Citation
Genomic cloning and tissue-specific expression of lipocortin I

Material Information

Title:
Genomic cloning and tissue-specific expression of lipocortin I
Creator:
Horlick, Kenneth Robert, 1963-
Publication Date:
Language:
English
Physical Description:
viii, 106 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Annexins ( jstor )
Diabetes ( jstor )
Diabetes complications ( jstor )
Exons ( jstor )
Insulin ( jstor )
Kidneys ( jstor )
Messenger RNA ( jstor )
Pups ( jstor )
Rats ( jstor )
RNA ( jstor )
Adrenal Cortex Hormones ( mesh )
Annexin I ( mesh )
Base Sequence ( mesh )
Cloning, Molecular ( mesh )
Department of Biochemistry and Molecular Biology thesis Ph.D ( mesh )
Dissertations, Academic -- College of Medicine -- Department of Biochemistry and Molecular Biology -- UF ( mesh )
Gene Expression ( mesh )
Genes, Structural -- genetics ( mesh )
Mice -- genetics ( mesh )
Molecular Sequence Data ( mesh )
Rats -- genetics ( mesh )
Research ( mesh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 1990.
Bibliography:
Bibliography: leaves 89-105.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Kenneth Robert Horlick.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
001581151 ( ALEPH )
24594090 ( OCLC )
AHK5058 ( NOTIS )

Downloads

This item has the following downloads:


Full Text











GENOMIC CLONING AND TISSUE-SPECIFIC
EXPRESSION OF LIPOCORTIN I


















BY

KENNETH ROBERT HORLICK


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


1990















To Marta


Digitized by the Internet Archive
in 2011 with funding from
University of Florida, George A. Smathers Libraries with support from LYRASIS and the Sloan Foundation


http://www.archive.org/details/genomiccloningti00horl














ACKNOWLEDGEMENTS

I would like to thank the members of my committee for

their invaluable guidance and support during my graduate

studies. Special thanks go to Dr. Richard Boyce for both

his guidance and understanding. Also, I would like to thank

my fellow graduate students, Bill Wong, Bill Dougall, Jan-

Ling Hsu, Sally Chesrown, and Jonathan Hurt, as well as Joan

Wilson, Dr. Gary Visner, Dr. Gerald Stephanz, and Dr. John

Valentine, for their helpful discussions, support, and

friendship over the past five years.

In addition, I would like to acknowledge my mentor, Dr.

Harry Nick, for all his guidance and support. My education

and training under his direction were a valuable and

rewarding experience.

Finally, I would like to express my unending gratitude

to my parents, Herbert and Maxine Horlick, whose unfaltering

support and love have enabled me to reach this point.


iii
















TABLE OF CONTENTS

page

ACKNOWLEDGEMENTS ...............................iii

LIST OF FIGURES ..................................... V

ABSTRACT...................................................ii

CHAPTERS

1 INTRODUCTION..... ................................... 1

2 CHARACTERIZATION OF THE MOUSE LIPOCORTIN I GENE..... 8

Introduction....................................... 8
Materials and Methods............................... 10
Results............... ................. ............ 13
Discussion .......................................... 27

3 REGULATION OF LIPOCORTIN I IN RAT MAMMARY TISSUE
DURING GLANDULAR DIFFERENTIATION AND INVOLUTION..... 33

Introduction.......... ......... ..................... 33
Materials and Methods.............................. 37
Results................................................ 40
Discussion .......................................... 50

4 TISSUE-SPECIFIC REGULATION OF LIPOCORTIN I mRNA
LEVELS IN RATS DURING DIABETES AND BY GLUCAGON....... 55

Introduction....................................... 55
Materials and Methods............................... 58
Results ............... .............................. 60
Discussion.......................................... 70

5 CONCLUSIONS AND FURTHER DIRECTIONS................... 79

REFERENCES.... ........................................... 89

BIOGRAPHICAL SKETCH.....................................106














LIST OF FIGURES
Figure page

2-1 Southern blot analysis of mouse genomic DNA
with a lipocortin I cDNA probe.................. 14

2-2 Restriction map and genomic structure of the
mouse lipocortin I gene........................ 18

2-3 Sequence of the mouse lipocortin I gene.......... 20

2-4 Sequence of the mouse lipocortin I promoter
region........................................... 24

2-5 Correlation of lipocortin I genomic structure
with protein domains............................ 26

3-1 Regulation of mammary lipocortin I mRNA during
pregnancy, lactation, and involution............ 41

3-2 Decrease in mammary lipocortin I mRNA levels
with the onset of lactation..................... 43

3-3 Regulation of lipocortin I mRNA and protein
levels in rat mammary tissue during glandular
differentiation and involution.................. 44

3-4 Densitometric analysis of the data in Figure
3-3.............................................. 45

3-5 The role of the suckling stimulus directly
after birth on lipocortin I mRNA levels in
mammary tissue.................................. 47

3-6 Induction of lipocortin I mRNA and protein
expression in mammary tissue of dams following
pup removal at birth or day seven of suckling... 48

3-7 Specificity of the mammary lipocortin I mRNA
regulation following pup withdrawal.............. 49

3-8 Densitometric analysis of the increase in
lipocortin I mRNA levels following pup
withdrawal ...................................... 51









4-1 Expression of lipocortin I mRNA in tissues from
a control and three-day streptozotocin-diabetic
rat.............................................. 61

4-2 Increased levels of lipocortin I mRNA in the
heart, kidney, and hindleg muscle of three-day
streptozotocin-diabetic rats.................... 62

4-3 Heart, kidney, and hindleg muscle lipocortin I
mRNA expression in streptozotocin-injected rats
on and off insulin treatment.................... 64

4-4 Induction of lipocortin I mRNA in the rat heart
after injection of glucagon..................... 66

4-5 Increased levels of lipocortin I mRNA in the
heart after glucagon injection in four animals.. 67

4-6 Time course of the increase in lipocortin I
mRNA in the heart after injection of glucagon... 68

4-7 Lipocortin I mRNA expression in the rat heart
following injection of glucagon and other
hormones......................................... 69

4-8 Lipocortin I mRNA expression in the mouse heart
following injection of glucagon and other
hormones......................................... 71














Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

GENOMIC CLONING AND TISSUE-SPECIFIC
EXPRESSION OF LIPOCORTIN I

by

KENNETH ROBERT HORLICK

December, 1990

Chairman: Dr. Harry S. Nick
Major Department: Biochemistry and Molecular Biology

The mouse lipocortin I structural gene was isolated and

characterized by screening two mouse Balb/c liver genomic

libraries with mouse lipocortin I cDNA and oligonucleotide

probes. Restriction enzyme mapping, Southern blotting, and

DNA sequencing were carried out on three overlapping genomic

clones. The lipocortin I gene spans 17 Kbp and is divided

into 13 exons which encode a protein of 346 amino acid

residues. The promoter region of the gene has a TATA box

and a CCAAT box located upstream of the transcription

initiation site at -31 and -76 bp, respectively. Several

potential regulatory sites in the 5' flanking region were

identified by comparison to known protein-binding consensus

sequences. A comparison of the lipocortin I gene structure

with that of the closely related gene lipocortin II suggests

a common evolutionary ancestor for these proteins.


vii








Lipocortin I mRNA and protein levels in the rat mammary

gland were studied during various stages of differentiation.

Both were abundant in the nonpregnant state, and began a

striking decline at midpregnancy when epithelial cells

undergo proliferation and differentiation. In the lactating

gland, no lipocortin I was detected. During involution of

the gland after weaning, lipocortin I mRNA and protein

increased to levels observed in nonpregnant animals. The

repression of lipocortin I mRNA expression at birth and

during lactation is dependent upon the suckling stimulus,

since pup withdrawal resulted in a rapid, mammary-specific

increase in lipocortin I mRNA levels. These results suggest

lipocortin I may play a role in mammary cell growth status

during gland differentiation.

To investigate potential alterations in lipocortin I

expression during diabetes, I injected rats with

streptozotocin and analyzed mRNA levels in several tissues.

In three-day streptozotocin-diabetic rats, lipocortin I mRNA

levels were significantly increased in the heart, kidney,

and hindleg muscle. Glucagon, a hormone highly elevated in

diabetics, caused induction of lipocortin I mRNA in the

heart, but not in the kidney or muscle, four hours after

injection.


viii














CHAPTER 1

INTRODUCTION

Lipocortin I (lipo I), also called annexin I (Crumpton

and Dedman, 1990), is one of the best characterized members

of the annexins, a group of calcium-dependent, phospholipid-

binding proteins which share about 50% sequence homology and

whose physiological role remains unclear. The annexins

differ from previously characterized calcium-binding

proteins in that they lack an EF-hand-type calcium binding

site (Geisow and Walker, 1986). Proteins which are part of

this family include lipocortins (Huang et al., 1986),

calpactins (Glenney, 1986), calelectrins (Geisow et al.,

1986; Geisow and Walker, 1986; Sudhof et al., 1988),

calcimedins (Smith and Dedman, 1986), anticoagulant protein

(Funakoshi et al., 1987), endonexins (Geisow et al., 1986;

Geisow and Walker, 1986; Schlaepfer et al., 1987; Weber et

al., 1987), and chromobindins (Creutz et al., 1987).

Various annexins have been implicated in cellular processes

including inflammation (Flower, 1988), exocytosis

(Burgonyne, 1988; Drust and Creutz, 1988), differentiation

(Violette et al., 1990), blood coagulation (Tait et al.,

1988), the immune response (Hirata and Iwata, 1983), and

membrane-cytoskeletal linkage (Roy-Choudhury et al., 1988).








2

Most recently, lipocortin III was identified as inositol

1,2-cyclic phosphate 2-phosphohydrolase, an enzyme important

in metabolizing the most highly active inositol phosphate

intermediates (Ross et al., 1990). This suggests the

possibility that the other annexins may also play a role in

inositol metabolism.

Lipocortin I has a molecular weight of 35,000 daltons

and has been immunolocalized mainly to the inner surface of

the plasma membrane (Glenney et al., 1987). Most of its

observed biological properties, including binding to

phospholipid and actin, are dependent on calcium levels

(Glenney, 1986; Schlaepfer and Haigler, 1987). Multiple

binding sites for both calcium and phospholipid apparently

exist in the protein (Klee, 1988). Recent studies using

monoclonal antibodies detected both calcium-bound and

calcium-free forms of lipo I associated with membranes in

A431 cells (Hayashi et al., 1990). Early experiments

indicated the protein was secreted, but this observation

remains unexplained because no evidence for a signal peptide

was found (Wallner et al., 1986). Expression is limited to

certain cell and tissue types (Fava et al., 1989; Glenney et

al., 1987; Pepinsky et al., 1986; Wallner et al., 1986), and

in some cases lipo I may account for as much as 0.1 to 0.5%

of total cellular protein (Violette et al., 1990).

Phosphorylation of specific cellular proteins by growth

factor/hormone receptor kinases is believed to be important








3

in intracellular signal transduction (Ullrich and

Schlessinger, 1990). Lipocortin I has been shown to be a

substrate for the epidermal growth factor receptor tyrosine

kinase in intact A-431 human carcinoma cells and human

fibroblasts (Giugni et al., 1985; Sawyer and Cohen, 1985),

and is phosphorylated by the epidermal growth factor

receptor in vitro in the presence of epidermal growth factor

and calcium (De et al., 1986). Karasik et al. (1988) have

demonstrated that lipo I is also a substrate for the insulin

receptor tyrosine kinase in isolated rat hepatocytes. In

addition, both protein kinase C and cyclic-AMP-dependent

protein kinase have been shown to phosphorylate lipo I on

serine/threonine residues (Varticovsky et al., 1988).

Lipocortin II, or p36, is a substrate for the pp60v8

oncogene kinase, further implicating the annexins in

cellular signal transduction (Cooper and Hunter, 1983).

The lipocortins were originally defined as

glucocorticoid-induced, anti-inflammatory proteins which

inhibit phospholipase A2, the enzyme which releases

arachidonic acid from membrane phospholipids and begins the

cascade of enzymatic steps leading to production of

prostaglandins and leukotrienes (Blackwell et al., 1980;

Flower and Blackwell, 1979; Hirata et al., 1980). Several

of the lipocortins were shown to inhibit phospholipase A2,

as well as other phospholipases, in vitro (Hirata, 1981).

The mechanism of this inhibition is now believed to be








4

"substrate depletion," where lipocortins bind to

phospholipids and protect them from cleavage by

phospholipases. This is because no direct interaction

between lipocortins and phospholipases has been detected,

and the inhibition can be overcome by raising the

concentration of phospholipid substrate in the in vitro

assays (Aarsman et al., 1987; Davidson et al., 1987; Haigler

et al., 1987).

The annexins share a common core region consisting of

four 70-amino acid repeating units (eight for

p68/calelectrin), based on predicted secondary structure

considerations (Crompton et al., 1988). In addition, a 17-

amino acid consensus sequence, believed to contain the sites

responsible for calcium/phospholipid binding activity, was

identified within each repeat (Geisow et al., 1986). The N-

termini of the lipocortins are divergent and may be involved

in the regulation of the individual proteins (Crompton et

al., 1988; Huang et al., 1986; Pepinsky et al., 1988; Saris

et al., 1986; Wallner et al., 1986). The N-terminus of lipo

I contains sites for tyrosine and serine/threonine

phosphorylation (Karasik et al., 1988; Sawyer and Cohen,

1985; Varticovski et al., 1988), proteolysis (Ando et al.,

1989; Chuah and Pallen, 1989), and head-to-head dimerization

(Pepinsky et al., 1989). The N-terminus of lipocortin II

also contains phosphorylation sites and is the location of

binding of pll, a protein which forms a tetramer with








5

lipocortin II and binds tightly to the inner membrane

surface (Glenney and Tack, 1985).

Although the cellular function of lipo I is presently

unclear, its implication in the important processes

mentioned above justifies further investigation of this

protein. This manuscript describes the groundwork for

studies designed to investigate the regulation of lipo I

gene expression using rats and mice as models. Chapter 2

involves the isolation and characterization of the mouse

lipo I structural gene and promoter. Knowledge of the gene

structure would enable a comparison with that of lipo II,

recently published (Amiguet et al., 1990), and other

annexins when these are eventually described. Such a

comparison would reveal if the exon-intron patterns of the

genes correlate with the 70-amino acid repeats and 17-amino

acid consensus sequences of the corresponding proteins. In

addition, valuable information regarding the evolution of

the annexins and their relationship to one another would be

gained.

Obtaining the promoter sequence in the 5' flanking

region of lipo I would likely be essential in studying gene

regulation, since both nonspecific and specific protein

binding sites important in gene expression are often located

upstream of the transcription initiation site of genes

(Mitchell and Tjian, 1989). Comparison of the promoter

region of lipo I with previously identified consensus








6

sequences representing regulatory protein binding sites

might locate similar regulatory regions in lipo I. Whether

putative regulatory sites are important in vivo could then

be addressed in future experiments, described in Chapter 5.

Chapters 3 and 4 involve an attempt to identify and

define a systems) which exhibit regulation of lipo I gene

expression so that the molecular basis of this regulation

could later be investigated. Also, exploring changes of

lipo I expression in response to various stimuli might help

elucidate its biological role. Based on a link between

prolactin, an important hormone in lactation, and a lipo I-

like gene in the pigeon cropsac (Horseman, 1989), potential

hormonal control of lipo I in the rat mammary gland is

evaluated in Chapter 3. The mammary gland, like the pigeon

cropsac, differentiates into a nutrient-secreting tissue

during pregnancy and is known to be a target of prolactin

action (Topper and Freeman, 1980). Northern and Western

analyses were carried out to analyze lipo I mRNA and protein

levels in mammary tissue of dams during pregnancy,

lactation, and weaning. During these periods, several

hormones undergo large alterations in plasma concentration,

and gland morphology and cell population change radically

(Borellini and Oka, 1989). In addition, the consequences of

premature pup withdrawal and prevention of the suckling

stimulus on lipo I expression in mammary tissue are

addressed in Chapter 3. These studies revealed a dramatic








7

regulation of lipo I during gland differentiation and

involution, and a hypothesis addressing this phenomenon is

provided.

In Chapter 4, tissue-specific regulation of lipo I mRNA

levels in diabetic rats is shown. These studies were

undertaken to explore a possible connection between lipo I

and the altered lipid metabolism known to occur in some

diabetic tissues. An attempt to identify a particular

hormone involved in regulation of lipo I during diabetes

implicated the peptide hormone glucagon, which is highly

elevated in the diabetic state. These experiments represent

the first report of glucagon influencing lipo I mRNA

expression and of tissue-specific alterations in lipo I in a

disease state.














CHAPTER 2

CHARACTERIZATION OF THE MOUSE
LIPOCORTIN I GENE

Introduction

The studies described in this chapter were carried out

for two main purposes: to determine the genomic structure of

the lipo I gene, and to obtain promoter sequence from the 5'

flanking region of the gene. Information provided by such

experiments would enable future studies aimed at

investigating specific regulatory mechanisms involved in

lipo I gene regulation.

It has been proposed that exons encode functional or

structural domains of proteins (Blake, 1983; Gilbert, 1978).

The lipo I protein consists of a unique N-terminus and a

core region consisting of four 70-amino acid repeating units

(Crompton et al., 1988). In addition, a 17-amino acid

consensus sequence believed to be responsible for

calcium/phospholipid binding was identified within each of

the four 70 amino acid repeats (Geisow et al., 1986). By

characterizing the lipo I gene structure, I could determine

if discrete exons encode protein domains, such as the unique

N-terminus and the internal repeating units.

The only lipocortin structural gene which has been

characterized until now is that of mouse lipo II, which was

8








9

reported to consist of at least 12 exons spanning 22 Kbp and

to be located on chromosome nine (Amiguet et al., 1990).

These authors knew from primer extension analysis (Saris et

al., 1986) that they had not located the first -52 bp of the

mRNA in the gene, and therefore had not identified the first

genomic exon(s), which are noncoding. The intron/exon

structure of the lipo II gene was analyzed in relation to

the known protein domains. It was shown that although no

striking correlation existed with regard to exons and the

70-amino acid repeats, three of the four 17-amino acid

consensus regions were encoded at the end of one exon and

the start of the following exon. In addition, the first two

exons of lipo II were found to code for separate regions

believed to be important in regulation of protein function.

In this chapter, similar analysis regarding exon-protein

domain correlation for lipo I is shown, and a comparison

made between the two gene structures. The results provide

interesting insight into the evolution of the annexin

family.

The region upstream of many genes has been shown to

encode sites for binding of regulatory proteins (Mitchell

and Tjian, 1989). Such sites may influence mRNA expression

in either a positive or negative fashion. Both gene-

specific and ubiquitous transcription regulatory factors

have been identified which bind to certain DNA sequences.

For many of these factors, a consensus binding sequence has








10

been derived from studying the promoter regions of several

genes. Regulatory elements defined so far include those

that mediate gene expression by glucocorticoids (GRE)(Picard

et al., 1988), cAMP (CRE)(Gonzalez et al., 1989), and serum

(SRE)(Norman et al., 1988). Sequencing the 5' upstream

region of lipo I would enable localization of potential

regulatory sites involved in transcription by comparison

with known consensus sequences. This is especially

important because there is evidence that glucocorticoids

induce lipo I mRNA levels (Phillips et al., 1989; Wallner et

al., 1986; Wong et al., submitted) and that the presence or

absence of serum influences lipo I mRNA expression in

several cell types (K. Horlick and W. Wong, unpublished

results).

The work described in this chapter will be important in

future studies aimed at investigating mechanisms of

regulation of mouse lipo I gene expression. A restriction

map and genomic sequence are required for studies such as

chromatin structure analysis (Zaret and Yamamoto, 1984),

deletion analysis (Dean et al., 1983), and in vivo

footprinting (Church and Gilbert, 1984).

Materials and Methods

Library Screening and Isolation of Lipo I Genomic Clones

A mouse Balb/c liver genomic library obtained from Dr.

Tom Caskey, Baylor, and one purchased from Clonetech, Palo

Alto, CA, were screened as described by Sambrook et al.








11

(1982). Typically, 20,000 recombinant phages were plated on

15-cm YT agar plates and incubated at 37*C for 16-18 hr.

Duplicate nitrocellulose lifts of each plate were washed in

a solution containing 50 mM Tris (pH 8.0), 1 M NaCl, 1 mM

EDTA, and 0.1% SDS at 370C for 1 hr. The filters were

prehybridized in 6X SSC (lX SSC contains 0.15 M NaCl, 0.015

M sodium citrate, pH 7.0), 5X Denhardt's solution (IX

Denhardt's solution is composed of 0.1 g each of ficoll,

polyvinylpyrrolidone, and bovine serum albumin), 0.1% SDS,

and 100 Ag/ml denatured salmon sperm DNA for 2 hr at 60C.

A P-labeled lipo I cDNA probe synthesized by random primer

extension (Feinberg and Vogelstein, 1983) was added to the

hybridization solution, and the filters were further

incubated at 60C for an additional 16-18 hr. The filters

were subjected to three 1-hr washes at 60C in lX SSC and

0.1 % SDS, and exposed to Kodak X-OMAT AR film for three

days at -85C with an intensifying screen (lightning-plus,

Du Pont). When a kinased oligonucleotide was used as a

probe, the washes were performed at 50C in 3X SSC and 0.3%

SDS. Each positive clone identified from the primary

screening was further purified to homogeneity, grown up

large scale, and its genomic insert excised and subcloned

into M13mpl8 for DNA sequencing (Messing, 1983).

Probe Preparation

Hybridization probes were synthesized with a-2P dATP

(NEN, 800uCi/mmole) by random primer extension with hexamer








12

primers (Pharmacia) (Feinberg and Vogelstein, 1983) using

all or part of a 900 bp partial mouse lipo I cDNA insert

(clone BWS9, W. Wong) or a 2.7 Kb Xba fragment from genomic

clone Jlipol9. A 61-bp oligonucleotide corresponding to the

first exon was radiolabeled using gamma-32P ATP and T4

polynucleotide kinase (BRL) as described by Sambrook et al.

(1982).

Genomic DNA Isolation and Southern Analysis

Mouse genomic DNA was isolated from confluent A31

Balb/c fibroblast cells by lysis in a solution of 1 mM Tris

pH 8.0, 100 mM EDTA, 1% SDS, and 50 mg/ml proteinase K

(Boehringer Mannheim Biochemicals). Following incubation

for 1 hr at 50C, nucleic acids were ethanol precipitated

and resuspended. After a 1-hr incubation at 370C in the

presence of 100 ug/ml DNase-free RNase A (Sigma), the DNA

was purified by phenol/chloroform extractions. Genomic DNA

was then ethanol precipitated and resuspended at a

concentration of about 0.5 mg/ml. Restriction enzyme-

digested DNA (30 Mg) was run on 1% agarose gels containing

0.04 M Tris-acetate and 1 mM EDTA (pH 8.0) for 14-16 hr at

30 volts. The gel was treated as follows prior to transfer:

Depurinated two times with 0.25 M HCl (10 min each),

denatured with 0.5 M NaOH (two times, 25 min each), and

neutralized with 1.78 M Tris-borate, 1.78 M boric acid, and

0.04 M EDTA, pH 8.0. Genomic DNA was transferred

electrophoretically for 1 hr to a noncharged nylon membrane








13

(GeneScreen, NEN), immobilized on the membrane by UV cross-

linking (Church and Gilbert, 1984), and hybridized with a

specific radiolabeled probe.

Hybridization of Southern Blots

Hybridizations were done as previously described

(Church and Gilbert, 1984). Blots were prehybridized for

15-30 min in a buffer containing 1% bovine serum albumin

(Sigma), 1 mM EDTA, 0.5 M NaHPO, (pH 7.2), and 7% SDS at

60'C. After addition of the labeled probe, the blots were

hybridized at 60C for 12-16 hr. The blots were then

subjected to three 10-min washes in 1 mM EDTA, 40 mM NaHPO4

(pH 7.2), 1% SDS at 65"C, and exposed to Kodak X-OMAT AR

film for various periods of time. When a kinased

oligonucleotide probe was used, the hybridization was done

at 50C for 3-5 hr, and the wash was done in the buffer

described above, but containing a final concentration of

0.45 M Na+ at 50C.

Results

Isolation of Lipo I Genomic Clones

Initially, mouse lipo I cDNA clone BWS9, containing

almost all of the lipo I coding sequence, was used to screen

a Balb/c mouse liver EMBL3 genomic library. This probe was

also used in genomic Southern blot analysis to estimate the

length of genomic DNA which contained lipo I coding sequence

(Fig. 2-1). Clone Jlipol9 was isolated and then

characterized by Southern blot analysis using the cDNA to

















2 3 4


- 23.2

- 9.4

- 6.6


- 4.4


-2.3
-2.0












Figure 2-1. Southern blot analysis of mouse genomic DNA with
a lipocortin I cDNA probe. Genomic DNA isolated from mouse
A31 fibroblast cells was digested with Xba I (lane 1), Sca I
(lane 2), Sst I (lane 3), and Pst I (lane 4). Restricted
DNA (30 pg/lane) was run on 1% agarose gels,
electrotransferred to GeneScreen membrane, and hybridized
with a lipocortin I cDNA probe. The numbers on the right
designate the relative position of molecular size markers in
Kbp.









15

localize exons. Restriction fragments containing exons were

cloned into M13 vectors and sequenced by the dideoxy method.

Intron/exon junctions were determined by comparing genomic

sequence with that of the mouse lipo I cDNA. Jlipol9 had a

19 kb insert which was found to contain 10 lipo I exons, but

not the 5' or 3' ends of the gene. Southern blot analysis

comparing lipo I restriction fragments from the genome to

those present in Jlipol9 (data not shown) revealed that this

clone contained a seven kb fragment at its 5' end which was

not part of the lipo I gene. Thus, the 19 kb insert in this

clone was a combination of two genomic fragments, one

containing part of the lipo I gene and another from

elsewhere in the genome, which were apparently ligated

together during library construction. This phenomenon was

also reported with regard to the cloning of the human

cytosolic aldehyde dehydrogenase (ALDH1) gene, where the

authors note they identified several genomic clones which

contain ALDH1 sequence at one end and other unidentified

sequences at the other end (Hsu et al., 1989). The Southern

analysis and subsequent characterization of another clone

rule out the possibility that Jlipol9 contained a

pseudogene.

To isolate the remainder of the gene, 5'- and 3'-

specific probes were used to screen a second mouse liver

EMBL3 genomic library. A 2.7 kb Xba restriction fragment

from Jlipol9 and an APCR-derived oligonucleotide








16

corresponding to the 5' end of the lipo I mRNA (Horlick et

al., submitted) were used as probes for the 5' end, while a

460 bp fragment corresponding to the 3' end of the cDNA was

utilized to probe for the 3' end. Two new clones, 5'lipol4

and 3'lipol7, were isolated using these probes and

characterized as explained above. Exon one sequence was

obtained from 5'lipol4, while the last two exons were found

in 3'lipol7.

Genomic Structure of Lipo I

The three lipo I genomic clones examined, including a

restriction map consistent with genomic Southern analysis,

are shown in Fig. 2-2. The DNA sequence of the mouse lipo I

gene and deduced amino acid sequence from the coding region

are shown in Fig. 2-3. The gene consists of 13 exons

spanning approximately 17 kb. Exon and intron sizes are

shown in Table 2-1. Exons range in size from 59 to 341 bp,

with an average size of 107 bp. Intron lengths vary from

109 bp to 6.0 kb, averaging 1.4 kb. The first exon is

entirely noncoding and represents the true start site of

transcription as determined by primer extension (Horlick et

al., submitted). Exon two contains the first 66 coding

bases and exon 13 has the final 54. In 7 of 11 cases,

introns occur between codons. All of the exon-intron

junctions conform to the consensus sequences established for

intron donor (5'GTA/GAGT3') and acceptor (5'[Py]n-NC/TAG3')

splice signals (Breathnach and Chambon, 1981; Padgett et

al., 1986).













0 4


C ) O II






0 0 H

.H4 0
4HO *.
0 4) 4)H




) fn II
-- 0 U .1%
0 0 M 0
Sr-4 0 C





)0 U) 0 N


0 r-C P

V )0 ) H



rl m
C Q00













*H 0 H ) II
O rO 04
t o Ur 4)
. 0r.
-H 0 c QW 11









0N004
0 04 r -4
e 4 W aO a0










tO 4M -)
4) > M 0
P PC-











( -H U









0 4-i 0 II
3 -H ti0 E
V C V a






N000
C -H ( )
00 Q) 0) 4)
c 0e 4 Eu H




C= -(0 X



r E-4 Q) U)



I - r (
S) 1COw
Q) ,C C 3 -
3 *MO















Cr,

CU
q-g
q-9


Icn


Ij


I-
LU


U) -


'In
Imm

Ecu




















2


cn-


cn


*r4


Un -


Un-j












o ow 4-
41 0 0
0 O 00)
4 Cr. r.1 l
0 c o (1 3 u id 4)


a 0 0) 4) O
U 41 0 0 +
&3M U P4 M
UQ) CP4 0 l
H r-l -H c
0-) ) 4\-

o4 0 > 4 0 r

SC0 *4 4+J u
.0.4 x *00

SU a)fl Ul) .i cr U) 0
O 0 4) 4)
04 0Cr4 94
C W 0 0) C4 rl
* m QM V M
# C US O0

Q-) U r. 8 r 0) >4V0
u --I u -H
0 ON 0 w o 9a
*4rk4. *4J -*k


0 0 ) 4 0
C 0) r ) 0 UC r-0
o r 0 ) *H CH c U
HP .M -4 0 0 U) 0
0 *-I O 1 C 3
OCOS~a 04: OH
0 0 0 -H 0
o C 0 HP 0a) -

S4) C C 8rl-- 4 c -r :


0 <4 J I r0 Cv 0
S4) 1-H 0 C0 143

'O X C4C. -4 0
0 0 0.v 0 04
) 0) 0 4 a 4-

0U) 4 ) U0 0C
C ASM 0 *L) )>

C Q a tmou
0 m 4 4 ON 1*1 *4
0 -4 0 W0 4)40 04
4 C -4. J0o

0 () 4 i 0C -4 a
4 ) 0 4) 0
wOCCCOO -HC
0 () 4) 4) 4O C O 4


rv-4 U u uA.Q 0 QO










51
21





I5
Is




I






US 4
53
4 n
Bi








3!
i i

LA
CS
y5

St



ag
ya
i5
s
WA


MI
[5
SO



8
Sj j
g&
5i
5
^
IS
MA f
IS
Gff
51
a.2l


i



I




SIa
as s
3d
SI

El
51

Eg
li
B^
IS
8S3

5 3
5
El
91
'


03

8
85
5

I




IS




ip

85
4-








U,
El 1
lJ
YS







gg
gg







aEJ
i






B
8
MF l
81




S

M&
yif

81
E1
81
51
il


Ih


BL






3!S


B 8
519,


g ^
I
E





Z i
13!



LiP
8'
IS
E*
5>


eg




I
Sii

5p
3h
gs

a
i
^*l








4--
5 S
3

S k
$5

if
5
s ^
si
8 **
21
214


r5








in
I
g ;



51



s* k
U
J
uj














0
51

'k



Ba
5^


E51

gB


SB


s3:!







&i
'p8

.pD
Ur
- 5


p- u


s

s -s












CI
S
Ei
.a;
t


ggfi
E ."



yi$

Ef
y^t i




yi
3s
is
.e *

***^
SS


g^
3!



&

i



aS
8



GI







3!t
p., u.
p










S-






*40
IS
VI
2i
Ya


4 -i
Lg
gi
s s
if
MS

Ed



5i@
5 t
%
5


gi


88

PI
83'


gi
as
821


I








I



i





























Table 2-1. Mouse lipocortin I intron and exon sizes.


exon length (bp) intron length (bp)


1 61 I 6000
2 80 II 109
3 109 III 600
4 88 IV 1800
5 114 V 600
6 91 VI 1400
7 80 VI 800
8 56 VIII 1300
9 94 IX 1300
10 96 X 1200
11 59 XI 800
12 123 XII 900
13 342








22

About 1400 bp of sequence upstream of the transcription

initiation site is shown in Fig. 2-4. The initiation site

closely resembles the weak consensus sequence 5'-

PyPygAPyPyPyPyPy-3', with transcription beginning at the A,

which has been identified as an independent recognition site

for transcription initiation in several mammalian genes

(Corden et al., 1980). A TATA box and CCAAT box are located

at positions -31 and -77, respectively. In addition, the

following potential regulatory sites were identified based

on reported consensus sequences (Mitchell and Tjian, 1989;

Addison and Kurtz, 1986): AP-1 binding site (-1331), Oct-1

binding site (-1217), cAMP response element (-325),

glucocorticoid response element (-298 and -107), delayed

glucocorticoid response element (-82), serum response

element (-234 and -213), and AP-2 binding site (80 bp into

the first intron, not shown).

Structural Organization of the Lipo I Gene

Figure 2-5 shows the position of the exons relative to

the corresponding amino acid sequence. The four C-terminal

amino acid repeats have been aligned, and the more highly

conserved 17-amino acid units believed to be responsible for

calcium/phospholipid binding are underlined (Geisow et al,

1986; Pepinsky et al., 1988). Although the third 70-amino

acid repeat is encoded by exons 8, 9, and 10, no other

striking correlation between exon structure and the large

repeats can be seen. Three of the four 17-amino acid











o
411




0 *HC
0 H4






P40
E-4) U )





ONt

- Q)> -
H 4
r. a



H 4)
QO c
*d 4)
H r-c


H- 0
O )



0 0



> 0-H4





09 0
O
4J 4J





0wi




* O
) *to <
C4 0 -


a 4. -
4r o A
&M '
CO 10







g^d~







ii i ~
7.
7jI .I Ki
jB g




I I
*I










0



.0
;44-) W





rO ) C r ) (

H 0 -H 0
00 00
*: *r d

CO Q 0-
rH 0 -H 0
o0 c 4 -4
P 4.) -4 0
d 40 4.i -H
*0 0 4)



--4 $4 -4
-) 0 0 S-H 6 3
M Z-H V




.4 9 O -'"
P a O 4-)



SC
0-H CO 3






4 V. Cg 0
(3 c* 4 a, *O
*-I m


0 a) 4 0 "

0 043 ( -rCC

HO 4) 0p
0o n to 3 to
*O c 00


0- 0 0>
iH 0 H ) 14
r-4 0 0 -
-H0 *r( 4




*i fi ro-q *C
- 0 ( 0 43
044) ) 0O 9



0. 4 0 4 -HI

0 U5 3 1 l
in 4) -rH (0 0 0U

-1C 0 0 N
40 torq 04 )

fH43 rd ^ X C
in 3 H ri -H














































































a
O
0














U-
w 0











O











Z
45





.UJ





rU








27

repeats occur at a Lys-Gly junction which is at the end of

one exon and the start of the next. The third 17-amino acid

repeat, unlike the other three, is located entirely within

one exon. This pattern is essentially identical to that

reported for mouse p36, or lipo II, where the first, second,

and fourth 17-amino acid repeats occur at exon boundaries,

while the third is located in one exon. Interestingly, the

second exon encodes the N-terminal 22 amino acids, including

sites for phosphorylation, proteolysis, and head-to-head

dimerization (see intro. for ref.).

Discussion

In this chapter, I have shown the complete mouse lipo I

gene structure and about 1400 bp of upstream flanking

region. This enables an analysis of lipo I gene/protein

structure relationships, as well as a comparison with that

of mouse lipo II. A complete comparison, however, is not

yet possible because the 5' end and promoter region of lipo

II have not been identified (Amiguet et al., 1990). Such an

analysis is useful to determine whether lipo I fits the

hypothesis that exons encode discrete functional or

structural domains of proteins (Blake, 1983; Gilbert, 1978).

The lipo I protein can be divided into two regions, an

N-terminus unique to this protein and a core region

consisting of four 70-amino acid repeats. These structural

repeats are shared among the other lipocortins and are

believed to be necessary for calcium/phospholipid binding.








28

All four are encoded by three exons, and in three of the

four cases exon/exon boundaries show no striking correlation

with amino acid repeat boundaries. However, in the case of

the third 70-amino acid repeat, exons 8, 9, and 10

correspond almost exactly with the repeat boundaries. The

significance of this observation is not clear, although it

suggests that each repeat may have originally been encoded

by a combination of three separate exons whose boundaries

then became less defined during subsequent duplication. The

pattern seen in lipo I is very similar to that of lipo II in

terms of the 70-amino acid repeats. In lipo II, however,

the boundaries of the third repeat do not correspond quite

as well to the exon/exon boundaries.

Correlation of the 17-amino acid consensus sequences

within each repeat (Geisow et al., 1986) to exon structure

supports the idea of a common ancestor exon for the repeat

unit. As shown in Fig. 2-5, three of four of the 17-amino

acid repeats begin at a Lys-Gly which is at the end of one

exon and the start of the next. The third repeat is the

exception, because it is encoded in the central part of one

exon. This pattern is virtually identical to that seen in

lipo II, except that in this case the first repeat starts

two amino acids before the Lys-Gly (Amiguet et al., 1990).

It is interesting to note that the majority of the

unique N-terminus is encoded by exon two. This part of the

protein contains potential sites for tyrosine and serine








29

phosphorylation, proteolysis, and dimerization. Therefore,

it is possible that exon two is a lipo I-specific regulatory

exon responsible for mediating its particular activity.

This correlates with the fact that the putative second and

third exons of lipo II encode regions believed important in

its regulation (Amiguet et al., 1990). Lipo II exon two

encodes the site for binding of a protein called pll, while

exon three encodes phosphorylation and proteolytic cleavage

sites (Glenney and Tack, 1985). Mitsunobu et al. (1989)

have isolated a cDNA from GL-5-JCK human glioblastoma cells

in which the region coding for the first 16 amino acids of

lipo II was fused to the coding region for the 370 C-

terminal amino acids of the c-raf-1 oncogene/kinase.

Expression of this lipo II/c-raf-1 fusion protein resulted

in transformation of NIH3T3 cells. The first 16 amino acids

of lipo II, encoded entirely by the putative second exon,

contain the binding site for pll. Binding of pll to lipo II

results in the formation of a p362pll2 tetramer which is

anchored to the cytoskeleton (Zokas and Glenney, 1987), so

it is possible that aberrant localization of the c-raf-1

kinase to the cytoskeleton, mediated by the pll binding site

encoded by the lipo II second exon, caused the cell

transformation observed by Mitsunobu et al. (1989).

Further analysis between the genomic structures of lipo

I and lipo II leaves little doubt of their common ancestry.

If one assumes that the -52 bp of noncoding sequence








30

(indicated by primer extension) not identified in the lipo

II gene make up its first exon (Amiguet et al., 1990; Saris

et al., 1986), then the two genomic structures are nearly

identical. Both would consist of 13 exons, 6 of which are

exactly the same in length. The shared gene structure

supports the evolution of these two genes from a common 13

exon-containing ancestral gene, rather than the co-evolution

of the genes from a duplication of an ancestral repeat-

encoding exon. This theory would also account for the

origin of calelectrin/p68 from a duplication of the 13 exon

ancestor to form the eight-repeat structure of p68. The

verification of this hypothesis must await the

characterization of gene structures for the remaining

members of the lipocortin family, including p68.

Of the potential regulatory sequences identified in the

1400 bp upstream of the transcription initiation site, the

most interesting are the GREs. Dexamethasone (DEX) has been

shown to induce lipo I mRNA levels in several cell types

(Phillips et al., 1989; Wallner et al., 1986; Wong et al.,

submitted), although it is clear that this response does not

occur in all cells investigated (Bienkowski et al., 1989;

Bronnegard et al., 1988; Hullin et al., 1989; Isacke et al.,

1989; Northup et al., 1988; William et al., 1988). Whether

this specificity is due solely to the presence or absence of

glucocorticoid receptors, or involves other factors, is

presently unclear. Especially intriguing is the region at








31

positions -82 to -42, which resembles the delayed

glucocorticoid response element (sGRE) of the rat alphas-

globulin promoter (Addison and Kurtz, 1986). This 45 bp

region was shown to mediate induction of transcription by

DEX. This induction, unlike those termed rapid primary

responses, required protein synthesis. A response which is

blocked by cycloheximide and usually shows a lag between

administration of the hormone and initiation of the response

has been called an indirect or secondary response (Chen and

Feigelson, 1980; Hess et al., 1990; Klein et al., 1988; Paek

and Axel, 1987; Widman and Chasin, 1982). The induction of

lipo I mRNA in the mouse pre-adipocyte line 3T3-L1 by DEX

both exhibits a lag time of about two hr and is blocked by

cycloheximide (Wong et al., submitted). Therefore, it is

possible that the delayed response to DEX observed in 3T3-

L1 cells is mediated by the putative sGRE in the lipo I

promoter.

Other potential regulatory sites of interest include

the two serum response-like elements. Different lipo I mRNA

expression levels were observed in several tissue culture

cells depending on the presence or absence of serum (K.

Horlick and W. Wong, unpublished data). In agreement with

this, the mRNA for lipo II (calpactin I) was shown to be

induced as a primary response to serum stimulation of

quiescent A31 cells (Keutzer and Hirschhorn, 1990). Also,

as documented in Chapter 4, an induction of lipo I mRNA in








32

the rat heart after injection of glucagon was observed.

Since glucagon action is mediated in many cases by increased

levels of cAMP, it is possible that the cAMP response

element identified in the lipo I promoter mediates this

tissue-specific response. In support of this, lipo I mRNA

levels are altered in 3T3-L1 cells after treatment with

methylisobutyl xanthine, a phosphodiesterase inhibitor which

leads to increased intracellular cAMP levels (Parsons et

al., 1988; W. Wong, unpublished data). Other experiments

shown in Chapter 4, however, do not support a role for cAMP

in the induction of heart lipo I mRNA by glucagon.

In conclusion, I have described the genomic structure

of mouse lipo I and compared it to the known portion of the

lipo II locus. The two closely related genes are unlinked

and located on chromosomes 19 and 9, respectively (Amiguet.

et al., 1990; Horlick et al., submitted). It will be of

interest to determine whether the other members of the

lipocortin family show a similar intron/exon organization,

further implicating a common gene ancestor which gave rise

to these proteins.














CHAPTER 3

REGULATION OF LIPOCORTIN I IN RAT MAMMARY TISSUE
DURING GLANDULAR DIFFERENTIATION AND INVOLUTION

Introduction

The mammary gland in both humans and rodents is a

complex tissue exhibiting dramatic morphologic and

functional changes during pregnancy and lactation in females

(Borellini and Oka, 1989; Hollmann, 1974; Topper and

Freeman, 1980). The gland consists of several cell types,

including fat cells, epithelial cells, and myoepithelial

cells, whose number and morphology change according to

developmental status.

During sexual maturation, epithelial cells grow

extensively to form the tree-shaped ductal system

characteristic of mammary tissue. Upon sexual maturation,

this ductal development stops even though the major hormonal

stimuli for growth are still present. At this stage the

epithelial cells are dormant, arrested in the G, phase of

the cell cycle. Pregnancy causes hormonal changes which

relieve mammary epithelial cells of growth constraints, and

consequently cell replication resumes in the first half of

pregnancy. In middle to late pregnancy, epithelial

proliferation continues, and differentiation into secretary

cells, or alveoli, takes place. As term approaches, alveoli

33








34

begin to accumulate secretary products and increase

cytoplasmic size.

In the lactating gland, secretary cells are highly

polarized with respect to both morphology and function. A

large part of the cytoplasm is occupied by rough endoplasmic

reticulum and a well-developed Golgi apparatus is located in

the apical region. Alveoli manufacture and secrete large

quantities of protein, fat, and carbohydrate.

As suckling decreases during natural weaning,

involution of the gland begins. At this time, secretary

alveoli develop large vacuoles containing casein micelles

and large fat droplets. As weaning progresses, these

vacuoles fuse with hydrolytic lysosomes, leading to

autophagy. The majority of epithelia are destroyed, but

some survive to become resting cells, like those in the

mature virgin gland, which will proliferate and

differentiate upon the next pregnancy.

The hormonal determinants of mammary gland development

are complex and beyond the scope of this introduction. They

include insulin, cortisol, prolactin, estrogen, epidermal

growth factor, transforming growth factor beta, thyroid

hormones, retinoids, and vitamin D3 (Borellini and Oka,

1989). In addition, other factors affecting mammary growth

include calcium, polyamines, and poly(ADP-ribose).

A lipo I-like gene was studied in the pigeon cropsac,

an organ which displays the same hormonal specificity as the








35

mammary gland, but is substantially simpler (Horseman, 1989;

Pukac and Horseman, 1986). In the cropsac, a homogenous

population of pseudostratified squamous epithelia

proliferates and differentiates after prolactin treatment.

As mentioned above, prolactin is very important in

establishing and maintaining lactation in the mammary gland.

The differentiated epithelia of the cropsac synthesize and

store large amounts of lipoprotein globules which are used

to nourish offspring.

Several genes which were induced in the cropsac after

intradermal injection of prolactin were cloned and

characterized (Pukac and Horseman, 1986). The mRNA for the

major prolactin-induced gene was stimulated as early as

three hr after injection of the hormone and peaked at levels

about 70-fold higher than before injection. This mRNA

encoded a polypeptide of molecular weight 35,500. When the

nucleotide sequence of this prolactin-induced cDNA was

determined, it was found to be highly similar to that of

mammalian lipo I (Horseman, 1989). The only region of

substantial sequence difference was a domain in mammalian

lipo I encoding amino acids 20-40, including a tyrosine

phosphorylation site and other residues believed to be

physiologically important. It was concluded that

lipocortins might be regulated by prolactin in other

tissues, and that the difference in sequence near the N-

termini of mammalian and avian lipocortins might represent a

divergence yielding different regulatory mechanisms.








36

Lozano et al. (1989b) studied several mammary gland

calcium-binding proteins in the mouse mammary gland during

development. Some of these proteins had previously been

identified as calelectrins and calpactin I/lipocortin II

(Hom et al., 1988). It was found that the mammary gland

calcium-binding proteins were developmentally regulated:

They were present in large amounts in the mature virgin

gland, but were virtually absent in the lactating gland.

Immunolocalization revealed that ductal epithelial cells in

the virgin gland were rich in calelectrins and calpactin I,

while myoepithelia did not contain them. The secretary

alveolar epithelial cells of the lactating gland, in

contrast to epithelia from the virgin gland, were

essentially devoid of these proteins. Based on these

results, the authors seriously questioned a role for

calelectrin and calpactin I in casein exocytosis. They

previously had proposed that these calcium binding proteins

might be involved in epithelial cell spreading, including

cell motility or cell shape changes (Braslau et al., 1984;

Rocha et al., 1986).

This chapter shows studies designed to investigate lipo

I mRNA and protein expression in the rat mammary gland

during natural differentiation and involution, as well as

after premature termination of lactation by pup removal.

Since two other annexins were shown to be developmentally

regulated in the mouse mammary gland as described above, it








37

would be important to determine if lipo I would exhibit

regulation in mammary tissue. Another question these

studies address is whether or not mammalian lipo I might be

induced by prolactin, similar to the lipo I-like pigeon gene

in the cropsac. The profile of prolactin expression in the

rat during pregnancy and lactation is known, and could be

compared to expression of lipo I.

The results described in this chapter indicate that

both lipo I mRNA and protein levels show striking

alterations in the mammary gland of dams during normal

differentiation and involution, as well as following

premature pup removal. In contrast to the pigeon lipo I-

like gene, rat mammary lipo I does not appear to be induced

by prolactin, and is in fact inversely related to predicted

prolactin levels.

Materials and Methods

Animals

Timed-pregnant Sprague-Dawley rats were obtained from

Charles River Laboratories.

RNA Isolation

Total RNA was isolated by homogenizing tissues in a

guanidinium thiocyanate-sarcosyl solution followed by acid

phenol/chloroform extraction and ethanol precipitation as

described previously (Chomczynski and Sacchi, 1987).

Typically, about 1 g of tissue was lysed in 5 ml of

thiocyanate solution containing 4 M guanidine thiocyanate,








38

25 mM sodium citrate (pH 7.0), 0.5% sarcosyl, 100 mM 2-

mercaptoethanol. To this solution, 300 pl of 2 M sodium

acetate (pH 4.0), 3 ml of H20-saturated phenol, and 1 ml of

chloroform:isoamyl alcohol (24:1) were added in stepwise

fashion. The mixture was centrifuged at 10,000 x g for 10

min to separate phases. The aqueous phase was mixed with 3

ml of isopropanol and total RNA precipitated by incubating

the mixture at -20C for at least 1 hr, followed by

centrifugation at 10,000 x g for 30 min. The RNA pellet was

then resuspended in 600 pl of guanidine thiocyanate solution

and further purified by isopropanol and ethanol

precipitation.

Northern Analysis

An aliquot of 20 pg total RNA was loaded on a 1% MOPS (3-

(N-morpholino)- propanesulphonic acid)-formaldehyde agarose

gel as described previously (Sambrook et al., 1982). The

gel was run for 12-16 hr at 40 volts with constant buffer

recirculation. The gel was then subjected to three 30-min

washes with water, one 45-min wash in 0.05 N NaOH and 0.01 M

NaC1, one 45-min wash in 0.1 M Tris-HCl (pH 8.0), and a 30-

min wash in a solution containing 0.089 M Tris-borate, 0.089

M boric acid, and 0.002 M EDTA, pH 8.0. The RNA was

electrophoretically transferred from the gel to a noncharged

nylon membrane (GeneScreen, NEN) for 1 hr. The RNA was

immobilized on the membrane by cross-linking with UV light

(Church and Gilbert, 1984) and analyzed with a specific

radiolabeled probe.










Probe Synthesis

A mouse lipocortin I cDNA provided by William Wong of

this laboratory, a rat Cu/Zn superoxide dismutase cDNA

provided by Jan-Ling Hsu of this laboratory, and a mouse

histone H4 cDNA (Seiler-Tuyns and Birnstiel, 1981) were used

as probes. Probes labelled with a-"P dATP (NEN,

800uCi/mmol) were synthesized either by random primer

extension, as described in Chapter 2, or by an M13 single-

stranded probe synthesis method using an M13mpl8 clone

containing the mouse lipo I cDNA insert in the appropriate

orientation to produce a probe complementary to mRNA (Church

and Gilbert, 1984). Hybridization was carried out as

described in Chapter 2.

Western Analysis

Mammary tissue was weighed and homogenized in 10 ml of

20 mM Tris-HCl (pH 7.4), 1 mM EDTA, 255 mM sucrose

supplemented with 1% aprotinin. A polytron was used for

homogenization (two times at half-maximal speed for 10 sec

each). After the suspension was spun at 212,000 X g for 70

min at 4C, a Markwell protein assay was performed on the

supernatant. 100 Ag of total protein was run on a 10%

polyacrylamide reducing gel and transferred to

nitrocellulose. The membrane was blocked for 3 hr using 20

mM Tris-HCl (pH 7.4), 0.5 M NaCl (TBS) supplemented with 3%

BSA and 0.05% Tween and incubated for 16 hr at 4C with an

anti-lipocortin I antibody (Huang et al., 1986) at 1:1000









40

dilution in 3% BSA/TBS. The membrane was washed for 1 hr

with 1% BSA/TBS and then incubated with 1 X 107 cpm of I125

labeled protein A for 1 hr. After three 20-min washes in 25

ml TBS, the membrane was air-dried and exposed for 3-5 days

to Kodak X-OMAT film.

Results

To investigate lipo I mRNA levels in the rat mammary

gland during differentiation and involution, I carried out

Northern analysis using a mouse lipo I cDNA probe (Fig. 3-

1). Messenger RNA levels from mature virgin animals were

compared with those from animals which were either pregnant,

lactating, or weaned. The mRNA was very abundant in the

nonpregnant state. At midpregnancy, a large decline was

observed, corresponding to the time when epithelial cells

proliferate and differentiate (Topper and Freeman, 1980).

By day 22 of pregnancy (1-2 days before birth), mRNA levels

decreased at least 50-fold as compared to virgin animals.

At birth a small, but reproducible increase occurs. With

the onset of lactation, lipo I mRNA was undetectable and

remained so for the remainder of the suckling period. After

weaning had occurred (30 days following birth), the mRNA

rose to levels comparable to those seen in virgin animals.

To illustrate the time during pregnancy when epithelial

cells begin proliferating, I also determined histone H4 mRNA

levels, which increase during DNA synthesis and cell

proliferation (Seiler-Tuyns and Birnstiel, 1981). A rise in



















PREGNANT
NP 7 11 15 19 22 B 1 3


LACTATING
7 15 19 22 W


Upocortin I


C4/Zn SOD
















Figure 3-1. Regulation of mammary lipocortin I mRNA during
pregnancy, lactation, and involution. Total RNA was
isolated from mammary tissue of female rats which were
mature virgins (NP), pregnant for various lengths of time
(days), had just given birth (B), had suckled pups for
various lengths of time (days), or after weaning (W, 30 days
after birth). Birth usually occurs on day 23. Northern
blot analysis was carried out with a cDNA probe for mouse
lipocortin I, then the blot was stripped and reprobed with
mouse histone H4 and rat copper/zinc superoxide dismutase
(SOD) cDNAs.


I








42

histone H4 is apparent at day 15 of pregnancy, when mammary

epithelial cells begin proliferation and differentiation,

and also after weaning, during glandular involution.

Copper/zinc superoxide dismutase mRNA levels are illustrated

as an internal control, and show only a small variation over

the same time course.

Figure 3-2 focuses on the decrease in steady-state lipo

I mRNA levels in mammary tissue of dams following the start

of suckling. Two animals are shown to demonstrate

reproducibility. The decline in lipo I mRNA can be compared

to levels of copper/zinc superoxide dismutase, which remain

relatively constant during the experiment.

To investigate whether the lipo I protein followed a

similar expression pattern, extracted mammary tissue

proteins were analyzed by immunoblotting (Fig. 3-3). Also

shown are mammary lipo I mRNA levels from the same animals.

The lipo I-specific antibody revealed abundant levels of

lipo I protein in the virgin rat gland. Like the mRNA, the

protein declined during pregnancy, was nearly undetected

during lactation, and increased at weaning. Densitometric

analysis of protein and mRNA levels shows a close

correspondence between the two (Fig. 3-4).

Since the lipo I mRNA increased rapidly upon weaning,

the role of the suckling stimulus in lipo I regulation was

investigated. Messenger RNA levels were determined in

mammary tissue of dams which had pups withdrawn at birth.
























0 0 1 1 2 2 3 3


Upo




Cu/Zn SOD


Figure 3-2. Decrease in mammary lipocortin I mRNA levels
with the onset of lactation. Total RNA was isolated from
mammary tissue of animals which had just given birth or had
suckled pups for one, two, or three days. Each
determination was performed in duplicate. Northern analysis
was carried out using mouse lipocortin I and rat Cu/Zn SOD
cDNA probes.


doys after birth





















NP 15P 22P B 1L 7L 15. W


mRNA





protein


Figure 3-3. Regulation of lipocortin I mRNA and protein
levels in rat mammary tissue during glandular
differentiation and involution. Total RNA and protein were
isolated from mammary tissue of rats as described in Figure
3-1. P, pregnant; L, lactating. Northern analysis and
immunoblotting were then carried out using a mouse
lipocortin I cDNA probe and anti-lipocortin I antibody,
respectively.








45







70 24
S22
60-- ..20

< 50- 0 18 z
n -16z W
E 740- 14 o
z/ -.12
* 30-- -10 o
T 8 1
* 20 6 o 0


0 0
NP 15P 22P B 1L 7L 15L W






















Figure 3-4. Densitometric analysis of the data in Figure 3-
3. A Bio Image Visage 60 image processor was used for
quantitation of lipocortin I mRNA and protein levels in
Figure 3-3.








46

Figure 3-5 shows that as early as one day after pups were

removed, lipo I mRNA levels dramatically increased over the

level at birth. Actin mRNA rose to a lesser degree, while

levels of copper/zinc superoxide dismutase mRNA were

relatively constant during the experiment.

To further investigate the role of the suckling

stimulus, lipo I mRNA levels were analyzed in mammary tissue

of dams following pup withdrawal at birth and after seven

days of suckling (Fig. 3-6). Also, time points prior to 24

hr after withdrawal were examined in order to determine how

fast the induction of lipo I mRNA was. If pups are removed

at birth, completely preventing the suckling stimulus,

mammary lipo I mRNA levels increased significantly in the

dams as early as 6 hr after removal, reaching a plateau by

12 hr. If pups were withdrawn after seven days of suckling,

the increase in lipo I mRNA was delayed by several hours and

peaked by 24 hr. In contrast, lipo I protein levels were

low to undetectable for more than 24 hr after pups were

removed either at birth or after seven days of suckling, but

by five days after removal the protein had reached maximal

levels.

To examine the specificity of lipo I regulation

following pup withdrawal, lipo I mRNA levels were next

measured in the mammary gland and several other tissues from

animals whose pups were withdrawn 15 days following birth

(Fig. 3-7). This experiment demonstrated that lipo I mRNA

























0 0 1 3 5 7 9


lipo I





actin



Cu/Zn SOD


Figure 3-5. The role of the suckling stimulus directly after
birth on lipocortin I mRNA levels in mammary tissue. Pups
were removed at birth and total RNA was isolated from
mammary tissue of dams at 0, 1, 3, 5, 7, and 9 days
following pup withdrawal. Northern blot analysis was done
using lipocortin I, actin, and Cu/Zn SOD cDNA probes as
described previously.


days after pup removal






















pups removed at:
time after removal:


mRNA



protein


Bith 7 dqy
0 6 12 24 Sd 0 6 12 24 5d


Figure 3-6. Induction of lipocortin I mRNA and protein
expression in mammary tissue of dams following pup removal
at birth or day seven of suckling. Pups were removed from
the dams at birth or following seven days of suckling, and
total RNA and protein were isolated from mammary tissue of
dams at 0, 6, 12, 24, and 120 hr/5 days following pup
withdrawal. Northern analysis and immunoblotting were
carried out as described in the legend to Figure 3-3.






























mammary tum
time after
removal: 0 6 12 24 5d


HWart KMy Muscle
0 6 12 24 Sd 0 6 12 24 Sd 0 6 12 24 Sd


Figure 3-7. Specificity of the mammary lipocortin I mRNA
regulation following pup withdrawal. Total RNA was isolated
from various tissues of dams whose pups were removed
following 15 days of suckling. RNA was prepared 0, 6, 12,
24, and 120 hr/5 days after pup withdrawal. Northern
analysis was done using a mouse lipocortin I cDNA probe.








50

levels were constant in the heart, kidney, and hindleg

muscle of dams, while there was a significant rise in

mammary tissue expression over the five-day withdrawal

period. Thus, the regulation of lipo I mRNA in the mammary

gland after pup removal was a tissue-specific phenomenon.

The increase in lipo mRNA levels over the five-day period

following pup withdrawal, shown in Fig. 3-6 and 3-7, was

between 60- and 80-fold (Fig. 3-8).

Discussion

It is likely that hormonal changes during pregnancy and

lactation influence the pattern of mammary lipo I mRNA and

protein expression. Based on the awareness of a prolactin-

inducible, lipo I-like gene in the pigeon cropsac, I

explored the effects of prolactin on mammalian lipo I gene

expression. These experiments involved the use of the

midpregnancy-derived mammary epithelial cell line HC11,

which had been clonally selected for its responsiveness to

prolactin (Ball et al., 1988). Treatment of these cells

with prolactin, however, caused no change in lipo I mRNA

expression, which was also the case when mammary explants

were treated with prolactin in culture (data not shown).

Furthermore, in the rat, circulating levels of prolactin are

low until one day before birth, when they rise dramatically

(Rosenblatt et al., 1979). Prolactin levels remain high

during suckling and gradually decline as weaning approaches.

In contrast, lipo I mRNA and protein levels are high in the















80

O-

60-



40-



20-



0-


6 12 24 5d


0 6 12 24 5d


FIGURE 3-8. Densitometric analysis of the increase in
lipocortin I mRNA levels following pup withdrawal.
Quantitation of the mRNA data in Figures 3-6 and 3-7 was
done using a Bio Image Visage 60 image processor. The first
five bars (open) represent pup removal at birth and show a
30-fold mRNA increase from birth to five days after pup
removal. The next five bars (diagonal lines) represent pup
removal after seven days of suckling and exhibit a 120-fold
mRNA increase over the five-day period after pup withdrawal.
The last five bars (X's), which represent pup removal after
15 days of suckling, show a mRNA induction of 320-fold over
the time course.


0 6 12 24 5d


r








52

virgin gland and during the first half of pregnancy, and low

to undetectable at birth and during lactation. This

indicates that if prolactin is involved in regulating

mammary lipo I expression, it would do so by down-

regulation, which I did not observe in HCll cells or mammary

explants. Future studies investigating mammary epithelial

cell lines for hormonal effects on lipo I expression may aid

in understanding the regulation I observed in the mammary

gland during differentiation and involution.

Although prolactin did not affect expression of lipo I

mRNA in the mouse mammary epithelial cell line HC11, I did

observe high levels of the message (data not shown). Thus,

it is likely that the resting ductal epithelial cells, which

give rise to secretary cells during pregnancy, are

responsible for the high lipo I expression observed in the

virgin gland. Immunolocalization of two other annexins,

annexin II and calelectrin, in virgin mammary epithelial

cells by Rocha and coworkers supports this hypothesis (Hom

et al., 1988; Lozano et al., 1989a; Lozano et al., 1989b).

In contrast, secretary cells of the lactating gland were

essentially devoid of these proteins (Lozano et al., 1989b).

