Citation
Transgenic expression of the alcohol dehydrogenase-1 gene of maize in sunflower

Material Information

Title:
Transgenic expression of the alcohol dehydrogenase-1 gene of maize in sunflower
Creator:
Ingersoll, John Charles, 1953-
Publication Date:
Language:
English
Physical Description:
vi, 161 leaves : ill., photos. ; 29 cm.

Subjects

Subjects / Keywords:
Corn ( jstor )
DNA ( jstor )
Genes ( jstor )
Genetic mutation ( jstor )
Genetic vectors ( jstor )
Messenger RNA ( jstor )
Plasmids ( jstor )
Promoter regions ( jstor )
Sunflowers ( jstor )
Tumors ( jstor )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1990.
Bibliography:
Includes bibliographical references (leaves 149-160).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by John Charles Ingersoll.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
001583935 ( ALEPH )
AHK7875 ( NOTIS )
23011928 ( OCLC )

Downloads

This item has the following downloads:


Full Text








TRANSGENIC EXPRESSION OF THE ALCOHOL DEHYDROGENASE-1
GENE OF MAIZE IN SUNFLOWER












By

JOHN CHARLES INGERSOLL


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY


UNIVERSITY OF FLORIDA


1990





























Dedicated to Barbara Saffer











ACKNOWLEDGMENTS


I wish to extend my thanks to fellow graduate students and colleagues who have

been helpful throughout my graduate career. Special thanks goes to my friend Jack

Shelton for always being available when I needed advice and/or a helping hand. Also to

my friends, co-workers, and roommates, Beth and Kevin O'Grady, for their help and

support. I especially wish to thank Dr. William Gurley who gave me a chance to learn and

develop in his laboratory.













TABLE OF CONTENTS



ACKNOWLEDGMENTS....................................................................... iii

ABSTRACT ......................................................................................v

CHAPTERS

1. INTRODUCTION.................................................................1

2. TRANSCRIPTIONAL EXPRESSION OF MAIZE Adhl
IN SUNFLOWER TUMORS .... .... ........ ............. ................19

Introduction..................................................................... 19
Materials and Methods............................................................... 21
Results......................................... ................................ 24
Discussion.................................................................. 45

3. PROMOTER ANALYSIS OF MAIZE Adhl IN
SUNFLOWER TUMORS...................................................... 54

Introduction....................................................... ......... 54
Materials and Methods................................... .................... 55
Results.................................................................... 57
Discussion.................................................................130

4. SUMMARY ......................................................................146

REFERENCES .................................................................................... 149

BIOGRAPHICAL SKETCH ............................................................. 161












Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

TRANSGENIC EXPRESSION OF THE ALCOHOL DEHYDROGENASE-1 GENE OF
MAIZE IN SUNFLOWER

by

John Charles Ingersoll

May, 1990

Chairman: William B. Gurley
Major Department: Microbiology and Cell Science

The Adhl gene from maize was incorporated into the genome of dicotyledonous

sunflower hypocotyl cells via Agrobacterium tumnefaciens mediated transfer. Transcription

of this foreign gene in sunflower tumors was induced by anaerobic stress in a similar

fashion as in its natural host. Splicing of the nine introns from the primary transcripts

proved to be aberrant in this heterologous system. Analysis of the non-processed mRNA

by S 1 nuclease hybridization indicated that initiation of transcription occurred at the

recognized Adhl start site and a possible second site 500 base pairs further upstream.

The 5' flanking sequences of Adhl were positioned upstream of a T-DNA reporter

gene (780) and an internal reference gene system was employed to analyze regulatory

regions within the promoter. The T-DNA sequences of the vector plasmid had a positive

effect on transcription when located upstream of the chimeric test genes. This positive

effect was overcome by positioning the shuttle vector T-DNA downstream of these genes.

Specific promoter mutations indicated that the anaerobic response element (ARE) of Adhl

was recognized and required for efficient transcription upon anaerobic induction in

sunflower tumors. Deletion of this element did not convert this inducible gene to a






constitutively active gene. Flanking the ARE with 8 (at -140) and 12 (at -91) base pair

insertions reduced the anaerobic response to -20% of wild type, while inverting the

orientation severely decreased the response to <5%. Re-positioning the ARE upstream

from its accustomed position abolished the response. The internal region of the promoter

(between -410 and -140) was responsible for 60% of the transcriptional activity when

positioned in its accustomed location in the promoter with respect to the ARE. When the

intermediate region was separated from the ARE by 14 base pairs, transcriptional activity

decreased almost 90%, while inverting this region increased activity 45% above wild type

activity. The distal region of the promoter (between -1094 and -410) contributed about

10% to total transcriptional activity while adversely influencing the TATA-proximal region

when the intermediate region was absent.











CHAPTER 1
INTRODUCTION



In recent years much attention has been focused on the interaction between

transcription factors and regulatory DNA elements of transcriptionally active plant genes.

A number of methods have been employed to identify the DNA sequences involved in

these interactions. These methods include band shift experiments (gel mobility retardation

assays) (Wu and Crothers, 1984), DNase I footprinting (Galus and Schmitz, 1978), and

in vivo dimethyl sulfate (DMS) genomic footprinting (Maxam and Gilbert, 1980). The

binding sites identified in this way have subsequently been characterized with regard to

their potential for transcriptional regulation. A more direct approach to the identification of

cis-regulatory elements has involved mutation of the 5' flanking region of the gene under

study. Important sequence elements that act as positive or negative regulatory elements

affecting transcription in a transgenic system may be identified by correlations between a

specific mutation and loss of promoter activity. Criteria for the regulatory analysis of a

gene requires a suitable transient or transgenic host and an accurate method of evaluating

activity of the gene, be it at the transcriptional or protein product level.

The relatively recent development of gene transfer techniques for plants has greatly

enhanced our ability to elucidate the regulatory mechanisms of a number of genes. The

different methods of gene transfer include microinjection of nucleic acid into protoplasts

(Crossway et al., 1986), electroporation into protoplasts (Fromm et al., 1985),

polyethelene glycol (PEG) induced uptake by protoplasts (Paskowski et al., 1984), DNA

coated microprojectiles (Klein et al., 1987, 1988), and Agrobacterium tumefaciens

mediated transformation into a wide range of dicotyledonous plants in addition to some

monocotyledonous species (Nester et al., 1984; Hooykaas et al., 1984; Binns and








Thomashaw, 1988, for review). The analysis of promoter structure in heterologous plant

systems may utilize the natural transcription unit, or may be facilitated by fusing the

promoter to one of a number of reporter genes, whose expression may be easily

monitored and quantified (Kuhlemeier et al., 1987, for review). These reporter genes

include the coding regions for two Agrobacterium T-DNA genes, octopine synthase (ocs)

and nopoline synthase (nos) (Kemp, 1982; Tempe and Goldman, 1982), and the coding

regions for other bacterial genes such as neomycin phosphotransferase (NPT) (Fraley et

al., 1983), chloramphenicol acetyl transferase (CAT) (Gorman et al., 1982; An, 1986),
and P-glucuronidase (GUS) (Jefferson, 1987; Jefferson et al., 1987).

This review focuses on the experimental investigation of a representative sampling

of differently regulated plant gene promoters and the analysis of some monocotyledonous

gene promoters in dicotyledonous plant systems. Important experiments involving the

localization and elucidation of important cis-acting sequences of a transcription unit

requires the investigation of the expression strengths delineated by in vitro mutated

promoters. Different plant systems at the transient or transgenic levels are employed for

these investigations. The promoters discussed in this survey represent some constitutively

active plant gene promoters and cis-acting regulatory sequences responsible for the

induced expression of a gene by environmental factors. Regeneration of transgenic plants

also allow for analysis of those regions responsible for regulating organ specific

expression.


Constitutive Regulation


The Constitutively Regulated Cauliflower Mosaic Virus (CaMV) 35S Promoter.

The promoter of the CaMV 35S transcription unit exemplifies a particularly well

studied example of promoter analysis in plant systems. This promoter has been

commonly used in transgenic plant experiments due to its ability to function in a wide







variety of plant systems. It is highly active in transient assays using cell lines from both

dicotyledenous and monocotyledenous plant species (Fromm et al., 1985; Ou-Lee et al.,

1986; Nagata et al., 1987; Dekeyser et al., 1989) and is constitutively expressed in

regenerated transgenic plants (Koziel et al., 1984; Odell et al., 1985; Shah et al., 1986).

To localize important cis-regulatory regions within the 35S promoter, deletion mutation

experiments have been performed with subsequent analysis of gene products. Odell et al.

(1985) fused the 35S promoter to the coding region of a human growth factor gene and by

monitoring mRNA levels in tobacco call showed that this promoter was fully active when

the 5' flanking sequences of this chimeric gene extended 343 base pairs upstream from the

transcription initiation site. Gene products from this construct were observed in roots,

petals, and stems of transgenic tobacco plants (Odell et al., 1985). Further analysis of the

promoter in tobacco calli involved additional 5' deletions to position -105 and -46 which

reduced promoter activity 67% and 95%, respectively. This group also showed that the

promoter sequences extending 46 bp upstream from the transcript start site, which

includes the TATA box, were sufficient to initiate transcription at the start site normally

utilized in the transcription of the intact CaMV 35S gene. Thus the promoter sequences

situated between -343 and -46 were shown to be necessary for full transcriptional activity

in tobacco and transcription did not appear to be tissue specific (Odell et al., 1985).

Similar deletion experiments of the CaMV 35S promoter when fused to the coding region

of a firefly luciferase gene were constructed and analyzed in carrot protoplasts (Ow et al.,

1987). The results of these experiments showed that the promoter was fully active when

it extended upstream only 148 bp from the CAP site. However, an additional 40 bp

deletion to -108 reduced activity 80%. This lower transcript level was not altered by

additional 5' deletions to -104 and -89. A further deletion of 16 base pairs to -73 did

result in a reduced level of expression of the chimeric gene to less than 1% of the

maximum expression (Ow et al., 1987).







The CaMV 35S promoter deletion studies in calli and protoplasts provided

information that enabled investigators to focus their attention on specific regions of the

promoter. The CaMV 35S promoter is on average 30-fold more transcriptionally active

than the A. tumefaciens T-DNA nopaline synthase (nos) promoter in transgenic petunia

(Sanders et al., 1987). Sequences previously shown to be important, between -392 and

-55 of the 35S promoter were positioned directly upstream of a truncated (to position

-150) nos promoter fused to a CAT reporter gene (Odell et al., 1988). The addition of

these sequences, in both orientations, resulted in increased expression of the truncated

chimeric gene in tobacco, tobacco calli, and soybean protoplasts, to levels equal to the

"wild type" 35S promoter (-392 to +1) (Odell et al., 1988). These results indicate that this

region contains promoter elements that can function in association with a heterologous

promoter in a bidirectional manner. This enhancer-like effect is position dependent in that

an inverse correlation was observed between distance from the TATA box and

transcriptional activity (Odell et al., 1988). The promoter region between -392 to -90 of

the 35S gene has also been shown to stimulate transcription in maize protoplasts when

placed upstream of the maize alcohol dehydrogenase 1 (Adhl) promoter truncated to the

-140 position (Ellis et al., 1987). These sequences also stimulate an increase in

transcription of two T-DNA genes (genes 5 and 7; Willmitzer et al., 1982) in transgenic

tobacco plants and transcriptional activity increases 10-fold when this region is duplicated

in tandem within the natural 35S promoter positioned upstream of NPT II coding

sequences (Kay et al., 1987).

An additional study in transgenic tobacco leaves analyzing the effects of 5' and

internal deletions of the 35S promoter localized three regions necessary for maximum

transcription efficiency (Fang et al., 1989). Whereas Odell et al. (1985) did not observe

any significant drop in transcription upon deletion of sequences between -343 and -168 in

tobacco, Fang et al. (1989) found that the region between -343 and -208 contributed 50%

of the activity to the downstream promoter sequences. A second region, -208 to -90, was








found to contribute 40% of the activity to downstream sequences and was enhancer-like in

its activity. A third region between -90 and -46 of the 35S promoter (which does not

include the TATA box) did not contribute to promoter activity when sequences 5' to this

region were absent, but its presence, in either orientation, in association with the upstream

sequences allowed for increased transcriptional activity (Fang et al., 1989).
Histochemical localization of different 35S promoter mutations fused to a P-

glucuronidase (GUS) reporter gene was used to identify two domains of the 35S

promoter responsible for tissue specificity not previously observed in regenerated tobacco

(Benfey et al., 1989). Domain A (-90 to +8), which does not contribute to increased

transcriptional expression in tobacco leaves (Fang et al., 1989), confers strong expression

to roots. It was observed that nuclear protein factors bind to the DNA within this region

between -90 and -59 (Benfey and Chua, 1989). Domain B (-343 to -90) is not active in

roots, but is mainly responsible for transcriptional activity in vasculated tissues such as

leaves, cotyledons, and hypocotyls (Benfey et al., 1989). These two promoter domains

work best when associated with each other and are both necessary for constitutive

expression. Analysis of mutations identified cis-elements which in turn became targets for

subsequent studies that mapped protein:DNA interactions. DNase I footprinting

experiments performed on the sequences -90 to -46 localized the binding sites for the

activation sequence factor I (ASF-I) between -85 and -58 (Lam et al., 1989).

The experiments utilized to characterize the CaMV 35S promoter illustrates the

contribution made by specific plant gene promoter mutations and their analysis in

transgenic plant systems to target and identify important regulatory regions.







Inducible Genes


Expression of Thermally Induced Plant Genes.

Different plant systems have been exploited to analyze the regulated expression of

environmentally inducible genes such as heat shock, wounding, light, and anaerobic

stress (Benfey and Chua, 1989, for review). Examples of this type of investigation

include the transformation of soybean heat shock (HS) genes in heterologous sunflower

and tobacco systems. Expression of the HS multigene family in soybean may be

necessary for survival of the plant when subjected to thermal stress (Key et al., 1987, for

review). In an effort to delineate regulatory elements of a soybean HS gene, Gmhspl7.3-

B has been incorporated into sunflower seedling hypocotyl tissue via Agrobacterium

mediated transfer (Schoffl and Baumann 1985). The transferred DNA contained the

protein coding region and about 1 kb of 5' flanking sequences. In sunflower tumor tissue

Gmhspl7.3-B was shown to be transcriptionally expressed upon thermoinduction,

though at very low levels compared to soybean. A number of 5' deletion mutations of the

Gmhspl7.3-B promoter, the longest extending 439 bp upstream of the start site, were

then constructed in vitro. Expression of each deletion was analyzed in regenerated

tobacco plants (Baumann et al., 1987). In this heterologous transgenic system, those

deletion mutants that were expressed were induced at the mRNA level by heat shock and

utilized the correct transcription initiation site. Sequences within the promoter between

180 and 154 bp upstream of the translation start were found capable of conveying thermo-

inducibility upon this gene. This region contains overlapping heat shock elements (HSEs)

first described in HS genes of Drosophila (for review see Pelham, 1985) which show a

common spacing and location in relation to start of transcription in all soybean heat shock

genes thus far described (Raschke et al., 1988). Baumann et al. (1987) also determined

that distal HSE-like sequences between -298 and -181 (relative to the translation start

codon) also make a positive contribution to thermoinducibility. An additional sequence








element which was AT-rich was identified between -439 and -298. This element was

shown to be capable of bidirectional activity when placed upstream of the truncated

Gmhspl 7.5-B promoter.

Another soybean HS gene, Gmhspl7.5-E, has also been incorporated into

sunflower tumors via Agrobacterium transfer (Gurley et al., 1986). The transgenic tumor

tissue was heat shocked at 400C whereupon transcription levels increase at least 10-fold

from a copy of the gene containing 3,250 bp of upstream sequences. Mutational analysis

of the promoter by 5' deletions revealed that sequences between -1175 and -95 were

necessary for maximal induction of the gene (Gurley et al., 1986). The identification of

important regions of the Gmhspl7.5-E promoter by these initial deletions allowed for a

more specific mutational analysis. Additional manipulations of the promoter by 5' and

internal deletions revealed that the distal region of the promoter between -1175 and -259

donates a modest 25% activity to the transcriptional activity. Further removal of

sequences to -179 decreased transcription to 58% compared to the promoter extending

1175 bp upstream (Czarecka et al., 1989). Both 5' and internal deletion mutants enabled

identification of two regions near the TATA box, site 1 (-49 to -72) and site 2 (-81 to

-102), which harbor HSEs and are involved in the transcription response to heat stress.

Removal of either of these two regions abolished thermoinducibility The sequences

between -274 and -189 contributed 66% of the induced transcriptional expression of the

gene (Czarnecka et al., 1989). Within these sequences is a TATA dyad

(TATAAAGAATITC) that is conserved in both Drosophila and soybean heat shock genes

and may also contribute thermoinducibility.

Heat shock genes appear to be ubiquitous (see Schlesinger et al., 1982) and have

similar promoter elements (Pelham, 1985, for review) among eucaryotes. It is interesting

to note that the Drosophila hsp70 promoter (extending upstream 258 bp from the

transcription initiation site) when fused to the coding region of a neomycin

phosphotransferase II gene proved to be thermally inducible in tobacco calli (Spena et al.,







1985). Similarly, upon regeneration of the call into transgenic tobacco plants the chimeric

gene was induced by heat shock in roots, stems, and leaves, but was not found expressed

in pollen (Spena and Schell, 1987).


Expression of a Wound-Inducible Plant Gene.

The proteinase inhibitor II (PI II) gene of potato is a member of a small gene

family that is normally expressed in the tubers of the plant in a tissue specific manner

(Sanchez-Serrano et al., 1986) but is induced by mechanical wounding or insect attack in

leaves (Green and Ryan, 1972). To investigate cis-regulatory elements of this gene, 5'

and 3' flanking sequences were fused to the CAT gene coding region and transformed into

tobacco (Thornburg et al., 1987). A 7.8-fold increase in CAT activity was detected as

compared to basal levels when the leaves were subjected to mechanical wounding. When

the 3' flanking sequences of the T-DNA 6b gene were substututed for those of PI I for

this chimeric construct no activity was observed. Therefore it was determined that the 3'

flanking sequences were required for the wound response of this gene in tobacco

(Thomburg et al., 1987). Transcripts of a potato PI II gene were systemically induced

and accurately spliced in tobacco plants (Johnson et al., 1989) in a similar manner as in its

natural host (Sanchez-Serrano et al., 1987). Induction levels were strongest within the

region of vascular tissue in tobacco as it is in potato (Keil et al., 1989). Information

gathered by these experiments suggest that specific in vitro mutations of regulatory

regions and analysis in tobacco may now be utilized as a means to identify important

sequences of these genes.


Light Regulated Plant Genes.

The nuclear genes of pea encoding the small subunit of ribulose-1,5 bisphosphate

(RuBP) carboxylase (Coruzzi et al., 1984) represent examples of plant genes that are

transcriptionally regulated by the presence or absence of light. Different plant systems








have been utilized to identify cis-acting regulatory elements of these genes. The pea rbcS-

E9 gene has been transformed into petunia protoplasts which were subsequently grown as

calli (Broglie et al., 1984). A construct containing 1052 bp of sequences 5' to its start site

was transcribed in a similar fashion as in its natural host. Though less than in pea leaves,

transcription in petunia was shown to be induced up to 50-fold in calli upon exposure to

light. The resulting transcripts were correctly initiated, polyadenylated, and efficiently

spliced removing the two intervening introns of the immature message (Broglie et al.,

1984). The promoter of another light- regulated pea gene of the rbcS gene family, ss3.6

(Cashmore, 1983), was fused to a bacterial CAT reporter gene and transformed into

tobacco calli (Herrera-Estrella et al., 1984). This light regulated promoter extended from

-4 to -973 bp relative to the transcription start site. The promoter of ss3.6 was also shown

to regulate transcription in soybean callus tissue (Facciotti et al., 1985). Thus, the cis-

regulatory elements of these light regulated genes from pea were independently recognized

by nuclear factors of both tobacco and soybean.

Once the efficiency of transgenic expression was demonstrated for these light

regulated genes, mutational analyses were employed to identify and localize important

regulatory sequences. The promoter of the pea rbcS-E9 gene was subjected to a number

of 5' deletions and one internal deletion. Transgenic calli tissue harboring each construct

were pooled and the transcripts analyzed (Morelli et al., 1985). In this manner it was

shown that sequences between -1052 and -352 are necessary for maximum transcriptional

activity and that sequences involved in light regulation are localized to the TATA box

region from -35 to -2. Similar manipulations were performed on the pea rbcS ss3.6 gene

promoter situated upstream of the CAT reporter gene and transformed into tobacco tumor

tissue (Timko et al., 1985). The promoter sequences from -973 to -90 were found to

convey maximum transcription levels and possessed the photoregulatory information

regardless of orientation. This ability to respond to light was also seen when the 5'

flanking sequences were fused to a heterologous nopaline synthase (nos) promoter and







assayed in tobacco cells. This upstream fragment did not, however, influence

transcription when placed 3' to the coding region of a chimeric nos/CAT construct (Timko

et al., 1985).

The light inducible rbcS-E9 gene with a promoter extending 1,052 bp upstream

from the start of transcription was induced in the presence of light in transgenic petunia

and tobacco plants with most of the activity in leaves which is similar to its expression in

pea (Nagy et al., 1985). Two additional members of the rbcS multigene family of pea,

rbcS-3A and rbcS-3C, were transferred into petunia plants and assayed for light induced

expression (Fluhr et al., 1986b; Fluhr and Chua 1986). In petunia the pea rbcS-3A gene

needed only 410 bp of its 5' flanking sequence to be efficiently transcribed with light-

mediated phytochrome control in an organ specific manner (most highly expressed in

leaves). The sequence requirement for maximum transcription efficiency in regenerated

plants differs from that observed for rbcS-E9 in petunia calli (Morelli et al., 1985). The

-327 to -48 region of the rbcS-3A promoter in regenerated petunia plants were defined as

enhancer-like in that they convey elevated, light inducible and organ specific transcription

levels when placed upstream of a truncated heterologous CaMV 35S promoter regardless

of orientation. Similar results were observed when the region -317 to -82 of the closely

related pea rbcS-E9 gene was placed in both orientations upstream of a truncated nos

promoter and analyzed in transgenic petunia plants (Fluhr et al., 1986a). Regulatory

expression levels of pea rbcS gene promoters were further investigated by additional in

vitro manipulations and analysis in transgenic tobacco. RbcS-3A and rbcS-E9 are closely

related genes, but rbcS-3A is expressed to a much higher level in pea. Sequences between

-50 and +30, including the TATA box, were physically switched between the two genes

by cloning procedures. In tobacco each chimeric was transcriptionally expressed at levels

corresponding to activity obtained with the homologous TATA region (-50 to +30)

(Kuhlemeier et al., 1988) inferring that these sequences are not responsible for the

difference in transcription levels. Sequences extending from -330 to -50 of the rbcS-3A







gene were then inserted in the same position upstream of an rbcS-E9 5' truncated deletion

to -50. This chimeric promoter resulted in high levels of induced expression similar to

that of rbcS-3A. These two experiments indicate that the amplitude of expression is

determined by sequences upstream of -50 (Kuhlemeier et al., 1988). These same pea

rbcS-3A promoter sequences, between -330 and -50, also confer cell specificity of

expression in transgenic tobacco (Aoyagi et al., 1988). Similar sequence block exchange

experiments were performed between the highly expressed petunia rbcS gene SSU301

and the weakly transcribed SSU911 in transgenic tobacco plants. In this case, promoter

sequences located between -285 and -204 of SSU301 were shown to convey the

difference in expression levels (Dean et al., 1989).

The pea rbcS-3A promoter had also been examined by a number of 5' and

internal promoter deletions when fused to a CAT reporter gene and transformed into

tobacco plants (Kuhlemeier et al., 1987a). A promoter extending upstream to the -169

position was induced by light but with 3- to 5-fold less expression than the promoter of a

similar chimeric that extended to -410, whereas a 5' deletion to -149 inhibited light

induced transcription. Thus, a positive light response element (LRE) was mapped

between positions -166 and -100. This region of rbcS-3A contains three domains,

designated boxes I (-156 to -162), II (-130 to -151), and III (-114 to -125) which are also

found within the promoter of other photoregulated pea rbcS genes. Results from fusing

this region upstream of a truncated CaMV 35S promoter/CAT coding region construct,

followed by transformation and regeneration of tobacco plants, indicated the presence of a

negative LRE which suppresses transcription of this chimeric gene in the dark

(Kuhlemeier et al., 1987a).

General repositioning and deletion studies of cis-acting regulatory elements of the

light regulated pea gene promoters by in vitro mutations and analysis in transgenic plants

localized regions within the promoter which allowed for a more fine-tuned analysis by

more specific promoter mutation experiments. A 5' deletion into box II of the rbcS-3A








promoter (to -149) drastically reduced light regulated expression in tobacco plants

(Kuhlemeier et al., 1987a). This promoter with sequences extending upstream to -175

conveyed light regulation, but point mutations within box II abolished transcription and

mutations within box III reduced transcription by 95% in transgenic tobacco (Kuhlemeier

et al., 1988). A second construct possessing the pea rbcS-3A promoter truncated to -410

expresses light regulated gene activity when boxes II and III are internally deleted

(Kuhlemeier et al., 1987a). This paradox can be explained by the presence of redundant

sequences of boxes II and III, designated boxes II* and III*, which are found within the

-220 region of the promoter. A pea nuclear transcription factor, GT-1, binds to boxes II

and III and to the redundant boxes II* and III* (Green et al., 1987). Results of these

experiments indicate the same transcription factor binds to either set of sequences within

the pea rbcS-3A promoter and deletion or mutation of each region separately does not

disrupt light regulation, but deletion of both simultaneously abolishes expression in

transgenic tobacco. Although the pea rbcS-3A gene has two sets of positive LREs within

its promoter (Kuhlemeier et al., 1988), sequences within the region harboring boxes II

and III are also responsible for repressing transcription of the constitutive CaMV 35S

promoter in the dark and therefore possess a negative LRE (Kuhlemeier et al., 1987a).


Monocotyledonous Gene Promoters



Expression of Monocotyledonous Promoters in Dicotyledonous Plants.

A number of monocot genes have been transferred and analyzed in different

dicotyledonous plant systems. Among these, an oat phytochrome gene was incorporated

into regenerated tobacco plants where it was determined that its own light repressible

promoter could not function (Keller et al., 1989). Only when this gene was placed under

the control of the constitutive CaMV 35S promoter were mRNA and proteins detected.

Similarly, the rbcS gene of wheat could not utilize its own promoter in transgenic tobacco








where again transcription products were only observed when the coding sequence was

fused to CaMV 35S promoter (Keith and Chua, 1986). Alternatively, CAT activity was

observed in transgenic tobacco in an endosperm specific manner when the promoters of

two wheat endosperm protein genes, low molecular weight (LMW) and high molecular

weight (HMW) glutenin, were fused to a CAT reporter gene and incorporated into tobacco

(Colot et al., 1987). In addition, a light inducible and tissue specific cab (chlorophyll a/b

binding protein) gene from wheat was accurately regulated and transcribed in transgenic

tobacco and petunia plants (Lamppa et al., 1985).

The promoter of the wheat cab-1 gene having 1.8 kb of the 5' flanking sequences

fused to CAT coding sequences was shown to confer light and organ specific expression

of this chimeric in transgenic tobacco plants (Nagy et al., 1986). Promoter mutations by

in vitro 5' deletions and subsequent transfer into dicotyledonous tobacco resulted in

comparable expression of chimerics having either 1.8 kb or 357 bp of 5' flanking

sequences, whereas further deletion to -124 resulted in undetectable transcript levels

(Nagy et al., 1987). Further analysis of the wheat cab-1 promoter sequences identified a

region between -357 and -89 as conveying enhancer-like activity upon the heterologous

CaMV 35S promoter in transgenic tobacco (Nagy et al., 1987). Another regulated

monocot gene that is inducible in dicots utilizing its own promoter is the hsp70 gene of

maize in transgenic petunia. Upon thermoinduction this gene is transcribed 40- to 60-fold

higher than in transgenic plants not placed under heat stress (Rochester et al., 1986).

Proper induction and expression of maize hsp70 in petunia is not surprising since the heat

shock genes appear to be highly conserved between eucaryotes as was seen with

expression of the Drosophila hsp70 promoter in tobacco (Spena and Schell, 1987). It is

apparent that the promoters of different monocot genes may be recognized by some

transgenic dicots but not by others, and in those cases where expression is seen, the

heterologous system may be exploited to identify important regulatory elements within

these promoters.







Maize zein genes code for endosperm specific storage proteins that are produced

during seed development (Higgins, 1984). This class of genes consists of about 100

copies per haploid genome and comprise several multigene families (Hagan and

Rubenstein, 1981). Early studies concerned with the cis-acting region of zein genes have

taken advantage of the fact that when members of this gene family are transferred into a

dissimilar plant system by A. tumefaciens, they are fortuitously expressed in the crown

gall tumor cells. An advantage of tumor expression studies is its avoidance of lengthy

periods needed for regeneration of transgenic plants. A second advantage is the

reproducibility obtained by pooling large numbers of tumors. Promoter mutation analysis

in pooled transformed primary tumor tissue can be performed with little concern to

position effect as seen in transgenic plants (Kuhlemeir et al., 1987; Willmitzer, 1988, for

reviews). Data gathered from these types of experiments which map promoter elements

may then be correlated with regions of the promoter identified by in vitro DNA binding

assays. This avenue of experimentation has been utilized in the investigation of the

monocotyledonous maize zein genes in Agrobacterium transformed dicots. Matske et al.,

(1984) transformed sunflower stemlet hypocotyl tissue with the zein gene (Z4) of maize

using an A. tumefaciens based vector. This highly regulated gene was transcribed at low

levels in sunflower tumor cells utilizing the same two transcription start sites recognized in

maize endosperm, but no protein products were detectable (Matzke et al., 1984). Two

additional zein genes were similarly incorporated into sunflower plantlets where again

each was transcribed at low levels utilizing the recognized transcription start and

termination sites in cloned tumor tissue (Goldbrough et al., 1986). Again, no protein was

detected (Goldbrough et al., 1986). Rousell et al., (1988) analyzed the upstream flanking

region of a zein gene (gZl9abl) with a number of 5' deletions fused to a CAT reporter

gene in sunflower tumor tissue. They reported that promoter sequences between -337 and

-125 relative to the CAP site were necessary for efficient transcription, whereas deletions

within 125 bp upstream of the CAP site greatly reduced transcriptional activity. The








assignment of a cis-element to this region of the zein promoter correlated with the

identification of a 22 bp protein binding site centered at -320. The binding site had been

identified by in vitro DNA-protein interactions utilizing maize endosperm nuclear extracts

(Maier et al., 1987). A region of 15 bp was identified as being a conserved promoter

sequence similarly located in all zein genes (Brown et al., 1987). From these results a

correlation can be seen between promoter deletion experiments of a monocot gene in dicot

tumor tissue and the factor binding assays with homologous nuclear extracts. This

correlation suggests that analogues of nuclear factors responsible for endosperm-specific

expression of zein in maize are present in dicots where they presumably regulate unrelated

gene families.


The Anaerobically Induced Maize Alcohol Dehydrogenase-1 (Adhl) Gene of Maize.

When a maize plant is subjected to anaerobic stress there is a switch from oxidative

respiration to ethanolic fermentation (for reviews see Dennis et al., 1987; Kloeckener-

Guissen and Freeling, 1987). Activity of the aerobic proteins decline in maize roots and

within one hour of hypoxia there is an accumulation of transitional proteins. The

abundance of these transitional proteins quickly declines with the subsequent accumulation

of 10 major and 10 minor anaerobic proteins (ANPs) which make up over 70% of the total

protein in the root (Sachs et al., 1980). The ANPs of the major class thus far identified

are associated with the glycolytic pathway. These include sucrose synthase (Springer et

al., 1986), pyruvate decarboxylase (Laszlo and St. Lawrence, 1983), glucose phosphate

isomerase (Kelley and Freeling, 1984a), fructose 1,6-diphosphate aldolase (Kelley and

Freeling, 1984b), and alcohol dehydrogenase (Freeling, 1973). There are two alcohol

dehydrogenase (Adh) genes of maize, Adhl and Adh2. Adhl is located in single copy on

the long arm of chromosome 1 and Adh2 in single copy on the short arm of chromosome

4 (Schwartz, 1971). The transcription products of each gene encodes for a polypeptide







which combine to form either enzymatically active homodimers (ADH1-ADH1 or ADH2-

ADH2) or heterodimer (ADH1-ADH2) (Freeling, 1974; Ferl et al, 1979).

The expression of Adhl is essential for the survival of a maize plant subjected to

extended periods of hypoxia. Regulation of the Adhl gene is at the mRNA level (Ferl et

al., 1980; Rowland and Strommer, 1986). Within two hours of anaerobic stress it is

transcriptionally expressed in roots. When plants are continuously stressed, transcript

levels increase 50-fold after about 5 hours and remain at steady state levels until plant

death (Gerlach et al., 1982, 1983; for review see Freeling and Bennett, 1985). ADH1 is

not seen in leaves (Okimoto et al., 1980) even after anaerobic stress, but is present in

pollen and the scutellum within maize kernels in both aerobic and anaerobic environments

(Freeling and Schwartz, 1973). The Adhl-S gene (S refers to slow electrophoretic

mobility) encodes a 3.4 kb transcript possessing nine A-T rich introns which are spliced to

form a final 1,650 bp mRNA (Dennis et al., 1984). This gene has a TATA box and a

putative CAAT box common to many eukaryotic genes (Dynan and Tjian, 1985).
Transgenic plant expression systems have been utilized in an attempt to identify

regulatory elements responsible for the anaerobic induction and transcript stability of

Adhl. Llewellyn et al. (1985) utilized Agrobacterium tunefaciens to transfer maize Adhl

into Nicotiana tobacum and Nicotiana plubagimfolia. The transferred Adhl gene

possessed 1.1 kb of 5' flanking sequences, its coding region, and about 3.0 kb of 3'

flanking sequences. Negligible expression of this monocot gene was observed in tumor

tissue of tobacco that had been subjected to anaerobic stress by argon for four days. This

same promoter, including its untranslated leader sequence, was fused to a CAT reporter

gene and transformed tobacco plants (Nicotiana tobacum) were regenerated (Ellis et al.,

1987). Again, the Adhl promoter showed only minimal expression in tobacco after 18

hours of anaerobic stress. Upstream sequences possessing enhancer-like activity from

either the octopine synthase (ocs) gene or the CaMV 35S gene were then placed upstream

of the -140 position of the Adhl/CAT fusion construct. Upon anaerobic induction, CAT







activity could be detected in transformed tobacco with transcription initiating at the proper

start site. Thus, the sequences between -140 and +106 of Adhl were identified as

harboring the regulatory region responsible for the anaerobic response. This response

element is weakly recognized in transgenic tobacco plants and only upon addition of an

upstream enhancer-like element could the induced response mimic that of Adhl in maize

(Peacock et al., 1987).

The entire maize Adhl gene was transformed into maize protoplasts by

electroporation where it was efficiently expressed at both transcription and protein levels

(Callis et al., 1987). An Adhl promoter/CAT coding region construct has also been

electroporated into maize protoplasts and activity determined (Howard et al., 1987)

whereupon CAT activity was observed upon anaerobiosis in this homologous transgenic

system. While these early studies merely demonstrated activity of Adhl in transgenic

systems, Walker et al. (1987) enlisted this homologous transgenic system to perform a 5'

deletion series study on the Adhl promoter. The promoter deletion extending 1094 bp

upstream from the transcription initiation site as previously observed by Howard et al.,

(1987) allowed for increased levels of transcription upon anaerobic induction. The 5'

deletion to the -140 site was still induced by anaerobiosis but the quantity of the gene

products were reduced 25%. Further deletions to -124 and -112 resulted in anaerobic

induction, but to a lesser extent than the two previous deletions with transcriptional

expression at very low levels. A final deletion to -99 eliminated both anaerobic induction

and constitutive expression of the gene. Lee et al., (1987) performed a similar set of 5'

deletions of the Adhl promoter fused to a CAT reporter gene and transformed into maize

protoplasts. Their 5' deletion series included 3 constructs extending 1,094 bp, 410 bp,

and 140 bp upstream of the initiation site. The -410 deletion decreased expression of this

chimeric 35% with the further deletion to -140 resulting in 18% activity compared to the

-1094 promoter. This last value differs from the 75% activity of the same construct

observed by Walker et al. (1987). Linker scan experiments were performed through the







Adhl promoter which identified a region (-140 to -99) responsible for increased

transcription levels upon anaerobic induction (Walker et al., 1987). The anaerobic

response element (ARE) is subdivided into two functional domains, regions I (-140 to

-133) and II (-133 to -99).

Representative examples of constitutive and inducible plant gene promoters and

their analysis in different plant systems have been presented. Data gathered by these

experiments have been valuable in identifying DNA sequences that comprise promoter

elements that mediate regulated transcriptional control of plant genes. The ability of some

monocotyledonous gene promoters to be recognized and properly expressed in

dicotyledonous plant systems, particularly the analysis of the cis-acting regulation of

maize zein genes in sunflower tumors suggests that similar experiments were feasible with

the maize Adhl gene. The present study entails the transformation of maize Adhl into

sunflower seedling hypocotyls via an Agrobacterium vector and characterization of

transgenic expression in response to anaerobic stress. The objective was to detect

transcription mediated by this foreign gene in dicotyledonous sunflower and investigate

any regulatory similarities between maize and sunflower. A comparison was made

regarding the ability of the gene to be induced by anaerobiosis, efficiency of expression,

and the length of time required for maximum expression. The second phase of this project

localized important regulatory regions of the promoter recognized in sunflower by in vitro

mutagenesis of the promoter and analysis of transcription in response to anaerobic stress.












CHAPTER 2
TRANSCRIPTIONAL EXPRESSION OF MAIZE Adhl
IN SUNFLOWER TUMORS


Introduction


Agrobacterium tumefaciens is a Gram negative bacterium that has the ability to

integrate a specific portion (T-DNA) of its tumor inducing plasmid (pTi) into the genome

of a wide variety of dicotyledonous plants (Hooykaas et al., 1984; Nester et al., 1984;

Binns and Thomashow, 1989; for review). This natural gene transfer system between

A.tumefaciens and higher plants has been exploited as a means of introducing foreign

DNA into plant cells (Matzke and Chilton, 1981; Caplan et al., 1983). The experimental

strategy often involves the insertion of the cloned gene of interest into an intermediate

shuttle vector which is used to transfer genes from Escherichia coli to Agrobacterium by

triparental conjugation (Comai et al., 1983; Fraley et al., 1983) where it is incorporated

into the T-DNA by cointegration via homologous recombination. The modified T-DNA is

transferred to the plant cell by Agrobacterium and subsequently incorporated into the

genome.

Transgenic expression of a number of plant genes has been obtained using T-DNA

based vector systems. In most cases the foreign gene is transcriptionally expressed in the

heterologous plant system in a manner that closely resembles its expression in the original

plant. There are numerous cases illustrating this faithfulness of transcription of genes in

different plant species. One example of the fidelity of transgenic expression is seen in the

tissue and developmentally specific expression of the seed storage gene for phaseolin from

the French Broad Bean (Phaseolus vulgaris) in transformed tobacco seedlings







(Sengupta-Gopalan et al., 1985). In this case, transcript levels for phaseolin were 1000-

fold lower in the leaves and stem, but quite abundant in seeds where it is naturally

expressed in Phaseolus.

T-DNA based vector systems have been used to transfer genes from

monocotyledonous plants into the genomes of dicotyledonous hosts. Although

Agrobacterium predominantly infects dicotyledonous plants, there is no a priori reason to

expect that individual genes from these two plant groups will exhibit fundamentally

different mechanisms for the regulation of gene expression at the molecular level. The

best example of a monocot gene functioning in a dicot is seen with the wheat gene

whAB1.6 (Lamppa et al., 1985) which encodes the chlorophyll a/b binding protein.

Expression of this gene proved to be both light regulated and organ-specific in regenerated

plants of both tobacco and petunia. Another example of a monocot gene transferred into a

dicot host is a zein gene of maize in sunflower tumors (Matzke et al., 1984). Low level

transcriptional expression of this highly regulated gene was seen to occur in tumor tissue

cloned from a single transformed cell.

The use of tumor tissue (or tumor-derived callus cultures) to study heterologous

expression of plant genes is especially well suited for genes showing little, if any, tissue

or developmental specificity in their regulation. Tumors may also serve as an

experimental system to characterize the inducible aspects of heterologous gene expression

separately from tissue and developmental specificity. An example of a gene that may

possess both tissue specific and general inducibility is maize Adhl. In maize this gene is

transcriptionally inducible by anaerobic stress, such as flooding (Freeling, 1973), in a

tissue specific manner. In addition, its gene products are present at constitutive levels in

the scutellum of the kernel (Freeling and Schwartz, 1973), whereas in leaves activity is

not present in nonstressed conditions, nor is it inducible by anaerobiosis (Okimoto et al.,

1980). The Adhl gene is also induced by anaerobiosis in maize roots (Ferl et al., 1980).

The mRNA increases about 50-fold after induction (Dennis et al., 1984) reaching this







level about 5 hours after initiation of anaerobic stress and remains at this high level for at

least 48 hours.

In the initial stages of this study, the Ti plasmid of Agrobacterium tumefaciens

strain 15955 was used as a vector to introduce the alcohol dehydrogenase 1 gene (Adhl)

of maize into the genome of sunflower. Transcriptional expression was characterized in

uncloned tumor tissue. Primary tumors from infected sunflower hypocotyls were placed

under anaerobic stress (flooding) for various lengths of time and analyzed for

transcriptional expression. We have shown by RNA blot hybridization and S 1 nuclease

hybrid protection mapping that the maize Adhl gene was incorporated into transformed

sunflower cells, and transcribed specifically in response to anaerobic stress utilizing its

natural promoter.


Materials and Methods


Transfer and Incorporation of Adhl into the Ti Plasmid.

The recombinant plasmid pB428-W9 containing the maize Adhl gene was

transferred into A.tumefaciens by tripartite conjugation (Comai et al., 1983; Fraley et al.,

1983). Three Gram negative bacteria were mated: E. coli strain SK1590 (Kushner, 1978)

containing the chloramphenicol resistant intermediate vector pB428-W9, E. coli LE392

(Murray et al., 1977) containing the kanamycin resistant helper plasmid pRK2013 (Ditta et

al., 1980), and the streptomycin resistant A.tumefaciens strain possessing its wild-type

pTi. Cultures of each were grown in 50 ml of Luria broth (LB) containing appropriate

antibiotics: overnight cultures of E. coli SK1590 harboring pB428-W9 (chloramphenicol,

20 tg/ml), and E. coli LE 392 containing pRK2013 (kanamycin, 50 gg/ml), and a two

day old culture of A. tumefaciens strain 15955 (streptomycin, 250 g.g/ml). Cells from 3

ml of each culture were pelleted by centrifugation at 4,000 xg for 10 min, washed in 10 ml

of sterile 10 mM MgSO4, and resuspended in 3 ml of LB containing no antibiotics. The







cultures were then mixed in equal proportions, and 100 gl to 300 tl of the mixture

transferred to an LB agar plate for mating (48 hr, 280C). The bacterial cells from the
tripartite mating were suspended in 2 to 3 ml of 10 mM MgSO4 and 100 to 200 ptl was

spread onto plates of LB containing streptomycin (250 pgg/ml) and chloramphenicol (20

gg/ml). The selection plates were incubated at 280C for 5 days to allow integration of the

shuttle plasmid with the pTi and colony growth to occur. Confirmation that colonies were

A. tumefaciens was obtained by a positive ketolactose test (Bernaerts and DeLay, 1963).

Incorporation of the Adhl gene into the pTi was demonstrated by Southern hybridization

(Southern, 1975) of immobilized pTi using a radioactively-labeled restriction fragment

(XbaI to KpnI of pB428; Dennis et al., 1984) corresponding to the coding region of Adhl

as the probe.


Tumor Growth.

Sunflower (Helianthus annus, cv. Large Grey) seedlings were inoculated with A.

tumefaciens containing the engineered pTi (pTi15955:pB428-W9) plasmid. A.

tumefaciens was grown in 50 ml of LB containing antibiotics for 2 days at 280C and used

to inoculate (syringe wounding) the hypocotyls of 6 to 8 day old seedlings. Plants were

grown indoors under fluorescent lights with a 16 hr light/8 hr dark cycle. Tumors were

harvested from 12 to 16 days after inoculation.


Induction of Adhl by Anaerobic Stress.

Sunflower tumors and maize roots were placed under low oxygen conditions in an

attempt to induce activity of Adhl. Immediately upon harvesting, the tumors were placed

into incubation media consisting of 1% sucrose, 1 mM KPO4 buffer (pH 6.0), and 100

pg/ml of rifamycin (modification of Gurley et al., 1986). Argon gas was bubbled through

the media for about 20 min to reduce the level of 02 before the containers were sealed.

After 1 to 24 hr of anaerobic stress, the tumors were frozen in liquid nitrogen and stored at







-800C. Maize (Dekalb XL-80) roots from 3 to 4 day old seedling were used as a control

for induction. The maize seedlings were fully submerged in water in the dark for 24 hr.

The root tips were then harvested and immediately frozen.


Analysis of Inducible Transgenic Expression.

Inducible expression of maize Adhl in stressed and unstressed tumors was

examined by RNA blot hybridization and Si nuclease hybrid protection mapping of

polyadenylated RNA. Total RNA was extracted by the

triisopropylnaphthalenesulfonate/para-aminosalicylate (TNA/PAS) method (Jackson and

Ingle, 1973) as modified by Czamecka et al., (1985). Poly(A)+RNA was fractionated by

oligo(dT)-cellulose chromatography (Silflow et al., 1979).

Northern blot hybridization of poly(A)+RNA was used to evaluate the length of

the Adhl message and to assess inducibility of the gene after exposure to stress for
various lengths of time. The poly(A)+RNA (10 gig to 20 gjg) was fractionated by

electrophoresis on a 2% (w/v) agarose, 6% (v/v) formaldehyde gel (Rave et al., 1979) and

directly transferred to nitrocellulose filter paper (Thomas, 1980). The transferred

poly(A)+RNA was hybridized with either nick translated maize Adhl cDNA from

pZML793 (Dennis et al., 1984), or an internally labeled single stranded bacteriophage

M13 (mp8) probe (Church and Gilbert, 1984) specific to the 5' portion (HaeIIl/TaqI

fragment; -90 to +85) of the gene.

Sl nuclease hybrid protection mapping (Favaloro et al., 1980) was used to

analyze the transcription start site of maize Adhl in both tumor cells and maize roots. A

Hinfl fragment from the 5' region of the gene was 5' end labeled (Maxam and Gilbert,

1980) and then digested with PstI leaving a 215 bp fragment, PstI to Hinfl (-140 to +77),
labeled at the Hinfl site. This probe was mixed with 40 to 50 p.g of poly(A)+RNA from

sunflower tumors in a total volume of 10 til of hybridization solution (40 mM piperazine-

N,N'-bis[2-ethane-sulfonic acid] buffer, pH 6.0, 400 mM NaCI, 1 mM EDTA, and 80%







formaldehyde) overlayed with 15 11 of mineral oil, and heat denatured at 850C for 15 min.

Hybridization was at 450C for 12 to 18 hr which was followed by digestion with S1

nuclease (200 units/ml) at 150C for 30 min (Czarnecka et al., 1985). The resulting

RNA:DNA hybrids were then fractionated by electrophoresis on an 8% urea DNA

sequencing gel and autoradiographed with X-ray film (Kodak SB-5) with intensifier

screens at -800C for 24 to 60 hours. Analysis of Adhl promoter 5' deletions by S1

hybridization was done by the excision of radioactive bands from the gel and

quantification by Cerekov counting.


Results


Construction of the Intermediate Vector Plasmid.

The Adhl gene has been isolated and characterized by Dennis et al., (1984), and

has been shown by genetic studies (Schwartz, 1966) and Southern blot hybridization

analysis (Dennis et al., 1984) to exist in single copy in maize. The complete gene is

contained in plasmid pB428 (Dennis et al., 1984) which consists of an 11.4 kb fragment

inserted into the BamHI site of pBR322 (Bolivar et al., 1977). This restriction fragment

includes 1.5 kb of DNA 5' to the transcription start site, the coding region (with 9 introns)

and about 6 kb of downstream sequences (Fig. 2-1). Excess sequences 3' to the gene

were removed by subcloning an 8 kb BamHI to KpnI fragment containing Adhl into an

intermediate vector (shuttle vector).

The intermediate vector used to transfer the Adhl gene to A. tumefaciens was

designated pW9 (Bruce and Gurley, 1987) and consisted of a 4,158 bp fragment of

pT15955 T-left DNA (sites 9062 to 13220 bp, Barker et al., 1983) ligated into the BamHI

and SphI restriction sites of the chloramphenicol resistant, broad host range plasmid

pACYC184 (Chang and Cohen, 1978). The T-DNA fragment was derived from the

pBR322-based plasmid p223G (provided by Dennis Sutton, Agrigenetics Advanced























.5


1 23 4 56 78 9 10
SOl moo IIOm


pBR322 %
%% %
S


/


I- I-


-U


Adh-1


Bamrn H1

pB428














Fig. 2-1. Schematic representation of pB428 (Dennis et al., 1984). This plasmid
contains an 11.4 kb BamHI fragment harboring the maize Adhl gene in the unique
BamHI site of pBR322 (Bolivar et al., 1977). Exons are represented by black boxes with
corresponding number designation listed above each. Introns are depicted by white boxes
between the exons. Important restriction sites and their position with respect to the start of
transcription are presented.


II


I


----A







Research Division, Madison, WI) in which the Smal site in the gene corresponding to

transcript 6b was changed to BglII by linker addition. After removal of a 776 bp BamHI

to KpnI fragment from pW9, the Adhl BamHI to KpnI fragment was inserted by

ligation. The resulting 15.4 kb intermediate vector containing the Adhl gene was

designated pB428-W9 and is shown in Figure 2-2.


Transfer and Incorporation of Adhl into the Ti Plasmid.

Tripartite conjugation (Comai et al., 1978; Fraley et al., 1983) results in the

eventual transfer of the recombinant plasmid from E. coli into the recipient A.

tumefaciens. Since the intermediate vector plasmid was a derivative of pACYC184, it

could not transfer unassisted into A. tumefaciens. The plasmid pRK2013 containing the

transfer genes from pRK2 (Figurski and Helinski, 1979) was utilized to achieve conjugal

transfer of pB428-W9 into Agrobacterium. Tripartite matings resulted in colonies of

transconjugant A. tumefaciens which possessed the ability to grow in the presence of

chloramphenicol. Since the shuttle plasmid has an E. coli replicon with a limited host

range, it cannot replicate autonomously in A. tumefaciens. The simplest explanation for

the acquisition of chloramphenicol resistance by A. tumefaciens was by co-integration of

the shuttle plasmid into the T-DNA of the pTi (Fig. 2-3). Confirmation of shuttle

plasmid:Ti plasmid cointegration was obtained by Southern hybridization analysis of the

Ti plasmid with an Adhl probe (Fig. 2-4).

Single homologous recombination of pB428-W9 with pTil5955 resulted in

incorporation of the shuttle plasmid in the T-left region of the T-DNA (Fig. 2-3). This

incorporation generated a duplication of the T-DNA genes 6a and 6b and a partial

duplication of the octopine synthase gene (lacking promoter sequences). The extra copy

of the gene corresponding to transcript 6b was probably not functional in the plant since

the reading frame was disrupted by the BglII linker at the former Smal site.



















Bam H1 Bam H1
Kpn I Kpn I
* Isolate fragment Isolate fragment


Kpn I


7.7 kb


SaIl
Sph I
(13220)


Bam H1


KpnI
(9838)


3.4 kb


3.4 kb


Fig. 2-2. Cloning scheme for shuttle vector pB428-W9. Location and
transcriptional orientation of represented genes are designated by arrows within plasmids.
Origin of plasmid DNA and important restriction sites are as labeled. Numbers within
parenthesis designate position of restriction sites within octopine-type Agrobacterium
15955 T-DNA (Barker et al., 1983). Legend: Apr, ampecillin resistance; Cpr,
chloramphenicol resistance; ocs (octopine synthase), 4, 6a, and 6b represent T-DNA
genes of Agrobacterium 15955 (Willmitzer et al., 1981). Dotted lines (gene 4 and ocs)
portray lack of promoter sequences.













Q r=
u d H d 3 u, 6 -o- ~

E




booo
0 >:







4.4



Z~r (A 00U
o -o.O o'-0
H1 0 v-.4 0~
C.)O


"o 0





OJ 0
0: o U r












r- 0
S 0.
bo"O X.O














n C) U~i ~ O ;





a C)
04- s Zn






















GU 0
c M u .O U 0 = i:
"t "?~ cud (A o Cd o


El C a E 8> CQc


tu o C cl t >
c ea f3 (U
rZ 0o



> -'r.

r. cl 00 W

toP~


C,~~

4 U CO v o c) Oc0'
c o<
o =0~an ,y



boo r.~;3 v ,


0~5
F 00v o C
'o, = 0











1=


(Or
10

404
-t


T-


to
-r

0




CM


L,;














3 4 5 6 7 8 9 10
-fqvP~E -I


A













B


^ *& **soft


TI
plasmid



, Chromosomal
S DNA






STI
- plasmid




Chromosomal
DNA


Fig. 2-4. Confirmation of Adhl incorporation into Ti-plasmid. (A) Ethidium
bromide stained DNA from nine different colonies (lanes 1-9) of Agrobacterium that grew
on selection plates after tripartite matings (see Materials and Methods). Non-transformed
Agrobacterium control (lane 10). (B) Southern blot analysis of samples described in A.
Hybridization was to a nick-translated (Rigby et al., 1977) DNA probe harboring the
Adhl genomic clone (see Materials and Methods). Intact Ti-plasmids and bacterial
chromosomal DNA are designated.


4 5 6 7 8 9 10


.1


1 2 3







Analysis of Transcriptional Expression of Maize Adhl in Primary Tumors.

Hypocotyls of sunflower seedlings were infected with A. tumefaciens harboring

pTil5955:pB428-W9. Tumor tissue developed at the wound sites indicating that the T-

DNA, and thus the maize Adhl gene, had transferred into the genomes of sunflower cells.

These tumors, which were 70 to 80% the size of tumors that formed on seedlings infected

with wild-type A. tumefaciens strain 15955, were harvested and anaerobically stressed.

Poly(A)+RNA was isolated from the tumor tissue and assessed for levels of maize Adhl

RNA.

Sunflower tumors synthesized endogenous Adh mRNA in response to anaerobic

stress. This conclusion was based on the hybridization (Fig. 2-5) of immobilized

poly(A)+RNA from tumors inoculated with A. tumefaciens harboring either the naturally

occurring pTi15955 or the engineered pTi15955:pB428-W9 with nick translated maize

Adhl cDNA from pZML793 (Dennis et al., 1984). The sunflower transcripts were

slightly smaller than the 1,650 bp maize Adhl mRNA (Gerlach, et al., 1982) (Fig. 2-5,

lanes labeled M). The cross-hybridization of the maize cDNA with the mRNA of the

endogenous sunflower Adh gene gave an indication of the level of sequence conservation

between these two species of plants, and also indicated the level of transcriptional

induction of Adhl in tumors.

There was low level of hybridization to poly(A)+RNA from uninduced tumors

(Fig. 2-5, lanes A and B; 0 hours) incited by wild-type pTi and by pTi15955:pB428-W9.

After 1 hr of anaeobic stress, only tumors incited by pTi15955:pB428-W9 showed an

increase of Adhl mRNA levels. A dramatic increase in Adhl RNA levels was seen in

both types of tumors after flooding for 3, 6, 9, and 12 hr. Although the earlier induction

of Adhl in tumors incited by pTil5955:pB428-W9 compared to tumors containing

pTi15955 was not expected, the overall results indicate that sunflower tumors provide a

suitable experimental system to study the anaerobic response.











0 1 3 20 6 9 12 20
rA Bi 5A BA 5A BB M iA BI 'A BI 5A BI M





4 1
1 ? r


II


i.


Fig. 2-5. Northern blot and time course analysis of poly(A)+RNA. Messenger
RNA (14 pg) from control tumors formed after inoculation with wild type Agrobacterium
15955 (lanes A) and tumors infected with Agrobacterium possessing the Adhl gene in T-
DNA (pTi15955:B428-W9) (lanes B). Lanes M contain poly(A)+RNA (1 tg) from roots
of anaerobically stressed maize seedlings. Time (hours) that tumors and roots were
subjected to anaerobic stress (see Materials and Methods) are indicated. Blots were
probed with nick-translated maize Adhl cDNA from pZm793 (Dennis et al., 1984). Solid
arrow indicates location of processed mRNA. Open arrows indicate location of larger
transcripts (see text).


ALD


r.a

t i:







The cDNA probe also hybridized to two large transcripts (3 to 4 kb and 6 to 10 kb)

present in the poly(A)+RNA isolated from anaerobically stressed tumors containing the

maize gene (Fig. 2-5; lanes labeled B; hrs. 3, 6, 9 and 12). These larger transcripts were

not seen in lanes containing poly(A)+RNA from control tumors or maize roots. From this

type of analysis using the cross-hybridizing cDNA probe, it was unclear whether the

introduced maize Adhl gene was transcriptionally expressed in the heterologous system.

In order to specifically detect the transcripts derived from the maize gene in the

presence of endogenous Adh RNA, a second RNA blot analysis using an M13-derived

(Church and Gilbert, 1984) strand specific probe was utilized. The internally labeled

probe consisted of a HaeII (-90) to TaqI (+85) fragment of the maize Adhl gene cloned

into M13 bacteriophage mp8 (Fig. 2-6). This probe was complementary to 85 bases of

untranslated 5' leader sequence of maize Adhl RNA.

The ability of this probe to hybridize specifically to maize Adhl transcripts was

substantiated by RNA blot analysis. Hybridization was seen between the leader specific

probe and poly(A)+RNA of anaerobically stressed tumors harboring the foreign Adhl

gene; there appeared to be only slight hybridization with transcripts that were the same size

as processed maize Adhl mRNA (1,650 bases) (Fig. 2-6). In contrast, prominent

hybridization occurred which corresponded to the two larger transcripts previously

observed (Fig. 2-5) with the nonspecific cDNA probe (Fig.2-6; lanes labeled B; hrs. 1, 3,

6, 9, and 12). The specificity of the leader probe was confirmed, since poly(A)+RNA

from sunflower tumor tissue incited by control A. tumefaciens 15955 did not hybridize

with the probe (Fig. 2-6; A lanes), whereas a 1,650 base message from maize roots

hybridized quite readily (Fig. 2-6; lane M).

The RNA blot hybridizations indicate that the transgenic maize Adhl gene in

primary sunflower tumor tissue was transcriptionally expressed in an anaerobically

inducible manner. Processing of the RNA (intron removal or proper termination),

however, appeared to be aberrant. Failure to splice the nine introns of this transcript is









1 3 20
A 1 A B1 "


6 9 12 20
iA BI IA B1 A B1 M 0


I*1


Ii


E


Adhl


Hae III
-90


TATA
-31


RNA
TaqI
*1 +85 ATG


Insert


.4,Mpg


Probe


primer
MvV/N


Fig. 2-6. Northern blot probed with maize Adhl specific probe. Experimental
parameters are as in Figure 2-5. Internally labeled (Church and Gilbert, 1984) maize
Adhl specific probe harboring 90 bp of 5' flanking and 85 bp of leader sequences is
illustrated. Lane "(" contains end labeled HaelII generated OX174 markers with size
designations.


0
'A BI


.1353


.872


I
I
I
1
I
I







predicted to yield a 3.4 kb message which roughly corresponds to the size of the smaller

of the two large transcripts. Further experiments that address the identity and origin of the

largest hybridizing RNA are discussed below.

Sl hybridization protection mapping was performed on poly(A)+RNA isolated

from primary tumors and maize roots in order to determine if the transgenically expressed

Adhl gene used the same transcriptional initiation site preferred in maize. An end-labeled

probe that consisted of 140 bp of DNA upstream of the reported start site for the maize

gene (Dennis et al., 1984) and 77 bp of DNA complimentary to the mRNA leader

sequence was utilized. No bands were detectable by S1 nuclease hybrid protection

mapping of RNA from control tumors (Fig. 2-7; A lanes) indicating the specific nature of

the probe. In contrast, an S 1 nuclease protected band from RNA isolated from stressed

tumors containing the maize Adhl gene was obtained (Fig. 2-7; B lanes; 1, 6, and 9 hr)

that precisely coincided in length with the protected fragment obtained from maize root

RNA (Fig. 2-7; lane M). Additional higher molecular weight transcripts which formed an

RNA:DNA hybrid over the entire 217 bp DNA probe were also present suggesting the

presence of anaerobically inducible readthrough transcription initiating upstream of the

natural start site.


Splicing of Adhl transcripts in primary tumors.

S hybridization protection analysis was employed to investigate the splicing of

Adhl transcripts in sunflower tumor cells A DNA probe was labeled at a HindII site

within the first intron and consisted of 1,094 bp of untranscribed 5' flanking sequences

and the first 213 bp of the transcribed region of the gene (Fig.2-8, DNA probe "a", panel

C) (Dennis et al., 1984). No protection was observed when hybridized to mRNA from

maize roots subjected to flooding (Fig. 2-8; panel A, lane 5). Conversely, a 213 bp

fragment was protected from S1 nuclease digestion by mRNA from tumors with

incorporated Adhl stressed for six hours (Fig. 2-8; panel A, lane 4) indicating that at least









20 0 1
0M t rA BA B'


234--

194.-







118* -


6 9 20
-A B'A B'M


full length
"<" probe


-p I


72.


Pst I
-140


TATA
-31


protected
"- fragment






Hinf I
+77


DNA probe *


RNA


Fig. 2-7. S1 nuclease hybridization protection and time course analysis of
poly(A)*RNA. The 217 bp 5' end labeled (*) hybridization probe is illustrated. Poly
(A)+RNA (1 ag) from maize roots (lane M) and from primary tumors (16 lg) and lengths
of time tissues were subjected to anaerobic stress are as previously described. Control
lane "t" contains 22.4 plg of tRNA from Baker's yeast (Sigma).






















Fig. 2-8. S1 nuclease hybridization protection analysis of maize Adhl in
sunflower tumors. (A) Hybridization to poly(A)+RNA with DNA probe (a) 5' end
labeled at +213 within intron 1. Lane ")" is as previously described. Lanes 1 and 2
contain 15 gLg of poly(A)+RNA isolated from control sunflower tumors formed with wild
type Agrobacterium 15955, uninduced or anaerobically stressed for 6 hours, respectively
(see Materials and Methods). Lanes 3 and 4 contain 15 gg of poly(A)+RNA isolated from
tumors formed after infection with Agrobacterium harboring pTi15955-pB428-W9,
uninduced or anaerobically stressed for 6 hours, respectively. Lane 5 contains 2 pg of
poly(A)+RNA isolated from maize roots subjected to 22 hours of flooding (see Materials
and Methods). (B) Hybridization to poly(A)+RNA with DNA probe (b) 5' end labeled
within exon 2. Lane designations are as described for panel A. (C) Representation of S
hybridization strategy. Properly processed polyadenylated RNA protect an 118 bp
fragment of probe (b) and those transcripts that maintain intro 1 protect 213 bp of DNA
probe (a) and 773 bp of probe (b). Significant transcript sites are represented. End
labeled (*) probes and predicted protected fragments for each are illustrated. Arrows
indicate protected fragments: solid, predicted fragment; open, non-predicted protected
fragment.














2345


B
012

.
ct -700
r


345


-<- 792


S -N. 213


S118


Hin dill
+1 +213

exon 1


Hin dill

213 bases


Accl
+792

intron xon 2



xon I



Acc I


792 bases


1353.
872.
603-


0 1


o *


234.-



194. *-


118. w -


Bam HI
-1094


DNA probe (a)


DNA probe (b)


118 baes







some polyadenylated transcripts had not processed intron 1. The RNA from control

tumors and the uninduced tumors with maize Adhl showed no protected bands (Fig. 2-8;

panel A, lanes 1-3).

The failure of sunflower tumors to properly splice maize Adhl transcripts was

further indicated by a similar experiment using a DNA probe 5' end labeled within the

second exon (AccI site at +792) (Fig. 2-8). Poly(A)+RNA from the stressed maize roots

resulted in a 118 base protected fragment (Fig. 2-8; panel B, lane 5) that corresponded to

the intron 1:exon 2 splice junction (Dennis et al., 1984) indicating that intron 1 had been

properly spliced from the mature message as expected. Messenger RNA from

anaerobically induced tumors (6 hours) harboring Adhl failed to protect the 118 bp, but

rather hybridized and protected a fragment approximately 800 bp in length (Fig. 2-8; panel

B, lane 4). The 5' terminus of this hybrid protected RNA corresponded with the

transcription start site indicating that the intron was still present in most of the tumor

transcripts of maize Adhl.

These data suggest that little or no transcription products from maize Adhl in

sunflower cells had spliced intron 1 from the mature message. Keith and Chua (1986)

had similar results when analyzing a chimeric construct containing maize Adhl intron 6 in

transgenic tobacco plants. Intron 6 had been inserted between chloramphenicol acetyl

transferase (CAT) coding sequences and the pea rbc-E9 polyadenylation signal of a

construct driven by the cauliflower mosaic virus (CaMV) 35S promoter. They showed

that in tobacco about 70% of the transcripts from this chimeric failed to splice the

intervening intron. This information, together with the banding pattern of the Adhl

transcripts from stressed sunflower tumor tissue in the Northern blots (Figs. 2-5 and 2-6),

imply that all nine introns within RNA derived from this monocot gene are inefficiently

spliced in dicotyledonous plants, at least sunflower and tobacco.







Possible upstream start site.

An interesting observation developed from the Sl hybridization experiments

performed to look at splicing activity. In those lanes addressing transcript processing

from anaerobically stressed tumors, protected fragments appeared that were indicative of a

possible upstream transcription start site. The hybridization experiment using the probe

end labeled within intron 1 not only protected 213 bp of the probe from S1 digestion, but

a fragment of about 700 bp (Fig. 2-8, panel A, lane 4). The second probe end labeled

within exon 2 may have also hybridized and protected a long stretch of DNA extending

1,200 to 1,300 bp upstream (Fig. 2-8, panel B, lane 4). These surprising results suggest

that a second upstream promoter, also under the control of environmental stress, may be

present further upstream (approximately 500 bp) from the known Adhl transcription start

site.

To further investigate the possibility of an upstream start site, a 690 bp DNA

fragment end labeled at an XbaI restriction site, 410 bp upstream of the recognized

initiation site (Dennis et al., 1984), was used in another S1 nuclease mapping analysis.

No protection was observed with transcripts from transformed tumors that had not been

stressed (Fig. 2-9; lane C), nor from maize roots subjected to flooding (Fig. 2-9; lane M).

However, poly(A)+RNA from tumors stressed for six hours protected about 100 bp of the

end labeled probe (Fig. 2-9; lane I) supporting the existence of a second initiation site

approximately 510 bp upstream of the known transcript initiation site. Consistent with

evidence of an upstream start is the presence of TATATTAA sequence approximately 25

to 35 bp further upstream of this possible start. This sequence conforms to the 5'-

TATA(A/T)A(A/T)-3' consensus sequence (Breathnach and Chambon, 1981) usually

found 21 to 35 bp upstream of a transcription start site that functions in positioning the

start of transcription in many eukaryotes (Dynan and Tjian, 1985). On the other hand, no

sequences resembling other proximal promoter elements, such as a CAAT box, are

present upstream of the TATA sequence; instead, this region is highly AT rich (Dennis et



















.122


S110


protected
DNA


gw~PYI


- .90


Bam HI
-1094


Xba I
-410


DNA probe


Fig. 2-9. Examination of possible upstream transcription initiation site by S1
hybridization mapping. The 684 bp Adhl upstream 5' end labeled (*) probe is illustrated.
Hybridization experiments are with 20 gLg each of poly(A)+RNA from tumors harboring
the Adhl gene; uninduce (Lane C) or anaerobically stressed for 6 hours (lane I). Control
mRNA (2 g.g) is from maize roots (lane M). Lane "m" contains pBR322 Hpall end
labeled fragments (lengths are presented). Lane "t" is as previously described.







al., 1984). Primer extension experiments of poly(A)+RNA from sunflower tumors or

maize roots were inconclusive in confirming the existence of an upstream start site (data

not shown).


