA was
incubated with SI nuclease (1.25 units) or endo R (5.0 units) in a 250
/¿I reaction at 37°C under standard reaction conditions for each enzyme
(see Materials and Methods). Equivalent amounts of double-stranded
cleavage activity for both enzymes were used for each reaction (See
Figure 5-7). At the indicated times, 25 /¿I portions of each reaction
mixture were acid precipitated and counted. The percent (%) acid-
precipitable counts remaining at each time point is plotted. Closed
circles, endo R; open circles, SI.

82

Figure 5-9. Endo R Activity on Single-Stranded Circular DNA.
A standard reaction mixture of 125 /il contained 5 /jg of X single-
stranded circular DNA and 2.5 units of endo R. At the indicated times,
25 /il portions were removed, the reaction was terminated with the
addition of 0.1% SDS and 20 mM EDTA, and the reaction products were
fractionated on a 1.4% agarose gel.

o
Circles -
Linears *
10 25 40 60

CHAPTER VI
PROPERTIES OF ENDO R
Reaction Conditions for Double-Stranded Cleavage
2+
Purified endo R requires Mg cations at 5-10 raM for optimal
O i
cleavage activity (Table V). Calcium ions (Ca ) at 0.1-1.0 mM can
24-
substitute for Mg , but only about half of the activity is achieved
2-f¬
under these conditions. No activity is observed with Zn alone at any
2+ 2+
concentration, and both Ca and Zn are inhibitory at higher
2+ 2+
concentrations in the presence of Mg . When Mn is substituted for
2+
Mg , a different specificity of cleavage is observed at concentrations
below 0.1 mM, while greater concentrations result in non-specific
degradation of the substrate.
Endo R is extremely salt sensitive (Figure 6-1). A 50% inhibition
was observed with NaCl or KC1 at concentrations of 10 mM. Because of
this sensitivity, fractions emerging from columns eluted with salt
gradients were dialyzed before being assayed.
Endo R is active over a wide pH range, from pH 6 to pH 9, in Tris-
HC1, sodium acetate or sodium phosphate buffers (not shown). The pi of
endo R was estimated to be between pH 6.5 and 7.0. This was determined
by observing the binding characteristics of the enzyme to DEAE cellulose
at different pHs (see Chapter II: Materials and Methods). No increase
in the rate of the reaction was observed with temperatures above 37°C,
while temperatures below 37°C resulted in a decreased rate of cleavage.
85

86
TABLE V
DIVALENT METAL CATION
REQUIREMENTS FOR ENDO Ra
MgCl2
MnCl2a
CaCl2
Z11CI2
% Double
Stranded
(mM)
('mM)
(mM)
(mM)
Cleavaee
0
-
_
_
0
1.0
-
-
-
50
5.0
-
-
-
100
10.0
-
-
-
100
15.0
-
-
-
80
_
0
_
_
0
-
0.1
-
-
100
-
>0.5
-
-
0
_
_
0.1
_
50
-
-
0.5
-
50
-
-
1.0
-
50
-
-
5.0
-
5
-
-
10.0
-
<1
5.0
_
0.1-1.0
_
100
5.0
-
5.0
-
50
5.0
-
10.0
-
40
_
_
0-10.0
0
5.0
-
-
0.1
40
5.0
-
-
>0.1
0
aBstEII linearized pSM620 (0.2 pmol) was incubated with 1 unit
of fraction V endo R under standard reaction conditions with
the amount of divalent metal cation indicated in the table.
The reaction products were fractionated on 1.4% agarose gels,
stained with ethidium bromide and photographed. The amount of
double-stranded cleavage was determined from densitometer
tracings of the 3.0 and 1.7 kbp endo R/BstEII products as
described in the legend to figure 6-1.
^Concentrations of MnCl2 >0.1 mM result in nonspecific degradation
of substrate DNA, while concentrations between 0.01 and 0.10 mM
produce a different cleavage specificity (see Figure 6-3).

Figure 6-1. Sodium and Potassium Inhibition of Endo R.
Standard reactions containing 0.2 pmol of BstEII linearized PSM620 were
incubated with 1 unit of fraction V endo R with increasing
concentrations of NaCl or KCl for 1 hour at 37°C. The products of the
reaction were fractionated on a 1.4% agarose gel, stained with ethidium
bromide and photographed with Polaroid Type 55 film, which produces a
negative and a positive print. The intensity of the 3.0 kbp product was
measured from the negative using the LKB ultrascan XL densitometer and
the LKB gel scan program, version 1.0. The percent activity is plotted
against the concentration of Na and K chloride in the reaction. The
amount of cleavage at 1 mM NaCl (the salt contribution from the
extracts) is assigned 100% activity.

88

89
Reducing agents such as 2-mercaptoethanol and dithiothreitol had little
or no effect on activity (not shown).
Substrate concentrations between 20 and 40 ng/ml were optimal for
double-stranded cleavage. Purified enzyme exhibited no preference for
form I or form III plasmid substrates, and both were cleaved at equal
rates. When the appearance of endo R digested products was compared
over time, the amount of product formation was identical for both types
of input plasmid (Figure 6-2). This suggests that the conversion of
form I substrate to form III was not the rate limiting step in the
production of specifically cleaved products and that supercoiled or
torsionally stressed substrates were not required for endo R specific
cleavage.
Taking these factors in account, standard reaction mixtures of 25
Ml were incubated at 37°C for 1 hour and contained 20 mM Tris-HCl, pH
7.5; 5 mM MgC^; 1 mM DTT, 0.2 pmol form I plasmid substrate and 1 unit
of endo R. One unit of endo R activity is defined as the amount of
protein that is required to cleave 50% of pGM620D substrate under
standard reaction conditions.
0_L
Alternate Cleavage Specificity in the Presence of Mn— Ions
When manganese is used as metal ion cofactor, complete degradation
of the substrate occurs with standard levels of enzyme and a different
2+
specificity is observed with low concentration of Mn or enzyme. In
Figure 6-3, peak fractions emerging from a Bio-Gel 1.5M column (fraction
2+
IV) were assayed in an identical series of reactions using either Mg
2+
of Mn as the cofactor. Comparison of the activity profiles revealed
that the different specificities were coincidental. High concentrations
2+
of enzyme resulted in high levels of specific cleavage with Mg ,
but

Figure 6-2. Cleavage of Form I and Form III Plasmid Substrate.
Two and one-half micrograms of supercoiled (Fml) or BstEII linearized
(Fm3) pSM620 substrate was incubated with 2.5 units of fraction V endo R
in reaction volumes of 125 fil under standard reaction conditions. At
the indicated times, 25 n1 portions were removed and treated with
proteinase K stop solution as described in the legend to Figure 3-2.
After phenol extraction and ethanol precipitation, the endo R products
of the form I substrate were digested with BstEII for 1 hour at 60°C.
Both the BstEII digested and undigested reaction products were
electrophoresed on a 1.4% agarose gel.

91
I Fm1 I
0 15 30 60 90
| Fm3 |
0 15 30 60 90

9+ 9+
Figure 6-3. Specificity of Endo R with Mg and Mn .
Standard reaction mixtures of 25 pi containing 0.5 pg of pSM620
substrate, 5.0 mM MgC^ or MnC^, and 4 pi of the indicated fraction
from a BioGel Al.5M column (Fraction IV endo R), were incubated at 37°C
for 1 hour. The samples were phenol extracted, ethanol precipitated,
digested with BstEII. and fractionated on a 1.4% agarose gel.

93
Mg
Mn
20 22 24 26 28 30 32 34 36 M 20 22 24 26 28 30 32 34 36 M
Fm3 -
3.0 -
1.7 -
M
‘ II u
1 1

94
2+
degraded the substrate entirely in the presence of Mn . Conversely,
low enzyme concentrations present in fractions around the perimeter of
2+
the peak, resulted in an altered specificity with Mn as cofactor, and
2+
a reduced endo R cleavage with Mg . These results suggest that the
different specificities reside on the same protein and are intrinsic
properties of endo R observed under different conditions.
Endo R Specific Cleavage is of a Double-Stranded Nature
Analysis of the endo R products at several time points during the
reaction before digestion with BstEII (Figure 6-4A) revealed that the
supercoiled input plasmid was quickly converted to the nicked circular
plasmid form. Linear pSM620 molecules, which are formed from one
double-stranded break, were produced as early as three minutes into the
reaction, while the production of AAV and pBR322 linears, which require
two double-stranded breaks, were detected at 15 minutes. Comparison of
the BstEII digested products (Figure 6-4B) with undigested samples
revealed that specific cleavage at the AAV/pBR322 junctions paralleled
the production of form III plasmid and AAV and pBR monomers. The
accumulation of linear molecules and specifically cleaved products
correlated well with the decrease in form II molecules. This
relationship is displayed graphically in figure 6-4C.
Previous results indicated that endo R was equally active on
supercoiled and linear forms of input plasmid and that the rate of
formation of specifically cleaved double-stranded products paralleled
the rate of formation of linear molecules. It was possible, however,
that the production of linear molecules was preceded by a nicked
circular intermediate as an obligatory step, and that the form II

Figure 6-4. Cleavage Reaction Time Course.
Two picamoles of form I pSM620 was incubated with 20 units of fraction V
enzyme at 37°C in a reaction volume of 0.5 ml. 50 ¿tl portions were
removed at the indicated times and the reactions were terminated with
the addition of an equal volume of stop solution (1 mg/ml proteinase K,
20 mM EDTA, 1.0% SDS), phenol extracted, and ethanol precipitated. One
half of each time point was digested with BstEII and both the uncut (A)
and BstEII digested (B) samples were fractionated on a 1.4% agarose gel.
Fm3 = linear plasmid, A and P are linear monomer AAV and pBR322
molecules, respectively. C) The conversion of the undigested plasmid
forms (in A, FI and F2) to linear endo R products (F3) are plotted as a
function of time. The appearance of the 3.0 kb (3K) fragment from
BstEII digestion of endo R products was used as a measure of the level
of specific cleavage of the supercoiled substrate. The level of
cleavage at 60 minutes was assigned 100%.

96
40 60
hFm2
B
r i.7

97
Figure 6-4 (continued), part C

Figure 6-5. Single-Stranded Specificity of Endo R.
A reaction mixture of 500 /¿I containing 1.0 pmol of pGM1008 in standard
reaction buffer was incubated with 20 units of endo R (fraction V) at
37°C. At the indicated times, 50 fil aliquots were removed and treated
as described for figure 3-2. One half of each time point was digested
with EcoRI. denatured with the addition of 0.1 volume of 2 N NaOH, and
fractionated on a 1.5% denaturing agarose gel (B), as described in
Chapter II: Materials and Methods. Time points not digested with EcoRI
were fractionated on a 1.0% non-denaturing agarose gel (A). The 0.8 and
3.6 kilobase fragments are produced by either single or double-stranded
cleavage by endo R and further digestion with EcoRI .

