Citation
Molecular characterization and detection of dasheen mosaic virus

Material Information

Title:
Molecular characterization and detection of dasheen mosaic virus
Creator:
Li, Ruhui, 1959-
Publication Date:
Language:
English
Physical Description:
138 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Amino acids ( jstor )
Antiserum ( jstor )
Capsid proteins ( jstor )
Nucleotide sequences ( jstor )
Potyvirus ( jstor )
Proteins ( jstor )
RNA ( jstor )
Taro ( jstor )
Virology ( jstor )
Western blotting ( jstor )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1995.
Bibliography:
Includes bibliographical references (leaves 120-137).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Ruhui Li.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
002059770 ( ALEPH )
AKP7838 ( NOTIS )
33867124 ( OCLC )

Downloads

This item has the following downloads:


Full Text












MOLECULAR CHARACTERIZATION AND DETECTION
OF DASHEEN MOSAIC VIRUS
















By

RUHUI LI


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


1995
















ACKNOWLEDGMENTS


I would like to express my deepest appreciation and gratitude to Dr. F. W. Zettler,

a great teacher in my career. My interest in plant virology was inspired when I attended his

plant virology class, and continued when I worked in his laboratory. Indeed, this work

could not have been done with his advice, support, encouragement and patience. I would

like to thank Dr. Ernest Hiebert, cochairman of my committee, who always shared with

me his expertise in many parts of my research, who was always patient when I learned to

do computer analysis. My great gratitude also goes to Dr. D. E. Purcifull, for his support

of my research, for his encouragement whether I succeed or failed, for his constructive

criticism and challenge to my writing, for his strict attitude to work, and for his sense of

humor too. I would like to extend my appreciation to Dr. C. L. Guy, who always opened

the door for me, and who shared his knowledge and time with me.

I wish to express my gratitude to Dr. G. N. Agrios for his care and encouragement

during these years. My special thanks go to Dr. C. L. Niblett and his wife Tiffany for their

encouragement and kindness during the initial stage of my study in the United States.

I want to thank Dr. Carlye Baker, who first taught me the molecular techniques,

and who was always there when I needed help, with a smile. I also want to thank Dr. Gail

Wisler, for always standing there, not just as a colleague, but also as a friend.











I would like to extend my appreciation to Kristin Beckham, Maureen Petersen,

Mark Elliott, Eugene Crawford, Ellen Dickstein and Lucious Mitchell for their excellent

technical assistance and friendship.

I give heartfelt thanks to my parents, Fengling Li and Guizhen He, for their love,

support, encouragement and understanding. They have not seen their eldest child, and only

daughter, for almost seven years. To them, I owe my deepest gratitude.

To my husband, Wei-Wei Rao, and our son, Ran Rao, go my love and gratitude,

they have endured many hardships along the way and both have sacrificed a lot, just to

share this dream with me.

I also gratefully acknowledge the financial assistance of the USDA/CSRS (CBAG

Grant No. 90-34135-5172), the American Floral Endowment, and the Manatee Fruit

Company.















TABLE OF CONTENTS


Page

ACKNOWLEDGMENTS................... ......... ii

LIST OF FIGURES ........... ................... vi

LIST OF TABLES ................ ... ......... .. viii

KEY TO ABBREVIATIONS ..... ... ........... ..... ix

ABSTRACT ................... .. ........... xi

CHAPTER 1 INTRODUCTION ...................... .1


CHAPTER 2


CHAPTER 3








CHAPTER 4


General Characteristics of Potyviridae ............... 1
Dasheen Mosaic Virus ....................... 12

CLONING, SEQUENCING OF 3'-TERMINAL REGION
AND COAT PROTEIN EXPRESSION OF DSMV-Chl

Introduction ............... ... ....... 20
Materials and Methods ......................21
Results .................. .......... 32
Discussion .............. ..... ....... 61

VARIABILITY OF COAT PROTEINS AMONG ISOLATES
OF DASHEEN MOSAIC VIRUS

Introduction .................. .......... 66
Materials and Methods ............. ...... 67
Results ...... ........ ....... ........ 70
Discussion .. ................ ......... 83

DETECTION OF DASHEEN MOSAIC VIRUS

Introduction .......................... 89
Materials and Methods .................... 90

iv













Results ... ................. .........99
Discussion . 110

CHAPTER 5 SUMMARY AND CONCLUSIONS ............. 113

REFERENCE LIST ................................. 120

BIOGRAPHICAL SKETCH .................... ........ 138












































v















LIST OF FIGURES


Figure page

2-1 Analysis of partially purified and purified DsMV-Chl preparations 34

2-2 Electron micrograph of a purifed DsMV-Chl preparation
negatively stained with 2% uranyl acetate ..... 35

2-3 Agarose gel electrophoresis ofDsMV-Chl RNA isolated
from purifed virions .......................... 37

2-4 Map of the cDNA clones representing the DsMV-Chl genome 40

2-5 Sequencing strategy used for the cDNA clones representing
the 3'-terminal region of DsMV Chl .... 41

2-6 Nucleotide sequence of the 3'-terminal region of DsMV-Chl ...... .42

2-7 Phylogenetic tree obtained from the alignment of putative amino acid
sequences of NIb proteins between DsMV and 14 other potyviruses
using the PAUP program ..... .......... ........ 50

2-8 Hydrophobicity plot of the NIb protein sequence of DsMV-Chl .. 51

2-9 Phylogenetic tree obtained from the alignment of coat proteins
between DsMV isolates and 8 potyviruses
using the PAUP program ................. ....... 54

2-10 Phylogenetic tree obtained from the alignment of coat proteins
between DsMV isolates and 14 other potyviruses
using the PAUP program ................... 55

2-11 Analysis of the DsMV pETh-3-CP expressed in E. coli ... 57

2-12 Western blotting analysis of the expressed CP and
native CP of DsMV ........................ .. .. 59

3-1 Western blotting analysis of the coat proteins ofdasheen mosaic
virus (DsMV) isolates from their original hosts ... 72

vi












3-2 Western blotting analysis of the Chl isolate ofdasheen mosaic
virus (DsMV-Chl) and other potyviruses .... 73

3-3 Western blotting analysis of the Chl isolate ofdasheen mosaic
virus (DsMV-Chl) transferred to several different hosts. ... 74

3-4 Western blotting analysis of four dasheen mosaic virus (DsMV)
isolates serially propagated in Philodendron selloum seedlings 75

3-5 Comparison of nucleotide sequences of the coat protein (CP)
gene of dasheen mosaic virus isolates ... 77

3-6 Comparison of amino acid sequences of coat proteins
of dasheen mosaic virus isolates ..... ...... 82

3-7 Comparison of nucleotide sequences of the 3'-NCRs
of dasheen mosaic virus isolates . 84

4-1 Electron micrograph of cylindrical inclusions (CI) induced by
a caladium isolate of dasheen mosaic virus in a leaf cell
ofPhilodendron selloum .......................100

4-2 Agarose gel electrophoresis ofRT-PCR amplified products obtained
from total RNA extracted from aroid leaf tissues ... 107

4-3 Agarose gel electrophoresis ofRT-PCR amplified products obtained
from total RNA extracted from leaf tissues of calla lily plants 108













LIST OF TABLES


Table ae

2-1 DsMV-Chl cDNA clones identified by immunoscreening
and preliminary sequencing ................... .... 38

2-2 DsMV-Ch1 cDNA clones identified by preliminary sequencing ..... 39

2-3 Percent nucleotide identity of NIb genes ofDsMV-Chl
and 14 other potyviruses ........................ 48

2-4 Percent similarity of the NIb protein, the coat protein
and the 3' noncodingregion (3'-NCR) ofDsMV-Chl
and 14 other potyviruses ....................... 49

2-5 Percent nucleotide identity of CP genes of two DsMV isolates
and 14 other potyviruses ..................... .... 52

2-6 Comparison of the DsMV-FL antiserum and the expressed
coat protein antiserum in I-ELISA . ... 60

4-1 A.w absorbance value of I-ELISA and DAS-ELISA
forDsMVdetection .............. ..... .......... 101

4-2 Comparison of I-ELISA and Western blotting procedures
to detect DsMV in caladium leaves . ... 102

4-3 Relative distribution of DsMV in three aroid hosts
as determined by I-ELISA .............. ....... 104

4-4 Effect of wounding on detection of DsMV in caladium corms 105

4-5 Comparison ofRT-PCR, I-ELISA and Western blotting
for detecting DsMV ..........................109
















KEY TO ABBREVIATIONS


AI
bp
BCMV
B1CMV
BYMV
CP
C-terminus
cDNA
CMV
CI
HiCi
DIECA
DSMO
DsMV-Ce
DsMV-Ch

DsMV-Ch2

DsMV-Ch3

DsMV-Xc
DsMV-Za
ELISA
HC/Pro
IPTG
kb
kDa
LB
P-ME
MW
3'-NCR
N-terminus
NIa
NIb
nm
nt
oligo dT


amorphous inclusion
base pair
bean common mosaic virus
blackeye cowpea mosaic virus
bean yellow mosaic virus
coat protein
carboxy-terminus
complementary DNA
cucumber mosaic virus
cylindrical inclusion
microCurie
diethyldithiocarbamate
dimethyl sulfoxide
taro isolate of dasheen mosaic virus
caladium isolate of dasheen mosaic virus from
cultivar 'Candidum'
caladium isolate of dasheen mosaic virus from
cultivar 'Carolyn Whorton'
caladium isolate of dasheen mosaic virus from
cultivar 'Frieda Hemple'
cocoyam isolate of dasheen mosaic virus
calla lily isolate of dasheen mosaic virus
enzyme-linked immunosorbent assay
helper component/protease
isopropyl-B-D-thiogalactopyranoside
kilobase
kilodalton
Luria broth
0-mercaptoethanol
molecular weight
3' non-coding region
amino-terminus
nuclear inclusion a
nuclear inclusion b
nanometer
nucleotide
oligonucleotide deoxythymidine












PCR
PepMoV
PMoV
PPV
PRSV-W
PRSV-P
PSbMV
PStV
PVY
RT-PCR
SbMV
SCMV
SDS-PAGE

TEV
TuMV
TVMV
WMV 2
X-Gal
ZYMV


polymerase chain reaction
pepper mottle virus
peanut mottle virus
plum pox virus
papaya ringspot virus type W
papaya ringspot virus type P
pea seed-borne mosaic virus
peanut stripe virus
potato virus Y
reverse transcription-polymerase chain reaction
soybean mosaic virus
sugarcane mosaic virus
sodium dodecyl sulfate polyacrylamide
gel electrophoresis
tobacco etch virus
turnip mosaic virus
tobacco vein mottling virus
watermelon mosaic virus 2
5-bromo-4-chloro-3-infolyl-B-D-galactopyranoside
zucchini yellow mosaic virus












Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the Requirements
for the Degree of Doctor of Philosophy

MOLECULAR CHARACTERIZATION AND DETECTION OF
DASHEEN MOSAIC VIRUS

by

Ruhui Li

August, 1995


Chairman: F. W. Zettler
Cochairman: E. Hiebert
Major Department: Plant Pathology

The sequence of the 3'-terminal 3158 nucleotides of a caladium (Caladium

hortulanum) isolate of dasheen mosaic virus (DsMV-Chl) was determined. The region

contains the nucleotide sequence which encodes the carboxyl terminus of the NIa

protease, the NIb RNA polymerase, and the coat protein (CP). The genomic organization

of this region is similar to those of other potyviruses. The overall nucleotide sequence

homology of the coding region compared with those of other sequenced potyviruses is

between 57-67%, and the amino acid sequence homology is between 68-82%.

Phylogenetic alignment of the genomic sequences indicated that DsMV is a distinct

member of the genus Potyvirus in the family Potyviridae.

The CP gene of DsMV-Ch was amplified by PCR, cloned into a pETh-3 vector,

and expressed in Escherichia coli. Antiserum against the expressed CP was obtained and

it was suitable for detecting DsMV in SDS-diffusion test, ELISA and Western blotting.











Variability among DsMV isolates from caladium, calla lily (Zantedeschia spp.),

cocoyam (Xanthosoma spp.), and taro (Colocasia esculenta) was noted in symptom

severity in inoculated Philodendron selloum seedlings. The CP molecular weight (MWs)

among isolates varied, ranging from 38-47 kDa in their original hosts based on western

blotting analysis. Because respective MWs of each DsMV isolate remained constant after

three passages in Philodendron selloum or other hosts, it was concluded that the observed

differences in the CP MWs were virus-mediated. Comparison of the CP sequence among

DsMV isolates revealed deletions and additions at the 3'-terminal regions, which may

contribute to the variability of the CP MWs among different DsMV isolates.

DsMV was not uniformly distributed within tissues of infected cocoyam and taro

leaves. In contrast, more uniform distribution of the virus was noted within infected

'Candidum', 'Carolyn Whorton', and 'Frieda Hemple' caladium leaves. Relatively high

growing temperatures resulted in a reduction in the distribution of DsMV within leaves of

infected cocoyam and taro plants. Under such conditions, many leaves without detectable

virus were produced by infected plants, which may be related to restriction of virus

movement in these plants.

Immunosorbent electron microscopy (ISEM), ELISA, Western blotting, and

reverse transcription-PCR (RT-PCR) were used to detect different DsMV isolates in

leaves and/or corms of caladium, calla lily, cocoyam and taro. Of them, RT-PCR was the

most sensitive. DsMV detection was also facilitated by corm wounding.














CHAPTER 1
INTRODUCTION


Dasheen mosaic virus (DsMV) is a species of the genus Potyvirus in the family Poyviridae,

and infects plants in the family Araceae, collectively referred to as aroids. This potyvirus

causes stunting and foliar mosaic, chlorotic feathering, and distortion symptoms in infected

plants, thereby reducing their market values and/or yields (Zettler & Hartman, 1987).


General Characteristics of Potyviridae


The Potyviridae is the largest of 47 plant virus groups and families currently

recognized by the International Committee for the Taxonomy of Viruses. Three genera,

Potyvirus, Rymovirus, and Bymovirus, are recognized (Murphy et al., 1995). There are two

whitefly transmitted viruses and two aphid transmitted viruses are unassigned. The family

contains at least 184 definitive and possible species (30% of all known plant viruses), many of

which cause significant losses in agronomic, pasture, horticultural and ornamental crops

(Shukla et al., 1994). A feature shared by all potyviruses is that they induce characteristic

cylindrical inclusion bodies in the cytoplasm of the infected cells (Edwardson, 1974). These

cylindrical inclusion (CI) bodies are formed by a virus-encoded protein (Dougherty & Hiebert,

1980). Except for species of the genus Bymovirus, which have bipartite particles about 500-











600 nm and 250-300 nm long, Pootvirus and Rymovirus virions are flexuous filaments of 650

to 900 nm in length (Murphy et al., 1995). The particles of monopartite potyviruses contain

one positive-sense, single-stranded genomic RNA molecule of 8.5-10 kb, which is

encapsidated by a single type of coat protein (Hollings & Brunt, 1981). The genomic RNA has

a protein (VPg) covalently attached to its 5' end (Hari, 1981; Siaw et al., 1985; Riechmann et

al., 1989; Murphy et al., 1990) and a poly(A) tract at its 3' end (Hari, 1979). Most potyviruses

(Potyvirus) are transmitted by aphids in a non-persistent manner, while Rymovirus, Bymovirus,

are transmitted by mites, and fungi, respectively. Some potyviruses, such as TEV, are known

to form nuclear inclusion bodies consisting of two nuclear proteins (NIa & NIb) aggregated in

equimolar amounts in nuclei of infected cells. A few potyviruses, such as PRSV-W, PeMoV,

potato virus A (PVA) and celery mosaic induce the formation of amorphous inclusions in the

cytoplasm and/or in the nucleoplasm of infected cells (Christie & Edwardson, 1977;

Edwardson & Christie, 1983).


Genome Organization


The complete nucleotide sequence of the following thirteen potyviruses has been

documented: TEV (Allison et al., 1986), TVMV (Domier et al., 1986), PPV (Maiss et al.,

1989; Lain et al., 1989), PepMoV (Vance et al., 1989), the necrotic and Hungarian strains of

PVY (Robaglia et al., 1989, Thole et al., 1993), PSbMV (Johansen et al., 1991), PRSV-P

(Yeh et al., 1992), the two strain of SbMV (Jayaram et al., 1992), TuMV (Nicolas et al.,

1992), Johnsongrass mosaic (Gough & Shukla, 1993), PVA (Puurand et al., 1994), PStV











(Gunasinghe et al., 1994) and ZYMV (Wisler et al., 1995). The sequence analysis of

potyviruses and in vitro translation studies of potyvirus genomic RNAs have revealed a single

open reading frame (ORF) encoding a large polyprotein ranging from 320 kDa to 358 kDa,

depending on the virus. This polyprotein is proteolytically processed into at least eight mature

viral proteins by three virus-encoded proteases (Hellmann et al., 1983; Dougherty &

Carrington, 1988). The different gene products into which the potyviral polyprotein is cleaved

are, proceeding from the N- to the C-terminus of the polyprotein: P1 protease, the helper

component/protease protein (HC-Pro), P3, a putative 6K peptide (6K1), the CI protein with

helicase activity, a second 6K peptide (6K2), the nuclear inclusion "a" protein (NIa), which

functions as VPg and protease, the nuclear inclusion "b" protein (NIb), the presumptive RNA

polymerase, and the capsid protein (CP). The length of potyviral 5' non-coding regions ranges

from 85 nucleotides (nt) for PRSV-W to 205 nt for TVMV. These regions are especially rich

in adenine residues with relatively few guanine residues. It has been shown that the TEV 5'

non-coding region can function as an enhancer of translation (Carrington et al., 1990).

Alignment of the non-coding regions of PPV, PVY, TEV, and TVMV revealed two highly

conserved regions, namely box "a" (ACAACAU) and box "b" (UCAAGCA) (Lain et al.,

1989; Turpen, 1989). These conserved sequences and their secondary structure may be

important for processes such as encapsidation, translation or replication (Lain et al., 1989;

Atreya et al., 1992; Riechmann et al., 1992).

The 3' non-coding regions of different potyviruses have been described as variable in

size, sequence, and predicted secondary structure (Lain et al., 1988; Turpen, 1989; Quemada











et al., 1990a, b). They contain AU-rich segments, and each sequence can be predicted to fold

into stable secondary structures (Turpen, 1989). Several short segments displaying sequence

homology among different potyviruses have been identified (Lain, 1989; Uyeda et al., 1992). In

contrast with the high sequence diversity found among the 3' non-coding regions of different

potyviruses, the 3' non-coding regions are more conserved among different strains of the same

potyvirus (Wetzel., 1991). The poly(A) tails have been determined to be very variable in length

(Allison et al., 1986; Lain et al., 1988). The most important functions of the 3' non-coding

region involve the interaction with virus replicase during the initiation of minus-strand RNA

synthesis and the prevention of exonucleolytic degradation (Bryan et al., 1992; Dolja &

Carrington, 1992). It has been shown that the 3' non-coding region of TVMV can have a

direct effect on the induction of disease symptoms (Rodriguez-Cerezo et al., 1991).


Replication


The subcellular site(s) of potyviral RNA synthesis has not been identified with

certainty, but is believed to be in the cytoplasm, as found with other positive stranded RNA

viruses (Verchot et al., 1991). A polymerase activity is associated with an enzyme complex

isolated from plants infected with PPV (Martin & Garcia, 1991). Several viral proteins,

including NIb, CI, VPg/NIa, and two small peptides (6K1 and 6K2), are believed to be

involved in the replication process of potyviruses. The large nuclear inclusion protein, NIb, is

the most conserved gene product of potyviruses and is believed to be the RNA-dependent

RNA polymerase (RdRp) based on the presence of conserved sequence motif (GDD)











characteristic of these enzymes (Domier et al., 1987; Lain et al., 1989; Robaglia et al., 1989;

Poch et al., 1989; Riechmann et al., 1992).

The CI protein of PPV has been shown to have nucleic acid-stimulated ATPase activity

and to be able to unwind RNA duplexes (Lain et al., 1990, 1991). The PPV CI was able to

unwind only dsRNA substrates with the 3' single-strand overhangs, indicating that the helicase

activity functions from the 3' to the 5' direction (Lain et al., 1990). The CI proteins of

potyviruses were found to contain a conserved nucleotide binding consensus sequence motif

(GXXGXGKS) at the C-terminal region and were implicated as membrane-binding

components of the replication complex (Domier et al., 1987).

In addition to the role of NIa in the proteolytic processing of the potyviral polyprotein,

for which only its carboxyl half is required, its N-terminal part has been shown to be the VPg.

The VPg ofTVMV (Siaw et al., 1985) and PPV (Riechmann et al., 1989) have been identified

as proteins of 24 kDa and 22 kDa, respectively. The TVMV VPg cistron has been mapped

showing that the VPg is the N-terminal portion of the NIa protein (Shahabuddin et al., 1988).

Likewise, the TEV VPg has been found to be either the 49 kDa NIa or its N-terminal 24 kDa

half (Murphy et al., 1990). The VPg is attached to the 5' end of the RNA by means of a

phosphate ester linkage to Y residues of the protein (Murphy et al., 1991). By analogy with

other viral systems, VPg is believed to serve as the primer for viral RNA synthesis

(Shahabuddin et al., 1988).

The NIa protease also may be involved in regulation of potyvirus replication. One level

of control has been proposed to be the regulation of the expression of gene products by











sequential proteolytic events (Dougherty et al., 1989a, b). Another proposed level of control is

that the subcellular localization of the NIa/NIb may play a regulatory role (Carrington et al.,

1991).


Proteolytic Processing of Polprotein


Three virus-encoded proteases, NIa (Carrington & Dougherty, 1987a; Hellmann et al.,

1988; Chang et al., 1988; Garcia et al., 1989a; Ghabrial et al., 1990), HC-Pro (Carrington et

al., 1989a), and P1 (Carrington et al., 1990; Verchot et al., 1991), process the large viral

precursor polyprotein co- and post-transcriptionally. The NIa is responsible for cleavages in the

C-terminal two-thirds of the polyprotein (Dougherty et al., 1988), whereas HC-Pro and P1

autocatalytically cleave at their respective C-termini (Carrington et al., 1989 a, b; Verchot et

al., 1991).

The small nuclear inclusion protein, NIa, is the major protease of potyviruses, and it is

capable of cleaving in a cis- and trans-manner at least six and possibly seven sites within the

polyprotein. It has a two-domain structure where the N-terminal domain is the genome-linked

VPg (Shahabuddin et al, 1988; Murphy et al., 1990), and the C-terminal half is the true

proteinase (Dougherty & Carrington, 1988). This proteolytic domain in TEV and TVMV was

like that reported for the poliovirus 3C and cowpea mosaic virus 24 kDa proteases (Domier et

al., 1987). The NIa protease is related to the trypsin-like family of cellular serine proteases,

except that a Cys is substituted for the active site nucleophile (Bazan and Fletterick, 1988;

Gorbalenya et al., 1989). Mutagenesis of selected TEV 27-kDa NIa ORF codons supports the











hypothesis that His-46, Asp-81, and Cys-151 make up the active-site triad (Dougherty et al.,

1989b). The consensus sequence GXCG has been found in all potyviruses examined to date

(Shukla et al., 1994). The NIa autocatalytically releases from the polyprotein by cleaving the

CI-NIa, and NIa-NIb junctions and catalyzes the production of CI, NIb, and CP by cleaving

the P3-CI, and NIb-CP junctions (Carrington & Dougherty, 1987a, b; Carrington et al., 1988;

Hellman et al., 1988; Garcia et al., 1989a, b, 1990). Additional cleavages, to release VPg and

the 6K1 and 6K2 products, also occur (Garcia et al., 1992; Restrepo-Hartwig & Carrington,

1992).

The NIa protease requires those conserved cleavage sites, defined as heptapeptide

sequences, that are efficiently recognized only by their own respective proteases (Carrington &

Dougherty, 1987a, 1988; Carrington et al., 1988; Dougherty et al., 1988, 1989a; Garcia et al.,

1989 a, b; Garcia & Lain, 1991; Parks & Dougherty, 1991). Cleavages are frequently at a

Q/(G, or S) site. A group-specific motif VXXQ/(A, S, G, or V), common to most potyviruses,

has been found (Shukla et al., 1994). The requirement for the conserved cleavage sites is

unique to the NIa proteases.

The helper component protease (HC-Pro) functions as an autocatalytic protease. The

HC-Pro 52 kDa protein of TEV is a multifunctional protein, and the proteolytically active

domain has been localized at its C-terminal half (Carrington et al., 1989a, b). The presence of

two essential residues, specifically Cys-679 and His-772, in this protease supports the

hypothesis that HC-Pro most closely resembles members of the cysteine-type family of

proteases (Oh & Carrington, 1989). Cleavage is at a specific G/G dipeptide and appears to be











the only cleavage event mediated by the HC-Pro protein (Carrington et al., 1989b; Oh &

Carrington, 1989). The HC-Pro ofpotyviruses accumulates to high levels and often complexes

into amorphous inclusion bodies (de Mejia et al., 1985b)

By expressing TEV polyprotein in transgenic plants, it was shown that a novel

proteolytic activity caused by neither HC nor NIa proteases is required for processing at the C-

terminal region of P1 protein (Carrington et al., 1990). Verchot et al. (1991) have

demonstrated that P1 is the protease responsible for cleaving the PI-HC junction at the Q/(S,

or G). Using the wheat germ in vitro translation system and a series of truncated or

mutagenized cDNAs from TEV, they showed that most of the HC protein and the first 157

amino acids of P1 were not required for proteolysis of the P1-HC junction and that the N-

terminal boundary of the protease domain lies somewhere between 157-188 and 304. The P1

protease is a serine-like protease based on the presence of the conserved active-site triad (His-

215, Asp-225 and Ser-256 for TEV) and the conserved motif (GXSG) found in all aphid-

transmitted potyviruses (Lain, 1990; Verchot, 1991). However, another factor besides P1

might be required since cleavage at this site does not occur in an in vitro rabbit reticulocyte

lysate system (Hiebert et al., 1984b; Carrington et al., 1989a). Alternatively, the absence of

cleavage in the reticulocyte lysate-based system could be due to the presence of a protease

inhibitor (Verchot et al., 1991).












Virus Movement


Natural plant-to-plant spread of the majority of potyviruses is accomplished by aphids, and

four viral proteins, PI, HC/Pro, CI and CP, have been suggested or demonstrated to be

involved in either cell-to-cell movement or plant-to-plant spread. Based on the sequence

similarity of the P1 protein of TVMV to that of 30 kDa movement protein of tobacco mosaic

virus, it has been suggested that the P1 protein may be involved in cell-to-cell movement

(Domier et al.,1987; Lain et al., 1989a; Robaglia et al., 1989). However, sequence identity may

be a poor indicator of function since it is known that cell-to-cell movement proteins of plant

viruses exhibit very little similarity, even among members of the same group (Lain et al., 1989a;

Hull, 1991). The P1 protein of other potyviruses (TEV, PPV, PVY), for example, differed

from that of TVMV. The P1 proteins of the potyviruses are the most variable products of the

genome (Wisler et al., 1995), which suggests that P1, particularly its N-terminal non-proteases

domain, may be involved in some specific virus-host interaction (Hull, 1991). By deletions and

modifications of the P1 coding sequence, Verchot and Carrington recently (1995)

demonstrated that P1 protein of TEV was not involved in the movement.

The HC protein is involved in aphid transmission and must be acquired by the insect in

conjunction with the virus (Pirone & Thornbury, 1983; Thornbury & Pirone, 1983; Hiebert et

al., 1984; Thorbury et al., 1985; Berger & Pirone, 1986). Although the HC protein is closely

related to the protein associated with the amorphous inclusions induced by certain potyviruses

(Hiebert et al., 1984; De Mejia et al., 1985 a, b; Baunoch et al., 1990), functional studies have











suggested that either the inclusion-bound form of this protein has been inactivated or,

alternatively, the HC activity is associated with a modified form of the inclusion protein

(Thombury & Pirone, 1983; Thornbury et al., 1985; Dougherty & Carrington, 1988). The size

of the biologically active HC form is believed to be a dimer, with MWs of 116 kDa for PVY

(Hellmann et al., 1983) and 106 kDa for TVMV (Thombury et al., 1985). The loss of

transmissibility associated with HC deficiency has been correlated with two mutations in the

HC coding sequence of potato virus C (Thombury et al., 1990; Atreya et al., 1992) and the

PAT isolate of ZYMV-PAT (Granier et al., 1993). The long-distance movement of TEV has

been associated with the central region of the HC-Pro by using site-directed mutagenesis of

infectious cDNA and complementary by HC-Pro supplied in trans by a transgenic host (Cronin

et al., 1995).

The CI protein has also been suggested to be involved in cell-to-cell movement on the

basis of electron microscope observations that CIs are associated with plasmodesmata and

virus particles (Lawson & Hearon, 1971; Murant et al., 1971; Langenberg, 1986; Lesemann,

1989; Baunoch et al., 1991).

The coat protein is the most extensively characterized potyviral gene product. The CP

nucleotide sequences of 103 strains of 35 distinct members of the Potyviridae have been

resolved (Shukla et al., 1994; Pappu et al., 1994; Puurand et al., 1994; Husted et al., 1994;

Colinet & Lepoivre, 1994). The interest in CP comes mainly from its usefulness in taxonomic

and evolution studies, in diagnosis, and in the study of CP-mediated resistance. Sequence

comparisons and particle assembly properties suggest the presence of three different regions in











the coat protein molecules of potyviruses: (i) a surface-exposed N-terminus varying in length

and sequence, (ii) a highly conserved core of 215-227 amino acids, and (iii) a surface-exposed

C-terminus of 18-20 amino acids (Shukla and Ward, 1989). Removal of the N- and C-termini

by trypsin digestion leaves a fully assembled virus particle composed of the coat protein core

region, which can not be distinguished by electron microscopy from untreated native infective

particles. Apparently the N- and C-termini are neither required for particle assembly nor for

infectivity during mechanical inoculation (Shukla et al., 1988; Jagadish et al., 1991).

The CP functions to protect the viral RNA, to facilitate its transmission by aphids (Gal-

On et al., 1990; Lecoq & Purcifull, 1992), and to facilitate movement of the virus within plants

(Dolja et al., 1994, 1995). Sequence analyses have shown that a change in the amino acid

triplet DAG, which is conserved in all aphid-transmissible potyviruses (Harrison & Robinson,

1988; Atreya et al., 1991), and other amino acids in the amino-terminus (N-terminus) of the CP

alters aphid transmissibility (Atreya et al., 1990, 1991, 1995; Harrison & Robinson, 1988; Gal-

On et al., 1990; Salomon & Raccah, 1990). A non-aphid transmissible isolate ofZYMV, which

has a defective CP but is capable of producing an active form of HC, has been described

(Antignus et al., 1989; Gal-On et al., 1992). By using mutational analysis, Atreya et al. (1995)

demonstrated that a basic residue (D or N) in the first position, the nonpolar residue A in the

second position, and the small nonpolar residue G in the third position are required for aphid

transmissibility.

The TEV CP has been recently shown to be necessary for cell-to-cell movement and

long-distance transport of the virus in plants (Dolja et al., 1994, 1995). The mutation at the











highly conserved S amino acid residue in the core domain and deletion at the variable C-

terminal region abolished or reduced virus movement within the plants.

In addition to their natural functions, the CP genes of some potyviruses, including

SbMV (Stark & Beachy, 1989), PPV (Reger et al., 1989; Scorza et al), PVY (Kaniewski et al.,

1990), PRSV-P (Ling et al., 1991; Fitch et al., 1992), TEV (Lindbo & Dougherty, 1992),

WMV-2 (Namba et al., 1992), ZYMV (Namba et al., 1992; Fang & Grumet, 1993), TVMV

(Zaccomer et al., 1993), and lettuce mosaic virus (Dianat et al., 1993) have been used

experimentally to obtain genetically engineered plants with CP-mediated resistance. Many of

these transgenic plants showed certain degrees of resistance to viral infection.


Dasheen Mosaic Virus


Dasheen mosaic virus (DsMV) is a species of the Potyviridae which causes serious

diseases of cultivated aroid plants worldwide (Zettler et al., 1978; Shimoyama et al., 1992a, b).

Viruses other than DsMV include konjak mosaic potyvirus ofAmorphophallus (Shimoyama et

al., 1992a, b); tobacco necrosis necrovirus of Dieffenbachia (Paludan & Begtrup, 1982);

cucumber mosaic cucumovirus of Arum (Lovisolo & Conti, 1969), Amorphophallus

(Shimoyama et al., 1990) and Colocasia (Kumuro & Asuyama, 1955); tomato spotted wilt

tospovirus of Zantedeschia (Tompkins & Severin, 1950); and bobone rhabdovirus of

Colocasia (James et al., 1973). DsMV and konjak mosaic virus are considered different on the

basis of biological and serological properties. However, none of these viruses infect as many

aroids nor is as wide spread as DsMV.











The Araceae, or aroid family, comprises about 107 genera and 2,500 species of

monocotyledonous herbs and vines. Most aroid plants occur in tropical Asia and the New

World tropics (Grayum, 1990). Many of them, such as Aglaonema, Arisaema, Caladum,

Dieffenbachia, Epipremnum, Monstera, Philodendron, Pinellia Spathiphyllun, and

Syngonium are important ornamentals, which account for nearly 25% of U.S. production of

foliage plants (U.S. Bureau of Census, 1974). Certain species of Anthurimn, Richardia and

Zantedeschia are valuable cut flower crops, and Cryptocoryne species are commercially grown

aquarium plants. Two genera ofaroids, Colocasia commonly referred as dasheen or taro, and

Xanthosoma, or cocoyam, are important tropical food crops. DsMV was first reported in 1970

in Florida by Zettler et al. (1970), and has since been found elsewhere, including Hawaii

(Buddenhagen et al, 1970; Hartman & Zettler, 1972; Kositratana et al, 1983), Puerto Rico

(Alconero & Zettler, 1971), Trinidad (Kenten & Woods, 1973), India (Hartman, 1974),

Venezuela (Debrot & Ordosgoitti, 1974), Japan (Tooyama, 1975), Egypt (Abo-Nil & Zettler,

1976), Netherlands (Hakkaart & Waterreus, 1976), the Solomon Islands (Gollifer et al. 1977),

Belgium (Samyn & Walvaert, 1977), Papua New Guinea (Shaw et al., 1979), Great Britain

(Hill & Wright, 1980), the Cameroons (Girard et al., 1980), Kiribati (Shanmuganathan, 1980),

French Polynesia (Jackson, 1982), Nigeria (Volin et al., 1981), Italy (Rana et al., 1983), South

Africa (Van der Meer, 1985), Costa Rica (Ramirez, 1985), Australia (Greber & Shaw, 1986),

P. R China (Zettler et al., 1987), Taiwan (Ko et al., 1988) and Cuba (Quintero, 1989).

Although DsMV has been reported to experimentally infect nonaroids such as Chenopodium

awaranticolor, C quinoa C. ambrosioides, Nicotiana benthamiana and Tetragonia expansa











(Gollifer & Brown, 1972; Rana et al., 1983; Kositratana, 1985; Shimoyama et al., 1992a), its

natural host range is restricted to aroid plants, and it has been reported to infect species of 20

genera: Aglaonema, Alocasia, Amorphophallus, Anthri*m, Arisaema Caladiwn, Colocasia,

Cryptocoryne, Cyrtosperma, Dieffenbacha, Monstera, Philodendron Pinellia, Richardia

Scindapsus, Spathiphyllun, Stenospermation, Syngonium, Xanthostna and Zantedeschia

(Zettler et al., 1987; Samyn & Welvaert, 1977; Chen, personal communication).

As noted for other Potyviridae, DsMV has flexuous, filamentous particles about 750

nm long (Zettler et al., 1978; Samyn & Welvaert, 1977; Hill & Wright, 1980; Girard et al.,

1980; Kositratana et al, 1983; Van der Meer, 1985; Greber & Shaw, 1986; Quintero, 1989). It

induces cylindrical inclusions in infected cells (Zettler et al., 1978; Girard et al, 1980;

Shanmuganathan,1980; Paludan & Begtrup, 1982; Greber & Shaw, 1986; Kositratana, 1985;

Ko et al., 1988, Liang et al., 1994), and like other members of this genus, DsMV is sap-

transmissible. DsMV also is transmitted in a non-persistent manner by aphids, namely Myzus

persicae, Aphis craccivora (Morales & Zettler, 1977; Van der Meer, 1985), and Aphis

gossypii (Gollifer et al, 1977), but apparently not by either Pentalonia nigronervosa (Morales

& Zettler, 1977) or Rhopalosiphumpadi (Gollifer et al., 1977).

The genome of DsMV is a single-stranded RNA of MW 3.2-3.42 x 106 (Kositratana,

1985; Shimoyama et al., 1992b). The four nonstructural proteins that have been identified thus

far were HC-Pro (51 kDa), CI (69 kDa), NIa (49 kDa), and NIb (56 kDa) proteins (Nagel &

Hiebert, unpublished). The DsMV CP protein is serologically related to those of araujia

mosaic, BICMV, TEV and ZYMV (Abo El-Nil et al., 1977; Hiebert & Charudattan, 1984;











Kositratana, 1985). The DsMV CI protein is serologically related to that of araujia mosaic

virus (Hiebert & Charudattan, 1984), and the DsMV in vitro synthesized protein is related to

the TVMV HC-Pro protein (Hiebert et al., 1984). The 3'-terminal region and the CP gene of

two Colocasia isolates of DsMV from Florida have been cloned and sequenced (Pappu et al.,

1993, 1994a, b). The predicted CP of isolate DsMV-LA contains 329 amino acids and has an

estimated MW of 36.2 kDa, and the CP of isolate DsMV-TEN contains 314 amino acids and

has a MW of 34.6 kDa. The CP sequence comparisons and phylogenetic reconstructions

indicated that the DsMV is a distinct potyvirus within the passionfruit woodiness virus

subgroup cluster.

Symptoms caused by DsMV in nature may differ considerably according to the aroid

host infected and the season in which the host is grown. In some aroids such as Colocasia,

Richardia Xanthosoma Zantedeschia and certain Dieffenbachia cultivars, DsMV causes leaf

mosaic, leaf mottle, chlorotic streaking along veins on leaves, and leaf distortion. The

inflorescence of Zantedeschia may show color break, with blisters and malformation (Zettler et

al., 1970; Alconero & Zettler, 1971; Hakkaart & Waterreus, 1976; Hill & Wright, 1980;

Paludan & Begtrup, 1982; Van der Meer, 1985; Greber & Shaw, 1986). In other aroids, such

as Aglaonema and Spathiphyllum, DsMV symptoms are usually much less evident. A

characteristic of many aroids is that DsMV symptoms are intermittently expressed, often

making detection difficult. In some instances, such as with Colocasia, Dieffenbachia,

Richardia, symptom expression is seasonal, most often appearing on foliage produced during

fall and/or spring months (Chase & Zettler, 1982; Greber & Shaw; 1986). Some aroid cultivars











more readily express DsMV symptoms than others. The caladium cultivars, 'Candidum' and

'White Christmas', for example, are much more likely to exhibit symptoms throughout the

growing season than the cultivars 'Frieda Hemple' and 'Carolyn Whorton' (Zettler & Hartman,

1986). The virus can cause yield loss of up to 60% in Caladimn, Dieffenbachik Philodendron

and Zantedeschia (Zettler & Hartman, 1987).


Diagnosis and detection of DsMV have been based on techniques of bioassay,

serology, and/or light and electron microscopy. Philodendron selloum seedlings are very

susceptible to infection of DsMV and have been used frequently in bioassays (Zettler et al.,

1970; Paludan & Begtrup, 1982); however, the seed viability of this and other aroids is short,

and the seed are not readily available commercially (Zettler & Hartman, 1987). Since DsMV is

not the only potyvirus which infects aroids (Shimoyama et al., 1992a; Chen, personal

communication), light and electron microscopy can not necessarily be used as reliable evidence

for ascertaining the existence of DsMV (Zettler & Hartman, 1987), nor are these methods

likely to be as sensitive as some others (Greber & Shaw, 1986). Serological methods, such as

immunodiffusion tests, have been used extensively in diagnosis and detection of DsMV, but

this method requires larger quantities of antiserum than techniques such as ELISA (Zettler &

Hartman, 1986). ELISA was also reported to be used for DsMV detection (Rana et al., 1986;

Hu et al., 1995), but either the antiserum used reacted with host proteins or no difference could

be detected among different isolates.

Dasheen mosaic virus has been successfully controlled by tissue culture methods in

some greenhouse grown aroids such as Anthwuium, Dieffenbachia, Philodendron,











Spathiphyllum, Syngonium and Zantedeschia, although the primary purpose of the tissue

culture method for these plants is rapid in vitro propagation (Zettler & Hartman, 1986, Gomez

et al., 1989). Despite these techniques, DsMV still causes problems in some low-cash field-

grown aroids such as Caladium, Colocasia and Xanthosoma, (Zettler et al. 1991).

Dasheen mosaic occurs throughout the world, due to the international distribution of

aroids as food plants and ornamentals and the perpetuation of the virus by propagating plants

vegetatively. Little is known about the evolutionary relationships among DsMV isolates

occurring in different geographic areas and among various hosts. There is evidence for the

occurrence of a severe strain of the virus in Frech Polynesia (Jackson, 1982). Symptomatic and

serological differences were noticed between an Egyptian isolate and a Florida isolate of

DsMV from taro (Abo El-Nil et al., 1976). Symptomatic and serological differences between a

Fiji isolate and a Florida isolate from taro were also noted (Abo El-Nil., 1977). Differences in

growth rate between P. sellout seedlings inoculated with several DsMV isolates were

reported, in which 79.5% and 4% weight reduction for taro and dieffenbachia isolates,

respectively, were reported (Wisler et al., 1978). The DsMV antiserum against a Chinese

evergreen isolate reacted with homologous isolate but not Florida and Fuji isolates in DAS-

ELISA (Kositratana, 198?). Shimoyama et al. (1992a) reported that the DsMV antiserum they

prepared did not react with several other potyvirses, including PVY-T, WMV-2, ZYMV,

BYMV, TuMV, BICMV, SbMV and konjak mosaic viruses. These studies indicated that

distinct DsMV isolates do exist, although the relationships between them remain obscure.











Other studies, in contrast, such as that by Zettler et al. (1987) indicate only slight differences

among DsMV isolates.

As an important group of ornamentals, domestic and international movement of aroids

occurs on a large scale. In addition to commercial bulk shipments of plant materials, there is

considerable movement of small quantities of clonal plant germplasm for purposes of

establishing botanical collections, breeding programs and medicinal plants. In order to avoid the

spread of some aroid diseases, including DsMV, international guidelines for the safe movement

of aroid germplasm have been recommended (Zettler et al., 1989). These guidelines

recommend growing plants in greenhouses and indexing them periodically for at least one crop

cycle before certifying them as being virus-free. Such conditions, if implemented, would impose

severe constraints in the international trade of these plants. Reliable, sensitive, practical, and

rapid means for detecting DsMV could help overcome such problems. A better knowledge of

the characteristics of DsMV, regarding both its general and molecular properties, would

provide the basis needed for improving the detection of DsMV and for understanding the

relationships among different DsMV isolates. The purposes of this study were to (i) purify the

virus for molecular studies of DsMV, (ii) obtain and evaluate antiserum to be used to diagnose

this virus. (iii) develop reliable and effective methods for detecting DsMV in propagating units

of Caadium, Colocasia and Xanthosoma.

An isolate from caladium was purified and its viral RNA used to establish a cDNA

library. The 3-terminal region of this isolate was sequenced and compared to those of other

potyviruses. The CP gene was expressed in Escherichia coli and used to obtain the antiserum









19

that was useful for serological tests. It was determined that the CP of DsMV isolates varied in

size and in nucleotide sequence. Serological procedures such as ELISA and Western blotting

were developed for detecting DsMV. Also reported was the use of RT-PCR for DsMV

detection.














CHAPTER 2
CLONING, SEQUENCING OF THE 3'-TERMINAL REGION
AND EXPRESSION OF THE COAT PROTEIN OF DSMV-Chl


Introduction


As a potyvirus, dasheen mosaic virus (DsMV) shares many properties with other

aphid-borne potyviruses, such as having flexuous, filamentous particles, inducing formation of

cylindrical inclusions (CI) in infected cells, having a positive-sense, single-stranded RNA

genome, being sap- and aphid-transmissible, having a relatively restricted host range, and being

serologically related to many other potyviruses (Zettler et al., 1978; Li et al., 1992). The RNA

of a Florida DsMV isolate from taro (Colocasia esculenta) has been translated in the rabbit

reticulocyte lysate in vitro system (Nagel & Hiebert, unpublished) to give five major

polypeptides, namely the HC-Pro, CI, NIa, NIb and CP proteins. The molecular weight of the

genomic RNA was estimated to be 3.2 x 106 for a California isolate from Chinese evergreen

(Kositratana, 1985), and 3.42 x 106 for a Japanese DsMV isolate from taro (Shimoyama et al.,

1992). The coat protein (CP) and the 3' non-coding region (3'-NCR) of two DsMV taro

isolates, LA and TEN, have been sequenced recently (Pappu et al., 1994b). However, the

characteristics of the DsMV genome organization and the sequences of other genes have not

been studied. Furthermore, understanding the molecular characteristics of DsMV will help to

define the virus and improve prospects fot its diagnosis and detection for the purposes of

establishing practical quarantine regulations and facilitating the production of virus-free plants











through micropropagation. The only source ofDsMV antiserum was that provided by Abo El-

Nil et al. (1977), but this supply is nearly exhausted. DsMV isolates also cross reacted with

PTY 1 monoclonal antibody, which is commercially available through Agdia Inc. (Elkhart, IN).

However, since this and other monoclonal antisera may not react with some potyviruses or

some potyviral isolates thereof (Jordan, 1992), there is an inherent risk of not detecting certain

viruses or viral isolates lacking the epitopes common to most other potyviruses. In this study,

the 3'-terminal region 3158 nucleotides of a DsMV caladium isolate was cloned, sequenced

and analyzed. The DsMV CP was expressed in Escherichia coli and used to produce

polyclonal antiserum for DsMV diagnosis and detection.


Materials and Methods


Virus Isolates


A 'Candidum' caladium plant infected with an isolate of DsMV was maintained in a

greenhouse and used to inoculate P. selloum seedling plants at the 7-8 leaf stage with an

artist's airbrush gun. Source tissue was triturated in a mortar and pestle with 0.05 M potassium

phosphate buffer (w/v, 1:20), pH 7.2, containing 600 mesh carborundum. The supernatant was

added to a glass bottle, which was connected with a portable carbon dioxide tank, and was

propelled onto the first two newly expanded leaves of P. selloum seedlings using carbon

dioxide at a pressure of 40 pounds per square inch (Gooding & Ross, 1970).











Virus Purification

The ultracentrifugation method used for DsMV purification was similar to that for

ZYMV described by Wisler (1992) with modifications. The leaf or root tissues of infected

caladium, calla lily, cocoyam, taro or Philodendron selloum seedlings were homogenized in a

cooled Waring blender for 1 min with 3 volumes of 0.3 M potassium phosphate buffer, pH 8.2,

to which 0.6% sodium diethyldithiocarbamate (DIECA) and 0.2% J-mercaptoethanol (J3-ME)

were added. The homogenate was emulsified with 1:1 (w/v) cold trichlorofluorethane (Freon)

for 30 sec. Following centrifugation at 2,500 g with a Sorvall high speed centrifuge (Du Pont

Co., Wilmington, DE) for 10 min, the aqueous phase was filtered through four layers of cheese

cloth. The suspension was centrifuged at 7,500 g for 10 min. Triton X-100 was added to the

aqueous phase to a final concentration of 1%. The mixture was stirred for 20 min at 40C. The

mixture was then centrifuged in a Beckman Ti 70 rotor (Beckman Instruments, Inc., Palo Alto,

CA) at 100,000 g (37k rpm) for 90 min. The pellet was resuspended in 20 mM HEPES, pH

8.2, containing 10 mM EDTA and 0.1% P-ME, with a tissue homogenizer. After stirring for

one hour at 4C, the suspension was partially clarified by centrifugation at 2,000 g for 10 min.

The supernatant was layered on the top of Beckman SW41 tubes containing a Cs2SO4 solution

(11.6 g salt plus 27 ml of 20 mM HEPES, pH 8.2), 5 ml per tube. The tubes were centrifuged

at 140,000 g (32k rpm) for 16-18 hr at 4oC. The two opalescent virus zones 24-26 mm from

the bottom of the tube were collected by droplet fractionation. The collected fractions

containing the virions were combined and diluted with 1 volume of 20 mM HEPES, pH 8.2,

and centrifuged at 10,000 g for 10 min. The virus was precipitated from the supernatant by











adding polyethylene glycol (PEG, MW 8,000) to a concentration of 6% (w/v), stirring at 4C

for 30 min, and then centrifuging at 10,000 g as before. The pellet was resuspended in 0.5 ml

of 20 mM HEPES, pH 8.2. Concentrations of the virus preparations were estimated by

spectrophotometry using an approximate extinction coefficient of A2w 2.6 (1 mg/ml, 1 cm light

path). Five pl of a 1:20 dilution of the virus preparation was mixed with an equal volume of

Laemmli dissociating solution (Laemmli, 1970), boiled for 2 min and analyzed by sodium

dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Gels were stained with

Coomassie Brilliant Blue R-250 (Gibco BRL, Gaithersburg MD), and destined in a solution

containing 1% acetic acid and 10% methanol for visualization. The virus preparations were

stored at -800C, and then used for RNA isolation.


Viral RNA Isolation


Viral RNA was isolated from purified virus preparations by two methods, sucrose

gradient centrilfgation and phenol/ chloroform extraction.

A purified virus preparation (5 mg) was dissociated by incubation in an equal volume

of RNA dissociating solution (0.2 M Tris-HCl, pH 9.0, containing 2 mM EDTA, and 2%

SDS) and 400 pg/ml ofprotease K for 10 min at room temperature. Linear-log sucrose density

gradients were made as described (Brakke and Van Pelt, 1970). The gradients were allowed to

diffuse overnight at 4C. A volume equal to that of the samples was removed from each

gradient before loading the samples. The gradients were centrifuged at 185,000 g (39k rpm)

for 5 hr at 150C with a Beckman SW41 rotor. Gradient zones containing RNA were collected











using an ISCO UV fractionator (ISCO, Inc., Lincoln, NE). The RNA was precipitated

overnight at -200C by adding 1/20 volume of 3 M sodium acetate (pH 5.2), and 3 volumes of

100% cold ethanol. After centrifugation at 10,000 g for 10 min, the pellet was rinsed with 70%

ethanol and vacuum-dried. The RNA was then resuspended in a small volume of sterile water

and stored at -800C.

The viral RNA was also extracted from incubated virus preparations by adding an

equal volume of phenol/chloroform (1:1) to the mixture, inverting gently and centrifuging at

12,000 g in an Eppendorf microcentrifuge for 5 min. The phenol fraction was removed by

adding an equal volume of chloroform, and centrifuging. The RNA was then precipitated with

3 volumes of 100/o ethanol in the presence of 0.3 M sodium acetate (pH 5.2) at -20C

overnight. After centrifugation, the RNA was resuspended in sterile water and stored at -800C.


Synthesis ofcDNAs


Two types of cDNAs were synthesized, one with oligo(dT)12.1g primers and the other

with random hexamers. Freshly prepared viral RNA was used for cloning, with 5 Pg RNA

being used as templates for the first strand synthesis. The first and second strand cDNAs were

synthesized using a TimeSaver" cDNA synthesis Kit (Pharmacia Biotech., Inc., Piscataway,

NJ) following the manufacturer's instructions. The first-stranded cDNA synthesis was labeled

with 1 l (10 pCi -32P-dCTP) (3000 Ci/mmol) (Du Pont NEN, Boston, MA) and used as a

tracer. After the double-stranded cDNA synthesis, the sample was extracted with phenol-











chloroform and purified by passing through a Sepharose CL-4B column. The next step

involved ligation ofEcoRINotI linkers to cDNAs.

In vitro packaging of the XDNA was performed using the Packagene Lambda DNA

Packaging System under the conditions recommended by the manufacturer (Promega Co.,

Madison, WI). The phage titer was determined by plating small aliquots of the packaging

extract on XL1-Blue cells.

Size analysis of cDNA was performed on a 0.9% gel. The gel was exposed to X-ray

film and compared to a 1-kb ladder molecular weight standard (Gibco BRL).


Immunoscreening ofDsMV-Chl Phage Clones


Immunoscreening for clones expressing CP or CI genes of the DsMV genome was

conducted essentially according to manufacturer's instructions as described in the PicoBlue"

Immunoscreening Kit and Predigested Lambda ZAP I/EcoRI/CIAP Cloning Kit (Stratagene,

La Jolla, CA). The titered bacteriophage library (500 pfu/plate) was used to inoculate 200 pl of

freshly prepared XL1-Blue ofE coli competent cells (OD6oo= 0.5), and incubated at 370C for

15 min. The mixture was added to 3 ml of NZY top agar (0.5% NaCl, 0.2% MgS4. 7H20,

0.5% yeast extract, 1% casein hydrolysate, and 0.8% agar) containing 500 pg/ml X-

galactoside and 10 mM isopropyl-B-D-thiogalactopyranoside (IPTG), which was poured onto

a NZY plate (80 mm x 80 mm) and incubated at 370C for 5-6 hr to allow for formation of

plaques (0.5 mm in diameter). The plates were chilled at 4C for 2 hr in order to prevent the

top agar from sticking to the nitrocellulose membranes. The plates were dried in a hood for 15











min, and sterile nitrocellulose membranes soaked in 10 mM IPTG were carefully layered upon

them. The plates were incubated at 420C for an additional 4-5 hr to allow expression of the

cloned gene(s). IPTG is a gratuitous inducer used to induce the expression of the B-

galactosidase fusion protein, and %ZAP II phage is a temperature-sensitive mutant (Pharmacia

Biotech.). The membranes were lifted, rinsed three times for 10 min each in TBST solution,

and processed as described in western blot analysis in chapter 4. DsMV-FL antiserum (1:1000)

and DsMV-FL CI antiserum (1:1000) were employed as primary antibodies. Positive plaques

were isolated with a sterile glass pipette and placed in 50 pl of SM buffer (100 mM NaCI, 50

mM Tris-HCl, pH 7.5, 10 mM MgCI2) containing 3 drops of chloroform. The tubes were

vortexed and incubated at room temperature for 2 hr to allow the phages to diffuse into the

solution. Forty pl aliquots of the phage clones were added to 200 pl of the XL1-Blue cells

(OD6o= 0.5), absorbed at 370C for 15 min, and amplified at 37TC in a shaker overnight in 5 ml

of2X YT with 0.2% maltose and 10 mM MgCI2. The cultures were centrifuged at 2,000 g for

10 min to remove the cell debris. Supernatants containing phages were stored at 40C with

addition of chloroform to a final concentration of 5%.


In Vivo Excision ofDsMV-Chl Plasmids from The XZAP II Vector


The plasmid clones were excised from the XZAP II vector according to the

manufacturer's instructions using a Predigested XZAP I/EcoRI/CIAP Cloning Kit

(Stratagene) with the following modification except that amplified phage clones (200 ul) were

used to start the excision. After excision, plasmids (pDCPn or pDCIn) were transformed into











SOLR of E coli cells, and plated on LB/AMP plates (0.5% NaCI, 1.0% tryptone, 0.5% yeast

extract, 1.5% agar, and 500 pg/ml). Single colonies were picked up, amplified and used for

clone analysis.


Analysis ofDsMV-Chl Clones:


Plasmids were purified according to a mini-prep procedure described by QIAGEN Inc.

(Chatsworth, CA). Up to 1.5 ml of cell culture was collected by centrifugation in a

microcentrifuge at 12,000 g for 1 min at 40C. The supernatant was discarded, and the pellet

was resuspended in 320 Wl of P1 buffer (50 mM Tris-HC1, pH 8.0, 10 mM EDTA, RNase A

100Ig/ml). After incubation at room temperature for 5 min, 320 pl ofP2 (200 mM NaOH, 1%

SDS) was added and the tube was mixed gently by inversion. After adding 320 pl ofP3 buffer

(3 M potassium acetate, pH 5.5), the tube was centrifuged at 12,000 g for 5 min. The aqueous

phase was transferred to a fresh tube and 1 volume of 100% isopropanol was added. The

mixture was then centrifuged at 12,000 g for 5 min. The pellet was resuspended in 25 pl of

sterile water, and then screened by EcoRI (Promega) digestion for clone with a single insert to

be used for sequence analysis.


DNA Sequencing ofDsMV-Chl Clones


The plasmid preparations were sequenced by the dideoxy chain termination procedure

using the Sequenase Version 2.0 DNA Sequencing Kit (United States Biochemical, Cleveland,

OH) with ca-35S-dATP. T7 and T3 primers complementary to the pBlueScript vector and











synthesized internal primers were used to complete the sequence determination for either two

clones or both strands of the same clone. Sequencing products were performed in a 6% (w/v)

polyacrylamide gel containing 7 M urea. Autoradiographs of air-dried sequencing gels were

made using XAR x-ray film (Eastman Kodak, Rochester, NY).


Pairwise Comparison and Phylogenetic Analysis


Sequence analysis and comparisons were made using the University of Wisconsin

Genetics Computer Group (GCG) Sequence Software package version 7.0 (Devereux et al.,

1984) available at the University of Florida ICBR Biological Computing Facility. The

sequences of the 3' non-coding region, CP, and NIb proteins of DsMV isolates were compared

to 14 other potyviruses. The sequences of 14 other potyviruses and DsMV-LA were obtained

by Farfetch from GeneBank, and the sequences were aligned using the Pileup method of

aligning multiple sequences in the GCG program.

Phylogenetic analyses were done by a cladistic parsimony method using the computer

program PAUP version 3.1.1 developed by D. L. Swoford (distributed by the Illinois Natural

History Survey, Champaign, Ill). Optimum trees were obtained with the heuristic method with

the tree-bisection-reconnected branch-swapping option or exhaustive method. One hundred

bootstrap replications were performed to establish confidence estimates on groups contained in

the most parsimonious tree.











Aphid Transmission


Three caladium isolates (Chl, Ch2 and Ch3) were tested for aphid transmission. The

aphids (Myzuspersicae), maintained on pepper (Capsicwn amnuum), were starved for two hr

and then placed on infected leaves for 30-40 sec. The aphids were then moved to P. sellomw

seedlings used as test plants. Each trial consisted of 6 test plants and each test plant received 10

aphids. After 15 min the aphids were killed. The plants were maintained in a greenhouse, and

two weeks later, were observed for symptom expression. Visual observations were confirmed

by I-ELISA test using DsMV-FL antiserum.


Subcloning and Expression of the DsMV Coat Protein and NIb protein


Based on the CP nucleotide sequence of DsMV-Chl, two primers, namely EH232 (5'-

AAGCTTGCAGGCTGATGATACAG-3') corresponding to the 5'-end of the CP gene and

EH234 (5'-GAATTCTTGAACACCGTGCAC-3') corresponding to the 3'-end of the non-

coding region, were synthesized at the University of Florida DNA Synthesis Core. A Hindm l

or EcoRI restriction site was included at the 5'-end of each primer for directional cloning of the

CP gene into an expression pETh-3 vector (McCarty et al., 1991) at HindIII and EcoRI on the

polylinker.

The intact CP gene (942 nt) was amplified by PCR as described in chapter 4. The DNA

fragment was purified from a 0.9% agarose gel by using Prep-A-Gene Master Kit (Bio-Rad )

according to manufacturer's instructions. The purified DNA was then cloned into a PCR

vector pGEM T vector (Promega) to generate pGEM-T-CP according to the manufacturer's











instructions. The plasmid pGEM-T-CP was digested by HindIt I and EcoRI (Promega) and

subcloned into HindIIIEcoRI double-digested pETh-3 to generate pETh-3-CP. The

nucleotide sequence of the vector/insert junction was confirmed by DNA sequencing using the

Sequenase Version 2.0 DNA Sequencing Kit (US Biochemical).

A single colony culture (5 ml) of E. coli BL21DE3pLysS, transformed with pETh-3-

CP, was grown overnight at 370C in LB containing 50 igg/ml ampicillin and 25 pg/ml

chloramphenicol. The overnight culture was diluted 1:100 into 5 ml or 250 ml (large scale) of

M9 medium (Sambrook et al., 1989) containing 50 pig/ml ampicillin, 25 Ig/ml

chloramphenicol, 0.4% glucose and 0.5% tryptone, and the culture was shaken at 370C until

early log phase (OD600 = 0.6). Then IPTG was added to a final concentration of 1 mM, and

growth was continued for an additional 4 hr at 370C. E. coli BL21DE3pLysS cells were

harvested by centrifugation at 5,000 g, the culture broth was discarded, and the cell pellet was

resuspended in one tenth of the original volume of TE buffer (10 mM Tris-HCI, pH 8.0, 1 mM

EDTA) and frozen overnight at -200C. The viscous cell suspension was thawed, sonicated for

30 sec and the lysate was then centrifuged at 10,000 g for 10 min. The pellet was resuspended

in a small volume of TE buffer. The preparations were then analyzed by SDS-PAGE. Both

noninduced pETh-3-CP and pETh-3 cultures were tested as controls.

The same approach used for the DsMV CP expression was applied to express the NIb

polymerase in E. coli. Three pairs of synthesized primers were used for PCR amplification of

either the intact or truncated NIb gene or a fragment containing the C-terminal region of the

NIa and the NIb gene: EH239 (5'-GAATTCATGCAAAGTGGGTGGGTGA-3')











corresponding to the 5'-end of the NIb gene and EH238 (5'-

AGATCTCTACTGCAACACAACCTC-3') corresponding to the 3'-end of the NIb gene,

primers EH256 (5'-AAGCTTGCAGCGAGATGATGA-3') corresponding to a sequence in

the NIb gene and EH238, primers EH267 (5'-GGGATTGGAATAGGCT-3') corresponding

to a sequence in the 5'-terminal region of the NIa gene and EH238.


Antigen Preparation and Antibody Production


After sonication, the fusion protein expressed by E. coli was partially purified by three

cycles of centrifugation at 10,000 g, washing each pellet with TE buffer, and separating the

proteins by preparative SDS-PAGE. Protein bands were visualized by incubating gels in 0.2 M

KCI for 10 min at 40C. The targeted protein band was excised, washed three times in cold

deionized water, and frozen at -200C. The cut pieces of the gel were then eluted using a Bio-

Rad Electoelutor at 10 mAmp/tube with constant current for 5 hr. The extracts containing the

protein were collected and dialyzed overnight against distilled water at room temperature.

Purity of the eluted protein was checked by analytical SDS-PAGE, after which the protein was

lyophilized.

Immunization was conducted as described by Purcifull and Batchelor (1977). A quarter

ml of purified protein (1 mg) at 4 mg/ml was emulsified with an equal volume of complete

Freund's adjuvant and injected into the thigh muscles of a New Zealand white rabbit (No.

1210). This was followed by two 1.0 mg injections of the CP protein emulsified with

incomplete Freund's adjuvant two or three weeks later. Blood was collected weekly for two











months, starting two weeks after the third injection. After a four week interval, a booster

injection was given, followed by subsequent bleeding.


Serological Evaluation ofAntiserum


The antiserum obtained was tested by SDS-immunodiffusion, I-ELISA and Western

blotting analysis. The SDS-immunodiffusion tests were conducted using crude extracts as

described by Purcifull and Batchelor (1977). The immunodiffusion medium consisted of 0.5%

Noble agar, 1% sodium azide and 0.5% SDS. About 12 ml of the thoroughly mixed agar

suspension was poured into a disposable plastic petri dish (90 mm x 15 mm). A set of wells

consisting of six peripheral antigen wells surrounding a central antiserum well with an interval

of 5 mm from the edges of one another were made with a gel cutter. Samples were prepared by

grinding plant tissues in 1% SDS solution (final concentration) with a mortar and pestle. After

addition of the antigens and antisera, the double radial diffusion plates were incubated at 250C.

Results were recorded after 24 hr and 48 hr. The DsMV-FL antiserum was used as a control.

Both I-ELISA and Western blotting using the DsMV-FL antiserum and the expressed DsMV

CP antiserum were conducted using procedures described in Chapter 4.


Results


Purification ofDsMV-Ch and Isolation of Viral RNA


The DsMV virions were only purified from the first two newly formed leaves after

inoculation of P. sellowu seedlings grown in relatively cool weather conditions during the











spring. The Aad/Aaso ratio of the final purified virus preparations obtained by 2 mM HEPES

buffer in 2 trials ranged from 1.11 to 1.20, with an average of 1.16. The estimated virus yields

were 4-8 mg/100g leaf tissue. SDS-PAGE analysis showed that the amount of virus obtained

by ultracentrifugation was slightly higher than that obtained by PEG precipitation (Fig. 2-1A).

The leaf tissues had higher concentrations of the virus than the root tissue (Fig. 2-1B).

Although many DsMV particles were seen in the leaf dip preparations, the virus could not be

purified from infected leaves of caladium, calla lily, cocoyam, and taro, presumably due to the

presence of viscous host components, probably polysaccharides.

Although cesium chloride was used in the purification of DsMV in previous research

(Abo El-Nil et al., 1977; Kositratana, 1985; Shimoyama et al., 1992), DsMV was degraded in

cesium chloride gradients made in 20 mM HEPES, pH 8.0, containing 10 mM EDTA and

0.1% P-ME. Electron microscopic examination of the virus preparations revealed numerous

fragments of virus particles. It was presumed, therefore, that degradation of virus particles

resulted from cesium chloride. In cesium sulfate gradients, however, two opalescent virus

bands were formed, and the bottom band contained more virions than the top band based on

the SDS-PAGE result (Fig. 2-1B). Furthermore, the virions from the bottom band collected

from the cesium sulfate gradients were less degraded than those noted in cesium chloride

gradients based on electron microscopy (Fig. 2-2).

Viral RNA was readily extracted in phenol/chloroform, and the procedure required a

minimum of time to process, thereby reducing the chance of degradation. The yield of viral

RNA extracted by phenol/chloroform was 14.5 pg, which was much higher than that by

















1 2 3


1 2 3


66K

45K N
35K U


i] -


"aCP


A


B


Fig. 2-1. Analysis of partially purified and purified DsMV-Chl preparations. A. The
partially purified preparations. Lane 1, protein standards: bovine serum albumin (66 kDa),
egg albumin (45 kDa), pepsin (35 kDa); lane 2, the purified preparation using the
ultracentrifugation method; lane 3, the purified preparation using PEG precipitation. B.
The purified preparations. Lane 1, the viral preparation collected from the top band of the
Cs2SO4 gradient; lane 2, the viral preparation collected from bottom band of the Cs2SO4
gradient; lane 3, the preparation from root tissues of P. selloum seedlings. The virus was
purified from inoculated P. selloum seedlings as procedures described in the text. Protein
samples were analyzed by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis
followed by Coomassie staining. The coat protein of the purified DsMV-Chl is indicated by
the arrow.


_


" :i;f;i':









35












_% .


















Fig. 2-2. Electron micrograph of a purified DsMV-Chl preparation negatively stained
with 2% uranyl acetate. The virus was purified from inoculated P. selloum seedlings by
ultracentafugation purification method described in text. Bar = 500 nm.











sucrose gradient (5.28 pg), and the resulting RNA was much more intact in agarose gel (Fig.

2-3).


Molecular Analysis ofcDNA Clones


After serological screening with DsMV-FL virion antiserum, 16 clones expressing the

CP (pDCP) were selected and screened by EcoRI and NotI digestions. Twelve pDCP clones

with a single insert were selected for direct sequence mapping (Table 2-1). The sizes of the

inserts in these clones ranged from 1.1-5.2 kb. The reaction of DsMV-FL CI antiserum was

nonspecific, and 22 white clones (pDCI) were randomly selected for EcoRI and NotI digestion

screening and sequence mapping. Among these clones, eight had correct inserts, which ranged

from 0.9 to 2.7 kb (Table 2-2). These cDNA clones with overlapping inserts covered all but the

1.2 kb central region and the upstream 5'-terminal region of the DsMV-Chl genome, based on

comparisons with the published sequence of SbMV (Jayaram et al., 1992) (Fig. 2-4). Twelve

clones with insert sizes ranging from 1.1 to 3.4 kb were selected for sequence analysis (Fig. 2-

5).


Sequences Representing the 3'-terminal region ofDsMV-Chl


The nucleotide sequence of 3158 bases (excluding the poly(A) tail) corresponding to

the 3'-terminal region of DsMV RNA was determined (Fig. 2-6). The nucleotide positions

were confirmed by analyzing either both strands of the same clones or individual strands of

different clones. Stretches of 20-40 adenosine residues were found at the ends of two clones















1 2


1OKb NO!


Fig. 2-3. Agarose gel electrophoresis ofDsMV-Chl RNA isolated from purified virions:
Lane 1, viral RNA isolated by phenol/chloroform extraction; lane 2, viral RNA isolated by
sucrose gradient. The viral RNA was loaded onto a 0.9% agarose gel. The separated RNA
was stained by ethidium bromide and visualized under UV light.















Table 2-1. DsMV-Chl cDNA clones identified
by immunoscreening' and preliminary sequencing2


Clone
designation

pDCP1

pDCP2

pDCP3

pDCP5

pDCP6

pDCP7

pDCP8

pDCP10

pDCP11

pDCP12

pDCP14

pDCP15

pDCP16


Approximate
size (kbp)

2.0

5.2

4.2

1.1

2.8

1.4

2.5

2.1

2.5

2.9

1.9

2.2

1.2


ScDNA library in XZAP II vectors was plaque screened by DsMV- FL
antiserum. White plaques expressing the CP were selected.
2 The selected clones were confirmed by EcoRI digestion, and the clones
with a single insert were selected. The positive clones were sequenced by
vector primers, T3 and T7, and results were mapped to relative positions
in the RNA genome compared to a published nucleotide sequence of
SbMV by a Gap program of the GCG program package.
3 Reactive with DsMV-FL antiserum.


Serological
reactivity3

CP

CP

CP

CP

CP

CP

CP

CP

CP

CP

CP

CP

CP
















Table 2-2. DsMV-Chl cDNA clones identified by preliminary sequencing'


Clone
designation

pDCI2


pDCI4

pDCI7

pDCI18

pDCI19

pDCI21

pDCI22


Approximate
size (kbp)

1.8


1.3

0.9

1.5

2.7

1.8

1.6


HC-Pro, CI

HC-Pro

NIb

HC-Pro, CI

P1, P2

P1, P2


cDNA library in XZAP H vectors was plaque screened by DsMV-FL
CI antiserum. White clones were selected. The selected clones were
confirmed by EcoRI digestion, and the clones with a single insert were
selected.
2 The positive clones were sequenced by vector primers, T3 and T7, and
the results were mapped to relative positions in the RNA genome
compared to a published SbMV nucleotide sequence by a Gap program
of the GCG program package.


Relative
position2

NIb, CP

























iii

a2


I-I
H


zC 0
) 3 a)









Z 04
0 En
0 C4
fi a






QH 0 0


0U
ma



0 ,Q
a 0
(0 4)

0 )3
Z0 (0






H 04 5
4 rE-4 0
004

040 -

H) -H (




1-1 4J O-




fo ^ (0 -


















>1 0 (dr4
> ()C 4 )
0 300

4 1H ) (0
u I4-I .U (

0 Iv 4 0 0
kH 0- II
[4- 1 qf
CL AU -U


Q 04




0 40 *H en 0
A t ,O -









,44 0 0I
4 4 H
oo -, a c




I I A I ^ 0
H a0
fe O Q *(U

|to *y -HO




H 0 0 0
0 U co (U1AO0)









II


( 0 ma
( a o <0 oE(
A (Q 0 .
I0- OO 0


J) ro a) a
I O II
(0 C ( II
O T II
(O (U
IHO C


I n 0 0
0~ a *
*0 E 0)
a ir* E
in ~- 4 d k





























Fig. 2-6. Nucleotide sequence of the 3'-terminal region of DsMV-Chl. The predicted amino
acid sequence of the open reading frame coding for the putative polyprotein is shown.
Underlined amino acids correspond to the NIa protease activity site (between residues 31 and
34), to the polymerase active motif (between 451 and 495), and aphid transmission motif
(amino acids 662-664). Amino acids underlined with dotted lines and slashes (/) correspond to
the putative polyprotein cleavage sites.















1 CAAAGAGAGAGGAGCGCGTATGCATGGTTGGCACGAATTTCCAAGATAAAAGCATGCGCG 60
KRE E R V C M V G T N FQ DK S MRA

61 CTACGATCTCGGAAGCATCTCTCATTCTACCAGAAGGGCAGGGAACATTCTGGAAACATT 120
TI S E A S LI L P E G Q G T F W K H W

121 GGATTTCAACTAAGGATGGGGAGTGTGGGATCCCATGGTGGCTGTGAGTGATGGATATA 180
I S T K D G E C G I P M V A V S D G Y I

181 TAGTTGGTTTCCATGGCCTTGGCTCAAACATATCTGAGAGGAACTATTTTGTCCCTTTCA 240
VG FH G L G S N IS E RN Y F V P F T

241 CTGACGACTTCGAGCAAACACATCTTAAAAGGCTCGATAGTCTTGAATGGACCCAGCATT 300
D D F E Q T H L K R L D S L E W T Q H W

301 GGCACTTTCAGCCTGACAAGATAGCTTGGGGTTCACTCAGACTAGTTAATGACCAACCTA 360
H FQ PD K I A W G S L R L V N DQ P T

361 CTGAAGATTTTAAGATTTCAAAGTTAATTTCAGACCTTTTCGAAAATCCTGTACAATTAC 420
E D F K I S K L I S D L F E N P V Q L Q/

421 AAGGGTCTCAAAGTGGGTGGGTGATTAATACTGCCGAAGGGAATCTAAAAGCTGTTGCCC 480
G SQ S G W V I N T A E G N L K A V A R

481 GGTGTGAAAGTGCACTCGTGACAAAACATACAGTGAAGGGACCGTGCAGATACTTCTCAG 540
CE S A L V T K H T V K G PC RY F SE

541 AGTACTTGAGTTCAAACCAGGAAGCTGAAAAGTTTTTCAGACCATTCATGGGAGCTTATC 600
YLS S N Q E A E K F F R P F M G A Y R

601 GCTCAAGTAGACTTAACAGGGAAGCTTTCAAGAAAGACTTCTTTAAGTATGCAAAGCCTG 660
SS R L N R E A F K K D F F K Y A K P V

661 TTGAGTTGAATAAAGTTGATTTCAATGCCTTCCAGATTGCAGTGGCAAGTGTGGAGACAA 720
E L N K V D F N A F Q I A V A S V E T M

721 TGATGATGGAAACAGGATTTAGCGAATGTGAGTATACACAGACGCTCAAACAATCATTG 780
M M E T G FS E CE Y IT D A Q T I I D

781 ACTCCCTCAATATGAAAGCAGCTGTGGGGGCTCAATATCGTGGGAAGAAGTCTGAGTACT 840
S L N M K A A V G A Q Y RG KK S EY F

841 TCCACGATATGGAGGTCTACGATATGGAACGACTCCTCTTCCAAAGTTGTGAAAGACTAT 900
H D M E V Y D M E R L L FQ SC E RL F

901 TCTATGGGAAGAAGGGAGTCTGGAATGGCTCATTAAAGGCAGAGTTGCGTCCAATTGAGA 960
YGK K G V W N G S L K A E L R P I E K

961 AAACGCAACTCAATAAAACAAGGACATTTACTGCCGCTCCTCTTGACACATTGTTAGGAG 1020
TQ LN KT RT F T A A P L DT L L G A

1021 CGAAGGCTTGTGTGGATGACTTTAACAACCAATTCTATAGTCTCAACCTAAAGTGTCCAT 1080
K A C V D D F N N Q F Y S L N L K C P W

Fig. 2-6-continued











44



1081 GGACAGTTGGTATGACCAAATTTTATAAAGGTTGGGATTCATTGATGAGAAAGCTTCCAG 1140
T V G M T K F Y K G W D S L M R K L P E

1141 AAGGATGGGTCTACTGCCACGCTGATGGGTCTCAGTTTGACTCATCATTAACACCACTCC 1200
G W V Y C H A D G S Q F D S S LT PLL

1201 TCATAAACGCGGTCGTGGACATCAGGAAGTTTTTCATGGAGGAGTGGTGGGTTGGTGAAG 1260
IN A V V D I R K F F M E E W W V G E E

1261 AAATGCTTGACAACTTGTATGCTGAAATTGTCTACACACCTATATTGACCCCAGATGGAA 1320
M L D N L Y A E I V Y T P I LT P D G T

1321 CAATTTTTAAGAAATTTAGGGGCAATAATAGTGGACAACCATCGACAGTCGTGGATAATA 1380
I F K K F R G N N S GQ PS T V V D N T

1381 CATTGATGGTTGTCATTTCAGTTTACTACGCATGTATCAAGCAAGGTTGGACGGATTATG 1440
L M V V I S V Y Y A C I KQ G W T DY D

1441 ATGTTAGTCAAAGAATAGTCTTCTTTGCAAATGGTGATGACATCATATTGGCTGTGCAGC 1500
V S Q R I V F F A N G D D I I L A V Q R

1501 GAGATGATGAACCCATCCTTAATACCTTTCAGGATTCTTTTCACGAATTGGGGCTCAACT 1560
D D E P I L N T F Q D S F H E L G L N Y

1561 ATGATTTCTCTGAGCGCACGATGAAGAGAGAGGAACTTTGGTTCATGTCCCATCAAGCTA 1620
D FS E R T M K RE E LW F M S H Q A M

1621 TGAAAGTAGGGATGTTTATATCCCTAAACTAGAGCGAGAGAGAATTGTATCAATTTTAG 1680
K V G D V Y I P K L E R E R I V S I LE

1681 AATGGGATAGAAGCAAAGAAATCATGCACAGAACAGAGGCAATTTGTGCAGCTATGATAG 1740
W D R S K E I M H R T E A I C A A M I E

1741 AAGCATGGGGTTACACTGACCTCTTGCAAGAAATAAGGAAATTCTATCTATGGCTGCTTG 1800
A W G Y T D L L Q E I R K F Y L W L L E

1801 AAAAAGATGAATTTAAGACACTAGCCTCTGAAGGGCGGGCACCATATATTGCTGAAACAG 1860
KD E F K T L A S E G R A P Y I A E T A

1861 CACTCAAGAAGCTATACACAGATGAAAACATAAAGGAGTGCGAGCTTCAGCGTTATCTGG 1920
L K K L Y T D E N I K E C E L Q R Y L D

1921 ATGCTTTCAATTTTGAAATGTTCTGCGAACATGATGAGGTTGTGTTGCAGGCTGATGATA 1980
A F N F E M F C E H D E V V L Q/A D D T

1981 CAGTTGATGCAAGGAAAAACAACAATACTACAAAAACAACTGAAACAAAAACACCTGCAA 2040
VD A R K N N N T T KT T ET KT PAT

2041 CGGGTGGTGGGAACAACCAAACAACAACACGCCACCTGTAGATAACACAACCAACAATA 2100
G G G N N T N N N T P P V D N T TNNN

2101 ATCCTCCACCGCCACCACCGGCGGTTACAAAGGTAACAGAGGTACCCGCCAATAAGCAAG 2160
PP P P P P A V T K V T E V P A N K Q V

Fig. 2-6-continued















2161 TGGTCCCAGCAGCAAGTGAGAAAGGTAAGGAAGTGTGTAAAGATGTTAACGCTGGCACTA 2220
V P A A S E K G K E V V K D V N A G T S

2221 GTGGCACATACTCCGTACCTCGGTTGAATAGAATCACAAACAAAATGAATTTACCTTTAG 2280
G T Y S V P R L N R I T N K M N L P L V

2281 TTAAAGGTAAATGCATTTTAAATTTGAATCATTTAATCGAGTACAAGCCAGAACAGCGTG 2340
K G K C I L N L N H L I E Y K P E Q R D

2341 ACATATTCAATACCAGAGCCACCCACACTCAATTTGAAGTCTGGTACAATGCTGTCAAGA 2400
I F N T R A T H T Q F E V W Y N A V K R

2401 GAGAATACGAGCTTGAGGATGAGCAGATGCACATAGTTATGAATGGTTTTATGGTTTGGT 2460
E Y E L E D E Q M H I V M N G F M V W C

2461 GCATCGATAATGGAACATCACCTGATATCAACGGGGCTTGGGTGATGATGGACGGAAACG 2520
I D N G T S P D I N G A W V M M D G N D

2521 ATCAAATTGAATACCCGTTGAAGCCAATTGTTGAAAATGCAAAACCAACCTTGCGTCAGA 2580
QI EY P L K P I V E N A K PT L RQ I

2581 TAATGCATCACTTTTCTGACGCAGCAGAGGCATACATTGAACTGAGAAACGCAGAGAAAC 2640
M H H FS D A A E A Y I E L R N A E K P

2641 CGTATATGCCTAGATACGGTCTTATTCGCAATTTACGTGATGCAAGTCTCGCCCGGTATG 2700
Y M P R Y G L I R N L R D A S L A R Y A

2701 CTTTTGACTTTTATGAGGTCAATTCTAAAACACCGGTGCGAGCAAGAGAAGCAGTTGCGC 2760
F D F Y E V N S KT P V R A R E A V A Q

2761 AAATGAAGGCGGCTGCACTCTCTAACGTTACCACTAGGTTGTTTGGTTTGGATGGTAACG 2820
M K A A A L S N V T T RL F G L D G N V

2821 TTTCAACTTCAAGCGAGAACACTGAAAGGCACACTGCAAAAGACGTCACACCAAACATGC 2880
ST S S E N T E RH T A K D V T P N M H

2881 ACACTTTACTTGGTGTTTCGTCTCCGCAGTAAAGGTCTGGTAAACAGGGCCGACAGTTAT 2940
T L L G V S S P Q *

2941 TGGCTCGCTGTTTGTAGTTTTATTTATATAAAGTATTGTTTGTATTCAAGTAGTGCTATT 3000

3001 TGGTTATAAACTACAGCGTGGTTTTCCACCGATGTGGAGTTGGCTTTGCACCCTATTATC 3060

3061 TACGTCCTTTATGTATTTGAAAACTACTGAACTACTGCACCTACGTCAGACCGCAAGGCG 3120

3121 ATGGGCGCGGTAGGCGAGACGCTTCGTGCACGGTGTTCA(n) 3159


Fig. 2-6-continued











(pDCP1 and pDCP7), suggesting this end represented the 3' end of the DsMV RNA.

Computer analysis of the sequence revealed a unique large open reading frame (ORF) in the

positive strand (virion sense). No other ORF of significant size was observed in either the plus

or minus strands. The ATG start codon of the single ORF was not identified. However, by

analogy with other potyviruses, it is presumably located near the 5'-terminus of the genome.

The ORF terminated at the first TAA stop codon, which is located at 246 residues upstream of

the 3' end. Nucleotide sequence heterogeneity among different cDNA clones was found to be

about 98-99%.

The putative amino acid sequence includes 140 C-terminal amino acids of the NIa

protease (about 40% of the protein), the NIb protein consisting of 516 amino acids, and the

coat protein consisting of 313 amino acids (Fig. 2-6). The cleavage sites between these three

proteins were identified by comparing them with those of other sequenced potyviruses

(Dougherty et al.; 1988; Shukla et al., 1994). The cleavage site between the NIa and the NIb

proteins was at the amino acid 140-141 position (Q/G), whereas the site between the NIb and

the CP proteins was at the amino acid 656-657 position (Q/A). The conserved cleavage

sequence VXXQ/A(G,S,E) has been found in both sites, which were VQLQ/G between the

NIa and the Nib proteins and VVLQ/A between the Nib and the CP proteins.


Analysis of the NIb Protein


The Nib protein of DsMV contained the consensus sequence motif

SGXXXTXXXNT-(30aa)-GDD. This polymerase motif was found in the DsMV NIb protein











beginning at amino acid residue 451 of the sequence. A second consensus motig YCHADGS,

was present in the NIb protein at amino acid positions 384 to 390. The similarity of the DsMV

NIb protein to those of other potyviruses ranged from 58% to 68% at the nucleotide level

(Table 2-3), and from 72% to 85% at the amino acid level (Table 2-4), respectively. A

phylogenetic tree was obtained from the alignment of putative NIb proteins ofDsMV-Ch and

14 other potyviruses (Fig. 2-7) on the premise that this protein is the most conserved one

among all the potyviruses (Shukla at al., 1994). Though DsMV was distinct from other

potyviruses, it was closely related to ZYMV in the BCMV subgroup. The potyviruses, SbMV

and WMV-2, were clustered together, confirming their close relationship (Shukla et al., 1994).

It is interesting to note that all potyviruses except those in the BCMV subgroup were clustered

together.

The putative amino acid sequence of the NIb protein of DsMV-Chl was used to

prepare a hydrophobicity plot according to the method ofKyte & Doolittle ( 1982) (Fig.2-8).

The N-terminal and C-terminal regions of this protein are hydrophilic, while in the central

region there is an even distribution of hydrophilic and hydrophobic regions. Each of these

regions consists of about 20 amino acids, suggesting the transmembrane property of the NIb

protein.


Analysis of the Coat Protein


The coat protein of DsMV-Chl also showed a relatively high degree of similarity with

those of other potyviruses (Table 2-5). The similarity ranged from 55% to 68% at the















Table 2-3. Percent nucleotide identity of NIb genes
ofDsMV-Chl and 14 other potyviruses
Percent similarity
Virus
2 3 4 5 6 7 8 9 10 11 12 13 14 15

1. DsMV-Chl 68 67 67 67 66 58 59 59 58 59 58 59 59 58

2. BCMV 60 72 73 70 60 59 58 58 59 59 59 59 61

3. SbMV 70 80 69 58 59 56 61 58 58 59 60 61

4. PStV 71 68 58 59 56 56 60 59 57 59 60

5. WMV-2 70 58 60 59 57 60 58 59 60 61

6. ZYMV 59 57 59 56 59 58 59 60 60

7. PVY-N 59 59 59 60 62 61 58 60

8. TEV 60 58 63 61 58 59 61

9. PSbMV 61 61 60 64 59 61

10. PRSV-P 59 60 60 59 62

11. TuMV 60 61 61 65

12. TVMV 60 60 62

13. SCMV 55 61

14. BYMV 61

15. PPV

i Name and abbreviations of the viruses used in table: BCMV, bean common
mosaic virus; BYMV, bean yellow mosaic virus; DsMV-Chl, dasheen mosaic virus
Chl isolate; PPV, plum pox virus; PSbMV, pea seed-borne mosaic virus; PRSV-P,
papaya ringspot virus type P; PSbMV, pea seed-borne mosaic virus; PStV, peanut
stripe virus; PVY-N, the N strain of potato virus Y; SbMV, soybean mosaic virus;
SCMV, sugarcane mosaic virus; TEV, tobacco etch virus; TuMV, turnip mosaic
virus; TVMV, tobacco vein mottling virus; WMV-2, watermelon mosaic virus 2;
ZYMV, zucchini yellow mosaic virus.
2 Percent similarity of Nib genes among the DsMV-Chl and other potyviruses was
obtained by Pileup in the GCG program package.















Table 2-4. Percent similarity of the NIb protein, the coat protein and
the 3' non-coding region (3'-NCR) ofDsMV-Chl and 14 other potyviruses


Percent similarity2
Virus1 NIb CP 3'-NCR

DsMV-Chl 92 79
BCMV 85 82 36
SbMV 84 82 39
PStV 83 77 38
WMV-2 84 80 35
ZYMV 83 80 34
PVY-N 73 79 35
TEV 75 74 39
PSbMV 74 72 34
PRSV-P 73 72 34
TuMV 75 73 36
TVMV 72 69 33
SCMV 74 68 35
BYMV 76 70 36
PPV 74 66 34

1 Name and abbreviations of the viruses used in table: BCMV, bean common mosaic
virus; BYMV, bean yellow mosaic virus; DsMV-Chl, dasheen mosaic virus Chl
isolate; PPV, plum pox virus; PSbMV, pea seed-borne mosaic virus; PRSV-P,
papaya ringspot virus type P; PSbMV, pea seed-borne mosaic virus; PStV, peanut
stripe virus; PVY-N, N strain of potato virus Y; SbMV, soybean mosaic virus;
SCMV, sugarcane mosaic virus; TEV, tobacco etch virus; TuMV, turnip mosaic
virus; TVMV, tobacco vein mottling virus; WMV-2, watermelon mosaic virus 2;
ZYMV, zucchini yellow mosaic virus.
2 Percent similarity of the NIb, the CP and the 3'-NCR between the DsMV-Chl
and other potyviruses was obtained by Gap in the GCG program package.

















SbMV


47
- BCMV
66


PStV
74


ZYMV


DsMV-Chl
148


PSbMV


TuMV


TVMV


PRSV-P


Fig. 2-7. Phylogenetic tree obtained from the
alignment of putative polymerases between DsMV-Chl
and 14 other potyviruses using the PAUP program.
The tree is the bootstrap 50% majority-rule
consensus tree. The number above a given branch
refers to branch length. Vertical distances are
arbitrary, and horizontal distances reflect number of
amino acid differences between branch nodes.






















co E




s 0






O)







4)
.- .. a








4-

S00 c0
4' CT


0CI
I-.








S2
0 s
0* .S

















1-s

I
o>

C 00
C
O4


C CN T- 0 .-











Table 2-5. Percent nucleotide identity of CP genes
of two DsMV isolates and 14 other potyviruses
Percent similarity2


Virus'


1. DsMV-Chl

2. DsMV-LA

3. BCMV

4. SbMV

5. PStV

6. WMV-2

7. ZYMV

8. PVY-N

9. TEV

10. PSbMV

11. PRSV-P

12. TuMV

13. TVMV

14. SCMV

15. BYMV

16. PPV


2 3 4

84 68 67

68 67

72


SName and abbreviations of the viruses used in table: BCMV, bean common mosaic
virus; BYMV, bean yellow mosaic virus; DsMV-Chl, dasheen mosaic virus Chl
isolate; DsMV-LA, dasheen mosaic virus LA isolate; PPV, plum pox virus; PRSV-P,
papaya ringspot virus type P; PSbMV, pea seed-borne mosaic virus; PStV, peanut
stripe virus; PVY-N, N strain of potato virus Y; SbMV, soybean mosaic virus;
SCMV, sugarcane mosaic virus; TEV, tobacco etch virus; TuMV, turnip mosaic
virus; TVMV, tobacco vein mottling virus; WMV-2, watermelon mosaic virus 2;
ZYMV, zucchini yellow mosaic virus.
2 Percent similarity of CP genes among the DsMV-Chl and other potyviruses was
obtained by Pileup in the GCG program package.











nucleotide level, and from 67% to 82% at the amino acid level (Table 2-4). Individual

comparisons showed that potyviruses such as BCMV and SbMV are the most closely related

to DsMV among those potyviruses for which the sequences are known. A comparison of the

coat protein ofDsMV-Chl with that ofDsMV-LA (Pappu et al., 1994a) revealed a similarity

of 84% at the nucleotide level and 92% at the amino acid level, indicating that many of the

nucleotide changes observed were silent. Diversity in the coat proteins of the DsMV-Chl and

other potyviruses occurred predominantly in sequence and length at the N-terminal regions

(Shukla et al., 1994). The conserved property of the CPs among different virus strains has been

used to classify the potyviruses and their strains (Shukla et al., 1988). Two sorts of

phylogenetic trees were obtained by alignment of the coat proteins of the Chl and LA isolates

of DsMV and either 8 (for exhaustive search) or 14 (for bootstrap search) other potyviruses.

The exhaustive search generated a tree showing that both DsMV isolates were closely related

to those in the BCMV subgroup (Fig. 2-9); however, in the bootstrap 50% majority-rule

consensus tree (Fig. 2-10), the two DsMV isolates were clustered together, and distinct from

other potyviruses.

At the N-terminal region of the DsMV-Chl CP, there was a DAR triplet at position

+5 to +7 in relation to the cleavage site. A single mutation from G to A at the 1986 nucleotide

changed the amino residue from a nonpolar glycine to a basic arginine. To confirm this was a

true point mutation, ten different clones covering the CP gene were sequenced, and all of them

had this point mutation.














159

128
PVY-N

100
183
PPV
83
142 248
TBV

161
TEV

65
9 DsMV-Chl
96
6DsMV-LA
120
89
89 BCMV
108
147
4 SbMV

160
160 SCMV





Fig. 2-9. Phylogenetic tree obtained from the
alignment of coat proteins between DsMV isolates
and 8 other potyviruses using the PAUP program.
The tree is the exhaustive consensus tree. The
number above a given branch refers to branch length.
Vertical distances are arbitrary, and horizontal
distances reflect number of amino acid differences
between branch nodes.













DsMV-Chl
- DsMV-LA




21

33

4



84


15SbMV
- SbMV


WMV-2


PStV


TEV


TuMV
69
69 PVY-N

88
PRSV-P
50 119 P
PPV
93
PSbMV
105
BYMV
99
99TVMV

122
122 SCMV



Fig. 2-10. Phylogenetic tree obtained from the
alignment of coat proteins between DsMV isolates
and 14 other potyviruses using the PAUP program.
The tree is the bootstrap 50% majority-rule
consensus tree. The number below a given branch
refers to branch length. Vertical distances
are arbitrary, and horizontal distances reflect
number of amino acid differences between branch
nodes.











