Citation
Characterization of the P1 protein of the zucchini yellow mosaic potyvirus

Material Information

Title:
Characterization of the P1 protein of the zucchini yellow mosaic potyvirus
Creator:
Wisler, Gail C., 1954-
Publication Date:
Language:
English
Physical Description:
xi, 129 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Amino acids ( jstor )
Antiserum ( jstor )
Enzyme linked immunosorbent assay ( jstor )
Genomes ( jstor )
Potyvirus ( jstor )
Proteins ( jstor )
Reactivity ( jstor )
RNA ( jstor )
Virology ( jstor )
Watermelons ( jstor )
Dissertations, Academic -- Plant Pathology -- UF
Plant Pathology thesis Ph. D
Potyvirus diseases ( lcsh )
Proteins -- Analysis ( lcsh )
Zucchini -- Diseases and pests ( lcsh )
City of Madison ( local )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1992.
Bibliography:
Includes bibliographical references (leaves 117-128).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Gail C. Wisler.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
028085952 ( ALEPH )
27569031 ( OCLC )
AJM3941 ( NOTIS )

Downloads

This item has the following downloads:


Full Text











CHARACTERIZATION OF THE P1 PROTEIN
OF THE ZUCCHINI YELLOW MOSAIC POTYVIRUS



















By

GAIL C. WISLER


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

1992


- --3 F













ACKNOWLEDGEMENTS


The most important aspect of a graduate student's

career is his or her major professor and advisory committee.

In this respect I have been extremely fortunate to have Dr.

D.E. Purcifull as my major professor and Dr. E. Hiebert as

my co-advisor. They have shared completely their expertise

and enthusiasm for my work, and have been supportive

throughout my project.

Dr. F.W. Zettler was my major professor for my master's

degree, and has continued to be an excellent source of

advice and moral support, and a fine friend as always. Dr.

S. E. Webb, Dr. S. G. Zam, and Dr. J.R. Edwardson have also

been extremely helpful and enthusiastic, and I am grateful

to have had the opportunity to interact with and learn from

them.

The excellent technical assistance and comradery

offered by Eugene Crawford, Kristin Beckham, Gary Marlow,

Carlye Baker, and Maureen Petersen have made my work more

productive and certainly more enjoyable. I greatly admire

their skills and will not forget their kindness.

I am especially thankful to have had the support of my

husband, H. William Brown, who helped me through the

difficult times and made the good times even better. I am

ii








also fortunate to have had the advice and encouragement that

my mother, Caryl M. Wisler has always given me. My father,

Gerry Wisler was always supportive, and encouraged me in all

my endeavors.

Earning this degree has been an excellent learning

experience for me, and this, plus the relationships I have

developed while a student here at the University of Florida,

have made it all very worthwhile.


iii














TABLE OF CONTENTS



ACKNOWLEDGEMENTS ii

LIST OF TABLES .. v

LIST OF FIGURES ... vi

KEY TO ABBREVIATIONS viii

ABSTRACT .. x

CHAPTER 1 INTRODUCTION. .. 1

CHAPTER 2 CLONING AND SEQUENCING OF A FLORIDA ISOLATE
OF ZUCCHINI YELLOW MOSAIC VIRUS

Introduction .. .. 11
Materials and Methods .. .. 12
Results 20
Discussion .. 51

CHAPTER 3 SEROLOGICAL CHARACTERIZATION OF THE P1
PROTEIN OF ZUCCHINI YELLOW MOSAIC VIRUS
FROM FLORIDA

Introduction 55
Materials and Methods .. 56
Results .. 66
Discussion .. ... 88

CHAPTER 4 SUMMARY AND CONCLUSIONS. ... 91


APPENDIX: MONOCLONAL ANTIBODIES TO THE CAPSID PROTEIN
OF ZUCCHINI YELLOW MOSAIC VIRUS 97

REFERENCE LIST. ....... 117

BIOGRAPHICAL SKETCH 129














LIST OF TABLES


Table Paqi

2-1 ZYMV-FL/AT cDNA clones identified by immuno-
screening in Agtll.................................22

2-2 ZYMV-FL/AT cDNA clones identified by immuno-
screening in AZAPII. ..............................23

2-3 Percentage of nucleotide and amino acid sequence
homologies of four ZYMV isolates and five distantly
related potyviruses with respect to ZYMV-FL/AT.....49

3-1 List of zucchini yellow mosaic virus isolates used
for serological studies of the P1 protein..........57

3-2 Evidence for variation in molecular weight and
reactivity of P1-related proteins of ZYMV isolates
in western blots...................................72

3-3 Summary of reactions of antisera to the P1 of
ZYMV-FL/AT and ZYMV-RU in immunofluorescence tests.87














LIST OF FIGURES


Figure Page

2-1 Map of selected cDNA clones from Agtll and
AZAPII which represent the genome of
ZYMV-FL/AT....................................24

2-2 Sequencing strategy used for the cDNA clones
representing P1-, HC/Pro(AI)-, and P3-
encoding regions..............................25

2-3 Nucleotide and deduced amino acid sequence of
ZYMV-FL/AT....................................28

2-4 Hydrophobicity of P1 of ZYMV-FL/AT plotted
according to Kyte and Doolittle (1982) ........37

2-5 Map of acidic and basic residues of the P1
protein of ZYMV-FL/AT.........................38

2-6 Hydrophobicity plot of the P3 sequence of
ZYMV-FL/AT....................................39

2-7 Map of the acidic and basic residues of the
P3 protein of ZYMV-FL/AT ......................40

2-8 PCR products of P1 from ZYMV-MD and ZYMV-SV
using primers specific to the P1 coding
region .......................................42

2-9 Nucleotide sequence alignments of the P1
coding regions from ZYMV-FL/AT with that of
ZYMV-CA, -SV, -MD,and -RU.....................44

2-10 Amino acid sequence alignment of the P1
proteins of five ZYMV isolates: ZYMV-FL/AT,
-MD, -RU -SV, and -CA..........................47

3-1 Expression of P1 protein of ZYMV-FL/AT cloned
into the pETh plasmid..........................67

3-2 Characterization of the reactions of the P1-
related proteins of 22 isolates of zucchini
yellow mosaic virus (ZYMV) in western blots...71

vi








3-3 Western blots of extracts from plants singly
infected with selected ZYMV isolates..........73

3-4 Western blots showing 8% and 15% SDS-PAGE gel
concentrations............................... 74

3-5 Detection of the P1 protein in extracts from
plants of four cucurbit cultivars singly
infected with three isolates of zucchini
yellow mosaic virus ...........................75

3-6 Western blots of extracts from pumpkin singly
infected with selected ZYMV isolates using
antisera to P1, CI, and CP of ZYMV-FL/AT,
and to the AI of PRSV-W as probes.............76

3-7 Specificity of antiserum to P1 of ZYMV-FL/AT
in western blots..............................78

3-8 Reactivity of 22 zucchini yellow mosaic virus
isolates in western blots using antiserum to
the P1 of ZYMV-RU as a probe...................79

3-9 Immunoprecipitation of wheat germ in vitro
translation products..........................80

3-10 Localization of P1 in epidermal tissue in
stems of watermelon infected with ZYMV-FL/AT..83

3-11 Epidermal strips of watermelon tissue infected
with ZYMV-FL/AT treated with preimmune serum,
stained with Rhodamine-protein A, and
photographed with epifluorescence.............84

3-12 Aggregates of P1 protein in watermelon tissue
infected with ZYMV-RU treated with antiserum
to the P1 of ZYMV-FL/AT (1181), stained with
Rhodamine-protein A, and photographed with
epifluorescence optics.........................85

3-13 Epidermal strips from mock-inoculated
watermelon tissue treated with antiserum to
the P1 of ZYMV-FL/AT (1181) and stained with
Rhodamine-protein A.......................... 86


vii














KEY TO ABBREVIATIONS


AI
bp
CP
C-terminus
cDNA
CMV
CI
MCi
dpm
DIECA
ELISA
ES buffer
HC/Pro
kDa
LB
LDS
mw
N-terminus
NIa
NIb
nm
nt
oligo dT
P1
P3
PCR
PPV
PSbMV
PVYN
RT
SDS-PAGE

TEV
TVMV
VPg
WG
ZYFV
ZYMV-FL/AT

ZYMV-CA
ZYMV-MD


amorphous inclusion
base pairs
capsid protein
carboxy-terminus
complementary DNA
cucumber mosaic virus
cylindrical inclusion
microCurie
disintegrations per minute
diethyldithiocarbamate
enzyme-linked immunosorbent assay
extraction buffer
helper component/protease
kilodalton
Luria broth
Laemmli dissociating solution
molecular weight
amino-terminus
nuclear inclusion a
nuclear inclusion b
nanometer
nucleotide
oligonucleotide deoxy-thymidine
P1 protein
P3 protein
polymerase chain reaction
plum pox virus
pea seed-borne mosaic virus
necrotic strain of potato virus Y
room temperature
sodium dodecyl sulfate polyacrylamide
gel electrophoresis
tobacco etch virus
tobacco vein mottling virus
genome-linked viral protein
wheat germ
zucchini yellow fleck virus
aphid-transmissible isolate of zucchini
yellow mosaic virus from Florida
ZYMV isolate from California
mild isolate of ZYMV from Florida


viii








ZYMV isolate from Reunion Island
severe isolate of ZYMV from Florida


ZYMV-RU
ZYMV-SV













Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

CHARACTERIZATION OF THE P1 PROTEIN OF THE
ZUCCHINI YELLOW MOSAIC POTYVIRUS

By

Gail Clara Wisler

August, 1992


Chairperson: Dan E. Purcifull
Major Department: Plant Pathology

The nucleotide sequence of the 5'-terminal P1 coding

region of an aphid transmissible isolate of zucchini yellow

mosaic virus (ZYMV-FL/AT) was compared to the P1 coding

region of four other ZYMV isolates. Mild (ZYMV-MD) and

severe (ZYMV-SV) isolates from Florida and an isolate from

California (ZYMV-CA) had 95-98% homologies to ZYMV-FL/AT,

whereas the P1 coding region of ZYMV from Reunion Island

(ZYMV-RU) had 60% homology to ZYMV-FL/AT. The ZYMV-MD had

an 18 nucleotide insert following the start codon of the P1

coding region. The P1 proteins of all ZYMV isolates shared

conserved amino acids in areas of the C-terminus that have

been reported to be conserved in other potyviruses.

The P1 protein from ZYMV-FL/AT was expressed in

Escherichia coli and used for polyclonal antiserum

production. This antiserum reacted in western blots with








extracts of pumpkin (Cucurbita pepo L.) singly infected with

22 ZYMV isolates but did not react with extracts from

noninfected plants or from plants infected with three other

potyviruses, a potexvirus, a cucumovirus. The P1 proteins

of ZYMV isolates ranged from 33- to 35-kDa. The P1 protein

of ZYMV-MD, which contained a six amino acid insert, was

larger (ca. 35-kDa) than the P1 of ZYMV-FL/AT. Possible

protein breakdown products (26-27-kDa) were noted for some

isolates. Three isolates showed an 88-kDa product; one was

tested and it reacted with antiserum to amorphous inclusion

protein (AI), indicating incomplete processing between the

P1 and AI cleavage site. Antiserum made to the P1 of ZYMV-

RU gave similar results in western blots with respect to

size heterogeneity of the P1 protein among ZYMV isolates,

but it only reacted with 16 of 22 ZYMV isolates tested.

Indirect immunofluorescence tests with antisera to the

P1 proteins of ZYMV-FL/AT and ZYMV-RU indicated that the P1

protein aggregates in ZYMV-infected tissues.

The P1 coding region is more variable than other

regions of the genome among ZYMV isolates that have been

studied. The occurrence of breakdown products, incomplete

processing between P1 and AI, and different sizes of P1

proteins with certain isolates are likely due to sequence

differences in the respective P1 proteins. Antisera to the

P1 proteins have potential as serological probes for

identifying ZYMV and distinguishing among ZYMV isolates.














CHAPTER 1
INTRODUCTION


The Potyviridae is the largest group of plant

viruses, consisting of at least 180 members, most of which

are aphid transmitted (Barnett, 1991). Collectively,

potyviruses infect a wide range of agriculturally important

crops, causing severe yield losses (Hollings and Brunt,

1981; Matthews, 1982). The potyviral genome is a message-

sense, single stranded RNA molecule, consisting of about

10,000 nucleotides (nt). A characteristic feature of all

potyviruses is the production of proteinaceous cylindrical

inclusions (CI) in the cytoplasm of infected plants

(Edwardson, 1974; Edwardson and Christie, 1991). The

potyviral genome consists of a single open reading frame

(ORF) which is translated into a polyprotein of about 3.5 X

105 kilodaltons (kDa) which is subsequently cleaved into at

least eight individual proteins by viral-encoded proteases

(de Mejia et al., 1985b; Carrington et al., 1989a; Dougherty

and Carrington, 1988; Allison et al., 1986; Garcia et al,

1989; Verchot et al., 1991). Six of these proteins have

been characterized, but little is known about two proteins

referred to as P1 and P3, which are the first and third

proteins encoded from the 5'-terminus of the genome. The P1









and P3 proteins flank the helper component/protease

(HC/Pro), or amorphous inclusion (AI), region.

Because of the large number of potyviruses and the

close relationships among many members, identification and

distinction among potyviruses have received a considerable

amount of attention. Properties of the capsid protein (CP)

and the nucleotide (nt) sequence of the CP-encoding region

have received the most attention as criteria for

classification, with nt sequences of 20 distinct potyviruses

and 42 strains having been determined (Ward and Shukla,

1991). This attention can be attributed to the gene

encoding the CP being the first gene to be transcribed from

the 3'-end of the genome by reverse transcriptase using

oligo dT primers (Quemada et al., 1990; Gal-On et al.,

1990), and because the CP can be extracted from virions

which are easily purified from virus infected plant tissue.

The CP functions to protect the viral RNA by encapsidation

and it also is involved in aphid transmission (Gal-On et

al., 1990; Lecoq and Purcifull, 1992). Sequence analyses

have shown that a change in the amino acid triplet Asp-Ala-

Gly (DAG) in the amino-terminus (N-terminus) of the CP

alters aphid transmissibility (Atreya et al., 1990; 1991;

Harrison and Robinson, 1988; Gal-On et al., 1990; Salomon

and Raccah, 1990). The CP of two potyviruses, papaya

ringspot virus type P (papaya) and soybean mosaic virus,

have also been used in plant transformations to protect










against super-infection by strains of the same virus and by

other potyviruses (Ling et al., 1991; Stark and Beachy,

1989).

The two nuclear inclusion proteins, NIa (49-kda) and

NIb (54 to 58-kDa) aggregate in equimolar amounts in some

potyviral infections, are localized in the nucleus of

infected plants, and contain nuclear targeting signals

(Restrepo et al., 1990). The carboxy-terminal (C-terminal)

portion of the NIa is a protease responsible for processing

in cis and in trans at a minimum of six sites on the

polyprotein (Carrington and Dougherty, 1987a, 1987b, 1988;

Carrington et al., 1988; Chang et al., 1988; Dougherty and

Parks, 1989, 1991; Dougherty et al., 1988, 1989; Garcia et

al., 1989; Hellmann et al., 1988; Martin et al., 1990;

Riechmann et al., 1992). The NIa resembles the proteases of

como-, nepo-, and picornaviruses (Domier et al., 1987;

Goldbach and Wellinck, 1988), and is related to the trypsin-

like family of serine proteases (Bazan and Fletterick,

1988). The N-terminal portion of the NIa is now known to be

the genome-linked viral protein (VPg) attached to the 5'-

terminus of the viral RNA (Siaw et al., 1985; Hari, 1981;

Shahabuddin et al., 1988; Murphy et al., 1990).

The large nuclear inclusion protein, NIb, is the most

highly conserved of the potyviral genes among those which

have been sequenced (Ward and Shukla, 1991), and has high

sequence similarity with RNA-dependent-RNA-polymerases










encoded by plus-sense RNA viruses (Domier et al., 1987;

Bruenn, 1991).

The CI are produced by all members of the Potyviridae

examined so far (Edwardson and Christie, 1991). They are

found free in the cytoplasm (Baunoch et al., 1988), in

association with the endoplasmic reticulum (Langenberg,

1986), and attached to cell membranes and plasmodesmata.

Langenberg has suggested a possible involvement of CI in

cell-to-cell movement of viruses because of the association

of CI with virus particles and plasmodesmata (Langenberg and

Purcifull, 1989; Langenberg et al., 1989). Recently, the CI

have been shown to have helicase activity and to possess

nucleoside triphosphate (NTP)-binding activity (Lain et al.,

1988, 1989, 1990, 1991; Robaglia, et al., 1989; Riechmann et

al., 1992).

The coding region between the CI and HC/Pro, designated

as P3, exhibits a low sequence similarity among those

potyviruses which have been sequenced. The 42-kDa P3

protein of tobacco vein mottling virus (TVMV) has been

expressed in E. coli and antiserum has been prepared to it

(Rodriguez-Cerezo and Shaw, 1991). In western blots, this

antiserum reacted with a 42-kDa and a 37-kDa protein in

infected plants indicating that there may be an alternate

processing site between P3 and CI. Although it has been

suggested that there is limited sequence homology between P3

and the 2A protease of picornaviruses (Domier et al., 1987;










Dougherty and Carrington, 1988), no protease activity of P3

has been demonstrated (Shukla et al., 1991).

The role of the HC/Pro in aphid transmission has been

well established (Berger and Pirone, 1986; Govier and

Kassanis, 1974; Pirone and Thornbury, 1983; Thornbury et

al., 1985). Immunochemical studies have shown that the

coding region for the amorphous inclusion (AI) is the same

as the HC/Pro (Baunoch et al., 1988; de Mejia et al.,

1985a), but whereas antiserum to the HC/Pro blocks aphid

transmission of potato virus Y and TVMV, antiserum to the AI

does not (Thornbury et al., 1985). It has been suggested

that the inclusion form of this protein may be inactive in

terms of aphid transmission (Dougherty and Carrington,

1988). The C-terminus of the HC/Pro functions as a

protease, responsible for the cleavage between the HC/Pro

and P3 (Carrington et al., 1989a, 1989b, 1990) at a

conserved gly-gly (G-G) amino acid residue. Identification

of two essential amino acids in the C-terminal half of the

HC/Pro indicate that it is a member of the cysteine-type

family of proteases (Oh and Carrington, 1989). Sequence

comparisons have shown a high homology of the protease of

HC/Pro with that of a dsRNA hypovirulence-associated virus

of the chestnut blight fungus (Choi et al., 1991), and both

proteases autocatalytically cleave between the G-G residues.

The protein encoded by the 5'-terminal region of the

potyviral genome is the most variable of those which have








6

been sequenced (Shukla et al., 1991), and shows the greatest

molecular weight (mw) variation of over 30 potyviruses which

have been studied by in vitro translations (E. Hiebert,

personal comm.; Hiebert and Dougherty, 1988), with a size

range from 32 to 68-kDa. The C-terminus of P1 has recently

been identified as a serine-type protease responsible for

the autocatalytic cleavage between P1 and HC/Pro (Verchot et

al., 1991). Since this cleavage occurs efficiently in the

wheat germ in vitro translation system, but not in the

rabbit reticulocyte lysate system, it has been suggested

that an alternate cofactor may be required for the

processing event. Rodriguez-Cerezo and Shaw (1991)

expressed P1 in E. coli and antiserum was prepared to the

expressed P1 protein. A 31-kDa protein was detected in low

levels in infected tissue extracts which had been enriched

for endoplasmic reticulum and mitochondria. Rodriguez-

Cerezo and Shaw are the first to demonstrate the existence

of both P1 and P3 in infected plants. Yeh et al. (1992), by

using monoclonal antibodies (MAbs) to a 112-kDa protein

product of papaya ringspot virus-type W (PRSV-W), were able

to detect both 51- and 64-kDa proteins which presumably

correspond to the HC/Pro and the Pi proteins, respectively.

Zucchini yellow mosaic virus (ZYMV) is one of several

members of the Potyviridae which cause serious losses of

cucurbitaceous crops worldwide. ZYMV was first detected in

1973 in Italy (Lisa et al., 1981), and has since been









identified in the U.S. (Adlerz et al., 1983; Purcifull et

al., 1984; Provvidenti et al., 1984; Nameth et al., 1985),

Israel (Antignus et al., 1989), Turkey (Davis, 1986), Japan

(Suzuki et al., 1988), Australia (Greber et al., 1988),

France (Lecoq et al., 1983), Lebanon (Lesemann et al.,

1983), and Jordan (Al-Musa, 1989).

Both serological and biological variations have been

reported for ZYMV isolates (Lisa and Lecoq, 1984; Lecoq and

Purcifull, 1992; Wang et al., 1988; 1992). Serological

relationships are often complex and ZYMV has been reported

to cross react with watermelon mosaic virus-2 (WMV-2) in

serological studies of the CP (Davis et al., 1984; Huang et

al., 1986; Lisa and Lecoq, 1984; Purcifull et al., 1984;

Somowiyarjo et al., 1989) and CI protein (Suzuki et al.,

1988). Biological variants range from strains which induce

very mild symptoms to those which induce severe and necrotic

symptoms (Petersen et al., 1991; Lecoq and Purcifull, 1992).

These types of variants have been detected in geographically

distinct regions including France and the U.S. (Lecoq and

Purcifull, 1992). Biological variants have also been

observed which differ in the ability to be aphid transmitted

(Lecoq et al., 1991a; Lecoq and Purcifull, 1992). Some

isolates are aphid transmitted, whereas others are

inefficiently transmissible or not transmitted by aphids.

Zucchini yellow mosaic virus has reportedly been

responsible for severe yield losses in France (Lisa and









Lecoq, 1984), Israel (Cohen, 1986), and the U.S. (Blua and

Perring, 1989). Recent studies (Lecoq et al., 1991b: Wang

et al., 1991) report the use of mild isolates of ZYMV for

cross protection against more severe isolates. This means

of control appears promising for ZYMV. Some workers have

reported that ZYMV may be transmitted at a low rate through

seed (Schrijnwerkers et al., 1991; Davis and Mizuki, 1986),

and many isolates are efficiently aphid transmitted.

In addition to ZYMV, several other potyviruses, such as

papaya ringspot virus type-W (PRSV-W), watermelon mosaic

virus-2 (WMV-2), zucchini yellow fleck virus (ZYFV), bean

yellow mosaic virus, Bryonia mottle virus (Lovisolo, 1980),

and Telfairia mosaic virus (Shoyinka et al., 1987) have been

reported to infect cucurbits in the field. As a result, the

possibility for genetic recombination among these cucurbit

potyviruses exists (King, 1987; Morozov et al., 1989).

Consequently, the ability to accurately diagnose and

differentiate isolates is important in breeding programs

designed to control ZYMV through the development and use of

resistant cucurbit cultivars. Differentiation of ZYMV

isolates is also important in cross-protection studies.

Diagnosis and distinction of ZYMV isolates have been

based in part on differential host reactions.

Immunochemical assays involving both polyclonal (PAb) and

monoclonal (MAb) antisera to the CP are useful for diagnosis










of ZYMV, but are not completely definitive for distinction

between isolates.

Studies of both structural and nonstructural proteins

of potyviruses have been based on their ease of isolation,

either because they are readily purified, they aggregate in

infected tissue, or, as with the CP, they can be easily

cloned by oligo dT priming. Neither P1 nor P3 have been

shown to accumulate or aggregate in infected plants and thus

they have not been well characterized. As an early part of

this study, several MAbs to the CP of ZYMV were evaluated

for their ability to distinguish and diagnose ZYMV isolates,

as described in Appendix 1. The primary focus of this study,

however, was to further characterize the P1 and P3 of ZYMV.

To achieve this goal, the objectives of this study included

(1) characterization of the P1 and P3 proteins and coding

regions of an aphid-transmissible isolate of ZYMV from

Florida (ZYMV-FL/AT); (2) comparison of the P1 and P3

proteins and their coding regions from ZYMV-FL/AT to those

of other ZYMV isolates and other cucurbit potyviruses; (3)

evaluation of antisera to these proteins as serological

probes for studying the variability of ZYMV isolates; and

(4) evaluation of the antigenic relationships of these

proteins among ZYMV isolates and other potyviruses infecting

the Cucurbitaceae. The high sequence variability of P1 and

P3 make both of them interesting protein coding regions for

study, and knowledge gained in this research should lead to










a better understanding of the roles of P1 and P3 in the

viral infection process.

This study reports nucleotide sequence variability

among the P1 coding region of five ZYMV isolates. Antisera

to the P1 proteins of two ZYMV isolates detected size

differences in the P1 proteins, incompletely processed P1

products, possible breakdown products, and antigenic

differences among several ZYMV isolates. Nucleotide

sequence information only is presented for the P3 coding

region of ZYMV-FL/AT due to the inability to express this

protein in E. coli as a result of its apparent toxicity.














CHAPTER 2
CLONING AND SEQUENCING OF A FLORIDA ISOLATE
OF ZUCCHINI YELLOW MOSAIC VIRUS



Introduction


It has been hypothesized that potyvirus strains "show

an overall high sequence identity irrespective of the gene

product being considered, while distinct viruses have a

significantly lower degree of identity between gene

products" (Shukla et al., 1991, p.181). The nucleotide (nt)

sequence identities for the CP gene of distinct potyviruses

range approximately from 30 to 60%, while the nucleic acid

sequence identities determined for strains of a potyvirus

are greater than 95% (Ward and Shukla, 1991). These authors

point out that for the four potyviruses that have been

sequenced, the P1 coding region of the potyviral genome has

a lower homology than other coding regions, and that this

appears to be the most variable region of the genome. They

also suggest that this variability may indicate a possible

role for P1 in specific virus-host interactions.

The major goal in this study was to characterize and

compare the P1 and P3 proteins of several ZYMV isolates. A

means of achieving this goal was to produce P1 and P3 of

ZYMV-FL/AT in a high level expression system, and produce

11









specific antisera to each. The first step in this process

was to clone the ZYMV genome and determine the nt and

deduced amino acid sequence of the region encoding P1

through P3.

Materials and Methods


Virus Isolates

An isolate of ZYMV from Florida (Purcifull et al.,

1984), which has been maintained in a greenhouse by aphid

transmission for the past three years, FC-1119AT, was used

as the type isolate throughout this study, and it will be

referred to as ZYMV-FL/AT. The sequence of P1 through P3 of

ZYMV-FL/AT was compared to a ZYMV isolate from California

(ZYMV-CA) which was sequenced by R.Balint (personal comm.),

one from Reunion Island (ZYMV-RU, Baker et al., 1991b), a

severe, necrotic isolate from Florida (FC-2088) designated

as ZYMV-FL/SV, and a mild isolate from Florida (FC-1994)

designated as ZYMV/MD.

Virus Purification and RNA Extraction

The protocol used for virus purification is similar to

that described by Lecoq and Pitrat (1985). ZYMV-infected

Cucurbita Depo L. 'Small Sugar' tissue was harvested 14 days

post inoculation and homogenized for 10 sec with 3.75

volumes of 0.3 M K2HPO4, pH 8.5, with freshly added 0.2%

sodium diethyldithiocarbamate (DIECA) and 0.2% 2-

mercaptoethanol. The resulting slurry was then homogenized

with 2/3 volume of trichlorofluorethane (Freon) for one min.









After centrifugation at 5,000 g for 10 min, the aqueous

phase was made 1% with Triton X-100 and was stirred for 20

min at 4 C. Partially purified virus was collected by

ultracentri-fugation at 37,000 rpm in a Beckman Ti70 rotor

for 1.5 hr at 4 C and was resuspended in 0.02 M HEPES, pH

8.2 with a tissue homogenizer. After stirring for one hr at

4 C, the suspension was partially clarified by

centrifugation at 2,500 g for 2 min. The supernatant was

layered onto a Cs2SO4 gradient (10 g/27 ml 0.01 M HEPES, pH

8.2) and centrifuged for 16 hr at 32,000 g in a Beckman SW41

rotor at 4 C. The opalescent virus zone 24-27 mm from the

bottom of the tube was collected, diluted with one volume of

0.02 M HEPES, pH 8.2, and was centrifuged at 10,000 g for 10

min. The supernate was made 8% with polyethylene glycol

(PEG) 8000 and was stirred for 20 min at 4 C. A pellet

containing virus was collected by centrifugation at 10,000 g

for 10 min, and resuspended in 0.02 M HEPES, pH 8.2.

Concentrations of the virus preparations were estimated by

spectrophotometry using an approximate extinction

coefficient of A260=2.5 (1 mg/ml, 1 cm light path).

Preparations were divided into aliquots and stored at -80 C.

A virus preparation containing approximately 3 mg/ml

was added to an equal volume (1 ml) of RNA dissociating

solution [200 mM Tris-HCl, 2 mM EDTA, 2% sodium dodecyl

sulfate (SDS), pH 9.0], and six pl of protease K. After a

10 min incubation at room temperature (RT), the preparation










was layered onto a linear-log sucrose density gradient

(Brakke and Van Pelt, 1970) and was subjected to

ultracentrifugation at 39,000 rpm for 5 hr at 15 C with a

Beckman SW41 rotor. Gradient zones containing RNA were

collected using an ISCO UV analyzer. The RNA was

precipitated by adding 0.1 volume of 3 M sodium acetate and

2-5 volumes of 100% ethanol (Sambrook et al., 1989).

Pellets were resuspended in 50 Al diethyl- pyrocarbonate

(DEPC) treated water and stored at -80 C.

Synthesis of cDNA

The initial cDNA library of the ZYMV RNA was made using

Agtll (Lambda Librarian, Stratagene, LaJolla, CA), which is

based on a modification of a procedure described by Gubler

and Hoffman (1983). Freshly prepared viral RNA was used for

cloning, with 8.3 Mg RNA as the template in the first strand

synthesis reaction. Both random and oligo dT primers were

used in two separate first strand synthesis reactions which

were labeled by the addition of [32P]dCTP. Incorporation of

label was measured in fractions eluted from P-60 columns

(100-200 mesh Bio-Gel P-60; Bio-Rad, Melville, NY). Those

fractions with counts between 2,000 and 30,000

disintegrations per minute (dpm) were combined, and nucleic

acid was precipitated with ethanol. Second strand synthesis

and the ligation of EcoRI/NotI linkers were performed

according to the manufacturer's instructions.










Size analysis of cDNA was performed on a 0.9% agarose

gel. The gel was exposed to X-ray film and compared to a 1-

kb ladder molecular weight standard (BRL, Gaithersburg, MD).

A zone corresponding to 800-7,000 base pairs (bp) was cut

from the gel and electroeluted with a Bio-Rad (Melville, NY)

electroeluter according to manufacturer's instructions. The

volume of the eluted cDNA was reduced with water-saturated

n-butanol, followed by an ethanol precipitation. The cDNA

preparations with linkers from both random and oligo dT

priming were combined and they were ligated to EcoRl-

digested, calf intestinal alkaline phosphatase (CIAP)-

treated Agtll DNA (Protoclone Agtll System, Promega,

Madison, WI) for three hr at 22 C (Huynh et al., 1984.).

Molar ratios of vector to insert ranged from 1:1 to 1:2 to

1:3. The ligated cDNA was packaged and titered according to

manufacturer's instructions using the Packagene Lambda DNA

Packaging System (Promega, Madison, WI). Packaged phage was

titered on Escherichia coli strain Y1090 grown from a single

colony to an O.D.600 of 0.6 to 0.8 in Luria broth (LB)

(Sambrook et al., 1989), supplemented with 10 mM MgSO and

0.2% maltose.

A library made specifically to the 5'-terminus of the

ZYMV genome was constructed using the Lambda ZAP II/EcoRI

Cloning Kit (Stratagene, La Jolla, CA). A primer, with the

sequence of 5'-CGGTGTGTGCGCTAC-3', which corresponded to an

area encoding the cylindrical inclusion (CI) protein was









used in this cloning experiment and was synthesized at the

University of Florida DNA Synthesis Core. The host strain

used for this vector system was E. coli XL1-Blue.

Nucleic Acid Hybridization of ZYMV Clones

Nucleic acid probes prepared from viral RNA were

labeled with [32P]dCTP using either a Nick Translation Kit

(Promega, Madison, WI) or a Random Primed DNA Labeling Kit

(Boehringer Mannheim (Indianapolis, IN) according to

manufacturer's instructions. Nylon Hybond membranes, 0.45 j

pore size (Amersham, Inc., Arlington Heights, IL) cut to fit

media plates containing plaques, were laid onto the agar

surface for approximately 15 min. Membranes were then

placed onto filter paper pads soaked in three solutions

sequentially for 15 min each: (1) 0.5 M NaOH, 1.5 M NaC1,

(2) 1 M Tris-HCl, pH 7.5, 1.5 M NaC1, and (3) 2X SSC

(Sambrook et al., 1989). They were placed in a UV

Crosslinker for 2 min, after which they were prehybridized

in 10 ml of 1% SDS, 1 M NaCl, 10% PEG 8000, with 5 mg/ml

denatured salmon sperm. Membranes were placed in a heat seal

bag and incubated at 55 C for 15 min with agitation, after

which 100-200 ACi/ml denatured probe was added. This was

followed by an overnight incubation at 55 C. Membranes were

washed twice in 100 ml of 2X SSC for 5 min each at room

temperature (RT), followed by two rinses in 200 ml of 2X SSC

containing 1% SDS at 55 C for 30 min each. A final rinse

was in 100 ml of 0.1X SSC at RT for 30 min. Washed









membranes were exposed to X-ray film with an intensifying

screen.

Immunoscreening of ZYMV Clones

Immunoscreening for clones expressing specific regions

of the ZYMV genome was conducted essentially according to

manufacturer's instructions as described in the picoBlue

Immunoscreening Kit (Stratagene) and by Short et al.,

(1988). Recombinant bacteriophage library lysate was added

to 200 .l of the appropriate strain of E. coli cells, and

allowed to absorb at 37 C for 15 min. This was added to 3

ml of LB soft agar containing 10 mM MgSO4, which was poured

onto LB plates and incubated at 42 C for 3-4 hr until

plaques appeared. A nitrocellulose membrane (NCM) which had

previously been saturated with 10 mM isopropyl-B-D-

thiogalactopyranoside (IPTG) was laid onto each plate. The

IPTG is a gratuitous inducer used to induce the expression

of the B-galactosidase fusion protein. Plates were then

moved to 37 C and allowed to incubate an additional 4-6 hr.

Membranes were removed, rinsed three times for 5 min in a

solution containing 20 mM Tris-HCl, pH 7.5, 150 mM NaCl,

0.05% Tween-20 (TBST), and then incubated in TBST containing

5% Carnation dry milk powder for 15 min to block protein

binding sites. E. coli lysate was prepared as described in

Huynh et al., (1984) and added at 1 mg/ml to the blocking

solution. Antisera to the CP and CI of ZYMV, to the small

nuclear inclusion protein (NIa) of tobacco etch virus (TEV),









the HC/Pro of TVMV, and to the AI of papaya ringspot virus

type-W (PRSV-W) were used for primary antibody screening.

The virus antisera used in screening were known to cross-

react with corresponding proteins of ZYMV and other

potyviruses. Primary antibody was diluted in the blocking

solution at 1/500 to 1/1000 and incubated overnight at 4 C

with shaking. Each step was followed by three 5 min washes

with TBST. The secondary antibody, alkaline phosphatase-

conjugated goat anti-rabbit IgG (Sigma Chemical Co., St.

Louis, MO), was added at a dilution of 1/2000 in blocking

solution and was incubated with shaking at RT for 1-2 hr.

After rinsing in TBST, a final rinse was made in development

buffer (0.1 M Tris-HCl, 0.1 M NaCl, pH 9.6.). The color

substrates (Gibco BRL, Gaithersburg, MD), nitroblue

tetrazolium (NBT) (22 jl of a 75 mg/ml solution) and 5-

bromo-4-chloro-3-indolylphosphate (BCIP) (20 pl of a 50

mg/ml solution) were added to 20 ml development buffer with

50 Al of 2M MgC12. Color development was allowed to proceed

for approximately 30 min before reactions were stopped by

rinsing with deionized water. Positive clones were isolated

with a sterile pipette and placed in a buffer containing 100

mM NaCl, 50 mM Tris, pH 7.5, 10 mM MgSO4 (SM buffer) with 5%

chloroform and stored at 4 C. Clones were purified by 2 to

3 rounds of plating and screening.










Analysis of ZYMV Clones

Plaque purified clones in Agtll which were positive in

immunoscreening were raised in a 5 ml culture in the

lysogenic host E. coli Y1089 and were prepared by a mini-

prep procedure. Preparations were digested with EcoRI, run

on an agarose gel, transferred to a nylon membrane using an

agarose gel transfer unit (Millipore MilliBlot-V System,

Bedford, MA), and exposed to a [32P]dCTP labeled ZYMV probe.

Clones in both Agtll and AZAPII were analyzed by

polymerase chain reaction (PCR) using Agtll forward and

reverse primers. Plaques were placed into 20 pl of SM

buffer and frozen at -20 C. Ten pl were used as the

template in a BIOS thermocycler with three cycles of 94 C

for 3 min, 45 C for 1 min, and 72 C for 3 min. This was

followed by 35 cycles at 93 C for 1 min, 45 C for 1 min, and

72 C for 3 min. Plasmid clones were analyzed with PCR by

placing individual colonies in 20 pl of 20 mM Tris-HCl, pH

8, containing 1% Triton X-100, heating to 95 C for 10 min,

and centrifuging at 10,000 g for 2 min. Ten Ml of this

template was used in PCR with the appropriate primers.

Subcloninq of Recombinant Bacteriophage

Clones identified in Agtll were digested as described,

and extracted from an agarose gel using a Prep-A-Gene DNA

Purification Kit (Bio-Rad). Fragments were then subcloned

by lighting into EcoRl digested pGEMEX-1 (Promega) which had

been treated with CIAP (Sambrook et al., 1989). Plasmid








20

clones (pBluescript SK-) were isolated from AZAP II with the

use of the helper phage R408 according to manufacturer's

instructions (Stratagene). Recombinant plasmid cultures

were prepared for further analysis by the alkaline lysis

miniprep procedure (Sambrook et al., 1989).

Two additional Pl-encoding regions, one from ZYMV-SV

and one from ZYMV-MD, were cloned into the pETh vector

(McCarty et al., 1991) after increase of cDNA by PCR using

primers specific for PI, following procedures similar to

those described by Robertson et al. (1991).

DNA Sequencing of ZYMV Clones

The nucleotide sequences of plasmid preparations and

PCR products were determined using the standard Sanger

dideoxy chain termination method (1977) employed in both US

Biochemical Corp., Cleveland, OH, and Pharmacia LKB,

Piscataway, NJ, sequencing kits. Both 6% and 4% acrylamide

gels with 7 M urea were used. Sequence analysis and

comparisons were made using the University of Wisconsin

Genetics Computer Group Sequence Software (GCG) available at

the University of Florida ICBR Biological Computing

Facility.


Results


Clones Representing the ZYMV Genome

The initial cloning experiment using Agtll yielded an

estimated 73 x 106 clear (positive) plaques, and the yield









from AZAPII was estimated to be 14 x 106 clear plaques.

After serological screening with antisera to the CP, NIa,

CI, AI, and HC/Pro, several clones were selected which were

specific to each of these protein-encoding regions on the

ZYMV genome. In the Agtll cloning experiment, ten clones

were identified by the reactivity of their expressed

products with CP antiserum. Nine of these clones were

specific for the CP and an additional, large clone of 4.5-

kilobase pairs (kbp), was reactive with both CP and NIa

antisera (Table 2-1). Two clones were identified which

represented the CI, and two which represented the AI coding

region. Preliminary sequencing indicated that the AI-

positive clones were not large enough to include the Pl-

encoding region. Subsequent cloning experiments using

AZAPII yielded six additional CI-positive clones, seven

additional AI-positive clones, and three clones that were

both CI- and AI-positive (Table 2-2). Three of the CI

clones were large enough to code for both the CI and AI

regions, and their products reacted with antisera to both CI

and AI proteins. An AI-positive clone of 2.9-kbp was

selected (AI6) which included all of Pl, AI, and a portion

(ca. 600-bp) of P3. Clone AI6 also represented 55-bp of the

leader sequence. None of the 30 clones was identified that

represented the entire leader sequence, which, based on the

ZYMV-CA sequence, is approximately 141-bp.













Table 2-1. ZYMV-FL/AT cDNA clones identified
by immunoscreening in Xgtll.


Clone
designation
CP1

CP2

CP3

CP4

CP5

CP6

CP7

CP8

CP9

CP10

CI1

CI2

All

AI2


Approximate
size (kbp)
0.85

1.40

0.60

0.40

1.75

0.75

4.50

1.80

3.30

1.30

2.30

2.20

1.60

0.90


Serologicala
reactivity
CP

CP

CP

CP

CP

CP

CP,NIa

CP

CP

CP

CI

CI

AI

AI


coding regions listed refer to clones, the
products of which reacted with antisera to
the capsid protein (CP), small nuclear inclusion
protein (NIa), cylindrical inclusion protein
(CI), or amorphous inclusion protein (AI) in
immunoscreening assays.













Table 2-2. ZYMV-FL/AT cDNA clones identified
by immunoscreening in XZAPII.


Clone
designation

CI3

CI4

CI5

CI6

CI7

CI8

CI9

CI10

CI11

AI3

AI4

AI5

AI6

AI7

AI8

AI9


Approximate
size (kbp)

1.80

3.50

3.00

2.90

2.80

2.00

1.60

1.80

2.50

1.50

1.60

1.90

2.90

1.50

3.00

3.00


Serologicala
reactivity

CI

CI,AI

CI,AI

CI,AI

CI

CI

CI

CI

CI

AI

AI

AI

AI

AI

AI

AI


coding regions listed refer to clones, the
products of which reacted with antisera to
the cylindrical inclusion protein (CI), or
amorphous inclusion protein (AI) in immuno-
screening assays.
















































































0

Pc4H

UY



'-4



04


















0
(n 4)


u 1

Qii
C3 0-O


Q)0 J-r4 0








#$4 r
IL) 00




400
lW *-I 0o


) a 4) 0


u m0








0 04
r*4














41 00)




4) 0
OSA





























M) 4-14 0
*045










I H 0
t 4 ) 0
0 rI M ^
















S$4 0
- aI .



N 04 *




a
S uO






*

04













0




















V-4
04









Sequences Representing the 5'-terminus of ZYMV

Four clones were selected which together represent the

entire ZYMV-FL/AT genome; AI6 (2.9-kbp), AI8 (3.0-kbp), CI1

(2.3-kbp), and CP7 (4.5-kbp) (Fig. 2-1). Several additional

clones were used to sequence the entire region from P1

through the P3-encoding region (Fig. 2-2).

The sequence of ZYMV-FL/AT, from the 55-bp of the

leader through P3, with the corresponding amino acid

sequence, is presented in Fig. 2-3. Based on consensus

sequences (Oh and Carrington, 1989; Mavankal & Rhoads, 1991;

Thornbury et al., 1990; Verchot et al., 1991), the P1-

encoding region of ZYMV-FL/AT is 912-bp, the AI is 1,386-bp,

and P3 is 1,191-bp in length. The cleavage site between P1

and Al is at amino acid position 304-305 (tyr/ser), whereas

the site between AI and P3 is at amino acid position 766-767

(gly/gly), and between P3 and CI is at position 1,164-1,165

(glu/gly).

In the Pi-encoding region, the consensus sequence for

the predicted protease at the C-terminus is Gly-Xaa-Ser-Gly-

--Phe-Ile-Val-Arg-Gly (Verchot et al., 1991), Xaa being any

amino acid, whereas that for ZYMV-FL/AT is Gly-Cys-Ser-Gly--

-Leu-Val-Ile-Arg-Gly. In addition, Ser and His were found

at positions 264 and 223, respectively. These amino acids

are strictly conserved among potyviruses. Both the Ser and

His have been shown by point mutations in tobacco etch virus




























Fig. 2-3. Nucleotide and deduced amino acid sequence of
ZYMV-FL/AT. Amino acids are represented by a single
letter code. Underlined residues represent sequences
similar to conserved potyviral sequences. Asterisks
indicate amino acids strictly conserved among potyviruses
that have been sequenced. Slash(/) indicates cleavage
sites between proteins.










1 60

AACTCTTACAGTATTTAGAAATTCTCCAATCACTTCGTTTACTTCAGACATAACAATGGC



M A

61 120

CTCTATCATGATTGGTTCAATCTCCGTACCCATTGCAAAGACTAAGCAGTGTGCAAACAC

S I M I G S I S V P I A K T K Q C A N T

121 180

TCAAGTAAGTAATCGGGTTAATATAGTGGCACCTGGCCACATGGCAACATGCCCATTGCC

Q V S N R V N I V A P G H M A T C P L P

181 240

ACTGAAAACGCACATGTATTACAGGCATGAGTCCAAGAAGTTGATGCAATCAAACAAAAG

L K T H M Y Y R H E S K K L M Q S N K S

241 300

CATTGACATTCTGAACAATTTCTTCAGCACTGACGAGATGAAGTTTAGGCTCACTCGAAA

I D I L N N F F S T D E M K F R L T R N

301 360

CGAGATGAGCAAGGTGAAAAAGGGTCCGAGTGGGAGGATAGTCCTCCGCAAGCCGAGTAA

E M S K V K KG PS G RI V L R K P S K

361 420

GCAGCGGGTTTTCGCTCGTATTGAGCAGGATGAGGCAGCACGCAAGAAAGAGACTGTTTT

Q R V F A R I E Q D E A A R K K E T V F

421 480

CCTCGAAGGAAATTATGACGATTCTATCACAAATCTAGCACGTGTTCTTCCACCTGAAGT

L E G N Y D D S I T N L A R V L P P E V

Fig. 2-3--continued.










481 540

GACTCACAACGTTGATGTGAGCTTGACGTCATCGTTTACAAGCGCACATACAAGAAGGA

T H N V D V S L T S S F Y K R T Y K K E


541


600


AAGGAAGAAAGTGGCGCAAAAGCAAATTGTGCAAGCACCACTCAATAGCTTGTGCACACG

R K K V A Q K Q I V Q A P L N S L C T R


601


660


TGTTCTTAAAATTGCACGCAATAAAAATATCCCTGTTGAGATGATTGGCAACAAGAAGGC

V L K I A R N K N I P V E M I G N K K A


661


720


GAGACATACACTCACCTTCAAGAGGTTTAGGGGATATTTTGTTGGAAAGGTGTCAGTTGC

R H T L T F K R F R G Y F V G K V S V A

721 780

GCATGAAGAAGGACGAATGCGGCGCACTGAGATGTCGTATGAGCAGTTTAAATGGATTCT



H E E G R M R R T E M S Y E Q F K W I L


781


840


AAAAGCCATTTGTCAGGTCACCCATACAGAGCGAATTCGTGAGGAAGATATTAAACCAGG

K A IC Q V T H T ER I R E E D IK PG


841


900


TTGTAGTGGGTGGGTGTTGGGCACTAATCATACATTGACTAAAAGATATTCAAGATTGCC



C S G W V L G T N H T L T K R Y S R L P


Fig. 2-3--continued.










901 960

ACATTTGGTGATTCGAGGTAGAGACGACGATGGGATTGTGAACGCGCTGGAACAGGTGTT

H L V I R G R D D D G I V N A L E Q V L

961 1020

ATTTTATAGCGAAGTTGACCACTATTCGTCGCAACCGGAAGTTCAGTTCTTCCAAGGATG

F Y/ S E V D H Y S S Q P E V Q F F Q G W

1021 1080

GCGACGAATGTTTGACAAGTTTAGGCCCAGCCCAGATCATGTGTGCAAAGTTGACCACAA

R R M F D K F R P S P D H V C K V D H N

1081 1140

CAACGAGGAATGTGGTGAGTTAGCAGCAATCTTTTGTCAGGCTTTATTCCCAGTAGTGAA

*

N E E C G E L A A I F C Q A L F P V V K

1141 1200

ACTATCGTGCCAAACATGCAGAGAAAGCTTAGTAGAAGTTAGCTTTCGAGGAATTAAAGA

L S C Q T C R E S L V E V S F R G I K D

1201 1260

TTCTTTGAACGCAAACTTTATTGTCCACAAGGATGAATGGGGTAGTTTCAAGGAAGGCTA

S L N A N F I V H K D E W G S F K E G Y

1261 1320

TCAATACGATAATATTTTCAAATTAATCAAAGTGGCAACACAGGCAACTCAGAATCTCAA

Q Y D N I F K L I K V A T Q A T Q N L K

1321 1380

GCTCTCATCTGAAGTTATGAAATTAGTTCAGAACCACACAAGCACTCACATGAAGCAAAT

L S S E V M K L V Q N H T S T H M K Q I

Fig. 2-3--continued.










1381 1440

ACAAGACATCAACAAGGCGCTCATGAAAGGTTCGGTTATTGGTTACGCAAGACGAATTGGACTT

Q D I N K A L M K G S L V T Q D E L D L

1441 1500

AGCTTTGAAACAGCTTCTTGAAATGACTCAGTGGTTTAAGAACCACATGCACCTGACTGG

A L K Q L L E M T Q W F K N H M H L T G

1501 1560

TGAGGAGGCATTGAAGATGTTCAGAAATAAGCGTTCTAGCAAGGCCATGATAAATCCTAG

E E A L K M F R N K R S S K A M I N P S

1561 1620

CCTTCTATGTGACAACCAATTGGACAAAAATGGAAATTTTGTTTGGGGAGAAAGAGGATA

L L C D N Q L D K N G N F V W GE R G Y

1621 1680

CCATTCCAAGCGATTATTCAAGAACTTCTTCGAAGAAGTAATACCAAGCGAAGGATATAC

H S K R L F K N F F E E V I P S E G Y T

1681 1740

GAAGTACGTAGTGCGAAACTTTCCAAATGGTACTCGTAAGTTGGCCATAGGCTCGTTGAT

K Y V V R N F P N G T R K L A I G S L I

1741 1800

TGTACCACTCAATTTGGATAGGGCACGCACTGCACTACTTGGAGAGAGTATTGAGAAGAA

V P L N L D R A R T A L L G E S I E K K

1801 1860

GCCACTCACATCAGCGGTGTGCTCCCAACAGAATGGAAATTATATACACTCATGCTGCTG

P L T S A C V S Q Q N G N Y I H S C C C


Fig. 2-3--continued.











1861 1920

TGTAACGATGGATGATGGAACCCCGATGTACTCCGAGCTTAAGAGCCCGACGAAGAGGCA

V T MD D G T PM Y S E L K S PT K R H

1921 1980

TCTAGTTATAGGAGCTTCTGGTGATCCAAAGTACATTGATCTGCCAGCATCTGAGGCAGA

L V I G A S G D P K Y I D L P A S E A E

1981 2040

ACGCATGTATATAGCAAAGGAAGGTTATTGCTATCTCAATATTTTCCTCGCAATGCTTGT



R M Y I A K E G Y C Y L N I F L A M L V

2041 2100

AAATGTTAATGAGAACGAAGCAAAGGATTTCACCAAAATGATTCGTGATGTTTTGATCCC

N V N E N E A K D F T K M I R D V L I P

2101 2160

CATGCTTGGGCAGTGGCCTTCATTGATGGATGTTGCAACTGCAGCATATATTCTAGGTGT

M L G Q W P S L M D V A T A A Y I L G V

2161 2220

ATTCCATCCTGAAACGCGATGCGCTGAATTACCCAGGATCCTTGTTGACCACGCTACACA

F H P E T R C A E L P R I L V D H A T Q

2221 2280

AACCATGCATGTCATTGATTCTTATGGATCACTAACTGTTGGGTATCACGTGCTCAAGGC



T M H V I D S Y G S L T V G Y H V L K A


Fig. 2-3--continued.










2281 2340

CGGAACTGTTAATCATTTAATTCAATTTGCCTCAAATGATCTGCAAAGCGAGATGAAACA

G T V N H L I Q F A S N D L Q S E M K H

2341 2400

TTACAGAGTTGGCGGAACACCAACACAGCGCATTAAACTCGAGGAGCAGCTGATTAAAGG

Y R V G/ G T P T Q R I K L E E Q L I K G

2401 2460

AATTTTCAAACCAAAACTTATGATGCAGCTCCTGCATGATGACCCATACATATTATTGCT

I F K P K L M M Q L L H D D P Y I L L L

2461 2520

TGGCATGATCTCACCCACCATTCTTGTACATATGTATAGGATGCGTCATTTTGAGCGGGG

G M I S P T I L V H M Y R M R H F E R G

2521 2580

TATTGAGATATGGATTAAGAGGGATCATGAAATCGGAAAGATTTTCGTCATATTAGAGCA

I E I W I K R D H E I G K I F V I L E Q

2581 2640

GCTCACACGCAAGGTTGCTCTGGCTGAAGTTCTTGTGGATCAACTTAACTTGATAAGTGA

L T R K V A L A E V L V D Q L N L I S E

2641 2700

AGCTTCACCACATTTACTTGAAATTATGAAGGGTTGTCAAGATAATCAGAGGGCATACGT

A S P H L L E I M K G C Q D N Q R A Y V

2701 2760

ACCTGCGCTGGATTTGTTAACGATACAAGTGGAGCGTGAGTTTTCAAATAAAGAACTCAA

P A L D L L T I Q V E R E F S N K E L K


Fig. 2-3--continued.










2761 2820

AACCAATGGTTATCCCGATTTGCAGCAAACGCTCTTCGATATGAGGGAAAAAATGTATGC

T N G Y P D L Q Q T L F D M R E K M Y A

2821 2880

AAAGCAGCTGCACAATTCATGGCAAGAGCTAAGCTTGCTGGAAAAATCCTGTGTAACCGT

K Q L H N S W Q E L S L L E K S C V T V

2881 2940

GCGATTGAAGCAATTCTCGATTTTTACGGAAAGAAATTTAATCCAGCGAGCAAAAGAAGG

R L K Q F S I F T E R N L I Q R A K E G

2941 3000

AAAGCGCGCATCTTCGCTACAATTTGTTCACGAGTGTTTTATCACGACCCGAGTACATGC

K R A S S L Q F V H E C F I T T R V H A

3001 3060

GAAGAGCATTCGCGATGCAGGCGTGCGCAAACTAAATGAGGCTCTCGTCGGAATTTGTAA

K S I R D A G V R K L N E A L V G I C K

3061 3120

ATTCTTTTTCTCTTGTGGTTTCAAAATTTTTGCACGATGCTATAGCGACATAATATACCT

F F F S C G F K I F A R C Y S D I I Y L

3121 3180

TGTGAACGTGTGTTTGGTTTTCTCCTTGCTGCTACAAATGTCCAATACTGTGCGCAGTAT

V N V C L V F S L L L Q M S N T V R S M

3181 3240

GATAGCAGCGACAAGGGAAGAAAAAGAGAGAGCGATGGCAAATAAAGCTGATGAAAATGA

I A A T R E E K E R A M A N K A D E N E


Fig. 2-3--continued.










3241 3300

AAGGACGTTAATGCATATGTACCACATTTTCAGCAAGAAACAGGATGATGCGCCCATATA

R T L M H M Y H I F S K K Q D D A P I Y

3301 3360

CAATGACTTTCTTGAACATGTGCGTAATGTGAGACCAGATCTTGAGGAAACTCTCTTGTA

N D F L E H V R N V R P D L E E T L L Y

3361 3420

CATGGCTGGCGTAGAAGTTGTTTCAACACAGGCTAAGTCAGCGGTTCAGATTCAATTCGA

M A G V E V V S T Q A K S A V Q I Q F E

3421 3480

GAAAATTATAGCTGTGTTGGCGCTGCTTACCATGTGCTTTGACGCCGAAAGAAGCGATGC

K I I A V L A L L T M C F D A E R S D A

3481 3540

CATTTTCAAGATTTTGACAAAACTCAAAACAGTTTTTGGTACGGTTGGAGAAACGGTCCG

I F K I L T K L K T V F G T V G E T V R

3541 3547

ACTTCAA

L Q /

Fig. 2-3--continued.








36

(TEV, Verchot et al., 1991) to be important for proteolytic

processing between P1 and AI proteins.

In the N-terminus of the AI region, the consensus

sequence for aphid transmission is reported to be Cys-Gly-

Val-Ala-Ala----Pro-Cys-Lys-Ile-Tyr-Cys--Cys (Thornbury et

al., 1990), where Lys is the putative amino acid required

for aphid transmission. The corresponding sequence for

ZYMV-FL/AT is Cys-Gly-Leu-Ala-Ala----Pro-Val-Lys-Leu-Ser-

Cys--C (Fig. 2-3). This consensus sequence for ZYMV-FL/AT

is the same as that for ZYMV-CA and ZYMV-RU (Baker et al.,

1991b). The two amino acid residues required for protease

activity of the HC/Pro (Oh and Carrington, 1989) are also

conserved with a Cys at position 652 and a His at position

725 (Fig. 2.3).

The deduced amino acid sequence of P1 of ZYMV-FL/AT was

used to prepare a hydrophobicity plot according to Kyte &

Doolittle (1982) (Fig. 2-4). The P1 protein is highly

hydrophilic except for a strongly hydrophobic N-terminal 20

amino acids. There is no obvious pattern to suggest a

transmembrane motif. The P1 of ZYMV-FL/AT also has a high

proportion of basic amino acids (Fig. 2-5) and is thus

highly positively charged. In contrast, the hydrophobicity

map for P3 (Fig. 2-6) shows a distribution of both

hydrophobic and hydrophilic regions, and a fairly random

distribution of acidic as well as basic amino acids (Fig. 2-

7). Interestingly, this plot is quite similar to that of



















100 200 300
3 111' I 1 II I I 1111 I 11 It 3

2 2

0- 0

-1 -1
-2 -2
-3 -3
-4 -4

100 200 300






Fig. 2-4. Hydrophobicity of P1 of ZYMV-FL/AT
plotted according to Kyte and Doolittle (1982).
Horizontal scale represents amino acid residues of
PI. Vertical scale represents hydrophobic amino
acids (above the midline) and hydrophilic amino
acids (below the midline).



















100 200 300

A A i


100 200 300




Fig. 2-5. Map of acidic (A) and basic (B)
residues of the P1 protein of ZYMV-FL/AT.

















100 200 300

3
2 -
1 -
0-
-1
-2


100 200 300





Fig. 2-6. Hydrophobicity plot of the P3 sequence of
ZYMV-FL/AT. The horizontal scale indicates amino acid
residues in the P3 protein. The hydrophobicity (vertical)
scale is that of Kyte and Doolittle (1982), with hydrophobic
amino acids above the midline and hydrophilic amino acids
below the midline. Residues for ca. 35-50 and ca. 260-280
correspond to those suggested for P3 of TVMV to be involved
in the formation of membrane spanning helices
(Rodriguez-Cerezo and Shaw, 1991).








40














100 200 300




100 200 300
100 200 300


Fig. 2-7. Map of acidic (A) and basic (B) amino acid
residues of the P3 protein of ZYMV-FL/AT.








41

the P3 of TVMV (Rodriguez-Cerezo and Shaw, 1991). Two areas

of the P3 of ZYMV-FL/AT, indicated in Fig. 2-6, corresponded

to the possible membrane spanning helices suggested by

Rodriguez-Cerezo and Shaw.

Homologies Between the P1 of ZYMV Isolates

Comparisons were made between the P1 encoding regions

of five ZYMV isolates: ZYMV-CA, ZYMV-RU, ZYMV-FL/AT, ZYMV-

SV, and ZYMV-MD. The latter three isolates were sequenced

in the present study. The sequence of P1 from ZYMV-FL/AT

was derived from clones produced in Agtll and AZAPII. The

sequences of P1 from ZYMV-SV and ZYMV-MD were derived from

clones produced by RNA-PCR products using custom primers for

P1. The specific primers for production of P1 were, on the

5'-terminus, 5'-CATGAGAATTCAAGCTTACATGGCCTCTATCATG-3', and

on the 3'-terminus, 5'-CTGACTTCTAGACCTGTTCCAGCGCGTTCA-3'.

Initial comparison of P1 products from RNA-PCR in agarose

gels between the mild and severe isolates showed a size

difference between the two, with the mild being slightly

larger (Fig. 2-8). Nucleotide sequence comparisons showed

an 18 nt insert in the mild isolate immediately after the

start codon (Fig. 2-9), thus accounting for the size

difference noted in agarose gels. The sequences between the

ZYMV-FL/AT, ZYMV-SV and ZYMV-MD were quite similar, with a

nt homology of 98% between ZYMV-FL/AT and the ZYMV-SV

isolate, and a 95% homology between the ZYMV-FL/AT and the

ZYMV-MD isolate. Of ten amino acid changes in the ZYMV-SV

























p r


-2,036
-1,636

-1, 018




506
396
344
298





Fig. 2-8. Electrophoretic analysis of PCR products
of P1 from ZYMV-MD and ZYMV-SV using primers
specific to the P1 coding region in a 0.9% agarose
gel.



























Fig. 2-9. Nucleotide sequence alignments of the P1
coding region from ZYMV-FL/AT with that of ZYMV-CA,
-SV, -MD, and -RU. Clones of ZYMV-SV and ZYMV-MD
extend only to the GGAACAGG motif as shown due to
the primer selection for PCR cloning.













1
ATG.......
ATG........
ATG .......
ATGAGAATTC
ATG.......

51
ACCCATTGCA
ACCCATTGCA
ACCCATTGCA
ACCCATTGCA
CCCTATCGTT

101
TTAATATAGT
CTAATATAGT
TTAGTATAGT
TTAATATAGT
TGAATATTGT

151
ACGCACATGT
ACGCACATGT
ACGCACATGT
ACGCACATGT
TCGCACTCAT

201
CAAAAGCATT
CAAGAGCATT
CAAAAGCATT
CAAAAGTATT
TGAAAGCATT

251
AGTTTAGGCT
AGTTTAGGCT
AGTTTAGGCT
AGTTTAGTGT
GTTTTAGGCT

301
GGGAGGATAG
GGGAGGATAG
GGGAGGATAG
GGGAGGATAG
GGAAGGATGA


AAGCTTTACA


AAGACTAAGC
AAGACTGAGC
AAGACTGAGC
AAGACTGAGC
GAGTCTGCTC


GGCACCTGGC
GGCACCTGGC
GCCACCTGG.
GGCACCTGGC
GGCACCTGGC


ATTACAGGCA
ATTACAGGCA
ATTACAGGCA
ATTACAGGCA
ATTACAAACA


GACATTCTGA
GACATTCTGA
GACATTCTGA
GACATTCTGA
AATATCCTCA


CACTCGAAAC
CACTCGAAAC
CACTCGAAAC
CACTCGAAAC
CACTCGCAAT


TCCTCCGCAA
TCCTCCGCAA
TCCTCCGCAA
CCCTCCGCAA
TACTCCGCAA


.GCCTCTATC
.GCCTCCATC
.GCCTCTATC
TGCCTCTATC
.GCCGCTATC


AGTGTGCAAA
AGTGTGCAAA
AGTGTGCAAA
ACTGTGCAAA
GGTGTGCAAC


CACATGGCAA
CACATGGCAA
..CATGGCAA
CACATGGCAA
CACGTGGCAG


TGAGTCCAAG
TGAGTCCAAG
TGAGTCCAAG
TGAGTCCAAG
TGCATCAGAG


ACAATTTCTT
ACAACTTCTT
ACAATTTCTT
ACAATTTCTT
ATAGTTTCTT


GAGATGAGCA
GAGATGAGCA
GAGATGAGCA
GAGATGAGCA
GAGATGAGCA


GCCGAGTAAG
GCCGAGTAAG
GCCGAGTAAG
GCCGAGTAAG
ACCAAGAGCA


ATGATTGGTT
ATGATTGGTT
ATGATTGGTT
ATGATTGGTT
ATGATTGGTT


CACTCAAGTA
CACTCAAGTA
CACTCAAGTA
CACTCAAGTA
GGTTCAAACT


CATGCCCATT
CATGCCCATT
CATGCCCATT
TATGCCCATT
TTTGCAAGCC


AA...GTTGA
AA...GTTGA
AA...GTTGA
AA...GTTGA
AAACTCTCCA


CAGCACTGA.
CAGCACTGA.
CAGCACTGA.
CAGCACTGA.
TGACACTGAT


AGGTGAAAAA
AGCTGAAAAA
AGGTGAAAAA
AGGTTAAAAA
AGGTAAAGAA


CAGCGGGTTT
CAGCGGGTTT
CAGAGGGTTT
CAGCGGGTTT
CAACGTGTTT


CAATCTCCGT
CAATCTCTGT
CAATCTCGGT
CAATCTCTGT
CAATCTCTGT

100
AGTAATCGGG
AGTAATCGGG
AGTAATCGGG
AGTAATCGGG
GGAAACCGTG

150
GCCACTGAAA
GCCACTGAAA
GCCACTGAAA
GCCACTGAAA
ACAAATGAAA

200
TGCAATCAAA
TGCAATCAAA
TGCAATCAAA
TGCAATCAAA
AACAAGCTAG

250
..CGAGATGA
..CGAGATGA
..CGAGATGA
..CGAGATGA
CCAGAGATGC

300
GGGTCCGAGT
GGGTCCGAGC
GGGTCCGAGT
GGGTCCGAGT
GGGGCCAAAT

350
TCGCTCGTAT
TCGCTCGTAT
TCGCTCGTAT
TCGCTCGTAT
TGGAGCGTAT













351
TGAGCAGGAT
CGAGCAGGAT
TGAGCAGGAT
TGAGCAGGAT
CAGCTTTGAA

401
ATTATGACGA
ATTATGACGA
ATTATGACGA
ATTATGACGA
GAGTATATGC

451
ACTCACAACG
ACTCACAACG
ACTCACAACG
ACTCACAACG
AATGGCATAG

501
CAAGAAGGAA
CAAGAAGGAA
CAAGAAGGAA
CAAGAAGGAA
CAGAAAGGAA

551
CACTCAATAG
CACTTAATAG
CACTTAATAG
CACTTAATAG
GTGTTAATAA

601
ATCCCTGTTG
ATCCCTGTTG
ATCCCTGTTG
ATCCCTGTTG
ATTCCAGTTG


GAGGCAGCAC
GAGGCAGCAC
GAGGCAGCAC
GAGGCAGCAC
AAGATCGAAA


TTCTATCACA
TTCCATCACA
TTCGATCATA
TTCGATCACA
TACTGTGACG


TTGATGTGAG
TTGATGTGAG
TTGATGTGAG
TTGATGTGAG
CTAACTCAAG


AGGAAGAAAG
AGGAAGAAAG
AGGAAGAAAG
AGGAAGAAAG
AAGAAGAAAA


CTTGTGCACA
CTTGTGCACA
TTTGTGCACA
CTTGTGCACA
TCTGTGCGAT


AGATGATTGG
AGATGATTGG
AGATGATTGG
AGATGATTGG
AAATGATTGG


651
FL CAAGAGGTTT AGGGGATATT
CA CAAGAGGTTT AGGGGATGTT
SV CAAGAGGTTT AGGGGATGTT
MD CAAGAGGTTT AGGGGATATT
RU CAAGAACTTT AAGGGATCTT
Fig. 2-9--continued.


