RELATIONSHIP OF THE Vibrio vulnificus GROUP 1-LIKE CAPSULAR
POLYSACCHARIDE OPERON TO PHASE VARIATION
By
MARIA A. CHATZIDAKI
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2004
Copyright 2004
by
Maria A. Chatzidaki
This dissertation is dedicated to my parents Andreas and Eleni, my sister Stella and the
love of my life, Grigorios Livanis who made this happen.
ACKNOWLEDGMENTS
First and foremost, I would like to express my deep gratitude and sincere
appreciation to my advisor, Dr. Anita C. Wright, for her outstanding guidance,
encouragement and advice during my graduate studies and the development of this
dissertation. She has always been a source of motivation and inspiration. I would like
especially to acknowledge Dr. Paul Gulig for the discussions and advice, and for
generously providing me with valuable sequencing data, all of which contributed to the
completion of this dissertation. Sincere appreciation is also extended to the other
members of my committee, Dr. Doug Archer and Dr. Gary Rodrick, for their guidance,
and constructive criticisms that led to improvements in this dissertation.
I would like to express my immensurable gratitude to my parents, Andreas and
Eleni Chatzidaki, and my sister, Stella, for their continuous love and moral support,
despite the distance. I especially thank my parents who taught me that I could achieve
anything that I committed myself to fully. In the last years of my studies I was privileged
to have a very good friend around, loannis Livanis, studying at the same University
whose humor and support made those years more enjoyable.
Finally, I would like to express my deepest love and gratitude to my partner in life,
Grigorios Livanis, for all of his love, support and sacrifice. Without him by my side I
would not have reached my goals successfully. Words cannot express how thankful I am
to be sharing my life with someone so loving, patient and thoughtful.
TABLE OF CONTENTS
Page
ACKNOWLEDGMENTS ................................................................................................. i
LIST O F TA BLES .......................................................................................................... vii
LIST O F FIG U RE S .................................................................................................. iii
A B ST R A C T .............................................. ................................................................ ix
CHAPTER
I IN TR O D U CTIO N ................................................................................................... 1
Vibrio vulnficus......................................................................................................1
V vulnificus D isease................................................................................................3
Distribution of V. vulnifcus...................................................................................... 5
V vulnificus Pathogenesis .......................................................................................6
V vulnificus Capsular Polysaccharide..................................................................... 8
Capsular Polysaccharide Assembly ....................................................................... 10
Mechanisms of Phase Variation ............................................................................13
Focus of the Present Study ....................................................................................20
Specific Aim 1: Investigate Gene Organization in V. vulnificus CPS Operon..........20
Specific Aim 2: Examine the Conservation and Distribution of CPS
Genes Among V. vulnificus Strains, Vibrio spp. or Different Species .................21
Specific Aim 3: Examine the Genetic Basis for Phase Variation.............................22
2 MATERIALS AND METHODS ..........................................................................23
Bacterial Strains and Culture Conditions ..............................................................23
D N A C loning......................................... .............................................................23
DNA Sequence Analysis ........................................................................................25
Restriction Fragment Length Polymorphism.........................................................25
Complementation ofwzbv in V. vulnificus MO6-24/T Phase Variant ....................26
Electron Microscopy................................................................................................27
3 RESULTS: SPECIFIC AIM 1 .................................................................................28
Rationale for Study ................................................................................................ 28
Genetic Organization of V vulnificus Group I-like CPS Operon............................28
Identification of Genes for CPS Biosynthesis in V vulnificus M06-24/0 ...............31
Comparison of the CPS Operons Among Vibrio Species ........................................39
4 RESULTS: SPECIFIC AIM 2 ...............................................................................43
Rationale for Study ................................................................................................ 43
Unique, Species-Specific Organization of V vulnificus CPS Translocation
and Surface Assembly Genes...........................................................................43
Comparison of CPS Operons for V vulnificus Strains: Identification of
Three Types of Phase Variants ........................................................................45
Phenotypic Characterization of the Different Phase Variants..................................51
5 RESULTS: SPECIFIC AIM 3 ...............................................................................53
Rationale for Study ................................................................................................ 53
Alignment of MO6-24/O Phase Variants in the Putative Promoter Regions .............53
Phase Variation Mechanism for LC4/T2 ...............................................................55
6 SUMMARY AND CONCLUSIONS ......................................................................59
Organization of a Group 1-like CPS Operon in V vulnificus...................................59
Comparison of CPS Operons Among Vibrio Species ..............................................60
Translucent Phase Variants Exhibit Multiple Genotypes.........................................62
Role of SSRs in V vulnificus CPS.........................................................................63
T2 Phase Variation is Mediated by Deletion ofwzb ........................................ ..65
V. vulnificus TI Phase Variation ...........................................................................67
Multiple Scenarios for V. vulnificus Phase Variation...............................................68
CPS Expression and the Environmental Survival ..............................................69
Biological Significance of Phase Variation ...........................................................72
LIST OF REFERENCES.......................................................................................74
BIOGRAPHICAL SKETCH ........................................................................................90
LIST OF TABLES
Table page
1. CPS phenotype of V vulnificus strains ..............................................................24
2. Homologues for the V vulnificus genes in the group 1 CPS operon ....................37
3. Genetic variability of group 1 operons ...............................................................46
4. Divergence among strains and phase variants at the V vulnificus CPS
conserved locus .................................................................................................. 48
LIST OF FIGURES
Figure page
1. Phase variants of V vulnificus M 06-24...............................................................9
2. Organization of CPS operons............................................................................. 30
3. RFLP analysis of PCR amplified fragments from MO6-24 phase variants............49
4. PCR Analysis of CPS transport genes in V vulnificus phase variants....................50
5. Electron micrographs of V vulnificus strains and phase variants .........................52
6. Sequence comparison of the 5' region of the CPS locus for V vulnificus ..............54
7. Electron micrographs of complemented V vulnificus LC4/T2.............................57
8. Model for phase variation of CPS expression in V vulnificus..............................68
9. Fluorescent microscopy image of algal (Thallasiosira pseudomona)
and bacterial cells (V. vulnificus M06-24/T).................................................71
Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
RELATIONSHIP OF THE Vibrio vulnificus GROUP 1-LIKE CAPSULAR
POLYSACCHARIDE OPERON TO PHASE VARIATION
By
Maria A. Chatzidaki
August 2004
Chair: Anita C. Wright
Major Department: Food Science and Human Nutrition
Vibrio vulnificus is an opportunistic human pathogen that can be extremely
invasive, producing rapidly fatal septicemia in susceptible persons. Expression of
capsular polysaccharide (CPS) is a primary virulence factor, and encapsulated strains are
marked by opaque (0) colony morphology that can switch to translucent (T) colony
phenotype with reduced CPS expression and virulence in a process referred to as phase
variation. We previously characterized a V vulnificus CPS operon with similarity to
group 1 CPS operons of Escherichia coli. The present study confirms V vulnificus group
1 operon structure, and presents genetic comparisons of opaque versus translucent phase
variants. Different classes of translucent phase variants (TI, T2, and T3) were identified
by their phenotypic and genetic profiles. Although decreased CPS expression was
observed in Ti strains, the CPS operon appears intact with only minor differences in
DNA sequence between phase variants. On the other hand, both T2 and T3 phase variants
were completely acapsular and do not revert to opaque phenotype. T2 cells exhibited
deletion of the wzb gene, and. complementation analysis confirmed both the site-
specificity of this deletion and the requirement of the gene product for translocation of
CPS to the cell surface. Larger deletions of multiple CPS transport genes were observed
in T3. Species-specific, tandem cassettes of short sequence repeats (SSRs) flanked both
the wzb and the entire CPS transport locus, strongly implicating SSR-mediated deletion
as a mechanism for phase variation in V vulnificus. These data provide the first genetic
comparison of CPS phase variants in this species and suggest a novel mechanism for the
phase variation of CPS expression and virulence in V vulnificus.
CHAPTER 1
INTRODUCTION
Vibrio vulnificus
Vibrionaceae, a gram-negative family of bacteria, has various important members,
including Vibrio vulnificus, Vibrio parachaemolyticus and Vibrio cholerae. V. vulnificus
is a curved, rod-shaped bacterium with a single polar flagellum. It inhabits and thrives in
shallow coastal waters in temperate climates throughout most of the world (Myatt and
Davis 1989, Maxwell et al. 1991, Dalsgaard et al. 1996, Hoi et al. 1998, Shapiro et al.
1998), and its presence is not associated with pollution. It resides in high numbers in
filter-feeding shellfish (up to 1x106 bacteria per gram of oyster), but can also be found
free living in the seawater (Wright et al. 1996, Motes et al. 1998).
Specifically, V. vulnificus prefers tropical and subtropical climates and propagates
at water temperatures exceeding 18C (Kaspar and Tamplin 1993, Hlady and Klontz
1996). Total viable V vulnificus cell counts demonstrate seasonality, reaching nearly
undetectable levels when the water temperature falls below 100C (Oliver et al. 1982,
Kaysner et al. 1987). As waters get warmer numbers of vibrios can reach from lx103 to
Ix106 bacteria per gram of oyster (Tamplin et al. 1982, Motes et al. 1998). It is thought
that the bacteria enter a viable but non culturable (VBNC) state with the fall in
temperature (Oliver et al. 1995). During that phase the bacteria exhibit morphological
changes. Bacteria assume a coccoid shape instead of the usual rod and the membrane
fatty acid composition changes; increased mechanical resistance is acquired and amino
acid transport slows down (Linder and Oliver 1989, Weichart and Kjelleberg 1996,
Weichart et al. 1997). It has been shown that the VBNC state accounts for cells that are
unable to support cell division on media that are routinely used to sustain the
microorganism's growth (Oliver 1991, Stelma et al. 1992, Colwell et al. 1985, Whiteside
and Oliver 1997, Bryan et al. 1999). As a result, traditional culture techniques fail to
detect VBNC cells, which could have serious implications for the seafood industry, as
post-harvest storage of oysters involves refrigeration or freezing. Post-harvest chilling
can induce the VBNC state in V. vulnificus, making the cells undetectable, and lead to
erroneous post harvest cell numbers. An increase in temperature, irrespective of the
growth medium, can cause an increase in culturability, and V vulnificus resumes its
original state (Oliver and Bockian 1995).
V vulnificus is halophilic, with salinity preferences that range from 15-25 parts per
thousand (ppt) (Motes et al. 1998). Studies have shown that salinities greater than 25ppt
are not favorable and can have a negative effect on the survival of the bacteria (Kaspar
and Tamplin 1993, Motes and De Paola 1996, Motes et al. 1998). V. vulnificus is divided
into three categories in terms of biochemical, phenotypic, immunological, and host range
differences (Tison et al. 1982). The strains that belong in biotype 1 are indole- and
omithine decarboxylase-positive and exhibit multiple immunologically distinct
lipopolysaccharide types (Amaro et al. 1997). Also this biotype contains the V vulnificus
strains that have been isolated from shellfish and have been involved with human disease
either through handling or consuming raw shellfish. The members of biotype 2 are V
vulnificus strains with the potential to cause disease in eels (Tison et al. 1982). These are
indole- and ornithine decarboxylase-negative strains, and all express a single
lipopolysaccharide type (Tison et al. 1982). Biotype 2 strains were only recognized as
marine vertebrate pathogens, but have now been shown to be virulent in mice (Amaro et
al. 1994) and capable of causing disease in humans (Amaro and Biosca 1996). In
addition, Bisharat et al. (1999) identified another biotype (Biotype 3) for a new strain of
V. vulnificus, which was isolated from raw fish handlers in Israel with wound infection
and bacteremia.
V. vulnificus Disease
At least 13 species in the Vibrio genus are known to cause diseases in man, and the
symptoms vary from severe diarrhea to septicemia. V. vulnificus disease was first
encountered by the U.S. Center for Disease Control (CDC) in 1964 and was then
mistakenly identified as a virulent strain of V parachaemolyticus. A few years later
though, it was recognized as a distinct species, due to the unique characteristics of the
disease compared to the other Vibrio sp. diseases (Hollis et al. 1976, Blake et al. 1979,
Morris and Blake 1985).
V. vulnificus is associated with raw shellfish consumption and especially oysters,
consumption and can be one of the most invasive and rapidly fatal of the opportunistic
human pathogens (De Paola et al. 1994, Rippey 1994, Wright et al. 1996). Oysters are
filter feeders and capture suspended food particles from the water (Prieur et al. 1990). At
the same time, bacteria and other free floating microorganisms can be trapped and oysters
can serve as carriers for human pathogens (Prieur et al. 1990). During feeding,
microorganisms attach to the various oyster tissues, hemolymph, gills, adductor muscle,
and mantle, by the in-flow that is created (Tamplin and Capers 1992). It has been shown
though that V. vulnificus is indigenous to shellfish (Oliver et al. 1982, De Paola et al.
1994, Wright et al. 1996).
It is evident that V vulnificus is very important for the seafood industry due to the
high mortality rate observed during the V vulnificus disease; it is the leading cause of
reported seafood-related deaths in this country (Tacket et al. 1984, Shapiro et al. 1998).
Of all seafood-borne infections, it is the most serious in the United States, as it accounts
for 95% of all seafood-related deaths, and it is estimated that there are fifty food-borne
cases each year serious enough to lead to hospitalization (Morris and Black 1985, Morris
1988). It is noticeable that infections with V vulnificus are seen primarily in males over
the age of 40 and generally occur between the months of May and October.
V vulnificus can cause invasive systemic disease with symptoms generally
occurring within 16-38 hours following ingestion and include fever, chills, decrease in
blood pressure, and the development of "secondary lesions," typically on the legs. These
lesions begin as fluid-filled blisters, which progress to result in extensive destruction of
muscle tissue, frequently requiring amputation of the affected limb. Progression of the
infection rapidly leads to death in 50% of the cases, with death occurring in a matter of
days (CDC, 08/11/2001, www.cdc.gov). Prompt administration of antibiotics is essential
and intensive medical treatment is required. The organism also causes infection through a
cut or puncture wounds acquired while shucking oysters, peeling shrimp, cleaning fish,
etc., and these patients may also develop fever and chills, with redness, swelling, pain,
and tissue destruction at the site of the wound, but they do not develop the secondary
lesions. The fatality rate for wound infections is approximately 25% (CDC, 08/11/2001,
www.cdc.gov 2002).
The infectious dose for V. vulnificus disease is not known, but it should be noted
that only individuals with certain underlying diseases, such as certain liver diseases
(especially cirrhosis and hepatitis), iron overload hemochromatosiss), diabetes, cancer,
gastric disease, and AIDS, are susceptible (Tacket et al. 1984). According to the
Canadian Hemochromatosis Society, Hemochromatosis (HHC, 06/1/2001,
www.cdnhemochromatosis.ca) is a hereditary condition that causes an overload of iron in
the body. The liver, heart, endocrine glands, skin and joints are principally affected, and
liver cirrhosis, cardiomyopathy, diabetes mellitus, hypogonadism and arthritis are the
usual manifestations (HHC, 06/1/2001, www.cdnhemochromatosis.ca). Individuals
belonging to these high risk groups are 80 times more likely to get sick and more than
200 times more likely to die from consuming V vulnificus-infected raw oysters than are
healthy persons (CDC, 08/11/2001, www.cdc.gov).
Distribution of V vulnificus
The main cause of V. vulnificus illnesses is the consumption of raw oysters,
Crassostrea virginica, which are harvested from Gulf Coast estuaries (Shapiro et al.
1998). It is an interesting fact as this organism has also been recovered from the Atlantic
Coast (Motes et al. 1998, Shapiro et al. 1998) and Pacific Coast sites (Kaysner et al.
1989). The bacterial numbers in the Gulf Coast estuaries can range from 103 to 106
organisms per gram of oyster tissue (Tamplin et al. 1982), but the Atlantic Coast sites
which have higher salinities showed reduced numbers of V vulnificus with comparable
water temperatures throughout the warm months (Motes et al. 1998). A study that was
done in Chesapeake Bay estuaries demonstrated comparable bacterial counts to those
from the Gulf Coast (Wright et al. 1996). V vulnificus outbreaks have been reported in
countries outside the U.S. such as Sweden, Germany, Holland, South Korea, and
Denmark, with bacteria present in the oyster tissue and the seawater (Dalsgaard et al.
1996, Linkus and Oliver 1999).
V. vulnificus Pathogenesis
V vulnificus bacteria contain multiple virulence characteristics that may be
involved or required for manifestation of disease in humans. As seen in all gram-negative
microorganisms, biotype 1 V vulnificus produces lipopolysaccharide (LPS) endotoxin
with variable O-side chain on its surface (Amaro et al. 1997). Although V vulnificus
endotoxin initiates a certain level of cytokine induction, it has less pyrogenic potential
than endotoxins from other gram-negative bacteria (McPherson et al. 1991). Powell et al.
(1997) challenged mice with the encapsulated M06-24/0 strain and its un-encapsulated
transposon mutant, CVD752, with purified CPS and LPS. They observed that purified
CPS was a slightly more active inducer of TNF-alpha than was LPS. It is believed that
LPS plays a role in stimulating the host cytokine response during the disease process, but
it cannot solely explain the massive inflammation and septic shock that are observed
during systemic infection (Strom and Paranjpye 2000).
V vulnificus also produces a number of extracellular proteins, among them two
hemolytic proteins, a protease and a cytolysin. The more important of the two, the
cytolysin, is a heat-labile, 56-kDa enzyme that lyses mammalian erythrocytes (Gray and
Kreger 1985). It is heat-labile, and the purified protein can increase vascular permeability
in guinea pig skin and is lethal for mice at levels of about 3pg/Kg of body weight (Gray
and Kreger 1985, Wright and Morris 1991). The gene encoding this protein, vvhA, shows
similarity to the V. cholerae El Tor hemolysin and the V cholerae non-01 cytolysin
(Yamamoto et al. 1990, Wright and Morris 1991). This protein may play a role in
virulence as antibodies in the sera of infected mice, specific to the toxin, have been
detected. However, it is not necessary for the extensive tissue damage observed in V
vulnificus infections, as inactivation of the protein did not affect virulence (Gray and
Kreger 1986, Wright and Morris 1991). Thus far, the actual contribution to the disease
process has not been elucidated, excluding it as a virulence determinant in the V
vulnificus disease process (Gray and Kreger 1986, Wright and Morris 1991).
The protease, VVP or VVPE, has elastolytic and collagenolytic activities (Smith
and Merkel 1982, Kothary and Kreger 1987, Miyoshi et al. 1987). It has been suggested
to be a potential virulence factor, particularly in skin lesions, but its inactivation had no
effect on the growth of the organism in vitro or in vivo, nor did it have any effect on the
induction of vascular permeability in rats (Kothary and Kreger 1987, Miyoshi et al. 1998,
Shao and Hor 1999). Inactivation of the V vulnificus vvpE gene had no effect on the
bacterial ability to infect mice irrespective of iron addition (Jeong et al. 2000).
Interestingly, in the absence of VVP, there was an increase in the amount of cytolysin
activity (as measured by hemolysis of mouse erythrocytes) in culture supernatants of the
mutant compared to the wild-type, suggesting that the cytolysin may act as a substrate to
the protease and when absent, more cytolysin is available to cause tissue damage,
increasing the virulence potential of the organism (Shao and Hor 1999).
V vulnificus produces hydroxymate and phenolate (catechol) for the acquisition of
iron from the mammalian host (Simpson and Oliver 1983). An isogenic mutant in the
catechol siderophore (VenB) was considerably less virulent in mice (Litwin et al. 1996).
It has been hypothesized that bacteria sense the environment for iron, and the change
from a high- to a low-iron concentration may act as an important sensory signal of the
mammalian host. Iron is very important for V vulnificus. This is evident from the
increased concentration of iron in the sera of most of the susceptible population to the V
vulnificus and by the animal model used for V vulnificus disease studies. Intraperitoneal
injection of mice with a virulent V vulnificus isolate generally results in little effect, with
a lethal dose of (LD50) requiring greater than xlx06 bacteria. However, the LDso
dramatically decreases to values ranging from a few bacteria to 1x103 bacteria if iron is
injected usually shortly before the bacterial challenge. In this iron overloaded mouse
model the LD.s for avirulent strains is greater than 1x104 bacteria. Oral inoculations of
mice required higher numbers of bacteria (x 109) (Wright et al. 1981).
V. vulnificus Capsular Polysaccharide
The symptoms of V. vulnificus septicemia resemble those ofendotoxic shock, but
as was mentioned previously the lipopolysaccharide of this organism was relatively inert,
and its contribution to virulence remains unclear (McPherson et al. 1991, Powell et al.
1997). V vulnificus strains isolated from humans have been associated with the
expression of CPS on their surface (Wright et al. 1990, Wright et al. 1999). Thus far, the
primary virulence factor for V vulnificus is expression of capsular polysaccharide, and
those isolates that do not express it are avirulent (Wright et al. 1990). As shown in Figure
1, V vulnificus strains exhibit phenotypic variation when grown on an agar surface;
Opaque (0) colony morphology is associated with CPS expression, but colonies may also
show a Translucent (T) phenotype, whereby cells are acapsular or have reduced CPS
expression (Yoshida et al. 1985, Simpson et al. 1987). These phenotypes can be
reversible for both 0-T and T-O transitions in some strains at a rate of about 10-3 to
10-4 in a process termed phase variation (Wright et al. 1990). Similar associations of CPS,
colony morphology, and virulence have also been reported for non-01 V cholerae
(Johnson et al. 1994).
Figure 1. Phase variants of V vulnificus M06-24
Cell surface expression of CPS varied with growth phase, with the highest amounts
observed during logarithmic growth at 300C (Wright et al. 1999). Opaque, encapsulated
strains are highly lethal in mice, especially in animals with excess iron (Wright et al.
1981) and resist bactericidal effects of serum or phagocytosis (Tamplin et al. 1985,
Shinoba et al. 1987). Translucent isolates with reduced CPS expression are also
diminished in the virulent phenotype (Simpson et al. 1987, Yamamoto et al. 1990, Wright
et al. 1999). The capsule apparently enables V vulnificus to evade nonspecific host
defense mechanisms, such as activation of the alternative pathway of the complement
cascade and complement-mediated opsonophagocytosis (Tamplin et al. 1985, Moxon and
Kroll 1990, Roberts 1992).
Wright et al. (1999) demonstrated that the translucent phase variant of M06-24/O
was able to bind type 1 CPS-specific monoclonal antibodies, suggesting conservation in
the CPS between the variants. Thus the differences were on the amount of capsule that
surrounded the cell and not on the capsular type that was present. Great diversity of CPS
types among V. vulnificus has been reported and virulence of V vulnificus has not been
associated with any particular CPS composition (Hayat et al. 1993). Opaque and
translucent phase variation of colony morphology is considered a virulence marker for V.
vulnificus. Expression of capsule is necessary but is not sufficient for virulence, as
encapsulated strains were avirulent (Starks, Scheb et al. 2000).
Capsular Polysaccharide Assembly
Most of the work on the CPS biosynthesis and assembly of the capsule to the
outside of the cell has been done on Escherichia coli, and in 1999, Drummelsmith and
Whitfield introduced a new categorization system for capsular polysaccharides,
comprising four new groups (group 1 through 4). Wright et al. (2001) identified a group
1-like operon in V. vulnificus, and in this study we will solely focus on the analysis and
characterization of group 1 operons, with E. coli as a prototype. The sequence of the 16-
kb capsule biosynthesis cluster has been determined for the group 1 prototype isolate, E.
coli E69 (O9a:K30) (Drummelsmith and Whitfield 1999, Rahn et al. 1999). The CPS
operon contains 12 open reading frames, which are divided into two regions by a
transcriptional attenuator (Rahn and Whitfield 2003).
Proteins encoded by genes that are located upstream of the attenuator are conserved
and involved in the translocation and assembly of the high-molecular-weight CPS, but
those located downstream of the attenuator are not conserved and are involved in
synthesis and low-level polymerization of the CPS repeat units (Rahn and Whitfield
2003). These proteins include the serotype-specific glycosyltransferases and components
of the Wzx- and Wzy-dependent polymerization pathway (Rahn, and Whitfield 2003).
According to Paiment et al. (2002), E. coli group 1 CPS involves a Wzy-dependent
pathway, in which the individual repeat units are assembled on undecaprenol phosphate
at the cytoplasmic face of the inner membrane by the sequential activity of
glycosyltransferases, and then the repeat units are believed to cross to the periplasmic
face of the inner membrane by an unknown mechanism involving a putative flippase, the
Wzx protein. A polymerase, Wzy, is then involved in the polymerization of the lipid-
linked repeat units, where in E. coli K30, they can follow one of two fates at this point.
High-level polymerization, termed K30cps, can occur in the periplasmic face of the inner
membrane to generate the high-molecular-weight CPS, which is then translocated to the
cell surface. Alternatively, one or even a few repeat units can be ligated onto lipid A-core
and expressed on the cell surface as KLPS (MacLachlan et al. 1993, Dodgson et al. 1996).
The region of the operon that is located downstream of the transcriptional attenuator is
sufficient for the production of KLPS but not for synthesis of the high-molecular-weight
capsule (Rahn and Whitfield 2003).
Preceding the attenuator in the K30 operon the products of the first four genes
(orfX, wza, wzb and wzc) are believed to be involved in the high-level polymerization and
surface expression of the high-molecular-weight CPS (K30cps). These genes are
separated from a block of downstream genes encoding enzymes for repeat unit synthesis
by a transcriptional attenuator (Rahn et al. 1999, Rahn and Whitfield 2003). The first
gene encodes for the OrfX protein, which has only one known homologue found in
Klebsiella pneumoniae K2 strains (ORF3) (Arakawa et al. 1991, Arakawa et al. 1995,
Alvarez et al. 2000). Only until recently was a role assigned to this protein; is an outer
membrane protein (Wzi) and wzi mutants have increased amounts of cell-free exo-
polysaccharide at the expense of a capsular structure (Rahn et al. 2003). Additionally, wzi
mutants had no effect on expression of the wza and wzc gene products, thus any
regulatory role for Wzi was ruled out. Wzi might be required for attachment of the
capsular polymer to the cell surface, either by providing an anchor itself or indirectly by
providing an assembly system for a different molecule that serves as the anchor.
Wza is an outer membrane lipoprotein that multimerizes to form ring-like
structures resembling secretins for type II and type III protein secretion of high-
molecular-weight (HMW) CPS polymers across the outer membrane (Drummelsmith and
Whitfield 2000). Mutations in the wza gene led to loss of polymer secretion and
accumulation of HMW intermediates within the periplasm. Interestingly though, wza
mutants can still make and polymerize KLPS, and probably exists a feedback mechanism
in the system to prevent accumulation of HMW intermediates that are going to be
transported to the outside (Drummelsmith and Whitfield 1999, 2000). Wza mutants
exhibit a phenotype that is distinct from the one observed in Wzi mutants, as in the latter
mucoidy and KLPS are unaffected (Rahn et al. 2003). It is hypothesized that Wzi acts
further down in the polymerization and transport cascade of CPS, with a possible role in
determining the distribution of cell-associated and cell-free K antigen (Rahn et al. 2003).
Following wza are two genes whose proteins are thought to have a synergistic
function, Wzc, a tyrosine autokinase, and Wzb, its cognate phosphatase (Drummelsmith
and Whitfield 1999, Wugeditsch et al. 2001). In E. coli K30 these proteins are required
for the assembly of the high-molecular-weight capsular layer on the cell surface, though
not for polymerization or assembly of KLPS (Drummelsmith and Whitfield 1999,
Wugeditsch et al. 2001). The C-terminal 17 amino acids of Wzc include variable
numbers of tyrosine phosphorylation sites required for assembly of K30 high molecular
weight capsule (Wugeditsch et al. 2001). It has been hypothesized that Wzc must
undergo cycles ofphosphorylation and dephosphorylation for the K30 CPS to be
expressed (Wugeditsch et al. 2001). To date the precise role of Wzc has not been
elucidated, but the Wugeditsch et al. (2001) study suggested that Wzc maybe involved in
volume control of the HMW CPS on the outside by coordinating other components in the
assembly complex in a manner analogous to the proposed role of Wzz in the biosynthesis
of O antigens (Bastin et al. 1993, Morona et al. 1995). Homologues of wzi-wza-wzb-wzc
are also found in the CPS loci from K. pneumoniae (Arakawa et al. 1991, Rahn et al.
1999). Additionally, there are second copies of the wza, wzb, and wzc (wza22min, wzb22min,
and wzc22min) genes on the chromosomes of E. coli K30 and K-12 strains, with products
that participate with low efficiency in K30 CPS and colanic acid production (Vincent et
al. 2000, Wugeditsch et al. 2001). Colanic acid or M antigen is produce by E. coli K-12
and is a loosely attached EPS that is produced in low levels (Geobel 1963).
Mechanisms of Phase Variation
Phase variation is considered the switching of a specific target gene or a whole
operon to either an ON or an OFF state. These phase variations are usually reversible, but
may be irreversible and are generally random events occurring at high frequency (>10-5
per generation) resulting in a phenotypically heterogeneous population (Henderson et al.
1999). Such phenomena may also be considered as "programmed events," as the genome
of the organism is usually organized in such a way that certain events are more likely to
occur (van Belkum et al. 1998, Henderson et al. 1999). Phase variation has been observed
among various organisms, both bacterial and non-bacterial, and frequently involves
phenotypic changes in surface structures (CPS, LPS, pili, or outer membrane proteins)
required for response to host defenses or changing environmental conditions (for a review
see Henderson et al. 1999). Thus, phase variation is thought to be essential to maintain
diversity, which is required for survival of many pathogens in continuously changing
environments. Despite the growing number of examples of this phenomenon, relatively
few distinct mechanisms have been described for phase variation, and these include
promoter inversions, insertion element-mediated alterations, differential methylation, and
genetic rearrangement mediated by multiple repeated short DNA segments (Henderson et
al. 1999).
Repetitive DNA segments, which are frequently seen in eukaryotes, are gradually
being identified in prokaryotes. Repetitive DNA may consist of simple homopolymeric
tracts of a single nucleotide or of several multimeric classes of repeats in large or small
numbers, and these sequences have been defined as short sequence repeats (SSRs) or
variable number of tandem repeats (VNTRs) (van Belkum et al. 1998, Henderson et al.
1999). The identified SSRs are usually 1 to 6 nucleotides in length or longer with more
than 15 nucleotides, with intermediate size repeats being only rarely encountered
(vanBelhum et al. 1998). It has also been reported that the shorter unit repeats are
involved in regulatory processes and are affected by slipped strand mispairing and that
the longer repeats play a physical, rather than a regulatory role (vanBelhum et al. 1998).
The genome sequence of E. coli revealed that SSR-type regions harboring repeat units of
fewer than 8 nucleotides were very rare (Blattner et al. 1997, vanBelhum et al. 1998).
DNA comprised of inverted repeats, direct repeats, mirror repeats, and
homopurine/homopyrimidine runs is also termed "defined ordered sequence DNA"
(dosDNA, Rosche et al. 1995). DosDNA regions can be considered "hot spots" for
transient mispairing during DNA replication allowing for slipped misalignment events to
occur that may lead to changes in the translational reading frame slipped-strand
mispairing (Belland 1991, Rosche et al. 1995, van Belkum et al. 1998, Henderson et al.
1999). These alterations can occur within a gene to produce frame-shifts that result in
stop codons leading to truncated proteins or localize in the promoter region to decrease
gene expression by changing the promoter strength (Chandler and Fayet 1993, van
Belkum et al. 1998). Additionally, the number of repeated units may be altered through
strand-slippage and mismatch repair during transcription (Streisinger et al. 1966, Rosche
et al. 1995, van Belkum et al. 1998). Trinh and Sinden (1993) created insertion mutations
that shifted the reading frame of the chloramphenicol acetyl transferase (cat) gene, and
estimated the frequency of spontaneous reversion to Cmr phenotype (0.1x 109-50x109)
through deletion of the mutation insert (17 bp) in pBR325. It was also proposed that the
deletion event was mediated by slipped misalignment between flanking direct repeats
during DNA replication or by other frame-shift mutations and that longer direct repeats
may increase the deletion frequency (Trinh and Sinden 1993, Rosche et al. 1995).
The slipped-strand mispairing or misalignment model was proposed by Streisinger
et al. (1966) to explain the mechanism of addition and deletion of one base within a
homopolymeric run of several bases. Deletion and addition mutations had also been
reported for one copy of the three tandem direct sequence (CTGG) that is located in the
lacI gene, and led to the extension of the Streisinger model in order to explain the
deletion of DNA located between direct repeats (Farabaugh et al. 1978, Galas 1978). This
type of mutation has been attributed to errors in replication caused by the intra-strand
misalignment of nonadjacent direct repeats. A hairpin stem loop structure can be formed
in the template strand due to slippage of the nascent strand from the first copy of the
direct repeat to the second copy of the direct repeat. As a result, the two direct repeats are
brought into closer proximity and thereby facilitating primer template misalignment and
leading to the deletion of material between the direct repeats and one copy of the direct
repeat (Albertini et al. 1982, Ripley and Glickman 1983, van Belkum et al. 1998). Site-
specific inversions or insertions/deletions of DNA segments usually require a specific
recombinase, but some direct repeat-directed and palindrome-directed mutations are
independent of RecA (Farabaugh et al. 1978, Sinden et al. 1991, van Belkum et al. 1998).
The regions bordering the SSR loci are susceptible to more frequently occurring
mutagenic events. Site-specific recombination is usually involved in these phase variation
phenomena, which differs from general homologous recombination in that substrate
DNAs with considerable homology are needed, and exchange can occur anywhere within
the region of homology (Henderson et al. 1999). The frequency of the recombination
events increases with the length of the homologous region. In addition, in the general
recombination pathway RecA is required for general homologous recombination, in
contrast to site-specific reactions in which the recombining sequences are usually short
and the reaction occurs at a single specific site within the recombining sequence
(Henderson et al. 1999). In general, rearrangements associated with SSRs are generally
considered to be random, but may be viewed as "programmed events" because the
genomic organization favors the recombination (Henderson et al. 1999).
Site-specific inversion of DNA segments provides a simple ON to OFF switch for
genes located within or adjacent to the invertible region (Henderson et al. 1999). In these
events the spatial relationship of promoters or regulatory elements with the genes they
affect is altered, and the best-characterized examples of variation achieved by site-
specific DNA inversions are the type 1 fimbriae of E. coli and the flagellum of
Salmonella typhimurium (Henderson et al. 1999).
The opacity proteins (Opa) of Neisseria gonorrhoeae and Neisseria meningitidis
undergo both antigenic and phase variation (Meyer et al. 1990). These adhesins mediate a
variety of neisserial-host cell interactions including opsonin-independent phagocytosis by
professional phagocytes and invasion of epithelial cells (Dehio et al. 1998). N.
gonorrhoeae may possess 11-12 opa loci scattered throughout the chromosome, while N.
meningitidis only 3 or 4. These are the loci that form the basis for antigenic variation in
these organisms (Connell et al. 1990, Aho et al. 1991). Thus, bacteria display either a
single Opa protein or multiple Opa proteins simultaneously (Meyer et al. 1990). The
mechanism for the phase variation event is at the translational level, as alterations occur
in the reading frame of the leader sequence of each opa gene that contains a repetitive
pentamer sequence (5'-CTCTT-3'), which is termed the coding repeat (CR) (Stem et al.
1986, Meyer et al. 1990). According to the number of CRs that are present at the time,
the translational reading frame of an opa gene may be shifted as the methionine codon is
(6, 9, 12 CRs) or it is not (any other configuration) in frame with the coding region of the
whole molecule (Stem et al. 1986).
As mentioned previously, modulation of expression by transcriptional strand
slippage is a result of slipped-strand mispairing in regions outside the ORF, generally
occurring upstream of the gene. The Opc outer membrane protein of N. meningitidis
undergoes this form of regulation with the ope not only undergoing a phase variation
event of the ON/OFF type, but also volume control (van Ham et al. 1993, Sarkari et al.
1994, Saunders 1994). Phase changes are produced by strand slippage in a stretch of
cytosine bases adjacent to the promoter region of the opc gene (Sarkari et al. 1994,
Saunders 1994). The number of cytosine bases that comprise the homopolymer varies,
and three different phenotypes exist: 12 or 13 lead to the Opc++, 11 or 14 to Opc+ (10
times less abundant), and >15 or <10 to Opc (no opc mRNA is detected) (Sarkari et al.
1994, Saunders 1994).
Variation by differential methylation differs from the mechanisms of phase
variation described above. This type of variation is described as epigenetic in that the
phenotypes are altered but the genotypes are not. Rather than genomic rearrangements
the integrity of the genome is maintained, while various regulatory proteins act in concert
to alter the transcription of the phase-variable gene (van der Woude et al. 1996). There
are, on estimate, 1800 GATC sites in E. coli that become fully methylated or are
transiently hemi-methylated by deoxyadenosine methylase (Dam) during DNA
replication, allowing for a method of DNA repair and a mechanism by which bacterial
and/or phage replication can be timed (Adley and Bukhari 1984, Abeles et al. 1993).
Regulation of certain genes can occur by differential protection from methylation of such
sites (Ringquist and Smith 1992, Hale et al. 1994). That mechanism was reported and
studied extensively in the regulation ofP fimbrial expression in uropathogenic E. coli,
which undergoes reversible phase variation at 370C, while at temperatures below 260C,
expression is shut off (Blyn et al. 1990, van der Woude et al. 1996).
Phase variation has been characterized in E. coli strains with group IA capsular K
antigens (Drummelsmith et al. 1997). A pair of insertion sequences (ISI) flanks manCl-
manB'-ugd region in E. coli E69, providing a mechanism for gene replication. Another
example is found in division I Haemophilus influenza strains with capsular
polysaccharides belonging to serotypes a to d (Kroll 1992). In these strains, the cap
(capsule biosynthesis) locus is flanked by IS1016 elements, which might explain the
recombination-mediated amplification in cap occurring in some clinical isolates (Kroll
1992).
Vibrio cholerae is also a member of the Vibrionaceae family and has been involved
in 8 pandemics throughout the world. There are multiple defined serogroups of V
cholerae and until 1992 only V cholera 01 was recognized as a major human pathogen.
However, in late 1992 in Bengal a novel V. cholerae serogroup, 0139, was isolated and
literally replaced V cholerae 01 as the major cholera serogroup (Stroeher et al. 1998). V
cholerae 0139 serogroup is essentially the same as V. cholerae 01 of the El Tor biotype
with the acquisition of a new 0-antigen and capsule (Johnson et al. 1994, Karaolis et al.
1994, Manning et al. 1995, Bik et al. 1995, Comstock et al. 1995, Stroeher et al. 1995,
Bik et al. 1996, Comstock et al. 1996, Stroeher et al. 1997, Stroeher and Manning 1997).
V cholerae 0139 serotype emerged from the V. cholerae 01 by a relatively precise
replacement of the original V cholerae 01 rfb (or wb*) region (Manning et al. 1995,
Comstock et al. 1995, Bik et al. 1995, Stroeher et al. 1997, Stroeher and Manning 1997).
The V. cholera 01/0139 rfb region contains an IS element that probably provided the
portable regions of homology within non-homologous regions for genetic rearrangements
to occur (Mooi and Bik 1997). Finally, these mobile elements have the ability to become
associated with specific genes and to translocate them, as well as to induce various
genetic reorganizations, including insertions, deletions, and inversions (Simon et al.
1980).
Focus of the Present Study
The genetic basis for V. vulnificus phase variation is not known. Recently, a group
1-like CPS operon was identified through transposon mutagenesis, and it was
demonstrated that the wza gene was required for surface assembly of the CPS (Wright et
al. 1999). This highly conserved gene encodes a lipoprotein that forms multimeric
structures in the outer membrane (Whitfield and Roberts 1999). Genomes of most (90%)
encapsulated V. vulnificus strains (90%) contained the wzav,, while translucent strains
were less likely to be positive for this gene (50%), and exhibited genetic rearrangements
at this locus as indicated by Southern analysis of phase variants (Wright et al. 2001).
Group 1 CPS homologues in other strains are generally followed by wzb and wzc, and the
presence ofwza-wzb-wzc homologues identifies group 1 CPS operons in E. coli
(Drummelsmith and Whitfield 1999). Examination of phase variants of different strains
of V. vulnificus suggested that the group 1 CPS locus might be a site for genetic
rearrangements that correlated with a phase shift. Therefore, the present study completed
the DNA sequence of the CPS operon to confirm homology to other group 1 operons, and
genetic analysis was performed on several phase variants to investigate the relationship of
CPS operon genetic instability to phase variable phenotypes.
Specific Aim 1: Investigate Gene Organization in V. vulnificus CPS Operon
Wright et al. (2001) identified a group 1-like CPS operon through transposon
mutagenesis, and demonstrated that the wza gene was required for surface assembly of
the CPS. Group 1 CPS operons have been described for a number of gram-negative
species and are generally organized into contiguous regions containing a 5' locus with
highly conserved genes (wza, wzb, and wzc) involved in the translocation and surface
assembly of the CPS to the cell surface. These conserved genes are followed by the
polymorphic region with genes for CPS biosynthesis and polymerization
((Drummelsmith and Whitfield 1999, Whitfield and Paiment 2003). The presence of wza
in V vulnificus M06-24/0 strongly indicated the presence of a group 1 operon, but
identification of the rest of the translocation and surface assembly genes (wzb, and wzc)
was needed to validate that hypothesis.
For the identification of the entire V vulnificus M06-24/O CPS operon we used a
combination of transposon marker-assisted cloning using insertions in the CPS operon
from the Wright et al. (2001) study and PCR amplification of DNA with previously
described primers (Wright et al. 2001), newly obtained sequence from this study, as well
as sequence provided by Dr. Paul Gulig at the University of Florida.
Specific Aim 2: Examine the Conservation and Distribution of CPS Genes Among
V. vulnificus Strains, Vibrio spp. or Different Species
Group 1 CPS operons have been described in a number of gram-negative
microorganisms with highly homologous organization. Interestingly, the conserved genes
(wza, wzb, and wzc) were found in uninterrupted succession, but in V vulnificus M06-
24/0 wza and wzb were interrupted by a hypothetical protein. Thus, DNA sequence
comparisons of the organization of the CPS operon genes among V vulnificus strains,
Vibrio spp. or different gram-negative species (E. coli) would allow for the identification
of particular patterns that might be specific to the species. During this study two separate
sequencing projects were taking place that led to the publication of two V vulnificus
genomic sequences from strains CMCP6 and YJ016 (Chen et al. 2003, Kim et al. 2003)
increasing the available genome pool for study.