The 3'-NCR of DsMV showed less than 40% homology with those of other

potyviruses, but higher than the 84% among Chi and LA isolates (Table 2-4). A search for

possible secondary structure revealed only short stretches of potentially unstable base pairing.

/
Aphid Transmission


All three caladium isolates, DsMV-Chl, -Ch2, and -Ch3 were determined to be

transmitted by aphids from their original hosts to P. selloum seedlings. Three out of six P.

selloum plants became infected after aphid inoculation with the Chl isolate, two out of six

plants with Ch2, and one out of six plants with Ch3, as indicated by symptom expression and

positive reactions in I-ELISA.


Expression of the CP and the NIb Genes in E. coli


To express DsMV CP as an intact protein, a 1.2 kb DNA fragment was obtained by

PCR using two viral specific primers, EH232 and EH234, and subcloned into a pETh-3

expression vector to yield pETh-3-CP. Large quantities of the insoluble DsMV CP were

expressed by the pETh-3-CP recombinant (Fig. 2-11). The expressed CP protein was about 39

kDa, which contained a 15-amino-acid residue as a fusion protein. Purification of the expressed

protein was facilitated by its insolubility. The protein was partially purified from cell lysates by

several cycles of centrifugation and washing the pellets. Further purification was accomplished

by preparative SDS-PAGE and electroelution.






























1 2 3


S5 7


53k






29kf~1


WW .


Ti

,...

,. :
-.-;ii.

';'`~''
:. ;s;:
:;:

""
:"


Fig. 2-11. Analysis of the DsMV pETh-3-CP expressed in E. coli: Lane 1, protein
standards: bovine serum albumin (68 kDa), glutamate dehydrogenase (53 kDa), carbonic
anhydrase (29 kDa); lanes 2-5, E. coli BL21DE3pLysS with pETh-3-CP, 0, 1, 3, and 5 hr
after inducing by IPTG, respectively; Lane 6-7, E. coli BL21DE3pLysS with pETh-3 vector, 0
and 5 hr after inducing by IPTG. Partially purified proteins were obtained by centrifuged cell
lysates of cultures. Protein samples were analyzed by 10% sodium dodecyl sulfate
polyacrylamide gel electrophoresis followed by Coomassie staining. The expressed coat protein
of 39 kDa is indicated by the arrow.


i











The expressed protein reacted with DsMV-FL polyclonal antiserum and with PTY 1

monoclonal antiserum. When comparing it to its homologous state in Western blotting, the

expressed DsMV-Chl CP was smaller in size than that of the native one (44 kDa) (Fig. 2-12).

The expected DNA fragments of both the intact and truncated NIb genes were

obtained by PCR using pDCPI2 as the template. The correct clones were confirmed by

restricted enzyme digestions and sequencing. However, induction of these clones was

unsuccessful in both BL21DE3pLYsS and BL21DE3pLYsE. The latter carries a CE6 plasmid

(data not shown). The growth of bacterial cells slowed following induction with IPTG, and no

expression was detected.


Application of DsMV Antiserum against Expressed Coat Protein


The expressed DsMV coat protein was a good immunogen and the antiserum prepared

to it compared favorably with DsMV-FL antiserum (Table 2-6). The antiserum obtained in the

second bleeding reacted with DsMV from infected plants in immunodiffusion tests (data not

shown). It also reacted in I-ELISA and Western blotting without any discernible background.

Both the antiserum to the expressed CP and the antiserum to the virion reacted with five

DsMV isolates, namely Chl, Ch2, Ch3, Ce, and Xc, as well as ZYMV, PRSV-P, PRSV-W

and WMV-2, but not with an isolate of tulip breaking virus from Lilium. Neither antiserum

reacted with squash mosaic comovirus or with the healthy controls.



















1 2 3 4


5 6


43K


w -0


Fig. 2-12. Western blotting analysis of the expressed CP and native CP of DsMV: lane 1,
expressed CP; lane 2, extract from DsMV-infected Caladium hortulanum 'Candidum'
(Chl); lane 3, extract from DsMV-infected Colocasia esculenta; lanes 4-5, extracts from
DsMV-infected Zantedeschia aethiopica (Za); lane 6, healthy Philodendron selloum.
Proteins were electrophoresed in a 10% sodium dodecyl sulfate polyacrylamide gel. After
electrophoresis, the proteins were blotted onto a nitrocellulose membrane and reacted with
DsMV-FL antiserum, and then detected with phosphatase-conjugated goat anti-rabbit
antibodies.


r*.~.... ~L














Table 2-6. Comparison of the DsMV-FL antiserum
and the expressed coat protein antiserum in I-ELISA'

DsMV-FL AS3 Expressed CP AS4
Antigen2 1:1000 1:10000

DsMV-Chl 0.467 0.519
DsMV-Ch2 0.542 0.384
DsMV-Ch3 0.576 0.975
DsMV-Cel 0.439 0.318
DsMV-X 0.345 0.285
Healthy caladium 0.000 0.002
TBV 0.000 0.001
Healthy lily 0.000 0.003
ZYMV 0.961 0.294
WMV-2 0.720 0.398
PRSV-W 0.431 0.135
SqMV 0.000 0.003
Healthy pumpkin 0.000 0.016

The antisera were compared using I-ELISA as described in
the text. The absorbancies (A405) represent the mean values
of at least four wells.
2 Name and abbreviations of the viruses used in test: DsMV,
several isolates of dasheen mosaic virus; PRSV-W, papaya
ringspot virus type W; PRSV-P, papaya ringspot virus type P;
TBV, tulip breaking virus infecting lily; WMV-2, watermelon
mosaic virus 2; ZYMV, zucchini yellow mosaic virus;
SqMV, squash mosaic comovirus.
3 Antiserum (rabbit No. 7?) against purified virions of DsMV
Florida taro isolate (Abo El-Nil et al., 1977).
4 Antiserum (rabbit No. 1210) against E. coli expressed coat protein
of DsMV-Chl from caladium isolate.












Discussion


Dasheen mosaic virus antiserum of high quality has only been successfully obtained

three times, using viral preparations purified from infected plants (Abo El-Ndi et al., 1977;

Kositratana, 1985; Shimoyama et al., 1992). Most other workers either failed to purify the

virus (Hakkaart & Waterreus, 1975; Samyn & Welvaert, 1977) or could not eliminate host

contaminants that interfered with serological tests (Rodoni & Moran, 1988). During the initial

experiments in this study, several different virus purification methods, including one described

by Abo El-Nil et al. (1977) were tried, also without much success. The isopycnic methods

using either phosphate or HEPES buffers were less efficient in preventing irreversible virus

aggregation during the extraction process and in reversing virus aggregation during PEG

precipitation. Precipitated virions thus were not resuspended and were lost during subsequent

low speed centrifugation. In this study, ultracentrifugation using phosphate buffer was used

successfully to purify DsMV in conjunction with cesium sulfate density gradient centrifugation.

Philodendron selloum was the only host from which the virus was purified. The virus

could only be purified from the first two symptomatic leaves of inoculated P. selloum

seedlings, however, because the virus titers in the subsequently formed leaves dropped

considerably. The yields of DsMV produced in this study were 4-8 mg/100 g of tissue. We

were unsuccessful in purifying DsMV from other hosts (caladium, calla lily, cocoyam and taro),

despite the high virus titers in these hosts based on the detection of numerous virus particles in

negatively stained leaf extracts. This lack of success can be attributed to the highly viscous











nature of leaf extracts of these hosts, which as in other reports (Hakkaart & Waterreus, 1975;

Samyn & Welvaert, 1977), interfered with purification. However, it has been reported that

DsMV, konjak mosaic and CMV were purified from Amorphophallus konjak (Shimoyama et

al., 1992). Also, DsMV and an unidentified isometric virus were purified from Pinellia (Chen,

personal communication).

The viral RNA isolated by the phenol/chloroform extraction yielded more intact DsMV

RNA than the sucrose gradient method, which is an important factor to consider when

establishing a cDNA library for a virus.

The sequence data of the 3'-terminal region of DsMV-Chl support that it is a distinct

member of the genus Potyvirus in the family Potyviridae since the similarities of the virus with

other potyviruses were 72 to 85% with the NIb proteins, 67-82% with the coat proteins, and

less than 40% with the 3'-NCRs, respectively (Table 2-4). Comparison of NIb proteins and

coat proteins of DsMV and 14 other potyviruses revealed a close relationship of DsMV with

those in the BCMV subgroup. The phylogenetic trees obtained by alignment of the coat

proteins using two exhaustive and bootstrap searches were not the same, however, indicating

that differences exist between different search programs. It is interesting to note that all

potyviruses except DsMV and those in the BCMV subgroup were clustered together in one

group, on the basis of the Nib proteins and the coat proteins (Fig. 2-7 & 2-10, respectively).

Two proteolytic cleavage sites at the C-terminal region of the DsMV-Chl were

identified. The protease responsible for the cleavage at these sites is the NIa protease.

Comparison of determined and predicted cleavage sites in the C-terminal halves of the potyviral











polyproteins revealed that the NIA protein cleaves at the Q/A, Q/G, Q/S, Q/T, Q/, or Q/E

dipeptide sequences (Dougherty & Carrington, 1988, Shukla et al., 1994). Further comparison

of the potyviral cleavage sites revealed a conserved sequence VXXQ/A (G, S, E) around the

NIa protease cleavage sites. Based on these rules, two putative cleavage sites were identified in

the sequenced region of DsMV. The sequence VXLQ/G was found around the cleavage site of

the NIa and the NIb proteins, and the sequence VXLQ/A was found around the cleavage site

of the NIb and the coat proteins. This conserved cleavage sequence has also been found in

SbMV (Jayaram et al., 1992), BCMV isolates (Khan et al., 1993), and PStV (Gunasinghe et

al., 1994), suggesting a close relationship among these viral proteases.

Comparison of NIb proteins of different potyviruses have revealed that this protein is

the most conserved of the individual potyviral proteins (Shulda et al., 1994). The DSMV-Chl

NIb protein is 83-85% similar to the analogous proteins of the members in the BCMV

subgroup, and 72-76% similar to the other potyviruses compared (Table 2-4). The NIb protein

of potyviruses contains the conserved motif SGXXXTXXXNT-18-37aa-GDD, which is

conserved in both animal and plant positive-stranded viral RNA-dependent RNA polymerase

(Kamer & Argos, 1984). This motif was present in the NIb protein of DsMV as

SGQPSTVVDNT-30aa-GDD in a position analogous to that of other sequenced potyviruses

when they were aligned according to the sequenced homology. A second consensus motif;

YCDADGS, which is also believed to be involved in the putative polymerase activity (Allison

et al., 1986; Domier et al., 1986) was present in the NIb protein of DsMV as YCHADGS.

When compared with other potyviruses, the motif YCHADGS is present in the NIb proteins in











the members of the BCMV subgroup, while the motif YCDADGS are present in all the other

potyviruses compared.

The CP sequences of potyviruses are highly conserved throughout most of the

sequence but diverge in sequence and length at the N-terminal region. The CP sequence of

DsMV-Chl is approximately 80% similar to those of the BCMV subgroup and ranged from 67

to 79% similar to those of other potyviruses compared. The DsMV isolates displayed higher

levels of homology in the CP sequences (92-96%). From phylogenetic analysis using PAUP, it

is clear that DsMV is a distinct virus, albeit relatively close to the potyviruses in the BCMV

subgroup.

According to the CP sequence, DsMV-Chl was not expected to be aphid-

transmissible, since it did not have the DAG sequence in the N-terminus portion of the CP as is

typical for aphid-transmissible potyviruses (Harrison & Robinson, 1988). Instead, it had the

DAR at the N-terminal region of the coat protein. However, when the aphid transmission tests

were conducted using DsMV-Chl from the infected caladium as virus source, this isolate

proved to be aphid transmissible. Furthermore, when the same isolate was cloned by RT-PCR

from the original host (caladium cultivar 'Candidum') and sequenced, the triplet DAG rather

than DAR was present. Kositratana reported (1985) that a California DsMV isolate from

Chinese evergreen plants was not aphid-transmissible from infected P. selloum plants to healthy

P. selloum seedlings, which might also resulted from the mutation at the DAG triplet. It is

probable that mutation at this triplet was frequent, due to the propagation of a variant in P.











selloum seedlings. This variant might have been present in the original DsMV infected

caladium plants, or it could have been the result of a single point mutation (GGG to AGG).

The antiserum against the E. coli expressed CP of DsMV-Chl reacted with DsMV

isolates and other potyviruses tested in a manner similar to that of the DsMV-FL antiserum

obtained by Abo El-Nil et al. (1977). The DsMV antisera not only reacted with its homologous

isolates, but also with most potyviruses tested, which indicated that the close relationship of

DsMV with these other potyviruses. The expression of the CP gene in vitro provided a suitable

alternative for obtaining immunogen for antiserum production to this virus, which thus far has

been difficult by conventional means.














CHAPTER 3
VARIABILITY OF COAT PROTEINS AMONG ISOLATES
OF DASHEEN MOSAIC VIRUS


Introduction


Many cultivated aroids have become ubiquitously infected with dasheen mosaic

virus throughout the world, since they are exclusively propagated by vegetative means and

thus can harbor the virus indefinitely (Zettler & Hartman, 1977). Although DsMV has been

reported from many countries, the relationships between isolates have not yet been studied

extensively. A severe DsMV isolate of taro has been reported in French Polynesia

(Jackson, 1982). Biological and serological differences between isolates were noticed in

infected taro from Egypt and Florida (Abo El-Nil et al., 1977), and between Florida and Fiji

isolates of taro (Abo EL-Nil et al., 1977). The serological difference between a California

isolate from Chinese evergreen and two isolates from taro, Florida isolate and Fiji isolate

(Kositratana, 1985). It has been reported that the estimated molecular weights of DsMV

coat protein varied among isolates from different hosts (Li et al., 1992; Pappu et al.,

1994b), and this variability could be associated with diversity on the N-terminal region of

the CPs (Pappu et al., 1994b).

The accumulating body of knowledge of coat protein sequences has been used by

various authors to differentiate potyviruses and their strains. Comparisons of the growing

number of potyviruses sequenced revealed that distinct potyviruses show only 38-71%

66











sequence homology in their coat proteins, whereas this homology is greater than 90% among

strains belonging to the same virus (Shulda & Ward, 1988, 1989). Furthermore, the 3' non-

coding regions (3'-NCRs) of different potyviruses also display a high degree of sequence

variation (similarity of 39-45% only), whereas sequences are highly conserved between virus

strains (similarities of 83% and more). Recently, the coat protein and the 3'-NCR sequences of

four DsMV isolates (Pappu et al., 1994a; Li et al., 1994; this study) are available to be

compared.


Materials and Methods


Antigens


Florida isolates of DsMV used in this study were DsMV-Ce from taro (Colocasia

esculenta), and DsMV-Chl, -Ch2, -Ch3 from three cultivars of caladium (Caladium

hortulanum), Candidum', 'Carolyn Whorton' and 'Frieda Hemple', respectively. The

calla lily (Zantedeschia aethiopica) isolate, DsMV-Za, was from California; and the

cocoyam (Xanthosoma caracu) isolate, DsMV-Xc, was from Puerto Rico. These isolates

were maintained in their original hosts throughout this investigation. The isolates were

also maintained in mechanically inoculated P. selloum seedlings throughout the study.

Symptoms of P. selloum usually appeared 2 weeks after inoculation, and the first

symptomatic leaf formed after inoculation was routinely tested.

Antigens of PRSV-W, PStV, PepMoV, PVY, TEV, WMV-2 and ZYMV were

provided by D. E. Purcifull (Department of Plant Pathology, University of Florida,











Gainesville). TVMV was from T. P. Pirone (Department of Plant Pathology, University of

Kentucky, Lexington). A Puerto Rican passionfruit potyvirus (Bird et al., 1991) was

provided by A. C. Monllor (Department of Crop Protection, University of Puerto Rico,

Rio Piedras). Also tested in this investigation were antigens of a gladiolus isolate of

BYMV (Nagel et al., 1983), bidens mottle collected from Bidenspilosa in the campus of

the University of Florida (Gainesville), and two strains of PMoV from peanut and

bambarra groundnut (Li et al., 1991).


Antisera


The purified DsMV-FL IgG ofAbo El-Nil et al. (1977) was routinely used in this

study. Antisera of BICMV, PRSV-W, PMoV, PStV, PVY, TEV, WMV-2 and ZYMV

were provided by D. E. Purcifull. Antisera to the Puerto Rican passionfruit potyvirus was

provided by A. C. Monllor. The PTY 1 potyvirus group cross reactive monoclonal

antiserum (PTY 1) was purchased from Agdia, Inc. (Elkhart, IN).


Propagations and Analysis of DsMV Isolates


Each DsMV isolate in its original host was maintained in a greenhouse. The leaf

samples were collected from infected plants and tested by Western blotting as described in

Chapter 4.

Six DsMV isolates, -Chl, -Ch2, -Ch3, -Cel, -Xc and -Za were used to inoculate

Philodendron selloum seedlings at the 7-8 leaf stage in the spring months of 1991. Each











isolate was then serially transferred at least twice to additional plants of P. selloum

seedlings. The first symptomatic leaves were collected from the infected plants of each

passage, and prepared for Western blotting.

Each isolate was also used to inoculate tissue culture-derived, virus-free plants of

taro, cocoyam, and the caladium cultivars 'Candidum', 'Carolyn Whorton', 'Frieda

Hemple' and 'Rosebud'. The leaf tissues of the infected plants were prepared for and

tested by Western blotting.


Cloning and Nucleotide Sequencing ofPCR-amplified CP Genes


The CP genes of the DsMV isolates Chla and Ch2 were obtained by RT-PCR as

described in Chapter 2. The DsMV-Chla was from caladium cultivar 'Candidum' which

was the same host from which DsMV-Chl was isolated, and -Ch2 was from caladium

cultivar 'Carolyn Whorton'. After electrophoresis, the desired amplified CP fragments

were isolated by using Prep-A-Gene Kit (Bio-Rad Laboratories, Hercules, CA), ligated

into pGEM-T vector (Promega Co., Madison, WI), and transformed into competent

Escherichia coli DH5a cells. The recombinant colonies were screened by the blue-white

color reaction. The plasmid preparations from the selected clones were then sequenced by

the termination method (Untited States Biochemical, Cleveland, OH) using T7, SP6 vector

primers and DsMV CP-specific internal primers. The nucleotide sequences were

determined for both strands.











Sequence and Comparison of the CP and the 3'-NCR


The nucleotide sequences of the coat protein genes and the 3' non-coding regions

of three caladium isolates, Chl, Chla, Ch2, and the two taro isolates, LA and TEN,

sequenced by Pappu et al. (1994b) were compiled, and analyzed. The Chla isolate was

cloned from the original host of the DsMV-Chl, caladium cultivar 'Candidum' by RT-

PCR. The level of the sequence relatedness was compared using Pileup available in the

GCG program package from the University of Wisconsin (Devereux et al., 1984).


Results


Symptoms in P. selloum


Each of six isolates tested induced systematic vein chlorosis in the first and/or

second leaves of P. selloum after mechanical inoculation. However, the isolates DsMV-

Ce, -Chl, and -Ch2 induced more severe symptoms in P. selloum than those of the Ch3,

Xc and Za isolates. The mild isolates induced chlorotic spots in the first symptomatic

leaves, whereas severe isolates induced pronounced stunting. Similar symptom differences

among DsMV isolates in P. selloum have been described by Abo El-Nil et al. (1977) and

Wisler et al. (1978).












The Coat Proteins of DsMV in Their Original Hosts


The estimated CP molecular weight (MW) of each of six DsMV isolates from their

original hosts varied (Fig. 3-1). In Western blots using DsMV antiserum, the respective

highest CP MW values for the isolates Chl, Ch2, Ch3, Ce, Xc, and Za were 44, 46, 38,

44, 47 and 43 kDa, whereas values for the other eleven potyviruses tested were much

lower, ranging from 31 kDa for TEV to 36 kDa for the Puerto Rican passionfruit virus

(Fig. 3-2). Similar results were noticed when polyclonal antisera of BICMV, PRSV-W,

PMoV, PStV, TEV, WMV-2, ZYMV, and the Puerto Rican passionfruit potyvirus, were

tested. In reciprocal tests with DsMV and two PMoV strains from peanut and bambarra

groundnut, homologous reactions were much stronger than heterologous ones. Likewise,

homologous reactions were stronger than heterologous reactions when two PMoV strains

were compared against the other potyviruses (i.e. PRSV-W, PStV, TEV, WMV-2, and

the Puerto Rican passionfruit potyvirus).


The Coat Proteins of DsMV Isolates in Other Hosts


The CP MWs corresponding to those noted in their respective original hosts were

detected for each of six DsMV isolates infecting P. selloum. Each isolate was manually

inoculated to plants ofP. selloum, caladium, cocoyam and taro (Fig. 3-3). Similarly, after

two or more serial passages through manually inoculated P. selloum seedlings, respective

CP MW values remained consistent for each of the DsMV isolates tested (Fig. 3-4).







































Fig. 3-1. Western blotting analysis of the coat proteins of dasheen mosaic virus (DsMV)
isolates from their original hosts: lane 1, healthy Colocasia esculenta; lane 2, BRL protein
standard; lane 3, Xanthosoma caracu (Xc); lane 4, Colocasia esculenta (Ce); lane 5,
Caladium hortulanum 'Carolyn Whorton' (Ch2); lane 6, C. hortulanum 'Frieda Hemple'
(Ch3); lane 7, C. hortulanum 'Candidum' (Chl); and lane 8, Zantedeschia aethiopica
(Za). Proteins were electrophoresed in a 10% sodium dodecyl sulfate polyacrylamide gel.
After electrophoresis, the proteins were blotted onto a nitrocellulose membrane and
reacted with DsMV-FL antiserum, and then detected with phosphatase-conjugated goat
anti-rabbit antibodies.







































Fig. 3-2. Western blotting analysis of the Chl isolate of dasheen mosaic virus (DsMV-
Chl) and other potyviruses: lane 1, healthy Philodendron selloum; lane 2, BRL protein
standard; lane 3, DsMV-Chl; lane 4, tobacco etch virus; lane 5, passionfruit potyvirus;
lane 6, watermelon mosaic virus 2; lane 7, papaya ringspot virus type W; lane 8, zucchini
yellow mosaic virus; lane 9, pepper mottle virus; lane 9, potato virus Y; lane 10, bean
yellow mosaic virus (gladiolus strain); lane 11, bidens mottle virus. Proteins were
electrophoresed in a 10% sodium dodecyl sulfate polyacrylamide gel. After
electrophoresis, the proteins were blotted onto a nitrocellulose membrane and reacted by
DsMV-FL antiserum, and then detected with phosphatase-conjugated goat anti-rabbit
antibodies.









74










J :


















Fig. 3-3. Western blotting analysis of the Chl isolate of dasheen mosaic virus (DsMV-
Chl) transferred to several different hosts: lane 1, BRL protein standard; lane 2, healthy
Philodendron selloum; lane 3, Xanthosoma caracu; lane 4, Colocasia esculenta; lane 5,
Caladium hortulanum 'Carolyn Whorton'; lane 6, C. hortulanum 'Candidum'; lane 7, C
hortulanum 'Candidum'; lane 8, C. hortulanum 'Frieda Hemple'; lane 9, healthy C.
hortulanum 'Candidum'. Proteins were electrophoresed in a 10% sodium dodecyl sulfate
polyacrylamide gel. After electrophoresis, the proteins were blotted onto a nitrocellulose
membrane and reacted with DsMV-FL antiserum, and then detected with phosphatase-
conjugated goat anti-rabbit antibodies.

























131


ui-

... i. .. ......









Fig. 3-4. Western blotting analysis of four dasheen mosaic virus (DsMV) isolates serially
propagated in Philodendron selloum seedlings: lane 1, BRL protein marker; lanes 2 and
14, healthy P. selloum; lanes 3-5, Cel isolate from Colocasia esculenta; lanes 6-8, Chl
isolate from Caladium hortulanum 'Candidum'; lanes 9-11, Xc isolate from Xanthosoma
caracu; and lanes 12-13, Ch2 isolate from C. hortulanum 'Carolyn Whorton'. The
proteins were electrophoresed in a 10% sodium dodecyl sulfate polyacrylamide gel. After
electrophoresis, the proteins were blotted onto a nitrocellulose membrane and detected
with DsMV-FL antiserum, and then detected with phosphatase-conjugated goat anti-rabbit
antibodies.


-Z .. ....
;:IR











Comparison of the Coat Protein Sequences


The alignment of the CP sequences of the caladium isolates, Chl, Chla, Ch2, and

the taro isolates, LA and TEN (Pappu et al., 1994b) showed (Fig. 3-5). The amino acid

sequences were deduced from the nucleotide sequences. Fig. 3-6 shows the multiple

alignment of the predicted amino acid sequences for these DsMV isolates. Sequence

homologies of CP genes among these DsMV isolates were 84% to 96% at the nucleotide

level, and 92% to 96% at the amino acid level. However, the CP of the LA isolate (330

amino acids) was 15-16 amino acids longer than those of the three other isolates studied:

314 amino acids for isolates Chl and Ch2, and 315 amino acids for the TEN isolate (Fig.

3-6). These differences can be attributed to a 12-base addition and a 57-60 base deletion

at the 5'-terminal region of the CP gene of the Chl, Ch2 and TEN isolates. The addition

occurred between positions + 49 and + 50 and corresponded to amino acid residues of 17

to 20 of the CPs of the Chl, Ch2 and TEN isolates. The deletion was from +94 (+97 for

the isolate TEN) to +154, corresponding to amino acid residues 32 (33 for isolate TEN)

to 51 of the LA isolate. The addition and deletion occurred within the unusual threonine

and asparagine rich portion of the N-terminal region.

Among isolates Chl, Chla, Ch2 and TEN, the N-terminal region of the coat

proteins appeared highly conserved, both in length (76-77 amino acids) and in sequence

(similarity 71% to 78%). While the N-terminal region of the LA isolate was larger in size

(92 amino acids), its sequence similarity was 71-73%. Furthermore, the CP core and the

C-terminal region of the Chl, Ch2, LA and TEN isolates were all fairly conserved both in




























Fig. 3-5. Comparison ofnucleotide sequences of the coat protein (CP) gene
of dasheen mosaic virus isolates Chl and Chla (from Caladium hortulanum
'Candidum'), Ch2 (from Caladium hortulanum 'Carolyn Whorton'), LA and
TEN (from Colocasia esculenta). Nucleotide coding for the N-terminal regions
of the CPs are underlined, and the stop codons are shown by asterisks.

















GCTGATGACA
GCAGATGACA
GCTGATGATA
GCTGATGATA
PCTGATGATA


CAGTTGATGC
CAGTTGATGC
CAGTTGATGC
CAGTTGATGC
CAGTTGATGC


AGGGAATCAG
AGGGAACCAG
AAGGAAAAAC
AGGGAAAAAC
AGGGAAGAAT


AACAATACCA
AATAATACTA
AACAATACTA
AACAACACTA
AGCAAAAACA


ATAAAACA..
ATAAAACAAC
CAAAAACAAC
CAAAAACAAC
CAAAAACAAC


N-terminus

49 88
.......... ACCCCTGCAG CTGGTGGTGG TAACAACACA AATACCAACA
CGAAACAAAG ACTCCTGCAG CAAGTGGTGG TAACAACACA AAT.......
TGAAACAAAA ACACCTGCAA CGGGTGGTGG GAACAACACA AAC.......
TGAAACAAAA ACACCTGCAA CGGGCGATGG GAACAACACA AAC.......
TGAAACAAAA ACTCCTGCAT CGGGTCGTGG CAACAACACC AAC


89 138
CCAATACTGG TAACAACACA AACACCAATA CCAGTACTGG TAACAATACA







139 188
AACACCAACA CCAACACTAA TACCAACACA ACCAATAATA ATCCTCCACC
AATACTCCAC CACCACCCGC AAACAACACA ACTAATAACA ATCCTCCACC
.. AACAACA CGCCACCTGT AGATAACACA ACCAACAATA ATCCTCCACC
... GACAACA CGCCACCTGT AGGTAACACA ACCAACAATA ATCCTCCACC
AACAGCACTA CACCACCTGC AAATAACAAC ACAAACAACA ATCCTCCACC




189 238
GCCACCACCG GCGGCACCAA AAGCTTCAGA GACGCCAGCA AACAAGCAGG
GCCACCACCG ACGGCACCAA AGGCGACAGA GACGCCAGCC AACACACAAG
GCCACCACCG GCGGTTACAA AGGCAACAGA GATACCCGCC AATAAGCAAG
ACCACCACCG GCGGTTCCAA AGGTAGCAGA GATACCCGCC AATAAGCAAG
ACCGCCACCA GGCGCGCCAA AAGCAACAGA GACGCCGGCT AACAAACAAG


239
TAGTCCCCAC AACAAGTGAT
TAGTCCCAAC GGCAAGTGGG
TGGTCCCAGC AGCAAGTGAG
TGGTCCCAGC AGCAAGTGAG
TCGTCCCCCA AACAAATGAG


AAAGGTAAGG
AAAGGTAAGG
AAAGGTAAGG
AAAGGTAAGG


AGATTGTTAA
AAGTTGTTAA
AAATTGTGAA
AAATTGTGAA


288
AGATGTCAAT
AGATGTCAAC
AGATGTTAAC
AGATGTTAAC


AAACGGAAGG AAGTGGTCAA AGATGTCAAC


Fig. 3-5--Continued


DsMV-LA
DsMV-TEN
DsMV-Chl
DsMV-Chla
DsMV-Ch2


















DsMV-LA
DsMV-TEN
DsMV-Chl
DsMV-Chla
DsMV-Ch2


289
GCTGGCACAA
GCTGGCACAA
GCTGGCACTA
GCTGGCACTA
GCTGGCACCA

339
TAAAATGAAC
CAAGATGAAT
CAAAATGAAT
CAAAACGAAT
CAAAATGAAC


389
ATTTAATCGA
ATTTAATCGA
ATTTAATCGA
ATTTAATCGA
ACTTGATCGA


439
ACCCACACAC
ACCCACACAC
ACCCACACTC
ACCCACACTC
ACCCACACAC


489
GCTCGAGGAT
GCTTGAGGAC
GCTTGAGGAT
GCTTGAGGAT
GCTCGAGGAT


539
GCATCGACAA
GCATCGATAA
GCATCGATAA
GAACATCACC
GCATCGACAA


CTCTGTACCT
TTCTGTACCT
CTCTGTACCT
CTCTGTACCT
CTCTGTACCT


TCAAAGGCAA
TTAAAGGTAA
TTAAAGGTAA
TTAAAGGTAA
TTAAAGGTAA


CGGTTAAACA
CGATTGAATA
CGGTTGAATA
CGGTTGAATA
CGATTAAACA


GTGCATTTTA
GTGCATTTTA
ATGCATTCTA
ATGCATTTTA
ATGCATTTTG


338
AAATCACAAA
AAATCACAAA
GAATCACAAA
AAATCACAAA
GAATCACACA

388
AATTTAAATC
AATTTAAACC
AATTTGAATC
AATTTGAATC
CATTTAAATC


GTGGAACATA
GTGGCACATA
GTGGCACACA
GTGGCACATA
GTGGCACGTA


TTGCCTTTAG
TTACCTTTAG
TTACCTTTAG
TTACCTTTAG
TTACCTTTAG



GCACAAACCT
GTACAAACCC
GTACAAGCCA
GTACAAGCCA
GTACAAACCA



AGTTTGAGGT
AATTCGAGGT
AATTTGAAGT
AATTTGAAGT
AATTTGAGGT



GAGCAGATGC
GAGCAGATGC
GAGCAGATGC
GAGCAGATGC
GAGCAGATGC



TGGAACATCA
TGGAACATCA
TGGAACATCA
TGATATCAAC
TGGAACTTCA


GAACAGCGTG
GAACAGCGCG
GAACAGCGTG
GAACAGCGAG



CTGGTACAAT
ATGGTACAAC
CTGGTACAAT
CTGGTACAAT
CTGGTACAAT



ATATTGTTAT
ACATTGTAAT
ACATAGTTAT
ACATAGTTAT
ACATTGTTAT



CCTGACATTA
CCCGATATCA
CCTGATATCA
GGGGCTTGGG
CCCGACATCA


ACATCTTCAA
ACATATTCAA
ACATATTCAA
ACATCTTCAA



GCTGTCAAGA
GCCGTTAAGA
GCTGTCAAGA
GCTGTCAAGA
GCTGTCAAGA



GAATGGTTTC
GAATGGTTTC
GAATGGTTTT
GAATGGTTTT
GAACGGTTTC



ACGGGGCTTG
ACGGGGCTTG
ACGGGGCTTG
TGATGATGGC
ACGGGGCTTG


TACCAGAGCC
TACCAGAGCC
TACCAGAGCC
TACCAGAGCC


488
GGGAATATGA
GGGAGTACGA
GAGAATACGA
GAGAATACGA
GGGAATATGA


538
ATGGTTTGGT
ATGGTTTGGT
ATGGTTTGGT
ATGGTTTGGT
ATGGTTTGGT


588
GGTGATGATG
GGTGATGATG
GGTGATGATG
ATCGATAGTG
GGTGATGATG


Fig. 3-5--Continued


438
GAGCAGCGTG ACATATTCAA CACCAGAGCC


















DsMV-LA
DsMV-TEN
DsMV-Chl
DsMV-Chla
DsMV-Ch2


ATCAAATTGA
ATCAGATTGA
ATCAAATTGA
ATCAAATTGA
ATCAAATTGA


589
GATGGAAATG
GACGGAAACG
GACGGAAACG
GATGGAAGTG
GACGGAAATG


639
AAAACCCACC
AAAACCCACC
AAAACCAACC
AAAACCAACT
AAGACCCACC


689
CTTATATTGA
CTTATATCGA
CATACATTGA
CATACATTGA
CGTACATTGA


739
CTTATTCGCA
CTCATTCGCA
CTTATTCGCA
CTCATCCGCA
CTAATTCGCA


789
CTATGAAGTT
CTATGAGGTC
TTATGAGGTC
CTATGAGGTC
CTATGAAGTC


839
AAATGAAGGC
AAATGAAGGC
AAATGAAGGC
GGATGAAGGC
AGATGAAGGC


ATACCCGTTA
ATACCCGTTA
ATACCCGTTG
ATACCCGTTA
ATACCCGTTA


TAATGCATCA
TAATGCATCA
TAATGCATCA
TTATGCATCA
TAATGCATCA



GCGGAAAAAC
GCGGAGAAAC
GCAGAGAAAC
GCGGAGAAAC
GCGGAAAAAC



TGCAAGTCTC
TGCAAGTCTT
TGCAAGTCTC
TGCAAGTCTT
TGCAAGTCTC



CACCGGTCCG
CACCGGTGCG
CACCGGTGCG
CACCGGTGCG
CGCCGGTACG



TCTAACGTTA
TCCAACGTTA
TCTAACGTTA
TCTAACGTTA
TCTAACGTTA


AAGCCGATTG
AAACCAATTG
AAGCCAATTG
AAACCAATTG
AAGCCGATCG



CTTTTCTGAC
CTTTTCTGAC
CTTTTCTGAC
CTTTTCTGAC
CTTTTCTGAC



CATACATGCC
CATACATGCC
CGTATATGCC
CGTACATGCC
CATACATGCC



GCCCGGTACG
GCCCGGTATG
GCCCGGTATG
GCCCGGTATG
GCCCGGTATG



AGCAAGGGAG
AGCGAGAGAA
AGCAAGAGAA
AGCAAGAGAA
AGCAAGAGAG



CCACTAGGTT
CCACTACCTT
CCACTAGGTT
CCACTAGGTT
CCACTAGGTT


638
TGGAGAATGC
TGGAAAATGC
TTGAAAATGC
TCGAAAATGC
TGGAAAATGC


688
GCAGCAGAGG
GCAGCAGAGG
GCAGCAGAGG
GCAGCAGAGG
GCAGCAGAGG


738
TAGGTATGGT
TAGGTATGGT
TAGATACGGT
TAGGTATGGT
TAGGATAGGT


788
CTTTCGACTT
CTTTCGACTT
CTTTTGACTT
CTTTTGACTT
CTTTCGACTT


838
GCAGTTGCGC
GCAGTCGCGC
GCAGTTGCGC
GCAGTTACGC
GCAGTAGCGC


888
GTTTGGTTTG
GTTTGGTTTG
GTTTGGTTTG
GTTTGGTTTG
GTTTGGTTTG


Fig. 3-5--Continued


TTGCGTCAGA
TTGCGTCAGA
TTGCGTCAGA
TTGCGTCAGA
TTGCGTCAGA



ACTGAGAAAT
ACCGAGGAAT
ACTGAGAAAC
ATTGAGGAAC
ACTGAGAAAT



ACTTACGTGA
ATCTACGTGA
ATTTACGTGA
ACTTACGTGA
ACTTACGTGA



AACTCTAAAA
AATTCTAAAA
AATTCTAAAA
AATTCTAAAA
AATTCTAAGA



CGCTGCACTT
CGCTGCGCTC
GGCTGCACTC
CGCTGCACTC
TGCTGCACTC



















889
GATGGTAACG
GATGGTAACG
GATGGTAACG
GATGGTAACG
GATGGTAACG


AGACGTCACA
GGATGTCACG
AGACGTCACA
AGACGTCACA
AGACGTCACA


TTTCGACTTC
TTTCAACTTC
TTTCAACTTC
TTTCAACTTC
TTTCAACTTC


CCCAACATGC
CCAAATATGC
CCAAACATGC
CCAAACATGC
CCAAACATGC


AAGCGAGAAC
AAGCGAGAAC
AAGCGAGAAC
AAGCGAGAAC
AAGCGAGAAC


ATACATTGCT
ACACCTTGCT
ACACTTTACT
ACACTTTACT
ACACTTTACT


ACTGAAAGGC
ACTGAAAGGC
ACTGAAAGGC
ACTGAAAGGC
ACTGGAAAGC


TGGTGTGGCA
CGGCGTAGCG
TGGTGTTTCG
TGGCGTTTCG
TGGCGTTTCG


938
ACACTGCAAA
ATACTGCAAA
ACACTGCAAA
ACACTGCAAA
ACACTGCAAA


TCTCCACAGTAA
CCTCCGCAGTAA
TCTCCGCAGTAA
TCTCCGCAGTAA
TCTCCGCAGTAA


Fig. 3-5--Continued


DsMV-LA
DsMV-TEN
DsMV-Chl
DsMV-Chla
DsMV-Ch2


990




















1
DsMV-LA ADDTVDAGNQ


DsMV-TEN
DsMV-Chl
DsMV-Chla
DsMV-Ch2


NNTNKT.... TRAAGGGNNT NTNTNTGNNT


------TETK
---T--TETK
------TETK
SKNT--TETK



TNNNPPPPPP
----------
----------
----------


----------
-------RKN
----------
--------KN


47
NTNTNTNTNT
--PP-PAN--
.-N-PPVD--
.D-----G--
-ST-PPAN-N


97
AGTSGTYSVP

---H---
----------
----------


147
THTQFEVWYN

----------





197
DGNDQIEYPL



--S--------
----------
-S-------



247
LIRNLRDASL

----------





297
DGNVSTSSEN


----------


KPIVENAKPT


----S---
-P-T------
-P-T-D----
-P-S-R----



AAPKASEIPA
TA--------
-VT--T----
----V---
G----T-T--



LPLVKGKCIL

----------


N.........



NKQWPTTSD
-T-----A-G
------AA-E
----------
------Q-NE



NLNHLIEYKP

----------


46
NTNTSTGNNT
..........






96
KGKEIVKDVN
---V ------
---V------

----------

-R--V-----


146
EQRDIFNTRA

----------


---------- H-------- ----------
---------- H --------- ----------


EQMHIVMNGF

----------


LRQIMHHFSD


MVWCIDNGTS



----------





AAEAYI ELRN


196
PDINGAWVMM

----------





246
AEKPYMPRYG


---------- ---------- ---------- --------I-
------- R-- ---------- ---------- -------- I-


ARYAFDFYEV


TERHTAKDVT





-GK-------


NSKTPVRARE


PNMHTLLGVS


AVAQMKAAAL



--TR------


296
SNVTTRLFGL


330
SPQ*

---*
__-*
--*


Fig. 3-6. Comparison of amino acid sequences of coat proteins of dasheen mosaic

virus isolates LA, TEN, Chl, Chla and Ch2. Identical amino acids are shown by

dashes and gaps are indicated by dots.


RLNKITNKMN


---R------
-R -
--------T-

---R--H---



AVKREYELED

----------











length (237 amino acids) and in sequence (98% at the amino acid level) (Fig. 3-6). The

overall sequence similarity of the coat proteins was quite high and comparable to identities

observed between strains of a single potyvirus species (Shukla & Ward, 1988; Ward et al.,

1992).

The 3'-NCR of the Chl, Ch2 and LA isolates were all similar in length (246, 243

and 247 nt, respectively). The sequence identity in this region ranged from 79-83% (Fig.

3-7).



Discussion


Western blotting analysis confirmed that the CP of DsMV is considerably larger

than those of most potyviruses (Abo El-Nil et al., 1978). The CP MWs of six DsMV

isolates were estimated to be 38-47 kDa, whereas ten other potyviruses used in

comparisons had estimated MWs of 31-36 kDa in Western blotting analyses. These

variations apparently reflect genomic differences between DsMV isolates since the specific

CP MW for each isolate is constant after serial passages through different hosts. Whereas

most potyviruses, including konjak mosaic (Shimoyama et al., 1992), have CP MWs of

about 32-36 kDa, those of DsMV isolates have values of 38-47 kDa. Abo El-Nil et al.

(1977) suggested that the high CP MW values of DsMV was associated with the N-

terminal portion of the coat protein. The availability of the CP sequences of several DsMV

isolates (Pappu et al., 1994a, b; this study) and of other potyviruses may help to confirm

this hypothesis. Indeed, the DsMV CPs of 314 to 330 amino acids noted in this study are


















AGGTCTGGTA
AGGTCTGGTA
AGGTCTGGTA
AGGTCTGGTA


51
TTTATATAAA
TTTACATAAA
TATATTTAAA
TATATTTAAA


101
ACAGCGTGGT
ACAGAGTGGT
ACAGTGTGTT
ACAGTGTGTT


AACAGGGCCG
AACAGG..CC
AACAGG..CC
AACAGA..GA


GTATTGTTTG
GTATTGTTTG
GTACTGTTTG
GTACTGTTTG



TTTCCACCGA
TTTCCACCGA
TTTCCACCGA
TTTCCACCGA


ACAGTTATTG
ACAGTTATTG
ACAGTTATTG
CCACTTATCG


TATTCAAGTA
TATTCAAGTA
TATTCAGGTA
TTTTCAAGTT



TGTGGAGTTG
TGTGGAGA.G
TGTGGAGAGG
TGTGGAGAGG


GCTCGCTGTT
GCTCGCTGTT
GCTCGCTGTC
TCTCGCTGTC



GTGCTATTTG
GTGCTATTTG
GTGTTATTTG
GTGGTATTTG



.GCTTTGCAC
TGCTATGCAT
TGCTATGCAC
TGCTATGCAC


50
TGTAGTTTTA
TGTAGTTTTA
TGTAGTCTTA
TGTAGTTTTA


100
GTTATAAACT
ATTATAAACT
ATTATAAACT
ATTACAAACT


150
CCTATTATCT
CCTACTATCT
CCTACTATCT
CCTACTATCT


AC.GTCCTTT
ACATTCCTTT
AC.GTCCTTT
AC.GTCCTTT


201
CCGCAAG...
CCGTAAG...
CCGTTGGTGC
CCGTTGGTGC


251
C
C


ATGTATTTGA
AAATGTTTGA
AAATATTTGG
AAATATTTGG



GCGATGGGCG
..CCATGGCG
GCCACTGGCG
GCCACTGGCG


AAACTACTGA ACTACTGCAC
AAACTACTGA ACCACTGCAC
AAACTGCTGA ACCACTGCAC


CTACGTCAGA
CTACATCAGA
CTACATCGGA


AAACTGCTGA ACCACTGCAC CTACATCGGA


CGGTAGGCGA
CTGTAGGCGA
CGGTAGGCGA
CGGTAGGCGA


GACGCTTCGT
GATGCTTCGT
GATGCTTCGT
GATGCTTCGT


250
GCACGGTGTT
GCACGGTGTT
GCACGGTGTT
GCACGGTGTT


Fig. 3-7. Comparison of nucleotide sequences of the 3'-NCRs of dasheen mosaic
virus isolates Chl and Chla, Ch2 and LA. Dots indicate the gaps for optimum
alignment.


1
DsMV-Chl
DsMV-Chla
DsMV-Ch2
DsMV-LA











relatively large for a potyvirus. However, the calculated CP MWs for four sequenced

isolates were from 34.6-36.9 kDa, which were close to those seen for other potyviruses.

Furthermore, the estimated MW of the CP expressed in E. coli was smaller (39 kDa, as

reported in chapter 2) than that (44 kDa) from infected plants, even though the expressed

CP had a fusion protein of 15 amino acids long. The similar differences between CP MW

(36 kDa) observed in SDS-PAGE and that calculated using sequence data (33 kDa) have

been reported for PRSV-P (Quemada et al., 1990a; Yeh et al., 1992).

There are several factors that could account for such apparent discrepancies in

MW. First, they might reflect the unusual amino acid composition of the DsMV CP

(Pappu et al., 1994a; Li et al., 1994; this study). The DsMV CP is different from those of

other potyviruses in that it is quite threonine and asparagine-rich at the N-terminal region.

These two amino acid residues account for 31.8-50% of the amino acid residues at the N-

terminal region of the CPs. In addition to a 6-proline sequence at the N-terminal region,

there are also many more (8-10) potential N-glycosylation sites which are clustered near

both the N- and the C-termini of the DsMV CP (Pappu et al., 1994a; this study) than in

the CPs of most potyviruses. These unusual sequences may affect behavior of DsMV CP

in SDS-PAGE, although theoretically no such influence should exist based on the

presumption that proteins are completely denatured under such conditions. Several short

proline stretches and/or a seven-proline stretch were also found at the N-terminal regions

of several sweet potato potyviruses (Colinet & Lepoivre, 1994). The CP MWs of these

viruses in SDS-PAGE, however, corresponded closely to those calculated from their











sequences of 316-355 amino acids, thereby indicating that proline stretches had no effect

on the MWs of the proteins in SDS-PAGE.

Another possibility is that some chemical components in aroids may have effects

on the migration rate of the DsMV CP in SDS-PAGE, causing such an abnormal behavior.

This possibility could be not tested, however, because the host range of DsMV is largely

restricted to aroids. Clearly, attempts to purify this virus from different aroids were

seriously impeded by their unusually viscous sap.

The variability of the CP MWs among different isolates, contrasts with the studies

of other potyvirus strains, such as ZYMV (Wisler, 1992) and PRSV (data not shown),

which appear to be much more uniform in size. Sequence analysis of the DsMV CPs

revealed a deletion and an addition at the N-terminal regions of the Chl, Ch2 and TEN

isolates, which, when compared to the LA isolate, consisted of a 16-amino-acid deletion.

The deletions or duplications at the N-terminal region of the DsMV CP among different

isolates may contribute to the variability of the coat protein sizes. The significance of these

deletions or duplications to the evolution of DsMV has been discussed by Pappu et al.

(1994). Similar sequence diversities at the N-terminal region of the CPs were also

reported for strains of TuMV (Sano et al., 1992), SCMV (Xiao et al., 1993), and BCMV

(Khan et al., 1993).

The availability of the sequences of the coat protein and the 3'-NCR of the DsMV

isolates, Chl, Ch2, LA and TEN, allowed an assessment to be made of their relationship

at the sequence level. As has been for reported for other potyviruses (Shukla et al., 1988),











the amino acid variation among the CPs of the four DsMV isolates occurs primarily at the

N-terminal region, while the sequence of the core and C-terminal regions are highly

conserved (Fig. 3-6). The CP sequences of these isolates showed similarities of 92% to

96%, which are, by convention, considered to be values delineated for strains of a given

virus (Shukla et al., 1988). Furthermore, the similarities of the 3'-NCR sequences of the

isolates Chl, Ch2 and LA were 79-83%, indicating that these isolates are very close to

each other.

We confirmed earlier studies (Abo El-Nil et al., 1977; Wisler et al., 1978) that

some isolates of DsMV can induce more severe stunting symptoms in P. selloum than

others, but CP MW is apparently not correlated with this properties. For example, the

respective isolates with the highest and lowest CP MW values, DsMV-Xc (47 kDa) and

DsMV-Ch3 (38 kDa) induced mild symptoms in P. selloum, whereas the four other

isolates (Chl, Ch2, Cel and Za) that induced more severe stunting symptoms had

intermediate CP MWs. However, relationships between the symptom differences in P.

selloum and CP sequence similarity of these isolates could not be established since CPs of

the Ch3, Xc and Za isolates have yet to be sequenced.

The coat protein variability of DsMV isolates does not appear to compromise the

ability to detect different DsMV isolates serologically. Abo El-Nil et al. (1977) noted

strong precipitin reactions between isolates with only barely perceptible reciprocal spur

formation in SDS-immunodiffusion tests. Likewise, each of the DsMV isolates could











readily be detected in ELISA and Western blot tests in this study, as could several taro

isolates of DsMV isolates from different geographical areas (Zettler et al., 1987).

Despite the CP MW differences between DsMV and other potyviruses (except two

PMoV strains) reciprocal reactions in Western blotting analyses reveal close serological

relationships. The unusual composition of its CP apparently had no significant effect on

the ability of DsMV antiserum to react against many other potyviruses. Furthermore, the

antisera from two different DsMV isolates cross-reacted with other potyviruses, thereby

providing additional evidence that the unusual amino acid residues stretches at the DsMV

CP does not contain epitopes essential for detecting it serologically.




Full Text
MOLECULAR CHARACTERIZATION AND DETECTION
OF DASHEEN MOSAIC VIRUS
By
RUHUILI
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1995

ACKNOWLEDGMENTS
I would like to express my deepest appreciation and gratitude to Dr. F. W. Zettler,
a great teacher in my career. My interest in plant virology was inspired when I attended his
plant virology class, and continued when I worked in his laboratory. Indeed, this work
could not have been done with his advice, support, encouragement and patience. I would
like to thank Dr. Ernest Hiebert, cochairman of my committee, who always shared with
me his expertise in many parts of my research, who was always patient when I learned to
do computer analysis. My great gratitude also goes to Dr. D. E. Purcifull, for his support
of my research, for his encouragement whether I succeed or failed, for his constructive
criticism and challenge to my writing, for his strict attitude to work, and for his sense of
humor too. I would like to extend my appreciation to Dr. C. L. Guy, who always opened
the door for me, and who shared his knowledge and time with me.
I wish to express my gratitude to Dr. G. N. Agrios for his care and encouragement
during these years. My special thanks go to Dr. C. L. Niblett and his wife Tiffany for their
encouragement and kindness during the initial stage of my study in the United States.
I want to thank Dr. Carlye Baker, who first taught me the molecular techniques,
and who was always there when I needed help, with a smile. I also want to thank Dr. Gail
Wisler, for always standing there, not just as a colleague, but also as a friend.

I would like to extend my appreciation to Kristin Beckham, Maureen Petersen,
Mark Elliott, Eugene Crawford, Ellen Dickstein and Lucious Mitchell for their excellent
technical assistance and friendship.
I give heartfelt thanks to my parents, Fengling Li and Guizhen He, for their love,
support, encouragement and understanding. They have not seen their eldest child, and only
daughter, for almost seven years. To them, I owe my deepest gratitude.
To my husband, Wei-Wei Rao, and our son, Ran Rao, go my love and gratitude,
they have endured many hardships along the way and both have sacrificed a lot, just to
share this dream with me.
I also gratefully acknowledge the financial assistance of the USDA/CSRS (CBAG
Grant No. 90-34135-5172), the American Floral Endowment, and the Manatee Fruit
Company.

TABLE OF CONTENTS
Page
ACKNOWLEDGMENTS ii
LIST OF FIGURES vi
LIST OF TABLES viii
KEY TO ABBREVIATIONS ix
ABSTRACT xi
CHAPTER 1 INTRODUCTION 1
General Characteristics of Potyviridae 1
Dasheen Mosaic Virus 12
CHAPTER 2 CLONING, SEQUENCING OF 3’-TERMINAL REGION
AND COAT PROTEIN EXPRESSION OF DSMV-Chl
Introduction 20
Materials and Methods 21
Results 32
Discussion 61
CHAPTER 3 VARIABILITY OF COAT PROTEINS AMONG ISOLATES
OF DASHEEN MOSAIC VIRUS
Introduction 66
Materials and Methods 67
Results 70
Discussion 83
CHAPTER 4 DETECTION OF DASHEEN MOSAIC VIRUS
Introduction 89
Materials and Methods 90
iv

Results 99
Discussion 110
CHAPTER 5 SUMMARY AND CONCLUSIONS 113
REFERENCE LIST 120
BIOGRAPHICAL SKETCH 138
v

LIST OF FIGURES
Figure Page
2-1 Analysis of partially purified and purified DsMV-Chl preparations . . 34
2-2 Electron micrograph of a purifed DsMV-Chl preparation
negatively stained with 2% uranyl acetate 35
2-3 Agarose gel electrophoresis of DsMV-Chl RNA isolated
from purifed virions 37
2-4 Map of the cDNA clones representing the DsMV-Chl genome 40
2-5 Sequencing strategy used for the cDNA clones representing
the 3’-terminal region of DsMV Chi 41
2-6 Nucleotide sequence of the 3’-terminal region of DsMV-Chl 42
2-7 Phylogenetic tree obtained from the alignment of putative amino acid
sequences of Nib proteins between DsMV and 14 other potyviruses
using the PAUP program 50
2-8 Hydrophobicity plot of the Nib protein sequence of DsMV-Chl .... 51
2-9 Phylogenetic tree obtained from the alignment of coat proteins
between DsMV isolates and 8 potyviruses
using the PAUP program 54
2-10 Phylogenetic tree obtained from the alignment of coat proteins
between DsMV isolates and 14 other potyviruses
using the PAUP program 55
2-11 Analysis of the DsMV pETh-3-CP expressed in E. coli 57
2-12 Western blotting analysis of the expressed CP and
native CP of DsMV 59
3-1 Western blotting analysis of the coat proteins of dasheen mosaic
virus (DsMV) isolates from their original hosts 72
VI

3-2 Western blotting analysis of the Chi isolate of dasheen mosaic
virus (DsMV-Chl) and other potyviruses 73
3-3 Western blotting analysis of the Chi isolate of dasheen mosaic
virus (DsMV-Chl) transferred to several different hosts 74
3-4 Western blotting analysis of four dasheen mosaic virus (DsMV)
isolates serially propagated in Philodendron selloum seedlings 75
3-5 Comparison of nucleotide sequences of the coat protein (CP)
gene of dasheen mosaic virus isolates 77
3-6 Comparison of amino acid sequences of coat proteins
of dasheen mosaic virus isolates 82
3-7 Comparison of nucleotide sequences of the 3’-NCRs
of dasheen mosaic virus isolates 84
4-1 Electron micrograph of cylindrical inclusions (Cl) induced by
a caladium isolate of dasheen mosaic virus in a leaf cell
of Philodendron selloum 100
4-2 Agarose gel electrophoresis of RT-PCR amplified products obtained
from total RNA extracted from aroid leaf tissues 107
4-3 Agarose gel electrophoresis of RT-PCR amplified products obtained
from total RNA extracted from leaf tissues of calla lily plants 108
vii

LIST OF TABLES
Table Page
2-1 DsMV-Chl cDNA clones identified by immunoscreening
and preliminary sequencing 38
2-2 DsMV-Chl cDNA clones identified by preliminary sequencing 39
2-3 Percent nucleotide identity of Nib genes of DsMV-Chl
and 14 other potyviruses 48
2-4 Percent similarity of the Nib protein, the coat protein
and the 3’ noncodingregion (3’-NCR) of DsMV-Chl
and 14 other potyviruses 49
2-5 Percent nucleotide identity of CP genes of two DsMV isolates
and 14 other potyviruses 52
2-6 Comparison of the DsMV-FL antiserum and the expressed
coat protein antiserum in I-ELISA 60
4-1 Aw absorbance value of I-ELISA and DAS-ELIS A
for DsMV detection 101
4-2 Comparison of I-ELISA and Western blotting procedures
to detect DsMV in caladium leaves 102
4-3 Relative distribution of DsMV in three aroid hosts
as determined by I-ELISA 104
4-4 Effect of wounding on detection of DsMV in caladium corms 105
4-5 Comparison of RT-PCR, I-ELISA and Western blotting
for detecting DsMV 109
viii

KEY TO ABBREVIATIONS
AI
bp
BCMV
B1CMV
BYMV
CP
C-terminus
cDNA
CMV
Cl
pCi
DIECA
DSMO
DsMV-Ce
DsMV-Chl
DsMV-Ch2
DsMV-Ch3
DsMV-Xc
DsMV-Za
ELISA
HC/Pro
IPTG
kb
kDa
LB
p-ME
MW
3’-NCR
N-terminus
NIa
Nib
nm
nt
oligo dT
amorphous inclusion
base pair
bean common mosaic virus
blackeye cowpea mosaic virus
bean yellow mosaic virus
coat protein
carboxy-terminus
complementary DNA
cucumber mosaic virus
cylindrical inclusion
microCurie
diethyldithiocarbamate
dimethyl sulfoxide
taro isolate of dasheen mosaic virus
caladium isolate of dasheen mosaic virus from
cultivar 'Candidum’
caladium isolate of dasheen mosaic virus from
cultivar Carolyn Whorton’
caladium isolate of dasheen mosaic virus from
cultivar 'Frieda Hemple’
cocoyam isolate of dasheen mosaic virus
calla lily isolate of dasheen mosaic virus
enzyme-linked immunosorbent assay
helper component/protease
isopropyl-B-D-thiogalactopyranoside
kilobase
kilodalton
Luria broth
P-mercaptoethanol
molecular weight
3 ’ non-coding region
amino-terminus
nuclear inclusion a
nuclear inclusion b
nanometer
nucleotide
oligonucleotide deoxythymidine
IX

PCR
PepMoV
PMoV
PPV
PRSV-W
PRSV-P
PSbMV
PStV
PVY
RT-PCR
SbMV
SCMV
SDS-PAGE
TEV
TuMV
TVMV
WMV 2
X-Gal
ZYMV
polymerase chain reaction
pepper mottle virus
peanut mottle virus
plum pox virus
papaya ringspot virus type W
papaya ringspot virus type P
pea seed-borne mosaic virus
peanut stripe virus
potato virus Y
reverse transcription-polymerase chain reaction
soybean mosaic virus
sugarcane mosaic virus
sodium dodecyl sulfate polyacrylamide
gel electrophoresis
tobacco etch virus
turnip mosaic virus
tobacco vein mottling virus
watermelon mosaic virus 2
5-bromo-4-chloro-3-infolyl-13-D-galactopyranoside
zucchini yellow mosaic virus

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the Requirements
for the Degree of Doctor of Philosophy
MOLECULAR CHARACTERIZATION AND DETECTION OF
DASHEEN MOSAIC VIRUS
by
Ruhui Li
August, 1995
Chairman: F. W. Zettler
Cochairman: E. Hiebert
Major Department: Plant Pathology
The sequence of the 3’-terminal 3158 nucleotides of a caladium (Caladium
hortulanum) isolate of dasheen mosaic virus (DsMV-Chl) was determined. The region
contains the nucleotide sequence which encodes the carboxyl terminus of the NIa
protease, the Nib RNA polymerase, and the coat protein (CP). The genomic organization
of this region is similar to those of other potyviruses. The overall nucleotide sequence
homology of the coding region compared with those of other sequenced potyviruses is
between 57-67%, and the amino acid sequence homology is between 68-82%.
Phylogenetic alignment of the genomic sequences indicated that DsMV is a distinct
member of the genus Potyvirus in the family Potyviridae.
The CP gene of DsMV-Ch was amplified by PCR, cloned into a pETh-3 vector,
and expressed in Escherichia coli. Antiserum against the expressed CP was obtained and
it was suitable for detecting DsMV in SDS-diffusion test, ELISA and Western blotting.
XI

Variability among DsMV isolates from caladium, calla lily (Zantedeschia spp.),
cocoyam (Xanthosoma spp), and taro (Colocasia esculenta) was noted in symptom
severity in inoculated Philodendron selloum seedlings. The CP molecular weight (MWs)
among isolates varied, ranging from 38-47 kDa in their original hosts based on western
blotting analysis. Because respective MWs of each DsMV isolate remained constant after
three passages in Philodendron selloum or other hosts, it was concluded that the observed
differences in the CP MWs were virus-mediated. Comparison of the CP sequence among
DsMV isolates revealed deletions and additions at the 3’-terminal regions, which may
contribute to the variability of the CP MWs among different DsMV isolates.
DsMV was not uniformly distributed within tissues of infected cocoyam and taro
leaves. In contrast, more uniform distribution of the virus was noted within infected
'Candidum’, 'Carolyn Whorton’, and 'Frieda Hemple’ caladium leaves. Relatively high
growing temperatures resulted in a reduction in the distribution of DsMV within leaves of
infected cocoyam and taro plants. Under such conditions, many leaves without detectable
virus were produced by infected plants, which may be related to restriction of virus
movement in these plants.
Immunosorbent electron microscopy (ISEM), ELISA, Western blotting, and
reverse transcription-PCR (RT-PCR) were used to detect different DsMV isolates in
leaves and/or conns of caladium, calla lily, cocoyam and taro. Of them, RT-PCR was the
most sensitive. DsMV detection was also facilitated by corm wounding.
Xll

CHAPTER 1
INTRODUCTION
Dasheen mosaic virus (DsMV) is a species of the genus Potyvirus in the family Potyviridae,
and infects plants in the family Araceae, collectively referred to as aroids. This potyvirus
causes stunting and foliar mosaic, chlorotic feathering, and distortion symptoms in infected
plants, thereby reducing their market values and/or yields (Zettler & Hartman, 1987).
General Characteristics of Potyviridae
The Potyviridae is the largest of 47 plant virus groups and families currently
recognized by the International Committee for the Taxonomy of Viruses. Three genera,
Potyvirus, Rymovirus, and Bymovirus, are recognized (Murphy et al., 1995). There are two
whitefly transmitted viruses and two aphid transmitted viruses are unassigned. The family
contains at least 184 definitive and possible species (30% of all known plant viruses), many of
which cause significant losses in agronomic, pasture, horticultural and ornamental crops
(Shukla et al., 1994). A feature shared by all potyviruses is that they induce characteristic
cylindrical inclusion bodies in the cytoplasm of the infected cells (Edwardson, 1974). These
cylindrical inclusion (Cl) bodies are formed by a virus-encoded protein (Dougherty & Hiebert,
1980). Except for species of the genus Bymovirus, which have bipartite particles about 500-
1

2
600 nm and 250-300 nm long, Potyvirus and Rymovirus virions are flexuous filaments of 650
to 900 nm in length (Murphy et al., 1995). The particles of monopartite potyviruses contain
one positive-sense, single-stranded genomic RNA molecule of 8.5-10 kb, which is
encapsidated by a single type of coat protein (Hollings & Brunt, 1981). The genomic RNA has
a protein (VPg) covalently attached to its 5' end (Hari, 1981; Siaw et al., 1985; Riechmann et
al., 1989; Murphy et al., 1990) and a poly(A) tract at its 3' end (Hari, 1979). Most potyviruses
(Potyvirus) are transmitted by aphids in a non-persistent manner, while Rymovirus, Bymovirus,
are transmitted by mites, and fungi, respectively. Some potyviruses, such as TEV, are known
to form nuclear inclusion bodies consisting of two nuclear proteins (NIa & Nib) aggregated in
equimolar amounts in nuclei of infected cells. A few potyviruses, such as PRSV-W, PeMoV,
potato virus A (PVA) and celery mosaic induce the formation of amorphous inclusions in the
cytoplasm and/or in the nucleoplasm of infected cells (Christie & Edwardson, 1977;
Edwardson & Christie, 1983).
Genome Organization
The complete nucleotide sequence of the following thirteen potyviruses has been
documented: TEV (Allison et al., 1986), TVMV (Domier et al., 1986), PPV (Maiss et al.,
1989; Lain et al., 1989), PepMoV (Vance et al., 1989), the necrotic and Hungarian strains of
PVY (Robaglia et al., 1989, Thole et al., 1993), PSbMV (Johansen et al., 1991), PRSV-P
(Yeh et al., 1992), the two strain of SbMV (Jayaram et al., 1992), TuMV (Nicolas et al.,
1992), Johnsongrass mosaic (Gough & Shukla, 1993), PVA (Puurand et al., 1994), PStV

3
(Gunasinghe et al., 1994) and ZYMV (Wisler et al., 1995). The sequence analysis of
potyviruses and in vitro translation studies of potyvirus genomic RNAs have revealed a single
open reading frame (ORF) encoding a large polyprotein ranging from 320 kDa to 358 kDa,
depending on the virus. This polyprotein is proteolytically processed into at least eight mature
viral proteins by three virus-encoded proteases (Hellmann et al., 1983; Dougherty &
Carrington, 1988). The different gene products into which the potyviral polyprotein is cleaved
are, proceeding from the N- to the C-terminus of the polyprotein: PI protease, the helper
component/protease protein (HC-Pro), P3, a putative 6K peptide (6K1), the Cl protein with
helicase activity, a second 6K peptide (6K2), the nuclear inclusion “a” protein (NIa), which
functions as VPg and protease, the nuclear inclusion “b” protein (Nib), the presumptive RNA
polymerase, and the capsid protein (CP). The length of potyviral 5' non-coding regions ranges
from 85 nucleotides (nt) for PRSV-W to 205 nt for TVMV. These regions are especially rich
in adenine residues with relatively few guanine residues. It has been shown that the TEV 5'
non-coding region can function as an enhancer of translation (Carrington et al., 1990).
Alignment of the non-coding regions of PPV, PVY, TEV, and TVMV revealed two highly
conserved regions, namely box “a” (ACAACAU) and box “b” (UCAAGCA) (Lain et al.,
1989; Turpén, 1989). These conserved sequences and their secondary structure may be
important for processes such as encapsidation, translation or replication (Lain et al., 1989;
Atreya et al., 1992; Riechmann et al., 1992).
The 3' non-coding regions of different potyviruses have been described as variable in
size, sequence, and predicted secondary structure (Lain et al., 1988; Turpén, 1989; Quemada

4
et al., 1990a, b). They contain AU-rich segments, and each sequence can be predicted to fold
into stable secondary structures (Turpén, 1989). Several short segments displaying sequence
homology among different potyviruses have been identified (Lain, 1989; Uyeda et al., 1992). In
contrast with the high sequence diversity found among the 3' non-coding regions of different
potyviruses, the 3’ non-coding regions are more conserved among different strains of the same
potyvirus (Wetzel., 1991). The poly(A) tails have been determined to be very variable in length
(Allison et al., 1986; Lain et al., 1988). The most important functions of the 3' non-coding
region involve the interaction with virus replicase during the initiation of minus-strand RNA
synthesis and the prevention of exonucleolytic degradation (Bryan et al., 1992; Dolja &
Carrington, 1992). It has been shown that the 3' non-coding region of TVMV can have a
direct effect on the induction of disease symptoms (Rodriguez-Cerezo et al., 1991).
Replication
The subcellular site(s) of potyviral RNA synthesis has not been identified with
certainty, but is believed to be in the cytoplasm, as found with other positive stranded RNA
viruses (Verchot et al., 1991). A polymerase activity is associated with an enzyme complex
isolated from plants infected with PPV (Martin & Garcia, 1991). Several viral proteins,
including Nib, Cl, VPg/NIa, and two small peptides (6K1 and 6K2), are believed to be
involved in the replication process of potyviruses. The large nuclear inclusion protein, Nib, is
the most conserved gene product of potyviruses and is believed to be the RNA-dependent
RNA polymerase (RdRp) based on the presence of conserved sequence motif (GDD)

5
characteristic of these enzymes (Domier et al., 1987; Lain et al., 1989; Robaglia et al., 1989;
Poch et al., 1989; Riechmann et al., 1992).
The Cl protein of PPV has been shown to have nucleic acid-stimulated ATPase activity
and to be able to unwind RNA duplexes (Lain et al., 1990, 1991). The PPV Cl was able to
unwind only dsRNA substrates with the 3' single-strand overhangs, indicating that the helicase
activity functions from the 3' to the 5' direction (Lain et al., 1990). The Cl proteins of
potyviruses were found to contain a conserved nucleotide binding consensus sequence motif
(GXXGXGKS) at the C-terminal region and were implicated as membrane-binding
components of the replication complex (Domier et al., 1987).
In addition to the role of NIa in the proteolytic processing of the potyviral polyprotein,
for which only its carboxyl half is required, its N-terminal part has been shown to be the VPg.
The VPg of TVMV (Siaw et al., 1985) and PPV (Riechmann et al., 1989) have been identified
as proteins of 24 kDa and 22 kDa, respectively. The TVMV VPg cistron has been mapped
showing that the VPg is the N-terminal portion of the NIa protein (Shahabuddin et al., 1988).
Likewise, the TEV VPg has been found to be either the 49 kDa NIa or its N-terminal 24 kDa
half (Murphy et al., 1990). The VPg is attached to the 5' end of the RNA by means of a
phosphate ester linkage to Y residues of the protein (Murphy et al., 1991). By analogy with
other viral systems, VPg is believed to serve as the primer for viral RNA synthesis
(Shahabuddin et al., 1988).
The NIa protease also may be involved in regulation of potyvirus replication. One level
of control has been proposed to be the regulation of the expression of gene products by

6
sequential proteolytic events (Dougherty et al., 1989a, b). Another proposed level of control is
that the subcellular localization of the NIa/NIb may play a regulatory role (Carrington et al.,
1991).
Proteolytic Processing of Polyprotein
Three virus-encoded proteases, NIa (Carrington & Dougherty, 1987a; Hellmann et al.,
1988; Chang et al., 1988; Garcia et al., 1989a; Ghabrial et al., 1990), HC-Pro (Carrington et
al., 1989a), and PI (Carrington et al., 1990; Verchot et al., 1991), process the large viral
precursor polyprotein co- and post-transcriptionally. The NIa is responsible for cleavages in the
C-terminal two-thirds of the polyprotein (Dougherty et al., 1988), whereas HC-Pro and PI
autocatalytically cleave at their respective C-termini (Carrington et al., 1989 a, b; Verchot et
al., 1991).
The small nuclear inclusion protein, NIa, is the major protease of potyviruses, and it is
capable of cleaving in a cis- and trans-manner at least six and possibly seven sites within the
polyprotein. It has a two-domain structure where the N-terminal domain is the genome-linked
VPg (Shahabuddin et al, 1988; Murphy et al., 1990), and the C-terminal half is the true
proteinase (Dougherty & Carrington, 1988). This proteolytic domain in TEV and TVMV was
like that reported for the poliovirus 3C and cowpea mosaic virus 24 kDa proteases (Domier et
al., 1987). The NIa protease is related to the trypsin-like family of cellular serine proteases,
except that a Cys is substituted for the active site nucleophile (Bazan and Fletterick, 1988;
Gorbalenya et al., 1989). Mutagenesis of selected TEV 27-kDa Nía ORF codons supports the

7
hypothesis that His-46, Asp-81, and Cys-151 make up the active-site triad (Dougherty et al.,
1989b). The consensus sequence GXCG has been found in all potyviruses examined to date
(Shukla et al., 1994). The NIa autocatalytically releases from the polyprotein by cleaving the
CI-NIa, and NIa-NIb junctions and catalyzes the production of Cl, Nib, and CP by cleaving
the P3-CI, and NIb-CP junctions (Carrington & Dougherty, 1987a, b; Carrington et al., 1988;
Heilman et al., 1988; Garcia et al., 1989a, b, 1990). Additional cleavages, to release VPg and
the 6K1 and 6K2 products, also occur (Garcia et al., 1992; Restrepo-Hartwig & Carrington,
1992).
The NIa protease requires those conserved cleavage sites, defined as heptapeptide
sequences, that are efficiently recognized only by their own respective proteases (Carrington &
Dougherty, 1987a, 1988; Carrington et al., 1988; Dougherty et al., 1988, 1989a; Garcia et al.,
1989 a, b; Garcia & Lain, 1991; Parks & Dougherty, 1991). Cleavages are frequently at a
Q/(G, or S) site. A group-specific motif VXXQ/(A, S, G, or V), common to most potyviruses,
has been found (Shukla et al., 1994). The requirement for the conserved cleavage sites is
unique to the NIa proteases.
The helper component protease (HC-Pro) functions as an autocatalytic protease. The
HC-Pro 52 kDa protein of TEV is a multifunctional protein, and the proteolytically active
domain has been localized at its C-terminal half (Carrington et al., 1989a, b). The presence of
two essential residues, specifically Cys-679 and His-772, in this protease supports the
hypothesis that HC-Pro most closely resembles members of the cysteine-type family of
proteases (Oh & Carrington, 1989). Cleavage is at a specific G/G dipeptide and appears to be

8
the only cleavage event mediated by the HC-Pro protein (Carrington et al., 1989b; Oh &
Carrington, 1989). The HC-Pro of potyviruses accumulates to high levels and often complexes
into amorphous inclusion bodies (de Mejia et al., 1985b)
By expressing TEV polyprotein in transgenic plants, it was shown that a novel
proteolytic activity caused by neither HC nor NIa proteases is required for processing at the C-
terminal region of PI protein (Carrington et al., 1990). Verchot et al. (1991) have
demonstrated that PI is the protease responsible for cleaving the Pl-HC junction at the Q/(S,
or G). Using the wheat germ in vitro translation system and a series of truncated or
mutagenized cDNAs from TEV, they showed that most of the HC protein and the first 157
amino acids of PI were not required for proteolysis of the Pl-HC junction and that the N-
terminal boundary of the protease domain lies somewhere between 157-188 and 304. The PI
protease is a serine-like protease based on the presence of the conserved active-site triad (His-
215, Asp-225 and Ser-256 for TEV) and the conserved motif (GXSG) found in all aphid-
transmitted potyviruses (Lain, 1990; Verchot, 1991). However, another factor besides PI
might be required since cleavage at this site does not occur in an in vitro rabbit reticulocyte
lysate system (Hiebert et al., 1984b; Carrington et al., 1989a). Alternatively, the absence of
cleavage in the reticulocyte lysate-based system could be due to the presence of a protease
inhibitor (Verchot et al., 1991).

9
Virus Movement
Natural plant-to-plant spread of the majority of potyviruses is accomplished by aphids, and
four viral proteins, PI, HC/Pro, Cl and CP, have been suggested or demonstrated to be
involved in either cell-to-cell movement or plant-to-plant spread. Based on the sequence
similarity of the PI protein of TVMV to that of 30 kDa movement protein of tobacco mosaic
virus, it has been suggested that the PI protein may be involved in cell-to-cell movement
(Domier et al.,1987; Lain et al., 1989a; Robaglia et al., 1989). However, sequence identity may
be a poor indicator of function since it is known that cell-to-cell movement proteins of plant
viruses exhibit very little similarity, even among members of the same group (Lain et al., 1989a;
Hull, 1991). The PI protein of other potyviruses (TEV, PPV, PVY), for example, differed
from that of TVMV. The PI proteins of the potyviruses are the most variable products of the
genome (Wisler et al., 1995), which suggests that PI, particularly its N-terminal non-proteases
domain, may be involved in some specific virus-host interaction (Hull, 1991). By deletions and
modifications of the PI coding sequence, Verchot and Carrington recently (1995)
demonstrated that PI protein of TEV was not involved in the movement.
The HC protein is involved in aphid transmission and must be acquired by the insect in
conjunction with the virus (Pirone & Thombury, 1983; Thombury & Pirone, 1983; Hiebert et
al., 1984; Thombury et al., 1985; Berger & Pirone, 1986). Although the HC protein is closely
related to the protein associated with the amorphous inclusions induced by certain potyviruses
(Hiebert et al., 1984; De Mejia et al., 1985 a, b; Baunoch et al., 1990), functional studies have

10
suggested that either the inclusion-bound form of this protein has been inactivated or,
alternatively, the HC activity is associated with a modified form of the inclusion protein
(Thombury & Pirone, 1983; Thombury et al., 1985; Dougherty & Carrington, 1988). The size
of the biologically active HC form is believed to be a dimer, with MWs of 116 kDa for PVY
(Hellmann et al., 1983) and 106 kDa for TVMV (Thombury et al., 1985). The loss of
transmissibility associated with HC deficiency has been correlated with two mutations in the
HC coding sequence of potato vims C (Thombury et al., 1990; Atreya et al., 1992) and the
PAT isolate of ZYMV-PAT (Granier et al., 1993). The long-distance movement of TEV has
been associated with the central region of the HC-Pro by using site-directed mutagenesis of
infectious cDNA and complementary by HC-Pro supplied in tram by a transgenic host (Cronin
et al., 1995).
The Cl protein has also been suggested to be involved in cell-to-cell movement on the
basis of electron microscope observations that CIs are associated with plasmodesmata and
vims particles (Lawson & Hearon, 1971; Murant et al., 1971; Langenberg, 1986; Lesemann,
1989; Baunoch et al., 1991).
The coat protein is the most extensively characterized potyviral gene product. The CP
nucleotide sequences of 103 strains of 35 distinct members of the Potyviridae have been
resolved (Shukla et al., 1994; Pappu et al., 1994; Puurand et al., 1994; Husted et al., 1994;
Colinet & Lepoivre, 1994). The interest in CP comes mainly from its usefulness in taxonomic
and evolution studies, in diagnosis, and in the study of CP-mediated resistance. Sequence
comparisons and particle assembly properties suggest the presence of three different regions in

11
the coat protein molecules of potyviruses: (i) a surface-exposed N-terminus varying in length
and sequence, (ii) a highly conserved core of 215-227 amino acids, and (iii) a surface-exposed
C-terminus of 18-20 amino acids (Shukla and Ward, 1989). Removal of the N- and C-termini
by trypsin digestion leaves a fully assembled virus particle composed of the coat protein core
region, which can not be distinguished by electron microscopy from untreated native infective
particles. Apparently the N- and C-termini are neither required for particle assembly nor for
infectivity during mechanical inoculation (Shukla et al., 1988; Jagadish et al., 1991).
The CP functions to protect the viral RNA, to facilitate its transmission by aphids (Gal-
On et al., 1990; Lecoq & Purcifull, 1992), and to facilitate movement of the virus within plants
(Dolja et al., 1994, 1995). Sequence analyses have shown that a change in the amino acid
triplet DAG, which is conserved in all aphid-transmissible potyviruses (Harrison & Robinson,
1988; Atreya et al., 1991), and other amino acids in the amino-terminus (N-terminus) of the CP
alters aphid transmissibility (Atreya et al., 1990, 1991, 1995; Harrison & Robinson, 1988; Gal-
On et al., 1990; Salomon & Raccah, 1990). A non-aphid transmissible isolate of ZYMV, which
has a defective CP but is capable of producing an active form of HC, has been described
(Antignus et al., 1989; Gal-On et al., 1992). By using mutational analysis, Atreya et al. (1995)
demonstrated that a basic residue (D or N) in the first position, the nonpolar residue A in the
second position, and the small nonpolar residue G in the third position are required for aphid
transmissibility.
The TEV CP has been recently shown to be necessary for cell-to-cell movement and
long-distance transport of the virus in plants (Dolja et al., 1994, 1995). The mutation at the

12
highly conserved S amino acid residue in the core domain and deletion at the variable C-
terminal region abolished or reduced virus movement within the plants.
In addition to their natural functions, the CP genes of some potyviruses, including
SbMV (Stark & Beachy, 1989), PPV (Reger et al., 1989; Scorza et al), PVY (Kaniewski et al.,
1990), PRSV-P (Ling et al., 1991; Fitch et al., 1992), TEV (Lindbo & Dougherty, 1992),
WMV-2 (Namba et al., 1992), ZYMV (Namba et al., 1992; Fang & Grumet, 1993), TVMV
(Zaccomer et al., 1993), and lettuce mosaic virus (Dianat et al., 1993) have been used
experimentally to obtain genetically engineered plants with CP-mediated resistance. Many of
these transgenic plants showed certain degrees of resistance to viral infection.
Dasheen Mosaic Virus
Dasheen mosaic virus (DsMV) is a species of the Potyviridae which causes serious
diseases of cultivated aroid plants worldwide (Zettler et al., 1978; Shimoyama et al., 1992a, b).
Viruses other than DsMV include konjak mosaic potyvirus of Amorphophallus (Shimoyama et
al., 1992a, b); tobacco necrosis necrovirus of Dieffenbachia (Paludan & Begtrup, 1982);
cucumber mosaic cucumovirus of Arum (Lovisolo & Conti, 1969), Amorphophallus
(Shimoyama et al., 1990) and Colocasia (Kumuro & Asuyama, 1955); tomato spotted wilt
tospovirus of Zantedeschia (Tompkins & Severin, 1950); and bobone rhabdovirus of
Colocasia (James et al., 1973). DsMV and konjak mosaic virus are considered different on the
basis of biological and serological properties. However, none of these viruses infect as many
aroids nor is as wide spread as DsMV.

13
The Araceae, or aroid family, comprises about 107 genera and 2,500 species of
monocotyledonous herbs and vines. Most aroid plants occur in tropical Asia and the New
World tropics (Grayum, 1990). Many of them, such as Aglaonema, Arisaema, Caladium,
Dieffenbachia, Epipremnum, Monstera, Philodendron, Pinellia, Spathiphyllum, and
Syngonium are important ornamentals, which account for nearly 25% of U.S. production of
foliage plants (U.S. Bureau of Census, 1974). Certain species of Anthurium, Richardia, and
Zantedeschia are valuable cut flower crops, and Cryptocoryne species are commercially grown
aquarium plants. Two genera of aroids, Colocasia, commonly referred as dasheen or taro, and
Xanthosoma, or cocoyam, are important tropical food crops. DsMV was first reported in 1970
in Florida by Zettler et al. (1970), and has since been found elsewhere, including Hawaii
(Buddenhagen et al, 1970; Hartman & Zettler, 1972; Kositratana et al, 1983), Puerto Rico
(Alconero & Zettler, 1971), Trinidad (Kenten & Woods, 1973), India (Hartman, 1974),
Venezuela (Debrot & Ordosgoitti, 1974), Japan (Tooyama, 1975), Egypt (Abo-Nil & Zettler,
1976), Netherlands (Hakkaart & Waterreus, 1976), the Solomon Islands (Gollifer et al. 1977),
Belgium (Samyn & Walvaert, 1977), Papua New Guinea (Shaw et al., 1979), Great Britain
(Hill & Wright, 1980), the Cameroons (Girard et al., 1980), Kiribati (Shanmuganathan, 1980),
French Polynesia (Jackson, 1982), Nigeria (Volin et al., 1981), Italy (Rana et al., 1983), South
Africa (Van der Meer, 1985), Costa Rica (Ramirez, 1985), Australia (Greber & Shaw, 1986),
P. R. China (Zettler et al., 1987), Taiwan (Ko et al., 1988) and Cuba (Quintero, 1989).
Although DsMV has been reported to experimentally infect nonaroids such as Chenopodium
amar anticolor, C. quinoa, C. ambrosioides, Nicotiana benthamiana and Tetragonia expansa

14
(Gollifer & Brown, 1972; Rana et al., 1983; Kositratana, 1985; Shimoyama et al., 1992a), its
natural host range is restricted to aroid plants, and it has been reported to infect species of 20
genera: Aglaonema, Alocasia, Amorphophallus, Anthurium, Arisaema, Caladium, Colocasia,
Cryptocoryne, Cyrtosperma, Dieffenbachia, Monstera, Philodendron, Pinellia, Richardia,
Scindapsus, Spathiphyllum, Stenospermation, Syngonium, Xanthosoma and Zantedeschia
(Zettler et al., 1987; Samyn & Welvaert, 1977; Chen, personal communication).
As noted for other Potyviridae, DsMV has flexuous, filamentous particles about 750
nm long (Zettler et al., 1978; Samyn & Welvaert, 1977; Hill & Wright, 1980; Girard et al.,
1980; Kositratana et al, 1983; Van der Meer, 1985; Greber & Shaw, 1986; Quintero, 1989). It
induces cylindrical inclusions in infected cells (Zettler et al., 1978; Girard et al, 1980;
Shanmuganathan,1980; Paludan & Begtrup, 1982; Greber & Shaw, 1986; Kositratana, 1985;
Ko et al., 1988, Liang et al., 1994), and like other members of this genus, DsMV is sap-
transmissible. DsMV also is transmitted in a non-persistent manner by aphids, namely Myzus
persicae, Aphis craccivora (Morales & Zettler, 1977; Van der Meer, 1985), and Aphis
gossypii (Gollifer et al, 1977), but apparently not by either Pentalonia nigronervosa (Morales
& Zettler, 1977) or Rhopalosiphumpadi (Gollifer et al., 1977).
The genome of DsMV is a single-stranded RNA of MW 3.2-3.42 x 106 (Kositratana,
1985; Shimoyama et al., 1992b). The four nonstructural proteins that have been identified thus
far were HC-Pro (51 kDa), Cl (69 kDa), NIa (49 kDa), and Nib (56 kDa) proteins (Nagel &
Hiebert, unpublished). The DsMV CP protein is serologically related to those of araujia
mosaic, B1CMV, TEV and ZYMV (Abo El-Nil et al., 1977; Hiebert & Charudattan, 1984;

15
Kositratana, 1985). The DsMV Cl protein is serologically related to that of araujia mosaic
virus (Hiebert & Charudattan, 1984), and the DsMV in vitro synthesized protein is related to
the TVMV HC-Pro protein (Hiebert et al., 1984). The 3'-terminal region and the CP gene of
two Colocasia isolates of DsMV from Florida have been cloned and sequenced (Pappu et al.,
1993, 1994a, b). The predicted CP of isolate DsMV-LA contains 329 amino acids and has an
estimated MW of 36.2 kDa, and the CP of isolate DsMV-TEN contains 314 amino acids and
has a MW of 34.6 kDa. The CP sequence comparisons and phylogenetic reconstructions
indicated that the DsMV is a distinct potyvirus within the passionfruit woodiness virus
subgroup cluster.
Symptoms caused by DsMV in nature may differ considerably according to the aroid
host infected and the season in which the host is grown. In some aroids such as Colocasia,
Richardia, Xanthosoma, Zantedeschia and certain Dieffenbachia cultivare, DsMV causes leaf
mosaic, leaf mottle, chlorotic streaking along veins on leaves, and leaf distortion. The
inflorescence of Zantedeschia may show color break, with blisters and malformation (Zettler et
al., 1970; Alconero & Zettler, 1971; Hakkaart & Waterreus, 1976; Hill & Wright, 1980;
Paludan & Begtrup, 1982; Van der Meer, 1985; Greber & Shaw, 1986). In other aroids, such
as Aglaonema and Spathiphyllum, DsMV symptoms are usually much less evident. A
characteristic of many aroids is that DsMV symptoms are intermittently expressed, often
making detection difficult. In some instances, such as with Colocasia, Dieffenbachia,
Richardia, symptom expression is seasonal, most often appearing on foliage produced during
fall and/or spring months (Chase & Zettler, 1982; Greber & Shaw; 1986). Some aroid cultivare

16
more readily express DsMV symptoms than others. The caladium cultivars, 'Candidum’ and
White Christmas’, for example, are much more likely to exhibit symptoms throughout the
growing season than the cultivars Frieda Hemple’ and Carolyn Whorton’ (Zettler & Hartman,
1986). The virus can cause yield loss of up to 60% in Caladium, Dieffenbachia, Philodendron
and Zantedeschia (Zettler & Hartman, 1987).
Diagnosis and detection of DsMV have been based on techniques of bioassay,
serology, and/or light and electron microscopy. Philodendron selloum seedlings are very
susceptible to infection of DsMV and have been used frequently in bioassays (Zettler et al.,
1970; Paludan & Begtrup, 1982); however, the seed viability of this and other aroids is short,
and the seed are not readily available commercially (Zettler & Hartman, 1987). Since DsMV is
not the only potyvirus which infects aroids (Shimoyama et al., 1992a; Chen, personal
communication), light and electron microscopy can not necessarily be used as reliable evidence
for ascertaining the existence of DsMV (Zettler & Hartman, 1987), nor are these methods
likely to be as sensitive as some others (Greber & Shaw, 1986). Serological methods, such as
immunodiffusion tests, have been used extensively in diagnosis and detection of DsMV, but
this method requires larger quantities of antiserum than techniques such as ELISA (Zettler &
Hartman, 1986). ELISA was also reported to be used for DsMV detection (Rana et al., 1986 ;
Hu et al., 1995), but either the antiserum used reacted with host proteins or no difference could
be detected among different isolates.
Dasheen mosaic virus has been successfully controlled by tissue culture methods in
some greenhouse grown aroids such as Anthurium, Dieffenbachia, Philodendron,

17
Spathiphyllum, Syngonium and Zantedeschia, although the primary purpose of the tissue
culture method for these plants is rapid in vitro propagation (Zettler & Hartman, 1986, Gomez
et al., 1989). Despite these techniques, DsMV still causes problems in some low-cash field-
grown aroids such as Caladium, Colocasia and Xanthosoma, (Zettler et al. 1991).
Dasheen mosaic occurs throughout the world, due to the international distribution of
aroids as food plants and ornamentals and the perpetuation of the vims by propagating plants
vegetatively. Little is known about the evolutionary relationships among DsMV isolates
occurring in different geographic areas and among various hosts. There is evidence for the
occurrence of a severe strain of the vims in Freeh Polynesia (Jackson, 1982). Symptomatic and
serological differences were noticed between an Egyptian isolate and a Florida isolate of
DsMV from taro (Abo El-Nil et al., 1976). Symptomatic and serological differences between a
Fiji isolate and a Florida isolate from taro were also noted (Abo El-Nil., 1977). Differences in
growth rate between P. selloum seedlings inoculated with several DsMV isolates were
reported, in which 79.5% and 4% weight reduction for taro and dieffenbachia isolates,
respectively, were reported (Wisler et al., 1978). The DsMV antiserum against a Chinese
evergreen isolate reacted with homologous isolate but not Florida and Fuji isolates in DAS-
ELISA (Kositratana, 198?). Shimoyama et al. (1992a) reported that the DsMV antiserum they
prepared did not react with several other potyvimses, including PVY-T, WMV-2, ZYMV,
BYMV, TuMV, B1CMV, SbMV and konjak mosaic viruses. These studies indicated that
distinct DsMV isolates do exist, although the relationships between them remain obscure.

18
Other studies, in contrast, such as that by Zettler et al. (1987) indicate only slight differences
among DsMV isolates.
As an important group of ornamentals, domestic and international movement of aroids
occurs on a large scale. In addition to commercial bulk shipments of plant materials, there is
considerable movement of small quantities of clonal plant germplasm for purposes of
establishing botanical collections, breeding programs and medicinal plants. In order to avoid the
spread of some aroid diseases, including DsMV, international guidelines for the safe movement
of aroid germplasm have been recommended (Zettler et al., 1989). These guidelines
recommend growing plants in greenhouses and indexing them periodically for at least one crop
cycle before certifying them as being virus-free. Such conditions, if implemented, would impose
severe constraints in the international trade of these plants. Reliable, sensitive, practical, and
rapid means for detecting DsMV could help overcome such problems. A better knowledge of
the characteristics of DsMV, regarding both its general and molecular properties, would
provide the basis needed for improving the detection of DsMV and for understanding the
relationships among different DsMV isolates. The purposes of this study were to (i) purify the
virus for molecular studies of DsMV, (ii) obtain and evaluate antiserum to be used to diagnose
this virus, (iii) develop reliable and effective methods for detecting DsMV in propagating units
of Caladium, Colocasia and Xanthosoma.
An isolate from caladium was purified and its viral RNA used to establish a cDNA
library. The 3-terminal region of this isolate was sequenced and compared to those of other
potyviruses. The CP gene was expressed in Escherichia coli and used to obtain the antiserum

19
that was useful for serological tests. It was determined that the CP of DsMV isolates varied in
size and in nucleotide sequence. Serological procedures such as ELISA and Western blotting
were developed for detecting DsMV. Also reported was the use of RT-PCR for DsMV
detection.