The ductal cells, which are dormant in the mature virgin

animal and reported to be arrested in the G, phase of the

cell cycle, begin proliferation and differentiation into

secretary cells around midpregnancy (Topper and Freeman,

1980). The striking decline in lipo I mRNA and protein








53

levels that I observed in the rat mammary gland during

pregnancy corresponds to the onset of these changes in

epithelial cell morphology. I believe that the high level

of lipo I in the virgin mammary gland may be involved in

inhibiting epithelial cell proliferation and

differentiation. This leads to a consideration of what

regulates lipo I. It is well known that epidermal growth

factor (EGF) is important in signaling mammary gland growth

during pregnancy (Taketani and Oka, 1983). The EGF

receptor, which is known to phosphorylate lipo I (Sawyer and

Cohen, 1985), reaches its highest levels in the mammary

gland around midpregnancy (Edery et al., 1985). Perhaps

phosphorylation of lipo I during pregnancy alters its

activity, which is followed by a subsequent down-regulation

of lipo I expression. Although it has been demonstrated

that serine/threonine phosphorylation of lipo I blocks its

phospholipase-inhibitory activity and alters its

calcium/phospholipid binding properties (Ando et al., 1985;

Hirata, 1981; Hirata et al., 1984; Touqui et al., 1986), it

is yet to be investigated whether tyrosine phosphorylation,

too, is inhibitory. Nevertheless, this event may be

necessary to initiate epithelial cell proliferation and

differentiation.

Soon after natural weaning or premature termination of

the suckling stimulus by pup removal, a subpopulation of the

mammary secretary epithelial cells reverts back to the








54

resting state, while the remainder of the cells die

(Borellini and Oka, 1989; Hollmann, 1974). No irreversible

changes in the gland occur immediately after cessation of

suckling, because lactation can recommence several days

after weaning (Silver, 1956). The subset of epithelial

cells which reverts to the resting state may be responsible

for the rapid increase in mammary lipo I mRNA after removal

of the suckling stimulus. These cells may receive a signal

from the sympathetic nervous system when suckling ceases

which causes a rapid transcriptional activation of lipo I in

preparation for return to the resting state. As shown in

Fig. 3-6, translation of lipo I mRNA appears to be delayed

and requires more than 24 hours after cessation of suckling.

This delay may correspond to the time when glandular

involution becomes a committed event, encompassing

epithelial cell death. This appears to occur approximately

five days after weaning (Silver, 1956), and therefore

correlates with the time at which maximal levels of lipo I

are reached. I believe that the high lipo I levels observed

in the involuted gland following natural weaning (Fig. 3-1)

indicate the presence of new resting epithelial cells,

which, like those in the mature virgin gland, may undergo

proliferation and differentiation with the onset of a new

pregnancy.














CHAPTER 4

TISSUE-SPECIFIC REGULATION OF LIPOCORTIN I mRNA
LEVELS IN RATS DURING DIABETES AND BY GLUCAGON

Introduction

Diabetes mellitis, a serious and prevalent disease

among humans, is known to result in a wide variety of

physiological alterations which often may result in death

(Warren et al., 1966). Numerous qualitative and

quantitative alterations take place in the pancreas, the

organ in which the insulin-producing islet cells are

located. Cardiovascular disease is one of the leading

causes of death in diabetics, with both heart dysfunction

and atherosclerosis frequently developing. Renal

alterations include a marked hypertrophy with corresponding

increase in kidney weight, as well as an increased

glomerular filtration rate. Blindness may result from

retinopathy, such as microaneurysms. Nervous system damage,

most notably in peripheral nerves, results in symptoms

including pain and loss of sense in the feet and legs.

Gangrene in the extremities, bone and skin lesions, muscle

atrophy, liver damage, and gastrointestinal problems often

occur in diabetics.

Many studies regarding diabetes have relied upon animal

models, including rats (Fein et al., 1980), rabbits (Bhimji

55








56

et al., 1985), and dogs (Regan et al., 1981). Administration

of alloxan (Dunn et al., 1943) or the antibiotic

streptozotocin (STZ)(Junod et al., 1967) has been shown to

cause impaired f-cell function and hypoinsulinemia in young

animals, thus simulating the diabetic state. In addition,

there are Chinese hamster (Yerganian et al., 1957), mouse

(Bielschowski and Bielschowski, 1956), and rat (Rodrigues

and McNeill, 1990) inbred strains which develop spontaneous,

hereditary diabetes.

Several biochemical alterations have been observed in

tissues from diabetic animals. Fatty acid compositions of

phospholipids of heart, kidney, aorta, and serum undergo

changes in both human (Chase et al., 1979) and animal (Faas

and Carter, 1980) diabetes. Specifically, linoleic acid was

found to be increased and arachidonic acid to be decreased

in most tissues as compared to nondiabetic controls (Faas

and Carter, 1980; Holman et al., 1983; Schrade et al.,

1963). Physical properties of cell membranes, such as

fluidity, may be altered in diabetic tissues (Cheung et al.,

1980; Shinitzky, 1980). Recent studies have focused on the

diminished arachidonic acid levels and altered arachidonate

metabolism in heart muscle of STZ-diabetic rats

(Gudbjarnason et al., 1987; Pieper, 1990). Since

alterations in arachidonate-derived products such as

prostaglandins and leukotrienes have been implicated in

heart dysfunction in diabetic rats (Johnson et al., 1984),








57

it is possible that changes in arachidonate metabolism could

play a critical role in diabetic heart disease.

Many other biochemical changes in the diabetic heart

have been documented. The P-adrenergic receptor number in

cardiac membranes was lowered and their coupling to

adenylate cyclase was altered in STZ-diabetic rats (Atkins

et al., 1985). The 1,2-diacylglycerol content in myocardium

from STZ-diabetic rats was highly elevated (Okumura et al.,

1988). Significant reductions in calcium binding and uptake

have been observed in sarcoplasmic reticulum sections from

diabetic rat hearts (Bergh et al., 1988; Bielefeld et al.,

1983; Fein et al., 1980; Ganguly et al., 1983; Penpargkul et

al., 1979). Both phosphoinositide synthesis and release

from membrane phospholipids were greatly reduced in diabetic

rat hearts (Bergh et al., 1988). In addition to the heart,

reduced inositol content and turnover have been observed in

diabetic nerve, lens, and kidney (Craven and DeRubertis,

1989; Winegrad, 1987).

Studies reported in this chapter were carried out to

investigate the possible role of lipo I in the altered

metabolism associated with diabetes. Lipocortin I has been

implicated as a regulator of arachidonic acid metabolism

through modulation of phospholipase A2 activity (Hirata et

al., 1980). As noted above, levels of arachidonic acid and

some of its metabolites were shown to be altered in several

tissues of diabetic animals. The phospholipid-binding








58

activity of lipo I is known to be calcium-dependent

(Glenney, 1986), and significant changes in calcium levels

in some diabetic tissues have been documented. Finally, the

closely related protein lipocortin III was recently

identified as a hydrolase involved in regulation of

phosphoinositide turnover, suggesting the function of lipo I

may also be to regulate this important pathway. As

described above, alterations in phosphoinositide metabolism

have been documented in several diabetic tissues.

After demonstrating tissue-specific induction of lipo I

in STZ-diabetic rats, certain hormones were investistigated

to determine which ones might play a role in lipo I

induction. It was found that glucagon, which is highly

elevated in diabetic animals (Unger et al., 1963), caused

induction of lipo I in the heart as early as 4 hr after

injection. Lipocortin I mRNA expression in two other

tissues in which induction was seen in diabetic animals was

not affected by glucagon up to 24 hr after injection.

Possible reasons for the relatively rapid induction of lipo

I mRNA expression in the heart by glucagon, and induction in

heart and other tissues in diabetic animals, will be

discussed. These studies are the first to link glucagon and

diabetes with any of the annexins.

Materials and Methods

STZ-Diabetes and Insulin Treatment

Male Sprague-Dawley rats (100-150 grams) were injected

intraperitoneally with 65 mg/Kg streptozotocin (Aldrich),









59

which was dissolved in 0.05 M sodium citrate buffer, pH 4.5.

After 24 hr, urine was analyzed using Boehringer Mannheim

Chemstrips to detect glucosuria and ketosis. Animals

exhibiting these symptoms, as well as loss of body weight,

were sacrificed after three-four days and tissues isolated

for RNA extraction. Another group of animals, made diabetic

as described above, was injected once daily for seven days

with 2 U of NPH beef insulin (Squibb). Urine glucose and

ketone levels returned to normal during insulin treatment.

Two animals maintained on insulin were sacrificed following

the final injection, while two others were taken off insulin

for three days to allow diabetic symptoms to again develop.

The normal state of insulin-treated rats, and diabetic state

of rats removed from insulin treatment, were confirmed by

both urine analysis and blood glucose determination (Sigma).

Hormones

Glucagon, a kind gift of Lilly Research Laboratories,

was used at a concentration of 1 mg/Kg body weight.

Dibutyral cAMP (Sigma) was used at 50 mg/Kg, dexamethasone

phosphate (Quad) at 10 mg/Kg, epinephrine (Sigma) at 1

mg/Kg, and insulin at 2 mg/Kg. Glucagon, epinephrine, and

insulin were dissolved at a concentration of 1 mg/ml in a

buffer containing 1% bovine serum albumin and 1.6% glycerol,

pH 2.5-3.0.









60

RNA Isolation. Northern Analysis, Probe Preparation, and
Hybridization

These procedures are described in Materials and Methods

in Chapters 2 and 3. A mouse P-actin cDNA was kindly

provided by Larry Kedes.

Results

To determine if changes in lipo I mRNA expression occur

in tissues of diabetic rats, I injected rats with STZ to

induce diabetes and compared tissue lipo I mRNA levels with

those of controls. Figure 4-1 shows Northern analysis

comparing lipo I mRNA levels in several tissues from a

diabetic and control rat. While levels in the brain,

intestine, lung, and thymus were similar, a significant

increase was observed in the heart, kidney, and hindleg

muscle. Actin mRNA levels are shown as an internal control.

Note that the mouse P-actin cDNA probe used hybridized to

two mRNA species of different sizes in heart and hindleg

muscle.

To demonstrate the reproducibility of the induction of

lipo I mRNA in the heart, kidney, and hindleg muscle, I

repeated the above experiment using two other STZ-diabetic

rats. Figure 4-2 further illustrates this induction, and

also shows that lipo I mRNA levels in the liver and

intestine are not affected by acute diabetes. Again, actin

mRNA levels are shown for comparison.

To investigate whether the induction of lipo I mRNA in

the heart, kidney, and hindleg muscle was truly a result of

















1 /


'O ^* ;


SDCDCD /
D C D C D


Figure 4-1. Expression of lipocortin I mRNA in tissues from
a control and three-day streptozotocin-diabetic rat. Rats
were injected intraperitoneally with buffer only or 65 mg/kg
streptozotocin and tissue RNA was isolated and subject to
Northern analysis after three days. A mouse P-actin probe
was used as an internal control.


CD


D
D


lipo I



actin

























Heart Kidney
C D1 D2 C D1 D2 C


*_ Intestine
02 C D1 D2


lipo I



actin





















Figure 4-2. Increased levels of lipocortin I mRNA in the
heart, kidney, and hindleg muscle of three-day
streptozotocin-diabetic rats. Northern analysis was carried
out as described in the Figure 4-1 legend.








63

the diabetic state and not caused by another effect of STZ,

I carried out an experiment in which insulin was used to

control the disease (Fig. 4-3). Rats were injected with STZ

to induce diabetes. After three days, when both urine

glucose and ketones were very high, animals were subject to

daily injections of 2 U NPH beef insulin for the following

seven days. One day after insulin treatment, urine glucose

and ketone levels approached normal and remained so until

the end of the treatment. Following the seven-day insulin

therapy, two animals were sacrificed and total RNA was

isolated from tissues. Two other rats were removed from

insulin treatment, and as a consequence urine glucose and

ketones rose within a day. Three days after stopping

insulin treatment, animals were sacrificed and total RNA was

isolated from tissues. Northern analysis (Fig. 4-3a) showed

that in the heart and kidney, lipo I mRNA levels increased

when animals were removed from insulin treatment and

exhibited diabetic symptoms. In contrast, levels in hindleg

muscle remained the same. To confirm diabetes and show that

insulin treatment was effective, blood samples were taken

and plasma glucose levels determined (Fig. 4-3b). While

blood glucose levels in the insulin-treated rats were only

slightly above the normal range, levels in the animals taken

off insulin were clearly indicative of diabetes.

I next investigated hormones which might play a role in

the altered lipo I expression in diabetic rat tissues. A









64










heart kidney muscle
Insulin on off on off on off

a .lipo IO















On i^ '
Ionsun lictin

300

400--




S100.

0-
On Off
Insulin Insulin










Figure 4-3. Heart, kidney, and hindleg muscle lipocortin I
mRNA expression in streptozotocin-injected rats on and off
insulin treatment. a) Three days after intraperitoneal
injection of 65 mg/kg streptozotocin, rats were given daily
injections of 2 U NPH beef insulin for seven days.
Following the final insulin injection, two rats were
sacrificed and tissue RNA isolated. Two other rats were
removed from the insulin treatment for three days before
isolating tissue RNA. Northern analysis shows lipocortin I
and actin mRNA levels. b) Serum glucose levels in the rats
represented above were determined using a Sigma kit and are
shown graphically. The normal range is around 150-200
mg/dL.








65

preliminary study using animals which had been injected with

glucagon, insulin, and dexamethasone revealed that lipo I

mRNA was induced in the heart 4 hr after injection of

glucagon (Jan-Ling Hsu and K. Horlick, unpublished results).

Glucagon, which is known to mediate cellular effects via

increased cAMP levels and calcium mobilization (Wakelam et

al., 1986), is highly elevated during diabetes (Unger et

al., 1963). To further study a potential link between

glucagon and lipo I induction, I injected rats with glucagon

and assayed lipo I mRNA levels in several tissues after 4

hr. Figure 4-4 demonstrates that glucagon injection caused

an increase in lipo I mRNA levels in the heart, but not in

kidney or muscle, after 4 and 24 hr. Figure 4-5 shows

glucagon induction of lipo I mRNA levels in the heart of

four animals, representing an increase of between two- and

five-fold compared to the control animal. Quantitation was

done using actin mRNA levels to normalize lipo I data. To

determine the approximate time required for induction of

heart lipo I mRNA by glucagon, a time course experiment was

undertaken (Fig. 4-6). The results showed that induction

required about 4 hr and could still be seen 24 hr after

injection.

Next, I tested other hormones to help define the

mechanism by which lipo I mRNA expression is elevated in the

heart (Fig. 4-7). Dexamethasone, a synthetic

glucocorticoid, and insulin, had no effect. Epinephrine, a












Glucagon





4


Glucagon





24


Heart
- +


Kidney
- +


Muscle
- +


lipo I





actin


Figure 4-4. Induction of lipocortin I mRNA in the rat heart
after injection of glucagon. Four or 24 hr after
intravenous tail vein injection of 1 mg/kg glucagon, total
RNA was isolated from various tissues and subject to
Northern analysis. Actin mRNA levels are shown as an
internal control.

















Glucagon


- + + + +


Figure 4-5. Increased levels of lipocortin I mRNA in the
heart after glucagon injection in four animals. Heart RNA
was isolated 4 hr after injection of 1 mg/kg glucagon or
buffer only and subject to Northern analysis. One of the
two actin mRNA species is also shown.


lipo I


ia ctin



















0 0.5 1


2 4 8 12 24


Figure 4-6. Time course of the increase in lipocortin I mRNA
in the heart after injection of glucagon. Rats were
injected intravenously with 1 mg/kg glucagon and heart RNA
was isolated after various times (hr). Northern analysis
also shows actin mRNA levels.


lipo I




actin



























S n i .lipo I




actin













Figure 4-7. Lipocortin I mRNA expression in the rat heart
following injection of glucagon and other hormones. Rats
were injected intravenously with saline, glucagon,
epinephrine, dibutyral cAMP, dexamethasone, or insulin and
heart RNA was isolated after 4 hr. Northern analysis shows
lipocortin I and actin mRNA levels.








70

hormone which acts through increased cAMP levels and effects

heart function (Regan et al., 1964), was also without

effect. In addition, injection of cAMP did not change heart

lipo I mRNA expression. The induction of heart lipo I mRNA

by glucagon and lack of effect of the other hormones and

cAMP was also observed in mice (Fig. 4-8).

Discussion

Studies in this chapter demonstrate that tissue-

specific regulation of lipo I mRNA levels occurs as a result

of diabetes, and that glucagon may play a part in this

regulation. These experiments are the first to report a

link between a member of the annexin family and diabetes,

and also to show alterations in expression of an annexin in

response to glucagon.

Of the STZ-diabetic tissues studied, the heart, kidney,

and hindleg muscle showed a significant increase in steady-

state lipo I mRNA levels. To gain possible insight into the

role of lipo I in these tissues, the known effects of

diabetes on them must be considered. In the case of the

heart, cardiovascular disease is a major cause of death in

diabetes, responsible for about 70% of diabetic mortality

(Christlieb, 1973). While atherosclerosis is an important

component, studies in the rat (Fein et al., 1980), rabbit

(Fein et al., 1985), dog (Regan et al., 1974), and monkey

(Haider et al., 1981) show evidence for primary

cardiomyopathy, or dysfunction in the heart itself. A



























lipo I





actin












Figure 4-8. Lipocortin I mRNA expression in the mouse heart
following injection of glucagon and other hormones. Mice
were injected intravenously with saline, glucagon,
epinephrine, dibutyral cAMP, dexamethason, or insulin and
heart RNA was isolated after 4 hr. Northern analysis shows
lipocortin I and actin mRNA levels.









72

variety of alterations in heart rate have been described in

diabetic rats (Pfaffman, 1980). In addition, structural

changes in diabetic rat myocardium have been documented

(Thompson, 1988). In that study, alterations in all three

primary components of the heart, the cardiocytes, connective

tissue matrix, and microvasculature, were observed, most of

which were reversed after insulin treatment. Interestingly,

the effects of diabetes on the heart appeared to be focal,

with groups of normal and abnormal cardiocytes interspersed

throughout the muscle tissue.

A multitude of biochemical alterations have been

studied in diabetic hearts. The normal flux of metabolites

through glycolysis and the Krebs cycle is disrupted by the

large amounts of ketone bodies which accumulate and are the

main source of energy for heart respiration in diabetes

(Taegtmeyer and Passmore, 1985). A decreased ability of the

sarcoplasmic reticulum to take up calcium, depressed myosin

and actomyosin ATPase activities, and lowered Na /K+ ATPase

were observed in diabetic rat hearts (Tahiliani and McNeill,

1986). The P-adrenergic receptor number in cardiac

membranes was lowered and their coupling to adenylate

cyclase altered in diabetic rat cardiac membranes (Atkins et

al., 1985).

Most interesting with regard to lipo I are the changes

in lipid metabolism documented in the diabetic heart. Fatty

acid compositions of phospholipids of the heart are altered,








73

including a decline in arachidonic acid levels (Faas and

Carter, 1980; Holman et al., 1983; Schrade et al., 1963).

Some metabolites of arachidonic acid, such as prostacyclin

and leukotrienes, are also affected (Johnson et al., 1984).

Since lipo I has been implicated as an inhibitor of

arachidonic acid metabolism through modulation of

phospholipase A2 (Hirata et al., 1980), it is possible that

the elevated levels of lipo I mRNA observed in the diabetic

rat heart may play a role in reduced arachidonic acid levels

and regulation of arachidonic acid-derived products.

Physical properties of cell membranes, including fluidity,

appear to be altered in the diabetic heart (Cheung et al.,

1980; Shinitzky, 1980). The phospholipid-binding activity

of lipo I, its localization to the inner surface of the

plasma membrane, and the implication of some of the annexins

in membrane-cytoskeletal linkage, offer the possibility that

elevated lipo I could be involved in membrane alterations

seen in the diabetic heart. Finally, elevated levels of

lipo I in the diabetic rat heart may play a role in reduced

phosphoinositol synthesis and release (Bergh et al., 1988).

If the function of lipo I is similar to that of lipo III, a

hydrolase which metabolizes cyclic phosphoinositol

intermediates (Ross et al., 1990), a connection between

elevated lipo I expression and altered phosphoinositol

turnover in the diabetic heart is possible.








74

The two most notable alterations in the diabetic kidney

are an increase in glomerular filtration rate and a marked

hypertrophy (Cortes et al., 1987; Seyer-Hanson, 1983). A

long list of biochemical changes have been observed in the

diabetic kidney, including both increases and decreases in

enzymes involved in glycoprotein metabolism, increased

thickness of glomerular basement membrane, decreased

guanylate cyclase activity, increased gluconeogensis,

increased glycogen content, increase in RNA synthesis, and

changes in pentose phosphate metabolites (Cortes et al.,

1983; Steer et al., 1985). Most of these alterations were

corrected after insulin treatment. As was noted in the

heart, a deficiency in arachidonic acid was also observed in

the diabetic kidney (Faas and Carter, 1980; Holman et al.,

1983). In addition, the glomerular inositol content and the

turnover of polyphosphoinositides was reduced by almost 60%

in streptozotocin-diabetic rats (Craven and DeRubertis,

1989), similar to what was observed in the diabetic heart.

It is intriguing to think that the observed induction in

heart and kidney lipo I mRNA I observed might be involved in

these changes in arachidonic acid or phosphoinositol

metabolism in the diabetic.

Diabetes has profound effects on the biochemical,

morphological, and contractile properties of skeletal muscle

as well as that of cardiac muscle. Amino acid transport is

reduced (Manchester, 1970), Na-K -ATPase activity is








75

depressed (Moore et al., 1983), and increased proteolysis

and a reduction of protein synthesis lead to loss of muscle

strength and mass (Smith et al., 1989). Insulin treatment

was found to reverse the increased proteolysis observed in

streptozotocin-diabetic rat skeletal muscle. To the best of

my knowledge, arachidonic acid and phosphoinositol levels

have not been studied in diabetic skeletal muscle. If

levels of these were found to decrease compared to control

animals, as is the case in heart and kidney, a role for lipo

I in their down-regulation would be strengthened.

In contrast to what was observed in the heart and

kidney, lipo I mRNA was not increased in the hindleg muscle

of STZ-injected animals removed from insulin treatment

relative to those which were on insulin (Fig. 4-3). In

light of the observation that hindleg muscle lipo I mRNA was

increased after STZ-injection (Fig. 4-1 and 4-2) relative to

normal animals, several possibilities exist. One is that

the increase in lipo I mRNA in hindleg muscle after STZ-

injection was a direct, transient effect of STZ on that

muscle, rather that a consequence of diabetes. Or, perhaps

the increase in hindleg muscle lipo I mRNA only occurs

transiently during the first few days of acute diabetes, and

cannot recur during a second incidence of severe diabetes

following insulin treatment.

Having established that lipo I mRNA levels increase in

the diabetic heart, kidney, and skeletal muscle, I next








76

investigated several hormones which might mediate this

effect. Of the hormones tested, only glucagon, a hormone

which is highly elevated during diabetes (Unger et al.,

1963), consistently altered lipo I mRNA expression. Known

target tissues for glucagon action include the liver,

adipose tissue, heart, kidney, intestine, and skeletal

muscle (Lefebvre and Luyckx, 1979). The effect I observed,

an induction of three- to five-fold was observed in the

heart, but not in the kidney or skeletal muscle, starting 4

hr after injection. No changes were observed in kidney or

skeletal muscle up to 24 hr after glucagon administration

(Fig. 4-4).

These results suggest that elevated glucagon levels may

mediate a relatively rapid induction of lipo I mRNA in the

diabetic heart, while induction in the diabetic kidney and

skeletal muscle may require longer exposure to high glucagon

levels, or not involve glucagon. In support of a more long

term effect of glucagon in the kidney, glucagon infusion for

seven days promoted renal growth in the rat, a phenomenon

known to occur during diabetes (Logan and Lee, 1988).

The positive chronotropic and inotropic actions of

glucagon on the heart (increase in heart rate and

contractility) have been well documented in many species,

including dog, rat, and guinea pig (Farah and Tuttle, 1960).

Alterations in intracellular calcium levels by glucagon are

important in these effects on the rat heart (Chernow et al.,








77

1987), but the role of cAMP is unclear (Busuttil et al.,

1976; LaRaia et al., 1968; Rodgers et al., 1981). In the

adult mouse heart, evidence was shown that cAMP was not

altered during the chronotropic and inotropic actions of

glucagon (Clark et al., 1976).

The induction of lipo I mRNA in the rat heart by

glucagon may not involve changes in cAMP levels. Increased

lipo I mRNA levels were not observed in either rats or mice

after injection of epinephrine, a hormone which elicits

heart effects similar to those of glucagon and acts via cAMP

(Regan et al., 1964), or after injection of dibutyral cAMP

(Fig. 5 and 6). I believe that induced levels of lipo I

mRNA in the heart may be due to glucagon-mediated, cAMP-

independent changes in calcium levels (Petersen and Bear,

1986; Wakelam et al., 1986).

In summary, lipo I mRNA levels are induced in the

heart, kidney, and hindleg muscle of streptozotocin-diabetic

rats. Glucagon injection leads to increased lipo I mRNA

levels in the heart, but not in the kidney or hindleg

muscle, as early as 4 hr following administration. These

results suggest that glucagon may play a primary role in

heart lipo I mRNA induction during diabetes, and that

induction in the diabetic kidney and skeletal muscle

involves factors other than, or is independent of, glucagon.

Induction of lipo I mRNA during diabetes may involve

alterations in arachidonic acid or phosphoinositol








78

metabolism (Bergh et al., 1988; Craven and DeRubertis, 1989;

Faas and Carter, 1980; Gubjarnason et al., 1987; Holman et

al., 1983; Johnson et al., 1984; Pieper, 1990; Schrade et

al., 1963; Winegrad, 1987). Perhaps these changes occur

rapidly in the heart in response to elevated glucagon, and

more gradually in kidney and skeletal muscle as the disease

progresses and tissue function deteriorates.














CHAPTER 5

CONCLUSIONS AND FURTHER DIRECTIONS

Studies in this dissertation provide the basis for

future experiments to investigate the mechanisms governing

regulation of the lipo I gene. In Chapter 2, the mouse lipo

I gene structure was determined. An interesting finding was

that three of the four 17-amino acid consensus sequences

believed to be important in lipo I phospholipid/calcium

binding activity were encoded by the last codon of one exon

and the following 16 codons of the next exon. This is

highly suggestive of an exon duplication event early in the

evolution of lipo I. There is a striking similarity in the

gene structures of lipo I and lipo II (Amiguet et al.,

1990), indicating that these two annexins are derived from a

common ancestor. It will be very interesting to compare the

gene structures of lipo I and II with those of the other

annexins, including the 67 kDa species, when these are

determined. Such analysis may provide insight regarding the

relationship between the annexins and their evolution.

The lipo I promoter region was shown to contain several

potential regulatory sites which matched or resembled known

consensus sequences. There is indirect evidence that some

of these sites may be functional. Lipocortin I expression








80

in the mouse mammary epithelial cell line HC11 is effected

by serum (K. Horlick, unpublished results), and two

potential serum response elements were identified in the

lipo I promoter. The sites identified which are most likely

to be involved in lipo I regulation are the putative

glucocorticoid response elements, particularly the delayed

glucocorticoid response element. Lipo I mRNA has been shown

to be induced by dexamethasone in macrophages (Wallner et

al., 1986) and fibroblasts (Phillips et al., 1989; Wong et

al., submitted), although this does not occur in all cell

types examined (Bienkowski et al., 1989; Bronnegard et al.,

1988; Hullin et al., 1989; Isacke et al., 1989; Northup et

al., 1988; William et al., 1988). Studies outlined later in

this chapter are designed to determine whether the sites

identified in the lipo I promoter are indeed involved in lipo

I mRNA regulation, and to possibly identify others.

Chapters 3 and 4 involve tissue-specific regulation of

lipo I mRNA in two very different rat systems: The

differentiating mammary gland, and streptozotocin-induced

diabetes. Studies in Chapter 3 demonstrate that lipo I

exhibits a striking regulation as the mammary gland

undergoes normal differentiation and involution, and that

the suckling stimulus plays a role in this regulation.

While there are several different cell types in mammary

tissue, it is likely that epithelial cells are the dominant

factor in the lipo I regulation I observed.








81

Immunolocalization studies using mammary tissue sections

from various stages of development, similar to those carried

out for lipocortin II and calelectrin in the mouse mammary

gland (Lozano et al., 1989a), could confirm this hypothesis.

The fact that large changes in lipo I expression coincide

with periods when epithelial cells change growth and

differentiative status suggests the two may be related. In

light of this, I have proposed that high levels of lipo I

may be associated with the dormant epithelial cells of the

mature virgin and involuted glands. A hormone or growth

factor-mediated event during pregnancy, which leads to

decreased levels of lipo I, may be necessary for dormant

epithelial cells to proliferate and differentiate into

secretary cells.

One of the most interesting findings in these studies

is that some type of translational control of lipo I

apparently occurs in mammary tissue. After premature pup

withdrawal, lipo I mRNA increased rapidly and reached peak

levels around 12-24 hr following removal. In contrast,

little or no protein was detected until some time after 24

hr following pup withdrawal, and peak levels were observed

by five days following withdrawal. This indicates that

although a large pool of lipo I mRNA accumulates soon after

cessation of suckling, translation is significantly delayed.

I believe that a rapid signal sent to the mammary gland

after pup withdrawal, mediated by the sympathetic nervous








82

system, triggers a rapid increase in lipo I mRNA expression

in secretary epithelial cells destined to revert to the

resting state during involution. In situ hybridization to

localize lipo I mRNA could confirm this theory. The delay

in translation of lipo I mRNA may reflect the time necessary

for the gland, and epithelial cells in particular, to commit

to involution. Lipocortin I mRNA may accumulate in certain

epithelial cells immediately after cessation of suckling in

preparation for reversion to the resting state, but

translation could be delayed for several days in case

suckling must resume. At a time believed to be about five

days following pup removal (Silver, 1956), lactation is no

longer possible and epithelial cells are committed to death

or reversion to dormancy (Hollmann, 1974). The expression

pattern of mammary lipo I during both natural development

and after premature cessation of suckling is consistent with

an important role for lipo I in the resting epithelial

cells. While this role cannot be currently determined, I

have suggested lipo I may possibly be necessary to prevent

phosphoinositol turnover in these cells, keeping them from

proliferating until the appropriate time during pregnancy.

The in vivo mammary gland studies, particularly those

involving removal of the suckling stimulus, indicate that

lipo I mRNA is subject to regulation at the levels of both

mRNA expression and translation. The former type of

regulation could be either due to transcriptional control,








83

mRNA stability changes, or a combination of both. Due to

the complexity of the mammary gland and its multiple cell

types, an in vitro system will likely be necessary to

further explore mammary lipo I regulation. While indirect

evidence suggests a mammary epithelial cell line would be

the best to investigate, immunolocalization and in situ

hybridization studies would be useful in confirming this. I

have carried out preliminary studies on lipo I mRNA

expression in the mouse mammary epithelial line HC11, which

has been shown to be responsive to both prolactin and

dexamethasone (Ball et al., 1988; Doppler et al., 1989).

These cells, derived from midpregnant mouse mammary tissue,

express high levels of lipo I mRNA (data not shown).

Therefore, it could be a useful system in determining

factors that down-regulate lipo I during pregnancy.

Accordingly, I investigated the effects of several hormones

on expression of lipo I mRNA in HCll cells. Neither

prolactin, estrogen, progesterone, epidermal growth factor,

nor insulin had an effect (data not shown), but two

noteworthy observations were made. Dexamethasone caused a

reproducible increase in lipo I mRNA levels, and serum had

an inhibitory influence on mRNA expression. More thorough

studies using HC11, or another of the available mammary

epithelial cell lines, may be useful in further defining the

hormonal signals which regulate lipo I in the mammary gland.

Experiments utilizing mammary explants in culture may also








84

prove useful (Matusik and Rosen, 1978), but would still have

the problem of multiple cell types.

In Chapter 4, it was shown that lipo I mRNA expression

was increased in certain tissues of three-day

streptozotocin-diabetic rats, and that glucagon may play a

role in lipo I mRNA induction in the diabetic heart.

Diabetes is a complex disease resulting in many hormonal

alterations, so again an in vitro system will be required to

further study the mechanism of lipo I regulation. An

important question to address is what particular hormones,

or aspects of altered cellular metabolism, are factors in

regulating lipo I expression.

Experiments should focus on cell lines derived from the

heart, kidney, and skeletal muscle, because these tissues

showed altered lipo I expression in diabetic animals. Heart

cells would be most interesting due to the ability of

glucagon to alter lipo I mRNA levels in the heart. As

mentioned regarding the mammary gland studies, in situ

hybridization would be helpful in indicating which

particular cell types in tissues express lipo I mRNA, and

therefore which cell lines might be the best candidates for

study.

I carried out preliminary studies to attempt to

identify a glucagon- or dexamethasone-responsive cell line

of kidney or muscle origin. Lipocortin I mRNA levels were

not affected by these hormones in rat mesangial cells, which








85

are smooth muscle-like cells from the kidney, or in the G8

mouse skeletal muscle line. Chick heart atrial cells were

also examined, but insufficient cross-hybridization with our

mouse cDNA probe was a problem. If heart myocytes were

shown by in situ hybridization to express lipo I mRNA,

further investigation of these cells might prove worthwhile.

It is possible to isolate and maintain beating heart

myocytes from adult mice or rats in culture (Jacobson and

Piper, 1986), so potential hormonal effects on lipo I

expression in these cells can be evaluated.

Providing that future studies based on the information

in Chapters 3 and 4 will define a cell line which exhibits

lipo I mRNA regulation in response to a hormonal stimulus or

change in growth status, experiments to probe the mechanism

of this regulation can be undertaken. Multiple cell types

would make such studies in whole tissues unlikely to succeed

and difficult to interpret. Initially, the mechansim by

which a change in mRNA levels occurs would be investigated.

As stated before, this could result from transcriptional

alterations, or changes in mRNA stability or some other

post-transcriptional means. Experiments incorporating the

transcriptional inhibitor actinomycin D, and the protein

synthesis inhibitor cycloheximide, would help answer such

questions. The nuclear run-on assay, which measures the

amount of nascent transcripts in isolated nuclei, could be

used to investigate transcriptional changes (McKnight and

Palmiter, 1979).








86

After obtaining some idea of the type(s) of mechanisms

involved in regulation of lipo I gene expression, particular

sites in the gene and its promoter mediating this regulation

can be investigated. Two types of experiments, deletion

analysis and chromatin structure analysis, may be undertaken

to identify potential regulatory regions. The first

involves transfection of promoter deletion mutants into cell

lines and assaying for transcription levels of a reporter

gene. This can be done either by selecting for stable

transfectants (Buetti and Diggelmann, 1983) or through

analysis of the entire population of transfected cells,

referred to as transient expression (Dean et al., 1983).

Chromatin structure analysis is based on the observation

that pancreatic deoxyribonuclease, or DNase I,

preferentially digests genes that are or have been

transcriptionally active (Weintraub and Groudine, 1976).

Most of the cleavage sites for DNase I, referred to as DNase

I hypersensitive sites, have been localized to the 5'

flanking region of genes (Elgin, 1981). In many cases,

DNase I hypersensitive sites were shown to occur close to

important regulatory elements, such as enhancers (Zaret and

Yamamoto, 1984). A combination of deletion and chromatin

structure analysis should be useful in providing a low

resolution view of important regulatory regions within the

lipo I gene.








87

If DNase I hypersensitive sites are found using

conventional methods, they may be more precisely located by

a recently developed, high resolution technique. This

involves electrophoresing genomic DNA on native

polyacrylamide gels prior to electroblotting and

hybridization, and has been utilized to map DNAse I

hypersensitive sites in the human histone H4 gene (Pauli et

al., 1988).

Information provided by the above techniques may allow

studies of lipo I gene regulation in vivo at nucleotide

resolution. Intact cells are treated with a chemical probe

for DNA structure, dimethylsulfate, and DNA-protein

interactions are visualized on DNA sequencing gels as G-

residues with altered reactivity to DMS (Church and Gilbert,

1984). This in vivo analysis has the advantage of avoiding

artifacts which might be obtained in in vitro studies such

as gel retardation assays (Fried and Crothers, 1981), but is

limited to revealing interactions at only G-residues.

In conclusion, studies described here make an important

contribution to the annexin field in several ways. The

results in Chapter 2 concerning lipo I, along with what is

known about the lipocortin II gene, strongly suggest a

common ancestor for these proteins and will be important in

elucidating the evolution of the annexins when the remaining

genes are characterized. In addition, sequence information

from the promoter now enables regulatory studies to be








88

designed. Experiments shown in Chapter 3 represent the most

dramatic examples of lipo I mRNA and protein regulation

currently known, and will hopefully lead to a tissue culture

system in which this regulation can be further defined and

investigated. Also, the potential link between lipo I and

mammary cell growth status deserves further investigation,

and may indicate that lipo I, like lipo III, is involved in

an important biochemical pathway such as inositol

metabolism. Finally, studies in Chapter 4 show for the

first time a link between glucagon and induced expression of

an annexin, and offer the possibility that lipo I is

involved in the altered lipid metabolism known to occur

during diabetes.














REFERENCES


Aarsman, A. J., Mynbeek, G., Van Den Bosch, H., Rothhut, B.,
Prieur, B., Comera, C., Jordan, L., and Russo-Marie, F.
(1987). Lipocortin inhibition of extracellular and
intracellular phospholipases A2 is substrate
concentration dependent. FEBS Lett. 219: 176-180.

Addison, W. R., and Kurtz, D. T. (1986). Nucleotide
sequences required for the regulation of a rat a2^
globulin gene by glucocorticoids. Mol, Cell. Biol. 6:
2334-2346.

Amiguet, P., D'Eustachio, P., Kristensen, T., Wetsel, R. A.,
Saris, C. J. M., Hunter, T., Chaplin, D. D., and Tack,
B. F. (1990). Structure and chromosome assignment of
the murine p36 (calpactin I heavy chain) gene.
Biochemistry 29: 1226-1232.

Ando, Y., Imamura, S., Hong, Y. -M., Owada, M. K., Kakunaga,
T., and Kannagi, R. (1989). Enhancement of calcium
sensitivity of lipocortin I in phospholipid binding
induced by limited proteolysis and phosphorylation at
the amino terminus as analyzed by phospholipid affinity
column chromatography. J. Biol. Chem. 264: 6948-6955.

Atkins, F. L., Dowell, R. T., and Love, S. (1985). 3-
adrenergic receptors, adenylate cyclase activity, and
cardiac dysfunction in the diabetic rat. J. Cardiovasc.
Pharmacol. 7: 66-70.

Ball, R. K., Friis, R. R., Schoenenberger, C. A., Doppoler,
W., and Groner, B. (1988). Prolactin regulation of P-
casein gene expression and of a cytosolic 120-kd
protein in a cloned mouse mammary epithelial cell line.
EMBO J. 7: 2089-2095.

Bergh, C.-H., Hjalmarson, A., Sjogren, K.-G., and Jacobsson,
B. (1988). The effect of diabetes on
phosphatidylinositol turnover and calcium influx in
myocardium. Horm. Metabol. Res. 20: 381-386.

Bhimji, S., Godin, D. V., and McNeill, J. H. (1985).
Biochemical and functional changes in hearts from
rabbits with diabetes. Diabetologia 28: 452-457.










Bielefeld, D. R., Pace, C. S., and Boshell, B. R. (1983).
Altered sensitivity of chronic diabetic rat heart to
calcium. Am. J. Physiol. 245: E560-E567.

Bielschowski, M., and Bielschowski, F. (1956). The New
Zealand strain of obese mice. Australian J. Exp. Biol.
Med. 34: 181-198.

Bienkowski, M.J., Petro, M.A., and Robinson, L.J. (1989).
Inhibition of thromboxane A synthesis in U937 cells by
glucocorticoids. J. Biol. Chem. 264: 6536-6544.

Blackwell, G.J., Carnuccio, R., Di Rosa, M., Flower, R.J.,
Parente, L., and Persico, P. (1980). Macrocortin: a
polypeptide causing the anti-phospholipase effect of
glucocorticoids. Nature 287: 147-149.

Blake, C. (1983). Exons-present from the beginning? Nature
306: 535-537.

Borellini, F., and Oka, T. (1989). Growth control and
differentiation in mammary epithelial cells. Env.
Health Perspec. 80: 85-99.

Braslau, D. L., Ringo, D. L., and Rocha, V. (1984).
Synthesis of novel calcium-dependent proteins
associated with mammary epithelial cell migration and
differentiation. Exp. Cell Res. 155: 213-221.

Breathnach, R., and Chambon, P. (1981). Organization and
expression of eucaryotic split genes coding for
proteins. Annu. Rev. Biochem. 50: 349-383.

Bronnegard, M., Andersson, O., Edwall, D., Lund, J.,
Norstedt, G., and Caristedt-Duke, J. (1988). Human
calpactin II (lipocortin I) messenger ribonucleic acid
is not induced by glucocorticoids. Mol. Endocrinol. 2:
732-739.

Buetti, E., and Diggelmann, H. (1983). Glucocorticoid
regulation of mouse mammary tumor virus: identification
of a short essential DNA region. EMBO J. 2: 1423-1429.

Burgonyne, R. D. (1988). Calpactin in exocytosis? Nature
331: 20.

Busuttil, R. W., Paddock, R. J., Fisher, J. W., and George,
W. J. (1976). Changes in cyclic nucleotide levels and
contractile force in the isolated hypoxic rat heart
during perfusion with glucagon. Circ. Res. 38: 162-
167.










Chase, H. P., Williams, R. L., and Dupont, J. (1979).
Increased prostaglandin synthesis in childhood diabetes
mellitus. J. Pediatr. 94: 185-189.

Chen, C.-L. C., and Feigelson. P. (1980). Hormonal control
of a2u globulin synthesis and its mRNA in isolated
hepatocytes. Ann. NY Acad Sci. 349: 28-45.

Chernow, B., Zaloga, G. P., Malcolm, D., Willey, S. C.,
Clapper, M., and Holaday, J. W. (1987). Glucagon's
chronotropic action is calcium dependent. J. Pharmacol.
Exp. Ther. 241: 833-837.

Cheung, H. C., Almira, E. C., Kansal, P. C., and Reddy, W.
J. (1980). A membrane abnormality in lymphocytes from
diabetic subjects. Endocr. Res. Commun. 7: 145-156.

Chomczynski, P., and Sacchi, N. (1987). Single-step method
of RNA isolation by acid guanidinium thiocyanate-
phenol-chloroform extraction. Anal. Biochem. 162: 156-
159.

Christlieb, A. R. (1973). Diabetes and hypertensive vascular
disease: mechanisms and treatment. Am. J. Cardiol. 28:
27-41.

Chuah, S. Y. and Pallen, C. J. (1989). Calcium-dependent and
phosphorylation-stimulated proteolysis of lipocortin I
by an endogenous A431 cell membrane protease. J. Biol.
Chem. 264: 21160-21166.

Church, G.M., and Gilbert, W. (1984). Genomic sequencing.
Proc. Natl. Acad. Sci. USA 81: 1991-1995.

Clark, C. M., JR., Waller, D., Kohalmi, D., Gardner, R.,
Clark, J., Levey, G. S., Wildenthal, K., and Allen, D.
(1976). Evidence that cyclic AMP is not involved in the
chronotropic action of glucagon in the adult mouse
heart. Endocrin. 99: 23-29.

Cooper, J. A., and Hunter, T. (1983). Identification and
characterization of cellular targets for tyrosine
protein kinases. J. Biol. Chem. 258: 1108-1115.

Corden, J., Wasylyk, B., Buchwalder, A., Sassone-Corsi, P.,
Kedinger, C., and Chambon, P. (1980). Promoter
sequences of eukaryotic protein-coding genes. Science
209: 1405-1414.










Cortes, P., Dulmer, F., Goldman, J., and Levin, N. W.
(1987). Relationship between renal function and
metabolic alterations in early streptozotocin-induced
diabetes in rats. Diabetes 36: 80-87.

Cortes, P., Dulmer, F., Venkatachalam, K., and Levin, N. W.
(1983). Effects of diabetes mellitus on renal
metabolism. Mineral Electrolyte Metab. 9: 306-316.

Craven, P. A., and DeRubertis, F. R. (1989). Protein kinase
C is activated in glomeruli from streptozotocin
diabetic rats. J. Clin. Invest. 83: 1667-1675.

Creutz, C. E., Zakas, W. J., Hamman, H. C., Crane, S.,
Martin, W. H., Gould, K. L., Oddie, K. M., and Parsons,
S. J. (1987). Identification of chromaffin granule-
binding proteins. J. Biol. Chem. 262: 1860-1868.

Crompton, M. R., Moss, S. E., and Crumpton, M. J. (1988).
Diversity in the calpactin/lipocortin family. Cell 55:
1-3.

Crumpton, M. J., and Dedman, J. R. (1990). Protein
terminology tangle. Nature 345: 12.

Davidson, F. F., Dennis, E. A., Powell, M., and Glenney, J.
(1987). Inhibition of phospholipase A2 by "lipocortins"
and calpactins: an effect of binding to substrate
phospholipids. J. Biol. Chem. 262: 1698-1705.

De, B. K., Misono, K. S., Lukas, T. J., Mroczkowski, B., and
Cohen, S. (1986). A calcium-dependent 35-kilodalton
substrate for epidermal growth factor receptor/kinase
isolated from normal tissue. J. Biol. Chem. 261: 13784-
13792.

Dean, D. C., Knoll, B. J., Riser, M. E., and O'Malley, B. W.
(1983). A 5'-flanking sequence essential for
progesterone regulation of an ovalbumin fusion gene.
Nature 305: 551-554.

Doppoler, W., Groner, B., and Ball, R. K. (1989). Prolactin
and glucocorticoid hormones synergistically induce
expression of transfected rat 3-casein gene promoter
constructs in a mammary epithelial cell line. Proc.
Natl. Acad. Sci. USA 86: 104-108.

Drust, D., and Creutz, C. (1988). Aggregation of chromaffin
granules by calpactin at micromolar levels of calcium.
Nature 331: 88-91.




Full Text

PAGE 1

*(120,& &/21,1* $1' 7,668(63(&,),& (;35(66,21 2) /,32&257,1 %< .(11(7+ 52%(57 +25/,&. $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

7R 0DUWD 'LJLWL]HG E\ WKH ,QWHUQHW $UFKLYH LQ ZLWK IXQGLQJ IURP 8QLYHUVLW\ RI )ORULGD *HRUJH $ 6PDWKHUV /LEUDULHV ZLWK VXSSRUW IURP /<5$6,6 DQG WKH 6ORDQ )RXQGDWLRQ KWWSZZZDUFKLYHRUJGHWDLOVJHQRPLFFORQLQJWL22KRUO

PAGE 3

$&.12:/('*(0(176 ZRXOG OLNH WR WKDQN WKH PHPEHUV RI P\ FRPPLWWHH IRU WKHLU LQYDOXDEOH JXLGDQFH DQG VXSSRUW GXULQJ P\ JUDGXDWH VWXGLHV 6SHFLDO WKDQNV JR WR 'U 5LFKDUG %R\FH IRU ERWK KLV JXLGDQFH DQG XQGHUVWDQGLQJ $OVR ZRXOG OLNH WR WKDQN P\ IHOORZ JUDGXDWH VWXGHQWV %LOO :RQJ %LOO 'RXJDOO -DQ /LQJ +VX 6DOO\ &KHVURZQ DQG -RQDWKDQ +XUW DV ZHOO DV -RDQ :LOVRQ 'U *DU\ 9LVQHU 'U *HUDOG 6WHSKDQ] DQG 'U -RKQ 9DOHQWLQH IRU WKHLU KHOSIXO GLVFXVVLRQV VXSSRUW DQG IULHQGVKLS RYHU WKH SDVW ILYH \HDUV ,Q DGGLWLRQ ZRXOG OLNH WR DFNQRZOHGJH P\ PHQWRU 'U +DUU\ 1LFN IRU DOO KLV JXLGDQFH DQG VXSSRUW 0\ HGXFDWLRQ DQG WUDLQLQJ XQGHU KLV GLUHFWLRQ ZHUH D YDOXDEOH DQG UHZDUGLQJ H[SHULHQFH )LQDOO\ ZRXOG OLNH WR H[SUHVV P\ XQHQGLQJ JUDWLWXGH WR P\ SDUHQWV +HUEHUW DQG 0D[LQH +RUOLFN ZKRVH XQIDOWHULQJ VXSSRUW DQG ORYH KDYH HQDEOHG PH WR UHDFK WKLV SRLQW LLL

PAGE 4

7$%/( 2) &217(176 SDJH $&.12:/('*(0(176  /,67 2) ),*85(6 9 $%675$&7 YLL &+$37(56 ,1752'8&7,21 &+$5$&7(5,=$7,21 2) 7+( 0286( /,32&257,1 *(1( ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 5HVXOWV 'LVFXVVLRQ 5(*8/$7,21 2) /,32&257,1 ,1 5$7 0$00$5< 7,668( '85,1* */$1'8/$5 ',))(5(17,$7,21 $1' ,192/87,21 ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 5HVXOWV 'LVFXVVLRQ 7,668(63(&,),& 5(*8/$7,21 2) /,32&257,1 P51$ /(9(/6 ,1 5$76 '85,1* ',$%(7(6 $1' %< */8&$*21 ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 5HVXOWV 'LVFXVVLRQ &21&/86,216 $1' )857+(5 ',5(&7,216 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ LY

PAGE 5

/,67 2) ),*85(6 )LJXUH SDJH 6RXWKHUQ EORW DQDO\VLV RI PRXVH JHQRPLF '1$ ZLWK D OLSRFRUWLQ F'1$ SUREH 5HVWULFWLRQ PDS DQG JHQRPLF VWUXFWXUH RI WKH PRXVH OLSRFRUWLQ JHQH 6HTXHQFH RI WKH PRXVH OLSRFRUWLQ JHQH 6HTXHQFH RI WKH PRXVH OLSRFRUWLQ SURPRWHU UHJLRQ &RUUHODWLRQ RI OLSRFRUWLQ JHQRPLF VWUXFWXUH ZLWK SURWHLQ GRPDLQV 5HJXODWLRQ RI PDPPDU\ OLSRFRUWLQ P51$ GXULQJ SUHJQDQF\ ODFWDWLRQ DQG LQYROXWLRQ 'HFUHDVH LQ PDPPDU\ OLSRFRUWLQ P51$ OHYHOV ZLWK WKH RQVHW RI ODFWDWLRQ 5HJXODWLRQ RI OLSRFRUWLQ P51$ DQG SURWHLQ OHYHOV LQ UDW PDPPDU\ WLVVXH GXULQJ JODQGXODU GLIIHUHQWLDWLRQ DQG LQYROXWLRQ 'HQVLWRPHWULF DQDO\VLV RI WKH GDWD LQ )LJXUH 7KH UROH RI WKH VXFNOLQJ VWLPXOXV GLUHFWO\ DIWHU ELUWK RQ OLSRFRUWLQ P51$ OHYHOV LQ PDPPDU\ WLVVXH ,QGXFWLRQ RI OLSRFRUWLQ P51$ DQG SURWHLQ H[SUHVVLRQ LQ PDPPDU\ WLVVXH RI GDPV IROORZLQJ SXS UHPRYDO DW ELUWK RU GD\ VHYHQ RI VXFNOLQJ 6SHFLILFLW\ RI WKH PDPPDU\ OLSRFRUWLQ P51$ UHJXODWLRQ IROORZLQJ SXS ZLWKGUDZDO 'HQVLWRPHWULF DQDO\VLV RI WKH LQFUHDVH LQ OLSRFRUWLQ P51$ OHYHOV IROORZLQJ SXS ZLWKGUDZDO Y

PAGE 6

([SUHVVLRQ RI OLSRFRUWLQ P51$ LQ WLVVXHV IURP D FRQWURO DQG WKUHHGD\ VWUHSWR]RWRFLQGLDEHWLF UDW ,QFUHDVHG OHYHOV RI OLSRFRUWLQ P51$ LQ WKH KHDUW NLGQH\ DQG KLQGOHJ PXVFOH RI WKUHHGD\ VWUHSWR]RWRFLQGLDEHWLF UDWV +HDUW NLGQH\ DQG KLQGOHJ PXVFOH OLSRFRUWLQ P51$ H[SUHVVLRQ LQ VWUHSWR]RWRFLQLQMHFWHG UDWV RQ DQG RII LQVXOLQ WUHDWPHQW ,QGXFWLRQ RI OLSRFRUWLQ P51$ LQ WKH UDW KHDUW DIWHU LQMHFWLRQ RI JOXFDJRQ ,QFUHDVHG OHYHOV RI OLSRFRUWLQ P51$ LQ WKH KHDUW DIWHU JOXFDJRQ LQMHFWLRQ LQ IRXU DQLPDOV 7LPH FRXUVH RI WKH LQFUHDVH LQ OLSRFRUWLQ P51$ LQ WKH KHDUW DIWHU LQMHFWLRQ RI JOXFDJRQ /LSRFRUWLQ P51$ H[SUHVVLRQ LQ WKH UDW KHDUW IROORZLQJ LQMHFWLRQ RI JOXFDJRQ DQG RWKHU KRUPRQHV /LSRFRUWLQ P51$ H[SUHVVLRQ LQ WKH PRXVH KHDUW IROORZLQJ LQMHFWLRQ RI JOXFDJRQ DQG RWKHU KRUPRQHV YL

PAGE 7

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ *(120,& &/21,1* $1' 7,668(63(&,),& (;35(66,21 2) /,32&257,1 E\ .(11(7+ 52%(57 +25/,&. 'HFHPEHU &KDLUPDQ 'U +DUU\ 6 1LFN 0DMRU 'HSDUWPHQW %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ 7KH PRXVH OLSRFRUWLQ VWUXFWXUDO JHQH ZDV LVRODWHG DQG FKDUDFWHUL]HG E\ VFUHHQLQJ WZR PRXVH %DOEF OLYHU JHQRPLF OLEUDULHV ZLWK PRXVH OLSRFRUWLQ F'1$ DQG ROLJRQXFOHRWLGH SUREHV 5HVWULFWLRQ HQ]\PH PDSSLQJ 6RXWKHUQ EORWWLQJ DQG '1$ VHTXHQFLQJ ZHUH FDUULHG RXW RQ WKUHH RYHUODSSLQJ JHQRPLF FORQHV 7KH OLSRFRUWLQ JHQH VSDQV .ES DQG LV GLYLGHG LQWR H[RQV ZKLFK HQFRGH D SURWHLQ RI DPLQR DFLG UHVLGXHV 7KH SURPRWHU UHJLRQ RI WKH JHQH KDV D 7$7$ ER[ DQG D &&$$7 ER[ ORFDWHG XSVWUHDP RI WKH WUDQVFULSWLRQ LQLWLDWLRQ VLWH DW DQG ES UHVSHFWLYHO\ 6HYHUDO SRWHQWLDO UHJXODWRU\ VLWHV LQ WKH n IODQNLQJ UHJLRQ ZHUH LGHQWLILHG E\ FRPSDULVRQ WR NQRZQ SURWHLQELQGLQJ FRQVHQVXV VHTXHQFHV $ FRPSDULVRQ RI WKH OLSRFRUWLQ JHQH VWUXFWXUH ZLWK WKDW RI WKH FORVHO\ UHODWHG JHQH OLSRFRUWLQ ,, VXJJHVWV D FRPPRQ HYROXWLRQDU\ DQFHVWRU IRU WKHVH SURWHLQV YLL

PAGE 8

/LSRFRUWLQ LQ51$ DQG SURWHLQ OHYHOV LQ WKH UDW PDPPDU\ JODQG ZHUH VWXGLHG GXULQJ YDULRXV VWDJHV RI GLIIHUHQWLDWLRQ %RWK ZHUH DEXQGDQW LQ WKH QRQSUHJQDQW VWDWH DQG EHJDQ D VWULNLQJ GHFOLQH DW PLGSUHJQDQF\ ZKHQ HSLWKHOLDO FHOOV XQGHUJR SUROLIHUDWLRQ DQG GLIIHUHQWLDWLRQ ,Q WKH ODFWDWLQJ JODQG QR OLSRFRUWLQ ZDV GHWHFWHG 'XULQJ LQYROXWLRQ RI WKH JODQG DIWHU ZHDQLQJ OLSRFRUWLQ P51$ DQG SURWHLQ LQFUHDVHG WR OHYHOV REVHUYHG LQ QRQSUHJQDQW DQLPDOV 7KH UHSUHVVLRQ RI OLSRFRUWLQ P51$ H[SUHVVLRQ DW ELUWK DQG GXULQJ ODFWDWLRQ LV GHSHQGHQW XSRQ WKH VXFNOLQJ VWLPXOXV VLQFH SXS ZLWKGUDZDO UHVXOWHG LQ D UDSLG PDPPDU\VSHFLILF LQFUHDVH LQ OLSRFRUWLQ P51$ OHYHOV 7KHVH UHVXOWV VXJJHVW OLSRFRUWLQ PD\ SOD\ D UROH LQ PDPPDU\ FHOO JURZWK VWDWXV GXULQJ JODQG GLIIHUHQWLDWLRQ 7R LQYHVWLJDWH SRWHQWLDO DOWHUDWLRQV LQ OLSRFRUWLQ H[SUHVVLRQ GXULQJ GLDEHWHV LQMHFWHG UDWV ZLWK VWUHSWR]RWRFLQ DQG DQDO\]HG P51$ OHYHOV LQ VHYHUDO WLVVXHV ,Q WKUHHGD\ VWUHSWR]RWRFLQGLDEHWLF UDWV OLSRFRUWLQ P51$ OHYHOV ZHUH VLJQLILFDQWO\ LQFUHDVHG LQ WKH KHDUW NLGQH\ DQG KLQGOHJ PXVFOH *OXFDJRQ D KRUPRQH KLJKO\ HOHYDWHG LQ GLDEHWLFV FDXVHG LQGXFWLRQ RI OLSRFRUWLQ P51$ LQ WKH KHDUW EXW QRW LQ WKH NLGQH\ RU PXVFOH IRXU KRXUV DIWHU LQMHFWLRQ YLLL

PAGE 9

&+$37(5 ,1752'8&7,21 /LSRFRUWLQ OLSR ,f DOVR FDOOHG DQQH[LQ &UXPSWRQ DQG 'HGPDQ f LV RQH RI WKH EHVW FKDUDFWHUL]HG PHPEHUV RI WKH DQQH[LQV D JURXS RI FDOFLXPGHSHQGHQW SKRVSKROLSLGn ELQGLQJ SURWHLQV ZKLFK VKDUH DERXW b VHJXHQFH KRPRORJ\ DQG ZKRVH SK\VLRORJLFDO UROH UHPDLQV XQFOHDU 7KH DQQH[LQV GLIIHU IURP SUHYLRXVO\ FKDUDFWHUL]HG FDOFLXPELQGLQJ SURWHLQV LQ WKDW WKH\ ODFN DQ ()KDQGW\SH FDOFLXP ELQGLQJ VLWH *HLVRZ DQG :DONHU f 3URWHLQV ZKLFK DUH SDUW RI WKLV IDPLO\ LQFOXGH OLSRFRUWLQV +XDQJ HW DO f FDOSDFWLQV *OHQQH\ f FDOHOHFWULQV *HLVRZ HW DO *HLVRZ DQG :DONHU 6XGKRI HW DO f FDOFLPHGLQV 6PLWK DQG 'HGPDQ f DQWLFRDJXODQW SURWHLQ )XQDNRVKL HW DO f HQGRQH[LQV *HLVRZ HW DO *HLVRZ DQG :DONHU 6FKODHSIHU HW DO :HEHU HW DO f DQG FKURPRELQGLQV &UHXW] HW DO f 9DULRXV DQQH[LQV KDYH EHHQ LPSOLFDWHG LQ FHOOXODU SURFHVVHV LQFOXGLQJ LQIODPPDWLRQ )ORZHU f H[RF\WRVLV %XUJRQ\QH 'UXVW DQG &UHXW] f GLIIHUHQWLDWLRQ 9LROHWWH HW DO f EORRG FRDJXODWLRQ 7DLW HW DO f WKH LPPXQH UHVSRQVH +LUDWD DQG ,ZDWD f DQG PHPEUDQHF\WRVNHOHWDO OLQNDJH 5R\&KRXGKXU\ HW DO f

PAGE 10

0RVW UHFHQWO\ OLSRFRUWLQ ,,, ZDV LGHQWLILHG DV LQRVLWRO F\FOLF SKRVSKDWH SKRVSKRK\GURODVH DQ HQ]\PH LPSRUWDQW LQ PHWDEROL]LQJ WKH PRVW KLJKO\ DFWLYH LQRVLWRO SKRVSKDWH LQWHUPHGLDWHV 5RVV HW DO f 7KLV VXJJHVWV WKH SRVVLELOLW\ WKDW WKH RWKHU DQQH[LQV PD\ DOVR SOD\ D UROH LQ LQRVLWRO PHWDEROLVP /LSRFRUWLQ KDV D PROHFXODU ZHLJKW RI GDOWRQV DQG KDV EHHQ LPPXQRORFDOL]HG PDLQO\ WR WKH LQQHU VXUIDFH RI WKH SODVPD PHPEUDQH *OHQQH\ HW DO f 0RVW RI LWV REVHUYHG ELRORJLFDO SURSHUWLHV LQFOXGLQJ ELQGLQJ WR SKRVSKROLSLG DQG DFWLQ DUH GHSHQGHQW RQ FDOFLXP OHYHOV *OHQQH\ 6FKODHSIHU DQG +DLJOHU f 0XOWLSOH ELQGLQJ VLWHV IRU ERWK FDOFLXP DQG SKRVSKROLSLG DSSDUHQWO\ H[LVW LQ WKH SURWHLQ .OHH f 5HFHQW VWXGLHV XVLQJ PRQRFORQDO DQWLERGLHV GHWHFWHG ERWK FDOFLXPERXQG DQG FDOFLXPIUHH IRUPV RI OLSR DVVRFLDWHG ZLWK PHPEUDQHV LQ $ FHOOV +D\DVKL HW DO f (DUO\ H[SHULPHQWV LQGLFDWHG WKH SURWHLQ ZDV VHFUHWHG EXW WKLV REVHUYDWLRQ UHPDLQV XQH[SODLQHG EHFDXVH QR HYLGHQFH IRU D VLJQDO SHSWLGH ZDV IRXQG :DOOQHU HW DO f ([SUHVVLRQ LV OLPLWHG WR FHUWDLQ FHOO DQG WLVVXH W\SHV )DYD HW DO *OHQQH\ HW DO 3HSLQVN\ HW DO :DOOQHU HW DO f DQG LQ VRPH FDVHV OLSR PD\ DFFRXQW IRU DV PXFK DV WR b RI WRWDO FHOOXODU SURWHLQ 9LROHWWH HW DO f 3KRVSKRU\ODWLRQ RI VSHFLILF FHOOXODU SURWHLQV E\ JURZWK IDFWRUKRUPRQH UHFHSWRU NLQDVHV LV EHOLHYHG WR EH LPSRUWDQW