5' deletions of the maize Adhl promoter and analysis in sunflower.

The Adhl gene of maize has been shown to utilize its own promoter in transgenic

sunflower cells and retain its ability to respond to anaerobic stress. Similar 5' deletion

mutations of the promoter were constructed in an analogous attempt to localize important

sequences involved in transcriptional regulation of the gene in this transgenic system. Due

to the presence of certain restriction sites within the maize Adhl gene, a number of

manipulations were required to construct 5' deletion mutants to positions -410 and -140.

The 8 kb BamHI to Kpnl fragment utilized in previous experiments was subcloned into

pUC19 (Vierra and Messing, 1982) where an EcoRI restriction site from the pUC19

polylinker is proximal to the KpnI site. The BamHI to EcoRI fragment from this

intermediate construct containing Adhl was then subcloned into pBR322. These

manipulations allowed the fragment of interest to reside in a vector void of HindIII

restriction sites. The gene was then "gutted" by removal of a 2.5 kb HindIII fragment

internal to the gene resulting in pAdh-AH (Fig. 2-10). The actual promoter mutations

were constructed by subcloning fragments consisting of Adhl 5' flanking sequences the

5' untranslated leader sequence, and the first 213 bases of the coding region, into pUC19.

The first of these mutations involved the XbaI (-410) to HindIII (+213) fragment which

lacked 684 bp of the most distal 5' sequences. Similarly, the second construct consisted

of a PstI (-140) to HindIII (+213) fragment minus 954 base pairs upstream of the -140

site of the promoter. Each of these promoter deletions subcloned into pUC19 acquired a

BamHI restriction site from the vector's polylinker located immediately 5' to the promoter

deletions. The promoter mutants were then subcloned into the BamHI and HindIII

restriction sites of pAdh-AH which had the wild type promoter excised. Finally, the 2.5















pUC19



Bam H1
Kpn I


Bam H1


pBR322


Hindll


HindIll

* isolate fragment
ligate


Bam H'


Hindll


Bam I


Fig. 2-10. Construction of "gutted" pAdh-AH. Stippled region of plasmids
indicative of genomic sequences from maize containing Adhl; white region represents
designated vector. Location and transcription orientation of Adhl is illustrated by arrow
within bacterial plasmids. Perpendicular line through arrow of pAdh-AH indicates internal
deletion of a 2.5 kb HindIII fragment.








kb HindIII internal fragment was re-inserted in its proper orientation into the pAdh-AH

derivatives resulting in two Adhl genes with intact coding sequences having the promoter

5' deletion to position -410 and -140 (Fig. 2-11). Each of these constructs possessed a

BamHI site at their 5' ends that was essential for ligation of these mutated genes into the

pW9 shuttle vector.

Six hr anaerobically stressed sunflower tumor tissue which contained Adhl 5'

deletion mutations were examined for transcriptional expression by S1 transcript mapping

experiments. Each showed a difference in transcriptional activity compared to that of wild

type (Fig. 2-12; lane -1094-1). The -410 mutant expressed transcription levels

approximately 40% of wild type (Fig. 2-12; lane -410-1). Removal of additional

sequences to position -140 resulted in further reduction of transcript levels to

approximately 15% that of wild type (Fig. 2-12; lane -140-1). Constitutive activity of each

of the constructs was less than 1.5% of the maximum value after induction (Fig. 2-12,

lanes U). Interestingly, these results show a correlation to those of Lee et al. (1987) who

examined expression in homologous maize protoplasts. Also, both 5' deletion mutants

initiated transcription at the proper start site and expression of each gene was inducible.

This indicated that the ARE identified in maize protoplasts (Walker et al., 1987), which is

still present in these deletion mutants, may work in a similar fashion in sunflower.


Discussion



Maize Adhl is a highly regulated, organ specific gene that was able to utilize its

own promoter when induced in transgenic sunflower tumors. Transcription was activated

in response to anaerobic stress and reached steady state levels between 1 and 6 hours after

induction and remained at this level for at least an additional 3 hr. Although it is apparent

that sunflower tumor cells possess transcription factors that are recognized and properly

utilized by regulatory elements of this monocot gene both RNA blot hybridizations and S1













(-140)Pst I


pUC19


isolate
Barn H1/Hn dill
fragment
BamH1

ga tio Pst I


Hin dll Adh-



Pst I 8.81 kb

(410)Xb I H Ar Kpn I
Barn Eco R1
Pst IpBR322
Snsert Hin dill/Hin dill
fragment

Hindill Hindill
Adh-1


pAdh-410
Pst 11.3 kb

(-410) Xba I Ap Kpn I
Barn H1 Eco R1
Pst I pBR322


pUC19


Isolate
BarmH1/Hindlll
fragment


\j .ligation


Adh-1

HIndill
8.54 kb

Kpn I
140)Pst I r co R1
Barn H1
Psti -pBR322|


Fig. 2-11. Construction of the two genomic Adhl 5' deletion promoter mutants,
pAdh-410 and pAdh-140. Origin of sequences within plasmids and Adhl location and
orientation are as previously described. Important restriction sites and position with
respect to the Adhl start of transcription are shown in parenthesis.


(-140) Pst I

(-410) Xba I
Barn H1











-410
IU I


0
234-

194- me






118. e-


II


full length
-l W- probe


I


protected
" -* "" fragment


72- *


Fig. 2-12. Sl nuclease protection analysis of Adhl 5' deletion mutants from
sunflower tumors. Hybridization of the end labeled probe previously described in figure
2-7 was with poly(A)+RNA isolated from tumors formed upon infection with
Agrobacterium harboring maize Adhl transcription units with 5' flanking sequences
extending 1,094 (-1094), 410 (-410), or 140 (-140) base pairs upstream from the
recognized initiation of transcription site. Results of Sl mapping from control
(uninduced) tumors containing 20 gpg of poly(A)+RNA are presented in lanes "U" and
from induced tumors anaerobicallyy stressed for 6 hours) containing 20 .g of
poly(A)+RNA in lanes I. The 77 bp protected fragment is designated. Lanes ")" and "t"
are as previously described.


-140
ru- -- I


-1094
t r







nuclease mapping experiments indicated that the heterologous Adhl transcript was poorly

spliced in sunflower tumors. Proper removal of intron 1 was shown to be all but non-

existent. Northern blot analysis indicated that the other eight introns were also

inefficiently spliced since the most prominent bands correspond to a full length 3.4 kb

unspliced transcript (Figs. 2-5 and 2-6). In the study by Keith and Chua (1986), a

chimeric gene consisting of the wheat rbc coding region under the control of the CaMV

35S promoter was incorporated into transgenic tobacco plants. They demonstrated that

the single intron remained unspliced 10 to 30% of the time, although those that were

spliced did so at the correct splice junctions. To further compare aberrant splicing of a

monocot transcript in a dicot system, this group developed a chimeric gene having either

intron 6 of maize Adhl or the pea rbcS-3A first intron positioned between CAT coding

sequences and the pea rbc-E9 polyadenylation signal. These chimeric genes, driven by

the CaMV 35S promoter, were incorporated into transgenic tobacco. Only about 30% of

the transcripts containing the Adhl intron were spliced, whereas roughly 80% of the

introns from pea were processed from the transcripts.

The results presented in this study differ from those obtained when maize Adhl

was incorporated into the genome of tobacco. Analysis of tumors incited by T-DNA

harboring maize Adhl resulted in no detectable transcript levels (Llewellyn et al., 1985).

When the Adhl promoter was linked to a chloramphenicol acetyl transferase (CAT) gene

and incorporated into transgenic tobacco plants, again there was little evidence of promoter

function (Ellis et al., 1987a). Anaerobically induced CAT activity and proper start site

utilization were observed in tobacco only when the upstream sequences of octopine

synthase (ocs) or cauliflower mosaic virus (CaMV) 35S genes were positioned 5' to -140

of this chimeric gene. Similarly, the developmentally regulated zein promoter showed

activity in cloned sunflower tumor tissue. Although transcripts were detectable, no

proteins were observed (Matzke et al., 1984; Goldbrough et al., 1986). After

incorporation of a maize zein gene into tobacco, poly(A)+RNA could only be detected at







very low levels in the seeds of transgenic plants (Schemthaner et al., 1988). The

promoter was shown to function in a tissue specific manner after it was linked to a

glucuronidase synthase (GUS) reporter gene whose product can react histochemically to

localize minute amounts of activity. Thus, it appears that transcription factors are present

in sunflower tumor tissue that can be recognized and utilized by maize Adhl and zein

promoters. In tobacco the transcript initiation sites of these promoters are recognized but

transcription efficiency seems to be much lower than in sunflower indicating differences in

the abundance, or recognition efficiency, of analogous transcription factors in these two

dicot systems.

Although in the present study splicing of maize Adhl transcription products was

aberrant in sunflower tumor cells, Adhl promoter function was unimpaired. Two 5'

deletions of the promoter and analysis of gene product levels by S1 hybridization indicated

similar promoter strengths in this dicotyledonous system as found by Lee et al. (1987) in

maize protoplasts. In the present study deletions of sequences upstream of position -410

and -140 did not release the promoter from anaerobic regulation but resulted in a

substantial reduction in activity to 40% and 15% of wild type, respectively. Adhl

promoter analysis in homologous maize protoplasts showed about 65% and 18% activity

for the same promoter mutations compared to wild type activity (Lee et al., 1987).

Results of the -410 deletion in protoplasts superficially appear to differ from sunflower,

but the activity in the protoplast study was actually an average of 7 different experiments

in which the data fluctuated anywhere from 100% to 42% of wild type activity. Walker et

al. (1987) also performed a similar promoter analysis of the Adhl promoter linked to a

CAT reporter gene in maize protoplasts. They reported that a 5' deletion to the -140

position was still induced by low oxygen tension, but the transcript level was 75% of wild

type. They also localized the region that is necessary for anaerobic induction (anaerobic

response element; ARE) between -140 and -99.







Analysis of RNA derived from the maize Adhl gene suggested that in sunflower

tumors a small portion of the transcripts initiated approximately 520 bp upstream of the

proximal start site. The DNA sequences at this putative upstream start site are relatively

AT-rich and may contribute to the production of spurious bands in an S1 nuclease hybrid

protection assay due to the reannealing of the DNA probe and subsequent cleavage at

regions of partial denaturation. This possibility seems unlikely in this case, however,

since under identical hybridization conditions the appearance of the high molecular weight

bands were strictly correlated with RNA from anaerobically stressed tumor cells harboring

maize Adhl. We are left with the possibility that maize Adhl has a second promoter

corresponding to the upstream start site.

The existence of linked dual regulatory sites for Adhl (F allele) has previously

been hypothesized by Schwartz (1976a, 1976b) and dual promoters have been observed

in other eukaryotic genes that are developmentally or tissue specific in their regulation (for

review, Shibler and Sierra, 1986). Of particular interest is the alcohol dehydrogenase

gene in Drosophila melanogaster. A proximal promoter is utilized in the larval stage to

produce mRNA of about 1,100 bases in length with a 70 base untranslated leader. The

major transcript in the adult stage utilizes a distal promoter 654 bp upstream to the

proximal promoter. This upstream promoter has a TATA site 31 bp 5' to the start of

transcription and produces a transcript which, after processing, yields an approximately

1,150 base mRNA initiated at the upstream start site. Both adult and larval stage mRNAs

utilize the same coding region and differ only at the extreme 5' non-coding region.

(Benyajati et al., 1983)

The occurrence of an upstream start site (distal promoter) in sunflower tumors

raises the possibility that a dual promoter system similar to that present in Drosophila Adh

may also exist in maize Adhl. The inefficiency of intron removal in sunflower

fortuitously assisted in the identification of the distal promoter since S1 nuclease mapping

probes originally selected for the presence of 5' labelling sites internal to the coding region







were able to detect a continuous RNA:DNA hybrid from the labelled 5' terminus of the

probe to the distal start site. Of possible significance is the occurrence of sequences

showing homology to the D. melanogaster Adh distal promoter in the region of the

putative maize distal promoter (Kreitman, 1983) (Fig. 2-13). Other DNA sequences in the

region of the upstream start site which are consistent with its proposed role as a distal

promoter include a TATA-like motif (5'-TATATTAA-3') similarly spaced from a 5'-CAT-

3' sequence which is recognized as the transcription initiation site in D. melanogaster.

Transcripts initiated at the putative distal promoter of maize Adhl would be 3.9 kb

in size before processing. In the case of Drosophila Adh, transcripts initiated by the distal

promoter are spliced in the untranslated leader sequence, a process which removes

spurious ATG triplets that may reduce translational efficiency if present in the mRNA.

The putative distal promoter of maize Adhl may also follow a similar pattern of intron

splicing. Two potential 5' donor sites for splicing are located at +8 and +13 in transcripts

derived from the distal promoter. Drawing on the Drosophila analogy, a possible 3'

acceptor site in the region corresponding to the leader of the transcript derived from the

proximal promoter is located at +5. The utilization of these splicing sites would remove

redundant ATG triplets upstream of the coding region (+19 and +26) and would increase

the size of the mRNA by only 4 to 9 bases. Though this model for a dual promoter for

maize Adhl is simply conjecture due to the lack of any supporting evidence for the

utilization of the distal promoter in maize, it is interesting to note that an insertion of a 1.85

kb Mp-1 like element into the promoter (at -31) of Adhl reduced transcription levels of

this gene in seeds and anaerobically stressed seedlings to 6% of normal activity, whereas

ADH1 expression in pollen remained constant (Chen et al., 1987). The failure of Mp-1

to inactivate pollen expression suggests that in this case Adhl expression is regulated by a

promoter other than that associated with the proximal TATA. Again, a comparison

between this gene and Drosophila Adh may be made in that developmental control of

Adh expression is achieved by employing dual promoters (Benyajati et al., 1983). The

























U,z x


cn cda






13 E cng
U .



I- .Lc 0
O


~4-4







nC ui


















1.-4 UA








crit ~ .0 1:U
*





C.)



Uo U ~q C.)















)U C
E 4 E 4|
E-4


CD E-





E- C





E-4
H I








C0 0
H-
0-U)



E- HE-



o (o



) CD)C ,D


0-+ +
U-0

IC.

E-c ) U









I E-c









FCD H
0 E-I
U o



-4 *
E- 40






CD EH
0E-

U-H -










< E-I
o CD
0 E-C








c 2) o-
u c



















E




53

existence of dual promoters regulated by organ specificity cannot as yet be ruled out. It

will be interesting to pursue this question experimentally.

Even though splicing of the maize Adhl gene in sunflower tumors is faulty,

regulation of the transcriptional expression proved to be functional and closely mimicked

the response of this gene in its natural host. The following section focuses on localizing

and analyzing cis-acting regulatory elements of Adhl that are recognized in this

dicotyledonous plant system.












CHAPTER 3
PROMOTER ANALYSIS OF MAIZE Adhl
IN SUNFLOWER TUMORS


Introduction


In order to identify and map regulatory elements of the maize Adhl promoter a

number of mutations were constructed by cloning and were analyzed in vivo using the

heterologous system of sunflower tumors. To facilitate in vitro manipulation of the Adhl

promoter the Adhl coding region and introns were removed and substituted by the coding

region of the 780 gene of T-right (pTil5955) (Karcher et al., 1984; Winter et al., 1984) as

shown in Fig. 3-1. This gene, so named because it produces an approximate 780 bp

transcript was enlisted as a reporter gene for the Adhl promoter because of the lack of

interfering restriction sites within the coding region and the absence of introns within the

resulting transcript.

In order to more accurately quantify transcription from the promoter mutants in

sunflower tumors, an internal standard of measurement was applied as utilized by

McKnight and Kingsbury (1982) and Bruce and Gurley (1987). This method of

quantification consists of incorporating two homologous genes into T-DNA which are

transferred in equal number into the genome of the recipient host. The DNA sequence

composition of one gene remained constant and is referred to as the reference gene. The

second gene, referred to as the test gene, can be mutated in vitro and incorporated into the

genome of sunflower along with the reference gene. Test and reference transcripts were

distinguished by the presence of a 22 base insert into the test gene 5' untranslated leader.

Thus, mRNA encoded by the test gene could be directly compared to the transcription

products of the reference gene.







Materials and Methods


Maize Adhl 5' and 3' deletions.

Construction of the test and reference genes required the construction of 3'

deletions with the end points within the untranslated leader sequence of Adhl. Plasmids
(10 gig) containing the entire promoter and the first 213 bp of the coding region were

linearized at a unique SstlI site (+106). The linearized fragment was suspended in 39 pi of

TE (10 mM Tris/HCl pH 8.0; ImM EDTA) and 10 il of a Bal 31 reaction buffer (100 mM

Tris/HCI pH 8.1, 60 mM MgC12, 60 mM CaCl2, and 1.5 M NaC1) was added. The
mixture was placed in a 300C water bath for approximately 5 minutes before adding 1 pl

(250 U/ml) of exonuclease Bal 31 (Bethesda Research Laboratories). Aliquots of 10 p.l

were subsequently transferred to separate "Microfuge" tubes containing 1 p of 40 mM

EGTA (giving a final EGTA concentration of 3.6 mM) at 20, 40, 60, 90, and 180 second

intervals in order to stop the exonuclease reaction. Each tube was immediately placed in a

650C water bath for 15 minutes to further arrest the reaction. The five aliquots were

pooled, extracted once with an equal volume of phenol/chloroform and once with an equal

volume of chloroform. The DNA was then ethanol-precipitated. Internal deletions of the

anaerobic response element (ARE) and the 5' promoter deletion mutations were similarly

produced. Removal of the ARE involved a 5' Bal 31 exonuclease digestion of the test

gene at a unique PstI restriction site (-140). Promoter mutated 5' deletions of the

Adhl/780 test gene chimeric construct were similarly generated. Test gene chimerics in a

pUC19 vector were opened at unique BamHI (-1094) or Xbal (-410) sites and deletions

obtained with the Bal 31 exonuclease reactions as previously described with the exception

that reaction intervals were 1, 2, 3, 4, and 5 minutes.

Any 5' overhangs generated by the exonuclease activity of the different Bal 31

digestions were subjected to fill in reactions and linker addition (Maniatis et al., 1982); the

5' promoter deletions with XhoI linkers (Bio Rad) and the ARE deletion with PstI linkers







(BRL). End points of the deletions were estimated by sizing on an 8% polyacrylamide gel

and compared to standard size markers. The end points of Adhl promoter 3' deletions for

construction of test and reference genes were also determined by sizing on an 8%

polyacrylamide gel. The actual Adhl/780 junctions and identification of ARE

constructions were subsequently determined by M13 sequence analysis.


M13 sequence analysis.

Localization of the test and reference gene Adhl promoter/780 coding junctions

and test gene promoter mutations were determined by M13 cloning/dideoxy sequencing

(Sanger et al., 1977). Chimeric test and reference genes were excised from p251 double

gene vectors used in tripartite matings. These genes were subcloned into M13 strain

mpl8 or mpl9 and sequenced to confirm the identity of mutations.


Transfer and incorporation of Adhl/80 chimeric test and/or reference genes into the Ti-

plasmid.

Tripartite matings (Comai et al., 1983; Fraley et al., 1983) were as previously

described in chapter 2 with the following modifications. E. coli strain LE 392 rec- was

used to harbor both the intermediate shuttle vectors and the helper plasmid pRK2013

(Ditta et al., 1980). The Agrobacterium tumefaciens 15955 mutant Ag5260 (strr;knr)

(Bruce and Gurley, 1987) was the recipient strain in mating events. This mutant strain

has the endogenous 780 gene deleted from T-right of the Ti-plasmid and replaced by a

kanamycin resistant gene from transposon Tn5 (Rothstein et al., 1980). Overnight

cultures of Ag5260 were grown in LB containing streptomycin (250 gg/ml) and

kanamycin (50 gg/ml). Two milliliter aliquots of each of the overnight cultures were

centrifuged at room temperature and the cells were washed twice with sterile 10 mM

MgSO4. The E. coli cells were resuspended in 50 mis of LB containing no antibiotic and

grown to log phase (2 1/2 hr) in a shaking 370C water bath at 250 rpm. The Ag5260 cells







were resuspended in 4 ml of LB with no antibiotic. Equal portions (200 pls) of the two

E. coli cultures harboring the shuttle vector and the helper plasmid, and Ag5260 were
mixed in a "Microfuge" tube. The cells were pelleted (45 seconds), resuspended in 100 pl

of LB, and spotted in the center of an LB agar plate for mating (48 hrs, 280C). Selection

of Agrobacterium with the incorporated chimeric genes were as previously described in
chapter 2 with the exception that the selection plates also contained kanamycin (20 p.g/ml).

Resulting colonies were transferred to LB containing the three antibiotics; streptomycin
(250 gg/ml), chloramphenicol (20pjg/ml), and kanamycin (20 .tg/ml). Transconjugants

were reselected by growth (2 days) in LB containing antibiotics (streptomycin 250 gg/ml,

kanamycin 20 g.g/ml, and chloramphenicol 20 gpg/ml).


Tumor formation and anaerobic stress.

Inoculation of sunflower (Helianthus annus, cv. Large Grey) seedlings with

Agrobacterium harboring the modified T-DNA of the Ti-plasmids were as previously

described in chapter 2 (materials and methods). Tumor tissue containing each construct

was either induced for six hr and frozen or were frozen immediately upon harvesting

(uninduced).


Analysis of transgenic expression.

Poly(A)RNA was collected from the different tumor tissue as described in

materials and methods of chapter 2. S nuclease hybrid protection mapping was utilized

in analyzing relative transcription levels. The probe employed in this analysis was a 274

bp end labeled Hpall fragment of the test gene (see text) separated and isolated from an

8% polyacrylamide gel. The S nuclease reactions were as previously described with the

exception that 400 units/ml of enzyme (BRL) was used per reaction at room temperature.







Results


Construction of test and reference genes.

The two chimeric constructs to be utilized as the test and the reference genes were

cloned as illustrated in figure 3-1. The initial step involved the excision of maize Adhl

genomic sequences from pB428 (Dennis et al., 1984) possessing 1,094 base pairs (bp) of

the 5' flanking region, the leader sequences, and the first 213 bp of the transcript coding

region with its subsequent insertion into the polylinker of pUC19. This second plasmid

was then opened within the region responsible for encoding the first exon of the transcript

at a unique SstlI restriction site located at +106 which is 6 bp downstream of the ATG

translation initiation codon (+100). This linearized DNA fragment was then "chewed

back" into the untranslated leader sequence (5' to ATG) by the exonucleic activity of Bal

31 with the subsequent addition of XhoI linkers. The promoter and remaining leader

sequences within the BamHI (-1094) to XhoI linkered fragments produced by this

manipulation were then ligated upstream of the T-DNA 780 gene coding sequences carried

within a pUC19 plasmid vector (pUC19:5' del) (Bruce and Gurley, 1987). The resulting

chimeric constructs were sequenced through the Adhl promoter/780 gene junction

whereupon two likely candidates to be utilized as the test and reference chimeric genes

were identified (Fig. 3-2).

The chimeric gene used as a test gene consisted of the Adhl promoter XhoI-

linkered within the leader sequence at +78 and positioned upstream of the 780 coding

region (Fig. 3-2C). A second chimeric gene used as the reference gene was comprised of

the Adhl promoter possessing sequences -1094 to +65 (65 base pairs into the leader)

situated directly upstream to the 780 coding sequences with no intervening linkers (Fig. 3-

2C). The reason this particular construct lacks the XhoI/SalI linkered junction is not

known, but this configuration of sequences achieved the desired objective of altering the

leader sequences compared to those of the test gene, and was advantageous to the desired





















I Bun, HI
M1dilH KdiP Il



Whddll
pBR322

pUC19 HMdll
I* olhdoe fragmlot


(-1094) I 06)
Ban HI A0 !nOdlll


1i9stion
Ildk



Xh i
loolato ffagment


S/r


B~nH1Sph I
BanHI pAdh780-T/R Spdil
4.8 kb


UpUCl


Fig. 3-1. Construction of test and reference genes. Shaded regions of plasmids
represent DNA fragments harboring either Adhl or the transcribed region of the T-DNA
780 gene. Plasmid pB428 is described in chapter 2 and pUC19:5' del. is a pUC19
derivative containing the 19 bp leader, coding sequences, and about 1.2 kb of 3' flanking
sequences of the 780 gene (Bruce and Gurley, 1987). Important restriction sites are as
labeled; the numbers in parenthesis designate position with reference to the Adhl
transcription start site and identify the 780 start site. Orientation of transcription of genes
are designated by arrows within plasmids. Legend: Apr, ampecillin resistance; S/X, union
of Sal and XhoI restriction sites by ligation.


DaI 31
rits I Unrkw








AC G T

M W


U)



-Ui


A G C
AGC


BS 040


*T
c
.A
*C
c
S T
*A
.G
*C
.T
A
*A
C
* :C
.C
*G
*G
e *A
oG
C
Tc
SG
VC

*G
G
T


C
*C
.c

**-A
-G
*A

G






*T
*A
.G
S G
*T
.A
.G


40 T
.T
T


Chimeric
Test gene




Chimeric


maize AdhI 780 coding
promoter linker sequences
+54 +65 +78 -1 +1 +10
GGGTCTCGGAGTGGATCGATTTGG CCTCGACCCGCCATCGAAA
CCCAGAGCCTCACCTAGCTAAACCCGGAGCTGGCGCGTAGCTTT


maize Ad
promote


Reference gene


!hl


22 bp
difference


er 780 coding
54 +10 sequences
GGGTCTCGGAGT~CCATCGAAACATCGAGCAA
CCCAGAGCCTCApGGTAGCTTTGTAGCTCGTT
+65+1


Fig. 3-2. Sequence identification of chimeric constructs to be used as the test gene
(A) and the reference gene (B). Panel C compares difference between the test and
reference genes at the Adhl promoter/780 coding region junction. Shaded region
highlights the 22 bp difference between the two constructs. Boxed sequences represent
ligation of Sall and XhoI linkers. Underlined sequences within box indicate
complementary bases of the two linkers.


A







outcome. The test gene has 22 base pairs at the Adhl/780 junction that the reference gene

does not possess.


Analysis of test and reference gene products.

The reference gene and the test gene were each cloned into the shuttle vector pW9

as described in chapter 2. Construction of the double gene reference vector required that

the reference gene become a permanent resident of the shuttle vector while maintaining

unique sites for the insertion of a test gene. This required that the pUC19-derived plasmid

pAdh780R harboring the reference gene be opened at the BamHI (-1094) restriction site

and changed to a Sall site by the addition of linkers. This construct was itself double-

digested with Sall and SphI restriction endonucleases whereupon the entire chimeric

reference gene was isolated and subcloned into like restriction sites in pW9 giving rise to

the reference gene shuttle vector pRef-W9 (Fig. 3-3). The reference gene was positioned

in this shuttle vector such that the 5' most region of the promoter was adjacent to

sequences derived from pACYC184 (Chang and Cohen, 1978) and the coding region is

upstream of the T-DNA portion. Similarly, the test gene harbored within pUC19

(pAdh780T) was isolated after restriction digestions at BamHI and HindIII and then

subcloned into pW9 giving rise to the test gene shuttle vector pTest-W9 (Fig. 3-4). This

second shuttle vector differed from pRef-W9 in the position and location at which the

Adhl chimeric construct was inserted. The promoter sequences were adjacent to the T-

DNA region of pW9 and the pACYC184 sequences were in turn downstream of the test

gene coding region. These two shuttle vectors were incorporated in separate experiments

into the T-DNA (T-left) of the Ag5260 Ti-plasmid and transferred to the genome of

sunflower seedlings from which resulting tumor tissue was harvested. Primary tumor

tissue possessing each of the constructs were either uninduced (no anaerobic stress) or

subjected to an anaerobic environment for 6 hr (induced). Transcription products from

each tumor tissue type were then subjected to Si hybridization analysis.












Sail
Sph I
(13220)


linkers


S/X


Sal
Sph I
Isolate fragment


Sph I
Hindll


Sph I


SaIl

Reference C pACYC1 84
gene
pRef-W9
9.8 kb

Sph I 4 BamH1
(13220) 6b a (9062)
T-DNA




Fig. 3-3. Construction of the pRef-W9 shuttle vector harboring the reference
gene. Location and transcriptional orientation of represented genes are designated by
arrows within plasmids. Origin of DNA for each plasmid and important restriction sites
are as labeled. Numbers within parenthesis designate position of restriction sites within
octopine-type A. tumefaciens 15955 T-DNA (Barker et al., 1983). Legend: Cpr,
chloramphenicol resistance; S/X, Sall/XhoI junction; ocs, 4, 6a, and 6b are T-DNA genes
of A. tumefaciens 15955 (Willmitzer et al., 1981). Genes with dotted lines (gene 4 and
ocs) lack promoter sequences.












Bam H1


Bam HI
Hin dill
SIsolate fragment







Hin d II
i Barn Hi
41 (9062)


Bam H1


Sph I
Hindll


Bam HI
Hin dill
*Isolate fragment









Sph I
Hin dill


Fig. 3-4. Construction of the pTest-W9 shuttle vector harboring the test gene.
Important regions and parameters are as previously described.


Sail
Sph I
(13220)


4.2 kb







Sl hybrid protection mapping was employed to accurately quantify promoter

activity of mutated test genes. The probe employed in these experiments was a 283 base

pair Hpall DNA fragment isolated from the test gene and end labeled. It comprised 138

bases extending upstream of the recognized start of transcription of the Adhl promoter, 78

base pairs of the Adhl leader, 8 base pairs from the added Sall and XhoI linkers, a single

non-transcribed base (-1) and the first 59 bp of the transcribed region of the 780 gene

(Fig. 3-5). The S1 protection strategy required transcripts produced by the test gene in

sunflower tumors to hybridize and protect 146 bases of the end labeled DNA probe to the

Adhl start of transcription (Fig. 3-5A). In contrast, transcripts coded for by the reference

gene bound the same probe, but due to the lack of 22 complementary bases within the test

transcript, 22 bases of the probe looped out. This single stranded loop exposed these

non-complementary bases of the probe to S 1 nuclease attack producing two protected

fragments 65 and 59 bases in length with only the 59 base fragment being end labeled

(Fig. 3-5B).

The reference gene and the test gene that had been subcloned into separate shuttle

vectors (Figs. 3-3 and 3-4) were separately integrated into the T-DNA of a mutated form

of Agrobacterium tumefaciens 15955 (Ag5260) in which the endogenous 780 gene of T-

right had been excised and a kanamycin resistant gene substituted at this position (Bruce

and Gurley,1987). This lack of the endogenous 780 gene negated any interference in

analysis of the transcription products of the test and reference genes. Messenger RNA

collected from 6 hr anaerobically stressed sunflower tumors that had been infected by the

Agrobacterium separately harboring either of these two constructs were distinguishable

from each other in the predicted manner when subjected to S 1 nuclease mapping (Fig. 3-

6). The transcripts produced by the test gene protected 146 bases of the probe with no

band appearing at the location predicted for the reference gene (Fig. 3-6, lane 4). This

suggests that the chimeric test gene utilized the same transcription start site in sunflower

tumors as the endogenous Adhl gene in maize and tumor cells (see chapter 2). Messenger










aa3 -







0 C>




4)
8E











C U0 M




;.0 o
t ) 4 -0


0


Cn
4-




u .- C
a .o


















N -5 4)
5. S S















.- t C
Oc) CCO
0U C4
O @ 3 &
c It3 "f
^".1











g1l
(U< c"














10 2
C *

z z



< 4c
z z









+ IL





to




E



4)
CE
4)-


:a






c
S" E
o Q0
0 .






CM
< Tr CO






















118- M


full length
-- probe



W test









4- reference


72 4


Fig. 3-6. S1 nuclease hybridization analysis of the reference gene and the test
gene. Hybridization of end labeled DNA probe previously described was with 1/10 (lanes
1,3, and 4) or 1/5 (lane 2) of poly(A)+RNA isolated from 25 to 40 grams of sunflower
tumor tissue. Poly(A)+RNA was collected from uninduced tumors harboring the
reference gene (lane 1) and induced tumors possessing the reference gene (lanes 2 and 3)
or the test gene (lane 4). Protected fragment are designated. Lane "0" contains end
labeled HaeII generated 4X174 markers with size designations.







RNA from tumors harboring the reference gene in turn protected 59 bases of the

end labeled probe (Fig. 3-6, lanes 2 and 3) indicating that the 22 base loop of the probe

was degraded by S1 nuclease activity. No transcript protection was observed for

reference gene products from uninduced tumor tissue (Fig. 3-6, lane 1). These

experiments indicate that not only was the natural transcription start site of the Adhl

chimeric constructs still recognized in sunflower cells, but the promoter was still

responsive to anaerobic stress. These preliminary experiments demonstrated that the

transcript products of each of these genes could be differentiated by hybrid protection

mapping using a single DNA probe.


Analysis of test gene promoter mutations.

As a first step in the identification of cis-elements within the Adhl promoter, a

number of 5' deletions of the test gene were constructed and assayed in sunflower. Two

of these mutant constructs utilized unique restriction sites within the promoter, XbaI

(-410) and PstI (-140). The initial deletion construct involved the digestion of the pUC19

vector harboring the test gene, pAdh780T, with XbaI and the subsequent addition of Sail

liners to this site. This construct was then double-digested with endonucleases Sail and

HindIII and subcloned into the polylinker of pUC19 giving rise to pAdh780T2 (Fig 3-

7A). These manipulations resulted in a test gene possessing 410 bp of the most proximal

upstream sequences to the start of transcription along with the acquisition of restriction

sites from the polylinker of pUCl9 immediately upstream to the gene. Particularly

important was the BamHI site of the polylinker that was necessary for subsequent cloning

into the shuttle vector. A similar procedure was used to produce a deletion to -140 by

subcloning a PstI (-140) to HindIII fragment of pAdh780T into pUC19 resulting in

pAdh780T3 (Fig. 3-7B). Additional 5' deletions of the test gene were constructed by Bal

31 exonuclease digestions initiated at the BamHl (-1094) or Xbal (-410) sites of the

promoter (pAdh780T) with the subsequent addition of Xhol linkers producing a series of










(-140)
(-410) Pst I
iXbs 1 780








Blunt in dlli
Bam HI pAdh 780T HIndlil
(-1094) 4.8 kb



pUC19

ZblunIIHin 4
l I liners slate frogmen
(-140)
Pst I
(-410) Pst I

Bm Hlndilll I
(-1094) Hin ndll

Apr
L P 1 PUC19
9pUC194
Sal I
Hindlll
isolate fragment (-140)
Pst I S/X

Pst I
sa u o pSpo h




9pUC19


Pst I S/X
(-410) SaHll

/Sphl
pAdh 780T2 n Hindll
4.17 kb

ApA
\ pUC19






Fig. 3-7. Construction of 5' promoter deletion test genes pAdh780T2 to -410 (A)
and pAdh780T3 to -140 (B). Important sites and descriptions of plasmids are as
previously presented.








truncated test genes that were then subcloned into theSall and HindIII sites of pUC19
(Fig. 3-8). Location of the deletions were estimated by comparison to OX174 HaeIII

sizing markers on 8% polyacrylamide gels (data not shown). These Bal 31 generated

mutants resulted in test genes having 5' flanking sequences extending to approximately

-1000, -920, -850, -432, -324, and -288 relative to the transcript initiation site. Upon

insertion into pUC19 each of the exonuclease generated 5' deletion genes obtained

restriction sites (including BamHI) at the 5' end point from the polylinker (Fig. 3-8).

The eight 5' deletion test gene mutants, along with the original test gene that

retained the wild type promoter to -1094, were subcloned into the BamHI and HindIII

restriction sites of the pW9 shuttle vector derivative pRef-W9 (Fig. 3-9). This cloning

strategy resulted in a double gene shuttle vector (illustrated as pAdh-780TR-W9 in figure

3-9) that harbored the reference gene possessing the wild type Adhl promoter along with

a mutated test gene. Upon transfer into Agrobacterium 5260 and incorporation of the

shuttle vector into the Ti-plasmid, both genes along with T-DNA genes of the vector are

integrated into the T-DNA. Their position and orientation with respect to the naturally

occurring genes of T-left are presented in Fig. 3-10.

Tumor tissue that formed after infection of the sunflower seedlings with the

different derivatives of Ag5260 harboring the test and reference genes were anaerobically

stressed for 6 hr. Poly(A)+RNA isolated from the tumors was subjected to S1 protection

analysis as previously described. The poly(A)+RNA collected from anaerobically stressed

tumor tissue protected detectable levels of the end labeled probe representative of both the

test and reference genes (Fig. 3-11). Quantification employed the direct comparison of

each of the different test gene transcription products with transcripts produced by the

reference gene. The ratio of mRNA transcribed by the test gene possessing the wild type

Adhl promoter (-1094) versus the transcription products of the reference gene, also

possessing the Adhl wild type promoter, was arbitrarily assigned a relative transcription

level (RTL) value of 100. The average transcript level ratios and RTLs of the different













Bam H1 pA
(-1094)





Bal 31
Xholinkers


Sph I
Hin dlll


Sph I
Hindill


Sph I
Hindill


Bam HI
(-1094)


Xho I
Hin dill
slate fragment
(-140)
Pst I
Xho I
linker

Sph I
pUC19 Hindll
Sail Hindlll


IXho I
Hin dill
isolatee fragment


Bar


Hindlll


Fig. 3-8. Construction of test gene 5' promoter deletion series. Important sites
and descriptions of plasmids are as previously presented.


(-410)


Xho I
linker


















gene I



Sph I
(13220)


Bam H1


Sph I
Hin dll


Fig. 3-9. Construction of the double gene shuttle vector pAdh780TR-W9.
Important sites and descriptions of plasmids are as previously presented.












40 c 0.E
C14 0 : 3 x 3
r 4- 0 0 0
00

0 0
c c ur







4 ) 4 > ) C
H: O '"E 0 4) g 0





C14 04 004)
4 2 O'= >







=.r-- 0






4)4.
N Cd
0 ed 0










4.) 0 0 %
bG ~ ), 0 r >'.



4 0 0 0 0~ cu > 'I '
~= 4.~


r rA 00r
C sd w














0 b OO-o
z0 c.C
nsooz 00 u r



















cd = 0 0 1
XedO










,a M S
18 "C d i













< '4:: 0 P4 C 4 -
4- 1-4 U U


cd = = u > 0 0 C
Su Ldo\ '

o brr
10 0 cd d r.(D0
044 r 4.. q
bi ed -04-40 r_




o ar. o E 06~
'd > 0 cq
G 0 R C7 4.)
~~Cd E 4-4 =




















I-


m


4









14
-gy


















-TI
in


9i
*-0)


.4

-1


I















I



4- probe


M OW m 4


- -


m oft 4


4W M M


-- reference


Fig. 3-11. S1 hybridization assay of reference gene and 5' deletion test genes.
Each lane contains 1/10 of the poly(A)+RNA isolated from 25 to 40 grams of tumor tissue
that had been subjected to anaerobic stress for 6 hours. The sunflower cells were infected
by A. tumefaciens 5260 with incorporated double gene shuttle vector pAdh780TR-W9
(see Fig. 3-10). Lane designations represent 5' most point of test gene promoter with
respect to start of transcription. Protected fragments are designated.


-- test


~


























TABLE 3-1
Relative Transcription Levels (RTL) of 5' Deletion Mutants

5' border Number of Test/reference
of test gene experiments ratio avg. RTL

5'A-1094* 2 1.07 100
5'A-1000 1 0.90 84
5'A-920 2 1.08 101
5'A-850 2 1.34 125
5'A-432 2 0.69 65
5'A-410* 2 1.02 95
5'A-324 1 0.81 75
5'A-288 2 0.65 61
5'A-140* 2 0.77 72
*deletion end-point determined by DNA sequencing, others were
estimated by polyacrylamide gel analysis using restriction fragment
size markers







mutated test genes versus the constant reference gene were then calculated in relation to the

100 assigned the wild type. Table 3-1 summarizes the ratio and RTL values for each of

the 5' deletion mutants surveyed.

The most notable observation concerning the RTL values for the 5' deletion

mutations is that all of the RTLs remained relatively high. Initially, as 5' sequences are

deleted there was an actual rise in transcriptional activity. Removal of about 250 bp

(5'A-850) of the most distal 5' upstream sequences increased activity approximately 25%

above that of wild type. A more severe deletion to position -432 (5'A-432) lowered

transcriptional activity to an RTL value of 65, while an additional small deletion to -410

raised the RTL to that of wild type. The 5' deletions of the test gene promoter to -324,

-288, and -140 resulted in similar RTLs ranging from 61 to 72. These results suggest that

negative elements may exist within the upstream sequences of the Adhl promoter within

the small region between (approximately) -432 and -410. The 400 base pairs between

-850 and -432 appear to be required for maximum transcription when this putative

negative region is present, since a deletion to 5'A-432 markedly decreased the activity.

Upon deletion of the potential negative region, the transcript level was boosted to that of

wild type. A second possible explanation for this effect is that of a position effect of the

test gene within the shuttle vector. Unlike the reference gene utilized in these experiments

and the Adhl single gene analysis of chapter 2, the promoter of the test genes were

inserted into the shuttle vector in such a way as to be positioned immediately downstream

of the T-DNA (Fig. 3-9). Any activator-like sequences within the T-DNA region would

be in fairly close association with the test promoter and may have an effect upon the 5'

deletion analysis of the constructs. That is, as more sequences are deleted from the 5' end

of the promoter, the closer the remaining sequences and regulatory elements become

associated with the T-DNA.







Analysis of test genes transferred via shuttle vector p195.
The 5'A-140 deletion RTL of 72 closely corresponds to results observed by

Walker et al. (1987) when the maize Adhl promoter was fused to a CAT reporter gene

deleted to this same position and analyzed in maize protoplasts. However, these results

differ from lower transcription levels (<20% of wild type activity) observed for this

construct in maize protoplasts by Lee et al. (1987) and the preliminary results observed

concerning the maize Adhl mutants in sunflower tumors presented in this study (see

chapter 2). In an attempt to investigate any effect the T-DNA may have upon analysis of

the promoter deletions after incorporation of the shuttle vector into the Ti-plasmid,

sequences of the T-DNA situated upstream of the incorporated test genes were examined

more closely. As can be seen in figure 3-10 test genes assimilated into T-left are

downstream of the 3' coding region of the T-DNA gene 4 which codes for an enzyme

involved in cytokinin production, gene 6a which is involved in secretion of opines

(Messens et al., 1985), the 6b gene thought to control tumor size in some plant species

(Hookykaas et al., 1988), and the octopine synthase (ocs) gene (Hack and Kemp, 1980).

Upstream of the coding region of 6a is a region of 16 bp, ACGCAGCCGCTITCGA, that

is 67% homologous (11 of 16 bases) to the ocs enhancer-like element (Ellis et al., 1987b).

This sequence is located between -514 to -499 (9444 to 9459 in T-left, Barker et al.,

1983) relative to the transcription start site of 6a and within the 3' coding region of gene 4.

The ocs element-like sequence of genes 4 and 6a is 382 bp from the T-DNA/test

gene junction of the shuttle vector. Since these sequences are similar to the ocs enhancer-

like element, and due to its close proximity to the test genes, a region of the shuttle vector

was removed in an attempt to abolish any affect it may have had on transcription of the test

genes. An 858 bp PstI fragment within the T-DNA portion of the shuttle vector (pRef-

W9) was excised to give rise to pRef-W9-P (Fig. 3-12A). This second shuttle vector

lacked the promoter region for the 6a gene and specifically the 16 bp ocs-like element.

The reference gene and the T-DNA of pRef-W9-P were subsequently subcloned into the











A.


Reference
gene


Sph I
(13220)


B.


Reference
gene
Sph
(13220)


Fig. 3-12. Shuttle vectors lacking possible PstI fragment harboring potential ocs-
like element. (A) pACYC184 derived shuttle vector pRef-W9-P. (B) pSUP205 derived
shuttle vector p195. Important sites and descriptions of plasmids are as previously
presented with the exception that 6a/4 contains a 3' portion of the gene 4 coding region
immediately upstream of 3' coding sequences of 6a.







Bam HI and Sall restriction sites of pSUP205 (Simon et al., 1986) resulting in a third

shuttle vector, p195 (Fig. 3-12B). The 7.7 kb pSUP205 is a mobilizing plasmid

possessing the mobilization (Mob) site from the broad host range plasmid RP4 cloned into

the E. coli vector pBR325 (Bolivar et al., 1978). This Mob site was utilized during

tripartite matings to increase the transfer efficiency of the shuttle vector into the recipient

Agrobacterium.

The test gene possessing the Adhl wild type promoter, 5'A-1094, and two 5'

promoter deletion mutants, 5'A-410 and 5'A-140, were inserted into the BamHI and

HindIII restriction sites of p195. This gave rise to double gene shuttle vectors p195-

5'A-1094, p195-5'A-410, and pl95-5'A-140, each possessing the standard reference

gene (Fig. 3-13). The test and reference genes were transferred into Ag5260 and

incorporated into the T-DNA (Fig. 3-14). The association of each of the chimeric genes

carried by the double gene vector p195 with surrounding DNA after incorporation into the

Ti-plasmid differed from those genes that had been transported via the pRef-W9 vector

(Fig. 3-14). The promoter of the test genes was again positioned adjacent to the shuttle

vector T-DNA but these sequences now lacked the 6a promoter and the 3' proximal most

sequences of the gene 4 coding region. Also the test and reference genes were separated

by about 7.3 kb of the pSUP205 sequences rather than the approximately 3.6 kb of

pACYC184 sequences derived from the pRef-W9 shuttle vector.

The Ag5260 transconjugants from the pSUP205 derived vectors harboring the

reference gene and the test gene promoter mutants in the T-DNA of the Ti-plasmid were

used to infect the hypocotyls of sunflower seedlings. The poly(A)+RNA isolated from the

tumors anaerobically induced for 6 hr was subjected to S 1 nuclease protection mapping

after hybridization to the Hpall end labeled probe isolated from the test gene as previously

described. The test and reference gene products were quantified and RTL derived for each

experiment. The average ratio of the wild type test gene products versus the reference

gene products was given the RTL value of 100. The average ratio of each of the deletion














































Fig. 3-13. Double gene shuttle vector pl95-Test. Important sites and descriptions
of plasmid are as previously presented.


















00















of)
Cl cu













U
'-4






































in.
a 4
.-? a4-



0

U -!

E~


U0











1f.



~O



0 -







0.. U





'4
ist


It







II



V










4I'





4
sU




ft

8
5,,


a.
lo -





CM
J!
E
inI







gene products versus the internal standard were compared to the wild type ratios and

assigned their own corresponding RTL value (Fig. 3-15; Table 3-2).

The test gene that had been deleted to the -410 position (195-5'A-410) did not

exhibit decreased activity, nor result in an RTL value similar to that the of wild type

promoter as was previously observed in experiments utilizing the pW9 derived shuttle

vector (Fig. 3-11; Table 3-1). Rather, the RTL was more than double the wild type.
Similarly, the RTL of the more drastic 5' deletion mutant to -140 (195-5'A-140) also

resulted in an RTL value 2-fold higher than wild type, but was slightly less than that of

195-5'A-410. This result may have been due to one of several possibilities. One is that at

a negative element exists within the region between -1094 and -410. Deletion of these

negative regulatory sequences may then have allowed for increased transcription levels of

the genes. A second explanation invokes the possibility of a position effect of the test

gene in relation to T-DNA of the shuttle vector, with a third possibility involving a

combination of both, deletion of a negative element region and position affect. Removal

of these same promoter sequences of the test genes transferred to Ag5260 by pRef-W9 did

not give rise to an increase in the RTL compared to the wild type RTL, but rather a slight

decrease (Table 3-1).

To further investigate the probability of position effect upon the test genes, the use

of filler DNA from the E. coli vector plasmid pBR322 (Bolivar et al., 1977) was

employed. A 1,125 bp BamHI to PstI fragment was subcloned upstream of the 5'A-140

test gene deletion mutant in pAdh780T3. This test gene along with its newly acquired

1,125 bp filler DNA was subsequently cloned into the BamHI and HindIII sites of the

double gene shuttle vector p195 (Fig. 3-16). This test gene is similar in content and

orientation within the p195 shuttle vector as 195:5'A-140, but is separated from the shuttle

vector T-DNA by the 1,125 bp insertion (195:5'A-140BR in Figs. 3-16 and 3-17). After

incorporation of 195:5'A-140BR into T-DNA, inoculation of seedlings, tumor formation,

and RNA extractions the mRNA from both induced (6 hr) and uninduced primary tumors











00


0
'-I
r
-o
f8


0?


'a


t- probe


4- test


118.






72- -


- -*- reference


-1094
195:5'A-1094
T-DNA


-410 -140

Adh-1


+1

zhi780


0



-140


195:5'A-410I
T-DNA

195:5A-140
T-DNA


220



192


Fig. 3-15. S1 hybridization assay of reference gene and 5' deletion test genes
transferred into Ag5260 via p195. Poly(A)+RNA was isolated from tumor tissue that had
been subjected to anaerobic stress for 6 hours. Lane designations represent 5' most point
of test gene promoter with respect to start of transcription. Lanes 195:5'-1094,
195:5'-410, and 195:5'-140 contain 2.4 gg, 2.9 gg, and 18.8 ig of poly(A)+RNA,
respectively. Illustrations of each test gene in relation to T-DNA and the RTL value for
each are presented.


279-


194-


RTL

100




























TABLE 3-2
RTL Values Shuttle Vector p195
5' border Number of Test/reference
of test gene experiments ratio avg. RTL
5' A-1094 6 1.72 100 10.7
5'A-410 7 3.79 220 40.1
5'A-140 6 3.30 192 20.0
* standard deviation given as













pAdh 780T3 indll
3.9 kb



pUC19


Bam HI
PtI
Isolate fragment



(-140) I
Pst
Bam H


pAdh 780T3 Hinal
3.9 kb



SpUC1 I


Eco Hin d




,k 3 kb

Hin dll
S. blunt
Ligation

EcoR

Bunll







isolate fragment




Pall 4V 1125bp


Paet I
pBR322


BOM t"I pAdh 78OT4




PUC19

Nindff
p195 I. isolate fragment


Fig. 3-16. Construction of test gene 5'A-140BR that has 1,125 bp of filler DNA
positioned upstream of the 5' deleted test gene to -140 and its incorporation into the p195

shuttle vector. pBR322 sequences are represented by lightly shaded region, 5'A-140 test
gene sequences by intermediate shaded region, and T-DNA by black region. Important
sites and gene designations are as previously presented.



























Fig. 3-17. S1 hybridization assay of reference gene and 5' deletion test genes
transferred into Ag5260 via p195. Poly(A)+RNA was isolated from tumor tissue that had
been subjected to anaerobic stress for 6 hours. Lane designations represent 5' most point
of test gene promoter with respect to start of transcription and 1,125 bp of filler DNA
positioned upstream of the 5' deleted test gene to -140 designated by 195:5'-140BR.
Lanes 195:5'-1094, 195:5'-410, 195:5'-140, and 195:-140BR contain 2.4 pg, 2.9 gg,
18.8 gg, and 4.9 lg of poly(A)+RNA, respectively. Protected fragments are designated.
Illustrations of each test gene in relation to T-DNA and the RTL value for each are
presented with the pBR322 sequences represented by the hatched region.















0


1,

0)


9?
1)
0)


I'
4)7
0)


279-* I

194. -


I, -


I





.- probe




-, '- test


118 .-





72.


S-.- reference


-1094
195:5'A-1094
T-DNA


Adh-I


-140 +1

| 780


-410
195:5'A-410
T-DNA I1I
-140
195:5'A-140
T-DNA I
-140
195:5'A-140BR
* *////////////////_////////-/// I
T-DNA pBR322 1125 bp
pBR322 1125 bp


RTL

100


220



192



50







was subjected to S 1 hybrid protection analysis. While the test and reference gene

transcripts from the uninduced tissue was negligible (data not shown), detectable

transcript levels from induced tumors protected the end labeled probe (Fig. 3-17, lane 4).

Five separate experiments resulted in an average test/reference gene product ratio of 0.863

which converts to an RTL value of 50. This RTL is half that of the wild type test gene

and one fourth the level of the same 5' deletion lacking filler DNA (Fig. 3-17). Therefore,

by separating the -140 test gene from T-DNA by 1,125 bp of filler DNA the transcript

level dropped by almost 75%. These results indicate that T-DNA situated upstream

exerted a positive effect on the test gene transcription. The ocs element is most likely the

cause of this enhancement which was inversely proportional to distance.


Analysis of test genes transferred via shuttle vector p251.

The ocs element has not been shown to affect transcription in tobacco calli when

positioned 3' to a 5'-truncated ocs gene (Leisner and Gelvin, 1989), or 3' to an Adhl

promoter/CAT reporter gene in maize protoplasts (Ellis et al., 1987b). With this in mind,

in an attempt to develop a sunflower tumor assay system for the AdhlFl80 chimeric test

and reference genes free of any affect on transcription from the T-DNA, the shuttle vector

was re-designed such that the T-DNA portion would be 3' to the test gene as well as the

reference gene. The reference gene and T-DNA from pRef-W9 was subcloned into the

Sall and BamHI restriction sites of pSUP205. The resulting plasmid was opened at the

single HindIII site of the pSUP205 sequences, filled in, and blunt end ligated (Maniatis et

al., 1982) subsequently removing this HindII site. This plasmid was in turn opened at a

single Asp 718 (KpnI) restriction site within the T-DNA portion 776 bp from the T-

DNA/pSUP205 junction whereupon HindII linkers were inserted (Fig. 3-18). The

resulting shuttle vector, p251, possessed pSUP205 sequences that contributed a

chloramphenicol resistance gene and the mobilization site (Mob) for increased conjugation

efficiency, the reference gene, and the T-DNA necessary for recombination into T-left of










pSUP205 pRet-W9
7.7 kb 9.8 kb
W4 l ndilll
ndE Sphi IamH1
H1 (13220) 6b (9062)
T- DNA Aep 71
(9838)
Sail Sall
SBmH1 BamHI
SIsolate fragment Isolate fragment





















Sa Cp




Spi 6b6a BamH1

T-DNA A7p 718
Hindl







blunt
ligation











A.p 718

Aap 718
blunt
endig linkers








ocs aH
Sph I b BamH1
















T-DNA Amndl1




Fig. 3-18. Construction of the shuttle vector p251. Important sites and
descriptions of plasmids and intermediates are as previously presented.
descriptions of plasmids and intermediates are as previously presented.







pTi-Ag5260. The newly acquired HindIII restriction site within the T-DNA allowed for

incorporation of test genes into the shuttle vector in the opposite orientation of any of the

previous double gene vectors (Fig. 3-19).

Test genes with the wild type promoter, 5' deletions to -410 and -140, and the

-140 5' deletion mutant with the pBR322 filler sequences were designated test genes 1, 2,

3, and 4 respectively (Fig. 3-21). Each of these test genes was subcloned into p251.

These double gene vectors were transferred into Ag5260 and incorporated into the T-DNA

(Fig. 3-20). The promoters of the test and reference genes were separated by the 7.3 kb

pSUP205 sequences and the T-DNA with the 6a, 6b, and ocs genes (and therefore the

ocs element) now situated 3' to the inserted test genes. Poly(A)+RNA was collected from

both uninduced and induced (6 hrs anaerobic stress) tumors formed by sunflower

seedlings infected with the Agrobacterium. Results of Sl hybridization protection

mapping of the transcripts hybridized to the test gene HpalI end labeled probe are shown

in figure 3-21. There were negligible levels of protected DNA with mRNA isolated from

each type of the uninduced tumor tissue. Test and reference gene transcripts from the

induced tumors protected probes which were quantified and test/reference ratios calculated

(Table 3-3).

The average wild type promoter test/reference gene ratio incorporated into pTi-

5260 utilizing the double gene vector p251 was assigned an RTL value of 100. Test gene-

2 that has 684 bp of the most distal sequences deleted to -410 had an RTL of 88 reflecting

an approximately 10% reduction from wild type promoter activity. The more extreme

deletions of test genes 3 and 4 to -140, without or with upstream spacer DNA from

pBR322, resulted in more drastic reduction of RTL values to 29 and 33 respectively (Fig.

3-21). These values markedly differed from previous results utilizing the double gene

vectors pRef-W9 and p195, each of which had higher RTL values for the 5'A-140

deletion. The test to reference gene product ratio of 5'A-140BR (5' deletion with 1125 bp

of spacer DNA) transferred by p195 (Fig. 3-16; 195:5'A-140BR) was directly compared














Bam H1


Bam Hi
HindIll
Isolate fragment


Bam H1
Hindll
Isolate fragment





S/X


Barn H1


Sph I
Hin dill


Hindll


Fig. 3-19. Construction of the p251 double gene shuttle vector derivatives.
Important sites and descriptions of plasmids and intermediates are as previously presented.














C)~












'0

to 0






'0
c c
o














o
0 0
e- ~

















U0
b1~

















cl
EE
im.x



-co




r SR




o o-

4- 0
Of'E



i~4 U




Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EKHPS4SXH_B53GRQ INGEST_TIME 2017-07-13T21:50:58Z PACKAGE AA00003747_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES



PAGE 2

75$16*(1,& (;35(66,21 2) 7+( $/&2+2/ '(+<'52*(1$6( *(1( 2) 0$,=( ,1 681)/2:(5 %\ -2+1 &+$5/(6 ,1*(562// $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 3

'HGLFDWHG WR %DUEDUD 6DIIHU

PAGE 4

$&.12:/('*0(176 ZLVK WR H[WHQG P\ WKDQNV WR IHOORZ JUDGXDWH VWXGHQWV DQG FROOHDJXHV ZKR KDYH EHHQ KHOSIXO WKURXJKRXW P\ JUDGXDWH FDUHHU 6SHFLDO WKDQNV JRHV WR P\ IULHQG -DFN 6KHOWRQ IRU DOZD\V EHLQJ DYDLODEOH ZKHQ QHHGHG DGYLFH DQGRU D KHOSLQJ KDQG $OVR WR P\ IULHQGV FRZRUNHUV DQG URRPPDWHV %HWK DQG .HYLQ 2*UDG\ IRU WKHLU KHOS DQG VXSSRUW HVSHFLDOO\ ZLVK WR WKDQN 'U :LOOLDP *XUOH\ ZKR JDYH PH D FKDQFH WR OHDUQ DQG GHYHORS LQ KLV ODERUDWRU\

PAGE 5

7$%/( 2) &217(176 SDJH $&.12:/('*0(176 LLL $%675$&7 Y &+$37(56 ,1752'8&7,21 75$16&5,37,21$/ (;35(66,21 2) 0$,=( $GKO ,1 681)/2:(5 780256 ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 5HVXOWV 'LVFXVVLRQ 352027(5 $1$/<6,6 2) 0$,=( $GKO ,1 681)/2:(5 780256 ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 5HVXOWV 'LVFXVVLRQ 6800$5< 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ ,9

PAGE 6

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ 75$16*(1,& (;35(66,21 2) 7+( $/&2+2/ '(+<'52*(1$6( *(1( 2) 0$,=( ,1 681)/2:(5 E\ -RKQ &KDUOHV ,QJHUVROO 0D\ &KDLUPDQ :LOOLDP % *XUOH\ 0DMRU 'HSDUWPHQW 0LFURELRORJ\ DQG &HOO 6FLHQFH 7KH $GKO JHQH IURP PDL]H ZDV LQFRUSRUDWHG LQWR WKH JHQRPH RI GLFRW\OHGRQRXV VXQIORZHU K\SRFRW\O FHOOV YLD $JUREDFWHULXP WXPHIDFLHQV PHGLDWHG WUDQVIHU 7UDQVFULSWLRQ RI WKLV IRUHLJQ JHQH LQ VXQIORZHU WXPRUV ZDV LQGXFHG E\ DQDHURELF VWUHVV LQ D VLPLODU IDVKLRQ DV LQ LWV QDWXUDO KRVW 6SOLFLQJ RI WKH QLQH LQWURQV IURP WKH SULPDU\ WUDQVFULSWV SURYHG WR EH DEHUUDQW LQ WKLV KHWHURORJRXV V\VWHP $QDO\VLV RI WKH QRQSURFHVVHG P51$ E\ 6, QXFOHDVH K\EULGL]DWLRQ LQGLFDWHG WKDW LQLWLDWLRQ RI WUDQVFULSWLRQ RFFXUUHG DW WKH UHFRJQL]HG $GKO VWDUW VLWH DQG D SRVVLEOH VHFRQG VLWH EDVH SDLUV IXUWKHU XSVWUHDP 7KH n IODQNLQJ VHTXHQFHV RI $GKO ZHUH SRVLWLRQHG XSVWUHDP RI D 7'1$ UHSRUWHU JHQH f DQG DQ LQWHUQDO UHIHUHQFH JHQH V\VWHP ZDV HPSOR\HG WR DQDO\]H UHJXODWRU\ UHJLRQV ZLWKLQ WKH SURPRWHU 7KH 7'1$ VHTXHQFHV RI WKH YHFWRU SODVPLG KDG D SRVLWLYH HIIHFW RQ WUDQVFULSWLRQ ZKHQ ORFDWHG XSVWUHDP RI WKH FKLPHULF WHVW JHQHV 7KLV SRVLWLYH HIIHFW ZDV RYHUFRPH E\ SRVLWLRQLQJ WKH VKXWWOH YHFWRU 7'1$ GRZQVWUHDP RI WKHVH JHQHV 6SHFLILF SURPRWHU PXWDWLRQV LQGLFDWHG WKDW WKH DQDHURELF UHVSRQVH HOHPHQW $5(f RI $GKO ZDV UHFRJQL]HG DQG UHTXLUHG IRU HIILFLHQW WUDQVFULSWLRQ XSRQ DQDHURELF LQGXFWLRQ LQ VXQIORZHU WXPRUV 'HOHWLRQ RI WKLV HOHPHQW GLG QRW FRQYHUW WKLV LQGXFLEOH JHQH WR D Y

PAGE 7

FRQVWLWXWLYHO\ DFWLYH JHQH )ODQNLQJ WKH $5( ZLWK DW f DQG DW f EDVH SDLU LQVHUWLRQV UHGXFHG WKH DQDHURELF UHVSRQVH WR ab RI ZLOG W\SH ZKLOH LQYHUWLQJ WKH RULHQWDWLRQ VHYHUHO\ GHFUHDVHG WKH UHVSRQVH WR b 5HSRVLWLRQLQJ WKH $5( XSVWUHDP IURP LWV DFFXVWRPHG SRVLWLRQ DEROLVKHG WKH UHVSRQVH 7KH LQWHUQDO UHJLRQ RI WKH SURPRWHU EHWZHHQ DQG f ZDV UHVSRQVLEOH IRU b RI WKH WUDQVFULSWLRQDO DFWLYLW\ ZKHQ SRVLWLRQHG LQ LWV DFFXVWRPHG ORFDWLRQ LQ WKH SURPRWHU ZLWK UHVSHFW WR WKH $5( :KHQ WKH LQWHUPHGLDWH UHJLRQ ZDV VHSDUDWHG IURP WKH $5( E\ EDVH SDLUV WUDQVFULSWLRQDO DFWLYLW\ GHFUHDVHG DOPRVW b ZKLOH LQYHUWLQJ WKLV UHJLRQ LQFUHDVHG DFWLYLW\ b DERYH ZLOG W\SH DFWLYLW\ 7KH GLVWDO UHJLRQ RI WKH SURPRWHU EHWZHHQ DQG f FRQWULEXWHG DERXW b WR WRWDO WUDQVFULSWLRQDO DFWLYLW\ ZKLOH DGYHUVHO\ LQIOXHQFLQJ WKH 7$7$SUR[LPDO UHJLRQ ZKHQ WKH LQWHUPHGLDWH UHJLRQ ZDV DEVHQW YL

PAGE 8

&+$37(5 ,1752'8&7,21 ,Q UHFHQW \HDUV PXFK DWWHQWLRQ KDV EHHQ IRFXVHG RQ WKH LQWHUDFWLRQ EHWZHHQ WUDQVFULSWLRQ IDFWRUV DQG UHJXODWRU\ '1$ HOHPHQWV RI WUDQVFULSWLRQDOO\ DFWLYH SODQW JHQHV $ QXPEHU RI PHWKRGV KDYH EHHQ HPSOR\HG WR LGHQWLI\ WKH '1$ VHTXHQFHV LQYROYHG LQ WKHVH LQWHUDFWLRQV 7KHVH PHWKRGV LQFOXGH EDQG VKLIW H[SHULPHQWV JHO PRELOLW\ UHWDUGDWLRQ DVVD\Vf :X DQG &URWKHUV f '1DVH IRRWSULQWLQJ *DOXV DQG 6FKPLW] f DQG LQ YLYR GLPHWK\O VXOIDWH '06f JHQRPLF IRRWSULQWLQJ 0D[DP DQG *LOEHUW f 7KH ELQGLQJ VLWHV LGHQWLILHG LQ WKLV ZD\ KDYH VXEVHTXHQWO\ EHHQ FKDUDFWHUL]HG ZLWK UHJDUG WR WKHLU SRWHQWLDO IRU WUDQVFULSWLRQDO UHJXODWLRQ $ PRUH GLUHFW DSSURDFK WR WKH LGHQWLILFDWLRQ RI FVUHJXODWRU\ HOHPHQWV KDV LQYROYHG PXWDWLRQ RI WKH n IODQNLQJ UHJLRQ RI WKH JHQH XQGHU VWXG\ ,PSRUWDQW VHTXHQFH HOHPHQWV WKDW DFW DV SRVLWLYH RU QHJDWLYH UHJXODWRU\ HOHPHQWV DIIHFWLQJ WUDQVFULSWLRQ LQ D WUDQVJHQLF V\VWHP PD\ EH LGHQWLILHG E\ FRUUHODWLRQV EHWZHHQ D VSHFLILF PXWDWLRQ DQG ORVV RI SURPRWHU DFWLYLW\ &ULWHULD IRU WKH UHJXODWRU\ DQDO\VLV RI D JHQH UHTXLUHV D VXLWDEOH WUDQVLHQW RU WUDQVJHQLF KRVW DQG DQ DFFXUDWH PHWKRG RI HYDOXDWLQJ DFWLYLW\ RI WKH JHQH EH LW DW WKH WUDQVFULSWLRQDO RU SURWHLQ SURGXFW OHYHO 7KH UHODWLYHO\ UHFHQW GHYHORSPHQW RI JHQH WUDQVIHU WHFKQLTXHV IRU SODQWV KDV JUHDWO\ HQKDQFHG RXU DELOLW\ WR HOXFLGDWH WKH UHJXODWRU\ PHFKDQLVPV RI D QXPEHU RI JHQHV 7KH GLIIHUHQW PHWKRGV RI JHQH WUDQVIHU LQFOXGH PLFURLQMHFWLRQ RI QXFOHLF DFLG LQWR SURWRSODVWV &URVVZD\ HW DO f HOHFWURSRUDWLRQ LQWR SURWRSODVWV )URPP HW DO f SRO\HWKHOHQH JO\FRO 3(*f LQGXFHG XSWDNH E\ SURWRSODVWV 3DVNRZVNL HW DO f '1$ FRDWHG PLFURSURMHFWLOHV .OHLQ HW DO f DQG $JUREDFWHULXP WXPHIDFLHQV PHGLDWHG WUDQVIRUPDWLRQ LQWR D ZLGH UDQJH RI GLFRW\OHGRQRXV SODQWV LQ DGGLWLRQ WR VRPH PRQRFRW\OHGRQRXV VSHFLHV 1HVWHU HW DO +RR\NDDV HW DO %LQQV DQG