99

100
molecules were produced by site specific single-stranded cleavage of the
input plasmid. Digestion of a specifically cleaved form II intermediate
with a one-cut restriction enzyme would yield nicked form III molecules
that would be indistinguishable from unreacted material on native
agarose gels, but would produce discrete bands on a denaturing agarose
gel. In addition, nicked circular products were observed early in the
reaction and would result in the early accumulation of specifically
cleaved products. These could be easily distinguished from products
formed from double-stranded cuts which occurred relatively late in the
reaction. To detect the presence of site specific single-stranded
breaks, the plasmid pGM1008 was incubated with endo R and the products
of the reaction were analyzed at several time points by fractionation on
both neutral and denaturing agarose gels (Figures 6-5 A and B,
respectively). As can be seen from these experiments, the production of
the 0.8 kb fragment produced from the EcoRI digestion of endo R products
(Figure 6-5B) proceeded slowly and corresponded closely to the
accumulation of form III in undigested products (Figure 6-5A). This
indicates that the formation of nicked circular DNA very early in the
reaction was the result of random nicking of the substrate and that
specific double-stranded cleavage occurs at a much slower rate.
Effect of Nucleotides and Polynucleotides on the Cleavage Activity
The addition of substances that stimulate or inhibit activity can
often reveal important aspects of enzymatic mechanisms. With a nuclease
such as endo R, it was logical to look at the effect that the addition
of nucleotides and nucleotide polymers would have on specific cleavage
activity.

101
The addition of a mixture of the 4 deoxyribonucleoside
triphosphates (dNTP) at concentrations between 0 and 5 mM had no
observable effect on the endo R cleavage reaction (Table VI). However,
when added separately, dGTP and dATP stimulated cleavage 2-3 fold at
concentrations between 0.5 and 1.0 mM. In contrast, the addition of
dCTP or dTTP had no observable effect on activity. Conversely, a
mixture of the 4 ribonucleoside triphosphates (rNTP) was slightly
inhibitory at 5mM. CTP and UTP did not affect activity when added
separately, while GTP of ATP completely inhibited double stranded
cleavage at concentrations greater than 5mM. Curiously, the addition of
ATP at concentrations greater than 1.0 mM produced a pronounced
inhibition (Figure 6-6). Moreover, the addition of an ATP generating
system (creatine phosphate and creatine phosphokinase), in the presence
of 1.0 mM ATP, completely inhibited double-stranded cleavage. However,
endo R has shown no affinity for GTP or ATP-linked agarose resins in the
2+
presence of Mg ions, and no other indication of binding between endo R
and ATP or GTP could be demonstrated. In crude preparations of endo R,
the addition of duplex calf thymus DNA and ATP resulted in a stimulation
of specific cleavage. Subsequent experiments with more purified
preparations of enzyme have shown that this effect was probably due to
inhibition of interfering activities (i.e. contaminating nucleases)
rather than to a direct stimulation of endo R. In addition, endo R
O
(fractions III, IV, or V) did not hydrolyze 7 H-ATP under standard
cleavage reaction conditions. No ATPase activity could be detected in
these fractions with or without the addition of substrate DNA (not
shown).

102
TABLE VI
NUCLEOTIDE INHIBITION AND STIMULATION3
Concentration Activity
/ig/ral %
dNTP
0-5.0
100
dGTP
0-0.1
100
0.5
150
1.0
200
5.0
90
dCTP
0-5.0
100
dATP
0-0.05
100
0.1
150
0.5
200
1.0
150
5.0
10
dTTP
0-0.1
100
0.5-5.0
125
rNTP
0-1.0
100
1.0
90
5.0
80
GTP
0-1.0
100
5.0
10
CTP
0-5.0
100
ATP
0-0.5
100
1.0
25
5.0
<1
UTP
0-1.0
100
5.0
10
aStandard reaction mixtures (25 /¿l) containing 0.2 pmol of BstEII
digested pSM620 was incubated with 1 unit of endo R at 37°C for
1 hour with the indicated concentration of nucleotide. The
reaction products were fractionated on 1.4% agarose gels and
the relative activity was estimated from photographs and
densitometer tracings as described for Figure 6-1. dNTP - all
four deoxyribonucleotide triphosphates; rNTP - all four
ribonucleotide triphosphates.

Figure 6-6. ATP Inhibition of Endo R Activity.
ATP at concentrations of 0, 0.1, 0.5, 1.0, 5.0 and 10.0 mM was added to
standard endo R cleavage reactions (25 /il) containing 0.5 /¿g of BstEII
digested pSM620 substrate. The quantity of product formed was
determined as described for Figure 6-1 using the LKB ultrascan
densitometer.

104

105
The results of assays in which homopolymers were added to the
reaction indicated that endo R had a strong affinity for polymers of
single-stranded poly(dG) over other DNA forms. In these experiments,
standard endo R reactions containing 20 /ig/ml pSM620 substrate, were
titrated with single-stranded poly(dG)^2> single-stranded poly(dC)-^2>
native E.coli DNA, heat-denatured E.coli DNA or with double-stranded
poly(dG)12:p°ly(dC)(Figure 6-7A). The results clearly showed that
single-stranded poly(dG) DNA was the most potent inhibitor of endo R
activity, and completely inhibited cleavage at all concentrations
tested. The quantity of poly(dG) required for complete inhibition is
10-100 fold less than the concentrations required of the other
competitor DNAs, and at least four times less than the number of moles
of nucleotides in the substrate. Double-stranded poly(dG):poly(dC),
total cellular RNA (not shown) and native (not shown) or denatured
E,coli DNA inhibited the cleavage reaction at approximately equal
concentrations. Approximately 40 /¿g/ml of each were required to achieve
90% inhibition (Figure 6-7B), which corresponds to 2 moles of nucleotide
inhibitor per mole of nucleotide substrate. The addition of tRNA or
polymers of brominated poly(GC), which forms a left-handed Z-DNA
conformation, had no effect on cleavage activity at any of the
concentrations tested (0-40 /¿g/ml). The affinity of endo R for single-
stranded poly(dG) was confirmed by chromatographic results, where only
minimal amounts of activity bound to single-stranded DNA agarose, while
all of the cleavage activity bound tightly to single-stranded poly(dG)
agarose columns of comparable capacity.

Figure 6-7. Polynucleotide Competition of Double-Stranded Cleavage
Activity.
A) Standard reactions mixtures (25 /¿l) containing 20 /¿g/ml BstEII
digested pSM620, 1 unit of fraction V endo R and 0, 5, 10, 20 or 40
/ig/ml DNA competitor were incubated for 1 hour at 37°C. The products
were electrophoresed on a 1.4% agarose gel and the level of endo R
activity was measured as described for Figure 6-1. dG = single-stranded
poly(dG)^2> dC = single-stranded poly(dC)^2> GC = double-stranded
poly (dG) i2 ;p°ly(dC) ^ and SS = heat denatured E. coli DNA. B) The
cleavage activity is plotted against the amount of competitor DNA added
to the reaction. The activity profile for double-stranded E.coli DNA
and single-stranded E.coli DNA were virtually identical and only the
data for the single-stranded competitor is shown here.

107
dG
5 10 2040
dC
5 10 20 40
dG:dC
5 102040
ssDNA
5 102040
4.4 -I
-Fm3
* • H
H ♦ 1
-3.0
2.3 -I
-1.7
1.5 -
% 4

108
Figure 6-7 (continued), part B

Figure 6-8. Stoichiometry of the Endo R Cleavage Reaction.
A reaction mixture containing 1.0 pmol of pSM620 in 100 /¿I was incubated
with 1 unit of fraction V endo R under standard reaction conditions. At
30 minutes, the reaction was split into two portions, the reaction
terminated in one portion with the addition of an equal volume of 1
mg/ml proteinase K, 20 mM EDTA, 1.0% SDS and incubation at 37°C for 1
hour. 0.5 pmols of pSM703 was added to the remaining portion,
incubation at 37°C was continued for an additional 30 minutes, and the
reaction was terminated as above. After phenol extraction and ethanol
precipitation, both aliquots were digested with BstEII and fractionated
on a 1.4% agarose gel. The 1.7 kb fragment is indicative of the amount
of pSM620 cleavage, while the 1.6 kb band indicates the amount of pSM703
cleavage.

en *vj
lí ’
111
1620
i
1620+703
o

Ill
Are Stoichiometric Amounts of Enzyme Required for Cleavage
To determine if endo R was required in stoichiometric amounts for
cleavage, two different substrates which could be differentiated on the
basis of the size of the cleavage products, were added sequentially to
the reaction mixture (Figure 6-8). When a 10 fold excess of pSM620 was
incubated with endo R and digested with BstEII. only a small fraction of
the substrate had reacted at 30 minutes, indicating that the reaction
was saturated with substrate. The addition of an equal amount of pSM703
to the reaction, followed by incubation for an additional 30 minutes,
resulted in the continued cleavage of both substrates at a maximum rate.
Cleavage of the pSM620 substrate can be differentiated from pSM703
cleavage by virtue of the 100 base pair deletions in the AAV terminal
sequences in the pSM703 clone. BstEII digestion of endo R products
produces a 1.7 kb fragment from cleavage at the left pSM620 junction,
which is easily distinguished from the 1.6 kb fragment generated by
cleavage at the left pSM703 junction (refer to Figure 4-3). These
results indicated a distributive or non-stoichiometric mode of double-
stranded cleavage by endo R.
Characterization of the Ends of the Reaction Products
Knowledge of the position of the phosphomonoester and hydroxyl
groups on the products of nucleolytic digestion is useful for comparison
with other nucleases. The positions of these groups were determined
independently by the ligation of endo R products and by 5' and 3'
labeling experiments. The plasmid pGM1008 was used as the substrate for
endo R ligation studies. PGM1008 is cleaved by fraction V endo R at a
frequency equal to that of pSM620 (Table IV). The initial products of