PAGE 11

LQ LQWUDFHOOXODU VLJQDO WUDQVGXFWLRQ 8OOULFK DQG 6FKOHVVLQJHU f /LSRFRUWLQ KDV EHHQ VKRZQ WR EH D VXEVWUDWH IRU WKH HSLGHUPDO JURZWK IDFWRU UHFHSWRU W\URVLQH NLQDVH LQ LQWDFW $ KXPDQ FDUFLQRPD FHOOV DQG KXPDQ ILEUREODVWV *LXJQL HW DO 6DZ\HU DQG &RKHQ f DQG LV SKRVSKRU\ODWHG E\ WKH HSLGHUPDO JURZWK IDFWRU UHFHSWRU LQ YLWUR LQ WKH SUHVHQFH RI HSLGHUPDO JURZWK IDFWRU DQG FDOFLXP 'H HW DO f .DUDVLN HW DO f KDYH GHPRQVWUDWHG WKDW OLSR LV DOVR D VXEVWUDWH IRU WKH LQVXOLQ UHFHSWRU W\URVLQH NLQDVH LQ LVRODWHG UDW KHSDWRF\WHV ,Q DGGLWLRQ ERWK SURWHLQ NLQDVH & DQG F\FOLF$03GHSHQGHQW SURWHLQ NLQDVH KDYH EHHQ VKRZQ WR SKRVSKRU\ODWH OLSR RQ VHULQHWKUHRQLQH UHVLGXHV 9DUWLFRYVN\ HW DO f /LSRFRUWLQ ,, RU S LV D VXEVWUDWH IRU WKH SSYVUF RQFRJHQH NLQDVH IXUWKHU LPSOLFDWLQJ WKH DQQH[LQV LQ FHOOXODU VLJQDO WUDQVGXFWLRQ &RRSHU DQG +XQWHU f 7KH OLSRFRUWLQV ZHUH RULJLQDOO\ GHILQHG DV JOXFRFRUWLFRLGLQGXFHG DQWLLQIODPPDWRU\ SURWHLQV ZKLFK LQKLELW SKRVSKROLSDVH $M WKH HQ]\PH ZKLFK UHOHDVHV DUDFKLGRQLF DFLG IURP PHPEUDQH SKRVSKROLSLGV DQG EHJLQV WKH FDVFDGH RI HQ]\PDWLF VWHSV OHDGLQJ WR SURGXFWLRQ RI SURVWDJODQGLQV DQG OHXNRWULHQHV %ODFNZHOO HW DO )ORZHU DQG %ODFNZHOO +LUDWD HW DO f 6HYHUDO RI WKH OLSRFRUWLQV ZHUH VKRZQ WR LQKLELW SKRVSKROLSDVH $J DV ZHOO DV RWKHU SKRVSKROLSDVHV LQ YLWUR +LUDWD f 7KH PHFKDQLVP RI WKLV LQKLELWLRQ LV QRZ EHOLHYHG WR EH

PAGE 12

VXEVWUDWH GHSOHWLRQ ZKHUH OLSRFRUWLQV ELQG WR SKRVSKROLSLGV DQG SURWHFW WKHP IURP FOHDYDJH E\ SKRVSKROLSDVHV 7KLV LV EHFDXVH QR GLUHFW LQWHUDFWLRQ EHWZHHQ OLSRFRUWLQV DQG SKRVSKROLSDVHV KDV EHHQ GHWHFWHG DQG WKH LQKLELWLRQ FDQ EH RYHUFRPH E\ UDLVLQJ WKH FRQFHQWUDWLRQ RI SKRVSKROLSLG VXEVWUDWH LQ WKH LQ YLWUR DVVD\V $DUVPDQ HW DO 'DYLGVRQ HW DO +DLJOHU HW DO f 7KH DQQH[LQV VKDUH D FRPPRQ FRUH UHJLRQ FRQVLVWLQJ RI IRXU DPLQR DFLG UHSHDWLQJ XQLWV HLJKW IRU SFDOHOHFWULQf EDVHG RQ SUHGLFWHG VHFRQGDU\ VWUXFWXUH FRQVLGHUDWLRQV &URPSWRQ HW DO f ,Q DGGLWLRQ D DPLQR DFLG FRQVHQVXV VHTXHQFH EHOLHYHG WR FRQWDLQ WKH VLWHV UHVSRQVLEOH IRU FDOFLXPSKRVSKROLSLG ELQGLQJ DFWLYLW\ ZDV LGHQWLILHG ZLWKLQ HDFK UHSHDW *HLVRZ HW DO f 7KH 1 WHUPLQL RI WKH OLSRFRUWLQV DUH GLYHUJHQW DQG PD\ EH LQYROYHG LQ WKH UHJXODWLRQ RI WKH LQGLYLGXDO SURWHLQV &URPSWRQ HW DO +XDQJ HW DO 3HSLQVN\ HW DO 6DULV HW DO :DOOQHU HW DO f 7KH 1WHUPLQXV RI OLSR FRQWDLQV VLWHV IRU W\URVLQH DQG VHULQHWKUHRQLQH SKRVSKRU\ODWLRQ .DUDVLN HW DO 6DZ\HU DQG &RKHQ 9DUWLFRYVNL HW DO f SURWHRO\VLV $QGR HW DO &KXDK DQG 3DOOHQ f DQG KHDGWRKHDG GLPHUL]DWLRQ 3HSLQVN\ HW DO f 7KH 1WHUPLQXV RI OLSRFRUWLQ ,, DOVR FRQWDLQV SKRVSKRU\ODWLRQ VLWHV DQG LV WKH ORFDWLRQ RI ELQGLQJ RI SOO D SURWHLQ ZKLFK IRUPV D WHWUDPHU ZLWK

PAGE 13

OLSRFRUWLQ ,, DQG ELQGV WLJKWO\ WR WKH LQQHU PHPEUDQH VXUIDFH *OHQQH\ DQG 7DFN f $OWKRXJK WKH FHOOXODU IXQFWLRQ RI OLSR LV SUHVHQWO\ XQFOHDU LWV LPSOLFDWLRQ LQ WKH LPSRUWDQW SURFHVVHV PHQWLRQHG DERYH MXVWLILHV IXUWKHU LQYHVWLJDWLRQ RI WKLV SURWHLQ 7KLV PDQXVFULSW GHVFULEHV WKH JURXQGZRUN IRU VWXGLHV GHVLJQHG WR LQYHVWLJDWH WKH UHJXODWLRQ RI OLSR JHQH H[SUHVVLRQ XVLQJ UDWV DQG PLFH DV PRGHOV &KDSWHU LQYROYHV WKH LVRODWLRQ DQG FKDUDFWHUL]DWLRQ RI WKH PRXVH OLSR VWUXFWXUDO JHQH DQG SURPRWHU .QRZOHGJH RI WKH JHQH VWUXFWXUH ZRXOG HQDEOH D FRPSDULVRQ ZLWK WKDW RI OLSR ,, UHFHQWO\ SXEOLVKHG $PLJXHW HW DO f DQG RWKHU DQQH[LQV ZKHQ WKHVH DUH HYHQWXDOO\ GHVFULEHG 6XFK D FRPSDULVRQ ZRXOG UHYHDO LI WKH H[RQLQWURQ SDWWHUQV RI WKH JHQHV FRUUHODWH ZLWK WKH DPLQR DFLG UHSHDWV DQG DPLQR DFLG FRQVHQVXV VHTXHQFHV RI WKH FRUUHVSRQGLQJ SURWHLQV ,Q DGGLWLRQ YDOXDEOH LQIRUPDWLRQ UHJDUGLQJ WKH HYROXWLRQ RI WKH DQQH[LQV DQG WKHLU UHODWLRQVKLS WR RQH DQRWKHU ZRXOG EH JDLQHG 2EWDLQLQJ WKH SURPRWHU VHTXHQFH LQ WKH n IODQNLQJ UHJLRQ RI OLSR ZRXOG OLNHO\ EH HVVHQWLDO LQ VWXG\LQJ JHQH UHJXODWLRQ VLQFH ERWK QRQVSHFLILF DQG VSHFLILF SURWHLQ ELQGLQJ VLWHV LPSRUWDQW LQ JHQH H[SUHVVLRQ DUH RIWHQ ORFDWHG XSVWUHDP RI WKH WUDQVFULSWLRQ LQLWLDWLRQ VLWH RI JHQHV 0LWFKHOO DQG 7MLDQ f &RPSDULVRQ RI WKH SURPRWHU UHJLRQ RI OLSR ZLWK SUHYLRXVO\ LGHQWLILHG FRQVHQVXV

PAGE 14

VHTXHQFHV UHSUHVHQWLQJ UHJXODWRU\ SURWHLQ ELQGLQJ VLWHV PLJKW ORFDWH VLPLODU UHJXODWRU\ UHJLRQV LQ OLSR :KHWKHU SXWDWLYH UHJXODWRU\ VLWHV DUH LPSRUWDQW LQ YLYR FRXOG WKHQ EH DGGUHVVHG LQ IXWXUH H[SHULPHQWV GHVFULEHG LQ &KDSWHU &KDSWHUV DQG LQYROYH DQ DWWHPSW WR LGHQWLI\ DQG GHILQH D V\VWHPVf ZKLFK H[KLELW UHJXODWLRQ RI OLSR JHQH H[SUHVVLRQ VR WKDW WKH PROHFXODU EDVLV RI WKLV UHJXODWLRQ FRXOG ODWHU EH LQYHVWLJDWHG $OVR H[SORULQJ FKDQJHV RI OLSR H[SUHVVLRQ LQ UHVSRQVH WR YDULRXV VWLPXOL PLJKW KHOS HOXFLGDWH LWV ELRORJLFDO UROH %DVHG RQ D OLQN EHWZHHQ SURODFWLQ DQ LPSRUWDQW KRUPRQH LQ ODFWDWLRQ DQG D OLSR OLNH JHQH LQ WKH SLJHRQ FURSVDF +RUVHPDQ f SRWHQWLDO KRUPRQDO FRQWURO RI OLSR LQ WKH UDW PDPPDU\ JODQG LV HYDOXDWHG LQ &KDSWHU 7KH PDPPDU\ JODQG OLNH WKH SLJHRQ FURSVDF GLIIHUHQWLDWHV LQWR D QXWULHQWVHFUHWLQJ WLVVXH GXULQJ SUHJQDQF\ DQG LV NQRZQ WR EH D WDUJHW RI SURODFWLQ DFWLRQ 7RSSHU DQG )UHHPDQ f 1RUWKHUQ DQG :HVWHUQ DQDO\VHV ZHUH FDUULHG RXW WR DQDO\]H OLSR P51$ DQG SURWHLQ OHYHOV LQ PDPPDU\ WLVVXH RI GDPV GXULQJ SUHJQDQF\ ODFWDWLRQ DQG ZHDQLQJ 'XULQJ WKHVH SHULRGV VHYHUDO KRUPRQHV XQGHUJR ODUJH DOWHUDWLRQV LQ SODVPD FRQFHQWUDWLRQ DQG JODQG PRUSKRORJ\ DQG FHOO SRSXODWLRQ FKDQJH UDGLFDOO\ %RUHOOLQL DQG 2ND f ,Q DGGLWLRQ WKH FRQVHTXHQFHV RI SUHPDWXUH SXS ZLWKGUDZDO DQG SUHYHQWLRQ RI WKH VXFNOLQJ VWLPXOXV RQ OLSR H[SUHVVLRQ LQ PDPPDU\ WLVVXH DUH DGGUHVVHG LQ &KDSWHU 7KHVH VWXGLHV UHYHDOHG D GUDPDWLF

PAGE 15

UHJXODWLRQ RI OLSR GXULQJ JODQG GLIIHUHQWLDWLRQ DQG LQYROXWLRQ DQG D K\SRWKHVLV DGGUHVVLQJ WKLV SKHQRPHQRQ LV SURYLGHG ,Q &KDSWHU WLVVXHVSHFLILF UHJXODWLRQ RI OLSR P51$ OHYHOV LQ GLDEHWLF UDWV LV VKRZQ 7KHVH VWXGLHV ZHUH XQGHUWDNHQ WR H[SORUH D SRVVLEOH FRQQHFWLRQ EHWZHHQ OLSR DQG WKH DOWHUHG OLSLG PHWDEROLVP NQRZQ WR RFFXU LQ VRPH GLDEHWLF WLVVXHV $Q DWWHPSW WR LGHQWLI\ D SDUWLFXODU KRUPRQH LQYROYHG LQ UHJXODWLRQ RI OLSR GXULQJ GLDEHWHV LPSOLFDWHG WKH SHSWLGH KRUPRQH JOXFDJRQ ZKLFK LV KLJKO\ HOHYDWHG LQ WKH GLDEHWLF VWDWH 7KHVH H[SHULPHQWV UHSUHVHQW WKH ILUVW UHSRUW RI JOXFDJRQ LQIOXHQFLQJ OLSR P51$ H[SUHVVLRQ DQG RI WLVVXHVSHFLILF DOWHUDWLRQV LQ OLSR LQ D GLVHDVH VWDWH

PAGE 16

&+$37(5 &+$5$&7(5,=$7,21 2) 7+( 0286( /,32&257,1 *(1( ,QWURGXFWLRQ 7KH VWXGLHV GHVFULEHG LQ WKLV FKDSWHU ZHUH FDUULHG RXW IRU WZR PDLQ SXUSRVHV WR GHWHUPLQH WKH JHQRPLF VWUXFWXUH RI WKH OLSR JHQH DQG WR REWDLQ SURPRWHU VHTXHQFH IURP WKH n IODQNLQJ UHJLRQ RI WKH JHQH ,QIRUPDWLRQ SURYLGHG E\ VXFK H[SHULPHQWV ZRXOG HQDEOH IXWXUH VWXGLHV DLPHG DW LQYHVWLJDWLQJ VSHFLILF UHJXODWRU\ PHFKDQLVPV LQYROYHG LQ OLSR JHQH UHJXODWLRQ ,W KDV EHHQ SURSRVHG WKDW H[RQV HQFRGH IXQFWLRQDO RU VWUXFWXUDO GRPDLQV RI SURWHLQV %ODNH *LOEHUW f 7KH OLSR SURWHLQ FRQVLVWV RI D XQLTXH 1WHUPLQXV DQG D FRUH UHJLRQ FRQVLVWLQJ RI IRXU DPLQR DFLG UHSHDWLQJ XQLWV &URPSWRQ HW DO f ,Q DGGLWLRQ D DPLQR DFLG FRQVHQVXV VHTXHQFH EHOLHYHG WR EH UHVSRQVLEOH IRU FDOFLXPSKRVSKROLSLG ELQGLQJ ZDV LGHQWLILHG ZLWKLQ HDFK RI WKH IRXU DPLQR DFLG UHSHDWV *HLVRZ HW DO f %\ FKDUDFWHUL]LQJ WKH OLSR JHQH VWUXFWXUH FRXOG GHWHUPLQH LI GLVFUHWH H[RQV HQFRGH SURWHLQ GRPDLQV VXFK DV WKH XQLTXH 1WHUPLQXV DQG WKH LQWHUQDO UHSHDWLQJ XQLWV 7KH RQO\ OLSRFRUWLQ VWUXFWXUDO JHQH ZKLFK KDV EHHQ FKDUDFWHUL]HG XQWLO QRZ LV WKDW RI PRXVH OLSR ,, ZKLFK ZDV

PAGE 17

UHSRUWHG WR FRQVLVW RI DW OHDVW H[RQV VSDQQLQJ .ES DQG WR EH ORFDWHG RQ FKURPRVRPH QLQH $PLJXHW HW DO f 7KHVH DXWKRUV NQHZ IURP SULPHU H[WHQVLRQ DQDO\VLV 6DULV HW DO f WKDW WKH\ KDG QRW ORFDWHG WKH ILUVW ES RI WKH P51$ LQ WKH JHQH DQG WKHUHIRUH KDG QRW LGHQWLILHG WKH ILUVW JHQRPLF H[RQVf ZKLFK DUH QRQFRGLQJ 7KH LQWURQH[RQ VWUXFWXUH RI WKH OLSR ,, JHQH ZDV DQDO\]HG LQ UHODWLRQ WR WKH NQRZQ SURWHLQ GRPDLQV ,W ZDV VKRZQ WKDW DOWKRXJK QR VWULNLQJ FRUUHODWLRQ H[LVWHG ZLWK UHJDUG WR H[RQV DQG WKH DPLQR DFLG UHSHDWV WKUHH RI WKH IRXU DPLQR DFLG FRQVHQVXV UHJLRQV ZHUH HQFRGHG DW WKH HQG RI RQH H[RQ DQG WKH VWDUW RI WKH IROORZLQJ H[RQ ,Q DGGLWLRQ WKH ILUVW WZR H[RQV RI OLSR ,, ZHUH IRXQG WR FRGH IRU VHSDUDWH UHJLRQV EHOLHYHG WR EH LPSRUWDQW LQ UHJXODWLRQ RI SURWHLQ IXQFWLRQ ,Q WKLV FKDSWHU VLPLODU DQDO\VLV UHJDUGLQJ H[RQSURWHLQ GRPDLQ FRUUHODWLRQ IRU OLSR LV VKRZQ DQG D FRPSDULVRQ PDGH EHWZHHQ WKH WZR JHQH VWUXFWXUHV 7KH UHVXOWV SURYLGH LQWHUHVWLQJ LQVLJKW LQWR WKH HYROXWLRQ RI WKH DQQH[LQ IDPLO\ 7KH UHJLRQ XSVWUHDP RI PDQ\ JHQHV KDV EHHQ VKRZQ WR HQFRGH VLWHV IRU ELQGLQJ RI UHJXODWRU\ SURWHLQV 0LWFKHOO DQG 7MLDQ f 6XFK VLWHV PD\ LQIOXHQFH P51$ H[SUHVVLRQ LQ HLWKHU D SRVLWLYH RU QHJDWLYH IDVKLRQ %RWK JHQH VSHFLILF DQG XELTXLWRXV WUDQVFULSWLRQ UHJXODWRU\ IDFWRUV KDYH EHHQ LGHQWLILHG ZKLFK ELQG WR FHUWDLQ '1$ VHTXHQFHV )RU PDQ\ RI WKHVH IDFWRUV D FRQVHQVXV ELQGLQJ VHTXHQFH KDV

PAGE 18

EHHQ GHULYHG IURP VWXG\LQJ WKH SURPRWHU UHJLRQV RI VHYHUDO JHQHV 5HJXODWRU\ HOHPHQWV GHILQHG VR IDU LQFOXGH WKRVH WKDW PHGLDWH JHQH H[SUHVVLRQ E\ JOXFRFRUWLFRLGV *5(f3LFDUG HW DO f F$03 &5(f*RQ]DOH] HW DO f DQG VHUXP 65(f1RUPDQ HW DO f 6HJXHQFLQJ WKH n XSVWUHDP UHJLRQ RI OLSR ZRXOG HQDEOH ORFDOL]DWLRQ RI SRWHQWLDO UHJXODWRU\ VLWHV LQYROYHG LQ WUDQVFULSWLRQ E\ FRPSDULVRQ ZLWK NQRZQ FRQVHQVXV VHTXHQFHV 7KLV LV HVSHFLDOO\ LPSRUWDQW EHFDXVH WKHUH LV HYLGHQFH WKDW JOXFRFRUWLFRLGV LQGXFH OLSR P51$ OHYHOV 3KLOOLSV HW DO :DOOQHU HW DO :RQJ HW DO VXEPLWWHGf DQG WKDW WKH SUHVHQFH RU DEVHQFH RI VHUXP LQIOXHQFHV OLSR P51$ H[SUHVVLRQ LQ VHYHUDO FHOO W\SHV +RUOLFN DQG : :RQJ XQSXEOLVKHG UHVXOWVf 7KH ZRUN GHVFULEHG LQ WKLV FKDSWHU ZLOO EH LPSRUWDQW LQ IXWXUH VWXGLHV DLPHG DW LQYHVWLJDWLQJ PHFKDQLVPV RI UHJXODWLRQ RI PRXVH OLSR JHQH H[SUHVVLRQ $ UHVWULFWLRQ PDS DQG JHQRPLF VHTXHQFH DUH UHTXLUHG IRU VWXGLHV VXFK DV FKURPDWLQ VWUXFWXUH DQDO\VLV =DUHW DQG
PAGE 19

f 7\SLFDOO\ UHFRPELQDQW SKDJHV ZHUH SODWHG RQ FP <7 DJDU SODWHV DQG LQFXEDWHG DW r& IRU KU 'XSOLFDWH QLWURFHOOXORVH OLIWV RI HDFK SODWH ZHUH ZDVKHG LQ D VROXWLRQ FRQWDLQLQJ P0 7ULV S+ f 0 1D&O P0 ('7$ DQG b 6'6 DW r& IRU KU 7KH ILOWHUV ZHUH SUHK\EULGL]HG LQ ; 66& ,; 66& FRQWDLQV 0 1D&O 0 VRGLXP FLWUDWH S+ f ; 'HQKDUGWnV VROXWLRQ ,; 'HQKDUGWnV VROXWLRQ LV FRPSRVHG RI J HDFK RI ILFROO SRO\YLQ\OS\UUROLGRQH DQG ERYLQH VHUXP DOEXPLQf b 6'6 DQG QJPO GHQDWXUHG VDOPRQ VSHUP '1$ IRU KU DW & $ 3ODEHOHG OLSR F'1$ SUREH V\QWKHVL]HG E\ UDQGRP SULPHU H[WHQVLRQ )HLQEHUJ DQG 9RJHOVWHLQ f ZDV DGGHG WR WKH K\EULGL]DWLRQ VROXWLRQ DQG WKH ILOWHUV ZHUH IXUWKHU LQFXEDWHG DW r& IRU DQ DGGLWLRQDO KU 7KH ILOWHUV ZHUH VXEMHFWHG WR WKUHH KU ZDVKHV DW r& LQ ,; 66& DQG b 6'6 DQG H[SRVHG WR .RGDN ;20$7 $5 ILOP IRU WKUHH GD\V DW & ZLWK DQ LQWHQVLI\LQJ VFUHHQ OLJKWQLQJSOXV 'X 3RQWf :KHQ D NLQDVHG ROLJRQXFOHRWLGH ZDV XVHG DV D SUREH WKH ZDVKHV ZHUH SHUIRUPHG DW r& LQ ; 66& DQG b 6'6 (DFK SRVLWLYH FORQH LGHQWLILHG IURP WKH SULPDU\ VFUHHQLQJ ZDV IXUWKHU SXULILHG WR KRPRJHQHLW\ JURZQ XS ODUJH VFDOH DQG LWV JHQRPLF LQVHUW H[FLVHG DQG VXEFORQHG LQWR 0PSO IRU '1$ VHTXHQFLQJ 0HVVLQJ f 3UREH 3UHSDUDWLRQ +\EULGL]DWLRQ SUREHV ZHUH V\QWKHVL]HG ZLWK D3 G$73 1(1 X&LPPROHf E\ UDQGRP SULPHU H[WHQVLRQ ZLWK KH[DPHU

PAGE 20

SULPHUV 3KDUPDFLDf )HLQEHUJ DQG 9RJHOVWHLQ f XVLQJ DOO RU SDUW RI D ES SDUWLDO PRXVH OLSR F'1$ LQVHUW FORQH %:6 : :RQJf RU D .E ;ED IUDJPHQW IURP JHQRPLF FORQH -OLSRO $ ES ROLJRQXFOHRWLGH FRUUHVSRQGLQJ WR WKH ILUVW H[RQ ZDV UDGLRODEHOHG XVLQJ JDPPD3 $73 DQG 7 SRO\QXFOHRWLGH NLQDVH %5/f DV GHVFULEHG E\ 6DPEURRN HW DO f *HQRPLF '1$ ,VRODWLRQ DQG 6RXWKHUQ $QDO\VLV 0RXVH JHQRPLF '1$ ZDV LVRODWHG IURP FRQIOXHQW $ %DOEF ILEUREODVW FHOOV E\ O\VLV LQ D VROXWLRQ RI P0 7ULV S+ P0 ('7$ b 6'6 DQG PJPO SURWHLQDVH %RHKULQJHU 0DQQKHLP %LRFKHPLFDOVf )ROORZLQJ LQFXEDWLRQ IRU KU DW r& QXFOHLF DFLGV ZHUH HWKDQRO SUHFLSLWDWHG DQG UHVXVSHQGHG $IWHU D KU LQFXEDWLRQ DW r& LQ WKH SUHVHQFH RI JPO '1DVHIUHH 51DVH $ 6LJPDf WKH '1$ ZDV SXULILHG E\ SKHQROFKORURIRUP H[WUDFWLRQV *HQRPLF '1$ ZDV WKHQ HWKDQRO SUHFLSLWDWHG DQG UHVXVSHQGHG DW D FRQFHQWUDWLRQ RI DERXW PJPO 5HVWULFWLRQ HQ]\PH GLJHVWHG '1$ MXJf ZDV UXQ RQ b DJDURVH JHOV FRQWDLQLQJ 0 7ULVDFHWDWH DQG P0 ('7$ S+ f IRU KU DW YROWV 7KH JHO ZDV WUHDWHG DV IROORZV SULRU WR WUDQVIHU 'HSXULQDWHG WZR WLPHV ZLWK 0 +& PLQ HDFKf GHQDWXUHG ZLWK 0 1D2+ WZR WLPHV PLQ HDFKf DQG QHXWUDOL]HG ZLWK 0 7ULVERUDWH 0 ERULF DFLG DQG 0 ('7$ S+ *HQRPLF '1$ ZDV WUDQVIHUUHG HOHFWURSKRUHWLFDOO\ IRU KU WR D QRQFKDUJHG Q\ORQ PHPEUDQH

PAGE 21

*HQH6FUHHQ 1(1f LPPRELOL]HG RQ WKH PHPEUDQH E\ 89 FURVV OLQNLQJ &KXUFK DQG *LOEHUW f DQG K\EULGL]HG ZLWK D VSHFLILF UDGLRODEHOHG SUREH +\EULGL]DWLRQ RI 6RXWKHUQ %ORWV +\EULGL]DWLRQV ZHUH GRQH DV SUHYLRXVO\ GHVFULEHG &KXUFK DQG *LOEHUW f %ORWV ZHUH SUHK\EULGL]HG IRU PLQ LQ D EXIIHU FRQWDLQLQJ b ERYLQH VHUXP DOEXPLQ 6LJPDf P0 ('7$ 0 1D+3 S+ f DQG b 6'6 DW r& $IWHU DGGLWLRQ RI WKH ODEHOHG SUREH WKH EORWV ZHUH K\EULGL]HG DW r& IRU KU 7KH EORWV ZHUH WKHQ VXEMHFWHG WR WKUHH PLQ ZDVKHV LQ P0 ('7$ P0 1D+3 S+ f b 6'6 DW r& DQG H[SRVHG WR .RGDN ;20$7 $5 ILOP IRU YDULRXV SHULRGV RI WLPH :KHQ D NLQDVHG ROLJRQXFOHRWLGH SUREH ZDV XVHG WKH K\EULGL]DWLRQ ZDV GRQH DW r& IRU KU DQG WKH ZDVK ZDV GRQH LQ WKH EXIIHU GHVFULEHG DERYH EXW FRQWDLQLQJ D ILQDO FRQFHQWUDWLRQ RI 0 1D DW r& 5HVXOWV ,VRODWLRQ RI /LSR *HQRPLF &ORQHV ,QLWLDOO\ PRXVH OLSR F'1$ FORQH %:6 FRQWDLQLQJ DOPRVW DOO RI WKH OLSR FRGLQJ VHTXHQFH ZDV XVHG WR VFUHHQ D %DOEF PRXVH OLYHU (0%/ JHQRPLF OLEUDU\ 7KLV SUREH ZDV DOVR XVHG LQ JHQRPLF 6RXWKHUQ EORW DQDO\VLV WR HVWLPDWH WKH OHQJWK RI JHQRPLF '1$ ZKLFK FRQWDLQHG OLSR FRGLQJ VHTXHQFH )LJ f &ORQH -OLSRO ZDV LVRODWHG DQG WKHQ FKDUDFWHUL]HG E\ 6RXWKHUQ EORW DQDO\VLV XVLQJ WKH F'1$ WR

PAGE 22

)LJXUH 6RXWKHUQ EORW DQDO\VLV RI PRXVH JHQRPLF '1$ ZLWK D OLSRFRUWLQ F'1$ SUREH *HQRPLF '1$ LVRODWHG IURP PRXVH $ ILEUREODVW FHOOV ZDV GLJHVWHG ZLWK ;ED ODQH f 6HD ODQH f 6VW ODQH f DQG 3VW ODQH f 5HVWULFWHG '1$ LJODQHf ZDV UXQ RQ b DJDURVH JHOV HOHFWURWUDQVIHUUHG WR *HQH6FUHHQ PHPEUDQH DQG K\EULGL]HG ZLWK D OLSRFRUWLQ F'1$ SUREH 7KH QXPEHUV RQ WKH ULJKW GHVLJQDWH WKH UHODWLYH SRVLWLRQ RI PROHFXODU VL]H PDUNHUV LQ .ES

PAGE 23

ORFDOL]H H[RQV 5HVWULFWLRQ IUDJPHQWV FRQWDLQLQJ H[RQV ZHUH FORQHG LQWR 0 YHFWRUV DQG VHTXHQFHG E\ WKH GLGHR[\ PHWKRG ,QWURQH[RQ MXQFWLRQV ZHUH GHWHUPLQHG E\ FRPSDULQJ JHQRPLF VHTXHQFH ZLWK WKDW RI WKH PRXVH OLSR F'1$ -OLSRO KDG D NE LQVHUW ZKLFK ZDV IRXQG WR FRQWDLQ OLSR H[RQV EXW QRW WKH n RU n HQGV RI WKH JHQH 6RXWKHUQ EORW DQDO\VLV FRPSDULQJ OLSR UHVWULFWLRQ IUDJPHQWV IURP WKH JHQRPH WR WKRVH SUHVHQW LQ -OLSRO GDWD QRW VKRZQf UHYHDOHG WKDW WKLV FORQH FRQWDLQHG D VHYHQ NE IUDJPHQW DW LWV n HQG ZKLFK ZDV QRW SDUW RI WKH OLSR JHQH 7KXV WKH NE LQVHUW LQ WKLV FORQH ZDV D FRPELQDWLRQ RI WZR JHQRPLF IUDJPHQWV RQH FRQWDLQLQJ SDUW RI WKH OLSR JHQH DQG DQRWKHU IURP HOVHZKHUH LQ WKH JHQRPH ZKLFK ZHUH DSSDUHQWO\ OLJDWHG WRJHWKHU GXULQJ OLEUDU\ FRQVWUXFWLRQ 7KLV SKHQRPHQRQ ZDV DOVR UHSRUWHG ZLWK UHJDUG WR WKH FORQLQJ RI WKH KXPDQ F\WRVROLF DOGHK\GH GHK\GURJHQDVH $/'+f JHQH ZKHUH WKH DXWKRUV QRWH WKH\ LGHQWLILHG VHYHUDO JHQRPLF FORQHV ZKLFK FRQWDLQ $/'+ VHTXHQFH DW RQH HQG DQG RWKHU XQLGHQWLILHG VHTXHQFHV DW WKH RWKHU HQG +VX HW DO f 7KH 6RXWKHUQ DQDO\VLV DQG VXEVHTXHQW FKDUDFWHUL]DWLRQ RI DQRWKHU FORQH UXOH RXW WKH SRVVLELOLW\ WKDW -OLSRO FRQWDLQHG D SVHXGRJHQH 7R LVRODWH WKH UHPDLQGHU RI WKH JHQH n DQG n VSHFLILF SUREHV ZHUH XVHG WR VFUHHQ D VHFRQG PRXVH OLYHU (0%/ JHQRPLF OLEUDU\ $ NE ;ED UHVWULFWLRQ IUDJPHQW IURP -OLSRO DQG DQ $3&5GHULYHG ROLJRQXFOHRWLGH

PAGE 24

FRUUHVSRQGLQJ WR WKH n HQG RI WKH OLSR P51$ +RUOLFN HW DO VXEPLWWHGf ZHUH XVHG DV SUREHV IRU WKH n HQG ZKLOH D ES IUDJPHQW FRUUHVSRQGLQJ WR WKH n HQG RI WKH F'1$ ZDV XWLOL]HG WR SUREH IRU WKH n HQG 7ZR QHZ FORQHV nOLSRO DQG nOLSRO ZHUH LVRODWHG XVLQJ WKHVH SUREHV DQG FKDUDFWHUL]HG DV H[SODLQHG DERYH ([RQ RQH VHTXHQFH ZDV REWDLQHG IURP nOLSRO ZKLOH WKH ODVW WZR H[RQV ZHUH IRXQG LQ nOLSRO *HQRPLF 6WUXFWXUH RI /LSR 7KH WKUHH OLSR JHQRPLF FORQHV H[DPLQHG LQFOXGLQJ D UHVWULFWLRQ PDS FRQVLVWHQW ZLWK JHQRPLF 6RXWKHUQ DQDO\VLV DUH VKRZQ LQ )LJ 7KH '1$ VHTXHQFH RI WKH PRXVH OLSR JHQH DQG GHGXFHG DPLQR DFLG VHTXHQFH IURP WKH FRGLQJ UHJLRQ DUH VKRZQ LQ )LJ 7KH JHQH FRQVLVWV RI H[RQV VSDQQLQJ DSSUR[LPDWHO\ NE ([RQ DQG LQWURQ VL]HV DUH VKRZQ LQ 7DEOH ([RQV UDQJH LQ VL]H IURP WR ES ZLWK DQ DYHUDJH VL]H RI ES ,QWURQ OHQJWKV YDU\ IURP ES WR NE DYHUDJLQJ NE 7KH ILUVW H[RQ LV HQWLUHO\ QRQFRGLQJ DQG UHSUHVHQWV WKH WUXH VWDUW VLWH RI WUDQVFULSWLRQ DV GHWHUPLQHG E\ SULPHU H[WHQVLRQ +RUOLFN HW DO VXEPLWWHGf ([RQ WZR FRQWDLQV WKH ILUVW FRGLQJ EDVHV DQG H[RQ KDV WKH ILQDO ,Q RI FDVHV LQWURQV RFFXU EHWZHHQ FRGRQV $OO RI WKH H[RQLQWURQ MXQFWLRQV FRQIRUP WR WKH FRQVHQVXV VHTXHQFHV HVWDEOLVKHG IRU LQWURQ GRQRU n*7$*$*7nf DQG DFFHSWRU n>3\@Q1&7$*nf VSOLFH VLJQDOV %UHDWKQDFK DQG &KDPEQ 3DGJHWW HW DO f

PAGE 25

)LJXUH 5HVWULFWLRQ PDS DQG JHQRPLF VWUXFWXUH RI WKH PRXVH OLSRFRUWLQ JHQH 7KH WKUHH JHQRPLF FORQHV FKDUDFWHUL]HG DQG WKHLU UHODWLYH SRVLWLRQV DUH VKRZQ DW WKH WRS %HORZ LV D UHVWULFWLRQ PDS VKRZLQJ WKH ORFDWLRQ RI H[RQV 2SHQ DUHDV UHSUHVHQW XQWUDQVODWHG VHTXHQFH DQG GDUN UHJLRQV UHSUHVHQW FRGLQJ VHTXHQFH 5HVWULFWLRQ HQGRQXFOHDVH VLWHV DUH DV IROORZV $ $SD ( (FR 5, .SQ / 6VW 0 6PD 6 6DO ; ;ED ,

PAGE 26

V / -OLSRO r OLSRO 6 ( / 0( ;( // NE ; / ;/ I rOLSRO /; $ / ; /. LLLPLM

PAGE 27

)LJXUH 6HTXHQFH RI WKH PRXVH OLSRFRUWLQ JHQH 7KH QXFOHRWLGH VHTXHQFH RI WKH H[RQV DQG WKHLU LPPHGLDWH IODQNLQJ LQWURQ VHTXHQFHV DUH VKRZQ 'HGXFHG DPLQR DFLG VHTXHQFH LV VKRZQ EHORZ WKH FRGLQJ UHJLRQV 1XPEHUV MXVW DERYH WKH QXFOHRWLGH VHTXHQFH DUH EDVHG RQ WKH IXOOOHQJWK F'1$ VHTXHQFH DQG QXPEHUV EHORZ WKH DPLQR DFLG VHTXHQFH VWDUW DW WKH LQLWLDWRU PHWKLRQLQH FRGRQ 7KH VHTXHQFH EHJLQV RQH QXFOHRWLGH EHIRUH WKH WUDQVFULSWLRQ VWDUW VLWH DV GHILQHG E\ SULPHU H[WHQVLRQ$3&5 7KH n HQG RI WKH ODUJHVW F'1$ FORQH LV LQGLFDWHG E\ QXFOHRWLGH -XVW n RI WKLV D SRWHQWLDO SRO\ $f DGGLWLRQ VLJQDO LV XQGHUOLQHG ([RQV DQG nn IODQNLQJ VHTXHQFH DUH LQ XSSHUFDVH OHWWHUV ZKLOH LQWURQ VHTXHQFH LV LQ ORZHUFDVH

PAGE 28

f &$&7&7&$:;$,&72&2*$t,&7DF7,2*7&&&&**t:2&$$*&$$$,$&$$$* JWDDJJFWWD NWS WFD8WWFDJ $7$&7&7&00 $7* *&$ $7* *7$ 7&$ *$$ 77& &7& $$* &$* *&& &*7 777 &77 *$$ $$7 &$$ *$$ &$* *$$ 7$7 *77 JWDDJWDJWFDDDDWDWWDWJDDJWDJWWDFFDWJWWDDDDWJJDFDJWDDFDWJDDWJDDWDDDWDDDWJDDWJDFWDDDDDFWDDWWFDWJWFWFWWJFDFDFDWDJ 0HW $OD 0HW 9DO 6HU *OX 3KH /HX /\V *LQ $OD $UJ 3KH /HX *OX $VQ *LQ *OX *LQ *OX 7\U 9DO &$$ *&7 *7$ $$$ 7&$ 7$& $$$ **7 **7 &&7 *** 7&$ *&$ *7* $*& &&& 7$& &&7 7&& 77& $$7 *7$ 7&& 7&* *$7 *77 *&7 *&& 77* &$& $$$ *&7 $7& $7* *77 $$$ JWDDJJWWJW NWSJWDWWWFFDJ *7 *7* *$7 *$$ *&$ *LQ $OD 9DO /\V 6HU 7\U /\V *O\ *O\ 3UR *O\ 6HU $OD 9DO 6HU 3UR 7\U 3UR 6HU 3KH $VQ 9DO 6HU 6HU $VS 9DO $OD $OD /HX +LV /\V $OD +H 0HW 9DO /\V O\ 9DO $VS *OX $OD $&& $7& $77 *$& $77 &77 $&& $$* 1e $&& $$7 *&7 &$* &*& &$* &$* $7& $$* *&& *&* 7$& 77$ &$* *$* $$7 *2 $$* JWDJWJDJDD f§ NWS WWWWFFFHDJ &&& 77* *$7 *$$ *7& 77* $*$ $$$ *&& &77 $&$ **& &$& &7* 7KU OLH +H $VS +H /HX 7KU /\V $UJ 7KU $VQ $OD *LQ $UJ *LQ *LQ +H /\V $OD $OD 7\U /HX *LQ *OX $VQ *O\ /\V 3UR /HX $VS *OX 9DO /HX $UJ /\V $OD /HX 7KU *O\ +LV /HX *$* *$* *77 *77 77* *&7 $7* &7$ $$$ $&7 &&$ *&7 &$* 777 *$7 *&$ *$7 *$$ &7& &*7 **7 *&& $7* $$* JWDDDWWDWWf§ ,GS f WDDDWWFDJ **$ &77 **$ $&$ *$7 *$$ *$& $&7 &7& $77 *$* $77 77* $&$ $&$ $*$ 7&7 $$& *OX *OX 9DO 9DO OHX $OD 0HW /HX /\V 7KU 3UR $OD *LQ 3KH $VS $OD $VS *OX /HX $UJ *O\ $OD 0HW /\V *O\ /HX *O\ 7KU $VS *OX $VS 7KU /HX +H *OX +H /HX 7KU 7KU $UJ 6HU $VQ *$$ &$$ $7& $*$ *$* $77 $$7 $*$ *7& 7$& $*$ *$$ JWFDJDFFFDJ ‘ NWS DWWFFWDFDJ $* &7* $$$ $*$ *$7 &7* *&& $$$ *$& $7& $&7 7&$ *$7 $&$ 7&7 **$ *$& 777 &2* $$$ *&& 77* &77 *&7 &77 *&& $$* JWDWD *OX *LQ +H $UJ *OX +H $VQ $UJ 9DO 7\U $UJ *OX OX /HX /\V $UJ $VS /HX $OD /\V $VS +H 7KU 6HU $VS 7KU 6HU *O\ $VS 3KH $UJ /\V $OD /HX /HX $OD /HX $OD /\V DFDWD WWSWDWWWWDFDJ **7 *$& &*7 7*, &$* *$& 7,* $*, *,* $$7 &$$ *$7 7,* *&7 *$7 $&$ *$7 *&& $** JWDDJFDDJDWf§ WWSn WWFWWJDFDJ *&7 77* 7$7 *$$ 2&7 **$ *$$ $77 $*$ $$* *2* $&$ *$& *,* $$7 *O\ $VS $UJ &\V *LQ $VS OHX 6HU 9DO $VQ *LQ $VS OHX $OD $VS 77LU $VS $OD $UJ $OD OHX 7\U *OX $OD *O\ *OX $UJ $UJ O\V *O\ ,KU $VS 9DO $VQ *7& 77& $&& $&$ $77 &7* $&& $2& $** $*& 7+ &&7 &$7 &7, &%& $*$ JWDDWDDJDWD NWSWFFFDWWFDJ 7* ,77 &$* $$7 7$& **$ $$* 7$& $&7 &$$ &$7 *$& $7* $$& $$$ *&7 &7* *$7 &7* *$$ &7* $$* **7 *$& $Q 9DO 3KH 7KU 7KU OLH OHX 7KU 6HU $UJ 6HU 3KH 3UR +LV OHX $UJ $UJ 9 DO 3KH *LQ $VQ 7\U *O\ O\V 7\U 6HU *LQ +LV $VS +HW $VQ /\V $OD OHX $VS /HX *OX OHX O\V *O\ $VS +H } *$* $$* 7*& &7& $&$ $&& $7& JWDWJWDJDDf§ NIFSWFWFWWDFDJ 7* $$* 7*7 *&& $&& $*& $&7 &&$ *&7 77& 777 *&& *$* $$* &7* 7$& *$$ *&& $7* $$* JWDFf§ 9WSJWFWJFDFDJ **7 *&& **$ $&7 &*& &$7 $$* *OX O\V &\V /HX 7KU 7KU OLH 9 DO /\V &\V $OD 7KU 6HU 7KU 3UR $OD 3KH 3KH $OD *OX /\V OHX 7\U *OX $OD +HW /\V *O\ $OD *O\ 7KU $UJ +LV O\V *&$ 77* $7& $** $+ $7* *7& 7*& &*7 7&* *$$ $+ *$& $7* $$7 *$$ $7& $$$ *7$ 7+ 7$& &$* $$* $$* 7$7 **$ $7& 7&7 &77 7*& &$$ *&& $7& &7* JWDWJWWJWDf§ NIFS JWFWFDDFDJ *$7 *$$ $&& $$$ **$ *$& 7$7 $OD OHX OLH $UJ +H 0HW 9DO 6HU $UJ 6HU *OX +H $VS 0HW $VQ *OX OLH O\V 9DO 3KH 7\U *LQ O\V O\V 7\U *O\ +H 6HU /HX &\V *LQ $OD +H OHX $VS *OX 7KU /\V *O\ $VS 7\U WR 2 *$$ $$$ $7& &7* &7* *&7 &7* 7*7 **7 **$ $$& 7$* $&$7&&&$$&7$77&7*&$$**77&7*$**$*$$7*7&7&77$*&7*77*77772&Q&*$7**&$7***&77$$*7$**$$$*77*&777**&$*$7$$*7&7$$Q$&&7*&777*$$7$$7$7$*&&7$7$$$7$*$7P$&$7&$77 *OX /\V OH /DL 9DO $OD /HX &\V *O\ *O\ $VQ (0f $&7&7*7$&$$7$*$*$$$7$&77*7777*77$$77$7*Q7$7&&&$$$77$7$$$*&&&&$7$$*&$$*7&$&777**7$&&$77&&7*$*$$$*$$*777$&$7$7$$7$$$$7$$$$&$$7Q7$7$$*$&$$77**7*7*7077*7&7&7&&QQ*7*$7Q7&7Q7777&74&$7*7$$7&&$$*$*$$*7 &$*7777&&&&$7774*$*$7$$7777*7*$7777*7*$$$7&$&&$$$*77&7$&7$*$$$*&7

PAGE 29

0RXVH OLSRFRUWLQ LQWURQ DQG H[RQ VL]HV OHQJWK ESf LQWURQ OHQJWK ESf ,, ,,, ,9 9 9, 9, 9,,, ,; ; ;, ;,,

PAGE 30

$ERXW ES RI VHTXHQFH XSVWUHDP RI WKH WUDQVFULSWLRQ LQLWLDWLRQ VLWH LV VKRZQ LQ )LJ 7KH LQLWLDWLRQ VLWH FORVHO\ UHVHPEOHV WKH ZHDN FRQVHQVXV VHTXHQFH n 3Y3Y&$3\3Y3\3\3\ ZLWK WUDQVFULSWLRQ EHJLQQLQJ DW WKH $ ZKLFK KDV EHHQ LGHQWLILHG DV DQ LQGHSHQGHQW UHFRJQLWLRQ VLWH IRU WUDQVFULSWLRQ LQLWLDWLRQ LQ VHYHUDO PDPPDOLDQ JHQHV &RUGHQ HW DO f $ 7$7$ ER[ DQG &&$$7 ER[ DUH ORFDWHG DW SRVLWLRQV DQG UHVSHFWLYHO\ ,Q DGGLWLRQ WKH IROORZLQJ SRWHQWLDO UHJXODWRU\ VLWHV ZHUH LGHQWLILHG EDVHG RQ UHSRUWHG FRQVHQVXV VHTXHQFHV 0LWFKHOO DQG 7MLDQ $GGLVRQ DQG .XUW] f $3 ELQGLQJ VLWH f 2FW ELQGLQJ VLWH f F$03 UHVSRQVH HOHPHQW f JOXFRFRUWLFRLG UHVSRQVH HOHPHQW DQG f GHOD\HG JOXFRFRUWLFRLG UHVSRQVH HOHPHQW f VHUXP UHVSRQVH HOHPHQW DQG f DQG $3 ELQGLQJ VLWH ES LQWR WKH ILUVW LQWURQ QRW VKRZQf 6WUXFWXUDO 2UJDQL]DWLRQ RI WKH /LSR *HQH )LJXUH VKRZV WKH SRVLWLRQ RI WKH H[RQV UHODWLYH WR WKH FRUUHVSRQGLQJ DPLQR DFLG VHTXHQFH 7KH IRXU &WHUPLQDO DPLQR DFLG UHSHDWV KDYH EHHQ DOLJQHG DQG WKH PRUH KLJKO\ FRQVHUYHG DPLQR DFLG XQLWV EHOLHYHG WR EH UHVSRQVLEOH IRU FDOFLXPSKRVSKROLSLG ELQGLQJ DUH XQGHUOLQHG *HLVRZ HW DO 3HSLQVN\ HW DO f $OWKRXJK WKH WKLUG DPLQR DFLG UHSHDW LV HQFRGHG E\ H[RQV DQG QR RWKHU VWULNLQJ FRUUHODWLRQ EHWZHHQ H[RQ VWUXFWXUH DQG WKH ODUJH UHSHDWV FDQ EH VHHQ 7KUHH RI WKH IRXU DPLQR DFLG

PAGE 31

)LJXUH 6HTXHQFH RI WKH PRXVH OLSRFRUWLQ SURPRWHU UHJLRQ 7$7$ DQG &&$$7 PRWLIV DW SRVLWLRQV DQG UHVSHFWLYHO\ DUH LQ EROG SULQW 6HTXHQFHV UHVHPEOLQJ ELQGLQJ VLWHV IRU UHJXODWRU\ SURWHLQV DUH XQGHUOLQHG DQG QDPHG DV H[SODLQHG LQ WKH WH[W

PAGE 32

$3 $3 2&7 &7**$*$$*$**&7&$*&$**7$$*$*&$&7**77*&7777&$*$7**$&7&$*&77&*$77&7&$*&$&&&$&&7**&$*&&&$&$$&7*7&7*7$$77&&$777&&$*7**$*&7*$&$&&&7&$7$&$*$&$*7*&$7$7$*$&$$$$&$&&$$7*&$7*7$$$77$$$$&$$7$$$7$$777777$$$$*7$&$$* B f f f 7$*7*77777$77$$$7*7&$77$7$$77&&$7&777$$&$7&*$77$77*$$$$7&*7*$**7$$77&$*$*7&7&$&*$*77&&&7*777&77$*77$7$&7$*777&$$$**&77$$7$**$$**&$$*$*&$77*&7**7*$$7&$&$$*$$$$*7$&7&$77$*$*$$7&$777777$$$$$&&7&&$$$7$$*7 WR r &5( *5( 65( 65( &77&77&77&77&77&77&77&77&77&77&77&77&77&777777$*UUQ*$2*7&$$7*7*777$$7777$$$**$&7&&&$*7$$*U7&7&&$$*$7$$*$&$***$*$*&$$&$7$*&7*$$&&$&2&$7&2&$7*$$&&$77&&7**$**$$7$$$$$&&7&$*$$2*$$&$2&$2***$$$$7&&$7*$77&& *5( V*5( 77*777&7&&77**7777*$&&$4*&7*$*&&$*77&77&$$$*$$$$*$&$4&&$&77$&7$$&77&7**772&7$4*7*7**&77&$&77&$7$7&&7f$7$$$$,2W2*$*7&&$$&&&7&&$&Qf&&

PAGE 33

)LJXUH &RUUHODWLRQ RI OLSRFRUWLQ JHQRPLF VWUXFWXUH ZLWK SURWHLQ GRPDLQV 7KH XSSHU OLQH RI DPLQR DFLGV UHSUHVHQWV WKH XQLTXH 1WHUPLQXV DQG WKH ORZHU IRXU OLQHV VKRZ WKH LQWHUQDO UHSHDWV ZKLFK DUH LPSRUWDQW LQ FDFLXPSKRVSKROLSLG ELQGLQJ 7KH DPLQR DFLG FRQVHQVXV VHTXHQFH ZLWKLQ HDFK RI WKH IRXU UHSHDWV LV XQGHUOLQHG ([RQV HQFRGLQJ WKH YDULRXV UHJLRQV DQG WKH ORFDWLRQV ZKHUH DPLQR DFLG VHTXHQFH LV LQWHUUXSWHG E\ LQWURQV DUH LQGLFDWHG

PAGE 34

%221 = (;21 0$096()/.4$5)/(14(4(< 9_ $9.6<.**3* (;21 (;21 6$963<36)1966'9$$W+.$,09 .O*9'($7,,2O/UW&571 $2522,.$$
PAGE 35

UHSHDWV RFFXU DW D /\V*O\ MXQFWLRQ ZKLFK LV DW WKH HQG RI RQH H[RQ DQG WKH VWDUW RI WKH QH[W 7KH WKLUG DPLQR DFLG UHSHDW XQOLNH WKH RWKHU WKUHH LV ORFDWHG HQWLUHO\ ZLWKLQ RQH H[RQ 7KLV SDWWHUQ LV HVVHQWLDOO\ LGHQWLFDO WR WKDW UHSRUWHG IRU PRXVH S RU OLSR ,, ZKHUH WKH ILUVW VHFRQG DQG IRXUWK DPLQR DFLG UHSHDWV RFFXU DW H[RQ ERXQGDULHV ZKLOH WKH WKLUG LV ORFDWHG LQ RQH H[RQ ,QWHUHVWLQJO\ WKH VHFRQG H[RQ HQFRGHV WKH 1WHUPLQDO DPLQR DFLGV LQFOXGLQJ VLWHV IRU SKRVSKRU\ODWLRQ SURWHRO\VLV DQG KHDGWRKHDG GLPHUL]DWLRQ VHH LQWUR IRU UHIf 'LVFXVVLRQ ,Q WKLV FKDSWHU KDYH VKRZQ WKH FRPSOHWH PRXVH OLSR JHQH VWUXFWXUH DQG DERXW ES RI XSVWUHDP IODQNLQJ UHJLRQ 7KLV HQDEOHV DQ DQDO\VLV RI OLSR JHQHSURWHLQ VWUXFWXUH UHODWLRQVKLSV DV ZHOO DV D FRPSDULVRQ ZLWK WKDW RI PRXVH OLSR ,, $ FRPSOHWH FRPSDULVRQ KRZHYHU LV QRW \HW SRVVLEOH EHFDXVH WKH n HQG DQG SURPRWHU UHJLRQ RI OLSR ,, KDYH QRW EHHQ LGHQWLILHG $PLJXHW HW DO f 6XFK DQ DQDO\VLV LV XVHIXO WR GHWHUPLQH ZKHWKHU OLSR ILWV WKH K\SRWKHVLV WKDW H[RQV HQFRGH GLVFUHWH IXQFWLRQDO RU VWUXFWXUDO GRPDLQV RI SURWHLQV %ODNH *LOEHUW f 7KH OLSR SURWHLQ FDQ EH GLYLGHG LQWR WZR UHJLRQV DQ 1WHUPLQXV XQLTXH WR WKLV SURWHLQ DQG D FRUH UHJLRQ FRQVLVWLQJ RI IRXU DPLQR DFLG UHSHDWV 7KHVH VWUXFWXUDO UHSHDWV DUH VKDUHG DPRQJ WKH RWKHU OLSRFRUWLQV DQG DUH EHOLHYHG WR EH QHFHVVDU\ IRU FDOFLXPSKRVSKROLSLG ELQGLQJ

PAGE 36

$OO IRXU DUH HQFRGHG E\ WKUHH H[RQV DQG LQ WKUHH RI WKH IRXU FDVHV H[RQH[RQ ERXQGDULHV VKRZ QR VWULNLQJ FRUUHODWLRQ ZLWK DPLQR DFLG UHSHDW ERXQGDULHV +RZHYHU LQ WKH FDVH RI WKH WKLUG DPLQR DFLG UHSHDW H[RQV DQG FRUUHVSRQG DOPRVW H[DFWO\ ZLWK WKH UHSHDW ERXQGDULHV 7KH VLJQLILFDQFH RI WKLV REVHUYDWLRQ LV QRW FOHDU DOWKRXJK LW VXJJHVWV WKDW HDFK UHSHDW PD\ KDYH RULJLQDOO\ EHHQ HQFRGHG E\ D FRPELQDWLRQ RI WKUHH VHSDUDWH H[RQV ZKRVH ERXQGDULHV WKHQ EHFDPH OHVV GHILQHG GXULQJ VXEVHTXHQW GXSOLFDWLRQ 7KH SDWWHUQ VHHQ LQ OLSR LV YHU\ VLPLODU WR WKDW RI OLSR ,, LQ WHUPV RI WKH DPLQR DFLG UHSHDWV ,Q OLSR ,, KRZHYHU WKH ERXQGDULHV RI WKH WKLUG UHSHDW GR QRW FRUUHVSRQG TXLWH DV ZHOO WR WKH H[RQH[RQ ERXQGDULHV &RUUHODWLRQ RI WKH DPLQR DFLG FRQVHQVXV VHTXHQFHV ZLWKLQ HDFK UHSHDW *HLVRZ HW DO f WR H[RQ VWUXFWXUH VXSSRUWV WKH LGHD RI D FRPPRQ DQFHVWRU H[RQ IRU WKH UHSHDW XQLW $V VKRZQ LQ )LJ WKUHH RI IRXU RI WKH DPLQR DFLG UHSHDWV EHJLQ DW D /\V*O\ ZKLFK LV DW WKH HQG RI RQH H[RQ DQG WKH VWDUW RI WKH QH[W 7KH WKLUG UHSHDW LV WKH H[FHSWLRQ EHFDXVH LW LV HQFRGHG LQ WKH FHQWUDO SDUW RI RQH H[RQ 7KLV SDWWHUQ LV YLUWXDOO\ LGHQWLFDO WR WKDW VHHQ LQ OLSR ,, H[FHSW WKDW LQ WKLV FDVH WKH ILUVW UHSHDW VWDUWV WZR DPLQR DFLGV EHIRUH WKH /\V*O\ $PLJXHW HW DO f ,W LV LQWHUHVWLQJ WR QRWH WKDW WKH PDMRULW\ RI WKH XQLTXH 1WHUPLQXV LV HQFRGHG E\ H[RQ WZR 7KLV SDUW RI WKH SURWHLQ FRQWDLQV SRWHQWLDO VLWHV IRU W\URVLQH DQG VHULQH

PAGE 37

SKRVSKRU\ODWLRQ SURWHRO\VLV DQG GLPHUL]DWLRQ 7KHUHIRUH LW LV SRVVLEOH WKDW H[RQ WZR LV D OLSR ,VSHFLILF UHJXODWRU\ H[RQ UHVSRQVLEOH IRU PHGLDWLQJ LWV SDUWLFXODU DFWLYLW\ 7KLV FRUUHODWHV ZLWK WKH IDFW WKDW WKH SXWDWLYH VHFRQG DQG WKLUG H[RQV RI OLSR ,, HQFRGH UHJLRQV EHOLHYHG LPSRUWDQW LQ LWV UHJXODWLRQ $PLJXHW HW DO f /LSR ,, H[RQ WZR HQFRGHV WKH VLWH IRU ELQGLQJ RI D SURWHLQ FDOOHG SOO ZKLOH H[RQ WKUHH HQFRGHV SKRVSKRU\ODWLRQ DQG SURWHRO\WLF FOHDYDJH VLWHV *OHQQH\ DQG 7DFN f 0LWVXQREX HW DO f KDYH LVRODWHG D F'1$ IURP */-&. KXPDQ JOLREODVWRPD FHOOV LQ ZKLFK WKH UHJLRQ FRGLQJ IRU WKH ILUVW DPLQR DFLGV RI OLSR ,, ZDV IXVHG WR WKH FRGLQJ UHJLRQ IRU WKH & WHUPLQDO DPLQR DFLGV RI WKH FUDI RQFRJHQHNLQDVH ([SUHVVLRQ RI WKLV OLSR ,,FUDI IXVLRQ SURWHLQ UHVXOWHG LQ WUDQVIRUPDWLRQ RI 1,+7 FHOOV 7KH ILUVW DPLQR DFLGV RI OLSR ,, HQFRGHG HQWLUHO\ E\ WKH SXWDWLYH VHFRQG H[RQ FRQWDLQ WKH ELQGLQJ VLWH IRU SOO %LQGLQJ RI SOO WR OLSR ,, UHVXOWV LQ WKH IRUPDWLRQ RI D SSOO WHWUDPHU ZKLFK LV DQFKRUHG WR WKH F\WRVNHOHWRQ =RNDV DQG *OHQQH\ f VR LW LV SRVVLEOH WKDW DEHUUDQW ORFDOL]DWLRQ RI WKH FUDI NLQDVH WR WKH F\WRVNHOHWRQ PHGLDWHG E\ WKH SOO ELQGLQJ VLWH HQFRGHG E\ WKH OLSR ,, VHFRQG H[RQ FDXVHG WKH FHOO WUDQVIRUPDWLRQ REVHUYHG E\ 0LWVXQREX HW DO f )XUWKHU DQDO\VLV EHWZHHQ WKH JHQRPLF VWUXFWXUHV RI OLSR DQG OLSR ,, OHDYHV OLWWOH GRXEW RI WKHLU FRPPRQ DQFHVWU\ ,I RQH DVVXPHV WKDW WKH a ES RI QRQFRGLQJ VHTXHQFH