CHAPTER 2
CLONING, SEQUENCING OF THE 3’-TERMINAL REGION
AND EXPRESSION OF THE COAT PROTEIN OF DSMV-Chl
Introduction
As a potyvirus, dasheen mosaic virus (DsMV) shares many properties with other
aphid-borne potyviruses, such as having flexuous, filamentous particles, inducing formation of
cylindrical inclusions (Cl) in infected cells, having a positive-sense, single-stranded RNA
genome, being sap- and aphid-transmissible, having a relatively restricted host range, and being
serologically related to many other potyviruses (Zettler et al., 1978; Li et al., 1992). The RNA
of a Florida DsMV isolate from taro (Colocasia esculenta) has been translated in the rabbit
reticulocyte lysate in vitro system (Nagel & Hiebert, unpublished) to give five major
polypeptides, namely the HC-Pro, Cl, NIa, Nib and CP proteins. The molecular weight of the
genomic RNA was estimated to be 3.2 x 106 for a California isolate from Chinese evergreen
(Kositratana, 1985), and 3.42 x 106for a Japanese DsMV isolate from taro (Shimoyama et al.,
1992). The coat protein (CP) and the 3’ non-coding region (3’-NCR) of two DsMV taro
isolates, LA and TEN, have been sequenced recently (Pappu et al., 1994b). However, the
characteristics of the DsMV genome organization and the sequences of other genes have not
been studied. Furthermore, understanding the molecular characteristics of DsMV will help to
define the virus and improve prospects fot its diagnosis and detection for the purposes of
establishing practical quarantine regulations and facilitating the production of virus-free plants
20

21
through micropropagation. The only source of DsMV antiserum was that provided by Abo El-
Nil et al. (1977), but this supply is nearly exhausted. DsMV isolates also cross reacted with
PTY 1 monoclonal antibody, which is commercially available through Agdia Inc. (Elkhart, IN).
However, since this and other monoclonal antisera may not react with some potyviruses or
some potyviral isolates thereof (Jordan, 1992), there is an inherent risk of not detecting certain
viruses or viral isolates lacking the epitopes common to most other potyviruses. In this study,
the 3’-terminal region 3158 nucleotides of a DsMV caladium isolate was cloned, sequenced
and analyzed. The DsMV CP was expressed in Escherichia cotí and used to produce
polyclonal antiserum for DsMV diagnosis and detection.
Materials and Methods
Virus Isolates
A 'Candidum’ caladium plant infected with an isolate of DsMV was maintained in a
greenhouse and used to inoculate P. selloum seedling plants at the 7-8 leaf stage with an
artist’s airbrush gun. Source tissue was triturated in a mortar and pestle with 0.05 M potassium
phosphate buffer (w/v, 1:20), pH 7.2, containing 600 mesh carborundum. The supernatant was
added to a glass bottle, which was connected with a portable carbon dioxide tank, and was
propelled onto the first two newly expanded leaves of P. selloum seedlings using carbon
dioxide at a pressure of 40 pounds per square inch (Gooding & Ross, 1970).

22
Virus Purification
The ultracentrifugation method used for DsMV purification was similar to that for
ZYMV described by Wisler (1992) with modifications. The leaf or root tissues of infected
caladium, calla lily, cocoyam, taro or Philodendron selloum seedlings were homogenized in a
cooled Waring blender for 1 min with 3 volumes of 0.3 M potassium phosphate buffer, pH 8.2,
to which 0.6% sodium diethyldithiocarbamate (DIECA) and 0.2% P-mercaptoethanol (|3-ME)
were added. The homogenate was emulsified with 1:1 (w/v) cold trichlorofluorethane (Freon)
for 30 sec. Following centrifugation at 2,500 g with a Sorvall high speed centrifuge (Du Pont
Co., Wilmington, DE) for 10 min, the aqueous phase was filtered through four layers of cheese
cloth. The suspension was centrifuged at 7,500 g for 10 min. Triton X-100 was added to the
aqueous phase to a final concentration of 1%. The mixture was stirred for 20 min at 4°C. The
mixture was then centrifuged in a Beckman Ti 70 rotor (Beckman Instruments, Inc., Palo Alto,
CA) at 100,000 g (37k rpm) for 90 min. The pellet was resuspended in 20 mM HEPES, pH
8.2, containing 10 mM EDTA and 0.1% P-ME, with a tissue homogenizer. After stirring for
one hour at 4°C, the suspension was partially clarified by centrifugation at 2,000 g for 10 min.
The supernatant was layered on the top of Beckman SW41 tubes containing a CS2SO4 solution
(11.6 g salt plus 27 ml of 20 mM HEPES, pH 8.2), 5 ml per tube. The tubes were centrifuged
at 140,000 g (32k rpm) for 16-18 hr at 4°C. The two opalescent virus zones 24-26 mm from
the bottom of the tube were collected by droplet fractionation. The collected fractions
containing the virions were combined and diluted with 1 volume of 20 mM HEPES, pH 8.2,
and centrifuged at 10,000 g for 10 min. The virus was precipitated from the supernatant by

23
adding polyethylene glycol (PEG, MW 8,000) to a concentration of 6% (w/v), stirring at 4°C
for 30 min, and then centrifuging at 10,000 g as before. The pellet was resuspended in 0.5 ml
of 20 mM HEPES, pH 8.2. Concentrations of the virus preparations were estimated by
spectrophotometry using an approximate extinction coefficient of A260 2.6 (1 mg/ml, 1 cm light
path). Five pi of a 1:20 dilution of the virus preparation was mixed with an equal volume of
Laemmli dissociating solution (Laemmli, 1970), boiled for 2 min and analyzed by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Gels were stained with
Coomassie Brilliant Blue R-250 (Gibco BRL, Gaithersburg, MD), and destained in a solution
containing 1% acetic acid and 10% methanol for visualization. The virus preparations were
stored at -80°C, and then used for RNA isolation.
Viral RNA Isolation
Viral RNA was isolated from purified virus preparations by two methods, sucrose
gradient centrifugation and phenol/ chloroform extraction.
A purified virus preparation (5 mg) was dissociated by incubation in an equal volume
of RNA dissociating solution (0.2 M Tris-HCl, pH 9.0, containing 2 mM EDTA, and 2%
SDS) and 400 pg/ml of protease K for 10 min at room temperature. Linear-log sucrose density
gradients were made as described (Brakke and Van Pelt, 1970). The gradients were allowed to
diffuse overnight at 4°C. A volume equal to that of the samples was removed from each
gradient before loading the samples. The gradients were centrifuged at 185,000 g (39k rpm)
for 5 hr at 15°C with a Beckman SW41 rotor. Gradient zones containing RNA were collected

24
using an ISCO UV fractionator (ISCO, Inc., Lincoln, NE). The RNA was precipitated
overnight at -20°C by adding 1/20 volume of 3 M sodium acetate (pH 5.2), and 3 volumes of
100% cold ethanol. After centrifugation at 10,000 g for 10 min, the pellet was rinsed with 70%
ethanol and vacuum-dried. The RNA was then resuspended in a small volume of sterile water
and stored at -80°C.
The viral RNA was also extracted from incubated virus preparations by adding an
equal volume of phenol/chloroform (1:1) to the mixture, inverting gently and centrifuging at
12,000 g in an Eppendorf microcentrifuge for 5 min. The phenol fraction was removed by
adding an equal volume of chloroform, and centrifuging. The RNA was then precipitated with
3 volumes of 100% ethanol in the presence of 0.3 M sodium acetate (pH 5.2) at -20°C
overnight. After centrifugation, the RNA was resuspended in sterile water and stored at -80°C.
Synthesis of cDNAs
Two types of cDNAs were synthesized, one with oligo(dT)i2-ig primers and the other
with random hexamers. Freshly prepared viral RNA was used for cloning, with 5 pg RNA
being used as templates for the first strand synthesis. The first and second strand cDNAs were
synthesized using a TimeSaverâ„¢ cDNA synthesis Kit (Pharmacia Biotech., Inc., Piscataway,
NJ) following the manufacturer’s instructions. The first-stranded cDNA synthesis was labeled
with 1 pi (10 pCi a-32P-dCTP) (3000 Ci/mmol) (Du Pont NEN, Boston, MA) and used as a
tracer. After the double-stranded cDNA synthesis, the sample was extracted with phenol-

25
chloroform and purified by passing through a Sepharose CL-4B column. The next step
involved ligation of EcóRUNotl linkers to cDNAs.
In vitro packaging of the ADNA was performed using the Packagene Lambda DNA
Packaging System under the conditions recommended by the manufacturer (Promega Co.,
Madison, WI). The phage titer was determined by plating small aliquots of the packaging
extract on XL 1-Blue cells.
Size analysis of cDNA was performed on a 0.9% gel. The gel was exposed to X-ray
film and compared to a 1-kb ladder molecular weight standard (Gibco BRL).
Immunoscreening ofDsMV-Chl Phage Clones
Immunoscreening for clones expressing CP or Cl genes of the DsMV genome was
conducted essentially according to manufacturer’s instructions as described in the P/'coBlue™
Immunoscreening Kit and Predigested Lambda ZAP II/LboRI/CIAP Cloning Kit (Stratagene,
La Jolla, CA). The titered bacteriophage library (500 pfu/plate) was used to inoculate 200 pi of
freshly prepared XL 1-Blue of E. coli competent cells (OD6oo= 0.5), and incubated at 37°C for
15 min. The mixture was added to 3 ml of NZY top agar (0.5% NaCl, 0.2% MgS04.7H20,
0.5% yeast extract, 1% casein hydrolysate, and 0.8% agar) containing 500 pg/ml X-
galactoside and 10 mM isopropyl-B-D-thiogalactopyranoside (IPTG), which was poured onto
a NZY plate (80 mm x 80 mm) and incubated at 37°C for 5-6 hr to allow for formation of
plaques (0.5 mm in diameter). The plates were chilled at 4°C for 2 hr in order to prevent the
top agar from sticking to the nitrocellulose membranes. The plates were dried in a hood for 15

26
min, and sterile nitrocellulose membranes soaked in 10 mM IPTG were carefully layered upon
them. The plates were incubated at 42°C for an additional 4-5 hr to allow expression of the
cloned gene(s). DPTG is a gratuitous inducer used to induce the expression of the 13-
galactosidase fusion protein, and AZAP II phage is a temperature-sensitive mutant (Pharmacia
Biotech ). The membranes were lifted, rinsed three times for 10 min each in TBST solution,
and processed as described in western blot analysis in chapter 4. DsMV-FL antiserum (1:1000)
and DsMV-FL Cl antiserum (1:1000) were employed as primary antibodies. Positive plaques
were isolated with a sterile glass pipette and placed in 50 pi of SM buffer (100 mM NaCl, 50
mM Tris-HCl, pH 7.5, 10 mM MgCl2) containing 3 drops of chloroform. The tubes were
vortexed and incubated at room temperature for 2 hr to allow the phages to diffuse into the
solution. Forty pi aliquots of the phage clones were added to 200 pi of the XL 1-Blue cells
(ODfioo = 0.5), absorbed at 37°C for 15 min, and amplified at 37°C in a shaker overnight in 5 ml
of 2X YT with 0.2% maltose and 10 mM MgCl2. The cultures were centrifuged at 2,000 g for
10 min to remove the cell debris. Supernatants containing phages were stored at 4°C with
addition of chloroform to a final concentration of 5%.
In Vivo Excision of DsMV-Chl Plasmids from The AZAPII Vector
The plasmid clones were excised from the AZAP II vector according to the
manufacturer’s instructions using a Predigested AZAP II/£coRI/CIAP Cloning Kit
(Stratagene) with the following modification except that amplified phage clones (200 pi) were
used to start the excision. After excision, plasmids (pDCPn or pDCIn) were transformed into

27
SOLR of E. coli cells, and plated on LB/AMP plates (0.5% NaCl, 1.0% tryptone, 0.5% yeast
extract, 1.5% agar, and 500 pg/ml). Single colonies were picked up, amplified and used for
clone analysis.
Analysis of DsMY-Chl Clones:
Plasmids were purified according to a mini-prep procedure described by QIAGEN Inc.
(Chatsworth, CA). Up to 1.5 ml of cell culture was collected by centrifugation in a
microcentrifuge at 12,000 g for 1 min at 4°C. The supernatant was discarded, and the pellet
was resuspended in 320 pi of PI buffer (50 mM Tris-HCl, pH 8.0, 10 mM EDTA, RNase A
100pg/ml). After incubation at room temperature for 5 min, 320 pi of P2 (200 mM NaOH, 1%
SDS) was added and the tube was mixed gently by inversion. After adding 320 pi of P3 buffer
(3 M potassium acetate, pH 5.5), the tube was centrifuged at 12,000 g for 5 min. The aqueous
phase was transferred to a fresh tube and 1 volume of 100% isopropanol was added. The
mixture was then centrifuged at 12,000 g for 5 min. The pellet was resuspended in 25 pi of
sterile water, and then screened by £coRI (Promega) digestion for clone with a single insert to
be used for sequence analysis.
DNA Sequencing of DsMY-Chl Clones
The plasmid preparations were sequenced by the dideoxy chain termination procedure
using the Sequenase Version 2.0 DNA Sequencing Kit (United States Biochemical, Cleveland,
OH) with a-35S-dATP. T7 and T3 primers complementary to the pBlueScript vector and

28
synthesized internal primers were used to complete the sequence determination for either two
clones or both strands of the same clone. Sequencing products were performed in a 6% (w/v)
polyacrylamide gel containing 7 M urea. Autoradiographs of air-dried sequencing gels were
made using XAR x-ray film (Eastman Kodak, Rochester, NY).
Pairwise Comparison and Phylogenetic Analysis
Sequence analysis and comparisons were made using the University of Wisconsin
Genetics Computer Group (GCG) Sequence Software package version 7.0 (Devereux et al.,
1984) available at the University of Florida ICBR Biological Computing Facility. The
sequences of the 3’ non-coding region, CP, and Nib proteins of DsMV isolates were compared
to 14 other potyviruses. The sequences of 14 other potyviruses and DsMV-LA were obtained
by Farfetch from GeneBank, and the sequences were aligned using the Pileup method of
aligning multiple sequences in the GCG program.
Phylogenetic analyses were done by a cladistic parsimony method using the computer
program PAUP version 3.1.1 developed by D. L. Swoford (distributed by the Illinois Natural
History Survey, Champaign, Ill). Optimum trees were obtained with the heuristic method with
the tree-bisection-reconnected branch-swapping option or exhaustive method. One hundred
bootstrap replications were performed to establish confidence estimates on groups contained in
the most parsimonious tree.

29
Aphid Transmission
Three caladium isolates (Chi, Ch2 and Ch3) were tested for aphid transmission. The
aphids (Myzus persicae), maintained on pepper (Capsicum camuuni), were starved for two hr
and then placed on infected leaves for 30-40 sec. The aphids were then moved to P. selloum
seedlings used as test plants. Each trial consisted of 6 test plants and each test plant received 10
aphids. After 15 min the aphids were killed. The plants were maintained in a greenhouse, and
two weeks later, were observed for symptom expression. Visual observations were confirmed
by I-ELISA test using DsMV-FL antiserum.
Subcloning and Expression of the DsMV Coat Protein and Nib protein
Based on the CP nucleotide sequence of DsMV-Chl, two primers, namely EH232 (5’-
AAGCTTGCAGGCTGATGATACAG-3’) corresponding to the 5’-end of the CP gene and
EH234 (5’-GAATTCTTGAACACCGTGCAC-3’) corresponding to the 3’-end of the non¬
coding region, were synthesized at the University of Florida DNA Synthesis Core. A Hindlll
or EcoRl restriction site was included at the 5’-end of each primer for directional cloning of the
CP gene into an expression pETh-3 vector (McCarty et al., 1991) at Hindlll and EcoRl on the
polylinker.
The intact CP gene (942 nt) was amplified by PCR as described in chapter 4. The DNA
fragment was purified from a 0.9% agarose gel by using Prep-A-Gene Master Kit (Bio-Rad )
according to manufacturer’s instructions. The purified DNA was then cloned into a PCR
vector pGEM T vector (Promega) to generate pGEM-T-CP according to the manufacturer’s

30
instructions. The plasmid pGEM-T-CP was digested by HindiU and EcóRl (Promega) and
subcloned into HindHUEcoRl double-digested pETh-3 to generate pETh-3-CP. The
nucleotide sequence of the vector/insert junction was confirmed by DNA sequencing using the
Sequenase Version 2.0 DNA Sequencing Kit (US Biochemical).
A single colony culture (5 ml) of E. coli BL21DE3pLysS, transformed with pETh-3-
CP, was grown overnight at 37°C in LB containing 50 pg/ml ampicillin and 25 pg/ml
chloramphenicol. The overnight culture was diluted 1:100 into 5 ml or 250 ml (large scale) of
M9 medium (Sambrook et al., 1989) containing 50 pg/ml ampicillin, 25 pg/ml
chloramphenicol, 0.4% glucose and 0.5% tryptone, and the culture was shaken at 37°C until
early log phase (OD,*» = 0.6). Then IPTG was added to a final concentration of 1 mM, and
growth was continued for an additional 4 hr at 37°C. E. coli BL21DE3pLysS cells were
harvested by centrifugation at 5,000 g, the culture broth was discarded, and the cell pellet was
resuspended in one tenth of the original volume of TE buffer (10 mM Tris-HCl, pH 8.0, 1 mM
EDTA) and frozen overnight at -20°C. The viscous cell suspension was thawed, sonicated for
30 sec and the lysate was then centrifuged at 10,000 g for 10 min. The pellet was resuspended
in a small volume of TE buffer. The preparations were then analyzed by SDS-PAGE. Both
noninduced pETh-3-CP and pETh-3 cultures were tested as controls.
The same approach used for the DsMV CP expression was applied to express the Nib
polymerase in E. coli. Three pairs of synthesized primers were used for PCR amplification of
either the intact or truncated Nib gene or a fragment containing the C-terminal region of the
NIa and the Nib gene: EH239 (5’-GAATTCATGCAAAGTGGGTGGGTGA-3’)

31
corresponding to the 5’-end of the Nib gene and EH238 (5’-
AGATCTCTACTGCAACACAACCTC-3 ’) corresponding to the 3’-end of the Nib gene,
primers EH256 (5’-AAGCTTGCAGCGAGATGATGA-3’) corresponding to a sequence in
the Nib gene and EH238, primers EH267 (5’-GGGATTGGAATAGGCT-3’) corresponding
to a sequence in the 5’-terminal region of the NIa gene and EH238.
Antigen Preparation and Antibody Production
After sonication, the fusion protein expressed by E. coli was partially purified by three
cycles of centrifugation at 10,000 g, washing each pellet with TE buffer, and separating the
proteins by preparative SDS-PAGE. Protein bands were visualized by incubating gels in 0.2 M
KC1 for 10 min at 4°C. The targeted protein band was excised, washed three times in cold
deionized water, and frozen at -20°C. The cut pieces of the gel were then eluted using a Bio-
Rad Electoelutor at 10 mAmp/tube with constant current for 5 hr. The extracts containing the
protein were collected and dialyzed overnight against distilled water at room temperature.
Purity of the eluted protein was checked by analytical SDS-PAGE, after which the protein was
lyophilized.
Immunization was conducted as described by Purcifull and Batchelor (1977). A quarter
ml of purified protein (1 mg) at 4 mg/ml was emulsified with an equal volume of complete
Freund’s adjuvant and injected into the thigh muscles of a New Zealand white rabbit (No.
1210). This was followed by two 1.0 mg injections of the CP protein emulsified with
incomplete Freund’s adjuvant two or three weeks later. Blood was collected weekly for two

32
months, starting two weeks after the third injection. After a four week interval, a booster
injection was given, followed by subsequent bleeding.
Serological Evaluation of Antiserum
The antiserum obtained was tested by SDS-immunodiftiision, I-ELISA and Western
blotting analysis. The SDS-immunodiftiision tests were conducted using crude extracts as
described by Purcifull and Batchelor (1977). The immunodifiiision medium consisted of 0.5%
Noble agar, 1% sodium azide and 0.5% SDS. About 12 ml of the thoroughly mixed agar
suspension was poured into a disposable plastic petri dish (90 mm x 15 mm). A set of wells
consisting of six peripheral antigen wells surrounding a central antiserum well with an interval
of 5 mm from the edges of one another were made with a gel cutter. Samples were prepared by
grinding plant tissues in 1% SDS solution (final concentration) with a mortar and pestle. After
addition of the antigens and antisera, the double radial diffusion plates were incubated at 25°C.
Results were recorded after 24 hr and 48 hr. The DsMV-FL antiserum was used as a control.
Both I-ELISA and Western blotting using the DsMV-FL antiserum and the expressed DsMV
CP antiserum were conducted using procedures described in Chapter 4.
Results
Purification of DsMY-Ch and Isolation of Viral RNA
The DsMV virions were only purified from the first two newly formed leaves after
inoculation of P. selloum seedlings grown in relatively cool weather conditions during the

33
spring. The A260/A280 ratio of the final purified virus preparations obtained by 2 mM HEPES
buffer in 2 trials ranged from 1.11 to 1.20, with an average of 1.16. The estimated virus yields
were 4-8 mg/100g leaf tissue. SDS-PAGE analysis showed that the amount of virus obtained
by ultracentrifiigation was slightly higher than that obtained by PEG precipitation (Fig. 2-1 A).
The leaf tissues had higher concentrations of the virus than the root tissue (Fig. 2-IB).
Although many DsMV particles were seen in the leaf dip preparations, the virus could not be
purified from infected leaves of caladium, calla lily, cocoyam, and taro, presumably due to the
presence of viscous host components, probably polysaccharides.
Although cesium chloride was used in the purification of DsMV in previous research
(Abo El-Nil et al., 1977; Kositratana, 1985; Shimoyama et al., 1992), DsMV was degraded in
cesium chloride gradients made in 20 mM HEPES, pH 8.0, containing 10 mM EDTA and
0.1% P-ME. Electron microscopic examination of the virus preparations revealed numerous
fragments of virus particles. It was presumed, therefore, that degradation of virus particles
resulted from cesium chloride. In cesium sulfate gradients, however, two opalescent virus
bands were formed, and the bottom band contained more virions than the top band based on
the SDS-PAGE result (Fig. 2-IB). Furthermore, the virions from the bottom band collected
from the cesium sulfate gradients were less degraded than those noted in cesium chloride
gradients based on electron microscopy (Fig. 2-2).
Viral RNA was readily extracted in phenol/chloroform, and the procedure required a
minimum of time to process, thereby reducing the chance of degradation. The yield of viral
RNA extracted by phenol/chloroform was 14.5 pg, which was much higher than that by

34
Fig. 2-1. Analysis of partially purified and purified DsMV-Chl preparations. A. The
partially purified preparations. Lane 1, protein standards: bovine serum albumin (66 kDa),
egg albumin (45 kDa), pepsin (35 kDa); lane 2, the purified preparation using the
ultracentrifugation method; lane 3, the purified preparation using PEG precipitation. B.
The purified preparations. Lane 1, the viral preparation collected from the top band of the
CS2SO4 gradient; lane 2, the viral preparation collected from bottom band of the CS2SO4
gradient; lane 3, the preparation from root tissues of P. selloum seedlings. The virus was
purified from inoculated P. selloum seedlings as procedures described in the text. Protein
samples were analyzed by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis
followed by Coomassie staining. The coat protein of the purified DsMV-Chl is indicated by
the arrow.

35
Fig. 2-2. Electron micrograph of a purified DsMV-Chl preparation negatively stained
with 2% uranyl acetate. The virus was purified from inoculated P. selloum seedlings by
ultracentafugation purification method described in text. Bar = 500 nm.

36
sucrose gradient (5.28 pg), and the resulting RNA was much more intact in agarose gel (Fig.
2-3).
Molecular Analysis of cDNA Clones
After serological screening with DsMV-FL virion antiserum, 16 clones expressing the
CP (pDCP) were selected and screened by EcoRI and Noil digestions. Twelve pDCP clones
with a single insert were selected for direct sequence mapping (Table 2-1). The sizes of the
inserts in these clones ranged from 1.1-5.2 kb. The reaction of DsMV-FL Cl antiserum was
nonspecific, and 22 white clones (pDCI) were randomly selected for EcoRI and Noil digestion
screening and sequence mapping. Among these clones, eight had correct inserts, which ranged
from 0.9 to 2.7 kb (Table 2-2). These cDNA clones with overlapping inserts covered all but the
1.2 kb central region and the upstream 5’-terminal region of the DsMV-Chl genome, based on
comparisons with the published sequence of SbMV (Jayaram et al., 1992) (Fig. 2-4). Twelve
clones with insert sizes ranging from 1.1 to 3.4 kb were selected for sequence analysis (Fig. 2-
5)-
Sequences Representing the 3’-terminal region of DsMY-Chl
The nucleotide sequence of 3158 bases (excluding the poly(A) tail) corresponding to
the 3’-terminal region of DsMV RNA was determined (Fig. 2-6). The nucleotide positions
were confirmed by analyzing either both strands of the same clones or individual strands of
different clones. Stretches of 20-40 adenosine residues were found at the ends of two clones

37
Fig. 2-3. Agarose gel electrophoresis of DsMV-Chl RNA isolated from purified virions:
Lane 1, viral RNA isolated by phenol/chloroform extraction; lane 2, viral RNA isolated by
sucrose gradient. The viral RNA was loaded onto a 0.9% agarose gel. The separated RNA
was stained by ethidium bromide and visualized under UV light.

38
Table 2-1. DsMV-Chl cDNA clones identified
by immunoscreening1 and preliminary sequencing2
Clone
Approximate
Serological
designation
size ikbol
reactivity3
pDCPl
2.0
CP
pDCP2
5.2
CP
pDCP3
4.2
CP
pDCP5
1.1
CP
pDCP6
2.8
CP
pDCP7
1.4
CP
pDCP8
2.5
CP
pDCPIO
2.1
CP
pDCPll
2.5
CP
pDCP12
2.9
CP
pDCP14
1.9
CP
pDCP15
2.2
CP
pDCP16
1.2
CP
1 cDNA library in XZAP II vectors was plaque screened by DsMV- FL
antiserum. White plaques expressing the CP were selected.
2 The selected clones were confirmed by £coRI digestion, and the clones
with a single insert were selected. The positive clones were sequenced by
vector primers, T3 and T7, and results were mapped to relative positions
in the RNA genome compared to a published nucleotide sequence of
SbMV by a Gap program of the GCG program package.
3 Reactive with DsMV-FL antiserum.

39
Table 2-2. DsMV-Chl cDNA clones identified by preliminary sequencing1
Clone
designation
Approximate
size IkbpI
Relative
position2
pDCI2
1.8
Nib, CP
pDCI4
1.3
HC-Pro, Cl
pDCI7
0.9
HC-Pro
pDCI18
1.5
Nib
pDCI19
2.7
HC-Pro, Cl
pDCI21
1.8
PI, P2
pDCI22
1.6
PI, P2
1 cDNA library in XZAP II vectors was plaque screened by DsMV-FL
Cl antiserum. White clones were selected. The selected clones were
confirmed by £coRI digestion, and the clones with a single insert were
selected.
2 The positive clones were sequenced by vector primers, T3 and T7, and
the results were mapped to relative positions in the RNA genome
compared to a published SbMV nucleotide sequence by a Gap program
of the GCG program package.

5
Nib
CP
pDCI22 pDCI4
pDCI21 pDCI7
pDC119
1 1 H Poly (A) 3'
pDCI2 pDCP7
pDCI18 pDCPl
pDCP5 & 16
pDCPl4
pDCPIO
PDCP15
pDCP8 & 11
PDCP12
pDCP6
pDCP3
Fig. 2-4. Map of the cDNA clones representing the DsMV-Chl genome.
The position of each clone was mapped by preliminary sequencing
and comparing them with the published nucleotide sequence of SbMV
(Jayarama et al.,1992)

Nía
Nib
CP
3'-NCR
5’
pDCP7
pDCPl
Poly (A) 3 1
pDCP5 & 16
pDCP14
pDCP 6 & 12
pDCP8 & 11
Fig. 2-5. Sequencing strategy used for the cDNA clones representing the
3'-terminal region of DsMV-Chl. Arrows indicate the direction of sequencing
and distance read from the beginning of the clone from the location of a
primer. Nía = NIa protease gene; Nib = polymerase gene; CP = coat protein
gene; 31-NCR = 3' non-coding region.
it*

Fig. 2-6. Nucleotide sequence of the 3’-terminal region of DsMV-Chl. The predicted amino
acid sequence of the open reading frame coding for the putative polyprotein is shown.
Underlined amino acids correspond to the NIa protease activity site (between residues 31 and
34), to the polymerase active motif (between 451 and 495), and aphid transmission motif
(amino acids 662-664). Amino acids underlined with dotted lines and slashes (/) correspond to
the putative polyprotein cleavage sites.

43
1 CAAAGAGAGAGGAGCGCGTATGCATGGTTGGCACGAATTTCCAAGATAAAAGCATGCGCG 60
KREERVCMVGTNFQDKSMRA
61 CTACGATCTCGGAAGCATCTCTCATTCTACCAGAAGGGCAGGGAACATTCTGGAAACATT 120
TISEASLILPEGQGTFWKHW
121 GGATTTCAACTAAGGATGGGGAGTGTGGGATCCCCATGGTGGCTGTGAGTGATGGATATA 180
I S T K D G E C G I PMVAVSDGYI
181 TAGTTGGTTTCCATGGCCTTGGCTCAAACATATCTGAGAGGAACTATTTTGTCCCTTTCA 240
VGFHGLGSNISERNYFVPFT
241 CTGACGACTTCGAGCAAACACATCTTAAAAGGCTCGATAGTCTTGAATGGACCCAGCATT 300
DDFEQTHLKRLDSLEWTQHW
301 GGCACTTTCAGCCTGACAAGATAGCTTGGGGTTCACTCAGACTAGTTAATGACCAACCTA 360
HFQPDKIAWGSLRLVNDQPT
361 CTGAAGATTTTAAGATTTCAAAGTTAATTTCAGACCTTTTCGAAAATCCTGTACAATTAC 420
EDFKISKLISDLFENPVQLQ/
421 AAGGGTCTCAAAGTGGGTGGGTGATTAATACTGCCGAAGGGAATCTAAAAGCTGTTGCCC 480
GSQSGWVINTAEGNLKAVAR
481 GGTGTGAAAGTGCACTCGTGACAAAACATACAGTGAAGGGACCGTGCAGATACTTCTCAG 540
CESALVTKHTVKGPCRYFS E
541 AGTACTTGAGTTCAAACCAGGAAGCTGAAAAGTTTTTCAGACCATTCATGGGAGCTTATC 600
YLSSNQEAEKFFRPFMGAYR
601 GCTCAAGTAGACTTAACAGGGAAGCTTTCAAGAAAGACTTCTTTAAGTATGCAAAGCCTG 660
SSRLNREAFKKDFFKYAKPV
661 TTGAGTTGAATAAAGTTGATTTCAATGCCTTCCAGATTGCAGTGGCAAGTGTGGAGACAA 720
ELNKVDFNAFQIAVASVETM
721 TGATGATGGAAACAGGATTTAGCGAATGTGAGTATATCACAGACGCTCAAACAATCATTG 780
MMETGFSECEYITDAQTIID
781 ACTCCCTCAATATGAAAGCAGCTGTGGGGGCTCAATATCGTGGGAAGAAGTCTGAGTACT 840
SLNMKAAVGAQYRGKKSEYF
841 TCCACGATATGGAGGTCTACGATATGGAACGACTCCTCTTCCAAAGTTGTGAAAGACTAT 900
HDMEVYDMERLLFQSCERLF
901 TCTATGGGAAGAAGGGAGTCTGGAATGGCTCATTAAAGGCAGAGTTGCGTCCAATTGAGA 960
YGKKGVWNGSLKAELRPIEK
961 AAACGCAACTCAATAAAACAAGGACATTTACTGCCGCTCCTCTTGACACATTGTTAGGAG 1020
TQLNKTRTFTAAPLDTLLGA
1021 CGAAGGCTTGTGTGGATGACTTTAACAACCAATTCTATAGTCTCAACCTAAAGTGTCCAT 1080
KACVDDFNNQFYSLNLKCPW
Fig. 2-6—continued

44
1081 GGACAGTTGGTATGACCAAATTTTATAAAGGTTGGGATTCATTGATGAGAAAGCTTCCAG 1140
TVGMTKFYKGWDS LMRKLPE
1141 AAGGATGGGTCTACTGCCACGCTGATGGGTCTCAGTTTGACTCATCATTAACACCACTCC 1200
G W V Y C H A D G S QFDSSLTPLL
1201 TCATAAACGCGGTCGTGGACATCAGGAAGTTTTTCATGGAGGAGTGGTGGGTTGGTGAAG 1260
INAVVDI RKFFMEEWWVGEE
1261 AAATGCTTGACAACTTGTATGCTGAAATTGTCTACACACCTATATTGACCCCAGATGGAA 1320
MLDNLYAEIVYTPILTPDGT
1321 CAATTTTT AAGAAATTTAGGGGCAATAATAGT GGACAACCAT C GACAGT C GT GGATAATA 1380
I FKKFRGNN SGQPSTVVDNT
1381 CATTGATGGTTGTCATTTCAGTTTACTACGCATGTATCAAGCAAGGTTGGACGGATTATG 1440
LMVVI SVYYACI KQGWTDYD
1441 ATGTTAGTCAAAGAATAGTCTTCTTTGCAAATGGTGATGACATCATATTGGCTGTGCAGC 1500
VSQRIVFFAN GDP I I L A V Q R
1501 GAGATGATGAACCCATCCTTAATACCTTTCAGGATTCTTTTCACGAATTGGGGCTCAACT 1560
DDEPILNTFQDSFHELGLNY
1561 ATGATTTCTCTGAGCGCACGATGAAGAGAGAGGAACTTTGGTTCATGTCCCATCAAGCTA 1620
DFSERTMKREELWFMSHQAM
1621 TGAAAGTAGGGGATGTTTATATCCCTAAACTAGAGCGAGAGAGAATTGTATCAATTTTAG 1680
KVGDVYIPKLERERIVSILE
1681 AATGGGATAGAAGCAAAGAAATGATGCACAGAACAGAGGCAATTTGTGCAGCTATGATAG 1740
WDRS KEIMHRTEAI CAAMI E
1741 AAGCATGGGGTTACACTGACCTCTTGCAAGAAATAAGGAAATTCTATCTATGGCTGCTTG 1800
AWGYTDLLQEI RKFYLWLLE
1801 AAAAAGATGAATTTAAGACACTAGCCTCTGAAGGGCGGGCACCATATATTGCTGAAACAG 1860
KDEFKTLAS EGRAPYIAETA
1861 CACTCAAGAAGCTATACACAGATGAAAACATAAAGGAGTGCGAGCTTCAGCGTTATCTGG 1920
LKKLYTDENIKECELQRYLD
1921 ATGCTTTCAATTTTGAAATGTTCTGCGAACATGATGAGGTTGTGTTGCAGGCTGATGATA 1980
AFNFEMFCEHDEVVLQ/ADDT
1981 CAGTTGATGCAAGGAAAAACAACAATACTACAAAAACAACTGAAACAAAAACACCTGCAA 2040
V DAR KNNNTTKTTETKTPAT
2041 CGGGTGGTGGGAACAAGACAAACAACAACACGCCACCTGTAGATAACACAACCAACAATA 2100
GGGNNTNNNTPPVPNTTNNN
2101 ATCCTCCACCGCCACCACCGGCGGTTACAAAGGTAACAGAGGTACCCGCCAATAAGCAAG 2160
P PP P P PAVTKVT EVPANKQV
Fig. 2-6~continued

45
2161 TGGT CCCAGCAGCAAGTGAGAAAGGTAAGGAAGTTGTGAAAGATGTTAACGCTGGCACTA 2220
VPAAS EKGKEVVKDVNAGT S
2221 GTGGCACATACTCCGTACCTCGGTTGAATAGAATGACAAACAAAATGAATTTACCTTTAG 2280
GTYSVPRLNRITNKMNLPLV
2281 TTAAAGGTAAATGCATTTTAAATTTGAATCATTTAATCGAGTACAAGCCAGAACAGCGTG 2340
KGKCILNLNHLIEYKPEQRD
2341 AGATATTCAATACCAGAGCCACCCACACTCAATTTGAAGTCTGGTACAATGCTGTCAAGA 2400
I FNTRATHTQFEVWYNAVKR
2401 GAGAATACGAGCTTGAGGATGAGGAGATGCACATAGTTATGAATGGTTTTATGGTTTGGT 2460
EYELEDEQMHIVMNGFMVWC
2461 GCATCGATAATGGAACATCACCTGATATCAACGGGGCTTGGGTGATGATGGACGGAAACG 2520
IDNGTSPDINGAWVMMDGND
2521 ATCAAATTGAATACCCGTTGAAGCCAATTGTTGAAAATGGAAAACCAACCTTGCGTCAGA 2580
QIEYPLKPIVENAKPTLRQI
2581 TAATGGATCACTTTTCTGACGCAGCAGAGGCATACATTGAACTGAGAAACGCAGAGAAAC 2640
MHHFSDAAEAYI ELRNAEKP
2641 CGTATATGCCTAGATACGGTCTTATTCGCAATTTACGTGATGCAAGTCTCGCCCGGTATG 2700
YMPRYGLI RNLRDASLARYA
2701 CTTTTGACTTTTATGAGGTCAATTCTAAAACACCGGTGCGAGCAAGAGAAGCAGTTGCGC 2760
FD FYEVN S KT PVRAREAVAQ
2761 AAATGAAGGCGGCTGCACTCTCTAACGTTACCACTAGGTTGTTTGGTTTGGATGGTAACG 2820
MKAAALSNVTTRLFGLDGNV
2821 TTTCAACTTCAAGCGAGAACACTGAAAGGCACACTGCAAAAGACGTCACACCAAACATGC 2880
STSSENTERHTAKDVTPNMH
2881 ACACTTTACTTGGTGTTTCGTCTCCGCAGTAAAGGTCTGGTAAACAGGGCCGACAGTTAT 2940
TLLGVSSPQ*
2941 TGGCTCGCTGTTTGTAGTTTTATTTATATAAAGTATTGTTTGTATTCAAGTAGTGCTATT 3000
3001 TGGTTATAAACTACAGCGTGGTTTTCCACCGATGTGGAGTTGGCTTTGCACCCTATTATC 3060
3061 TACGTCCTTTATGTATTTGAAAACTACTGAACTACTGCACCTACGTCAGACCGCAAGGCG 3120
3121 ATGGGCGCGGTAGGCGAGACGCTTCGTGCACGGTGTTCA (n) 3159
Fig. 2-6-continued

46
(pDCPl and pDCP7), suggesting this end represented the 3’ end of the DsMV RNA.
Computer analysis of the sequence revealed a unique large open reading frame (ORF) in the
positive strand (virion sense). No other ORF of significant size was observed in either the plus
or minus strands. The ATG start codon of the single ORF was not identified. However, by
analogy with other potyviruses, it is presumably located near the 5’-terminus of the genome.
The ORF terminated at the first TAA stop codon, which is located at 246 residues upstream of
the 3’ end. Nucleotide sequence heterogeneity among different cDNA clones was found to be
about 98-99%.
The putative amino acid sequence includes 140 C-terminal amino acids of the NIa
protease (about 40% of the protein), the Nib protein consisting of 516 amino acids, and the
coat protein consisting of 313 amino acids (Fig. 2-6). The cleavage sites between these three
proteins were identified by comparing them with those of other sequenced potyviruses
(Dougherty et al.; 1988; Shukla et al., 1994). The cleavage site between the NIa and the Nib
proteins was at the amino acid 140-141 position (Q/G), whereas the site between the Nib and
the CP proteins was at the amino acid 656-657 position (Q/A). The conserved cleavage
sequence VXXQ/A(G,S,E) has been found in both sites, which were VQLQ/G between the
NIa and the Nib proteins and WLQ/A between the Nib and the CP proteins.
Analysis of the Nib Protein
The Nib protein of DsMV contained the consensus sequence motif,
SGXXXTXXXNT-(30aa)-GDD. This polymerase motif was found in the DsMV Nib protein

47
beginning at amino acid residue 451 of the sequence. A second consensus motif, YCHADGS,
was present in the Nib protein at amino acid positions 384 to 390. The similarity of the DsMV
Nib protein to those of other potyviruses ranged from 58% to 68% at the nucleotide level
(Table 2-3), and from 72% to 85% at the amino acid level (Table 2-4), respectively. A
phylogenetic tree was obtained from the alignment of putative Nib proteins of DsMV-Chi and
14 other potyviruses (Fig. 2-7) on the premise that this protein is the most conserved one
among all the potyviruses (Shukla at al., 1994). Though DsMV was distinct from other
potyviruses, it was closely related to ZYMV in the BCMV subgroup. The potyviruses, SbMV
and WMV-2, were clustered together, confirming their close relationship (Shukla et al., 1994).
It is interesting to note that all potyviruses except those in the BCMV subgroup were clustered
together.
The putative amino acid sequence of the Nib protein of DsMV-Chl was used to
prepare a hydrophobicity plot according to the method of Kyte & Doolittle ( 1982) (Fig.2-8).
The N-terminal and C-terminal regions of this protein are hydrophilic, while in the central
region there is an even distribution of hydrophilic and hydrophobic regions. Each of these
regions consists of about 20 amino acids, suggesting the transmembrane property of the Nib
protein.
Analysis of the Coat Protein
The coat protein of DsMV-Chi also showed a relatively high degree of similarity with
those of other potyviruses (Table 2-5). The similarity ranged from 55% to 68% at the

48
Table 2-3. Percent nucleotide identity of Nib genes
of DsMV-Chl and 14 other potyviruses
Virus
Percent similarity^
2
3
4
5
6
7
8
9
10
11
12
13
14
15
1.
DsMV-Chl
68
67
67
67
66
58
59
59
58
59
58
59
59
58
2.
BCMV
60
72
73
70
60
59
58
58
59
59
59
59
61
3.
SbMV
70
80
69
58
59
56
61
58
58
59
60
61
4.
PStV
71
68
58
59
56
56
60
59
57
59
60
5.
WMV-2
70
58
60
59
57
60
58
59
60
61
6.
ZYMV
59
57
59
56
59
58
59
60
60
7.
PVY-N
59
59
59
60
62
61
58
60
8.
TEV
60
58
63
61
58
59
61
9.
PSbMV
61
61
60
64
59
61
10
. PRSV-P
59
60
60
59
62
11
. TUMV
60
61
61
65
12
. TVMV
60
60
62
13
. SCMV
55
61
14
. BYMV
61
15
. PPV
1 Name and abbreviations of the viruses used in table: BCMV, bean common
mosaic virus; BYMV, bean yellow mosaic virus; DsMV-Chl, dasheen mosaic virus
Chi isolate; PPV, plum pox virus; PSbMV, pea seed-borne mosaic virus; PRSV-P,
papaya ringspot virus type P; PSbMV, pea seed-borne mosaic virus; PStV, peanut
stripe virus; PVY-N, the N strain of potato virus Y; SbMV, soybean mosaic virus;
SCMV, sugarcane mosaic virus; TEV, tobacco etch virus; TuMV, turnip mosaic
virus; TVMV, tobacco vein mottling virus; WMV-2, watermelon mosaic virus 2;
ZYMV, zucchini yellow mosaic virus.
2 Percent similarity of Nib genes among the DsMV-Chl and other potyviruses was
obtained by Pileup in the GCG program package.

49
Table 2-4. Percent similarity of the Nib protein, the coat protein and
the 3’ non-coding region (3’-NCR) of DsMV-Chl and 14 other potyviruses
Percent similarity2
Virus'
Nib
CP
3’-NCR
DsMV-Chl
92
79
BCMV
85
82
36
SbMV
84
82
39
PS tv
83
77
38
WMV-2
84
80
35
ZYMV
83
80
34
PVY-N
73
79
35
TEV
75
74
39
PSbMV
74
72
34
PRSV-P
73
72
34
TuMV
75
73
36
TVMV
72
69
33
SCMV
74
68
35
BYMV
76
70
36
PPV
74
66
34
1 Name and abbreviations of the viruses used in table: BCMV, bean common mosaic
virus; BYMV, bean yellow mosaic virus; DsMV-Chl, dasheen mosaic virus Chi
isolate; PPV, plum pox virus; PSbMV, pea seed-borne mosaic virus; PRSV-P,
papaya ringspot virus type P; PSbMV, pea seed-borne mosaic virus; PStV, peanut
stripe virus; PVY-N, N strain of potato virus Y; SbMV, soybean mosaic virus;
SCMV, sugarcane mosaic virus; TEV, tobacco etch virus; TuMV, turnip mosaic
virus; TVMV, tobacco vein mottling virus; WMV-2, watermelon mosaic virus 2;
ZYMV, zucchini yellow mosaic virus.
2 Percent similarity of the Nib, the CP and the 3’-NCR between the DsMV-Chl
and other potyviruses was obtained by Gap in the GCG program package.

36
SbMV
25
36
WMV-2
47
BCMV
66
29
PStV
74
45
ZYMV
78
56
DsMV-Chl
148
103
130
114
133
120
112
15J
140
PSbMV
- SCMV
TEV
- TuMV
PPV
BYMV
TVMV
165
PVY-N
— PRSV-P
Fig. 2-7. Phylogenetic tree obtained from the
alignment of putative polymerases between DsMV-Chl
and 14 other potyviruses using the PAUP program.
The tree is the bootstrap 50% majority-rule
consensus tree. The number above a given branch
refers to branch length. Vertical distances are
arbitrary, and horizontal distances reflect number
amino acid differences between branch nodes.

100 200 300 400 500
Fig. 2-8 Hydrophobicity plot of the Nib protein sequence of DsMV-Chl. The horizontal scale indicates
amino acid residues in the Nib protein. The hydrophobicity (vertical) scale is that of Kyte and Doolittle
(1982), with hydrophobic amino acids above the midline and hydrophilic amino acids below the midline.

52
Table 2-5. Percent nucleotide identity of CP genes
of two DsMV isolates and 14 other potyviruses
Percent similarity
V 11 Ud
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
1.
DsMV-Chl
84
68
67
64
64
63
62
60
58
58
58
57
57
56
55
2.
DsMV-LA
68
67
65
62
64
60
60
57
58
57
58
54
54
57
3.
BCMV
72
71
71
70
58
60
58
59
58
59
57
60
59
4.
SbMV
73
80
67
58
59
58
60
58
56
58
61
58
5.
PStV
68
67
58
61
57
57
59
58
58
58
57
6.
WMV-2
65
60
59
58
59
60
55
55
59
57
7.
ZYMV
60
61
57
59
58
57
55
56
59
8.
PVY-N
63
62
61
61
56
58
61
61
9.
TEV
61
61
62
59
59
63
62
10
. PSbMV
59
60
56
59
60
61
11
. PRSV-P
59
57
58
60
60
12
. TuMV
57
57
56
61
13
. TVMV
56
57
59
14
. SCMV
55
55
15
. BYMV
57
16
. PPV
1 Name and abbreviations of the viruses used in table: BCMV, bean common mosaic
virus; BYMV, bean yellow mosaic virus; DsMV-Chl, dasheen mosaic virus Chi
isolate; DsMV-LA, dasheen mosaic virus LA isolate; PPV, plum pox virus; PRSV-P,
papaya ringspot virus type P; PSbMV, pea seed-borne mosaic virus; PStV, peanut
stripe virus; PVY-N, N strain of potato virus Y; SbMV, soybean mosaic virus;
SCMV, sugarcane mosaic virus; TEV, tobacco etch virus; TuMV, turnip mosaic
virus; TVMV, tobacco vein mottling virus; WMV-2, watermelon mosaic virus 2;
ZYMV, zucchini yellow mosaic virus.
2 Percent similarity of CP genes among the DsMV-Chl and other potyviruses was
obtained by Pileup in the GCG program package.

53
nucleotide level, and from 67% to 82% at the amino acid level (Table 2-4). Individual
comparisons showed that potyviruses such as BCMV and SbMV are the most closely related
to DsMV among those potyviruses for which the sequences are known. A comparison of the
coat protein of DsMV-Chi with that of DsMV-LA (Pappu et al., 1994a) revealed a similarity
of 84% at the nucleotide level and 92% at the amino acid level, indicating that many of the
nucleotide changes observed were silent. Diversity in the coat proteins of the DsMV-Chl and
other potyviruses occurred predominantly in sequence and length at the N-terminal regions
(Shukla et al., 1994). The conserved property of the CPs among different virus strains has been
used to classify the potyviruses and their strains (Shukla et al., 1988). Two sorts of
phylogenetic trees were obtained by alignment of the coat proteins of the Chi and LA isolates
of DsMV and either 8 (for exhaustive search) or 14 (for bootstrap search) other potyviruses.
The exhaustive search generated a tree showing that both DsMV isolates were closely related
to those in the BCMV subgroup (Fig. 2-9); however, in the bootstrap 50% majority-rule
consensus tree (Fig. 2-10), the two DsMV isolates were clustered together, and distinct from
other potyviruses.
At the N-terminal region of the DsMV-Chl CP, there was a DAR triplet at position
+5 to +7 in relation to the cleavage site. A single mutation from G to A at the 1986 nucleotide
changed the amino residue from a nonpolar glycine to a basic arginine. To confirm this was a
true point mutation, ten different clones covering the CP gene were sequenced, and all of them
had this point mutation.

54
159
142
147
BYMV
128
100
PVY-N
183
83
PPV
248
TBV
161
TEV
96
120
65
65
DsMV-Chl
DsMV-LA
89
108
BCMV
111
SbMV
160
SCMV
Fig. 2-9. Phylogenetic tree obtained from the
alignment of coat proteins between DsMV isolates
and 8 other potyviruses using the PAUP program.
The tree is the exhaustive consensus tree. The
number above a given branch refers to branch length.
Vertical distances are arbitrary, and horizontal
distances reflect number of amino acid differences
between branch nodes.

55
22
31
DsMV-Chl
- DsMV-LA
84
35
21
33
15
C
SbMV
WMV-2
24
21
BCMV
26
PStV
43
ZYMV
Fig. 2-10. Phylogenetic tree obtained from the
alignment of coat proteins between DsMV isolates
and 14 other potyviruses using the PAUP program.
The tree is the bootstrap 50% majority-rule
consensus tree. The number below a given branch
refers to branch length. Vertical distances
are arbitrary, and horizontal distances reflect
number of amino acid differences between branch
nodes.

56
The 3’-NCR of DsMV showed less than 40% homology with those of other
potyviruses, but higher than the 84% among Chi and LA isolates (Table 2-4). A search for
possible secondary structure revealed only short stretches of potentially unstable base pairing.
/
Aphid Transmission
All three caladium isolates, DsMV-Chl, -Ch2, and -Ch3 were determined to be
transmitted by aphids from their original hosts to P. selloiim seedlings. Three out of six P.
selloum plants became infected after aphid inoculation with the Chi isolate, two out of six
plants with Ch2, and one out of six plants with Ch3, as indicated by symptom expression and
positive reactions in I-ELISA.
Expression of the CP and the Nib Genes in E. coli
To express DsMV CP as an intact protein, a 1.2 kb DNA fragment was obtained by
PCR using two viral specific primers, EH232 and EH234, and subcloned into a pETh-3
expression vector to yield pETh-3-CP. Large quantities of the insoluble DsMV CP were
expressed by the pETh-3-CP recombinant (Fig. 2-11). The expressed CP protein was about 39
kDa, which contained a 15-amino-acid residue as a fusion protein. Purification of the expressed
protein was facilitated by its insolubility. The protein was partially purified from cell lysates by
several cycles of centrifugation and washing the pellets. Further purification was accomplished
by preparative SDS-PAGE and electroelution.

57
Fig. 2-11. Analysis of the DsMV pETh-3-CP expressed in E. coli: Lane 1, protein
standards: bovine serum albumin (68 kDa), glutamate dehydrogenase (53 kDa), carbonic
anhydrase (29 kDa); lanes 2-5, E. coli BL21DE3pLysS with pETh-3-CP, 0, 1, 3, and 5 hr
after inducing by IPTG, respectively; Lane 6-7, E. coli BL21DE3pLysS with pETh-3 vector, 0
and 5 hr after inducing by IPTG. Partially purified proteins were obtained by centrifuged cell
lysates of cultures. Protein samples were analyzed by 10% sodium dodecyl sulfate
polyacrylamide gel electrophoresis followed by Coomassie staining. The expressed coat protein
of 39 kDa is indicated by the arrow.

58
The expressed protein reacted with DsMV-FL polyclonal antiserum and with PTY 1
monoclonal antiserum. When comparing it to its homologous state in Western blotting, the
expressed DsMV-Chl CP was smaller in size than that of the native one (44 kDa) (Fig. 2-12).
The expected DNA fragments of both the intact and truncated Nib genes were
obtained by PCR using pDCP12 as the template. The correct clones were confirmed by
restricted enzyme digestions and sequencing. However, induction of these clones was
unsuccessful in both BL21DE3pLYsS and BL21DE3pLYsE. The latter carries a CE6 plasmid
(data not shown). The growth of bacterial cells slowed following induction with IPTG, and no
expression was detected.
Application of DsMV Antiserum against Expressed Coat Protein
The expressed DsMV coat protein was a good immunogen and the antiserum prepared
to it compared favorably with DsMV-FL antiserum (Table 2-6). The antiserum obtained in the
second bleeding reacted with DsMV from infected plants in immunodiffusion tests (data not
shown). It also reacted in I-ELISA and Western blotting without any discernible background.
Both the antiserum to the expressed CP and the antiserum to the virion reacted with five
DsMV isolates, namely Chi, Ch2, Ch3, Ce, and Xc, as well as ZYMV, PRSV-P, PRSV-W
and WMV-2, but not with an isolate of tulip breaking virus from Lilium. Neither antiserum
reacted with squash mosaic comovirus or with the healthy controls.

59
1 2 3 4 5 6
Fig. 2-12. Western blotting analysis of the expressed CP and native CP of DsMV: lane 1,
expressed CP; lane 2, extract from DsMV-infected Caladium hortulanum 'Candidum’
(Chi); lane 3, extract from DsMV-infected Colocasia esculenta, lanes 4-5, extracts from
DsMV-infected Zantedeschia aethiopica (Za); lane 6, healthy Philodendron selloum.
Proteins were electrophoresed in a 10% sodium dodecyl sulfate polyacrylamide gel. After
electrophoresis, the proteins were blotted onto a nitrocellulose membrane and reacted with
DsMV-FL antiserum, and then detected with phosphatase-conjugated goat anti-rabbit
antibodies.

60
Table 2-6. Comparison of the DsMV-FL antiserum
and the expressed coat protein antiserum in I-ELISA1
DsMV-FL AS3
Expressed CP AS4
Antigen2
1:1000
1:10000
DsMV-Chl
0.467
0.519
DsMV-Ch2
0.542
0.384
DsMV-Ch3
0.576
0.975
DsMV-Cel
0.439
0.318
DsMV-X
0.345
0.285
Healthy caladium
0.000
0.002
TBV
0.000
0.001
Healthy lily
0.000
0.003
ZYMV
0.961
0.294
WMV-2
0.720
0.398
PRSV-W
0.431
0.135
SqMV
0.000
0.003
Healthy pumpkin
0.000
0.016
1 The antisera were compared using I-ELISA as described in
the text. The absorbancies (A405) represent the mean values
of at least four wells.
2 Name and abbreviations of the viruses used in test: DsMV,
several isolates of dasheen mosaic virus; PRSV-W, papaya
ringspot virus type W; PRSV-P, papaya ringspot virus type P;
TBV, tulip breaking virus infecting lily; WMV-2, watermelon
mosaic virus 2; ZYMV, zucchini yellow mosaic virus;
SqMV, squash mosaic comovirus.
3 Antiserum (rabbit No. 7?) against purified virions of DsMV
Florida taro isolate (Abo El-Nil et al., 1977).
4 Antiserum (rabbit No. 1210) against E. coli expressed coat protein
of DsMV-Chl from caladium isolate.

61
Discussion
Dasheen mosaic vims antiserum of high quality has only been successfully obtained
three times, using viral preparations purified from infected plants (Abo El-Nil et al., 1977;
Kositratana, 1985; Shimoyama et al., 1992). Most other workers either failed to purify the
vims (Hakkaart & Waterreus, 1975; Samyn & Welvaert, 1977) or could not eliminate host
contaminants that interfered with serological tests (Rodoni & Moran, 1988). During the initial
experiments in this study, several different vims purification methods, including one described
by Abo El-Nil et al. (1977) were tried, also without much success. The isopycnic methods
using either phosphate or HEPES buffers were less efficient in preventing irreversible vims
aggregation during the extraction process and in reversing vims aggregation during PEG
precipitation. Precipitated virions thus were not resuspended and were lost during subsequent
low speed centrifugation. In this study, ultracentrifugation using phosphate buffer was used
successfully to purify DsMV in conjunction with cesium sulfate density gradient centrifugation.
Philodendron selloum was the only host from which the vims was purified. The vims
could only be purified from the first two symptomatic leaves of inoculated P. selloum
seedlings, however, because the vims titers in the subsequently formed leaves dropped
considerably. The yields of DsMV produced in this study were 4-8 mg/100 g of tissue. We
were unsuccessful in purifying DsMV from other hosts (caladium, calla lily, cocoyam and taro),
despite the high vims titers in these hosts based on the detection of numerous vims particles in
negatively stained leaf extracts. This lack of success can be attributed to the highly viscous

62
nature of leaf extracts of these hosts, which as in other reports (Hakkaart & Waterreus, 1975;
Samyn & Welvaert, 1977), interfered with purification. However, it has been reported that
DsMV, konjak mosaic and CMV were purified from Amorphophallus konjak (Shimoyama et
al., 1992). Also, DsMV and an unidentified isometric virus were purified from Pine Ilia (Chen,
personal communication).
The viral RNA isolated by the phenol/chloroform extraction yielded more intact DsMV
RNA than the sucrose gradient method, which is an important factor to consider when
establishing a cDNA library for a virus.
The sequence data of the 3’-terminal region of DsMV-Chl support that it is a distinct
member of the genus Potyvirus in the family Potyviridae since the similarities of the virus with
other potyviruses were 72 to 85% with the Nib proteins, 67-82% with the coat proteins, and
less than 40% with the 3’-NCRs, respectively (Table 2-4). Comparison of Nib proteins and
coat proteins of DsMV and 14 other potyviruses revealed a close relationship of DsMV with
those in the BCMV subgroup. The phylogenetic trees obtained by alignment of the coat
proteins using two exhaustive and bootstrap searches were not the same, however, indicating
that differences exist between different search programs. It is interesting to note that all
potyviruses except DsMV and those in the BCMV subgroup were clustered together in one
group, on the basis of the Nib proteins and the coat proteins (Fig. 2-7 & 2-10, respectively).
Two proteolytic cleavage sites at the C-terminal region of the DsMV-Chl were
identified. The protease responsible for the cleavage at these sites is the NIa protease.
Comparison of determined and predicted cleavage sites in the C-terminal halves of the potyviral

63
polyproteins revealed that the N1A protein cleaves at the Q/A, Q/G, Q/S, Q/T, Q/V, or Q/E
dipeptide sequences (Dougherty & Carrington, 1988, Shukla et al., 1994). Further comparison
of the potyviral cleavage sites revealed a conserved sequence VXXQ/A (G, S, E) around the
NIa protease cleavage sites. Based on these rules, two putative cleavage sites were identified in
the sequenced region of DsMV. The sequence VXLQ/G was found around the cleavage site of
the NIa and the Nib proteins, and the sequence VXLQ/A was found around the cleavage site
of the Nib and the coat proteins. This conserved cleavage sequence has also been found in
SbMV (Jayaram et al., 1992), BCMV isolates (Khan et al., 1993), and PStV (Gunasinghe et
al., 1994), suggesting a close relationship among these viral proteases.
Comparison of Nib proteins of different potyviruses have revealed that this protein is
the most conserved of the individual potyviral proteins (Shukla et al., 1994). The DSMV-Chl
Nib protein is 83-85% similar to the analogous proteins of the members in the BCMV
subgroup, and 72-76% similar to the other potyviruses compared (Table 2-4). The Nib protein
of potyviruses contains the conserved motif SGXXXTXXXNT-18-37aa-GDD, which is
conserved in both animal and plant positive-stranded viral RNA-dependent RNA polymerase
(Kamer & Argos, 1984). This motif was present in the Nib protein of DsMV as
SGQPSTWDNT-30aa-GDD in a position analogous to that of other sequenced potyviruses
when they were aligned according to the sequenced homology. A second consensus motif,
YCDADGS, which is also believed to be involved in the putative polymerase activity (Allison
et al., 1986; Domier et al., 1986) was present in the Nib protein of DsMV as YCHADGS.
When compared with other potyviruses, the motif YCHADGS is present in the Nib proteins in

64
the members of the BCMV subgroup, while the motif YCDADGS are present in all the other
potyviruses compared.
The CP sequences of potyviruses are highly conserved throughout most of the
sequence but diverge in sequence and length at the N-terminal region. The CP sequence of
DsMV-Chl is approximately 80% similar to those of the BCMV subgroup and ranged from 67
to 79% similar to those of other potyviruses compared. The DsMV isolates displayed higher
levels of homology in the CP sequences (92-96%). From phylogenetic analysis using PAUP, it
is clear that DsMV is a distinct virus, albeit relatively close to the potyviruses in the BCMV
subgroup.
According to the CP sequence, DsMV-Chl was not expected to be aphid-
transmissible, since it did not have the DAG sequence in the N-terminus portion of the CP as is
typical for aphid-transmissible potyviruses (Harrison & Robinson, 1988). Instead, it had the
DAR at the N-terminal region of the coat protein. However, when the aphid transmission tests
were conducted using DsMV-Chl from the infected caladium as virus source, this isolate
proved to be aphid transmissible. Furthermore, when the same isolate was cloned by RT-PCR
from the original host (caladium cultivar Candidum’) and sequenced, the triplet DAG rather
than DAR was present. Kositratana reported (1985) that a California DsMV isolate from
Chinese evergreen plants was not aphid-transmissible from infected P. selloum plants to healthy
P. selloum seedlings, which might also resulted from the mutation at the DAG triplet. It is
probable that mutation at this triplet was frequent, due to the propagation of a variant in P.

65
selloum seedlings. This variant might have been present in the original DsMV infected
caladium plants, or it could have been the result of a single point mutation (GGG to AGG).
The antiserum against the E. coli expressed CP of DsMV-Chl reacted with DsMV
isolates and other potyviruses tested in a manner similar to that of the DsMV-FL antiserum
obtained by Abo El-Nil et al. (1977). The DsMV antisera not only reacted with its homologous
isolates, but also with most potyviruses tested, which indicated that the close relationship of
DsMV with these other potyviruses. The expression of the CP gene in vitro provided a suitable
alternative for obtaining immunogen for antiserum production to this virus, which thus far has
been difficult by conventional means.

CHAPTER 3
VARIABILITY OF COAT PROTEINS AMONG ISOLATES
OF DASHEEN MOSAIC VIRUS
IntroductioD
Many cultivated aroids have become ubiquitously infected with dasheen mosaic
virus throughout the world, since they are exclusively propagated by vegetative means and
thus can harbor the virus indefinitely (Zettler & Hartman, 1977). Although DsMV has been
reported from many countries, the relationships between isolates have not yet been studied
extensively. A severe DsMV isolate of taro has been reported in French Polynesia
(Jackson, 1982). Biological and serological differences between isolates were noticed in
infected taro from Egypt and Florida (Abo El-Nil et al., 1977), and between Florida and Fiji
isolates of taro (Abo EL-Nil et al., 1977). The serological difference between a California
isolate from Chinese evergreen and two isolates from taro, Florida isolate and Fiji isolate
(Kositratana, 1985). It has been reported that the estimated molecular weights of DsMV
coat protein varied among isolates from different hosts (Li et al., 1992; Pappu et al.,
1994b), and this variability could be associated with diversity on the N-terminal region of
the CPs (Pappu et al., 1994b).
The accumulating body of knowledge of coat protein sequences has been used by
various authors to differentiate potyviruses and their strains. Comparisons of the growing
number of potyviruses sequenced revealed that distinct potyviruses show only 38-71%
66

67
sequence homology in their coat proteins, whereas this homology is greater than 90% among
strains belonging to the same virus (Shukla & Ward, 1988, 1989). Furthermore, the 3’ non¬
coding regions (3’-NCRs) of different potyviruses also display a high degree of sequence
variation (similarity of 39-45% only), whereas sequences are highly conserved between virus
strains (similarities of 83% and more). Recently, the coat protein and the 3’-NCR sequences of
four DsMV isolates (Pappu et al., 1994a; Li et al., 1994; this study) are available to be
compared.
Materials and Methods
Antigens
Florida isolates of DsMV used in this study were DsMV-Ce from taro (Colocasia
esculenta), and DsMV-Chl, -Ch2, -Ch3 from three cultivars of caladium (Caladium
hortulanum), 'Candidum’, 'Carolyn Whorton’ and 'Frieda Hemple’, respectively. The
calla lily (Zantedeschia aethiopica) isolate, DsMV-Za, was from California; and the
cocoyam (Xanthosoma caracú) isolate, DsMV-Xc, was from Puerto Rico. These isolates
were maintained in their original hosts throughout this investigation. The isolates were
also maintained in mechanically inoculated P. selloum seedlings throughout the study.
Symptoms of P. selloum usually appeared 2 weeks after inoculation, and the first
symptomatic leaf formed after inoculation was routinely tested.
Antigens of PRSV-W, PStV, PepMoV, PVY, TEV, WMV-2 and ZYMV were
provided by D. E. Purcifull (Department of Plant Pathology, University of Florida,

68
Gainesville). TVMV was from T. P. Pirone (Department of Plant Pathology, University of
Kentucky, Lexington). A Puerto Rican passionfruit potyvirus (Bird et al., 1991) was
provided by A. C. Monllor (Department of Crop Protection, University of Puerto Rico,
Rio Piedras). Also tested in this investigation were antigens of a gladiolus isolate of
BYMV (Nagel et al., 1983), bidens mottle collected from Bidens pilosa in the campus of
the University of Florida (Gainesville), and two strains of PMoV from peanut and
bambarra groundnut (Li et al., 1991).
Antisera
The purified DsMV-FL IgG of Abo El-Nil et al. (1977) was routinely used in this
study. Antisera of B1CMV, PRSV-W, PMoV, PStV, PVY, TEV, WMV-2 and ZYMV
were provided by D. E. Purcifull. Antisera to the Puerto Rican passionfruit potyvirus was
provided by A. C. Monllor. The PTY 1 potyvirus group cross reactive monoclonal
antiserum (PTY 1) was purchased from Agdia, Inc. (Elkhart, IN).
Propagations and Analysis of DsMV Isolates
Each DsMV isolate in its original host was maintained in a greenhouse. The leaf
samples were collected from infected plants and tested by Western blotting as described in
Chapter 4.
Six DsMV isolates, -Chi, -Ch2, -Ch3, -Cel, -Xc and -Za were used to inoculate
Philodendron selloum seedlings at the 7-8 leaf stage in the spring months of 1991. Each

69
isolate was then serially transferred at least twice to additional plants of P. selloum
seedlings. The first symptomatic leaves were collected from the infected plants of each
passage, and prepared for Western blotting.
Each isolate was also used to inoculate tissue culture-derived, virus-free plants of
taro, cocoyam, and the caladium cultivars 'Candidum’, 'Carolyn Whorton’, 'Frieda
Hemple’ and 'Rosebud’. The leaf tissues of the infected plants were prepared for and
tested by Western blotting.
Cloning and Nucleotide Sequencing of PCR-amplified CP Genes
The CP genes of the DsMV isolates Chi a and Ch2 were obtained by RT-PCR as
described in Chapter 2. The DsMV-Chla was from caladium cultivar 'Candidum’ which
was the same host from which DsMV-Chl was isolated, and -Ch2 was from caladium
cultivar 'Carolyn Whorton’. After electrophoresis, the desired amplified CP fragments
were isolated by using Prep-A-Gene Kit (Bio-Rad Laboratories, Hercules, CA), ligated
into pGEM-T vector (Promega Co., Madison, WI), and transformed into competent
Escherichia coli DH5a cells. The recombinant colonies were screened by the blue-white
color reaction. The plasmid preparations from the selected clones were then sequenced by
the termination method (Untited States Biochemical, Cleveland, OH) using T7, SP6 vector
primers and DsMV CP-specific internal primers. The nucleotide sequences were
determined for both strands.

70
Sequence and Comparison of the CP and the 3’-NCR
The nucleotide sequences of the coat protein genes and the 3 ’ non-coding regions
of three caladium isolates, Chi, Chi a, Ch2, and the two taro isolates, LA and TEN,
sequenced by Pappu et al. (1994b) were compiled, and analyzed. The Chi a isolate was
cloned from the original host of the DsMV-Chl, caladium cultivar 'Candidum’ by RT-
PCR. The level of the sequence relatedness was compared using Pileup available in the
GCG program package from the University of Wisconsin (Devereux et al., 1984).
Results
Symptoms in P. selloum
Each of six isolates tested induced systematic vein chlorosis in the first and/or
second leaves of P. selloum after mechanical inoculation. However, the isolates DsMV-
Ce, -Chi, and -Ch2 induced more severe symptoms in P. selloum than those of the Ch3,
Xc and Za isolates. The mild isolates induced chlorotic spots in the first symptomatic
leaves, whereas severe isolates induced pronounced stunting. Similar symptom differences
among DsMV isolates in P. selloum have been described by Abo El-Nil et al. (1977) and
Wisler et al. (1978).

71
The Coat Proteins of DsMV in Their Original Hosts
The estimated CP molecular weight (MW) of each of six DsMV isolates from their
original hosts varied (Fig. 3-1). In Western blots using DsMV antiserum, the respective
highest CP MW values for the isolates Chi, Ch2, Ch3, Ce, Xc, and Za were 44, 46, 38,
44, 47 and 43 kDa, whereas values for the other eleven potyviruses tested were much
lower, ranging from 31 kDa for TEV to 36 kDa for the Puerto Rican passionfruit virus
(Fig. 3-2). Similar results were noticed when polyclonal antisera of B1CMV, PRSV-W,
PMoV, PStV, TEV, WMV-2, ZYMV, and the Puerto Rican passionfruit potyvirus, were
tested. In reciprocal tests with DsMV and two PMoV strains from peanut and bambarra
groundnut, homologous reactions were much stronger than heterologous ones. Likewise,
homologous reactions were stronger than heterologous reactions when two PMoV strains
were compared against the other potyviruses (i.e. PRSV-W, PStV, TEV, WMV-2, and
the Puerto Rican passionfruit potyvirus).
The Coat Proteins of DsMV Isolates in Other Hosts
The CP MWs corresponding to those noted in their respective original hosts were
detected for each of six DsMV isolates infecting P. selloum. Each isolate was manually
inoculated to plants of P. selloum, caladium, cocoyam and taro (Fig. 3-3). Similarly, after
two or more serial passages through manually inoculated P. selloum seedlings, respective
CP MW values remained consistent for each of the DsMV isolates tested (Fig. 3-4).

72
12345 67 89
97 K
68 K
43 K
29 K
Fig. 3-1. Western blotting analysis of the coat proteins of dasheen mosaic virus (DsMV)
isolates from their original hosts: lane 1, healthy Colocasia esculenta, lane 2, BRL protein
standard; lane 3, Xanthosoma caracú (Xc); lane 4, Colocasia esculenta (Ce); lane 5,
Caladium hortulanum Carolyn Whorton’ (Ch2); lane 6, C. hortulanum 'Frieda Hemple’
(Ch3); lane 7, C. hortulanum 'Candidum’ (Chi); and lane 8, Zantedeschia aethiopica
(Za). Proteins were electrophoresed in a 10% sodium dodecyl sulfate polyacrylamide gel.
After electrophoresis, the proteins were blotted onto a nitrocellulose membrane and
reacted with DsMV-FL antiserum, and then detected with phosphatase-conjugated goat
anti-rabbit antibodies.

73
1 23 4 56789 10 11
68 K
43 K
29 K
Fig. 3-2. Western blotting analysis of the Chi isolate of dasheen mosaic virus (DsMV-
Chl) and other potyviruses: lane 1, healthy Philodendron sellounr, lane 2, BRL protein
standard; lane 3, DsMV-Chl; lane 4, tobacco etch virus; lane 5, passionfruit potyvirus;
lane 6, watermelon mosaic virus 2; lane 7, papaya ringspot virus type W; lane 8, zucchini
yellow mosaic virus; lane 9, pepper mottle virus; lane 9, potato virus Y; lane 10, bean
yellow mosaic virus (gladiolus strain); lane 11, bidens mottle virus. Proteins were
electrophoresed in a 10% sodium dodecyl sulfate polyacrylamide gel. After
electrophoresis, the proteins were blotted onto a nitrocellulose membrane and reacted by
DsMV-FL antiserum, and then detected with phosphatase-conjugated goat anti-rabbit
antibodies.

74
1 23 4. 56789
97k
68k
43k
29k
Fig. 3-3. Western blotting analysis of the Chi isolate of dasheen mosaic virus (DsMV-
Chl) transferred to several different hosts: lane 1, BRL protein standard; lane 2, healthy
Philodendron selloum; lane 3, Xanthosoma caracú; lane 4, Colocasia esculenta, lane 5,
Caladium hortulanum 'Carolyn Whorton’; lane 6, C. hortulanum 'Candidum’; lane 7, C.
hortulanum 'Candidum’; lane 8, C. hortulanum 'Frieda Hemple’; lane 9, healthy C.
hortulanum 'Candidum’. Proteins were electrophoresed in a 10% sodium dodecyl sulfate
polyacrylamide gel. After electrophoresis, the proteins were blotted onto a nitrocellulose
membrane and reacted with DsMV-FL antiserum, and then detected with phosphatase-
conjugated goat anti-rabbit antibodies.

75
1 2 3 4 5 6 7 8 9 10 11 12 13 14
68 K
Fig. 3-4. Western blotting analysis of four dasheen mosaic virus (DsMV) isolates serially
propagated in Philodendron selloum seedlings: lane 1, BRL protein marker; lanes 2 and
14, healthy P. selloum; lanes 3-5, Cel isolate from Colocasia esculenta; lanes 6-8, Chi
isolate from Caladium hortulanum Candidum’; lanes 9-11, Xc isolate from Xanthosoma
caracú; and lanes 12-13, Ch2 isolate from C. hortulanum 'Carolyn Whorton’. The
proteins were electrophoresed in a 10% sodium dodecyl sulfate polyacrylamide gel. After
electrophoresis, the proteins were blotted onto a nitrocellulose membrane and detected
with DsMV-FL antiserum, and then detected with phosphatase-conjugated goat anti-rabbit
antibodies.

76
Comparison of the Coat Protein Sequences
The alignment of the CP sequences of the caladium isolates, Chi, Chi a, Ch2, and
the taro isolates, LA and TEN (Pappu et al., 1994b) showed (Fig. 3-5). The amino acid
sequences were deduced from the nucleotide sequences. Fig. 3-6 shows the multiple
alignment of the predicted amino acid sequences for these DsMV isolates. Sequence
homologies of CP genes among these DsMV isolates were 84% to 96% at the nucleotide
level, and 92% to 96% at the amino acid level. However, the CP of the LA isolate (330
amino acids) was 15-16 amino acids longer than those of the three other isolates studied:
314 amino acids for isolates Chi and Ch2, and 315 amino acids for the TEN isolate (Fig.
3-6). These differences can be attributed to a 12-base addition and a 57-60 base deletion
at the 5’-terminal region of the CP gene of the Chi, Ch2 and TEN isolates. The addition
occured between positions + 49 and + 50 and corresponded to amino acid residues of 17
to 20 of the CPs of the Chi, Ch2 and TEN isolates. The deletion was from +94 (+97 for
the isolate TEN) to +154, corresponding to amino acid residues 32 (33 for isolate TEN)
to 51 of the LA isolate. The addition and deletion occurred within the unusual threonine
and asparagine rich portion of the N-terminal region.
Among isolates Chi, Chi a, Ch2 and TEN, the N-terminal region of the coat
proteins appeared highly conserved, both in length (76-77 amino acids) and in sequence
(similarity 71% to 78%). While the N-terminal region of the LA isolate was larger in size
(92 amino acids), its sequence similarity was 71-73%. Furthermore, the CP core and the
C-terminal region of the Chi, Ch2, LA and TEN isolates were all fairly conserved both in

Fig. 3-5. Comparison of nucleotide sequences of the coat protein (CP) gene
of dasheen mosaic virus isolates Chi and Chi a (from Caladium hortulanum
'Candidum’), Ch2 (from Caladium hortulanum 'Carolyn Whorton’), LA and
TEN (from Colocasia esculenta). Nucleotide coding for the N-terminal regions
of the CPs are underlined, and the stop codons are shown by asterisks.

78
1
DsMV-LA GCTGATGACA
DsMV-TEN GCAGATGACA
DsMV-Chl GCTGATGATA
DsMV-Chla GCTGATGATA
DsMV-Ch2 pCTGATGATA
CAGTTGATGC AGGGAATCAG
CAGTTGATGC AGGGAACCAG
CAGTTGATGC AAGGAAAAAC
CAGTTGATGC AGGGAAAAAC
CAGTTGATGC AGGGAAGAAT
N-terminus
48
AACAATACCA ATAAAACA..
AATAATACTA ATAAAACAAC
AACAATACTA CAAAAACAAC
AACAACACTA CAAAAACAAC
AGCAAAAACA CAAAAACAAC
49 88
ACCCCTGCAG CTGGTGGTGG TAACAACACA AATACCAACA
CGAAACAAAG ACTCCTGCAG CAAGTGGTGG TAACAACACA AAT
TGAAACAAAA ACACCTGCAA CGGGTGGTGG GAACAACACA AAC
TGAAACAAAA ACACCTGCAA CGGGCGATGG GAACAACACA AAC
TGAAACAAAA ACTCCTGCAT CGGGTCGTGG CAACAACACC AAC
89 138
CCAATACTGG TAACAACACA AACACCAATA CCAGTACTGG TAACAATACA
139 188
AACACCAACA CCAACACTAA TACCAACACA ACCAATAATA ATCCTCCACC
AATACTCCAC CACCACCCGC AAACAACACA ACTAATAACA ATCCTCCACC
. . .AACAACA CGCCACCTGT AGATAACACA ACCAACAATA ATCCTCCACC
. . . GACAACA CGCCACCTGT AGGTAACACA ACCAACAATA ATCCTCCACC
AACAGCACTA CACCACCTGC AAATAACAAC ACAAACAACA ATCCTCCACC
189 238
GCCACCACCG GCGGCACCAA AAGCTTCAGA GACGCCAGCA AACAAGCAGG
GCCACCACCG ACGGCACCAA AGGCGACAGA GACGCCAGCC AACACACAAG
GCCACCACCG GCGGTTACAA AGGCAACAGA GATACCCGCC AATAAGCAAG
ACCACCACCG GCGGTTCCAA AGGTAGCAGA GATACCCGCC AATAAGCAAG
ACCGCCACCA GGCGCGCCAA AAGCAACAGA GACGCCGGCT AACAAACAAG
239 288
TAGTCCCCAC AACAAGTGAT AAAGGTAAGG AGATTGTTAA AGATGTCAAT
TAGTCCCAAC GGCAAGTGGG AAAGGTAAGG AAGTTGTTAA AGATGTCAAC
TGGTCCCAGC AGCAAGTGAG AAAGGTAAGG AAATTGTGAA AGATGTTAAC
TGGTCCCAGC AGCAAGT GAG AAAGGTAAGG AAATTGTGAA AGAT GTTAAC
TCGTCCCCCA AACAAATGAG AAACGGAAGGjAAGTGGTCAA AGATGTCAAC
Fig. 3-5~Continued

79
289
DsMV-LA GCTGGCACAA
DsMV-TEN GCTGGCACAA
DsMV-Chl GCTGGCACTA
DsMV-Chla GCTGGCACTA
DsMV-Ch2 GCTGGCACCA
339
TAAAATGAAC
CAAGATGAAT
CAAAATGAAT
CAAAACGAAT
CAAAATGAAC
389
ATTTAATCGA
ATTTAATCGA
ATTTAATCGA
ATTTAATCGA
ACTTGATCGA
439
AC CCAC AC AC
ACC CACACAC
ACCCACACTC
ACCCACACTC
ACCCACACAC
489
GCTCGAGGAT
GCTTGAGGAC
GCTTGAGGAT
GCTTGAGGAT
GCTCGAGGAT
539
GCATCGACAA
GCATCGATAA
GCAT C GATAA
GAACATCACC
GCATCGACAA
GTGGAACATA CTCTGTACCT
GTGGCACATA TTCTGTACCT
GTGGCACACA CTCTGTACCT
GTGGCACATA CTCTGTACCT
GTGGCACGTA CTCTGTACCT
TTGCCTTTAG TCAAAGGCAA
TTACCTTTAG TTAAAGGTAA
TTACCTTTAG TTAAAGGTAA
TTACCTTTAG TTAAAGGTAA
TTACCTTTAG TTAAAGGTAA
GCACAAACCT GAGCAGCGTG
GTACAAACCC GAACAGC GT G
GTACAAGCCA GAACAGCGCG
GTACAAGCCA GAACAGCGTG
GTACAAACCA GAACAGCGAG
AGTTTGAGGT CTGGTACAAT
AATTCGAGGT ATGGTACAAC
AATTTGAAGT CTGGTACAAT
AATTTGAAGT CTGGTACAAT
AATTTGAGGT CTGGTACAAT
GAGCAGATGC ATATTGTTAT
GAGCAGATGC ACATTGTAAT
GAGCAGATGC ACATAGTTAT
GAGCAGATGC ACATAGTTAT
GAGCAGATGC ACATTGTTAT
TGGAACATCA CCTGACATTA
TGGAACATCA CCCGATATCA
TGGAACATCA CCTGATATCA
TGATATCAAC GGGGCTTGGG
TGGAACTTCA CCCGACATCA
338
CGGTTAAACA AAATCACAAA
CGATTGAATA AAATCACAAA
CGGTTGAATA GAATCACAAA
CGGTTGAATA AAATCACAAA
CGATTAAACA GAATCACACA
388
GTGCATTTTA AATTTAAATC
GTGCATTTTA AATTTAAACC
ATGCATTCTA AATTTGAATC
ATGCATTTTA AATTTGAATC
ATGCATTTTG CATTTAAATC
438
ACATATTCAA CACCAGAGCC
ACATCTTCAA TACCAGAGCC
ACATATTCAA TAC CAGAGC C
ACATATTCAA TACCAGAGCC
ACATCTTCAA TACCAGAGCC
488
GCTGTCAAGA GGGAATATGA
GCCGTTAAGA GGGAGTACGA
GCTGTCAAGA GAGAATACGA
GCTGTCAAGA GAGAATACGA
GCTGTCAAGA GGGAATATGA
538
GAATGGTTTC ATGGTTTGGT
GAATGGTTTC ATGGTTTGGT
GAATGGTTTT ATGGTTTGGT
GAATGGTTTT ATGGTTTGGT
GAACGGTTTC ATGGTTTGGT
588
ACGGGGCTTG GGTGATGATG
ACGGGGCTTG GGTGATGATG
ACGGGGCTTG GGTGATGATG
TGATGATGGC ATCGATAGTG
ACGGGGCTTG GGTGATGATG
Fig. 3-5—Continued

80
589
DsMV-LA GATGGAAATG ATCAAATTGA
DsMV-TEN GACGGAAACG ATCAGATTGA
DsMV-Chl GACGGAAACG ATCAAATTGA
DsMV-Chla GATGGAAGTG ATCAAATTGA
DsMV-Ch2 GACGGAAATG ATCAAATTGA
639
AAAACCCACC TTGCGTCAGA
AAAACCCACC TTGCGTCAGA
AAAACCAACC TTGCGTCAGA
AAAACCAACT TTGCGTCAGA
AAGACCCACC TTGCGTCAGA
689
CTTATATTGA ACTGAGAAAT
CTTATATCGA ACCGAGGAAT
CATACATTGA ACTGAGAAAC
CATACATTGA ATTGAGGAAC
CGTACATTGA ACTGAGAAAT
739
CTTATTCGCA ACTTACGTGA
CTCATTCGCA ATCTACGTGA
CTTATTCGCA ATTTACGTGA
CTCATCCGCA ACTTACGTGA
CTAATTCGCA ACTTACGTGA
789
CTATGAAGTT AACTCTAAAA
CTATGAGGTC AATTCTAAAA
TTATGAGGTC AATTCTAAAA
CTATGAGGTC AATTCTAAAA
CTATGAAGTC AATTCTAAGA
839
AAATGAAGGC CGCTGCACTT
AAATGAAGGC CGCTGCGCTC
AAATGAAGGC GGCTGCACTC
GGATGAAGGC CGCTGCACTC
AGATGAAGGC TGCTGCACTC
638
ATACCCGTTA AAGCCGATTG TGGAGAATGC
ATACCCGTTA AAACCAATTG TGGAAAATGC
ATACCCGTTG AAGCCAATTG TTGAAAATGC
ATACCCGTTA AAACCAATTG TCGAAAATGC
ATACCCGTTA AAGCCGATCG TGGAAAATGC
688
TAATGCATCA CTTTTCTGAC GCAGCAGAGG
TAATGCATCA CTTTTCTGAC GCAGCAGAGG
TAATGCATCA CTTTTCTGAC GCAGCAGAGG
TTATGCATCA CTTTTCTGAC GCAGCAGAGG
TAATGCATCA CTTTTCTGAC GCAGCAGAGG
738
GCGGAAAAAC CATACATGCC TAGGTATGGT
GCGGAGAAAC CATACATGCC TAGGTATGGT
GCAGAGAAAC CGTATATGCC TAGATACGGT
GCGGAGAAAC CGTACATGCC TAGGTATGGT
GCGGAAAAAC CATACATGCC TAGGATAGGT
788
TGCAAGTCTC GCCCGGTACG CTTTCGACTT
TGCAAGTCTT GCCCGGTATG CTTTCGACTT
TGCAAGTCTC GCCCGGTATG CTTTTGACTT
TGCAAGTCTT GCCCGGTATG CTTTTGACTT
TGCAAGTCTC GCCCGGTATG CTTTCGACTT
838
CACCGGTCCG AGCAAGGGAG GCAGTTGCGC
CACCGGTGCG AGCGAGAGAA GCAGTCGCGC
CACCGGTGCG AGCAAGAGAA GCAGTTGCGC
CACCGGTGCG AGCAAGAGAA GCAGTTACGC
CGCCGGTACG AGCAAGAGAG GCAGTAGCGC
888
TCTAACGTTA CCACTAGGTT GTTTGGTTTG
TCCAACGTTA CCACTACCTT GTTTGGTTTG
TCTAACGTTA CCACTAGGTT GTTTGGTTTG
TCTAACGTTA CCACTAGGTT GTTTGGTTTG
TCTAACGTTA CCACTAGGTT GTTTGGTTTG
Fig. 3-5—Continued

81
889
DsMV-LA GATGGTAACG
DsMV-TEN GATGGTAACG
DsMV-Chl GATGGTAACG
DsMV-Chla GATGGTAACG
DsMV-Ch2 GATGGTAACG
939
AGACGTCACA
GGATGTCACG
AGACGTCACA
AGACGTCACA
AGACGTCACA
TTTCGACTTC AAGCGAGAAC
TTTCAACTTC AAGCGAGAAC
TTTCAACTTC AAGCGAGAAC
TTTCAACTTC AAGCGAGAAC
TTTCAACTTC AAGCGAGAAC
CCCAACATGC ATACATTGCT
CCAAATATGC ACACCTTGCT
CCAAACATGC ACACTTTACT
CCAAACATGC ACACTTTACT
CCAAACATGC ACACTTTACT
938
ACTGAAAGGC ACACTGCAAA
ACTGAAAGGC ATACTGCAAA
ACTGAAAGGC ACACTGCAAA
ACTGAAAGGC ACACTGCAAA
ACTGGAAAGC ACACTGCAAA
990
★
TGGTGTGGCA TCTCCACAGTAA
CGGCGTAGCG CCTCCGCAGTAA
TGGTGTTTCG TCTCCGCAGTAA
TGGCGTTTCG TCTCCGCAGTAA
TGGCGTTTCG TCTCCGCAGTAA
Fig. 3-5—Continued

82
1 46
DsMV-LA ADDTVDAGNQ NNTNKT.... TRAAGGGNNT NTNTNTGNNT NTNTSTGNNT
DsMV-TEN TETK S
DsMV-Chl RKN T—TETK -P-T
DsMV-Chla TETK -P-T-D
DsMV-Ch2 KN SKNT—TETK -P-S-R N
47 96
NTNTNTNTNT TNNNPPPPPP AAPKASEIPA NKQWPTTSD KGKEIVKDVN
— PP-PAN— TA -T A-G V
• -N-PPVD— -VT—T AA-E
.D G— V
-ST-PPAN-N G T-T— Q-NE -R--V
97 146
AGTSGTYSVP RLNKITNKMN LPLVKGKCIL NLNHLIEYKP EQRDIFNTRA
H R
T_
R__H H
147 196
THTQFEVWYN AVKREYELED EQMHIVMNGF MVWCIDNGTS PDINGAWVMM
S
197 246
DGNDQIEYPL KPIVENAKPT LRQIMHHFSD AAEAYIELRN AEKPYMPRYG
— S
R__ j_
247 296
LIRNLRDASL ARYAFDFYEV NSKTPVRARE AVAQMKAAAL SNVTTRLFGL
TR-
297 330
DGNVSTSSEN TERHTAKDVT PNMHTLLGVS SPQ*
_ _ ★
★
-tc
Fig. 3-6. Comparison of amino acid sequences of coat proteins of dasheen mosaic
virus isolates LA, TEN, Chi, Chi a and Ch2. Identical amino acids are shown by
dashes and gaps are indicated by dots.

83
length (237 amino acids) and in sequence (98% at the amino acid level) (Fig. 3-6). The
overall sequence similarity of the coat proteins was quite high and comparable to identities
observed between strains of a single potyvirus species (Shukla & Ward, 1988; Ward et al.,
1992).
The 3’-NCR of the Chi, Ch2 and LA isolates were all similar in length (246, 243
and 247 nt, respectively). The sequence identity in this region ranged from 79-83% (Fig.
3-7).
Discussion
Western blotting analysis confirmed that the CP of DsMV is considerably larger
than those of most potyviruses (Abo El-Nil et al., 1978). The CP MWs of six DsMV
isolates were estimated to be 38-47 kDa, whereas ten other potyviruses used in
comparisons had estimated MWs of 31-36 kDa in Western blotting analyses. These
variations apparently reflect genomic differences between DsMV isolates since the specific
CP MW for each isolate is constant after serial passages through different hosts. Whereas
most potyviruses, including konjak mosaic (Shimoyama et al., 1992), have CP MWs of
about 32-36 kDa, those of DsMV isolates have values of 38-47 kDa. Abo El-Nil et al.
(1977) suggested that the high CP MW values of DsMV was associated with the N-
terminal portion of the coat protein. The availability of the CP sequences of several DsMV
isolates (Pappu et al., 1994a, b; this study) and of other potyviruses may help to confirm
this hypothesis. Indeed, the DsMV CPs of 314 to 330 amino acids noted in this study are

84
1
DsMV-Chl AGGTCTGGTA
DsMV-Chla AGGTCTGGTA
DsMV-Ch2 AGGTCTGGTA
DsMV-LA AGGTCTGGTA
51
TTTATATAAA
TTTACATAAA
TATATTTAAA
TATATTTAAA
101
ACAGCGTGGT
ACAGAGTGGT
ACAGTGTGTT
ACAGTGTGTT
151
AC.GTCCTTT
ACATTCCTTT
AC.GTCCTTT
AC.GTCCTTT
201
CCGCAAG...
CCGTAAG...
CCGTTGGTGC
CCGTTGGTGC
AACAGGGCCG ACAGTTATTG
AACAGG..CC ACAGTTATTG
AACAGG..CC ACAGTTATTG
AACAGA..GA CCACTTATCG
GTATTGTTTG TATTCAAGTA
GTATTGTTTG TATTCAAGTA
GTACTGTTTG TATTCAGGTA
GTACTGTTTG TTTTCAAGTT
TTTCCACCGA TGTGGAGTTG
TTTCCACCGA TGTGGAGA.G
TTTCCACCGA TGTGGAGAGG
TTTCCACCGA TGTGGAGAGG
ATGTATTTGA AAACTACTGA
AAATGTTTGA AAACTACTGA
AAATATTTGG AAACTGCTGA
AAATATTTGG AAACTGCTGA
GCGATGGGCG CGGTAGGCGA
..CCATGGCG CTGTAGGCGA
GCCACTGGCG CGGTAGGCGA
GCCACTGGCG CGGTAGGCGA
50
GCTCGCTGTT TGTAGTTTTA
GCTCGCTGTT TGTAGTTTTA
GCTCGCTGTC TGTAGTCTTA
TCTCGCTGTC TGTAGTTTTA
100
GTGCTATTTG GTTATAAACT
GTGCTATTTG ATTATAAACT
GTGTTATTTG ATTATAAACT
GTGGTATTTG ATTACAAACT
150
.GCTTTGCAC CCTATTATCT
TGCTATGCAT CCTACTATCT
TGCTATGCAC CCTACTATCT
TGCTATGCAC CCTACTATCT
200
ACTACTGCAC CTACGTCAGA
ACCACTGCAC CTACATCAGA
ACCACTGCAC CTACATCGGA
ACCACTGCAC CTACATCGGA
250
GACGCTTCGT GCACGGTGTT
GATGCTTCGT GCACGGTGTT
GATGCTTCGT GCACGGTGTT
GATGCTTCGT GCACGGTGTT
251
C
C
Fig. 3-7. Comparison of nucleotide sequences of the 3’-NCRs of dasheen mosaic
virus isolates Chi and Chi a, Ch2 and LA. Dots indicate the gaps for optimum
alignment.

85
relatively large for a potyvirus. However, the calculated CP MWs for four sequenced
isolates were from 34.6-36.9 kDa, which were close to those seen for other potyviruses.
Furthermore, the estimated MW of the CP expressed in E. coli was smaller (39 kDa, as
reported in chapter 2) than that (44 kDa) from infected plants, even though the expressed
CP had a fusion protein of 15 amino acids long. The similar differences between CP MW
(36 kDa) observed in SDS-PAGE and that calculated using sequence data (33 kDa) have
been reported for PRSV-P (Quemada et al., 1990a; Yeh et al., 1992).
There are several factors that could account for such apparent discrepancies in
MW. First, they might reflect the unusual amino acid composition of the DsMV CP
(Pappu et al., 1994a; Li et al., 1994; this study). The DsMV CP is different from those of
other potyviruses in that it is quite threonine and asparagine-rich at the N-terminal region.
These two amino acid residues account for 31.8-50% of the amino acid residues at the N-
terminal region of the CPs. In addition to a 6-proline sequence at the N-terminal region,
there are also many more (8-10) potential V-glycosylation sites which are clustered near
both the N- and the C-termini of the DsMV CP (Pappu et al., 1994a; this study) than in
the CPs of most potyviruses. These unusual sequences may affect behavior of DsMV CP
in SDS-PAGE, although theoretically no such influence should exist based on the
presumption that proteins are completely denatured under such conditions. Several short
proline stretches and/or a seven-proline stretch were also found at the N-terminal regions
of several sweet potato potyviruses (Colinet & Lepoivre, 1994). The CP MWs of these
viruses in SDS-PAGE, however, corresponded closely to those calculated from their

86
sequences of 316-355 amino acids, thereby indicating that proline stretches had no effect
on the MWs of the proteins in SDS-PAGE.
Another possibility is that some chemical components in aroids may have effects
on the migration rate of the DsMV CP in SDS-PAGE, causing such an abnormal behavior.
This possibility could be not tested, however, because the host range of DsMV is largely
restricted to aroids. Clearly, attempts to purify this virus from different aroids were
seriously impeded by their unusually viscous sap.
The variability of the CP MWs among different isolates, contrasts with the studies
of other potyvirus strains, such as ZYMV (Wisler, 1992) and PRSV (data not shown),
which appear to be much more uniform in size. Sequence analysis of the DsMV CPs
revealed a deletion and an addition at the N-terminal regions of the Chi, Ch2 and TEN
isolates, which, when compared to the LA isolate, consisted of a 16-amino-acid deletion.
The deletions or duplications at the N-terminal region of the DsMV CP among different
isolates may contribute to the variability of the coat protein sizes. The significance of these
deletions or duplications to the evolution of DsMV has been discussed by Pappu et al.
(1994). Similar sequence diversities at the N-terminal region of the CPs were also
reported for strains of TuMV (Sano et al., 1992), SCMV (Xiao et al., 1993), and BCMV
(Khanet al., 1993).
The availability of the sequences of the coat protein and the 3’-NCR of the DsMV
isolates, Chi, Ch2, LA and TEN, allowed an assessment to be made of their relationship
at the sequence level. As has been for reported for other potyviruses (Shukla et al., 1988),

87
the amino acid variation among the CPs of the four DsMV isolates occurs primarily at the
N-terminal region, while the sequence of the core and C-terminal regions are highly
conserved (Fig. 3-6). The CP sequences of these isolates showed similarities of 92% to
96%, which are, by convention, considered to be values delineated for strains of a given
virus (Shukla et al., 1988). Furthermore, the similarities of the 3’-NCR sequences of the
isolates Chi, Ch2 and LA were 79-83%, indicating that these isolates are very close to
each other.
We confirmed earlier studies (Abo El-Nil et al., 1977; Wisler et al., 1978) that
some isolates of DsMV can induce more severe stunting symptoms in P. selloum than
others, but CP MW is apparently not correlated with this properties. For example, the
respective isolates with the highest and lowest CP MW values, DsMV-Xc (47 lcDa) and
DsMV-Ch3 (38 kDa) induced mild symptoms in P. selloum, whereas the four other
isolates (Chi, Ch2, Cel and Za) that induced more severe stunting symptoms had
intermediate CP MWs. However, relationships between the symptom differences in P.
selloum and CP sequence similarity of these isolates could not be established since CPs of
the Ch3, Xc and Za isolates have yet to be sequenced.
The coat protein variability of DsMV isolates does not appear to compromise the
ability to detect different DsMV isolates serologically. Abo El-Nil et al. (1977) noted
strong precipitin reactions between isolates with only barely perceptible reciprocal spur
formation in SDS-immunodiffusion tests. Likewise, each of the DsMV isolates could

88
readily be detected in ELISA and Western blot tests in this study, as could several taro
isolates of DsMV isolates from different geographical areas (Zettler et al., 1987).
Despite the CP MW differences between DsMV and other potyviruses (except two
PMoV strains) reciprocal reactions in Western blotting analyses reveal close serological
relationships. The unusual composition of its CP apparently had no significant effect on
the ability of DsMV antiserum to react against many other potyviruses. Furthermore, the
antisera from two different DsMV isolates cross-reacted with other potyviruses, thereby
providing additional evidence that the unusual amino acid residues stretches at the DsMV
CP does not contain epitopes essential for detecting it serologically.

CHAPTER 4
DETECTION OF DASHEEN MOSAIC VIRUS IN AROID CROPS
Introduction
Plants infected with dasheen mosaic virus (DsMV) often express symptoms
intermittently (Zettler et al., 1978; Chase & Zettler, 1982), which presents a problem for the
detection of the virus based on visual symptoms alone. Also, DsMV is perpetuated and carried
over long distances through symptomless vegetative propagating materials. Development of
reliable and practical methods for detecting DsMV and effective therapeutic procedures are
essential for the international movement of disease-free aroid plants, especially if severe isolates
are involved (Jackson, 1982). Bioassays (growout tests and indicator hosts), electron
microscopy (EM) and immunodiffusion tests have been the methods most commonly used
previously for the detection of DsMV (Zettler & Hartman, 1986), although more recently,
enzyme-linked immunosorbent assay (ELISA), immunosorbent electron microscopy (ISEM)
and immuno-dot blotting for DsMV detection have also been used (Hu et al., 1995; Rodoni &
Moran, 1988; Zheng et al., 1988; Ko et al., 1986; Kositratana, 1985). Bioassay methods pose
practical problems for DsMV detection since this virus is largely confined to plants in the family
Araceae, and suitable indicator plants are not readily available (Zettler & Hartman, 1986).
Moreover, the bioassay methods are laborious, time-consuming, and require extensive
greenhouse space (Matthews, 1991). Seed of Philodendron selloum, the most widely used test
89

90
species, is available only on a seasonal basis and this species is not a local lesion host.
Philodendron verrucosum, a local lesion host (Tooyama, 1975), is a relatively rare plant
species, and it is not commercially available.
The antigenic properties of many plant viruses make it possible to detect them with a
high degree of sensitivity and specificity. A number of serological methods, such as
immunodiffusion tests, ISEM, ELISA, Western blotting, and immuno-dot blotting have been
developed for detection of plant viruses. Over the years, these techniques have been refined,
and there is an increasing availability of polyclonal and monoclonal antisera for conducting
these tests (Speigel et al., 1993).
Reverse transcription polymerase chain reaction (RT-PCR)-based assays have been
increasingly used for detection of plant RNA viruses due to their high sensitivities (Vunsh et al.,
1990; Wetzel et al., 1991a; Langeveld et al., 1991; Robertson et al., 1991; Rojas et al., 1993;
Rowhani et al., 1993; Colinet et al., 1994; Smith et al., 1994). With its relative simplicity and
high sensitivity, RT-PCR has good potential for detecting minute quantities of virus in plant
tissue. Determination of the 3’-terminal region of the DsMV genome (this study) has provided
us with the opportunity to detect this virus by RT-PCR.
Materials and Methods
DsMV Isolates
DsMV isolates from different hosts were collected and maintained in greenhouses for
study. The caladium (Caladium hortulanum) conns were collected from a commerial source in

91
Highlands County, Florida. Cocoyam (.Xanthosoma caracú) corms were from Costa Rica; and
the taro (Colocasia esculenta) corms were from Taiwan. Leaves of wild C. esculenta plants
were also collected from the campus of the University of Florida at Gainesville. The calla lily
(Zantedeschia aethiopica) plants were from Watsonville, CA DsMV isolates from these plants
were mechanically transmitted to Philodendron selloum seedlings. The infected plants
developed systemic chlorotic streaking along the veins of new leaves within 2-3 weeks after
inoculation.
Immunosorbent Electron Microscopy (I SEMI
Immunosorbent electron microscopy (ISEM) was performed by chopping a small piece
of leaf tissue into tiny pieces with a razor blade in a drop of 50 mM potassium phosphate
buffer, pH 7.2. The extract was incubated on a grid for 1 min, and then rinsed with potassium
phosphate buffer and water. DsMV-FL virion antiserum (Abo El-Nil et al., 1977) diluted
1:200 was added on the grid and incubated for 5 min. Following washing, protein A gold-
labeled solution was applied on the grid for 5 min. After washing, the grid was stained with 2%
uranyl acetate and viewed with a Hitachi H-600 transmission electron microscope. For thin
sections, leaf samples (1x2 mm) of P. selloum, caladium and cocoyam plants infected with
DsMV were fixed in 4% glutaraldehyde (in 0.1 M potassium phosphate buffer, pH 7.2), post-
fixed with 1% osmium tetroxide, dehydrated in an acetone series, and embedded in Spurr’s
epoxy resin. Sections were cut with a Sorvall MT2-B ultramicrotome (Du Pont Co.,
Wilmington, DE) and then stained with uranyl acetate and lead citrate.

92
Enzyme-linked Immunosorbent Assay (ELISA)
The DsMV antisera used in the ELISA tests were the DsMV-FL antiserum used by
Abo El-Nil et al. (1977) and the antiserum prepared in this study to CP expressed in
Escherichia coli. The PTY 1 cross-reactive monoclonal antibody was also used. The anti¬
rabbit and antimouse IgG used was obtained by the Sigma Chemical Co. (St. Louis, MO). The
ELISA procedure was as described by Clark and Adams (1977). To purify IgG from the
DsMV-FL virion antiserum, one ml of antiserum was diluted in 9 ml of distilled water. The IgG
was precipitated by adding an equal volume of saturated ammonium sulfate solution and
incubating it at room temperature for 30-60 min. The solution was then centrifuged at 10,000 g
for 10 min. The IgG precipitate was resuspended in 2 ml 1/2 strength phosphate-buffered saline
(PBS, 20 mM sodium phosphate-potassium phosphate buffer, pH 7.4, containing 3 mM
potassium chloride and 150 mM sodium chloride, pH 7.4) and dialyzed three times against 1/2
strength PBS at 4°C for 4 hr. The IgG was then fractionated through a DEAE Sephacel
column (Pharmacia, Uppsala, Sweden). The effluent was collected in fractions of 1 ml and
monitored by a spectrophotometer at 280 nm. The first peak of protein was collected and
adjusted to 1.4 OD. Purified DsMV-FL IgG was used either immediately for enzyme
conjugation or stored at -20°C for use as coating antibody. Type VII alkaline phosphatase
(Sigma Chemical) was centrifuged at 1,000 g for 10 min and the pellet was resuspended in
purified IgG preparation at a concentration of 1 mg/ml and at a ratio of 1:2 (enzyme:IgG). The
mixture was then dialyzed against PBS at 4°C, and then 25% aqueous glutaraldehyde was

93
added to make a final concentration of 0.05%. The mixture was incubated at room temperature
for 4 hr. After dialysis, bovine serum albumin (Sigma Chemical) was added to a final
concentration of 5 mg/ml. The conjugate was stored at 4°C for ELISA tests.
In indirect ELISA (I-ELISA) tests, samples were ground in CEP buffer [15 mM
sodium carbonate, 35 mM sodium bicarbonate, 0.02% polyvinyl pyrrolidone (PVP), and 0.2%
egg albumin (EA)] or coating buffer (12 mM sodium bicarbonate, 35 mM sodium carbonate,
pH 9.6) in a ratio of 1 to 10, and added to the wells of the Type II polystyrene microelisa plates
(Dynatech Labs, Inc., Chantilly, VA). For each well, 100 pi of sample was added. The plates
were incubated at 37°C for 1-2 hr and rinsed with four 5-minute washes in PBS, containing
0.05% Tween-20 (PBST). Fifty pi ofDsMV antibody diluted 1:500 (DsMV-FL antiserum) or
1:5000 (K coli expressed CP antiserum) or 1:1000 (PTY 1) in enzyme-conjugate buffer
(PBST, containing 2.0% polyvinyl pyrrolidone and 0.2% ovalbumin), was added and incubated
at 37°C for 1-2 hr. The plates were then rinsed four times as before. Fifty pi of 2 pg/ml
antirabbit IgG (for DsMV polyclonal antisera) or antimouse IgG (for monoclonal antiserum),
each diluted 1:3,000 in enzyme-conjugate buffer, was then added to appropriate wells. The
plates were incubated for 1-2 hr at 37°C and washed 5 times in PBST. Fifty pi of substrate (p-
nitrophenyl disodium phosphate, 1 mg/ml, Sigma Chemical) in substráete buffer at pH 9.8
(9.7% diethanolamine, Fisher Scientific, Fair Lawn, NJ) was added to the plates and incubated
at room temperature. Absorbance readings (405 nm) were taken on a Biotek automated
microplate reader, model EL 309 (Bio-Tek Instruments Inc., Winooski, VT) at fifteen minute
intervals for 1 hr.

94
For DAS-ELISA, coating buffer (200 pi) was added to plates and incubated for 1 hr at
37°C. The plates were then washed 3 times with PBST. One hundred pi of DsMV-FL
antiserum diluted 1:500 in the enzyme-conjugated buffer was added to the plates and incubated
at 37°C for 1-2 hr. The plates were washed four times with PBST. Fifty pi of the prepared
antigen was added to the plates and incubated at 37°C for 1-2 hr. The plates were washed four
times in PBST, and fifty pi of phosphatase-conjugated DsMV IgG was then added to the
plates. The plates were incubated at 37°C for 1-2 hr and washed five times in PBST. The
remainding steps were as described previously.
Western Blotting
Virus was detected by Western blotting as previously described (Li et al., 1990). Leaf
or petiole tissue (0.1 g) was minced and added (1:2.5, w/v) to SDS extraction buffer (62.5 mM
Tris buffer, pH 6.8, containing 2% SDS, 10% glycerol, and 5% 13-mercaptoethanol) in a 1.5-ml
microfUge tube. The samples were boiled for 2 min. The supernatant was saved and stored at -
20°C. Extracts were run through 10% SDS-acrylamide gel on a Mini-Protean II
Electrophoresis Cell (Bio-Rad Laboratories, Inc., Melville, NY) for 1.5 hr at 100-V constant
voltage. Separated proteins were transferred to nitrocellulose membranes (0.45p pore size,
from Bio-Rad Laboratories) by electroblotting in a Bio-Rad Mini Trans-Blot Cell (Model
200/2.0) for 1 hr. The blots were washed three times for 5 min in TBST buffer (20 mM Tris,
pH 7.5, containing 0.5 M NaCl and 0.05% Tween-20), soaked for 1 hr at room temperature in
1:500-5,000 dilution of antisera, and again washed three times, each for 5 min with TBST. The

95
blots were soaked at room temperature for 1 hr in a solution containing alkaline phosphatase-
conjugated goat antirabbit or antimouse IgG (1:1,000 dilution). The conjugate was detected
with 0.3 mg/ml nitro blue tetrazolium (Fisher Scientific, Pittsburgh, PA) and 0.15 mg/ml 5-
bromo-4-choloro-3-indolyl phosphate (Fisher Scientific) in developing buffer, pH 9.6 (0.1 M
NaHC03, containing 0.1 M MgCl2). The reaction was stopped by rinsining in deionized water.
Prestained protein standards (Gibco BRL, Gaithersburg, MD) were used as markers.
Corm Wounding Test
Twenty caladium corms were cut with a razor blade as described by Vunsh et al. for
gladiolus (1990). Part (0.1 g) of the corm tissue was tested immediately by IEM and I-ELISA.
The remainder of the sample was put into a paper bag, and kept at room temperature. Twenty
days later, the corm tissue near the wounded surface was tested by the same methods.
Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
Total RNA was isolated from leaf tissue of either infected or healthy plants according
to the following method described by de Varies et al. (1988). All solutions were prepared by
diethyl pyrocarbonate (DEPC)-treated water and autoclaved. Leaf tissues (0.4 g) of DsMV-
infected and healthy plants were ground in liquid nitrogen into fine powder. Two volumes (0.8
ml, v/w) of RNA extracting buffer (0.1 M Tris-HCl, pH 8.0, containing 0.1 M LiCl, 10 mM
EDTA and 1% SDS) and two volumes (0.8 ml, v/w) of hot phenol (70°C) were added to the
frozen powder, ground briefly and transferred to a 2-ml microtube. The tube was heated at

96
70°C for 5 min and centrifuged for 10 min at 12,000 g in an Eppendorf microcentrifuge
(Brinkmann Instruments, Inc., Westbury, NY). The supernatant was recovered and extracted
with phenol/chloroform (1:1; v/v) three times. The phenol was removed by chloroform
extraction. The total RNA was precipitated from the recovered aqueous phase by addition of
1/3 volume of 8 M LiCl at 4°C overnight. The mixture was centrifiiged at 12,000 g for 15 min.
The pellet was washed sequentially in 2 M LiCl and 70% ethanol, vacuum-dried, and
resuspended in 50 pi of sterile distilled water (5 Prime to 3 Prime Inc., Boulder, CO). Five pi
aliquots of total RNA were used immediately to synthesize cDNA, and the remaining aliquots
were stored at -80°C for future use.
Reverse transcription was performed on 10 pg of total RNA extracted from leaves in a
reaction volume of 20 pi containing lx reaction buffer (50 mM Tris-HCl, pH 8.3, 75 mM KC1,
3 mM MgCL), 10 mM dithiothreitol (DTT), 100 pM each of four deoxyribonucleotide
triphosphate (dNTPs), 20 units RNasin (Promega Co., Madison, WI), 100 units Moloney
murine leukemia virus reverse transcriptase (Superscript n, from Gibco BRL), and 100 pmol
downstream primer EH258-260 (5’-TTTTTTTTTTTTTTTTTTTTA/C/G-3’). This mixture
was incubated for 60 min at 41°C. The reaction was terminated by incubating mixture at 95°C
for 10 min. and then cooling it on ice. The synthesized cDNA was used immediately as the
template for PCR amplification.
The PCR was carried out in a UNO-Thermocycler (Biometra Inc., Tampa, FL). The
primers, EH232 (5’-AAGCTTGCAGGCTGATGATACAG-3’) corresponding to the 5’-end
of the DsMV CP gene and linked at the 5’-end of it a Hind HI restriction site, and EH234 (5’-

97
GAATTCTTGAACACCGTGCAC-3’) corresponding to the 3’-end of the non-coding region
and linked at the 5’-end of it a £coRI restriction site, were used for amplification of the gene.
For standard reaction, 200 pM dNTPs, 0.2 pM of each primer, lx PCR buffer (10 mM Tris-
Hcl, pH 8.2, containing 50 mM KC1), 1.5 mM MgCl2, 2.5 U of Taq DNA polymerase, 200
pmol of each primer, and 2 pi of cDNA products were used in a total of 100 pi reaction
volume. The reactions were run at the following temperature-cycling profile (touchdown
PCR): 11 cycles of 1.5 min at 94°C, 2 min at 72->61°C (temperature declines of 1°C each
cycle), and 2 min at 72°C; 24 cycles of 1 min at 94°C, 1 min at 61°C, and 2 min at 72°C
followed by a 10 min extension at 72°C.
The following temperature-cycling profile (regular PCR) was applied in the primary
reactions or in subcloning of DsMV CP using plasmid DNA as template: 5 cycles of 1.5 min at
94°C, 2 min at 61°C, 2 min at 72°C; 30 cycles of 1 min at 94°C, 1 min at 61°C, and 2 min at
72°C, followed by a 10 min extension at 72°C. Ten pi of the PCR products were then run on a
0.9% agarose (Gibco BRL) electrophoresis gel. Gels were stained for 5 min with 0.5 pg/ml
ethidium bromide, destained in deionized water for 15 min, and photographed on a UV-
transilluminator with a Gel Print ToolBox (BioPhotonics Co., Ann Arbor, MI).
Southern Blotting
Nucleic acid probes prepared from DsMV CP fragments amplified from plasmid pCPl
by PCR were labeled with (32P) dCTP (Du Pont NEN, Boston, MA) using a Random Primed
DNA KIT (Boehringer Mannheim, Indianapolis, IN) according to the manufacturer’s

98
instructions. The RT-PCR products were analyzed on a 0.9% agarose gel. The gel was soaked
in 50 ml of solution (1.5 M NaCl, 0.625 N NaOH) for 8 min, then in 50 ml of a neutralized
solution (1 M Tris-HCL, pH 7.4, 1.5 M NaCl), and equilibrated with lOx standard saline citrate
(SSC) (1.5 M NaCl, 0.15 M sodium citrate, pH 7.0). The RT-PCR products were then
transferred to a Nylon Hybond membrane with a 0.45 p pore size (Amersham, Inc., Arlington
Heights, IL) by blotting in 1 Ox SSC for 3 hr. Nucleic acids were bound to the membrane by
UV cross-linking using a UV-Crosslinker FB-UVXL-1000 (Fisher Scientific) for 90 sec. The
membrane was prehybridized in a rotating Mini Oven (Vangard International, Inc., Neptune,
NJ) at 65°C for one hour with 20 ml of 5x SSC, containing 1% SDS, 10% PEG 8000 and 1
mg/ml denatured salmon sperm DNA. Approximately 100-200 pCi/ml denatured probe was
added to the prehybridization solution and allowed to hybridize to the membrane overnight at
65°C. After hybridization, the solution was stored at -20°C in a sterile tube and reused within
one month. Before reuse, the probe was denatured by boiling for 5-10 min. The membrane was
washed twice in 100 ml of 2x SSC for 5 min each at room temperature, followed by two rinses
in 100 ml of 0.4x SSC containing 2% SDS at 65°C for 30 min each. A final rinse was in 100 ml
of 0.2x SSC at room temperature for 30 min. Washed membranes were exposed to X-ray film
with an intensifying screen.
Comparison of I-ELISA, Western Blot and RT-PCR
Leaf tissues from DsMV infected calla lily and healthy P. selloum seedling plants were
used to compare the sensitivities of I-ELISA, Western blotting and RT-PCR. For I-ELISA and

99
western blotting, leaf extracts diluted 1:10 with buffer (equal to 10 mg tissue) were used. Ten
pg of total plant RNA (extract of 10 mg tissue) were used for RT-PCR. The methods for these
tests were as those described above for each of the respective techniques.
Results
Cylindrical Inclusions of DsMV
Type in cylindrical inclusion bodies with scrolls, pinwheels and laminated aggregates
as described previously for DsMV (Zettler et al., 1978) were seen in cells of 'Candidum’
caladium and cocoyam infected with, respectively, the Chi and Xc isolates of DsMV (Fig. 4-
1).
ELISA
In direct comparisons, I-ELISA was found to be more sensitive than DAS-ELISA
(Table 4-1). The OD values of I-ELISA were as much as four times those of DAS-ELISA.
Although the background reaction was lower when 0.5 gg/ml DsMV IgG was used, use of 2
pg/ml IgG resulted in significant contrast between infected and healthy samples within a 15 min
observation time. Similar results were noted in I-ELISA tests regardless whether extraction
was in coating buffer or CEP buffer was used. Accordingly, I-ELISA using CEP as the
extracting buffer was routinely used to detect DsMV in tissue culture-derived plantlets.
The sensitivity of I-ELISA was very similar to that of Western blotting when both
methods were compared (Table 4-2). Eight out of 10 'Candidum’, 5 of 14 'Frieda Hemple’

100
Fig. 4-1. Electron micrograph of cylindrical inclusions (Cl) induced by
a caladium isolate of dasheen mosaic virus in a leaf cell of Philodendron
selloum. Typical scrolls, pinwheels, and laminated aggregates were presented.
Many virus particles were in the cytoplasm of the infected cell. LA, laminated
aggregate; P, pinwheel; S, scroll. Bar = 1 pm.

101
Table 4-1. A^j absorbance values of I-ELISA1 and DAS-ELISA1
for DsMV detection
Test
Sample2
1
2
3
4
5 6
7
8
I-ELISA(CEP3)
0.492
0.492
0.458
0.544
0.612 0.001
0.014
0.009
I-ELISA (CB3)
0.356
0.102
0.490
0.225
0.482 0.017
0.012
0.009
DAS-ELISA
0.153
0.148
0.315
0.056
0.153 0.003
0.006
0.000
1 I-ELISA = indirect ELISA and DAS-ELISA = double antibody sandwich direct
ELISA.
2 Antigens used were extracts from leaf samples of caladium plants grown out from
commercial corms. Antigens 1:10 in buffer and DsMV-FL antiserum 1:500 in buffer.
Absorbance readings were taken 15 min after adding substrate. The absorbance
(A405) value represents the mean of six wells.
3 CEP = coating extraction phosphate buffer and CB = coating buffer.

102
Table 4-2. Comparison of I-ELISA1 and Western blotting2
procedures to detect DsMV in caladium leaves
Cultivar No. of samples
I-ELISA
Western blotting
Candidum
8
+
+
Candidum
2
-
-
Frieda Hemple
5
+
+
Frieda Hemple
9
-
-
Carolyn Whorton
1
+
+
Carolyn Whorton
10
-
-
3
Control
1 , r-r to * r
3
-
-
1 I-ELISA was performed as described in the text. Leaf tissues of plants were
ground 1:10 in CEP buffer and DsMV-FL antiserum was diluted 1:500 in
enzyme-conjugate buffer. The absorbance (A405) value for positive sample
was at least three times higher than that of healthy control.
2 Western blotting was carried out as described in the text. Leaf tissues of
plants were used. DsMV-FL antiserum diluted 1:500 in TBST buffer was
used to detect DsMV. A protein band of the CP size of each isolate was
detected in positive sample in western blotting analysis, while no such
band was detected in the negative samples or healthy controls.
3 Plants used as controls were tissue culture-derived caladium plants.

103
and 1 of 15 'Carolyn Whorton’ caladium plants were determined to be infected by both
methods.
Distribution of Detectable DsMV within Infected Plants bv I-ELISA
Leaves, petioles, and/or corms of three naturally infected hosts (caladium, taro and
cocoyam) were collected and tested by I-ELISA using DsMV-FL antiserum. DsMV was
detected reliably in both leaves and petioles of infected caladium plants, while in cocoyam and
taro plants, DsMV sometimes was detected in leaves, but not in petioles or vice versa (Table 4-
3). Although DsMV usually was detected in both leaves and petioles of infected caladium
plants, it was not always detected in corms of the same plants.
DsMV was detected in leaves of infected caladium plants whether symptoms were
evident or lacking. In contrast, only symptomatic tissues of infected cocoyam and taro plants
reacted positively in I-ELISA. Whereas symptomatic leaves of greenhouse-grown plants were
evident throughout the 3-year observation period, those of cocoyam and taro were evident
only in the early spring or late fall months of each year.
Corm Wounding
Corm wounding facilitated the ability to detect DsMV in caladium. Similar results were
obtained by Vunsh et al. (1990) for BYMV in gladiolus. Whereas DsMV was detected by I-
ELISA and ISEM in only 1 of 20 unwounded corms, it was detected in 13 of the same corms
20 days after wounding (Table 4-4).

104
Table 4-3. Relative distribution of DsMV in three aroid hosts1
as determined by I-ELISA
Host
No. Samples
Leaf
Petiole
Corm
Caladium
22
+
+
+
5
+
-
-
Cocoyam
1
12
+
+
.2
nt
2
+
-
nt
2
-
+
nt
17
-
-
nt
Taro
1
+
+
nt
2
+
-
nt
1
-
+
nt
2
-
-
nt
3
Control
3
-
-
-
1 Corm tissues were tested before planting in pots. The leaf and petiole tissues
were collected from plants from the tested corms. DsMV-FL antiserum tested
by I-ELISA as described in the text was used. The absorbance (A405) value for
positive samples were at least three times higher than that of the controls.
2 nt= not tested.
3 Plants used as controls were tissue culture-derived caladium plants.

105
Table 4-4. Effect of wounding on detection of DsMV in caladium conns1
No. of
Corms2
Unwounded Corm
Wounded Corm
I-ELISA3
ISEM3
I-ELISA
ISEM
1
+
+
+
+
7
+
-
+
+
1
-
+
+
+
4
-
-
+
+
7
-
-
-
-
1 Corms of'Frieda Hemple’ caladium were used in tests. Corms were cut
and kept in a paper bag at room temperature. The corm tissues were
tested immediately before wounding and 20 days after wounding.
2 represents the number of corms which gave the indicated
reaction in both I-ELISA and ISEM tests. For I-ELISA tests, the
absorbance (Atos nm)of the positive sample was at least three times
higher than that of the healthy control. Viral particles were detected
in positive samples, but not in negative samples by electron microscopy.
3 DsMV was detected by I-ELISA and ISEM using DsMV-FL antiserum.

106
RT-PCR for DsMV Detection
A DNA fragment of about 1200 bp, which represented the CP gene and the 3’ non¬
coding region, was resolved by agarose gel electrophoresis from infected caladium plants. No
comparable product was amplified from healthy P. selloum seedlings (Fig. 4-2). Strong
amplification of a second smaller DNA fragment of about 500 bp was observed when reactions
were run at the regular temperature-cycling profile (61°C as annealing temperature) (Fig. 4-
2A). However, the second non-specific band disappeared when the “touchdown” temperature¬
cycling profile (72->61°C as annealing temperature) was assessed (Fig. 4-2B).
Comparison between RT-PCR, ELISA, and Western blotting for DsMV Detection
Infected caladium and field-collected calla lily plants were used to compare the
sensitivity of RT-PCR for DsMV detection. Healthy P. selloum seedlings and pDCPl plasmid
were used as negative and positive controls, respectively. An amplified fragment of the
expected size was obtained from all infected caladium and calla lily samples, whereas no
fragment was amplified from the negative controls (Fig. 4-3 A). The results of RT-PCR were
confirmed by southern blotting using a radioactive probe (Fig. 4-3B). However, DsMV was
not detected in 3 of the 8 infected calla lily samples when I-ELISA and Western blotting tests
were used (Table 4-5).

107
Fig. 4-2. Agarose gel electrophoresis of RT-PCR amplified products
obtained from total RNA extracted from aroid leaf tissues. A. Lane 1, 1 kb
DNA ladder; lane 2, healthy caladium; lanes 3-4, DsMV-infected caladium;
lane 5, pDCPl plasmid. The oligonucleotide primer used for cDNA
synthesis was EH258-260, and for PCR the DsMV CP primers EH232 and
EH234 were used. The amplified fragment of 1200 bp contained the intact
DsMV CP gene. The CP was detected using the following temperature-cycling
profile in a UNO-Thermocycler (Biometra Inc., Tampa, FL): five cycles of 1.5
min at 94°C, 2 min at 61°C, 2 min at 72°C; 30 cycles of 1 min at 94°C, 1 min at
61°C, 2 min at 72°C. B. Lane 1; 1 kb DNA ladder; lanes 2-3, infected
cocoyam; lane 4, infected caladium; lane 5, healthy caladium; lane 6, pDCPl
plasmid. The temperature cycling profile used: eleven cycles of 1.5 min at 94°C,
2 min at 72—>61°C (temperature declines 1°C each cycle), 2 min at 72°C; 24
cycles of 1 min at 94°C, 1 min at 61°C, 2 min at 72°C.

108
123456789 1234 56789
A B
Fig. 4-3. Agarose gel electrophoresis of RT-PCR amplified products
obtained from total RNA extracted from leaf tissues of calla lily plants. A.
Lane 1, 1 kb DNA ladder; lane 2, DsMV-infected caladium; lanes 3-7, calla
lily plants; lane 8, pDCPl plasmid, lane 9, healthy caladium. The
oligonucleotide primer used for cDNA synthesis was EH258-260, and for
PCR were the DsMV CP primers EH232 and EH234. The amplified fragment
of 1200 bp contained intact the DsMV CP gene. The CP was detected using
the following temperature-cycling profile in a UNO-Thermocycler (Biometra
Inc., Tampa, FL): 11 cycles of 1.5 min at 94°C, 2 min at 72->61°C
(temperature declines 1°C each cycle), 2 min at 72°C; 24 cycles of 1 min at
94°C, 1 min at 61°C, 2 min at 72°C. B. Southern blotting analysis of RT-PCR
amplified products. The DNA fragments were transferred to a nylon membrane
and probed with the cloned CP gene labeled with a-32P.

109
Table 4-5. Comparison of RT-PCR, I-ELISA and
Western blotting for detecting DsMV1
Sample2
ELISA3
Western blotting3
RT-PCR3
1
0.058
_
+
2
0.059
-
+
3
1.850
+
+
4
2.120
+
+
5
0.470
+
-1-
6
0.051
-
+
7
0.283
-I-
+
8
1.239
+
+
Positive control4
1.007
+
+
Healthy4
0.027
-
-
1All samples were tested by RT-PCR, I-ELISA and western blotting
tests as described in text. The I-ELISA absorbance (A405 nm) value
represents averages of 8 wells. DsMV-FL antiserum and PTY 1
monoclonal antiserum were both used in western blotting analysis,
and produced similar results.
2 Calla lily samples were collected from the greenhouse or field.
3 For I-ELISA tests, the absorbance (A405 nm) of the positive sample
was at least three times higher than that of healthy control. A protein band
of 44 kDa was detected for a positive sample in western blotting analysis,
while no such band was detected in the negative sample or healthy control.
A DNA fragment of 1.2 kb representing the CP gene and the 3’ non-coding
region was detected in all samples except healthy control.
4 Positive control was DsMV-infected caladium, and the heathy control was
tissue culture-derived caladium.

110
Discussion
The goal of this research was to refine methods for improving the detection of DsMV
in aroid plants. Reliable detection systems consisting of serological assays such as ELISA,
Western blotting and tissue-blotting, and of nucleic acid assays such as nucleic acid
hybridization and RT-PCR (or PCR for DNA viruses) have been developed for many viruses
better characterized than DsMV. In particular, limited knowledge of DsMV at the molecular
level and the limited availability of polyclonal antiserum for this virus have been constraints of
diagnosis and detection of the virus.
Results obtained by I-ELISA for detecting DsMV were supported by Western blotting
(Table 4-2). Virus infections of aroids can be detected readily by I-ELISA (Table 4-3). Thus, I-
ELISA offers a reliable alternative to previously used techniques such as SDS-immunodifiusion
and ISEM for detecting DsMV from leaf, petiole and corm tissues (Zettler & Hartman, 1986).
It has been reported that the natural viscosity of the aroid leaf extracts and the presence
of some “unusual” substances probably caused the high level of non-specific interference in
ELISA tests (Rodoni & Moran, 1988). However, there were no such effects in our I-ELISA
tests when either IgG of antiserum to DsMV-FL or antiserum to expressed CP was used.
Neither extracts from healthy leaves nor from healthy corm tissues produced inordinately high
background values in the tests. The contamination of the DsMV immunogen with plant
proteins could have accounted for the high background in the ELISA tests of Rodani and
Moran’s (1988) antiserum.

Ill
Based upon ELISA results, which confirmed observations of symptoms, no virus was
present in symptomless tissues of cocoyam and taro, as was reported previously for
dieffenbachia (Chase & Zettler, 1982). In contrast, virus distribution is much more uniform in
caladium leaves. Thus, the greenhouse grow-out recommended by the FAO/IBPGR for edible
aroids, does not necessarily apply to this aroid.
The differences in symptom expression and distribution of the virus in infected taro and
cocoyam plants may be attributed to the restriction of virus movement within plants of
cocoyam and taro. Our results also showed that DsMV was always detected in the corm
tissues from the infected caladium plants (Table 4-3). Unlike with leaf tissues, the distribution
of detectable DsMV in corms was uneven, which may be related to low levels of viral
replication in the corms. By wounding the corms, however, the detection rate was increased
greatly, probably due to an increase in viral replication in response to wounding. Thus, as with
gladiolus viruses (Vunsh et al., 1990), corm wounding could facilitate the detection of DsMV.
The detection of DsMV in association with certification and clean-stock programs for
edible aroids could be greatly improved by using techniques such as RT-PCR. Our results
indicate that ELISA and Western blotting could not detect DsMV in symtomless leaves of
cocoyam and taro, and thus RT-PCR could be adopted to complement or substitute for
ELISA. Indeed, direct comparison of RT-PCR, I-ELISA and Western blotting tests
demonstrated that RT-PCR amplification of viral-specific RNA was more sensitive than I-
ELISA and Western blotting to detect DsMV (Table 4-5). The sensitivity of the DsMV RT-

112
PCR method used in this study makes it as an attractive for virus detection, especially in those
hosts in which distribution of DsMV within plants varies seasonally.

CHAPTER 5
SUMMARY AND CONCLUSIONS
A caladium isolate of dasheen mosaic virus (DsMV-Chl) was purified from
inoculated Philodendron selloum seedlings following a protocol used for ZYMV (Wisler,
1992). The propagative host, P. selloum, was the only aroid host from which the virus
was successfully purified. Other aroid hosts (caladium, calla lily, cocoyam, and taro) had
highly viscous leaf extracts, which may cause the virus particles to precipitate irreversibly.
Symptomatic leaves of all aroid hosts, however, contained high concentrations of the virus
based on examination of negatively stained leaf extracts.
Clones representing most of the genomic RNA of DsMV-Chl were obtained by
immunoscreening of a cDNA library and direct sequence mapping. The sequence of the
3’-terminal region of 3158 nucleotides was determined. Cleavage sites were located at the
Q/G (amino acids 140-141) and the Q/A (amino acids 656-657) sites of the 3’-terminal
region of DsMV-Chl. The conserved cleavage sequence VXLQ/(G, or A) was found in
both sites, which is similar to those of most sequenced potyviruses, especially those in the
BCMV subgroup (Shukla et al., 1994).
This sequenced region contained a portion of the NIa, the Nib, the coat protein
(CP) genes and the 3’ non-coding region. The partial NIa protein (140 amino acids)
contained the consensus sequence GXCG, which has been found in all other sequenced
potyviruses (Shukla et al., 1994). This sequence is proposed to be the active site for the
113

114
protease activity of the NIa protein. The DsMV-Chl Nib protein, consisting of 516 amino
acids, showed 72% to 85% similarity with those of other potyviruses. The consensus
motifs YCHADGS and SGQPSTWDNT-30aa-GDD, responsible for the putative RNA
polymerase function of potyviruses (Kamer & Argos, 1984; Allison et al., 1986; Domier et
al.; 1986; Gunasinghe et al.; 1994), were also present in DsMV.
The size of the CP of the DsMV-Chl isolate was 313 amino acids with a
calculated MW of 34.6 kDa; this is similar to the CPs of other potyviruses (Shukla et al.;
1994). This value was somewhat smaller than expected, however, based on SDS-PAGE
results (Li et al., 1992). The DsMV-Chl CP shared 68-82% similarity with those of other
potyviruses, and has shown a close relationship with those in the BCMV subgroup. The
core regions of the CPs of DsMV-Chl and other potyviruses are very conserved, whereas
the N-terminal regions are variable. Nevertheless, the alignments of the N-terminal regions
revealed proline-rich sequences as in other DsMV isolates (Pappu et al., 1994a; this study)
and other potyviruses, including johnsongrass mosaic, omithogalum mosaic, sweet potato
feathery mottle, PPV and maize dwarf mosaic (Shukla et al.; 1994). The functions of these
sequences are unknown. The DAG aphid-transmission triplet was also present in the N-
terminal region of DsMV starting at +5 amino acid from the cleavage site. These data
show that DsMV is a typical, albeit distinct member of the genus Potyvirus in the family
Potyviridae.
The DsMV-Chl CP gene was cloned by PCR, and subcloned into an expression
vector pETh-3 to generate pETh-3-CP. The expression of pETh-3-CP in Escherichia coli

115
cells produced large quantities of insoluble DsMV CP. The expressed CP was purified
from cell lysates and was used as an immunogen to produce antiserum against the DsMV
CP. Serological tests such as ELISA and Western blotting indicated that the antiserum
produced was similar to antiserum prepared to purified virions (Abo El-Nil et al., 1977).
In vitro expression of the DsMV CP resolved the problems of purifying this virus and thus
provided an alternative way for obtaining antiserum needed for diagnostic work.
Western blotting analysis confirmed that the CP of DsMV is considerably larger
than those of most potyviruses (Abo El-Nil et al., 1978). The CP MWs of six DsMV
isolates were about 38-47 kDa, whereas ten other potyviruses used in comparisons had
MWs of only 31-36 kDa. These variations apparently reflect genomic differences between
DsMV isolates since the specific CP MW for each isolate is constant even after serial
passages through different hosts. Whereas most potyviruses, including konjak mosaic
(Shimoyama et al., 1992a, b), have CP MWs of about 32-36 kDa, those of DsMV isolates
have values of 38-47 kDa. Abo El-Nil et al. (1977) suggested that the high CP MW values
of DsMV were associated with the labile portion of the coat protein. The availability of
the CP sequences of several DsMV isolates (Pappu et al., 1994b; this study) and of other
potyviruses helped to confirm this hypothesis. Indeed, the DsMV CPs of 314 to 330
amino acids of two caladium isolates noted in this study are relatively large for a
potyvirus. However, the calculated CP MWs for four sequenced isolates were from 34.6-
36.9 kDa, which are typical of potyviruses. Furthermore, the MW of the CP expressed in
E. coli was smaller (39 kDa) than that (44 kDa) from infected plants, even though the

116
expressed CP had a fusion protein of 15 amino acids long. The similar CP MW difference
between SDS-PAGE and sequence data result has been reported for PRSV-P (Quemada
et al., 1990a).
One of the factors that could account for such perceived differences in molecular
weights in SDS-PAGE is the amino acid composition of the DsMV CP. The DsMV CP is
different from those of most potyviruses in that it is quite threonine/asparagine-rich at the
N-terminal region. These two amino acid residues account for 31.8-50.0% of the amino
acid residues at the N-terminal region of the CPs. In addition to a 6-proline sequence at
the N-terminal region, there are also many more (8-10) potential V-glycosylation sites
clustered near both the N- and the C-termini of the DsMV CP (Pappu et al., 1994a; this
study) than there are in the CPs of most potyviruses. These unusual sequences may affect
behavior of DsMV CP in SDS-PAGE, although theoretically no such influence should
exist based on the presumption that proteins are completely degraded by the anionic
detergent, SDS. Several short proline stretches and/or a seven-proline stretch were also
found at the N-terminal regions of several sweet potato potyviruses (Colinet & Lepoivre,
1994). The CP MWs of these viruses in SDS-PAGE, however, correspond closely to
those calculated from their sequences of 316-355 amino acids, thereby indicating that
proline stretches may have no effect on the estimated MWs of the proteins in SDS-PAGE.
The variability of CP MWs among different DsMV isolates noted in this study
contrasts with the studies of other potyviruses, such as ZYMV (Wisler, 1992) and PRSV-
W (data not shown), which appear to be much more uniform among different strains.

117
Sequence analysis of the DsMV CPs revealed a deletion and an addition at the N-terminal
regions of the Chi, Ch2 and TEN isolates, which, when compared to the LA isolate. The
deletions or duplications at the N-terminal region of the DsMV CP among different
isolates may also contribute to the variability of the coat protein sizes. Similar sequence
diversity at the N-terminal region of the CPs was also reported for strains of TuMV (Sano
et al., 1992), strains of SCMV (Xiao et al., 1993), and BCMV (Khan et al., 1993).
The availability of the sequences of the coat protein and the 3’-NCR of the DsMV
Chi, Ch2, LA and TEN isolates allowed an assessment to stufy their relationship at the
sequence level. As has been reported for other potyviruses (Shukla et al., 1988), the amino
acid variation among the CPs of the four DsMV isolates occurs primarily at the N-terminal
region, whereas the sequences of the core and C-terminal regions are highly conserved
(Fig. 4-6). The CP sequences of these isolates showed similarities of 92 to 96%, which
are, by convention, considered to be within values for delineating strains of a given virus
(Shukla et al., 1988). Furthermore, the similarities of the 3’-NCR sequences of the isolates
Chi, Ch2 and LA were 79-83%, indicating that these isolates are very close to each other.
The results obtained in this research confirmed earlier studies (Abo El-Nil et al.,
1977; Wisler et al., 1978) that some isolates of DsMV can induce more severe stunting
symptoms in P. selloum than others; however, the CP MW is apparently not correlated
with this property. For example, the respective isolates with the highest and lowest CP
sizes, i.e. DsMV-Xc (47 kDa) and DsMV-Ch3 (38 kDa) induced mild symptoms in P.
selloum, whereas the four other isolates (Chi, Ch2, Ce and Za) that induced more severe

118
stunting symptoms had intermediate CP MWs. However, relationships between the
symptom differences in P. selloum and the CP sequence similarity of these isolates could
not be established since CPs of the Ch3, Xc and Za isolates have yet to be sequenced.
The coat protein variability of DsMV isolates does not appear to compromise the
ability to detect different DsMV isolates serologically. In this study, each of the DsMV
isolates could readily be detected either by ELISA or by Western blotting.
Despite the CP MW differences between DsMV and most other potyviruses,
reciprocal reactions in Western blot analyses reveal close serological relationships between
DsMV and other potyviruses, thereby suggesting that unusual composition of DsMV CP
apparently had no significant effect on its serological affinities to other potyviruses.
Furthermore, the antisera from two different DsMV isolates cross-reacted with other
potyviruses, thereby providing additional evidence that the unusual DsMV CP stretches do
not contain epitopes that interfere with the ability to detect different strains of the virus.
Results obtained by I-ELISA in the detection of DsMV were supported by Western
blotting and ISEM. Virus infections of aroids can be detected by I-ELISA. Thus, I-ELISA
offers a reliable alternative to previously used techniques such as SDS-immunodiffiision and
immunosorbent electron microscopy for detecting DsMV from leaf petiole and corm tissues. It
has been reported that the natural viscosity of the aroid sap combined with the presence of
some “unusual” substances probably caused the high level of non-specific interference in
ELISA tests (Rodoni & Moran, 1988). However, there were no such effects in our ELISA
tests, regardless whether DsMV-FL antiserum or expressed CP antiserum was used.

119
Our results confirmed earlier findings (Zettler et al., 1986) that DsMV symptom
expression is intermittent in some aroid hosts. For cocoyam and taro, the expression of the viral
symptoms usually occurred in early spring or late fall months. The intermittent symptom
expression and distribution of the virus in infected cocoyam and taro plants may be attributed
to the restriction of the viral movement, as was previously reported for dieffenbachia (Chase &
Zettler, 1982). However, in caladium, viral symptoms could be observed throughout the
season. These observations were in agreement with ELISA and Western blotting studies;
DsMV was not detected by these methods in symptomless leaves of cocoyam and taro, but the
virus was readily detected throughout the growing season in leaves of caladium. Thus, the one
crop cycle greenhouse grow-out recommended by the FAO/IBPGR for edible aroids, does not
necessarily apply to caladium. By wounding the corms, the detection rate was increased
greatly, probably due to the increase of viral replication. Therefore, corm wounding could
facilitate the detection of DsMV in corm tissue as that reported by Vunsh et al. (1990) for
gladiolus.
DsMV detection associated with certification and clean-stock programs for edible
aroids could be greatly improved by techniques such as RT-PCR which can be even more
sensitive than either ELISA or Western blotting. Our results showed that DsMV could be
detected by RT-PCR in calla lily or cocoyam tissues which were negative for DsMV by I-
ELISA or Western blotting. The sensitivity of the DsMV RT-PCR method used in this study
makes it an attractive alternative for virus detection, especially for those hosts in which
distribution of DsMV within plants varies seasonally, such as cocoyam and taro.

REFERENCE LIST
Abo El-Nil, M.M., and Zettler, F.W. 1976. Natural occurrence of dasheen mosaic virus in
Egyptian taro, Colocasia esculenta. Plant Sci. Letters 6:401-408.
Abo El-Nil, M.M., Zettler, F.W., and Hiebert, E. 1977. Purification, serology, and some
physical properties of dasheen mosaic virus. Phytopathology 67:1445-1450.
Alconero, R., and Zettler, F.W. 1971. Virus infections of Colocasia and Xanthosoma in
Puerto Rico. Plant Dis. Reptr. 55:506-508.
Allison, R., Johnston, R.E., and Dougherty, W.G. 1986. The nucleotide sequence of the
coding region of tobacco vein mottling virus genomic RNA: Evidence for the synthesis of a
single polyprotein. Virology 154:9-20.
Andrews, J.H., and Shalla, T.A. 1974. The origin, development and conformation of
amorphous inclusion body components in tobacco etch virus-infected cells. Phytopathology
64:1234-1243.
Antignus, Y., Raccah, B., Gal-On, A., and Cohen, S. 1989. Biological and serological
characterization ofZYMV and WMV-2 isolates in Israel. Phytoparasitica 17:289-298.
Atreya, C D. 1992. Application of genome sequence information in potyvirus taxonomy: an
overview. In: Barnett, O.W. (ed.), Potyvirus Taxonomy. Springer-Verlag, Wien and New
York (Archives of Virology [Supplement] 5), pp. 17-23.
Atreya, C.D., Atreya, P.L., Thombury, D.W., and Pirone, T.P. 1992. Site-directed mutations
in the potyvirus HC-Pro gene affect helper component activity, virus accumulation, and
symptom expression in infected tobacco plants. Virology 191:106-111.
Atreya, C D, Raccah, B., and Pirone, T.P. 1990. A point mutation in the coat protein
abolishes aphid transmissibility of a potyvirus. Virology 178:161-165.
Atreya, P.L., Atreya, C.D., and Pirone, T.P. 1991. Amino acid substitutions in the coat
protein result in loss of insect transmissibility of a plant virus. Proc. Natl. Acad. Sci. USA
88:7887-7891.
120

121
Atreya, P.L., Lopez-Moya, JJ, Chu, M.H. Atreya, C D. and Pirone, T.P. 1995. Mutational
analysis of the coat protein N-terminal amino acids involved in potyvirus transmission by
aphids. J. Gen. Virol. 76:265-270.
Baulcombe, D.C., Lloyd, J., Manoussopoulos, I.N., Roberts, I.M., and Harrison, B.D. 1993.
Signal for potyvirus-dependent aphid transmission of potato aucuba mosaic virus and the effect
of its transfer to potato virus X. J. Gen. Virol. 74:1245-1253.
Baunoch, D.A., Das, P., and Hari, V. 1990. Potato virus Y helper component protein is
associated with amorphous inclusions. J. Gen. Virol. 71:2479-2482.
Baunoch, D.A., Das, P., Browning, M.E., and Hari, V. 1991. A temporal study of the
expression of the capsid, cytoplasmic inclusion and nuclear inclusion protein of tobacco etch
potyvirus in infected plants. J. Gen. Virol. 72:487-492.
Bazan, J.F., and Fletterick, R.J. 1988. Viral cysteine proteases are homologous to the trypsin¬
like family of serine proteases: Structural and functional implications. Proc. Natl. Acad. Sci.
USA 85:7872-7876.
Berger, P.H, and Pirone, T.P. 1986. The effect of helper component on the uptake and
localization of potyvirus in Myzuspersicae. Virology 153:256-261.
Brakke, M.K., and Van Pelt, N. 1970. Linear-log gradients for estimating sedimentation
coefficients of plant viruses and nucleic acids. Anal. Biochem. 38:56-64.
Bryan, G.T., Gardner, R.C., and Forster, R.L.S. 1992. Nucleotide sequence of the coat
protein gene of a strain of clover yellow vein virus from New Zealand: Conservation of a stem-
loop structure in the 3’ region of potyviruses. Arch. Virol. 124:133-146.
Buddenhagen, I.W., Milbrath, G.M., and Hsieh, S. P. 1970. Virus diseases of taro and other
aroids. Proc. Second Int. Symp. on Tropical Root and Tuber Crops 2:53-55.
Carrington, J.C., Cary, S.M., and Dougherty, W.G. 1988. Mutational analysis of tobacco etch
virus polyprotein processing: Cis and trans proteolytic activities of polyprotein containing the
49-kilodalton proteinase. J. Virol. 62:2313-2320.
Carrington, J.C., Cary, S.M., Parks, T.D., and Dougherty, W.G. 1989a. A second proteinase
encoded by a plant potyvirus genome. EMBO J. 8:365-370.
Carrington, J.C., and Dougherty, W.G. 1987a. Small nuclear inclusion protein encoded by a
plant potyvirus genome is a protease. J. Virol. 61:2540-2548.

122
Carrington, J.C., and Dougherty, W.G. 1987b. Processing of the tobacco etch virus 49K
protease requires autoproteolysis. Virology 160:355-362.
Carrington, J.C., and Dougherty W.G. 1988. A viral cleavage site cassette: Identification of
amino acid sequences required for tobacco etch virus polyprotein processing. Proc. Natl.
Acad. Sci. USA 85:3391-3395.
Carrington, J.C., and Freed, D.D. 1990. Cap-independent enhancement of translation by a
plant potyvirus 5' nontranslated region. J. Virol. 64:1590-1597.
Carrington, J.C., Freed, D.D., and Sanders, T.C. 1989b. Autocatalytic processing of the
potyvirus helper component proteinase in Escherichia coli and in vitro. ]. Virol. 63:4459-
4463.
Carrington, J.C., Freed, D.D., and Oh, C.-S. 1990. Expression of potyvirus polyprotein in
transgenic plants reveals three proteolytic activities required for complete processing. EMBO J.
9:1347-1353.
Carrington, J.C., Freed, D.D., and Leinicke, A.J. 1991. Bipartite signal sequence mediates
nuclear translocation of the plant potyviral NIa protein. Plant Cell 3:953-962.
Chang, C.-A., Hiebert, E., and Purcifull, D.E. 1988. Analysis of in vitro translation of bean
yellow mosaic virus RNA: inhibition of proteolytic processing by antiserum to the 49k nuclear
inclusion protein. J. Gen. Virol. 69:1117-1122.
Chase, A.R., and Zettler, F.W. 1982. Dasheen mosaic virus of dieffenbachia cultivars. Plant
Dis. 66:891-893.
Christie, R.G., and Edwardson, J.R. 1977. Light and electron microscopy of plant virus
inclusions. Florida Agricultural Experiment Station Monograph Series 9, pp. 55-58.
Clark, M.P., and Adams, A.N. 1977. Characteristics of the microplate method of enzyme-
linked immunosorbent assay for detection of plant viruses. J. Gen. Virol. 34:475-483.
Colinet, D., Kummert, J., Lepoivre, P., and Semal., J. 1993. Identification of distinct
potyviruses in mixedly-infected sweetpotato by the polymerase chain reaction with degenerate
primers. J. Virol. Methods 45:149-159.
Colinet, D., Kummert, J., and Lepoivre, P. 1994. The complete nucleotide sequences of the
coat protein cistron and the 3’ non-coding region of a newly-identified potyvirus infecting
sweetpotato, as compared to those of sweetpotato feathery mottle virus. Arch. Virol.
139:327-336.

123
Colinet, D., and Lepoivre, P. 1994. The complete nucleotide sequence of the coat protein
cistron and the 3’ non-coding region of a newly-identified potyvirus infecting sweetpotato, as
compared to those of sweetpotato feathery mottle virus. Arch. Virol. 139:327-336.
Cronin, S., Verchot, J., Haideman-Cahill, R., Schaad, M.C., and Carrington, J.C. 1995. Long¬
distance movement factor: A transport function of the potyvirus helper component proteinase.
The Plant Cell 7:549-559.
De Mejia, M.V.G., Hiebert, E., and PurcifUll, D.E. 1985a. Isolation and partial
characterization of the amorphous cytoplasmic inclusions associated with infections caused by
two potyviruses. Virology 142:24-33.
De Mejia, M.V.G., Hiebert, E., PurcifUll, D.E., Thombury, D.W., and Pirone, T.P. 1985b.
Identification of potyviral amorphous inclusion protein as a non-structural virus-specific protein
related to helper component. Virology 142:34-43.
Debrot, E.A., and Ordosgoitti, A. 1974. Dasheen mosaic virus infection of Colocasia and
Xanthosoma in Venezuela. Plant Dis. Reptr. 58:1032-1034.
de Varies, S., Hoge, H., and Bisseling, T. 1988. Isolation of total RNA from plant tissue. Plant
Molecular Biology Manual. B6:1-3. Klumer Academic Publisher, Dordrecht, Belgium.
Dinant, S., Blaise, F., Kusiak, C., Astier-Manifacier, S., and Albony, J. 1993. Heterologous
resistance to potato virus Y in transgenic tobacco plants expressing the coat protein gene of
lettuce mosaic potyvirus. Phytopathology 83:818-824.
Dolja, V.V., and Carrington, J.C. 1992. Evolution of positive-strand RNA viruses. Seminars in
Virol. 3:315-326.
Dolja, V.V., Haideman-Cahill, R, Montgomery, A.E., Vandenbosch, K.A., and Carrington,
J.C. 1995. Capsid protein determinants involved in cell-to-cell and long distance movement of
tobacco etch potyvirus. Virology 206:1007-1016.
Dolja, V.V., McBride, H.J., and Carrington, J.C. 1994. Distinct functions of capsid protein in
assembly and movement of tobacco etch virus in plants. EMBO J. 13:1482-1491.
Domier, L.L., Franklin, K.M., Shahabuddin, M., Hellmann G.M., Siaw, M.F.E., Lomonossoff,
G.P., Shaw, J.G., and Rhoads, R.E. 1986. The nucleotide sequence of tobacco vein mottling
virus RNA. Nucl. Acids Res. 14:5417-5430.
Domier, L.L., Shaw, J.G., and Rhoads, R.E. 1987. Potyviral proteins share amino acid
sequence homology with picoma-, como-, and caulimoviral proteins. Virology 158:20-27.

124
Dougherty, W.G., and Carrington, J.C. 1988. Expression and function of potyviral gene
products. Annu. Rev. Phytopathol. 26:123-143.
Dougherty, W. G., and Hiebert, E. 1980. Translation of potyvirus RNA in a rabbit reticulocyte
lysate: identification of nuclear inclusion protein as products of tobacco etch virus RNA
translation and cylindrical inclusion protein as a product of the potyvirus genome. Virology
104:174-182.
Dougherty, W.G., and Parks, T.D. 1991. Post-translational processing of the tobacco etch
virus 49-kDa small nuclear inclusion polyprotein: identification of an internal cleavage site and
delimitation of VPg and proteinase domains. Virology 183:449-456.
Dougherty, W.G., Carrington, J.C. Cary, S.M., and Parks, T.D. 1988. Biochemical and
mutational analysis of a plant virus polyprotein cleavage site. EMBO J. 7:1281-1287.
Dougherty, W.G., Cary, S.M., and Parks, T.D. 1989a. Molecular genetic analysis of a plant
virus polyprotein cleavage site: a model. Virology 171:356-364.
Dougherty, W.G., Parks, T.D., Cary, S.M., Bazan, J.F., and Fletterick, R.J. 1989b.
Characterization of the catalytic residues of the tobacco etch virus 49-kDa proteinase.
Virology 172:302-310.
Edwardson, J.R. 1974. Some properties of the potato virus Y-group. Fla. Agrie. Exp. Stn.
Monogr. Series 4. 398p.
Edwardson, J.R., and Christie, R.G. 1983. Cytoplasmic cylindrical and nucleolar inclusions
induced by potato virus A Phytopathology 73:290-293.
Fang, G, and Grumet, R. 1992. Agrobacterium tumefaciem mediated transformation and
regeneration of muskmelon plants. Plant Cell Repts. 9:160-164.
Flitch, M.M.M., Manshardt, R.M., Gonsalves, D., Slightom, J.L., and Sandford, J.C. 1992.
Virus resistant papaya plants derived from tisssue bombarded with the coat protein gene of
papaya ringspot virus. Bio/Technology 10:1466-1472.
Francki, RI B., Fauquet, C.M., Knudson, D.L., and Brown, F. 1991. Classification and
Nomenclature of Viruses: Fifth Report of the International Committee on Taxonomy of
Viruses. Arch. Virol. (Supplement 2) Springer-Verlag, Heidelberg, Berlin.
Gal-On, A., Antignus, Y., Rosner, A., and Raccah., B. 1990. Nucleotide sequence
comparisons between zucchini yellow mosaic virus (ZYMV) strains differing in their
multiplication rate and transmissibility by aphids. Page 468 in: Abstr. Eighth Int. Cong. Virol.,
Berlin.

125
Gal-On, A., Antignus, Y., Rosner, A., and Raccah, B. 1992. A zucchini yellow mosaic virus
coat protein gene mutation restores aphid transmissibility but has no effect on multiplication. J.
Gen. Virol. 73:2183-2187.
Garcia, J.A., and Lain, S. 1991. Proteolytic activity of plum pox virus-tobacco etch virus
chimeric Nla proteases. FEBS Letters 281:67-72.
Garcia, JA, Martin, M.T., Gervera, M.A., and Riechmann, J.L. 1992. Proteolytic processing
of the plum pox potyvirus polyprotein by the Nla protease at a novel cleavage site. Virology
188:697-703.
Garcia, JA, Riechmann, J.L., and Lain, S. 1989a. Proteolytic activity of the plum pox
potyvirus NIa-like protein in Escherichia coli. Virology 170:362-269.
Garcia, J.A., Riechmann, J.L., and Lain, S. 1989b. Artificial cleavage site recognized by plum
pox potyvirus protease in Escherichia coli. J. Virol. 63:2457-2460.
Ghabrial, S.A., Smith, HA, Parks, T.D., and Dougherty, W.G. 1990. Molecular genetic
analyses of the soybean mosaic virus Nla protease. J. Gen. Virol. 71:1921 -1927.
Girard, J.C., Giannotti, J., Baudin, P., and Chatenet M. 1980. [Mise en evidence de dasheen
mosaic virus dans des macabos (Xanthosoma sagittaefolium) provenant du Cameroum.]
Agron. Trop. 35:30-34.
Gollifer, D.E., and Brown, J.F. 1972. Virus disease of Colocasia esculenta in the British
Solomon Islands. Plant Dis. Reptr. 56:597-599.
Gollifer, D.E., Jackson, V.H., Dabek, A.J., Plumb, R.T., and May, Y.Y. 1977. The occurrence
and transmission of viruses of edible aroids in the Solomon Islands and the Southwest Pacific.
Pesticide Articles and News Summaries 23:171-177.
Gomez, L., Monge, M., Valverde, R., Arias, O., and Thorpe, T. 1989. Micropropagation of 3
virus-free edible aroids. Turrialba 39(2): 15 5-161.
Gooding, G.V., and Ross, H. 1970. Effect of tobacco etch virus on yield and market value of
commercial cultivars of burley tobacco in North Carolina. Tobacco Science XIV, pp. 55-57;
Tobacco 170:19-21.
Gorbalenya, A.E., Donchenko, A.P., Blinov, V.M., and Koonin, E.V. 1989. Cysteine proteases
of positive strand RNA viruses and chymotrypsin-like serine proteases. A distinct protein
superfamily with a common structural fold. FEBS Letters 243:103-114.

126
Gough, K.H., and Shukla, D.D. 1993. The nucleotide sequence of Johnsongrass mosaic virus
genomic RNA. Intervirology 136:181 -192.
Grayum, M.H. 1990. Evolution and phylogeny of the Araceae. Ann. Missouri Bot. Gard.
77:628-697.
Granier, F., Durand-Tardif, M., Casse-Delbart, F., Lecoq, H., and Robaglia, C. 1993.
Mutations in zucchini yellow mosaic virus helper component protein associated with loss of
aphid transmissibility. J. Gen. Virol. 74:2737-2742.
Greber, R.S., and Shaw, D.E. 1986. Dasheen mosaic virus in Queensland. Austr. Plant Path.
15:29-33.
Gunasinghe, U.B., Flasiski, S., Nelson, R.S., and Cassidy, B.G. 1994. Nucleotide sequence
and genome organization of peanut stripe potyvirus. J. Gen. Virol. 75:2519-2526.
Hakkaart, F.A., and Waterreus, H.A.J.I. 1976. A virus disease of Diejfenbachia 'Exotica'.
ActaHort. 59:175-180.
Hari, V. 1979. The RNA of tobacco etch virus contains poly( A). Virology 92:568-571.
Hari, V. 1981. The RNA of tobacco etch virus: Further characterization and detection of
protein linked to RNA. Virology 112:391-399.
Harrison, B.D., and Robinson, D.J. 1988. Molecular variations in vector-borne plant viruses:
epidemiological significance. Phil. Trans. R. Soc. Lond. B 321:447-462.
Hartman, R.D. 1974. Dasheen mosaic virus of cultivated aroids and its control by seed
propagation and culture of shoot tips. Ph D. Dissertation. University of Florida, Gainesville.
80p.
Hartman, RD., and Zettler, F.W. 1972. Dasheen mosaic virus infections of commercial
plantings of aroids in Florida. Phytopathology 64:768.
Hellmann, G.M. Shaw, J.G., and Rhodes, R.E. 1988. In vitro analysis of tobacco vein mottling
virus NIa cistron: evidence for a virus- encoded protease. Virology 163:554-562.
Hellmann, G.M., Thombury, D.W., Hiebert, E., Shaw, J.G., Pirone, T.P., and Rhoads, R.E.
1983. Cell-free translation of tobacco vein mottling virus RNA. II. Immunoprecipitation of
products by antisera to cylindrical inclusion, nuclear inclusion and helper component proteins.
Virology 124:434-444.

127
Hiebert, E., and Charudattan, R. 1984. Characterization of araujia mosaic virus by in vitro
translation analyses. Phytopathology 74:642-646.
Hiebert, E., Thombury, D.W., and Pirone, T.P. 1984. Immunoprecipitation analysis of
potyviral in vitro translation products using antisera to helper component of tobacco vein
mottling virus and potato virus Y. Virology 135:1-9.
Hollings, M, and Brunt, A. A. 1981. Potyvirus group. CMI/AAB Description of Plant Viruses
No. 245.
Hu, J.S., Meleisea, S., Shaarawy, M.A., and Zettler, F.W. 1995. Distribution and incidence of
dasheen mosaic potyvirus infecting taro in Hawaii. Australasian Plant Pathol, (in press).
Hull, R. 1991. The movement of viruses within plants. Semin. Virol. 2:89-95.
Husted, K., Bech, K., Albrechtsen, M., and Borkhardt, B. 1994. Identification, partial
sequencing, and detection of a potyvirus from Kalanchoe blossfeldiana. Phytopathology
84:161-165.
Jackson, G.V.H. 1982. A virus disease of taro in French Polynesia. Report to the South
Pacific Commission, Noumea, New Caledonia. 14p.
Jagadish, M.N., Ward, C.W., Gough, K.H., Tulloch, P.A., and Shukla, D.D. 1991. Expression
of potyvirus coat protein in Escherichia coli and yeast and its assembly into virus-like particles.
J. Gen. Virol. 72:1543-1550.
James, R, Kenten, RH., and Woods, RD. 1973. Virus-like particles associated with two
diseases of Colocasia esculenta (L.) Schott in the Solomon Islands. J. Gen. Virol. 21:145-154.
Jayaram, C.H., Hill, J.H., and Miller, W.A. 1992. Complete nucleotide sequence of two
soybean mosaic virus strains differentiated by response of soybean containing the Rsv
resistance gene. J. Gen. Virol. 73:2067-2077.
Johansen, R, Rasmussen, O. F., Heide, M., and Borkhardt, B. 1991. The complete nucleotide
sequence of pea seed-borne mosaic virus RNA. J. Gen. Virol. 72:2625-2632.
Jordan, R 1992. Potyviruses, monoclonal antibodies, and antigenic sites. In: Barnett, O.W.
(ed.), Potyvirus Taxonomy. Springer-Verlag, Wien and New York (Archives of Virology
[Supplement] 5), pp.81-95.
Kamer, G, and Argos, P. 1984 Primary structural comparison of RNA-dependent
polymerases from plant, animal and bacterial virus RNA. Nucleic Acids Res. 12:7269-7282.

128
Kaniewski, W., Lawson, C., Sammons, B., Haley, L., and Hart, J. 1990. Field resistance of
transgenic Russet Burbank potato to effects of infection by potato virus X and Y.
Bio/Technology. 8:750-754.
Kassanis, B. 1939. Intranuclear inclusions in virus infected plants. Ann. Appl. Biol. 26:705-
709.
Kenten, RH, and Woods, R.D. 1973. Viruses of Colocasia escalenta and Xanthosoma
sagittifolium. Pesticide Articles and News Summaries 19:38-41.
Khan, J.A., Lohuis, D., Goldbach, R, and Dijkstra, J. 1993. Sequence data to settle the
taxonomic position of bean common mosaic virus and blackeye cowpea mosaic virus isolates.
J. Gen. Virol. 74:2243-2249.
Kositratana, W. 1985. Identification, characterization, and detection of dasheen mosaic virus
in Chinese evergreen plants (Aglaonema commutatum) in California. Ph.D. Dissertation.
University of California, Riverside. 134p.
Kositratana, W., Weathers, L.G., and Gumpf. D.J. 1983. Dasheen mosaic virus in Chinese
evergreen plants in California. Phytopathology 73:791.
Kumuro, Y., and Asuyama, H. 1955. Studies on cucumber mosaic virus, n. The isolation of
the virus from various plants showing mosaic in the vicinity of Tokyo, Japan. Annu.
Phytopathol. Soc. Japan. 20:77-82.
Kyte, J., and Doolittle, R.F. 1982. A simple method for displaying the hydropathic character of
a protein. J. Mol. Biol. 157:105-132.
Lain, S., Martin, M.T., Riechmann, J.L., and Garcia, J.A. 1991. Novel catalytic activity
associated with positive-strand RNA virus infection: nucleic acid-stimulated ATPase activity of
the plum pox potyvirus helicase like protein. J. Virol. 63:1-6.
Lain, S., Riechmann, J. L., Martin, M. T., and Garcia, J. A. 1988. Nucleotide sequence of the
3' terminal region of plum pox potyvirus RNA. Virus Res. 10:325-342.
Lain, S., Riechmann, J. L., and Garcia, J.A. 1989. The complete nucleotide sequence of plum
pox virus RNA Virus Res. 13:157-172.
Lain, S., Riechmann, J.L., and Garcia, J.A. 1990. RNA helicase: a novel activity associated
with a protein encoded by a positive strand RNA virus. Nucleic Acids Res. 18:7003-7006.
Langenberg, W.G. 1986. Virus protein associated with cylindrical inclusion of two viruses that
infect wheat. J. Gen. Virol. 67:1161-1168.

129
Langeveld, S., Dore, J.-M., Memelink, J., Derks, A., van der Vlugt, C., Asjes, C., and Bol, J.
1991. Identification of potyviruses using the polymerase chain reaction with degenerate
primers. J. Gen. Virol. 72:1531-1539.
Lawson, R.H., and Hearon, S.S. 1971. The association of pinwheel inclusions with
plasmodesmata. Virology 44:454-456.
Lesemann, D.-E. 1988. Cytopathology. In The Plant Viruses, Vol. 4, The Filamentous Plant
Viruses (Ed: Milne, R.G) pp. 179-235. New York and London: Plenum Press.
Lecoq, H., and Purcifiill, D.E. 1992. Biological variability of potyviruses, an example: zucchini
yellow mosaic virus. In: Barnett, O.W.(ed.), Potyvirus taxonomy. Springer, Wien and New
York (Archives of Virology [Supplement] 5), pp.229-234.
Li, R.H., Zettler, F.W., Elliott, M.S., Petersen, M.A., Still, P.A., Baker, C.A., and Mink, G.I.
1991. A strain of peanut mottle virus seedbome in bambarra groundnut. Plant Dis. 75:130-
133.
Li, R.H., Zettler, F.W., Baker, C.A., Purciiull, D.E., Hiebert, E., and Wisler, G.C. 1992.
Variability of capsid protein size among dasheen mosaic virus (DMV) isolates.
Phytopathology (Abstr.) 82:1090.
Li, R.H., Zettler, F.W., and Hiebert, E. 1994. Nucleotide sequence and expression of the coat
protein (CP) gene of a dasheen mosaic virus isolate (DsMV-Ch) from Caladium.
Phytopathology 84:1105.
Lindbo, J.A., and Dougherty, W.G. 1992. Pathogen-derived resistance to a potyvirus: immune
and resistant phenotypes in transgenic tobacco expressing altered forms of a potyvirus coat
protein nucleotide sequence. Mol. Plant-Microbe Interact. 5:144-153.
Ling, K., Namba, S., Gonsalves, C., Slightom, J.C., and Gonsalves, D. 1991. Protection
against detrimental effects of potyvirus infection in transgenic tobacco plants expressing the
papaya ringspot virus coat protein gene. Bio/Technology 9:752-758.
Lovisolo, 0., and Conti, M.A.C. 1969. Biological characterization of some isolates of
cucumber mosaic virus. Annales de Phytopathologie 1:367-373.
Maiss, E., Timpe, U., Brisske, A., Jelkmann, W., Casper, R., Himmler, G., Mattanovich, D.,
and Katinger, H. W. D. 1989. The complete nucleotide sequence of plum pox virus RNA. J.
Gen. Virol. 70:513-524.

130
Martin, M.T., and Garcia, J.A. 1991. Plum pox potyvirus RNA replication in a crude
membrane fraction from infected Nicoticma clevelandii leaves. J. Gen. Virol. 72:785-790.
Matthews, R.E.F. 1991. Plant Virology (3rd ed.) Academic Press, Inc., San Diego, California.
835p.
McCarty, D.R., Hattori, T., Carson, C.B., Vasil, V., Lazar, M., and Vasil, I.K. 1991. The
viviparous-1 developmental gene of maize encodes a novel transcriptional activator. Cell
66:895-905.
Morales, F.J., and Zettler, F.W. 1977. Aphid transmission characteristics of dasheen mosaic
virus. Fitopathol. Colombiana 6:134.
Murant, AF., and Roberts, I.M. 1971. Cylindrical inclusions in coriander leaf cells infected
with parsnip mosaic virus. J. Gen. Virol. 10:65-70.
Murphy, F.A, Fauquet, C.M., Bishop, DHL., Ghabrial, S.A., Jarvis, A.W., Martelli, G.P.,
Mayo, M.A., and Summers, M.D. 1995. Classification and Nomenclature of Viruses: Sixth
Report of the International Committee on Taxonomy of Viruses. Arch. Virol. (Supplement
10) Springer-Verlag, Wien, New York.
Murphy, J.F., Rhoads, R.E., Hunt, A.G., and Shaw, J.G. 1990. The VPg of tobacco etch virus
RNA is the 49-kDa proteinase or the N-terminal 24-kDa part of the proteinase. Virology
178:285-288.
Murphy, J.F., Rychlik, W., Rhoads, R.E., Hunt, A.G., and Shaw, J.G. 1991. A tyrosine
residue in the small nuclear inclusion protein of tobacco vein mottling virus links the VPg to the
viralRNA. J. Virol. 65:511-513.
Nagel, J., Zettler, F.W., and Hiebert, E. 1983. Strains of bean yellow mosaic virus compared
to clover yellow vein virus in relation to gladiolus production in Florida. Phytopathology
73:449-454.
Namba, S., Ling, K., Gonsalves, C., Slightom, J.L., and Gonsalves, D. 1992. Protection of
transgenic plants expressing the coat protein gene of watermelon mosaic virus 2 and zucchini
yellow mosaic virus against six potyviruses. Phytopathology 82:940-946.
Nicolas, O., and Laliberte, J-F. 1992. The complete nucleotide sequence of turnip mosaic
potyvirus RNA. J. Gen. Virol. 73:2785-2793.
Oh, C.-S., and Carrington, J.C. 1989. Identification of essential residues in potyvirus
proteinase HC-Pro by site-directed mutagenesis. Virology 173:692-699.

131
Paludan, N., and Begtrup, J. 1982. Diejfenbachia maculata (Lodd.) G. Don. Virus attack in
Danish cultures, survey and diagnosis. Danish Res. Serv. for Plant and Soil Sci. Report No.
1612:399-404.
Parks, T.D., and Dougherty, W.G. 1991. Substrate recognition by the NIa proteinase of two
potyviruses involves multiple domains: Characterization using genetically engineered hybrid
proteinase molecules. Virology 182:17-27.
Pappu, S.S., Pappu, H.R., Rybicki, E.R., and Niblett, C.L. 1993. A polymerase chain reaction
method adapted for selective amplification and cloning of 3’sequences of potyviral genomes:
application to dasheen mosaic virus. J. Virol. Methods. 41:9-20.
Pappu, S.S., Pappu, H.R., Rybicki, E.R., and Niblett, C.L. 1994a. Unusual amino terminal
sequence characterizes the capsid protein of dasheen mosaic virus. J. Gen. Virol. 75:239-242.
Pappu, S.S., Pappu, H.R., Lastra, R., and Niblett, C.L. 1994b. Variability in the length of the
amino terminal sequence contributes to the capsid protein diversity among dasheen mosaic
potyvirus isolates. Arch. Virol. 136:407-41.
Pirone, T.P., and Thombury, D.W. 1983. Role of virion and helper component in regulating
aphid transmission of tobacco etch virus. Phytopathology 73:872-875.
Poch, O., Sauvaget, I., Delarue, M, and Tordo, N. 1989. Identification of four conserved
motifs among the RNA-dependent polymerase encoding elements. EMBO J. 8:3867-3874.
Purcifiill, D.E., and Batchelor, D.L. 1977. Immunodifiusion tests with sodium dodecyl sulfate
(SDS) treated plant viruses and plant viral inclusions. Fla. Agrie. Exp. Stn. Tech. Bull. 788. 39
pp.
Puurand, U., Makinen, K., Paulin, L., and Saarma, M. 1994. The complete nucleotide
sequence of potato virus A: A genomic RNA and its sequence similarities with other
potyviruses. J. Gen. Virol. 75:457-461.
Quemada, H., L'Hostis, B., Gonsalves, D., Reardon, I. M. Heinrikson, R., Hiebert, E., Sieu, L.
C., and Slightom, J. L. 1990a. The nucleotide sequence of the 3'terminal region of papaya
ringspot virus strains W and P. J. Gen. Virol. 71:203-210.
Quemada, H., Sieu, L. C., Siemieniak, D. R., Gonsalves, D. and Slightom, J. L. 1990b.
Watermelon mosaic virus II and zucchini yellow mosaic virus: cloning of 3'terminal regions,
nucleotide sequences, and phylogenetic comparisons. J. Gen. Virol. 71:1451-1460.
Quintero, S. 1989. [Virosis in tardas (Xanthosoma sp.) and taro (Colocasia esculenta) in
Cuba.] Agrotecnia de Cuba 21(2)75-85.

132
Ramirez, P. 1985. [Isolation and characterization of dasheen mosaic virus in Costa Rica.]
Turrialba 35(3):279-283.
Rana, G.L., Vovlas, C., and Zettler, F.W. 1983. Manual transmission of dasheen mosaic virus
from Richardia to nonaraceous hosts. Plant Dis. 67:1121 -1122.
Regner, F., da Camara-Machado, M.L., Steinkellner, H., and Mattanovich, D. 1992. Coat
protein mediated resistance to plum pox virus in Nicotiana clevelcuidii and N. benthamiana.
Plant Cell Repts. 11:30-33.
Restrepo-Hartwig, M.A, and Carrington, J.C. 1992. Regulation of nuclear transport of a plant
potyvirus protein by autoproteolysis. J. Virol. 66:5662-5666.
Riechmann, J.L., Lain, S., and Garcia, J. A. 1989. The genome-linked protein and 3’ RNA
sequence of plum pox potyvirus. J. Gen. Virol. 70:2785-2789.
Riechmann, J.L., Lain, S., and Garcia, J. A 1991. Identification of the initiation codon of
plum pox potyvirus genomic RNA. Virology 185:544-552.
Riechmann, J.L., Lain, S., and Garcia J.A. 1992. Highlights and prospects of potyvirus
molecular biology. J. Gen. Virol. 73:1-16.
Rodríguez-Cerezo, E., Klein, P. G, and Shaw, J. G. 1991. A determinant of disease symptom
severity is located in the 3'-terminal noncoding region of the RNA of a plant virus. Proc. Natl.
Acad. Sci. USA 88:9863-9867.
Robaglia, C., Durand-Tardif, M., Tronchet, M., Boudazin, G, Astier-Manifacier, S., and
Casse-Delbart, F. 1989. Nucleotide sequence of potato virus Y (N strain) genomic RNA J.
Gen. Virol. 70:935-947.
Robertson, N.L., French, R., and Gary, S.M. 1991. Use of group-specific primers and the
polymerase chain reaction for the detection and identification of luteoviruses. J. Gen. Virol.
72:1473-1477.
Rodoni, S.C., and Moran, J.R. 1988. The detection of dasheen mosaic virus using the enzyme-
linked immunosorbent assay (ELISA). Acta Hort. 234:281-288.
Rojas, M.R., Gilbertson, R.L., Russell, D.R., and Maxwell, D P. 1993. Use of degenerate
primers in the polymerase chain reaction to detect whitefly-transmitted geminiviruses. Plant
Dis. 77:340-347.

133
Rowhani, A., Chay, C., Golino, D.A., and Falk, B.W. 1993. Development of a polymerase
chain reaction technique for the detection of grapevine fanleaf virus in grapevine tissue.
Phytopathology 83:749-753.
Salomon, R., and Raccah, B. 1990. The role of the N-terminus of potyvirus coat protein in
aphid transmission. Abstr. pp. 83-87, VIII Int. Cong. Virol., Berlin, Aug.26-31. 1990.
Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual.
2nd ed., Vol. 2. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
Samyn, G., and Welvaert, W. 1977. Dasheen mosaic virus of some Araceae species. Med.
Fac. Landbouww. Rijksuniv. Gent. 42:1227-1233.
Sano, Y., van der Vlugt, R., de Haan, P., Takahashi, A., Kawakami, M., Goldbach, R., and
Kojima, M. 1992. On the variability of the 3’terminal sequence of the turnip mosaic virus
genome. Arch. Virol. 126:231-238.
Scorza, R., Ravelonanard, M., Callahan, AM., Cordts, J.M., Fuchs, M., Dunez, J., and
Gonsalves, D. 1994. Transgenic plum (Primus domestica L.) expresses the plum pox virus
coat protein gene. Plant Cell Repts. 14:18-22.
Shahabuddin, M., Shaw, J.G., and Rhoads, R.E. 1988. Mapping of the tobacco vein mottling
virus VPg cistron. Virology 163:636-637.
Shanmuganathan, N. 1980. Virus and virus-like diseases of plants in the Gilbert Islands.
F.A.O. Plant Protect. Bull. 28:29-38.
Shaw, D. E., Plumb, R. T., and Jackson, J.V.H. 1979. Virus diseases of taro (Colocasia
esculenta) and Xanthosoma sp. in Papua New Guniea. Papua New Guinea Agrie. J. 30:71-79.
Sheffield, F.M.L. 1941. The cytoplasmic and nuclear inclusions associated with severe etch
virus. J. Royal Microscop. Soc. 61:30-45.
Shimoyama, J., Hanada, K., Kameya-Iwaki, M., Tochihara, H, and Gunji, T. 1990. Necrotic
stunt disease of konjak, Amorphophallus konjac, caused by cucumber mosaic virus. Ann.
Phytopathol. Soc. Japan 56:680-683.
Shimoyama, J., Hanada, K., Tsuda, S., Kameya-Iwaki, M., and Gunji, T. 1992a. Some
physicochemical and serological properties of konjak mosaic virus and dasheen mosaic virus.
Ann. Phytopathol. Soc. Japan 58:713-718.

134
Shimoyama, J., Kameya-Iwaki, M., Hanada, K., and Gunji, T. 1992b. Konjak mosaic virus, a
new potyvirus infecting konjak, Amorphophallus konjak. Ann. Phytopathol. Soc. Japan 58:
706-712.
Shukla, D.D., Strike, P.M., Tracy, S.L., Gough, K.L., and Ward, C.W. 1988. The N and C
termini of the coat proteins of potyviruses are surface-located and the N terminus contains the
major virus-specific epitopes. J. Gen. Virol. 69:493-502.
Shukla, D.D., and Ward, C.W. 1988. Amino acid sequence homology of coat protein as a basis
for identification and classification of the potyvirus group. J. Gen. Virol. 69:2703-2710.
Shukla, D.D., and Ward, G.W. 1989. Structure of potyvirus coat proteins and its application
in the taxonomy of the potyvirus group. Adv. Virus Res. 36:273-314.
Shukla, D.D., Ward, C.W., and Brunt, A.A. 1994. Potyviridae. CAB International,
Wallingford, UK.
Siaw, M.F.E., Shahabuddin, ML, Ballard, S., and Shaw, J.G. 1985. Identification of a protein
covalently linked to the 5' terminal of tobacco vein mottling virus RNA. Virology 142:134-
143.
Smith, G.R., and van de Velde, R. 1994. Detection of sugarcane mosaic virus and Fiji disease
virus in diseased sugarcane using the polymerase chain reaction. Plant Dis. 78:557-561.
Spiegel, S., Frison, E.A., and Converse, R.H. 1993. Recent developments in therapy and
virus-detection procedures for international movement of clonal plant germ plasm. Plant Dis.
77:1176-1180.
Stark, D.M., and Beachy, R.N. 1989. Protection against potyvirus infection in transgenic
plants: evidence for broad spectrum resistance. Bio/Technology 7:1257-1262.
Thole, V., Dalmay, T., Burgyan, J., and Balazs., E. 1993. Cloning and sequence of potato
virus Y (Hungarian isolate) genomic RNA. Gene 123:149-156.
Thombury, D.W., Hellmann, G.M., Rhoads, R.E., and Pirone, T.P. 1985. Purification and
characterization of potyvirus helper component. Virology 144:260-267.
Thombury, D.W., Patterson, C.A., Dessens, J.T., and Pirone, T.P. 1990. Comparative
sequence of the helper component (HC) region of potato virus Y and a HC-defective strain,
potato virus C. Virology 178:573-578.
Thombury, D.W., and Pirone, T.P. 1983. Helper component of two potyviruses are
serologically distinct. Virology 144:260-267.

135
Tompkins, C.M., and Severin, H.H.P. 1950. Spotted wilt of white, yellow and pink calla.
Hilgardia 20:207.
Tooyama, A. 1975. Indicator plants for dasheen mosaic virus. Ann. Phytopathol. Soc. Japan
41:504-505.
Turpén, T. 1989. Molecular cloning of a potato virus Y genome: nucleotide sequence
homology in non-coding regions of potyviruses. J. Gen. Virol. 70:1951 -1960.
U. S. Bureau of the Census. 1974. U. S. Census of Agriculture Vol. V. Special Reports, Part
1. Horticulture Specialties. Washington D. C.: U. S. Government Printing Office.
Uyeda, I. 1992. Bean yellow mosaic virus subgroup: Search for the group specific sequences
in the 3’ terminal region of the genome. In: Barnett, O.W. (ed.), Potyvirus Taxonomy.
Springer-Verlag, Wien and New York (Archives of Virology [Supplement] 5), pp.377-385.
Van der Meer, F.W. 1985. Occurrence of dasheen mosaic virus in South Africa.
Phytophylactica 17:95-98.
Vance, V.B., Moore, D., Turpén, T.H., Bracker, A, and Hollowell, V.C. 1992. The complete
nucleotide sequence of pepper mottle virus genomic RNA: Comparison of the encoded
polyprotein with those of other sequenced potyviruses. Virology 191:19-30.
Verchot, J., and Carrington, J.C. 1995. Debilitation of plant potyvirus infectivity by PI
proteinase-inactivating mutations and restoration by second-site modifications. J. Virol.
69:1582-1590.
Verchot, J., Koonin, E.V., and Carrington, J.C. 1991. The 35-kDa protein from the N-
terminus of a potyviral polyprotein functions as a third virus-encoded proteinase. Virology
185:527-535.
Volin, R.B., Thottappilly, G., Rossel, H.W., and Terry, E.R. 1981. Isolation of dasheen
mosaic virus in Nigeria and screening cocoyam seedling populations for resistance.
Phytopathology 71:263.
Vunsh, P., Rosner, A.; and Stein, A. 1990. The use of the polymerase chain reactions (PCR)
for the detection of bean yellow mosaic virus in gladiolus. Ann. Appl. Biol. 117:561-569.
Wetzel, T., Candresse, T., Rawelonandro, and Dunez, J. 1991a. A polymerase chain reaction
assay adapted to plum pox potyvirus detection. J. Virol. Methods 33:355-365.

136
Wetzel, T., Candresse, T., Rawelonandro, M., Delbos, R. P., Mazyad, H., Aboul-Ata, A. E.,
and Dunez, J. 1991b. Nucleotide sequence of the 3'-terminal region of the RNA of the El
Amar strain of plum pox potyvirus. J. Gen. Virol. 72:1741-1746.
Wisler, G.C. 1992. Characterization of the PI protein of the zucchini yellow mosaic potyvirus.
Ph.D. Dissertation. University of Florida, Gainesville. 129p.
Wisler, G.C., Purcifull, D.E., and Hiebert, E. 1995. Characterization of the PI protein and
coding region of the zucchini yellow mosaic virus. J. Gen. Virol. 76:37-45.
Wisler, G.C., Zettler, F.W., and McRitchie, J.J. 1978. Dasheen mosaic virus infections of
philodendrons in Florida. Proc. Fla. State Hort. Soc. 91:237-240.
Xiao, X.W., Frenkel, M.J., Teakle, D.S., Ward, C.W., and Shukla, D.D. 1993. Sequence
diversity in the surface-exposed amino-terminal region of the coat proteins of seven strains of
sugarcane mosaic virus correlated with their host range. Arch. Virol. 132:399-408.
Yeh, S.-D., Jan, F.-J., Chiang, C.H., Doong, T.-J., Chen, M.-C., Chung, P.-H., and Bau, H.-J.
1992. Complete nucleotide sequence and genetic organization of papaya ringspot virus RNA.
J. Gen. Virol. 73:2531-2541.
Zaccomer, B., Cellier, F., Boyer, J.C., Haenni, A.L., and Tepfeer, M. 1993. Transgenic plants
that express coat protein gene including the 3’ untranslated region of the turnip yellow mosaic
virus (TYMV) genome are partially protected against TVMV infection. Gene 136:87-94.
Zettler, F.W., Abo El-Nil, M.M., and Hiebert, E. 1978. Dasheen mosaic virus. CMI/AAB
Descriptions of Plant Viruses. No. 191.
Zettler, F.W., Foxe, M.J., Hartman, R.D., Edwardson, J.R., and Christie, R.G. 1970.
Filamentous viruses infecting dasheen and other araceous plants. Phytopathology 60:783-987.
Zettler, F.W., and Hartman, R.D. 1986. Dasheen mosaic virus and its control in cultivated
aroids. Pages 91-102 in: Virus Diseases of Horticultural Crops in the Tropics and Subtropics.
FFTC Book Ser. 3. Food and Fertilizer Technology Center for the Asian and Pacific Region.
Taipei, Taiwan, Republic of China. 193pp.
Zettler, F.W., and Hartman, R.D. 1987. Dasheen mosaic virus as a pathogen of cultivated
aroids and control of the virus by tissue culture. Plant Dis. 71:958-963.
Zettler, F.W., Hartman, R.D., and Logan, A.E. 1991. Feasibility of producing pathogen-free
aroid root crops commercially by micropropagation, pp. 80-85. In Twenty-sixth Annu.
Meeting of the Caribbean Root Crops Society, 24 July- 4 August, 1990, Mayaguez, Puerto
Rico.

137
Zettler, F.W., Jackson, G.V.H., and Frison, E.A 1989. FAO/IBPGR Technical Guidelines for
the Safe Movement of Edible Aroid Germplasm. Food and Agriculture of the United States,
Rome/Intemational Board for Plant Genetic Resources, Rome, 24 p.
Zettler, F.W., Tsai, J.H., Faan, H.C., Ke, C, and Lu, K.C. 1987. Dasheen mosaic virus
infecting taro in People’s Republic of China. Plant Dis. 837-839.
Zheng, G. Y., Kositratana, W.C., and Gumpf, D.J. 1988. Detection of plant viruses using dot-
immunobinding assay. Chinese J. Virol. 4:150-156.

BIOGRAPHICAL SKETCH
Ruhui Li was bom in Kunming, P. R. China, on March 17, 1959. She graduated
from Yunnan Agricultural University in 1982 with a B.S. in plant protection. She started
work at Yunnan Agricultural Academy of Sciences as a research assistant and then was a
research associate in the field of plant pathology. In 1988, she came to the Department of
Plant Pathology at the University of Florida as a visiting scholar and worked under the
supervision of Dr. C. L. Niblett, after which she worked under Dr. F. W. Zettler. She
started a graduate program in 1990 under the direction of F. W. Zettler, working on the
molecular biology and detecting techniques of dasheen mosaic vims. She expects to
receive her Ph.D. degree in August of 1995. Ruhui is a member of the American
Phytopathological Society.
138

I certify that I have read this study and that in
acceptable standards of scholarly presentation and is fully adei
as a dissertation for the degree of Doctor of Philosophy.
opinion it conforms to
scope and quality,
F. W. Zettler, Chairman
Professor of Plant Pathology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Ernest Hiebert, Cochairman
Professor of Plant Pathology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
£. / tU<;
Dan E. Purcifull
Professor of Plant Pathology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Charles L. Guy"
Associate Professor of Horiiculture
This dissertation was submitted to the Graduate Faculty of the College of
Agriculture and to the Graduate School and was accepted as partial fulfillment of the
requirements for the degree of Doctor of Philosophy.
T.
August, 1995
Dean, College of Agriculture
Dean, Graduate School

LD
1780
1395
â–  IrleW
yjXXSiSir 0F florida
3 i 'I mi lililí II |
1262 08556 8177



xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID ED2LSF72O_0WB8HX INGEST_TIME 2011-09-29T20:42:25Z PACKAGE AA00004712_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES



PAGE 1

02/(&8/$5 &+$5$&7(5,=$7,21 $1' '(7(&7,21 2) '$6+((1 026$,& 9,586 %\ 58+8,/, $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

$&.12:/('*0(176 ZRXOG OLNH WR H[SUHVV P\ GHHSHVW DSSUHFLDWLRQ DQG JUDWLWXGH WR 'U ) : =HWWOHU D JUHDW WHDFKHU LQ P\ FDUHHU 0\ LQWHUHVW LQ SODQW YLURORJ\ ZDV LQVSLUHG ZKHQ DWWHQGHG KLV SODQW YLURORJ\ FODVV DQG FRQWLQXHG ZKHQ ZRUNHG LQ KLV ODERUDWRU\ ,QGHHG WKLV ZRUN FRXOG QRW KDYH EHHQ GRQH ZLWK KLV DGYLFH VXSSRUW HQFRXUDJHPHQW DQG SDWLHQFH ZRXOG OLNH WR WKDQN 'U (UQHVW +LHEHUW FRFKDLUPDQ RI P\ FRPPLWWHH ZKR DOZD\V VKDUHG ZLWK PH KLV H[SHUWLVH LQ PDQ\ SDUWV RI P\ UHVHDUFK ZKR ZDV DOZD\V SDWLHQW ZKHQ OHDUQHG WR GR FRPSXWHU DQDO\VLV 0\ JUHDW JUDWLWXGH DOVR JRHV WR 'U ( 3XUFLIXOO IRU KLV VXSSRUW RI P\ UHVHDUFK IRU KLV HQFRXUDJHPHQW ZKHWKHU VXFFHHG RU IDLOHG IRU KLV FRQVWUXFWLYH FULWLFLVP DQG FKDOOHQJH WR P\ ZULWLQJ IRU KLV VWULFW DWWLWXGH WR ZRUN DQG IRU KLV VHQVH RI KXPRU WRR ZRXOG OLNH WR H[WHQG P\ DSSUHFLDWLRQ WR 'U & / *X\ ZKR DOZD\V RSHQHG WKH GRRU IRU PH DQG ZKR VKDUHG KLV NQRZOHGJH DQG WLPH ZLWK PH ZLVK WR H[SUHVV P\ JUDWLWXGH WR 'U 1 $JULRV IRU KLV FDUH DQG HQFRXUDJHPHQW GXULQJ WKHVH \HDUV 0\ VSHFLDO WKDQNV JR WR 'U & / 1LEOHWW DQG KLV ZLIH 7LIIDQ\ IRU WKHLU HQFRXUDJHPHQW DQG NLQGQHVV GXULQJ WKH LQLWLDO VWDJH RI P\ VWXG\ LQ WKH 8QLWHG 6WDWHV ZDQW WR WKDQN 'U &DUO\H %DNHU ZKR ILUVW WDXJKW PH WKH PROHFXODU WHFKQLTXHV DQG ZKR ZDV DOZD\V WKHUH ZKHQ QHHGHG KHOS ZLWK D VPLOH DOVR ZDQW WR WKDQN 'U *DLO :LVOHU IRU DOZD\V VWDQGLQJ WKHUH QRW MXVW DV D FROOHDJXH EXW DOVR DV D IULHQG X

PAGE 3

, ZRXOG OLNH WR H[WHQG P\ DSSUHFLDWLRQ WR .ULVWLQ %HFNKDP 0DXUHHQ 3HWHUVHQ 0DUN (OOLRWW (XJHQH &UDZIRUG (OOHQ 'LFNVWHLQ DQG /XFLRXV 0LWFKHOO IRU WKHLU H[FHOOHQW WHFKQLFDO DVVLVWDQFH DQG IULHQGVKLS JLYH KHDUWIHOW WKDQNV WR P\ SDUHQWV )HQJOLQJ /L DQG *XL]KHQ +H IRU WKHLU ORYH VXSSRUW HQFRXUDJHPHQW DQG XQGHUVWDQGLQJ 7KH\ KDYH QRW VHHQ WKHLU HOGHVW FKLOG DQG RQO\ GDXJKWHU IRU DOPRVW VHYHQ \HDUV 7R WKHP RZH P\ GHHSHVW JUDWLWXGH 7R P\ KXVEDQG :HL:HL 5DR DQG RXU VRQ 5DQ 5DR JR P\ ORYH DQG JUDWLWXGH WKH\ KDYH HQGXUHG PDQ\ KDUGVKLSV DORQJ WKH ZD\ DQG ERWK KDYH VDFULILFHG D ORW MXVW WR VKDUH WKLV GUHDP ZLWK PH DOVR JUDWHIXOO\ DFNQRZOHGJH WKH ILQDQFLDO DVVLVWDQFH RI WKH 86'$&656 &%$* *UDQW 1R f WKH $PHULFDQ )ORUDO (QGRZPHQW DQG WKH 0DQDWHH )UXLW &RPSDQ\

PAGE 4

7$%/( 2) &217(176 3DJH $&.12:/('*0(176 LL /,67 2) ),*85(6 YL /,67 2) 7$%/(6 YLLL .(< 72 $%%5(9,$7,216 L[ $%675$&7 [L &+$37(5 ,1752'8&7,21 *HQHUDO &KDUDFWHULVWLFV RI 3RW\YLULGDH 'DVKHHQ 0RVDLF 9LUXV &+$37(5 &/21,1* 6(48(1&,1* 2) f7(50,1$/ 5(*,21 $1' &2$7 3527(,1 (;35(66,21 2) '609&KO ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 5HVXOWV 'LVFXVVLRQ &+$37(5 9$5,$%,/,7< 2) &2$7 3527(,16 $021* ,62/$7(6 2) '$6+((1 026$,& 9,586 ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 5HVXOWV 'LVFXVVLRQ &+$37(5 '(7(&7,21 2) '$6+((1 026$,& 9,586 ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV LY

PAGE 5

5HVXOWV 'LVFXVVLRQ &+$37(5 6800$5< $1' &21&/86,216 5()(5(1&( /,67 %,2*5$3+,&$/ 6.(7&+ Y

PAGE 6

/,67 2) ),*85(6 )LJXUH 3DJH $QDO\VLV RI SDUWLDOO\ SXULILHG DQG SXULILHG 'V09&KO SUHSDUDWLRQV (OHFWURQ PLFURJUDSK RI D SXULIHG 'V09&KO SUHSDUDWLRQ QHJDWLYHO\ VWDLQHG ZLWK b XUDQ\O DFHWDWH $JDURVH JHO HOHFWURSKRUHVLV RI 'V09&KO 51$ LVRODWHG IURP SXULIHG YLULRQV 0DS RI WKH F'1$ FORQHV UHSUHVHQWLQJ WKH 'V09&KO JHQRPH 6HTXHQFLQJ VWUDWHJ\ XVHG IRU WKH F'1$ FORQHV UHSUHVHQWLQJ WKH fWHUPLQDO UHJLRQ RI 'V09 &KL 1XFOHRWLGH VHTXHQFH RI WKH fWHUPLQDO UHJLRQ RI 'V09&KO 3K\ORJHQHWLF WUHH REWDLQHG IURP WKH DOLJQPHQW RI SXWDWLYH DPLQR DFLG VHTXHQFHV RI 1LE SURWHLQV EHWZHHQ 'V09 DQG RWKHU SRW\YLUXVHV XVLQJ WKH 3$83 SURJUDP +\GURSKRELFLW\ SORW RI WKH 1LE SURWHLQ VHTXHQFH RI 'V09&KO 3K\ORJHQHWLF WUHH REWDLQHG IURP WKH DOLJQPHQW RI FRDW SURWHLQV EHWZHHQ 'V09 LVRODWHV DQG SRW\YLUXVHV XVLQJ WKH 3$83 SURJUDP 3K\ORJHQHWLF WUHH REWDLQHG IURP WKH DOLJQPHQW RI FRDW SURWHLQV EHWZHHQ 'V09 LVRODWHV DQG RWKHU SRW\YLUXVHV XVLQJ WKH 3$83 SURJUDP $QDO\VLV RI WKH 'V09 S(7K&3 H[SUHVVHG LQ ( FROL :HVWHUQ EORWWLQJ DQDO\VLV RI WKH H[SUHVVHG &3 DQG QDWLYH &3 RI 'V09 :HVWHUQ EORWWLQJ DQDO\VLV RI WKH FRDW SURWHLQV RI GDVKHHQ PRVDLF YLUXV 'V09f LVRODWHV IURP WKHLU RULJLQDO KRVWV 9,

PAGE 7

:HVWHUQ EORWWLQJ DQDO\VLV RI WKH &KL LVRODWH RI GDVKHHQ PRVDLF YLUXV 'V09&KOf DQG RWKHU SRW\YLUXVHV :HVWHUQ EORWWLQJ DQDO\VLV RI WKH &KL LVRODWH RI GDVKHHQ PRVDLF YLUXV 'V09&KOf WUDQVIHUUHG WR VHYHUDO GLIIHUHQW KRVWV :HVWHUQ EORWWLQJ DQDO\VLV RI IRXU GDVKHHQ PRVDLF YLUXV 'V09f LVRODWHV VHULDOO\ SURSDJDWHG LQ 3KLORGHQGURQ VHOORXP VHHGOLQJV &RPSDULVRQ RI QXFOHRWLGH VHTXHQFHV RI WKH FRDW SURWHLQ &3f JHQH RI GDVKHHQ PRVDLF YLUXV LVRODWHV &RPSDULVRQ RI DPLQR DFLG VHTXHQFHV RI FRDW SURWHLQV RI GDVKHHQ PRVDLF YLUXV LVRODWHV &RPSDULVRQ RI QXFOHRWLGH VHTXHQFHV RI WKH f1&5V RI GDVKHHQ PRVDLF YLUXV LVRODWHV (OHFWURQ PLFURJUDSK RI F\OLQGULFDO LQFOXVLRQV &Of LQGXFHG E\ D FDODGLXP LVRODWH RI GDVKHHQ PRVDLF YLUXV LQ D OHDI FHOO RI 3KLORGHQGURQ VHOORXP $JDURVH JHO HOHFWURSKRUHVLV RI 573&5 DPSOLILHG SURGXFWV REWDLQHG IURP WRWDO 51$ H[WUDFWHG IURP DURLG OHDI WLVVXHV $JDURVH JHO HOHFWURSKRUHVLV RI 573&5 DPSOLILHG SURGXFWV REWDLQHG IURP WRWDO 51$ H[WUDFWHG IURP OHDI WLVVXHV RI FDOOD OLO\ SODQWV YLL

PAGE 8

/,67 2) 7$%/(6 7DEOH 3DJH 'V09&KO F'1$ FORQHV LGHQWLILHG E\ LPPXQRVFUHHQLQJ DQG SUHOLPLQDU\ VHTXHQFLQJ 'V09&KO F'1$ FORQHV LGHQWLILHG E\ SUHOLPLQDU\ VHTXHQFLQJ 3HUFHQW QXFOHRWLGH LGHQWLW\ RI 1LE JHQHV RI 'V09&KO DQG RWKHU SRW\YLUXVHV 3HUFHQW VLPLODULW\ RI WKH 1LE SURWHLQ WKH FRDW SURWHLQ DQG WKH f QRQFRGLQJUHJLRQ f1&5f RI 'V09&KO DQG RWKHU SRW\YLUXVHV 3HUFHQW QXFOHRWLGH LGHQWLW\ RI &3 JHQHV RI WZR 'V09 LVRODWHV DQG RWKHU SRW\YLUXVHV &RPSDULVRQ RI WKH 'V09)/ DQWLVHUXP DQG WKH H[SUHVVHG FRDW SURWHLQ DQWLVHUXP LQ ,(/,6$ $LR DEVRUEDQFH YDOXH RI ,(/,6$ DQG '$6(/,6 $ IRU 'V09 GHWHFWLRQ &RPSDULVRQ RI ,(/,6$ DQG :HVWHUQ EORWWLQJ SURFHGXUHV WR GHWHFW 'V09 LQ FDODGLXP OHDYHV 5HODWLYH GLVWULEXWLRQ RI 'V09 LQ WKUHH DURLG KRVWV DV GHWHUPLQHG E\ ,(/,6$ (IIHFW RI ZRXQGLQJ RQ GHWHFWLRQ RI 'V09 LQ FDODGLXP FRUPV &RPSDULVRQ RI 573&5 ,(/,6$ DQG :HVWHUQ EORWWLQJ IRU GHWHFWLQJ 'V09 YLLL

PAGE 9

.(< 72 $%%5(9,$7,216 $, ES %&09 %&09 %<09 &3 &WHUPLQXV F'1$ &09 &O S&L ',(&$ '602 'V09&H 'V09&KO 'V09&K 'V09&K 'V09;F 'V09=D (/,6$ +&3UR ,37* NE N'D /% S0( 0: f1&5 1WHUPLQXV 1,D 1LE QP QW ROLJR G7 DPRUSKRXV LQFOXVLRQ EDVH SDLU EHDQ FRPPRQ PRVDLF YLUXV EODFNH\H FRZSHD PRVDLF YLUXV EHDQ \HOORZ PRVDLF YLUXV FRDW SURWHLQ FDUER[\WHUPLQXV FRPSOHPHQWDU\ '1$ FXFXPEHU PRVDLF YLUXV F\OLQGULFDO LQFOXVLRQ PLFUR&XULH GLHWK\OGLWKLRFDUEDPDWH GLPHWK\O VXOIR[LGH WDUR LVRODWH RI GDVKHHQ PRVDLF YLUXV FDODGLXP LVRODWH RI GDVKHHQ PRVDLF YLUXV IURP FXOWLYDU n&DQGLGXPf FDODGLXP LVRODWH RI GDVKHHQ PRVDLF YLUXV IURP FXOWLYDU &DURO\Q :KRUWRQf FDODGLXP LVRODWH RI GDVKHHQ PRVDLF YLUXV IURP FXOWLYDU n)ULHGD +HPSOHf FRFR\DP LVRODWH RI GDVKHHQ PRVDLF YLUXV FDOOD OLO\ LVRODWH RI GDVKHHQ PRVDLF YLUXV HQ]\PHOLQNHG LPPXQRVRUEHQW DVVD\ KHOSHU FRPSRQHQWSURWHDVH LVRSURS\O%'WKLRJDODFWRS\UDQRVLGH NLOREDVH NLORGDOWRQ /XULD EURWK 3PHUFDSWRHWKDQRO PROHFXODU ZHLJKW f QRQFRGLQJ UHJLRQ DPLQRWHUPLQXV QXFOHDU LQFOXVLRQ D QXFOHDU LQFOXVLRQ E QDQRPHWHU QXFOHRWLGH ROLJRQXFOHRWLGH GHR[\WK\PLGLQH ,;

PAGE 10

3&5 3HS0R9 30R9 339 3569: 35693 36E09 36W9 39< 573&5 6E09 6&09 6'63$*( 7(9 7X09 7909 :09 ;*DO =<09 SRO\PHUDVH FKDLQ UHDFWLRQ SHSSHU PRWWOH YLUXV SHDQXW PRWWOH YLUXV SOXP SR[ YLUXV SDSD\D ULQJVSRW YLUXV W\SH : SDSD\D ULQJVSRW YLUXV W\SH 3 SHD VHHGERUQH PRVDLF YLUXV SHDQXW VWULSH YLUXV SRWDWR YLUXV < UHYHUVH WUDQVFULSWLRQSRO\PHUDVH FKDLQ UHDFWLRQ VR\EHDQ PRVDLF YLUXV VXJDUFDQH PRVDLF YLUXV VRGLXP GRGHF\O VXOIDWH SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV WREDFFR HWFK YLUXV WXUQLS PRVDLF YLUXV WREDFFR YHLQ PRWWOLQJ YLUXV ZDWHUPHORQ PRVDLF YLUXV EURPRFKORURLQIRO\O'JDODFWRS\UDQRVLGH ]XFFKLQL \HOORZ PRVDLF YLUXV

PAGE 11

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ 02/(&8/$5 &+$5$&7(5,=$7,21 $1' '(7(&7,21 2) '$6+((1 026$,& 9,586 E\ 5XKXL /L $XJXVW &KDLUPDQ ) : =HWWOHU &RFKDLUPDQ ( +LHEHUW 0DMRU 'HSDUWPHQW 3ODQW 3DWKRORJ\ 7KH VHTXHQFH RI WKH fWHUPLQDO QXFOHRWLGHV RI D FDODGLXP &DODGLXP KRUWXODQXPf LVRODWH RI GDVKHHQ PRVDLF YLUXV 'V09&KOf ZDV GHWHUPLQHG 7KH UHJLRQ FRQWDLQV WKH QXFOHRWLGH VHTXHQFH ZKLFK HQFRGHV WKH FDUER[\O WHUPLQXV RI WKH 1,D SURWHDVH WKH 1LE 51$ SRO\PHUDVH DQG WKH FRDW SURWHLQ &3f 7KH JHQRPLF RUJDQL]DWLRQ RI WKLV UHJLRQ LV VLPLODU WR WKRVH RI RWKHU SRW\YLUXVHV 7KH RYHUDOO QXFOHRWLGH VHTXHQFH KRPRORJ\ RI WKH FRGLQJ UHJLRQ FRPSDUHG ZLWK WKRVH RI RWKHU VHTXHQFHG SRW\YLUXVHV LV EHWZHHQ b DQG WKH DPLQR DFLG VHTXHQFH KRPRORJ\ LV EHWZHHQ b 3K\ORJHQHWLF DOLJQPHQW RI WKH JHQRPLF VHTXHQFHV LQGLFDWHG WKDW 'V09 LV D GLVWLQFW PHPEHU RI WKH JHQXV 3RW\YLUXV LQ WKH IDPLO\ 3RW\YLULGDH 7KH &3 JHQH RI 'V09&K ZDV DPSOLILHG E\ 3&5 FORQHG LQWR D S(7K YHFWRU DQG H[SUHVVHG LQ (VFKHULFKLD FROL $QWLVHUXP DJDLQVW WKH H[SUHVVHG &3 ZDV REWDLQHG DQG LW ZDV VXLWDEOH IRU GHWHFWLQJ 'V09 LQ 6'6GLIIXVLRQ WHVW (/,6$ DQG :HVWHUQ EORWWLQJ ;,

PAGE 12

9DULDELOLW\ DPRQJ 'V09 LVRODWHV IURP FDODGLXP FDOOD OLO\ =DQWHGHVFKLD VSSf FRFR\DP ;DQWKRVRPD VSSf DQG WDUR &RORFDVLD HVFXOHQWDf ZDV QRWHG LQ V\PSWRP VHYHULW\ LQ LQRFXODWHG 3KLORGHQGURQ VHOORXP VHHGOLQJV 7KH &3 PROHFXODU ZHLJKW 0:Vf DPRQJ LVRODWHV YDULHG UDQJLQJ IURP N'D LQ WKHLU RULJLQDO KRVWV EDVHG RQ ZHVWHUQ EORWWLQJ DQDO\VLV %HFDXVH UHVSHFWLYH 0:V RI HDFK 'V09 LVRODWH UHPDLQHG FRQVWDQW DIWHU WKUHH SDVVDJHV LQ 3KLORGHQGURQ VHOORXP RU RWKHU KRVWV LW ZDV FRQFOXGHG WKDW WKH REVHUYHG GLIIHUHQFHV LQ WKH &3 0:V ZHUH YLUXVPHGLDWHG &RPSDULVRQ RI WKH &3 VHTXHQFH DPRQJ 'V09 LVRODWHV UHYHDOHG GHOHWLRQV DQG DGGLWLRQV DW WKH fWHUPLQDO UHJLRQV ZKLFK PD\ FRQWULEXWH WR WKH YDULDELOLW\ RI WKH &3 0:V DPRQJ GLIIHUHQW 'V09 LVRODWHV 'V09 ZDV QRW XQLIRUPO\ GLVWULEXWHG ZLWKLQ WLVVXHV RI LQIHFWHG FRFR\DP DQG WDUR OHDYHV ,Q FRQWUDVW PRUH XQLIRUP GLVWULEXWLRQ RI WKH YLUXV ZDV QRWHG ZLWKLQ LQIHFWHG n&DQGLGXPf n&DURO\Q :KRUWRQf DQG n)ULHGD +HPSOHf FDODGLXP OHDYHV 5HODWLYHO\ KLJK JURZLQJ WHPSHUDWXUHV UHVXOWHG LQ D UHGXFWLRQ LQ WKH GLVWULEXWLRQ RI 'V09 ZLWKLQ OHDYHV RI LQIHFWHG FRFR\DP DQG WDUR SODQWV 8QGHU VXFK FRQGLWLRQV PDQ\ OHDYHV ZLWKRXW GHWHFWDEOH YLUXV ZHUH SURGXFHG E\ LQIHFWHG SODQWV ZKLFK PD\ EH UHODWHG WR UHVWULFWLRQ RI YLUXV PRYHPHQW LQ WKHVH SODQWV ,PPXQRVRUEHQW HOHFWURQ PLFURVFRS\ ,6(0f (/,6$ :HVWHUQ EORWWLQJ DQG UHYHUVH WUDQVFULSWLRQ3&5 573&5f ZHUH XVHG WR GHWHFW GLIIHUHQW 'V09 LVRODWHV LQ OHDYHV DQGRU FRQQV RI FDODGLXP FDOOD OLO\ FRFR\DP DQG WDUR 2I WKHP 573&5 ZDV WKH PRVW VHQVLWLYH 'V09 GHWHFWLRQ ZDV DOVR IDFLOLWDWHG E\ FRUP ZRXQGLQJ ;OO

PAGE 13

&+$37(5 ,1752'8&7,21 'DVKHHQ PRVDLF YLUXV 'V09f LV D VSHFLHV RI WKH JHQXV 3RW\YLUXV LQ WKH IDPLO\ 3RW\YLULGDH DQG LQIHFWV SODQWV LQ WKH IDPLO\ $UDFHDH FROOHFWLYHO\ UHIHUUHG WR DV DURLGV 7KLV SRW\YLUXV FDXVHV VWXQWLQJ DQG IROLDU PRVDLF FKORURWLF IHDWKHULQJ DQG GLVWRUWLRQ V\PSWRPV LQ LQIHFWHG SODQWV WKHUHE\ UHGXFLQJ WKHLU PDUNHW YDOXHV DQGRU \LHOGV =HWWOHU t +DUWPDQ f *HQHUDO &KDUDFWHULVWLFV RI 3RW\YLULGDH 7KH 3RW\YLULGDH LV WKH ODUJHVW RI SODQW YLUXV JURXSV DQG IDPLOLHV FXUUHQWO\ UHFRJQL]HG E\ WKH ,QWHUQDWLRQDO &RPPLWWHH IRU WKH 7D[RQRP\ RI 9LUXVHV 7KUHH JHQHUD 3RW\YLUXV 5\PRYLUXV DQG %\PRYLUXV DUH UHFRJQL]HG 0XUSK\ HW DO f 7KHUH DUH WZR ZKLWHIO\ WUDQVPLWWHG YLUXVHV DQG WZR DSKLG WUDQVPLWWHG YLUXVHV DUH XQDVVLJQHG 7KH IDPLO\ FRQWDLQV DW OHDVW GHILQLWLYH DQG SRVVLEOH VSHFLHV b RI DOO NQRZQ SODQW YLUXVHVf PDQ\ RI ZKLFK FDXVH VLJQLILFDQW ORVVHV LQ DJURQRPLF SDVWXUH KRUWLFXOWXUDO DQG RUQDPHQWDO FURSV 6KXNOD HW DO f $ IHDWXUH VKDUHG E\ DOO SRW\YLUXVHV LV WKDW WKH\ LQGXFH FKDUDFWHULVWLF F\OLQGULFDO LQFOXVLRQ ERGLHV LQ WKH F\WRSODVP RI WKH LQIHFWHG FHOOV (GZDUGVRQ f 7KHVH F\OLQGULFDO LQFOXVLRQ &Of ERGLHV DUH IRUPHG E\ D YLUXVHQFRGHG SURWHLQ 'RXJKHUW\ t +LHEHUW f ([FHSW IRU VSHFLHV RI WKH JHQXV %\PRYLUXV ZKLFK KDYH ELSDUWLWH SDUWLFOHV DERXW

PAGE 14

QP DQG QP ORQJ 3RW\YLUXV DQG 5\PRYLUXV YLULRQV DUH IOH[XRXV ILODPHQWV RI WR QP LQ OHQJWK 0XUSK\ HW DO f 7KH SDUWLFOHV RI PRQRSDUWLWH SRW\YLUXVHV FRQWDLQ RQH SRVLWLYHVHQVH VLQJOHVWUDQGHG JHQRPLF 51$ PROHFXOH RI NE ZKLFK LV HQFDSVLGDWHG E\ D VLQJOH W\SH RI FRDW SURWHLQ +ROOLQJV t %UXQW f 7KH JHQRPLF 51$ KDV D SURWHLQ 93Jf FRYDOHQWO\ DWWDFKHG WR LWV n HQG +DUL 6LDZ HW DO 5LHFKPDQQ HW DO 0XUSK\ HW DO f DQG D SRO\$f WUDFW DW LWV n HQG +DUL f 0RVW SRW\YLUXVHV 3RW\YLUXVf DUH WUDQVPLWWHG E\ DSKLGV LQ D QRQSHUVLVWHQW PDQQHU ZKLOH 5\PRYLUXV %\PRYLUXV DUH WUDQVPLWWHG E\ PLWHV DQG IXQJL UHVSHFWLYHO\ 6RPH SRW\YLUXVHV VXFK DV 7(9 DUH NQRZQ WR IRUP QXFOHDU LQFOXVLRQ ERGLHV FRQVLVWLQJ RI WZR QXFOHDU SURWHLQV 1,D t 1LEf DJJUHJDWHG LQ HTXLPRODU DPRXQWV LQ QXFOHL RI LQIHFWHG FHOOV $ IHZ SRW\YLUXVHV VXFK DV 3569: 3H0R9 SRWDWR YLUXV $ 39$f DQG FHOHU\ PRVDLF LQGXFH WKH IRUPDWLRQ RI DPRUSKRXV LQFOXVLRQV LQ WKH F\WRSODVP DQGRU LQ WKH QXFOHRSODVP RI LQIHFWHG FHOOV &KULVWLH t (GZDUGVRQ (GZDUGVRQ t &KULVWLH f *HQRPH 2UJDQL]DWLRQ 7KH FRPSOHWH QXFOHRWLGH VHTXHQFH RI WKH IROORZLQJ WKLUWHHQ SRW\YLUXVHV KDV EHHQ GRFXPHQWHG 7(9 $OOLVRQ HW DO f 7909 'RPLHU HW DO f 339 0DLVV HW DO /DLQ HW DO f 3HS0R9 9DQFH HW DO f WKH QHFURWLF DQG +XQJDULDQ VWUDLQV RI 39< 5REDJOLD HW DO 7KROH HW DO f 36E09 -RKDQVHQ HW DO f 35693
PAGE 15

*XQDVLQJKH HW DO f DQG =<09 :LVOHU HW DO f 7KH VHTXHQFH DQDO\VLV RI SRW\YLUXVHV DQG LQ YLWUR WUDQVODWLRQ VWXGLHV RI SRW\YLUXV JHQRPLF 51$V KDYH UHYHDOHG D VLQJOH RSHQ UHDGLQJ IUDPH 25)f HQFRGLQJ D ODUJH SRO\SURWHLQ UDQJLQJ IURP N'D WR N'D GHSHQGLQJ RQ WKH YLUXV 7KLV SRO\SURWHLQ LV SURWHRO\WLFDOO\ SURFHVVHG LQWR DW OHDVW HLJKW PDWXUH YLUDO SURWHLQV E\ WKUHH YLUXVHQFRGHG SURWHDVHV +HOOPDQQ HW DO 'RXJKHUW\ t &DUULQJWRQ f 7KH GLIIHUHQW JHQH SURGXFWV LQWR ZKLFK WKH SRW\YLUDO SRO\SURWHLQ LV FOHDYHG DUH SURFHHGLQJ IURP WKH 1 WR WKH &WHUPLQXV RI WKH SRO\SURWHLQ 3, SURWHDVH WKH KHOSHU FRPSRQHQWSURWHDVH SURWHLQ +&3URf 3 D SXWDWLYH SHSWLGH .f WKH &O SURWHLQ ZLWK KHOLFDVH DFWLYLW\ D VHFRQG SHSWLGH .f WKH QXFOHDU LQFOXVLRQ fDf SURWHLQ 1,Df ZKLFK IXQFWLRQV DV 93J DQG SURWHDVH WKH QXFOHDU LQFOXVLRQ fEf SURWHLQ 1LEf WKH SUHVXPSWLYH 51$ SRO\PHUDVH DQG WKH FDSVLG SURWHLQ &3f 7KH OHQJWK RI SRW\YLUDO n QRQFRGLQJ UHJLRQV UDQJHV IURP QXFOHRWLGHV QWf IRU 3569: WR QW IRU 7909 7KHVH UHJLRQV DUH HVSHFLDOO\ ULFK LQ DGHQLQH UHVLGXHV ZLWK UHODWLYHO\ IHZ JXDQLQH UHVLGXHV ,W KDV EHHQ VKRZQ WKDW WKH 7(9 n QRQFRGLQJ UHJLRQ FDQ IXQFWLRQ DV DQ HQKDQFHU RI WUDQVODWLRQ &DUULQJWRQ HW DO f $OLJQPHQW RI WKH QRQFRGLQJ UHJLRQV RI 339 39< 7(9 DQG 7909 UHYHDOHG WZR KLJKO\ FRQVHUYHG UHJLRQV QDPHO\ ER[ fDf $&$$&$8f DQG ER[ fEf 8&$$*&$f /DLQ HW DO 7XUSQ f 7KHVH FRQVHUYHG VHTXHQFHV DQG WKHLU VHFRQGDU\ VWUXFWXUH PD\ EH LPSRUWDQW IRU SURFHVVHV VXFK DV HQFDSVLGDWLRQ WUDQVODWLRQ RU UHSOLFDWLRQ /DLQ HW DO $WUH\D HW DO 5LHFKPDQQ HW DO f 7KH n QRQFRGLQJ UHJLRQV RI GLIIHUHQW SRW\YLUXVHV KDYH EHHQ GHVFULEHG DV YDULDEOH LQ VL]H VHTXHQFH DQG SUHGLFWHG VHFRQGDU\ VWUXFWXUH /DLQ HW DO 7XUSQ 4XHPDGD

PAGE 16

HW DO D Ef 7KH\ FRQWDLQ $8ULFK VHJPHQWV DQG HDFK VHTXHQFH FDQ EH SUHGLFWHG WR IROG LQWR VWDEOH VHFRQGDU\ VWUXFWXUHV 7XUSQ f 6HYHUDO VKRUW VHJPHQWV GLVSOD\LQJ VHTXHQFH KRPRORJ\ DPRQJ GLIIHUHQW SRW\YLUXVHV KDYH EHHQ LGHQWLILHG /DLQ 8\HGD HW DO f ,Q FRQWUDVW ZLWK WKH KLJK VHTXHQFH GLYHUVLW\ IRXQG DPRQJ WKH n QRQFRGLQJ UHJLRQV RI GLIIHUHQW SRW\YLUXVHV WKH f QRQFRGLQJ UHJLRQV DUH PRUH FRQVHUYHG DPRQJ GLIIHUHQW VWUDLQV RI WKH VDPH SRW\YLUXV :HW]HO f 7KH SRO\$f WDLOV KDYH EHHQ GHWHUPLQHG WR EH YHU\ YDULDEOH LQ OHQJWK $OOLVRQ HW DO /DLQ HW DO f 7KH PRVW LPSRUWDQW IXQFWLRQV RI WKH n QRQFRGLQJ UHJLRQ LQYROYH WKH LQWHUDFWLRQ ZLWK YLUXV UHSOLFDVH GXULQJ WKH LQLWLDWLRQ RI PLQXVVWUDQG 51$ V\QWKHVLV DQG WKH SUHYHQWLRQ RI H[RQXFOHRO\WLF GHJUDGDWLRQ %U\DQ HW DO 'ROMD t &DUULQJWRQ f ,W KDV EHHQ VKRZQ WKDW WKH n QRQFRGLQJ UHJLRQ RI 7909 FDQ KDYH D GLUHFW HIIHFW RQ WKH LQGXFWLRQ RI GLVHDVH V\PSWRPV 5RGULJXH]&HUH]R HW DO f 5HSOLFDWLRQ 7KH VXEFHOOXODU VLWHVf RI SRW\YLUDO 51$ V\QWKHVLV KDV QRW EHHQ LGHQWLILHG ZLWK FHUWDLQW\ EXW LV EHOLHYHG WR EH LQ WKH F\WRSODVP DV IRXQG ZLWK RWKHU SRVLWLYH VWUDQGHG 51$ YLUXVHV 9HUFKRW HW DO f $ SRO\PHUDVH DFWLYLW\ LV DVVRFLDWHG ZLWK DQ HQ]\PH FRPSOH[ LVRODWHG IURP SODQWV LQIHFWHG ZLWK 339 0DUWLQ t *DUFLD f 6HYHUDO YLUDO SURWHLQV LQFOXGLQJ 1LE &O 93J1,D DQG WZR VPDOO SHSWLGHV DQG .f DUH EHOLHYHG WR EH LQYROYHG LQ WKH UHSOLFDWLRQ SURFHVV RI SRW\YLUXVHV 7KH ODUJH QXFOHDU LQFOXVLRQ SURWHLQ 1LE LV WKH PRVW FRQVHUYHG JHQH SURGXFW RI SRW\YLUXVHV DQG LV EHOLHYHG WR EH WKH 51$GHSHQGHQW 51$ SRO\PHUDVH 5G5Sf EDVHG RQ WKH SUHVHQFH RI FRQVHUYHG VHTXHQFH PRWLI *''f

PAGE 17

FKDUDFWHULVWLF RI WKHVH HQ]\PHV 'RPLHU HW DO /DLQ HW DO 5REDJOLD HW DO 3RFK HW DO 5LHFKPDQQ HW DO f 7KH &O SURWHLQ RI 339 KDV EHHQ VKRZQ WR KDYH QXFOHLF DFLGVWLPXODWHG $73DVH DFWLYLW\ DQG WR EH DEOH WR XQZLQG 51$ GXSOH[HV /DLQ HW DO f 7KH 339 &O ZDV DEOH WR XQZLQG RQO\ GV51$ VXEVWUDWHV ZLWK WKH n VLQJOHVWUDQG RYHUKDQJV LQGLFDWLQJ WKDW WKH KHOLFDVH DFWLYLW\ IXQFWLRQV IURP WKH n WR WKH n GLUHFWLRQ /DLQ HW DO f 7KH &O SURWHLQV RI SRW\YLUXVHV ZHUH IRXQG WR FRQWDLQ D FRQVHUYHG QXFOHRWLGH ELQGLQJ FRQVHQVXV VHTXHQFH PRWLI *;;*;*.6f DW WKH &WHUPLQDO UHJLRQ DQG ZHUH LPSOLFDWHG DV PHPEUDQHELQGLQJ FRPSRQHQWV RI WKH UHSOLFDWLRQ FRPSOH[ 'RPLHU HW DO f ,Q DGGLWLRQ WR WKH UROH RI 1,D LQ WKH SURWHRO\WLF SURFHVVLQJ RI WKH SRW\YLUDO SRO\SURWHLQ IRU ZKLFK RQO\ LWV FDUER[\O KDOI LV UHTXLUHG LWV 1WHUPLQDO SDUW KDV EHHQ VKRZQ WR EH WKH 93J 7KH 93J RI 7909 6LDZ HW DO f DQG 339 5LHFKPDQQ HW DO f KDYH EHHQ LGHQWLILHG DV SURWHLQV RI N'D DQG N'D UHVSHFWLYHO\ 7KH 7909 93J FLVWURQ KDV EHHQ PDSSHG VKRZLQJ WKDW WKH 93J LV WKH 1WHUPLQDO SRUWLRQ RI WKH 1,D SURWHLQ 6KDKDEXGGLQ HW DO f /LNHZLVH WKH 7(9 93J KDV EHHQ IRXQG WR EH HLWKHU WKH N'D 1,D RU LWV 1WHUPLQDO N'D KDOI 0XUSK\ HW DO f 7KH 93J LV DWWDFKHG WR WKH n HQG RI WKH 51$ E\ PHDQV RI D SKRVSKDWH HVWHU OLQNDJH WR < UHVLGXHV RI WKH SURWHLQ 0XUSK\ HW DO f %\ DQDORJ\ ZLWK RWKHU YLUDO V\VWHPV 93J LV EHOLHYHG WR VHUYH DV WKH SULPHU IRU YLUDO 51$ V\QWKHVLV 6KDKDEXGGLQ HW DO f 7KH 1,D SURWHDVH DOVR PD\ EH LQYROYHG LQ UHJXODWLRQ RI SRW\YLUXV UHSOLFDWLRQ 2QH OHYHO RI FRQWURO KDV EHHQ SURSRVHG WR EH WKH UHJXODWLRQ RI WKH H[SUHVVLRQ RI JHQH SURGXFWV E\

PAGE 18

VHTXHQWLDO SURWHRO\WLF HYHQWV 'RXJKHUW\ HW DO D Ef $QRWKHU SURSRVHG OHYHO RI FRQWURO LV WKDW WKH VXEFHOOXODU ORFDOL]DWLRQ RI WKH 1,D1,E PD\ SOD\ D UHJXODWRU\ UROH &DUULQJWRQ HW DO f 3URWHRO\WLF 3URFHVVLQJ RI 3RO\SURWHLQ 7KUHH YLUXVHQFRGHG SURWHDVHV 1,D &DUULQJWRQ t 'RXJKHUW\ D +HOOPDQQ HW DO &KDQJ HW DO *DUFLD HW DO D *KDEULDO HW DO f +&3UR &DUULQJWRQ HW DO Df DQG 3, &DUULQJWRQ HW DO 9HUFKRW HW DO f SURFHVV WKH ODUJH YLUDO SUHFXUVRU SRO\SURWHLQ FR DQG SRVWWUDQVFULSWLRQDOO\ 7KH 1,D LV UHVSRQVLEOH IRU FOHDYDJHV LQ WKH &WHUPLQDO WZRWKLUGV RI WKH SRO\SURWHLQ 'RXJKHUW\ HW DO f ZKHUHDV +&3UR DQG 3, DXWRFDWDO\WLFDOO\ FOHDYH DW WKHLU UHVSHFWLYH &WHUPLQL &DUULQJWRQ HW DO D E 9HUFKRW HW DO f 7KH VPDOO QXFOHDU LQFOXVLRQ SURWHLQ 1,D LV WKH PDMRU SURWHDVH RI SRW\YLUXVHV DQG LW LV FDSDEOH RI FOHDYLQJ LQ D FLV DQG WUDQVPDQQHU DW OHDVW VL[ DQG SRVVLEO\ VHYHQ VLWHV ZLWKLQ WKH SRO\SURWHLQ ,W KDV D WZRGRPDLQ VWUXFWXUH ZKHUH WKH 1WHUPLQDO GRPDLQ LV WKH JHQRPHOLQNHG 93J 6KDKDEXGGLQ HW DO 0XUSK\ HW DO f DQG WKH &WHUPLQDO KDOI LV WKH WUXH SURWHLQDVH 'RXJKHUW\ t &DUULQJWRQ f 7KLV SURWHRO\WLF GRPDLQ LQ 7(9 DQG 7909 ZDV OLNH WKDW UHSRUWHG IRU WKH SROLRYLUXV & DQG FRZSHD PRVDLF YLUXV N'D SURWHDVHV 'RPLHU HW DO f 7KH 1,D SURWHDVH LV UHODWHG WR WKH WU\SVLQOLNH IDPLO\ RI FHOOXODU VHULQH SURWHDVHV H[FHSW WKDW D &\V LV VXEVWLWXWHG IRU WKH DFWLYH VLWH QXFOHRSKLOH %D]DQ DQG )OHWWHULFN *RUEDOHQ\D HW DO f 0XWDJHQHVLV RI VHOHFWHG 7(9 N'D 1D 25) FRGRQV VXSSRUWV WKH

PAGE 19

K\SRWKHVLV WKDW +LV $VS DQG &\V PDNH XS WKH DFWLYHVLWH WULDG 'RXJKHUW\ HW DO Ef 7KH FRQVHQVXV VHTXHQFH *;&* KDV EHHQ IRXQG LQ DOO SRW\YLUXVHV H[DPLQHG WR GDWH 6KXNOD HW DO f 7KH 1,D DXWRFDWDO\WLFDOO\ UHOHDVHV IURP WKH SRO\SURWHLQ E\ FOHDYLQJ WKH &,1,D DQG 1,D1,E MXQFWLRQV DQG FDWDO\]HV WKH SURGXFWLRQ RI &O 1LE DQG &3 E\ FOHDYLQJ WKH 3&, DQG 1,E&3 MXQFWLRQV &DUULQJWRQ t 'RXJKHUW\ D E &DUULQJWRQ HW DO +HLOPDQ HW DO *DUFLD HW DO D E f $GGLWLRQDO FOHDYDJHV WR UHOHDVH 93J DQG WKH DQG SURGXFWV DOVR RFFXU *DUFLD HW DO 5HVWUHSR+DUWZLJ t &DUULQJWRQ f 7KH 1,D SURWHDVH UHTXLUHV WKRVH FRQVHUYHG FOHDYDJH VLWHV GHILQHG DV KHSWDSHSWLGH VHTXHQFHV WKDW DUH HIILFLHQWO\ UHFRJQL]HG RQO\ E\ WKHLU RZQ UHVSHFWLYH SURWHDVHV &DUULQJWRQ t 'RXJKHUW\ D &DUULQJWRQ HW DO 'RXJKHUW\ HW DO D *DUFLD HW DO D E *DUFLD t /DLQ 3DUNV t 'RXJKHUW\ f &OHDYDJHV DUH IUHTXHQWO\ DW D 4* RU 6f VLWH $ JURXSVSHFLILF PRWLI 9;;4$ 6 RU 9f FRPPRQ WR PRVW SRW\YLUXVHV KDV EHHQ IRXQG 6KXNOD HW DO f 7KH UHTXLUHPHQW IRU WKH FRQVHUYHG FOHDYDJH VLWHV LV XQLTXH WR WKH 1,D SURWHDVHV 7KH KHOSHU FRPSRQHQW SURWHDVH +&3URf IXQFWLRQV DV DQ DXWRFDWDO\WLF SURWHDVH 7KH +&3UR N'D SURWHLQ RI 7(9 LV D PXOWLIXQFWLRQDO SURWHLQ DQG WKH SURWHRO\WLFDOO\ DFWLYH GRPDLQ KDV EHHQ ORFDOL]HG DW LWV &WHUPLQDO KDOI &DUULQJWRQ HW DO D Ef 7KH SUHVHQFH RI WZR HVVHQWLDO UHVLGXHV VSHFLILFDOO\ &\V DQG +LV LQ WKLV SURWHDVH VXSSRUWV WKH K\SRWKHVLV WKDW +&3UR PRVW FORVHO\ UHVHPEOHV PHPEHUV RI WKH F\VWHLQHW\SH IDPLO\ RI SURWHDVHV 2K t &DUULQJWRQ f &OHDYDJH LV DW D VSHFLILF ** GLSHSWLGH DQG DSSHDUV WR EH

PAGE 20

WKH RQO\ FOHDYDJH HYHQW PHGLDWHG E\ WKH +&3UR SURWHLQ &DUULQJWRQ HW DO E 2K t &DUULQJWRQ f 7KH +&3UR RI SRW\YLUXVHV DFFXPXODWHV WR KLJK OHYHOV DQG RIWHQ FRPSOH[HV LQWR DPRUSKRXV LQFOXVLRQ ERGLHV GH 0HMLD HW DO Ef %\ H[SUHVVLQJ 7(9 SRO\SURWHLQ LQ WUDQVJHQLF SODQWV LW ZDV VKRZQ WKDW D QRYHO SURWHRO\WLF DFWLYLW\ FDXVHG E\ QHLWKHU +& QRU 1,D SURWHDVHV LV UHTXLUHG IRU SURFHVVLQJ DW WKH & WHUPLQDO UHJLRQ RI 3, SURWHLQ &DUULQJWRQ HW DO f 9HUFKRW HW DO f KDYH GHPRQVWUDWHG WKDW 3, LV WKH SURWHDVH UHVSRQVLEOH IRU FOHDYLQJ WKH 3O+& MXQFWLRQ DW WKH 46 RU *f 8VLQJ WKH ZKHDW JHUP LQ YLWUR WUDQVODWLRQ V\VWHP DQG D VHULHV RI WUXQFDWHG RU PXWDJHQL]HG F'1$V IURP 7(9 WKH\ VKRZHG WKDW PRVW RI WKH +& SURWHLQ DQG WKH ILUVW DPLQR DFLGV RI 3, ZHUH QRW UHTXLUHG IRU SURWHRO\VLV RI WKH 3O+& MXQFWLRQ DQG WKDW WKH 1 WHUPLQDO ERXQGDU\ RI WKH SURWHDVH GRPDLQ OLHV VRPHZKHUH EHWZHHQ DQG 7KH 3, SURWHDVH LV D VHULQHOLNH SURWHDVH EDVHG RQ WKH SUHVHQFH RI WKH FRQVHUYHG DFWLYHVLWH WULDG +LV $VS DQG 6HU IRU 7(9f DQG WKH FRQVHUYHG PRWLI *;6*f IRXQG LQ DOO DSKLG WUDQVPLWWHG SRW\YLUXVHV /DLQ 9HUFKRW f +RZHYHU DQRWKHU IDFWRU EHVLGHV 3, PLJKW EH UHTXLUHG VLQFH FOHDYDJH DW WKLV VLWH GRHV QRW RFFXU LQ DQ LQ YLWUR UDEELW UHWLFXORF\WH O\VDWH V\VWHP +LHEHUW HW DO E &DUULQJWRQ HW DO Df $OWHUQDWLYHO\ WKH DEVHQFH RI FOHDYDJH LQ WKH UHWLFXORF\WH O\VDWHEDVHG V\VWHP FRXOG EH GXH WR WKH SUHVHQFH RI D SURWHDVH LQKLELWRU 9HUFKRW HW DO f

PAGE 21

9LUXV 0RYHPHQW 1DWXUDO SODQWWRSODQW VSUHDG RI WKH PDMRULW\ RI SRW\YLUXVHV LV DFFRPSOLVKHG E\ DSKLGV DQG IRXU YLUDO SURWHLQV 3, +&3UR &O DQG &3 KDYH EHHQ VXJJHVWHG RU GHPRQVWUDWHG WR EH LQYROYHG LQ HLWKHU FHOOWRFHOO PRYHPHQW RU SODQWWRSODQW VSUHDG %DVHG RQ WKH VHTXHQFH VLPLODULW\ RI WKH 3, SURWHLQ RI 7909 WR WKDW RI N'D PRYHPHQW SURWHLQ RI WREDFFR PRVDLF YLUXV LW KDV EHHQ VXJJHVWHG WKDW WKH 3, SURWHLQ PD\ EH LQYROYHG LQ FHOOWRFHOO PRYHPHQW 'RPLHU HW DO /DLQ HW DO D 5REDJOLD HW DO f +RZHYHU VHTXHQFH LGHQWLW\ PD\ EH D SRRU LQGLFDWRU RI IXQFWLRQ VLQFH LW LV NQRZQ WKDW FHOOWRFHOO PRYHPHQW SURWHLQV RI SODQW YLUXVHV H[KLELW YHU\ OLWWOH VLPLODULW\ HYHQ DPRQJ PHPEHUV RI WKH VDPH JURXS /DLQ HW DO D +XOO f 7KH 3, SURWHLQ RI RWKHU SRW\YLUXVHV 7(9 339 39
PAGE 22

VXJJHVWHG WKDW HLWKHU WKH LQFOXVLRQERXQG IRUP RI WKLV SURWHLQ KDV EHHQ LQDFWLYDWHG RU DOWHUQDWLYHO\ WKH +& DFWLYLW\ LV DVVRFLDWHG ZLWK D PRGLILHG IRUP RI WKH LQFOXVLRQ SURWHLQ 7KRPEXU\ t 3LURQH 7KRPEXU\ HW DO 'RXJKHUW\ t &DUULQJWRQ f 7KH VL]H RI WKH ELRORJLFDOO\ DFWLYH +& IRUP LV EHOLHYHG WR EH D GLPHU ZLWK 0:V RI N'D IRU 39< +HOOPDQQ HW DO f DQG N'D IRU 7909 7KRPEXU\ HW DO f 7KH ORVV RI WUDQVPLVVLELOLW\ DVVRFLDWHG ZLWK +& GHILFLHQF\ KDV EHHQ FRUUHODWHG ZLWK WZR PXWDWLRQV LQ WKH +& FRGLQJ VHTXHQFH RI SRWDWR YLPV & 7KRPEXU\ HW DO $WUH\D HW DO f DQG WKH 3$7 LVRODWH RI =<093$7 *UDQLHU HW DO f 7KH ORQJGLVWDQFH PRYHPHQW RI 7(9 KDV EHHQ DVVRFLDWHG ZLWK WKH FHQWUDO UHJLRQ RI WKH +&3UR E\ XVLQJ VLWHGLUHFWHG PXWDJHQHVLV RI LQIHFWLRXV F'1$ DQG FRPSOHPHQWDU\ E\ +&3UR VXSSOLHG LQ WUDP E\ D WUDQVJHQLF KRVW &URQLQ HW DO f 7KH &O SURWHLQ KDV DOVR EHHQ VXJJHVWHG WR EH LQYROYHG LQ FHOOWRFHOO PRYHPHQW RQ WKH EDVLV RI HOHFWURQ PLFURVFRSH REVHUYDWLRQV WKDW &,V DUH DVVRFLDWHG ZLWK SODVPRGHVPDWD DQG YLPV SDUWLFOHV /DZVRQ t +HDURQ 0XUDQW HW DO /DQJHQEHUJ /HVHPDQQ %DXQRFK HW DO f 7KH FRDW SURWHLQ LV WKH PRVW H[WHQVLYHO\ FKDUDFWHUL]HG SRW\YLUDO JHQH SURGXFW 7KH &3 QXFOHRWLGH VHTXHQFHV RI VWUDLQV RI GLVWLQFW PHPEHUV RI WKH 3RW\YLULGDH KDYH EHHQ UHVROYHG 6KXNOD HW DO 3DSSX HW DO 3XXUDQG HW DO +XVWHG HW DO &ROLQHW t /HSRLYUH f 7KH LQWHUHVW LQ &3 FRPHV PDLQO\ IURP LWV XVHIXOQHVV LQ WD[RQRPLF DQG HYROXWLRQ VWXGLHV LQ GLDJQRVLV DQG LQ WKH VWXG\ RI &3PHGLDWHG UHVLVWDQFH 6HTXHQFH FRPSDULVRQV DQG SDUWLFOH DVVHPEO\ SURSHUWLHV VXJJHVW WKH SUHVHQFH RI WKUHH GLIIHUHQW UHJLRQV LQ

PAGE 23

WKH FRDW SURWHLQ PROHFXOHV RI SRW\YLUXVHV Lf D VXUIDFHH[SRVHG 1WHUPLQXV YDU\LQJ LQ OHQJWK DQG VHTXHQFH LLf D KLJKO\ FRQVHUYHG FRUH RI DPLQR DFLGV DQG LLLf D VXUIDFHH[SRVHG &WHUPLQXV RI DPLQR DFLGV 6KXNOD DQG :DUG f 5HPRYDO RI WKH 1 DQG &WHUPLQL E\ WU\SVLQ GLJHVWLRQ OHDYHV D IXOO\ DVVHPEOHG YLUXV SDUWLFOH FRPSRVHG RI WKH FRDW SURWHLQ FRUH UHJLRQ ZKLFK FDQ QRW EH GLVWLQJXLVKHG E\ HOHFWURQ PLFURVFRS\ IURP XQWUHDWHG QDWLYH LQIHFWLYH SDUWLFOHV $SSDUHQWO\ WKH 1 DQG &WHUPLQL DUH QHLWKHU UHTXLUHG IRU SDUWLFOH DVVHPEO\ QRU IRU LQIHFWLYLW\ GXULQJ PHFKDQLFDO LQRFXODWLRQ 6KXNOD HW DO -DJDGLVK HW DO f 7KH &3 IXQFWLRQV WR SURWHFW WKH YLUDO 51$ WR IDFLOLWDWH LWV WUDQVPLVVLRQ E\ DSKLGV *DO 2Q HW DO /HFRT t 3XUFLIXOO f DQG WR IDFLOLWDWH PRYHPHQW RI WKH YLUXV ZLWKLQ SODQWV 'ROMD HW DO f 6HTXHQFH DQDO\VHV KDYH VKRZQ WKDW D FKDQJH LQ WKH DPLQR DFLG WULSOHW '$* ZKLFK LV FRQVHUYHG LQ DOO DSKLGWUDQVPLVVLEOH SRW\YLUXVHV +DUULVRQ t 5RELQVRQ $WUH\D HW DO f DQG RWKHU DPLQR DFLGV LQ WKH DPLQRWHUPLQXV 1WHUPLQXVf RI WKH &3 DOWHUV DSKLG WUDQVPLVVLELOLW\ $WUH\D HW DO +DUULVRQ t 5RELQVRQ *DO 2Q HW DO 6DORPRQ t 5DFFDK f $ QRQDSKLG WUDQVPLVVLEOH LVRODWH RI =<09 ZKLFK KDV D GHIHFWLYH &3 EXW LV FDSDEOH RI SURGXFLQJ DQ DFWLYH IRUP RI +& KDV EHHQ GHVFULEHG $QWLJQXV HW DO *DO2Q HW DO f %\ XVLQJ PXWDWLRQDO DQDO\VLV $WUH\D HW DO f GHPRQVWUDWHG WKDW D EDVLF UHVLGXH RU 1f LQ WKH ILUVW SRVLWLRQ WKH QRQSRODU UHVLGXH $ LQ WKH VHFRQG SRVLWLRQ DQG WKH VPDOO QRQSRODU UHVLGXH LQ WKH WKLUG SRVLWLRQ DUH UHTXLUHG IRU DSKLG WUDQVPLVVLELOLW\ 7KH 7(9 &3 KDV EHHQ UHFHQWO\ VKRZQ WR EH QHFHVVDU\ IRU FHOOWRFHOO PRYHPHQW DQG ORQJGLVWDQFH WUDQVSRUW RI WKH YLUXV LQ SODQWV 'ROMD HW DO f 7KH PXWDWLRQ DW WKH

PAGE 24

KLJKO\ FRQVHUYHG 6 DPLQR DFLG UHVLGXH LQ WKH FRUH GRPDLQ DQG GHOHWLRQ DW WKH YDULDEOH & WHUPLQDO UHJLRQ DEROLVKHG RU UHGXFHG YLUXV PRYHPHQW ZLWKLQ WKH SODQWV ,Q DGGLWLRQ WR WKHLU QDWXUDO IXQFWLRQV WKH &3 JHQHV RI VRPH SRW\YLUXVHV LQFOXGLQJ 6E09 6WDUN t %HDFK\ f 339 5HJHU HW DO 6FRU]D HW DOf 39< .DQLHZVNL HW DO f 35693 /LQJ HW DO )LWFK HW DO f 7(9 /LQGER t 'RXJKHUW\ f :09 1DPED HW DO f =<09 1DPED HW DO )DQJ t *UXPHW f 7909 =DFFRPHU HW DO f DQG OHWWXFH PRVDLF YLUXV 'LDQDW HW DO f KDYH EHHQ XVHG H[SHULPHQWDOO\ WR REWDLQ JHQHWLFDOO\ HQJLQHHUHG SODQWV ZLWK &3PHGLDWHG UHVLVWDQFH 0DQ\ RI WKHVH WUDQVJHQLF SODQWV VKRZHG FHUWDLQ GHJUHHV RI UHVLVWDQFH WR YLUDO LQIHFWLRQ 'DVKHHQ 0RVDLF 9LUXV 'DVKHHQ PRVDLF YLUXV 'V09f LV D VSHFLHV RI WKH 3RW\YLULGDH ZKLFK FDXVHV VHULRXV GLVHDVHV RI FXOWLYDWHG DURLG SODQWV ZRUOGZLGH =HWWOHU HW DO 6KLPR\DPD HW DO D Ef 9LUXVHV RWKHU WKDQ 'V09 LQFOXGH NRQMDN PRVDLF SRW\YLUXV RI $PRUSKRSKDOOXV 6KLPR\DPD HW DO D Ef WREDFFR QHFURVLV QHFURYLUXV RI 'LHIIHQEDFKLD 3DOXGDQ t %HJWUXS f FXFXPEHU PRVDLF FXFXPRYLUXV RI $UXP /RYLVROR t &RQWL f $PRUSKRSKDOOXV 6KLPR\DPD HW DO f DQG &RORFDVLD .XPXUR t $VX\DPD f WRPDWR VSRWWHG ZLOW WRVSRYLUXV RI =DQWHGHVFKLD 7RPSNLQV t 6HYHULQ f DQG ERERQH UKDEGRYLUXV RI &RORFDVLD -DPHV HW DO f 'V09 DQG NRQMDN PRVDLF YLUXV DUH FRQVLGHUHG GLIIHUHQW RQ WKH EDVLV RI ELRORJLFDO DQG VHURORJLFDO SURSHUWLHV +RZHYHU QRQH RI WKHVH YLUXVHV LQIHFW DV PDQ\ DURLGV QRU LV DV ZLGH VSUHDG DV 'V09

PAGE 25

7KH $UDFHDH RU DURLG IDPLO\ FRPSULVHV DERXW JHQHUD DQG VSHFLHV RI PRQRFRW\OHGRQRXV KHUEV DQG YLQHV 0RVW DURLG SODQWV RFFXU LQ WURSLFDO $VLD DQG WKH 1HZ :RUOG WURSLFV *UD\XP f 0DQ\ RI WKHP VXFK DV $JODRQHPD $ULVDHPD &DODGLXP 'LHIIHQEDFKLD (SLSUHPQXP 0RQVWHUD 3KLORGHQGURQ 3LQHOOLD 6SDWKLSK\OOXP DQG 6\QJRQLXP DUH LPSRUWDQW RUQDPHQWDOV ZKLFK DFFRXQW IRU QHDUO\ b RI 86 SURGXFWLRQ RI IROLDJH SODQWV 86 %XUHDX RI &HQVXV f &HUWDLQ VSHFLHV RI $QWKXULXP 5LFKDUGLD DQG =DQWHGHVFKLD DUH YDOXDEOH FXW IORZHU FURSV DQG &U\SWRFRU\QH VSHFLHV DUH FRPPHUFLDOO\ JURZQ DTXDULXP SODQWV 7ZR JHQHUD RI DURLGV &RORFDVLD FRPPRQO\ UHIHUUHG DV GDVKHHQ RU WDUR DQG ;DQWKRVRPD RU FRFR\DP DUH LPSRUWDQW WURSLFDO IRRG FURSV 'V09 ZDV ILUVW UHSRUWHG LQ LQ )ORULGD E\ =HWWOHU HW DO f DQG KDV VLQFH EHHQ IRXQG HOVHZKHUH LQFOXGLQJ +DZDLL %XGGHQKDJHQ HW DO +DUWPDQ t =HWWOHU .RVLWUDWDQD HW DO f 3XHUWR 5LFR $OFRQHUR t =HWWOHU f 7ULQLGDG .HQWHQ t :RRGV f ,QGLD +DUWPDQ f 9HQH]XHOD 'HEURW t 2UGRVJRLWWL f -DSDQ 7RR\DPD f (J\SW $ER1LO t =HWWOHU f 1HWKHUODQGV +DNNDDUW t :DWHUUHXV f WKH 6RORPRQ ,VODQGV *ROOLIHU HW DO f %HOJLXP 6DP\Q t :DOYDHUW f 3DSXD 1HZ *XLQHD 6KDZ HW DO f *UHDW %ULWDLQ +LOO t :ULJKW f WKH &DPHURRQV *LUDUG HW DO f .LULEDWL 6KDQPXJDQDWKDQ f )UHQFK 3RO\QHVLD -DFNVRQ f 1LJHULD 9ROLQ HW DO f ,WDO\ 5DQD HW DO f 6RXWK $IULFD 9DQ GHU 0HHU f &RVWD 5LFD 5DPLUH] f $XVWUDOLD *UHEHU t 6KDZ f 3 5 &KLQD =HWWOHU HW DO f 7DLZDQ .R HW DO f DQG &XED 4XLQWHUR f $OWKRXJK 'V09 KDV EHHQ UHSRUWHG WR H[SHULPHQWDOO\ LQIHFW QRQDURLGV VXFK DV &KHQRSRGLXP DPDU DQWLFRORU & TXLQRD & DPEURVLRLGHV 1LFRWLDQD EHQWKDPLDQD DQG 7HWUDJRQLD H[SDQVD

PAGE 26

*ROOLIHU t %URZQ 5DQD HW DO .RVLWUDWDQD 6KLPR\DPD HW DO Df LWV QDWXUDO KRVW UDQJH LV UHVWULFWHG WR DURLG SODQWV DQG LW KDV EHHQ UHSRUWHG WR LQIHFW VSHFLHV RI JHQHUD $JODRQHPD $ORFDVLD $PRUSKRSKDOOXV $QWKXULXP $ULVDHPD &DODGLXP &RORFDVLD &U\SWRFRU\QH &\UWRVSHUPD 'LHIIHQEDFKLD 0RQVWHUD 3KLORGHQGURQ 3LQHOOLD 5LFKDUGLD 6FLQGDSVXV 6SDWKLSK\OOXP 6WHQRVSHUPDWLRQ 6\QJRQLXP ;DQWKRVRPD DQG =DQWHGHVFKLD =HWWOHU HW DO 6DP\Q t :HOYDHUW &KHQ SHUVRQDO FRPPXQLFDWLRQf $V QRWHG IRU RWKHU 3RW\YLULGDH 'V09 KDV IOH[XRXV ILODPHQWRXV SDUWLFOHV DERXW QP ORQJ =HWWOHU HW DO 6DP\Q t :HOYDHUW +LOO t :ULJKW *LUDUG HW DO .RVLWUDWDQD HW DO 9DQ GHU 0HHU *UHEHU t 6KDZ 4XLQWHUR f ,W LQGXFHV F\OLQGULFDO LQFOXVLRQV LQ LQIHFWHG FHOOV =HWWOHU HW DO *LUDUG HW DO 6KDQPXJDQDWKDQ 3DOXGDQ t %HJWUXS *UHEHU t 6KDZ .RVLWUDWDQD .R HW DO /LDQJ HW DO f DQG OLNH RWKHU PHPEHUV RI WKLV JHQXV 'V09 LV VDS WUDQVPLVVLEOH 'V09 DOVR LV WUDQVPLWWHG LQ D QRQSHUVLVWHQW PDQQHU E\ DSKLGV QDPHO\ 0\]XV SHUVLFDH $SKLV FUDFFLYRUD 0RUDOHV t =HWWOHU 9DQ GHU 0HHU f DQG $SKLV JRVV\SLL *ROOLIHU HW DO f EXW DSSDUHQWO\ QRW E\ HLWKHU 3HQWDORQLD QLJURQHUYRVD 0RUDOHV t =HWWOHU f RU 5KRSDORVLSKXPSDGL *ROOLIHU HW DO f 7KH JHQRPH RI 'V09 LV D VLQJOHVWUDQGHG 51$ RI 0: [ .RVLWUDWDQD 6KLPR\DPD HW DO Ef 7KH IRXU QRQVWUXFWXUDO SURWHLQV WKDW KDYH EHHQ LGHQWLILHG WKXV IDU ZHUH +&3UR N'Df &O N'Df 1,D N'Df DQG 1LE N'Df SURWHLQV 1DJHO t +LHEHUW XQSXEOLVKHGf 7KH 'V09 &3 SURWHLQ LV VHURORJLFDOO\ UHODWHG WR WKRVH RI DUDXMLD PRVDLF %&09 7(9 DQG =<09 $ER (O1LO HW DO +LHEHUW t &KDUXGDWWDQ

PAGE 27

.RVLWUDWDQD f 7KH 'V09 &O SURWHLQ LV VHURORJLFDOO\ UHODWHG WR WKDW RI DUDXMLD PRVDLF YLUXV +LHEHUW t &KDUXGDWWDQ f DQG WKH 'V09 LQ YLWUR V\QWKHVL]HG SURWHLQ LV UHODWHG WR WKH 7909 +&3UR SURWHLQ +LHEHUW HW DO f 7KH nWHUPLQDO UHJLRQ DQG WKH &3 JHQH RI WZR &RORFDVLD LVRODWHV RI 'V09 IURP )ORULGD KDYH EHHQ FORQHG DQG VHTXHQFHG 3DSSX HW DO D Ef 7KH SUHGLFWHG &3 RI LVRODWH 'V09/$ FRQWDLQV DPLQR DFLGV DQG KDV DQ HVWLPDWHG 0: RI N'D DQG WKH &3 RI LVRODWH 'V097(1 FRQWDLQV DPLQR DFLGV DQG KDV D 0: RI N'D 7KH &3 VHTXHQFH FRPSDULVRQV DQG SK\ORJHQHWLF UHFRQVWUXFWLRQV LQGLFDWHG WKDW WKH 'V09 LV D GLVWLQFW SRW\YLUXV ZLWKLQ WKH SDVVLRQIUXLW ZRRGLQHVV YLUXV VXEJURXS FOXVWHU 6\PSWRPV FDXVHG E\ 'V09 LQ QDWXUH PD\ GLIIHU FRQVLGHUDEO\ DFFRUGLQJ WR WKH DURLG KRVW LQIHFWHG DQG WKH VHDVRQ LQ ZKLFK WKH KRVW LV JURZQ ,Q VRPH DURLGV VXFK DV &RORFDVLD 5LFKDUGLD ;DQWKRVRPD =DQWHGHVFKLD DQG FHUWDLQ 'LHIIHQEDFKLD FXOWLYDUH 'V09 FDXVHV OHDI PRVDLF OHDI PRWWOH FKORURWLF VWUHDNLQJ DORQJ YHLQV RQ OHDYHV DQG OHDI GLVWRUWLRQ 7KH LQIORUHVFHQFH RI =DQWHGHVFKLD PD\ VKRZ FRORU EUHDN ZLWK EOLVWHUV DQG PDOIRUPDWLRQ =HWWOHU HW DO $OFRQHUR t =HWWOHU +DNNDDUW t :DWHUUHXV +LOO t :ULJKW 3DOXGDQ t %HJWUXS 9DQ GHU 0HHU *UHEHU t 6KDZ f ,Q RWKHU DURLGV VXFK DV $JODRQHPD DQG 6SDWKLSK\OOXP 'V09 V\PSWRPV DUH XVXDOO\ PXFK OHVV HYLGHQW $ FKDUDFWHULVWLF RI PDQ\ DURLGV LV WKDW 'V09 V\PSWRPV DUH LQWHUPLWWHQWO\ H[SUHVVHG RIWHQ PDNLQJ GHWHFWLRQ GLIILFXOW ,Q VRPH LQVWDQFHV VXFK DV ZLWK &RORFDVLD 'LHIIHQEDFKLD 5LFKDUGLD V\PSWRP H[SUHVVLRQ LV VHDVRQDO PRVW RIWHQ DSSHDULQJ RQ IROLDJH SURGXFHG GXULQJ IDOO DQGRU VSULQJ PRQWKV &KDVH t =HWWOHU *UHEHU t 6KDZ f 6RPH DURLG FXOWLYDUH

PAGE 28

PRUH UHDGLO\ H[SUHVV 'V09 V\PSWRPV WKDQ RWKHUV 7KH FDODGLXP FXOWLYDUV n&DQGLGXPf DQG :KLWH &KULVWPDVf IRU H[DPSOH DUH PXFK PRUH OLNHO\ WR H[KLELW V\PSWRPV WKURXJKRXW WKH JURZLQJ VHDVRQ WKDQ WKH FXOWLYDUV )ULHGD +HPSOHf DQG &DURO\Q :KRUWRQf =HWWOHU t +DUWPDQ f 7KH YLUXV FDQ FDXVH \LHOG ORVV RI XS WR b LQ &DODGLXP 'LHIIHQEDFKLD 3KLORGHQGURQ DQG =DQWHGHVFKLD =HWWOHU t +DUWPDQ f 'LDJQRVLV DQG GHWHFWLRQ RI 'V09 KDYH EHHQ EDVHG RQ WHFKQLTXHV RI ELRDVVD\ VHURORJ\ DQGRU OLJKW DQG HOHFWURQ PLFURVFRS\ 3KLORGHQGURQ VHOORXP VHHGOLQJV DUH YHU\ VXVFHSWLEOH WR LQIHFWLRQ RI 'V09 DQG KDYH EHHQ XVHG IUHTXHQWO\ LQ ELRDVVD\V =HWWOHU HW DO 3DOXGDQ t %HJWUXS f KRZHYHU WKH VHHG YLDELOLW\ RI WKLV DQG RWKHU DURLGV LV VKRUW DQG WKH VHHG DUH QRW UHDGLO\ DYDLODEOH FRPPHUFLDOO\ =HWWOHU t +DUWPDQ f 6LQFH 'V09 LV QRW WKH RQO\ SRW\YLUXV ZKLFK LQIHFWV DURLGV 6KLPR\DPD HW DO D &KHQ SHUVRQDO FRPPXQLFDWLRQf OLJKW DQG HOHFWURQ PLFURVFRS\ FDQ QRW QHFHVVDULO\ EH XVHG DV UHOLDEOH HYLGHQFH IRU DVFHUWDLQLQJ WKH H[LVWHQFH RI 'V09 =HWWOHU t +DUWPDQ f QRU DUH WKHVH PHWKRGV OLNHO\ WR EH DV VHQVLWLYH DV VRPH RWKHUV *UHEHU t 6KDZ f 6HURORJLFDO PHWKRGV VXFK DV LPPXQRGLIIXVLRQ WHVWV KDYH EHHQ XVHG H[WHQVLYHO\ LQ GLDJQRVLV DQG GHWHFWLRQ RI 'V09 EXW WKLV PHWKRG UHTXLUHV ODUJHU TXDQWLWLHV RI DQWLVHUXP WKDQ WHFKQLTXHV VXFK DV (/,6$ =HWWOHU t +DUWPDQ f (/,6$ ZDV DOVR UHSRUWHG WR EH XVHG IRU 'V09 GHWHFWLRQ 5DQD HW DO +X HW DO f EXW HLWKHU WKH DQWLVHUXP XVHG UHDFWHG ZLWK KRVW SURWHLQV RU QR GLIIHUHQFH FRXOG EH GHWHFWHG DPRQJ GLIIHUHQW LVRODWHV 'DVKHHQ PRVDLF YLUXV KDV EHHQ VXFFHVVIXOO\ FRQWUROOHG E\ WLVVXH FXOWXUH PHWKRGV LQ VRPH JUHHQKRXVH JURZQ DURLGV VXFK DV $QWKXULXP 'LHIIHQEDFKLD 3KLORGHQGURQ

PAGE 29

6SDWKLSK\OOXP 6\QJRQLXP DQG =DQWHGHVFKLD DOWKRXJK WKH SULPDU\ SXUSRVH RI WKH WLVVXH FXOWXUH PHWKRG IRU WKHVH SODQWV LV UDSLG LQ YLWUR SURSDJDWLRQ =HWWOHU t +DUWPDQ *RPH] HW DO f 'HVSLWH WKHVH WHFKQLTXHV 'V09 VWLOO FDXVHV SUREOHPV LQ VRPH ORZFDVK ILHOG JURZQ DURLGV VXFK DV &DODGLXP &RORFDVLD DQG ;DQWKRVRPD =HWWOHU HW DO f 'DVKHHQ PRVDLF RFFXUV WKURXJKRXW WKH ZRUOG GXH WR WKH LQWHUQDWLRQDO GLVWULEXWLRQ RI DURLGV DV IRRG SODQWV DQG RUQDPHQWDOV DQG WKH SHUSHWXDWLRQ RI WKH YLUXV E\ SURSDJDWLQJ SODQWV YHJHWDWLYHO\ /LWWOH LV NQRZQ DERXW WKH HYROXWLRQDU\ UHODWLRQVKLSV DPRQJ 'V09 LVRODWHV RFFXUULQJ LQ GLIIHUHQW JHRJUDSKLF DUHDV DQG DPRQJ YDULRXV KRVWV 7KHUH LV HYLGHQFH IRU WKH RFFXUUHQFH RI D VHYHUH VWUDLQ RI WKH YLUXV LQ )UHHK 3RO\QHVLD -DFNVRQ f 6\PSWRPDWLF DQG VHURORJLFDO GLIIHUHQFHV ZHUH QRWLFHG EHWZHHQ DQ (J\SWLDQ LVRODWH DQG D )ORULGD LVRODWH RI 'V09 IURP WDUR $ER (O1LO HW DO f 6\PSWRPDWLF DQG VHURORJLFDO GLIIHUHQFHV EHWZHHQ D )LML LVRODWH DQG D )ORULGD LVRODWH IURP WDUR ZHUH DOVR QRWHG $ER (O1LO f 'LIIHUHQFHV LQ JURZWK UDWH EHWZHHQ 3 VHOORXP VHHGOLQJV LQRFXODWHG ZLWK VHYHUDO 'V09 LVRODWHV ZHUH UHSRUWHG LQ ZKLFK b DQG b ZHLJKW UHGXFWLRQ IRU WDUR DQG GLHIIHQEDFKLD LVRODWHV UHVSHFWLYHO\ ZHUH UHSRUWHG :LVOHU HW DO f 7KH 'V09 DQWLVHUXP DJDLQVW D &KLQHVH HYHUJUHHQ LVRODWH UHDFWHG ZLWK KRPRORJRXV LVRODWH EXW QRW )ORULGD DQG )XML LVRODWHV LQ '$6 (/,6$ .RVLWUDWDQD "f 6KLPR\DPD HW DO Df UHSRUWHG WKDW WKH 'V09 DQWLVHUXP WKH\ SUHSDUHG GLG QRW UHDFW ZLWK VHYHUDO RWKHU SRW\YLUXVHV LQFOXGLQJ 39<7 :09 =<09 %<09 7X09 %&09 6E09 DQG NRQMDN PRVDLF YLUXVHV 7KHVH VWXGLHV LQGLFDWHG WKDW GLVWLQFW 'V09 LVRODWHV GR H[LVW DOWKRXJK WKH UHODWLRQVKLSV EHWZHHQ WKHP UHPDLQ REVFXUH

PAGE 30

2WKHU VWXGLHV LQ FRQWUDVW VXFK DV WKDW E\ =HWWOHU HW DO f LQGLFDWH RQO\ VOLJKW GLIIHUHQFHV DPRQJ 'V09 LVRODWHV $V DQ LPSRUWDQW JURXS RI RUQDPHQWDOV GRPHVWLF DQG LQWHUQDWLRQDO PRYHPHQW RI DURLGV RFFXUV RQ D ODUJH VFDOH ,Q DGGLWLRQ WR FRPPHUFLDO EXON VKLSPHQWV RI SODQW PDWHULDOV WKHUH LV FRQVLGHUDEOH PRYHPHQW RI VPDOO TXDQWLWLHV RI FORQDO SODQW JHUPSODVP IRU SXUSRVHV RI HVWDEOLVKLQJ ERWDQLFDO FROOHFWLRQV EUHHGLQJ SURJUDPV DQG PHGLFLQDO SODQWV ,Q RUGHU WR DYRLG WKH VSUHDG RI VRPH DURLG GLVHDVHV LQFOXGLQJ 'V09 LQWHUQDWLRQDO JXLGHOLQHV IRU WKH VDIH PRYHPHQW RI DURLG JHUPSODVP KDYH EHHQ UHFRPPHQGHG =HWWOHU HW DO f 7KHVH JXLGHOLQHV UHFRPPHQG JURZLQJ SODQWV LQ JUHHQKRXVHV DQG LQGH[LQJ WKHP SHULRGLFDOO\ IRU DW OHDVW RQH FURS F\FOH EHIRUH FHUWLI\LQJ WKHP DV EHLQJ YLUXVIUHH 6XFK FRQGLWLRQV LI LPSOHPHQWHG ZRXOG LPSRVH VHYHUH FRQVWUDLQWV LQ WKH LQWHUQDWLRQDO WUDGH RI WKHVH SODQWV 5HOLDEOH VHQVLWLYH SUDFWLFDO DQG UDSLG PHDQV IRU GHWHFWLQJ 'V09 FRXOG KHOS RYHUFRPH VXFK SUREOHPV $ EHWWHU NQRZOHGJH RI WKH FKDUDFWHULVWLFV RI 'V09 UHJDUGLQJ ERWK LWV JHQHUDO DQG PROHFXODU SURSHUWLHV ZRXOG SURYLGH WKH EDVLV QHHGHG IRU LPSURYLQJ WKH GHWHFWLRQ RI 'V09 DQG IRU XQGHUVWDQGLQJ WKH UHODWLRQVKLSV DPRQJ GLIIHUHQW 'V09 LVRODWHV 7KH SXUSRVHV RI WKLV VWXG\ ZHUH WR Lf SXULI\ WKH YLPV IRU PROHFXODU VWXGLHV RI 'V09 LLf REWDLQ DQG HYDOXDWH DQWLVHUXP WR EH XVHG WR GLDJQRVH WKLV YLPV LLLf GHYHORS UHOLDEOH DQG HIIHFWLYH PHWKRGV IRU GHWHFWLQJ 'V09 LQ SURSDJDWLQJ XQLWV RI &DODGLXP &RORFDVLD DQG ;DQWKRVRPD $Q LVRODWH IURP FDODGLXP ZDV SXULILHG DQG LWV YLUDO 51$ XVHG WR HVWDEOLVK D F'1$ OLEUDU\ 7KH WHUPLQDO UHJLRQ RI WKLV LVRODWH ZDV VHTXHQFHG DQG FRPSDUHG WR WKRVH RI RWKHU SRW\YLPVHV 7KH &3 JHQH ZDV H[SUHVVHG LQ (VFKHULFKLD FROL DQG XVHG WR REWDLQ WKH DQWLVHUXP

PAGE 31

WKDW ZDV XVHIXO IRU VHURORJLFDO WHVWV ,W ZDV GHWHUPLQHG WKDW WKH &3 RI 'V09 LVRODWHV YDULHG LQ VL]H DQG LQ QXFOHRWLGH VHTXHQFH 6HURORJLFDO SURFHGXUHV VXFK DV (/,6$ DQG :HVWHUQ EORWWLQJ ZHUH GHYHORSHG IRU GHWHFWLQJ 'V09 $OVR UHSRUWHG ZDV WKH XVH RI 573&5 IRU 'V09 GHWHFWLRQ

PAGE 32

&+$37(5 &/21,1* 6(48(1&,1* 2) 7+( f7(50,1$/ 5(*,21 $1' (;35(66,21 2) 7+( &2$7 3527(,1 2) '609&KO ,QWURGXFWLRQ $V D SRW\YLUXV GDVKHHQ PRVDLF YLUXV 'V09f VKDUHV PDQ\ SURSHUWLHV ZLWK RWKHU DSKLGERUQH SRW\YLUXVHV VXFK DV KDYLQJ IOH[XRXV ILODPHQWRXV SDUWLFOHV LQGXFLQJ IRUPDWLRQ RI F\OLQGULFDO LQFOXVLRQV &Of LQ LQIHFWHG FHOOV KDYLQJ D SRVLWLYHVHQVH VLQJOHVWUDQGHG 51$ JHQRPH EHLQJ VDS DQG DSKLGWUDQVPLVVLEOH KDYLQJ D UHODWLYHO\ UHVWULFWHG KRVW UDQJH DQG EHLQJ VHURORJLFDOO\ UHODWHG WR PDQ\ RWKHU SRW\YLUXVHV =HWWOHU HW DO /L HW DO f 7KH 51$ RI D )ORULGD 'V09 LVRODWH IURP WDUR &RORFDVLD HVFXOHQWDf KDV EHHQ WUDQVODWHG LQ WKH UDEELW UHWLFXORF\WH O\VDWH LQ YLWUR V\VWHP 1DJHO t +LHEHUW XQSXEOLVKHGf WR JLYH ILYH PDMRU SRO\SHSWLGHV QDPHO\ WKH +&3UR &O 1,D 1LE DQG &3 SURWHLQV 7KH PROHFXODU ZHLJKW RI WKH JHQRPLF 51$ ZDV HVWLPDWHG WR EH [ IRU D &DOLIRUQLD LVRODWH IURP &KLQHVH HYHUJUHHQ .RVLWUDWDQD f DQG [ IRU D -DSDQHVH 'V09 LVRODWH IURP WDUR 6KLPR\DPD HW DO f 7KH FRDW SURWHLQ &3f DQG WKH f QRQFRGLQJ UHJLRQ f1&5f RI WZR 'V09 WDUR LVRODWHV /$ DQG 7(1 KDYH EHHQ VHTXHQFHG UHFHQWO\ 3DSSX HW DO Ef +RZHYHU WKH FKDUDFWHULVWLFV RI WKH 'V09 JHQRPH RUJDQL]DWLRQ DQG WKH VHTXHQFHV RI RWKHU JHQHV KDYH QRW EHHQ VWXGLHG )XUWKHUPRUH XQGHUVWDQGLQJ WKH PROHFXODU FKDUDFWHULVWLFV RI 'V09 ZLOO KHOS WR GHILQH WKH YLUXV DQG LPSURYH SURVSHFWV IRW LWV GLDJQRVLV DQG GHWHFWLRQ IRU WKH SXUSRVHV RI HVWDEOLVKLQJ SUDFWLFDO TXDUDQWLQH UHJXODWLRQV DQG IDFLOLWDWLQJ WKH SURGXFWLRQ RI YLUXVIUHH SODQWV

PAGE 33

WKURXJK PLFURSURSDJDWLRQ 7KH RQO\ VRXUFH RI 'V09 DQWLVHUXP ZDV WKDW SURYLGHG E\ $ER (O 1LO HW DO f EXW WKLV VXSSO\ LV QHDUO\ H[KDXVWHG 'V09 LVRODWHV DOVR FURVV UHDFWHG ZLWK 37< PRQRFORQDO DQWLERG\ ZKLFK LV FRPPHUFLDOO\ DYDLODEOH WKURXJK $JGLD ,QF (ONKDUW ,1f +RZHYHU VLQFH WKLV DQG RWKHU PRQRFORQDO DQWLVHUD PD\ QRW UHDFW ZLWK VRPH SRW\YLUXVHV RU VRPH SRW\YLUDO LVRODWHV WKHUHRI -RUGDQ f WKHUH LV DQ LQKHUHQW ULVN RI QRW GHWHFWLQJ FHUWDLQ YLUXVHV RU YLUDO LVRODWHV ODFNLQJ WKH HSLWRSHV FRPPRQ WR PRVW RWKHU SRW\YLUXVHV ,Q WKLV VWXG\ WKH fWHUPLQDO UHJLRQ QXFOHRWLGHV RI D 'V09 FDODGLXP LVRODWH ZDV FORQHG VHTXHQFHG DQG DQDO\]HG 7KH 'V09 &3 ZDV H[SUHVVHG LQ (VFKHULFKLD FRW DQG XVHG WR SURGXFH SRO\FORQDO DQWLVHUXP IRU 'V09 GLDJQRVLV DQG GHWHFWLRQ 0DWHULDOV DQG 0HWKRGV 9LUXV ,VRODWHV $ n&DQGLGXPf FDODGLXP SODQW LQIHFWHG ZLWK DQ LVRODWH RI 'V09 ZDV PDLQWDLQHG LQ D JUHHQKRXVH DQG XVHG WR LQRFXODWH 3 VHOORXP VHHGOLQJ SODQWV DW WKH OHDI VWDJH ZLWK DQ DUWLVWfV DLUEUXVK JXQ 6RXUFH WLVVXH ZDV WULWXUDWHG LQ D PRUWDU DQG SHVWOH ZLWK 0 SRWDVVLXP SKRVSKDWH EXIIHU ZY f S+ FRQWDLQLQJ PHVK FDUERUXQGXP 7KH VXSHUQDWDQW ZDV DGGHG WR D JODVV ERWWOH ZKLFK ZDV FRQQHFWHG ZLWK D SRUWDEOH FDUERQ GLR[LGH WDQN DQG ZDV SURSHOOHG RQWR WKH ILUVW WZR QHZO\ H[SDQGHG OHDYHV RI 3 VHOORXP VHHGOLQJV XVLQJ FDUERQ GLR[LGH DW D SUHVVXUH RI SRXQGV SHU VTXDUH LQFK *RRGLQJ t 5RVV f

PAGE 34

9LUXV 3XULILFDWLRQ 7KH XOWUDFHQWULIXJDWLRQ PHWKRG XVHG IRU 'V09 SXULILFDWLRQ ZDV VLPLODU WR WKDW IRU =<09 GHVFULEHG E\ :LVOHU f ZLWK PRGLILFDWLRQV 7KH OHDI RU URRW WLVVXHV RI LQIHFWHG FDODGLXP FDOOD OLO\ FRFR\DP WDUR RU 3KLORGHQGURQ VHOORXP VHHGOLQJV ZHUH KRPRJHQL]HG LQ D FRROHG :DULQJ EOHQGHU IRU PLQ ZLWK YROXPHV RI 0 SRWDVVLXP SKRVSKDWH EXIIHU S+ WR ZKLFK b VRGLXP GLHWK\OGLWKLRFDUEDPDWH ',(&$f DQG b 3PHUFDSWRHWKDQRO _0(f ZHUH DGGHG 7KH KRPRJHQDWH ZDV HPXOVLILHG ZLWK ZYf FROG WULFKORURIOXRUHWKDQH )UHRQf IRU VHF )ROORZLQJ FHQWULIXJDWLRQ DW J ZLWK D 6RUYDOO KLJK VSHHG FHQWULIXJH 'X 3RQW &R :LOPLQJWRQ '(f IRU PLQ WKH DTXHRXV SKDVH ZDV ILOWHUHG WKURXJK IRXU OD\HUV RI FKHHVH FORWK 7KH VXVSHQVLRQ ZDV FHQWULIXJHG DW J IRU PLQ 7ULWRQ ; ZDV DGGHG WR WKH DTXHRXV SKDVH WR D ILQDO FRQFHQWUDWLRQ RI b 7KH PL[WXUH ZDV VWLUUHG IRU PLQ DW r& 7KH PL[WXUH ZDV WKHQ FHQWULIXJHG LQ D %HFNPDQ 7L URWRU %HFNPDQ ,QVWUXPHQWV ,QF 3DOR $OWR &$f DW J N USPf IRU PLQ 7KH SHOOHW ZDV UHVXVSHQGHG LQ P0 +(3(6 S+ FRQWDLQLQJ P0 ('7$ DQG b 30( ZLWK D WLVVXH KRPRJHQL]HU $IWHU VWLUULQJ IRU RQH KRXU DW r& WKH VXVSHQVLRQ ZDV SDUWLDOO\ FODULILHG E\ FHQWULIXJDWLRQ DW J IRU PLQ 7KH VXSHUQDWDQW ZDV OD\HUHG RQ WKH WRS RI %HFNPDQ 6: WXEHV FRQWDLQLQJ D &662 VROXWLRQ J VDOW SOXV PO RI P0 +(3(6 S+ f PO SHU WXEH 7KH WXEHV ZHUH FHQWULIXJHG DW J N USPf IRU KU DW r& 7KH WZR RSDOHVFHQW YLUXV ]RQHV PP IURP WKH ERWWRP RI WKH WXEH ZHUH FROOHFWHG E\ GURSOHW IUDFWLRQDWLRQ 7KH FROOHFWHG IUDFWLRQV FRQWDLQLQJ WKH YLULRQV ZHUH FRPELQHG DQG GLOXWHG ZLWK YROXPH RI P0 +(3(6 S+ DQG FHQWULIXJHG DW J IRU PLQ 7KH YLUXV ZDV SUHFLSLWDWHG IURP WKH VXSHUQDWDQW E\

PAGE 35

DGGLQJ SRO\HWK\OHQH JO\FRO 3(* 0: f WR D FRQFHQWUDWLRQ RI b ZYf VWLUULQJ DW r& IRU PLQ DQG WKHQ FHQWULIXJLQJ DW J DV EHIRUH 7KH SHOOHW ZDV UHVXVSHQGHG LQ PO RI P0 +(3(6 S+ &RQFHQWUDWLRQV RI WKH YLUXV SUHSDUDWLRQV ZHUH HVWLPDWHG E\ VSHFWURSKRWRPHWU\ XVLQJ DQ DSSUR[LPDWH H[WLQFWLRQ FRHIILFLHQW RI $ PJPO FP OLJKW SDWKf )LYH SL RI D GLOXWLRQ RI WKH YLUXV SUHSDUDWLRQ ZDV PL[HG ZLWK DQ HTXDO YROXPH RI /DHPPOL GLVVRFLDWLQJ VROXWLRQ /DHPPOL f ERLOHG IRU PLQ DQG DQDO\]HG E\ VRGLXP GRGHF\O VXOIDWHSRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV 6'63$*(f *HOV ZHUH VWDLQHG ZLWK &RRPDVVLH %ULOOLDQW %OXH 5 *LEFR %5/ *DLWKHUVEXUJ 0'f DQG GHVWDLQHG LQ D VROXWLRQ FRQWDLQLQJ b DFHWLF DFLG DQG b PHWKDQRO IRU YLVXDOL]DWLRQ 7KH YLUXV SUHSDUDWLRQV ZHUH VWRUHG DW r& DQG WKHQ XVHG IRU 51$ LVRODWLRQ 9LUDO 51$ ,VRODWLRQ 9LUDO 51$ ZDV LVRODWHG IURP SXULILHG YLUXV SUHSDUDWLRQV E\ WZR PHWKRGV VXFURVH JUDGLHQW FHQWULIXJDWLRQ DQG SKHQRO FKORURIRUP H[WUDFWLRQ $ SXULILHG YLUXV SUHSDUDWLRQ PJf ZDV GLVVRFLDWHG E\ LQFXEDWLRQ LQ DQ HTXDO YROXPH RI 51$ GLVVRFLDWLQJ VROXWLRQ 0 7ULV+&O S+ FRQWDLQLQJ P0 ('7$ DQG b 6'6f DQG SJPO RI SURWHDVH IRU PLQ DW URRP WHPSHUDWXUH /LQHDUORJ VXFURVH GHQVLW\ JUDGLHQWV ZHUH PDGH DV GHVFULEHG %UDNNH DQG 9DQ 3HOW f 7KH JUDGLHQWV ZHUH DOORZHG WR GLIIXVH RYHUQLJKW DW r& $ YROXPH HTXDO WR WKDW RI WKH VDPSOHV ZDV UHPRYHG IURP HDFK JUDGLHQW EHIRUH ORDGLQJ WKH VDPSOHV 7KH JUDGLHQWV ZHUH FHQWULIXJHG DW J N USPf IRU KU DW r& ZLWK D %HFNPDQ 6: URWRU *UDGLHQW ]RQHV FRQWDLQLQJ 51$ ZHUH FROOHFWHG

PAGE 36

XVLQJ DQ ,6&2 89 IUDFWLRQDWRU ,6&2 ,QF /LQFROQ 1(f 7KH 51$ ZDV SUHFLSLWDWHG RYHUQLJKW DW r& E\ DGGLQJ YROXPH RI 0 VRGLXP DFHWDWH S+ f DQG YROXPHV RI b FROG HWKDQRO $IWHU FHQWULIXJDWLRQ DW J IRU PLQ WKH SHOOHW ZDV ULQVHG ZLWK b HWKDQRO DQG YDFXXPGULHG 7KH 51$ ZDV WKHQ UHVXVSHQGHG LQ D VPDOO YROXPH RI VWHULOH ZDWHU DQG VWRUHG DW r& 7KH YLUDO 51$ ZDV DOVR H[WUDFWHG IURP LQFXEDWHG YLUXV SUHSDUDWLRQV E\ DGGLQJ DQ HTXDO YROXPH RI SKHQROFKORURIRUP f WR WKH PL[WXUH LQYHUWLQJ JHQWO\ DQG FHQWULIXJLQJ DW J LQ DQ (SSHQGRUI PLFURFHQWULIXJH IRU PLQ 7KH SKHQRO IUDFWLRQ ZDV UHPRYHG E\ DGGLQJ DQ HTXDO YROXPH RI FKORURIRUP DQG FHQWULIXJLQJ 7KH 51$ ZDV WKHQ SUHFLSLWDWHG ZLWK YROXPHV RI b HWKDQRO LQ WKH SUHVHQFH RI 0 VRGLXP DFHWDWH S+ f DW r& RYHUQLJKW $IWHU FHQWULIXJDWLRQ WKH 51$ ZDV UHVXVSHQGHG LQ VWHULOH ZDWHU DQG VWRUHG DW r& 6\QWKHVLV RI F'1$V 7ZR W\SHV RI F'1$V ZHUH V\QWKHVL]HG RQH ZLWK ROLJRG7fLLJ SULPHUV DQG WKH RWKHU ZLWK UDQGRP KH[DPHUV )UHVKO\ SUHSDUHG YLUDO 51$ ZDV XVHG IRU FORQLQJ ZLWK SJ 51$ EHLQJ XVHG DV WHPSODWHV IRU WKH ILUVW VWUDQG V\QWKHVLV 7KH ILUVW DQG VHFRQG VWUDQG F'1$V ZHUH V\QWKHVL]HG XVLQJ D 7LPH6DYHUr1 F'1$ V\QWKHVLV .LW 3KDUPDFLD %LRWHFK ,QF 3LVFDWDZD\ 1-f IROORZLQJ WKH PDQXIDFWXUHUfV LQVWUXFWLRQV 7KH ILUVWVWUDQGHG F'1$ V\QWKHVLV ZDV ODEHOHG ZLWK SL S&L D3G&73f &LPPROf 'X 3RQW 1(1 %RVWRQ 0$f DQG XVHG DV D WUDFHU $IWHU WKH GRXEOHVWUDQGHG F'1$ V\QWKHVLV WKH VDPSOH ZDV H[WUDFWHG ZLWK SKHQRO

PAGE 37

FKORURIRUP DQG SXULILHG E\ SDVVLQJ WKURXJK D 6HSKDURVH &/% FROXPQ 7KH QH[W VWHS LQYROYHG OLJDWLRQ RI (F581RWO OLQNHUV WR F'1$V ,Q YLWUR SDFNDJLQJ RI WKH $'1$ ZDV SHUIRUPHG XVLQJ WKH 3DFNDJHQH /DPEGD '1$ 3DFNDJLQJ 6\VWHP XQGHU WKH FRQGLWLRQV UHFRPPHQGHG E\ WKH PDQXIDFWXUHU 3URPHJD &R 0DGLVRQ :,f 7KH SKDJH WLWHU ZDV GHWHUPLQHG E\ SODWLQJ VPDOO DOLTXRWV RI WKH SDFNDJLQJ H[WUDFW RQ ;/ %OXH FHOOV 6L]H DQDO\VLV RI F'1$ ZDV SHUIRUPHG RQ D b JHO 7KH JHO ZDV H[SRVHG WR ;UD\ ILOP DQG FRPSDUHG WR D NE ODGGHU PROHFXODU ZHLJKW VWDQGDUG *LEFR %5/f ,PPXQRVFUHHQLQJ RI'V09&KO 3KDJH &ORQHV ,PPXQRVFUHHQLQJ IRU FORQHV H[SUHVVLQJ &3 RU &O JHQHV RI WKH 'V09 JHQRPH ZDV FRQGXFWHG HVVHQWLDOO\ DFFRUGLQJ WR PDQXIDFWXUHUfV LQVWUXFWLRQV DV GHVFULEHG LQ WKH 3nFR%OXHr1 ,PPXQRVFUHHQLQJ .LW DQG 3UHGLJHVWHG /DPEGD =$3 ,,/ER5,&,$3 &ORQLQJ .LW 6WUDWDJHQH /D -ROOD &$f 7KH WLWHUHG EDFWHULRSKDJH OLEUDU\ SIXSODWHf ZDV XVHG WR LQRFXODWH SL RI IUHVKO\ SUHSDUHG ;/ %OXH RI ( FROL FRPSHWHQW FHOOV 2'RR f DQG LQFXEDWHG DW r& IRU PLQ 7KH PL[WXUH ZDV DGGHG WR PO RI 1=< WRS DJDU b 1D&O b 0J6+ b \HDVW H[WUDFW b FDVHLQ K\GURO\VDWH DQG b DJDUf FRQWDLQLQJ SJPO ; JDODFWRVLGH DQG P0 LVRSURS\O%'WKLRJDODFWRS\UDQRVLGH ,37*f ZKLFK ZDV SRXUHG RQWR D 1=< SODWH PP [ PPf DQG LQFXEDWHG DW r& IRU KU WR DOORZ IRU IRUPDWLRQ RI SODTXHV PP LQ GLDPHWHUf 7KH SODWHV ZHUH FKLOOHG DW r& IRU KU LQ RUGHU WR SUHYHQW WKH WRS DJDU IURP VWLFNLQJ WR WKH QLWURFHOOXORVH PHPEUDQHV 7KH SODWHV ZHUH GULHG LQ D KRRG IRU

PAGE 38

PLQ DQG VWHULOH QLWURFHOOXORVH PHPEUDQHV VRDNHG LQ P0 ,37* ZHUH FDUHIXOO\ OD\HUHG XSRQ WKHP 7KH SODWHV ZHUH LQFXEDWHG DW r& IRU DQ DGGLWLRQDO KU WR DOORZ H[SUHVVLRQ RI WKH FORQHG JHQHVf '37* LV D JUDWXLWRXV LQGXFHU XVHG WR LQGXFH WKH H[SUHVVLRQ RI WKH JDODFWRVLGDVH IXVLRQ SURWHLQ DQG $=$3 ,, SKDJH LV D WHPSHUDWXUHVHQVLWLYH PXWDQW 3KDUPDFLD %LRWHFK f 7KH PHPEUDQHV ZHUH OLIWHG ULQVHG WKUHH WLPHV IRU PLQ HDFK LQ 7%67 VROXWLRQ DQG SURFHVVHG DV GHVFULEHG LQ ZHVWHUQ EORW DQDO\VLV LQ FKDSWHU 'V09)/ DQWLVHUXP f DQG 'V09)/ &O DQWLVHUXP f ZHUH HPSOR\HG DV SULPDU\ DQWLERGLHV 3RVLWLYH SODTXHV ZHUH LVRODWHG ZLWK D VWHULOH JODVV SLSHWWH DQG SODFHG LQ SL RI 60 EXIIHU P0 1D&O P0 7ULV+&O S+ P0 0J&Of FRQWDLQLQJ GURSV RI FKORURIRUP 7KH WXEHV ZHUH YRUWH[HG DQG LQFXEDWHG DW URRP WHPSHUDWXUH IRU KU WR DOORZ WKH SKDJHV WR GLIIXVH LQWR WKH VROXWLRQ )RUW\ SL DOLTXRWV RI WKH SKDJH FORQHV ZHUH DGGHG WR SL RI WKH ;/ %OXH FHOOV 2'ILRR f DEVRUEHG DW r& IRU PLQ DQG DPSOLILHG DW r& LQ D VKDNHU RYHUQLJKW LQ PO RI ; <7 ZLWK b PDOWRVH DQG P0 0J&O 7KH FXOWXUHV ZHUH FHQWULIXJHG DW J IRU PLQ WR UHPRYH WKH FHOO GHEULV 6XSHUQDWDQWV FRQWDLQLQJ SKDJHV ZHUH VWRUHG DW r& ZLWK DGGLWLRQ RI FKORURIRUP WR D ILQDO FRQFHQWUDWLRQ RI b ,Q 9LYR ([FLVLRQ RI 'V09&KO 3ODVPLGV IURP 7KH $=$3,, 9HFWRU 7KH SODVPLG FORQHV ZHUH H[FLVHG IURP WKH $=$3 ,, YHFWRU DFFRUGLQJ WR WKH PDQXIDFWXUHUfV LQVWUXFWLRQV XVLQJ D 3UHGLJHVWHG $=$3 ,,eFR5,&,$3 &ORQLQJ .LW 6WUDWDJHQHf ZLWK WKH IROORZLQJ PRGLILFDWLRQ H[FHSW WKDW DPSOLILHG SKDJH FORQHV SLf ZHUH XVHG WR VWDUW WKH H[FLVLRQ $IWHU H[FLVLRQ SODVPLGV S'&3Q RU S'&,Qf ZHUH WUDQVIRUPHG LQWR

PAGE 39

62/5 RI ( FROL FHOOV DQG SODWHG RQ /%$03 SODWHV b 1D&O b WU\SWRQH b \HDVW H[WUDFW b DJDU DQG SJPOf 6LQJOH FRORQLHV ZHUH SLFNHG XS DPSOLILHG DQG XVHG IRU FORQH DQDO\VLV $QDO\VLV RI 'V09&KO &ORQHV 3ODVPLGV ZHUH SXULILHG DFFRUGLQJ WR D PLQLSUHS SURFHGXUH GHVFULEHG E\ 4,$*(1 ,QF &KDWVZRUWK &$f 8S WR PO RI FHOO FXOWXUH ZDV FROOHFWHG E\ FHQWULIXJDWLRQ LQ D PLFURFHQWULIXJH DW J IRU PLQ DW r& 7KH VXSHUQDWDQW ZDV GLVFDUGHG DQG WKH SHOOHW ZDV UHVXVSHQGHG LQ SL RI 3, EXIIHU P0 7ULV+&O S+ P0 ('7$ 51DVH $ SJPOf $IWHU LQFXEDWLRQ DW URRP WHPSHUDWXUH IRU PLQ SL RI 3 P0 1D2+ b 6'6f ZDV DGGHG DQG WKH WXEH ZDV PL[HG JHQWO\ E\ LQYHUVLRQ $IWHU DGGLQJ SL RI 3 EXIIHU 0 SRWDVVLXP DFHWDWH S+ f WKH WXEH ZDV FHQWULIXJHG DW J IRU PLQ 7KH DTXHRXV SKDVH ZDV WUDQVIHUUHG WR D IUHVK WXEH DQG YROXPH RI b LVRSURSDQRO ZDV DGGHG 7KH PL[WXUH ZDV WKHQ FHQWULIXJHG DW J IRU PLQ 7KH SHOOHW ZDV UHVXVSHQGHG LQ SL RI VWHULOH ZDWHU DQG WKHQ VFUHHQHG E\ (F5O 3URPHJDf GLJHVWLRQ IRU FORQH ZLWK D VLQJOH LQVHUW WR EH XVHG IRU VHTXHQFH DQDO\VLV '1$ 6HTXHQFLQJ RI 'V09&KO &ORQHV 7KH SODVPLG SUHSDUDWLRQV ZHUH VHTXHQFHG E\ WKH GLGHR[\ FKDLQ WHUPLQDWLRQ SURFHGXUH XVLQJ WKH 6HTXHQDVH 9HUVLRQ '1$ 6HTXHQFLQJ .LW 8QLWHG 6WDWHV %LRFKHPLFDO &OHYHODQG 2+f ZLWK D6G$73 7 DQG 7 SULPHUV FRPSOHPHQWDU\ WR WKH S%OXH6FULSW YHFWRU DQG

PAGE 40

V\QWKHVL]HG LQWHUQDO SULPHUV ZHUH XVHG WR FRPSOHWH WKH VHTXHQFH GHWHUPLQDWLRQ IRU HLWKHU WZR FORQHV RU ERWK VWUDQGV RI WKH VDPH FORQH 6HTXHQFLQJ SURGXFWV ZHUH SHUIRUPHG LQ D b ZYf SRO\DFU\ODPLGH JHO FRQWDLQLQJ 0 XUHD $XWRUDGLRJUDSKV RI DLUGULHG VHTXHQFLQJ JHOV ZHUH PDGH XVLQJ ;$5 [UD\ ILOP (DVWPDQ .RGDN 5RFKHVWHU 1
PAGE 41

$SKLG 7UDQVPLVVLRQ 7KUHH FDODGLXP LVRODWHV &KL &K DQG &Kf ZHUH WHVWHG IRU DSKLG WUDQVPLVVLRQ 7KH DSKLGV 0\]XV SHUVLFDHf PDLQWDLQHG RQ SHSSHU &DSVLFXP FDPXXQLf ZHUH VWDUYHG IRU WZR KU DQG WKHQ SODFHG RQ LQIHFWHG OHDYHV IRU VHF 7KH DSKLGV ZHUH WKHQ PRYHG WR 3 VHOORXP VHHGOLQJV XVHG DV WHVW SODQWV (DFK WULDO FRQVLVWHG RI WHVW SODQWV DQG HDFK WHVW SODQW UHFHLYHG DSKLGV $IWHU PLQ WKH DSKLGV ZHUH NLOOHG 7KH SODQWV ZHUH PDLQWDLQHG LQ D JUHHQKRXVH DQG WZR ZHHNV ODWHU ZHUH REVHUYHG IRU V\PSWRP H[SUHVVLRQ 9LVXDO REVHUYDWLRQV ZHUH FRQILUPHG E\ ,(/,6$ WHVW XVLQJ 'V09)/ DQWLVHUXP 6XEFORQLQJ DQG ([SUHVVLRQ RI WKH 'V09 &RDW 3URWHLQ DQG 1LE SURWHLQ %DVHG RQ WKH &3 QXFOHRWLGH VHTXHQFH RI 'V09&KO WZR SULPHUV QDPHO\ (+ f $$*&77*&$**&7*$7*$7$&$*ff FRUUHVSRQGLQJ WR WKH fHQG RI WKH &3 JHQH DQG (+ f*$$77&77*$$&$&&*7*&$&ff FRUUHVSRQGLQJ WR WKH fHQG RI WKH QRQn FRGLQJ UHJLRQ ZHUH V\QWKHVL]HG DW WKH 8QLYHUVLW\ RI )ORULGD '1$ 6\QWKHVLV &RUH $ +LQGOOO RU (FR5O UHVWULFWLRQ VLWH ZDV LQFOXGHG DW WKH fHQG RI HDFK SULPHU IRU GLUHFWLRQDO FORQLQJ RI WKH &3 JHQH LQWR DQ H[SUHVVLRQ S(7K YHFWRU 0F&DUW\ HW DO f DW +LQGOOO DQG (FR5O RQ WKH SRO\OLQNHU 7KH LQWDFW &3 JHQH QWf ZDV DPSOLILHG E\ 3&5 DV GHVFULEHG LQ FKDSWHU 7KH '1$ IUDJPHQW ZDV SXULILHG IURP D b DJDURVH JHO E\ XVLQJ 3UHS$*HQH 0DVWHU .LW %LR5DG f DFFRUGLQJ WR PDQXIDFWXUHUfV LQVWUXFWLRQV 7KH SXULILHG '1$ ZDV WKHQ FORQHG LQWR D 3&5 YHFWRU S*(0 7 YHFWRU 3URPHJDf WR JHQHUDWH S*(07&3 DFFRUGLQJ WR WKH PDQXIDFWXUHUfV

PAGE 42

LQVWUXFWLRQV 7KH SODVPLG S*(07&3 ZDV GLJHVWHG E\ +LQFILOO DQG (F6O 3URPHJDf DQG VXEFORQHG LQWR +LQG+8(FR5O GRXEOHGLJHVWHG S(7K WR JHQHUDWH S(7K&3 7KH QXFOHRWLGH VHTXHQFH RI WKH YHFWRULQVHUW MXQFWLRQ ZDV FRQILUPHG E\ '1$ VHTXHQFLQJ XVLQJ WKH 6HTXHQDVH 9HUVLRQ '1$ 6HTXHQFLQJ .LW 86 %LRFKHPLFDOf $ VLQJOH FRORQ\ FXOWXUH POf RI ( FROL %/'(S/\V6 WUDQVIRUPHG ZLWK S(7K &3 ZDV JURZQ RYHUQLJKW DW r& LQ /% FRQWDLQLQJ SJPO DPSLFLOOLQ DQG SJPO FKORUDPSKHQLFRO 7KH RYHUQLJKW FXOWXUH ZDV GLOXWHG LQWR PO RU PO ODUJH VFDOHf RI 0 PHGLXP 6DPEURRN HW DO f FRQWDLQLQJ SJPO DPSLFLOOLQ SJPO FKORUDPSKHQLFRO b JOXFRVH DQG b WU\SWRQH DQG WKH FXOWXUH ZDV VKDNHQ DW r& XQWLO HDUO\ ORJ SKDVH 2'r} f 7KHQ ,37* ZDV DGGHG WR D ILQDO FRQFHQWUDWLRQ RI P0 DQG JURZWK ZDV FRQWLQXHG IRU DQ DGGLWLRQDO KU DW r& ( FROL %/'(S/\V6 FHOOV ZHUH KDUYHVWHG E\ FHQWULIXJDWLRQ DW J WKH FXOWXUH EURWK ZDV GLVFDUGHG DQG WKH FHOO SHOOHW ZDV UHVXVSHQGHG LQ RQH WHQWK RI WKH RULJLQDO YROXPH RI 7( EXIIHU P0 7ULV+&O S+ P0 ('7$f DQG IUR]HQ RYHUQLJKW DW r& 7KH YLVFRXV FHOO VXVSHQVLRQ ZDV WKDZHG VRQLFDWHG IRU VHF DQG WKH O\VDWH ZDV WKHQ FHQWULIXJHG DW J IRU PLQ 7KH SHOOHW ZDV UHVXVSHQGHG LQ D VPDOO YROXPH RI 7( EXIIHU 7KH SUHSDUDWLRQV ZHUH WKHQ DQDO\]HG E\ 6'63$*( %RWK QRQLQGXFHG S(7K&3 DQG S(7K FXOWXUHV ZHUH WHVWHG DV FRQWUROV 7KH VDPH DSSURDFK XVHG IRU WKH 'V09 &3 H[SUHVVLRQ ZDV DSSOLHG WR H[SUHVV WKH 1LE SRO\PHUDVH LQ ( FROL 7KUHH SDLUV RI V\QWKHVL]HG SULPHUV ZHUH XVHG IRU 3&5 DPSOLILFDWLRQ RI HLWKHU WKH LQWDFW RU WUXQFDWHG 1LE JHQH RU D IUDJPHQW FRQWDLQLQJ WKH &WHUPLQDO UHJLRQ RI WKH 1,D DQG WKH 1LE JHQH (+ f*$$77&$7*&$$$*7***7***7*$ff

PAGE 43

FRUUHVSRQGLQJ WR WKH fHQG RI WKH 1LE JHQH DQG (+ f $*$7&7&7$&7*&$$&$&$$&&7&ff FRUUHVSRQGLQJ WR WKH fHQG RI WKH 1LE JHQH SULPHUV (+ f$$*&77*&$*&*$*$7*$7*$ f FRUUHVSRQGLQJ WR D VHTXHQFH LQ WKH 1LE JHQH DQG (+ SULPHUV (+ f***$77**$$7$**&7ff FRUUHVSRQGLQJ WR D VHTXHQFH LQ WKH fWHUPLQDO UHJLRQ RI WKH 1,D JHQH DQG (+ $QWLJHQ 3UHSDUDWLRQ DQG $QWLERG\ 3URGXFWLRQ $IWHU VRQLFDWLRQ WKH IXVLRQ SURWHLQ H[SUHVVHG E\ ( FROL ZDV SDUWLDOO\ SXULILHG E\ WKUHH F\FOHV RI FHQWULIXJDWLRQ DW J ZDVKLQJ HDFK SHOOHW ZLWK 7( EXIIHU DQG VHSDUDWLQJ WKH SURWHLQV E\ SUHSDUDWLYH 6'63$*( 3URWHLQ EDQGV ZHUH YLVXDOL]HG E\ LQFXEDWLQJ JHOV LQ 0 .& IRU PLQ DW r& 7KH WDUJHWHG SURWHLQ EDQG ZDV H[FLVHG ZDVKHG WKUHH WLPHV LQ FROG GHLRQL]HG ZDWHU DQG IUR]HQ DW r& 7KH FXW SLHFHV RI WKH JHO ZHUH WKHQ HOXWHG XVLQJ D %LR 5DG (OHFWRHOXWRU DW P$PSWXEH ZLWK FRQVWDQW FXUUHQW IRU KU 7KH H[WUDFWV FRQWDLQLQJ WKH SURWHLQ ZHUH FROOHFWHG DQG GLDO\]HG RYHUQLJKW DJDLQVW GLVWLOOHG ZDWHU DW URRP WHPSHUDWXUH 3XULW\ RI WKH HOXWHG SURWHLQ ZDV FKHFNHG E\ DQDO\WLFDO 6'63$*( DIWHU ZKLFK WKH SURWHLQ ZDV O\RSKLOL]HG ,PPXQL]DWLRQ ZDV FRQGXFWHG DV GHVFULEHG E\ 3XUFLIXOO DQG %DWFKHORU f $ TXDUWHU PO RI SXULILHG SURWHLQ PJf DW PJPO ZDV HPXOVLILHG ZLWK DQ HTXDO YROXPH RI FRPSOHWH )UHXQGfV DGMXYDQW DQG LQMHFWHG LQWR WKH WKLJK PXVFOHV RI D 1HZ =HDODQG ZKLWH UDEELW 1R f 7KLV ZDV IROORZHG E\ WZR PJ LQMHFWLRQV RI WKH &3 SURWHLQ HPXOVLILHG ZLWK LQFRPSOHWH )UHXQGfV DGMXYDQW WZR RU WKUHH ZHHNV ODWHU %ORRG ZDV FROOHFWHG ZHHNO\ IRU WZR

PAGE 44

PRQWKV VWDUWLQJ WZR ZHHNV DIWHU WKH WKLUG LQMHFWLRQ $IWHU D IRXU ZHHN LQWHUYDO D ERRVWHU LQMHFWLRQ ZDV JLYHQ IROORZHG E\ VXEVHTXHQW EOHHGLQJ 6HURORJLFDO (YDOXDWLRQ RI $QWLVHUXP 7KH DQWLVHUXP REWDLQHG ZDV WHVWHG E\ 6'6LPPXQRGLIWLLVLRQ ,(/,6$ DQG :HVWHUQ EORWWLQJ DQDO\VLV 7KH 6'6LPPXQRGLIWLLVLRQ WHVWV ZHUH FRQGXFWHG XVLQJ FUXGH H[WUDFWV DV GHVFULEHG E\ 3XUFLIXOO DQG %DWFKHORU f 7KH LPPXQRGLILLLVLRQ PHGLXP FRQVLVWHG RI b 1REOH DJDU b VRGLXP D]LGH DQG b 6'6 $ERXW PO RI WKH WKRURXJKO\ PL[HG DJDU VXVSHQVLRQ ZDV SRXUHG LQWR D GLVSRVDEOH SODVWLF SHWUL GLVK PP [ PPf $ VHW RI ZHOOV FRQVLVWLQJ RI VL[ SHULSKHUDO DQWLJHQ ZHOOV VXUURXQGLQJ D FHQWUDO DQWLVHUXP ZHOO ZLWK DQ LQWHUYDO RI PP IURP WKH HGJHV RI RQH DQRWKHU ZHUH PDGH ZLWK D JHO FXWWHU 6DPSOHV ZHUH SUHSDUHG E\ JULQGLQJ SODQW WLVVXHV LQ b 6'6 VROXWLRQ ILQDO FRQFHQWUDWLRQf ZLWK D PRUWDU DQG SHVWOH $IWHU DGGLWLRQ RI WKH DQWLJHQV DQG DQWLVHUD WKH GRXEOH UDGLDO GLIWLLVLRQ SODWHV ZHUH LQFXEDWHG DW r& 5HVXOWV ZHUH UHFRUGHG DIWHU KU DQG KU 7KH 'V09)/ DQWLVHUXP ZDV XVHG DV D FRQWURO %RWK ,(/,6$ DQG :HVWHUQ EORWWLQJ XVLQJ WKH 'V09)/ DQWLVHUXP DQG WKH H[SUHVVHG 'V09 &3 DQWLVHUXP ZHUH FRQGXFWHG XVLQJ SURFHGXUHV GHVFULEHG LQ &KDSWHU 5HVXOWV 3XULILFDWLRQ RI 'V0<&K DQG ,VRODWLRQ RI 9LUDO 51$ 7KH 'V09 YLULRQV ZHUH RQO\ SXULILHG IURP WKH ILUVW WZR QHZO\ IRUPHG OHDYHV DIWHU LQRFXODWLRQ RI 3 VHOORXP VHHGOLQJV JURZQ LQ UHODWLYHO\ FRRO ZHDWKHU FRQGLWLRQV GXULQJ WKH

PAGE 45

VSULQJ 7KH $$ UDWLR RI WKH ILQDO SXULILHG YLUXV SUHSDUDWLRQV REWDLQHG E\ P0 +(3(6 EXIIHU LQ WULDOV UDQJHG IURP WR ZLWK DQ DYHUDJH RI 7KH HVWLPDWHG YLUXV \LHOGV ZHUH PJJ OHDI WLVVXH 6'63$*( DQDO\VLV VKRZHG WKDW WKH DPRXQW RI YLUXV REWDLQHG E\ XOWUDFHQWULILLJDWLRQ ZDV VOLJKWO\ KLJKHU WKDQ WKDW REWDLQHG E\ 3(* SUHFLSLWDWLRQ )LJ $f 7KH OHDI WLVVXHV KDG KLJKHU FRQFHQWUDWLRQV RI WKH YLUXV WKDQ WKH URRW WLVVXH )LJ ,%f $OWKRXJK PDQ\ 'V09 SDUWLFOHV ZHUH VHHQ LQ WKH OHDI GLS SUHSDUDWLRQV WKH YLUXV FRXOG QRW EH SXULILHG IURP LQIHFWHG OHDYHV RI FDODGLXP FDOOD OLO\ FRFR\DP DQG WDUR SUHVXPDEO\ GXH WR WKH SUHVHQFH RI YLVFRXV KRVW FRPSRQHQWV SUREDEO\ SRO\VDFFKDULGHV $OWKRXJK FHVLXP FKORULGH ZDV XVHG LQ WKH SXULILFDWLRQ RI 'V09 LQ SUHYLRXV UHVHDUFK $ER (O1LO HW DO .RVLWUDWDQD 6KLPR\DPD HW DO f 'V09 ZDV GHJUDGHG LQ FHVLXP FKORULGH JUDGLHQWV PDGH LQ P0 +(3(6 S+ FRQWDLQLQJ P0 ('7$ DQG b 30( (OHFWURQ PLFURVFRSLF H[DPLQDWLRQ RI WKH YLUXV SUHSDUDWLRQV UHYHDOHG QXPHURXV IUDJPHQWV RI YLUXV SDUWLFOHV ,W ZDV SUHVXPHG WKHUHIRUH WKDW GHJUDGDWLRQ RI YLUXV SDUWLFOHV UHVXOWHG IURP FHVLXP FKORULGH ,Q FHVLXP VXOIDWH JUDGLHQWV KRZHYHU WZR RSDOHVFHQW YLUXV EDQGV ZHUH IRUPHG DQG WKH ERWWRP EDQG FRQWDLQHG PRUH YLULRQV WKDQ WKH WRS EDQG EDVHG RQ WKH 6'63$*( UHVXOW )LJ ,%f )XUWKHUPRUH WKH YLULRQV IURP WKH ERWWRP EDQG FROOHFWHG IURP WKH FHVLXP VXOIDWH JUDGLHQWV ZHUH OHVV GHJUDGHG WKDQ WKRVH QRWHG LQ FHVLXP FKORULGH JUDGLHQWV EDVHG RQ HOHFWURQ PLFURVFRS\ )LJ f 9LUDO 51$ ZDV UHDGLO\ H[WUDFWHG LQ SKHQROFKORURIRUP DQG WKH SURFHGXUH UHTXLUHG D PLQLPXP RI WLPH WR SURFHVV WKHUHE\ UHGXFLQJ WKH FKDQFH RI GHJUDGDWLRQ 7KH \LHOG RI YLUDO 51$ H[WUDFWHG E\ SKHQROFKORURIRUP ZDV SJ ZKLFK ZDV PXFK KLJKHU WKDQ WKDW E\

PAGE 46

)LJ $QDO\VLV RI SDUWLDOO\ SXULILHG DQG SXULILHG 'V09&KO SUHSDUDWLRQV $ 7KH SDUWLDOO\ SXULILHG SUHSDUDWLRQV /DQH SURWHLQ VWDQGDUGV ERYLQH VHUXP DOEXPLQ N'Df HJJ DOEXPLQ N'Df SHSVLQ N'Df ODQH WKH SXULILHG SUHSDUDWLRQ XVLQJ WKH XOWUDFHQWULIXJDWLRQ PHWKRG ODQH WKH SXULILHG SUHSDUDWLRQ XVLQJ 3(* SUHFLSLWDWLRQ % 7KH SXULILHG SUHSDUDWLRQV /DQH WKH YLUDO SUHSDUDWLRQ FROOHFWHG IURP WKH WRS EDQG RI WKH &662 JUDGLHQW ODQH WKH YLUDO SUHSDUDWLRQ FROOHFWHG IURP ERWWRP EDQG RI WKH &662 JUDGLHQW ODQH WKH SUHSDUDWLRQ IURP URRW WLVVXHV RI 3 VHOORXP VHHGOLQJV 7KH YLUXV ZDV SXULILHG IURP LQRFXODWHG 3 VHOORXP VHHGOLQJV DV SURFHGXUHV GHVFULEHG LQ WKH WH[W 3URWHLQ VDPSOHV ZHUH DQDO\]HG E\ b VRGLXP GRGHF\O VXOIDWH SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV IROORZHG E\ &RRPDVVLH VWDLQLQJ 7KH FRDW SURWHLQ RI WKH SXULILHG 'V09&KO LV LQGLFDWHG E\ WKH DUURZ

PAGE 47

)LJ (OHFWURQ PLFURJUDSK RI D SXULILHG 'V09&KO SUHSDUDWLRQ QHJDWLYHO\ VWDLQHG ZLWK b XUDQ\O DFHWDWH 7KH YLUXV ZDV SXULILHG IURP LQRFXODWHG 3 VHOORXP VHHGOLQJV E\ XOWUDFHQWDIXJDWLRQ SXULILFDWLRQ PHWKRG GHVFULEHG LQ WH[W %DU QP

PAGE 48

VXFURVH JUDGLHQW SJf DQG WKH UHVXOWLQJ 51$ ZDV PXFK PRUH LQWDFW LQ DJDURVH JHO )LJ f 0ROHFXODU $QDO\VLV RI F'1$ &ORQHV $IWHU VHURORJLFDO VFUHHQLQJ ZLWK 'V09)/ YLULRQ DQWLVHUXP FORQHV H[SUHVVLQJ WKH &3 S'&3f ZHUH VHOHFWHG DQG VFUHHQHG E\ (FR5, DQG 1RLO GLJHVWLRQV 7ZHOYH S'&3 FORQHV ZLWK D VLQJOH LQVHUW ZHUH VHOHFWHG IRU GLUHFW VHTXHQFH PDSSLQJ 7DEOH f 7KH VL]HV RI WKH LQVHUWV LQ WKHVH FORQHV UDQJHG IURP NE 7KH UHDFWLRQ RI 'V09)/ &O DQWLVHUXP ZDV QRQVSHFLILF DQG ZKLWH FORQHV S'&,f ZHUH UDQGRPO\ VHOHFWHG IRU (FR5, DQG 1RLO GLJHVWLRQ VFUHHQLQJ DQG VHTXHQFH PDSSLQJ $PRQJ WKHVH FORQHV HLJKW KDG FRUUHFW LQVHUWV ZKLFK UDQJHG IURP WR NE 7DEOH f 7KHVH F'1$ FORQHV ZLWK RYHUODSSLQJ LQVHUWV FRYHUHG DOO EXW WKH NE FHQWUDO UHJLRQ DQG WKH XSVWUHDP fWHUPLQDO UHJLRQ RI WKH 'V09&KO JHQRPH EDVHG RQ FRPSDULVRQV ZLWK WKH SXEOLVKHG VHTXHQFH RI 6E09 -D\DUDP HW DO f )LJ f 7ZHOYH FORQHV ZLWK LQVHUW VL]HV UDQJLQJ IURP WR NE ZHUH VHOHFWHG IRU VHTXHQFH DQDO\VLV )LJ f 6HTXHQFHV 5HSUHVHQWLQJ WKH fWHUPLQDO UHJLRQ RI 'V0<&KO 7KH QXFOHRWLGH VHTXHQFH RI EDVHV H[FOXGLQJ WKH SRO\$f WDLOf FRUUHVSRQGLQJ WR WKH fWHUPLQDO UHJLRQ RI 'V09 51$ ZDV GHWHUPLQHG )LJ f 7KH QXFOHRWLGH SRVLWLRQV ZHUH FRQILUPHG E\ DQDO\]LQJ HLWKHU ERWK VWUDQGV RI WKH VDPH FORQHV RU LQGLYLGXDO VWUDQGV RI GLIIHUHQW FORQHV 6WUHWFKHV RI DGHQRVLQH UHVLGXHV ZHUH IRXQG DW WKH HQGV RI WZR FORQHV

PAGE 49

)LJ $JDURVH JHO HOHFWURSKRUHVLV RI 'V09&KO 51$ LVRODWHG IURP SXULILHG YLULRQV /DQH YLUDO 51$ LVRODWHG E\ SKHQROFKORURIRUP H[WUDFWLRQ ODQH YLUDO 51$ LVRODWHG E\ VXFURVH JUDGLHQW 7KH YLUDO 51$ ZDV ORDGHG RQWR D b DJDURVH JHO 7KH VHSDUDWHG 51$ ZDV VWDLQHG E\ HWKLGLXP EURPLGH DQG YLVXDOL]HG XQGHU 89 OLJKW

PAGE 50

7DEOH 'V09&KO F'1$ FORQHV LGHQWLILHG E\ LPPXQRVFUHHQLQJ DQG SUHOLPLQDU\ VHTXHQFLQJ &ORQH $SSUR[LPDWH 6HURORJLFDO GHVLJQDWLRQ VL]H LNERO UHDFWLYLW\ S'&3O &3 S'&3 &3 S'&3 &3 S'&3 &3 S'&3 &3 S'&3 &3 S'&3 &3 S'&3,2 &3 S'&3OO &3 S'&3 &3 S'&3 &3 S'&3 &3 S'&3 &3 F'1$ OLEUDU\ LQ ;=$3 ,, YHFWRUV ZDV SODTXH VFUHHQHG E\ 'V09 )/ DQWLVHUXP :KLWH SODTXHV H[SUHVVLQJ WKH &3 ZHUH VHOHFWHG 7KH VHOHFWHG FORQHV ZHUH FRQILUPHG E\ eFR5, GLJHVWLRQ DQG WKH FORQHV ZLWK D VLQJOH LQVHUW ZHUH VHOHFWHG 7KH SRVLWLYH FORQHV ZHUH VHTXHQFHG E\ YHFWRU SULPHUV 7 DQG 7 DQG UHVXOWV ZHUH PDSSHG WR UHODWLYH SRVLWLRQV LQ WKH 51$ JHQRPH FRPSDUHG WR D SXEOLVKHG QXFOHRWLGH VHTXHQFH RI 6E09 E\ D *DS SURJUDP RI WKH *&* SURJUDP SDFNDJH 5HDFWLYH ZLWK 'V09)/ DQWLVHUXP

PAGE 51

7DEOH 'V09&KO F'1$ FORQHV LGHQWLILHG E\ SUHOLPLQDU\ VHTXHQFLQJ &ORQH GHVLJQDWLRQ $SSUR[LPDWH VL]H ,NES, 5HODWLYH SRVLWLRQ S'&, 1LE &3 S'&, +&3UR &O S'&, +&3UR S'&, 1LE S'&, +&3UR &O S'&, 3, 3 S'&, 3, 3 F'1$ OLEUDU\ LQ ;=$3 ,, YHFWRUV ZDV SODTXH VFUHHQHG E\ 'V09)/ &O DQWLVHUXP :KLWH FORQHV ZHUH VHOHFWHG 7KH VHOHFWHG FORQHV ZHUH FRQILUPHG E\ eFR5, GLJHVWLRQ DQG WKH FORQHV ZLWK D VLQJOH LQVHUW ZHUH VHOHFWHG 7KH SRVLWLYH FORQHV ZHUH VHTXHQFHG E\ YHFWRU SULPHUV 7 DQG 7 DQG WKH UHVXOWV ZHUH PDSSHG WR UHODWLYH SRVLWLRQV LQ WKH 51$ JHQRPH FRPSDUHG WR D SXEOLVKHG 6E09 QXFOHRWLGH VHTXHQFH E\ D *DS SURJUDP RI WKH *&* SURJUDP SDFNDJH

PAGE 52

1LE &3 S'&, S'&, S'&, S'&, S'& + 3RO\ $f n S'&, S'&3 S'&, S'&3O S'&3 t S'&3O S'&3,2 3'&3 S'&3 t 3'&3 S'&3 S'&3 )LJ 0DS RI WKH F'1$ FORQHV UHSUHVHQWLQJ WKH 'V09&KO JHQRPH 7KH SRVLWLRQ RI HDFK FORQH ZDV PDSSHG E\ SUHOLPLQDU\ VHTXHQFLQJ DQG FRPSDULQJ WKHP ZLWK WKH SXEOLVKHG QXFOHRWLGH VHTXHQFH RI 6E09 -D\DUDPD HW DOf

PAGE 53

1D 1LE &3 n1&5 f S'&3 S'&3O 3RO\ $f S'&3 t S'&3 S'&3 t S'&3 t )LJ 6HTXHQFLQJ VWUDWHJ\ XVHG IRU WKH F'1$ FORQHV UHSUHVHQWLQJ WKH nWHUPLQDO UHJLRQ RI 'V09&KO $UURZV LQGLFDWH WKH GLUHFWLRQ RI VHTXHQFLQJ DQG GLVWDQFH UHDG IURP WKH EHJLQQLQJ RI WKH FORQH IURP WKH ORFDWLRQ RI D SULPHU 1D 1,D SURWHDVH JHQH 1LE SRO\PHUDVH JHQH &3 FRDW SURWHLQ JHQH 1&5 n QRQFRGLQJ UHJLRQ LWr

PAGE 54

)LJ 1XFOHRWLGH VHTXHQFH RI WKH fWHUPLQDO UHJLRQ RI 'V09&KO 7KH SUHGLFWHG DPLQR DFLG VHTXHQFH RI WKH RSHQ UHDGLQJ IUDPH FRGLQJ IRU WKH SXWDWLYH SRO\SURWHLQ LV VKRZQ 8QGHUOLQHG DPLQR DFLGV FRUUHVSRQG WR WKH 1,D SURWHDVH DFWLYLW\ VLWH EHWZHHQ UHVLGXHV DQG f WR WKH SRO\PHUDVH DFWLYH PRWLI EHWZHHQ DQG f DQG DSKLG WUDQVPLVVLRQ PRWLI DPLQR DFLGV f $PLQR DFLGV XQGHUOLQHG ZLWK GRWWHG OLQHV DQG VODVKHV f FRUUHVSRQG WR WKH SXWDWLYH SRO\SURWHLQ FOHDYDJH VLWHV

PAGE 55

&$$$*$*$*$**$*&*&*7$7*&$7**77**&$&*$$777&&$$*$7$$$$*&$7*&*&* .5((59&09*71)4'.605$ &7$&*$7&7&**$$*&$7&7&7&$77&7$&&$*$$***&$***$$&$77&7**$$$&$77 7,6($6/,/3(*4*7):.+: **$777&$$&7$$**$7****$*7*7***$7&&&&$7**7**&7*7*$*7*$7**$7$7$ 6 7 ( & ,309$96'*<, 7$*77**777&&$7**&&77**&7&$$$&$7$7&7*$*$**$$&7$7777*7&&&777&$ 9*)+*/*61,6(51<)93)7 &7*$&*$&77&*$*&$$$&$&$7&77$$$$**&7&*$7$*7&77*$$7**$&&&$*&$77 '')(47+/.5/'6/(:74+: **&$&777*$*&&7*$&$$*$7$*&77****77&$&7&$*$&7$*77$$7*$&&$$&&7$ +)43'.,$:*6/5/91'437 &7*$$*$7777$$*$777&$$$*77$$777&$*$&&7777&*$$$$7&&7*7$&$$77$& (').,6./,6'/)(1394/4 $$***7&7&$$$*7***7***7*$77$$7$&7*&&*$$***$$7&7$$$$*&7*77*&&& *646*:9,17$(*1/.$9$5 **7*7*$$$*7*&$&7&*7*$&$$$$&$7$&$*7*$$***$&&*7*&$*$7$&77&7&$* &(6$/97.+79.*3&5<)6( $*7$&77*$*77&$$$&&$**$$*&7*$$$$*77777&$*$&&$77&$7***$*&77$7&
PAGE 56

**$&$*77**7$7*$&&$$$7777$7$$$**77***$77&$77*$7*$*$$$*&77&&$* 79*07.)<.*:'6 /05./3( $$**$7***7&7$&7*&&$&*&7*$7***7&7&$*777*$&7&$7&$77$$&$&&$&7&& : 9 < & + $ 6 4)'66/73// 7&$7$$$&*&**7&*7**$&$7&$**$$*77777&$7**$**$*7**7***77**7*$$* ,1$99', 5.))0((::9*(( $$$7*&77*$&$$&77*7$7*&7*$$$77*7&7$&$&$&&7$7$77*$&&&&$*$7**$$ 0/'1/<$(,9<73,/73'*7 &$$77777 $$*$$$777$****&$$7$$7$*7 **$&$$&&$7 & *$&$*7 & *7 **$7$$7$ )..)5*11 6*436799'17 &$77*$7**77*7&$777&$*777$&7$&*&$7*7$7&$$*&$$**77**$&**$77$7* /099, 69<<$&, .4*:7'<' $7*77$*7&$$$*$$7$*7&77&777*&$$$7**7*$7*$&$7&$7$77**&7*7*&$*& 9645,9))$1 *'3 , / $ 9 4 5 *$*$7*$7*$$&&&$7&&77$$7$&&777&$**$77&7777&$&*$$77****&7&$$&7 ''(3,/17)4'6)+(/*/1< $7*$777&7&7*$*&*&$&*$7*$$*$*$*$**$$&777**77&$7*7&&&$7&$$*&7$ ')6(570.5((/:)06+4$0 7*$$$*7$****$7*777$7$7&&&7$$$&7$*$*&*$*$*$*$$77*7$7&$$7777$* .9*'9<,3./(5(5,96,/( $$7***$7$*$$*&$$$*$$$7*$7*&$&$*$$&$*$**&$$777*7*&$*&7$7*$7$* :'56 .(,0+57($, &$$0, ( $$*&$7****77$&$&7*$&&7&77*&$$*$$$7$$**$$$77&7$7&7$7**&7*&77* $:*<7'//4(, 5.)
PAGE 57

7**7 &&&$*&$*&$$*7*$*$$$**7$$**$$*77*7*$$$*$7*77$$&*&7**&$&7$ 93$$6 (.*.(99.'91$*7 6 *7**&$&$7$&7&&*7$&&7&**77*$$7$*$$7*$&$$$&$$$$7*$$777$&&777$* *7<6935/15,71.01/3/9 77$$$**7$$$7*&$7777$$$777*$$7&$777$$7&*$*7$&$$*&&$*$$&$*&*7* .*.&,/1/1+/,(<.3(45' $*$7$77&$$7$&&$*$*&&$&&&$&$&7&$$777*$$*7&7**7$&$$7*&7*7&$$*$ )175$7+74)(9:<1$9.5 *$*$$7$&*$*&77*$**$7*$**$*$7*&$&$7$*77$7*$$7**7777$7**777**7 (<(/('(40+,901*)09:& *&$7&*$7$$7**$$&$7&$&&7*$7$7&$$&****&77***7*$7*$7**$&**$$$&* ,'1*763',1*$:900'*1' $7&$$$77*$$7$&&&*77*$$*&&$$77*77*$$$$7*&$$$$&&$$&&77*&*7&$*$ 4,(<3/.3,9(1$.37/54, 7$$7**$7&$&7777&7*$&*&$*&$*$**&$7$&$77*$$&7*$*$$$&*&$*$*$$$& 0++)6'$$($<, (/51$(.3 &*7$7$7*&&7$*$7$&**7&77$77&*&$$777$&*7*$7*&$$*7&7&*&&&**7$7* <035<*/, 51/5'$6/$5<$ &7777*$&7777$7*$**7&$$77&7$$$$&$&&**7*&*$*&$$*$*$$*&$*77*&*& )' )<(91 6 .7 395$5($9$4 $$$7*$$**&**&7*&$&7&7&7$$&*77$&&$&7$**77*777**777**$7**7$$&* 0.$$$/619775/)*/'*19 777&$$&77&$$*&*$*$$&$&7*$$$**&$&$&7*&$$$$*$&*7&$&$&&$$$&$7*& 6766(17(5+7$.'97310+ $&$&777$&77**7*777&*7&7&&*&$*7$$$**7&7**7$$$&$***&&*$&$*77$7 7//*96634r 7**&7&*&7*777*7$*7777$777$7$7$$$*7$77*777*7$77&$$*7$*7*&7$77 7**77$7$$$&7$&$*&*7**7777&&$&&*$7*7**$*77**&777*&$&&&7$77$7& 7$&*7&&777$7*7$777*$$$$&7$&7*$$&7$&7*&$&&7$&*7&$*$&&*&$$**&* $7***&*&**7$**&*$*$&*&77&*7*&$&**7*77&$ Qf )LJ FRQWLQXHG

PAGE 58

S'&3O DQG S'&3f VXJJHVWLQJ WKLV HQG UHSUHVHQWHG WKH f HQG RI WKH 'V09 51$ &RPSXWHU DQDO\VLV RI WKH VHTXHQFH UHYHDOHG D XQLTXH ODUJH RSHQ UHDGLQJ IUDPH 25)f LQ WKH SRVLWLYH VWUDQG YLULRQ VHQVHf 1R RWKHU 25) RI VLJQLILFDQW VL]H ZDV REVHUYHG LQ HLWKHU WKH SOXV RU PLQXV VWUDQGV 7KH $7* VWDUW FRGRQ RI WKH VLQJOH 25) ZDV QRW LGHQWLILHG +RZHYHU E\ DQDORJ\ ZLWK RWKHU SRW\YLUXVHV LW LV SUHVXPDEO\ ORFDWHG QHDU WKH fWHUPLQXV RI WKH JHQRPH 7KH 25) WHUPLQDWHG DW WKH ILUVW 7$$ VWRS FRGRQ ZKLFK LV ORFDWHG DW UHVLGXHV XSVWUHDP RI WKH f HQG 1XFOHRWLGH VHTXHQFH KHWHURJHQHLW\ DPRQJ GLIIHUHQW F'1$ FORQHV ZDV IRXQG WR EH DERXW b 7KH SXWDWLYH DPLQR DFLG VHTXHQFH LQFOXGHV &WHUPLQDO DPLQR DFLGV RI WKH 1,D SURWHDVH DERXW b RI WKH SURWHLQf WKH 1LE SURWHLQ FRQVLVWLQJ RI DPLQR DFLGV DQG WKH FRDW SURWHLQ FRQVLVWLQJ RI DPLQR DFLGV )LJ f 7KH FOHDYDJH VLWHV EHWZHHQ WKHVH WKUHH SURWHLQV ZHUH LGHQWLILHG E\ FRPSDULQJ WKHP ZLWK WKRVH RI RWKHU VHTXHQFHG SRW\YLUXVHV 'RXJKHUW\ HW DO 6KXNOD HW DO f 7KH FOHDYDJH VLWH EHWZHHQ WKH 1,D DQG WKH 1LE SURWHLQV ZDV DW WKH DPLQR DFLG SRVLWLRQ 4*f ZKHUHDV WKH VLWH EHWZHHQ WKH 1LE DQG WKH &3 SURWHLQV ZDV DW WKH DPLQR DFLG SRVLWLRQ 4$f 7KH FRQVHUYHG FOHDYDJH VHTXHQFH 9;;4$*6(f KDV EHHQ IRXQG LQ ERWK VLWHV ZKLFK ZHUH 94/4* EHWZHHQ WKH 1,D DQG WKH 1LE SURWHLQV DQG :/4$ EHWZHHQ WKH 1LE DQG WKH &3 SURWHLQV $QDO\VLV RI WKH 1LE 3URWHLQ 7KH 1LE SURWHLQ RI 'V09 FRQWDLQHG WKH FRQVHQVXV VHTXHQFH PRWLI 6*;;;7;;;17DDf*'' 7KLV SRO\PHUDVH PRWLI ZDV IRXQG LQ WKH 'V09 1LE SURWHLQ

PAGE 59

EHJLQQLQJ DW DPLQR DFLG UHVLGXH RI WKH VHTXHQFH $ VHFRQG FRQVHQVXV PRWLI <&+$'*6 ZDV SUHVHQW LQ WKH 1LE SURWHLQ DW DPLQR DFLG SRVLWLRQV WR 7KH VLPLODULW\ RI WKH 'V09 1LE SURWHLQ WR WKRVH RI RWKHU SRW\YLUXVHV UDQJHG IURP b WR b DW WKH QXFOHRWLGH OHYHO 7DEOH f DQG IURP b WR b DW WKH DPLQR DFLG OHYHO 7DEOH f UHVSHFWLYHO\ $ SK\ORJHQHWLF WUHH ZDV REWDLQHG IURP WKH DOLJQPHQW RI SXWDWLYH 1LE SURWHLQV RI 'V09&KL DQG RWKHU SRW\YLUXVHV )LJ f RQ WKH SUHPLVH WKDW WKLV SURWHLQ LV WKH PRVW FRQVHUYHG RQH DPRQJ DOO WKH SRW\YLUXVHV 6KXNOD DW DO f 7KRXJK 'V09 ZDV GLVWLQFW IURP RWKHU SRW\YLUXVHV LW ZDV FORVHO\ UHODWHG WR =<09 LQ WKH %&09 VXEJURXS 7KH SRW\YLUXVHV 6E09 DQG :09 ZHUH FOXVWHUHG WRJHWKHU FRQILUPLQJ WKHLU FORVH UHODWLRQVKLS 6KXNOD HW DO f ,W LV LQWHUHVWLQJ WR QRWH WKDW DOO SRW\YLUXVHV H[FHSW WKRVH LQ WKH %&09 VXEJURXS ZHUH FOXVWHUHG WRJHWKHU 7KH SXWDWLYH DPLQR DFLG VHTXHQFH RI WKH 1LE SURWHLQ RI 'V09&KO ZDV XVHG WR SUHSDUH D K\GURSKRELFLW\ SORW DFFRUGLQJ WR WKH PHWKRG RI .\WH t 'RROLWWOH f )LJf 7KH 1WHUPLQDO DQG &WHUPLQDO UHJLRQV RI WKLV SURWHLQ DUH K\GURSKLOLF ZKLOH LQ WKH FHQWUDO UHJLRQ WKHUH LV DQ HYHQ GLVWULEXWLRQ RI K\GURSKLOLF DQG K\GURSKRELF UHJLRQV (DFK RI WKHVH UHJLRQV FRQVLVWV RI DERXW DPLQR DFLGV VXJJHVWLQJ WKH WUDQVPHPEUDQH SURSHUW\ RI WKH 1LE SURWHLQ $QDO\VLV RI WKH &RDW 3URWHLQ 7KH FRDW SURWHLQ RI 'V09&KL DOVR VKRZHG D UHODWLYHO\ KLJK GHJUHH RI VLPLODULW\ ZLWK WKRVH RI RWKHU SRW\YLUXVHV 7DEOH f 7KH VLPLODULW\ UDQJHG IURP b WR b DW WKH

PAGE 60

7DEOH 3HUFHQW QXFOHRWLGH LGHQWLW\ RI 1LE JHQHV RI 'V09&KO DQG RWKHU SRW\YLUXVHV 9LUXV 3HUFHQW VLPLODULW\n 'V09&KO %&09 6E09 36W9 :09 =<09 39<1 7(9 36E09 35693 7809 7909 6&09 %<09 339 1DPH DQG DEEUHYLDWLRQV RI WKH YLUXVHV XVHG LQ WDEOH %&09 EHDQ FRPPRQ PRVDLF YLUXV %<09 EHDQ \HOORZ PRVDLF YLUXV 'V09&KO GDVKHHQ PRVDLF YLUXV &KL LVRODWH 339 SOXP SR[ YLUXV 36E09 SHD VHHGERUQH PRVDLF YLUXV 35693 SDSD\D ULQJVSRW YLUXV W\SH 3 36E09 SHD VHHGERUQH PRVDLF YLUXV 36W9 SHDQXW VWULSH YLUXV 39<1 WKH 1 VWUDLQ RI SRWDWR YLUXV < 6E09 VR\EHDQ PRVDLF YLUXV 6&09 VXJDUFDQH PRVDLF YLUXV 7(9 WREDFFR HWFK YLUXV 7X09 WXUQLS PRVDLF YLUXV 7909 WREDFFR YHLQ PRWWOLQJ YLUXV :09 ZDWHUPHORQ PRVDLF YLUXV =<09 ]XFFKLQL \HOORZ PRVDLF YLUXV 3HUFHQW VLPLODULW\ RI 1LE JHQHV DPRQJ WKH 'V09&KO DQG RWKHU SRW\YLUXVHV ZDV REWDLQHG E\ 3LOHXS LQ WKH *&* SURJUDP SDFNDJH

PAGE 61

7DEOH 3HUFHQW VLPLODULW\ RI WKH 1LE SURWHLQ WKH FRDW SURWHLQ DQG WKH f QRQFRGLQJ UHJLRQ f1&5f RI 'V09&KO DQG RWKHU SRW\YLUXVHV 3HUFHQW VLPLODULW\ 9LUXVn 1LE &3 f1&5 'V09&KO %&09 6E09 36 WY :09 =<09 39<1 7(9 36E09 35693 7X09 7909 6&09 %<09 339 1DPH DQG DEEUHYLDWLRQV RI WKH YLUXVHV XVHG LQ WDEOH %&09 EHDQ FRPPRQ PRVDLF YLUXV %<09 EHDQ \HOORZ PRVDLF YLUXV 'V09&KO GDVKHHQ PRVDLF YLUXV &KL LVRODWH 339 SOXP SR[ YLUXV 36E09 SHD VHHGERUQH PRVDLF YLUXV 35693 SDSD\D ULQJVSRW YLUXV W\SH 3 36E09 SHD VHHGERUQH PRVDLF YLUXV 36W9 SHDQXW VWULSH YLUXV 39<1 1 VWUDLQ RI SRWDWR YLUXV < 6E09 VR\EHDQ PRVDLF YLUXV 6&09 VXJDUFDQH PRVDLF YLUXV 7(9 WREDFFR HWFK YLUXV 7X09 WXUQLS PRVDLF YLUXV 7909 WREDFFR YHLQ PRWWOLQJ YLUXV :09 ZDWHUPHORQ PRVDLF YLUXV =<09 ]XFFKLQL \HOORZ PRVDLF YLUXV 3HUFHQW VLPLODULW\ RI WKH 1LE WKH &3 DQG WKH f1&5 EHWZHHQ WKH 'V09&KO DQG RWKHU SRW\YLUXVHV ZDV REWDLQHG E\ *DS LQ WKH *&* SURJUDP SDFNDJH

PAGE 62

6E09 :09 %&09 36W9 =<09 'V09&KO 36E09 6&09 7(9 7X09 339 %<09 7909 39<1 f§ 35693 )LJ 3K\ORJHQHWLF WUHH REWDLQHG IURP WKH DOLJQPHQW RI SXWDWLYH SRO\PHUDVHV EHWZHHQ 'V09&KO DQG RWKHU SRW\YLUXVHV XVLQJ WKH 3$83 SURJUDP 7KH WUHH LV WKH ERRWVWUDS b PDMRULW\UXOH FRQVHQVXV WUHH 7KH QXPEHU DERYH D JLYHQ EUDQFK UHIHUV WR EUDQFK OHQJWK 9HUWLFDO GLVWDQFHV DUH DUELWUDU\ DQG KRUL]RQWDO GLVWDQFHV UHIOHFW QXPEHU DPLQR DFLG GLIIHUHQFHV EHWZHHQ EUDQFK QRGHV

PAGE 63

)LJ +\GURSKRELFLW\ SORW RI WKH 1LE SURWHLQ VHTXHQFH RI 'V09&KO 7KH KRUL]RQWDO VFDOH LQGLFDWHV DPLQR DFLG UHVLGXHV LQ WKH 1LE SURWHLQ 7KH K\GURSKRELFLW\ YHUWLFDOf VFDOH LV WKDW RI .\WH DQG 'RROLWWOH f ZLWK K\GURSKRELF DPLQR DFLGV DERYH WKH PLGOLQH DQG K\GURSKLOLF DPLQR DFLGV EHORZ WKH PLGOLQH

PAGE 64

7DEOH 3HUFHQW QXFOHRWLGH LGHQWLW\ RI &3 JHQHV RI WZR 'V09 LVRODWHV DQG RWKHU SRW\YLUXVHV 3HUFHQW VLPLODULW\ 9 8O! 'V09&KO 'V09/$ %&09 6E09 36W9 :09 =<09 39<1 7(9 36E09 35693 7X09 7909 6&09 %<09 339 1DPH DQG DEEUHYLDWLRQV RI WKH YLUXVHV XVHG LQ WDEOH %&09 EHDQ FRPPRQ PRVDLF YLUXV %<09 EHDQ \HOORZ PRVDLF YLUXV 'V09&KO GDVKHHQ PRVDLF YLUXV &KL LVRODWH 'V09/$ GDVKHHQ PRVDLF YLUXV /$ LVRODWH 339 SOXP SR[ YLUXV 35693 SDSD\D ULQJVSRW YLUXV W\SH 3 36E09 SHD VHHGERUQH PRVDLF YLUXV 36W9 SHDQXW VWULSH YLUXV 39<1 1 VWUDLQ RI SRWDWR YLUXV < 6E09 VR\EHDQ PRVDLF YLUXV 6&09 VXJDUFDQH PRVDLF YLUXV 7(9 WREDFFR HWFK YLUXV 7X09 WXUQLS PRVDLF YLUXV 7909 WREDFFR YHLQ PRWWOLQJ YLUXV :09 ZDWHUPHORQ PRVDLF YLUXV =<09 ]XFFKLQL \HOORZ PRVDLF YLUXV 3HUFHQW VLPLODULW\ RI &3 JHQHV DPRQJ WKH 'V09&KO DQG RWKHU SRW\YLUXVHV ZDV REWDLQHG E\ 3LOHXS LQ WKH *&* SURJUDP SDFNDJH

PAGE 65

QXFOHRWLGH OHYHO DQG IURP b WR b DW WKH DPLQR DFLG OHYHO 7DEOH f ,QGLYLGXDO FRPSDULVRQV VKRZHG WKDW SRW\YLUXVHV VXFK DV %&09 DQG 6E09 DUH WKH PRVW FORVHO\ UHODWHG WR 'V09 DPRQJ WKRVH SRW\YLUXVHV IRU ZKLFK WKH VHTXHQFHV DUH NQRZQ $ FRPSDULVRQ RI WKH FRDW SURWHLQ RI 'V09&KL ZLWK WKDW RI 'V09/$ 3DSSX HW DO Df UHYHDOHG D VLPLODULW\ RI b DW WKH QXFOHRWLGH OHYHO DQG b DW WKH DPLQR DFLG OHYHO LQGLFDWLQJ WKDW PDQ\ RI WKH QXFOHRWLGH FKDQJHV REVHUYHG ZHUH VLOHQW 'LYHUVLW\ LQ WKH FRDW SURWHLQV RI WKH 'V09&KO DQG RWKHU SRW\YLUXVHV RFFXUUHG SUHGRPLQDQWO\ LQ VHTXHQFH DQG OHQJWK DW WKH 1WHUPLQDO UHJLRQV 6KXNOD HW DO f 7KH FRQVHUYHG SURSHUW\ RI WKH &3V DPRQJ GLIIHUHQW YLUXV VWUDLQV KDV EHHQ XVHG WR FODVVLI\ WKH SRW\YLUXVHV DQG WKHLU VWUDLQV 6KXNOD HW DO f 7ZR VRUWV RI SK\ORJHQHWLF WUHHV ZHUH REWDLQHG E\ DOLJQPHQW RI WKH FRDW SURWHLQV RI WKH &KL DQG /$ LVRODWHV RI 'V09 DQG HLWKHU IRU H[KDXVWLYH VHDUFKf RU IRU ERRWVWUDS VHDUFKf RWKHU SRW\YLUXVHV 7KH H[KDXVWLYH VHDUFK JHQHUDWHG D WUHH VKRZLQJ WKDW ERWK 'V09 LVRODWHV ZHUH FORVHO\ UHODWHG WR WKRVH LQ WKH %&09 VXEJURXS )LJ f KRZHYHU LQ WKH ERRWVWUDS b PDMRULW\UXOH FRQVHQVXV WUHH )LJ f WKH WZR 'V09 LVRODWHV ZHUH FOXVWHUHG WRJHWKHU DQG GLVWLQFW IURP RWKHU SRW\YLUXVHV $W WKH 1WHUPLQDO UHJLRQ RI WKH 'V09&KO &3 WKHUH ZDV D '$5 WULSOHW DW SRVLWLRQ WR LQ UHODWLRQ WR WKH FOHDYDJH VLWH $ VLQJOH PXWDWLRQ IURP WR $ DW WKH QXFOHRWLGH FKDQJHG WKH DPLQR UHVLGXH IURP D QRQSRODU JO\FLQH WR D EDVLF DUJLQLQH 7R FRQILUP WKLV ZDV D WUXH SRLQW PXWDWLRQ WHQ GLIIHUHQW FORQHV FRYHULQJ WKH &3 JHQH ZHUH VHTXHQFHG DQG DOO RI WKHP KDG WKLV SRLQW PXWDWLRQ

PAGE 66

%<09 39<1 339 7%9 7(9 'V09&KO 'V09/$ %&09 6E09 6&09 )LJ 3K\ORJHQHWLF WUHH REWDLQHG IURP WKH DOLJQPHQW RI FRDW SURWHLQV EHWZHHQ 'V09 LVRODWHV DQG RWKHU SRW\YLUXVHV XVLQJ WKH 3$83 SURJUDP 7KH WUHH LV WKH H[KDXVWLYH FRQVHQVXV WUHH 7KH QXPEHU DERYH D JLYHQ EUDQFK UHIHUV WR EUDQFK OHQJWK 9HUWLFDO GLVWDQFHV DUH DUELWUDU\ DQG KRUL]RQWDO GLVWDQFHV UHIOHFW QXPEHU RI DPLQR DFLG GLIIHUHQFHV EHWZHHQ EUDQFK QRGHV

PAGE 67

'V09&KO 'V09/$ & 6E09 :09 %&09 36W9 =<09 )LJ 3K\ORJHQHWLF WUHH REWDLQHG IURP WKH DOLJQPHQW RI FRDW SURWHLQV EHWZHHQ 'V09 LVRODWHV DQG RWKHU SRW\YLUXVHV XVLQJ WKH 3$83 SURJUDP 7KH WUHH LV WKH ERRWVWUDS b PDMRULW\UXOH FRQVHQVXV WUHH 7KH QXPEHU EHORZ D JLYHQ EUDQFK UHIHUV WR EUDQFK OHQJWK 9HUWLFDO GLVWDQFHV DUH DUELWUDU\ DQG KRUL]RQWDO GLVWDQFHV UHIOHFW QXPEHU RI DPLQR DFLG GLIIHUHQFHV EHWZHHQ EUDQFK QRGHV

PAGE 68

7KH f1&5 RI 'V09 VKRZHG OHVV WKDQ b KRPRORJ\ ZLWK WKRVH RI RWKHU SRW\YLUXVHV EXW KLJKHU WKDQ WKH b DPRQJ &KL DQG /$ LVRODWHV 7DEOH f $ VHDUFK IRU SRVVLEOH VHFRQGDU\ VWUXFWXUH UHYHDOHG RQO\ VKRUW VWUHWFKHV RI SRWHQWLDOO\ XQVWDEOH EDVH SDLULQJ $SKLG 7UDQVPLVVLRQ $OO WKUHH FDODGLXP LVRODWHV 'V09&KO &K DQG &K ZHUH GHWHUPLQHG WR EH WUDQVPLWWHG E\ DSKLGV IURP WKHLU RULJLQDO KRVWV WR 3 VHOORXP VHHGOLQJV 7KUHH RXW RI VL[ 3 VHOORXP SODQWV EHFDPH LQIHFWHG DIWHU DSKLG LQRFXODWLRQ ZLWK WKH &KL LVRODWH WZR RXW RI VL[ SODQWV ZLWK &K DQG RQH RXW RI VL[ SODQWV ZLWK &K DV LQGLFDWHG E\ V\PSWRP H[SUHVVLRQ DQG SRVLWLYH UHDFWLRQV LQ ,(/,6$ ([SUHVVLRQ RI WKH &3 DQG WKH 1LE *HQHV LQ ( FROL 7R H[SUHVV 'V09 &3 DV DQ LQWDFW SURWHLQ D NE '1$ IUDJPHQW ZDV REWDLQHG E\ 3&5 XVLQJ WZR YLUDO VSHFLILF SULPHUV (+ DQG (+ DQG VXEFORQHG LQWR D S(7K H[SUHVVLRQ YHFWRU WR \LHOG S(7K&3 /DUJH TXDQWLWLHV RI WKH LQVROXEOH 'V09 &3 ZHUH H[SUHVVHG E\ WKH S(7K&3 UHFRPELQDQW )LJ f 7KH H[SUHVVHG &3 SURWHLQ ZDV DERXW N'D ZKLFK FRQWDLQHG D DPLQRDFLG UHVLGXH DV D IXVLRQ SURWHLQ 3XULILFDWLRQ RI WKH H[SUHVVHG SURWHLQ ZDV IDFLOLWDWHG E\ LWV LQVROXELOLW\ 7KH SURWHLQ ZDV SDUWLDOO\ SXULILHG IURP FHOO O\VDWHV E\ VHYHUDO F\FOHV RI FHQWULIXJDWLRQ DQG ZDVKLQJ WKH SHOOHWV )XUWKHU SXULILFDWLRQ ZDV DFFRPSOLVKHG E\ SUHSDUDWLYH 6'63$*( DQG HOHFWURHOXWLRQ

PAGE 69

)LJ $QDO\VLV RI WKH 'V09 S(7K&3 H[SUHVVHG LQ ( FROL /DQH SURWHLQ VWDQGDUGV ERYLQH VHUXP DOEXPLQ N'Df JOXWDPDWH GHK\GURJHQDVH N'Df FDUERQLF DQK\GUDVH N'Df ODQHV ( FROL %/'(S/\V6 ZLWK S(7K&3 DQG KU DIWHU LQGXFLQJ E\ ,37* UHVSHFWLYHO\ /DQH ( FROL %/'(S/\V6 ZLWK S(7K YHFWRU DQG KU DIWHU LQGXFLQJ E\ ,37* 3DUWLDOO\ SXULILHG SURWHLQV ZHUH REWDLQHG E\ FHQWULIXJHG FHOO O\VDWHV RI FXOWXUHV 3URWHLQ VDPSOHV ZHUH DQDO\]HG E\ b VRGLXP GRGHF\O VXOIDWH SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV IROORZHG E\ &RRPDVVLH VWDLQLQJ 7KH H[SUHVVHG FRDW SURWHLQ RI N'D LV LQGLFDWHG E\ WKH DUURZ

PAGE 70

7KH H[SUHVVHG SURWHLQ UHDFWHG ZLWK 'V09)/ SRO\FORQDO DQWLVHUXP DQG ZLWK 37< PRQRFORQDO DQWLVHUXP :KHQ FRPSDULQJ LW WR LWV KRPRORJRXV VWDWH LQ :HVWHUQ EORWWLQJ WKH H[SUHVVHG 'V09&KO &3 ZDV VPDOOHU LQ VL]H WKDQ WKDW RI WKH QDWLYH RQH N'Df )LJ f 7KH H[SHFWHG '1$ IUDJPHQWV RI ERWK WKH LQWDFW DQG WUXQFDWHG 1LE JHQHV ZHUH REWDLQHG E\ 3&5 XVLQJ S'&3 DV WKH WHPSODWH 7KH FRUUHFW FORQHV ZHUH FRQILUPHG E\ UHVWULFWHG HQ]\PH GLJHVWLRQV DQG VHTXHQFLQJ +RZHYHU LQGXFWLRQ RI WKHVH FORQHV ZDV XQVXFFHVVIXO LQ ERWK %/'(S/
PAGE 71

)LJ :HVWHUQ EORWWLQJ DQDO\VLV RI WKH H[SUHVVHG &3 DQG QDWLYH &3 RI 'V09 ODQH H[SUHVVHG &3 ODQH H[WUDFW IURP 'V09LQIHFWHG &DODGLXP KRUWXODQXP n&DQGLGXPf &KLf ODQH H[WUDFW IURP 'V09LQIHFWHG &RORFDVLD HVFXOHQWD ODQHV H[WUDFWV IURP 'V09LQIHFWHG =DQWHGHVFKLD DHWKLRSLFD =Df ODQH KHDOWK\ 3KLORGHQGURQ VHOORXP 3URWHLQV ZHUH HOHFWURSKRUHVHG LQ D b VRGLXP GRGHF\O VXOIDWH SRO\DFU\ODPLGH JHO $IWHU HOHFWURSKRUHVLV WKH SURWHLQV ZHUH EORWWHG RQWR D QLWURFHOOXORVH PHPEUDQH DQG UHDFWHG ZLWK 'V09)/ DQWLVHUXP DQG WKHQ GHWHFWHG ZLWK SKRVSKDWDVHFRQMXJDWHG JRDW DQWLUDEELW DQWLERGLHV

PAGE 72

7DEOH &RPSDULVRQ RI WKH 'V09)/ DQWLVHUXP DQG WKH H[SUHVVHG FRDW SURWHLQ DQWLVHUXP LQ ,(/,6$ 'V09)/ $6 ([SUHVVHG &3 $6 $QWLJHQ 'V09&KO 'V09&K 'V09&K 'V09&HO 'V09; +HDOWK\ FDODGLXP 7%9 +HDOWK\ OLO\ =<09 :09 3569: 6T09 +HDOWK\ SXPSNLQ 7KH DQWLVHUD ZHUH FRPSDUHG XVLQJ ,(/,6$ DV GHVFULEHG LQ WKH WH[W 7KH DEVRUEDQFLHV $f UHSUHVHQW WKH PHDQ YDOXHV RI DW OHDVW IRXU ZHOOV 1DPH DQG DEEUHYLDWLRQV RI WKH YLUXVHV XVHG LQ WHVW 'V09 VHYHUDO LVRODWHV RI GDVKHHQ PRVDLF YLUXV 3569: SDSD\D ULQJVSRW YLUXV W\SH : 35693 SDSD\D ULQJVSRW YLUXV W\SH 3 7%9 WXOLS EUHDNLQJ YLUXV LQIHFWLQJ OLO\ :09 ZDWHUPHORQ PRVDLF YLUXV =<09 ]XFFKLQL \HOORZ PRVDLF YLUXV 6T09 VTXDVK PRVDLF FRPRYLUXV $QWLVHUXP UDEELW 1R "f DJDLQVW SXULILHG YLULRQV RI 'V09 )ORULGD WDUR LVRODWH $ER (O1LO HW DO f $QWLVHUXP UDEELW 1R f DJDLQVW ( FROL H[SUHVVHG FRDW SURWHLQ RI 'V09&KO IURP FDODGLXP LVRODWH

PAGE 73

'LVFXVVLRQ 'DVKHHQ PRVDLF YLPV DQWLVHUXP RI KLJK TXDOLW\ KDV RQO\ EHHQ VXFFHVVIXOO\ REWDLQHG WKUHH WLPHV XVLQJ YLUDO SUHSDUDWLRQV SXULILHG IURP LQIHFWHG SODQWV $ER (O1LO HW DO .RVLWUDWDQD 6KLPR\DPD HW DO f 0RVW RWKHU ZRUNHUV HLWKHU IDLOHG WR SXULI\ WKH YLPV +DNNDDUW t :DWHUUHXV 6DP\Q t :HOYDHUW f RU FRXOG QRW HOLPLQDWH KRVW FRQWDPLQDQWV WKDW LQWHUIHUHG ZLWK VHURORJLFDO WHVWV 5RGRQL t 0RUDQ f 'XULQJ WKH LQLWLDO H[SHULPHQWV LQ WKLV VWXG\ VHYHUDO GLIIHUHQW YLPV SXULILFDWLRQ PHWKRGV LQFOXGLQJ RQH GHVFULEHG E\ $ER (O1LO HW DO f ZHUH WULHG DOVR ZLWKRXW PXFK VXFFHVV 7KH LVRS\FQLF PHWKRGV XVLQJ HLWKHU SKRVSKDWH RU +(3(6 EXIIHUV ZHUH OHVV HIILFLHQW LQ SUHYHQWLQJ LUUHYHUVLEOH YLPV DJJUHJDWLRQ GXULQJ WKH H[WUDFWLRQ SURFHVV DQG LQ UHYHUVLQJ YLPV DJJUHJDWLRQ GXULQJ 3(* SUHFLSLWDWLRQ 3UHFLSLWDWHG YLULRQV WKXV ZHUH QRW UHVXVSHQGHG DQG ZHUH ORVW GXULQJ VXEVHTXHQW ORZ VSHHG FHQWULIXJDWLRQ ,Q WKLV VWXG\ XOWUDFHQWULIXJDWLRQ XVLQJ SKRVSKDWH EXIIHU ZDV XVHG VXFFHVVIXOO\ WR SXULI\ 'V09 LQ FRQMXQFWLRQ ZLWK FHVLXP VXOIDWH GHQVLW\ JUDGLHQW FHQWULIXJDWLRQ 3KLORGHQGURQ VHOORXP ZDV WKH RQO\ KRVW IURP ZKLFK WKH YLPV ZDV SXULILHG 7KH YLPV FRXOG RQO\ EH SXULILHG IURP WKH ILUVW WZR V\PSWRPDWLF OHDYHV RI LQRFXODWHG 3 VHOORXP VHHGOLQJV KRZHYHU EHFDXVH WKH YLPV WLWHUV LQ WKH VXEVHTXHQWO\ IRUPHG OHDYHV GURSSHG FRQVLGHUDEO\ 7KH \LHOGV RI 'V09 SURGXFHG LQ WKLV VWXG\ ZHUH PJ J RI WLVVXH :H ZHUH XQVXFFHVVIXO LQ SXULI\LQJ 'V09 IURP RWKHU KRVWV FDODGLXP FDOOD OLO\ FRFR\DP DQG WDURf GHVSLWH WKH KLJK YLPV WLWHUV LQ WKHVH KRVWV EDVHG RQ WKH GHWHFWLRQ RI QXPHURXV YLPV SDUWLFOHV LQ QHJDWLYHO\ VWDLQHG OHDI H[WUDFWV 7KLV ODFN RI VXFFHVV FDQ EH DWWULEXWHG WR WKH KLJKO\ YLVFRXV

PAGE 74

QDWXUH RI OHDI H[WUDFWV RI WKHVH KRVWV ZKLFK DV LQ RWKHU UHSRUWV +DNNDDUW t :DWHUUHXV 6DP\Q t :HOYDHUW f LQWHUIHUHG ZLWK SXULILFDWLRQ +RZHYHU LW KDV EHHQ UHSRUWHG WKDW 'V09 NRQMDN PRVDLF DQG &09 ZHUH SXULILHG IURP $PRUSKRSKDOOXV NRQMDN 6KLPR\DPD HW DO f $OVR 'V09 DQG DQ XQLGHQWLILHG LVRPHWULF YLUXV ZHUH SXULILHG IURP 3LQH ,OLD &KHQ SHUVRQDO FRPPXQLFDWLRQf 7KH YLUDO 51$ LVRODWHG E\ WKH SKHQROFKORURIRUP H[WUDFWLRQ \LHOGHG PRUH LQWDFW 'V09 51$ WKDQ WKH VXFURVH JUDGLHQW PHWKRG ZKLFK LV DQ LPSRUWDQW IDFWRU WR FRQVLGHU ZKHQ HVWDEOLVKLQJ D F'1$ OLEUDU\ IRU D YLUXV 7KH VHTXHQFH GDWD RI WKH fWHUPLQDO UHJLRQ RI 'V09&KO VXSSRUW WKDW LW LV D GLVWLQFW PHPEHU RI WKH JHQXV 3RW\YLUXV LQ WKH IDPLO\ 3RW\YLULGDH VLQFH WKH VLPLODULWLHV RI WKH YLUXV ZLWK RWKHU SRW\YLUXVHV ZHUH WR b ZLWK WKH 1LE SURWHLQV b ZLWK WKH FRDW SURWHLQV DQG OHVV WKDQ b ZLWK WKH f1&5V UHVSHFWLYHO\ 7DEOH f &RPSDULVRQ RI 1LE SURWHLQV DQG FRDW SURWHLQV RI 'V09 DQG RWKHU SRW\YLUXVHV UHYHDOHG D FORVH UHODWLRQVKLS RI 'V09 ZLWK WKRVH LQ WKH %&09 VXEJURXS 7KH SK\ORJHQHWLF WUHHV REWDLQHG E\ DOLJQPHQW RI WKH FRDW SURWHLQV XVLQJ WZR H[KDXVWLYH DQG ERRWVWUDS VHDUFKHV ZHUH QRW WKH VDPH KRZHYHU LQGLFDWLQJ WKDW GLIIHUHQFHV H[LVW EHWZHHQ GLIIHUHQW VHDUFK SURJUDPV ,W LV LQWHUHVWLQJ WR QRWH WKDW DOO SRW\YLUXVHV H[FHSW 'V09 DQG WKRVH LQ WKH %&09 VXEJURXS ZHUH FOXVWHUHG WRJHWKHU LQ RQH JURXS RQ WKH EDVLV RI WKH 1LE SURWHLQV DQG WKH FRDW SURWHLQV )LJ t UHVSHFWLYHO\f 7ZR SURWHRO\WLF FOHDYDJH VLWHV DW WKH &WHUPLQDO UHJLRQ RI WKH 'V09&KO ZHUH LGHQWLILHG 7KH SURWHDVH UHVSRQVLEOH IRU WKH FOHDYDJH DW WKHVH VLWHV LV WKH 1,D SURWHDVH &RPSDULVRQ RI GHWHUPLQHG DQG SUHGLFWHG FOHDYDJH VLWHV LQ WKH &WHUPLQDO KDOYHV RI WKH SRW\YLUDO

PAGE 75

SRO\SURWHLQV UHYHDOHG WKDW WKH 1$ SURWHLQ FOHDYHV DW WKH 4$ 4* 46 47 49 RU 4( GLSHSWLGH VHTXHQFHV 'RXJKHUW\ t &DUULQJWRQ 6KXNOD HW DO f )XUWKHU FRPSDULVRQ RI WKH SRW\YLUDO FOHDYDJH VLWHV UHYHDOHG D FRQVHUYHG VHTXHQFH 9;;4$ 6 (f DURXQG WKH 1,D SURWHDVH FOHDYDJH VLWHV %DVHG RQ WKHVH UXOHV WZR SXWDWLYH FOHDYDJH VLWHV ZHUH LGHQWLILHG LQ WKH VHTXHQFHG UHJLRQ RI 'V09 7KH VHTXHQFH 9;/4* ZDV IRXQG DURXQG WKH FOHDYDJH VLWH RI WKH 1,D DQG WKH 1LE SURWHLQV DQG WKH VHTXHQFH 9;/4$ ZDV IRXQG DURXQG WKH FOHDYDJH VLWH RI WKH 1LE DQG WKH FRDW SURWHLQV 7KLV FRQVHUYHG FOHDYDJH VHTXHQFH KDV DOVR EHHQ IRXQG LQ 6E09 -D\DUDP HW DO f %&09 LVRODWHV .KDQ HW DO f DQG 36W9 *XQDVLQJKH HW DO f VXJJHVWLQJ D FORVH UHODWLRQVKLS DPRQJ WKHVH YLUDO SURWHDVHV &RPSDULVRQ RI 1LE SURWHLQV RI GLIIHUHQW SRW\YLUXVHV KDYH UHYHDOHG WKDW WKLV SURWHLQ LV WKH PRVW FRQVHUYHG RI WKH LQGLYLGXDO SRW\YLUDO SURWHLQV 6KXNOD HW DO f 7KH '609&KO 1LE SURWHLQ LV b VLPLODU WR WKH DQDORJRXV SURWHLQV RI WKH PHPEHUV LQ WKH %&09 VXEJURXS DQG b VLPLODU WR WKH RWKHU SRW\YLUXVHV FRPSDUHG 7DEOH f 7KH 1LE SURWHLQ RI SRW\YLUXVHV FRQWDLQV WKH FRQVHUYHG PRWLI 6*;;;7;;;17DD*'' ZKLFK LV FRQVHUYHG LQ ERWK DQLPDO DQG SODQW SRVLWLYHVWUDQGHG YLUDO 51$GHSHQGHQW 51$ SRO\PHUDVH .DPHU t $UJRV f 7KLV PRWLI ZDV SUHVHQW LQ WKH 1LE SURWHLQ RI 'V09 DV 6*4367:'17DD*'' LQ D SRVLWLRQ DQDORJRXV WR WKDW RI RWKHU VHTXHQFHG SRW\YLUXVHV ZKHQ WKH\ ZHUH DOLJQHG DFFRUGLQJ WR WKH VHTXHQFHG KRPRORJ\ $ VHFRQG FRQVHQVXV PRWLI <&'$'*6 ZKLFK LV DOVR EHOLHYHG WR EH LQYROYHG LQ WKH SXWDWLYH SRO\PHUDVH DFWLYLW\ $OOLVRQ HW DO 'RPLHU HW DO f ZDV SUHVHQW LQ WKH 1LE SURWHLQ RI 'V09 DV <&+$'*6 :KHQ FRPSDUHG ZLWK RWKHU SRW\YLUXVHV WKH PRWLI <&+$'*6 LV SUHVHQW LQ WKH 1LE SURWHLQV LQ

PAGE 76

WKH PHPEHUV RI WKH %&09 VXEJURXS ZKLOH WKH PRWLI <&'$'*6 DUH SUHVHQW LQ DOO WKH RWKHU SRW\YLUXVHV FRPSDUHG 7KH &3 VHTXHQFHV RI SRW\YLUXVHV DUH KLJKO\ FRQVHUYHG WKURXJKRXW PRVW RI WKH VHTXHQFH EXW GLYHUJH LQ VHTXHQFH DQG OHQJWK DW WKH 1WHUPLQDO UHJLRQ 7KH &3 VHTXHQFH RI 'V09&KO LV DSSUR[LPDWHO\ b VLPLODU WR WKRVH RI WKH %&09 VXEJURXS DQG UDQJHG IURP WR b VLPLODU WR WKRVH RI RWKHU SRW\YLUXVHV FRPSDUHG 7KH 'V09 LVRODWHV GLVSOD\HG KLJKHU OHYHOV RI KRPRORJ\ LQ WKH &3 VHTXHQFHV bf )URP SK\ORJHQHWLF DQDO\VLV XVLQJ 3$83 LW LV FOHDU WKDW 'V09 LV D GLVWLQFW YLUXV DOEHLW UHODWLYHO\ FORVH WR WKH SRW\YLUXVHV LQ WKH %&09 VXEJURXS $FFRUGLQJ WR WKH &3 VHTXHQFH 'V09&KO ZDV QRW H[SHFWHG WR EH DSKLG WUDQVPLVVLEOH VLQFH LW GLG QRW KDYH WKH '$* VHTXHQFH LQ WKH 1WHUPLQXV SRUWLRQ RI WKH &3 DV LV W\SLFDO IRU DSKLGWUDQVPLVVLEOH SRW\YLUXVHV +DUULVRQ t 5RELQVRQ f ,QVWHDG LW KDG WKH '$5 DW WKH 1WHUPLQDO UHJLRQ RI WKH FRDW SURWHLQ +RZHYHU ZKHQ WKH DSKLG WUDQVPLVVLRQ WHVWV ZHUH FRQGXFWHG XVLQJ 'V09&KO IURP WKH LQIHFWHG FDODGLXP DV YLUXV VRXUFH WKLV LVRODWH SURYHG WR EH DSKLG WUDQVPLVVLEOH )XUWKHUPRUH ZKHQ WKH VDPH LVRODWH ZDV FORQHG E\ 573&5 IURP WKH RULJLQDO KRVW FDODGLXP FXOWLYDU &DQGLGXPff DQG VHTXHQFHG WKH WULSOHW '$* UDWKHU WKDQ '$5 ZDV SUHVHQW .RVLWUDWDQD UHSRUWHG f WKDW D &DOLIRUQLD 'V09 LVRODWH IURP &KLQHVH HYHUJUHHQ SODQWV ZDV QRW DSKLGWUDQVPLVVLEOH IURP LQIHFWHG 3 VHOORXP SODQWV WR KHDOWK\ 3 VHOORXP VHHGOLQJV ZKLFK PLJKW DOVR UHVXOWHG IURP WKH PXWDWLRQ DW WKH '$* WULSOHW ,W LV SUREDEOH WKDW PXWDWLRQ DW WKLV WULSOHW ZDV IUHTXHQW GXH WR WKH SURSDJDWLRQ RI D YDULDQW LQ 3

PAGE 77

VHOORXP VHHGOLQJV 7KLV YDULDQW PLJKW KDYH EHHQ SUHVHQW LQ WKH RULJLQDO 'V09 LQIHFWHG FDODGLXP SODQWV RU LW FRXOG KDYH EHHQ WKH UHVXOW RI D VLQJOH SRLQW PXWDWLRQ *** WR $**f 7KH DQWLVHUXP DJDLQVW WKH ( FROL H[SUHVVHG &3 RI 'V09&KO UHDFWHG ZLWK 'V09 LVRODWHV DQG RWKHU SRW\YLUXVHV WHVWHG LQ D PDQQHU VLPLODU WR WKDW RI WKH 'V09)/ DQWLVHUXP REWDLQHG E\ $ER (O1LO HW DO f 7KH 'V09 DQWLVHUD QRW RQO\ UHDFWHG ZLWK LWV KRPRORJRXV LVRODWHV EXW DOVR ZLWK PRVW SRW\YLUXVHV WHVWHG ZKLFK LQGLFDWHG WKDW WKH FORVH UHODWLRQVKLS RI 'V09 ZLWK WKHVH RWKHU SRW\YLUXVHV 7KH H[SUHVVLRQ RI WKH &3 JHQH LQ YLWUR SURYLGHG D VXLWDEOH DOWHUQDWLYH IRU REWDLQLQJ LPPXQRJHQ IRU DQWLVHUXP SURGXFWLRQ WR WKLV YLUXV ZKLFK WKXV IDU KDV EHHQ GLIILFXOW E\ FRQYHQWLRQDO PHDQV

PAGE 78

&+$37(5 9$5,$%,/,7< 2) &2$7 3527(,16 $021* ,62/$7(6 2) '$6+((1 026$,& 9,586 ,QWURGXFWLR' 0DQ\ FXOWLYDWHG DURLGV KDYH EHFRPH XELTXLWRXVO\ LQIHFWHG ZLWK GDVKHHQ PRVDLF YLUXV WKURXJKRXW WKH ZRUOG VLQFH WKH\ DUH H[FOXVLYHO\ SURSDJDWHG E\ YHJHWDWLYH PHDQV DQG WKXV FDQ KDUERU WKH YLUXV LQGHILQLWHO\ =HWWOHU t +DUWPDQ f $OWKRXJK 'V09 KDV EHHQ UHSRUWHG IURP PDQ\ FRXQWULHV WKH UHODWLRQVKLSV EHWZHHQ LVRODWHV KDYH QRW \HW EHHQ VWXGLHG H[WHQVLYHO\ $ VHYHUH 'V09 LVRODWH RI WDUR KDV EHHQ UHSRUWHG LQ )UHQFK 3RO\QHVLD -DFNVRQ f %LRORJLFDO DQG VHURORJLFDO GLIIHUHQFHV EHWZHHQ LVRODWHV ZHUH QRWLFHG LQ LQIHFWHG WDUR IURP (J\SW DQG )ORULGD $ER (O1LO HW DO f DQG EHWZHHQ )ORULGD DQG )LML LVRODWHV RI WDUR $ER (/1LO HW DO f 7KH VHURORJLFDO GLIIHUHQFH EHWZHHQ D &DOLIRUQLD LVRODWH IURP &KLQHVH HYHUJUHHQ DQG WZR LVRODWHV IURP WDUR )ORULGD LVRODWH DQG )LML LVRODWH .RVLWUDWDQD f ,W KDV EHHQ UHSRUWHG WKDW WKH HVWLPDWHG PROHFXODU ZHLJKWV RI 'V09 FRDW SURWHLQ YDULHG DPRQJ LVRODWHV IURP GLIIHUHQW KRVWV /L HW DO 3DSSX HW DO Ef DQG WKLV YDULDELOLW\ FRXOG EH DVVRFLDWHG ZLWK GLYHUVLW\ RQ WKH 1WHUPLQDO UHJLRQ RI WKH &3V 3DSSX HW DO Ef 7KH DFFXPXODWLQJ ERG\ RI NQRZOHGJH RI FRDW SURWHLQ VHTXHQFHV KDV EHHQ XVHG E\ YDULRXV DXWKRUV WR GLIIHUHQWLDWH SRW\YLUXVHV DQG WKHLU VWUDLQV &RPSDULVRQV RI WKH JURZLQJ QXPEHU RI SRW\YLUXVHV VHTXHQFHG UHYHDOHG WKDW GLVWLQFW SRW\YLUXVHV VKRZ RQO\ b

PAGE 79

VHTXHQFH KRPRORJ\ LQ WKHLU FRDW SURWHLQV ZKHUHDV WKLV KRPRORJ\ LV JUHDWHU WKDQ b DPRQJ VWUDLQV EHORQJLQJ WR WKH VDPH YLUXV 6KXNOD t :DUG f )XUWKHUPRUH WKH f QRQn FRGLQJ UHJLRQV f1&5Vf RI GLIIHUHQW SRW\YLUXVHV DOVR GLVSOD\ D KLJK GHJUHH RI VHTXHQFH YDULDWLRQ VLPLODULW\ RI b RQO\f ZKHUHDV VHTXHQFHV DUH KLJKO\ FRQVHUYHG EHWZHHQ YLUXV VWUDLQV VLPLODULWLHV RI b DQG PRUHf 5HFHQWO\ WKH FRDW SURWHLQ DQG WKH f1&5 VHTXHQFHV RI IRXU 'V09 LVRODWHV 3DSSX HW DO D /L HW DO WKLV VWXG\f DUH DYDLODEOH WR EH FRPSDUHG 0DWHULDOV DQG 0HWKRGV $QWLJHQV )ORULGD LVRODWHV RI 'V09 XVHG LQ WKLV VWXG\ ZHUH 'V09&H IURP WDUR &RORFDVLD HVFXOHQWDf DQG 'V09&KO &K &K IURP WKUHH FXOWLYDUV RI FDODGLXP &DODGLXP KRUWXODQXPf n&DQGLGXPf n&DURO\Q :KRUWRQf DQG n)ULHGD +HPSOHf UHVSHFWLYHO\ 7KH FDOOD OLO\ =DQWHGHVFKLD DHWKLRSLFDf LVRODWH 'V09=D ZDV IURP &DOLIRUQLD DQG WKH FRFR\DP ;DQWKRVRPD FDUDFf LVRODWH 'V09;F ZDV IURP 3XHUWR 5LFR 7KHVH LVRODWHV ZHUH PDLQWDLQHG LQ WKHLU RULJLQDO KRVWV WKURXJKRXW WKLV LQYHVWLJDWLRQ 7KH LVRODWHV ZHUH DOVR PDLQWDLQHG LQ PHFKDQLFDOO\ LQRFXODWHG 3 VHOORXP VHHGOLQJV WKURXJKRXW WKH VWXG\ 6\PSWRPV RI 3 VHOORXP XVXDOO\ DSSHDUHG ZHHNV DIWHU LQRFXODWLRQ DQG WKH ILUVW V\PSWRPDWLF OHDI IRUPHG DIWHU LQRFXODWLRQ ZDV URXWLQHO\ WHVWHG $QWLJHQV RI 3569: 36W9 3HS0R9 39< 7(9 :09 DQG =<09 ZHUH SURYLGHG E\ ( 3XUFLIXOO 'HSDUWPHQW RI 3ODQW 3DWKRORJ\ 8QLYHUVLW\ RI )ORULGD

PAGE 80

*DLQHVYLOOHf 7909 ZDV IURP 7 3 3LURQH 'HSDUWPHQW RI 3ODQW 3DWKRORJ\ 8QLYHUVLW\ RI .HQWXFN\ /H[LQJWRQf $ 3XHUWR 5LFDQ SDVVLRQIUXLW SRW\YLUXV %LUG HW DO f ZDV SURYLGHG E\ $ & 0RQOORU 'HSDUWPHQW RI &URS 3URWHFWLRQ 8QLYHUVLW\ RI 3XHUWR 5LFR 5LR 3LHGUDVf $OVR WHVWHG LQ WKLV LQYHVWLJDWLRQ ZHUH DQWLJHQV RI D JODGLROXV LVRODWH RI %<09 1DJHO HW DO f ELGHQV PRWWOH FROOHFWHG IURP %LGHQV SLORVD LQ WKH FDPSXV RI WKH 8QLYHUVLW\ RI )ORULGD *DLQHVYLOOHf DQG WZR VWUDLQV RI 30R9 IURP SHDQXW DQG EDPEDUUD JURXQGQXW /L HW DO f $QWLVHUD 7KH SXULILHG 'V09)/ ,J* RI $ER (O1LO HW DO f ZDV URXWLQHO\ XVHG LQ WKLV VWXG\ $QWLVHUD RI %&09 3569: 30R9 36W9 39< 7(9 :09 DQG =<09 ZHUH SURYLGHG E\ ( 3XUFLIXOO $QWLVHUD WR WKH 3XHUWR 5LFDQ SDVVLRQIUXLW SRW\YLUXV ZDV SURYLGHG E\ $ & 0RQOORU 7KH 37< SRW\YLUXV JURXS FURVV UHDFWLYH PRQRFORQDO DQWLVHUXP 37< f ZDV SXUFKDVHG IURP $JGLD ,QF (ONKDUW ,1f 3URSDJDWLRQV DQG $QDO\VLV RI 'V09 ,VRODWHV (DFK 'V09 LVRODWH LQ LWV RULJLQDO KRVW ZDV PDLQWDLQHG LQ D JUHHQKRXVH 7KH OHDI VDPSOHV ZHUH FROOHFWHG IURP LQIHFWHG SODQWV DQG WHVWHG E\ :HVWHUQ EORWWLQJ DV GHVFULEHG LQ &KDSWHU 6L[ 'V09 LVRODWHV &KL &K &K &HO ;F DQG =D ZHUH XVHG WR LQRFXODWH 3KLORGHQGURQ VHOORXP VHHGOLQJV DW WKH OHDI VWDJH LQ WKH VSULQJ PRQWKV RI (DFK

PAGE 81

LVRODWH ZDV WKHQ VHULDOO\ WUDQVIHUUHG DW OHDVW WZLFH WR DGGLWLRQDO SODQWV RI 3 VHOORXP VHHGOLQJV 7KH ILUVW V\PSWRPDWLF OHDYHV ZHUH FROOHFWHG IURP WKH LQIHFWHG SODQWV RI HDFK SDVVDJH DQG SUHSDUHG IRU :HVWHUQ EORWWLQJ (DFK LVRODWH ZDV DOVR XVHG WR LQRFXODWH WLVVXH FXOWXUHGHULYHG YLUXVIUHH SODQWV RI WDUR FRFR\DP DQG WKH FDODGLXP FXOWLYDUV n&DQGLGXPf n&DURO\Q :KRUWRQf n)ULHGD +HPSOHf DQG n5RVHEXGf 7KH OHDI WLVVXHV RI WKH LQIHFWHG SODQWV ZHUH SUHSDUHG IRU DQG WHVWHG E\ :HVWHUQ EORWWLQJ &ORQLQJ DQG 1XFOHRWLGH 6HTXHQFLQJ RI 3&5DPSOLILHG &3 *HQHV 7KH &3 JHQHV RI WKH 'V09 LVRODWHV &KL D DQG &K ZHUH REWDLQHG E\ 573&5 DV GHVFULEHG LQ &KDSWHU 7KH 'V09&KOD ZDV IURP FDODGLXP FXOWLYDU n&DQGLGXPf ZKLFK ZDV WKH VDPH KRVW IURP ZKLFK 'V09&KO ZDV LVRODWHG DQG &K ZDV IURP FDODGLXP FXOWLYDU n&DURO\Q :KRUWRQf $IWHU HOHFWURSKRUHVLV WKH GHVLUHG DPSOLILHG &3 IUDJPHQWV ZHUH LVRODWHG E\ XVLQJ 3UHS$*HQH .LW %LR5DG /DERUDWRULHV +HUFXOHV &$f OLJDWHG LQWR S*(07 YHFWRU 3URPHJD &R 0DGLVRQ :,f DQG WUDQVIRUPHG LQWR FRPSHWHQW (VFKHULFKLD FROL '+D FHOOV 7KH UHFRPELQDQW FRORQLHV ZHUH VFUHHQHG E\ WKH EOXHZKLWH FRORU UHDFWLRQ 7KH SODVPLG SUHSDUDWLRQV IURP WKH VHOHFWHG FORQHV ZHUH WKHQ VHTXHQFHG E\ WKH WHUPLQDWLRQ PHWKRG 8QWLWHG 6WDWHV %LRFKHPLFDO &OHYHODQG 2+f XVLQJ 7 63 YHFWRU SULPHUV DQG 'V09 &3VSHFLILF LQWHUQDO SULPHUV 7KH QXFOHRWLGH VHTXHQFHV ZHUH GHWHUPLQHG IRU ERWK VWUDQGV

PAGE 82

6HTXHQFH DQG &RPSDULVRQ RI WKH &3 DQG WKH f1&5 7KH QXFOHRWLGH VHTXHQFHV RI WKH FRDW SURWHLQ JHQHV DQG WKH f QRQFRGLQJ UHJLRQV RI WKUHH FDODGLXP LVRODWHV &KL &KL D &K DQG WKH WZR WDUR LVRODWHV /$ DQG 7(1 VHTXHQFHG E\ 3DSSX HW DO Ef ZHUH FRPSLOHG DQG DQDO\]HG 7KH &KOD LVRODWH ZDV FORQHG IURP WKH RULJLQDO KRVW RI WKH 'V09&KO FDODGLXP FXOWLYDU n&DQGLGXPf E\ 57 3&5 7KH OHYHO RI WKH VHTXHQFH UHODWHGQHVV ZDV FRPSDUHG XVLQJ 3LOHXS DYDLODEOH LQ WKH *&* SURJUDP SDFNDJH IURP WKH 8QLYHUVLW\ RI :LVFRQVLQ 'HYHUHX[ HW DO f 5HVXOWV 6\PSWRPV LQ 3 VHOORXP (DFK RI VL[ LVRODWHV WHVWHG LQGXFHG V\VWHPDWLF YHLQ FKORURVLV LQ WKH ILUVW DQGRU VHFRQG OHDYHV RI 3 VHOORXP DIWHU PHFKDQLFDO LQRFXODWLRQ +RZHYHU WKH LVRODWHV 'V09 &H &KL DQG &K LQGXFHG PRUH VHYHUH V\PSWRPV LQ 3 VHOORXP WKDQ WKRVH RI WKH &K ;F DQG =D LVRODWHV 7KH PLOG LVRODWHV LQGXFHG FKORURWLF VSRWV LQ WKH ILUVW V\PSWRPDWLF OHDYHV ZKHUHDV VHYHUH LVRODWHV LQGXFHG SURQRXQFHG VWXQWLQJ 6LPLODU V\PSWRP GLIIHUHQFHV DPRQJ 'V09 LVRODWHV LQ 3 VHOORXP KDYH EHHQ GHVFULEHG E\ $ER (O1LO HW DO f DQG :LVOHU HW DO f

PAGE 83

7KH &RDW 3URWHLQV RI 'V09 LQ 7KHLU 2ULJLQDO +RVWV 7KH HVWLPDWHG &3 PROHFXODU ZHLJKW 0:f RI HDFK RI VL[ 'V09 LVRODWHV IURP WKHLU RULJLQDO KRVWV YDULHG )LJ f ,Q :HVWHUQ EORWV XVLQJ 'V09 DQWLVHUXP WKH UHVSHFWLYH KLJKHVW &3 0: YDOXHV IRU WKH LVRODWHV &KL &K &K &H ;F DQG =D ZHUH DQG N'D ZKHUHDV YDOXHV IRU WKH RWKHU HOHYHQ SRW\YLUXVHV WHVWHG ZHUH PXFK ORZHU UDQJLQJ IURP N'D IRU 7(9 WR N'D IRU WKH 3XHUWR 5LFDQ SDVVLRQIUXLW YLUXV )LJ f 6LPLODU UHVXOWV ZHUH QRWLFHG ZKHQ SRO\FORQDO DQWLVHUD RI %&09 3569: 30R9 36W9 7(9 :09 =<09 DQG WKH 3XHUWR 5LFDQ SDVVLRQIUXLW SRW\YLUXV ZHUH WHVWHG ,Q UHFLSURFDO WHVWV ZLWK 'V09 DQG WZR 30R9 VWUDLQV IURP SHDQXW DQG EDPEDUUD JURXQGQXW KRPRORJRXV UHDFWLRQV ZHUH PXFK VWURQJHU WKDQ KHWHURORJRXV RQHV /LNHZLVH KRPRORJRXV UHDFWLRQV ZHUH VWURQJHU WKDQ KHWHURORJRXV UHDFWLRQV ZKHQ WZR 30R9 VWUDLQV ZHUH FRPSDUHG DJDLQVW WKH RWKHU SRW\YLUXVHV LH 3569: 36W9 7(9 :09 DQG WKH 3XHUWR 5LFDQ SDVVLRQIUXLW SRW\YLUXVf 7KH &RDW 3URWHLQV RI 'V09 ,VRODWHV LQ 2WKHU +RVWV 7KH &3 0:V FRUUHVSRQGLQJ WR WKRVH QRWHG LQ WKHLU UHVSHFWLYH RULJLQDO KRVWV ZHUH GHWHFWHG IRU HDFK RI VL[ 'V09 LVRODWHV LQIHFWLQJ 3 VHOORXP (DFK LVRODWH ZDV PDQXDOO\ LQRFXODWHG WR SODQWV RI 3 VHOORXP FDODGLXP FRFR\DP DQG WDUR )LJ f 6LPLODUO\ DIWHU WZR RU PRUH VHULDO SDVVDJHV WKURXJK PDQXDOO\ LQRFXODWHG 3 VHOORXP VHHGOLQJV UHVSHFWLYH &3 0: YDOXHV UHPDLQHG FRQVLVWHQW IRU HDFK RI WKH 'V09 LVRODWHV WHVWHG )LJ f

PAGE 84

. . )LJ :HVWHUQ EORWWLQJ DQDO\VLV RI WKH FRDW SURWHLQV RI GDVKHHQ PRVDLF YLUXV 'V09f LVRODWHV IURP WKHLU RULJLQDO KRVWV ODQH KHDOWK\ &RORFDVLD HVFXOHQWD ODQH %5/ SURWHLQ VWDQGDUG ODQH ;DQWKRVRPD FDUDF ;Ff ODQH &RORFDVLD HVFXOHQWD &Hf ODQH &DODGLXP KRUWXODQXP &DURO\Q :KRUWRQf &Kf ODQH & KRUWXODQXP n)ULHGD +HPSOHf &Kf ODQH & KRUWXODQXP n&DQGLGXPf &KLf DQG ODQH =DQWHGHVFKLD DHWKLRSLFD =Df 3URWHLQV ZHUH HOHFWURSKRUHVHG LQ D b VRGLXP GRGHF\O VXOIDWH SRO\DFU\ODPLGH JHO $IWHU HOHFWURSKRUHVLV WKH SURWHLQV ZHUH EORWWHG RQWR D QLWURFHOOXORVH PHPEUDQH DQG UHDFWHG ZLWK 'V09)/ DQWLVHUXP DQG WKHQ GHWHFWHG ZLWK SKRVSKDWDVHFRQMXJDWHG JRDW DQWLUDEELW DQWLERGLHV

PAGE 85

. . )LJ :HVWHUQ EORWWLQJ DQDO\VLV RI WKH &KL LVRODWH RI GDVKHHQ PRVDLF YLUXV 'V09 &KOf DQG RWKHU SRW\YLUXVHV ODQH KHDOWK\ 3KLORGHQGURQ VHOORXQU ODQH %5/ SURWHLQ VWDQGDUG ODQH 'V09&KO ODQH WREDFFR HWFK YLUXV ODQH SDVVLRQIUXLW SRW\YLUXV ODQH ZDWHUPHORQ PRVDLF YLUXV ODQH SDSD\D ULQJVSRW YLUXV W\SH : ODQH ]XFFKLQL \HOORZ PRVDLF YLUXV ODQH SHSSHU PRWWOH YLUXV ODQH SRWDWR YLUXV < ODQH EHDQ \HOORZ PRVDLF YLUXV JODGLROXV VWUDLQf ODQH ELGHQV PRWWOH YLUXV 3URWHLQV ZHUH HOHFWURSKRUHVHG LQ D b VRGLXP GRGHF\O VXOIDWH SRO\DFU\ODPLGH JHO $IWHU HOHFWURSKRUHVLV WKH SURWHLQV ZHUH EORWWHG RQWR D QLWURFHOOXORVH PHPEUDQH DQG UHDFWHG E\ 'V09)/ DQWLVHUXP DQG WKHQ GHWHFWHG ZLWK SKRVSKDWDVHFRQMXJDWHG JRDW DQWLUDEELW DQWLERGLHV

PAGE 86

N N N N )LJ :HVWHUQ EORWWLQJ DQDO\VLV RI WKH &KL LVRODWH RI GDVKHHQ PRVDLF YLUXV 'V09 &KOf WUDQVIHUUHG WR VHYHUDO GLIIHUHQW KRVWV ODQH %5/ SURWHLQ VWDQGDUG ODQH KHDOWK\ 3KLORGHQGURQ VHOORXP ODQH ;DQWKRVRPD FDUDF ODQH &RORFDVLD HVFXOHQWD? ODQH &DODGLXP KRUWXODQXP n&DURO\Q :KRUWRQf ODQH & KRUWXODQXP n&DQGLGXPf ODQH & KRUWXODQXP n&DQGLGXPf ODQH & KRUWXODQXP n)ULHGD +HPSOHf ODQH KHDOWK\ & KRUWXODQXP n&DQGLGXPf 3URWHLQV ZHUH HOHFWURSKRUHVHG LQ D b VRGLXP GRGHF\O VXOIDWH SRO\DFU\ODPLGH JHO $IWHU HOHFWURSKRUHVLV WKH SURWHLQV ZHUH EORWWHG RQWR D QLWURFHOOXORVH PHPEUDQH DQG UHDFWHG ZLWK 'V09)/ DQWLVHUXP DQG WKHQ GHWHFWHG ZLWK SKRVSKDWDVH FRQMXJDWHG JRDW DQWLUDEELW DQWLERGLHV

PAGE 87

. )LJ :HVWHUQ EORWWLQJ DQDO\VLV RI IRXU GDVKHHQ PRVDLF YLUXV 'V09f LVRODWHV VHULDOO\ SURSDJDWHG LQ 3KLORGHQGURQ VHOORXP VHHGOLQJV ODQH %5/ SURWHLQ PDUNHU ODQHV DQG KHDOWK\ 3 VHOORXP ODQHV &HO LVRODWH IURP &RORFDVLD HVFXOHQWD ODQHV &KL LVRODWH IURP &DODGLXP KRUWXODQXP &DQGLGXPf ODQHV ;F LVRODWH IURP ;DQWKRVRPD FDUDF DQG ODQHV &K LVRODWH IURP & KRUWXODQXP n&DURO\Q :KRUWRQf 7KH SURWHLQV ZHUH HOHFWURSKRUHVHG LQ D b VRGLXP GRGHF\O VXOIDWH SRO\DFU\ODPLGH JHO $IWHU HOHFWURSKRUHVLV WKH SURWHLQV ZHUH EORWWHG RQWR D QLWURFHOOXORVH PHPEUDQH DQG GHWHFWHG ZLWK 'V09)/ DQWLVHUXP DQG WKHQ GHWHFWHG ZLWK SKRVSKDWDVHFRQMXJDWHG JRDW DQWLUDEELW DQWLERGLHV

PAGE 88

&RPSDULVRQ RI WKH &RDW 3URWHLQ 6HTXHQFHV 7KH DOLJQPHQW RI WKH &3 VHTXHQFHV RI WKH FDODGLXP LVRODWHV &KL &KL D &K DQG WKH WDUR LVRODWHV /$ DQG 7(1 3DSSX HW DO Ef VKRZHG )LJ f 7KH DPLQR DFLG VHTXHQFHV ZHUH GHGXFHG IURP WKH QXFOHRWLGH VHTXHQFHV )LJ VKRZV WKH PXOWLSOH DOLJQPHQW RI WKH SUHGLFWHG DPLQR DFLG VHTXHQFHV IRU WKHVH 'V09 LVRODWHV 6HTXHQFH KRPRORJLHV RI &3 JHQHV DPRQJ WKHVH 'V09 LVRODWHV ZHUH b WR b DW WKH QXFOHRWLGH OHYHO DQG b WR b DW WKH DPLQR DFLG OHYHO +RZHYHU WKH &3 RI WKH /$ LVRODWH DPLQR DFLGVf ZDV DPLQR DFLGV ORQJHU WKDQ WKRVH RI WKH WKUHH RWKHU LVRODWHV VWXGLHG DPLQR DFLGV IRU LVRODWHV &KL DQG &K DQG DPLQR DFLGV IRU WKH 7(1 LVRODWH )LJ f 7KHVH GLIIHUHQFHV FDQ EH DWWULEXWHG WR D EDVH DGGLWLRQ DQG D EDVH GHOHWLRQ DW WKH fWHUPLQDO UHJLRQ RI WKH &3 JHQH RI WKH &KL &K DQG 7(1 LVRODWHV 7KH DGGLWLRQ RFFXUHG EHWZHHQ SRVLWLRQV DQG DQG FRUUHVSRQGHG WR DPLQR DFLG UHVLGXHV RI WR RI WKH &3V RI WKH &KL &K DQG 7(1 LVRODWHV 7KH GHOHWLRQ ZDV IURP IRU WKH LVRODWH 7(1f WR FRUUHVSRQGLQJ WR DPLQR DFLG UHVLGXHV IRU LVRODWH 7(1f WR RI WKH /$ LVRODWH 7KH DGGLWLRQ DQG GHOHWLRQ RFFXUUHG ZLWKLQ WKH XQXVXDO WKUHRQLQH DQG DVSDUDJLQH ULFK SRUWLRQ RI WKH 1WHUPLQDO UHJLRQ $PRQJ LVRODWHV &KL &KL D &K DQG 7(1 WKH 1WHUPLQDO UHJLRQ RI WKH FRDW SURWHLQV DSSHDUHG KLJKO\ FRQVHUYHG ERWK LQ OHQJWK DPLQR DFLGVf DQG LQ VHTXHQFH VLPLODULW\ b WR bf :KLOH WKH 1WHUPLQDO UHJLRQ RI WKH /$ LVRODWH ZDV ODUJHU LQ VL]H DPLQR DFLGVf LWV VHTXHQFH VLPLODULW\ ZDV b )XUWKHUPRUH WKH &3 FRUH DQG WKH &WHUPLQDO UHJLRQ RI WKH &KL &K /$ DQG 7(1 LVRODWHV ZHUH DOO IDLUO\ FRQVHUYHG ERWK LQ

PAGE 89

)LJ &RPSDULVRQ RI QXFOHRWLGH VHTXHQFHV RI WKH FRDW SURWHLQ &3f JHQH RI GDVKHHQ PRVDLF YLUXV LVRODWHV &KL DQG &KL D IURP &DODGLXP KRUWXODQXP n&DQGLGXPff &K IURP &DODGLXP KRUWXODQXP n&DURO\Q :KRUWRQff /$ DQG 7(1 IURP &RORFDVLD HVFXOHQWDf 1XFOHRWLGH FRGLQJ IRU WKH 1WHUPLQDO UHJLRQV RI WKH &3V DUH XQGHUOLQHG DQG WKH VWRS FRGRQV DUH VKRZQ E\ DVWHULVNV

PAGE 90

'V09/$ *&7*$7*$&$ 'V097(1 *&$*$7*$&$ 'V09&KO *&7*$7*$7$ 'V09&KOD *&7*$7*$7$ 'V09&K S&7*$7*$7$ &$*77*$7*& $***$$7&$* &$*77*$7*& $***$$&&$* &$*77*$7*& $$**$$$$$& &$*77*$7*& $***$$$$$& &$*77*$7*& $***$$*$$7 1WHUPLQXV $$&$$7$&&$ $7$$$$&$ $$7$$7$&7$ $7$$$$&$$& $$&$$7$&7$ &$$$$$&$$& $$&$$&$&7$ &$$$$$&$$& $*&$$$$$&$ &$$$$$&$$& $&&&&7*&$* &7**7**7** 7$$&$$&$&$ $$7$&&$$&$ &*$$$&$$$* $&7&&7*&$* &$$*7**7** 7$$&$$&$&$ $$7 7*$$$&$$$$ $&$&&7*&$$ &***7**7** *$$&$$&$&$ $$& 7*$$$&$$$$ $&$&&7*&$$ &***&*$7** *$$&$$&$&$ $$& 7*$$$&$$$$ $&7&&7*&$7 &***7&*7** &$$&$$&$&& $$& &&$$7$&7** 7$$&$$&$&$ $$&$&&$$7$ &&$*7$&7** 7$$&$$7$&$ $$&$&&$$&$ &&$$&$&7$$ 7$&&$$&$&$ $&&$$7$$7$ $7&&7&&$&& $$7$&7&&$& &$&&$&&&*& $$$&$$&$&$ $&7$$7$$&$ $7&&7&&$&& $$&$$&$ &*&&$&&7*7 $*$7$$&$&$ $&&$$&$$7$ $7&&7&&$&& *$&$$&$ &*&&$&&7*7 $**7$$&$&$ $&&$$&$$7$ $7&&7&&$&& $$&$*&$&7$ &$&&$&&7*& $$$7$$&$$& $&$$$&$$&$ $7&&7&&$&& *&&$&&$&&* *&**&$&&$$ $$*&77&$*$ *$&*&&$*&$ $$&$$*&$** *&&$&&$&&* $&**&$&&$$ $**&*$&$*$ *$&*&&$*&& $$&$&$&$$* *&&$&&$&&* *&**77$&$$ $**&$$&$*$ *$7$&&&*&& $$7$$*&$$* $&&$&&$&&* *&**77&&$$ $**7$*&$*$ *$7$&&&*&& $$7$$*&$$* $&&*&&$&&$ **&*&*&&$$ $$*&$$&$*$ *$&*&&**&7 $$&$$$&$$* 7$*7&&&&$& $$&$$*7*$7 $$$**7$$** $*$77*77$$ $*$7*7&$$7 7$*7&&&$$& **&$$*7*** $$$**7$$** $$*77*77$$ $*$7*7&$$& 7**7&&&$*& $*&$$*7*$* $$$**7$$** $$$77*7*$$ $*$7*77$$& 7**7&&&$*& $*&$$*7 *$* $$$**7$$** $$$77*7*$$ $*$7 *77$$& 7&*7&&&&&$ $$&$$$7*$* $$$&**$$**M$$*7**7&$$ $*$7*7&$$& )LJ a&RQWLQXHG

PAGE 91

'V09/$ *&7**&$&$$ 'V097(1 *&7**&$&$$ 'V09&KO *&7**&$&7$ 'V09&KOD *&7**&$&7$ 'V09&K *&7**&$&&$ 7$$$$7*$$& &$$*$7*$$7 &$$$$7*$$7 &$$$$&*$$7 &$$$$7*$$& $777$$7&*$ $777$$7&*$ $777$$7&*$ $777$$7&*$ $&77*$7&*$ $& &&$& $& $& $&& &$&$&$& $&&&$&$&7& $&&&$&$&7& $&&&$&$&$& *&7&*$**$7 *&77*$**$& *&77*$**$7 *&77*$**$7 *&7&*$**$7 *&$7&*$&$$ *&$7&*$7$$ *&$7 & *$7$$ *$$&$7&$&& *&$7&*$&$$ *7**$$&$7$ &7&7*7$&&7 *7**&$&$7$ 77&7*7$&&7 *7**&$&$&$ &7&7*7$&&7 *7**&$&$7$ &7&7*7$&&7 *7**&$&*7$ &7&7*7$&&7 77*&&777$* 7&$$$**&$$ 77$&&777$* 77$$$**7$$ 77$&&777$* 77$$$**7$$ 77$&&777$* 77$$$**7$$ 77$&&777$* 77$$$**7$$ *&$&$$$&&7 *$*&$*&*7* *7$&$$$&&& *$$&$*& *7 *7$&$$*&&$ *$$&$*&*&* *7$&$$*&&$ *$$&$*&*7* *7$&$$$&&$ *$$&$*&*$* $*777*$**7 &7**7$&$$7 $$77&*$**7 $7**7$&$$& $$777*$$*7 &7**7$&$$7 $$777*$$*7 &7**7$&$$7 $$777*$**7 &7**7$&$$7 *$*&$*$7*& $7$77*77$7 *$*&$*$7*& $&$77*7$$7 *$*&$*$7*& $&$7$*77$7 *$*&$*$7*& $&$7$*77$7 *$*&$*$7*& $&$77*77$7 7**$$&$7&$ &&7*$&$77$ 7**$$&$7&$ &&&*$7$7&$ 7**$$&$7&$ &&7*$7$7&$ 7*$7$7&$$& ****&77*** 7**$$&77&$ &&&*$&$7&$ &**77$$$&$ $$$7&$&$$$ &*$77*$$7$ $$$7&$&$$$ &**77*$$7$ *$$7&$&$$$ &**77*$$7$ $$$7&$&$$$ &*$77$$$&$ *$$7&$&$&$ *7*&$7777$ $$777$$$7& *7*&$7777$ $$777$$$&& $7*&$77&7$ $$777*$$7& $7*&$7777$ $$777*$$7& $7*&$7777* &$777$$$7& $&$7$77&$$ &$&&$*$*&& $&$7&77&$$ 7$&&$*$*&& $&$7$77&$$ 7$& &$*$*& & $&$7$77&$$ 7$&&$*$*&& $&$7&77&$$ 7$&&$*$*&& *&7*7&$$*$ ***$$7$7*$ *&&*77$$*$ ***$*7$&*$ *&7*7&$$*$ *$*$$7$&*$ *&7*7&$$*$ *$*$$7$&*$ *&7*7&$$*$ ***$$7$7*$ *$$7**777& $7**777**7 *$$7**777& $7**777**7 *$$7**7777 $7**777**7 *$$7**7777 $7**777**7 *$$&**777& $7**777**7 $&****&77* **7*$7*$7* $&****&77* **7*$7*$7* $&****&77* **7*$7*$7* 7*$7*$7**& $7&*$7$*7* $&****&77* **7*$7*$7* )LJ f§&RQWLQXHG

PAGE 92

'V09/$ *$7**$$$7* $7&$$$77*$ 'V097(1 *$&**$$$&* $7&$*$77*$ 'V09&KO *$&**$$$&* $7&$$$77*$ 'V09&KOD *$7**$$*7* $7&$$$77*$ 'V09&K *$&**$$$7* $7&$$$77*$ $$$$&&&$&& 77*&*7&$*$ $$$$&&&$&& 77*&*7&$*$ $$$$&&$$&& 77*&*7&$*$ $$$$&&$$&7 77*&*7&$*$ $$*$&&&$&& 77*&*7&$*$ &77$7$77*$ $&7*$*$$$7 &77$7$7&*$ $&&*$**$$7 &$7$&$77*$ $&7*$*$$$& &$7$&$77 *$ $77*$**$$& &*7$&$77*$ $&7*$*$$$7 &77$77&*&$ $&77$&*7*$ &7&$77&*&$ $7&7$&*7*$ &77$77&*&$ $777$&*7*$ &7&$7&&*&$ $&77$&*7*$ &7$$77&*&$ $&77$&*7*$ &7$7*$$*77 $$&7&7$$$$ &7$7*$**7& $$77&7$$$$ 77$7*$**7& $$77&7$$$$ &7$7*$**7& $$77&7$$$$ &7$7*$$*7& $$77&7$$*$ $$$7*$$**& &*&7*&$&77 $$$7*$$**& &*&7*&*&7& $$$7*$$**& **&7*&$&7& **$7*$$**& &*&7*&$&7& $*$7*$$**& 7*&7*&$&7& $7$&&&*77$ $$*&&*$77* 7**$*$$7*& $7$&&&*77$ $$$&&$$77* 7**$$$$7*& $7$&&&*77* $$*&&$$77* 77*$$$$7*& $7$&&&*77$ $$$&&$$77* 7&*$$$$7*& $7$&&&*77$ $$*&&*$7&* 7**$$$$7*& 7$$7*&$7&$ &7777&7*$& *&$*&$*$** 7$$7*&$7&$ &7777&7*$& *&$*&$*$** 7$$7*&$7&$ &7777&7*$& *&$*&$*$** 77$7*&$7&$ &7777&7*$& *&$*&$*$** 7$$7*&$7&$ &7777&7*$& *&$*&$*$** *&**$$$$$& &$7$&$7*&& 7$**7$7**7 *&**$*$$$& &$7$&$7*&& 7$**7$7**7 *&$*$*$$$& &*7$7$7*&& 7$*$7$&**7 *&**$*$$$& &*7$&$7*&& 7$**7$7**7 *&**$$$$$& &$7$&$7*&& 7$**$7$**7 7*&$$*7&7& *&&&**7$&* &777&*$&77 7*&$$*7&77 *&&&**7$7* &777&*$&77 7*&$$*7&7& *&&&**7$7* &7777*$&77 7*&$$*7&77 *&&&**7$7* &7777*$&77 7*&$$*7&7& *&&&**7$7* &777&*$&77 &$&&**7&&* $*&$$***$* *&$*77*&*& &$&&**7*&* $*&*$*$*$$ *&$*7&*&*& &$&&**7*&* $*&$$*$*$$ *&$*77*&*& &$&&**7*&* $*&$$*$*$$ *&$*77$&*& &*&&**7$&* $*&$$*$*$* *&$*7$*&*& 7&7$$&*77$ &&$&7$**77 *777**777* 7&&$$&*77$ &&$&7$&&77 *777**777* 7&7$$&*77$ &&$&7$**77 *777**777* 7&7$$&*77$ &&$&7$**77 *777**777* 7&7$$&*77$ &&$&7$**77 *777**777* )LJ f§&RQWLQXHG

PAGE 93

'V09/$ *$7**7$$&* 'V097(1 *$7**7$$&* 'V09&KO *$7**7$$&* 'V09&KOD *$7**7$$&* 'V09&K *$7**7$$&* $*$&*7&$&$ **$7*7&$&* $*$&*7&$&$ $*$&*7&$&$ $*$&*7&$&$ 777&*$&77& $$*&*$*$$& 777&$$&77& $$*&*$*$$& 777&$$&77& $$*&*$*$$& 777&$$&77& $$*&*$*$$& 777&$$&77& $$*&*$*$$& &&&$$&$7*& $7$&$77*&7 &&$$$7$7*& $&$&&77*&7 &&$$$&$7*& $&$&777$&7 &&$$$&$7*& $&$&777$&7 &&$$$&$7*& $&$&777$&7 $&7*$$$**& $&$&7*&$$$ $&7*$$$**& $7$&7*&$$$ $&7*$$$**& $&$&7*&$$$ $&7*$$$**& $&$&7*&$$$ $&7**$$$*& $&$&7*&$$$ 7**7*7**&$ 7&7&&$&$*7$$ &**&*7$*&* &&7&&*&$*7$$ 7**7*777&* 7&7&&*&$*7$$ 7**&*777&* 7&7&&*&$*7$$ 7**&*777&* 7&7&&*&$*7$$ )LJ f§&RQWLQXHG

PAGE 94

'V09/$ $''79'$*14 1171.7 75$$***117 171717*117 171767*117 'V097(1 7(7. 6 'V09&KO 5.1 7f§7(7. 37 'V09&KOD 7(7. 37' 'V09&K .1 6.17f§7(7. 365 1 1717171717 7111333333 $$3.$6(,3$ 1.4:3776' .*.(,9.'91 f§ 333$1f§ 7$ 7 $* 9 f 1339'f§ 97f§7 $$( *f§ 9 6733$11 77f§ 41( 59 $*76*7<693 5/1.,71.01 /3/9.*.&,/ 1/1+/,(<.3 (45',)175$ + 5 7B 5BB+ + 7+74)(9:<1 $9.5(<(/(' (40+,901*) 09:&,'1*76 3',1*$:900 6 '*1'4,(<3/ .3,9(1$.37 /54,0++)6' $$($<,(/51 $(.3<035<* f§ 6 5BB MB /,51/5'$6/ $5<$)')<(9 16.7395$5( $9$40.$$$/ 619775/)*/ 75 '*196766(1 7(5+7$.'97 310+7//*96 634r B $U )LJ &RPSDULVRQ RI DPLQR DFLG VHTXHQFHV RI FRDW SURWHLQV RI GDVKHHQ PRVDLF YLUXV LVRODWHV /$ 7(1 &KL &KL D DQG &K ,GHQWLFDO DPLQR DFLGV DUH VKRZQ E\ GDVKHV DQG JDSV DUH LQGLFDWHG E\ GRWV

PAGE 95

OHQJWK DPLQR DFLGVf DQG LQ VHTXHQFH b DW WKH DPLQR DFLG OHYHOf )LJ f 7KH RYHUDOO VHTXHQFH VLPLODULW\ RI WKH FRDW SURWHLQV ZDV TXLWH KLJK DQG FRPSDUDEOH WR LGHQWLWLHV REVHUYHG EHWZHHQ VWUDLQV RI D VLQJOH SRW\YLUXV VSHFLHV 6KXNOD t :DUG :DUG HW DO f 7KH f1&5 RI WKH &KL &K DQG /$ LVRODWHV ZHUH DOO VLPLODU LQ OHQJWK DQG QW UHVSHFWLYHO\f 7KH VHTXHQFH LGHQWLW\ LQ WKLV UHJLRQ UDQJHG IURP b )LJ f 'LVFXVVLRQ :HVWHUQ EORWWLQJ DQDO\VLV FRQILUPHG WKDW WKH &3 RI 'V09 LV FRQVLGHUDEO\ ODUJHU WKDQ WKRVH RI PRVW SRW\YLUXVHV $ER (O1LO HW DO f 7KH &3 0:V RI VL[ 'V09 LVRODWHV ZHUH HVWLPDWHG WR EH N'D ZKHUHDV WHQ RWKHU SRW\YLUXVHV XVHG LQ FRPSDULVRQV KDG HVWLPDWHG 0:V RI N'D LQ :HVWHUQ EORWWLQJ DQDO\VHV 7KHVH YDULDWLRQV DSSDUHQWO\ UHIOHFW JHQRPLF GLIIHUHQFHV EHWZHHQ 'V09 LVRODWHV VLQFH WKH VSHFLILF &3 0: IRU HDFK LVRODWH LV FRQVWDQW DIWHU VHULDO SDVVDJHV WKURXJK GLIIHUHQW KRVWV :KHUHDV PRVW SRW\YLUXVHV LQFOXGLQJ NRQMDN PRVDLF 6KLPR\DPD HW DO f KDYH &3 0:V RI DERXW N'D WKRVH RI 'V09 LVRODWHV KDYH YDOXHV RI N'D $ER (O1LO HW DO f VXJJHVWHG WKDW WKH KLJK &3 0: YDOXHV RI 'V09 ZDV DVVRFLDWHG ZLWK WKH 1 WHUPLQDO SRUWLRQ RI WKH FRDW SURWHLQ 7KH DYDLODELOLW\ RI WKH &3 VHTXHQFHV RI VHYHUDO 'V09 LVRODWHV 3DSSX HW DO D E WKLV VWXG\f DQG RI RWKHU SRW\YLUXVHV PD\ KHOS WR FRQILUP WKLV K\SRWKHVLV ,QGHHG WKH 'V09 &3V RI WR DPLQR DFLGV QRWHG LQ WKLV VWXG\ DUH

PAGE 96

'V09&KO $**7&7**7$ 'V09&KOD $**7&7**7$ 'V09&K $**7&7**7$ 'V09/$ $**7&7**7$ 777$7$7$$$ 777$&$7$$$ 7$7$777$$$ 7$7$777$$$ $&$*&*7**7 $&$*$*7**7 $&$*7*7*77 $&$*7*7*77 $&*7&&777 $&$77&&777 $&*7&&777 $&*7&&777 &&*&$$* &&*7$$* &&*77**7*& &&*77**7*& $$&$***&&* $&$*77$77* $$&$**&& $&$*77$77* $$&$**&& $&$*77$77* $$&$*$*$ &&$&77$7&* *7$77*777* 7$77&$$*7$ *7$77*777* 7$77&$$*7$ *7$&7*777* 7$77&$**7$ *7$&7*777* 7777&$$*77 777&&$&&*$ 7*7**$*77* 777&&$&&*$ 7*7**$*$* 777&&$&&*$ 7*7**$*$** 777&&$&&*$ 7*7**$*$** $7*7$777*$ $$$&7$&7*$ $$$7*777*$ $$$&7$&7*$ $$$7$777** $$$&7*&7*$ $$$7$777** $$$&7*&7*$ *&*$7***&* &**7$**&*$ &&$7**&* &7*7$**&*$ *&&$&7**&* &**7$**&*$ *&&$&7**&* &**7$**&*$ *&7&*&7*77 7*7$*7777$ *&7&*&7*77 7*7$*7777$ *&7&*&7*7& 7*7$*7&77$ 7&7&*&7*7& 7*7$*7777$ *7*&7$777* *77$7$$$&7 *7*&7$777* $77$7$$$&7 *7*77$777* $77$7$$$&7 *7**7$777* $77$&$$$&7 *&777*&$& &&7$77$7&7 7*&7$7*&$7 &&7$&7$7&7 7*&7$7*&$& &&7$&7$7&7 7*&7$7*&$& &&7$&7$7&7 $&7$&7*&$& &7$&*7&$*$ $&&$&7*&$& &7$&$7&$*$ $&&$&7*&$& &7$&$7&**$ $&&$&7*&$& &7$&$7&**$ *$&*&77&*7 *&$&**7*77 *$7*&77&*7 *&$&**7*77 *$7*&77&*7 *&$&**7*77 *$7*&77&*7 *&$&**7*77 & & )LJ &RPSDULVRQ RI QXFOHRWLGH VHTXHQFHV RI WKH f1&5V RI GDVKHHQ PRVDLF YLUXV LVRODWHV &KL DQG &KL D &K DQG /$ 'RWV LQGLFDWH WKH JDSV IRU RSWLPXP DOLJQPHQW

PAGE 97

UHODWLYHO\ ODUJH IRU D SRW\YLUXV +RZHYHU WKH FDOFXODWHG &3 0:V IRU IRXU VHTXHQFHG LVRODWHV ZHUH IURP N'D ZKLFK ZHUH FORVH WR WKRVH VHHQ IRU RWKHU SRW\YLUXVHV )XUWKHUPRUH WKH HVWLPDWHG 0: RI WKH &3 H[SUHVVHG LQ ( FROL ZDV VPDOOHU N'D DV UHSRUWHG LQ FKDSWHU f WKDQ WKDW N'Df IURP LQIHFWHG SODQWV HYHQ WKRXJK WKH H[SUHVVHG &3 KDG D IXVLRQ SURWHLQ RI DPLQR DFLGV ORQJ 7KH VLPLODU GLIIHUHQFHV EHWZHHQ &3 0: N'Df REVHUYHG LQ 6'63$*( DQG WKDW FDOFXODWHG XVLQJ VHTXHQFH GDWD N'Df KDYH EHHQ UHSRUWHG IRU 35693 4XHPDGD HW DO D
PAGE 98

VHTXHQFHV RI DPLQR DFLGV WKHUHE\ LQGLFDWLQJ WKDW SUROLQH VWUHWFKHV KDG QR HIIHFW RQ WKH 0:V RI WKH SURWHLQV LQ 6'63$*( $QRWKHU SRVVLELOLW\ LV WKDW VRPH FKHPLFDO FRPSRQHQWV LQ DURLGV PD\ KDYH HIIHFWV RQ WKH PLJUDWLRQ UDWH RI WKH 'V09 &3 LQ 6'63$*( FDXVLQJ VXFK DQ DEQRUPDO EHKDYLRU 7KLV SRVVLELOLW\ FRXOG EH QRW WHVWHG KRZHYHU EHFDXVH WKH KRVW UDQJH RI 'V09 LV ODUJHO\ UHVWULFWHG WR DURLGV &OHDUO\ DWWHPSWV WR SXULI\ WKLV YLUXV IURP GLIIHUHQW DURLGV ZHUH VHULRXVO\ LPSHGHG E\ WKHLU XQXVXDOO\ YLVFRXV VDS 7KH YDULDELOLW\ RI WKH &3 0:V DPRQJ GLIIHUHQW LVRODWHV FRQWUDVWV ZLWK WKH VWXGLHV RI RWKHU SRW\YLUXV VWUDLQV VXFK DV =<09 :LVOHU f DQG 3569 GDWD QRW VKRZQf ZKLFK DSSHDU WR EH PXFK PRUH XQLIRUP LQ VL]H 6HTXHQFH DQDO\VLV RI WKH 'V09 &3V UHYHDOHG D GHOHWLRQ DQG DQ DGGLWLRQ DW WKH 1WHUPLQDO UHJLRQV RI WKH &KL &K DQG 7(1 LVRODWHV ZKLFK ZKHQ FRPSDUHG WR WKH /$ LVRODWH FRQVLVWHG RI D DPLQRDFLG GHOHWLRQ 7KH GHOHWLRQV RU GXSOLFDWLRQV DW WKH 1WHUPLQDO UHJLRQ RI WKH 'V09 &3 DPRQJ GLIIHUHQW LVRODWHV PD\ FRQWULEXWH WR WKH YDULDELOLW\ RI WKH FRDW SURWHLQ VL]HV 7KH VLJQLILFDQFH RI WKHVH GHOHWLRQV RU GXSOLFDWLRQV WR WKH HYROXWLRQ RI 'V09 KDV EHHQ GLVFXVVHG E\ 3DSSX HW DO f 6LPLODU VHTXHQFH GLYHUVLWLHV DW WKH 1WHUPLQDO UHJLRQ RI WKH &3V ZHUH DOVR UHSRUWHG IRU VWUDLQV RI 7X09 6DQR HW DO f 6&09 ;LDR HW DO f DQG %&09 .KDQHW DO f 7KH DYDLODELOLW\ RI WKH VHTXHQFHV RI WKH FRDW SURWHLQ DQG WKH f1&5 RI WKH 'V09 LVRODWHV &KL &K /$ DQG 7(1 DOORZHG DQ DVVHVVPHQW WR EH PDGH RI WKHLU UHODWLRQVKLS DW WKH VHTXHQFH OHYHO $V KDV EHHQ IRU UHSRUWHG IRU RWKHU SRW\YLUXVHV 6KXNOD HW DO f

PAGE 99

WKH DPLQR DFLG YDULDWLRQ DPRQJ WKH &3V RI WKH IRXU 'V09 LVRODWHV RFFXUV SULPDULO\ DW WKH 1WHUPLQDO UHJLRQ ZKLOH WKH VHTXHQFH RI WKH FRUH DQG &WHUPLQDO UHJLRQV DUH KLJKO\ FRQVHUYHG )LJ f 7KH &3 VHTXHQFHV RI WKHVH LVRODWHV VKRZHG VLPLODULWLHV RI b WR b ZKLFK DUH E\ FRQYHQWLRQ FRQVLGHUHG WR EH YDOXHV GHOLQHDWHG IRU VWUDLQV RI D JLYHQ YLUXV 6KXNOD HW DO f )XUWKHUPRUH WKH VLPLODULWLHV RI WKH f1&5 VHTXHQFHV RI WKH LVRODWHV &KL &K DQG /$ ZHUH b LQGLFDWLQJ WKDW WKHVH LVRODWHV DUH YHU\ FORVH WR HDFK RWKHU :H FRQILUPHG HDUOLHU VWXGLHV $ER (O1LO HW DO :LVOHU HW DO f WKDW VRPH LVRODWHV RI 'V09 FDQ LQGXFH PRUH VHYHUH VWXQWLQJ V\PSWRPV LQ 3 VHOORXP WKDQ RWKHUV EXW &3 0: LV DSSDUHQWO\ QRW FRUUHODWHG ZLWK WKLV SURSHUWLHV )RU H[DPSOH WKH UHVSHFWLYH LVRODWHV ZLWK WKH KLJKHVW DQG ORZHVW &3 0: YDOXHV 'V09;F N'Df DQG 'V09&K N'Df LQGXFHG PLOG V\PSWRPV LQ 3 VHOORXP ZKHUHDV WKH IRXU RWKHU LVRODWHV &KL &K &HO DQG =Df WKDW LQGXFHG PRUH VHYHUH VWXQWLQJ V\PSWRPV KDG LQWHUPHGLDWH &3 0:V +RZHYHU UHODWLRQVKLSV EHWZHHQ WKH V\PSWRP GLIIHUHQFHV LQ 3 VHOORXP DQG &3 VHTXHQFH VLPLODULW\ RI WKHVH LVRODWHV FRXOG QRW EH HVWDEOLVKHG VLQFH &3V RI WKH &K ;F DQG =D LVRODWHV KDYH \HW WR EH VHTXHQFHG 7KH FRDW SURWHLQ YDULDELOLW\ RI 'V09 LVRODWHV GRHV QRW DSSHDU WR FRPSURPLVH WKH DELOLW\ WR GHWHFW GLIIHUHQW 'V09 LVRODWHV VHURORJLFDOO\ $ER (O1LO HW DO f QRWHG VWURQJ SUHFLSLWLQ UHDFWLRQV EHWZHHQ LVRODWHV ZLWK RQO\ EDUHO\ SHUFHSWLEOH UHFLSURFDO VSXU IRUPDWLRQ LQ 6'6LPPXQRGLIIXVLRQ WHVWV /LNHZLVH HDFK RI WKH 'V09 LVRODWHV FRXOG

PAGE 100

UHDGLO\ EH GHWHFWHG LQ (/,6$ DQG :HVWHUQ EORW WHVWV LQ WKLV VWXG\ DV FRXOG VHYHUDO WDUR LVRODWHV RI 'V09 LVRODWHV IURP GLIIHUHQW JHRJUDSKLFDO DUHDV =HWWOHU HW DO f 'HVSLWH WKH &3 0: GLIIHUHQFHV EHWZHHQ 'V09 DQG RWKHU SRW\YLUXVHV H[FHSW WZR 30R9 VWUDLQVf UHFLSURFDO UHDFWLRQV LQ :HVWHUQ EORWWLQJ DQDO\VHV UHYHDO FORVH VHURORJLFDO UHODWLRQVKLSV 7KH XQXVXDO FRPSRVLWLRQ RI LWV &3 DSSDUHQWO\ KDG QR VLJQLILFDQW HIIHFW RQ WKH DELOLW\ RI 'V09 DQWLVHUXP WR UHDFW DJDLQVW PDQ\ RWKHU SRW\YLUXVHV )XUWKHUPRUH WKH DQWLVHUD IURP WZR GLIIHUHQW 'V09 LVRODWHV FURVVUHDFWHG ZLWK RWKHU SRW\YLUXVHV WKHUHE\ SURYLGLQJ DGGLWLRQDO HYLGHQFH WKDW WKH XQXVXDO DPLQR DFLG UHVLGXHV VWUHWFKHV DW WKH 'V09 &3 GRHV QRW FRQWDLQ HSLWRSHV HVVHQWLDO IRU GHWHFWLQJ LW VHURORJLFDOO\

PAGE 101

&+$37(5 '(7(&7,21 2) '$6+((1 026$,& 9,586 ,1 $52,' &5236 ,QWURGXFWLRQ 3ODQWV LQIHFWHG ZLWK GDVKHHQ PRVDLF YLUXV 'V09f RIWHQ H[SUHVV V\PSWRPV LQWHUPLWWHQWO\ =HWWOHU HW DO &KDVH t =HWWOHU f ZKLFK SUHVHQWV D SUREOHP IRU WKH GHWHFWLRQ RI WKH YLUXV EDVHG RQ YLVXDO V\PSWRPV DORQH $OVR 'V09 LV SHUSHWXDWHG DQG FDUULHG RYHU ORQJ GLVWDQFHV WKURXJK V\PSWRPOHVV YHJHWDWLYH SURSDJDWLQJ PDWHULDOV 'HYHORSPHQW RI UHOLDEOH DQG SUDFWLFDO PHWKRGV IRU GHWHFWLQJ 'V09 DQG HIIHFWLYH WKHUDSHXWLF SURFHGXUHV DUH HVVHQWLDO IRU WKH LQWHUQDWLRQDO PRYHPHQW RI GLVHDVHIUHH DURLG SODQWV HVSHFLDOO\ LI VHYHUH LVRODWHV DUH LQYROYHG -DFNVRQ f %LRDVVD\V JURZRXW WHVWV DQG LQGLFDWRU KRVWVf HOHFWURQ PLFURVFRS\ (0f DQG LPPXQRGLIIXVLRQ WHVWV KDYH EHHQ WKH PHWKRGV PRVW FRPPRQO\ XVHG SUHYLRXVO\ IRU WKH GHWHFWLRQ RI 'V09 =HWWOHU t +DUWPDQ f DOWKRXJK PRUH UHFHQWO\ HQ]\PHOLQNHG LPPXQRVRUEHQW DVVD\ (/,6$f LPPXQRVRUEHQW HOHFWURQ PLFURVFRS\ ,6(0f DQG LPPXQRGRW EORWWLQJ IRU 'V09 GHWHFWLRQ KDYH DOVR EHHQ XVHG +X HW DO 5RGRQL t 0RUDQ =KHQJ HW DO .R HW DO .RVLWUDWDQD f %LRDVVD\ PHWKRGV SRVH SUDFWLFDO SUREOHPV IRU 'V09 GHWHFWLRQ VLQFH WKLV YLUXV LV ODUJHO\ FRQILQHG WR SODQWV LQ WKH IDPLO\ $UDFHDH DQG VXLWDEOH LQGLFDWRU SODQWV DUH QRW UHDGLO\ DYDLODEOH =HWWOHU t +DUWPDQ f 0RUHRYHU WKH ELRDVVD\ PHWKRGV DUH ODERULRXV WLPHFRQVXPLQJ DQG UHTXLUH H[WHQVLYH JUHHQKRXVH VSDFH 0DWWKHZV f 6HHG RI 3KLORGHQGURQ VHOORXP WKH PRVW ZLGHO\ XVHG WHVW

PAGE 102

VSHFLHV LV DYDLODEOH RQO\ RQ D VHDVRQDO EDVLV DQG WKLV VSHFLHV LV QRW D ORFDO OHVLRQ KRVW 3KLORGHQGURQ YHUUXFRVXP D ORFDO OHVLRQ KRVW 7RR\DPD f LV D UHODWLYHO\ UDUH SODQW VSHFLHV DQG LW LV QRW FRPPHUFLDOO\ DYDLODEOH 7KH DQWLJHQLF SURSHUWLHV RI PDQ\ SODQW YLUXVHV PDNH LW SRVVLEOH WR GHWHFW WKHP ZLWK D KLJK GHJUHH RI VHQVLWLYLW\ DQG VSHFLILFLW\ $ QXPEHU RI VHURORJLFDO PHWKRGV VXFK DV LPPXQRGLIIXVLRQ WHVWV ,6(0 (/,6$ :HVWHUQ EORWWLQJ DQG LPPXQRGRW EORWWLQJ KDYH EHHQ GHYHORSHG IRU GHWHFWLRQ RI SODQW YLUXVHV 2YHU WKH \HDUV WKHVH WHFKQLTXHV KDYH EHHQ UHILQHG DQG WKHUH LV DQ LQFUHDVLQJ DYDLODELOLW\ RI SRO\FORQDO DQG PRQRFORQDO DQWLVHUD IRU FRQGXFWLQJ WKHVH WHVWV 6SHLJHO HW DO f 5HYHUVH WUDQVFULSWLRQ SRO\PHUDVH FKDLQ UHDFWLRQ 573&5fEDVHG DVVD\V KDYH EHHQ LQFUHDVLQJO\ XVHG IRU GHWHFWLRQ RI SODQW 51$ YLUXVHV GXH WR WKHLU KLJK VHQVLWLYLWLHV 9XQVK HW DO :HW]HO HW DO D /DQJHYHOG HW DO 5REHUWVRQ HW DO 5RMDV HW DO 5RZKDQL HW DO &ROLQHW HW DO 6PLWK HW DO f :LWK LWV UHODWLYH VLPSOLFLW\ DQG KLJK VHQVLWLYLW\ 573&5 KDV JRRG SRWHQWLDO IRU GHWHFWLQJ PLQXWH TXDQWLWLHV RI YLUXV LQ SODQW WLVVXH 'HWHUPLQDWLRQ RI WKH fWHUPLQDO UHJLRQ RI WKH 'V09 JHQRPH WKLV VWXG\f KDV SURYLGHG XV ZLWK WKH RSSRUWXQLW\ WR GHWHFW WKLV YLUXV E\ 573&5 0DWHULDOV DQG 0HWKRGV 'V09 ,VRODWHV 'V09 LVRODWHV IURP GLIIHUHQW KRVWV ZHUH FROOHFWHG DQG PDLQWDLQHG LQ JUHHQKRXVHV IRU VWXG\ 7KH FDODGLXP &DODGLXP KRUWXODQXPf FRQQV ZHUH FROOHFWHG IURP D FRPPHULDO VRXUFH LQ

PAGE 103

+LJKODQGV &RXQW\ )ORULGD &RFR\DP ;DQWKRVRPD FDUDFf FRUPV ZHUH IURP &RVWD 5LFD DQG WKH WDUR &RORFDVLD HVFXOHQWDf FRUPV ZHUH IURP 7DLZDQ /HDYHV RI ZLOG & HVFXOHQWD SODQWV ZHUH DOVR FROOHFWHG IURP WKH FDPSXV RI WKH 8QLYHUVLW\ RI )ORULGD DW *DLQHVYLOOH 7KH FDOOD OLO\ =DQWHGHVFKLD DHWKLRSLFDf SODQWV ZHUH IURP :DWVRQYLOOH &$ 'V09 LVRODWHV IURP WKHVH SODQWV ZHUH PHFKDQLFDOO\ WUDQVPLWWHG WR 3KLORGHQGURQ VHOORXP VHHGOLQJV 7KH LQIHFWHG SODQWV GHYHORSHG V\VWHPLF FKORURWLF VWUHDNLQJ DORQJ WKH YHLQV RI QHZ OHDYHV ZLWKLQ ZHHNV DIWHU LQRFXODWLRQ ,PPXQRVRUEHQW (OHFWURQ 0LFURVFRS\ 6(0, ,PPXQRVRUEHQW HOHFWURQ PLFURVFRS\ ,6(0f ZDV SHUIRUPHG E\ FKRSSLQJ D VPDOO SLHFH RI OHDI WLVVXH LQWR WLQ\ SLHFHV ZLWK D UD]RU EODGH LQ D GURS RI P0 SRWDVVLXP SKRVSKDWH EXIIHU S+ 7KH H[WUDFW ZDV LQFXEDWHG RQ D JULG IRU PLQ DQG WKHQ ULQVHG ZLWK SRWDVVLXP SKRVSKDWH EXIIHU DQG ZDWHU 'V09)/ YLULRQ DQWLVHUXP $ER (O1LO HW DO f GLOXWHG ZDV DGGHG RQ WKH JULG DQG LQFXEDWHG IRU PLQ )ROORZLQJ ZDVKLQJ SURWHLQ $ JROG ODEHOHG VROXWLRQ ZDV DSSOLHG RQ WKH JULG IRU PLQ $IWHU ZDVKLQJ WKH JULG ZDV VWDLQHG ZLWK b XUDQ\O DFHWDWH DQG YLHZHG ZLWK D +LWDFKL + WUDQVPLVVLRQ HOHFWURQ PLFURVFRSH )RU WKLQ VHFWLRQV OHDI VDPSOHV [ PPf RI 3 VHOORXP FDODGLXP DQG FRFR\DP SODQWV LQIHFWHG ZLWK 'V09 ZHUH IL[HG LQ b JOXWDUDOGHK\GH LQ 0 SRWDVVLXP SKRVSKDWH EXIIHU S+ f SRVW IL[HG ZLWK b RVPLXP WHWUR[LGH GHK\GUDWHG LQ DQ DFHWRQH VHULHV DQG HPEHGGHG LQ 6SXUUfV HSR[\ UHVLQ 6HFWLRQV ZHUH FXW ZLWK D 6RUYDOO 07% XOWUDPLFURWRPH 'X 3RQW &R :LOPLQJWRQ '(f DQG WKHQ VWDLQHG ZLWK XUDQ\O DFHWDWH DQG OHDG FLWUDWH

PAGE 104

(Q]\PHOLQNHG ,PPXQRVRUEHQW $VVD\ (/,6$f 7KH 'V09 DQWLVHUD XVHG LQ WKH (/,6$ WHVWV ZHUH WKH 'V09)/ DQWLVHUXP XVHG E\ $ER (O1LO HW DO f DQG WKH DQWLVHUXP SUHSDUHG LQ WKLV VWXG\ WR &3 H[SUHVVHG LQ (VFKHULFKLD FROL 7KH 37< FURVVUHDFWLYH PRQRFORQDO DQWLERG\ ZDV DOVR XVHG 7KH DQWLn UDEELW DQG DQWLPRXVH ,J* XVHG ZDV REWDLQHG E\ WKH 6LJPD &KHPLFDO &R 6W /RXLV 02f 7KH (/,6$ SURFHGXUH ZDV DV GHVFULEHG E\ &ODUN DQG $GDPV f 7R SXULI\ ,J* IURP WKH 'V09)/ YLULRQ DQWLVHUXP RQH PO RI DQWLVHUXP ZDV GLOXWHG LQ PO RI GLVWLOOHG ZDWHU 7KH ,J* ZDV SUHFLSLWDWHG E\ DGGLQJ DQ HTXDO YROXPH RI VDWXUDWHG DPPRQLXP VXOIDWH VROXWLRQ DQG LQFXEDWLQJ LW DW URRP WHPSHUDWXUH IRU PLQ 7KH VROXWLRQ ZDV WKHQ FHQWULIXJHG DW J IRU PLQ 7KH ,J* SUHFLSLWDWH ZDV UHVXVSHQGHG LQ PO VWUHQJWK SKRVSKDWHEXIIHUHG VDOLQH 3%6 P0 VRGLXP SKRVSKDWHSRWDVVLXP SKRVSKDWH EXIIHU S+ FRQWDLQLQJ P0 SRWDVVLXP FKORULGH DQG P0 VRGLXP FKORULGH S+ f DQG GLDO\]HG WKUHH WLPHV DJDLQVW VWUHQJWK 3%6 DW r& IRU KU 7KH ,J* ZDV WKHQ IUDFWLRQDWHG WKURXJK D '($( 6HSKDFHO FROXPQ 3KDUPDFLD 8SSVDOD 6ZHGHQf 7KH HIIOXHQW ZDV FROOHFWHG LQ IUDFWLRQV RI PO DQG PRQLWRUHG E\ D VSHFWURSKRWRPHWHU DW QP 7KH ILUVW SHDN RI SURWHLQ ZDV FROOHFWHG DQG DGMXVWHG WR 2' 3XULILHG 'V09)/ ,J* ZDV XVHG HLWKHU LPPHGLDWHO\ IRU HQ]\PH FRQMXJDWLRQ RU VWRUHG DW r& IRU XVH DV FRDWLQJ DQWLERG\ 7\SH 9,, DONDOLQH SKRVSKDWDVH 6LJPD &KHPLFDOf ZDV FHQWULIXJHG DW J IRU PLQ DQG WKH SHOOHW ZDV UHVXVSHQGHG LQ SXULILHG ,J* SUHSDUDWLRQ DW D FRQFHQWUDWLRQ RI PJPO DQG DW D UDWLR RI HQ]\PH,J*f 7KH PL[WXUH ZDV WKHQ GLDO\]HG DJDLQVW 3%6 DW r& DQG WKHQ b DTXHRXV JOXWDUDOGHK\GH ZDV

PAGE 105

DGGHG WR PDNH D ILQDO FRQFHQWUDWLRQ RI b 7KH PL[WXUH ZDV LQFXEDWHG DW URRP WHPSHUDWXUH IRU KU $IWHU GLDO\VLV ERYLQH VHUXP DOEXPLQ 6LJPD &KHPLFDOf ZDV DGGHG WR D ILQDO FRQFHQWUDWLRQ RI PJPO 7KH FRQMXJDWH ZDV VWRUHG DW r& IRU (/,6$ WHVWV ,Q LQGLUHFW (/,6$ ,(/,6$f WHVWV VDPSOHV ZHUH JURXQG LQ &(3 EXIIHU > P0 VRGLXP FDUERQDWH P0 VRGLXP ELFDUERQDWH b SRO\YLQ\O S\UUROLGRQH 393f DQG b HJJ DOEXPLQ ($f@ RU FRDWLQJ EXIIHU P0 VRGLXP ELFDUERQDWH P0 VRGLXP FDUERQDWH S+ f LQ D UDWLR RI WR DQG DGGHG WR WKH ZHOOV RI WKH 7\SH ,, SRO\VW\UHQH PLFURHOLVD SODWHV '\QDWHFK /DEV ,QF &KDQWLOO\ 9$f )RU HDFK ZHOO SL RI VDPSOH ZDV DGGHG 7KH SODWHV ZHUH LQFXEDWHG DW r& IRU KU DQG ULQVHG ZLWK IRXU PLQXWH ZDVKHV LQ 3%6 FRQWDLQLQJ b 7ZHHQ 3%67f )LIW\ SL RI'V09 DQWLERG\ GLOXWHG 'V09)/ DQWLVHUXPf RU FROL H[SUHVVHG &3 DQWLVHUXPf RU 37< f LQ HQ]\PHFRQMXJDWH EXIIHU 3%67 FRQWDLQLQJ b SRO\YLQ\O S\UUROLGRQH DQG b RYDOEXPLQf ZDV DGGHG DQG LQFXEDWHG DW r& IRU KU 7KH SODWHV ZHUH WKHQ ULQVHG IRXU WLPHV DV EHIRUH )LIW\ SL RI SJPO DQWLUDEELW ,J* IRU 'V09 SRO\FORQDO DQWLVHUDf RU DQWLPRXVH ,J* IRU PRQRFORQDO DQWLVHUXPf HDFK GLOXWHG LQ HQ]\PHFRQMXJDWH EXIIHU ZDV WKHQ DGGHG WR DSSURSULDWH ZHOOV 7KH SODWHV ZHUH LQFXEDWHG IRU KU DW r& DQG ZDVKHG WLPHV LQ 3%67 )LIW\ SL RI VXEVWUDWH S QLWURSKHQ\O GLVRGLXP SKRVSKDWH PJPO 6LJPD &KHPLFDOf LQ VXEVWU£HWH EXIIHU DW S+ b GLHWKDQRODPLQH )LVKHU 6FLHQWLILF )DLU /DZQ 1-f ZDV DGGHG WR WKH SODWHV DQG LQFXEDWHG DW URRP WHPSHUDWXUH $EVRUEDQFH UHDGLQJV QPf ZHUH WDNHQ RQ D %LRWHN DXWRPDWHG PLFURSODWH UHDGHU PRGHO (/ %LR7HN ,QVWUXPHQWV ,QF :LQRRVNL 97f DW ILIWHHQ PLQXWH LQWHUYDOV IRU KU

PAGE 106

)RU '$6(/,6$ FRDWLQJ EXIIHU SLf ZDV DGGHG WR SODWHV DQG LQFXEDWHG IRU KU DW r& 7KH SODWHV ZHUH WKHQ ZDVKHG WLPHV ZLWK 3%67 2QH KXQGUHG SL RI 'V09)/ DQWLVHUXP GLOXWHG LQ WKH HQ]\PHFRQMXJDWHG EXIIHU ZDV DGGHG WR WKH SODWHV DQG LQFXEDWHG DW r& IRU KU 7KH SODWHV ZHUH ZDVKHG IRXU WLPHV ZLWK 3%67 )LIW\ SL RI WKH SUHSDUHG DQWLJHQ ZDV DGGHG WR WKH SODWHV DQG LQFXEDWHG DW r& IRU KU 7KH SODWHV ZHUH ZDVKHG IRXU WLPHV LQ 3%67 DQG ILIW\ SL RI SKRVSKDWDVHFRQMXJDWHG 'V09 ,J* ZDV WKHQ DGGHG WR WKH SODWHV 7KH SODWHV ZHUH LQFXEDWHG DW r& IRU KU DQG ZDVKHG ILYH WLPHV LQ 3%67 7KH UHPDLQGLQJ VWHSV ZHUH DV GHVFULEHG SUHYLRXVO\ :HVWHUQ %ORWWLQJ 9LUXV ZDV GHWHFWHG E\ :HVWHUQ EORWWLQJ DV SUHYLRXVO\ GHVFULEHG /L HW DO f /HDI RU SHWLROH WLVVXH Jf ZDV PLQFHG DQG DGGHG ZYf WR 6'6 H[WUDFWLRQ EXIIHU P0 7ULV EXIIHU S+ FRQWDLQLQJ b 6'6 b JO\FHURO DQG b PHUFDSWRHWKDQROf LQ D PO PLFURI8JH WXEH 7KH VDPSOHV ZHUH ERLOHG IRU PLQ 7KH VXSHUQDWDQW ZDV VDYHG DQG VWRUHG DW r& ([WUDFWV ZHUH UXQ WKURXJK b 6'6DFU\ODPLGH JHO RQ D 0LQL3URWHDQ ,, (OHFWURSKRUHVLV &HOO %LR5DG /DERUDWRULHV ,QF 0HOYLOOH 1
PAGE 107

EORWV ZHUH VRDNHG DW URRP WHPSHUDWXUH IRU KU LQ D VROXWLRQ FRQWDLQLQJ DONDOLQH SKRVSKDWDVH FRQMXJDWHG JRDW DQWLUDEELW RU DQWLPRXVH ,J* GLOXWLRQf 7KH FRQMXJDWH ZDV GHWHFWHG ZLWK PJPO QLWUR EOXH WHWUD]ROLXP )LVKHU 6FLHQWLILF 3LWWVEXUJK 3$f DQG PJPO EURPRFKRORURLQGRO\O SKRVSKDWH )LVKHU 6FLHQWLILFf LQ GHYHORSLQJ EXIIHU S+ 0 1D+& FRQWDLQLQJ 0 0J&Of 7KH UHDFWLRQ ZDV VWRSSHG E\ ULQVLQLQJ LQ GHLRQL]HG ZDWHU 3UHVWDLQHG SURWHLQ VWDQGDUGV *LEFR %5/ *DLWKHUVEXUJ 0'f ZHUH XVHG DV PDUNHUV &RUP :RXQGLQJ 7HVW 7ZHQW\ FDODGLXP FRUPV ZHUH FXW ZLWK D UD]RU EODGH DV GHVFULEHG E\ 9XQVK HW DO IRU JODGLROXV f 3DUW Jf RI WKH FRUP WLVVXH ZDV WHVWHG LPPHGLDWHO\ E\ ,(0 DQG ,(/,6$ 7KH UHPDLQGHU RI WKH VDPSOH ZDV SXW LQWR D SDSHU EDJ DQG NHSW DW URRP WHPSHUDWXUH 7ZHQW\ GD\V ODWHU WKH FRUP WLVVXH QHDU WKH ZRXQGHG VXUIDFH ZDV WHVWHG E\ WKH VDPH PHWKRGV 5HYHUVH 7UDQVFULSWLRQ3RO\PHUDVH &KDLQ 5HDFWLRQ 573&5f 7RWDO 51$ ZDV LVRODWHG IURP OHDI WLVVXH RI HLWKHU LQIHFWHG RU KHDOWK\ SODQWV DFFRUGLQJ WR WKH IROORZLQJ PHWKRG GHVFULEHG E\ GH 9DULHV HW DO f $OO VROXWLRQV ZHUH SUHSDUHG E\ GLHWK\O S\URFDUERQDWH '(3&fWUHDWHG ZDWHU DQG DXWRFODYHG /HDI WLVVXHV Jf RI 'V09 LQIHFWHG DQG KHDOWK\ SODQWV ZHUH JURXQG LQ OLTXLG QLWURJHQ LQWR ILQH SRZGHU 7ZR YROXPHV PO YZf RI 51$ H[WUDFWLQJ EXIIHU 0 7ULV+&O S+ FRQWDLQLQJ 0 /L&O P0 ('7$ DQG b 6'6f DQG WZR YROXPHV PO YZf RI KRW SKHQRO r&f ZHUH DGGHG WR WKH IUR]HQ SRZGHU JURXQG EULHIO\ DQG WUDQVIHUUHG WR D PO PLFURWXEH 7KH WXEH ZDV KHDWHG DW

PAGE 108

r& IRU PLQ DQG FHQWULIXJHG IRU PLQ DW J LQ DQ (SSHQGRUI PLFURFHQWULIXJH %ULQNPDQQ ,QVWUXPHQWV ,QF :HVWEXU\ 1
PAGE 109

*$$77&77*$$&$&&*7*&$&ff FRUUHVSRQGLQJ WR WKH fHQG RI WKH QRQFRGLQJ UHJLRQ DQG OLQNHG DW WKH fHQG RI LW D (F5O UHVWULFWLRQ VLWH ZHUH XVHG IRU DPSOLILFDWLRQ RI WKH JHQH )RU VWDQGDUG UHDFWLRQ S0 G173V S0 RI HDFK SULPHU O[ 3&5 EXIIHU P0 7ULV +FO S+ FRQWDLQLQJ P0 .&f P0 0J&O 8 RI 7DT '1$ SRO\PHUDVH SPRO RI HDFK SULPHU DQG SL RI F'1$ SURGXFWV ZHUH XVHG LQ D WRWDO RI SL UHDFWLRQ YROXPH 7KH UHDFWLRQV ZHUH UXQ DW WKH IROORZLQJ WHPSHUDWXUHF\FOLQJ SURILOH WRXFKGRZQ 3&5f F\FOHV RI PLQ DW r& PLQ DW !r& WHPSHUDWXUH GHFOLQHV RI r& HDFK F\FOHf DQG PLQ DW r& F\FOHV RI PLQ DW r& PLQ DW r& DQG PLQ DW r& IROORZHG E\ D PLQ H[WHQVLRQ DW r& 7KH IROORZLQJ WHPSHUDWXUHF\FOLQJ SURILOH UHJXODU 3&5f ZDV DSSOLHG LQ WKH SULPDU\ UHDFWLRQV RU LQ VXEFORQLQJ RI 'V09 &3 XVLQJ SODVPLG '1$ DV WHPSODWH F\FOHV RI PLQ DW r& PLQ DW r& PLQ DW r& F\FOHV RI PLQ DW r& PLQ DW r& DQG PLQ DW r& IROORZHG E\ D PLQ H[WHQVLRQ DW r& 7HQ SL RI WKH 3&5 SURGXFWV ZHUH WKHQ UXQ RQ D b DJDURVH *LEFR %5/f HOHFWURSKRUHVLV JHO *HOV ZHUH VWDLQHG IRU PLQ ZLWK SJPO HWKLGLXP EURPLGH GHVWDLQHG LQ GHLRQL]HG ZDWHU IRU PLQ DQG SKRWRJUDSKHG RQ D 89 WUDQVLOOXPLQDWRU ZLWK D *HO 3ULQW 7RRO%R[ %LR3KRWRQLFV &R $QQ $UERU 0,f 6RXWKHUQ %ORWWLQJ 1XFOHLF DFLG SUREHV SUHSDUHG IURP 'V09 &3 IUDJPHQWV DPSOLILHG IURP SODVPLG S&3O E\ 3&5 ZHUH ODEHOHG ZLWK 3f G&73 'X 3RQW 1(1 %RVWRQ 0$f XVLQJ D 5DQGRP 3ULPHG '1$ .,7 %RHKULQJHU 0DQQKHLP ,QGLDQDSROLV ,1f DFFRUGLQJ WR WKH PDQXIDFWXUHUfV

PAGE 110

LQVWUXFWLRQV 7KH 573&5 SURGXFWV ZHUH DQDO\]HG RQ D b DJDURVH JHO 7KH JHO ZDV VRDNHG LQ PO RI VROXWLRQ 0 1D&O 1 1D2+f IRU PLQ WKHQ LQ PO RI D QHXWUDOL]HG VROXWLRQ 0 7ULV+&/ S+ 0 1D&Of DQG HTXLOLEUDWHG ZLWK O2[ VWDQGDUG VDOLQH FLWUDWH 66&f 0 1D&O 0 VRGLXP FLWUDWH S+ f 7KH 573&5 SURGXFWV ZHUH WKHQ WUDQVIHUUHG WR D 1\ORQ +\ERQG PHPEUDQH ZLWK D S SRUH VL]H $PHUVKDP ,QF $UOLQJWRQ +HLJKWV ,/f E\ EORWWLQJ LQ 2[ 66& IRU KU 1XFOHLF DFLGV ZHUH ERXQG WR WKH PHPEUDQH E\ 89 FURVVOLQNLQJ XVLQJ D 89&URVVOLQNHU )%89;/ )LVKHU 6FLHQWLILFf IRU VHF 7KH PHPEUDQH ZDV SUHK\EULGL]HG LQ D URWDWLQJ 0LQL 2YHQ 9DQJDUG ,QWHUQDWLRQDO ,QF 1HSWXQH 1-f DW r& IRU RQH KRXU ZLWK PO RI [ 66& FRQWDLQLQJ b 6'6 b 3(* DQG PJPO GHQDWXUHG VDOPRQ VSHUP '1$ $SSUR[LPDWHO\ S&LPO GHQDWXUHG SUREH ZDV DGGHG WR WKH SUHK\EULGL]DWLRQ VROXWLRQ DQG DOORZHG WR K\EULGL]H WR WKH PHPEUDQH RYHUQLJKW DW r& $IWHU K\EULGL]DWLRQ WKH VROXWLRQ ZDV VWRUHG DW r& LQ D VWHULOH WXEH DQG UHXVHG ZLWKLQ RQH PRQWK %HIRUH UHXVH WKH SUREH ZDV GHQDWXUHG E\ ERLOLQJ IRU PLQ 7KH PHPEUDQH ZDV ZDVKHG WZLFH LQ PO RI [ 66& IRU PLQ HDFK DW URRP WHPSHUDWXUH IROORZHG E\ WZR ULQVHV LQ PO RI [ 66& FRQWDLQLQJ b 6'6 DW r& IRU PLQ HDFK $ ILQDO ULQVH ZDV LQ PO RI [ 66& DW URRP WHPSHUDWXUH IRU PLQ :DVKHG PHPEUDQHV ZHUH H[SRVHG WR ;UD\ ILOP ZLWK DQ LQWHQVLI\LQJ VFUHHQ &RPSDULVRQ RI ,(/,6$ :HVWHUQ %ORW DQG 573&5 /HDI WLVVXHV IURP 'V09 LQIHFWHG FDOOD OLO\ DQG KHDOWK\ 3 VHOORXP VHHGOLQJ SODQWV ZHUH XVHG WR FRPSDUH WKH VHQVLWLYLWLHV RI ,(/,6$ :HVWHUQ EORWWLQJ DQG 573&5 )RU ,(/,6$ DQG

PAGE 111

ZHVWHUQ EORWWLQJ OHDI H[WUDFWV GLOXWHG ZLWK EXIIHU HTXDO WR PJ WLVVXHf ZHUH XVHG 7HQ SJ RI WRWDO SODQW 51$ H[WUDFW RI PJ WLVVXHf ZHUH XVHG IRU 573&5 7KH PHWKRGV IRU WKHVH WHVWV ZHUH DV WKRVH GHVFULEHG DERYH IRU HDFK RI WKH UHVSHFWLYH WHFKQLTXHV 5HVXOWV &\OLQGULFDO ,QFOXVLRQV RI 'V09 7\SH LQ F\OLQGULFDO LQFOXVLRQ ERGLHV ZLWK VFUROOV SLQZKHHOV DQG ODPLQDWHG DJJUHJDWHV DV GHVFULEHG SUHYLRXVO\ IRU 'V09 =HWWOHU HW DO f ZHUH VHHQ LQ FHOOV RI n&DQGLGXPf FDODGLXP DQG FRFR\DP LQIHFWHG ZLWK UHVSHFWLYHO\ WKH &KL DQG ;F LVRODWHV RI 'V09 )LJ f (/,6$ ,Q GLUHFW FRPSDULVRQV ,(/,6$ ZDV IRXQG WR EH PRUH VHQVLWLYH WKDQ '$6(/,6$ 7DEOH f 7KH 2' YDOXHV RI ,(/,6$ ZHUH DV PXFK DV IRXU WLPHV WKRVH RI '$6(/,6$ $OWKRXJK WKH EDFNJURXQG UHDFWLRQ ZDV ORZHU ZKHQ JJPO 'V09 ,J* ZDV XVHG XVH RI SJPO ,J* UHVXOWHG LQ VLJQLILFDQW FRQWUDVW EHWZHHQ LQIHFWHG DQG KHDOWK\ VDPSOHV ZLWKLQ D PLQ REVHUYDWLRQ WLPH 6LPLODU UHVXOWV ZHUH QRWHG LQ ,(/,6$ WHVWV UHJDUGOHVV ZKHWKHU H[WUDFWLRQ ZDV LQ FRDWLQJ EXIIHU RU &(3 EXIIHU ZDV XVHG $FFRUGLQJO\ ,(/,6$ XVLQJ &(3 DV WKH H[WUDFWLQJ EXIIHU ZDV URXWLQHO\ XVHG WR GHWHFW 'V09 LQ WLVVXH FXOWXUHGHULYHG SODQWOHWV 7KH VHQVLWLYLW\ RI ,(/,6$ ZDV YHU\ VLPLODU WR WKDW RI :HVWHUQ EORWWLQJ ZKHQ ERWK PHWKRGV ZHUH FRPSDUHG 7DEOH f (LJKW RXW RI n&DQGLGXPf RI n)ULHGD +HPSOHf

PAGE 112

)LJ (OHFWURQ PLFURJUDSK RI F\OLQGULFDO LQFOXVLRQV &Of LQGXFHG E\ D FDODGLXP LVRODWH RI GDVKHHQ PRVDLF YLUXV LQ D OHDI FHOO RI 3KLORGHQGURQ VHOORXP 7\SLFDO VFUROOV SLQZKHHOV DQG ODPLQDWHG DJJUHJDWHV ZHUH SUHVHQWHG 0DQ\ YLUXV SDUWLFOHV ZHUH LQ WKH F\WRSODVP RI WKH LQIHFWHG FHOO /$ ODPLQDWHG DJJUHJDWH 3 SLQZKHHO 6 VFUROO %DU SP r -t

PAGE 113

7DEOH $AM DEVRUEDQFH YDOXHV RI ,(/,6$ DQG '$6(/,6$ IRU 'V09 GHWHFWLRQ 7HVW 6DPSOH ,(/,6$&(3f ,(/,6$ &%f '$6(/,6$ ,(/,6$ LQGLUHFW (/,6$ DQG '$6(/,6$ GRXEOH DQWLERG\ VDQGZLFK GLUHFW (/,6$ $QWLJHQV XVHG ZHUH H[WUDFWV IURP OHDI VDPSOHV RI FDODGLXP SODQWV JURZQ RXW IURP FRPPHUFLDO FRUPV $QWLJHQV LQ EXIIHU DQG 'V09)/ DQWLVHUXP LQ EXIIHU $EVRUEDQFH UHDGLQJV ZHUH WDNHQ PLQ DIWHU DGGLQJ VXEVWUDWH 7KH DEVRUEDQFH $f YDOXH UHSUHVHQWV WKH PHDQ RI VL[ ZHOOV &(3 FRDWLQJ H[WUDFWLRQ SKRVSKDWH EXIIHU DQG &% FRDWLQJ EXIIHU

PAGE 114

7DEOH &RPSDULVRQ RI ,(/,6$ DQG :HVWHUQ EORWWLQJ SURFHGXUHV WR GHWHFW 'V09 LQ FDODGLXP OHDYHV &XOWLYDU 1R RI VDPSOHV ,(/,6$ :HVWHUQ EORWWLQJ &DQGLGXP &DQGLGXP )ULHGD +HPSOH )ULHGD +HPSOH &DURO\Q :KRUWRQ &DURO\Q :KRUWRQ &RQWURO UU WR r U ,(/,6$ ZDV SHUIRUPHG DV GHVFULEHG LQ WKH WH[W /HDI WLVVXHV RI SODQWV ZHUH JURXQG LQ &(3 EXIIHU DQG 'V09)/ DQWLVHUXP ZDV GLOXWHG LQ HQ]\PHFRQMXJDWH EXIIHU 7KH DEVRUEDQFH $f YDOXH IRU SRVLWLYH VDPSOH ZDV DW OHDVW WKUHH WLPHV KLJKHU WKDQ WKDW RI KHDOWK\ FRQWURO :HVWHUQ EORWWLQJ ZDV FDUULHG RXW DV GHVFULEHG LQ WKH WH[W /HDI WLVVXHV RI SODQWV ZHUH XVHG 'V09)/ DQWLVHUXP GLOXWHG LQ 7%67 EXIIHU ZDV XVHG WR GHWHFW 'V09 $ SURWHLQ EDQG RI WKH &3 VL]H RI HDFK LVRODWH ZDV GHWHFWHG LQ SRVLWLYH VDPSOH LQ ZHVWHUQ EORWWLQJ DQDO\VLV ZKLOH QR VXFK EDQG ZDV GHWHFWHG LQ WKH QHJDWLYH VDPSOHV RU KHDOWK\ FRQWUROV 3ODQWV XVHG DV FRQWUROV ZHUH WLVVXH FXOWXUHGHULYHG FDODGLXP SODQWV

PAGE 115

DQG RI n&DURO\Q :KRUWRQf FDODGLXP SODQWV ZHUH GHWHUPLQHG WR EH LQIHFWHG E\ ERWK PHWKRGV 'LVWULEXWLRQ RI 'HWHFWDEOH 'V09 ZLWKLQ ,QIHFWHG 3ODQWV EY ,(/,6$ /HDYHV SHWLROHV DQGRU FRUPV RI WKUHH QDWXUDOO\ LQIHFWHG KRVWV FDODGLXP WDUR DQG FRFR\DPf ZHUH FROOHFWHG DQG WHVWHG E\ ,(/,6$ XVLQJ 'V09)/ DQWLVHUXP 'V09 ZDV GHWHFWHG UHOLDEO\ LQ ERWK OHDYHV DQG SHWLROHV RI LQIHFWHG FDODGLXP SODQWV ZKLOH LQ FRFR\DP DQG WDUR SODQWV 'V09 VRPHWLPHV ZDV GHWHFWHG LQ OHDYHV EXW QRW LQ SHWLROHV RU YLFH YHUVD 7DEOH f $OWKRXJK 'V09 XVXDOO\ ZDV GHWHFWHG LQ ERWK OHDYHV DQG SHWLROHV RI LQIHFWHG FDODGLXP SODQWV LW ZDV QRW DOZD\V GHWHFWHG LQ FRUPV RI WKH VDPH SODQWV 'V09 ZDV GHWHFWHG LQ OHDYHV RI LQIHFWHG FDODGLXP SODQWV ZKHWKHU V\PSWRPV ZHUH HYLGHQW RU ODFNLQJ ,Q FRQWUDVW RQO\ V\PSWRPDWLF WLVVXHV RI LQIHFWHG FRFR\DP DQG WDUR SODQWV UHDFWHG SRVLWLYHO\ LQ ,(/,6$ :KHUHDV V\PSWRPDWLF OHDYHV RI JUHHQKRXVHJURZQ SODQWV ZHUH HYLGHQW WKURXJKRXW WKH \HDU REVHUYDWLRQ SHULRG WKRVH RI FRFR\DP DQG WDUR ZHUH HYLGHQW RQO\ LQ WKH HDUO\ VSULQJ RU ODWH IDOO PRQWKV RI HDFK \HDU &RUP :RXQGLQJ &RUP ZRXQGLQJ IDFLOLWDWHG WKH DELOLW\ WR GHWHFW 'V09 LQ FDODGLXP 6LPLODU UHVXOWV ZHUH REWDLQHG E\ 9XQVK HW DO f IRU %<09 LQ JODGLROXV :KHUHDV 'V09 ZDV GHWHFWHG E\ (/,6$ DQG ,6(0 LQ RQO\ RI XQZRXQGHG FRUPV LW ZDV GHWHFWHG LQ RI WKH VDPH FRUPV GD\V DIWHU ZRXQGLQJ 7DEOH f

PAGE 116

7DEOH 5HODWLYH GLVWULEXWLRQ RI 'V09 LQ WKUHH DURLG KRVWV DV GHWHUPLQHG E\ ,(/,6$ +RVW 1R 6DPSOHV /HDI 3HWLROH &RUP &DODGLXP &RFR\DP QW QW QW QW 7DUR QW QW QW QW &RQWURO &RUP WLVVXHV ZHUH WHVWHG EHIRUH SODQWLQJ LQ SRWV 7KH OHDI DQG SHWLROH WLVVXHV ZHUH FROOHFWHG IURP SODQWV IURP WKH WHVWHG FRUPV 'V09)/ DQWLVHUXP WHVWHG E\ ,(/,6$ DV GHVFULEHG LQ WKH WH[W ZDV XVHG 7KH DEVRUEDQFH $f YDOXH IRU SRVLWLYH VDPSOHV ZHUH DW OHDVW WKUHH WLPHV KLJKHU WKDQ WKDW RI WKH FRQWUROV QW QRW WHVWHG 3ODQWV XVHG DV FRQWUROV ZHUH WLVVXH FXOWXUHGHULYHG FDODGLXP SODQWV

PAGE 117

7DEOH (IIHFW RI ZRXQGLQJ RQ GHWHFWLRQ RI 'V09 LQ FDODGLXP FRUPV 1R RI &RUPV 8QZRXQGHG &RUP :RXQGHG &RUP ,(/,6$ ,6(0 ,(/,6$ ,6(0 &RUPV RIn)ULHGD +HPSOHf FDODGLXP ZHUH XVHG LQ WHVWV &RUPV ZHUH FXW DQG NHSW LQ D SDSHU EDJ DW URRP WHPSHUDWXUH 7KH FRUP WLVVXHV ZHUH WHVWHG LPPHGLDWHO\ EHIRUH ZRXQGLQJ DQG GD\V DIWHU ZRXQGLQJ UHSUHVHQWV WKH QXPEHU RI FRUPV ZKLFK JDYH WKH LQGLFDWHG UHDFWLRQ LQ ERWK ,(/,6$ DQG ,6(0 WHVWV )RU ,(/,6$ WHVWV WKH DEVRUEDQFH $WRV QPfRI WKH SRVLWLYH VDPSOH ZDV DW OHDVW WKUHH WLPHV KLJKHU WKDQ WKDW RI WKH KHDOWK\ FRQWURO 9LUDO SDUWLFOHV ZHUH GHWHFWHG LQ SRVLWLYH VDPSOHV EXW QRW LQ QHJDWLYH VDPSOHV E\ HOHFWURQ PLFURVFRS\ 'V09 ZDV GHWHFWHG E\ ,(/,6$ DQG ,6(0 XVLQJ 'V09)/ DQWLVHUXP

PAGE 118

573&5 IRU 'V09 'HWHFWLRQ $ '1$ IUDJPHQW RI DERXW ES ZKLFK UHSUHVHQWHG WKH &3 JHQH DQG WKH f QRQn FRGLQJ UHJLRQ ZDV UHVROYHG E\ DJDURVH JHO HOHFWURSKRUHVLV IURP LQIHFWHG FDODGLXP SODQWV 1R FRPSDUDEOH SURGXFW ZDV DPSOLILHG IURP KHDOWK\ 3 VHOORXP VHHGOLQJV )LJ f 6WURQJ DPSOLILFDWLRQ RI D VHFRQG VPDOOHU '1$ IUDJPHQW RI DERXW ES ZDV REVHUYHG ZKHQ UHDFWLRQV ZHUH UXQ DW WKH UHJXODU WHPSHUDWXUHF\FOLQJ SURILOH r& DV DQQHDOLQJ WHPSHUDWXUHf )LJ $f +RZHYHU WKH VHFRQG QRQVSHFLILF EDQG GLVDSSHDUHG ZKHQ WKH fWRXFKGRZQf WHPSHUDWXUHn F\FOLQJ SURILOH !r& DV DQQHDOLQJ WHPSHUDWXUHf ZDV DVVHVVHG )LJ %f &RPSDULVRQ EHWZHHQ 573&5 (/,6$ DQG :HVWHUQ EORWWLQJ IRU 'V09 'HWHFWLRQ ,QIHFWHG FDODGLXP DQG ILHOGFROOHFWHG FDOOD OLO\ SODQWV ZHUH XVHG WR FRPSDUH WKH VHQVLWLYLW\ RI 573&5 IRU 'V09 GHWHFWLRQ +HDOWK\ 3 VHOORXP VHHGOLQJV DQG S'&3O SODVPLG ZHUH XVHG DV QHJDWLYH DQG SRVLWLYH FRQWUROV UHVSHFWLYHO\ $Q DPSOLILHG IUDJPHQW RI WKH H[SHFWHG VL]H ZDV REWDLQHG IURP DOO LQIHFWHG FDODGLXP DQG FDOOD OLO\ VDPSOHV ZKHUHDV QR IUDJPHQW ZDV DPSOLILHG IURP WKH QHJDWLYH FRQWUROV )LJ $f 7KH UHVXOWV RI 573&5 ZHUH FRQILUPHG E\ VRXWKHUQ EORWWLQJ XVLQJ D UDGLRDFWLYH SUREH )LJ %f +RZHYHU 'V09 ZDV QRW GHWHFWHG LQ RI WKH LQIHFWHG FDOOD OLO\ VDPSOHV ZKHQ ,(/,6$ DQG :HVWHUQ EORWWLQJ WHVWV ZHUH XVHG 7DEOH f

PAGE 119

)LJ $JDURVH JHO HOHFWURSKRUHVLV RI 573&5 DPSOLILHG SURGXFWV REWDLQHG IURP WRWDO 51$ H[WUDFWHG IURP DURLG OHDI WLVVXHV $ /DQH NE '1$ ODGGHU ODQH KHDOWK\ FDODGLXP ODQHV 'V09LQIHFWHG FDODGLXP ODQH S'&3O SODVPLG 7KH ROLJRQXFOHRWLGH SULPHU XVHG IRU F'1$ V\QWKHVLV ZDV (+ DQG IRU 3&5 WKH 'V09 &3 SULPHUV (+ DQG (+ ZHUH XVHG 7KH DPSOLILHG IUDJPHQW RI ES FRQWDLQHG WKH LQWDFW 'V09 &3 JHQH 7KH &3 ZDV GHWHFWHG XVLQJ WKH IROORZLQJ WHPSHUDWXUHF\FOLQJ SURILOH LQ D 8127KHUPRF\FOHU %LRPHWUD ,QF 7DPSD )/f ILYH F\FOHV RI PLQ DW r& PLQ DW r& PLQ DW r& F\FOHV RI PLQ DW r& PLQ DW r& PLQ DW r& % /DQH NE '1$ ODGGHU ODQHV LQIHFWHG FRFR\DP ODQH LQIHFWHG FDODGLXP ODQH KHDOWK\ FDODGLXP ODQH S'&3O SODVPLG 7KH WHPSHUDWXUH F\FOLQJ SURILOH XVHG HOHYHQ F\FOHV RI PLQ DW r& PLQ DW f§!r& WHPSHUDWXUH GHFOLQHV r& HDFK F\FOHf PLQ DW r& F\FOHV RI PLQ DW r& PLQ DW r& PLQ DW r&

PAGE 120

$ % )LJ $JDURVH JHO HOHFWURSKRUHVLV RI 573&5 DPSOLILHG SURGXFWV REWDLQHG IURP WRWDO 51$ H[WUDFWHG IURP OHDI WLVVXHV RI FDOOD OLO\ SODQWV $ /DQH NE '1$ ODGGHU ODQH 'V09LQIHFWHG FDODGLXP ODQHV FDOOD OLO\ SODQWV ODQH S'&3O SODVPLG ODQH KHDOWK\ FDODGLXP 7KH ROLJRQXFOHRWLGH SULPHU XVHG IRU F'1$ V\QWKHVLV ZDV (+ DQG IRU 3&5 ZHUH WKH 'V09 &3 SULPHUV (+ DQG (+ 7KH DPSOLILHG IUDJPHQW RI ES FRQWDLQHG LQWDFW WKH 'V09 &3 JHQH 7KH &3 ZDV GHWHFWHG XVLQJ WKH IROORZLQJ WHPSHUDWXUHF\FOLQJ SURILOH LQ D 8127KHUPRF\FOHU %LRPHWUD ,QF 7DPSD )/f F\FOHV RI PLQ DW r& PLQ DW !r& WHPSHUDWXUH GHFOLQHV r& HDFK F\FOHf PLQ DW r& F\FOHV RI PLQ DW r& PLQ DW r& PLQ DW r& % 6RXWKHUQ EORWWLQJ DQDO\VLV RI 573&5 DPSOLILHG SURGXFWV 7KH '1$ IUDJPHQWV ZHUH WUDQVIHUUHG WR D Q\ORQ PHPEUDQH DQG SUREHG ZLWK WKH FORQHG &3 JHQH ODEHOHG ZLWK D3

PAGE 121

7DEOH &RPSDULVRQ RI 573&5 ,(/,6$ DQG :HVWHUQ EORWWLQJ IRU GHWHFWLQJ 'V09 6DPSOH (/,6$ :HVWHUQ EORWWLQJ 573&5 3RVLWLYH FRQWURO +HDOWK\ $OO VDPSOHV ZHUH WHVWHG E\ 573&5 ,(/,6$ DQG ZHVWHUQ EORWWLQJ WHVWV DV GHVFULEHG LQ WH[W 7KH ,(/,6$ DEVRUEDQFH $ QPf YDOXH UHSUHVHQWV DYHUDJHV RI ZHOOV 'V09)/ DQWLVHUXP DQG 37< PRQRFORQDO DQWLVHUXP ZHUH ERWK XVHG LQ ZHVWHUQ EORWWLQJ DQDO\VLV DQG SURGXFHG VLPLODU UHVXOWV &DOOD OLO\ VDPSOHV ZHUH FROOHFWHG IURP WKH JUHHQKRXVH RU ILHOG )RU ,(/,6$ WHVWV WKH DEVRUEDQFH $ QPf RI WKH SRVLWLYH VDPSOH ZDV DW OHDVW WKUHH WLPHV KLJKHU WKDQ WKDW RI KHDOWK\ FRQWURO $ SURWHLQ EDQG RI N'D ZDV GHWHFWHG IRU D SRVLWLYH VDPSOH LQ ZHVWHUQ EORWWLQJ DQDO\VLV ZKLOH QR VXFK EDQG ZDV GHWHFWHG LQ WKH QHJDWLYH VDPSOH RU KHDOWK\ FRQWURO $ '1$ IUDJPHQW RI NE UHSUHVHQWLQJ WKH &3 JHQH DQG WKH f QRQFRGLQJ UHJLRQ ZDV GHWHFWHG LQ DOO VDPSOHV H[FHSW KHDOWK\ FRQWURO 3RVLWLYH FRQWURO ZDV 'V09LQIHFWHG FDODGLXP DQG WKH KHDWK\ FRQWURO ZDV WLVVXH FXOWXUHGHULYHG FDODGLXP

PAGE 122

'LVFXVVLRQ 7KH JRDO RI WKLV UHVHDUFK ZDV WR UHILQH PHWKRGV IRU LPSURYLQJ WKH GHWHFWLRQ RI 'V09 LQ DURLG SODQWV 5HOLDEOH GHWHFWLRQ V\VWHPV FRQVLVWLQJ RI VHURORJLFDO DVVD\V VXFK DV (/,6$ :HVWHUQ EORWWLQJ DQG WLVVXHEORWWLQJ DQG RI QXFOHLF DFLG DVVD\V VXFK DV QXFOHLF DFLG K\EULGL]DWLRQ DQG 573&5 RU 3&5 IRU '1$ YLUXVHVf KDYH EHHQ GHYHORSHG IRU PDQ\ YLUXVHV EHWWHU FKDUDFWHUL]HG WKDQ 'V09 ,Q SDUWLFXODU OLPLWHG NQRZOHGJH RI 'V09 DW WKH PROHFXODU OHYHO DQG WKH OLPLWHG DYDLODELOLW\ RI SRO\FORQDO DQWLVHUXP IRU WKLV YLUXV KDYH EHHQ FRQVWUDLQWV RI GLDJQRVLV DQG GHWHFWLRQ RI WKH YLUXV 5HVXOWV REWDLQHG E\ ,(/,6$ IRU GHWHFWLQJ 'V09 ZHUH VXSSRUWHG E\ :HVWHUQ EORWWLQJ 7DEOH f 9LUXV LQIHFWLRQV RI DURLGV FDQ EH GHWHFWHG UHDGLO\ E\ ,(/,6$ 7DEOH f 7KXV (/,6$ RIIHUV D UHOLDEOH DOWHUQDWLYH WR SUHYLRXVO\ XVHG WHFKQLTXHV VXFK DV 6'6LPPXQRGLILXVLRQ DQG ,6(0 IRU GHWHFWLQJ 'V09 IURP OHDI SHWLROH DQG FRUP WLVVXHV =HWWOHU t +DUWPDQ f ,W KDV EHHQ UHSRUWHG WKDW WKH QDWXUDO YLVFRVLW\ RI WKH DURLG OHDI H[WUDFWV DQG WKH SUHVHQFH RI VRPH fXQXVXDOf VXEVWDQFHV SUREDEO\ FDXVHG WKH KLJK OHYHO RI QRQVSHFLILF LQWHUIHUHQFH LQ (/,6$ WHVWV 5RGRQL t 0RUDQ f +RZHYHU WKHUH ZHUH QR VXFK HIIHFWV LQ RXU ,(/,6$ WHVWV ZKHQ HLWKHU ,J* RI DQWLVHUXP WR 'V09)/ RU DQWLVHUXP WR H[SUHVVHG &3 ZDV XVHG 1HLWKHU H[WUDFWV IURP KHDOWK\ OHDYHV QRU IURP KHDOWK\ FRUP WLVVXHV SURGXFHG LQRUGLQDWHO\ KLJK EDFNJURXQG YDOXHV LQ WKH WHVWV 7KH FRQWDPLQDWLRQ RI WKH 'V09 LPPXQRJHQ ZLWK SODQW SURWHLQV FRXOG KDYH DFFRXQWHG IRU WKH KLJK EDFNJURXQG LQ WKH (/,6$ WHVWV RI 5RGDQL DQG 0RUDQfV f DQWLVHUXP

PAGE 123

,OO %DVHG XSRQ (/,6$ UHVXOWV ZKLFK FRQILUPHG REVHUYDWLRQV RI V\PSWRPV QR YLUXV ZDV SUHVHQW LQ V\PSWRPOHVV WLVVXHV RI FRFR\DP DQG WDUR DV ZDV UHSRUWHG SUHYLRXVO\ IRU GLHIIHQEDFKLD &KDVH t =HWWOHU f ,Q FRQWUDVW YLUXV GLVWULEXWLRQ LV PXFK PRUH XQLIRUP LQ FDODGLXP OHDYHV 7KXV WKH JUHHQKRXVH JURZRXW UHFRPPHQGHG E\ WKH )$2,%3*5 IRU HGLEOH DURLGV GRHV QRW QHFHVVDULO\ DSSO\ WR WKLV DURLG 7KH GLIIHUHQFHV LQ V\PSWRP H[SUHVVLRQ DQG GLVWULEXWLRQ RI WKH YLUXV LQ LQIHFWHG WDUR DQG FRFR\DP SODQWV PD\ EH DWWULEXWHG WR WKH UHVWULFWLRQ RI YLUXV PRYHPHQW ZLWKLQ SODQWV RI FRFR\DP DQG WDUR 2XU UHVXOWV DOVR VKRZHG WKDW 'V09 ZDV DOZD\V GHWHFWHG LQ WKH FRUP WLVVXHV IURP WKH LQIHFWHG FDODGLXP SODQWV 7DEOH f 8QOLNH ZLWK OHDI WLVVXHV WKH GLVWULEXWLRQ RI GHWHFWDEOH 'V09 LQ FRUPV ZDV XQHYHQ ZKLFK PD\ EH UHODWHG WR ORZ OHYHOV RI YLUDO UHSOLFDWLRQ LQ WKH FRUPV %\ ZRXQGLQJ WKH FRUPV KRZHYHU WKH GHWHFWLRQ UDWH ZDV LQFUHDVHG JUHDWO\ SUREDEO\ GXH WR DQ LQFUHDVH LQ YLUDO UHSOLFDWLRQ LQ UHVSRQVH WR ZRXQGLQJ 7KXV DV ZLWK JODGLROXV YLUXVHV 9XQVK HW DO f FRUP ZRXQGLQJ FRXOG IDFLOLWDWH WKH GHWHFWLRQ RI 'V09 7KH GHWHFWLRQ RI 'V09 LQ DVVRFLDWLRQ ZLWK FHUWLILFDWLRQ DQG FOHDQVWRFN SURJUDPV IRU HGLEOH DURLGV FRXOG EH JUHDWO\ LPSURYHG E\ XVLQJ WHFKQLTXHV VXFK DV 573&5 2XU UHVXOWV LQGLFDWH WKDW (/,6$ DQG :HVWHUQ EORWWLQJ FRXOG QRW GHWHFW 'V09 LQ V\PWRPOHVV OHDYHV RI FRFR\DP DQG WDUR DQG WKXV 573&5 FRXOG EH DGRSWHG WR FRPSOHPHQW RU VXEVWLWXWH IRU (/,6$ ,QGHHG GLUHFW FRPSDULVRQ RI 573&5 ,(/,6$ DQG :HVWHUQ EORWWLQJ WHVWV GHPRQVWUDWHG WKDW 573&5 DPSOLILFDWLRQ RI YLUDOVSHFLILF 51$ ZDV PRUH VHQVLWLYH WKDQ (/,6$ DQG :HVWHUQ EORWWLQJ WR GHWHFW 'V09 7DEOH f 7KH VHQVLWLYLW\ RI WKH 'V09 57

PAGE 124

3&5 PHWKRG XVHG LQ WKLV VWXG\ PDNHV LW DV DQ DWWUDFWLYH IRU YLUXV GHWHFWLRQ HVSHFLDOO\ LQ WKRVH KRVWV LQ ZKLFK GLVWULEXWLRQ RI 'V09 ZLWKLQ SODQWV YDULHV VHDVRQDOO\

PAGE 125

&+$37(5 6800$5< $1' &21&/86,216 $ FDODGLXP LVRODWH RI GDVKHHQ PRVDLF YLUXV 'V09&KOf ZDV SXULILHG IURP LQRFXODWHG 3KLORGHQGURQ VHOORXP VHHGOLQJV IROORZLQJ D SURWRFRO XVHG IRU =<09 :LVOHU f 7KH SURSDJDWLYH KRVW 3 VHOORXP ZDV WKH RQO\ DURLG KRVW IURP ZKLFK WKH YLUXV ZDV VXFFHVVIXOO\ SXULILHG 2WKHU DURLG KRVWV FDODGLXP FDOOD OLO\ FRFR\DP DQG WDURf KDG KLJKO\ YLVFRXV OHDI H[WUDFWV ZKLFK PD\ FDXVH WKH YLUXV SDUWLFOHV WR SUHFLSLWDWH LUUHYHUVLEO\ 6\PSWRPDWLF OHDYHV RI DOO DURLG KRVWV KRZHYHU FRQWDLQHG KLJK FRQFHQWUDWLRQV RI WKH YLUXV EDVHG RQ H[DPLQDWLRQ RI QHJDWLYHO\ VWDLQHG OHDI H[WUDFWV &ORQHV UHSUHVHQWLQJ PRVW RI WKH JHQRPLF 51$ RI 'V09&KO ZHUH REWDLQHG E\ LPPXQRVFUHHQLQJ RI D F'1$ OLEUDU\ DQG GLUHFW VHTXHQFH PDSSLQJ 7KH VHTXHQFH RI WKH fWHUPLQDO UHJLRQ RI QXFOHRWLGHV ZDV GHWHUPLQHG &OHDYDJH VLWHV ZHUH ORFDWHG DW WKH 4* DPLQR DFLGV f DQG WKH 4$ DPLQR DFLGV f VLWHV RI WKH fWHUPLQDO UHJLRQ RI 'V09&KO 7KH FRQVHUYHG FOHDYDJH VHTXHQFH 9;/4* RU $f ZDV IRXQG LQ ERWK VLWHV ZKLFK LV VLPLODU WR WKRVH RI PRVW VHTXHQFHG SRW\YLUXVHV HVSHFLDOO\ WKRVH LQ WKH %&09 VXEJURXS 6KXNOD HW DO f 7KLV VHTXHQFHG UHJLRQ FRQWDLQHG D SRUWLRQ RI WKH 1,D WKH 1LE WKH FRDW SURWHLQ &3f JHQHV DQG WKH f QRQFRGLQJ UHJLRQ 7KH SDUWLDO 1,D SURWHLQ DPLQR DFLGVf FRQWDLQHG WKH FRQVHQVXV VHTXHQFH *;&* ZKLFK KDV EHHQ IRXQG LQ DOO RWKHU VHTXHQFHG SRW\YLUXVHV 6KXNOD HW DO f 7KLV VHTXHQFH LV SURSRVHG WR EH WKH DFWLYH VLWH IRU WKH

PAGE 126

SURWHDVH DFWLYLW\ RI WKH 1,D SURWHLQ 7KH 'V09&KO 1LE SURWHLQ FRQVLVWLQJ RI DPLQR DFLGV VKRZHG b WR b VLPLODULW\ ZLWK WKRVH RI RWKHU SRW\YLUXVHV 7KH FRQVHQVXV PRWLIV <&+$'*6 DQG 6*4367:'17DD*'' UHVSRQVLEOH IRU WKH SXWDWLYH 51$ SRO\PHUDVH IXQFWLRQ RI SRW\YLUXVHV .DPHU t $UJRV $OOLVRQ HW DO 'RPLHU HW DO *XQDVLQJKH HW DO f ZHUH DOVR SUHVHQW LQ 'V09 7KH VL]H RI WKH &3 RI WKH 'V09&KO LVRODWH ZDV DPLQR DFLGV ZLWK D FDOFXODWHG 0: RI N'D WKLV LV VLPLODU WR WKH &3V RI RWKHU SRW\YLUXVHV 6KXNOD HW DO f 7KLV YDOXH ZDV VRPHZKDW VPDOOHU WKDQ H[SHFWHG KRZHYHU EDVHG RQ 6'63$*( UHVXOWV /L HW DO f 7KH 'V09&KO &3 VKDUHG b VLPLODULW\ ZLWK WKRVH RI RWKHU SRW\YLUXVHV DQG KDV VKRZQ D FORVH UHODWLRQVKLS ZLWK WKRVH LQ WKH %&09 VXEJURXS 7KH FRUH UHJLRQV RI WKH &3V RI 'V09&KO DQG RWKHU SRW\YLUXVHV DUH YHU\ FRQVHUYHG ZKHUHDV WKH 1WHUPLQDO UHJLRQV DUH YDULDEOH 1HYHUWKHOHVV WKH DOLJQPHQWV RI WKH 1WHUPLQDO UHJLRQV UHYHDOHG SUROLQHULFK VHTXHQFHV DV LQ RWKHU 'V09 LVRODWHV 3DSSX HW DO D WKLV VWXG\f DQG RWKHU SRW\YLUXVHV LQFOXGLQJ MRKQVRQJUDVV PRVDLF RPLWKRJDOXP PRVDLF VZHHW SRWDWR IHDWKHU\ PRWWOH 339 DQG PDL]H GZDUI PRVDLF 6KXNOD HW DO f 7KH IXQFWLRQV RI WKHVH VHTXHQFHV DUH XQNQRZQ 7KH '$* DSKLGWUDQVPLVVLRQ WULSOHW ZDV DOVR SUHVHQW LQ WKH 1 WHUPLQDO UHJLRQ RI 'V09 VWDUWLQJ DW DPLQR DFLG IURP WKH FOHDYDJH VLWH 7KHVH GDWD VKRZ WKDW 'V09 LV D W\SLFDO DOEHLW GLVWLQFW PHPEHU RI WKH JHQXV 3RW\YLUXV LQ WKH IDPLO\ 3RW\YLULGDH 7KH 'V09&KO &3 JHQH ZDV FORQHG E\ 3&5 DQG VXEFORQHG LQWR DQ H[SUHVVLRQ YHFWRU S(7K WR JHQHUDWH S(7K&3 7KH H[SUHVVLRQ RI S(7K&3 LQ (VFKHULFKLD FROL

PAGE 127

FHOOV SURGXFHG ODUJH TXDQWLWLHV RI LQVROXEOH 'V09 &3 7KH H[SUHVVHG &3 ZDV SXULILHG IURP FHOO O\VDWHV DQG ZDV XVHG DV DQ LPPXQRJHQ WR SURGXFH DQWLVHUXP DJDLQVW WKH 'V09 &3 6HURORJLFDO WHVWV VXFK DV (/,6$ DQG :HVWHUQ EORWWLQJ LQGLFDWHG WKDW WKH DQWLVHUXP SURGXFHG ZDV VLPLODU WR DQWLVHUXP SUHSDUHG WR SXULILHG YLULRQV $ER (O1LO HW DO f ,Q YLWUR H[SUHVVLRQ RI WKH 'V09 &3 UHVROYHG WKH SUREOHPV RI SXULI\LQJ WKLV YLUXV DQG WKXV SURYLGHG DQ DOWHUQDWLYH ZD\ IRU REWDLQLQJ DQWLVHUXP QHHGHG IRU GLDJQRVWLF ZRUN :HVWHUQ EORWWLQJ DQDO\VLV FRQILUPHG WKDW WKH &3 RI 'V09 LV FRQVLGHUDEO\ ODUJHU WKDQ WKRVH RI PRVW SRW\YLUXVHV $ER (O1LO HW DO f 7KH &3 0:V RI VL[ 'V09 LVRODWHV ZHUH DERXW N'D ZKHUHDV WHQ RWKHU SRW\YLUXVHV XVHG LQ FRPSDULVRQV KDG 0:V RI RQO\ N'D 7KHVH YDULDWLRQV DSSDUHQWO\ UHIOHFW JHQRPLF GLIIHUHQFHV EHWZHHQ 'V09 LVRODWHV VLQFH WKH VSHFLILF &3 0: IRU HDFK LVRODWH LV FRQVWDQW HYHQ DIWHU VHULDO SDVVDJHV WKURXJK GLIIHUHQW KRVWV :KHUHDV PRVW SRW\YLUXVHV LQFOXGLQJ NRQMDN PRVDLF 6KLPR\DPD HW DO D Ef KDYH &3 0:V RI DERXW N'D WKRVH RI 'V09 LVRODWHV KDYH YDOXHV RI N'D $ER (O1LO HW DO f VXJJHVWHG WKDW WKH KLJK &3 0: YDOXHV RI 'V09 ZHUH DVVRFLDWHG ZLWK WKH ODELOH SRUWLRQ RI WKH FRDW SURWHLQ 7KH DYDLODELOLW\ RI WKH &3 VHTXHQFHV RI VHYHUDO 'V09 LVRODWHV 3DSSX HW DO E WKLV VWXG\f DQG RI RWKHU SRW\YLUXVHV KHOSHG WR FRQILUP WKLV K\SRWKHVLV ,QGHHG WKH 'V09 &3V RI WR DPLQR DFLGV RI WZR FDODGLXP LVRODWHV QRWHG LQ WKLV VWXG\ DUH UHODWLYHO\ ODUJH IRU D SRW\YLUXV +RZHYHU WKH FDOFXODWHG &3 0:V IRU IRXU VHTXHQFHG LVRODWHV ZHUH IURP N'D ZKLFK DUH W\SLFDO RI SRW\YLUXVHV )XUWKHUPRUH WKH 0: RI WKH &3 H[SUHVVHG LQ ( FROL ZDV VPDOOHU N'Df WKDQ WKDW N'Df IURP LQIHFWHG SODQWV HYHQ WKRXJK WKH

PAGE 128

H[SUHVVHG &3 KDG D IXVLRQ SURWHLQ RI DPLQR DFLGV ORQJ 7KH VLPLODU &3 0: GLIIHUHQFH EHWZHHQ 6'63$*( DQG VHTXHQFH GDWD UHVXOW KDV EHHQ UHSRUWHG IRU 35693 4XHPDGD HW DO Df 2QH RI WKH IDFWRUV WKDW FRXOG DFFRXQW IRU VXFK SHUFHLYHG GLIIHUHQFHV LQ PROHFXODU ZHLJKWV LQ 6'63$*( LV WKH DPLQR DFLG FRPSRVLWLRQ RI WKH 'V09 &3 7KH 'V09 &3 LV GLIIHUHQW IURP WKRVH RI PRVW SRW\YLUXVHV LQ WKDW LW LV TXLWH WKUHRQLQHDVSDUDJLQHULFK DW WKH 1WHUPLQDO UHJLRQ 7KHVH WZR DPLQR DFLG UHVLGXHV DFFRXQW IRU b RI WKH DPLQR DFLG UHVLGXHV DW WKH 1WHUPLQDO UHJLRQ RI WKH &3V ,Q DGGLWLRQ WR D SUROLQH VHTXHQFH DW WKH 1WHUPLQDO UHJLRQ WKHUH DUH DOVR PDQ\ PRUH f SRWHQWLDO 9JO\FRV\ODWLRQ VLWHV FOXVWHUHG QHDU ERWK WKH 1 DQG WKH &WHUPLQL RI WKH 'V09 &3 3DSSX HW DO D WKLV VWXG\f WKDQ WKHUH DUH LQ WKH &3V RI PRVW SRW\YLUXVHV 7KHVH XQXVXDO VHTXHQFHV PD\ DIIHFW EHKDYLRU RI 'V09 &3 LQ 6'63$*( DOWKRXJK WKHRUHWLFDOO\ QR VXFK LQIOXHQFH VKRXOG H[LVW EDVHG RQ WKH SUHVXPSWLRQ WKDW SURWHLQV DUH FRPSOHWHO\ GHJUDGHG E\ WKH DQLRQLF GHWHUJHQW 6'6 6HYHUDO VKRUW SUROLQH VWUHWFKHV DQGRU D VHYHQSUROLQH VWUHWFK ZHUH DOVR IRXQG DW WKH 1WHUPLQDO UHJLRQV RI VHYHUDO VZHHW SRWDWR SRW\YLUXVHV &ROLQHW t /HSRLYUH f 7KH &3 0:V RI WKHVH YLUXVHV LQ 6'63$*( KRZHYHU FRUUHVSRQG FORVHO\ WR WKRVH FDOFXODWHG IURP WKHLU VHTXHQFHV RI DPLQR DFLGV WKHUHE\ LQGLFDWLQJ WKDW SUROLQH VWUHWFKHV PD\ KDYH QR HIIHFW RQ WKH HVWLPDWHG 0:V RI WKH SURWHLQV LQ 6'63$*( 7KH YDULDELOLW\ RI &3 0:V DPRQJ GLIIHUHQW 'V09 LVRODWHV QRWHG LQ WKLV VWXG\ FRQWUDVWV ZLWK WKH VWXGLHV RI RWKHU SRW\YLUXVHV VXFK DV =<09 :LVOHU f DQG 3569 : GDWD QRW VKRZQf ZKLFK DSSHDU WR EH PXFK PRUH XQLIRUP DPRQJ GLIIHUHQW VWUDLQV

PAGE 129

6HTXHQFH DQDO\VLV RI WKH 'V09 &3V UHYHDOHG D GHOHWLRQ DQG DQ DGGLWLRQ DW WKH 1WHUPLQDO UHJLRQV RI WKH &KL &K DQG 7(1 LVRODWHV ZKLFK ZKHQ FRPSDUHG WR WKH /$ LVRODWH 7KH GHOHWLRQV RU GXSOLFDWLRQV DW WKH 1WHUPLQDO UHJLRQ RI WKH 'V09 &3 DPRQJ GLIIHUHQW LVRODWHV PD\ DOVR FRQWULEXWH WR WKH YDULDELOLW\ RI WKH FRDW SURWHLQ VL]HV 6LPLODU VHTXHQFH GLYHUVLW\ DW WKH 1WHUPLQDO UHJLRQ RI WKH &3V ZDV DOVR UHSRUWHG IRU VWUDLQV RI 7X09 6DQR HW DO f VWUDLQV RI 6&09 ;LDR HW DO f DQG %&09 .KDQ HW DO f 7KH DYDLODELOLW\ RI WKH VHTXHQFHV RI WKH FRDW SURWHLQ DQG WKH f1&5 RI WKH 'V09 &KL &K /$ DQG 7(1 LVRODWHV DOORZHG DQ DVVHVVPHQW WR VWXI\ WKHLU UHODWLRQVKLS DW WKH VHTXHQFH OHYHO $V KDV EHHQ UHSRUWHG IRU RWKHU SRW\YLUXVHV 6KXNOD HW DO f WKH DPLQR DFLG YDULDWLRQ DPRQJ WKH &3V RI WKH IRXU 'V09 LVRODWHV RFFXUV SULPDULO\ DW WKH 1WHUPLQDO UHJLRQ ZKHUHDV WKH VHTXHQFHV RI WKH FRUH DQG &WHUPLQDO UHJLRQV DUH KLJKO\ FRQVHUYHG )LJ f 7KH &3 VHTXHQFHV RI WKHVH LVRODWHV VKRZHG VLPLODULWLHV RI WR b ZKLFK DUH E\ FRQYHQWLRQ FRQVLGHUHG WR EH ZLWKLQ YDOXHV IRU GHOLQHDWLQJ VWUDLQV RI D JLYHQ YLUXV 6KXNOD HW DO f )XUWKHUPRUH WKH VLPLODULWLHV RI WKH f1&5 VHTXHQFHV RI WKH LVRODWHV &KL &K DQG /$ ZHUH b LQGLFDWLQJ WKDW WKHVH LVRODWHV DUH YHU\ FORVH WR HDFK RWKHU 7KH UHVXOWV REWDLQHG LQ WKLV UHVHDUFK FRQILUPHG HDUOLHU VWXGLHV $ER (O1LO HW DO :LVOHU HW DO f WKDW VRPH LVRODWHV RI 'V09 FDQ LQGXFH PRUH VHYHUH VWXQWLQJ V\PSWRPV LQ 3 VHOORXP WKDQ RWKHUV KRZHYHU WKH &3 0: LV DSSDUHQWO\ QRW FRUUHODWHG ZLWK WKLV SURSHUW\ )RU H[DPSOH WKH UHVSHFWLYH LVRODWHV ZLWK WKH KLJKHVW DQG ORZHVW &3 VL]HV LH 'V09;F N'Df DQG 'V09&K N'Df LQGXFHG PLOG V\PSWRPV LQ 3 VHOORXP ZKHUHDV WKH IRXU RWKHU LVRODWHV &KL &K &H DQG =Df WKDW LQGXFHG PRUH VHYHUH

PAGE 130

VWXQWLQJ V\PSWRPV KDG LQWHUPHGLDWH &3 0:V +RZHYHU UHODWLRQVKLSV EHWZHHQ WKH V\PSWRP GLIIHUHQFHV LQ 3 VHOORXP DQG WKH &3 VHTXHQFH VLPLODULW\ RI WKHVH LVRODWHV FRXOG QRW EH HVWDEOLVKHG VLQFH &3V RI WKH &K ;F DQG =D LVRODWHV KDYH \HW WR EH VHTXHQFHG 7KH FRDW SURWHLQ YDULDELOLW\ RI 'V09 LVRODWHV GRHV QRW DSSHDU WR FRPSURPLVH WKH DELOLW\ WR GHWHFW GLIIHUHQW 'V09 LVRODWHV VHURORJLFDOO\ ,Q WKLV VWXG\ HDFK RI WKH 'V09 LVRODWHV FRXOG UHDGLO\ EH GHWHFWHG HLWKHU E\ (/,6$ RU E\ :HVWHUQ EORWWLQJ 'HVSLWH WKH &3 0: GLIIHUHQFHV EHWZHHQ 'V09 DQG PRVW RWKHU SRW\YLUXVHV UHFLSURFDO UHDFWLRQV LQ :HVWHUQ EORW DQDO\VHV UHYHDO FORVH VHURORJLFDO UHODWLRQVKLSV EHWZHHQ 'V09 DQG RWKHU SRW\YLUXVHV WKHUHE\ VXJJHVWLQJ WKDW XQXVXDO FRPSRVLWLRQ RI 'V09 &3 DSSDUHQWO\ KDG QR VLJQLILFDQW HIIHFW RQ LWV VHURORJLFDO DIILQLWLHV WR RWKHU SRW\YLUXVHV )XUWKHUPRUH WKH DQWLVHUD IURP WZR GLIIHUHQW 'V09 LVRODWHV FURVVUHDFWHG ZLWK RWKHU SRW\YLUXVHV WKHUHE\ SURYLGLQJ DGGLWLRQDO HYLGHQFH WKDW WKH XQXVXDO 'V09 &3 VWUHWFKHV GR QRW FRQWDLQ HSLWRSHV WKDW LQWHUIHUH ZLWK WKH DELOLW\ WR GHWHFW GLIIHUHQW VWUDLQV RI WKH YLUXV 5HVXOWV REWDLQHG E\ ,(/,6$ LQ WKH GHWHFWLRQ RI 'V09 ZHUH VXSSRUWHG E\ :HVWHUQ EORWWLQJ DQG ,6(0 9LUXV LQIHFWLRQV RI DURLGV FDQ EH GHWHFWHG E\ ,(/,6$ 7KXV ,(/,6$ RIIHUV D UHOLDEOH DOWHUQDWLYH WR SUHYLRXVO\ XVHG WHFKQLTXHV VXFK DV 6'6LPPXQRGLIILLVLRQ DQG LPPXQRVRUEHQW HOHFWURQ PLFURVFRS\ IRU GHWHFWLQJ 'V09 IURP OHDI SHWLROH DQG FRUP WLVVXHV ,W KDV EHHQ UHSRUWHG WKDW WKH QDWXUDO YLVFRVLW\ RI WKH DURLG VDS FRPELQHG ZLWK WKH SUHVHQFH RI VRPH fXQXVXDOf VXEVWDQFHV SUREDEO\ FDXVHG WKH KLJK OHYHO RI QRQVSHFLILF LQWHUIHUHQFH LQ (/,6$ WHVWV 5RGRQL t 0RUDQ f +RZHYHU WKHUH ZHUH QR VXFK HIIHFWV LQ RXU (/,6$ WHVWV UHJDUGOHVV ZKHWKHU 'V09)/ DQWLVHUXP RU H[SUHVVHG &3 DQWLVHUXP ZDV XVHG

PAGE 131

2XU UHVXOWV FRQILUPHG HDUOLHU ILQGLQJV =HWWOHU HW DO f WKDW 'V09 V\PSWRP H[SUHVVLRQ LV LQWHUPLWWHQW LQ VRPH DURLG KRVWV )RU FRFR\DP DQG WDUR WKH H[SUHVVLRQ RI WKH YLUDO V\PSWRPV XVXDOO\ RFFXUUHG LQ HDUO\ VSULQJ RU ODWH IDOO PRQWKV 7KH LQWHUPLWWHQW V\PSWRP H[SUHVVLRQ DQG GLVWULEXWLRQ RI WKH YLUXV LQ LQIHFWHG FRFR\DP DQG WDUR SODQWV PD\ EH DWWULEXWHG WR WKH UHVWULFWLRQ RI WKH YLUDO PRYHPHQW DV ZDV SUHYLRXVO\ UHSRUWHG IRU GLHIIHQEDFKLD &KDVH t =HWWOHU f +RZHYHU LQ FDODGLXP YLUDO V\PSWRPV FRXOG EH REVHUYHG WKURXJKRXW WKH VHDVRQ 7KHVH REVHUYDWLRQV ZHUH LQ DJUHHPHQW ZLWK (/,6$ DQG :HVWHUQ EORWWLQJ VWXGLHV 'V09 ZDV QRW GHWHFWHG E\ WKHVH PHWKRGV LQ V\PSWRPOHVV OHDYHV RI FRFR\DP DQG WDUR EXW WKH YLUXV ZDV UHDGLO\ GHWHFWHG WKURXJKRXW WKH JURZLQJ VHDVRQ LQ OHDYHV RI FDODGLXP 7KXV WKH RQH FURS F\FOH JUHHQKRXVH JURZRXW UHFRPPHQGHG E\ WKH )$2,%3*5 IRU HGLEOH DURLGV GRHV QRW QHFHVVDULO\ DSSO\ WR FDODGLXP %\ ZRXQGLQJ WKH FRUPV WKH GHWHFWLRQ UDWH ZDV LQFUHDVHG JUHDWO\ SUREDEO\ GXH WR WKH LQFUHDVH RI YLUDO UHSOLFDWLRQ 7KHUHIRUH FRUP ZRXQGLQJ FRXOG IDFLOLWDWH WKH GHWHFWLRQ RI 'V09 LQ FRUP WLVVXH DV WKDW UHSRUWHG E\ 9XQVK HW DO f IRU JODGLROXV 'V09 GHWHFWLRQ DVVRFLDWHG ZLWK FHUWLILFDWLRQ DQG FOHDQVWRFN SURJUDPV IRU HGLEOH DURLGV FRXOG EH JUHDWO\ LPSURYHG E\ WHFKQLTXHV VXFK DV 573&5 ZKLFK FDQ EH HYHQ PRUH VHQVLWLYH WKDQ HLWKHU (/,6$ RU :HVWHUQ EORWWLQJ 2XU UHVXOWV VKRZHG WKDW 'V09 FRXOG EH GHWHFWHG E\ 573&5 LQ FDOOD OLO\ RU FRFR\DP WLVVXHV ZKLFK ZHUH QHJDWLYH IRU 'V09 E\ (/,6$ RU :HVWHUQ EORWWLQJ 7KH VHQVLWLYLW\ RI WKH 'V09 573&5 PHWKRG XVHG LQ WKLV VWXG\ PDNHV LW DQ DWWUDFWLYH DOWHUQDWLYH IRU YLUXV GHWHFWLRQ HVSHFLDOO\ IRU WKRVH KRVWV LQ ZKLFK GLVWULEXWLRQ RI 'V09 ZLWKLQ SODQWV YDULHV VHDVRQDOO\ VXFK DV FRFR\DP DQG WDUR

PAGE 132

5()(5(1&( /,67 $ER (O1LO 00 DQG =HWWOHU ): 1DWXUDO RFFXUUHQFH RI GDVKHHQ PRVDLF YLUXV LQ (J\SWLDQ WDUR &RORFDVLD HVFXOHQWD 3ODQW 6FL /HWWHUV $ER (O1LO 00 =HWWOHU ): DQG +LHEHUW ( 3XULILFDWLRQ VHURORJ\ DQG VRPH SK\VLFDO SURSHUWLHV RI GDVKHHQ PRVDLF YLUXV 3K\WRSDWKRORJ\ $OFRQHUR 5 DQG =HWWOHU ): 9LUXV LQIHFWLRQV RI &RORFDVLD DQG ;DQWKRVRPD LQ 3XHUWR 5LFR 3ODQW 'LV 5HSWU $OOLVRQ 5 -RKQVWRQ 5( DQG 'RXJKHUW\ :* 7KH QXFOHRWLGH VHTXHQFH RI WKH FRGLQJ UHJLRQ RI WREDFFR YHLQ PRWWOLQJ YLUXV JHQRPLF 51$ (YLGHQFH IRU WKH V\QWKHVLV RI D VLQJOH SRO\SURWHLQ 9LURORJ\ $QGUHZV -+ DQG 6KDOOD 7$ 7KH RULJLQ GHYHORSPHQW DQG FRQIRUPDWLRQ RI DPRUSKRXV LQFOXVLRQ ERG\ FRPSRQHQWV LQ WREDFFR HWFK YLUXVLQIHFWHG FHOOV 3K\WRSDWKRORJ\ $QWLJQXV < 5DFFDK % *DO2Q $ DQG &RKHQ 6 %LRORJLFDO DQG VHURORJLFDO FKDUDFWHUL]DWLRQ RI=<09 DQG :09 LVRODWHV LQ ,VUDHO 3K\WRSDUDVLWLFD $WUH\D & $SSOLFDWLRQ RI JHQRPH VHTXHQFH LQIRUPDWLRQ LQ SRW\YLUXV WD[RQRP\ DQ RYHUYLHZ ,Q %DUQHWW 2: HGf 3RW\YLUXV 7D[RQRP\ 6SULQJHU9HUODJ :LHQ DQG 1HZ 6XSSOHPHQW@ f SS $WUH\D &' $WUH\D 3/ 7KRPEXU\ ': DQG 3LURQH 73 6LWHGLUHFWHG PXWDWLRQV LQ WKH SRW\YLUXV +&3UR JHQH DIIHFW KHOSHU FRPSRQHQW DFWLYLW\ YLUXV DFFXPXODWLRQ DQG V\PSWRP H[SUHVVLRQ LQ LQIHFWHG WREDFFR SODQWV 9LURORJ\ $WUH\D & 5DFFDK % DQG 3LURQH 73 $ SRLQW PXWDWLRQ LQ WKH FRDW SURWHLQ DEROLVKHV DSKLG WUDQVPLVVLELOLW\ RI D SRW\YLUXV 9LURORJ\ $WUH\D 3/ $WUH\D &' DQG 3LURQH 73 $PLQR DFLG VXEVWLWXWLRQV LQ WKH FRDW SURWHLQ UHVXOW LQ ORVV RI LQVHFW WUDQVPLVVLELOLW\ RI D SODQW YLUXV 3URF 1DWO $FDG 6FL 86$

PAGE 133

$WUH\D 3/ /RSH]0R\D -&KX 0+ $WUH\D & DQG 3LURQH 73 0XWDWLRQDO DQDO\VLV RI WKH FRDW SURWHLQ 1WHUPLQDO DPLQR DFLGV LQYROYHG LQ SRW\YLUXV WUDQVPLVVLRQ E\ DSKLGV *HQ 9LURO %DXOFRPEH '& /OR\G 0DQRXVVRSRXORV ,1 5REHUWV ,0 DQG +DUULVRQ %' 6LJQDO IRU SRW\YLUXVGHSHQGHQW DSKLG WUDQVPLVVLRQ RI SRWDWR DXFXED PRVDLF YLUXV DQG WKH HIIHFW RI LWV WUDQVIHU WR SRWDWR YLUXV ; *HQ 9LURO %DXQRFK '$ 'DV 3 DQG +DUL 9 3RWDWR YLUXV < KHOSHU FRPSRQHQW SURWHLQ LV DVVRFLDWHG ZLWK DPRUSKRXV LQFOXVLRQV *HQ 9LURO %DXQRFK '$ 'DV 3 %URZQLQJ 0( DQG +DUL 9 $ WHPSRUDO VWXG\ RI WKH H[SUHVVLRQ RI WKH FDSVLG F\WRSODVPLF LQFOXVLRQ DQG QXFOHDU LQFOXVLRQ SURWHLQ RI WREDFFR HWFK SRW\YLUXV LQ LQIHFWHG SODQWV *HQ 9LURO %D]DQ -) DQG )OHWWHULFN 59LUDO F\VWHLQH SURWHDVHV DUH KRPRORJRXV WR WKH WU\SVLQn OLNH IDPLO\ RI VHULQH SURWHDVHV 6WUXFWXUDO DQG IXQFWLRQDO LPSOLFDWLRQV 3URF 1DWO $FDG 6FL 86$ %HUJHU 3+ DQG 3LURQH 73 7KH HIIHFW RI KHOSHU FRPSRQHQW RQ WKH XSWDNH DQG ORFDOL]DWLRQ RI SRW\YLUXV LQ 0\]XV SHUVLFDH 9LURORJ\ %UDNNH 0. DQG 9DQ 3HOW 1 /LQHDUORJ JUDGLHQWV IRU HVWLPDWLQJ VHGLPHQWDWLRQ FRHIILFLHQWV RI SODQW YLUXVHV DQG QXFOHLF DFLGV $QDO %LRFKHP %U\DQ *7 *DUGQHU 5& DQG )RUVWHU 5/6 1XFOHRWLGH VHTXHQFH RI WKH FRDW SURWHLQ JHQH RI D VWUDLQ RI FORYHU \HOORZ YHLQ YLUXV IURP 1HZ =HDODQG &RQVHUYDWLRQ RI D VWHP ORRS VWUXFWXUH LQ WKH f UHJLRQ RI SRW\YLUXVHV $UFK 9LURO %XGGHQKDJHQ ,: 0LOEUDWK *0 DQG +VLHK 6 3 9LUXV GLVHDVHV RI WDUR DQG RWKHU DURLGV 3URF 6HFRQG ,QW 6\PS RQ 7URSLFDO 5RRW DQG 7XEHU &URSV &DUULQJWRQ -& &DU\ 60 DQG 'RXJKHUW\ :* 0XWDWLRQDO DQDO\VLV RI WREDFFR HWFK YLUXV SRO\SURWHLQ SURFHVVLQJ &LV DQG WUDQV SURWHRO\WLF DFWLYLWLHV RI SRO\SURWHLQ FRQWDLQLQJ WKH NLORGDOWRQ SURWHLQDVH 9LURO &DUULQJWRQ -& &DU\ 60 3DUNV 7' DQG 'RXJKHUW\ :* D $ VHFRQG SURWHLQDVH HQFRGHG E\ D SODQW SRW\YLUXV JHQRPH (0%2 &DUULQJWRQ -& DQG 'RXJKHUW\ :* D 6PDOO QXFOHDU LQFOXVLRQ SURWHLQ HQFRGHG E\ D SODQW SRW\YLUXV JHQRPH LV D SURWHDVH 9LURO

PAGE 134

&DUULQJWRQ -& DQG 'RXJKHUW\ :* E 3URFHVVLQJ RI WKH WREDFFR HWFK YLUXV SURWHDVH UHTXLUHV DXWRSURWHRO\VLV 9LURORJ\ &DUULQJWRQ -& DQG 'RXJKHUW\ :* $ YLUDO FOHDYDJH VLWH FDVVHWWH ,GHQWLILFDWLRQ RI DPLQR DFLG VHTXHQFHV UHTXLUHG IRU WREDFFR HWFK YLUXV SRO\SURWHLQ SURFHVVLQJ 3URF 1DWO $FDG 6FL 86$ &DUULQJWRQ -& DQG )UHHG '' &DSLQGHSHQGHQW HQKDQFHPHQW RI WUDQVODWLRQ E\ D SODQW SRW\YLUXV n QRQWUDQVODWHG UHJLRQ 9LURO &DUULQJWRQ -& )UHHG '' DQG 6DQGHUV 7& E $XWRFDWDO\WLF SURFHVVLQJ RI WKH SRW\YLUXV KHOSHU FRPSRQHQW SURWHLQDVH LQ (VFKHULFKLD FROL DQG LQ YLWUR @ 9LURO &DUULQJWRQ -& )UHHG '' DQG 2K &6 ([SUHVVLRQ RI SRW\YLUXV SRO\SURWHLQ LQ WUDQVJHQLF SODQWV UHYHDOV WKUHH SURWHRO\WLF DFWLYLWLHV UHTXLUHG IRU FRPSOHWH SURFHVVLQJ (0%2 &DUULQJWRQ -& )UHHG '' DQG /HLQLFNH $%LSDUWLWH VLJQDO VHTXHQFH PHGLDWHV QXFOHDU WUDQVORFDWLRQ RI WKH SODQW SRW\YLUDO 1,D SURWHLQ 3ODQW &HOO &KDQJ &$ +LHEHUW ( DQG 3XUFLIXOO '( $QDO\VLV RI LQ YLWUR WUDQVODWLRQ RI EHDQ \HOORZ PRVDLF YLUXV 51$ LQKLELWLRQ RI SURWHRO\WLF SURFHVVLQJ E\ DQWLVHUXP WR WKH N QXFOHDU LQFOXVLRQ SURWHLQ *HQ 9LURO &KDVH $5 DQG =HWWOHU ): 'DVKHHQ PRVDLF YLUXV RI GLHIIHQEDFKLD FXOWLYDUV 3ODQW 'LV &KULVWLH 5* DQG (GZDUGVRQ -5 /LJKW DQG HOHFWURQ PLFURVFRS\ RI SODQW YLUXV LQFOXVLRQV )ORULGD $JULFXOWXUDO ([SHULPHQW 6WDWLRQ 0RQRJUDSK 6HULHV SS &ODUN 03 DQG $GDPV $1 &KDUDFWHULVWLFV RI WKH PLFURSODWH PHWKRG RI HQ]\PH OLQNHG LPPXQRVRUEHQW DVVD\ IRU GHWHFWLRQ RI SODQW YLUXVHV *HQ 9LURO &ROLQHW .XPPHUW /HSRLYUH 3 DQG 6HPDO ,GHQWLILFDWLRQ RI GLVWLQFW SRW\YLUXVHV LQ PL[HGO\LQIHFWHG VZHHWSRWDWR E\ WKH SRO\PHUDVH FKDLQ UHDFWLRQ ZLWK GHJHQHUDWH SULPHUV 9LURO 0HWKRGV &ROLQHW .XPPHUW DQG /HSRLYUH 3 7KH FRPSOHWH QXFOHRWLGH VHTXHQFHV RI WKH FRDW SURWHLQ FLVWURQ DQG WKH f QRQFRGLQJ UHJLRQ RI D QHZO\LGHQWLILHG SRW\YLUXV LQIHFWLQJ VZHHWSRWDWR DV FRPSDUHG WR WKRVH RI VZHHWSRWDWR IHDWKHU\ PRWWOH YLUXV $UFK 9LURO

PAGE 135

&ROLQHW DQG /HSRLYUH 3 7KH FRPSOHWH QXFOHRWLGH VHTXHQFH RI WKH FRDW SURWHLQ FLVWURQ DQG WKH f QRQFRGLQJ UHJLRQ RI D QHZO\LGHQWLILHG SRW\YLUXV LQIHFWLQJ VZHHWSRWDWR DV FRPSDUHG WR WKRVH RI VZHHWSRWDWR IHDWKHU\ PRWWOH YLUXV $UFK 9LURO &URQLQ 6 9HUFKRW +DLGHPDQ&DKLOO 5 6FKDDG 0& DQG &DUULQJWRQ -& /RQJn GLVWDQFH PRYHPHQW IDFWRU $ WUDQVSRUW IXQFWLRQ RI WKH SRW\YLUXV KHOSHU FRPSRQHQW SURWHLQDVH 7KH 3ODQW &HOO 'H 0HMLD 09* +LHEHUW ( DQG 3XUFLI8OO '( D ,VRODWLRQ DQG SDUWLDO FKDUDFWHUL]DWLRQ RI WKH DPRUSKRXV F\WRSODVPLF LQFOXVLRQV DVVRFLDWHG ZLWK LQIHFWLRQV FDXVHG E\ WZR SRW\YLUXVHV 9LURORJ\ 'H 0HMLD 09* +LHEHUW ( 3XUFLI8OO '( 7KRPEXU\ ': DQG 3LURQH 73 E ,GHQWLILFDWLRQ RI SRW\YLUDO DPRUSKRXV LQFOXVLRQ SURWHLQ DV D QRQVWUXFWXUDO YLUXVVSHFLILF SURWHLQ UHODWHG WR KHOSHU FRPSRQHQW 9LURORJ\ 'HEURW ($ DQG 2UGRVJRLWWL $ 'DVKHHQ PRVDLF YLUXV LQIHFWLRQ RI &RORFDVLD DQG ;DQWKRVRPD LQ 9HQH]XHOD 3ODQW 'LV 5HSWU GH 9DULHV 6 +RJH + DQG %LVVHOLQJ 7 ,VRODWLRQ RI WRWDO 51$ IURP SODQW WLVVXH 3ODQW 0ROHFXODU %LRORJ\ 0DQXDO % .OXPHU $FDGHPLF 3XEOLVKHU 'RUGUHFKW %HOJLXP 'LQDQW 6 %ODLVH ) .XVLDN & $VWLHU0DQLIDFLHU 6 DQG $OERQ\ +HWHURORJRXV UHVLVWDQFH WR SRWDWR YLUXV < LQ WUDQVJHQLF WREDFFR SODQWV H[SUHVVLQJ WKH FRDW SURWHLQ JHQH RI OHWWXFH PRVDLF SRW\YLUXV 3K\WRSDWKRORJ\ 'ROMD 99 DQG &DUULQJWRQ -& (YROXWLRQ RI SRVLWLYHVWUDQG 51$ YLUXVHV 6HPLQDUV LQ 9LURO 'ROMD 99 +DLGHPDQ&DKLOO 5 0RQWJRPHU\ $( 9DQGHQERVFK .$ DQG &DUULQJWRQ -& &DSVLG SURWHLQ GHWHUPLQDQWV LQYROYHG LQ FHOOWRFHOO DQG ORQJ GLVWDQFH PRYHPHQW RI WREDFFR HWFK SRW\YLUXV 9LURORJ\ 'ROMD 99 0F%ULGH +DQG &DUULQJWRQ -& 'LVWLQFW IXQFWLRQV RI FDSVLG SURWHLQ LQ DVVHPEO\ DQG PRYHPHQW RI WREDFFR HWFK YLUXV LQ SODQWV (0%2'RPLHU // )UDQNOLQ .0 6KDKDEXGGLQ 0 +HOOPDQQ *0 6LDZ 0)( /RPRQRVVRII *3 6KDZ -* DQG 5KRDGV 5( 7KH QXFOHRWLGH VHTXHQFH RI WREDFFR YHLQ PRWWOLQJ YLUXV 51$ 1XFO $FLGV 5HV 'RPLHU // 6KDZ -* DQG 5KRDGV 5( 3RW\YLUDO SURWHLQV VKDUH DPLQR DFLG VHTXHQFH KRPRORJ\ ZLWK SLFRPD FRPR DQG FDXOLPRYLUDO SURWHLQV 9LURORJ\

PAGE 136

'RXJKHUW\ :* DQG &DUULQJWRQ -& ([SUHVVLRQ DQG IXQFWLRQ RI SRW\YLUDO JHQH SURGXFWV $QQX 5HY 3K\WRSDWKRO 'RXJKHUW\ : DQG +LHEHUW ( 7UDQVODWLRQ RI SRW\YLUXV 51$ LQ D UDEELW UHWLFXORF\WH O\VDWH LGHQWLILFDWLRQ RI QXFOHDU LQFOXVLRQ SURWHLQ DV SURGXFWV RI WREDFFR HWFK YLUXV 51$ WUDQVODWLRQ DQG F\OLQGULFDO LQFOXVLRQ SURWHLQ DV D SURGXFW RI WKH SRW\YLUXV JHQRPH 9LURORJ\ 'RXJKHUW\ :* DQG 3DUNV 7' 3RVWWUDQVODWLRQDO SURFHVVLQJ RI WKH WREDFFR HWFK YLUXV N'D VPDOO QXFOHDU LQFOXVLRQ SRO\SURWHLQ LGHQWLILFDWLRQ RI DQ LQWHUQDO FOHDYDJH VLWH DQG GHOLPLWDWLRQ RI 93J DQG SURWHLQDVH GRPDLQV 9LURORJ\ 'RXJKHUW\ :* &DUULQJWRQ -& &DU\ 60 DQG 3DUNV 7' %LRFKHPLFDO DQG PXWDWLRQDO DQDO\VLV RI D SODQW YLUXV SRO\SURWHLQ FOHDYDJH VLWH (0%2 'RXJKHUW\ :* &DU\ 60 DQG 3DUNV 7' D 0ROHFXODU JHQHWLF DQDO\VLV RI D SODQW YLUXV SRO\SURWHLQ FOHDYDJH VLWH D PRGHO 9LURORJ\ 'RXJKHUW\ :* 3DUNV 7' &DU\ 60 %D]DQ -) DQG )OHWWHULFN 5E &KDUDFWHUL]DWLRQ RI WKH FDWDO\WLF UHVLGXHV RI WKH WREDFFR HWFK YLUXV N'D SURWHLQDVH 9LURORJ\ (GZDUGVRQ -5 6RPH SURSHUWLHV RI WKH SRWDWR YLUXV
PAGE 137

*DO2Q $ $QWLJQXV < 5RVQHU $ DQG 5DFFDK % $ ]XFFKLQL \HOORZ PRVDLF YLUXV FRDW SURWHLQ JHQH PXWDWLRQ UHVWRUHV DSKLG WUDQVPLVVLELOLW\ EXW KDV QR HIIHFW RQ PXOWLSOLFDWLRQ *HQ 9LURO *DUFLD -$ DQG /DLQ 6 3URWHRO\WLF DFWLYLW\ RI SOXP SR[ YLUXVWREDFFR HWFK YLUXV FKLPHULF 1OD SURWHDVHV )(%6 /HWWHUV *DUFLD -$ 0DUWLQ 07 *HUYHUD 0$ DQG 5LHFKPDQQ -/ 3URWHRO\WLF SURFHVVLQJ RI WKH SOXP SR[ SRW\YLUXV SRO\SURWHLQ E\ WKH 1OD SURWHDVH DW D QRYHO FOHDYDJH VLWH 9LURORJ\ *DUFLD -$ 5LHFKPDQQ -/ DQG /DLQ 6 D 3URWHRO\WLF DFWLYLW\ RI WKH SOXP SR[ SRW\YLUXV 1,DOLNH SURWHLQ LQ (VFKHULFKLD FROL 9LURORJ\ *DUFLD -$ 5LHFKPDQQ -/ DQG /DLQ 6 E $UWLILFLDO FOHDYDJH VLWH UHFRJQL]HG E\ SOXP SR[ SRW\YLUXV SURWHDVH LQ (VFKHULFKLD FROL 9LURO *KDEULDO 6$ 6PLWK +$ 3DUNV 7' DQG 'RXJKHUW\ :* 0ROHFXODU JHQHWLF DQDO\VHV RI WKH VR\EHDQ PRVDLF YLUXV 1OD SURWHDVH *HQ 9LURO *LUDUG -& *LDQQRWWL %DXGLQ 3 DQG &KDWHQHW 0 >0LVH HQ HYLGHQFH GH GDVKHHQ PRVDLF YLUXV GDQV GHV PDFDERV ;DQWKRVRPD VDJLWWDHIROLXPf SURYHQDQW GX &DPHURXP@ $JURQ 7UDS *ROOLIHU '( DQG %URZQ -) 9LUXV GLVHDVH RI &RORFDVLD HVFXOHQWD LQ WKH %ULWLVK 6RORPRQ ,VODQGV 3ODQW 'LV 5HSWU *ROOLIHU '( -DFNVRQ 9+ 'DEHN $3OXPE 57 DQG 0D\ << 7KH RFFXUUHQFH DQG WUDQVPLVVLRQ RI YLUXVHV RI HGLEOH DURLGV LQ WKH 6RORPRQ ,VODQGV DQG WKH 6RXWKZHVW 3DFLILF 3HVWLFLGH $UWLFOHV DQG 1HZV 6XPPDULHV *RPH] / 0RQJH 0 9DOYHUGH 5 $ULDV 2 DQG 7KRUSH 7 0LFURSURSDJDWLRQ RI YLUXVIUHH HGLEOH DURLGV 7XUULDOED f *RRGLQJ *9 DQG 5RVV + (IIHFW RI WREDFFR HWFK YLUXV RQ \LHOG DQG PDUNHW YDOXH RI FRPPHUFLDO FXOWLYDUV RI EXUOH\ WREDFFR LQ 1RUWK &DUROLQD 7REDFFR 6FLHQFH ;79 SS 7REDFFR *RUEDOHQ\D $( 'RQFKHQNR $3 %OLQRY 90 DQG .RRQLQ (9 &\VWHLQH SURWHDVHV RI SRVLWLYH VWUDQG 51$ YLUXVHV DQG FK\PRWU\SVLQOLNH VHULQH SURWHDVHV $ GLVWLQFW SURWHLQ VXSHUIDPLO\ ZLWK D FRPPRQ VWUXFWXUDO IROG )(%6 /HWWHUV

PAGE 138

*RXJK .+ DQG 6KXNOD '' 7KH QXFOHRWLGH VHTXHQFH RI -RKQVRQJUDVV PRVDLF YLUXV JHQRPLF 51$ ,QWHUYLURORJ\ *UD\XP 0+ (YROXWLRQ DQG SK\ORJHQ\ RI WKH $UDFHDH $QQ 0LVVRXUL %RW *DUG *UDQLHU ) 'XUDQG7DUGLI 0 &DVVH'HOEDUW ) /HFRT + DQG 5REDJOLD & 0XWDWLRQV LQ ]XFFKLQL \HOORZ PRVDLF YLUXV KHOSHU FRPSRQHQW SURWHLQ DVVRFLDWHG ZLWK ORVV RI DSKLG WUDQVPLVVLELOLW\ *HQ 9LURO *UHEHU 56 DQG 6KDZ '( 'DVKHHQ PRVDLF YLUXV LQ 4XHHQVODQG $XVWU 3ODQW 3DWK *XQDVLQJKH 8% )ODVLVNL 6 1HOVRQ 56 DQG &DVVLG\ %* 1XFOHRWLGH VHTXHQFH DQG JHQRPH RUJDQL]DWLRQ RI SHDQXW VWULSH SRW\YLUXV *HQ 9LURO +DNNDDUW )$ DQG :DWHUUHXV +$-, $ YLUXV GLVHDVH RI 'LHMIHQEDFKLD n([RWLFDn $FWD+RUW +DUL 9 7KH 51$ RI WREDFFR HWFK YLUXV FRQWDLQV SRO\ $f 9LURORJ\ +DUL 9 7KH 51$ RI WREDFFR HWFK YLUXV )XUWKHU FKDUDFWHUL]DWLRQ DQG GHWHFWLRQ RI SURWHLQ OLQNHG WR 51$ 9LURORJ\ +DUULVRQ %' DQG 5RELQVRQ '0ROHFXODU YDULDWLRQV LQ YHFWRUERUQH SODQW YLUXVHV HSLGHPLRORJLFDO VLJQLILFDQFH 3KLO 7UDQV 5 6RF /RQG % +DUWPDQ 5' 'DVKHHQ PRVDLF YLUXV RI FXOWLYDWHG DURLGV DQG LWV FRQWURO E\ VHHG SURSDJDWLRQ DQG FXOWXUH RI VKRRW WLSV 3K 'LVVHUWDWLRQ 8QLYHUVLW\ RI )ORULGD *DLQHVYLOOH S +DUWPDQ 5' DQG =HWWOHU ): 'DVKHHQ PRVDLF YLUXV LQIHFWLRQV RI FRPPHUFLDO SODQWLQJV RI DURLGV LQ )ORULGD 3K\WRSDWKRORJ\ +HOOPDQQ *0 6KDZ -* DQG 5KRGHV 5( ,Q YLWUR DQDO\VLV RI WREDFFR YHLQ PRWWOLQJ YLUXV 1,D FLVWURQ HYLGHQFH IRU D YLUXV HQFRGHG SURWHDVH 9LURORJ\ +HOOPDQQ *0 7KRPEXU\ ': +LHEHUW ( 6KDZ -* 3LURQH 73 DQG 5KRDGV 5( &HOOIUHH WUDQVODWLRQ RI WREDFFR YHLQ PRWWOLQJ YLUXV 51$ ,, ,PPXQRSUHFLSLWDWLRQ RI SURGXFWV E\ DQWLVHUD WR F\OLQGULFDO LQFOXVLRQ QXFOHDU LQFOXVLRQ DQG KHOSHU FRPSRQHQW SURWHLQV 9LURORJ\

PAGE 139

+LHEHUW ( DQG &KDUXGDWWDQ 5 &KDUDFWHUL]DWLRQ RI DUDXMLD PRVDLF YLUXV E\ LQ YLWUR WUDQVODWLRQ DQDO\VHV 3K\WRSDWKRORJ\ +LHEHUW ( 7KRPEXU\ ': DQG 3LURQH 73 ,PPXQRSUHFLSLWDWLRQ DQDO\VLV RI SRW\YLUDO LQ YLWUR WUDQVODWLRQ SURGXFWV XVLQJ DQWLVHUD WR KHOSHU FRPSRQHQW RI WREDFFR YHLQ PRWWOLQJ YLUXV DQG SRWDWR YLUXV < 9LURORJ\ +ROOLQJV 0 DQG %UXQW $ $ 3RW\YLUXV JURXS &0,$$% 'HVFULSWLRQ RI 3ODQW 9LUXVHV 1R +X -6 0HOHLVHD 6 6KDDUDZ\ 0$ DQG =HWWOHU ): 'LVWULEXWLRQ DQG LQFLGHQFH RI GDVKHHQ PRVDLF SRW\YLUXV LQIHFWLQJ WDUR LQ +DZDLL $XVWUDODVLDQ 3ODQW 3DWKRO LQ SUHVVf +XOO 5 7KH PRYHPHQW RI YLUXVHV ZLWKLQ SODQWV 6HPLQ 9LURO +XVWHG %HFK $OEUHFKWVHQ 0 DQG %RUNKDUGW % ,GHQWLILFDWLRQ SDUWLDO VHTXHQFLQJ DQG GHWHFWLRQ RI D SRW\YLUXV IURP .DODQFKRH EORVVIHOGLDQD 3K\WRSDWKRORJ\ -DFNVRQ *9+ $ YLUXV GLVHDVH RI WDUR LQ )UHQFK 3RO\QHVLD 5HSRUW WR WKH 6RXWK 3DFLILF &RPPLVVLRQ 1RXPHD 1HZ &DOHGRQLD S -DJDGLVK 01 :DUG &: *RXJK .+ 7XOORFK 3$ DQG 6KXNOD '' ([SUHVVLRQ RI SRW\YLUXV FRDW SURWHLQ LQ (VFKHULFKLD FROL DQG \HDVW DQG LWV DVVHPEO\ LQWR YLUXVOLNH SDUWLFOHV *HQ 9LURO -DPHV 5 .HQWHQ 5+ DQG :RRGV 5' 9LUXVOLNH SDUWLFOHV DVVRFLDWHG ZLWK WZR GLVHDVHV RI &RORFDVLD HVFXOHQWD /f 6FKRWW LQ WKH 6RORPRQ ,VODQGV *HQ 9LURO -D\DUDP &+ +LOO -+ DQG 0LOOHU :$ &RPSOHWH QXFOHRWLGH VHTXHQFH RI WZR VR\EHDQ PRVDLF YLUXV VWUDLQV GLIIHUHQWLDWHG E\ UHVSRQVH RI VR\EHDQ FRQWDLQLQJ WKH 5VY UHVLVWDQFH JHQH *HQ 9LURO -RKDQVHQ 5 5DVPXVVHQ 2 ) +HLGH 0 DQG %RUNKDUGW % 7KH FRPSOHWH QXFOHRWLGH VHTXHQFH RI SHD VHHGERUQH PRVDLF YLUXV 51$ *HQ 9LURO -RUGDQ 5 3RW\YLUXVHV PRQRFORQDO DQWLERGLHV DQG DQWLJHQLF VLWHV ,Q %DUQHWW 2: HGf 3RW\YLUXV 7D[RQRP\ 6SULQJHU9HUODJ :LHQ DQG 1HZ 6XSSOHPHQW@ f SS .DPHU DQG $UJRV 3 3ULPDU\ VWUXFWXUDO FRPSDULVRQ RI 51$GHSHQGHQW SRO\PHUDVHV IURP SODQW DQLPDO DQG EDFWHULDO YLUXV 51$ 1XFOHLF $FLGV 5HV

PAGE 140

.DQLHZVNL : /DZVRQ & 6DPPRQV % +DOH\ / DQG +DUW )LHOG UHVLVWDQFH RI WUDQVJHQLF 5XVVHW %XUEDQN SRWDWR WR HIIHFWV RI LQIHFWLRQ E\ SRWDWR YLUXV ; DQG < %LR7HFKQRORJ\ .DVVDQLV % ,QWUDQXFOHDU LQFOXVLRQV LQ YLUXV LQIHFWHG SODQWV $QQ $SSO %LRO .HQWHQ 5+ DQG :RRGV 5' 9LUXVHV RI &RORFDVLD HVFDOHQWD DQG ;DQWKRVRPD VDJLWWLIROLXP 3HVWLFLGH $UWLFOHV DQG 1HZV 6XPPDULHV .KDQ -$ /RKXLV *ROGEDFK 5 DQG 'LMNVWUD 6HTXHQFH GDWD WR VHWWOH WKH WD[RQRPLF SRVLWLRQ RI EHDQ FRPPRQ PRVDLF YLUXV DQG EODFNH\H FRZSHD PRVDLF YLUXV LVRODWHV *HQ 9LURO .RVLWUDWDQD : ,GHQWLILFDWLRQ FKDUDFWHUL]DWLRQ DQG GHWHFWLRQ RI GDVKHHQ PRVDLF YLUXV LQ &KLQHVH HYHUJUHHQ SODQWV $JODRQHPD FRPPXWDWXPf LQ &DOLIRUQLD 3K' 'LVVHUWDWLRQ 8QLYHUVLW\ RI &DOLIRUQLD 5LYHUVLGH S .RVLWUDWDQD : :HDWKHUV /* DQG *XPSI ''DVKHHQ PRVDLF YLUXV LQ &KLQHVH HYHUJUHHQ SODQWV LQ &DOLIRUQLD 3K\WRSDWKRORJ\ .XPXUR < DQG $VX\DPD + 6WXGLHV RQ FXFXPEHU PRVDLF YLUXV Q 7KH LVRODWLRQ RI WKH YLUXV IURP YDULRXV SODQWV VKRZLQJ PRVDLF LQ WKH YLFLQLW\ RI 7RN\R -DSDQ $QQX 3K\WRSDWKRO 6RF -DSDQ .\WH DQG 'RROLWWOH 5) $ VLPSOH PHWKRG IRU GLVSOD\LQJ WKH K\GURSDWKLF FKDUDFWHU RI D SURWHLQ 0RO %LRO /DLQ 6 0DUWLQ 07 5LHFKPDQQ -/ DQG *DUFLD -$ 1RYHO FDWDO\WLF DFWLYLW\ DVVRFLDWHG ZLWK SRVLWLYHVWUDQG 51$ YLUXV LQIHFWLRQ QXFOHLF DFLGVWLPXODWHG $73DVH DFWLYLW\ RI WKH SOXP SR[ SRW\YLUXV KHOLFDVH OLNH SURWHLQ 9LURO /DLQ 6 5LHFKPDQQ / 0DUWLQ 0 7 DQG *DUFLD $ 1XFOHRWLGH VHTXHQFH RI WKH n WHUPLQDO UHJLRQ RI SOXP SR[ SRW\YLUXV 51$ 9LUXV 5HV /DLQ 6 5LHFKPDQQ / DQG *DUFLD -$ 7KH FRPSOHWH QXFOHRWLGH VHTXHQFH RI SOXP SR[ YLUXV 51$ 9LUXV 5HV /DLQ 6 5LHFKPDQQ -/ DQG *DUFLD -$ 51$ KHOLFDVH D QRYHO DFWLYLW\ DVVRFLDWHG ZLWK D SURWHLQ HQFRGHG E\ D SRVLWLYH VWUDQG 51$ YLUXV 1XFOHLF $FLGV 5HV /DQJHQEHUJ :* 9LUXV SURWHLQ DVVRFLDWHG ZLWK F\OLQGULFDO LQFOXVLRQ RI WZR YLUXVHV WKDW LQIHFW ZKHDW *HQ 9LURO

PAGE 141

/DQJHYHOG 6 'RUH -0 0HPHOLQN 'HUNV $ YDQ GHU 9OXJW & $VMHV & DQG %RO ,GHQWLILFDWLRQ RI SRW\YLUXVHV XVLQJ WKH SRO\PHUDVH FKDLQ UHDFWLRQ ZLWK GHJHQHUDWH SULPHUV *HQ 9LURO /DZVRQ 5+ DQG +HDURQ 66 7KH DVVRFLDWLRQ RI SLQZKHHO LQFOXVLRQV ZLWK SODVPRGHVPDWD 9LURORJ\ /HVHPDQQ '( &\WRSDWKRORJ\ ,Q 7KH 3ODQW 9LUXVHV 9RO 7KH )LODPHQWRXV 3ODQW 9LUXVHV (G 0LOQH 5*f SS 1HZ 6XSSOHPHQW@ f SS /L 5+ =HWWOHU ): (OOLRWW 06 3HWHUVHQ 0$ 6WLOO 3$ %DNHU &$ DQG 0LQN *, $ VWUDLQ RI SHDQXW PRWWOH YLUXV VHHGERPH LQ EDPEDUUD JURXQGQXW 3ODQW 'LV /L 5+ =HWWOHU ): %DNHU &$ 3XUFLLXOO '( +LHEHUW ( DQG :LVOHU *& 9DULDELOLW\ RI FDSVLG SURWHLQ VL]H DPRQJ GDVKHHQ PRVDLF YLUXV '09f LVRODWHV 3K\WRSDWKRORJ\ $EVWUf /L 5+ =HWWOHU ): DQG +LHEHUW ( 1XFOHRWLGH VHTXHQFH DQG H[SUHVVLRQ RI WKH FRDW SURWHLQ &3f JHQH RI D GDVKHHQ PRVDLF YLUXV LVRODWH 'V09&Kf IURP &DODGLXP 3K\WRSDWKRORJ\ /LQGER -$ DQG 'RXJKHUW\ :* 3DWKRJHQGHULYHG UHVLVWDQFH WR D SRW\YLUXV LPPXQH DQG UHVLVWDQW SKHQRW\SHV LQ WUDQVJHQLF WREDFFR H[SUHVVLQJ DOWHUHG IRUPV RI D SRW\YLUXV FRDW SURWHLQ QXFOHRWLGH VHTXHQFH 0RO 3ODQW0LFUREH ,QWHUDFW /LQJ 1DPED 6 *RQVDOYHV & 6OLJKWRP -& DQG *RQVDOYHV 3URWHFWLRQ DJDLQVW GHWULPHQWDO HIIHFWV RI SRW\YLUXV LQIHFWLRQ LQ WUDQVJHQLF WREDFFR SODQWV H[SUHVVLQJ WKH SDSD\D ULQJVSRW YLUXV FRDW SURWHLQ JHQH %LR7HFKQRORJ\ /RYLVROR DQG &RQWL 0$& %LRORJLFDO FKDUDFWHUL]DWLRQ RI VRPH LVRODWHV RI FXFXPEHU PRVDLF YLUXV $QQDOHV GH 3K\WRSDWKRORJLH 0DLVV ( 7LPSH 8 %ULVVNH $ -HONPDQQ : &DVSHU 5 +LPPOHU 0DWWDQRYLFK DQG .DWLQJHU + : 7KH FRPSOHWH QXFOHRWLGH VHTXHQFH RI SOXP SR[ YLUXV 51$ *HQ 9LURO

PAGE 142

0DUWLQ 07 DQG *DUFLD -$ 3OXP SR[ SRW\YLUXV 51$ UHSOLFDWLRQ LQ D FUXGH PHPEUDQH IUDFWLRQ IURP LQIHFWHG 1LFRWLFPD FOHYHODQGLL OHDYHV *HQ 9LURO 0DWWKHZV 5() 3ODQW 9LURORJ\ UG HGf $FDGHPLF 3UHVV ,QF 6DQ 'LHJR &DOLIRUQLD S 0F&DUW\ '5 +DWWRUL 7 &DUVRQ &% 9DVLO 9 /D]DU 0 DQG 9DVLO ,. 7KH YLYLSDURXV GHYHORSPHQWDO JHQH RI PDL]H HQFRGHV D QRYHO WUDQVFULSWLRQDO DFWLYDWRU &HOO 0RUDOHV )DQG =HWWOHU ): $SKLG WUDQVPLVVLRQ FKDUDFWHULVWLFV RI GDVKHHQ PRVDLF YLUXV )LWRSDWKRO &RORPELDQD 0XUDQW $) DQG 5REHUWV ,0 &\OLQGULFDO LQFOXVLRQV LQ FRULDQGHU OHDI FHOOV LQIHFWHG ZLWK SDUVQLS PRVDLF YLUXV *HQ 9LURO 0XUSK\ )$ )DXTXHW &0 %LVKRS '+/ *KDEULDO 6$ -DUYLV $: 0DUWHOOL *3 0D\R 0$ DQG 6XPPHUV 0' &ODVVLILFDWLRQ DQG 1RPHQFODWXUH RI 9LUXVHV 6L[WK 5HSRUW RI WKH ,QWHUQDWLRQDO &RPPLWWHH RQ 7D[RQRP\ RI 9LUXVHV $UFK 9LURO 6XSSOHPHQW f 6SULQJHU9HUODJ :LHQ 1HZ
PAGE 143

3DOXGDQ 1 DQG %HJWUXS 'LHMIHQEDFKLD PDFXODWD /RGGf 'RQ 9LUXV DWWDFN LQ 'DQLVK FXOWXUHV VXUYH\ DQG GLDJQRVLV 'DQLVK 5HV 6HUY IRU 3ODQW DQG 6RLO 6FL 5HSRUW 1R 3DUNV 7' DQG 'RXJKHUW\ :* 6XEVWUDWH UHFRJQLWLRQ E\ WKH 1,D SURWHLQDVH RI WZR SRW\YLUXVHV LQYROYHV PXOWLSOH GRPDLQV &KDUDFWHUL]DWLRQ XVLQJ JHQHWLFDOO\ HQJLQHHUHG K\EULG SURWHLQDVH PROHFXOHV 9LURORJ\ 3DSSX 66 3DSSX +5 5\ELFNL (5 DQG 1LEOHWW &/ $ SRO\PHUDVH FKDLQ UHDFWLRQ PHWKRG DGDSWHG IRU VHOHFWLYH DPSOLILFDWLRQ DQG FORQLQJ RI fVHTXHQFHV RI SRW\YLUDO JHQRPHV DSSOLFDWLRQ WR GDVKHHQ PRVDLF YLUXV 9LURO 0HWKRGV 3DSSX 66 3DSSX +5 5\ELFNL (5 DQG 1LEOHWW &/ D 8QXVXDO DPLQR WHUPLQDO VHTXHQFH FKDUDFWHUL]HV WKH FDSVLG SURWHLQ RI GDVKHHQ PRVDLF YLUXV *HQ 9LURO 3DSSX 66 3DSSX +5 /DVWUD 5 DQG 1LEOHWW &/ E 9DULDELOLW\ LQ WKH OHQJWK RI WKH DPLQR WHUPLQDO VHTXHQFH FRQWULEXWHV WR WKH FDSVLG SURWHLQ GLYHUVLW\ DPRQJ GDVKHHQ PRVDLF SRW\YLUXV LVRODWHV $UFK 9LURO 3LURQH 73 DQG 7KRPEXU\ ': 5ROH RI YLULRQ DQG KHOSHU FRPSRQHQW LQ UHJXODWLQJ DSKLG WUDQVPLVVLRQ RI WREDFFR HWFK YLUXV 3K\WRSDWKRORJ\ 3RFK 2 6DXYDJHW 'HODUXH 0 DQG 7RUGR 1 ,GHQWLILFDWLRQ RI IRXU FRQVHUYHG PRWLIV DPRQJ WKH 51$GHSHQGHQW SRO\PHUDVH HQFRGLQJ HOHPHQWV (0%2 3XUFLILLOO '( DQG %DWFKHORU '/ ,PPXQRGLILLLVLRQ WHVWV ZLWK VRGLXP GRGHF\O VXOIDWH 6'6f WUHDWHG SODQW YLUXVHV DQG SODQW YLUDO LQFOXVLRQV )OD $JULH ([S 6WQ 7HFK %XOO SS 3XXUDQG 8 0DNLQHQ 3DXOLQ / DQG 6DDUPD 0 7KH FRPSOHWH QXFOHRWLGH VHTXHQFH RI SRWDWR YLUXV $ $ JHQRPLF 51$ DQG LWV VHTXHQFH VLPLODULWLHV ZLWK RWKHU SRW\YLUXVHV *HQ 9LURO 4XHPDGD + /n+RVWLV % *RQVDOYHV 5HDUGRQ 0 +HLQULNVRQ 5 +LHEHUW ( 6LHX / & DQG 6OLJKWRP / D 7KH QXFOHRWLGH VHTXHQFH RI WKH nWHUPLQDO UHJLRQ RI SDSD\D ULQJVSRW YLUXV VWUDLQV : DQG 3 *HQ 9LURO 4XHPDGD + 6LHX / & 6LHPLHQLDN 5 *RQVDOYHV DQG 6OLJKWRP / E :DWHUPHORQ PRVDLF YLUXV ,, DQG ]XFFKLQL \HOORZ PRVDLF YLUXV FORQLQJ RI nWHUPLQDO UHJLRQV QXFOHRWLGH VHTXHQFHV DQG SK\ORJHQHWLF FRPSDULVRQV *HQ 9LURO 4XLQWHUR 6 >9LURVLV LQ WDUGDV ;DQOKRVRPD VSf DQG WDUR &RORFDVLD HVFXOHQWDf LQ &XED@ $JURWHFQLD GH &XED f

PAGE 144

5DPLUH] 3 >,VRODWLRQ DQG FKDUDFWHUL]DWLRQ RI GDVKHHQ PRVDLF YLUXV LQ &RVWD 5LFD@ 7XUULDOED f 5DQD */ 9RYODV & DQG =HWWOHU ): 0DQXDO WUDQVPLVVLRQ RI GDVKHHQ PRVDLF YLUXV IURP 5LFKDUGLD WR QRQDUDFHRXV KRVWV 3ODQW 'LV 5HJQHU ) GD &DPDUD0DFKDGR 0/ 6WHLQNH8QHU + DQG 0DWWDQRYLFK &RDW SURWHLQ PHGLDWHG UHVLVWDQFH WR SOXP SR[ YLUXV LQ 1LFRWLDQD FOHYHOFXLGLL DQG 1 EHQWKDPLDQD 3ODQW &HOO 5HSWV 5HVWUHSR+DUWZLJ 0$ DQG &DUULQJWRQ -& 5HJXODWLRQ RI QXFOHDU WUDQVSRUW RI D SODQW SRW\YLUXV SURWHLQ E\ DXWRSURWHRO\VLV 9LURO 5LHFKPDQQ -/ /DLQ 6 DQG *DUFLD $ 7KH JHQRPHOLQNHG SURWHLQ DQG f 51$ VHTXHQFH RI SOXP SR[ SRW\YLUXV *HQ 9LURO 5LHFKPDQQ -/ /DLQ 6 DQG *DUFLD $ ,GHQWLILFDWLRQ RI WKH LQLWLDWLRQ FRGRQ RI SOXP SR[ SRW\YLUXV JHQRPLF 51$ 9LURORJ\ 5LHFKPDQQ -/ /DLQ 6 DQG *DUFLD -$ +LJKOLJKWV DQG SURVSHFWV RI SRW\YLUXV PROHFXODU ELRORJ\ *HQ 9LURO 5RGUJXH]&HUH]R ( .OHLQ 3 DQG 6KDZ $ GHWHUPLQDQW RI GLVHDVH V\PSWRP VHYHULW\ LV ORFDWHG LQ WKH nWHUPLQDO QRQFRGLQJ UHJLRQ RI WKH 51$ RI D SODQW YLUXV 3URF 1DWO $FDG 6FL 86$ 5REDJOLD & 'XUDQG7DUGLI 0 7URQFKHW 0 %RXGD]LQ $VWLHU0DQLIDFLHU 6 DQG &DVVH'HOEDUW ) 1XFOHRWLGH VHTXHQFH RI SRWDWR YLUXV < 1 VWUDLQf JHQRPLF 51$ *HQ 9LURO 5REHUWVRQ 1/ )UHQFK 5 DQG *DU\ 60 8VH RI JURXSVSHFLILF SULPHUV DQG WKH SRO\PHUDVH FKDLQ UHDFWLRQ IRU WKH GHWHFWLRQ DQG LGHQWLILFDWLRQ RI OXWHRYLUXVHV *HQ 9LURO 5RGRQL 6& DQG 0RUDQ -5 7KH GHWHFWLRQ RI GDVKHHQ PRVDLF YLUXV XVLQJ WKH HQ]\PH OLQNHG LPPXQRVRUEHQW DVVD\ (/,6$f $FWD +RUW 5RMDV 05 *LOEHUWVRQ 5/ 5XVVHOO '5 DQG 0D[ZHOO 3 8VH RI GHJHQHUDWH SULPHUV LQ WKH SRO\PHUDVH FKDLQ UHDFWLRQ WR GHWHFW ZKLWHIO\WUDQVPLWWHG JHPLQLYLUXVHV 3ODQW 'LV

PAGE 145

5RZKDQL $ &KD\ & *ROLQR '$ DQG )DON %: 'HYHORSPHQW RI D SRO\PHUDVH FKDLQ UHDFWLRQ WHFKQLTXH IRU WKH GHWHFWLRQ RI JUDSHYLQH IDQOHDI YLUXV LQ JUDSHYLQH WLVVXH 3K\WRSDWKRORJ\ 6DORPRQ 5 DQG 5DFFDK % 7KH UROH RI WKH 1WHUPLQXV RI SRW\YLUXV FRDW SURWHLQ LQ DSKLG WUDQVPLVVLRQ $EVWU SS 9P ,QW &RQJ 9LURO %HUOLQ $XJ 6DPEURRN )ULWVFK () DQG 0DQLDWLV 7 0ROHFXODU &ORQLQJ $ /DERUDWRU\ 0DQXDO QG HG 9RO &ROG 6SULQJ +DUERU /DERUDWRU\ &ROG 6SULQJ +DUERU 1< 6DP\Q DQG :HOYDHUW : 'DVKHHQ PRVDLF YLUXV RI VRPH $UDFHDH VSHFLHV 0HG )DF /DQGERXZZ 5LMNVXQLY *HQW 6DQR < YDQ GHU 9OXJW 5 GH +DDQ 3 7DNDKDVKL $ .DZDNDPL 0 *ROGEDFK 5 DQG .RMLPD 0 2Q WKH YDULDELOLW\ RI WKH fWHUPLQDO VHTXHQFH RI WKH WXUQLS PRVDLF YLUXV JHQRPH $UFK 9LURO 6FRU]D 5 5DYHORQDQDUG 0 &DOODKDQ $0 &RUGWV -0 )XFKV 0 'XQH] DQG *RQVDOYHV 7UDQVJHQLF SOXP 3ULPXV GRPHVWLFD /f H[SUHVVHV WKH SOXP SR[ YLUXV FRDW SURWHLQ JHQH 3ODQW &HOO 5HSWV 6KDKDEXGGLQ 0 6KDZ -* DQG 5KRDGV 5( 0DSSLQJ RI WKH WREDFFR YHLQ PRWWOLQJ YLUXV 93J FLVWURQ 9LURORJ\ 6KDQPXJDQDWKDQ 1 9LUXV DQG YLUXVOLNH GLVHDVHV RI SODQWV LQ WKH *LOEHUW ,VODQGV )$2 3ODQW 3URWHFW %XOO 6KDZ ( 3OXPE 5 7 DQG -DFNVRQ -9+ 9LUXV GLVHDVHV RI WDUR &RORFDVLD HVFXOHQWDf DQG ;DQWKRVRPD VS LQ 3DSXD 1HZ *XQLHD 3DSXD 1HZ *XLQHD $JULH 6KHIILHOG )0/ 7KH F\WRSODVPLF DQG QXFOHDU LQFOXVLRQV DVVRFLDWHG ZLWK VHYHUH HWFK YLUXV 5R\DO 0LFURVFRS 6RF 6KLPR\DPD +DQDGD .DPH\D,ZDNL 0 7RFKLKDUD + DQG *XQML 7 1HFURWLF VWXQW GLVHDVH RI NRQMDN $PRUSKRSKDOOXV NRQMDF FDXVHG E\ FXFXPEHU PRVDLF YLUXV $QQ 3K\WRSDWKRO 6RF -DSDQ 6KLPR\DPD +DQDGD 7VXGD 6 .DPH\D,ZDNL 0 DQG *XQML 7 D 6RPH SK\VLFRFKHPLFDO DQG VHURORJLFDO SURSHUWLHV RI NRQMDN PRVDLF YLUXV DQG GDVKHHQ PRVDLF YLUXV $QQ 3K\WRSDWKRO 6RF -DSDQ

PAGE 146

6KLPR\DPD .DPH\D,ZDNL 0 +DQDGD DQG *XQML 7 E .RQMDN PRVDLF YLUXV D QHZ SRW\YLUXV LQIHFWLQJ NRQMDN $PRUSKRSKDOOXV NRQMDN $QQ 3K\WRSDWKRO 6RF -DSDQ 6KXNOD '' 6WULNH 30 7UDF\ 6/ *RXJK ./ DQG :DUG &: 7KH 1 DQG & WHUPLQL RI WKH FRDW SURWHLQV RI SRW\YLUXVHV DUH VXUIDFHORFDWHG DQG WKH 1 WHUPLQXV FRQWDLQV WKH PDMRU YLUXVVSHFLILF HSLWRSHV *HQ 9LURO 6KXNOD '' DQG :DUG &: $PLQR DFLG VHTXHQFH KRPRORJ\ RI FRDW SURWHLQ DV D EDVLV IRU LGHQWLILFDWLRQ DQG FODVVLILFDWLRQ RI WKH SRW\YLUXV JURXS *HQ 9LURO 6KXNOD '' DQG :DUG *: 6WUXFWXUH RI SRW\YLUXV FRDW SURWHLQV DQG LWV DSSOLFDWLRQ LQ WKH WD[RQRP\ RI WKH SRW\YLUXV JURXS $GY 9LUXV 5HV 6KXNOD '' :DUG &: DQG %UXQW $$ 3RW\YLULGDH &$% ,QWHUQDWLRQDO :DOOLQJIRUG 8. 6LDZ 0)( 6KDKDEXGGLQ 0/ %DOODUG 6 DQG 6KDZ -* ,GHQWLILFDWLRQ RI D SURWHLQ FRYDOHQWO\ OLQNHG WR WKH n WHUPLQDO RI WREDFFR YHLQ PRWWOLQJ YLUXV 51$ 9LURORJ\ 6PLWK *5 DQG YDQ GH 9HOGH 5 'HWHFWLRQ RI VXJDUFDQH PRVDLF YLUXV DQG )LML GLVHDVH YLUXV LQ GLVHDVHG VXJDUFDQH XVLQJ WKH SRO\PHUDVH FKDLQ UHDFWLRQ 3ODQW 'LV 6SLHJHO 6 )ULVRQ ($ DQG &RQYHUVH 5+ 5HFHQW GHYHORSPHQWV LQ WKHUDS\ DQG YLUXVGHWHFWLRQ SURFHGXUHV IRU LQWHUQDWLRQDO PRYHPHQW RI FORQDO SODQW JHUP SODVP 3ODQW 'LV 6WDUN '0 DQG %HDFK\ 51 3URWHFWLRQ DJDLQVW SRW\YLUXV LQIHFWLRQ LQ WUDQVJHQLF SODQWV HYLGHQFH IRU EURDG VSHFWUXP UHVLVWDQFH %LR7HFKQRORJ\ 7KROH 9 'DOPD\ 7 %XUJ\DQ DQG %DOD]V ( &ORQLQJ DQG VHTXHQFH RI SRWDWR YLUXV < +XQJDULDQ LVRODWHf JHQRPLF 51$ *HQH 7KRPEXU\ ': +HOOPDQQ *0 5KRDGV 5( DQG 3LURQH 73 3XULILFDWLRQ DQG FKDUDFWHUL]DWLRQ RI SRW\YLUXV KHOSHU FRPSRQHQW 9LURORJ\ 7KRPEXU\ ': 3DWWHUVRQ &$ 'HVVHQV -7 DQG 3LURQH 73 &RPSDUDWLYH VHTXHQFH RI WKH KHOSHU FRPSRQHQW +&f UHJLRQ RI SRWDWR YLUXV < DQG D +&GHIHFWLYH VWUDLQ SRWDWR YLUXV & 9LURORJ\ 7KRPEXU\ ': DQG 3LURQH 73 +HOSHU FRPSRQHQW RI WZR SRW\YLUXVHV DUH VHURORJLFDOO\ GLVWLQFW 9LURORJ\

PAGE 147

7RPSNLQV &0 DQG 6HYHULQ ++3 6SRWWHG ZLOW RI ZKLWH \HOORZ DQG SLQN FDOOD +LOJDUGLD 7RR\DPD $ ,QGLFDWRU SODQWV IRU GDVKHHQ PRVDLF YLUXV $QQ 3K\WRSDWKRO 6RF -DSDQ 7XUSQ 7 0ROHFXODU FORQLQJ RI D SRWDWR YLUXV < JHQRPH QXFOHRWLGH VHTXHQFH KRPRORJ\ LQ QRQFRGLQJ UHJLRQV RI SRW\YLUXVHV *HQ 9LURO 8 6 %XUHDX RI WKH &HQVXV 8 6 &HQVXV RI $JULFXOWXUH 9RO 9 6SHFLDO 5HSRUWV 3DUW +RUWLFXOWXUH 6SHFLDOWLHV :DVKLQJWRQ & 8 6 *RYHUQPHQW 3ULQWLQJ 2IILFH 8\HGD %HDQ \HOORZ PRVDLF YLUXV VXEJURXS 6HDUFK IRU WKH JURXS VSHFLILF VHTXHQFHV LQ WKH f WHUPLQDO UHJLRQ RI WKH JHQRPH ,Q %DUQHWW 2: HGf 3RW\YLUXV 7D[RQRP\ 6SULQJHU9HUODJ :LHQ DQG 1HZ 6XSSOHPHQW@ f SS 9DQ GHU 0HHU ): 2FFXUUHQFH RI GDVKHHQ PRVDLF YLUXV LQ 6RXWK $IULFD 3K\WRSK\ODFWLFD 9DQFH 9% 0RRUH 7XUSQ 7+ %UDFNHU $ DQG +ROORZHOO 9& 7KH FRPSOHWH QXFOHRWLGH VHTXHQFH RI SHSSHU PRWWOH YLUXV JHQRPLF 51$ &RPSDULVRQ RI WKH HQFRGHG SRO\SURWHLQ ZLWK WKRVH RI RWKHU VHTXHQFHG SRW\YLUXVHV 9LURORJ\ 9HUFKRW DQG &DUULQJWRQ -& 'HELOLWDWLRQ RI SODQW SRW\YLUXV LQIHFWLYLW\ E\ 3, SURWHLQDVHLQDFWLYDWLQJ PXWDWLRQV DQG UHVWRUDWLRQ E\ VHFRQGVLWH PRGLILFDWLRQV 9LURO 9HUFKRW .RRQLQ (9 DQG &DUULQJWRQ -& 7KH N'D SURWHLQ IURP WKH 1 WHUPLQXV RI D SRW\YLUDO SRO\SURWHLQ IXQFWLRQV DV D WKLUG YLUXVHQFRGHG SURWHLQDVH 9LURORJ\ 9ROLQ 5% 7KRWWDSSLOO\ 5RVVHO +: DQG 7HUU\ (5 ,VRODWLRQ RI GDVKHHQ PRVDLF YLUXV LQ 1LJHULD DQG VFUHHQLQJ FRFR\DP VHHGOLQJ SRSXODWLRQV IRU UHVLVWDQFH 3K\WRSDWKRORJ\ 9XQVK 3 5RVQHU $ DQG 6WHLQ $ 7KH XVH RI WKH SRO\PHUDVH FKDLQ UHDFWLRQV 3&5f IRU WKH GHWHFWLRQ RI EHDQ \HOORZ PRVDLF YLUXV LQ JODGLROXV $QQ $SSO %LRO :HW]HO 7 &DQGUHVVH 7 5DZHORQDQGUR DQG 'XQH] D $ SRO\PHUDVH FKDLQ UHDFWLRQ DVVD\ DGDSWHG WR SOXP SR[ SRW\YLUXV GHWHFWLRQ 9LURO 0HWKRGV

PAGE 148

:HW]HO 7 &DQGUHVVH 7 5DZHORQDQGUR 0 'HOERV 5 3 0D]\DG + $ERXO$WD $ ( DQG 'XQH] E 1XFOHRWLGH VHTXHQFH RI WKH nWHUPLQDO UHJLRQ RI WKH 51$ RI WKH (O $PDU VWUDLQ RI SOXP SR[ SRW\YLUXV *HQ 9LURO :LVOHU *& &KDUDFWHUL]DWLRQ RI WKH 3, SURWHLQ RI WKH ]XFFKLQL \HOORZ PRVDLF SRW\YLUXV 3K' 'LVVHUWDWLRQ 8QLYHUVLW\ RI )ORULGD *DLQHVYLOOH S :LVOHU *& 3XUFLIXOO '( DQG +LHEHUW ( &KDUDFWHUL]DWLRQ RI WKH 3, SURWHLQ DQG FRGLQJ UHJLRQ RI WKH ]XFFKLQL \HOORZ PRVDLF YLUXV *HQ 9LURO :LVOHU *& =HWWOHU ): DQG 0F5LWFKLH -'DVKHHQ PRVDLF YLUXV LQIHFWLRQV RI SKLORGHQGURQV LQ )ORULGD 3URF )OD 6WDWH +RUW 6RF ;LDR ;: )UHQNHO 07HDNOH '6 :DUG &: DQG 6KXNOD '' 6HTXHQFH GLYHUVLW\ LQ WKH VXUIDFHH[SRVHG DPLQRWHUPLQDO UHJLRQ RI WKH FRDW SURWHLQV RI VHYHQ VWUDLQV RI VXJDUFDQH PRVDLF YLUXV FRUUHODWHG ZLWK WKHLU KRVW UDQJH $UFK 9LURO
PAGE 149

=HWWOHU ): -DFNVRQ *9+ DQG )ULVRQ ($ )$2,%3*5 7HFKQLFDO *XLGHOLQHV IRU WKH 6DIH 0RYHPHQW RI (GLEOH $URLG *HUPSODVP )RRG DQG $JULFXOWXUH RI WKH 8QLWHG 6WDWHV 5RPH,QWHPDWLRQDO %RDUG IRU 3ODQW *HQHWLF 5HVRXUFHV 5RPH S =HWWOHU ): 7VDL -+ )DDQ +& .H & DQG /X .& 'DVKHHQ PRVDLF YLUXV LQIHFWLQJ WDUR LQ 3HRSOHfV 5HSXEOLF RI &KLQD 3ODQW 'LV =KHQJ < .RVLWUDWDQD :& DQG *XPSI ''HWHFWLRQ RI SODQW YLUXVHV XVLQJ GRW LPPXQRELQGLQJ DVVD\ &KLQHVH 9LURO

PAGE 150

%,2*5$3+,&$/ 6.(7&+ 5XKXL /L ZDV ERP LQ .XQPLQJ 3 5 &KLQD RQ 0DUFK 6KH JUDGXDWHG IURP
PAGE 151

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHL DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ RSLQLRQ LW FRQIRUPV WR VFRSH DQG TXDOLW\ ) : =HWWOHU &KDLUPDQ 3URIHVVRU RI 3ODQW 3DWKRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ (UQHVW +LHEHUW &RFKDLUPDQ 3URIHVVRU RI 3ODQW 3DWKRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ e W8 'DQ ( 3XUFLIXOO 3URIHVVRU RI 3ODQW 3DWKRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ &KDUOHV / *X\ $VVRFLDWH 3URIHVVRU RI +RULLFXOWXUH 7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI $JULFXOWXUH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 7 $XJXVW 'HDQ &ROOHJH RI $JULFXOWXUH 'HDQ *UDGXDWH 6FKRRO

PAGE 152

/' f ,U ,WL RI IORULGD D On} } +8 ‘18% ,,