112
endo R digestion of pGM1008 consisted of approximately equal portions of
form II and form III DNA and included a background smear, which was
presumably the combined result of endo R cleavage at minor sites and
nonspecific degradation of the substrate (Figure 6-9, lane R). When
these products were treated with T4 DNA ligase, greater than 50% of the
linear molecules could be ligated to higher molecular weight forms
(Figure 6-9, lane RL). No increase in the yield of higher molecular
weight products was observed with continued ligation or after treatment
of endo R products with the Klenow fragment to produce blunt ends prior
to ligation (not shown). These results indicated that a majority of
endo R products contained ends with 5' phosphates and 3' hydroxyls and
were, therefore, substrates for DNA ligase. However, a significant
amount of the form III product was not ligatable. This may reflect a
heterogeneous nature of the ends produced by endo R, where only a
fraction of the reaction products were ligatable forms that did not
contain gaps or overhangs in the hybridized molecule. Generating blunt
ends prior to ligation may produce more ligatable forms, but also
reduces the overall efficiency of ligation. It was also possible,
however, that incomplete ligation reflected the presence of
contaminating nucleolytic or phosphatase activities in the enzyme
extracts.
The 5' position of the phosphomonoester group was further verified
by 5' end labeling experiments (Table VII). In these studies, endo R
treated samples that had been dephosphorylated with calf intestine
alkaline phosphatase (CIAP) prior to end labeling, incorporated 50 fold
more radioactivity than the untreated control samples. However, a
significant amount of incorporation was detected in endo R products that

113
TABLE VII
END LABELING OF ENDO R PRODUCTS3
Reaction Conditions
Incorporation
(cpm x 10" )
No Endo R, No CIAP 8
No Endo R, + CIAP 6
+ Endo R, No CIAP 24
+ Endo R, + CIAP 110
pBR322 x EcoRI 6
aReaction mixtures (50 pi) containing 0.4 pmols of the plasmid
pGM1008 were incubated with 2 units of fraction V endo R under
standard reaction conditions for 1 hour at 37°C. The reactions
were split into two equal portions and 1 portion was treated with
calf intestine alkaline phosphatase (CIAP). Both the phosphatased
and phosphorylated samples and two identical control samples, which
had not been treated with endo R, were 5'-end labeled with poly¬
nucleotide kinase and 7 ^P-ATP as described in Chapter II. The
kinasing reactions (25 pi) were terminated with the addition of 2 pi
of 0.25 M EDTA, a 5 pi aliquot of each was precipitated in 10% TCA,
0.2 mg/ml BSA and the acid precipitable radioactivity of each fraction
was determined.

114
were not dephosphorylated, corresponding to about 5 fold less than the
incorporation observed with the CIAP-treated products. It was possible
that this incorporation was due to a kinase exchange reaction. However,
it may also reflect the presence of an additional nucleolytic or
phosphatase activity in the extracts.
To determine if endo R extracts contained contaminating
nucleolytic and phosphatase activities, a portion of the products of the
end-labeling reaction was digested with EcoRI. and both the undigested
(Figure 6-10A) and EcoRI digested (Figure 6-10B) samples were
fractionated on agarose gels. The results in Figure 6-10A show that
most of the label in the phosphatased, endo R treated samples was
incorporated into form III and form II plasmid DNA. When these products
were further digested with EcoRI. the majority of the label was retained
either in the specifically cleaved fragments or in unreacted substrate
(Figure 6-10B, right panel). Samples not dephosphorylated before end
labeling displayed a similar pattern of incorporation, but at a much
reduced level. It is unlikely that the same nucleolytic activity would
produce two types of ends (Laskowski, 1985). Therefore, the
radioactivity incorporated into endo R products not treated with CIAP
may be the result of a kinase exchange reaction or may reflect the
presence of an associated phosphatase activity in the enzyme extracts.
Finally, there is no evidence to support the presence of a contaminating
endonuclease, since the pattern of incorporation was the same regardless
of whether the samples were dephosphorylated prior to end labeling.
However, the results do not exclude the possibility that a small amount
of contaminating exonucleolytic activity is present in the extracts.
Overall, the results from these studies indicate that the majority of

Figure 6-9. Ligation of Endo R Products.
A standard reaction mixture of 100 /tl containing 0.4 pmol of form I
pSM620 substrate was incubated with 4 units of fraction V endo R for 1
hour at 37°C. The reaction was phenol extracted and ethanol
precipitated and the dry DNA pellet was redissolved in 100 /il of T4 DNA
ligase buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgC^, 1 mM DTT and 1 mM
ATP). The mixture was divided into 2 equal portions and 400 units of T4
DNA ligase were added to one of the portions. The ligation reaction was
incubated at 15°C for 24 hours and both the ligated (RL) and unligated
(R) endo R products were fractionated on a 1% agarose gel. The position
of nicked circular (Fm2) and linear (Fm3) plasmid DNA is indicated next
to the marker lane.

116

Figure 6-10. 5' End Labeling of Endo R Products.
PGM1008 substrate (0.4 pmol) was incubated with 2 units of fraction V
endo R in a standard reaction of 50 fil. A second identical control
reaction was not treated with endo R. The reaction mixtures were phenol
extracted and ethanol precipitated and the pellets were redissolved in
25 fil of 0.1 M Tris-HCl, pH 8.5, and 0.1% SDS. One half of each mixture
was dephosphorylated with the addition of 1 unit of calf intestine
alkaline phosphatase (CIAP) and incubation at room temperature for 2
hours. All samples were phenol and chloroform extracted, ethanol
precipitated and the pellets were redissolved in 25 pi polynucleotide
kinase buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgC^, 1 mM DTT) containing
10 /iCi of 7 P-ATP and 4 units kinase. After incubation at 37°C for 30
minutes, a 5 /il aliquot of each sample was precipitated in 10% TCA, 0.2
mg/ml BSA and the amount of acid precipitable counts was determined. 0
= no endo R; OC = no endo R plus CIAP; R = endo R treated; RC = endo R
treated plus CIAP. A) Autoradiograph of undigested products B)
Ethidium stained gel (left panel) and autoradiograph (right panel) of
EcoRI digested 5'-end labeled samples.

118
** - 2.0

119
M O OC R RC
6.6 -
4.4 -
â–º 4 r
h 4.4
\~ 3.6
2.3 "
2.0 "
0.8
RC R OC 0 M
Figure 6-10 (continued)
part B

120
ends of the fragments produced by endo R specific cleavage contain 5'
phosphate and 3' hydroxyl groups.
Is Endo R a Human Topoisomerase
The properties of endo R share a few similarities with those of
mammalian topoisomerases. The most intriguing is the capacity of both
type I and type II topoisomerases to introduce transient breaks in DNA
(Liu et al.. 1983). It was natural to speculate then, that endo R
cleavage is actually due to interruption of the relaxation process of a
supercoiled substrate. This is especially true of type II
topoisomerases, where double-stranded cleavage has been functionally
separated from the rejoining step with the use of specific inhibitors
(Chen et al.. 1984; Nelson et al.. 1984; Yang et al.. 1985).
Established assays for the detection of topoisomerase activity
(Liu et al., 1980, 1981) were employed to determine if endo R contained
associated topoisomerase activity. The available evidence
overwhelmingly indicates that endo R does not contain an associated topo
activity. In contrast to type I or type II topoisomerases, topoisomers
have never been observed in agarose gels when form I plasmid DNA was
incubated with endo R. In addition, antibodies to both types of human
topoisomerases did not significantly inhibit double-stranded cleavage
(not shown). Finally, although endo R did decatenate kinetoplast DNA
(not shown), the products of the reaction were linear molecules and not
the monomer circles characteristic of type II topoisomerase activity
(Liu et al., 1980).

CHAPTER VII
DISCUSSION AND CONCLUSIONS
Purification of Endo R
Endo R is an enzyme of cellular origin. However, specific
cleavage activity is enhanced approximately 5 fold in nuclear extracts
prepared from Ad2 infected cells grown in the presence of hydroxyurea.
Hydroxyurea is a potent reversible inhibitor of ribonucleotide reductase
and inhibits DNA replication by blocking the production of deoxyribo-
nucleotides from ribonucleotide precursors (Timson, 1975). Thus, the
observed stimulation of activity is presumably the result of Ad2 early
gene expression, which does not require DNA replication (Green et al.,
1971), and is therefore, unaffected by the addition of hydroxyurea. It
is not clear, however, whether the stimulation results from enzyme
modification or from a direct enhancement of endo R gene expression.
There remains a significant difference between the molecular
weights determined for native and denatured protein. The gel filtration
and sedimentation data indicate a native molecular weight of
approximately 115-120 kd, while the results from SDS gel analysis
indicate that endo R is a slightly smaller protein of approximately
100,000 dal. This type of discrepancy is not uncommon, and could be
explained by postulating an asymmetric, nonspherical shape for native
endo R. It should be noted however, that endo R has not been purified
to homogeneity. Therefore, it is possible that the minor peptides in
the enzyme preparation contribute significantly to cleavage activity.
121

122
Excision of AAV Sequences In Vitro
When crude nuclear extracts were assayed for specific cleavage
activity on AAV plasmid substrates, only 1% of the starting material was
cleaved at either AAV/vector junction and the products could be
visualized only by Southern (1975) hybridization. Further purification
of endo R has simplified the gel assay and greatly increased the yield
of specifically cleaved product. This has allowed the detailed study of
AAV excision in vitro, and has led to a better understanding of the
characteristics of endo R nucleolytic activity.
The wild type AAV plasmid, pSM620, contains two major endo R sites
at either AAV/vector junction. The major product of the reaction was a
linear plasmid molecule produced by independent cleavage at one or the
other junction. Therefore, the fragments observed in the agarose gel
assay were the result of a partial digestion with endo R followed by
complete digestion with BstEII. On occasion, however, both AAV/vector
junctions were cleaved simultaneously, accounting for approximately 3%
of the product and yielding linear AAV and pBR322 molecules. The site
of cleavage in pSM620 was localized to within 25 bp of the AAV/vector
junction by hybridizing the reaction products to either AAV of pBR322
specific probes. In addition, it was demonstrated that interaction
between the two AAV terminal repeats was not required and that either
AAV/vector junction could be cleaved independently of the other.
Subclones that contained either the left or right AAV/pBR322 junction
were cleaved with equal efficiency when compared to cleavage of the
parental clone.
Endo R cleavage of mutant AAV clones in which the AAV/vector
junctions had been sequenced, aided in the identification of a