PAGE 9

7KRPDVKDZ IRU UHYLHZf 7KH DQDO\VLV RI SURPRWHU VWUXFWXUH LQ KHWHURORJRXV SODQW V\VWHPV PD\ XWLOL]H WKH QDWXUDO WUDQVFULSWLRQ XQLW RU PD\ EH IDFLOLWDWHG E\ IXVLQJ WKH SURPRWHU WR RQH RI D QXPEHU RI UHSRUWHU JHQHV ZKRVH H[SUHVVLRQ PD\ EH HDVLO\ PRQLWRUHG DQG TXDQWLILHG .XKOHPHLHU HW DO IRU UHYLHZf 7KHVH UHSRUWHU JHQHV LQFOXGH WKH FRGLQJ UHJLRQV IRU WZR $JUREDFWHULXP 7'1$ JHQHV RFWRSLQH V\QWKDVH RFVf DQG QRSROLQH V\QWKDVH QRVf .HPS 7HPSH DQG *ROGPDQ f DQG WKH FRGLQJ UHJLRQV IRU RWKHU EDFWHULDO JHQHV VXFK DV QHRP\FLQ SKRVSKRWUDQVIHUDVH 137f )UDOH\ HW DO f FKORUDPSKHQLFRO DFHW\O WUDQVIHUDVH &$7f *RUPDQ HW DO $Q f DQG 3JOXFXURQLGDVH *86f -HIIHUVRQ -HIIHUVRQ HW DO f 7KLV UHYLHZ IRFXVHV RQ WKH H[SHULPHQWDO LQYHVWLJDWLRQ RI D UHSUHVHQWDWLYH VDPSOLQJ RI GLIIHUHQWO\ UHJXODWHG SODQW JHQH SURPRWHUV DQG WKH DQDO\VLV RI VRPH PRQRFRW\OHGRQRXV JHQH SURPRWHUV LQ GLFRW\OHGRQRXV SODQW V\VWHPV ,PSRUWDQW H[SHULPHQWV LQYROYLQJ WKH ORFDOL]DWLRQ DQG HOXFLGDWLRQ RI LPSRUWDQW FVDFWLQJ VHTXHQFHV RI D WUDQVFULSWLRQ XQLW UHTXLUHV WKH LQYHVWLJDWLRQ RI WKH H[SUHVVLRQ VWUHQJWKV GHOLQHDWHG E\ LQ YLWUR PXWDWHG SURPRWHUV 'LIIHUHQW SODQW V\VWHPV DW WKH WUDQVLHQW RU WUDQVJHQLF OHYHOV DUH HPSOR\HG IRU WKHVH LQYHVWLJDWLRQV 7KH SURPRWHUV GLVFXVVHG LQ WKLV VXUYH\ UHSUHVHQW VRPH FRQVWLWXWLYHO\ DFWLYH SODQW JHQH SURPRWHUV DQG FVDFWLQJ UHJXODWRU\ VHTXHQFHV UHVSRQVLEOH IRU WKH LQGXFHG H[SUHVVLRQ RI D JHQH E\ HQYLURQPHQWDO IDFWRUV 5HJHQHUDWLRQ RI WUDQVJHQLF SODQWV DOVR DOORZ IRU DQDO\VLV RI WKRVH UHJLRQV UHVSRQVLEOH IRU UHJXODWLQJ RUJDQ VSHFLILF H[SUHVVLRQ &RQVWLWXWLYH 5HJXODWLRQ 7KH &RQVWLWXWLYHO\ 5HJXODWHG &DXOLIORZHU 0RVDLF 9LUXV &D09O 6 3URPRWHU 7KH SURPRWHU RI WKH &D09 6 WUDQVFULSWLRQ XQLW H[HPSOLILHV D SDUWLFXODUO\ ZHOO VWXGLHG H[DPSOH RI SURPRWHU DQDO\VLV LQ SODQW V\VWHPV 7KLV SURPRWHU KDV EHHQ FRPPRQO\ XVHG LQ WUDQVJHQLF SODQW H[SHULPHQWV GXH WR LWV DELOLW\ WR IXQFWLRQ LQ D ZLGH

PAGE 10

YDULHW\ RI SODQW V\VWHPV ,W LV KLJKO\ DFWLYH LQ WUDQVLHQW DVVD\V XVLQJ FHOO OLQHV IURP ERWK GLFRW\OHGHQRXV DQG PRQRFRW\OHGHQRXV SODQW VSHFLHV )URPP HW DO 2X/HH HW DO 1DJDWD HW DO 'HNH\VHU HW DO f DQG LV FRQVWLWXWLYHO\ H[SUHVVHG LQ UHJHQHUDWHG WUDQVJHQLF SODQWV .R]LHO HW DO 2GHOO HW DO 6KDK HW DO f 7R ORFDOL]H LPSRUWDQW FVUHJXODWRU\ UHJLRQV ZLWKLQ WKH 6 SURPRWHU GHOHWLRQ PXWDWLRQ H[SHULPHQWV KDYH EHHQ SHUIRUPHG ZLWK VXEVHTXHQW DQDO\VLV RI JHQH SURGXFWV 2GHOO HW DO f IXVHG WKH 6 SURPRWHU WR WKH FRGLQJ UHJLRQ RI D KXPDQ JURZWK IDFWRU JHQH DQG E\ PRQLWRULQJ P51$ OHYHOV LQ WREDFFR FDOOL VKRZHG WKDW WKLV SURPRWHU ZDV IXOO\ DFWLYH ZKHQ WKH n IODQNLQJ VHTXHQFHV RI WKLV FKLPHULF JHQH H[WHQGHG EDVH SDLUV XSVWUHDP IURP WKH WUDQVFULSWLRQ LQLWLDWLRQ VLWH *HQH SURGXFWV IURP WKLV FRQVWUXFW ZHUH REVHUYHG LQ URRWV SHWDOV DQG VWHPV RI WUDQVJHQLF WREDFFR SODQWV 2GHOO HW DO f )XUWKHU DQDO\VLV RI WKH SURPRWHU LQ WREDFFR FDOOL LQYROYHG DGGLWLRQDO n GHOHWLRQV WR SRVLWLRQ DQG ZKLFK UHGXFHG SURPRWHU DFWLYLW\ b DQG b UHVSHFWLYHO\ 7KLV JURXS DOVR VKRZHG WKDW WKH SURPRWHU VHTXHQFHV H[WHQGLQJ ES XSVWUHDP IURP WKH WUDQVFULSW VWDUW VLWH ZKLFK LQFOXGHV WKH 7$7$ ER[ ZHUH VXIILFLHQW WR LQLWLDWH WUDQVFULSWLRQ DW WKH VWDUW VLWH QRUPDOO\ XWLOL]HG LQ WKH WUDQVFULSWLRQ RI WKH LQWDFW &D09 6 JHQH 7KXV WKH SURPRWHU VHTXHQFHV VLWXDWHG EHWZHHQ DQG ZHUH VKRZQ WR EH QHFHVVDU\ IRU IXOO WUDQVFULSWLRQDO DFWLYLW\ LQ WREDFFR DQG WUDQVFULSWLRQ GLG QRW DSSHDU WR EH WLVVXH VSHFLILF 2GHOO HW DO f 6LPLODU GHOHWLRQ H[SHULPHQWV RI WKH &D09 6 SURPRWHU ZKHQ IXVHG WR WKH FRGLQJ UHJLRQ RI D ILUHIO\ OXFLIHUDVH JHQH ZHUH FRQVWUXFWHG DQG DQDO\]HG LQ FDUURW SURWRSODVWV 2Z HW DO f 7KH UHVXOWV RI WKHVH H[SHULPHQWV VKRZHG WKDW WKH SURPRWHU ZDV IXOO\ DFWLYH ZKHQ LW H[WHQGHG XSVWUHDP RQO\ ES IURP WKH &$3 VLWH +RZHYHU DQ DGGLWLRQDO ES GHOHWLRQ WR UHGXFHG DFWLYLW\ b 7KLV ORZHU WUDQVFULSW OHYHO ZDV QRW DOWHUHG E\ DGGLWLRQDO n GHOHWLRQV WR DQG $ IXUWKHU GHOHWLRQ RI EDVH SDLUV WR GLG UHVXOW LQ D UHGXFHG OHYHO RI H[SUHVVLRQ RI WKH FKLPHULF JHQH WR OHVV WKDQ b RI WKH PD[LPXP H[SUHVVLRQ 2Z HW DO f

PAGE 11

7KH &D09 6 SURPRWHU GHOHWLRQ VWXGLHV LQ FDOOL DQG SURWRSODVWV SURYLGHG LQIRUPDWLRQ WKDW HQDEOHG LQYHVWLJDWRUV WR IRFXV WKHLU DWWHQWLRQ RQ VSHFLILF UHJLRQV RI WKH SURPRWHU 7KH &D09 6 SURPRWHU LV RQ DYHUDJH IROG PRUH WUDQVFULSWLRQDOO\ DFWLYH WKDQ WKH $ WXPHIDFLHQV 7'1$ QRSDOLQH V\QWKDVH QRVf SURPRWHU LQ WUDQVJHQLF SHWXQLD 6DQGHUV HW DO f 6HTXHQFHV SUHYLRXVO\ VKRZQ WR EH LPSRUWDQW EHWZHHQ DQG RI WKH 6 SURPRWHU ZHUH SRVLWLRQHG GLUHFWO\ XSVWUHDP RI D WUXQFDWHG WR SRVLWLRQ f QRV SURPRWHU IXVHG WR D &$7 UHSRUWHU JHQH 2GHOO HW DO f 7KH DGGLWLRQ RI WKHVH VHTXHQFHV LQ ERWK RULHQWDWLRQV UHVXOWHG LQ LQFUHDVHG H[SUHVVLRQ RI WKH WUXQFDWHG FKLPHULF JHQH LQ WREDFFR WREDFFR FDOOL DQG VR\EHDQ SURWRSODVWV WR OHYHOV HTXDO WR WKH ZLOG W\SH 6 SURPRWHU WR f 2GHOO HW DO f 7KHVH UHVXOWV LQGLFDWH WKDW WKLV UHJLRQ FRQWDLQV SURPRWHU HOHPHQWV WKDW FDQ IXQFWLRQ LQ DVVRFLDWLRQ ZLWK D KHWHURORJRXV SURPRWHU LQ D ELGLUHFWLRQDO PDQQHU 7KLV HQKDQFHUOLNH HIIHFW LV SRVLWLRQ GHSHQGHQW LQ WKDW DQ LQYHUVH FRUUHODWLRQ ZDV REVHUYHG EHWZHHQ GLVWDQFH IURP WKH 7$7$ ER[ DQG WUDQVFULSWLRQDO DFWLYLW\ 2GHOO HW DO f 7KH SURPRWHU UHJLRQ EHWZHHQ WR RI WKH 6 JHQH KDV DOVR EHHQ VKRZQ WR VWLPXODWH WUDQVFULSWLRQ LQ PDL]H SURWRSODVWV ZKHQ SODFHG XSVWUHDP RI WKH PDL]H DOFRKRO GHK\GURJHQDVH $GKOf SURPRWHU WUXQFDWHG WR WKH SRVLWLRQ (OOLV HW DO f 7KHVH VHTXHQFHV DOVR VWLPXODWH DQ LQFUHDVH LQ WUDQVFULSWLRQ RI WZR 7'1$ JHQHV JHQHV DQG :LOOPLW]HU HW DO f LQ WUDQVJHQLF WREDFFR SODQWV DQG WUDQVFULSWLRQDO DFWLYLW\ LQFUHDVHV IROG ZKHQ WKLV UHJLRQ LV GXSOLFDWHG LQ WDQGHP ZLWKLQ WKH QDWXUDO 6 SURPRWHU SRVLWLRQHG XSVWUHDP RI 137 ,, FRGLQJ VHTXHQFHV .D\ HW DO f $Q DGGLWLRQDO VWXG\ LQ WUDQVJHQLF WREDFFR OHDYHV DQDO\]LQJ WKH HIIHFWV RI n DQG LQWHUQDO GHOHWLRQV RI WKH 6 SURPRWHU ORFDOL]HG WKUHH UHJLRQV QHFHVVDU\ IRU PD[LPXP WUDQVFULSWLRQ HIILFLHQF\ )DQJ HW DO f :KHUHDV 2GHOO HW DO f GLG QRW REVHUYH DQ\ VLJQLILFDQW GURS LQ WUDQVFULSWLRQ XSRQ GHOHWLRQ RI VHTXHQFHV EHWZHHQ DQG LQ WREDFFR )DQJ HW DO f IRXQG WKDW WKH UHJLRQ EHWZHHQ DQG FRQWULEXWHG b RI WKH DFWLYLW\ WR WKH GRZQVWUHDP SURPRWHU VHTXHQFHV $ VHFRQG UHJLRQ WR ZDV

PAGE 12

IRXQG WR FRQWULEXWH b RI WKH DFWLYLW\ WR GRZQVWUHDP VHTXHQFHV DQG ZDV HQKDQFHUOLNH LQ LWV DFWLYLW\ $ WKLUG UHJLRQ EHWZHHQ DQG RI WKH 6 SURPRWHU ZKLFK GRHV QRW LQFOXGH WKH 7$7$ ER[f GLG QRW FRQWULEXWH WR SURPRWHU DFWLYLW\ ZKHQ VHTXHQFHV n WR WKLV UHJLRQ ZHUH DEVHQW EXW LWV SUHVHQFH LQ HLWKHU RULHQWDWLRQ LQ DVVRFLDWLRQ ZLWK WKH XSVWUHDP VHTXHQFHV DOORZHG IRU LQFUHDVHG WUDQVFULSWLRQDO DFWLYLW\ )DQJ HW DO f +LVWRFKHPLFDO ORFDOL]DWLRQ RI GLIIHUHQW 6 SURPRWHU PXWDWLRQV IXVHG WR D JOXFXURQLGDVH *86f UHSRUWHU JHQH ZDV XVHG WR LGHQWLI\ WZR GRPDLQV RI WKH 6 SURPRWHU UHVSRQVLEOH IRU WLVVXH VSHFLILFLW\ QRW SUHYLRXVO\ REVHUYHG LQ UHJHQHUDWHG WREDFFR %HQIH\ HW DO f 'RPDLQ $ WR f ZKLFK GRHV QRW FRQWULEXWH WR LQFUHDVHG WUDQVFULSWLRQDO H[SUHVVLRQ LQ WREDFFR OHDYHV )DQJ HW DO f FRQIHUV VWURQJ H[SUHVVLRQ WR URRWV ,W ZDV REVHUYHG WKDW QXFOHDU SURWHLQ IDFWRUV ELQG WR WKH '1$ ZLWKLQ WKLV UHJLRQ EHWZHHQ DQG %HQIH\ DQG &KXD f 'RPDLQ % WR f LV QRW DFWLYH LQ URRWV EXW LV PDLQO\ UHVSRQVLEOH IRU WUDQVFULSWLRQDO DFWLYLW\ LQ YDVFXODWHG WLVVXHV VXFK DV OHDYHV FRW\OHGRQV DQG K\SRFRW\OV %HQIH\ HW DO f 7KHVH WZR SURPRWHU GRPDLQV ZRUN EHVW ZKHQ DVVRFLDWHG ZLWK HDFK RWKHU DQG DUH ERWK QHFHVVDU\ IRU FRQVWLWXWLYH H[SUHVVLRQ $QDO\VLV RI PXWDWLRQV LGHQWLILHG FLVHOHPHQWV ZKLFK LQ WXUQ EHFDPH WDUJHWV IRU VXEVHTXHQW VWXGLHV WKDW PDSSHG SURWHLQ'1$ LQWHUDFWLRQV '1DVH IRRWSULQWLQJ H[SHULPHQWV SHUIRUPHG RQ WKH VHTXHQFHV WR ORFDOL]HG WKH ELQGLQJ VLWHV IRU WKH DFWLYDWLRQ VHTXHQFH IDFWRU $6),f EHWZHHQ DQG /DP HW DO f 7KH H[SHULPHQWV XWLOL]HG WR FKDUDFWHUL]H WKH &D09 6 SURPRWHU LOOXVWUDWHV WKH FRQWULEXWLRQ PDGH E\ VSHFLILF SODQW JHQH SURPRWHU PXWDWLRQV DQG WKHLU DQDO\VLV LQ WUDQVJHQLF SODQW V\VWHPV WR WDUJHW DQG LGHQWLI\ LPSRUWDQW UHJXODWRU\ UHJLRQV

PAGE 13

,QGXFLEOH *HQHV ([SUHVVLRQ RI 7KHUPDOO\ ,QGXFHG 3ODQW *HQHV 'LIIHUHQW SODQW V\VWHPV KDYH EHHQ H[SORLWHG WR DQDO\]H WKH UHJXODWHG H[SUHVVLRQ RI HQYLURQPHQWDOO\ LQGXFLEOH JHQHV VXFK DV KHDW VKRFN ZRXQGLQJ OLJKW DQG DQDHURELF VWUHVV %HQIH\ DQG &KXD IRU UHYLHZf ([DPSOHV RI WKLV W\SH RI LQYHVWLJDWLRQ LQFOXGH WKH WUDQVIRUPDWLRQ RI VR\EHDQ KHDW VKRFN +6f JHQHV LQ KHWHURORJRXV VXQIORZHU DQG WREDFFR V\VWHPV ([SUHVVLRQ RI WKH +6 PXOWLJHQH IDPLO\ LQ VR\EHDQ PD\ EH QHFHVVDU\ IRU VXUYLYDO RI WKH SODQW ZKHQ VXEMHFWHG WR WKHUPDO VWUHVV .H\ HW DO IRU UHYLHZf ,Q DQ HIIRUW WR GHOLQHDWH UHJXODWRU\ HOHPHQWV RI D VR\EHDQ +6 JHQH *PKVSO % KDV EHHQ LQFRUSRUDWHG LQWR VXQIORZHU VHHGOLQJ K\SRFRW\O WLVVXH YLD $JUREDFWHULXP PHGLDWHG WUDQVIHU 6FKRIIO DQG %DXPDQQ f 7KH WUDQVIHUUHG '1$ FRQWDLQHG WKH SURWHLQ FRGLQJ UHJLRQ DQG DERXW NE RI n IODQNLQJ VHTXHQFHV ,Q VXQIORZHU WXPRU WLVVXH *PKVSO% ZDV VKRZQ WR EH WUDQVFULSWLRQDOO\ H[SUHVVHG XSRQ WKHUPRLQGXFWLRQ WKRXJK DW YHU\ ORZ OHYHOV FRPSDUHG WR VR\EHDQ $ QXPEHU RI n GHOHWLRQ PXWDWLRQV RI WKH *PKVSO% SURPRWHU WKH ORQJHVW H[WHQGLQJ ES XSVWUHDP RI WKH VWDUW VLWH ZHUH WKHQ FRQVWUXFWHG LQ YLWUR ([SUHVVLRQ RI HDFK GHOHWLRQ ZDV DQDO\]HG LQ UHJHQHUDWHG WREDFFR SODQWV %DXPDQQ HW DO f ,Q WKLV KHWHURORJRXV WUDQVJHQLF V\VWHP WKRVH GHOHWLRQ PXWDQWV WKDW ZHUH H[SUHVVHG ZHUH LQGXFHG DW WKH P51$ OHYHO E\ KHDW VKRFN DQG XWLOL]HG WKH FRUUHFW WUDQVFULSWLRQ LQLWLDWLRQ VLWH 6HTXHQFHV ZLWKLQ WKH SURPRWHU EHWZHHQ DQG ES XSVWUHDP RI WKH WUDQVODWLRQ VWDUW ZHUH IRXQG FDSDEOH RI FRQYH\LQJ WKHUPR LQGXFLELOLW\ XSRQ WKLV JHQH 7KLV UHJLRQ FRQWDLQV RYHUODSSLQJ KHDW VKRFN HOHPHQWV +6(Vf ILUVW GHVFULEHG LQ +6 JHQHV RI 'URVRSKLOD IRU UHYLHZ VHH 3HOKDP f ZKLFK VKRZ D FRPPRQ VSDFLQJ DQG ORFDWLRQ LQ UHODWLRQ WR VWDUW RI WUDQVFULSWLRQ LQ DOO VR\EHDQ KHDW VKRFN JHQHV WKXV IDU GHVFULEHG 5DVFKNH HW DO f %DXPDQQ HW DO f DOVR GHWHUPLQHG WKDW GLVWDO +6(OLNH VHTXHQFHV EHWZHHQ DQG UHODWLYH WR WKH WUDQVODWLRQ VWDUW FRGRQf DOVR PDNH D SRVLWLYH FRQWULEXWLRQ WR WKHUPRLQGXFLELOLW\ $Q DGGLWLRQDO VHTXHQFH

PAGE 14

HOHPHQW ZKLFK ZDV $7ULFK ZDV LGHQWLILHG EHWZHHQ DQG 7KLV HOHPHQW ZDV VKRZQ WR EH FDSDEOH RI ELGLUHFWLRQDO DFWLYLW\ ZKHQ SODFHG XSVWUHDP RI WKH WUXQFDWHG *PKVSO% SURPRWHU $QRWKHU VR\EHDQ +6 JHQH *PKVSO( KDV DOVR EHHQ LQFRUSRUDWHG LQWR VXQIORZHU WXPRUV YLD $JUREDFWHULXP WUDQVIHU *XUOH\ HW DO f 7KH WUDQVJHQLF WXPRU WLVVXH ZDV KHDW VKRFNHG DW r& ZKHUHXSRQ WUDQVFULSWLRQ OHYHOV LQFUHDVH DW OHDVW IROG IURP D FRS\ RI WKH JHQH FRQWDLQLQJ ES RI XSVWUHDP VHTXHQFHV 0XWDWLRQDO DQDO\VLV RI WKH SURPRWHU E\ n GHOHWLRQV UHYHDOHG WKDW VHTXHQFHV EHWZHHQ DQG ZHUH QHFHVVDU\ IRU PD[LPDO LQGXFWLRQ RI WKH JHQH *XUOH\ HW DO f 7KH LGHQWLILFDWLRQ RI LPSRUWDQW UHJLRQV RI WKH *PKVSO( SURPRWHU E\ WKHVH LQLWLDO GHOHWLRQV DOORZHG IRU D PRUH VSHFLILF PXWDWLRQDO DQDO\VLV $GGLWLRQDO PDQLSXODWLRQV RI WKH SURPRWHU E\ n DQG LQWHUQDO GHOHWLRQV UHYHDOHG WKDW WKH GLVWDO UHJLRQ RI WKH SURPRWHU EHWZHHQ DQG GRQDWHV D PRGHVW b DFWLYLW\ WR WKH WUDQVFULSWLRQDO DFWLYLW\ )XUWKHU UHPRYDO RI VHTXHQFHV WR GHFUHDVHG WUDQVFULSWLRQ WR b FRPSDUHG WR WKH SURPRWHU H[WHQGLQJ ES XSVWUHDP &]DPHFND HW DO f %RWK f DQG LQWHUQDO GHOHWLRQ PXWDQWV HQDEOHG LGHQWLILFDWLRQ RI WZR UHJLRQV QHDU WKH 7$7$ ER[ VLWH WR f DQG VLWH WR f ZKLFK KDUERU +6(V DQG DUH LQYROYHG LQ WKH WUDQVFULSWLRQ UHVSRQVH WR KHDW VWUHVV 5HPRYDO RI HLWKHU RI WKHVH WZR UHJLRQV DEROLVKHG WKHUPRLQGXFLELOLW\ 7KH VHTXHQFHV EHWZHHQ DQG FRQWULEXWHG b RI WKH LQGXFHG WUDQVFULSWLRQDO H[SUHVVLRQ RI WKH JHQH &]DUQHFND HW DO f :LWKLQ WKHVH VHTXHQFHV LV D 7$7$ G\DG 7$7$$$*$$777&f WKDW LV FRQVHUYHG LQ ERWK 'URVRSKLOD DQG VR\EHDQ KHDW VKRFN JHQHV DQG PD\ DOVR FRQWULEXWH WKHUPRLQGXFLELOLW\ +HDW VKRFN JHQHV DSSHDU WR EH XELTXLWRXV VHH 6FKOHVLQJHU HW DO f DQG KDYH VLPLODU SURPRWHU HOHPHQWV 3HOKDP IRU UHYLHZf DPRQJ HXFDU\RWHV ,W LV LQWHUHVWLQJ WR QRWH WKDW WKH 'URVRSKLOD KVS SURPRWHU H[WHQGLQJ XSVWUHDP ES IURP WKH WUDQVFULSWLRQ LQLWLDWLRQ VLWHf ZKHQ IXVHG WR WKH FRGLQJ UHJLRQ RI D QHRP\FLQ SKRVSKRWUDQVIHUDVH ,, JHQH SURYHG WR EH WKHUPDOO\ LQGXFLEOH LQ WREDFFR FDOOL 6SHQD HW DO

PAGE 15

f 6LPLODUO\ XSRQ UHJHQHUDWLRQ RI WKH FDOOL LQWR WUDQVJHQLF WREDFFR SODQWV WKH FKLPHULF JHQH ZDV LQGXFHG E\ KHDW VKRFN LQ URRWV VWHPV DQG OHDYHV EXW ZDV QRW IRXQG H[SUHVVHG LQ SROOHQ 6SHQD DQG 6FKHOO f ([SUHVVLRQ RI D :RXQG,QGXFLEOH 3ODQW *HQH 7KH SURWHLQDVH LQKLELWRU ,, 3, ,,f JHQH RI SRWDWR LV D PHPEHU RI D VPDOO JHQH IDPLO\ WKDW LV QRUPDOO\ H[SUHVVHG LQ WKH WXEHUV RI WKH SODQW LQ D WLVVXH VSHFLILF PDQQHU 6DQFKH]6HUUDQR HW DO f EXW LV LQGXFHG E\ PHFKDQLFDO ZRXQGLQJ RU LQVHFW DWWDFN LQ OHDYHV *UHHQ DQG 5\DQ f 7R LQYHVWLJDWH FVUHJXODWRU\ HOHPHQWV RI WKLV JHQH n DQG n IODQNLQJ VHTXHQFHV ZHUH IXVHG WR WKH &$7 JHQH FRGLQJ UHJLRQ DQG WUDQVIRUPHG LQWR WREDFFR 7KRUQEXUJ HW DO f $ IROG LQFUHDVH LQ &$7 DFWLYLW\ ZDV GHWHFWHG DV FRPSDUHG WR EDVDO OHYHOV ZKHQ WKH OHDYHV ZHUH VXEMHFWHG WR PHFKDQLFDO ZRXQGLQJ :KHQ WKH n IODQNLQJ VHTXHQFHV RI WKH 7'1$ E JHQH ZHUH VXEVWXWXWHG IRU WKRVH RI 3, ,, IRU WKLV FKLPHULF FRQVWUXFW QR DFWLYWLW\ ZDV REVHUYHG 7KHUHIRUH LW ZDV GHWHUPLQHG WKDW WKH n IODQNLQJ VHTXHQFHV ZHUH UHTXLUHG IRU WKH ZRXQG UHVSRQVH RI WKLV JHQH LQ WREDFFR 7KRUQEXUJ HW DO f 7UDQVFULSWV RI D SRWDWR 3, ,, JHQH ZHUH V\VWHPLFDOO\ LQGXFHG DQG DFFXUDWHO\ VSOLFHG LQ WREDFFR SODQWV -RKQVRQ HW DO f LQ D VLPLODU PDQQHU DV LQ LWV QDWXUDO KRVW 6DQFKH]6HUUDQR HW DO f ,QGXFWLRQ OHYHOV ZHUH VWURQJHVW ZLWKLQ WKH UHJLRQ RI YDVFXODU WLVVXH LQ WREDFFR DV LW LV LQ SRWDWR .HLO HW DO f ,QIRUPDWLRQ JDWKHUHG E\ WKHVH H[SHULPHQWV VXJJHVW WKDW VSHFLILF LQ YLWUR PXWDWLRQV RI UHJXODWRU\ UHJLRQV DQG DQDO\VLV LQ WREDFFR PD\ QRZ EH XWLOL]HG DV D PHDQV WR LGHQWLI\ LPSRUWDQW VHTXHQFHV RI WKHVH JHQHV /LJKW 5HJXODWHG 3ODQW *HQHV 7KH QXFOHDU JHQHV RI SHD HQFRGLQJ WKH VPDOO VXEXQLW RI ULEXORVH ELVSKRVSKDWH 5X%3f FDUER[\ODVH &RUX]]L HW DO f UHSUHVHQW H[DPSOHV RI SODQW JHQHV WKDW DUH WUDQVFULSWLRQDOO\ UHJXODWHG E\ WKH SUHVHQFH RU DEVHQFH RI OLJKW 'LIIHUHQW SODQW V\VWHPV

PAGE 16

KDYH EHHQ XWLOL]HG WR LGHQWLI\ FLVDFWLQJ UHJXODWRU\ HOHPHQWV RI WKHVH JHQHV 7KH SHD UEF6 ( JHQH KDV EHHQ WUDQVIRUPHG LQWR SHWXQLD SURWRSODVWV ZKLFK ZHUH VXEVHTXHQWO\ JURZQ DV FDOOL %URJOLH HW DO f $ FRQVWUXFW FRQWDLQLQJ ES RI VHTXHQFHV n WR LWV VWDUW VLWH ZDV WUDQVFULEHG LQ D VLPLODU IDVKLRQ DV LQ LWV QDWXUDO KRVW 7KRXJK OHVV WKDQ LQ SHD OHDYHV WUDQVFULSWLRQ LQ SHWXQLD ZDV VKRZQ WR EH LQGXFHG XS WR IROG LQ FDOOL XSRQ H[SRVXUH WR OLJKW 7KH UHVXOWLQJ WUDQVFULSWV ZHUH FRUUHFWO\ LQLWLDWHG SRO\DGHQ\ODWHG DQG HIILFLHQWO\ VSOLFHG UHPRYLQJ WKH WZR LQWHUYHQLQJ LQWURQV RI WKH LPPDWXUH PHVVDJH %URJOLH HW DO f 7KH SURPRWHU RI DQRWKHU OLJKW UHJXODWHG SHD JHQH RI WKH UEF6 JHQH IDPLO\ VV &DVKPRUH f ZDV IXVHG WR D EDFWHULDO &$7 UHSRUWHU JHQH DQG WUDQVIRUPHG LQWR WREDFFR FDOOL +HUUHUD(VWUHOOD HW DO f 7KLV OLJKW UHJXODWHG SURPRWHU H[WHQGHG IURP WR ES UHODWLYH WR WKH WUDQVFULSWLRQ VWDUW VLWH 7KH SURPRWHU RI VV ZDV DOVR VKRZQ WR UHJXODWH WUDQVFULSWLRQ LQ VR\EHDQ FDOOXV WLVVXH )DFFLRWWL HW DO f 7KXV WKH FLV UHJXODWRU\ HOHPHQWV RI WKHVH OLJKW UHJXODWHG JHQHV IURP SHD ZHUH LQGHSHQGHQWO\ UHFRJQL]HG E\ QXFOHDU IDFWRUV RI ERWK WREDFFR DQG VR\EHDQ 2QFH WKH HIILFLHQF\ RI WUDQVJHQLF H[SUHVVLRQ ZDV GHPRQVWUDWHG IRU WKHVH OLJKW UHJXODWHG JHQHV PXWDWLRQDO DQDO\VHV ZHUH HPSOR\HG WR LGHQWLI\ DQG ORFDOL]H LPSRUWDQW UHJXODWRU\ VHTXHQFHV 7KH SURPRWHU RI WKH SHD UEF6( JHQH ZDV VXEMHFWHG WR D QXPEHU RI n GHOHWLRQV DQG RQH LQWHUQDO GHOHWLRQ 7UDQVJHQLF FDOOL WLVVXH KDUERULQJ HDFK FRQVWUXFW ZHUH SRROHG DQG WKH WUDQVFULSWV DQDO\]HG 0RUHOOL HW DO f ,Q WKLV PDQQHU LW ZDV VKRZQ WKDW VHTXHQFHV EHWZHHQ DQG DUH QHFHVVDU\ IRU PD[LPXP WUDQVFULSWLRQDO DFWLYLW\ DQG WKDW VHTXHQFHV LQYROYHG LQ OLJKW UHJXODWLRQ DUH ORFDOL]HG WR WKH 7$7$ ER[ UHJLRQ IURP WR 6LPLODU PDQLSXODWLRQV ZHUH SHUIRUPHG RQ WKH SHD UEF6 VV JHQH SURPRWHU VLWXDWHG XSVWUHDP RI WKH &$7 UHSRUWHU JHQH DQG WUDQVIRUPHG LQWR WREDFFR WXPRU WLVVXH 7LPNR HW DO f 7KH SURPRWHU VHTXHQFHV IURP WR ZHUH IRXQG WR FRQYH\ PD[LPXP WUDQVFULSWLRQ OHYHOV DQG SRVVHVVHG WKH SKRWRUHJXODWRU\ LQIRUPDWLRQ UHJDUGOHVV RI RULHQWDWLRQ 7KLV DELOLW\ WR UHVSRQG WR OLJKW ZDV DOVR VHHQ ZKHQ WKH n IODQNLQJ VHTXHQFHV ZHUH IXVHG WR D KHWHURORJRXV QRSDOLQH V\QWKDVH QRVf SURPRWHU DQG

PAGE 17

DVVD\HG LQ WREDFFR FHOOV 7KLV XSVWUHDP IUDJPHQW GLG QRW KRZHYHU LQIOXHQFH WUDQVFULSWLRQ ZKHQ SODFHG n WR WKH FRGLQJ UHJLRQ RI D FKLPHULF QRV&$7 FRQVWUXFW 7LPNR HW DO f 7KH OLJKW LQGXFLEOH UEF6( JHQH ZLWK D SURPRWHU H[WHQGLQJ ES XSVWUHDP IURP WKH VWDUW RI WUDQVFULSWLRQ ZDV LQGXFHG LQ WKH SUHVHQFH RI OLJKW LQ WUDQVJHQLF SHWXQLD DQG WREDFFR SODQWV ZLWK PRVW RI WKH DFWLYLW\ LQ OHDYHV ZKLFK LV VLPLODU WR LWV H[SUHVVLRQ LQ SHD 1DJ\ HW DO f 7ZR DGGLWLRQDO PHPEHUV RI WKH UEF6 PXOWLJHQH IDPLO\ RI SHD UEF6$ DQG UEF66& ZHUH WUDQVIHUUHG LQWR SHWXQLD SODQWV DQG DVVD\HG IRU OLJKW LQGXFHG H[SUHVVLRQ )OXKU HW DO E )OXKU DQG &KXD f ,Q SHWXQLD WKH SHD UEF6$ JHQH QHHGHG RQO\ ES RI LWV n IODQNLQJ VHTXHQFH WR EH HIILFLHQWO\ WUDQVFULEHG ZLWK OLJKW PHGLDWHG SK\WRFKURPH FRQWURO LQ DQ RUJDQ VSHFLILF PDQQHU PRVW KLJKO\ H[SUHVVHG LQ OHDYHVf 7KH VHTXHQFH UHTXLUHPHQW IRU PD[LPXP WUDQVFULSWLRQ HIILFLHQF\ LQ UHJHQHUDWHG SODQWV GLIIHUV IURP WKDW REVHUYHG IRU UEF6( LQ SHWXQLD FDOOL 0RUHOOL HW DO f 7KH WR UHJLRQ RI WKH UEF6$ SURPRWHU LQ UHJHQHUDWHG SHWXQLD SODQWV ZHUH GHILQHG DV HQKDQFHUOLNH LQ WKDW WKH\ FRQYH\ HOHYDWHG OLJKW LQGXFLEOH DQG RUJDQ VSHFLILF WUDQVFULSWLRQ OHYHOV ZKHQ SODFHG XSVWUHDP RI D WUXQFDWHG KHWHURORJRXV &D09 6 SURPRWHU UHJDUGOHVV RI RULHQWDWLRQ 6LPLODU UHVXOWV ZHUH REVHUYHG ZKHQ WKH UHJLRQ WR RI WKH FORVHO\ UHODWHG SHD UEF6( JHQH ZDV SODFHG LQ ERWK RULHQWDWLRQV XSVWUHDP RI D WUXQFDWHG QRV SURPRWHU DQG DQDO\]HG LQ WUDQVJHQLF SHWXQLD SODQWV )OXKU HW DO Df 5HJXODWRU\ H[SUHVVLRQ OHYHOV RI SHD UEF6 JHQH SURPRWHUV ZHUH IXUWKHU LQYHVWLJDWHG E\ DGGLWLRQDO LQ YLWUR PDQLSXODWLRQV DQG DQDO\VLV LQ WUDQVJHQLF WREDFFR 5EF6$ DQG UEF6( DUH FORVHO\ UHODWHG JHQHV EXW UEF6$ LV H[SUHVVHG WR D PXFK KLJKHU OHYHO LQ SHD 6HTXHQFHV EHWZHHQ DQG LQFOXGLQJ WKH 7$7$ ER[ ZHUH SK\VLFDOO\ VZLWFKHG EHWZHHQ WKH WZR JHQHV E\ FORQLQJ SURFHGXUHV ,Q WREDFFR HDFK FKLPHULF ZDV WUDQVFULSWLRQDOO\ H[SUHVVHG DW OHYHOV FRUUHVSRQGLQJ WR DFWLYLW\ REWDLQHG ZLWK WKH KRPRORJRXV 7$7$ UHJLRQ WR f .XKOHPHLHU HW DO f LQIHUULQJ WKDW WKHVH VHTXHQFHV DUH QRW UHVSRQVLEOH IRU WKH GLIIHUHQFH LQ WUDQVFULSWLRQ OHYHOV 6HTXHQFHV H[WHQGLQJ IURP WR RI WKH UEF6$

PAGE 18

JHQH ZHUH WKHQ LQVHUWHG LQ WKH VDPH SRVLWLRQ XSVWUHDP RI DQ UEF6( n WUXQFDWHG GHOHWLRQ WR 7KLV FKLPHULF SURPRWHU UHVXOWHG LQ KLJK OHYHOV RI LQGXFHG H[SUHVVLRQ VLPLODU WR WKDW RI UEF6$ 7KHVH WZR H[SHULPHQWV LQGLFDWH WKDW WKH DPSOLWXGH RI H[SUHVVLRQ LV GHWHUPLQHG E\ VHTXHQFHV XSVWUHDP RI .XKOHPHLHU HW DO f 7KHVH VDPH SHD UEF6$ SURPRWHU VHTXHQFHV EHWZHHQ DQG DOVR FRQIHU FHOO VSHFLILFLW\ RI H[SUHVVLRQ LQ WUDQVJHQLF WREDFFR $R\DJL HW DO f 6LPLODU VHTXHQFH EORFN H[FKDQJH H[SHULPHQWV ZHUH SHUIRUPHG EHWZHHQ WKH KLJKO\ H[SUHVVHG SHWXQLD UEF6 JHQH 668 DQG WKH ZHDNO\ WUDQVFULEHG 668 LQ WUDQVJHQLF WREDFFR SODQWV ,Q WKLV FDVH SURPRWHU VHTXHQFHV ORFDWHG EHWZHHQ DQG RI 668 ZHUH VKRZQ WR FRQYH\ WKH GLIIHUHQFH LQ H[SUHVVLRQ OHYHOV 'HDQ HW DO f 7KH SHD UEF6$ SURPRWHU KDG DOVR EHHQ H[DPLQHG E\ D QXPEHU RI f DQG LQWHUQDO SURPRWHU GHOHWLRQV ZKHQ IXVHG WR D &$7 UHSRUWHU JHQH DQG WUDQVIRUPHG LQWR WREDFFR SODQWV .XKOHPHLHU HW DO Df $ SURPRWHU H[WHQGLQJ XSVWUHDP WR WKH SRVLWLRQ ZDV LQGXFHG E\ OLJKW EXW ZLWK WR IROG OHVV H[SUHVVLRQ WKDQ WKH SURPRWHU RI D VLPLODU FKLPHULF WKDW H[WHQGHG WR ZKHUHDV D n GHOHWLRQ WR LQKLELWHG OLJKW LQGXFHG WUDQVFULSWLRQ 7KXV D SRVLWLYH OLJKW UHVSRQVH HOHPHQW /5(f ZDV PDSSHG EHWZHHQ SRVLWLRQV DQG 7KLV UHJLRQ RI UEF6$ FRQWDLQV WKUHH GRPDLQV GHVLJQDWHG ER[HV WR f ,, WR f DQG ,,, WR f ZKLFK DUH DOVR IRXQG ZLWKLQ WKH SURPRWHU RI RWKHU SKRWRUHJXODWHG SHD UEF6 JHQHV 5HVXOWV IURP IXVLQJ WKLV UHJLRQ XSVWUHDP RI D WUXQFDWHG &D09 6 SURPRWHU&$7 FRGLQJ UHJLRQ FRQVWUXFW IROORZHG E\ WUDQVIRUPDWLRQ DQG UHJHQHUDWLRQ RI WREDFFR SODQWV LQGLFDWHG WKH SUHVHQFH RI D QHJDWLYH /5( ZKLFK VXSSUHVVHV WUDQVFULSWLRQ RI WKLV FKLPHULF JHQH LQ WKH GDUN .XKOHPHLHU HW DO Df *HQHUDO UHSRVLWLRQLQJ DQG GHOHWLRQ VWXGLHV RI FZDFWLQJ UHJXODWRU\ HOHPHQWV RI WKH OLJKW UHJXODWHG SHD JHQH SURPRWHUV E\ LQ YLWUR PXWDWLRQV DQG DQDO\VLV LQ WUDQVJHQLF SODQWV ORFDOL]HG UHJLRQV ZLWKLQ WKH SURPRWHU ZKLFK DOORZHG IRU D PRUH ILQHWXQHG DQDO\VLV E\ PRUH VSHFLILF SURPRWHU PXWDWLRQ H[SHULPHQWV $ n GHOHWLRQ LQWR ER[ ,, RI WKH UEF6$

PAGE 19

SURPRWHU WR f GUDVWLFDOO\ UHGXFHG OLJKW UHJXODWHG H[SUHVVLRQ LQ WREDFFR SODQWV .XKOHPHLHU HW DO Df 7KLV SURPRWHU ZLWK VHTXHQFHV H[WHQGLQJ XSVWUHDP WR FRQYH\HG OLJKW UHJXODWLRQ EXW SRLQW PXWDWLRQV ZLWKLQ ER[ ,, DEROLVKHG WUDQVFULSWLRQ DQG PXWDWLRQV ZLWKLQ ER[ ,,, UHGXFHG WUDQVFULSWLRQ E\ b LQ WUDQVJHQLF WREDFFR .XKOHPHLHU HW DO f $ VHFRQG FRQVWUXFW SRVVHVVLQJ WKH SHD UEF6$ SURPRWHU WUXQFDWHG WR H[SUHVVHV OLJKW UHJXODWHG JHQH DFWLYLW\ ZKHQ ER[HV ,, DQG ,,, DUH LQWHUQDOO\ GHOHWHG .XKOHPHLHU HW DO Df 7KLV SDUDGR[ FDQ EH H[SODLQHG E\ WKH SUHVHQFH RI UHGXQGDQW VHTXHQFHV RI ER[HV ,, DQG ,,, GHVLJQDWHG ER[HV ,,r DQG ,,,r ZKLFK DUH IRXQG ZLWKLQ WKH UHJLRQ RI WKH SURPRWHU $ SHD QXFOHDU WUDQVFULSWLRQ IDFWRU *7 ELQGV WR ER[HV ,, DQG ,,, DQG WR WKH UHGXQGDQW ER[HV ,,r DQG ,,,r *UHHQ HW DO f 5HVXOWV RI WKHVH H[SHULPHQWV LQGLFDWH WKH VDPH WUDQVFULSWLRQ IDFWRU ELQGV WR HLWKHU VHW RI VHTXHQFHV ZLWKLQ WKH SHD UEF6$ SURPRWHU DQG GHOHWLRQ RU PXWDWLRQ RI HDFK UHJLRQ VHSDUDWHO\ GRHV QRW GLVUXSW OLJKW UHJXODWLRQ EXW GHOHWLRQ RI ERWK VLPXOWDQHRXVO\ DEROLVKHV H[SUHVVLRQ LQ WUDQVJHQLF WREDFFR $OWKRXJK WKH SHD UEF6$ JHQH KDV WZR VHWV RI SRVLWLYH /5(V ZLWKLQ LWV SURPRWHU .XKOHPHLHU HW DO f VHTXHQFHV ZLWKLQ WKH UHJLRQ KDUERULQJ ER[HV ,, DQG ,,, DUH DOVR UHVSRQVLEOH IRU UHSUHVVLQJ WUDQVFULSWLRQ RI WKH FRQVWLWXWLYH &D09 6 SURPRWHU LQ WKH GDUN DQG WKHUHIRUH SRVVHVV D QHJDWLYH /5( .XKOHPHLHU HW DO Df 0RQRFRWYOHGRQRXV *HQH 3URPRWHUV ([SUHVVLRQ RI 0RQRFRWYOHGRQRXV 3URPRWHUV LQ 'LFRW\OHGRQRXV 3ODQWV $ QXPEHU RI PRQRFRW JHQHV KDYH EHHQ WUDQVIHUUHG DQG DQDO\]HG LQ GLIIHUHQW GLFRW\OHGRQRXV SODQW V\VWHPV $PRQJ WKHVH DQ RDW SK\WRFKURPH JHQH ZDV LQFRUSRUDWHG LQWR UHJHQHUDWHG WREDFFR SODQWV ZKHUH LW ZDV GHWHUPLQHG WKDW LWV RZQ OLJKW UHSUHVVLEOH SURPRWHU FRXOG QRW IXQFWLRQ .HOOHU HW DO f 2QO\ ZKHQ WKLV JHQH ZDV SODFHG XQGHU WKH FRQWURO RI WKH FRQVWLWXWLYH &D09 6 SURPRWHU ZHUH P51$ DQG SURWHLQV GHWHFWHG 6LPLODUO\ WKH UEF6 JHQH RI ZKHDW FRXOG QRW XWLOL]H LWV RZQ SURPRWHU LQ WUDQVJHQLF WREDFFR

PAGE 20

ZKHUH DJDLQ WUDQVFULSWLRQ SURGXFWV ZHUH RQO\ REVHUYHG ZKHQ WKH FRGLQJ VHTXHQFH ZDV IXVHG WR &D09 6 SURPRWHU .HLWK DQG &KXD f $OWHUQDWLYHO\ &$7 DFWLYLW\ ZDV REVHUYHG LQ WUDQVJHQLF WREDFFR LQ DQ HQGRVSHUP VSHFLILF PDQQHU ZKHQ WKH SURPRWHUV RI WZR ZKHDW HQGRVSHUP SURWHLQ JHQHV ORZ PROHFXODU ZHLJKW /0:f DQG KLJK PROHFXODU ZHLJKW +0:f JOXWHQLQ ZHUH IXVHG WR D &$7 UHSRUWHU JHQH DQG LQFRUSRUDWHG LQWR WREDFFR &RORW HW DO f ,Q DGGLWLRQ D OLJKW LQGXFLEOH DQG WLVVXH VSHFLILF FDE FKORURSK\OO DE ELQGLQJ SURWHLQf JHQH IURP ZKHDW ZDV DFFXUDWHO\ UHJXODWHG DQG WUDQVFULEHG LQ WUDQVJHQLF WREDFFR DQG SHWXQLD SODQWV /DPSSD HW DO f 7KH SURPRWHU RI WKH ZKHDW FDE JHQH KDYLQJ NE RI WKH n IODQNLQJ VHTXHQFHV IXVHG WR &$7 FRGLQJ VHTXHQFHV ZDV VKRZQ WR FRQIHU OLJKW DQG RUJDQ VSHFLILF H[SUHVVLRQ RI WKLV FKLPHULF LQ WUDQVJHQLF WREDFFR SODQWV 1DJ\ HW DO f 3URPRWHU PXWDWLRQV E\ LQ YLWUR n GHOHWLRQV DQG VXEVHTXHQW WUDQVIHU LQWR GLFRW\OHGRQRXV WREDFFR UHVXOWHG LQ FRPSDUDEOH H[SUHVVLRQ RI FKLPHULFV KDYLQJ HLWKHU NE RU ES RI n IODQNLQJ VHTXHQFHV ZKHUHDV IXUWKHU GHOHWLRQ WR UHVXOWHG LQ XQGHWHFWDEOH WUDQVFULSW OHYHOV 1DJ\ HW DO f )XUWKHU DQDO\VLV RI WKH ZKHDW FDE SURPRWHU VHTXHQFHV LGHQWLILHG D UHJLRQ EHWZHHQ DQG DV FRQYH\LQJ HQKDQFHUOLNH DFWLYLW\ XSRQ WKH KHWHURORJRXV &D09 6 SURPRWHU LQ WUDQVJHQLF WREDFFR 1DJ\ HW DO f $QRWKHU UHJXODWHG PRQRFRW JHQH WKDW LV LQGXFLEOH LQ GLFRWV XWLOL]LQJ LWV RZQ SURPRWHU LV WKH KVSO2 JHQH RI PDL]H LQ WUDQVJHQLF SHWXQLD 8SRQ WKHUPRLQGXFWLRQ WKLV JHQH LV WUDQVFULEHG WR IROG KLJKHU WKDQ LQ WUDQVJHQLF SODQWV QRW SODFHG XQGHU KHDW VWUHVV 5RFKHVWHU HW DO f 3URSHU LQGXFWLRQ DQG H[SUHVVLRQ RI PDL]H KVS LQ SHWXQLD LV QRW VXUSULVLQJ VLQFH WKH KHDW VKRFN JHQHV DSSHDU WR EH KLJKO\ FRQVHUYHG EHWZHHQ HXFDU\RWHV DV ZDV VHHQ ZLWK H[SUHVVLRQ RI WKH 'URVRSKLOD KVS SURPRWHU LQ WREDFFR 6SHQD DQG 6FKHOO f ,W LV DSSDUHQW WKDW WKH SURPRWHUV RI GLIIHUHQW PRQRFRW JHQHV PD\ EH UHFRJQL]HG E\ VRPH WUDQVJHQLF GLFRWV EXW QRW E\ RWKHUV DQG LQ WKRVH FDVHV ZKHUH H[SUHVVLRQ LV VHHQ WKH KHWHURORJRXV V\VWHP PD\ EH H[SORLWHG WR LGHQWLI\ LPSRUWDQW UHJXODWRU\ HOHPHQWV ZLWKLQ WKHVH SURPRWHUV

PAGE 21

0DL]H ]HLQ JHQHV FRGH IRU HQGRVSHUP VSHFLILF VWRUDJH SURWHLQV WKDW DUH SURGXFHG GXULQJ VHHG GHYHORSPHQW +LJJLQV f 7KLV FODVV RI JHQHV FRQVLVWV RI DERXW FRSLHV SHU KDSORLG JHQRPH DQG FRPSULVH VHYHUDO PXOWLJHQH IDPLOLHV +DJDQ DQG 5XEHQVWHLQ f (DUO\ VWXGLHV FRQFHUQHG ZLWK WKH F]VDFWLQJ UHJLRQ RI ]HLQ JHQHV KDYH WDNHQ DGYDQWDJH RI WKH IDFW WKDW ZKHQ PHPEHUV RI WKLV JHQH IDPLO\ DUH WUDQVIHUUHG LQWR D GLVVLPLODU SODQW V\VWHP E\ $ WXPHIDFLHQV WKH\ DUH IRUWXLWRXVO\ H[SUHVVHG LQ WKH FURZQ JDOO WXPRU FHOOV $Q DGYDQWDJH RI WXPRU H[SUHVVLRQ VWXGLHV LV LWV DYRLGDQFH RI OHQJWK\ SHULRGV QHHGHG IRU UHJHQHUDWLRQ RI WUDQVJHQLF SODQWV $ VHFRQG DGYDQWDJH LV WKH UHSURGXFLELOLW\ REWDLQHG E\ SRROLQJ ODUJH QXPEHUV RI WXPRUV 3URPRWHU PXWDWLRQ DQDO\VLV LQ SRROHG WUDQVIRUPHG SULPDU\ WXPRU WLVVXH FDQ EH SHUIRUPHG ZLWK OLWWOH FRQFHUQ WR SRVLWLRQ HIIHFW DV VHHQ LQ WUDQVJHQLF SODQWV .XKOHPHLU HW DO :LOOPLW]HU IRU UHYLHZVf 'DWD JDWKHUHG IURP WKHVH W\SHV RI H[SHULPHQWV ZKLFK PDS SURPRWHU HOHPHQWV PD\ WKHQ EH FRUUHODWHG ZLWK UHJLRQV RI WKH SURPRWHU LGHQWLILHG E\ LQ YLWUR '1$ ELQGLQJ DVVD\V 7KLV DYHQXH RI H[SHULPHQWDWLRQ KDV EHHQ XWLOL]HG LQ WKH LQYHVWLJDWLRQ RI WKH PRQRFRW\OHGRQRXV PDL]H ]HLQ JHQHV LQ $JUREDFWHULXP WUDQVIRUPHG GLFRWV 0DWVNH HW DO f WUDQVIRUPHG VXQIORZHU VWHPOHW K\SRFRW\O WLVVXH ZLWK WKH ]HLQ JHQH =f RI PDL]H XVLQJ DQ $ WXPHIDFLHQV EDVHG YHFWRU 7KLV KLJKO\ UHJXODWHG JHQH ZDV WUDQVFULEHG DW ORZ OHYHOV LQ VXQIORZHU WXPRU FHOOV XWLOL]LQJ WKH VDPH WZR WUDQVFULSWLRQ VWDUW VLWHV UHFRJQL]HG LQ PDL]H HQGRVSHUP EXW QR SURWHLQ SURGXFWV ZHUH GHWHFWDEOH 0DW]NH HW DO f 7ZR DGGLWLRQDO ]HLQ JHQHV ZHUH VLPLODUO\ LQFRUSRUDWHG LQWR VXQIORZHU SODQWOHWV ZKHUH DJDLQ HDFK ZDV WUDQVFULEHG DW ORZ OHYHOV XWLOL]LQJ WKH UHFRJQL]HG WUDQVFULSWLRQ VWDUW DQG WHUPLQDWLRQ VLWHV LQ FORQHG WXPRU WLVVXH *ROGEURXJK HW DO f $JDLQ QR SURWHLQ ZDV GHWHFWHG *ROGEURXJK HW DO f 5RXVHOO HW DO f DQDO\]HG WKH XSVWUHDP IODQNLQJ UHJLRQ RI D ]HLQ JHQH J=,DEOf ZLWK D QXPEHU RI f GHOHWLRQV IXVHG WR D &$7 UHSRUWHU JHQH LQ VXQIORZHU WXPRU WLVVXH 7KH\ UHSRUWHG WKDW SURPRWHU VHTXHQFHV EHWZHHQ DQG UHODWLYH WR WKH &$3 VLWH ZHUH QHFHVVDU\ IRU HIILFLHQW WUDQVFULSWLRQ ZKHUHDV GHOHWLRQV ZLWKLQ ES XSVWUHDP RI WKH &$3 VLWH JUHDWO\ UHGXFHG WUDQVFULSWLRQDO DFWLYLW\ 7KH

PAGE 22

DVVLJQPHQW RI D FVHOHPHQW WR WKLV UHJLRQ RI WKH ]HLQ SURPRWHU FRUUHODWHG ZLWK WKH LGHQWLILFDWLRQ RI D ES SURWHLQ ELQGLQJ VLWH FHQWHUHG DW 7KH ELQGLQJ VLWH KDG EHHQ LGHQWLILHG E\ LQ YLWUR '1$SURWHLQ LQWHUDFWLRQV XWLOL]LQJ PDL]H HQGRVSHUP QXFOHDU H[WUDFWV 0DLHU HW DO f $ UHJLRQ RI ES ZDV LGHQWLILHG DV EHLQJ D FRQVHUYHG SURPRWHU VHTXHQFH VLPLODUO\ ORFDWHG LQ DOO ]HLQ JHQHV %URZQ HW DO f )URP WKHVH UHVXOWV D FRUUHODWLRQ FDQ EH VHHQ EHWZHHQ SURPRWHU GHOHWLRQ H[SHULPHQWV RI D PRQRFRW JHQH LQ GLFRW WXPRU WLVVXH DQG WKH IDFWRU ELQGLQJ DVVD\V ZLWK KRPRORJRXV QXFOHDU H[WUDFWV 7KLV FRUUHODWLRQ VXJJHVWV WKDW DQDORJXHV RI QXFOHDU IDFWRUV UHVSRQVLEOH IRU HQGRVSHUPVSHFLILF H[SUHVVLRQ RI ]HLQ LQ PDL]H DUH SUHVHQW LQ GLFRWV ZKHUH WKH\ SUHVXPDEO\ UHJXODWH XQUHODWHG JHQH IDPLOLHV 7KH $QDHURELFDOO\ ,QGXFHG 0DL]H $OFRKRO 'HK\GURJHQDVH $GKOf *HQH RI 0DL]H :KHQ D PDL]H SODQW LV VXEMHFWHG WR DQDHURELF VWUHVV WKHUH LV D VZLWFK IURP R[LGDWLYH UHVSLUDWLRQ WR HWKDQROLF IHUPHQWDWLRQ IRU UHYLHZV VHH 'HQQLV HW DO .ORHFNHQHU *XLVVHQ DQG )UHHOLQJ f $FWLYLW\ RI WKH DHURELF SURWHLQV GHFOLQH LQ PDL]H URRWV DQG ZLWKLQ RQH KRXU RI K\SR[LD WKHUH LV DQ DFFXPXODWLRQ RI WUDQVLWLRQDO SURWHLQV 7KH DEXQGDQFH RI WKHVH WUDQVLWLRQDO SURWHLQV TXLFNO\ GHFOLQHV ZLWK WKH VXEVHTXHQW DFFXPXODWLRQ RI PDMRU DQG PLQRU DQDHURELF SURWHLQV $13Vf ZKLFK PDNH XS RYHU b RI WKH WRWDO SURWHLQ LQ WKH URRW 6DFKV HW DO f 7KH $13V RI WKH PDMRU FODVV WKXV IDU LGHQWLILHG DUH DVVRFLDWHG ZLWK WKH JO\FRO\WLF SDWKZD\ 7KHVH LQFOXGH VXFURVH V\QWKDVH 6SULQJHU HW DO f S\UXYDWH GHFDUER[\ODVH /DV]OR DQG 6W /DZUHQFH f JOXFRVH SKRVSKDWH LVRPHUDVH .HOOH\ DQG )UHHOLQJ Df IUXFWRVH GLSKRVSKDWH DOGRODVH .HOOH\ DQG )UHHOLQJ Ef DQG DOFRKRO GHK\GURJHQDVH )UHHOLQJ f 7KHUH DUH WZR DOFRKRO GHK\GURJHQDVH $GKf JHQHV RI PDL]H $GKO DQG $GK $GKO LV ORFDWHG LQ VLQJOH FRS\ RQ WKH ORQJ DUP RI FKURPRVRPH DQG $GKO LQ VLQJOH FRS\ RQ WKH VKRUW DUP RI FKURPRVRPH 6FKZDUW] f 7KH WUDQVFULSWLRQ SURGXFWV RI HDFK JHQH HQFRGHV IRU D SRO\SHSWLGH

PAGE 23

ZKLFK FRPELQH WR IRUP HLWKHU HQ]\PDWLFDOO\ DFWLYH KRPRGLPHUV $'+$'+ RU $'+ $'+f RU KHWHURGLPHU $'+$'+f )UHHOLQJ )HUO HW DO f 7KH H[SUHVVLRQ RI $GKO LV HVVHQWLDO IRU WKH VXUYLYDO RI D PDL]H SODQW VXEMHFWHG WR H[WHQGHG SHULRGV RI K\SR[LD 5HJXODWLRQ RI WKH $GKO JHQH LV DW WKH P51$ OHYHO )HUO HW DO 5RZODQG DQG 6WURPPHU f :LWKLQ WZR KRXUV RI DQDHURELF VWUHVV LW LV WUDQVFULSWLRQDOO\ H[SUHVVHG LQ URRWV :KHQ SODQWV DUH FRQWLQXRXVO\ VWUHVVHG WUDQVFULSW OHYHOV LQFUHDVH IROG DIWHU DERXW KRXUV DQG UHPDLQ DW VWHDG\ VWDWH OHYHOV XQWLO SODQW GHDWK *HUODFK HW DO IRU UHYLHZ VHH )UHHOLQJ DQG %HQQHWW f $'+ LV QRW VHHQ LQ OHDYHV 2NLPRWR HW DO f HYHQ DIWHU DQDHURELF VWUHVV EXW LV SUHVHQW LQ SROOHQ DQG WKH VFXWHOOXP ZLWKLQ PDL]H NHUQHOV LQ ERWK DHURELF DQG DQDHURELF HQYLURQPHQWV )UHHOLQJ DQG 6FKZDUW] f 7KH $GKO6 JHQH 6 UHIHUV WR VORZ HOHFWURSKRUHWLF PRELOLW\f HQFRGHV D NE WUDQVFULSW SRVVHVVLQJ QLQH $7 ULFK LQWURQV ZKLFK DUH VSOLFHG WR IRUP D ILQDO ES P51$ 'HQQLV HW DO f 7KLV JHQH KDV D 7$7$ ER[ DQG D SXWDWLYH &$$7 ER[ FRPPRQ WR PDQ\ HXNDU\RWLF JHQHV '\QDQ DQG 7MLDQ f 7UDQVJHQLF SODQW H[SUHVVLRQ V\VWHPV KDYH EHHQ XWLOL]HG LQ DQ DWWHPSW WR LGHQWLI\ UHJXODWRU\ HOHPHQWV UHVSRQVLEOH IRU WKH DQDHURELF LQGXFWLRQ DQG WUDQVFULSW VWDELOLW\ RI $GKO /OHZHOO\Q HW DO f XWLOL]HG $JUREDFWHULXP WXPHIDFLHQV WR WUDQVIHU PDL]H $GKO LQWR 1LFRWLDQD WREDFXP DQG 1LFRWLDQD SOXEDJLPIROLD 7KH WUDQVIHUUHG $GKO JHQH SRVVHVVHG NE RI n IODQNLQJ VHTXHQFHV LWV FRGLQJ UHJLRQ DQG DERXW NE RI n IODQNLQJ VHTXHQFHV 1HJOLJLEOH H[SUHVVLRQ RI WKLV PRQRFRW JHQH ZDV REVHUYHG LQ WXPRU WLVVXH RI WREDFFR WKDW KDG EHHQ VXEMHFWHG WR DQDHURELF VWUHVV E\ DUJRQ IRU IRXU GD\V 7KLV VDPH SURPRWHU LQFOXGLQJ LWV XQWUDQVODWHG OHDGHU VHTXHQFH ZDV IXVHG WR D &$7 UHSRQHU JHQH DQG WUDQVIRUPHG WREDFFR SODQWV 1LFRWLDQD WREDFXPf ZHUH UHJHQHUDWHG (OOLV HW DO f $JDLQ WKH $GKO SURPRWHU VKRZHG RQO\ PLQLPDO H[SUHVVLRQ LQ WREDFFR DIWHU KRXUV RI DQDHURELF VWUHVV 8SVWUHDP VHTXHQFHV SRVVHVVLQJ HQKDQFHUOLNH DFWLYLW\ IURP HLWKHU WKH RFWRSLQH V\QWKDVH RFVf JHQH RU WKH &D09 6 JHQH ZHUH WKHQ SODFHG XSVWUHDP RI WKH SRVLWLRQ RI WKH $GKO&$7 IXVLRQ FRQVWUXFW 8SRQ DQDHURELF LQGXFWLRQ &$7

PAGE 24

DFWLYLW\ FRXOG EH GHWHFWHG LQ WUDQVIRUPHG WREDFFR ZLWK WUDQVFULSWLRQ LQLWLDWLQJ DW WKH SURSHU VWDUW VLWH 7KXV WKH VHTXHQFHV EHWZHHQ DQG RI $GKO ZHUH LGHQWLILHG DV KDUERULQJ WKH UHJXODWRU\ UHJLRQ UHVSRQVLEOH IRU WKH DQDHURELF UHVSRQVH 7KLV UHVSRQVH HOHPHQW LV ZHDNO\ UHFRJQL]HG LQ WUDQVJHQLF WREDFFR SODQWV DQG RQO\ XSRQ DGGLWLRQ RI DQ XSVWUHDP HQKDQFHUOLNH HOHPHQW FRXOG WKH LQGXFHG UHVSRQVH PLPLF WKDW RI $GKO LQ PDL]H 3HDFRFN HW DO f 7KH HQWLUH PDL]H $GKO JHQH ZDV WUDQVIRUPHG LQWR PDL]H SURWRSODVWV E\ HOHFWURSRUDWLRQ ZKHUH LW ZDV HIILFLHQWO\ H[SUHVVHG DW ERWK WUDQVFULSWLRQ DQG SURWHLQ OHYHOV &DOOLV HW DO f $Q $GKO SURPRWHU&$7 FRGLQJ UHJLRQ FRQVWUXFW KDV DOVR EHHQ HOHFWURSRUDWHG LQWR PDL]H SURWRSODVWV DQG DFWLYLW\ GHWHUPLQHG +RZDUG HW DO f ZKHUHXSRQ &$7 DFWLYLW\ ZDV REVHUYHG XSRQ DQDHURELRVLV LQ WKLV KRPRORJRXV WUDQVJHQLF V\VWHP :KLOH WKHVH HDUO\ VWXGLHV PHUHO\ GHPRQVWUDWHG DFWLYLW\ RI $GKO LQ WUDQVJHQLF V\VWHPV :DONHU HW DO f HQOLVWHG WKLV KRPRORJRXV WUDQVJHQLF V\VWHP WR SHUIRUP D n GHOHWLRQ VHULHV VWXG\ RQ WKH $GKO SURPRWHU 7KH SURPRWHU GHOHWLRQ H[WHQGLQJ ES XSVWUHDP IURP WKH WUDQVFULSWLRQ LQLWLDWLRQ VLWH DV SUHYLRXVO\ REVHUYHG E\ +RZDUG HW DO f DOORZHG IRU LQFUHDVHG OHYHOV RI WUDQVFULSWLRQ XSRQ DQDHURELF LQGXFWLRQ 7KH n GHOHWLRQ WR WKH VLWH ZDV VWLOO LQGXFHG E\ DQDHURELRVLV EXW WKH TXDQWLW\ RI WKH JHQH SURGXFWV ZHUH UHGXFHG b )XUWKHU GHOHWLRQV WR DQG UHVXOWHG LQ DQDHURELF LQGXFWLRQ EXW WR D OHVVHU H[WHQW WKDQ WKH WZR SUHYLRXV GHOHWLRQV ZLWK WUDQVFULSWLRQDO H[SUHVVLRQ DW YHU\ ORZ OHYHOV $ ILQDO GHOHWLRQ WR HOLPLQDWHG ERWK DQDHURELF LQGXFWLRQ DQG FRQVWLWXWLYH H[SUHVVLRQ RI WKH JHQH /HH HW DO f SHUIRUPHG D VLPLODU VHW RI n GHOHWLRQV RI WKH $GKO SURPRWHU IXVHG WR D &$7 UHSRUWHU JHQH DQG WUDQVIRUPHG LQWR PDL]H SURWRSODVWV 7KHLU n GHOHWLRQ VHULHV LQFOXGHG FRQVWUXFWV H[WHQGLQJ ES ES DQG ES XSVWUHDP RI WKH LQLWLDWLRQ VLWH 7KH GHOHWLRQ GHFUHDVHG H[SUHVVLRQ RI WKLV FKLPHULF b ZLWK WKH IXUWKHU GHOHWLRQ WR UHVXOWLQJ LQ b DFWLYLW\ FRPSDUHG WR WKH SURPRWHU 7KLV ODVW YDOXH GLIIHUV IURP WKH b DFWLYLW\ RI WKH VDPH FRQVWUXFW REVHUYHG E\ :DONHU HW DO f /LQNHU VFDQ H[SHULPHQWV ZHUH SHUIRUPHG WKURXJK WKH