PAGE 38

LQGLFDWHG E\ SULPHU H[WHQVLRQf QRW LGHQWLILHG LQ WKH OLSR ,, JHQH PDNH XS LWV ILUVW H[RQ $PLJXHW HW DO 6DULV HW DO f WKHQ WKH WZR JHQRPLF VWUXFWXUHV DUH QHDUO\ LGHQWLFDO %RWK ZRXOG FRQVLVW RI H[RQV RI ZKLFK DUH H[DFWO\ WKH VDPH LQ OHQJWK 7KH VKDUHG JHQH VWUXFWXUH VXSSRUWV WKH HYROXWLRQ RI WKHVH WZR JHQHV IURP D FRPPRQ H[RQFRQWDLQLQJ DQFHVWUDO JHQH UDWKHU WKDQ WKH FRHYROXWLRQ RI WKH JHQHV IURP D GXSOLFDWLRQ RI DQ DQFHVWUDO UHSHDWn HQFRGLQJ H[RQ 7KLV WKHRU\ ZRXOG DOVR DFFRXQW IRU WKH RULJLQ RI FDOHOHFWULQS IURP D GXSOLFDWLRQ RI WKH H[RQ DQFHVWRU WR IRUP WKH HLJKWUHSHDW VWUXFWXUH RI S 7KH YHULILFDWLRQ RI WKLV K\SRWKHVLV PXVW DZDLW WKH FKDUDFWHUL]DWLRQ RI JHQH VWUXFWXUHV IRU WKH UHPDLQLQJ PHPEHUV RI WKH OLSRFRUWLQ IDPLO\ LQFOXGLQJ S 2I WKH SRWHQWLDO UHJXODWRU\ VHTXHQFHV LGHQWLILHG LQ WKH ES XSVWUHDP RI WKH WUDQVFULSWLRQ LQLWLDWLRQ VLWH WKH PRVW LQWHUHVWLQJ DUH WKH *5(V 'H[DPHWKDVRQH '(;f KDV EHHQ VKRZQ WR LQGXFH OLSR P51$ OHYHOV LQ VHYHUDO FHOO W\SHV 3KLOOLSV HW DO :DOOQHU HW DO :RQJ HW DO VXEPLWWHGf DOWKRXJK LW LV FOHDU WKDW WKLV UHVSRQVH GRHV QRW RFFXU LQ DOO FHOOV LQYHVWLJDWHG %LHQNRZVNL HW DO %URQQHJDUG HW DO +XOOLQ HW DO ,VDFNH HW DO 1RUWKXS HW DO :LOOLDP HW DO f :KHWKHU WKLV VSHFLILFLW\ LV GXH VROHO\ WR WKH SUHVHQFH RU DEVHQFH RI JOXFRFRUWLFRLG UHFHSWRUV RU LQYROYHV RWKHU IDFWRUV LV SUHVHQWO\ XQFOHDU (VSHFLDOO\ LQWULJXLQJ LV WKH UHJLRQ DW

PAGE 39

SRVLWLRQV WR ZKLFK UHVHPEOHV WKH GHOD\HG JOXFRFRUWLFRLG UHVSRQVH HOHPHQW V*5(f RI WKH UDW DOSKDX JOREXOLQ SURPRWHU $GGLVRQ DQG .XUW] f 7KLV ES UHJLRQ ZDV VKRZQ WR PHGLDWH LQGXFWLRQ RI WUDQVFULSWLRQ E\ '(; 7KLV LQGXFWLRQ XQOLNH WKRVH WHUPHG UDSLG SULPDU\ UHVSRQVHV UHTXLUHG SURWHLQ V\QWKHVLV $ UHVSRQVH ZKLFK LV EORFNHG E\ F\FORKH[LPLGH DQG XVXDOO\ VKRZV D ODJ EHWZHHQ DGPLQLVWUDWLRQ RI WKH KRUPRQH DQG LQLWLDWLRQ RI WKH UHVSRQVH KDV EHHQ FDOOHG DQ LQGLUHFW RU VHFRQGDU\ UHVSRQVH &KHQ DQG )HLJHOVRQ +HVV HW DO .OHLQ HW DO 3DHN DQG $[HO :LGPDQ DQG &KDVLQ f 7KH LQGXFWLRQ RI OLSR P51$ LQ WKH PRXVH SUHDGLSRF\WH OLQH 7/ E\ '(; ERWK H[KLELWV D ODJ WLPH RI DERXW WZR KU DQG LV EORFNHG E\ F\FORKH[LPLGH :RQJ HW DO VXEPLWWHGf 7KHUHIRUH LW LV SRVVLEOH WKDW WKH GHOD\HG UHVSRQVH WR '(; REVHUYHG LQ 7 / FHOOV LV PHGLDWHG E\ WKH SXWDWLYH V*5( LQ WKH OLSR SURPRWHU 2WKHU SRWHQWLDO UHJXODWRU\ VLWHV RI LQWHUHVW LQFOXGH WKH WZR VHUXP UHVSRQVHOLNH HOHPHQWV 'LIIHUHQW OLSR P51$ H[SUHVVLRQ OHYHOV ZHUH REVHUYHG LQ VHYHUDO WLVVXH FXOWXUH FHOOV GHSHQGLQJ RQ WKH SUHVHQFH RU DEVHQFH RI VHUXP +RUOLFN DQG : :RQJ XQSXEOLVKHG GDWDf ,Q DJUHHPHQW ZLWK WKLV WKH P51$ IRU OLSR ,, FDOSDFWLQ ,f ZDV VKRZQ WR EH LQGXFHG DV D SULPDU\ UHVSRQVH WR VHUXP VWLPXODWLRQ RI TXLHVFHQW $ FHOOV .HXW]HU DQG +LUVFKKRUQ f $OVR DV GRFXPHQWHG LQ &KDSWHU DQ LQGXFWLRQ RI OLSR P51$ LQ

PAGE 40

WKH UDW KHDUW DIWHU LQMHFWLRQ RI JOXFDJRQ ZDV REVHUYHG 6LQFH JOXFDJRQ DFWLRQ LV PHGLDWHG LQ PDQ\ FDVHV E\ LQFUHDVHG OHYHOV RI F$03 LW LV SRVVLEOH WKDW WKH F$03 UHVSRQVH HOHPHQW LGHQWLILHG LQ WKH OLSR SURPRWHU PHGLDWHV WKLV WLVVXHVSHFLILF UHVSRQVH ,Q VXSSRUW RI WKLV OLSR P51$ OHYHOV DUH DOWHUHG LQ 7/ FHOOV DIWHU WUHDWPHQW ZLWK PHWK\OLVREXW\O [DQWKLQH D SKRVSKRGLHVWHUDVH LQKLELWRU ZKLFK OHDGV WR LQFUHDVHG LQWUDFHOOXODU F$03 OHYHOV 3DUVRQV HW DO : :RQJ XQSXEOLVKHG GDWDf 2WKHU H[SHULPHQWV VKRZQ LQ &KDSWHU KRZHYHU GR QRW VXSSRUW D UROH IRU F$03 LQ WKH LQGXFWLRQ RI KHDUW OLSR P51$ E\ JOXFDJRQ ,Q FRQFOXVLRQ KDYH GHVFULEHG WKH JHQRPLF VWUXFWXUH RI PRXVH OLSR DQG FRPSDUHG LW WR WKH NQRZQ SRUWLRQ RI WKH OLSR ,, ORFXV 7KH WZR FORVHO\ UHODWHG JHQHV DUH XQOLQNHG DQG ORFDWHG RQ FKURPRVRPHV DQG UHVSHFWLYHO\ $PLJXHW HW DO +RUOLFN HW DO VXEPLWWHGf ,W ZLOO EH RI LQWHUHVW WR GHWHUPLQH ZKHWKHU WKH RWKHU PHPEHUV RI WKH OLSRFRUWLQ IDPLO\ VKRZ D VLPLODU LQWURQH[RQ RUJDQL]DWLRQ IXUWKHU LPSOLFDWLQJ D FRPPRQ JHQH DQFHVWRU ZKLFK JDYH ULVH WR WKHVH SURWHLQV

PAGE 41

&+$37(5 5(*8/$7,21 2) /,32&257,1 ,1 5$7 0$00$5< 7,668( '85,1* */$1'8/$5 ',))(5(17,$7,21 $1' ,192/87,21 ,QWURGXFWLRQ 7KH PDPPDU\ JODQG LQ ERWK KXPDQV DQG URGHQWV LV D FRPSOH[ WLVVXH H[KLELWLQJ GUDPDWLF PRUSKRORJLF DQG IXQFWLRQDO FKDQJHV GXULQJ SUHJQDQF\ DQG ODFWDWLRQ LQ IHPDOHV %RUHOOLQL DQG 2ND +ROOPDQQ 7RSSHU DQG )UHHPDQ f 7KH JODQG FRQVLVWV RI VHYHUDO FHOO W\SHV LQFOXGLQJ IDW FHOOV HSLWKHOLDO FHOOV DQG P\RHSLWKHOLDO FHOOV ZKRVH QXPEHU DQG PRUSKRORJ\ FKDQJH DFFRUGLQJ WR GHYHORSPHQWDO VWDWXV 'XULQJ VH[XDO PDWXUDWLRQ HSLWKHOLDO FHOOV JURZ H[WHQVLYHO\ WR IRUP WKH WUHHVKDSHG GXFWDO V\VWHP FKDUDFWHULVWLF RI PDPPDU\ WLVVXH 8SRQ VH[XDO PDWXUDWLRQ WKLV GXFWDO GHYHORSPHQW VWRSV HYHQ WKRXJK WKH PDMRU KRUPRQDO VWLPXOL IRU JURZWK DUH VWLOO SUHVHQW $W WKLV VWDJH WKH HSLWKHOLDO FHOOV DUH GRUPDQW DUUHVWHG LQ WKH SKDVH RI WKH FHOO F\FOH 3UHJQDQF\ FDXVHV KRUPRQDO FKDQJHV ZKLFK UHOLHYH PDPPDU\ HSLWKHOLDO FHOOV RI JURZWK FRQVWUDLQWV DQG FRQVHTXHQWO\ FHOO UHSOLFDWLRQ UHVXPHV LQ WKH ILUVW KDOI RI SUHJQDQF\ ,Q PLGGOH WR ODWH SUHJQDQF\ HSLWKHOLDO SUROLIHUDWLRQ FRQWLQXHV DQG GLIIHUHQWLDWLRQ LQWR VHFUHWRU\ FHOOV RU DOYHROL WDNHV SODFH $V WHUP DSSURDFKHV DOYHROL

PAGE 42

EHJLQ WR DFFXPXODWH VHFUHWRU\ SURGXFWV DQG LQFUHDVH F\WRSODVPLF VL]H ,Q WKH ODFWDWLQJ JODQG VHFUHWRU\ FHOOV DUH KLJKO\ SRODUL]HG ZLWK UHVSHFW WR ERWK PRUSKRORJ\ DQG IXQFWLRQ $ ODUJH SDUW RI WKH F\WRSODVP LV RFFXSLHG E\ URXJK HQGRSODVPLF UHWLFXOXP DQG D ZHOOGHYHORSHG *ROJL DSSDUDWXV LV ORFDWHG LQ WKH DSLFDO UHJLRQ $OYHROL PDQXIDFWXUH DQG VHFUHWH ODUJH TXDQWLWLHV RI SURWHLQ IDW DQG FDUERK\GUDWH $V VXFNOLQJ GHFUHDVHV GXULQJ QDWXUDO ZHDQLQJ LQYROXWLRQ RI WKH JODQG EHJLQV $W WKLV WLPH VHFUHWRU\ DOYHROL GHYHORS ODUJH YDFXROHV FRQWDLQLQJ FDVHLQ PLFHOOHV DQG ODUJH IDW GURSOHWV $V ZHDQLQJ SURJUHVVHV WKHVH YDFXROHV IXVH ZLWK K\GURO\WLF O\VRVRPHV OHDGLQJ WR DXWRSKDJ\ 7KH PDMRULW\ RI HSLWKHOLD DUH GHVWUR\HG EXW VRPH VXUYLYH WR EHFRPH UHVWLQJ FHOOV OLNH WKRVH LQ WKH PDWXUH YLUJLQ JODQG ZKLFK ZLOO SUROLIHUDWH DQG GLIIHUHQWLDWH XSRQ WKH QH[W SUHJQDQF\ 7KH KRUPRQDO GHWHUPLQDQWV RI PDPPDU\ JODQG GHYHORSPHQW DUH FRPSOH[ DQG EH\RQG WKH VFRSH RI WKLV LQWURGXFWLRQ 7KH\ LQFOXGH LQVXOLQ FRUWLVRO SURODFWLQ HVWURJHQ HSLGHUPDO JURZWK IDFWRU WUDQVIRUPLQJ JURZWK IDFWRU EHWD WK\URLG KRUPRQHV UHWLQRLGV DQG YLWDPLQ %RUHOOLQL DQG 2ND f ,Q DGGLWLRQ RWKHU IDFWRUV DIIHFWLQJ PDPPDU\ JURZWK LQFOXGH FDOFLXP SRO\DPLQHV DQG SRO\$'3ULERVHf $ OLSR ,OLNH JHQH ZDV VWXGLHG LQ WKH SLJHRQ FURSVDF DQ RUJDQ ZKLFK GLVSOD\V WKH VDPH KRUPRQDO VSHFLILFLW\ DV WKH

PAGE 43

PDPPDU\ JODQG EXW LV VXEVWDQWLDOO\ VLPSOHU +RUVHPDQ 3XNDF DQG +RUVHPDQ f ,Q WKH FURSVDF D KRPRJHQRXV SRSXODWLRQ RI SVHXGRVWUDWLILHG VTXDPRXV HSLWKHOLD SUROLIHUDWHV DQG GLIIHUHQWLDWHV DIWHU SURODFWLQ WUHDWPHQW $V PHQWLRQHG DERYH SURODFWLQ LV YHU\ LPSRUWDQW LQ HVWDEOLVKLQJ DQG PDLQWDLQLQJ ODFWDWLRQ LQ WKH PDPPDU\ JODQG 7KH GLIIHUHQWLDWHG HSLWKHOLD RI WKH FURSVDF V\QWKHVL]H DQG VWRUH ODUJH DPRXQWV RI OLSRSURWHLQ JOREXOHV ZKLFK DUH XVHG WR QRXULVK RIIVSULQJ 6HYHUDO JHQHV ZKLFK ZHUH LQGXFHG LQ WKH FURSVDF DIWHU LQWUDGHUPDO LQMHFWLRQ RI SURODFWLQ ZHUH FORQHG DQG FKDUDFWHUL]HG 3XNDF DQG +RUVHPDQ f 7KH P51$ IRU WKH PDMRU SURODFWLQLQGXFHG JHQH ZDV VWLPXODWHG DV HDUO\ DV WKUHH KU DIWHU LQMHFWLRQ RI WKH KRUPRQH DQG SHDNHG DW OHYHOV DERXW IROG KLJKHU WKDQ EHIRUH LQMHFWLRQ 7KLV P51$ HQFRGHG D SRO\SHSWLGH RI PROHFXODU ZHLJKW :KHQ WKH QXFOHRWLGH VHTXHQFH RI WKLV SURODFWLQLQGXFHG F'1$ ZDV GHWHUPLQHG LW ZDV IRXQG WR EH KLJKO\ VLPLODU WR WKDW RI PDPPDOLDQ OLSR +RUVHPDQ f 7KH RQO\ UHJLRQ RI VXEVWDQWLDO VHTXHQFH GLIIHUHQFH ZDV D GRPDLQ LQ PDPPDOLDQ OLSR HQFRGLQJ DPLQR DFLGV LQFOXGLQJ D W\URVLQH SKRVSKRU\ODWLRQ VLWH DQG RWKHU UHVLGXHV EHOLHYHG WR EH SK\VLRORJLFDOO\ LPSRUWDQW ,W ZDV FRQFOXGHG WKDW OLSRFRUWLQV PLJKW EH UHJXODWHG E\ SURODFWLQ LQ RWKHU WLVVXHV DQG WKDW WKH GLIIHUHQFH LQ VHTXHQFH QHDU WKH 1 WHUPLQL RI PDPPDOLDQ DQG DYLDQ OLSRFRUWLQV PLJKW UHSUHVHQW D GLYHUJHQFH \LHOGLQJ GLIIHUHQW UHJXODWRU\ PHFKDQLVPV

PAGE 44

/R]DQR HW DO Ef VWXGLHG VHYHUDO PDPPDU\ JODQG FDOFLXPELQGLQJ SURWHLQV LQ WKH PRXVH PDPPDU\ JODQG GXULQJ GHYHORSPHQW 6RPH RI WKHVH SURWHLQV KDG SUHYLRXVO\ EHHQ LGHQWLILHG DV FDOHOHFWULQV DQG FDOSDFWLQ ,OLSRFRUWLQ ,, +RUQ HW DO f ,W ZDV IRXQG WKDW WKH PDPPDU\ JODQG FDOFLXPELQGLQJ SURWHLQV ZHUH GHYHORSPHQWDOO\ UHJXODWHG 7KH\ ZHUH SUHVHQW LQ ODUJH DPRXQWV LQ WKH PDWXUH YLUJLQ JODQG EXW ZHUH YLUWXDOO\ DEVHQW LQ WKH ODFWDWLQJ JODQG ,PPXQRORFDOL]DWLRQ UHYHDOHG WKDW GXFWDO HSLWKHOLDO FHOOV LQ WKH YLUJLQ JODQG ZHUH ULFK LQ FDOHOHFWULQV DQG FDOSDFWLQ ZKLOH P\RHSLWKHOLD GLG QRW FRQWDLQ WKHP 7KH VHFUHWRU\ DOYHRODU HSLWKHOLDO FHOOV RI WKH ODFWDWLQJ JODQG LQ FRQWUDVW WR HSLWKHOLD IURP WKH YLUJLQ JODQG ZHUH HVVHQWLDOO\ GHYRLG RI WKHVH SURWHLQV %DVHG RQ WKHVH UHVXOWV WKH DXWKRUV VHULRXVO\ TXHVWLRQHG D UROH IRU FDOHOHFWULQ DQG FDOSDFWLQ LQ FDVHLQ H[RF\WRVLV 7KH\ SUHYLRXVO\ KDG SURSRVHG WKDW WKHVH FDOFLXP ELQGLQJ SURWHLQV PLJKW EH LQYROYHG LQ HSLWKHOLDO FHOO VSUHDGLQJ LQFOXGLQJ FHOO PRWLOLW\ RU FHOO VKDSH FKDQJHV %UDVODX HW DO 5RFKD HW DO f 7KLV FKDSWHU VKRZV VWXGLHV GHVLJQHG WR LQYHVWLJDWH OLSR P51$ DQG SURWHLQ H[SUHVVLRQ LQ WKH UDW PDPPDU\ JODQG GXULQJ QDWXUDO GLIIHUHQWLDWLRQ DQG LQYROXWLRQ DV ZHOO DV DIWHU SUHPDWXUH WHUPLQDWLRQ RI ODFWDWLRQ E\ SXS UHPRYDO 6LQFH WZR RWKHU DQQH[LQV ZHUH VKRZQ WR EH GHYHORSPHQWDOO\ UHJXODWHG LQ WKH PRXVH PDPPDU\ JODQG DV GHVFULEHG DERYH LW

PAGE 45

ZRXOG EH LPSRUWDQW WR GHWHUPLQH LI OLSR ZRXOG H[KLELW UHJXODWLRQ LQ PDPPDU\ WLVVXH $QRWKHU TXHVWLRQ WKHVH VWXGLHV DGGUHVV LV ZKHWKHU RU QRW PDPPDOLDQ OLSR PLJKW EH LQGXFHG E\ SURODFWLQ VLPLODU WR WKH OLSR ,OLNH SLJHRQ JHQH LQ WKH FURSVDF 7KH SURILOH RI SURODFWLQ H[SUHVVLRQ LQ WKH UDW GXULQJ SUHJQDQF\ DQG ODFWDWLRQ LV NQRZQ DQG FRXOG EH FRPSDUHG WR H[SUHVVLRQ RI OLSR 7KH UHVXOWV GHVFULEHG LQ WKLV FKDSWHU LQGLFDWH WKDW ERWK OLSR P51$ DQG SURWHLQ OHYHOV VKRZ VWULNLQJ DOWHUDWLRQV LQ WKH PDPPDU\ JODQG RI GDPV GXULQJ QRUPDO GLIIHUHQWLDWLRQ DQG LQYROXWLRQ DV ZHOO DV IROORZLQJ SUHPDWXUH SXS UHPRYDO ,Q FRQWUDVW WR WKH SLJHRQ OLSR OLNH JHQH UDW PDPPDU\ OLSR GRHV QRW DSSHDU WR EH LQGXFHG E\ SURODFWLQ DQG LV LQ IDFW LQYHUVHO\ UHODWHG WR SUHGLFWHG SURODFWLQ OHYHOV 0DWHULDOV DQG 0HWKRGV $QLPDOV 7LPHGSUHJQDQW 6SUDJXH'DZOH\ UDWV ZHUH REWDLQHG IURP &KDUOHV 5LYHU /DERUDWRULHV 51$ ,VRODWLRQ 7RWDO 51$ ZDV LVRODWHG E\ KRPRJHQL]LQJ WLVVXHV LQ D JXDQLGLQLXP WKLRF\DQDWHVDUFRV\O VROXWLRQ IROORZHG E\ DFLG SKHQROFKORURIRUP H[WUDFWLRQ DQG HWKDQRO SUHFLSLWDWLRQ DV GHVFULEHG SUHYLRXVO\ &KRPF]\QVNL DQG 6DFFKL f 7\SLFDOO\ DERXW J RI WLVVXH ZDV O\VHG LQ PO RI WKLRF\DQDWH VROXWLRQ FRQWDLQLQJ 0 JXDQLGLQH WKLRF\DQDWH

PAGE 46

P0 VRGLXP FLWUDWH S+ f b VDUFRV\O P0 PHUFDSWRHWKDQRO 7R WKLV VROXWLRQ LO RI 0 VRGLXP DFHWDWH S+ f PO RI +]2VDWXUDWHG SKHQRO DQG PO RI FKORURIRUPLVRDP\O DOFRKRO f ZHUH DGGHG LQ VWHSZLVH IDVKLRQ 7KH PL[WXUH ZDV FHQWULIXJHG DW [ J IRU PLQ WR VHSDUDWH SKDVHV 7KH DJXHRXV SKDVH ZDV PL[HG ZLWK PO RI LVRSURSDQRO DQG WRWDO 51$ SUHFLSLWDWHG E\ LQFXEDWLQJ WKH PL[WXUH DW r& IRU DW OHDVW KU IROORZHG E\ FHQWULIXJDWLRQ DW [ J IRU PLQ 7KH 51$ SHOOHW ZDV WKHQ UHVXVSHQGHG LQ LO RI JXDQLGLQH WKLRF\DQDWH VROXWLRQ DQG IXUWKHU SXULILHG E\ LVRSURSDQRO DQG HWKDQRO SUHFLSLWDWLRQ 1RUWKHUQ $QDO\VLV $Q DOLJXRW RI LJ WRWDO 51$ ZDV ORDGHG RQ D b 0236 1PRUSKROLQRf SURSDQHVXOSKRQLF DFLGfIRUPDOGHK\GH DJDURVH JHO DV GHVFULEHG SUHYLRXVO\ 6DPEURRN HW DO f 7KH JHO ZDV UXQ IRU KU DW YROWV ZLWK FRQVWDQW EXIIHU UHFLUFXODWLRQ 7KH JHO ZDV WKHQ VXEMHFWHG WR WKUHH PLQ ZDVKHV ZLWK ZDWHU RQH PLQ ZDVK LQ 1 1D2+ DQG 0 1D&O RQH PLQ ZDVK LQ 0 7ULV+&O S+ f DQG D PLQ ZDVK LQ D VROXWLRQ FRQWDLQLQJ 0 7ULVERUDWH 0 ERULF DFLG DQG 0 ('7$ S+ 7KH 51$ ZDV HOHFWURSKRUHWLFDOO\ WUDQVIHUUHG IURP WKH JHO WR D QRQFKDUJHG Q\ORQ PHPEUDQH *HQH6FUHHQ 1(1f IRU KU 7KH 51$ ZDV LPPRELOL]HG RQ WKH PHPEUDQH E\ FURVVOLQNLQJ ZLWK 89 OLJKW &KXUFK DQG *LOEHUW f DQG DQDO\]HG ZLWK D VSHFLILF UDGLRODEHOHG SUREH

PAGE 47

3UREH 6\QWKHVLV $ PRXVH OLSRFRUWLQ F'1$ SURYLGHG E\ :LOOLDP :RQJ RI WKLV ODERUDWRU\ D UDW &X=Q VXSHUR[LGH GLVPXWDVH F'1$ SURYLGHG E\ -DQ/LQJ +VX RI WKLV ODERUDWRU\ DQG D PRXVH KLVWRQH + F'1$ 6HLOHU7X\QV DQG %LUQVWLHO f ZHUH XVHG DV SUREHV 3UREHV ODEHOOHG ZLWK D3 G$73 1(1 X&LPPROf ZHUH V\QWKHVL]HG HLWKHU E\ UDQGRP SULPHU H[WHQVLRQ DV GHVFULEHG LQ &KDSWHU RU E\ DQ 0 VLQJOH VWUDQGHG SUREH V\QWKHVLV PHWKRG XVLQJ DQ 0PSO FORQH FRQWDLQLQJ WKH PRXVH OLSR F'1$ LQVHUW LQ WKH DSSURSULDWH RULHQWDWLRQ WR SURGXFH D SUREH FRPSOHPHQWDU\ WR P51$ &KXUFK DQG *LOEHUW f +\EULGL]DWLRQ ZDV FDUULHG RXW DV GHVFULEHG LQ &KDSWHU :HVWHUQ $QDO\VLV 0DPPDU\ WLVVXH ZDV ZHLJKHG DQG KRPRJHQL]HG LQ PO RI P0 7ULV+&O S+ f P0 ('7$ P0 VXFURVH VXSSOHPHQWHG ZLWK b DSURWLQLQ $ SRO\WURQ ZDV XVHG IRU KRPRJHQL]DWLRQ WZR WLPHV DW KDOIPD[LPDO VSHHG IRU VHF HDFKf $IWHU WKH VXVSHQVLRQ ZDV VSXQ DW ; J IRU PLQ DW r& D 0DUNZHOO SURWHLQ DVVD\ ZDV SHUIRUPHG RQ WKH VXSHUQDWDQW QT RI WRWDO SURWHLQ ZDV UXQ RQ D b SRO\DFU\ODPLGH UHGXFLQJ JHO DQG WUDQVIHUUHG WR QLWURFHOOXORVH 7KH PHPEUDQH ZDV EORFNHG IRU KU XVLQJ P0 7ULV+&O S+ f 0 1D&O 7%6f VXSSOHPHQWHG ZLWK b %6$ DQG b 7ZHHQ DQG LQFXEDWHG IRU KU DW r& ZLWK DQ DQWLOLSRFRUWLQ DQWLERG\ +XDQJ HW DO f DW

PAGE 48

GLOXWLRQ LQ b %6$7%6 7KH PHPEUDQH ZDV ZDVKHG IRU KU ZLWK b %6$7%6 DQG WKHQ LQFXEDWHG ZLWK ; FSP RI UHn ODEHOHG SURWHLQ $ IRU KU $IWHU WKUHH PLQ ZDVKHV LQ PO 7%6 WKH PHPEUDQH ZDV DLUGULHG DQG H[SRVHG IRU GD\V WR .RGDN ;20$7 ILOP 5HVXOWV 7R LQYHVWLJDWH OLSR P51$ OHYHOV LQ WKH UDW PDPPDU\ JODQG GXULQJ GLIIHUHQWLDWLRQ DQG LQYROXWLRQ FDUULHG RXW 1RUWKHUQ DQDO\VLV XVLQJ D PRXVH OLSR F'1$ SUREH )LJ f 0HVVHQJHU 51$ OHYHOV IURP PDWXUH YLUJLQ DQLPDOV ZHUH FRPSDUHG ZLWK WKRVH IURP DQLPDOV ZKLFK ZHUH HLWKHU SUHJQDQW ODFWDWLQJ RU ZHDQHG 7KH P51$ ZDV YHU\ DEXQGDQW LQ WKH QRQSUHJQDQW VWDWH $W PLGSUHJQDQF\ D ODUJH GHFOLQH ZDV REVHUYHG FRUUHVSRQGLQJ WR WKH WLPH ZKHQ HSLWKHOLDO FHOOV SUROLIHUDWH DQG GLIIHUHQWLDWH 7RSSHU DQG )UHHPDQ f %\ GD\ RI SUHJQDQF\ GD\V EHIRUH ELUWKf P51$ OHYHOV GHFUHDVHG DW OHDVW IROG DV FRPSDUHG WR YLUJLQ DQLPDOV $W ELUWK D VPDOO EXW UHSURGXFLEOH LQFUHDVH RFFXUV :LWK WKH RQVHW RI ODFWDWLRQ OLSR P51$ ZDV XQGHWHFWDEOH DQG UHPDLQHG VR IRU WKH UHPDLQGHU RI WKH VXFNOLQJ SHULRG $IWHU ZHDQLQJ KDG RFFXUUHG GD\V IROORZLQJ ELUWKf WKH P51$ URVH WR OHYHOV FRPSDUDEOH WR WKRVH VHHQ LQ YLUJLQ DQLPDOV 7R LOOXVWUDWH WKH WLPH GXULQJ SUHJQDQF\ ZKHQ HSLWKHOLDO FHOOV EHJLQ SUROLIHUDWLQJ DOVR GHWHUPLQHG KLVWRQH + P51$ OHYHOV ZKLFK LQFUHDVH GXULQJ '1$ V\QWKHVLV DQG FHOO SUROLIHUDWLRQ 6HLOHU7X\QV DQG %LUQVWLHO f $ ULVH LQ

PAGE 49

35(*1$17 /$&7$7,1* 13 % : )LJXUH 5HJXODWLRQ RI PDPPDU\ OLSRFRUWLQ P51$ GXULQJ SUHJQDQF\ ODFWDWLRQ DQG LQYROXWLRQ 7RWDO 51$ ZDV LVRODWHG IURP PDPPDU\ WLVVXH RI IHPDOH UDWV ZKLFK ZHUH PDWXUH YLUJLQV 13f SUHJQDQW IRU YDULRXV OHQJWKV RI WLPH GD\Vf KDG MXVW JLYHQ ELUWK %f KDG VXFNOHG SXSV IRU YDULRXV OHQJWKV RI WLPH GD\Vf RU DIWHU ZHDQLQJ : GD\V DIWHU ELUWKf %LUWK XVXDOO\ RFFXUV RQ GD\ 1RUWKHUQ EORW DQDO\VLV ZDV FDUULHG RXW ZLWK D F'1$ SUREH IRU PRXVH OLSRFRUWLQ WKHQ WKH EORW ZDV VWULSSHG DQG UHSUREHG ZLWK PRXVH KLVWRQH + DQG UDW FRSSHU]LQF VXSHUR[LGH GLVPXWDVH 62'f F'1$V

PAGE 50

KLVWRQH + LV DSSDUHQW DW GD\ RI SUHJQDQF\ ZKHQ PDPPDU\ HSLWKHOLDO FHOOV EHJLQ SUROLIHUDWLRQ DQG GLIIHUHQWLDWLRQ DQG DOVR DIWHU ZHDQLQJ GXULQJ JODQGXODU LQYROXWLRQ &RSSHU]LQF VXSHUR[LGH GLVPXWDVH P51$ OHYHOV DUH LOOXVWUDWHG DV DQ LQWHUQDO FRQWURO DQG VKRZ RQO\ D VPDOO YDULDWLRQ RYHU WKH VDPH WLPH FRXUVH )LJXUH IRFXVHV RQ WKH GHFUHDVH LQ VWHDG\VWDWH OLSR P51$ OHYHOV LQ PDPPDU\ WLVVXH RI GDPV IROORZLQJ WKH VWDUW RI VXFNOLQJ 7ZR DQLPDOV DUH VKRZQ WR GHPRQVWUDWH UHSURGXFLELOLW\ 7KH GHFOLQH LQ OLSR P51$ FDQ EH FRPSDUHG WR OHYHOV RI FRSSHU]LQF VXSHUR[LGH GLVPXWDVH ZKLFK UHPDLQ UHODWLYHO\ FRQVWDQW GXULQJ WKH H[SHULPHQW 7R LQYHVWLJDWH ZKHWKHU WKH OLSR SURWHLQ IROORZHG D VLPLODU H[SUHVVLRQ SDWWHUQ H[WUDFWHG PDPPDU\ WLVVXH SURWHLQV ZHUH DQDO\]HG E\ LPPXQREORWWLQJ )LJ f $OVR VKRZQ DUH PDPPDU\ OLSR P51$ OHYHOV IURP WKH VDPH DQLPDOV 7KH OLSR ,VSHFLILF DQWLERG\ UHYHDOHG DEXQGDQW OHYHOV RI OLSR SURWHLQ LQ WKH YLUJLQ UDW JODQG /LNH WKH P51$ WKH SURWHLQ GHFOLQHG GXULQJ SUHJQDQF\ ZDV QHDUO\ XQGHWHFWHG GXULQJ ODFWDWLRQ DQG LQFUHDVHG DW ZHDQLQJ 'HQVLWRPHWULF DQDO\VLV RI SURWHLQ DQG P51$ OHYHOV VKRZV D FORVH FRUUHVSRQGHQFH EHWZHHQ WKH WZR )LJ f 6LQFH WKH OLSR P51$ LQFUHDVHG UDSLGO\ XSRQ ZHDQLQJ WKH UROH RI WKH VXFNOLQJ VWLPXOXV LQ OLSR UHJXODWLRQ ZDV LQYHVWLJDWHG 0HVVHQJHU 51$ OHYHOV ZHUH GHWHUPLQHG LQ PDPPDU\ WLVVXH RI GDPV ZKLFK KDG SXSV ZLWKGUDZQ DW ELUWK

PAGE 51

&X=Q 622 )LJXUH 'HFUHDVH LQ PDPPDU\ OLSRFRUWLQ P51$ OHYHOV ZLWK WKH RQVHW RI ODFWDWLRQ 7RWDO 51$ ZDV LVRODWHG IURP PDPPDU\ WLVVXH RI DQLPDOV ZKLFK KDG MXVW JLYHQ ELUWK RU KDG VXFNOHG SXSV IRU RQH WZR RU WKUHH GD\V (DFK GHWHUPLQDWLRQ ZDV SHUIRUPHG LQ GXSOLFDWH 1RUWKHUQ DQDOVLV ZDV FDUULHG RXW XVLQJ PRXVH OLSRFRUWLQ DQG UDW &X=Q 62' F'1$ SUREHV

PAGE 52

P51$ SURWHLQ )LJXUH 5HJXODWLRQ RI OLSRFRUWLQ P51$ DQG SURWHLQ OHYHOV LQ UDW PDPPDU\ WLVVXH GXULQJ JODQGXODU GLIIHUHQWLDWLRQ DQG LQYROXWLRQ 7RWDO 51$ DQG SURWHLQ ZHUH LVRODWHG IURP PDPPDU\ WLVVXH RI UDWV DV GHVFULEHG LQ )LJXUH 3 SUHJQDQW / ODFWDWLQJ 1RUWKHUQ DQDO\VLV DQG LPPXQREORWWLQJ ZHUH WKHQ FDUULHG RXW XVLQJ D PRXVH OLSRFRUWLQ F'1$ SUREH DQG DQWLOLSRFRUWLQ DQWLERG\ UHVSHFWLYHO\

PAGE 53

)LJXUH 'HQVLWRPHWULF DQDO\VLV RI WKH GDWD LQ )LJXUH $ %LR ,PDJH 9LVDJH LPDJH SURFHVVRU ZDV XVHG IRU TXDQWLWDWLRQ RI OLSRFRUWLQ P51$ DQG SURWHLQ OHYHOV LQ )LJXUH

PAGE 54

)LJXUH VKRZV WKDW DV HDUO\ DV RQH GD\ DIWHU SXSV ZHUH UHPRYHG OLSR P51$ OHYHOV GUDPDWLFDOO\ LQFUHDVHG RYHU WKH OHYHO DW ELUWK $FWLQ P51$ URVH WR D OHVVHU GHJUHH ZKLOH OHYHOV RI FRSSHU]LQF VXSHUR[LGH GLVPXWDVH P51$ ZHUH UHODWLYHO\ FRQVWDQW GXULQJ WKH H[SHULPHQW 7R IXUWKHU LQYHVWLJDWH WKH UROH RI WKH VXFNOLQJ VWLPXOXV OLSR P51$ OHYHOV ZHUH DQDO\]HG LQ PDPPDU\ WLVVXH RI GDPV IROORZLQJ SXS ZLWKGUDZDO DW ELUWK DQG DIWHU VHYHQ GD\V RI VXFNOLQJ )LJ f $OVR WLPH SRLQWV SULRU WR KU DIWHU ZLWKGUDZDO ZHUH H[DPLQHG LQ RUGHU WR GHWHUPLQH KRZ IDVW WKH LQGXFWLRQ RI OLSR P51$ ZDV ,I SXSV DUH UHPRYHG DW ELUWK FRPSOHWHO\ SUHYHQWLQJ WKH VXFNOLQJ VWLPXOXV PDPPDU\ OLSR P51$ OHYHOV LQFUHDVHG VLJQLILFDQWO\ LQ WKH GDPV DV HDUO\ DV KU DIWHU UHPRYDO UHDFKLQJ D SODWHDX E\ KU ,I SXSV ZHUH ZLWKGUDZQ DIWHU VHYHQ GD\V RI VXFNOLQJ WKH LQFUHDVH LQ OLSR P51$ ZDV GHOD\HG E\ VHYHUDO KRXUV DQG SHDNHG E\ KU ,Q FRQWUDVW OLSR SURWHLQ OHYHOV ZHUH ORZ WR XQGHWHFWDEOH IRU PRUH WKDQ KU DIWHU SXSV ZHUH UHPRYHG HLWKHU DW ELUWK RU DIWHU VHYHQ GD\V RI VXFNOLQJ EXW E\ ILYH GD\V DIWHU UHPRYDO WKH SURWHLQ KDG UHDFKHG PD[LPDO OHYHOV 7R H[DPLQH WKH VSHFLILFLW\ RI OLSR UHJXODWLRQ IROORZLQJ SXS ZLWKGUDZDO OLSR P51$ OHYHOV ZHUH QH[W PHDVXUHG LQ WKH PDPPDU\ JODQG DQG VHYHUDO RWKHU WLVVXHV IURP DQLPDOV ZKRVH SXSV ZHUH ZLWKGUDZQ GD\V IROORZLQJ ELUWK )LJ f 7KLV H[SHULPHQW GHPRQVWUDWHG WKDW OLSR P51$

PAGE 55

)LJXUH 7KH UROH RI WKH VXFNOLQJ VWLPXOXV GLUHFWO\ DIWHU ELUWK RQ OLSRFRUWLQ P51$ OHYHOV LQ PDPPDU\ WLVVXH 3XSV ZHUH UHPRYHG DW ELUWK DQG WRWDO 51$ ZDV LVRODWHG IURP PDPPDU\ WLVVXH RI GDPV DW DQG GD\V IROORZLQJ SXS ZLWKGUDZDO 1RUWKHUQ EORW DQDO\VLV ZDV GRQH XVLQJ OLSRFRUWLQ DFWLQ DQG &X=Q 62' F'1$ SUREHV DV GHVFULEHG SUHYLRXVO\

PAGE 56

L SXSV UHPRYHG DW %LUWK GD\V WLPH DIWHU UHPRYDO G G )LJXUH ,QGXFWLRQ RI OLSRFRUWLQ P51$ DQG SURWHLQ H[SUHVVLRQ LQ PDPPDU\ WLVVXH RI GDPV IROORZLQJ SXS UHPRYDO DW ELUWK RU GD\ VHYHQ RI VXFNOLQJ 3XSV ZHUH UHPRYHG IURP WKH GDPV DW ELUWK RU IROORZLQJ VHYHQ GD\V RI VXFNOLQJ DQG WRWDO 51$ DQG SURWHLQ ZHUH LVRODWHG IURP PDPPDU\ WLVVXH RI GDPV DW DQG KU GD\V IROORZLQJ SXS ZLWKGUDZDO 1RUWKHUQ DQDO\VLV DQG LPPXQREORWWLQJ ZHUH FDUULHG RXW DV GHVFULEHG LQ WKH OHJHQG WR )LJXUH

PAGE 57

WLPH DIWHU UHPRYDO 0DPPDU\ WLVVXH .LGQH\ 0XVFOH )LJXUH 6SHFLILFLW\ RI WKH PDPPDU\ OLSRFRUWLQ P51$ UHJXODWLRQ IROORZLQJ SXS ZLWKGUDZDO 7RWDO 51$ ZDV LVRODWHG IURP YDULRXV WLVVXHV RI GDPV ZKRVH SXSV ZHUH UHPRYHG IROORZLQJ GD\V RI VXFNOLQJ 51$ ZDV SUHSDUHG DQG KU GD\V DIWHU SXS ZLWKGUDZDO 1RUWKHUQ DQDO\VLV ZDV GRQH XVLQJ D PRXVH OLSRFRUWLQ F'1$ SUREH

PAGE 58

OHYHOV ZHUH FRQVWDQW LQ WKH KHDUW NLGQH\ DQG KLQGOHJ PXVFOH RI GDPV ZKLOH WKHUH ZDV D VLJQLILFDQW ULVH LQ PDPPDU\ WLVVXH H[SUHVVLRQ RYHU WKH ILYHGD\ ZLWKGUDZDO SHULRG 7KXV WKH UHJXODWLRQ RI OLSR P51$ LQ WKH PDPPDU\ JODQG DIWHU SXS UHPRYDO ZDV D WLVVXHVSHFLILF SKHQRPHQRQ 7KH LQFUHDVH LQ OLSR P51$ OHYHOV RYHU WKH ILYHGD\ SHULRG IROORZLQJ SXS ZLWKGUDZDO VKRZQ LQ )LJ DQG ZDV EHWZHHQ DQG IROG )LJ f 'LVFXVVLRQ ,W LV OLNHO\ WKDW KRUPRQDO FKDQJHV GXULQJ SUHJQDQF\ DQG ODFWDWLRQ LQIOXHQFH WKH SDWWHUQ RI PDPPDU\ OLSR P51$ DQG SURWHLQ H[SUHVVLRQ %DVHG RQ WKH DZDUHQHVV RI D SURODFWLQ LQGXFLEOH OLSR ,OLNH JHQH LQ WKH SLJHRQ FURSVDF H[SORUHG WKH HIIHFWV RI SURODFWLQ RQ PDPPDOLDQ OLSR JHQH H[SUHVVLRQ 7KHVH H[SHULPHQWV LQYROYHG WKH XVH RI WKH PLGSUHJQDQF\GHULYHG PDPPDU\ HSLWKHOLDO FHOO OLQH +& ZKLFK KDG EHHQ FORQDOO\ VHOHFWHG IRU LWV UHVSRQVLYHQHVV WR SURODFWLQ %DOO HW DO f 7UHDWPHQW RI WKHVH FHOOV ZLWK SURODFWLQ KRZHYHU FDXVHG QR FKDQJH LQ OLSR P51$ H[SUHVVLRQ ZKLFK ZDV DOVR WKH FDVH ZKHQ PDPPDU\ H[SODQWV ZHUH WUHDWHG ZLWK SURODFWLQ LQ FXOWXUH GDWD QRW VKRZQf )XUWKHUPRUH LQ WKH UDW FLUFXODWLQJ OHYHOV RI SURODFWLQ DUH ORZ XQWLO RQH GD\ EHIRUH ELUWK ZKHQ WKH\ ULVH GUDPDWLFDOO\ 5RVHQEODWW HW DO f 3URODFWLQ OHYHOV UHPDLQ KLJK GXULQJ VXFNOLQJ DQG JUDGXDOO\ GHFOLQH DV ZHDQLQJ DSSURDFKHV ,Q FRQWUDVW OLSR P51$ DQG SURWHLQ OHYHOV DUH KLJK LQ WKH

PAGE 59

),*85( 'HQVLWRPHWULF DQDO\VLV RI WKH LQFUHDVH LQ OLSRFRUWLQ LQ51$ OHYHOV IROORZLQJ SXS ZLWKGUDZDO 4XDQWLWDWLRQ RI WKH P51$ GDWD LQ )LJXUHV DQG ZDV GRQH XVLQJ D %LR ,PDJH 9LVDJH LPDJH SURFHVVRU 7KH ILUVW ILYH EDUV RSHQf UHSUHVHQW SXS UHPRYDO DW ELUWK DQG VKRZ D IROG P51$ LQFUHDVH IURP ELUWK WR ILYH GD\V DIWHU SXS UHPRYDO 7KH QH[W ILYH EDUV GLDJRQDO OLQHVf UHSUHVHQW SXS UHPRYDO DIWHU VHYHQ GD\V RI VXFNOLQJ DQG H[KLELW D IROG P51$ LQFUHDVH RYHU WKH ILYHGD\ SHULRG DIWHU SXS ZLWKGUDZDO 7KH ODVW ILYH EDUV ;nVf ZKLFK UHSUHVHQW SXS UHPRYDO DIWHU GD\V RI VXFNOLQJ VKRZ D P51$ LQGXFWLRQ RI IROG RYHU WKH WLPH FRXUVH

PAGE 60

YLUJLQ JODQG DQG GXULQJ WKH ILUVW KDOI RI SUHJQDQF\ DQG ORZ WR XQGHWHFWDEOH DW ELUWK DQG GXULQJ ODFWDWLRQ 7KLV LQGLFDWHV WKDW LI SURODFWLQ LV LQYROYHG LQ UHJXODWLQJ PDPPDU\ OLSR H[SUHVVLRQ LW ZRXOG GR VR E\ GRZQ UHJXODWLRQ ZKLFK GLG QRW REVHUYH LQ +& FHOOV RU PDPPDU\ H[SODQWV )XWXUH VWXGLHV LQYHVWLJDWLQJ PDPPDU\ HSLWKHOLDO FHOO OLQHV IRU KRUPRQDO HIIHFWV RQ OLSR H[SUHVVLRQ PD\ DLG LQ XQGHUVWDQGLQJ WKH UHJXODWLRQ REVHUYHG LQ WKH PDPPDU\ JODQG GXULQJ GLIIHUHQWLDWLRQ DQG LQYROXWLRQ $OWKRXJK SURODFWLQ GLG QRW DIIHFW H[SUHVVLRQ RI OLSR P51$ LQ WKH PRXVH PDPPDU\ HSLWKHOLDO FHOO OLQH +& GLG REVHUYH KLJK OHYHOV RI WKH PHVVDJH GDWD QRW VKRZQf 7KXV LW LV OLNHO\ WKDW WKH UHVWLQJ GXFWDO HSLWKHOLDO FHOOV ZKLFK JLYH ULVH WR VHFUHWRU\ FHOOV GXULQJ SUHJQDQF\ DUH UHVSRQVLEOH IRU WKH KLJK OLSR H[SUHVVLRQ REVHUYHG LQ WKH YLUJLQ JODQG ,PPXQRORFDOL]DWLRQ RI WZR RWKHU DQQH[LQV DQQH[LQ ,, DQG FDOHOHFWULQ LQ YLUJLQ PDPPDU\ HSLWKHOLDO FHOOV E\ 5RFKD DQG FRZRUNHUV VXSSRUWV WKLV K\SRWKHVLV +RUQ HW DO /R]DQR HW DO D /R]DQR HW DO Ef ,Q FRQWUDVW VHFUHWRU\ FHOOV RI WKH ODFWDWLQJ JODQG ZHUH HVVHQWLDOO\ GHYRLG RI WKHVH SURWHLQV /R]DQR HW DO Ef 7KH GXFWDO FHOOV ZKLFK DUH GRUPDQW LQ WKH PDWXUH YLUJLQ DQLPDO DQG UHSRUWHG WR EH DUUHVWHG LQ WKH SKDVH RI WKH FHOO F\FOH EHJLQ SUROLIHUDWLRQ DQG GLIIHUHQWLDWLRQ LQWR VHFUHWRU\ FHOOV DURXQG PLGSUHJQDQF\ 7RSSHU DQG )UHHPDQ f 7KH VWULNLQJ GHFOLQH LQ OLSR P51$ DQG SURWHLQ

PAGE 61

OHYHOV WKDW REVHUYHG LQ WKH UDW PDPPDU\ JODQG GXULQJ SUHJQDQF\ FRUUHVSRQGV WR WKH RQVHW RI WKHVH FKDQJHV LQ HSLWKHOLDO FHOO PRUSKRORJ\ EHOLHYH WKDW WKH KLJK OHYHO RI OLSR LQ WKH YLUJLQ PDPPDU\ JODQG PD\ EH LQYROYHG LQ LQKLELWLQJ HSLWKHOLDO FHOO SUROLIHUDWLRQ DQG GLIIHUHQWLDWLRQ 7KLV OHDGV WR D FRQVLGHUDWLRQ RI ZKDW UHJXODWHV OLSR ,W LV ZHOO NQRZQ WKDW HSLGHUPDO JURZWK IDFWRU (*)f LV LPSRUWDQW LQ VLJQDOLQJ PDPPDU\ JODQG JURZWK GXULQJ SUHJQDQF\ 7DNHWDQL DQG 2ND f 7KH (*) UHFHSWRU ZKLFK LV NQRZQ WR SKRVSKRU\ODWH OLSR 6DZ\HU DQG &RKHQ f UHDFKHV LWV KLJKHVW OHYHOV LQ WKH PDPPDU\ JODQG DURXQG PLGSUHJQDQF\ (GHU\ HW DO f 3HUKDSV SKRVSKRU\ODWLRQ RI OLSR GXULQJ SUHJQDQF\ DOWHUV LWV DFWLYLW\ ZKLFK LV IROORZHG E\ D VXEVHTXHQW GRZQUHJXODWLRQ RI OLSR H[SUHVVLRQ $OWKRXJK LW KDV EHHQ GHPRQVWUDWHG WKDW VHULQHWKUHRQLQH SKRVSKRU\ODWLRQ RI OLSR EORFNV LWV SKRVSKROLSDVHLQKLELWRU\ DFWLYLW\ DQG DOWHUV LWV FDOFLXPSKRVSKROLSLG ELQGLQJ SURSHUWLHV $QGR HW DO +LUDWD +LUDWD HW DO 7RXTXL HW DO f LW LV \HW WR EH LQYHVWLJDWHG ZKHWKHU W\URVLQH SKRVSKRU\ODWLRQ WRR LV LQKLELWRU\ 1HYHUWKHOHVV WKLV HYHQW PD\ EH QHFHVVDU\ WR LQLWLDWH HSLWKHOLDO FHOO SUROLIHUDWLRQ DQG GLIIHUHQWLDWLRQ 6RRQ DIWHU QDWXUDO ZHDQLQJ RU SUHPDWXUH WHUPLQDWLRQ RI WKH VXFNOLQJ VWLPXOXV E\ SXS UHPRYDO D VXESRSXODWLRQ RI WKH PDPPDU\ VHFUHWRU\ HSLWKHOLDO FHOOV UHYHUWV EDFN WR WKH

PAGE 62

UHVWLQJ VWDWH ZKLOH WKH UHPDLQGHU RI WKH FHOOV GLH %RUHOOLQL DQG 2ND +ROOPDQQ f 1R LUUHYHUVLEOH FKDQJHV LQ WKH JODQG RFFXU LPPHGLDWHO\ DIWHU FHVVDWLRQ RI VXFNOLQJ EHFDXVH ODFWDWLRQ FDQ UHFRPPHQFH VHYHUDO GD\V DIWHU ZHDQLQJ 6LOYHU f 7KH VXEVHW RI HSLWKHOLDO FHOOV ZKLFK UHYHUWV WR WKH UHVWLQJ VWDWH PD\ EH UHVSRQVLEOH IRU WKH UDSLG LQFUHDVH LQ PDPPDU\ OLSR P51$ DIWHU UHPRYDO RI WKH VXFNOLQJ VWLPXOXV 7KHVH FHOOV PD\ UHFHLYH D VLJQDO IURP WKH V\PSDWKHWLF QHUYRXV V\VWHP ZKHQ VXFNOLQJ FHDVHV ZKLFK FDXVHV D UDSLG WUDQVFULSWLRQDO DFWLYDWLRQ RI OLSR LQ SUHSDUDWLRQ IRU UHWXUQ WR WKH UHVWLQJ VWDWH $V VKRZQ LQ )LJ WUDQVODWLRQ RI OLSR P51$ DSSHDUV WR EH GHOD\HG DQG UHTXLUHV PRUH WKDQ KRXUV DIWHU FHVVDWLRQ RI VXFNOLQJ 7KLV GHOD\ PD\ FRUUHVSRQG WR WKH WLPH ZKHQ JODQGXODU LQYROXWLRQ EHFRPHV D FRPPLWWHG HYHQW HQFRPSDVVLQJ HSLWKHOLDO FHOO GHDWK 7KLV DSSHDUV WR RFFXU DSSUR[LPDWHO\ ILYH GD\V DIWHU ZHDQLQJ 6LOYHU f DQG WKHUHIRUH FRUUHODWHV ZLWK WKH WLPH DW ZKLFK PD[LPDO OHYHOV RI OLSR DUH UHDFKHG EHOLHYH WKDW WKH KLJK OLSR OHYHOV REVHUYHG LQ WKH LQYROXWHG JODQG IROORZLQJ QDWXUDO ZHDQLQJ )LJ f LQGLFDWH WKH SUHVHQFH RI QHZ UHVWLQJ HSLWKHOLDO FHOOV ZKLFK OLNH WKRVH LQ WKH PDWXUH YLUJLQ JODQG PD\ XQGHUJR SUROLIHUDWLRQ DQG GLIIHUHQWLDWLRQ ZLWK WKH RQVHW RI D QHZ SUHJQDQF\

PAGE 63

&+$37(5 7,668(63(&,),& 5(*8/$7,21 2) /,32&257,1 LWO51$ /(9(/6 ,1 5$76 '85,1* ',$%(7(6 $1' %< */8&$*21 ,QWURGXFWLRQ 'LDEHWHV PHOOLWLV D VHULRXV DQG SUHYDOHQW GLVHDVH DPRQJ KXPDQV LV NQRZQ WR UHVXOW LQ D ZLGH YDULHW\ RI SK\VLRORJLFDO DOWHUDWLRQV ZKLFK RIWHQ PD\ UHVXOW LQ GHDWK :DUUHQ HW DO f 1XPHURXV JXDOLWDWLYH DQG JXDQWLWDWLYH DOWHUDWLRQV WDNH SODFH LQ WKH SDQFUHDV WKH RUJDQ LQ ZKLFK WKH LQVXOLQSURGXFLQJ LVOHW FHOOV DUH ORFDWHG &DUGLRYDVFXODU GLVHDVH LV RQH RI WKH OHDGLQJ FDXVHV RI GHDWK LQ GLDEHWLFV ZLWK ERWK KHDUW G\VIXQFWLRQ DQG DWKHURVFOHURVLV IUHJXHQWO\ GHYHORSLQJ 5HQDO DOWHUDWLRQV LQFOXGH D PDUNHG K\SHUWURSK\ ZLWK FRUUHVSRQGLQJ LQFUHDVH LQ NLGQH\ ZHLJKW DV ZHOO DV DQ LQFUHDVHG JORPHUXODU ILOWUDWLRQ UDWH %OLQGQHVV PD\ UHVXOW IURP UHWLQRSDWK\ VXFK DV PLFURDQHXU\VPV 1HUYRXV V\VWHP GDPDJH PRVW QRWDEO\ LQ SHULSKHUDO QHUYHV UHVXOWV LQ V\PSWRPV LQFOXGLQJ SDLQ DQG ORVV RI VHQVH LQ WKH IHHW DQG OHJV *DQJUHQH LQ WKH H[WUHPLWLHV ERQH DQG VNLQ OHVLRQV PXVFOH DWURSK\ OLYHU GDPDJH DQG JDVWURLQWHVWLQDO SUREOHPV RIWHQ RFFXU LQ GLDEHWLFV 0DQ\ VWXGLHV UHJDUGLQJ GLDEHWHV KDYH UHOLHG XSRQ DQLPDO PRGHOV LQFOXGLQJ UDWV )HLQ HW DO f UDEELWV %KLPML

PAGE 64

HW DO f DQG GRJV 5HJDQ HW DO f $GPLQLVWUDWLRQ RI DOOR[DQ 'XQQ HW DO f RU WKH DQWLELRWLF VWUHSWR]RWRFLQ 67=f-XQRG HW DO f KDV EHHQ VKRZQ WR FDXVH LPSDLUHG "FHOO IXQFWLRQ DQG K\SRLQVXOLQHPLD LQ \RXQJ DQLPDOV WKXV VLPXODWLQJ WKH GLDEHWLF VWDWH ,Q DGGLWLRQ WKHUH DUH &KLQHVH KDPVWHU
PAGE 65

LW LV SRVVLEOH WKDW FKDQJHV LQ DUDFKLGRQDWH PHWDEROLVP FRXOG SOD\ D FULWLFDO UROH LQ GLDEHWLF KHDUW GLHDVH 0DQ\ RWKHU ELRFKHPLFDO FKDQJHV LQ WKH GLDEHWLF KHDUW KDYH EHHQ GRFXPHQWHG 7KH DGUHQHUJLF UHFHSWRU QXPEHU LQ FDUGLDF PHPEUDQHV ZDV ORZHUHG DQG WKHLU FRXSOLQJ WR DGHQ\ODWH F\FODVH ZDV DOWHUHG LQ 67=GLDEHWLF UDWV $WNLQV HW DO f 7KH GLDF\OJO\FHURO FRQWHQW LQ P\RFDUGLXP IURP 67=GLDEHWLF UDWV ZDV KLJKO\ HOHYDWHG 2NXPXUD HW DO f 6LJQLILFDQW UHGXFWLRQV LQ FDOFLXP ELQGLQJ DQG XSWDNH KDYH EHHQ REVHUYHG LQ VDUFRSODVPLF UHWLFXOXP VHFWLRQV IURP GLDEHWLF UDW KHDUWV %HUJK HW DO %LHOHIHOG HW DO )HLQ HW DO *DQJXO\ HW DO 3HQSDUJNXO HW DO f %RWK SKRVSKRLQRVLWLGH V\QWKHVLV DQG UHOHDVH IURP PHPEUDQH SKRVSKROLSLGV ZHUH JUHDWO\ UHGXFHG LQ GLDEHWLF UDW KHDUWV %HUJK HW DO f ,Q DGGLWLRQ WR WKH KHDUW UHGXFHG LQRVLWRO FRQWHQW DQG WXUQRYHU KDYH EHHQ REVHUYHG LQ GLDEHWLF QHUYH OHQV DQG NLGQH\ &UDYHQ DQG 'H5XEHUWLV :LQHJUDG f 6WXGLHV UHSRUWHG LQ WKLV FKDSWHU ZHUH FDUULHG RXW WR LQYHVWLJDWH WKH SRVVLEOH UROH RI OLSR LQ WKH DOWHUHG PHWDEROLVP DVVRFLDWHG ZLWK GLDEHWHV /LSRFRUWLQ KDV EHHQ LPSOLFDWHG DV D UHJXODWRU RI DUDFKLGRQLF DFLG PHWDEROLVP WKURXJK PRGXODWLRQ RI SKRVSKROLSDVH DFWLYLW\ +LUDWD HW DO f $V QRWHG DERYH OHYHOV RI DUDFKLGRQLF DFLG DQG VRPH RI LWV PHWDEROLWHV ZHUH VKRZQ WR EH DOWHUHG LQ VHYHUDO WLVVXHV RI GLDEHWLF DQLPDOV 7KH SKRVSKROLSLGELQGLQJ

PAGE 66

DFWLYLW\ RI OLSR LV NQRZQ WR EH FDOFLXPGHSHQGHQW *OHQQH\ f DQG VLJQLILFDQW FKDQJHV LQ FDOFLXP OHYHOV LQ VRPH GLDEHWLF WLVVXHV KDYH EHHQ GRFXPHQWHG )LQDOO\ WKH FORVHO\ UHODWHG SURWHLQ OLSRFRUWLQ ,,, ZDV UHFHQWO\ LGHQWLILHG DV D K\GURODVH LQYROYHG LQ UHJXODWLRQ RI SKRVSKRLQRVLWLGH WXUQRYHU VXJJHVWLQJ WKH IXQFWLRQ RI OLSR PD\ DOVR EH WR UHJXODWH WKLV LPSRUWDQW SDWKZD\ $V GHVFULEHG DERYH DOWHUDWLRQV LQ SKRVSKRLQRVLWLGH PHWDEROLVP KDYH EHHQ GRFXPHQWHG LQ VHYHUDO GLDEHWLF WLVVXHV $IWHU GHPRQVWUDWLQJ WLVVXHVSHFLILF LQGXFWLRQ RI OLSR LQ 67=GLDEHWLF UDWV FHUWDLQ KRUPRQHV ZHUH LQYHVWLVWLJDWHG WR GHWHUPLQH ZKLFK RQHV PLJKW SOD\ D UROH LQ OLSR LQGXFWLRQ ,W ZDV IRXQG WKDW JOXFDJRQ ZKLFK LV KLJKO\ HOHYDWHG LQ GLDEHWLF DQLPDOV 8QJHU HW DO f FDXVHG LQGXFWLRQ RI OLSR LQ WKH KHDUW DV HDUO\ DV KU DIWHU LQMHFWLRQ /LSRFRUWLQ P51$ H[SUHVVLRQ LQ WZR RWKHU WLVVXHV LQ ZKLFK LQGXFWLRQ ZDV VHHQ LQ GLDEHWLF DQLPDOV ZDV QRW DIIHFWHG E\ JOXFDJRQ XS WR KU DIWHU LQMHFWLRQ 3RVVLEOH UHDVRQV IRU WKH UHODWLYHO\ UDSLG LQGXFWLRQ RI OLSR P51$ H[SUHVVLRQ LQ WKH KHDUW E\ JOXFDJRQ DQG LQGXFWLRQ LQ KHDUW DQG RWKHU WLVVXHV LQ GLDEHWLF DQLPDOV ZLOO EH GLFXVVHG 7KHVH VWXGLHV DUH WKH ILUVW WR OLQN JOXFDJRQ DQG GLDEHWHV ZLWK DQ\ RI WKH DQQH[LQV 0DWHULDOV DQG 0HWKRGV 67='LDEHWHV DQG ,QVXOLQ 7UHDWPHQW 0DOH 6SUDJXH'DZOH\ UDWV JUDPVf ZHUH LQMHFWHG LQWUDSHULWRQHDOO\ ZLWK PJ.J VWUHSWR]RWRFLQ $OGULFKf

PAGE 67

ZKLFK ZDV GLVVROYHG LQ 0 VRGLXP FLWUDWH EXIIHU S+ $IWHU KU XULQH ZDV DQDO\]HG XVLQJ %RHKULQJHU 0DQQKHLP &KHPVWULSV WR GHWHFW JOXFRVXULD DQG NHWRVLV $QLPDOV H[KLELWLQJ WKHVH V\PSWRPV DV ZHOO DV ORVV RI ERG\ ZHLJKW ZHUH VDFULILFHG DIWHU WKUHHIRXU GD\V DQG WLVVXHV LVRODWHG IRU 51$ H[WUDFWLRQ $QRWKHU JURXS RI DQLPDOV PDGH GLDEHWLF DV GHVFULEHG DERYH ZDV LQMHFWHG RQFH GDLO\ IRU VHYHQ GD\V ZLWK 8 RI 13+ EHHI LQVXOLQ 6TXLEEf 8ULQH JOXFRVH DQG NHWRQH OHYHOV UHWXUQHG WR QRUPDO GXULQJ LQVXOLQ WUHDWPHQW 7ZR DQLPDOV PDLQWDLQHG RQ LQVXOLQ ZHUH VDFULILFHG IROORZLQJ WKH ILQDO LQMHFWLRQ ZKLOH WZR RWKHUV ZHUH WDNHQ RII LQVXOLQ IRU WKUHH GD\V WR DOORZ GLDEHWLF V\PSWRPV WR DJDLQ GHYHORS 7KH QRUPDO VWDWH RI LQVXOLQWUHDWHG UDWV DQG GLDEHWLF VWDWH RI UDWV UHPRYHG IURP LQVXOLQ WUHDWPHQW ZHUH FRQILUPHG E\ ERWK XULQH DQDO\VLV DQG EORRG JOXFRVH GHWHUPLQDWLRQ 6LJPDf +RUPRQHV *OXFDJRQ D NLQG JLIW RI /LOO\ 5HVHDUFK /DERUDWRULHV ZDV XVHG DW D FRQFHQWUDWLRQ RI PJ.J ERG\ ZHLJKW 'LEXW\UDO F$03 6LJPDf ZDV XVHG DW PJ.J GH[DPHWKDVRQH SKRVSKDWH 4XDGf DW PJ.J HSLQHSKULQH 6LJPDf DW PJ.J DQG LQVXOLQ DW PJ.J *OXFDJRQ HSLQHSKULQH DQG LQVXOLQ ZHUH GLVVROYHG DW D FRQFHQWUDWLRQ RI PJPO LQ D EXIIHU FRQWDLQLQJ b ERYLQH VHUXP DOEXPLQ DQG b JO\FHURO S+

PAGE 68

51$ ,VRODWLRQ 1RUWKHUQ $QDO\VLV 3UREH 3UHSDUDWLRQ DQG +\EULGL]DWLRQ 7KHVH SURFHGXUHV DUH GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV LQ &KDSWHUV DQG $ PRXVH DFWLQ F'1$ ZDV NLQGO\ SURYLGHG E\ /DUU\ .HGHV 5HVXOWV 7R GHWHUPLQH LI FKDQJHV LQ OLSR P51$ H[SUHVVLRQ RFFXU LQ WLVVXHV RI GLDEHWLF UDWV LQMHFWHG UDWV ZLWK 67= WR LQGXFH GLDEHWHV DQG FRPSDUHG WLVVXH OLSR P51$ OHYHOV ZLWK WKRVH RI FRQWUROV )LJXUH VKRZV 1RUWKHUQ DQDO\VLV FRPSDULQJ OLSR P51$ OHYHOV LQ VHYHUDO WLVVXHV IURP D GLDEHWLF DQG FRQWURO UDW :KLOH OHYHOV LQ WKH EUDLQ LQWHVWLQH OXQJ DQG WK\PXV ZHUH VLPLODU D VLJQLILFDQW LQFUHDVH ZDV REVHUYHG LQ WKH KHDUW NLGQH\ DQG KLQGOHJ PXVFOH $FWLQ P51$ OHYHOV DUH VKRZQ DV DQ LQWHUQDO FRQWURO 1RWH WKDW WKH PRXVH "DFWLQ F'1$ SUREH XVHG K\EULGL]HG WR WZR P51$ VSHFLHV RI GLIIHUHQW VL]HV LQ KHDUW DQG KLQGOHJ PXVFOH 7R GHPRQVWUDWH WKH UHSURGXFLELOLW\ RI WKH LQGXFWLRQ RI OLSR P51$ LQ WKH KHDUW NLGQH\ DQG KLQGOHJ PXVFOH UHSHDWHG WKH DERYH H[SHULPHQW XVLQJ WZR RWKHU 67=GLDEHWLF UDWV )LJXUH IXUWKHU LOOXVWUDWHV WKLV LQGXFWLRQ DQG DOVR VKRZV WKDW OLSR P51$ OHYHOV LQ WKH OLYHU DQG LQWHVWLQH DUH QRW DIIHFWHG E\ DFXWH GLDEHWHV $JDLQ DFWLQ P51$ OHYHOV DUH VKRZQ IRU FRPSDULVRQ 7R LQYHVWLJDWH ZKHWKHU WKH LQGXFWLRQ RI OLSR P51$ LQ WKH KHDUW NLGQH\ DQG KLQGOHJ PXVFOH ZDV WUXO\ D UHVXOW RI

PAGE 69

)LJXUH ([SUHVVLRQ RI OLSRFRUWLQ P51$ LQ WLVVXHV IURP D FRQWURO DQG WKUHHGD\ VWUHSWR]RWRFLQGLDEHWLF UDW 5DWV ZHUH LQMHFWHG LQWUDSHULWRQHDOO\ ZLWK EXIIHU RQO\ RU PJNJ VWUHSWR]RWRFLQ DQG WLVVXH 51$ ZDV LVRODWHG DQG VXEMHFW WR 1RUWKHUQ DQDO\VLV DIWHU WKUHH GD\V $ PRXVH DFWLQ SUREH ZDV XVHG DV DQ LQWHUQDO FRQWURO

PAGE 70

+HDUW .LGQH\ 0XVFOH & ' & ' & ' /LYHU ,QWHVWLQH )LJXUH ,QFUHDVHG OHYHOV RI OLSRFRUWLQ P51$ LQ WKH KHDUW NLGQH\ DQG KLQGOHJ PXVFOH RI WKUHHGD\ VWUHSWR]RWRFLQGLDEHWLF UDWV 1RUWKHUQ DQDO\VLV ZDV FDUULHG RXW DV GHVFULEHG LQ WKH )LJXUH OHJHQG

PAGE 71

WKH GLDEHWLF VWDWH DQG QRW FDXVHG E\ DQRWKHU HIIHFW RI 67= FDUULHG RXW DQ H[SHULPHQW LQ ZKLFK LQVXOLQ ZDV XVHG WR FRQWURO WKH GLVHDVH )LJ f 5DWV ZHUH LQMHFWHG ZLWK 67= WR LQGXFH GLDEHWHV $IWHU WKUHH GD\V ZKHQ ERWK XULQH JOXFRVH DQG NHWRQHV ZHUH YHU\ KLJK DQLPDOV ZHUH VXEMHFW WR GDLO\ LQMHFWLRQV RI 8 13+ EHHI LQVXOLQ IRU WKH IROORZLQJ VHYHQ GD\V 2QH GD\ DIWHU LQVXOLQ WUHDWPHQW XULQH JOXFRVH DQG NHWRQH OHYHOV DSSURDFKHG QRUPDO DQG UHPDLQHG VR XQWLO WKH HQG RI WKH WUHDWPHQW )ROORZLQJ WKH VHYHQGD\ LQVXOLQ WKHUDS\ WZR DQLPDOV ZHUH VDFULILFHG DQG WRWDO 51$ ZDV LVRODWHG IURP WLVVXHV 7ZR RWKHU UDWV ZHUH UHPRYHG IURP LQVXOLQ WUHDWPHQW DQG DV D FRQVHTXHQFH XULQH JOXFRVH DQG NHWRQHV URVH ZLWKLQ D GD\ 7KUHH GD\V DIWHU VWRSSLQJ LQVXOLQ WUHDWPHQW DQLPDOV ZHUH VDFULILFHG DQG WRWDO 51$ ZDV LVRODWHG IURP WLVVXHV 1RUWKHUQ DQDO\VLV )LJ Df VKRZHG WKDW LQ WKH KHDUW DQG NLGQH\ OLSR P51$ OHYHOV LQFUHDVHG ZKHQ DQLPDOV ZHUH UHPRYHG IURP LQVXOLQ WUHDWPHQW DQG H[KLELWHG GLDEHWLF V\PSWRPV ,Q FRQWUDVW OHYHOV LQ KLQGOHJ PXVFOH UHPDLQHG WKH VDPH 7R FRQILUP GLDEHWHV DQG VKRZ WKDW LQVXOLQ WUHDWPHQW ZDV HIIHFWLYH EORRG VDPSOHV ZHUH WDNHQ DQG SODVPD JOXFRVH OHYHOV GHWHUPLQHG )LJ Ef :KLOH EORRG JOXFRVH OHYHOV LQ WKH LQVXOLQWUHDWHG UDWV ZHUH RQO\ VOLJKWO\ DERYH WKH QRUPDO UDQJH OHYHOV LQ WKH DQLPDOV WDNHQ RII LQVXOLQ ZHUH FOHDUO\ LQGLFDWLYH RI GLDEHWHV QH[W LQYHVWLJDWHG KRUPRQHV ZKLFK PLJKW SOD\ D UROH LQ WKH DOWHUHG OLSR H[SUHVVLRQ LQ GLDEHWLF UDW WLVVXHV $

PAGE 72

KHDUW NLGQH\ PXVFOH ,QVXOLQ RQ RII RQ RII RQ RII D OLSR DFWLQ )LJXUH +HDUW NLGQH\ DQG KLQGOHJ PXVFOH OLSRFRUWLQ P51$ H[SUHVVLRQ LQ VWUHSWR]RWRFLQLQMHFWHG UDWV RQ DQG RII LQVXOLQ WUHDWPHQW Df 7KUHH GD\V DIWHU LQWUDSHULWRQHDO LQMHFWLRQ RI PJNJ VWUHSWR]RWRFLQ UDWV ZHUH JLYHQ GDLO\ LQMHFWLRQV RI 8 13+ EHHI LQVXOLQ IRU VHYHQ GD\V )ROORZLQJ WKH ILQDO LQVXOLQ LQMHFWLRQ WZR UDWV ZHUH VDFULILFHG DQG WLVVXH 51$ LVRODWHG 7ZR RWKHU UDWV ZHUH UHPRYHG IURP WKH LQVXOLQ WUHDWPHQW IRU WKUHH GD\V EHIRUH LVRODWLQJ WLVVXH 51$ 1RUWKHUQ DQDO\VLV VKRZV OLSRFRUWLQ DQG DFWLQ P51$ OHYHOV Ef 6HUXP JOXFRVH OHYHOV LQ WKH UDWV UHSUHVHQWHG DERYH ZHUH GHWHUPLQHG XVLQJ D 6LJPD NLW DQG DUH VKRZQ JUDSKLFDOO\ 7KH QRUPDO UDQJH LV DURXQG PJG/

PAGE 73

SUHOLPLQDU\ VWXG\ XVLQJ DQLPDOV ZKLFK KDG EHHQ LQMHFWHG ZLWK JOXFDJRQ LQVXOLQ DQG GH[DPHWKDVRQH UHYHDOHG WKDW OLSR P51$ ZDV LQGXFHG LQ WKH KHDUW KU DIWHU LQMHFWLRQ RI JOXFDJRQ -DQ/LQJ +VX DQG +RUOLFN XQSXEOLVKHG UHVXOWVf *OXFDJRQ ZKLFK LV NQRZQ WR PHGLDWH FHOOXODU HIIHFWV YLD LQFUHDVHG F$03 OHYHOV DQG FDOFLXP PRELOL]DWLRQ :DNHODP HW DO f LV KLJKO\ HOHYDWHG GXULQJ GLDEHWHV 8QJHU HW DO f 7R IXUWKHU VWXG\ D SRWHQWLDO OLQN EHWZHHQ JOXFDJRQ DQG OLSR LQGXFWLRQ LQMHFWHG UDWV ZLWK JOXFDJRQ DQG DVVD\HG OLSR P51$ OHYHOV LQ VHYHUDO WLVVXHV DIWHU KU )LJXUH GHPRQVWUDWHV WKDW JOXFDJRQ LQMHFWLRQ FDXVHG DQ LQFUHDVH LQ OLSR P51$ OHYHOV LQ WKH KHDUW EXW QRW LQ NLGQH\ RU PXVFOH DIWHU DQG KU )LJXUH VKRZV JOXFDJRQ LQGXFWLRQ RI OLSR P51$ OHYHOV LQ WKH KHDUW RI IRXU DQLPDOV UHSUHVHQWLQJ DQ LQFUHDVH RI EHWZHHQ WZR DQG ILYHIROG FRPSDUHG WR WKH FRQWURO DQLPDO 4XDQWLWDWLRQ ZDV GRQH XVLQJ DFWLQ P51$ OHYHOV WR QRUPDOL]H OLSR GDWD 7R GHWHUPLQH WKH DSSUR[LPDWH WLPH UHTXLUHG IRU LQGXFWLRQ RI KHDUW OLSR P51$ E\ JOXFDJRQ D WLPH FRXUVH H[SHULPHQW ZDV XQGHUWDNHQ )LJ f 7KH UHVXOWV VKRZHG WKDW LQGXFWLRQ UHTXLUHG DERXW KU DQG FRXOG VWLOO EH VHHQ KU DIWHU LQMHFWLRQ 1H[W WHVWHG RWKHU KRUPRQHV WR KHOS GHILQH WKH PHFKDQLVP E\ ZKLFK OLSR P51$ H[SUHVVLRQ LV HOHYDWHG LQ WKH KHDUW )LJ f 'H[DPHWKDVRQH D V\QWKHWLF JOXFRFRUWLFRLG DQG LQVXOLQ KDG QR HIIHFW (SLQHSKULQH D

PAGE 74

+HDUW .LGQH\ 0XVFOH *OXFDJRQ f§ f§ f§ OLSR DFWLQ +HDUW .LGQH\ 0XVFOH *OXFDJRQ f§ f§ OLSR )LJXUH ,QGXFWLRQ RI OLSRFRUWLQ P51$ LQ WKH UDW KHDUW DIWHU LQMHFWLRQ RI JOXFDJRQ )RXU RU KU DIWHU LQWUDYHQRXV WDLO YHLQ LQMHFWLRQ RI PJNJ JOXFDJRQ WRWDO 51$ ZDV LVRODWHG IURP YDULRXV WLVVXHV DQG VXEMHFW WR 1RUWKHUQ DQDO\VLV $FWLQ P51$ OHYHOV DUH VKRZQ DV DQ LQWHUQDO FRQWURO

PAGE 75

*OXFDJRQ f§ rP b r ‘ fb DFWLQ )LJXUH ,QFUHDVHG OHYHOV RI OLSRFRUWLQ P51$ LQ WKH KHDUW DIWHU JOXFDJRQ LQMHFWLRQ LQ IRXU DQLPDOV +HDUW 51$ ZDV LVRODWHG KU DIWHU LQMHFWLRQ RI PJNJ JOXFDJRQ RU EXIIHU RQO\ DQG VXEMHFW WR 1RUWKHUQ DQDO\VLV 2QH RI WKH WZR DFWLQ P51$ VSHFLHV LV DOVR VKRZQ

PAGE 76

)LJXUH 7LPH FRXUVH RI WKH LQFUHDVH LQ OLSRFRUWLQ P51$ LQ WKH KHDUW DIWHU LQMHFWLRQ RI JOXFDJRQ 5DWV ZHUH LQMHFWHG LQWUDYHQRXVO\ ZLWK PJNJ JOXFDJRQ DQG KHDUW 51$ ZDV LVRODWHG DIWHU YDULRXV WLPHV KUf 1RUWKHUQ DQDO\VLV DOVR VKRZV DFWLQ P51$ OHYHOV

PAGE 77

OLSR )LJXUH /LSRFRUWLQ P51$ H[SUHVVLRQ LQ WKH UDW KHDUW IROORZLQJ LQMHFWLRQ RI JOXFDJRQ DQG RWKHU KRUPRQHV 5DWV ZHUH LQMHFWHG LQWUDYHQRXVO\ ZLWK VDOLQH JOXFDJRQ HSLQHSKULQH GLEXW\UDO F$03 GH[DPHWKDVRQH RU LQVXOLQ DQG KHDUW 51$ ZDV LVRODWHG DIWHU KU 1RUWKHUQ DQDO\VLV VKRZV OLSRFRUWLQ DQG DFWLQ P51$ OHYHOV

PAGE 78

KRUPRQH ZKLFK DFWV WKURXJK LQFUHDVHG F$03 OHYHOV DQG HIIHFWV KHDUW IXQFWLRQ 5HJDQ HW DO f ZDV DOVR ZLWKRXW HIIHFW ,Q DGGLWLRQ LQMHFWLRQ RI F$03 GLG QRW FKDQJH KHDUW OLSR P51$ H[SUHVVLRQ 7KH LQGXFWLRQ RI KHDUW OLSR P51$ E\ JOXFDJRQ DQG ODFN RI HIIHFW RI WKH RWKHU KRUPRQHV DQG F$03 ZDV DOVR REVHUYHG LQ PLFH )LJ f 'LVFXVVLRQ 6WXGLHV LQ WKLV FKDSWHU GHPRQVWUDWH WKDW WLVVXH VSHFLILF UHJXODWLRQ RI OLSR P51$ OHYHOV RFFXUV DV D UHVXOW RI GLDEHWHV DQG WKDW JOXFDJRQ PD\ SOD\ D SDUW LQ WKLV UHJXODWLRQ 7KHVH H[SHULPHQWV DUH WKH ILUVW WR UHSRUW D OLQN EHWZHHQ D PHPEHU RI WKH DQQH[LQ IDPLO\ DQG GLDEHWHV DQG DOVR WR VKRZ DOWHUDWLRQV LQ H[SUHVVLRQ RI DQ DQQH[LQ LQ UHVSRQVH WR JOXFDJRQ 2I WKH 67=GLDEHWLF WLVVXHV VWXGLHG WKH KHDUW NLGQH\ DQG KLQGOHJ PXVFOH VKRZHG D VLJQLILFDQW LQFUHDVH LQ VWHDG\ VWDWH OLSR P51$ OHYHOV 7R JDLQ SRVVLEOH LQVLJKW LQWR WKH UROH RI OLSR LQ WKHVH WLVVXHV WKH NQRZQ HIIHFWV RI GLDEHWHV RQ WKHP PXVW EH FRQVLGHUHG ,Q WKH FDVH RI WKH KHDUW FDUGLRYDVFXODU GLVHDVH LV D PDMRU FDXVH RI GHDWK LQ GLDEHWHV UHVSRQVLEOH IRU DERXW b RI GLDEHWLF PRUWDOLW\ &KULVWOLHE f :KLOH DWKHURVFOHURVLV LV DQ LPSRUWDQW FRPSRQHQW VWXGLHV LQ WKH UDW )HLQ HW DO f UDEELW )HLQ HW DO f GRJ 5HJDQ HW DO f DQG PRQNH\ +DLGHU HW DO f VKRZ HYLGHQFH IRU SULPDU\ FDUGLRP\RSDWK\ RU G\VIXQFWLRQ LQ WKH KHDUW LWVHOI $

PAGE 79

)LJXUH /LSRFRUWLQ P51$ H[SUHVVLRQ LQ WKH PRXVH KHDUW IROORZLQJ LQMHFWLRQ RI JOXFDJRQ DQG RWKHU KRUPRQHV 0LFH ZHUH LQMHFWHG LQWUDYHQRXVO\ ZLWK VDOLQH JOXFDJRQ HSLQHSKULQH GLEXW\UDO F$03 GH[DPHWKDVRQ RU LQVXOLQ DQG KHDUW 51$ ZDV LVRODWHG DIWHU KU 1RUWKHUQ DQDO\VLV VKRZV OLSRFRUWLQ DQG DFWLQ P51$ OHYHOV

PAGE 80

YDULHW\ RI DOWHUDWLRQV LQ KHDUW UDWH KDYH EHHQ GHVFULEHG LQ GLDEHWLF UDWV 3IDIIPDQ f ,Q DGGLWLRQ VWUXFWXUDO FKDQJHV LQ GLDEHWLF UDW P\RFDUGLXP KDYH EHHQ GRFXPHQWHG 7KRPSVRQ f ,Q WKDW VWXG\ DOWHUDWLRQV LQ DOO WKUHH SULPDU\ FRPSRQHQWV RI WKH KHDUW WKH FDUGLRF\WHV FRQQHFWLYH WLVVXH PDWUL[ DQG PLFURYDVFXODWXUH ZHUH REVHUYHG PRVW RI ZKLFK ZHUH UHYHUVHG DIWHU LQVXOLQ WUHDWPHQW ,QWHUHVWLQJO\ WKH HIIHFWV RI GLDEHWHV RQ WKH KHDUW DSSHDUHG WR EH IRFDO ZLWK JURXSV RI QRUPDO DQG DEQRUPDO FDUGLRF\WHV LQWHUVSHUVHG WKURXJKRXW WKH PXVFOH WLVVXH $ PXOWLWXGH RI ELRFKHPLFDO DOWHUDWLRQV KDYH EHHQ VWXGLHG LQ GLDEHWLF KHDUWV 7KH QRUPDO IOX[ RI PHWDEROLWHV WKURXJK JO\FRO\VLV DQG WKH .UHEV F\FOH LV GLVUXSWHG E\ WKH ODUJH DPRXQWV RI NHWRQH ERGLHV ZKLFK DFFXPXODWH DQG DUH WKH PDLQ VRXUFH RI HQHUJ\ IRU KHDUW UHVSLUDWLRQ LQ GLDEHWHV 7DHJWPH\HU DQG 3DVVPRUH f $ GHFUHDVHG DELOLW\ RI WKH VDUFRSODVPLF UHWLFXOXP WR WDNH XS FDOFLXP GHSUHVVHG P\RVLQ DQG DFWRP\RVLQ $73DVH DFWLYLWLHV DQG ORZHUHG 1D. $73DVH ZHUH REVHUYHG LQ GLDEHWLF UDW KHDUWV 7DKLOLDQL DQG 0F1HLOO f 7KH DGUHQHUJLF UHFHSWRU QXPEHU LQ FDUGLDF PHPEUDQHV ZDV ORZHUHG DQG WKHLU FRXSOLQJ WR DGHQ\ODWH F\FODVH DOWHUHG LQ GLDEHWLF UDW FDUGLDF PHPEUDQHV $WNLQV HW DO f 0RVW LQWHUHVWLQJ ZLWK UHJDUG WR OLSR DUH WKH FKDQJHV LQ OLSLG PHWDEROLVP GRFXPHQWHG LQ WKH GLDEHWLF KHDUW )DWW\ DFLG FRPSRVLWLRQV RI SKRVSKROLSLGV RI WKH KHDUW DUH DOWHUHG

PAGE 81

LQFOXGLQJ D GHFOLQH LQ DUDFKLGRQLF DFLG OHYHOV )DDV DQG &DUWHU +ROPDQ HW DO 6FKUDGH HW DO f 6RPH PHWDEROLWHV RI DUDFKLGRQLF DFLG VXFK DV SURVWDF\FOLQ DQG OHXNRWULHQHV DUH DOVR DIIHFWHG -RKQVRQ HW DO f 6LQFH OLSR KDV EHHQ LPSOLFDWHG DV DQ LQKLELWRU RI DUDFKLGRQLF DFLG PHWDEROLVP WKURXJK PRGXODWLRQ RI SKRVSKROLSDVH $J +LUDWD HW DO f LW LV SRVVLEOH WKDW WKH HOHYDWHG OHYHOV RI OLSR P51$ REVHUYHG LQ WKH GLDEHWLF UDW KHDUW PD\ SOD\ D UROH LQ UHGXFHG DUDFKLGRQLF DFLG OHYHOV DQG UHJXODWLRQ RI DUDFKLGRQLF DFLGGHULYHG SURGXFWV 3K\VLFDO SURSHUWLHV RI FHOO PHPEUDQHV LQFOXGLQJ IOXLGLW\ DSSHDU WR EH DOWHUHG LQ WKH GLDEHWLF KHDUW &KHXQJ HW DO 6KLQLW]N\ f 7KH SKRVSKROLSLGELQGLQJ DFWLYLW\ RI OLSR LWV ORFDOL]DWLRQ WR WKH LQQHU VXUIDFH RI WKH SODVPD PHPEUDQH DQG WKH LPSOLFDWLRQ RI VRPH RI WKH DQQH[LQV LQ PHPEUDQHF\WRVNHOHWDO OLQNDJH RIIHU WKH SRVVLELOLW\ WKDW HOHYDWHG OLSR FRXOG EH LQYROYHG LQ PHPEUDQH DOWHUDWLRQV VHHQ LQ WKH GLDEHWLF KHDUW )LQDOO\ HOHYDWHG OHYHOV RI OLSR LQ WKH GLDEHWLF UDW KHDUW PD\ SOD\ D UROH LQ UHGXFHG SKRVSKRLQRVLWRO V\QWKHVLV DQG UHOHDVH %HUJK HW DO f ,I WKH IXQFWLRQ RI OLSR LV VLPLODU WR WKDW RI OLSR ,,, D K\GURODVH ZKLFK PHWDEROL]HV F\FOLF SKRVSKRLQRVLWRO LQWHUPHGLDWHV 5RVV HW DO f D FRQQHFWLRQ EHWZHHQ HOHYDWHG OLSR H[SUHVVLRQ DQG DOWHUHG SKRVSKRLQRVLWRO WXUQRYHU LQ WKH GLDEHWLF KHDUW LV SRVVLEOH

PAGE 82

7KH WZR PRVW QRWDEOH DOWHUDWLRQV LQ WKH GLDEHWLF NLGQH\ DUH DQ LQFUHDVH LQ JORPHUXODU ILOWUDWLRQ UDWH DQG D PDUNHG K\SHUWURSK\ &RUWHV HW DO 6H\HU+DQVRQ f $ ORQJ OLVW RI ELRFKHPLFDO FKDQJHV KDYH EHHQ REVHUYHG LQ WKH GLDEHWLF NLGQH\ LQFOXGLQJ ERWK LQFUHDVHV DQG GHFUHDVHV LQ HQ]\PHV LQYROYHG LQ JO\FRSURWHLQ PHWDEROLVP LQFUHDVHG WKLFNQHVV RI JORPHUXODU EDVHPHQW PHPEUDQH GHFUHDVHG JXDQ\ODWH F\FODVH DFWLYLW\ LQFUHDVHG JOXFRQHRJHQVLV LQFUHDVHG JO\FRJHQ FRQWHQW LQFUHDVH LQ 51$ V\QWKHVLV DQG FKDQJHV LQ SHQWRVH SKRVSKDWH PHWDEROLWHV &RUWHV HW DO 6WHHU HW DO f 0RVW RI WKHVH DOWHUDWLRQV ZHUH FRUUHFWHG DIWHU LQVXOLQ WUHDWPHQW $V ZDV QRWHG LQ WKH KHDUW D GHILFLHQF\ LQ DUDFKLGRQLF DFLG ZDV DOVR REVHUYHG LQ WKH GLDEHWLF NLGQH\ )DDV DQG &DUWHU +ROPDQ HW DO f ,Q DGGLWLRQ WKH JORPHUXODU LQRVLWRO FRQWHQW DQG WKH WXUQRYHU RI SRO\SKRVSKRLQRVLWLGHV ZDV UHGXFHG E\ DOPRVW b LQ VWUHSWR]RWRFLQGLDEHWLF UDWV &UDYHQ DQG 'H5XEHUWLV f VLPLODU WR ZKDW ZDV REVHUYHG LQ WKH GLDEHWLF KHDUW ,W LV LQWULJXLQJ WR WKLQN WKDW WKH REVHUYHG LQGXFWLRQ LQ KHDUW DQG NLGQH\ OLSR P51$ REVHUYHG PLJKW EH LQYROYHG LQ WKHVH FKDQJHV LQ DUDFKLGRQLF DFLG RU SKRVSKRLQRVLWRO PHWDEROLVP LQ WKH GLDEHWLF 'LDEHWHV KDV SURIRXQG HIIHFWV RQ WKH ELRFKHPLFDO PRUSKRORJLFDO DQG FRQWUDFWLOH SURSHUWLHV RI VNHOHWDO PXVFOH DV ZHOO DV WKDW RI FDUGLDF PXVFOH $PLQR DFLG WUDQVSRUW LV UHGXFHG 0DQFKHVWHU f 1D.$73DVH DFWLYLW\ LV

PAGE 83

GHSUHVVHG 0RRUH HW DO f DQG LQFUHDVHG SURWHRO\VLV DQG D UHGXFWLRQ RI SURWHLQ V\QWKHVLV OHDG WR ORVV RI PXVFOH VWUHQJWK DQG PDVV 6PLWK HW DO f ,QVXOLQ WUHDWPHQW ZDV IRXQG WR UHYHUVH WKH LQFUHDVHG SURWHRO\VLV REVHUYHG LQ VWUHSWR]RWRFLQGLDEHWLF UDW VNHOHWDO PXVFOH 7R WKH EHVW RI P\ NQRZOHGJH DUDFKLGRQLF DFLG DQG SKRVSKRLQRVLWRO OHYHOV KDYH QRW EHHQ VWXGLHG LQ GLDEHWLF VNHOHWDO PXVFOH ,I OHYHOV RI WKHVH ZHUH IRXQG WR GHFUHDVH FRPSDUHG WR FRQWURO DQLPDOV DV LV WKH FDVH LQ KHDUW DQG NLGQH\ D UROH IRU OLSR LQ WKHLU GRZQUHJXODWLRQ ZRXOG EH VWUHQJWKHQHG ,Q FRQWUDVW WR ZKDW ZDV REVHUYHG LQ WKH KHDUW DQG NLGQH\ OLSR P51$ ZDV QRW LQFUHDVHG LQ WKH KLQGOHJ PXVFOH RI 67=LQMHFWHG DQLPDOV UHPRYHG IURP LQVXOLQ WUHDWPHQW UHODWLYH WR WKRVH ZKLFK ZHUH RQ LQVXOLQ )LJ f ,Q OLJKW RI WKH REVHUYDWLRQ WKDW KLQGOHJ PXVFOH OLSR P51$ ZDV LQFUHDVHG DIWHU 67=LQMHFWLRQ )LJ DQG f UHODWLYH WR QRUPDO DQLPDOV VHYHUDO SRVVLELOLWLHV H[LVW 2QH LV WKDW WKH LQFUHDVH LQ OLSR P51$ LQ KLQGOHJ PXVFOH DIWHU 67= LQMHFWLRQ ZDV D GLUHFW WUDQVLHQW HIIHFW RI 67= RQ WKDW PXVFOH UDWKHU WKDW D FRQVHTXHQFH RI GLDEHWHV 2U SHUKDSV WKH LQFUHDVH LQ KLQGOHJ PXVFOH OLSR P51$ RQO\ RFFXUV WUDQVLHQWO\ GXULQJ WKH ILUVW IHZ GD\V RI DFXWH GLDEHWHV DQG FDQQRW UHFXU GXULQJ D VHFRQG LQFLGHQFH RI VHYHUH GLDEHWHV IROORZLQJ LQVXOLQ WUHDWPHQW +DYLQJ HVWDEOLVKHG WKDW OLSR P51$ OHYHOV LQFUHDVH LQ WKH GLDEHWLF KHDUW NLGQH\ DQG VNHOHWDO PXVFOH QH[W

PAGE 84

LQYHVWLJDWHG VHYHUDO KRUPRQHV ZKLFK PLJKW PHGLDWH WKLV HIIHFW 2I WKH KRUPRQHV WHVWHG RQO\ JOXFDJRQ D KRUPRQH ZKLFK LV KLJKO\ HOHYDWHG GXULQJ GLDEHWHV 8QJHU HW DO f FRQVLVWHQWO\ DOWHUHG OLSR P51$ H[SUHVVLRQ .QRZQ WDUJHW WLVVXHV IRU JOXFDJRQ DFWLRQ LQFOXGH WKH OLYHU DGLSRVH WLVVXH KHDUW NLGQH\ LQWHVWLQH DQG VNHOHWDO PXVFOH /HIHEYUH DQG /X\FN[ f 7KH HIIHFW REVHUYHG DQ LQGXFWLRQ RI WKUHH WR ILYHIROG ZDV REVHUYHG LQ WKH KHDUW EXW QRW LQ WKH NLGQH\ RU VNHOHWDO PXVFOH VWDUWLQJ KU DIWHU LQMHFWLRQ 1R FKDQJHV ZHUH REVHUYHG LQ NLGQH\ RU VNHOHWDO PXVFOH XS WR KU DIWHU JOXFDJRQ DGPLQLVWUDWLRQ )LJ f 7KHVH UHVXOWV VXJJHVW WKDW HOHYDWHG JOXFDJRQ OHYHOV PD\ PHGLDWH D UHODWLYHO\ UDSLG LQGXFWLRQ RI OLSR P51$ LQ WKH GLDEHWLF KHDUW ZKLOH LQGXFWLRQ LQ WKH GLDEHWLF NLGQH\ DQG VNHOHWDO PXVFOH PD\ UHTXLUH ORQJHU H[SRVXUH WR KLJK JOXFDJRQ OHYHOV RU QRW LQYROYH JOXFDJRQ ,Q VXSSRUW RI D PRUH ORQJ WHUP HIIHFW RI JOXFDJRQ LQ WKH NLGQH\ JOXFDJRQ LQIXVLRQ IRU VHYHQ GD\V SURPRWHG UHQDO JURZWK LQ WKH UDW D SKHQRPHQRQ NQRZQ WR RFFXU GXULQJ GLDEHWHV /RJDQ DQG /HH f 7KH SRVLWLYH FKURQRWURSLF DQG LQRWURSLF DFWLRQV RI JOXFDJRQ RQ WKH KHDUW LQFUHDVH LQ KHDUW UDWH DQG FRQWUDFWLOLW\f KDYH EHHQ ZHOO GRFXPHQWHG LQ PDQ\ VSHFLHV LQFOXGLQJ GRJ UDW DQG JXLQHD SLJ )DUDK DQG 7XWWOH f $OWHUDWLRQV LQ LQWUDFHOOXODU FDOFLXP OHYHOV E\ JOXFDJRQ DUH LPSRUWDQW LQ WKHVH HIIHFWV RQ WKH UDW KHDUW &KHUQRZ HW DO

PAGE 85

f EXW WKH UROH RI F$03 LV XQFOHDU %XVXWWLO HW DO /D5DLD HW DO 5RGJHUV HW DO f ,Q WKH DGXOW PRXVH KHDUW HYLGHQFH ZDV VKRZQ WKDW F$03 ZDV QRW DOWHUHG GXULQJ WKH FKURQRWURSLF DQG LQRWURSLF DFWLRQV RI JOXFDJRQ &ODUN HW DO f 7KH LQGXFWLRQ RI OLSR P51$ LQ WKH UDW KHDUW E\ JOXFDJRQ PD\ QRW LQYROYH FKDQJHV LQ F$03 OHYHOV ,QFUHDVHG OLSR P51$ OHYHOV ZHUH QRW REVHUYHG LQ HLWKHU UDWV RU PLFH DIWHU LQMHFWLRQ RI HSLQHSKULQH D KRUPRQH ZKLFK HOLFLWV KHDUW HIIHFWV VLPLODU WR WKRVH RI JOXFDJRQ DQG DFWV YLD F$03 5HJDQ HW DO f RU DIWHU LQMHFWLRQ RI GLEXW\UDO F$03 )LJ DQG f EHOLHYH WKDW LQGXFHG OHYHOV RI OLSR P51$ LQ WKH KHDUW PD\ EH GXH WR JOXFDJRQPHGLDWHG F$03 LQGHSHQGHQW FKDQJHV LQ FDOFLXP OHYHOV 3HWHUVHQ DQG %HDU :DNHODP HW DO f ,Q VXPPDU\ OLSR P51$ OHYHOV DUH LQGXFHG LQ WKH KHDUW NLGQH\ DQG KLQGOHJ PXVFOH RI VWUHSWR]RWRFLQGLDEHWLF UDWV *OXFDJRQ LQMHFWLRQ OHDGV WR LQFUHDVHG OLSR P51$ OHYHOV LQ WKH KHDUW EXW QRW LQ WKH NLGQH\ RU KLQGOHJ PXVFOH DV HDUO\ DV KU IROORZLQJ DGPLQLVWUDWLRQ 7KHVH UHVXOWV VXJJHVW WKDW JOXFDJRQ PD\ SOD\ D SULPDU\ UROH LQ KHDUW OLSR P51$ LQGXFWLRQ GXULQJ GLDEHWHV DQG WKDW LQGXFWLRQ LQ WKH GLDEHWLF NLGQH\ DQG VNHOHWDO PXVFOH LQYROYHV IDFWRUV RWKHU WKDQ RU LV LQGHSHQGHQW RI JOXFDJRQ ,QGXFWLRQ RI OLSR P51$ GXULQJ GLDEHWHV PD\ LQYROYH DOWHUDWLRQV LQ DUDFKLGRQLF DFLG RU SKRVSKRLQRVLWRO

PAGE 86

PHWDEROLVP %HUJK HW DO &UDYHQ DQG 'H5XEHUWLV )DDV DQG &DUWHU *XEMDUQDVRQ HW DO +ROPDQ HW DO -RKQVRQ HW DO 3LHSHU 6FKUDGH HW DO :LQHJUDG f 3HUKDSV WKHVH FKDQJHV RFFXU UDSLGO\ LQ WKH KHDUW LQ UHVSRQVH WR HOHYDWHG JOXFDJRQ DQG PRUH JUDGXDOO\ LQ NLGQH\ DQG VNHOHWDO PXVFOH DV WKH GLVHDVH SURJUHVVHV DQG WLVVXH IXQFWLRQ GHWHULRUDWHV

PAGE 87

&+$37(5 &21&/86,216 $1' )857+(5 ',5(&7,216 6WXGLHV LQ WKLV GLVVHUWDWLRQ SURYLGH WKH EDVLV IRU IXWXUH H[SHULPHQWV WR LQYHVWLJDWH WKH PHFKDQLVPV JRYHUQLQJ UHJXODWLRQ RI WKH OLSR JHQH ,Q &KDSWHU WKH PRXVH OLSR JHQH VWUXFWXUH ZDV GHWHUPLQHG $Q LQWHUHVWLQJ ILQGLQJ ZDV WKDW WKUHH RI WKH IRXU DPLQR DFLG FRQVHQVXV VHTXHQFHV EHOLHYHG WR EH LPSRUWDQW LQ OLSR SKRVSKROLSLGFDOFLXP ELQGLQJ DFWLYLW\ ZHUH HQFRGHG E\ WKH ODVW FRGRQ RI RQH H[RQ DQG WKH IROORZLQJ FRGRQV RI WKH QH[W H[RQ 7KLV LV KLJKO\ VXJJHVWLYH RI DQ H[RQ GXSOLFDWLRQ HYHQW HDUO\ LQ WKH HYROXWLRQ RI OLSR 7KHUH LV D VWULNLQJ VLPLODULW\ LQ WKH JHQH VWUXFWXUHV RI OLSR DQG OLSR ,, $PLJXHW HW DO f LQGLFDWLQJ WKDW WKHVH WZR DQQH[LQV DUH GHULYHG IURP D FRPPRQ DQFHVWRU ,W ZLOO EH YHU\ LQWHUHVWLQJ WR FRPSDUH WKH JHQH VWUXFWXUHV RI OLSR DQG ,, ZLWK WKRVH RI WKH RWKHU DQQH[LQV LQFOXGLQJ WKH N'D VSHFLHV ZKHQ WKHVH DUH GHWHUPLQHG 6XFK DQDO\VLV PD\ SURYLGH LQVLJKW UHJDUGLQJ WKH UHODWLRQVKLS EHWZHHQ WKH DQQH[LQV DQG WKHLU HYROXWLRQ 7KH OLSR SURPRWHU UHJLRQ ZDV VKRZQ WR FRQWDLQ VHYHUDO SRWHQWLDO UHJXODWRU\ VLWHV ZKLFK PDWFKHG RU UHVHPEOHG NQRZQ FRQVHQVXV VHTXHQFHV 7KHUH LV LQGLUHFW HYLGHQFH WKDW VRPH RI WKHVH VLWHV PD\ EH IXQFWLRQDO /LSRFRUWLQ H[SUHVVLRQ

PAGE 88

LQ WKH PRXVH PDPPDU\ HSLWKHOLDO FHOO OLQH +& LV HIIHFWHG E\ VHUXP +RUOLFN XQSXEOLVKHG UHVXOWVf DQG WZR SRWHQWLDO VHUXP UHVSRQVH HOHPHQWV ZHUH LGHQWLILHG LQ WKH OLSR SURPRWHU 7KH VLWHV LGHQWLILHG ZKLFK DUH PRVW OLNHO\ WR EH LQYROYHG LQ OLSR UHJXODWLRQ DUH WKH SXWDWLYH JOXFRFRUWLFRLG UHVSRQVH HOHPHQWV SDUWLFXODUO\ WKH GHOD\HG JOXFRFRUWLFRLG UHVSRQVH HOHPHQW /LSR P51$ KDV EHHQ VKRZQ WR EH LQGXFHG E\ GH[DPHWKDVRQH LQ PDFURSKDJHV :DOOQHU HW DO f DQG ILEUREODVWV 3KLOOLSV HW DO :RQJ HW DO VXEPLWWHGf DOWKRXJK WKLV GRHV QRW RFFXU LQ DOO FHOO W\SHV H[DPLQHG %LHQNRZVNL HW DO %URQQHJDUG HW DO +XOOLQ HW DO ,VDFNH HW DO 1RUWKXS HW DO :LOOLDP HW DO f 6WXGLHV RXWOLQHG ODWHU LQ WKLV FKDSWHU DUH GHVLJQHG WR GHWHUPLQH ZKHWKHU WKH VLWHV LGHQWLIHG LQ WKH OLSR SURPRWHU DUH LQGHHG LQYROYHG LQ OLSR P51$ UHJXODWLRQ DQG WR SRVVLEO\ LGHQWLI\ RWKHUV &KDSWHUV DQG LQYROYH WLVVXHVSHFLILF UHJXODWLRQ RI OLSR P51$ LQ WZR YHU\ GLIIHUHQW UDW V\VWHPV 7KH GLIIHUHQWLDWLQJ PDPPDU\ JODQG DQG VWUHSWR]RWRFLQLQGXFHG GLDEHWHV 6WXGLHV LQ &KDSWHU GHPRQVWUDWH WKDW OLSR H[KLELWV D VWULNLQJ UHJXODWLRQ DV WKH PDPPDU\ JODQG XQGHUJRHV QRUPDO GLIIHUHQWLDWLRQ DQG LQYROXWLRQ DQG WKDW WKH VXFNOLQJ VWLPXOXV SOD\V D UROH LQ WKLV UHJXODWLRQ :KLOH WKHUH DUH VHYHUDO GLIIHUHQW FHOO W\SHV LQ PDPPDU\ WLVVXH LW LV OLNHO\ WKDW HSLWKHOLDO FHOOV DUH WKH GRPLQDQW IDFWRU LQ WKH OLSR UHJXODWLRQ REVHUYHG

PAGE 89

,PPXQRORFDOL]DWLRQ VWXGLHV XVLQJ PDPPDU\ WLVVXH VHFWLRQV IURP YDULRXV VWDJHV RI GHYHORSPHQW VLPLODU WR WKRVH FDUULHG RXW IRU OLSRFRUWLQ ,, DQG FDOHOHFWULQ LQ WKH PRXVH PDPPDU\ JODQG /R]DQR HW DO Df FRXOG FRQILUP WKLV K\SRWKHVLV 7KH IDFW WKDW ODUJH FKDQJHV LQ OLSR H[SUHVVLRQ FRLQFLGH ZLWK SHULRGV ZKHQ HSLWKHOLDO FHOOV FKDQJH JURZWK DQG GLIIHUHQWLDWLYH VWDWXV VXJJHVWV WKH WZR PD\ EH UHODWHG ,Q OLJKW RI WKLV KDYH SURSRVHG WKDW KLJK OHYHOV RI OLSR PD\ EH DVVRFLDWHG ZLWK WKH GRUPDQW HSLWKHOLDO FHOOV RI WKH PDWXUH YLUJLQ DQG LQYROXWHG JODQGV $ KRUPRQH RU JURZWK IDFWRUPHGLDWHG HYHQW GXULQJ SUHJQDQF\ ZKLFK OHDGV WR GHFUHDVHG OHYHOV RI OLSR PD\ EH QHFHVVDU\ IRU GRUPDQW HSLWKHOLDO FHOOV WR SUROLIHUDWH DQG GLIIHUHQWLDWH LQWR VHFUHWRU\ FHOOV 2QH RI WKH PRVW LQWHUHVWLQJ ILQGLQJV LQ WKHVH VWXGLHV LV WKDW VRPH W\SH RI WUDQVODWLRQDO FRQWURO RI OLSR DSSDUHQWO\ RFFXUV LQ PDPPDU\ WLVVXH $IWHU SUHPDWXUH SXS ZLWKGUDZDO OLSR P51$ LQFUHDVHG UDSLGO\ DQG UHDFKHG SHDN OHYHOV DURXQG KU IROORZLQJ UHPRYDO ,Q FRQWUDVW OLWWOH RU QR SURWHLQ ZDV GHWHFWHG XQWLO VRPH WLPH DIWHU KU IROORZLQJ SXS ZLWKGUDZDO DQG SHDN OHYHOV ZHUH REVHUYHG E\ ILYH GD\V IROORZLQJ ZLWKGUDZDO 7KLV LQGLFDWHV WKDW DOWKRXJK D ODUJH SRRO RI OLSR P51$ DFFXPXODWHV VRRQ DIWHU FHVVDWLRQ RI VXFNOLQJ WUDQVODWLRQ LV VLJQLILFDQWO\ GHOD\HG EHOLHYH WKDW D UDSLG VLJQDO VHQW WR WKH PDPPDU\ JODQG DIWHU SXS ZLWKGUDZDO PHGLDWHG E\ WKH V\PSDWKHWLF QHUYRXV

PAGE 90

V\VWHP WULJJHUV D UDSLG LQFUHDVH LQ OLSR P51$ H[SUHVVLRQ LQ VHFUHWRU\ HSLWKHOLDO FHOOV GHVWLQHG WR UHYHUW WR WKH UHVWLQJ VWDWH GXULQJ LQYROXWLRQ ,Q VLWX K\EULGL]DWLRQ WR ORFDOL]H OLSR P51$ FRXOG FRQILUP WKLV WKHRU\ 7KH GHOD\ LQ WUDQVODWLRQ RI OLSR P51$ PD\ UHIOHFW WKH WLPH QHFHVVDU\ IRU WKH JODQG DQG HSLWKHOLDO FHOOV LQ SDUWLFXODU WR FRPPLW WR LQYROXWLRQ /LSRFRUWLQ P51$ PD\ DFFXPXODWH LQ FHUWDLQ HSLWKHOLDO FHOOV LPPHGLDWHO\ DIWHU FHVVDWLRQ RI VXFNOLQJ LQ SUHSDUDWLRQ IRU UHYHUVLRQ WR WKH UHVWLQJ VWDWH EXW WUDQVODWLRQ FRXOG EH GHOD\HG IRU VHYHUDO GD\V LQ FDVH VXFNOLQJ PXVW UHVXPH $W D WLPH EHOLHYHG WR EH DERXW ILYH GD\V IROORZLQJ SXS UHPRYDO 6LOYHU f ODFWDWLRQ LV QR ORQJHU SRVVLEOH DQG HSLWKHOLDO FHOOV DUH FRPPLWWHG WR GHDWK RU UHYHUVLRQ WR GRUPDQF\ +ROOPDQQ f 7KH H[SUHVVLRQ SDWWHUQ RI PDPPDU\ OLSR GXULQJ ERWK QDWXUDO GHYHORSPHQW DQG DIWHU SUHPDWXUH FHVVDWLRQ RI VXFNOLQJ LV FRQVLVWDQW ZLWK DQ LPSRUWDQW UROH IRU OLSR LQ WKH UHVWLQJ HSLWKHOLDO FHOOV :KLOH WKLV UROH FDQQRW EH FXUUHQWO\ GHWHUPLQHG KDYH VXJJHVWHG OLSR PD\ SRVVLEO\ EH QHFHVVDU\ WR SUHYHQW SKRVSKRLQRVLWRO WXUQRYHU LQ WKHVH FHOOV NHHSLQJ WKHP IURP SUROLIHUDWLQJ XQWLO WKH DSSURSULDWH WLPH GXULQJ SUHJQDQF\ 7KH LQ YLYR PDPPDU\ JODQG VWXGLHV SDUWLFXODUO\ WKRVH LQYROYLQJ UHPRYDO RI WKH VXFNOLQJ VWLPXOXV LQGLFDWH WKDW OLSR P51$ LV VXEMHFW WR UHJXODWLRQ DW WKH OHYHOV RI ERWK P51$ H[SUHVVLRQ DQG WUDQVODWLRQ 7KH IRUPHU W\SH RI UHJXODWLRQ FRXOG EH HLWKHU GXH WR WUDQVFULSWLRQDO FRQWURO

PAGE 91

[R51$ VWDELOLW\ FKDQJHV RU D FRPELQDWLRQ RI ERWK 'XH WR WKH FRPSOH[LW\ RI WKH PDPPDU\ JODQG DQG LWV PXOWLSOH FHOO W\SHV DQ LQ YLWUR V\VWHP ZLOO OLNHO\ EH QHFHVVDU\ WR IXUWKHU H[SORUH PDPPDU\ OLSR UHJXODWLRQ :KLOH LQGLUHFW HYLGHQFH VXJJHVWV D PDPPDU\ HSLWKHOLDO FHOO OLQH ZRXOG EH WKH EHVW WR LQYHVWLJDWH LPPXQRORFDOL]DWLRQ DQG LQ VLWX K\EULGL]DWLRQ VWXGLHV ZRXOG EH XVHIXO LQ FRQILUPLQJ WKLV KDYH FDUULHG RXW SUHOLPLQDU\ VWXGLHV RQ OLSR P51$ H[SUHVVLRQ LQ WKH PRXVH PDPPDU\ HSLWKHOLDO OLQH +& ZKLFK KDV EHHQ VKRZQ WR EH UHVSRQVLYH WR ERWK SURODFWLQ DQG GH[DPHWKDVRQH %DOO HW DO 'RSSOHU HW DO f 7KHVH FHOOV GHULYHG IURP PLGSUHJQDQW PRXVH PDPPDU\ WLVVXH H[SUHVV KLJK OHYHOV RI OLSR P51$ GDWD QRW VKRZQf 7KHUHIRUH LW FRXOG EH D XVHIXO V\VWHP LQ GHWHUPLQLQJ IDFWRUV WKDW GRZQUHJXODWH OLSR GXULQJ SUHJQDQF\ $FFRUGLQJO\ LQYHVWLJDWHG WKH HIIHFWV RI VHYHUDO KRUPRQHV RQ H[SUHVVLRQ RI OLSR P51$ LQ +& FHOOV 1HLWKHU SURODFWLQ HVWURJHQ SURJHVWHURQH HSLGHUPDO JURZWK IDFWRU QRU LQVXOLQ KDG DQ HIIHFW GDWD QRW VKRZQf EXW WZR QRWHZRUWK\ REVHUYDWLRQV ZHUH PDGH 'H[DPHWKDVRQH FDXVHG D UHSURGXFLEOH LQFUHDVH LQ OLSR P51$ OHYHOV DQG VHUXP KDG DQ LQKLELWRU\ LQIOXHQFH RQ P51$ H[SUHVVLRQ 0RUH WKRURXJK VWXGLHV XVLQJ +& RU DQRWKHU RI WKH DYDLODEOH PDPPDU\ HSLWKHOLDO FHOO OLQHV PD\ EH XVHIXO LQ IXUWKHU GHILQLQJ WKH KRUPRQDO VLJQDOV ZKLFK UHJXODWH OLSR LQ WKH PDPPDU\ JODQG ([SHULPHQWV XWLOL]LQJ PDPPDU\ H[SODQWV LQ FXOWXUH PD\ DOVR

PAGE 92

SURYH XVHIXO 0DWXVLN DQG 5RVHQ f EXW ZRXOG VWLOO KDYH WKH SUREOHP RI PXOWLSOH FHOO W\SHV ,Q &KDSWHU LW ZDV VKRZQ WKDW OLSR P51$ H[SUHVVLRQ ZDV LQFUHDVHG LQ FHUWDLQ WLVVXHV RI WKUHHGD\ VWUHSWR]RWRFLQGLDEHWLF UDWV DQG WKDW JOXFDJRQ PD\ SOD\ D UROH LQ OLSR P51$ LQGXFWLRQ LQ WKH GLDEHWLF KHDUW 'LDEHWHV LV D FRPSOH[ GLVHDVH UHVXOWLQJ LQ PDQ\ KRUPRQDO DOWHUDWLRQV VR DJDLQ DQ LQ YLWUR V\VWHP ZLOO EH UHTXLUHG WR IXUWKHU VWXG\ WKH PHFKDQLVP RI OLSR UHJXODWLRQ $Q LPSRUWDQW TXHVWLRQ WR DGGUHVV LV ZKDW SDUWLFXODU KRUPRQHV RU DVSHFWV RI DOWHUHG FHOOXODU PHWDEROLVP DUH IDFWRUV LQ UHJXODWLQJ OLSR H[SUHVVLRQ ([SHULPHQWV VKRXOG IRFXV RQ FHOO OLQHV GHULYHG IURP WKH KHDUW NLGQH\ DQG VNHOHWDO PXVFOH EHFDXVH WKHVH WLVVXHV VKRZHG DOWHUHG OLSR H[SUHVVLRQ LQ GLDEHWLF DQLPDOV +HDUW FHOOV ZRXOG EH PRVW LQWHUHVWLQJ GXH WR WKH DELOLW\ RI JOXFDJRQ WR DOWHU OLSR P51$ OHYHOV LQ WKH KHDUW $V PHQWLRQHG UHJDUGLQJ WKH PDPPDU\ JODQG VWXGLHV LQ VLWX K\EULGL]DWLRQ ZRXOG EH KHOSIXO LQ LQGLFDWLQJ ZKLFK SDUWLFXODU FHOO W\SHV LQ WLVVXHV H[SUHVV OLSR P51$ DQG WKHUHIRUH ZKLFK FHOO OLQHV PLJKW EH WKH EHVW FDQGLGDWHV IRU VWXG\ FDUULHG RXW SUHOLPLQDU\ VWXGLHV WR DWWHPSW WR LGHQWLI\ D JOXFDJRQ RU GH[DPHWKDVRQHUHVSRQVLYH FHOO OLQH RI NLGQH\ RU PXVFOH RULJLQ /LSRFRUWLQ P51$ OHYHOV ZHUH QRW DIIHFWHG E\ WKHVH KRUPRQHV LQ UDW PHVDQJLDO FHOOV ZKLFK

PAGE 93

DUH VPRRWK PXVFOHOLNH FHOOV IURP WKH NLGQH\ RU LQ WKH PRXVH VNHOHWDO PXVFOH OLQH &KLFN KHDUW DWULDO FHOOV ZHUH DOVR H[DPLQHG EXW LQVXIILFLHQW FURVVK\EULGL]DWLRQ ZLWK RXU PRXVH F'1$ SUREH ZDV D SUREOHP ,I KHDUW P\RF\WHV ZHUH VKRZQ E\ LQ VLWX K\EULGL]DWLRQ WR H[SUHVV OLSR P51$ IXUWKHU LQYHVWLJDWLRQ RI WKHVH FHOOV PLJKW SURYH ZRUWKZKLOH ,W LV SRVVLEOH WR LVRODWH DQG PDLQWDLQ EHDWLQJ KHDUW P\RF\WHV IURP DGXOW PLFH RU UDWV LQ FXOWXUH -DFREVRQ DQG 3LSHU f VR SRWHQWLDO KRUPRQDO HIIHFWV RQ OLSR H[SUHVVLRQ LQ WKHVH FHOOV FDQ EH HYDOXDWHG 3URYLGLQJ WKDW IXWXUH VWXGLHV EDVHG RQ WKH LQIRUPDWLRQ LQ &KDSWHUV DQG ZLOO GHILQH D FHOO OLQH ZKLFK H[KLELWV OLSR P51$ UHJXODWLRQ LQ UHVSRQVH WR D KRUPRQDO VWLPXOXV RU FKDQJH LQ JURZWK VWDWXV H[SHULPHQWV WR SUREH WKH PHFKDQLVP RI WKLV UHJXODWLRQ FDQ EH XQGHUWDNHQ 0XOWLSOH FHOO W\SHV ZRXOG PDNH VXFK VWXGLHV LQ ZKROH WLVVXHV XQOLNHO\ WR VXFFHHG DQG GLIILFXOW WR LQWHUSUHW ,QLWLDOO\ WKH PHFKDQVLP E\ ZKLFK D FKDQJH LQ P51$ OHYHOV RFFXUV ZRXOG EH LQYHVWLJDWHG $V VWDWHG EHIRUH WKLV FRXOG UHVXOW IURP WUDQVFULSWLRQDO DOWHUDWLRQV RU FKDQJHV LQ P51$ VWDELOLW\ RU VRPH RWKHU SRVWWUDQVFULSWLRQDO PHDQV ([SHULPHQWV LQFRUSRUDWLQJ WKH WUDQVFULSWLRQDO LQKLELWRU DFWLQRP\FLQ DQG WKH SURWHLQ V\QWKHVLV LQKLELWRU F\FORKH[LPLGH ZRXOG KHOS DQVZHU VXFK TXHVWLRQV 7KH QXFOHDU UXQRQ DVVD\ ZKLFK PHDVXUHV WKH DPRXQW RI QDVFHQW WUDQVFULSWV LQ LVRODWHG QXFOHL FRXOG EH XVHG WR LQYHVWLJDWH WUDQVFULSWLRQDO FKDQJHV 0F.QLJKW DQG 3DOPLWHU f

PAGE 94

$IWHU REWDLQLQJ VRPH LGHD RI WKH W\SHVf RI PHFKDQLVPV LQYROYHG LQ UHJXODWLRQ RI OLSR JHQH H[SUHVVLRQ SDUWLFXODU VLWHV LQ WKH JHQH DQG LWV SURPRWHU PHGLDWLQJ WKLV UHJXODWLRQ FDQ EH LQYHVWLJDWHG 7ZR W\SHV RI H[SHULPHQWV GHOHWLRQ DQDO\VLV DQG FKURPDWLQ VWUXFWXUH DQDO\VLV PD\ EH XQGHUWDNHQ WR LGHQWLI\ SRWHQWLDO UHJXODWRU\ UHJLRQV 7KH ILUVW LQYROYHV WUDQVIHFWLRQ RI SURPRWHU GHOHWLRQ PXWDQWV LQWR FHOO OLQHV DQG DVVD\LQJ IRU WUDQVFULSWLRQ OHYHOV RI D UHSRUWHU JHQH 7KLV FDQ EH GRQH HLWKHU E\ VHOHFWLQJ IRU VWDEOH WUDQVIHFWDQWV %XHWWL DQG 'LJJHOPDQQ f RU WKURXJK DQDO\VLV RI WKH HQWLUH SRSXODWLRQ RI WUDQVIHFWHG FHOOV UHIHUHG WR DV WUDQVLHQW H[SUHVVLRQ 'HDQ HW DO f &KURPDWLQ VWUXFWXUH DQDO\VLV LV EDVHG RQ WKH REVHUYDWLRQ WKDW SDQFUHDWLF GHR[\ULERQXFOHDVH RU '1DVH SUHIHUHQWLDOO\ GLJHVWV JHQHV WKDW DUH RU KDYH EHHQ WUDQVFULSWLRQDOO\ DFWLYH :HLQWUDXE DQG *URXGLQH f 0RVW RI WKH FOHDYDJH VLWHV IRU '1DVH UHIHUUHG WR DV '1DVH K\SHUVHQVLWLYH VLWHV KDYH EHHQ ORFDOL]HG WR WKH n IODQNLQJ UHJLRQ RI JHQHV (OJLQ f ,Q PDQ\ FDVHV '1DVH K\SHUVHQVLWLYH VLWHV ZHUH VKRZQ WR RFFXU FORVH WR LPSRUWDQW UHJXODWRU\ HOHPHQWV VXFK DV HQKDQFHUV =DUHW DQG
PAGE 95

,I '1DVH K\SHUVHQVLWLYH VLWHV DUH IRXQG XVLQJ FRQYHQWLRQDO PHWKRGV WKH\ PD\ EH PRUH SUHFLVHO\ ORFDWHG E\ D UHFHQWO\ GHYHORSHG KLJK UHVROXWLRQ WHFKQLTXH 7KLV LQYROYHV HOHFWURSKRUHVLQJ JHQRPLF '1$ RQ QDWLYH SRO\DFU\ODPLGH JHOV SULRU WR HOHFWUREORWWLQJ DQG K\EULGL]DWLRQ DQG KDV EHHQ XWLOL]HG WR PDS '1$VH K\SHUVHQVLWLYH VLWHV LQ WKH KXPDQ KLVWRQH + JHQH 3DXOL HW DO f ,QIRUPDWLRQ SURYLGHG E\ WKH DERYH WHFKQLTXHV PD\ DOORZ VWXGLHV RI OLSR JHQH UHJXODWLRQ LQ YLYR DW QXFOHRWLGH UHVROXWLRQ ,QWDFW FHOOV DUH WUHDWHG ZLWK D FKHPLFDO SUREH IRU '1$ VWUXFWXUH GLPHWK\OVXOIDWH DQG '1$SURWHLQ LQWHUDFWLRQV DUH YLVXDOL]HG RQ '1$ VHTXHQFLQJ JHOV DV UHVLGXHV ZLWK DOWHUHG UHDFWLYLW\ WR '06 &KXUFK DQG *LOEHUW f 7KLV LQ YLYR DQDO\VLV KDV WKH DGYDQWDJH RI DYRLGLQJ DUWLIDFWV ZKLFK PLJKW EH REWDLQHG LQ LQ YLWUR VWXGLHV VXFK DV JHO UHWDUGDWLRQ DVVD\V )ULHG DQG &URWKHUV f EXW LV OLPLWHG WR UHYHDOLQJ LQWHUDFWLRQV DW RQO\ *UHVLGXHV ,Q FRQFOXVLRQ VWXGLHV GHVFULEHG KHUH PDNH DQ LPSRUWDQW FRQWULEXWLRQ WR WKH DQQH[LQ ILHOG LQ VHYHUDO ZD\V 7KH UHVXOWV LQ &KDSWHU FRQFHUQLQJ OLSR DORQJ ZLWK ZKDW LV NQRZQ DERXW WKH OLSRFRUWLQ ,, JHQH VWURQJO\ VXJJHVW D FRPPRQ DQFHVWRU IRU WKHVH SURWHLQV DQG ZLOO EH LPSRUWDQW LQ HOXFLGDWLQJ WKH HYROXWLRQ RI WKH DQQH[LQV ZKHQ WKH UHPDLQLQJ JHQHV DUH FKDUDFWHUL]HG ,Q DGGLWLRQ VHTXHQFH LQIRUPDWLRQ IURP WKH SURPRWHU QRZ HQDEOHV UHJXODWRU\ VWXGLHV WR EH

PAGE 96

GHVLJQHG ([SHULPHQWV VKRZQ LQ &KDSWHU UHSUHVHQW WKH PRVW GUDPDWLF H[DPSOHV RI OLSR P51$ DQG SURWHLQ UHJXODWLRQ FXUUHQWO\ NQRZQ DQG ZLOO KRSHIXOO\ OHDG WR D WLVVXH FXOWXUH V\VWHP LQ ZKLFK WKLV UHJXODWLRQ FDQ EH IXUWKHU GHILQHG DQG LQYHVWLJDWHG $OVR WKH SRWHQWLDO OLQN EHWZHHQ OLSR DQG PDPPDU\ FHOO JURZWK VWDWXV GHVHUYHV IXUWKHU LQYHVWLJDWLRQ DQG PD\ LQGLFDWH WKDW OLSR OLNH OLSR ,,, LV LQYROYHG LQ DQ LPSRUWDQW ELRFKHPLFDO SDWKZD\ VXFK DV LQRVLWRO PHWDEROLVP )LQDOO\ VWXGLHV LQ &KDSWHU VKRZ IRU WKH ILUVW WLPH D OLQN EHWZHHQ JOXFDJRQ DQG LQGXFHG H[SUHVVLRQ RI DQ DQQH[LQ DQG RIIHU WKH SRVVLELOLW\ WKDW OLSR LV LQYROYHG LQ WKH DOWHUHG OLSLG PHWDEROLVP NQRZQ WR RFFXU GXULQJ GLDEHWHV

PAGE 97

5()(5(1&(6 $DUVPDQ $ 0\QEHHN 9DQ 'HQ %RVFK + 5RWKKXW % 3ULHXU % &RPHU£ & -RUGDQ / DQG 5XVVR0DULH ) f /LSRFRUWLQ LQKLELWLRQ RI H[WUDFHOOXODU DQG LQWUDFHOOXODU SKRVSKROLSDVHV $ LV VXEVWUDWH FRQFHQWUDWLRQ GHSHQGHQW )(%6 /HWW $GGLVRQ : 5 DQG .XUW] 7 f 1XFOHRWLGH VHTXHQFHV UHTXLUHG IRU WKH UHJXODWLRQ RI D UDW DX JOREXOLQ JHQH E\ JOXFRFRUWLFRLGV 0RO &HOO %LRO $PLJXHW 3 'n(XVWDFKLR 3 .ULVWHQVHQ 7 :HWVHO 5 $ 6DULV & 0 +XQWHU 7 &KDSOLQ ' DQG 7DFN % ) f 6WUXFWXUH DQG FKURPRVRPH DVVLJQPHQW RI WKH PXULQH S FDOSDFWLQ KHDY\ FKDLQf JHQH %LRFKHPLVWU\ $QGR < ,PDPXUD 6 +RQJ < 0 2ZDGD 0 .DNXQDJD 7 DQG .DQQDJL 5 f (QKDQFHPHQW RI FDOFLXP VHQVLWLYLW\ RI OLSRFRUWLQ LQ SKRVSKROLSLG ELQGLQJ LQGXFHG E\ OLPLWHG SURWHRO\VLV DQG SKRVSKRU\ODWLRQ DW WKH DPLQR WHUPLQXV DV DQDO\]HG E\ SKRVSKROLSLG DIILQLW\ FROXPQ FKURPDWRJUDSK\ %LRO &KHP $WNLQV ) / 'RZHOO 5 7 DQG /RYH 6 f DGUHQHUJLF UHFHSWRUV DGHQ\ODWH F\FODVH DFWLYLW\ DQG FDUGLDF G\VIXQFWLRQ LQ WKH GLDEHWLF UDW &DUGLRYDVF 3KDUPDFRO %DOO 5 )ULLV 5 5 6FKRHQHQEHUJHU & $ 'RSSROHU : DQG *URQHU % f 3URODFWLQ UHJXODWLRQ RI FDVHLQ JHQH H[SUHVVLRQ DQG RI D F\WRVROLF NG SURWHLQ LQ D FORQHG PRXVH PDPPDU\ HSLWKHOLDO FHOO OLQH (0%2 %HUJK &+ +MDOPDUVRQ $ 6MRJUHQ .* DQG -DFREVVRQ % f 7KH HIIHFW RI GLDEHWHV RQ SKRVSKDWLG\OLQRVLWRO WXUQRYHU DQG FDOFLXP LQIOX[ LQ P\RFDUGLXP +RUP 0HWDERO 5HV %KLPML 6 *RGLQ 9 DQG 0F1HLOO + f %LRFKHPLFDO DQG IXQFWLRQDO FKDQJHV LQ KHDUWV IURP UDEELWV ZLWK GLDEHWHV 'LDEHWRORTLD

PAGE 98

%LHOHIHOG 5 3DFH & 6 DQG %RVKHOO % 5 f $OWHUHG VHQVLWLYLW\ RI FKURQLF GLDEHWLF UDW KHDUW WR FDOFLXP $P 3K\VLRO (( %LHOVFKRZVNL 0 DQG %LHOVFKRZVNL ) f 7KH 1HZ =HDODQG VWUDLQ RI REHVH PLFH $XVWUDOLDQ ([S %LRO 0HG %LHQNRZVNL 03HWUR 0$ DQG 5RELQVRQ /f ,QKLELWLRQ RI WKURPER[DQH $ V\QWKHVLV LQ 8 FHOOV E\ JOXFRFRUWLFRLGV %LRO &KHP %ODFNZHOO *&DUQXFFLR 5 'L 5RVD 0 )ORZHU 53£UHQWH / DQG 3UVLFR 3 f 0DFURFRUWLQ D SRO\SHSWLGH FDXVLQJ WKH DQWLSKRVSKROLSDVH HIIHFW RI JOXFRFRUWLFRLGV 1DWXUH %ODNH & f ([RQVSUHVHQW IURP WKH EHJLQQLQJ" 1DWXUH %RUHOOLQL ) DQG 2ND 7 f *URZWK FRQWURO DQG GLIIHUHQWLDWLRQ LQ PDPPDU\ HSLWKHOLDO FHOOV (QY +HDOWK 3HUVSHF %UDVODX / 5LQJR / DQG 5RFKD 9 f 6\QWKHVLV RI QRYHO FDOFLXPGHSHQGHQW SURWHLQV DVVRFLDWHG ZLWK PDPPDU\ HSLWKHOLDO FHOO PLJUDWLRQ DQG GLIIHUHQWLDWLRQ ([S &HOO 5HV %UHDWKQDFK 5 DQG &KDPEQ 3 f 2UJDQL]DWLRQ DQG H[SUHVVLRQ RI HXFDU\RWLF VSOLW JHQHV FRGLQJ IRU SURWHLQV $QQX 5HY %LRFKHP %URQQHJDUG 0 $QGHUVVRQ 2 (GZDOO /XQG 1RUVWHGW DQG &DULVWHGW'XNH f +XPDQ FDOSDFWLQ ,, OLSRFRUWLQ ,f PHVVHQJHU ULERQXFOHLF DFLG LV QRW LQGXFHG E\ JOXFRFRUWLFRLGV 0RO (QGRFULQRO %XHWWL ( DQG 'LJJHOPDQQ + f *OXFRFRUWLFRLG UHJXODWLRQ RI PRXVH PDPPDU\ WXPRU YLUXV LGHQWLILFDWLRQ RI D VKRUW HVVHQWLDO '1$ UHJLRQ (0%2 %XUJRQ\QH 5 f &DOSDFWLQ LQ H[RF\WRVLV" 1DWXUH %XVXWWLO 5 : 3DGGRFN 5 )LVKHU : DQG *HRUJH : f &KDQJHV LQ F\FOLF QXFOHRWLGH OHYHOV DQG FRQWUDFWLOH IRUFH LQ WKH LVRODWHG K\SR[LF UDW KHDUW GXULQJ SHUIXVLRQ ZLWK JOXFDJRQ &LUF 5HV

PAGE 99

&KDVH + 3 :LOOLDPV 5 / DQG 'XSRQW f ,QFUHDVHG SURVWDJODQGLQ V\QWKHVLV LQ FKLOGKRRG GLDEHWHV PHOOLWXV 3HGLDWU &KHQ &/ & DQG )HLJHOVRQ 3 f +RUPRQDO FRQWURO RI DX JOREXOLQ V\QWKHVLV DQG LWV P51$ LQ LVRODWHG KHSDWRF\WHV $QQ 1< $FDG 6FL &KHUQRZ % =DORJD 3 0DOFROP :LOOH\ 6 & &ODSSHU 0 DQG +RODGD\ : f *OXFDJRQnV FKURQRWURSLF DFWLRQ LV FDOFLXP GHSHQGHQW 3KDUPDFRO ([S 7KHU &KHXQJ + & $OPLUD ( & .DQVDO 3 & DQG 5HGG\ : f $ PHPEUDQH DEQRUPDOLW\ LQ O\PSKRF\WHV IURP GLDEHWLF VXEMHFWV (QGRFU 5HV &RPPXQ &KRPF]\QVNL 3 DQG 6DFFKL 1 f 6LQJOHVWHS PHWKRG RI 51$ LVRODWLRQ E\ DFLG JXDQLGLQLXP WKLRF\DQDWH SKHQROFKORURIRUP H[WUDFWLRQ $QDO %LRFKHP &KULVWOLHE $ 5 f 'LDEHWHV DQG K\SHUWHQVLYH YDVFXODU GLVHDVH PHFKDQLVPV DQG WUHDWPHQW $P &DUGLRO &KXDK 6 < DQG 3DOOHQ & f &DOFLXPGHSHQGHQW DQG SKRVSKRU\ODWLRQVWLPXODWHG SURWHRO\VLV RI OLSRFRUWLQ E\ DQ HQGRJHQRXV $ FHOO PHPEUDQH SURWHDVH %LRO &KHP &KXUFK *0 DQG *LOEHUW : f *HQRPLF VHTXHQFLQJ 3URF 1DWO $FDG 6FL 86$ &ODUN & 0 -5 :DOOHU .RKDOPL *DUGQHU 5 &ODUN /HYH\ 6 :LOGHQWKDO DQG $OOHQ f (YLGHQFH WKDW F\FOLF $03 LV QRW LQYROYHG LQ WKH FKURQRWURSLF DFWLRQ RI JOXFDJRQ LQ WKH DGXOW PRXVH KHDUW (QGRFULQ &RRSHU $ DQG +XQWHU 7 f ,GHQWLILFDWLRQ DQG FKDUDFWHUL]DWLRQ RI FHOOXODU WDUJHWV IRU W\URVLQH SURWHLQ NLQDVHV %LRO &KHP &RUGHQ :DV\O\N % %XFKZDOGHU $ 6DVVRQH&RUVL 3 .HGLQJHU & DQG &KDPEQ 3 f 3URPRWHU VHTXHQFHV RI HXNDU\RWLF SURWHLQFRGLQJ JHQHV 6FLHQFH

PAGE 100

&RUWHV 3 'XOPHU ) *ROGPDQ DQG /HYLQ 1 : f 5HODWLRQVKLS EHWZHHQ UHQDO IXQFWLRQ DQG PHWDEROLF DOWHUDWLRQV LQ HDUO\ VWUHSWR]RWRFLQLQGXFHG GLDEHWHV LQ UDWV 'LDEHWHV &RUWHV 3 'XOPHU ) 9HQNDWDFKDODP DQG /HYLQ 1 : f (IIHFWV RI GLDEHWHV PHOOLWXV RQ UHQDO PHWDEROLVP 0LQHUDO (OHFWURO\WH 0HWDE &UDYHQ 3 $ DQG 'H5XEHUWLV ) 5 f 3URWHLQ NLQDVH & LV DFWLYDWHG LQ JORPHUXOL IURP VWUHSWR]RWRFLQ GLDEHWLF UDWV &OLQ ,QYHVW &UHXW] & ( =DNDV : +DPPDQ + & &UDQH 6 0DUWLQ : + *RXOG / 2GGLH 0 DQG 3DUVRQV 6 f ,GHQWLILFDWLRQ RI FKURPDIILQ JUDQXOHn ELQGLQJ SURWHLQV %LRO &KHP &URPSWRQ 0 5 0RVV 6 ( DQG &UXPSWRQ 0 f 'LYHUVLW\ LQ WKH FDOSDFWLQOLSRFRUWLQ IDPLO\ &HOO &UXPSWRQ 0 DQG 'HGPDQ 5 f 3URWHLQ WHUPLQRORJ\ WDQJOH 1DWXUH 'DYLGVRQ ) ) 'HQQLV ( $ 3RZHOO 0 DQG *OHQQH\ f ,QKLELWLRQ RI SKRVSKROLSDVH $ E\ OLSRFRUWLQV DQG FDOSDFWLQV DQ HIIHFW RI ELQGLQJ WR VXEVWUDWH SKRVSKROLSLGV %LRO &KHP 'H % 0LVRQR 6 /XNDV 7 0URF]NRZVNL % DQG &RKHQ 6 f $ FDOFLXPGHSHQGHQW NLORGDOWRQ VXEVWUDWH IRU HSLGHUPDO JURZWK IDFWRU UHFHSWRUNLQDVH LVRODWHG IURP QRUPDO WLVVXH %LRO &KHP 'HDQ & .QROO % 5LVHU 0 ( DQG 2n0DOOH\ % : f $ nIODQNLQJ VHTXHQFH HVVHQWLDO IRU SURJHVWHURQH UHJXODWLRQ RI DQ RYDOEXPLQ IXVLRQ JHQH 1DWXUH 'RSSROHU : *URQHU % DQG %DOO 5 f 3URODFWLQ DQG JOXFRFRUWLFRLG KRUPRQHV V\QHUJLVWLFDOO\ LQGXFH H[SUHVVLRQ RI WUDQVIHFWHG UDW FDVHLQ JHQH SURPRWHU FRQVWUXFWV LQ D PDPPDU\ HSLWKHOLDO FHOO OLQH 3URF 1DWO $FDG 6FL 86$ 'UXVW DQG &UHXW] & f $JJUHJDWLRQ RI FKURPDIILQ JUDQXOHV E\ FDOSDFWLQ DW PLFURPRODU OHYHOV RI FDOFLXP 1DWXUH

PAGE 101

'XQQ 6 6KHHKDQ + / DQG 0F/HWFKLH 1 % f 1HFURVLV RI LVOHWV RI ODQJHUKDQV SURGXFHG H[SHULPHQWDOO\ /DQFHW (GHU\ 0 3DQJ /DUVRQ / &RORVL 7 DQG 1DQGL 6 f (SLGHUPDO JURZWK IDFWRU UHFHSWRU OHYHOV LQ PRXVH PDPPDU\ JODQGV LQ YDULRXV SK\VLRORJLFDO VWDWHV (QGRFULQ (OJLQ 6 & 5 f '1DVH ,K\SHUVHQVLWLYH VLWHV RI FKURPDWLQ &HOO )DDV ) + DQG &DUWHU : f $OWHUHG IDWW\ DFLG GHVDWXUDWLRQ DQG PLFURVRPDO IDWW\ DFLG FRPSRVLWLRQ LQ WKH VWUHSWR]RWRFLQ GLDEHWLF UDW /LSLGV )DUDK $ DQG 7XWWOH 5 f 6WXGLHV RQ WKH SKDUPDFRORJ\ RI JOXFDJRQ 3KDUPDFRO ([S 7KHU )DYD 5 0F.DQQD DQG &RKHQ 6 f /LSRFRUWLQ Sf LV DEXQGDQW LQ D UHVWULFWHG QXPEHU RI GLIIHUHQWLDWHG FHOO W\SHV LQ DGXOW RUJDQV &HOO 3KYVLRO )HLQ ) 6 .RUQVWHLQ / % 6WUREHFN ( &DSDVVR 0 DQG 6RQQHQEOLFN ( + f $OWHUHG P\RFDUGLDO PHFKDQLFV LQ GLDEHWLF UDWV &LUF 5HV )HLQ ) 6 0LOOHU*UHHQ % DQG 6RQQHQEOLFN ( + f $OWHUHG P\RFDUGLDO PHFKDQLFV LQ GLDEHWLF UDEELWV $P 3KYVLRO ++ )HLQEHUJ $3 DQG 9RJHOVWHLQ % f $ WHFKQLTXH IRU UDGLRODEHOLQJ '1$ UHVWULFWLRQ HQGRQXFOHDVH IUDJPHQWV WR KLJK VSHFLILF DFWLYLW\ $QDO %LRFKHP )ORZHU 5 f /LSRFRUWLQ DQG WKH PHFKDQLVP RI DFWLRQ RI WKH JOXFRFRUWLFRLGV %U 3KDUPDFRO )ORZHU 5DQG %ODFNZHOO *f $QWLLQIODPPDWRU\ VWHURLGV LQGXFH ELRV\QWKHVLV RI D SKRVSKROLSDVH $ LQKLELWRU ZKLFK SUHYHQWV SURVWDJODQGLQ JHQHUDWLRQ 1DWXUH )ULHG 0 DQG &URWKHUV 0 f (TXLOLEULD DQG NLQHWLFV RI ODF UHSUHVVRURSHUDWRU LQWHUDFWLRQV E\ SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV 1XFO $FLGV 5HV

PAGE 102

)XQDNRVKL 7 +HQGULFNVRQ / ( 0F0XOOHQ % $ DQG )XMLNDZD f 3ULPDU\ VWUXFWXUH RI KXPDQ SODFHQWDO DQWLFRDJXODQW SURWHLQ %LRFKHPLVWU\ *DQJXOL 3 3LHUFH 1 'KDOOD 6 DQG 'KDOOD 1 6 f 'HIHFWLYH VDUFRSODVPLF UHWLFXODU FDOFLXP WUDQVSRUW LQ GLDEHWLF FDUGLRP\RSDWK\ $P 3K\VLRO (( *HLVRZ 0 )ULWVFKH 8 +H[KDP 0 'DVK % DQG -RKQVRQ 7 f $ FRQVHQVXV DPLQRDFLG VHTXHQFH UHSHDW LQ WRUSHGR DQG PDPPDOLDQ &DGHSHQGHQW PHPEUDQHELQGLQJ SURWHLQV 1DWXUH *HLVRZ 0 DQG :DONHU + f 1HZ SURWHLQV LQYROYHG LQ FHOO UHJXODWLRQ E\ &D DQG SKRVSKROLSLGV 7UHQGV %LRFKHP 6FL *LOEHUW : f :K\ JHQHV LQ SLHFHV" 1DWXUH *LXJQL 7 -DPHV / & DQG +DLJOHU + 7 f (SLGHUPDO JURZWK IDFWRU VWLPXODWHV W\URVLQH SKRVSKRU\ODWLRQ RI VSHFLILF SURWHLQV LQ SHUPHDELOL]HG KXPDQ ILEUREODVWV %LRO &KHP *OHQQH\ 5 -U f 7ZR UHODWHG EXW GLVWLQFW IRUPV RI WKH 0U W\URVLQH NLQDVH VXEVWUDWH FDOSDFWLQf WKDW LQWHUDFWV ZLWK SKRVSKROLSLGV DQG DFWLQ LQ D &D] GHSHQGHQW PDQQHU 3URF 1DWO $FDG 6FL 86$ *OHQQH\ 5 -U DQG 7DFN %) f $PLQRWHUPLQDO VHTXHQFH RI S DQG DVVRFLDWHG SO2 LGHQWLILFDWLRQ RI WKH VLWH RI W\URVLQH SKRVSKRU\ODWLRQ DQG KRPRORJ\ ZLWK 6 3URF 1DWO $FDG 6FL 86$ *OHQQH\ 5 -U 7DFN % DQG 3RZHOO 0 $ f 7ZR GLVWLQFW &DUHJXODWHG SKRVSKROLSLG DQG DFWLQELQGLQJ SURWHLQV LVRODWHG IURP OXQJ DQG SODFHQWD &HOO %LRO *RQ]DOH] $
PAGE 103

+DLGHU %
PAGE 104

+RNLQ / ( f 5HFHSWRUV DQG SKRVSKRLQRVLWLGH JHQHUDWHG VHFRQG PHVVHQJHUV $QQ 5HY %LRFKHP +ROOPDQQ + f &\WRORJ\ DQG ILQH VWUXFWXUH RI WKH PDPPDU\ JODQG ,Q % / /DUVRQ DQG 9 5 6PLWK HGVf /DFWDWLRQf§$ &RPSUHKHQVLYH 7UHDWLVH 9RO SS $FDGHPLF 3UHVV 1HZ
PAGE 105

-DFREVRQ 6 / DQG 3LSHU + 0 f &HOO FXOWXUHV RI DGXOW FDUGLRP\RF\WHV DV PRGHOV RI WKH P\RFDUGLXP 0RO &HOO &DUGLRO -RKQVRQ / (O+DJH $ (KUUHLFK 6 *XGEMDUQDVRQ 6 :KLWHKXUVW : DQG %DODV] 7 f (IIHFWV RI EHQR[DSURIHQ %f GLHWK\OFDUEDPD]LQH '(&f RU QRUGLK\GURJXDLDUHWLF DFLG 1'($f RQ LVRSURWHUDQRO ,f LQGXFHG YHQWULFXODU ILEULOODWLRQ LQ UDWV DEVWUDFWf )HG 3URF -XQRG $ /DPEHUW $ ( 2UFL / 3LFWHW 5 *RQHW $ ( DQG 5HQROG $ ( f 6WXGLHV RI WKH GLDEHWRJHQLF DFWLRQ RI VWUHSWR]RWRFLQ 3URF 6RF ([S %LRO 0HG .DUDVLN $ 3HSLQVN\ 5 % 6KRHOVRQ 6 ( DQG .DKQ & 5 f /LSRFRUWLQV DQG DV VXEVWUDWHV IRU WKH LQVXOLQ UHFHSWRU NLQDVH LQ UDW OLYHU %LRO &KHP .HXW]HU & DQG +LUVFKKRUQ 5 5 f 7KH JURZWK UHJXODWHG JHQH % LV LGHQWLILHG DV WKH KHDY\ FKDLQ RI FDOSDFWLQ ([S &HOO 5HV R .OHH & f &D GHSHQGHQW SKRVSKROLSLG DQG PHPEUDQHf ELQGLQJ SURWHLQV %LRFKHPLVWU\ .OHLQ ( 6 'L/RUHQ]R 3RVVHFNHUW %HDWR 0 DQG 5LQJROG 0 f 6HTXHQFHV GRZQVWUHDP RI WKH JOXFRFRUWLFRLG UHJXODWRU\ HOHPHQW PHGLDWH F\FORKH[LPLGH LQKLELWLRQ RI VWHURLG LQGXFHG H[SUHVVLRQ IURP WKH UDW DADFLG JO\FRSURWHLQ SURPRWHU HYLGHQFH IRU D ODELOH WUDQVFULSWLRQ IDFWRU 0RO (QGRFULQRO .UHLWPDQ 0 ( DQG $JXDGH 0 f ([FHVV SRO\PRUSKLVP DW WKH $GK ORFXV LQ 'URVRSKLOD 0HODQRJDVWHU *HQHWLFV /D5DLD 3 &UDLJ 5 DQG 5HGG\ : f *OXFDJRQHIIHFW RQ DGHQRVLQH nn PRQRSKRVSKDWH LQ WKH UDW KHDUW $P 3K\VLRO /HIHEYUH 3 DQG /X\FN[ $ 6 f *OXFDJRQ ,Q & + *UD\ DQG 9 + 7 -DPHV HGVf +RUPRQHV LQ %ORRG 9RO SS $FDGHPLF 3UHVV 1HZ
PAGE 106

/RK ( < (OOLRWW ) &ZLUOD 6 /DQLHU / / DQG 'DYLV 0 0 f 3RO\PHUDVH FKDLQ UHDFWLRQ ZLWK VLQJOHVLGHG VSHFLILFLW\ DQDO\VLV RI 7 FHOO UHFHSWRU GHOWD FKDLQ 6FLHQFH /R]DQR / +DLQGO $ + DQG 5RFKD 9 Df 3XULILFDWLRQ FKDUDFWHUL]DWLRQ DQG ORFDOL]DWLRQ RI N'D FDOFLXPVHQVLWLYH SURWHLQ FDOHOHFWULQf IURP PDPPDU\ JODQGV &HOO 3K\VLRO /R]DQR 6LOEHUVWHLQ % +ZDQJ 6 +DLQGO $ + DQG 5RFKD 9 Ef 'HYHORSPHQWDO UHJXODWLRQ RI FDOFLXPELQGLQJ SURWHLQV FDOHOHFWULQV DQG FDOSDFWLQ ,f LQ PDPPDU\ JODQGV &HOO 3K\VLRO 0DQFKHVWHU / f 7KH FRQWURO E\ LQVXOLQ RI DPLQR DFLG DFFXPXODWLRQ LQ PXVFOH %LRFKHP 0DWXVLN 5 DQG 5RVHQ 0 f 3URODFWLQ LQGXFWLRQ RI FDVLHQ P51$ LQ RUJDQ FXOWXUH %LRO &KHP 0F.QLJKW 6 DQG 3DOPLWHU 5 f 7UDQVFULSWLRQDO UHJXODWLRQ RI WKH RYDOEXPLQ DQG FRQDOEXPLQ JHQHV E\ VWHURLG KRUPRQHV LQ FKLFN RYLGXFW %LRO &KHP 0HVVLQJ f 1HZ 0 YHFWRUV IRU FORQLQJ 0HWKRGV (Q]YPRO 0LWFKHOO 3 DQG 7MLDQ 5 f 7UDQVFULSWLRQDO UHJXODWLRQ LQ PDPPDOLDQ FHOOV E\ VHTXHQFHVSHFLILF '1$ ELQGLQJ SURWHLQV 6FLHQFH 0LWVXQRED ) )XNXL 0 2GD 7
PAGE 107

1RUWKXS 9DOHQWLQH%UDXQ $ -RKQVRQ / 6HYHUVRQ / DQG +ROOHQEHUJ 0 f (YDOXDWLRQ RI WKH DQWLLQIODPPDWRU\ DQG SKRVSKROLSDVH LQKLELWRU\ DFWLYLW\ RI FDOSDFWLQ ,,OLSRFRUWLQ &OLQ ,QYHVW 2NXPXUD $NL\DPD 1 +DVKLPRWR + 2JDZD DQG 6DWDNH 7 f $OWHUDWLRQ RI GLDF\OJO\FHURO FRQWHQW LQ P\RFDUGLXP IURP GLDEHWLF UDWV 'LDEHWHV 3DGJHWW 5 $ *UDERZVNL 3 .RQDUVND 0 0 6HLOHU 6 DQG 6KDUS 3 $ f 6SOLFLQJ RI PHVVHQJHU 51$ SUHFXUVRUV $QQX 5HY %LRFKHP 3DHN DQG $[HO 5 f *OXFRFRUWLFRLGV HQKDQFH VWDELOLW\ RI KXPDQ JURZWK KRUPRQH P51$ 0RO &HOO %LRO 3DUVRQV : 5DPNXPDU 9 DQG 6WLOHV / f ,VREXW\OPHWK\O[DQWKLQH VWLPXODWHV DGHQ\ODWH F\FODVH E\ EORFNLQJ WKH LQKLELWRU\ UHJXODWRU\ SURWHLQ *MB 0RO 3KDUPDFRO 3DXOL 8 &KU\VRJHORV 6 6WHLQ DQG 6WHLQ f 1DWLYH JHQRPLF EORWWLQJ D QRYHO DSSURDFK WR PDSSLQJ '1DVH K\SHUVHQVLWLYH VLWHV DQG SURWHLQ'1$ LQWHUDFWLRQV DW KLJK UHVROXWLRQ %LR7HFKQLFUXHV 3HQSDUJNXO 6 0DOKRWUD $ )HLQ ) 6WUREHFN 6RQQHQEOLFN ( DQG 6FKHXHU f 0\RFDUGLDO ELRFKHPLFDO DOWHUDWLRQV LQ H[SHULPHQWDO GLDEHWHV LQ UDWV DEVWUDFWf &OLQ 5HV $ 3HSLQVN\ 5 % 6LQFODLU / %URZQLQJ 0DWWDOLDQR 7 6PDUW &KRZ ( )DOEHO 7 5LEROLQL $ *DUZLQ DQG :DOOQHU % f 3XULILFDWLRQ DQG SDUWLDO VHTXHQFH DQDO\VLV RI D N'D SURWHLQ WKDW LQKLELWV SKRVSKROLSDVH $ DFWLYLW\ IURP UDW SHULWRQHDO H[XGDWHV %LRO &KHP 3HSLQVN\ 5 % 6LQFODLU / &KRZ ( 3 DQG 2n%ULQH *UHFR % f $ GLPHULF IRUP RI OLSRFRUWLQ LQ KXPDQ SODFHQWD %LRFKHP

PAGE 108

3HSLQVN\ 5 % 7L]DUG 5 0DWWDOLDQR 5 6LQFODLU / 0LOOHU 7 %URZQLQJ / &KRZ ( 3 %XUQH & +XDQJ 6 3UDWW :DFKWHU / +HVVLRQ & )UH\ $ = DQG :DOOQHU % 3 f )LYH GLVWLQFW FDOFLXP DQG SKRVSKROLSLG ELQGLQJ SURWHLQV VKDUH KRPRORJ\ ZLWK OLSRFRUWLQ %LRO &KHP 3HWHUVRQ + DQG %HDU & f 7ZR JOXFDJRQ WUDQVGXFWLRQ V\VWHPV 1DWXUH 3IDIIOH 0 5XJJLHUR ) +RIPDQQ + )HUQDQGH] 0 3 6HOPLQ
PAGE 109

5HJDQ 7 :X & )
PAGE 110

6DZ\HU 6 7 DQG &RKHQ 6 f (SLGHUPDO JURZWK IDFWRU VWLPXODWHV WKH SKRVSKRU\ODWLRQ RI WKH FDOFLXPGHSHQGHQW GDOWRQ VXEVWUDWH LQ LQWDFW $ FHOOV %LRO &KHP 6FKODHSIHU ' DQG +DLJOHU + 7 f &KDUDFWHUL]DWLRQ RI &DGHSHQGHQW SKRVSKROLSLG ELQGLQJ DQG SKRVSKRU\ODWLRQ RI OLSRFRUWLQ %LRO &KHP 6FKODHSIHU ' 0HKOPDQ 7 %XUJHVV : + DQG +DLJOHU + 7 f 6WUXFWXUDO DQG IXQFWLRQDO FKDUDFWHUL]DWRQ RI HQGRQH[LQ ,, D FDOFLXP DQG SKRVSKROLSLGELQGLQJ SURWHLQ 3URF 1DWO $FDG 6FL 86$ 6FKUDGH : %RHKOH ( %LHJOHU 5 DQG +DUPXWK ( f )DWW\DFLG FRPSRVLWLRQ RI OLSLG IUDFWLRQV LQ GLDEHWLF VHUXP /DQFHW 6HLOHU7X\QV $ DQG %LUQVWLHO 0 / f 6WUXFWXUH DQG H[SUHVVLRQ LQ /FHOOV RI D FORQHG + KLVWRQH JHQH RI WKH PRXVH 0RO %LRO 6H\HU+DQVHQ f 5HQDO K\SHUWURSK\ LQ H[SHULPHQWDO GLDEHWHV PHOOLWXV .LGQH\ ,QW 6KLQLW]N\ 0 f )OXLGLW\ RI FHOO PHPEUDQHVFXUUHQW FRQFHSWV DQG WUHQGV ,QW 5HY &YWRO 6LOYHU $ f 9DVFXODU FKDQJHV LQ WKH PDPPDU\ JODQG GXULQJ HQJRUJHPHQW ZLWK PLON 3KYVLRO 3 6PLWK 2 / :RQJ & < DQG *HOIDQG 5 $ f 6NHOHWDO PXVFOH SURWHRO\VLV LQ UDWV ZLWK DFXWH VWUHSWR]RFLQLQGXFHG GLDEHWHV 'LDEHWHV 6PLWK 9 / DQG 'HGPDQ 5 f $Q LPPXQRORJLFDO FRPSDULVRQ RI VHYHUDO QRYHO FDFLXPELQGLQJ SURWHLQV %LRO &KHP 6WHHU $ 6RFKRU 0 DQG 0F/HDQ 3 f 5HQDO K\SHUWURSK\ LQ H[SHULPHQWDO GLDEHWHV FKDQJHV LQ SHQWRVH SKRVSKDWH SDWKZD\ DFWLYLW\ 'LDEHWHV 6XGKRI 7 & 6ODXJKWHU & $ /H]QLFNL %DUMRQ 3 DQG 5H\QROGV $ f +XPDQ N'D FDOHOHFWULQ FRQWDLQV D GXSOLFDWLRQ RI IRXU UHSHDWV IRXQG LQ N'D OLSRFRUWLQV 3URF 1DWO $FDG 6FL 86$

PAGE 111

7DHJWPH\HU + DQG 3DVVPRUH 0 f 'HIHFWLYH HQHUJ\ PHWDEROLVP RI WKH KHDUW LQ GLDEHWHV /DQFHW 7DKLOLDQL $ DQG 0F1HLOO + f 'LDEHWHV LQGXFHG DEQRUPDOLWLHV LQ WKH P\RFDUGLXP /LIH 6FLHQFHV 7DLW ) 6DNDWD 0 0F0XOOHQ % $ 0LDR & + )XQDNRVKL 7 +HQGULFNVRQ / DQG )XMLNDZD f 3ODFHQWDO DQWLFRDJXODQW SURWHLQV LVRODWLRQ DQG FRPSDUDWLYH FKDUDFWHUL]DWLRQ RI IRXU PHPEHUV RI WKH OLSRFRUWLQ IDPLO\ %LRFKHPLVWU\ 7DNHWDQL < DQG 2ND 7 f 3RVVLEOH SK\VLRORJLFDO UROH RI HSLGHUPDO JURZWK IDFWRU LQ WKH GHYHORSPHQW RI WKH PRXVH PDPPDU\ JODQG GXULQJ SUHJQDQF\ )(%6 /HWW 7KRPSVRQ ( : f 6WUXFWXUDO PDQLIHVWDWLRQV RI GLDEHWLF FDUGLRP\RSDWK\ LQ WKH UDW DQG LWV UHYHUVDO E\ LQVXOLQ WUHDWPHQW $P $QDW 7RSSHU < DQG )UHHPDQ & 6 f 0XOWLSOH KRUPRQH LQWHUDFWLRQV LQ WKH GHYHORSPHQWDO ELRORJ\ RI WKH PDPPDU\ JODQG 3K\VLRO 5HY 7RXTXL / 5RWKKXW % 6KDZ $ 0 )UDGLQ $ 9DUJDIWLJ % % DQG 5XVVR0DULH ) f 3ODWHOHW DFWLYDWLRQ D UROH IRU D DQWLSKRVSKROLSDVH $ SURWHLQ LQGLVWLQJXLVKDEOH IURP OLSRFRUWLQ 1DWXUH 8OOULFK $ DQG 6FKOHVVLQJHU f 6LJQDO WUDQVGXFWLRQ E\ UHFHSWRUV ZLWK W\URVLQH NLQDVH DFWLYLW\ &HOO 8QJHU 5 + (LVHQWUDXW $ 0 DQG 0DGLVRQ / / f 7KH HIIHFWV RI WRWDO VWDUYDWLRQ XSRQ WKH OHYHOV RI FLUFXODWLQJ JOXFDJRQ DQG LQVXOLQ LQ PDQ &OLQ ,QYHVW 9DUWLFRYVNL / &KDKZDOD 6 % :KLWPDQ 0 &DQWOH\ / 6FKLQGOHU &KRZ ( 3 6LQFODLU / DQG 3HSLQVN\ 5 % f /RFDWLRQ RI VLWHV LQ KXPDQ OLSRFRUWLQ WKDW DUH SKRVSKRU\ODWHG E\ SURWHLQ W\URVLQH NLQDVHV DQG SURWHLQ NLQDVHV $ DQG & %LRFKHPLVWU\

PAGE 112

9LROHWWH 6 0 .LQJ %URZQLQJ / 3HSLQVN\ 5 % :DOOQHU % 3 DQG 6DUWRUHOOL $ & f 5ROH RI OLSRFRUWLQ LQ WKH JOXFRFRUWLFRLG LQGXFWLRQ RI WKH WHUPLQDO GLIIHUHQWLDWLRQ RI D KXPDQ VTXDPRXV FDUFLQRPD &HOO 3KYVLRO :DNHODP 0 2 0XUSK\ +UXE\ 9 DQG +RXVOD\ 0 f $FWLYDWLRQ RI WZR VLJQDOWUDQVGXFLQJ V\VWHPV LQ KHSDWRF\WHV E\ JOXFDJRQ 1DWXUH :DOOQHU % 3 0DWWDOLDQR 5 +HVVLRQ & &DWH 5 / 7L]DUG 5 6LQFODLU / )RHOOHU & &KRZ ( 3 %URZQLQJ / 5DPDFKDQGUDQ / DQG 3HSLQVN\ 5 % f &ORQLQJ DQG H[SUHVVLRQ RI KXPDQ OLSRFRUWLQ D SKRVSKROLSDVH $ LQKLELWRU ZLWK SRWHQWLDO DQWLn LQIODPPDWRU\ DFWLYLW\ 1DWXUH :DUUHQ 6 /H&RPSWH 3 0 DQG /HJJ 0 $ f 7KH 3DWKRORJ\ RI 'LDEHWHV 0HOOLWXV /HD DQG )HELQJHU 3KLODGHOSKLD :HEHU -RKQVVRQ 1 3OHVPDQQ 8 9DQ 3 1 6ROLQJ + $PSH & DQG 9DQGHNHUFNKRYH f 7KH DPLQR DFLG VHTXHQFH RI SURWHLQ ,, DQG LWV SKRVSKRU\ODWLRQ VLWH IRU SURWHLQ NLQDVH & WKH GRPDLQ VWUXFWXUH &DPRGXODWHG OLSLG ELQGLQJ SURWHLQV (0%2 :HLQWUDXE + DQG *URXGLQH 0 f &KURPRVRPDO VXEXQLWV LQ DFWLYH JHQHV KDYH DQ DOWHUHG FRQIRUPDWLRQ 6FLHQFH :LGPDQ / ( DQG &KDVLQ / $ f 0XOWLKRUPRQDO LQGXFWLRQ RI DXJOREXOLQ LQ DQ HVWDEOLVKHG UDW KHSDWRF\WH FHOO OLQH &HOO 3KYVLRO :LOOLDP ) 0URF]NRZVNL % &RKHQ 6 DQG .UDIW $ f 'LIIHUHQWLDWLRQ RI +/ FHOOV LV DVVRFLDWHG ZLWK DQ LQFUHDVH LQ WKH N'D SURWHLQ OLSRFRUWLQ &HOO 3KYVLRO :LQHJUDG $ f 'RHV D FRPPRQ PHFKDQLVP LQGXFH WKH GLYHUVH FRPSOLFDWLRQV RI GLDEHWHV" 'LDEHWHV :RQJ : 7 )URVW 6 ) DQG 1LFN + 6 f 3URWHLQ V\QWKHVLVGHSHQGHQW LQGXFWLRQ RI DQQH[LQ E\ JOXFRFRUWLFRLG VXEPLWWHGf
PAGE 113

=DUHW 6 DQG
PAGE 114

%,2*5$3+,&$/ 6.(7&+ .HQQHWK 5REHUW +RUOLFN ZDV ERUQ RQ -XQH LQ WKH %URQ[ 1HZ
PAGE 115

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ +DUU\ £ L 1LFN &KDLUPDQ $VVRFLDWH 3URIHVVRU RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'HEWRU RI 3KLORVRSK\ 5LFKDUG 3 %R\FH 3URIHVVRU RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 0LFKF 3URIHVVRU RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ D U<\?rLAL 6XVDQ $ 0R\HU 3URIHVVRU RI ,PPXQRORJ\ DQG 0HGLFDO 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 6LJXUG -\ 1RUPDQQ 3URIHVVRU RI 3DWKRORJ\ /DERUDWRU\ 0HGLFLQH DQG

PAGE 116

7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI 0HGLFLQH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 'HFHPEHU 'HDQ *UDGXDWH 6FKRRO

PAGE 117

81,9(56,7< 2) )/25,'$ R m


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID ERWOQM161_ESJFET INGEST_TIME 2011-11-02T14:44:31Z PACKAGE AA00004760_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES


GENOMIC CLONING AND TISSUE-SPECIFIC
EXPRESSION OF LIPOCORTIN I
BY
KENNETH ROBERT HORLICK
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1990

To Marta
Digitized by the Internet Archive
in 2011 with funding from
University of Florida, George A. Smathers Libraries with support from LYRASIS and the Sloan Foundation
http://www.archive.org/details/genomiccloningtiOOhorl

ACKNOWLEDGEMENTS
I would like to thank the members of my committee for
their invaluable guidance and support during my graduate
studies. Special thanks go to Dr. Richard Boyce for both
his guidance and understanding. Also, I would like to thank
my fellow graduate students, Bill Wong, Bill Dougall, Jan-
Ling Hsu, Sally Chesrown, and Jonathan Hurt, as well as Joan
Wilson, Dr. Gary Visner, Dr. Gerald Stephanz, and Dr. John
Valentine, for their helpful discussions, support, and
friendship over the past five years.
In addition, I would like to acknowledge my mentor, Dr.
Harry Nick, for all his guidance and support. My education
and training under his direction were a valuable and
rewarding experience.
Finally, I would like to express my unending gratitude
to my parents, Herbert and Maxine Horlick, whose unfaltering
support and love have enabled me to reach this point.
iii

TABLE OF CONTENTS
Page
ACKNOWLEDGEMENTS ÍÜ
LIST OF FIGURES V
ABSTRACT vii
CHAPTERS
1 INTRODUCTION 1
2 CHARACTERIZATION OF THE MOUSE LIPOCORTIN I GENE 8
Introduction 8
Materials and Methods 10
Results 13
Discussion 27
3 REGULATION OF LIPOCORTIN I IN RAT MAMMARY TISSUE
DURING GLANDULAR DIFFERENTIATION AND INVOLUTION 33
Introduction 33
Materials and Methods 37
Results 40
Discussion 50
4 TISSUE-SPECIFIC REGULATION OF LIPOCORTIN I mRNA
LEVELS IN RATS DURING DIABETES AND BY GLUCAGON 55
Introduction 55
Materials and Methods 58
Results 60
Discussion 70
5 CONCLUSIONS AND FURTHER DIRECTIONS 79
REFERENCES 89
BIOGRAPHICAL SKETCH 106
iv

LIST OF FIGURES
Figure page
2-1 Southern blot analysis of mouse genomic DNA
with a lipocortin I cDNA probe 14
2-2 Restriction map and genomic structure of the
mouse lipocortin I gene 18
2-3 Sequence of the mouse lipocortin I gene 20
2-4 Sequence of the mouse lipocortin I promoter
region 24
2-5 Correlation of lipocortin I genomic structure
with protein domains 26
3-1 Regulation of mammary lipocortin I mRNA during
pregnancy, lactation, and involution 41
3-2 Decrease in mammary lipocortin I mRNA levels
with the onset of lactation 43
3-3 Regulation of lipocortin I mRNA and protein
levels in rat mammary tissue during glandular
differentiation and involution 44
3-4 Densitometric analysis of the data in Figure
3-3 45
3-5 The role of the suckling stimulus directly
after birth on lipocortin I mRNA levels in
mammary tissue 47
3-6 Induction of lipocortin I mRNA and protein
expression in mammary tissue of dams following
pup removal at birth or day seven of suckling... 48
3-7 Specificity of the mammary lipocortin I mRNA
regulation following pup withdrawal 49
3-8 Densitometric analysis of the increase in
lipocortin I mRNA levels following pup
withdrawal 51
v

4-1
Expression of lipocortin I mRNA in tissues from
a control and three-day streptozotocin-diabetic
rat 61
4-2 Increased levels of lipocortin I mRNA in the
heart, kidney, and hindleg muscle of three-day
streptozotocin-diabetic rats 62
4-3 Heart, kidney, and hindleg muscle lipocortin I
mRNA expression in streptozotocin-injected rats
on and off insulin treatment 64
4-4 Induction of lipocortin I mRNA in the rat heart
after injection of glucagon 66
4-5 Increased levels of lipocortin I mRNA in the
heart after glucagon injection in four animals.. 67
4-6 Time course of the increase in lipocortin I
mRNA in the heart after injection of glucagon... 68
4-7 Lipocortin I mRNA expression in the rat heart
following injection of glucagon and other
hormones 69
4-8 Lipocortin I mRNA expression in the mouse heart
following injection of glucagon and other
hormones 71
vi

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
GENOMIC CLONING AND TISSUE-SPECIFIC
EXPRESSION OF LIPOCORTIN I
by
KENNETH ROBERT HORLICK
December, 1990
Chairman: Dr. Harry S. Nick
Major Department: Biochemistry and Molecular Biology
The mouse lipocortin I structural gene was isolated and
characterized by screening two mouse Balb/c liver genomic
libraries with mouse lipocortin I cDNA and oligonucleotide
probes. Restriction enzyme mapping, Southern blotting, and
DNA sequencing were carried out on three overlapping genomic
clones. The lipocortin I gene spans 17 Kbp and is divided
into 13 exons which encode a protein of 346 amino acid
residues. The promoter region of the gene has a TATA box
and a CCAAT box located upstream of the transcription
initiation site at -31 and -76 bp, respectively. Several
potential regulatory sites in the 5' flanking region were
identified by comparison to known protein-binding consensus
sequences. A comparison of the lipocortin I gene structure
with that of the closely related gene lipocortin II suggests
a common evolutionary ancestor for these proteins.
vii

Lipocortin I mRNA and protein levels in the rat mammary
gland were studied during various stages of differentiation.
Both were abundant in the nonpregnant state, and began a
striking decline at midpregnancy when epithelial cells
undergo proliferation and differentiation. In the lactating
gland, no lipocortin I was detected. During involution of
the gland after weaning, lipocortin I mRNA and protein
increased to levels observed in nonpregnant animals. The
repression of lipocortin I mRNA expression at birth and
during lactation is dependent upon the suckling stimulus,
since pup withdrawal resulted in a rapid, mammary-specific
increase in lipocortin I mRNA levels. These results suggest
lipocortin I may play a role in mammary cell growth status
during gland differentiation.
To investigate potential alterations in lipocortin I
expression during diabetes, I injected rats with
streptozotocin and analyzed mRNA levels in several tissues.
In three-day streptozotocin-diabetic rats, lipocortin I mRNA
levels were significantly increased in the heart, kidney,
and hindleg muscle. Glucagon, a hormone highly elevated in
diabetics, caused induction of lipocortin I mRNA in the
heart, but not in the kidney or muscle, four hours after
injection.
viii

CHAPTER 1
INTRODUCTION
Lipocortin I (lipo I), also called annexin I (Crumpton
and Dedman, 1990), is one of the best characterized members
of the annexins, a group of calcium-dependent, phospholipid¬
binding proteins which share about 50% seguence homology and
whose physiological role remains unclear. The annexins
differ from previously characterized calcium-binding
proteins in that they lack an EF-hand-type calcium binding
site (Geisow and Walker, 1986). Proteins which are part of
this family include lipocortins (Huang et al., 1986),
calpactins (Glenney, 1986), calelectrins (Geisow et al.,
1986; Geisow and Walker, 1986; Sudhof et al., 1988),
calcimedins (Smith and Dedman, 1986), anticoagulant protein
(Funakoshi et al., 1987), endonexins (Geisow et al., 1986;
Geisow and Walker, 1986; Schlaepfer et al., 1987; Weber et
al., 1987), and chromobindins (Creutz et al., 1987).
Various annexins have been implicated in cellular processes
including inflammation (Flower, 1988), exocytosis
(Burgonyne, 1988; Drust and Creutz, 1988), differentiation
(Violette et al., 1990), blood coagulation (Tait et al.,
1988), the immune response (Hirata and Iwata, 1983), and
membrane-cytoskeletal linkage (Roy-Choudhury et al., 1988).
1

2
Most recently, lipocortin III was identified as inositol
1,2-cyclic phosphate 2-phosphohydrolase, an enzyme important
in metabolizing the most highly active inositol phosphate
intermediates (Ross et al., 1990). This suggests the
possibility that the other annexins may also play a role in
inositol metabolism.
Lipocortin I has a molecular weight of 35,000 daltons
and has been immunolocalized mainly to the inner surface of
the plasma membrane (Glenney et al., 1987). Most of its
observed biological properties, including binding to
phospholipid and actin, are dependent on calcium levels
(Glenney, 1986; Schlaepfer and Haigler, 1987). Multiple
binding sites for both calcium and phospholipid apparently
exist in the protein (Klee, 1988). Recent studies using
monoclonal antibodies detected both calcium-bound and
calcium-free forms of lipo I associated with membranes in
A431 cells (Hayashi et al., 1990). Early experiments
indicated the protein was secreted, but this observation
remains unexplained because no evidence for a signal peptide
was found (Wallner et al., 1986). Expression is limited to
certain cell and tissue types (Fava et al., 1989; Glenney et
al., 1987; Pepinsky et al., 1986; Wallner et al., 1986), and
in some cases lipo I may account for as much as 0.1 to 0.5%
of total cellular protein (Violette et al., 1990).
Phosphorylation of specific cellular proteins by growth
factor/hormone receptor kinases is believed to be important

3
in intracellular signal transduction (Ullrich and
Schlessinger, 1990). Lipocortin I has been shown to be a
substrate for the epidermal growth factor receptor tyrosine
kinase in intact A-431 human carcinoma cells and human
fibroblasts (Giugni et al., 1985; Sawyer and Cohen, 1985),
and is phosphorylated by the epidermal growth factor
receptor in vitro in the presence of epidermal growth factor
and calcium (De et al., 1986). Karasik et al. (1988) have
demonstrated that lipo I is also a substrate for the insulin
receptor tyrosine kinase in isolated rat hepatocytes. In
addition, both protein kinase C and cyclic-AMP-dependent
protein kinase have been shown to phosphorylate lipo I on
serine/threonine residues (Varticovsky et al., 1988).
Lipocortin II, or p36, is a substrate for the pp60vsrc
oncogene kinase, further implicating the annexins in
cellular signal transduction (Cooper and Hunter, 1983).
The lipocortins were originally defined as
glucocorticoid-induced, anti-inflammatory proteins which
inhibit phospholipase Aj, the enzyme which releases
arachidonic acid from membrane phospholipids and begins the
cascade of enzymatic steps leading to production of
prostaglandins and leukotrienes (Blackwell et al., 1980;
Flower and Blackwell, 1979; Hirata et al., 1980). Several
of the lipocortins were shown to inhibit phospholipase
as well as other phospholipases, in vitro (Hirata, 1981).
The mechanism of this inhibition is now believed to be

4
"substrate depletion," where lipocortins bind to
phospholipids and protect them from cleavage by
phospholipases. This is because no direct interaction
between lipocortins and phospholipases has been detected,
and the inhibition can be overcome by raising the
concentration of phospholipid substrate in the in vitro
assays (Aarsman et al., 1987; Davidson et al., 1987; Haigler
et al., 1987) .
The annexins share a common core region consisting of
four 70-amino acid repeating units (eight for
p68/calelectrin), based on predicted secondary structure
considerations (Crompton et al., 1988). In addition, a 17-
amino acid consensus sequence, believed to contain the sites
responsible for calcium/phospholipid binding activity, was
identified within each repeat (Geisow et al., 1986). The N-
termini of the lipocortins are divergent and may be involved
in the regulation of the individual proteins (Crompton et
al., 1988; Huang et al., 1986; Pepinsky et al., 1988; Saris
et al., 1986; Wallner et al., 1986). The N-terminus of lipo
I contains sites for tyrosine and serine/threonine
phosphorylation (Karasik et al., 1988; Sawyer and Cohen,
1985; Varticovski et al., 1988), proteolysis (Ando et al.,
1989; Chuah and Pallen, 1989), and head-to-head dimerization
(Pepinsky et al., 1989). The N-terminus of lipocortin II
also contains phosphorylation sites and is the location of
binding of pll, a protein which forms a tetramer with

5
lipocortin II and binds tightly to the inner membrane
surface (Glenney and Tack, 1985).
Although the cellular function of lipo I is presently
unclear, its implication in the important processes
mentioned above justifies further investigation of this
protein. This manuscript describes the groundwork for
studies designed to investigate the regulation of lipo I
gene expression using rats and mice as models. Chapter 2
involves the isolation and characterization of the mouse
lipo I structural gene and promoter. Knowledge of the gene
structure would enable a comparison with that of lipo II,
recently published (Amiguet et al., 1990), and other
annexins when these are eventually described. Such a
comparison would reveal if the exon-intron patterns of the
genes correlate with the 70-amino acid repeats and 17-amino
acid consensus sequences of the corresponding proteins. In
addition, valuable information regarding the evolution of
the annexins and their relationship to one another would be
gained.
Obtaining the promoter sequence in the 5' flanking
region of lipo I would likely be essential in studying gene
regulation, since both nonspecific and specific protein
binding sites important in gene expression are often located
upstream of the transcription initiation site of genes
(Mitchell and Tjian, 1989). Comparison of the promoter
region of lipo I with previously identified consensus

6
sequences representing regulatory protein binding sites
might locate similar regulatory regions in lipo I. Whether
putative regulatory sites are important in vivo could then
be addressed in future experiments, described in Chapter 5.
Chapters 3 and 4 involve an attempt to identify and
define a system(s) which exhibit regulation of lipo I gene
expression so that the molecular basis of this regulation
could later be investigated. Also, exploring changes of
lipo I expression in response to various stimuli might help
elucidate its biological role. Based on a link between
prolactin, an important hormone in lactation, and a lipo I-
like gene in the pigeon cropsac (Horseman, 1989), potential
hormonal control of lipo I in the rat mammary gland is
evaluated in Chapter 3. The mammary gland, like the pigeon
cropsac, differentiates into a nutrient-secreting tissue
during pregnancy and is known to be a target of prolactin
action (Topper and Freeman, 1980). Northern and Western
analyses were carried out to analyze lipo I mRNA and protein
levels in mammary tissue of dams during pregnancy,
lactation, and weaning. During these periods, several
hormones undergo large alterations in plasma concentration,
and gland morphology and cell population change radically
(Borellini and Oka, 1989). In addition, the consequences of
premature pup withdrawal and prevention of the suckling
stimulus on lipo I expression in mammary tissue are
addressed in Chapter 3. These studies revealed a dramatic

7
regulation of lipo I during gland differentiation and
involution, and a hypothesis addressing this phenomenon is
provided.
In Chapter 4, tissue-specific regulation of lipo I mRNA
levels in diabetic rats is shown. These studies were
undertaken to explore a possible connection between lipo I
and the altered lipid metabolism known to occur in some
diabetic tissues. An attempt to identify a particular
hormone involved in regulation of lipo I during diabetes
implicated the peptide hormone glucagon, which is highly
elevated in the diabetic state. These experiments represent
the first report of glucagon influencing lipo I mRNA
expression and of tissue-specific alterations in lipo I in a
disease state.

CHAPTER 2
CHARACTERIZATION OF THE MOUSE
LIPOCORTIN I GENE
Introduction
The studies described in this chapter were carried out
for two main purposes: to determine the genomic structure of
the lipo I gene, and to obtain promoter sequence from the 5'
flanking region of the gene. Information provided by such
experiments would enable future studies aimed at
investigating specific regulatory mechanisms involved in
lipo I gene regulation.
It has been proposed that exons encode functional or
structural domains of proteins (Blake, 1983; Gilbert, 1978).
The lipo I protein consists of a unique N-terminus and a
core region consisting of four 70-amino acid repeating units
(Crompton et al., 1988). In addition, a 17-amino acid
consensus sequence believed to be responsible for
calcium/phospholipid binding was identified within each of
the four 70 amino acid repeats (Geisow et al., 1986). By
characterizing the lipo I gene structure, I could determine
if discrete exons encode protein domains, such as the unique
N-terminus and the internal repeating units.
The only lipocortin structural gene which has been
characterized until now is that of mouse lipo II, which was
8

9
reported to consist of at least 12 exons spanning 22 Kbp and
to be located on chromosome nine (Amiguet et al., 1990).
These authors knew from primer extension analysis (Saris et
al., 1986) that they had not located the first -52 bp of the
mRNA in the gene, and therefore had not identified the first
genomic exon(s), which are noncoding. The intron/exon
structure of the lipo II gene was analyzed in relation to
the known protein domains. It was shown that although no
striking correlation existed with regard to exons and the
70-amino acid repeats, three of the four 17-amino acid
consensus regions were encoded at the end of one exon and
the start of the following exon. In addition, the first two
exons of lipo II were found to code for separate regions
believed to be important in regulation of protein function.
In this chapter, similar analysis regarding exon-protein
domain correlation for lipo I is shown, and a comparison
made between the two gene structures. The results provide
interesting insight into the evolution of the annexin
family.
The region upstream of many genes has been shown to
encode sites for binding of regulatory proteins (Mitchell
and Tjian, 1989). Such sites may influence mRNA expression
in either a positive or negative fashion. Both gene-
specific and ubiquitous transcription regulatory factors
have been identified which bind to certain DNA sequences.
For many of these factors, a consensus binding sequence has

10
been derived from studying the promoter regions of several
genes. Regulatory elements defined so far include those
that mediate gene expression by glucocorticoids (GRE)(Picard
et al., 1988), cAMP (CRE)(Gonzalez et al., 1989), and serum
(SRE)(Norman et al., 1988). Seguencing the 5' upstream
region of lipo I would enable localization of potential
regulatory sites involved in transcription by comparison
with known consensus sequences. This is especially
important because there is evidence that glucocorticoids
induce lipo I mRNA levels (Phillips et al., 1989; Wallner et
al., 1986; Wong et al., submitted) and that the presence or
absence of serum influences lipo I mRNA expression in
several cell types (K. Horlick and W. Wong, unpublished
results).
The work described in this chapter will be important in
future studies aimed at investigating mechanisms of
regulation of mouse lipo I gene expression. A restriction
map and genomic sequence are required for studies such as
chromatin structure analysis (Zaret and Yamamoto, 1984),
deletion analysis (Dean et al., 1983), and in vivo
footprinting (Church and Gilbert, 1984) .
Materials and Methods
Library Screening and Isolation of Lipo I Genomic Clones
A mouse Balb/c liver genomic library obtained from Dr.
Tom Caskey, Baylor, and one purchased from Clonetech, Palo
Alto, CA, were screened as described by Sambrook et al.

11
(1982). Typically, 20,000 recombinant phages were plated on
15-cm YT agar plates and incubated at 37°C for 16-18 hr.
Duplicate nitrocellulose lifts of each plate were washed in
a solution containing 50 mM Tris (pH 8.0), 1 M NaCl, 1 mM
EDTA, and 0.1% SDS at 37°C for 1 hr. The filters were
prehybridized in 6X SSC (IX SSC contains 0.15 M NaCl, 0.015
M sodium citrate, pH 7.0), 5X Denhardt's solution (IX
Denhardt's solution is composed of 0.1 g each of ficoll,
polyvinylpyrrolidone, and bovine serum albumin), 0.1% SDS,
and 100 ng/ml denatured salmon sperm DNA for 2 hr at 60"C.
A 32P-labeled lipo I cDNA probe synthesized by random primer
extension (Feinberg and Vogelstein, 1983) was added to the
hybridization solution, and the filters were further
incubated at 60°C for an additional 16-18 hr. The filters
were subjected to three 1-hr washes at 60°C in IX SSC and
0.1 % SDS, and exposed to Kodak X-OMAT AR film for three
days at -85"C with an intensifying screen (lightning-plus,
Du Pont). When a kinased oligonucleotide was used as a
probe, the washes were performed at 50°C in 3X SSC and 0.3%
SDS. Each positive clone identified from the primary
screening was further purified to homogeneity, grown up
large scale, and its genomic insert excised and subcloned
into M13mpl8 for DNA sequencing (Messing, 1983).
Probe Preparation
Hybridization probes were synthesized with a-32P dATP
(NEN, 800uCi/mmole) by random primer extension with hexamer

12
primers (Pharmacia) (Feinberg and Vogelstein, 1983) using
all or part of a 900 bp partial mouse lipo I cDNA insert
(clone BWS9, W. Wong) or a 2.7 Kb Xba fragment from genomic
clone Jlipol9. A 61-bp oligonucleotide corresponding to the
first exon was radiolabeled using gamma-32P ATP and T4
polynucleotide kinase (BRL) as described by Sambrook et al.
(1982) .
Genomic DNA Isolation and Southern Analysis
Mouse genomic DNA was isolated from confluent A31
Balb/c fibroblast cells by lysis in a solution of 1 mM Tris
pH 8.0, 100 mM EDTA, 1% SDS, and 50 mg/ml proteinase K
(Boehringer Mannheim Biochemicals). Following incubation
for 1 hr at 50°C, nucleic acids were ethanol precipitated
and resuspended. After a 1-hr incubation at 37°C in the
presence of 100 ¿¿g/ml DNase-free RNase A (Sigma) , the DNA
was purified by phenol/chloroform extractions. Genomic DNA
was then ethanol precipitated and resuspended at a
concentration of about 0.5 mg/ml. Restriction enzyme-
digested DNA (30 jug) was run on 1% agarose gels containing
0.04 M Tris-acetate and 1 mM EDTA (pH 8.0) for 14-16 hr at
30 volts. The gel was treated as follows prior to transfer:
Depurinated two times with 0.25 M HC1 (10 min each),
denatured with 0.5 M NaOH (two times, 25 min each), and
neutralized with 1.78 M Tris-borate, 1.78 M boric acid, and
0.04 M EDTA, pH 8.0. Genomic DNA was transferred
electrophoretically for 1 hr to a noncharged nylon membrane

13
(GeneScreen, NEN), immobilized on the membrane by UV cross-
linking (Church and Gilbert, 1984), and hybridized with a
specific radiolabeled probe.
Hybridization of Southern Blots
Hybridizations were done as previously described
(Church and Gilbert, 1984). Blots were prehybridized for
15-30 min in a buffer containing 1% bovine serum albumin
(Sigma), 1 mM EDTA, 0.5 M NaHP04 (pH 7.2), and 7% SDS at
60°C. After addition of the labeled probe, the blots were
hybridized at 60°C for 12-16 hr. The blots were then
subjected to three 10-min washes in 1 mM EDTA, 40 mM NaHP04
(pH 7.2), 1% SDS at 65°C, and exposed to Kodak X-OMAT AR
film for various periods of time. When a kinased
oligonucleotide probe was used, the hybridization was done
at 50°C for 3-5 hr, and the wash was done in the buffer
described above, but containing a final concentration of
0.45 M Na+ at 50°C.
Results
Isolation of Lipo I Genomic Clones
Initially, mouse lipo I cDNA clone BWS9, containing
almost all of the lipo I coding sequence, was used to screen
a Balb/c mouse liver EMBL3 genomic library. This probe was
also used in genomic Southern blot analysis to estimate the
length of genomic DNA which contained lipo I coding sequence
(Fig. 2-1). Clone Jlipol9 was isolated and then
characterized by Southern blot analysis using the cDNA to

14
1 2 3 4
- 2.3
- 2.0
Figure 2-1. Southern blot analysis of mouse genomic DNA with
a lipocortin I cDNA probe. Genomic DNA isolated from mouse
A31 fibroblast cells was digested with Xba I (lane 1), Sea I
(lane 2), Sst I (lane 3), and Pst I (lane 4). Restricted
DNA (30 /ig/lane) was run on 1% agarose gels,
electrotransferred to GeneScreen membrane, and hybridized
with a lipocortin I cDNA probe. The numbers on the right
designate the relative position of molecular size markers in
Kbp.

15
localize exons. Restriction fragments containing exons were
cloned into M13 vectors and sequenced by the dideoxy method.
Intron/exon junctions were determined by comparing genomic
sequence with that of the mouse lipo I cDNA. Jlipol9 had a
19 kb insert which was found to contain 10 lipo I exons, but
not the 5' or 3' ends of the gene. Southern blot analysis
comparing lipo I restriction fragments from the genome to
those present in Jlipol9 (data not shown) revealed that this
clone contained a seven kb fragment at its 5' end which was
not part of the lipo I gene. Thus, the 19 kb insert in this
clone was a combination of two genomic fragments, one
containing part of the lipo I gene and another from
elsewhere in the genome, which were apparently ligated
together during library construction. This phenomenon was
also reported with regard to the cloning of the human
cytosolic aldehyde dehydrogenase (ALDH1) gene, where the
authors note they identified several genomic clones which
contain ALDH1 sequence at one end and other unidentified
sequences at the other end (Hsu et al., 1989). The Southern
analysis and subsequent characterization of another clone
rule out the possibility that Jlipol9 contained a
pseudogene.
To isolate the remainder of the gene, 5'- and 3'-
specific probes were used to screen a second mouse liver
EMBL3 genomic library. A 2.7 kb Xba restriction fragment
from Jlipol9 and an APCR-derived oligonucleotide

16
corresponding to the 5' end of the lipo I mRNA (Horlick et
al., submitted) were used as probes for the 5' end, while a
460 bp fragment corresponding to the 3' end of the cDNA was
utilized to probe for the 3' end. Two new clones, 5'lipol4
and 3'lipol7, were isolated using these probes and
characterized as explained above. Exon one sequence was
obtained from 5'lipol4, while the last two exons were found
in 3'lipol7.
Genomic Structure of Lipo I
The three lipo I genomic clones examined, including a
restriction map consistent with genomic Southern analysis,
are shown in Fig. 2-2. The DNA sequence of the mouse lipo I
gene and deduced amino acid sequence from the coding region
are shown in Fig. 2-3. The gene consists of 13 exons
spanning approximately 17 kb. Exon and intron sizes are
shown in Table 2-1. Exons range in size from 59 to 341 bp,
with an average size of 107 bp. Intron lengths vary from
109 bp to 6.0 kb, averaging 1.4 kb. The first exon is
entirely noncoding and represents the true start site of
transcription as determined by primer extension (Horlick et
al., submitted). Exon two contains the first 66 coding
bases and exon 13 has the final 54. In 7 of 11 cases,
introns occur between codons. All of the exon-intron
junctions conform to the consensus sequences established for
intron donor (5'GTA/GAGT3') and acceptor (5'[Py]n-NC/TAG3')
splice signals (Breathnach and Chambón, 1981; Padgett et
al., 1986).

Figure 2-2. Restriction map and genomic structure of the mouse lipocortin I gene.
The three genomic clones characterized and their relative positions are shown at the
top. Below is a restriction map showing the location of exons. Open areas represent
untranslated sequence and dark regions represent coding sequence. Restriction
endonuclease sites are as follows: A = Apa I, E = Eco RI, K = Kpn I, L = Sst I, M =
Sma I, S = Sal I, X = Xba I.

s
L
Jlipol9
5* lipol4
S
J
E
L
ME
XE
LL
1
1 kb
X
L
XL
f
23 4 5 6
3 *lipol7
LX A L X LK
I4444W
7 8 9 10 1112 13

Figure 2-3. Sequence of the mouse lipocortin I gene. The nucleotide sequence of the
13 exons and their immediate flanking intron sequences are shown. Deduced amino acid
sequence is shown below the coding regions. Numbers just above the nucleotide
sequence are based on the full-length cDNA sequence, and numbers below the amino acid
sequence start at the initiator methionine codon. The sequence begins one nucleotide
before the transcription start site as defined by primer extension/APCR. The 3' end
of the largest cDNA clone is indicated by nucleotide 1392. Just 5' of this, a
potential poly (A) addition signal is underlined. Exons and 5'/3' flanking sequence
are in uppercase letters, while intron sequence is in lowercase.

62
-1 6)
CAGTCTGAM/XATCTG¿COGAGTCTacTIOGTCCCCGGG*AOCAAGCAA*TACAAAG gtaaggctta---6.0 ktp- tcaUttcag ATACTTCTCTMAA
ATG
GCA
ATG
GTA
TCA
GAA
TTC
CTC
AAG
CAG
GCC
CGT
TTT
CTT
GAA
AAT
CAA
GAA
CAG
GAA
TAT
GTT
gtaagtagtcaaaatattatgaagtagttaccatgttaaaatggacagtaacatgaatgaataaataaatgaatgactaaaaactaattcatgtctcttgcacacatag
Met
Ala
Met
Val
Ser
Glu
Phe
Leu
Lys
Gln
Ala
Arg
Phe
Leu
Glu
Asn
Gln
Glu
Gln
Glu
Tyr
Val
1
10
20
142
250 251
CAA
GCT
GTA
AAA
TCA
TAC
AAA
GGT
GGT
CCT
GGG
TCA
GCA
GTG
AGC
CCC
TAC
CCT
TCC
TTC
AAT
GTA
TCC
TCG GAT
GTT GCT GCC TTG CAC AAA GCT ATC ATG GTT AAA G gtaaggttgt - -0.6 kfcp---gtatttccag GT GTG GAT GAA GCA
Gln
Ala
Val
Lys
Ser
Tyr
Lys
Gly
Gly
Pro
Gly
Ser
Ala
Val
Ser
Pro
Tyr
Pro
Ser
Phe
Asn
Val
Ser
Ser Asp
Val Ala Ala Leu His Lys Ala He Met Val Lys G ly Val Asp Glu Ala
50
40
50
60
338
359
ACC
ATC
ATT
GAC
ATT
ctt
ACC
AAG
M£
ACC
AAT
GCT
CAG
CGC
CAG
CAG
ATC
AAG
GCC
GCG
TAC
TTA
CAG
GAG AAT
GM AAG gtagtgagaa-
— 1.8 kfcp—ttttccceag CCC TTG GAT GAA GTC TTG AGA AAA GCC CTT ACA GGC CAC CTG
Thr
lie
lie
Asp
He
Leu
Thr
Lys
Arg
Ihr
Asn
Ala
Gln
Arg
Gln
Gln
He
Lys
Ala
Ala
Tyr
Leu
Gln
Glu Asn
Gly Lys
Pro Leu Asp Glu Val Leu Arg Lys Ala Leu Thr Gly His Leu
70
80
90
100
452
453
GAG
GAG
GTT
GTT
TTG
GCT
ATG
CTA
AAA
ACT
OCA
GCT
CAG
TTT
GAT
GCA
GAT
GAA
CTC
CGT
GGT
GCC
ATG
AAG gtaaattatt—0.6 ktp- - •
taaattcag GGA CTT GGA ACA GAT GAA GAC ACT CTC ATT GAG ATT TTG ACA ACA AGA TCT AAC
Glu
Glu
Val
Val
leu
Ala
Met
Leu
Lys
Thr
Pro
Ala
Gln
Phe
Asp
Ala
Asp
Glu
Leu
Arg
Gly
Ala
Met
Lys
Gly Leu Gly Thr Asp Glu Asp Thr Leu lie Glu He Leu Thr Thr Arg Ser Asn
110
120
130 140
543
544
623
GAA
CAA
ATC
AGA
GAG
ATT
AAT
AGA
GTC
TAC
AGA
GAA
G gtcagacccag-- â– 
1.4
ktp-
—attcctacag AG
CTG
AAA AGA
GAT CTG GCC AAA GAC ATC ACT TCA GAT ACA TCT GGA GAC TTT CGG AAA GCC TTG CTT GCT CTT GCC AAG gtata
Glu
Gln
He
Arg
Glu
lie
Asn
Arg
Val
Tyr
Arg
Glu
G
lu
Leu
Lys Arg
Asp Leu Ala Lys Asp lie Thr Ser Asp Thr Ser Gly Asp Phe Arg Lys Ala Leu Leu Ala Leu Ala Lys
150
160
170 180
624
679
680
acata- -0.8 ttp---tattttacag GGT GAC CGT TGI CAG GAC TTG AGI GTG AAT CAA GAT TIG GCT GAT ACA GAT GCC AGG gtaagcaagat—1.3 ttp-'- ttcttgacag GCI TTG IAT GAA OCT GGA GAA ATI AGA AAG GOG ACA GAC GIG AAT
Gly Asp Arg Cys Gin Asp leu Ser Val Asn Gin Asp Leu Ala Asp Oír Asp Ala Arg Ala Leu Tyr Glu Ala Gly Glu Arg Arg lys Gly Oír Asp Val Asn
190 200 210
773 774
GTC TTC ACC ACA ATT CTG ACC AOC AGG AGC TH CCT CAT CTI CBC AGA G gtaataagata---1.3 »p---tcccattcag TG ITT CAG AAT TAC GGA AAG TAC AGT CAA CAT GAC ATG AAC AAA GCT CTG GAT CTG GAA CTG AAG GGT GAC An
Val Phe Thr Thr lie leu Oír Ser Arg Ser Ptie Pro His Leu Arg Arg V al Phe Gln Asn Tyr Gly Lys Tyr Ser Gin His Asp Met Asn Lys Ala Leu Asp Leu Glu Leu Lys Gly Asp He
220 230 240 250 260
8» 870 928 929
GAG AAG TGC ac ACA ACC ATC G gtatgtagaa— 1.2kfcp---tctcttacag TG AAG TGT GCC ACC AGC Aa CCA GCT TTC ITT GCC GAG AAG aG TAC GAA GCC ATG AAG gtac---0.8 Vtp---gtctgcacag GCT GCC GGA Aa CGC CAT AAG
Glu Lys Cys Leu Oír Thr ¡le V al Lys Cys Ala Oír Ser Thr Pro Ala Phe Phe Ala Glu Lys leu Tyr Glu Ala Met Lys Gly Ala Gly Thr Arg His Lys
270 280 290
1051 1052
GCA TTG ATC AGG AH ATG CTC TOC OGT TCG GAA ATT GAC ATG AAT GAA ATC AAA OTA TH TAC CAG AAG AAG TAT GGA ATC TCT CTT TGC CAA GCC ATC CTG gtatgttgta—-0.9 top-- -gtctcaacag GAT GAA ACC AAA GGA GAC TAT
Ala leu lie Arg lie Met Val Ser Arg Ser Glu He Asp Met Asn Glu lie Lys Val Phe Tyr Gln lys lys Tyr Gly He Ser Leu Cys Gln Ala He Leu Asp Glu Ihr Lys Gly Asp Tyr
300 310 320 330
ÍO
O
GAA AAA ATC CTG CTG GCT CTG TGT GGT GGA AAC TAG ACATCCCAACTATTCTGCAAGCTTCTGAGGAGAATGTCTCTTAGCTCTTCTTTTOCTTCGATGGCATGGQCTTAACTAGGAAACTTGCTTTGGCAGATAACTCTAAnACCTGCTTTGAATAATATAOCCTATAAATAGATTnACATCATT
Glu Lys 1 le Laj Val Ala Leu Cys Gly Gly Asn EM)
340
1392
ACTCTGTACAATAGAGAAATACTTCTTTTCTTAATTATGnTATCCCAAATTATAAAGCCCCATAAGCAAGTCACTTTOCTACCATTCCTGAGAAAGAAGTTTACATATAATAAAATAAAACAATnTATAAGACAATTOGTGTCTCATTGTCTCTCCTTnCTGATnTCTnTTTTCTGCATGTAATCCAAGAGAAGT
CAGTTTTCCCCATTTGGAGATAATTTTGTGATTTTGTGAAATCACCAAAGTTCTACTAGAAAGCT

1
2
3
4
5
6
7
8
9
10
11
12
13
21
Mouse lipocortin I intron and exon sizes.
length (bp) intron length (bp)
61
I
6000
80
II
109
109
III
600
88
IV
1800
114
V
600
91
VI
1400
80
VI
800
56
VIII
1300
94
IX
1300
96
X
1200
59
XI
800
123
XII
900
342

22
About 1400 bp of sequence upstream of the transcription
initiation site is shown in Fig. 2-4. The initiation site
closely resembles the weak consensus sequence 5'-
PvPvCAPyPvPyPyPy-31. with transcription beginning at the A,
which has been identified as an independent recognition site
for transcription initiation in several mammalian genes
(Corden et al., 1980). A TATA box and CCAAT box are located
at positions -31 and -77, respectively. In addition, the
following potential regulatory sites were identified based
on reported consensus sequences (Mitchell and Tjian, 1989;
Addison and Kurtz, 1986): AP-1 binding site (-1331), Oct-1
binding site (-1217), cAMP response element (-325),
glucocorticoid response element (-298 and -107), delayed
glucocorticoid response element (-82), serum response
element (-234 and -213), and AP-2 binding site (80 bp into
the first intron, not shown).
Structural Organization of the Lipo I Gene
Figure 2-5 shows the position of the exons relative to
the corresponding amino acid sequence. The four C-terminal
amino acid repeats have been aligned, and the more highly
conserved 17-amino acid units believed to be responsible for
calcium/phospholipid binding are underlined (Geisow et al,
1986; Pepinsky et al., 1988). Although the third 70-amino
acid repeat is encoded by exons 8, 9, and 10, no other
striking correlation between exon structure and the large
repeats can be seen. Three of the four 17-amino acid

Figure 2-4. Sequence of the mouse lipocortin I promoter region. TATA and CCAAT motifs
at positions -31 and -77, respectively, are in bold print. Sequences resembling
binding sites for regulatory proteins are underlined and named as explained in the
text.

AP-1
-1350 AP-1 -1300 -1250 OCT -1200
CTGGAGAAGAGGCTCAGCAGGTAAGAGCACTGGTTGCTTTTCAGATGGACTCAGCTTCGATTCTCAGCACCCACCTGGCAGCCCACAACTGTCTGTAATTCCATTTCCAGTGGAGCTGACACCCTCATACAGACAGTGCATATAGACAAAACACCAATGCATGTAAATTAAAACAATAAATAATTTTTTAAAAGTACAAG
-750 -700 -650 -600
• _ • • •
TAGTGTTTTTATTAAATGTCATTATAATTCCATCTTTAACATCGATTATTGAAAATCGTGAGGTAATTCAGAGTCTCACGAGTTCCCTGTTTCTTAGTTATACTAGTTTCAAAGGCTTAATAGGAAGGCAAGAGCATTGCTGGTGAATCACAAGAAAAGTACTCATTAGAGAATCATTTTTTAAAAACCTCCAAATAAGT
to
*350 CRE -300 GRE -250 SRE SRE -200
CTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTTTTTAGTTTTGAGGTCAATGTGTTTAATTTTAAAGGAGTCCCAGTAAGTTCTCCAAGATAAGACAQjGAGAGCAACATAQCTGAACCACQCATCQCATGAACOTTCCTGGAQGAATAAAAACCTCAGAAGGMCAQCAGGGGAAAATCCATGATTCC
-150 -100 GRE sCRE -50 -1
TGI 11CII iGlCTOOCTGAAGATOGnCCOOGAGTACTTTTCAAGACTTGTTTCTCCnGGTTTTGACCAOOCTGAOCCAGnCnCAAAGAAAAGACAOCaiCnACTAACTTCTOGnOCTAOGTGTQOtrnCACTTCATATCCTATAWWTCAOGAGTCCAACCCTCCACTTCC

Figure 2-5. Correlation of lipocortin I genomic structure with protein domains. The
upper line of amino acids represents the unique N-terminus, and the lower four lines
show the internal repeats which are important in cacium/phospholipid binding. The
17-amino acid consensus sequence within each of the four repeats is underlined.
Exons encoding the various regions, and the locations where amino acid sequence is
interrupted by introns, are indicated.

1 BOON 2 22 Z3 EXON 3
MAMVSEFLKQARFLENQEQEY V|0 AVKSYKGGPG
58 59 EXON 4 90 91 EXON 5
SAVSPYPSFNVSSDVAAtHKAIMV KlGVDEATIIOlLrtCRTN AOROOIKAAYLOENG K|P LDEVLRKALTGHLEEVVLAMtKT
128 129 EXON 6 158 159 EXON 7 185
PAQFDADELRGAM K|G l G T 0 E D T L I E I L T T R SNEQ1REINRVYR E|E LKRDIAKD1 TSDTSGDFRKALIAIAK|
186 EXON 8 204 205 EXON 9 235236 EXON 10 267 268
G O R C Q D L S V K 0 D L A 0 T D A R|A l Y E A G E R R KGTDVNVFTT I LTSRSF PHLRR|VFQNYGKYSQHDMNKAIDLELKGD I EKCLTT 1|V ¡y,
EXON 11 287 288
EXON 12
328 329 EXON 13
KCATSTPAFFAEKLYEAM IC|G AGTRHKAL1RIHVSR SE I DHNE I KVFYQKKY G I SLCOA I L|DETKGDYEK I LVALCGGN

27
repeats occur at a Lys-Gly junction which is at the end of
one exon and the start of the next. The third 17-amino acid
repeat, unlike the other three, is located entirely within
one exon. This pattern is essentially identical to that
reported for mouse p36, or lipo II, where the first, second,
and fourth 17-amino acid repeats occur at exon boundaries,
while the third is located in one exon. Interestingly, the
second exon encodes the N-terminal 22 amino acids, including
sites for phosphorylation, proteolysis, and head-to-head
dimerization (see intro, for ref.).
Discussion
In this chapter, I have shown the complete mouse lipo I
gene structure and about 1400 bp of upstream flanking
region. This enables an analysis of lipo I gene/protein
structure relationships, as well as a comparison with that
of mouse lipo II. A complete comparison, however, is not
yet possible because the 5' end and promoter region of lipo
II have not been identified (Amiguet et al., 1990). Such an
analysis is useful to determine whether lipo I fits the
hypothesis that exons encode discrete functional or
structural domains of proteins (Blake, 1983; Gilbert, 1978).
The lipo I protein can be divided into two regions, an
N-terminus unique to this protein and a core region
consisting of four 70-amino acid repeats. These structural
repeats are shared among the other lipocortins and are
believed to be necessary for calcium/phospholipid binding.

28
All four are encoded by three exons, and in three of the
four cases exon/exon boundaries show no striking correlation
with amino acid repeat boundaries. However, in the case of
the third 70-amino acid repeat, exons 8, 9, and 10
correspond almost exactly with the repeat boundaries. The
significance of this observation is not clear, although it
suggests that each repeat may have originally been encoded
by a combination of three separate exons whose boundaries
then became less defined during subsequent duplication. The
pattern seen in lipo I is very similar to that of lipo II in
terms of the 70-amino acid repeats. In lipo II, however,
the boundaries of the third repeat do not correspond quite
as well to the exon/exon boundaries.
Correlation of the 17-amino acid consensus sequences
within each repeat (Geisow et al., 1986) to exon structure
supports the idea of a common ancestor exon for the repeat
unit. As shown in Fig. 2-5, three of four of the 17-amino
acid repeats begin at a Lys-Gly which is at the end of one
exon and the start of the next. The third repeat is the
exception, because it is encoded in the central part of one
exon. This pattern is virtually identical to that seen in
lipo II, except that in this case the first repeat starts
two amino acids before the Lys-Gly (Amiguet et al., 1990).
It is interesting to note that the majority of the
unique N-terminus is encoded by exon two. This part of the
protein contains potential sites for tyrosine and serine

29
phosphorylation, proteolysis, and dimerization. Therefore,
it is possible that exon two is a lipo I-specific regulatory
exon responsible for mediating its particular activity.
This correlates with the fact that the putative second and
third exons of lipo II encode regions believed important in
its regulation (Amiguet et al., 1990). Lipo II exon two
encodes the site for binding of a protein called pll, while
exon three encodes phosphorylation and proteolytic cleavage
sites (Glenney and Tack, 1985). Mitsunobu et al. (1989)
have isolated a cDNA from GL-5-JCK human glioblastoma cells
in which the region coding for the first 16 amino acids of
lipo II was fused to the coding region for the 370 C-
terminal amino acids of the c-raf-1 oncogene/kinase.
Expression of this lipo II/c-raf-1 fusion protein resulted
in transformation of NIH3T3 cells. The first 16 amino acids
of lipo II, encoded entirely by the putative second exon,
contain the binding site for pll. Binding of pll to lipo II
results in the formation of a p362pll2 tetramer which is
anchored to the cytoskeleton (Zokas and Glenney, 1987), so
it is possible that aberrant localization of the c-raf-1
kinase to the cytoskeleton, mediated by the pll binding site
encoded by the lipo II second exon, caused the cell
transformation observed by Mitsunobu et al. (1989).
Further analysis between the genomic structures of lipo
I and lipo II leaves little doubt of their common ancestry.
If one assumes that the ~52 bp of noncoding sequence

30
(indicated by primer extension) not identified in the lipo
II gene make up its first exon (Amiguet et al., 1990; Saris
et al., 1986), then the two genomic structures are nearly
identical. Both would consist of 13 exons, 6 of which are
exactly the same in length. The shared gene structure
supports the evolution of these two genes from a common 13
exon-containing ancestral gene, rather than the co-evolution
of the genes from a duplication of an ancestral repeat¬
encoding exon. This theory would also account for the
origin of calelectrin/p68 from a duplication of the 13 exon
ancestor to form the eight-repeat structure of p68. The
verification of this hypothesis must await the
characterization of gene structures for the remaining
members of the lipocortin family, including p68.
Of the potential regulatory sequences identified in the
1400 bp upstream of the transcription initiation site, the
most interesting are the GREs. Dexamethasone (DEX) has been
shown to induce lipo I mRNA levels in several cell types
(Phillips et al., 1989; Wallner et al., 1986; Wong et al.,
submitted), although it is clear that this response does not
occur in all cells investigated (Bienkowski et al., 1989;
Bronnegard et al., 1988; Hullin et al., 1989; Isacke et al.,
1989; Northup et al., 1988; William et al., 1988). Whether
this specificity is due solely to the presence or absence of
glucocorticoid receptors, or involves other factors, is
presently unclear. Especially intriguing is the region at

31
positions -82 to -42, which resembles the delayed
glucocorticoid response element (sGRE) of the rat alpha2u-
globulin promoter (Addison and Kurtz, 1986). This 45 bp
region was shown to mediate induction of transcription by
DEX. This induction, unlike those termed rapid primary
responses, required protein synthesis. A response which is
blocked by cycloheximide and usually shows a lag between
administration of the hormone and initiation of the response
has been called an indirect or secondary response (Chen and
Feigelson, 1980; Hess et al., 1990; Klein et al., 1988; Paek
and Axel, 1987; Widman and Chasin, 1982). The induction of
lipo I mRNA in the mouse pre-adipocyte line 3T3-L1 by DEX
both exhibits a lag time of about two hr and is blocked by
cycloheximide (Wong et al., submitted). Therefore, it is
possible that the delayed response to DEX observed in 3T3-
L1 cells is mediated by the putative sGRE in the lipo I
promoter.
Other potential regulatory sites of interest include
the two serum response-like elements. Different lipo I mRNA
expression levels were observed in several tissue culture
cells depending on the presence or absence of serum (K.
Horlick and W. Wong, unpublished data). In agreement with
this, the mRNA for lipo II (calpactin I) was shown to be
induced as a primary response to serum stimulation of
quiescent A31 cells (Keutzer and Hirschhorn, 1990). Also,
as documented in Chapter 4, an induction of lipo I mRNA in

32
the rat heart after injection of glucagon was observed.
Since glucagon action is mediated in many cases by increased
levels of cAMP, it is possible that the cAMP response
element identified in the lipo I promoter mediates this
tissue-specific response. In support of this, lipo I mRNA
levels are altered in 3T3-L1 cells after treatment with
methylisobutyl xanthine, a phosphodiesterase inhibitor which
leads to increased intracellular cAMP levels (Parsons et
al., 1988; W. Wong, unpublished data). Other experiments
shown in Chapter 4, however, do not support a role for cAMP
in the induction of heart lipo I mRNA by glucagon.
In conclusion, I have described the genomic structure
of mouse lipo I and compared it to the known portion of the
lipo II locus. The two closely related genes are unlinked
and located on chromosomes 19 and 9, respectively (Amiguet.
et al., 1990; Horlick et al., submitted). It will be of
interest to determine whether the other members of the
lipocortin family show a similar intron/exon organization,
further implicating a common gene ancestor which gave rise
to these proteins.

CHAPTER 3
REGULATION OF LIPOCORTIN I IN RAT MAMMARY TISSUE
DURING GLANDULAR DIFFERENTIATION AND INVOLUTION
Introduction
The mammary gland in both humans and rodents is a
complex tissue exhibiting dramatic morphologic and
functional changes during pregnancy and lactation in females
(Borellini and Oka, 1989; Hollmann, 1974; Topper and
Freeman, 1980). The gland consists of several cell types,
including fat cells, epithelial cells, and myoepithelial
cells, whose number and morphology change according to
developmental status.
During sexual maturation, epithelial cells grow
extensively to form the tree-shaped ductal system
characteristic of mammary tissue. Upon sexual maturation,
this ductal development stops even though the major hormonal
stimuli for growth are still present. At this stage the
epithelial cells are dormant, arrested in the G, phase of
the cell cycle. Pregnancy causes hormonal changes which
relieve mammary epithelial cells of growth constraints, and
consequently cell replication resumes in the first half of
pregnancy. In middle to late pregnancy, epithelial
proliferation continues, and differentiation into secretory
cells, or alveoli, takes place. As term approaches, alveoli
33

34
begin to accumulate secretory products and increase
cytoplasmic size.
In the lactating gland, secretory cells are highly
polarized with respect to both morphology and function. A
large part of the cytoplasm is occupied by rough endoplasmic
reticulum and a well-developed Golgi apparatus is located in
the apical region. Alveoli manufacture and secrete large
quantities of protein, fat, and carbohydrate.
As suckling decreases during natural weaning,
involution of the gland begins. At this time, secretory
alveoli develop large vacuoles containing casein micelles
and large fat droplets. As weaning progresses, these
vacuoles fuse with hydrolytic lysosomes, leading to
autophagy. The majority of epithelia are destroyed, but
some survive to become resting cells, like those in the
mature virgin gland, which will proliferate and
differentiate upon the next pregnancy.
The hormonal determinants of mammary gland development
are complex and beyond the scope of this introduction. They
include insulin, cortisol, prolactin, estrogen, epidermal
growth factor, transforming growth factor beta, thyroid
hormones, retinoids, and vitamin D3 (Borellini and Oka,
1989). In addition, other factors affecting mammary growth
include calcium, polyamines, and poly(ADP-ribose).
A lipo I-like gene was studied in the pigeon cropsac,
an organ which displays the same hormonal specificity as the

35
mammary gland, but is substantially simpler (Horseman, 1989;
Pukac and Horseman, 1986). In the cropsac, a homogenous
population of pseudostratified squamous epithelia
proliferates and differentiates after prolactin treatment.
As mentioned above, prolactin is very important in
establishing and maintaining lactation in the mammary gland.
The differentiated epithelia of the cropsac synthesize and
store large amounts of lipoprotein globules which are used
to nourish offspring.
Several genes which were induced in the cropsac after
intradermal injection of prolactin were cloned and
characterized (Pukac and Horseman, 1986). The mRNA for the
major prolactin-induced gene was stimulated as early as
three hr after injection of the hormone and peaked at levels
about 70-fold higher than before injection. This mRNA
encoded a polypeptide of molecular weight 35,500. When the
nucleotide sequence of this prolactin-induced cDNA was
determined, it was found to be highly similar to that of
mammalian lipo I (Horseman, 1989). The only region of
substantial sequence difference was a domain in mammalian
lipo I encoding amino acids 20-40, including a tyrosine
phosphorylation site and other residues believed to be
physiologically important. It was concluded that
lipocortins might be regulated by prolactin in other
tissues, and that the difference in sequence near the N-
termini of mammalian and avian lipocortins might represent a
divergence yielding different regulatory mechanisms.

36
Lozano et al. (1989b) studied several mammary gland
calcium-binding proteins in the mouse mammary gland during
development. Some of these proteins had previously been
identified as calelectrins and calpactin I/lipocortin II
(Horn et al., 1988). It was found that the mammary gland
calcium-binding proteins were developmentally regulated:
They were present in large amounts in the mature virgin
gland, but were virtually absent in the lactating gland.
Immunolocalization revealed that ductal epithelial cells in
the virgin gland were rich in calelectrins and calpactin I,
while myoepithelia did not contain them. The secretory
alveolar epithelial cells of the lactating gland, in
contrast to epithelia from the virgin gland, were
essentially devoid of these proteins. Based on these
results, the authors seriously questioned a role for
calelectrin and calpactin I in casein exocytosis. They
previously had proposed that these calcium binding proteins
might be involved in epithelial cell spreading, including
cell motility or cell shape changes (Braslau et al., 1984;
Rocha et al., 1986).
This chapter shows studies designed to investigate lipo
I mRNA and protein expression in the rat mammary gland
during natural differentiation and involution, as well as
after premature termination of lactation by pup removal.
Since two other annexins were shown to be developmentally
regulated in the mouse mammary gland as described above, it

37
would be important to determine if lipo I would exhibit
regulation in mammary tissue. Another question these
studies address is whether or not mammalian lipo I might be
induced by prolactin, similar to the lipo I-like pigeon gene
in the cropsac. The profile of prolactin expression in the
rat during pregnancy and lactation is known, and could be
compared to expression of lipo I.
The results described in this chapter indicate that
both lipo I mRNA and protein levels show striking
alterations in the mammary gland of dams during normal
differentiation and involution, as well as following
premature pup removal. In contrast to the pigeon lipo I-
like gene, rat mammary lipo I does not appear to be induced
by prolactin, and is in fact inversely related to predicted
prolactin levels.
Materials and Methods
Animals
Timed-pregnant Sprague-Dawley rats were obtained from
Charles River Laboratories.
RNA Isolation
Total RNA was isolated by homogenizing tissues in a
guanidinium thiocyanate-sarcosyl solution followed by acid
phenol/chloroform extraction and ethanol precipitation as
described previously (Chomczynski and Sacchi, 1987).
Typically, about 1 g of tissue was lysed in 5 ml of
thiocyanate solution containing 4 M guanidine thiocyanate,

38
25 mM sodium citrate (pH 7.0), 0.5% sarcosyl, 100 mM 2-
mercaptoethanol. To this solution, 300 (il of 2 M sodium
acetate (pH 4.0), 3 ml of HzO-saturated phenol, and 1 ml of
chloroform:isoamyl alcohol (24:1) were added in stepwise
fashion. The mixture was centrifuged at 10,000 x g for 10
min to separate phases. The agueous phase was mixed with 3
ml of isopropanol and total RNA precipitated by incubating
the mixture at -20°C for at least 1 hr, followed by
centrifugation at 10,000 x g for 30 min. The RNA pellet was
then resuspended in 600 nl of guanidine thiocyanate solution
and further purified by isopropanol and ethanol
precipitation.
Northern Analysis
An aliguot of 20 /xg total RNA was loaded on a 1% MOPS (3-
(N-morpholino)- propanesulphonic acid)-formaldehyde agarose
gel as described previously (Sambrook et al., 1982). The
gel was run for 12-16 hr at 40 volts with constant buffer
recirculation. The gel was then subjected to three 30-min
washes with water, one 45-min wash in 0.05 N NaOH and 0.01 M
NaCl, one 45-min wash in 0.1 M Tris-HCl (pH 8.0), and a 30-
min wash in a solution containing 0.089 M Tris-borate, 0.089
M boric acid, and 0.002 M EDTA, pH 8.0. The RNA was
electrophoretically transferred from the gel to a noncharged
nylon membrane (GeneScreen, NEN) for 1 hr. The RNA was
immobilized on the membrane by cross-linking with UV light
(Church and Gilbert, 1984) and analyzed with a specific
radiolabeled probe.

39
Probe Synthesis
A mouse lipocortin I cDNA provided by William Wong of
this laboratory, a rat Cu/Zn superoxide dismutase cDNA
provided by Jan-Ling Hsu of this laboratory, and a mouse
histone H4 cDNA (Seiler-Tuyns and Birnstiel, 1981) were used
as probes. Probes labelled with a-32? dATP (NEN,
800uCi/mmol) were synthesized either by random primer
extension, as described in Chapter 2, or by an M13 single-
stranded probe synthesis method using an M13mpl8 clone
containing the mouse lipo I cDNA insert in the appropriate
orientation to produce a probe complementary to mRNA (Church
and Gilbert, 1984). Hybridization was carried out as
described in Chapter 2.
Western Analysis
Mammary tissue was weighed and homogenized in 10 ml of
20 mM Tris-HCl (pH 7.4), 1 mM EDTA, 255 mM sucrose
supplemented with 1% aprotinin. A polytron was used for
homogenization (two times at half-maximal speed for 10 sec
each). After the suspension was spun at 212,000 X g for 70
min at 4°C, a Markwell protein assay was performed on the
supernatant. 100 /xg of total protein was run on a 10%
polyacrylamide reducing gel and transferred to
nitrocellulose. The membrane was blocked for 3 hr using 20
mM Tris-HCl (pH 7.4), 0.5 M NaCl (TBS) supplemented with 3%
BSA and 0.05% Tween and incubated for 16 hr at 4°C with an
anti-lipocortin I antibody (Huang et al., 1986) at 1:1000

40
dilution in 3% BSA/TBS. The membrane was washed for 1 hr
with 1% BSA/TBS and then incubated with 1 X 107 cpm of re¬
labeled protein A for 1 hr. After three 20-min washes in 25
ml TBS, the membrane was air-dried and exposed for 3-5 days
to Kodak X-OMAT film.
Results
To investigate lipo I mRNA levels in the rat mammary
gland during differentiation and involution, I carried out
Northern analysis using a mouse lipo I cDNA probe (Fig. 3-
1). Messenger RNA levels from mature virgin animals were
compared with those from animals which were either pregnant,
lactating, or weaned. The mRNA was very abundant in the
nonpregnant state. At midpregnancy, a large decline was
observed, corresponding to the time when epithelial cells
proliferate and differentiate (Topper and Freeman, 1980).
By day 22 of pregnancy (1-2 days before birth), mRNA levels
decreased at least 50-fold as compared to virgin animals.
At birth a small, but reproducible increase occurs. With
the onset of lactation, lipo I mRNA was undetectable and
remained so for the remainder of the suckling period. After
weaning had occurred (30 days following birth), the mRNA
rose to levels comparable to those seen in virgin animals.
To illustrate the time during pregnancy when epithelial
cells begin proliferating, I also determined histone H4 mRNA
levels, which increase during DNA synthesis and cell
proliferation (Seiler-Tuyns and Birnstiel, 1981). A rise in

41
PREGNANT LACTATING
NP 7 11 15 19 22 B 1 3 7 15 19 22 W
Histone
Cu/Zn SOD
Figure 3-1. Regulation of mammary lipocortin I mRNA during
pregnancy, lactation, and involution. Total RNA was
isolated from mammary tissue of female rats which were
mature virgins (NP), pregnant for various lengths of time
(days), had just given birth (B), had suckled pups for
various lengths of time (days), or after weaning (W, 30 days
after birth). Birth usually occurs on day 23. Northern
blot analysis was carried out with a cDNA probe for mouse
lipocortin I, then the blot was stripped and reprobed with
mouse histone H4 and rat copper/zinc superoxide dismutase
(SOD) cDNAs.

42
histone H4 is apparent at day 15 of pregnancy, when mammary
epithelial cells begin proliferation and differentiation,
and also after weaning, during glandular involution.
Copper/zinc superoxide dismutase mRNA levels are illustrated
as an internal control, and show only a small variation over
the same time course.
Figure 3-2 focuses on the decrease in steady-state lipo
I mRNA levels in mammary tissue of dams following the start
of suckling. Two animals are shown to demonstrate
reproducibility. The decline in lipo I mRNA can be compared
to levels of copper/zinc superoxide dismutase, which remain
relatively constant during the experiment.
To investigate whether the lipo I protein followed a
similar expression pattern, extracted mammary tissue
proteins were analyzed by immunoblotting (Fig. 3-3). Also
shown are mammary lipo I mRNA levels from the same animals.
The lipo I-specific antibody revealed abundant levels of
lipo I protein in the virgin rat gland. Like the mRNA, the
protein declined during pregnancy, was nearly undetected
during lactation, and increased at weaning. Densitometric
analysis of protein and mRNA levels shows a close
correspondence between the two (Fig. 3-4).
Since the lipo I mRNA increased rapidly upon weaning,
the role of the suckling stimulus in lipo I regulation was
investigated. Messenger RNA levels were determined in
mammary tissue of dams which had pups withdrawn at birth.

43
•• mi
Cu/Zn SOO
Figure 3-2. Decrease in mammary lipocortin I mRNA levels
with the onset of lactation. Total RNA was isolated from
mammary tissue of animals which had just given birth or had
suckled pups for one, two, or three days. Each
determination was performed in duplicate. Northern analsis
was carried out using mouse lipocortin I and rat Cu/Zn SOD
cDNA probes.

44
mRNA
protein
Figure 3-3. Regulation of lipocortin I mRNA and protein
levels in rat mammary tissue during glandular
differentiation and involution. Total RNA and protein were
isolated from mammary tissue of rats as described in Figure
3-1. P, pregnant; L, lactating. Northern analysis and
immunoblotting were then carried out using a mouse
lipocortin I cDNA probe and anti-lipocortin I antibody,
respectively.

45
Figure 3-4. Densitometric analysis of the data in Figure 3-
3. A Bio Image Visage 60 image processor was used for
quantitation of lipocortin I mRNA and protein levels in
Figure 3-3.

46
Figure 3-5 shows that as early as one day after pups were
removed, lipo I mRNA levels dramatically increased over the
level at birth. Actin mRNA rose to a lesser degree, while
levels of copper/zinc superoxide dismutase mRNA were
relatively constant during the experiment.
To further investigate the role of the suckling
stimulus, lipo I mRNA levels were analyzed in mammary tissue
of dams following pup withdrawal at birth and after seven
days of suckling (Fig. 3-6). Also, time points prior to 24
hr after withdrawal were examined in order to determine how
fast the induction of lipo I mRNA was. If pups are removed
at birth, completely preventing the suckling stimulus,
mammary lipo I mRNA levels increased significantly in the
dams as early as 6 hr after removal, reaching a plateau by
12 hr. If pups were withdrawn after seven days of suckling,
the increase in lipo I mRNA was delayed by several hours and
peaked by 24 hr. In contrast, lipo I protein levels were
low to undetectable for more than 24 hr after pups were
removed either at birth or after seven days of suckling, but
by five days after removal the protein had reached maximal
levels.
To examine the specificity of lipo I regulation
following pup withdrawal, lipo I mRNA levels were next
measured in the mammary gland and several other tissues from
animals whose pups were withdrawn 15 days following birth
(Fig. 3-7). This experiment demonstrated that lipo I mRNA

47
Figure 3-5. The role of the suckling stimulus directly after
birth on lipocortin I mRNA levels in mammary tissue. Pups
were removed at birth and total RNA was isolated from
mammary tissue of dams at 0, 1, 3, 5, 7, and 9 days
following pup withdrawal. Northern blot analysis was done
using lipocortin I, actin, and Cu/Zn SOD cDNA probes as
described previously.

48
pups removed at Birth 7 days
time after removal: 0 6 12 24 5d 0 6 12 24 5d
mRNA
protein
Figure 3-6. Induction of lipocortin I mRNA and protein
expression in mammary tissue of dams following pup removal
at birth or day seven of suckling. Pups were removed from
the dams at birth or following seven days of suckling, and
total RNA and protein were isolated from mammary tissue of
dams at 0, 6, 12, 24, and 120 hr/5 days following pup
withdrawal. Northern analysis and immunoblotting were
carried out as described in the legend to Figure 3-3.

49
time after
removal:
Mammary tissue
0 6 12 24 5d
Heart Kidney Muscle
0 6 12 24 Sd 0 6 12 24 Sd 0 6 12 24 Sd
Figure 3-7. Specificity of the mammary lipocortin I mRNA
regulation following pup withdrawal. Total RNA was isolated
from various tissues of dams whose pups were removed
following 15 days of suckling. RNA was prepared 0, 6, 12,
24, and 120 hr/5 days after pup withdrawal. Northern
analysis was done using a mouse lipocortin I cDNA probe.

50
levels were constant in the heart, kidney, and hindleg
muscle of dams, while there was a significant rise in
mammary tissue expression over the five-day withdrawal
period. Thus, the regulation of lipo I mRNA in the mammary
gland after pup removal was a tissue-specific phenomenon.
The increase in lipo mRNA levels over the five-day period
following pup withdrawal, shown in Fig. 3-6 and 3-7, was
between 60- and 80-fold (Fig. 3-8).
Discussion
It is likely that hormonal changes during pregnancy and
lactation influence the pattern of mammary lipo I mRNA and
protein expression. Based on the awareness of a prolactin-
inducible, lipo I-like gene in the pigeon cropsac, I
explored the effects of prolactin on mammalian lipo I gene
expression. These experiments involved the use of the
midpregnancy-derived mammary epithelial cell line HC11,
which had been clonally selected for its responsiveness to
prolactin (Ball et al., 1988). Treatment of these cells
with prolactin, however, caused no change in lipo I mRNA
expression, which was also the case when mammary explants
were treated with prolactin in culture (data not shown).
Furthermore, in the rat, circulating levels of prolactin are
low until one day before birth, when they rise dramatically
(Rosenblatt et al., 1979). Prolactin levels remain high
during suckling and gradually decline as weaning approaches.
In contrast, lipo I mRNA and protein levels are high in the

51
FIGURE 3-8. Densitometric analysis of the increase in
lipocortin I inRNA levels following pup withdrawal.
Quantitation of the mRNA data in Figures 3-6 and 3-7 was
done using a Bio Image Visage 60 image processor. The first
five bars (open) represent pup removal at birth and show a
30-fold mRNA increase from birth to five days after pup
removal. The next five bars (diagonal lines) represent pup
removal after seven days of suckling and exhibit a 120-fold
mRNA increase over the five-day period after pup withdrawal.
The last five bars (X's), which represent pup removal after
15 days of suckling, show a mRNA induction of 320-fold over
the time course.

52
virgin gland and during the first half of pregnancy, and low
to undetectable at birth and during lactation. This
indicates that if prolactin is involved in regulating
mammary lipo I expression, it would do so by down-
regulation, which I did not observe in HC11 cells or mammary
explants. Future studies investigating mammary epithelial
cell lines for hormonal effects on lipo I expression may aid
in understanding the regulation I observed in the mammary
gland during differentiation and involution.
Although prolactin did not affect expression of lipo I
mRNA in the mouse mammary epithelial cell line HC11, I did
observe high levels of the message (data not shown). Thus,
it is likely that the resting ductal epithelial cells, which
give rise to secretory cells during pregnancy, are
responsible for the high lipo I expression observed in the
virgin gland. Immunolocalization of two other annexins,
annexin II and calelectrin, in virgin mammary epithelial
cells by Rocha and coworkers supports this hypothesis (Horn
et al., 1988; Lozano et al., 1989a; Lozano et al., 1989b).
In contrast, secretory cells of the lactating gland were
essentially devoid of these proteins (Lozano et al., 1989b).
The ductal cells, which are dormant in the mature virgin
animal and reported to be arrested in the G, phase of the
cell cycle, begin proliferation and differentiation into
secretory cells around midpregnancy (Topper and Freeman,
1980). The striking decline in lipo I mRNA and protein

53
levels that I observed in the rat mammary gland during
pregnancy corresponds to the onset of these changes in
epithelial cell morphology. I believe that the high level
of lipo I in the virgin mammary gland may be involved in
inhibiting epithelial cell proliferation and
differentiation. This leads to a consideration of what
regulates lipo I. It is well known that epidermal growth
factor (EGF) is important in signaling mammary gland growth
during pregnancy (Taketani and Oka, 1983). The EGF
receptor, which is known to phosphorylate lipo I (Sawyer and
Cohen, 1985), reaches its highest levels in the mammary
gland around midpregnancy (Edery et al., 1985). Perhaps
phosphorylation of lipo I during pregnancy alters its
activity, which is followed by a subsequent down-regulation
of lipo I expression. Although it has been demonstrated
that serine/threonine phosphorylation of lipo I blocks its
phospholipase-inhibitory activity and alters its
calcium/phospholipid binding properties (Ando et al., 1985;
Hirata, 1981; Hirata et al., 1984; Touqui et al., 1986), it
is yet to be investigated whether tyrosine phosphorylation,
too, is inhibitory. Nevertheless, this event may be
necessary to initiate epithelial cell proliferation and
differentiation.
Soon after natural weaning or premature termination of
the suckling stimulus by pup removal, a subpopulation of the
mammary secretory epithelial cells reverts back to the

54
resting state, while the remainder of the cells die
(Borellini and Oka, 1989; Hollmann, 1974). No irreversible
changes in the gland occur immediately after cessation of
suckling, because lactation can recommence several days
after weaning (Silver, 1956). The subset of epithelial
cells which reverts to the resting state may be responsible
for the rapid increase in mammary lipo I mRNA after removal
of the suckling stimulus. These cells may receive a signal
from the sympathetic nervous system when suckling ceases
which causes a rapid transcriptional activation of lipo I in
preparation for return to the resting state. As shown in
Fig. 3-6, translation of lipo I mRNA appears to be delayed
and requires more than 24 hours after cessation of suckling.
This delay may correspond to the time when glandular
involution becomes a committed event, encompassing
epithelial cell death. This appears to occur approximately
five days after weaning (Silver, 1956), and therefore
correlates with the time at which maximal levels of lipo I
are reached. I believe that the high lipo I levels observed
in the involuted gland following natural weaning (Fig. 3-1)
indicate the presence of new resting epithelial cells,
which, like those in the mature virgin gland, may undergo
proliferation and differentiation with the onset of a new
pregnancy.

CHAPTER 4
TISSUE-SPECIFIC REGULATION OF LIPOCORTIN I itlRNA
LEVELS IN RATS DURING DIABETES AND BY GLUCAGON
Introduction
Diabetes mellitis, a serious and prevalent disease
among humans, is known to result in a wide variety of
physiological alterations which often may result in death
(Warren et al., 1966). Numerous gualitative and
guantitative alterations take place in the pancreas, the
organ in which the insulin-producing islet cells are
located. Cardiovascular disease is one of the leading
causes of death in diabetics, with both heart dysfunction
and atherosclerosis freguently developing. Renal
alterations include a marked hypertrophy with corresponding
increase in kidney weight, as well as an increased
glomerular filtration rate. Blindness may result from
retinopathy, such as microaneurysms. Nervous system damage,
most notably in peripheral nerves, results in symptoms
including pain and loss of sense in the feet and legs.
Gangrene in the extremities, bone and skin lesions, muscle
atrophy, liver damage, and gastrointestinal problems often
occur in diabetics.
Many studies regarding diabetes have relied upon animal
models, including rats (Fein et al., 1980), rabbits (Bhimji
55

56
et al., 1985), and dogs (Regan et al., 1981). Administration
of alloxan (Dunn et al., 1943) or the antibiotic
streptozotocin (STZ)(Junod et al., 1967) has been shown to
cause impaired /?-cell function and hypoinsulinemia in young
animals, thus simulating the diabetic state. In addition,
there are Chinese hamster (Yerganian et al., 1957), mouse
(Bielschowski and Bielschowski, 1956), and rat (Rodrigues
and McNeill, 1990) inbred strains which develop spontaneous,
hereditary diabetes.
Several biochemical alterations have been observed in
tissues from diabetic animals. Fatty acid compositions of
phospholipids of heart, kidney, aorta, and serum undergo
changes in both human (Chase et al., 1979) and animal (Faas
and Carter, 1980) diabetes. Specifically, linoleic acid was
found to be increased and arachidonic acid to be decreased
in most tissues as compared to nondiabetic controls (Faas
and Carter, 1980; Holman et al., 1983; Schrade et al.,
1963). Physical properties of cell membranes, such as
fluidity, may be altered in diabetic tissues (Cheung et al.,
1980; Shinitzky, 1980). Recent studies have focused on the
diminished arachidonic acid levels and altered arachidonate
metabolism in heart muscle of STZ-diabetic rats
(Gudbjarnason et al., 1987; Pieper, 1990). Since
alterations in arachidonate-derived products such as
prostaglandins and leukotrienes have been implicated in
heart dysfunction in diabetic rats (Johnson et al., 1984),

57
it is possible that changes in arachidonate metabolism could
play a critical role in diabetic heart diease.
Many other biochemical changes in the diabetic heart
have been documented. The /3-adrenergic receptor number in
cardiac membranes was lowered and their coupling to
adenylate cyclase was altered in STZ-diabetic rats (Atkins
et al., 1985). The 1,2-diacylglycerol content in myocardium
from STZ-diabetic rats was highly elevated (Okumura et al.,
1988). Significant reductions in calcium binding and uptake
have been observed in sarcoplasmic reticulum sections from
diabetic rat hearts (Bergh et al., 1988; Bielefeld et al.,
1983; Fein et al., 1980; Ganguly et al., 1983; Penpargkul et
al., 1979). Both phosphoinositide synthesis and release
from membrane phospholipids were greatly reduced in diabetic
rat hearts (Bergh et al., 1988). In addition to the heart,
reduced inositol content and turnover have been observed in
diabetic nerve, lens, and kidney (Craven and DeRubertis,
1989; Winegrad, 1987).
Studies reported in this chapter were carried out to
investigate the possible role of lipo I in the altered
metabolism associated with diabetes. Lipocortin I has been
implicated as a regulator of arachidonic acid metabolism
through modulation of phospholipase activity (Hirata et
al., 1980). As noted above, levels of arachidonic acid and
some of its metabolites were shown to be altered in several
tissues of diabetic animals. The phospholipid-binding

58
activity of lipo I is known to be calcium-dependent
(Glenney, 1986), and significant changes in calcium levels
in some diabetic tissues have been documented. Finally, the
closely related protein lipocortin III was recently
identified as a hydrolase involved in regulation of
phosphoinositide turnover, suggesting the function of lipo I
may also be to regulate this important pathway. As
described above, alterations in phosphoinositide metabolism
have been documented in several diabetic tissues.
After demonstrating tissue-specific induction of lipo I
in STZ-diabetic rats, certain hormones were investistigated
to determine which ones might play a role in lipo I
induction. It was found that glucagon, which is highly
elevated in diabetic animals (Unger et al., 1963), caused
induction of lipo I in the heart as early as 4 hr after
injection. Lipocortin I mRNA expression in two other
tissues in which induction was seen in diabetic animals was
not affected by glucagon up to 24 hr after injection.
Possible reasons for the relatively rapid induction of lipo
I mRNA expression in the heart by glucagon, and induction in
heart and other tissues in diabetic animals, will be
dicussed. These studies are the first to link glucagon and
diabetes with any of the annexins.
Materials and Methods
STZ-Diabetes and Insulin Treatment
Male Sprague-Dawley rats (100-150 grams) were injected
intraperitoneally with 65 mg/Kg streptozotocin (Aldrich),

59
which was dissolved in 0.05 M sodium citrate buffer, pH 4.5.
After 24 hr, urine was analyzed using Boehringer Mannheim
Chemstrips to detect glucosuria and ketosis. Animals
exhibiting these symptoms, as well as loss of body weight,
were sacrificed after three-four days and tissues isolated
for RNA extraction. Another group of animals, made diabetic
as described above, was injected once daily for seven days
with 2 U of NPH beef insulin (Squibb). Urine glucose and
ketone levels returned to normal during insulin treatment.
Two animals maintained on insulin were sacrificed following
the final injection, while two others were taken off insulin
for three days to allow diabetic symptoms to again develop.
The normal state of insulin-treated rats, and diabetic state
of rats removed from insulin treatment, were confirmed by
both urine analysis and blood glucose determination (Sigma).
Hormones
Glucagon, a kind gift of Lilly Research Laboratories,
was used at a concentration of 1 mg/Kg body weight.
Dibutyral cAMP (Sigma) was used at 50 mg/Kg, dexamethasone
phosphate (Quad) at 10 mg/Kg, epinephrine (Sigma) at 1
mg/Kg, and insulin at 2 mg/Kg. Glucagon, epinephrine, and
insulin were dissolved at a concentration of 1 mg/ml in a
buffer containing 1% bovine serum albumin and 1.6% glycerol,
pH 2.5-3.0.

60
RNA Isolation. Northern Analysis, Probe Preparation, and
Hybridization
These procedures are described in Materials and Methods
in Chapters 2 and 3. A mouse /3-actin cDNA was kindly
provided by Larry Kedes.
Results
To determine if changes in lipo I mRNA expression occur
in tissues of diabetic rats, I injected rats with STZ to
induce diabetes and compared tissue lipo I mRNA levels with
those of controls. Figure 4-1 shows Northern analysis
comparing lipo I mRNA levels in several tissues from a
diabetic and control rat. While levels in the brain,
intestine, lung, and thymus were similar, a significant
increase was observed in the heart, kidney, and hindleg
muscle. Actin mRNA levels are shown as an internal control.
Note that the mouse /?-actin cDNA probe used hybridized to
two mRNA species of different sizes in heart and hindleg
muscle.
To demonstrate the reproducibility of the induction of
lipo I mRNA in the heart, kidney, and hindleg muscle, I
repeated the above experiment using two other STZ-diabetic
rats. Figure 4-2 further illustrates this induction, and
also shows that lipo I mRNA levels in the liver and
intestine are not affected by acute diabetes. Again, actin
mRNA levels are shown for comparison.
To investigate whether the induction of lipo I mRNA in
the heart, kidney, and hindleg muscle was truly a result of

61
CDCDCDC DCDCDC D
Figure 4-1. Expression of lipocortin I mRNA in tissues from
a control and three-day streptozotocin-diabetic rat. Rats
were injected intraperitoneally with buffer only or 65 mg/kg
streptozotocin and tissue RNA was isolated and subject to
Northern analysis after three days. A mouse /3-actin probe
was used as an internal control.

62
Figure 4-2. Increased levels of lipocortin I mRNA in the
heart, kidney, and hindleg muscle of three-day
streptozotocin-diabetic rats. Northern analysis was carried
out as described in the Figure 4-1 legend.

63
the diabetic state and not caused by another effect of STZ,
I carried out an experiment in which insulin was used to
control the disease (Fig. 4-3). Rats were injected with STZ
to induce diabetes. After three days, when both urine
glucose and ketones were very high, animals were subject to
daily injections of 2 U NPH beef insulin for the following
seven days. One day after insulin treatment, urine glucose
and ketone levels approached normal and remained so until
the end of the treatment. Following the seven-day insulin
therapy, two animals were sacrificed and total RNA was
isolated from tissues. Two other rats were removed from
insulin treatment, and as a consequence urine glucose and
ketones rose within a day. Three days after stopping
insulin treatment, animals were sacrificed and total RNA was
isolated from tissues. Northern analysis (Fig. 4-3a) showed
that in the heart and kidney, lipo I mRNA levels increased
when animals were removed from insulin treatment and
exhibited diabetic symptoms. In contrast, levels in hindleg
muscle remained the same. To confirm diabetes and show that
insulin treatment was effective, blood samples were taken
and plasma glucose levels determined (Fig. 4-3b). While
blood glucose levels in the insulin-treated rats were only
slightly above the normal range, levels in the animals taken
off insulin were clearly indicative of diabetes.
I next investigated hormones which might play a role in
the altered lipo I expression in diabetic rat tissues. A

64
Figure 4-3. Heart, kidney, and hindleg muscle lipocortin I
mRNA expression in streptozotocin-injected rats on and off
insulin treatment, a) Three days after intraperitoneal
injection of 65 mg/kg streptozotocin, rats were given daily
injections of 2 U NPH beef insulin for seven days.
Following the final insulin injection, two rats were
sacrificed and tissue RNA isolated. Two other rats were
removed from the insulin treatment for three days before
isolating tissue RNA. Northern analysis shows lipocortin I
and actin mRNA levels, b) Serum glucose levels in the rats
represented above were determined using a Sigma kit and are
shown graphically. The normal range is around 150-200
mg/dL.

65
preliminary study using animals which had been injected with
glucagon, insulin, and dexamethasone revealed that lipo I
mRNA was induced in the heart 4 hr after injection of
glucagon (Jan-Ling Hsu and K. Horlick, unpublished results).
Glucagon, which is known to mediate cellular effects via
increased cAMP levels and calcium mobilization (Wakelam et
al., 1986), is highly elevated during diabetes (Unger et
al., 1963). To further study a potential link between
glucagon and lipo I induction, I injected rats with glucagon
and assayed lipo I mRNA levels in several tissues after 4
hr. Figure 4-4 demonstrates that glucagon injection caused
an increase in lipo I mRNA levels in the heart, but not in
kidney or muscle, after 4 and 24 hr. Figure 4-5 shows
glucagon induction of lipo I mRNA levels in the heart of
four animals, representing an increase of between two- and
five-fold compared to the control animal. Quantitation was
done using actin mRNA levels to normalize lipo I data. To
determine the approximate time required for induction of
heart lipo I mRNA by glucagon, a time course experiment was
undertaken (Fig. 4-6). The results showed that induction
required about 4 hr and could still be seen 24 hr after
injection.
Next, I tested other hormones to help define the
mechanism by which lipo I mRNA expression is elevated in the
heart (Fig. 4-7). Dexamethasone, a synthetic
glucocorticoid, and insulin, had no effect. Epinephrine, a

66
Heart Kidney Muscle
Glucagon -+- + — +
lipo I
Heart Kidney Muscle
Glucagon ~ — + — +
♦ lipo I
24 , m
actin
Figure 4-4. Induction of lipocortin I mRNA in the rat heart
after injection of glucagon. Four or 24 hr after
intravenous tail vein injection of 1 mg/kg glucagon, total
RNA was isolated from various tissues and subject to
Northern analysis. Actin mRNA levels are shown as an
internal control.

67
Glucagon — + + + +
t * - *é % .» actin
Figure 4-5. Increased levels of lipocortin I mRNA in the
heart after glucagon injection in four animals. Heart RNA
was isolated 4 hr after injection of 1 mg/kg glucagon or
buffer only and subject to Northern analysis. One of the
two actin mRNA species is also shown.

68
O 0.5 1 2 4 8 12 24
Figure 4-6. Time course of the increase in lipocortin I mRNA
in the heart after injection of glucagon. Rats were
injected intravenously with 1 mg/kg glucagon and heart RNA
was isolated after various times (hr). Northern analysis
also shows actin mRNA levels.

69
lipo I
Figure 4-7. Lipocortin I mRNA expression in the rat heart
following injection of glucagon and other hormones. Rats
were injected intravenously with saline, glucagon,
epinephrine, dibutyral cAMP, dexamethasone, or insulin and
heart RNA was isolated after 4 hr. Northern analysis shows
lipocortin I and actin mRNA levels.

70
hormone which acts through increased cAMP levels and effects
heart function (Regan et al., 1964), was also without
effect. In addition, injection of cAMP did not change heart
lipo I mRNA expression. The induction of heart lipo I mRNA
by glucagon and lack of effect of the other hormones and
cAMP was also observed in mice (Fig. 4-8).
Discussion
Studies in this chapter demonstrate that tissue-
specific regulation of lipo I mRNA levels occurs as a result
of diabetes, and that glucagon may play a part in this
regulation. These experiments are the first to report a
link between a member of the annexin family and diabetes,
and also to show alterations in expression of an annexin in
response to glucagon.
Of the STZ-diabetic tissues studied, the heart, kidney,
and hindleg muscle showed a significant increase in steady-
state lipo I mRNA levels. To gain possible insight into the
role of lipo I in these tissues, the known effects of
diabetes on them must be considered. In the case of the
heart, cardiovascular disease is a major cause of death in
diabetes, responsible for about 70% of diabetic mortality
(Christlieb, 1973). While atherosclerosis is an important
component, studies in the rat (Fein et al., 1980), rabbit
(Fein et al., 1985), dog (Regan et al., 1974), and monkey
(Haider et al., 1981) show evidence for primary
cardiomyopathy, or dysfunction in the heart itself. A

71
Figure 4-8. Lipocortin I mRNA expression in the mouse heart
following injection of glucagon and other hormones. Mice
were injected intravenously with saline, glucagon,
epinephrine, dibutyral cAMP, dexamethason, or insulin and
heart RNA was isolated after 4 hr. Northern analysis shows
lipocortin I and actin mRNA levels.

72
variety of alterations in heart rate have been described in
diabetic rats (Pfaffman, 1980). In addition, structural
changes in diabetic rat myocardium have been documented
(Thompson, 1988). In that study, alterations in all three
primary components of the heart, the cardiocytes, connective
tissue matrix, and microvasculature, were observed, most of
which were reversed after insulin treatment. Interestingly,
the effects of diabetes on the heart appeared to be focal,
with groups of normal and abnormal cardiocytes interspersed
throughout the muscle tissue.
A multitude of biochemical alterations have been
studied in diabetic hearts. The normal flux of metabolites
through glycolysis and the Krebs cycle is disrupted by the
large amounts of ketone bodies which accumulate and are the
main source of energy for heart respiration in diabetes
(Taegtmeyer and Passmore, 1985). A decreased ability of the
sarcoplasmic reticulum to take up calcium, depressed myosin
and actomyosin ATPase activities, and lowered Na+/K+ ATPase
were observed in diabetic rat hearts (Tahiliani and McNeill,
1986) . The /3-adrenergic receptor number in cardiac
membranes was lowered and their coupling to adenylate
cyclase altered in diabetic rat cardiac membranes (Atkins et
al., 1985).
Most interesting with regard to lipo I are the changes
in lipid metabolism documented in the diabetic heart. Fatty
acid compositions of phospholipids of the heart are altered,

73
including a decline in arachidonic acid levels (Faas and
Carter, 1980; Holman et al., 1983; Schrade et al., 1963).
Some metabolites of arachidonic acid, such as prostacyclin
and leukotrienes, are also affected (Johnson et al., 1984).
Since lipo I has been implicated as an inhibitor of
arachidonic acid metabolism through modulation of
phospholipase Ag (Hirata et al., 1980), it is possible that
the elevated levels of lipo I mRNA observed in the diabetic
rat heart may play a role in reduced arachidonic acid levels
and regulation of arachidonic acid-derived products.
Physical properties of cell membranes, including fluidity,
appear to be altered in the diabetic heart (Cheung et al.,
1980; Shinitzky, 1980). The phospholipid-binding activity
of lipo I, its localization to the inner surface of the
plasma membrane, and the implication of some of the annexins
in membrane-cytoskeletal linkage, offer the possibility that
elevated lipo I could be involved in membrane alterations
seen in the diabetic heart. Finally, elevated levels of
lipo I in the diabetic rat heart may play a role in reduced
phosphoinositol synthesis and release (Bergh et al., 1988).
If the function of lipo I is similar to that of lipo III, a
hydrolase which metabolizes cyclic phosphoinositol
intermediates (Ross et al., 1990), a connection between
elevated lipo I expression and altered phosphoinositol
turnover in the diabetic heart is possible.

74
The two most notable alterations in the diabetic kidney
are an increase in glomerular filtration rate and a marked
hypertrophy (Cortes et al., 1987; Seyer-Hanson, 1983). A
long list of biochemical changes have been observed in the
diabetic kidney, including both increases and decreases in
enzymes involved in glycoprotein metabolism, increased
thickness of glomerular basement membrane, decreased
guanylate cyclase activity, increased gluconeogensis,
increased glycogen content, increase in RNA synthesis, and
changes in pentose phosphate metabolites (Cortes et al.,
1983; Steer et al., 1985). Most of these alterations were
corrected after insulin treatment. As was noted in the
heart, a deficiency in arachidonic acid was also observed in
the diabetic kidney (Faas and Carter, 1980; Holman et al.,
1983). In addition, the glomerular inositol content and the
turnover of polyphosphoinositides was reduced by almost 60%
in streptozotocin-diabetic rats (Craven and DeRubertis,
1989), similar to what was observed in the diabetic heart.
It is intriguing to think that the observed induction in
heart and kidney lipo I mRNA I observed might be involved in
these changes in arachidonic acid or phosphoinositol
metabolism in the diabetic.
Diabetes has profound effects on the biochemical,
morphological, and contractile properties of skeletal muscle
as well as that of cardiac muscle. Amino acid transport is
reduced (Manchester, 1970), Na+-K+-ATPase activity is

75
depressed (Moore et al., 1983), and increased proteolysis
and a reduction of protein synthesis lead to loss of muscle
strength and mass (Smith et al., 1989). Insulin treatment
was found to reverse the increased proteolysis observed in
streptozotocin-diabetic rat skeletal muscle. To the best of
my knowledge, arachidonic acid and phosphoinositol levels
have not been studied in diabetic skeletal muscle. If
levels of these were found to decrease compared to control
animals, as is the case in heart and kidney, a role for lipo
I in their down-regulation would be strengthened.
In contrast to what was observed in the heart and
kidney, lipo I mRNA was not increased in the hindleg muscle
of STZ-injected animals removed from insulin treatment
relative to those which were on insulin (Fig. 4-3). In
light of the observation that hindleg muscle lipo I mRNA was
increased after STZ-injection (Fig. 4-1 and 4-2) relative to
normal animals, several possibilities exist. One is that
the increase in lipo I mRNA in hindleg muscle after STZ-
injection was a direct, transient effect of STZ on that
muscle, rather that a consequence of diabetes. Or, perhaps
the increase in hindleg muscle lipo I mRNA only occurs
transiently during the first few days of acute diabetes, and
cannot recur during a second incidence of severe diabetes
following insulin treatment.
Having established that lipo I mRNA levels increase in
the diabetic heart, kidney, and skeletal muscle, I next

76
investigated several hormones which might mediate this
effect. Of the hormones tested, only glucagon, a hormone
which is highly elevated during diabetes (Unger et al.,
1963), consistently altered lipo I mRNA expression. Known
target tissues for glucagon action include the liver,
adipose tissue, heart, kidney, intestine, and skeletal
muscle (Lefebvre and Luyckx, 1979) . The effect I observed,
an induction of three- to five-fold , was observed in the
heart, but not in the kidney or skeletal muscle, starting 4
hr after injection. No changes were observed in kidney or
skeletal muscle up to 24 hr after glucagon administration
(Fig. 4-4).
These results suggest that elevated glucagon levels may
mediate a relatively rapid induction of lipo I mRNA in the
diabetic heart, while induction in the diabetic kidney and
skeletal muscle may require longer exposure to high glucagon
levels, or not involve glucagon. In support of a more long
term effect of glucagon in the kidney, glucagon infusion for
seven days promoted renal growth in the rat, a phenomenon
known to occur during diabetes (Logan and Lee, 1988).
The positive chronotropic and inotropic actions of
glucagon on the heart (increase in heart rate and
contractility) have been well documented in many species,
including dog, rat, and guinea pig (Farah and Tuttle, 1960).
Alterations in intracellular calcium levels by glucagon are
important in these effects on the rat heart (Chernow et al.,

77
1987), but the role of cAMP is unclear (Busuttil et al.,
1976; LaRaia et al., 1968; Rodgers et al., 1981). In the
adult mouse heart, evidence was shown that cAMP was not
altered during the chronotropic and inotropic actions of
glucagon (Clark et al., 1976).
The induction of lipo I mRNA in the rat heart by
glucagon may not involve changes in cAMP levels. Increased
lipo I mRNA levels were not observed in either rats or mice
after injection of epinephrine, a hormone which elicits
heart effects similar to those of glucagon and acts via cAMP
(Regan et al., 1964), or after injection of dibutyral cAMP
(Fig. 5 and 6). I believe that induced levels of lipo I
mRNA in the heart may be due to glucagon-mediated, cAMP-
independent changes in calcium levels (Petersen and Bear,
1986; Wakelam et al., 1986).
In summary, lipo I mRNA levels are induced in the
heart, kidney, and hindleg muscle of streptozotocin-diabetic
rats. Glucagon injection leads to increased lipo I mRNA
levels in the heart, but not in the kidney or hindleg
muscle, as early as 4 hr following administration. These
results suggest that glucagon may play a primary role in
heart lipo I mRNA induction during diabetes, and that
induction in the diabetic kidney and skeletal muscle
involves factors other than, or is independent of, glucagon.
Induction of lipo I mRNA during diabetes may involve
alterations in arachidonic acid or phosphoinositol

78
metabolism (Bergh et al., 1988; Craven and DeRubertis, 1989
Faas and Carter, 1980; Gubjarnason et al., 1987; Holman et
al., 1983; Johnson et al., 1984; Pieper, 1990; Schrade et
al., 1963; Winegrad, 1987). Perhaps these changes occur
rapidly in the heart in response to elevated glucagon, and
more gradually in kidney and skeletal muscle as the disease
progresses and tissue function deteriorates.

CHAPTER 5
CONCLUSIONS AND FURTHER DIRECTIONS
Studies in this dissertation provide the basis for
future experiments to investigate the mechanisms governing
regulation of the lipo I gene. In Chapter 2, the mouse lipo
I gene structure was determined. An interesting finding was
that three of the four 17-amino acid consensus sequences
believed to be important in lipo I phospholipid/calcium
binding activity were encoded by the last codon of one exon
and the following 16 codons of the next exon. This is
highly suggestive of an exon duplication event early in the
evolution of lipo I. There is a striking similarity in the
gene structures of lipo I and lipo II (Amiguet et al.,
1990), indicating that these two annexins are derived from a
common ancestor. It will be very interesting to compare the
gene structures of lipo I and II with those of the other
annexins, including the 67 kDa species, when these are
determined. Such analysis may provide insight regarding the
relationship between the annexins and their evolution.
The lipo I promoter region was shown to contain several
potential regulatory sites which matched or resembled known
consensus sequences. There is indirect evidence that some
of these sites may be functional. Lipocortin I expression
79

80
in the mouse mammary epithelial cell line HC11 is effected
by serum (K. Horlick, unpublished results), and two
potential serum response elements were identified in the
lipo I promoter. The sites identified which are most likely
to be involved in lipo I regulation are the putative
glucocorticoid response elements, particularly the delayed
glucocorticoid response element. Lipo I mRNA has been shown
to be induced by dexamethasone in macrophages (Wallner et
al., 1986) and fibroblasts (Phillips et al., 1989; Wong et
al., submitted), although this does not occur in all cell
types examined (Bienkowski et al., 1989; Bronnegard et al.,
1988; Hullin et al., 1989; Isacke et al., 1989; Northup et
al., 1988; William et al., 1988). Studies outlined later in
this chapter are designed to determine whether the sites
identifed in the lipo I promoter are indeed involved in lipo
I mRNA regulation, and to possibly identify others.
Chapters 3 and 4 involve tissue-specific regulation of
lipo I mRNA in two very different rat systems: The
differentiating mammary gland, and streptozotocin-induced
diabetes. Studies in Chapter 3 demonstrate that lipo I
exhibits a striking regulation as the mammary gland
undergoes normal differentiation and involution, and that
the suckling stimulus plays a role in this regulation.
While there are several different cell types in mammary
tissue, it is likely that epithelial cells are the dominant
factor in the lipo I regulation I observed.

81
Immunolocalization studies using mammary tissue sections
from various stages of development, similar to those carried
out for lipocortin II and calelectrin in the mouse mammary
gland (Lozano et al., 1989a), could confirm this hypothesis.
The fact that large changes in lipo I expression coincide
with periods when epithelial cells change growth and
differentiative status suggests the two may be related. In
light of this, I have proposed that high levels of lipo I
may be associated with the dormant epithelial cells of the
mature virgin and involuted glands. A hormone or growth
factor-mediated event during pregnancy, which leads to
decreased levels of lipo I, may be necessary for dormant
epithelial cells to proliferate and differentiate into
secretory cells.
One of the most interesting findings in these studies
is that some type of translational control of lipo I
apparently occurs in mammary tissue. After premature pup
withdrawal, lipo I mRNA increased rapidly and reached peak
levels around 12-24 hr following removal. In contrast,
little or no protein was detected until some time after 24
hr following pup withdrawal, and peak levels were observed
by five days following withdrawal. This indicates that
although a large pool of lipo I mRNA accumulates soon after
cessation of suckling, translation is significantly delayed.
I believe that a rapid signal sent to the mammary gland
after pup withdrawal, mediated by the sympathetic nervous

82
system, triggers a rapid increase in lipo I mRNA expression
in secretory epithelial cells destined to revert to the
resting state during involution. In situ hybridization to
localize lipo I mRNA could confirm this theory. The delay
in translation of lipo I mRNA may reflect the time necessary
for the gland, and epithelial cells in particular, to commit
to involution. Lipocortin I mRNA may accumulate in certain
epithelial cells immediately after cessation of suckling in
preparation for reversion to the resting state, but
translation could be delayed for several days in case
suckling must resume. At a time believed to be about five
days following pup removal (Silver, 1956), lactation is no
longer possible and epithelial cells are committed to death
or reversion to dormancy (Hollmann, 1974). The expression
pattern of mammary lipo I during both natural development
and after premature cessation of suckling is consistant with
an important role for lipo I in the resting epithelial
cells. While this role cannot be currently determined, I
have suggested lipo I may possibly be necessary to prevent
phosphoinositol turnover in these cells, keeping them from
proliferating until the appropriate time during pregnancy.
The in vivo mammary gland studies, particularly those
involving removal of the suckling stimulus, indicate that
lipo I mRNA is subject to regulation at the levels of both
mRNA expression and translation. The former type of
regulation could be either due to transcriptional control,

83
xoRNA stability changes, or a combination of both. Due to
the complexity of the mammary gland and its multiple cell
types, an in vitro system will likely be necessary to
further explore mammary lipo I regulation. While indirect
evidence suggests a mammary epithelial cell line would be
the best to investigate, immunolocalization and in situ
hybridization studies would be useful in confirming this. I
have carried out preliminary studies on lipo I mRNA
expression in the mouse mammary epithelial line HC11, which
has been shown to be responsive to both prolactin and
dexamethasone (Ball et al., 1988; Doppler et al., 1989).
These cells, derived from midpregnant mouse mammary tissue,
express high levels of lipo I mRNA (data not shown).
Therefore, it could be a useful system in determining
factors that down-regulate lipo I during pregnancy.
Accordingly, I investigated the effects of several hormones
on expression of lipo I mRNA in HC11 cells. Neither
prolactin, estrogen, progesterone, epidermal growth factor,
nor insulin had an effect (data not shown), but two
noteworthy observations were made. Dexamethasone caused a
reproducible increase in lipo I mRNA levels, and serum had
an inhibitory influence on mRNA expression. More thorough
studies using HC11, or another of the available mammary
epithelial cell lines, may be useful in further defining the
hormonal signals which regulate lipo I in the mammary gland.
Experiments utilizing mammary explants in culture may also

84
prove useful (Matusik and Rosen, 1978), but would still have
the problem of multiple cell types.
In Chapter 4, it was shown that lipo I mRNA expression
was increased in certain tissues of three-day
streptozotocin-diabetic rats, and that glucagon may play a
role in lipo I mRNA induction in the diabetic heart.
Diabetes is a complex disease resulting in many hormonal
alterations, so again an in vitro system will be required to
further study the mechanism of lipo I regulation. An
important question to address is what particular hormones,
or aspects of altered cellular metabolism, are factors in
regulating lipo I expression.
Experiments should focus on cell lines derived from the
heart, kidney, and skeletal muscle, because these tissues
showed altered lipo I expression in diabetic animals. Heart
cells would be most interesting due to the ability of
glucagon to alter lipo I mRNA levels in the heart. As
mentioned regarding the mammary gland studies, in situ
hybridization would be helpful in indicating which
particular cell types in tissues express lipo I mRNA, and
therefore which cell lines might be the best candidates for
study.
I carried out preliminary studies to attempt to
identify a glucagon- or dexamethasone-responsive cell line
of kidney or muscle origin. Lipocortin I mRNA levels were
not affected by these hormones in rat mesangial cells, which

85
are smooth muscle-like cells from the kidney, or in the G8
mouse skeletal muscle line. Chick heart atrial cells were
also examined, but insufficient cross-hybridization with our
mouse cDNA probe was a problem. If heart myocytes were
shown by in situ hybridization to express lipo I mRNA,
further investigation of these cells might prove worthwhile.
It is possible to isolate and maintain beating heart
myocytes from adult mice or rats in culture (Jacobson and
Piper, 1986), so potential hormonal effects on lipo I
expression in these cells can be evaluated.
Providing that future studies based on the information
in Chapters 3 and 4 will define a cell line which exhibits
lipo I mRNA regulation in response to a hormonal stimulus or
change in growth status, experiments to probe the mechanism
of this regulation can be undertaken. Multiple cell types
would make such studies in whole tissues unlikely to succeed
and difficult to interpret. Initially, the mechansim by
which a change in mRNA levels occurs would be investigated.
As stated before, this could result from transcriptional
alterations, or changes in mRNA stability or some other
post-transcriptional means. Experiments incorporating the
transcriptional inhibitor actinomycin D, and the protein
synthesis inhibitor cycloheximide, would help answer such
questions. The nuclear run-on assay, which measures the
amount of nascent transcripts in isolated nuclei, could be
used to investigate transcriptional changes (McKnight and
Palmiter, 1979).

86
After obtaining some idea of the type(s) of mechanisms
involved in regulation of lipo I gene expression, particular
sites in the gene and its promoter mediating this regulation
can be investigated. Two types of experiments, deletion
analysis and chromatin structure analysis, may be undertaken
to identify potential regulatory regions. The first
involves transfection of promoter deletion mutants into cell
lines and assaying for transcription levels of a reporter
gene. This can be done either by selecting for stable
transfectants (Buetti and Diggelmann, 1983) or through
analysis of the entire population of transfected cells,
refered to as transient expression (Dean et al., 1983).
Chromatin structure analysis is based on the observation
that pancreatic deoxyribonuclease, or DNase I,
preferentially digests genes that are or have been
transcriptionally active (Weintraub and Groudine, 1976).
Most of the cleavage sites for DNase I, referred to as DNase
I hypersensitive sites, have been localized to the 5'
flanking region of genes (Elgin, 1981). In many cases,
DNase I hypersensitive sites were shown to occur close to
important regulatory elements, such as enhancers (Zaret and
Yamamoto, 1984). A combination of deletion and chromatin
structure analysis should be useful in providing a low
resolution view of important regulatory regions within the
lipo I gene.

87
If DNase I hypersensitive sites are found using
conventional methods, they may be more precisely located by
a recently developed, high resolution technique. This
involves electrophoresing genomic DNA on native
polyacrylamide gels prior to electroblotting and
hybridization, and has been utilized to map DNAse I
hypersensitive sites in the human histone H4 gene (Pauli et
al., 1988).
Information provided by the above techniques may allow
studies of lipo I gene regulation in vivo at nucleotide
resolution. Intact cells are treated with a chemical probe
for DNA structure, dimethylsulfate, and DNA-protein
interactions are visualized on DNA sequencing gels as G-
residues with altered reactivity to DMS (Church and Gilbert,
1984). This in vivo analysis has the advantage of avoiding
artifacts which might be obtained in in vitro studies such
as gel retardation assays (Fried and Crothers, 1981), but is
limited to revealing interactions at only G-residues.
In conclusion, studies described here make an important
contribution to the annexin field in several ways. The
results in Chapter 2 concerning lipo I, along with what is
known about the lipocortin II gene, strongly suggest a
common ancestor for these proteins and will be important in
elucidating the evolution of the annexins when the remaining
genes are characterized. In addition, sequence information
from the promoter now enables regulatory studies to be

88
designed. Experiments shown in Chapter 3 represent the most
dramatic examples of lipo I mRNA and protein regulation
currently known, and will hopefully lead to a tissue culture
system in which this regulation can be further defined and
investigated. Also, the potential link between lipo I and
mammary cell growth status deserves further investigation,
and may indicate that lipo I, like lipo III, is involved in
an important biochemical pathway such as inositol
metabolism. Finally, studies in Chapter 4 show for the
first time a link between glucagon and induced expression of
an annexin, and offer the possibility that lipo I is
involved in the altered lipid metabolism known to occur
during diabetes.

REFERENCES
Aarsman, A. J., Mynbeek, G. , Van Den Bosch, H., Rothhut, B.,
Prieur, B., Comerá, C., Jordan, L., and Russo-Marie, F.
(1987). Lipocortin inhibition of extracellular and
intracellular phospholipases A2 is substrate
concentration dependent. FEBS Lett. 219: 176-180.
Addison, W. R., and Kurtz, D. T. (1986). Nucleotide
sequences required for the regulation of a rat a2u-
globulin gene by glucocorticoids. Mol. Cell. Biol. 6:
2334-2346.
Amiguet, P., D'Eustachio, P., Kristensen, T., Wetsel, R. A.,
Saris, C. J. M., Hunter, T., Chaplin, D. D., and Tack,
B. F. (1990). Structure and chromosome assignment of
the murine p36 (calpactin I heavy chain) gene.
Biochemistry 29: 1226-1232.
Ando, Y., Imamura, S., Hong, Y. -M., Owada, M. K., Kakunaga,
T., and Kannagi, R. (1989). Enhancement of calcium
sensitivity of lipocortin I in phospholipid binding
induced by limited proteolysis and phosphorylation at
the amino terminus as analyzed by phospholipid affinity
column chromatography. J. Biol. Chem. 264: 6948-6955.
Atkins, F. L. , Dowell, R. T. , and Love, S. (1985). /?-
adrenergic receptors, adenylate cyclase activity, and
cardiac dysfunction in the diabetic rat. J. Cardiovasc.
Pharmacol. 7: 66-70.
Ball, R. K., Friis, R. R., Schoenenberger, C. A., Doppoler,
W., and Groner, B. (1988). Prolactin regulation of /3-
casein gene expression and of a cytosolic 120-kd
protein in a cloned mouse mammary epithelial cell line.
EMBO J. 7: 2089-2095.
Bergh, C.-H., Hjalmarson, A., Sjogren, K.-G., and Jacobsson,
B. (1988). The effect of diabetes on
phosphatidylinositol turnover and calcium influx in
myocardium. Horm. Metabol. Res. 20: 381-386.
Bhimji, S., Godin, D. V., and McNeill, J. H. (1985).
Biochemical and functional changes in hearts from
rabbits with diabetes. Diabetoloqia 28: 452-457.
89

90
Bielefeld, D. R., Pace, C. S., and Boshell, B. R. (1983).
Altered sensitivity of chronic diabetic rat heart to
calcium. Am. J. Physiol. 245: E560-E567.
Bielschowski, M., and Bielschowski, F. (1956). The New
Zealand strain of obese mice. Australian J. Exp. Biol.
Med. 34: 181-198.
Bienkowski, M.J., Petro, M.A., and Robinson, L.J. (1989).
Inhibition of thromboxane A synthesis in U937 cells by
glucocorticoids. J. Biol. Chem. 264: 6536-6544.
Blackwell, G.J., Carnuccio, R., Di Rosa, M., Flower, R.J.,
Párente, L., and Pérsico, P. (1980). Macrocortin: a
polypeptide causing the anti-phospholipase effect of
glucocorticoids. Nature 287: 147-149.
Blake, C. (1983). Exons-present from the beginning? Nature
306: 535-537.
Borellini, F., and Oka, T. (1989). Growth control and
differentiation in mammary epithelial cells. Env.
Health Perspec. 80: 85-99.
Braslau, D. L., Ringo, D. L., and Rocha, V. (1984).
Synthesis of novel calcium-dependent proteins
associated with mammary epithelial cell migration and
differentiation. Exp. Cell Res. 155: 213-221.
Breathnach, R., and Chambón, P. (1981). Organization and
expression of eucaryotic split genes coding for
proteins. Annu. Rev. Biochem. 50: 349-383.
Bronnegard, M., Andersson, O., Edwall, D., Lund, J.,
Norstedt, G. , and Caristedt-Duke, J. (1988). Human
calpactin II (lipocortin I) messenger ribonucleic acid
is not induced by glucocorticoids. Mol. Endocrinol. 2:
732-739.
Buetti, E., and Diggelmann, H. (1983). Glucocorticoid
regulation of mouse mammary tumor virus: identification
of a short essential DNA region. EMBO J. 2: 1423-1429.
Burgonyne, R. D. (1988). Calpactin in exocytosis? Nature
331: 20.
Busuttil, R. W., Paddock, R. J., Fisher, J. W., and George,
W. J. (1976). Changes in cyclic nucleotide levels and
contractile force in the isolated hypoxic rat heart
during perfusion with glucagon. Circ. Res. 38: 162-
167.

91
Chase, H. P., Williams, R. L., and Dupont, J. (1979).
Increased prostaglandin synthesis in childhood diabetes
mellitus. J. Pediatr. 94: 185-189.
Chen, C.-L. C., and Feigelson. P. (1980). Hormonal control
of a2u globulin synthesis and its mRNA in isolated
hepatocytes. Ann. NY Acad Sci. 349: 28-45.
Chernow, B., Zaloga, G. P., Malcolm, D., Willey, S. C.,
Clapper, M., and Holaday, J. W. (1987). Glucagon's
chronotropic action is calcium dependent. J. Pharmacol.
Exp. Ther. 241: 833-837.
Cheung, H. C., Almira, E. C., Kansal, P. C., and Reddy, W.
J. (1980). A membrane abnormality in lymphocytes from
diabetic subjects. Endocr. Res. Commun. 7: 145-156.
Chomczynski, P., and Sacchi, N. (1987). Single-step method
of RNA isolation by acid guanidinium thiocyanate-
phenol-chloroform extraction. Anal. Biochem. 162: 156-
159.
Christlieb, A. R. (1973). Diabetes and hypertensive vascular
disease: mechanisms and treatment. Am. J. Cardiol. 28:
27-41.
Chuah, S. Y. and Pallen, C. J. (1989). Calcium-dependent and
phosphorylation-stimulated proteolysis of lipocortin I
by an endogenous A431 cell membrane protease. J. Biol.
Chem. 264: 21160-21166.
Church, G.M., and Gilbert, W. (1984). Genomic sequencing.
Proc. Natl. Acad. Sci. USA 81: 1991-1995.
Clark, C. M., JR., Waller, D., Kohalmi, D., Gardner, R.,
Clark, J., Levey, G. S., Wildenthal, K., and Allen, D.
(1976). Evidence that cyclic AMP is not involved in the
chronotropic action of glucagon in the adult mouse
heart. Endocrin. 99: 23-29.
Cooper, J. A., and Hunter, T. (1983). Identification and
characterization of cellular targets for tyrosine
protein kinases. J. Biol. Chem. 258: 1108-1115.
Corden, J., Wasylyk, B., Buchwalder, A., Sassone-Corsi, P.,
Kedinger, C., and Chambón, P. (1980). Promoter
sequences of eukaryotic protein-coding genes. Science
209: 1405-1414.

92
Cortes, P., Dulmer, F., Goldman, J., and Levin, N. W.
(1987). Relationship between renal function and
metabolic alterations in early streptozotocin-induced
diabetes in rats. Diabetes 36: 80-87.
Cortes, P., Dulmer, F., Venkatachalam, K., and Levin, N. W.
(1983). Effects of diabetes mellitus on renal
metabolism. Mineral Electrolyte Metab. 9: 306-316.
Craven, P. A., and DeRubertis, F. R. (1989). Protein kinase
C is activated in glomeruli from streptozotocin
diabetic rats. J. Clin. Invest. 83: 1667-1675.
Creutz, C. E., Zakas, W. J., Hamman, H. C., Crane, S.,
Martin, W. H., Gould, K. L., Oddie, K. M., and Parsons,
S. J. (1987). Identification of chromaffin granule¬
binding proteins. J. Biol. Chem. 262: 1860-1868.
Crompton, M. R., Moss, S. E., and Crumpton, M. J. (1988).
Diversity in the calpactin/lipocortin family. Cell 55:
1-3.
Crumpton, M. J., and Dedman, J. R. (1990). Protein
terminology tangle. Nature 345: 12.
Davidson, F. F., Dennis, E. A., Powell, M., and Glenney, J.
(1987). Inhibition of phospholipase A2 by "lipocortins"
and calpactins: an effect of binding to substrate
phospholipids. J. Biol. Chem. 262: 1698-1705.
De, B. K., Misono, K. S., Lukas, T. J., Mroczkowski, B., and
Cohen, S. (1986). A calcium-dependent 35-kilodalton
substrate for epidermal growth factor receptor/kinase
isolated from normal tissue. J. Biol. Chem. 261: 13784-
13792.
Dean, D. C., Knoll, B. J., Riser, M. E., and O'Malley, B. W.
(1983). A 5'-flanking sequence essential for
progesterone regulation of an ovalbumin fusion gene.
Nature 305: 551-554.
Doppoler, W., Groner, B., and Ball, R. K. (1989). Prolactin
and glucocorticoid hormones synergistically induce
expression of transfected rat /3-casein gene promoter
constructs in a mammary epithelial cell line. Proc.
Natl. Acad. Sci. USA 86: 104-108.
Drust, D., and Creutz, C. (1988). Aggregation of chromaffin
granules by calpactin at micromolar levels of calcium.
Nature 331: 88-91.

93
Dunn, J. S., Sheehan, H. L., and McLetchie, N. G. B. (1943).
Necrosis of islets of langerhans produced
experimentally. Lancet 1: 484-487.
Edery, M., Pang, K., Larson, L., Colosi, T., and Nandi, S.
(1985). Epidermal growth factor receptor levels in
mouse mammary glands in various physiological states.
Endocrin. 117: 405-411.
Elgin, S. C. R. (1981). DNase I-hypersensitive sites of
chromatin. Cell 27: 413-415.
Faas, F. H., and Carter, W. J. (1980). Altered fatty acid
desaturation and microsomal fatty acid composition in
the streptozotocin diabetic rat. Lipids 15: 953-961.
Farah, A., and Tuttle, R. (1960). Studies on the
pharmacology of glucagon. J. Pharmacol. Exp. Ther. 129:
49-55.
Fava, R., McKanna, J., and Cohen, S. (1989). Lipocortin I
(p35) is abundant in a restricted number of
differentiated cell types in adult organs. J. Cell.
Phvsiol. 141: 284-293.
Fein, F. S., Kornstein, L. B., Strobeck, J. E., Capasso, J.
M., and Sonnenblick, E. H. (1980). Altered myocardial
mechanics in diabetic rats. Circ. Res. 47: 922-933.
Fein, F. S., Miller-Green, B., and Sonnenblick, E. H.
(1985). Altered myocardial mechanics in diabetic
rabbits. Am. J. Phvsiol. 248: H729-H736.
Feinberg, A.P. and Vogelstein, B. (1983). A technique for
radiolabeling DNA restriction endonuclease fragments to
high specific activity. Anal. Biochem. 132: 6-13.
Flower, R. J. (1988). Lipocortin and the mechanism of action
of the glucocorticoids. Br. J. Pharmacol. 94: 987-
1015.
Flower, R.J., and Blackwell, G.J. (1979). Anti-inflammatory
steroids induce biosynthesis of a phospholipase A2
inhibitor which prevents prostaglandin generation.
Nature 278: 456-459.
Fried, M., and Crothers, D. M. (1981). Equilibria and
kinetics of lac repressor-operator interactions by
polyacrylamide gel electrophoresis. Nucl. Acids Res. 9:
6505-6525.

94
Funakoshi, T., Hendrickson, L. E., McMullen, B. A., and
Fujikawa, K. (1987). Primary structure of human
placental anticoagulant protein. Biochemistry 26: 8087-
8092.
Ganguli, P. K., Pierce, G. N., Dhalla, K. S., and Dhalla, N.
S. (1983). Defective sarcoplasmic reticular calcium
transport in diabetic cardiomyopathy. Am. J. Physiol.
244: E528-E535.
Geisow, M. J., Fritsche, U., Hexham, J. M., Dash, B., and
Johnson, T. (1986). A consensus amino-acid sequence
repeat in torpedo and mammalian Ca2+-dependent
membrane-binding proteins. Nature 320: 636-638.
Geisow, M. J., and Walker, J. H. (1986). New proteins
involved in cell regulation by Ca2+ and phospholipids.
Trends Biochem. Sci. 11: 420-423.
Gilbert, W. (1978). Why genes in pieces? Nature 271: 501.
Giugni, T. D., James, L. C., and Haigler, H. T. (1985).
Epidermal growth factor stimulates tyrosine
phosphorylation of specific proteins in permeabilized
human fibroblasts. J. Biol. Chem. 260: 15081-15090.
Glenney, J. R., Jr. (1986). Two related but distinct forms
of the Mr 36,000 tyrosine kinase substrate (calpactin)
that interacts with phospholipids and actin in a Caz+-
dependent manner. Proc. Natl. Acad. Sci. USA 83: 4258-
4262.
Glenney, J. R., Jr., and Tack, B.F. (1985). Amino-terminal
sequence of p36 and associated plO: identification of
the site of tyrosine phosphorylation and homology with
S-100. Proc. Natl. Acad. Sci. USA 82: 7884-7888.
Glenney, J. R., Jr., Tack, B., and Powell, M. A. (1987). Two
distinct Ca++-regulated phospholipid- and actin-binding
proteins isolated from lung and placenta. J. Cell.
Biol. 104: 503-511.
Gonzalez, G. A., Yamamoto, K. K., Fischer, W. H., Karr, D.,
Menzel, P., Biggs, W. Ill, Vale, W. W., and Montminy,
M. R. (1989). A cluster of phosphorylation sites on the
cyclic AMP-regulated nuclear factor CREB predicted by
its sequence. Nature 337: 749-752.
Gudbjarnason, S., El-Hage, A., Whitehurst, V. E., Simental,
F., and Balazs, T. (1987). Reduced arachidonic acid
levels in major phospholipids of heart muscle in the
diabetic rat. J. Mol. Cell. Cardiol. 19: 1141-1146.

95
Haider, B., Yeh, C. K. , Thomas, G., Oldewurtal, H. S.,
Lyons, M. M., and Regan, T. J. (1981). Influence of
diabetes on the myocardium and coronary arteries of
rhesus monkeys fed an atherogenic diet. Circ. Res. 49:
1278-1288.
Haigler, H. T., Fitch, J. M., and Schlaepfer, D. D. (1989).
Two lipocortin-like proteins, endonexin II and anchorin
CII, may be alternate splices of the same gene. Trends
Biochem. Sci. 14: 48-51.
Haigler, H. T., Schlaepfer, D. D., and Burgess, W. H.
(1987). Characterization of lipocortin I and an
immunologically unrelated 33-kDa protein as epidermal
growth factor receptor/kinase substrates and
phospholipase A2 inhibitors. J. Biol. Chem. 262: 6921-
6930.
Hayashi, H., Owada, M. K., Sonobe, S., Domae, K.,
Yamanouchi, T., Kakunaga, T., Kitajima, Y., and Yaoita,
H. (1990). Monoclonal antibodies specific to a Ca¿+-
bound form of lipocortin I distinguish its Caz+-
dependent phospholipid-binding ability from its ability
to inhibit phospholipase A2. Biochem. J. 269: 709-715.
Hess, P., Meenakshi, T., Chan, G. C. -K., Carlstedt-Duke,
J., Gustafsson, J. -A., and Payvar, F. (1990). Purified
glucocorticoid receptors bind selectively in vitro to a
cloned DNA fragment that mediates a delayed secondary
response to glucocorticoids in vivo. Proc. Natl. Acad.
Sci. USA 87: 2564-2568.
Hirata, F. (1981). The regulation of lipomodulin, a
phospholipase inhibitory protein, in rabbit neutrophils
by phosphorylation. J. Biol. Chem. 256: 7730-7733.
Hirata, F., and Iwata, M. (1983). Role of lipomodulin, a
phospholipase inhibitory protein, in immunoregulation
by thymocytes. J. Immunol. 130: 1930-1936.
Hirata, F., Matsuda, K., Notsu, Y., Hattori, T., and Del
Carmine, R. (1984). Phosphorylation at a tyrosine
residue of lipomodulin in mitogen-stimulated murine
thymocytes. Proc, Natl. Acad. Sci. USA 81: 4717-4721.
Hirata, F., Schiffman, D., Venkatasubramanian, K., Salmon,
D. and Axelrod, J. (1980). A phospholipase A2
inhibitory protein in rabbit neutrophils induced by
glucocorticoids. Proc. Natl. Acad. Sci. USA 77: 2533-
2536.

96
Hokin, L. E. (1985). Receptors and phosphoinositide-
generated second messengers. Ann. Rev. Biochem. 54:
205-235.
Hollmann, K. H. (1974). Cytology and fine structure of the
mammary gland. In B. L. Larson and V. R. Smith (eds.),
Lactation—A Comprehensive Treatise. Vol. I, pp. 3-95.
Academic Press, New York.
Holman, R. T., Johnson, S. B., Gerrard, J. M., Mauer, M.,
Kupcho-Andberg, S., and Brown, D. M. (1983).
Arachidonic acid deficiency in streptozotocin-induced
diabetes. Proc. Natl. Acad. Sci. USA 80: 2375-2379.
Horn, Y. K., Sudhof, T. C., Lozano, J. L., Haindl, A. H., and
Rocha, V. (1988). Mammary gland Ca2 -binding
(-dependent) proteins: identification as calelectrins
and calpactin I/p36. J. Cell. Physiol. 135: 435-442.
Horlick, K., Cheng, I., Wong, W., Wakeland, E., and Nick, H.
(1990). Mouse Lipocortin I Gene Structure and
Chromosomal Assignment: Gene Duplication and the
Origins of a Gene Family, (submitted)
Horseman, N. D. (1989). A prolactin-inducible gene product
which is a member of the calpactin/lipocortin family.
Mol. Endocrinol. 3: 773-779.
Hsu, L. C., Chang, W. -C., and Yoshida, A. (1989). Genomic
structure of the human cytosolic aldehyde dehydrogenase
gene. Genomics 5: 857-865.
Huang, K. -S., Wallner, B. P., Mattaliano, R. J., Tizard,
R., Burne, C., Frey, A., Hession, C., McGray, P.,
Sinclair, L. K., Chow, E. P., Browning, J. L.,
Ramachandran, K. L., Tang, J., Smart, J. E., and
Pepinsky, R. B. (1986). Two human 35 kd inhibitors of
phospholipase A2 are related to substrates of pp60v"src
and the epidermal growth factor receptor/kinase. Cell
46: 191-199.
Hullin, F., Raynal, P., Ragab-Thomas, J. M. F., Fauvel, J.,
and Chap, H. (1989). Effects of dexamethasone on
prostaglandin synthesis and on lipocortin status in
human endothelial cells. J. Biol. Chem. 264: 3506-
3513.
Isacke, C. M., Lindberg, R. A., and Hunter, T. (1989).
Synthesis of p35 and p36 is increased when U-937 cells
differentiate in culture but expression is not induced
by glucocorticoids. Mol. Cell Biol. 9: 232-240.

97
Jacobson, S. L., and Piper, H. M. (1986). Cell cultures of
adult cardiomyocytes as models of the myocardium. J.
Mol. Cell. Cardiol. 18: 661-678.
Johnson, G. L., El-Hage, A., Ehrreich, S. I., Gudbjarnason,
S., Whitehurst, W. and Balasz, T. (1984). Effects of
benoxaprofen (B), diethylcarbamazine (DEC), or
nordihydroguaiaretic acid (NDEA) on isoproteranol (I)-
induced ventricular fibrillation in rats (abstract).
Fed. Proc. 43: 742.
Junod, A., Lambert, A. E., Orci, L., Pictet, R., Gonet, A.
E., and Renold, A. E. (1967). Studies of the
diabetogenic action of streptozotocin. Proc. Soc. Exp.
Biol. Med. 126: 201-205.
Karasik, A., Pepinsky, R. B., Shoelson, S. E., and Kahn, C.
R. (1988). Lipocortins 1 and 2 as substrates for the
insulin receptor kinase in rat liver. J. Biol. Chem.
263: 11862-11867.
Keutzer, J. C., and Hirschhorn, R. R. (1990). The growth-
regulated gene 1B6 is identified as the heavy chain of
calpactin I. Exp. Cell Res. 188:153-159.
o . .
Klee, C. (1988) . Ca -dependent phospholipid- (and membrane)
binding proteins. Biochemistry 27: 6645-6653.
Klein, E. S., DiLorenzo, D., Posseckert, G., Beato, M., and
Ringold, G. M. (1988). Sequences downstream of the
glucocorticoid regulatory element mediate cycloheximide
inhibition of steroid induced expression from the rat
a^-acid glycoprotein promoter: evidence for a labile
transcription factor. Mol. Endocrinol. 2: 1343-1351.
Kreitman, M. E., and Aguade, M. (1986). Excess polymorphism
at the Adh locus in Drosophila Melanogaster. Genetics
114: 93-110.
LaRaia, P. J., Craig, R. J., and Reddy, W. J. (1968).
Glucagon-effect on adenosine 3'5' monophosphate in the
rat heart. Am. J. Physiol. 215: 968-970.
Lefebvre, P. J., and Luyckx, A. S. (1979). Glucagon. In C.
H. Gray and V. H. T. James (eds.), Hormones in Blood.
Vol. 1, pp. 171-223. Academic Press, New York.
Logan, J. L., and Lee, S. M. (1988). Effects of glucagon on
physiologic and compensatory renal growth in the rat.
Hormone Res. 29: 39-44.

98
Loh, E. Y., Elliott, J. F., Cwirla, S., Lanier, L. L. and
Davis, M. M. (1989) . Polymerase chain reaction with
single-sided specificity: analysis of T cell receptor
delta chain. Science 243: 217-220.
Lozano, J. L., Haindl, A. H., and Rocha, V. (1989a).
Purification, characterization, and localization of 70
kDa calcium-sensitive protein (calelectrin) from
mammary glands. J. Cell. Physiol. 141: 318-324.
Lozano, J. J., Silberstein, G. B., Hwang, S. -I., Haindl, A.
H., and Rocha, V. (1989b). Developmental regulation of
calcium-binding proteins (calelectrins and calpactin I)
in mammary glands. J. Cell. Physiol. 138: 503-510.
Manchester, K. L. (1970). The control by insulin of amino
acid accumulation in muscle. Biochem. J. 117: 457-465.
Matusik, R. J., and Rosen, J. M. (1978). Prolactin induction
of casien mRNA in organ culture. J. Biol. Chem. 253:
2343-2347.
McKnight, G. S., and Palmiter, R. D. (1979). Transcriptional
regulation of the ovalbumin and conalbumin genes by
steroid hormones in chick oviduct. J. Biol. Chem. 254:
9050-9058.
Messing, J. (1983). New M13 vectors for cloning. Methods.
Enzvmol. 101: 20-78.
Mitchell, P. J., and Tjian, R. (1989). Transcriptional
regulation in mammalian cells by sequence-specific DNA
binding proteins. Science 245: 371-378.
Mitsunoba, F., Fukui, M., Oda, T., Yamamoto, T., and
Toyoshima, K. (1989). A mechanism of c-raf-1
activation: fusion of the lipocortin II amino-terminal
sequence with the c-raf-1 kinase domain. Oncogene 4:
437-442.
Moore, R. D., Munford, J. W., and Pillsworth, T. J. (1983).
Effects of streptozotocin diabetes and fasting on
intracellular sodium and adenosine triphosphate in rat
soleus muscle. J. Physiol. (London) 338: 277-294.
Norman, C., Runswick, M., Pollock, R., and Treisman, R.
(1988). Isolation and properties of cDNA clones
encoding SRF, a transcription factor that binds to the
c-fos serum response element. Cell 55: 989-998.

99
Northup, J. K., Valentine-Braun, K. A., Johnson, L. K.,
Severson, D. L., and Hollenberg, M. D. (1988).
Evaluation of the anti-inflammatory and phospholipase-
inhibitory activity of calpactin II/lipocortin I. J.
Clin. Invest. 82: 1347-1352.
Okumura, K., Akiyama, N., Hashimoto, H., Ogawa, K., and
Satake, T. (1988). Alteration of 1,2-diacylglycerol
content in myocardium from diabetic rats. Diabetes 37:
1168-1172.
Padgett, R. A., Grabowski, P. J., Konarska, M. M., Seiler,
S., and Sharp, P. A. (1986). Splicing of messenger RNA
precursors. Annu. Rev. Biochem. 55: 1119-1150.
Paek, I., and Axel, R. (1987). Glucocorticoids enhance
stability of human growth hormone mRNA. Mol. Cell.
Biol. 7: 1496-1507.
Parsons, W. J., Ramkumar, V., and Stiles, G. L. (1988).
Isobutylmethylxanthine stimulates adenylate cyclase by
blocking the inhibitory regulatory protein, Gj_. Mol.
Pharmacol. 34: 37-41.
Pauli, U., Chrysogelos, S., Stein, J., and Stein, G. (1988)
Native genomic blotting: a novel approach to mapping
DNase I hypersensitive sites and protein-DNA
interactions at high resolution. BioTechnicrues 6: 142-
146.
Penpargkul, S., Malhotra, A., Fein, F., Strobeck, J.,
Sonnenblick, E., and Scheuer, J. (1979). Myocardial
biochemical alterations in experimental diabetes in
rats (abstract). Clin. Res. 27: 441A.
Pepinsky, R. B., Sinclair, L., Browning, J., Mattaliano, T.
Smart, J., Chow, E., Falbel, T., Ribolini, A., Garwin,
J., and Wallner, B. (1986). Purification and partial
sequence analysis of a 37-kDa protein that inhibits
phospholipase A2 activity from rat peritoneal exudates
J. Biol. Chem. 261: 4239-4246.
Pepinsky, R. B., Sinclair, L. K., Chow, E. P., and O'Brine-
Greco, B. (1989). A dimeric form of lipocortin-1 in
human placenta. Biochem. J. 263: 97-103.

100
Pepinsky, R, B., Tizard, R., Mattaliano, R. J., Sinclair, L.
K., Miller, G. T., Browning, J. L., Chow, E. P., Burne,
C., Huang, K. -S., Pratt, D., Wachter, L., Hession, C.,
Frey, A. Z., and Wallner, B. P. (1988). Five distinct
calcium and phospholipid binding proteins share
homology with lipocortin I. J. Biol. Chem. 263: 10799-
10811.
Peterson, 0. H., and Bear, C. (1986). Two glucagon
transduction systems. Nature 323: 18.
Pfaffle, M., Ruggiero, F., Hofmann, H., Fernandez, M. P.,
Selmin, 0., Yamada, Y., Garrone, R., and von der Mark,
K. (1988). Biosynthesis, secretion, and extracellular
localization of anchorin CII, a collagen-binding
protein of the calpactin family. EMBO J. 7: 2335-2342.
Pfaffman, M. A. (1980). The effects of streptozotocin-
induced diabetes and insulin-treatment on the
cardiovascular system of the rat. Res. Comm. Chem.
Path. Pharmacol. 28: 27-41.
Phillips, C., Rose-John, S., Rincke, G., Furstenberger, G.,
and Marks, F. (1989). cDNA cloning, sequence, and
expression in glucocorticoid-stimulated quiescent swiss
3T3 fibroblasts of mouse lipocortin I. Biochem.
Biophvs. Res. Commun. 159: 155-162.
Picard, D., Salser, S. J., and Yamamoto, K. R. (1988). A
movable and regulable inactivation function within the
steroid binding domain of the glucocorticoid receptor.
Cell 54: 1073-1081.
Pieper, G. M. (1990). Arachidonic acid causes postischemic
dysfucntion in control but not diabetic hearts. Am. J.
Phvsiol. 258: H923-H930.
Pukac, L. A., and Horseman, N. D. (1986). Regulation of
cloned prolactin-inducible genes in pigeon crop. Mol.
Endocrinol. 1: 188-194.
Regan, T. J., Ettinger, P. O., Khan, M. I., Jesrani, J. U.,
Lyons, M., Oldewurtel, H. A., and Weber, M. (1974).
Altered myocardial function and metabolism in chronic
diabetes mellitus without ischemia in dogs. Circ. Res.
35: 222-237.
Regan, T. J., Lehan, P. H., Henneman, D. H., Behar, A., and
Hellems, H. K. (1964). Myocardial metabolic and
contractile response to glucagon and epinephrine. J.
Lab. Clin. Med. 63: 638-646.

101
Regan, T. J., Wu, C. F., Yeh, C. K., Oldewurtel, H. A., and
Haider, B. (1981). Myocardial composition and function
in diabetes: the effects of chronic insulin use. Circ.
Res. 49: 1268-1277.
Rodgers, R. L., Macleod, K. M., and McNeill, J. H. (1981).
Response of rat and guinea pug hearts to glucagon-lack
of evidence for a dissociation between changes in
myocardial cyclic 3'-5'-adenosine monophosphate and
contractility. Circ. Res. 49: 216-225.
Rodrigues, B., and McNeill, J. H. (1990). Cardiac
dysfunction in islolated perfused hearts from
spontaneously diabetic BB rats. Can. J. Physiol.
Pharmacol. 68: 514- 518.
Rosenblatt, J. S., Siegel, H. I., and Mayer, A. D. (1979).
Progress in the study of maternal behavior in the rat:
hormonal, nonhormonal, sensory, and developmental
aspects. In R. A. Rosenblatt, C. B. Hinde, and M. C.
Busnel (eds.), Advances in the Study of Behavior, pp.
225-311. Academic Press, New York.
Ross, T. S., Tait, J. F., and Majerus, P. W. (1990).
Identity of inositol 1,2-cyclic phosphate 2-
phosphohydrolase with lipocortin III. Science 248: 605-
607.
Roy-Choudhury, S., Mishra, V. S., Low, M. G., and Das, M.
(1988). A phospholipid is the membrane anchoring domain
of a protein growth factor of molecular mass 34 kDa in
placental trophoblasts. Proc. Natl. Acad. Sci. USA 85:
2014-2018.
Sakata, T., Iwagami, S., Tsuruta, Y., Suzuki, R., Hojo, K.,
Sato, K. and Teraoka, H. (1988). Mouse lipocortin I
cDNA. Nucleic Acids Res. 16: 11818.
Sambrook, J., Fritsch, E. F., and Maniatis, T. (1982).
Molecular Cloning A Laboratory Manual. Cold Spring
Harbor Laboratory Press, New York.
Saris, C. J. M., Tack, B. F., Kristensen, T., Glenney, J.
R., Jr., and Hunter, T. (1986). The cDNA sequence for
the protein-tyrosine kinase substrate p36 (calpactin I
heavy chain) reveals a multidomain protein with
internal repeats. Cell 46: 201-212.
Sawyer, S. T., and Cohen, S. (1981). Enhancement of calcium
uptake and phosphatidylinositol turnover by epidermal
growth factor in A-431 cells. Biochemistry 20: 6280-
6286.

102
Sawyer, S. T., and Cohen, S. (1985). Epidermal growth factor
stimulates the phosphorylation of the calcium-dependent
35,000-dalton substrate in intact A-431 cells. J. Biol.
Chem. 260:8233-8236.
Schlaepfer, D. D., and Haigler, H. T. (1987).
Characterization of Ca2+-dependent phospholipid binding
and phosphorylation of lipocortin I. J. Biol. Chem.
262: 6931-6937.
Schlaepfer, D. D., Mehlman, T., Burgess, W. H., and Haigler,
H. T. (1987). Structural and functional characterizaton
of endonexin II, a calcium- and phospholipid-binding
protein. Proc. Natl. Acad. Sci. USA 84: 6078-6082.
Schrade, W., Boehle, E., Biegler, R., and Harmuth, E.
(1963). Fatty-acid composition of lipid fractions in
diabetic serum. Lancet 1: 285-290.
Seiler-Tuyns, A., and Birnstiel, M. L. (1981). Structure and
expression in L-cells of a cloned H4 histone gene of
the mouse. J. Mol. Biol. 151: 607-625.
Seyer-Hansen, K. (1983). Renal hypertrophy in experimental
diabetes mellitus. Kidney Int. 23: 643-646.
Shinitzky, M. (1980). Fluidity of cell membranes-current
concepts and trends. Int. Rev. Cvtol. 60: 121-147.
Silver, I. A. (1956). Vascular changes in the mammary gland
during engorgement with milk. J. Phvsiol. 133: 65P.
Smith, O. L. K., Wong, C. Y., and Gelfand, R. A. (1989).
Skeletal muscle proteolysis in rats with acute
streptozocin-induced diabetes. Diabetes 38: 1117-1122.
Smith, V. L., and Dedman, J. R. (1986). An immunological
comparison of several novel cacium-binding proteins. J.
Biol. Chem. 261: 15815-15818.
Steer, K. A., Sochor, M., and McLean, P. (1985). Renal
hypertrophy in experimental diabetes: changes in
pentose phosphate pathway activity. Diabetes 34: 485-
490.
Sudhof, T. C., Slaughter, C. A., Leznicki, I., Barjon, P.,
and Reynolds, G. A. (1988). Human 67-kDa calelectrin
contains a duplication of four repeats found in 35-kDa
lipocortins. Proc. Natl. Acad. Sci. USA 85: 664-668.

103
Taegtmeyer, H., and Passmore, J. M. (1985). Defective energy
metabolism of the heart in diabetes. Lancet 1: 139-
141.
Tahiliani, A. G., and McNeill, J. H. (1986). Diabetes-
induced abnormalities in the myocardium. Life Sciences
38: 959-974.
Tait, J. F., Sakata, M., McMullen, B. A., Miao, C. H.,
Funakoshi, T., Hendrickson, L., and Fujikawa, K.
(1988). Placental anticoagulant proteins: isolation and
comparative characterization of four members of the
lipocortin family. Biochemistry 27: 6268-6276.
Taketani, Y., and Oka, T. (1983). Possible physiological
role of epidermal growth factor in the development of
the mouse mammary gland during pregnancy. FEBS Lett.
152: 256-260.
Thompson, E. W. (1988). Structural manifestations of
diabetic cardiomyopathy in the rat and its reversal by
insulin treatment. Am. J. Anat. 182: 270-282.
Topper, Y. J., and Freeman, C. S. (1980). Multiple hormone
interactions in the developmental biology of the
mammary gland. Physiol. Rev. 60: 1049-1106.
Touqui, L., Rothhut, B., Shaw, A. M., Fradin, A., Vargaftig,
B. B., and Russo-Marie, F. (1986). Platelet activation-
a role for a 40K anti-phospholipase A2 protein
indistinguishable from lipocortin. Nature 321: 177-
180.
Ullrich, A., and Schlessinger, J. (1990). Signal
transduction by receptors with tyrosine kinase
activity. Cell 61: 203-212.
Unger, R. H., Eisentraut, A. M., and Madison, L. L. (1963).
The effects of total starvation upon the levels of
circulating glucagon and insulin in man. J. Clin.
Invest. 42: 1031-1039.
Varticovski, L., Chahwala, S. B., Whitman, M., Cantley, L.,
Schindler, D., Chow, E. P., Sinclair, L. K., and
Pepinsky, R. B. (1988). Location of sites in human
lipocortin I that are phosphorylated by protein
tyrosine kinases and protein kinases A and C.
Biochemistry 27: 3682-3690.

104
Violette, S. M., King, I., Browning, J. L., Pepinsky, R. B.,
Wallner, B. P., and Sartorelli, A. C. (1990). Role of
lipocortin I in the glucocorticoid induction of the
terminal differentiation of a human squamous carcinoma.
J. Cell. Phvsiol. 142: 70-77.
Wakelam, M. J. O., Murphy, G. J., Hruby, V. J., and Houslay,
M. D. (1986). Activation of two signal-transducing
systems in hepatocytes by glucagon. Nature 323: 68-71.
Wallner, B. P., Mattaliano, R. J., Hession, C., Cate, R. L.,
Tizard, R., Sinclair, L. K., Foeller, C., Chow, E. P.,
Browning, J. L., Ramachandran, K. L., and Pepinsky, R.
B. (1986). Cloning and expression of human lipocortin,
a phospholipase A2 inhibitor with potential anti¬
inflammatory activity. Nature 320: 77-81.
Warren, S., LeCompte, P. M., and Legg, M. A. (1966). The
Pathology of Diabetes Mellitus. Lea and Febinger,
Philadelphia.
Weber, K., Johnsson, N., Plesmann, U., Van, P. N., Soling,
H. - D., Ampe, C., and Vandekerckhove, J. (1987). The
amino acid sequence of protein II and its
phosphorylation site for protein kinase C; the domain
structure Ca2+-modulated lipid binding proteins. EMBO
J. 6: 1599-1604.
Weintraub, H. , and Groudine, M. (1976). Chromosomal subunits
in active genes have an altered conformation. Science
193: 848- 856.
Widman, L. E., and Chasin, L. A. (1982). Multihormonal
induction of a2u-globulin in an established rat
hepatocyte cell line. J. Cell. Phvsiol. 112: 316-326.
William, F., Mroczkowski, B., Cohen, S., and Kraft, A.
(1988). Differentiation of HL-60 cells is associated
with an increase in the 35-kDa protein lipocortin I. J.
Cell. Phvsiol. 137: 402-410.
Winegrad, A. I. (1987). Does a common mechanism induce the
diverse complications of diabetes? Diabetes 36: 396-
406.
Wong, W. T., Frost, S. F., and Nick, H. S. (1990). Protein
synthesis-dependent induction of annexin I by
glucocorticoid, (submitted)
Yerganian, G., Mackay, B., and Gagnon, H. J. (1957). An
inbred guinea pig strain which develops spontaneous
diabetes mellitus. Genetics 40: 403-411.

105
Zaret, K. S., and Yamamoto, K. R. (1984). Reversible and
persistent changes in chromatin structure accompany
activation of a glucocorticoid-dependent enhancer
element. Cell 38: 29-38.
Zokas, L., and Glenney, J. R., Jr. (1987). The calpactin
light chain is tightly linked to the cytoskeletal form
of calpactin I: studies using monoclonal antibodies to
calpactin subunits. J. Cell Biol. 105: 2111-2121.

BIOGRAPHICAL SKETCH
Kenneth Robert Horlick was born on June 30, 1963, in
the Bronx, New York. He attended Middlesex High School in
Middlesex, New Jersey, and received a Bachelor of Arts
degree in biochemistry from Rutgers University in 1985. In
September of 1985, he began his graduate education in the
Department of Biochemistry and Molecular Biology at the
University of Florida, Gainesville, working under the
direction of Dr. Harry S. Nick. After receiving his
doctoral degree in December, 1990, he plans to pursue a
career in biotechnology research and development.
106

I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
4
Harry á
-i Nick, Chairman
Associate Professor of
Biochemistry and Molecular
Biology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Debtor of Philosophy.
Richard P. Boyce
Professor of Biochemistry
and Molecular Biology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
Michc
Professor of Biochemistry
and Molecular Biology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
a. rYy\*-i^i
Susan A. Moyer
Professor of Immunology and
Medical Microbiology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
Sigurd Jy Normann
Professor of Pathology
Laboratory Medicine
and

This dissertation was submitted to the Graduate Faculty of
the College of Medicine and to the Graduate School and was
accepted as partial fulfillment of the requirements for the
degree of Doctor of Philosophy.
December, 1990
Dean, Graduate School

„.lÍ,m1versity of florida
- ■ lililí mil
3 1262 08554 3972