123
recognition signal for the enzyme. The conclusion from these
experiments was that endo R recognized polypurine/polypyrimidine
sequences rich in G:C base pairs. This was verified further by the
identification of minor fragments produced from cleavage within internal
AAV sequences. A computer search using a consensus sequence derived
from these experiments, reliably predicted the presence of most of the
fragments observed from endo R cleavage of the AAV substrates.
Is Endo R responsible for the Rescue of AAV Sequences In Vivo
When AAV plasmids are transfected into human cells most of the
input plasmid DNA is converted to relaxed circular and linear plasmid
DNA. This is true regardless of whether the plasmid contains an AAV
genome capable of autonomous replication (Hermonat et al.. 1984;
Samulski et al.. 1982, 1983; Laughlin et al.. 1983) or whether the
transfection is done in the presence of hydroxyurea. Digestion of the
recovered input DNA with restriction enzymes indicates that a large
fraction of the input DNA has been cleaved at one or the other AAV
junction with vector DNA. Additional fragments seen in vivo suggest
that specific cleavage also occurs at the inboard copies of the AAV
terminus (the sequence CCaCTCCCTCTCT), and at an internal sequence to
produce fragments of 1.6 and 2.4 kb. This means that specific AAV
sequences are substrates for a host-encoded endonuclease activity and
that this activity does not require DNA replication. All of these in
vivo observations are consistent with the properties of endo R in vitro.
In addition, cleavage by endo R occurs in a region in AAV substrates
that is consistent with what is predicted by the model for AAV DNA
replication. This is supported by the observation that endo R products

124
were substrates for DNA replication in vivo and in vitro. However,
without the benefit of a cellular mutation in endo R, it can not be
concluded that this activity is required for AAV rescue.
If endo R represents a major pathway for AAV rescue, then excision
of AAV sequences by endo R must explain not only how wild type AAV
sequences are rescued, but also how mutants which contain terminal
deletions are rescued. In view of the sequence specificity of endo R,
the following model can be offered for rescue of wild type and mutant
sequences (Figure 7-1). Normal AAV rescue occurs by endo R cleavage at
the two outboard AAV recognition sites to directly produce an AAV
replicative intermediate. This can occur when the wild type plasmids,
pSM620 or pAVl, are transfected into mammalian cells. Cleavage could be
directed toward the outboard sites by tandem copies of the AAV terminal
sequences between integrated provirus or if AAV integrates into the host
genome in a region rich in G:C base pairs. In some molecules, cleavage
can occur at an outboard site in one end, and only at an inboard site at
the other end (pSM621, pSM609). These molecules can generate an AAV
replicative intermediate by subsequent correction of the missing ori
sequence (Samulski et al., 1983) . However, molecules that have been
cleaved at both inboard endo R sites are ori" and incapable of DNA
replication. Such molecules would have to recombine with uncleaved
input plasmid molecules to recover a functional origin sequence. A
prediction of this model is that the deletion of the terminal 15 bp of
AAV from both ends (ie., deletion of both outboard recognition sites)
should significantly reduce the infectivity of AAV plasmids. This is,
in fact, consistent with the behavior of an AAV mutant plasmid
(psub201+), recently reported by Samulski et al. (1987), in which the

Figure 7-1. Model for the Excision of AAV DNA from Recombinant
Plasmids.
Solid line indicates internal AAV sequences, dotted line indicates
flanking plasmid sequences, open boxes indicate the AAV origins which
consist of the terminal 125 bp palindromic repeats. Vertical lines and
arrows indicate the inboard and outboard AAV recognition sequences and
endo R cleavage sites.

126
1 i
€3
i i
O
I Endo R
1—
—c
f ori+
+
1—
r
1 ori+
+
I
orí “

127
first 13 bp from are missing both ends. With this plasmid, DNA
replication is 8-fold more efficient if the AAV sequences are cleaved
away from the vector sequences before transfection into Ad2-infected
cells.
The frequency of endo R excision of AAV plasmids is also
consistent with what is seen in vivo. Based on the observed frequency
of cleavage in vitro, it would be expected that only 0.01-1% of the
input pSM620 molecules would be cut at both junctions to produce ori+
AAV duplex DNA. In a typical transfection experiment (0.1-10 ng of
plasmid DNA per 10 cm dish) an estimated excision frequency of 0.01%
would produce 0.3-30 AAV duplex DNA molecules in each transfected cell.
(See Chapter II for the calculation.) This is approximately the limit
of detection in most transfection experiments. However, if this
frequency is correct, then there should be a linear relationship between
the yield of replicative form DNA produced in transfected cells and the
amount of input plasmid DNA used in the transfection. In agreement with
this, Samulski et al. (1982) have shown that the yield of AAV DNA is
linear with the amount of input DNA in the range between 0.1 and 10 /jg
of plasmid DNA per 10 cm dish.
In using the recombinant plasmids as substrates for in vitro
excision, it was assumed that these plasmids were models for AAV
proviruses integrated into chromatin. Typically, a cell line carrying
AAV proviruses contains 2-5 tandem copies of the AAV genome (Cheung et
al., 1980; Laughlin et al.. 1986; McLaughlin et al.. 1988). The
junction of two tandem AAV copies would contain either a single copy of
the sequence ggCCaCTCCCTCTCT or two copies of the same sequence in an
inverted orientation, producing the palindromic sequence

128
agagagggagTggCC/ggCCaCTCCCTCTCT. Plasmids containing a single (pGM1228)
or a double inverted copy (pGM1344) of this sequence were cleaved by
endo R, and the clone containing two copies of the AAV recognition
signal was cleaved approximately 5 fold more efficiently. This
sequence, which is actually a stretch of polypurine residues followed by
a polypyrimidine stretch, is also a derivative of the sequence at the
junction of pBR322 and AAV in pSM620 (gn/CCaCTCCCTCTCT) and this
substrate is cleaved at high frequency. This type of recognition
sequence could be generated if AAV integrated into a G:C rich region in
the host DNA.
Qualitatively, however, there must be at least two major
differences between rescue from chromatin and rescue from recombinant
O /
plasmids. First, whereas approximately 10 -1CF molecules of AAV plasmid
DNA are required per cell to see maximum production of AAV virions in a
transfection experiment, endogenous AAV proviruses are usually present
at less than 10 copies per cell. There appears to be, then, at least 2
orders of magnitude difference between excision frequencies from
chromatin and naked DNA. This may reflect the presence of additional
components required for excision from chromatin. In this regard, it is
worth noting that the efficiency of cleavage at the right AAV/vector
junction in pAVl was significantly better in crude extracts (not shown)
than with purified enzyme preparations (Figure 4-3). One possible
explanation for this observation is that accessory proteins may have
been lost during the purification.
A second issue is the apparent stability of AAV proviruses in the
absence of helper virus (Cheung et al., 1980). Although
extrachromosomal copies of AAV are occasionally generated during passage

129
of latently infected cells, most proviral copies are stable
indefinitely, unless the cell is superinfected with helper virus (Cheung
et al.. 1980; McLaughlin et al.. 1988). Thus, AAV proviral termini are
not usually a target for endo R. Possible explanations for this are
that either the termini are inaccessible due to the secondary structure
of chromatin or that endo R activity is tightly regulated in the cell.
In this regard, Larsen and Weintraub (1982) have shown that the SI
sensitivity of homopurine-homopyrimidine sequences upstream of the
chicken beta A globin gene in chromatin depends on whether or not the
chromatin was isolated from cells that were actively expressing the
globin gene. Thus, the initiation of AAV rescue by adenovirus
superinfection may be due to the activation of AAV gene expression by
adenovirus gene products (Laughlin et al., 1982; Richardson and
Westphal, 1984).
Enzyme Recognition
In general, the level of cutting by endo R depends on the length
of the recognition sequence and the amount of substitutions in the G (or
C) strand in a given length. Plasmids that contain homopolymeric
stretches of poly(dG):poly(dC) are the ideal substrates for endo R.
Endo R cleavage experiments using clones that contained stretches of
poly(dG) of varying length indicated that a minimum of 9 bases of G
residues were required for cleavage and that the frequency of cleavage
increased in direct proportion to the length of the homopolymeric chain,
to a maximum of approximately 30 base pairs. Substitutions or
variations in the ideal sequence reduced the level of cleavage, where
the overall frequency depended on the length of the recognition sequence

130
and the amount of substitution (Table IV). For example, substrates that
contained the alternating copolymer poly(GA)3g (50% G:C base pairs) were
cleaved at 10% of the level observed in substrates containing 31 bp of
poly(dG):poly(dC). This reflected the effect of substitution of G
residues with A residues. In addition, the level of cleavage seen with
plasmids containing poly(GA)gg was more than 3 fold greater than the
level of cleavage observed with substrates that contained 11 repeats of
the same alternating copolymer (poly(GA)^), indicating that the length
of the substituted polymer also affected the level of cleavage.
Moreover, the homopolymer, poly(dA)gg:poly(dT)gg, was not a substrate
for endo R (not shown). These results suggested that the frequency of
cleavage depended on the length of the recognition signal and the
percentage of G:C base pairs in this sequence.
The type of substitution in the G:C polymer was also important.
Substitution of G residues with A was tolerated, but resulted in
significantly lower cleavage frequencies. However, substitutions of G
with C residues in the alternating copolymer poly(GC)2Q, completely
inhibited double-stranded cleavage (pGM1635, Table IV). On the surface
this may seem to indicate that a transition between purines and between
pyrimidines was allowed, while substitutions of pyrimidines for purines
and purines for pyrimidines was not. However, the comparison of the
level of cleavage between clones that contained mixed purine and
pyrmidine recognition signals with those that were homopurinic indicated
that this was not the case. Substrates that contained the Dictyostelium
telomeric sequence, (C2-6^5’ which is a polypyrimidine/polypurine chain
(80% C), or the Tetrahymena telomeric sequence, (C^A2)g, in which
purines are mixed with pyrimidines (67% C), were cleaved at