PAGE 25

$GKO SURPRWHU ZKLFK LGHQWLILHG D UHJLRQ WR f UHVSRQVLEOH IRU LQFUHDVHG WUDQVFULSWLRQ OHYHOV XSRQ DQDHURELF LQGXFWLRQ :DONHU HW DO f 7KH DQDHURELF UHVSRQVH HOHPHQW $5(f LV VXEGLYLGHG LQWR WZR IXQFWLRQDO GRPDLQV UHJLRQV WR f DQG ,, WR f 5HSUHVHQWDWLYH H[DPSOHV RI FRQVWLWXWLYH DQG LQGXFLEOH SODQW JHQH SURPRWHUV DQG WKHLU DQDO\VLV LQ GLIIHUHQW SODQW V\VWHPV KDYH EHHQ SUHVHQWHG 'DWD JDWKHUHG E\ WKHVH H[SHULPHQWV KDYH EHHQ YDOXDEOH LQ LGHQWLI\LQJ '1$ VHTXHQFHV WKDW FRPSULVH SURPRWHU HOHPHQWV WKDW PHGLDWH UHJXODWHG WUDQVFULSWLRQDO FRQWURO RI SODQW JHQHV 7KH DELOLW\ RI VRPH PRQRFRW\OHGRQRXV JHQH SURPRWHUV WR EH UHFRJQL]HG DQG SURSHUO\ H[SUHVVHG LQ GLFRW\OHGRQRXV SODQW V\VWHPV SDUWLFXODUO\ WKH DQDO\VLV RI WKH FULDFWLQJ UHJXODWLRQ RI PDL]H ]HLQ JHQHV LQ VXQIORZHU WXPRUV VXJJHVWV WKDW VLPLODU H[SHULPHQWV ZHUH IHDVLEOH ZLWK WKH PDL]H $GKO JHQH 7KH SUHVHQW VWXG\ HQWDLOV WKH WUDQVIRUPDWLRQ RI PDL]H $GKO LQWR VXQIORZHU VHHGOLQJ K\SRFRW\OV YLD DQ $JUREDFWHULXP YHFWRU DQG FKDUDFWHUL]DWLRQ RI WUDQVJHQLF H[SUHVVLRQ LQ UHVSRQVH WR DQDHURELF VWUHVV 7KH REMHFWLYH ZDV WR GHWHFW WUDQVFULSWLRQ PHGLDWHG E\ WKLV IRUHLJQ JHQH LQ GLFRW\OHGRQRXV VXQIORZHU DQG LQYHVWLJDWH DQ\ UHJXODWRU\ VLPLODULWLHV EHWZHHQ PDL]H DQG VXQIORZHU $ FRPSDULVRQ ZDV PDGH UHJDUGLQJ WKH DELOLW\ RI WKH JHQH WR EH LQGXFHG E\ DQDHURELRVLV HIILFLHQF\ RI H[SUHVVLRQ DQG WKH OHQJWK RI WLPH UHTXLUHG IRU PD[LPXP H[SUHVVLRQ 7KH VHFRQG SKDVH RI WKLV SURMHFW ORFDOL]HG LPSRUWDQW UHJXODWRU\ UHJLRQV RI WKH SURPRWHU UHFRJQL]HG LQ VXQIORZHU E\ LQ YLWUR PXWDJHQHVLV RI WKH SURPRWHU DQG DQDO\VLV RI WUDQVFULSWLRQ LQ UHVSRQVH WR DQDHURELF VWUHVV

PAGE 26

&+$37(5 75$16&5,37,21$/ (;35(66,21 2) 0$,=( $GKO ,1 681)/2:(5 780256 ,QWURGXFWLRQ $JUREDFWHULXP WXPHIDFLHQV LV D *UDP QHJDWLYH EDFWHULXP WKDW KDV WKH DELOLW\ WR LQWHJUDWH D VSHFLILF SRUWLRQ 7'1$f RI LWV WXPRU LQGXFLQJ SODVPLG S7Lf LQWR WKH JHQRPH RI D ZLGH YDULHW\ RI GLFRW\OHGRQRXV SODQWV +RR\NDDV HW DO 1HVWHU HW DO %LQQV DQG 7KRPDVKRZ IRU UHYLHZf 7KLV QDWXUDO JHQH WUDQVIHU V\VWHP EHWZHHQ $WXPHIDFLHQV DQG KLJKHU SODQWV KDV EHHQ H[SORLWHG DV D PHDQV RI LQWURGXFLQJ IRUHLJQ '1$ LQWR SODQW FHOOV 0DW]NH DQG &KLOWRQ &DSODQ HW DO f 7KH H[SHULPHQWDO VWUDWHJ\ RIWHQ LQYROYHV WKH LQVHUWLRQ RI WKH FORQHG JHQH RI LQWHUHVW LQWR DQ LQWHUPHGLDWH VKXWWOH YHFWRU ZKLFK LV XVHG WR WUDQVIHU JHQHV IURP (VFKHULFKLD FROL WR $JUREDFWHULXP E\ WULSDUHQWDO FRQMXJDWLRQ &RPDL HW DO )UDOH\ HW DL f ZKHUH LW LV LQFRUSRUDWHG LQWR WKH 7'1$ E\ FRLQWHJUDWLRQ YLD KRPRORJRXV UHFRPELQDWLRQ 7KH PRGLILHG 7'1$ LV WUDQVIHUUHG WR WKH SODQW FHOO E\ $JUREDFWHULXP DQG VXEVHTXHQWO\ LQFRUSRUDWHG LQWR WKH JHQRPH 7UDQVJHQLF H[SUHVVLRQ RI D QXPEHU RI SODQW JHQHV KDV EHHQ REWDLQHG XVLQJ 7'1$ EDVHG YHFWRU V\VWHPV ,Q PRVW FDVHV WKH IRUHLJQ JHQH LV WUDQVFULSWLRQDOO\ H[SUHVVHG LQ WKH KHWHURORJRXV SODQW V\VWHP LQ D PDQQHU WKDW FORVHO\ UHVHPEOHV LWV H[SUHVVLRQ LQ WKH RULJLQDO SODQW 7KHUH DUH QXPHURXV FDVHV LOOXVWUDWLQJ WKLV IDLWKIXOQHVV RI WUDQVFULSWLRQ RI JHQHV LQ GLIIHUHQW SODQW VSHFLHV 2QH H[DPSOH RI WKH ILGHOLW\ RI WUDQVJHQLF H[SUHVVLRQ LV VHHQ LQ WKH WLVVXH DQG GHYHORSPHQWDOO\ VSHFLILF H[SUHVVLRQ RI WKH VHHG VWRUDJH JHQH IRU SKDVHROLQ IURP WKH )UHQFK %URDG %HDQ 3KDVHROXV YXOJDULVf LQ WUDQVIRUPHG WREDFFR VHHGOLQJV

PAGE 27

6HQJXSWD*RSDODQ HW DO f ,Q WKLV FDVH WUDQVFULSW OHYHOV IRU SKDVHROLQ ZHUH IROG ORZHU LQ WKH OHDYHV DQG VWHP EXW TXLWH DEXQGDQW LQ VHHGV ZKHUH LW LV QDWXUDOO\ H[SUHVVHG LQ 3KDVHROXV 7'1$ EDVHG YHFWRU V\VWHPV KDYH EHHQ XVHG WR WUDQVIHU JHQHV IURP PRQRFRW\OHGRQRXV SODQWV LQWR WKH JHQRPHV RI GLFRW\OHGRQRXV KRVWV $OWKRXJK $JUREDFWHULXP SUHGRPLQDQWO\ LQIHFWV GLFRW\OHGRQRXV SODQWV WKHUH LV QR D SULRUL UHDVRQ WR H[SHFW WKDW LQGLYLGXDO JHQHV IURP WKHVH WZR SODQW JURXSV ZLOO H[KLELW IXQGDPHQWDOO\ GLIIHUHQW PHFKDQLVPV IRU WKH UHJXODWLRQ RI JHQH H[SUHVVLRQ DW WKH PROHFXODU OHYHO 7KH EHVW H[DPSOH RI D PRQRFRW JHQH IXQFWLRQLQJ LQ D GLFRW LV VHHQ ZLWK WKH ZKHDW JHQH ZK$%O /DPSSD HW DO f ZKLFK HQFRGHV WKH FKORURSK\OO DE ELQGLQJ SURWHLQ ([SUHVVLRQ RI WKLV JHQH SURYHG WR EH ERWK OLJKW UHJXODWHG DQG RUJDQVSHFLILF LQ UHJHQHUDWHG SODQWV RI ERWK WREDFFR DQG SHWXQLD $QRWKHU H[DPSOH RI D PRQRFRW JHQH WUDQVIHUUHG LQWR D GLFRW KRVW LV D ]HLQ JHQH RI PDL]H LQ VXQIORZHU WXPRUV 0DW]NH HW DO f /RZ OHYHO WUDQVFULSWLRQDO H[SUHVVLRQ RI WKLV KLJKO\ UHJXODWHG JHQH ZDV VHHQ WR RFFXU LQ WXPRU WLVVXH FORQHG IURP D VLQJOH WUDQVIRUPHG FHOO 7KH XVH RI WXPRU WLVVXH RU WXPRUGHULYHG FDOOXV FXOWXUHVf WR VWXG\ KHWHURORJRXV H[SUHVVLRQ RI SODQW JHQHV LV HVSHFLDOO\ ZHOO VXLWHG IRU JHQHV VKRZLQJ OLWWOH LI DQ\ WLVVXH RU GHYHORSPHQWDO VSHFLILFLW\ LQ WKHLU UHJXODWLRQ 7XPRUV PD\ DOVR VHUYH DV DQ H[SHULPHQWDO V\VWHP WR FKDUDFWHUL]H WKH LQGXFLEOH DVSHFWV RI KHWHURORJRXV JHQH H[SUHVVLRQ VHSDUDWHO\ IURP WLVVXH DQG GHYHORSPHQWDO VSHFLILFLW\ $Q H[DPSOH RI D JHQH WKDW PD\ SRVVHVV ERWK WLVVXH VSHFLILF DQG JHQHUDO LQGXFLELOLW\ LV PDL]H $GKO ,Q PDL]H WKLV JHQH LV WUDQVFULSWLRQDOO\ LQGXFLEOH E\ DQDHURELF VWUHVV VXFK DV IORRGLQJ )UHHOLQJ f LQ D WLVVXH VSHFLILF PDQQHU ,Q DGGLWLRQ LWV JHQH SURGXFWV DUH SUHVHQW DW FRQVWLWXWLYH OHYHOV LQ WKH VFXWHOOXP RI WKH NHUQHO )UHHOLQJ DQG 6FKZDUW] f ZKHUHDV LQ OHDYHV DFWLYLW\ LV QRW SUHVHQW LQ QRQVWUHVVHG FRQGLWLRQV QRU LV LW LQGXFLEOH E\ DQDHURELRVLV 2NLPRWR HW DO f 7KH $GKO JHQH LV DOVR LQGXFHG E\ DQDHURELRVLV LQ PDL]H URRWV )HUO HW DO f 7KH P51$ LQFUHDVHV DERXW IROG DIWHU LQGXFWLRQ 'HQQLV HW DO f UHDFKLQJ WKLV

PAGE 28

OHYHO DERXW KRXUV DIWHU LQLWLDWLRQ RI DQDHURELF VWUHVV DQG UHPDLQV DW WKLV KLJK OHYHO IRU DW OHDVW KRXUV ,Q WKH LQLWLDO VWDJHV RI WKLV VWXG\ WKH 7L SODVPLG RI $JUREDFWHULXP WXPHIDFLHQV VWUDLQ ZDV XVHG DV D YHFWRU WR LQWURGXFH WKH DOFRKRO GHK\GURJHQDVH JHQH $GKOf RI PDL]H LQWR WKH JHQRPH RI VXQIORZHU 7UDQVFULSWLRQDO H[SUHVVLRQ ZDV FKDUDFWHUL]HG LQ XQFORQHG WXPRU WLVVXH 3ULPDU\ WXPRUV IURP LQIHFWHG VXQIORZHU K\SRFRW\OV ZHUH SODFHG XQGHU DQDHURELF VWUHVV IORRGLQJf IRU YDULRXV OHQJWKV RI WLPH DQG DQDO\]HG IRU WUDQVFULSWLRQDO H[SUHVVLRQ :H KDYH VKRZQ E\ 51$ EORW K\EULGL]DWLRQ DQG 6 QXFOHDVH K\EULG SURWHFWLRQ PDSSLQJ WKDW WKH PDL]H $GKO JHQH ZDV LQFRUSRUDWHG LQWR WUDQVIRUPHG VXQIORZHU FHOOV DQG WUDQVFULEHG VSHFLILFDOO\ LQ UHVSRQVH WR DQDHURELF VWUHVV XWLOL]LQJ LWV QDWXUDO SURPRWHU 0DWHULDOV DQG 0HWKRGV 7UDQVIHU DQG ,QFRUSRUDWLRQ RI $GKO LQWR WKH 7L 3ODVPLG 7KH UHFRPELQDQW SODVPLG S%: FRQWDLQLQJ WKH PDL]H $GKO JHQH ZDV WUDQVIHUUHG LQWR $WXPHIDFLHQV E\ WULSDUWLWH FRQMXJDWLRQ &RPDL HW DL )UDOH\ HW DL f 7KUHH *UDP QHJDWLYH EDFWHULD ZHUH PDWHG ( FROL VWUDLQ 6. .XVKQHU f FRQWDLQLQJ WKH FKORUDPSKHQLFRO UHVLVWDQW LQWHUPHGLDWH YHFWRU S%: ( FROL /( 0XUUD\ HW DL f FRQWDLQLQJ WKH NDQDP\FLQ UHVLVWDQW KHOSHU SODVPLG S5. 'LWWD HW DO f DQG WKH VWUHSWRP\FLQ UHVLVWDQW $WXPHIDFLHQV VWUDLQ SRVVHVVLQJ LWV ZLOGW\SH S7L &XOWXUHV RI HDFK ZHUH JURZQ LQ PO RI /XULD EURWK /%f FRQWDLQLQJ DSSURSULDWH DQWLELRWLFV RYHUQLJKW FXOWXUHV RI ( FROL 6., KDUERULQJ S%: FKORUDPSKHQLFRO SJPOf DQG ( FROL /( FRQWDLQLQJ S5. NDQDP\FLQ _LJPOf DQG D WZR GD\ ROG FXOWXUH RI $ WXPHIDFLHQV VWUDLQ VWUHSWRP\FLQ _OJPOf &HOOV IURP PO RI HDFK FXOWXUH ZHUH SHOOHWHG E\ FHQWULIXJDWLRQ DW [J IRU PLQ ZDVKHG LQ PO RI VWHULOH P0 0J6 DQG UHVXVSHQGHG LQ PO RI /% FRQWDLQLQJ QR DQWLELRWLFV 7KH

PAGE 29

FXOWXUHV ZHUH WKHQ PL[HG LQ HTXDO SURSRUWLRQV DQG _LO WR LO RI WKH PL[WXUH WUDQVIHUUHG WR DQ /% DJDU SODWH IRU PDWLQJ KU r&f 7KH EDFWHULDO FHOOV IURP WKH WULSDUWLWH PDWLQJ ZHUH VXVSHQGHG LQ WR PO RI P0 0J6 DQG WR ZDV VSUHDG RQWR SODWHV RI /% FRQWDLQLQJ VWUHSWRP\FLQ _OJPOf DQG FKORUDPSKHQLFRO SJPOf 7KH VHOHFWLRQ SODWHV ZHUH LQFXEDWHG DW r& IRU GD\V WR DOORZ LQWHJUDWLRQ RI WKH VKXWWOH SODVPLG ZLWK WKH S7L DQG FRORQ\ JURZWK WR RFFXU &RQILUPDWLRQ WKDW FRORQLHV ZHUH $ WXPHIDFLHQV ZDV REWDLQHG E\ D SRVLWLYH NHWRODFWRVH WHVW %HPDHUWV DQG 'H/D\ f ,QFRUSRUDWLRQ RI WKH $GKO JHQH LQWR WKH S7L ZDV GHPRQVWUDWHG E\ 6RXWKHUQ K\EULGL]DWLRQ 6RXWKHUQ f RI LPPRELOL]HG S7L XVLQJ D UDGLRDFWLYHO\ODEHOHG UHVWULFWLRQ IUDJPHQW ;EDO WR .SQO RI S% 'HQQLV HW DO f FRUUHVSRQGLQJ WR WKH FRGLQJ UHJLRQ RI $GKO DV WKH SUREH 7XPRU *URZWK 6XQIORZHU +HOLDQWKXV DQQXV FY /DUJH *UH\f VHHGOLQJV ZHUH LQRFXODWHG ZLWK $ WXPHIDFLHQV FRQWDLQLQJ WKH HQJLQHHUHG S7L S7LOS%:f SODVPLG $ WXPHIDFLHQV ZDV JURZQ LQ PO RI /% FRQWDLQLQJ DQWLELRWLFV IRU GD\V DW r& DQG XVHG WR LQRFXODWH V\ULQJH ZRXQGLQJf WKH K\SRFRW\OV RI WR GD\ ROG VHHGOLQJV 3ODQWV ZHUH JURZQ LQGRRUV XQGHU IOXRUHVFHQW OLJKWV ZLWK D KU OLJKW KU GDUN F\FOH 7XPRUV ZHUH KDUYHVWHG IURP WR GD\V DIWHU LQRFXODWLRQ ,QGXFWLRQ RI $GKO E\ $QDHURELF 6WUHVV 6XQIORZHU WXPRUV DQG PDL]H URRWV ZHUH SODFHG XQGHU ORZ R[\JHQ FRQGLWLRQV LQ DQ DWWHPSW WR LQGXFH DFWLYLW\ RI $GKO ,PPHGLDWHO\ XSRQ KDUYHVWLQJ WKH WXPRUV ZHUH SODFHG LQWR LQFXEDWLRQ PHGLD FRQVLVWLQJ RI b VXFURVH P0 .32 EXIIHU S+ f DQG LJPO RI ULIDP\FLQ PRGLILFDWLRQ RI *XUOH\ HW DO f $UJRQ JDV ZDV EXEEOHG WKURXJK WKH PHGLD IRU DERXW PLQ WR UHGXFH WKH OHYHO RI 2 EHIRUH WKH FRQWDLQHUV ZHUH VHDOHG $IWHU WR KU RI DQDHURELF VWUHVV WKH WXPRUV ZHUH IUR]HQ LQ OLTXLG QLWURJHQ DQG VWRUHG DW

PAGE 30

r& 0DL]H 'HNDOE ;/f URRWV IURP WR GD\ ROG VHHGOLQJ ZHUH XVHG DV D FRQWURO IRU LQGXFWLRQ 7KH PDL]H VHHGOLQJV ZHUH IXOO\ VXEPHUJHG LQ ZDWHU LQ WKH GDUN IRU KU 7KH URRW WLSV ZHUH WKHQ KDUYHVWHG DQG LPPHGLDWHO\ IUR]HQ $QDO\VLV RI ,QGXFLEOH 7UDQVJHQLF ([SUHVVLRQ ,QGXFLEOH H[SUHVVLRQ RI PDL]H $GKO LQ VWUHVVHG DQG XQVWUHVVHG WXPRUV ZDV H[DPLQHG E\ 51$ EORW K\EULGL]DWLRQ DQG 6, QXFOHDVH K\EULG SURWHFWLRQ PDSSLQJ RI SRO\DGHQ\ODWHG 51$ 7RWDO 51$ ZDV H[WUDFWHG E\ WKH WULLVRSURS\OQDSKWKDOHQHVXOIRQDWHSDUDDPLQRVDOLF\ODWH 71$3$6f PHWKRG -DFNVRQ DQG ,QJOH f DV PRGLILHG E\ &]DPHFND HW DO f 3RO\$f51$ ZDV IUDFWLRQDWHG E\ ROLJRG7fFHOOXORVH FKURPDWRJUDSK\ 6LOIORZ HW DO f 1RUWKHUQ EORW K\EULGL]DWLRQ RI SRO\$f51$ ZDV XVHG WR HYDOXDWH WKH OHQJWK RI WKH $GKO PHVVDJH DQG WR DVVHVV LQGXFLELOLW\ RI WKH JHQH DIWHU H[SRVXUH WR VWUHVV IRU YDULRXV OHQJWKV RI WLPH 7KH SRO\$f51$ _LJ WR SJf ZDV IUDFWLRQDWHG E\ HOHFWURSKRUHVLV RQ D b ZYf DJDURVH b YYf IRUPDOGHK\GH JHO 5DYH HW DO f DQG GLUHFWO\ WUDQVIHUUHG WR QLWURFHOOXORVH ILOWHU SDSHU 7KRPDV f 7KH WUDQVIHUUHG SRO\$f51$ ZDV K\EULGL]HG ZLWK HLWKHU QLFN WUDQVODWHG PDL]H $GKO F'1$ IURP S=0/ 'HQQLV HW DO f RU DQ LQWHUQDOO\ ODEHOHG VLQJOH VWUDQGHG EDFWHULRSKDJH 0 PSf SUREH &KXUFK DQG *LOEHUW f VSHFLILF WR WKH n SRUWLRQ +DHOOO7DTO IUDJPHQW WR f RI WKH JHQH 6, QXFOHDVH K\EULG SURWHFWLRQ PDSSLQJ )DYDORUR HW DO f ZDV XVHG WR DQDO\]H WKH WUDQVFULSWLRQ VWDUW VLWH RI PDL]H $GKO LQ ERWK WXPRU FHOOV DQG PDL]H URRWV $ +LQ IUDJPHQW IURP WKH f UHJLRQ RI WKH JHQH ZDV n HQG ODEHOHG 0D[DP DQG *LOEHUW f DQG WKHQ GLJHVWHG ZLWK 3VWO OHDYLQJ D ES IUDJPHQW 3VWO WR +LQ WR f ODEHOHG DW WKH +LQ VLWH 7KLV SUREH ZDV PL[HG ZLWK WR _LJ RI SRO\$f51$ IURP VXQIORZHU WXPRUV LQ D WRWDO YROXPH RI LO RI K\EULGL]DWLRQ VROXWLRQ P0 SLSHUD]LQH 11nELV>HWKDQHVXOIRQLF DFLG@ EXIIHU S+ P0 1D&O P0 ('7$ DQG b

PAGE 31

IRUPDOGHK\GHf RYHUOD\HG ZLWK _LO RI PLQHUDO RLO DQG KHDW GHQDWXUHG DW r& IRU PLQ +\EULGL]DWLRQ ZDV DW r& IRU WR KU ZKLFK ZDV IROORZHG E\ GLJHVWLRQ ZLWK 6, QXFOHDVH XQLWVPOf DW r& IRU PLQ &]DPHFND HW DO f 7KH UHVXOWLQJ 51$'1$ K\EULGV ZHUH WKHQ IUDFWLRQDWHG E\ HOHFWURSKRUHVLV RQ DQ b XUHD '1$ VHTXHQFLQJ JHO DQG DXWRUDGLRJUDSKHG ZLWK ;UD\ ILOP .RGDN 6%f ZLWK LQWHQVLILHU VFUHHQV DW r& IRU WR KRXUV $QDO\VLV RI $GKO SURPRWHU n GHOHWLRQV E\ 6, K\EULGL]DWLRQ ZDV GRQH E\ WKH H[FLVLRQ RI UDGLRDFWLYH EDQGV IURP WKH JHO DQG TXDQWLILFDWLRQ E\ &HUHNRY FRXQWLQJ 5HVXOWV &RQVWUXFWLRQ RI WKH ,QWHUPHGLDWH 9HFWRU 3ODVPLG 7KH $GKO JHQH KDV EHHQ LVRODWHG DQG FKDUDFWHUL]HG E\ 'HQQLV HW DO f DQG KDV EHHQ VKRZQ E\ JHQHWLF VWXGLHV 6FKZDUW] f DQG 6RXWKHUQ EORW K\EULGL]DWLRQ DQDO\VLV 'HQQLV HW DO f WR H[LVW LQ VLQJOH FRS\ LQ PDL]H 7KH FRPSOHWH JHQH LV FRQWDLQHG LQ SODVPLG S% 'HQQLV HW DO f ZKLFK FRQVLVWV RI DQ NE IUDJPHQW LQVHUWHG LQWR WKH %DP+? VLWH RI S%5 %ROLYDU HW DO f 7KLV UHVWULFWLRQ IUDJPHQW LQFOXGHV NE RI '1$ n WR WKH WUDQVFULSWLRQ VWDUW VLWH WKH FRGLQJ UHJLRQ ZLWK LQWURQVf DQG DERXW NE RI GRZQVWUHDP VHTXHQFHV )LJ f ([FHVV VHTXHQFHV n WR WKH JHQH ZHUH UHPRYHG E\ VXEFORQLQJ DQ NE %DP??? WR .SQO IUDJPHQW FRQWDLQLQJ $GKO LQWR DQ LQWHUPHGLDWH YHFWRU VKXWWOH YHFWRUf 7KH LQWHUPHGLDWH YHFWRU XVHG WR WUDQVIHU WKH $GKO JHQH WR $ WXPHIDFLHQV ZDV GHVLJQDWHG S: %UXFH DQG *XUOH\ f DQG FRQVLVWHG RI D ES IUDJPHQW RI S7 7OHIW '1$ VLWHV WR ES %DUNHU HW DO f OLJDWHG LQWR WKH %DP+O DQG 6SK? UHVWULFWLRQ VLWHV RI WKH FKORUDPSKHQLFRO UHVLVWDQW EURDG KRVW UDQJH SODVPLG S$&<& &KDQJ DQG &RKHQ f 7KH 7'1$ IUDJPHQW ZDV GHULYHG IURP WKH S%5EDVHG SODVPLG S* SURYLGHG E\ 'HQQLV 6XWWRQ $JULJHQHWLFV $GYDQFHG

PAGE 32

)LJ 6FKHPDWLF UHSUHVHQWDWLRQ RI S% 'HQQLV HW DO f 7KLV SODVPLG FRQWDLQV DQ NE %DP:O IUDJPHQW KDUERULQJ WKH PDL]H $GKO JHQH LQ WKH XQLTXH %DP+O VLWH RI S%5 %ROLYDU HW DO f ([RQV DUH UHSUHVHQWHG E\ EODFN ER[HV ZLWK FRUUHVSRQGLQJ QXPEHU GHVLJQDWLRQ OLVWHG DERYH HDFK ,QWURQV DUH GHSLFWHG E\ ZKLWH ER[HV EHWZHHQ WKH H[RQV ,PSRUWDQW UHVWULFWLRQ VLWHV DQG WKHLU SRVLWLRQ ZLWK UHVSHFW WR WKH VWDUW RI WUDQVFULSWLRQ DUH SUHVHQWHG

PAGE 33

5HVHDUFK 'LYLVLRQ 0DGLVRQ :,f LQ ZKLFK WKH 6PDO VLWH LQ WKH JHQH FRUUHVSRQGLQJ WR WUDQVFULSW E ZDV FKDQJHG WR %JO,, E\ OLQNHU DGGLWLRQ $IWHU UHPRYDO RI D ES %DP+O WR .SQO IUDJPHQW IURP S: WKH $GKO %DP+O WR .SQO IUDJPHQW ZDV LQVHUWHG E\ OLJDWLRQ 7KH UHVXOWLQJ NE LQWHUPHGLDWH YHFWRU FRQWDLQLQJ WKH $GKO JHQH ZDV GHVLJQDWHG S%: DQG LV VKRZQ LQ )LJXUH 7UDQVIHU DQG ,QFRUSRUDWLRQ RI $GKO LQWR WKH 7L 3ODVPLG 7ULSDUWLWH FRQMXJDWLRQ &RPDL HW DO )UDOH\ HW DO f UHVXOWV LQ WKH HYHQWXDO WUDQVIHU RI WKH UHFRPELQDQW SODVPLG IURP ( FROL LQWR WKH UHFLSLHQW $ WXPHIDFLHQV 6LQFH WKH LQWHUPHGLDWH YHFWRU SODVPLG ZDV D GHULYDWLYH RI S$&<& LW FRXOG QRW WUDQVIHU XQDVVLVWHG LQWR $ WXPHIDFLHQV 7KH SODVPLG S5. FRQWDLQLQJ WKH WUDQVIHU JHQHV IURP S5. )LJXUVNL DQG +HOLQVNL f ZDV XWLOL]HG WR DFKLHYH FRQMXJDO WUDQVIHU RI S%: LQWR $JUREDFWHULXP 7ULSDUWLWH PDWLQJV UHVXOWHG LQ FRORQLHV RI WUDQVFRQMXJDQW $ WXPHIDFLHQV ZKLFK SRVVHVVHG WKH DELOLW\ WR JURZ LQ WKH SUHVHQFH RI FKORUDPSKHQLFRO 6LQFH WKH VKXWWOH SODVPLG KDV DQ ( FROL UHSOLFQ ZLWK D OLPLWHG KRVW UDQJH LW FDQQRW UHSOLFDWH DXWRQRPRXVO\ LQ $ WXPHIDFLHQV 7KH VLPSOHVW H[SODQDWLRQ IRU WKH DFTXLVLWLRQ RI FKORUDPSKHQLFRO UHVLVWDQFH E\ $ WXPHIDFLHQV ZDV E\ FRLQWHJUDWLRQ RI WKH VKXWWOH SODVPLG LQWR WKH 7'1$ RI WKH S7L )LJ f &RQILUPDWLRQ RI VKXWWOH SODVPLG7L SODVPLG FRLQWHJUDWLRQ ZDV REWDLQHG E\ 6RXWKHUQ K\EULGL]DWLRQ DQDO\VLV RI WKH 7L SODVPLG ZLWK DQ $GKO SUREH )LJ f 6LQJOH KRPRORJRXV UHFRPELQDWLRQ RI S%: ZLWK S7L UHVXOWHG LQ LQFRUSRUDWLRQ RI WKH VKXWWOH SODVPLG LQ WKH 7OHIW UHJLRQ RI WKH 7'1$ )LJ f 7KLV LQFRUSRUDWLRQ JHQHUDWHG D GXSOLFDWLRQ RI WKH 7'1$ JHQHV D DQG E DQG D SDUWLDO GXSOLFDWLRQ RI WKH RFWRSLQH V\QWKDVH JHQH ODFNLQJ SURPRWHU VHTXHQFHVf 7KH H[WUD FRS\ RI WKH JHQH FRUUHVSRQGLQJ WR WUDQVFULSW E ZDV SUREDEO\ QRW IXQFWLRQDO LQ WKH SODQW VLQFH WKH UHDGLQJ IUDPH ZDV GLVUXSWHG E\ WKH %JOOO OLQNHU DW WKH IRUPHU 6PDO VLWH

PAGE 34

)LJ &ORQLQJ VFKHPH IRU VKXWWOH YHFWRU S%: /RFDWLRQ DQG WUDQVFULSWLRQDO RULHQWDWLRQ RI UHSUHVHQWHG JHQHV DUH GHVLJQDWHG E\ DUURZV ZLWKLQ SODVPLGV 2ULJLQ RI SODVPLG '1$ DQG LPSRUWDQW UHVWULFWLRQ VLWHV DUH DV ODEHOHG 1XPEHUV ZLWKLQ SDUHQWKHVLV GHVLJQDWH SRVLWLRQ RI UHVWULFWLRQ VLWHV ZLWKLQ RFWRSLQHW\SH $JUREDFWHULXP 7'1$ %DUNHU HW DO f /HJHQG $SU DPSHFLOOLQ UHVLVWDQFH &SU FKORUDPSKHQLFRO UHVLVWDQFH RFV RFWRSLQH V\QWKDVHf D DQG E UHSUHVHQW 7'1$ JHQHV RI $JUREDFWHULXP :LOOPLW]HU HW DO f 'RWWHG OLQHV JHQH DQG RFVf SRUWUD\ ODFN RI SURPRWHU VHTXHQFHV

PAGE 35

)LH ,QFRUSRUDWLRQ RI VKXWWOH YHFWRU KDUERULQJ $GKO LQWR 7OHIW RI 7'1$ $SSUR[LPDWH ORFDWLRQ RI VKXWWOH YHFWRU DVVLPLODWLRQ LV GHSLFWHG E\ EDU DERYH 7'1$ 7KH EODFN UHJLRQ UHSUHVHQWV LQFRUSRUDWHG VHTXHQFHV RI GXSOLFDWHG 7'1$ 7KH VKDGHG UHJLRQ LV WKH '1$ IUDJPHQW WKDW RULJLQDWHG IURP S% KDUERULQJ WKH JHQRPLF $GKO JHQH DQG WKH ZKLWH SRUWLRQ LV WKH EDFWHULDO S$&<& VHTXHQFHV +RUL]RQWDO DUURZV LQGLFDWH ORFDWLRQ DQG GLUHFWLRQ RI WUDQVFULSWLRQ RI LQFRUSRUDWHG JHQHV DQG HQGRJHQRXV 7'1$ JHQHV 6PDOO YHUWLFDO OLQHV DWWDFKHG WR HQG RI DUURZV LQGLFDWH SUHVHQFH RI QDWXUDOO\ RFFXUULQJ n IODQNLQJ VHTXHQFHV 7UDQVFULSW XQLWV DQG HQFRGH HQ]\PHV LQYROYHG LQ SURGXFWLRQ RI WKH DX[LQ LQGROHDFHWLF DFLG 7KRPDVKRZ HW DO f HQFRGHV LVRSHQWHQ\O WUDQVIHUDVH WKH HQ]\PH UHVSRQVLEOH IRU SURGXFWLRQ RI D F\WRNLQLQ %XFKPDQQ HW DO f D GXSOLFDWHGf HQFRGHV D SHUPHDVH UHVSRQVLEOH IRU VHFUHWLRQ RI RSLQHV IURP SODQW FHOOV 0HVVHQV HW DO f E GXSOLFDWHG WUDQVFULSWLRQ XQLW IURP VKXWWOH YHFWRU LV QRQIXQFWLRQDO VHH WH[Wf SUREDEOH LQYROYHPHQW LQ WXPRU IRUPDWLRQ LQ QDUURZ KRVW UDQJH +RR\NDDV HW DO f RFV SURGXFW FDWDO\VHV V\QWKHVLV RI RFWRSLQH RFV LQ IURP VKXWWOH YHFWRU ODFNV n IODQNLQJ VHTXHQFHVf DQG WUDQVFULSW XQLWV DQG KDYH XQNQRZQ IXQFWLRQV %LQQV DQG 7KRPDVKRZ IRU UHYLHZf 9HUWLFDO OLQHV ZLWKLQ UHSUHVHQWHG '1$ LQGLFDWH ORFDWLRQ RI %DP+O DQG PGLQ UHVWULFWLRQ VLWHV

PAGE 36

RHV M %DP +, +LQ GOOO } D E !+ RHV &SU $GK D E RHV 1, 92

PAGE 37

$O )LJ &RQILUPDWLRQ RI $GKO LQFRUSRUDWLRQ LQWR 7LSODVPLG $f (WKLGLXP EURPLGH VWDLQHG '1$ IURP QLQH GLIIHUHQW FRORQLHV ODQHV f RI $JUREDFWHULXP WKDW JUHZ RQ VHOHFWLRQ SODWHV DIWHU WULSDUWLWH PDWLQJV VHH 0DWHULDOV DQG 0HWKRGVf 1RQWUDQVIRUPHG $JUREDFWHULXP FRQWURO ODQH f %f 6RXWKHUQ EORW DQDO\VLV RI VDPSOHV GHVFULEHG LQ $ +\EULGL]DWLRQ ZDV WR D QLFNWUDQVODWHG 5LJE\ HW DO f '1$ SUREH KDUERULQJ WKH $GKO JHQRPLF FORQH VHH 0DWHULDOV DQG 0HWKRGVf ,QWDFW 7LSODVPLGV DQG EDFWHULDO FKURPRVRPDO '1$ DUH GHVLJPDWHG

PAGE 38

$QDO\VLV RI 7UDQVFULSWLRQDO ([SUHVVLRQ RI 0DL]H $GKO LQ 3ULPDU\ 7XPRUV +\SRFRW\OV RI VXQIORZHU VHHGOLQJV ZHUH LQIHFWHG ZLWK $ WXPHIDFLHQV KDUERULQJ S7LOS%: 7XPRU WLVVXH GHYHORSHG DW WKH ZRXQG VLWHV LQGLFDWLQJ WKDW WKH 7 '1$ DQG WKXV WKH PDL]H $GKO JHQH KDG WUDQVIHUUHG LQWR WKH JHQRPHV RI VXQIORZHU FHOOV 7KHVH WXPRUV ZKLFK ZHUH WR b WKH VL]H RI WXPRUV WKDW IRUPHG RQ VHHGOLQJV LQIHFWHG ZLWK ZLOGW\SH $ WXPHIDFLHQV VWUDLQ ZHUH KDUYHVWHG DQG DQDHURELFDOO\ VWUHVVHG 3RO\$f51$ ZDV LVRODWHG IURP WKH WXPRU WLVVXH DQG DVVHVVHG IRU OHYHOV RI PDL]H $GKO 51$ 6XQIORZHU WXPRUV V\QWKHVL]HG HQGRJHQRXV $GK P51$ LQ UHVSRQVH WR DQDHURELF VWUHVV 7KLV FRQFOXVLRQ ZDV EDVHG RQ WKH K\EULGL]DWLRQ )LJ f RI LPPRELOL]HG SRO\$f51$ IURP WXPRUV LQRFXODWHG ZLWK $ WXPHIDFLHQV KDUERULQJ HLWKHU WKH QDWXUDOO\ RFFXUULQJ S7L RU WKH HQJLQHHUHG S7LOS%: ZLWK QLFN WUDQVODWHG PDL]H $GKO F'1$ IURP S=0/ 'HQQLV HW DO f 7KH VXQIORZHU WUDQVFULSWV ZHUH VOLJKWO\ VPDOOHU WKDQ WKH ES PDL]H $GKO P51$ *HUODFK HW DO f )LJ ODQHV ODEHOHG 0f 7KH FURVVK\EULGL]DWLRQ RI WKH PDL]H F'1$ ZLWK WKH P51$ RI WKH HQGRJHQRXV VXQIORZHU $GK JHQH JDYH DQ LQGLFDWLRQ RI WKH OHYHO RI VHTXHQFH FRQVHUYDWLRQ EHWZHHQ WKHVH WZR VSHFLHV RI SODQWV DQG DOVR LQGLFDWHG WKH OHYHO RI WUDQVFULSWLRQDO LQGXFWLRQ RI $GKO LQ WXPRUV 7KHUH ZDV ORZ OHYHO RI K\EULGL]DWLRQ WR SRO\$f51$ IURP XQLQGXFHG WXPRUV )LJ ODQHV $ DQG % KRXUVf LQFLWHG E\ ZLOGW\SH S7L DQG E\ S7LOS%: $IWHU KU RI DQDHRELF VWUHVV RQO\ WXPRUV LQFLWHG E\ S7LOS%: VKRZHG DQ LQFUHDVH RI $GKO P51$ OHYHOV $ GUDPDWLF LQFUHDVH LQ $GKO 51$ OHYHOV ZDV VHHQ LQ ERWK W\SHV RI WXPRUV DIWHU IORRGLQJ IRU DQG KU $OWKRXJK WKH HDUOLHU LQGXFWLRQ RI $GKO LQ WXPRUV LQFLWHG E\ S7LOS%: FRPSDUHG WR WXPRUV FRQWDLQLQJ S7L ZDV QRW H[SHFWHG WKH RYHUDOO UHVXOWV LQGLFDWH WKDW VXQIORZHU WXPRUV SURYLGH D VXLWDEOH H[SHULPHQWDO V\VWHP WR VWXG\ WKH DQDHURELF UHVSRQVH

PAGE 39

)LJ 1RUWKHUQ EORW DQG WLPH FRXUVH DQDO\VLV RI SRO\$f51$ 0HVVHQJHU 51$ LJf IURP FRQWURO WXPRUV IRUPHG DIWHU LQRFXODWLRQ ZLWK ZLOG W\SH $JUREDFWHULXP ODQHV $f DQG WXPRUV LQIHFWHG ZLWK $JUREDFWHULXP SRVVHVVLQJ WKH $GKO JHQH LQ 7 '1$ S7LO%:f ODQHV %f /DQHV 0 FRQWDLQ SRO\$f51$ MLJf IURP URRWV RI DQDHURELFDOO\ VWUHVVHG PDL]H VHHGOLQJV 7LPH KRXUVf WKDW WXPRUV DQG URRWV ZHUH VXEMHFWHG WR DQDHURELF VWUHVV VHH 0DWHULDOV DQG 0HWKRGVf DUH LQGLFDWHG %ORWV ZHUH SUREHG ZLWK QLFNWUDQVODWHG PDL]H $GKO F'1$ IURP S=P 'HQQLV HW DO f 6ROLG DUURZ LQGLFDWHV ORFDWLRQ RI SURFHVVHG P51$ 2SHQ DUURZV LQGLFDWH ORFDWLRQ RI ODUJHU WUDQVFULSWV VHH WH[Wf

PAGE 40

7KH F'1$ SUREH DOVR K\EULGL]HG WR WZR ODUJH WUDQVFULSWV WR NE DQG WR NEf SUHVHQW LQ WKH SRO\$f51$ LVRODWHG IURP DQDHURELFDOO\ VWUHVVHG WXPRUV FRQWDLQLQJ WKH PDL]H JHQH )LJ ODQHV ODEHOHG % KUV DQG f 7KHVH ODUJHU WUDQVFULSWV ZHUH QRW VHHQ LQ ODQHV FRQWDLQLQJ SRO\$f51$ IURP FRQWURO WXPRUV RU PDL]H URRWV )URP WKLV W\SH RI DQDO\VLV XVLQJ WKH FURVVK\EULGL]LQJ F'1$ SUREH LW ZDV XQFOHDU ZKHWKHU WKH LQWURGXFHG PDL]H $GKO JHQH ZDV WUDQVFULSWLRQDOO\ H[SUHVVHG LQ WKH KHWHURORJRXV V\VWHP ,Q RUGHU WR VSHFLILFDOO\ GHWHFW WKH WUDQVFULSWV GHULYHG IURP WKH PDL]H JHQH LQ WKH SUHVHQFH RI HQGRJHQRXV $GK 51$ D VHFRQG 51$ EORW DQDO\VLV XVLQJ DQ 0GHULYHG &KXUFK DQG *LOEHUW f VWUDQG VSHFLILF SUREH ZDV XWLOL]HG 7KH LQWHUQDOO\ ODEHOHG SUREH FRQVLVWHG RI D +DH,,, f WR 7DTO f IUDJPHQW RI WKH PDL]H $GKO JHQH FORQHG LQWR 0O EDFWHULRSKDJH PS )LJ f 7KLV SUREH ZDV FRPSOHPHQWDU\ WR EDVHV RI XQWUDQVODWHG n OHDGHU VHTXHQFH RI PDL]H $GKO 51$ 7KH DELOLW\ RI WKLV SUREH WR K\EULGL]H VSHFLILFDOO\ WR PDL]H $GKO WUDQVFULSWV ZDV VXEVWDQWLDWHG E\ 51$ EORW DQDO\VLV +\EULGL]DWLRQ ZDV VHHQ EHWZHHQ WKH OHDGHU VSHFLILF SUREH DQG SRO\$f51$ RI DQDHURELFDOO\ VWUHVVHG WXPRUV KDUERULQJ WKH IRUHLJQ $GKO JHQH WKHUH DSSHDUHG WR EH RQO\ VOLJKW K\EULGL]DWLRQ ZLWK WUDQVFULSWV WKDW ZHUH WKH VDPH VL]H DV SURFHVVHG PDL]H $GKO P51$ EDVHVf )LJ f ,Q FRQWUDVW SURPLQHQW K\EULGL]DWLRQ RFFXUUHG ZKLFK FRUUHVSRQGHG WR WKH WZR ODUJHU WUDQVFULSWV SUHYLRXVO\ REVHUYHG )LJ f ZLWK WKH QRQVSHFLILF F'1$ SUREH )LJ ODQHV ODEHOHG % KUV DQG f 7KH VSHFLILFLW\ RI WKH OHDGHU SUREH ZDV FRQILUPHG VLQFH SRO\$f51$ IURP VXQIORZHU WXPRU WLVVXH LQFLWHG E\ FRQWURO $ WXPHIDFLHQV GLG QRW K\EULGL]H ZLWK WKH SUREH )LJ $ ODQHVf ZKHUHDV D EDVH PHVVDJH IURP PDL]H URRWV K\EULGL]HG TXLWH UHDGLO\ )LJ ODQH 0f 7KH 51$ EORW K\EULGL]DWLRQV LQGLFDWH WKDW WKH WUDQVJHQLF PDL]H $GKO JHQH LQ SULPDU\ VXQIORZHU WXPRU WLVVXH ZDV WUDQVFULSWLRQDOO\ H[SUHVVHG LQ DQ DQDHURELFDOO\ LQGXFLEOH PDQQHU 3URFHVVLQJ RI WKH 51$ LQWURQ UHPRYDO RU SURSHU WHUPLQDWLRQf KRZHYHU DSSHDUHG WR EH DEHUUDQW )DLOXUH WR VSOLFH WKH QLQH LQWURQV RI WKLV WUDQVFULSW LV

PAGE 41

$GK +DH ,,, 51$ 7$7$ 7DT $7* LQVHUW A PS 3UREH SULPHU $$$ )LJ 1RUWKHUQ EORW SUREHG ZLWK PDL]H $GKO VSHFLILF SUREH ([SHULPHQWDO SDUDPHWHUV DUH DV LQ )LJXUH ,QWHUQDOO\ ODEHOHG &KXUFK DQG *LOEHUW f PDL]H $GKO VSHFLILF SUREH KDUERULQJ ES RI n IODQNLQJ DQG ES RI OHDGHU VHTXHQFHV LV LOOXVWUDWHG /DQH -! FRQWDLQV HQG ODEHOHG +DH ,,, JHQHUDWHG -f; PDUNHUV ZLWK VL]H GHVLJQDWLRQV

PAGE 42

SUHGLFWHG WR \LHOG D NE PHVVDJH ZKLFK URXJKO\ FRUUHVSRQGV WR WKH VL]H RI WKH VPDOOHU RI WKH WZR ODUJH WUDQVFULSWV )XUWKHU H[SHULPHQWV WKDW DGGUHVV WKH LGHQWLW\ DQG RULJLQ RI WKH ODUJHVW K\EULGL]LQJ 51$ DUH GLVFXVVHG EHORZ 6, K\EULGL]DWLRQ SURWHFWLRQ PDSSLQJ ZDV SHUIRUPHG RQ SRO\$f51$ LVRODWHG IURP SULPDU\ WXPRUV DQG PDL]H URRWV LQ RUGHU WR GHWHUPLQH LI WKH WUDQVJHQLFDOO\ H[SUHVVHG $GKO JHQH XVHG WKH VDPH WUDQVFULSWLRQDO LQLWLDWLRQ VLWH SUHIHUUHG LQ PDL]H $Q HQGODEHOHG SUREH WKDW FRQVLVWHG RI ES RI '1$ XSVWUHDP RI WKH UHSRUWHG VWDUW VLWH IRU WKH PDL]H JHQH 'HQQLV HW DL f DQG ES RI '1$ FRPSOLPHQWDU\ WR WKH P51$ OHDGHU VHTXHQFH ZDV XWLOL]HG 1R EDQGV ZHUH GHWHFWDEOH E\ 6, QXFOHDVH K\EULG SURWHFWLRQ PDSSLQJ RI 51$ IURP FRQWURO WXPRUV )LJ $ ODQHVf LQGLFDWLQJ WKH VSHFLILF QDWXUH RI WKH SUREH ,Q FRQWUDVW DQ 6, QXFOHDVH SURWHFWHG EDQG IURP 51$ LVRODWHG IURP VWUHVVHG WXPRUV FRQWDLQLQJ WKH PDL]H $GKO JHQH ZDV REWDLQHG )LJ % ODQHV DQG KUf WKDW SUHFLVHO\ FRLQFLGHG LQ OHQJWK ZLWK WKH SURWHFWHG IUDJPHQW REWDLQHG IURP PDL]H URRW 51$ )LJ ODQH 0f $GGLWLRQDO KLJKHU PROHFXODU ZHLJKW WUDQVFULSWV ZKLFK IRUPHG DQ 51$'1$ K\EULG RYHU WKH HQWLUH ES '1$ SUREH ZHUH DOVR SUHVHQW VXJJHVWLQJ WKH SUHVHQFH RI DQDHURELFDOO\ LQGXFLEOH UHDGWKURXJK WUDQVFULSWLRQ LQLWLDWLQJ XSVWUHDP RI WKH QDWXUDO VWDUW VLWH 6SOLFLQJ RI $GKO WUDQVFULSWV LQ SULPDU\ WXPRUV 6, K\EULGL]DWLRQ SURWHFWLRQ DQDO\VLV ZDV HPSOR\HG WR LQYHVWLJDWH WKH VSOLFLQJ RI $GKO WUDQVFULSWV LQ VXQIORZHU WXPRU FHOOV $ '1$ SUREH ZDV ODEHOHG DW D mGLOO VLWH ZLWKLQ WKH ILUVW LQWURQ DQG FRQVLVWHG RI ES RI XQWUDQVFULEHG n IODQNLQJ VHTXHQFHV DQG WKH ILUVW ES RI WKH WUDQVFULEHG UHJLRQ RI WKH JHQH )LJ '1$ SUREH D SDQHO &f 'HQQLV HW DO f 1R SURWHFWLRQ ZDV REVHUYHG ZKHQ K\EULGL]HG WR P51$ IURP PDL]H URRWV VXEMHFWHG WR IORRGLQJ )LJ SDQHO $ ODQH f &RQYHUVHO\ D ES IUDJPHQW ZDV SURWHFWHG IURP 6, QXFOHDVH GLJHVWLRQ E\ P51$ IURP WXPRUV ZLWK LQFRUSRUDWHG $GKO VWUHVVHG IRU VL[ KRXUV )LJ SDQHO $ ODQH f LQGLFDWLQJ WKDW DW OHDVW

PAGE 43

2 KUV ,7 W n$ ED % n$ % $ (r 0 r f§ 0 IXOO OHQJWK SUREH r B % A L ,V SURWHFWHG IUDJPHQW 3VW 7$7$ +LQI '1$ SUREH 51$ A )LJ 6, QXFOHDVH K\EULGL]DWLRQ SURWHFWLRQ DQG WLPH FRXUVH DQDO\VLV RI SRO\$f51$ 7KH ES n HQG ODEHOHG rf K\EULGL]DWLRQ SUREH LV LOOXVWUDWHG 3RO\ $f51$ ILJf IURP PDL]H URRWV ODQH 0f DQG IURP SULPDU\ WXPRUV _LJf DQG OHQJWKV RI WLPH WLVVXHV ZHUH VXEMHFWHG WR DQDHURELF VWUHVV DUH DV SUHYLRXVO\ GHVFULEHG &RQWURO ODQH W FRQWDLQV SJ RI W51$ IURP %DNHUnV \HDVW 6LJPDf

PAGE 44

)LJ 6, QXFOHDVH K\EULGL]DWLRQ SURWHFWLRQ DQDO\VLV RI PDL]H $GKO LQ VXQIORZHU WXPRUV $f +\EULGL]DWLRQ WR SRO\$f51$ ZLWK '1$ SUREH Df n HQG ODEHOHG DW ZLWKLQ LQWURQ /DQH ff LV DV SUHYLRXVO\ GHVFULEHG /DQHV DQG FRQWDLQ >LJ RI SRO\$f51$ LVRODWHG IURP FRQWURO VXQIORZHU WXPRUV IRUPHG ZLWK ZLOG W\SH $JUREDFWHULXP XQLQGXFHG RU DQDHURELFDOO\ VWUHVVHG IRU KRXUV UHVSHFWLYHO\ VHH 0DWHULDOV DQG 0HWKRGVf /DQHV DQG FRQWDLQ LJ RI SRO\$f51$ LVRODWHG IURP WXPRUV IRUPHG DIWHU LQIHFWLRQ ZLWK $JUREDFWHULXP KDUERULQJ S7LOS%: XQLQGXFHG RU DQDHURELFDOO\ VWUHVVHG IRU KRXUV UHVSHFWLYHO\ /DQH FRQWDLQV _LJ RI SRO\$f51$ LVRODWHG IURP PDL]H URRWV VXEMHFWHG WR KRXUV RI IORRGLQJ VHH 0DWHULDOV DQG 0HWKRGVf %f +\EULGL]DWLRQ WR SRO\$f51$ ZLWK '1$ SUREH Ef n HQG ODEHOHG ZLWKLQ H[RQ /DQH GHVLJQDWLRQV DUH DV GHVFULEHG IRU SDQHO $ &f 5HSUHVHQWDWLRQ RI 6 K\EULGL]DWLRQ VWUDWHJ\ 3URSHUO\ SURFHVVHG SRO\DGHQ\ODWHG 51$ SURWHFW DQ ES IUDJPHQW RI SUREH Ef DQG WKRVH WUDQVFULSWV WKDW PDLQWDLQ LQWUR SURWHFW ES RI '1$ SUREH Df DQG ES RI SUREH Ef 6LJQLILFDQW WUDQVFULSW VLWHV DUH UHSUHVHQWHG (QG ODEHOHG rf SUREHV DQG SUHGLFWHG SURWHFWHG IUDJPHQWV IRU HDFK DUH LOOXVWUDWHG $UURZV LQGLFDWH SURWHFWHG IUDJPHQWV VROLG SUHGLFWHG IUDJPHQW RSHQ QRQSUHGLFWHG SURWHFWHG IUDJPHQW

PAGE 45

r % r r r f§ F 51$ %DP +, +LQ GLOO $FF f[RQ LQWURQ H[RQ '1$ SUREH Df +LQ GLOO EDVHV $FF '1$ SUREH Ef EDVHV EDVHV

PAGE 46

VRPH SRO\DGHQ\ODWHG WUDQVFULSWV KDG QRW SURFHVVHG LQWURQ 7KH 51$ IURP FRQWURO WXPRUV DQG WKH XQLQGXFHG WXPRUV ZLWK PDL]H $GKO VKRZHG QR SURWHFWHG EDQGV )LJ SDQHO $ ODQHV f 7KH IDLOXUH RI VXQIORZHU WXPRUV WR SURSHUO\ VSOLFH PDL]H $GKO WUDQVFULSWV ZDV IXUWKHU LQGLFDWHG E\ D VLPLODU H[SHULPHQW XVLQJ D '1$ SUREH n HQG ODEHOHG ZLWKLQ WKH VHFRQG H[RQ $FFO VLWH DW f )LJ f 3RO\$f51$ IURP WKH VWUHVVHG PDL]H URRWV UHVXOWHG LQ D EDVH SURWHFWHG IUDJPHQW )LJ SDQHO % ODQH f WKDW FRUUHVSRQGHG WR WKH LQWURQ OH[RQ VSOLFH MXQFWLRQ 'HQQLV HW DO f LQGLFDWLQJ WKDW LQWURQ KDG EHHQ SURSHUO\ VSOLFHG IURP WKH PDWXUH PHVVDJH DV H[SHFWHG 0HVVHQJHU 51$ IURP DQDHURELFDOO\ LQGXFHG WXPRUV KRXUVf KDUERULQJ $GKO IDLOHG WR SURWHFW WKH ES EXW UDWKHU K\EULGL]HG DQG SURWHFWHG D IUDJPHQW DSSUR[LPDWHO\ ES LQ OHQJWK )LJ SDQHO % ODQH f 7KH n WHUPLQXV RI WKLV K\EULG SURWHFWHG 51$ FRUUHVSRQGHG ZLWK WKH WUDQVFULSWLRQ VWDUW VLWH LQGLFDWLQJ WKDW WKH LQWURQ ZDV VWLOO SUHVHQW LQ PRVW RI WKH WXPRU WUDQVFULSWV RI PDL]H $GKO 7KHVH GDWD VXJJHVW WKDW OLWWOH RU QR WUDQVFULSWLRQ SURGXFWV IURP PDL]H $GKO LQ VXQIORZHU FHOOV KDG VSOLFHG LQWURQ IURP WKH PDWXUH PHVVDJH .HLWK DQG &KXD f KDG VLPLODU UHVXOWV ZKHQ DQDO\]LQJ D FKLPHULF FRQVWUXFW FRQWDLQLQJ PDL]H $GKO LQWURQ LQ WUDQVJHQLF WREDFFR SODQWV ,QWURQ KDG EHHQ LQVHUWHG EHWZHHQ FKORUDPSKHQLFRO DFHW\O WUDQVIHUDVH &$7f FRGLQJ VHTXHQFHV DQG WKH SHD UEF( SRO\DGHQ\ODWLRQ VLJQDO RI D FRQVWUXFW GULYHQ E\ WKH FDXOLIORZHU PRVDLF YLUXV &D09f 6 SURPRWHU 7KH\ VKRZHG WKDW LQ WREDFFR DERXW b RI WKH WUDQVFULSWV IURP WKLV FKLPHULF IDLOHG WR VSOLFH WKH LQWHUYHQLQJ LQWURQ 7KLV LQIRUPDWLRQ WRJHWKHU ZLWK WKH EDQGLQJ SDWWHUQ RI WKH $GKO WUDQVFULSWV IURP VWUHVVHG VXQIORZHU WXPRU WLVVXH LQ WKH 1RUWKHUQ EORWV )LJV DQG f LPSO\ WKDW DOO QLQH LQWURQV ZLWKLQ 51$ GHULYHG IURP WKLV PRQRFRW JHQH DUH LQHIILFLHQWO\ VSOLFHG LQ GLFRW\OHGRQRXV SODQWV DW OHDVW VXQIORZHU DQG WREDFFR

PAGE 47

3RVVLEOH XSVWUHDP VWDUW VLWH $Q LQWHUHVWLQJ REVHUYDWLRQ GHYHORSHG IURP WKH 6, K\EULGL]DWLRQ H[SHULPHQWV SHUIRUPHG WR ORRN DW VSOLFLQJ DFWLYLW\ ,Q WKRVH ODQHV DGGUHVVLQJ WUDQVFULSW SURFHVVLQJ IURP DQDHURELFDOO\ VWUHVVHG WXPRUV SURWHFWHG IUDJPHQWV DSSHDUHG WKDW ZHUH LQGLFDWLYH RI D SRVVLEOH XSVWUHDP WUDQVFULSWLRQ VWDUW VLWH 7KH K\EULGL]DWLRQ H[SHULPHQW XVLQJ WKH SUREH HQG ODEHOHG ZLWKLQ LQWURQ QRW RQO\ SURWHFWHG ES RI WKH SUREH IURP 6, GLJHVWLRQ EXW D IUDJPHQW RI DERXW ES )LJ SDQHO $ ODQH f 7KH VHFRQG SUREH HQG ODEHOHG ZLWKLQ H[RQ PD\ KDYH DOVR K\EULGL]HG DQG SURWHFWHG D ORQJ VWUHWFK RI '1$ H[WHQGLQJ WR ES XSVWUHDP )LJ SDQHO % ODQH f 7KHVH VXUSULVLQJ UHVXOWV VXJJHVW WKDW D VHFRQG XSVWUHDP SURPRWHU DOVR XQGHU WKH FRQWURO RI HQYLURQPHQWDO VWUHVV PD\ EH SUHVHQW IXUWKHU XSVWUHDP DSSUR[LPDWHO\ ESf IURP WKH NQRZQ $GKO WUDQVFULSWLRQ VWDUW VLWH 7R IXUWKHU LQYHVWLJDWH WKH SRVVLELOLW\ RI DQ XSVWUHDP VWDUW VLWH D ES '1$ IUDJPHQW HQG ODEHOHG DW DQ ;EDO UHVWULFWLRQ VLWH ES XSVWUHDP RI WKH UHFRJQL]HG LQLWLDWLRQ VLWH 'HQQLV HW DL f ZDV XVHG LQ DQRWKHU 6, QXFOHDVH PDSSLQJ DQDO\VLV 1R SURWHFWLRQ ZDV REVHUYHG ZLWK WUDQVFULSWV IURP WUDQVIRUPHG WXPRUV WKDW KDG QRW EHHQ VWUHVVHG )LJ ODQH &f QRU IURP PDL]H URRWV VXEMHFWHG WR IORRGLQJ )LJ ODQH 0f +RZHYHU SRO\$f51$ IURP WXPRUV VWUHVVHG IRU VL[ KRXUV SURWHFWHG DERXW ES RI WKH HQG ODEHOHG SUREH )LJ ODQH ,f VXSSRUWLQJ WKH H[LVWHQFH RI D VHFRQG LQLWLDWLRQ VLWH DSSUR[LPDWHO\ ES XSVWUHDP RI WKH NQRZQ WUDQVFULSW LQLWLDWLRQ VLWH &RQVLVWHQW ZLWK HYLGHQFH RI DQ XSVWUHDP VWDUW LV WKH SUHVHQFH RI 7$7$77$$ VHTXHQFH DSSUR[LPDWHO\ WR ES IXUWKHU XSVWUHDP RI WKLV SRVVLEOH VWDUW 7KLV VHTXHQFH FRQIRUPV WR WKH n 7$7$$7f$$7fn FRQVHQVXV VHTXHQFH %UHDWKQDFK DQG &KDPEQ f XVXDOO\ IRXQG WR ES XSVWUHDP RI D WUDQVFULSWLRQ VWDUW VLWH WKDW IXQFWLRQV LQ SRVLWLRQLQJ WKH VWDUW RI WUDQVFULSWLRQ LQ PDQ\ HXNDU\RWHV '\QDQ DQG 7MLDQ f 2Q WKH RWKHU KDQG QR VHTXHQFHV UHVHPEOLQJ RWKHU SUR[LPDO SURPRWHU HOHPHQWV VXFK DV D &$$7 ER[ DUH SUHVHQW XSVWUHDP RI WKH 7$7$ VHTXHQFH LQVWHDG WKLV UHJLRQ LV KLJKO\ $7 ULFK 'HQQLV HW

PAGE 48

W & 0 P SURWHFWHG '1$ f ‘0% %DP +, ;ED '1$ SUREH )LJ ([DPLQDWLRQ RI SRVVLEOH XSVWUHDP WUDQVFULSWLRQ LQLWLDWLRQ VLWH E\ 6, K\EULGL]DWLRQ PDSSLQJ 7KH ES $GKO XSVWUHDP n HQG ODEHOHG rf SUREH LV LOOXVWUDWHG +\EULGL]DWLRQ H[SHULPHQWV DUH ZLWK SJ HDFK RI SRO\$f51$ IURP WXPRUV KDUERULQJ WKH $GKO JHQH XQLQGXFH /DQH &f RU DQDHURELFDOO\ VWUHVVHG IRU KRXUV ODQH ,f &RQWURO P51$ LJf LV IURP PDL]H URRWV ODQH 0f /DQH P FRQWDLQV S%5 +SD: HQG ODEHOHG IUDJPHQWV OHQJWKV DUH SUHVHQWHGf /DQH W LV DV SUHYLRXVO\ GHVFULEHG

PAGE 49

DO f 3ULPHU H[WHQVLRQ H[SHULPHQWV RI SRO\$f51$ IURP VXQIORZHU WXPRUV RU PDL]H URRWV ZHUH LQFRQFOXVLYH LQ FRQILUPLQJ WKH H[LVWHQFH RI DQ XSVWUHDP VWDUW VLWH GDWD QRW VKRZQf n GHOHWLRQV RI WKH PDL]H $GKO SURPRWHU DQG DQDO\VLV LQ VXQIORZHU 7KH $GKO JHQH RI PDL]H KDV EHHQ VKRZQ WR XWLOL]H LWV RZQ SURPRWHU LQ WUDQVJHQLF VXQIORZHU FHOOV DQG UHWDLQ LWV DELOLW\ WR UHVSRQG WR DQDHURELF VWUHVV 6LPLODU n GHOHWLRQ PXWDWLRQV RI WKH SURPRWHU ZHUH FRQVWUXFWHG LQ DQ DQDORJRXV DWWHPSW WR ORFDOL]H LPSRUWDQW VHTXHQFHV LQYROYHG LQ WUDQVFULSWLRQDO UHJXODWLRQ RI WKH JHQH LQ WKLV WUDQVJHQLF V\VWHP 'XH WR WKH SUHVHQFH RI FHUWDLQ UHVWULFWLRQ VLWHV ZLWKLQ WKH PDL]H $GKO JHQH D QXPEHU RI PDQLSXODWLRQV ZHUH UHTXLUHG WR FRQVWUXFW n GHOHWLRQ PXWDQWV WR SRVLWLRQV DQG 7KH NE %DP+O WR .SQO IUDJPHQW XWLOL]HG LQ SUHYLRXV H[SHULPHQWV ZDV VXEFORQHG LQWR S8& 9LHUUD DQG 0HVVLQJ f ZKHUH DQ eFR5, UHVWULFWLRQ VLWH IURP WKH S8& SRO\OLQNHU LV SUR[LPDO WR WKH .SQO VLWH 7KH %DP+O WR eFR5, IUDJPHQW IURP WKLV LQWHUPHGLDWH FRQVWUXFW FRQWDLQLQJ $GKO ZDV WKHQ VXEFORQHG LQWR S%5 7KHVH PDQLSXODWLRQV DOORZHG WKH IUDJPHQW RI LQWHUHVW WR UHVLGH LQ D YHFWRU YRLG RI +LQGOOO UHVWULFWLRQ VLWHV 7KH JHQH ZDV WKHQ JXWWHG E\ UHPRYDO RI D NE +LQGOOO IUDJPHQW LQWHUQDO WR WKH JHQH UHVXOWLQJ LQ S$GK$+ )LJ f 7KH DFWXDO SURPRWHU PXWDWLRQV ZHUH FRQVWUXFWHG E\ VXEFORQLQJ IUDJPHQWV FRQVLVWLQJ RI $GKO n IODQNLQJ VHTXHQFHV WKH n XQWUDQVODWHG OHDGHU VHTXHQFH DQG WKH ILUVW EDVHV RI WKH FRGLQJ UHJLRQ LQWR S8& 7KH ILUVW RI WKHVH PXWDWLRQV LQYROYHG WKH ;EDO f WR +LQGOOO f IUDJPHQW ZKLFK ODFNHG ES RI WKH PRVW GLVWDO n VHTXHQFHV 6LPLODUO\ WKH VHFRQG FRQVWUXFW FRQVLVWHG RI D 3VUL f WR mGLOO f IUDJPHQW PLQXV EDVH SDLUV XSVWUHDP RI WKH VLWH RI WKH SURPRWHU (DFK RI WKHVH SURPRWHU GHOHWLRQV VXEFORQHG LQWR S8& DFTXLUHG D %DP+O UHVWULFWLRQ VLWH IURP WKH YHFWRUnV SRO\OLQNHU ORFDWHG LPPHGLDWHO\ n WR WKH SURPRWHU GHOHWLRQV 7KH SURPRWHU PXWDQWV ZHUH WKHQ VXEFORQHG LQWR WKH %DP+O DQG mGLOO UHVWULFWLRQ VLWHV RI S$GK$+ ZKLFK KDG WKH ZLOG W\SH SURPRWHU H[FLVHG )LQDOO\ WKH

PAGE 50

%DP + (FR 5 S%5 )LJ &RQVWUXFWLRQ RI JXWWHG S$GK$+ 6WLSSOHG UHJLRQ RI SODVPLGV LQGLFDWLYH RI JHQRPLF VHTXHQFHV IURP PDL]H FRQWDLQLQJ $GKOn ZKLWH UHJLRQ UHSUHVHQWV GHVLJQDWHG YHFWRU /RFDWLRQ DQG WUDQVFULSWLRQ RULHQWDWLRQ RI $GKO LV LOOXVWUDWHG E\ DUURZ ZLWKLQ EDFWHULDO SODVPLGV 3HUSHQGLFXODU OLQH WKURXJK DUURZ RI S$GK$+ LQGLFDWHV LQWHUQDO GHOHWLRQ RI D NE +LQGOOO IUDJPHQW