Specific Aim 3: Examine the Genetic Basis for Phase Variation
V. vulnificus exhibits phase variation, a phenomenon that functions under an unknown
mechanism. To characterize and identify the mechanisms) of the phase variation
phenomenon variants of different V. vulnificus strains were examined for sequence
divergence in the CPS operon. It would also be interesting to examine the level of
conservation among the CPS translocation and surface assembly genes (wza, wzb, wzc).
Additionally, restriction fragment length polymorphism of the entire or parts of the V.
vulnificus CPS operon would be a quick, easy, and cheap alternative to DNA sequencing
for comparison of various phase variants of a single strain.
CHAPTER 2
MATERIALS AND METHODS
Bacterial Strains and Culture Conditions
V. vulnificus strains (Table 1) were grown in Luria-Bertani broth (LB, Difco) or LB
agar, with 1.0% tryptone, 0.5% yeast extract, and 1.0% NaCl. The strains were incubated
at 300C or 37C with vigorous agitation overnight. All culture strains were stored at -
70C in LB broth with 50% (w/v) glycerol. When antibiotics were required, kanamycin
(50jtg/ml), tetracycline (50tg/ml) or polymyxin (50tg/ml) were added to cultures of V
vulnificus. E. coli S17-1 pir (Simon et al. 1983) was used for complementation
experiments. All media were purchased from Difco (Detroit, MI), and reagents were
purchased from Sigma Chemicals (St. Louis, MO).
DNA Cloning
DNA encompassing the entire group 1 CPS operon of V vulnificus MO6-24/O was
recovered by a combination of transposon marker-assisted cloning and DNA
amplification by PCR. DNA sequence from other strains was recovered by direct
sequencing of PCR products. Genomic DNA from the transposon mutant V. vulnificus
CVD 737 (Wright et al. 1990) was obtained with the use of QIAmp DNA Mini Kit
(Qiagen). Digested fragments with BamHI enzyme (Promega, for reaction conditions see
RFLP section) of genomic DNA were cloned into pBluescript SK (Promega) according to
the manufacturer's instructions. Then, 4 p1 was taken directly from the ligation mixtures
and was transformed into chemically competent cells, E. coli JM109 (Promega)
according to the manufacturer's instructions.
Table 1. CPS phenotype of V vulnificus strains
Bacteria Description
M06-24/O
M06-24/T
CVD752
CVD737
LC4/O
LC4/T
345/T
Encapsulated clinical isolate
Tl translucent phase variant of M06-24 with reduced CPS expression
Acapsular TnphoA mutant of M06-24/O with insertion in wza
(Wright et al. 2001)
Acapsular TnphoA mutant of M06-24/O with insertion in ORF5
(Wright et al. 2001)
Encapsulated clinical isolate
T2 translucent phase variant of LC4/Owith no CPS on the cell surface
Environmental acapsular strain
The various E. coil JM109 clones were screened for the kanamycin resistance
marker on the TnphoA transposon that had been previously introduced into the CPS
operon of V. vulnificus M06-24/O (Wright et al. 1990). Plasmids from the various
transformants were extracted with the Wizard Plus Minipreps DNA Purification
Systems (Promega). Additional screening of the clones was performed at this point by
enzymatic digestion (BamHI, Promega), in an effort to identify those with the highest
size insert. The digests were recovered by agarose gel (1% w/v) after electrophoreses and
visualization with ethidium bromide. DNA from the appropriate clones was concentrated
by ethanol precipitation and was sent for sequencing with the use ofT3 and T7 primers
that are part of the pBluescript SK plasmid.
PCR amplification was achieved with previously described primers (Wright et al.
2001), newly obtained sequence from this study, as well as sequence provided by Dr.
Paul Gulig at the University of Florida. PCR amplifications were performed with 100 ng
of DNA per 25pl reaction and either Taq DNA polymerase (Eppendorf) for routine PCR
reactions (product sizes < 6Kb) or Expand Long Template PCR System (Roche) for
longer amplicons. All PCR reactions were carried out using a thermocycler (GeneAmp
PCR System 2400, PERKIN ELMER, or Mastercyclergradient, Eppendorf) under the
following conditions: incubation at 94C for 5 min, 25 cycles of 94C for 1 min, 560C for
1 min, and 720C for 1 min with a final 7 min extension at 720C or for longer amplicons
according to the manufacturers instructions (Roche). Amplified products were visualized
on an agarose gel (0.5 to 3%) with ethidium bromide, and DNA was obtained from the
bands and purified with the use of Ultrafree-MC Centrifugal Filter Devices (Millipore).
Alternatively, the PCR products were purified directly from the PCR reactions with the
GENECLEAN KIT system (Q-BIOgene). The purified amplicons were subsequently
cloned in pGEMTEasy (Promega) and pBluescript SK (Promega) vectors, and then both
were introduced into chemically competent E. coli JM109 cells (Promega).
DNA Sequence Analysis
DNA was sequenced at the ICBR core facility at the University of Florida.
Nucleotide sequence identity searches and alignments were done with the TFASTA,
FASTA or PILEUP program (GCG Wisconsin Package) or BLAST (National Center for
Biotechnology Information).
Restriction Fragment Length Polymorphism
Identification of possible differences located downstream from the CPS operon was
performed by PCR amplification. Primers that originated downstream from the conserved
CPS region (after wzc) were used to amplify that region, and the amplicons were
analyzed by restriction fragment length polymorphism. The bacterial strains that were
used for this part of the study were M06-24/O and the translucent phase variant M06-
24/T. DNA from these strains was amplified by PCR (as mentioned above) yielding two
portions of the downstream region of the operon. The first one was an 8-Kb fragment
originating from wzc to wbjB, with primers wzce2: aagagattgatgtagcgcgcag and 737B:
cgagtccatatactactcgt, and the second an 11-Kb fragment with primers 737C:
gctcatcatatacctgagca and ugdB: ctcaatatccacatctacgatag that covered the region from
wbjB all the way to the end, ugd. The amplicons were then digested with four restriction
enzymes (Alul, RsaI, HaeIII and Hinfl, Promega) with the following reaction mixtures:
0.5 ag of DNA, 2 pl of Buffer, 1 tl of enzyme in total volume of 20 ul. The digestion
mixtures were incubated at 37C overnight and were visualized on an agarose gel (2%)
with ethidium bromide.
Complementation of wzbv, in V vulnificus M06-24/T Phase Variant
PCR products of M06-24/O and LC4/O containing the wzb gene as either a 1-Kb
(752K-ggttgatcagataacgcgaa and wzb 1-aaggaatacaagcgtctagg) or 3.6-Kb (B712K-
gcgaggatccagcaacttacgttcactt and Pwzb -gttacccgggaatacaagcgtctaggt) fragment, without
or with upstream sequences, respectively. Either pGEMT-Easy (Promega) or TOPO TA
(Invitrogen) cloning vectors were used for the 1-Kb and 3.6-Kb, respectively. The
ligation reactions were performed according to the manufacturer's instruction, and then 4
ll of the ligation mixtures were introduced into chemically competent E. coli JM109
(Promega). Screening of the insert-containing clones was performed with blue/white
selection (Promega) of the grown colonies on the appropriate antibiotic plates. The
plasmids of the desired colonies were extracted (as described previously) and were EcoRI
and BamHI-digested (as mentioned previously). Restriction fragments containing the wzb
were further ligated into pRK404 plasmid (same as with other plasmids) and subcloned
into conjugation-competent E. coli Sl7-kpir (Simon et al. 1983) to yield pWZBI
(without upstream sequences) or pWZB3.6 (with upstream sequences) plasmids.
Recombinant DNA was introduced into translucent V. vulnificus LC4/T (T2) as
previously described (Wright et al. 2001) through conjugation, and transconjugates were
plated to LB agar plates containing tetracycline (10Iag/ml) and polymyxin (50gg/ml) and
were observed for colony morphology. Complemented strains were selected by reversion
to opaque colony morphology and confirmed by DNA sequencing as described above.
Electron Microscopy
V vulnificus cells were recovered from overnight growth on agar plates and
negatively stained with osmium vapors (Os04, Ted Pella, Redding, CA). A loopfull from
the bacterial culture plate was used to inoculate a drop of LB broth on 300mesh copper
microscopy grids (Ted Pella, Redding, CA) coated with plastic membrane. The grids
were secured with double sided sticky tape on a microscope slide and were placed in an
osmium chamber without coming in contact with the osmium droplets. They remained in
the chamber for 45 min to fix and negatively stain the bacterial samples. Lastly, grids
were washed gently once with water and let to dry for 10-15 min before visualization.
The samples were visualized under a transmission electron microscope Zeiss EM-10 CA
at 80 Kv.
CHAPTER 3
RESULTS: SPECIFIC AIM 1
Rationale for Study
As mentioned previously, Wright et al. (2001) identified a gene with homology to
wza of E. coli K30 (Drummelsmith and Whitfield 1999) that was required for surface
assembly of the V. vulnificus CPS. According to Drummelsmith and Whitfield (1999) all
group 1 CPS operons contain wza-wzb-wzc homologues, leading to the assumption of a
group 1-like CPS operon present in V. vulnificus M06-24/O (Wright et al. 2001). The
presence of all three conserved genes will strengthen the assumption that in V vulnificus
M06-24/O a group 1 CPS operon is present. Thus, sequencing of the entire CPS operon
would help us assign with certainty the CPS type.
Genetic Organization of V. vulnificus Group 1-like CPS Operon
Group 1 CPS operons have been described for a number of gram-negative species
(Drummelsmith and Whitfield 1999, Whitfield and Paiment 2003) and are generally
organized into contiguous regions containing a 5' locus with highly conserved
translocation and surface assembly genes (wza, wzb, and wzc) of the CPS to the cell
surface, followed by the polymorphic region with genes for CPS biosynthesis and
polymerization (Drummelsmith and Whitfield 1999). The CPS operon described for the
group 1 prototype isolate (E. coli E69 09a: K30) consists of 12 open reading frames
(Figure 2D, Drummelsmith and Whitfield 1999, Rahn et al. 1999), which are divided into
two regions by a transcriptional attenuator (Rahn and Whitfield 2003).
Cloning and PCR amplification allowed sequencing of the entire CPS operon for V
vulnificus M06-24/O. The genetic organization of the operon demonstrated homology to
the other group 1 operons (Figure 2). The previously identified wzav, (AAL09161,
Wright et al. 2001) was followed by the well-conserved wzbvv (56% deduced amino acid
identity to the putative acid phosphatase Wzb ofE. coli) and wzcvw (42% deduced amino
acid identity to the Wzc tyrosine-protein kinase ofE. coli). The conserved CPS
translocation and surface assembly genes that usually localize the 5' region of V.
vulnificus operon followed the polymorphic 16-Kb gene cluster responsible for the
biosynthesis and polymerization of the capsule. As a result, genes upstream of the
attenuator include wza-wzb-wzc, while downstream genes encode serotype-specific
glycosyltransferases and other components of the Wzx- and Wzy-dependent
polymerization pathway (Rahn and Whitfield 2003). The presence of wza-wzb-wzc
homologues confirmed the identity of this operon in V vulnificus, as these genes are
indicative of group 1 CPS operons in E. coli and other species (Drummelsmith and
Whitfield 1999).
Examination of multiple CPS operons from different strains of V vulnificus
showed similarities in the genetic organization (Figure 2). Genomic sequence from
GenBank for V. vulnificus strains CMCP6 (Kim et al. 2003) and YJ016 (Chen et al. 2003)
also indicated the presence of wza-wzb-wzc homologues and confirmed group 1 operons
as common to the species.
CL-
too
Ar
i, pLb0f
C c~u
Ca
ts U
Ij) N _
0. S ()
LQ~
*0 3
a0 j>) 0)5 ^
"5a
U -.
10
t3 40~o
3c,
= r =
0
Is N cn
.4j 4L
t" 0. 1 I i s
AL 45 5 I
tt ^ ,
t3 g
45
a E
III t I u cs a g tc
0 0 ?
> -a
Sgt
A LL u.
AL Q
Q AL 01 AL SO U
0 a)
o 03 S- |
^ BO 4 i; Yi .
ts |i0
:" Us1 I ;| -*|
i., 5n h S l ^ S ?
0 -6
u 'S
n.9 ^ va .; M ~'-'-
L u e E
E..
H
-5 0
C
0 5-
C C12
SU
Further, a hybridization study using a wza gene probe indicated group 1 operons
were present in the great majority of encapsulated V. vulnificus strains (Wright et al.
2001). Although all V. vulnificus operons contained wbfY and wbfVhomologues at the 3'
termini, the biosynthetic regions among these strains were, as expected, polymorphic and
reflected the diversity of the polysaccharide structures that has been observed for this
species (Hayat et al. 1993).
Identification of Genes for CPS Biosynthesis in V. vulnificus M06-24/0
The CPS translocation and surface assembly genes were followed by the
polymorphic region that contains genes for the biosynthesis of group 1 CPS (Table 2).
The repeating unit of the V vulnificus M06-24/0 CPS polymer was comprised of three
quinovosamine (QuiNAc) and one galactosamine (GalNAcA) sugar residues (Reddy et
al. 1992). The aforementioned monosaccharide components are not present in the E. coli
K30 group 1 CPS, however, GalNAcA was found as a linear homopolymer in the Vi CPS
of Salmonella typhi and S. paratyphi C (Reddy et al. 1992, Daniels et al. 1989). Both
QuiNAc and GalNAcA have been identified in O-specific chains of LPS of P. aeruginosa
strains (Kaya et al. 1989). Detailed summary of individual genes, their homologues, and
function are shown in Table 2, with all of the ORFs of known identity exhibited
homology to genes related to either the biosynthesis of CPS or LPS. The first gene in the
polymorphic region aligned with deduced amino acid sequence to a UDP-N-acetyl-D-
galactosamine dehydrogenase.of V vulnificus (wbpO, 97% identity) and also aligned
with the conserved domain for WecC/Ugd enzymes (NCBI/CD COG0677/COG1004.1,
95.4% and 99.8% identity with 436 and 414 of 441 amino acids respectively) a predicted
UDP-mannose or glucose 6-dehydrogenase, responsible for the production of UDP-
uronic acid sugars or aminosugars. The predicted Ugd protein product was shown to be
necessary for E. coli E69 K30 antigen synthesis, with glucose, galactose and mannose
sugars in its repeating CPS unit (Drummelsmith et al. 1997). Following was a gene with
deduced amino acid homology to wbqB/wbpP (73%/71% identity), a putative UDP-
glucose-4-epimerase, part of the E. coli 0121 O-antigen gene cluster and a biosynthetic
gene in the B-band O antigen of P. aeruginosa serotype 06 LPS, respectively (Raymond
et al. 2002, Fratamico et al. 2003). This V. vulnificus gene also gave an alignment (52.5%
identity) with the conserved domain for WcaG enzyme (NCBI/CD COG0451), a
nucleoside-diphosphate-sugar epimerase, responsible for carbohydrate transport and
metabolism that is found in the E. coli K-12 colanic acid with fucose, glucose and
galactose sugar residues and isolates with group 2 capsules (Stevenson et al. 1996,
Whitfield and Paiment 2003). The B-band of P. aeruginosa LPS is a repeating linear
tetrasaccharide consisting of QuiNAc and GalNAcA, sugars also found in the V
vulnificus M06-24/0 capsule. A knockout mutant of that wbpP in Pseudomonas led to B-
band deficiency, which was cross-complemented by a salmonella Vi CPS homologue,
wcdB, encoding a NADP-dependent enzyme required for synthesis of the GalNAcA
homopolymer (Houng and Venkatesan 1998). These data indicated that wbpP is taking
part in the biosynthesis of UDP-GalNAcA.
The sequence downstream of wbpP had only limited deduced amino acid alignment
(22% identity, 42% similarity) to the Wzx protein of Streptococcus thermophilus, a
conserved flipase in the Wzy-dependent pathway (Broadbent et al. 2003). This protein
was shown to be required for the transport of the lipid-linked group-1 K30 capsule units
across the plasma membrane to the periplasmic space in E. coli (Drummelsmith and
Whitfield 1999). The wzx gene was reported previously for a CPS-related locus of
another V vulnificus strain (Smith and Siebeling 2003); however, the genetic context
differed, as it was flanked by two genes with homology to wcvF (24% identity,
AAC70778) and wcvG (18% identity, AF048749), which encode rhamnosyl and glycosyl
transferases, respectively. Interestingly, wzx (19% identity, AAC32342) was present only
in one of the two published genomes, and the wzy was not found only in the V. vulnificus
1003 (Chen et al. 2003, Kim et al. 2003, Smith and Siebeling 2003). The NCBI/CDD
gave an alignment (100%, NCBI/CD pfam01943) with a polysaccharide biosynthesis
protein, with members of this family being integral membrane proteins (Rfbx protein is a
member of that family and is involved in the export of O antigen and teichoic acid).
The sequence following wzx showed deduced homology (29% identity, 48%
similarity) to a hypothetical protein (HP) from the marine planctomycete Pyrellula sp.
Strain 1 (Glockner et al. 2003) and contains a protein signal peptide and transmembrane
prediction domain. This gene was followed by one with deduced amino acid sequence
homology to the HP- ORF10 (28% identity, 46% similarity) in the wb* cluster of the 037
serogroup O-antigen biosynthesis of V cholerae, which encodes a glycosyl-transferase
enzyme involved in polysaccharide biosynthesis (Li et al. 2002). Is a unique gene in the
037 wb* cluster with no significant homology to the previously published V cholerae
wb* cluster sequences (Li et al. 2002). The gene product of the next ORF was
homologous (36% identity, 52% similarity) to a probable mannosyltransferase B, wbdB,
in K. pneumoniae 05-antigen LPS (homopolymer of mannose residues), and the
NCBI/CDD gave an alignment (91.3%, NCBI/CD pfam00534) with a glycosyl-
transferase 1, or waaG (formerly rfaG) in 0157:H7 (Kido et al. 1998, Merino 2000,
Shimizu et al. 2002). According to the NCBI/CD, members of the glycosyl-transferases
group 1 family transfer activated sugars to a variety of substrates, such as fructose-6-
phosphate and lipopolysaccharides. The structure of the 0157 polysaccharide is
unbranched and linear with a tetrasaccharide repeating unit: [-3)-a-D-GalNAcp-(l-2)-a-
D- PerNAcp-(l-2)- a-L-Fucp-(1-4)-P-D-Glcp-(l-]n (Perry et al. 1986), and these enzymes
are necessary for core-elongation of the LPS (Barua et al. 2002). The WaaG protein is a
UDP-glucose: lipopolysaccharide a 1,3-glucosyltrasnsferase that adds glucose I to
heptose II of the core oligosaccharide of LPS, and loss of the gene resulted in absence of
the outer core oligosaccharide of LPS (Barua et al. 2002).
The next four ORFs were homologous to genes with deduced amino acid
homologies to genes involved in the production of quinovosamine and
galactosaminouronic acid polysaccharides. The first gene was homologous to an
epimerase/dehydratase enzyme (85% identity, 94% similarity) of V. cholera 037-
antigen biosynthesis (ORF7, Li et al. 2002) and WbjB protein of Pseudomonas
aeruginosa (75% identity, 84% similarity). WbjB was involved in polysaccharide
biosynthesis in the surface polysaccharide structures of P. aeruginosa 011 strain PA 103
O-antigen, which possesses two fucosamine and one glucose sugar residues, and is
homologous to cap5E gene of Staphylococcus aureus Type 5 CPS biosynthetic loci
(Dean et al. 1999). Such homology is not surprising, as they all have in common the
presence of N-Acetyl-L-fucosamine residue in their structures. WbjB/Cap5E are
moderately homologous to WbpM of P. aeruginosa, involved in UDP-N-acetyl-D-
fucosamine/quinovosamine biosynthesis from UDP-D-GlcNAc. Thus it is the first
enzyme in the fucosamine pathway and is involved in the dehydration and epimerization
of the UDP-D-GlcNAc (Creuzenet and Lam 2001). The NCBI/CDD gave an alignment
(83.8%, NCBI/CD COG0451) with WcaG, which belongs in a family of nucleoside-
diphosphate-sugar epimerases, members of which are involved in carbohydrate transport
and metabolism. WcaG is also found in the E. coli K-12 colanic acid with fucose,
glucose, and galactose sugar residues and isolates with group 2 capsules (Stevenson et al.
1996, Whitfield and Paiment 2003).
The V vulnificus wbjB gene is followed by two genes with homologies to wbjC and
wbjD of P. aeruginosa 011 strain PA 103. These two genes are homologues of cap5F and
capSG and follow cap5E in S. aureus group 5 CPS, all of which are involved in the
biosynthesis of O-antigen and capsule respectively (Kneidinger et al. 2003). Knockouts
of cap5E or cap5G resulted in acapsular S. aureus mutants (Wann et al. 1999, Kneidinger
et al. 2003). In V. vulnificus M06-24/0 operon a homologue (68% identity, 81%
similarity) to deduced amino acid sequence of genes wbjD was present but not wbjC as
seen in the putative L-FucNAc biosynthesis pathway. WbjD shows homology to UDP-
GlcNAc 2-epimerases involved in the biosynthesis of UDP-ManNAc, yielding a mixture
of UDP-L-PneNAc and UDP-L-FucNAc (Kiser et al. 1999). However, a gene with
homology to RmlD (65% identity, 78% similarity) replaced wbjC and was located
between wbjB,v and wbjDy, in V vulnificus M06-24/0. This protein catalyzes the
reduction of a hexulose intermediate to dTDP-L-rhamnose (Kneidinger et al. 2003).
Bacterioides fragilis NCTC9343 capsular polysaccharide B (PS B) is composed of the
repeating unit [4)-L-QuipNAc( 13)-D-QuipNAc( 14)[-L-Fucp( 12)-D-GalpA(13)-D-
GlcpNAc(13)]-D-Galp(l], which lacks L-FucNAc or L-PheNAc, but interestingly also has
genes highly similar to wbjB and wbjD of P. aeruginosa serotype 011 that flank rmlD
(Coyne et al. 2000, Kneidinger et al. 2003). The intervening gene replaces wbjC,
probably because there is no fucosamine present in the CPS of the V vulnificus M06-
24/0. Substitution of wbjC has been observed before in clusters containing the
wbjB/capSE/wbvB and wbjD/cap5G/wbvD genes (Kneidinger et al. 2003). This gene is
part of the rmlA-D pathway of dTDP-L-rhamnose in V cholerae O-antigen. L-rhamnose
is commonly present in O antigens of gram-negative bacteria and capsular
polysaccharides of gram-positive bacteria (Li et al. 2002). dTDP-L-rhamnose is the
activated form for the rhamnose moiety in both O antigen and CPS biosynthesis (Li et al.
2002). The synthesis of dTDP-L-rhamnose from D-glucose 1-phosphate is catalyzed by
four enzymes encoded by rmlA, rmlB, rmlC, and rmlD genes, which are generally
grouped within O antigen or CPS gene clusters and present always when rhamnose is in
the structure (Bik et al. 1996, Stroeher et al. 1998, Li et al. 2002). The next gene in the
polymorphic region was wbuBrv, which showed homology to a putative L-fucosamine
transferase, WbuB, in the O antigen gene cluster of E. coli 026 (51% identity, 67%
similarity) (D'Souza et al. 2002). The 026 O antigen contains the sugars L-rhamnose (L-
Rha), N-acetyl-L-fucosamine (L-FucNAc) and N-acetyl-D-glucosamine (L-GlcNAc)
(Manca et al. 1996). They suggested that it is responsible for the linkage a-L-FucNAc-(1-
3)- o-GlcNAc.
The last four genes showed homology to the wbfT (66 % identity, 81% similarity),
wbfU (81% identity, 90% similarity), wbfY(70% identity, 82% similarity) and wbfV
(72% identity, 84% similarity), respectively, of V cholerae 0139 O antigen biosynthesis
(Yamasaki et al. 1999). The structural configuration of the sugar moieties of 0139 LPS
contains the trisaccharide GlcNAc-GalA-QuiNAc (Yamasaki et al. 1999). Interestingly,
Table 2. Homologues for the V. vulnificus genes in the group 1 CPS operon
Amino
Size Amino Accession Species
Gene ) acid Description n
(bp) identity (reference)
identity
100 Function unknown
Periplasmic
1287 100 protein, cps
transport
212
444
S Hypothetical
protein
Protein-tyrosine-
phosphatase
Putative tyrosine-
2275 92
protein kinase
UDP-N-acetyl-D-
1323 97 galactosamine
dehydrogenase
wza
HP
wzb
wzc
wbpO/
wecC
wbpP
(wbqB)
934
419
UDP-glucose-4-
epimerase
Putative
22 involvement in
exopolysaccharide
Hypothetical
transmembrane
29
protein with signal
peptide
ORFX 244
1204 29 Glycosyl-
transferase
NP 759762
AAL09161
AEO16799
NP 933132
NP 759758
AAQ17507
AAM27817
(AAO39691
)
AAL32506
NP 864758
V vulnificus
CMCP6
(Kim et al. 2003)
V. vulnificus
M06-24
(Wright et al. 2001)
V vulnificus
CMCP6
(Kim et al. 2003,
Simpson et al.
2000)
V vulnificus YJO16
(Chen et al. 2003)
V vulnificus
CMCP6
(Kim et al. 2003)
V. vulnificus
(Park et al. 2003)
P. aeruginosa
(Raymond 2002)
Strep. thermophilus
(Broadbent et al.
2003)
Pirelula sp.
(Gloeckner et al.
2003)
V cholerae 037
(Li et al. 2002)
71
1079
(73)
wzx
HP
AAM22598
Table 2. (Continued)
Amino
Size Amino Accession Species
Gene ) acid Description no eeen
(bp) identity no. (reference)
Probable mannosyl-
transferase B/
1227 36 .
putative glycosyl
transferase
wbjB/ 1125 85 Epimerase/
wcaG (75) dehydratase
dTDP-4-
rmlD 923 65 dehydrorhamnose
reductase
UDP-N-
wbjD 1159 66 acetylglucosamine
2-epimerase
Putative L-
wbuB 1096 51 fucosamine
transferase
Probable UDP-
66 galactose 4-
epimerase
81 Probable galactosyl
transferase
1958 70
(97)
72
1194 72
(97)
Predicted
nucleoside-
diphosphate sugar
epimerase
Predicted UDP-
glucose 6-
dehydrogenase
AF 189151
AAM22595
(AAF72954)
AAM22596
AAM27787
AAN60464
BAA33610
BAA33641
BAA33644
(NP_759752)
BAA33642
(NP_759751)
wbdB
waaG
(rfaG)
a Identities are based on the Protein BLAST.
K pneumoniae
(Shimizu et al.
2002, Merino et
al., 2000)
V cholera 037
(Li et al. 2002,
Dean et al. 1999)
V cholera 037
(Li et al. 2002,
Manrong et al.
2002)
P. aeruginosa
(Raymond, 2002,
Dean et al. 1999)
E. coli 026
(D'Souza et al.
2002)
V cholerae 0139
(Yamasaki et al.
1999)
V cholerae 0139
(Yamasaki et al.
1999)
V cholerae 0139
V vulnificus
YJ016
(Yamasaki et al.
1999, Chen et al.
2003)
V. cholerae 0139
V vulnificus
CMCP6
(Yamasaki et al.
1999,
Kim et al. 2003)
wbfT
wbJU
wilY
wbfV /
Ugd
the wbfV gene also exhibited 100% alignment (according to the NCBI Conserved Domain
Search) with Ugd dehydrogenase (COG1004.1, Ugd).
Comparison of the CPS Operons Among Vibrio Species
In late 1992 in Bengal a novel V. cholerae serogroup, 0139, was isolated and
literally replaced V cholera 01 as the major cholera serogroup (Stroeher et al. 1998). V
cholerae 0139 serogroup is essentially the same as V cholerae 01 of the El Tor biotype
with the acquisition of a new 0-antigen and capsule (Johnson et al. 1994, Karaolis et al.
1994, Manning et al. 1995, Bik et al. 1995, Comstock et al. 1995, Stroeher et al. 1995,
Bik et al. 1996, Comstock et al. 1996, Stroeher et al. 1997, Stroeher and Manning 1997).
It has been shown that the 0139 LPS can be described as semi-rough as it appears to
have only a single 0-antigen repeat unit (Manning et al. 1995). Furthermore, V. cholerae
0139 has been reported to have capsular material (Waldor et al. 1994) and produces two
colony morphologies, opaque or translucent, as is seen in V vulnificus M06-24 (Johnson
et al. 1994, Weintraub et al. 1994).
The 0-antigen of the V cholera 01 LPS is a homopolymer of 4-amino-4,6-
dideoxy-mannose (perosamine), which is substituted with 3-deoxy-glycero-tetronic acid
(tetroate) (Kenne et al. 1982). The LPS also contains another sugar known as
quinovosamine. This sugar is found in a ratio of approximately 1 to 20 compared to
perosamine and is thought to either cap the O-antigen or the core oligosaccharide.
Quinovosamine is also found in V cholerae 0139, which has a completely different O-
antigen composition (Figure 2D) (Stroeher et al. 1998), and in the CPS of V vulnificus
M06-24 (Reddy et al. 1992). The sugars found in the LPS of V cholerae 0139 are
primarily colitose, glucose, heptose, fructose, glucosamine and quinovosamine (Knirel et
al. 1995, Preston et al. 1995).
The genetic region required for the biosynthesis of the V. cholerae 0139 O-antigen
is the rib operon and contains the insertion sequence IS1358 (Manning et al. 1995,
Stroeher et al. 1995, Fallarino et al. 1997). The IS1358 element, previously associated
with V vulnificus CPS expression and was conserved among LPS operons of other
serotypes, as well as in V anguilllarum. Highly conserved regions flank the 0139 CPS
region and are homologous to LPS loci in other V. cholerae strains, suggesting that V
cholerae 0139 arose from epidemic 01 El Tor strain by homologous recombination with
DNA from a non-pathogenic donor (Stroeher et al. 1998, Sozhamannan et al. 1999). As
both CPS and LPS are heterogeneous among most V vulnificus strains, perhaps lineages
with recombinant CPS/LPS loci will become apparent as more genomic sequence and
polysaccharide structure become available.
IS elements were previously associated with CPS genes in one strain of V
vulnificus (Smith and Seibeling 2003). In this study, several IS elements were linked to
CPS-related genes, and variability in genomic location was observed between translucent
and opaque variants. However, the relationship of these loci to a particular operon or the
relationship of IS elements to CPS gene expression was not demonstrated. Our sequence
and other genomic sequence did not identify any IS elements associated with group 1
loci, but the possibility exists that IS elements may be relevant to phase variation for
other types of CPS operons in V. vulnificus.
Upstream of the rfb operon the JUMPstart sequence is present, described by Hobbs
and Reeves (1994), which has regulatory function (Bailey et al. 1997). The JUMPstart
region is found upstream of most polysaccharides and not surprisingly was upstream of
wza in V vulnificus M06-24/0 (Wright et al. 2001). Thus in V cholerae 0139 the
biosynthesis of the capsular material and the LPS occurs at the same region and both are
comprised of the same sugars, their only difference is that the O-antigen is attached to the
lipid A-core (Waldor et al. 1994). The surface polysaccharide biosynthesis region of the
V. cholerae 0139 surface polysaccharide is complex as is also seen in V vulnificus M06-
24. Mutational analysis has shown that there are some genes involved in both capsule and
0-antigen biosynthesis, as well as genes specific for either capsule or O-antigen (Waldor
et al. 1994, Comstock et al. 1995, Stroeher et al. 1995, Bik et al. 1996, Stroeher et al.
1997).
Although, V cholerae 0139 has a CPS the genes for the translocation and surface
assembly were different from those seen in group 1 operons. Additionally, a stretch of
highly conserved genes is located on the 3' end of the operon, which is common for both
V cholerae 01 and 0139 rfb region. WbfU is a galactosyl transferase, WbeW in V
cholerae 01, and a mutation in this gene affects O-antigen synthesis (Fallarino et al.,
1997). Stroeher et al. (1998) hypothesized that the UDP-galactose, which is produced by
wbJT and wbfW, is picked up by one of the putative galactosyl transferases (WbfS and
WbfU) and gets transferred to the lipid carrier, bactoprenol. Five more genes were
present in the 3' of the 0139 operon, wbfP, wbfR wbJV, wbfX, and wbfY, which were
homologous to a galactosyl transferase ofEr. amylovora, an aspartame synthetase that is
found in a number of species, a nucleotide sugar dehydrogenase of E. coli 0111 and two
proteins with unknown functions, respectively (Stroeher et al. 1998). WbfT, WbfU,
WbfY, and WbfV were present and highly homologous to ORFs that were also located at
the 3' end of the group CPS operon of V vulnificus M06-24.
42
Similarities between V. vulnificus M06-24 and V cholerae 0139 biosynthetic
regions were present and both operons had genes with no defined regions that
corresponded to specific biosynthetic pathways. Additionally, multiple distinct genes
with similar function were present and most importantly the 3' end between them
demonstrated high level of conservation. It could be hypothesized at this moment that V.
vulnificus M06-24 could have served as one of the donors for the acquisition of the
newly acquired CPS genes of V. cholera 0139.
CHAPTER 4
RESULTS: SPECIFIC AIM 2
Rationale for Study
The results from the previous chapter allow with confidence the assumption of a
group 1 operon in V. vulnificus M06-24/O with characteristic conservation of the
translocation and surface assembly genes (wza, wzb, wzc). These results in combination
with the preservation of the wza gene in multiple V vulnificus strains (Wright et al. 2001)
led us to the second aim. This chapter describes various studies that were performed in
order to examine the level of conservation of the genes that are located upstream of the
biosynthetic region. To achieve such a task V. vulnificus strains were obtained, and their
translocation and surface assembly regions were sequenced. Additionally, sequence from
the two published V vulnificus genomes in the GenBank (Kim et al. 2003, Chen et al.
2003), the Vibriofisheri genomic sequencing project' and the prototype for group 1
operons in E. coli were available and were all included in the analysis.
Unique, Species-Specific Organization of V. vulnificus CPS Translocation and
Surface Assembly Genes
DNA sequence comparisons of the organization of the conserved CPS translocation
and surface assembly genes for V. vulnificus strains revealed genetic structure in this
region of the operon that was unique to the species (Figure 2). Previously described
group 1 operons in other species exhibit the CPS transport genes, wza, wzb, and wzc in
uninterrupted succession. However, in V. vulnificus M06-24/O wza and wzb were
Shttp://ergo.integratedgenomics.com/Genomes/VFI
interrupted by an open reading frame encoding a hypothetical protein (HP), and flanking
wzb and wzc was a stretch of short sequence repeats (SSRs) identified as RIA, RIB and
not seen in other group 1 operons (Table 3). Direct repeats in positions RIA and RIB
contained the same repeated 8-bp sequence (ACAGGACC) in V. vulnificus M06/O and
its phase variant and LC4/O. The number of the R1A and RIB repeating units differed
among the strains with 25 and 8 in M06-24/O, 24 and 8 for the translucent variant of
M06-24 and 23 and 10 for the 0 variant of a different clinical strain, LC4, respectively.
An additional SSR (R2) was observed in V. vulnificus M06-24/0 following wzc but
differed from RIA and RIB in the repeating subunit, 7-bp in length (CTAGAAC). The
number of repeating units did not differ between the M06-24 phase variants, 13 repeating
units in both. Unfortunately, loss of conservation that characterizes the biosynthetic
region the presence and the number of repeating units for R2 could not be identified for
the LC4 phase variants.
Published V vulnificus genomic sequences (BAC93101, AA009290) from strains
CMCP6 and YJ016 exhibited homologous organization to the CPS operon of V.
vulnificus M06-24/0 and also included the HP and the repeats. However, R1A (27
repeating units) and RIB (14 repeating units) were identical in the sequence of the SSRs
but were only present in the CMCP6 and not the YJ016 (Chen et al. 2003, Kim et al.
2003). R2 sequences were also present in the genomic sequences, but they differed from
M06-24 in the number and in the location. Strain CMCP6 had 20 repeating units of the
R2, but did not follow wzc. instead were located downstream of swecC (Kim et al. 2003).
Genome2, YJ016 strain, contained two copies of the R2 repeating unit in its first
chromosome. The first was located 5-Kb upstream from the conserved genes with 22
repeating units and the second did not follow wzc also but wecB, with only 5 repeating
units. Interestingly, this region of the V. fischeri genome also contained an intervening
HP between wza and wzb sequence but the direct repeats were not present, suggesting
that these SSRs are specific for the V. vulnificus species.
Comparison of CPS Operons for V. vulnificus Strains: Identification of Three Types
of Phase Variants
Opaque and translucent phase variants of different V. vulnificus strains were
examined for sequence divergence in the CPS operon. Differences in DNA sequence
between strains M06-24 versus LC4 in the DNA coding sequence of the CPS
translocation and surface assembly genes (wza, wzb, wzc) showed considerable variability
that was not expected for conserved genes. For example over 100 bp and 15 amino acid
substitutions were observed in wzc between MO6-24/O and LC4/O strains (Table 4).
DNA sequence identity ranged from 95 to 100% for the 5 ORFs, as shown at this locus.
On the other hand, near DNA sequence identity ranging from 99 to 100% of individual
coding sequences between phase variants of MO6-24 strain was noted. However, DNA
sequencing identified three distinct genotypes associated with phase variation, which
were designated TI, T2. and T3. As described below, multiple base substitutions were
observed in TI, and deletion mutations were observed for T2 and T3 phase variants.
As shown in Table 4, translucent variant MO6-24/T1 was very similar to the
opaque parent strain in the translocation and surface assembly gene region and differed
by 6 bases overall in the coding regions of the conserved CPS genes, resulting in 2 amino
acid substitutions in Wza. Thus, although TI exhibits minor gene rearrangement in
m rm 0
Cl
m m'
C, C.
C*V
I I
0
H
Q
-U
0L
0
-Q
cd3
o .v
E
00 00
N IN
I I
N N
I I
5 N
I I
I I
O -
6 6 u
o 0o U
0 0 0- oa
3 3 Z E z E
^ ^^
c.
I
I N
00 O
) 0O
"5
8 S i*
3 o? O "i "
cl -
U
o
I
0
I
0
I
0
V-
en
0
I-
4-
r.
a,
o
cIe
0t
u,
os
o
CL
. I I
ORFX and wza. the operon appears to be intact. The putative promoter region upstream
of wza was divergent between M06-24/O and phase variant M06-24/T1. As CPS is still
expressed in TI strains, we hypothesized that expression was somehow down-regulated
by genetic mutations in the CPS locus. Alternatively reduced expression could be due to
mutations in regulatory regions outside of the CPS operon or to post-translational events,
such as up-regulation of CPS degradative enzymes.
Down-regulation of CPS in E. coli was postulated to result from loss of tyrosine
phosphorylation sites in wzc. There were 6 tyrosine residues in wzcvv of V. vulnificus
M06-24/O compared to seven in E. coli. However, 100% DNA identity was observed for
wzb and wzc between M06-24/O and Ti; therefore, this mechanism could not account for
down-regulation of CPS in V vulnificus. RFLP comparison of PCR amplicons from the
downstream biosynthetic region of the CPS operon also did not detect any large deletions
or rearrangements in the genetic structure (Figure 3). Thus, divergence within the CPS
operon did not explain the TI genotype, and the genetic basis for M06-24 phase
variation cannot be assigned thus far.
However, translucent LC4 (T2) also diverged from the opaque parent strain
(LC4/O) in the number and location of repeated units for R1A and RIB regions (Table
3). Thus, the LC4/T2 deletion encompassed not only a 440-bp segment that included the
entire wzb gene but also removed part of the RI SSR repeating units, reducing the total
number of repeated subunits from 33 to 12. PCR amplification confirmed this deletion in
a number of translucent isolates (Figure 4). It was hypothesized that this deletion was
responsible for the phase variation in T2 isolates and was mediated the Rl direct repeats
flanking this gene.
O Cl
00
C0 0C
00
c l -
- 0 0
o
d o
cq
i
o
*- 0
an
u V)
cd -:
cnc
a)
a
a)
-3 .9
Ec
S,-
tS o
S.-
e E
we
cz
u )
0
X;t
(U
.0
o
S
o
0
ve
&o
o2
c
I-m
E .i
N
*M'
_ I
Figure 4. PCR Analysis of CPS transport genes in V vulnificus phase variants
PCR amplicons derived from primers that spanned the region transport region of
the CPS operon, as described in materials and methods. Approximate band sizes
are derived from DNA standards (not shown). Opaque variants of MO6-24 (lane
1) and LC4 (lane 3), and their corresponding translucent variants (lane 2 and 4,
respectively).
Strain 345/T is an environmental isolate that was originally isolated as a translucent
variant. This strain was negative by PCR for the entire wza-wzb-wzc region but was
positive for the vvhA gene encoding the species-specific hemolysin gene of V vulnificus
(Jones et al. 2004). These results suggested that this strain may have extensive deletions
that removed the entire CPS transport locus. Alternatively, this strain may be negative for
the entire group 1 operon or possesses a non-group 1 CPS operon, which does not contain
the wza-wzb-wzc region. For example, Zuppardo and Siebeling (1998) identified genes
required for CPS expression in V. vulnificus 1003 that were not common to any of the
group 1 operons described herein. Therefore, it was hypothesized that T3 isolates may
represent multiple deletions that eliminate CPS expression. Supporting that hypothesis
TIT 0 T2
was the presence of multiple R2 regions flanking the entire CPS transport region in V.
vulnificus YJ016, suggesting that more extensive deletions are mediated by the tandem
R2 repeats.
Phenotypic Characterization of the Different Phase Variants
Previous examination of V vulnificus MO6-24/T (TI) indicated that this strain still
expressed capsule, but that CPS expression was reduced or otherwise impaired (Wright et
al. 1999). Immunoelectron microscopy (IEM) showed a patchy capsule that did not
completely encase these strains, and reduced CPS expression was also confirmed by flow
cytometry using monoclonal antibody (Wright et al. 1999). This report differed from
other studies that had indicated translucent V vulnificus variants were completely devoid
of capsule (Yoshida et al. 1985). Therefore, the phase types (T1, T2, and T3) described
above, were examined for CPS expression using electron microscopy. As shown in
Figure 5A, TI genotype (M06-24/TI) was confirmed to express some CPS, but as
expected deletion mutant T2 (Figure 5D) strain appeared completely acapsular. The T2
phenotype was also identical in appearance by EM to transposon mutant CVD752, which
was previously shown to be acapsular by both IEM and flow cytometry (Wright et al.
1999, 2001). The second deletion mutant, 345/T (T3) demonstrated the same
characteristics as T2.
Previous studies have demonstrated reversible phase variation for MO6-24 from
either O-T or T-O at a rate of about 10-3 to 10-4 (Wright et al. 1990). Thus, spontaneous
Tl revertants recovered by opaque colony morphology showed increased CPS expression
and virulence phenotype. Conditions that enhance the rate of phase variation
demonstrated that Ti strain was quite unstable, reverting at high frequency as indicated
by sectored colonies (Jones et al. 2004). On the other hand, T2 and T3 strains, as
expected, were stable in the translucent phase, presumably due to the consequence of
gene deletion. Thus, these studies demonstrated that the differences in translucent
phenotypes corresponded to the different genotypes.
I.
1D) LCJ4 2
Figure 5. Electron micrographs of V vulnificus strains and phase variants
Negatively stained V. vulnificus strains: A), C) Encapsulated M06-24/O and
LC4/O strains, respectively and B), D) T1 variant of M06-24/O and T2 variant
of LC4/O, respectively.
Q LC4/0w
CHAPTER 5
RESULTS: SPECIFIC AIM 3
Rationale for Study
Aim 3 proposed the examination of phase variant pairs of various V vulnificus
strains in order to identify mechanism of phase variation. The targets for this attempt
were the translocation and surface assembly genes of the highly conserved region of the
CPS operon. Nucleotide sequence and protein alignments in that region might
demonstrate differences that could account for the phase variation phenomenon seen in V
vulnificus. Differences throughout the entire CPS operon could exist that could harbor
valuable information about phase variation mechanisms, but loss of conservation that
characterizes the 3' termini of the CPS operon makes such a task impossible to
accomplish at this point (other than the RFLP analysis performed in the previous chapter
for M06-24 phase variants). This is the region that contains the CPS biosynthetic genes,
which vary according to the repeating units of the various capsular types.
Alignment of M06-24/O Phase Variants in the Putative Promoter Regions
As shown in Figure 6, the previously identified (Wright et al. 2001) putative
promoter differed between the M06-24/O and TI by one base at the -10 region (from
TAATAT to TAATAA, respectively). As both promoters have a non-ideal spacer length
(18 bp) and -35 region (TTGTGC), differences at this highly conserved site (82%) may
imply reduced promoter strength (Doree and Mulks 2001). T1 also exhibited three
additional substitutions that created a stretch of 6 adenine bases just downstream of the
promoter region.
M06-24/T: 301
M06-24/0: 515
06-24/T: 361
M06-24/0: 575
M06-24/T: 421
M06-24/0: 635
M06-24/T: 481
M06-24/0: 695
M06-24/T: 541
M06-24/0: 755
M06-24/T: 601
M06-24/0: 814
0M6-24/T: 661
M06-24/0: 874
O06-24/T: 721
Y06-24/0: 934
106-24/T: 781
106-24/0: 994
406-24/T: 841
406-24/0:1054
taatgcgatttttttcatgattattcctttgtatatatacgttttcaaacatcgatgtcg 360
l i lI iili l l i l l l i l i i l il 1 i i1l i l 1 l l i I lil l l li l l iil l i l ii
taatgcgatttttttcatgattattcctttgtatatatacgttttcaaacatcgatgtcg 574
gaactttaatagctccggtgtttattttaggtagaatttggAcggaatgtaaacaattag 420
gaactttaatagctccggtgtttattttaggtagaatttgggcggaatgtaaacaattag 634
ttgtagctgcaAcgatgtgaatttatggtttttatctcattgatagtaccgtttgcttag 480
li l ii lll1 II lilll l l llI ll l I 11 11i 111J i11 liI III I
ttgtagctgcagcgatgtgaatttatggtttttatctcattgatagtaccgtttgcttag 694
-35 -10
** ** ** *
caaaaacaattgtgctctaagccacaatatggataataAccgcccatAaAAaatattaat 540
caaaaacaattgtgctctaagccacaatatggataatatccgcccatgattaatattaat 754
** *** ** **
OrfX
~atg *ic iatactcagtG;GtQtcat3. ~ltcagtactttgttgcagcaagccattag 600
a J-1 -cacaa.:ta.,:7ij gt-.t4gt,:Cataaaa-cgtcaqtac: tttgttgqcagcaagccatttag 813
ops
agctattgcgcagcaaattgtcccagcgctatgtggttttgcgtgcttaccaaagggcgg 660
l i 1 1 l i l l l i i l i l i l l li l i Il l l l l i Il l il l l l l l l l i l l l l i l l I I
ag -rtgcgagcaaattgcc cg gggt tcttaccaagggcgg 873
tagcgtgtcaaaaaagccacaaatatgggtggaaaaccacacttttaacgggttcttaca 720
I i lIil I I ll Il li l I li l il l l l l l l l l i l l l i l l l i ll l Il l i l l i li
t cgtgtcaa~ai ii:ca aa rt tgggtggaaaaccacacttttaacggqttcttaca 933
ttttcttacgttcagttagcgtagaatgttgtgcgaagctgcttaaaatcgcagtcagtg 780
tlrrilli. ii I lil. il i lglililgril l tg llll ll llaagc taaaatcgcq 993
ttrcrtacgttcagtagctatargttgtgqgaagctgcttaaaatcgcagtcagtg 993
tgggagctaggctataaagtatagttaaatgcggttaaggaaaacgcctttaactatgtt 840
tgg.igagci:tagcgtaia. jtatagttaaatgcggttaaggaaaacgcctttaactatgtt 1053
wza v
gaatac : ,: rrr t agagtagaagasa,'gargrraatcgaactttgtcat 900
g i l l i l l l l a l lri. r t .il llal i l l l i l lll il lig t I la l l l il illg1 1 1 3
gaat aet rtt ,:a ag uttaga ageaatagtgttcaatCgaacctttgatcat 1113
Figure 6. Sequence comparison of the 5' region of the CPS locus for V vulnificus
Putative promoter region is shown in boldface, and locations of 10 and 35 sites
are indicated above coding sequence with asterisks over highly conserved
nucleotides (Hobbs and Reeves 1994). The "JUMPstart" region is underlined,
and the ops element is doubly overlined.
However, none of the differences between M06-24 phase variants could account
for the observed T1 phenotype because sequences from opaque strains other than M06-
24/0 were identical to the T1 promoter. A single base deletion within ORFX or T1
produced a frame-shift mutation that was not present in M06-24/O. It should be noted
that ORFX contains an ops element, which is part of a larger "JUMPstart" region that has
been shown to function as an anti-terminator in E. coli CPS (Gentz and Bujard 1985,
Hobbs and Reeves 1994). The wzi gene encoding a CPS anchor is located at this site in E.
coli and K. pneumoniae, but exhibited no homology to V. vulnificus ORFX. Other
differences between M06-24/O and T included two amino acid substitutions in wza. To
date, anti-terminator components for V. vulnificus CPS operon and the function of the
ORFX gene product have not been determined, and further studies to characterize these
elements and identify functional promoters are needed.
Phase Variation Mechanism for LC4/T2
The presence of SSRs (SSRIA, SSR1B) that were flanking wzb and the deletion of
the wzb gene in V vulnificus LC4/T2 phase variants suggested that the repeats could be
responsible for the phase shift. Therefore, complementation studies were performed to
introduce the intact wzb gene without (pWZB1) or with upstream sequence (pWZB3.6)
into wzb-deleted LC4/T2 phase variant. The pWZB1 construct consisted of the SSRIA
and the whole wzb gene, in contrast the pWZB3.6 construct, contained additionally the
upstream operon promoter, ORFX, and the wza gene. Both constructs were introduced
into conjugation competent E. coli S17- Xpir (Simon et al. 1983). Complemented LC4/T2
strains were screened for opacity.
The complemented mutants demonstrated opaque colony morphology, whether the
pWZB or the pWZB3.6 was introduced, indicating that wzb was able to complement the
defect in trans. Additionally, reversion to the opaque phenotype by the introduction of
the wzb gene alone implies that the upstream genes were functional and confirmed the
role of this gene in phase variation. The wzb gene was cloned from both M06-24/O and
LC4/O, and both copies were found to complement T2. Conversely, complementation of
these constructs into M06-24/T1 did not result in recovery of opaque phenotype, and
transconjugates remained translucent. Thus, complementation analysis determined that
the LC4/O phase shift to T2 was a result of a specific mutation at this locus.
Complementation studies also confirmed the role of wzb in CPS expression. Wzb
was previously proposed to contribute to CPS translocation to the cell surface, but
functional analysis was not available. Wzb in E. coli was shown to be the cognate
phosphatase for Wzc, and Wugeditsch et al. (2001) hypothesized that cycles of
phosphorylation and dephosphorylation may be required for CPS to be expressed in E.
coli. However, the wzb gene function was not confirmed. Therefore, complemented
mutants of LC4/T2 were also examined by electron microscopy (Figure 7). These strains
were found to express CPS equivalent to the opaque parent strain, which confirmed that
wzb is required for CPS expression on the cell surface.
The wzb gene in V vulnificus was flanked by two regions of repetitive DNA
segments, consisting of multiples of an 8-bp repeat which has identical sequence in both
sets but differs in the number of repeats. We hypothesize that these repeats may function
to facilitate the rate of recombination and play a role in the deletion responsible for T2
translucent phenotype in avirulent strains.
A)
e
A
B) C)
Figure 7. Electron micrographs of complemented V vulnificus LC4/T2
Negatively stained V. vulnificus strains: A) acapsular wzb-deleted LC4/T2, B)
complemented LC4/T2 with pWZB 1 plasmid from M06-24/O and, C)
complemented LC4/T2 with pWZB I plasmid from LC4/O
SSRs have been reported to promote phase variation through slipped-strand
mispairing. When repeats precede a gene in the promoter region, transcription is
influenced via the effects of variable length within the SSR on the strength of the
promoter (Henderson et al. 1999). Alternatively, they may be found within the gene, and
variation results in alteration of the translational reading frame (Chandler and Fayet 1993,
van Belkum et al. 1998). In the case of V. vulnificus none of the above applies due to the
location of the repeats. They were neither located after the initiation codon of a gene, nor
58
were they located in the promoter region (ORFX). Thus, the only hypothesis that can be
made at this point is that the repeats are flanking the conserved CPS gene, wzb, may
facilitate a deletion event causing the excision of the entire gene in the LC4/T2 phase
variant.
CHAPTER 6
SUMMARY AND CONCLUSIONS
Organization of a Group 1-like CPS Operon in V. vulnificus
The genetic organization of the V. vulnificus M06-24/O CPS operon was
homologous to group 1 CPS operons originally described in E. coli (Drummelsmith and
Whitfield 1999). Genes (wza-wzb-wzc) required for translocation and assembly of CPS to
the cell surface in E. coli are considered indicative of group 1 operons, as they are shared
by many gram-negative bacteria with this type of CPS (Arakawa et al. 1991, Rahn et al.
1999, Whitfield and Paiment 2003). Transport genes generally localize to the 5' region of
E. coli group 1 operons and are followed by polymorphic biosynthetic genes, which are
all expressed as a single transcript (Whitfield and Roberts 1999). The presence and
organization of these genes confirmed the identity of the V. vulnificus operon. A
previously described putative promoter (Wright et al. 2001) upstream of ORFX (Orfl)
and Rho-independent transcriptional terminator (not shown) at the terminus of the
polymorphic region defined the limits of the V vulnificus group 1 operon.
Interestingly, a high level of conservation was observed in both 5' and 3' regions of
the CPS operons among various strains of V. vulnificus. Comparisons of V vulnificus
MO6-24/O CPS operon with genomic sequence of CMPC6 and YJ106 revealed that
genes responsible for translocation and surface assembly of CPS were highly conserved,
identities were higher than 90% for wza, wzb, and wzc genes. Genes with reported or
proposed biosynthetic function were, as expected, mostly polymorphic. This divergence
probably reflected the diversity of polysaccharide structures that has been observed for
this species (Hayat et al. 1993). However, similarities among strains were observed in
some genes from this usually polymorphic region. For example, all V vulnificus CPS
operons, for which complete sequence was available, contained wbJY and wbfV
homologues (97 % deduced amino acid identity) at the 3' termini. This conservation of
genetic structure may indicate conserved evolution of the V vulnificus CPS operons.
Comparison of CPS Operons Among Vibrio Species
Vibrio cholerae is also a member of the Vibrionaceae family and has been involved
in 8 pandemics throughout the world. Cholera is characterized by massive fluid loss that
can lead to shock, organ failure and often death. There are multiple defined serogroups of
V cholerae, and until 1992 only V cholerae 01 was recognized as a major human
pathogen. However, in late 1992 in Bengal a novel V cholerae serogroup (0139) was
isolated and literally replaced V. cholerae 01 as the major cholera serogroup (Stroeher et
al. 1998). V. cholerae 0139 serogroup is essentially the same as V cholerae 01 of the El
Tor biotype with the acquisition of a new O-antigen and capsule (Johnson et al. 1994,
Karaolis et al. 1994, Manning et al. 1995, Bik et al. 1995, Comstock et al. 1995, Stroeher
et al. 1995, Bik et al. 1996, Comstock et al. 1996, Stroeher et al. 1997, Stroeher and
Manning 1997).
V cholerae 0139 serotype emerged from the V cholerae 01 by a relatively precise
replacement in the LPS operon of the original V cholerae 01 rfb region with 0139-
specific genes. The 0139 LPS can be described as semi-rough as it has only a single O-
antigen repeat unit (Manning et al. 1995). Furthermore, V. cholerae 0139 has capsular
material (Waldor et al. 1994) and produces two colony morphologies (opaque or
translucent) as is seen in V vulnficusM06-24 (Johnson et al. 1994, Weintraub et al.
1994). The rfb operon of V cholerae 0139 O-antigen also contains the insertion
sequence IS1358 element (Stroeher et al. 1995, Manning et al. 1995, Fallarino et al.
1997). IS1358 element has also been associated with V vulnificus CPS expression and
was conserved among LPS operons of other V cholerae serotypes, as well as in V
anguilllarum. Upstream of the start of rfb operon in V cholerae was the JUMPstart
sequence described by Hobbs and Reeves (1994), which has regulatory function (Bailey
et al. 1997). The JUMPstart region is found upstream of most polysaccharides and not
surprisingly was upstream of ORFX in V. vulnificus M06-24/0 (Wright et al. 2001).
The 0-antigen of the V. cholerae 01 LPS is a homopolymer of perosamine, which
is substituted with tetroate (Kenne et al. 1982). V cholerae 01 LPS also contains
quinovosamine and is found in a ratio of approximately 1 to 20 compared to perosamine.
V cholerae 0139 has a completely different O-antigen composition, but quinovosamine
is also found in the LPS (Stroeher et al. 1998) and in the CPS of V. vulnificus M06-24/0
(Reddy et al. 1992). The sugars found in the LPS of V cholerae 0139 are primarily
colitose, glucose, heptose, fructose, glucosamine and quinovosamine (Knirel et al. 1995,
Preston et al. 1995). In V cholerae 0139 genes for the biosynthesis of the capsular
material and the LPS localize to the same region, and these polysaccharides differ only in
that the 0-antigen is attached to the lipid A-core (Waldor et al. 1994). The surface
polysaccharide biosynthesis region of the V cholera 0139 operon is complex, and
mutational analysis has shown that there are some genes involved in both capsule and 0-
antigen biosynthesis, while other genes are specific for either capsule or 0-antigen
(Waldor et al. 1994, Comstock et al. 1995, Stroeher et al. 1995, Bik et al. 1996).
A stretch of genes that is located on the 3' end of the operon are common for both
V cholerae 01 and 0139 rIb region. Additionally, a cluster of four highly conserved
genes (wbfT, wbfU, wbfY, and wbfV) were at the end of the operons in both V. vulnificus
M06-24 and V. cholerae 0139. Two of these genes (wbfV and wbfY) were present in the
same location in all strains of V vulnificus. Southern hybridizations with wbfW/wbfX
gene probes previously demonstrated that homologous DNA is present in a wide number
of non- 1 V. cholerae strains and a variety of non-cholera Vibrios (Comstock et al.
1995). Thus, multiple distinct genes with similar structure and high level of conservation
are probably present at the 3' end of many Vibrio spp. As both CPS and LPS are mostly
heterogeneous among V vulnificus strains, perhaps lineages with recombinant CPS/LPS
loci will become apparent as more genomic sequence and polysaccharide structure
become available. Also, it could be hypothesized that V vulnificus group 1 operons could
have served as one of the donors for the acquisition of the newly acquired CPS genes of
V cholera 0139.
Translucent Phase Variants Exhibit Multiple Genotypes
The CPS operon of V. vulnificus was composed of conserved and variable regions,
but variation within the conserved region accounted for differences in the genotypes of
phase variants. Three distinct genotypes (TI, T2, and T3) were found to be associated
with phase variation. TI (M06-24/T) exhibited an intact CPS with reversible phase
variation at a rate of 10-3 to 10-4 (Wright et al. 1990) and expressed some CPS on its
surface. T2 (LC4/T) was locked to the translucent phenotype and was unable to produce
opaque colonies. It was also devoid of capsule, which was attributed to the deletion of a
conserved gene, wzb. Deletion mutations may also be responsible for phase shift to T3
translucent phenotype and involved another set of SSRs within and upstream of the
operon, but the extent of this mutation is not yet defined.
Although the TI, T2, T3 genotypes presented in this study are only observed in
single isolates of different strains, preliminary data indicated that all genotypes are
common to most strains of V vulnificus. We have found that certain growth conditions
affect the phase variation rate and increased the appearance of the translucent variant
(Jones et al. 2004). Late stationary phase cultures of M06-24/O (7 days) demonstrated
translucent colonies which exceeded 50%. When TI cultures were returned to nutritive
media (LB), <50% of TI isolates remained translucent compared to 100% of T2 isolates.
Given that there are no genotypic differences in the CPS region between opaque and T1,
and the fact that T1 variants do have some capsule on the surface of the cell, introduction
to a nutritive medium may relieve environmental stressors that were responsible for the
original phase switch. In addition, phase variation between O and T1 apparently involves
a downshift in regulation of gene expression rather than elimination of capsule. On the
other hand, T2 variants have the entire wzb gene deleted from their chromosome, which
eliminated capsule expression, and presumably that deletion event prevented reversion to
opaque phenotype. These data suggest that the phase variation phenomenon for V
vulnificus is, in fact, environmentally regulated, and the genotypic consequences are
probably related to proteins that control recombination events to increase survival during
stress or starvation.
Role of SSRs in V. vulnificus CPS
The role of repetitive DNA segments in phase variation has been previously
described in the literature, and is generally thought to promote phase variation through
slipped-strand mispairing, leading to duplications or deletion mutations within repeated
elements. However, these repetitive elements are usually located within the gene itself or
precede an operon in the promoter region. Decreased gene expression results from the
effects of variable SSR subunit numbers that alter the promoter strength (Chandler and
Fayet 1993, van Belkum et al. 1998). Alternatively, the number of subunits within a
repeated intragenic segment may vary, as a result of insertions/deletions that produce
translational frame-shifts due to the generation of stop codons that truncate a gene
product.
Direct repeat-mediated recombination events have been reported in the literature.
Zhang et al. (1997) identified a vis locus in Borreliae spp. consisting of an expressed vlsE
gene and 15 silent vis cassettes and demonstrated that promiscuous recombination
occurred in the vlsE cassette region in C3H/HeN mice, altering antigenicity of the VlsE
variants, resulting in antigenic variation. The vis cassettes were comprised of conserved
and variable regions resembling the coding sequences of the Neisseria pilin variants that
were divided into constant, semi-variable, and hyper-variable regions (Haas and Meyer
1986). It was hypothesized that the constant regions and a conserved DNA sequence
located at the 3' end of all pilin loci were thought to pair the regions involved in
recombination events (Wainwright et al. 1994). It was suggested that segments, but not
entire regions, of the silent vis cassettes were recombined into the vlsE site with
potentially millions of different vlsE alleles (Zhang et al. 1997).
The repetitive sequences in V vulnificus somewhat resemble other repetitive
elements in eubacteria referred to as REP, ERIC, and IRU sequences, which are
described as short, interspersed, intergenic, repetitive DNA (for a review see Lupski and
Wienstock 1999). These repeats are distributed throughout the genome and have been
used extensively for molecular typing, as primers derived from these sequences generate
strain-specific patterns from PCR amplicons. The function of these sequences is not
known, but like the V. vulnificus repeats, they are generally located between genes within
polycistronic operons. Despite the formation of stem-loop structures, they generally do
not act as transcriptional terminators (Lupski and Wienstock 1999).
As seen with the interspersed repetitive elements, the V vulnificus R1 repetitive
sequences were also intergenic; however, they were not distributed throughout the
genome but, instead, localized near the same gene in the CPS operon in the strains
examined. However, the R2 repeating subunit was dispersed thought the chromosome of
the two V vulnificus published genomes. A total number of 6 copies of the R2 repeat
were present in both V vulnificus strains and not only did R2 flank the entire CPS operon
but also copies were found a million bases upstream. The V vulnificus repeated subunit
size (7-bp and 8-bp) was also much shorter than the typical repetitive interspersed
sequences, although a heptanucleotide in cyanobacteria has been described as short
tandemly repeated repetitive (STRR) sequences (Lupski and Wienstock 1999). The
repetitive sequences of V. vulnificus are not palindromic but do generate predicted stem-
loop structures due to the GC content of the subunit sequence ACAGGACC. The
deletions responsible for phase variation in V vulnificus have not been previously
associated with the dispersed repetitive elements like REP and ERIC.
T2 Phase Variation is Mediated by Deletion of wzb
The deletion of wzb in the transition from LC4/O to the T2 translucent phenotype
strongly suggested that this event was responsible for the phase shift in that strain.
Complementation studies that introduced either the intact LC4/O or M06-24/O wzb gene
into wzb-deleted T2 phase variant were performed. Clones were constructed with or
without upstream regions, as was previously done with complementation studies of the
wza gene (Wright et al. 2001). The complemented mutants demonstrated opaque colony
morphology for both constructs, indicating that this gene was able to restore the defect in
trans and that the wzb gene was functional irrespective of the presence of upstream DNA.
Introduction of wzb constructs into M06-24/TI did not result in recovery of opaque
phenotype and transconjugates remained translucent. Thus, complementation analysis
determined that the LC4/O phase shift to T2 was a result of a site-specific mutation at the
wzb locus. Introduction of the wzb gene in LC4/T2 variant led to the recovery of CPS
expression. The levels of CPS on the cell surface of the complemented strain were at least
equivalent to the opaque parent strain, which confirmed that wzb is required for CPS
expression on the cell surface.
This is the first description of a genetic mechanism for the phase variation of CPS
expression and virulence in V. vulnificus. Although different genotypes were associated
with the translucent isolates examined, all demonstrated that the conserved region of the
V vulnificus CPS operon was a "hot spot" for genetic mutation and this instability was
associated with SSRs. We hypothesized that the SSRs (RIA and RIB) that were flanking
wzb played a role in the deletion event that occurred. CPS phase variation involving SSRs
appears to be unique to the species, as these sequences are not described in other bacterial
species with related group 1-like operons. SSRs have been previously shown to regulate
slipped-strand mispairing in other phase variation systems, but site-specific gene deletion
has not been previously described to our knowledge. This process may be facilitated,
"adaptive mutations", and associated with stationary phase (Jones et al. 2004), whereby
increased mutational rates result from non-replicative growth and differential expression
of DNA repair enzymes.
V. vulnificus T1 Phase Variation
The genetic basis for T1 phase variants is still undefined, as only few differences
observed upstream in the putative promoter region. A few base substitutions were present
in the TI phenotype when compared to the opaque. Minor differences in the putative
promoter region of the CPS operon could lead to reduced strength of the promoter and
explain the reduced CPS on the cell surface of the T1 variant. However, M06-24/T1
DNA sequence more closely resembled LC4/O than its parent phase variant (M06-24/O)
in the promoter region. Perhaps this is an intermediate phase that is more primed for
deletion events to occur. The identification of spontaneous phase variant of LC4/O,
LC4/T2, with a deleted conserved gene, further supports that hypothesis.
Genes responsible for CPS regulation in M06-24/T1 phase variants may reside in
regions downstream from the promoter or even outside of the entire CPS operon. An IS
element has been previously associated with genes required for CPS expression in at least
one V. vulnificus strain (Smith and Seibeling 2003). Phase variants exhibited differences
in RFLP patterns that corresponded to the insertion of the IS element in translucent
variants. However, the relationship of these CPS genes to a particular operon was not
clear, and none of the genes were present in the group 1 CPS operons. Our studies did not
identify any IS elements associated with translucent phase variants at the group 1 locus,
but the possibility exists that IS elements may exist in a region outside the CPS operon or
be relevant to other types of CPS operons. Additionally, post-transcriptional events may
be responsible for the patchy capsule on the surface of the translucent variant as possible
enzymatic activity could be responsible for capsular degradation.
Multiple Scenarios for V. vulnificus Phase Variation
The discovery of multiple translucent genotypes presented herein supports the
assumption that there are multiple mechanisms for phase variation in V. vulnificus. These
data illustrated the genetic instability within the CPS locus, particularly in genes
associated with SSRs. A model for possible phase variation of V vulnificus CPS
expression is described in Figure 8. The genetic basis for T1 phase variants is still
undefined, but the site-specific deletion of wzb was clearly responsible for phase
variation observed in the T2 phase variant. This gene was flanked by regions of repetitive
DNA segments in V. vulnificus and we hypothesized that R1 SSR elements facilitated
recombination, resulting in the shift to the avirulent T2 translucent phenotype.
CPS Operon Structure Transcription CPS Phenotype Phase Reversion
Transport Genes Biosynthetic Region
wza wb wzc
R2 RI RI R2 Yes
wza wzb wc
r -"[---- ^ No
S/ No
Figure 8. Model for phase variation of CPS expression in V. vulnificus
CPS operons are diagramed as horizontal lines showing transport genes wza,
wzb, wzc and biosynthetic regions. Arrows filled with vertical bars (RI) or
shaded vertical bars (R2) represent intergenic, repeated subunits. Unfilled
arrows represent differential transcription showing either down-regulation
(narrow arrow) or truncated gene product (shorter arrow). The amount of CPS
expressed is indicated by the thickness of the outer layer of the diagrammatic
bacterial cell. Question marks indicate hypothetical aspects of the model.
Deletion mutations, involving a different set of SSRs (R2) within and
upstream/downstream of the operon, may also be responsible for phase shift to T3
translucent phenotype, but the extent of this mutation is not yet defined.
CPS Expression and the Environmental Survival
Bacteria need to adapt and respond to the constantly changing environments and
genetic variation is required for survival. Bacterial mutations and recombinations
between genes, acquisition of new genetic material, and regulation of gene expression of
existing DNA are ways of acquiring flexibility and ensuring survival of bacterial
populations. Another way to increase genetic diversity and cell proliferation is to form
biofilms. Biofilm involves the creation of bacterial communities that attach to surfaces in
aquatic environments, and there are multiple stages during biofilm formation. Initially
free floating bacteria sample the environment and reversibly attach on surfaces forming a
monolayer of cells. As time progresses production of extracellular polysaccharide (EPS)
allows the creation of a more mature structure. At this point bacterial communities are
formed, and signaling takes place between the members.
Bacteria in the environment rarely see nutrient rich conditions and are usually faced
with nutrient limitations and starvation. Being part of a biofilm allows for better survival
under nutrient deprivation, pH changes, oxidative stress, disinfectants, and antibiotics.
The members of a biofilm sense their surroundings and are able to adjust their metabolic
processes to maximize the use of available substrates resulting in heterogeneity within the
biofilm (Jefferson 2004). Additionally, bacteria secrete autoinducers (AIs) which are
substances that allow for environmental sensing and communication. The changes that
the biofilm members undergo may not always be permanent as many are the cells that
detach from the biofilm and become planctonic again, quickly adapting to their new
environment.
The extracellular polymeric substance (EPS) is the "glue" that surrounds the
bacterial cells and keeps the entire structure together. Examples of the biofilm enhancing
role of EPS in gram-negative bacteria have been reported for the alginate biosynthesis in
P. aeruginosa and for extracellular polysaccharide in V cholerae (Davies et al. 1993,
Watnick and Kotler 1999). On the other hand, Joseph and Wright (2004) studied the role
of CPS on biofilm formation between V. vulnificus phase variants and demonstrated that
CPS expression inhibited biofilm formation of V vulnificus. M06-24/O exhibited three-
fold less attached cells on abiotic surfaces than did the translucent variant. Confirmation
of the inhibitory function of CPS was provided by increased biofilms that were present in
the CVD752 and M06-24/31T acapsular mutants. Differences in the results between V
vulnificus CPS and V. cholerae El Tor were attributed to differences in the sugar
composition of the two structures.
Vibrio spp. attach to algae and zooplankton and through filter feeding accumulate
in the oyster tissue (Chiavelli et al. 2001, Hood and Winter 1997, Wright et al. 1996,
Kumazawa et al. 1991, De Paola et al. 1994, Tamplin et al. 1982). Attachment to algal
cells was also demonstrated in our laboratory (Chatzidaki and Wright, unpublished data).
Fluorescent microscopy images depicting interactions between MO6-24 phase variants
and algal cells demonstrated that only the translucent phase variant was able to a layer
around the algal cell (Figure 9). These studies suggest that inhibition of CPS expression,
as seen in translucent phase variants, may have a biological function that facilitates
attachment to other members of the estuarine community.
Figure 9. Fluorescent microscopy image of algal (Thallasiosira pseudomona) and
bacterial cells (V vulnificus MO6-24/T). Visualization was achieved by acridine
orange (1% w/v).
Evolution of multiple mechanisms for transition to the translucent biofilm-adapted
phenotype may function to maximize the variability of the survival response for this
species. For example, populations with reversible Ti variants might be able to more
readily detach from the biofilm in the partially encapsulated form if conditions became
deleterious, while deletion mutants that are fixed in the translucent phase may form
stable, attached structures associated with the core of a biofilm. On the other hand, CPS
expression is clearly advantageous during infection explaining the need for an
intermediate reversible translucent phenotype (TI) before the appearance of permanent,
irreversible, gene deletion mutations. Thus better understanding of the mechanisms
controlling the conversion to the avirulent translucent phenotype may provide strategies
for disease prevention and intervention.
Biological Significance of Phase Variation
Phase-variable structures have been recognized in many cases by their effect on
colony morphology that led to descriptions like dry versus moist, rugose versus smooth,
and opaque versus translucent. Alternating between two phenotypes in a heritable and
reversible manner is classified as phase variation. What distinguishes this variation from
genetic noise and classical gene regulation is that there is a genetic or epigenetic
mechanism that allows the variability to be heritable (van der Woude and Baumler 2004).
Thus, the daughter cell will inherit that mechanism and will also exhibit variation
between generations, with frequency of reversion that exceeds that of a random mutation.
Changes in colony morphology can be attributed to phase variation of a variety of
surface-exposed proteins, the capsule, and cell wall composition. The capsule can
influence interactions with the host cells and host environment, including invasion,
adhesion, and serum sensitivity, and is a well-recognized virulence factor.
The biological significance of phase variation is not well understood and probably
varies widely from organism to organism, but the underlying genetic variability should
provide rapid adaptation to changing environmental parameters and mechanisms for
evading host immune defenses via antigenic variation (Zhao et al. 1997, Lim et al. 1998).
The phase variation switch is considered a random event, but lately the hypothesis of
modulated switching frequency is more evident. Environmental regulation of phase-
variable gene expression allows the bacterium to be optimally suited to growth in a
particular environment. For instance, iron starvation increases the frequency of antigenic
and phase variation ofN. gonorrhoeae pili and may be correlated with a general change
in the DNA recombination rate and the DNA repair rate (Serkin and Seifert 2000). Low
iron concentrations are often encountered by this obligate human pathogen during
infection and thus are likely to be an important signal for the survival of this bacterium in
the host. Additionally, stimuli that affect the expression of phase-variable fimbriae in E.
coli and S. enterica serotype Typhimurium include temperature, pH, carbon source, and
amino acid concentration (Blomfield 2001). Finally, phase variation of adhesions are
thought to allow detachment from colonized surfaces and facilitate dissemination within
the host or back into the environment for transfer to another host (Ofek and Sharon 1988,
Keith et al. 1990, Virji et al. 1991, Kroll 1992, Nassif et al. 1993).
The molecular mechanisms underlying phase variation and the corresponding
regulatory systems that determine the switch frequency are probably related to specific
growth conditions or physiological states. Thus, perceiving phase variation as a random,
nonregulated process may lead to incorrect conclusions when addressing the significance
of phase variation. Finally, it is clear that the expression of certain genes that undergo
phase variation can enhance survival. Reversible phase variation events allow
microorganisms to shift back to more favorable biologically states, rather than being
locked into one particular phase. Deletions mutations may also be recovered in high
density communities such as biofilms where genetic exchange is accelerated. As a result,
varied phenotypes present a mixed population, which is then poised for environmental
change (Dybvig 1993). How the different genetic mechanisms, environmental regulation,
and specific gene products each contribute to the success of the bacterial population
largely remains to be determined.
LIST OF REFERENCES
Abeles, A., T. Brendler, and S. Austin. 1993. Evidence of two levels of control of Pl
oriR and host oriC replication origins by DNA adenine methylation. J. Bacteriol.
175: 7801-7807.
Adley, C.C., and A.I. Bukhari. 1984. Methylation dependent expression of the mom gene
of bacteriophage Mu: deletions downstream from the methylation sites affect
expression. Nucleic Acids Res. 12: 3535-3550.
Aho, E.L., J.A. Dempsey, M.M. Hobbs, D.G. Klapper, and J.G. Cannon. 1991.
Characterization of the opa (class 5) family of Neisseria meningitides. Mol.
Microbiol. 5: 1429-1437.
Albertini, A.M., M. Hofer, M.P. Calos, and J.H. Miller. 1982. On the formation of
spontaneous deletions: the importance of short sequence homologies in the
generation of large deletions. Cell. 29(2): 319-328.
Alvarez, D., S. Merino, J.M. Tomas, V.J. Benedi, and S. Alberti. 2000. Capsular
polysaccharide is a major complement resistance factor in lipopolysaccharide O
side chain-deficient Klebsiella pneumoniae clinical isolates. Infect. Immun. 68:
953-955.
Amaro, B. Fouz, E.G. Biosca, E. Marco-Noales and R. Collado 1997. The
lipopolysaccharide O side chain of Vibrio vulnificus serogroup E is a virulence
determinant for eels. Infect. Immun. 65: 2475-2479.
Arakawa, Y., M. Ohta, R. Wacharotayankun, M. Mori, N. Kido, H. Ito, T. Komatsu, T.
Sugiyama, and N. Kato. 1991. Biosynthesis of Klebsiella K2 capsular
polysaccharide in Escherichia coli HB101 requires the function of rmpA and the
chromosomal CPS gene cluster of the virulent strain Klebsiellapneumoniae Chedid
(01:K2). Infect. Immun. 59: 2043-2050.
Arakawa, Y.. R. Wacharotayankun, T. Nagatsuka, H. Ito, N. Kato, and M. Ohta. 1995.
Genomic organization of the Klebsiella pneumoniae cps region responsible for
serotype K2 capsular polysaccharide synthesis in the virulent strain Chedid. J.
Bacteriol. 177: 1788-1796.
Bailey, M.J.A., C. Hughes, and V. Koronakis. 1997. RfaH and the ops element,
components of a novel system controlling bacterial transcription elongation. Mol.
Microbiol. 26: 845-852.
Barua, S., T. Yamashino, T. Hasegawa, K. Yokoyama, K. Torii, and M. Ohta. 2002.
Involvement of surface polysaccharides in the organic acid resistance of Shiga
Toxin-producing Escherichia coli 0157:H7. Mol. Microbiol. 43(3): 629-640.
Bastin, D. A., G. Stevenson, P. K. Brown, A. Haase, and P. R. Reeves. 1993. Repeat unit
polysaccharides of bacteria: a model for polymerization resembling that of
ribosomes and fatty acid synthetase, with a novel mechanism for determining chain
length. Mol. Microbiol. 7:725-734.
Belland, R.J. 1991. H-DNA formation by the coding repeat elements of neisserial opa
genes. Mol. Micro. 5: 2351-2360.
Bik, E.M., A.E. Bunschoten, R.D. Gouw, and F.R. Mooi. 1995. Genesis of the novel
epidemic Vibrio cholerae 0139 strain: evidence for horizontal transfer of genes
involved in polysaccharide synthesis. EMBO J. 14: 209-216.
Bik, E.M., A.E. Bunschoten, R.J.L. Willems, A.C.Y. Chang, and F.R. Mooi. 1996.
Genetic organization and functional analysis of the otn DNA essential for cell-wall
polysaccharide synthesis in Vibrio cholerae 0139. Mol. Microbiol. 20: 799-811.
Bisharat, N., V. Agmon, R. Finkelstein, R. Raz, G. Ben-Dror, L. Lerner, S. Soboh, E.
Colodner, D.N. Cameron, D.L. Wykstra, D.L. Swerdlow, J.J. Farmer. 1999.
Clinical, epidemiological, and microbiological feature of Vibrio vulnificus biogroup
3 causing outbreaks of wound infection and bacteraemia in Israel. Lancet. 354:
1421-1424.
Blake, P.A., M.H. Merson, R.E. Weaver, D.G. Hollis, and P.C. Heublein. 1979. Disease
caused by a marine Vibrio. Clin. Char. Epidimiol. N. Engl. J. Med. 300: 1-5.
Blomfield, I. C. 2001. The regulation of pap and type 1 fimbriation in Escherichia coli.
Adv. Microb. Physiol. 45:1-49.
Blyn, L.B., B.A. Braaten, and D.A. Low. 1990. Regulation of pap pilin phase variation
by mechanism involving differential dam methylation states. EMBO J. 9: 4045-
4054.
Broadbent, J.R., D.J. McMahon, D.L. Welker, C.J. Oberg, and S. Moineau. 2003.
Biochemistry, genetics, and applications of exopolysaccharide production in
Streptococcus thermophilus: a review. J. Dairy Sci. 86 (2): 407-423.
Bryan, P. J., R. J. Steffan, A. De Paola, J. W. Foster, and A. K. Bej. 1999. Adaptive
response to cold temperature in Vibrio vulnificus. Curr. Microbiol. 38: 168-175.
Bugert, P. and K. Geider. 1995. Molecular analysis of the ams operon required for
exopolysaccharide synthesis ofErwinia amylovora. Mol. Microbiol. 15(5): 917-
933.
Chandler, M. and 0. Fayet. 1993. Translational frameshifting in the control of
transposition in bacteria. Mol. Microbiol. 7: 497-503.
Chen,C.Y., K.M. Wu, Y.C. Chang, C.H. Chang, H.C. Tsai, T.L. Liao, Y.M. Liu, H.J.
Chen, A.B. Shen, J.C. Li, T.L. Su, C.P. Shao, C.T. Lee, L.I. Hor, and S.F. Tsai.
2003. Comparative genome analysis of Vibrio vulnificus, a marine pathogen.
Genome Res. 13: 2577-2587.
Chiavelli, D. A., J. W. Marsh, and R. K. Taylor. 2001. The mannose-
sensitivehemagglutinin of Vibrio cholerae promotes adherence to zooplankton.
Appl.Environ. Microbiol. 67: 3220-3225.
Colwell R. R., P. R. Brayton, D. J. Grimes, D. B. Roszak, S. A. Huq, and L. M. Palmer.
1985. Viable but nonculturable Vibrio cholerae and related pathogens in the
environment: implications for release of genetically engineered microorganisms.
Bio. Technol. 3: 817-820.
Comstock, L.E., D. Maneval, Jr., P. Panigrahi, A. Joseph, M.M. Levine, J.B. Kaper, J.G.
Morris, and J.A. Johnson. 1995. Capsule and O antigen in Vibrio cholerae 0139
Bengal associated with a genetic region not present on Vibrio cholerae 01. Infect.
Immun. 63: 317-323.
Comstock, L.E., J.A. Johnson, J.M. Michalski, J.G. Morris, and J.B. Kaper. 1996.
Cloning and sequencing of a region encoding a surface polysaccharide of Vibrio
cholerae 0139 and characterisation of the insertion site in the chromosome of
Vibrio cholera 01. Mol. Microbiol. 19: 815-826.
Connell, T.D., D. Shaffer, and J.G. Cannon. 1990. Characterization of the repertoire of
hypervariable regions in the Protein II (opa) gene family of Neisseria gonorrhoeae.
Mol. Microbiol. 4: 439-449.
Coyne, M.J., W. Kalka-Moll, A.O. Tzianabos, D.L. Kasper, and L.E. Comstock. 2000.
Bacteroidesfragilis NCTC9343 produces at least three distinct capsular
polysaccharides: cloning, characterization, and reassignment of polysaccharide B
and C biosynthesis loci. Infect. Immun. 68(11): 6176-6181.
Creuzenet, C., and J.S. Lam. 2001. Topological and functional characterization of
WbpM, an inner membrane UDP-GlcNAc C6 dehydratase essential for
lipopolysaccharide biosynthesis in Pseudomonas aeruginosa. Mol. Microbiol.
41:1295-1310.
D'Souza, J.M., L. Wang, and P. Reeves. 2002. Sequence of the Escherichia coli 026 0-
antigen gene cluster and identification of 026 specific genes. Gene 297: 123-127.
Dalsgaard, A., N. Frimodt-Moller, B. Bruun, L. Hoi and J.L. Larsen. 1996. Clinical
manifestations and molecular epidemiology of Vibrio vulnificus infections in
Denmark. Eur. J. Clin. Microbiol. Infect. Dis. 15: 227-232.
Daniels, E. M., R. Schneerson, W. M. Eagen, S. C. Szu, and J.B. Robbins. 1989.
Characterization of the Salmonella parataphy C Vi polysaccharide. Infect. Immun.
57:3159-3164.
Davies, D.G., A.M. Chakrabarty, and G.G. Geesey. 1993. Exopolysaccharide production
in biofilms: substratum activation of alginate gene expression by Pseudomonas
aeruginosa. Appl. Envirn. Microbiol. 59: 1181-1186.
De Paola, A., G.M. Capers, and D. Alexander. 1994. Densities of Vibrio vulnificus in the
intestines of fish from the U.S. Gulf Coast. Appl. Environ. Microbiol. 60: 984-988.
Dean, C.R., C.V. Franklund, J.D. Retief, M.J Coyne, K. Hatano, D.J. Evans, G.B. Pier,
J.B. Goldberg. 1999. Characterization of the serogroup 011 O-antigen locus of
Pseudomonas aeruginosa PA103. J. Bacteriol. 181(14):4275-4284.
Dehio, C., S.D. Gray-Owen, and T.F. Meyer. 1998. The role of neisserial Opa proteins in
interactions with host cells. Trends Microbiol. 6: 489-495.
Dodgson, C., P. Amor, and C. Whitfield. 1996. Distribution of the rol gene encoding the
regulator of lipopolysaccharide O-chain length in Escherichia coli and its influence
on the expression of group I capsular antigens. J. Bacteriol. 178: 1895-1902
Doree S.M. and M.H. Mulks. 2001. Identification of an Actinobacillus pleuropneumoniae
consensus promoter structure. J Bacteriol. 183(6): 1983-1989.
Drummelsmith, J. and C. Whitfield. 1999. Gene products required for surface expression
of the capsular form of the group 1 K antigen in Escherichia coli (09a: K30). Mol.
Microbiol. 31(5):1321-1332.
Drummelsmith, J., and C. Whitfield. 2000. Translocation of group 1 capsular
polysaccharide to the surface of Escherichia coli requires multimeric complex in
the outer membrane. EMBO J. 19: 57-66
Drummelsmith, J., P. Amor, and C. Whitfield. 1997. Polymorphism, duplication, and
ISI -mediated rearrangement in the chromosomal his-rfb-gnd region of Escherichia
coli strains with group IA capsular K antigens. J. Bacteriol. 179(10): 3232-3238.
Dybvig, K. 1993. DNA rearrangements and phenotypic switching in prokaryotes. Mol.
Microbiol. 10: 465-471.
Fallarino, A., C. Mavrangelos, U.H. Stroeher, and P.A. Manning. 1997. Identification of
additional genes required for O-antigen biosynthesis in Vibrio cholerae 01. J.
Bacteriol. 179: 2147-2153.
Farabaugh, P.J., U. Schmeissner, M. Hofer, and J.H. Miller. 1978. Genetic studies of the
lac repressor. On the molecular nature of spontaneous hotspots in the lad gene of
Escherichia coli. J. Mol. Biol. 126(4): 847-857.
Fratamico, P. M., C. E. Briggs, D. Needle, C. Chen, and C. DebRoy. 2003. Sequence of
the Escherichia coli 0121 O-antigen gene cluster and detection of
enterohemorrhagic E. coli 0121 by PCR amplification of the wzx and wzy genes. J.
Clin. Microbiol. 41(7): 3379-3383.
Galas, D.J. 1978. An analysis of sequence repeats in the lad gene of Escherichia coli. J.
Mol. Biol. 126(4): 858-863.
Gentz, R. and H. Bujard. 1985. Promoters recognized by Escherichia coli RNA
polymerase selected by function: highly efficient promoters from bacteriophage T5.
J. Bacteriol. 164:70-77.
Geobel, W.F. 1963. Colanic acid. Proc. Natl. Acad. Sci. 49: 464-471.
Gloeckner, F.O., M. Kube, M. Bauer, H. Teeling, T. Lombardot, W. Ludwig, D. Gade, A.
Beck, K. Borzym, K. Heitmann, R. Rabus, H. Schlesner, R. Amann, and R.
Reinhardt. 2003. Complete genome sequence of the marine planctomycete
Pirellula sp. strain 1. Proc. Natl. Acad. Sci. U.S.A. 100(14): 8298-8303.
Gray, L.D. and A.S. Kreger. 1985. Purification and characterization of an extracellular
cytolysin produced by Vibrio vulnificus. Infect. Immun. 48: 62-72.
Gray, L.D. and A.S. Kreger. 1986. Detection of anti-Vibrio vulnificus cytolysin
antibodies in sera from mice and a human surviving V vulnificus disease. Infect.
Immun. 51: 964-965.
Haas, R. and T.F. Meyer. 1986. The repertoire of silent pilus genes in Neisseria
gonorrhoeae: evidence for gene conversion. Cell. 44: 107-115.
Hale, W., M.W. van der Woude, and D.A. Low. 1994. Analysis of nonmethylated GATC
sites in Escherichia coli chromosome and identification of sites that are
differentially methylated in response to environmental stimuli. J. Bacteriol. 176:
3438-3441.
Hayat, U., G.P. Reddy., C.A. Bush, J.A. Johnson, A.C. Wright, J.G. Morris. 1993.
Capsular types of Vibrio vulnificus: an analysis of strains from clinical and
environmental sources. J. Infect. Dis. 168(3):758-762.
Henderson, Ian R., P. Owen, and J. P. Nataro. 1999. Molecular switches- the On and Off
of bacterial phase variation. Mol. Microbiol. 33(5): 919-932.
Hlady, W.G. and K.C. Klontz. 1996. The epidemiology of Vibrio infections in Florida,
1981-1993. J. Infect. Dis. 173: 1176-1183.
Hobbs, M. and P.R. Reeves. 1994. The JUMPstart sequence: a 39 bp element common to
several polysaccharide gene clusters. Mol. Microbiol. 12:855-856.
Hoi, L., A. Dalsgaard, J.L. Larsen, J.M. Warner, and J.D. Oliver. 1997. Comparison of
ribotyping and randomly amplified polymorphic DNA PCR for characterization of
Vibrio vulnificus. Appl. Environ. Microbiol. 63: 1674-1678.
Hollis D.G., R.E. Weaver, C.N. Baker, and C. Thornsberry. 1976. Halophilic Vibrio
species isolated from blood cultures. J. Clin. Microbiol. 3:425-431.
Hood, M. A. and P. A. Winter. 1997. Attachment of Vibrio cholerae under various
environmental conditions and to selected substrates. FEMS Microbiol. Ecol. 22:
215-223.
Houng, H.S. and M.M. Venkatesan. 1998. Genetic analysis of Shigella sonnei form I
antigen: identification of a novel IS630 as an essential element for the form I
antigen expression. Microb. Pathog. 25(4): 165-173.
Jefferson, K.K. 2004. What drives bacteria to produce a biofilm? FEMS Microbiol. Let.
236(2): 163-173.
Jeong, K.C., H.S. Jeong, J.H. Rhee, S.E. Lee, S.S. Chung, A.M. Starks, G.M. Escudero,
P.A. Gulig, and S.H. Choi. 2000. Construction and phenotypic evaluation of a
Vibrio vulnificus vvpE mutant for elastolytic protease. Infect. Immun. 68(9): 5096-
5106.
Johnson, J.A., C.A. Salles, P. Panigrahi, M.J. Albert, A.C. Wright, R.J. Johnson, and J.G.
Morris. 1994. Vibrio cholerae 0139 synonym Bengal is closely related to Vibrio
cholera El Tor but has important differences. Infect. Immun. 62: 2108-2110.
Jones, M.K., M.A. Chatzidaki, and A.C. Wright. 2004. Dynamics of phase variation for
Vibrio vulnificus capsular polysaccharide expression. American Society of
Microbiology poster, H041, New Orleans, LO.
Joseph, L.A. and A.C. Wright. 2004. Expression of Vibrio vulnificus capsular
polysaccharide inhibits biofilm formation. J Bacteriol. 186(3): 889-893.
Karaolis, D.K., R. Lan, and P.R. Reeves. 1994. Molecular evolution of the seventh
pandemic clone of Vibrio cholerae and its relationship to other pandemic and
epidemic V. cholera isolates. J. Bacteriol. 176: 6199-6206.
Kaspar, C.W. and M.L. Tamplin. 1993. Effects of temperature and salinity on the
survival of Vibrio vulnificus in seawater and shellfish. Appl. Environ. Microbiol.
59: 2425-2429.
Kaya, S., Y. Araki, and E. Ito. 1989. The structure of the O-specific chain of the
lipopolysaccharide from Pseudomona aeruginosa IID 1012. J. Biochem. 105:29-
34.
Kaysner, C. A., M. L. Tamplin, M. M. Wekell, R. F. Stott, and K. G. Colburn. 1989.
Survival of Vibrio vulnificus in shellstock and shucked oysters (Crassostrea gigas
and Crassostrea virginica) and effects of isolation medium on recovery. Appl.
Environ. Microbiol. 55: 3072-3079.
Kaysner, C.A., C. Abeyta, Jr, M.M. Wekell, A. De Paola, Jr, R.F. Stott, and J.M. Leitch.
1987. Incidence of Vibrio cholerae from estuaries of the United States West Coast.
Appl. Environ. Microbiol. 53: 1344-1348.
Keith, B.R., S.L. Harria, P.W. Russell, and P.E. Ordorff. 1990. Effect of type 1 piliation
on in vitro killing of Escherichia coli by mouse peritoneal macrophages. Infect.
Immun. 58: 3448-3454.
Kenne, L., B. Lindberg, P. Unger, B. Gustafson, T. Holme. 1982. Structural studies of the
Vibrio cholera O-antigen. Carbohydr. Res. 100: 341-349.
Kido, N., T. Sugiyama, T. Yokochi, H. Kobayashi, and Y. Okawa. 1998. Synthesis of
Escherichia coli 09a Polysaccharide Requires the Participation of Two Domains of
WbdA, a Mannosyltrasferase Encoded within the wb* Gene Cluster. Mol.
Microbiol. 27(6):1213-1221.
Kim,Y.R., S.E. Lee, C.M. Kim, S.Y. Kim, E.K. Shin, D.H. Shin, S.S. Chung, H.E. Choy,
A. Progulske-Fox, J.D. Hillman, M. Handfield, and J.H. Rhee. 2003.
Characterization and pathogenic significance of Vibrio vulnificus antigens
preferentially expressed in septicemic patients. Infect. Immun. 71(10): 5461-5471.
Kiser, K.B., N. Bhasin, L. Deng, and J.C. Lee. 1999. Staphylococcus aureus cap5P
encodes a UDP-N-acetylglucosamine 2-epimerase with functional redundancy. J.
Bacteriol. 181(16): 4818-4824.
Kneidinger, B., K. O'Riordan, J. Li, J.R. Brisson, J.C. Lee, and J.S. Lam. 2003. Three
highly conserved proteins catalyze the conversion of UDP-N-acetyl-D-glucosamine
to precursors for the biosynthesis of 0 antigen in Pseudomonas aeruginosa 011
and capsule in Staphylococcus aureus type 5. Implications for the UDP-N-acetyl-L-
fucosamine biosynthetic pathway. J. Biol. Chem. 278(6): 3615-3627.
Knirel, Y.A., L. Paredes, P.E. Jansson, A. Weintraub, and M.J. Albert. 1995. Structure of
the capsular polysaccharide of Vibrio cholerae 0139 synonym Bengal containing -
galactose 4,6-cyclophosphate. Eur. J. Biochem. 232: 391-396.
Kothary, M.H. and A.S. Kreger. 1987. Purification and characterization of an elastolytic
protease of Vibrio vulnificus. J. Gen. Microbiol. 133: 1783-1791.
Kroll, J.S. 1992. The genetics of encapsulation in Haemophilus influenza. J. Infect. Dis.
165(Suppl. 1): S93-S96.
Kumazawa, N. H., N. Fukuma, and Y. Komoda. 1991. Attachment of Vibrio
parahaemolyticus strains to estuarine algae. J. Vet. Med. Sci. 53: 201-205.
Li, M., T. Shimada, J.G. Morris, A. Sulakvelidze, and S. Sozhamannan. 2002. Evidence
for the emergence of non-O 1 and non-O 139 Vibrio cholerae strains with
pathogenic potential by exchange of O-antigen biosynthesis regions. Infect.
Immun. 70(5): 2441-2453.
Lim, J.K., N.W.T. Gunther, H. Zhao, D.E. Johnson, S.K. Keay, and H.L. Mobley. 1998.
In vivo phase variation of Escherichia coli type 1 fimbrial genes in women with
urinary tract infection. Infect. Immun. 66: 3303-3310.
Linder, K. and J.D. Oliver. 1989. Membrane fatty acid and virulence changes in the
viable but nonculturable state of Vibrio vulnificus. Appl. Environ. Microbiol. 55:
2837-2842.
Litwin, C.M. and B.L. Byre. 1998. Cloning and characterization of an outer membrane
protein of Vibrio vulnificus required for heme utilization: regulation of expression
and determination of the gene sequence. Infect. Immun. 66: 3134-3141.
Litwin, C.M., T.W. Rayback, and J. Skinner. 1996. Role of catechol siderophore
synthesis in Vibrio vulnificus virulence. Infect. Immun. 64: 2834-2838.
Lupski, J.R. and G.M. Weinstock. 1992. Short, interspersed repetitive DNA sequences in
prokaryotic genomes. J. Bacteriol. 174(14): 4525-4529.
MacLachlan, P.R., W.J. Keenleyside, C. Dodgson, and C. Whitfield. 1993. Formation of
the K30 (group I) capsule in Escherichia coli 09:K30 does not require attachment
to lipopolysaccharide lipid A-core. J. Bacteriol. 175: 7515-7522.
Manca, M.C., A. Weintraub, and G. Widmalm. 1996. Structural studies of the
Escherichia coli 026 O-antigen polysaccharide. Carbohydr. Res. 281(1): 155-160.
Manning, P.A., U.H. Stroeher, L.E. Karageorgos, and R. Morona. 1995. Putative O-
antigen transport genes within the rfb region of Vibrio cholerae 01 are homologous
to those of capsule transport. Gene 158: 1-7.
Manrong, L, T. Shimada, J.G. Morris, A. Sulakvelidze, S. Sozhamannan. 2002. Evidence
for the emergence of non-O 1 and non-0139 Vibrio cholerae strains with
pathogenic potential by exchange of O-antigen biosynthesis regions. Infec. Immun.
70(5): 2441-2453.
Maxwell, E.L., B.C. Mayall, S.R. Pearson and P.A. Stanley. 1991. A case of Vibrio
vulnificus septicaemia acquired in Victoria. Med. J. Aust. 154: 214-215.
McPherson, V.L., J.A. Watts, L.M. Simpson and J.D. Oliver. 1991. Physiological effects
of the lipopolysaccharide of Vibrio vulnificus on mice and rats. Microbios. 67: 141-
149.
Merino, S., M. Altarriba, L. Izquierdo, M. M. Nogueras, M. Regue, and J. M. Tomas.
2000. Cloning and sequencing of the Klepsiella pneuminiae 05 wb gene cluster and
its role in pathogenesis. Infect. Immun. 68(5): 2435-2440.
Meyer, T.F., C.P. Gibbs, and R. Haas. 1990. Variation control of protein expression in
Neisseria. Annu. Rev. Microbiol. 44: 451-477.
Miyoshi, N., C. Shimizu, S. Miyoshi, and S. Shinoda. 1987. Purification and
characterization of Vibrio vulnificus protease. Microbiol. Immunol. 31: 13-25.
Miyoshi, S., H. Nakazawa, K. Kawata, K. Tomochika, K. Tobe, and S. Shinoda. 1998.
Characterization of the hemorrhagic reaction caused by Vibrio vulnificus
metalloprotease, a member of the thermolysin family. Infect. Immun. 66: 4851-
4855.
Mooi, F.R. and E.M. Bik. 1997. The evolution of epidemic Vibrio cholerae strains.
Trends Microbiol. 4: 161-165.
Morona, R., L. Van Den Bosch, and P. A. Manning. 1995. Molecular, genetic, and
topological characterization of O-antigen chain length regulation in Shigella
flexneri. J. Bacteriol. 177:1059-1068.
Morris, J.G. 1988. Vibrio vulnificus--a new monster of the deep? Ann. Intern. Med. 109:
261-263.
Morris, J.G., A.C. Wright, L.M. Simpson, P.K. Wood, D.E. Johnson, and J.D. Oliver.
1987. Virulence of Vibrio vulnificus: association with utilization of transferrin-
bound iron, and lack of correlation with levels of cytotoxin or protease production.
FEMS Microbiol. Lett. 40: 55-60.
Morris, J.G., and R.E. Black. 1985. Cholera and other vibrioses in the United States. N.
Engl. J. Med. 312: 343-347.
Motes, M.L. and A. De Paola. 1996. Offshore suspension relaying to reduce levels of
Vibrio vulnificus in oysters (Crassostrea virginica). Appl. Environ. Microbiol. 62:
3875-3877.
Motes, M.L., A. De Paola, D.W. Cook, J.E. Veazey, J.C. Hunsucker, W.E. Garthright,
R.J. Blodgett and S.J. Chirtel. 1998. Influence of water temperature and salinity on
Vibrio vulnificus in Northern Gulf and Atlantic Coast oysters (Crassostrea
virginica). Appl. Environ. Microbiol. 64: 1459-1465.
Myatt, D.C. and G.H. Davis. 1989. Isolation of medically significant Vibrio Species from
riverine sources in South East Queensland. Microbios. 60: 111-123.
Nassif, X., J. Lowy, P. Stenberg, P. O'Gaora, A. Ganji, and M. So. 1993. Antigenic
variation of pilin regulates adhesion of Neisseria meningitides to human epithelial
cells. Mol. Microbiol. 8: 719-725.
Ofek, I., and N. Sharon. 1988. Lectinophagocytosis: a molecular mechanism of
recognition between cell surface sugars and lectins in the phagocytosis of bacteria.
Infect. Imun. 56: 539-547.
Oliver, J. D. 1991. Formation of nonculturable Vibrio vulnificus cells and its relationship
to the starvation state. Appl. Environ. Microbiol. 57: 2640-2644.
Oliver, J.D. and R. Bockian. 1995. In vivo resuscitation, and virulence towards mice, of
viable but nonculturable cells of Vibrio vulnificus. Appl. Environ. Microbiol. 61:
2620-2623.
Oliver, J.D., F. Hite, D. McDougald, N.L. Andon and L.M. Simpson. 1995. Entry into,
and resuscitation from, the viable but nonculturable state by Vibrio vulnificus in an
estuarine environment. Appl. Environ. Microbiol. 61: 2624-2630.
Oliver, J.D., R.A. Warner and D.R. Cleland. 1982. Distribution and ecology of Vibrio
vulnificus and other lactose-fermenting marine Vibrios in coastal waters of the
Southeastern United States. Appl. Environ. Microbiol. 44: 1404-1414.
Paiment, A., J. Hocking, and C. Whitfield. 2002. Impact of Phosphorylation of Specific
Residues in the Tyrosine Autokinase, Wzc, on Its Activity in Assembly of Group 1
Capsules in Escherichia coli. J. Bacteriol. 184(23): 6437-6447.
Park, N.Y., J.H. Lee, H.S. Jeong, and S.H. Choi. 2003. Direct Submission, Food Science
& Technology, Chonnam National University, Buk-Ku Yong Bong Dong, Kwang-
Ju 500-757, South Korea.
Perry, M.B., L. MacLean, and D.W. Griffith. 1986. Structure of the O-chain
polysaccharide of the phenol-phase soluble lipopolysaccharide of Escherichia coli
0:157:H7. Biochem. Cell Biol. 64(1): 21-28.
Powell, J. L., A. C. Wright, S. S. Wasserman, D. M. Hone, and J. G. Morris, Jr. 1997.
Release of tumor necrosis factor alpha in response to Vibrio vulnificus capsular
polysaccharide in in vivo and in vitro models. Infect. Immun. 65: 3713-3718.
Preston, L.M., Q. Xu, J.A. Johnson, A. Joseph, D. Maneval Jr., K. Husain, G.P. Reddy,
C.A. Bush, and J.G. Morris. 1995. Preliminary structure determination of the
capsular polysaccharide of Vibrio cholera 0139 Bengal All 837. J. Bacteriol. 177:
835-838.
Prieur, D., G. Mevel, J. L. Nicolas, A. Plusquellec, and M. Vigneulle. 1990. Interactions
between bivalve mollusks and bacteria in the marine environment. Oceanogr. Mar.
Biol. Annu. Review. 28: 277-352.
Rahn, A., and C. Whitfield. 2003. Transcriptional organization and regulation of the
Escherichia coli K30 group 1 capsule biosynthesis (cps) gene cluster. Mol.
Microbiol. 47:1045-1060
Rahn, A., J. Drummelsmith, and C. Whitfield. 1999. Conserved organization in the CPS
gene clusters for expression of Escherichia coli group 1 K antigens: relationship to
the colanic acid biosynthesis locus and the CPS genes from Klebsiellapneumoniae.
J. Bacteriol. 181: 2307-2313.
Rahn, A., K. Beis, J. H. Naismith, and C. Whitfield. 2003. A novel outer membrane
protein, Wzi, is involved in surface assembly of the Escherichia coli K30 group 1
capsule. J. Bacteriol. 185(19): 5882-5890.
Raymond, C.K., E.H. Sims,A. Kas, D.H. Spencer, T.V. Kutyavin, R.G. Ivey, Y. Zhou, R.
Kaul, J.B. Clendenning, and M.V. Olson. 2002. Genetic variation at the O-antigen
biosynthetic locus in Pseudomonas aeruginosa. J. Bacteriol. 184 (13): 3614-3622.
Reddy, G.P., U. Hayat, C. Abeygunawardana, C. Fox, A.C. Wright, D.R. Maneval, C.A.
Bush, and J.G. Morris. 1992. Purification and determination of the structure of
capsular polysaccharide of Vibrio vulnificus M06-24. J. Bacteriol. 174(8): 2620-
2630.
Ringquist, S. and C.L. Smith. 1992. The Escherichia coli chromosome contains specific,
unmethylated dam and dcm sites. Proc. Natl. Acad. Sci. USA. 89: 4539-4543.
Ripley, L.S. and B.W. Glickman. 1983. Unique self-complementarity of palindromic
sequences provides DNA structural intermediates for mutation. Cold Spring Harb.
Symp. Quant. Biol. 47(2): 851-861.
Rippey S.R. 1994. Infectious diseases associated with molluscun shellfish consumption.
Clin. Microbiol. Rev. 7: 419-425.
Roberts, I.S. 1996. The biochemistry and genetics of capsular polysaccharide production
in bacteria. Annu. Rev. Microbiol. 50: 285-315.
Rosche, W.A., T.Q. Trinh, and R.R. Sinden. 1995. Differential DNA secondary structure-
mediated deletion mutation in the leading and lagging strands. J. Bacteriol.
177(15): 4385-4391.
Sarkari, J., N. Pandit, E.R. Moxon, and M. Achtman. 1994. Variable expression of the
Opc outer membrane protein in Neisseria meningitides is caused by size variation
of a promoter containing poly-cytidine. Mol. Microbiol. 13: 207-217.
Saunders, J.R. 1994. Population genetics of phase variable antigens. In Population
Genetics of Bacteria. Baumberg.
Serkin, C. D., and H. S. Seifert. 2000. Iron availability regulates DNA recombination in
Neisseria gonorrhoeae. Mol. Microbiol. 37:1075-1086.
Shao, C.P. and L.I. Hor. 1999. Characterization of metalloprotease-deficient Vibrio
vulnificus mutant generated by allelic exchange technique. 1999. B/D-314. In:
American Society for Microbiology 99th General Meeting. Chicago. IL. ASM. p.
91.
Shapiro, R.L., S. Altekruse, L. Hutwagner, R. Bishop, R. Hammond, S. Wilson, B. Ray,
S. Thompson, R.V. Tauxe and P.M. Griffin. 1998. The role of Gulf Coast oysters
harvested in warmer months in Vibrio vulnificus infections in the United States,
1988-1996. J. Infect. Dis. 178: 752-759.
Shimizu, T., K. Ohtani, H. Hirakawa, K. Ohshima, A. Yamashita, T. Shiba, N.
Ogasawara, M. Hattori, S. Kuhara, and H. Hayashi. 2002. Complete genome
sequence of Clostridium perfringens, an anaerobic flesh-eater. Proc. Natl. Acad.
Sci. U.S.A. 99(2): 996-1001.
Shinoba, S., M. Kabayashi, H. Yamada, S. Yoshiba, M. Ogawa, and M. Mizuguchi.
1987. Inhibitory effect of capsular antigen of Vibrio vulnificus on bactericidal
activity on human serum. Microbiol. Immunol. 31: 393-401.
Simon, M., J. Zeig, M. Silverman, G. Mandel, and R. Doolittle. 1980. Phase variation:
evolution of a controlling element. Science. 209: 1370-1374.
Simon, R., U. Priefer, and A. Puhler. 1983. A broad host range mobilization system for in
vivo genetic engineering: transposon mutagenesis in gram-negative bacteria.
Bio/Technology. 1: 784-791.
Simpson, L.M. and J.D. Oliver. 1983. Siderophore production by Vibrio vulnificus.
Infect. Immun. 41: 644-649.
Simpson, L.M. and J.D. Oliver. 1987. Ability of Vibrio vulnificus to obtain iron from
transferring and other iron-binding compounds. Curr. Microbiol. 15: 155-158.
Simpson,A.J., F.C. Reinach, P. Arruda, F.A. Abreu, M. Acencio, R. Alvarenga, L.M.
Alves, J.E. Araya, G.S. Baia, C.S. Baptista, M.H. Barros, E.D. Bonaccorsi,S.
Bordin,J.M. Bove, M.R. Briones, M.R. Bueno, A.A. Camargo, L.E. Camargo, D.M
Carraro, H. Carrer, N.B. Colauto, C. Colombo, F.F. Costa, M.C. Costa, C.M.
Costa-Neto, L.L. Coutinho, M. Cristofani, E. Dias-Neto, C. Docena, H. El-Dorry,
A.P. Facincani, A.J. Ferreira, V.C. Ferreira, J.A. Ferro, J.S. Fraga, S.C. Franca,
M.C Franco, M. Frohme, L.R. Furlan, M. Gamier, G.H. Goldman, M.H. Goldman,
S.L. Gomes, A. Gruber, P.L. Ho, J.D. Hoheisel, M.L. Junqueira, E.L. Kemper, J.P.
Kitajima, and C.L. Marino. 2000. The genome sequence of the plant pathogen
Xylellafastidiosa. The Xylellafastidiosa consortium of the organization for
nucleotide sequencing and analysis. Nature. 406 (6792): 151-157.
Sinden, R.R., G.X. Zheng, R.G. Brankamp, and K.N. Allen. 1991. On the deletion of
inverted repeated DNA in Escherichia coli: effects of length, thermal stability, and
cruciform formation in vivo. Genetics. 129(4): 991-1005.
Smith, G.C. and J.R. Merkel. 1982. Collagenolytic activity of Vibrio vulnificus: potential
contribution to its invasiveness. Infect. Immun. 35: 1155-1156.
Smith,A.B. and R.J. Siebeling. 2003. Identification of genetic loci required for capsular
expression in Vibrio vulnificus. Infect. Immun. 71 (3): 1091-1097.
Sozhamannan, S., Y.K. Deng, M. Li, A. Sulakvelidze, J. Kaper, J.A. Johnson, G.B. Nair,
and G. Morris. 1999. Cloning and sequencing of the genes downstream of the wbf
gene cluster of Vibrio cholerae serogroup 0139 and analysis of the junction genes
in other serogroups. Infect. Immun. 67(10): 5033-5040.
Starks, A.M. T.R. Scheb, M.L. Tamplin, S. Parveen, T.J. Doyle, P.E. Bomeisl, G.M.
Escudero, and P.A. Gulig. 2000. Pathogenesis of infection by clinical and
environmental strains of Vibrio vulnificus. Appl. Environ. Microbiol. 58: 5785-
5793.
Stelma, G. N. Jr., A. L. Reyes, J. T. Peeler, C. H. Johnson, and P. L. Spaulding. 1992.
Virulence characteristics of clinical and environmental isolates of Vibrio vulnificus.
Appl. Environ. Microbiol. 58: 2776-2782.
Stem, A., M. Brown, P. Nickel, and T.F. Meyer. 1986. Opacity genes in Neisseria
gonorrhoeae: control of phase and antigenic variation. Cell. 47: 61-71.
Stevenson, G., K. Andrianopoulos, M. Hobbs, P.R. Reeves. Organization of the
Escherichia coli K-12 gene cluster responsible for production of the extracellular
polysaccharide colanic acid. J. Bacteriol. 1996. 178: 4885-4893.
Streisinger, G., Y. Okada, J. Emrich, J. Newton, A. Tsugita, E. Terzaghi, and M. Inouye.
1966. Frameshift mutations and the genetic code. Cold Spring Harb. Symp. Quant.
Biol. 31: 77-84.
Stroeher, U.H. and P.A. Manning. 1997. Vibrio cholerae serotype 0139: swapping genes
for surface polysaccharide biosynthesis. Trends Microbiol. 5: 178-180.
Stroeher, U.H., K.E. Jedani, and P.A. Manning. 1998. Genetic organization of the regions
associated with surface polysaccharide synthesis in Vibrio cholerae 01, 0139 and
V. anguillarum 01 and 02: a review. Gene. 223: 269-282.
Stroeher, U.H., K.E. Jedani, B.K. Dredge, R. Morona, M.H. Brown, L.E. Karageorgos,
J.M. Albert, and P.A. Manning. 1995. Genetic rearrangement of the rfb regions of
Vibrio cholerae 01 and 0139. Proc. Natl. Acad. Sci. 92: 10374-10378.
Stroeher, U.H., L.E. Karageorgos, M.H. Brown, R. Morona, and P.A. Manning. 1995. A
putative pathway for perosamine biosynthesis is the first function encoded within
the rfb region of Vibrio cholera 01. Gene. 166: 33-42.
Strom, M.S., and R.N. Paranjpye. 2000. Epidemiology and pathogenesis of Vibrio
vulnificus. Microb. Infect. 2:177-188.
Tacket, C.O., F. Brenner, and P.A. Blake. 1984. Clinical features and an epidemiological
study of Vibrio vulnificus infections. J. Infect. Dis. 149: 558-561.
Tamplin, M. L., G. E. Rodrick, N. J. Blake, and T. Cuba. 1982. The isolation and
characterization of Vibrio vulnificus from two Florida estuaries. Appl.Environ.
Microbiol. 44: 1466-1470.
Tamplin, M.L. and G.M. Capers. 1992. Persistence of Vibrio vulnificus in tissues of Gulf
Coast oysters, Crassostrea virginica, exposed to seawater disinfected with UV
light. Appl Environ. Microbiol. 58: 1506-1510.
Tamplin, M.L., S. Specter, G.E. Rodrick, and H. Friedman. 1985. Vibrio vulnificus resists
phagocytosis in the absence of serum opsonins. Infect. Immun. 49:715-718.
Tison, D.L., M. Nishibuchi, J.D. Greenwood and R.J. Seidler. 1982. Vibrio vulnificus
biogroup 2: new biogroup pathogenic for eels. Appl. Environ. Microbiol. 44: 640-
646.
Trinh, T.Q. and R.R. Sinden. 1993. The influence of primary and secondary DNA
structure in deletion and duplication between direct repeats in Escherichia coli.
Genetics. 134(2): 409-422.
van Belkum, A., S. Scherer, L. van Alphen, and H. Verbough. 1998. Short-sequence
DNA repeats in prokaryotic genomes. Microbiol. Mol. Biol. Rev. 62: 275-293.
van der Woude and Baumler. 2004. Phase and antigenic variation in bacteria. Clin
Microbiol. Rev. 17(3): 581-611.
van der Woude, M., B. Braaten, and D. Low. 1996. Epigenetic phase variation of the pap
operon in Escherichia coli. Trends Microbiol. 4: 5-9.
van Ham, S.M., L. van Alphen, F.R. Mooi, and J.P. van Putten. 1993. Phase variation of
H. influenzae fimbriae: transcriptional control of two divergent genes through a
variable combined promoter region. Cell. 73: 1187-1196.
Vincent, C., B. Duclos, C. Grangeasse, E. Vaganay, M. Riberty, A. J. Cozzone, and P.
Doublet. 2000. Relationship between exopolysaccharide production and protein-
tyrosine phosphorylation in gram-negative bacteria. J. Mol. Biol. 304:311-321.
Virji, M., H. Kaythy, D.J. Ferguson, C. Alexandrescu, J.E. Heckels, and E. R. Moxon.
1991. The role of pili in the interactions of pathogenic Neisseria with cultured
human endothelial cells. Mol. Microbiol. 5: 1831-1841.
Wainwright, L.A., K.H. Pritchard, and H.S. Seifert. 1994. A conserved DNA sequence is
required for efficient gonococcal pilin antigenic variation. Mol. Microbiol. 13: 75-
87.
Waldor, M.K., R. Colwell, and J.J. Mekalanos. 1994. The Vibrio cholerae 0139
serogroup antigen includes an O-polysaccharide capsule and lipopolysaccharide
virulence determinant. Proc. Natl. Acad. Sci. 91: 11388-11392.
Wann, E.R., B. Dassy, J.M. Fournier, and T.J. Foster. 1999. Genetic analysis of the cap5
locus of Staphylococcus aureus. FEMS Microbiol. Lett. 170(1): 97-103.
Watnick and Kotler. 1999. Steps in the development of Vibrio cholerae El Tor biofilm.
Mol. Microbiol. 34: 586-595.
Weichart, D. and S. Kjelleberg. 1996. Stress resistance and recovery potential of
culturable and viable but nonculturable cells of Vibrio vulnificus. Microbiol. 142:
845-853.
Weichart, D., D. McDougald, D. Jacobs and S. Kjelleberg. 1997. In situ analysis of
nucleic acids in cold-induced nonculturable Vibrio vulnificus. Appl. Environ.
Microbiol. 63: 2754-2758.
Weintraub, A., G. Widmalm, P.E. Jannsson, M. Jannson, K. Hultenby, and M.J. Albert.
1994. Vibrio cholerae 0139 Bengal possesses a capsular polysaccharide, which
may confer increased virulence. Microb. Pathogen. 16: 235-241.
Whiteside, M. D., and J. D. Oliver. 1997. Resuscitation of Vibrio vulnificus from the
viable but nonculturable state. Appl. Environ. Microbiol. 63: 1002-1005.
Whitfield C. and I.S. Roberts. 1999. Structure, assembly and regulation of expression of
capsules in Escherichia coli. Mol Microbiol. 31(5): 1307-1319.
Whitfield, C. and A. Paiment. 2003. Biosynthesis and assembly of group 1 capsular
polysaccharide in Escherichia coli and related extracellular polysaccharides in
other bacteria. Carbohydr. Research. 338:2491-2502.
Wright, A. C., R. T. Hill, J. A. Johnson, M. Roghman, R. R. Colwell, and J. G. Morris.
1996. Distribution of Vibrio vulnificus in the Chesapeake Bay. Appl. Environ.
Microbiol. 62: 717-724.
Wright, A.C. and J.G. Morris. 1991. The extracellular cytolysin of Vibrio vulnificus:
inactivation and relationship to virulence in mice. Infect. Immun. 59: 192-197.
Wright, A.C., J.L Powell, M.K. Tanner, L.A. Ensor, A.B. Karpas, J.G. Morris, Jr., and
M.B. Sztein. 1999. Differential expression of V vulnificus capsular polysaccharide.
Inect. Immun. 67(5): 2250-2257.
Wright, A.C., J.L. Powell, J.B. Kaper, and J.G. Morris. 2001. Identification of a group 1-
like capsular polysaccharide operon for Vibrio vulnificus. Infec. Immu. 69(11):
6893-6901.
Wright, A.C., L. M. Simpson, J.D. Oliver, and J.G. Morris. 1990. Phenotypic evaluation
of acapsular transposon mutants of Vibrio vulnificus. Infect. Immun. 58: 1769-
1773.
Wright, A.C., L.M. Simpson, and J.D. Oliver. 1981. Role of iron in the pathogenesis of
Vibrio vulnificus infections. Infect. Immun. 34: 503-507.
Wugeditsch, T., A. Paiment, J. Hocking, J. Drummelsmith, C. Forrester, and C.
Whitfield. 2001. Phosphorylation of Wzc, a tyrosine autokinase, is essential for
assembly of group 1 capsular polysaccharides in Escherichia coli. J. Biol. Chem.
276: 2361-2371.
Yamamoto, K., A.C. Wright, J.B. Kaper, and J.G. Morris. 1990. The cytolysin gene of
Vibrio vulnificus: sequence and relationship to the Vibrio cholerae El Tor
hemolysin gene. Infect. Immun. 58: 2706-2709.
Yamasaki, S., T. Shimizu, K. Hishino, S. Ho, T. Shimada, G.B. Nair, Y. Takeda. 1999.
The genes responsible for O-antigen synthesis of V. cholerae 0139 are closely
elated to those of V. cholerae 022. Gene. 237:321-332.
Yoshida, S., M. Ogawa, and Y. Mizuguchi. 1985. Relation of capsular materials and
colony opacity to virulence of Vibrio vulnificus. Infect. Immun. 47: 446-451.
Zeig, J., and M. Simon. 1980. Analysis of the nucleotide sequence of an invertible
controlling element. Proc. Natl. Acad. Sci. 77: 4196-4200.
Zhang, J., J.M. Hardham, A.G. Barbour, and S.J. Norris. 1997. Antigenic variation in
Lyme disease Borreliae by promiscuous recombination of VMP-like sequence
cassettes. Cell. 89: 275-285.
Zhao, H., Li, X., D.E. Johnson, I. Blomfield, and H. L. Mobley. 1997. In vivo phase
variation of MR/P fimbrial gene expression in Proteus mirabilis infecting the
urinary tract. Mol. Microbiol. 23: 1009-1019.
Zuppardo, A.B., and R. J. Siebeling. 1998. An epimerase gene essential for capsule
synthesis in Vibrio vulnificus. Infect. Immun. 2601-2606.
BIOGRAPHICAL SKETCH
Maria Chatzidaki was born on July 20, 1975, in Athens, Hellas. After graduating
from high school, she decided to take the national examinations for entrance into a
Hellenic university. In 1994 she was admitted to the Department of Food Science and
Technology at the Agricultural University of Athens. Her devotion to academic
excellence and merit was demonstrated by ranking in the top 2 percent in her department
for the entire duration of her studies. For this reason, she received annually recognition
awards from the State Scholarships Foundation of the Hellenic Republic.
After receiving her B.Sc./M.Sc. combined degree with high honors in the summer
of 1999, she was offered assistantships to pursue graduate studies in Food Science at
Ohio State University and the University of Florida (UF). Her choice to join the graduate
school at UF was highly influenced by the fact that it was the only one where both she
and her fiance Grigorios Livanis, were offered a scholarship among their combined
university choices.
In the fall of 1999, she enrolled in the Ph.D. program of the Department of Food
Science and Human Nutrition at the University of Florida with food microbiology as a
field of specialization. Once more, Maria's devotion to academic excellence was
demonstrated by receiving certificates of achievement for outstanding academic
accomplishments from the University of Florida International Center in April of 2000,
2001, 2002, 2003, and 2004. In addition she received a certificate of recognition for her
outstanding contributions to the University of Florida and the College of Agricultural and
|
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EKN5KBIJ0_WDP0SQ INGEST_TIME 2011-09-29T19:14:44Z PACKAGE AA00004691_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
PAGE 1
RELATIONSHIP OF THE Vibrio vulnificus GROUP 1-LIKE CAPSULAR POL YSACCHARIDE OPERON TO PHASE VARIATION By MARIA A. CHA TZIDAKI A DISSERTATIO PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2004
PAGE 2
Copyright 2004 by Maria A. Chatzidaki
PAGE 3
This dissertation is dedicated to my parents Andreas and E leni my sister St ella and the love of my life Grigorios Livanis who made this happen.
PAGE 4
ACKNOWLEDGMENTS First and foremost, I would like to express my deep gratitude and sincere appreciation to my advisor Dr. Anita C. Wright for her outstanding guidance, encouragement and advice during my graduate studies and the development of this dissertation. She has always been a source of motivation and inspiration. I would like especially to acknowledge Dr. Paul Gulig for the discussions and advice and for generously providing me with valuable sequencing data all of which contributed to the completion of this dissertation. Sincere appreciation is also extended to the other members of my committee Dr. Doug Archer and Dr. Gary Rodrick for their guidance and constructive criticisms that led to improvements in this dissertation. I would like to express my immensurable gratitude to my parents Andreas and Eleni Chatzidaki and my sister Stella for their continuous love and moral support despite the distance. I especially thank my parents who taught me that I could achieve anything that I committed myself to fully. In the last years of my studies I was privileged to ha ve a very good friend around Ioannis Livanis studying at the same University whose humor and support made those years more enjoyable. Finally I would like to express my deepest love and gratitude to my partner in life Grigorios Livanis for all of his love support and sacrifice Without him by my side I would not ha ve r eac hed my goa ls successfully Words cannot express how thankful I am to be s harin g my li fe wit h so meone so lovin g, patient and thoughtful. IV
PAGE 5
TAB LE O F C O NTENTS ACKNOWLEDGMENTS ......... ... ... ...... ...... ... ....... .............. .................. .... .... .... ............ .. iv L IST OF TABLES ..... .... ............................ ......... ....... ............................. ......... ................ vi i LIST OF FIGURES .... . ... ........ .......... ... .............. ....... .... .... ....... ..................................... viii ABSTRACT .............. ...... ....... . .................................... ... ....... ............... ......... ................... ix CHAPTER INT R ODUCTION . ............................ . . . ...... ...... ...... ........... . .... . ... . . ............... ...... 1 Vibrio vulnifi.cus ................... . ... .... ... . ...... . ...... . ........... .... ......... . .... .......... . . ....... ... l V vulnifi.cus Disease . ....... ....... .... ... .. ... ... ..... ............... ........ ................... ... .... .............. 3 Distr i bution of V vulnifi.cus ..... .................. ............... ... ............. ................................. 5 V vulnifi.cus Pathogenesis ................................ ..... ..... .. .... .... ..... . ............... .... .. .... ... 6 V vulnifi.cus Capsu l ar Pol ysacc h ari d e ...................... ........... .... ......... .... . ...... .............. 8 Capsular Polysacchari d e Assem bl y ..................................... ........... ... ................ ....... 1 0 Mechanisms of Phase Variation ............ ... ...... .................... ........ .................. ..... ........ 1 3 Focus of the Present Study ......... .................... ... ................. .... .... ........ ..... ................. 20 Specific Aim 1: Investigate Gene Organization in V vulnifi.cus CPS Operon .... ....... 20 Specific Aim 2: Examine the Conservation and D istr i bution of C P S Genes Among V vulnificus Strai n s Vibrio spp. or Different Spec i es ................ 21 Specific Aim 3: Exam i ne the Genet i c B asis fo r P h ase Variation ............ ...... ............ 22 2 MATERIALS AND METHO D S .. ....... ...... ........... ......... ... ........ ... ... .. .... ................ 23 Bacterial Strains and Cul ture Condit i o n s ....... .... .. ................................... ............ ...... 23 D A Cloning ...... ........ ... .................... .... . ............... ... ................. .. .... ........ ............ 23 DNA Sequence Analysis ....... ................ ........ ... ...................... .......... .... .................... 25 Restriction Fragment Length Po l ymorphism ..... ............... ......... ... ...... . ..... ......... ... 25 Complementation of wzbvv in V vulnifi.cus MO6-24 / T Phase Variant ..... .............. ... 26 Electron Microscopy ............................ ........ .... ............ ... .... ...... . ........... .......... ...... 27 3 RESULTS: SPECIFIC AIM 1 .................. ... ..... .... ........ ...... ........... ......... .. .............. 28 Rationale for Study .................... ......... ..... .............. ... ... .... ... .................. ....... .... .... 28 Genetic Organization of V vulnificus Group I-l ike CPS Operon ....... ................... ... 28 V
PAGE 6
Identification of Genes for CPS Biosynthesis in V vulnificus MO6-24 / O .... .... .... ... 31 Comparison of the CPS Operons Among Vibrio Species ......... .... ..... . ... ........ ........ 39 4 RESULTS: SP E CIFIC AIM 2 .... .......... ............ ..... . ........... . ..... ..... ...................... .43 Rationale for Stud y ... ... . . ... ... ... ..... ....... . ..... . ........... ........... .............. .......... ....... .... 43 Unique Species-Specific Organization of V vulnificus CPS Translocation and Surface Assembly Genes ..... ................... ......................... ... ......... .... .......... .43 Comparison of CPS Operons for V vulnificus Strains: Identification of Three T y pes of Phase Variants ...... ..................... .... ........... ... ................... ... ... ... .45 Phenot y pic Characterization of the Different Phase Variants ................ . ......... ..... .... 51 5 RESULTS : SP E CIFIC AIM 3 ..... ............... ... .. ......... . ... ..... .. ....... ....... ................... . . 53 Rationale for Study ................... .... ...... .................... .... ........... ......... .......... ............. 53 Alignment of MO6 24 / O Phase Variants in the Putative Promoter Regions .......... ... 53 Phase Variation Mechanism for LC4 / T2 ................................................ .................... 55 6 SUMMARY AND CONCLUSIONS ... ............... ..................... .... ... .... ....... ............ 59 Organi z ation of a Group I-like CPS Operon in V vulnificus ........... ...... .... ............... 59 Comparison o f CPS Operons Among Vibrio Species .............. ... ... ....... ............ .... ... 60 Translucent Phase Variants Exhibit Multi pie Genotypes ... ................. ........ ............. 62 Role of SSRs in V v ulnificu s CPS ..... ... .............. ....... ... .... ...... ...... ... .... .............. .... 63 T2 Phase Variation is Mediated by Deletion of wzb .... ....... ...... ............................... 65 V v uln ifi cu s T l Phase Variation ....... . ...... ......... ... ... . ....... .... ........... ...... . ..... ....... . 67 Multiple Scen a rios for V vulnificu s Phase Variation ................ .... ........................... 68 CPS Expres s ion and the E nvironmental Survival ................ ............. ................... ...... 69 Biological Si g nificance of Phase Variation ....... ...... ..... ... .... ........... ...... ....... ......... .... 72 LIST OF REFERENC E S . ............... . ..... ... ... ..... . ............... ................ ... .... ...... ... ........... 74 BIOGRAPHICAL SKETCH ....... ................. ..... ...................... ................ .... ... . ... ... .... ..... 90 VJ
PAGE 7
LIST OF TABLES l. CPS phenotype of V vu lnifi cus strains ......................... .. ............. .. ........ ............ 24 2 Homologues for the V vuln(ficus genes in the group 1 CPS operon ... ................. 37 3. Genetic variab ilit y of gro up 1 operons ....... ........................... ......... .... ........ .. .... ... .46 4. Divergence among strains and phase variants at the V vulnificus CPS conserved locus ..... . ....... ...... ... ...... ........ . .... .... .... ... ... ... ........... .......... . .............. 48 Vll
PAGE 8
LIST OF FIGURES Figure 1. Phase variants of V. vulnificus M 06-24 ... ........ .... ......................... ... ............. ...... 9 2. Organization of CPS operons ...... ........... ............ ..... ... . ...... ............... . ... ......... ... 30 3. RFLP analysis of PCR amplified fragments from MO6 24 phase variants ....... ... .49 4. PCR Analysis of CPS transport genes i n V. vulnificus phase var i ants .............. . .... 50 5. Electron micrographs of V. vulnificus strains and phase variants ......... ... ... ... ... ..... 52 6. Sequence comparison of the 5' region of the CPS locus for V. vu lnificus ......... ..... 54 7. Electron micro graphs of complemented V. vulnificus LC4 / T2 . ....... .......... .... ... . ... 57 8. Model for phase variation of CPS expression in V. vulnificus .... ........ ...... ........... 68 9. Fluorescent microscopy image of algal (Thallasiosira pseudomona) and bacterial cells (V. vulnificus MO6-24 / T) ......... . .................. .................. .... .... 71 Vlll
PAGE 9
Abstract of Dissertation Presented to the Graduate School of the U niversity of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy RELATIONSHIP OF THE Vibrio vulnificus GROUP I-LIKE CAPSULAR POL YSACCHARIDE OPERON TO PHASE VARIATION By Maria A. Chatzidaki August 2004 Chair: Anita C. Wright Major Department: Food Science and Human Nutrition Vibrio vu lnificu s is an opportunistic human pathogen that can be extremely invasive producin g rapidly fatal septicemia in susceptible persons. Expression of capsular polysaccharide (CPS) is a primary virulence factor, and encapsulated strains are marked by opaque (0) colony morphology that can switch to translucent (T) colony phenotype with reduced CPS expression and virulence in a process referred to as phase variation. We previously characterized a V vulnificus CPS operon with similarity to gro up 1 CPS operons of Escherichia coli. The present study confirms V vulnificus group 1 operon structure and presents ge netic comparisons of opaque ve rsus translucent phase variants. Different c la sses of translucent phase variants (Tl, T2, and T3) were identified by their phenotypic and genet ic profiles. Although decreased CPS expression was observed in T l strai ns the CPS operon appears intact with only minor differences in DNA sequence between phase variants. On the other hand both T2 and T3 phase variants were completely acapsular and do not revert to opaque phenotype. T2 cells exhibited I X
PAGE 10
deletion of the w z b gene and. complementation analysis confirmed both the site specificity of this deletion and the requirement of the gene product for translocation of CPS to the cell surface. Larger deletions of multiple CPS transport genes were observed in T3. Species-specific tandem cassettes of short sequence repeats (SSRs) flanked both the wzb and the entire CPS transport locus strongly implicating SSR-mediated deletion as a mechanism for phase variation in V vulnificu s These data provide the first genetic comparison of CPS phase variants in this species and suggest a novel mechanism for the phase variation of CPS expression and v irulence in V vulnificus X
PAGE 11
CHAPTER 1 INTRODUCTION Vibrio vulnificus Vibrionaceae a gra m-negative family of bacteria has var ious important members, including Vibrio vulnificus Vibrio parachaemolyticus and Vibrio cholerae V. vu ln ificus is a curved rod-shaped bacterium with a single polar flage llum It inhabits and thrives in s hallow coastal water s in temperate climates throughout most of the world (Mya tt and Davis 1989 Maxwell et al. 1991, Dals ga ard et al. 1996 Hoi et al. 1998 Shapiro et al. 1998) and it s presence i s not associated with pollution. It re si des in hi gh numbers in filter-fe eding s h e llfish (u p to 1 x106 bacteria per g ram of oyster), but can also be found free living in the seawater (Wrig ht et al. 1996 Motes et al. 1998 ) Specifically V vulnificus prefers tropical and s ubtropical climates and propagates at water temperatures exceed in g l 8 C (Kas par and Tamplin 1993 Hlady and Klontz 1996). Total viab l e V v u lnifi cu s cell counts demon strate seasonality reaching nearly undetectable l evels when the water temperature falls below 1 0C ( Oli ver et al 1982 Kaysner et al. 1 987). As wate r s get warmer number s ofvibrios can reach from l xl03 to 1x106 bacteria per gram of oyster (Tamplin et al. 198 2 Motes et al. 1998) It is thou ght that th e bacteria enter a viab l e but non culturabl e (VBNC) state with the fall in temperature (Oliver et al. 1995) Durin g that phase the bacteria exhibit morphological changes Bacteria ass u me a coccoid s h ape in s tead of the u s ual rod and the membrane fatty ac id composition chan g es ; incr ease d m ec hanic a l resistance i s acquired and amino ac id transport slows down (L ind e r and Oliver 1 9 89 Weichart an d Kjelleberg 1996
PAGE 12
2 Weichart et al. 1997). It has been shown that the VBNC state accounts for cells that are unable to support cell division on media that are routinely used to sustain the microorganism s growth (Oliver 1991 Ste lma et al. 1992 Colwell et al. 1985, Whiteside and Oliver 1997, Bryan et al. 1999). As a result traditional culture techniques fail to detect VBNC cells which cou l d have serious implications for the seafood industry, as post harvest storage of oysters involves refrigeration or freezing. Post-harvest chilling can induce the VB C state in V vulnificus, making the cells undetectable and lead to erroneous post harvest cell numbers. An increase in temperature irrespective of the growth medium can cause an increase in culturability and V vulnificus resumes its original state (Oliver and Bockian 1995). V vulnificus is halophilic with salinity preferences that range from 15-25 parts per thousand (ppt) (Motes et al. 1998) Studies have shown that salinities greater than 25ppt are not favorable and can have a negative effect on the survival of the bacteria (Kaspar and Tamplin 1993 Motes and De Pao l a 1996 Motes et al. 1998) V vulnificus is divided into three categories in terms of biochemical phenotypic immunological and host range differences (Tison et al. 1982). The strains that belong in biotype 1 are indoleand omithine decarbox y lase-positive and exhibit multiple immunologically distinct lipopolysaccharide types (Amaro et al. 1997). Also this biotype contains the V vulnificus strains that have been isolated from shellfish and have been involved with human disease either through handling or consuming raw shellfish The members of biotype 2 are V vulnificu s strain s with the potential to cause disease in eels (Tison et al. 1982). These are indoleand omithine decarbox y lase-negative strains and all express a single lipopol y saccharide t y p e (Ti son et al. 1982). Biotype 2 strains were only recognized as
PAGE 13
marine vertebrate pathogens, but have now been shown to be virulent in mice (Amaro et al. 1994) and capable of causing disease in humans (Amaro and Biosca 1996). In addition Bisharat et al. (1999) identified another biotype (Biotype 3) for a new strain of V vulnificus, which was isolated from raw fish handlers in Israel with wound infection and bacteremia. V. vulnificus Disease 3 At least 13 species in the Vibrio genus are known to cause diseases in man and the symptoms var y from se v ere diarrhea to septicemia. V vulnificu s disease was first encountered by the U.S. Center for Disease Control (CDC) in 1964 and was then mistakenly identified as a virulent strain of V parachaemolyticus. A few years later though it was recognized as a distinct species, due to the unique characteristics of the disease compared to the other Vibrio sp. diseases (Hollis et al. 1976 Blake et al. 1979 Morris and Blak e 1985). V vulnificus is associated with raw shellfish consumption and especially oysters consumption and can be one of the most invasive and rapidly fatal of the opportunistic human patho g ens (De Paola et al. 1994 Rippey 1994 Wright et al. 1996) Oysters are filter feeders and capture s uspended food particles from the water (Prieur et al 1990) At the same time bacteria and other free floating microorganisms can be trapped and oysters can serve as carriers for human pathogens (Prieur et al. 1990). During feeding microor g anisms attach to the various oyster tissues hemolymph gills adductor muscle and mantle b y the in-fl o w that is created (Tamplin and Capers 1992). It has been shown though that V vulnificu s is indigenous to shellfish (Oliver et al. 1982 De Paola et al. 1994 Wri g ht e t al. 1996).
PAGE 14
4 It is evident that V vulnificus is very important for the seafood industry due to the high mortality rate observed during the V vulnificus disease; it is the leading cause of reported seafood-related deaths in this country (Tacket et al. 1984, Shapiro et al. 1998). Of all seafood-borne infections it is the most serious in the United States, as it accounts for 95% of all seafood-related deaths and it is estimated that there are fifty food-borne cases each year serious enough to lead to hospitalization (Morris and Black 1985 Morris 1988). It is noticeable that infections with V vulnificus are seen primarily in males over the age of 40 and generally occur between the months of May and October. V vulnificu s can cause invasive systemic disease with symptoms generally occurring within 16-38 hours following ingestion and include fever chills decrease in blood pressure and the development of secondary lesions," typically on the legs. These lesions begin a s fluid-filled blisters which progress to result in extensive destruction of muscle tissue frequentl y requiring amputation of the affected limb. Progression of the infection rapidl y leads to death in 50% of the cases with death occurring in a matter of day s (CDC 08/11/ 2 001 www.cdc.gov). Prompt administration of antibiotics is essential and intensive medical treatment is required. The organism also causes infection through a cut or puncture wounds acquired while shucking oysters peeling shrimp cleaning fish etc. and the s e p a tients ma y also develop fever and chills with redness swelling pain and tissue d es truction at the site of the wound but they do not develop the secondary lesions. The fatality rat e for wound infections is approximatel y 25 % (CDC, 08 /11/ 2001 www.cdc. g o v 2 00 2) The infectious do s e for V vulnificus disease is not known but it should be noted that onl y indi v idu a l s with c e rtain underlying di s eases such as certain liver diseases
PAGE 15
5 (especially cirrhosis and hepatitis) iron overload (hemochromatosis) diabetes cancer gastric disease and AIDS, are susceptib l e (Tacket et al. 1984). According to the Canadian Hemochromatosis Society Hemochromatosis (HHC 061112001, www.cdnhemochromatosis.ca) is a hereditary condition that causes an overload of iron in the body. The liver heart endocrine g l ands skin and joints are principally affected and liver cirrhosis cardiomyopathy diabetes mellitus hypogonadism and arthritis are the usual manifestations (HHC 06 / 1 / 2001 www.cdnhemochromatosis ca) Individua l s belonging to these high risk groups are 80 times more likely to get sick and more than 200 times more likely to die from consuming V vulnifzcus-infected raw oysters than are healthy persons (CDC 08/11 /2001, www.cdc.gov ). Dist r ibu t ion o f V. vulnific u s The main cause of V vulnifzcu s illnesses is the consumption of raw oysters Crasso s trea vir g inica which are harvested from Gulf Coast estuaries (Shapiro et al. 1998) It is an interesting fact as this organism has also been recovered from the Atlantic Coast (Motes et al. 1998 Shapiro et al. 1998) and Pacific Coast sites (Kaysner et al. 1989). The bacterial numbers in the Gulf Coast estuaries can range from 103 to 106 organisms per gram of oyster tissue (Tamp l in et al. 1982) but the Atlantic Coast sites which have higher salinities showed reduced numbers of V vulnifzcus with comparable water temperatures throughout the warm months (Motes et al. 1998). A study that was done in Chesapeake Bay estuaries demonstrated comparable bacterial counts to those from the Gulf Coast (Wright et al. 1996). V vulnifzcus outbreaks have been reported in countries outside the U.S. such as Sweden Germany Holland South Korea and Denmark with bact e ria pre s ent in th e oyster tissue and the s eawater (Dalsgaard et al. 1996 Linku s and Oli ve r 1999).
PAGE 16
6 V. vulnificus Pathogenesis V vulnificus bacteria contain multiple viru lenc e characteristics that may be involved or required for manifestation of disease in humans. As seen in all gram-negative microorganisms biotype 1 V vulnificus produces lipopol ysaccharide (LPS) endotoxin with variable O-side cha in on its surface (Amaro et al. 1997). A lthou gh V vulnificus endotoxin initiates a certain le ve l of cytokine induction it has less pyrogenic potential than endotoxins from other gram -n egat i ve bacteria (McPherson et al. 1991). Powell et al. (1997) challenged mice with the encapsu lat ed MO6-24 / O strain and its unencapsu lat ed transposon mutant CVD752 with purified CPS and LPS. They observed that purified CPS was a slightly more active inducer of TNF-alpha than was LPS. It is believed that LPS plays a role in stimulating the host cytokine response during the disease process but it cannot solely explain the massive inflammation and septic shock that are observed during systemic infection (Strom and Paranjpye 2000). V vulnificus also produces a number of extracellu lar proteins among them two hemolytic proteins a protease and a cytolysin. The more important of the two, the cytolysin is a heat-labile 56-kDa enzyme that lyses mammalian erythrocytes (Gray and Kreger 1985). It is heat-labile and the purified protein can increase vascular permeability in guinea pig skin and is lethal for mice at le vels of about 3g / Kg of body weight (Gray and Kreger 1985 Wright and Morris 1991). The gene encoding this protein vvhA shows similarity to the V chol e rae El Tor hemolysin and the V chol e rae non-O1 cytolysin (Yamamoto et al. 1990 Wright and Morris 1991 ). This protein may play a role in virulence as antibodies in the sera of infected mice specific to the toxin have been detected. Howev e r it i s not n e c e ssary for the extensive tissu e damage observed in V
PAGE 17
vulnificus infections as inactivation of the protein did not affect virulence (Gray and Kreger 1986, Wright and Morris 1991 ) Thus far, the actual contribution to the disease process has not been e lucidated excluding it as a virulence d ete rminant in the V vu lnifi cus di sease process (Gray and Kreger 1986 Wright and Morris 1991). 7 The protease VVP or VVPE, has elastolytic and collagenolytic activities (Smith and Merkel 1982 Kothary and Kreger 1987 Miyoshi et al. 1987) It has been suggested to be a potential virulence factor, particu l arly in skin lesions but its inactivation had no effect on the growth of the organism in v itro or in vivo, nor did it have any effect on the induction of vascu lar permeability in rats (Kothary and Kreger 1987 Miyoshi et al. 1998 Shao and Hor 1999). Inactivation of the V vulnificus vvpE gene had no effect on the bacterial ability to in fect mice irre s pective of iron addition (Jeong et al. 2000). Interestingly in the absence of VVP, there was an increase in the amount of cytolysin activ it y (as measured b y h emolysis of mouse erythrocytes) in culture supernatants of the mutant compared to the wild-type, suggesting that the cytolysin may act as a substrate to th e protease and when absent, more cytolysin i s available to cause tissue damage, incr eas in g the viru l ence potential of the organism (Shao and Hor 19 99). V vulnificus produces hydro xymate and phenol ate ( catechol) for the acquisition of iron from the mammalian host (S impson and Oliver 1983). An isogenic mutant in the catechol si d erophore (VenB) was considerably less vi rul ent in mice (Litwin et al. 199 6) It h as been h ypot h es i zed that b ac t e ri a sense the environment for iron and the change from a highto a low-iron concentration may act as an important sensory signal of the mammalian host. Iron is very important for V vu lnifi cus. This is evident from the incr eased concentration of iron in th e sera of most of the s u scept ibl e population to the V
PAGE 18
8 vulnificus and by the animal model used for V vulnificus disease studies. Intraperitoneal injection of mice with a virulent V vulnificus isolate generally results in little effect, with a lethal dose of (L D5 0 ) requiring greater than 1x106 bacteria. However, the LD50 dramaticall y decreases to va lu es ranging from a few bacteria to lx103 bacteria if iron is injected usually s hortl y before the bacterial challenge. In this iron overloaded mouse model the LD5 0 for avirulent strains is greater than 1x104 bacteria. Oral inoculations of mice required higher numbers of bacteria (lx109 ) (Wr i ght et al. 1981). V. vulnificus Capsular Pol ys accharide The symptoms of V vulnificus septicemia resemble those of endotoxic shock but as was mentioned previously the lipopolysaccharide of this organism was relatively inert and its contribution to virulence remains unclear (McPherson et al. 1991 Powell et al. 1997). V vulnificus strai n s isolated from humans have been asso ciated with the expression of CPS on their surface (W ri g ht et al. 1990 Wright et al. 1999) Thus far the primary v irulenc e factor for V vu lnifi cus is expression of capsular polysaccharide and tho se isolat es that d o not exp r ess it are avi rul ent (Wright et al. 1990). As shown in Figure 1 V vulnificus stra in s ex hibit phenotypic var i ation when grown on an agar surface; Opaque (0) colony morpho l ogy i s associa t ed with CPS expression but co l onies may also s how a Translucent (T) phenotype whereby cells are acapsular or ha ve reduced CPS express ion (Yoshida et al. 198 5 Simpso n e t al. 1987). T he se phenotypes can be reversible for both o T and T -o transit i ons in some strains at a rate of about 10-3 to 10-4 in a process termed phase variation ( Wri ght e t al. 1990). Similar associations of CPS colony morphology and vi rul ence ha ve also be e n report ed for non-O1 V cholerae (Johnson et al. 1994).
PAGE 19
9 Figure 1. Phase variants of V. vulni.ficus MO6-24 Cell surface expression of CPS varied with growth phase with the highest amounts observed during logarithmic growt h at 30C (W right et al. 1999). Opaque encapsulated strains are highl y lethal in mice especially in animals with excess iron (Wright et al. 1981) and resist bactericidal effects of serum or phagocytosis (Tamp lin et al. 1985 Shinoba et al. 1987). Trans luc ent i so lates with reduced CPS expression are also diminished in the virulent phenotype (Simpson et al. 1987 Yamamoto et al. 1990 Wright et al. 1999). The capsule apparently enables V. vulni.ficus to evade nonspecific host defense mechanisms such as activation of the alternative pathway of the complement cascade and comp l ement-mediated opsonophagocytosis (Tamplin et al. 1985 Moxon and Kroll 1990 Robe11s 199 2) Wright et al. (1999) demonstrated that the translucent phase variant of MO6-24 / O was able to bind type 1 CPS -specific monoclonal antibodies suggesting conservation in the CPS betw ee n th e var iants. Thus the differences were on the amount of capsule that surrounded th e cell and not on the capsu lar type that was present. Great diversity of CPS
PAGE 20
10 types among V vulnificus has been reported and virulence of V vulnificus has not been associated with any particular CPS composition (Hayat et al. 1993). Opaque and translucent pha e variation of colony morphology is considered a virulence marker for V vulnificus Exp ression of capsule is nece sary but is not sufficient for virulence as encapsulated strains were avirulent (Starks Scheb et al. 2000). Capsular Polysaccharide Assembly Most of the work on the CPS biosynthesis and assembly of the capsule to the outside of the cell has been done on E cherichia coli and in 1999 Drumrnelsmith and Whitfield introduced a new categorization system for capsular polysaccharides comprising four new groups (group I through 4). Wright et al. (200 1 ) identified a group I-like operon in V vulnificus, and in this study we will solely focus on the analysis and characterization of group I operons with E. coli as a prototype. T he sequence of the 16kb capsule biosynthesis cluster has been determined for the group 1 prototype isolate E. coli E69 (O9a:K30) (Drum melsmith and Whitfield 1999 Rahn et al. 1999). The CPS operon contains 12 open reading frames which are divided into two regions by a transcriptional attenuator (Rahn and Whitfield 2003). Proteins encoded by genes that are located upstream of the attenuator are conserved and invo lved in the trans location and assembly of the high molecular-weight CPS, but those located downstream of the attenuator are not conserved and are involved in sy nthesis and low-level polymerization of the CPS repeat units (Rahn and Whitfield 2003). These proteins include the serotype-specific g l ycosy ltran ferases and components of the Wzxand W zy -dependent polymerization pathway (Rahn and Whitfield 2003) According to Paiment et al. (2002) E. co li gro up I CPS in vo l ves a W z y-dependent pathway in which the individual repeat unit s are assembled on undecaprenol phosphate
PAGE 21
11 at the cytoplasmic face of the inner membrane by the sequential activity of g l ycosyltransferases and then the repeat units are believed to cross to the periplasmic face of the inner membrane by an unknown mechanism invol v ing a putative flippase the Wzx protein. A polymerase Wzy is then involved in the polymerization of the lipid linked repeat units where in E. coli K30 they can follow one of two fates at this point. High-level pol y meri z ation termed K30 cPs, can occur in the periplasmic face of the inner membrane to generate the high-molecular-weight CPS, which is then translocated to the cell surface. Alternatively one or even a few repeat units can be ligated onto lipid A-core and expressed on the cell surface as KLPS (MacLachlan et al. 1993 Dodgson et al. 1996). The region of the operon that is located downstream of the transcriptional attenuator is sufficient for the production of KLPS but not for synthesis of the high-molecular-weight capsule (Rahn and Whitfield 2003) Preceding the attenuator in the K30 operon the products of the first four genes (orfX, wza, wzb and wzc) are believed to be involved in the high-level polymerization and surface expression of the high-molecular-weight CPS (K30 c p ). These genes are separated from a block of downstream ge nes encoding enzymes for repeat unit synthesis by a transcriptional attenuator (Rahn et al. 1999 Rahn and Whitfield 2003). The first gene encodes for the OrfX protein which ha s only one known homologue found in Klebsiella pneumoniae K2 strains (ORF3) (Arakawa et al. 1991, Arakawa et al. 1995 Alvarez e t al. 200 0). Only until recently was a role assigned to this protein ; is an outer membrane protein (Wzi) and w z i mutants have increased amounts of cell-free exo polysaccharide a t the expense of a capsular structure (Rahn et al. 2003). Additionally wzi mutant s had no effect on expression of the w z a and wzc gene products thus an y
PAGE 22
12 regulatory role for Wzi was ruled out. Wzi might be required for attachment of the capsular polymer to the cell surface, either by providing an anchor itself or indirectly by providing an assembly system for a different molecule that serves as the anchor. Wza is an outer membrane lipoprotein that multimerizes to form ring-like structures resembling secretins for type II and type III protein secretion of high molecular-weight (HMW) CPS polymers across the outer membrane (Drummelsmith and Whitfield 2000). Mutations in the wza ge ne led to loss of polymer secretion and accumulation of HMW intermediates within the periplasm. Interestingl y though wza mutants can still make and pol y merize K L PS, and probably exists a feedback mechanism in the system to prevent accumulation ofHMW intermediates that are going to be transported to the outside (Drumme l smit h and Whitfield 1999 2000) Wza mutants exhibit a phenotype that is distinct from the one observed in Wzi mutants as in the latter mucoid y and KLPS are unaffected (Rahn et al. 2003). It is hypothesized that Wzi acts fmther down in the pol y merization and transport cascade of CPS, with a possible role in determining the distribution of cell-associated and cell-free K ant i gen (Rahn et al. 2003). Fo llo wing wza are two genes whose proteins are thou ght to have a synergistic function Wzc a t yros in e autokinase and Wzb its cognate phosphatase (Drumrnelsmith and Whitfield 1999, Wugeditsch et al. 200 1). In E. coli K30 these proteins are required for the assembly of the high-molecular-weight capsular l ayer on the cell surface though not for polymerization or assemb l y of KLPS (Drummelsmith and Whitfield 1999 Wugeditsch et al. 2001 ) The C-terminal 17 amino acids of W zc include variable numbers of tyro s ine phosphorylation s it es required for assembly of K30 high molecular weight capsule (Wugeditsch et al. 2001 ) It has been hypothesized that Wzc must
PAGE 23
13 undergo cycles of phosphorylation and dephosphorylation for the K30 CPS to be expressed (W ugeditsch et al. 2001). To date the precise role ofWzc has not been elucidated but the Wugeditsch et al. (2001) study suggested that Wzc maybe involved in volume control of the HMW CPS on the outside by coordinating other components in the assembly complex in a manner analogous to the proposed role of Wzz in the biosynthesis of O antigens (Bastin et al. 1993 Morona et al. 1995). Homologues of wz i-wza-wzbwzc are also found in the CPS loci from K. pneumoniae (Arakawa et al. 1991 Rahn et al. 1999 ) Additionally th ere are second copies of the wza wzb and wzc (wza22min, wzb22min, and wzc22min) genes on the chromosomes of E. co li K30 and K-12 strains with products that participate with lo w efficiency in K30 CPS and colanic acid production (Vincent et al. 2000 Wuged i tsch et al. 2001). Colanic acid or M antigen is produce by E.coli K-12 and is a loo se l y attached E PS that i s produced in low levels (Geobel 1963) Mechanisms of Phase Variation Phase variation is considered the switching of a specific target gene or a whole operon to either an O or an OFF state. These phase variations are usually reversible but may be irreversible and are ge nerall y random events occurrin g at high frequency ( > 10-5 per generation) resultin g in a phenotypically heterogeneous population ( Henderson et al. 1999). Such phenomena may also be considered as "programmed events," as the genome of the organism i s u suaJiy organized in such a way that certain events are more likel y to occur (van Belkum et al. 1998 Henderson et al. 1999). Phase variation has been observed among various organisms both bacterial and non-bacterial and frequently in vo lves phenotypic changes in s urface structures (CPS LPS, pili or outer membrane proteins ) required for r es ponse to host defenses or changing e nvironm e ntal conditions (for a review see Henderson et al. 1999). Thus phase variation i s thought to be esse ntial to maintain
PAGE 24
14 diversity which is required for survival of many pathogens in continuously changing environments. Despite the growing number of examples of this phenomenon, relatively few distinct mechanisms have been described for phase variation, and these include promoter inversions insertion element-mediated alterations differential methylation and genetic rearrangement mediated by multiple repeated short DNA segments (Henderson et al. 1999). Repetitive DNA segments which are frequently seen in eukaryotes, are gradually being identified in prokaryotes. Repetitive DNA may consist of simp l e homopolymeric tracts of a single nucleotide or of several multimeric classes of repeats in large or small numbers and these sequences have been defined as short sequence repeats (SSRs) or variable number of tandem repeats (VNTRs) (van Belkum et al. 1998 Henderson et al. 1999). The identified SSRs are usually 1 to 6 nucleotides in length or longer with more than 15 nucleotides with intermediate size repeats being only rarely encountered (vanBelhum et al. 1998 ). It has also been reported that the shorter unit repeats are involved in regulatory processes and are affected by slipped strand mispairing and that the longer repeats play a physical rather than a regulatory role (vanBelhum et al. 1998). The genome sequence of E. coli revealed that SSR-type regions harboring repeat units of fewer than 8 nucleotides were very rare (Blattn er et al. 1997 vanBelhum et al. 1998). DNA comprised of inverted repeats direct repeats mirror repeats and homopurine/homop y rimidine runs is also termed "defined ordered sequence DNA (dosDNA Rosche et al. 1995). DosDNA regions can be considered "hot spots for transient mispairing during D A replication allowing for slipped misalignment events to occur that may lead to changes in the translational reading frame slipped-strand
PAGE 25
15 mispairing ( Belland 1991 Rosche et al. 1995 van Belkum et al. 1998 Henderson et al. 1999). These alterations can occur within a gene to produce frame-shifts that result in stop codons leading to truncated proteins or localize in the promoter region to decrease gene expression by changing the promoter strength (Chandler and Fayet 1993 van Belkum et al. 1998 ). Additionally, the number of repeated units may be altered throu gh strand-slippage and mismatch repair during transcription (Streisinger et al. 1966 Rosche et al. 1995 van Belkum et al. 1998). Trinh and Sinden (1993) created insertion mutations that shifted the reading frame of the chloramphenicol acetyl transferase (cat) gene, and estimated the frequency of spontaneous reversion to Cmr phenotype (0.1 x 109-50x 109 ) through deletion of the mutation insert ( 17 bp) in pBR325. It was also proposed that the deletion event was mediated by slipped misalignment between flanking direct repeats during DNA replication or b y other frame-shift mutations and that longer direct repeats may increase the deletion frequency (Trinh and Sinden 1993 Rosche et al. 1995). The slipped-strand mispairing or misalignment model was proposed b y Streisinger et al. (1966) to explain the mechanism of addition and deletion of one base within a homopolym eric run of several bases Deletion and addition mutations had also been reported for one copy of the three tandem direct sequence (CTGG) that is located in the lacl gene and l ed to the extension of the Strei singer model in order to explain the deletion of DNA located between direct repeats (Farabaugh et al. 1978 Galas 1978). This type of mutation has been attributed to errors in replication caused b y the intra-strand misalignment of nonadj acent direct repeats. A hairpin stem loop structure can be formed in the template strand due to slippage of the nascent strand from the first copy of the dir ect repeat to the second copy of th e direct repeat. As a result the two direct repeats are
PAGE 26
16 brought into closer proximity and thereby facilitating primer template misalignment and leading to the deletion of material between the direct repeats and one copy of the direct repeat (Albertini et al. 1982 Ripley and Glickman 1983 van Belkum et al. 1998). Site specific inversions or insertions / deletions of DNA segments usually require a specific recombinase but some direct repeat-directed and palindrome-directed mutations are independent of RecA (Farabaugh et al. 1978 Sinden et al. 1991, van Belkum et al. 1998). The regions bordering the SSR loci are susceptible to more frequently occurring mutagenic events. Site-specific recombination is usually involved in these phase variation phenomena which differs from general homologous recombination in that substrate DNAs with considerable homology are needed and exchange can occur anywhere within the region of homology (Henderson et al. 1999). The frequency of the recombination events increases with the length of the homologous region. In addition in the general recombination pathwa y RecA is required for general homologous recombination, in contrast to site-specific reactions in which the recombining sequences are usually short and the reaction occurs at a single specific site within the recombining sequence (Henderson et al. 1999). In general rearrangements associated with SSRs are generally considered to be random but may be viewed as programmed events because the genomic organization favors the recombination (Henderson et al. 1999). Site-specific inversion of DNA segments provides a simple ON to OFF switch for genes located within or adjacent to the invertible region (Henderson et al. 1999). In these events the spatial relationship of promoters or regulatory elements with the genes they affect is altered and th e best-characterized examples of variation achieved by site-
PAGE 27
specific DNA inversions are the type 1 fimbriae of E. coli and the flagellum of Salmonella typhimurium (Henderson et al. 1999). 17 The opacity proteins ( Opa) of Neisse ria gonorrhoeae and Neisser ia meningitidis undergo both antigenic and phase variation (Meyer et al. 1990). These adhesins mediate a variety of neisserial-ho s t cell interactions including opsonin-independent phagocytosis b y profe ss ional phagocytes and invasion of epithelial cells (Dehio et al. 1998) N. gonorrhoeae may possess 11-12 opa loci scattered throughout the chromosome while N. meningitidis only 3 or 4. These are the loci that form the basis for antigenic variation in these organisms (Connell et al. 1990 Aho et al. 1991 ). Thus bacteria display either a single Opa protein or multiple Opa proteins simultaneously ( Meyer et al. 1990). The mechani s m for the phase var iation event is at the translational level as alterations occur in the reading frame of the leader sequence of each opa gene that contains a repetitive pentamer sequence (5' -CTCTT-3') which is termed the coding repeat (CR) ( Stem et al. 1986 Meyer et al. 1990 ). According to the number of CRs that are present at the time the translational read in g frame of an opa gene may be shifted as the methionine codon is (6 9 1 2 CRs) or it is not (any other configuration) in frame with the coding region of the whole molecule (Stem et al. 1986). As mentioned previously modulation of expression b y transcriptional strand slippage is a result of slipped-strand mispairing in regions outside the ORF generally occurring up stream of the gene. The Ope outer membrane protein of N. meningitidis under goes this form of regulation with the ope not only und e rgoing a phase variation event of the O / OFF t y pe but a l so volun1e control (van Ham et al. 1993 Sarkari et al. 199 4 Saunders 1 994). Phase chan g es are produc e d b y s trand s lippa ge in a stretch of
PAGE 28
cytosine bases adjacent to the promoter region of the ope gene (Sarkari et al. 1994 Saunders 1994). The number of cytosine bases that comprise the homopolymer varies and three different phenotypes exist: 12 or 13 lead to the Ope++ 11 or 14 to Ope+ (10 times less abundant) and > 15 or <10 to Ope (no ope mRNA is detected) (Sarkari et al. 1994 Saunders 1994) 18 Variation by differential methylation differs from the mechanisms of phase variation described above. This type of variation is described as epigenetic in that the phenotypes are altered but the genotypes are not. Rather than genomic rearrangements the integrity of the genome is maintained while various regulatory proteins act in concert to alter the transcription of the phase-variable gene (van der Woude et al. 1996). There are on estimate 1800 GA TC sites in E. coli that become fully methylated or are transiently hemi-meth y lated by deoxyadenosine methylase (Dam) during DNA replication allowing for a method of DNA repair and a mechanism by which bacterial and / or phage replication can be timed (Adley and Bukhari 1984, Abeles et al. 1993). Regulation of certain g enes can occur by differential protection from methylation of such sites (Ringquist and Smith 1992 Hale et al. 1994). That mechanism was reported and studied extensively in the regulation of P fimbrial expression in uropathogenic E. coli which undergoes reversible phase variation at 37 C while at temperatures below 26 C expression is shut off (Blyn et al. 1990 van der Woude et al. 1996). Phase variation has been characterized in E. coli strains with group IA capsular K anti g ens ( Drummelsmith et al. 1997). A pair of insertion sequences (ISJ) flanks manC1 -manB1-ugd region in E. c oli providing a mechanism for gene replication Another example is found in div ision I Ha e mophilus influ e n z a e strains with capsular
PAGE 29
polysaccharides belon gi ng to serotypes a to d (Kroll 1992). In these strains, the cap (capsule bios y nthesis ) locus is flanked by ISJOJ6 elements, which might explain the recombination-mediated amplification in cap occurring in some clinical isolates (Kroll 1992). 19 Vibrio cholerae is also a member of the Vibrionaceae family and has been invol ve d in 8 pandemics throughout the world. There are multiple defined serogroups of V cholerae and until 1992 only V c hol erae 01 was recognized as a major human pathogen However in late 1992 in Bengal a novel V cholerae serogroup 0139, was isolated and literally replaced V cholerae O 1 as the major cholera serogroup (Stroeher et al. 1998). V cho l erae 0139 serogroup is essentially the same as V cho l erae 01 o f the El Tor biotype with the acquisition of a new O-antigen and capsule (Johnson et al. 1994 Karaolis et al. 1994 Manning et al. 1995 Bik et al. 1995 Comstock et al. 1995 Stroeher et al. 1995 Bik et al. 1996 Comstock et al. 1996 Stroeher et al. 1997 Stroeher and Manning 1997). V cholerae 0139 serotype emerged from the V cholerae 01 by a relatively precise replacement of the original V cholerae 01 rfb (or wb*) region ( Manning et al. 1995 Comstock et al. 1995 Bik et al. 1995 Stroeher et al. 1997 Stroeher and Manning 1997). The V cho l erae O l /013 9 rfb region contains an IS element that probably provided the portable region s of homology within non-homologous regions for genetic rearrangements to occur (Mooi and Bik 1997). Finally, these mobile elements have the ability to become associated with specific ge nes and to translocate them as well as to induce various ge netic reorganizations including insertions deletions a nd inversions (S imon et al. 1980).
PAGE 30
20 Focus of the Present Study The genetic basis for V vulnificus pha se variation is not known. Recently a group 1-like CPS operon was identified through transpo son mutagenesis, and it was demonstrated that the wza gene was required for su rfac e assembly of the CPS (Wright et al. I 999). This highl y conserved gene encodes a lipoprotein that fom1s multimeric structures in the outer membrane (Wh itfield and Roberts 1999). Genomes of most (90%) encapsulated V v ulnificus strains (90%) contained the w zavv, while translucent strains were less likely to be positive for this gene (50%) and exhib ited genetic rearrangements at this locus as indicated by Southern analysis of phase variants (Wright et al. 2001 ). Group 1 CPS homologues in other strains are generally followed by w z b and wzc and the presence of wz a-wzb-wzc homologues identifies group 1 CPS operons in E. coli (Drummelsmith and Whitfield 1999). Examination of phase variants of different strains of V vulnificu s suggested that the group 1 CPS locus might be a site for genetic rearrangements that correlated w ith a phase shift Therefore the present study completed the DNA sequence of the CPS operon to confirm homology to other group 1 operons and genetic anal y sis was performed on several phase variants to investigate the relationship of CPS operon genetic instability to phase variable phenotypes. Specific Aim 1: Investigate Gene Organization in V. vulnificus CPS Operon Wright et al. ( 2001) identified a group 1-like CPS operon through transposon mutagenesis and demon s trated that the w z a gene was required for surface assembly of the CPS. Group 1 CPS operons have been described for a number of gram-negative species and are g en e rall y organized into contiguous regions containing a 5' locus with hig hly conserved gene s ( w z a w z b and w z c) involved in the translocation and surface assembly of the CPS to th e cell surface. These conserved genes are followed by the
PAGE 31
21 polymorphic region with genes for CPS biosynthesis and polymerization ((Drumme l smith and Whitfield 1999 Whitfield and Paiment 2003) The presence of wza in V vulnificus MO6-24 / O strongl y indicated the presence of a group 1 operon but identification of the rest of the translocation and surface assembly genes (wzb, and wzc) was needed to validate that h ypot he s is For the identification of the entire V vulnificus MO6-24 / O CPS operon we used a combination of transposon marker-assisted cloning using insertions in the CPS operon from the Wright et al. (2001) study and PCR amp lific ation of DNA with previously described primers (Wright et al. 200 l ), newly obtained sequence from this study, as well as sequence provided b y Dr. Paul Gulig at the University of Florida. Specific Aim 2: Examine the Conservation and Distribution of CPS Genes Among V. vulnificus Strains, Vibrio spp. or Different Species Group I CPS operons have been described in a number of gram-negative microorganisms with highly homologous organization. Interestingly the conserved genes (wza, wzb and wzc) were found in uninterrupted succession but in V vu lnificus MO624/O wza and wzb were interrupted by a hypothetical protein. Thus, DNA sequence comparisons of the organization of the CPS operon genes among V vulnificus strains, Vibrio spp. or different gram-negative species (E. coli) would allow for the identification of particular patterns th at might be specific to the species. During this study two separate sequencing projects were taking place that l ed to the publication of two V vulnificus genomic sequences from strains CMCP6 and YJ016 (Chen et al. 2003, Kim et al. 2003) increasin g the available ge nom e pool for study.
PAGE 32
22 Specific Aim 3: Examine the Genetic Basis for Phase Variation V vulnificus exhibits phase varia tion a phenomenon that functions under an unknown mechanism. To characterize and identify the mechanism(s) of the phase variation phenomenon variants o f different V vulnificus strains were examined for sequence divergence in the CPS operon. It would also be interesting to examine the le vel of conservation among the CPS translocation and surface assembly genes (wza wzb wzc). Add ition ally restriction fragment length polymorphism of the entire or parts of the V vulnificu s CPS operon wou ld be a quick easy and cheap alternative to DNA sequencing for comparison of various phase variants of a single strain.
PAGE 33
CHAPTER2 MATERIALS AND METHODS Ba c te ri a l Str ains and C ultur e C on di t io n s V vulnificus strains (Table 1) were grown in Luria Bertani broth (LB, Difeo) or LB agar with l .0% tryptone 0 .5% yeast extract and 1.0% NaCl. The strains were incubated at 30C or 37 C with vigorous agitation overnight. All culture strains were stored at-70 0 C in LB broth w ith 50% (w/v) glycerol. When antibiotics were required kanamycin (50g/ml), tetrac y cline (50g / ml) or polymyxin (50g / ml) were added to cultures of V vulnificus E. coli S 17-1 A pir (Simon et al. 1983) was used for complementation experiments. All media were purchased from Difeo (Detroit, MI), and reagents were purchased from Sigma Chemicals (St. Lou i s MO). DNA C l o n ing DNA encompassing the entire group l CPS operon of V vulnificus MO6 24/O was recovered by a combination of transposon marker-assisted cloning and DNA amplification by PCR. DNA sequence from other strains was recovered by direct sequencing of PCR products. Genomic DNA from the transposon mutant V vulnificus CVD 737 (Wright et al. 1990) was obtained with the use of QIAmp DNA Mini Kit (Qiagen). Digested fragments with BamHI enzyme (Promega, for reaction condit i ons see RFLP section) of ge nomic D A were cloned into pBluescript SK (Promega) according to the manufacturer's instructions Then, 4 l was taken directly from the ligation mixtures and was transformed into chemically competent cells E. coli JM109 (Promega) according to the manufacturer's instructions. 23
PAGE 34
Table 1. CPS phenotype of V vuln(ficus strains Bacteria MO6-24 / O MO6-24 / T CVD752 CVD737 LC4 / O LC4 / T 345 / T Description Encapsula ted clinical isolate Tl translucent phase variant of MO6-24 with reduced CPS expression Acapsular TnphoA mutant of M06-24 / O with insertion in wza (Wright et al. 2001) Acapsular TnphoA mutant of M0624 / O with insertion in ORF5 (Wright et al. 2001) Encapsu lated clinical isolate T2 translucent phase variant of LC4 / Owith no CPS on the cell surface Environmenta l acapsular strain 24 The various E. coil JM 109 clones were screened for the kanamycin resistance marker on the TnphoA transposon that had been previously introduced into the CPS operon of V vulnificus MO6-24 / O (Wright et al. 1990 ). Plasmids from the various transformants were extracted with the Wizard Plus Minipreps DNA Purification Systems (Promega). Add ition a l screening of the clones was performed at this point by enzymatic digestion (BamH I Promega) in an effort to identify those with the highest s i ze insert. The digests were recovered by agarose gel (1 % w / v) after electrophoreses and visualization with ethidium bromide. DNA from the appropriate clones was concentrated by ethano l precipitation and was sent for sequencing with the use of T3 and T7 primers that are part of the pBluescript SK plasmid. PCR amplification was achieved with previously described primers (Wright et al. 2001 ) newly obtained sequence from this study as well as sequence provided by Dr. Paul Gulig at the University of F lorida. PCR amplifications were performed with 10 0 ng of DNA per 25 reaction and eit her Taq DNA polymerase (Eppendorf) for routine PCR
PAGE 35
25 reactions (product sizes < 6Kb) or Expan d Long Template PCR System (Roche) for lon ger amplicons. All PCR reactions were carried out using a thermocycler (GeneAmp PCR System 2400, PERKIN ELMER, or Mastercyclergradient Eppendorf) under the following conditions: incubation at 94 C for 5 min 25 cycles of 94 C for 1 min 56 C for 1 min and 72 C for 1 min with a final 7 min extension at 72C or for longer amp lico ns according to the manufacturers instructions (Roche). Amplified products were visualized on an agarose gel (0.5 to 3%) with ethidi um bromide and DNA was obtained from the band s and purified with the use of Ultrafree-MC Centrifugal Filter Devices (Millipore). Alternatively the PCR products were purified directly from the PCR reactions with the GENECLEAN KIT system (Q -BIO gene). The purified amplicons were subsequently cloned in pGEMTEas y ( Promega) and pBluescript SK (Promega) vectors and then both were introduced into chemically competent E. coli JM109 cells (Promega). DNA Sequence Analysis D A was sequenced at the ICBR core facility at the University of Florida. Nucleotide sequence identity searches and alignments were done with the TF ASTA, F ASTA or PILEUP program (GCG Wisconsin Packa ge) or BLAST (National Center for Biotechnolog y Information). Restriction Fragment Length Polymorphism Identification of possible differences located downstream from the CPS operon was performed b y P C R amplification. Primers that originated downstream from the conserved CPS re g ion (after wzc) were used to amplify that region and the amplicons were analyzed by restriction fragment l ength polymorphism. The bacterial strains that were us e d for this part of the st ud y were MO6-24 / O and the translucent phase variant MO6 24/T. DNA from these stra in s was amplified b y PCR (as mentioned above) y ieldin g two
PAGE 36
26 portions of the downstream region of the operon. The first one was an 8-Kb fragment originating from wzc to wbjB with primers wzce2 : aagagattgatgtagcgcgcag and 737B: cgagtccatatactactcgt and the second an 11-Kb fragment with primers 737C: gctcatcatatacctgagca and ugdB: ctcaatatccacatctacgatag that covered the region from wbjB all the way to the end ugd. The amplicons were then digested with four restriction enzymes (Alul Rsal HaeIII and Hin.fl, Promega) with the following reaction mixtures: 0.5 g of DNA 2 l of Buffer 1 l of enzyme in total volume of20 The digestion mixtures were incubated at 37C overnight and were visualized on an agarose gel (2%) with ethidium bromide. Complementation of wzbvv in V. vulnificus M06-24ff Phase Variant PCR products of MO6-24 / O and LC4 / O containing the wzb gene as either a 1-Kb (752K ggttgatcagataacgcgaa and wzb l-aaggaatacaagcgtcta gg) or 3.6-Kb (B712K gcgaggatccagcaacttacgttcactt and Pwzb 1-gttacccgggaatacaagcgtctaggt) fragment without or with upstream sequences respectively. Either pGEMT-Easy (Promega) or TOPO TA (Invitrogen) cloning vectors were used for the 1-Kb and 3.6-Kb respectively. The ligation reactions were performed according to the manufacturer s instruction and then 4 l of the ligation mixtures were introduced into chemically competent E. coli JM 109 (Promega). Screening of the insert-containing clones was performed with blue / white selection (Promega) of the grown colonies on the appropriate antibiotic plates. The plasmids of the desired colonies were extracted (as described previously) and were Eco RI and BamHI-digested (as mentioned previously). Restriction fragments containing the w z b were further lig at e d into pRK404 p la smid (same as with other plasmids) and subc lon ed into conjugation-competent E. coli S 17-Apir (Simon et al. 1983) to yield pWZBl
PAGE 37
27 (without upstream sequences) or pWZB3.6 (with upstream sequences) plasmids. Recombinant DNA was introduced into translucent V vulnificus LC4 / T (T2) as previously described (Wright et al. 2001) through conjugation, and transconjugates were plated to LB agar plates containing tetracycline (1 Og/ ml) and polymyxin (50g/ml) and were observed for colony morphology Complemented strains were selected by reversion to opaque colony morphology and confirmed by DNA sequencing as described above. E l ect r o n M i croscopy V vulnificus cells were recovered from overnight growth on agar plates and negatively stained with osmium vapors (Os04 Ted Pella, Redding, CA). A loopfull from the bacterial culture plate was used to inoculate a drop of LB broth on 300mesh copper microscopy grids (Ted Pella Redding CA) coated with plastic membrane. The grids were secured with double sided sticky tape on a microscope slide and were placed in an osmium chamber without coming in contact with the osmium droplets They remained in the chamber for 45 min to fix and negative l y stain the bacterial samples. Lastly grids were washed gently once with water and l et to dry for 10-15 min before visualization. The samples were visualized w1der a transmission electron microscope Zeiss EM-10 CA at 80 Kv
PAGE 38
CHAPTER 3 RESULTS: SPECIFIC AIM 1 Rationale for Study As mentioned previously Wright et al. (2001) identified a gene with homology to wza of E. coli K30 (Drumme lsmith and Whitfield 1999) that was required for surface assembly of the V vulnificus CPS. According to Drummelsmith and Whitfield (1999) all group 1 CPS operons contain wza wzb wzc homologues leadin g to the assumption of a group I-like CPS operon present in V vulnificus MO6-24 / O (Wright et al. 2001 ). The presence of all three conserved genes will strengthen the assumption that in V vulnificus MO6-24 / O a group l CPS operon is present. Thus sequencing of the entire CPS operon would help us assign with certainty the CPS type. Genetic Organization of V. vulnificus Group 1-like CPS Operon Group 1 CPS operons have been described for a number of gram-negative species (Drurnmelsmith and Whitfield 1999, Whitfield and Paiment 2003) and are generally organized into contiguous regions containing a 5' locus with highly conserved translocation and surface assemb l y genes (w z a w z b and w z c) of the CPS to the cell surface followed by the polymorphic region with genes for CPS biosynthesis and polymerization (Drummelsmith and Whitfield 1999). T he CPS operon described for the group 1 prototype isolate (E. coli E69 O9a: K30) consists of 12 open reading frames (Figure 2D, Drummelsmith and Whitfield 1999, Rahn et al. 1999), which are divided into two regions by a transcriptional attenuator (Rahn and Whitfield 2003). 28
PAGE 39
29 Cloning and PCR amplification allowed sequencing of the entire CPS operon for V vulnificus MO6-24 /O. The genetic organization of the operon demonstrated homology to the other group l operons (Figure 2). The previously identified wzavv (AAL09161, Wright et al. 2001) was followed by the well-conserved wzbvv (56% deduced amino acid identity to the putative acid phosphatase Wzb of E. coli) and wzcvv ( 42% deduced amino acid identity to the Wzc tyrosine -protein kinase of E. coli). The conserved CPS translocation and surface assembly genes that usuall y localize the 5' region of V vulnificus operon followed the polymorphic 16-Kb gene cluster responsible for the biosynthesis and polymerization of the capsule. As a result genes upstream of the attenuator include wza wzb wzc, while downstream genes encode serotype-specific glycosyltransferases and other components of the Wzxand Wzy-dependent polymerization pathwa y (Rahn and Whitfield 2003). The presence of wza wzb wzc homologues confirmed the identity of this operon in V vulnificus as these ge ne s are indicative of group 1 CPS operons in E. coli and other species (Drummelsmith and Whitfield 1999). Examination of multiple CPS operons from different strains of V vulnificus showed similarities in the genetic organization (Figure 2). Genomic sequence from GenBank for V vulnificus strains CMCP6 (Kim et al. 2003) and YJ016 (Chen et al. 2003) also indicated the presence of wza-wzb-wzc homologues and confirmed group 1 operons as common to the species.
PAGE 40
A) V v 11/11ific11 s MO 6-24/0 C P S Transport Genes 11 CPS Biosynthetic Genes ORFXwza HPI wzb wzc wecC wbpP wzxHP2Hl'3rfaGwbj8 r111/DwbjDwb118 wbfTwbfU wbfYwbfV .._. IJ, IJ, IJ, .__. H 1 B I S H E I I I C J C Lt IOKb 2~b B I B) V v11/11ifi c11sCMCP6 C P S Transport Genes 1 1 C P S Biosynthetic Genes ORFX w z a HPI w z b wzc wecB wecC wciJ wbjF wbjT wbpH wbfY wbfV IJ, IJ, IJ, IJ, IJ, ... ... ... ... ... ... ... ... ... ... ... ... C) V. v11/11ific11s YJ016 I CPS Trans1,ort Genes II C P S Biosynthetic Genes 0 R FX w z a HP I w z b wzc wec B wecC wzx wbpX wbdB gmd wcaG wbdQ 111a11C 1110118 wbpG his Ii his F weeE weeF weeG wee Ii pg/8 pg/C wbfY wbfV ... ...,.__... D) V. cholerae O 139 gmhD wbf IIJ,AIIJ,BIIJ,DIIJ,C IIJ,E ......... IS/538 IJ,w z mlllJ,wzzlllJ,~,"'dlJ,HIJ, I E) coli Group I Operon (KJO) CPS Transport Genes 11 K CPS/LI'S Genes lllJ, L IIJ,M IIJ,N IIJ,O IJ, P lllJ, Q lllJ, R lllJ, S .:11a11C IIJ,ma118 lllJ, T lllJ, CPS Biosyothctic Genes w zi wza wzb wzc wbaP wzy orfY wcaN wcaO orfZ wbaZ wzx g11d IS I ugd ma11B 111 a11C ... ..,v _,w..,x ..,v.., Figure 2. Organization of CPS operons. A) V. vulnificus M06-24/ 0 group-I CPS B) V. vu lnificu s CMCP6 group-I CPS: gap demonstrates th e absence of gene homologies for the ORFs present C) V. vulnificus YJ016 group1 CPS D) V cholerae 0139 CPS and E) E.coli K30 group 1 CPS prototype. Spaces between genes are not in scale w 0
PAGE 41
31 Further a hybridization study using a wza gene probe indicated group 1 operons were present in the great majority of encapsulated V vulnificus strains ( Wright et al. 2001). Although all V. vulnificus operons contained wbjY and wbfVhomologues at the 3' termini, the biosynthetic regions among these strains were, as expected, polymorphic and reflected the diversity of the polysaccharide structures that has been observed for this species (Hayat et al. 1993). Identification of Genes for CPS Biosynthesis in V. vulnificus M06-24/0 The CPS translocation and surface assembly genes were followed by the polymorphic region that contains genes for the biosynthesis of group 1 CPS (Ta ble 2). The repeating unit of the V. vulnificus MO6-24 / O CPS polymer was comprised oftbree quinovosamine (QuiNAc) and one galactosamine (GalNAcA) sugar residues (Reddy et al. 1992). The aforementioned monosaccharide components are not present in the E. coli K30 group 1 CPS however GalNAcA was found as a linear homopolymer in the Vi CPS of Salmonella typ hi and S. paratyphi C ( Redd y et al. 1992 Daniels et al. 1989 ) Both QuiNAc and GalNAcA have been identified in O-specific chains of LPS of P. aeruginosa strains (Kaya et al. 1989). Detailed summary of indi v idual genes, their homologues and function are shown in Table 2, wit h all of the ORFs of known identity exhibited homology to genes related to either the biosynthesis of CPS or L PS. The first gene in the polymorphic region aligned with deduced amino acid sequence to a UDP -N-acet y l-D ga lacto samine dehydro ge nase.of V. vulnificus (wbpO 97% identity) and a lso al igned with the conserved domain for WecC/Ugd enzymes (NCBI/CD COG0677 / COG1004.1 95.4% and 99.8 % identity with 436 and 414 of 441 amino acids respectively) a predicted UDP-mannose or glucose 6-dehydrogenase responsible for the production of U DP-
PAGE 42
32 uronic acid sugars or aminosugars. The predicted U gd protein product was shown to be necessary for E. coli K30 antigen synthesis with glucose, galactose and mannose sugars in its repeating CPS unit (Drumrnelsmith et al. 1997). Following was a gene with deduced amino acid homology to wbqB/wbpP (73%/71 % identity), a putative UDP glucose-4-epimerase part of the E. coli O 121 O antigen gene cluster and a biosynthetic gene in the B-band O antigen of P. aeruginosa serotype 06 LPS respectively (Raymond et al. 2002 Fratamico et al. 2003). This V vulnificus gene also gave an alignment (52.5% identity) with the conserved domain for WcaG enzyme (NCBI/CD COG0451), a nucleoside-diphosphate-sugar epimerase, responsible for carbohydrate transport and metabolism that is found in the E. coli K-12 colanic acid with fucose glucose and galactose sugar residues and isolates with group 2 capsules (Stevenson et al. 1996, Whitfield and Paiment 2003). The B-band of P. aeruginosa LPS is a repeating linear tetrasaccharide consisting of QuiNAc and GalNAcA sugars also found in the V vulnificus MO6-24 / O capsule. A knockout mutant of that wbpP in Pseudomonas led to B band deficiency which was cross-complemented by a salmonella Vi CPS homologue, wcdB encoding a ADP-dependent enzyme required for synthesis of the GalNAcA homopolymer (Houng and Venkatesan 1998). These data indicated that wbpP is taking part in the biosynthesis of UDP-GalNAcA. The sequence downstream of wbpP had only limited deduced amino acid alignment (22% identity 42% similarity) to the Wzx protein of Streptococcus thermophilus a conserved flipase in the Wzy-dependent pathway (Broadbent et al. 2003). This protein was shown to be required for the transport of the lipid-linked group-I K30 capsule units across the plasma membrane to the periplasmic space in E. c oli (Drumrnelsmith and
PAGE 43
33 Whitfield 1999). The wz.x gene was reported previously for a CPS related locus of another V vulni.ficus strain (Smith and Siebeling 2003); however, the genetic context differed as it was flanked by two genes with homology to wcvF (24% identity, AAC70778) and wcvG ( 18% identity AF048749) which encode rharnnosyl and glycosyl transferases respectively. Interestingly wzx (19% identity, AAC32342) was present only in one of the two published genomes and the wzy was not found only in the V vulni.ficus 1003 (Chen et al. 2003 Kim et al. 2003, Smith and Siebeling 2003). The NCBI/CDD gave an alignment (100% NCBI/CD pfam0 1943) with a polysaccharide biosynthesis protein with members of this family being integral membrane proteins (Rfbx protein is a member of that fan1ily and is involved in the export of O antigen and teichoic acid). The sequence following wzx showed deduced homology (29% identity, 48% similarity) to a hypothetical protein (HP) from the marine planctomycete Pyrellula sp. Strain 1 (Glockner et al. 2003) and contains a protein signal peptide and transmembrane prediction domain. This gene was followed by one with deduced amino acid sequence homology to the HP-ORFl0 (28% identity 46% similarity) in the wb* cluster of the 037 serogroup O-antigen biosynthesis of V cholerae which encodes a glycosyl-transferase enzyme involved in polysaccharide biosynthesis (Li et al. 2002). I s a unique gene in the 03 7 wb cluster with no significant homology to the previous l y published V cholerae wb* cluster sequences (Li et al. 2002) The gene product of the next ORF was homologous (36% identity 52% similarity) to a probable mannosyltransferase B wbdB, in K. pneu monia e OS-antigen LPS (homopolymer of mannose residues) and the NCBI/CDD gave an alignment (91.3%, NCBI/CD pfam00534) with a glycosyl transferase 1 or waaG (fo rmerly ,faG) in O157:H7 (Kido et al. 1998 Merino 2000,
PAGE 44
34 Shimizu et al. 2002). According to the NCBI/CD, members of the glycosyl transferases group 1 family transfer activated sugars to a variety of substrates, such as fructose-6 phosphate and lipopol ysac charides. The structure of the O 157 polysaccharide is unbranched and linear with a tetrasaccharide repeating unit: [-3)-a o-GalNAcp -(1-2)-a oPer Acp-(1-2)a-L-Fucp-(1-4) P-o-Glcp-(1-]n (Perry et al. 1986) and these enzymes are necessary for core-elongation of the LPS (Barua et al. 2002). The WaaG protein is a U DP-glucose: lipopolysaccharide a 1 3 gl ucosyltrasnsferase that adds glucose I to heptose II of the core oligosaccharide of LPS, and loss of the gene resulted in absence of the outer core oligosaccharide of LPS (Barna et al. 2002). The next four ORFs were homologous to genes with deduced amino acid homologies to genes in vo lved in the production of quinovosamine and galactosaminouronic aci d polysaccharides. The first gene was homologous to an epimerase/dehydratase enzyme (85% identity 94% similarity) of V. cho l erae O37antigen biosynthesis (ORF 7 Li e t al. 2002) and WbjB protein of Ps eudomonas aeruginosa (75% identity 84 % similarity). WbjB was involved in polysaccharide biosynthesi s in the surface pol ysa ccharide structures of P. aeruginosa O 11 strain PA 103 O-antigen which possesses two fucosamine and one gl ucose sugar residues and is homolo gous to cap5E gene of Stap h ylococcus aureus Type 5 CPS biosynthetic loci (Dean et al. 1999 ) Such homology is not surprising as they all have in common the presence of N-Acety l -L-fucosami n e residue in their structures. WbjB / Cap5E are moderately homolo gous to WbpM of P aeruginosa in vo lved in UDP-N-acetyl-o fucosamine / quinovosamine biosynthesis from U DP-o-GlcNAc. Thus it is the first enzyme in the fucosan1ine pathway and is involved in the deh ydra tion and epimeri z ation
PAGE 45
35 of the UDP-o-GlcNAc (C reuzenet and Lam 2001). The NCBI/CDD gave an alignment (83 8% NCBI/CD COG0451) with WcaG which belongs in a family of nucleoside diphosphate-sugar epimerases, members of which are involved in carbohydrate transport and metabolism. W caG is also found in the E. co li K-12 colanic acid with fucose glucose and galactose sugar residues and isolates with g roup 2 capsules (Stevenson et al. 1996 Whitfield and Paiment 2003). The V vulnificus wbj B gene is followed by two genes with homologies to wbjC and wbj D of P. aeruginosa 011 strain PA103. These two genes are homologues of cap5F and cap5G and follow cap5E in S. aureus group 5 CPS all of which are involved in the biosynthesis of O-antigen and capsule respectively (Kneidinger et al. 2003). Knockouts of cap5E or cap5G resulted in acapsular S. aureus mutants (Wann et al. 1999 Kneidinger et al. 2003). In V vulnificus MO6-24 / O operon a homologue (68% identity 81 % similarity) to deduced amino acid sequence of genes wbj D was present but not wbjC as seen in the putative L-FucNAc biosynthesis pathway. WbjD shows homology to UDP GlcNAc 2-epimerases invo lved in the biosynthesis of U DP-ManNAc yielding a mixture of UDP-L-PneNAc and UDP-L-FucNAc (Kiser et al. 1999) However a gene with homology to Rm!D (65 % identity 78 % similarity) replaced wbjC and was located between wbJBvv and wbJDvv in V vulnificus MO6-24 / O. This protein catalyzes the reduction of a h ex ulo se intermediate to dTDP-L-rharnnose (Kneidinger et al. 2003). Bacterioides fi'agilis NCTC9343 capsular pol ysacc haride B ( PS B) is composed of the repeating unit [ 4)-L-QuipNAc( 13)-D-QuipNAc(l 4 )[-L-Fucp(l 2) D-GalpA(l 3)-D GlcpNAc(13)]-D-Galp(l ] which lacks L -FucNAc or L -PheNAc but interestingly also has genes hi g hl y s imil ar to w bjB and wbjD of P. aeruginosa serotype 011 that flank rm!D
PAGE 46
36 (Coyne et al. 2000, Kneidinger et al. 2003). The intervening gene replaces wbjC, probably because there is no fucosamine present in the CPS of the V vulnificus MO624 /O. Substitution of wbjC has been observed before in clusters containing the wbjB/capSE / wbvB and wbjD/cap5G l wbvD genes (Kneidinger et al. 2003). This gene is part of the rmlA-D pathway of dTDP-L-rhamnose in V cholerae O antigen. L rhamnose is commonly present in O antigens of gram negative bacteria and capsular polysaccharides of gram-positive bacteria (Li et al. 2002). dTDP-L-rhamnose is the activated form for the rhamnose moiety in both O antigen and CPS biosynthesis (Li et al. 2002). The synthesis of dTDP-L-rhamnose from D-glucose I-phosphate is catalyzed by four enzymes encoded by rm/A rmlB, rmlC, and rmlD genes which are generally grouped within O antigen or CPS gene cl u sters and present always when rhamnose is in the structure (Bik et al. 1996 Stroeher et al. 1998 Li et al. 2002). The next gene in the polymorphic region was wbuB vv, which showed homology to a putative L-fucosamine transferase WbuB in the O antigen gene cluster of E. coli 026 (51 % identity 67% similarity) (D'Souza et al. 2002). The 026 0 antigen contains the sugars L-rhamnose (L Rha) N -acetyl-L-fucosamine (L-FucNAc) and N-acetyl-o-glucosamine (L-GlcNAc) (Manca et al. 1996). They suggested that it is responsible for the linkage a-L-FucNAc-(13)a-GlcNAc The last four genes showed homology to the wbfF (66 % identity, 81 % similarity ), wbjU (8 I% identity 90% similarity) wbjY (70 % identity 8 2% similarity) and wbjV (72% identit y, 84% similarity) respectively of V chol e rae O 139 0 antigen biosynthesis (Yamasaki et al. 1999 ) The structural configuration of the sugar moieties of O 139 LPS contains the trisaccharide GlcNAc-GalA QuiNAc (Yamasaki et al. 1999). Interestingly
PAGE 47
37 Table 2. Homologues for the V vuln(ficus genes in the group 1 CPS operon Siz e Amino Accession Species Gene acid Description (bp) identitl no. (reference) V vulnificus ORFX 244 100 Function unknown NP 759762 CMCP6 (Kim et al. 2003) Periplasmic V vulnificus wza 1287 100 protein cps AAL09161 MO6-24 transport (W right et al. 2001) V vulnificus Hypothetical CMCP6 HP 212 69 AE016799 (Kim et al. 2003 protein Simpson et al. 2000) wzb 444 98 Protein-tyrosineNP 933132 V vulnificus YJ016 phosphatase (Chen et al. 2003 ) Putative tyrosine V vulnificus wzc 2275 92 NP 759758 CMCP6 protein kinase ( Kim et al. 2003) wbpO / U D P-N-acety 1-DV vulnificus 1323 97 gal actosamine AAQ17507 wecC deh y drogenase (Park et al. 2003) wbp P 7 1 U DP-glucose-4AAM27817 P aeruginosa 1079 (AA O39691 (wb qB ) (73) epimerase ) (Raymond 2002) Putative S t rep th er mophilus wzx 934 22 involvement in AAL32506 (Broadbent et al. exopolysaccharide 2003) Hypothetica l Pir e lula sp transmem bran e HP 4 19 29 protein with signal NP 86 475 8 (G loeckner et al. peptide 2003) HP 1 204 29 GlycosylAAM 225 98 V cholerae 03 7 transferase ( Li et a l. 2 00 2)
PAGE 48
38 Table 2. (Continued) Size Amino Accession Species Gene acid Description (bp) identitl no. (reference) wbdB Probable mannosyl -K. pneumoniae waaG 1227 36 transferase B / AF 189151 (Shimizu et al. (rfaG) putat i ve g l ycosyl 2002, Merino et transferase al., 2000) wbJBI 85 Epimerase/ AAM22595 V cholera 037 1125 (Li et al. 2002, wcaG (75) dehydratase (AAF72954) D ean et al. 1999) dTDP-4V cholera 037 rmlD 923 65 dehydrorhamnose AAM22596 (Li et al. 2002 reductase Manrong et al. 2002) UDP N -P. aeruginosa wbjD 1159 66 acety l g ucosamine AAM27787 (Raymond, 2002, 2 ep i merase Dean et al. 1999) Putative L -E.coli 026 wbuB 1096 51 fucosamine AAN60464 (D'Souza et al. transferase 2002) Probable UDP V cholerae 0139 wbfr 964 66 galactose 4BAA33610 (Yamasaki et al. ep1merase 1 999) Probable galactosy l V cholerae 0139 wbjU 552 81 BAA33641 (Yamasaki et al. transferase 1999) V cholerae 0139 Predicted V vulnificus wbjY 1958 70 nucleosideBAA33644 YJ016 (97) diphosphate sugar (NP 759752) (Yamasaki et al. ep1merase 1 999 Chen et al. 2003) V cholerae 0139 V vulnificus wbjVI 72 Predicted UDP CMCP6 1194 g lucose 6BAA33642 (Yamasaki et al. Ugd (97) dehydrogenase (NP 759751) 1999 Kim et al. 2003) a Identities are based on the Protein BLAST.
PAGE 49
39 the wbjV gene also exhibite d 100 % align ment (accor di ng to the NCBI Conserve d Domain Search) with Ugd deh ydroge nase (COG10 04.1 Ug d). Comparison of the CPS Operons Among Vibrio Species In late 1992 in Bengal a novel V cho l erae serogro up 0139, was isolated and literall y replaced V cholerae 01 as th e major cholera serogroup (Stroeher et al. 1998). V cho l erae O 1 39 serogroup is essentially the same as V cho l erae O 1 of the E l Tor bio type with the acquisition of a new O-antigen and capsule (Johnson et al. 1994 Karaolis et al. 1994 Manning et al. 1995 Bik et al. 1995 Comstock et al. 1995 Stroeher et al. 199 5 Bik et al. 1996 Comstock et al. 1996 Stroeher et al. 1 99 7 Stroe her and Manning 1997). It has been shown that the O 1 39 LPS can be described as semi -rou gh as it appears to have on l y a single O-antigen repeat unit (Manning et al. 1995). F urth ermo r e, V cholerae 0139 has been reported to have capsular material (Waldor et al. 19 94) and prod u ces two co l ony morphologies opaq u e or translucent as is seen in V vulnificus MO6 24 (Johnson et al. 1 994 Weintraub et al. 1 994). The O-anti ge n of the V cholerae O l LPS i s a homopolymer of 4 -amin o -4 6dideox ymannose (perosam in e ) which is substituted wit h 3-d eoxy-g ly cero-tetronic acid (tetroate) (Kenne et al. 1982). The LPS a l so contains ano ther sugar known as quinovosamine Th i s sugar i s found in a ratio of approximately 1 to 20 compared to p erosami ne and is thought to either cap t h e O-antigen or the core oligosaccharide. Quino vosam ine is also found in V chole ra e 0139, which has a complete ly different O antigen composition (Figure 2D) (Stroeher et al. 1998 ) and in the CPS of V vulnificus MO6-24 ( Redd y et al. 1 992). The sugars found in the LPS of V cholerae O 139 are primarily colitose glucose h eptose, fructose glucosamine and quinovosamine (Knirel et al. 1 995 Pr eston et al. 1995).
PAGE 50
40 The genetic region required for the biosynthesis of the V cholerae 0139 O-antigen is the rjb operon and contains the insertion sequence ISJ 358 (Manning et al. 1995, Stroeher et al. 1995 Fallarino et al. 1997). The ISJ 358 element previously associated with V vulnificus CPS expressio n and was conserved among LPS operons of other serotypes as well as in V anguilllarum. Highl y co nse rve d regions flank the O 139 CPS region and are homologous to LPS loci in other V cholerae strains, suggesting that V cholerae 0139 arose from epidemic 01 El Tor strain by homologous recombination with DNA from a non-patho ge nic donor (Stroe her et al. 1998 Sozhamannan et al. 1999). As both CPS and LPS are heterogeneous among most V vulnificus strains perhaps line ages with recombinant CPS/LPS loci will become apparent as more genomic sequence and polysaccharide structure become available. IS elements were previously associated with CPS genes in one strain of V vulnificus (Smith and Seibeling 2003) In this study several IS elements were linked to CPS-related genes and variability in geno mic location was observed between translucent and opaque variants. However the relationship of these loci to a particular operon or the relationship of IS elements to CPS gene expression was not demonstrated. Our sequence and other genomic sequence did not identify any IS elements associated with group 1 loci but the possibility exists that IS e lements may be relevant to phase variation for other types of CPS operons in V vulnificus Upstream of the rjb operon the JUMPstart sequence is present described by Hobbs and Reeves (1994) which has regulatory function (Bailey et al. 1997). The JUMPstart region is found upstream of most polysaccharides and not surprisingly was upstream of wza in V vulnificus MO6-24 / O (Wright et al. 200 1) Thus in V cholerae 0139 the
PAGE 51
41 biosynthesis of the capsular material and the LPS occurs at the same region and both are comprised of the same sugars their only difference is that the O-antigen is attached to the lipid A-core (Waldor et al. 1994). The surface polysaccharide biosynthesis region of the V cholerae O 139 surface polysaccharide is complex as is also seen in V vulnificus MO624. Mutational analysis has shown that there are some genes involved in both capsule and O-antigen biosynthesis as well as genes specific for either capsule or O-antigen (Waldor et al. 1994 Comstock et al. 1995 Stroeher et al. 1995 Bik et al. 1996 Stroeher et al. 1997). Although V chol e rae O 139 has a CPS the genes for the translocation and surface assembly were different from those seen in group 1 operons. Additionally a stretch of highly conserved genes is located on the 3' end of the operon which is common for both V cholera e O 1 and O 13 9 rjb region. Wbtu is a galactosyl transferase, Wbe W in V cholerae O 1 and a mutation in this gene affects O-antigen synthesis (Fallarino et al. 1997). Stroeher et al. (1998) hypothesized that the UDP-galactose which is produced by wbfI' and wbjW, i s pick e d up by one of the putative galactosyl transferases (WbfS and Wbtu) and gets transferred to the lipid carrier bactoprenol. Five more genes were present in the 3' ofthe 0139 operon wbjP wbjR wbjV, wbjX, and wbjY, which were homologous to a galactosyl transferase of Er. am y lovora an aspartame synthetase that is found in a number of species a nucleotide sugar dehydrogenase of. coli O 111 and two proteins with unknown functions respectively (Stroeher et al. 1998) WbIT Wbtu, WbfY and WbfV were present and highly homologous to ORFs that were also located at the 3 end of the g roup I C PS operon of V vulnifi c us MO624.
PAGE 52
42 Similarities between V vulnificus M06-24 and V cholerae O 139 bios ynthet ic regions were present and both operons had ge nes with no defined regions that corresponded to specific biosynthetic p a thwa ys Additionally multiple distinct genes with s imilar function were present and most importantl y the 3' e nd between them d emo nstrat ed hi gh l evel of co n se r vat ion It could be h y pothesi ze d at this moment that V vulnificus M06-24 could ha ve served as one of the donors for t he acquisition of the newl y acquired CPS ge n es of V cholerae 0139.
PAGE 53
CHAPTER4 RESULTS: SPECIFIC AIM 2 Rationale for Study The results from the previous chapter allow with confidence the assumption of a group 1 operon in V vulnificus MO6-24 / O with characteristic con ervation of the translocation and surface assembly genes (wza, wzb, wzc). These results in combination with the preservation of the wza gene in multiple V vulnificus strains (Wright et al. 2001) led us to the second aim. This chapter describes various studies that were performed in order to examine the level of conservation of the genes that are located upstream of the biosynthetic region. To achieve such a task V vulnificus strains were obtained and their translocation and urface assembly regions were sequenced. Additionally sequence from the two published V vulnificus genomes in the GenBank (Kim et al. 2003 Chen et al. 2003), the Vibrio fisheri ge nomic sequencing project' and the prototype for group 1 operons in E. coli were ava ilable and were all included in the analysis. Unique, Species-Specific Organization of V. vulnificus CPS Translocation and Surface Assembly Genes D A sequence comparisons of the organization of the conserved CPS translocation and surface a embly genes for V vulnificus strains revealed ge netic structure in this region of the operon that was unique to the species (Figure 2). Previously described group 1 operons in other spec i es exhibit the CPS transport genes wza, wzb, and wzc in uninterrupted succession However in V vulnificus MO6-24 / O w z a and wzb were 1 http ://ergo inte g ratedgenomics.com / Genomes/VFI 43
PAGE 54
44 interrupted by an open reading frame encoding a hypothetical protein (HP), and flanking wzb and wzc was a stretch of short sequence repeats ( SRs) identified as RIA, RJB and not seen in other group I operons (Table 3). Direct repeats in positions RJA and RIB contained the same repeated 8-bp sequence (ACAGGACC) in V vulnificus MO6/ O and its phase variant and LC4 / O. The number of the RIA and RIB repeating units differed among the strains with 25 and 8 in MO6-24 / O 24 and 8 for the translucent variant of MO6-24 and 23 and IO for the O variant of a different clinical strain, LC4 respectively. An additional S R (R2) was observed in V vulnificu MO6-24 / O following wzc but differed from RIA and RIB in the repeating subunit, 7-bp in length (CTAGAAC) The number of repeating units did not differ between the MO6-24 phase variants 13 repeating units in both. Unfortunate l y loss of conservation that characterizes the biosynthetic re gion the presence and the number of repeating units for R2 could not be identified for the LC4 phase variants. Published V vulnificus genom ic sequences (BAC93101 AAO09290) from strains CMCP6 and YJ016 exhibited homologous organization to the CP operon of V vulnificus MO6-24 / O and also included the HP and the repeats. However RlA (27 repeating uni ts) and R 1 B ( 14 repeating uni ts) were identical in the sequence of the S SRs but were only present in the CMCP6 and not the YJ016 (Chen et al. 20 03 Kim et al. 2003). R2 sequences were also present in the genomic sequences but they differed from MO6-24 in the numb er and in the location. Strain CMCP6 had 20 repeating units of the R2 but did not follow w z c, instea d were located downstream of swecC (Kim et al. 2003). Genome2 YJ016 strain contained two copies of the R2 repeating unit in its first chromosome The first wa loc ated 5-Kb upstream from the conserved genes with 22
PAGE 55
repeating units and the second did not fo llo w wzc also but wecB, with only 5 repeating units. Interestingl y thi s reg ion of the V fischeri genome also contained an intervening HP between wza and wzb seq u ence but the direct repeats were not present s u ggesting that these SSRs are pecific for the V vulnificus species. 45 Comparison of CPS Operons for V. vulnificus Strains: Identification of Three Types of Phase Variants Opaque and translucent phase variants of different V vulnificus strains were examined for sequence divergence in the CPS operon. Differences in DNA sequence between strains M0624 ver us LC4 in the DNA coding sequence of the CPS translocation and surface assemb l y genes (wza, wzb, wzc) showed consi d erable variabi l ity that was not expected for conserved genes For example over 100 bp and 15 amino acid substitutions were observed in wzc between M06-24/ 0 and LC4 / 0 strains (Tab l e 4). D A sequence identity ranged from 95 to 100 % for the 5 ORFs as shown at this locus. On the other hand near DNA sequence identity ranging from 99 to 100% of individual coding sequence between phase variants of M06-24 strain was noted. However DNA sequencing identified three distinct genotypes associated with p h ase variation which were designated Tl, T2 and T3. As described below multiple base substitutions were observed in Tl, and deletion mutations were observed for T2 and T3 phase variants As shown in Table 4 translucent variant M06-24/Tl was very similar to the opaque parent strain in the translocation and surface assembly gene region and differed by 6 bas es overall in the coding reg i on of the conserved CPS ge nes result in g in 2 amino acid s ubstitution s in Wza. Thus, a lthough T l exhibits minor gene rearrangement in
PAGE 56
Table 3. Genetic variability ofgrouQ__I _<:>_perons Strain V vulnificu s MO6-24/ O V vulnificus MO6-24/Tl V vulnificus CMCP6 (Kim et al. 2003) V vulnificus Y JO 16 (Chen et al. 2003) V vulnificus LC4 / O V vuln[ficus LC4 /T2 V fischeri (ergo.integratedgenomics.corn/ Genomes/ VF!) E. coli (Whitfie ld and Roberts 1999) Gene order wza HP RI Awzb-Rl B wzc-R2 wza HP RlA-wzb-RlB wzc-R2 wza -HP -RIA-wzb-RIB-wzc-wecC-R2R2 ... -wza-HP-wzb-wzc-wecB-R2-wecC(1) wcaJ HP w z a wzc ( 2) wza HP RIA-wzb-RIB -wzc-?a wza HP R 1 wzc -?a wza -HP w z b wzc wza w z b wzc Number of repeated units ( unit sequence) RIA RIB (ACAGGACC) 25 24 27 b 23 12 b b 8 8 14 b 10 b b b R2 (CCTAGAA) 13 13 20 22 5 ?a ?a b b a Question marks demonstrate the inability to sequence the entire CPS operon for the LC4 phase variant. b Absence ofrepeating units. +'" 0\
PAGE 57
47 ORFX and wza the operon appears to be intact. The putative promoter region upstream of wza was div ergent between MO6-24 / O and phase variant MO6-24/Tl. As CPS is still expressed in T 1 strains we hypothesized that expression was some how down-regulated by genetic mutations in the CPS locus. Alternatively reduced expression could be due to mutations in re g ulatory regions outside of the CPS operon or to post-translational events such as up-regulation of CPS degradative enzymes. Down-regulation of CPS in E. coli was postulated to resu lt from lo ss of tyrosine phosphorylation site in wzc. There were 6 tyrosine residues in ),I zcv v of V. vulnificus MO6-24 / O compared to seven in E. coli. However 100% DNA identity was observed for wzb and wzc between MO6-24 / O and Tl; therefore this mechanism could not account for down-regulation of CPS in V. vulnificus. RFLP comparison of PCR amplicons from the down tream biosynthetic region of the CPS operon also did not detect any lar ge deletions or rearrangements in the genetic structure (F igure 3). Thus divergence within the CPS operon did not explain the Tl genotype and the genetic basis for MO6-24 phase variation cannot be a signed thus far. However translucent LC4 (T2) also diverged from the opaque parent strain (LC4 / O) in the number and location of repeated units for R 1 A and R 1 B regions (Table 3). Thus the LC4 / T2 deletion encompasse d not only a 440-bp segment that included the entire wzb ge ne but also removed part of the Rl SSR repeating units reducing the total number of repeated subunits from 33 to 12. PCR amplification confirmed this deletion in a number of translucent isolates ( Fi g ure 4). It was hypothesized that this deletion was responsible for the phase var i ation in T2 isolat es and was mediated the RI direct repeats flankin g thi s g ene.
PAGE 58
Table 4. Divergence am_ong_ strains and phase variants at the V vuln(ficus CPS conserved locus ORFXa wza HPl w z b wzc Strains: DNA Protein DNA Protein DNA Protein DNA Protein DNA Protein (244bp) (88aa) (1227bp) (412aa) (311 bp) (105aa (435bp) (149aa) (2249bp) (750aa) MO6 / O vs. LC4 / O _4b -1 68 1 1 0 0 18 2 108 MO6 / O vs MO6/Tl -1 0 5 2 0 0 0 0 0 LC4 / O vs. LC4/T2 0 0 1 l 0 0 -434 -149 2 a Coding sequences are described in text, and total number of nucleotide base pairs (bp) and amino acid residues (aa) is shown. b Strain differences are indicated by the number of nucleotide base pair or amino acid residue substitutions for each coding sequence. Negative numbers indicate deletions relative to the first strain in the set compared. 14 0 2 +'>-00
PAGE 59
A) M06-24 B) M06-24 0 Tl 0 Tl O Tl 0 Tl 0 Tl 0 Tl O Tl 0 Tl Figure 3. RFLP analysis of PCR amplified fragments from M06-24 phase variants A} PCR amplified region from wzc to wbjB and B) PCR amplified region from wbjB to wbjV: Agarose gels contain the enzyme digested regions with four different restriction enzymes \0
PAGE 60
50 0 Tl 0 T2 Figure 4. PCR Analysis of CPS transport genes in V vulnificus phase variants PCR amplicons derived from pr i mers that spanned the region transport region of the CPS operon as described in materials and methods Approximate band sizes are derived from DNA standards (not shown). Opaque variants of MO6-24 (lane 1) and LC4 (lane 3 ), and their corresponding translucent variants (lane 2 and 4 respectively). Strain 345 / T is an environmental iso l ate that was originally isolated as a translucent variant. This strain was negative by PCR for the entire wza-w z b-wzc region but was positive for the vvh A gene encodin g the species-specific hemolysin gene of V vulnificus (Jones et al. 2004). These results suggested that this strain may have extensive deletions that removed the entire CPS transport locus. Alternatively this strain may be negative for the entire group 1 operon or possesses a non-group 1 CPS operon which does not contain the w z a-w z bwzc re g ion. For example Zuppardo and Siebeling (1998) identified genes required for CPS expression in V vuln(ficus 1003 that were not common to any of the group 1 operons described herein. Therefore it was hypothesized that T3 isolates may represent multiple deletions that eliminate CPS expression. Supporting that hypothesis
PAGE 61
was the presence of multiple R2 regions flanking the entire CPS transport region in V vulnificus Y JO 16, suggesting that more extensive deletions are mediated by the tandem R2 repeats Phenotypic C h a r acte r izat ion o f th e Diffe r e n t Ph ase V arian ts 51 Previous exan1ination of V vulnificus MO6-24 / T (Tl) indicated that this strain still expressed capsule but that CPS expression was reduced or otherwise impaired (Wright et al. 1999). lmmunoelectron microscopy (IEM) showed a patchy capsule that did not completely encase these strains and reduced CPS expression was also confirmed by flow cytometry using monoclonal antibody (Wright et al. 1999). This report differed from other studies that had indicated translucent V vulnificus variants were comp l etely devoid of capsule (Yoshida et al. 1985). Therefore, the phase types (Tl, T2 and T3) described above were examined for CPS expression using electron microscopy. As shown in Figure SA, Tl genotype (MO6-24 /Tl) was confirmed to express some CPS but as expected deletion mutant T2 (Figure 5D) strain appeared completely acapsular. The T2 phenotype was also identical in appearance by EM to transposon mutant CVD752 which was previousl y shown to be acapsular by both IEM and flow cytometry (Wr i ght et al. 1999 2001 ) The second deletion mutant 345 / T (T3) demonstrated the same characteristics as T 2. Previous studies have demonstrated r eversible phase variation for MO6-24 from either O-T or T-O at a rate of about 10-3 to 10-4 (Wright et al 1990). Thus spontaneous T 1 revertants recovered by opaque colony morphology showed increased CPS expression and virulence phenot y p e. Conditions that enhance the rate of phase variation demonstrated that Tl strain was quite unstable reverting at high frequency as indicated by sectored coloni es (Jones et al. 2 004). On the other hand T 2 and T3 strains as
PAGE 62
expected were stable in the translucent phase presumably due to the consequence of gene deletion. Thus these studies demonstrated that the differences in translucent phenotypes corresponded to the different genotypes. A) M06/ 0 8) M06/Tt C) LC4 / 0 D) LC4/T2 Figure 5. Electron micro g raphs of V vulnificus strains and phase variants 52 Negatively stained V. vulnificus strains: A) C) Encapsulated M06-24/ 0 and LC4 / 0 strains respectively and B) D) Tl variant of M06-24/ 0 and T2 variant of LC4 / 0 respectivel y
PAGE 63
CHAPTERS RESULTS: SPECIFIC AIM 3 Rationale for Study Aim 3 proposed the examination of phase variant pairs of various V vulnificus strains in order to identify mechanism of phase variation. The targets for this attempt were the translocation and surface assembly genes of the highly conserved region of the CPS operon. Nucleotide sequence and protein alignments in that region might demonstrate differences that could account for the phase variation phenomenon seen in V vulnificus. Differences throughout the ent ire CPS operon could exist that could harbor va luabl e information about phase variation mechanisms but loss of conservation that characterizes the 3' termini of the CPS operon makes such a task impossible to accomplish at this point ( other than the RFLP analysis performed in the previous chapter for MO6-24 phase variants). This is the region that contains the CPS biosynthetic genes which vary according to the repeating units of the various capsular types. Alignment of M06-24/0 Phase Variants in the Putative Promoter Regions As shown in Figure 6 the previously identified (Wright et al. 2001) putative promoter differed between the MO6-24 / O and Tl by one base at t he -10 region (from TAA TAT to T AA T AA respectively). As both promoters have a non-ideal spacer length (18 bp) and -35 region (TTGTGC) differences at this highly conserved site (82%) may imply reduced promoter strength (Doree and Mulks 200 l ). Tl also exhibited three additional substitutions that created a stretch of 6 adenine bases just downstream of the promoter re g ion. 53
PAGE 64
54 O6-24/T: 301 taatgcgatttttttcatgattattcctttgtatatatacgttttcaaacatcgatgtcg 360 I I I I I 1111111111111111111111111111111111 I I I I I I I I I I I I I I I I I I I I I 06-24/0: 515 taatgcgatttttttcatgattattcctttgtatatatacgttttcaaacatcgatgtcg 574 O6-24/T: 361 gaactttaatagctccggtgtttattttaggtagaatttggAcggaatgtaaacaattag 420 1 1 I I11111111 1 1 1 11111111111111111111 I I I I I 1 I I I 1 11111111111 1 1 1 06-24/0: 575 gaactttaatagctccggtgtttattttaggtagaatttgggcggaatgtaaacaattag 634 O6-24/T: 421 ttgtagctgcaAcgatgtgaatttatggtttttatctcattgatagtaccgtttgcttag 480 11111 111111 111111111111111111111111111111111111111111111 1 I I 06-24/0: 635 ttgtagctgcagcgatgtgaatttatggtttttatctcattgatagtaccgtttgcttag 694 -35 -10 O6-24/T: 481 caaaaacaattgtgctctaagccacaatatggataataAccgcccatAaAAaatattaat 540 1 11 11 1111111111111111111111111 1 I I I I 111 11111111 I 1111 1 1 11 1 06-24/ 0 : 6 9 5 caaaaacaattgtgctctaagccacaatatggataatatccgcccatgattaatattaat 754 *. OrfX ---+ O6-24/T: 541 aatgacacaatactcagtGgtgtcataaaacgtcagtactttgttgcagcaagccattag 600 11 11 11 11 11 111111 I I I I I I I 111111111111111111111111 11 11 11 111111 06-24/ 0 : 755 aatgacacaatactcagt-gtgtcataaaacgtcagtactttgttgcagcaagccattag 813 ops O6-24/T: 6 0 1 agctattgcgcagcaaattgtcccagcgctatgtggttttgcgtgcttaccaaagggcgg 660 I I I I I I I I I I I I I I I I I I I I I I I I 111111111111111 11 1111111111111111111 06-24/0: 814 agctattgcgcagcaaattgtcccagcgctatgtggttttgcgtgcttaccaaa g _gcgg 873 O6-24/T: 661 tagcgtgtcaaaaaagccacaaatatgggtggaaaaccacacttttaacgggttcttaca 720 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 1111111111111111111111111111 11 1 0624/0: 874 tagcgtgtcaaaaaagccacaaatatgggtggaaaaccacacttttaacgggttcttaca 933 O6-24/T: 721 ttttcttacgttcagttagcgtagaatgttgtgcgaagctgcttaaaatcgcagtcagtg 780 I I I I I I I I I 11 11111 11 1 1 1111111111111111111 I I I I I I 11 1111111111111 06-24/0: 934 ttttcttacgttcagttagcgtagaatgttgtgcgaagctgcttaaaatcgca.9:tcagtg 993 O6-24/T: 7 8 1 tgggagctaggctataaagtatagttaaatgcggttaaggaaaacgcctttaactatgtt 840 I I I 1 1111111 111111 1 I I I I I I I I I I I I I I I I I I I I 1111111111111 1111111 11 06-24/0 : 994 tgggagctaggctataaagtatagttaaatgcggttaaggaaaacgcctttaactatgtt 1053 wzavv O6-24/T: 8 4 1 gaatacctatgctttcaaaagcgttagaaagaaatggtgttcaatcgaacctttgctcat 900 11 11 11111 1 11 1 1 1 11 I I I I I 11111111 I I I I I I I I I I I I I I I 11 11111111111 11 06-24/0 :1054 gaatacctatgctttcaaaagcgttagaaagaaatggtgttcaatcgaaccttt ctcat 1113 Figure 6 Sequence comparison of t h e 5' re g ion of the CPS locus for V vulnificus Putati ve promoter re g ion is s h own in boldface and lo cat ion s of 10 and 35 sites are indicated above coding se quence with asterisks over hi g hly conserved nucleotid es (Ho bbs and Reeve s 1994) The JUMPstart region is underlined and the ops e l eme nt i s doubl y over lin ed.
PAGE 65
55 However none of the differences between M06-24 phase variants could account for the observed Tl phenotype because sequences from opaque strains other than M06-24 / 0 were identical to the Tl promoter. A single base deletion within ORFX or Tl produced a frame-shift mutation that was not present in M06-24/0. It should be noted that ORFX contains an ops element whic h is part of a larger 'JUMPstart" region that has been shown to function as an anti-terminator in E. coli CPS (Gentz and Bujard 1985 Hobbs and Reeves 1994). The wzi gene encoding a CPS anchor is located at this site in E. coli and K. pne umonia e but exhibited no homology to V vulnificus ORFX. Other differences between M06-24/ 0 and Tl included two amino acid substitutions in wza. To date anti-terminator components for V vulnificus CPS operon and the function of the ORFX gene product have not been determined and further studies to characterize these elements and identify functional promoters are needed. Phase Variation Mechanism for LC4/T2 The presence of SSRs (SSRlA, SSRlB) that were flanking wzb and the deletion of the w z b gene in V v ulnificus LC4 / T2 phase variants suggested that the repeats could be responsible for the phase shift Therefore complementation studies were performed to introduce the intact wz b gene without (pWZBl) or with upstream sequence (pWZB3.6) into w z b-deleted LC4 / T2 phase var iant. The pWZBl construct consisted of the SSRlA and the w hole wzb gene in contrast the pWZB3.6 construct contained additionally the upstream operon promoter ORFX and the w z a gene Both constructs were introduced into conjugation competent E. coli S 1711,pir (Simon et al. 1983). Complemented LC4 / T2 strains were screened for opacity.
PAGE 66
56 The complemented mutants demonstrated opaque colony morphology, whether the pWZBl or the pWZB3.6 was introduced indicating that wzb was able to complement the defect in trans Additionally reversion to the opaque phenotype by the introduction of the wzb gene alone implies that the upstream genes were functional and confirmed the role of this gene in phase variation. The wzb gene was cloned from both MO6 24 / O and LC4 / O and both copies were found to complement T2 Conversely, complementation of these constructs into MO6-24 /Tl did not result in recovery of opaque phenotype and transconjugates remained translucent. Thus complementation analysis determined that the LC4 / O phase shift to T2 was a result of a specific mutation at this locus Complementation studies also confirmed the role of wz b in CPS expression. Wzb was previousl y proposed to contribute to CPS translocation to the cell surface, but functional analysis was not available. Wzb in E. coli was shown to be the cognate phosphatase for Wzc and Wugeditsch et al. (2001) hypothesized that cycles of phosphor y lation and dephosphorylation may be required for CPS to be expressed in E. coli. However the wz b gene function was not confirmed Therefore complemented mutants of LC4 / T2 were also examined by electron microscopy (F igure 7). These strains were found to express CPS equivalent to the opaque parent strain which confirmed that w z b is required for CPS expression on the cell surface. The wzb gene in V vulnificus was flanked by two regions ofrepetitive DNA segments consisting of multip l es of an 8-bp repeat which has identical sequence in both se ts but differs in the number ofrepeats. We hypothesi ze that these r epea ts may function to facilitate the rate of recombination and play a role in the deletion responsible for T2 translucent phenotype in avirulent strains.
PAGE 67
57 A) B) C) Figure 7. Electron micrographs of complemented V vulni.ficus LC4/T2 Negatively stained V. vulnificus strains: A) acapsular wzb -deleted LC4 / T2 B) complemented LC4 / T2 with p WZB 1 plasmid from M06-24/ 0 and, C) complemented LC4 / T2 with p WZB 1 plasmid from LC4 / 0 SSRs have been reported to promote phase variation through slipped-strand mispairing. When repeats precede a gene in the promoter region transc rip tion i s influenced via the effects of variable l ength within the SSR on the strength of the promoter (Henderson et al. 1999). A lt ernative l y they may be found within the gene, and variation results in alteration of the translational reading frame (Chandler and Fayet 1993 van Belkum et al. 1998). In the case of V vulni.ficus none of the above applies due to the location of the repe a t s They were neither lo cated after the initiation codon of a gene, nor
PAGE 68
58 were the y located in the promoter region (ORFX). Thus the only hypothesis that can be made at this point is that the repeats are flanking the conserved CPS gene wzb, may facilitate a deletion event causing the excision of the entire gene in the LC4 / T2 phase variant.
PAGE 69
CHAPTER6 SUMMARY AND CONCLUSIONS Organization of a Group 1 like CPS Operon in V. vulnificus The genetic organization of the V vulnificus MO6-24/O CPS operon was homologous to group 1 CPS operons originally described in E. coli (Drummelsmith and Whitfield 1999). Genes (wza-wzb-wzc) required for translocation and assembly of CPS to the cell surface in E. coli are considered indicative of group 1 operons, as they are shared b y many gram-negative bacteria with this type of CPS (Arakawa et al. 1991 Rahn et al. 1999 Whitfield and Paiment 2003). Transport ge nes generally localize to the 5' region of E. coli group 1 operons and are followed by polymorphic biosynthetic genes, which are all expressed as a single transcript (Whitfield and Roberts 1999). The presence and organization of these genes confirmed the identity of the V vulnificus operon. A previously described putative promoter (Wright et al. 2001) upstream of ORFX (Orfl) and Rho-independent transcriptional terminator (not shown) at the terminus of the polymorphic region defined the limits of the V vulnificus group 1 operon. Interestingly a high level of conservation was observed in both 5' and 3' regions of the CPS operons among vario u s strains of V vulnificus. Comparisons of V vulnificus MO6-24 / O CPS operon with genomic sequence ofCMPC6 and YJ106 revealed that genes responsible for trans location and surface assembly of CPS were hi g hly conserved, identities were hi gher than 90% for w za, w z b and wzc genes. Genes with reported or proposed biosynthetic function were as expected mostly polymorphic. This divergence probably reflected the diversity of polysaccharide structures that has been observed for 59
PAGE 70
this species (Hayat et al. 1993). However, similarities among strains were observed in some genes from this usually polymorphic region. For example all V vulnificus CPS operons, for which complete sequence was available contained wbjY and wbfV homologue s (97 % deduced amino acid identity) at the 3' termini. This conservation of genetic structure may indicate conserved evolution of the V vulnificus CPS operons. Comparison of CPS Operons Among Vibrio Species 60 Vibrio cholerae i s also a member of the Vibrionaceae family and has been involved in 8 pandemics throughout the world. Cholera is characterized b y massive fluid loss that can lead to shock organ failure and often death. There are multiple defined serogroups of V cho l erae and until 1992 only V cholerae 01 was recognized as a major human pathogen. However in late 1992 in Bengal a novel V cholerae serogroup (0139) was i so lated and literall y replaced V cholerae 01 as the major cholera serogroup (Stroeher et al. 1998 ). V cholerae 0 139 serogroup is essentially the same as V cholerae 0 1 of the El Tor biotype with the acquisition of a new 0-antigen and capsule ( Johnson et al. 1994, Karaolis et al. 1994 Manning et al. 1995 Bik et al. 1995 Comstock et al. 1995, Stroeher et al. 1995 Bik et al. 1996 Comstock et al. 1996 Stroeher et al. 1997, Stroeher and Manning 1997). V cholerae 0 139 serotype emerged from the V cholerae 0 1 by a relatively precise replacement in the LPS operon of the original V cholerae 01 rjb region with 0139-specific genes. The 0 139 LPS can be d escr ibed as semi-rough as it has only a single 0-antigen repeat unit (Manning et al. 1995). Furthermore, V chol e rae 0139 has capsular material (Wa ldor et al. 1994) and produces two colony morphologies (opaque or translucent) as is seen in V vulnificusM06-24 (Johnson et al. 1994 Weintraub et al.
PAGE 71
61 1994). The rjb operon of V cholerae 0139 O-antigen also contains the insertion sequence ISJ 358 element (Stroeher et al. 1995, Manning et al. 1995, Fallarino et al. 1997). ISJ 358 element has also been associated with V vulnificus CPS expression and was conserved among LPS operons of other V cholerae serotypes, as well as in V anguilllarum. Upstream of the start of rfb operon in V cholerae was the JUMP start sequence described by Hobbs and Reeves (1994) which has regulatory function (Bailey et al. 1997). The JUMPstart region is found upstream of most polysaccharides and not surprisingly was upstream of ORFX in V vulnificus MO6-24 / O (Wright et al. 2001). The O-antigen of the V cholerae O 1 LPS is a homopolymer of perosamine which is substituted with tetroate (Kenne et al. 1982) V cholerae O 1 LPS also contains quinovosamine and is found in a ratio of approximately 1 to 20 compared to perosamine. V cholerae 0139 has a completely different O-antigen composition but quinovosamine is also found in the LPS (Stroeher et al. 1998) and in the CPS of V vulnificus MO6-24 / O (Reddy et al. 1992). The sugars found in the LPS of V cholerae 0139 are primarily colitose glucose heptose fructose glucosamine and quinovosamine (Knirel et al. 1995 Preston et al. 1995). In V cholerae O 139 genes for the biosynthesis of the capsular material and the LPS localize to the same region and these polysaccharides differ only in that the O-antigen i s attached to the lipid A-core (Waldor et al. 1994). The surface polysaccharide biosynthesis region of the V cholerae 0139 operon is complex, and mutational analysis has shown that there are some genes involved in both capsule and O antigen bios y nthesis while other genes are specific for either capsule or O-antigen (Waldor et al. 1994 Comstock et al. 1995, Stroeher et al. 1995 Bik et al. 1996).
PAGE 72
62 A stretch of genes that is located o n the 3' end of the operon are common for both V cholerae 01 and 0139 rjb reg i on Additionally a cluster of four highly conserved genes (wbjT, wbjU, wbjY, and wbfV) were at the end of the operons in both V vulnificus MO6-24 and V chof e rae 0139. Two of these genes (wbjVand wbjY) were present in the same location in all strains of V vulnificus. Southern hybridizations with wbjW/wbjX gene probes previously demonstrated that homo l ogous DNA is present in a wide number of non -O1 V cholera e strains and a variety of non cholera Vibrios (Comstock et al. 1995). Thus multiple distinct genes with similar structure and high level of conservation are probably present at the 3' end of many Vibrio spp As both CPS and LPS are mostly heterogeneous among V vulnificus strains perhaps lineages with recombinant CPS / LPS loci will become apparent as more genomic sequence and polysaccharide structure become available. Also it could be hypothesized that V vulnificus group 1 operons could have served as one of the donors for the acquisition of the newly acquired CPS genes of V cholerae 0139. Trans l ucent P h ase Varia n ts Ex h ib it M u lt i ple Gen otypes The CPS operon of V vulnificus was composed of conserved and variabl e regions but variation within the conserved region accounted for differences in the genotypes of phase variants. Three distinct genotypes (Tl, T2 and T3) were found to be associated with phase variation. Tl (MO6-24 / T) exhibited an intact CPS with reversible phase variation at a rate of 10-3 to 104 (Wright et al. 1990) and expressed some CPS on its surface. T2 (LC4 / T) was locked to the translucent phenotype and was unable to produce opaque colonies. It was also devoid of capsule which was attributed to the deletion of a conserved gene wzb. Deletion mutations may also be responsible for phase shift to T3
PAGE 73
translucent phenotype and involved another set of SSRs within and upstream of the operon but the extent of this mutation is not yet defined 63 Although the Tl, T2 T3 genotypes presented in this study are only observed in single isolates of different strains preliminary data indicated that all genotypes are common to most strains of V vulnificus. We ha ve found that certain growth conditions affect the phase variation rate and increased the appearance of the translucent variant (Jones et al. 2004). Late stat ionary phase cultures of MO6-24/O (7 days) demonstrated translucent colonies which exceeded 50%. When Tl cultures were returned to nutritive media (LB) < 50% of Tl isolates remained translucent compared to 100% of T2 isolates. Given that there are no genotypic differences in the CPS region between opaque and Tl, and the fact that T 1 variants do have some capsule on the surface of the cell, introduction to a nutritive medium may relieve environmental stressors that were responsible for the original phase switch. In addition phase var iation between O and Tl apparently involves a downshift in regulation of gene expression rather than elimination of capsule. On the other hand T2 variants have the entire w z b gene deleted from their chromosome which eliminated capsule expression and presumably that deletion event prevented reversion to opaque phenotype. These data suggest that the phase variation phenomenon for V vulnificus is, in fact environmentally regulated and the genotypic consequences are probably related to proteins that control recombination events to increase survival during stress or starvation. Role of SSRs in V. vulnificus CPS The role of repetitive D A segments in phase variation has been previously described in the literature and is generally thought to promote phase variation through s lipp ed-strand mispairin g, leading to duplications or deletion mutations within repeated
PAGE 74
64 elements. However these repetitive elements are usually located within the gene itself or precede an operon in the promoter region. Decreased gene expression results from the effects of variable SSR subunit numbers that alter the promoter strength (Chandler and Fayet 1993 van Belkum et al. 1998). Alternatively, the number of subunits within a repeated intragenic segment may vary, as a result of insertions / deletions that produce translational frame-shifts due to the generatio n of stop codons that truncate a gene product. Direct repeat-mediated recombination events have been reported in the literature. Zhang et al. (1997) identified a vis locus in Borr e lia e spp consisting of an expressed vlsE gene and 15 silent vis cassettes and demonstrated that promiscuous recombination occured in the vlsE cassette region in C3H/HeN mice altering antigenicity of the VlsE variants resulting in antigenic variation. The vis cassettes were comprised of conserved and variable regions resembling the coding sequences of the Neisseria pilin variants that were divided into constant semi-variable and hyper-variable regions (Haas and Meyer 1986). It was hypothesized that the constant regions and a conserved DNA sequence located at the 3' e nd of all pilin loci were thought to pair the regions involved in recombination events (Wainwri ght et al. 1994). It was suggested that segments, but not entire regions of the silent vis cassettes were recombined into the vlsE site with potentially millions of different vlsE alleles (Zhang et al. 1997). The repetiti ve seq uences in V vulnificus somewhat resemble other repetitive elements in eubacteria referred to as REP, E RIC and IRU sequences which are described as short interspersed intergenic repetiti ve DNA (for a review see Lupski and Wienstock 1999). These repeats are distributed throughout the genome and have been
PAGE 75
65 used extensively for molecular typing as primers derived from these sequences generate strain-specific patterns from PCR amplicons. The function of these sequences is not known but like the V vulnificus repeats, they are generally located between genes within polycistroruc operons Despite the formation of stem-loop structures, they generally do not act as transcriptional terminators (Lupski and Wienstock 1999). As seen with the interspersed repetitive elements, the V vulnificus RI repetitive sequences were also intergenic ; however they were not distributed throughout the genome but instead localized near the same gene in the CPS operon in the strains examined. However the R2 repeating subunit was dispersed thought the chromosome of the two V vulnificus published genomes. A total number of 6 copies of the R2 repeat were present in both V vu lnificus strains and not only did R2 flank the entire CPS operon but also copies were found a million bases upstream. The V vulnificus repeated subunit size (7-bp and 8-bp) was also much shorter than the typical repetitive interspersed sequences although a heptanucleotide in cyanobacteria has been described as short tandeml y repeated repetitive (ST RR) sequences (Lupski and Wienstock 1999). The repetitive sequences of V vulnificus are not palindromic but do generate predicted stem loop structures due to the GC content of the subunit sequence ACAGGACC. The deletions re sponsib le for phase var iation in V vulnificus have not been previousl y associated with the dispersed repetitive elements like REP and ERIC. T2 Phase Variation is Mediated by Deletion of wzb The deletion of wzb in the transition from LC4/0 to the T2 translucent phenotype strongly suggested that this event was responsible for the phase shift in that strain. Complementation studies that introduced either the intact LC4 / 0 or M06-24/ 0 wzb gene into wzb-d e l eted T2 phase va riant were performed. Clones were constructed with or
PAGE 76
66 without upstream regions as was previously done with complementation studies of the wza gene (Wright et al. 2001). The complemented mutants demonstrated opaque colony morphology for both constructs indicating that this gene was able to restore the defect in trans and that the wzb gene was functional irrespective of the presence of upstream DNA. Introduction of w zb constructs into MO6-24 /Tl did not result in recovery of opaque phenotype and transconjugates remained translucent. Thus complementation analysis determined that the LC4 / O phase shift to T2 was a result of a site-specific mutation at the wzb locus Introduction of the wzb gene in LC4 / T2 variant led to the recovery of CPS expression. The levels of CPS on the cell surface of the complemented strain were at least equivalent to the opaque parent strain which confirmed that w z b is required for CPS expression on the cell surface. This is the first description of a genetic mechanism for the phase variation of CPS expression and virulence in V vulnificus. Although different genotypes were associated with the translucent isolates examined all demonstrated that the conserved region of the V vulnificus CPS operon was a "hot spot" for genetic mutation and this instability was associated with SSRs. We hypothesized that the SSRs (RIA and RIB) that were flanking wzb played a role in the deletion event that occurred. CPS phase variation involving SSRs appears to be unique to the species as these sequences are not described in other bacterial species with related group I-like operons. SSRs have been previously shown to regulate slipped-strand mispairing in other phase variation systems but site-specific gene deletion has not been previously described to our knowledge. This process ma y be facilitated adaptive mutations ", and associated with stationary phase (Jones et al. 2004) whereby
PAGE 77
67 increased mutational rates result from non-replicative growth and differential expression of DNA repair enzymes. V. vulnificus Tl Phase Variation The genetic basis for Tl phase variants is still undefined as only few differences observed upstream in the putative promoter region. A few base substitutions were present in the Tl phenotype when compared to the opaque. Minor differences in the putative promoter region of the CPS operon could lead to reduced strength of the promoter and explain the reduced CPS on the cell surface of the Tl variant. However, MO6-24 /Tl DNA sequence more closely resembled LC4 / O than its parent phase var iant (MO6-24 / O) in the promoter region. Perhaps this is an intermediate phase that is more primed for deletion events to occur. The iqentification of spontaneous phase variant of LC4/ O LC4 / T2 with a deleted conserved gene further supports that hypothesis. Genes responsible for CPS regulation in MO6-24 /Tl phase variants may reside in regions downstream from the promoter or even outside of the entire CPS operon. An IS element has been previously associated with genes required for CPS expression in at least one V vuln~ficus strain (Smith and Seibeling 2003). Phase variants exhibited differences in RFLP patterns that corresponded to the insertion of the IS element in translucent variants However the relationship of these CPS genes to a particular operon was not clear and none of the genes were present in the group 1 CPS operons. Our studies did not identify any IS elements associated with translucent phase variants at the group 1 locus but the possibility exists that IS e l ements may exist in a region outside the CPS operon or be relevant to other types of CPS operons. Additionally post-transcriptional events may be responsible for the patchy capsul e on the surface of the translucent variant as possible enzymatic activity could be responsible for capsular degradation
PAGE 78
68 Multiple Scenarios for V. vulnificus Phase Variation The disco ve ry of multiple translucent genotypes presented herein supports the assumption that there are multiple mechanisms for phase variation in V vulnificus These data illustrated the genetic instability within the CPS locus particularly in genes associated w ith SSRs. A model for possible phase va ria t ion of V vulnificus CPS expression is described in Figure 8. The genetic basis for Tl phase variants is still undefined but the site-specific deletion of wzb was clearly responsible for phase variation observed in the T2 phase variant. This gene was flanked by regions of repetitive D A segments in V vu lnifi c us and we hypothesized that Rl SSR elements facilitated recombination resulting in the shift to the avirulent T2 translucent phenotype. CPS Operon Structure Transcription CPS Phenotvpe Phase Reversion Transport Genes Biosy nthetic Region ,vu, wzb wzc R2 RI RI R2 > c::::)o/ Yes Ei'.3 Fl -11,ztl wzb wzc ? CAY Yes CiiiJ Fl :->. wza wzc c=) .. Ei'.3 -'1Y 0 ? c) -zy 0 Figure 8. Model for phase var iation of C PS expression in V vulnificus CPS operons are diagramed as horizontal lines showing transport genes wza wzb wzc and biosynthetic regions. Arrows filled with vertical bars (Rl) or shaded vertical bars (R2) represent intergenic repeated subunits. Unfilled anows represent differential transcription s ho w in g eit her down-regulation (narrow arrow) or truncated gene product (shorter arrow) The amount of CPS expressed is indicated by the thickness of the outer layer of the diagrammatic bacterial cell. Question marks indicate h ypothetical aspects of the model.
PAGE 79
Deletion mutations involving a different set of SSRs (R2) w ithin and upstream/downstream of the operon may also be responsible for phase shift to T3 translucent phenotype but the extent of this mutation is not yet defined. CPS Expression and the Environmental Survival 69 Bacteria need to adapt and respond to the constantly changing environments and genetic variation is required for survival. Bacterial mutations and recombinations between genes, acquisition of new genetic material and regulation of gene expression of existing DNA are ways of acquiring flexibility and ensuring survival of bacterial populations. Another way to increase genetic di versity and cell proliferation is to form biofilms Biofilm invol ves the creation of bacterial communities that attach to surfaces in aquatic environments and there are multiple stages during biofilm formation. Initially free floating bacteria sample the environment and reversibly attach on surfaces forming a mono layer of cells. As time progresses production of extracellular polysaccharide (EPS) allows the creation of a more mature structure. At this point bacterial communities are formed and signaling takes place between the members. Bacteria in the environment rarely see nutrient rich conditions and are usually faced with nutrient limitations and starvation. Being part of a biofilm allows for better survival under nutrient depri va tion pH changes oxidative stress, disinfectants and antibiotics. The members of a biofilm sense their surroundings and are able to adjust their metabolic processes to maximize the use of ava ilable substrates resulting in heterogeneity within the biofilm (Jefferson 2004) Additionally bacteria secrete autoinducers (Als) which are substances that allow for environmental sensing and communication. The changes that the biofilm members und e rgo may not always be permanent as many are the cells that
PAGE 80
70 detach from the biofilm and become planctonic again, quickly adapting to their new environment. The extracellular polymeric substance (EPS) is the glue" that surrounds the bacterial cells and keeps the entire st ructure together. Examples of the biofilm enhancing role of EPS in gram-negative bacteria have been reported for the alginate biosynthesis in P. aeruginosa and for extracellular polysaccharide in V cholerae (Dav ies et al. 1993 Watnick and Kotler 1999). On the other hand Joseph and Wright (2004) studied the role of CPS on biofilm formation b etween V vulnificus phase variants and demonstrated that CPS expression inhibited biofilm formation of V vulnificus MO6-24 / O exhibited three fold less attached cells on abiotic surfaces than did the translucent variant. Confirmation of the inhibitor y function of CPS was provided b y increased biofilms that were present in the CVD752 and MO6-24 /31 T acapsular mutants. Differences in the results between V vulnificus CPS and V cholerae El Tor were attributed to differences in the sugar composition of the two structures. Vibrio spp attach to algae and zooplankton and through filter feeding accumulate in the oyster tissue (C hiavelli et al. 200 1 Hood and Winter 1997 Wright et al. 1996 Kumazawa et al. 1991, De Paola et al. 1994 Tamplin et al. 1982 ). Attachment to algal cells was also demonstrated in our laboratory (Chatzidaki and Wright unpublished data). Fluorescent microscop y images depicting interactions between MO6-24 phase variants and algal cells demon stra ted that only the translucent phase variant was ab le to a layer around the algal cell (Figure 9). These st udie s suggest that inhibition of CPS expression as seen in translucent phase var iants may have a biological function that facilitates attachment to other members of the estuarine community.
PAGE 81
71 Figure 9. Fluorescent microscopy image of algal (Thallasiosira pseudomona) and bacteri a l cells (V vulnificus M06-24/ T). Visualization was achieved by acridine orange ( l % w / v). Evo lution of multiple mechani sms for transition to the translucent biofilm-adapted phenot ype may function to maximize the variability of the survival response for this species. Fo r exampl e populations with reversible Tl variants mi g ht be able to more re a dil y d etach from the biofilm in the p a rti ally e ncap s ulat e d form if conditions became deleteriou s w hil e d e letion mutant s that are fixed in the translucent phase may form s table attached s tructures associated with the core of a biofilm. On the other hand CPS expression is clearly advantageo u s during infection explaining the need for an int e rm ediate reversible translucent phenotype (Tl) before the appeara nce of permanent irrever s ibl e gen e deletion mutation s. Thus better understandin g o f the mechanisms controlling the c o n vers i on to th e avirulent tran s luc e nt phenotype may provide strategies for dis ease prevention and in te r ve ntion.
PAGE 82
72 Biolog i ca l S i gni fic a n ce of P h ase Varia t io n Phase variable structures have been recognized in many cases by their effect on colony morpholog y that led to descriptions l ike dry versus moist rugose versus smooth, and opaque versus translucent. Alternating between two phenotypes in a heritable and reversible manner is classified as phase variation. What distinguishes this variation from genetic noise and classical gene regulation is that there is a genetic or epigenetic mechanism that allows the variability to be heritable (van der Woude and Baumler 2004). Thus the daughter cell will inherit that mechan i sm and will also exhibit variation between generations with frequency of reversion that exceeds that of a random mutation Changes in colony morphology can be attributed to phase variation of a variety of surface-exposed proteins the capsu l e and cell wall composition. The capsule can influence interactions with the host cells and host environment including invasion adhesion and serum sensitivity and is a well-recognized virulence factor. The biological significance of phase variation is not well understood and probably varies widely from organism to organism but the underlying genetic variability should provide rapid adaptation to changing environmental parameters and mechanisms for evading host immune defenses via antigenic variation (Zhao et al. 1997 Lim et al. 1998 ) The phase variation switch is considered a random event but lately the h y pothesis of modulated switchin g frequency is more evident. Environmental regulation of phase variable gene expres s ion allows the bacterium to be optimally suited to growth in a particular environment. For instance iron starvation increases the frequency of antigenic and phase variation of N. g onorrho e a e pili and may be correlated with a general change in the D A recombination rate and the DNA repair rate (Serkin and Seifert 2000). Low iron concentration s ar e often encountered by this obligate human pathogen during
PAGE 83
73 infection and thus are likely to be an important signal for the survival of this bacterium in the host. Additionally, stimul i that affect the expression of phase-variable fimbriae in E. coli and S. enterica serotype Typhimurium include temperature pH, carbon source and amino acid concentration (Blomfield 200 1 ). Finally phase variation of adhesions are thought to allow detachment from colonized surfaces and facilitate dissemination within the host or back into the environment for transfer to another host (Ofek and Sharon 1988 Keith et al. 1990 Virj i et al. 1991 Kroll 1992 Nassif et al. 1993 ). The molecular mechanisms underlying phase variation and the corresponding regulatory systems that determine the switch frequency are probably related to specific growth conditions or ph ys iological states. Thus perceiving phase variation as a random nonregulated proces s may lead to incorrect conclusions when addressing the significance of phase variation. Finally, it is clear that the expression of certain genes that undergo phase variation can enhance survival. Reversible phase variation events allow microor ganis m s to shift back to more favorable biologically states rather than being locked into one particular phase Deletions mutations may also be recovered in high density communities such as biofilms where genetic exchange is accelerated. As a result varied phenotypes pre sen t a mixed population which is then poised for environmental change (Dybvig 1993). How the different genetic mechanisms environmental regulation and specific gene products each contribute to the success of the bacterial population largely remains to be determined.
PAGE 84
LIST OF REFERENCES Abeles A. T. Brendler, and S. Austin. 1993. Evidence of two levels of control of Pl oriR and host oriC replication origins by DNA adenine methylation. J. Bacteriol. 175: 7801-7807. Adley, C.C., and A.I. Bukhari. 1984. Methylation dependent expression of the mom gene of bacteriophage Mu: deletions downstream from the methylation sites affect expression. ucleic Acids Res. 12: 3535-3550 Aho E.L. J.A. Dempsey M.M. Hobbs D G. Klapper and J.G Cannon. 1991. Characterization of the opa (class 5) family of Neisseria meningitides. Mo!. Microbiol. 5: 1429-1437. Albertini A.M. M Hofer M.P. Calos and J.H. Miller. 1982. On the formation of spontaneous deletions: the importance of short sequence homologies in the generation of large deletions. Cell. 29(2): 319-328. Alvarez D. S. Merino J.M. Tomas, V.J. Benedi, and S. Alberti. 2000. Capsular polysaccharide is a major complement resistance factor in lipopolysaccharide 0 side chain-deficient Klebsiella pneurnoniae clinical isolates. Infect. Immun. 68: 953-955 Amaro B. Fouz E.G. Biosca E. Marco-Noales and R Collado 1997. The lipopolysaccharide O side chain of Vibrio vulnificus serogroup Eis a virulence determinant for eels. Infect. Immun. 65: 2475-2479. Arakawa Y., M. Ohta R. Wacharotayankun M. Mori N. Kido, H. Ito, T. Komatsu T. Sugiyama and N. Kato. 1991. Biosynthesis of Klebsiella K2 capsular polysaccharide in Escherichia coli HB 101 requires the function of rrnpA and the chromosomal CPS gene cluster of the virulent strain Klebsi e lla pneurnonia e Chedid (01 :K2). Infect. Immun. 59: 2043-2050. Arakawa Y., R. Wacharotayankun T. Nagatsuka H. Ito N. Kato and M Ohta. 1995. Genomic organi z ation of the Kl e bsiella pne urnoniae cps region responsible for serotype K2 capsular polysaccharide synthesis in the virulent strain Chedid. J. Bacteriol. 177: 1788-1796. Bailey M.J.A. C. Hughes and V. Koronakis. 1997. RfaH and the ops element components of a novel system controlling bacterial transcription elongation. Mo!. Microbiol. 26: 845 852. 74
PAGE 85
Barua S. T. Yamashino T. Hasegawa K. Yokoyama K. Torii, and M. Ohta 2002 Involvement of surface polysaccharides in the organic acid resistance of Shiga Toxin-producing Escherichia coli O157:H7. Mol. Microbial. 43(3): 629 640. 75 Bastin D. A., G. Stevenson P K. Brown, A. Haase, and P R Reeves. 1993. Repeat unit polysaccharides o f bacteria: a mode l for polymerization resembling that of ribosomes and fatty acid synthetase with a novel mechanism for determining chain length. Mo!. Microbial. 7:725-734. Belland R.J. 1991. H-DNA formation by the coding repeat elements of neisserial opa genes. Mol. Micro. 5: 2351 2360 Bik E.M. A E. Bunschoten R.D. Gouw, and F .R. Mooi. 1995. Genesis of the novel epidemic Vibrio cholerae 0139 strain: evidence for horizontal transfer of genes involved in pol y saccharide s y nthesis EMBO J 14: 209 216. Bik E.M. A.E. Bunschoten R.J.L. Willems A.C .Y. Chang and F.R Mooi. 1996. Genetic organization and functiona l analysis of the otn DNA essential for cell wall polysaccharide s y nthesis in Vibrio chol e rae 0139. Mol. Microbial. 20: 799 811. Bisharat N V. Agmon R. Finkelstein R. Raz G. Ben-Dror L. Lerner S. Soboh E. Colodner D. Cameron D.L. Wykstra D.L. Swerdlow J .J. Farmer. 1999 Clinical epidemiological and microbiological feature of Vibrio vulnificus biogroup 3 causing outbreaks of wound infection and bacteraemia in Israel. Lancet. 354: 1421-1424. Blake, P A. M.H. Merson R. E Weaver D .G. Hollis and P.C. Heublein. 1979. Disease caused by a marine Vibrio. Clin. Char. Epidimiol. N. Engl. J. Med. 300: 1-5. Blomfield I. C. 2001. The regulation of pap and type 1 fimbriation in Escherichia coli. Ad v Microb. Ph y siol. 45: 1 49. Blyn L.B. B.A. Braaten and D A. Low 1990. Regulation of pap pilin phase variation b y mechanism involving differentia l dam methylation states. E MBO J. 9: 40454054 Broadbent J.R. D.J. McMahon D.L. Welker C.J. Oberg and S. Moineau. 2003. Biochemistry genetics and applications of exopolysaccharide production in S tre pto c oc c u s th er mophilus: a review. J. Dairy Sci. 86 (2): 407-423. Br y an P. J., R J. Steff a n A. De Paola J W. Foster and A. K. Bej. 1999. Adaptive response to cold t e mperature in Vibrio vulnificus. Curr Microbial. 38: 168-175. Bugert P. and K Geid er. 1995 Molecular analysis of the a m s operon required for exopolysaccharid e synthesis of Erwinia am y lovora. Mo!. Microbial. 15(5): 917933.
PAGE 86
Chandler, M and 0. Fayet. 1993. Translational frameshifting in the control of transposition in bacteria Mot. Microbiol. 7: 497 503. Chen,C.Y. K.M. Wu Y.C. Chang, C H. Chang H C. Tsai, T.L. Liao Y M. Liu, H.J. Chen A.B. Shen J.C. Li T.L. Su C.P. Shao C.T. Lee, L.I. Hor and S.F. Tsai. 2003. Comparative genome analysis of Vibrio vulnificus a marine pathogen. Genome Res. 13: 2577-2587. Chiavelli, D A., J. W. Marsh, and R. K Taylor. 2001. The mannose sensitivehemagglutinin of Vibrio cholerae promotes adherence to zooplankton. Appl.Environ. Microbiol. 67: 3220-3225. 76 Colwell R.R., P.R. Brayton D. J. Grimes D B. Roszak S. A. Hug, and L. M Palmer. 1985. Viable but nonculturable Vibrio cholerae and related pathogens in the environment: implications for release of genetically engineered microorganisms. Bio. Technol. 3: 817-820. Comstock L.E. D. Maneval Jr. P. Panigrahi A. Joseph M.M. Levine, J.B. Kaper J.G. Morris, and J.A. Johnson. 1995. Capsule and O antigen in Vibrio cholerae 0139 Bengal associated with a genet i c region not present on Vibrio cholerae O 1 Infect. Immun 63: 317 323. Comstock L.E J.A. Johnson J M Michalski J.G. Morris and J.B Kaper. 1996. Cloning and sequencing o f a region encoding a surface polysaccharide of Vibrio cholerae O 139 and characterisation of the insertion site in the chromosome of Vibrio cholerae O 1. Mol. Micro biol. 19: 815-826. Connell T.D. D. Shaffer and J .G Cannon. 1990 Characterization of the repertoire of hypervariable regions in the Protein II (opa) gene family of Neisseria gonorrhoeae. Mot. Microbiol. 4: 439-449. Coyne M.J. W. Kalka Moll A.O. Tzianabos, D.L. Kasper and L.E Comstock. 2000. Bacteroid es fragilis NCTC9343 produces at least three distinct capsular polysaccharides: cloning characterization and reassignment of polysaccharide B and C biosynthesis loci. Infect. Immun 68(11): 6176-6181. Creuzenet C and J.S. Lam. 2001. Topological and functional characterization of WbpM an inner membrane UDP GlcNAc C6 dehydratase essential for lipopol ysaccharide biosynthesis in Ps eudomonas aeruginosa. Mol. Microbiol. 41:1295-1310. D'Souza J.M. L. Wang and P Reeves. 2002. Sequence of the Escherichia coli 026 O antigen gene cluster and identification of 026 specific genes. Gene 297: 123-127 Dal sgaa rd A., Frimodt-Moller B Bruun L. Hoi and J.L. Larsen. 1996. Clinical manifestations and molecular epidemiology of Vibrio vulnificus infections in Denmark. E ur. J. Clin. Microbiol. Infect. Dis 15: 227-232.
PAGE 87
77 Daniels E. M. R. Schneerson W. M. Eagen S. C. Szu and J.B. Robbins. 1989. Characterization of the Salmonella parataphy C Vi polysaccharide. Infect. Immun. 57:3159-3164. Davies D G ., A.M. Chakrabarty and G.G. Geesey. 1993. Exopolysaccharide production in biofilms: substratum activation of alginate gene expression by Pse udomona s aeruginosa. Appl. Envirn. Microbiol. 59: 1181-1186. De Paola A. G.M. Capers and D Alexander. 1994. Densities of Vibrio vulni.ficus in the intestines offish from the U.S. Gulf Coast. Appl. Environ. Microbiol. 60: 984-988. Dean C.R. C.V. Franklund J.D. Retief M.J Coyne K. Hatano D.J. Evans, G.B. Pier, J.B. Goldberg. 1999. Characterization of the serogroup 011 O-antigen locus of Pseudomonas a e ruginosa PA103. J. Bacterial. 181(14):4275-4284. Dehio C., S.D. Gray-Owen and T.F Meyer. 1998. The role of neisserial Opa proteins in interactions with host cells. Trends Microbiol. 6: 489-495. Dodgson C ., P. Amor and C. Whitfield. 1996 Distribution of the rol gene encoding the regulator of lipopolysaccharide O-chain length in Escherichia coli and its influence on the expression of group I capsular antigens. J Bacteriol. 178 : 1895-1902 Doree S.M. and M.H. Mulks. 2001 Identification of an Actinobacillus pleuropneumoniae consensus promoter structure. J Bacteriol. 183(6): 1983-1989. Drummelsmith J. and C. Whitfield. 1999 Gene products required for surface express ion of the capsular form of the group 1 K antigen in Escherichia coli (O9a: K30). Mol. Microbiol. 31(5):1321-1332. Drummelsmith J ., and C. Whitfield. 2000. Translocation of group 1 capsular polysaccharide to the surface of Escherichia coli requires multimeric complex in the outer membrane. EMBO J. 19: 57-66 Drummelsmith J. P Amor and C. Whitfield I 997. Polymorphism duplication and IS I-mediated rearrangement in the chromosomal his-rjb-gnd region of Es c herichia coli strains with group IA capsular K antigens. J. Bacteriol. 179(10): 3232-3238. Dybvig K. 1993. DNA rearrangements and phenotypic switching in prokaryotes. Mol. Microbial. I 0: 465 471. Fallarino A., C Mav ran g elos U.H. Stroeher and P.A. Manning. 1997. Identification of additional gene s required for O-antigen biosynthesis in Vibrio cholerae O I. J. Bacteriol. 179: 2147 2153. Farabaugh P.J. U Schmeissner M. Hofer and J .H. Miller. 1978 Genetic studies of the lac repressor. On the molecular nature of spontaneous hotspots in the lac! gene of Esc h er i c hi a co l i J. Mo!. Biol. 126(4): 847-857.
PAGE 88
78 Fratamico P. M., C. E Briggs, D Needle C. Chen, and C. DebRoy. 2003. Sequence of the Escherichia coli O 121 O-antigen gene cluster and detection of enterohemorrhagic E. coli O 121 by PCR amplification of the wzx and wzy genes. J. Clin. Microbial. 41(7): 3379-3383. Galas D.J 1978. An analysis of sequence repeats in the lacl gene of Escherichia coli. J. Mol. Biol. 126 (4): 858-863. Gentz R. and H. Bujard. 1985. Promoters recognized by Escherichia coli RNA polymerase selected by function: highly efficient promoters from bacteriophage TS. J. Bacterial. 164:70-77. Geobel W.F. 1963. Colanic acid. Proc. Natl. Acad. Sci. 49: 464-471. Gloeckner F .O., M. Kube M. Bauer H. Teeling T. Lombardot W. Ludwig, D. Gade A. Beck K. Borzym K. Heitmann R. Rabus H. Schlesner, R. Amann and R. Reinhardt. 2003. Complete genome sequence of the marine planctom ycete Pirellula sp. strain 1. Proc. Natl. Acad. Sci. U.S.A. 100(14): 8298-8303. Gray L.D. and A.S. Kreger. 1985 Purification and characterization of an extracellular cytolysin produced by Vibrio vulnificus. Infect. Immun 48: 62-72. Gray L.D and A.S. Kreger. 1986. Detection of anti-Vibrio vulnificus cytolysin antibodies in sera from mice and a human surviving V vulnificus disease. Infect. lrnmun. 51 : 964-965. Haas, R. and T.F Meyer.1986. The repertoire of silent pilus genes in Neisseria gonorrhoeae: evidence for gene conversion. Cell. 44: 107-115. Hale W., M.W. van der Woude and D.A. Low. 1994. Analysis ofnonrnethylated GATC sites in Escherichia coli chromosome and identification of sites that are diff erentially methylated in response to environmental stimuli. J. Bac te riol. 176: 3438-3441 Hayat U., G.P. Redd y C.A. Bush J.A. Johnson A.C. Wright J .G. Morris. 1993. Capsu lar types of Vibrio vu lnificus : an analysis of strains from clinical and environmental sources. J. Infect. Dis. 168(3):758762 Henderson Ian R., P. Owen and J.P. Nataro. 1999. Molecular switches the On and Off of bacterial phase variation. Mol. Micro biol. 33(5): 919-932. Hlady W.G. and K .C. Klontz. 1996. The epidemiology of Vibrio infections in Florida 1981-1993. J Infect. Dis. 173: 1176-1183. Hobbs M. and P.R. Reeves. 1994 The J UMPstart sequence: a 39 bp element common to several polysaccharide gene clusters. Mo!. Microbiol. 12:855-856.
PAGE 89
79 Hoi L., A. Dalsgaard J.L. Larsen J.M. Warner and J.D. Oliver. 1997 Comparison of ribotyping and randomly amplified polymorphic DNA PCR for characterization of Vibrio vulnificus. Appl. E nviron. Micro biol. 63: 1674-1678. Hollis D.G. R.E. Weaver C N. Baker and C. Thornsberry 1976 Halophilic Vibrio species isolated from blood cultures. J. Clin. Microbial. 3:425 431. Hood M.A. and P.A. Winter. 1997. Attachment of Vibrio cholerae under various environmental conditions and to se l ected substrates. FEMS Microbial. Ecol. 22: 215-223. Houng, H.S. and M.M. Venkatesan. 1998. Genetic analysis of Shigella sonnei form I antigen: identification of a novel IS630 as an essential element for the form I antigen expression. Microb. Pathog. 25( 4): 165-173 Jefferson K.K. 2004. What drives bacteria to produce a biofilm? FEMS Microbial. Let. 236(2): 163-173. Jeong K.C. H.S. Jeong J.H. Rhee S.E. Lee, S.S. Chung, A.M Starks, G.M. Esc udero P.A. Gulig and S.H. Choi 2000. Construction and phenotypic evaluation of a Vibrio vulnificus vvpE mutant for elastolytic protease. Infect. Immun. 68(9): 50965106. Johnson J.A. C.A. Salles P. Panigrahi M .J Albert, A.C. Wright R.J. Johnson and J.G. Morris. 1994. Vibrio cholerae O 139 synonym Bengal is closely related to Vibrio cholerae El Tor but has important differences. Infect. Immun. 62: 2108-2110. Jones M.K., M.A. Chatzidaki and A.C. Wright. 2004. D y namics of phase variation for Vibrio vulnificus capsular polysaccharide expression. American Society of Microbiology poster H041 New Orleans LO. Joseph, L.A. and A.C. Wright. 2004. Ex pression of Vibrio vulnificus capsular polysaccharide inhibits biofilm formation. J Bacterial. 186(3): 889-893 Karaolis, D.K., R. Lan and P.R. Reeves 1994. Molecular evolution of the seventh pandemic clone of Vibrio cholerae and its relationship to other pandemic and epidemic V cholerae isolate s. J. Bacterial. 176 : 6199 6206. Kaspar, C.W. and M.L. Tamp lin. 1993. Effects of temperature and salinity on the survival of Vibrio vulnificus in seawa ter and shellfish. Appl. Environ. Microbial. 59: 2425-2429. Kaya, S., Y. Araki and E Ito. 1989. The st ructur e of the O specific chain of the lipopolysaccharide from Pseudomona aeruginosa IID 1012. J. Biochem. 105:2934.
PAGE 90
80 Kaysner C. A M. L. Tamplin, M. M. Wekell, R. F. Stott and K. G. Colburn. 1989. Survival of Vibrio vulnificus in shellstock and shucked oysters (Crassostrea gigas and Crassostrea virginica) and effects of isolation medium on recovery. Appl. Environ. Microbiol. 55: 3072-3079. Kaysner C.A., C. Abeyta, Jr, M.M. Wekell, A. De Paola Jr R.F. Stott, and J.M. Leitch. 1987. Incidence of Vibrio cholerae from estuaries of the United States West Coast. Appl. Environ. Micro biol. 53: 1344 1348. Keith B.R S.L. Harria P.W. Russell and P.E Orndorff. 1990. Effect of type 1 piliation on in vitro killing of Escherichia co li by mouse peritoneal macrophages. Infect. Immun. 58: 3448-3454. Kenne L., B. Lindberg P. Unger, B. Gustafson T. Holme. 1982. Structural studies of the Vibrio cholerae O-antigen. Carbohydr. Res. 100: 341-349. Kido N. T. Sugiyan1a T. Yokochi H. Kobayashi and Y Okawa. 1998. Synthesis of Escherichia coli O9a Polysaccharide Requires the Participation of Two Domains of WbdA a Mannosyltrasferase Encoded within the wb* Gene Cluster. Mo!. Micro biol. 27(6): 1213-1221. Kim Y.R. S.E. Lee C.M Kim S.Y. Kim E.K. Shin D.H. Shin, S.S. Chung H.E. Choy A. Progulske-Fox J.D. Hillman, M. Handfield and J.H. Rhee. 2003. Characterization and pathogenic significance of Vibrio vulnificus antigens preferentially expresse d in septicemic patients. Infect. Immun. 71(10): 5461-5471. Kiser K.B. N. Bhasin L. Deng and J C. Lee. 1999. Staph y lococcus aureus cap5P encodes a UDP -N-acet ylg lucosamine 2-epimerase with functional redundancy J. Bacteriol. 181 ( 16): 4818-4824. Kneidinger B. K. O'Riordan J. Li, J R. Brisson J.C. Lee and J.S. Lam. 2003. Three highly conserved proteins catalyze the conversion of UDP -N-acet yl -D-glucosarnine to precursors for the biosynthesis of O antigen in Ps eudo monas aeruginosa O 11 and capsule in Staphylococcus aureus type 5. Implications for the UDP-N-acetyl-L fucosamine biosynthetic pathway. J. Biol. Chem. 278(6): 3615-3627. Knirel, Y.A. L. Paredes P .E Jansson A. Weintraub, and M.J. Albert. 1995. Structure of the capsular polysaccharide of Vibrio cholerae 0139 synonym Bengal containing galactose 4 6-cyclophosphate. Eur. J. Biochem. 232: 391-396. Kothary M.H. and A.S. Kreger. 1987. Purification and characterization of an elastolytic protease of Vibrio vu lnificus. J. Gen. Microbiol. 133: 1783-1791. Kroll J.S. 1992. The genetics of enca psulation in Haemophilus influenzae. J. Infect. Dis. 165(Suppl. 1): S93-S96. Kumazawa N. H. Fukuma, and Y. Komoda. 1991 Attachment of Vibrio parahaemolyticus strains to est uarine algae. J. Vet. Med. Sci. 53: 20 1 205.
PAGE 91
81 Li, M. T. Shimada J.G. Morris A. Sulakvelidze, and S. Sozhamannan. 2002. Evidence for the emergence of non-O1 and non-O139 Vibrio cholerae strains with pathogenic potential by exchange of O-antigen biosynthesis regions. Infect. lmmun. 70(5) : 2441 2453 Lim J.K ., N.W.T. Gunther H Zhao D.E. Johnson, S.K. Keay and H.L. Mobley. 1998. In vivo phase var iation of Escherichia coli type 1 fimbrial genes in women with urinary tract infection. Infect. Immun. 66: 3303-3310. Linder K. and J.D. Oliver. 1989. Membrane fatty acid and virulence changes in the viable but nonculturable state of Vibrio vulnificus. Appl. Environ. Microbiol. 55: 2837-2842. Litwin C.M. and B.L. Byrne. 1998 Cloning and characterization of an outer membrane protein of Vibrio vu lnificus required for heme utilization: regulation of expression and det ermination of the gene sequence Infect. Immun. 66: 3134-3141. Litwin C.M T.W. Rayback and J. Skinner. 1996. Role of catechol siderophore synthesis in Vibrio vulnificus viru lence. Infect. Immun. 64 : 2834 2838. Lupski J .R. and G.M. Weinstock. 1992. Short interspersed repetitive DNA sequences in prokaryotic genomes. J. Bacteriol. 174(14): 4525-4529. MacLachlan P.R. W J. Keenleyside C. Dodgson and C. Whitfield. 1993. Formation of the K30 (group I) capsule in Escherichia coli O9:K30 does not require attachment to lipopol ysaccharide lipid A core. J. Bacteriol. 175: 75157522 Manca M .C., A. Weintraub and G. Widmalm. 1996. Structural studies of the Escherichia coli 026 O-antigen polysaccharide Carbohydr. Res. 281 (1 ): 155-160 Manning P.A. U .H. Stroeher L.E. Karageorgos and R. Morona. 1995. Putative O antigen transport genes within the rjb region of Vibrio cholerae O 1 are homologous to those of capsule transport Gene 158: 1 7 Manrong L T. Shimada J.G. Morris A. Sulakvelidze S Sozhamannan. 2002. Evidence for th e emergence of non-O1 and non-O139 Vibrio cholerae strains with patho ge nic potential b y exchange of O-antigen biosynthesis regions. lnfec. Immun. 70(5) : 2441 2453. Maxwell E.L. B.C. Mayall S.R. Pearson and P.A. Stanley 1991. A case of Vibrio vulnificus septicaemia acquired in Victoria Med J. Aust. 154 : 2 14-215. McPher s on V.L. J.A. Watts L.M. Simpson and J.D. Oliver. 1991. Physiological effects of the lipopol ysa ccharide of Vibrio vulnificus on mice and rats. Microbios. 67: 141149.
PAGE 92
82 Merino S., M. Altarriba L. Izquierdo M. M. Nogueras, M. Regue, and J.M. Tomas. 2000 Cloning and sequencing of the Klepsiella pneuminiae 05 wb gene cluster and its role in pathogenesis. Infect. Immun 68(5): 2435-2440. Meyer, T.F. C.P. Gibbs and R. Haas. 1990. Variation control of protein expression in Neiss e ria Annu. Rev. Microbial. 44: 451-477 Miyoshi N. C. Shimizu S. Miyoshi and S. Shinoda 1987 Purification and characterization of Vibrio vulnificus protease. Microbial. Immunol. 31: 1325. Miyoshi S. H. Nakazawa K. Kawata K. Tomochika K. Tobe, and S. Shinoda. 1998. Characterization of the hemorrhagic reaction caused by Vibrio vulnificus metalloprotease a member of the thermolysin famil y Infect. Immun. 66: 48514855. Mooi F.R. and E.M. Bik. 1997. The evolut ion of epidemic Vibrio cholerae strains. Trends Microbial. 4: 161-165. Morona, R. L. Van Den Bosch, and P.A. Manning. 1995. Molecular genetic, and topological characterization of O-antigen chain length regulation in Shigella jlexn e ri J Bacterial. 177:1059-1068. Morris, J.G. 1988. Vibrio vulnificus --a new monster of the deep? Ann Intern. Med. 109: 261263 Morris J.G. A.C. Wright L.M. Simpson P.K. Wood D. E Johnson and J.D Oliver. 1987. Virulence of Vibrio vulnificus: association with utilization of transferrin bound iron and lack of correlation with levels of cytotoxin or protease production. FEMS Microbial. Lett. 40: 55-60. Morris J.G. and R.E. Black. 1985. Cho l era and other vibrioses in the United States. N. Engl. J. Med. 312: 343-347 Motes M.L. and A. De Paola 1996. Offshore suspension relaying to reduce levels of Vibrio vulnificus in oysters (Crassostr e a virginica). Appl. Environ Microbial. 62: 3875-3877. Motes, M.L. A. De Paola D.W. Cook J.E. Veazey, J.C. Hunsucker W.E. Garthright R.J. Blodgett and S.J. Chirtel. 1998. Influence of water temperature and salinity on Vibrio vulnifi c u s in Northern Gulf and At lantic Coast o y sters (Crassost re a virginica) Appl. Environ Microbial. 64: 1459-1465. Myatt D.C. and G.H. Davis. 1989. Isolation of medically significant Vibr io Species from riverine sources in South East Queensland. Microbios. 60: 111-123. Nassif X. J Lowy P. Stenberg P. O Gaora A. Ganji and M. So. 1993 Antigenic variation of pilin regulates adhesion of N e iss e ria m e ningitid e s to human epithelial cells. Mol. Microbial. 8: 719-725.
PAGE 93
83 Ofek I. and N. Sharon. 1988 Lectinophagocytosis: a molecular mechanism of recognition between cell surface sugars and lectins in the phagocytosis of bacteria. Infect. Imun. 56: 539-547 Oliver J. D. 1991. Formation of nonculturable Vibrio vulnificus cells and its relationship to the starvation state. Appl. Environ. Microbiol. 57: 2640 2644. Oliver J.D. and R. Bockian. 1995. In vivo resuscitation and vir ulence towards mice, of viable but nonculturab l e cells of Vibrio vulnificus. Appl. Environ. Microbiol. 61: 2620-2623. Oliver J.D. F. Hite, D McDougald, N.L. Andon and L.M. Simpson 1995. Entry into and resuscitation from, the viable but nonculturable state by Vibrio vulnificus in an estuarine environment. Appl. Environ Microbiol. 61: 2624 2630. Oliver J.D., R.A. Warner and D.R. Cleland 1982. Distribution and ecology of Vibrio vulnificus and other lactose-fermenting marine Vibrios in coastal waters of the Southeastern United States Appl. Environ. Microbiol. 44: 1404-1414 Paiment A. J. Hocking and C Whitfield. 2002 Impact of Phosphorylation of Specific Residues in the Tyrosine Autokinase, Wzc on Its Activity in Assembly of Group l Capsules in Escherichia coli. J. Bacteriol. 184(23) : 6437-6447. Park N.Y. J.H. Lee, H.S. Jeong and S.H. Choi. 2003. Direct Submission, Food Science & Technology Chonnam National University Buk-Ku Yong Bong Dong Kwang Ju 500-757 South Korea. Perry M.B., L. MacLean and D.W. Griffith 1986. Structure of the O-chain polysaccharide of the phenol-phase soluble lipopol ys accharide of Escherichia coli 0: 157:H7. Biochem. Cell Biol. 64(1 ): 2128. Powell J. L., A. C. Wright S S. Wasserman D M. Hone and J. G. Morris Jr. 1997 Rele ase of tumor necrosis factor alpha in response to Vibrio vulnificus capsular polysaccharide in in vivo and in v itro models. Infect. Immun. 65 : 3713-3718. Preston L.M. Q. Xu J.A. Johnson A. Joseph D Maneval Jr. K. Husain, G.P. Reddy C.A. Bu sh and J.G Morris. 1995 Preliminary structure determination of the capsular polysaccharide of Vibrio cholerae O 139 Bengal AI 1837. J. Bacteriol. 177: 835 838. Prieur D G. Mevel J. L. Nicolas A. Plusquellec and M. Vigneulle. 1990 Interactions between bival ve mollusks and bacteria in the marine environment. Oceanogr. Mar Biol. Annu. R eview. 28: 277 352. Rahn A., and C. Whitfield. 2003. T ranscriptional org a ni za tion and re g ulation of the Escherich ia coli K30 group 1 capsule biosynthesis (c ps ) gene cluster. Mo!. Microbiol. 47:1045-1060
PAGE 94
84 Rahn A., J. Drummelsmith, and C. Whitfield. 1999 Conserved organization in the CPS gene clusters for expression of Escher ichia coli group 1 K antigens: relationsrup to the colanic acid biosynthesis locus and the CPS genes from Klebsiella pneumoniae. J. Bacteriol. 181: 230 7-2313. Rahn A., K. Beis J. H. aismith and C. Whitfield. 2003. A novel outer membrane protein Wzi is involved in surface assembly of the Escherichia col i K30 group 1 capsule. J. Bacteriol. 185 (19) : 5882-5890. Ra y mond C.K. E .H. Sims,A. Kas D.H. Spencer T.V. Kutyavin R.G Ivey Y. Zhou, R. Kaul J.B. Clendenning, and M .V. Olson. 2002. Genetic variation at the O-antigen biosynthetic locus in Pseudomonas aeruginosa. J. Bacteriol. 184 (13): 3614-3622. Reddy G.P. U. Hayat C. Abeygunawardana, C. Fox A.C. Wright D.R. Maneva l C.A. Bush and J.G. MotTis. 1992. Purific at ion and determination of the structure of capsular polysaccharide of Vibrio vulnificus M06-24. J Bacteriol. 174(8): 2620 2630. Ringquist S. and C.L. Smith 1992 The Escherichia coli chromosome contains specific unmethylated dam and dcm sites. Proc. Natl. Acad. Sci. USA. 89: 4539 -45 43. Ripley L.S. and B.W. Glickman. 1983. Unique self-complementarity of palindromic sequences provides DNA structural intermediates for mutation. Cold Spring Harb. Symp. Quant. Biol. 47(2): 851-861. Rippe y S.R. 1994. Infectious diseases asssociated with molluscun shellfish consumption. Clin. Microbiol. Rev. 7: 419-425. Roberts, I.S. 1996. The biochemistry and genetics of capsular polysaccharide production in bacteria. Annu. Rev. Microbiol. 50: 285-315. Rosch e W.A., T.Q Trinh and R.R Sinden. 1995 Differenti al DNA secondary structure mediated deletion mutation in the leading and la gging strands. J. Bacteriol. 177(15): 4385-4391. Sarkari J. N. Pandit E .R Moxon and M. Achtman. 1994. Variable expression of the Ope outer membrane protein in Neisseria m e ningitides is caused by size variation of a promoter containing pol y -cytidine. Mol. Microbiol. 13: 207-217 Saunders J.R. 1994. Population genetics of phase variable antigens. In Population Genetics of Bacteria. Baumberg. Serkin C. D. and H. S Seifert 2000. Iron availability regulates DNA recombination in Neisseria gonorrhoeae Mol. Microbiol. 37:1075-1086.
PAGE 95
Shao C.P. and L.I. Hor. 1999. Characterizat ion of metalloprotease deficient Vibrio vulnificus mutant generated by alle l ic exchange technique. 1999 B/D-314. In: American Society for Microbiology 99th General Meeting Chicago. IL. ASM p 91. 85 Shapiro R.L. S. Altekruse, L. Hutwagner R Bishop R Hammond S. Wilson B. Ray S. Thompson, R V Tauxe and P M Griffin. 1998. The role of Gu l f Coast o y sters harvested in warmer months in Vibrio vulnificus infections in the Uni ted States 1988-1996. J. Infect. Dis. 178: 752-759. Shimizu T. K. Ohtani H. Hirakawa K. Ohshima A. Yamashita T. Shiba N. Ogasawara M. Hattori S Kuhara and H. Hayashi 2002. Complete genome sequence of Clostrid ium perfringens an anaerobic flesh-eater. Proc. Natl. Acad Sci. U.S.A. 99(2): 996-1001. Shinoba S., M. Kaba yas hi H. Yamada S. Yoshiba M Ogawa and M. Mizuguchi. 1987 Inhibitory effe ct of capsular antigen of Vibrio vulnificus on bactericidal activity on human serum. Microbiol. Immunol. 31: 393-401. Simon M. J. Zeig M. Silverman G Mande l and R. Doolittle. 1980. Phase variation: evolution of a controlling element. Science. 209: 1370-1374. Simon R., U. Priefer and A. Puhler. 1983 A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram-negative bacteria Bio / Technology. 1: 784-791. Simpson L.M. and J.D. Oli ver. 1983 Siderophore production by Vibrio vulnificus Infect. Immun 41: 644-649. Simpson L.M. and J.D. Oliver. 1987. Ab i lity of Vibrio vulnificus to obtain iron from transferrin and other iron-binding compounds. Curr Microbiol. 15: 155-158. Simpson A.J. F.C. R einac h P. An-uda F.A. Abreu M. Acencio R. Alvarenga L.M. Alves J.E. Araya G.S. Baia C.S. Baptista M H Barros E.D Bonaccorsi ,S. Bordin J.M. Bove M.R. Briones M.R. Bueno A.A. Camargo L.E. Camargo D.M Can-aro H. Caner, .B. Colauto C. Colombo F.F. Costa M.C. Costa, C .M. Costa-Neto L.L. Coutinho M. Cristofani E. Dias-Neto C. Docena H E l-Dorry A.P. Facincani A.J. Ferreira V C. Ferreira J.A. Ferro J.S. Fraga, S.C. Franca M.C Franco M Frohme L.R. Furlan M. Gamier G.H Goldman M.H. Goldman S.L. Gomes A. Gruber P.L. Ho J.D. Hoheisel M.L. Junqueira E .L. Kemper J.P. Kitajima and C.L. Marino. 2000 The genome sequence of the plant pathogen Xylella fastidiosa The Xyle lla fastidiosa consortium of the organization for nucleotide se qu e ncing and analysis Nature 406 (6792): 151-157. Sinden R.R. G.X Zhe n g, R.G. Brankamp and K.N. Allen. 1991. On the deletion o f inverted repeat e d DNA in Escheric hia coli: effects of length thermal stability and crucifom1 formation in vivo Genetics. 129(4): 991-1005
PAGE 96
86 Smith G.C. and J.R. Merkel. 1 982. Collagenolytic activity of Vibrio vu lnificus: potential contribution to it s invasiveness. Infect. Immun. 35 : 1155 1156. Smith ,A. B and R.J. Siebeling. 2003. Identification of genetic loci required for capsular expression in Vibrio vulnificus. Infect. lmmun. 71 (3): 1091-1097. Sozhamannan S., Y.K. Deng M. Li, A. Sulakvelidze J. Kaper J .A. Johnson, G.B. Nair, and G. Morris. 1999. Cloning and sequencing of the genes downstream of the wbf gene cluster of Vibrio cholerae serogroup 0139 and analysis of the junction genes in other serogroups. Infect. Immun. 67(10) : 5033-5040. Starks A.M. T.R. Scheb, M.L. Tamplin S. Parveen T.J. Doyle, P.E. Bomeisl G.M. Escudero, and P A. Gulig. 2000. Pathogenesis of infection by clinical and environmental strains of Vibrio vu lnificus. Appl. Environ. Microbiol. 58: 5785 5793. Stelma G. N. Jr. A. L. Re yes, J. T. Peeler C.H. Johnson, and P L. Spaulding. 1992. Virulence characteristics of clinical and environmental isolates of Vibrio vulnificus. Appl. Environ Microbiol. 58: 2776 2782. Stern, A. M. Brown P ickel and T.F. Meyer. 1986 Opacity genes in Ne isseria gonorrho eae: control of phase and antigenic variation. Cell. 47: 61-71. Stevenson G., K. Andrianopoulos, M. Hobbs P.R. Reeves. Organization of the Escherichia coli K-12 gene cluster responsible for production of the extracellular polysaccharide colanic acid. J. Bacteriol. 1996. 178: 4885-4893. Streisinger G. Y. Okada J. Emrich J. Newton A. Tsugita E. Terzaghi and M. Inouye 1966. Frameshift mutations and the genetic code Cold Spring Harb. Symp Quant. Biol. 31: 77-84. Stroeher U.H and P .A. Manning. 1997. Vibrio cholerae serotype 0139: swapping genes for surface pol ysacc haride bios y nthesis. Trends Microbiol. 5: 178-180. Stroeher U .H. K .E. Jedani and P.A. Manning. 1998. Genetic organization of the regions associated with surface polysaccharide synthesis in Vibrio cholerae 01, 0139 and V anguillarum 01 and 02: a re v iew Gene. 223 : 269-282. Stroeher U.H K.E. Jedani B.K. Dredge R. Morona M H. Brown L.E. Karageorgos J.M. Albert a nd P.A. Manning. 1995. Genetic rearrangement of the rjb regions of Vibrio cholerae 01 and 0139. Proc. Natl. Acad. Sci. 92 : 10374-10378. Stroeher U .H. L.E Karageorgos M H. Brown R. Morona and P.A. Manning. 1995. A putati ve pathwa y for perosamine biosynthesis is the first function encoded within the rjb re g ion of Vibrio cho l e rae 01. Gene. 166: 33-42. Strom M .S. and R . Paranjpye. 2 000. Epidemiology and pathogenesis of Vibrio v ulnifi cus Microb. Infe ct. 2: 177-188.
PAGE 97
87 Tacket C.O. F. Brenner and P .A. Blake 1984. Cl i nical features and an epidemiological study of Vibrio v ulnificus infections J Infect. Dis 149: 558-561. Tamplin M L. G. E Rodrick, N. J. Blake, and T. Cuba. 1982 The iso l ation and characterization of Vibrio vulnificus from two Florida estuaries. Appl.Environ. Microbial. 44: 1466 14 70. Tamplin M.L. and G.M. Capers. 1992. Persistence of Vibrio v ulnificus in tissues of Gulf Coast oysters Crassostr e a virginica exposed to seawater disinfected with UV l ight. Appl Environ. Microbial. 58: 1506 1510 Tamplin M.L. S. Specter G .E. Rodrick and H. Friedman. 1985. Vibrio vulnificus resists phagocytosis in the absence of serum opsonins Infect. Immun. 49:715 718 Tison D.L. M. Nishibuchi J.D. Greenwood and R.J. Seidler. 1982. Vibrio vulnificus biogroup 2: new biogroup pathogenic for eels. Appl. Environ. Microbial. 44: 640 646 Trinh T.Q. and R .R. Sinden. 1993 The influence of primary and secondary DNA structure in deletion and duplication between direct repeats in Esch e richia c oli. Genetics. 134(2): 409-422. van Belkun1 A., S Scherer L. van Alphen, and H Verbough. 1998. Short -sequence D A repeats in prokaryotic genomes. Microbial. Mol. Biol. Re v 62: 275-293. van der Woude and Baumler. 2004 Phase and antigenic variation in bacteria. Clin Microbial. Rev. 17(3): 581611. van der Woude M., B. Braaten and D Low. 1996. Epigenetic phase v ariation o f the pap operon in Esc h e r ic hia coli Trends M i crobial. 4: 5-9. van Ham S.M. L. van Alphen F.R. Mooi and J.P. van Putten. 1993. Phase variation of H. injlu e n z a e fimbriae: transcriptional control of two di v ergent genes through a variable combined promoter region Ce ll. 73: 1187 1196. Vincent C. B. Duclos C. Grangeasse E. Vaganay M. Riberty A J. Co z zone and P. Doublet. 2000. Relationship between exopolysaccharide production and protein tyrosine phosphor y lation in gram negative bacteria. J. Mol. Biol. 304:311-321. Virji M., H. Ka y thy, D.J. Fer g uson C. A l exandrescu J.E Heckels and E. R. Moxon. 1991. The role o f pili in the interactions of pathogenic Ne iss e ria with cu l tured human endothelial cells. Mol. Micro biol. 5: 1831-1841. Wainwri g ht L.A. K .H. Pritchard and H.S Seifert. 1994 A conserved DNA sequence is required for efficient gonococcal pilin antigenic variation. Mol. Microbial. 13: 7587.
PAGE 98
Waldor, M.K. R Colwell and J.J. Mekalanos. 1994 The Vibrio cholerae 0139 serogroup antigen includes an O-polysaccharide capsule and lipopolysaccharide virulence determinant. Proc. Natl. Acad Sci. 91: 11388 11392. 88 Wann E.R. B Dass y J.M. Fournier and T.J Foster. 1999. Genetic analysis of the cap5 locus of Staphylococcus aureus. FEMS Microbiol. Lett. 170(1): 97-103. Watnick and Kotler. 1999. Steps in the development of Vibrio cholerae El Tor biofilm Mo!. Microbiol. 34: 586-595. Weichart D. and S. Kjelleberg. 1996. Stress resistance and recovery potential of culturable and viable but nonculturable cells of Vibrio vu lnific us. Microbiol. 142: 845-853. Weichart D., D. McDougald D. Jacobs and S Kjelleberg. 1997 In situ analysis of nucleic acids in cold-induced nonculturable Vibrio vulnificus. Appl. Environ. Microbiol. 63: 2754-2758. Weintraub A., G Widmalm P.E Jannsson, M. Jannson K. Hultenby and M.J Albert. 1994. Vibrio cholerae O 139 Bengal possesses a capsular polysaccharide which may confer increased virulence Microb. Pathogen. 16: 235-241. Whiteside M. D., and J. D. Oliver. 1 997 Resuscitation of Vibrio vulnificus from the viable but nonculturable state. Appl. Environ. Micro biol. 63: 1002-1005. Whitfield C. and LS. Roberts 1999. Structure assembly and regulation of expression of capsules in Escherichia co li. Mo! Micro biol. 31 (5): 1307 1319. Whitfield C. and A. Paiment. 2003. Biosynthesis and assembly of group 1 capsular polysaccharide in Escherichia coli and related extracellular polysaccharides in other bacteria. Carbohydr. Research. 338:2491 2502. Wright A. C. R T. Hill J. A. Johnson M. Roghrnan R.R. Colwell and J. G. Morris 1996 Distribution of Vibrio vulnificus in the Chesapeake Bay Appl. Environ. Microbiol. 62: 717 724. Wright A.C. and J.G. Morris. 1991. The extracellular cytolysin of Vibrio vulnificus: inactivation and relationship to v irul ence in mice. Infect. Immun. 59: 192 197. Wright A.C. J.L Powell M.K. Tanner L.A Ensor A.B. Karpas J.G Morris Jr., and M.B Sztein. 1999. Differentia l expression of V vulnificus capsu l ar polysaccharide. Inect. Immun. 67(5): 2250-2257. Wright A.C. J.L. Pow e ll J.B. Kaper and J.G. Morris. 2001. Identification of a gr oup 1-like capsular polysaccharide operon for Vibrio vu ln ificus. lnfec. Irnmu 69(11): 6893-6901.
PAGE 99
89 Wright A .C., L. M. Simpson J.D Oliver, and J .G. Morris 1990 Phenotypic evaluation of acapsular transposon mutants of Vibrio vulnificus. Infect. Irnmun. 58: 1769 1773. Wright A .C., L.M. Simpson and J.D. Oliver. 1981. Ro l e of iron in the pathogenesis of Vibrio vulnificus infections. Infect. Immun. 34 : 503 507. Wugeditsch T. A Paiment J. Hocking J. Drummelsmith, C. Forrester and C. Whitfield. 2001. Phosphorylation of Wzc a tyrosine auto kinase is essential for assembly of group 1 capsular polysaccharides in Escherichia coli. J. Biol. Chem. 276: 2361-2371. Yamamoto K A.C. Wright J B Kaper and J.G. Morris. 1990. The cytolysin gene o f Vibrio vulnifi cus: sequence an d re l ationsh i p to the Vibrio cholerae E 1 Tor hemolysin gene. Infect. Immun 58: 2706 2709 Yamasaki S. T Shimizu K. Hishino S Ho T. Shimada G.B. Nair Y Takeda. 1999 The genes responsible for O antigen synthesis of V cholera e 0139 are closely elated to those of V cholerae 022. Gene. 237:321-332. Yoshida S., M Ogawa and Y. Mizuguchi. 1985. Relation of capsular materia l s and colony opacity to viru l ence of Vibrio vulnificus Infect. Irnmun. 47 : 446 451. Zeig J. and M. Simon. 1980 Analysis of the nucleotide sequence of an invertible controlling element. Proc. Natl. Acad. Sci. 77 : 4196-4200. Zhang J J.M. Hardham A.G. Barbour and S J. Norris. 1997 Antigenic variation in Lyme disease Borr e liae by promiscuous recombination of VMP like sequence cassettes. Cell. 89 : 275-285 Zhao H., Li X D. E Johnson, I. B l omfield and H. L. Mobley. 1997. In vivo phase variation of MR/P fimbrial gene expression in P r ot e us mirabili s infecting the urinary tract. Mo!. Microbial. 23: 1 009 1019 Zuppardo A B. and R. J. Siebeling. 1998 An epimerase gene essential for capsule synthesis in Vibrio v u lnificus Infect. lmmun. 2601 2606
PAGE 100
BIOGRAPHICAL SKETCH Maria Chatzidaki was born on Jul y 20, 1975 in Athens, Hellas. After graduating from high school, she decided to take the national examinations for entrance into a Hellenic uni versity. In 1994 she was admitted to the Department of Food Science and Technology at the Agricultural U niversity o f Athens Her de vo tion to academic excellence and merit was demonstrated by ranking in the top 2 percent in her department for the entire duration of her studies. For this reason she recei ve d annuall y recognition awards from the State Scholarships Fo undation of the Hellenic Republic. After recei ving her B.Sc ./ M.Sc. combined degree with high honors in the summer of 1999 she was offered assistantships to pursue graduate studies in Food Science at Ohio State Univers ity and the Universit y of Florida (UF). Her choice to join the graduate school at UF was highly influenced by the fact that it was the only one where both she and her fianc e Grigorios Livanis, were offered a scholarship among their combined universit y choices. In the fall of 1 999 she enrolled in the Ph.D. program of the Department of Food Science and Human N utrition at the U niversity of Florida with food microbiology as a field of specialization. Once more, Maria's devotion to academic excellence was demonstrated by receiving certificates of achievement for outstanding academic accomplishments from the U ni vers it y of Florida International Center in April of 2000, 200 1 2002 2003 and 2004. In addition she received a certificate of recognition for her outstanding contributions to the U niver si ty of Florida and the College of Agricultural and 90
PAGE 101
91 Life Sciences in April of 2003; and in spring of 2004 Maria received a Presidential Recognition Award for her outstanding achievements and contributions to the University of Florida. She has also been an active member and served as a treasurer for the Gator Chapter for Food Protection in the University of Florida (parent organization: Florida Association for Food Protection) since 2001. She fulfilled all the requirements and coursework with a 4.0 overall G.P.A. and was awarded a Doctor of Philosophy degree in August 2004.
PAGE 102
I certif y that I hav e read this study and that in m y opinion it conforms to accept a ble standards of s cholarl y presentation and is fully adequate in scope and quali ty, as a dissertation for the degree of Doctor of Philosophy. Human Nutrition I certify that I hav e read this study and that in m y opinion it conforms to acceptable standards of scholarl y presentation and is fully adequate, in scope and quality as a dissertation for the degree of Doctor of Philosophy 9J!!J: Professor of Food Science and Human Nutrition I certif y that I have read this study and that in my opinion i t conforms to acceptable standards of scholarl y presentation and is fully adequate in scope and quality a s a dissertation for the de g ree of Doctor of Philoso h y d Science and Human Nutrition I certify that I hav e r e ad this study and that in m y opinion it conforms to accep ta ble standards of s cholarl y presentation and is full y adequate in scope and quali ty, as a dissertation for the de g r e e of Doctor of Philosoph y au! A. Gulig Professor of Molecular Genetics and Microbiolog y
PAGE 103
This dissertation was submitted to the Graduate Faculty of the College of Agricultural and Life Sciences and to the Graduate School and was accepted as partial fulfillment of the requirements for the degree of Doctor of Philosophy. August 2004 Dean College of Agricultura n Sciences Dean Graduate School
PAGE 104
7 0 20 ....-0 ~i.....-1 c49S UNIVERSIT Y OF FLORIDA II 11111111111111111111111111 1 11111111 1 11111111111111111111111111 3 1262 08554 2529
|