131
approximately the same frequency (Table IV), corresponding to about 30%
of the level observed with the parental polyidG)^ clone. In addition,
the AAV recognition sequence (CCaCTCCCTCTCT), which contains 8 C
residues in a 13 base pyrimidine-rich sequence (62% C), was cleaved at
1% of the level observed with the polyidG)^ clone. Thus, the length of
the recognition sequence and the degree of deviation from the ideal
poly(dG):poly(dC) sequence were major considerations for the level of
cleavage activity. However, the type of base substitution was also
important in certain cases. This was especially true in cleavage assays
with the alternating copolymer (GC^q, which can exist in a left handed
Z-DNA configuration (Peck and Wang, 1983; Singleton et al.. 1983), and
was not cleaved by endo R. These results suggested that endo R cleavage
frequencies could be better explained in the context of the structural
properties of the recognition signal, rather than strictly on a sequence
basis.
Evidence from nuclease digestion experiments (Drew, 1984; Cantor
and Efstradiatis, 1984; Drew and Travers, 1984; Pulleyblank et al..
1985; Evans et al.. 1986) indicate that duplex chains of
poly(dG):poly(dC) exhibit a non-B, non-Z DNA conformation, which is
similar, but not identical to A-type DNA (Arnott et al.. 1974). The
conformation of these polymers in solution are characterized by a wide
and shallow minor groove and a deep and cavernous hydrated major groove
(McCall et al., 1985). The longer helical repeat of approximately 11
bases and the larger helical radius are more typical of double-stranded
RNA than B-DNA (Bram, 1971). Under torsional stress or when flanked by
B-DNA, these sequences are likely to exist in a ladder-like structure
resulting from the stacking of the guanosine bases, while the C-strand

132
passively swivels around the stacked G-strand (McCall et al.. 1985). In
addition, the 3' flanking region of the poly(dG) strand seemed to exist
in an "unpaired" conformation in torsionally stress molecules (Kohwi-
Shigematsu et al.. 1985).
The cleavage behavior of endo R with the various oligomer
substrates can be better explained in the context of these structural
observations. These observations suggest that the importance of the
sequence at the site of recognition may be secondary to that of DNA
conformation. This would explain why homopolymers of poly(dG) are the
ideal substrates and why certain variations of this sequence are
tolerated while others are not. Variations in the recognition sequence
result in the disruption of guanosine stacking on the G-strand to
different degrees. Duplex molecules containing the alternating
copolymer (GA) maintain the unusual stacking conformation of
homopolymeric G:C chains to a lessor degree, through purine-purine
stacking (Evans et al.. 1986). In contrast, in substrates containing
alternating GC residues the secondary structure characteristic of
poly(G) seems to have been disrupted by the C-residues, and under
certain salt conditions, the GC copolymer may exist in a left-handed Z-
DNA conformation (Peck and Wang, 1983; Singleton et al.. 1983) that
differs markedly from the structure of poly(dG):poly(dC). These
observations indicate that the mixing of purine and pyrimidine residues
in the recognition sequence is not as important as the maintenance of
the poly(dG) conformation. This would explain why the telomeric
sequences, (0^2)3 and (^2-6^ 5’ were cleaved at approximately the same
frequency. Both sequences presumably maintain enough of the poly(dG)
structure with long, interrupted stretches of G:C base pairs, and

133
neither contain long stretches of alternating GC residues which could
disrupt this conformation. In summary, endo R seems to recognize an
alternate DNA structure characteristic of homopolymers containing
poly(dG):poly(dC). The length and variation of this sequence is
important only in the context of how it affects the DNA secondary
structure. The substitution of G with A or T residues presumably
results in the gradual disruption of this altered conformation, while
the introduction of alternating GC residues changes the DNA secondary
structure to a form not recognized by endo R.
The analysis of endo R cleavage sites at the sequence level
supported the view that enzyme recognition was the result of secondary
structure in the DNA molecule. While the frequency of cleavage was
shown to be directly proportional to the length and G:C base pair
content of the recognition signal, the cleavage sites were distributed,
for the most part, in a pattern that was more consistent with structural
differences between the various inserts than with the insert sequence.
With substrates that contained a high percentage of G:C base pairs
(pGM1008, pGM913, pGM1116, pGM1505, Figure 5-6), cleavage occurred
between every base of the insert, presumably because minor substitutions
of G residues did not cause a significant alteration of the secondary
structure. In more highly substituted inserts (pGM1483, pGA38, pGAll,
pGM1228), the cleavage pattern apparently reflected alterations of the
G:C conformation, resulting in a more specific or periodic array of
cleavage sites. For example, cleavage of the sequence (0^2)3 occurred
at regular intervals on both strands, immediately 5' to the T residues
on the GT strand (pGM1483, Figure 5-4C, Figure 5-6). This suggested
that the poly(dG) structure was locally disrupted by the insertion of

134
two T residues, while the overall conformation of the insert was
unchanged. Therefore, endo R seemed to have the ability to recognize
the secondary structure of the entire insert in spite of local
disruptions, since none of the uninterrupted stretches of poly(dG) in
pGM1483 were long enough to be endo R recognition sites by themselves.
This effect was even more pronounced in the alternating poly(GA) clones
(pGA38, pGAll, Figure 5-4B, Figure 5-6), where cleavage occurred at
every other base in the recognition sequence, 3' to every A residue (and
C residue). This cleavage pattern presumably reflected local
perturbations in guanosine base stacking, while purine base interactions
maintained an alternate DNA structure in the insert that was still
recognized by endo R. The ability of endo R to recognize the secondary
structure as a whole, may explain why the stronger cleavage sites in the
GA strand of pGAll and pGA38 (Figure 5-6) occurred at the ends of the
insert. The cleavage pattern observed in pGM1228, which contains a
single copy of the AAV recognition sequence (Figure 5-4D, Figure 5-6),
can also be explained in terms of the secondary structure of the insert.
In this clone, cleavage occurred at a low frequency and was confined to
a small region, rich in G residues. The short length and relatively high
substitution of G residues in this region apparently produced a
secondary structure that was only marginally recognized by endo R.
Sequence analysis of the endo R cut sites indicated that cleavage
occurred throughout the regions rich in G:C base pairs. However, the
pattern of cutting in the G-rich or C-rich strands was not identical and
suggested that endo R cleavage of the substrate may occur through a
series of concerted single-stranded nicks on opposite strands, rather
than by double-stranded cleavage. This was supported by the results

135
from endo R time course experiments which indicated that the
specifically cleaved fragments were the product of double-stranded
breaks, while site specific single-stranded nicks in the substrates were
not detected. Taken together, these observations imply that the enzyme
rapidly produces single-stranded breaks on both strands of the molecule
which eventually result in a double-stranded breaks.
The pattern of cleavage in several of the clones (pGM1008, pGM913,
pGM1116, pGM1505, pGM1228, and pGM1344, Figure 5-6) depicted a
distribution that was skewed toward the 3' end of each strand (Figure 5-
4). This suggested that a significant amount of molecules might contain
sizable 3' protruding ends consisting of C-rich and G-rich sequences.
Overhangs of this nature would tend to hybridize together, and in
effect, reduce the amount of observable specifically cleaved products in
the endo R reactions. The experimental data, however, did not support
this conclusion. Phenol extraction and heating of the reaction products
before electrophoresis did not increase the yield of specifically
cleaved product. However, intramolecular aggregation and basepairing
between guanine residues in single-stranded overhangs has been shown to
be a thermodynamic possibility (Henderson, et al.. 1987). It is
possible, then, that basepairing between G residues on one of the 3'
overhangs form hairpin structures that would prevent hybridization of
the G-rich and C-rich overhangs.
It was also possible that the products of endo R cleavage
contained blunt ends or short 3' overhangs that were not likely to
hybridize. By this mechanism, endo R would produce a double-stranded
break in each molecule by making single-stranded nicks at opposing
positions in each strand. The distribution of sites throughout the

136
recognition sequence suggested that very few nicks were made in each
strand before a double-stranded break occurred. The cleavage pattern
observed in the clones containing the telomeric sequence ((¡¿^2)3
(pGM1483, Figure 5-4C, Figure 5-6) and the alternating copolymer (GA)-q
(pGAll, Figure 5-4B, Figure 5-6) support this hypothesis. Cleavage in
these substrates occurred at regular intervals and at opposing positions
in each strand. Continued cleavage or degradation of either strand in a
5' to 3' direction would account for the increased distribution of
cleavage sites at the 3' end of the insert junction observed in several
of the substrates. Thus, the observed distribution of cleavage sites
may reflect a population of molecules that are cleaved a minimum number
of times anywhere within the recognition sequence. Double-stranded
breaks would then be the result of concerted single-stranded nicks in
opposing positions on each strand, producing molecules with short 3'-OH
overhangs or blunt ends. The higher frequency of cleavage sites at the
3' end of each strand may be explained as an artifact of additional
cleavage or degradation of the cleaved molecules.
The activity profile of endo R is strikingly similar to the
activity of a number of single-stranded DNA endonucleases. This is
especially true of SI nuclease, where it seems clear that the enzyme
also recognizes the altered secondary structure in duplex DNA consisting
of stretches of polypurine/polypyrimidine (Evans and Efstradiatis, 1986;
Pulleyblank et al.. 1985; Cantor and Efstradiatis, 1984). However,
important differences between these activities indicate that endo R is
not a classical single-stranded nuclease. First, whereas endo R will
cleave short linearized polypurine/polypyrimidine sequences, SI requires
supercoiling of these substrates. This presumably reflects the need for

137
a torsionally stressed molecule (Cantor and Efstratiadis, 1984) and may
indicate that an altered structure of the polymer flanking regions is
necessary for cleavage by SI (Kohwi-Shigematsu and Kohwi, 1985).
Secondly, endo R specificity for single-stranded DNA could not be
demonstrated by any classical means, including acid solubilization of
3
H-E.coli DNA or by competition assays with single-stranded DNA. Endo R
cleavage of X single-stranded circles may be attributed to an intrinsic
activity or may be due to the presence of a contaminating nuclease.
Evidence for a Contaminating Nuclease
Several lines of evidence suggest that endo R preparations contain
a contaminating nuclease or a second activity, possibly as an intrinsic
part of the same enzyme. For example, background smearing in the
standard gel assay indicated that the substrate was being
nonspecifically degraded. This effect was observed with even the purest
preparations of endo R and became pronounced when large amounts of
enzyme were added or with prolonged incubation times. In addition, a
significant amount the specifically cleaved linear products were not
substrates for T4 DNA ligase and could be 5' end labeled without prior
treatment with CIAP. This indicated that two types of ends were being
produced on endo R products. Moreover, examination of endo R products
early in the reaction revealed that the form II molecules produced were
randomly nicked. A similar random nicking activity was observed on
single-stranded if>X circles. These observations may indicate that a
separate, unrelated nucleolytic activity was present in endo R extracts.
Alternatively, all of these results can be explained by an alternate