PAGE 51

NE +LQGOOO LQWHUQDO IUDJPHQW ZDV UHLQVHUWHG LQ LWV SURSHU RULHQWDWLRQ LQWR WKH S$GK$+ GHULYDWLYHV UHVXOWLQJ LQ WZR $GKO JHQHV ZLWK LQWDFW FRGLQJ VHTXHQFHV KDYLQJ WKH SURPRWHU n GHOHWLRQ WR SRVLWLRQ DQG )LJ f (DFK RI WKHVH FRQVWUXFWV SRVVHVVHG D %DP5O VLWH DW WKHLU n HQGV WKDW ZDV HVVHQWLDO IRU OLJDWLRQ RI WKHVH PXWDWHG JHQHV LQWR WKH S: VKXWWOH YHFWRU 6L[ KU DQDHURELFDOO\ VWUHVVHG VXQIORZHU WXPRU WLVVXH ZKLFK FRQWDLQHG $GKO n GHOHWLRQ PXWDWLRQV ZHUH H[DPLQHG IRU WUDQVFULSWLRQDO H[SUHVVLRQ E\ 6, WUDQVFULSW PDSSLQJ H[SHULPHQWV (DFK VKRZHG D GLIIHUHQFH LQ WUDQVFULSWLRQDO DFWLYLW\ FRPSDUHG WR WKDW RI ZLOG W\SH )LJ ODQH f 7KH PXWDQW H[SUHVVHG WUDQVFULSWLRQ OHYHOV DSSUR[LPDWHO\ b RI ZLOG W\SH )LJ ODQH f 5HPRYDO RI DGGLWLRQDO VHTXHQFHV WR SRVLWLRQ UHVXOWHG LQ IXUWKHU UHGXFWLRQ RI WUDQVFULSW OHYHOV WR DSSUR[LPDWHO\ b WKDW RI ZLOG W\SH )LJ ODQH f &RQVWLWXWLYH DFWLYLW\ RI HDFK RI WKH FRQVWUXFWV ZDV OHVV WKDQ b RI WKH PD[LPXP YDOXH DIWHU LQGXFWLRQ )LJ ODQHV 8f ,QWHUHVWLQJO\ WKHVH UHVXOWV VKRZ D FRUUHODWLRQ WR WKRVH RI /HH HW DO f ZKR H[DPLQHG H[SUHVVLRQ LQ KRPRORJRXV PDL]H SURWRSODVWV $OVR ERWK n GHOHWLRQ PXWDQWV LQLWLDWHG WUDQVFULSWLRQ DW WKH SURSHU VWDUW VLWH DQG H[SUHVVLRQ RI HDFK JHQH ZDV LQGXFLEOH 7KLV LQGLFDWHG WKDW WKH $5( LGHQWLILHG LQ PDL]H SURWRSODVWV :DONHU HW DO f ZKLFK LV VWLOO SUHVHQW LQ WKHVH GHOHWLRQ PXWDQWV PD\ ZRUN LQ D VLPLODU IDVKLRQ LQ VXQIORZHU 'LVFXVVLRQ 0DL]H $GKO LV D KLJKO\ UHJXODWHG RUJDQ VSHFLILF JHQH WKDW ZDV DEOH WR XWLOL]H LWV RZQ SURPRWHU ZKHQ LQGXFHG LQ WUDQVJHQLF VXQIORZHU WXPRUV 7UDQVFULSWLRQ ZDV DFWLYDWHG LQ UHVSRQVH WR DQDHURELF VWUHVV DQG UHDFKHG VWHDG\ VWDWH OHYHOV EHWZHHQ DQG KRXUV DIWHU LQGXFWLRQ DQG UHPDLQHG DW WKLV OHYHO IRU DW OHDVW DQ DGGLWLRQDO KU $OWKRXJK LW LV DSSDUHQW WKDW VXQIORZHU WXPRU FHOOV SRVVHVV WUDQVFULSWLRQ IDFWRUV WKDW DUH UHFRJQL]HG DQG SURSHUO\ XWLOL]HG E\ UHJXODWRU\ HOHPHQWV RI WKLV PRQRFRW JHQH ERWK 51$ EORW K\EULGL]DWLRQV DQG 6,

PAGE 52

+Q GLOO f 3VI f ;ED f %DP + S8& f ;ED %DP + ;ED +LQ GLOO 6DP + +LQ GLOO +LQ GLOO LVRODWH %DP +O+nQ GLOO IUDJPHQW %DP + f OLJDWLRQ ; f 3VI ;ED Q %DP + f LVRODWH %DP +O+nQ GLOO IUDJPHQW 3VI 3VW f ;ED %DP + .SQ (FR 5 f OLJDWLRQ ; ? +LQ GOO f 3VI ;ED %DP )LJ &RQVWUXFWLRQ RI WKH WZR JHQRPLF $GKO n GHOHWLRQ SURPRWHU PXWDQWV S$GK DQG S$GK 2ULJLQ RI VHTXHQFHV ZLWKLQ SODVPLGV DQG $GKO ORFDWLRQ DQG RULHQWDWLRQ DUH DV SUHYLRXVO\ GHVFULEHG ,PSRUWDQW UHVWULFWLRQ VLWHV DQG SRVLWLRQ ZLWK UHVSHFW WR WKH $GKO VWDUW RI WUDQVFULSWLRQ DUH VKRZQ LQ SDUHQWKHVLV

PAGE 53

r r ff f 8 8 8 IXOO OHQJWK SUREH PPP SURWHFWHG IUDJPHQW f f )LJ 6, QXFOHDVH SURWHFWLRQ DQDO\VLV RI $GKO n GHOHWLRQ PXWDQWV IURP VXQIORZHU WXPRUV +\EULGL]DWLRQ RI WKH HQG ODEHOHG SUREH SUHYLRXVO\ GHVFULEHG LQ )LJXUH ZDV ZLWK SRO\$f51$ LVRODWHG IURP WXPRUV IRUPHG XSRQ LQIHFWLRQ ZLWK $JUREDFWHULXP KDUERULQJ PDL]H $GKO WUDQVFULSWLRQ XQLWV ZLWK n IODQNLQJ VHTXHQFHV H[WHQGLQJ f f RU f EDVH SDLUV XSVWUHDP IURP WKH UHFRJQL]HG LQLWLDWLRQ RI WUDQVFULSWLRQ VLWH 5HVXOWV RI 6, PDSSLQJ IURP FRQWURO XQLQGXFHGf WXPRUV FRQWDLQLQJ SJ RI SRO\$f51$ DUH SUHVHQWHG LQ ODQHV 8 DQG IURP LQGXFHG WXPRUV DQDHURELFDOO\ VWUHVVHG IRU KRXUVf FRQWDLQLQJ SLJ RI SRO\$f51$ LQ ODQHV 7KH ES SURWHFWHG IUDJPHQW LV GHVLJQDWHG /DQHV M! DQG W DUH DV SUHYLRXVO\ GHVFULEHG

PAGE 54

QXFOHDVH PDSSLQJ H[SHULPHQWV LQGLFDWHG WKDW WKH KHWHURORJRXV $GKO WUDQVFULSW ZDV SRRUO\ VSOLFHG LQ VXQIORZHU WXPRUV 3URSHU UHPRYDO RI LQWURQ ZDV VKRZQ WR EH DOO EXW QRQn H[LVWHQW 1RUWKHUQ EORW DQDO\VLV LQGLFDWHG WKDW WKH RWKHU HLJKW LQWURQV ZHUH DOVR LQHIILFLHQWO\ VSOLFHG VLQFH WKH PRVW SURPLQHQW EDQGV FRUUHVSRQG WR D IXOO OHQJWK NE XQVSOLFHG WUDQVFULSW )LJV DQG f ,Q WKH VWXG\ E\ .HLWK DQG &KXD f D FKLPHULF JHQH FRQVLVWLQJ RI WKH ZKHDW UEF FRGLQJ UHJLRQ XQGHU WKH FRQWURO RI WKH &D09 6 SURPRWHU ZDV LQFRUSRUDWHG LQWR WUDQVJHQLF WREDFFR SODQWV 7KH\ GHPRQVWUDWHG WKDW WKH VLQJOH LQWURQ UHPDLQHG XQVSOLFHG WR b RI WKH WLPH DOWKRXJK WKRVH WKDW ZHUH VSOLFHG GLG VR DW WKH FRUUHFW VSOLFH MXQFWLRQV 7R IXUWKHU FRPSDUH DEHUUDQW VSOLFLQJ RI D PRQRFRW WUDQVFULSW LQ D GLFRW V\VWHP WKLV JURXS GHYHORSHG D FKLPHULF JHQH KDYLQJ HLWKHU LQWURQ RI PDL]H $GKO RU WKH SHD UEF6$ ILUVW LQWURQ SRVLWLRQHG EHWZHHQ &$7 FRGLQJ VHTXHQFHV DQG WKH SHD UEF( SRO\DGHQ\ODWLRQ VLJQDO 7KHVH FKLPHULF JHQHV GULYHQ E\ WKH &D09 6 SURPRWHU ZHUH LQFRUSRUDWHG LQWR WUDQVJHQLF WREDFFR 2QO\ DERXW b RI WKH WUDQVFULSWV FRQWDLQLQJ WKH $GKO LQWURQ ZHUH VSOLFHG ZKHUHDV URXJKO\ b RI WKH LQWURQV IURP SHD ZHUH SURFHVVHG IURP WKH WUDQVFULSWV 7KH UHVXOWV SUHVHQWHG LQ WKLV VWXG\ GLIIHU IURP WKRVH REWDLQHG ZKHQ PDL]H $GKO ZDV LQFRUSRUDWHG LQWR WKH JHQRPH RI WREDFFR $QDO\VLV RI WXPRUV LQFLWHG E\ 7'1$ KDUERULQJ PDL]H $GKO UHVXOWHG LQ QR GHWHFWDEOH WUDQVFULSW OHYHOV /OHZHOO\Q HW DL f :KHQ WKH $GKO SURPRWHU ZDV OLQNHG WR D FKORUDPSKHQLFRO DFHW\O WUDQVIHUDVH &$7f JHQH DQG LQFRUSRUDWHG LQWR WUDQVJHQLF WREDFFR SODQWV DJDLQ WKHUH ZDV OLWWOH HYLGHQFH RI SURPRWHU IXQFWLRQ (OOLV HW DO Df $QDHURELFDOO\ LQGXFHG &$7 DFWLYLW\ DQG SURSHU VWDUW VLWH XWLOL]DWLRQ ZHUH REVHUYHG LQ WREDFFR RQO\ ZKHQ WKH XSVWUHDP VHTXHQFHV RI RFWRSLQH V\QWKDVH RFVf RU FDXOLIORZHU PRVDLF YLUXV &D09f 6 JHQHV ZHUH SRVLWLRQHG n WR RI WKLV FKLPHULF JHQH 6LPLODUO\ WKH GHYHORSPHQWDOO\ UHJXODWHG ]HLQ SURPRWHU VKRZHG DFWLYLW\ LQ FORQHG VXQIORZHU WXPRU WLVVXH $OWKRXJK WUDQVFULSWV ZHUH GHWHFWDEOH QR SURWHLQV ZHUH REVHUYHG 0DW]NH HW DO *ROGEURXJK HW DO f $IWHU LQFRUSRUDWLRQ RI D PDL]H ]HLQ JHQH LQWR WREDFFR SRO\$f51$ FRXOG RQO\ EH GHWHFWHG DW

PAGE 55

YHU\ ORZ OHYHOV LQ WKH VHHGV RI WUDQVJHQLF SODQWV 6FKHPWKDQHU HW DO f 7KH SURPRWHU ZDV VKRZQ WR IXQFWLRQ LQ D WLVVXH VSHFLILF PDQQHU DIWHU LW ZDV OLQNHG WR D JOXFXURQLGDVH V\QWKDVH *86f UHSRUWHU JHQH ZKRVH SURGXFW FDQ UHDFW KLVWRFKHPLFDOO\ WR ORFDOL]H PLQXWH DPRXQWV RI DFWLYLW\ 7KXV LW DSSHDUV WKDW WUDQVFULSWLRQ IDFWRUV DUH SUHVHQW LQ VXQIORZHU WXPRU WLVVXH WKDW FDQ EH UHFRJQL]HG DQG XWLOL]HG E\ PDL]H $GKO DQG ]HLQ SURPRWHUV ,Q WREDFFR WKH WUDQVFULSW LQLWLDWLRQ VLWHV RI WKHVH SURPRWHUV DUH UHFRJQL]HG EXW WUDQVFULSWLRQ HIILFLHQF\ VHHPV WR EH PXFK ORZHU WKDQ LQ VXQIORZHU LQGLFDWLQJ GLIIHUHQFHV LQ WKH DEXQGDQFH RU UHFRJQLWLRQ HIILFLHQF\ RI DQDORJRXV WUDQVFULSWLRQ IDFWRUV LQ WKHVH WZR GLFRW V\VWHPV $OWKRXJK LQ WKH SUHVHQW VWXG\ VSOLFLQJ RI PDL]H $GKO WUDQVFULSWLRQ SURGXFWV ZDV DEHUUDQW LQ VXQIORZHU WXPRU FHOOV $GKO SURPRWHU IXQFWLRQ ZDV XQLPSDLUHG 7ZR n GHOHWLRQV RI WKH SURPRWHU DQG DQDO\VLV RI JHQH SURGXFW OHYHOV E\ 6 K\EULGL]DWLRQ LQGLFDWHG VLPLODU SURPRWHU VWUHQJWKV LQ WKLV GLFRW\OHGRQRXV V\VWHP DV IRXQG E\ /HH HW DO f LQ PDL]H SURWRSODVWV ,Q WKH SUHVHQW VWXG\ GHOHWLRQV RI VHTXHQFHV XSVWUHDP RI SRVLWLRQ DQG GLG QRW UHOHDVH WKH SURPRWHU IURP DQDHURELF UHJXODWLRQ EXW UHVXOWHG LQ D VXEVWDQWLDO UHGXFWLRQ LQ DFWLYLW\ WR b DQG b RI ZLOG W\SH UHVSHFWLYHO\ $GKO SURPRWHU DQDO\VLV LQ KRPRORJRXV PDL]H SURWRSODVWV VKRZHG DERXW b DQG b DFWLYLW\ IRU WKH VDPH SURPRWHU PXWDWLRQV FRPSDUHG WR ZLOG W\SH DFWLYLW\ /HH HW DO f 5HVXOWV RI WKH GHOHWLRQ LQ SURWRSODVWV VXSHUILFLDOO\ DSSHDU WR GLIIHU IURP VXQIORZHU EXW WKH DFWLYLW\ LQ WKH SURWRSODVW VWXG\ ZDV DFWXDOO\ DQ DYHUDJH RI GLIIHUHQW H[SHULPHQWV LQ ZKLFK WKH GDWD IOXFWXDWHG DQ\ZKHUH IURP b WR b RI ZLOG W\SH DFWLYLW\ :DONHU HW DO f DOVR SHUIRUPHG D VLPLODU SURPRWHU DQDO\VLV RI WKH $GKO SURPRWHU OLQNHG WR D &$7 UHSRUWHU JHQH LQ PDL]H SURWRSODVWV 7KH\ UHSRUWHG WKDW D n GHOHWLRQ WR WKH SRVLWLRQ ZDV VWLOO LQGXFHG E\ ORZ R[\JHQ WHQVLRQ EXW WKH WUDQVFULSW OHYHO ZDV b RI ZLOG W\SH 7KH\ DOVR ORFDOL]HG WKH UHJLRQ WKDW LV QHFHVVDU\ IRU DQDHURELF LQGXFWLRQ DQDHURELF UHVSRQVH HOHPHQW $5(f EHWZHHQ DQG

PAGE 56

$QDO\VLV RI 51$ GHULYHG IURP WKH PDL]H $GKO JHQH VXJJHVWHG WKDW LQ VXQIORZHU WXPRUV D VPDOO SRUWLRQ RI WKH WUDQVFULSWV LQLWLDWHG DSSUR[LPDWHO\ ES XSVWUHDP RI WKH SUR[LPDO VWDUW VLWH 7KH '1$ VHTXHQFHV DW WKLV SXWDWLYH XSVWUHDP VWDUW VLWH DUH UHODWLYHO\ $7ULFK DQG PD\ FRQWULEXWH WR WKH SURGXFWLRQ RI VSXULRXV EDQGV LQ DQ 6 QXFOHDVH K\EULG SURWHFWLRQ DVVD\ GXH WR WKH UHDQQHDOLQJ RI WKH '1$ SUREH DQG VXEVHTXHQW FOHDYDJH DW UHJLRQV RI SDUWLDO GHQDWXUDWLRQ 7KLV SRVVLELOLW\ VHHPV XQOLNHO\ LQ WKLV FDVH KRZHYHU VLQFH XQGHU LGHQWLFDO K\EULGL]DWLRQ FRQGLWLRQV WKH DSSHDUDQFH RI WKH KLJK PROHFXODU ZHLJKW EDQGV ZHUH VWULFWO\ FRUUHODWHG ZLWK 51$ IURP DQDHURELFDOO\ VWUHVVHG WXPRU FHOOV KDUERULQJ PDL]H $GKO :H DUH OHIW ZLWK WKH SRVVLELOLW\ WKDW PDL]H $GKO KDV D VHFRQG SURPRWHU FRUUHVSRQGLQJ WR WKH XSVWUHDP VWDUW VLWH 7KH H[LVWHQFH RI OLQNHG GXDO UHJXODWRU\ VLWHV IRU $GKO ) DOOHOHf KDV SUHYLRXVO\ EHHQ K\SRWKHVL]HG E\ 6FKZDUW] D Ef DQG GXDO SURPRWHUV KDYH EHHQ REVHUYHG LQ RWKHU HXNDU\RWLF JHQHV WKDW DUH GHYHORSPHQWDOO\ RU WLVVXH VSHFLILF LQ WKHLU UHJXODWLRQ IRU UHYLHZ 6KLEOHU DQG 6LHUUD f 2I SDUWLFXODU LQWHUHVW LV WKH DOFRKRO GHK\GURJHQDVH JHQH LQ 'URVRSKLOD PHODQRJDVWHU $ SUR[LPDO SURPRWHU LV XWLOL]HG LQ WKH ODUYDO VWDJH WR SURGXFH P51$ RI DERXW EDVHV LQ OHQJWK ZLWK D EDVH XQWUDQVODWHG OHDGHU 7KH PDMRU WUDQVFULSW LQ WKH DGXOW VWDJH XWLOL]HV D GLVWDO SURPRWHU ES XSVWUHDP WR WKH SUR[LPDO SURPRWHU 7KLV XSVWUHDP SURPRWHU KDV D 7$7$ VLWH ES n WR WKH VWDUW RI WUDQVFULSWLRQ DQG SURGXFHV D WUDQVFULSW ZKLFK DIWHU SURFHVVLQJ \LHOGV DQ DSSUR[LPDWHO\ EDVH P51$ LQLWLDWHG DW WKH XSVWUHDP VWDUW VLWH %RWK DGXOW DQG ODUYDO VWDJH P51$V XWLOL]H WKH VDPH FRGLQJ UHJLRQ DQG GLIIHU RQO\ DW WKH H[WUHPH n QRQFRGLQJ UHJLRQ %HQ\DMDWL HW DOf f 7KH RFFXUUHQFH RI DQ XSVWUHDP VWDUW VLWH GLVWDO SURPRWHUf LQ VXQIORZHU WXPRUV UDLVHV WKH SRVVLELOLW\ WKDW D GXDO SURPRWHU V\VWHP VLPLODU WR WKDW SUHVHQW LQ 'URVRSKLOD $GK PD\ DOVR H[LVW LQ PDL]H $GKO 7KH LQHIILFLHQF\ RI LQWURQ UHPRYDO LQ VXQIORZHU IRUWXLWRXVO\ DVVLVWHG LQ WKH LGHQWLILFDWLRQ RI WKH GLVWDO SURPRWHU VLQFH 6 QXFOHDVH PDSSLQJ SUREHV RULJLQDOO\ VHOHFWHG IRU WKH SUHVHQFH RI n ODEHOOLQJ VLWHV LQWHUQDO WR WKH FRGLQJ UHJLRQ

PAGE 57

ZHUH DEOH WR GHWHFW D FRQWLQXRXV 51$'1$ K\EULG IURP WKH ODEHOOHG n WHUPLQXV RI WKH SUREH WR WKH GLVWDO VWDUW VLWH 2I SRVVLEOH VLJQLILFDQFH LV WKH RFFXUUHQFH RI VHTXHQFHV VKRZLQJ KRPRORJ\ WR WKH PHODQRJDVWHU $GK GLVWDO SURPRWHU LQ WKH UHJLRQ RI WKH SXWDWLYH PDL]H GLVWDO SURPRWHU .UHLWPDQ f )LJ f 2WKHU '1$ VHTXHQFHV LQ WKH UHJLRQ RI WKH XSVWUHDP VWDUW VLWH ZKLFK DUH FRQVLVWHQW ZLWK LWV SURSRVHG UROH DV D GLVWDO SURPRWHU LQFOXGH D 7$7$OLNH PRWLI n7$7$77$$nf VLPLODUO\ VSDFHG IURP D n&$7 n VHTXHQFH ZKLFK LV UHFRJQL]HG DV WKH WUDQVFULSWLRQ LQLWLDWLRQ VLWH LQ PHODQRJDVWHU 7UDQVFULSWV LQLWLDWHG DW WKH SXWDWLYH GLVWDO SURPRWHU RI PDL]H $GKO ZRXOG EH NE LQ VL]H EHIRUH SURFHVVLQJ ,Q WKH FDVH RI 'URVRSKLOD $GK WUDQVFULSWV LQLWLDWHG E\ WKH GLVWDO SURPRWHU DUH VSOLFHG LQ WKH XQWUDQVODWHG OHDGHU VHTXHQFH D SURFHVV ZKLFK UHPRYHV VSXULRXV $7* WULSOHWV WKDW PD\ UHGXFH WUDQVODWLRQDO HIILFLHQF\ LI SUHVHQW LQ WKH P51$ 7KH SXWDWLYH GLVWDO SURPRWHU RI PDL]H $GKO PD\ DOVR IROORZ D VLPLODU SDWWHUQ RI LQWURQ VSOLFLQJ 7ZR SRWHQWLDO n GRQRU VLWHV IRU VSOLFLQJ DUH ORFDWHG DW DQG LQ WUDQVFULSWV GHULYHG IURP WKH GLVWDO SURPRWHU 'UDZLQJ RQ WKH 'URVRSKLOD DQDORJ\ D SRVVLEOH n DFFHSWRU VLWH LQ WKH UHJLRQ FRUUHVSRQGLQJ WR WKH OHDGHU RI WKH WUDQVFULSW GHULYHG IURP WKH SUR[LPDO SURPRWHU LV ORFDWHG DW 7KH XWLOL]DWLRQ RI WKHVH VSOLFLQJ VLWHV ZRXOG UHPRYH UHGXQGDQW $7* WULSOHWV XSVWUHDP RI WKH FRGLQJ UHJLRQ DQG f DQG ZRXOG LQFUHDVH WKH VL]H RI WKH P51$ E\ RQO\ WR EDVHV 7KRXJK WKLV PRGHO IRU D GXDO SURPRWHU IRU PDL]H $GKO LV VLPSO\ FRQMHFWXUH GXH WR WKH ODFN RI DQ\ VXSSRUWLQJ HYLGHQFH IRU WKH XWLOL]DWLRQ RI WKH GLVWDO SURPRWHU LQ PDL]H LW LV LQWHUHVWLQJ WR QRWH WKDW DQ LQVHUWLRQ RI D NE 0S OLNH HOHPHQW LQWR WKH SURPRWHU DW f RI $GKO UHGXFHG WUDQVFULSWLRQ OHYHOV RI WKLV JHQH LQ VHHGV DQG DQDHURELFDOO\ VWUHVVHG VHHGOLQJV WR b RI QRUPDO DFWLYLW\ ZKHUHDV $'+ H[SUHVVLRQ LQ SROOHQ UHPDLQHG FRQVWDQW &KHQ HW DO f 7KH IDLOXUH RI 0S WR LQDFWLYDWH SROOHQ H[SUHVVLRQ VXJJHVWV WKDW LQ WKLV FDVH $GKO H[SUHVVLRQ LV UHJXODWHG E\ D SURPRWHU RWKHU WKDQ WKDW DVVRFLDWHG ZLWK WKH SUR[LPDO 7$7$ $JDLQ D FRPSDULVRQ EHWZHHQ WKLV JHQH DQG 'URVRSKLOD $GK PD\ EH PDGH LQ WKDW GHYHORSPHQWDO FRQWURO RI $GK H[SUHVVLRQ LV DFKLHYHG E\ HPSOR\LQJ GXDO SURPRWHUV %HQ\DMDWL HW DO f 7KH

PAGE 58

)LJ 6HTXHQFH FRPSDULVRQ RI WKH SRVVLEOH PDL]H $GKO XSVWUHDP SURPRWHU ZLWK WKH 'URVRSKLOD PHODQRJDVWHU GLVWDO SURPRWHU FRQVHQVXV VHTXHQFH EHWZHHQ GLIIHUHQW VWUDLQVf .UHLWPDQ f 'RXEOH EDVHV IRU WKH PHODQRJDVWHU VHTXHQFHV LQGLFDWHV HLWKHU EDVH FDQ RFFXS\ WKLV VSDFH EHWZHHQ VWUDLQV 'DVKHG OLQHV LQVHUWHG EHWZHHQ EDVHV LQ DWWHPSW WR DOLJQ PRVW OLNH EDVHV /LNH EDVHV DUH FRQQHFWHG E\ YHUWLFDO RU GLDJQDO OLQHV 6WDUW RI WUDQVFULSWLRQ IRU PHODQRJDVWHU GLVWDO SURPRWHU DQG SRVVLEOH VWDUW VLWHV IRU PDL]H DUH LQGLFDWHG E\ DQG UHVSHFWLYHO\ 7$7$ ER[ LV LOOXVWUDWHG DQG 6 LQGLFDWHV SRVVLEOH n VSOLFH MXQFWLRQV $7* VLWHV GRZQVWUHDP RI SRVVLEOH VWDUW VLWHV DUH XQGHUOLQHG

PAGE 59

'URVRSKLOD 7$7$ ER[ && $&*$&$*$$&$*7$777$$**$*&7*&*$$**7&&$$*7&$7*&$77$77*7& ,, , , , ,,, , , ,, , , ,,, $&*7&&&*7*7&M7$7$77$$M&7&77&7*777$$$*&&$$f§ &$7*$&$7*&77* RU f r I Ir &$*7*&$*77*7&$77*&$*77& , , ,, &*7*&**7*$$$$7*7*$$$7*

PAGE 60

H[LVWHQFH RI GXDO SURPRWHUV UHJXODWHG E\ RUJDQ VSHFLILFLW\ FDQQRW DV \HW EH UXOHG RXW ,W ZLOO EH LQWHUHVWLQJ WR SXUVXH WKLV TXHVWLRQ H[SHULPHQWDOO\ (YHQ WKRXJK VSOLFLQJ RI WKH PDL]H $GKO JHQH LQ VXQIORZHU WXPRUV LV IDXOW\ UHJXODWLRQ RI WKH WUDQVFULSWLRQDO H[SUHVVLRQ SURYHG WR EH IXQFWLRQDO DQG FORVHO\ PLPLFNHG WKH UHVSRQVH RI WKLV JHQH LQ LWV QDWXUDO KRVW 7KH IROORZLQJ VHFWLRQ IRFXVHV RQ ORFDOL]LQJ DQG DQDO\]LQJ FVDFWLQJ UHJXODWRU\ HOHPHQWV RI $GKO WKDW DUH UHFRJQL]HG LQ WKLV GLFRW\OHGRQRXV SODQW V\VWHP

PAGE 61

&+$37(5 352027(5 $1$/<6,6 2) 0$,=( $GKO ,1 681)/2:(5 780256 ,QWURGXFWLRQ ,Q RUGHU WR LGHQWLI\ DQG PDS UHJXODWRU\ HOHPHQWV RI WKH PDL]H $GKO SURPRWHU D QXPEHU RI PXWDWLRQV ZHUH FRQVWUXFWHG E\ FORQLQJ DQG ZHUH DQDO\]HG LQ YLYR XVLQJ WKH KHWHURORJRXV V\VWHP RI VXQIORZHU WXPRUV 7R IDFLOLWDWH LQ YLWUR PDQLSXODWLRQ RI WKH $GKO SURPRWHU WKH $GKO FRGLQJ UHJLRQ DQG LQWURQV ZHUH UHPRYHG DQG VXEVWLWXWHG E\ WKH FRGLQJ UHJLRQ RI WKH JHQH RI 7ULJKW S7LOf .DUFKHU HW DL :LQWHU HW DL f DV VKRZQ LQ )LJ 7KLV JHQH VR QDPHG EHFDXVH LW SURGXFHV DQ DSSUR[LPDWH ES WUDQVFULSW ZDV HQOLVWHG DV D UHSRUWHU JHQH IRU WKH $GKO SURPRWHU EHFDXVH RI WKH ODFN RI LQWHUIHULQJ UHVWULFWLRQ VLWHV ZLWKLQ WKH FRGLQJ UHJLRQ DQG WKH DEVHQFH RI LQWURQV ZLWKLQ WKH UHVXOWLQJ WUDQVFULSW ,Q RUGHU WR PRUH DFFXUDWHO\ TXDQWLI\ WUDQVFULSWLRQ IURP WKH SURPRWHU PXWDQWV LQ VXQIORZHU WXPRUV DQ LQWHUQDO VWDQGDUG RI PHDVXUHPHQW ZDV DSSOLHG DV XWLOL]HG E\ 0F.QLJKW DQG .LQJVEXU\ f DQG %UXFH DQG *XUOH\ f 7KLV PHWKRG RI TXDQWLILFDWLRQ FRQVLVWV RI LQFRUSRUDWLQJ WZR KRPRORJRXV JHQHV LQWR 7'1$ ZKLFK DUH WUDQVIHUUHG LQ HTXDO QXPEHU LQWR WKH JHQRPH RI WKH UHFLSLHQW KRVW 7KH '1$ VHTXHQFH FRPSRVLWLRQ RI RQH JHQH UHPDLQHG FRQVWDQW DQG LV UHIHUUHG WR DV WKH UHIHUHQFH JHQH 7KH VHFRQG JHQH UHIHUUHG WR DV WKH WHVW JHQH FDQ EH PXWDWHG LQ YLWUR DQG LQFRUSRUDWHG LQWR WKH JHQRPH RI VXQIORZHU DORQJ ZLWK WKH UHIHUHQFH JHQH 7HVW DQG UHIHUHQFH WUDQVFULSWV ZHUH GLVWLQJXLVKHG E\ WKH SUHVHQFH RI D EDVH LQVHUW LQWR WKH WHVW JHQH n XQWUDQVODWHG OHDGHU 7KXV P51$ HQFRGHG E\ WKH WHVW JHQH FRXOG EH GLUHFWO\ FRPSDUHG WR WKH WUDQVFULSWLRQ SURGXFWV RI WKH UHIHUHQFH JHQH

PAGE 62

0DWHULDOV DQG 0HWKRGV 0DL]H $GKO n DQG n GHOHWLRQV &RQVWUXFWLRQ RI WKH WHVW DQG UHIHUHQFH JHQHV UHTXLUHG WKH FRQVWUXFWLRQ RI n GHOHWLRQV ZLWK WKH HQG SRLQWV ZLWKLQ WKH XQWUDQVODWHG OHDGHU VHTXHQFH RI $GKO 3ODVPLGV SJf FRQWDLQLQJ WKH HQWLUH SURPRWHU DQG WKH ILUVW ES RI WKH FRGLQJ UHJLRQ ZHUH OLQHDUL]HG DW D XQLTXH 6VULO VLWH f 7KH OLQHDUL]HG IUDJPHQW ZDV VXVSHQGHG LQ LO RI 7( P0 7ULV+&O S+ ,P0 ('7$f DQG SL RI D %DO UHDFWLRQ EXIIHU P0 7ULV+&O S+ P0 0J&O P0 &D&O DQG 0 1D&Of ZDV DGGHG 7KH PL[WXUH ZDV SODFHG LQ D r& ZDWHU EDWK IRU DSSUR[LPDWHO\ PLQXWHV EHIRUH DGGLQJ SL 8POf RI H[RQXFOHDVH %DO %HWKHVGD 5HVHDUFK /DERUDWRULHVf $OLTXRWV RI SL ZHUH VXEVHTXHQWO\ WUDQVIHUUHG WR VHSDUDWH 0LFURIXJH WXEHV FRQWDLQLQJ SL RI P0 (*7$ JLYLQJ D ILQDO (*7$ FRQFHQWUDWLRQ RI P0f DW DQG VHFRQG LQWHUYDOV LQ RUGHU WR VWRS WKH H[RQXFOHDVH UHDFWLRQ (DFK WXEH ZDV LPPHGLDWHO\ SODFHG LQ D r& ZDWHU EDWK IRU PLQXWHV WR IXUWKHU DUUHVW WKH UHDFWLRQ 7KH ILYH DOLTXRWV ZHUH SRROHG H[WUDFWHG RQFH ZLWK DQ HTXDO YROXPH RI SKHQROFKORURIRUP DQG RQFH ZLWK DQ HTXDO YROXPH RI FKORURIRUP 7KH '1$ ZDV WKHQ HWKDQROSUHFLSLWDWHG ,QWHUQDO GHOHWLRQV RI WKH DQDHURELF UHVSRQVH HOHPHQW $5(f DQG WKH n SURPRWHU GHOHWLRQ PXWDWLRQV ZHUH VLPLODUO\ SURGXFHG 5HPRYDO RI WKH $5( LQYROYHG D n %DO H[RQXFOHDVH GLJHVWLRQ RI WKH WHVW JHQH DW D XQLTXH 3VWO UHVWULFWLRQ VLWH f 3URPRWHU PXWDWHG n GHOHWLRQV RI WKH $GKO WHVW JHQH FKLPHULF FRQVWUXFW ZHUH VLPLODUO\ JHQHUDWHG 7HVW JHQH FKLPHULFV LQ D S8& YHFWRU ZHUH RSHQHG DW XQLTXH %DP+O f RU;EDO f VLWHV DQG GHOHWLRQV REWDLQHG ZLWK WKH %DO H[RQXFOHDVH UHDFWLRQV DV SUHYLRXVO\ GHVFULEHG ZLWK WKH H[FHSWLRQ WKDW UHDFWLRQ LQWHUYDOV ZHUH DQG PLQXWHV $Q\ n RYHUKDQJV JHQHUDWHG E\ WKH H[RQXFOHDVH DFWLYLW\ RI WKH GLIIHUHQW %DO GLJHVWLRQV ZHUH VXEMHFWHG WR ILOO LQ UHDFWLRQV DQG OLQNHU DGGLWLRQ 0DQLDWLV HWDO f WKH n SURPRWHU GHOHWLRQV ZLWK ;KRO OLQNHUV %LR 5DGf DQG WKH $5( GHOHWLRQ ZLWK 3VWO OLQNHUV

PAGE 63

%5/f (QG SRLQWV RI WKH GHOHWLRQV ZHUH HVWLPDWHG E\ VL]LQJ RQ DQ b SRO\DFU\ODPLGH JHO DQG FRPSDUHG WR VWDQGDUG VL]H PDUNHUV 7KH HQG SRLQWV RI $GKO SURPRWHU n GHOHWLRQV IRU FRQVWUXFWLRQ RI WHVW DQG UHIHUHQFH JHQHV ZHUH DOVR GHWHUPLQHG E\ VL]LQJ RQ DQ b SRO\DFU\ODPLGH JHO 7KH DFWXDO $GKOOt2 MXQFWLRQV DQG LGHQWLILFDWLRQ RI $5( FRQVWUXFWLRQV ZHUH VXEVHTXHQWO\ GHWHUPLQHG E\ 0O VHTXHQFH DQDO\VLV 0O VHTXHQFH DQDO\VLV /RFDOL]DWLRQ RI WKH WHVW DQG UHIHUHQFH JHQH $GKO SURPRWHU FRGLQJ MXQFWLRQV DQG WHVW JHQH SURPRWHU PXWDWLRQV ZHUH GHWHUPLQHG E\ 0 FORQLQJGLGHR[\ VHTXHQFLQJ 6DQJHU HW DO f &KLPHULF WHVW DQG UHIHUHQFH JHQHV ZHUH H[FLVHG IURP S GRXEOH JHQH YHFWRUV XVHG LQ WULSDUWLWH PDWLQJV 7KHVH JHQHV ZHUH VXEFORQHG LQWR 0 VWUDLQ PSO RU PSO DQG VHTXHQFHG WR FRQILUP WKH LGHQWLW\ RI PXWDWLRQV 7UDQVIHU DQG LQFRUSRUDWLRQ RI $GKO,62 FKLPHULF WHVW DQGRU UHIHUHQFH JHQHV LQWR WKH 7L SODVPLG 7ULSDUWLWH PDWLQJV &RPDL HW DO )UDOH\ HW DO f ZHUH DV SUHYLRXVO\ GHVFULEHG LQ FKDSWHU ZLWK WKH IROORZLQJ PRGLILFDWLRQV ( FROL VWUDLQ /( UHFa ZDV XVHG WR KDUERU ERWK WKH LQWHUPHGLDWH VKXWWOH YHFWRUV DQG WKH KHOSHU SODVPLG S5. 'LWWD HW DO f 7KH $JUREDFWHULXP WXPHIDFLHQV PXWDQW $J VWUUNQUf %UXFH DQG *XUOH\ f ZDV WKH UHFLSLHQW VWUDLQ LQ PDWLQJ HYHQWV 7KLV PXWDQW VWUDLQ KDV WKH HQGRJHQRXV JHQH GHOHWHG IURP 7ULJKW RI WKH 7LSODVPLG DQG UHSODFHG E\ D NDQDP\FLQ UHVLVWDQW JHQH IURP WUDQVSRVRQ 7Q 5RWKVWHLQ HW DO f 2YHUQLJKW FXOWXUHV RI $J ZHUH JURZQ LQ /% FRQWDLQLQJ VWUHSWRP\FLQ _LJPOf DQG NDQDP\FLQ _LJPOf 7ZR PLOOLOLWHU DOLTXRWV RI HDFK RI WKH RYHUQLJKW FXOWXUHV ZHUH FHQWULIXJHG DW URRP WHPSHUDWXUH DQG WKH FHOOV ZHUH ZDVKHG WZLFH ZLWK VWHULOH P0 0J6 7KH ( FROL FHOOV ZHUH UHVXVSHQGHG LQ PLV RI /% FRQWDLQLQJ QR DQWLELRWLF DQG JURZQ WR ORJ SKDVH KUf LQ D VKDNLQJ r& ZDWHU EDWK DW USP 7KH $J FHOOV

PAGE 64

ZHUH UHVXVSHQGHG LQ PO RI /% ZLWK QR DQWLELRWLF (TXDO SRUWLRQV SLVf RI WKH WZR ( FROL FXOWXUHV KDUERULQJ WKH VKXWWOH YHFWRU DQG WKH KHOSHU SODVPLG DQG $J ZHUH PL[HG LQ D 0LFURIXJH WXEH 7KH FHOOV ZHUH SHOOHWHG VHFRQGVf UHVXVSHQGHG LQ _LO RI /% DQG VSRWWHG LQ WKH FHQWHU RI DQ /% DJDU SODWH IRU PDWLQJ KUV r&f 6HOHFWLRQ RI $JUREDFWHULXP ZLWK WKH LQFRUSRUDWHG FKLPHULF JHQHV ZHUH DV SUHYLRXVO\ GHVFULEHG LQ FKDSWHU ZLWK WKH H[FHSWLRQ WKDW WKH VHOHFWLRQ SODWHV DOVR FRQWDLQHG NDQDP\FLQ SJPOf 5HVXOWLQJ FRORQLHV ZHUH WUDQVIHUUHG WR /% FRQWDLQLQJ WKH WKUHH DQWLELRWLFV VWUHSWRP\FLQ MLJPOf FKORUDPSKHQLFRO SJPOf DQG NDQDP\FLQ SJPOf 7UDQVFRQMXJDQWV ZHUH UHVHOHFWHG E\ JURZWK GD\Vf LQ /% FRQWDLQLQJ DQWLELRWLFV VWUHSWRP\FLQ LJPO NDQDP\FLQ LJPO DQG FKORUDPSKHQLFRO LJPOf 7XPRU IRUPDWLRQ DQG DQDHURELF VWUHVV ,QRFXODWLRQ RI VXQIORZHU +HOLDQWKXV DQQXV FY /DUJH *UH\f VHHGOLQJV ZLWK $JUREDFWHULXP KDUERULQJ WKH PRGLILHG 7'1$ RI WKH 7LSODVPLGV ZHUH DV SUHYLRXVO\ GHVFULEHG LQ FKDSWHU PDWHULDOV DQG PHWKRGVf 7XPRU WLVVXH FRQWDLQLQJ HDFK FRQVWUXFW ZDV HLWKHU LQGXFHG IRU VL[ KU DQG IUR]HQ RU ZHUH IUR]HQ LPPHGLDWHO\ XSRQ KDUYHVWLQJ XQLQGXFHGf $QDO\VLV RI WUDQVJHQLF H[SUHVVLRQ 3RO\$f51$ ZDV FROOHFWHG IURP WKH GLIIHUHQW WXPRU WLVVXH DV GHVFULEHG LQ PDWHULDOV DQG PHWKRGV RI FKDSWHU 6 QXFOHDVH K\EULG SURWHFWLRQ PDSSLQJ ZDV XWLOL]HG LQ DQDO\]LQJ UHODWLYH WUDQVFULSWLRQ OHYHOV 7KH SUREH HPSOR\HG LQ WKLV DQDO\VLV ZDV D ES HQG ODEHOHG +SDOO IUDJPHQW RI WKH WHVW JHQH VHH WH[Wf VHSDUDWHG DQG LVRODWHG IURP DQ b SRO\DFU\ODPLGH JHO 7KH 6 QXFOHDVH UHDFWLRQV ZHUH DV SUHYLRXVO\ GHVFULEHG ZLWK WKH H[FHSWLRQ WKDW XQLWVPO RI HQ]\PH %5/f ZDV XVHG SHU UHDFWLRQ DW URRP WHPSHUDWXUH

PAGE 65

5HVXOWV &RQVWUXFWLRQ RI WHVW DQG UHIHUHQFH JHQHV 7KH WZR FKLPHULF FRQVWUXFWV WR EH XWLOL]HG DV WKH WHVW DQG WKH UHIHUHQFH JHQHV ZHUH FORQHG DV LOOXVWUDWHG LQ ILJXUH 7KH LQLWLDO VWHS LQYROYHG WKH H[FLVLRQ RI PDL]H $GKO JHQRPLF VHTXHQFHV IURP S% 'HQQLV HW DO f SRVVHVVLQJ EDVH SDLUV ESf RI WKH n IODQNLQJ UHJLRQ WKH OHDGHU VHTXHQFHV DQG WKH ILUVW ES RI WKH WUDQVFULSW FRGLQJ UHJLRQ ZLWK LWV VXEVHTXHQW LQVHUWLRQ LQWR WKH SRO\OLQNHU RI S8& 7KLV VHFRQG SODVPLG ZDV WKHQ RSHQHG ZLWKLQ WKH UHJLRQ UHVSRQVLEOH IRU HQFRGLQJ WKH ILUVW H[RQ RI WKH WUDQVFULSW DW D XQLTXH 6V,, UHVWULFWLRQ VLWH ORFDWHG DW ZKLFK LV ES GRZQVWUHDP RI WKH $7* WUDQVODWLRQ LQLWLDWLRQ FRGRQ f 7KLV OLQHDUL]HG '1$ IUDJPHQW ZDV WKHQ FKHZHG EDFN LQWR WKH XQWUDQVODWHG OHDGHU VHTXHQFH n WR $7*f E\ WKH H[RQXFOHLF DFWLYLW\ RI %DO ZLWK WKH VXEVHTXHQW DGGLWLRQ RI ;KRO OLQNHUV 7KH SURPRWHU DQG UHPDLQLQJ OHDGHU VHTXHQFHV ZLWKLQ WKH %DP8O f WR ;KRO OLQNHUHG IUDJPHQWV SURGXFHG E\ WKLV PDQLSXODWLRQ ZHUH WKHQ OLJDWHG XSVWUHDP RI WKH 7'1$ JHQH FRGLQJ VHTXHQFHV FDUULHG ZLWKLQ D S8& SODVPLG YHFWRU S8&n GHOf %UXFH DQG *XUOH\ f 7KH UHVXOWLQJ FKLPHULF FRQVWUXFWV ZHUH VHTXHQFHG WKURXJK WKH $GKO SURPRWHU JHQH MXQFWLRQ ZKHUHXSRQ WZR OLNHO\ FDQGLGDWHV WR EH XWLOL]HG DV WKH WHVW DQG UHIHUHQFH FKLPHULF JHQHV ZHUH LGHQWLILHG )LJ f 7KH FKLPHULF JHQH XVHG DV D WHVW JHQH FRQVLVWHG RI WKH $GKO SURPRWHU ;KRO OLQNHUHG ZLWKLQ WKH OHDGHU VHTXHQFH DW DQG SRVLWLRQHG XSVWUHDP RI WKH FRGLQJ UHJLRQ )LJ &f $ VHFRQG FKLPHULF JHQH XVHG DV WKH UHIHUHQFH JHQH ZDV FRPSULVHG RI WKH $GKO SURPRWHU SRVVHVVLQJ VHTXHQFHV WR EDVH SDLUV LQWR WKH OHDGHUf VLWXDWHG GLUHFWO\ XSVWUHDP WR WKH FRGLQJ VHTXHQFHV ZLWK QR LQWHUYHQLQJ OLQNHUV )LJ &f 7KH UHDVRQ WKLV SDUWLFXODU FRQVWUXFW ODFNV WKH ;KRO6DOO OLQNHUHG MXQFWLRQ LV QRW NQRZQ EXW WKLV FRQILJXUDWLRQ RI VHTXHQFHV DFKLHYHG WKH GHVLUHG REMHFWLYH RI DOWHULQJ WKH OHDGHU VHTXHQFHV FRPSDUHG WR WKRVH RI WKH WHVW JHQH DQG ZDV DGYDQWDJHRXV WR WKH GHVLUHG

PAGE 66

)LJ &RQVWUXFWLRQ RI WHVW DQG UHIHUHQFH JHQHV 6KDGHG UHJLRQV RI SODVPLGV UHSUHVHQW '1$ IUDJPHQWV KDUERULQJ HLWKHU $GKO RU WKH WUDQVFULEHG UHJLRQ RI WKH 7'1$ JHQH 3ODVPLG S% LV GHVFULEHG LQ FKDSWHU DQG S8&n GHO LV D S8& GHULYDWLYH FRQWDLQLQJ WKH ES OHDGHU FRGLQJ VHTXHQFHV DQG DERXW NE RI f IODQNLQJ VHTXHQFHV RI WKH JHQH %UXFH DQG *XUOH\ f ,PSRUWDQW UHVWULFWLRQ VLWHV DUH DV ODEHOHG WKH QXPEHUV LQ SDUHQWKHVLV GHVLJQDWH SRVLWLRQ ZLWK UHIHUHQFH WR WKH $GKO WUDQVFULSWLRQ VWDUW VLWH DQG LGHQWLI\ WKH VWDUW VLWH 2ULHQWDWLRQ RI WUDQVFULSWLRQ RI JHQHV DUH GHVLJQDWHG E\ DUURZV ZLWKLQ SODVPLGV /HJHQG $SU DPSHFLOOLQ UHVLVWDQFH 6; XQLRQ RI 6DLO DQG ;KRO UHVWULFWLRQ VLWHV E\ OLJDWLRQ

PAGE 67

&KLPHULF 7HVW JHQH PDL]H $GKO SURPRWHU FRGLQJ OLQNHU VHTXHQFHV ***7&7&**$*7**$7&*$777**& &&&$*$*&&7& $&&7 $*&7$$$&&& &&7&*$&&&*&&$7&*$$$ **$*&7*&*&**7$*&777 &KLPHULF 5HIHUHQFH JHQH PDL]H $GKO SURPRWHU ES GLIIHUHQFH ? FRGLQJ ? VHTXHQFHV f r f ***7&7&**$*7&&$7&*$$$&$7&*$*&$$ &&&$*$*&&7&$S**7$*&777*7$*&7&*77 r )LJ 6HTXHQFH LGHQWLILFDWLRQ RI FKLPHULF FRQVWUXFWV WR EH XVHG DV WKH WHVW JHQH $f DQG WKH UHIHUHQFH JHQH %f 3DQHO & FRPSDUHV GLIIHUHQFH EHWZHHQ WKH WHVW DQG UHIHUHQFH JHQHV DW WKH $GKO SURPRWHU FRGLQJ UHJLRQ MXQFWLRQ 6KDGHG UHJLRQ KLJKOLJKWV WKH ES GLIIHUHQFH EHWZHHQ WKH WZR FRQVWUXFWV %R[HG VHTXHQFHV UHSUHVHQW OLJDWLRQ RI 6DO DQG ;KR OLQNHUV 8QGHUOLQHG VHTXHQFHV ZLWKLQ ER[ LQGLFDWH FRPSOHPHQWDU\ EDVHV RI WKH WZR OLQNHUV

PAGE 68

RXWFRPH 7KH WHVW JHQH KDV EDVH SDLUV DW WKH $GKOO62 MXQFWLRQ WKDW WKH UHIHUHQFH JHQH GRHV QRW SRVVHVV $QDO\VLV RI WHVW DQG UHIHUHQFH JHQH SURGXFWV 7KH UHIHUHQFH JHQH DQG WKH WHVW JHQH ZHUH HDFK FORQHG LQWR WKH VKXWWOH YHFWRU S: DV GHVFULEHG LQ FKDSWHU &RQVWUXFWLRQ RI WKH GRXEOH JHQH UHIHUHQFH YHFWRU UHTXLUHG WKDW WKH UHIHUHQFH JHQH EHFRPH D SHUPDQHQW UHVLGHQW RI WKH VKXWWOH YHFWRU ZKLOH PDLQWDLQLQJ XQLTXH VLWHV IRU WKH LQVHUWLRQ RI D WHVW JHQH 7KLV UHTXLUHG WKDW WKH S8&GHULYHG SODVPLG S$GK5 KDUERULQJ WKH UHIHUHQFH JHQH EH RSHQHG DW WKH %DP8O f UHVWULFWLRQ VLWH DQG FKDQJHG WR D 6DLO VLWH E\ WKH DGGLWLRQ RI OLQNHUV 7KLV FRQVWUXFW ZDV LWVHOI GRXEOH GLJHVWHG ZLWK 6DLO DQG 6SKO UHVWULFWLRQ HQGRQXFOHDVHV ZKHUHXSRQ WKH HQWLUH FKLPHULF UHIHUHQFH JHQH ZDV LVRODWHG DQG VXEFORQHG LQWR OLNH UHVWULFWLRQ VLWHV LQ S: JLYLQJ ULVH WR WKH UHIHUHQFH JHQH VKXWWOH YHFWRU S5HI: )LJ f 7KH UHIHUHQFH JHQH ZDV SRVLWLRQHG LQ WKLV VKXWWOH YHFWRU VXFK WKDW WKH f PRVW UHJLRQ RI WKH SURPRWHU ZDV DGMDFHQW WR VHTXHQFHV GHULYHG IURP S$&<& &KDQJ DQG &RKHQ f DQG WKH FRGLQJ UHJLRQ LV XSVWUHDP RI WKH 7'1$ SRUWLRQ 6LPLODUO\ WKH WHVW JHQH KDUERUHG ZLWKLQ S8& S$GK7f ZDV LVRODWHG DIWHU UHVWULFWLRQ GLJHVWLRQV DW %DP:O DQG +LQGOOO DQG WKHQ VXEFORQHG LQWR S: JLYLQJ ULVH WR WKH WHVW JHQH VKXWWOH YHFWRU S7HVW: )LJ f 7KLV VHFRQG VKXWWOH YHFWRU GLIIHUHG IURP S5HI: LQ WKH SRVLWLRQ DQG ORFDWLRQ DW ZKLFK WKH $GKO FKLPHULF FRQVWUXFW ZDV LQVHUWHG 7KH SURPRWHU VHTXHQFHV ZHUH DGMDFHQW WR WKH 7 '1$ UHJLRQ RI S: DQG WKH S$&<& VHTXHQFHV ZHUH LQ WXUQ GRZQVWUHDP RI WKH WHVW JHQH FRGLQJ UHJLRQ 7KHVH WZR VKXWWOH YHFWRUV ZHUH LQFRUSRUDWHG LQ VHSDUDWH H[SHULPHQWV LQWR WKH 7'1$ 7OHIWf RI WKH $J 7LSODVPLG DQG WUDQVIHUUHG WR WKH JHQRPH RI VXQIORZHU VHHGOLQJV IURP ZKLFK UHVXOWLQJ WXPRU WLVVXH ZDV KDUYHVWHG 3ULPDU\ WXPRU WLVVXH SRVVHVVLQJ HDFK RI WKH FRQVWUXFWV ZHUH HLWKHU XQLQGXFHG QR DQDHURELF VWUHVVf RU VXEMHFWHG WR DQ DQDHURELF HQYLURQPHQW IRU KU LQGXFHGf 7UDQVFULSWLRQ SURGXFWV IURP HDFK WXPRU WLVVXH W\SH ZHUH WKHQ VXEMHFWHG WR 6 K\EULGL]DWLRQ DQDO\VLV

PAGE 69

V[ 6DO , 6SK? f LVRODWH IUDJPHQW 7 6DO 6SWO )LJ &RQVWUXFWLRQ RI WKH S5HI: VKXWWOH YHFWRU KDUERULQJ WKH UHIHUHQFH JHQH /RFDWLRQ DQG WUDQVFULSWLRQDO RULHQWDWLRQ RI UHSUHVHQWHG JHQHV DUH GHVLJQDWHG E\ DUURZV ZLWKLQ SODVPLGV 2ULJLQ RI '1$ IRU HDFK SODVPLG DQG LPSRUWDQW UHVWULFWLRQ VLWHV DUH DV ODEHOHG 1XPEHUV ZLWKLQ SDUHQWKHVLV GHVLJQDWH SRVLWLRQ RI UHVWULFWLRQ VLWHV ZLWKLQ RFWRSLQHW\SH $ WXPHIDFLHQV 7'1$ %DUNHU HW DO f /HJHQG &SU FKORUDPSKHQLFRO UHVLVWDQFH 6; 6DOO;KRO MXQFWLRQ RFV D DQG E DUH 7'1$ JHQHV RI $ WXPHIDFLHQV :LOOPLW]HU HW DO f *HQHV ZLWK GRWWHG OLQHV JHQH DQG RFVf ODFN SURPRWHU VHTXHQFHV

PAGE 70

%DP +, +LQ GLOO f LVRODWH IUDJPHQW 6; )LJ &RQVWUXFWLRQ RI WKH S7HVW: VKXWWOH YHFWRU KDUERULQJ WKH WHVW JHQH ,PSRUWDQW UHJLRQV DQG SDUDPHWHUV DUH DV SUHYLRXVO\ GHVFULEHG

PAGE 71

6, K\EULG SURWHFWLRQ PDSSLQJ ZDV HPSOR\HG WR DFFXUDWHO\ TXDQWLI\ SURPRWHU DFWLYLW\ RI PXWDWHG WHVW JHQHV 7KH SUREH HPSOR\HG LQ WKHVH H[SHULPHQWV ZDV D EDVH SDLU +SDOO '1$ IUDJPHQW LVRODWHG IURP WKH WHVW JHQH DQG HQG ODEHOHG ,W FRPSULVHG EDVHV H[WHQGLQJ XSVWUHDP RI WKH UHFRJQL]HG VWDUW RI WUDQVFULSWLRQ RI WKH $GKO SURPRWHU EDVH SDLUV RI WKH $GKO OHDGHU EDVH SDLUV IURP WKH DGGHG 6DLO DQG ;KRO OLQNHUV D VLQJOH QRQWUDQVFULEHG EDVH f DQG WKH ILUVW ES RI WKH WUDQVFULEHG UHJLRQ RI WKH JHQH )LJ f 7KH 6, SURWHFWLRQ VWUDWHJ\ UHTXLUHG WUDQVFULSWV SURGXFHG E\ WKH WHVW JHQH LQ VXQIORZHU WXPRUV WR K\EULGL]H DQG SURWHFW EDVHV RI WKH HQG ODEHOHG '1$ SUREH WR WKH $GKO VWDUW RI WUDQVFULSWLRQ )LJ $f ,Q FRQWUDVW WUDQVFULSWV FRGHG IRU E\ WKH UHIHUHQFH JHQH ERXQG WKH VDPH SUREH EXW GXH WR WKH ODFN RI FRPSOHPHQWDU\ EDVHV ZLWKLQ WKH WHVW WUDQVFULSW EDVHV RI WKH SUREH ORRSHG RXW 7KLV VLQJOH VWUDQGHG ORRS H[SRVHG WKHVH QRQFRPSOHPHQWDU\ EDVHV RI WKH SUREH WR 6 QXFOHDVH DWWDFN SURGXFLQJ WZR SURWHFWHG IUDJPHQWV DQG EDVHV LQ OHQJWK ZLWK RQO\ WKH EDVH IUDJPHQW EHLQJ HQG ODEHOHG )LJ %f 7KH UHIHUHQFH JHQH DQG WKH WHVW JHQH WKDW KDG EHHQ VXEFORQHG LQWR VHSDUDWH VKXWWOH YHFWRUV )LJV DQG f ZHUH VHSDUDWHO\ LQWHJUDWHG LQWR WKH 7'1$ RI D PXWDWHG IRUP RI $JUREDFWHULXP WXPHIDFLHQV $Jf LQ ZKLFK WKH HQGRJHQRXV JHQH RI 7 ULJKW KDG EHHQ H[FLVHG DQG D NDQDP\FLQ UHVLVWDQW JHQH VXEVWLWXWHG DW WKLV SRVLWLRQ %UXFH DQG *XUOH\ f 7KLV ODFN RI WKH HQGRJHQRXV JHQH QHJDWHG DQ\ LQWHUIHUHQFH LQ DQDO\VLV RI WKH WUDQVFULSWLRQ SURGXFWV RI WKH WHVW DQG UHIHUHQFH JHQHV 0HVVHQJHU 51$ FROOHFWHG IURP KU DQDHURELFDOO\ VWUHVVHG VXQIORZHU WXPRUV WKDW KDG EHHQ LQIHFWHG E\ WKH $JUREDFWHULXP VHSDUDWHO\ KDUERULQJ HLWKHU RI WKHVH WZR FRQVWUXFWV ZHUH GLVWLQJXLVKDEOH IURP HDFK RWKHU LQ WKH SUHGLFWHG PDQQHU ZKHQ VXEMHFWHG WR 6, QXFOHDVH PDSSLQJ )LJ f 7KH WUDQVFULSWV SURGXFHG E\ WKH WHVW JHQH SURWHFWHG EDVHV RI WKH SUREH ZLWK QR EDQG DSSHDULQJ DW WKH ORFDWLRQ SUHGLFWHG IRU WKH UHIHUHQFH JHQH )LJ ODQH f 7KLV VXJJHVWV WKDW WKH FKLPHULF WHVW JHQH XWLOL]HG WKH VDPH WUDQVFULSWLRQ VWDUW VLWH LQ VXQIORZHU WXPRUV DV WKH HQGRJHQRXV $GKO JHQH LQ PDL]H DQG WXPRU FHOOV VHH FKDSWHU f 0HVVHQJHU

PAGE 72

)LJ 6, QXFOHDVH K\EULGL]DWLRQ SURWHFWLRQ VWUDWHJ\ IRU WKH WHVW DQG UHIHUHQFH JHQH $f 3URWHFWLRQ E\ WUDQVFULSWV SURGXFHG E\ WHVW JHQH %f 3URWHFWLRQ E\ WUDQVFULSWV SURGXFHG E\ UHIHUHQFH JHQH 7KH '1$ HQG ODEHOHG SUREH LV D +SDOO IUDJPHQW LVRODWHG IURP WKH WHVW JHQH WKLFN EODFN UHJLRQ FRPSOHPHQWDU\ WR VHTXHQFHV ZKLWH UHJLRQ UHSUHVHQWV $GKO OHDGHU VHTXHQFHV DQG VKDGHG UHJLRQ WKH OLQNHU VHTXHQFHV QRW SUHVHQW LQ UHIHUHQFH JHQH 6 QXFOHDVH DFWLYLW\ UHSUHVHQWHG E\ VPDOO DUURZV

PAGE 73

6 QXFOHDVH ‘ , 7HVW JHQH P51$ , '1$ SUREHA ? '1$ SUREH W ES 6 QXFOHDVH % Wn$f§ '1$ SUREH 5HIHUHQFH JHQH P51$ '1$ SUREH 2V 21 ES ES

PAGE 74

)LJ 6, QXFOHDVH K\EULGL]DWLRQ DQDO\VLV RI WKH UHIHUHQFH JHQH DQG WKH WHVW JHQH +\EULGL]DWLRQ RI HQG ODEHOHG '1$ SUREH SUHYLRXVO\ GHVFULEHG ZDV ZLWK ODQHV DQG f RU ODQH f RI SRO\$f51$ LVRODWHG IURP WR JUDPV RI VXQIORZHU WXPRU WLVVXH 3RO\$f51$ ZDV FROOHFWHG IURP XQLQGXFHG WXPRUV KDUERULQJ WKH UHIHUHQFH JHQH ODQH f DQG LQGXFHG WXPRUV SRVVHVVLQJ WKH UHIHUHQFH JHQH ODQHV DQG f RU WKH WHVW JHQH ODQH f 3URWHFWHG IUDJPHQW DUH GHVLJQDWHG /DQH ff FRQWDLQV HQG ODEHOHG +DH,, JHQHUDWHG ff; PDUNHUV ZLWK VL]H GHVLJQDWLRQV

PAGE 75

51$ IURP WXPRUV KDUERULQJ WKH UHIHUHQFH JHQH LQ WXUQ SURWHFWHG EDVHV RI WKH HQG ODEHOHG SUREH )LJ ODQHV DQG f LQGLFDWLQJ WKDW WKH EDVH ORRS RI WKH SUREH ZDV GHJUDGHG E\ 6, QXFOHDVH DFWLYLW\ 1R WUDQVFULSW SURWHFWLRQ ZDV REVHUYHG IRU UHIHUHQFH JHQH SURGXFWV IURP XQLQGXFHG WXPRU WLVVXH )LJ ODQH f 7KHVH H[SHULPHQWV LQGLFDWH WKDW QRW RQO\ ZDV WKH QDWXUDO WUDQVFULSWLRQ VWDUW VLWH RI WKH $GKO FKLPHULF FRQVWUXFWV VWLOO UHFRJQL]HG LQ VXQIORZHU FHOOV EXW WKH SURPRWHU ZDV VWLOO UHVSRQVLYH WR DQDHURELF VWUHVV 7KHVH SUHOLPLQDU\ H[SHULPHQWV GHPRQVWUDWHG WKDW WKH WUDQVFULSW SURGXFWV RI HDFK RI WKHVH JHQHV FRXOG EH GLIIHUHQWLDWHG E\ K\EULG SURWHFWLRQ PDSSLQJ XVLQJ D VLQJOH '1$ SUREH $QDO\VLV RI WHVW JHQH SURPRWHU PXWDWLRQV $V D ILUVW VWHS LQ WKH LGHQWLILFDWLRQ RI FVHOHPHQWV ZLWKLQ WKH $GKO SURPRWHU D QXPEHU RI n GHOHWLRQV RI WKH WHVW JHQH ZHUH FRQVWUXFWHG DQG DVVD\HG LQ VXQIORZHU 7ZR RI WKHVH PXWDQW FRQVWUXFWV XWLOL]HG XQLTXH UHVWULFWLRQ VLWHV ZLWKLQ WKH SURPRWHU ;ED? f DQG 3VWO f 7KH LQLWLDO GHOHWLRQ FRQVWUXFW LQYROYHG WKH GLJHVWLRQ RI WKH S8& YHFWRU KDUERULQJ WKH WHVW JHQH S$GK7 ZLWK ;EDO DQG WKH VXEVHTXHQW DGGLWLRQ RI 6DLO OLQNHUV WR WKLV VLWH 7KLV FRQVWUXFW ZDV WKHQ GRXEOHGLJHVWHG ZLWK HQGRQXFOHDVHV 6DLO DQG PGOOO DQG VXEFORQHG LQWR WKH SRO\OLQNHU RI S8& JLYLQJ ULVH WR S$GK7 )LJ $f 7KHVH PDQLSXODWLRQV UHVXOWHG LQ D WHVW JHQH SRVVHVVLQJ ES RI WKH PRVW SUR[LPDO XSVWUHDP VHTXHQFHV WR WKH VWDUW RI WUDQVFULSWLRQ DORQJ ZLWK WKH DFTXLVLWLRQ RI UHVWULFWLRQ VLWHV IURP WKH SRO\OLQNHU RI S8& LPPHGLDWHO\ XSVWUHDP WR WKH JHQH 3DUWLFXODUO\ LPSRUWDQW ZDV WKH %DP+O VLWH RI WKH SRO\OLQNHU WKDW ZDV QHFHVVDU\ IRU VXEVHTXHQW FORQLQJ LQWR WKH VKXWWOH YHFWRU $ VLPLODU SURFHGXUH ZDV XVHG WR SURGXFH D GHOHWLRQ WR E\ VXEFORQLQJ D 3VWO f WR mGLOO IUDJPHQW RI S$GK7 LQWR S8& UHVXOWLQJ LQ S$GK7 )LJ %f $GGLWLRQDO n GHOHWLRQV RI WKH WHVW JHQH ZHUH FRQVWUXFWHG E\ %DO H[RQXFOHDVH GLJHVWLRQV LQLWLDWHG DW WKH %DP+O f RU ;EDO f VLWHV RI WKH SURPRWHU S$GK7f ZLWK WKH VXEVHTXHQW DGGLWLRQ RI ;KRO OLQNHUV SURGXFLQJ D VHULHV RI

PAGE 76

3VW 6; )LJ &RQVWUXFWLRQ RI n SURPRWHU GHOHWLRQ WHVW JHQHV S$GK7 WR $f DQG S$GK7 WR %f ,PSRUWDQW VLWHV DQG GHVFULSWLRQV RI SODVPLGV DUH DV SUHYLRXVO\ SUHVHQWHG

PAGE 77

WUXQFDWHG WHVW JHQHV WKDW ZHUH WKHQ VXEFORQHG LQWR WKH6D, DQG mGLOO VLWHV RI S8& )LJ f /RFDWLRQ RI WKH GHOHWLRQV ZHUH HVWLPDWHG E\ FRPSDULVRQ WR Mf; +DH,,, VL]LQJ PDUNHUV RQ b SRO\DFU\ODPLGH JHOV GDWD QRW VKRZQf 7KHVH %DO JHQHUDWHG PXWDQWV UHVXOWHG LQ WHVW JHQHV KDYLQJ n IODQNLQJ VHTXHQFHV H[WHQGLQJ WR DSSUR[LPDWHO\ DQG UHODWLYH WR WKH WUDQVFULSW LQLWLDWLRQ VLWH 8SRQ LQVHUWLRQ LQWR S8& HDFK RI WKH H[RQXFOHDVH JHQHUDWHG n GHOHWLRQ JHQHV REWDLQHG UHVWULFWLRQ VLWHV LQFOXGLQJ %DP+Of DW WKH n HQG SRLQW IURP WKH SRO\OLQNHU )LJ f 7KH HLJKW n GHOHWLRQ WHVW JHQH PXWDQWV DORQJ ZLWK WKH RULJLQDO WHVW JHQH WKDW UHWDLQHG WKH ZLOG W\SH SURPRWHU WR ZHUH VXEFORQHG LQWR WKH %DP+O DQG mGLOO UHVWULFWLRQ VLWHV RI WKH S: VKXWWOH YHFWRU GHULYDWLYH S5HI: )LJ f 7KLV FORQLQJ VWUDWHJ\ UHVXOWHG LQ D GRXEOH JHQH VKXWWOH YHFWRU LOOXVWUDWHG DV S$GK75: LQ ILJXUH f WKDW KDUERUHG WKH UHIHUHQFH JHQH SRVVHVVLQJ WKH ZLOG W\SH $GKO SURPRWHU DORQJ ZLWK D PXWDWHG WHVW JHQH 8SRQ WUDQVIHU LQWR $JUREDFWHULXP DQG LQFRUSRUDWLRQ RI WKH VKXWWOH YHFWRU LQWR WKH 7LSODVPLG ERWK JHQHV DORQJ ZLWK 7'1$ JHQHV RI WKH YHFWRU DUH LQWHJUDWHG LQWR WKH 7'1$ 7KHLU SRVLWLRQ DQG RULHQWDWLRQ ZLWK UHVSHFW WR WKH QDWXUDOO\ RFFXUULQJ JHQHV RI 7OHIW DUH SUHVHQWHG LQ )LJ 7XPRU WLVVXH WKDW IRUPHG DIWHU LQIHFWLRQ RI WKH VXQIORZHU VHHGOLQJV ZLWK WKH GLIIHUHQW GHULYDWLYHV RI $J KDUERULQJ WKH WHVW DQG UHIHUHQFH JHQHV ZHUH DQDHURELFDOO\ VWUHVVHG IRU KU 3RO\$f51$ LVRODWHG IURP WKH WXPRUV ZDV VXEMHFWHG WR 6 SURWHFWLRQ DQDO\VLV DV SUHYLRXVO\ GHVFULEHG 7KH SRO\$f51$ FROOHFWHG IURP DQDHURELFDOO\ VWUHVVHG WXPRU WLVVXH SURWHFWHG GHWHFWDEOH OHYHOV RI WKH HQG ODEHOHG SUREH UHSUHVHQWDWLYH RI ERWK WKH WHVW DQG UHIHUHQFH JHQHV )LJ f 4XDQWLILFDWLRQ HPSOR\HG WKH GLUHFW FRPSDULVRQ RI HDFK RI WKH GLIIHUHQW WHVW JHQH WUDQVFULSWLRQ SURGXFWV ZLWK WUDQVFULSWV SURGXFHG E\ WKH UHIHUHQFH JHQH 7KH UDWLR RI P51$ WUDQVFULEHG E\ WKH WHVW JHQH SRVVHVVLQJ WKH ZLOG W\SH $GKO SURPRWHU f YHUVXV WKH WUDQVFULSWLRQ SURGXFWV RI WKH UHIHUHQFH JHQH DOVR SRVVHVVLQJ WKH $GKO ZLOG W\SH SURPRWHU ZDV DUELWUDULO\ DVVLJQHG D UHODWLYH WUDQVFULSWLRQ OHYHO 57/f YDOXH RI 7KH DYHUDJH WUDQVFULSW OHYHO UDWLRV DQG 57/V RI WKH GLIIHUHQW