GCAAGAAAGA
GCAAGGAAGA
GCAAGGAAGA
GCAAGGAAGA
AAGGAGCAGA


AATCTAGCAC
AATCTAGCAC
AGTCTAGCAC
AATCTAGCAC
TCCATCATTA


CTTGACGTCA
CTTGCGATCA
CTTGACGTCA
CTTGACGTCA
TTTGCGCTCA


TGGCGCAAAA
TGGCGCAAAA
TGGCGCAAAA
TGGCGCAAAA
TAGTATGTGA


CGTGTTCTTA
CGTGTTCTTA
CGTGTTCTTA
CGTGTTCTTA
CGCGTTCTCA


CAACAAGAAG
CAACAAGAAG
CAACAAGAAG
CAACAAGAAG
AAAGAAAAAG


TTGTTGGAAA
TTGTTGGAAA
TTGTTGGAAA
TTGTTGGAAA
TCATTGGGAA


GACTGTTTTC
GGCTGTTTTC
GGCTGTTTTC
GGCTGTTTTC
AAGACAAGTT


GTGTTCTTCC
GTGTTCTTCC
GTGTTCTTCC
GTGTTCTTCC
ATACATTCAC


TCGTTTTACA
CCGTTTTACA
CCGTTTTACA
CCATTTTACA
CCGTTCTATA


GCAAATTGTG
GCAAATTGTG
GCAAATTGTG
GCAGATTGTG
AAATGTTGTG


AAATTGCACG
AAATTGCACG
AAATTGCACG
AAATTGCACG
AGATAGCGCG


GCGAGACATA
ACGAGACATA
GCGAGACATA
GCGAGACATA
AATCGACACA


GGTGTCAGTT
GGTGTCAGTT
GGTGTCAGTT
GGTGTCAGTT
AGTTTCATTA


400
CTCGAAGGAA
CTCGAAGGAA
CTCGAAGGAA
CTCGAAGGAA
CTACCATGGC

450
ACCTGAAGTG
ACCTGCCGTG
ACCTGAAGTG
ACCTGAAGTG
AGATGAAAGG

500
AGCGCACATA
AGCGCACATA
AGCGCACATA
AGCGCACATA
AACGTTCATG

550
C...AAGCAC
C...AAGCAC
C...AAGCAC
C...AAGCAC
CGTTCAGCCA

600
CAATAAAAAT
CAATAAAAAT
CAATAAAAAT
CAATAAAAAT
GGAGAAAAAC

650
CACTCACCTT
CACTCACCTT
CACTCACCTT
CACTCACCTT
CCCTCACCTT

700
GCGCATGAAG
GCGCATGAAG
GCGCATGAAG
GCGCATGAAG
GCACACGAAA















701
AAGGACGAAT
AAGGACGAAT
AAGGACGAAT
AAGGACGAAT
GGGGCCAAAT

751
CTAAAAGCCA
CTTAAAGCCA
CTAAAACCCA
CTAAAAGCCA
CTACAAGCCA

801
TATTAAACCA
TATTAAACCA
TATTAAACCA
TATTAAACCA
CATCAAGCCG

851
CTAAAAGATA
CTAAAAGATA
CTAAAAGATA
CTAAAAGATA
CTCAGAAATT

901
GATGGGATTG
GATGGGATTG
GATGGGATTG
GATGGGATTG
GAAGGAATTG


GCGGCGCACT
GCGGCACACT
GCGGCGCACT
GCGGCGCACT
GAGACATGTT


TTTGTCAGGT
TTTGTCAGGT
TTTGTCAGGT
TTTGTCAGGT
TCTGTCGGGT


GGTTGTAGTG
GGTTGTAGTG
GGTTGTAGTG
GGTTGTAGTG
GGGTGTAGCG


TTCAAGATTG
TTCAAGATTG
TTCAAGATTG
TTCAAGATTG
TTCGAGGTTA


TGAACGCGCT
TGAACGCGCT
TGAACGCGCT
TGAACGCGCT
TGAATGCATT


750
GAGATGTCGT ATGAGCAGTT TAAATGGATT
GAGATGTCGT ATGAGCAGTT TAAATGGCTT
GAGATGTCGT ATGAGCAGTT TAAATGGATT
GAGATGTCGT ATGAGCAGTT TAAATGGATT
GAGATGTCGT ACGAACAGTT TGGATTCATT


CACCCATACA
CACCCATACA
CACCTATACA
CACCCATACA
TACGAACACA


GGTGGGTGTT
GGTGGGTGTT
GGTGGGTGTT
GGTGGGTGTT
GATGGGTTCT


CCACATTTGG
CCACATTTGG
CCACATTTGG
CCACATTTGG
CCATGCCTAG


GGAACAGGTG
GGAACAGGTG
GGAACAGG..
GGAACAGG..
AGAACCAGTG


GAGCGAATTC
GAGCGAATTC
GAGCGAATTC
GAGCGAATTC
AGATGTGTGC


GGGCACTAAT
GGGCACTAAT
GGGCACTAAT
GGGCACTAAT
AGGCGATGAT


TGATTCGAGG
TGATTCGAGG
TGATTCGAGG
TGATTCGAGG
TAATTCGTGG


800
GTGAGGAAGA
GTGAGGAAGA
GCGAGGAAGA
GTGAGGAAGA
GCGATGAGGA

850
CATACATTGA
CATACATTGA
CATACATTGA
CATACATTGA
CACGAACTTA

900
TAGAGACGAC
TAGAGACGAC
TAGAGATGAC
TAGAGACGAC
TAGAGATGAT


942
TTATTTTATA GC
TTATTTTATA GC


TTCTTCTATG AT


Fig. 2-9--continued.

















1
M----ASI
.RIQALH...
S----.A.

. M I- Il 1 *

51
THMYYRHESK
..........
S.S..K.A.E
..........


101
GRIVLRKPSK
...A......
..MIL...RA
..........
..........
151
PEVTHNVDVS
..........
NGIA-NS--.
..........
.A........
201
NKNIPVEMIG


E..........
E.........


..........
251
KWILKAICQV


GF..Q...R.
.....P....


301
RDDDGIVNAL


...E......
...Eooeoe


MIGSISVPIA


S. .V





KLMQSNK-SI


..SKQASE..





QRVFARIEQD


...LE..SFE





LTSSFYKRTY
...P......
.R.P .... SC
...P......
.R.P......


KTKQCANTQV
..EH ......
ESAR..TV.T
..E.......
..E.......


DILNNFFSTD
..........
N...S..D..





--E-AARKKE
--.-...E.
KI.KG.ERQV
--.-...E.
--.-....E.


KKERKKVAQK


R..K..IVCE
..........


NKKARHTLTF KRFRGYFVGK


...... ..
K..N......

S. .T......
...T ......


THTERIREED


.N.RCV.D..
.Y ........
.........
orreeoee


.N.K.S.I..


.....C....
*
IKPGCSGWVL



..........
ee ee


SNRVNIVAPG

G..........
G.........
.... S..P..
. .A. ... .


-EMKFRLTRN
-....SV...
P..R ......





TVFLEGNYDD
A..........
LPWRVYATVT
A.........
A.........


QIVQAP-LNS


NV.RSASV.N



*
VSVAHEEGRM


..L...R.Q.





GTNHTLTKRY


.DD.E..QKF

..........e o


50
HMATCPLPLK
...1......
.V.V.KPQM.


..........
100
EMSKVKKGPS
..........
.........N


... L.....
150
SITNLARVLP
..........
..I.TFTDER
..IS......
..........
200
LCTRVLKIAR
..........
..D.......
..........
..........
250
RRTEMSYEQF

.HV.......

.HV.......


300
SRLPHLVIRG


..C-.....
..PC-......
..........


EQVLFYS


.P.F..D


CA RDDDGIVNAL EQVLFYS


Fig. 2-10. Amino acid sequence alignment of the P1 proteins
of five ZYMV isolates: ZYMV-FL/AT, -MD, -RU, -SV, and
-CA. Conserved residues among ZYMV isolates are underlined.
Asterisks indicate strictly conserved residues among
potyviruses. ZYMV-MD and -SV terminate at -EQ due to
primer selection for PCR.









isolate compared to ZYMV-FL/AT, five made a difference in

the polarity or charge, and five changes made no difference.

In addition there was a deletion of a His at position 41 in

the ZYMV-SV isolate. The P1 from the ZYMV-MD isolate had an

insert of 6 additional amino acids immediately following the

initiation codon, compared to ZYMV-FL/AT. There were nine

different amino acids in the N-terminal half of ZYMV-MD,

seven of which made a difference in the charge or polarity.

The P1 of ZYMV-CA had a high degree of similarity

compared to ZYMV-FL/AT (96%), whereas ZYMV-RU was highly

divergent with only a 60% nt sequence homology compared to

the P1 of ZYMV-FL/AT (Table 2-3). In spite of the

variability seen among five P1 regions, certain consensus

regions and amino acids believed to be involved or required

for protease activity of P1 were conserved. For example,

all five isolates had the amino acid consensus Gly-Xaa-Ser-

Gly, the His at position 223 and Ser at position 264 (Fig.

2-10). The conserved potyvirus sequence of Phe-Ile-Val-

Arg-Gly (Verchot et al., 1991) close to the P1/AI cleavage

site, was slightly different, with a sequence of Leu-Val-

Ile-Arg-Gly for all five isolates (Fig. 2-10).

Homologies Between P1. AI. and P3 of ZYMV Isolates and Other

Potyviruses

Nucleotide and amino acid sequence comparisons were

made between the P1, AI, and P3 of ZYMV-FL/AT with ZYMV-CA,














Table 2-3. Percentage of nucleotide and amino acid
sequence homologies of the P1, amorphous inclusion
(AI), and P3 regions of four ZYMV isolates and five
distantly related potyviruses with respect to
ZYMV-FL/AT.


Virus/isolate


ZYMV-CA

ZYMV-SV

ZYMV-MD

ZYMV-RU

TEV

PVYN

TVMV

PPV

PSbMV


96(97)

98(97)

95(97)

60(70)

42(45)

37(46)

39(48)

41(38)

39(37)


98(98)

ndb

nd

88 (96)

52 (63)

51 (64)

52 (64)

52 (65)

50 (58)


98(99)

nd

nd

84 (96)

43 (54)

44 (49)

44 (52)

45 (50)

45 (52)


a
Homologies were determined using the GAP alignment
of the University of Wisconsin Genetics Computer
Group Program. GAP calculates alignment of two
complete sequences that maximizes the number of
matches and minimizes the number of gaps.
Nucleotide sequence homologies are listed first
with amino acid homologies in ().


b
nd=not determined










ZYMV-RU, TEV (Allison et al., 1986), potato virus Y-strain

N(PVY") (Robaglia et al., 1989), TVMV (Domier et al., 1986),

plum pox virus (PPV) (Lain et al., 1990), and pea seed-borne

mosaic virus (PSbMV) (Johansen et al., 1991) (Table 2-3).

Sequence comparisons also were made between ZYMV-FL/AT, and

ZYMV-SV, and ZYMV-MD for P1.

The P1 of ZYMV-CA, ZYMV-SV, and ZYMV-MD had high nt and

amino acid sequence homologies to ZYMV-FL/AT ranging from

96% (CA) to 98% (SV). However, the P1 gene of ZYMV-RU had a

60% nt and a 70% amino acid homology compared to the P1 of

ZYMV-FL/AT, and this was the greatest difference seen

between a single gene among five ZYMV isolates studied to

date. These nt homology values are also compared to the P1

of TEV (42%), PVY" (37%), TVMV (39%), PPV (41%), and PSbMV

(39%). The amino acid homologies were higher than the nt

homologies for each virus in most cases (Table 2-3).

The AI nt coding region of ZYMV-FL/AT was also compared

to that of ZYMV-CA (98% homology) and ZYMV-RU (88%). The

deduced amino acid sequence for ZYMV-CA was the same as the

nt homology compared to ZYMV-FL/AT. However, the amino acid

homology for the Al of ZYMV-RU was 98%, indicating that many

of the nt changes made no difference in the amino acid

sequence. The AI sequence comparisons to unrelated

potyviruses were from 50% homology for PSbMV to 52% for TEV,

TVMV, and PPV.










The nt sequence of the P3 of ZYMV-FL/AT showed a 98%

homology with the P3 of ZYMV-CA and 84% homology with ZYMV-

RU. The ZYMV-FL/AT and distantly related potyviruses had nt

homologies to ZYMV-FL/AT ranging from 43-45%. The amino

acid sequence homologies of P3 compared to ZYMV-FL/AT were

slightly higher than the nt homologies (Table 2-3). In all

nt and amino acid comparisons, the P1 was the least

conserved region whereas the HC/Pro was more highly

conserved than either P1 or P3.


Discussion


Attempts to clone the entire 5'-terminus of the ZYMV

genome necessitated the use of custom primers to force

cloning specifically for the 5'-end. This resulted in a

series of clones which represented the entire ORF of the

ZYMV genome.

High nucleotide sequence similarities among the P1 of

ZYMV-FL/AT, -SV, -MD, and -CA isolates were noted, but a

significant divergence was seen with the P1 of the ZYMV-RU

isolate. The larger size of the P1 from ZYMV-MD as seen in

PCR analysis in agarose gels was verified by sequences which

showed a six amino acid insert after the start codon.

Whereas the first five amino acids were Met-Ala-Ser-Ile-Met

for ZYMV-FL/AT, -SV, and -CA, and Met-Ala-Ala-Ile-Met for

ZYMV-RU, the corresponding sequence for ZYMV-MD was Met-Arg-

Ile-Glu-Ale-Leu-His-Ala-Ser-Ile-Met. All the differences








52

seen in the amino acid sequence for the ZYMV-MD were in the

N-terminal half of P1. Eight of the 11 amino acid

differences (which include one deletion) in the ZYMV-SV

isolate were also in the N-terminal half of P1.

The conserved residues in the C-terminus of P1 have

been maintained to some degree in the five ZYMV isolates

studied. The His and Ser residues important for protease

activity were present in all five isolates of ZYMV.

However, the consensus sequence reported for the five

potyviruses analyzed by Verchot et al. (1991) is slightly

different. Instead of Phe-Ile-Val-Arg-Gly, the sequence for

ZYMV isolates is Leu-Val-Ile-Arg-Gly. This sequence

suggests a possible inversion of amino acids Val and Ile at

this point. In spite of the lower conservation of ZYMV-RU,

it is interesting to note that the conserved regions are the

same among all ZYMV isolates, as well as the putative

Tyr/Ser cleavage site between P1 and AI.

Among the five ZYMV isolates in this study, and five

other potyviruses which have been completely sequenced

(Verchot et al., 1991), the P1 is the most variable region

on the potyviral genome. In addition, the N-terminus of P1

is more variable than its C-terminus.

Although the AI was not the primary focus of this

research, the homologies of the potyviruses and three ZYMV

isolates addressed in this study were compared. The AI-

encoding region was more highly conserved than that of P1,









with a high homology (98%) noted between ZYMV-FL and ZYMV-

CA, and a lower (88%) homology between ZYMV-FL/AT and ZYMV-

RU. Other potyviruses had sequence homologies compared to

ZYMV-FL/AT in the range (51-52%) expected for distinct

potyviruses (Shukla et al., 1991).

The homologies seen for the P3-encoding region were

similar to those seen for the AI-encoding region, with a

high homology (98%) between ZYMV-FL/AT and -CA, and a lower

homology (84%) between ZYMV-FL/AT and -RU isolates. The

homologies of distinct potyviruses compared to ZYMV-FL/AT

were lower (43-44%), as expected.

It is clear from the sequence analyses presented in

this study, that there is variation in the P1 coding region

among ZYMV isolates. There is also greater variation in the

P1 region than in the AI or the P3 regions. The ZYMV-RU

isolate appears to have a more highly diverged P1 nt

sequence than the other ZYMV isolates addressed in this

study. According to the criteria proposed by Shukla et al.

(1991), ZYMV-RU does not fit the category of either a strain

or a distinct potyvirus, regardless of whether the P1, AI,

or P3 regions are considered. In addition, the CP region of

ZYMV-RU is 88% similar to that of ZYMV-CA (Baker, et al.,

1991b). Polyclonal antisera to the CP of ZYMV-FL/AT and

ZYMV-RU cross react in reciprocal SDS-immunodiffusion tests

with the formation of spurs (Baker, et al., 1991a). Several

monoclonal antibodies (MAbs) produced to ZYMV-FL/AT








54

(Appendix 1) show a low affinity to ZYMV-RU. The

symptomatology of ZYMV-RU on a range of susceptible hosts is

very similar to classical ZYMV symptoms (Baker et al.,

1991a; H.Lecoq, unpublished).













CHAPTER 3
SEROLOGICAL CHARACTERIZATION OF THE P1 PROTEIN OF
ZUCCHINI YELLOW MOSAIC VIRUS FROM FLORIDA

Introduction


The nt sequences of the P1 and and P3 coding regions

are less conserved than other coding regions on the

potyviral genome (Shukla et al., 1991). Furthermore, the N-

terminus of the P1 protein is less conserved than its C-

terminus. For these reasons, it was hypothesized that the

antigenic characterization of the P1 and P3 proteins would

prove useful in distinguishing different isolates of

potyviruses.

In order to evaluate the potential of antigenic

properties of P1 and P3 for distinction of ZYMV isolates,

the following experimental approach was attempted: cloning

and sequencing of the P1 and P3 encoding regions as

described in chapter 2, expression of the encoded proteins

in E. coli, production of antisera to the expressed

proteins, and development of serological detection methods.

These procedures were successful for the P1 protein of ZYMV-

FL/At and ZYMV-RU, and this chapter describes the antigenic

detection and characterization of the P1 proteins of ZYMV

isolates by western blots of extracts from infected plants








56

and by immunofluorescence in infected tissues. Although the

P3 of ZYMV was cloned and sequenced, the toxicity of this

protein in E. coli prevented expression of P3 and

preparation of antisera, so that no serological studies were

conducted with the P3 protein. During the course of this

study, Rodriguez-Cerezo and Shaw (1991) used a similar

approach to obtain antisera to P1 and P3 of TVMV. Although

the P3 of TVMV appeared to be toxic to E. coli, as seen by

cessation of cell growth, P3 was expressed in low levels.

They detected the P1 and P3 proteins of TVMV serologically

in extracts from infected plants and protoplasts. The P3 of

TEV is likewise toxic to E. coli and cannot be expressed in

its entirety (V. Doljas, personal comm.).




Materials and Methods


Culture of Virus Isolates

Table 3-1 lists the isolates of ZYMV used in this

study, their source, and the original host from which they

were isolated. Host plants were maintained in a growth room

under a ca. 16 hr day length with an average temperature of

23 C or in a greenhouse. Isolates obtained from outside the

state of Florida were kept under quarantine conditions in a

locked growth room. Two ZYMV isolates from Israel were

kindly provided by Y. Antignus (Volcani Center, Bet Dagan,

Israel). Three ZYMV isolates from France were kindly










Table 3-1. List of zucchini yellow mosaic virus isolates
used for serological studies of the P1 protein.


Isolate
FC-2000

FC-2050

FC-2154

ZYMV-RU

Italy

ZYMV-FL/AT
a
ZYMV-FL/GH

ZYMV-SV

ZYMV-MD

81-25

FC-3182

HAT

NAT

Egypt

Connecticut

Taiwan

PAT

weak

E15

FC-3179

FC-3180

FC-3181


Origin
FL-Alachua Co.

FL-Dade Co.

FL-Collier Co.

Reunion Island

Italy

FL-Sumter Co.

FL-Sumter Co.

FL-Palm Beach Co.

FL-Alachua Co.

FL-Sumter Co.

FL-DeSoto Co.

Israel

Israel

ATCC 405

ATCC 594

ATCC 622

France

France

France

FL-DeSoto Co.

FL-DeSoto Co.

FL-DeSoto Co.


Host
squash

squash

watermelon

Momordica charantia

zucchini

zucchini

zucchini

squash

squash

squash

zucchini

zucchini

zucchini

squash

squash

squash

muskmelon

muskmelon

muskmelon

zucchini

zucchini

zucchini


a
ZYMV-FL/GH=an isolate of ZYMV maintained for several years
by mechanical inoculation.










provided by H. Lecoq (INRA, Station de Pathologie Vegetale,

Montfavet, France). Three additional isolates were obtained

from the American Type Culture Collection (ATCC). The 81-25

culture was isolated by W.C. Adlerz and was obtained from

D.E. Purcifull. All the remaining Florida isolates were

from the collection of D.E. Purcifull and G.W. Simone. Host

plants used for routine assay and maintenance were pumpkin

(Cucurbita pepo L. 'Small Sugar'). Squash (C. pepo L.

'Early Prolific Straightneck'), watermelon [Citrullus

lanatus (Thunb.) Matsumi & Nakai 'Crimson Sweet'], and

cantaloupe (C. melo L. 'Hales Best Jumbo') were also used

for some studies.

For mechanical inoculations, tissues were triturated in

a mortar and pestle with 0.02 M potassium phosphate buffer,

pH 7.5, with the addition of 600 mesh carborundum. The

slurry was rubbed onto fully expanded cotyledons with

sterile cheesecloth pads, and plants were rinsed gently with

water several minutes after inoculation. Mock inoculations

were made using extracts from noninoculated plants.

Increase of P1 and P3 by PCR for Subcloning and Expression

Based on the nt sequence of P1 and P3 of ZYMV-FL/AT,

primers were made which correspond to the beginning and end

of each protein encoding region with special attention to

areas with a high GC content. For cloning of P1 of ZYMV-

FL/AT, restriction sites with five flanking bases on the 5'-

end were incorporated into the primers to provide for










directional cloning into the pETh vector (McCarty et al.,

1991) at HindIII and BglII sites on the polylinker. The

pETh vector was selected as the expression vector in this

study. It is a modification of the original pET vector

developed by Studier et al. (1990) for high level expression

of genes under the control of the T7 RNA polymerase from

bacteriophage T7. In this system, if the protein product is

not toxic to E. coli, host transcription cannot compete

after induction of the T7 promoter and almost all

transcription becomes due to the T7 RNA polymerase.

Primers used for increase of the P1 of ZYMV-FL/AT are

presented in chapter 2. The P1 of ZYMV-RU was also

increased by PCR for subcloning and expression. The primer

for the 5'-end of the ZYMV-RU P1 gene was the same as for

ZYMV-FL/AT P1, but for the 3'-end the primer was 5'-

GGGCTCTAGATGGTTCTAATGCAT-3', which included a BglII site and

four flanking bases on the 5'-end. Primers for increase of

P3 by PCR were, on the 5'-terminus, 5'-GGCGGAACACCAACA-3'

and on the 3'-terminus was 5'-CCAACCGTACCAAAA-3'. The

primers for P3 did not include restriction sites, and the P3

gene was blunt-end ligated into the pETh vector.

The correct reading frames were selected for P1 and P3,

based on the nt and deduced amino acid sequence, to be in

frame with the ATG initiation codon of pETh. For P1 of both

ZYMV-FL/AT and ZYMV-RU the plasmid providing the correct

reading frame was pETh-3b, and for P3 it was pETh-3c. In










all cases digestion at the engineered restriction sites on

the primers was unsuccessful (even after protease K

digestion and phenol/chloroform extraction), so the PCR

product was blunt-end ligated into the SmaI-digested, CIAP-

treated plasmid.

An intermediate E. coli host, strain HB101, was

transformed (Sambrook et al., 1989) for initial studies.

Plasmid mini-preps were made from transformants to

determine, by sequence data, the presence of the correct

gene, its orientation, and verification of the correct

reading frame for expression. Primers used for sequencing

were the T7 promoter primer and the pBR322 EcoRI site

clockwise primer, both obtained from the University of

Florida DNA synthesis facility.

Induction and Expression of P1 and P3 Proteins

Plasmid cultures which were identified as P1 and P3 in

the correct orientation and reading frame were used to

transform the appropriate host for expression, E. coli

strain BL21DE3pLysS. A single transformant colony grown on

LB containing ampicillin (50 gg/ml) and chloramphenicol (25

Ag/ml) was raised in 5 ml of M9 medium (Sambrook et al.,

1989) with 0.4% glucose and 0.5% tryptone at 37 C with

shaking to an O.D.600 of 0.6. Cultures were divided into 2.5

ml aliquots. One 2.5 ml aliquot was induced with 1 mM IPTG.

Both induced and noninduced cultures were allowed to grow an

additional 3-4 hr at 37 C. Cells were harvested by









centrifugation at 5,000 g, pellets were resuspended in one

half the original volume of TE buffer (10 mM Tris-HCl, 1 mM

EDTA, pH 8.0), and frozen at -20 C overnight. The viscosity

of the cell lysate necessitated sonication for 5 sec to

allow for pipetting. Ten pl of each sample was mixed with

an equal volume of Laemmli dissociating solution (LDS)

(Laemmli, 1970), the mixtures were boiled for 2 min, and

were subjected to analysis by sodium dodecyl sulfate-

polyacrylamide gel electrophoresis (SDS-PAGE). Gels were

stained with Coomassie Brilliant Blue R-250 (BRL,

Gaithersburg, MD) for detection of expressed proteins. In

all cases, both induced and noninduced recombinant plasmid

cultures were tested, as well as plasmid cultures containing

no inserted gene.

Since P3 appeared to be toxic to E. coli in this

system, as determined by lack of cell growth and protein

expression following induction, an alternate induction

procedure was attempted using the bacteriophage CE6 to

infect pETh plasmids containing P3 in the E. coli host

HMS174. The HMS174 has no T7 RNA polymerase and the enzyme

is provided by infection with CE6 bacteriophage. This

expression can be useful for expression of toxic gene

products (Studier et al., 1990).

Antigen Preparation and Antibody Production

Since the P1 proteins expressed by both ZYMV-FL/AT and

ZYMV-RU were insoluble, the proteins were partially









purified, after sonication, by three cycles of

centrifugation of the precipitate at 10,000 g and washing

with TE buffer, followed by preparative SDS-PAGE on a 3 mm

gel. Protein bands were visualized by incubating in 0.2 M

KC1 for 7 min at 4 C. The protein bands were excised,

washed three times in cold distilled water, frozen at -20 C,

and eluted using a Bio-Rad Electroeluter at 10 mAmp/tube,

with constant current for 5 hr. Polarity was reversed for 1

min, and the extracted proteins were dialyzed overnight

against distilled water. Purity of the eluted protein was

checked by analytical SDS-PAGE, after which the protein was

lyophilized.

A New Zealand white rabbit (no. 1181) was immunized on

day one with 2 mg of ZYMV-FL/AT P1 protein in 0.5 ml sterile

distilled water which was emulsified with 0.5 ml of Freund's

complete adjuvant. Injections were made using 0.25 ml of

emulsion per site, with two intramuscular sites per hip. On

day 14 and day 21, 1 mg protein was used with 0.5 ml water

and 0.5 ml Freund's incomplete adjuvant. The same schedule

was followed for rabbit no. 1186 which was immunized with

the P1 protein of ZYMV-RU. Rabbits were bled on a weekly

basis starting on day 28 for 2 months, with a 4 week

interval before a booster injection on day 112 and

subsequent bleeding.










Western Blotting Procedure

The western blotting procedure was conducted

essentially as described by Towbin et al. (1979) using a

Bio-Rad Mini-Protean II Electrophoresis Cell and Bio-Rad

Trans-Blot Electrophoretic Transfer Cell. Ten per cent gels

were used primarily, with occasional 8 and 15% gels being

run for special purposes.

Young, symptomatic leaves of inoculated test plants

were harvested between days 5 and 21 post-inoculation.

Extracts for immunoblots were initially prepared by

triturating leaf tissue in LDS (1:1, w:v), followed by

boiling for 2 min. However, for adequate extraction of P1

from plant tissues, an alternate extraction buffer (ES

buffer) (Rodriguez-Cerezo and Shaw, 1991) was used which

gave improved results. The ES buffer consisted of 75 mM

Tris-HCl, pH 6.1 containing 9 M urea, 7.5% 2-

mercaptoethanol, and 4.5% SDS. One part plant tissue was

triturated in a mortar and pestle with 2 parts of ES buffer.

The triturate was squeezed through a single layer of

moistened cheesecloth, boiled 2 min, and centrifuged at

5,000 g for 5 min. Centrifuged samples were stored at -20 C.

Each isolate was tested from at least two different sources

of tissue.

Nitrocellulose membranes (Bio-Rad Trans-Blot, 0.4A)

were rinsed three times with TBST after transfer, followed

by incubation for 15 min at RT with 10 ml blocking solution









containing E. coli lysate at 1 mg/ml and extracts from

noninfected plants. The noninfected plant extract was

prepared by triturating leaf tissue in water (1:9, w:v) and

straining through a single layer of moistened cheesecloth.

The specific primary antibody was added at 1/1000 dilution.

The procedure for the secondary antibody and development are

as described in chapter 2 for immunoscreening. Reactions

were allowed to develop at RT and were stopped by rinsing in

deionized water.

In Vitro Translation and Immunoprecipitation

The wheat germ (WG) in vitro translation procedure was

the same as described by Cline et al. (1985). Three pg of

RNA from ZYMV-FL/AT in a 50 Al WG extract mixture,

containing 40 MCi of [H3]leucine was incubated at 25 C for

60 min. Immunoprecipitation analyses were performed as

described by Dougherty and Hiebert (1980). Precipitated

products were separated on a 10% SDS-PAGE and detected on

dried gels by fluorography as described by Bonner and Lasky

(1974). Antisera used for immunoprecipitation of in vitro

translation products were to the P1 and CP of ZYMV, and to

the AI of PRSV-W.

Production of Antisera to Synthetic Peptides

Synthetic peptides to the N-terminus of both the P1 and

P3 proteins of ZYMV were prepared by the University of

Florida protein synthesizing facility. The amino acid

sequence of the peptide prepared to P1 was Met-Ala-Ser-Ile-









Met-Ile-Gly-Ser-Ile-Ser-Val-Pro and to P3 was Gly-Thr-Pro-

Thr-Gln-Arg-Ile-Lys-Leu-Glu-Glu-Gln. Both free peptide and

peptide conjugated to BSA were used as immunogens. Peptides

were coupled to BSA according to Harlow and Lane (1988).

One mg peptide and 1 mg BSA were each dissolved in 1 ml of

0.1 M potassium phosphate buffer, pH 7.0. Two hundred Al of

fresh 25% glutaraldehyde was added to 1 ml of the

protein:peptide solution and stirred overnight at room

temperature. This was followed by dialysis against

deionized water three times over a 24 hr period. The

material was lyophilized and stored at -20 C. Immunization

protocols followed were as described for the expressed P1

protein from E. coli. Rabbit numbers for P3 peptide and the

conjugated P3 peptide were 1167 and 1169, respectively. The

rabbit numbers for the P1 peptide and the conjugated P1

peptide were 1168 and 1170, respectively.

Light Microscopy and Immunofluorescence Tests

Indirect immunofluorescence tests were conducted as

described by Hiebert et al. (1984) with some modifications.

Six Al of 10% dimethyl sulfoxide (DMSO) in phosphate

buffered saline (PBS), 27 pl of healthy plant extract (1/10

in PBS containing 1% ovalbumin), and 27 pl of antiserum were

incubated together for 30 min prior to addition of epidermal

strips from plant tissue. Epidermal strips were incubated

in the antibody preparation in a 1.5 ml microfuge tube after

vortexing for 10 sec to ensure complete exposure of the










tissue to the antibody solution. Tissue was incubated in

the antibody solution on a shaker for 3-4 hr at RT in the

dark. Rinsing between steps was done twice in 1 ml of TBST

after vortexing for 10 sec and once for 1 hr in PBS while

shaking at RT in the dark. Rhodamine-conjugated protein A

(Sigma Chemical Co., St. Louis, MO) was used as a

fluorescent probe. The rhodamine-conjugate was diluted 1

g/ml in PBS. Eight gl of the conjugate was mixed with 40 gl

of 10% DMSO and 352 pl of PBS. After vortexing, rinsed

tissue was incubated in this solution at RT for 3-4 hr in

the dark while shaking. After a final rinse, tissue was

mounted on microscope slides using Aqua-mount (Lerner Labs,

New Haven, CT). 'Crimson Sweet' watermelon was used as the

host for immunofluorescence tests. Tissue sections were

photographed with epifluorescence optics using a Nikon

Fluophot microscope with a G2A filter.




Results


Expression of P1 and P3 Coding Regions in E. coli

Initial efforts to clone P1 by cohesive end ligation at

digested sites of PCR products were unsuccessful.

Subsequently, PCR products of P1 and P3 were blunt-end

ligated successfully into the pETh plasmid. Clones were

sequenced to determine the correct orientation and reading




















1 2 3 4 5 6


..~ p. '-L
- r


200
97

- 68



43



29


Fig. 3-1. Expression of P1 protein of ZYMV-FL/AT cloned
into the pETh plasmid. A: Cultures expressing P1 were grown
for 3 hrs after induction with IPTG. Noninduced cultures
were processed the same as induced cultures. Lanes 2 and 4
are induced cultures carrying the P1 gene. Lanes 1 and 3
are noninduced cultures carrying the P1 gene. Lane 5 is a
noninduced culture carrying the pETh plasmid only, and lane
6 is the same culture, induced. B: Lane 1 is the P1
protein which was partially purified by centrifugation prior
to preparative electrophoresis, and lane 2 is the supernate
from the same preparation. Arrow indicates the P1 expressed
protein at ca. 35-kDa.


1 2


~i










frame, and were then used to transform the appropriate E.

coli host for expression, BL21DE3pLysS.

Induction of P1 from ZYMV-FL/AT resulted in

overexpression of an insoluble protein product of ca. 36-kDa

(Fig. 3-1A). Fifty ml cultures were induced for large scale

P1 protein production. The P1 protein was insoluble and

thus was easily purified by three cycles of centrifugation

and washing, thereby providing a product free of

mostbacterial proteins (Fig. 3-1B). Further purification of

P1 protein from bacterial lysates was accomplished by

preparative SDS-PAGE and electroelution. The protein

product was then lyophilized and used for antiserum

production in rabbits. Bleeding dates for P1 of ZYMV-FL/AT

used were from 4 weeks to 7 months after the original series

of immunizations. For the P1 of ZYMV-FL/AT, rabbit 1181 was

bled from September 13, 1991 through July 16, 1992. The P1

of ZYMV-RU was expressed and purified in a similar manner

for use as an immunogen. For the P1 of ZYVM-RU, rabbit 1186

was bled from May 28, 1992 through July 16, 1992.

Induction of the P3 protein was unsuccessful in both

the pETh/BL21DE3pLysS system and when using the

bacteriophage CE6 to infect the host HMS174 carrying the

pETh plasmid (data not shown). These results are similar

to the results with the TEV P3 protein (V. Doljas, personal

comm.), which is toxic in E. coli and thus cannot be

expressed in its entirety. Rodriguez-Cerezo and Shaw (1991)









expressed P3 of TVMV in E. coli. The induced bacterial

cells ceased growth following induction with IPTG, and thus

the level of expression was low (E. Rodriguez-Cerezo,

personal comm.). Apparently the P3 protein of all three

potyviruses is toxic to varying degrees in E. coli.

Detection of P1 Protein in Plants Infected with ZYMV

Initial extraction of ZYMV-infected plant tissues with

LDS gave very weak reactions in western blots. Extraction

with ES buffer gave satisfactory reactions with ZYMV-

infected plant tissues in western blots using antiserum to

P1 of ZYMV-FL/AT as a probe. The antiserum reacted

specifically to a ca. 34-kDa protein in plant tissue

infected with ZYMV-FL/AT. No protein was detected in

extracts from healthy plant tissues. Western blots with

preimmune serum did not result in a detectable protein

reaction.

In western blots using antiserum to the P1 of ZYMV-

FL/AT (1181), a P1 protein reaction at ca. 34-kDa for ZYMV-

FL/AT was noted. Some heterogeneity was seen among the

other ZYMV isolates used in this study (Fig. 3-2). A higher

molecular weight (mw) of ca. 35-kDa was noted for some ZYMV

isolates including ZYMV-MD, FC-2000, FC-2050, and three

isolates from France (PAT, weak, and E15) (Table 3-2). P1

products that were slightly smaller than that of ZYMV-FL/AT

included those of ZYMV-SV, three ATCC isolates of ZYMV (from

Egypt, Taiwan, and Connecticut), and the original ZYMV










isolate from Italy. In addition to size differences of P1

protein, some isolates showed a possible breakdown product

of ca. 26-27-kDa whereas others (FC-3182, weak and E15 from

France) showed an incomplete processing of P1 and HC/Pro by

the reaction of a band of ca. 88-kDa. This 88-kDa band of

FC-3182 was tested and also reacted with antiserum to the AI

of PRSV-W (Fig. 3-3).

The size heterogeneity between ZYMV-MD, ZYMV-FL/AT, and

ZYMV-SV seen in SDS-PAGE using 10% acrylamide gels with

antisera to the P1 of ZYMV-FL/AT as a probe, was further

examined by subjecting them to SDS-PAGE in 8% and 15%

acrylamide gels (Fig. 3-4). These size differences were

also noted in the 8% and 15% gels, providing evidence that

the heterogeneity seen is due to true mw differences between

P1 proteins and not solely due to charge differences

(Hedrick and Smith, 1968).

The size differences between the P1 proteins of ZYMV-

FL/AT, ZYMV-MD, and ZYMV-SV were consistent regardless of

the host used for western blot assays. These three isolates

were tested in pumpkin, watermelon, cantaloupe, and squash

(Fig. 3-5).

Of the ZYMV isolates tested in this study, ZYMV-RU

reacted weakly or not at all with the antiserum to the P1 of

ZYMV-FL/AT. This isolate did react with antisera to the CP

and CI of ZYMV and to the AI of PRSV-W (Fig. 3-6). Extracts

from pumpkin singly infected with any of several other
































in .In.. I cc '
.S =







S97
EI



O0r4 >-U ir if f i



a

ID .tn e I La .*?


.:c .t y...O I


a0 O


Awr.


*- a





4-


Fig. 3-2. Characterization of the reactions of the Pl-
related proteins of 22 isolates of zucchini yellow mosaic
virus (ZYMV) in western blots. Blots were probed with
antiserum no. 1181 (collection date 3-17-92) to the P1
protein of ZYMV-FL/AT.


"!* ,







72

Table 3-2. Evidence for antigenic and size variation of P1-
related proteins among ZYMV isolates in western blots using
antiserum to ZYMV-FL/AT (1181) and ZYMV-RU (1186).
Approximate Reaction Reaction
TnnlatP molecular weight pattern(1181) pattern(1186)
FC-2000 35 a 35 35

FC-2050 35 35 35

FC-2154 34 34,26 34
b
ZYMV-RU 33(+/-) 33(+/-) 33

Italy 33 33 33(+/-)

ZYMV-FL/AT 34 34,26 -

ZYMV-FL/GH 34 34,26

ZYMV-SV 33.5 33.5

ZYMV-MD 35 35 35

81-25 34 34 34

3182 34 88,34,26 88,34

HAT 34 34 34

NAT 34 34 34

Egypt 33 33

Connecticut 33 33

Taiwan 33 33 33

PAT 35 35,27 35

weak 35 88,35,27 35

E15 35 88,35,27 35

FC-3179 34 34,26 34

FC-3180 34 34,26 34

FC-3181 34 34
a molecular weights are in kDa.
b (+/-)=extremely weak reactions; not detectable
in every test.
c = no detectable reaction.
















































Fig. 3-3. Western blots of extracts from plants singly
infected with selected ZYMV isolates. Blots were probed
with antisera to P1 of ZYMV-FL/AT (PI) and to the AI of
PRSV-W (AI). Arrow indicates the position of the 88-kDa
protein of isolate FC-3182 which reacts with both P1 and AI
antisera.























JJ i l l
S~~h 02!P" -

A B N M M Q


15%

34?
;i? i '
jj i l l

JJ


-200


-97
-68


-43
^^ *....* W ^^ 4.


-29


Fig. 3-4. Western blots showing 8% and 15% SDS-PAGE gel
concentrations. Antiserum used to probe blots was to the P1
of ZYMFV-FL/AT. The size differences among the isolates
shown were consistent regardless of the gel concentration.
Pl=protein expressed from E. coli. mw=molecular weight
markers.


-43

-29


-18



















pumpkin


squash


cantaloupe watermelon


EI I I E I a g g





*-97
*i ....
43, 8

-43


" .O


m ...... q*0


- 29


Fig. 3-5. Detection of the P1 protein in western blots of
extracts from plants of four cucurbit cultivars singly
infected with three isolates of zucchini yellow mosaic
virus. The hosts were pumpkin (Cucurbita pepo 'Small
Sugar'), squash (C. peDo 'Early Prolific Straightneck'),
cantaloupe (Cucumis melo 'Hale's Best Jumbo'), and
watermelon (Citrullus lanatus 'Crimson Sweet'). Antiserum
no. 1181 (collection date 3-17-92) to P1 of ZYMV-FL/AT was
used as the probe.


WWI















a a



8 .1^ '.... '*l l ii


Fig. 3-6. Western blots of extracts from pumpkin singly
infected with selected ZYMV isolates using antiserum to P1
of ZYMV-FL/AT, CI, and CP of ZYMV-FL/AT, and to the AI of
PRSV-W as probes. The ZYMV-RU isolate reacted weakly or not
at all with antiserum to the P1 of ZYMV-FL/AT, but reacts
with other antisera. P1, membrane probed with antiserum to
the P1 protein of ZYMV-FL/AT. AI, membrane probed with
antiserum to the AI of PRSV-W. CI, membrane probed with
antiserum to the CI of ZYMV-FL/AT. CP, membrane probed with
antiserum to the CP of ZYMV-FL/AT. Arrangement of isolates
is the same for all four membranes. Arrows indicate
position of respective proteins in each membrane.










viruses that infect cucurbits but are distinct from ZYMV

were also tested in western blots. These included PRSV-W,

WMV-2, an named potyvirus (FC-2932) which is

antigenically different from ZYMV, PRSV-W, and WMV-2

(Purcifull et al., 1991), cucumber mosaic virus (CMV), and a

possible potexvirus of cucurbits (FC-1860, Purcifull et al.,

1988). All of these extracts were negative in western blot

tests when tested against antiserum to the P1 of ZYMV-FL/AT

(Fig. 3-7). Antiserum to the P1 protein of ZYMV-RU was also

negative when tested against PRSV-W, WMV-2, FC-1860, and FC-

2932 (data not shown). This antiserum showed differential

reactivity to several ZYMV isolates (Table 3-2, Fig. 3-8).

For those isolates which reacted with antisera to both ZYMV-

FL/AT P1 and ZYMV-RU P1, the approximate mw estimates for

those isolates were the same.

Immunoprecipitation Analysis of In Vitro Translation

Products

Translation products obtained in the WG in vitro

translation system were immunoprecipitated with antisera to

the P1 and CP of ZYMV-FL/AT, to the Al of PRSV-W and with

preimmune serum. Since the WG translation system does not

yield large products, analysis of SDS-PAGE showed only the

P1 and Al present in total translation products (Fig. 3-9).

The antisera to P1 and AI precipitated products of the

appropriate mw for each, ca. 34-kDa and 52-kDa,

























200

97
68

43



29



18





Fig. 3-7. Specificity of antiserum (no. 1181, collection
date 3-17-92) to P1 of ZYMV-FL/AT in western blots.
Extracts from samples infected with ZYMV-FL/AT show a
prominent band at ca. 34-kDa and a weak band at ca. 26-kDa.
Note lack of reactivity with extracts from pumpkin singly
infected with any of three potyviruses (PRSV-W, WMV-2,
2932), a cucumovirus (CMV), a possible potexvirus (FC-1860,
potex), or from noninoculated pumpkin leaves (HSSP/healthy).















































Fig. 3-8. Reactivity of 22 zucchini yellow mosaic virus
(ZYMV) isolates in western blots using antiserum to the P1
of ZYMV-RU as a probe. Blots were probed with antiserum no.
1186 (collection date 6-10-92).



















at H I H tI oQ

200
97
68
<52
43 34

29



18
14




Fig. 3-9. Immunoprecipitation of wheat germ in vitro
translation products. TP=total products, Pl=products
immunoprecipitated with ZYMV-FL/AT P1 antiserum, AI=products
immunoprecipitated with antiserum to the AI of PRSV-W,
CP=products immunoprecipitated with antiserum to the CP of
ZYMV-FL/AT, and NS=products immunoprecipitated with
preimmune serum. mw=molecular weights are from top to
bottom: 200-, 97-, 68-, 43-, 29-, 18-, 14-kDa.










respectively. Neither the CP nor preimmune serum

precipitated a protein product. Interestingly, the P1

antiserum precipitated a smaller product, ca. 25-kDa, which

may be similar to the possible breakdown product usually

seen in immunoblots for that isolate.

Detection of P1 Protein by Indirect Immunofluorescence

Fluorescence microscopy of rhodamine-conjugated protein

A labeled antiserum to the P1 protein showed the presence of

aggregates in the cytoplasm of epidermal strips from ZYMV-

infected watermelon. Isolate ZYMV-FL/AT showed accumulation

of amorphous aggregates with particulate fluorescing bodies

in cells of epidermal tissues (Fig. 3-10) when treated with

antiserum to the P1 of ZYMV-FL/AT. Similar results were

seen with isolates ZYMV-SV and FC-3182. It is possible,

judging from the location of the fluorescing material, that

these bodies might be associated with the CI protein

inclusions. Further studies using electron microscopy of

ultrathin sections will be needed to ascertain this.

Epidermal strips of ZYMV-FL/AT, ZYMV-SV and FC-3182 showed

no fluorescence with preimmune serum as a probe (Fig. 3-11;

Table 3-3), and the aggregates could be seen unstained in

epidermal tissue. Likewise, tissues of watermelon infected

with ZYMV-RU and healthy watermelon (mock-inoculated) were

negative for fluorescence with both antiserum to the P1 of

ZYMV-FL/AT and preimmune sera. As with the ZYMV-FL/AT,

ZYMV-SV, and FC-3182, aggregates of P1 like those seen in










fluorescence tests could be seen in ZYMV-RU infected

tissues, although the aggregates did not fluoresce (Fig. 3-

12). Mock-inoculated watermelon tissues showed no

fluorescence when stained with either immune (Fig. 3-13) or

preimmune serum.

Tissues of ZYMV-FL/AT, ZYMV-SV, ZYMV-RU, FC-3182, and

mock-inoculated watermelon were also tested in

immunofluorescence studies using antiserum to the P1 of

ZYMV-RU. Only watermelon tissue infected with ZYMV-RU or

FC-3182 showed the particulate fluorescing aggregates,

whereas ZYMV-FL/AT, -SV, and mock-inoculated tissues showed

no fluorescing aggregates (Table 3-3). Although aggregates

were seen in ZYMV-FL/AT and in ZYMV-SV infected tissues,

they did not fluoresce.

Serological Studies of Synthetic Peptides to P1 and P3 of

ZYMV

Antisera to the N-terminal 12 amino acids of P1 and P3

were used in SDS-immunodiffusion, ELISA, dot-immunoblots,

and immunoblotting assays. None of the antisera, whether to

the conjugated peptide or to the free peptide, reacted with

any detectable protein product from ZYMV-infected plant

tissues.




























A


















B

Fig. 3-10. Localization of P1 in epidermal tissue from
stems of watermelon infected with ZYMV-FL/AT. Antiserum to
the P1 of ZYMV-FL/AT (rabbit no. 1181, collection date 3-17-
92)was used as the detecting antibody, and tissues were
stained with Rhodamine-protein A and photographed with
epifluorescence optics. Note the specific fluorescence of
granular aggregates. Magnification =1,714 X. A, tissue
photographed with epifluorescence optics; B, same field of
view photographed with visible light.





























A




















Fig. 3-11. Epidermal strips of watermelon tissue infected
with ZYMV-FL/AT treated with preimmune serum, stained with
Rhodamine protein A. Magnification =1714 X. A, tissue
photographed with epifluorescence optics; B, same field of
view photographed with visible light.





























A




















Fig. 3-12. Aggregates of P1 protein in watermelon stem
epidermal tissue infected with ZYMV-RU treated with
antiserum to the P1 of ZYMV-FL/AT (1181, collection date 3-
17-92), stained with Rhodamine-protein A. Note granular
aggregates are clearly visible, but do not fluoresce.
Magnification =1714 X. A, tissue photographed with
epifluorescence optics; B, same field of view photographed
with visible light.











































Fig. 3-13. Epidermal strips from mock-inoculated watermelon
tissue treated with antiserum to the P1 of ZYMV-FL/AT (1181)
and stained with Rhodamine-protein A. Note absence of
fluorescent granular bodies. Magnification =1714 X.















Table 3-3. Summary of reactions of antisera to the P1
of ZYMV-FL/AT and ZYMV-RU in immunofluorescence tests.


Reactivity a


b Antiserum to
Isolate P1 of ZYMV-FL/AT


Antiserum to preimmune
P1 of ZYMV-RU serum


ZYMV-FL/AT

ZYMV-SV

ZYMV-RU

FC-3182


Mock


a
Reactivity determined as positive (+) by the
presence of yellow, fluorescent aggregates in plant
cells. Lack of reactivity (-) determined by absence
of fluorescent aggregates.
b
The isolates indicated were inoculated to watermelon
plants.
Mock=mock-inoculated control plants.












Discussion


As was demonstrated in Chapter 2 for five ZYMV

isolates, variability exists in the P1 nt and deduced amino

acid sequences. Results from serological assays in

immunoblots are in agreement with the sequence data. For

example, the larger size seen in the nt and amino acid

sequence of ZYMV-MD is reflected in the larger size of the

P1 protein observed in western blots. The slightly smaller

size of the P1 from ZYMV-SV in western blots was also

reflected in a slightly smaller size of its respective gene

in PCR analysis. The amino acids differences, reflecting

different charges and polarities, may also influence the

migration of P1 in SDS-PAGE.

Among the ZYMV isolates in this study, heterogeneity in

the size of P1 was seen, as well as the presence of

degradation products and differences in the capacity to

fully process the cleavage site between P1 and HC/Pro. The

size differences seen between ZYMV-FL/AT, ZYMV-SV, and ZYMV-

MD P1 proteins were consistent regardless of the percent

acrylamide, or of the plant host infected. The low nt (60%)

and amino acid (70%) sequence homology between P1 of ZYMV-RU

and ZYMV-FL/AT is reflected in the weak reactivity of the

ZYMV-RU isolate in western blots when tested against

antiserum to the P1 of ZYMV-FL/AT.









The P1 antiserum produced to ZYMV-FL/AT was specific

for ZYMV. It neither reacted with extracts from plants

infected singly with any of several other viruses that

infect cucurbits, nor with extracts from noninfected

cucurbit tissues. The ZYMV-FL/AT P1 antiserum precipitated

a product of the predicted mw (ca. 34kDa) for P1 from WG

translation products, with a smaller product of ca. 25-kDa.

The small product may correspond to a similar sized product

from infected tissue extracts seen in western blots.

Antiserum to P3 of ZYMV-FL/AT was not produced due to

the toxicity of P3 to E. coli which precluded its production

in vitro. Toxicity of P3 in E. coli has been reported with

two other potyviruses (V. Doljas, E. Rodriguez-Cerezo,

personal comm.). It was indicated by Rodriguez-Cerezo and

Shaw (1991) that two regions on the P3 protein of TVMV were

possible membrane spanning regions. These regions may

somehow be involved in the toxicity of P3 to E. coli.

Antiserum to the P1 of ZYMV-FL/AT distinguished

differences among ZYMV isolates. These differences were

reflected in size variation in the P1 protein, possible

breakdown products for some isolates, and incompletely

processed polyprotein. Antiserum to the P1 of ZYMV-RU also

showed differences in the size variation of the Pl protein

like that seen with antiserum to the P1 of ZYMV-FL/AT.

Antiserum to the P1 of ZYMV-RU also detected antigenic

differences in western blots by lack of reactivity with some




Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E5KEUML5V_LPNHF2 INGEST_TIME 2017-07-12T21:06:01Z PACKAGE AA00003286_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES



CHARACTERIZATION OF THE PI PROTEIN
OF THE ZUCCHINI YELLOW MOSAIC POTYVIRUS
By
GAIL C. WISLER
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA

ACKNOWLEDGEMENTS
The most important aspect of a graduate student's
career is his or her major professor and advisory committee.
In this respect I have been extremely fortunate to have Dr.
D.E. Purcifull as my major professor and Dr. E. Hiebert as
my co-advisor. They have shared completely their expertise
and enthusiasm for my work, and have been supportive
throughout my project.
Dr. F.W. Zettler was my major professor for my master's
degree, and has continued to be an excellent source of
advice and moral support, and a fine friend as always. Dr.
S. E. Webb, Dr. S. G. Zam, and Dr. J.R. Edwardson have also
been extremely helpful and enthusiastic, and I am grateful
to have had the opportunity to interact with and learn from
them.
The excellent technical assistance and comradery
offered by Eugene Crawford, Kristin Beckham, Gary Marlow,
Carlye Baker, and Maureen Petersen have made my work more
productive and certainly more enjoyable. I greatly admire
their skills and will not forget their kindness.
I am especially thankful to have had the support of my
husband, H. William Brown, who helped me through the
difficult times and made the good times even better. I am
11

also fortunate to have had the advice and encouragement that
my mother, Caryl M. Wisler has always given me. My father,
Gerry Wisler was always supportive, and encouraged me in all
my endeavors.
Earning this degree has been an excellent learning
experience for me, and this, plus the relationships I have
developed while a student here at the University of Florida,
have made it all very worthwhile.
in

TABLE OF CONTENTS
ACKNOWLEDGEMENTS ii
LIST OF TABLES V
LIST OF FIGURES vi
KEY TO ABBREVIATIONS viii
ABSTRACT X
CHAPTER 1 INTRODUCTION 1
CHAPTER 2 CLONING AND SEQUENCING OF A FLORIDA ISOLATE
OF ZUCCHINI YELLOW MOSAIC VIRUS
Introduction 11
Materials and Methods 12
Results 20
Discussion 51
CHAPTER 3 SEROLOGICAL CHARACTERIZATION OF THE PI
PROTEIN OF ZUCCHINI YELLOW MOSAIC VIRUS
FROM FLORIDA
Introduction 55
Materials and Methods 56
Results 66
Discussion 88
CHAPTER 4 SUMMARY AND CONCLUSIONS 91
APPENDIX: MONOCLONAL ANTIBODIES TO THE CAPSID PROTEIN
OF ZUCCHINI YELLOW MOSAIC VIRUS 97
REFERENCE LIST 117
BIOGRAPHICAL SKETCH 129
IV

LIST OF TABLES
Table
Page
2-1 ZYMV-FL/AT cDNA clones identified by immuno-
screening in Aqtll 22
2-2 ZYMV-FL/AT cDNA clones identified by immuno-
screening in ^ZAPII 23
2-3 Percentage of nucleotide and amino acid sequence
homologies of four ZYMV isolates and five distantly
related potyviruses with respect to ZYMV-FL/AT 49
3-1 List of zucchini yellow mosaic virus isolates used
for serological studies of the PI protein 57
3-2 Evidence for variation in molecular weight and
reactivity of Pl-related proteins of ZYMV isolates
in western blots 72
3-3 Summary of reactions of antisera to the PI of
ZYMV-FL/AT and ZYMV-RU in immunofluorescence tests.87
v

LIST OF FIGURES
Figure Page
2-1 Map of selected cDNA clones from Áqt.11 and
/ÍZAPII which represent the genome of
ZYMV-FL/AT 24
2-2 Sequencing strategy used for the cDNA clones
representing P1-, HC/Pro(AI)-, and P3-
encoding regions 2 5
2-3 Nucleotide and deduced amino acid sequence of
ZYMV-FL/AT 28
2-4 Hydrophobicity of PI of ZYMV-FL/AT plotted
according to Kyte and Doolittle (1982) 37
2-5 Map of acidic and basic residues of the PI
protein of ZYMV-FL/AT 38
2-6 Hydrophobicity plot of the P3 sequence of
ZYMV-FL/AT 3 9
2-7 Map of the acidic and basic residues of the
P3 protein of ZYMV-FL/AT 40
2-8 PCR products of PI from ZYMV-MD and ZYMV-SV
using primers specific to the PI coding
region 42
2-9 Nucleotide sequence alignments of the PI
coding regions from ZYMV-FL/AT with that of
ZYMV-CA, -SV, -MD, and -RU 44
2-10 Amino acid sequence alignment of the PI
proteins of five ZYMV isolates: ZYMV-FL/AT,
-MD, -RU -SV, and -CA 47
3-1 Expression of PI protein of ZYMV-FL/AT cloned
into the pETh plasmid 67
3-2 Characterization of the reactions of the Pl-
related proteins of 22 isolates of zucchini
yellow mosaic virus (ZYMV) in western blots...71
vi

3-3 Western blots of extracts from plants singly
infected with selected ZYMV isolates 73
3-4 Western blots showing 8% and 15% SDS-PAGE gel
concentrations 74
3-5 Detection of the PI protein in extracts from
plants of four cucurbit cultivars singly
infected with three isolates of zucchini
yellow mosaic virus 75
3-6 Western blots of extracts from pumpkin singly
infected with selected ZYMV isolates using
antisera to PI, Cl, and CP of ZYMV-FL/AT,
and to the AI of PRSV-W as probes 7 6
3-7 Specificity of antiserum to PI of ZYMV-FL/AT
in western blots 78
3-8 Reactivity of 22 zucchini yellow mosaic virus
isolates in western blots using antiserum to
the PI of ZYMV-RU as a probe 79
3-9 Immunoprecipitation of wheat germ in vitro
translation products 80
3-10 Localization of PI in epidermal tissue in
stems of watermelon infected with ZYMV-FL/AT..83
3-11 Epidermal strips of watermelon tissue infected
with ZYMV-FL/AT treated with preimmune serum,
stained with Rhodamine-protein A, and
photographed with epifluorescence 84
3-12 Aggregates of PI protein in watermelon tissue
infected with ZYMV-RU treated with antiserum
to the PI of ZYMV-FL/AT (1181), stained with
Rhodamine-protein A, and photographed with
epif luorescence optics 85
3-13 Epidermal strips from mock-inoculated
watermelon tissue treated with antiserum to
the PI of ZYMV-FL/AT (1181) and stained with
Rhodamine-protein A 86
vii

KEY TO ABBREVIATIONS
AI
bp
CP
C-terminus
cDNA
CMV
Cl
MCi
dpm
DIECA
ELISA
ES buffer
HC/Pro
kDa
LB
LDS
mw
N-terminus
NIa
Nib
nm
nt
oligo dT
PI
P3
PCR
PPV
PSbMV
PVYn
RT
SDS-PAGE
amorphous inclusion
base pairs
capsid protein
carboxy-terminus
complementary DNA
cucumber mosaic virus
cylindrical inclusion
microCurie
disintegrations per minute
diethyldithiocarbamate
enzyme-linked immunosorbent assay
extraction buffer
helper component/protease
kilodalton
Luria broth
Laemmli dissociating solution
molecular weight
amino-terminus
nuclear inclusion a
nuclear inclusion b
nanometer
nucleotide
oligonucleotide deoxy-thymidine
PI protein
P3 protein
polymerase chain reaction
plum pox virus
pea seed-borne mosaic virus
necrotic strain of potato virus Y
room temperature
sodium dodecyl sulfate polyacrylamide
gel electrophoresis
TEV
TVMV
VPg
WG
ZYFV
ZYMV-FL/AT
tobacco etch virus
tobacco vein mottling virus
genome-linked viral protein
wheat germ
zucchini yellow fleck virus
aphid-transmissible isolate of zucchini
yellow mosaic virus from Florida
ZYMV-CA
ZYMV-MD
ZYMV isolate from California
mild isolate of ZYMV from Florida
vm

tSJ ISJ
K K
MV-RU
MV-SV
ZYMV isolate from Reunion Island
severe isolate of ZYMV from Florida
IX

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
CHARACTERIZATION OF THE PI PROTEIN OF THE
ZUCCHINI YELLOW MOSAIC POTYVIRUS
By
Gail Clara Wisler
August, 1992
Chairperson: Dan E. Purcifull
Major Department: Plant Pathology
The nucleotide sequence of the 5'-terminal PI coding
region of an aphid transmissible isolate of zucchini yellow
mosaic virus (ZYMV-FL/AT) was compared to the PI coding
region of four other ZYMV isolates. Mild (ZYMV-MD) and
severe (ZYMV-SV) isolates from Florida and an isolate from
California (ZYMV-CA) had 95-98% homologies to ZYMV-FL/AT,
whereas the PI coding region of ZYMV from Reunion Island
(ZYMV-RU) had 60% homology to ZYMV-FL/AT. The ZYMV-MD had
an 18 nucleotide insert following the start codon of the PI
coding region. The PI proteins of all ZYMV isolates shared
conserved amino acids in areas of the C-terminus that have
been reported to be conserved in other potyviruses.
The PI protein from ZYMV-FL/AT was expressed in
Escherichia coli and used for polyclonal antiserum
production. This antiserum reacted in western blots with
x

extracts of pumpkin (Cucúrbita pepo L.) singly infected with
22 ZYMV isolates but did not react with extracts from
noninfected plants or from plants infected with three other
potyviruses, a potexvirus, a cucumovirus. The PI proteins
of ZYMV isolates ranged from 33- to 35-kDa. The PI protein
of ZYMV-MD, which contained a six amino acid insert, was
larger (ca. 35-kDa) than the PI of ZYMV-FL/AT. Possible
protein breakdown products (26-27-kDa) were noted for some
isolates. Three isolates showed an 88-kDa product; one was
tested and it reacted with antiserum to amorphous inclusion
protein (AI), indicating incomplete processing between the
PI and AI cleavage site. Antiserum made to the PI of ZYMV-
RU gave similar results in western blots with respect to
size heterogeneity of the PI protein among ZYMV isolates,
but it only reacted with 16 of 22 ZYMV isolates tested.
Indirect immunofluorescence tests with antisera to the
PI proteins of ZYMV-FL/AT and ZYMV-RU indicated that the PI
protein aggregates in ZYMV-infected tissues.
The PI coding region is more variable than other
regions of the genome among ZYMV isolates that have been
studied. The occurrence of breakdown products, incomplete
processing between PI and AI, and different sizes of PI
proteins with certain isolates are likely due to sequence
differences in the respective PI proteins. Antisera to the
PI proteins have potential as serological probes for
identifying ZYMV and distinguishing among ZYMV isolates.
xi

CHAPTER 1
INTRODUCTION
The Potyviridae is the largest group of plant
viruses, consisting of at least 180 members, most of which
are aphid transmitted (Barnett, 1991). Collectively,
potyviruses infect a wide range of agriculturally important
crops, causing severe yield losses (Hollings and Brunt,
1981; Matthews, 1982). The potyviral genome is a message-
sense, single stranded RNA molecule, consisting of about
10,000 nucleotides (nt). A characteristic feature of all
potyviruses is the production of proteinaceous cylindrical
inclusions (Cl) in the cytoplasm of infected plants
(Edwardson, 1974; Edwardson and Christie, 1991). The
potyviral genome consists of a single open reading frame
(ORF) which is translated into a polyprotein of about 3.5 X
105 kilodaltons (kDa) which is subseguently cleaved into at
least eight individual proteins by viral-encoded proteases
(de Mejia et al., 1985b; Carrington et al., 1989a; Dougherty
and Carrington, 1988; Allison et al., 1986; Garcia et al,
1989; Verchot et al., 1991). Six of these proteins have
been characterized, but little is known about two proteins
referred to as PI and P3, which are the first and third
proteins encoded from the 5'-terminus of the genome. The PI
1

2
and P3 proteins flank the helper component/protease
(HC/Pro), or amorphous inclusion (AI), region.
Because of the large number of potyviruses and the
close relationships among many members, identification and
distinction among potyviruses have received a considerable
amount of attention. Properties of the capsid protein (CP)
and the nucleotide (nt) sequence of the CP-encoding region
have received the most attention as criteria for
classification, with nt sequences of 20 distinct potyviruses
and 42 strains having been determined (Ward and Shukla,
1991). This attention can be attributed to the gene
encoding the CP being the first gene to be transcribed from
the 3'-end of the genome by reverse transcriptase using
oligo dT primers (Quemada et al., 1990; Gal-On et al.,
1990), and because the CP can be extracted from virions
which are easily purified from virus infected plant tissue.
The CP functions to protect the viral RNA by encapsidation
and it also is involved in aphid transmission (Gal-On et
al., 1990; Lecoq and Purcifull, 1992). Sequence analyses
have shown that a change in the amino acid triplet Asp-Ala-
Gly (DAG) in the amino-terminus (N-terminus) of the CP
alters aphid transmissibility (Atreya et al., 1990; 1991;
Harrison and Robinson, 1988; Gal-On et al., 1990; Salomon
and Raccah, 1990). The CP of two potyviruses, papaya
ringspot virus type P (papaya) and soybean mosaic virus,
have also been used in plant transformations to protect

3
against super-infection by strains of the same virus and by
other potyviruses (Ling et al., 1991; Stark and Beachy,
1989) .
The two nuclear inclusion proteins, NIa (49-kda) and
Nib (54 to 58-kDa) aggregate in equimolar amounts in some
potyviral infections, are localized in the nucleus of
infected plants, and contain nuclear targeting signals
(Restrepo et al., 1990). The carboxy-terminal (C-terminal)
portion of the NIa is a protease responsible for processing
in cis and in trans at a minimum of six sites on the
polyprotein (Carrington and Dougherty, 1987a, 1987b, 1988;
Carrington et al., 1988; Chang et al., 1988; Dougherty and
Parks, 1989, 1991; Dougherty et al., 1988, 1989; Garcia et
al., 1989; Hellmann et al., 1988; Martin et al., 1990;
Riechmann et al., 1992). The NIa resembles the proteases of
como-, nepo-, and picornaviruses (Domier et al., 1987;
Goldbach and Wellinck, 1988) , and is related to the trypsin¬
like family of serine proteases (Bazan and Fletterick,
1988). The N-terminal portion of the NIa is now known to be
the genome-linked viral protein (VPg) attached to the 5'-
terminus of the viral RNA (Siaw et al., 1985; Hari, 1981;
Shahabuddin et al., 1988; Murphy et al., 1990).
The large nuclear inclusion protein, Nib, is the most
highly conserved of the potyviral genes among those which
have been sequenced (Ward and Shukla, 1991), and has high
sequence similarity with RNA-dependent-RNA-polymerases

4
encoded by plus-sense RNA viruses (Domier et al., 1987;
Bruenn, 1991).
The Cl are produced by all members of the Potyviridae
examined so far (Edwardson and Christie, 1991). They are
found free in the cytoplasm (Baunoch et al., 1988), in
association with the endoplasmic reticulum (Langenberg,
1986), and attached to cell membranes and plasmodesmata.
Langenberg has suggested a possible involvement of Cl in
cell-to-cell movement of viruses because of the association
of Cl with virus particles and plasmodesmata (Langenberg and
Purcifull, 1989; Langenberg et al., 1989). Recently, the Cl
have been shown to have helicase activity and to possess
nucleoside triphosphate (NTP)-binding activity (Lain et al.,
1988, 1989, 1990, 1991; Robaglia, et al., 1989; Riechmann et
al., 1992).
The coding region between the Cl and HC/Pro, designated
as P3, exhibits a low seguence similarity among those
potyviruses which have been seguenced. The 42-kDa P3
protein of tobacco vein mottling virus (TVMV) has been
expressed in E. coli and antiserum has been prepared to it
(Rodriguez-Cerezo and Shaw, 1991). In western blots, this
antiserum reacted with a 42-kDa and a 37-kDa protein in
infected plants indicating that there may be an alternate
processing site between P3 and Cl. Although it has been
suggested that there is limited sequence homology between P3
and the 2A protease of picornaviruses (Domier et al., 1987;

5
Dougherty and Carrington, 1988), no protease activity of P3
has been demonstrated (Shukla et al., 1991).
The role of the HC/Pro in aphid transmission has been
well established (Berger and Pirone, 1986; Govier and
Kassanis, 1974; Pirone and Thornbury, 1983; Thornbury et
al., 1985). Immunochemical studies have shown that the
coding region for the amorphous inclusion (Al) is the same
as the HC/Pro (Baunoch et al., 1988; de Mejia et al.,
1985a), but whereas antiserum to the HC/Pro blocks aphid
transmission of potato virus Y and TVMV, antiserum to the Al
does not (Thornbury et al., 1985). It has been suggested
that the inclusion form of this protein may be inactive in
terms of aphid transmission (Dougherty and Carrington,
1988) . The C-terminus of the HC/Pro functions as a
protease, responsible for the cleavage between the HC/Pro
and P3 (Carrington et al., 1989a, 1989b, 1990) at a
conserved gly-gly (G-G) amino acid residue. Identification
of two essential amino acids in the C-terminal half of the
HC/Pro indicate that it is a member of the cysteine-type
family of proteases (Oh and Carrington, 1989). Sequence
comparisons have shown a high homology of the protease of
HC/Pro with that of a dsRNA hypovirulence-associated virus
of the chestnut blight fungus (Choi et al., 1991), and both
proteases autocatalytically cleave between the G-G residues.
The protein encoded by the 5'-terminal region of the
potyviral genome is the most variable of those which have

6
been sequenced (Shukla et al., 1991), and shows the greatest
molecular weight (mw) variation of over 30 potyviruses which
have been studied by in vitro translations (E. Hiebert,
personal comm.; Hiebert and Dougherty, 1988), with a size
range from 32 to 68-kDa. The C-terminus of PI has recently
been identified as a serine-type protease responsible for
the autocatalytic cleavage between PI and HC/Pro (Verchot et
al., 1991). Since this cleavage occurs efficiently in the
wheat germ in vitro translation system, but not in the
rabbit reticulocyte lysate system, it has been suggested
that an alternate cofactor may be required for the
processing event. Rodriguez-Cerezo and Shaw (1991)
expressed PI in E. coli and antiserum was prepared to the
expressed PI protein. A 31-kDa protein was detected in low
levels in infected tissue extracts which had been enriched
for endoplasmic reticulum and mitochondria. Rodriguez-
Cerezo and Shaw are the first to demonstrate the existence
of both PI and P3 in infected plants. Yeh et al. (1992), by
using monoclonal antibodies (MAbs) to a 112-kDa protein
product of papaya ringspot virus-type W (PRSV-W), were able
to detect both 51- and 64-kDa proteins which presumably
correspond to the HC/Pro and the PI proteins, respectively.
Zucchini yellow mosaic virus (ZYMV) is one of several
members of the Potyviridae which cause serious losses of
cucurbitaceous crops worldwide. ZYMV was first detected in
1973 in Italy (Lisa et al., 1981), and has since been

7
identified in the U.S. (Adlerz et al., 1983; Purcifull et
al., 1984; Provvidenti et al., 1984; Nameth et al., 1985),
Israel (Antignus et al., 1989), Turkey (Davis, 1986), Japan
(Suzuki et al., 1988), Australia (Greber et al., 1988),
France (Lecoq et al., 1983), Lebanon (Lesemann et al.,
1983), and Jordan (Al-Musa, 1989).
Both serological and biological variations have been
reported for ZYMV isolates (Lisa and Lecoq, 1984; Lecoq and
Purcifull, 1992; Wang et al., 1988; 1992). Serological
relationships are often complex and ZYMV has been reported
to cross react with watermelon mosaic virus-2 (WMV-2) in
serological studies of the CP (Davis et al., 1984; Huang et
al., 1986; Lisa and Lecoq, 1984; Purcifull et al., 1984;
Somowiyarjo et al., 1989) and Cl protein (Suzuki et al.,
1988). Biological variants range from strains which induce
very mild symptoms to those which induce severe and necrotic
symptoms (Petersen et al., 1991; Lecoq and Purcifull, 1992).
These types of variants have been detected in geographically
distinct regions including France and the U.S. (Lecoq and
Purcifull, 1992). Biological variants have also been
observed which differ in the ability to be aphid transmitted
(Lecoq et al., 1991a; Lecoq and Purcifull, 1992). Some
isolates are aphid transmitted, whereas others are
inefficiently transmissible or not transmitted by aphids.
Zucchini yellow mosaic virus has reportedly been
responsible for severe yield losses in France (Lisa and

8
Lecoq, 1984), Israel (Cohen, 1986), and the U.S. (Blua and
Perring, 1989). Recent studies (Lecoq et al., 1991b: Wang
et al., 1991) report the use of mild isolates of ZYMV for
cross protection against more severe isolates. This means
of control appears promising for ZYMV. Some workers have
reported that ZYMV may be transmitted at a low rate through
seed (Schrijnwerkers et al., 1991; Davis and Mizuki, 1986),
and many isolates are efficiently aphid transmitted.
In addition to ZYMV, several other potyviruses, such as
papaya ringspot virus type-W (PRSV-W), watermelon mosaic
virus-2 (WMV-2), zucchini yellow fleck virus (ZYFV), bean
yellow mosaic virus, Bryonia mottle virus (Lovisolo, 1980),
and Telfairia mosaic virus (Shoyinka et al., 1987) have been
reported to infect cucurbits in the field. As a result, the
possibility for genetic recombination among these cucurbit
potyviruses exists (King, 1987; Morozov et al., 1989).
Consequently, the ability to accurately diagnose and
differentiate isolates is important in breeding programs
designed to control ZYMV through the development and use of
resistant cucurbit cultivars. Differentiation of ZYMV
isolates is also important in cross-protection studies.
Diagnosis and distinction of ZYMV isolates have been
based in part on differential host reactions.
Immunochemical assays involving both polyclonal (PAb) and
monoclonal (MAb) antisera to the CP are useful for diagnosis

9
of ZYMV, but are not completely definitive for distinction
between isolates.
Studies of both structural and nonstructural proteins
of potyviruses have been based on their ease of isolation,
either because they are readily purified, they aggregate in
infected tissue, or, as with the CP, they can be easily
cloned by oligo dT priming. Neither PI nor P3 have been
shown to accumulate or aggregate in infected plants and thus
they have not been well characterized. As an early part of
this study, several MAbs to the CP of ZYMV were evaluated
for their ability to distinguish and diagnose ZYMV isolates,
as described in Appendix 1. The primary focus of this study,
however, was to further characterize the PI and P3 of ZYMV.
To achieve this goal, the objectives of this study included
(1) characterization of the PI and P3 proteins and coding
regions of an aphid-transmissible isolate of ZYMV from
Florida (ZYMV-FL/AT); (2) comparison of the PI and P3
proteins and their coding regions from ZYMV-FL/AT to those
of other ZYMV isolates and other cucurbit potyviruses; (3)
evaluation of antisera to these proteins as serological
probes for studying the variability of ZYMV isolates; and
(4) evaluation of the antigenic relationships of these
proteins among ZYMV isolates and other potyviruses infecting
the Cucurbitaceae. The high sequence variability of PI and
P3 make both of them interesting protein coding regions for
study, and knowledge gained in this research should lead to

10
a better understanding of the roles of PI and P3 in the
viral infection process.
This study reports nucleotide sequence variability
among the PI coding region of five ZYMV isolates. Antisera
to the PI proteins of two ZYMV isolates detected size
differences in the PI proteins, incompletely processed PI
products, possible breakdown products, and antigenic
differences among several ZYMV isolates. Nucleotide
sequence information only is presented for the P3 coding
region of ZYMV-FL/AT due to the inability to express this
protein in E. coli as a result of its apparent toxicity.

CHAPTER 2
CLONING AND SEQUENCING OF A FLORIDA ISOLATE
OF ZUCCHINI YELLOW MOSAIC VIRUS
Introduction
It has been hypothesized that potyvirus strains "show
an overall high sequence identity irrespective of the gene
product being considered, while distinct viruses have a
significantly lower degree of identity between gene
products" (Shukla et al., 1991, p.181). The nucleotide (nt)
sequence identities for the CP gene of distinct potyviruses
range approximately from 30 to 60%, while the nucleic acid
sequence identities determined for strains of a potyvirus
are greater than 95% (Ward and Shukla, 1991). These authors
point out that for the four potyviruses that have been
sequenced, the PI coding region of the potyviral genome has
a lower homology than other coding regions, and that this
appears to be the most variable region of the genome. They
also suggest that this variability may indicate a possible
role for PI in specific virus-host interactions.
The major goal in this study was to characterize and
compare the PI and P3 proteins of several ZYMV isolates. A
means of achieving this goal was to produce PI and P3 of
ZYMV-FL/AT in a high level expression system, and produce
11

12
specific antisera to each. The first step in this process
was to clone the ZYMV genome and determine the nt and
deduced amino acid sequence of the region encoding PI
through P3.
Materials and Methods
Virus Isolates
An isolate of ZYMV from Florida (Purcifull et al.,
1984), which has been maintained in a greenhouse by aphid
transmission for the past three years, FC-1119AT, was used
as the type isolate throughout this study, and it will be
referred to as ZYMV-FL/AT. The sequence of PI through P3 of
ZYMV-FL/AT was compared to a ZYMV isolate from California
(ZYMV-CA) which was sequenced by R.Balint (personal comm.),
one from Reunion Island (ZYMV-RU, Baker et al., 1991b), a
severe, necrotic isolate from Florida (FC-2088) designated
as ZYMV—FL/SV, and a mild isolate from Florida (FC-1994)
designated as ZYMV/MD.
Virus Purification and RNA Extraction
The protocol used for virus purification is similar to
that described by Lecoq and Pitrat (1985). ZYMV-infected
Cucúrbita pepo L. 'Small Sugar' tissue was harvested 14 days
post inoculation and homogenized for 10 sec with 3.75
volumes of 0.3 M K2HP04, pH 8.5, with freshly added 0.2%
sodium diethyldithiocarbamate (DIECA) and 0.2% 2-
mercaptoethanol. The resulting slurry was then homogenized
with 2/3 volume of trichlorofluorethane (Freon) for one min.

13
After centrifugation at 5,000 g for 10 min, the aqueous
phase was made 1% with Triton X-100 and was stirred for 20
min at 4 C. Partially purified virus was collected by
ultracentri-fugation at 37,000 rpm in a Beckman Ti70 rotor
for 1.5 hr at 4 C and was resuspended in 0.02 M HEPES, pH
8.2 with a tissue homogenizer. After stirring for one hr at
4 C, the suspension was partially clarified by
centrifugation at 2,500 g for 2 min. The supernatant was
layered onto a Cs2S04 gradient (10 g/27 ml 0.01 M HEPES, pH
8.2) and centrifuged for 16 hr at 32,000 g in a Beckman SW41
rotor at 4 C. The opalescent virus zone 24-27 mm from the
bottom of the tube was collected, diluted with one volume of
0.02 M HEPES, pH 8.2, and was centrifuged at 10,000 g for 10
min. The supernate was made 8% with polyethylene glycol
(PEG) 8000 and was stirred for 20 min at 4 C. A pellet
containing virus was collected by centrifugation at 10,000 g
for 10 min, and resuspended in 0.02 M HEPES, pH 8.2.
Concentrations of the virus preparations were estimated by
spectrophotometry using an approximate extinction
coefficient of A260=2.5 ( 1 mg/ml, 1 cm light path).
Preparations were divided into aliquots and stored at -80 C.
A virus preparation containing approximately 3 mg/ml
was added to an equal volume (1 ml) of RNA dissociating
solution [200 mM Tris-HCl, 2 mM EDTA, 2% sodium dodecyl
sulfate (SDS) , pH 9.0], and six jul of protease K. After a
10 min incubation at room temperature (RT), the preparation

14
was layered onto a linear-log sucrose density gradient
(Brakke and Van Pelt, 1970) and was subjected to
ultracentrifugation at 39,000 rpm for 5 hr at 15 C with a
Beckman SW41 rotor. Gradient zones containing RNA were
collected using an ISCO UV analyzer. The RNA was
precipitated by adding 0.1 volume of 3 M sodium acetate and
2-5 volumes of 100% ethanol (Sambrook et al., 1989).
Pellets were resuspended in 50 y.1 diethyl- pyrocarbonate
(DEPC) treated water and stored at -80 C.
Synthesis of cDNA
The initial cDNA library of the ZYMV RNA was made using
Agtll (Lambda Librarian, Stratagene, LaJolla, CA), which is
based on a modification of a procedure described by Gubler
and Hoffman (1983). Freshly prepared viral RNA was used for
cloning, with 8.3 ¿¿g RNA as the template in the first strand
synthesis reaction. Both random and oligo dT primers were
used in two separate first strand synthesis reactions which
were labeled by the addition of [32P]dCTP. Incorporation of
label was measured in fractions eluted from P-60 columns
(100-200 mesh Bio-Gel P-60; Bio-Rad, Melville, NY). Those
fractions with counts between 2,000 and 30,000
disintegrations per minute (dpm) were combined, and nucleic
acid was precipitated with ethanol. Second strand synthesis
and the ligation of EcoRI/Notl linkers were performed
according to the manufacturer's instructions.

15
Size analysis of cDNA was performed on a 0.9% agarose
gel. The gel was exposed to X-ray film and compared to a 1-
kb ladder molecular weight standard (BRL, Gaithersburg, MD).
A zone corresponding to 800-7,000 base pairs (bp) was cut
from the gel and electroeluted with a Bio-Rad (Melville, NY)
electroeluter according to manufacturer's instructions. The
volume of the eluted cDNA was reduced with water-saturated
n-butanol, followed by an ethanol precipitation. The cDNA
preparations with linkers from both random and oligo dT
priming were combined and they were ligated to EcoRl-
digested, calf intestinal alkaline phosphatase (CIAP)-
treated Aqtll DNA (Protoclone Aqtll System, Promega,
Madison, WI) for three hr at 22 C (Huynh et al., 1984.).
Molar ratios of vector to insert ranged from 1:1 to 1:2 to
1:3. The ligated cDNA was packaged and titered according to
manufacturer's instructions using the Packagene Lambda DNA
Packaging System (Promega, Madison, WI). Packaged phage was
titered on Escherichia coli strain Y1090 grown from a single
colony to an O.D.60Q of 0.6 to 0.8 in Luria broth (LB)
(Sambrook et al., 1989), supplemented with 10 mM MgS04 and
0.2% maltose.
A library made specifically to the 5'-terminus of the
ZYMV genome was constructed using the Lambda ZAP II/EcoRI
Cloning Kit (Stratagene, La Jolla, CA). A primer, with the
sequence of 5'-CGGTGTGTGCGCTAC-3', which corresponded to an
area encoding the cylindrical inclusion (Cl) protein was

16
used in this cloning experiment and was synthesized at the
University of Florida DNA Synthesis Core. The host strain
used for this vector system was E. coli XLl-Blue.
Nucleic Acid Hybridization of ZYMV Clones
Nucleic acid probes prepared from viral RNA were
labeled with [32P]dCTP using either a Nick Translation Kit
(Promega, Madison, WI) or a Random Primed DNA Labeling Kit
(Boehringer Mannheim (Indianapolis, IN) according to
manufacturer's instructions. Nylon Hybond membranes, 0.45 /i
pore size (Amersham, Inc., Arlington Heights, IL) cut to fit
media plates containing plaques, were laid onto the agar
surface for approximately 15 min. Membranes were then
placed onto filter paper pads soaked in three solutions
sequentially for 15 min each: (1) 0.5 M NaOH, 1.5 M NaCl,
(2) 1 M Tris-HCl, pH 7.5, 1.5 M NaCl, and (3) 2X SSC
(Sambrook et al., 1989). They were placed in a UV
Crosslinker for 2 min, after which they were prehybridized
in 10 ml of 1% SDS, 1 M NaCl, 10% PEG 8000, with 5 mg/ml
denatured salmon sperm. Membranes were placed in a heat seal
bag and incubated at 55 C for 15 min with agitation, after
which 100-200 juCi/ml denatured probe was added. This was
followed by an overnight incubation at 55 C. Membranes were
washed twice in 100 ml of 2X SSC for 5 min each at room
temperature (RT), followed by two rinses in 200 ml of 2X SSC
containing 1% SDS at 55 C for 30 min each. A final rinse
was in 100 ml of 0.1X SSC at RT for 30 min. Washed

17
membranes were exposed to X-ray film with an intensifying
screen.
Immunoscreening of ZYMV Clones
Immunoscreening for clones expressing specific regions
of the ZYMV genome was conducted essentially according to
manufacturer's instructions as described in the picoBlue
Immunoscreening Kit (Stratagene) and by Short et al.,
(1988). Recombinant bacteriophage library lysate was added
to 200 ¡JL1 of the appropriate strain of E. coli cells, and
allowed to absorb at 37 C for 15 min. This was added to 3
ml of LB soft agar containing 10 mM MgS04, which was poured
onto LB plates and incubated at 42 C for 3-4 hr until
plaques appeared. A nitrocellulose membrane (NCM) which had
previously been saturated with 10 mM isopropy1-6-D-
thiogalactopyranoside (IPTG) was laid onto each plate. The
IPTG is a gratuitous inducer used to induce the expression
of the B-galactosidase fusion protein. Plates were then
moved to 37 C and allowed to incubate an additional 4-6 hr.
Membranes were removed, rinsed three times for 5 min in a
solution containing 20 mM Tris-HCl, pH 7.5, 150 mM NaCl,
0.05% Tween-20 (TBST), and then incubated in TBST containing
5% Carnation dry milk powder for 15 min to block protein
binding sites. E. coli lysate was prepared as described in
Huynh et al., (1984) and added at 1 mg/ml to the blocking
solution. Antisera to the CP and Cl of ZYMV, to the small
nuclear inclusion protein (NIa) of tobacco etch virus (TEV),

18
the HC/Pro of TVMV, and to the AI of papaya ringspot virus
type-W (PRSV-W) were used for primary antibody screening.
The virus antisera used in screening were known to cross-
react with corresponding proteins of ZYMV and other
potyviruses. Primary antibody was diluted in the blocking
solution at 1/500 to 1/1000 and incubated overnight at 4 C
with shaking. Each step was followed by three 5 min washes
with TBST. The secondary antibody, alkaline phosphatase-
conjugated goat anti-rabbit IgG (Sigma Chemical Co., St.
Louis, MO), was added at a dilution of 1/2000 in blocking
solution and was incubated with shaking at RT for 1-2 hr.
After rinsing in TBST, a final rinse was made in development
buffer (0.1 M Tris-HCl, 0.1 M NaCl, pH 9.6.). The color
substrates (Gibco BRL, Gaithersburg, MD), nitroblue
tetrazolium (NBT) (22 nl of a 75 mg/ml solution) and 5-
bromo-4-chloro-3-indolylphosphate (BCIP) (20 ¿¿1 of a 50
mg/ml solution) were added to 20 ml development buffer with
50 fj. 1 of 2M MgCl2. Color development was allowed to proceed
for approximately 30 min before reactions were stopped by
rinsing with deionized water. Positive clones were isolated
with a sterile pipette and placed in a buffer containing 100
mM NaCl, 50 mM Tris, pH 7.5, 10 mM MgS04 (SM buffer) with 5%
chloroform and stored at 4 C. Clones were purified by 2 to
3 rounds of plating and screening.

19
Analysis of ZYMV Clones
Plaque purified clones in Aqtll which were positive in
immunoscreening were raised in a 5 ml culture in the
lysogenic host E. coli Y1089 and were prepared by a mini-
prep procedure. Preparations were digested with EcoRI, run
on an agarose gel, transferred to a nylon membrane using an
agarose gel transfer unit (Millipore MilliBlot-V System,
Bedford, MA), and exposed to a [32P]dCTP labeled ZYMV probe.
Clones in both Aqtll and /)ZAPII were analyzed by
polymerase chain reaction (PCR) using Aqtll forward and
reverse primers. Plaques were placed into 20 ¿¿1 of SM
buffer and frozen at -20 C. Ten ¿il were used as the
template in a BIOS thermocycler with three cycles of 94 C
for 3 min, 45 C for 1 min, and 72 C for 3 min. This was
followed by 35 cycles at 93 C for 1 min, 45 C for 1 min, and
72 C for 3 min. Plasmid clones were analyzed with PCR by
placing individual colonies in 20 ¿¿1 of 20 mM Tris-HCl, pH
8, containing 1% Triton X-100, heating to 95 C for 10 min,
and centrifuging at 10,000 g for 2 min. Ten ¿il of this
template was used in PCR with the appropriate primers.
Subcloninq of Recombinant Bacteriophage
Clones identified in Aqtll were digested as described,
and extracted from an agarose gel using a Prep-A-Gene DNA
Purification Kit (Bio-Rad). Fragments were then subcloned
by ligating into EcoRI digested pGEMEX-1 (Promega) which had
been treated with CIAP (Sambrook et al.,
1989). Plasmid

20
clones (pBluescript SK-) were isolated from <4ZAP II with the
use of the helper phage R408 according to manufacturer's
instructions (Stratagene) . Recombinant plasmid cultures
were prepared for further analysis by the alkaline lysis
miniprep procedure (Sambrook et al., 1989).
Two additional Pl-encoding regions, one from ZYMV-SV
and one from ZYMV-MD, were cloned into the pETh vector
(McCarty et al., 1991) after increase of cDNA by PCR using
primers specific for PI, following procedures similar to
those described by Robertson et al. (1991).
DNA Sequencing of ZYMV Clones
The nucleotide sequences of plasmid preparations and
PCR products were determined using the standard Sanger
dideoxy chain termination method (1977) employed in both US
Biochemical Corp., Cleveland, OH, and Pharmacia LKB,
Piscataway, NJ, sequencing kits. Both 6% and 4% acrylamide
gels with 7 M urea were used. Sequence analysis and
comparisons were made using the University of Wisconsin
Genetics Computer Group Sequence Software (GCG) available at
the University of Florida ICBR Biological Computing
Facility.
Results
Clones Representing the ZYMV Genome
The initial cloning experiment using Agtll yielded an
estimated 73 x 106 clear (positive) plaques, and the yield

21
from /ÍZAPII was estimated to be 14 x 106 clear plaques.
After serological screening with antisera to the CP, NIa,
Cl, AI, and HC/Pro, several clones were selected which were
specific to each of these protein-encoding regions on the
ZYMV genome. In the Agtll cloning experiment, ten clones
were identified by the reactivity of their expressed
products with CP antiserum. Nine of these clones were
specific for the CP and an additional, large clone of 4.5-
kilobase pairs (kbp), was reactive with both CP and NIa
antisera (Table 2-1). Two clones were identified which
represented the Cl, and two which represented the AI coding
region. Preliminary sequencing indicated that the AI-
positive clones were not large enough to include the Pl-
encoding region. Subsequent cloning experiments using
/IZAPII yielded six additional CI-positive clones, seven
additional AI-positive clones, and three clones that were
both Cl- and AI-positive (Table 2-2). Three of the Cl
clones were large enough to code for both the Cl and AI
regions, and their products reacted with antisera to both Cl
and AI proteins. An AI-positive clone of 2.9-kbp was
selected (AI6) which included all of PI, AI, and a portion
(ca. 600-bp) of P3. Clone AI6 also represented 55-bp of the
leader sequence. None of the 30 clones was identified that
represented the entire leader sequence, which, based on the
ZYMV-CA sequence, is approximately 141-bp.

22
Table 2-1. ZYMV-FL/AT cDNA clones identified
by immunoscreening in >.gtll.
Clone
designation
Approximate
size (kbp)
Serologicala
reactivity
CPI 0
CP2 1
CP3 0
CP4 0
CP5 1
CP6 0
CP7 4
CP8 1
CP9 3
CP10 1
CI1 2
CI2 2
All 1
AI2 0
85
CP
40
CP
60
CP
40
CP
75
CP
75
CP
50
CP,NIa
80
CP
30
CP
30
CP
30
Cl
20
Cl
60
AI
90
AI
coding regions listed refer to clones, the
products of which reacted with antisera to
the capsid protein (CP), small nuclear inclusion
protein (NIa), cylindrical inclusion protein
(Cl), or amorphous inclusion protein (AI) in
immunoscreening assays.

23
Table 2-2. ZYMV-FL/AT cDNA
by immunoscreening in AZAPII
clones identified
Clone
Approximate
Serologicala
designation
size (kbp)
reactivity
CI3
1.80
Cl
CI4
3.50
Cl, AI
CI5
3.00
Cl, AI
CI6
2.90
Cl, AI
CI7
2.80
Cl
CI8
2.00
Cl
CI9
1.60
Cl
CI10
1.80
Cl
cm
2.50
Cl
AI3
1.50
AI
AI4
1.60
AI
AI5
1.90
AI
AI6
2.90
AI
AI7
1.50
AI
AI8
3.00
AI
AI9
3.00
AI
coding regions listed refer to clones, the
products of which reacted with antisera to
the cylindrical inclusion protein (Cl), or
amorphous inclusion protein (AI) in immuno-
screening assays.

PI
HC/Pro
(AI) .
P3
Cl VPg NIa
Nib CP
1 |-A(
AI6
2.9-Kbp
CP7
4.5-Kbp
AI8
3.0-Kbp
H
CI1
2.3-Kbp
Fig. 2-1. Map of selected cDNA clones from Xgtll and Á.ZAPII which represent
the genome of ZYMV-FL/AT.

HC/Pro
(AI)
L
PI
â–º
Fig. 2-2. Sequencing strategy used for the cDNA clones representing
P1-, HC/Pro(AI)-, and P3-encoding regions. Arrows indicate the
direction of sequencing and distance read from the beginning of the
clone or from the location of a primer. L=leader sequence.
to
U1

26
Sequences Representing the 5'-terminus of ZYMV
Four clones were selected which together represent the
entire ZYMV-FL/AT genome; AI6 (2.9-kbp), AI8 (3.0-kbp), CI1
(2.3-kbp), and CP7 (4.5-kbp) (Fig. 2-1). Several additional
clones were used to seguence the entire region from PI
through the P3-encoding region (Fig. 2-2).
The sequence of ZYMV-FL/AT, from the 55-bp of the
leader through P3, with the corresponding amino acid
sequence, is presented in Fig. 2-3. Based on consensus
sequences (Oh and Carrington, 1989; Mavankal & Rhoads, 1991;
Thornbury et al., 1990; Verchot et al., 1991), the Pl-
encoding region of ZYMV-FL/AT is 912-bp, the Al is 1,386-bp,
and P3 is 1,191-bp in length. The cleavage site between PI
and Al is at amino acid position 304-305 (tyr/ser), whereas
the site between Al and P3 is at amino acid position 766-767
(gly/gly)/ and between P3 and Cl is at position 1,164-1,165
(glu/gly).
In the Pl-encoding region, the consensus sequence for
the predicted protease at the C-terminus is Gly-Xaa-Ser-Gly-
—Phe-Ile-Val-Arg-Gly (Verchot et al., 1991), Xaa being any
amino acid, whereas that for ZYMV-FL/AT is Gly-Cys-Ser-Gly—
-Leu-Val-Ile-Arg-Gly. In addition, Ser and His were found
at positions 264 and 223, respectively. These amino acids
are strictly conserved among potyviruses. Both the Ser and
His have been shown by point mutations in tobacco etch virus

Fig. 2-3. Nucleotide and deduced amino acid sequence of
ZYMV-FL/AT. Amino acids are represented by a single
letter code. Underlined residues represent sequences
similar to conserved potyviral sequences. Asterisks
indicate amino acids strictly conserved among potyviruses
that have been sequenced. Slash(/) indicates cleavage
sites between proteins.

28
1 60
AACTCTTACAGTATTTAGAAATTCTCCAATCACTTCGTTTACTTCAGACATAACAATGGC
M A
61 120
CTCTATCATGATTGGTTCAATCTCCGTACCCATTGCAAAGACTAAGCAGTGTGCAAACAC
SIMIGSISVPIAKTKQCANT
121 180
TCAAGTAAGTAATCGGGTTAATATAGTGGCACCTGGCCACATGGCAACATGCCCATTGCC
QVSNRVNIVAPGHMATCPLP
181 240
ACTGAAAACGCACATGTATTACAGGCATGAGTCCAAGAAGTTGATGCAATCAAACAAAAG
LKTHMYYRHESKKLMQSNKS
241 300
CATTGACATTCTGAACAATTTCTTCAGCACTGACGAGATGAAGTTTAGGCTCACTCGAAA
IDILNNFFSTDEMKFRLTRN
301 360
CGAGATGAGCAAGGTGAAAAAGGGTCCGAGTGGGAGGATAGTCCTCCGCAAGCCGAGTAA
EMSKVKKGPSGRIVLRKPSK
361 420
GCAGCGGGTTTTCGCTCGTATTGAGCAGGATGAGGCAGCACGCAAGAAAGAGACTGTTTT
QRVF ARIEQDEAARKKETVF
421 480
CCTCGAAGGAAATTATGACGATTCTATCACAAATCTAGCACGTGTTCTTCCACCTGAAGT
LEGNYDDSITNLARVLPPEV
Fig. 2-3—continued.

29
481 540
GACTCACAACGTTGATGTGAGCTTGACGTCATCGTTTTACAAGCGCACATACAAGAAGGA
THNVDVSLTSSFYKRTYKKE
541 600
AAGGAAGAAAGTGGCGCAAAAGCAAATTGTGCAAGCACCACTCAATAGCTTGTGCACACG
RKKVAQKQIVQAPLNSLCTR
601 660
TGTTCTTAAAATTGCACGCAATAAAAATATCCCTGTTGAGATGATTGGCAACAAGAAGGC
VLKIARNKNIPVEMIGNKKA
661 720
GAGACATACACTCACCTTCAAGAGGTTTAGGGGATATTTTGTTGGAAAGGTGTCAGTTGC
RHTLTFKRFRGYFVGKVSVA
721 780
GCATGAAGAAGGACGAATGCGGCGCACTGAGATGTCGTATGAGCAGTTTAAATGGATTCT
*
HEEGRMRRTEMSYEQFKWIL
781 840
AAAAGCCATTTGTCAGGTCACCCATACAGAGCGAATTCGTGAGGAAGATATTAAACCAGG
KAICQVTHTERIREEDIKPG
841 900
TTGTAGTGGGTGGGTGTTGGGCACTAATCATACATTGACTAAAAGATATTCAAGATTGCC
*
C S G WVLGTNHTLTKRY SRLP
Fig. 2-3--continued.

30
901 960
ACATTTGGTGATTCGAGGTAGAGACGACGATGGGATTGTGAACGCGCTGGAACAGGTGTT
H L V I R G RDDDGIVNALEQVL
961 1020
ATTTTATAGCGAAGTTGACCACTATTCGTCGCAACCGGAAGTTCAGTTCTTCCAAGGATG
FY/SEVDHYSSQPEVQFFQGW
1021 1080
GCGACGAATGTTTGACAAGTTTAGGCCCAGCCCAGATCATGTGTGCAAAGTTGACCACAA
RRMFDKFRPSPDHVCKVDHN
1081 1140
CAACGAGGAATGTGGTGAGTTAGCAGCAATCTTTTGTCAGGCTTTATTCCCAGTAGTGAA
*
NEECGELAAI FCQALFPVVK
1141 1200
ACTATCGTGCCAAACATGCAGAGAAAGCTTAGTAGAAGTTAGCTTTCGAGGAATTAAAGA
L S C QTCRESLVEVSFRGIKD
1201 1260
TTCTTTGAACGCAAACTTTATTGTCCACAAGGATGAATGGGGTAGTTTCAAGGAAGGCTA
SLNANFIVHKDEWGSFKEGY
1261 1320
TCAATACGATAATATTTTCAAATTAATCAAAGTGGCAACACAGGCAACTCAGAATCTCAA
QYDNIFKLIKVATQATQNLK
1321 1380
GCTCTCATCTGAAGTTATGAAATTAGTTCAGAACCACACAAGCACTCACATGAAGCAAAT
LSSEVMKLVQNHTSTHMKQI
Fig. 2-3—continued.

31
1381 1440
ACAAGACATCAACAAGGCGCTCATGAAAGGTTCATTGGTTACGCAAGACGAATTGGACTT
QDINKALMKGSLVTQDELDL
1441 1500
AGCTTTGAAACAGCTTCTTGAAATGACTCAGTGGTTTAAGAACCACATGCACCTGACTGG
ALKQLLEMTQWFKNHMHLTG
1501 1560
TGAGGAGGCATTGAAGATGTTCAGAAATAAGCGTTCTAGCAAGGCCATGATAAATCCTAG
EEALKMFRNKRSSKAMI NPS
1561 1620
CCTTCTATGTGACAACCAATTGGACAAAAATGGAAATTTTGTTTGGGGAGAAAGAGGATA
LLCDNQLDKNGNFVWGERGY
1621 1680
CCATTCCAAGCGATTATTCAAGAACTTCTTCGAAGAAGTAATACCAAGCGAAGGATATAC
HSKRLFKNFFEEVIPSEGYT
1681 1740
GAAGTACGTAGTGCGAAACTTTCCAAATGGTACTCGTAAGTTGGCCATAGGCTCGTTGAT
KYVVRNFPNGTRKLAIGSLI
1741 1800
TGTACCACTCAATTTGGATAGGGCACGCACTGCACTACTTGGAGAGAGTATTGAGAAGAA
VPLNLDRARTALLGES I EKK
1801 1860
GCCACTCACATCAGCGTGTGTCTCCCAACAGAATGGAAATTATATACACTCATGCTGCTG
PLTSACVSQQNGNYIHSCCC
Fig. 2-3—continued.

32
1861 1920
TGTAACGATGGATGATGGAACCCCGATGTACTCCGAGCTTAAGAGCCCGACGAAGAGGCA
VTMDDGTPMY SELKSPTKRH
1921 1980
TCTAGTTATAGGAGCTTCTGGTGATCCAAAGTACATTGATCTGCCAGCATCTGAGGCAGA
LVIGASGDPKYIDLPASEAE
1981 2040
ACGCATGTATATAGCAAAGGAAGGTTATTGCTATCTCAATATTTTCCTCGCAATGCTTGT
★
RMYIAKEGYCYLNIFLAMLV
2041 2100
AAATGTTAATGAGAACGAAGCAAAGGATTTCACCAAAATGATTCGTGATGTTTTGATCCC
NVNENEAKDFTKMIRDVLIP
2101 2160
CATGCTTGGGCAGTGGCCTTCATTGATGGATGTTGCAACTGCAGCATATATTCTAGGTGT
MLGQWPSLMDVATAAYILGV
2161 2220
ATTCCATCCTGAAACGCGATGCGCTGAATTACCCAGGATCCTTGTTGACCACGCTACACA
FHPETRCAELPRILVDHATQ
2221 2280
AACCATGCATGTCATTGATTCTTATGGATCACTAACTGTTGGGTATCACGTGCTCAAGGC
•k
TMHVIDSYGSLTVGYHVLKA
Fig. 2-3—continued.

33
2281 2340
CGGAACTGTTAATCATTTAATTCAATTTGCCTCAAATGATCTGCAAAGCGAGATGAAACA
GTVNHLIQFASNDLQSEMKH
2341 2400
TTACAGAGTTGGCGGAACACCAACACAGCGCATTAAACTCGAGGAGCAGCTGATTAAAGG
YRVG/GTPTQRIKLEEQLIKG
2401 2460
AATTTTCAAACCAAAACTTATGATGCAGCTCCTGCATGATGACCCATACATATTATTGCT
IFKPKLMMQLLHDDPYILLL
2461 2520
TGGCATGATCTCACCCACCATTCTTGTACATATGTATAGGATGCGTCATTTTGAGCGGGG
GMI SPTI LVHMYRMRHFERG
2521 2580
TATTGAGATATGGATTAAGAGGGATCATGAAATCGGAAAGATTTTCGTCATATTAGAGCA
IEIWIKRDHEIGKIFVILEQ
2581 2640
GCTCACACGCAAGGTTGCTCTGGCTGAAGTTCTTGTGGATCAACTTAACTTGATAAGTGA
LTRKVALAEVLVDQLNLISE
2641 2700
AGCTTCACCACATTTACTTGAAATTATGAAGGGTTGTCAAGATAATCAGAGGGCATACGT
ASPHLLEIMKGCQDNQRAYV
2701 2760
ACCTGCGCTGGATTTGTTAACGATACAAGTGGAGCGTGAGTTTTCAAATAAAGAACTCAA
PALDLLTIQVEREFSNKELK
Fig. 2-3—continued

34
2761 2820
AACCAATGGTTATCCCGATTTGCAGCAAACGCTCTTCGATATGAGGGAAAAAATGTATGC
TNGYPDLQQTLFDMREKMYA
2821 2880
AAAGCAGCTGCACAATTCATGGCAAGAGCTAAGCTTGCTGGAAAAATCCTGTGTAACCGT
KQLHNSWQELSLLEKSCVTV
2881 2940
GCGATTGAAGCAATTCTCGATTTTTACGGAAAGAAATTTAATCCAGCGAGCAAAAGAAGG
RLKQFSIFTERNLIQRAKEG
2941 3000
AAAGCGCGCATCTTCGCTACAATTTGTTCACGAGTGTTTTATCACGACCCGAGTACATGC
KRASSLQFVHECFITTRVHA
3001 3060
GAAGAGCATTCGCGATGCAGGCGTGCGCAAACTAAATGAGGCTCTCGTCGGAATTTGTAA
KSIRDAGVRKLNEALVGICK
3061 3120
ATTCTTTTTCTCTTGTGGTTTCAAAATTTTTGCACGATGCTATAGCGACATAATATACCT
FFFSCGFKIFARCYSDI IYL
3121 3180
TGTGAACGTGTGTTTGGTTTTCTCCTTGCTGCTACAAATGTCCAATACTGTGCGCAGTAT
VNVCLVFSLLLQMSNTVRSM
3181 3240
GATAGCAGCGACAAGGGAAGAAAAAGAGAGAGCGATGGCAAATAAAGCTGATGAAAATGA
IAATREEKERAMANKADENE
Fig. 2-3—continued.

35
3241 3300
AAGGACGTTAATGCATATGTACCACATTTTCAGCAAGAAACAGGATGATGCGCCCATATA
RTLMHMYHIFSKKQDDAPIY
3301 3360
CAATGACTTTCTTGAACATGTGCGTAATGTGAGACCAGATCTTGAGGAAACTCTCTTGTA
NDFLEHVRNVRPDLEETLLY
3361 3420
CATGGCTGGCGTAGAAGTTGTTTCAACACAGGCTAAGTCAGCGGTTCAGATTCAATTCGA
MAGVEVVSTQAKSAVQIQFE
3421 3480
GAAAATTATAGCTGTGTTGGCGCTGCTTACCATGTGCTTTGACGCCGAAAGAAGCGATGC
K I IAVLALLTMCFDAERSDA
3481 3540
CATTTTCAAGATTTTGACAAAACTCAAAACAGTTTTTGGTACGGTTGGAGAAACGGTCCG
I FKILTKLKTVFGTVGETVR
3541 3547
ACTTCAA
L Q /
Fig. 2-3—continued.

36
(TEV, Verchot et al., 1991) to be important for proteolytic
processing between PI and AI proteins.
In the N-terminus of the AI region, the consensus
seguence for aphid transmission is reported to be Cys-Gly-
Val-Ala-Ala Pro-Cys-Lys-Ile-Tyr-Cys—Cys (Thornbury et
al., 1990), where Lys is the putative amino acid required
for aphid transmission. The corresponding sequence for
ZYMV-FL/AT is Cys-Gly-Leu-Ala-Ala Pro-Val-Lys-Leu-Ser-
Cys—C (Fig. 2-3). This consensus sequence for ZYMV-FL/AT
is the same as that for ZYMV-CA and ZYMV-RU (Baker et al.,
1991b). The two amino acid residues required for protease
activity of the HC/Pro (Oh and Carrington, 1989) are also
conserved with a Cys at position 652 and a His at position
725 (Fig. 2.3).
The deduced amino acid sequence of PI of ZYMV-FL/AT was
used to prepare a hydrophobicity plot according to Kyte &
Doolittle (1982) (Fig. 2-4). The PI protein is highly
hydrophilic except for a strongly hydrophobic N-terminal 20
amino acids. There is no obvious pattern to suggest a
transmembrane motif. The PI of ZYMV-FL/AT also has a high
proportion of basic amino acids (Fig. 2-5) and is thus
highly positively charged. In contrast, the hydrophobicity
map for P3 (Fig. 2-6) shows a distribution of both
hydrophobic and hydrophilic regions, and a fairly random
distribution of acidic as well as basic amino acids (Fig. 2-
7). Interestingly, this plot is quite similar to that of

37
100 200 300
3
2
1
0
-1
-2
-3
-4
Fig. 2-4. Hydrophobicity of PI of ZYMV-FL/AT
plotted according to Kyte and Doolittle (1982).
Horizontal scale represents amino acid residues of
PI. Vertical scale represents hydrophobic amino
acids (above the midline) and hydrophilic amino
acids (below the midline).

38
100 200 300
Fig. 2-5. Map of acidic (A) and basic (B)
residues of the Pi protein of ZYMV-FL/AT.

39
100 200 300
Fig. 2-6. Hydrophobicity plot of the P3 sequence of
ZYMV-FL/AT. The horizontal scale indicates amino acid
residues in the P3 protein. The hydrophobicity (vertical)
scale is that of Kyte and Doolittle (1982), with hydrophobic
amino acids above the midline and hydrophilic amino acids
below the midline. Residues for ca. 35-50 and ca. 260-280
correspond to those suggested for P3 of TVMV to be involved
in the formation of membrane spanning helices
(Rodriguez-Cerezo and Shaw, 1991).

40
100 200 300
Fig. 2-7. Map of acidic (A) and basic (B) amino acid
residues of the P3 protein of ZYMV-FL/AT.

41
the P3 of TVMV (Rodriguez-Cerezo and Shaw, 1991). Two areas
of the P3 of ZYMV-FL/AT, indicated in Fig. 2-6, corresponded
to the possible membrane spanning helices suggested by
Rodriguez-Cerezo and Shaw.
Homologies Between the PI of ZYMV Isolates
Comparisons were made between the PI encoding regions
of five ZYMV isolates: ZYMV-CA, ZYMV-RU, ZYMV-FL/AT, ZYMV-
SV, and ZYMV-MD. The latter three isolates were sequenced
in the present study. The sequence of PI from ZYMV-FL/AT
was derived from clones produced in Aqtll and /4ZAPII. The
sequences of PI from ZYMV-SV and ZYMV-MD were derived from
clones produced by RNA-PCR products using custom primers for
PI. The specific primers for production of PI were, on the
5'-terminus, 5'-CATGAGAATTCAAGCTTACATGGCCTCTATCATG-3', and
on the 3'-terminus, 5'-CTGACTTCTAGACCTGTTCCAGCGCGTTCA-3'.
Initial comparison of PI products from RNA-PCR in agarose
gels between the mild and severe isolates showed a size
difference between the two, with the mild being slightly
larger (Fig. 2-8). Nucleotide sequence comparisons showed
an 18 nt insert in the mild isolate immediately after the
start codon (Fig. 2-9) , thus accounting for the size
difference noted in agarose gels. The sequences between the
ZYMV-FL/AT, ZYMV-SV and ZYMV-MD were quite similar, with a
nt homology of 98% between ZYMV-FL/AT and the ZYMV-SV
isolate, and a 95% homology between the ZYMV-FL/AT and the
ZYMV-MD isolate. Of ten amino acid changes in the ZYMV-SV

42
N
-2,036
-1,636
-1, 018
- 506
- 396
- 344
- 298
Fig. 2-8. Electrophoretic analysis of PCR products
of PI from ZYMV-MD and ZYMV-SV using primers
specific to the PI coding region in a 0.9% agarose
gel.

Fig. 2-9. Nucleotide sequence alignments of the Pi
coding region from ZYMV-FL/AT with that of ZYMV-CA,
-SV, -MD, and -RD. Clones of ZYMV-SV and ZYMV-MD
extend only to the GGAACAGG motif as shown due to
the primer selection for PCR cloning.

44
1 50
FL ATG GCCTCTATC ATGATTGGTT CAATCTCCGT
CA ATG GCCTCCATC ATGATTGGTT CAATCTCTGT
SV ATG GCCTCTATC ATGATTGGTT CAATCTCGGT
MD ATGAGAATTC AAGCTTTACA TGCCTCTATC ATGATTGGTT CAATCTCTGT
RU ATG GCCGCTATC ATGATTGGTT CAATCTCTGT
51 100
FL ACCCATTGCA AAGACTAAGC AGTGTGCAAA CACTCAAGTA AGTAATCGGG
CA ACCCATTGCA AAGACTGAGC AGTGTGCAAA CACTCAAGTA AGTAATCGGG
SV ACCCATTGCA AAGACTGAGC AGTGTGCAAA CACTCAAGTA AGTAATCGGG
MD ACCCATTGCA AAGACTGAGC ACTGTGCAAA CACTCAAGTA AGTAATCGGG
RU CCCTATCGTT GAGTCTGCTC GGTGTGCAAC GGTTCAAACT GGAAACCGTG
101
FL TTAATATAGT
CA CTAATATAGT
SV TTAGTATAGT
MD TTAATATAGT
RU TGAATATTGT
GGCACCTGGC
GGCACCTGGC
GCCACCTGG.
GGCACCTGGC
GGCACCTGGC
CACATGGCAA
CACATGGCAA
..CATGGCAA
CACATGGCAA
CACGTGGCAG
CATGCCCATT
CATGCCCATT
CATGCCCATT
TATGCCCATT
TTTGCAAGCC
150
GCCACTGAAA
GCCACTGAAA
GCCACTGAAA
GCCACTGAAA
ACAAATGAAA
151
FL ACGCACATGT
CA ACGCACATGT
SV ACGCACATGT
MD ACGCACATGT
RU TCGCACTCAT
ATTACAGGCA
ATTACAGGCA
ATTACAGGCA
ATTACAGGCA
ATTACAAACA
TGAGTCCAAG
TGAGTCCAAG
TGAGTCCAAG
TGAGTCCAAG
TGCATCAGAG
AA...GTTGA
AA...GTTGA
AA...GTTGA
AA...GTTGA
AAACTCTCCA
200
TGCAATCAAA
TGCAATCAAA
TGCAATCAAA
TGCAATCAAA
AACAAGCTAG
201
FL CAAAAGCATT
CA CAAGAGCATT
SV CAAAAGCATT
MD CAAAAGTATT
RU TGAAAGCATT
GACATTCTGA ACAATTTCTT
GACATTCTGA ACAACTTCTT
GACATTCTGA ACAATTTCTT
GACATTCTGA ACAATTTCTT
AATATCCTCA ATAGTTTCTT
CAGCACTGA.
CAGCACTGA.
CAGCACTGA.
CAGCACTGA.
TGACACTGAT
250
..CGAGATGA
..CGAGATGA
..CGAGATGA
..CGAGATGA
CCAGAGATGC
251
FL AGTTTAGGCT
CA AGTTTAGGCT
SV AGTTTAGGCT
MD AGTTTAGTGT
RU GTTTTAGGCT
CACTCGAAAC
CACTCGAAAC
CACTCGAAAC
CACTCGAAAC
CACTCGCAAT
GAGATGAGCA
GAGATGAGCA
GAGATGAGCA
GAGATGAGCA
GAGATGAGCA
AGGTGAAAAA
AGCTGAAAAA
AGGTGAAAAA
AGGTTAAAAA
AGGTAAAGAA
300
GGGTCCGAGT
GGGTCCGAGC
GGGTCCGAGT
GGGTCCGAGT
GGGGCCAAAT
301
FL GGGAGGATAG
CA GGGAGGATAG
SV GGGAGGATAG
MD GGGAGGATAG
RU GGAAGGATGA
TCCTCCGCAA GCCGAGTAAG
TCCTCCGCAA GCCGAGTAAG
TCCTCCGCAA GCCGAGTAAG
CCCTCCGCAA GCCGAGTAAG
TACTCCGCAA ACCAAGAGCA
CAGCGGGTTT
CAGCGGGTTT
CAGAGGGTTT
CAGCGGGTTT
CAACGTGTTT
350
TCGCTCGTAT
TCGCTCGTAT
TCGCTCGTAT
TCGCTCGTAT
TGGAGCGTAT

45
351
FL TGAGCAGGAT GAGGCAGCAC GCAAGAAAGA GACTGTTTTC
CA CGAGCAGGAT GAGGCAGCAC GCAAGGAAGA GGCTGTTTTC
SV TGAGCAGGAT GAGGCAGCAC GCAAGGAAGA GGCTGTTTTC
MD TGAGCAGGAT GAGGCAGCAC GCAAGGAAGA GGCTGTTTTC
RU CAGCTTTGAA AAGATCGAAA AAGGAGCAGA AAGACAAGTT
400
CTCGAAGGAA
CTCGAAGGAA
CTCGAAGGAA
CTCGAAGGAA
CTACCATGGC
401
FL ATTATGACGA TTCTATCACA AATCTAGCAC GTGTTCTTCC
CA ATTATGACGA TTCCATCACA AATCTAGCAC GTGTTCTTCC
SV ATTATGACGA TTCGATCATA AGTCTAGCAC GTGTTCTTCC
MD ATTATGACGA TTCGATCACA AATCTAGCAC GTGTTCTTCC
RU GAGTATATGC TACTGTGACG TCCATCATTA ATACATTCAC
450
ACCTGAAGTG
ACCTGCCGTG
ACCTGAAGTG
ACCTGAAGTG
AGATGAAAGG
451
FL ACTCACAACG
CA ACTCACAACG
SV ACTCACAACG
MD ACTCACAACG
RU AATGGCATAG
TTGATGTGAG
TTGATGTGAG
TTGATGTGAG
TTGATGTGAG
CTAACTCAAG
CTTGACGTCA
CTTGCGATCA
CTTGACGTCA
CTTGACGTCA
TTTGCGCTCA
TCGTTTTACA
CCGTTTTACA
CCGTTTTACA
CCATTTTACA
CCGTTCTATA
500
AGCGCACATA
AGCGCACATA
AGCGCACATA
AGCGCACATA
AACGTTCATG
501
FL CAAGAAGGAA AGGAAGAAAG
CA CAAGAAGGAA AGGAAGAAAG
SV CAAGAAGGAA AGGAAGAAAG
MD CAAGAAGGAA AGGAAGAAAG
RU CAGAAAGGAA AAGAAGAAAA
TGGCGCAAAA GCAAATTGTG
TGGCGCAAAA GCAAATTGTG
TGGCGCAAAA GCAAATTGTG
TGGCGCAAAA GCAGATTGTG
TAGTATGTGA AAATGTTGTG
550
C...AAGCAC
C...AAGCAC
C...AAGCAC
C...AAGCAC
CGTTCAGCCA
551
FL CACTCAATAG CTTGTGCACA
CA CACTTAATAG CTTGTGCACA
SV CACTTAATAG TTTGTGCACA
MD CACTTAATAG CTTGTGCACA
RU GTGTTAATAA TCTGTGCGAT
CGTGTTCTTA
CGTGTTCTTA
CGTGTTCTTA
CGTGTTCTTA
CGCGTTCTCA
AAATTGCACG
AAATTGCACG
AAATTGCACG
AAATTGCACG
AGATAGCGCG
600
CAATAAAAAT
CAATAAAAAT
CAATAAAAAT
CAATAAAAAT
GGAGAAAAAC
601
FL ATCCCTGTTG
CA ATCCCTGTTG
SV ATCCCTGTTG
MD ATCCCTGTTG
RU ATTCCAGTTG
AGATGATTGG
AGATGATTGG
AGATGATTGG
AGATGATTGG
AAATGATTGG
CAACAAGAAG GCGAGACATA
CAACAAGAAG ACGAGACATA
CAACAAGAAG GCGAGACATA
CAACAAGAAG GCGAGACATA
AAAGAAAAAG AATCGACACA
650
CACTCACCTT
CACTCACCTT
CACTCACCTT
CACTCACCTT
CCCTCACCTT
651
FL CAAGAGGTTT AGGGGATATT
CA CAAGAGGTTT AGGGGATGTT
SV CAAGAGGTTT AGGGGATGTT
MD CAAGAGGTTT AGGGGATATT
RU CAAGAACTTT AAGGGATCTT
Fig. 2-9—continued.
TTGTTGGAAA
TTGTTGGAAA
TTGTTGGAAA
TTGTTGGAAA
TCATTGGGAA
GGTGTCAGTT
GGTGTCAGTT
GGTGTCAGTT
GGTGTCAGTT
AGTTTCATTA
700
GCGCATGAAG
GCGCATGAAG
GCGCATGAAG
GCGCATGAAG
GCACACGAAA

46
701 750
FL AAGGACGAAT GCGGCGCACT GAGATGTCGT ATGAGCAGTT TAAATGGATT
CA AAGGACGAAT GCGGCACACT GAGATGTCGT ATGAGCAGTT TAAATGGCTT
SV AAGGACGAAT GCGGCGCACT GAGATGTCGT ATGAGCAGTT TAAATGGATT
MD AAGGACGAAT GCGGCGCACT GAGATGTCGT ATGAGCAGTT TAAATGGATT
RU GGGGCCAAAT GAGACATGTT GAGATGTCGT ACGAACAGTT TGGATTCATT
751 800
FL CTAAAAGCCA TTTGTCAGGT CACCCATACA GAGCGAATTC GTGAGGAAGA
CA CTTAAAGCCA TTTGTCAGGT CACCCATACA GAGCGAATTC GTGAGGAAGA
SV CTAAAACCCA TTTGTCAGGT CACCTATACA GAGCGAATTC GCGAGGAAGA
MD CTAAAAGCCA TTTGTCAGGT CACCCATACA GAGCGAATTC GTGAGGAAGA
RU CTACAAGCCA TCTGTCGGGT TACGAACACA AGATGTGTGC GCGATGAGGA
801 850
FL TATTAAACCA GGTTGTAGTG GGTGGGTGTT GGGCACTAAT CATACATTGA
CA TATTAAACCA GGTTGTAGTG GGTGGGTGTT GGGCACTAAT CATACATTGA
SV TATTAAACCA GGTTGTAGTG GGTGGGTGTT GGGCACTAAT CATACATTGA
MD TATTAAACCA GGTTGTAGTG GGTGGGTGTT GGGCACTAAT CATACATTGA
RU CATCAAGCCG GGGTGTAGCG GATGGGTTCT AGGCGATGAT CACGAACTTA
851 900
FL CTAAAAGATA TTCAAGATTG CCACATTTGG TGATTCGAGG TAGAGACGAC
CA CTAAAAGATA TTCAAGATTG CCACATTTGG TGATTCGAGG TAGAGACGAC
SV CTAAAAGATA TTCAAGATTG CCACATTTGG TGATTCGAGG TAGAGATGAC
MD CTAAAAGATA TTCAAGATTG CCACATTTGG TGATTCGAGG TAGAGACGAC
RU CTCAGAAATT TTCGAGGTTA CCATGCCTAG TAATTCGTGG TAGAGATGAT
901
FL GATGGGATTG
CA GATGGGATTG
SV GATGGGATTG
MD GATGGGATTG
RU GAAGGAATTG
TGAACGCGCT
TGAACGCGCT
TGAACGCGCT
TGAACGCGCT
TGAATGCATT
942
GGAACAGGTG TTATTTTATA GC
GGAACAGGTG TTATTTTATA GC
GGAACAGG
GGAACAGG
AGAACCAGTG TTCTTCTATG AT
Fig. 2-9—continued

47
1 50
FL M ASI MIGSISVPIA KTKQCANTQV SNRVNIVAPG HMATCPLPLK
MD . RIQALH EH I
RU . .A V ESAR..TV.T G V.V.KPQM.
SV . E S..P.. -
CA . E A
51 100
FL THMYYRHESK KLMQSNK-SI DILNNFFSTD -EMKFRLTRN EMSKVKKGPS
MD - - . . . . SV
RUS.S..K.A.E . . SKQASE. . N...S..D.. P..R N
SV - -
CA - - L
101 150
FL GRIVLRKPSK QRVFARIEQD —E-AARKKE TVFLEGNYDD SITNLARVLP
MD ...A — ...... E. A
RU ..MIL...RA ...LE..SFE KI.KG.ERQV LPWRVYATVT ..I.TFTDER
SV — ...... E. A IS
CA —...... E. A
151 200
FL PEVTHNVDVS LTSSFYKRTY KKERKKVAQK QIVQAP-LNS LCTRVLKIAR
MD P -
RU NGIA-NS—. .R.P....SC R..K..IVCE NV.RSASV.N ..D
SV P -
CA .A R.P -
201 * 250
FL NKNIPVEMIG NKKARHTLTF KRFRGYFVGK VSVAHEEGRM RRTEMSYEQF
MD
RU E K..N N.K.S.I.. ..L...R.Q. . HV
SV c
CA T C H
251 * 300
FL KWILKAICQV THTERIREED IKPGCSGWVL GTNHTLTKRY SRLPHLVIRG
MD
RUGF..Q...R. .N.RCV.D DD . E . . QKF ..PC-
SV P Y
CA
301
FL RDDDGIVNAL EQVLFYS
MD
RU . . . E P. F. . D
SV
CA RDDDGIVNAL EQVLFYS
Fig. 2-10. Amino acid sequence alignment of the PI proteins
of five ZYMV isolates: ZYMV-FL/AT, -MD, -RU, -SV, and
-CA. Conserved residues among ZYMV isolates are underlined.
Asterisks indicate strictly conserved residues among
potyviruses. ZYMV-MD and -SV terminate at -EQ due to
primer selection for PCR.

48
isolate compared to ZYMV-FL/AT, five made a difference in
the polarity or charge, and five changes made no difference.
In addition there was a deletion of a His at position 41 in
the ZYMV-SV isolate. The PI from the ZYMV-MD isolate had an
insert of 6 additional amino acids immediately following the
initiation codon, compared to ZYMV-FL/AT. There were nine
different amino acids in the N-terminal half of ZYMV-MD,
seven of which made a difference in the charge or polarity.
The PI of ZYMV-CA had a high degree of similarity
compared to ZYMV-FL/AT (96%), whereas ZYMV-RU was highly
divergent with only a 60% nt sequence homology compared to
the PI of ZYMV-FL/AT (Table 2-3). In spite of the
variability seen among five PI regions, certain consensus
regions and amino acids believed to be involved or required
for protease activity of PI were conserved. For example,
all five isolates had the amino acid consensus Gly-Xaa-Ser-
Gly, the His at position 223 and Ser at position 264 (Fig.
2-10). The conserved potyvirus sequence of Phe-Ile-Val-
Arg-Gly (Verchot et al., 1991) close to the Pl/AI cleavage
site, was slightly different, with a sequence of Leu-Val-
Ile-Arg-Gly for all five isolates (Fig. 2-10) .
Homologies Between PI, AI, and P3 of ZYMV Isolates and Other
Potvviruses
Nucleotide and amino acid sequence comparisons were
made between the PI, AI, and P3 of ZYMV-FL/AT with ZYMV-CA,

49
Table 2-3. Percentage of nucleotide and amino acid
sequence homologies of the Pi, amorphous inclusion
(AI), and P3 regions of four ZYMV isolates and five
distantly related potyviruses with respect to
ZYMV-FL/AT.
rus/isolate
-El.
AI.
El
ZYMV-CA
a
96(97)
98(98)
98(99)
ZYMV-SV
98(97)
ndb
nd
ZYMV-MD
95(97)
nd
nd
ZYMV-RU
60(70)
88 (96)
84 (96)
TEV
42(45)
52 (63)
43 (54)
pvyn
37(46)
51(64)
44 (49)
TVMV
39(48)
52 (64)
44 (52)
PPV
41(38)
52 (65)
45 (50)
PSbMV
39(37)
50 (58)
45 (52)
a
Homologies were determined using the GAP alignment
of the University of Wisconsin Genetics Computer
Group Program. GAP calculates alignment of two
complete sequences that maximizes the number of
matches and minimizes the number of gaps.
Nucleotide sequence homologies are listed first
with amino acid homologies in ().
b
nd=not determined

50
ZYMV-RU, TEV (Allison et al., 1986), potato virus Y-strain
N(PVYn) (Robaglia et al., 1989), TVMV (Domier et al., 1986),
plum pox virus (PPV) (Lain et al., 1990), and pea seed-borne
mosaic virus (PSbMV) (Johansen et al., 1991) (Table 2-3).
Sequence comparisons also were made between ZYMV-FL/AT, and
ZYMV-SV, and ZYMV-MD for PI.
The PI of ZYMV-CA, ZYMV-SV, and ZYMV-MD had high nt and
amino acid sequence homologies to ZYMV-FL/AT ranging from
96% (CA) to 98% (SV). However, the PI gene of ZYMV-RU had a
60% nt and a 70% amino acid homology compared to the PI of
ZYMV-FL/AT, and this was the greatest difference seen
between a single gene among five ZYMV isolates studied to
date. These nt homology values are also compared to the PI
of TEV (42%), PVYn (37%), TVMV (39%), PPV (41%), and PSbMV
(39%). The amino acid homologies were higher than the nt
homologies for each virus in most cases (Table 2-3).
The Al nt coding region of ZYMV-FL/AT was also compared
to that of ZYMV-CA (98% homology) and ZYMV-RU (88%) . The
deduced amino acid sequence for ZYMV-CA was the same as the
nt homology compared to ZYMV-FL/AT. However, the amino acid
homology for the Al of ZYMV-RU was 98%, indicating that many
of the nt changes made no difference in the amino acid
sequence. The Al sequence comparisons to unrelated
potyviruses were from 50% homology for PSbMV to 52% for TEV,
TVMV, and PPV.

51
The nt sequence of the P3 of ZYMV-FL/AT showed a 98%
homology with the P3 of ZYMV-CA and 84% homology with ZYMV-
RU. The ZYMV-FL/AT and distantly related potyviruses had nt
homologies to ZYMV-FL/AT ranging from 43-45%. The amino
acid sequence homologies of P3 compared to ZYMV-FL/AT were
slightly higher than the nt homologies (Table 2-3). In all
nt and amino acid comparisons, the PI was the least
conserved region whereas the HC/Pro was more highly
conserved than either PI or P3.
Discussion
Attempts to clone the entire 5'-terminus of the ZYMV
genome necessitated the use of custom primers to force
cloning specifically for the 5'-end. This resulted in a
series of clones which represented the entire ORF of the
ZYMV genome.
High nucleotide sequence similarities among the PI of
ZYMV-FL/AT, -SV, -MD, and -CA isolates were noted, but a
significant divergence was seen with the PI of the ZYMV-RU
isolate. The larger size of the PI from ZYMV-MD as seen in
PCR analysis in agarose gels was verified by sequences which
showed a six amino acid insert after the start codon.
Whereas the first five amino acids were Met-Ala-Ser-Ile-Met
for ZYMV-FL/AT, -SV, and -CA, and Met-Ala-Ala-Ile-Met for
ZYMV-RU, the corresponding sequence for ZYMV-MD was Met-Arg-
Ile-Glu-Ale-Leu-His-Ala-Ser-Ile-Met. All the differences

52
seen in the amino acid sequence for the ZYMV-MD were in the
N-terminal half of PI. Eight of the 11 amino acid
differences (which include one deletion) in the ZYMV-SV
isolate were also in the N-terminal half of PI.
The conserved residues in the C-terminus of PI have
been maintained to some degree in the five ZYMV isolates
studied. The His and Ser residues important for protease
activity were present in all five isolates of ZYMV.
However, the consensus sequence reported for the five
potyviruses analyzed by Verchot et al. (1991) is slightly
different. Instead of Phe-Ile-Val-Arg-Gly, the sequence for
ZYMV isolates is Leu-Val-Ile-Arg-Gly. This sequence
suggests a possible inversion of amino acids Val and lie at
this point. In spite of the lower conservation of ZYMV-RU,
it is interesting to note that the conserved regions are the
same among all ZYMV isolates, as well as the putative
Tyr/Ser cleavage site between PI and AI.
Among the five ZYMV isolates in this study, and five
other potyviruses which have been completely sequenced
(Verchot et al., 1991), the PI is the most variable region
on the potyviral genome. In addition, the N-terminus of PI
is more variable than its C-terminus.
Although the AI was not the primary focus of this
research, the homologies of the potyviruses and three ZYMV
isolates addressed in this study were compared. The AI-
encoding region was more highly conserved than that of PI,

53
with a high homology (98%) noted between ZYMV-FL and ZYMV-
CA, and a lower (88%) homology between ZYMV-FL/AT and ZYMV-
RU. Other potyviruses had seguence homologies compared to
ZYMV-FL/AT in the range (51-52%) expected for distinct
potyviruses (Shukla et al., 1991).
The homologies seen for the P3-encoding region were
similar to those seen for the AI-encoding region, with a
high homology (98%) between ZYMV-FL/AT and -CA, and a lower
homology (84%) between ZYMV-FL/AT and -RU isolates. The
homologies of distinct potyviruses compared to ZYMV-FL/AT
were lower (43-44%), as expected.
It is clear from the seguence analyses presented in
this study, that there is variation in the PI coding region
among ZYMV isolates. There is also greater variation in the
PI region than in the AI or the P3 regions. The ZYMV-RU
isolate appears to have a more highly diverged PI nt
sequence than the other ZYMV isolates addressed in this
study. According to the criteria proposed by Shukla et al.
(1991), ZYMV-RU does not fit the category of either a strain
or a distinct potyvirus, regardless of whether the PI, AI,
or P3 regions are considered. In addition, the CP region of
ZYMV-RU is 88% similar to that of ZYMV-CA (Baker, et al.,
1991b). Polyclonal antisera to the CP of ZYMV-FL/AT and
ZYMV-RU cross react in reciprocal SDS-immunodiffusion tests
with the formation of spurs (Baker, et al., 1991a). Several
monoclonal antibodies (MAbs) produced to ZYMV-FL/AT

54
(Appendix 1) show a low affinity to ZYMV-RU. The
symptomatology of ZYMV-RU on a range of susceptible hosts is
very similar to classical ZYMV symptoms (Baker et al.,
1991a; H.Lecog, unpublished).

CHAPTER 3
SEROLOGICAL CHARACTERIZATION OF THE PI PROTEIN OF
ZUCCHINI YELLOW MOSAIC VIRUS FROM FLORIDA
Introduction
The nt sequences of the PI and and P3 coding regions
are less conserved than other coding regions on the
potyviral genome (Shukla et al., 1991). Furthermore, the N
terminus of the PI protein is less conserved than its C-
terminus. For these reasons, it was hypothesized that the
antigenic characterization of the PI and P3 proteins would
prove useful in distinguishing different isolates of
potyviruses.
In order to evaluate the potential of antigenic
properties of PI and P3 for distinction of ZYMV isolates,
the following experimental approach was attempted: cloning
and sequencing of the PI and P3 encoding regions as
described in chapter 2, expression of the encoded proteins
in E. coli. production of antisera to the expressed
proteins, and development of serological detection methods.
These procedures were successful for the PI protein of ZYMV
FL/At and ZYMV-RU, and this chapter describes the antigenic
detection and characterization of the PI proteins of ZYMV
isolates by western blots of extracts from infected plants
55

56
and by immunofluorescence in infected tissues. Although the
P3 of ZYMV was cloned and sequenced, the toxicity of this
protein in E. coli prevented expression of P3 and
preparation of antisera, so that no serological studies were
conducted with the P3 protein. During the course of this
study, Rodriguez-Cerezo and Shaw (1991) used a similar
approach to obtain antisera to PI and P3 of TVMV. Although
the P3 of TVMV appeared to be toxic to E. coli. as seen by
cessation of cell growth, P3 was expressed in low levels.
They detected the PI and P3 proteins of TVMV serologically
in extracts from infected plants and protoplasts. The P3 of
TEV is likewise toxic to E. coli and cannot be expressed in
its entirety (V. Doljas, personal comm.).
Materials and Methods
Culture of Virus Isolates
Table 3-1 lists the isolates of ZYMV used in this
study, their source, and the original host from which they
were isolated. Host plants were maintained in a growth room
under a ca. 16 hr day length with an average temperature of
23 C or in a greenhouse. Isolates obtained from outside the
state of Florida were kept under quarantine conditions in a
locked growth room. Two ZYMV isolates from Israel were
kindly provided by Y. Antignus (Volcani Center, Bet Dagan,
Israel). Three ZYMV isolates from France were kindly

57
Table 3-1. List of zucchini yellow mosaic virus isolates
used for serological studies of the Pi protein.
Isolate
Origin
Host
FC-2000
FL-Alachua Co.
squash
FC-2050
FL-Dade Co.
squash
FC-2154
FL-Collier Co.
watermelon
ZYMV-RU
Reunion Island
Momordica charantia
Italy
Italy
zucchini
ZYMV-FL/AT
FL-Sumter Co.
zucchini
a
ZYMV-FL/GH
FL-Sumter Co.
zucchini
ZYMV-SV
FL-Palm Beach Co.
squash
ZYMV-MD
FL-Alachua Co.
squash
81-25
FL-Sumter Co.
squash
FC-3182
FL-DeSoto Co.
zucchini
HAT
Israel
zucchini
NAT
Israel
zucchini
Egypt
ATCC 405
squash
Connecticut
ATCC 594
squash
Taiwan
ATCC 622
squash
PAT
France
muskmelon
weak
France
muskmelon
E15
France
muskmelon
FC-3179
FL-DeSoto Co.
zucchini
FC-3180
FL-DeSoto Co.
zucchini
FC-3181
FL-DeSoto Co.
zucchini
ZYMV-FL/GH=an isolate of ZYMV maintained for several years
by mechanical inoculation.

58
provided by H. Lecoq (INRA, Station de Pathologie Vegetale,
Montfavet, France). Three additional isolates were obtained
from the American Type Culture Collection (ATCC). The 81-25
culture was isolated by W.C. Adlerz and was obtained from
D.E. Purcifull. All the remaining Florida isolates were
from the collection of D.E. Purcifull and G.W. Simone. Host
plants used for routine assay and maintenance were pumpkin
(Cucúrbita pepo L. 'Small Sugar'). Squash (C. pepo L.
'Early Prolific Straightneck'), watermelon [Citrullus
lanatus (Thunb.) Matsumi & Nakai 'Crimson Sweet'], and
cantaloupe (C. meló L. 'Hales Best Jumbo') were also used
for some studies.
For mechanical inoculations, tissues were triturated in
a mortar and pestle with 0.02 M potassium phosphate buffer,
pH 7.5, with the addition of 600 mesh carborundum. The
slurry was rubbed onto fully expanded cotyledons with
sterile cheesecloth pads, and plants were rinsed gently with
water several minutes after inoculation. Mock inoculations
were made using extracts from noninoculated plants.
Increase of PI and P3 by PCR for Subcloninq and Expression
Based on the nt sequence of PI and P3 of ZYMV-FL/AT,
primers were made which correspond to the beginning and end
of each protein encoding region with special attention to
areas with a high GC content. For cloning of PI of ZYMV-
FL/AT, restriction sites with five flanking bases on the 5'-
end were incorporated into the primers to provide for

59
directional cloning into the pETh vector (McCarty et al.,
1991) at Hindlll and Bglll sites on the polylinker. The
pETh vector was selected as the expression vector in this
study. It is a modification of the original pET vector
developed by Studier et al. (1990) for high level expression
of genes under the control of the T7 RNA polymerase from
bacteriophage T7. In this system, if the protein product is
not toxic to E. coli, host transcription cannot compete
after induction of the T7 promoter and almost all
transcription becomes due to the T7 RNA polymerase.
Primers used for increase of the PI of ZYMV-FL/AT are
presented in chapter 2. The PI of ZYMV-RU was also
increased by PCR for subcloning and expression. The primer
for the 5'-end of the ZYMV-RU PI gene was the same as for
ZYMV-FL/AT PI, but for the 3'-end the primer was 5'-
GGGCTCTAGATGGTTCTAATGCAT-3', which included a Bglll site and
four flanking bases on the 5'-end. Primers for increase of
P3 by PCR were, on the 5'-terminus, 5'-GGCGGAACACCAACA-3'
and on the 3'-terminus was 5'-CCAACCGTACCAAAA-3'. The
primers for P3 did not include restriction sites, and the P3
gene was blunt-end ligated into the pETh vector.
The correct reading frames were selected for PI and P3,
based on the nt and deduced amino acid sequence, to be in
frame with the ATG initiation codon of pETh. For PI of both
ZYMV-FL/AT and ZYMV-RU the plasmid providing the correct
reading frame was pETh-3b, and for P3 it was pETh-3c. In

60
all cases digestion at the engineered restriction sites on
the primers was unsuccessful (even after protease K
digestion and phenol/chloroform extraction), so the PCR
product was blunt-end ligated into the Smal-digested, CIAP-
treated plasmid.
An intermediate E. coli host, strain HB101, was
transformed (Sambrook et al., 1989) for initial studies.
Plasmid mini-preps were made from transformants to
determine, by sequence data, the presence of the correct
gene, its orientation, and verification of the correct
reading frame for expression. Primers used for sequencing
were the T7 promoter primer and the pBR322 EcoRI site
clockwise primer, both obtained from the University of
Florida DNA synthesis facility.
Induction and Expression of PI and P3 Proteins
Plasmid cultures which were identified as PI and P3 in
the correct orientation and reading frame were used to
transform the appropriate host for expression, E. coli
strain BL21DE3pLysS. A single transformant colony grown on
LB containing ampicillin (50 jug/ml) and chloramphenicol (25
Mg/ml) was raised in 5 ml of M9 medium (Sambrook et al.,
1989) with 0.4% glucose and 0.5% tryptone at 37 C with
shaking to an O.D. 600 of 0.6. Cultures were divided into 2.5
ml aliquots. One 2.5 ml aliquot was induced with 1 mM IPTG.
Both induced and noninduced cultures were allowed to grow an
additional 3-4 hr at 37 C. Cells were harvested by

61
centrifugation at 5,000 g, pellets were resuspended in one
half the original volume of TE buffer (10 mM Tris-HCl, 1 mM
EDTA, pH 8.0), and frozen at -20 C overnight. The viscosity
of the cell lysate necessitated sonication for 5 sec to
allow for pipetting. Ten /il of each sample was mixed with
an egual volume of Laemmli dissociating solution (LDS)
(Laemmli, 1970), the mixtures were boiled for 2 min, and
were subjected to analysis by sodium dodecyl sulfate-
polyacrylamide gel electrophoresis (SDS-PAGE). Gels were
stained with Coomassie Brilliant Blue R-250 (BRL,
Gaithersburg, MD) for detection of expressed proteins. In
all cases, both induced and noninduced recombinant plasmid
cultures were tested, as well as plasmid cultures containing
no inserted gene.
Since P3 appeared to be toxic to E. coli in this
system, as determined by lack of cell growth and protein
expression following induction, an alternate induction
procedure was attempted using the bacteriophage CE6 to
infect pETh plasmids containing P3 in the E. coli host
HMS174. The HMS174 has no T7 RNA polymerase and the enzyme
is provided by infection with CE6 bacteriophage. This
expression can be useful for expression of toxic gene
products (Studier et al., 1990).
Antigen Preparation and Antibody Production
Since the PI proteins expressed by both ZYMV-FL/AT and
ZYMV-RU were insoluble, the proteins were partially

62
purified, after sonication, by three cycles of
centrifugation of the precipitate at 10,000 g and washing
with TE buffer, followed by preparative SDS-PAGE on a 3 mm
gel. Protein bands were visualized by incubating in 0.2 M
KCl for 7 min at 4 C. The protein bands were excised,
washed three times in cold distilled water, frozen at -20 C,
and eluted using a Bio-Rad Electroeluter at 10 mAmp/tube,
with constant current for 5 hr. Polarity was reversed for 1
min, and the extracted proteins were dialyzed overnight
against distilled water. Purity of the eluted protein was
checked by analytical SDS-PAGE, after which the protein was
lyophilized.
A New Zealand white rabbit (no. 1181) was immunized on
day one with 2 mg of ZYMV-FL/AT PI protein in 0.5 ml sterile
distilled water which was emulsified with 0.5 ml of Freund's
complete adjuvant. Injections were made using 0.25 ml of
emulsion per site, with two intramuscular sites per hip. On
day 14 and day 21, 1 mg protein was used with 0.5 ml water
and 0.5 ml Freund's incomplete adjuvant. The same schedule
was followed for rabbit no. 1186 which was immunized with
the PI protein of ZYMV-RU. Rabbits were bled on a weekly
basis starting on day 28 for 2 months, with a 4 week
interval before a booster injection on day 112 and
subsequent bleeding.

63
Western Blotting Procedure
The western blotting procedure was conducted
essentially as described by Towbin et al. (1979) using a
Bio-Rad Mini-Protean II Electrophoresis Cell and Bio-Rad
Trans-Blot Electrophoretic Transfer Cell. Ten per cent gels
were used primarily, with occasional 8 and 15% gels being
run for special purposes.
Young, symptomatic leaves of inoculated test plants
were harvested between days 5 and 21 post-inoculation.
Extracts for immunoblots were initially prepared by
triturating leaf tissue in LDS (1:1, w:v), followed by
boiling for 2 min. However, for adequate extraction of PI
from plant tissues, an alternate extraction buffer (ES
buffer) (Rodriguez-Cerezo and Shaw, 1991) was used which
gave improved results. The ES buffer consisted of 75 mM
Tris-HCl, pH 6.1 containing 9 M urea, 7.5% 2-
mercaptoethanol, and 4.5% SDS. One part plant tissue was
triturated in a mortar and pestle with 2 parts of ES buffer.
The triturate was squeezed through a single layer of
moistened cheesecloth, boiled 2 min, and centrifuged at
5,000 g for 5 min. Centrifuged samples were stored at -20 C.
Each isolate was tested from at least two different sources
of tissue.
Nitrocellulose membranes (Bio-Rad Trans-Blot, 0.4/l¿)
were rinsed three times with TBST after transfer, followed
by incubation for 15 min at RT with 10 ml blocking solution

64
containing E. coli lysate at 1 mg/ml and extracts from
noninfected plants. The noninfected plant extract was
prepared by triturating leaf tissue in water (1:9, w:v) and
straining through a single layer of moistened cheesecloth.
The specific primary antibody was added at 1/1000 dilution.
The procedure for the secondary antibody and development are
as described in chapter 2 for immunoscreening. Reactions
were allowed to develop at RT and were stopped by rinsing in
deionized water.
In Vitro Translation and Immunoprecipitation
The wheat germ (WG) in vitro translation procedure was
the same as described by Cline et al. (1985). Three /¿g of
RNA from ZYMV-FL/AT in a 50 /¿I WG extract mixture,
containing 40 /¿Ci of [H3] leucine was incubated at 25 C for
60 min. Immunoprecipitation analyses were performed as
described by Dougherty and Hiebert (1980). Precipitated
products were separated on a 10% SDS-PAGE and detected on
dried gels by fluorography as described by Bonner and Lasky
(1974). Antisera used for immunoprecipitation of in vitro
translation products were to the PI and CP of ZYMV, and to
the AI of PRSV-W.
Production of Antisera to Synthetic Peptides
Synthetic peptides to the N-terminus of both the PI and
P3 proteins of ZYMV were prepared by the University of
Florida protein synthesizing facility. The amino acid
sequence of the peptide prepared to PI was Met-Ala-Ser-Ile-

65
Met-Ile-Gly-Ser-Ile-Ser-Val-Pro and to P3 was Gly-Thr-Pro-
Thr-Gln-Arg-Ile-Lys-Leu-Glu-Glu-Gln. Both free peptide and
peptide conjugated to BSA were used as immunogens. Peptides
were coupled to BSA according to Harlow and Lane (1988).
One mg peptide and 1 mg BSA were each dissolved in 1 ml of
0.1 M potassium phosphate buffer, pH 7.0. Two hundred /il of
fresh 25% glutaraldehyde was added to 1 ml of the
protein:peptide solution and stirred overnight at room
temperature. This was followed by dialysis against
deionized water three times over a 24 hr period. The
material was lyophilized and stored at -20 C. Immunization
protocols followed were as described for the expressed PI
protein from E. coli. Rabbit numbers for P3 peptide and the
conjugated P3 peptide were 1167 and 1169, respectively. The
rabbit numbers for the PI peptide and the conjugated PI
peptide were 1168 and 1170, respectively.
Light Microscopy and Immunofluorescence Tests
Indirect immunofluorescence tests were conducted as
described by Hiebert et al. (1984) with some modifications.
Six Ml of 10% dimethyl sulfoxide (DMSO) in phosphate
buffered saline (PBS), 27 nl of healthy plant extract (1/10
in PBS containing 1% ovalbumin) , and 27 fil of antiserum were
incubated together for 30 min prior to addition of epidermal
strips from plant tissue. Epidermal strips were incubated
in the antibody preparation in a 1.5 ml microfuge tube after
vortexing for 10 sec to ensure complete exposure of the

66
tissue to the antibody solution. Tissue was incubated in
the antibody solution on a shaker for 3-4 hr at RT in the
dark. Rinsing between steps was done twice in 1 ml of TBST
after vortexing for 10 sec and once for 1 hr in PBS while
shaking at RT in the dark. Rhodamine-conjugated protein A
(Sigma Chemical Co., St. Louis, MO) was used as a
fluorescent probe. The rhodamine-conjugate was diluted 1
g/ml in PBS. Eight n1 of the conjugate was mixed with 40 n1
of 10% DMSO and 352 ¿¿1 of PBS. After vortexing, rinsed
tissue was incubated in this solution at RT for 3-4 hr in
the dark while shaking. After a final rinse, tissue was
mounted on microscope slides using Aqua-mount (Lerner Labs,
New Haven, CT). 'Crimson Sweet' watermelon was used as the
host for immunofluorescence tests. Tissue sections were
photographed with epifluorescence optics using a Nikon
Fluophot microscope with a G2A filter.
Results
Expression of PI and P3 Coding Regions in E. coli
Initial efforts to clone PI by cohesive end ligation at
digested sites of PCR products were unsuccessful.
Subsequently, PCR products of PI and P3 were blunt-end
ligated successfully into the pETh plasmid. Clones were
sequenced to determine the correct orientation and reading

67
Fig. 3-1. Expression of PI protein of ZYMV-FL/AT cloned
into the pETh plasmid. A: Cultures expressing PI were grown
for 3 hrs after induction with IPTG. Noninduced cultures
were processed the same as induced cultures. Lanes 2 and 4
are induced cultures carrying the PI gene. Lanes 1 and 3
are noninduced cultures carrying the PI gene. Lane 5 is a
noninduced culture carrying the pETh plasmid only, and lane
6 is the same culture, induced. B: Lane 1 is the PI
protein which was partially purified by centrifugation prior
to preparative electrophoresis, and lane 2 is the supernate
from the same preparation. Arrow indicates the PI expressed
protein at ca. 35-kDa.

68
frame, and were then used to transform the appropriate E.
coli host for expression, BL2lDE3pLysS.
Induction of PI from ZYMV-FL/AT resulted in
overexpression of an insoluble protein product of ca. 36-kDa
(Fig. 3-1A). Fifty ml cultures were induced for large scale
PI protein production. The PI protein was insoluble and
thus was easily purified by three cycles of centrifugation
and washing, thereby providing a product free of
mostbacterial proteins (Fig. 3-1B). Further purification of
PI protein from bacterial lysates was accomplished by
preparative SDS-PAGE and electroelution. The protein
product was then lyophilized and used for antiserum
production in rabbits. Bleeding dates for PI of ZYMV-FL/AT
used were from 4 weeks to 7 months after the original series
of immunizations. For the PI of ZYMV-FL/AT, rabbit 1181 was
bled from September 13, 1991 through July 16, 1992. The PI
of ZYMV-RU was expressed and purified in a similar manner
for use as an immunogen. For the PI of ZYVM-RU, rabbit 1186
was bled from May 28, 1992 through July 16, 1992.
Induction of the P3 protein was unsuccessful in both
the pETh/BL21DE3pLysS system and when using the
bacteriophage CE6 to infect the host HMS174 carrying the
pETh plasmid (data not shown). These results are similar
to the results with the TEV P3 protein (V. Doljas, personal
comm.), which is toxic in E. coli and thus cannot be
expressed in its entirety. Rodriguez-Cerezo and Shaw (1991)

69
expressed P3 of TVMV in E. coli. The induced bacterial
cells ceased growth following induction with IPTG, and thus
the level of expression was low (E. Rodriguez-Cerezo,
personal comm.)" Apparently the P3 protein of all three
potyviruses is toxic to varying degrees in E. coli.
Detection of PI Protein in Plants Infected with ZYMV
Initial extraction of ZYMV-infected plant tissues with
LDS gave very weak reactions in western blots. Extraction
with ES buffer gave satisfactory reactions with ZYMV-
infected plant tissues in western blots using antiserum to
PI of ZYMV-FL/AT as a probe. The antiserum reacted
specifically to a ca. 34-kDa protein in plant tissue
infected with ZYMV-FL/AT. No protein was detected in
extracts from healthy plant tissues. Western blots with
preimmune serum did not result in a detectable protein
reaction.
In western blots using antiserum to the PI of ZYMV-
FL/AT (1181), a PI protein reaction at ca. 34-kDa for ZYMV-
FL/AT was noted. Some heterogeneity was seen among the
other ZYMV isolates used in this study (Fig. 3-2). A higher
molecular weight (mw) of ca. 35-kDa was noted for some ZYMV
isolates including ZYMV-MD, FC-2000, FC-2050, and three
isolates from France (PAT, weak, and E15) (Table 3-2). PI
products that were slightly smaller than that of ZYMV-FL/AT
included those of ZYMV-SV, three ATCC isolates of ZYMV (from
Egypt, Taiwan, and Connecticut), and the original ZYMV

70
isolate from Italy. In addition to size differences of PI
protein, some isolates showed a possible breakdown product
of ca. 26-27-kDa whereas others (FC-3182, weak and E15 from
France) showed an incomplete processing of PI and HC/Pro by
the reaction of a band of ca. 88-kDa. This 88-kDa band of
FC-3182 was tested and also reacted with antiserum to the AI
of PRSV-W (Fig. 3-3).
The size heterogeneity between ZYMV-MD, ZYMV-FL/AT, and
ZYMV-SV seen in SDS-PAGE using 10% acrylamide gels with
antisera to the PI of ZYMV-FL/AT as a probe, was further
examined by subjecting them to SDS-PAGE in 8% and 15%
acrylamide gels (Fig. 3-4). These size differences were
also noted in the 8% and 15% gels, providing evidence that
the heterogeneity seen is due to true mw differences between
PI proteins and not solely due to charge differences
(Hedrick and Smith, 1968).
The size differences between the PI proteins of ZYMV-
FL/AT, ZYMV-MD, and ZYMV-SV were consistent regardless of
the host used for western blot assays. These three isolates
were tested in pumpkin, watermelon, cantaloupe, and sguash
(Fig. 3-5).
Of the ZYMV isolates tested in this study, ZYMV-RU
reacted weakly or not at all with the antiserum to the PI of
ZYMV-FL/AT. This isolate did react with antisera to the CP
and Cl of ZYMV and to the AI of PRSV-W (Fig. 3-6). Extracts
from pumpkin singly infected with any of several other

71
es
00
H
en
El &
jJ
3
O
•rl
â– IJ
ü
AJ
s t
4
A
o\
©
H
04
S|
3 -H
Eh •
d in
r*
00
00
0)
Q)
o «
< s
P H
H
H
H
CO
w
u n
04 1
t w
m
m
m
as
-200
_ 97
- 68
- 43
- 29
- 18
Fig. 3-2. Characterization of the reactions of the Pl-
related proteins of 22 isolates of zucchini yellow mosaic
virus (ZYMV) in western blots. Blots were probed with
antiserum no. 1181 (collection date 3-17-92) to the PI
protein of ZYMV-FL/AT.

72
Table 3-2. Evidence for antigenic and size variation of Pl-
related proteins among ZYMV isolates in western blots using
antiserum to ZYMV-FL/AT (1181) and ZYMV-RU (1186).
Tan!atP
Approximate
molecular weight
Reaction
pattern(1181)
Reaction
pattern(1186)
FC-2000
35 a
35
35
FC-2050
35
35
35
FC-2154
34
34,26
34
ZYMV-RU
b
33(+/-)
33(+/-)
33
Italy
33
33
33 (+/-)
ZYMV-FL/AT
34
34,26
c
ZYMV-FL/GH
34
34,26
-
ZYMV-SV
33.5
33.5
-
ZYMV-MD
35
35
35
81-25
34
34
34
3182
34
88,34,26
88,34
HAT
34
34
34
NAT
34
34
34
Egypt
33
33
-
Connecticut
33
33
-
Taiwan
33
33
33
PAT
35
35,27
35
weak
35
88,35,27
35
E15
35
88,35,27
35
FC-3179
34
34,26
34
FC-3180
34
34,26
34
FC-3181
34
34
-
a molecular weights are in kDa.
b (+/-)=extremely weak reactions; not detectable
in every test.
c - = no detectable reaction.

73
Fig. 3-3. Western blots of extracts from plants singly
infected with selected ZYMV isolates. Blots were probed
with antisera to PI of ZYMV-FL/AT (PI) and to the AI of
PRSV-W (AI). Arrow indicates the position of the 88-kDa
protein of isolate FC-3182 which reacts with both PI and AI
antisera.

74
s%
15%
-29
-18
Fig. 3-4. Western blots showing 8% and 15% SDS-PAGE gel
concentrations. Antiserum used to probe blots was to the PI
of ZYMFV-FL/AT. The size differences among the isolates
shown were consistent regardless of the gel concentration.
Pl=protein expressed from E. coli. mw=molecular weight
markers.

75
pumpkin
<
1 & a
i i i
N N N
squash cantaloupe watermelon
5 9
i i
<
* i
i
•s .
. ..v, w
Ml
»H 4J
19
- 200
- 97
. 68
- 43
- 29
Fig. 3-5. Detection of the PI protein in western blots of
extracts from plants of four cucurbit cultivars singly
infected with three isolates of zucchini yellow mosaic
virus. The hosts were pumpkin (Cucúrbita pepo 'Small
Sugar'), squash (C. pepo 'Early Prolific Straightneck'),
cantaloupe (Cucumis melo 'Hale's Best Jumbo'), and
watermelon (Citrullus lanatus 'Crimson Sweet'). Antiserum
no. 1181 (collection date 3-17-92) to PI of ZYMV-FL/AT was
used as the probe.

76
Fig. 3-6. Western blots of extracts from pumpkin singly
infected with selected ZYMV isolates using antiserum to PI
of ZYMV-FL/AT, Cl, and CP of ZYMV-FL/AT, and to the AI of
PRSV-W as probes. The ZYMV-RU isolate reacted weakly or not
at all with antiserum to the PI of ZYMV-FL/AT, but reacts
with other antisera. PI, membrane probed with antiserum to
the PI protein of ZYMV-FL/AT. AI, membrane probed with
antiserum to the AI of PRSV-W. Cl, membrane probed with
antiserum to the Cl of ZYMV-FL/AT. CP, membrane probed with
antiserum to the CP of ZYMV-FL/AT. Arrangement of isolates
is the same for all four membranes. Arrows indicate
position of respective proteins in each membrane.

77
viruses that infect cucurbits but are distinct from ZYMV
were also tested in western blots. These included PRSV-W,
WMV-2, an unamed potyvirus (FC-2932) which is
antigenically different from ZYMV, PRSV-W, and WMV-2
(Purcifull et al., 1991), cucumber mosaic virus (CMV), and a
possible potexvirus of cucurbits (FC-1860, Purcifull et al.,
1988). All of these extracts were negative in western blot
tests when tested against antiserum to the PI of ZYMV-FL/AT
(Fig. 3-7). Antiserum to the PI protein of ZYMV-RU was also
negative when tested against PRSV-W, WMV-2, FC-1860, and FC-
2932 (data not shown). This antiserum showed differential
reactivity to several ZYMV isolates (Table 3-2, Fig. 3-8).
For those isolates which reacted with antisera to both ZYMV-
FL/AT PI and ZYMV-RU PI, the approximate mw estimates for
those isolates were the same.
Immunoprecipitation Analysis of In Vitro Translation
Products
Translation products obtained in the WG ¿n vitro
translation system were immunoprecipitated with antisera to
the PI and CP of ZYMV-FL/AT, to the Al of PRSV-W and with
preimmune serum. Since the WG translation system does not
yield large products, analysis of SDS-PAGE showed only the
PI and Al present in total translation products (Fig. 3-9) .
The antisera to PI and Al precipitated products of the
appropriate mw for each, ca. 34-kDa and 52-kDa,

78
<
.J
l
N
5
1
05
X
>
05
1
0)
w
ro
jj
w
ffj
23

jg
0
w
a*
o
05
ft
X
- 200
- 97
- 68
- 43
- 29
- 18
Fig. 3-7. Specificity of antiserum (no. 1181, collection
date 3-17-92) to PI of ZYMV-FL/AT in western blots.
Extracts from samples infected with ZYMV-FL/AT show a
prominent band at ca. 34-kDa and a weak band at ca. 26-kDa.
Note lack of reactivity with extracts from pumpkin singly
infected with any of three potyviruses (PRSV-W, WMV-2,
2932), a cucumovirus (CMV), a possible potexvirus (FC-1860,
potex), or from noninoculated pumpkin leaves (HSSP/healthy).

79
Fig. 3-8. Reactivity of 22 zucchini yellow mosaic virus
(ZYMV) isolates in western blots using antiserum to the PI
of ZYMV-RU as a probe. Blots were probed with antiserum no.
1186 (collection date 6-10-92).

80
^ Hi H H W
6 tn < O Z
Fig. 3-9. Immunoprecipitation of wheat germ in vitro
translation products. TP=total products, Pl=products
immunoprecipitated with ZYMV-FL/AT PI antiserum, AI=products
immunoprecipitated with antiserum to the AI of PRSV-W,
CP=products immunoprecipitated with antiserum to the CP of
ZYMV-FL/AT, and NS=products immunoprecipitated with
preimmune serum. mw=molecular weights are from top to
bottom: 200-, 97-, 68-, 43-, 29-, 18-, 14-kDa.

81
respectively. Neither the CP nor preimmune serum
precipitated a protein product. Interestingly, the PI
antiserum precipitated a smaller product, ca. 25-kDa, which
may be similar to the possible breakdown product usually
seen in immunoblots for that isolate.
Detection of PI Protein by Indirect Immunofluorescence
Fluorescence microscopy of rhodamine-conjugated protein
A labeled antiserum to the PI protein showed the presence of
aggregates in the cytoplasm of epidermal strips from ZYMV-
infected watermelon. Isolate ZYMV-FL/AT showed accumulation
of amorphous aggregates with particulate fluorescing bodies
in cells of epidermal tissues (Fig. 3-10) when treated with
antiserum to the PI of ZYMV-FL/AT. Similar results were
seen with isolates ZYMV-SV and FC-3182. It is possible,
judging from the location of the fluorescing material, that
these bodies might be associated with the Cl protein
inclusions. Further studies using electron microscopy of
ultrathin sections will be needed to ascertain this.
Epidermal strips of ZYMV-FL/AT, ZYMV-SV and FC-3182 showed
no fluorescence with preimmune serum as a probe (Fig. 3-11;
Table 3-3), and the aggregates could be seen unstained in
epidermal tissue. Likewise, tissues of watermelon infected
with ZYMV-RU and healthy watermelon (mock-inoculated) were
negative for fluorescence with both antiserum to the PI of
ZYMV-FL/AT and preimmune sera. As with the ZYMV-FL/AT,
ZYMV-SV, and FC-3182, aggregates of PI like those seen in

82
fluorescence tests could be seen in ZYMV-RU infected
tissues, although the aggregates did not fluoresce (Fig. 3-
12). Mock-inoculated watermelon tissues showed no
fluorescence when stained with either immune (Fig. 3-13) or
preimmune serum.
Tissues of ZYMV-FL/AT, ZYMV-SV, ZYMV-RU, FC-3182, and
mock-inoculated watermelon were also tested in
immunofluorescence studies using antiserum to the PI of
ZYMV-RU. Only watermelon tissue infected with ZYMV-RU or
FC-3182 showed the particulate fluorescing aggregates,
whereas ZYMV-FL/AT, -SV, and mock-inoculated tissues showed
no fluorescing aggregates (Table 3-3). Although aggregates
were seen in ZYMV-FL/AT and in ZYMV-SV infected tissues,
they did not fluoresce.
Serological Studies of Synthetic Peptides to PI and P3 of
ZYMV
Antisera to the N-terminal 12 amino acids of PI and P3
were used in SDS-immunodiffusion, ELISA, dot-immunoblots,
and immunoblotting assays. None of the antisera, whether to
the conjugated peptide or to the free peptide, reacted with
any detectable protein product from ZYMV-infected plant
tissues.

83
Fig. 3-10. Localization of PI in epidermal tissue from
stems of watermelon infected with ZYMV-FL/AT. Antiserum to
the PI of ZYMV-FL/AT (rabbit no. 1181, collection date 3-17-
92)was used as the detecting antibody, and tissues were
stained with Rhodamine-protein A and photographed with
epifluorescence optics. Note the specific fluorescence of
granular aggregates. Magnification =1,714 X. A, tissue
photographed with epifluorescence optics; B, same field of
view photographed with visible light.

84
Fig. 3-11. Epidermal strips of watermelon tissue infected
with ZYMV-FL/AT treated with preimmune serum, stained with
Rhodamine protein A. Magnification =1714 X. A, tissue
photographed with epifluorescence optics; B, same field of
view photographed with visible light.

85
B
Fig. 3-12. Aggregates of PI protein in watermelon stem
epidermal tissue infected with ZYMV-RU treated with
antiserum to the PI of ZYMV-FL/AT (1181, collection date 3-
17-92), stained with Rhodamine-protein A. Note granular
aggregates are clearly visible, but do not fluoresce.
Magnification =1714 X. A, tissue photographed with
epifluorescence optics; B, same field of view photographed
with visible light.

86
Fig. 3-13. Epidermal strips from mock-inoculated watermelon
tissue treated with antiserum to the PI of ZYMV-FL/AT (1181)
and stained with Rhodamine-protein A. Note absence of
fluorescent granular bodies. Magnification =1714 X.

87
Table 3-3. Summary of reactions of antisera to the Pi
of ZYMV-FL/AT and ZYMV-RU in immunofluorescence tests.
Reactivitya
b Antiserum to Antiserum to Preimmune
Isolate Pi Of ZYMV-FL/AT Pi of ZYMV-RU apmm
ZYMV-FL/AT + -
ZYMV-SV + -
ZYMV-RU - + -
FC-3182 + + -
Mock - -
a
Reactivity determined as positive (+) by the
presence of yellow, fluorescent aggregates in plant
cells. Lack of reactivity (-) determined by absence
of fluorescent aggregates.
b
The isolates indicated were inoculated to watermelon
plants.
Mock=mock-inoculated control plants.

88
Discussion
As was demonstrated in Chapter 2 for five ZYMV
isolates, variability exists in the PI nt and deduced amino
acid sequences. Results from serological assays in
immunoblots are in agreement with the sequence data. For
example, the larger size seen in the nt and amino acid
sequence of ZYMV-MD is reflected in the larger size of the
PI protein observed in western blots. The slightly smaller
size of the PI from ZYMV-SV in western blots was also
reflected in a slightly smaller size of its respective gene
in PCR analysis. The amino acids differences, reflecting
different charges and polarities, may also influence the
migration of PI in SDS-PAGE.
Among the ZYMV isolates in this study, heterogeneity in
the size of PI was seen, as well as the presence of
degradation products and differences in the capacity to
fully process the cleavage site between PI and HC/Pro. The
size differences seen between ZYMV-FL/AT, ZYMV-SV, and ZYMV-
MD PI proteins were consistent regardless of the percent
acrylamide, or of the plant host infected. The low nt (60%)
and amino acid (70%) sequence homology between PI of ZYMV-RU
and ZYMV-FL/AT is reflected in the weak reactivity of the
ZYMV-RU isolate in western blots when tested against
antiserum to the PI of ZYMV-FL/AT.

89
The PI antiserum produced to ZYMV-FL/AT was specific
for ZYMV. It neither reacted with extracts from plants
infected singly with any of several other viruses that
infect cucurbits, nor with extracts from noninfected
cucurbit tissues. The ZYMV-FL/AT PI antiserum precipitated
a product of the predicted mw (ca. 34kDa) for PI from WG
translation products, with a smaller product of ca. 25-kDa.
The small product may correspond to a similar sized product
from infected tissue extracts seen in western blots.
Antiserum to P3 of ZYMV-FL/AT was not produced due to
the toxicity of P3 to E. coli which precluded its production
in vitro. Toxicity of P3 in E. coli has been reported with
two other potyviruses (V. Doljas, E. Rodriguez-Cerezo,
personal comm.). It was indicated by Rodriguez-Cerezo and
Shaw (1991) that two regions on the P3 protein of TVMV were
possible membrane spanning regions. These regions may
somehow be involved in the toxicity of P3 to E. coli.
Antiserum to the PI of ZYMV-FL/AT distinguished
differences among ZYMV isolates. These differences were
reflected in size variation in the PI protein, possible
breakdown products for some isolates, and incompletely
processed polyprotein. Antiserum to the PI of ZYMV-RU also
showed differences in the size variation of the PI protein
like that seen with antiserum to the PI of ZYMV-FL/AT.
Antiserum to the PI of ZYMV-RU also detected antigenic
differences in western blots by lack of reactivity with some

90
ZYMV isolates. The ZYMV-RU PI antiserum (rabbit no. 1186,
collection date 6-10-92) reacted with 16 of 22 ZYMV isolates
tested. This lack of reactivity seen may be due to titer
differences between isolates, to limited sequence
homologies, or differences in extractability of the PI
protein among isolates.
Immunofluorescence tests indicate that aggregation
occurs with the PI protein in infected plant tissues. This
is shown by fluorescing aggregates in epidermal tissues from
infected watermelon when treated with homologous PI
antisera. Pumpkin tissues were used in preliminary tests,
but watermelon was a better host for sampling of epidermal
strips. The antisera to PI of ZYMV-FL/AT reacted with its
respective isolate and with ZYMV-SV, but not with ZYMV-RU.
Antiserum to PI of ZYMV-RU reacted with its homologous
antigen but not with ZYMV-FL/AT or with ZYMV-SV, in
agreement with western blot analyses. Both the ZYMV-FL/AT
PI and ZYMV-RU PI antisera reacted with FC-3182. This
isolate also reacted strongly to both PI antisera in western
blots. Thus, isolate FC-3182 must have epitopes in common
with both PI from ZYMV-FL/AT and ZYMV-RU.

CHAPTER 4
SUMMARY AND CONCLUSIONS
Clones representing all portions of the ZYMV genome
were obtained by the combined use of oligo dT primers,
random primers, and a primer corresponding to the Cl region
of the genome. The nt seguences for the PI of five ZYMV
isolates were compared, three of which were sequenced in
this study. A high nt and deduced amino acid homology was
seen between four ZYMV isolates, including three from
Florida and one from California. However, an isolate from
Reunion Island had a low (60%) nt homology compared to the
other ZYMV isolates from Florida and California. In
contrast, the AI and P3 of ZYMV-RU had 84-88% nt sequence
homologies compared to ZYMV-FL and ZYMV-CA. In addition,
the sequence of the CP of ZYMV-RU is 88% similar to that of
ZYMV-CA (Baker et al., 1991b). According to the criteria
set forth by Shukla et al. (1991) the nt sequence homology
of PI from ZYMV-RU compared to the PI of other ZYMV isolates
(60%) classify it as a distinct potyvirus, while the
sequence homologies of other regions of the ZYMV-RU genome
(<90%) are not quite as high as that expected to be
considered an isolate of the same virus.
91

92
The additional 18 nts in the 5'-terminus of the PI gene
of ZYMV-MD, coding for six additional amino acids, would
account for the slightly larger size of the PI PCR product
seen for the ZYMV-MD isolate in agarose gels. This also
accounts in part for the larger size of ZYMV-MD seen in
western blots using antiserum to PI of ZYMV-FL/AT.
Nucleotide sequence homologies between the PI of ZYMV-
FL/AT and other potyviruses including TEV, PVYN, TVMV, PPV,
and PSbMV ranged from 37% to 42%. These homologies also
were lower than those for the AI (50-52%) and P3 (43-45%)
compared to ZYMV-FL/AT. These data are in agreement with
Shukla et al. (1991) in that the percent homology between
distinct potyviruses is low, and that PI is less conserved
than the AI or P3 encoding region.
The N-termini of PI proteins of the five ZYMV isolates
in this study were less conserved than their C-termini. The
additional six amino acids of ZYMV-MD were inserted directly
following the methionine. The histidine missing in the
ZYMV-SV is also in the N-terminus. Most of the changes in
amino acids in both ZYMV-MD and ZYMV-SV are also in the N-
termini.
The two amino acid residues in the C-terminus of PI
determined by Verchot et al. (1991) to be essential for
protease activity are conserved in all ZYMV isolates in this
study. The Tyr/Ser cleavage sites between PI and HC/Pro are
also conserved among the ZYMV isolates. Although the

93
consensus sequence, Leu-Val-Ile-Arg-Gly, was the same for
all ZYMV isolates, it was slightly different from that
published for 5 distinct potyviruses (Verchot et al., 1991).
The PI proteins for both ZYMV-FL/AT and ZYMV-RU
expressed from E. coli were insoluble, and thus were easily
purified for antibody production. The P3 protein of ZYMV-
FL/AT, however, was apparently toxic to E. coli in two
different expression systems and thus was not produced in
this study.
Antiserum specific to PI of ZYMV-FL/AT reacted in
western blots with all ZYMV isolates examined in this study,
although the ZYMV-RU isolate either reacted weakly or gave
no detectable reaction. According to the nt sequence, the
PI region of the ZYMV-RU genome is only 60% similar to that
of ZYMV-FL/AT, with a 70% amino acid similarity. This may
account for the low level of reactivity in western blots and
lack of reactivity in immunofluorescence tests. Nucleotide
and amino acid heterogeneity was seen among the PI of five
ZYMV isolates. Heterogeneity was also observed in western
blots among the PI proteins of 22 ZYMV isolates tested
against ZYMV-FL/AT PI antiserum. There were differences in
the size of the PI protein produced, in the presence of
breakdown products, and in the incomplete processing of the
PI and HC/Pro polyprotein.
The antiserum to the PI of ZYMV-FL/AT did not react
with extracts from plants infected individually with three

94
other potyviruses, one cucumovirus, or one potexvirus.
Antiserum to the PI of ZYMV-RU did not react in western
blots with the three potyviruses, or with the potexvirus,
but was not tested against CMV.
The specificity seen for the ZYMV-FL/AT PI antiserum in
western blots was also seen in indirect immunofluoresence
tests in epidermal strips from watermelon. The PI antiserum
reacted with ZYMV-FL/AT, and ZYMV-SV, but not with ZYMV-RU
or with healthy (mock inoculated) watermelon tissues. The
lack of reactivity of antiserum to ZYMV-FL/AT PI protein
with ZYMV-RU infected tissues in immunofluorescence is not
surprising due to the weak reactivity seen in western blots
and to the limited sequence homology between these two
isolates. Immunofluorescence tests using antiserum to the
PI of ZYMV-RU showed reactivity with ZYMV-RU but not with
ZYMV-FL/AT or ZYMV-SV. These results are reflected in the
lack of reactivity seen with these isolates in western blots
using antiserum to ZYMV-RU PI as a probe. The FC-3182
isolate, which reacted with the antisera to both ZYMV-FL/AT
and ZYMV-RU PI in western blots, likewise reacted with both
antisera in immunofluorescence tests, indicating the
presence of shared epitopes among the PI of ZYMV-FL/AT,
ZYMV-RU, and FC-3182 isolates. The PI proteins of ZYMV-
FL/AT, ZYMV-SV, ZYMV-RU, and FC-3182 were detected in
infected tissue with the immune serum as amorphous,
particulate aggregates in the cytoplasm. Further analysis

95
by electron microscopy is needed to determine the precise
morphology of the aggregates and their possible association
with other viral proteins or with host components.
The antisera developed in this study have been useful
for detecting variability of ZYMV isolates by
immunoblotting. Antiserum to the PI of ZYMV-FL/AT was
specific to ZYMV isolates, and showed that there are
differences in the size of PI proteins and occurrence of
related products among isolates. The antiserum to PI of
ZYMV-RU showed differential reactivity to certain isolates
of ZYMV, indicating possible antigenic differences among
ZYMV isolates, differences in titer among isolates, or
differences in extractability among ZYMV isolates.
The PI amino acid sequence showed heterogeneity among
ZYMV isolates in this study, with the N-terminus being less
conserved than the C-terminus. These traits are noted for
other potyviruses (Verchot et al., 1991), supporting the
speculation that PI may be associated with virus-host
interactions. This may be true in particular for the N-
terminus of PI which is more variable than the C-terminus.
Further studies to elucidate this possible involvement of PI
in host response might involve the use of full length
infectious transcripts. With these transcripts the PI from
different isolates could be interchanged to determine the
possible effects on the host response. Alternatively,
mutants in the PI region could be used for this purpose.

96
Because there is considerable biological variation available
in naturally occurring ZYMV isolates, the former study may
be more meaningful.
Further studies on P3 should include cloning portions
of the protein separately to avoid the possibility of
cloning toxic regions which may disrupt the bacterial cell
processes. The P3 is also an interesting protein for study,
since little is known about its function.

APPENDIX
MONOCLONAL ANTIBODIES TO THE CAPSID PROTEIN
OF ZUCCHINI YELLOW MOSAIC VIRUS
Introduction
Researchers at the University of Florida, the Volcani
Center in Israel, and at the USDA in Orlando, Florida, have
been coordinating efforts on potyviruses which infect the
Cucurbitaceae. These studies involve comparison and
distinction of isolates using differential plant hosts,
development of polyclonal antisera used in immunodiffusion
and ELISA tests, in vitro translational studies, aphid
transmission, characterization of nonstructural proteins,
and development of monoclonal antibodies (MAbs). As an
early part of the research for the present study, several
MAbs to the capsid protein (CP) of ZYMV were evaluated for
their ability to distinguish and differentiate isolates of
ZYMV. One MAb to watermelon mosaic virus-2 (WMV-2) was also
evaluated for its diagnostic potential for WMV-2 isolates.
Two MAbs to papaya ringspot virus-type W (PRSV-W) obtained
in another study (Baker et al., 1991a) were combined and
evaluated for their diagnostic potential along with the MAbs
to ZYMV and WMV-2. The following materials and methods
97

detail procedures to develop and evaluate MAbs to ZYMV and
WMV-2.
98
Materials and Methods
Immunization Protocol
In all cases, four Balb/c mice were immunized on day
one with a subcutaneous (SC) injection of 50 /^g purified
virus in 0.5 ml distilled water, emulsified in an equal
volume of Freund's complete adjuvant (FCA). The subsequent
injections, except for the final one, also 50 jug, were
administered intraperitoneally (IP), emulsified in an equal
volume of Freund's incomplete adjuvant (FIA). One mouse was
selected for a fusion based on results from a test bleeding.
It was immunized with 25 ¿¿g in 0.5 ml water without adjuvant
directly into the tail vein (intravenous, IV). If the
entire volume could not be injected into the tail vein the
remainder was injected IP. Three to five days after the IV
injection the mouse was sacrificed for a fusion.
Two additional immunization protocols were used in this
study. One will be referred to as in vivo immunization and
involved the protocol described above. An additional in
vitro fusion protocol was used as outlined by Boss (1986),
Weigers et al., (1986), and S. Zam (personal comm.). Two
mice were either previously immunized as described above or
not previously immunized. In either case the final

99
immunization was administered to the two combined excised
spleens in culture on the day the mice were sacrificed.
This iri vitro boost consisted of 25 nq antigen and 20 [iq/ml
of the adjuvant N-acetyl muramyl L-alanyl-D-isoglutamine
(Sigma Chemical Co., St. Louis, MO). The fusion was
performed three to five days later.
The immunization schedule for a poorly aphid
transmissible (PAT) isolate of ZYMV involved injections on
day one, 21, and 28, followed by a fusion on day 31. For an
aphid-transmissible isolate of ZYMV from Florida (ZYMV-
FL/AT), mice were immunized individually with both whole
virus or capsid protein (CP). The immunization schedules
for the ZYMV-FL/AT isolate preparations were: day one, day
30, day 37, (IV, IP, or an immunization in vitro). with the
fusion on day 40. The immunization schedule which was
effective in production of MAbs for WMV-2 (isolate FC-1656)
was: day one, day 21, day 83, day 147, day 167 (IV and IP),
with the fusion on day 170.
Fusion Protocol
The fusion procedures followed are similar to those
outlined by Galfre and Milstein (1981). The mouse was
sacrificed by placing it in a closed container with a small
piece of dry ice for approximately 30 sec, and the spleen
was excised and gently mashed through an 80-mesh sieve, and
placed in 5 ml of serum-free Dulbecco's modified eagle
medium (DMEM, Gibco Laboratories, Grand Island, NY). The

100
SP2/0 myeloma cell line, obtained from the University of
Florida Hybridoma Laboratory and used as the fusion partner,
was maintained in a logarithmic growth phase in DMEM-F,
supplemented with 10% fetal calf serum, 1 mM L-glutamine, 1%
penicillin/streptomycin, and 0.001 mg/ml amphotericin B
(fungizone, Sigma Chemical Co., St. Louis, MO). Both the
spleen cells and the SP2/0 cells were washed twice by
centrifugation at 2,000 X g for 7 min in serum free DM EM,
and were combined at a ratio of one part SP2/0 cells to two
parts spleen cells, respectively. They were centrifuged
together a final time and were resuspended in 50% PEG [mw
1500, in 75 mM HEPES (pH 8.0)] over a period of 15 sec. The
cell suspension was swirled in a 37 C water bath for 30 sec,
and incubated for 90 sec at 37 C. One ml of serum-free DMEM
was then added over 30 sec, swirled 30 sec, followed by the
addition of 10 ml DMEM over 30 sec and incubation for 5 min
in a 37 C water bath. The solution was then centrifuged and
the pellet resuspended in HAT selective media containing 20%
fetal calf serum to give a final concentration of 5 X 108
cells/ml. The HAT medium contained DMEM-F with 20% fetal
calf serum and 1 ml HAT/50 ml of media (5 mM hypoxanthine,
0.02 mM aminopterin, 0.8 mM thymidine, Sigma Chemical Co.,
St. Louis, MO). These samples were plated out at 100
/il/well in 96-well plates, and placed in a 37 C incubator
with an atmosphere of 6% C02 and 90% humidity. Cultures
were fed with 50 /i.1/well of HT medium (DMEM-F with

101
hypoxanthine and thymidine, but without aminopterin) 7 days
after fusion and then screened serologically for antibody
production as colonies developed.
Screening Procedures
All hybridoma cultures were screened against their
homologous virus in both an antibody-trapped and plate-
trapped indirect enzyme linked immunosorbent assay (ELISA)
(Halk, 1986), using purified virus and extracts from both
healthy and infected Cucúrbita pepo L. 'Small Sugar' pumpkin
tissue. The antibody-trapped indirect ELISA consisted of
the following steps: (1) rabbit antiserum to ZYMV at 1/1000
dilution in coating buffer, pH 9.6, was placed in Immulon II
microtiter plates (Dynatech Laboratories Inc., Chantilly,
VA) at 75 or 100 /¿1 per well. Plates were incubated at 4 C
overnight or at 37 C for 1 hr. Each step was followed by
three 5 min washes in 0.1 M phosphate buffered saline (PBS),
pH 7.4, with 0.5% Tween-20 (PBST); (2) antigen was added at
50 or 75 /¿1/well, diluted in PBST at 1/1000 dilution (pure
virus) or 1/10 (one part plant tissue triturated in nine
parts PBS triturated in a mortar and pestle, and expressed
through cheesecloth). Incubation was at 37 C for 1 hr; (3)
MAb tissue culture supernate or ascites was diluted
appropriately and added at 50 /¿1/well, and incubated at 37 C
for 1 hr; (4) the enzyme conjugate, goat anti-mouse IgG and
IgM alkaline phosphatase was added at 1/1000 dilution each
in conjugate buffer (PBST with 2% PVP-40 and 0.2% ovalbumin)

102
at 50 fig/well, at 37 C, for 1 hr; (5) The substrate, p-
nitrophenylphosphate (PNPP, Sigma Chemical Co., St. Louis,
MO) was added at 1 mg/ml using 50 m1/well. Plates were read
with a Biotek automated microplate reader EL309 (Bio-Tek
Instr., Winooski, VT) every 15 min as reactions developed.
The plate-trapped indirect ELISA consisted of the same steps
as above, omitting the first step and with the antigen
dilutions made in coating buffer. Ascites were usually
diluted 1/1000 to 1/10,000 in PBS, and tissue culture
supernates were diluted at 1/100 to 1/1000 depending on the
reactivity of the clone.
Two MAbs to PRSV-W, which in combination reacted with
15 PRSV-W isolates, were kindly provided by C.A. Baker.
Cloning and Ascites Production
The most promising cell lines were selected for
cloning, increased in large volumes, and used for ascites
production. Each culture was cloned two to three times by
limiting dilution. Isotyping was done by using a Zymed
Monoclonal antibody ID kit (Zymed Lab Inc., San Francisco,
CA). Ascites were produced by injecting at least 1 X 106
cells into Balb/c mice which had been primed 10-14 days
earlier with pristane (0.5 ml, IP). Ascites were collected
from five days to three weeks later using an 18-gauge
needle, and clarified by centrifugation.

103
Results
ZYMV-specific MAbs to the CP and whole virus were
obtained from the PAT and AT isolates. One MAb of WMV-2 was
selected for serological analysis of WMV-2 isolates.
Reactions in ELISA were considered positive if the
absorbance at 405 nm was three times the healthy reading and
greater than 0.1.
One MAb to ZYMV, MAb-Zl, reacted with extracts from
plants infected with all 15 ZYMV isolates tested (10 from
Florida, three from France, one from Italy, and one from
Reunion Island) (Fig. 1). Reactions to the Reunion Island
isolate were usually low in absorbance value (A405 less than
0.5). MAb-Zl did not react with extracts from noninoculated
pumpkin, or with those from PRSV-W, WMV-2, a distinct
cucurbit potyvirus (2932), or cucumber mosaic virus (CMV)
(Fig. 1). The MAb-Zl (clonal designation BB2-A2-D4) was
derived from the PAT isolate of ZYMV and only reacted in
antibody-trapped indirect ELISA tests, but not in plate-
trapped ELISA tests.
MAb—Z2 (clonal designation AG7-D6-C6) was derived from
the AT isolate of ZYMV and reacted in both antibody-trapped
and plate-trapped ELISA (Fig. 2). This MAb reacted with
neither extracts from noninoculated plants, nor with
extracts from plants infected with PRSV-W, WMV-2, cucurbit
potyvirus FC-2932, or CMV.

104
MAb-Z3 (clonal designation AD4-H11-D10), made to the CP
of the AT isolate of ZYMV also reacted in both antibody and
plate-trapped ELISA, and often very weakly to the Reunion
Island isolate (Fig. 3). Weakly positive reactions to PRSV-
W were seen. In plate-trapped ELISA this MAB reacted very
weakly or not at all with the ZYMV-SV isolate from Florida.
MAb-Z4 (clonal designation DA3-B7-D4), derived from the
CP of the AT isolate of ZYMV, reacted well in both antibody-
trapped and plate-trapped ELISA (Fig. 4). This MAb also
reacted to WMV-2 and CMV at low levels (0.167 and 0.303,
respectively). These reactions are considered borderline
between positive and negative, as often seen with some MAbs.
Absorbance readings could be considered positive only if the
reaction was allowed to proceed over approximately three
hours.
MAb-Z5 (clonal designation BE7-F9-E10) made to the AT
isolate of ZYMV was similar to MAb-Z4, in that both reacted
in antibody- and plate-trapped ELISA, and both produced
weakly positive absorbance readings to WMV-2 and CMV (Fig.
5) •
MAB-Z6 (clonal designation FD5-B7-G6) was produced to
the AT isolate of ZYMV and reacted in both types of ELISA
tests (Fig. 6). Reactions to the Reunion Island isolate
were usually weak, but this was also variable, and could
sometimes be considered positive. This MAb also gave low,
but slightly positive readings with WMV-2 and CMV.

105
MAb-W (clonal designation FD1-B5-B5) to WMV-2 reacted
specifically in antibody-trapped ELISA to WMV-2 isolates
including 14 from Florida, two from California, and one each
from New York and New Zealand (Fig. 7). A distinction was
made, however, between two sources of the ATCC isolate of
WMV-2. Both sources, PV-27 and PV-27/V619 presumably came
from the same original accession, except the latter was
obtained several years earlier and was maintained in
greenhouse culture in Florida in C. pepo. All WMV-2
isolates reacted with polyclonal anti-WMV-2 sera in indirect
ELISA and immunodiffusion. MAB-W did not react with any
ZYMV or PRSV-W isolate.
MAbs-1, -2, -3, and -4 were all of the IgM isotype.
MAbs -5 and -6 were of the IgGl isotype. MAb-W was the IgGl
isotype. All MAbs were of the kappa light chain subclass.
Polyclonal antisera to ZYMV reacted with all isolates
in plate-trapped ELISA and also cross-reacted with PRSV-W
(A^05 of 0.871), WMV-2 (0.251), and cucurbit potyvirus FC-
2932 (0.314) (Fig. 8). This antiserum did not cross-react
with CMV or with noninfected tissue extracts. Conditioned
medium and ascites from nonimmunized mice did not react with
any virus isolate and reactions in both types of ELISA tests
were less than 0.10.
Two MAbs to PRSV-W were used in combination to detect
17 PRSV isolates in both ELISA tests. These isolates
included 15 from Florida, one each from New York,

106
California, Jordan, and Greece, the ATCC, one isolate of
PRSV-T (Tigre), and one isolate of PRSV-P (papaya). These
MAbs did not react with any WMV-2 or ZYMV isolate.
MAb-Zl, MAb-W, and the combined PRSV-W MAbs were
evaluated together for their diagnostic potential. Three
isolates of each virus were tested against a MAb to ZYMV, a
MAb to WMV-2, and to the combination of two MAbs to PRSV-W
(Fig. 9). There was no cross-reactivity between the three
viruses and their respective antibodies, and no reactivity
with CMV, zucchini yellow fleck virus (ZYFV), or with tissue
extracts from noninoculated pumpkin.
Discussion
The MAb-Zl used in antibody-trapped indirect ELISA
detected all ZYMV isolates tested. A low absorbance reading
was often seen with the Reunion Island isolate. This MAb
may have a low affinity for that particular isolate, and
this may be the explanation for some of the low readings
consistently seen.
The MAb to WMV-2 also has value for diagnosis of WMV-2
isolates. It reacted with 19 of 20 WMV-2 isolates in
antibody-trapped ELISA.
Although the two MAbs to PRSV-W individually were
selective to particular PRSV-W isolates, in combination they
reacted with all PRSV-W isolates tested.

107
Four MAbs, one to ZYMV, one to WMV-2, and two to PRSV-W
in combination, were effective in detection of the three
respective viruses of cucurbits. Together, these viruses
represent major problems to the production of cucurbits
wherever they are grown. These experiments show a
diagnostic potential of MAbs after thorough screening in
ELISA against a variety of virus isolates from several
different areas of cucurbit production.

Virus Isolates
108
MAb-Zl
ZYMV-FL/AT
ZYMV-MD
2000
2050
ZYMV-SV
2154
2208
2357
2537
81-25
PAT
weak
E15
Italy
ZYMV-RU
healthy
PRSV-W
WMV-2
2932
CMV
0 12 3
Absorbance (405nm)
Fig.l. Reactivity of MAb-Zl (BB2-A2-D4) to 15 ZYMV
isolates and four cucurbit viruses in antibody-trapped
indirect ELISA (ab-trap). Absorbance readings (405 nm)
were taken three hrs after substrate addition and are
an average of two wells. MAb-Zl did not react in
plate-trapped indirect ELISA.

Virus Isolates
109
MAb-Z2
ZYMV-FL/AT
ZYMV-MD
2000
2050
ZYMV-SV
2154
2208
2357
2537
81-25
PAT
weak
E15
Italy
ZYMV-RÜ
healthy
PRSV-W
WMV-2
2932
CMV
0.0 0.2 0.4 0.6 0.8 1.0 1.2
Absorbance (405 nm)
/////////////////
ab-trap
j positive
â–¡ negative
plate-trap
Q positive
V¡\ negative
Fig.2. Reactivity of MAb-Z2 (AG7-D6-C6) to 15 ZYMV
isolates and four cucurbit viruses in antibody-and
plate-trapped ELISA. Absorbance readings (405 nm)
were taken three hrs after substrate addition and
are an average of two wells.

110
MAb-Z3
w
Q)
4J
iH
O
CQ
H
CQ
3
u
â– H
>
WMV-2 ^
2932 J
CMV 2
ab-trap
^ positive
â–¡ negative
plate-trap
EB positive
0 negative
0
Absorbance (405 nm)
Fig. 3. Reactivity of monoclonal antibody MAb-Z3
(AD4-H11-D10) in antibody-trapped (ab-trap) and
plate-trapped ELISA. Readings were taken three hrs
after substrate was added and are an average of two
wells.

Virus Isolates
ni
MAb-Z4
ZYMV-FL/AT
ZYMV-MD
healthy ej
PRSV-W0
WMV-2
2932
CMV
I
^Z2ZZZ
ab-trap
g| positive
â–¡ negative
plate-trap
03 positive
Y7X negative
0
Absorbance (405 nm)
Fig. 4. Reactivity of MAb-Z4 (DA3-B7-D4) in antibody-
and plate-trapped indirect ELISA to 15 ZYMV isolates.
Absorbance readings (405 nm) were taken three hrs after
substrate addition and are an average of two wells.

112
MAb-Z5
co
0)
4J
(Ü
rH
0
co
H
CQ
3
â– H
>
El5
Italy®
.wwwwwww.
ZYMV-R
healthy^
PRSV-W0
WMV-2
2932b
CMVÃœsig
ab-trap
positive
â–¡ negative
plate-trap
El positive
^ negative
0
Absorbance (405 nm)
Fig. 5. Reactivity of MAb-Z5 (BE7-F9-E10) in antibody-
and plate-trapped indirect ELISA to 15 ZYMV isolates.
Absorbance readings (405 nm) were taken three hrs after
substrate addition and are an average of two wells.

113
MAb-Z6
m
<1>
4J
ÍÜ
rH
o
CO
H
CQ
3
U
â– H
>
healthyb
PRSV-W^a
WMV-2
2932 P
cmv Sfcsss
ab-trap
M positive
â–¡ negative
plate-trap
^ positive
E2 negative
0
Absorbance (405 nm)
Fig. 6. Reactivity of MAb-Z5 (FD5-B7-G6) in antibody-
and plate-trapped indirect ELISA to 15 ZYMV isolates.
Absorbance readings (405 nm) were taken three hrs after
substrate addition and are an average of two wells.

Virus Isolates
114
MAb-W
1656
2005
2159
2235
2295
2315
2325
2328
2390
2400
2421
2567
628
8666
California
Calif.(Webb)
New York
New Zealand
ATCC PV-27 â– 
ATCC-V-619 â–¡
healthy H
ab-trap
g positive
â–¡ negative
plate-trap
BSB positive
E2J negative
0
Absorbance (405 nm)
Fig. 7. Reactivity of monoclonal antibody MAb-W (FD1-B5-B5)
to 20 isolates of WMV-2 in antibody-trapped indirect ELISA.
Only one isolate of WMV-2, derived from an ATCC isolate, did
not react with the antibody. Readings were taken three hrs
after substrate addition and are an average of 2 wells.
MAb-W did not react in plate-trapped indirect ELISA.

Virus Isolates
115
Polyclonal
antiserum
ZYMV-FL/AT
ZYMV-MD
2000
2050
ZYMV-SV
2154
2208
2357
2537
8125
PAT
weak
E15
Italy
ZYMV-RU,
healthy^
PRSV-W
WMV-2
2932
CMV
W/////////////Z,
'/yy/yyyyyzyyyyyyyz/zyy/y/yzy/yyzyzyyy/yyzy/zzyyyy/z/zyzyzz
wyzyzzzyyzyzzyyyyyyyyyzyyzyzzzyyzyyyyyy/yyyyyyyyyyyyzzzy
zyyyzyzyzzyzyyzzzzzzzzzmzymzzzzzyz
y//Z'yzz/zyy/zzyyzyy/ZZ/yyZ'/Zzy/yyy/Z'Zyyzzy//Z/yy
yyyyzy/zy/yyyyyzyyzyyyzyy yyy/yy/zzyz/yyyyzyzyyyyzzzzzyyyyyyzyyzzyy/yzyy/z':
yyyyyyyyyyyyyyyyyzyy/yyyyyyyyyyyyyyyyyyzzzz/yyyyyzmzyy/y
zyyyyyyyyyyyyyyyyyyyyyyyzzyyyyz
yyy/zyyzzzzyzzyzyzzzyzyyzzzyyzyzzzyyzyzzzzyyyyyzyyyyyyzzzzz
'yyyyzyy/yyyyyzzzzyy///zz:
vzzzyyyyyyyyyyzzyyyyyyyyzyyyyyyyyyzyyzyyyyyyyyy/y/
zyyyy/yzyzyy///yzyyyzz//zyy
W////A
yyyyyzz/z
a_b-trap
^ positive
â–¡ negative
plate-trap
Q positive
^ negative
0
Absorbance (405 nm)
Fig. 8. Reactivity of polyclonal antiserum to the capsid
protein of ZYMV (rabbit no. 1028) with ZYMV isolates and
other cucurbit viruses in plate-trapped indirect ELISA.
Note cross-reactivity with PRSV-W, WMV-2, and a distinct
potyvirus, 2932. Conditioned medium and ascites from
nonimmunized mice gave absorbance readings (A 405 nm) of
less than 1.0 for all isolates in both antibody- and
plate-trapped indirect ELISA (data not shown). This
antiserum was not used in antibody-trapped indirect ELISA.

116
Absorbance (405 nm)
Fig. 9. Antibody-trapped indirect ELISA for diagnosis
of ZYMV, WMV-2, and PRSV-W. Monoclonal antibodies used
are MAB-Zl to ZYMV (BB2-A2-D4), MAb-W to WMV-2 (FD1-B5-B5),
and a combination of two monoclonals to PRSV-W (F3C-C10 and
F21C-E4). Readings were taken after three hrs after
substrate addition and are an average of 2 wells.

REFERENCE LIST
Adlerz, W.C., Purcifull, D.E., Simone, G.W., and Hiebert, E.
1983. Zucchini yellow mosaic virus: A pathogen of squash
and other cucurbits in Florida. Proc. Fla. State Hort. Soc.
96:72-74.
Al-Musa, A.M. 1989. Severe mosaic caused by zucchini yellow
mosaic virus in cucurbits in Jordan. Plant Pathology 38:541-
546.
Allison, R.F., Johnston, R.E., and Dougherty, W.G. 1986. The
nucleotide sequence of the coding region of tobacco etch
virus genomic RNA: evidence for the synthesis of a
polyprotein. Virology 154:161-165.
Antignus, Y., Raccah, B. Gal-On, A., Cohen, S. 1989.
Biological and serological characterization of ZYMV and WMV-
2 isolates in Israel. Phytoparasitica 17:289-298.
Atreya, C.D., Raccah, B., and Pirone, T.P. 1990. A point
mutation in the coat protein abolishes aphid
transmissibility of a potyvirus. Virology 178:161-165.
Atreya, P.C., Atreya, C.D., and Pirone, T.P. 1991. Amino
acid substitutions in the coat protein result in loss of
insect transmissibility of a plant virus. Proc. Natl. Acad.
Sci. USA. 88:7887-7891.
Baker, C.A., Lecoq, H., and Purcifull, D.E. 1991a.
Serological and biological variability among papaya ringspot
virus type-W isolates in Florida. Phytopathology 81:722-728.
Baker, C.A., Wisler, G.C., Marlow, G.C., Hiebert, E., and
Lecoq, H. 1991b. Sequence analysis at the 5- end of three
cucurbit potyviruses. Phytopathology 81:1222. (Abstr.).
Barnett, O.W. 1991. Potato virus Y group. In Classification
and Nomenclature of Viruses: Fifth Report of the
International Committee on Taxonomy of Viruses. (R.I.B.
Francki, C.M. Fauquet, D.L. Knudsen, and F. Brown), pp. 351-
356. Springer-Verlag, New York.
117

118
Baunoch, D., Das, P., and Hari, V. 1988. Intracellular
localization of TEV capsid and inclusion proteins by
immunogold labelling. J. Ultrastruct. Mol. Struct. Res.
99:203-212.
Bazan, J.F., and Fletterick, R.J. 1988. Viral cysteine
proteases are homologous to the trypsin-like family of
serine proteases: structural and functional implications.
Proc. Natl. Acad. Sci. USA 85:7872-7876.
Berger, P.H., and Pirone, T.P. 1986. The effect of helper
component on the uptake and localization of potyviruses in
Mvzus persicae. Virology 153:256-261.
Blua, M.J. and Perring, T.M. 1989. Effect of zucchini yellow
mosaic virus on development and yield of cantaloupe (Cucumis
melo). Plant Dis. 73:317-320.
Bonner, W.M., and Lasky, R.A. 1974. A film detection method
for tritium labeled proteins and nucleic acids in
polyacrylamide gels. Eur. J. Biochem. 46:83-88.
Boss, B.D. 1986. An improved in vitro immunization procedure
for the production of monoclonal antibodies. Methods in
Enzymology 121:27-33.
Brakke, M.K., and Van Pelt, N. 1970. Linear-log gradient for
estimating sedimentation coefficients of plant viruses and
nucleic acids. Anal. Biochem. 38:56-64.
Bruenn, J.A., 1991. Relationships among the positive strand
and double strand RNA viruses as viewed through the RNA-
dependent RNA polymerases. Nuc. Acids Res. 19:217-225.
Carrington, J.C., and Dougherty, W.G. 1987a. Small nuclear
inclusion protein encoded by a plant potyvirus genome is a
protease. J. Virol. 61:2540-2548.
Carrington, J.C., and Dougherty, W.G. 1987b. Processing of
the tobacco etch virus 49k protease requires
autoproteolysis. Virology 160:355-362.
Carrington, J.C., and Dougherty, W.G. 1988. A viral cleavage
site casette: identification of amino acid sequences
required for tobacco etch virus polyprotein processing.
Proc. Natl. Acad. Sci. USA 85:3391-3395.
Carrington, J.C., Cary, S.M., and Dougherty, W.G. 1988.
Mutational analysis of tobacco etch virus polyprotein
processing: cis and trans proteolytic activities of
polyproteins containing the 49-kilodalton proteinase. J.
Virol. 64:1590-1597.

119
Carrington, J.C., Cary, S.M., Parks, T.D., and Dougherty,
W.G. 1989a. A second proteinase encoded by a plant potyvirus
genome. EMBO J. 8:365-370.
Carrington, J.C., Freed, D.D., and Sanders, T.D. 1989b.
Autocatalytic processing of the potyvirus helper component
proteinase in Escherichia coli and íjq vitro. J. Virol.
63 : 4459-4463.
Carrington, J.C., Freed, D.D., and Oh, C.-S. 1990.
Expression of potyvirus polyproteins in transgenic plants
reveals three proteolytic activities reguired for complete
processing. EMBO J. 9:1347-1353.
Chang, C.-A., Hiebert, E., and Purcifull, D.E. 1988.
Analysis of in vitro translation of bean yellow mosaic virus
RNA: inhibition of proteolytic processing by antiserum to
the 49K nuclear inclusion protein. J. Gen. Virol. 69:1117-
1122.
Choi, G.H., Pawlyk, D.M., Nuss, D.L. 1991. The autocatalytic
protease p29 encoded by a hypovirulence-associated virus of
the chestnut blight fungus resembles the potyvirus encoded
protease HC-Pro. Virology 183:747-752.
Cline, K., Werner-Washburne, M., Lubben, T.H., and Keegstra,
K. 1985. Precursors to two nuclear-encoded chloroplast
proteins bind to the outer envelope membrane before being
imported into chloroplasts. J. Biol. Chem. 260:3691-3696.
Cohen, S. 1986. Outbreaks of zucchini yellow mosaic virus on
cucurbits in Israel. Phytoparasitica 14:148 (Abstr.).
Davis, R.F. 1986. Partial characterization of zucchini
yellow mosaic virus isolated from squash in Turkey. Plant
Dis. 70:735-738.
Davis, R.F., and Mizuki, M.K. 1986. Seed transmission of
zucchini yellow mosaic in squash. Phytopathology 76:1073.
Davis, R.F., and Yilmaz, M.A. 1984. Serological
relationships and host range properties of ZYMV and WMV-2
isolates. Phytopathology 74:848. (Abstr.).
de Mejia, M.V.G., Hiebert, E., and Purcifull, D.E. 1985a.
Isolation and partial characterization of the amorphous
cytoplasmic inclusions associated with infections caused by
two potyviruses. Virology 142:24-33.
de Mejia, M.V.G., Hiebert, E., Purcifull, D.E., Thornbury,
D.W., and Pirone, T.P. 1985b. Identification of potyviral
amorphous inclusion protein as a non-structural virus-

specific protein related to helper component. Virology
142:34-43.
120
Domier, L.L., Franklin, K.M., Shahabuddin, M., Hellmann,
G.M., Overmeyer, J.M., Hiremath, S.T., Siaw, M.F.E.,
Lomonossoff, G.P., Shaw, J.G., and Rhoads, R.E. 1986. The
nucleotide sequence of tobacco vein mottling virus RNA. Nuc.
Acid Res. 14:5417-5430.
Domier, L.L., Shaw, J.G., and Rhoads, R.E. 1987. Potyvirus
proteins share amino acid sequence homology with picorna-,
como-, and caulimoviral proteins. Virology 158:20-27.
Dougherty, W.G., and Carrington, J.C. 1988. Expression and
function of potyviral gene products. Annu. Rev. Phytopathol.
26:123-143.
Dougherty, W.G., and Hiebert, E. 1980. Translation of
potyvirus RNA in a rabbit reticulocyte lysate: Reaction
conditions and identification of capsid protein as one of
the products of in vitro translation of tobacco etch and
pepper mottle viral RNAs. Virology 101:466-474.
Dougherty, W.G., and Parks, T.D. 1989. Molecular genetic
and biochemical evidence for the involvement of the
heptapeptide cleavage sequence in determining the reaction
profile at two tobacco etch virus cleavage sites in cell-
free assay. Virology 172:145-155.
Dougherty, W.G., and Parks, T.D. 1991. Post-translational
processing of the tobacco etch 49-kDa small nuclear
inclusion polyprotein: identification of an internal
cleavage site and delimitation of VPg and proteinase
domains. Virology 183:449-456.
Dougherty, W.G., Carrington, J.C., Cary, S.M., and Parks,
T.D. 1988. Biochemical and mutational analysis of a plant
virus polyprotein cleavage site. EMBO J. 7:1281-1287.
Dougherty, W.G., Cary, S.M., and Parks, T.D. 1989. Molecular
genetic analysis of a plant virus polyprotein cleavage site:
a model. Virology 171:356-364.
Edwardson, J.R. 1974. Some properties of the potato virus Y-
group. Fla. Agrie. Exp. Stn. Monogr. Ser. 4, 225p.
Edwardson, J.R., and Christie, R.G. 1991. The Potyvirus
Group. Fla. Agrie. Exp. Stn. Monogr. 16-1. 1244p.
Galfre, G., and Milstein, C. 1981. Preparation of monoclonal
antibodies: Strategies and procedures. Methods in Enzymol.
73:3-46.

121
Gal-On, A., Antignus, Y., Rosner, A., and Raccah, B. 1990b.
Nucleotide sequence comparisons between zucchini yellow
mosaic virus (ZYMV) strains differing in their
multiplication rate and transmissibility by aphids. Page 468
In: Abstr. Eighth Int. Cong. Virol., Berlin.
Garcia, J.A., Riechmann, J.L., and Lain, S. 1989.
Proteolytic activity of the plum pox potyvirus NIa-like
protein in Escherichia coli. Virology 170:362-369.
Goldbach, R., and Wellink, J. 1988. Evolution of plus-
stranded RNA viruses. Intervirology 29:260-267.
Govier, D.A., and Kassanis, B. 1974. A virus-induced
component of plant sap needed when aphids acquire potato
virus Y from purified preparations. Virology 61:420-426.
Greber, R.S., Persley, D.M., Herrington, M.E. 1988. Some
characteristics of Australian isolates of ZYMV. Aust. J.
Agrie. Res. 39:1085-1094.
Gubler, U., and Hoffman, B.J. 1983. A simple and very
efficient method for generating cDNA libraries. Gene 25:263-
269.
Halk, E.L. 1986. Serotyping plant viruses with monoclonal
antibodies. In Methods in Enzymology (A. Weissbach and H.
Weissbach) 118:pp.766-780. Academic Press, New York.
Hari, V. 1981. The RNA of tobacco etch virus: further
characterization and detection of protein linked to RNA.
Virology 112:391-399.
Harlow, E., and Lane, D. 1988. Antibodies: A Laboratory
Manual. Cold Spring Harbor Laboratoy. Cold Spring Harbor.
NY.
Harrison, B.D., and Robinson, D.J. 1988. Molecular variation
in vector-borne plant viruses: epidemiological
significance. Phil Trans. R. Soc. Lond. B. 321:447-462.
Hedrick, J.L., and Smith, A.J. 1968. Size and charge isomer
separation and estimation of molecular weights of proteins
by disc gel electrophoresis. Archives of Biochem. and
Biophys. 126:155-164.
Hellmann, G.M., Shaw, J.G., and Rhoads, R.E. 1988. In vitro
analysis of tobacco vein mottling virus NIa cistron:
evidence for a virus-encoded protease. Virology 163:554-562.

122
Hiebert, E. , and Dougherty, W.G. 1988. Organization and
expression of the viral genome. Iri The Viruses: Filamentous
Viruses. (R.G. Milne, Ed.), pp.159-178. Plenum, New York.
Hiebert, E., Purcifull, D.E., and Christie, R.G. 1984.
Purification and immunological analysis of plant viral
inclusion bodies. In Methods in Virology, Vol. 8, (K.
Maramorosh and H. Koprowski, Eds.) pp.225-280. Academic
Press, New York.
Hollings, M., and Brunt, A.A. 1981. Potyviruses. In Handbook
of Plant Virus Infections and Comparative Diagnosis. (E.
Kurstak, Ed.), pp 731-807. Elsevier/North Holland Biomedical
Press, Netherlands.
Huang, C.H., Hseu, S.H., and Chao, Y.T. 1986. Purification
and serology of an isolate of zucchini yellow mosaic virus.
J. Agrie. Res. China 35:495-503.
Huynh, T.V., Young, R.A., and Davis, R.W. 1984. Constructing
and screening cDNA libraries in lambda gtlO and lambda gtll.
In: DNA Cloning Techniques: A Practical Approach. (D.
Glover, Ed.), pp.49-78. IRL Press. Oxford, England.
Johansen, E., Rasmussen, O.F., Heide, M., Borkhardt, B.
1991. The complete nucleotide sequence of pea seed-borne
mosaic virus RNA. J. Gen. Virol. 72:2625-2632.
King, A.M.Q. 1987. RNA viruses do it. Trends in Genetics
3:60-61.
Kyte, J., and Doolittle, R.F. 1982. A simple method for
displaying the hydropathic character of a protein. J. Mol
Biol. 157:105-132.
Laemmli, U.K. 1970. Cleavage of structural proteins during
the assembly of the head of bacteriophage T-4. Nature
(London) 227:680-685.
Lain, S., Martin, M.T., Riechmann, J.L., and Garcia, J.A.
1991. Novel catalytic activity associated with positive
strand RNA virus infection: nucleic acid-stimulated ATPase
activity of the plum pox potyvirus helicase like protein. J.
Virol. 65:1-6.
Lain, S., Riechmann, J.L., Mendex, E., and Garcia, J.A.
1988. The complete nucleotide sequence of plum pox potyvirus
RNA. Virus Res. 13:157-172.
Lain, S., Riechmann, J.L., Martin, M.T., and Garcia, J.A.
1989. Homologous potyvirus and flavivirus proteins belonging
to a superfamily of helicase-like proteins. Gene 82:357-362.

123
Lain, S., Riechmann, J.L., and Garcia, J.A. 1990. RNA
helicase: a novel activity associated with a protein
encoded by a positive strand RNA virus. Nuc. Acids Res.
18:7003-7006.
Langenberg, W.G. 1986. Virus protein associated with
cylindrical inclusions of two viruses that infect wheat. J.
Gen. Virol. 67:1161-1168.
Langenberg, W.G., and Purcifull, D.E. 1989. Interactions
between pepper ringspot virus and cylindrical inclusions of
potyviruses. J. Ultrastruc. and Molec. Struc. Res. 102:53-
58.
Langenberg, W.G., Lommel, S.A., and Purcifull, D.E. 1989.
Sorghum chlorotic spot virus binds to potyvirus cylindrical
inclusions in tobacco leaf cells. J. Ultrastruc. and Molec.
Struc. Res. 102:47-52.
Lecoq, H., Bowden, D., Raccah, B., Hiebert, E., and
Purcifull, D.E. 1991a. Characterization of a zucchini yellow
mosaic virus isolate with a deficient helper component.
Phytopathology 81:1087-1091.
Lecoq, H., Lemaire, J.M., and Wipf-Scheibel, C. 1991b.
Control of zucchini yellow mosaic in squash by cross
protection. Plant Disease 75:208-211.
Lecoq, H., Lisa, V., and Dellavalle, G. 1983. Serological
identity of muskmelon yellow stunt and zucchini yellow
mosaic virus. Plant Disease 67:824-825.
Lecoq, H., and Pitrat, M. 1985. Specificity of the helper-
component-mediated aphid transmission of three potyviruses
infecting muskmelon. Phytopathology 75:890-893.
Lecoq, H., and Purcifull, D.E. 1992. Biological variability
of potyviruses, an example: zucchini yellow mosaic virus.
In: Potyvirus Taxonomy. Archives of Virology. (O.W. Barnett,
Ed.), In Press.
Lesemann, D.E., Makkouk, K.M., Koenig, R., and Samman, E.N.
1983. Natural infection of cucurbits by zucchini yellow
mosaic virus in Lebanon. Phytopathol. Z. 1008:304-313.
Ling, K., Namba, S., Gonsalves, C., Slightom, J.C., and
Gonsalves, D. 1991. Protection against detrimental effects
of potyvirus infection in transgenic tobacco plants
expressing the papaya ringspot virus coat protein gene.
Bio/technology 9:752-758.

Lisa, V. , Boccardo, G., d'Agostino, G., Dellavalle, G.,
d'Aquilio, H. 1981. Characterization of a potyvirus that
causes zucchini yellow mosaic. Phytopathology 71:667-672.
124
Lisa, V. , and Lecoq, H. 1984. Zucchini yellow mosaic virus.
CMI/AAB Desc. Plant Viruses. No. 282.
Lovisolo, O. 1980. Virus and viroid diseases of cucurbits.
Acta Hort. 88:33-82.
Martin, M.T., Otin, C.L., Lain, S., and Garcia, J.A. 1990.
Determination of polyprotein processing sites by amino
terminal sequencing of nonstructural proteins encoded by
plum pox potyvirus. Virus Res. 15:97-106.
Matthews, R.E.F. 1982. The classification and nomenclature
of viruses. Fourth Report of the International Committee on
Taxonomy of Viruses. Intervirology 17:1-199.
Mavankal, G., and Rhoads, R.E. 1991. In vitro cleavage at or
near the N-terminus of the helper component protein in the
tobacco vein mottling virus polyprotein. Virology 185:721-
731.
McCarty, D.R., Hattori, T., Carson, C.B., Vasil, V., Lazar,
M., and Vasil, I.K. 1991. The viviparous-1 developmental
gene of maize encodes a novel transcriptional activator.
Cell 66:895-905.
Morozov, S.Y., Dolja, V.V., and Atabekov, J.G. 1989.
Probable reassortment of genomic elements among elongated
RNA-containing plant viruses. J. Mol. Evol. 29:52-62.
Murphy, J.F., Rhoads, R.E., Hunt, A.G., and Shaw, J.G. 1990.
The VPg of tobacco etch virus is the 49-kDa proteinase or
the N-terminal 24 kDa part of the proteinase. Virology
178:285-288.
Nameth, S.T., Dodds, J.A., Paulus, A.O., and Kishaba, A.
1985. Zucchini yellow mosaic virus associated with severe
diseases of melon and watermelon in southern California
desert valleys. Plant Dis. 69:785-788.
Oh, C.-S., and Carrington, J.C. 1989. Identification of
essential residues in potyvirus proteinase HC-Pro by site-
directed mutagenesis. Virology 173:692-699.
Petersen, M.A., Edwardson, J.R., Lecoq, H., and Purcifull,
D.E. 1991. Morphological variation of inclusions induced by
zucchini yellow mosaic virus isolates. Phytopathology
71:1218 (Abstr.).

125
Pirone, T.P., and Thornbury, D.W. 1983. Role of virion and
helper component in regulating aphid transmission of tobacco
etch virus. Phytopathology 73:872-875.
Provvidenti, R., Gonsalves, D., and Humaydan, H.S. 1984.
Occurrence of zucchini yellow mosaic in cucurbits from
Connecticut, New York, Florida, and California. Plant Dis.
68:443-446.
Purcifull, D.E., Adlerz, W.C., Simone, G.W., Hiebert, E.,
and Christie, S.R. 1984. Serological relationships and
partial characterization of zucchini yellow mosaic virus
isolated from squash in Florida. Plant Dis. 68:230-233.
Purcifull, D.E., Hiebert, E., Petersen, M.A., Simone, G.W.,
and Gooch, M.D. 1991. Partial characterization of a
potyvirus isolated from watermelon (Citrullus vulgaris) in
Florida. Phytopathology 81:1224 (Abstr.).
Purcifull, D.E., Simone, G.W., Baker, C.A., and Hiebert, E.
1988. Immunodiffusion tests for six viruses that infect
cucurbits in Florida. Proc. Fla. State Hort. Soc. 101:400-
403 .
Quemada, H., Sieu, L.C., Siemieniak, D.R., Gonsalves, D.,
and Slightom, J. 1990. Watermelon mosaic virus II and
zucchini yellow mosaic virus: cloning of 3'-terminal
regions, nucleotide sequences, and phylogenetic comparisons.
J. Gen Virol. 71:1451-1460.
Restrepo, M.A., Freed, D.D., Carrington, J.C. 1990. Nuclear
transport of plant potyviral proteins. Plant Cell 2:987-998.
Riechmann, J.L., Lain, S., Garcia, A. 1992. Highlights and
prospects of potyvirus molecular biology. J. Gen Virol.
73:1-16.
Robaglia, C., Durand-Tardif, M., Tronchet, M., Boudazin, G.,
Astier-Manifacier, S., and Casse-Delbart, F. 1989.
Nucleotide sequence of potato virus Y (N strain) genomic
RNA. J. Gen Virol. 70:935-947.
Robertson, N.L., French, R., and Gray, S.M. 1991. Use of
group-specific primers and the polymerase chain reaction for
the detection and identification of luteoviruses. J. Gen.
Virol. 72:1473-1477.
Rodriguez-Cerezo, E., and Shaw, J.G. 1991. Two newly
detected nonstructural viral proteins in potyvirus-infected
cells. Virology 185:572-579.

126
Salomon, R., and Raccah, B. 1990. The role of the N-terminus
of potyvirus coat protein in aphid transmission. Abstr. pp.
83-87, VIII Int. Cong. Virol., Berlin, Aug.26-31. 1990.
Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989.
Molecular Cloning: A Laboratory Manual. 2nd ed., Vol. 2.
Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
Sanger, F. Nicklen, S., and Coulson, A.R. 1977. DNA
sequencing with chain terminating inhibitors. Proc. Natl.
Acad. Sci. U.S.A. 74:5463-5467.
Schrijnwerkers, C.C.F.M., Huigberts, N., and Bos, L. 1991.
Zucchini yellow mosaic virus: two outbreaks in the
Netherlands and seed transmissibility. Neth. J. PI. Path.
97:187-191.
Shahabuddin, M., Shaw, J.G., and Rhoads, R.E. 1988. Mapping
of the tobacco vein mottling virus VPg cistron. Virology
163:635-637 .
Short, J.M., Fernandez, J.M., Sorge, J.A., Huse, W.D. 1988.
Lambda ZAP: A bacteriophage lambda expression vector with
in vivo excision properties. Nuc. Acids. Res. 16:7583-7599.
Shoyinka, S.A., Brunt, A.A., Philips, S., Lesemann, D.E.
Thottappilly, G., and Lastra, R. 1987. The occurrence,
properties, and affinities of Telfairia mosaic virus, a
potyvirus prevalent in Telfairia occidentalis
(Cucurbitaceae) in south western Nigeria. J. Phytopathology
119:13-24.
Shukla, D.D., Frenkel, M.J., and Ward, C.W. 1991. Structure
and function of the potyvirus genome with special reference
to the coat protein coding region. Can. J. Plant Pathol.
13:178-191.
Siaw, M.F.E., Shahabuddin, M., Ballard, S., Shaw, J.G., and
Rhoads, R.E. 1985. Identification of a protein covalently
linked to the 5'-terminus of tobacco vein mottling virus
RNA. Virology 142:134-143.
Somowiyarjo, S., Sako, N., and Nonaka, F. 1989. Dot-
immunobinding assay for zucchini yellow mosaic virus using
polyclonal and monoclonal antibodies. Ann. Phytopath. Soc.
Japan 55:56-63.
Stark, D.M., and Beachy, R.N. 1989. Protection against
potyvirus infection in transgenic plants: evidence for
broad spectrum resistance. Bio/technology 7:1257-1262.

127
Studier, F.W., Rosenberg, A.H., Dunn, J.J., and Dubendorff,
J.W. 1990. Use of T7 RNA polymerase to direct expression of
cloned genes. In Methods in Enzymology. (D. V. Goeddel, Ed.)
Vol. 185, p.60-88. Academic Press, San Diego.
Suzuki, N. , Shirako, Y., and Ehara, Y. 1988. Isolation and
serological comparisons of virus-coded proteins of three
potyviruses infecting cucurbit plants. J. Gen. Virol.
70:1085-1091.
Thornbury, D.W., Hellmann, G.M., Rhoads, R.E., and Pirone,
T.P. 1985. Purification and characterization of potyvirus
helper component. Virology 144:260-267.
Thornbury, D.W., Patterson, C.A., Dessens, J.T., and Pirone,
T.P. 1990. Comparative sequence of the helper component (HC)
region of potato virus Y and a HC-defective strain, potato
virus C. Virology 178:573-578.
Towbin, H., Staehelin, T., and Gordon, J. 1979.
Electrophoretic transfer of proteins from polyacrylamide
gels to nitrocellulose sheets: Procedure and some
applications. Proc. Natl. Acad. Sci. USA 76:4350-4354.
Verchot, J., Koonin, E.V., and Carrington, J.C. 1991. The
35-kDa protein from the N-terminus of a potyviral
polyprotein functions as a third virus-encoded proteinase.
Virology 185:527-535.
Wang, H.L., Gonsalves, D., Provvidenti, R., and Lecoq, H.
1991. Effectiveness of cross protection by a mild strain of
zucchini yellow mosaic virus in cucumber, melon, and squash.
Plant Dis. 75:203-207.
Wang, H.L., Gonsalves, D., Provvidenti, R., and Zitter, T.A.
1988. Biological and serological properties of four strains
of zucchini yellow mosaic virus. Phytopathology 78:1568
(Abstr.).
Wang, H.L., Gonsalves, D., Provvidenti, R., and Zitter, T.A.
1992. Comparative biological and serological properties of
four strains of zucchini yellow mosaic virus. Plant Dis.
76:530-535.
Ward, C.W., and Shukla, D.D. 1991. Taxonomy of potyviruses:
Current problems and some solutions. Intervirology 32:269-
296.
Wiegers, K. , Uhlig, H., and Dernick, R. 1986. In vitro
stimulation of presensitized mouse spleen cells with
poliovirus type 1, Mahoney, and enhancement of poliovirus-
specific hybridomas. J. Gen. Virol. 67:2053-2057.

128
Yeh, S.-D., Wang, C.-H., and Chen, M.-J. 1992. Detection and
immunological analysis of a 112k protein of papaya ringspot
virus produced in vivo. Bot. Bull. Academia Sinica 33:1-8.

BIOGRAPHICAL SKETCH
Gail C. Wisler was born in Indianapolis, Indiana, on
Feb. 23, 1954. She graduated from the College of William
and Mary in 1976 with a B.S. in biology. She started work
at the Florida Department of Agriculture & Consumer
Services, Division of Plant Industry (DPI) in the Bureau of
Plant Pathology as a laboratory technician following
graduation from William and Mary. In 1979 she began a M.S.
program under the direction of F.W. Zettler in the Plant
Pathology Department of the University of Florida, while
continuing to work fulltime. She finished her M.S. in 1981
and continued to work at DPI, where she concentrated on
plant viruses and related problems. She left DPI in 1986 to
head the monoclonal antibody laboratory at the University of
Florida Plant Pathology Department on a two year grant
funded position for cucurbit potyviruses and geminiviruses.
She started a Ph.D. program in September, 1988 under the
direction of D.E. Purcifull, working on the molecular
biology of zucchini yellow mosaic virus. She expects to
receive her degree in August of 1992. Gail is a member of
the American Phytopathological Society.
129

I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
Dan E. Purcifull,
Professor of Plan
íairman
Pathology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
? yf
Ernest Hiebert
Professor of Plant Pathology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, inYscppe and quality, as
a dissertation for the degree of Doctor of)Philosophy.
F.W. Zettler
Professor of Plant Pathology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
Jbhn R. Edwardson
Professor of Agronomy
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
Susan E. Webb
Assistant Professor of
Entomology and Nematology

I certify that I have read this study and that in my opinion
it conforms to acceptable standards of scholarly presentation
and is fully adequate, in scope and quality, as a dissertation
for the degree of Doctor of Philosophy.
Stephen G.^Zam^y
Associate Professor of
Microbiology and Cell Science
This dissertation was submitted to the Graduate Faculty of the
College of Agriculture and to the Graduate School and was
accepted as partial fulfillment of the^ requirements for the
degree of Doctor of Philosophy.
August, 1992
Dean,
Agrie
liege of
ture
Dean, Graduate School

UNIVERSITY OF FLORIDA
3 1262 08556 8292




PAGE 2

&+$5$&7(5,=$7,21 2) 7+( 3, 3527(,1 2) 7+( =8&&+,1, <(//2: 026$,& 327<9,586 %\ *$,/ & :,6/(5 $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$ 8+L9(*L7< X UFMLM$ 8W5t8(6

PAGE 3

$&.12:/('*(0(176 7KH PRVW LPSRUWDQW DVSHFW RI D JUDGXDWH VWXGHQWnV FDUHHU LV KLV RU KHU PDMRU SURIHVVRU DQG DGYLVRU\ FRPPLWWHH ,Q WKLV UHVSHFW KDYH EHHQ H[WUHPHO\ IRUWXQDWH WR KDYH 'U '( 3XUFLIXOO DV P\ PDMRU SURIHVVRU DQG 'U ( +LHEHUW DV P\ FRDGYLVRU 7KH\ KDYH VKDUHG FRPSOHWHO\ WKHLU H[SHUWLVH DQG HQWKXVLDVP IRU P\ ZRUN DQG KDYH EHHQ VXSSRUWLYH WKURXJKRXW P\ SURMHFW 'U ): =HWWOHU ZDV P\ PDMRU SURIHVVRU IRU P\ PDVWHUnV GHJUHH DQG KDV FRQWLQXHG WR EH DQ H[FHOOHQW VRXUFH RI DGYLFH DQG PRUDO VXSSRUW DQG D ILQH IULHQG DV DOZD\V 'U 6 ( :HEE 'U 6 =DP DQG 'U -5 (GZDUGVRQ KDYH DOVR EHHQ H[WUHPHO\ KHOSIXO DQG HQWKXVLDVWLF DQG DP JUDWHIXO WR KDYH KDG WKH RSSRUWXQLW\ WR LQWHUDFW ZLWK DQG OHDUQ IURP WKHP 7KH H[FHOOHQW WHFKQLFDO DVVLVWDQFH DQG FRPUDGHU\ RIIHUHG E\ (XJHQH &UDZIRUG .ULVWLQ %HFNKDP *DU\ 0DUORZ &DUO\H %DNHU DQG 0DXUHHQ 3HWHUVHQ KDYH PDGH P\ ZRUN PRUH SURGXFWLYH DQG FHUWDLQO\ PRUH HQMR\DEOH JUHDWO\ DGPLUH WKHLU VNLOOV DQG ZLOO QRW IRUJHW WKHLU NLQGQHVV DP HVSHFLDOO\ WKDQNIXO WR KDYH KDG WKH VXSSRUW RI P\ KXVEDQG + :LOOLDP %URZQ ZKR KHOSHG PH WKURXJK WKH GLIILFXOW WLPHV DQG PDGH WKH JRRG WLPHV HYHQ EHWWHU DP

PAGE 4

DOVR IRUWXQDWH WR KDYH KDG WKH DGYLFH DQG HQFRXUDJHPHQW WKDW P\ PRWKHU &DU\O 0 :LVOHU KDV DOZD\V JLYHQ PH 0\ IDWKHU *HUU\ :LVOHU ZDV DOZD\V VXSSRUWLYH DQG HQFRXUDJHG PH LQ DOO P\ HQGHDYRUV (DUQLQJ WKLV GHJUHH KDV EHHQ DQ H[FHOOHQW OHDUQLQJ H[SHULHQFH IRU PH DQG WKLV SOXV WKH UHODWLRQVKLSV KDYH GHYHORSHG ZKLOH D VWXGHQW KHUH DW WKH 8QLYHUVLW\ RI )ORULGD KDYH PDGH LW DOO YHU\ ZRUWKZKLOH LQ

PAGE 5

7$%/( 2) &217(176 $&.12:/('*(0(176 LL /,67 2) 7$%/(6 9 /,67 2) ),*85(6 YL .(< 72 $%%5(9,$7,216 YLLL $%675$&7 ; &+$37(5 ,1752'8&7,21 &+$37(5 &/21,1* $1' 6(48(1&,1* 2) $ )/25,'$ ,62/$7( 2) =8&&+,1, <(//2: 026$,& 9,586 ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 5HVXOWV 'LVFXVVLRQ &+$37(5 6(52/2*,&$/ &+$5$&7(5,=$7,21 2) 7+( 3, 3527(,1 2) =8&&+,1, <(//2: 026$,& 9,586 )520 )/25,'$ ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 5HVXOWV 'LVFXVVLRQ &+$37(5 6800$5< $1' &21&/86,216 $33(1',; 0212&/21$/ $17,%2',(6 72 7+( &$36,' 3527(,1 2) =8&&+,1, <(//2: 026$,& 9,586 5()(5(1&( /,67 %,2*5$3+,&$/ 6.(7&+ ,9

PAGE 6

/,67 2) 7$%/(6 7DEOH 3DJH =<09)/$7 F'1$ FORQHV LGHQWLILHG E\ LPPXQR VFUHHQLQJ LQ $TWOO =<09)/$7 F'1$ FORQHV LGHQWLILHG E\ LPPXQR VFUHHQLQJ LQ A=$3,, 3HUFHQWDJH RI QXFOHRWLGH DQG DPLQR DFLG VHTXHQFH KRPRORJLHV RI IRXU =<09 LVRODWHV DQG ILYH GLVWDQWO\ UHODWHG SRW\YLUXVHV ZLWK UHVSHFW WR =<09)/$7 /LVW RI ]XFFKLQL \HOORZ PRVDLF YLUXV LVRODWHV XVHG IRU VHURORJLFDO VWXGLHV RI WKH 3, SURWHLQ (YLGHQFH IRU YDULDWLRQ LQ PROHFXODU ZHLJKW DQG UHDFWLYLW\ RI 3OUHODWHG SURWHLQV RI =<09 LVRODWHV LQ ZHVWHUQ EORWV 6XPPDU\ RI UHDFWLRQV RI DQWLVHUD WR WKH 3, RI =<09)/$7 DQG =<0958 LQ LPPXQRIOXRUHVFHQFH WHVWV Y

PAGE 7

/,67 2) ),*85(6 )LJXUH 3DJH 0DS RI VHOHFWHG F'1$ FORQHV IURP $TWOO DQG $ =$3 ZKLFK UHSUHVHQW WKH JHQRPH RI =<09)/$7 6HTXHQFLQJ VWUDWHJ\ XVHG IRU WKH F'1$ FORQHV UHSUHVHQWLQJ 3 +&3UR$,f DQG 3 HQFRGLQJ UHJLRQV 1XFOHRWLGH DQG GHGXFHG DPLQR DFLG VHTXHQFH RI =<09)/$7 +\GURSKRELFLW\ RI 3, RI =<09)/$7 SORWWHG DFFRUGLQJ WR .\WH DQG 'RROLWWOH f 0DS RI DFLGLF DQG EDVLF UHVLGXHV RI WKH 3, SURWHLQ RI =<09)/$7 +\GURSKRELFLW\ SORW RI WKH 3 VHTXHQFH RI =<09)/$7 0DS RI WKH DFLGLF DQG EDVLF UHVLGXHV RI WKH 3 SURWHLQ RI =<09)/$7 3&5 SURGXFWV RI 3, IURP =<090' DQG =<0969 XVLQJ SULPHUV VSHFLILF WR WKH 3, FRGLQJ UHJLRQ 1XFOHRWLGH VHTXHQFH DOLJQPHQWV RI WKH 3, FRGLQJ UHJLRQV IURP =<09)/$7 ZLWK WKDW RI =<09&$ 69 0' DQG 58 $PLQR DFLG VHTXHQFH DOLJQPHQW RI WKH 3, SURWHLQV RI ILYH =<09 LVRODWHV =<09)/$7 0' 58 69 DQG &$ ([SUHVVLRQ RI 3, SURWHLQ RI =<09)/$7 FORQHG LQWR WKH S(7K SODVPLG &KDUDFWHUL]DWLRQ RI WKH UHDFWLRQV RI WKH 3O UHODWHG SURWHLQV RI LVRODWHV RI ]XFFKLQL \HOORZ PRVDLF YLUXV =<09f LQ ZHVWHUQ EORWV YL

PAGE 8

:HVWHUQ EORWV RI H[WUDFWV IURP SODQWV VLQJO\ LQIHFWHG ZLWK VHOHFWHG =<09 LVRODWHV :HVWHUQ EORWV VKRZLQJ b DQG b 6'63$*( JHO FRQFHQWUDWLRQV 'HWHFWLRQ RI WKH 3, SURWHLQ LQ H[WUDFWV IURP SODQWV RI IRXU FXFXUELW FXOWLYDUV VLQJO\ LQIHFWHG ZLWK WKUHH LVRODWHV RI ]XFFKLQL \HOORZ PRVDLF YLUXV :HVWHUQ EORWV RI H[WUDFWV IURP SXPSNLQ VLQJO\ LQIHFWHG ZLWK VHOHFWHG =<09 LVRODWHV XVLQJ DQWLVHUD WR 3, &O DQG &3 RI =<09)/$7 DQG WR WKH $, RI 3569: DV SUREHV 6SHFLILFLW\ RI DQWLVHUXP WR 3, RI =<09)/$7 LQ ZHVWHUQ EORWV 5HDFWLYLW\ RI ]XFFKLQL \HOORZ PRVDLF YLUXV LVRODWHV LQ ZHVWHUQ EORWV XVLQJ DQWLVHUXP WR WKH 3, RI =<0958 DV D SUREH ,PPXQRSUHFLSLWDWLRQ RI ZKHDW JHUP LQ YLWUR WUDQVODWLRQ SURGXFWV /RFDOL]DWLRQ RI 3, LQ HSLGHUPDO WLVVXH LQ VWHPV RI ZDWHUPHORQ LQIHFWHG ZLWK =<09)/$7 (SLGHUPDO VWULSV RI ZDWHUPHORQ WLVVXH LQIHFWHG ZLWK =<09)/$7 WUHDWHG ZLWK SUHLPPXQH VHUXP VWDLQHG ZLWK 5KRGDPLQHSURWHLQ $ DQG SKRWRJUDSKHG ZLWK HSLIOXRUHVFHQFH $JJUHJDWHV RI 3, SURWHLQ LQ ZDWHUPHORQ WLVVXH LQIHFWHG ZLWK =<0958 WUHDWHG ZLWK DQWLVHUXP WR WKH 3, RI =<09)/$7 f VWDLQHG ZLWK 5KRGDPLQHSURWHLQ $ DQG SKRWRJUDSKHG ZLWK HSLI OXRUHVFHQFH RSWLFV (SLGHUPDO VWULSV IURP PRFNLQRFXODWHG ZDWHUPHORQ WLVVXH WUHDWHG ZLWK DQWLVHUXP WR WKH 3, RI =<09)/$7 f DQG VWDLQHG ZLWK 5KRGDPLQHSURWHLQ $ YLL

PAGE 9

.(< 72 $%%5(9,$7,216 $, ES &3 &WHUPLQXV F'1$ &09 &O 0&L GSP ',(&$ (/,6$ (6 EXIIHU +&3UR N'D /% /'6 PZ 1WHUPLQXV 1,D 1LE QP QW ROLJR G7 3, 3 3&5 339 36E09 39
PAGE 10

&6WR 0958 0969 =<09 LVRODWH IURP 5HXQLRQ ,VODQG VHYHUH LVRODWH RI =<09 IURP )ORULGD ,;

PAGE 11

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ &+$5$&7(5,=$7,21 2) 7+( 3, 3527(,1 2) 7+( =8&&+,1, <(//2: 026$,& 327<9,586 %\ *DLO &ODUD :LVOHU $XJXVW &KDLUSHUVRQ 'DQ ( 3XUFLIXOO 0DMRU 'HSDUWPHQW 3ODQW 3DWKRORJ\ 7KH QXFOHRWLGH VHTXHQFH RI WKH nWHUPLQDO 3, FRGLQJ UHJLRQ RI DQ DSKLG WUDQVPLVVLEOH LVRODWH RI ]XFFKLQL \HOORZ PRVDLF YLUXV =<09)/$7f ZDV FRPSDUHG WR WKH 3, FRGLQJ UHJLRQ RI IRXU RWKHU =<09 LVRODWHV 0LOG =<090'f DQG VHYHUH =<0969f LVRODWHV IURP )ORULGD DQG DQ LVRODWH IURP &DOLIRUQLD =<09&$f KDG b KRPRORJLHV WR =<09)/$7 ZKHUHDV WKH 3, FRGLQJ UHJLRQ RI =<09 IURP 5HXQLRQ ,VODQG =<0958f KDG b KRPRORJ\ WR =<09)/$7 7KH =<090' KDG DQ QXFOHRWLGH LQVHUW IROORZLQJ WKH VWDUW FRGRQ RI WKH 3, FRGLQJ UHJLRQ 7KH 3, SURWHLQV RI DOO =<09 LVRODWHV VKDUHG FRQVHUYHG DPLQR DFLGV LQ DUHDV RI WKH &WHUPLQXV WKDW KDYH EHHQ UHSRUWHG WR EH FRQVHUYHG LQ RWKHU SRW\YLUXVHV 7KH 3, SURWHLQ IURP =<09)/$7 ZDV H[SUHVVHG LQ (VFKHULFKLD FROL DQG XVHG IRU SRO\FORQDO DQWLVHUXP SURGXFWLRQ 7KLV DQWLVHUXP UHDFWHG LQ ZHVWHUQ EORWV ZLWK [

PAGE 12

H[WUDFWV RI SXPSNLQ &XFUELWD SHSR /f VLQJO\ LQIHFWHG ZLWK =<09 LVRODWHV EXW GLG QRW UHDFW ZLWK H[WUDFWV IURP QRQLQIHFWHG SODQWV RU IURP SODQWV LQIHFWHG ZLWK WKUHH RWKHU SRW\YLUXVHV D SRWH[YLUXV D FXFXPRYLUXV 7KH 3, SURWHLQV RI =<09 LVRODWHV UDQJHG IURP WR N'D 7KH 3, SURWHLQ RI =<090' ZKLFK FRQWDLQHG D VL[ DPLQR DFLG LQVHUW ZDV ODUJHU FD N'Df WKDQ WKH 3, RI =<09)/$7 3RVVLEOH SURWHLQ EUHDNGRZQ SURGXFWV N'Df ZHUH QRWHG IRU VRPH LVRODWHV 7KUHH LVRODWHV VKRZHG DQ N'D SURGXFW RQH ZDV WHVWHG DQG LW UHDFWHG ZLWK DQWLVHUXP WR DPRUSKRXV LQFOXVLRQ SURWHLQ $,f LQGLFDWLQJ LQFRPSOHWH SURFHVVLQJ EHWZHHQ WKH 3, DQG $, FOHDYDJH VLWH $QWLVHUXP PDGH WR WKH 3, RI =<09 58 JDYH VLPLODU UHVXOWV LQ ZHVWHUQ EORWV ZLWK UHVSHFW WR VL]H KHWHURJHQHLW\ RI WKH 3, SURWHLQ DPRQJ =<09 LVRODWHV EXW LW RQO\ UHDFWHG ZLWK RI =<09 LVRODWHV WHVWHG ,QGLUHFW LPPXQRIOXRUHVFHQFH WHVWV ZLWK DQWLVHUD WR WKH 3, SURWHLQV RI =<09)/$7 DQG =<0958 LQGLFDWHG WKDW WKH 3, SURWHLQ DJJUHJDWHV LQ =<09LQIHFWHG WLVVXHV 7KH 3, FRGLQJ UHJLRQ LV PRUH YDULDEOH WKDQ RWKHU UHJLRQV RI WKH JHQRPH DPRQJ =<09 LVRODWHV WKDW KDYH EHHQ VWXGLHG 7KH RFFXUUHQFH RI EUHDNGRZQ SURGXFWV LQFRPSOHWH SURFHVVLQJ EHWZHHQ 3, DQG $, DQG GLIIHUHQW VL]HV RI 3, SURWHLQV ZLWK FHUWDLQ LVRODWHV DUH OLNHO\ GXH WR VHTXHQFH GLIIHUHQFHV LQ WKH UHVSHFWLYH 3, SURWHLQV $QWLVHUD WR WKH 3, SURWHLQV KDYH SRWHQWLDO DV VHURORJLFDO SUREHV IRU LGHQWLI\LQJ =<09 DQG GLVWLQJXLVKLQJ DPRQJ =<09 LVRODWHV [L

PAGE 13

&+$37(5 ,1752'8&7,21 7KH 3RW\YLULGDH LV WKH ODUJHVW JURXS RI SODQW YLUXVHV FRQVLVWLQJ RI DW OHDVW PHPEHUV PRVW RI ZKLFK DUH DSKLG WUDQVPLWWHG %DUQHWW f &ROOHFWLYHO\ SRW\YLUXVHV LQIHFW D ZLGH UDQJH RI DJULFXOWXUDOO\ LPSRUWDQW FURSV FDXVLQJ VHYHUH \LHOG ORVVHV +ROOLQJV DQG %UXQW 0DWWKHZV f 7KH SRW\YLUDO JHQRPH LV D PHVVDJH VHQVH VLQJOH VWUDQGHG 51$ PROHFXOH FRQVLVWLQJ RI DERXW QXFOHRWLGHV QWf $ FKDUDFWHULVWLF IHDWXUH RI DOO SRW\YLUXVHV LV WKH SURGXFWLRQ RI SURWHLQDFHRXV F\OLQGULFDO LQFOXVLRQV &Of LQ WKH F\WRSODVP RI LQIHFWHG SODQWV (GZDUGVRQ (GZDUGVRQ DQG &KULVWLH f 7KH SRW\YLUDO JHQRPH FRQVLVWV RI D VLQJOH RSHQ UHDGLQJ IUDPH 25)f ZKLFK LV WUDQVODWHG LQWR D SRO\SURWHLQ RI DERXW ; NLORGDOWRQV N'Df ZKLFK LV VXEVHJXHQWO\ FOHDYHG LQWR DW OHDVW HLJKW LQGLYLGXDO SURWHLQV E\ YLUDOHQFRGHG SURWHDVHV GH 0HMLD HW DO E &DUULQJWRQ HW DO D 'RXJKHUW\ DQG &DUULQJWRQ $OOLVRQ HW DO *DUFLD HW DO 9HUFKRW HW DO f 6L[ RI WKHVH SURWHLQV KDYH EHHQ FKDUDFWHUL]HG EXW OLWWOH LV NQRZQ DERXW WZR SURWHLQV UHIHUUHG WR DV 3, DQG 3 ZKLFK DUH WKH ILUVW DQG WKLUG SURWHLQV HQFRGHG IURP WKH nWHUPLQXV RI WKH JHQRPH 7KH 3,

PAGE 14

DQG 3 SURWHLQV IODQN WKH KHOSHU FRPSRQHQWSURWHDVH +&3URf RU DPRUSKRXV LQFOXVLRQ $,f UHJLRQ %HFDXVH RI WKH ODUJH QXPEHU RI SRW\YLUXVHV DQG WKH FORVH UHODWLRQVKLSV DPRQJ PDQ\ PHPEHUV LGHQWLILFDWLRQ DQG GLVWLQFWLRQ DPRQJ SRW\YLUXVHV KDYH UHFHLYHG D FRQVLGHUDEOH DPRXQW RI DWWHQWLRQ 3URSHUWLHV RI WKH FDSVLG SURWHLQ &3f DQG WKH QXFOHRWLGH QWf VHTXHQFH RI WKH &3HQFRGLQJ UHJLRQ KDYH UHFHLYHG WKH PRVW DWWHQWLRQ DV FULWHULD IRU FODVVLILFDWLRQ ZLWK QW VHTXHQFHV RI GLVWLQFW SRW\YLUXVHV DQG VWUDLQV KDYLQJ EHHQ GHWHUPLQHG :DUG DQG 6KXNOD f 7KLV DWWHQWLRQ FDQ EH DWWULEXWHG WR WKH JHQH HQFRGLQJ WKH &3 EHLQJ WKH ILUVW JHQH WR EH WUDQVFULEHG IURP WKH nHQG RI WKH JHQRPH E\ UHYHUVH WUDQVFULSWDVH XVLQJ ROLJR G7 SULPHUV 4XHPDGD HW DO *DO2Q HW DO f DQG EHFDXVH WKH &3 FDQ EH H[WUDFWHG IURP YLULRQV ZKLFK DUH HDVLO\ SXULILHG IURP YLUXV LQIHFWHG SODQW WLVVXH 7KH &3 IXQFWLRQV WR SURWHFW WKH YLUDO 51$ E\ HQFDSVLGDWLRQ DQG LW DOVR LV LQYROYHG LQ DSKLG WUDQVPLVVLRQ *DO2Q HW DO /HFRT DQG 3XUFLIXOO f 6HTXHQFH DQDO\VHV KDYH VKRZQ WKDW D FKDQJH LQ WKH DPLQR DFLG WULSOHW $VS$OD *O\ '$*f LQ WKH DPLQRWHUPLQXV 1WHUPLQXVf RI WKH &3 DOWHUV DSKLG WUDQVPLVVLELOLW\ $WUH\D HW DO +DUULVRQ DQG 5RELQVRQ *DO2Q HW DO 6DORPRQ DQG 5DFFDK f 7KH &3 RI WZR SRW\YLUXVHV SDSD\D ULQJVSRW YLUXV W\SH 3 SDSD\Df DQG VR\EHDQ PRVDLF YLUXV KDYH DOVR EHHQ XVHG LQ SODQW WUDQVIRUPDWLRQV WR SURWHFW

PAGE 15

DJDLQVW VXSHULQIHFWLRQ E\ VWUDLQV RI WKH VDPH YLUXV DQG E\ RWKHU SRW\YLUXVHV /LQJ HW DO 6WDUN DQG %HDFK\ f 7KH WZR QXFOHDU LQFOXVLRQ SURWHLQV 1,D NGDf DQG 1LE WR N'Df DJJUHJDWH LQ HTXLPRODU DPRXQWV LQ VRPH SRW\YLUDO LQIHFWLRQV DUH ORFDOL]HG LQ WKH QXFOHXV RI LQIHFWHG SODQWV DQG FRQWDLQ QXFOHDU WDUJHWLQJ VLJQDOV 5HVWUHSR HW DO f 7KH FDUER[\WHUPLQDO &WHUPLQDOf SRUWLRQ RI WKH 1,D LV D SURWHDVH UHVSRQVLEOH IRU SURFHVVLQJ LQ FLV DQG LQ WUDQV DW D PLQLPXP RI VL[ VLWHV RQ WKH SRO\SURWHLQ &DUULQJWRQ DQG 'RXJKHUW\ D E &DUULQJWRQ HW DO &KDQJ HW DO 'RXJKHUW\ DQG 3DUNV 'RXJKHUW\ HW DO *DUFLD HW DO +HOOPDQQ HW DO 0DUWLQ HW DO 5LHFKPDQQ HW DO f 7KH 1,D UHVHPEOHV WKH SURWHDVHV RI FRPR QHSR DQG SLFRUQDYLUXVHV 'RPLHU HW DO *ROGEDFK DQG :HOOLQFN f DQG LV UHODWHG WR WKH WU\SVLQn OLNH IDPLO\ RI VHULQH SURWHDVHV %D]DQ DQG )OHWWHULFN f 7KH 1WHUPLQDO SRUWLRQ RI WKH 1,D LV QRZ NQRZQ WR EH WKH JHQRPHOLQNHG YLUDO SURWHLQ 93Jf DWWDFKHG WR WKH n WHUPLQXV RI WKH YLUDO 51$ 6LDZ HW DO +DUL 6KDKDEXGGLQ HW DO 0XUSK\ HW DO f 7KH ODUJH QXFOHDU LQFOXVLRQ SURWHLQ 1LE LV WKH PRVW KLJKO\ FRQVHUYHG RI WKH SRW\YLUDO JHQHV DPRQJ WKRVH ZKLFK KDYH EHHQ VHTXHQFHG :DUG DQG 6KXNOD f DQG KDV KLJK VHTXHQFH VLPLODULW\ ZLWK 51$GHSHQGHQW51$SRO\PHUDVHV

PAGE 16

HQFRGHG E\ SOXVVHQVH 51$ YLUXVHV 'RPLHU HW DO %UXHQQ f 7KH &O DUH SURGXFHG E\ DOO PHPEHUV RI WKH 3RW\YLULGDH H[DPLQHG VR IDU (GZDUGVRQ DQG &KULVWLH f 7KH\ DUH IRXQG IUHH LQ WKH F\WRSODVP %DXQRFK HW DO f LQ DVVRFLDWLRQ ZLWK WKH HQGRSODVPLF UHWLFXOXP /DQJHQEHUJ f DQG DWWDFKHG WR FHOO PHPEUDQHV DQG SODVPRGHVPDWD /DQJHQEHUJ KDV VXJJHVWHG D SRVVLEOH LQYROYHPHQW RI &O LQ FHOOWRFHOO PRYHPHQW RI YLUXVHV EHFDXVH RI WKH DVVRFLDWLRQ RI &O ZLWK YLUXV SDUWLFOHV DQG SODVPRGHVPDWD /DQJHQEHUJ DQG 3XUFLIXOO /DQJHQEHUJ HW DO f 5HFHQWO\ WKH &O KDYH EHHQ VKRZQ WR KDYH KHOLFDVH DFWLYLW\ DQG WR SRVVHVV QXFOHRVLGH WULSKRVSKDWH 173fELQGLQJ DFWLYLW\ /DLQ HW DO 5REDJOLD HW DO 5LHFKPDQQ HW DO f 7KH FRGLQJ UHJLRQ EHWZHHQ WKH &O DQG +&3UR GHVLJQDWHG DV 3 H[KLELWV D ORZ VHJXHQFH VLPLODULW\ DPRQJ WKRVH SRW\YLUXVHV ZKLFK KDYH EHHQ VHJXHQFHG 7KH N'D 3 SURWHLQ RI WREDFFR YHLQ PRWWOLQJ YLUXV 7909f KDV EHHQ H[SUHVVHG LQ ( FROL DQG DQWLVHUXP KDV EHHQ SUHSDUHG WR LW 5RGULJXH]&HUH]R DQG 6KDZ f ,Q ZHVWHUQ EORWV WKLV DQWLVHUXP UHDFWHG ZLWK D N'D DQG D N'D SURWHLQ LQ LQIHFWHG SODQWV LQGLFDWLQJ WKDW WKHUH PD\ EH DQ DOWHUQDWH SURFHVVLQJ VLWH EHWZHHQ 3 DQG &O $OWKRXJK LW KDV EHHQ VXJJHVWHG WKDW WKHUH LV OLPLWHG VHTXHQFH KRPRORJ\ EHWZHHQ 3 DQG WKH $ SURWHDVH RI SLFRUQDYLUXVHV 'RPLHU HW DO

PAGE 17

'RXJKHUW\ DQG &DUULQJWRQ f QR SURWHDVH DFWLYLW\ RI 3 KDV EHHQ GHPRQVWUDWHG 6KXNOD HW DO f 7KH UROH RI WKH +&3UR LQ DSKLG WUDQVPLVVLRQ KDV EHHQ ZHOO HVWDEOLVKHG %HUJHU DQG 3LURQH *RYLHU DQG .DVVDQLV 3LURQH DQG 7KRUQEXU\ 7KRUQEXU\ HW DO f ,PPXQRFKHPLFDO VWXGLHV KDYH VKRZQ WKDW WKH FRGLQJ UHJLRQ IRU WKH DPRUSKRXV LQFOXVLRQ $Of LV WKH VDPH DV WKH +&3UR %DXQRFK HW DO GH 0HMLD HW DO Df EXW ZKHUHDV DQWLVHUXP WR WKH +&3UR EORFNV DSKLG WUDQVPLVVLRQ RI SRWDWR YLUXV < DQG 7909 DQWLVHUXP WR WKH $O GRHV QRW 7KRUQEXU\ HW DO f ,W KDV EHHQ VXJJHVWHG WKDW WKH LQFOXVLRQ IRUP RI WKLV SURWHLQ PD\ EH LQDFWLYH LQ WHUPV RI DSKLG WUDQVPLVVLRQ 'RXJKHUW\ DQG &DUULQJWRQ f 7KH &WHUPLQXV RI WKH +&3UR IXQFWLRQV DV D SURWHDVH UHVSRQVLEOH IRU WKH FOHDYDJH EHWZHHQ WKH +&3UR DQG 3 &DUULQJWRQ HW DO D E f DW D FRQVHUYHG JO\JO\ **f DPLQR DFLG UHVLGXH ,GHQWLILFDWLRQ RI WZR HVVHQWLDO DPLQR DFLGV LQ WKH &WHUPLQDO KDOI RI WKH +&3UR LQGLFDWH WKDW LW LV D PHPEHU RI WKH F\VWHLQHW\SH IDPLO\ RI SURWHDVHV 2K DQG &DUULQJWRQ f 6HTXHQFH FRPSDULVRQV KDYH VKRZQ D KLJK KRPRORJ\ RI WKH SURWHDVH RI +&3UR ZLWK WKDW RI D GV51$ K\SRYLUXOHQFHDVVRFLDWHG YLUXV RI WKH FKHVWQXW EOLJKW IXQJXV &KRL HW DO f DQG ERWK SURWHDVHV DXWRFDWDO\WLFDOO\ FOHDYH EHWZHHQ WKH ** UHVLGXHV 7KH SURWHLQ HQFRGHG E\ WKH nWHUPLQDO UHJLRQ RI WKH SRW\YLUDO JHQRPH LV WKH PRVW YDULDEOH RI WKRVH ZKLFK KDYH

PAGE 18

EHHQ VHTXHQFHG 6KXNOD HW DO f DQG VKRZV WKH JUHDWHVW PROHFXODU ZHLJKW PZf YDULDWLRQ RI RYHU SRW\YLUXVHV ZKLFK KDYH EHHQ VWXGLHG E\ LQ YLWUR WUDQVODWLRQV ( +LHEHUW SHUVRQDO FRPP +LHEHUW DQG 'RXJKHUW\ f ZLWK D VL]H UDQJH IURP WR N'D 7KH &WHUPLQXV RI 3, KDV UHFHQWO\ EHHQ LGHQWLILHG DV D VHULQHW\SH SURWHDVH UHVSRQVLEOH IRU WKH DXWRFDWDO\WLF FOHDYDJH EHWZHHQ 3, DQG +&3UR 9HUFKRW HW DO f 6LQFH WKLV FOHDYDJH RFFXUV HIILFLHQWO\ LQ WKH ZKHDW JHUP LQ YLWUR WUDQVODWLRQ V\VWHP EXW QRW LQ WKH UDEELW UHWLFXORF\WH O\VDWH V\VWHP LW KDV EHHQ VXJJHVWHG WKDW DQ DOWHUQDWH FRIDFWRU PD\ EH UHTXLUHG IRU WKH SURFHVVLQJ HYHQW 5RGULJXH]&HUH]R DQG 6KDZ f H[SUHVVHG 3, LQ ( FROL DQG DQWLVHUXP ZDV SUHSDUHG WR WKH H[SUHVVHG 3, SURWHLQ $ N'D SURWHLQ ZDV GHWHFWHG LQ ORZ OHYHOV LQ LQIHFWHG WLVVXH H[WUDFWV ZKLFK KDG EHHQ HQULFKHG IRU HQGRSODVPLF UHWLFXOXP DQG PLWRFKRQGULD 5RGULJXH] &HUH]R DQG 6KDZ DUH WKH ILUVW WR GHPRQVWUDWH WKH H[LVWHQFH RI ERWK 3, DQG 3 LQ LQIHFWHG SODQWV
PAGE 19

LGHQWLILHG LQ WKH 86 $GOHU] HW DO 3XUFLIXOO HW DO 3URYYLGHQWL HW DO 1DPHWK HW DO f ,VUDHO $QWLJQXV HW DO f 7XUNH\ 'DYLV f -DSDQ 6X]XNL HW DO f $XVWUDOLD *UHEHU HW DO f )UDQFH /HFRT HW DO f /HEDQRQ /HVHPDQQ HW DO f DQG -RUGDQ $O0XVD f %RWK VHURORJLFDO DQG ELRORJLFDO YDULDWLRQV KDYH EHHQ UHSRUWHG IRU =<09 LVRODWHV /LVD DQG /HFRT /HFRT DQG 3XUFLIXOO :DQJ HW DO f 6HURORJLFDO UHODWLRQVKLSV DUH RIWHQ FRPSOH[ DQG =<09 KDV EHHQ UHSRUWHG WR FURVV UHDFW ZLWK ZDWHUPHORQ PRVDLF YLUXV :09f LQ VHURORJLFDO VWXGLHV RI WKH &3 'DYLV HW DO +XDQJ HW DO /LVD DQG /HFRT 3XUFLIXOO HW DO 6RPRZL\DUMR HW DO f DQG &O SURWHLQ 6X]XNL HW DO f %LRORJLFDO YDULDQWV UDQJH IURP VWUDLQV ZKLFK LQGXFH YHU\ PLOG V\PSWRPV WR WKRVH ZKLFK LQGXFH VHYHUH DQG QHFURWLF V\PSWRPV 3HWHUVHQ HW DO /HFRT DQG 3XUFLIXOO f 7KHVH W\SHV RI YDULDQWV KDYH EHHQ GHWHFWHG LQ JHRJUDSKLFDOO\ GLVWLQFW UHJLRQV LQFOXGLQJ )UDQFH DQG WKH 86 /HFRT DQG 3XUFLIXOO f %LRORJLFDO YDULDQWV KDYH DOVR EHHQ REVHUYHG ZKLFK GLIIHU LQ WKH DELOLW\ WR EH DSKLG WUDQVPLWWHG /HFRT HW DO D /HFRT DQG 3XUFLIXOO f 6RPH LVRODWHV DUH DSKLG WUDQVPLWWHG ZKHUHDV RWKHUV DUH LQHIILFLHQWO\ WUDQVPLVVLEOH RU QRW WUDQVPLWWHG E\ DSKLGV =XFFKLQL \HOORZ PRVDLF YLUXV KDV UHSRUWHGO\ EHHQ UHVSRQVLEOH IRU VHYHUH \LHOG ORVVHV LQ )UDQFH /LVD DQG

PAGE 20

/HFRT f ,VUDHO &RKHQ f DQG WKH 86 %OXD DQG 3HUULQJ f 5HFHQW VWXGLHV /HFRT HW DO E :DQJ HW DO f UHSRUW WKH XVH RI PLOG LVRODWHV RI =<09 IRU FURVV SURWHFWLRQ DJDLQVW PRUH VHYHUH LVRODWHV 7KLV PHDQV RI FRQWURO DSSHDUV SURPLVLQJ IRU =<09 6RPH ZRUNHUV KDYH UHSRUWHG WKDW =<09 PD\ EH WUDQVPLWWHG DW D ORZ UDWH WKURXJK VHHG 6FKULMQZHUNHUV HW DO 'DYLV DQG 0L]XNL f DQG PDQ\ LVRODWHV DUH HIILFLHQWO\ DSKLG WUDQVPLWWHG ,Q DGGLWLRQ WR =<09 VHYHUDO RWKHU SRW\YLUXVHV VXFK DV SDSD\D ULQJVSRW YLUXV W\SH: 3569:f ZDWHUPHORQ PRVDLF YLUXV :09f ]XFFKLQL \HOORZ IOHFN YLUXV =<)9f EHDQ \HOORZ PRVDLF YLUXV %U\RQLD PRWWOH YLUXV /RYLVROR f DQG 7HOIDLULD PRVDLF YLUXV 6KR\LQND HW DO f KDYH EHHQ UHSRUWHG WR LQIHFW FXFXUELWV LQ WKH ILHOG $V D UHVXOW WKH SRVVLELOLW\ IRU JHQHWLF UHFRPELQDWLRQ DPRQJ WKHVH FXFXUELW SRW\YLUXVHV H[LVWV .LQJ 0RUR]RY HW DO f &RQVHTXHQWO\ WKH DELOLW\ WR DFFXUDWHO\ GLDJQRVH DQG GLIIHUHQWLDWH LVRODWHV LV LPSRUWDQW LQ EUHHGLQJ SURJUDPV GHVLJQHG WR FRQWURO =<09 WKURXJK WKH GHYHORSPHQW DQG XVH RI UHVLVWDQW FXFXUELW FXOWLYDUV 'LIIHUHQWLDWLRQ RI =<09 LVRODWHV LV DOVR LPSRUWDQW LQ FURVVSURWHFWLRQ VWXGLHV 'LDJQRVLV DQG GLVWLQFWLRQ RI =<09 LVRODWHV KDYH EHHQ EDVHG LQ SDUW RQ GLIIHUHQWLDO KRVW UHDFWLRQV ,PPXQRFKHPLFDO DVVD\V LQYROYLQJ ERWK SRO\FORQDO 3$Ef DQG PRQRFORQDO 0$Ef DQWLVHUD WR WKH &3 DUH XVHIXO IRU GLDJQRVLV

PAGE 21

RI =<09 EXW DUH QRW FRPSOHWHO\ GHILQLWLYH IRU GLVWLQFWLRQ EHWZHHQ LVRODWHV 6WXGLHV RI ERWK VWUXFWXUDO DQG QRQVWUXFWXUDO SURWHLQV RI SRW\YLUXVHV KDYH EHHQ EDVHG RQ WKHLU HDVH RI LVRODWLRQ HLWKHU EHFDXVH WKH\ DUH UHDGLO\ SXULILHG WKH\ DJJUHJDWH LQ LQIHFWHG WLVVXH RU DV ZLWK WKH &3 WKH\ FDQ EH HDVLO\ FORQHG E\ ROLJR G7 SULPLQJ 1HLWKHU 3, QRU 3 KDYH EHHQ VKRZQ WR DFFXPXODWH RU DJJUHJDWH LQ LQIHFWHG SODQWV DQG WKXV WKH\ KDYH QRW EHHQ ZHOO FKDUDFWHUL]HG $V DQ HDUO\ SDUW RI WKLV VWXG\ VHYHUDO 0$EV WR WKH &3 RI =<09 ZHUH HYDOXDWHG IRU WKHLU DELOLW\ WR GLVWLQJXLVK DQG GLDJQRVH =<09 LVRODWHV DV GHVFULEHG LQ $SSHQGL[ 7KH SULPDU\ IRFXV RI WKLV VWXG\ KRZHYHU ZDV WR IXUWKHU FKDUDFWHUL]H WKH 3, DQG 3 RI =<09 7R DFKLHYH WKLV JRDO WKH REMHFWLYHV RI WKLV VWXG\ LQFOXGHG f FKDUDFWHUL]DWLRQ RI WKH 3, DQG 3 SURWHLQV DQG FRGLQJ UHJLRQV RI DQ DSKLGWUDQVPLVVLEOH LVRODWH RI =<09 IURP )ORULGD =<09)/$7f f FRPSDULVRQ RI WKH 3, DQG 3 SURWHLQV DQG WKHLU FRGLQJ UHJLRQV IURP =<09)/$7 WR WKRVH RI RWKHU =<09 LVRODWHV DQG RWKHU FXFXUELW SRW\YLUXVHV f HYDOXDWLRQ RI DQWLVHUD WR WKHVH SURWHLQV DV VHURORJLFDO SUREHV IRU VWXG\LQJ WKH YDULDELOLW\ RI =<09 LVRODWHV DQG f HYDOXDWLRQ RI WKH DQWLJHQLF UHODWLRQVKLSV RI WKHVH SURWHLQV DPRQJ =<09 LVRODWHV DQG RWKHU SRW\YLUXVHV LQIHFWLQJ WKH &XFXUELWDFHDH 7KH KLJK VHTXHQFH YDULDELOLW\ RI 3, DQG 3 PDNH ERWK RI WKHP LQWHUHVWLQJ SURWHLQ FRGLQJ UHJLRQV IRU VWXG\ DQG NQRZOHGJH JDLQHG LQ WKLV UHVHDUFK VKRXOG OHDG WR

PAGE 22

D EHWWHU XQGHUVWDQGLQJ RI WKH UROHV RI 3, DQG 3 LQ WKH YLUDO LQIHFWLRQ SURFHVV 7KLV VWXG\ UHSRUWV QXFOHRWLGH VHTXHQFH YDULDELOLW\ DPRQJ WKH 3, FRGLQJ UHJLRQ RI ILYH =<09 LVRODWHV $QWLVHUD WR WKH 3, SURWHLQV RI WZR =<09 LVRODWHV GHWHFWHG VL]H GLIIHUHQFHV LQ WKH 3, SURWHLQV LQFRPSOHWHO\ SURFHVVHG 3, SURGXFWV SRVVLEOH EUHDNGRZQ SURGXFWV DQG DQWLJHQLF GLIIHUHQFHV DPRQJ VHYHUDO =<09 LVRODWHV 1XFOHRWLGH VHTXHQFH LQIRUPDWLRQ RQO\ LV SUHVHQWHG IRU WKH 3 FRGLQJ UHJLRQ RI =<09)/$7 GXH WR WKH LQDELOLW\ WR H[SUHVV WKLV SURWHLQ LQ ( FROL DV D UHVXOW RI LWV DSSDUHQW WR[LFLW\

PAGE 23

&+$37(5 &/21,1* $1' 6(48(1&,1* 2) $ )/25,'$ ,62/$7( 2) =8&&+,1, <(//2: 026$,& 9,586 ,QWURGXFWLRQ ,W KDV EHHQ K\SRWKHVL]HG WKDW SRW\YLUXV VWUDLQV VKRZ DQ RYHUDOO KLJK VHTXHQFH LGHQWLW\ LUUHVSHFWLYH RI WKH JHQH SURGXFW EHLQJ FRQVLGHUHG ZKLOH GLVWLQFW YLUXVHV KDYH D VLJQLILFDQWO\ ORZHU GHJUHH RI LGHQWLW\ EHWZHHQ JHQH SURGXFWV 6KXNOD HW DO Sf 7KH QXFOHRWLGH QWf VHTXHQFH LGHQWLWLHV IRU WKH &3 JHQH RI GLVWLQFW SRW\YLUXVHV UDQJH DSSUR[LPDWHO\ IURP WR b ZKLOH WKH QXFOHLF DFLG VHTXHQFH LGHQWLWLHV GHWHUPLQHG IRU VWUDLQV RI D SRW\YLUXV DUH JUHDWHU WKDQ b :DUG DQG 6KXNOD f 7KHVH DXWKRUV SRLQW RXW WKDW IRU WKH IRXU SRW\YLUXVHV WKDW KDYH EHHQ VHTXHQFHG WKH 3, FRGLQJ UHJLRQ RI WKH SRW\YLUDO JHQRPH KDV D ORZHU KRPRORJ\ WKDQ RWKHU FRGLQJ UHJLRQV DQG WKDW WKLV DSSHDUV WR EH WKH PRVW YDULDEOH UHJLRQ RI WKH JHQRPH 7KH\ DOVR VXJJHVW WKDW WKLV YDULDELOLW\ PD\ LQGLFDWH D SRVVLEOH UROH IRU 3, LQ VSHFLILF YLUXVKRVW LQWHUDFWLRQV 7KH PDMRU JRDO LQ WKLV VWXG\ ZDV WR FKDUDFWHUL]H DQG FRPSDUH WKH 3, DQG 3 SURWHLQV RI VHYHUDO =<09 LVRODWHV $ PHDQV RI DFKLHYLQJ WKLV JRDO ZDV WR SURGXFH 3, DQG 3 RI =<09)/$7 LQ D KLJK OHYHO H[SUHVVLRQ V\VWHP DQG SURGXFH

PAGE 24

VSHFLILF DQWLVHUD WR HDFK 7KH ILUVW VWHS LQ WKLV SURFHVV ZDV WR FORQH WKH =<09 JHQRPH DQG GHWHUPLQH WKH QW DQG GHGXFHG DPLQR DFLG VHTXHQFH RI WKH UHJLRQ HQFRGLQJ 3, WKURXJK 3 0DWHULDOV DQG 0HWKRGV 9LUXV ,VRODWHV $Q LVRODWH RI =<09 IURP )ORULGD 3XUFLIXOO HW DO f ZKLFK KDV EHHQ PDLQWDLQHG LQ D JUHHQKRXVH E\ DSKLG WUDQVPLVVLRQ IRU WKH SDVW WKUHH \HDUV )&$7 ZDV XVHG DV WKH W\SH LVRODWH WKURXJKRXW WKLV VWXG\ DQG LW ZLOO EH UHIHUUHG WR DV =<09)/$7 7KH VHTXHQFH RI 3, WKURXJK 3 RI =<09)/$7 ZDV FRPSDUHG WR D =<09 LVRODWH IURP &DOLIRUQLD =<09&$f ZKLFK ZDV VHTXHQFHG E\ 5%DOLQW SHUVRQDO FRPPf RQH IURP 5HXQLRQ ,VODQG =<0958 %DNHU HW DO Ef D VHYHUH QHFURWLF LVRODWH IURP )ORULGD )&f GHVLJQDWHG DV =<09f§)/69 DQG D PLOG LVRODWH IURP )ORULGD )&f GHVLJQDWHG DV =<090' 9LUXV 3XULILFDWLRQ DQG 51$ ([WUDFWLRQ 7KH SURWRFRO XVHG IRU YLUXV SXULILFDWLRQ LV VLPLODU WR WKDW GHVFULEHG E\ /HFRT DQG 3LWUDW f =<09LQIHFWHG &XFUELWD SHSR / n6PDOO 6XJDUn WLVVXH ZDV KDUYHVWHG GD\V SRVW LQRFXODWLRQ DQG KRPRJHQL]HG IRU VHF ZLWK YROXPHV RI 0 .+3 S+ ZLWK IUHVKO\ DGGHG b VRGLXP GLHWK\OGLWKLRFDUEDPDWH ',(&$f DQG b PHUFDSWRHWKDQRO 7KH UHVXOWLQJ VOXUU\ ZDV WKHQ KRPRJHQL]HG ZLWK YROXPH RI WULFKORURIOXRUHWKDQH )UHRQf IRU RQH PLQ

PAGE 25

$IWHU FHQWULIXJDWLRQ DW J IRU PLQ WKH DTXHRXV SKDVH ZDV PDGH b ZLWK 7ULWRQ ; DQG ZDV VWLUUHG IRU PLQ DW & 3DUWLDOO\ SXULILHG YLUXV ZDV FROOHFWHG E\ XOWUDFHQWULIXJDWLRQ DW USP LQ D %HFNPDQ 7L URWRU IRU KU DW & DQG ZDV UHVXVSHQGHG LQ 0 +(3(6 S+ ZLWK D WLVVXH KRPRJHQL]HU $IWHU VWLUULQJ IRU RQH KU DW & WKH VXVSHQVLRQ ZDV SDUWLDOO\ FODULILHG E\ FHQWULIXJDWLRQ DW J IRU PLQ 7KH VXSHUQDWDQW ZDV OD\HUHG RQWR D &V6 JUDGLHQW J PO 0 +(3(6 S+ f DQG FHQWULIXJHG IRU KU DW J LQ D %HFNPDQ 6: URWRU DW & 7KH RSDOHVFHQW YLUXV ]RQH PP IURP WKH ERWWRP RI WKH WXEH ZDV FROOHFWHG GLOXWHG ZLWK RQH YROXPH RI 0 +(3(6 S+ DQG ZDV FHQWULIXJHG DW J IRU PLQ 7KH VXSHUQDWH ZDV PDGH b ZLWK SRO\HWK\OHQH JO\FRO 3(*f DQG ZDV VWLUUHG IRU PLQ DW & $ SHOOHW FRQWDLQLQJ YLUXV ZDV FROOHFWHG E\ FHQWULIXJDWLRQ DW J IRU PLQ DQG UHVXVSHQGHG LQ 0 +(3(6 S+ &RQFHQWUDWLRQV RI WKH YLUXV SUHSDUDWLRQV ZHUH HVWLPDWHG E\ VSHFWURSKRWRPHWU\ XVLQJ DQ DSSUR[LPDWH H[WLQFWLRQ FRHIILFLHQW RI $ PJPO FP OLJKW SDWKf 3UHSDUDWLRQV ZHUH GLYLGHG LQWR DOLTXRWV DQG VWRUHG DW & $ YLUXV SUHSDUDWLRQ FRQWDLQLQJ DSSUR[LPDWHO\ PJPO ZDV DGGHG WR DQ HTXDO YROXPH POf RI 51$ GLVVRFLDWLQJ VROXWLRQ > P0 7ULV+&O P0 ('7$ b VRGLXP GRGHF\O VXOIDWH 6'6f S+ @ DQG VL[ MXO RI SURWHDVH $IWHU D PLQ LQFXEDWLRQ DW URRP WHPSHUDWXUH 57f WKH SUHSDUDWLRQ

PAGE 26

ZDV OD\HUHG RQWR D OLQHDUORJ VXFURVH GHQVLW\ JUDGLHQW %UDNNH DQG 9DQ 3HOW f DQG ZDV VXEMHFWHG WR XOWUDFHQWULIXJDWLRQ DW USP IRU KU DW & ZLWK D %HFNPDQ 6: URWRU *UDGLHQW ]RQHV FRQWDLQLQJ 51$ ZHUH FROOHFWHG XVLQJ DQ ,6&2 89 DQDO\]HU 7KH 51$ ZDV SUHFLSLWDWHG E\ DGGLQJ YROXPH RI 0 VRGLXP DFHWDWH DQG YROXPHV RI b HWKDQRO 6DPEURRN HW DO f 3HOOHWV ZHUH UHVXVSHQGHG LQ \ GLHWK\O S\URFDUERQDWH '(3&f WUHDWHG ZDWHU DQG VWRUHG DW & 6\QWKHVLV RI F'1$ 7KH LQLWLDO F'1$ OLEUDU\ RI WKH =<09 51$ ZDV PDGH XVLQJ $JWOO /DPEGD /LEUDULDQ 6WUDWDJHQH /D-ROOD &$f ZKLFK LV EDVHG RQ D PRGLILFDWLRQ RI D SURFHGXUH GHVFULEHG E\ *XEOHU DQG +RIIPDQ f )UHVKO\ SUHSDUHG YLUDO 51$ ZDV XVHG IRU FORQLQJ ZLWK J 51$ DV WKH WHPSODWH LQ WKH ILUVW VWUDQG V\QWKHVLV UHDFWLRQ %RWK UDQGRP DQG ROLJR G7 SULPHUV ZHUH XVHG LQ WZR VHSDUDWH ILUVW VWUDQG V\QWKHVLV UHDFWLRQV ZKLFK ZHUH ODEHOHG E\ WKH DGGLWLRQ RI >3@G&73 ,QFRUSRUDWLRQ RI ODEHO ZDV PHDVXUHG LQ IUDFWLRQV HOXWHG IURP 3 FROXPQV PHVK %LR*HO 3 %LR5DG 0HOYLOOH 1
PAGE 27

6L]H DQDO\VLV RI F'1$ ZDV SHUIRUPHG RQ D b DJDURVH JHO 7KH JHO ZDV H[SRVHG WR ;UD\ ILOP DQG FRPSDUHG WR D NE ODGGHU PROHFXODU ZHLJKW VWDQGDUG %5/ *DLWKHUVEXUJ 0'f $ ]RQH FRUUHVSRQGLQJ WR EDVH SDLUV ESf ZDV FXW IURP WKH JHO DQG HOHFWURHOXWHG ZLWK D %LR5DG 0HOYLOOH 1
PAGE 28

XVHG LQ WKLV FORQLQJ H[SHULPHQW DQG ZDV V\QWKHVL]HG DW WKH 8QLYHUVLW\ RI )ORULGD '1$ 6\QWKHVLV &RUH 7KH KRVW VWUDLQ XVHG IRU WKLV YHFWRU V\VWHP ZDV ( FROL ;/O%OXH 1XFOHLF $FLG +\EULGL]DWLRQ RI =<09 &ORQHV 1XFOHLF DFLG SUREHV SUHSDUHG IURP YLUDO 51$ ZHUH ODEHOHG ZLWK >3@G&73 XVLQJ HLWKHU D 1LFN 7UDQVODWLRQ .LW 3URPHJD 0DGLVRQ :,f RU D 5DQGRP 3ULPHG '1$ /DEHOLQJ .LW %RHKULQJHU 0DQQKHLP ,QGLDQDSROLV ,1f DFFRUGLQJ WR PDQXIDFWXUHUnV LQVWUXFWLRQV 1\ORQ +\ERQG PHPEUDQHV L SRUH VL]H $PHUVKDP ,QF $UOLQJWRQ +HLJKWV ,/f FXW WR ILW PHGLD SODWHV FRQWDLQLQJ SODTXHV ZHUH ODLG RQWR WKH DJDU VXUIDFH IRU DSSUR[LPDWHO\ PLQ 0HPEUDQHV ZHUH WKHQ SODFHG RQWR ILOWHU SDSHU SDGV VRDNHG LQ WKUHH VROXWLRQV VHTXHQWLDOO\ IRU PLQ HDFK f 0 1D2+ 0 1D&O f 0 7ULV+&O S+ 0 1D&O DQG f ; 66& 6DPEURRN HW DO f 7KH\ ZHUH SODFHG LQ D 89 &URVVOLQNHU IRU PLQ DIWHU ZKLFK WKH\ ZHUH SUHK\EULGL]HG LQ PO RI b 6'6 0 1D&O b 3(* ZLWK PJPO GHQDWXUHG VDOPRQ VSHUP 0HPEUDQHV ZHUH SODFHG LQ D KHDW VHDO EDJ DQG LQFXEDWHG DW & IRU PLQ ZLWK DJLWDWLRQ DIWHU ZKLFK MX&LPO GHQDWXUHG SUREH ZDV DGGHG 7KLV ZDV IROORZHG E\ DQ RYHUQLJKW LQFXEDWLRQ DW & 0HPEUDQHV ZHUH ZDVKHG WZLFH LQ PO RI ; 66& IRU PLQ HDFK DW URRP WHPSHUDWXUH 57f IROORZHG E\ WZR ULQVHV LQ PO RI ; 66& FRQWDLQLQJ b 6'6 DW & IRU PLQ HDFK $ ILQDO ULQVH ZDV LQ PO RI ; 66& DW 57 IRU PLQ :DVKHG

PAGE 29

PHPEUDQHV ZHUH H[SRVHG WR ;UD\ ILOP ZLWK DQ LQWHQVLI\LQJ VFUHHQ ,PPXQRVFUHHQLQJ RI =<09 &ORQHV ,PPXQRVFUHHQLQJ IRU FORQHV H[SUHVVLQJ VSHFLILF UHJLRQV RI WKH =<09 JHQRPH ZDV FRQGXFWHG HVVHQWLDOO\ DFFRUGLQJ WR PDQXIDFWXUHUnV LQVWUXFWLRQV DV GHVFULEHG LQ WKH SLFR%OXH ,PPXQRVFUHHQLQJ .LW 6WUDWDJHQHf DQG E\ 6KRUW HW DO f 5HFRPELQDQW EDFWHULRSKDJH OLEUDU\ O\VDWH ZDV DGGHG WR c-/ RI WKH DSSURSULDWH VWUDLQ RI ( FROL FHOOV DQG DOORZHG WR DEVRUE DW & IRU PLQ 7KLV ZDV DGGHG WR PO RI /% VRIW DJDU FRQWDLQLQJ P0 0J6 ZKLFK ZDV SRXUHG RQWR /% SODWHV DQG LQFXEDWHG DW & IRU KU XQWLO SODTXHV DSSHDUHG $ QLWURFHOOXORVH PHPEUDQH 1&0f ZKLFK KDG SUHYLRXVO\ EHHQ VDWXUDWHG ZLWK P0 LVRSURS\%' WKLRJDODFWRS\UDQRVLGH ,37*f ZDV ODLG RQWR HDFK SODWH 7KH ,37* LV D JUDWXLWRXV LQGXFHU XVHG WR LQGXFH WKH H[SUHVVLRQ RI WKH %JDODFWRVLGDVH IXVLRQ SURWHLQ 3ODWHV ZHUH WKHQ PRYHG WR & DQG DOORZHG WR LQFXEDWH DQ DGGLWLRQDO KU 0HPEUDQHV ZHUH UHPRYHG ULQVHG WKUHH WLPHV IRU PLQ LQ D VROXWLRQ FRQWDLQLQJ P0 7ULV+&O S+ P0 1D&O b 7ZHHQ 7%67f DQG WKHQ LQFXEDWHG LQ 7%67 FRQWDLQLQJ b &DUQDWLRQ GU\ PLON SRZGHU IRU PLQ WR EORFN SURWHLQ ELQGLQJ VLWHV ( FROL O\VDWH ZDV SUHSDUHG DV GHVFULEHG LQ +X\QK HW DO f DQG DGGHG DW PJPO WR WKH EORFNLQJ VROXWLRQ $QWLVHUD WR WKH &3 DQG &O RI =<09 WR WKH VPDOO QXFOHDU LQFOXVLRQ SURWHLQ 1,Df RI WREDFFR HWFK YLUXV 7(9f

PAGE 30

WKH +&3UR RI 7909 DQG WR WKH $, RI SDSD\D ULQJVSRW YLUXV W\SH: 3569:f ZHUH XVHG IRU SULPDU\ DQWLERG\ VFUHHQLQJ 7KH YLUXV DQWLVHUD XVHG LQ VFUHHQLQJ ZHUH NQRZQ WR FURVV UHDFW ZLWK FRUUHVSRQGLQJ SURWHLQV RI =<09 DQG RWKHU SRW\YLUXVHV 3ULPDU\ DQWLERG\ ZDV GLOXWHG LQ WKH EORFNLQJ VROXWLRQ DW WR DQG LQFXEDWHG RYHUQLJKW DW & ZLWK VKDNLQJ (DFK VWHS ZDV IROORZHG E\ WKUHH PLQ ZDVKHV ZLWK 7%67 7KH VHFRQGDU\ DQWLERG\ DONDOLQH SKRVSKDWDVH FRQMXJDWHG JRDW DQWLUDEELW ,J* 6LJPD &KHPLFDO &R 6W /RXLV 02f ZDV DGGHG DW D GLOXWLRQ RI LQ EORFNLQJ VROXWLRQ DQG ZDV LQFXEDWHG ZLWK VKDNLQJ DW 57 IRU KU $IWHU ULQVLQJ LQ 7%67 D ILQDO ULQVH ZDV PDGH LQ GHYHORSPHQW EXIIHU 0 7ULV+&O 0 1D&O S+ f 7KH FRORU VXEVWUDWHV *LEFR %5/ *DLWKHUVEXUJ 0'f QLWUREOXH WHWUD]ROLXP 1%7f QO RI D PJPO VROXWLRQf DQG EURPRFKORURLQGRO\OSKRVSKDWH %&,3f  RI D PJPO VROXWLRQf ZHUH DGGHG WR PO GHYHORSPHQW EXIIHU ZLWK IM RI 0 0J&O &RORU GHYHORSPHQW ZDV DOORZHG WR SURFHHG IRU DSSUR[LPDWHO\ PLQ EHIRUH UHDFWLRQV ZHUH VWRSSHG E\ ULQVLQJ ZLWK GHLRQL]HG ZDWHU 3RVLWLYH FORQHV ZHUH LVRODWHG ZLWK D VWHULOH SLSHWWH DQG SODFHG LQ D EXIIHU FRQWDLQLQJ P0 1D&O P0 7ULV S+ P0 0J6 60 EXIIHUf ZLWK b FKORURIRUP DQG VWRUHG DW & &ORQHV ZHUH SXULILHG E\ WR URXQGV RI SODWLQJ DQG VFUHHQLQJ

PAGE 31

$QDO\VLV RI =<09 &ORQHV 3ODTXH SXULILHG FORQHV LQ $TWOO ZKLFK ZHUH SRVLWLYH LQ LPPXQRVFUHHQLQJ ZHUH UDLVHG LQ D PO FXOWXUH LQ WKH O\VRJHQLF KRVW ( FROL < DQG ZHUH SUHSDUHG E\ D PLQL SUHS SURFHGXUH 3UHSDUDWLRQV ZHUH GLJHVWHG ZLWK (FR5, UXQ RQ DQ DJDURVH JHO WUDQVIHUUHG WR D Q\ORQ PHPEUDQH XVLQJ DQ DJDURVH JHO WUDQVIHU XQLW 0LOOLSRUH 0LOOL%ORW9 6\VWHP %HGIRUG 0$f DQG H[SRVHG WR D >3@G&73 ODEHOHG =<09 SUREH &ORQHV LQ ERWK $TWOO DQG f=$3,, ZHUH DQDO\]HG E\ SRO\PHUDVH FKDLQ UHDFWLRQ 3&5f XVLQJ $TWOO IRUZDUG DQG UHYHUVH SULPHUV 3ODTXHV ZHUH SODFHG LQWR LO RI 60 EXIIHU DQG IUR]HQ DW & 7HQ cLO ZHUH XVHG DV WKH WHPSODWH LQ D %,26 WKHUPRF\FOHU ZLWK WKUHH F\FOHV RI & IRU PLQ & IRU PLQ DQG & IRU PLQ 7KLV ZDV IROORZHG E\ F\FOHV DW & IRU PLQ & IRU PLQ DQG & IRU PLQ 3ODVPLG FORQHV ZHUH DQDO\]HG ZLWK 3&5 E\ SODFLQJ LQGLYLGXDO FRORQLHV LQ , RI P0 7ULV+&O S+ FRQWDLQLQJ b 7ULWRQ ; KHDWLQJ WR & IRU PLQ DQG FHQWULIXJLQJ DW J IRU PLQ 7HQ  RI WKLV WHPSODWH ZDV XVHG LQ 3&5 ZLWK WKH DSSURSULDWH SULPHUV 6XEFORQLQT RI 5HFRPELQDQW %DFWHULRSKDJH &ORQHV LGHQWLILHG LQ $TWOO ZHUH GLJHVWHG DV GHVFULEHG DQG H[WUDFWHG IURP DQ DJDURVH JHO XVLQJ D 3UHS$*HQH '1$ 3XULILFDWLRQ .LW %LR5DGf )UDJPHQWV ZHUH WKHQ VXEFORQHG E\ OLJDWLQJ LQWR (FR5, GLJHVWHG S*(0(; 3URPHJDf ZKLFK KDG EHHQ WUHDWHG ZLWK &,$3 6DPEURRN HW DO f 3ODVPLG

PAGE 32

FORQHV S%OXHVFULSW 6.f ZHUH LVRODWHG IURP =$3 ,, ZLWK WKH XVH RI WKH KHOSHU SKDJH 5 DFFRUGLQJ WR PDQXIDFWXUHUnV LQVWUXFWLRQV 6WUDWDJHQHf 5HFRPELQDQW SODVPLG FXOWXUHV ZHUH SUHSDUHG IRU IXUWKHU DQDO\VLV E\ WKH DONDOLQH O\VLV PLQLSUHS SURFHGXUH 6DPEURRN HW DO f 7ZR DGGLWLRQDO 3OHQFRGLQJ UHJLRQV RQH IURP =<0969 DQG RQH IURP =<090' ZHUH FORQHG LQWR WKH S(7K YHFWRU 0F&DUW\ HW DO f DIWHU LQFUHDVH RI F'1$ E\ 3&5 XVLQJ SULPHUV VSHFLILF IRU 3, IROORZLQJ SURFHGXUHV VLPLODU WR WKRVH GHVFULEHG E\ 5REHUWVRQ HW DO f '1$ 6HTXHQFLQJ RI =<09 &ORQHV 7KH QXFOHRWLGH VHTXHQFHV RI SODVPLG SUHSDUDWLRQV DQG 3&5 SURGXFWV ZHUH GHWHUPLQHG XVLQJ WKH VWDQGDUG 6DQJHU GLGHR[\ FKDLQ WHUPLQDWLRQ PHWKRG f HPSOR\HG LQ ERWK 86 %LRFKHPLFDO &RUS &OHYHODQG 2+ DQG 3KDUPDFLD /.% 3LVFDWDZD\ 1VHTXHQFLQJ NLWV %RWK b DQG b DFU\ODPLGH JHOV ZLWK 0 XUHD ZHUH XVHG 6HTXHQFH DQDO\VLV DQG FRPSDULVRQV ZHUH PDGH XVLQJ WKH 8QLYHUVLW\ RI :LVFRQVLQ *HQHWLFV &RPSXWHU *URXS 6HTXHQFH 6RIWZDUH *&*f DYDLODEOH DW WKH 8QLYHUVLW\ RI )ORULGD ,&%5 %LRORJLFDO &RPSXWLQJ )DFLOLW\ 5HVXOWV &ORQHV 5HSUHVHQWLQJ WKH =<09 *HQRPH 7KH LQLWLDO FORQLQJ H[SHULPHQW XVLQJ $JWOO \LHOGHG DQ HVWLPDWHG [ FOHDU SRVLWLYHf SODTXHV DQG WKH \LHOG

PAGE 33

IURP =$3,, ZDV HVWLPDWHG WR EH [ FOHDU SODTXHV $IWHU VHURORJLFDO VFUHHQLQJ ZLWK DQWLVHUD WR WKH &3 1,D &O $, DQG +&3UR VHYHUDO FORQHV ZHUH VHOHFWHG ZKLFK ZHUH VSHFLILF WR HDFK RI WKHVH SURWHLQHQFRGLQJ UHJLRQV RQ WKH =<09 JHQRPH ,Q WKH $JWOO FORQLQJ H[SHULPHQW WHQ FORQHV ZHUH LGHQWLILHG E\ WKH UHDFWLYLW\ RI WKHLU H[SUHVVHG SURGXFWV ZLWK &3 DQWLVHUXP 1LQH RI WKHVH FORQHV ZHUH VSHFLILF IRU WKH &3 DQG DQ DGGLWLRQDO ODUJH FORQH RI NLOREDVH SDLUV NESf ZDV UHDFWLYH ZLWK ERWK &3 DQG 1,D DQWLVHUD 7DEOH f 7ZR FORQHV ZHUH LGHQWLILHG ZKLFK UHSUHVHQWHG WKH &O DQG WZR ZKLFK UHSUHVHQWHG WKH $, FRGLQJ UHJLRQ 3UHOLPLQDU\ VHTXHQFLQJ LQGLFDWHG WKDW WKH $, SRVLWLYH FORQHV ZHUH QRW ODUJH HQRXJK WR LQFOXGH WKH 3O HQFRGLQJ UHJLRQ 6XEVHTXHQW FORQLQJ H[SHULPHQWV XVLQJ ,=$3,, \LHOGHG VL[ DGGLWLRQDO &,SRVLWLYH FORQHV VHYHQ DGGLWLRQDO $,SRVLWLYH FORQHV DQG WKUHH FORQHV WKDW ZHUH ERWK &O DQG $,SRVLWLYH 7DEOH f 7KUHH RI WKH &O FORQHV ZHUH ODUJH HQRXJK WR FRGH IRU ERWK WKH &O DQG $, UHJLRQV DQG WKHLU SURGXFWV UHDFWHG ZLWK DQWLVHUD WR ERWK &O DQG $, SURWHLQV $Q $,SRVLWLYH FORQH RI NES ZDV VHOHFWHG $,f ZKLFK LQFOXGHG DOO RI 3, $, DQG D SRUWLRQ FD ESf RI 3 &ORQH $, DOVR UHSUHVHQWHG ES RI WKH OHDGHU VHTXHQFH 1RQH RI WKH FORQHV ZDV LGHQWLILHG WKDW UHSUHVHQWHG WKH HQWLUH OHDGHU VHTXHQFH ZKLFK EDVHG RQ WKH =<09&$ VHTXHQFH LV DSSUR[LPDWHO\ ES

PAGE 34

7DEOH =<09)/$7 F'1$ FORQHV LGHQWLILHG E\ LPPXQRVFUHHQLQJ LQ !JWOO &ORQH GHVLJQDWLRQ $SSUR[LPDWH VL]H NESf 6HURORJLFDOD UHDFWLYLW\ &3, &3 &3 &3 &3 &3 &3 &3 &3 &3 &, &, $OO $, &3 &3 &3 &3 &3 &3 &31,D &3 &3 &3 &O &O $, $, FRGLQJ UHJLRQV OLVWHG UHIHU WR FORQHV WKH SURGXFWV RI ZKLFK UHDFWHG ZLWK DQWLVHUD WR WKH FDSVLG SURWHLQ &3f VPDOO QXFOHDU LQFOXVLRQ SURWHLQ 1,Df F\OLQGULFDO LQFOXVLRQ SURWHLQ &Of RU DPRUSKRXV LQFOXVLRQ SURWHLQ $,f LQ LPPXQRVFUHHQLQJ DVVD\V

PAGE 35

7DEOH =<09)/$7 F'1$ E\ LPPXQRVFUHHQLQJ LQ $=$3,, FORQHV LGHQWLILHG &ORQH $SSUR[LPDWH 6HURORJLFDOD GHVLJQDWLRQ VL]H NESf UHDFWLYLW\ &, &O &, &O $, &, &O $, &, &O $, &, &O &, &O &, &O &, &O FP &O $, $, $, $, $, $, $, $, $, $, $, $, $, $, FRGLQJ UHJLRQV OLVWHG UHIHU WR FORQHV WKH SURGXFWV RI ZKLFK UHDFWHG ZLWK DQWLVHUD WR WKH F\OLQGULFDO LQFOXVLRQ SURWHLQ &Of RU DPRUSKRXV LQFOXVLRQ SURWHLQ $,f LQ LPPXQR VFUHHQLQJ DVVD\V

PAGE 36

3, +&3UR $,f 3 &O 93J 1,D 1LE &3 ? $ $, .ES &3 .ES $, .ES + &, .ES )LJ 0DS RI VHOHFWHG F'1$ FORQHV IURP ;JWOO DQG ƒ=$3,, ZKLFK UHSUHVHQW WKH JHQRPH RI =<09)/$7

PAGE 37

+&3UR $,f / 3, )LJ 6HTXHQFLQJ VWUDWHJ\ XVHG IRU WKH F'1$ FORQHV UHSUHVHQWLQJ 3 +&3UR$,f DQG 3HQFRGLQJ UHJLRQV $UURZV LQGLFDWH WKH GLUHFWLRQ RI VHTXHQFLQJ DQG GLVWDQFH UHDG IURP WKH EHJLQQLQJ RI WKH FORQH RU IURP WKH ORFDWLRQ RI D SULPHU / OHDGHU VHTXHQFH WR 8

PAGE 38

6HTXHQFHV 5HSUHVHQWLQJ WKH nWHUPLQXV RI =<09 )RXU FORQHV ZHUH VHOHFWHG ZKLFK WRJHWKHU UHSUHVHQW WKH HQWLUH =<09)/$7 JHQRPH $, NESf $, NESf &, NESf DQG &3 NESf )LJ f 6HYHUDO DGGLWLRQDO FORQHV ZHUH XVHG WR VHJXHQFH WKH HQWLUH UHJLRQ IURP 3, WKURXJK WKH 3HQFRGLQJ UHJLRQ )LJ f 7KH VHTXHQFH RI =<09)/$7 IURP WKH ES RI WKH OHDGHU WKURXJK 3 ZLWK WKH FRUUHVSRQGLQJ DPLQR DFLG VHTXHQFH LV SUHVHQWHG LQ )LJ %DVHG RQ FRQVHQVXV VHTXHQFHV 2K DQG &DUULQJWRQ 0DYDQNDO t 5KRDGV 7KRUQEXU\ HW DO 9HUFKRW HW DO f WKH 3O HQFRGLQJ UHJLRQ RI =<09)/$7 LV ES WKH $O LV ES DQG 3 LV ES LQ OHQJWK 7KH FOHDYDJH VLWH EHWZHHQ 3, DQG $O LV DW DPLQR DFLG SRVLWLRQ W\UVHUf ZKHUHDV WKH VLWH EHWZHHQ $O DQG 3 LV DW DPLQR DFLG SRVLWLRQ JO\JO\f DQG EHWZHHQ 3 DQG &O LV DW SRVLWLRQ JOXJO\f ,Q WKH 3OHQFRGLQJ UHJLRQ WKH FRQVHQVXV VHTXHQFH IRU WKH SUHGLFWHG SURWHDVH DW WKH &WHUPLQXV LV *O\;DD6HU*O\ f§3KH,OH9DO$UJ*O\ 9HUFKRW HW DO f ;DD EHLQJ DQ\ DPLQR DFLG ZKHUHDV WKDW IRU =<09)/$7 LV *O\&\V6HU*O\f§ /HX9DO,OH$UJ*O\ ,Q DGGLWLRQ 6HU DQG +LV ZHUH IRXQG DW SRVLWLRQV DQG UHVSHFWLYHO\ 7KHVH DPLQR DFLGV DUH VWULFWO\ FRQVHUYHG DPRQJ SRW\YLUXVHV %RWK WKH 6HU DQG +LV KDYH EHHQ VKRZQ E\ SRLQW PXWDWLRQV LQ WREDFFR HWFK YLUXV

PAGE 39

)LJ 1XFOHRWLGH DQG GHGXFHG DPLQR DFLG VHTXHQFH RI =<09)/$7 $PLQR DFLGV DUH UHSUHVHQWHG E\ D VLQJOH OHWWHU FRGH 8QGHUOLQHG UHVLGXHV UHSUHVHQW VHTXHQFHV VLPLODU WR FRQVHUYHG SRW\YLUDO VHTXHQFHV $VWHULVNV LQGLFDWH DPLQR DFLGV VWULFWO\ FRQVHUYHG DPRQJ SRW\YLUXVHV WKDW KDYH EHHQ VHTXHQFHG 6ODVKf LQGLFDWHV FOHDYDJH VLWHV EHWZHHQ SURWHLQV

PAGE 40

$$&7&77$&$*7$777$*$$$77&7&&$$7&$&77&*777$&77&$*$&$7$$&$$7**& 0 $ &7&7$7&$7*$77**77&$$7&7&&*7$&&&$77*&$$$*$&7$$*&$*7*7*&$$$&$& 6,0,*6,693,$.7.4&$17 7&$$*7$$*7$$7&***77$$7$7$*7**&$&&7**&&$&$7**&$$&$7*&&&$77*&& 4961591,9$3*+0$7&3/3 $&7*$$$$&*&$&$7*7$77$&$**&$7*$*7&&$$*$$*77*$7*&$$7&$$$&$$$$* /.7+0<<5+(6../0461.6 &$77*$&$77&7*$$&$$777&77&$*&$&7*$&*$*$7*$$*777$**&7&$&7&*$$$ ,',/11))67'(0.)5/751 &*$*$7*$*&$$**7*$$$$$***7&&*$*7***$**$7$*7&&7&&*&$$*&&*$*7$$ (06.9..*36*5,9/5.36. *&$*&***7777&*&7&*7$77*$*&$**$7*$**&$*&$&*&$$*$$$*$*$&7*7777 459) $5,(4'($$5..(79) &&7&*$$**$$$77$7*$&*$77&7$7&$&$$$7&7$*&$&*7*77&77&&$&&7*$$*7 /(*1<''6,71/$59/33(9 )LJ f§FRQWLQXHG

PAGE 41

*$&7&$&$$&*77*$7*7*$*&77*$&*7&$7&*7777$&$$*&*&$&$7$&$$*$$**$ 7+19'96/766)<.57<..( $$**$$*$$$*7**&*&$$$$*&$$$77*7*&$$*&$&&$&7&$$7$*&77*7*&$&$&* 5..9$4.4,94$3/16/&75 7*77&77$$$$77*&$&*&$$7$$$$$7$7&&&7*77*$*$7*$77**&$$&$$*$$**& 9/.,$51.1,39(0,*1..$ *$*$&$7$&$&7&$&&77&$$*$**777$****$7$7777*77**$$$**7*7&$*77*& 5+7/7).5)5*<)9*.969$ *&$7*$$*$$**$&*$$7*&**&*&$&7*$*$7*7&*7$7*$*&$*777$$$7**$77&7 r +((*50557(06<(4).:, / $$$$*&&$777*7&$**7&$&&&$7$&$*$*&*$$77&*7*$**$$*$7$77$$$&&$** .$,&497+7(5,5((',.3* 77*7$*7***7***7*77***&$&7$$7&$7$&$77*$&7$$$$*$7$77&$$*$77*&& r & 6 :9/*71+7/7.5< 65/3 )LJ FRQWLQXHG

PAGE 42

$&$777**7*$77&*$**7$*$*$&*$&*$7***$77*7*$$&*&*&7**$$&$**7*77 + / 9 5 5'''*,91$/(49/ $7777$7$*&*$$*77*$&&$&7$77&*7&*&$$&&**$$*77&$*77&77&&$$**$7* )<6(9'+<6643(94))4*: *&*$&*$$7*777*$&$$*777$**&&&$*&&&$*$7&$7*7*7*&$$$*77*$&&$&$$ 550)'.)5363'+9&.9'+1 &$$&*$**$$7*7**7*$*77$*&$*&$$7&7777*7&$**&777$77&&&$*7$*7*$$ r 1((&*(/$$, )&4$/)399. $&7$7&*7*&&$$$&$7*&$*$*$$$*&77$*7$*$$*77$*&777&*$**$$77$$$*$ / 6 & 47&5(6/9(96)5*,.' 77&777*$$&*&$$$&777$77*7&&$&$$**$7*$$7****7$*777&$$**$$**&7$ 6/1$1),9+.'(:*6).(*< 7&$$7$&*$7$$7$7777&$$$77$$7&$$$*7**&$$&$&$**&$$&7&$*$$7&7&$$ 4<'1,)./,.9$74$741/. *&7&7&$7&7*$$*77$7*$$$77$*77&$*$$&&$&$&$$*&$&7&$&$7*$$*&$$$7 /66(90./941+767+0.4, )LJ f§FRQWLQXHG

PAGE 43

$&$$*$&$7&$$&$$**&*&7&$7*$$$**77&$77**77$&*&$$*$&*$$77**$&77 4',1.$/0.*6/974'(/'/ $*&777*$$$&$*&77&77*$$$7*$&7&$*7**777$$*$$&&$&$7*&$&&7*$&7** $/.4//(074:).1+0+/7* 7*$**$**&$77*$$*$7*77&$*$$$7$$*&*77&7$*&$$**&&$7*$7$$$7&&7$* (($/.0)51.566.$0, 136 &&77&7$7*7*$&$$&&$$77**$&$$$$$7**$$$7777*777****$*$$$*$**$7$ //&'14/'.1*1)9:*(5*< &&$77&&$$*&*$77$77&$$*$$&77&77&*$$*$$*7$$7$&&$$*&*$$**$7$7$& +6.5/).1))((9,36(*<7 *$$*7$&*7$*7*&*$$$&777&&$$$7**7$&7&*7$$*77**&&$7$**&7&*77*$7 .<9951)31*75./$,*6/, 7*7$&&$&7&$$777**$7$***&$&*&$&7*&$&7$&77**$*$*$*7$77*$*$$*$$ 93/1/'5$57$//*(6 (.. *&&$&7&$&$7&$*&*7*7*7&7&&&$$&$*$$7**$$$77$7$7$&$&7&$7*&7*&7* 3/76$&96441*1<,+6&&& )LJ f§FRQWLQXHG

PAGE 44

7*7$$&*$7**$7*$7**$$&&&&*$7*7$&7&&*$*&77$$*$*&&&*$&*$$*$**&$ 970''*730< 6(/.637.5+ 7&7$*77$7$**$*&77&7**7*$7&&$$$*7$&$77*$7&7*&&$*&$7&7*$**&$*$ /9,*$6*'3.<,'/3$6($( $&*&$7*7$7$7$*&$$$**$$**77$77*&7$7&7&$$7$7777&&7&*&$$7*&77*7 50<,$.(*<&
PAGE 45

&**$$&7*77$$7&$777$$77&$$777*&&7&$$$7*$7&7*&$$$*&*$*$7*$$$&$ *791+/,4)$61'/46(0.+ 77$&$*$*77**&**$$&$&&$$&$&$*&*&$77$$$&7&*$**$*&$*&7*$77$$$** <59**73745,./((4/,.* $$7777&$$$&&$$$$&77$7*$7*&$*&7&&7*&$7*$7*$&&&$7$&$7$77$77*&7 ,).3./004//+''3<,/// 7**&$7*$7&7&$&&&$&&$77&77*7$&$7$7*7$7$**$7*&*7&$7777*$*&**** *0, 637, /9+0<505+)(5* 7$77*$*$7$7**$77$$*$***$7&$7*$$$7&**$$$*$7777&*7&$7$77$*$*&$ ,(,:,.5'+(,*.,)9,/(4 *&7&$&$&*&$$**77*&7&7**&7*$$*77&77*7**$7&$$&77$$&77*$7$$*7*$ /75.9$/$(9/9'4/1/,6( $*&77&$&&$&$777$&77*$$$77$7*$$***77*7&$$*$7$$7&$*$***&$7$&*7 $63+//(,0.*&4'145$<9 $&&7*&*&7**$777*77$$&*$7$&$$*7**$*&*7*$*7777&$$$7$$$*$$&7&$$ 3$/'//7,49(5()61.(/. )LJ f§FRQWLQXHG

PAGE 46

$$&&$$7**77$7&&&*$777*&$*&$$$&*&7&77&*$7$7*$***$$$$$$7*7$7*& 71*<3'/447/)'05(.0<$ $$$*&$*&7*&$&$$77&$7**&$$*$*&7$$*&77*&7**$$$$$7&&7*7*7$$&&*7 .4/+16:4(/6//(.6&979 *&*$77*$$*&$$77&7&*$77777$&**$$$*$$$777$$7&&$*&*$*&$$$$*$$** 5/.4)6,)7(51/,45$.(* $$$*&*&*&$7&77&*&7$&$$777*77&$&*$*7*7777$7&$&*$&&&*$*7$&$7*& .5$66/4)9+(&),7759+$ *$$*$*&$77&*&*$7*&$**&*7*&*&$$$&7$$$7*$**&7&7&*7&**$$777*7$$ .6,5'$*95./1($/9*,&. $77&77777&7&77*7**777&$$$$77777*&$&*$7*&7$7$*&*$&$7$$7$7$&&7 )))6&*).,)$5&<6', ,
PAGE 47

$$**$&*77$$7*&$7$7*7$&&$&$7777&$*&$$*$$$&$**$7*$7*&*&&&$7$7$ 57/0+0<+,)6..4''$3,< &$$7*$&777&77*$$&$7*7*&*7$$7*7*$*$&&$*$7&77*$**$$$&7&7&77*7$ 1')/(+951953'/((7//< &$7**&7**&*7$*$$*77*777&$$&$&$**&7$$*7&$*&**77&$*$77&$$77&*$ 0$*9(99674$.6$94,4)( *$$$$77$7$*&7*7*77**&*&7*&77$&&$7*7*&777*$&*&&*$$$*$$*&*$7*& ,$9/$//70&)'$(56'$ &$7777&$$*$7777*$&$$$$&7&$$$$&$*77777**7$&**77**$*$$$&**7&&* ).,/7./.79)*79*(795 $&77&$$ / 4 )LJ f§FRQWLQXHG

PAGE 48

7(9 9HUFKRW HW DO f WR EH LPSRUWDQW IRU SURWHRO\WLF SURFHVVLQJ EHWZHHQ 3, DQG $, SURWHLQV ,Q WKH 1WHUPLQXV RI WKH $, UHJLRQ WKH FRQVHQVXV VHJXHQFH IRU DSKLG WUDQVPLVVLRQ LV UHSRUWHG WR EH &\V*O\ 9DO$OD$OD 3UR&\V/\V,OH7\U&\Vf§&\V 7KRUQEXU\ HW DO f ZKHUH /\V LV WKH SXWDWLYH DPLQR DFLG UHTXLUHG IRU DSKLG WUDQVPLVVLRQ 7KH FRUUHVSRQGLQJ VHTXHQFH IRU =<09)/$7 LV &\V*O\/HX$OD$OD 3UR9DO/\V/HX6HU &\Vf§& )LJ f 7KLV FRQVHQVXV VHTXHQFH IRU =<09)/$7 LV WKH VDPH DV WKDW IRU =<09&$ DQG =<0958 %DNHU HW DO Ef 7KH WZR DPLQR DFLG UHVLGXHV UHTXLUHG IRU SURWHDVH DFWLYLW\ RI WKH +&3UR 2K DQG &DUULQJWRQ f DUH DOVR FRQVHUYHG ZLWK D &\V DW SRVLWLRQ DQG D +LV DW SRVLWLRQ )LJ f 7KH GHGXFHG DPLQR DFLG VHTXHQFH RI 3, RI =<09)/$7 ZDV XVHG WR SUHSDUH D K\GURSKRELFLW\ SORW DFFRUGLQJ WR .\WH t 'RROLWWOH f )LJ f 7KH 3, SURWHLQ LV KLJKO\ K\GURSKLOLF H[FHSW IRU D VWURQJO\ K\GURSKRELF 1WHUPLQDO DPLQR DFLGV 7KHUH LV QR REYLRXV SDWWHUQ WR VXJJHVW D WUDQVPHPEUDQH PRWLI 7KH 3, RI =<09)/$7 DOVR KDV D KLJK SURSRUWLRQ RI EDVLF DPLQR DFLGV )LJ f DQG LV WKXV KLJKO\ SRVLWLYHO\ FKDUJHG ,Q FRQWUDVW WKH K\GURSKRELFLW\ PDS IRU 3 )LJ f VKRZV D GLVWULEXWLRQ RI ERWK K\GURSKRELF DQG K\GURSKLOLF UHJLRQV DQG D IDLUO\ UDQGRP GLVWULEXWLRQ RI DFLGLF DV ZHOO DV EDVLF DPLQR DFLGV )LJ f ,QWHUHVWLQJO\ WKLV SORW LV TXLWH VLPLODU WR WKDW RI

PAGE 49

)LJ +\GURSKRELFLW\ RI 3, RI =<09)/$7 SORWWHG DFFRUGLQJ WR .\WH DQG 'RROLWWOH f +RUL]RQWDO VFDOH UHSUHVHQWV DPLQR DFLG UHVLGXHV RI 3, 9HUWLFDO VFDOH UHSUHVHQWV K\GURSKRELF DPLQR DFLGV DERYH WKH PLGOLQHf DQG K\GURSKLOLF DPLQR DFLGV EHORZ WKH PLGOLQHf

PAGE 50

)LJ 0DS RI DFLGLF $f DQG EDVLF %f UHVLGXHV RI WKH 3L SURWHLQ RI =<09)/$7

PAGE 51

)LJ +\GURSKRELFLW\ SORW RI WKH 3 VHTXHQFH RI =<09)/$7 7KH KRUL]RQWDO VFDOH LQGLFDWHV DPLQR DFLG UHVLGXHV LQ WKH 3 SURWHLQ 7KH K\GURSKRELFLW\ YHUWLFDOf VFDOH LV WKDW RI .\WH DQG 'RROLWWOH f ZLWK K\GURSKRELF DPLQR DFLGV DERYH WKH PLGOLQH DQG K\GURSKLOLF DPLQR DFLGV EHORZ WKH PLGOLQH 5HVLGXHV IRU FD DQG FD FRUUHVSRQG WR WKRVH VXJJHVWHG IRU 3 RI 7909 WR EH LQYROYHG LQ WKH IRUPDWLRQ RI PHPEUDQH VSDQQLQJ KHOLFHV 5RGULJXH]&HUH]R DQG 6KDZ f

PAGE 52

)LJ 0DS RI DFLGLF $f DQG EDVLF %f DPLQR DFLG UHVLGXHV RI WKH 3 SURWHLQ RI =<09)/$7

PAGE 53

WKH 3 RI 7909 5RGULJXH]&HUH]R DQG 6KDZ f 7ZR DUHDV RI WKH 3 RI =<09)/$7 LQGLFDWHG LQ )LJ FRUUHVSRQGHG WR WKH SRVVLEOH PHPEUDQH VSDQQLQJ KHOLFHV VXJJHVWHG E\ 5RGULJXH]&HUH]R DQG 6KDZ +RPRORJLHV %HWZHHQ WKH 3, RI =<09 ,VRODWHV &RPSDULVRQV ZHUH PDGH EHWZHHQ WKH 3, HQFRGLQJ UHJLRQV RI ILYH =<09 LVRODWHV =<09&$ =<0958 =<09)/$7 =<09 69 DQG =<090' 7KH ODWWHU WKUHH LVRODWHV ZHUH VHTXHQFHG LQ WKH SUHVHQW VWXG\ 7KH VHTXHQFH RI 3, IURP =<09)/$7 ZDV GHULYHG IURP FORQHV SURGXFHG LQ $TWOO DQG ?=$3,, 7KH VHTXHQFHV RI 3, IURP =<0969 DQG =<090' ZHUH GHULYHG IURP FORQHV SURGXFHG E\ 51$3&5 SURGXFWV XVLQJ FXVWRP SULPHUV IRU 3, 7KH VSHFLILF SULPHUV IRU SURGXFWLRQ RI 3, ZHUH RQ WKH nWHUPLQXV n&$7*$*$$77&$$*&77$&$7**&&7&7$7&$7*n DQG RQ WKH nWHUPLQXV n&7*$&77&7$*$&&7*77&&$*&*&*77&$n ,QLWLDO FRPSDULVRQ RI 3, SURGXFWV IURP 51$3&5 LQ DJDURVH JHOV EHWZHHQ WKH PLOG DQG VHYHUH LVRODWHV VKRZHG D VL]H GLIIHUHQFH EHWZHHQ WKH WZR ZLWK WKH PLOG EHLQJ VOLJKWO\ ODUJHU )LJ f 1XFOHRWLGH VHTXHQFH FRPSDULVRQV VKRZHG DQ QW LQVHUW LQ WKH PLOG LVRODWH LPPHGLDWHO\ DIWHU WKH VWDUW FRGRQ )LJ f WKXV DFFRXQWLQJ IRU WKH VL]H GLIIHUHQFH QRWHG LQ DJDURVH JHOV 7KH VHTXHQFHV EHWZHHQ WKH =<09)/$7 =<0969 DQG =<090' ZHUH TXLWH VLPLODU ZLWK D QW KRPRORJ\ RI b EHWZHHQ =<09)/$7 DQG WKH =<0969 LVRODWH DQG D b KRPRORJ\ EHWZHHQ WKH =<09)/$7 DQG WKH =<090' LVRODWH 2I WHQ DPLQR DFLG FKDQJHV LQ WKH =<0969

PAGE 54

1 )LJ (OHFWURSKRUHWLF DQDO\VLV RI 3&5 SURGXFWV RI 3, IURP =<090' DQG =<0969 XVLQJ SULPHUV VSHFLILF WR WKH 3, FRGLQJ UHJLRQ LQ D b DJDURVH JHO

PAGE 55

)LJ 1XFOHRWLGH VHTXHQFH DOLJQPHQWV RI WKH 3L FRGLQJ UHJLRQ IURP =<09)/$7 ZLWK WKDW RI =<09&$ 69 0' DQG 5' &ORQHV RI =<0969 DQG =<090' H[WHQG RQO\ WR WKH **$$&$** PRWLI DV VKRZQ GXH WR WKH SULPHU VHOHFWLRQ IRU 3&5 FORQLQJ

PAGE 56

)/ $7* *&&7&7$7& $7*$77**77 &$$7&7&&*7 &$ $7* *&&7&&$7& $7*$77**77 &$$7&7&7*7 69 $7* *&&7&7$7& $7*$77**77 &$$7&7&**7 0' $7*$*$$77& $$*&777$&$ 7*&&7&7$7& $7*$77**77 &$$7&7&7*7 58 $7* *&&*&7$7& $7*$77**77 &$$7&7&7*7 )/ $&&&$77*&$ $$*$&7$$*& $*7*7*&$$$ &$&7&$$*7$ $*7$$7&*** &$ $&&&$77*&$ $$*$&7*$*& $*7*7*&$$$ &$&7&$$*7$ $*7$$7&*** 69 $&&&$77*&$ $$*$&7*$*& $*7*7*&$$$ &$&7&$$*7$ $*7$$7&*** 0' $&&&$77*&$ $$*$&7*$*& $&7*7*&$$$ &$&7&$$*7$ $*7$$7&*** 58 &&&7$7&*77 *$*7&7*&7& **7*7*&$$& **77&$$$&7 **$$$&&*7* )/ 77$$7$7$*7 &$ &7$$7$7$*7 69 77$*7$7$*7 0' 77$$7$7$*7 58 7*$$7$77*7 **&$&&7**& **&$&&7**& *&&$&&7** **&$&&7**& **&$&&7**& &$&$7**&$$ &$&$7**&$$ &$7**&$$ &$&$7**&$$ &$&*7**&$* &$7*&&&$77 &$7*&&&$77 &$7*&&&$77 7$7*&&&$77 777*&$$*&& *&&$&7*$$$ *&&$&7*$$$ *&&$&7*$$$ *&&$&7*$$$ $&$$$7*$$$ )/ $&*&$&$7*7 &$ $&*&$&$7*7 69 $&*&$&$7*7 0' $&*&$&$7*7 58 7&*&$&7&$7 $77$&$**&$ $77$&$**&$ $77$&$**&$ $77$&$**&$ $77$&$$$&$ 7*$*7&&$$* 7*$*7&&$$* 7*$*7&&$$* 7*$*7&&$$* 7*&$7&$*$* $$*77*$ $$*77*$ $$*77*$ $$*77*$ $$$&7&7&&$ 7*&$$7&$$$ 7*&$$7&$$$ 7*&$$7&$$$ 7*&$$7&$$$ $$&$$*&7$* )/ &$$$$*&$77 &$ &$$*$*&$77 69 &$$$$*&$77 0' &$$$$*7$77 58 7*$$$*&$77 *$&$77&7*$ $&$$777&77 *$&$77&7*$ $&$$&77&77 *$&$77&7*$ $&$$777&77 *$&$77&7*$ $&$$777&77 $$7$7&&7&$ $7$*777&77 &$*&$&7*$ &$*&$&7*$ &$*&$&7*$ &$*&$&7*$ 7*$&$&7*$7 &*$*$7*$ &*$*$7*$ &*$*$7*$ &*$*$7*$ &&$*$*$7*& )/ $*777$**&7 &$ $*777$**&7 69 $*777$**&7 0' $*777$*7*7 58 *7777$**&7 &$&7&*$$$& &$&7&*$$$& &$&7&*$$$& &$&7&*$$$& &$&7&*&$$7 *$*$7*$*&$ *$*$7*$*&$ *$*$7*$*&$ *$*$7*$*&$ *$*$7*$*&$ $**7*$$$$$ $*&7*$$$$$ $**7*$$$$$ $**77$$$$$ $**7$$$*$$ ***7&&*$*7 ***7&&*$*& ***7&&*$*7 ***7&&*$*7 ****&&$$$7 )/ ***$**$7$* &$ ***$**$7$* 69 ***$**$7$* 0' ***$**$7$* 58 **$$**$7*$ 7&&7&&*&$$ *&&*$*7$$* 7&&7&&*&$$ *&&*$*7$$* 7&&7&&*&$$ *&&*$*7$$* &&&7&&*&$$ *&&*$*7$$* 7$&7&&*&$$ $&&$$*$*&$ &$*&***777 &$*&***777 &$*$***777 &$*&***777 &$$&*7*777 7&*&7&*7$7 7&*&7&*7$7 7&*&7&*7$7 7&*&7&*7$7 7**$*&*7$7

PAGE 57

)/ 7*$*&$**$7 *$**&$*&$& *&$$*$$$*$ *$&7*7777& &$ &*$*&$**$7 *$**&$*&$& *&$$**$$*$ **&7*7777& 69 7*$*&$**$7 *$**&$*&$& *&$$**$$*$ **&7*7777& 0' 7*$*&$**$7 *$**&$*&$& *&$$**$$*$ **&7*7777& 58 &$*&777*$$ $$*$7&*$$$ $$**$*&$*$ $$*$&$$*77 &7&*$$**$$ &7&*$$**$$ &7&*$$**$$ &7&*$$**$$ &7$&&$7**& )/ $77$7*$&*$ 77&7$7&$&$ $$7&7$*&$& &$ $77$7*$&*$ 77&&$7&$&$ $$7&7$*&$& 69 $77$7*$&*$ 77&*$7&$7$ $*7&7$*&$& 0' $77$7*$&*$ 77&*$7&$&$ $$7&7$*&$& 58 *$*7$7$7*& 7$&7*7*$&* 7&&$7&$77$ *7*77&77&& JWJWWFWWFF *7*77&77&& JWJWWFWWFF $7$&$77&$& $&&7*$$*7* $&&7*&&*7* $&&7*$$*7* $&&7*$$*7* $*$7*$$$** )/ $&7&$&$$&* &$ $&7&$&$$&* 69 $&7&$&$$&* 0' $&7&$&$$&* 58 $$7**&$7$* 77*$7*7*$* 77*$7*7*$* 77*$7*7*$* 77*$7*7*$* &7$$&7&$$* &77*$&*7&$ &77*&*$7&$ &77*$&*7&$ &77*$&*7&$ 777*&*&7&$ 7&*7777$&$ &&*7777$&$ &&*7777$&$ &&$7777$&$ &&*77&7$7$ $*&*&$&$7$ $*&*&$&$7$ $*&*&$&$7$ $*&*&$&$7$ $$&*77&$7* )/ &$$*$$**$$ $**$$*$$$* &$ &$$*$$**$$ $**$$*$$$* 69 &$$*$$**$$ $**$$*$$$* 0' &$$*$$**$$ $**$$*$$$* 58 &$*$$$**$$ $$*$$*$$$$ 7**&*&$$$$ *&$$$77*7* 7**&*&$$$$ *&$$$77*7* 7**&*&$$$$ *&$$$77*7* 7**&*&$$$$ *&$*$77*7* 7$*7$7*7*$ $$$7*77*7* &$$*&$& &$$*&$& &$$*&$& &$$*&$& &*77&$*&&$ )/ &$&7&$$7$* &77*7*&$&$ &$ &$&77$$7$* &77*7*&$&$ 69 &$&77$$7$* 777*7*&$&$ 0' &$&77$$7$* &77*7*&$&$ 58 *7*77$$7$$ 7&7*7*&*$7 &*7*77&77$ &*7*77&77$ &*7*77&77$ &*7*77&77$ &*&*77&7&$ $$$77*&$&* $$$77*&$&* $$$77*&$&* $$$77*&$&* $*$7$*&*&* &$$7$$$$$7 &$$7$$$$$7 &$$7$$$$$7 &$$7$$$$$7 **$*$$$$$& )/ $7&&&7*77* &$ $7&&&7*77* 69 $7&&&7*77* 0' $7&&&7*77* 58 $77&&$*77* $*$7*$77** $*$7*$77** $*$7*$77** $*$7*$77** $$$7*$77** &$$&$$*$$* *&*$*$&$7$ &$$&$$*$$* $&*$*$&$7$ &$$&$$*$$* *&*$*$&$7$ &$$&$$*$$* *&*$*$&$7$ $$$*$$$$$* $$7&*$&$&$ &$&7&$&&77 &$&7&$&&77 &$&7&$&&77 &$&7&$&&77 &&&7&$&&77 )/ &$$*$**777 $****$7$77 &$ &$$*$**777 $****$7*77 69 &$$*$**777 $****$7*77 0' &$$*$**777 $****$7$77 58 &$$*$$&777 $$***$7&77 )LJ f§FRQWLQXHG 77*77**$$$ 77*77**$$$ 77*77**$$$ 77*77**$$$ 7&$77***$$ **7*7&$*77 **7*7&$*77 **7*7&$*77 **7*7&$*77 $*777&$77$ *&*&$7*$$* *&*&$7*$$* *&*&$7*$$* *&*&$7*$$* *&$&$&*$$$

PAGE 58

)/ $$**$&*$$7 *&**&*&$&7 *$*$7*7&*7 $7*$*&$*77 7$$$7**$77 &$ $$**$&*$$7 *&**&$&$&7 *$*$7*7&*7 $7*$*&$*77 7$$$7**&77 69 $$**$&*$$7 *&**&*&$&7 *$*$7*7&*7 $7*$*&$*77 7$$$7**$77 0' $$**$&*$$7 *&**&*&$&7 *$*$7*7&*7 $7*$*&$*77 7$$$7**$77 58 ****&&$$$7 *$*$&$7*77 *$*$7*7&*7 $&*$$&$*77 7**$77&$77 )/ &7$$$$*&&$ 777*7&$**7 &$&&&$7$&$ *$*&*$$77& *7*$**$$*$ &$ &77$$$*&&$ 777*7&$**7 &$&&&$7$&$ *$*&*$$77& *7*$**$$*$ 69 &7$$$$&&&$ 777*7&$**7 &$&&7$7$&$ *$*&*$$77& *&*$**$$*$ 0' &7$$$$*&&$ 777*7&$**7 &$&&&$7$&$ *$*&*$$77& *7*$**$$*$ 58 &7$&$$*&&$ 7&7*7&***7 7$&*$$&$&$ $*$7*7*7*& *&*$7*$**$ )/ 7$77$$$&&$ **77*7$*7* **7***7*77 ***&$&7$$7 &$7$&$77*$ &$ 7$77$$$&&$ **77*7$*7* **7***7*77 ***&$&7$$7 &$7$&$77*$ 69 7$77$$$&&$ **77*7$*7* **7***7*77 ***&$&7$$7 &$7$&$77*$ 0' 7$77$$$&&$ **77*7$*7* **7***7*77 ***&$&7$$7 &$7$&$77*$ 58 &$7&$$*&&* ***7*7$*&* *$7***77&7 $**&*$7*$7 &$&*$$&77$ )/ &7$$$$*$7$ 77&$$*$77* &&$&$777** 7*$77&*$** 7$*$*$&*$& &$ &7$$$$*$7$ 77&$$*$77* &&$&$777** 7*$77&*$** 7$*$*$&*$& 69 &7$$$$*$7$ 77&$$*$77* &&$&$777** 7*$77&*$** 7$*$*$7*$& 0' &7$$$$*$7$ 77&$$*$77* &&$&$777** 7*$77&*$** 7$*$*$&*$& 58 &7&$*$$$77 77&*$**77$ &&$7*&&7$* 7$$77&*7** 7$*$*$7*$7 )/ *$7***$77* &$ *$7***$77* 69 *$7***$77* 0' *$7***$77* 58 *$$**$$77* 7*$$&*&*&7 7*$$&*&*&7 7*$$&*&*&7 7*$$&*&*&7 7*$$7*&$77 **$$&$**7* 77$7777$7$ *& **$$&$**7* 77$7777$7$ *& **$$&$** **$$&$** $*$$&&$*7* 77&77&7$7* $7 )LJ f§FRQWLQXHG

PAGE 59

)/ 0 $6, 0,*6,693,$ .7.4&$1749 61591,9$3* +0$7&3/3/. 0' 5,4$/+ (+ 58 $ 9 (6$5797 99.340 69 ( 63 &$ ( $ )/ 7+0<<5+(6. ./0461.6, ',/11))67' (0.)5/751 (06.9..*36 0' 69 5866.$( 6.4$6( 16' 35 1 69 &$ / )/ *5,9/5.36. 459)$5,(4' f§($$5..( 79)/(*1<'' 6,71/$59/3 0' $ f§ ( $ 58 0,/5$ /(6)( .,.*(549 /3:59<$797 ,7)7'(5 69 f§ ( $ ,6 &$ f§ ( $ )/ 3(97+19'96 /766)<.57< ..(5..9$4. 4,94$3/16 /&759/.,$5 0' 3 58 1*,$16f§ 536& 5.,9&( 1956$691 69 3 &$ $ 53 r )/ 1.1,39(0,* 1..$5+7/7) .5)5*<)9*. 969$+((*50 557(06<(4) 0' 58 ( .1 1.6, /54 +9 69 F &$ 7 & + r )/ .:,/.$,&49 7+7(5,5((' ,.3*&6*:9/ *71+7/7.5< 65/3+/9,5* 0' 58*)45 15&9' '' ( 4.) 3& 69 3 < &$ )/ 5'''*,91$/ (49/)<6 0' 58 ( 3 ) 69 &$ 5'''*,91$/ (49/)<6 )LJ $PLQR DFLG VHTXHQFH DOLJQPHQW RI WKH 3, SURWHLQV RI ILYH =<09 LVRODWHV =<09)/$7 0' 58 69 DQG &$ &RQVHUYHG UHVLGXHV DPRQJ =<09 LVRODWHV DUH XQGHUOLQHG $VWHULVNV LQGLFDWH VWULFWO\ FRQVHUYHG UHVLGXHV DPRQJ SRW\YLUXVHV =<090' DQG 69 WHUPLQDWH DW (4 GXH WR SULPHU VHOHFWLRQ IRU 3&5

PAGE 60

LVRODWH FRPSDUHG WR =<09)/$7 ILYH PDGH D GLIIHUHQFH LQ WKH SRODULW\ RU FKDUJH DQG ILYH FKDQJHV PDGH QR GLIIHUHQFH ,Q DGGLWLRQ WKHUH ZDV D GHOHWLRQ RI D +LV DW SRVLWLRQ LQ WKH =<0969 LVRODWH 7KH 3, IURP WKH =<090' LVRODWH KDG DQ LQVHUW RI DGGLWLRQDO DPLQR DFLGV LPPHGLDWHO\ IROORZLQJ WKH LQLWLDWLRQ FRGRQ FRPSDUHG WR =<09)/$7 7KHUH ZHUH QLQH GLIIHUHQW DPLQR DFLGV LQ WKH 1WHUPLQDO KDOI RI =<090' VHYHQ RI ZKLFK PDGH D GLIIHUHQFH LQ WKH FKDUJH RU SRODULW\ 7KH 3, RI =<09&$ KDG D KLJK GHJUHH RI VLPLODULW\ FRPSDUHG WR =<09)/$7 bf ZKHUHDV =<0958 ZDV KLJKO\ GLYHUJHQW ZLWK RQO\ D b QW VHTXHQFH KRPRORJ\ FRPSDUHG WR WKH 3, RI =<09)/$7 7DEOH f ,Q VSLWH RI WKH YDULDELOLW\ VHHQ DPRQJ ILYH 3, UHJLRQV FHUWDLQ FRQVHQVXV UHJLRQV DQG DPLQR DFLGV EHOLHYHG WR EH LQYROYHG RU UHTXLUHG IRU SURWHDVH DFWLYLW\ RI 3, ZHUH FRQVHUYHG )RU H[DPSOH DOO ILYH LVRODWHV KDG WKH DPLQR DFLG FRQVHQVXV *O\;DD6HU *O\ WKH +LV DW SRVLWLRQ DQG 6HU DW SRVLWLRQ )LJ f 7KH FRQVHUYHG SRW\YLUXV VHTXHQFH RI 3KH,OH9DO $UJ*O\ 9HUFKRW HW DO f FORVH WR WKH 3O$, FOHDYDJH VLWH ZDV VOLJKWO\ GLIIHUHQW ZLWK D VHTXHQFH RI /HX9DO ,OH$UJ*O\ IRU DOO ILYH LVRODWHV )LJ f +RPRORJLHV %HWZHHQ 3, $, DQG 3 RI =<09 ,VRODWHV DQG 2WKHU 3RWYYLUXVHV 1XFOHRWLGH DQG DPLQR DFLG VHTXHQFH FRPSDULVRQV ZHUH PDGH EHWZHHQ WKH 3, $, DQG 3 RI =<09)/$7 ZLWK =<09&$

PAGE 61

7DEOH 3HUFHQWDJH RI QXFOHRWLGH DQG DPLQR DFLG VHTXHQFH KRPRORJLHV RI WKH 3L DPRUSKRXV LQFOXVLRQ $,f DQG 3 UHJLRQV RI IRXU =<09 LVRODWHV DQG ILYH GLVWDQWO\ UHODWHG SRW\YLUXVHV ZLWK UHVSHFW WR =<09)/$7 UXVLVRODWH (-/ $/ e =<09&$ D f f f =<0969 f QGE QG =<090' f QG QG =<095 f f f 7(9 f f f SY\Q f f f 7909 f f f 339 f f f 36E09 f f f D +RPRORJLHV ZHUH GHWHUPLQHG XVLQJ WKH *$3 DOLJQPHQW RI WKH 8QLYHUVLW\ RI :LVFRQVLQ *HQHWLFV &RPSXWHU *URXS 3URJUDP *$3 FDOFXODWHV DOLJQPHQW RI WZR FRPSOHWH VHTXHQFHV WKDW PD[LPL]HV WKH QXPEHU RI PDWFKHV DQG PLQLPL]HV WKH QXPEHU RI JDSV 1XFOHRWLGH VHTXHQFH KRPRORJLHV DUH OLVWHG ILUVW ZLWK DPLQR DFLG KRPRORJLHV LQ f E QG QRW GHWHUPLQHG

PAGE 62

=<0958 7(9 $OOLVRQ HW DO f SRWDWR YLUXV
PAGE 63

7KH QW VHTXHQFH RI WKH 3 RI =<09)/$7 VKRZHG D b KRPRORJ\ ZLWK WKH 3 RI =<09&$ DQG b KRPRORJ\ ZLWK =<09 58 7KH =<09)/$7 DQG GLVWDQWO\ UHODWHG SRW\YLUXVHV KDG QW KRPRORJLHV WR =<09)/$7 UDQJLQJ IURP b 7KH DPLQR DFLG VHTXHQFH KRPRORJLHV RI 3 FRPSDUHG WR =<09)/$7 ZHUH VOLJKWO\ KLJKHU WKDQ WKH QW KRPRORJLHV 7DEOH f ,Q DOO QW DQG DPLQR DFLG FRPSDULVRQV WKH 3, ZDV WKH OHDVW FRQVHUYHG UHJLRQ ZKHUHDV WKH +&3UR ZDV PRUH KLJKO\ FRQVHUYHG WKDQ HLWKHU 3, RU 3 'LVFXVVLRQ $WWHPSWV WR FORQH WKH HQWLUH nWHUPLQXV RI WKH =<09 JHQRPH QHFHVVLWDWHG WKH XVH RI FXVWRP SULPHUV WR IRUFH FORQLQJ VSHFLILFDOO\ IRU WKH nHQG 7KLV UHVXOWHG LQ D VHULHV RI FORQHV ZKLFK UHSUHVHQWHG WKH HQWLUH 25) RI WKH =<09 JHQRPH +LJK QXFOHRWLGH VHTXHQFH VLPLODULWLHV DPRQJ WKH 3, RI =<09)/$7 69 0' DQG &$ LVRODWHV ZHUH QRWHG EXW D VLJQLILFDQW GLYHUJHQFH ZDV VHHQ ZLWK WKH 3, RI WKH =<0958 LVRODWH 7KH ODUJHU VL]H RI WKH 3, IURP =<090' DV VHHQ LQ 3&5 DQDO\VLV LQ DJDURVH JHOV ZDV YHULILHG E\ VHTXHQFHV ZKLFK VKRZHG D VL[ DPLQR DFLG LQVHUW DIWHU WKH VWDUW FRGRQ :KHUHDV WKH ILUVW ILYH DPLQR DFLGV ZHUH 0HW$OD6HU,OH0HW IRU =<09)/$7 69 DQG &$ DQG 0HW$OD$OD,OH0HW IRU =<0958 WKH FRUUHVSRQGLQJ VHTXHQFH IRU =<090' ZDV 0HW$UJ ,OH*OX$OH/HX+LV$OD6HU,OH0HW $OO WKH GLIIHUHQFHV

PAGE 64

VHHQ LQ WKH DPLQR DFLG VHTXHQFH IRU WKH =<090' ZHUH LQ WKH 1WHUPLQDO KDOI RI 3, (LJKW RI WKH DPLQR DFLG GLIIHUHQFHV ZKLFK LQFOXGH RQH GHOHWLRQf LQ WKH =<0969 LVRODWH ZHUH DOVR LQ WKH 1WHUPLQDO KDOI RI 3, 7KH FRQVHUYHG UHVLGXHV LQ WKH &WHUPLQXV RI 3, KDYH EHHQ PDLQWDLQHG WR VRPH GHJUHH LQ WKH ILYH =<09 LVRODWHV VWXGLHG 7KH +LV DQG 6HU UHVLGXHV LPSRUWDQW IRU SURWHDVH DFWLYLW\ ZHUH SUHVHQW LQ DOO ILYH LVRODWHV RI =<09 +RZHYHU WKH FRQVHQVXV VHTXHQFH UHSRUWHG IRU WKH ILYH SRW\YLUXVHV DQDO\]HG E\ 9HUFKRW HW DO f LV VOLJKWO\ GLIIHUHQW ,QVWHDG RI 3KH,OH9DO$UJ*O\ WKH VHTXHQFH IRU =<09 LVRODWHV LV /HX9DO,OH$UJ*O\ 7KLV VHTXHQFH VXJJHVWV D SRVVLEOH LQYHUVLRQ RI DPLQR DFLGV 9DO DQG OLH DW WKLV SRLQW ,Q VSLWH RI WKH ORZHU FRQVHUYDWLRQ RI =<0958 LW LV LQWHUHVWLQJ WR QRWH WKDW WKH FRQVHUYHG UHJLRQV DUH WKH VDPH DPRQJ DOO =<09 LVRODWHV DV ZHOO DV WKH SXWDWLYH 7\U6HU FOHDYDJH VLWH EHWZHHQ 3, DQG $, $PRQJ WKH ILYH =<09 LVRODWHV LQ WKLV VWXG\ DQG ILYH RWKHU SRW\YLUXVHV ZKLFK KDYH EHHQ FRPSOHWHO\ VHTXHQFHG 9HUFKRW HW DO f WKH 3, LV WKH PRVW YDULDEOH UHJLRQ RQ WKH SRW\YLUDO JHQRPH ,Q DGGLWLRQ WKH 1WHUPLQXV RI 3, LV PRUH YDULDEOH WKDQ LWV &WHUPLQXV $OWKRXJK WKH $, ZDV QRW WKH SULPDU\ IRFXV RI WKLV UHVHDUFK WKH KRPRORJLHV RI WKH SRW\YLUXVHV DQG WKUHH =<09 LVRODWHV DGGUHVVHG LQ WKLV VWXG\ ZHUH FRPSDUHG 7KH $, HQFRGLQJ UHJLRQ ZDV PRUH KLJKO\ FRQVHUYHG WKDQ WKDW RI 3,

PAGE 65

ZLWK D KLJK KRPRORJ\ bf QRWHG EHWZHHQ =<09)/ DQG =<09 &$ DQG D ORZHU bf KRPRORJ\ EHWZHHQ =<09)/$7 DQG =<09 58 2WKHU SRW\YLUXVHV KDG VHJXHQFH KRPRORJLHV FRPSDUHG WR =<09)/$7 LQ WKH UDQJH bf H[SHFWHG IRU GLVWLQFW SRW\YLUXVHV 6KXNOD HW DO f 7KH KRPRORJLHV VHHQ IRU WKH 3HQFRGLQJ UHJLRQ ZHUH VLPLODU WR WKRVH VHHQ IRU WKH $,HQFRGLQJ UHJLRQ ZLWK D KLJK KRPRORJ\ bf EHWZHHQ =<09)/$7 DQG &$ DQG D ORZHU KRPRORJ\ bf EHWZHHQ =<09)/$7 DQG 58 LVRODWHV 7KH KRPRORJLHV RI GLVWLQFW SRW\YLUXVHV FRPSDUHG WR =<09)/$7 ZHUH ORZHU bf DV H[SHFWHG ,W LV FOHDU IURP WKH VHJXHQFH DQDO\VHV SUHVHQWHG LQ WKLV VWXG\ WKDW WKHUH LV YDULDWLRQ LQ WKH 3, FRGLQJ UHJLRQ DPRQJ =<09 LVRODWHV 7KHUH LV DOVR JUHDWHU YDULDWLRQ LQ WKH 3, UHJLRQ WKDQ LQ WKH $, RU WKH 3 UHJLRQV 7KH =<0958 LVRODWH DSSHDUV WR KDYH D PRUH KLJKO\ GLYHUJHG 3, QW VHTXHQFH WKDQ WKH RWKHU =<09 LVRODWHV DGGUHVVHG LQ WKLV VWXG\ $FFRUGLQJ WR WKH FULWHULD SURSRVHG E\ 6KXNOD HW DO f =<0958 GRHV QRW ILW WKH FDWHJRU\ RI HLWKHU D VWUDLQ RU D GLVWLQFW SRW\YLUXV UHJDUGOHVV RI ZKHWKHU WKH 3, $, RU 3 UHJLRQV DUH FRQVLGHUHG ,Q DGGLWLRQ WKH &3 UHJLRQ RI =<0958 LV b VLPLODU WR WKDW RI =<09&$ %DNHU HW DO Ef 3RO\FORQDO DQWLVHUD WR WKH &3 RI =<09)/$7 DQG =<0958 FURVV UHDFW LQ UHFLSURFDO 6'6LPPXQRGLIIXVLRQ WHVWV ZLWK WKH IRUPDWLRQ RI VSXUV %DNHU HW DO Df 6HYHUDO PRQRFORQDO DQWLERGLHV 0$EVf SURGXFHG WR =<09)/$7

PAGE 66

$SSHQGL[ f VKRZ D ORZ DIILQLW\ WR =<0958 7KH V\PSWRPDWRORJ\ RI =<0958 RQ D UDQJH RI VXVFHSWLEOH KRVWV LV YHU\ VLPLODU WR FODVVLFDO =<09 V\PSWRPV %DNHU HW DO D +/HFRJ XQSXEOLVKHGf

PAGE 67

&+$37(5 6(52/2*,&$/ &+$5$&7(5,=$7,21 2) 7+( 3, 3527(,1 2) =8&&+,1, <(//2: 026$,& 9,586 )520 )/25,'$ ,QWURGXFWLRQ 7KH QW VHTXHQFHV RI WKH 3, DQG DQG 3 FRGLQJ UHJLRQV DUH OHVV FRQVHUYHG WKDQ RWKHU FRGLQJ UHJLRQV RQ WKH SRW\YLUDO JHQRPH 6KXNOD HW DO f )XUWKHUPRUH WKH 1 WHUPLQXV RI WKH 3, SURWHLQ LV OHVV FRQVHUYHG WKDQ LWV & WHUPLQXV )RU WKHVH UHDVRQV LW ZDV K\SRWKHVL]HG WKDW WKH DQWLJHQLF FKDUDFWHUL]DWLRQ RI WKH 3, DQG 3 SURWHLQV ZRXOG SURYH XVHIXO LQ GLVWLQJXLVKLQJ GLIIHUHQW LVRODWHV RI SRW\YLUXVHV ,Q RUGHU WR HYDOXDWH WKH SRWHQWLDO RI DQWLJHQLF SURSHUWLHV RI 3, DQG 3 IRU GLVWLQFWLRQ RI =<09 LVRODWHV WKH IROORZLQJ H[SHULPHQWDO DSSURDFK ZDV DWWHPSWHG FORQLQJ DQG VHTXHQFLQJ RI WKH 3, DQG 3 HQFRGLQJ UHJLRQV DV GHVFULEHG LQ FKDSWHU H[SUHVVLRQ RI WKH HQFRGHG SURWHLQV LQ ( FROL SURGXFWLRQ RI DQWLVHUD WR WKH H[SUHVVHG SURWHLQV DQG GHYHORSPHQW RI VHURORJLFDO GHWHFWLRQ PHWKRGV 7KHVH SURFHGXUHV ZHUH VXFFHVVIXO IRU WKH 3, SURWHLQ RI =<09 )/$W DQG =<0958 DQG WKLV FKDSWHU GHVFULEHV WKH DQWLJHQLF GHWHFWLRQ DQG FKDUDFWHUL]DWLRQ RI WKH 3, SURWHLQV RI =<09 LVRODWHV E\ ZHVWHUQ EORWV RI H[WUDFWV IURP LQIHFWHG SODQWV

PAGE 68

DQG E\ LPPXQRIOXRUHVFHQFH LQ LQIHFWHG WLVVXHV $OWKRXJK WKH 3 RI =<09 ZDV FORQHG DQG VHTXHQFHG WKH WR[LFLW\ RI WKLV SURWHLQ LQ ( FROL SUHYHQWHG H[SUHVVLRQ RI 3 DQG SUHSDUDWLRQ RI DQWLVHUD VR WKDW QR VHURORJLFDO VWXGLHV ZHUH FRQGXFWHG ZLWK WKH 3 SURWHLQ 'XULQJ WKH FRXUVH RI WKLV VWXG\ 5RGULJXH]&HUH]R DQG 6KDZ f XVHG D VLPLODU DSSURDFK WR REWDLQ DQWLVHUD WR 3, DQG 3 RI 7909 $OWKRXJK WKH 3 RI 7909 DSSHDUHG WR EH WR[LF WR ( FROL DV VHHQ E\ FHVVDWLRQ RI FHOO JURZWK 3 ZDV H[SUHVVHG LQ ORZ OHYHOV 7KH\ GHWHFWHG WKH 3, DQG 3 SURWHLQV RI 7909 VHURORJLFDOO\ LQ H[WUDFWV IURP LQIHFWHG SODQWV DQG SURWRSODVWV 7KH 3 RI 7(9 LV OLNHZLVH WR[LF WR ( FROL DQG FDQQRW EH H[SUHVVHG LQ LWV HQWLUHW\ 9 'ROMDV SHUVRQDO FRPPf 0DWHULDOV DQG 0HWKRGV &XOWXUH RI 9LUXV ,VRODWHV 7DEOH OLVWV WKH LVRODWHV RI =<09 XVHG LQ WKLV VWXG\ WKHLU VRXUFH DQG WKH RULJLQDO KRVW IURP ZKLFK WKH\ ZHUH LVRODWHG +RVW SODQWV ZHUH PDLQWDLQHG LQ D JURZWK URRP XQGHU D FD KU GD\ OHQJWK ZLWK DQ DYHUDJH WHPSHUDWXUH RI & RU LQ D JUHHQKRXVH ,VRODWHV REWDLQHG IURP RXWVLGH WKH VWDWH RI )ORULGD ZHUH NHSW XQGHU TXDUDQWLQH FRQGLWLRQV LQ D ORFNHG JURZWK URRP 7ZR =<09 LVRODWHV IURP ,VUDHO ZHUH NLQGO\ SURYLGHG E\ < $QWLJQXV 9ROFDQL &HQWHU %HW 'DJDQ ,VUDHOf 7KUHH =<09 LVRODWHV IURP )UDQFH ZHUH NLQGO\

PAGE 69

7DEOH /LVW RI ]XFFKLQL \HOORZ PRVDLF YLUXV LVRODWHV XVHG IRU VHURORJLFDO VWXGLHV RI WKH 3L SURWHLQ ,VRODWH 2ULJLQ +RVW )& )/$ODFKXD &R VTXDVK )& )/'DGH &R VTXDVK )& )/&ROOLHU &R ZDWHUPHORQ =<0958 5HXQLRQ ,VODQG 0RPRUGLFD FKDUDQWLD ,WDO\ ,WDO\ ]XFFKLQL =<09)/$7 )/6XPWHU &R ]XFFKLQL D =<09)/*+ )/6XPWHU &R ]XFFKLQL =<0969 )/3DOP %HDFK &R VTXDVK =<090' )/$ODFKXD &R VTXDVK )/6XPWHU &R VTXDVK )& )/'H6RWR &R ]XFFKLQL +$7 ,VUDHO ]XFFKLQL 1$7 ,VUDHO ]XFFKLQL (J\SW $7&& VTXDVK &RQQHFWLFXW $7&& VTXDVK 7DLZDQ $7&& VTXDVK 3$7 )UDQFH PXVNPHORQ ZHDN )UDQFH PXVNPHORQ ( )UDQFH PXVNPHORQ )& )/'H6RWR &R ]XFFKLQL )& )/'H6RWR &R ]XFFKLQL )& )/'H6RWR &R ]XFFKLQL =<09)/*+ DQ LVRODWH RI =<09 PDLQWDLQHG IRU VHYHUDO \HDUV E\ PHFKDQLFDO LQRFXODWLRQ

PAGE 70

SURYLGHG E\ + /HFRT ,15$ 6WDWLRQ GH 3DWKRORJLH 9HJHWDOH 0RQWIDYHW )UDQFHf 7KUHH DGGLWLRQDO LVRODWHV ZHUH REWDLQHG IURP WKH $PHULFDQ 7\SH &XOWXUH &ROOHFWLRQ $7&&f 7KH FXOWXUH ZDV LVRODWHG E\ :& $GOHU] DQG ZDV REWDLQHG IURP '( 3XUFLIXOO $OO WKH UHPDLQLQJ )ORULGD LVRODWHV ZHUH IURP WKH FROOHFWLRQ RI '( 3XUFLIXOO DQG *: 6LPRQH +RVW SODQWV XVHG IRU URXWLQH DVVD\ DQG PDLQWHQDQFH ZHUH SXPSNLQ &XFUELWD SHSR / n6PDOO 6XJDUnf 6TXDVK & SHSR / n(DUO\ 3UROLILF 6WUDLJKWQHFNnf ZDWHUPHORQ >&LWUXOOXV ODQDWXV 7KXQEf 0DWVXPL t 1DNDL n&ULPVRQ 6ZHHWn@ DQG FDQWDORXSH & PHO / n+DOHV %HVW -XPERnf ZHUH DOVR XVHG IRU VRPH VWXGLHV )RU PHFKDQLFDO LQRFXODWLRQV WLVVXHV ZHUH WULWXUDWHG LQ D PRUWDU DQG SHVWOH ZLWK 0 SRWDVVLXP SKRVSKDWH EXIIHU S+ ZLWK WKH DGGLWLRQ RI PHVK FDUERUXQGXP 7KH VOXUU\ ZDV UXEEHG RQWR IXOO\ H[SDQGHG FRW\OHGRQV ZLWK VWHULOH FKHHVHFORWK SDGV DQG SODQWV ZHUH ULQVHG JHQWO\ ZLWK ZDWHU VHYHUDO PLQXWHV DIWHU LQRFXODWLRQ 0RFN LQRFXODWLRQV ZHUH PDGH XVLQJ H[WUDFWV IURP QRQLQRFXODWHG SODQWV ,QFUHDVH RI 3, DQG 3 E\ 3&5 IRU 6XEFORQLQT DQG ([SUHVVLRQ %DVHG RQ WKH QW VHTXHQFH RI 3, DQG 3 RI =<09)/$7 SULPHUV ZHUH PDGH ZKLFK FRUUHVSRQG WR WKH EHJLQQLQJ DQG HQG RI HDFK SURWHLQ HQFRGLQJ UHJLRQ ZLWK VSHFLDO DWWHQWLRQ WR DUHDV ZLWK D KLJK *& FRQWHQW )RU FORQLQJ RI 3, RI =<09 )/$7 UHVWULFWLRQ VLWHV ZLWK ILYH IODQNLQJ EDVHV RQ WKH n HQG ZHUH LQFRUSRUDWHG LQWR WKH SULPHUV WR SURYLGH IRU

PAGE 71

GLUHFWLRQDO FORQLQJ LQWR WKH S(7K YHFWRU 0F&DUW\ HW DO f DW +LQGOOO DQG %JOOO VLWHV RQ WKH SRO\OLQNHU 7KH S(7K YHFWRU ZDV VHOHFWHG DV WKH H[SUHVVLRQ YHFWRU LQ WKLV VWXG\ ,W LV D PRGLILFDWLRQ RI WKH RULJLQDO S(7 YHFWRU GHYHORSHG E\ 6WXGLHU HW DO f IRU KLJK OHYHO H[SUHVVLRQ RI JHQHV XQGHU WKH FRQWURO RI WKH 7 51$ SRO\PHUDVH IURP EDFWHULRSKDJH 7 ,Q WKLV V\VWHP LI WKH SURWHLQ SURGXFW LV QRW WR[LF WR ( FROL KRVW WUDQVFULSWLRQ FDQQRW FRPSHWH DIWHU LQGXFWLRQ RI WKH 7 SURPRWHU DQG DOPRVW DOO WUDQVFULSWLRQ EHFRPHV GXH WR WKH 7 51$ SRO\PHUDVH 3ULPHUV XVHG IRU LQFUHDVH RI WKH 3, RI =<09)/$7 DUH SUHVHQWHG LQ FKDSWHU 7KH 3, RI =<0958 ZDV DOVR LQFUHDVHG E\ 3&5 IRU VXEFORQLQJ DQG H[SUHVVLRQ 7KH SULPHU IRU WKH nHQG RI WKH =<0958 3, JHQH ZDV WKH VDPH DV IRU =<09)/$7 3, EXW IRU WKH nHQG WKH SULPHU ZDV n ***&7&7$*$7**77&7$$7*&$7n ZKLFK LQFOXGHG D %JOOO VLWH DQG IRXU IODQNLQJ EDVHV RQ WKH nHQG 3ULPHUV IRU LQFUHDVH RI 3 E\ 3&5 ZHUH RQ WKH nWHUPLQXV n**&**$$&$&&$$&$n DQG RQ WKH nWHUPLQXV ZDV n&&$$&&*7$&&$$$$n 7KH SULPHUV IRU 3 GLG QRW LQFOXGH UHVWULFWLRQ VLWHV DQG WKH 3 JHQH ZDV EOXQWHQG OLJDWHG LQWR WKH S(7K YHFWRU 7KH FRUUHFW UHDGLQJ IUDPHV ZHUH VHOHFWHG IRU 3, DQG 3 EDVHG RQ WKH QW DQG GHGXFHG DPLQR DFLG VHTXHQFH WR EH LQ IUDPH ZLWK WKH $7* LQLWLDWLRQ FRGRQ RI S(7K )RU 3, RI ERWK =<09)/$7 DQG =<0958 WKH SODVPLG SURYLGLQJ WKH FRUUHFW UHDGLQJ IUDPH ZDV S(7KE DQG IRU 3 LW ZDV S(7KF ,Q

PAGE 72

DOO FDVHV GLJHVWLRQ DW WKH HQJLQHHUHG UHVWULFWLRQ VLWHV RQ WKH SULPHUV ZDV XQVXFFHVVIXO HYHQ DIWHU SURWHDVH GLJHVWLRQ DQG SKHQROFKORURIRUP H[WUDFWLRQf VR WKH 3&5 SURGXFW ZDV EOXQWHQG OLJDWHG LQWR WKH 6PDOGLJHVWHG &,$3 WUHDWHG SODVPLG $Q LQWHUPHGLDWH ( FROL KRVW VWUDLQ +% ZDV WUDQVIRUPHG 6DPEURRN HW DO f IRU LQLWLDO VWXGLHV 3ODVPLG PLQLSUHSV ZHUH PDGH IURP WUDQVIRUPDQWV WR GHWHUPLQH E\ VHJXHQFH GDWD WKH SUHVHQFH RI WKH FRUUHFW JHQH LWV RULHQWDWLRQ DQG YHULILFDWLRQ RI WKH FRUUHFW UHDGLQJ IUDPH IRU H[SUHVVLRQ 3ULPHUV XVHG IRU VHTXHQFLQJ ZHUH WKH 7 SURPRWHU SULPHU DQG WKH S%5 (FR5, VLWH FORFNZLVH SULPHU ERWK REWDLQHG IURP WKH 8QLYHUVLW\ RI )ORULGD '1$ V\QWKHVLV IDFLOLW\ ,QGXFWLRQ DQG ([SUHVVLRQ RI 3, DQG 3 3URWHLQV 3ODVPLG FXOWXUHV ZKLFK ZHUH LGHQWLILHG DV 3, DQG 3 LQ WKH FRUUHFW RULHQWDWLRQ DQG UHDGLQJ IUDPH ZHUH XVHG WR WUDQVIRUP WKH DSSURSULDWH KRVW IRU H[SUHVVLRQ ( FROL VWUDLQ %/'(S/\V6 $ VLQJOH WUDQVIRUPDQW FRORQ\ JURZQ RQ /% FRQWDLQLQJ DPSLFLOOLQ MXJPOf DQG FKORUDPSKHQLFRO 0JPOf ZDV UDLVHG LQ PO RI 0 PHGLXP 6DPEURRN HW DO f ZLWK b JOXFRVH DQG b WU\SWRQH DW & ZLWK VKDNLQJ WR DQ 2' RI &XOWXUHV ZHUH GLYLGHG LQWR PO DOLTXRWV 2QH PO DOLTXRW ZDV LQGXFHG ZLWK P0 ,37* %RWK LQGXFHG DQG QRQLQGXFHG FXOWXUHV ZHUH DOORZHG WR JURZ DQ DGGLWLRQDO KU DW & &HOOV ZHUH KDUYHVWHG E\

PAGE 73

FHQWULIXJDWLRQ DW J SHOOHWV ZHUH UHVXVSHQGHG LQ RQH KDOI WKH RULJLQDO YROXPH RI 7( EXIIHU P0 7ULV+&O P0 ('7$ S+ f DQG IUR]HQ DW & RYHUQLJKW 7KH YLVFRVLW\ RI WKH FHOO O\VDWH QHFHVVLWDWHG VRQLFDWLRQ IRU VHF WR DOORZ IRU SLSHWWLQJ 7HQ LO RI HDFK VDPSOH ZDV PL[HG ZLWK DQ HJXDO YROXPH RI /DHPPOL GLVVRFLDWLQJ VROXWLRQ /'6f /DHPPOL f WKH PL[WXUHV ZHUH ERLOHG IRU PLQ DQG ZHUH VXEMHFWHG WR DQDO\VLV E\ VRGLXP GRGHF\O VXOIDWH SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV 6'63$*(f *HOV ZHUH VWDLQHG ZLWK &RRPDVVLH %ULOOLDQW %OXH 5 %5/ *DLWKHUVEXUJ 0'f IRU GHWHFWLRQ RI H[SUHVVHG SURWHLQV ,Q DOO FDVHV ERWK LQGXFHG DQG QRQLQGXFHG UHFRPELQDQW SODVPLG FXOWXUHV ZHUH WHVWHG DV ZHOO DV SODVPLG FXOWXUHV FRQWDLQLQJ QR LQVHUWHG JHQH 6LQFH 3 DSSHDUHG WR EH WR[LF WR ( FROL LQ WKLV V\VWHP DV GHWHUPLQHG E\ ODFN RI FHOO JURZWK DQG SURWHLQ H[SUHVVLRQ IROORZLQJ LQGXFWLRQ DQ DOWHUQDWH LQGXFWLRQ SURFHGXUH ZDV DWWHPSWHG XVLQJ WKH EDFWHULRSKDJH &( WR LQIHFW S(7K SODVPLGV FRQWDLQLQJ 3 LQ WKH ( FROL KRVW .06 7KH +06 KDV QR 7 51$ SRO\PHUDVH DQG WKH HQ]\PH LV SURYLGHG E\ LQIHFWLRQ ZLWK &( EDFWHULRSKDJH 7KLV H[SUHVVLRQ FDQ EH XVHIXO IRU H[SUHVVLRQ RI WR[LF JHQH SURGXFWV 6WXGLHU HW DO f $QWLJHQ 3UHSDUDWLRQ DQG $QWLERG\ 3URGXFWLRQ 6LQFH WKH 3, SURWHLQV H[SUHVVHG E\ ERWK =<09)/$7 DQG =<0958 ZHUH LQVROXEOH WKH SURWHLQV ZHUH SDUWLDOO\

PAGE 74

SXULILHG DIWHU VRQLFDWLRQ E\ WKUHH F\FOHV RI FHQWULIXJDWLRQ RI WKH SUHFLSLWDWH DW J DQG ZDVKLQJ ZLWK 7( EXIIHU IROORZHG E\ SUHSDUDWLYH 6'63$*( RQ D PP JHO 3URWHLQ EDQGV ZHUH YLVXDOL]HG E\ LQFXEDWLQJ LQ 0 .&O IRU PLQ DW & 7KH SURWHLQ EDQGV ZHUH H[FLVHG ZDVKHG WKUHH WLPHV LQ FROG GLVWLOOHG ZDWHU IUR]HQ DW & DQG HOXWHG XVLQJ D %LR5DG (OHFWURHOXWHU DW P$PSWXEH ZLWK FRQVWDQW FXUUHQW IRU KU 3RODULW\ ZDV UHYHUVHG IRU PLQ DQG WKH H[WUDFWHG SURWHLQV ZHUH GLDO\]HG RYHUQLJKW DJDLQVW GLVWLOOHG ZDWHU 3XULW\ RI WKH HOXWHG SURWHLQ ZDV FKHFNHG E\ DQDO\WLFDO 6'63$*( DIWHU ZKLFK WKH SURWHLQ ZDV O\RSKLOL]HG $ 1HZ =HDODQG ZKLWH UDEELW QR f ZDV LPPXQL]HG RQ GD\ RQH ZLWK PJ RI =<09)/$7 3, SURWHLQ LQ PO VWHULOH GLVWLOOHG ZDWHU ZKLFK ZDV HPXOVLILHG ZLWK PO RI )UHXQGnV FRPSOHWH DGMXYDQW ,QMHFWLRQV ZHUH PDGH XVLQJ PO RI HPXOVLRQ SHU VLWH ZLWK WZR LQWUDPXVFXODU VLWHV SHU KLS 2Q GD\ DQG GD\ PJ SURWHLQ ZDV XVHG ZLWK PO ZDWHU DQG PO )UHXQGnV LQFRPSOHWH DGMXYDQW 7KH VDPH VFKHGXOH ZDV IROORZHG IRU UDEELW QR ZKLFK ZDV LPPXQL]HG ZLWK WKH 3, SURWHLQ RI =<0958 5DEELWV ZHUH EOHG RQ D ZHHNO\ EDVLV VWDUWLQJ RQ GD\ IRU PRQWKV ZLWK D ZHHN LQWHUYDO EHIRUH D ERRVWHU LQMHFWLRQ RQ GD\ DQG VXEVHTXHQW EOHHGLQJ

PAGE 75

:HVWHUQ %ORWWLQJ 3URFHGXUH 7KH ZHVWHUQ EORWWLQJ SURFHGXUH ZDV FRQGXFWHG HVVHQWLDOO\ DV GHVFULEHG E\ 7RZELQ HW DO f XVLQJ D %LR5DG 0LQL3URWHDQ ,, (OHFWURSKRUHVLV &HOO DQG %LR5DG 7UDQV%ORW (OHFWURSKRUHWLF 7UDQVIHU &HOO 7HQ SHU FHQW JHOV ZHUH XVHG SULPDULO\ ZLWK RFFDVLRQDO DQG b JHOV EHLQJ UXQ IRU VSHFLDO SXUSRVHV
PAGE 76

FRQWDLQLQJ ( FROL O\VDWH DW PJPO DQG H[WUDFWV IURP QRQLQIHFWHG SODQWV 7KH QRQLQIHFWHG SODQW H[WUDFW ZDV SUHSDUHG E\ WULWXUDWLQJ OHDI WLVVXH LQ ZDWHU ZYf DQG VWUDLQLQJ WKURXJK D VLQJOH OD\HU RI PRLVWHQHG FKHHVHFORWK 7KH VSHFLILF SULPDU\ DQWLERG\ ZDV DGGHG DW GLOXWLRQ 7KH SURFHGXUH IRU WKH VHFRQGDU\ DQWLERG\ DQG GHYHORSPHQW DUH DV GHVFULEHG LQ FKDSWHU IRU LPPXQRVFUHHQLQJ 5HDFWLRQV ZHUH DOORZHG WR GHYHORS DW 57 DQG ZHUH VWRSSHG E\ ULQVLQJ LQ GHLRQL]HG ZDWHU ,Q 9LWUR 7UDQVODWLRQ DQG ,PPXQRSUHFLSLWDWLRQ 7KH ZKHDW JHUP :*f LQ YLWUR WUDQVODWLRQ SURFHGXUH ZDV WKH VDPH DV GHVFULEHG E\ &OLQH HW DO f 7KUHH J RI 51$ IURP =<09)/$7 LQ D , :* H[WUDFW PL[WXUH FRQWDLQLQJ &L RI >+@ OHXFLQH ZDV LQFXEDWHG DW & IRU PLQ ,PPXQRSUHFLSLWDWLRQ DQDO\VHV ZHUH SHUIRUPHG DV GHVFULEHG E\ 'RXJKHUW\ DQG +LHEHUW f 3UHFLSLWDWHG SURGXFWV ZHUH VHSDUDWHG RQ D b 6'63$*( DQG GHWHFWHG RQ GULHG JHOV E\ IOXRURJUDSK\ DV GHVFULEHG E\ %RQQHU DQG /DVN\ f $QWLVHUD XVHG IRU LPPXQRSUHFLSLWDWLRQ RI UQ YLWUR WUDQVODWLRQ SURGXFWV ZHUH WR WKH 3, DQG &3 RI =<09 DQG WR WKH $, RI 3569: 3URGXFWLRQ RI $QWLVHUD WR 6\QWKHWLF 3HSWLGHV 6\QWKHWLF SHSWLGHV WR WKH 1WHUPLQXV RI ERWK WKH 3, DQG 3 SURWHLQV RI =<09 ZHUH SUHSDUHG E\ WKH 8QLYHUVLW\ RI )ORULGD SURWHLQ V\QWKHVL]LQJ IDFLOLW\ 7KH DPLQR DFLG VHTXHQFH RI WKH SHSWLGH SUHSDUHG WR 3, ZDV 0HW$OD6HU,OH

PAGE 77

0HW,OH*O\6HU,OH6HU9DO3UR DQG WR 3 ZDV *O\7KU3UR 7KU*OQ$UJ,OH/\V/HX*OX*OX*OQ %RWK IUHH SHSWLGH DQG SHSWLGH FRQMXJDWHG WR %6$ ZHUH XVHG DV LPPXQRJHQV 3HSWLGHV ZHUH FRXSOHG WR %6$ DFFRUGLQJ WR +DUORZ DQG /DQH f 2QH PJ SHSWLGH DQG PJ %6$ ZHUH HDFK GLVVROYHG LQ PO RI 0 SRWDVVLXP SKRVSKDWH EXIIHU S+ 7ZR KXQGUHG LO RI IUHVK b JOXWDUDOGHK\GH ZDV DGGHG WR PO RI WKH SURWHLQSHSWLGH VROXWLRQ DQG VWLUUHG RYHUQLJKW DW URRP WHPSHUDWXUH 7KLV ZDV IROORZHG E\ GLDO\VLV DJDLQVW GHLRQL]HG ZDWHU WKUHH WLPHV RYHU D KU SHULRG 7KH PDWHULDO ZDV O\RSKLOL]HG DQG VWRUHG DW & ,PPXQL]DWLRQ SURWRFROV IROORZHG ZHUH DV GHVFULEHG IRU WKH H[SUHVVHG 3, SURWHLQ IURP ( FROL 5DEELW QXPEHUV IRU 3 SHSWLGH DQG WKH FRQMXJDWHG 3 SHSWLGH ZHUH DQG UHVSHFWLYHO\ 7KH UDEELW QXPEHUV IRU WKH 3, SHSWLGH DQG WKH FRQMXJDWHG 3, SHSWLGH ZHUH DQG UHVSHFWLYHO\ /LJKW 0LFURVFRS\ DQG ,PPXQRIOXRUHVFHQFH 7HVWV ,QGLUHFW LPPXQRIOXRUHVFHQFH WHVWV ZHUH FRQGXFWHG DV GHVFULEHG E\ +LHEHUW HW DO f ZLWK VRPH PRGLILFDWLRQV 6L[ 0O RI b GLPHWK\O VXOIR[LGH '062f LQ SKRVSKDWH EXIIHUHG VDOLQH 3%6f P RI KHDOWK\ SODQW H[WUDFW LQ 3%6 FRQWDLQLQJ b RYDOEXPLQf DQG ILO RI DQWLVHUXP ZHUH LQFXEDWHG WRJHWKHU IRU PLQ SULRU WR DGGLWLRQ RI HSLGHUPDO VWULSV IURP SODQW WLVVXH (SLGHUPDO VWULSV ZHUH LQFXEDWHG LQ WKH DQWLERG\ SUHSDUDWLRQ LQ D PO PLFURIXJH WXEH DIWHU YRUWH[LQJ IRU VHF WR HQVXUH FRPSOHWH H[SRVXUH RI WKH

PAGE 78

WLVVXH WR WKH DQWLERG\ VROXWLRQ 7LVVXH ZDV LQFXEDWHG LQ WKH DQWLERG\ VROXWLRQ RQ D VKDNHU IRU KU DW 57 LQ WKH GDUN 5LQVLQJ EHWZHHQ VWHSV ZDV GRQH WZLFH LQ PO RI 7%67 DIWHU YRUWH[LQJ IRU VHF DQG RQFH IRU KU LQ 3%6 ZKLOH VKDNLQJ DW 57 LQ WKH GDUN 5KRGDPLQHFRQMXJDWHG SURWHLQ $ 6LJPD &KHPLFDO &R 6W /RXLV 02f ZDV XVHG DV D IOXRUHVFHQW SUREH 7KH UKRGDPLQHFRQMXJDWH ZDV GLOXWHG JPO LQ 3%6 (LJKW Q RI WKH FRQMXJDWH ZDV PL[HG ZLWK Q RI b '062 DQG  RI 3%6 $IWHU YRUWH[LQJ ULQVHG WLVVXH ZDV LQFXEDWHG LQ WKLV VROXWLRQ DW 57 IRU KU LQ WKH GDUN ZKLOH VKDNLQJ $IWHU D ILQDO ULQVH WLVVXH ZDV PRXQWHG RQ PLFURVFRSH VOLGHV XVLQJ $JXDPRXQW /HUQHU /DEV 1HZ +DYHQ &7f n&ULPVRQ 6ZHHWn ZDWHUPHORQ ZDV XVHG DV WKH KRVW IRU LPPXQRIOXRUHVFHQFH WHVWV 7LVVXH VHFWLRQV ZHUH SKRWRJUDSKHG ZLWK HSLIOXRUHVFHQFH RSWLFV XVLQJ D 1LNRQ )OXRSKRW PLFURVFRSH ZLWK D *$ ILOWHU 5HVXOWV ([SUHVVLRQ RI 3, DQG 3 &RGLQJ 5HJLRQV LQ ( FROL ,QLWLDO HIIRUWV WR FORQH 3, E\ FRKHVLYH HQG OLJDWLRQ DW GLJHVWHG VLWHV RI 3&5 SURGXFWV ZHUH XQVXFFHVVIXO 6XEVHTXHQWO\ 3&5 SURGXFWV RI 3, DQG 3 ZHUH EOXQWHQG OLJDWHG VXFFHVVIXOO\ LQWR WKH S(7K SODVPLG &ORQHV ZHUH VHTXHQFHG WR GHWHUPLQH WKH FRUUHFW RULHQWDWLRQ DQG UHDGLQJ

PAGE 79

)LJ ([SUHVVLRQ RI 3, SURWHLQ RI =<09)/$7 FORQHG LQWR WKH S(7K SODVPLG $ &XOWXUHV H[SUHVVLQJ 3, ZHUH JURZQ IRU KUV DIWHU LQGXFWLRQ ZLWK ,37* 1RQLQGXFHG FXOWXUHV ZHUH SURFHVVHG WKH VDPH DV LQGXFHG FXOWXUHV /DQHV DQG DUH LQGXFHG FXOWXUHV FDUU\LQJ WKH 3, JHQH /DQHV DQG DUH QRQLQGXFHG FXOWXUHV FDUU\LQJ WKH 3, JHQH /DQH LV D QRQLQGXFHG FXOWXUH FDUU\LQJ WKH S(7K SODVPLG RQO\ DQG ODQH LV WKH VDPH FXOWXUH LQGXFHG % /DQH LV WKH 3, SURWHLQ ZKLFK ZDV SDUWLDOO\ SXULILHG E\ FHQWULIXJDWLRQ SULRU WR SUHSDUDWLYH HOHFWURSKRUHVLV DQG ODQH LV WKH VXSHUQDWH IURP WKH VDPH SUHSDUDWLRQ $UURZ LQGLFDWHV WKH 3, H[SUHVVHG SURWHLQ DW FD N'D

PAGE 80

IUDPH DQG ZHUH WKHQ XVHG WR WUDQVIRUP WKH DSSURSULDWH ( FROL KRVW IRU H[SUHVVLRQ %/O'(S/\V6 ,QGXFWLRQ RI 3, IURP =<09)/$7 UHVXOWHG LQ RYHUH[SUHVVLRQ RI DQ LQVROXEOH SURWHLQ SURGXFW RI FD N'D )LJ $f )LIW\ PO FXOWXUHV ZHUH LQGXFHG IRU ODUJH VFDOH 3, SURWHLQ SURGXFWLRQ 7KH 3, SURWHLQ ZDV LQVROXEOH DQG WKXV ZDV HDVLO\ SXULILHG E\ WKUHH F\FOHV RI FHQWULIXJDWLRQ DQG ZDVKLQJ WKHUHE\ SURYLGLQJ D SURGXFW IUHH RI PRVWEDFWHULDO SURWHLQV )LJ %f )XUWKHU SXULILFDWLRQ RI 3, SURWHLQ IURP EDFWHULDO O\VDWHV ZDV DFFRPSOLVKHG E\ SUHSDUDWLYH 6'63$*( DQG HOHFWURHOXWLRQ 7KH SURWHLQ SURGXFW ZDV WKHQ O\RSKLOL]HG DQG XVHG IRU DQWLVHUXP SURGXFWLRQ LQ UDEELWV %OHHGLQJ GDWHV IRU 3, RI =<09)/$7 XVHG ZHUH IURP ZHHNV WR PRQWKV DIWHU WKH RULJLQDO VHULHV RI LPPXQL]DWLRQV )RU WKH 3, RI =<09)/$7 UDEELW ZDV EOHG IURP 6HSWHPEHU WKURXJK -XO\ 7KH 3, RI =<0958 ZDV H[SUHVVHG DQG SXULILHG LQ D VLPLODU PDQQHU IRU XVH DV DQ LPPXQRJHQ )RU WKH 3, RI =<9058 UDEELW ZDV EOHG IURP 0D\ WKURXJK -XO\ ,QGXFWLRQ RI WKH 3 SURWHLQ ZDV XQVXFFHVVIXO LQ ERWK WKH S(7K%/'(S/\V6 V\VWHP DQG ZKHQ XVLQJ WKH EDFWHULRSKDJH &( WR LQIHFW WKH KRVW +06 FDUU\LQJ WKH S(7K SODVPLG GDWD QRW VKRZQf 7KHVH UHVXOWV DUH VLPLODU WR WKH UHVXOWV ZLWK WKH 7(9 3 SURWHLQ 9 'ROMDV SHUVRQDO FRPPf ZKLFK LV WR[LF LQ ( FROL DQG WKXV FDQQRW EH H[SUHVVHG LQ LWV HQWLUHW\ 5RGULJXH]&HUH]R DQG 6KDZ f

PAGE 81

H[SUHVVHG 3 RI 7909 LQ ( FROL 7KH LQGXFHG EDFWHULDO FHOOV FHDVHG JURZWK IROORZLQJ LQGXFWLRQ ZLWK ,37* DQG WKXV WKH OHYHO RI H[SUHVVLRQ ZDV ORZ ( 5RGULJXH]&HUH]R SHUVRQDO FRPPf $SSDUHQWO\ WKH 3 SURWHLQ RI DOO WKUHH SRW\YLUXVHV LV WR[LF WR YDU\LQJ GHJUHHV LQ ( FROL 'HWHFWLRQ RI 3, 3URWHLQ LQ 3ODQWV ,QIHFWHG ZLWK =<09 ,QLWLDO H[WUDFWLRQ RI =<09LQIHFWHG SODQW WLVVXHV ZLWK /'6 JDYH YHU\ ZHDN UHDFWLRQV LQ ZHVWHUQ EORWV ([WUDFWLRQ ZLWK (6 EXIIHU JDYH VDWLVIDFWRU\ UHDFWLRQV ZLWK =<09 LQIHFWHG SODQW WLVVXHV LQ ZHVWHUQ EORWV XVLQJ DQWLVHUXP WR 3, RI =<09)/$7 DV D SUREH 7KH DQWLVHUXP UHDFWHG VSHFLILFDOO\ WR D FD N'D SURWHLQ LQ SODQW WLVVXH LQIHFWHG ZLWK =<09)/$7 1R SURWHLQ ZDV GHWHFWHG LQ H[WUDFWV IURP KHDOWK\ SODQW WLVVXHV :HVWHUQ EORWV ZLWK SUHLPPXQH VHUXP GLG QRW UHVXOW LQ D GHWHFWDEOH SURWHLQ UHDFWLRQ ,Q ZHVWHUQ EORWV XVLQJ DQWLVHUXP WR WKH 3, RI =<09 )/$7 f D 3, SURWHLQ UHDFWLRQ DW FD N'D IRU =<09 )/$7 ZDV QRWHG 6RPH KHWHURJHQHLW\ ZDV VHHQ DPRQJ WKH RWKHU =<09 LVRODWHV XVHG LQ WKLV VWXG\ )LJ f $ KLJKHU PROHFXODU ZHLJKW PZf RI FD N'D ZDV QRWHG IRU VRPH =<09 LVRODWHV LQFOXGLQJ =<090' )& )& DQG WKUHH LVRODWHV IURP )UDQFH 3$7 ZHDN DQG (f 7DEOH f 3, SURGXFWV WKDW ZHUH VOLJKWO\ VPDOOHU WKDQ WKDW RI =<09)/$7 LQFOXGHG WKRVH RI =<0969 WKUHH $7&& LVRODWHV RI =<09 IURP (J\SW 7DLZDQ DQG &RQQHFWLFXWf DQG WKH RULJLQDO =<09

PAGE 82

LVRODWH IURP ,WDO\ ,Q DGGLWLRQ WR VL]H GLIIHUHQFHV RI 3, SURWHLQ VRPH LVRODWHV VKRZHG D SRVVLEOH EUHDNGRZQ SURGXFW RI FD N'D ZKHUHDV RWKHUV )& ZHDN DQG ( IURP )UDQFHf VKRZHG DQ LQFRPSOHWH SURFHVVLQJ RI 3, DQG +&3UR E\ WKH UHDFWLRQ RI D EDQG RI FD N'D 7KLV N'D EDQG RI )& ZDV WHVWHG DQG DOVR UHDFWHG ZLWK DQWLVHUXP WR WKH $, RI 3569: )LJ f 7KH VL]H KHWHURJHQHLW\ EHWZHHQ =<090' =<09)/$7 DQG =<0969 VHHQ LQ 6'63$*( XVLQJ b DFU\ODPLGH JHOV ZLWK DQWLVHUD WR WKH 3, RI =<09)/$7 DV D SUREH ZDV IXUWKHU H[DPLQHG E\ VXEMHFWLQJ WKHP WR 6'63$*( LQ b DQG b DFU\ODPLGH JHOV )LJ f 7KHVH VL]H GLIIHUHQFHV ZHUH DOVR QRWHG LQ WKH b DQG b JHOV SURYLGLQJ HYLGHQFH WKDW WKH KHWHURJHQHLW\ VHHQ LV GXH WR WUXH PZ GLIIHUHQFHV EHWZHHQ 3, SURWHLQV DQG QRW VROHO\ GXH WR FKDUJH GLIIHUHQFHV +HGULFN DQG 6PLWK f 7KH VL]H GLIIHUHQFHV EHWZHHQ WKH 3, SURWHLQV RI =<09 )/$7 =<090' DQG =<0969 ZHUH FRQVLVWHQW UHJDUGOHVV RI WKH KRVW XVHG IRU ZHVWHUQ EORW DVVD\V 7KHVH WKUHH LVRODWHV ZHUH WHVWHG LQ SXPSNLQ ZDWHUPHORQ FDQWDORXSH DQG VJXDVK )LJ f 2I WKH =<09 LVRODWHV WHVWHG LQ WKLV VWXG\ =<0958 UHDFWHG ZHDNO\ RU QRW DW DOO ZLWK WKH DQWLVHUXP WR WKH 3, RI =<09)/$7 7KLV LVRODWH GLG UHDFW ZLWK DQWLVHUD WR WKH &3 DQG &O RI =<09 DQG WR WKH $, RI 3569: )LJ f ([WUDFWV IURP SXPSNLQ VLQJO\ LQIHFWHG ZLWK DQ\ RI VHYHUDO RWKHU

PAGE 83

B )LJ &KDUDFWHUL]DWLRQ RI WKH UHDFWLRQV RI WKH 3O UHODWHG SURWHLQV RI LVRODWHV RI ]XFFKLQL \HOORZ PRVDLF YLUXV =<09f LQ ZHVWHUQ EORWV %ORWV ZHUH SUREHG ZLWK DQWLVHUXP QR FROOHFWLRQ GDWH f WR WKH 3, SURWHLQ RI =<09)/$7

PAGE 84

7DEOH (YLGHQFH IRU DQWLJHQLF DQG VL]H YDULDWLRQ RI 3O UHODWHG SURWHLQV DPRQJ =<09 LVRODWHV LQ ZHVWHUQ EORWV XVLQJ DQWLVHUXP WR =<09)/$7 f DQG =<0958 f 7DQDW3 $SSUR[LPDWH PROHFXODU ZHLJKW 5HDFWLRQ SDWWHUQf 5HDFWLRQ SDWWHUQf )& D )& )& =<0958 E f f ,WDO\ f =<09)/$7 F =<09)/*+ =<0969 =<090' +$7 1$7 (J\SW &RQQHFWLFXW 7DLZDQ 3$7 ZHDN ( )& )& )& D PROHFXODU ZHLJKWV DUH LQ N'D E f H[WUHPHO\ ZHDN UHDFWLRQV QRW GHWHFWDEOH LQ HYHU\ WHVW F QR GHWHFWDEOH UHDFWLRQ

PAGE 85

)LJ :HVWHUQ EORWV RI H[WUDFWV IURP SODQWV VLQJO\ LQIHFWHG ZLWK VHOHFWHG =<09 LVRODWHV %ORWV ZHUH SUREHG ZLWK DQWLVHUD WR 3, RI =<09)/$7 3,f DQG WR WKH $, RI 3569: $,f $UURZ LQGLFDWHV WKH SRVLWLRQ RI WKH N'D SURWHLQ RI LVRODWH )& ZKLFK UHDFWV ZLWK ERWK 3, DQG $, DQWLVHUD

PAGE 86

b )LJ :HVWHUQ EORWV VKRZLQJ b DQG b 6'63$*( JHO FRQFHQWUDWLRQV $QWLVHUXP XVHG WR SUREH EORWV ZDV WR WKH 3, RI =<0)9)/$7 7KH VL]H GLIIHUHQFHV DPRQJ WKH LVRODWHV VKRZQ ZHUH FRQVLVWHQW UHJDUGOHVV RI WKH JHO FRQFHQWUDWLRQ 3O SURWHLQ H[SUHVVHG IURP ( FROL PZ PROHFXODU ZHLJKW PDUNHUV

PAGE 87

SXPSNLQ t D L L L 1 1 1 VTXDVK FDQWDORXSH ZDWHUPHORQ L L }+ )LJ 'HWHFWLRQ RI WKH 3, SURWHLQ LQ ZHVWHUQ EORWV RI H[WUDFWV IURP SODQWV RI IRXU FXFXUELW FXOWLYDUV VLQJO\ LQIHFWHG ZLWK WKUHH LVRODWHV RI ]XFFKLQL \HOORZ PRVDLF YLUXV 7KH KRVWV ZHUH SXPSNLQ &XFUELWD SHSR n6PDOO 6XJDUnf VTXDVK & SHSR n(DUO\ 3UROLILF 6WUDLJKWQHFNnf FDQWDORXSH &XFXPLV PHOR n+DOHnV %HVW -XPERnf DQG ZDWHUPHORQ &LWUXOOXV ODQDWXV n&ULPVRQ 6ZHHWnf $QWLVHUXP QR FROOHFWLRQ GDWH f WR 3, RI =<09)/$7 ZDV XVHG DV WKH SUREH

PAGE 88

)LJ :HVWHUQ EORWV RI H[WUDFWV IURP SXPSNLQ VLQJO\ LQIHFWHG ZLWK VHOHFWHG =<09 LVRODWHV XVLQJ DQWLVHUXP WR 3, RI =<09)/$7 &O DQG &3 RI =<09)/$7 DQG WR WKH $, RI 3569: DV SUREHV 7KH =<0958 LVRODWH UHDFWHG ZHDNO\ RU QRW DW DOO ZLWK DQWLVHUXP WR WKH 3, RI =<09)/$7 EXW UHDFWV ZLWK RWKHU DQWLVHUD 3, PHPEUDQH SUREHG ZLWK DQWLVHUXP WR WKH 3, SURWHLQ RI =<09)/$7 $, PHPEUDQH SUREHG ZLWK DQWLVHUXP WR WKH $, RI 3569: &O PHPEUDQH SUREHG ZLWK DQWLVHUXP WR WKH &O RI =<09)/$7 &3 PHPEUDQH SUREHG ZLWK DQWLVHUXP WR WKH &3 RI =<09)/$7 $UUDQJHPHQW RI LVRODWHV LV WKH VDPH IRU DOO IRXU PHPEUDQHV $UURZV LQGLFDWH SRVLWLRQ RI UHVSHFWLYH SURWHLQV LQ HDFK PHPEUDQH

PAGE 89

YLUXVHV WKDW LQIHFW FXFXUELWV EXW DUH GLVWLQFW IURP =<09 ZHUH DOVR WHVWHG LQ ZHVWHUQ EORWV 7KHVH LQFOXGHG 3569: :09 DQ XQDPHG SRW\YLUXV )&f ZKLFK LV DQWLJHQLFDOO\ GLIIHUHQW IURP =<09 3569: DQG :09 3XUFLIXOO HW DO f FXFXPEHU PRVDLF YLUXV &09f DQG D SRVVLEOH SRWH[YLUXV RI FXFXUELWV )& 3XUFLIXOO HW DO f $OO RI WKHVH H[WUDFWV ZHUH QHJDWLYH LQ ZHVWHUQ EORW WHVWV ZKHQ WHVWHG DJDLQVW DQWLVHUXP WR WKH 3, RI =<09)/$7 )LJ f $QWLVHUXP WR WKH 3, SURWHLQ RI =<0958 ZDV DOVR QHJDWLYH ZKHQ WHVWHG DJDLQVW 3569: :09 )& DQG )& GDWD QRW VKRZQf 7KLV DQWLVHUXP VKRZHG GLIIHUHQWLDO UHDFWLYLW\ WR VHYHUDO =<09 LVRODWHV 7DEOH )LJ f )RU WKRVH LVRODWHV ZKLFK UHDFWHG ZLWK DQWLVHUD WR ERWK =<09 )/$7 3, DQG =<0958 3, WKH DSSUR[LPDWH PZ HVWLPDWHV IRU WKRVH LVRODWHV ZHUH WKH VDPH ,PPXQRSUHFLSLWDWLRQ $QDO\VLV RI ,Q 9LWUR 7UDQVODWLRQ 3URGXFWV 7UDQVODWLRQ SURGXFWV REWDLQHG LQ WKH :* Q YLWUR WUDQVODWLRQ V\VWHP ZHUH LPPXQRSUHFLSLWDWHG ZLWK DQWLVHUD WR WKH 3, DQG &3 RI =<09)/$7 WR WKH $O RI 3569: DQG ZLWK SUHLPPXQH VHUXP 6LQFH WKH :* WUDQVODWLRQ V\VWHP GRHV QRW \LHOG ODUJH SURGXFWV DQDO\VLV RI 6'63$*( VKRZHG RQO\ WKH 3, DQG $O SUHVHQW LQ WRWDO WUDQVODWLRQ SURGXFWV )LJ f 7KH DQWLVHUD WR 3, DQG $O SUHFLSLWDWHG SURGXFWV RI WKH DSSURSULDWH PZ IRU HDFK FD N'D DQG N'D

PAGE 90

rID O 1 ; f &X Z UR MM Z IIM 2nr MJ Z Dr R IW ; )LJ 6SHFLILFLW\ RI DQWLVHUXP QR FROOHFWLRQ GDWH f WR 3, RI =<09)/$7 LQ ZHVWHUQ EORWV ([WUDFWV IURP VDPSOHV LQIHFWHG ZLWK =<09)/$7 VKRZ D SURPLQHQW EDQG DW FD N'D DQG D ZHDN EDQG DW FD N'D 1RWH ODFN RI UHDFWLYLW\ ZLWK H[WUDFWV IURP SXPSNLQ VLQJO\ LQIHFWHG ZLWK DQ\ RI WKUHH SRW\YLUXVHV 3569: :09 f D FXFXPRYLUXV &09f D SRVVLEOH SRWH[YLUXV )& SRWH[f RU IURP QRQLQRFXODWHG SXPSNLQ OHDYHV +663KHDOWK\f

PAGE 91

)LJ 5HDFWLYLW\ RI ]XFFKLQL \HOORZ PRVDLF YLUXV =<09f LVRODWHV LQ ZHVWHUQ EORWV XVLQJ DQWLVHUXP WR WKH 3, RI =<0958 DV D SUREH %ORWV ZHUH SUREHG ZLWK DQWLVHUXP QR FROOHFWLRQ GDWH f

PAGE 92

)LJ ,PPXQRSUHFLSLWDWLRQ RI ZKHDW JHUP LQ YLWUR WUDQVODWLRQ SURGXFWV 73 WRWDO SURGXFWV 3O SURGXFWV LPPXQRSUHFLSLWDWHG ZLWK =<09)/$7 3, DQWLVHUXP $, SURGXFWV LPPXQRSUHFLSLWDWHG ZLWK DQWLVHUXP WR WKH $, RI 3569: &3 SURGXFWV LPPXQRSUHFLSLWDWHG ZLWK DQWLVHUXP WR WKH &3 RI =<09)/$7 DQG 16 SURGXFWV LPPXQRSUHFLSLWDWHG ZLWK SUHLPPXQH VHUXP PZ PROHFXODU ZHLJKWV DUH IURP WRS WR ERWWRP N'D

PAGE 93

UHVSHFWLYHO\ 1HLWKHU WKH &3 QRU SUHLPPXQH VHUXP SUHFLSLWDWHG D SURWHLQ SURGXFW ,QWHUHVWLQJO\ WKH 3, DQWLVHUXP SUHFLSLWDWHG D VPDOOHU SURGXFW FD N'D ZKLFK PD\ EH VLPLODU WR WKH SRVVLEOH EUHDNGRZQ SURGXFW XVXDOO\ VHHQ LQ LPPXQREORWV IRU WKDW LVRODWH 'HWHFWLRQ RI 3, 3URWHLQ E\ ,QGLUHFW ,PPXQRIOXRUHVFHQFH )OXRUHVFHQFH PLFURVFRS\ RI UKRGDPLQHFRQMXJDWHG SURWHLQ $ ODEHOHG DQWLVHUXP WR WKH 3, SURWHLQ VKRZHG WKH SUHVHQFH RI DJJUHJDWHV LQ WKH F\WRSODVP RI HSLGHUPDO VWULSV IURP =<09 LQIHFWHG ZDWHUPHORQ ,VRODWH =<09)/$7 VKRZHG DFFXPXODWLRQ RI DPRUSKRXV DJJUHJDWHV ZLWK SDUWLFXODWH IOXRUHVFLQJ ERGLHV LQ FHOOV RI HSLGHUPDO WLVVXHV )LJ f ZKHQ WUHDWHG ZLWK DQWLVHUXP WR WKH 3, RI =<09)/$7 6LPLODU UHVXOWV ZHUH VHHQ ZLWK LVRODWHV =<0969 DQG )& ,W LV SRVVLEOH MXGJLQJ IURP WKH ORFDWLRQ RI WKH IOXRUHVFLQJ PDWHULDO WKDW WKHVH ERGLHV PLJKW EH DVVRFLDWHG ZLWK WKH &O SURWHLQ LQFOXVLRQV )XUWKHU VWXGLHV XVLQJ HOHFWURQ PLFURVFRS\ RI XOWUDWKLQ VHFWLRQV ZLOO EH QHHGHG WR DVFHUWDLQ WKLV (SLGHUPDO VWULSV RI =<09)/$7 =<0969 DQG )& VKRZHG QR IOXRUHVFHQFH ZLWK SUHLPPXQH VHUXP DV D SUREH )LJ 7DEOH f DQG WKH DJJUHJDWHV FRXOG EH VHHQ XQVWDLQHG LQ HSLGHUPDO WLVVXH /LNHZLVH WLVVXHV RI ZDWHUPHORQ LQIHFWHG ZLWK =<0958 DQG KHDOWK\ ZDWHUPHORQ PRFNLQRFXODWHGf ZHUH QHJDWLYH IRU IOXRUHVFHQFH ZLWK ERWK DQWLVHUXP WR WKH 3, RI =<09)/$7 DQG SUHLPPXQH VHUD $V ZLWK WKH =<09)/$7 =<0969 DQG )& DJJUHJDWHV RI 3, OLNH WKRVH VHHQ LQ

PAGE 94

IOXRUHVFHQFH WHVWV FRXOG EH VHHQ LQ =<0958 LQIHFWHG WLVVXHV DOWKRXJK WKH DJJUHJDWHV GLG QRW IOXRUHVFH )LJ f 0RFNLQRFXODWHG ZDWHUPHORQ WLVVXHV VKRZHG QR IOXRUHVFHQFH ZKHQ VWDLQHG ZLWK HLWKHU LPPXQH )LJ f RU SUHLPPXQH VHUXP 7LVVXHV RI =<09)/$7 =<0969 =<0958 )& DQG PRFNLQRFXODWHG ZDWHUPHORQ ZHUH DOVR WHVWHG LQ LPPXQRIOXRUHVFHQFH VWXGLHV XVLQJ DQWLVHUXP WR WKH 3, RI =<0958 2QO\ ZDWHUPHORQ WLVVXH LQIHFWHG ZLWK =<0958 RU )& VKRZHG WKH SDUWLFXODWH IOXRUHVFLQJ DJJUHJDWHV ZKHUHDV =<09)/$7 69 DQG PRFNLQRFXODWHG WLVVXHV VKRZHG QR IOXRUHVFLQJ DJJUHJDWHV 7DEOH f $OWKRXJK DJJUHJDWHV ZHUH VHHQ LQ =<09)/$7 DQG LQ =<0969 LQIHFWHG WLVVXHV WKH\ GLG QRW IOXRUHVFH 6HURORJLFDO 6WXGLHV RI 6\QWKHWLF 3HSWLGHV WR 3, DQG 3 RI =<09 $QWLVHUD WR WKH 1WHUPLQDO DPLQR DFLGV RI 3, DQG 3 ZHUH XVHG LQ 6'6LPPXQRGLIIXVLRQ (/,6$ GRWLPPXQREORWV DQG LPPXQREORWWLQJ DVVD\V 1RQH RI WKH DQWLVHUD ZKHWKHU WR WKH FRQMXJDWHG SHSWLGH RU WR WKH IUHH SHSWLGH UHDFWHG ZLWK DQ\ GHWHFWDEOH SURWHLQ SURGXFW IURP =<09LQIHFWHG SODQW WLVVXHV

PAGE 95

)LJ /RFDOL]DWLRQ RI 3, LQ HSLGHUPDO WLVVXH IURP VWHPV RI ZDWHUPHORQ LQIHFWHG ZLWK =<09)/$7 $QWLVHUXP WR WKH 3, RI =<09)/$7 UDEELW QR FROOHFWLRQ GDWH fZDV XVHG DV WKH GHWHFWLQJ DQWLERG\ DQG WLVVXHV ZHUH VWDLQHG ZLWK 5KRGDPLQHSURWHLQ $ DQG SKRWRJUDSKHG ZLWK HSLIOXRUHVFHQFH RSWLFV 1RWH WKH VSHFLILF IOXRUHVFHQFH RI JUDQXODU DJJUHJDWHV 0DJQLILFDWLRQ ; $ WLVVXH SKRWRJUDSKHG ZLWK HSLIOXRUHVFHQFH RSWLFV % VDPH ILHOG RI YLHZ SKRWRJUDSKHG ZLWK YLVLEOH OLJKW

PAGE 96

)LJ (SLGHUPDO VWULSV RI ZDWHUPHORQ WLVVXH LQIHFWHG ZLWK =<09)/$7 WUHDWHG ZLWK SUHLPPXQH VHUXP VWDLQHG ZLWK 5KRGDPLQH SURWHLQ $ 0DJQLILFDWLRQ ; $ WLVVXH SKRWRJUDSKHG ZLWK HSLIOXRUHVFHQFH RSWLFV % VDPH ILHOG RI YLHZ SKRWRJUDSKHG ZLWK YLVLEOH OLJKW

PAGE 97

)LJ $JJUHJDWHV RI 3, SURWHLQ LQ ZDWHUPHORQ VWHP HSLGHUPDO WLVVXH LQIHFWHG ZLWK =<0958 WUHDWHG ZLWK DQWLVHUXP WR WKH 3, RI =<09)/$7 FROOHFWLRQ GDWH f VWDLQHG ZLWK 5KRGDPLQHSURWHLQ $ 1RWH JUDQXODU DJJUHJDWHV DUH FOHDUO\ YLVLEOH EXW GR QRW IOXRUHVFH 0DJQLILFDWLRQ ; $ WLVVXH SKRWRJUDSKHG ZLWK HSLIOXRUHVFHQFH RSWLFV % VDPH ILHOG RI YLHZ SKRWRJUDSKHG ZLWK YLVLEOH OLJKW

PAGE 98

)LJ (SLGHUPDO VWULSV IURP PRFNLQRFXODWHG ZDWHUPHORQ WLVVXH WUHDWHG ZLWK DQWLVHUXP WR WKH 3, RI =<09)/$7 f DQG VWDLQHG ZLWK 5KRGDPLQHSURWHLQ $ 1RWH DEVHQFH RI IOXRUHVFHQW JUDQXODU ERGLHV 0DJQLILFDWLRQ ;

PAGE 99

7DEOH 6XPPDU\ RI UHDFWLRQV RI DQWLVHUD WR WKH 3L RI =<09)/$7 DQG =<0958 LQ LPPXQRIOXRUHVFHQFH WHVWV 5HDFWLYLW\D E $QWLVHUXP WR $QWLVHUXP WR 3UHLPPXQH ,VRODWH 3L RI =<09)/$7 3L RI =<0958 VHUXP =<09)/$7 =<0969 =<0958 )& 0RFN D 5HDFWLYLW\ GHWHUPLQHG DV SRVLWLYH f E\ WKH SUHVHQFH RI \HOORZ IOXRUHVFHQW DJJUHJDWHV LQ SODQW FHOOV /DFN RI UHDFWLYLW\ f GHWHUPLQHG E\ DEVHQFH RI IOXRUHVFHQW DJJUHJDWHV E 7KH LVRODWHV LQGLFDWHG ZHUH LQRFXODWHG WR ZDWHUPHORQ SODQWV 0RFN PRFNLQRFXODWHG FRQWURO SODQWV

PAGE 100

'LVFXVVLRQ $V ZDV GHPRQVWUDWHG LQ &KDSWHU IRU ILYH =<09 LVRODWHV YDULDELOLW\ H[LVWV LQ WKH 3, QW DQG GHGXFHG DPLQR DFLG VHTXHQFHV 5HVXOWV IURP VHURORJLFDO DVVD\V LQ LPPXQREORWV DUH LQ DJUHHPHQW ZLWK WKH VHTXHQFH GDWD )RU H[DPSOH WKH ODUJHU VL]H VHHQ LQ WKH QW DQG DPLQR DFLG VHTXHQFH RI =<090' LV UHIOHFWHG LQ WKH ODUJHU VL]H RI WKH 3, SURWHLQ REVHUYHG LQ ZHVWHUQ EORWV 7KH VOLJKWO\ VPDOOHU VL]H RI WKH 3, IURP =<0969 LQ ZHVWHUQ EORWV ZDV DOVR UHIOHFWHG LQ D VOLJKWO\ VPDOOHU VL]H RI LWV UHVSHFWLYH JHQH LQ 3&5 DQDO\VLV 7KH DPLQR DFLGV GLIIHUHQFHV UHIOHFWLQJ GLIIHUHQW FKDUJHV DQG SRODULWLHV PD\ DOVR LQIOXHQFH WKH PLJUDWLRQ RI 3, LQ 6'63$*( $PRQJ WKH =<09 LVRODWHV LQ WKLV VWXG\ KHWHURJHQHLW\ LQ WKH VL]H RI 3, ZDV VHHQ DV ZHOO DV WKH SUHVHQFH RI GHJUDGDWLRQ SURGXFWV DQG GLIIHUHQFHV LQ WKH FDSDFLW\ WR IXOO\ SURFHVV WKH FOHDYDJH VLWH EHWZHHQ 3, DQG +&3UR 7KH VL]H GLIIHUHQFHV VHHQ EHWZHHQ =<09)/$7 =<0969 DQG =<09 0' 3, SURWHLQV ZHUH FRQVLVWHQW UHJDUGOHVV RI WKH SHUFHQW DFU\ODPLGH RU RI WKH SODQW KRVW LQIHFWHG 7KH ORZ QW bf DQG DPLQR DFLG bf VHTXHQFH KRPRORJ\ EHWZHHQ 3, RI =<0958 DQG =<09)/$7 LV UHIOHFWHG LQ WKH ZHDN UHDFWLYLW\ RI WKH =<0958 LVRODWH LQ ZHVWHUQ EORWV ZKHQ WHVWHG DJDLQVW DQWLVHUXP WR WKH 3, RI =<09)/$7

PAGE 101

7KH 3, DQWLVHUXP SURGXFHG WR =<09)/$7 ZDV VSHFLILF IRU =<09 ,W QHLWKHU UHDFWHG ZLWK H[WUDFWV IURP SODQWV LQIHFWHG VLQJO\ ZLWK DQ\ RI VHYHUDO RWKHU YLUXVHV WKDW LQIHFW FXFXUELWV QRU ZLWK H[WUDFWV IURP QRQLQIHFWHG FXFXUELW WLVVXHV 7KH =<09)/$7 3, DQWLVHUXP SUHFLSLWDWHG D SURGXFW RI WKH SUHGLFWHG PZ FD N'Df IRU 3, IURP :* WUDQVODWLRQ SURGXFWV ZLWK D VPDOOHU SURGXFW RI FD N'D 7KH VPDOO SURGXFW PD\ FRUUHVSRQG WR D VLPLODU VL]HG SURGXFW IURP LQIHFWHG WLVVXH H[WUDFWV VHHQ LQ ZHVWHUQ EORWV $QWLVHUXP WR 3 RI =<09)/$7 ZDV QRW SURGXFHG GXH WR WKH WR[LFLW\ RI 3 WR ( FROL ZKLFK SUHFOXGHG LWV SURGXFWLRQ LQ YLWUR 7R[LFLW\ RI 3 LQ ( FROL KDV EHHQ UHSRUWHG ZLWK WZR RWKHU SRW\YLUXVHV 9 'ROMDV ( 5RGULJXH]&HUH]R SHUVRQDO FRPPf ,W ZDV LQGLFDWHG E\ 5RGULJXH]&HUH]R DQG 6KDZ f WKDW WZR UHJLRQV RQ WKH 3 SURWHLQ RI 7909 ZHUH SRVVLEOH PHPEUDQH VSDQQLQJ UHJLRQV 7KHVH UHJLRQV PD\ VRPHKRZ EH LQYROYHG LQ WKH WR[LFLW\ RI 3 WR ( FROL $QWLVHUXP WR WKH 3, RI =<09)/$7 GLVWLQJXLVKHG GLIIHUHQFHV DPRQJ =<09 LVRODWHV 7KHVH GLIIHUHQFHV ZHUH UHIOHFWHG LQ VL]H YDULDWLRQ LQ WKH 3, SURWHLQ SRVVLEOH EUHDNGRZQ SURGXFWV IRU VRPH LVRODWHV DQG LQFRPSOHWHO\ SURFHVVHG SRO\SURWHLQ $QWLVHUXP WR WKH 3, RI =<0958 DOVR VKRZHG GLIIHUHQFHV LQ WKH VL]H YDULDWLRQ RI WKH 3, SURWHLQ OLNH WKDW VHHQ ZLWK DQWLVHUXP WR WKH 3, RI =<09)/$7 $QWLVHUXP WR WKH 3, RI =<0958 DOVR GHWHFWHG DQWLJHQLF GLIIHUHQFHV LQ ZHVWHUQ EORWV E\ ODFN RI UHDFWLYLW\ ZLWK VRPH

PAGE 102

=<09 LVRODWHV 7KH =<0958 3, DQWLVHUXP UDEELW QR FROOHFWLRQ GDWH f UHDFWHG ZLWK RI =<09 LVRODWHV WHVWHG 7KLV ODFN RI UHDFWLYLW\ VHHQ PD\ EH GXH WR WLWHU GLIIHUHQFHV EHWZHHQ LVRODWHV WR OLPLWHG VHTXHQFH KRPRORJLHV RU GLIIHUHQFHV LQ H[WUDFWDELOLW\ RI WKH 3, SURWHLQ DPRQJ LVRODWHV ,PPXQRIOXRUHVFHQFH WHVWV LQGLFDWH WKDW DJJUHJDWLRQ RFFXUV ZLWK WKH 3, SURWHLQ LQ LQIHFWHG SODQW WLVVXHV 7KLV LV VKRZQ E\ IOXRUHVFLQJ DJJUHJDWHV LQ HSLGHUPDO WLVVXHV IURP LQIHFWHG ZDWHUPHORQ ZKHQ WUHDWHG ZLWK KRPRORJRXV 3, DQWLVHUD 3XPSNLQ WLVVXHV ZHUH XVHG LQ SUHOLPLQDU\ WHVWV EXW ZDWHUPHORQ ZDV D EHWWHU KRVW IRU VDPSOLQJ RI HSLGHUPDO VWULSV 7KH DQWLVHUD WR 3, RI =<09)/$7 UHDFWHG ZLWK LWV UHVSHFWLYH LVRODWH DQG ZLWK =<0969 EXW QRW ZLWK =<0958 $QWLVHUXP WR 3, RI =<0958 UHDFWHG ZLWK LWV KRPRORJRXV DQWLJHQ EXW QRW ZLWK =<09)/$7 RU ZLWK =<0969 LQ DJUHHPHQW ZLWK ZHVWHUQ EORW DQDO\VHV %RWK WKH =<09)/$7 3, DQG =<0958 3, DQWLVHUD UHDFWHG ZLWK )& 7KLV LVRODWH DOVR UHDFWHG VWURQJO\ WR ERWK 3, DQWLVHUD LQ ZHVWHUQ EORWV 7KXV LVRODWH )& PXVW KDYH HSLWRSHV LQ FRPPRQ ZLWK ERWK 3, IURP =<09)/$7 DQG =<0958

PAGE 103

&+$37(5 6800$5< $1' &21&/86,216 &ORQHV UHSUHVHQWLQJ DOO SRUWLRQV RI WKH =<09 JHQRPH ZHUH REWDLQHG E\ WKH FRPELQHG XVH RI ROLJR G7 SULPHUV UDQGRP SULPHUV DQG D SULPHU FRUUHVSRQGLQJ WR WKH &O UHJLRQ RI WKH JHQRPH 7KH QW VHJXHQFHV IRU WKH 3, RI ILYH =<09 LVRODWHV ZHUH FRPSDUHG WKUHH RI ZKLFK ZHUH VHTXHQFHG LQ WKLV VWXG\ $ KLJK QW DQG GHGXFHG DPLQR DFLG KRPRORJ\ ZDV VHHQ EHWZHHQ IRXU =<09 LVRODWHV LQFOXGLQJ WKUHH IURP )ORULGD DQG RQH IURP &DOLIRUQLD +RZHYHU DQ LVRODWH IURP 5HXQLRQ ,VODQG KDG D ORZ bf QW KRPRORJ\ FRPSDUHG WR WKH RWKHU =<09 LVRODWHV IURP )ORULGD DQG &DOLIRUQLD ,Q FRQWUDVW WKH $, DQG 3 RI =<0958 KDG b QW VHTXHQFH KRPRORJLHV FRPSDUHG WR =<09)/ DQG =<09&$ ,Q DGGLWLRQ WKH VHTXHQFH RI WKH &3 RI =<0958 LV b VLPLODU WR WKDW RI =<09&$ %DNHU HW DO Ef $FFRUGLQJ WR WKH FULWHULD VHW IRUWK E\ 6KXNOD HW DO f WKH QW VHTXHQFH KRPRORJ\ RI 3, IURP =<0958 FRPSDUHG WR WKH 3, RI RWKHU =<09 LVRODWHV bf FODVVLI\ LW DV D GLVWLQFW SRW\YLUXV ZKLOH WKH VHTXHQFH KRPRORJLHV RI RWKHU UHJLRQV RI WKH =<0958 JHQRPH bf DUH QRW TXLWH DV KLJK DV WKDW H[SHFWHG WR EH FRQVLGHUHG DQ LVRODWH RI WKH VDPH YLUXV

PAGE 104

7KH DGGLWLRQDO QWV LQ WKH nWHUPLQXV RI WKH 3, JHQH RI =<090' FRGLQJ IRU VL[ DGGLWLRQDO DPLQR DFLGV ZRXOG DFFRXQW IRU WKH VOLJKWO\ ODUJHU VL]H RI WKH 3, 3&5 SURGXFW VHHQ IRU WKH =<090' LVRODWH LQ DJDURVH JHOV 7KLV DOVR DFFRXQWV LQ SDUW IRU WKH ODUJHU VL]H RI =<090' VHHQ LQ ZHVWHUQ EORWV XVLQJ DQWLVHUXP WR 3, RI =<09)/$7 1XFOHRWLGH VHTXHQFH KRPRORJLHV EHWZHHQ WKH 3, RI =<09 )/$7 DQG RWKHU SRW\YLUXVHV LQFOXGLQJ 7(9 39<1 7909 339 DQG 36E09 UDQJHG IURP b WR b 7KHVH KRPRORJLHV DOVR ZHUH ORZHU WKDQ WKRVH IRU WKH $, bf DQG 3 bf FRPSDUHG WR =<09)/$7 7KHVH GDWD DUH LQ DJUHHPHQW ZLWK 6KXNOD HW DO f LQ WKDW WKH SHUFHQW KRPRORJ\ EHWZHHQ GLVWLQFW SRW\YLUXVHV LV ORZ DQG WKDW 3, LV OHVV FRQVHUYHG WKDQ WKH $, RU 3 HQFRGLQJ UHJLRQ 7KH 1WHUPLQL RI 3, SURWHLQV RI WKH ILYH =<09 LVRODWHV LQ WKLV VWXG\ ZHUH OHVV FRQVHUYHG WKDQ WKHLU &WHUPLQL 7KH DGGLWLRQDO VL[ DPLQR DFLGV RI =<090' ZHUH LQVHUWHG GLUHFWO\ IROORZLQJ WKH PHWKLRQLQH 7KH KLVWLGLQH PLVVLQJ LQ WKH =<0969 LV DOVR LQ WKH 1WHUPLQXV 0RVW RI WKH FKDQJHV LQ DPLQR DFLGV LQ ERWK =<090' DQG =<0969 DUH DOVR LQ WKH 1 WHUPLQL 7KH WZR DPLQR DFLG UHVLGXHV LQ WKH &WHUPLQXV RI 3, GHWHUPLQHG E\ 9HUFKRW HW DO f WR EH HVVHQWLDO IRU SURWHDVH DFWLYLW\ DUH FRQVHUYHG LQ DOO =<09 LVRODWHV LQ WKLV VWXG\ 7KH 7\U6HU FOHDYDJH VLWHV EHWZHHQ 3, DQG +&3UR DUH DOVR FRQVHUYHG DPRQJ WKH =<09 LVRODWHV $OWKRXJK WKH

PAGE 105

FRQVHQVXV VHTXHQFH /HX9DO,OH$UJ*O\ ZDV WKH VDPH IRU DOO =<09 LVRODWHV LW ZDV VOLJKWO\ GLIIHUHQW IURP WKDW SXEOLVKHG IRU GLVWLQFW SRW\YLUXVHV 9HUFKRW HW DO f 7KH 3, SURWHLQV IRU ERWK =<09)/$7 DQG =<0958 H[SUHVVHG IURP ( FROL ZHUH LQVROXEOH DQG WKXV ZHUH HDVLO\ SXULILHG IRU DQWLERG\ SURGXFWLRQ 7KH 3 SURWHLQ RI =<09 )/$7 KRZHYHU ZDV DSSDUHQWO\ WR[LF WR ( FROL LQ WZR GLIIHUHQW H[SUHVVLRQ V\VWHPV DQG WKXV ZDV QRW SURGXFHG LQ WKLV VWXG\ $QWLVHUXP VSHFLILF WR 3, RI =<09)/$7 UHDFWHG LQ ZHVWHUQ EORWV ZLWK DOO =<09 LVRODWHV H[DPLQHG LQ WKLV VWXG\ DOWKRXJK WKH =<0958 LVRODWH HLWKHU UHDFWHG ZHDNO\ RU JDYH QR GHWHFWDEOH UHDFWLRQ $FFRUGLQJ WR WKH QW VHTXHQFH WKH 3, UHJLRQ RI WKH =<0958 JHQRPH LV RQO\ b VLPLODU WR WKDW RI =<09)/$7 ZLWK D b DPLQR DFLG VLPLODULW\ 7KLV PD\ DFFRXQW IRU WKH ORZ OHYHO RI UHDFWLYLW\ LQ ZHVWHUQ EORWV DQG ODFN RI UHDFWLYLW\ LQ LPPXQRIOXRUHVFHQFH WHVWV 1XFOHRWLGH DQG DPLQR DFLG KHWHURJHQHLW\ ZDV VHHQ DPRQJ WKH 3, RI ILYH =<09 LVRODWHV +HWHURJHQHLW\ ZDV DOVR REVHUYHG LQ ZHVWHUQ EORWV DPRQJ WKH 3, SURWHLQV RI =<09 LVRODWHV WHVWHG DJDLQVW =<09)/$7 3, DQWLVHUXP 7KHUH ZHUH GLIIHUHQFHV LQ WKH VL]H RI WKH 3, SURWHLQ SURGXFHG LQ WKH SUHVHQFH RI EUHDNGRZQ SURGXFWV DQG LQ WKH LQFRPSOHWH SURFHVVLQJ RI WKH 3, DQG +&3UR SRO\SURWHLQ 7KH DQWLVHUXP WR WKH 3, RI =<09)/$7 GLG QRW UHDFW ZLWK H[WUDFWV IURP SODQWV LQIHFWHG LQGLYLGXDOO\ ZLWK WKUHH

PAGE 106

RWKHU SRW\YLUXVHV RQH FXFXPRYLUXV RU RQH SRWH[YLUXV $QWLVHUXP WR WKH 3, RI =<0958 GLG QRW UHDFW LQ ZHVWHUQ EORWV ZLWK WKH WKUHH SRW\YLUXVHV RU ZLWK WKH SRWH[YLUXV EXW ZDV QRW WHVWHG DJDLQVW &09 7KH VSHFLILFLW\ VHHQ IRU WKH =<09)/$7 3, DQWLVHUXP LQ ZHVWHUQ EORWV ZDV DOVR VHHQ LQ LQGLUHFW LPPXQRIOXRUHVHQFH WHVWV LQ HSLGHUPDO VWULSV IURP ZDWHUPHORQ 7KH 3, DQWLVHUXP UHDFWHG ZLWK =<09)/$7 DQG =<0969 EXW QRW ZLWK =<0958 RU ZLWK KHDOWK\ PRFN LQRFXODWHGf ZDWHUPHORQ WLVVXHV 7KH ODFN RI UHDFWLYLW\ RI DQWLVHUXP WR =<09)/$7 3, SURWHLQ ZLWK =<0958 LQIHFWHG WLVVXHV LQ LPPXQRIOXRUHVFHQFH LV QRW VXUSULVLQJ GXH WR WKH ZHDN UHDFWLYLW\ VHHQ LQ ZHVWHUQ EORWV DQG WR WKH OLPLWHG VHTXHQFH KRPRORJ\ EHWZHHQ WKHVH WZR LVRODWHV ,PPXQRIOXRUHVFHQFH WHVWV XVLQJ DQWLVHUXP WR WKH 3, RI =<0958 VKRZHG UHDFWLYLW\ ZLWK =<0958 EXW QRW ZLWK =<09)/$7 RU =<0969 7KHVH UHVXOWV DUH UHIOHFWHG LQ WKH ODFN RI UHDFWLYLW\ VHHQ ZLWK WKHVH LVRODWHV LQ ZHVWHUQ EORWV XVLQJ DQWLVHUXP WR =<0958 3, DV D SUREH 7KH )& LVRODWH ZKLFK UHDFWHG ZLWK WKH DQWLVHUD WR ERWK =<09)/$7 DQG =<0958 3, LQ ZHVWHUQ EORWV OLNHZLVH UHDFWHG ZLWK ERWK DQWLVHUD LQ LPPXQRIOXRUHVFHQFH WHVWV LQGLFDWLQJ WKH SUHVHQFH RI VKDUHG HSLWRSHV DPRQJ WKH 3, RI =<09)/$7 =<0958 DQG )& LVRODWHV 7KH 3, SURWHLQV RI =<09 )/$7 =<0969 =<0958 DQG )& ZHUH GHWHFWHG LQ LQIHFWHG WLVVXH ZLWK WKH LPPXQH VHUXP DV DPRUSKRXV SDUWLFXODWH DJJUHJDWHV LQ WKH F\WRSODVP )XUWKHU DQDO\VLV

PAGE 107

E\ HOHFWURQ PLFURVFRS\ LV QHHGHG WR GHWHUPLQH WKH SUHFLVH PRUSKRORJ\ RI WKH DJJUHJDWHV DQG WKHLU SRVVLEOH DVVRFLDWLRQ ZLWK RWKHU YLUDO SURWHLQV RU ZLWK KRVW FRPSRQHQWV 7KH DQWLVHUD GHYHORSHG LQ WKLV VWXG\ KDYH EHHQ XVHIXO IRU GHWHFWLQJ YDULDELOLW\ RI =<09 LVRODWHV E\ LPPXQREORWWLQJ $QWLVHUXP WR WKH 3, RI =<09)/$7 ZDV VSHFLILF WR =<09 LVRODWHV DQG VKRZHG WKDW WKHUH DUH GLIIHUHQFHV LQ WKH VL]H RI 3, SURWHLQV DQG RFFXUUHQFH RI UHODWHG SURGXFWV DPRQJ LVRODWHV 7KH DQWLVHUXP WR 3, RI =<0958 VKRZHG GLIIHUHQWLDO UHDFWLYLW\ WR FHUWDLQ LVRODWHV RI =<09 LQGLFDWLQJ SRVVLEOH DQWLJHQLF GLIIHUHQFHV DPRQJ =<09 LVRODWHV GLIIHUHQFHV LQ WLWHU DPRQJ LVRODWHV RU GLIIHUHQFHV LQ H[WUDFWDELOLW\ DPRQJ =<09 LVRODWHV 7KH 3, DPLQR DFLG VHTXHQFH VKRZHG KHWHURJHQHLW\ DPRQJ =<09 LVRODWHV LQ WKLV VWXG\ ZLWK WKH 1WHUPLQXV EHLQJ OHVV FRQVHUYHG WKDQ WKH &WHUPLQXV 7KHVH WUDLWV DUH QRWHG IRU RWKHU SRW\YLUXVHV 9HUFKRW HW DO f VXSSRUWLQJ WKH VSHFXODWLRQ WKDW 3, PD\ EH DVVRFLDWHG ZLWK YLUXVKRVW LQWHUDFWLRQV 7KLV PD\ EH WUXH LQ SDUWLFXODU IRU WKH 1 WHUPLQXV RI 3, ZKLFK LV PRUH YDULDEOH WKDQ WKH &WHUPLQXV )XUWKHU VWXGLHV WR HOXFLGDWH WKLV SRVVLEOH LQYROYHPHQW RI 3, LQ KRVW UHVSRQVH PLJKW LQYROYH WKH XVH RI IXOO OHQJWK LQIHFWLRXV WUDQVFULSWV :LWK WKHVH WUDQVFULSWV WKH 3, IURP GLIIHUHQW LVRODWHV FRXOG EH LQWHUFKDQJHG WR GHWHUPLQH WKH SRVVLEOH HIIHFWV RQ WKH KRVW UHVSRQVH $OWHUQDWLYHO\ PXWDQWV LQ WKH 3, UHJLRQ FRXOG EH XVHG IRU WKLV SXUSRVH

PAGE 108

%HFDXVH WKHUH LV FRQVLGHUDEOH ELRORJLFDO YDULDWLRQ DYDLODEOH LQ QDWXUDOO\ RFFXUULQJ =<09 LVRODWHV WKH IRUPHU VWXG\ PD\ EH PRUH PHDQLQJIXO )XUWKHU VWXGLHV RQ 3 VKRXOG LQFOXGH FORQLQJ SRUWLRQV RI WKH SURWHLQ VHSDUDWHO\ WR DYRLG WKH SRVVLELOLW\ RI FORQLQJ WR[LF UHJLRQV ZKLFK PD\ GLVUXSW WKH EDFWHULDO FHOO SURFHVVHV 7KH 3 LV DOVR DQ LQWHUHVWLQJ SURWHLQ IRU VWXG\ VLQFH OLWWOH LV NQRZQ DERXW LWV IXQFWLRQ

PAGE 109

$33(1',; 0212&/21$/ $17,%2',(6 72 7+( &$36,' 3527(,1 2) =8&&+,1, <(//2: 026$,& 9,586 ,QWURGXFWLRQ 5HVHDUFKHUV DW WKH 8QLYHUVLW\ RI )ORULGD WKH 9ROFDQL &HQWHU LQ ,VUDHO DQG DW WKH 86'$ LQ 2UODQGR )ORULGD KDYH EHHQ FRRUGLQDWLQJ HIIRUWV RQ SRW\YLUXVHV ZKLFK LQIHFW WKH &XFXUELWDFHDH 7KHVH VWXGLHV LQYROYH FRPSDULVRQ DQG GLVWLQFWLRQ RI LVRODWHV XVLQJ GLIIHUHQWLDO SODQW KRVWV GHYHORSPHQW RI SRO\FORQDO DQWLVHUD XVHG LQ LPPXQRGLIIXVLRQ DQG (/,6$ WHVWV LQ YLWUR WUDQVODWLRQDO VWXGLHV DSKLG WUDQVPLVVLRQ FKDUDFWHUL]DWLRQ RI QRQVWUXFWXUDO SURWHLQV DQG GHYHORSPHQW RI PRQRFORQDO DQWLERGLHV 0$EVf $V DQ HDUO\ SDUW RI WKH UHVHDUFK IRU WKH SUHVHQW VWXG\ VHYHUDO 0$EV WR WKH FDSVLG SURWHLQ &3f RI =<09 ZHUH HYDOXDWHG IRU WKHLU DELOLW\ WR GLVWLQJXLVK DQG GLIIHUHQWLDWH LVRODWHV RI =<09 2QH 0$E WR ZDWHUPHORQ PRVDLF YLUXV :09f ZDV DOVR HYDOXDWHG IRU LWV GLDJQRVWLF SRWHQWLDO IRU :09 LVRODWHV 7ZR 0$EV WR SDSD\D ULQJVSRW YLUXVW\SH : 3569:f REWDLQHG LQ DQRWKHU VWXG\ %DNHU HW DO Df ZHUH FRPELQHG DQG HYDOXDWHG IRU WKHLU GLDJQRVWLF SRWHQWLDO DORQJ ZLWK WKH 0$EV WR =<09 DQG :09 7KH IROORZLQJ PDWHULDOV DQG PHWKRGV

PAGE 110

GHWDLO SURFHGXUHV WR GHYHORS DQG HYDOXDWH 0$EV WR =<09 DQG :09 0DWHULDOV DQG 0HWKRGV ,PPXQL]DWLRQ 3URWRFRO ,Q DOO FDVHV IRXU %DOEF PLFH ZHUH LPPXQL]HG RQ GD\ RQH ZLWK D VXEFXWDQHRXV 6&f LQMHFWLRQ RI >LT SXULILHG YLUXV LQ PO GLVWLOOHG ZDWHU HPXOVLILHG LQ DQ HTXDO YROXPH RI )UHXQGnV FRPSOHWH DGMXYDQW )&$f 7KH VXEVHTXHQW LQMHFWLRQV H[FHSW IRU WKH ILQDO RQH DOVR MXJ ZHUH DGPLQLVWHUHG LQWUDSHULWRQHDOO\ ,3f HPXOVLILHG LQ DQ HTXDO YROXPH RI )UHXQGnV LQFRPSOHWH DGMXYDQW ),$f 2QH PRXVH ZDV VHOHFWHG IRU D IXVLRQ EDVHG RQ UHVXOWV IURP D WHVW EOHHGLQJ ,W ZDV LPPXQL]HG ZLWK J LQ PO ZDWHU ZLWKRXW DGMXYDQW GLUHFWO\ LQWR WKH WDLO YHLQ LQWUDYHQRXV ,9f ,I WKH HQWLUH YROXPH FRXOG QRW EH LQMHFWHG LQWR WKH WDLO YHLQ WKH UHPDLQGHU ZDV LQMHFWHG ,3 7KUHH WR ILYH GD\V DIWHU WKH ,9 LQMHFWLRQ WKH PRXVH ZDV VDFULILFHG IRU D IXVLRQ 7ZR DGGLWLRQDO LPPXQL]DWLRQ SURWRFROV ZHUH XVHG LQ WKLV VWXG\ 2QH ZLOO EH UHIHUUHG WR DV LQ YLYR LPPXQL]DWLRQ DQG LQYROYHG WKH SURWRFRO GHVFULEHG DERYH $Q DGGLWLRQDO LQ YLWUR IXVLRQ SURWRFRO ZDV XVHG DV RXWOLQHG E\ %RVV f :HLJHUV HW DO f DQG 6 =DP SHUVRQDO FRPPf 7ZR PLFH ZHUH HLWKHU SUHYLRXVO\ LPPXQL]HG DV GHVFULEHG DERYH RU QRW SUHYLRXVO\ LPPXQL]HG ,Q HLWKHU FDVH WKH ILQDO

PAGE 111

LPPXQL]DWLRQ ZDV DGPLQLVWHUHG WR WKH WZR FRPELQHG H[FLVHG VSOHHQV LQ FXOWXUH RQ WKH GD\ WKH PLFH ZHUH VDFULILFHG 7KLV LQ YLWUR ERRVW FRQVLVWHG RI QT DQWLJHQ DQG ATPO RI WKH DGMXYDQW 1DFHW\O PXUDP\O /DODQ\O'LVRJOXWDPLQH 6LJPD &KHPLFDO &R 6W /RXLV 02f 7KH IXVLRQ ZDV SHUIRUPHG WKUHH WR ILYH GD\V ODWHU 7KH LPPXQL]DWLRQ VFKHGXOH IRU D SRRUO\ DSKLG WUDQVPLVVLEOH 3$7f LVRODWH RI =<09 LQYROYHG LQMHFWLRQV RQ GD\ RQH DQG IROORZHG E\ D IXVLRQ RQ GD\ )RU DQ DSKLGWUDQVPLVVLEOH LVRODWH RI =<09 IURP )ORULGD =<09 )/$7f PLFH ZHUH LPPXQL]HG LQGLYLGXDOO\ ZLWK ERWK ZKROH YLUXV RU FDSVLG SURWHLQ &3f 7KH LPPXQL]DWLRQ VFKHGXOHV IRU WKH =<09)/$7 LVRODWH SUHSDUDWLRQV ZHUH GD\ RQH GD\ GD\ ,9 ,3 RU DQ LPPXQL]DWLRQ LQ YLWURf ZLWK WKH IXVLRQ RQ GD\ 7KH LPPXQL]DWLRQ VFKHGXOH ZKLFK ZDV HIIHFWLYH LQ SURGXFWLRQ RI 0$EV IRU :09 LVRODWH )&f ZDV GD\ RQH GD\ GD\ GD\ GD\ ,9 DQG ,3f ZLWK WKH IXVLRQ RQ GD\ )XVLRQ 3URWRFRO 7KH IXVLRQ SURFHGXUHV IROORZHG DUH VLPLODU WR WKRVH RXWOLQHG E\ *DOIUH DQG 0LOVWHLQ f 7KH PRXVH ZDV VDFULILFHG E\ SODFLQJ LW LQ D FORVHG FRQWDLQHU ZLWK D VPDOO SLHFH RI GU\ LFH IRU DSSUR[LPDWHO\ VHF DQG WKH VSOHHQ ZDV H[FLVHG DQG JHQWO\ PDVKHG WKURXJK DQ PHVK VLHYH DQG SODFHG LQ PO RI VHUXPIUHH 'XOEHFFRnV PRGLILHG HDJOH PHGLXP '0(0 *LEFR /DERUDWRULHV *UDQG ,VODQG 1
PAGE 112

63 P\HORPD FHOO OLQH REWDLQHG IURP WKH 8QLYHUVLW\ RI )ORULGD +\EULGRPD /DERUDWRU\ DQG XVHG DV WKH IXVLRQ SDUWQHU ZDV PDLQWDLQHG LQ D ORJDULWKPLF JURZWK SKDVH LQ '0(0) VXSSOHPHQWHG ZLWK b IHWDO FDOI VHUXP P0 /JOXWDPLQH b SHQLFLOOLQVWUHSWRP\FLQ DQG PJPO DPSKRWHULFLQ % IXQJL]RQH 6LJPD &KHPLFDO &R 6W /RXLV 02f %RWK WKH VSOHHQ FHOOV DQG WKH 63 FHOOV ZHUH ZDVKHG WZLFH E\ FHQWULIXJDWLRQ DW ; J IRU PLQ LQ VHUXP IUHH '0 (0 DQG ZHUH FRPELQHG DW D UDWLR RI RQH SDUW 63 FHOOV WR WZR SDUWV VSOHHQ FHOOV UHVSHFWLYHO\ 7KH\ ZHUH FHQWULIXJHG WRJHWKHU D ILQDO WLPH DQG ZHUH UHVXVSHQGHG LQ b 3(* >PZ LQ P0 +(3(6 S+ f@ RYHU D SHULRG RI VHF 7KH FHOO VXVSHQVLRQ ZDV VZLUOHG LQ D & ZDWHU EDWK IRU VHF DQG LQFXEDWHG IRU VHF DW & 2QH PO RI VHUXPIUHH '0(0 ZDV WKHQ DGGHG RYHU VHF VZLUOHG VHF IROORZHG E\ WKH DGGLWLRQ RI PO '0(0 RYHU VHF DQG LQFXEDWLRQ IRU PLQ LQ D & ZDWHU EDWK 7KH VROXWLRQ ZDV WKHQ FHQWULIXJHG DQG WKH SHOOHW UHVXVSHQGHG LQ +$7 VHOHFWLYH PHGLD FRQWDLQLQJ b IHWDO FDOI VHUXP WR JLYH D ILQDO FRQFHQWUDWLRQ RI ; FHOOVPO 7KH +$7 PHGLXP FRQWDLQHG '0(0) ZLWK b IHWDO FDOI VHUXP DQG PO +$7 PO RI PHGLD P0 K\SR[DQWKLQH P0 DPLQRSWHULQ P0 WK\PLGLQH 6LJPD &KHPLFDO &R 6W /RXLV 02f 7KHVH VDPSOHV ZHUH SODWHG RXW DW LOZHOO LQ ZHOO SODWHV DQG SODFHG LQ D & LQFXEDWRU ZLWK DQ DWPRVSKHUH RI b & DQG b KXPLGLW\ &XOWXUHV ZHUH IHG ZLWK LZHOO RI +7 PHGLXP '0(0) ZLWK

PAGE 113

K\SR[DQWKLQH DQG WK\PLGLQH EXW ZLWKRXW DPLQRSWHULQf GD\V DIWHU IXVLRQ DQG WKHQ VFUHHQHG VHURORJLFDOO\ IRU DQWLERG\ SURGXFWLRQ DV FRORQLHV GHYHORSHG 6FUHHQLQJ 3URFHGXUHV $OO K\EULGRPD FXOWXUHV ZHUH VFUHHQHG DJDLQVW WKHLU KRPRORJRXV YLUXV LQ ERWK DQ DQWLERG\WUDSSHG DQG SODWH WUDSSHG LQGLUHFW HQ]\PH OLQNHG LPPXQRVRUEHQW DVVD\ (/,6$f +DON f XVLQJ SXULILHG YLUXV DQG H[WUDFWV IURP ERWK KHDOWK\ DQG LQIHFWHG &XFUELWD SHSR / n6PDOO 6XJDUn SXPSNLQ WLVVXH 7KH DQWLERG\WUDSSHG LQGLUHFW (/,6$ FRQVLVWHG RI WKH IROORZLQJ VWHSV f UDEELW DQWLVHUXP WR =<09 DW GLOXWLRQ LQ FRDWLQJ EXIIHU S+ ZDV SODFHG LQ ,PPXORQ ,, PLFURWLWHU SODWHV '\QDWHFK /DERUDWRULHV ,QF &KDQWLOO\ 9$f DW RU [ SHU ZHOO 3ODWHV ZHUH LQFXEDWHG DW & RYHUQLJKW RU DW & IRU KU (DFK VWHS ZDV IROORZHG E\ WKUHH PLQ ZDVKHV LQ 0 SKRVSKDWH EXIIHUHG VDOLQH 3%6f S+ ZLWK b 7ZHHQ 3%67f f DQWLJHQ ZDV DGGHG DW RU L ZHOO GLOXWHG LQ 3%67 DW GLOXWLRQ SXUH YLUXVf RU RQH SDUW SODQW WLVVXH WULWXUDWHG LQ QLQH SDUWV 3%6 WULWXUDWHG LQ D PRUWDU DQG SHVWOH DQG H[SUHVVHG WKURXJK FKHHVHFORWKf ,QFXEDWLRQ ZDV DW & IRU KU f 0$E WLVVXH FXOWXUH VXSHUQDWH RU DVFLWHV ZDV GLOXWHG DSSURSULDWHO\ DQG DGGHG DW LOZHOO DQG LQFXEDWHG DW & IRU KU f WKH HQ]\PH FRQMXJDWH JRDW DQWLPRXVH ,J* DQG ,J0 DONDOLQH SKRVSKDWDVH ZDV DGGHG DW GLOXWLRQ HDFK LQ FRQMXJDWH EXIIHU 3%67 ZLWK b 393 DQG b RYDOEXPLQf

PAGE 114

DW /LJZHOO DW & IRU KU f 7KH VXEVWUDWH S QLWURSKHQ\OSKRVSKDWH 3133 6LJPD &KHPLFDO &R 6W /RXLV 02f ZDV DGGHG DW PJPO XVLQJ PZHOO 3ODWHV ZHUH UHDG ZLWK D %LRWHN DXWRPDWHG PLFURSODWH UHDGHU (/ %LR7HN ,QVWU :LQRRVNL 97f HYHU\ PLQ DV UHDFWLRQV GHYHORSHG 7KH SODWHWUDSSHG LQGLUHFW (/,6$ FRQVLVWHG RI WKH VDPH VWHSV DV DERYH RPLWWLQJ WKH ILUVW VWHS DQG ZLWK WKH DQWLJHQ GLOXWLRQV PDGH LQ FRDWLQJ EXIIHU $VFLWHV ZHUH XVXDOO\ GLOXWHG WR LQ 3%6 DQG WLVVXH FXOWXUH VXSHUQDWHV ZHUH GLOXWHG DW WR GHSHQGLQJ RQ WKH UHDFWLYLW\ RI WKH FORQH 7ZR 0$EV WR 3569: ZKLFK LQ FRPELQDWLRQ UHDFWHG ZLWK 3569: LVRODWHV ZHUH NLQGO\ SURYLGHG E\ &$ %DNHU &ORQLQJ DQG $VFLWHV 3URGXFWLRQ 7KH PRVW SURPLVLQJ FHOO OLQHV ZHUH VHOHFWHG IRU FORQLQJ LQFUHDVHG LQ ODUJH YROXPHV DQG XVHG IRU DVFLWHV SURGXFWLRQ (DFK FXOWXUH ZDV FORQHG WZR WR WKUHH WLPHV E\ OLPLWLQJ GLOXWLRQ ,VRW\SLQJ ZDV GRQH E\ XVLQJ D =\PHG 0RQRFORQDO DQWLERG\ ,' NLW =\PHG /DE ,QF 6DQ )UDQFLVFR &$f $VFLWHV ZHUH SURGXFHG E\ LQMHFWLQJ DW OHDVW ; FHOOV LQWR %DOEF PLFH ZKLFK KDG EHHQ SULPHG GD\V HDUOLHU ZLWK SULVWDQH PO ,3f $VFLWHV ZHUH FROOHFWHG IURP ILYH GD\V WR WKUHH ZHHNV ODWHU XVLQJ DQ JDXJH QHHGOH DQG FODULILHG E\ FHQWULIXJDWLRQ

PAGE 115

5HVXOWV =<09VSHFLILF 0$EV WR WKH &3 DQG ZKROH YLUXV ZHUH REWDLQHG IURP WKH 3$7 DQG $7 LVRODWHV 2QH 0$E RI :09 ZDV VHOHFWHG IRU VHURORJLFDO DQDO\VLV RI :09 LVRODWHV 5HDFWLRQV LQ (/,6$ ZHUH FRQVLGHUHG SRVLWLYH LI WKH DEVRUEDQFH DW QP ZDV WKUHH WLPHV WKH KHDOWK\ UHDGLQJ DQG JUHDWHU WKDQ 2QH 0$E WR =<09 0$E=O UHDFWHG ZLWK H[WUDFWV IURP SODQWV LQIHFWHG ZLWK DOO =<09 LVRODWHV WHVWHG IURP )ORULGD WKUHH IURP )UDQFH RQH IURP ,WDO\ DQG RQH IURP 5HXQLRQ ,VODQGf )LJ f 5HDFWLRQV WR WKH 5HXQLRQ ,VODQG LVRODWH ZHUH XVXDOO\ ORZ LQ DEVRUEDQFH YDOXH $ OHVV WKDQ f 0$E=O GLG QRW UHDFW ZLWK H[WUDFWV IURP QRQLQRFXODWHG SXPSNLQ RU ZLWK WKRVH IURP 3569: :09 D GLVWLQFW FXFXUELW SRW\YLUXV f RU FXFXPEHU PRVDLF YLUXV &09f )LJ f 7KH 0$E=O FORQDO GHVLJQDWLRQ %%$'f ZDV GHULYHG IURP WKH 3$7 LVRODWH RI =<09 DQG RQO\ UHDFWHG LQ DQWLERG\WUDSSHG LQGLUHFW (/,6$ WHVWV EXW QRW LQ SODWH WUDSSHG (/,6$ WHVWV 0$Ef§= FORQDO GHVLJQDWLRQ $*'&f ZDV GHULYHG IURP WKH $7 LVRODWH RI =<09 DQG UHDFWHG LQ ERWK DQWLERG\WUDSSHG DQG SODWHWUDSSHG (/,6$ )LJ f 7KLV 0$E UHDFWHG ZLWK QHLWKHU H[WUDFWV IURP QRQLQRFXODWHG SODQWV QRU ZLWK H[WUDFWV IURP SODQWV LQIHFWHG ZLWK 3569: :09 FXFXUELW SRW\YLUXV )& RU &09

PAGE 116

0$E= FORQDO GHVLJQDWLRQ $'+'f PDGH WR WKH &3 RI WKH $7 LVRODWH RI =<09 DOVR UHDFWHG LQ ERWK DQWLERG\ DQG SODWHWUDSSHG (/,6$ DQG RIWHQ YHU\ ZHDNO\ WR WKH 5HXQLRQ ,VODQG LVRODWH )LJ f :HDNO\ SRVLWLYH UHDFWLRQV WR 3569 : ZHUH VHHQ ,Q SODWHWUDSSHG (/,6$ WKLV 0$% UHDFWHG YHU\ ZHDNO\ RU QRW DW DOO ZLWK WKH =<0969 LVRODWH IURP )ORULGD 0$E= FORQDO GHVLJQDWLRQ '$%'f GHULYHG IURP WKH &3 RI WKH $7 LVRODWH RI =<09 UHDFWHG ZHOO LQ ERWK DQWLERG\ WUDSSHG DQG SODWHWUDSSHG (/,6$ )LJ f 7KLV 0$E DOVR UHDFWHG WR :09 DQG &09 DW ORZ OHYHOV DQG UHVSHFWLYHO\f 7KHVH UHDFWLRQV DUH FRQVLGHUHG ERUGHUOLQH EHWZHHQ SRVLWLYH DQG QHJDWLYH DV RIWHQ VHHQ ZLWK VRPH 0$EV $EVRUEDQFH UHDGLQJV FRXOG EH FRQVLGHUHG SRVLWLYH RQO\ LI WKH UHDFWLRQ ZDV DOORZHG WR SURFHHG RYHU DSSUR[LPDWHO\ WKUHH KRXUV 0$E= FORQDO GHVLJQDWLRQ %()(f PDGH WR WKH $7 LVRODWH RI =<09 ZDV VLPLODU WR 0$E= LQ WKDW ERWK UHDFWHG LQ DQWLERG\ DQG SODWHWUDSSHG (/,6$ DQG ERWK SURGXFHG ZHDNO\ SRVLWLYH DEVRUEDQFH UHDGLQJV WR :09 DQG &09 )LJ f f 0$%= FORQDO GHVLJQDWLRQ )'%*f ZDV SURGXFHG WR WKH $7 LVRODWH RI =<09 DQG UHDFWHG LQ ERWK W\SHV RI (/,6$ WHVWV )LJ f 5HDFWLRQV WR WKH 5HXQLRQ ,VODQG LVRODWH ZHUH XVXDOO\ ZHDN EXW WKLV ZDV DOVR YDULDEOH DQG FRXOG VRPHWLPHV EH FRQVLGHUHG SRVLWLYH 7KLV 0$E DOVR JDYH ORZ EXW VOLJKWO\ SRVLWLYH UHDGLQJV ZLWK :09 DQG &09

PAGE 117

0$E: FORQDO GHVLJQDWLRQ )'%%f WR :09 UHDFWHG VSHFLILFDOO\ LQ DQWLERG\WUDSSHG (/,6$ WR :09 LVRODWHV LQFOXGLQJ IURP )ORULGD WZR IURP &DOLIRUQLD DQG RQH HDFK IURP 1HZ
PAGE 118

&DOLIRUQLD -RUGDQ DQG *UHHFH WKH $7&& RQH LVRODWH RI 35697 7LJUHf DQG RQH LVRODWH RI 35693 SDSD\Df 7KHVH 0$EV GLG QRW UHDFW ZLWK DQ\ :09 RU =<09 LVRODWH 0$E=O 0$E: DQG WKH FRPELQHG 3569: 0$EV ZHUH HYDOXDWHG WRJHWKHU IRU WKHLU GLDJQRVWLF SRWHQWLDO 7KUHH LVRODWHV RI HDFK YLUXV ZHUH WHVWHG DJDLQVW D 0$E WR =<09 D 0$E WR :09 DQG WR WKH FRPELQDWLRQ RI WZR 0$EV WR 3569: )LJ f 7KHUH ZDV QR FURVVUHDFWLYLW\ EHWZHHQ WKH WKUHH YLUXVHV DQG WKHLU UHVSHFWLYH DQWLERGLHV DQG QR UHDFWLYLW\ ZLWK &09 ]XFFKLQL \HOORZ IOHFN YLUXV =<)9f RU ZLWK WLVVXH H[WUDFWV IURP QRQLQRFXODWHG SXPSNLQ 'LVFXVVLRQ 7KH 0$E=O XVHG LQ DQWLERG\WUDSSHG LQGLUHFW (/,6$ GHWHFWHG DOO =<09 LVRODWHV WHVWHG $ ORZ DEVRUEDQFH UHDGLQJ ZDV RIWHQ VHHQ ZLWK WKH 5HXQLRQ ,VODQG LVRODWH 7KLV 0$E PD\ KDYH D ORZ DIILQLW\ IRU WKDW SDUWLFXODU LVRODWH DQG WKLV PD\ EH WKH H[SODQDWLRQ IRU VRPH RI WKH ORZ UHDGLQJV FRQVLVWHQWO\ VHHQ 7KH 0$E WR :09 DOVR KDV YDOXH IRU GLDJQRVLV RI :09 LVRODWHV ,W UHDFWHG ZLWK RI :09 LVRODWHV LQ DQWLERG\WUDSSHG (/,6$ $OWKRXJK WKH WZR 0$EV WR 3569: LQGLYLGXDOO\ ZHUH VHOHFWLYH WR SDUWLFXODU 3569: LVRODWHV LQ FRPELQDWLRQ WKH\ UHDFWHG ZLWK DOO 3569: LVRODWHV WHVWHG

PAGE 119

)RXU 0$EV RQH WR =<09 RQH WR :09 DQG WZR WR 3569: LQ FRPELQDWLRQ ZHUH HIIHFWLYH LQ GHWHFWLRQ RI WKH WKUHH UHVSHFWLYH YLUXVHV RI FXFXUELWV 7RJHWKHU WKHVH YLUXVHV UHSUHVHQW PDMRU SUREOHPV WR WKH SURGXFWLRQ RI FXFXUELWV ZKHUHYHU WKH\ DUH JURZQ 7KHVH H[SHULPHQWV VKRZ D GLDJQRVWLF SRWHQWLDO RI 0$EV DIWHU WKRURXJK VFUHHQLQJ LQ (/,6$ DJDLQVW D YDULHW\ RI YLUXV LVRODWHV IURP VHYHUDO GLIIHUHQW DUHDV RI FXFXUELW SURGXFWLRQ

PAGE 120

9LUXV ,VRODWHV 0$E=O =<09)/$7 =<090' =<0969 3$7 ZHDN ( ,WDO\ =<0958 KHDOWK\ 3569: :09 &09 $EVRUEDQFH QPf )LJO 5HDFWLYLW\ RI 0$E=O %%$'f WR =<09 LVRODWHV DQG IRXU FXFXUELW YLUXVHV LQ DQWLERG\WUDSSHG LQGLUHFW (/,6$ DEWUDSf $EVRUEDQFH UHDGLQJV QPf ZHUH WDNHQ WKUHH KUV DIWHU VXEVWUDWH DGGLWLRQ DQG DUH DQ DYHUDJH RI WZR ZHOOV 0$E=O GLG QRW UHDFW LQ SODWHWUDSSHG LQGLUHFW (/,6$

PAGE 121

9LUXV ,VRODWHV 0$E= =<09)/$7 =<090' =<0969 3$7 ZHDN ( ,WDO\ =<095 KHDOWK\ 3569: :09 &09 $EVRUEDQFH QPf DEWUDS M SRVLWLYH Â’ QHJDWLYH SODWHWUDS 4 SRVLWLYH 9c? QHJDWLYH )LJ 5HDFWLYLW\ RI 0$E= $*'&f WR =<09 LVRODWHV DQG IRXU FXFXUELW YLUXVHV LQ DQWLERG\DQG SODWHWUDSSHG (/,6$ $EVRUEDQFH UHDGLQJV QPf ZHUH WDNHQ WKUHH KUV DIWHU VXEVWUDWH DGGLWLRQ DQG DUH DQ DYHUDJH RI WZR ZHOOV

PAGE 122

0$E= Z X L+ 2 &4 + &4 X ‘+ :09 A &09 DEWUDS A SRVLWLYH ’ QHJDWLYH SODWHWUDS .% SRVLWLYH QHJDWLYH $EVRUEDQFH QPf )LJ 5HDFWLYLW\ RI PRQRFORQDO DQWLERG\ 0$E= $'+'f LQ DQWLERG\WUDSSHG DEWUDSf DQG SODWHWUDSSHG (/,6$ 5HDGLQJV ZHUH WDNHQ WKUHH KUV DIWHU VXEVWUDWH ZDV DGGHG DQG DUH DQ DYHUDJH RI WZR ZHOOV

PAGE 123

9LUXV ,VRODWHV QL 0$E= =<09)/$7 =<090' =<0969 3$7 ZHDN ( ,WDO\ =<0958 KHDOWK\ HM 3569: :09 &09 \n A]]]]D DEWUDS P SRVLWLYH Â’ QHJDWLYH SODWHWUDS SRVLWLYH <; QHJDWLYH $EVRUEDQFH QPf )LJ 5HDFWLYLW\ RI 0$E= '$%'f LQ DQWLERG\ DQG SODWHWUDSSHG LQGLUHFW (/,6$ WR =<09 LVRODWHV $EVRUEDQFH UHDGLQJV QPf ZHUH WDNHQ WKUHH KUV DIWHU VXEVWUDWH DGGLWLRQ DQG DUH DQ DYHUDJH RI WZR ZHOOV

PAGE 124

0$E= FR Lf§, &4 + &4 X ‘+ ,WDO\ ????????????????????< NVVD $::::::: =<095& KHDOWK\A 3569:A :09 ]D &09PJ DEWUDS SRVLWLYH ’ QHJDWLYH SODWHWUDS (O SRVLWLYH A QHJDWLYH $EVRUEDQFH QPf )LJ 5HDFWLYLW\ RI 0$E= %()(f LQ DQWLERG\ DQG SODWHWUDSSHG LQGLUHFW (/,6$ WR =<09 LVRODWHV $EVRUEDQFH UHDGLQJV QPf ZHUH WDNHQ WKUHH KUV DIWHU VXEVWUDWH DGGLWLRQ DQG DUH DQ DYHUDJH RI WZR ZHOOV

PAGE 125

0$E= WQ U U+ R &4 + &4 8 ‘+ KHDOWK\E 3569ZeD :09 3 FPY 6IFVVV DEWUDS 0 SRVLWLYH ’ QHJDWLYH SODWHWUDS A SRVLWLYH c QHJDWLYH $EVRUEDQFH QPf )LJ 5HDFWLYLW\ RI 0$E= )'%*f LQ DQWLERG\ DQG SODWHWUDSSHG LQGLUHFW (/,6$ WR =<09 LVRODWHV $EVRUEDQFH UHDGLQJV QPf ZHUH WDNHQ WKUHH KUV DIWHU VXEVWUDWH DGGLWLRQ DQG DUH DQ DYHUDJH RI WZR ZHOOV

PAGE 126

9LUXV ,VRODWHV 0$E: &DOLIRUQLD &DOLI:HEEf 1HZ
PAGE 127

9LUXV ,VRODWHV 3RO\FORQDO DQWLVHUXP =<09)/$7 =<090' =<0969 3$7 ZHDN ( ,WDO\ =<0958 KHDOWK\A 3569: :09 &09 ZP \\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\0\\\\\\\\\\\\\\; \\\\\\\\\\\\\\\\\\\\\\\\\\\[\\\\\\\\\\\\\ Y\\\\\\\\\\\\\\\\\\\\ Z\\\\V\\\\\\n\\\\\\[\\\\\\\\\\\\\\\\[n\\\\\\\\\\\ Z\\\\\\\\\\\\\\\[\\\\\\\\\\ <\\\\\\\\\\[\\\\\\\\\\\\\\\\\\\\ P\\\\\\\\\\\\\\\\\\\\[\\\\\\\\\\\\\\\\ \\\ \\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\ n\\\\N Y\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\ \\\\\\\\\\\\\\\\\\\ :$ \\\ DBEWUDS B SRVLWLYH Â’ QHJDWLYH SODWHWUDS 4 SRVLWLYH ( QHJDWLYH $EVRUEDQFH QPf )LJ 5HDFWLYLW\ RI SRO\FORQDO DQWLVHUXP WR WKH FDSVLG SURWHLQ RI =<09 UDEELW QR f ZLWK =<09 LVRODWHV DQG RWKHU FXFXUELW YLUXVHV LQ SODWHWUDSSHG LQGLUHFW (/,6$ 1RWH FURVVUHDFWLYLW\ ZLWK 3569: :09 DQG D GLVWLQFW SRW\YLUXV &RQGLWLRQHG PHGLXP DQG DVFLWHV IURP QRQLPPXQL]HG PLFH JDYH DEVRUEDQFH UHDGLQJV $ QPf RI OHVV WKDQ IRU DOO LVRODWHV LQ ERWK DQWLERG\ DQG SODWHWUDSSHG LQGLUHFW (/,6$ GDWD QRW VKRZQf 7KLV DQWLVHUXP ZDV QRW XVHG LQ DQWLERG\WUDSSHG LQGLUHFW (/,6$

PAGE 128

$EVRUEDQFH QPf )LJ $QWLERG\WUDSSHG LQGLUHFW (/,6$ IRU GLDJQRVLV RI =<09 :09 DQG 3569: 0RQRFORQDO DQWLERGLHV XVHG DUH 0$%=O WR =<09 %%$'f 0$E: WR :09 )'%%f DQG D FRPELQDWLRQ RI WZR PRQRFORQDOV WR 3569: )&& DQG )&(f 5HDGLQJV ZHUH WDNHQ DIWHU WKUHH KUV DIWHU VXEVWUDWH DGGLWLRQ DQG DUH DQ DYHUDJH RI ZHOOV

PAGE 129

5()(5(1&( /,67 $GOHU] :& 3XUFLIXOO '( 6LPRQH *: DQG +LHEHUW ( =XFFKLQL \HOORZ PRVDLF YLUXV $ SDWKRJHQ RI VTXDVK DQG RWKHU FXFXUELWV LQ )ORULGD 3URF )OD 6WDWH +RUW 6RF $O0XVD $0 6HYHUH PRVDLF FDXVHG E\ ]XFFKLQL \HOORZ PRVDLF YLUXV LQ FXFXUELWV LQ -RUGDQ 3ODQW 3DWKRORJ\ $OOLVRQ 5) -RKQVWRQ 5( DQG 'RXJKHUW\ :* 7KH QXFOHRWLGH VHTXHQFH RI WKH FRGLQJ UHJLRQ RI WREDFFR HWFK YLUXV JHQRPLF 51$ HYLGHQFH IRU WKH V\QWKHVLV RI D SRO\SURWHLQ 9LURORJ\ $QWLJQXV < 5DFFDK % *DO2Q $ &RKHQ 6 %LRORJLFDO DQG VHURORJLFDO FKDUDFWHUL]DWLRQ RI =<09 DQG :09 LVRODWHV LQ ,VUDHO 3K\WRSDUDVLWLFD $WUH\D &' 5DFFDK % DQG 3LURQH 73 $ SRLQW PXWDWLRQ LQ WKH FRDW SURWHLQ DEROLVKHV DSKLG WUDQVPLVVLELOLW\ RI D SRW\YLUXV 9LURORJ\ $WUH\D 3& $WUH\D &' DQG 3LURQH 73 $PLQR DFLG VXEVWLWXWLRQV LQ WKH FRDW SURWHLQ UHVXOW LQ ORVV RI LQVHFW WUDQVPLVVLELOLW\ RI D SODQW YLUXV 3URF 1DWO $FDG 6FL 86$ %DNHU &$ /HFRT + DQG 3XUFLIXOO '( D 6HURORJLFDO DQG ELRORJLFDO YDULDELOLW\ DPRQJ SDSD\D ULQJVSRW YLUXV W\SH: LVRODWHV LQ )ORULGD 3K\WRSDWKRORJ\ %DNHU &$ :LVOHU *& 0DUORZ *& +LHEHUW ( DQG /HFRT + E 6HTXHQFH DQDO\VLV DW WKH HQG RI WKUHH FXFXUELW SRW\YLUXVHV 3K\WRSDWKRORJ\ $EVWUf %DUQHWW 2: 3RWDWR YLUXV < JURXS ,Q &ODVVLILFDWLRQ DQG 1RPHQFODWXUH RI 9LUXVHV )LIWK 5HSRUW RI WKH ,QWHUQDWLRQDO &RPPLWWHH RQ 7D[RQRP\ RI 9LUXVHV 5,% )UDQFNL &0 )DXTXHW '/ .QXGVHQ DQG ) %URZQf SS 6SULQJHU9HUODJ 1HZ
PAGE 130

%DXQRFK 'DV 3 DQG +DUL 9 ,QWUDFHOOXODU ORFDOL]DWLRQ RI 7(9 FDSVLG DQG LQFOXVLRQ SURWHLQV E\ LPPXQRJROG ODEHOOLQJ 8OWUDVWUXFW 0RO 6WUXFW 5HV %D]DQ -) DQG )OHWWHULFN 59LUDO F\VWHLQH SURWHDVHV DUH KRPRORJRXV WR WKH WU\SVLQOLNH IDPLO\ RI VHULQH SURWHDVHV VWUXFWXUDO DQG IXQFWLRQDO LPSOLFDWLRQV 3URF 1DWO $FDG 6FL 86$ %HUJHU 3+ DQG 3LURQH 73 7KH HIIHFW RI KHOSHU FRPSRQHQW RQ WKH XSWDNH DQG ORFDOL]DWLRQ RI SRW\YLUXVHV LQ 0Y]XV SHUVLFDH 9LURORJ\ %OXD 0DQG 3HUULQJ 70 (IIHFW RI ]XFFKLQL \HOORZ PRVDLF YLUXV RQ GHYHORSPHQW DQG \LHOG RI FDQWDORXSH &XFXPLV PHORf 3ODQW 'LV %RQQHU :0 DQG /DVN\ 5$ $ ILOP GHWHFWLRQ PHWKRG IRU WULWLXP ODEHOHG SURWHLQV DQG QXFOHLF DFLGV LQ SRO\DFU\ODPLGH JHOV (XU %LRFKHP %RVV %' $Q LPSURYHG LQ YLWUR LPPXQL]DWLRQ SURFHGXUH IRU WKH SURGXFWLRQ RI PRQRFORQDO DQWLERGLHV 0HWKRGV LQ (Q]\PRORJ\ %UDNNH 0. DQG 9DQ 3HOW 1 /LQHDUORJ JUDGLHQW IRU HVWLPDWLQJ VHGLPHQWDWLRQ FRHIILFLHQWV RI SODQW YLUXVHV DQG QXFOHLF DFLGV $QDO %LRFKHP %UXHQQ -$ 5HODWLRQVKLSV DPRQJ WKH SRVLWLYH VWUDQG DQG GRXEOH VWUDQG 51$ YLUXVHV DV YLHZHG WKURXJK WKH 51$ GHSHQGHQW 51$ SRO\PHUDVHV 1XF $FLGV 5HV &DUULQJWRQ -& DQG 'RXJKHUW\ :* D 6PDOO QXFOHDU LQFOXVLRQ SURWHLQ HQFRGHG E\ D SODQW SRW\YLUXV JHQRPH LV D SURWHDVH 9LURO &DUULQJWRQ -& DQG 'RXJKHUW\ :* E 3URFHVVLQJ RI WKH WREDFFR HWFK YLUXV N SURWHDVH UHTXLUHV DXWRSURWHRO\VLV 9LURORJ\ &DUULQJWRQ -& DQG 'RXJKHUW\ :* $ YLUDO FOHDYDJH VLWH FDVHWWH LGHQWLILFDWLRQ RI DPLQR DFLG VHTXHQFHV UHTXLUHG IRU WREDFFR HWFK YLUXV SRO\SURWHLQ SURFHVVLQJ 3URF 1DWO $FDG 6FL 86$ &DUULQJWRQ -& &DU\ 60 DQG 'RXJKHUW\ :* 0XWDWLRQDO DQDO\VLV RI WREDFFR HWFK YLUXV SRO\SURWHLQ SURFHVVLQJ FLV DQG WUDQV SURWHRO\WLF DFWLYLWLHV RI SRO\SURWHLQV FRQWDLQLQJ WKH NLORGDOWRQ SURWHLQDVH 9LURO

PAGE 131

&DUULQJWRQ -& &DU\ 60 3DUNV 7' DQG 'RXJKHUW\ :* D $ VHFRQG SURWHLQDVH HQFRGHG E\ D SODQW SRW\YLUXV JHQRPH (0%2 &DUULQJWRQ -& )UHHG '' DQG 6DQGHUV 7' E $XWRFDWDO\WLF SURFHVVLQJ RI WKH SRW\YLUXV KHOSHU FRPSRQHQW SURWHLQDVH LQ (VFKHULFKLD FROL DQG MT YLWUR 9LURO &DUULQJWRQ -& )UHHG '' DQG 2K &6 ([SUHVVLRQ RI SRW\YLUXV SRO\SURWHLQV LQ WUDQVJHQLF SODQWV UHYHDOV WKUHH SURWHRO\WLF DFWLYLWLHV UHTXLUHG IRU FRPSOHWH SURFHVVLQJ (0%2 &KDQJ &$ +LHEHUW ( DQG 3XUFLIXOO '( $QDO\VLV RI LQ YLWUR WUDQVODWLRQ RI EHDQ \HOORZ PRVDLF YLUXV 51$ LQKLELWLRQ RI SURWHRO\WLF SURFHVVLQJ E\ DQWLVHUXP WR WKH QXFOHDU LQFOXVLRQ SURWHLQ *HQ 9LURO &KRL *+ 3DZO\N '0 1XVV '/ 7KH DXWRFDWDO\WLF SURWHDVH S HQFRGHG E\ D K\SRYLUXOHQFHDVVRFLDWHG YLUXV RI WKH FKHVWQXW EOLJKW IXQJXV UHVHPEOHV WKH SRW\YLUXV HQFRGHG SURWHDVH +&3UR 9LURORJ\ &OLQH :HUQHU:DVKEXUQH 0 /XEEHQ 7+ DQG .HHJVWUD 3UHFXUVRUV WR WZR QXFOHDUHQFRGHG FKORURSODVW SURWHLQV ELQG WR WKH RXWHU HQYHORSH PHPEUDQH EHIRUH EHLQJ LPSRUWHG LQWR FKORURSODVWV %LRO &KHP &RKHQ 6 2XWEUHDNV RI ]XFFKLQL \HOORZ PRVDLF YLUXV RQ FXFXUELWV LQ ,VUDHO 3K\WRSDUDVLWLFD $EVWUf 'DYLV 5) 3DUWLDO FKDUDFWHUL]DWLRQ RI ]XFFKLQL \HOORZ PRVDLF YLUXV LVRODWHG IURP VTXDVK LQ 7XUNH\ 3ODQW 'LV 'DYLV 5) DQG 0L]XNL 0. 6HHG WUDQVPLVVLRQ RI ]XFFKLQL \HOORZ PRVDLF LQ VTXDVK 3K\WRSDWKRORJ\ 'DYLV 5) DQG
PAGE 132

VSHFLILF SURWHLQ UHODWHG WR KHOSHU FRPSRQHQW 9LURORJ\ 'RPLHU // )UDQNOLQ .0 6KDKDEXGGLQ 0 +HOOPDQQ *0 2YHUPH\HU -0 +LUHPDWK 67 6LDZ 0)( /RPRQRVVRII *3 6KDZ -* DQG 5KRDGV 5( 7KH QXFOHRWLGH VHTXHQFH RI WREDFFR YHLQ PRWWOLQJ YLUXV 51$ 1XF $FLG 5HV 'RPLHU // 6KDZ -* DQG 5KRDGV 5( 3RW\YLUXV SURWHLQV VKDUH DPLQR DFLG VHTXHQFH KRPRORJ\ ZLWK SLFRUQD FRPR DQG FDXOLPRYLUDO SURWHLQV 9LURORJ\ 'RXJKHUW\ :* DQG &DUULQJWRQ -& ([SUHVVLRQ DQG IXQFWLRQ RI SRW\YLUDO JHQH SURGXFWV $QQX 5HY 3K\WRSDWKRO 'RXJKHUW\ :* DQG +LHEHUW ( 7UDQVODWLRQ RI SRW\YLUXV 51$ LQ D UDEELW UHWLFXORF\WH O\VDWH 5HDFWLRQ FRQGLWLRQV DQG LGHQWLILFDWLRQ RI FDSVLG SURWHLQ DV RQH RI WKH SURGXFWV RI LQ YLWUR WUDQVODWLRQ RI WREDFFR HWFK DQG SHSSHU PRWWOH YLUDO 51$V 9LURORJ\ 'RXJKHUW\ :* DQG 3DUNV 7' 0ROHFXODU JHQHWLF DQG ELRFKHPLFDO HYLGHQFH IRU WKH LQYROYHPHQW RI WKH KHSWDSHSWLGH FOHDYDJH VHTXHQFH LQ GHWHUPLQLQJ WKH UHDFWLRQ SURILOH DW WZR WREDFFR HWFK YLUXV FOHDYDJH VLWHV LQ FHOO IUHH DVVD\ 9LURORJ\ 'RXJKHUW\ :* DQG 3DUNV 7' 3RVWWUDQVODWLRQDO SURFHVVLQJ RI WKH WREDFFR HWFK N'D VPDOO QXFOHDU LQFOXVLRQ SRO\SURWHLQ LGHQWLILFDWLRQ RI DQ LQWHUQDO FOHDYDJH VLWH DQG GHOLPLWDWLRQ RI 93J DQG SURWHLQDVH GRPDLQV 9LURORJ\ 'RXJKHUW\ :* &DUULQJWRQ -& &DU\ 60 DQG 3DUNV 7' %LRFKHPLFDO DQG PXWDWLRQDO DQDO\VLV RI D SODQW YLUXV SRO\SURWHLQ FOHDYDJH VLWH (0%2 'RXJKHUW\ :* &DU\ 60 DQG 3DUNV 7' 0ROHFXODU JHQHWLF DQDO\VLV RI D SODQW YLUXV SRO\SURWHLQ FOHDYDJH VLWH D PRGHO 9LURORJ\ (GZDUGVRQ -5 6RPH SURSHUWLHV RI WKH SRWDWR YLUXV < JURXS )OD $JULH ([S 6WQ 0RQRJU 6HU S (GZDUGVRQ -5 DQG &KULVWLH 5* 7KH 3RW\YLUXV *URXS )OD $JULH ([S 6WQ 0RQRJU S *DOIUH DQG 0LOVWHLQ & 3UHSDUDWLRQ RI PRQRFORQDO DQWLERGLHV 6WUDWHJLHV DQG SURFHGXUHV 0HWKRGV LQ (Q]\PRO

PAGE 133

*DO2Q $ $QWLJQXV < 5RVQHU $ DQG 5DFFDK % E 1XFOHRWLGH VHTXHQFH FRPSDULVRQV EHWZHHQ ]XFFKLQL \HOORZ PRVDLF YLUXV =<09f VWUDLQV GLIIHULQJ LQ WKHLU PXOWLSOLFDWLRQ UDWH DQG WUDQVPLVVLELOLW\ E\ DSKLGV 3DJH ,Q $EVWU (LJKWK ,QW &RQJ 9LURO %HUOLQ *DUFLD -$ 5LHFKPDQQ -/ DQG /DLQ 6 3URWHRO\WLF DFWLYLW\ RI WKH SOXP SR[ SRW\YLUXV 1,DOLNH SURWHLQ LQ (VFKHULFKLD FROL 9LURORJ\ *ROGEDFK 5 DQG :HOOLQN (YROXWLRQ RI SOXV VWUDQGHG 51$ YLUXVHV ,QWHUYLURORJ\ *RYLHU '$ DQG .DVVDQLV % $ YLUXVLQGXFHG FRPSRQHQW RI SODQW VDS QHHGHG ZKHQ DSKLGV DFTXLUH SRWDWR YLUXV < IURP SXULILHG SUHSDUDWLRQV 9LURORJ\ *UHEHU 56 3HUVOH\ '0 +HUULQJWRQ 0( 6RPH FKDUDFWHULVWLFV RI $XVWUDOLDQ LVRODWHV RI =<09 $XVW $JULH 5HV *XEOHU 8 DQG +RIIPDQ %$ VLPSOH DQG YHU\ HIILFLHQW PHWKRG IRU JHQHUDWLQJ F'1$ OLEUDULHV *HQH +DON (/ 6HURW\SLQJ SODQW YLUXVHV ZLWK PRQRFORQDO DQWLERGLHV ,Q 0HWKRGV LQ (Q]\PRORJ\ $ :HLVVEDFK DQG + :HLVVEDFKf SS $FDGHPLF 3UHVV 1HZ
PAGE 134

+LHEHUW ( DQG 'RXJKHUW\ :* 2UJDQL]DWLRQ DQG H[SUHVVLRQ RI WKH YLUDO JHQRPH ,UL 7KH 9LUXVHV )LODPHQWRXV 9LUXVHV 5* 0LOQH (Gf SS 3OHQXP 1HZ
PAGE 135

/DLQ 6 5LHFKPDQQ -/ DQG *DUFLD -$ 51$ KHOLFDVH D QRYHO DFWLYLW\ DVVRFLDWHG ZLWK D SURWHLQ HQFRGHG E\ D SRVLWLYH VWUDQG 51$ YLUXV 1XF $FLGV 5HV /DQJHQEHUJ :* 9LUXV SURWHLQ DVVRFLDWHG ZLWK F\OLQGULFDO LQFOXVLRQV RI WZR YLUXVHV WKDW LQIHFW ZKHDW *HQ 9LURO /DQJHQEHUJ :* DQG 3XUFLIXOO '( ,QWHUDFWLRQV EHWZHHQ SHSSHU ULQJVSRW YLUXV DQG F\OLQGULFDO LQFOXVLRQV RI SRW\YLUXVHV 8OWUDVWUXF DQG 0ROHF 6WUXF 5HV /DQJHQEHUJ :* /RPPHO 6$ DQG 3XUFLIXOO '( 6RUJKXP FKORURWLF VSRW YLUXV ELQGV WR SRW\YLUXV F\OLQGULFDO LQFOXVLRQV LQ WREDFFR OHDI FHOOV 8OWUDVWUXF DQG 0ROHF 6WUXF 5HV /HFRT + %RZGHQ 5DFFDK % +LHEHUW ( DQG 3XUFLIXOO '( D &KDUDFWHUL]DWLRQ RI D ]XFFKLQL \HOORZ PRVDLF YLUXV LVRODWH ZLWK D GHILFLHQW KHOSHU FRPSRQHQW 3K\WRSDWKRORJ\ /HFRT + /HPDLUH -0 DQG :LSI6FKHLEHO & E &RQWURO RI ]XFFKLQL \HOORZ PRVDLF LQ VTXDVK E\ FURVV SURWHFWLRQ 3ODQW 'LVHDVH /HFRT + /LVD 9 DQG 'HOODYDOOH 6HURORJLFDO LGHQWLW\ RI PXVNPHORQ \HOORZ VWXQW DQG ]XFFKLQL \HOORZ PRVDLF YLUXV 3ODQW 'LVHDVH /HFRT + DQG 3LWUDW 0 6SHFLILFLW\ RI WKH KHOSHU FRPSRQHQWPHGLDWHG DSKLG WUDQVPLVVLRQ RI WKUHH SRW\YLUXVHV LQIHFWLQJ PXVNPHORQ 3K\WRSDWKRORJ\ /HFRT + DQG 3XUFLIXOO '( %LRORJLFDO YDULDELOLW\ RI SRW\YLUXVHV DQ H[DPSOH ]XFFKLQL \HOORZ PRVDLF YLUXV ,Q 3RW\YLUXV 7D[RQRP\ $UFKLYHV RI 9LURORJ\ 2: %DUQHWW (Gf ,Q 3UHVV /HVHPDQQ '( 0DNNRXN .0 .RHQLJ 5 DQG 6DPPDQ (1 1DWXUDO LQIHFWLRQ RI FXFXUELWV E\ ]XFFKLQL \HOORZ PRVDLF YLUXV LQ /HEDQRQ 3K\WRSDWKRO = /LQJ 1DPED 6 *RQVDOYHV & 6OLJKWRP -& DQG *RQVDOYHV 3URWHFWLRQ DJDLQVW GHWULPHQWDO HIIHFWV RI SRW\YLUXV LQIHFWLRQ LQ WUDQVJHQLF WREDFFR SODQWV H[SUHVVLQJ WKH SDSD\D ULQJVSRW YLUXV FRDW SURWHLQ JHQH %LRWHFKQRORJ\

PAGE 136

/LVD 9 %RFFDUGR Gn$JRVWLQR 'HOODYDOOH Gn$TXLOLR + &KDUDFWHUL]DWLRQ RI D SRW\YLUXV WKDW FDXVHV ]XFFKLQL \HOORZ PRVDLF 3K\WRSDWKRORJ\ /LVD 9 DQG /HFRT + =XFFKLQL \HOORZ PRVDLF YLUXV &0,$$% 'HVF 3ODQW 9LUXVHV 1R /RYLVROR 2 9LUXV DQG YLURLG GLVHDVHV RI FXFXUELWV $FWD +RUW 0DUWLQ 07 2WLQ &/ /DLQ 6 DQG *DUFLD -$ 'HWHUPLQDWLRQ RI SRO\SURWHLQ SURFHVVLQJ VLWHV E\ DPLQR WHUPLQDO VHTXHQFLQJ RI QRQVWUXFWXUDO SURWHLQV HQFRGHG E\ SOXP SR[ SRW\YLUXV 9LUXV 5HV 0DWWKHZV 5() 7KH FODVVLILFDWLRQ DQG QRPHQFODWXUH RI YLUXVHV )RXUWK 5HSRUW RI WKH ,QWHUQDWLRQDO &RPPLWWHH RQ 7D[RQRP\ RI 9LUXVHV ,QWHUYLURORJ\ 0DYDQNDO DQG 5KRDGV 5( ,Q YLWUR FOHDYDJH DW RU QHDU WKH 1WHUPLQXV RI WKH KHOSHU FRPSRQHQW SURWHLQ LQ WKH WREDFFR YHLQ PRWWOLQJ YLUXV SRO\SURWHLQ 9LURORJ\ 0F&DUW\ '5 +DWWRUL 7 &DUVRQ &% 9DVLO 9 /D]DU 0 DQG 9DVLO ,. 7KH YLYLSDURXV GHYHORSPHQWDO JHQH RI PDL]H HQFRGHV D QRYHO WUDQVFULSWLRQDO DFWLYDWRU &HOO 0RUR]RY 6< 'ROMD 99 DQG $WDEHNRY -* 3UREDEOH UHDVVRUWPHQW RI JHQRPLF HOHPHQWV DPRQJ HORQJDWHG 51$FRQWDLQLQJ SODQW YLUXVHV 0RO (YRO 0XUSK\ -) 5KRDGV 5( +XQW $* DQG 6KDZ -* 7KH 93J RI WREDFFR HWFK YLUXV LV WKH N'D SURWHLQDVH RU WKH 1WHUPLQDO N'D SDUW RI WKH SURWHLQDVH 9LURORJ\ 1DPHWK 67 'RGGV -$ 3DXOXV $2 DQG .LVKDED $ =XFFKLQL \HOORZ PRVDLF YLUXV DVVRFLDWHG ZLWK VHYHUH GLVHDVHV RI PHORQ DQG ZDWHUPHORQ LQ VRXWKHUQ &DOLIRUQLD GHVHUW YDOOH\V 3ODQW 'LV 2K &6 DQG &DUULQJWRQ -& ,GHQWLILFDWLRQ RI HVVHQWLDO UHVLGXHV LQ SRW\YLUXV SURWHLQDVH +&3UR E\ VLWH GLUHFWHG PXWDJHQHVLV 9LURORJ\ 3HWHUVHQ 0$ (GZDUGVRQ -5 /HFRT + DQG 3XUFLIXOO '( 0RUSKRORJLFDO YDULDWLRQ RI LQFOXVLRQV LQGXFHG E\ ]XFFKLQL \HOORZ PRVDLF YLUXV LVRODWHV 3K\WRSDWKRORJ\ $EVWUf

PAGE 137

3LURQH 73 DQG 7KRUQEXU\ ': 5ROH RI YLULRQ DQG KHOSHU FRPSRQHQW LQ UHJXODWLQJ DSKLG WUDQVPLVVLRQ RI WREDFFR HWFK YLUXV 3K\WRSDWKRORJ\ 3URYYLGHQWL 5 *RQVDOYHV DQG +XPD\GDQ +6 2FFXUUHQFH RI ]XFFKLQL \HOORZ PRVDLF LQ FXFXUELWV IURP &RQQHFWLFXW 1HZ
PAGE 138

6DORPRQ 5 DQG 5DFFDK % 7KH UROH RI WKH 1WHUPLQXV RI SRW\YLUXV FRDW SURWHLQ LQ DSKLG WUDQVPLVVLRQ $EVWU SS 9,,, ,QW &RQJ 9LURO %HUOLQ $XJ 6DPEURRN )ULWVFK () DQG 0DQLDWLV 7 0ROHFXODU &ORQLQJ $ /DERUDWRU\ 0DQXDO QG HG 9RO &ROG 6SULQJ +DUERU /DERUDWRU\ &ROG 6SULQJ +DUERU 1< 6DQJHU ) 1LFNOHQ 6 DQG &RXOVRQ $5 '1$ VHTXHQFLQJ ZLWK FKDLQ WHUPLQDWLQJ LQKLELWRUV 3URF 1DWO $FDG 6FL 86$ 6FKULMQZHUNHUV &&)0 +XLJEHUWV 1 DQG %RV / =XFFKLQL \HOORZ PRVDLF YLUXV WZR RXWEUHDNV LQ WKH 1HWKHUODQGV DQG VHHG WUDQVPLVVLELOLW\ 1HWK 3, 3DWK 6KDKDEXGGLQ 0 6KDZ -* DQG 5KRDGV 5( 0DSSLQJ RI WKH WREDFFR YHLQ PRWWOLQJ YLUXV 93J FLVWURQ 9LURORJ\ 6KRUW -0 )HUQDQGH] -0 6RUJH -$ +XVH :' /DPEGD =$3 $ EDFWHULRSKDJH ODPEGD H[SUHVVLRQ YHFWRU ZLWK LQ YLYR H[FLVLRQ SURSHUWLHV 1XF $FLGV 5HV 6KR\LQND 6$ %UXQW $$ 3KLOLSV 6 /HVHPDQQ '( 7KRWWDSSLOO\ DQG /DVWUD 5 7KH RFFXUUHQFH SURSHUWLHV DQG DIILQLWLHV RI 7HOIDLULD PRVDLF YLUXV D SRW\YLUXV SUHYDOHQW LQ 7HOIDLULD RFFLGHQWDOLV &XFXUELWDFHDHf LQ VRXWK ZHVWHUQ 1LJHULD 3K\WRSDWKRORJ\ 6KXNOD '' )UHQNHO 0DQG :DUG &: 6WUXFWXUH DQG IXQFWLRQ RI WKH SRW\YLUXV JHQRPH ZLWK VSHFLDO UHIHUHQFH WR WKH FRDW SURWHLQ FRGLQJ UHJLRQ &DQ 3ODQW 3DWKRO 6LDZ 0)( 6KDKDEXGGLQ 0 %DOODUG 6 6KDZ -* DQG 5KRDGV 5( ,GHQWLILFDWLRQ RI D SURWHLQ FRYDOHQWO\ OLQNHG WR WKH nWHUPLQXV RI WREDFFR YHLQ PRWWOLQJ YLUXV 51$ 9LURORJ\ 6RPRZL\DUMR 6 6DNR 1 DQG 1RQDND ) 'RW LPPXQRELQGLQJ DVVD\ IRU ]XFFKLQL \HOORZ PRVDLF YLUXV XVLQJ SRO\FORQDO DQG PRQRFORQDO DQWLERGLHV $QQ 3K\WRSDWK 6RF -DSDQ 6WDUN '0 DQG %HDFK\ 51 3URWHFWLRQ DJDLQVW SRW\YLUXV LQIHFWLRQ LQ WUDQVJHQLF SODQWV HYLGHQFH IRU EURDG VSHFWUXP UHVLVWDQFH %LRWHFKQRORJ\

PAGE 139

6WXGLHU ): 5RVHQEHUJ $+ 'XQQ -DQG 'XEHQGRUII -: 8VH RI 7 51$ SRO\PHUDVH WR GLUHFW H[SUHVVLRQ RI FORQHG JHQHV ,Q 0HWKRGV LQ (Q]\PRORJ\ 9 *RHGGHO (Gf 9RO S $FDGHPLF 3UHVV 6DQ 'LHJR 6X]XNL 1 6KLUDNR < DQG (KDUD < ,VRODWLRQ DQG VHURORJLFDO FRPSDULVRQV RI YLUXVFRGHG SURWHLQV RI WKUHH SRW\YLUXVHV LQIHFWLQJ FXFXUELW SODQWV *HQ 9LURO 7KRUQEXU\ ': +HOOPDQQ *0 5KRDGV 5( DQG 3LURQH 73 3XULILFDWLRQ DQG FKDUDFWHUL]DWLRQ RI SRW\YLUXV KHOSHU FRPSRQHQW 9LURORJ\ 7KRUQEXU\ ': 3DWWHUVRQ &$ 'HVVHQV -7 DQG 3LURQH 73 &RPSDUDWLYH VHTXHQFH RI WKH KHOSHU FRPSRQHQW +&f UHJLRQ RI SRWDWR YLUXV < DQG D +&GHIHFWLYH VWUDLQ SRWDWR YLUXV & 9LURORJ\ 7RZELQ + 6WDHKHOLQ 7 DQG *RUGRQ (OHFWURSKRUHWLF WUDQVIHU RI SURWHLQV IURP SRO\DFU\ODPLGH JHOV WR QLWURFHOOXORVH VKHHWV 3URFHGXUH DQG VRPH DSSOLFDWLRQV 3URF 1DWO $FDG 6FL 86$ 9HUFKRW .RRQLQ (9 DQG &DUULQJWRQ -& 7KH N'D SURWHLQ IURP WKH 1WHUPLQXV RI D SRW\YLUDO SRO\SURWHLQ IXQFWLRQV DV D WKLUG YLUXVHQFRGHG SURWHLQDVH 9LURORJ\ :DQJ +/ *RQVDOYHV 3URYYLGHQWL 5 DQG /HFRT + (IIHFWLYHQHVV RI FURVV SURWHFWLRQ E\ D PLOG VWUDLQ RI ]XFFKLQL \HOORZ PRVDLF YLUXV LQ FXFXPEHU PHORQ DQG VTXDVK 3ODQW 'LV :DQJ +/ *RQVDOYHV 3URYYLGHQWL 5 DQG =LWWHU 7$ %LRORJLFDO DQG VHURORJLFDO SURSHUWLHV RI IRXU VWUDLQV RI ]XFFKLQL \HOORZ PRVDLF YLUXV 3K\WRSDWKRORJ\ $EVWUf :DQJ +/ *RQVDOYHV 3URYYLGHQWL 5 DQG =LWWHU 7$ &RPSDUDWLYH ELRORJLFDO DQG VHURORJLFDO SURSHUWLHV RI IRXU VWUDLQV RI ]XFFKLQL \HOORZ PRVDLF YLUXV 3ODQW 'LV :DUG &: DQG 6KXNOD '' 7D[RQRP\ RI SRW\YLUXVHV &XUUHQW SUREOHPV DQG VRPH VROXWLRQV ,QWHUYLURORJ\ :LHJHUV 8KOLJ + DQG 'HUQLFN 5 ,Q YLWUR VWLPXODWLRQ RI SUHVHQVLWL]HG PRXVH VSOHHQ FHOOV ZLWK SROLRYLUXV W\SH 0DKRQH\ DQG HQKDQFHPHQW RI SROLRYLUXV VSHFLILF K\EULGRPDV *HQ 9LURO

PAGE 140


PAGE 141

%,2*5$3+,&$/ 6.(7&+ *DLO & :LVOHU ZDV ERUQ LQ ,QGLDQDSROLV ,QGLDQD RQ )HE 6KH JUDGXDWHG IURP WKH &ROOHJH RI :LOOLDP DQG 0DU\ LQ ZLWK D %6 LQ ELRORJ\ 6KH VWDUWHG ZRUN DW WKH )ORULGD 'HSDUWPHQW RI $JULFXOWXUH t &RQVXPHU 6HUYLFHV 'LYLVLRQ RI 3ODQW ,QGXVWU\ '3,f LQ WKH %XUHDX RI 3ODQW 3DWKRORJ\ DV D ODERUDWRU\ WHFKQLFLDQ IROORZLQJ JUDGXDWLRQ IURP :LOOLDP DQG 0DU\ ,Q VKH EHJDQ D 06 SURJUDP XQGHU WKH GLUHFWLRQ RI ): =HWWOHU LQ WKH 3ODQW 3DWKRORJ\ 'HSDUWPHQW RI WKH 8QLYHUVLW\ RI )ORULGD ZKLOH FRQWLQXLQJ WR ZRUN IXOOWLPH 6KH ILQLVKHG KHU 06 LQ DQG FRQWLQXHG WR ZRUN DW '3, ZKHUH VKH FRQFHQWUDWHG RQ SODQW YLUXVHV DQG UHODWHG SUREOHPV 6KH OHIW '3, LQ WR KHDG WKH PRQRFORQDO DQWLERG\ ODERUDWRU\ DW WKH 8QLYHUVLW\ RI )ORULGD 3ODQW 3DWKRORJ\ 'HSDUWPHQW RQ D WZR \HDU JUDQW IXQGHG SRVLWLRQ IRU FXFXUELW SRW\YLUXVHV DQG JHPLQLYLUXVHV 6KH VWDUWHG D 3K' SURJUDP LQ 6HSWHPEHU XQGHU WKH GLUHFWLRQ RI '( 3XUFLIXOO ZRUNLQJ RQ WKH PROHFXODU ELRORJ\ RI ]XFFKLQL \HOORZ PRVDLF YLUXV 6KH H[SHFWV WR UHFHLYH KHU GHJUHH LQ $XJXVW RI *DLO LV D PHPEHU RI WKH $PHULFDQ 3K\WRSDWKRORJLFDO 6RFLHW\

PAGE 142

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 'DQ ( 3XUFLIXOO 3URIHVVRU RI 3ODQ DLUPDQ 3DWKRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ (UQHVW +LHEHUW 3URIHVVRU RI 3ODQW 3DWKRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ
PAGE 143

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 6WHSKHQ *0DP\ $VVRFLDWH 3URIHVVRU RI 0LFURELRORJ\ DQG &HOO 6FLHQFH 7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI $JULFXOWXUH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKHA UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ $XJXVW 'HDQ $JULH OLHJH RI WXUH 'HDQ *UDGXDWH 6FKRRO

PAGE 144

81,9(56,7< 2) )/25,'$