138
specificity of endo R, rather than the presence of a contaminating
nucleolytic activity.
An alternate specificity was demonstrated for endo R under
2+ 24-
reaction conditions where Mn was substituted for Mg as metal
cofactor. Under these conditions with standard amounts of enzyme, the
substrate was degraded non-specifically (Figure 6-3). It is possible
that the nonspecific activity coexists, at a low level, with the
specific activity under reaction conditions that favor double-stranded
specific cleavage. This would explain the nonspecific degradation of
the substrate, as well as the random nicking of form II plasmid DNA and
single-stranded circular DNA.
A second issue is the inability of a portion of the endo R
reaction products to be ligated, and the fact that approximately 20
percent of the specifically cleaved products can be 5' end labeled
without treatment with alkaline phosphatase. These observations
indicate that a portion of the product molecules contain 5' hydroxyl
groups. It is unlikely, however, that this is the result of a separate
nucleolytic activity, since both the phosphorylated and dephosphorylated
ends occur on specifically cleaved molecules (Figure 6-10B). It is
possible that dephosphorylation of the specifically cleaved molecules is
due to an associated or contaminating phosphatase activity or that a
small amount of exonucleolytic activity which leaves 3' hydroxyl groups
is present in the extracts.
Other Mammalian Endonucleases
The characterization of site-specific endonucleases, which
recognize specific DNA sequences or minor distortions in the DNA helix,

139
has mostly been confined to those obtained from procaryotic sources.
Recently, however, a number of laboratories have isolated endonuclease
from eucaryotic cells that show at least some specificity for G residues
(McKenna et al.. 1981; Desiderio and Baltimore, 1984; Kataoka et al..
1984; Ruiz-Carillo and Renaud, 1987). In some respects, endo R is
different from all of these activities. For example, the non-random
endonuclease isolated by McKenna et al. (1981) appears to be a
degradative enzyme which digests adenovirus and SV40 DNA and initially
produces discrete fragments which are reduced to short oligonucleotides
with further digestion. The fragments produced have predominantly G
residues at their ends. In contrast, endo R has little if any activity
on Ad2 and SV40 DNA. Similarly, an endonucleolytic activity which
cleaves near the recombination site of immunoglobulin segments
(Kataoka et al.. 1984), also cleaves sites in pBR322 that consist of
short poly(dG) stretches (4-7 residues), while endo R does not
detectably cleave these short poly(dG) sequences. The activity most
similar to endo R is the one recently described by Ruiz-Carillo and
Renaud (1987) which they have called endo G. Endo G was isolated from
chicken erythrocytes and appears to cleave exclusively at stretches of
poly(dG)-poly(dC) which have a minimum length of 10 bp. Unlike endo R,
endo G does not appear to cleave alternating homopurine/homopyrimidine
stretches (poly(ga)-poly(CT). In spite of these differences, it is
possible that endo R is related to some and perhaps all of these
previously described enzymes. None of these enzymes have been purified
to homogeneity and their properties may change significantly during the
course of purification. By analogy with the recBC endonuclease
(Rosamond et al.. 1979; Taylor and Smith, 1980; Muskavitch and Linn,

140
1981; Taylor et al.. 1985), it is possible that all of these
endonucleases share a common core activity whose specificity is modified
by inhibitory or accessory proteins or the conditions of the reaction.
What Does Endo R Do for the Cell
The isolation of an enzyme from HeLa cells whose sole activity
appears to be cleavage at homopurine/homopyrimidine sequences raises the
question of the role of these sequences in cellular DNA. Endo R is one
of three major endonucleolytic activities that were detected in HeLa
cell nuclei. However, because of the specificity of endo R, it is
unlikely that it plays a degradative role in the cell. Furthermore, the
results of Larsen and Weintraub (1982) suggest that most poly(dG) or
poly(GA) sequences in chromatin would be protected from cleavage unless
they are undergoing transcription or replication.
The distribution of homopurine/homopyrimidine sequences appears to
be predominantly in non-coding sequences (Nakamura et al.. 1987;
Hoffman-Lieberman et al.. 1986; Jeffreys et al. 1985;), but their
distribution does not suggest any obvious role. In some cases these
sequences have been found near coding regions (Hentschel, 1982; Gliken
et al.. 1983; Richards et al.. 1983; Mace et al.. 1983; Field et al..
1984; Gerondakis et al.. 1984; Shih et al.. 1984; McGhee et al.. 1981;
Day et al., 1981). An intriguing aspect of these sequences is that in
many cases they have been found in regions of genetic instability,
either as part of satellite DNA (Fowler and Skinner, 1986) or as part of
moderately repeated tandem arrays which vary in the number of repeat
units (Jeffreys et al.. 1985; Nakamura et al.. 1987; Hoffman-Liebermann
et al.. 1986). Some of the variable number tandem repeat units (VNTR's)

141
have been found near coding genes as in the case of the insulin gene
(Bell et al.. 1982) and the myoglobin gene (Jeffreys et al.. 1985).
One commonly proposed mechanism for amplifying or reducing the
number of repeats in a tandem array is unequal homologous recombination.
This has led to the suggestion that VNTR sequences may contain hotspots
for recombination (Jeffreys et al., 1985). Although there is no direct
evidence to support this, it is striking that many of the VNTR's have
homopurine/homopyrimidine stretches similar to those found in AAV.
Jeffreys et al. (1985) concluded that the common core sequence in their
repeats was CxTCCTgCCC. Nakamura et al. (1987) deduced a somewhat
different core sequence, CCCCaCnnCCC. Specific examples of sequences
that have been associated with variable numbers of tandem repeats are
the insulin gene, CCCCaCaCCCC (Bell et al.. 1982), the myoglobin gene,
CCTCCaCCCgTCCTT (Jeffreys et al.. 1985), and the DR2 repeat of the
herpes simplex 1 terminal sequence, CTCCTCCCCCC (Mokarski and Roizman,
1983). It is possible, then, that endo R recognizes the secondary
structure of the VNTR sequences and is involved in one of the cellular
pathways for recombination. If, in fact, AAV termini contain a
recognition sequence for cellular recombination, then this might explain
how AAV proviruses are both integrated and rescued.
The sequence recognition of endo R is reminiscent of the
properties of telomere terminal transferase (telomerase) from
Tetrahymena (Henderson et al.. 1987). Although some variation exists in
the consensus sequence, all known nuclear telomeres consist of G-rich
and C-rich complementary strands (Blackburn, 1984). Several variations
of this sequence are recognized as telomeres in yeast, suggesting that
all of these sequences maintain a common secondary structure recognized

142
by telomerase (Szostak and Blackburn, 1982; Murray and Szostak, 1983;
Shampay et al.. 1984; Blackburn and Szostak, 1984). In addition,
elongation by telomerase requires telomeric sequences, at least 12 bp in
length, that contain 3' protruding ends rich in G-residues (Blackburn,
1986; Henderson et al.. 1987).
It is conceivable that endo R also plays a role in the maintenance
of chromosomal ends. Two variations of telomeric sequences were
substrates for endo R cleavage (pGM1483 and pGM1505, Figure 5-4C, Figure
5-6), and it is likely that all the variations of these sequences would
also be recognized and cleaved by endo R as well. In addition, the
sequence analysis of endo R cleavage sites, suggested that the enzyme
left 3' protruding ends. A portion of these would be rich in G
residues, and would, therefore, be substrates for the nontemplated
addition of sequences by telomerase. Thus, endo R cleavage of telomeric
sequences during DNA replication could allow the resolution of the ends
of the replicated chromosome, and at the same time, prepare telomeric
sequences for strand elongation by telomerase.
The results from studies of the effect of nucleotides and
polynucleotides on endo R activity suggest that endo R cleavage in vivo
may be tightly regulated. Endo R displayed a strong affinity for
homopolymers of single-stranded poly(dG) in DNA competition experiments.
This supported the conclusion that the major substrate for endo R was
poly(dG). However, the inhibition by poly(dG) may also reflect
autoregulatory properties of the enzyme. The accumulation of small
oligonucleotides of poly(dG) produced from endo R cleavage could serve
to inhibit or negatively modulate the cleavage reaction. Thus, the
amount of cleavage by endo R may be limited by endproduct inhibition.

143
Additional evidence suggests that endo R activity may be
allosterically modulated by ribo- and deoxyribo-nucleotides. Cleavage
activity was stimulated 2-3 fold with the addition of dGTP and dATP,
while the activity was strongly inhibited with the addition of ATP and
GTP. However, endo R did not bind to ATP- or GTP-linked agarose columns
and it is possible that the binding of these compounds by endo R
requires the presence of substrate DNA. These observations suggest that
there are two separate binding sites on the enzyme. One site may
recognize and bind DNA secondary structure, while another site may bind
substances that effect cleavage activity indirectly, possibly by causing
conformational changes of the enzyme. This level of control may be
necessary to prevent the cleavage of homopurine/homopyrimidine sequences
near the coding regions of transcriptionally active genes, when the
concentration of ribonucleotides is relatively high and the sequences
flanking the coding regions are exposed (Larsen and Weintraub, 1982).
During cellular DNA replication however, higher local concentrations of
deoxyribonucleotides may stimulate endo R cleavage activity.
In conclusion, endo R is a human cellular enzyme most likely
consisting of a single peptide with a native molecular weight of
approximately 120 kd. The enzyme apparently recognizes the secondary
structure characteristic of polypurine/polypyrimidine sequences rich in
G:C base pairs. Sequence analysis of the cleavage site suggests that
endo R produces double-stranded breaks in the substrate through a series
of concerted single-stranded nicks occurring throughout the recognition
site. The properties of the enzyme and the distribution of naturally

144
occurring recognition sequences in chromosomal DNA, suggest that Endo R
cleavage activity may play a role in genetic recombination and cellular
DNA replication.