PAGE 78

f 3VW f ;ED f ;ED ;KR OLQNHU 6SO +Q GLOO Y ;KR ; +Q GLOO ALVRODWH IUDJPHQW f 3VW ;KR? OLQNHU S8& 6DO +Q GLOO 6; %DP +, ;KR +Q GLOO LVRODWH IUDJPHQW )LJ &RQVWUXFWLRQ RI WHVW JHQH n SURPRWHU GHOHWLRQ VHULHV ,PSRUWDQW VLWHV DQG GHVFULSWLRQV RI SODVPLGV DUH DV SUHYLRXVO\ SUHVHQWHG

PAGE 79

V[ )LJ &RQVWUXFWLRQ RI WKH GRXEOH JHQH VKXWWOH YHFWRU S$GK75: ,PSRUWDQW VLWHV DQG GHVFULSWLRQV RI SODVPLGV DUH DV SUHYLRXVO\ SUHVHQWHG

PAGE 80

)LJ ,QFRUSRUDWLRQ RI WKH GRXEOH JHQH VKXWWOH YHFWRU S$GK75: LQWR 7OHIW RI $ WXPHIDFLHQV 7'1$ $SSUR[LPDWH ORFDWLRQ RI DVVLPLODWLRQ LV GHSLFWHG E\ EDU DERYH 7'1$ DQG YHUWLFDO GRWWHG OLQHV 7KH EODFN UHJLRQ UHSUHVHQWV VHTXHQFHV RI GXSOLFDWHG 7'1$ 7KH VKDGHG UHJLRQ LV WKH '1$ IUDJPHQW WKDW RULJLQDWHG IURP S% KDUERULQJ WKH JHQRPLF $GKO JHQH DQG WKH ZKLWH SRUWLRQ LV WKH EDFWHULDO S$&<& VHTXHQFHV +RUL]RQWDO DUURZV LQGLFDWH ORFDWLRQ DQG GLUHFWLRQ RI WUDQVFULSWLRQ RI LQFRUSRUDWHG JHQHV DQG HQGRJHQRXV 7'1$ JHQHV 6PDOO YHUWLFDO OLQHV DWWDFKHG WR HQG RI DUURZV LQGLFDWH SUHVHQFH RI QDWXUDOO\ RFFXUULQJ n IODQNLQJ VHTXHQFHV 7UDQVFULSW XQLWV DQG HQFRGH HQ]\PHV LQYROYHG LQ SURGXFWLRQ RI WKH DX[LQ LQGROHDFHWLF DFLG 7KRPDVKRZ HW DO f HQFRGHV LVRSHQWHQ\O WUDQVIHUDVH WKH HQ]\PH UHVSRQVLEOH IRU SURGXFWLRQ RI D F\WRNLQLQ %XFKPDQQ HW DO f D GXSOLFDWHGf HQFRGHV D SHUPHDVH UHVSRQVLEOH IRU VHFUHWLRQ RI RSLQHV IURP SODQW FHOO 0HVVHQV HW DO f E GXSOLFDWHG WUDQVFULSWLRQ XQLW IURP VKXWWOH YHFWRU LV QRQIXQFWLRQDO VHH WH[Wf SUREDEOH LQYROYHPHQW LQ WXPRU IRUPDWLRQ LQ QDUURZ KRVW UDQJH +RR\NDDV HW DO f RFV SURGXFW FDWDO\VHV V\QWKHVLV RI RFWRSLQH RFV LQ IURP VKXWWOH YHFWRU ODFNV n IODQNLQJ VHTXHQFHVf DQG WUDQVFULSW XQLWV DQG KDYH XQNQRZQ IXQFWLRQV %LQQV DQG 7KRPDVKRZ IRU UHYLHZf 9HUWLFDO OLQHV ZLWKLQ UHSUHVHQWHG '1$ LQGLFDWH ORFDWLRQ RI %DP:O DQG +LQGOOO UHVWULFWLRQ VLWHV 2SHQ DUURZ KHDGV LQGLFDWH ORFDWLRQ RI RFV HOHPHQW DQG VROLG DUURZ KHDGV LQGLFDWH ORFDWLRQ RI RFVOLNH HOHPHQWV

PAGE 81

! D E } n %DP + +nQ GLOO %DP + +QGOOO

PAGE 82

R f§f§ 0U SUREH UHIHUHQFH )LJ 6, K\EULGL]DWLRQ DVVD\ RI UHIHUHQFH JHQH DQG n GHOHWLRQ WHVW JHQHV (DFK ODQH FRQWDLQV RI WKH SRO\$f51$ LVRODWHG IURP WR JUDPV RI WXPRU WLVVXH WKDW KDG EHHQ VXEMHFWHG WR DQDHURELF VWUHVV IRU KRXUV 7KH VXQIORZHU FHOOV ZHUH LQIHFWHG E\ $ WXPHIDFLHQV ZLWK LQFRUSRUDWHG GRXEOH JHQH VKXWWOH YHFWRU S$GK75: VHH )LJ f /DQH GHVLJQDWLRQV UHSUHVHQW n PRVW SRLQW RI WHVW JHQH SURPRWHU ZLWK UHVSHFW WR VWDUW RI WUDQVFULSWLRQ 3URWHFWHG IUDJPHQWV DUH GHVLJQDWHG

PAGE 83

7$%/( 5HODWLYH 7UDQVFULSWLRQ /HYHOV 57/f RI n 'HOHWLRQ 0XWDQWV n ERUGHU RI WHVW JHQH 1XPEHU RI H[SHULPHQWV 7HVWUHIHUHQFH UDWLR DYJ 57/ n$r n$ n$ n$ n$ f$r n$ n$ n$r AGHOHWLRQ HQGSRLQW GHWHUPLQHG E\ '1$ VHTXHQFLQJ RWKHUV ZHUH HVWLPDWHG E\ SRO\DFU\ODPLGH JHO DQDO\VLV XVLQJ UHVWULFWLRQ IUDJPHQW VL]H PDUNHUV

PAGE 84

PXWDWHG WHVW JHQHV YHUVXV WKH FRQVWDQW UHIHUHQFH JHQH ZHUH WKHQ FDOFXODWHG LQ UHODWLRQ WR WKH DVVLJQHG WKH ZLOG W\SH 7DEOH VXPPDUL]HV WKH UDWLR DQG 57/ YDOXHV IRU HDFK RI WKH n GHOHWLRQ PXWDQWV VXUYH\HG 7KH PRVW QRWDEOH REVHUYDWLRQ FRQFHUQLQJ WKH 57/ YDOXHV IRU WKH n GHOHWLRQ PXWDWLRQV LV WKDW DOO RI WKH 57/V UHPDLQHG UHODWLYHO\ KLJK ,QLWLDOO\ DV n VHTXHQFHV DUH GHOHWHG WKHUH ZDV DQ DFWXDO ULVH LQ WUDQVFULSWLRQDO DFWLYLW\ 5HPRYDO RI DERXW ES n$f RI WKH PRVW GLVWDO n XSVWUHDP VHTXHQFHV LQFUHDVHG DFWLYLW\ DSSUR[LPDWHO\ b DERYH WKDW RI ZLOG W\SH $ PRUH VHYHUH GHOHWLRQ WR SRVLWLRQ n$f ORZHUHG WUDQVFULSWLRQDO DFWLYLW\ WR DQ 57/ YDOXH RI ZKLOH DQ DGGLWLRQDO VPDOO GHOHWLRQ WR UDLVHG WKH 57/ WR WKDW RI ZLOG W\SH 7KH n GHOHWLRQV RI WKH WHVW JHQH SURPRWHU WR DQG UHVXOWHG LQ VLPLODU 57/V UDQJLQJ IURP WR 7KHVH UHVXOWV VXJJHVW WKDW QHJDWLYH HOHPHQWV PD\ H[LVW ZLWKLQ WKH XSVWUHDP VHTXHQFHV RI WKH $GKO SURPRWHU ZLWKLQ WKH VPDOO UHJLRQ EHWZHHQ DSSUR[LPDWHO\f DQG 7KH EDVH SDLUV EHWZHHQ DQG DSSHDU WR EH UHTXLUHG IRU PD[LPXP WUDQVFULSWLRQ ZKHQ WKLV SXWDWLYH QHJDWLYH UHJLRQ LV SUHVHQW VLQFH D GHOHWLRQ WR n$ PDUNHGO\ GHFUHDVHG WKH DFWLYLW\ 8SRQ GHOHWLRQ RI WKH SRWHQWLDO QHJDWLYH UHJLRQ WKH WUDQVFULSW OHYHO ZDV ERRVWHG WR WKDW RI ZLOG W\SH $ VHFRQG SRVVLEOH H[SODQDWLRQ IRU WKLV HIIHFW LV WKDW RI D SRVLWLRQ HIIHFW RI WKH WHVW JHQH ZLWKLQ WKH VKXWWOH YHFWRU 8QOLNH WKH UHIHUHQFH JHQH XWLOL]HG LQ WKHVH H[SHULPHQWV DQG WKH $GKO VLQJOH JHQH DQDO\VLV RI FKDSWHU WKH SURPRWHU RI WKH WHVW JHQHV ZHUH LQVHUWHG LQWR WKH VKXWWOH YHFWRU LQ VXFK D ZD\ DV WR EH SRVLWLRQHG LPPHGLDWHO\ GRZQVWUHDP RI WKH 7'1$ )LJ f $Q\ DFWLYDWRUOLNH VHTXHQFHV ZLWKLQ WKH 7'1$ UHJLRQ ZRXOG EH LQ IDLUO\ FORVH DVVRFLDWLRQ ZLWK WKH WHVW SURPRWHU DQG PD\ KDYH DQ HIIHFW XSRQ WKH n GHOHWLRQ DQDO\VLV RI WKH FRQVWUXFWV 7KDW LV DV PRUH VHTXHQFHV DUH GHOHWHG IURP WKH n HQG RI WKH SURPRWHU WKH FORVHU WKH UHPDLQLQJ VHTXHQFHV DQG UHJXODWRU\ HOHPHQWV EHFRPH DVVRFLDWHG ZLWK WKH 7'1$

PAGE 85

$QDO\VLV RI WHVW JHQHV WUDQVIHUUHG YLD VKXWWOH YHFWRU S 7KH n$ GHOHWLRQ 57/ RI FORVHO\ FRUUHVSRQGV WR UHVXOWV REVHUYHG E\ :DONHU HW DO f ZKHQ WKH PDL]H $GKO SURPRWHU ZDV IXVHG WR D &$7 UHSRUWHU JHQH GHOHWHG WR WKLV VDPH SRVLWLRQ DQG DQDO\]HG LQ PDL]H SURWRSODVWV +RZHYHU WKHVH UHVXOWV GLIIHU IURP ORZHU WUDQVFULSWLRQ OHYHOV b RI ZLOG W\SH DFWLYLW\f REVHUYHG IRU WKLV FRQVWUXFW LQ PDL]H SURWRSODVWV E\ /HH HW DO f DQG WKH SUHOLPLQDU\ UHVXOWV REVHUYHG FRQFHUQLQJ WKH PDL]H $GKO PXWDQWV LQ VXQIORZHU WXPRUV SUHVHQWHG LQ WKLV VWXG\ VHH FKDSWHU f ,Q DQ DWWHPSW WR LQYHVWLJDWH DQ\ HIIHFW WKH 7'1$ PD\ KDYH XSRQ DQDO\VLV RI WKH SURPRWHU GHOHWLRQV DIWHU LQFRUSRUDWLRQ RI WKH VKXWWOH YHFWRU LQWR WKH 7LSODVPLG VHTXHQFHV RI WKH 7'1$ VLWXDWHG XSVWUHDP RI WKH LQFRUSRUDWHG WHVW JHQHV ZHUH H[DPLQHG PRUH FORVHO\ $V FDQ EH VHHQ LQ ILJXUH WHVW JHQHV DVVLPLODWHG LQWR 7OHIW DUH GRZQVWUHDP RI WKH n FRGLQJ UHJLRQ RI WKH 7'1$ JHQH ZKLFK FRGHV IRU DQ HQ]\PH LQYROYHG LQ F\WRNLQLQ SURGXFWLRQ JHQH D ZKLFK LV LQYROYHG LQ VHFUHWLRQ RI RSLQHV 0HVVHQV HW DO f WKH E JHQH WKRXJKW WR FRQWURO WXPRU VL]H LQ VRPH SODQW VSHFLHV +RRN\NDDV HW DO f DQG WKH RFWRSLQH V\QWKDVH LRFVf JHQH +DFN DQG .HPS f 8SVWUHDP RI WKH FRGLQJ UHJLRQ RI D LV D UHJLRQ RI ES $&*&$*&&*&777&*$ WKDW LV b KRPRORJRXV RI EDVHVf WR WKH RFV HQKDQFHUOLNH HOHPHQW (OOLV HW DO Ef 7KLV VHTXHQFH LV ORFDWHG EHWZHHQ WR WR LQ 7OHIW %DUNHU HW DO f UHODWLYH WR WKH WUDQVFULSWLRQ VWDUW VLWH RI D DQG ZLWKLQ WKH n FRGLQJ UHJLRQ RI JHQH 7KH RFV HOHPHQWOLNH VHTXHQFH RI JHQHV DQG D LV ES IURP WKH 7'1$WHVW JHQH MXQFWLRQ RI WKH VKXWWOH YHFWRU 6LQFH WKHVH VHTXHQFHV DUH VLPLODU WR WKH RFV HQKDQFHUn OLNH HOHPHQW DQG GXH WR LWV FORVH SUR[LPLW\ WR WKH WHVW JHQHV D UHJLRQ RI WKH VKXWWOH YHFWRU ZDV UHPRYHG LQ DQ DWWHPSW WR DEROLVK DQ\ DIIHFW LW PD\ KDYH KDG RQ WUDQVFULSWLRQ RI WKH WHVW JHQHV $Q ES 3VWO IUDJPHQW ZLWKLQ WKH 7'1$ SRUWLRQ RI WKH VKXWWOH YHFWRU S5HI :f ZDV H[FLVHG WR JLYH ULVH WR S5HI:3 )LJ $f 7KLV VHFRQG VKXWWOH YHFWRU ODFNHG WKH SURPRWHU UHJLRQ IRU WKH D JHQH DQG VSHFLILFDOO\ WKH ES RFVOLNH HOHPHQW 7KH UHIHUHQFH JHQH DQG WKH 7'1$ RI S5HI:3 ZHUH VXEVHTXHQWO\ VXEFORQHG LQWR WKH

PAGE 86

6SK f +Q GLOO n%DP +, PL f f )LJ 6KXWWOH YHFWRUV ODFNLQJ SRVVLEOH 3VWO IUDJPHQW KDUERULQJ SRWHQWLDO RFV OLNH HOHPHQW $f S$&<& GHULYHG VKXWWOH YHFWRU S5HI:3 %f S683 GHULYHG VKXWWOH YHFWRU SO ,PSRUWDQW VLWHV DQG GHVFULSWLRQV RI SODVPLGV DUH DV SUHYLRXVO\ SUHVHQWHG ZLWK WKH H[FHSWLRQ WKDW D FRQWDLQV D n SRUWLRQ RI WKH JHQH FRGLQJ UHJLRQ LPPHGLDWHO\ XSVWUHDP RI n FRGLQJ VHTXHQFHV RI D

PAGE 87

%DP +, DQG 6DLO UHVWULFWLRQ VLWHV RI S683 6LPRQ HW DO f UHVXOWLQJ LQ D WKLUG VKXWWOH YHFWRU SO )LJ %f 7KH NE S683 LV D PRELOL]LQJ SODVPLG SRVVHVVLQJ WKH PRELOL]DWLRQ 0REf VLWH IURP WKH EURDG KRVW UDQJH SODVPLG 53 FORQHG LQWR WKH ( FROL YHFWRU S%5 %ROLYDU HW DO f 7KLV 0RE VLWH ZDV XWLOL]HG GXULQJ WULSDUWLWH PDWLQJV WR LQFUHDVH WKH WUDQVIHU HIILFLHQF\ RI WKH VKXWWOH YHFWRU LQWR WKH UHFLSLHQW $JUREDFWHULXP 7KH WHVW JHQH SRVVHVVLQJ WKH $GKO ZLOG W\SH SURPRWHU n$ DQG WZR n SURPRWHU GHOHWLRQ PXWDQWV n$ DQG n$ ZHUH LQVHUWHG LQWR WKH %DP+O DQG +LQGOOO UHVWULFWLRQ VLWHV RI SL 7KLV JDYH ULVH WR GRXEOH JHQH VKXWWOH YHFWRUV S n$ SOn$ DQG SOn$ HDFK SRVVHVVLQJ WKH VWDQGDUG UHIHUHQFH JHQH )LJ f 7KH WHVW DQG UHIHUHQFH JHQHV ZHUH WUDQVIHUUHG LQWR $J DQG LQFRUSRUDWHG LQWR WKH 7'1$ )LJ f 7KH DVVRFLDWLRQ RI HDFK RI WKH FKLPHULF JHQHV FDUULHG E\ WKH GRXEOH JHQH YHFWRU SL ZLWK VXUURXQGLQJ '1$ DIWHU LQFRUSRUDWLRQ LQWR WKH 7LSODVPLG GLIIHUHG IURP WKRVH JHQHV WKDW KDG EHHQ WUDQVSRUWHG YLD WKH S5HI: YHFWRU )LJ f 7KH SURPRWHU RI WKH WHVW JHQHV ZDV DJDLQ SRVLWLRQHG DGMDFHQW WR WKH VKXWWOH YHFWRU 7'1$ EXW WKHVH VHTXHQFHV QRZ ODFNHG WKH D SURPRWHU DQG WKH n SUR[LPDO PRVW VHTXHQFHV RI WKH JHQH FRGLQJ UHJLRQ $OVR WKH WHVW DQG UHIHUHQFH JHQHV ZHUH VHSDUDWHG E\ DERXW NE RI WKH S683 VHTXHQFHV UDWKHU WKDQ WKH DSSUR[LPDWHO\ NE RI S$&<& VHTXHQFHV GHULYHG IURP WKH S5HI: VKXWWOH YHFWRU 7KH $J WUDQVFRQMXJDQWV IURP WKH S683 GHULYHG YHFWRUV KDUERULQJ WKH UHIHUHQFH JHQH DQG WKH WHVW JHQH SURPRWHU PXWDQWV LQ WKH 7'1$ RI WKH 7LSODVPLG ZHUH XVHG WR LQIHFW WKH K\SRFRW\OV RI VXQIORZHU VHHGOLQJV 7KH SRO\$f51$ LVRODWHG IURP WKH WXPRUV DQDHURELFDOO\ LQGXFHG IRU KU ZDV VXEMHFWHG WR 6, QXFOHDVH SURWHFWLRQ PDSSLQJ DIWHU K\EULGL]DWLRQ WR WKH +SDOO HQG ODEHOHG SUREH LVRODWHG IURP WKH WHVW JHQH DV SUHYLRXVO\ GHVFULEHG 7KH WHVW DQG UHIHUHQFH JHQH SURGXFWV ZHUH TXDQWLILHG DQG 57/ GHULYHG IRU HDFK H[SHULPHQW 7KH DYHUDJH UDWLR RI WKH ZLOG W\SH WHVW JHQH SURGXFWV YHUVXV WKH UHIHUHQFH JHQH SURGXFWV ZDV JLYHQ WKH 57/ YDOXH RI 7KH DYHUDJH UDWLR RI HDFK RI WKH GHOHWLRQ

PAGE 88

6DO? 5HIHUHQFH JHQH )LJ 'RXEOH JHQH VKXWWOH YHFWRU SL 7HVW ,PSRUWDQW VLWHV DQG GHVFULSWLRQV RI SODVPLG DUH DV SUHYLRXVO\ SUHVHQWHG

PAGE 89

)LJ ,QFRUSRUDWLRQ RI WKH S GHULYHG GRXEOH JHQH VKXWWOH YHFWRUV LQWR 7OHIW RI $ WXPHIDFLHQV 7'1$ $SSUR[LPDWH ORFDWLRQ RI DVVLPLODWLRQ LV GHSLFWHG 'HVFULSWLRQV RI SODVPLG 7OHIW LQFRUSRUDWHG JHQHV DQG ORFDWLRQ RI RFV HOHPHQWV DQG WKH RFVOLNH HOHPHQW DUH DV SUHYLRXVO\ SUHVHQWHG

PAGE 90

L %DP + ? +LQG+: D E } 8! W %DP + +QGOOO D E !‘f§! f§ RFV UHIHUHQFH $ &SU U WHVW D E ; f§‘ RFV $

PAGE 91

JHQH SURGXFWV YHUVXV WKH LQWHUQDO VWDQGDUG ZHUH FRPSDUHG WR WKH ZLOG W\SH UDWLRV DQG DVVLJQHG WKHLU RZQ FRUUHVSRQGLQJ 57/ YDOXH )LJ 7DEOH f 7KH WHVW JHQH WKDW KDG EHHQ GHOHWHG WR WKH SRVLWLRQ n$f GLG QRW H[KLELW GHFUHDVHG DFWLYLW\ QRU UHVXOW LQ DQ 57/ YDOXH VLPLODU WR WKDW WKH RI ZLOG W\SH SURPRWHU DV ZDV SUHYLRXVO\ REVHUYHG LQ H[SHULPHQWV XWLOL]LQJ WKH S: GHULYHG VKXWWOH YHFWRU )LJ 7DEOH f 5DWKHU WKH 57/ ZDV PRUH WKDQ GRXEOH WKH ZLOG W\SH 6LPLODUO\ WKH 57/ RI WKH PRUH GUDVWLF n GHOHWLRQ PXWDQW WR n$f DOVR UHVXOWHG LQ DQ 57/ YDOXH IROG KLJKHU WKDQ ZLOG W\SH EXW ZDV VOLJKWO\ OHVV WKDQ WKDW RI n$ 7KLV UHVXOW PD\ KDYH EHHQ GXH WR RQH RI VHYHUDO SRVVLELOLWLHV 2QH LV WKDW DW D QHJDWLYH HOHPHQW H[LVWV ZLWKLQ WKH UHJLRQ EHWZHHQ DQG 'HOHWLRQ RI WKHVH QHJDWLYH UHJXODWRU\ VHTXHQFHV PD\ WKHQ KDYH DOORZHG IRU LQFUHDVHG WUDQVFULSWLRQ OHYHOV RI WKH JHQHV $ VHFRQG H[SODQDWLRQ LQYRNHV WKH SRVVLELOLW\ RI D SRVLWLRQ HIIHFW RI WKH WHVW JHQH LQ UHODWLRQ WR 7'1$ RI WKH VKXWWOH YHFWRU ZLWK D WKLUG SRVVLELOLW\ LQYROYLQJ D FRPELQDWLRQ RI ERWK GHOHWLRQ RI D QHJDWLYH HOHPHQW UHJLRQ DQG SRVLWLRQ DIIHFW 5HPRYDO RI WKHVH VDPH SURPRWHU VHTXHQFHV RI WKH WHVW JHQHV WUDQVIHUUHG WR $J E\ S5HI: GLG QRW JLYH ULVH WR DQ LQFUHDVH LQ WKH 57/ FRPSDUHG WR WKH ZLOG W\SH 57/ EXW UDWKHU D VOLJKW GHFUHDVH 7DEOH f 7R IXUWKHU LQYHVWLJDWH WKH SUREDELOLW\ RI SRVLWLRQ HIIHFW XSRQ WKH WHVW JHQHV WKH XVH RI ILOOHU '1$ IURP WKH ( FROL YHFWRU SODVPLG S%5 %ROLYDU HW DO f ZDV HPSOR\HG $ ES %DP+O WR 3VWO IUDJPHQW ZDV VXEFORQHG XSVWUHDP RI WKH n$ WHVW JHQH GHOHWLRQ PXWDQW LQ S$GK7 7KLV WHVW JHQH DORQJ ZLWK LWV QHZO\ DFTXLUHG ES ILOOHU '1$ ZDV VXEVHTXHQWO\ FORQHG LQWR WKH %DP+O DQG mGLOO VLWHV RI WKH GRXEOH JHQH VKXWWOH YHFWRU SL )LJ f 7KLV WHVW JHQH LV VLPLODU LQ FRQWHQW DQG RULHQWDWLRQ ZLWKLQ WKH S VKXWWOH YHFWRU DV n$ EXW LV VHSDUDWHG IURP WKH VKXWWOH YHFWRU 7'1$ E\ WKH ES LQVHUWLRQ n$%5 LQ )LJV DQG f $IWHU LQFRUSRUDWLRQ RI n$%5 LQWR 7'1$ LQRFXODWLRQ RI VHHGOLQJV WXPRU IRUPDWLRQ DQG 51$ H[WUDFWLRQV WKH P51$ IURP ERWK LQGXFHG KUf DQG XQLQGXFHG SULPDU\ WXPRUV

PAGE 92

UHIHUHQFH f$ $GKO 7'1$ n$ 7'1$ $ 7'1$ 57/ )LJ 6, K\EULGL]DWLRQ DVVD\ RI UHIHUHQFH JHQH DQG n GHOHWLRQ WHVW JHQHV WUDQVIHUUHG LQWR $J YLD SL 3RO\$f51$ ZDV LVRODWHG IURP WXPRU WLVVXH WKDW KDG EHHQ VXEMHFWHG WR DQDHURELF VWUHVV IRU KRXUV /DQH GHVLJQDWLRQV UHSUHVHQW n PRVW SRLQW RI WHVW JHQH SURPRWHU ZLWK UHVSHFW WR VWDUW RI WUDQVFULSWLRQ /DQHV n n DQG n FRQWDLQ SJ SJ DQG SJ RI SRO\$f51$ UHVSHFWLYHO\ ,OOXVWUDWLRQV RI HDFK WHVW JHQH LQ UHODWLRQ WR 7'1$ DQG WKH 57/ YDOXH IRU HDFK DUH SUHVHQWHG

PAGE 93

7$%/( 57/ 9DOXHV 6KXWWOH 9HFWRU S f ERUGHU RI WHVW JHQH 1XPEHU RI H[SHULPHQWV 7HVWUHIHUHQFH UDWLR DYJ 57/r n$ s n$ s n$ s VWDQGDUG GHYLDWLRQ JLYHQ DV s

PAGE 94

f 3VW f 3VW (FR: +Q GLOO OLJDWLRQ f 3VW )LJ &RQVWUXFWLRQ RI WHVW JHQH n$%5 WKDW KDV ES RI ILOOHU '1$ SRVLWLRQHG XSVWUHDP RI WKH n GHOHWHG WHVW JHQH WR DQG LWV LQFRUSRUDWLRQ LQWR WKH SO VKXWWOH YHFWRU S%5 VHTXHQFHV DUH UHSUHVHQWHG E\ OLJKWO\ VKDGHG UHJLRQ n$ WHVW JHQH VHTXHQFHV E\ LQWHUPHGLDWH VKDGHG UHJLRQ DQG 7'1$ E\ EODFN UHJLRQ ,PSRUWDQW VLWHV DQG JHQH GHVLJQDWLRQV DUH DV SUHYLRXVO\ SUHVHQWHG

PAGE 95

)LJ 6, K\EULGL]DWLRQ DVVD\ RI UHIHUHQFH JHQH DQG n GHOHWLRQ WHVW JHQHV WUDQVIHUUHG LQWR $J YLD SO 3RO\$f51$ ZDV LVRODWHG IURP WXPRU WLVVXH WKDW KDG EHHQ VXEMHFWHG WR DQDHURELF VWUHVV IRU KRXUV /DQH GHVLJQDWLRQV UHSUHVHQW f PRVW SRLQW RI WHVW JHQH SURPRWHU ZLWK UHVSHFW WR VWDUW RI WUDQVFULSWLRQ DQG ES RI ILOOHU '1$ SRVLWLRQHG XSVWUHDP RI WKH n GHOHWHG WHVW JHQH WR GHVLJQDWHG E\ n%5 /DQHV n n f DQG %5 FRQWDLQ LJ cOJ SJ DQG SJ RI SRO\$f51$ UHVSHFWLYHO\ 3URWHFWHG IUDJPHQWV DUH GHVLJQDWHG ,OOXVWUDWLRQV RI HDFK WHVW JHQH LQ UHODWLRQ WR 7'1$ DQG WKH 57/ YDOXH IRU HDFK DUH SUHVHQWHG ZLWK WKH S%5 VHTXHQFHV UHSUHVHQWHG E\ WKH KDWFKHG UHJLRQ

PAGE 96

R 2V R R J" R I 6 A /2 WR WRn R! r!}} 2f &7! R! SUREH f§WHVW UHIHUHQFH ‘ $ 7'1$ n$ / $GKO 7'1$ $ 7'1$ $%5 A$ 57/

PAGE 97

ZDV VXEMHFWHG WR 6, K\EULG SURWHFWLRQ DQDO\VLV :KLOH WKH WHVW DQG UHIHUHQFH JHQH WUDQVFULSWV IURP WKH XQLQGXFHG WLVVXH ZDV QHJOLJLEOH GDWD QRW VKRZQf GHWHFWDEOH WUDQVFULSW OHYHOV IURP LQGXFHG WXPRUV SURWHFWHG WKH HQG ODEHOHG SUREH )LJ ODQH f )LYH VHSDUDWH H[SHULPHQWV UHVXOWHG LQ DQ DYHUDJH WHVWUHIHUHQFH JHQH SURGXFW UDWLR RI ZKLFK FRQYHUWV WR DQ 57/ YDOXH RI 7KLV 57/ LV KDOI WKDW RI WKH ZLOG W\SH WHVW JHQH DQG RQH IRXUWK WKH OHYHO RI WKH VDPH n GHOHWLRQ ODFNLQJ ILOOHU '1$ )LJ f 7KHUHIRUH E\ VHSDUDWLQJ WKH WHVW JHQH IURP 7'1$ E\ ES RI ILOOHU '1$ WKH WUDQVFULSW OHYHO GURSSHG E\ DOPRVW b 7KHVH UHVXOWV LQGLFDWH WKDW 7'1$ VLWXDWHG XSVWUHDP H[HUWHG D SRVLWLYH HIIHFW RQ WKH WHVW JHQH WUDQVFULSWLRQ 7KH RFV HOHPHQW LV PRVW OLNHO\ WKH FDXVH RI WKLV HQKDQFHPHQW ZKLFK ZDV LQYHUVHO\ SURSRUWLRQDO WR GLVWDQFH $QDO\VLV RI WHVW JHQHV WUDQVIHUUHG YLD VKXWWOH YHFWRU S 7KH RFV HOHPHQW KDV QRW EHHQ VKRZQ WR DIIHFW WUDQVFULSWLRQ LQ WREDFFR FDOOL ZKHQ SRVLWLRQHG n WR D nWUXQFDWHG RFV JHQH /HLVQHU DQG *HOYLQ f RU n WR DQ $GKO SURPRWHU&$7 UHSRUWHU JHQH LQ PDL]H SURWRSODVWV (OOLV HW DL Ef :LWK WKLV LQ PLQG LQ DQ DWWHPSW WR GHYHORS D VXQIORZHU WXPRU DVVD\ V\VWHP IRU WKH $GKOb FKLPHULF WHVW DQG UHIHUHQFH JHQHV IUHH RI DQ\ DIIHFW RQ WUDQVFULSWLRQ IURP WKH 7'1$ WKH VKXWWOH YHFWRU ZDV UHGHVLJQHG VXFK WKDW WKH 7'1$ SRUWLRQ ZRXOG EH n WR WKH WHVW JHQH DV ZHOO DV WKH UHIHUHQFH JHQH 7KH UHIHUHQFH JHQH DQG 7'1$ IURP S5HI: ZDV VXEFORQHG LQWR WKH 6DLO DQG %DP+O UHVWULFWLRQ VLWHV RI S683 7KH UHVXOWLQJ SODVPLG ZDV RSHQHG DW WKH VLQJOH +LQGO8 VLWH RI WKH S683 VHTXHQFHV ILOOHG LQ DQG EOXQW HQG OLJDWHG 0DQLDWLV HW DO f VXEVHTXHQWO\ UHPRYLQJ WKLV +LQGOOO VLWH 7KLV SODVPLG ZDV LQ WXUQ RSHQHG DW D VLQJOH $VS .SQOf UHVWULFWLRQ VLWH ZLWKLQ WKH 7'1$ SRUWLRQ ES IURP WKH 7 '1$S683 MXQFWLRQ ZKHUHXSRQ mGLOO OLQNHUV ZHUH LQVHUWHG )LJ f 7KH UHVXOWLQJ VKXWWOH YHFWRU S SRVVHVVHG S683 VHTXHQFHV WKDW FRQWULEXWHG D FKORUDPSKHQLFRO UHVLVWDQFH JHQH DQG WKH PRELOL]DWLRQ VLWH 0REf IRU LQFUHDVHG FRQMXJDWLRQ HIILFLHQF\ WKH UHIHUHQFH JHQH DQG WKH 7'1$ QHFHVVDU\ IRU UHFRPELQDWLRQ LQWR 7OHIW RI

PAGE 98

$DS EOXQW +LQ GLOO OLQNHUV W )LJ &RQVWUXFWLRQ RI WKH VKXWWOH YHFWRU S ,PSRUWDQW VLWHV DQG GHVFULSWLRQV RI SODVPLGV DQG LQWHUPHGLDWHV DUH DV SUHYLRXVO\ SUHVHQWHG

PAGE 99

S7L$J 7KH QHZO\ DFTXLUHG PGOOO UHVWULFWLRQ VLWH ZLWKLQ WKH 7'1$ DOORZHG IRU LQFRUSRUDWLRQ RI WHVW JHQHV LQWR WKH VKXWWOH YHFWRU LQ WKH RSSRVLWH RULHQWDWLRQ RI DQ\ RI WKH SUHYLRXV GRXEOH JHQH YHFWRUV )LJ f 7HVW JHQHV ZLWK WKH ZLOG W\SH SURPRWHU f GHOHWLRQV WR DQG DQG WKH n GHOHWLRQ PXWDQW ZLWK WKH S%5 ILOOHU VHTXHQFHV ZHUH GHVLJQDWHG WHVW JHQHV DQG UHVSHFWLYHO\ )LJ f (DFK RI WKHVH WHVW JHQHV ZDV VXEFORQHG LQWR S 7KHVH GRXEOH JHQH YHFWRUV ZHUH WUDQVIHUUHG LQWR $J DQG LQFRUSRUDWHG LQWR WKH 7'1$ )LJ f 7KH SURPRWHUV RI WKH WHVW DQG UHIHUHQFH JHQHV ZHUH VHSDUDWHG E\ WKH NE S683 VHTXHQFHV DQG WKH 7'1$ ZLWK WKH D E DQG RFV JHQHV DQG WKHUHIRUH WKH RFV HOHPHQWf QRZ VLWXDWHG n WR WKH LQVHUWHG WHVW JHQHV 3RO\$f51$ ZDV FROOHFWHG IURP ERWK XQLQGXFHG DQG LQGXFHG KUV DQDHURELF VWUHVVf WXPRUV IRUPHG E\ VXQIORZHU VHHGOLQJV LQIHFWHG ZLWK WKH $JUREDFWHULXP 5HVXOWV RI 6, K\EULGL]DWLRQ SURWHFWLRQ PDSSLQJ RI WKH WUDQVFULSWV K\EULGL]HG WR WKH WHVW JHQH +SD: HQG ODEHOHG SUREH DUH VKRZQ LQ ILJXUH 7KHUH ZHUH QHJOLJLEOH OHYHOV RI SURWHFWHG '1$ ZLWK P51$ LVRODWHG IURP HDFK W\SH RI WKH XQLQGXFHG WXPRU WLVVXH 7HVW DQG UHIHUHQFH JHQH WUDQVFULSWV IURP WKH LQGXFHG WXPRUV SURWHFWHG SUREHV ZKLFK ZHUH TXDQWLILHG DQG WHVWUHIHUHQFH UDWLRV FDOFXODWHG 7DEOH f 7KH DYHUDJH ZLOG W\SH SURPRWHU WHVWUHIHUHQFH JHQH UDWLR LQFRUSRUDWHG LQWR S7L XWLOL]LQJ WKH GRXEOH JHQH YHFWRU S ZDV DVVLJQHG DQ 57/ YDOXH RI 7HVW JHQH WKDW KDV ES RI WKH PRVW GLVWDO VHTXHQFHV GHOHWHG WR KDG DQ 57/ RI UHIOHFWLQJ DQ DSSUR[LPDWHO\ b UHGXFWLRQ IURP ZLOG W\SH SURPRWHU DFWLYLW\ 7KH PRUH H[WUHPH GHOHWLRQV RI WHVW JHQHV DQG WR ZLWKRXW RU ZLWK XSVWUHDP VSDFHU '1$ IURP S%5 UHVXOWHG LQ PRUH GUDVWLF UHGXFWLRQ RI 57/ YDOXHV WR DQG UHVSHFWLYHO\ )LJ f 7KHVH YDOXHV PDUNHGO\ GLIIHUHG IURP SUHYLRXV UHVXOWV XWLOL]LQJ WKH GRXEOH JHQH YHFWRUV S5HI: DQG SO HDFK RI ZKLFK KDG KLJKHU 57/ YDOXHV IRU WKH n$ GHOHWLRQ 7KH WHVW WR UHIHUHQFH JHQH SURGXFW UDWLR RI n$%5 n GHOHWLRQ ZLWK ES RI VSDFHU '1$f WUDQVIHUUHG E\ S )LJ f$%5f ZDV GLUHFWO\ FRPSDUHG

PAGE 100

V[ )LJ &RQVWUXFWLRQ RI WKH S GRXEOH JHQH VKXWWOH YHFWRU GHULYDWLYHV ,PSRUWDQW VLWHV DQG GHVFULSWLRQV RI SODVPLGV DQG LQWHUPHGLDWHV DUH DV SUHYLRXVO\ SUHVHQWHG

PAGE 101

)LJ ,QFRUSRUDWLRQ RI WKH S GHULYHG GRXEOH JHQH VKXWWOH YHFWRUV LQWR 7OHIW RI $ WXPHIDFLHQV 7'1$ $SSUR[LPDWH ORFDWLRQ RI DVVLPLODWLRQ LV GHSLFWHG 'HVFULSWLRQV RI SODVPLG 7OHIW LQFRUSRUDWHG JHQHV DQG ORFDWLRQ RI RFV HOHPHQWV DQG WKH RFVOLNH HOHPHQW DUH DV SUHYLRXVO\ SUHVHQWHG

PAGE 102

f %DP + +LQ GLOO D E ‘f§! 92 DP + +Q GLOO D E f§! !r UHIHUHQFH &SU WHVW D E

PAGE 103

)LJ 5HSUHVHQWDWLYH JHO RI 6 K\EULGL]DWLRQ SURWHFWLRQ DVVD\ RI UHIHUHQFH JHQH DQG n GHOHWLRQ WHVW JHQHV WUDQVIHUUHG LQWR $J YLD S 3RO\$f51$ ZDV LVRODWHG IURP WXPRU WLVVXH WKDW KDG EHHQ VXEMHFWHG WR DQDHURELF VWUHVV IRU KRXUV /DQH FRQWDLQV SLJ P51$ ZLWK WHVW JHQH ODQH LJ ZLWK WHVW JHQH ODQH LJ ZLWK WHVW JHQH ODQH SLJ ZLWK WHVW JHQH 3URWHFWHG IUDJPHQWV DUH GHVLJQDWHG /DQH ff FRQWDLQV HQG ODEHOHG +DHOO JHQHUDWHG Mf; PDUNHUV ZLWK VL]H GHVLJQDWLRQV ,OOXVWUDWLRQV RI HDFK WHVW JHQH DQG WKH 57/ YDOXH IRU HDFK DUH SUHVHQWHG 'LVWDO UHJLRQ RI WKH SURPRWHU LV UHSUHVHQWHG E\ ZKLWH UHJLRQ EHWZHHQ DQG LQWHUPHGLDWH UHJLRQ LQ LWV QDWXUDO n WR n RULHQWDWLRQ LV UHSUHVHQWHG E\ FURVVKDWFKHG DUURZ DQG WKH GLVWDO UHJLRQ RI WKH SURPRWHU ZLWK GHVLJQDWHG $5( DQG WKH OHDGHU VHTXHQFHV DUH SRVLWLRQHG EHWZHHQ DQG WKH JHQH 7KH S%5 VHTXHQFHV RI WHVW JHQH DUH UHSUHVHQWHG E\ WKH KDWFKHG UHJLRQ

PAGE 104

r SUREH WHVW r UHIHUHQFH FRQVWUXFW $5( S%5 ES 57/

PAGE 105

7$%/( 57/ 9DOXHV 6KXWWOH 9HFWRU S n ERUGHU RI WHVW JHQH 1XPEHU RI H[SHULPHQWV 7HVWUHIHUHQFH UDWLR DYJ 57/r n $ s n $ s n $ s n $%5 s VWDQGDUG GHYLDWLRQ JLYHQ DV s

PAGE 106

WR WKDW LQYROYLQJ WKH ZLOG W\SH WHVW JHQH WUDQVIHUUHG E\ S 57/ f 7KLV UDWLR UHVXOWV LQ DQ 57/ YDOXH RI ZKLFK LV VLPLODU WR WKH 57/V RI DQG IRU WHVW JHQHV DQG UHVSHFWLYHO\ )LJ 7DEOH f 7KLV LQGLFDWHV WKDW WHVW JHQHV RULHQWHG VXFK WKDW VKXWWOH YHFWRU 7'1$ LV n WR WKH FRGLQJ UHJLRQ ZHUH QRW LQIOXHQFHG E\ SRVLWLYH HOHPHQWV ZLWKLQ WKH 7'1$ 7KLV ORVV RI HIIHFW RQ WUDQVFULSWLRQ ZKHQ n WR WKH WHVW JHQH LV LQ DJUHHPHQW ZLWK ILQGLQJV RI /HLVQHU DQG *HOYLQ f DQG (OOLV HW DO Ef LQ WKHLU FKDUDFWHUL]DWLRQ RI WKH RFV HOHPHQW $OVR WKH LQIOXHQFH RI WKH SRVLWLYH HOHPHQW ZLWKLQ WKH 7'1$ ZDV DOVR ORVW XSRQ VHSDUDWLRQ RI WKH WHVW JHQH SURPRWHU IURP WKH 7'1$ E\ ES RI VSDFHU '1$ GHPRQVWUDWLQJ D GLVWDQFH GHSHQGHQFH IRU WKLV 7'1$ HIIHFW ,Q DQDHURELFDOO\ LQGXFHG VXQIORZHU WXPRUV S YHFWRUf WUDQVFULSW OHYHOV RI WHVW JHQH ZLWK WKH $GKO ZLOG W\SH SURPRWHU ZHUH WKUHHIROG KLJKHU WKDQ WKH UHIHUHQFH JHQH KDYLQJ WKH VDPH SURPRWHU 7DEOH f 7KH UHDVRQ IRU WKLV GLIIHUHQFH LV XQFOHDU 7KLV GLVVLPLODULW\ LQ WHVWUHIHUHQFH UDWLRV ZDV ILUVW REVHUYHG ZKHQ S683GHULYHG VKXWWOH YHFWRUV ZHUH XWLOL]HG :KHWKHU S683 VHTXHQFHV ZHUH TXHQFKLQJ WKH UHIHUHQFH JHQH LV QRW NQRZQ 6LQFH WKH UHIHUHQFH JHQH ZDV FRQVWDQW ZLWK UHVSHFW WR LWV PDNHXS DQG SRVLWLRQ LQ WKH VKXWWOH YHFWRU DQG WKH S683 VHTXHQFHV RI S GLG QRW LQIOXHQFH WUDQVFULSWLRQ RI WKH WHVW JHQHV FRPSDUH WHVW JHQH DQG f DOO WHVW JHQH PXWDWLRQV LQ VXQIORZHU FRXOG EH DFFXUDWHO\ FRPSDUHG WR WKH UHIHUHQFH JHQH LQWHUQDO VWDQGDUG IURP ZKLFK UHOLDEOH 57/ YDOXHV ZHUH FDOFXODWHG 0DL]H $GKO SURPRWHU DQDO\VLV LQ VXQIORZHU $QDO\VLV RI n GHOHWLRQ PXWDQWV ZLWKLQ YHFWRU S VXJJHVWHG WKDW D SRWHQWLDOO\ LPSRUWDQW UHJLRQ RI WKH SURPRWHU ZDV ORFDWHG XSVWUHDP RI WKH $5( LGHQWLILHG E\ :DONHU HW DO f 7KH n GHOHWLRQ WR RI WHVW JHQH ORZHUHG WUDQVFULSWLRQDO DFWLYLW\ RQO\ b FRPSDUHG WR WKH ZLOG W\SH SURPRWHU RI WHVW JHQH ZKHUHDV WKH PRUH VHYHUH GHOHWLRQ WR RI WHVW JHQH UHVXOWHG LQ D VLJQLILFDQW GURS RI DERXW b RI WKH WUDQVFULSWLRQDO DFWLYLW\ )LJ f 7KH SRWHQWLDO RI DQ HQKDQFHUOLNH LQIOXHQFH UHVLGLQJ LQ WKH ES

PAGE 107

EHWZHHQ DQG ZDV LQYHVWLJDWHG 7R DVVLVW LQ WKH GHVFULSWLRQ RI WKH HQVXLQJ WHVW JHQH SURPRWHUV WKH PDL]H $GKO SURPRWHU UHJLRQ ORFDWHG IURP WR LV UHIHUUHG WR DV WKH GLVWDO SURPRWHU UHJLRQ WR DV WKH RU LQWHUQDOf UHJLRQ DQG WKH VHTXHQFHV H[WHQGLQJ IURP WKH VWDUW RI WUDQVFULSWLRQ XSVWUHDP WR WKH SRVLWLRQ DV WKH SUR[LPDO SURPRWHU UHJLRQ ,QLWLDO H[SHULPHQWV WKDW FRQFHQWUDWHG RQ WKH DQDO\VLV RI WKH LQWHUQDO UHJLRQ RI WKH $GKO SURPRWHU LQYROYHG LWV UHPRYDO IURP WKH SURPRWHU RI WKH WHVW JHQH 7R WKLV HQG WKH ES GLVWDO SURPRWHU VHTXHQFHV ZLWKLQ D %DP+O WR ;ED? IUDJPHQW WR f IURP S% 'HQQLV HW DO f ZDV VXEFORQHG LQWR WKH S8&GHULYHG SRO\OLQNHU LPPHGLDWHO\ XSVWUHDP RI WKH n GHOHWHG WHVW JHQH RI S$GK7 7KLV JDYH ULVH WR WHVW JHQH LQ ZKLFK WKH UHJLRQ ZDV HVVHQWLDOO\ H[FLVHG DQG UHSODFHG ZLWK DQ ES 6DLO UHVWULFWLRQ VLWH FRQWULEXWHG E\ WKH S8& SRO\OLQNHU )LJ f $ VLPLODU WHVW JHQH FRQVWUXFW ZDV SURGXFHG E\ UHSODFLQJ WKH ES UHJLRQ ZLWK ES RI VSDFHU '1$ REWDLQHG IURP WKH ( FROL YHFWRU S%5 %ROLYDU HW DO f WKHUHE\ GHOHWLQJ WKH LQWHUQDO UHJLRQ EXW FRQVHUYLQJ WKH VSDFLQJ EHWZHHQ WKH UHPDLQLQJ SURPRWHU VHTXHQFHV 7KLV UHTXLUHG WKDW D ES eFR5, WR 6DLO IUDJPHQW IURP S%5 EH VXEFORQHG LQWR S$'+7 XSVWUHDP DQG DGMDFHQW WR WKH SRVLWLRQ RI WHVW JHQH )LJ f 7KH XQLTXH %DP+O VLWH ZLWKLQ WKH LQVHUWHG S%5 '1$ ES IURP WKH $GKO SURPRWHU ZDV FRQYHUWHG LQWR DQ ;EDO VLWH E\ DGGLWLRQ RI OLQNHUV 7KH ;EDO WR mGLOO IUDJPHQW IURP WKLV FRQVWUXFW ZKLFK FRQWDLQHG ES RI WKH S%5 '1$ WKH $GKO SURPRWHU SUR[LPDO DQG OHDGHU VHTXHQFHV DQG WKH FRGLQJ UHJLRQ ZDV WKHQ VXEFORQHG LQWR OLNH UHVWULFWLRQ VLWHV RI D SODVPLG LQ ZKLFK WKH GLVWDO SURPRWHU UHJLRQ KDG EHHQ LQVHUWHG LQWR WKH SRO\OLQNHU RI S8& S8&7HVWGLVf 7KH WHVW JHQH PXWDQW IRUPHG E\ WKHVH PDQLSXODWLRQV JDYH ULVH WR S$GK7 KDUERULQJ WHVW JHQH ZKHUH ES RI VSDFHU '1$ LQFOXGLQJ WKH 6DLO VLWH IURP WKH S8& SRO\OLQNHU ZDV VXEVWLWXWHG IRU WKH ES UHJLRQ RI WKH SURPRWHU )LJ f

PAGE 108

S$GK 7 7HVW JHQHf f ;ED? 3VW 6SK %DP +, 7 +LQ GLOO S8& /$ $ 5( S8& S$GK 7 7HVW JHQHf S8& $GK SURPRWHU UHJLRQ %DP +, WR ;ED f ESf 6DO f %DP +, f ;ED 6SK $5( +LQ GLOO S8& )LJ &RQVWUXFWLRQ RI WHVW JHQH ZLWKLQ S8& GHULYHG S$GK7 ,PSRUWDQW UHVWULFWLRQ VLWHV DUH GHVLJQDWHG 1XPEHUV LQ SDUHQWKHVLV UHSUHVHQW QRUPDO ORFDWLRQ RI UHVWULFWLRQ VLWHV LQ UHODWLRQ WR WKH VWDUW RI WUDQVFULSWLRQ f RU WKH ES LQVHUWLRQ WKDW UHSODFHG WKH LQWHUQDO UHJLRQ RI WKH SURPRWHU 7KH $5( LV UHSUHVHQWHG E\ FURVVKDWFKHG UHJLRQ

PAGE 109

S$GK 7 7HVW JHQHf %DP +, ff 6SK (FR 5O ;ED 3VIO +QGOOO / 6D,_ L O + / S8& \ $'& S8& S%5 IUDJPHQW 6D, WR (FR 5Of ES (FR 5O +LQ GLOO %DP +, f 3VWO S8& 6SLO +LQ GLOO ES ES $5( S8& %DP+, EOXQW ;ED OLQNHU S8& f (FR 5O +LQ GLOO ;ED 3VIO ?AA!N ES ES $5( S8&7HDWGLD ;ED ;ED +LQ GLOO +L r+ S8&,% DQG GLDWDO SURPRWHUf r n‘r 6SK O +LQ GLOO S8& )LJ &RQVWUXFWLRQ RI WHVW JHQH ZLWKLQ S8& GHULYHG S$GK7 ,PSRUWDQW UHVWULFWLRQ VLWHV DUH GHVLJQDWHG 1XPEHUV LQ SDUHQWKHVLV UHSUHVHQW QRUPDO ORFDWLRQ RI UHVWULFWLRQ VLWHV LQ UHODWLRQ WR WKH VWDUW RI WUDQVFULSWLRQ f 7KH $5( DQG WKH S%5 GHULYHG ILOOHU '1$ DUH UHSUHVHQWHG E\ FURVVKDWFKHG DQG KDWFKHG UHJLRQV UHVSHFWLYHO\

PAGE 110

7HVW JHQH DQG WHVW JHQH ZHUH WUDQVIHUUHG LQWR $JUREDFWHULXP YLD WKH S VKXWWOH YHFWRU $QDO\VLV RI WUDQVFULSW SURGXFWLRQ IURP DQDHURELFDOO\ VWUHVVHG KUf VXQIORZHU WXPRUV \LHOGHG 57/ YDOXHV RI IRU WHVW JHQH DQG IRU WHVW JHQH )LJ f 3RO\$f51$ IURP XQLQGXFHG WXPRU WLVVXH UHPDLQHG DW QHJOLJLEOH OHYHOV IRU ERWK WHVW DQG UHIHUHQFH JHQH SURGXFWV 7KH UHVXOWV IURP WKHVH H[SHULPHQWV LQGLFDWHG WKDW WKH WHVW JHQHV UHTXLUH WKH LQWHUQDO UHJLRQ RI LWV SURPRWHU IRU PD[LPXP WUDQVFULSWLRQ 5HPRYDO RI WKH LQWHUQDO UHJLRQ VLJQLILFDQWO\ ORZHUHG WUDQVFULSWLRQDO HIILFLHQF\ WKRXJK WKH DFWLYLW\ ZDV VOLJKWO\ KLJKHU ZKHQ WKH GLVWDO UHJLRQ ZDV DGMDFHQW WR WKH SUR[LPDO UHJLRQ WHVW JHQHf WKDQ ZKHQ WKH GLVWDO UHJLRQ ZDV VHSDUDWHG IURP WKH SUR[LPDO UHJLRQ E\ DQ LQWHUQDO VXEVWLWXWLRQ ZLWK ILOOHU '1$ DV REVHUYHG IRU WHVW JHQH 7KLV VLJQLILHV WKDW ZKHQ PRYHG FORVHU WR WKH SURPRWHU SUR[LPDO UHJLRQ WKH GLVWDO UHJLRQ FRQWULEXWHG WR D PRGHVW LQFUHDVH LQ WUDQVFULSWLRQ HIILFLHQF\ 7KLV LV LQ DJUHHPHQW ZLWK WKH n GHOHWLRQ VWXGLHV WKDW LQGLFDWHG WKDW WKH SUR[LPDO SURPRWHU UHJLRQ FRQWULEXWHV DERXW b WR WKH RYHUDOO WUDQVFULSWLRQDO DFWLYLW\ 6XUSULVLQJO\ ERWK WKH LQWHUQDO GHOHWLRQ DQG VXEVWLWXWHG JHQHV KDG PXFK ORZHU 57/V WKDQ nGHOHWHG WHVW JHQHV DQG LQ ZKLFK ERWK WKH GLVWDO DQG UHJLRQV ZHUH ERWK GHOHWHG (QKDQFHU HOHPHQWV DUH GHILQHG DV VWUHWFKHV RI '1$ WKDW ZKHQ SRVLWLRQHG LQ HLWKHU RULHQWDWLRQ DQG DW GLIIHUHQW ORFDWLRQV RI D JHQH HQKDQFHV WUDQVFULSWLRQ HIILFLHQF\ '\QDQ DQG 7MLDQ 6HUIOLQJ HW DO f 7KH n GHOHWLRQ DQDO\VLV RI WKLV VWXG\ LQGLFDWHV WKDW WKH LQWHUQDO UHJLRQ RI WKH SURPRWHU ZDV UHVSRQVLEOH IRU D ODUJH SHUFHQWDJH RI WKH WHVW JHQH WUDQVFULSWLRQ HIILFLHQF\ 7R LQYHVWLJDWH WKH SRVVLELOLW\ RI WKHVH VHTXHQFHV SRVVHVVLQJ HQKDQFHUOLNH TXDOLWLHV WKH UHJLRQ ZDV H[FLVHG DQG UHSRVLWLRQHG LQ ERWK RULHQWDWLRQV LQWR GLIIHUHQW ORFDWLRQV RI WKH WHVW JHQH 7R DLG LQ WKLV DQDO\VLV WKH UHJLRQ ZDV VXEFORQHG DQG WLQNHUHG LQ VXFK D ZD\ DV WR JDLQ IODQNLQJ UHVWULFWLRQ VLWHV QHFHVVDU\ IRU VXEVHTXHQW PDQLSXODWLRQV 7KLV UHTXLUHG WKDW WKH ES 6DO, WR 3VWO IUDJPHQW RI WHVW JHQH WKH UHJLRQf ZDV VXEFORQHG LQWR S8& 7KH 6SK? VLWH RI WKH S8& SRO\OLQNHU DGMDFHQW WR 3VWO f ZDV VXEVHTXHQWO\ RSHQHG ZKHUHXSRQ ;KRO WLQNHUV ZHUH

PAGE 111

8 SUREH WHVW ‘ UHIHUHQFH FRQVWUXFW A5( $GK f OLf§ $GK f ES <0 57/ )LJ 5HSUHVHQWDWLYH JHO RI 6, K\EULGL]DWLRQ SURWHFWLRQ DVVD\ RI UHIHUHQFH JHQH DQG VSHFLILHG WHVW JHQHV WUDQVIHUUHG LQWR $J YLD S 3RO\$f51$ ZDV LVRODWHG IURP WXPRU WLVVXH WKDW ZDV XQLQGXFHG 8f RU VXEMHFWHG WR DQDHURELF VWUHVV IRU KRXUV ,f /DQH FRQWDLQV SJ P51$ ZLWK WHVW JHQH ODQHV 8 SLf DQG SJf ZLWK WHVW JHQH ODQHV 8 SJf DQG SJf ZLWK WHVW JHQH 3URWHFWHG IUDJPHQWV DUH GHVLJQDWHG /DQH FRQWDLQV HQG ODEHOHG +DHOO JHQHUDWHG -f; PDUNHUV ZLWK VL]H GHVLJQDWLRQV ,OOXVWUDWLRQV RI HDFK WHVW JHQH DQG WKH 57/ YDOXH IRU HDFK DUH SUHVHQWHG 6HTXHQFHV RI JHQHV DUH DV SUHYLRXVO\ GHVFULEHG

PAGE 112

DGGHG )LJ f 7KH UHVXOWLQJ SODVPLG S(1 KDUERUHG WKH LQWHUQDO SURPRWHU VHTXHQFHV WR DQG ZDV IODQNHG E\ 6DLO DQG ;KRO UHVWULFWLRQ VLWHV 7KH 6DLO DQG;LR, HQGRQXFOHDVH UHVWULFWLRQ VLWHV KDYH LGHQWLFDO SURWUXGLQJ n FRKHVLYH WHUPLQL WKDW DOORZHG IRU LQVHUWLRQ RI WKH UHJLRQ LQWR 6DLO DQGRU ;KRO VLWHV LQ HLWKHU RULHQWDWLRQ $ QXPEHU RI SURPRWHU WHVW JHQH PXWDWLRQV XWLOL]LQJ WKH LQWHUQDO UHJLRQ ZHUH FRQVWUXFWHG WR LQYHVWLJDWH WKH UHJXODWRU\ SRWHQWLDO RI WKHVH VHTXHQFHV 7KH UHJLRQ ZDV LQVHUWHG LQWR LWV RULJLQDO SRVLWLRQ ZLWK UHVSHFW WR WKH SUR[LPDO SURPRWHU UHJLRQ LQ ERWK WKH n WR n DQG WKH n WR n RULHQWDWLRQV ZLWKLQ D 6DLO VLWH LPPHGLDWHO\ XSVWUHDP RI WKH n$ GHOHWLRQ RI WHVW JHQH )LJ f 7KH UHVXOWLQJ FRQVWUXFW ZLWK WKH LQWHUQDO UHJLRQ LQ LWV QRUPDO n WR n SRVLWLRQ ZDV GHVLJQDWHG WHVW JHQH DQG WKH FRQVWUXFW ZLWK WKHVH VHTXHQFHV LQ WKH RSSRVLWH RULHQWDWLRQ DV WHVW JHQH $QRWKHU VHW RI WHVW JHQH PXWDQWV ZHUH FRQVWUXFWHG LQ VXFK D PDQQHU DV WR SRVLWLRQ WKH UHJLRQ LQ ERWK RULHQWDWLRQV DW D GLVWDQFH IURP WKH VLWH RI WKH n GHOHWHG WHVW JHQH VHSDUDWHG E\ ES RI LQWHUYHQLQJ '1$ IURP S%5 7KHVH LQ YLWUR PDQLSXODWLRQV UHTXLUHG XWLOL]DWLRQ RI WHVW JHQH ZLWK DQ ES %DP +, WR 3VWO IUDJPHQW IURP S%5 WKDW KDG EHHQ SODFHG XSVWUHDP RI WKH SUR[LPDO UHJLRQ RI WKH WHVW JHQH SURPRWHU n GHOHWLRQ WR )LJV f $ ES eFR5, IUDJPHQW ZDV H[FLVHG IURP WKLV FRQVWUXFW ZKHUHXSRQ 6DLO OLQNHUV ZHUH DGGHG DQG OLJDWHG 7KH HQWLUH SURPRWHUPXWDWHG JHQH LQFOXGLQJ WKH ES S%5 GHULYHG '1$ ZDV VXEFORQHG LQWR 6DLO DQG +LQGOOO VLWHV RI S8& ZLWK WKH VXEVHTXHQW DFTXLVLWLRQ RI WKH SRO\OLQNHU LPPHGLDWHO\ XSVWUHDP )LJ f 7KH UHJLRQ RI S(1 ZDV WKHQ SRVLWLRQHG LQ ERWK RULHQWDWLRQV LQWR WKH 6DLO VLWH ES XSVWUHDP IURP JLYLQJ ULVH WR WHVW JHQH ZLWK WKH LQWHUQDO UHJLRQ RULHQWHG n WR n DQG WHVW JHQH KDYLQJ WKH VHTXHQFHV LQ WKH RSSRVLWH RULHQWDWLRQ )LJ f )LQDOO\ D WKLUG VHW RI FRQVWUXFWV LQYROYHG SRVLWLRQLQJ WKH UHJLRQ f WR WKH FRGLQJ VHTXHQFHV RI WKH n GHOHWHG WHVW JHQH 7KH S8&GHULYHG S$GK7 WKDW KDUERUV WHVW JHQH ZDV RSHQHG DW WKH 6SKO UHVWULFWLRQ VLWH n WR WKH FRGLQJ UHJLRQ RI WKLV FKLPHULF ZKHUH ;KRO

PAGE 113

S$GK 7 7HVW JHQHf S8& S8& f 6DO %DP + ;ED Of ;ED , f 3VW $5( S8& f %DP + 6DO ;ED ‘ 6DO ? f ?3VIO +LQ GLOO 6SK , ’ S8& 6SK +QGOOO S8&O 6SK 7 SRO\PHUDVH ;KR OLQNHUV S(1O S8& f 6DP + 6DO , ;ED f 3VW +QGOOO ;KR S8& )LJ ,VRODWLRQ DQG FORQLQJ VFKHPH RI $GKO LQWHUQDO f SURPRWHU UHJLRQ LQWR S8& WR IRUP S(1 ,PSRUWDQW VLWHV DQG GHVFULSWLRQV RI SODVPLGV DQG LQWHUPHGLDWHV DUH DV SUHYLRXVO\ SUHVHQWHG 7KH RULJLQDO ;EDO VLWH DW SRVLWLRQ KDG EHHQ FKDQJHG WR 6DLO E\ OLQNHU DGGLWLRQ )LJ f +RUL]RQWDO DUURZ LQGLFDWHV n WR n RULHQWDWLRQ RI WKH LQWHUQDO SURPRWHU UHJLRQ

PAGE 114

S$GK 7 7HVW JHQHf %DP +, ff 6SK (FR 5O ;ED 3VO +QGOOO 6DO,, OB/f§ S8& DQF S8& S$GK 7 7HVW JHQHf S8& S(1 ^6DO ;KR V[ 8 2+f -f 6DP +, 6D ;ED , 6D GHSKRVSKRU\ODWD $5( 6SEO +QGOOO S8& S$GK 7 7HVW JHQHf S8& f 6; f 6DO %DP +, ;ED $5( 6SLO +QGOOO 38& )LJ &RQVWUXFWLRQ RI S$GK7 DQG S$GK7 ,PSRUWDQW UHVWULFWLRQ VLWHV DUH GHVLJQDWHG 1XPEHUV LQ SDUHQWKHVLV UHSUHVHQW QRUPDO ORFDWLRQ RI UHVWULFWLRQ VLWHV LQ UHODWLRQ WR WKH VWDUW RI WUDQVFULSWLRQ f 7KH $5( LV UHSUHVHQWHG E\ FURVVKDWFKHG UHJLRQ

PAGE 115

S$GK 7 7HVW JHQHf S8& %DP+? (FR 5O L ,, A/LGLLL L L /S%5 ES $5( S8& S8& (FR 5 EOXQW 6P, OLQNHU 6DO A 6SK +LQ GLOO S%5 ES $5( S8& S8& 6SK S$GK 7 6SK 7HVW JHQHf IODP +, 6; 3VOL ,7_ 6D, +QGOOO <9, S8& / $+E S8& )LJ &RQVWUXFWLRQ RI S$GK7 DQG S$GK7 ,PSRUWDQW UHVWULFWLRQ VLWHV DUH GHVLJQDWHG 1XPEHUV LQ SDUHQWKHVLV UHSUHVHQW QRUPDO ORFDWLRQ RI UHVWULFWLRQ VLWHV LQ UHODWLRQ WR WKH VWDUW RI WUDQVFULSWLRQ f 7KH $5( DQG WKH S%5 GHULYHG ILOOHU '1$ DUH UHSUHVHQWHG E\ FURVVKDWFKHG DQG KDWFKHG UHJLRQV UHVSHFWLYHO\ 2ULHQWDWLRQ RI WKH UHn SRVLWLRQHG LQWHUQDO UHJLRQ LV GHVLJQDWHG E\ KRUL]RQWDO DUURZV

PAGE 116

OLQNHUV ZHUH VXEVHTXHQWO\ SODFHG IRU LQVHUWLRQ RI WKH S(1 IUDJPHQW )LJ f 7KH UHVXOWLQJ nLQVHUWLRQ FRQVWUXFWV ZHUH GHVLJQDWHG WHVW JHQH n WR n RULHQWDWLRQf DQG WHVW JHQH n WR n RULHQWDWLRQf )LJ f (DFK RI WKHVH WHVW JHQH FRQVWUXFWV ZDV FORQHG LQWR WKH %DP+? DQG mGLOO VLWHV RI S DV SUHYLRXVO\ LOOXVWUDWHG )LJ f 7UDQVFULSWLRQDO DFWLYLW\ RI WHVW JHQHV DQG ZHUH FRPSDUHG WR WKH n SURPRWHU GHOHWLRQ PXWDQW WR RI WHVW JHQH )LJ f $QDO\VLV RI WUDQVFULSWLRQ DFWLYLW\ LQ WXPRUV IRU WHVW JHQHV DQG LQGLFDWHG WKDW WKHVH FRQVWUXFWV VKRZHG QHJOLJLEOH DFWLYLW\ XQGHU DHURELF FRQGLWLRQV )LJ ODQHV 8f :KHQ FRPSDUHG WR D n GHOHWLRQ WR WHVW JHQHf WHVW JHQH KDV DQ 57/ RI b OHVV WUDQVFULSWLRQDOO\ DFWLYH WKDQ WHVW JHQH 7KH GLIIHUHQFH EHWZHHQ WKHVH WZR FRQVWUXFWV ZDV WKH SUHVHQFH RI WKH LQWHUYHQLQJ OLQNHUV IODQNLQJ WKH UHJLRQ WKDW ZHUH UHTXLUHG IRU UHLQVHUWLRQ 7KH LQVHUWLRQ UHVXOWHG LQ WKH DGGLWLRQ RI ES DW )LJ f ZKLFK DUH QRW QRUPDOO\ SUHVHQW LQ WKH $GKO SURPRWHU 0RUH VXUSULVLQJ LV WKH KLJK 57/ YDOXH RI WHVW JHQH 7KLV FRQVWUXFW KDV WKH UHJLRQ OLQNHUHG DQG LQVHUWHG LQ WKH LQYHUWHG RULHQWDWLRQ 7KH UHVXOWLQJ 57/ RI FRUUHVSRQGV WR D b LQFUHDVH LQ WUDQVFULSWLRQDO DFWLYLW\ RYHU WHVW JHQH DQG LV b KLJKHU WKDQ ZLOG W\SH OHYHOV 7KH DFWLYLWLHV 57/Vf RI WHVW JHQH DQG WHVW JHQH ZHUH FRPSDUHG WR WKDW RI n GHOHWHG WHVW JHQH LQ ZKLFK WKH VDPH S%5 VHTXHQFHV ZHUH SRVLWLRQHG XSVWUHDP RI WKH SUR[LPDO UHJLRQ )LJ f 7UDQVFULSWV IURP WHVW JHQHV DQG IURP DQDHURELFDOO\ VWUHVVHG WXPRUV KDG 57/V RI DQG UHVSHFWLYHO\ FORVHO\ FRUUHVSRQGLQJ WR WKH 57/ YDOXH RI IRU WHVW JHQH )LJ f ,W LV DSSDUHQW IURP WKHVH UHVXOWV WKDW WKH ES GRPDLQ GLG QRW FRQWULEXWH WR WUDQVFULSWLRQDO DFWLYLW\ RI WKH f$ GHOHWLRQ ZKHQ SRVLWLRQHG LQ HLWKHU RULHQWDWLRQ DW ES XSVWUHDP IURP LWV FXVWRPDU\ SRVLWLRQ 7KH UHVXOWV RI WKH GLVWDQFH DQDO\VLV DUH LQ DJUHHPHQW ZLWK 57/ YDOXHV GHULYHG IRU WHVW JHQHV DQG LQ ZKLFK WKH '1$ ZDV SRVLWLRQHG n WR WKH WHVW JHQH FRQVWUXFW 7KH WUDQVFULSW OHYHOV ZHUH FRPSDUHG WR WKRVH RI WHVW JHQH WKDW KDG QRW XQGHUJRQH DQ\ PDQLSXODWLRQV n WR WKH FRGLQJ UHJLRQ )LJ f 7KH SRO\$f51$ REWDLQHG IURP

PAGE 117

S$GK 7 7HVW JHQHf %DP +, r! 6SK (FR 5O ;ED 3VW 6D,_ +LQ GLOO L /f§-f§ S8& f§ f§(OL S8& $5( 6SK , 7 SRO\PHUDVH EOXQWf ;KRO OLQNHUV 7 %DP +, nf ;KRO S$GK 7 7HVW JHQHf %DP +, (FR 5O f ;ED 3VW 6DO S8& / $5( S(1 6DO ;KRO ;KRO GHSKRVSKRU\ODWH 6; 3VO +Q GLOO ;KR S8& S$GK 7 7HVW JHQHf 6DP +, f ;KRO (FR 5O ;ED 3VW L 6DO ,, 3VW 6; , / f§ S8& \ $5( +LQ GLOO S8& )LJ &RQVWUXFWLRQ RI S$GK7 DQG S$GK7 ,PSRUWDQW UHVWULFWLRQ VLWHV DUH GHVLJQDWHG 1XPEHUV LQ SDUHQWKHVLV UHSUHVHQW QRUPDO ORFDWLRQ RI UHVWULFWLRQ VLWHV LQ UHODWLRQ WR WKH VWDUW RI WUDQVFULSWLRQ f 7KH $5( LV UHSUHVHQWHG E\ FURVVKDWFKHG UHJLRQ 2ULHQWDWLRQ RI WKH UHSRVLWLRQHG LQWHUQDO UHJLRQ LV GHVLJQDWHG E\ KRUL]RQWDO DUURZV

PAGE 118

,OO 7L 3 7M 3 7M 3 ‘ UHIHUHQFH FRQVWUXFW N f 9 Q $ 1 57/ )LJ 5HSUHVHQWDWLYH JHO RI 6 K\EULGL]DWLRQ SURWHFWLRQ DVVD\ RI UHIHUHQFH JHQH DQG VSHFLILHG WHVW JHQHV WUDQVIHUUHG LQWR $J YLD S 3RO\$f51$ ZDV LVRODWHG IURP WXPRU WLVVXH WKDW ZDV XQLQGXFHG 8f RU VXEMHFWHG WR DQDHURELF VWUHVV IRU KRXUV ,f /DQHV 8 ILJf DQG SJf FRQWDLQV P51$ ZLWK WHVW JHQH ODQHV 8 SLf DQG SJf ZLWK WHVW JHQH DQG ODQHV 8 SJf DQG SJf ZLWK WHVW JHQH 3URWHFWHG IUDJPHQWV DUH GHVLJQDWHG /DQH ff FRQWDLQV HQG ODEHOHG +DH,, JHQHUDWHG !; PDUNHUV ZLWK VL]H GHVLJQDWLRQV ,OOXVWUDWLRQV RI HDFK WHVW JHQH DQG WKH 57/ YDOXH IRU HDFK DUH SUHVHQWHG /RFDWLRQ DQG RULHQWDWLRQ RI WKH SURPRWHU UHJLRQ LV UHSUHVHQWHG E\ FURVVKDWFKHG DUURZ 7KLFN YHUWLFDO OLQHV LQGLFDWLYH RI ES LQVHUWLRQ

PAGE 119

B U8 3 8 ‘ SUREH WHVW r ‘ UHIHUHQFH FRQVWUXFW S%5 ES 9 57/ N S%5 ES 7A9\0 D S%5 ES ALO6L 9A\0 )LJ 5HSUHVHQWDWLYH JHO RI 6 K\EULGL]DWLRQ SURWHFWLRQ DVVD\ RI UHIHUHQFH JHQH DQG VSHFLILHG WHVW JHQHV WUDQVIHUUHG LQWR $J YLD S 3RO\$f51$ ZDV LVRODWHG IURP WXPRU WLVVXH WKDW ZDV XQLQGXFHG 8f RU VXEMHFWHG WR DQDHURELF VWUHVV IRU KRXUV ,f /DQH _LJf FRQWDLQV P51$ ZLWK WHVW JHQH ODQHV 8 Sf DQG _LJf ZLWK WHVW JHQH DQG ODQHV 8 LJf DQG LJf ZLWK WHVW JHQH 3URWHFWHG IUDJPHQWV DUH GHVLJQDWHG /DQH ^! FRQWDLQV HQG ODEHOHG +DH: JHQHUDWHG -f; PDUNHUV ZLWK VL]H GHVLJQDWLRQV ,OOXVWUDWLRQV RI HDFK WHVW JHQH DQG WKH 57/ YDOXH IRU HDFK DUH SUHVHQWHG /RFDWLRQ DQG RULHQWDWLRQ RI WKH SURPRWHU UHJLRQ LV UHSUHVHQWHG E\ FURVVKDWFKHG DUURZ 7KH $5( DQG WKH S%5 GHULYHG ILOOHU '1$ DUH UHSUHVHQWHG E\ FURVVKDWFKHG DQG KDWFKHG UHJLRQV UHVSHFWLYHO\

PAGE 120

, M 3 SUREH WHVW f UHIHUHQFH FRQVWUXFW 57/ )LJ 5HSUHVHQWDWLYH JHO RI 6 K\EULGL]DWLRQ SURWHFWLRQ DVVD\ RI UHIHUHQFH JHQH DQG VSHFLILHG WHVW JHQHV WUDQVIHUUHG LQWR $J YLD S 3RO\$f51$ ZDV LVRODWHG IURP WXPRU WLVVXH WKDW ZDV XQLQGXFHG 8f RU VXEMHFWHG WR DQDHURELF VWUHVV IRU KRXUV ,f /DQH ILJf FRQWDLQV P51$ ZLWK WHVW JHQH ODQHV 8 ILOf DQG ILJf ZLWK WHVW JHQH DQG ODQHV 8 ILJf DQG ILJf ZLWK WHVW JHQH 3URWHFWHG IUDJPHQWV DUH GHVLJQDWHG /DQH FRQWDLQV HQG ODEHOHG +DH8 JHQHUDWHG -f; PDUNHUV ZLWK VL]H GHVLJQDWLRQV ,OOXVWUDWLRQV RI HDFK WHVW JHQH DQG WKH 57/ YDOXH IRU HDFK DUH SUHVHQWHG /RFDWLRQ DQG RULHQWDWLRQ RI WKH SURPRWHU UHJLRQ LV UHSUHVHQWHG E\ FURVVKDWFKHG DUURZ 7KH $5( DQG WKH S%5 GHULYHG ILOOHU '1$ DUH UHSUHVHQWHG E\ FURVVKDWFKHG DQG KDWFKHG UHJLRQV UHVSHFWLYHO\

PAGE 121

LQGXFHG WXPRUV KDUERULQJ WHVW JHQH UHVXOWHG LQ DQ 57/ YDOXH RI 7KLV 57/ LV VLPLODU WR WKH 57/ RI WHVW JHQH 7HVW JHQH SURGXFHG OHVV WKDQ RQHWKLUG WKH DFWLYLW\ RI WHVW JHQH DQG WHVW JHQH 7KH RQO\ GLIIHUHQFH EHWZHHQ WHVW JHQHV DQG ZDV WKH RULHQWDWLRQ RI WKH DGGHG VHTXHQFHV n WR WKH UHSRUWHU JHQH $ SRVVLEOH H[SODQDWLRQ RI WKH GLIIHUHQW WUDQVFULSW OHYHOV PD\ LQYROYH VHTXHQFHV ZLWKLQ WKH LQWHUQDO UHJLRQ WKDW ZKHQ SRVLWLRQHG LQ WKH n WR n RULHQWDWLRQ LQWHUIHUHG ZLWK WKH SRO\DGHQ\ODWLRQ RI WKH WUDQVFULSWV 7KH GLIIHUHQFH LQ RU ODFN RI SRO\DGHQ\ODWHG WHVW JHQH WUDQVFULSWV PD\ KDYH LQWHUIHUHG ZLWK WKHLU VWDELOLW\ ZKHUHDV WKH UHIHUHQFH JHQH WUDQVFULSWV ZRXOG KDYH UHPDLQHG XQDIIHFWHG UHVXOWLQJ LQ D ORZHU 57/ IRU WHVW JHQH $ ILQDO VHW RI H[SHULPHQWV LQYROYLQJ WKH LQWHUQDO $GKO SURPRWHU UHJLRQ EHWZHHQ DQG LQYROYHG LQVHUWLRQ RI D GXSOLFDWH UHJLRQ DGMDFHQW WR WKDW RI WHVW JHQHV DQG 7HVW JHQH ZDV RSHQHG DW D 6DLO VLWH LPPHGLDWHO\ XSVWUHDP RI WKH VHTXHQFHV )LJ f DQG WKH 6DLO WR;KRO '1$ IUDJPHQW RI S(1 FRQWDLQLQJ WKH WR VHTXHQFHV ZDV VXEFORQHG LQ WKH LQYHUVH RULHQWDWLRQ JLYLQJ ULVH WR WHVW JHQH )LJ $f 6LPLODUO\ WHVW JHQH ZDV RSHQHG DW WKH 6DLO VLWH EHWZHHQ WKH SRVLWLRQ DQG WKH LQYHUWHG UHJLRQ $ VHFRQG IUDJPHQW FRQVLVWLQJ RI WKHVH LQWHUQDO VHTXHQFHV ZDV VXEFORQHG LQ VXFK D ZD\ DV WR JLYH ULVH WR D GXSOLFDWH LQWHUQDO UHJLRQ LQ WKH LQYHUWHG RULHQWDWLRQ UHVXOWLQJ LQ WHVW JHQH )LJ %f 6, QXFOHDVH K\EULGL]DWLRQ DQDO\VLV RI WKHVH JHQHV IURP LQGXFHG WXPRUV UHVXOWHG LQ QHJOLJLEOH WUDQVFULSW OHYHOV )LJ ODQHV 8 DQG 8f 7KH 57/ YDOXH RI WHVW JHQH IURP LQGXFHG VXQIORZHU WXPRU WLVVXH ZDV )LJ f 7KLV 57/ ZDV DOPRVW WHQ IROG KLJKHU WKDQ WKDW RI WHVW JHQH %RWK WHVW JHQHV DQG KDG WKH GRPDLQ LQ FORVH SUR[LPLW\ WR WKH 7$7$SUR[LPDO GRPDLQ ZLWK WKH VDPH ES OLQNHU LQVHUWLRQ DW )LJ f $V SUHYLRXVO\ GLVFXVVHG WKLV ES DGGLWLRQ PD\ KDYH DIIHFWHG FRRSHUDWLYLW\ EHWZHHQ SURWHLQV ZLWKLQ WKH SUR[LPDO SRUWLRQ DQG WKH UHJLRQ RI WKH PDL]H $GKO SURPRWHU LQ VXQIORZHU FHOOV 7HVW JHQH PD\ KDYH RYHUFRPH WKH HIIHFWV RI WKLV GLVUXSWLRQ ZLWK WKH DGGLWLRQ RI WKH VHFRQG LQYHUWHG LQWHUQDO UHJLRQ f 7KH WHVW JHQH DV

PAGE 122

$ S$GK 7 7HVW JHQHf %DP +, S8& 6SLO +LQ GLOO S8& S$GK 7 7HVW JHQHf S(1 6DIL ;KR, 6DIL GHSKRVSKRU\ODWH %DP +, 6; ;ED V[ rf 3VnOO S8& $5( 6SK +LQ GLOO S8& % )LJ &RQVWUXFWLRQ RI S$GK7OO $f DQG S$GK7 %f ,PSRUWDQW UHVWULFWLRQ VLWHV DUH GHVLJQDWHG 1XPEHUV LQ SDUHQWKHVLV UHSUHVHQW QRUPDO ORFDWLRQ RI UHVWULFWLRQ VLWHV LQ UHODWLRQ WR WKH VWDUW RI WUDQVFULSWLRQ f 7KH $5( LV UHSUHVHQWHG E\ FURVVKDWFKHG UHJLRQ 2ULHQWDWLRQ RI WKH UHSRVLWLRQHG LQWHUQDO UHJLRQ LV GHVLJQDWHG E\ KRUL]RQWDO DUURZV 6ROLG UHJLRQ DGMDFHQW WR UHSUHVHQWV OLQNHU VHTXHQFHV

PAGE 123

)LJ 5HSUHVHQWDWLYH JHO RI 6, K\EULGL]DWLRQ SURWHFWLRQ DVVD\ RI UHIHUHQFH JHQH DQG VSHFLILHG WHVW JHQHV WUDQVIHUUHG LQWR $J YLD S 3RO\$f51$ ZDV LVRODWHG IURP WXPRU WLVVXH WKDW ZDV XQLQGXFHG 8f RU VXEMHFWHG WR DQDHURELF VWUHVV IRU KRXUV ,f /DQH SJf FRQWDLQV P51$ ZLWK WHVW JHQH ODQHV 8 SLf DQG SJf ZLWK WHVW JHQH DQG ODQHV 8 SJf DQG SJf ZLWK WHVW JHQH ODQHV 8 LOf DQG SJf ZLWK WHVW JHQH DQG ODQHV 8 SJf DQG SJf ZLWK WHVW JHQH 3URWHFWHG IUDJPHQWV DUH GHVLJQDWHG /DQH f FRQWDLQV HQG ODEHOHG +DH,, JHQHUDWHG -f; PDUNHUV ZLWK VL]H GHVLJQDWLRQV ,OOXVWUDWLRQV RI HDFK WHVW JHQH DQG WKH 57/ YDOXH IRU HDFK DUH SUHVHQWHG /RFDWLRQ DQG RULHQWDWLRQ RI WKH SURPRWHU UHJLRQV DUH UHSUHVHQWHG E\ FURVVKDWFKHG DUURZ 7KH $5( LV UHSUHVHQWHG E\ FURVVKDWFKHG UHJLRQ 6ROLG UHJLRQ DGMDFHQW WR UHSUHVHQWV OLQNHU VHTXHQFHV

PAGE 124

L 7L 3 7L 3 7L 3 7L 3 f§ f§ f SUREH WHVW UHIHUHQFH FRQVWUXFW mL nDUH $ c $ & /L 57/ OLQNHU

PAGE 125

GHSLFWHG LQ ILJXUH % KDG WZR LQYHUWHG UHJLRQV LQ WDQGHP XSVWUHDP RI WKH SRVLWLRQ 7KH 57/ RI WKLV WHVW JHQH PXWDQW ZDV ZKLFK LV VLJQLILFDQWO\ OHVV WKDQ WKH 57/ YDOXH RI WHVW JHQH )LJ f VXJJHVWLQJ WKDW PRUH LV QRW DOZD\V EHWWHU 0XWDWLRQDO DQDO\VLV RI WKH $GKO DQDHURELF UHVSRQVH HOHPHQW $5( LQ VXQIORZHU $ VWUHWFK RI VHTXHQFHV ZLWKLQ WKH RI PDL]H $GKO SURPRWHU KDV EHHQ LGHQWLILHG WKDW FRQIHUV DQDHURELF VWUHVV VSHFLILF LQGXFWLRQ LQ PDL]H SURWRSODVWV :DONHU HW DO f 7KLV UHJLRQ ZLWKLQ WKH SURPRWHU KDV EHHQ GHVLJQDWHG WKH DQDHURELF UHVSRQVH HOHPHQW $5(f DQG KDV EHHQ PDSSHG EHWZHHQ WR ZLWK UHVSHFW WR WKH VWDUW RI WUDQVFULSWLRQ 7R LQYHVWLJDWH ZKDW HIIHFW WKLV UHJLRQ EHVWRZV XSRQ JHQH DFWLYLW\ LQ WKH VXQIORZHU FHOO HQYLURQPHQW D QXPEHU RI PXWDWLRQV LQYROYLQJ WKH $5( LQ WKH WHVW JHQH ZHUH FRQVWUXFWHG DQG DVVD\HG LQ WXPRUV 7KH LQLWLDO PXWDWLRQ LQYROYHG WKH LQWHUQDO GHOHWLRQ RI WKH $5( IURP WKH $GKO SURPRWHU RI WKH $GKO FKLPHULF WHVW JHQH 7HVW JHQH RI S$GK7 ZDV RSHQHG DW WKH 3VWO VLWH DW %DO GLJHVWHG DQG 3VWO OLQNHUV DGGHG 7KH GLVWDO DQG LQWHUQDO SURPRWHU UHJLRQV WR f IURP S% 'HQQLV HW DO f ZHUH VXEVHTXHQWO\ SRVLWLRQHG n WR WKH WUXQFDWHG WHVW JHQH )LJ f 7KLV UHVXOWLQJ WHVW FRQVWUXFW GHVLJQDWHG f SRVVHVVHG WKH HQWLUH $GKO SURPRWHU ODFNLQJ ES EHWZHHQ DQG UHODWLYH WR WKH VWDUW RI WUDQVFULSWLRQ ZLWK D VLQJOH JXDQLQH UHVLGXH VXEVWLWXWHG IRU WKLV UHJLRQ DV D E\SURGXFW RI WKH 3VWO OLQNHU DGGLWLRQ )LJ $5( GHOHWLRQf 7KH SXWDWLYH &$$7 ER[ **&&$$$f DW SRVLWLRQ 'HQQLV HW DO f UHPDLQHG XQWRXFKHG E\ WKHVH PDQLSXODWLRQV DV ZDV WKH 7$7$ ER[ :KHQ DVVD\HG LQ DQDHURELFDOO\ VWUHVVHG KRXUVf WXPRU WLVVXH WHVW JHQH GLVSOD\HG QHJOLJLEOH WUDQVFULSWLRQDO DFWLYLW\ ZLWK DQ 57/ YDOXH OHVV WKDQ FRPSDUHG WR ZLOG W\SH OHYHOV )LJ ODQH ,f ,Q DGGLWLRQ UHPRYDO RI WKLV UHJLRQ GLG QRW UHVXOW LQ HOHYDWHG WUDQVFULSWLRQ LQ XQLQGXFHG WXPRUV )LJ ODQH 8f 7KHVH UHVXOWV LQGLFDWHG WKDW WKH $5( RI PDL]H $GKO DV GHILQHG LQ PDL]H SURWRSODVWV

PAGE 126

S$GK 7 %DP +, (FR 5O f ;ED 3VIO 6DO L /BOf§/ S8& S8& 3LOO +LQ GLOOf 3Q 6SK O +LQ GLOO S8& S$GK 7 $GKO GLVWDO WR f %DP +, 3DO %DP + 3DW )LJ &RQVWUXFWLRQ RI S$GK7 ,PSRUWDQW UHVWULFWLRQ VLWHV DUH GHVLJQDWHG 1XPEHUV LQ SDUHQWKHVLV UHSUHVHQW ORFDWLRQ RI UHVWULFWLRQ VLWHV LQ UHODWLRQ WR WKH VWDUW RI WUDQVFULSWLRQ f ZLWK f UHSUHVHQWLQJ GHOHWLRQ RI $5( )LJ f 7KH $5( LV UHSUHVHQWHG E\ FURVVKDWFKHG UHJLRQ

PAGE 127

$5( GHOHWLRQ LVf 7$7*77&&$&7&& $* *7 ** $* & 7* & $M** **& &$$$ &&* DWDFDDJJWJDJJWFFDFFWFJ,DFJWFFMFFJJWWnLJJF ZLOG W\SH f r f f f WDWJWWFFDFWFFDJJWJJDJFWJFD,JFFFFJJWWWFJFDDJFFJFJFDFJWJJWWWJFWWJFFFDFDJJF*&&$$$&&* $7$&$$**7*$**7&&$&&7&*O$&*7&****&&$$$*&*77&**&*&*7*&$&&$$$&*$$&***7*7&&*&&**777**& $5( &&$$7 %R[ $5( UHLQVHUWLRQ f n 7$7*77&&$&7&&$**7**$* -*J,W&*$& &7 *& D_J& && &**77 7& *& $$* && *& *& $&*7**7 77 *&7 7*&& & $& $* *& 6**&7&*$&&*& **&&$$A&&* $7$&$$**7*$**7&&$&&7& 6 && $*&7M6 *M$&* 7 &* ** *& & $$ $* &*77& ** &*&* 7 *& $& & $ $$& $ $& ** *7 *7& &* ***$*&7**&& &&**77OM**& 6DL L 3VW L V[ fI $5( $5( RSSRVLWH LQVHUWLRQ f 7$7*77&&$&7&&$**7**$* -**7&*$**&&*&&7*7***&$$*&$$$&&$&*7*&*&**&77*&*$$$&&****&7*&$* $7$& $$** 7 *$**7&&$&&7& 6 && $&& 7& &*& &**$&$&&&*77&*777**7*&$&*&*&& *$$& &7 77 ** && & &*-$& *7 & 6; &*$&&*&**&&$$3&&* $5( LQYHUVH RULHQWDWLRQ )LJ 6HTXHQFHV RI WKH RI WKH PDL]H $GKO DQDHURELF UHVSRQVH HOHPHQW $5(f UHJLRQ LQ WKH ZLOG W\SH SURPRWHU $5( GHOHWLRQ WHVW JHQHf DQG UHLQVHUWLRQ RI $5( LQWR WKH SURPRWHU LQ LWV QRUPDO n WR n RULHQWDWLRQ WHVW JHQHf RU RSSRVLWH RULHQWDWLRQ WHVW JHQHf /RFDWLRQ DQG RULHQWDWLRQ RI $5( LV LQGLFDWHG 5HVWULFWLRQ VLWHV DUH DV GHVLJQDWHG LQFOXGLQJ WKH 6; OLJDWLRQ MXQFWLRQ &$$7 PRWLI LV SUHVHQWHG $GGLWLRQDO VHTXHQFHV WKDW UHVXOWHG DV D E\SURGXFW RI WKH PDQLSXODWLRQV DUH LQ VKDGHG ER[HV

PAGE 128

UHIHUHQFH FRQVWUXFW $5( LI 57/ )LJ 5HSUHVHQWDWLYH JHO RI 6 K\EULGL]DWLRQ SURWHFWLRQ DVVD\ RI UHIHUHQFH JHQH DQG VSHFLILHG WHVW JHQHV WUDQVIHUUHG LQWR $J YLD S 3RO\$f51$ ZDV LVRODWHG IURP WXPRU WLVVXH WKDW ZDV XQLQGXFHG 8f RU VXEMHFWHG WR DQDHURELF VWUHVV IRU KRXUV ,f /DQHV 8 _LJf DQG Jf FRQWDLQV P51$ ZLWK WHVW JHQH ,OOXVWUDWLRQV RI WHVW JHQH DQG WHVW JHQH DQG WKH 57/ YDOXH IRU HDFK DUH SUHVHQWHG /RFDWLRQ DQG RULHQWDWLRQ RI WKH SURPRWHU UHJLRQV DQG $5(V DUH UHSUHVHQWHG E\ VWLSSOHG DUURZ DQG FURVVKDWFKHG DUURZ UHVSHFWLYHO\

PAGE 129

:DONHU HW DL f ZDV DOVR UHVSRQVLEOH IRU WKH DQDHURELF UHVSRQVH RI PDL]H $GKO SURPRWHU UHJXODWHG WUDQVFULSWLRQ LQ VXQIORZHU FHOOV $GGLWLRQDO SURPRWHU PXWDWLRQV LQYROYLQJ UHLQVHUWLRQ RI WKH $5( UHTXLUHG LWV LVRODWLRQ IURP WHVW JHQH RI S$GK7 $ ES +DH,,, IUDJPHQW SRVVHVVLQJ ES RI WKH S8&GHULYHG SRO\OLQNHU DQG ES RI WKH SURPRWHU VHTXHQFHV WR WKDW FRQWDLQHG WKH $5( ZDV LVRODWHG DQG ;KRO OLQNHUV ZHUH DGGHG )LJ f 7KLV ES IUDJPHQW ZDV WKHQ VXEFORQHG LQWR D VHFRQG S8& YHFWRU GHULYDWLYH S8&5,; WKDW KDG KDG WKH (FR.O VLWH ZLWKLQ LWV SRO\OLQNHU UHSODFHG ZLWK DQ ;KRO UHVWULFWLRQ VLWH (FR5, VLWHV ZHUH UHJHQHUDWHG RQ HLWKHU VLGH RI WKH DGGHG ;KRO OLQNHUVf 7KH UHVXOWLQJ SODVPLG S8&$5( KDG GXSOLFDWH VHWV RI YHFWRU SRO\OLQNHUV DQG WKH ES IUDJPHQW KDUERULQJ WKH $GKO $5( )LJ f 7KH $5( ZDV WKHQ LVRODWHG IURP WKLV FRQVWUXFW E\ GLJHVWLRQ ZLWK ;KRO DQG 6DLO UHVWULFWLRQ HQ]\PHV DQG VXEFORQHG LQWR YDULRXV SRVLWLRQV RI WKH WHVW JHQH 7KH LVRODWHG $5( ZDV VXEVHTXHQWO\ FORQHG LQ ERWK RULHQWDWLRQV LQWR WKH SURPRWHU RI DQ $GKOt WHVW JHQH LQ WKH YLFLQLW\ IURP ZKLFK WKHVH VDPH VHTXHQFHV KDG EHHQ RULJLQDOO\ GHOHWHG 7HVW JHQH KDG WKH $5( UHLQVHUWHG LQ LWV QRUPDO n WR n RULHQWDWLRQ 7KLV LQVHUWLRQ UHVXOWHG LQ WKH $5( RFFXS\LQJ LWV FXVWRPDU\ SRVLWLRQ ZLWKLQ WKH SURPRWHU DORQJ ZLWK WKH DGGLWLRQ RI ES DW WKH SRVLWLRQ DQG ES DW JHQHUDWHG IURP WKH DGGHG OLQNHUV )LJ f 7HVW JHQH DOVR KDG WKH $5( UHLPSODQWHG DW WKLV VDPH SRVLWLRQ EXW LQ WKH UHYHUVH RULHQWDWLRQ ZLWK WKH VXEVHTXHQW DGGLWLRQ RI ES DW DQG ES DW )LJ f 6, K\EULGL]DWLRQ PDSSLQJ RI JHQH SURGXFWV IURP HDFK RI WKHVH JHQHV UHVXOWHG LQ QHJOLJLEOH SURWHFWLRQ E\ WUDQVFULSWV IURP XQLQGXFHG VXQIORZHU WXPRUV )LJ ODQHV 8f 3RO\$f51$ IURP LQGXFHG WXPRUV KDUERULQJ WHVW JHQH LQGLFDWHG DQ 57/ YDOXH RI 7HVW JHQH KDG DQ 57/ RI PDUJLQDOO\ DERYH EDFNJURXQG OHYHOV %RWK 57/V ZHUH KLJKHU WKDQ WKDW RI WHVW JHQH IURP ZKLFK WKH $5( KDG EHHQ H[FLVHG EXW VWLOO ORZ FRPSDUHG WR ZLOG W\SH OHYHOV )LJ f

PAGE 130

S$GK 7 7HVW JHQHf f ;ED 3VW 6SK S8&$5( S8&5,;BA ;KR O +LQ GLOO 3VW ;ED 6D, / (FR5, (FR5, %DP + ;ED 3VIO ;ERO %DP+ L 6D, , $5( $5( ES ;ERO (FR5, O r )LJ ,VRODWLRQ DQG FORQLQJ VFKHPH RI $GKO $5( LQWR S8& WR IRUP S(1 ,PSRUWDQW VLWHV DQG GHVFULSWLRQV RI SODVPLGV DQG LQWHUPHGLDWHV DUH DV SUHYLRXVO\ SUHVHQWHG $5( LOOXVWUDWHV IUDJPHQW XVHG WR UHLQVHUW RU UHSRVLWLRQ $5( 3ODVPLG YHFWRU S8&5,; LV DV GHVFULEHG LQ WH[W 7KH $5( LV UHSUHVHQWHG E\ FURVVKDWFKHG UHJLRQ +RUL]RQWDO DUURZ LQGLFDWHV n WR n RULHQWDWLRQ RI WKH $5(

PAGE 131

)LJ 5HSUHVHQWDWLYH JHO RI 6, K\EULGL]DWLRQ SURWHFWLRQ DVVD\ RI UHIHUHQFH JHQH DQG VSHFLILHG WHVW JHQHV WUDQVIHUUHG LQWR $J YLD S 3RO\$f51$ ZDV LVRODWHG IURP WXPRU WLVVXH WKDW ZDV XQLQGXFHG 8f RU VXEMHFWHG WR DQDHURELF VWUHVV IRU KRXUV ,f /DQH SJf FRQWDLQV P51$ ZLWK WHVW JHQH ODQH SJf ZLWK WHVW JHQH DQG ODQHV 8 SJf DQG SJf ZLWK WHVW JHQH ODQHV 8 SLf DQG SJf ZLWK WHVW JHQH 3URWHFWHG IUDJPHQWV DUH GHVLJQDWHG /DQH ff FRQWDLQV HQG ODEHOHG +DH,, JHQHUDWHG If; PDUNHUV ZLWK VL]H GHVLJQDWLRQV ,OOXVWUDWLRQV RI HDFK WHVW JHQH DQG WKH 57/ YDOXH IRU HDFK DUH SUHVHQWHG /RFDWLRQ DQG RULHQWDWLRQ RI WKH SURPRWHU UHJLRQV DQG $5(V DUH UHSUHVHQWHG E\ VWLSSOHG DUURZ DQG FURVVKDWFKHG DUURZ UHVSHFWLYHO\ 7KLFN YHUWLFDO OLQHV LQGLFDWLYH RI ES LQVHUWLRQ

PAGE 132

8 L U 8 ‘ SUREH r WHVW UHIHUHQFH FRQVWUXFW f $5( 57/  ? OLQNHUV OLQNHUV

PAGE 133

7KHVH UHVXOWV LQGLFDWH WKDW WKH $GKO SURPRWHU VHTXHQFHV SRVLWLRQHG EHWZHHQ DQG SRVVHVV UHJXODWRU\ HOHPHQWV UHVSRQVLEOH IRU WKH DQDHURELF UHVSRQVH RI WKH WHVW JHQHV LQ VXQIORZHU FHOOV 7KH PDL]H $GKO $5( ZDV UHFRJQL]HG LQ WKLV KHWHURORJRXV V\VWHP LQ ERWK RULHQWDWLRQV EXW WR D PXFK ORZHU OHYHO LQ WKH UHYHUVH RULHQWDWLRQ 7KH UHODWLYHO\ ORZ 57/ YDOXHV IRU HDFK RI WKH WHVW JHQHV DQG PD\ EH LQGLFDWLYH RI D IDLUO\ VWULQJHQW SRVLWLRQ HIIHFW 7HVW JHQH KDV WKH $5( LQ LWV QRUPDO RULHQWDWLRQ VHSDUDWHG IURP WKH SXWDWLYH &$$7 ER[ VHTXHQFHV DQG 7$7$ ER[ E\ DQ DGGLWLRQDO ES QRW QRUPDOO\ SUHVHQW LQ WKH ZLOG W\SH SURPRWHU 7KH SK\VLFDO VHSDUDWLRQ RI WKHVH EDVHV E\ ES PD\ KDYH HIIHFWHG LQWHUDFWLRQV EHWZHHQ SURWHLQV DVVRFLDWHG ZLWK WZR UHJXODWRU\ HOHPHQWV RI WKHVH UHJLRQV 6LPLODUO\ UHJXODWRU\ HOHPHQWV ZLWKLQ WKH UHJLRQ ZHUH VHSDUDWHG IURP WKH $5( E\ DGGLWLRQDO EDVHV ZKLFK FRXOG VLPLODUO\ SODFH D VWUDLQ XSRQ '1$ ELQGLQJ SURWHLQ LQWHUDFWLRQV 7KLV SRVVLELOLW\ LV FRQVLVWHQW ZLWK GDWD REWDLQHG IRU WHVW JHQH )LJ f LQ ZKLFK WKH $5( ZDV VHSDUDWHG IURP WKH UHJLRQ E\ ES UHVXOWLQJ LQ D ORZ 57/ RI 7KH $5( ZDV UHORFDWHG LQ D GLIIHUHQW UHJLRQ RI WKH SURPRWHU WR LQYHVWLJDWH D SRVVLEOH SRVLWLRQ HIIHFW LQ UHODWLRQ WR RWKHU SURPRWHU VHTXHQFHV 7KH 6DO WR ;KRO IUDJPHQW RI S8&$5( FRQWDLQLQJ WKH DQDHURELF UHVSRQVH HOHPHQW ZDV FORQHG LQ ERWK RULHQWDWLRQV LPPHGLDWHO\ XSVWUHDP RI D n GHOHWHG WHVW JHQH LQWHUPHGLDWH DW SRVLWLRQ 7KLV FRQVWUXFW ODFNHG ERWK WKH GLVWDO VHTXHQFHV RI WKH $GKO SURPRWHU DQG WKH HQGRJHQRXV $5( )LJ f 7KLV PDQHXYHU JDYH ULVH WR WHVW JHQHV DQG ZLWK WKH UHLQVHUWHG $5( LQ LWV QRUPDO n WR n RULHQWDWLRQ DQG LQ WKH UHYHUVH RULHQWDWLRQ UHVSHFWLYHO\ DERXW ES IXUWKHU XSVWUHDP IURP LWV DFFXVWRPHG SRVLWLRQ )LJ f :KHQ VXEMHFWHG WR 6, K\EULGL]DWLRQ DQDO\VLV WKHUH ZHUH QHJOLJLEOH OHYHOV RI SUREH SURWHFWLRQ E\ WUDQVFULSWV SURGXFHG E\ WKHVH FKLPHULF JHQHV LQ XQLQGXFHG WXPRUV )LJ ODQHV 8f DQG YHU\ ORZ OHYHOV IURP LQGXFHG SULPDU\ WXPRUV IRU ERWK WHVW JHQHV DQG ZLWK 57/ YDOXHV OHVV WKDQ )LJ DQG ODQHV f

PAGE 134

f S$GK 7 S$GK 7 3DO ^3DQ +mGOOOf!\ +LQG0 3 6SK? +LQ GLOO S8&, S8& S$GK 7 7HVW JHQHf ;ED f 6SK? %DP + 6; 6DO 3VO? +LQ GLOO 9L , S8& r1 S8& $5( )LJ &RQVWUXFWLRQ RI S$GK7 DQG S$GK7 ,PSRUWDQW UHVWULFWLRQ VLWHV DUH GHVLJQDWHG 1XPEHUV LQ SDUHQWKHVLV UHSUHVHQW QRUPDO ORFDWLRQ RI UHVWULFWLRQ VLWHV LQ UHODWLRQ WR WKH VWDUW RI WUDQVFULSWLRQ f 7KH $5( LV UHSUHVHQWHG E\ FURVVKDWFKHG UHJLRQ 2ULHQWDWLRQ RI $5( LV LOOXVWUDWHG E\ KRUL]RQWDO DUURZ 6HH ILJXUH IRU RULJLQ RI S$GK7

PAGE 135

)LJ 5HSUHVHQWDWLYH JHO RI 6 K\EULGL]DWLRQ SURWHFWLRQ DVVD\ RI UHIHUHQFH JHQH DQG VSHFLILHG WHVW JHQHV WUDQVIHUUHG LQWR $J YLD S 3RO\$f51$ ZDV LVRODWHG IURP WXPRU WLVVXH WKDW ZDV XQLQGXFHG 8f RU VXEMHFWHG WR DQDHURELF VWUHVV IRU KRXUV ,f /DQH -Jf FRQWDLQV P51$ ZLWK WHVW JHQH ODQH _LJf ZLWK WHVW JHQH DQG ODQHV 8 LJf DQG SJf ZLWK WHVW JHQH ODQHV 8 LOf DQG _Jf ZLWK WHVW JHQH 3URWHFWHG IUDJPHQWV DUH GHVLJQDWHG /DQH ff FRQWDLQV HQG ODEHOHG +DH,, JHQHUDWHG !; PDUNHUV ZLWK VL]H GHVLJQDWLRQV ,OOXVWUDWLRQV RI HDFK WHVW JHQH DQG WKH 57/ YDOXH IRU HDFK DUH SUHVHQWHG /RFDWLRQ DQG RULHQWDWLRQ RI WKH SURPRWHU UHJLRQV DQG $5(V DUH UHSUHVHQWHG E\ VWLSSOHG DUURZ DQG FURVVKDWFKHG DUURZ UHVSHFWLYHO\ 7KLFN YHUWLFDO OLQHV LQGLFDWLYH RI ES LQVHUWLRQ

PAGE 136

, } nSUREH WHVW ‘ UHIHUHQFH FRQVWUXFW :DI $5( O Zf§ 57/

PAGE 137

$V D ZKROH WKH $5( H[SHULPHQWV VKRZHG WKDW WKH $5( DV GHILQHG LQ PDL]H LV IXQFWLRQDOO\ DFWLYH LQ VXQIORZHU DQG WKDW WKLV VHTXHQFH DFWV DV D SRVLWLYH UHJXODWRU VLQFH LWV GHOHWLRQ GLG QRW UHVXOW LQ LQFUHDVHG FRQVWLWXWLYH H[SUHVVLRQ ,Q DGGLWLRQ $5( IXQFWLRQ DSSHDUV WR EH SRVLWLRQ GHSHQGHQW ZLWK D ODUJH ORVV RI DFWLYLW\ VHHQ DV D UHVXOW RI SODFHPHQW IXUWKHU XSVWUHDP WKDQ LWV QRUPDO ORFDWLRQ LQ WKH 7$7$SUR[LPDO GRPDLQ 'LVFXVVLRQ 7HVW DQG UHIHUHQFH JHQHV FRPSRVHG RI WKH PDL]H $GKO SURPRWHU DQG FRGLQJ UHJLRQ ZHUH LQVHUWHG LQWR VKXWWOH YHFWRUV ZLWK WKHLU VXEVHTXHQW LQFRUSRUDWLRQ LQWR $ WXPHIDFLHQV 7'1$ IURP ZKLFK WKH HQGRJHQRXV JHQH KDG EHHQ GHOHWHG %UXFH DQG *XUOH\ f 7KHVH FRQVWUXFWV ZHUH WKHQ WUDQVIHUUHG DQG DVVLPLODWHG LQWR WKH JHQRPH RI VXQIORZHU VHHGOLQJ K\SRFRW\O FHOOV 7KH UHVXOWLQJ WXPRU WLVVXH ZDV HLWKHU IUR]HQ LPPHGLDWHO\ XSRQ KDUYHVWLQJ XQLQGXFHGf RU DQDHURELFDOO\ VWUHVVHG IRU VL[ KU LQGXFHGf 6LQFH WKH UHIHUHQFH JHQH UHPDLQHG XQFKDQJHG LQ DOO H[SHULPHQWV WKH WUDQVFULSWV SURGXFHG E\ WKH GLIIHUHQW WHVW JHQHV FRXOG EH GLUHFWO\ FRPSDUHG ([SHULPHQWV XWLOL]LQJ SRO\$f51$ H[WUDFWHG IURP XQLQGXFHG WXPRU WLVVXH LQGLFDWHG WKDW P51$ GHULYHG IURP WKH UHIHUHQFH DQG WHVW JHQHV ZDV SUHVHQW RQO\ DW YHU\ ORZ OHYHOV 5HIHUHQFH JHQH H[SUHVVLRQ ZDV LQGXFHG LQ WXPRUV E\ DQDHURELF VWUHVV FRQILUPLQJ WKDW WKH HOHPHQW UHVSRQVLEOH IRU WKH DQDHURELF UHVSRQVH ZDV SUHVHQW LQ WKH n UHJLRQ RI WKH $GKO JHQH 5HIHUHQFH WR 57/V LQ WKH IROORZLQJ GLVFXVVLRQ UHIHUV WR WKH TXDQWLW\ RI WHVW JHQH SURGXFWV IURP DQDHURELFDOO\ VWUHVVHG WXPRUV 9HFWRU SRVLWLRQ HIIHFWV 7UDQVFULSWLRQ OHYHOV RI WKH WHVW JHQHV ZHUH DIIHFWHG E\ WKHLU SRVLWLRQ LQ UHODWLRQ WR WKH 7'1$ UHJLRQ RI WKH VKXWWOH YHFWRUV :KHQ WKH SURPRWHU RI WKH FKLPHULF WHVW JHQHV ZHUH SRVLWLRQHG GRZQVWUHDP WR WKH 7'1$ )LJ f WKH 57/ YDOXHV ZHUH LQIODWHG $

PAGE 138

QXPEHU RI n GHOHWLRQ PXWDQWV ZLWK HQGSRLQWV EHWZHHQ DQG GLG QRW VKRZ GUDVWLFDOO\ UHGXFHG DFWLYLW\ 7KH 57/ YDOXHV IRU n GHOHWLRQV WR DQG ZHUH DQG UHVSHFWLYHO\ 7KH DFWLYLW\ 57/ f RI WKH GHOHWLRQ LV FORVH WR WKH b ZLOG W\SH DFWLYLW\ RI WKLV VDPH PDL]H $GKO SURPRWHU PXWDWLRQ IXVHG WR D &$7 UHSRUWHU JHQH LQ PDL]H SURWRSODVWV REVHUYHG E\ :DONHU HW DO f EXW GLIIHUV IURP WKH b DFWLYLW\ UHSRUWHG E\ /HH HW DO f DOVR LQ PDL]H SURWRSODVWV DQG WKH b VHHQ LQ LQGXFHG VXQIORZHU FHOOV DV GHVFULEHG LQ &KDSWHU 6SHFLILF VHTXHQFHV f WR FHUWDLQ 7'1$ JHQHV KDYH EHHQ VKRZQ WR KDYH D SRVLWLYH LQIOXHQFH XSRQ WKH PDL]H $GKO SURPRWHU ,Q WREDFFR D ES SDOLQGURPH ORFDWHG ZLWKLQ WKH SURPRWHU RI WKH RFWRSLQH V\QWKDVH RFVf JHQH DOORZV IRU LQFUHDVHG DFWLYLW\ RI D &$7 JHQH UHJXODWHG E\ WKH $GKO SURPRWHU FRQVLVWLQJ RI VHTXHQFHV EHWZHHQ DQG (OOLV HW DO f 6LPLODUO\ WKH DFWLYDWRU UHJLRQ %UXFH DQG *XUOH\ f XSVWUHDP RI WKH 7'1$ JHQH DOVR FRQIHUUHG D SRVLWLYH HIIHFW RQ DFWLYLW\ RQ WKH PDL]H $GKO SURPRWHU GHOHWHG WR DQG LQ ERWK LQGXFHG DQG XQLQGXFHG VXQIORZHU WXPRU FHOOV XQUHSRUWHG GDWDf 7KH SRVVLELOLW\ WKDW WKH VKXWWOH YHFWRU 7'1$ LQIOXHQFHG WKH PDL]H $GKO SURPRWHU UHJXODWLRQ OHDG WR D FORVHU H[DPLQDWLRQ RI WKH 7'1$ VHTXHQFHV DVVRFLDWHG ZLWK WKH LQVHUWHG JHQHV XSRQ LQFRUSRUDWLRQ LQWR WKH 7LSODVPLG )LJ f $ VHDUFK RI WKH VHTXHQFHV ZLWKLQ WKH 7'1$ UHJLRQ RI WKH VKXWWOH YHFWRU UHYHDOHG D VWUHWFK RI ES ORFDWHG ES n WR WKH D JHQH FRGLQJ UHJLRQ WKDW KDV b KRPRORJ\ WR WKH ES RFV HOHPHQW (OOLV HW DO f 7R LQYHVWLJDWH ZKHWKHU WKLV RFV HOHPHQWOLNH VHTXHQFH XSVWUHDP RI WKH D JHQH ZDV LQWHUIHULQJ ZLWK WHVW JHQH DQDO\VLV D VHFRQG SODVPLG S f ZLWK D VHFWLRQ RI WKH 7'1$ LQFOXGLQJ WKH n IODQNLQJ UHJLRQ RI WKH D JHQH H[FLVHG ZDV HPSOR\HG DV D VKXWWOH YHFWRU 5DWKHU WKDQ GHFUHDVLQJ H[SUHVVLRQ RI WHVW JHQHV WUXQFDWHG WR DQG WKH 57/V VXEVWDQWLDOO\ LQFUHDVHG WR OHYHOV IROG KLJKHU WKDQ WKH WHVW JHQH SRVVHVVLQJ WKH ZLOG W\SH SURPRWHU WKDW H[WHQGHG ES XSVWUHDP RI WKH WUDQVFULSWLRQ LQLWLDWLRQ VLWH &RPSDULVRQ RI WKH WZR GLIIHUHQW W\SHV RI LQFRUSRUDWLRQ LQGLFDWHV WKDW WKH SUHVHQFH RI D QHJDWLYH HOHPHQW LQ WKH GLVWDO UHJLRQ RI WKH SURPRWHU DORQH ZRXOG QRW

PAGE 139

VDWLVIDFWRULO\ H[SODLQ WKH LQFUHDVH LQ WUDQVFULSWLRQ DFWLYLW\ $OWHUQDWLYHO\ D SRVLWLRQ HIIHFW RI WKH WHVW JHQH PD\ VWLOO DFFRXQW IRU WKH LQFUHDVHG 57/V 5HPRYDO RI ES RI WKH 7'1$ UHJLRQ RI WKH VKXWWOH YHFWRU FRQWDLQLQJ WKH D SURPRWHU ZLWK WKH RFV HOHPHQWOLNH VHTXHQFHV QRW RQO\ GLG QRW ORZHU WKH n GHOHWLRQ PXWDQW 57/V EXW UDWKHU LQFUHDVHG WUDQVFULSW SURGXFWLRQ ,W ZDV WKHUHIRUH DSSDUHQW WKDW WKH VHTXHQFHV ZLWKLQ WKLV ES UHJLRQ ZHUH QRW UHVSRQVLEOH IRU WKH SRVLWLYH HIIHFW RQ DFWLYLW\ 3UHVXPDEO\ RWKHU 7'1$ VHTXHQFHV WKDW KDG QRW EHHQ H[FLVHG IURP WKH VKXWWOH YHFWRU DUH DIIHFWLQJ P51$ OHYHOV $ OLNHO\ FDQGLGDWH UHVSRQVLEOH IRU FRQIHUULQJ WKH SRVLWLYH WUDQVFULSWLRQ HIIHFW RQ WKH WHVW JHQHV ZDV WKH RFV HOHPHQW ORFDWHG ZLWKLQ WKH RFV SURPRWHU 7KLV HOHPHQW KDV EHHQ VKRZQ WR KDYH D SRVLWLYH LQIOXHQFH XSRQ WUDQVFULSWLRQ SURGXFWV RI WKH RFV JHQH /HLVQHU DQG *HOYLQ f DQG WKH KHWHURORJRXV PDL]H $GKO SURPRWHU WR f SRVLWLRQHG XSVWUHDP RI D &$7 UHSRUWHU JHQH LQ WUDQVJHQLF WREDFFR (OOLV HW DO Df DQG D VLPLODU FKLPHULF FRQVWUXFW ^$GKO SURPRWHU WR f LQ PDL]H SURWRSODVWV (OOLV HW DO Ef /HLVQHU DQG *HOYLQ f DQG (OOLV HW DO Ef DOVR FKDUDFWHUL]HG D GLVWDQFH HIIHFW RI WKH RFV HOHPHQW 7KH IXUWKHU DZD\ IURP SURPRWHU HOHPHQWV HJ $5(f RU WKH 7$7$ ER[ WKH OHVV LQIOXHQFH WKLV SRVLWLYH HOHPHQW KDV XSRQ WUDQVFULSWLRQ $OWHUQDWLYHO\ WKH FORVHU WR WKH SURPRWHU HOHPHQWV WKH JUHDWHU WKH SRVLWLYH LQIOXHQFH 7KLV GLVWDQFH SKHQRPHQRQ ZDV DOVR REVHUYHG ZLWK UHVSHFW WR WKH WHVW JHQHV RI WKLV VWXG\ :KHQ HDFK WHVW JHQH ZDV WUDQVIHUUHG YLD S5HI: LQWR $JUREDFWHULXP WKH RFV SDOLQGURPH ZDV ES XSVWUHDP %DUNHU HW DO f RI WKH PRVW n VHTXHQFHV RI WKH SURPRWHU GHOHWLRQ PXWDQWV UHVXOWLQJ LQ 57/ YDOXHV VOLJKWO\ ORZHU WKDQ WKH ZLOG W\SH OHYHOV 7DEOH f 8SRQ LQVHUWLRQ RI WKH SO GRXEOH JHQH YHFWRUV LQWR 7OHIW RI WKH 7'1$ WKH WHVW JHQHV ZHUH DOVR LQFRUSRUDWHG GRZQVWUHDP RI WKH RFV JHQH )LJ f 7KH UHPRYDO RI WKH LQWHUYHQLQJ 3VWO IUDJPHQW RI WKH VKXWWOH YHFWRU 7'1$ PRYHG WKH RFV HOHPHQW ES FORVHU WR WKH WHVW JHQH SURPRWHUV $OVR WKH SURPRWHU UHJLRQV RI WKH WZR n GHOHWLRQ PXWDQWV WR DQG UHPRYHG WKH PRVW n UHJLRQV ZKLOH PRYLQJ SURPRWHU SUR[LPDO HOHPHQWV VXFK DV WKH 7$7$ ER[ FORVHU WR WKH RFV HOHPHQW E\ ES DQG ES

PAGE 140

UHVSHFWLYHO\ FRPSDUHG WR WKH ZLOG W\SH SURPRWHU 7KLV LQWHUSUHWDWLRQ RI PRYLQJ SRVLWLYH WUDQVFULSWLRQ HOHPHQWV ZLWKLQ WKH 7'1$ FORVHU WR SURPRWHU UHJXODWRU\ UHJLRQV ZLWKLQ WKH $GKO SURPRWHU SURYLGHV D SODXVLEOH PHFKDQLVP ZKHUHE\ WUDQVFULSWLRQ RI WKH WHVW JHQHV DUH LQIOXHQFHG E\ WKHLU SRVLWLRQ ZLWKLQ WKH VKXWWOH YHFWRU +RZHYHU WKH SRVVLELOLW\ RI D QHJDWLYH UHJXODWRU\ HOHPHQW ZLWKLQ WKH $GKO SURPRWHU ZRUNLQJ LQ WDQGHP ZLWK WKH SRVLWLRQ HIIHFW FDQ QRW EH UXOHG RXW ,QIOXHQFH RI WUDQVFULSWLRQ E\ DQ XSVWUHDP 7'1$ HOHPHQWVf LQ WKH VKXWWOH YHFWRU ZDV FRQILUPHG E\ WKH VHSDUDWLRQ RI WKH n GHOHWHG WHVW JHQH IURP WKH 7'1$ RI WKH SO VKXWWOH YHFWRU E\ ES RI ILOOHU '1$ IURP S%5 %ROLYDU HW DL f 7KH 57/ YDOXH RI WKLV GHOHWLRQ GURSSHG IURP WR XSRQ VHSDUDWLRQ IURP WKH 7'1$ ZLWK WKH ILOOHU '1$ )LJ f 7KLV VXJJHVWV WKDW WKH WHVW JHQHV ZHUH EHLQJ DIIHFWHG E\ WKH UHPDLQLQJ VKXWWOH YHFWRU 7'1$ DQG WKLV SRVLWLYH DIIHFW ZDV D IXQFWLRQ RI GLVWDQFH IURP WKH SURPRWHU 7KH FORVHU LW LV WR WKH IRUHLJQ SURPRWHU WKH JUHDWHU WKH SRVLWLYH LQIOXHQFH &KDQJH LQ WHVW JHQH RULHQWDWLRQ UHPRYHG YHFWRU SRVLWLRQ HIIHFW ,Q D VHFRQG DWWHPSW WR DOOHYLDWH WKH LQIOXHQFH E\ WKH 7'1$ VHTXHQFHV XSRQ WHVW JHQH WUDQVFULSWLRQ WKH RULHQWDWLRQ RI WKH WHVW JHQHV ZHUH UHYHUVHG 7KLV SODFHG WKH 7'1$ UHJLRQ RI WKH YHFWRU DQG VXEVHTXHQWO\ WKH 7'1$ RI WKH 7LSODVPLG n WR WKH FRGLQJ UHJLRQ RI WKH WHVW JHQHV )LJ f 7KH n GHOHWHG WHVW JHQHV WR DQG WHVW JHQHV DQG f KDG 57/V RI DQG UHVSHFWLYHO\ FRPSDUHG WR WKH 57/ RI IRU WKH ZLOG W\SH SURPRWHU RI WHVW JHQH SRVLWLRQHG DQG WUDQVIHUUHG LQ WKLV VDPH RULHQWDWLRQ E\ WKLV VKXWWOH YHFWRU Sf 7KH n GHOHWHG FRQVWUXFW WR SRVLWLRQ ZLWK WKH ES ILOOHU '1$ LPPHGLDWHO\ XSVWUHDP n$%5f ZDV RULHQWHG LQ VKXWWOH YHFWRU SO VXFK WKDW WKH SURPRWHU VHTXHQFHV ZHUH DGMDFHQW WR WKH 7'1$ UHJLRQ EXW VHSDUDWHG E\ WKH OHQJWK RI WKH ILOOHU '1$ :KHQ WKH WHVWUHIHUHQFH WUDQVFULSW UDWLR RI n$%5 ZDV GLUHFWO\ FRPSDUHG WR WKDW RI ZLOG W\SH WHVW JHQH WUDQVIHUUHG ZLWK S RSSRVLWH RULHQWDWLRQf LWV 57/ GURSSHG WR WKH VDPH 57/ YDOXH DV WHVW JHQH WUDQVIHUUHG E\

PAGE 141

S WKDW KDG DOVR EHHQ GHOHWHG WR EXW ODFNHG DQ\ ILOOHU '1$ 7KLV LQGLFDWHG WKDW WKH HQKDQFHUOLNH DFWLYLW\ IURP 7'1$ ZDV QHXWUDOL]HG E\ WKH LQFUHDVHG GLVWDQFH IURP WKH WHVW JHQH SURPRWHU RU ZKHQ VLWXDWHG n WR WKH FKLPHULF JHQH RI LQWHUHVW ZKLFK DOVR PD\ EH D UHVXOW RI GLVWDQFH RI WKH HOHPHQW IURP WKH SURPRWHU 7KLV HIIHFW LV VLPLODUO\ REVHUYHG FRQFHUQLQJ WKH SRVLWLRQ RI WKH 7'1$ RFV HOHPHQW ZLWK UHVSHFW WR D WUXQFDWHG SURPRWHU RI RFV JHQH LQ WREDFFR /HLVQHU DQG *HOYLQ f DQG WR D FKLPHULF JHQH UHJXODWHG E\ WKH PDL]H $GKO SURPRWHU GHOHWHG WR WKH SRVLWLRQ LQ PDL]H SURWRSODVWV (OOLV HW DO Ef 7KH IXUWKHU XSVWUHDP WKH HOHPHQW ZDV SRVLWLRQHG IURP WKH SURPRWHU WKH OHVV HIIHFW WKHUH ZDV XSRQ WUDQVFULSWLRQ ZKHQ SODFHG n WR WKH WHVW JHQH SURPRWHU WKHUH ZDV QR HQKDQFHPHQW RI DFWLYLW\ 7KLV SKHQRPHQRQ KDV VLPLODUO\ EHHQ REVHUYHG IRU WKH DFWLYDWRU RI WKH JHQH LQ VXQIORZHU WXPRU WLVVXH :KHQ LQVHUWHG n WR D WUXQFDWHG JHQH WKH WUDQVFULSWLRQDO DFWLYLW\ ZDV QRW DIIHFWHG %UXFH DQG *XUOH\ f 7KH SURPRWHU RI WKH n GHOHWHG WHVW JHQH ZDV VHSDUDWHG IURP WKH S683 6LPRQ HW DO f UHJLRQ RI WKH S VKXWWOH YHFWRU ZLWK ES RI S%5 ILOOHU '1$ DQG LV UHIHUUHG WR DV WHVW JHQH )LJ f 7KH 57/ YDOXH IRU WKLV FRQVWUXFW ZDV ZKLFK LV VLPLODU WR WKH 57/ YDOXH RI IRU WHVW JHQH ODFNLQJ WKH ILOOHU '1$ 7KLV GHPRQVWUDWHV D QHJOLJLEOH DIIHFW RQ WKH WHVW JHQH GHOHWLRQ E\ WKH S%5 ILOOHU '1$ WKH S683 VHTXHQFHV RI WKH VKXWWOH YHFWRU RU WKH GLVWDQW NEf IURP WKH $GKOt UHIHUHQFH JHQH )URP WKHVH UHVXOWV LW ZDV GHWHUPLQHG WKDW WKH WHVW JHQHV WUDQVIHUUHG LQWR $ WXPHIDFLHQV YLD S DQG VXEVHTXHQW LQFRUSRUDWLRQ LQWR WKH VXQIORZHU JHQRPH ZRXOG JLYH DQ DFFXUDWH LQGLFDWLRQ RI SURPRWHU VWUHQJWKV RI GLIIHUHQW SURPRWHU PXWDWHG JHQHV LQ VXQIORZHU WXPRUV $ VXPPDU\ RI DOO SURPRWHU PXWDWLRQV DQG UHVXOWLQJ WHVWUHIHUHQFH UDWLRV DQG 57/ YDOXHV DUH SUHVHQWHG LQ )LJXUHV DQG DQG 7DEOH $QDO\VLV RI WKH PDL]H $GKO $5( LQ VXQIORZHU 7KH n GHOHWHG WHVW JHQH WUXQFDWHG WR KDG DERXW b OHVV LQGXFHG WUDQVFULSWLRQDO DFWLYLW\ 57/ f DV WKH ZLOG W\SH WHVW JHQH LQ VXQIORZHU EXW ZDV VWLOO

PAGE 142

FRQVWUXFW S%5 ES 96 $GK f ES 90 $GK f N S%5 ES }ZI[P ( S%5 ES L G 57/ )LJ ,OOXVWUDWLYH VXPPDU\ RI WHVW JHQHV WKURXJK

PAGE 143

FRQVWUXFW f $5( ( G Pf§ Z?f§ ? OLQNHUV OLQNHUV $8W P 57/ )LJ ,OOXVWUDWLYH VXPPDU\ RI WHVW JHQHV DQG WKURXJK

PAGE 144

7$%/( 57/ 9DOXHV 6KXWWOH 9HFWRU S n ERUGHU RI WHVW JHQH 1XPEHU RI H[SHULPHQWV 7HVWUHIHUHQFH UDWLR DYJ 57/r 7HVW JHQH s 7HVW JHQH s 7HVW JHQH s 7HVW JHQH s 7HVW JHQH s 7HVW JHQH s 7HVW JHQH s 7HVW JHQH s 7HVW JHQH s 7HVW JHQH s 7HVW JHQH s 7HVW JHQH s 7HVW JHQH s 7HVW JHQH s 7HVW JHQH s 7HVW JHQH s 7HVW JHQH s 7HVW JHQH s 7HVW JHQH s VWDQGDUG GHYLDWLRQ JLYHQ DV s

PAGE 145

UHVSRQVLYH WR DQDHURELRVLV 7KLV UHVXOW DORQJ ZLWK WKH REVHUYDWLRQ WKDW WKH UHIHUHQFH JHQH ZDV UHVSRQVLYH WR DQDHURELRVLV VXJJHVWV WKDW WKH VHTXHQFHV UHVSRQVLEOH IRU WKH DQDHURELF UHVSRQVH RI WKH IRUHLJQ FRQVWUXFW DUH SUHVHQW EHWZHHQ DQG DQG DUH UHFRJQL]HG E\ QXFOHDU IDFWRUV SUHVHQW LQ VXQIORZHU WXPRU FHOOV 7KLV ORFDOL]DWLRQ RI WKH DQDHURELF UHVSRQVH UHJXODWRU\ UHJLRQ LV LQ DJUHHPHQW ZLWK WKH PDL]H $GKO $5( SRVLWLRQHG EHWZHHQ DQG LGHQWLILHG LQ PDL]H SURWRSODVWV :DONHU HW DO f 7KLV GHILQHG UHJLRQ KDUERULQJ WKH $5( ZDV GHOHWHG IURP WKH ZLOG W\SH SURPRWHU RI WKH WHVW JHQH DQG WKH UHVXOWLQJ FKLPHULF H[DPLQHG LQ VXQIORZHU 7KH UHSODFHPHQW RI ES EHWZHHQ DQG $5(f ZLWK D VLQJOH JXDQLQH UHVLGXH VHYHUHO\ UHVWULFWHG WUDQVFULSWLRQ ZLWKLQ DQDHURELFDOO\ VWUHVVHG WXPRUV )LJ f %DVDO OHYHOV RI WUDQVFULSWLRQ IRU WKLV VDPH FRQVWUXFW GLG QRW LQFUHDVH LQ XQLQGXFHG WXPRUV WKHUHIRUH WKH GHOHWLRQ RI WKLV VPDOO VHFWLRQ RI '1$ GLVUXSWHG WKH UHJXODWRU\ UHVSRQVH RI WKH JHQH WR DQDHURELF VWUHVV EXW ZDV QRW UHVSRQVLEOH IRU VXSSUHVVLQJ WUDQVFULSWLRQ XQGHU DQDHURELF FRQGLWLRQV 8SRQ UHLQVHUWLRQ RI WKH OLQNHUHG $5( LQWR WKH VDPH UHJLRQ ZLWKLQ WKH SURPRWHU IURP ZKLFK LW KDG EHHQ H[FLVHG LQ LWV QRUPDO n WR n RULHQWDWLRQ WHVW JHQHf WKH DELOLW\ RI WKH FKLPHULF FRQVWUXFW WR UHVSRQG WR DQ DQDHURELF HQYLURQPHQW ZDV UHVWRUHG EXW WR RQO\ DERXW b 57/ f RI WKH DFWLYLW\ RI WKH ZLOG W\SH SURPRWHU 7HVW JHQH ZLWK WKH $5( UHLQVHUWHG LQ D n WR n RULHQWDWLRQ LQWR WKLV VDPH UHJLRQ KDG WKH DELOLW\ WR UHVSRQG WR DQDHURELF VWUHVV UHVWRUHG EXW WR DQ HYHQ ORZHU OHYHO 57/ f :KHQ WKH $5( ZDV LQVHUWHG ES XSVWUHDP RI LWV QDWXUDO SRVLWLRQ LQ ERWK RULHQWDWLRQV WHVW JHQHV DQG f WKH DELOLW\ WR UHVSRQG WR K\SR[LD ZDV YHU\ ORZ 7KH SRVLWLRQ RI WKH $5( LQ WKHVH FKLPHULF FRQVWUXFWV DSSHDUV WR EH IDLUO\ VWULQJHQW IRU PD[LPXP H[SUHVVLRQ 7KH UHLQVHUWHG $5(V DUH IODQNHG E\ OLQNHU VHTXHQFHV WKDW ZHUH UHTXLUHG IRU OLJDWLRQ 7KLV UHVXOWV LQ WHVW JHQH KDYLQJ D ES LQVHUWLRQ DW SRVLWLRQ DQG ES DW ZKLFK DSSHDUV WR EH UHVSRQVLEOH IRU DQ b GHFUHDVH LQ WKH 57/ 7KLV GHFUHDVH LQ DFWLYLW\ PD\ EH GXH WR WKH GLVUXSWLRQ RI D ELQGLQJ VLWH ZLWKLQ WKH SURPRWHU DW HLWKHU RU ERWK RI WKHVH SRVLWLRQV WKDW DGYHUVHO\ DIIHFWHG WKH HIILFLHQF\ EXW GLGQnW HOLPLQDWH WKH UHVSRQVH $QRWKHU SRVVLELOLW\ PD\ LQYROYH SURWHLQ

PAGE 146

IDFWRUV WKDW ELQG WR WKH $5( DQG LQWHUDFW ZLWK RWKHU IDFWRUV VXFK DV WKH 7$7$ ER[ ELQGLQJ SURWHLQ 7KH LQVHUWLRQ RI WKH DGGHG QXFOHRWLGHV PD\ KDYH FDXVHG WKHVH ELQGLQJ IDFWRUV WR EH VHSDUDWHG E\ D VPDOO QXPEHU RI EDVHV SODFLQJ D VWUDLQ RQ WKH K\SRWKHWLFDO SURWHLQ SURWHLQ LQWHUDFWLRQV ZKLFK ZDV UHIOHFWHG LQ WKH ORZ WUDQVFULSWLRQDO DFWLYLW\ 7KH YHU\ ORZ 57/ RI WHVW JHQH $5( LQ UHYHUVH RULHQWDWLRQf VHHPV WR DOVR EH LQGLFDWLYH RI GLVUXSWLRQ RI SURWHLQ LQWHUDFWLRQV EXW WR D PRUH VHYHUH H[WHQW 7KRXJK WKH $5( LV DSSDUHQWO\ VHDWHG ZLWKLQ WKH SUR[LPDO UHJLRQ RI WKH SURPRWHU VHTXHQFHV XSVWUHDP RI DSSHDU WR DOVR EH UHTXLUHG IRU PD[LPXP WUDQVFULSWLRQDO DFWLYLW\ 7KH 57/ YDOXHV GHULYHG IRU WHVW JHQHV DQG DUH LQGLFDWLYH RI D PRGHUDWH FRQWULEXWLRQ WR WUDQVFULSWLRQDO DFWLYLW\ RI WKH FKLPHULF JHQHV E\ WKH GLVWDO SURPRWHU UHJLRQ WR f LQ WKH VXQIORZHU WXPRU HQYLURQPHQW XSRQ DQDHURELF VWUHVV ZKHUHDV WKH SURPRWHU VHTXHQFHV EHWZHHQ DQG LQWHUPHGLDWHf UHJLRQ FRQWULEXWHG WR D IROG LQFUHDVH YHUVXV WKH DFWLYLW\ RI WHVW JHQH WKDW ODFNHG ERWK UHJLRQV 7KHVH REVHUYDWLRQV LQGLFDWH WKDW WKH PDL]H $GKO SURPRWHU LQ XQGLIIHUHQWLDWHG VXQIORZHU WXPRU WLVVXH PD\ UHFRJQL]H DQ HOHPHQW RU HOHPHQWVf ZLWKLQ WKH WR UHJLRQ WKDW ELQG D IDFWRU WKDW LQWHUDFWV ZLWK D VHFRQG VHW RI SURWHLQV ERXQG WR UHJXODWRU\ HOHPHQWV ZLWKLQ WKH SURPRWHU SUR[LPDO UHJLRQ 7KH SRVVLEOH UROH RI DQ HQKDQFHUOLNH DIIHFW E\ VHTXHQFHV ZLWKLQ WKH LQWHUQDO WR UHJLRQ RQ WKH WUDQVFULSWLRQDO DFWLYLW\ RI WKH WHVW JHQHV ZDV LQYHVWLJDWHG E\ WKH LQWHUQDO GHOHWLRQ RU UHSRVLWLRQLQJ RI WKLV UHJLRQ LQ ERWK RULHQWDWLRQV ZLWKLQ GLIIHUHQW VHFWRUV RI WKH WUDQVFULSWLRQ XQLW 7HVW JHQHV DQG KDG WKH LQWHUQDO UHJLRQ LQVHUWHG LQ LWV QRUPDO n WR n RULHQWDWLRQ DQG WKH RSSRVLWH n WR n RULHQWDWLRQ UHVSHFWLYHO\ ES XSVWUHDP RI WKH GHOHWLRQ (DFK RI WKHVH FRQVWUXFWV XWLOL]HG ES RI ILOOHU '1$ GHULYHG IURP S%5 WR VHSDUDWH WKH UHJLRQ IURP WKH SUR[LPDO GRPDLQ 7KH 57/ IRU WHVW JHQH ZDV ZKHUHDV WKDW RI WHVW JHQH ZDV 7KLV GDWD FRLQFLGHV ZLWK WKH 57/ YDOXHV RI IRU WHVW JHQH LQ ZKLFK ES RI WKH S%5 ILOOHU '1$ ZLWK WKH VDPH ES GLUHFWO\ DVVRFLDWHG ZLWK WKH SRVLWLRQ DQG WHVW JHQH 57/ f WKDW

PAGE 147

KDG DOO SURPRWHU VHTXHQFHV XSVWUHDP RI GHOHWHG 6LPLODUO\ ZKHQ WKH LQWHUPHGLDWH UHJLRQ ZDV SODFHG LQ HLWKHU RULHQWDWLRQ n WR WKH WHVW JHQH )LJ f WKHUH ZDV QR LQFUHDVH LQ WKH WUDQVFULSWLRQDO DFWLYLW\ 5DWKHU ZKHQ SRVLWLRQHG LQ WKH n WR n RULHQWDWLRQ n WR WKH FRGLQJ UHJLRQ WKH DFWLYLW\ VLJQLILFDQWO\ GHFUHDVHG $ SRVVLEOH H[SODQDWLRQ IRU WKLV SKHQRPHQRQ LV WKDW WKH YDULDELOLW\ LQFRUSRUDWHG LQ WKH 57/V ZDV QRW QDUURZ IRU WKHVH FRQVWUXFWV DQG WKDW WKLV GLIIHUHQFH LQ YDOXHV LV QRW VLJQLILFDQW LQ WKH ILQDO DQDO\VLV $ VHFRQG SRVVLELOLW\ PD\ LQYROYH LQWHUIHUHQFH ZLWK WKH SRO\DGHQ\ODWLRQ VLJQDO IRU WKH WHVW JHQH E\ WKHVH DGGHG VHTXHQFHV LQ WKLV SDUWLFXODU RULHQWDWLRQ GRZQVWUHDP WR WKH JHQH 0HVVHQJHU 51$ ZDV FROOHFWHG XWLOL]LQJ DQ ROLJRG7f FHOOXORVH FKURPDWRJUDSK\ FROXPQ 7KLV UHTXLUHG WKDW WUDQVFULSWV SRVVHVV SRO\DGHQ\ODWHG WDLOV WKDW ZRXOG ELQG WR WKH FROXPQ ,I SRO\DGHQ\ODWLRQ RI P51$ ZDV DGYHUVHO\ DIIHFWHG WKH WHVW JHQH SURGXFWV PD\ KDYH EHHQ XQVWDEOH RU PD\ KDYH DGKHUHG WR WKH FROXPQ LQ D VLJQLILFDQWO\ VPDOOHU TXDQWLW\ UHVXOWLQJ LQ OHVV PHVVDJH EHLQJ FROOHFWHG ZKHUHDV WKH UHIHUHQFH JHQH P51$ ZRXOG UHPDLQ FRQVWDQW ,Q HLWKHU FDVH WKH FRPSDULVRQ RI WHVW JHQH SURGXFWV WR UHIHUHQFH JHQH SURGXFWV ZRXOG UHIOHFW DQ LQDFFXUDWH GHFUHDVH LQ WHVW JHQH WUDQVFULSWLRQ 7KHVH UHVXOWV VXJJHVWV WKDW WKH UHJLRQ RI WKH $GKO SURPRWHU GLG QRW FRQWULEXWH DQ\ HQKDQFHUOLNH DFWLYLW\ WR WUDQVFULSWLRQ EXW LWV SUHVHQFH DQG SRVLWLRQ ZLWK UHVSHFW WR WKH GLVWDO UHJLRQ ZDV QHFHVVDU\ IRU HIILFLHQW WUDQVFULSWLRQ ,QWHUHVWLQJO\ ZKHQ WKH LQWHUQDO UHJLRQ ZDV GHOHWHG WHVW JHQHf RU VXEVWLWXWHG IRU E\ ES RI S%5 GHULYHG ILOOHU '1$ WHVW JHQHf WKH 57/ YDOXHV GURSSHG WR DQG UHVSHFWLYHO\ )LJ f 7KHVH YDOXHV DUH ORZHU WKDQ WKH 57/ RI GHULYHG IRU WHVW JHQH WKDW KDG DOO VHTXHQFHV n WR WKH SRVLWLRQ GHOHWHG 7KLV PD\ DJDLQ UHIOHFW D ODUJH UDQJH RI YDULDELOLW\ ZKHQ XVLQJ WKLV GRXEOH JHQH V\VWHP WR REWDLQ 57/ YDOXHV 2U D VHFRQG SRVVLELOLW\ LV WKDW WKH GLIIHUHQFH LQ 57/ YDOXHV DFFXUDWHO\ UHIOHFW D GHFUHDVH LQ DFWLYLW\ E\ WKH GHOHWLRQ RU VXEVWLWXWLRQ RI WKH UHJLRQ RI WKH SURPRWHU ZKHQ FRPSDUHG WR WHVW JHQH )LJ f 7KH VLPSOHVW H[SODQDWLRQ LV WKDW WKH GLVWDO SURPRWHU UHJLRQ EHWZHHQ

PAGE 148

DQG H[HUWHG D QHJDWLYH LQIOXHQFH RQ WUDQVFULSWLRQ LI WKH UHJLRQ ZDV GHOHWHG &RQVWUXFWLRQ RI WHVW JHQH LQYROYHG WKH UHLQVHUWLRQ RI WKH LQWHUPHGLDWH UHJLRQ RI WKH SURPRWHU LQWR LWV DFFXVWRPHG SRVLWLRQ n WR WKH SUR[LPDO SURPRWHU UHJLRQ ,QVWHDG RI DQ 57/ YDOXH VLPLODU WR WHVW JHQH 57/ f WKDW KDG WKH GLVWDO UHJLRQ UHPRYHG WKH 57/ GURSSHG WR DERXW b RI ZLOG W\SH DFWLYLW\
PAGE 149

3WDVKQH f 7KLV W\SH RI SURWHLQ LQWHUDFWLRQ GLVUXSWLRQ ZDV DOVR REVHUYHG XSRQ LQVHUWLRQ RI '1$ VHTXHQFHV LQWR WKH 69 HDUO\ SURPRWHU UHJLRQ 7KHVH LQVHUWLRQV ZHUH EHWZHHQ WKH *& ER[HV 6SO ELQGLQJ VLWHVf DQG WKH 7$7$ IDFWRU ER[ WKDW DUH QRUPDOO\ SRVLWLRQHG RQ WKH VDPH VLGH RI WKH '1$ KHOL[ 7KRVH DGGLWLRQV WKDW LQYROYHG LQVHUWLRQ RI KDOI WXUQV SURYHG WR EH PRUH GHWULPHQWDO WR WUDQVFULSWLRQ HIILFLHQF\ WKDQ WKH LQVHUWLRQV LQYROYLQJ IXOO KHOLFDO WXUQV RI LQWHUYHQLQJ '1$ 7DNDKRVKL HW DO f '1$ ORRSLQJ KDV DOVR EHHQ LPSOLFDWHG LQ SURWHLQ LQWHUDFWLRQV RI WKH 'URVRSKLOD PHODQRJDVWHU $GK IDFWRUV DVVRFLDWHG ZLWK WKH $GK SUR[LPDO SURPRWHU DQG WKH GLVWDQW ODUYDO HQKDQFHU 'XULQJ ODUYDO GHYHORSPHQW LW LV K\SRWKHVL]HG WKDW WKHVH IDFWRUV LQWHUDFW WR UHJXODWH WKH SUR[LPDO SURPRWHU ZKHUHDV LQ DGXOW IOLHV GLVWDO SURPRWHU IDFWRUV V\QHUJLVWLFDOO\ DVVRFLDWH ZLWK WKH ODUYDO HQKDQFHU DQG D VHFRQG DGXOW HQKDQFHU WR GULYH WUDQVFULSWLRQ IURP WKH GLVWDO SURPRWHU &RUELQ DQG 0DQLDWLV f ,QWHUSUHWDWLRQ RI PXWDWLRQDO DQDO\VLV LQ WHUPV RI D PRGHO IRU SURWHLQ'1$ LQWHUDFWLRQV 'LPHWK\O VXOSKDWH '06f IRRWSULQWLQJ KDG EHHQ XVHG E\ )HUO DQG 1LFN f WR GHWHFW IDFWRU ELQGLQJ VLWHV ZLWKLQ PDL]H $GKO n IODQNLQJ VHTXHQFHV LQ YLYR 7KH\ ORFDOL]HG D ELQGLQJ VLWH ZLWKLQ WKH $5( GHVLJQDWHG % FRPSRVHG RI WZR VXEVHWV %M DQG %f WKDW LV SUHVHQW LQ ERWK XQLQGXFHG DQG DQDHURELFDOO\ LQGXFHG PDL]H FHOO VXVSHQVLRQV 7KH SURWHLQVf DVVRFLDWHG ZLWK WKLV VLWH ZDV GHVLJQDWHG ELQGLQJ IDFWRU % 7KH\ DOVR ORFDOL]HG RWKHU ELQGLQJ VLWHV WKDW ZHUH GHWHFWDEOH RQO\ LQ FHOOV WKDW KDG XQGHUJRQH WUDQVFULSWLRQDO LQGXFWLRQ RQH ZLWKLQ WKH $5( GHVLJQDWHG VLWH $ WR f DQG D VHFRQG SRVLWLRQHG ES XSVWUHDP RI WKH GHILQHG $5( GHVLJQDWHG VLWH & WR f )LJ f 8SRQ DQDHURELF VWUHVV LW ZDV VSHFXODWHG WKDW WKH % IDFWRU XQGHUJRHV D FRQIRUPDWLRQDO FKDQJH DQG IDFWRUV $ DQG & ELQG WR WKH SURPRWHU DW WKHLU UHVSHFWLYH ELQGLQJ VLWHV )HUO DQG 1LFN f /LQNHU VFDQ H[SHULPHQWV WKDW GLVUXSWHG VLWH %@ PXWDWLRQ UHJLRQ WR f DQG % PXWDWLRQ UHJLRQ ,, WR f )LJ f ZLWKLQ WKH $5( UHGXFHG WUDQVFULSWLRQ WR FRQVWLWXWLYH OHYHOV RU WR EDFNJURXQG OHYHOV UHVSHFWLYHO\ LQ DQDHURELFDOO\

PAGE 150

ZLOG W\SH ‘ f & % % $ &&&&&$&*$*&*$$$_$&&$n&*7MF&$&**$&&$&**&7IO7*77&&$&7&&$**7**$*&7*&O*_F&n&&**nII 7&*&$$*&&*&*&&*<**M7nU*&77O*&&$nFƒ**n&*KF&$$$&&* *****7*&7&*&777_7**7B*&LM**7*&&7**7*&&*$7$&$$**7*$**7&&$&&7T*_$&*7T**B*B*&&$-8*&*77&**&*&*B*&$2&$_$$&*$$_F***7*L7&*F-**777**& 9}r L LL &&&&&$&*$*&*$$$$&&$&*7&&$&**$&&$&**&7$7*77&&$&7&&$**7**$*,7*&$O**&&;&*$&&7*&$*&&&&**777&*&$$*&&*&*&&*7**777*&77*&&&$&$**&**&&$$$&&* *****7*&7&*&7777**7*&$**7*&&7**7*&&*$7 $& $$* *7*$**7& &$&&7&'$&* 7&&**$**;G*,$& *7&****&&$$$*&*77&**&*&**&$&&$$$**$$&***7*7&**&&**777**& 3VW 3VIO )LJ '1$ VHTXHQFHV RI WKH LQWHUQDO DQG $5( SURPRWHU UHJLRQ MXQFWLRQ RI WKH PDL]H $GKO SURPRWHU ZLOG W\SHf DQG WKH ES LQVHUWLRQ RI WHVW JHQH '1$ ELQGLQJ VLWHV DV GHVLJQDWHG E\ )HUO DQG 1LFN f DUH LQ EUDFNHWV $ %@ % DQG & 0XWDWLRQ UHJLRQV DQG ,, :DONHU HW DO f DUH SUHVHQWHG DV WKH VKDGHG UHJLRQ 7KH ES LQVHUWLRQ LV LQ ER[ DQG VLWH RI LQVHUWLRQ LV DV GHVLJQDWHG

PAGE 151

VWUHVVHG PDL]H SURWRSODVWV ZKLOH QR DGYHUVH DIIHFW ZDV REVHUYHG XSRQ GLVUXSWLRQ RI VLWH $ :DONHU HW DL f 7KH % DQG & HOHPHQWV RI WKH SURPRWHU DUH VHSDUDWHG E\ DSSUR[LPDWHO\ KHOLFDO WXUQV &RQVWUXFWLRQ RI WHVW JHQH )LJ f UHVXOWHG LQ VHSDUDWLRQ RI WKH $5( IURP WKH LQWHUQDO UHJLRQ RI WKH SURPRWHU E\ ES RI OLQNHU '1$ 6LWH & )HUO DQG 1LFN f ORFDWHG ZLWKLQ WKLV UHJLRQ ZRXOG WKHQ EH VHSDUDWHG IURP VLWH % E\ WKHVH ES RU a KHOLFDO WXUQV UHVXOWLQJ LQ WKH WZR '1$ ELQGLQJ SURWHLQV WR EH RQ RSSRVLWH VLGHV RI WKH '1$ KHOL[ 7KLV VPDOO LQVHUWLRQ VHYHUHO\ GHFUHDVHG WKH 57/ RI WKH WHVW JHQH LQ VXQIORZHU WR D YDOXH RI 7KHUHIRUH XQGHU DQDHURELF VWUHVV WKH QRUPDO SRVLWLRQV RI WKH % DQG & IDFWRUV PD\ LQYROYH D SURWHLQSURWHLQ LQWHUDFWLRQ JLYLQJ FUHGHQFH WR WKH FRQIRUPDWLRQDO FKDQJH RI % 8SRQ VHSDUDWLRQ RI WKHVH IDFWRUV E\ ES WKH LQWHUDFWLRQ EHWZHHQ WKH WZR '1$ ELQGLQJ IDFWRUV PD\ KDYH EHFRPH VWHUHRVSHFLILFDOO\ PLVDOLJQHG UHVXOWLQJ LQ D KLJKO\ VWUDLQHG FRQILJXUDWLRQ 7KLV VWUDLQ PD\ WKHQ KDYH DGYHUVHO\ HIIHFWHG WUDQVFULSWLRQ WR VXFK DQ H[WHQW WKDW WKH 57/ ZDV HYHQ ORZHU WKDQ LI WKH & UHJLRQ ZDV HQWLUHO\ GHOHWHG DV REVHUYHG IRU WHVW JHQHV DQG $OWHUQDWLYHO\ ZKHQ WKH & VLWH ZDV SRVLWLRQHG DSSUR[LPDWHO\ ES IXUWKHU XSVWUHDP WKDQ QRUPDO E\ UHLQVHUWLRQ RI WKH LQWHUQDO UHJLRQ LQ LWV FXVWRPDU\ ORFDWLRQ EXW ZLWK RSSRVLWH RULHQWDWLRQ WHVW JHQHf LQWHUYHQLQJ '1$ PD\ KDYH EHHQ DEOH WR ORRS LQ VXFK D PDQQHU DV WR DOORZ IDFWRUV % DQG & WR LQWHUDFW PRUH HIILFLHQWO\ WKDQ ZKHQ DVVRFLDWHG ZLWK WKH ZLOG W\SH SURPRWHU 7KLV KLJKHU HIILFLHQF\ WKHUHIRUH UHIOHFWV D KLJKHU 57/ YDOXH WKDQ ZLOG W\SH $ VLPLODU LQWHUSUHWDWLRQ FDQ EH XWLOL]HG WR H[SODLQ WKH 57/ YDOXH RI IRU WHVW JHQH 7KLV FRQVWUXFW KDG WKH $5( UHLQVHUWHG DW LWV QRUPDO SRVLWLRQ EXW OLQNHUV VHSDUDWHG LW IURP WKH UHJLRQ E\ D OHVV GHWULPHQWDO ES EXW DOVR KDG D ES LQVHUWLRQ EHWZHHQ DQG WKDW PD\ LWVHOI LQWHUIHUH ZLWK SURWHLQSURWHLQ LQWHUDFWLRQV EHWZHHQ IDFWRUV WKDW ELQG WKH $5( DQG WKH 7$7$ ER[ ELQGLQJ IDFWRU (LWKHU RQH RU D FRPELQDWLRQ RI ERWK RI WKHVH SRVVLELOLWLHV FRXOG KDYH DIIHFWHG WKH WUDQVFULSWLRQDO UHVSRQVH RI WKH JHQH WR DQDHURELRVLV SRVVLEO\ WR D OHVVHU H[WHQW WKDQ WKH ES LQVHUWLRQ DQG WKXV UHIOHFWHG LQ D VOLJKWO\ KLJKHU 57/

PAGE 152

7KLV PRGHO LV DOVR FRQVLVWHQW ZLWK WKH 57/ GHULYHG IRU WHVW JHQH 7KLV FKLPHULF KDG WZR LQWHUQDO UHJLRQV VLWXDWHG XSVWUHDP RI WKH SUR[LPDO UHJLRQ RI WKH SURPRWHU 7KH VWUDLQ RI WKH SURWHLQ LQWHUDFWLRQV SURGXFHG E\ WKH ES VHSDUDWLRQ RI WKH $5( IURP WKH & VLWH f RI WKH FORVHU RI WKH WZR LQWHUQDO UHJLRQV PD\ KDYH EHHQ FRPSHQVDWHG E\ WKH SUHVHQFH RI WKH VHFRQG VLWH & LQ WKH PRUH GLVWDO RI WKH WZR LQWHUQDO UHJLRQV ZKLFK ZDV DOPRVW ES DZD\ IURP WKH $5( 7KH LQWHUYHQLQJ '1$ PD\ KDYH DOVR ORRSHG LQ VXFK D PDQQHU DV WR DOORZ IRU LQWHUDFWLRQ EHWZHHQ IDFWRUV % DQG & 'XH WR WKH LQFUHDVHG GLVWDQFH EHWZHHQ WKH GLVWDO & ELQGLQJ VLWH DQG WKH % ELQGLQJ VLWH WKH ORRSLQJ HIILFLHQF\ PD\ KDYH EHHQ OHVV WKDQ IRU WHVW JHQH UHIOHFWLQJ D ORZHU 57/ VLPLODU WR WKH ZLOG W\SH OHYHO 7KLV ORZHU OHYHO PD\ KDYH DOVR EHHQ DIIHFWHG E\ D OLPLWHG DPRXQW RI IDFWRU & LQ WKH FHOOV GXH WR WKH GXSOLFDWLRQ RI WKLV VLWH IRU HDFK WHVW JHQH DQG WKH VLQJOH VLWH IRU HDFK UHIHUHQFH JHQH $OWHUQDWLYHO\ ZKHQ WKH WZR & VLWHV ZHUH VLWXDWHG LQ D SURPRWHU ES DQG ES XSVWUHDP RI WKH $5( WHVW JHQHf WKH 57/ ZDV ZKLFK LV ORZHU WKDQ WKH 57/V IRU ERWK WHVW JHQHV DQG :KHQ WKH GXSOLFDWHG LQWHUQDO UHJLRQV ZHUH ERWK SUHVHQW LQ WDQGHP LQ WKH RSSRVLWH n WR nf RULHQWDWLRQ DV LQ WHVW JHQH WKH DELOLW\ RI WKH '1$ WR ORRS DQG DOORZ SURWHLQ IDFWRU LQWHUDFWLRQV PD\ KDYH EHHQ LQWHUIHUHG ZLWK E\ FRPSHWLWLRQ RI WKH & IDFWRU WR LQWHUDFW ZLWK WKH % IDFWRU RU D OLPLWHG DYDLODELOLW\ RI & UHVXOWLQJ LQ WKH ORZHU 57/

PAGE 153

&+$37(5 6800$5< 7KH PDL]H DOFRKRO GHK\GURJHQDVH $GKOf JHQH ZDV WUDQVFULEHG LQ XQFORQHG VXQIORZHU WXPRU FHOOV 7KH WUDQVFULSWLRQ ZDV ORZ LQ WKLV KHWHURORJRXV SODQW V\VWHP ZKHQ LQ DQ DHURELF HQYLURQPHQW EXW PLPLFNHG WKH WUDQVFULSWLRQDO UHVSRQVH RI WKLV JHQH LQ PDL]H URRWV ZKHQ VXEMHFWHG WR DQ DQDHURELF HQYLURQPHQW $Q HQGRJHQRXV $GK WUDQVFULSW LQ VXQIORZHU FURVV K\EULGL]HG ZLWK D PDL]H $GKO F'1$ FORQH ZKLFK LQGLFDWHV D PHDVXUH RI VHTXHQFH KRPRORJ\ EHWZHHQ WKH WZR JHQH SURGXFWV 7KH HQGRJHQRXV VXQIORZHU JHQH ZDV DOVR LQGXFHG LQ WXPRUV E\ DQDHURELRVLV ,W DSSHDUV WKDW VXQIORZHU WXPRU FHOOV KDUERU WUDQVFULSWLRQ IDFWRUV WKDW DUH DQDORJXHV WR WKRVH LQ PDL]H DQG UHDGLO\ UHFRJQL]H DQG WUDQVFULEH WKH KLJKO\ UHJXODWHG IRUHLJQ JHQHV RI PDL]H 6, QXFOHDVH K\EULG SURWHFWLRQ PDSSLQJ LOOXVWUDWHG WKDW WKH IRUHLJQ JHQH LQLWLDWHG WUDQVFULSWLRQ DW WKH VDPH VWDUW VLWH LQ VXQIORZHU DV LW GRHV LQ LWV QDWXUDO KRVW 7KH QLQH LQWURQV RI PDL]H $GKO SUHP51$ ZHUH QRW HIILFLHQWO\ VSOLFHG LQ VXQIORZHU 7KH LQHIILFLHQF\ LQ VSOLFLQJ PD\ KDYH IRUWXLWRXVO\ LGHQWLILHG D VHFRQG VWDUW VLWH XWLOL]HG LQ VXQIORZHU DSSUR[LPDWHO\ ES XSVWUHDP IURP LWV UHFRJQL]HG VWDUW VLWH LQ PDL]H ,QLWLDWLRQ RI WUDQVFULSWLRQ DW WKLV XSVWUHDP SURPRWHU LV DQDHURELFDOO\ LQGXFLEOH DQG PD\ EH UHFRJQL]HG LQ D PDL]H WLVVXH VSHFLILF PDQQHU 7ZR SURPRWHUn GHOHWLRQ PXWDWLRQV RI WKH PDL]H $GKO JHQH WR WKH DQG SRVLWLRQV UHODWLYH WR WKH VWDUW VLWH ORZHUHG WKH WUDQVFULSWLRQDO HIILFLHQF\ RI WKLV JHQH LQ VXQIORZHU 7KHVH UHVXOWV HQVXUHG WKDW WKH KHWHURORJRXV VXQIORZHU V\VWHP FRXOG VXFFHVVIXOO\ EH XVHG WR FKDUDFWHUL]H LPSRUWDQW UHJLRQV RI WKLV IRUHLJQ JHQH $ GRXEOH JHQH V\VWHP WKDW DOORZHG IRU WKH DFFXUDWH TXDQWLILFDWLRQ RI PXWDWHG SURPRWHU DFWLYLW\ ZDV XWLOL]HG WR PRUH FRPSOHWHO\ LQYHVWLJDWH SURPRWHU UHJXODWLRQ RI $GKO LQ VXQIORZHU 7KH

PAGE 154

DFWLYLW\ RI WKH JHQHV WHVWHG SURYHG WR EH DIIHFWHG E\ WKHLU SRVLWLRQ ZLWKLQ WKH VKXWWOH YHFWRUV XWLOL]HG LQ WKHVH H[SHULPHQWV WR LQFRUSRUDWH WKHP LQWR $JUREDFWHULXP WXPHIDFLHQV 6HTXHQFHV ZLWKLQ WKH 7'1$ UHJLRQ RI WKH VKXWWOH YHFWRUV H[HUWHG D SRVLWLYH DIIHFW RQ WKH WUDQVFULSWLRQDO DFWLYLW\ LQ VXQIORZHU ZKHQ SRVLWLRQHG LPPHGLDWHO\ XSVWUHDP RI WKH SURPRWHU EHLQJ DQDO\]HG 7KLV LQIOXHQFH ZDV QHJDWHG ZKHQ WKH 7'1$ ZDV SRVLWLRQHG GRZQVWUHDP RI WKH WHVW JHQH 7UDQVFULSWLRQDO VWUHQJWKV FRQWULEXWHG E\ WKUHH VHSDUDWH UHJLRQV RI WKH $GKO SURPRWHU UHYHDOHG WKDW WKH SUR[LPDO UHJLRQ WR f ZDV UHVSRQVLEOH IRU b RI WKH ZLOG W\SH DFWLYLW\ ZKLOH WKH LQWHUQDO UHJLRQ WR f DGGHG DQRWKHU b WR WKLV DFWLYLW\ ZKHQ LQ LWV DFFXVWRPHG SRVLWLRQ LQ UHODWLRQ WR WKH SUR[LPDO UHJLRQ RI WKH SURPRWHU 7KH GLVWDO UHJLRQ RI WKH SURPRWHU WR f PRGHUDWHO\ FRQWULEXWHG b WR WRWDO DFWLYLW\ LQ UHODWLRQ WR WKH RWKHU WZR VHFWLRQV DQG PD\ KDYH KDG D QHJDWLYH LQIOXHQFH RQ WKH SUR[LPDO VHTXHQFHV ZKHQ WKH LQWHUQDO UHJLRQ ZDV GHOHWHG DQG WKXV SRVLWLRQHG LPPHGLDWHO\ XSVWUHDP RI WKH SUR[LPDO UHJLRQ :LWKLQ WKH SUR[LPDO UHJLRQ RI WKH $GKO SURPRWHU LV WKH DQDHURELF UHVSRQVH HOHPHQW $5(f DV GHILQHG LQ PDL]H SURWRSODVWV :DONHU HW DO f 7KLV HOHPHQW WR f ZDV UHVSRQVLEOH IRU D VLPLODU UHVSRQVH WR DQ DQDHURELF HQYLURQPHQW LQ VXQIORZHU DV LW LV LQ PDL]H 'HOHWLRQ RI WKLV UHJLRQ IURP WKH SURPRWHU HOLPLQDWHG WKH DELOLW\ RI WKH JHQH WR UHVSRQG WR D ORZ R[\JHQ HQYLURQPHQW DQG GLG QRW DOORZ IRU LQFUHDVHG FRQVWLWXWLYH DFWLYLW\ 7KH SRVLWLRQ RI WKH $5( ZLWKLQ WKH SURPRWHU ZDV LPSRUWDQW :KHQ UHLQVHUWHG LQWR LWV FXVWRPDU\ SRVLWLRQ ZLWK WKH DGGLWLRQ RI ES DQG ES LQVHUWLRQV IODQNLQJ WKH UHJLRQ XSVWUHDP DQG GRZQVWUHDP UHVSHFWLYHO\ WUDQVFULSWLRQDO DFWLYLW\ GURSSHG WR b ZLOG W\SH DFWLYLW\ ZKLOH LQ WKH RSSRVLWH RULHQWDWLRQ DFWLYLW\ ZDV VHYHUHO\ GHFUHDVHG 5Hn SRVLWLRQLQJ RI WKH $5( DW ORZHUHG WKH WUDQVFULSWLRQDO UHVSRQVH WR OHVV WKDQ b RI ZLOG W\SH H[SUHVVLRQ 3RVLWLRQ RI WKH $5( ZLWKLQ WKH SUR[LPDO UHJLRQ LQ UHODWLRQ WR GLVWDQFH DQG KHOLFDO WXUQV IURP WKH LQWHUQDO UHJLRQ RI WKH SURPRWHU LV LPSRUWDQW WR WKH HIILFLHQF\ RI

PAGE 155

WUDQVFULSWLRQ :KHQ WKHVH WZR UHJLRQV ZHUH VHSDUDWHG E\ D ES LQVHUWLRQ a KHOLFDO WXUQVf WUDQVFULSWLRQ ZDV UHGXFHG WR DERXW b RI ZLOG W\SH DFWLYLW\ ZKLOH LQYHUVLRQ RI WKH LQWHUQDO UHJLRQ VXEVWDQWLDOO\ LQFUHDVHG WUDQVFULSWLRQDO HIILFLHQF\ DERYH WKDW RI ZLOG W\SH 7KH b DFWLYLW\ ZDV WZR WR WKUHH WLPHV ORZHU WKDQ WKDW RI WKH SURPRWHU FRQVLVWLQJ RI RQO\ WKH SUR[LPDO UHJLRQ VXJJHVWLQJ WKDW WKHUH ZDV D VHYHUH SUREOHP SUHYHQWLQJ WKH 51$ SRO\PHUDVH ,, IURP UHFRJQL]LQJ WKLV SURPRWHU 7KH GDWD SUHVHQWHG LQ WKLV VWXG\ VXJJHVWV WKDW SURWHLQSURWHLQ LQWHUDFWLRQV RFFXU EHWZHHQ WKH '1$ ELQGLQJ IDFWRUV DQG LQYROYHV WKH ORRSLQJ RI LQWHUYHQLQJ '1$ ZKLFK LV LQ DJUHHPHQW ZLWK WKH LQIRUPDWLRQ REWDLQHG LQ PDL]H )HUO DQG 1LFN f 7KH QXFOHDU ELQGLQJ IDFWRUV ERXQG WR WKH $5( DQG SRVLWLRQ ZKHQ WKH SODQW WLVVXH LV VXEMHFWHG WR DQDHURELF VWUHVV DSSHDU WR EH RQ WKH VDPH KHOLFDO IDFH RI WKH SURPRWHU /RRSLQJ RI WKH LQWHUYHQLQJ '1$ DOORZV IRU SURWHLQ LQWHUDFWLRQV RI WKHVH IDFWRUV DQG PD\ DOVR LQFOXGH WKH 7$7$ ELQGLQJ IDFWRU DOORZLQJ IRU WKH 51$ SRO\PHUDVH WR UHDGLO\ UHFRJQL]H WKLV UHJLRQ DQG UHVXOW LQ HIILFLHQW WUDQVFULSWLRQDO DFWLYLW\

PAGE 156

5()(5(1&(6 $Q f 'HYHORSPHQW RI SODQW SURPRWHU H[SUHVVLRQ YHFWRUV DQG WKHLU XVH IRU DQDO\VLV RI GLIIHUHQWLDO DFWLYLW\ RI QRSDOLQH V\QWKDVH SURPRWHU LQ WUDQVIRUPHG WREDFFR FHOOV 3ODQW 3K\VLRO $R\DJL .XKOHPHLHU & DQG 1+ &KXD f 7KH SHD UEF66$ HQKDQFHUOLNH HOHPHQW GLUHFWV FHOOVSHFLILF H[SUHVVLRQ LQ WUDQVJHQLF WREDFFR 0RO *HQ *HQHW %DUNHU 5) ,GOHU .% 7KRPSVRQ '9 DQG -' .HPS f 1XFOHRWLGH VHTXHQFH RI WKH 7'1$ UHJLRQ IURP $JUREDFWHULXP WXPHIDFLHQV RFWRSLQH 7L SODVPLG S7LO 3ODQW 0RO %LRO %DXPDQQ 5DVFKNH ( %HYDQ 0 DQG ) 6FKRIIO f )XQFWLRQDO DQDO\VLV RI VHTXHQFHV RI D VR\EHDQ KHDW VKRFN JHQH LQ WUDQVJHQLF WREDFFR SODQWV 7KH (0%2 %HQIH\ 31 DQG 1+ &KXD f 5HJXODWHG JHQHV LQ WUDQVJHQLF SODQWV 6FLHQFH %HQIH\ 31 5HQ / DQG 1+ &KXD f 7KH &D09 6 HQKDQFHU FRQWDLQV DW OHDVW WZR GRPDLQV ZKLFK FDQ FRQIHU GLIIHUHQW GHYHORSPHQWDO WLVVXHVSHFLILF H[SUHVVLRQ SDWWHUQV 7KH (0%2 %HQ\DMDWL & 6SRHUHO 1 +D\PHUOH + DQG 0 $VKEXPHU f 7KH PHVVHQJHU 51$ IRU DOFRKRO GHK\GURJHQDVH LQ 'URVRSKLOD PHODQRJDVWHU GLIIHUV LQ LWV n HQG LQ GLIIHUHQW GHYHORSPHQWDO VWDJHV &HOO %HPDHUWV 0DQG 'H/D\ f $ ELRFKHPLFDO WHVW IRU FURZQ JDOO EDFWHULD 1DWXUH %HYDQ 0 6KXIIOHERWWRP (GZDUGV -HIIHUVRQ 5 DQG : 6FKXFK f 7LVVXH DQG FHOOVSHFLILF DFWLYLW\ RI D SKHQ\ODODQLQH DPPRQLDO\DVH SURPRWHU LQ WUDQVJHQLF SODQWV 7KH (0%2 %LQQV $1 DQG 0) 7KRPDVKRZ f &HOO ELRORJ\ RI $JUREDFWHULXP LQIHFWLRQ DQG WUDQVIRUPDWLRQ RI SODQWV $QQ 5HY 0LFURELRO %LUFKOHU -$ f 7KH F\WRJHQHWLF ORFDOL]DWLRQ RI WKH DOFRKRO GHK\GURJHQDVH ORFXV LQ PDL]H *HQHWLFV %ROLYDU ) f &RQVWUXFWLRQ DQG FKDUDFWHUL]DWLRQ RI QHZ FORQLQJ YHKLFOHV ,,, 'HULYDWLYHV RI SODVPLG S%5 FDUU\LQJ XQLTXH eFR5, VLWHV IRU VHOHFWLRQ RI (FR5? JHQHUDWHG UHFRPELQDQW '1$ PROHFXOHV *HQH

PAGE 157

%ROLYDU ) 5RGULJXH] 5/ *UHHQH 3%HWODFK 0& +H\QHFNHU +/ %R\HU +: &URVD -+ DQG 6 )DONRZ f &RQVWUXFWLRQ DQG FKDUDFWHUL]DWLRQ RI QHZ FORQLQJ YHKLFOHV ,, $ PXOWLSXUSRVH FORQLQJ V\VWHP *HQH %UHDWKQDFK 5 DQG 3 &KDPEQ f 2UJDQL]DWLRQ DQG H[SUHVVLRQ RI HXFDU\RWLF VSOLW JHQHV FRGLQJ IRU SURWHLQV $QQ 5HY %LRFKHP %URJOLH 5 &RUX]]L )UDOH\ 57 5RJHUV 6* +RUVFK 5% 1HLGHUPH\HU -* )LQN &/ )OLFN -6 DQG 1+ &KXD f /LJKWUHJXODWHG H[SUHVVLRQ RI D SHD ULEXORVHOELVSKRVSKDWH FDUER[\ODVH VPDOO VXEXQLW JHQH LQ WUDQVIRUPHG SODQWV FHOOV 6FLHQFH %URZQ -:6 :DQGHOW & DQG )HL[ f 7KH XSVWUHDP UHJLRQV RI ]HLQ JHQHV VHTXHQFH DQDO\VLV DQG H[SUHVVLRQ LQ WKH XQLFHOOXODU JUHHQ DOJD $FHWDEXODULD (XU &HOO %LRO %UXFH :% DQG :% *XUOH\ f )XQFWLRQDO GRPDLQ RI D 7'1$ SURPRWHU DFWLYH LQ FURZQ JDOO WXPRUV 0RO DQG &HOO %LRO %XFKPDQQ 0DPHU )6FKURGHU :DIIHQVFKPLGW 6 DQG 6FKURGHU f 7XPRXU JHQHV LQ SODQWV 7'1$ HQFRGHG F\WRNLQLQ ELRV\QWKHVLV 7KH (0%2 &DOOLV )URPP 0 DQG 9 :DOERW f ,QWURQV LQFUHDVH JHQH H[SUHVVLRQ LQ FXOWXUHG PDL]H FHOOV *HQHV DQG 'HY &DSODQ $ +HUUHUD(VWUHOOD / ,Q]H 9DQ +DXWH ( 9DQ 0RQWDJX 0 6FKHOO DQG 3 =DPEU\VNL f ,QWURGXFWLRQ RI JHQHWLF PDWHULDO LQWR SODQW FHOOV 6FLHQFH &DVKPRUH $5 f 1XFOHDU JHQHV HQFRGLQJ WKH VPDOO VXEXQLW RI ULEXORVH ELVSKRVSKDWH FDUER[\ODVH ,Q *HQHWLF (QJLQHHULQJ RI 3ODQWV HGV .RVXJH 7 0HUHGLWK &3 DQG $ +ROODHQGHUf 3OHQXP 3UHVV 1HZ
PAGE 158

&RUX]]L %URJOLH 5 (GZDUGV & DQG 1+ &KXD f 7LVVXHVSHFLILF DQG OLJKWUHJXODWHG H[SUHVVLRQ RI D SHD QXFOHDU JHQH HQFRGLQJ WKH VPDOO VXEXQLW RI ULEXORVHOELVSKRVSKDWH FDUER[\ODVH 7KH (0%2 &URVVZD\ $ 2DNHV -9 ,UYLQH -0 :DUG % .QDXI 9& DQG &. 6KHZPDNHU f ,QWHJUDWLRQ RI IRULHJQ '1$ IROORZLQJ PLFURLQMHFWLRQ RI WREDFFR PHVRSK\OO SURWRSODVWV 0RO *HQ *HQHW &]DPHFND ( *XUOH\ :% 1DJDR 57 0RVTXHUD /$ DQG -/ .H\ f '1$ VHTXHQFH DQG WUDQVFULSW PDSSLQJ RI D VR\EHDQ JHQH HQFRGLQJ D VPDOO KHDW VKRFN SURWHLQ 31$6 &]DUQHFND ( .H\ -/ DQG :% *XUOH\ f 5HJXODWRU\ GRPDLQV RI WKH *PKVSO( KHDW VKRFN SURPRWHU RI VR\EHDQ 0RO DQG &HOO %LRO 'HDQ &' )DYUHDX 0 %HGEURRN DQG 3 'XQVPXLU f 6HTXHQFHV n WR WUDQVODWLRQ VWDUW UHJXODWH H[SUHVVLRQ RI SHWXQLD UEF6 JHQHV 7KH 3ODQW &HOO 'HNH\VHU 5 &ODHV % 0DULFKDO 0 YDQ 0RQWDJX 0 DQG $ &DSODQ f (YDOXDWLRQ RI VHOHFWDEOH PDUNHUV IRU ULFH WUDQVIRUPDWLRQ 3ODQW 3K\VLRO 'HQQLV (6 *HUODFK :/ 3U\RU $%HQQHW]HQ -/ ,QJOLV $ /OHZHOO\Q 6DFKV 00 )HUO 5DQG :3HDFRFN f 0ROHFXODU DQDO\VLV RI WKH DOFRKRO GHK\GURJHQDVH $GKOf JHQH RI PDL]H 1XF $FLGV 5HV 'HQQLV (6 :DONHU -& /OHZHOO\Q (OOLV -* 6LQJK 7RNXKLVD -* :ROVWHQKROPH '5 DQG :3HDFRFN f 7KH UHVSRQVH WR DQDHURELF VWUHVV WUDQVFULSWLRQDO UHJXODWLRQ RI JHQHV IRU DQDHURELFDOO\ LQGXFHG SURWHLQV ,Q 3ODQW 0ROHFXODU %LRORJ\ HGV YRQ :HWWVWHLQ DQG 1+ &KXDf 3OHQXP 3UHVV 1HZ
PAGE 159

)DQJ 5; 1DJ\ ) 6LYDVXEUDPDQLDP 6 DQG 1+ &KXD f 0XOWLSOH FLV UHJXODWRU\ HOHPHQWV IRU PD[LPDO H[SUHVVLRQ RI WKH FDXOLIORZHU PRVDLF YLUXV 6 SURPRWHU LQ WUDQVJHQLF SODQWV 7KH 3ODQW &HOO )DYDORUR 7UHLVPDQ 5 DQG 5 .DPHQ f 7UDQVFULSWLRQ PDSV RI SRO\RPD YLUXVVSHFLILF 51$ $QDO\VLV E\ WZRGLPHQWLRQDO QXFOHDVH 6, JHO PDSSLQJ 0HWKRGV (Q]\PRO )HUO 5DQG + 6 1LFN f ,Q YLYR GHWHFWLRQ RI UHJXODWRU\ IDFWRU ELQGLQJ VLWHV LQ WKH n IODQNLQJ UHJLRQ RI PDL]H $GKO RI %LRO &KHP )HUO 5%UHQQDQ 0' DQG 6FKZDUW] f ,Q YLWUR WUDQVODWLRQ RI PDL]H $'+ HYLGHQFH IRU WKH DQDHURELF LQGXFWLRQ RI P51$ %LRFKHP *HQHWLFV )HUO 5'ORXK\ 65 DQG 6FKZDUW] f $QDO\VLV RI PDL]H DOFRKRO GHK\GURJHQDVH E\ QDWLYH6'6 WZR GLPHQWLRQDO HOHFWURSKRUHVLV DQG DXWRUDGLRJUDSK\ 0RO *HQ *HQHW )LJXUVNL DQG +HOLQVNL f 5HSOLFDWLRQ RI DQ RULJLQFRQWDLQLQJ GHULYDWLYH RI SODVPLG 5. GHSHQGHQW RQ D SODVPLG IXQFWLRQ SURYLGHG LQ WUDQV 31$6 )OXKU 5 DQG 1+ &KXD f 'HYHORSPHQWDO UHJXODWLRQ RI WZR JHQHV HQFRGLQJ ULEXORVHELVSKRVSKDWH FDUER[\ODVH VPDOO VXEXQLW LQ SHD DQG WUDQVJHQLF SHWXQLD SODQWV SK\WRFKURPH UHVSRQVH DQG EOXHOLJKW LQGXFWLRQ 31$6 )OXKU 5 .XKOHPHLU & 1DJ\ ) DQG 1+ &KXD Df 2UJDQVSHFLILF DQG OLJKW LQGXFHG H[SUHVVLRQ RI SODQW JHQHV 6FLHQFH )OXKU 5 0RVHV 3 0RUHOOL &RUX]]L DQG 1+ &KXD Ef ([SUHVVLRQ G\QDPLFV RI WKH SHD UEF6 PXOWLJHQH IDPLO\ DQG RUJDQ GLVWULEXWLRQ RI WKH WUDQVFULSWV 7KH (0%2 )UDOH\ 57 5RJHUV 6* +RUVFK 5% 6DQGHUV 35 )OLFN -6 $GDPV 63 %LWWQHU 0/ %UDQG /$ )LQN &/ )U\ -6 *DOOXSSL *5 *ROGEHUJ 6% +RIIPDQQ 1/ DQG 6& :RR f ([SUHVVLRQ RI EDFWHULDO JHQHV LQ SODQW FHOOV 31$6 )UHHOLQJ 0 f 6LPXOWDQLRXV LQGXFWLRQ E\ DQDHURELRVLV RU RI PXOWLSOH HQ]\PHV VSHFLILHG E\ WZR XQOLQNHG JHQHV 'LIIHUHQWLDO $'+$'+ H[SUHVVLRQ LQ PDL]H 0RO *HQ *HQHW )UHHOLQJ 0 f 'LPHUL]DWLRQ RI PXOWLSOH PDL]H $'+V VWXGLHG LQ YLYR DQG LQ YLWUR %LRFKHP *HQHW )UHHOLQJ 0 DQG '& %HQQHWW f 0DL]H $GKO $QQ 5HY *HQHW )UHHOLQJ 0 DQG 6FKZDUW] f *HQHWLF UHODWLRQVKLSV EHWZHHQ WKH PXOWLSOH DOFRKRO GHK\GURJHQDVHV RI PDL]H %LRFKHP *HQ )URPP 0 7D\ORU /3 DQG 9 :DOERW f ([SUHVVLRQ RI JHQHV WUDQVIHUUHG LQWR PRQRFRW DQG GLFRW SODQW FHOOV E\ HOHFWURSKRUDWLRQ 31$6

PAGE 160

*DOXV DQG $ 6FKPLW] f '1DVH IRRWSULQWLQJ D VLPSOH PHWKRG IRU WKH GHWHFWLRQ RI SURWHLQ'1$ ELQGLQJ VSHFLILFW\ 1XFO $FLGV 5HV *HUODFK :/ /RU] + 6DFKV 00 /OHZHOO\Q 3U\RU $'HQQLV (6 DQG :3HDFRFN f 7KH DOFRKRO GHK\GURJHQDVH JHQHV RI PDL]H D SRWHQWLDO JHQH WUDQVIHU V\VWHP LQ SODQWV ,Q 0DQLSXODWLRQ DQG ([SUHVVLRQ RI *HQHV LQ (XNDU\RWHV HGV 1DJOH\ 3f /LQQDQH $: 3HDFRFN :DQG -$ 3DWHPDQf $FDGHPLF 3UHVV $XVWUDOLD SS *HUODFK :/ 3U\RU $'HQQLV (6 )HUO 56DFKV 00 DQG :3HDFRFN f F'1$ FORQLQJ DQG LQGXFWLRQ RI WKH DOFRKRO GHK\GURJHQDVH JHQH $GKOf RI PDL]H 31$6 *ROGEURXJK 3% *HOYLQ 6% DQG %$ /DUNLQV f ([SUHVVLRQ RI PDL]H ]HLQ JHQHV LQ WUDQVIRUPHG VXQIORZHU FHOOV 0RO *HQ *HQHW *RUPDQ &0 0RIIDW /) DQG %+ +RZDUG f 5HFRPELQDQW JHQRPHV ZKLFK H[SUHVV FKORUDPSKHQLFRO DFHW\OWUDQVIHUDVH LQ PDPPDOLDQ FHOOV 0RO DQG &HOO %LRO *UHHQ 3.D\ 6$ DQG 1+ &KXD f 6HTXHQFHVSHFLILF LQWHUDFWLRQV RI D SHD QXFOHDU IDFWRU ZLWK OLJKWUHVSRQVLYH HOHPHQWV RI WKH UEF6$ JHQH 7KH (0%2 *UHHQ 75 DQG &$ 5\DQ f :RXQGLQGXFHG SURWHLQDVH LQKLELWRU LQ SODQW OHDYHV D SRVVLEOH GHIHQVH PHFKDQLVP DJDLQVW LQVHFWV 6FLHQFH *XUOH\ :% &]DPHFND ( 1DJDR 57 DQG -/ .H\ f 8SVWUHDP VHTXHQFHV UHTXLUHG IRU HIILFLHQW H[SUHVVLRQ RI D VR\EHDQ KHDW VKRFN JHQH 0RO DQG &HOO %LRO +DFN ( DQG -' .HPS f 3XULILFDWLRQ DQG FKDUDFWHUL]DWLRQ RI WKH FURZQ JDOO VSHFLILF HQ]\PH RFWRSLQH V\QWKDVH 3ODQW 3K\VLRO +DJHQ DQG 5XEHQVWHLQ f &RPSOH[ RUJDQL]DWLRQ RI ]HLQ JHQHV LQ PDL]H *HQH +HUUHUD(VWUHOOD / 9DQ GHQ %URHFN* 0DHQKXQW 5 9DQ 0RQWDJX 0 6FKHOO 7LPNR 03 DQG $5 &DVKPRUH f /LJKWLQGXFLEOH DQG FKORURSODVW DVVRFLDWHG H[SUHVVLRQ RI D FKLPHULF JHQH LQWURGXFHG LQWR 1LFRWLDQD WDEDFXP XVLQJ D 7L SODVPLG YHFWRU 1DWXUH +LJJLQV 7-9 f 6\QWKHVLV DQG UHJXODWLRQ RI PDMRU SURWHLQV LQ VHHGV $QQ 5HY 3ODQW 3K\VLRO +RR\NDDV 3-GHQ 'XON5DV + DQG 5$ 6FKLOSHURRUW f 7KH $JUREDFWHULXP WXPHIDFLHQV 7'1$ JHQH E LV DQ RQH JHQH 3ODQW 0RO %LRO +RR\NDDV 3-+RINHU 0 GHQ 'XON5DV + DQG 5$ 6FKLOSHURRUW f $ FRPSDULVRQ RI YLUXOHQFH GHWHUPLQDQWV LQ DQ RFWRSLQH 7L SODVPLG D QRSDOLQH 7L SODVPLG DQG DQ 5L SODVPLG E\ FRPSOHPHQWDWLRQ 3ODVPLG

PAGE 161

+RZDUG ($ :DONHU -& 'HQQLV (6 DQG :3HDFRFN f 5HJXODWHG H[SUHVVLRQ RI DQ DOFRKRO GHK\GURJHQDVH FKLPHULF JHQH LQWURGXFHG LQWR PDL]H SURWRSODVWV 3ODQWD -DFNVRQ 0 DQG ,QJOH f 7KH LQWHUSUHWDWLRQ RI VWXGLHV RQ UDSLGO\ ODEHOHG ULERQXFOHLF DFLG LQ KLJKHU SODQWV 3ODQW 3K\VLRO -HIIHUVRQ -$ f $VVD\LQJ FKLPHULF JHQHV LQ SODQWV WKH *86 JHQH IXVLRQ V\VWHP 3ODQW 0RO %LRO 5HSRUWHU -HIIHUVRQ -$ .DYDQDJK 7$ DQG 0: %HYDQ f *86 IXVLRQV JOXFXURQLGDVH DV D YHUVDWLOH JHQH IXVLRQ PDUNHU LQ KLJKHU SODQWV 7KH (0%2 -RKQVRQ 5 1DUYDH] $Q DQG & 5\DQ f ([SUHVVLRQ RI SURWHLQDVH LQKLELWRUV DQG ,, LQ WUDQVJHQLF WREDFFR SODQWV HIIHFWV RQ QDWXUDO GHIHQVH DJDLQVW 0DQGXFD VH[WD ODUYDH 31$6 .DUFKHU 6'L5LWD 9DQG 6% *HOYLQ f 7UDQVFULSW DQDO\VLV RI 7U '1$ LQ RFWRSLQHW\SH FURZQ JDOO WXPRUV 0RO *HQ *HQHW .D\ 5 &KDQ $ 'DO\ 0 DQG 0F3KHUVRQ f 'XSOLFDWLRQ RI &D09 SURPRWHU VHTXHQFHV FUHDWHV D VWURQJ HQKDQFHU IRU SODQW JHQHV 6FLHQFH .HLO 0 6DQFKH]6HUUDQR -DQG / :LOOPLW]HU f %RWK ZRXQGLQGXFLEOH DQG WXEHUVSHFLILF H[SUHVVLRQ DUH PHGLDWHG E\ WKH SURPRWHU RI D VLQJOH PHPEHU RI WKH SRWDWR SURWHLQDVH LQKLELWRU ,, JHQH IDPLO\ 7KH (0%2 .HLWK % DQG 1+ &KXD f 0RQRFRW DQG GLFRW SUHP51$V DUH SURFHVVHG ZLWK GLIIHUHQW HIILFLHQFLHV LQ WUDQVJHQLF WREDFFR 7KH (0%2 .HOOHU -0 6KDQNOLQ 9LHUVWUD 5' DQG +3 +HUVKH\ f ([SUHVVLRQ RI D IXQFWLRQDO PRQRFRW\OHGRQRXV SK\WRFKURPH LQ WUDQVJHQLF WREDFFR 7KH (0%2 .HOOH\ 30 DQG 0 )UHHOLQJ Df $QDHURELF H[SUHVVLRQ RI PDL]H JOXFRVH SKRVSKDWH LVRPHUDVH %LRO &KHP .HOOH\ 30 DQG 0 )UHHOLQJ Ef $QDHURELF H[SUHVVLRQ RI PDL]H IUXFWRVH GLSKRVSKDWH DOGRODVH %LRO &KHP .HPS -' f (Q]\PHV LQ RFWRSLQH DQG QRSDOLQH PHWDEROLVP ,Q 0ROHFXODU %LRORJ\ RI 3ODQW 7XPRUV HGV .DKO DQG 6FKHOOf 1HZ
PAGE 162

.OHLQ 70 :ROI (' :X 5 DQG -& 6DQIRUG f +LJKYHORFLW\ PLFURSURMHFWLOHV IRU GHOLYHULQJ QXFOHLF DFLGV LQWR OLYLQJ FHOO 1DWXUH .ORHFNHQHU*UXLVVHP % DQG 0 )UHHOLQJ f 5HODWLRQVKLS EHWZHHQ DQDHURELF LQGXFLELOWL\ DQG WLVVXHVSHFLILF H[SUHVVLRQ IRU WKH PDL]H DQDHURELF JHQHV ,Q 3ODQW 0ROHFXODU %LRORJ\ HGV YRQ :HWWVWHLQ DQG 1+ &KXDf 3OHQXP 3UHVV 1HZ
PAGE 163

/HLVQHU 60 DQG 6% *HOYLQ f 0XOWLSOH GRPDLQV H[LVW ZLWKLQ WKH XSVWUHDP DFWLYDWRU VHTXHQFH RI WKH RFWRSLQH V\QWKDVH JHQH 7KH 3ODQW &HOO /OHZHOO\Q 'HQQLV ( DQG :3HDFRFN f 7KH DOFRKRO GHK\GURJHQDVH JHQHV RI PDL]H H[SUHVVLRQ VWXGLHV LQ WREDFFR FHOOV ,Q 0ROHFXODU )RUP DQG )XQFWLRQ RI WKH 3ODQW *HQRPH HGV YDQ 9ORWHQ'RWLQJ / *URRW *63 DQG 7& +DOOf 3OHQXP 3UHVV 1HZ
PAGE 164

1HVWHU (: *RUGRQ 03 $PDVLQR 50 DQG 0)
PAGE 165

5RXVVHOO '/ %RVWRQ 56 *ROGEURXJK 3% DQG %$ /DUNLQV f 'HOHWLRQ RI '1$ VHTXHQFHV IODQNLQJ DQ 0U ]HLQ JHQH UHGXFHV LWV WUDQVFULSWLRQDO DFWLYLW\ LQ KHWHURORJRXV SODQW WLVVXHV 0RO *HQ *HQHW 5RZODQG /DQG -1 6WURPPHU f $QDHURELF WUHDWPHQW RI PDL]H URRWV DIIHFWV WUDQVFULSWLRQ RI $GKODQG WUDQVFULSW VWDELOLW\ 0RO DQG &HOO %LRO 6DFKV 00 )UHHOLQJ 0 DQG 5 2NLPRWR f 7KH DQDHURELF SURWHLQV RI PDL]H &HOO 6DQFKH]6HUUDQR -.HLO 0 2n&RQQRU $ 6FKHOO DQG / :LOOPLW]HU f :RXQGLQGXFHG H[SUHVVLRQ RI D SRWDWR SURWHLQDVH LQKLELWRU ,, JHQH LQ WUDQVJHQLF WREDFFR SODQWV 7KH (0%2 6DQFKH]6HUUDQR -6FKPLGW 5 6FKHOO DQG / :LOOPLW]HU f 1XFOHRWLGH VHTXHQFH RI SURWHLQDVH LQKLELWRU ,, HQFRGLQJ F'1$ RI SRWDWR 6RODULXP WXEHURVXPf DQG LWV PRGH RI H[SUHVVLRQ 0RO *HQ *HQHW 6DQGHUV 35 :LQWHU -$ %DPDVRQ $5 DQG 57 )UDOH\ f &RPSDULVRQ RI FDXOLIORZHU PRVDLF YLUXV 6 DQG QRSDOLQH V\QWKDVH SURPRWHUV LQ WUDQVJHQLF SODQWV 1XF $FLGV 5HV 6DQJHU ) 1LFNOHQ 6 DQG $5 &RXOVRQ f '1$ VHTXHQFLQJ ZLWK FKDLQn WHUPLQDWLQJ LQKLELWRUV 31$6 6FKHPWKDQHU -3 0DW]NH 0$ DQG $-0 0DW]NH f (QGRVSHUPVSHFLILF DFWLYLW\ RI D ]HLQ JHQH SURPRWHU LQ WUDQVJHQLF WREDFFR SODQWV 7KH (0%2 6FKLEOHU 8 DQG ) 6LHUUD f $OWHUQDWLYH SURPRWHUV LQ GHYHORSPHQWDO JHQH H[SUHVVLRQ $QQ 5HY *HQHW 6FKOHVLQJHU 0$VKEXUQHU 0 DQG $ 7LVVLHUHV f +HDW 6KRFN IURP %DFWHULD WR 0DQ &ROG 6SULQJ +DUERU 1< &ROG 6SULQJ +DUERU /DERUDWRU\f 6FKRIIO ) DQG %DXPDQQ f 7KHUPRLQGXFHG WUDQVFULSWV RI D VR\EHDQ KHDW VKRFN JHQH DIWHU WUDQVIHU LQWR VXQIORZHU XVLQJ D 7L SODVPLG YHFWRU 7KH (0%2 6FKZDUW] f 7KH JHQHWLF FRQWURO RI DOFRKRO GHK\GURJHQDVH LQ PDL]H JHQH GXSOLFDWLRQ DQG UHSUHVVLRQ 31$6 6FKZDUW] f *HQHWLF FRQWURO RI DOFRKRO GHK\GURJHQDVH D FRPSHWLWLRQ PRGHO IRU UHJXODWLRQ RI JHQH DFWLRQ *HQHWLFV 6FKZDUW] Df 5HJXODWLRQ RI H[SUHVVLRQ RI $GK JHQHV LQ PDL]H 31$6 6FKZDUW] Ef 5HJXODWLRQ RI WKH DOFRKRO GHK\GURJHQDVH JHQHV RI PDL]H 6WDGOHU 6\PS

PAGE 166

6HQJXSWD*RSDODQ & 5HLFKHUW 1$ %DUNHU 5) +DOO 7& DQG -' .HPS f 'HYHORSPHQWDOO\ UHJXODWHG H[SUHVVLRQ RI WKH EHDQ >SKDVHROLQ JHQH LQ WREDFFR VHHG 31$6 6HUIOLQJ ( -DVLQ 0 DQG : 6FKDIIQHU f (QKDQFHUV DQG HXNDU\RWLF JHQH WUDQVFULSWLRQ 7,* 6KDK '0 +RUVFK 5% .OHH +.LVKRUH *0 :LQWHU -$ 7XUQHU 1( +LURQDND &0 6DQGHUV 35 *DVVHU &6 $\NHQW 6 6LHJHO 15 5RJHUV 6* DQG 57 )UDOH\ f (QJLQHHULQJ KHUELFLGH WROHUDQFH LQ WUDQVJHQLF SODQWV 6FLHQFH 6LOIORZ &' +DPPHWW -5 DQG -/ .H\ f 6HTXHQFH FRPSOH[LW\ RI SRO\DGHQ\ODWHG ULERQXFOHLF DFLG IURP VR\EHDQ VXVSHQVLRQ FXOWXUH FHOOV %LRFKHP 6LPRQ 5 2n&RQQHOO 0 /DEHV 0 DQG $ 3XKOHU f 3ODVPLG YHFWRUV IRU WKH JHQHWLF DQDO\VLV DQG PDQLSXODWLRQ RI 5KL]RELD DQG RWKHU JUDPQHJDWLYH EDFWHULD 0HWK RI (Q]\P 6RXWKHUQ (0 f 'HWHFWLRQ RI VSHFLILF VHTXHQFHV DPRQJ '1$ IUDJPHQWV VHSDUDWHG E\ JHO HOHFWURSKRUHVLV 0RO %LRO 6SHQD $ DQG 6FKHOO f 7KH H[SUHVVLRQ RI D KHDWLQGXFLEOH FKLPHULF JHQH LQ WUDQVJHQLF WREDFFR SODQWV 0RO *HQ *HQHW 6SHQD $ +DLQ 5 =LHUYRJHO 8 6DHGOHU + DQG 6FKHOO f &RQVWUXFWLRQ RI D KHDWLQGXFLEOH JHQH IRU SODQWV 'HPRQVWUDWLRQ RI KHDWLQGXFLEOH DFWLYLW\ RI WKH 'URVRSKLOD KVS SURPRWHU LQ SODQWV 7KH (0%2 6SULQJHU % :HUU : 6WDUOLQJHU 3 %HQQHWW '& =ROROLFD 0 DQG 0 )UHHOLQJ f 7KH VKUXQNHQ JHQH RQ FKURPRVRPH RI =HD PD\V LV H[SUHVVHG LQ YDULRXV SODQW WLVVXHV DQG HQFRGHV DQ DQDHURELF SURWHLQ 0RO *HQ *HQHW 7DNDKDVKL 9LJQHURQ 0 0DWWKHV+ :LOGHUPDQ $ =HQNH 0 DQG 3 &KDPEQ f 5HTXLUHPHQW RI VWHUHRVSHFLILF DOLJQPHQWV IRU LQLWLDWLRQ IURP WKH VLPLDQ YLUXV HDUO\ SURPRWHU 1DWXUH 7HPSH DQG $*ROGPDQ f 2FFXUHQFH DQG ELRV\QWKHVLV RI RSLQHV ,Q 0ROHFXODU %LRORJ\ RI 3ODQW 7XPRUV HGV .DKO DQG 6FKHOOf 1HZ
PAGE 167

7KRPDVKRZ 0) +XJO\ 6 %XFKROW] :* DQG /6 7KRPDVKRZ f 0ROHFXODU EDVLV IRU WKH DX[LQLQGHSHQGHQW SKHQRW\SH RI FURZQ JDOO WXPRU WLVVXHV 6FLHQFH 7KRUQEXUJ 5: $Q &OHYHODQG 7( -RKQVRQ 5 DQG &$ 5\DQ f :RXQGLQGXFLEOH H[SUHVVLRQ RI D SRWDWR LQKLELWRU ,,FKORUDPSKHQLFRO DFHW\OWUDQVIHUDVH JHQH IXVLRQ LQ WUDQVJHQLF WREDFFR SODQWV 31$6 7LPNR 03 .DXVFK $3 &DVWUHVDQD & )DVVOHU +HUUHUD(VWUHOOD / 9DQ GHQ %URHFN* 9DQ 0RQWDJX 0 6FKHOO DQG $5 &DVKPRUH f /LJKW UHJXODWLRQ RI SODQW JHQH H[SUHVVLRQ E\ DQ XSVWUHDP HQKDQFHUOLNH HOHPHQW 1DWXUH 8HQJ 3 *DOLOL 6DUDQDUD 9 *ROGEURXJK 3% 'XEH 3 %HDFK\ 51 DQG %$ /DUNLQV f ([SUHVVLRQ RI D PDL]H VWRUDJH SURWHLQ JHQH LQ SHWXQLD SODQWV LV QRW UHVWULFWHG WR VHHGV 3ODQW 3K\VLRO 9LHUUD DQG 0HVVLQJ f 7KH S8& SODVPLGV DQ 0PS GHULYHG V\VWHP IRU LQVHUWLRQ PXWDJHQHVLV DQG VHTXHQFLQJ ZLWK V\QWKHWLF XQLYHUVDO SULPHUV *HQH :DONHU -& +RZDUG ($ 'HQQLV (6 DQG :3HDFRFN f '1$ VHTXHQFHV UHTXLUHG IRU DQDHURELF H[SUHVVLRQ RI WKH PDL]H DOFRKRO GHK\GURJHQDVH JHQH 31$6 :DQJ -& DQG *1 *LDHYHU f $FWLRQ DW D GLVWDQFH DORQJ D '1$ 6FLHQFH :LOOPLW]HU / f 7KH XVH RI WUDQVJHQLF SODQWV WR VWXG\ SODQW JHQH H[SUHVVLRQ 7,* :LOOPLW]HU / 6LPRQV DQG 6FKHOO f 7KH 7/'1$ RI RFWRSLQH FURZQJDOO WXPRXUV FRGHV IRU VHYHQ ZHOOGHILQHG SRO\DGHQ\ODWHG WUDQVFULSWV 7KH (0%2 :LQWHU -$ :ULJKW 5/ DQG :% *XUOH\ f 0DS ORFDWLRQV RI ILYH WUDQVFULSWV KRPRORJRXV WR 7U'1$ LQ WREDFFR DQG VXQIORZHU FURZQ JDOO WXPRUV 1XF $FLGV 5HV :X +0 DQG &URWKHUV f 7KH ORFXV RI VHTXHQFHGLUHFWHG DQG SURWHLQLQGXFHG '1$ EHQGLQJ 1DWXUH :X / DQG $ %HUN f &RQVWUDLQWV RQ VSDFLQJ EHWZHHQ WUDQVFULSWLRQ IDFWRU ELQGLQJ VLWHV LQ D VLPSOH DGHQRYLUXV SURPRWHU *HQHV DQG 'HY

PAGE 168

%,2*5$3+,&$/ 6.(7&+ -RKQ &KDUOHV ,QJHUVROO ZDV ERP $XJXVW LQ :RRQVRFNHW 5, DQG JUHZ XS LQ 0DUEOHKHDG 0$ DQG 1HZLQJWRQ &7 +H DWWHQGHG ,QGLDQ 5LYHU &RPPXQLW\ &ROOHJH LQ )RUW 3LHUFH )/ UHFHLYLQJ DQ $VVRFLDWH RI $UWV GHJUHH LQ ELRORJ\ LQ $XJXVW RI -RKQ FRQWLQXHG KLV HGXFDWLRQ DW WKH 8QLYHUVLW\ RI )ORULGD ZKHUH KH UHFHLYHG D %DFKHORU RI 6FLHQFH GHJUHH LQ PLFURELRORJ\ LQ $XJXVW RI

PAGE 169

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ :LOOLDP % *XUOH\ $VVRFLDWH 3URIHVVRU RI @ DQG &HOO 6FLHQFH LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ )UDQFLV & 'DYLV -U $VVRFLDWH 3URIHVVRU RI 0LFUF DQG &HOO 6FLHQFH ELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ R/ / &XUWLV +DQQDK 3URIHVVRU RI +RUWLFXOWXUDO 6FLHQFH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ .HHOQDWKDP 7 6KDQPXJDQ 3URIHVVRU RI 0LFURELRORJ\ DQG &HOO 6FLHQFH

PAGE 170

7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI $JULFXOWXUH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ GHM? ; 0D\ 9W 'HDQ &ROOHJH RI $JULFXOWXUH 'HDQ *UDGXDWH 6FKRRO

PAGE 171

81,9(56,7< 2) )/25,'$ ,,, ,,, ,,,8 $