REFERENCES
Arnott, S., Chandrasekaran, R., Hall, I.H., and Puigjaner, L.C. (1983)
Heteronoraous DNA. Nucl. Acids Res. 11, 4141-4155.
Atchison, R.W., Casto, B.C., and Hammond, W.McD. (1965) Adenovirus-
associated defective virus particles. Science 149. 754-756.
Bell, G.I., Selby, M.J., and Rutter, W.J. (1982) The highly polymorphic
region near the human insulin gene is composed of simple tandemly
repeating sequences. Nature 295. 31-35.
Berns, K.I., Muzyczka, N., and Hauswirth, W.W. (1985) Replication of
parvoviruses, in Virology, Bernard Fields, ed., Raven Press,
New York, pp.415-432.
Berns, K.I., Pinkerton, T.C., Thomas, G.F., and Hoggan, M.D. (1975)
Detection of adeno-associated virus (AAV)-specific nucleotide
sequences in DNA isolated from latently infected Detroit 6 cells.
Virology 68, 556-560.
Blackburn, E.H. (1984) Telomeres: Do the ends justify the means?
Cell 37, 7-8.
Blackburn, E.H. (1986) Molecular structure of telomeres in lower
eukaryotes, in Molecular Developmental Biology, L. Bogorad, ed.,
New York: Alan R. Liss, Inc., pp.69-82.
Blackburn, E. H. and Szostak, J.W. (1984) The molecular structure of
centromeres and telomeres. Annu. Rev. Biochem. 53: 163-194.
Boissy, R. and Astell, C.R. (1985) Escherichia coli recBC sbcB recF
hosts permit the deletion-resistant propagation of plasmid clones
containing the 5'-terminal palindrome of minute virus of mice.
Gene 35, 179-185.
Bolivar, F., Rodriguez, R.L., Greene, D.J., Betlach, M.C., Heyneker,
H.L., Boyer, H.W., Crosa, J.H., and Falkow, S. (1979) Construction
and characterization of new cloning vectors. II. A multipurpose
cloning system. Gene 2, 95.
Boyer, H.W. (1969) A complementation analysis of the restriction and
modification of DNA in Eschericia Coli. J. Mol. Biol. 41, 459-479.
Bradford, M.M. (1976) A rapid and sensitive method for the quantitation
of microgram quantities of protein utilizing the principle of
protein-dye binding. Anal. Biochem. 72, 248-254.
145

146
Bram, S. (1971) Polynucleotide polymorphism in solution. Nature New
Biol. 233, 161-164.
Buller, R.M., Janik, J.E., Sebring, E.D., and Rose, J.A. (1981) Herpes
simplex virus types 1 and 2 completely help adenovirus-associated
virus replication. J. Virol. 40, 241-247.
Cantor, C.R. and Efstradiatis, A. (1984) Possible Structures of
homopurine-homopyrimidine Sl-hypersensitive sites. Nuc. Acids
Res. 12, 8059-8072.
Cavalier-Smith, T. (1974) Palindromic base sequences and replication of
eukaryotic chromosome ends. Nature 250. 467-470.
Challberg, M.D. and Kelly, T.J. (1979) Adenovirus DNA replication
in vitro. Proc. Natl. Acad. Sci. U.S.A. 76, 655-659.
Chen, G.L., Yang, L., Rowe, T.C., Halligan, B.D., Tewey, K.M., and Liu,
L.F. (1984) Nonintercalative antitumor drugs interfere with the
breakage-reunion reaction of mammalian DNA topoisomerase II.
J. Biol. Chem. 259, 13560-13566.
Cheung, A.K., Hoggan, M.D., Hauswirth, W.W., and Berns.K.I. (1980)
Integration of the adeno-associated virus genome into cellular
DNA in latently infected human Detroit 6 cells. J. Virol. 33,
739-748.
Day, L.E., Hirst, A.J., Lai, E.C., Mace, M., and Woo, S.L.C. (1981) 5'
domain and nucleotide sequence of an adult chicken chromosomal B-
globin gene. Biochemistry 20, 2091-2098.
Desiderio, S. and Baltimore, D. (1984) Double-stranded cleavage by cell
extracts near recombinational signal sequences of immunoglobulin
genes. Nature 308. 860-862.
Drew, H.R. (1984) Structural specificities of five commonly used DNA
nucleases. J. Mol. Biol. 176. 535-557.
Drew, H.R. and Travers, A.A. (1984) DNA structural variations in the
E.coli tvrT promoter. Cell 37, 491-502.
Evans, T. and Efstradiatis, A. (1986) Sequence-dependent SI nuclease
hypersensitivity of a heteronomous duplex. J. Biol. Chem. 261.
14771-14780.
Field, L.J., Philbrick, W.M., Howies, P.N., Dickinson, D.P., McGowen,
R.A. , and Gross, K.W. (1984) Expression of tissue-specific Ren-1
and Ren-2 genes of mice: Comparative analysis of 5'-proximal
flanking regions. Mol. Cell. Biol. 4, 2321-2331.
Fowler, R.F. and Skinner, D.M. (1986) Eucaryotic DNA diverges at a long
and complex pyrimidine-purine tract that can adopt altered
conformations. J. Biol. Chem. 261, 8994-9001.

147
Gerondakis, S., Cory, S., and Adams J.M. (1984) Translocation of the myc
cellular oncogene to the immunoglobulin heavy chain locus in
murine plasmacytomas is an imprecise reciprocal exchange. Cell
36, 973-982.
Glikin, G.C., Gargiulo, G., Rena-Descalzi, L., and Worcel, A. (1983)
Escherichia coli single-strand binding protein stabilizes specific
denatured sites in superhelical DNA. Nature 303. 770-774.
Green, M., Parsons, J.T., Pina, M., Fujinagu, K., Caffin, A., and
Landgraf-Lears, M. (1971) Transcription of adenovirus genes in
productively infected and transformed cells. Cold Spring Harbor
Symp. Quant. Biol. 35, 803.
Handa, H., Shiroki, K., and Shimojo, H. (1977) Establishment and
characterization of KB cell lines latently infected with adeno-
associated virus type 1. Virology 82, 84-92.
Hauswirth, W.W. and Berns, K.I. (1977) Origin and termination of adeno-
associated virus DNA replication. Virology 78, 488-99.
Hauswirth, W.W., van de Walle, M.J., Laipis, P.J., and Olivo, P.D.
(1984) Heterogeneous mitochondrial DNA D-loop sequences in bovine
tissue. Cell 37, 1001-1007.
Henderson, E., Hardin, C.C., Walk, S.K., Tinoco Jr., I., and Blackburn,
E.H. (1987) Telomeric DNA oligonucleotides form novel
intramolecular structures containing guanine-guanine base pairs.
Cell 51, 899-908.
Hentschel, C.C. (1982) Homocopolymer sequences in the spacer of a sea
urchin histone gene repeat are sensitive to SI nuclease. Nature
295. 714-716.
Hermonat, P.L. and Muzyczka, N. (1984) Use of adeno-associated virus
as a mammalian DNA cloning vector: Transduction of neomycin
resistance into mammalian tissue culture cells. Proc. Natl. Acad.
Sci. USA 81, 6466-6470.
Hermonat, P.L., Labow, M.A., Wright, R., Berns, K.I., and Muzyczka, N.
(1984) Genetics of adeno-associated virus: isolation and
preliminary characterization of adeno-associated virus type 2
mutants. J.Virol. 51, 329-339.
Hirt, B. (1967) Selective extraction of polyoma DNA from infected mouse
cell cultures. J. Mol. Biol. 26, 365-369.
Hoffman-Liebermann, B., Hoffman-Liebermann, D., Troutt, A., Kedes, L.H.,
and Cohen,S.N. (1986) Human homologs of TU transposon Sequences:
Polypurine/Polypyrimidine sequence elements that can alter DNA
conformation in vitro and in vivo. Mol. Cell. Biol. 6, 3632-3642.

148
Hoggan, M.D., Thomas, G.F., Thomas, F.B., and Johnson, F.B. (1972)
Continuous carriage of adenovirus associated virus genome in cell
culture in the absence of helper adeno-virus. In Proceedings of
the fourth lepetite colloquium. Cocoyac, Mexico. North-Holland
Publishing Company, Amsterdam, p.243-249
Holloman, W.K., Rowe, T.C., and Rusche, J.R. (1981) Studies on Nuclease
alpha from Ustilago maydis. J. Biol. Chem. 256. 5087-5094.
Jeffreys, A.J., Wilson, V. , and Thein, S.L. (1985) Hypervariable
"minisatellite" regions in human DNA. Nature 314. 67.
Kataoka, T., Kondo.S., Nishi, M., Kodaira, M., and Honjo, T. (1984)
Isolation and characterization of endonuclease J: a sequence-
specific endonuclease cleaving immunoglobulin genes. Nuc. Acids
Res. 12, 5995-6010.
Kohwi-Shigematsu, T. and Kohwi, Y. (1985) Poly(dG)-Poly(dC) sequences,
under torsional stress, induce an altered DNA conformation upon
neighboring DNA sequences. Cell 43, 199-206.
Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly
of the head of bacteriophage T4. Nature (London) 227. 680-685.
Larsen, E. and Weintraub, H. (1982) An altered DNA conformation detected
by SI Nuclease occurs at specific regions in active chick globin
chromatin. Cell 29, 609-622.
Laskowski, Sr., M. (1985) Nucleases: Historical Perspectives, in
Nucleases, Linn, M.L. and Roberts, R.J., ed., Cold Spring Harbor
Laboratory, pp.2-21.
Laughlin, C.A., Cardellichio, C.B., and Coon, H.C. (1986) Latent
infection of KB cells with adeno-associated virus type 2.
J. Virol. 60, 515-524.
Laughlin, C.A., Jones, N., and Carter, B.J. (1982) Effect of deletions
in adenovirus region 1 genes upon replication of adeno-associated
virus. J. Virol. 41, 868-876.
Laughlin, C.A., Tratschin, J.D., Coon, H., and Carter, B.J. (1983)
Cloning of infectious adeno-associated virus genomes in bacterial
plasmids. Gene 23, 65-73.
Lefebvre, R.B., Riva, S., and Berns, K.I. (1984) Conformation takes
precedence over sequence in adeno-associated virus DNA
replication. Mol. Cell. Biol. 4, 1416-1419.
Li, J.J. and Kelly, T.J. (1984) Simian virus 40 DNA replication in
vitro. Proc. Natl. Acad. Sci. USA 81, 6973-6977.
Liu, L.F. and Davis, J.L. (1981) Novel topologically knotted DNA from
bacteriophage P4 capsids: Studies with DNA topoisomerases. Nucl.
Acids Res. 9, 3979-3989.

149
Liu, L.F., Liu, C-C., and Alberts, B.M. (1980) Type II DNA
topoisomerases: Enzymes that can unknot a topologically
knotted DNA molecule via a reversible double-stranded break.
Cell 19, 697-707.
Liu, L.F., Rowe, T.C., Yang, L., Tewey, K.M., and Chen, G.L. (1983)
Cleavage of DNA by mammalian DNA topoisomerase II. J. Biol. Chem.
258. 15365-15370.
Lusby.E., Fife.K.H., and Berns, K.I. (1980) Nucleotide sequence of the
inverted terminal repetition in adeno-associated virus DNA.
J. Virol. 34, 402-409.
Mace, H.A.F., Pelham, H.R.B., and Travers, A.A. (1983) Association of an
SI nuclease-sensitive structure with short direct repeats 5'of
Drosophila heat shock genes. Nature 303. 555-557.
Maniatis, T., Fritsch, E.F., and Sambrook, J. (1982) Molecular Cloning:
A Laboratory Manual (Cold Spring Harbor Laboratory, New York: Cold
Spring Harbor Laboratory).
Maxam, A.M. and Gilbert, W. (1977) A new method of sequencing DNA.
Proc. Nat. Acad. Sci. USA 74, 560-564.
McCall, M., Brown, T., and Kennard, 0. (1985) The crystal structure of
d(G-G-G-G-C-C-C-C): A model for poly(dG):poly(dC). J. Mol. Biol.
183. 385-396.
McCutchan, J.H. and Pagano, J.S. (1968) Enhancement of the infectivity
of SV40 DNA with DEAE-dextran. J. Nat. Cancer Inst. 41, 351-357.
McGee, J.D., Wood, W.I., Dolan, M., Engel, J.D., and Felsenfeld, G.
(1981) A 200 base pair region at the 5' end of the chicken adult
B-globin gene is accessible to nuclease digestion. Cell 27, 45-
55.
McKenna, W.G., Maio, J.J., and Brown, F.L. (1981) Purification and
properties of a mammalian endonuclease showing site-specific
cleavage of DNA. J. Biol. Chem. 256. 6435-6443.
McLaughlin, S.K., Collis, P., Hermonat, P.L., and Muzyczka, N. (1988)
Adeno-associated virus general transduction vectors: Analysis of
proviral structures. J. Virol. 62, 1963-1973.
McPherson, R.A., Rosenthal, L.J., and Rose, J.A. (1985) Human
cytomegalovirus completely helps adeno-associated virus
replication. Virology 147, 217-222
Mocarski, E.S. and Roizman, B. (1981) Site-specific inversion sequence
of the herpes simplex virus genome: Domain and structural
features. Proc. Natl. Acad. Sci. U.S.A. 78, 7047-7051.

150
Murakami, Y., Eki, T., Yamada, M., Prives, C., and Hurwitz, J. (1986)
Species-specific in vitro synthesis of DNA containing the polyoma
virus origin of replication. Proc. Natl. Acad. Sci. USA 83, 6347-
6351.
Murray, A.W. and Szostak, J.W. (1983) Construction of artificial
chromosomes in yeast. Nature 305. 189-193.
Muskavitch, K.M.T. and Linn, S. (1981) RecBC-like enzymes: Exonuclease V
deoxyribonucleases, in The Enzymes, Boyer P.D. ed., Academic
Press, New York, p.233.
Muzyczka, N. (1980) Construction of an SV40-derived cloning vector.
Gene 11, 63-77.
Nakamura, Y., Leppert, M., O'Connell, P., Wolfe, R., Holm, T., Culver,
M., Martin, C., Fujimoto, E., Hoff, M., Kumlin, E., and White, R.
(1987) Variable number of tandem repeat (VNTR) markers for human
gene mapping. Science 235: 1616-1622.
Nelson, E.M., Tewey, K.H., and Liu, L.F. (1984) Mechanism of antitumor
drug action: Poisoning of mammalian DNA topoisomerase II on DNA by
4'-(9-acridinylamino)-methanesulfon-m-anisidide. Proc. Natl.
Acad. Sci. USA 81, 1361-1365.
Peck, L.J. and Wang, J.C. (1983) Energetics of B-to-Z transitions in
DNA. Proc. Natl. Acad. Sci. USA 80, 6206-6210.
Pulleyblank, D.E., Haniford, D.B., and Morgan, A.R. (1985) A structural
basis for SI nuclease sensitivity of double-stranded DNA. Cell
42, 271-280.
Richards, J.E., Gilliam, A.C., Shen, A., Tucker, P.W., and Blattner,
F.R. (1983) Unusual sequences in the murine immunoglobulin u-g
heavy-chain region. Nature 306, 483-487.
Richardson, W.D. and Westphal, H. (1985) Adenovirus early gene
regulation and the adeno-associated virus helper effect.
Curr. Top. Microbiol. Immunol. 109, 147-165.
Rosamond, J., Telander, K.M., and Linn, S. (1979) Modulation of the
action of the recBC enzyme of Escherichia coli K-12 by Ca^+.
J. Biol. Chem. 254, 8646-8652.
Ruiz-Carillo A. and Renaud J. (1987) Endonuclease G: a (dG)n:(dC)n-
specific DNase from higher eukaryotes. EMBO J. 6, 401-407.
Samulski, R.J., Berns, K.I., Tan. M., and Muzyczka, N. (1982) Cloning of
adeno-associated virus into pBR322: rescue of intact virus from
the recombinant plasmid in human cells. Proc. Natl. Acad. Sci.
U.S.A. 79, 2077-81.

151
Samulski, R.J., Chang, L-S, and Shenk, T. (1987) A recombinant plasmid
from which an infectious Adeno-Associated Virus genome can be
excised in vitro and its use to study viral recombination.
J. Virol. 61, 3096-3101.
Samulski, R.J., Srivastava, A., Berns, K.I., and Muzyczka, N. (1983)
Rescue of adeno-associated virus from recombinant plasmids: Gene
correction within the terminal repeats of AAV. Cell 33, 135-143.
Sanger, F., Nicklen, S., and Coulson, A.R. (1977) DNA sequencing with
chain-terminating inhibitors. Proc. Nat. Acad. Sci. USA 74, 5463-
5467.
Schon, E., Evans, T., Welsh, J., and Efstradiatis, A. (1983)
Conformation of Promoter DNA: fine mapping of Sl-hypersensitive
sites. Cell 35, 837-848.
Semler, B.L., Dorner, A.J., and Wimmer, E. (1984) Production of
infectious poliovirus cloned cDNA is dramatically increased by
SV40 transcription and replication signals. Nucl. Acids Res. 12.
5123-5141.
Senapathy, P., Tratschin, J.D., and Carter, B.J. (1984) Replication of
adeno-associated virus DNA: Complementation of naturally occurring
rep- mutants by a wild-type genome or an ori- mutant and
correction of terminal palindrome deletions. J. Mol. Biol. 179,
1-20.
Shampay, J., Szostak, J.W., and Blackburn E.H. (1984) DNA Sequences of
telomeres maintained in yeast. Nature 310. 154-157.
Shih, C-K., Linial, M., Goodenow, M.M., and Hayward, W.S. (1984)
Nucleotide sequence 5' of the chicken c-myc coding region:
Localization of a non-coding exon that is absent from myc
transcripts in most avian leukosis virus-induced lymphomas.
Proc. Natl. Acad. Sci. U.S.A. 81, 4697-4701.
Singleton, C.K., Klupik, J., and Wells, R.D. (1983) Conformational
flexibility of junctions between contiguous B- and Z-DNA in
supercoiled plasmids. Proc. Natl. Acad. Sci. USA 80, 2447-2451.
Southern, E.M. (1975) Detection of specific sequences among DNA
fragments separated by gel electrophoresis. J. Mol. Biol. 98,
503-518.
Srivastava, A., Lusby, E.W., and Berns, K.I. (1983) Nucleotide sequence
and organization of the adeno-associated virus 2 genome. J.
Virol. 45, 555-564.
Straus, S.E., Sebring, E.D., and Rose, J.A. (1976) Concatemers of
alternating plus and minus strands are intermediates in
adenovirus-associated DNA synthesis. Proc. Natl. Acad. Sci.
U.S.A. 73, 742-746.

152
Switzer, R.C., Muril, C.R., and Shifrin, S. (1979) A highly sensitive
silver stain for detecting proteins and peptides in acrylamide
gels. Anal. Biochem. 98, 231.
Szostak, J.W. and Blackburn, E.H. (1982) Cloning yeast telomeres on
linear plasmid vectors. Cell 29, 245-255.
Taylor, A.F. and Smith, G.R. (1980) Unwinding and rewinding of DNA by
the recBC enzyme. Cell 22, 447-457.
Taylor, A.F., Schultz, D.W., Ponticelli, A.S., and Smith, G.R. (1985)
RecBC enzyme nicking at chi sites during DNA unwinding: Location
and orientation dependence of cutting. Cell 41. 153-163.
Timson, J. (1975) Hydroxyurea (Review). Mutation Research 32, 115-132.
Vogt, V. (1973) Purification and further properties of single-stranded
specific nuclease from Aspergillus oryzae. Eur. J. Biochem. 33,
192-200.
Yang. V.C. and Langer, R. (1987) A simple and economical technique for
pi measurement. Biotechniques 5, 138-144.

BIOGRAPHICAL SKETCH
Jonathan was born in New York, New York, and was raised on Long
Island, New York. He graduated from Manhasset High School, Manhasset,
New York, in June 1974 and entered Suffolk County Community College in
September of that year. In September of 1976, John transferred to the
State University of New York at Albany and received Bachelor of Science
degrees in biology and chemistry in August of 1980. From 1980 to 1982,
he studied graduate biochemistry in a Master of Science program at the
same university. In September of 1982, John moved to Gainesville,
Florida, and entered graduate school in the Department of Immunology and
Medical Microbiology at the University of Florida. He thought he had
left Long Island for good, but in August, 1985, his mentor, Nicholas
Muzyczka, moved to the State University of New York at Stony Brook,
where John completed his research and earned his Ph.D. from the
University of Florida at Gainesville in August, 1988.
153

I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is fully
adequate, in scope and quality, as a dissertation for the degree of
Doctor of Philosophy.
¡/UUiAa*' —
Nicholas Muzyczka, PtKU. ,(Chairman
Associate Professor of Immunology
and Medical Microbiology
I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is fully
adequate, in scope and quality, as a dissertation for the degree of
Doctor of Philosophy.
Edward K. Wakeland, Ph.D
Associate Professor of Pathology
and Laboratory Medicine
I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is fully
adequate, in scope and quality, as a dissertation for the degree of
Doctor of Philosophy.
William W. Hauswirth, Ph.D
Professor of Immunology and
Medical Microbiology
I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is fully
adequate, in scope and quality, as a dissertation for the degree of
Doctor of Philosophy.
Pharmacology and Therapeutics

This dissertation was submitted to the Graduate Faculty of the
College of Medicine and to the Graduate School and was accepted as
partial fulfillment of the requirements for the degree of Doctor of
Philosophy.
August, 1988
TDean, College of Medicine
Dean, Graduate School

UNIVERSITY OF FLORIDA
3 1262 08554 3956



xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID ESY970T60_77LF5A INGEST_TIME 2011-11-02T15:51:21Z PACKAGE AA00004804_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES