Citation
Citrus Biotechnology into the 21st Century

Material Information

Title:
Citrus Biotechnology into the 21st Century
Creator:
Jensen, Shaun Paul
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (136 p.)

Thesis/Dissertation Information

Degree:
Master's ( M.S.)
Degree Grantor:
University of Florida
Degree Disciplines:
Plant Molecular and Cellular Biology
Committee Chair:
MOORE,GLORIA A
Committee Co-Chair:
FOLIMONOVA,SVETLANA YURYEVNA
Committee Members:
CHAPARRO,JOSE X

Subjects

Subjects / Keywords:
citrus -- cpp -- crispr -- nanoparticle
Plant Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Plant Molecular and Cellular Biology thesis, M.S.

Notes

Abstract:
Citrus is one of the most economically significant agricultural crops. Over the past two decades, citrus has suffered substantial losses due to several citrus diseases. These losses have led the citrus industry to determine that it simply cannot wait for conventional methods to solve these issues, and instead want to try newer, alternative methods. This has led growers and organizations to increase funding of citrus genetic research. This body of work plans to elucidate some of the new biotechnologies that have been used in various laboratories and resource centers abroad to help bring citrus from past techniques and into the 21st century and beyond, creating new opportunities to combat old problems. First, the state of citrus as an industry and a fruit crop is discussed to address the economic importance of citrus and the problems associated with breeding and genetic transformation. In the following chapters, three potential biotechnological solutions are proposed to combat these difficulties associated with citrus propagation: cell-penetrating peptides for use as a molecular delivery system and potential transformation method, nanoparticles as a targeted delivery system, and a modified CRISPR/Cas9 system to produce early flowering and reduce breeding and regeneration times. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (M.S.)--University of Florida, 2017.
Local:
Adviser: MOORE,GLORIA A.
Local:
Co-adviser: FOLIMONOVA,SVETLANA YURYEVNA.
Statement of Responsibility:
by Shaun Paul Jensen.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
LD1780 2017 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

0 CITRUS BIOTECHNOLOGY IN THE 21 ST CENTURY By SHAUN PAUL JENSEN A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2017

PAGE 2

2017 Shaun Jensen

PAGE 3

To my wife, daughter, and mother

PAGE 4

4 ACKNOWLEDGMENTS I thank my wife for all the time, effort, and love she has spent in helping me get to this point in my career and education. I thank my parents fo r always being supportive of my decisions and my life goals. I thank my all my sisters for helping me learn valuable life skills without having to experience them. Truly, my whole family is wonderful.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF ABBREVIATIONS ................................ ................................ ........................... 11 ABSTRACT ................................ ................................ ................................ ................... 15 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 17 Citrus on the Global Stage ................................ ................................ ...................... 17 Citrus Characteristics ................................ ................................ .............................. 19 Citrus Plant Structure ................................ ................................ ....................... 19 Citrus Flowering: Timing, Morphology, and Juvenility ................................ ...... 20 Citrus Fruits and Seed Development ................................ ................................ 21 Primary Citrus Diseases ................................ ................................ ......................... 22 Citrus Greening/HLB ................................ ................................ ........................ 23 Citrus Canker ................................ ................................ ................................ ... 25 Citrus Black Spot and Sweet Orange Scab ................................ ...................... 25 Citrus Technologies: A Response to Citrus Diseases and Industry Concerns ........ 27 Conventional Breeding of Genetic Improvement in Citrus ................................ 28 Citrus Transformation ................................ ................................ ....................... 29 New and Prospective C itrus Biotechnologies ................................ ................... 32 2 CELL PENETRATING PEPTIDES: A MOLECULAR DELIVERY SYSTEM IN CITRUS ................................ ................................ ................................ .................. 33 CPP Literature Review ................................ ................................ ............................ 33 Characteristics of Cell Penetrating Peptides ................................ .................... 33 Cell penetrating peptide types ................................ ................................ .............. 34 Cell penetrating peptide uses ................................ ................................ ............... 35 Translocation Mechanisms of Cell Penetrating Peptides ................................ 36 Direct translocation ................................ ................................ .............................. 36 Macropinocytosis ................................ ................................ ................................ 37 Receptor mediated endocytosis ................................ ................................ ........... 37 Cargoes of Cell P enetrating Peptides for Use in Plants ................................ ... 38 Materials and Methods ................................ ................................ ............................ 40 Materials ................................ ................................ ................................ ........... 40 Cell p enetrating peptides ................................ ................................ ..................... 40 Genetic material and sequence data ................................ ................................ .... 40 Citrus cultivars and other plant tissue used ................................ .......................... 41 Methods ................................ ................................ ................................ ............ 42 Large scale purification of plasmid DNA ................................ ............................... 42

PAGE 6

6 CPP prot ein delivery in citrus ................................ ................................ ............... 44 CPP transient expression method in citrus ................................ ........................... 44 CPP transformation protocol ................................ ................................ ................ 45 CPP tracking in citrus ................................ ................................ ........................... 46 Development of a relative GUS scale ................................ ................................ ... 46 Results and Discussion ................................ ................................ ........................... 48 Protein Delivery ................................ ................................ ................................ 48 Systemic Tracking of CPPs ................................ ................................ .............. 49 CPP mediated T ransient Expression of Plasmid DNA ................................ ..... 50 Cell Penetrating Peptide Conclusions ................................ ................................ .... 53 Tables ................................ ................................ ................................ ..................... 55 Figures ................................ ................................ ................................ .................... 58 3 NANOPARTICLES IN CITRUS: A TARGETED DELIVERY SYSTEM .................... 69 Nanoparticle Literature Review ................................ ................................ ............... 69 Materials and Methods ................................ ................................ ............................ 73 Materials ................................ ................................ ................................ ........... 73 Synthesis of Polysuccinimide ( PSI) ................................ ................................ .. 73 Preparation of Functionalized Nanoparticles ................................ .................... 74 Preparation of Germination Medium for the Plant Toxicity Assay ..................... 74 Preparation of Citrus Seeds ................................ ................................ ............. 74 Culture of Citrus Seeds ................................ ................................ .................... 75 Preparation o f MSBC Medium ................................ ................................ .......... 75 Toxicity Assessment by Tissue Culture ................................ ............................ 76 Results and Discussion ................................ ................................ ........................... 76 pH Responsiveness of Nanoparticles ................................ ............................... 76 Plant Toxicity ................................ ................................ ................................ .... 78 Plant Cell Viability Assay ................................ ................................ .................. 79 Nanoparticle Conclusions ................................ ................................ ....................... 80 Figures ................................ ................................ ................................ .................... 82 4 CRISPR/CAS9 TRANSCRIPTIONAL REGULATION IN CITRU S: A MOLECULAR SWITCH FOR EARLY FLOWERING ................................ .............. 86 CRISPR/Cas9 Literature Review ................................ ................................ ............ 86 Genome Targeting Technologies ................................ ................................ ..... 86 Overview of the CRISPR/Cas9 System ................................ ............................ 88 Transcriptional Regulation of Target Genes Using CRISPR/Cas9 ................... 91 Physiology of Flowering in Citrus ................................ ................................ ..... 92 Materials and Methods ................................ ................................ ............................ 93 Plant Materials ................................ ................................ ................................ .. 93 Plasmid Construction ................................ ................................ ....................... 93 pCAMBIA 2201 Cas9m4 and derivatives ................................ ............................. 93 Construction of pIDT:SMART: :AtU6p:sgRNA::Sp_term and insertion of sgRNAs 95 Agroinfiltration of Citrus ................................ ................................ .................... 96 RNA Extraction ................................ ................................ ................................ 97 RNA Purification ................................ ................................ ............................... 98

PAGE 7

7 Generation of cDNA ................................ ................................ ......................... 98 Quantitative Real Time PCR (qRT PCR) ................................ ......................... 98 Results and Discussion ................................ ................................ ........................... 99 Establishment of Flowering Gene Baseline Levels ................................ ........... 99 Comparison of Mature vs Juvenile Flowering Gene Levels ............................ 100 Targeted Gene Expression of TFL mediated by Cas9m4 to Induce Early Flowering ................................ ................................ ................................ ..... 101 Tables ................................ ................................ ................................ ................... 105 Figures ................................ ................................ ................................ .................. 108 5 CONCLUSIONS ................................ ................................ ................................ ... 117 LIST OF REFERENCES ................................ ................................ ............................. 119 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 136

PAGE 8

8 LIST OF TABLES Table page 2 1 Cell penetra ting peptides and their properties ................................ .................... 55 2 2 CPP mediated transformation results ................................ ................................ 56 4 1 Primers used in this chapter. ................................ ................................ ............ 105 4 2 SgRNA oligonucleotides and constructed plasmids ................................ ......... 107

PAGE 9

9 LIST OF FIGURES Figure page 2 1 V isual representation of the plasmids used in the study. ................................ .... 58 2 2 Preparation and confirmation of plasmid DNA. ................................ ................... 59 2 3 Relative quanti fication scale of GUS expression. ................................ ............... 60 2 4 Cell penetrating peptides (CPPs) complex with DNA plasmid cargo. ................. 61 2 5 Comparison of fiv e different CPPs in delivering purified GUS enzyme. .............. 62 2 6 Systemic transport of the cell penetrating peptide. ................................ ............. 63 2 7 Average rela tive GUS scores when trafficking protein cargo in citrus epicotyl segments. ................................ ................................ ................................ ........... 64 2 8 Efficacy of different CPPs in plasmid delivery of pCAMBIA 2201 in citrus. ......... 65 2 9 Average GUS scores from an assay testing the efficacy of Escort in assisting CPPs deliver plasmid cargo. ................................ ................................ ............... 66 2 10 Cell penetrating peptide transformation proc edure for citrus. ............................. 67 2 11 Visualization of GFP in citrus epicotyl segments from plasmid. .......................... 68 3 1 Preparation of PSI. ................................ ................................ ............................. 82 3 2 Proposed PSI based nanoparticle delivery and release. ................................ .... 83 3 3 Nanoparticle toxicity in citrus. ................................ ................................ ............. 84 3 4 Citrus plant toxicity of (PASP 26 co PSI 17 ) 3 ................................ ......................... 85 4 1 Plasmid Cas9m4. ................................ ................................ ............................. 108 4 2 Plasmid pUC118 FMV Pol y 2 1. ................................ ................................ ...... 109 4 3 Cas9m4 plasmids. ................................ ................................ ............................ 110 4 4 Cloning and c onfirmation of sgRNA insertions. ................................ ................ 111 4 5 Basal e xpression of TFL in j uvenile c itrus l eaves. ................................ ............ 112

PAGE 10

10 4 6 Comparison of flowering genes in mature plants vs juvenile plants. ................. 113 4 7 Transient expression of a Cas9 repressor and two flowering target genes . ... 114 4 8 Relative expression of Cas9m4, FT3 and TFl after repression. ........................ 115 4 9 Flower development from a young (18 months) sour orange (Citrus aurantium). ................................ ................................ ................................ ......................... 116

PAGE 11

11 LIST OF ABBREVIATION S 2AEE 2 (2 aminoethoxy)ethanol A Alanine. An amino acid. AAV A deno associated virus ACC Asiatic citrus canker ACP Asian citrus psyllid, Diaphorina cit ri CaMV 35S Cauliflower mosaic virus. A viral constitutive promoter. Cas9 CRISPR associated system 9 Cas9m4 Cas9 with 4 point mutations CBS Citrus black spot Cf u Colony forming unit Cl Chloride CLaf Candidatus Liberibacter a frican CLam Candidatus Liberibacter a merican CLas Candidatus Liberibacter asiaticus COP Coat protein CPP Cell penetrating peptide CRISPR Clustered regularly interspaced pali ndromic repeats Csn COP9 signalosome D Aspartic acide. An amino acid. DIC Differential interference contrast DLS Dynamic light scattering DMac N,N dimethylacetamide DMSO Dimethyl sulfoxide DNA Deoxyribose nucleic acid

PAGE 12

12 DSB Double stranded break dsDNA Double stranded DNA EDTA Ethylenediaminetetraacetic acid F Dex FITC Dextran FITC F luorescein isothiocyanate fluorescence setting FMV Figwort mosaic virus. A viral constitutive promoter. FT Flowering Locus T GFP Green fluorescent protein. A protein from Cnidarian species. gRNA Guide RNA GUS glucuronidase A gene reporter system. H Histidine. An amino acid. H 2 O 2 Hydrogen peroxide HLB Huanglongbing. Also known as citrus greening. HNH Histidine Asparagine Histidine. A nuclease. InD el Insertion or deletion IR Infrared JBS Jena BioScience. A biotechnical company. The company uses this abbreviation for its proprietary peptides. KRAB Kruppel associated box. A transcriptional repressor. LB Luria broth media MCS Multi clonal site MS Murashige and Skoog Refers to two researchers. Created an optimized plant growing salt mixture for use in tissue culture. N Asparagine. An amino acid. NAA Naphthaleneacetic acid NaCl Sodium Chloride

PAGE 13

13 NCA N carboxyanhydride NMR Nuclear Magnetic Re sonance NPR Non expressor of pathoge nesis related OD 600 Optical density at 600 nm. For measuring bacterial concentration. PAM Protospacer Adjacent Motif PAMP P athogen activated molecular pattern PASP P oly(aspartic acid) PASPA Polyaspartate PBLA (P oly( benzyl L aspartate) 43 ) 3 PBS Phosphate buffer solution PCR Polymerase chain reaction PHEA P oly(hydroxyethylaspartimide) PR Pathogenesis related PSI P oly(succinimide) PTD Protein transduction domain PTI PAMP triggered immunity qRT PCR Quantitative real time PCR R Arginine. An amino acid. R9 Arginine 9 R9 FAM Arginine 9 6 FAM fluorescein RNA Ribonucleic acid RT Room temperature, around 23 24 C. RuvC Resolvosome sensitive to UV subunit C. A nuclease. RVD repeat variable di residue S Serine An amino acid.

PAGE 14

14 SAR Systemic acquired resistance SDS Sodium dodecyl sulfate SEC S ize exclusion chromatography sgRNA Small guiding RNA siRNA Short interfering RNA ssDNA Single stranded DNA T Threonine. An amino acid. TALEN T ranscription activat or like effector nuclease TFL1 Terminal flower protein 1 tracrRNA Trans activating CRISPR RNA v/v Volume to volume ratio VP16 A transcriptional activator from Herpes Simplex Viral Protein 16 VP64 A transcriptional activator domain composed of four t andem repeats of VP16. w/v Weight to volume ratio Xac Xanthomonas axonopodis pv. citri ZFN Zinc finger nuclease gal 5 bromo 4 chloro 3 indolyl D galactopyranoside A compound used to stain for GUS in plants. gluc 5 bromo 4 chloro 3 indolyl glucuronide A compound used to stain for GUS in bacteria.

PAGE 15

15 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science CITRUS BIOTECHNOLOGY IN THE 21 ST CENTURY By Shaun Jensen December 2017 Chair: Gloria A. Moore Major: Plant Molecular and Cellular Biol ogy Citrus is one of the most economically significant agricultural crops. Over the past two decades, citrus has suffered substantial losses due to several citrus diseases. The se losses have led the citrus industry to determine that it simply cannot wait for conventional methods to solve these issues, and instead want to try newer, alternative methods. This has led growers and organizations to increase funding of citrus genetic research. This body of work plans to elucidate some of the new biotechnologies that have been used in various laboratories and resource centers abroad to help bring citrus from past techniques and into the 21st century and beyond, creating new opportu nities to combat old problems. First, the state of citrus as an industry and a frui t crop is discussed to address the economic importance of citrus and the problems associated with breeding and genetic transformation In the following chapters, three potential biotechnological solutions are proposed to combat these difficulties associate d with citrus propagation : cell penetrating peptides for use as a molecular delivery system and potential transformation method,

PAGE 16

16 nanoparticles as a targeted delivery system, and a modified CRISPR/Cas9 system to produce early flowering and reduce breeding a nd regeneration times

PAGE 17

17 CHAPTER 1 INTRODUCTION Citrus on the Global S tage The genus Citrus contains the most economically significant fruit tree crop species in the world. Citrus plants are classified in the subfamily Aurantioideae which belongs to the f amily Rutaceae (Penjor et al., 2013). Citrus consists of many species that are commercially produced in over 140 countries across the globe from Brazil and the United States to Southeast Asia and Australia. The consensus origin for the genus Citrus is in t he equatorial regions of Southeast Asia, including parts of India, China, and Malaysia. In this region, three primary citrus varieties evolved through which all other citrus is hybridized: mandarins ( Citrus reticulata ) pummelos ( Citrus maxima ), and citron s ( Citrus medica ) (Nicolosi, 2007) The most profitable cultivars include oranges ( C itrus x sinensis ), mandarins ( C. reticulata ), lemons ( C itrus x limon ), limes ( Citrus x aurantiifolia ), and grapefruits ( C itrus x paradisi ) (Liu et al, 2012). Citrus is util ized in a variety of ways: consumption of fresh fruit, imbibed as processed juice, its peels are used in the production of facial cleansers, and it even has some uses in the medical field, notably in the reduction of both stomach and breast cancer developm ent (Gonzalez et al., 2013, Song et al., 2013). In the 2013 2014 growing season, worldwide production of citrus exceeded 122 million tons (FAO, 2016). In the 2014 2015 citrus growing season, the United States alone produced 9.02 million tons of fruit wor th 3.38 billion US D ollars, with the state of is used in processing, where 90% of all citrus gets processed into juice (USDA, 2016). For the state of Florida, the indus try has much more significant impacts. It employs over

PAGE 18

18 45,000 people is credited to generate over 8.6 billion dollars each year in economic impacts, and is responsible for the majority of its agriculture income in cash receipts at nearly 18% (USDA, 2016). The production statistics of citrus are quite impressive. Despite the high numbers, they are only meant to illustrate that citrus has enormous impacts to agriculture in the United States, and more significantly Florida. Total citrus production for the Uni ted States is intrinsically tied to the production levels of Florida (USDA, 2016). While global total citrus production has mostly risen year over year at a rate of 1.6 million tons per year since the 2007 2008 growing season, the United States and Florid 1998 growing seasons at a n approximate rate of 502,00 tons per ye ar (FAO, 2016; USDA, 2016). The decline is due to a variety of factors, but is mostly due to citrus pathogenic diseases, such as citrus greening and citrus canker ( APHIS 2016) discussed in the section below Despite the never ending threats that diseases place on citrus growers, demand and market value for citrus has steadily increased. This has led to multiple attempts to help stabiliz e the United States citrus industry and restore them to their historical highs from both the public and private sectors. This has led to enormous amounts of funding for citrus research, including genetic sequencing and producing new transgenic methods, and breeding back in traits from wild varieties of citrus or its relatives (Main et al., 2017, Febres et al., 2011, Velasquez et al., 2016). In this work, three emerging biotechnologies which have been heavily studi ed for their impacts in both plants and an imals, have been re focused towards their effects in citrus: cell penetrating peptides (CPPs), nanoparticles, and a modified CRISPR/Cas9

PAGE 19

19 promoter system The following chapters will discuss these technologies at length. But first, i n order to discuss these technologies it is important to first understand the present state of citrus and the citrus industry, s pecifically, citrus characteristics, the major diseases affecting the industry and the current biotechnolog ies already in use T hese topics will be di scussed with respect to global citrus production but will place an emphasis on how these factors are important to the United States and especially to the state of Florida. Citrus Characteristics Citrus Plant Structure The genus Citrus is characterized as a group of generally plant species that forms small shrubs to medium height trees. There is an extreme amount of variation between citrus species and compared to its close relatives, such as trifoliate orange ( Poncirus trifoliata ) and eremocitrus ( Eremoci trus glauca ) but some general traits are associated with most varieties. Citrus plant s usually have a dense canopy of evergreen leaves. The seedlings will shoot up very quickly (approximately 6 weeks when the plant is about 6 inches tall above ground). T he shoot trunk will lignify and harden usually after the first year. The branches tend to have many thorns, but this is generally associated wi th young plants. The leaves have a characteristically strong, waxy cuticle, making old leaves very hard to work w ith in the laboratory. Lea f structure ranges from trifoliate, palmately compound, and unifoliate. Some varieties will even have a wing petiole, especially grapefruit ( C. x paradisi ) (USDA, 2011)

PAGE 20

20 Citrus Flower ing: Timing, Morphology and Juvenility Citru s can flower throughout most of the year in the tropics, but it usually will flower in the late winter or early spring months in the subtropical regions, including Florida (Iglesias et al., 2007) Several researcher s have shown that low temperatures may re lease bud dormancy and induce flowering (Southwick and Davenport, 1986 ; Tisserat et al., 1990 ; Iglesias et al. 2007 ). F lowers are considered true flowers; they contain both the ovary and pollen containing anthers usually housed within five white petals Most citrus varieties require a pollen source before the fruit will set and begins to mature, however some varieties are known to be parthenocarpic, where they can form a typical fruit in appearance, but generally make the fruit seedless (Iglesias et al. 2007). During juvenility, citrus plants do not form flowers and plant metabolism is dedicated towards growth. Juvenility is defined as the time it takes a plant to flower from germination As the plant matures, and becomes necessary for the plant to r eproduce, only then do citrus produce their flowers. In c itrus juvenility can last for extremely long period s ; some varieties do not flower for up to ten years before plants are able to produce flowers and bear edible fruit (Febres et al., 2007; Gmitter e t al., 2007a) This makes breeding citrus much more difficult discussed in detail below. Reduction in juvenility times is a positive trait wanted by both breeders and growers, and is the primary reason to the CRISPR/Cas9 work presented in Chapter 4. T he m olecular mechanisms of flowering and the role of the important flowering genes will be discussed further as well

PAGE 21

21 Citrus Fruits and Seed Development Citrus fruits are a specialized form botanical berries, k nown as a hesperidium, which forms from a single ovary (Ladaniya, 2010). The fruit usually forms a globular shape and is green until ripening where it likely changes color to an orange or yellowish appearance though this can vary greatly between different cultivars, such as the limes ( C. x aurantiifolia ). Fruit size ranges from the small citrus relatives known as kumquats ( Fortunella spp. ) (2.25 cm diameter) to the large pumelos ( Citrus grandis ) ( over 20 cm in diameter). Citrus fruit ripens very slowly, typically 6 8 months from pollination in mid March C. sinensis ) can take upwards of 12 14 months, where harvested fruit is picked alongside freshly pollinated flowers (Bain, 1958). In 1958, Joan Bain categorized fruit devel opment into three distinct phases: cell division stage (Stage I), cell enlargement phase (Stage divide and differentiate into either albedo or juice vesicle ce lls, Stage II is where the fruit grows to its final size, and Stage III is where the fruit matures, the flavedo changes color and the juice contains less acid (Bain, 1958) As the fruit ripens, the ovary and the carpels, create the core of the fruit, from which the hair like juice vesicle cell s radiate. As the fruit ripens, these juice vesicles will fill causing the sacs to fill into the pulpy flesh that is consumed. The fruit is encased in a think peel known as the rind, which in itself is divided into th e flavedo, or colored portion containing the oil glands which give off the characteristic citrus aroma, and the albedo, the white portion of the rind on which the juice vesicles terminate (Ladaniya, 2010)

PAGE 22

22 Seed production begins immediately after pollinat ion. The ovules present in the ovary begin to grow in size and mature around the newly created embryo The seeds form along the fruit core and are known to increase in size nearly 13 fold (Koltunow et al., 1995). Citrus seeds, in general, have two seed coa ts, one extremely durable external coat that is usually cream colored and one pliable and thin internal coat that is usually brown. Surrounding the entire embryo are two cotyledons that contain the carbohydrates needed by a freshly germinated sapling. Citr us cotyledons are discussed as possible tissues for transformation in the following chapter. It is essential to understand the general characteristics of the genus Citrus and its closest relatives, in order to discuss the pathogenic problems associated wi th citrus. Without these basic concepts, the symptoms and severity of the diseases covered below could go unnoticed. Primary Citrus Diseases A multitude of challenges threaten the citrus industry and have caused total citrus production to decline dra mati cally over the past decade. Across the globe, each citrus producing nation has to respond to at least one disease that disrupts total output. Two of the most severe pathogens to invade Florida and other major citrus producing countries are Huanlongbing (HL B) and Asiatic citrus canker (ACC) Both disease s have had a devastating effect on the citrus industry over the p ast decade, significantly increasing the cost of production and maintenance of the groves Not only has HLB and ACC produced devastating effect s on commercial citrus production but citrus black spot (CBS) and sweet orange scab have contributed to an Florida citrus industry plagued by one or more of these diseases in every acre ( APHIS 2016).

PAGE 23

23 Citrus Greening/HLB The worst disease for citrus is HL B, known colloquially as citrus greening. It has directly caused the death of millions of trees worldwide. The disease was first identified in China around the turn of the 20 th century. Since then, especially from 2005, HLB has spread from China, to almost every major citrus producing region in the world. Once a plants becomes infected with HLB the plant will begin to suffer a multitude of systemic effects. The severity of the effects differ from species to species, but ultimately if a plant becomes infec ted, it will never recover and slowly die. HLB symptoms affect the whole plant: leaves can turn yellow or become mottled, fruit ripens unevenly causing lopsided fruit or turn s green at the peduncular end, the juice becomes bitter, seeds can abort, and the whole tree suffers as if it had a nutrient deficiency (Bove, 2006) The caus al agent of HLB is a gram negative, phloem restricted bacteria known as Candidatus Liberibacter The term Candidatus is due to its inability to be cultured in vitro despite the extent to which it has been studied. Liberibacter has a long latency period whereby u pon initial infection, the bacteria escapes detection by the plant defense mechanisms and will not show symptoms for 6 12 months (Alvarez et al., 2016) ; the bacteria literally clog the phloem and siphon vital resources destined to go from the leaves to the roots, by the time the tree has finally begun to show symptoms Liberibacter contains multiple strains: the asiaticus strain (C L as) is the primary agent in the Unite d States and Asia the africanus strain (CLaf) infects most ly African and Middle Eastern regions, and the americanus (Clam) strain infects Brazil and South America (Bove, 2014; Ba tool et al., 2007 ) CLas is more h eat tolerant than its heat sensitive relati ves CLaf and Clam, and this trait is considered a major reason as to how it has

PAGE 24

24 become so widespread in Southeast Asia and in the state of Florida (Bove, 2014 Batool et al., 2007 ) In nature, Liberibacter is only known to be spread by an insect vector CLas and CLam are transmitted via the Asian citrus psyllid (ACP) ( Diaphorina citri ) while CLaf is transmitted by the African citrus psyllid ( Trioza erytreae ) These small, flying insects have a range of miles but can be blown or carried on the backs of ci trus trucks over even longer distances. They feed on the fresh, young leaves of citrus trees, extracting the phloem sap with their proboscises. Once in contact with the phloem, the insect has a very high chance of infecting the plant if it carries the path ogen or becoming a carrier itself from an already infected tree This problem can be exacerbated by the fact that f emale psyllid s can lay thousands of eggs d uring a lifetime (Bove, 2014, Batool et al., 2007) Of note, CLas can also be graft transmissible, which aids researchers in developing tools to combat this deadly disease (Bove, 2014; McClean and Oberholzer, 1965). Due to its rapid spread and long lasting impact on trees, HLB is the most damaging disease to have ever affected the industry. By 2012 HL B was responsible for the loss of over 215 million boxes of citrus, 4.5 billion US Dollars in value and 2,700 direct ly employed jobs for the state of Flor ida alone in between the 2006 2007 and 2010 2011 growing seasons (Hodges and Spreen, 2012). As of 20 16, Florida has lost nearly 40 percent of total planted citrus acreage and 49 percent of total production from their historical highs most of which was directly or indirectly caused by HLB (Alvarez, et al., 2016).

PAGE 25

25 Citrus Canker ACC is caused by the bact eria Xanthomonas axonopodis pv. citri (Xac) Once the Xac infects a tree, the plant to form s many pustules and lesions on the leaves and fruit. These lesions contain more of the bacteria and will release more of the pathogen when damaged through mechanical or natural means, especially through high winds and large amounts of rain, which are a common occurrence in Florida afternoons (Gottwald et al., 2002). Hurricanes and other tropical weather systems can play a major role in how well Xac can spread. Indeed, in the 2004 and 2005 hurricane seasons, citrus canker spread further than could ever happen in a typical thunderstorm (Gottwald and Irey, 2007). Citrus canker is second only to HLB in the a mount of crop losses for citrus. Even though ACC usually affects the fruit with lesions unappealing to a potential consumer, in the short term the fruit can still be pr oces s ed into juice. In the long term however, ACC will cause a slow decline in total fruit production and will eventually kill the infected plant (Apis.u sda.gov, 2016). Florida first identified the disease in 1995. Due to the severity of the disease, a statewide eradication program was enforced. However, after a decade, the program was terminated as the disease had spread so much that eradication was no lo nger possible ( APHIS 2016). Citrus Black Spot and Sweet Orange Scab Citrus black spot is caused by a fungal pathogen known as Guignardia citricarpa CBS causes eponymous black spots on the fruit that significant ly affects yield, especially in sweet oran ge varietie s. CBS can infect all commercial citrus species and cultivars commonly grown in Florida. Lemons and late maturing types of sweet oranges, black spot (Dewdney, et al. 2010 ; Dewdney

PAGE 26

26 et al., 2017). It i s found nearly worldwide, including Asia, Australia and the Unites States. I was first reported in south Florida in 2010 (APHIS, 2016). CBS causes the fruit crop to drop early, lead drop, and will cause the tree to produce significantly less fruit (Dewdn ey et al., 2017). The fruit and leaf drop contribute tremendously to how G. citricarpa spreads, with the conidia spores maturing in the dead leaves and spreading to other plants through wind and rain. Much like HLB, CBS also has a long latency period and v isual symptoms will not appear on the fruit for several months (Dewdney et al., 2017; APHIS, 2016). Sweet orange scab (SOS), similar to CBS, is characterized by large lesions on the fruit rinds, leaves and twigs. It i s caused by the fungal pathogen Elsino e australis (Chung, 201 1 ; Dewdney, 2017). SOS generally will cause problems long term effects in addition to its visible symp t oms, such as tree stunting and early fruit drop. SOS does not damage the fruit itself or the juice, so those fruits that were dest ined to be processed would still be salvageable if they had SOS symptoms. Th e disease cannot be neglected t hough as over multiple growing seasons, the tree will produce significantly less fruit (APHIS, 2016). Taken together, the fungal pathogens ACC and SOS do not account for the total losses inflicted by HLB or citrus canker in the United States of Florida, but as a whole these two diseases are still critical to control for citrus growers In fact, the European Commission has placed a ban on fruit comi ng in from South Africa, Brazil and Uruguay due to CBS (EC HFS, 2016), and the United States has placed every citrus producing state in quarantine for SOS, except California, which has only quarantined a few regions (APHIS, 2016)

PAGE 27

27 A ddressing these major ci trus diseases individually might overstate their significance in biotechnology applications, but d ue to HLB and other citrus pathogens, significant amounts of new funding opportunities have opened up for citrus research. In t rying to find solutions to thes e pathogens, more and more questions arise, that open the door for researchers to find the solutions. Citrus Technologies: A Response to Citrus Diseases and Industry Concerns The citrus industry is affected by e ach of the previously mentioned diseases eve ry growing season, but they are only a sample of the total amount of pathogens af fecting citrus worldwide They have had a devastating economic impact by reducing the number of fruit producing trees, reducing the span of tree productivity and increasing th e cost of managing the groves. Because of them, states and countries that produce citrus have responded to them with quarantines, regulations, or eradications Regulation is essential, but the main focus of the majority of producers is to generate lines o f plants with traits that are resistant to one or more of these pathogens. Critical to this point is u nderstanding the immune response in different citrus genotypes By comparing citrus to the plant model system Arabidopsis thaliana researchers have been a ble to propose multiple gene models for plant resistance and how the response might differ between susceptible and resistant cultivars. Initially studied in Arabidopsis the Non exp ressor of pathogenesis related ( NPR ) family of genes has been implicated a s key components of systemic acquired resistance (SAR) and basal levels of cellular defense NPR 1 in particular is necessary for the establishment of SAR and inducing the expression of pathogenesis related (PR) proteins that ultimately eliminate the infec tion and render the plant resistant to invading pathogens (Cao et al. 1997). NPR1 is a transcriptional activator of PR genes, notably

PAGE 28

28 PR1. Arabidopsis NPR3 and NPR4 are also transcriptional co activators but they seem to suppress PR1 gene expression and ar e also associated with the salicylic acid (SA) signal transduction (Zhang et al., 2006; Fu et al., 2012; Moreau et al., 2012). Using the Arabidopsis thaliana model of defense, it is clear that the four main pathogens can usually infect the plant due to som e malfunction from the normal defense pathway This means that a resistance gene(s) will not be present in commercial varieties and a resistance gene is unlikely to evolve into these cultivars since citrus is usually gra ft propagated, like the centuries ol d varieties like navel and Therefore, the c haracterization of a natural resistance gene(s) for conventional breeding will have to be discovered in wild citrus types Conventional Breeding of Genetic Improvement in Citrus Convent ional breeding is one useful technology that has been in practice for quite some time, and has recently been given new life, due to the multitude of genetic data and other citrus research over the past two decades. Now, conventional breeding it can be full y integrated into a genetic improvement program (Gmitter et al., 2007 b ). This process is characterized by breeding citrus varieties with distinct genes or genetic markers linked with traits that help produce a more desirable harvest This process can take many years. Due to the many factors associated in growing citrus, including soil types, citrus diseases, and nematodes, different techniques are used for conventional breeding in developing both scions (the canopy and fruit producing part of the plant) an d rootstocks (the root system and base of trunk). For fruit producing scions, traits which favor juice, smaller rind thickness, or seedlessness are highly sought after. In contrast, roostock cultivars are selected for their temperature tolerance, resistan ce to root pathogens, and

PAGE 29

29 for resistance to flooding or salinity (Gmitter et al., 2007 b ). Breeding new traits into each require different strategies, but the end result i s the same: after several years of testing the fruit for a new traits, it is subjected to a new set of evaluations and repetitions across a large region, and then it is subjected to commercial evaluation (Gmitter et al., 2007 b ). The process is vigorous and tedious but dependable, however, it is requires a significant amount of time often decades Another faster method is widely used by citrus researchers : genetic transformation. Currently, the citrus industry understands that traditional, conventional breeding may not be as eff icient in controlling these pathogens (Gmitter et al., 2007a) According to the National Research Council, genetic transformation of a disease resistance trait may be the only way to fully ex terminate the spread of the most damaging pathogens (NRC, 2010). Citrus T ransformation In this method, a single resistance gene from another species, genus, or family or even kingdom could be found and inserted into commercial citrus varieties in as little as one generation, with the trait being homozygous in only two generations. Seen as a quicker solution in producing resistant c itrus plants, it is easy to overlook the problems associated with g ene tic transformation in citrus. Introducing the exogenous DNA into a citrus genome is extremely difficult and tedious. In Arabidopsis thaliana method (Clough and Bent, 1998; Bent, 2006) A bacteria with the gene of interest in Agrobacterium tumefaciens is cultured and then the flowers are dipped into the culture media, where 1% of the thousands of seeds should contain the gene of interest (Bent, 2006). Citrus cannot be transformed so easily however. Due to its waxy cuticles, woody stems, and different genetics, citrus requires different strategies.

PAGE 30

30 Three different methods have been performed in citrus : protoplast transformation, particle bombardment of DNA directly into the genome and Agrobacterium mediated plasmid transfer (Febres et al., 2011) U sually the citrus tissue chosen for transformation is epicotyl segments but other tissues have become available more recently including cotyled ons leaves, and even mature plants (Oliveira et al., 2015 ). Subsequently, extensive tissue culture is required for the regeneration of the tissue into whole plants with all three methods. Protoplast transformation is the preferred method on varieties whi ch are dependent upon graft propagating. Generation and culture of citrus using protoplasts is a daunting task, as citrus tends to form very small quantities of embryogenic callus, especially in commercial varieties (Guo et al., 2005). In one source using sweet orange only a single transformation event occurred (Guo and Grosser, 2005). This method is therefore used minimally and in a few labs dedicated to the live culture of citrus protoplasts (Febres et al., 2011). Particle bombardment of DNA c oated projectiles directly into the tissue is another method that has been used in citrus transformation experiments (Yao et al., 1996). This method is preferred due to the use of mature tissue, as well as a lack of generating protoplasts, however it has a major setback in citrus, due to the low frequency of transformed callus. Therefore, this method is not used for most transformation experiments in citrus. This type of transformation is fascinating because it does not require the use of bacteria or its DN A sequences. It is something we would like to incorporate into this project.

PAGE 31

31 Agrobacterium mediated transformation is the most widely ad o pted method, since the regeneration frequency is greatest, producing transgenic plants at a recovery rate up to 45% in select cultivars (Febres et al., 2011). In Agrobacterium mediated transformation, a plasmid containing a gene of interest, as well as antibiotic selection and reporter genes, are set in between a set of T borders: the DNA sequences that are required for p roper integration of the transgene. The plasmid cloned from E scherichia coli is transferred into a uniquely disarmed, non pathogenic Agrobacterium strain usually from Agrobacterium tumefaciens The bacteria is placed in contact with plant tissue (the expl ant) during the transformation on co cultivation media with the explant. Next, the bacteria will invade into wounded plant cells on the tissue and insert the vector DNA repair mechanisms (Ziemienowicz, 2008). After a ntibiotic selection for the explants with the resistance genes, shoots will form from the callus creating transformed plants. There are several drawbacks to the use of Agrobacterium as a way to create disease resistant plants. One reason is that in most commercial varieties, optimized protocols can only achieve 5 10% transformation efficiency (Moore et al., 1992). Compared, to the mere 1% in Arabidopsis citrus transformation rates appear high, but it requires more hours of work and more resources, includ ing media preparation, antibiotics, citrus seed germination, sterile working conditions, and many weeks until you can even test the plants. Another significant drawback is in the regulation of transgenic crops. Given that the trait would likely come from another plant species, like Spinach ( Spinacia oleracea ) (Stover et al., 20 13), this method requires foreign DNA material that is highly regulated.

PAGE 32

32 In order to construct a p la nt optimized plasmid, several selection markers are required primarily anti bioti c genes that are not native to plants or Agrobacterium and require border sequences known as T DNA in order to insert into hos t genomes (Ziemienowicz, 2008). Therefor e successful creation of a transgenic plant, several hurdles would come from the United S tates F ood and Drug Administration, the United States Department of Agriculture, and other global regulating organizations which would severely limit their commercial introduction. New and Prospective C itrus Biotechnolog ies In the literature, other tech nologies have been addressed in citrus including genetic mapping ( Curtolo et al., 2017; Cuenca et al., 2016 ), sequencing and genome databases (Main et al., 2017) and most interestingly, CRISPR/Cas9 systems (Ledford, 2017; Jia and Wang, 2014). CRISPR/Cas9 is a genome altering tool that is discussed further in Chapter 4 of this work. Each of these technologies, as well as citrus transformation, have unlocked powerful new information at a much faster pace. Problems faced by the citrus industry, can be resear ch ed further in the laboratory, solutions can be found and then applied in the field in very little time compared to just twenty years ago. The purpose of this work hopes to elaborate upon new technologies adapted for citrus that have developed in Dr. Gl Gainesville, Florida. S pecifically in order to decrease the amount of time it would take to breed desirable traits, through the use of an alternative transformation method, which could eliminate the need for transgenic regulations, and by decreasing the maturation rate and increasing flowering.

PAGE 33

33 CHAPTER 2 C ELL PENETRATI NG PEPTIDES: A MOLEC ULAR DELIVERY SYSTEM IN CITRUS CPP Literature Review Characteristics of Cell P enetrating Peptides Cell penetrat ing peptides (CPPs) are a class of peptides which consist of short chains of amino acids and have a net positive charge. CPPs have been observed to translocate across most organic membranes carrying with them other molecules, highlighting their function as a cellular delivery mechanism. CPP function was first identified in two independent studies, in which researchers discovered the protein transduction domain (PTD) during tissue culture experiments using the HIV 1 Tat protein. Each laboratory concluded tha t the Tat protein contained two domains: a cysteine rich region, which homo dimerizes to other Tat proteins, and a positively charged domain, named the PTD, rich with lysine and arginine (Frankel and Pabo 1988; Green and Loewenstein, 1988). The PTD perfor ms the both of the function as it binds to other molecules and can translocate across cell membranes carrying these other molecules, known herein as cargoes, which include nucleic acids and proteins. The PTD is so versatile that when isolated, it still ret ains its duality, delivering the cargo before it ultimately degrades (El Sayed et al. 2009). These short, isolated peptide fragments were later renamed cell penetrating peptides, in honor of their function, translocating into cells and delivering specific molecules to their targets. CPP s must always include the minimum requirements for membrane translocation and cargo binding by maximizing each amino acid residue, and is thus usually manufactured to incorporate an argini ne arm. The arginine arm is a short

PAGE 34

34 segment of the CPP which contains several arginine residues. The presence of the arginine arm has been observed to translocate at much higher rates than other CPPs lacking such a motif (Nakase et al., 2007; Ma et al., 2011; Walrant et al., 2012). Though t he net charge in the amino acids arginine and lysine is identical, arginine is the preferred residue when synthesizing CPPs because arginine has two polar head groups compared to only one in lysine. This makes arginine a much more viable molecular componen t, which is much more likely to interact favorably with surface molecules of the opposite charge than is a lysine equivalent peptide (Fretz et al 2006). Due to the importance of the arginine arm the work presented in this chapter focuses heavily on the u se of arginine rich CPPs. Cell penetrating p eptide t ypes Since the discovery and isolation of the CPP Tat, a number of other CPPs have been identified or synthesized. Conveniently, many of these are readily available for scientific use ( Thoren et al., 2000 ; Vives et al., 2003; Langel, 2007). CPPs typically carry their cargo either covalently or non covalently, and CPPs can be categorized accordingly (Langel, 2007, Eiriksdottir et al., 2010). However, this approach to differentiation not suitable when only u se non covalently attached cargoes are utilized. This has led some researchers to categorize CPPs into four different groups: naturally derived, synthetic, chimeric and proprietary (Table 2 1). Naturally derived CPPs occur in a variety of organisms and ha ve been isolated from a variety of sources, including viruses, bacteria and even from the common fruit fly, ( D. melanogaster ), from which Penetratin is derived ( Thoren et al., 2000; Dom et al., 2003). Synthetic pepides include those that have been fabricat ed entirely in a laboratory setting and are created to maximize the effects of certain experiments. The CPP known

PAGE 35

35 as Arginine 9 (R9), for instance was created specifically as a way to optimize the Tat protein and has gone on to be used in siRNA delivery, a mong other functions (Wender et al., 2000; Bartz et al., 2011). Chimeric have a synthetic localizing signal placed on a terminal end of a naturally derived peptide. These include the simple HIV Tat and the more complex MPG (Morris et al., 1997) Proprietary mixtures of CPPs can also be purchased for research use; in this case the exact types and concentrations (Jena, Germany). In 2010, Eiriksdottir et al. postul ated another classification method based on how the CPPs interact with the cellular membrane and how they are internalized. They postulate three distinct groups of CPPs: helical, sheet, and disordered. Helical CPPs form alpha helices in the presence of pho spholipids and the cell through either electrostatic or hydrophobic interactions, such as MPG Sheet CPPs in contrast for beta sheets in the presence of phospholipids and only use electrostatic interactions, like Penetratin. The disordered group is chara cterized by the lack of any conformation changes and keeps its random state even in the presence of phospholipids. Examples from the disordered group include both Tat and R9 (Eiriksdottir et al., 2010). No matter which method of categorization used, CPPs h ave been used in a variety of ways since they were discovery. Cell penetrating p eptide u ses Currently, CPPs are revolutionizing the pharmaceutical and medical industries where they are being investigated as vehicles for the delivery of therapeutic compoun ds and other cargoes into the blood brain barrier. CPPs are thought to be beneficial in cancer research as macromolecular treatment delivery systems specifically targeted to

PAGE 36

36 cancer cells (Wadia and Dowdy, 2005; Faingold et al., 2012). These applications of specifically targeting certain cells has led scientists to believe that CPPs can also work in plants, where they have entered protoplasts (Chugh and Eudes, 2007), but were thought to be unable to penetrate the cell wall, preventing access to the cell memb rane. Surprisingly, recent evidence indicated CPPs also function in plant cells to ferry cargoes across cell membranes despite the presence of an acidic cell wall (Chen et al ., 2007; Chugh and Eudes, 2008a, Chugh and Eudes, 2008b). This offers a number of novel and creative possibilities regarding the improvement of plants that we would like to exploit in citrus. Translocation Mechanisms of Cell Penetrating Peptides Most research, contributes to the utility and wide application of CPP and cargo es in plants and animals. However, despite the vast amount of research using CPPs the exact mechanisms by which CPPs molecularly translocate across cellular membranes remains unclear (Langel, 2007 ; Eiriksdottir et al., 2010 ). In order to completely understand all of the potential applications of CPPs, the physiological mechanism for CPPs should be examined. Currently, three different supposed translocation mechanisms exist: direct penetration, macropinocytosis, and receptor mediated endocytosis. Each mechanism is supp orted by detailed evidence, but are not mutually exclusive (Futaki et al., 2007; Langel, 2007; Nakase et al., 2007; Mishra et al., 2011). Direct t ranslocation Direct translocation is the most energetically conservative mechanism of the potential mechanis ms. It requires only the passive rearrangement of the inner and outer lipid membranes as the positively charged PTD electrostatically interacts with the negative polar head groups of the inner cell membrane. When endocytosis processes

PAGE 37

37 are halted at 4oC, CP Ps still function and their translocation can increase. Results are similar during extended periods at low temperatures. This data indicates that the direct penetration model may be viable with the Tat PT D or similar CPP (Nakase et al., 2004). The direct p enetration model may explain some CPP translocation, but it is not likely the primary mechanism for molecular cargo exceeding 2,000 Daltons. This would be due to a steric hindrance at the lipid bi layer with larger cargoes (Nakase et al. 2008). Macropino cytosis Macropinocytosis is a cellular process that requires the complete rearrangement of the cytoskeleton in which the cell physically engulfs the peptide/cargo complex in the presence of dynamin and actin (Fretz et al. 2006; Mishra et al., 2011). Initi ation of macropinocytosis requires large quantities of ATP and is highly dependent upon cell membrane structures. The CPPs are known to bind to proteoglycans, most notably the negatively charged heparan sulfates (HS) embedded in the cell membrane (Tyagi et al., 2001; Wadia, Stan, Dowdy 2004). When a CPP binds to a HS, the initiation of actin filaments manipulates the cytoskeleton to engulf the CPP and its cargo (Vives et al., 2003; Nakase et al., 2007). This method of uptake forms a lipid endosome, which ab sorbs the whole complex in its own lipid bi layer. Current literature states that once the complex has been engulfed, the cargo still may not be actively present in the cells due to inadequate vesicle release post uptake (El Sayed et al., 2009; Ma et al., 2011). Further research is needed to elucidate how these vesicles are lysed and their contents made available to the cell. Receptor mediated e ndocytosis Receptor mediated endocytosis is a process in which the CPP and cargo complex interacts with a membrane bound receptor that elicits a downstream cell

PAGE 38

38 response. This response signals the subsequent uptake of the CPP and its cargo via formation of an endosome (Richard et al., 2003; Futaki et al., 2007). This mechanism is similar to macropinocytosis, except th at it does not require as much energy input and does not require the rearrangement of cytoskeleton elements. Endocytosis is more sensitive to exogenous CPP application than other CPP translocation types (Wadia and Dowdy, 2005). Current literature states th at endocytosis is the most probable pathway for overall enzymatic efficiency and has the most variability (i.e. clathrin dependent vs. clathrin independent) (Richard et al., 2003; El Sayed et al., 2009; Ma et al., 2011). This pathway has been shown to impr ove efficiency in the presence of endosome digesting compounds similar to those of viruses (Wadia et al., 2004). Receptor mediated endocytosis is difficult to study because there are currently no known CPP receptors that elicit the signal. One group conten ds that endocytosis is not the preferred method in CPPs because of their capability to function at 4oC, when endocytosis is stopped (Chugh and Eudes, 2009). Each translocation mechanism is supported by detailed evidence. Therefore, we support the hypothesi s of other authors that uptake of CPPs across the plasma membrane are not mutually exclusive and are highly dependent upon many factors, including atmospheric or solution temperature, concentration of CPPs fluidity of the membranes, and cargo used (Fretz et al., 2007; Nakase et al., 2008). Cargoes of Cell P enetrating Peptides for Use in Plants In contrast to the disputed translocation mechanisms, CPP cargoes are well characterized and are currently being rapidly applied in a wide range of biotechnology ap plications. Cargoes in the generic sense are simply molecules that covalently or non covalently bind to the CPPs at the PTD, and are translocated across the plasma

PAGE 39

39 membrane along with the peptide. In this context, cargoes i nclude nucleic acids, ranging fro m plasmid DNA, RNA, and siRNA, complete proteins, organic molecules, and even other peptides (Langel, 2007). Cargoes were originally thought to require a covalent bond before the CPP would be able t o translocate into live cells, but n ew insights indicate t hat instead of a strong sharing of electrons, only the weak electrostatic forces of positively charged amino acids are enough to bind to negatively charged molecular cargo such as that found on the sugar phosphate backbone of DNA or in proteins with a hig h density of negatively charged amino acids, like glutamic acid Though most of CPP research focuses on animals, this weaker binding has been shown to be effective in delivering cargo in both plants and animals (Langel, 2007; Chen et al. 2007 ; Chugh and E udes, 2008 ). In plants, Chen et al. (2007) have shown that plasmid DNA can be translocated into mung bean ( V igna radiata ) root tips and onion ( Allium cepa ) epidermal cells. They used a plant optimized plasmid containing the sequence for g reen fluorescent p rotein (GFP), a protein isolated from Cnidarian species, and glows a very bright green when excited and examined using the appropriate light filters. Not only was translocation of the plasmid achieved, they were also able to see the protein expressed in th e nuclei of the plant cells. This means that the plasmid was delivered into the nucleus of the plants, transcribed into messenger RNA (mRNA), exported out of the nucleus, where ribosomes translated the sequence into a protein that was then shuttled back in to the nuclei, where Chen et al. (2007) were able to visualize the protein. This is an enormous feat for just plasmid and CPPs. Subsequently, Chugh and Eudes (2008) used immature

PAGE 40

40 wheat ( Triticum aestivum cv. ) embryos in conjunction with CPPs and plasmid DN A, which also resulted in protein expression. (Chen et al. 2007, Chugh and Eudes, 2008). We have conducted our own experiments with citrus tissue treated with CPPs bound with various cargoes. Our purpose was to determine which CPPs allowed import of protei n cargo and with what efficiencies. The cargoes utilized were plasmid DNA or full length prote glucoronidase (GUS). In all cases, it was apparent that the proteins were taken up, although various CPPs were more or less efficient. Protein or fluorescence was visualized within the plant cells, but not in control samples when CPPs or p rotein were omitted. Materials and Methods Materials Cell p enetrating p eptides The CPPs used in this study are presented in Table 2 1.For protein and plasmid DNA delivery in mung bean and citrus, each peptide was used For in planta trafficking experiment s, we only used R9 and a fluorescence labeled R9 6 FAM fluorescein (R9 F) (Anaspec, Fremont, CA). Genetic m aterial and s equence d ata Plasmid DNA used in this section were reporter plasmids, pCAMBIA 2201 (Figure 2 1A) an d plasmid pCAMBIA 2202 s GFPS65T (Fig ure 2 1B) (Cambia Labs, Canberra, Australia) Both plasmids contain a multi clonal site (MCS) The MCS allows the plasmid to easily contain a gene of interest. The plasmid pCAMBIA 2201 contains the GUS reporter gene and a kanamycin resistance gene, while t he pCAMBIA 2202 sGFPS65T contains the GFP reporter gene and a chloramphenicol resistance gene.

PAGE 41

41 Sequence data was obtained from the source and uploaded into a genetic sequence program known as Vector NTI (Thermo Fisher Scientific, Waltham, MA). Citrus c ul tivars and o ther p lant t issue u sed The citrus types and cultivars used were C sinensis Osb. C paradisi Macf.) C sinensis x Poncirus trifoliata (L.) Raf. ). T hese cultivars were speci fically chosen for commercial or laboratory uses Sweet orange cultivars have enormous market value and is the leading citrus crop in North America and other Western countries (Bond and Roose, 1998). potential for regeneration when used in tissue culture experiments and as such has a large transformation yield citrange is used extensively as a rootstock for its cold hardiness and tolerance of abiotic factors when compared to other citrus From these cultivars, m ulti ple plant tissue types were used and was dependent on the experiment. T o investigate the potential use of CPPs in syst emic transport of molecules and to optimize the best conditions and tissues to use in our transformation experiments, citrus epicotyl se gm ents were primarily used. In the citrus transient expression optimization experiments, epicotyl segments and young leaves were used. U ptake activity and systemic transport in multiple citrus species using fluorescent CPP tracking assays. Understanding the systemic nature is useful for delivering cargoes into mature tissues in vivo and could even be used to inoculate plants with bactericides. We wanted to determine their transport capabilities using two tissue types: intact seedlings and mature plants. Mature plants have not historically been used in plant tissue culture because of their distinct lack of sterility. We are interested in creating an all new method of

PAGE 42

42 transformation, therefore we do not have to limit ourselves to traditional tissue culture transformation methods. Initially, we are interested in whether or not CPPs can be transported systemically in planta But, we are interested in delivering specific proteins directly into the plant. For this experiment, we used 15 orange ( Citrus x sinensis ) plants. The plants were trimmed and allowed to grow new flushes of about 20 30 cm. Once flushed, new leaves were infiltrated with PBS, containing a final concentration of 1 mM R9 F The concentration of peptide was adju sted as needed depending upon initial findings. Our experiments used two target points of entry into the recently flushed plant: one in the younger, upper leaves and the other in the slightly older, lower leaves. Systemic movement of the R9 F peptide in pl ants was determined by examining select leaves. Initially, the injected and adjacent leaves were removed and immediately examined for fluorescence. If these results indicate d that CPPs can move beyond the injection site, we began to look beyond the adjace nt leaves including the opposite end from inoculation point, and include longer time intervals. We expected that at least one cultivar should have provided enough evidence to indicate that CPPs can move throughout whole plants. This would have far reaching effects that could ultimately eliminate the need for tissue culture in gene transfer experiments. Methods Large s cale p urification of p lasmid DNA Amplification of plasmids : A utoclave d 5 00 ml Luria broth media ( LB ) in a 2 L flask cooled LB overnight The E.coli mutant containing the reporter plasmids, pCAMBIA 2201 GUS or pCAMBIA 2202 GFP S65T (Figure 2 1) was cultured in 10 mL of LB in 1 50 mL culture tubes with 10 L 50mg/mL kanamycin or 100mg/mL

PAGE 43

43 chloramphenicol, respectively, and shaken in a bacterial i ncubator at 37 C at 225 rpms overnight. At OD 600 of 0.6, the 10 mL culture was added t o pre warmed (37 C) LB, which was shake n for 2.5 hours at 37 C until the OD 600 reached 0.4 Added 25 0 L of appropriate antibiotic at the same concentrations and shak en at the same conditions overnight (12 16 hours). Lysis of Bacteria and Recovery of Plasmid DNA : Separated the liquid cultu re into plastic centrifuge bottle s. Harvested the bacteria through centrifugation at 4000 rpm in a pre cooled centrifuge (4 C) for Bacteria collected at the bottom. Poured off the supernatant and resuspend ed bacteria in 100 mL of ice cold buffer (0.1M NaCl, 10mM Tris Cl [pH 8.0], and 1mM EDTA [pH 8.0] ) Collected the pellets once more via centrifugation described previously. Bac teria resuspended into a lysozyme buffer (50 nM glucose, 25 nM Tris Cl [8.0] and 10 mM EDTA [8.0]). Added 1 mL lysozyme (10 mg/mL) 20 mL of a basic detergent solution (0.2 N NaOH and 1% (v/v) SDS) and 10 L of 100 mg/mL of RNaseA then incubated at room te mperature for 10 minutes. To neutralize the alkalai solution, 15 mL of ice cold a weak acid solution (5M potassium acetate, 11.5% (v/v) glacial acetic acid) was added and the mixture was shaken vigorously by hand and stored on ice for 10 minutes. Bacteria was recovered via centrifugation as described. Supernatant now contained the plasmid DNA. Decanted supernatant through four layers of cheesecloth. DNA washed with a 0.6 ratio (v/v) with isopropanol, mixed and incubated at room temperature for 10 minutes. D NA was recovered by centrifugati on at 5000 rpms for 15 minutes in a room temperature centrifuge. Supernatant removed, and the DNA pellet dried inverted at room temperature for 10 minutes DNA was dissolved into 10 15 mL of an elution buffer

PAGE 44

44 Purification of Plasmid DNA : To purify the DNA for laboratory use, the dissolved DNA was divided into multiple PCR purification columns. DNA was further purified according to the Re purification of plasmid DNA prepared by methods other than QIAGEN tips P rotocol (QIAG EN, Hilden, Germany ) Plasmid DNA was run on a 0.8% (w/v) agarose gel at 100V for 30 minutes to v iew the purification and verify the proper size (Figure 2 2A). To verify that the extractions contained the appropriate plasmid, restriction enzyme digestion w as performed to linearize using the restriction nuclease EcoRI at 37 C for 4 hours. Linear plasmid DNA was verified on a 0.8% (w/v) agarose gel ( Figure 2 2B) DNA concentration and purity were measu red using a spectrophotometer CPP p rotein d elivery in c i trus In order to deliver protein in citrus plants, samples of epicotyls or cotyledons were used. Samples were mixed in increasing concentrations of GUS protein from 1:1, 1:2, and 1:3, CPP to protein to determine the most efficient. To determine which CPPs were the best at delivering protein in citrus, 5 different CPPs ( Chariot, JBS_Nucleoducin, MPG i n a 1:1 mixture For both experiments, the CPP was combined with the GUS protein in solution and incubated for 1 hour at 37 C and then admini stered to the plant tissue. CPP t ransient e xpression m ethod in c itrus For transient e xpression experiments, 4 5 week old citrus seedlings, cut into 2cm segments or citrus cotyledons were used Optimization of this process was completed in small experiments, usually modifying the procedure by adding or removing a reagent pre or post treatm ent. Standard tubes and large plates were used.

PAGE 45

45 Etiolated grapefruit epicotyl segments were imbibed in a phosphate buffer solution for 1 hour. A GUS reporter plasmid, pCAMBIA 2201, was purified using plasmid maxi prep. 10 g of plasmid was suspended with 10 g of the CPP, Arginine 9 (R9) into 12 mL of phosphate buffer solution and incubated at 37 C for 30 minutes. Before introducing the epicotyl segments into solution, a lipid transfection agent, Escort, was added to the CPP plasmid complex solution in di ffering concentrations and incubated for another 10 minutes at 37 C. The segments were then incubated in the CPP plasmid Escort solution overnight (16 hours) at 37 C. The segments were removed from solution and soaked in trypsin for 5 minutes and then soaked in deionized water three times for 1 minute each The samples were then suspended in X gluc overnight (16 hours) and the resulting GUS score was recorded per segment CPP t ransformation p rotocol Cell penetrating peptide transformation procedure was tested for citrus. Etiolated citrus segments were co cultivated with the CPP, Arginine 9 (R9), and pCAMBIA 2201 in liquid medium overnight (16 hours) at 25 C. The segments were then removed from co cultivation medi um and transferred to solid medium conta ining the antibiotic borders. After 4 5 weeks, surviving segments turn ed green and some produce d several new shoots. Shoots were excised and placed on auxin containing (indole ac etic acid) rooting medium. O nce the roots were established, about 4 weeks later, the regenerated plants were placed in soil and set in a growth chamber with 12 hours of light per day. When the plants ha d enough leaf material to survive harvesting, a report er screen for either GUS or GFP was performed, followed by PCR confirm ation.

PAGE 46

46 CPP t racking in c itrus To begin tracking the R9 F in citrus seedlings, all three cultivars were germinated and grown in darkness on MS solid medium at 27 o C. They were removed from solid medium and placed in a plant preservation medium containing a CPP with a fluorescent tag, R9 F for up to 48 hours. The medium includes a final concentration of 1 or 5 mM purified R9 F. Negative controls are 1 or 5 mM of a non translocatable fluoresc ent polysaccharide, FITC Dextran (F Dex). Prior to examination, the seedling segments were removed from culture and washed to remove excess medium. A subsequent trypsin wash remove d exogenous fluorescence by cleaving any peptide fragments apart on the out side of the seedlings. Rinsing the plant segment removes the excess trypsin, and the plants can be scored for fluorescence. Samples of seedlings from each treatment and genotype are evaluated for relative fluorescence levels starting two weeks after planti ng and for a total of five weeks using the light parameters for FAM of Abs/Em = 494/521 nm. We expect to visualize R9 F in most samples taken throughout the entire plant as they grow. In this design, there should be no significant difference between relati ve fluorescence in both FAM concentrations when compared to controls, which indicates that R9 are moving systemically throughout the citrus plants. In our early experiments testing this method we have seen that R9 can be transported in the epicotyls all th e up way to the leaves Development of a r elative GUS s cale In order to determine its effectiveness at our transient expression method, we developed a relative GUS scale that we could use to compare treatments (Figure 2 3 ). The scale was rated from 0 to 5, where 0 was no expression, 1 was approximately 1 20%, 2 approximately 26 50%, 3 approximately 51 75%, 4 76 99%, and 5 was full

PAGE 47

47 expression of every visible piece of tissue. The percentages were based on blue expression per area.

PAGE 48

48 Results and Discussion On e of our main goals already under investigation is the transient expression of DNA using CPPs as the carrier agent. We hypothesize that a CPP transient expression assay could be used in combination with tissue culture in order to create a stable transforma tion protocol. Alternatively, CPPs could also be used to effectively deliver therapeutic treatments into field trees. In our preliminary studies using mung bean ( V. radiata ) and sweet orange ( C. sinensis ), CPPs proved capable of delivering protein and plas mid DNA cargo in epicotyls and cotyledons. Our data is presented below. Protein Delivery In order to determine if we could transiently express a plasmid (pCAMBIA 2201, containing a GUS gene, in plants we decided to use mung bean, where researchers have al ready proven them to work (Chen et al., 2007). First we isolated large amounts of plasmid DNA from E. coli and managed to recover and purify over 10 mg of plasmid to a concentration proper plasmid (Figure 2 2) A nanospectrophotomer was used to confirm the concentration (data not shown). Tissue used were mung seeds germinated in the dark on moist germination paper. at 37 o C. Our experiments confirmed a previous report that a 1:1 ratio of CPP to DNA is the most optimal ( Figure 2 4 ) ( Chen et al., 2007). Five day old etiolated seedlings were incubated for 1 hour wit h the CPP: complex solution at 37 o C. Seedlings were washed with a trypsin solution and rinsed with deionized water three times as indicated in the methods After rinsing, t he seedlings were stained for GUS overnight and were examined for the bl ue reporter c olor after 8 hours. Our results in mung bean indicated that the CPP JBS_Nucleoducin performed the best in the assa y, while R9 was a close

PAGE 49

49 second and contained less variance ( Figure 2 5 ). Systemic Tracking of CPPs Understanding the systemic nature is useful for delivering cargoes into mature tissues in vivo and could even be used to inoculate plants with bactericides. We wanted to determine their transport capabilities using two tissue types: intact seedlings and mature plants. Systemic Tracking of CPPs Und erstanding the systemic nature is useful for delivering cargoes into mature tissues in vivo, and could even be used to inoculate plants with bactericides. We wanted to determine their transport capabilities using two tissue types: intact seedlings and matu re plants. For in planta trafficking experiments, we used fluorescent labeled R9 6 FAM fluorescein (R9 F) to investigate how far the CPP with a fluorescent label could travel and compared it to FITC Dextran, a fluorescent labled polysaccharide The plant was placed in solution (described in Methods) (Figure 2 6A). After treatment, the plant was dissected and examined for fluorescence (Figure 2 6B E). The data indicate that R9 F is actually able to travel into the roots and through the vasculature (Figure 2 6B, C) all the way up into the leaves (Figure 2 6D, E). For the next tracking experiment both R9 and R9 F were used and complexed with GUS enzyme to determine the relative efficiency at transporting cargo and being systemic in the plant. Our data indica te R9 F and R9 per form similarly in sweet orange glucuronidase (GUS) protein is used as a cargo. Only R9 F indicates fluorescence activity, but both are capable of delivering the GUS protein cargo (Figure 2 7)

PAGE 50

50 CPP mediated Transient Expres sion of Plasmid DNA The protein delivery results prompted the next plasmid experiments. Since protein was so efficiently delivered, plasmid DNA would be more difficult to optimize, but could potentially be just as repeatable The first step to this goal w ould be to discover which CPP actually could deliver the plasmid in citrus efficiently. As described in Methods, f ive week old etiolated grapefruit ( C. paradisi ) 2201 plasmid Nucleoducin, R9, or MPG o C. Explants were incubated for 4 hours with the complex mixture at 37 o C. Seedlings were washed with a trypsin solution and rinsed with deionized water. The seedlings were stained for GUS overnight and were examin ed for the reporter color. The data indicate that R9 was expressed the most the most consistently (Figure 2 8 ). This result led to the optimizatio n of transient expression and transformation based solely around the R9 CPP. However, t his method was only successful on about 20% of total citrus explants across all the treatments and only about 60% of explants treated under R9, prompting an optimizati on to the procedure. Since CPPs can uptake via endocytosis, we decided increasing vesicle formation could improve our transient expression method. Therefore, we investigated the use of a lipid transfection reagent, Escort (Sigma Aldrich, St. Louis, MO), in order to accomplish this. This chemical has been implicated in delivering molecular cargoes, into cells in vitro (Tabatt et al., 2004) F ive week old C. x paradisi 2201 R9 Escort for 12 hours. Segments were moved and cultivated on non selection media for 5

PAGE 51

51 days, then washed with trypsin, rinsed, and stained and examined for the reporter color. (Figure 2 9 ) while a decreased effect was seen The most effective but since it was negligible to the 10 g treatment and it used half as much, 10 g was used in transformation experiments. At 10 g of Escort, 100% of expl ants expressed the GUS reporter. While the results seem to contrast with one another that the more Escort added, the w orse it performs at delivering the plasmid cargo but the likely reason is that the addition of Escort improves vesicle formation, but is limited by plant vesicles. This procedure ideally works on all citrus, but we acknowledge that certain cultivars will require further optimization, since we have only qualified use in grapefruit, sweet orange, and citrange CPP Mediated Transformation in Citrus The completion of this experiment and its data brought us one step closer to comple ting our transformation goal, as we used what we have learned toward our project purpose. Next, we wanted to determine if we can reduce the amount of bacterial DNA by replacing plasmid T borders for P borders and removing the selection markers. Our goal wi th this method is to be able to express a minimal gene PCR products, which includes only a promoter, gene and terminator, in planta. In order to increase efficiency upon Agrobacterium mediated transformation in citrus and eliminate the need for bacterial sequences, we used CPPs as carriers of genes and develop a new transformation method. We accomplished this task by to recover transgenic plants via tissue culture to impro ve such methods. The percent of

PAGE 52

52 explants producing shoots, total shoots produced, and average number of shoots produced per responding explant, reporter positives, and PCR positives were scored. We hypothesized that at least one cultivar would provide a cl ear protocol for stable integration of foreign genes when using CPPs as the delivery vector given the optimal conditions. Previous plant studies indicate that the combination of CPPs and conventional tissue culture methods could provide a new avenue for pl ant transformation (Ziemienowicz et al., 2012). The seedlings were in vitro germinated on Murashige and Skoog (MS) solid medium at 27 o C in the dark for three to five weeks. This makes the tissue much more nubile and lighter. These seedlings were cut into f ive to six 1 2 cm epicotyl sections. For cotyledon experiments, seed coats were removed aseptically and the two halves recovered. demonstrated in combination with this technique in order to regenerate transformed plants. The segments or cotyledons were imbibed in a phosphate buffered saline solution with 5% DMSO or a 1:20 toluene/ethanol (v/v) treatment to increase was be mixed in 1 mL of phosphate buffer o C for one hour, was next placed in DNA per 1 mL of solution overnight (16 hours) (Figure 2 10A ) Next the plants were placed on co cultivation media for 5 days and then switched to shooting media (Figure 2 10B). Once the segments shooted or died, the shoots were carefully removed from the segments and placed directly into rooting media (Figure 2 10C). Once the root

PAGE 53

53 system was established the plantlets were placed into soil and allowed to grow covered in a 12 hour day growth chamber (Figure 2 10D). The total number of segments and shoots used in the experiment is presented in Table 2 2. U sing this method, under the treatment using the plasmid pCAMBIA 2202 GFP SGFPS65T and R9 s hoots were regenerated that (Figure 2 10B ) passed the first round of reporter analysis with the v isualization of the GFP protein (Figure 2 11A, B ) and some explants likewise produced visu alization of GFP (Figure 2 11C) (Table 2 2) We have not yet obtained any GUS positive shoots with the pCAMBIA 2201 plasmid. When shoots might have had a blue color for GUS positive shoots, they were quickly identified them as PCR negative using our designe d primers for our constructs (Table 2 3 ). As previously described, producing transgenic plants is a very invol ved and time consuming process and r ecovering positive PCR shoots was a major goal of this research however we were only ever able to transiently express plasmid in the plant samples, and were never able to stably transform citrus. C ell P enetrating P eptide Conclusions The work presented in this chapter cab have great impact for the scientific community at large CPPs are able to efficiently bind to and traffic protein into citrus cells. This can have farther reaching affects now that purified protein with respect to the new methods of delivering gene editing proteins directly into the plant. CPPs additionally can deliver DNA plasmid into citrus cel ls, albeit a little inefficiently the optimization of plasmid delivery indicated that when paired with a lipid transfection agent transfection efficiency is much higher. By taking this method further we were able to show that although we

PAGE 54

54 can deliver plasmi d DNA directly, we were unable to get stable DNA integration or successful transformation. In conclusion, CPPs offer a system for the quick delivery of proteins and the expression of genes without using bacteria. Such techniques are useful for choosing th e best genes that should be used in conventional breeding programs but also could become a tool for the delivery of disease therapies to trees that are already planted in the field.

PAGE 55

55 Tables Table 2 1. Cell penetrating peptides and their properties CP P Charge Type Sequence R9 +9 Synthetic RRRRRRRRR R9 TAT +9 Synthetic GRRRRRRRRRPPQ R9 F +9 Chimeric RRRRRRRRR FAM TAT +8 Naturally derived GRKKRRQRRRPPQ Penetratin +7 Naturally derived RQIRIWFQNRRMRWRR Chariot +6 Synthetic KETWWETWWTEWSQPKKKRKV MPG +5 Chimeric Ac GALFLAFLAAALSLMGLWSQPKKKRKV NH (CH2)2 SH MPG +5 Chimeric Ac GALFLGFLGAAGSTMGAWSQPKKKRKV NH (CH2)2 SH JBS Nucleoducin ? Proprietary Not published

PAGE 56

56 Table 2 2. CPP mediated t ransformation r esults Cultivar #Segments #Shoots % Shoot /Segments Reporter Positive Shoots % Positive Shoots/Segment PCR Positive Shoots Grapefruit 778 118 15.17 22 2.83 0 Sweet Orange 587 30 5.11 4 .68 0 Carrizo 684 95 13.89 14 2.05 0 Totals 2049 243 11.86 40 1.95 0

PAGE 57

57 Table 2 3 Primers used in this chap ter Primer # Primer ID Location on Template DNA Sequence SJ1 35S P FW 35S Promoter catggagtcaaagattcaaatagag SJ2 Nos T RV NosT tcccgatctagtaacatagatgac SJ3 i35S P FW 35S Promoter ttcatttcatttggagagaacacg SJ4 iGUS RV GUS intron catcgaaacgcagcacgatac SJ5 35S P2 FW 35S Promoter gaagttcatttcatttggagagaacacg SJ6 GUS In RV GUS intron accgcatcgaaacgcagcacgatac

PAGE 58

58 Figures A B Figure 2 1 Visual representation of the plasmids used in the study. Sequences were uploaded from the source, CAMBIA labs, an d uploaded into Vector NTI software. The features were either added manually or present upon retrieval. A) The plasmid pCAMBIA 2201. This plasmid contains the GUS reporter gene and two antibiotic resistance genes for chloramphenicol and kanamycin. B) The p lasmid pCAMBIA 2202 SGFPS65T. Th e plasmid contains a gene for green fluorescent protein (GFP) and contains chloramphenic o l and neomycin resistance gene s

PAGE 59

59 A B Figure 2 2 Preparation and confirmation of plasmid DNA. A) Prepared, circular/superco iled plasmid DNA in three replicates (as pictured) from one 500 mL culture. 0.01 g DNA in each well. Preparations were made of each plasmid 3 different times. Lane 1: 1 kb plus Ladder Lanes 2 4: pCAMBIA 2201 (11,773 kb) Lanes 5 7: pCAMBIA 2202 GFP S65T (10, 446 kb) B) To further confirm the plasmid were suitable for experimentation, a restriction digestion was performed using EcoRI on pCAMBIA 2201. 1 g of DNA was used in the digestion assay and the reaction was performed as per the ns (New England BioLabs). Restriction digestion confirmation was performed in two replicates (as pictured) for both plas mids for each DNA preparation (3 times each). Lane 1: 1 kb plus Ladder Lanes 2 3: pCAMBIA 2201, undigested Lanes 5 7: pCAMBIA 2201, dige sted with EcoRI. Each large scale DNA preparation yielded approximately 12 mL of plasmid at a concentration of 1 g/L (Total 12mg). 15,000 10,000 2,000

PAGE 60

60 Figure 2 3 Relative quantification scale of GUS expression. To determine transfection efficacy of cell penetrati ng peptides (CPPs) using DNA or protein required the use of a relative quantification scale. After treatment with a GUS plasmid (pCAMBIA 2201) or isolated GUS protein, and subsequent staining with X gluc, plant material was scored using a scale from 0 to 5 where 0=0% (no blue color), 1: > 1 % 25%, 2: 2 6 50%, 3: 5 1 75%, 4: 7 6 % 99 %, 5: 100% C. paradisi ) samples, with the scale presented below indicating their relative GUS levels. B) A represen V. radiata ). C) stain is able to be expressed in the center of the plant segment.

PAGE 61

61 Figure 2 4 Cell penetrating peptides (C PPs) complex with DNA plasmid cargo. Plasmid DNA, pCAMBIA 2201, was incubated for 1 hour at 37 C with the given ratios of the CPP, Arginine 9 (R9). The solutions were run in a 0.8% agarose gel at 100 V for 30 minutes. The amount of DNA used was constant (0.1 g). Lane 1 : 1 kb ladder; Lane 2: plasmid only (0.1 g DNA, 0 g CPP); Lane 3: 1:1 ratio CPP to plasmid (0.1 g CPP, 0.1 g DNA); Lane 4: 3:4 ratio ( 0.075 g CPP 0.1 g DNA ); Lane 5: 1:2 ratio (0.05 g CPP, 0.1 g DNA); Lane 6: 1:4 ratio (0.25 g CP P, 0.1 g). This experiment was repeated three times.

PAGE 62

62 Figure 2 5. Comparison of f ive different CPPs in delivering purified GUS enzyme. Five different CPPs, Chariot, JBS_Nucleoducin, MPG investigated for their efficiency in de livering GUS protein. The values are averages of 10 different segments, from 3 independent assays of 3 segments in the first two assays, and 4 in the third. Error bars represent the standard error from the mean. All values had an extremely low p value and are considered significant.

PAGE 63

63 A B A B C D E Figure 2 6 Systemic transport o f the cell penetrating peptide. Arginine 9 Fluorescein ( R9 F Citrus sinensis x Poncirus trifoliata ) were propagated on MS ger mination medium for five weeks in the dark. Seedlings were removed from the solid medium and placed in an R9 F containing a fluorescent CPP, R9 F, or water only as a control for 2 days. Transverse sections and the leaves were removed and examined under blu e light fluorescence stereoscope. Green/yellow color indicates R9 F and the red color indicates chlorophyll auto fluorescence A) Visualization of the seedlings in culture tubes immersed in the CPP solution. B) Transverse section of epicotyl under R9 F trea tment C) Transverse section of epicotyl under FITC Dextran treatment D) Leaf from R9 F treatment E) FITC Dextran Leaf. Each tracking experiment was conducted three separate times using eight different seedlings, four of the control and four of the experime ntal.

PAGE 64

64 Figure 2 7 Average relative GUS scores when traffi cking protein cargo in citrus epicotyl segments Using the protein delivery in citrus protocol described in methods, the CPPs R9 and R9 F were compared in their efficacy in delivering GUS pr otein cargo. The resulting GUS score was recorded. The figure represents the mean of at least 10 epicotyl segments per treatment per experiment and the experiment was repeated 4 times. Error bars represent the standard error from the mean.

PAGE 65

65 Figure 2 8. Efficacy of different CPPs in plasmid delivery of pCAMBIA 2201 in citrus In order to choose the most efficient CPP to deliver cargo in citrus, four CPPs, Chariot, JBS Nucleoducin, MPG and R9, were examined for their ability to deliver the GUS reporter plasmid, pCAMBIA 2201 E picotyl samples were treated according to the methods, and then suspended in X gluc overnight (16 hours) to stain and the resulting GUS score was recorded per se gment. T he relative GUS score was recorded. A) Visualization of the epicotyl segments post treatment. B) Average relative GUS scores were calculated for each CPP and plotted in the chart. The experiment was repeated three times and approximately 12 segment s were used per treatment per test Error bars represent the standard error from the mean.

PAGE 66

66 Figure 2 9 Average GUS scores from an assay testing the efficacy of Escort in assisting CPPs deliver plasmid cargo. Etiolated grapefruit epicotyl segments were subjected to the CPP transient expression protocol described in methods The epicotyl samples were suspended in X gluc overnight (16 hours) to stain and the resulting GUS score was recorded per segment. The assay was repeated three times with a minim um of 12 samples per treatment and the results were averaged together. Multiple controls were used: only plasmid (No Escort/CPP), only Escort (Escort Only), and one without the addition of Escort (CPP Only). Error bars represent standard error from the mea n. Significance was determined using a student t compared to the No Escort/CPP control. Error bars represent the stand ard error from the mean

PAGE 67

67 A B C D Figure 2 10 Cell penetrating peptide transformation procedure for citrus. A ) Etiolated citrus segments are co cultivated with the CPP, Arginine 9 (R9), and pCAMBIA 2201 in liquid medium overnight (16 hours) at 25 C. B) The segments are removed from co cultivation media and transferred to solid medium. After 4 5 weeks, surviving segments turn green and some produce several new shoots. C) Shoots are excised and placed on auxin containing (indole acetic acid) rooting medium. D) Once the roots are established, about 4 weeks later, the regenerated plants are placed in soil and placed in a growth chamber with 12 hours of light per day. The plants pictured are 2 months old. When the plants have enough leaf material to survive harvesting, a reporter screen for either GUS or GFP was performed, followed with PCR confirmation.

PAGE 68

68 A B C Fi gure 2 11 Visualization of GFP in citrus epicotyl segments from plasmid Epicotyl segments were subjected to CPP transformation protocol describ ed in methods and diagramed in Figure 2 9 R egenerated shoots were examined for the green fluorescent protei n (GFP) from pCAMBIA 2202 SGFPS65T. A) Shoots under bright light. B) The same shoots under blue light with Abs/Em = 494/521 nm. C) The epicotyl segments from which the shoots were removed were cross sectioned and examined under blue light. The left segment indicates a control treatment, whereas the right segment indicates a segment treated with pCAMBIA 2202 GFPS65T. See Table 2 2 for number of replicates.

PAGE 69

69 Reprinted with permission from: Chen, M., Jensen, S.P., Hill, M.R., Moore, G., He, Z., and Sumerlin, B.S. (20 15). Synthesis of amphiphilic polysuccinimide star copolymers for responsive delivery in plants. Chemical Communications. 51: 9694 9697. Reprinted with permission from: Hill, M.R., MacKrell, E.J., Forsthoefel, C.P., Jensen, S.P., Chen, M., Moore, G.A., He Z.L. and Sumerlin, B.S. (2015). Biodegradable and pH responsive nanoparticles designed for site specific delivery in agriculture. Biomacromolecules. 16: 1276 1282. CHAPTER 3 NANOPARTICLES IN CIT RUS : A TARGETED DELIVERY SYSTEM Nanoparticle Literature Review Althou gh pH responsive materials have been extensively studied in the realm of medicine, less attention has been given to the application of these ad aptive materials in agriculture ( Gao et al., 2010; Trivedi and Kompella, 2010; Puoci et al., 2008 ) Despite the re lative lack of attention in agricultural sciences, responsive polymeric nanoparticles have significant potential to enhance the delivery efficacy of pesticides, nutrients, and drugs, which can in turn provide valuable benefits to help cure deadly plant dis eases ( Bhattacharyya et al., 2010; Chinnamuthu and Boopathi 2009; Perez de Luque and Rubiales, 2009; Yang et al., 2014; Zhang et al., 2013 ) Specific ally direct delivery of nanoparticles into the phloem, the vascular tissue in plants that aids in the tran sport of nutrients and photosynthates, is desirable not only because of its critical role in carrying nutrients but also because many plant pathogens reside in the phloem such as citrus huanglongbing (HLB) (Bove and Garnier, 2003 ) While most plant tissu e exists in a slightly acidic environment, the phloem exhibits a higher, slightly alkaline pH (Mendoza C ozatl, 2008). Thus, much like pH responsive nanoparticles designed to exploit the low pH of cancer cells, a nanodelivery system designed to respond to t he higher pH of the phloem may be useful for site specific delivery in plants, thereby potentially enhancing the eff iciency of delivered component.

PAGE 70

70 Many fundamental questions arise when applying stimulus responsive ( Theato et al., 2013 ) polymers for delive ry in plants. For instance, additional consideration must be given to how the nanoparticles enter plant cells and are subsequently transported to targeted sites. As opposed to a cell membrane, which takes in materials of various sizes by endocytosis, plant s possess a cell wall, which is more ordered and exhibits specific pore diameters of 30 nm (Fleischer et al., 1999 ) Therefore, it is important to carefully control the size of polymer nanoparticles so they can readily pass through the cell wall and reach the plasma membrane. Once in the plasma membrane, the loaded nanoparticles can be fu rther transported to the targeted sites along apoplastic and symplastic pathways by diffusion or electrochemical gradients. Given the lack of an excretory system in plants, the fate of materials used for such applications is another important concern. Whil e the most well known and studied pH responsive polymers {e.g., poly[(meth)acrylic acid] and poly[N,N dimethylaminoethyl(meth)acrylate]} have proven to be effective in a number of physiological applications, they typically contain nondegradable all carbon backbones, which limits their use in plants. Because biodegradability is of utmost importance for the delivery to plants to reduce concerns about environmental fate and sustainability, new types of stimulus responsive bio degradable materials are needed ( Ga o et al., 2010; Alarcon et al., 2005; Murthy et al., 2003 ) The construction of nanoparticles suitable for delivery to plant phloem thus becomes more complicated. The nanoparticles must be (i) responsive to the basic pH found in the phloem, (ii) small en ough to enter the plant cell through cell wall junctions, and (iii) biodegradable to reduce the extent of accumulation over time.

PAGE 71

71 Additionally, these nanoparticles would ideally be equipped with moieties to facilitate transport along electrochemical gradie nts and, most importantly, be capable of encapsulating guest compounds, including hydrophobic and hydrophilic small molecules or drugs. To this end, Polysuccinimide (PSI) has attracted attention for many years because of the biodegradable and hydrophilic n ature of its derivatives, namely, poly(aspartic acid) (PASP) and poly( hydroxyethylaspartimide) (PHEA) ( Kumar 2012; Moon et al., 2006; Tombre and Sarwade, 2005; Gu et al., 2013; Jeong et al., 2012; Lai et al., 2014; Ma et al., 2013 ) PSI is derived from the ri ng closing condensation polymerization of l aspartic acid. Subsequent hydrolysis of the polymeric repeat units and opened units (Figure 3 1) ( Wang et al., 2003 ) The biodegradability of PASP derived from the hydrolysis of PSI has been previously documented, although longer degradation periods compared to those of other poly(amino acids) were necessary, which is likely due to the presence of a mix of l and d aspart ic acid units hydr oxyl structures in the backbone ( Tombre and Sarwade, 2005; Alford et al., 1994; Roweton et al., 1997; Nakato et al., 1998). Nevertheless, the degradation is still expected to progress as opposed to that of polymers prepar ed radically with polymethylene backbones. Because of the reactivity of PSI toward primary amines, previous reports have involved various moieties being readily incorporated onto the PSI backbone to give fully functionalized PASP derivatives. Alternatively PSI has been partially functionalized, with the remaining succinimidyl units being hydr olyzed to give PASP copolymers (Xu et al., 2012; Wang et al.,

PAGE 72

72 2012 b ). Additionally, many groups have incorporated stimulus responsive moieties onto the PSI backbone (i .e., hydrazone bonds ( Wan g et al., 2012a; Lu et al., 2014a ; Lu et al., 2014 b ; Lee et al., 2015), amines ( Gu et al., 2013; Moon et al. 2010; Nemethy et al., 2013), thiols and disulfides ( Gyarnati et al., 2013; Zhang et al., 2012; Cui et al., 2013), carboxy ls (Xu et al., 2012), imidazole (Seo and Kim, 2006 ) etc.) to impart responsiveness onto the biodegradable PASP backbone. For this project, exploring the inherent pH responsive nature of PSI is the focus Because PSI is hydrolyzed at elevated pH to form w ater soluble and biodegradable PASP, we envisioned employing PSI as a potential platform for the development of a site specific delivery system for agricultural applications. Thus, utilizing PSI as a pH responsive and hydrophobic scaffold, we aimed to prep are a nanosized delivery system to capitalize on the higher pH of the phloem ( Figure 3 2 ). The approach includes partially functionalizing the backbone of PSI to form self assembled nanoparticles and relying on the hydrolytic lability of the remaining succ inimidyl groups for stimulus responsiveness. While PSI is not water soluble at neutral pH, its succinimidyl groups are hydrolyzed at elevated pH to yield de rivatives of water soluble PASP (Nakato et al., 2000 ) This pH driven solubility transition may prov ide a convenient mechanism for inducing supramolecular dissociation of PSI based polymeric assemblies. We reasoned that this transition in solubility could be exploited to allow PSI based polymers to serve as a platform for site specific, pH responsive gue st molecule release. Moreover, because the resulting PASP based copolymers are known to be biodegradable, the change in water solubility may simultaneously increase the rate of degradation of the polymeric byproduct. Although

PAGE 73

73 previous reports have utilized PSI as a precursor for the development of stimulus responsive (co)polymer materials, to the best of our knowledge, the inherent pH responsiveness of PSI itself has yet to be investigated. In this chapter the effect of nanoparticles were studied with resp ect to their toxicity in citrus. Additonally, nanoparticle s can be readily controlled by precipitation conditions and that particles small enough for delivery to plant phloem are possible. Furthermore, the PSI based copolymers showed limited toxicity to pl ant tissue at biologically relevant concentrations, suggesting these materials are a viable option for agricultural drug delivery systems. Materials and Methods Materials l Aspartic acid (98%), o phosphoric acid (85%), hexylamine (99%), and 2 (2 aminoethox y)ethanol (98%), were purchased from Sigma Aldrich. Potassium phosphate monobasic (Fisher) was used to prepare 0.1 M phosphate buffers with adjusted pH values for release studies. Murashige and Skoog basal salt mixture (MS salts) was purchased from Phytote chnology Laboratories. Benzyl adenine (BA), myoinositol, Claforan (cefotaxime), and a plant cell viability assay kit were obtained from Sigma Aldrich. All organic solvents were used as received. Synthesis of P olysuccinimide (PSI) The synthesis of polysucci nimide was prepared by M. Hill. P SI was prepared as previously reported (Moon, et al., 2006; Wang et al., 2012 ) Briefly, l aspartic acid (20 g, 0.15 mol) and phosphoric acid (10 g, 0.10 mol) were added to a 500 mL round bottom flask. The reaction vessel w as placed under nitrogen and heated to 180 C while its contents were being stirred for 2 h. The product was dissolved in

PAGE 74

74 N,N dimethylformamide (DMF, 100 mL) and precipitated into cold methanol. The product was then collected via vacuum filtration and wash ed with additional methanol and water to remove any remaining DMF. Preparation of Functionalized Nanoparticles This portion of the work was completed by M. Hill. The nucleophile (HA, 2 AEE, or NaOH) was added to a solution of PSI dissolved in DMF and stirr ed at room temperature overnight. The functionalized copolymer was then added dropwise to a beaker of stirring deionized water. For example, for a copolymer functionalized with 20% HA (20% PSI HA), PSI (498 mg, 5.15 mmol) was dissolved in DMF (5 mL), and H A (0.13 mL, 1.0 mmol) was added dropwise to the solution. The solution was stirred at room temperature overnight and precipitated into deionized water (200 mL). The aqueous nanoparticle solution was transferred to dialysis tubing (Spectra/Por, molecular we ight cutoff of 3500) and placed in deionized water, which was replenished daily for 1 week. Preparation of Germination Medium for the Plant Toxicity Assay This work was completed by the author of this document, S. Jensen. MS salts (2.15 g), myoinsoitol (50 mg), FM stock (1.865 g of Na2EDTA and FeSO47H2O (1.390 g) into 500 mL; 5 mL), and sucrose (15 g) were added to an autoclaved beaker. The solution pH was adjusted to 5.7, and the volume was brought to 1 L. Agar (7 g) was added to the medium and heated for 30 min to obtain the final germination medium. Preparation of Citrus Seeds This work was completed by the author of this document, S. Jensen. Germination medium (12 mL) was dispensed into autoclaved culture tubes. Healthy

PAGE 75

75 and viable citrus seeds from grap efruit ( Citrus x paradisi ) and sweet orange ( Citrus x sinensis ) were selected, and the outer seed coats were removed. Seed kernels were kept moist at all times. Each seed was placed in a sterile autoclaved beaker with a stir bar and stirred in 300 mL of th e following solutions for the indicated time intervals: 70% alcohol (2 min), 10% sodium hypochlorite (10 min), and three sterile DI water rinses (2 min). Culture of Citrus Seeds This work was completed by the author of this document, S. Jensen. One seed wa s inserted into each germination medium filled culture tube. The test tube racks were wrapped with plastic wrap and doubly wrapped with aluminum foil to minimize light exposure. Finally, the test tube racks with seeds were placed on the bottom of a growth chamber for 5 weeks, when the etiolated seedlings were used for toxicity screening. Preparation of MSBC Medium This work was completed by the author of this document, S. Jensen. MS salts (4.3 g), myoinositol (100 mg), GM stock [10 mL of a solution of glyci ne (20 mg), nicotinic acid (50 mg), pyridoxine HCl (100 mg), and thiamine HCl (100 mg) in DI water (500 mL)], sucrose (30 g), and BA (2 mg) were dissolved in DI water. The pH of the solution was adjusted to 5.7, and additional DI water was added to bring t he volume to 1 L. Agar (8 g) was added and the solution autoclaved for 25 mi n. After the solution had cooled, 1 mL of filtered and sterilized (500 mg/mL) Claforan stock sterilized culture dishes, and different concentrations of polymers were added before soli dification when the MSBC medium was in liquid phase near room temperature.

PAGE 76

76 Toxicity Assessment by Tissue Culture This work was completed by the author of this document, S. Jensen. Citrus plants were cut into 1 2 cm segments and placed on an appropriate MSB C medium filled culture dish. The dishes were then put into a growth chamber with alternating 12 h light and dark periods for 21 days. Alive and dead segments were counted after 8 and 21 days. Results and Discussion pH Responsiveness of Nanoparticles To s tudy the pH responsiveness and the drug release of the PSI based nanoparticles, the loaded nanoparticles were exposed to buffered solutions, and the change in fluorescence intensity was monitored over 72 h. Because Nile red is hydrophobic in water and fluo resces only within the hydrophobic interior of the nanoparticle, fluorescence is expected to decrease as the succinimidyl units are hydrolyzed and the nanoparticles disassemble to release the dye. While the hydrolysis of PSI under basic conditions is well known, we expected some hydrolysis would still occur under neutral conditions, albeit at a reduced rate. We thus first explored the hydrolysis kinetics at various pH values with 1% PSI 2AEE. As expected, the release rate was rapid at pH 8.5 and 8 because o f the hydrolysis of the succinimidyl backbone of the PSI units, with approximately 80 and 60%, respectively, of the dye being released at 30 h. On the other hand, PSI is more stable under neutral and acidic conditions; therefore, at pH 7 and 6, less than 4 0 and 20%, respectively, of the dye was released over 72 h (Figure 3 5A ). Release studies also showed that the functionalizing moiety (2AEE, HA, and NaOH) did not signif icantly affect the release rate, but incorporating high degrees of

PAGE 77

77 functionality, in th e e of PSI HA, slowed the release or prevented nanoparticle disassembly, with minimal release being observed in alkaline environments (Figure 3 5B ). We hypothesize that the hydrophobicity of the hexyl chains kept the copolymer sufficiently amphiphilic to m aintain nanoparticle stability, even after complete hydrolysis. Greater than 15% functionalization with HA appeared to render the material sufficiently hydrophobic to prevent disassembly and any dye release. Lastly, a copolymer of 10% PSI HA was precipitat ed at different concentrations to produce nanoparticles of varying sizes (13, 28, and 83 nm). The release at pH 8.5 suggested hydrolysis was slightly faster with smaller nanoparticles (Figure 3 5C ), which is potentially due to the increased surface area. A lthough a small amount of hydrolysis occurs at neutral pH, almost no hydrolysis occurs in acidic environments. Because plant tissue is slightly acidic (pH 5 6) except in the phloem (pH 8), the nanoparticles offer considerable promise for site specific de livery in agricultural applications. Naphthaleneacetic acid (NAA) is a synthetic plant hormone in the auxin family (Flasinski and Wydro, 2014), and is involved in many processes of live plant activity, such as cell elongation, division, and response to ext ernal environmental variety (Gomez and Carpena, 2014). NAA has limited solubility in water and excellent fluorescence and UV absorption properties (Moye and Wheaton, 1979; Guo et al., 2011), making it useful as a model pesticide to provide insight into the potential utility of PASP co PSI copolymers for controlled release in plants. As shown in Figure 3 9A, only minimal NAA release was observed for the PASP co PSI copolymer nanoparticles at neutral pH, suggesting the hydrophobic succinimide units are relati vely stable under these conditions. On the other hand, when the pH was increased to 8.5 ( i.e. near the

PAGE 78

78 pH of the phloem), NAA release was significantly accelerated. These results are consistent with the pH dependent hydrolysis of the hydrophobic PSI units to yield hydrophilic PASP units and subsequent nanoparticle disassembly. To confirm this, (PASP 26 co PSI 17 ) 3 was dissolved at pH = 8.5 and allowed to age for 48 h. Afterwards, the resulting polymer was isolated by dialysis and lyophilization and subsequen tly characterized by NMR and FTIR spectroscopy. The results (Figure 3 9B and C) were consistent with hydrolysis of the succinimide units, as evidenced by these spectra being nearly identical to those of polyaspartate homopolymer. Plant Toxicity This port ion of work was designed by the author of this document, S. Jensen. To evaluate any possible toxicity of the polymers toward plant tissue, a method was developed using living plant tissue. Citrus seeds were planted on germination medium and cultured in the dark at 25 C for 5 weeks, until the seedling reached the length of the culture tube. Each seedling was then cut into fragments and seeded on plates filled with MSBC medium with varying concentrations of the p olymers (PASP, PSI, and PSI HA). The plates wer e then put into a growth chamber with alternating 12 h lighting cycles and analyzed after 8 and 21 days to determine the percent of living tissue (Figure 3 6 ). As shown in Figure 3 6 PASP, PSI, and PSI HA showed limited toxicity up to concentrations of 19 HA no toxicity. It should be noted that although PASP dissolved easily in the MSBC medium, the more hydrophobic PSI homopolymer and PSI HA copolymer required DMSO to fully dissolve into the medium, which may have influenced the results of the toxicity assays for these (co)polymers at high concentrations. Nevertheless, the

PAGE 79

79 relatively low toxicity of the PSI based pol ymers to plant tissue provides further evidence of their promising potential for future applications in agriculture. While there are many established methods to evaluate the safety of polymeric materials in medicine, methods for toxicity evaluation in plan t cells and tissues are much less developed. We developed a method based on plant tissue culture to evaluate the toxicity of polymers in plants (Hill et al., 2015). Citrus seeds were planted on germination medium and were cultured in the dark at 25 o C for five weeks, causing the seedlings to become partially etiolated, or white, to reduce the potential interference of chlorophyll during subsequent fluorescence microscopy. The seedlings were cut into 1 2 cm fragments and placed on MSBC plates, which included specific concentrations of dissolved (PASP 26 co PSI 17 ) 3 The seedlings were placed into a growth chamber with alternating light and dark (12 h each) for two weeks. The dead and living tissue segments were counted. As shown in Figure 3 4 A, almost all citru s segments survived, even at high concentrations ( i.e., 240 g/mL) of polymer, indicating (PASP 26 co PSI 17 ) 3 is relatively non toxic to citrus plant tissue. Plant Cell Viability Assay This portion of the work was designed by S. Jensen. To further investiga te the toxicity of (PASP 26 co PSI 17 ) 3 we utilized a dual color fluorescent staining system designed for simultaneous visualization of vi able and non viable plant cells (Koyoma et al., 2001; Regan and Moffatt, 1990). Viable cells have intact plasma membran es and intracellular esterases with the ability to enzymatically hydrolyze a fluorescein diacetate probe. The resulting fluorescent hydrolyates are polar compounds that cannot cross the plasma membrane, which leads to green fluorescence within the cytoplas m. On the other hand, propidium iodide can enter non viable cells due to their damaged

PAGE 80

80 membranes, which leads to bright red fluorescence upon intercalation with DNA within the nucleus. As shown in Figure 3 4B citrus leaves treated with (PASP 26 co PSI 17 ) 3 demonstrated the green color of fluorescein diacetate under blue light at 490nm/525nm Ex/Em (FITC), while showing no fluorescence under blue light at 570nm/590nm Ex/Em (Rho). Conversely, when dead citrus leaves were used as a positive control, very little green fluorescence from FITC was observed, while significant red fluorescence from the propidium iodide was clearly visible. These results offer further evidence that (PASP 26 co PSI 17 ) 3 is non toxic at the concentrations considered. Nanoparticle Conclusion s Responsive nanoparticles were developed to capitalize on the higher pH of plant phloem for the design of a site specific delivery system to plants. Amphiphilic copolymers based on PSI were synthesized by functionalization with various amines that provide d a convenient means of tuning the hydrophilic hydrophob ic balance needed for nanoparticle formation. Controlling the degree of functionalization and nanoprecipitation conditions proved to be viable methods of programming nanoparticle size, and could prove useful when developing new systems for delivery applications. The nanoparticles were loaded with a model hydrophobic compound and showed controlled release at alkaline pH, with increased rates at higher solution pH and lower degrees of functionalization. Lastly, the toxicity of the polymers was tested on plant tissue, with only minimal toxicity being observed at reasonable concentrations of the polymers. In addition c ompared to traditional methods involving the thermal condensation polymerization of aspar tic acid to PSI and its subsequent partial hydrolysis to PASPA to produce amphiphilic polysuccinimide copolymers, a novel

PAGE 81

81 method using NCA ring opening polymerization was employed. The star polymer product, PBLA, was produced with a controllable molecular weight and a narrow molecular weight distribution. After deprotection, the resulting polypeptides were converted to PSI containing copolymers by partial ring closing of the aspartic acid units. The resulting amphiphilic star copolymers self assembled into aggregates with the ability to incapsulate NAA, a common plant hormone, and showed rapid release at an increased pH, similar to conditions present in the phloem of plants. Furthermore, a novel method to assess the toxicity of polymers in plant cells and ti ssues was established. Because plant cells can not be reliably cultured, plant tissue culture and a dual color fluorescent staining system were utilized to evaluate the toxicity of amphiphilic polypeptide. The results showed limited toxicity of the synthes ized polymers to plant tissue. Although the utility of controlled delivery systems has been widely proposed for the treatment of human disease with the goal of reducing side effects and improving availability of the delivered drugs, similar delivery system s for pesticides and nutrients to plants have received much less attention. However, given the current low use efficiency of fertilizers and pesticides, modern agriculture could greatly benefit from a site specific delivery system to reach targeted sites a nd reduce potential pollution caused by undelivered components. We believe this work has significant potential for phloem limited release, and given the biodegradability and minimal toxicity of these polymers to plant tissue and cells, other potential appl ications in agriculture can be envisioned

PAGE 82

82 Figures Figure 3 1 Preparation of PSI. Construction of PSI from Acid Catalyzed Condensation of L Aspartic Acid and Hydrolysis to PASP Scheme created by M. Hill.

PAGE 83

83 Figure 3 2. Proposed PSI b ased n ano pa rticle delivery and release (A ) PSI is synthesized through the step growth condensation reaction of L aspartic acid and ( B ) functionalized with hydrophilic primary amines to prepare amphiphilic and pH responsive PSI copolymers. ( C ) Amphiphilic PSI copol ymers are assembled into nanoparticles and ( D ) loaded with hydrophobic molecules, ( E ) which may disassemble and release loaded components at elevated pH, leaving behind the water soluble and biodegradable poly(aspartic acid) derivative polymer. Scheme was created by M. Hill.

PAGE 84

84 Figure 3 3 Nanoparticle toxicity in citrus. Plant tissue (citrus seed sapling) viability at various concentrations of PASP (purple), PSI (green), and PSI HA (orange). Plant toxicity assay was designed by the author of this doc ument, S. Jensen.

PAGE 85

85 Figure 3 4 Citrus plant toxicity of (PASP 26 co PSI 17 ) 3 Toxicity evaluation of (PASP 26 co PSI 17 ) 3 by (A) plant tissue culture (where NC = negative control (no polymer) and PC = positive control) (complete tissue death induced by high concentrations of a toxicant) and (B) dual color fluorescent staining system. Top image shows the results of a live citrus leaf treated with (PASP 26 co PSI 17 ) 3 and the bottom image shows the results from analysis of a dead citrus leaf (Red areas indic ate dead citrus cells and green areas indicate living citrus cells); DIC = Differential interference contrast; FITC = fluorescein isothiocyanate fluorescence setting; Rho = Rhodamine fluorescence setting Plant toxicity assay was designed by the author of this document, S. Jensen.

PAGE 86

86 CHAPTER 4 CRISPR/CAS9 TRANSCRIPTIONAL REGU LATION IN CITRUS : A MOLECULAR SWITCH FOR EARLY FLO WERING CRISPR/Cas9 Literature Review The goal of this chapter is to enhance a modern citrus breeding program to improve yield and decr ease production costs create better quality fruit and to infer dise ase resistance by decreasing the rate at which citrus flower s, ultimately increasing the rate at which new generations can be produced In this manner, t argeted genome engineering technolo gy can be used to contribute to future varietal improvement in citrus Genome Targeting T echnologies Current targeted genome technology primarily use zinc finger nucleases (ZFNs), transcription activator like effector nucleases (TALENs), or clustered reg ularly interspaced short palindromic repeat (CRISPR) and CRISPR associated protein 9 ( Cas9 ) (herein called CRISPR/ Cas9) systems Each system has been successfully used to genetically modify plants including citrus ( Jia and Wang, 2014 ) ZFNs can be used to cleave a target DNA site, by combining a FokI nuclease domain to a cluster of zinc finger proteins modified transcription factors, which act as DNA target ing mechanisms. The design of the ZFNs include a linear block of tandem sequences that target a sp ecific DNA sequence. In this way, ZFNs are extremely versatile due to the modular nature of their design (Klug, 2010). Once the DNA is cleaved at the targeted site, the DNA is subsequently repaired through nonhomologous end joining (NHEJ) that leads to mut ated sequence ZFNs have used successfully for

PAGE 87

87 genome modification in plants such as soybean ( Glycine max ) (Curtin et al., 2013) Arabidopsis (Lloyd et al., 2005) maize ( Zea mays ) (Shukla et al., 2009) More recently, TALEN technology has come into use a s another genome targeting approach for genome engineering TALENs can target any genome site based on a pattern that results from the repeat variable di residue (RVD) sequences found within a conserved TALE N repeat, with each RVD specifically binding to a corresponding nucleotide (Boch et al., 2009) This makes their design to be rather simple in the laboratory. Recently, researchers have shown TALENs can edit genome s in a variety of plant species, including A rabidopsis (Cermak, et al. 2011) rice ( Oryza s ativa ) (Li et al., 2012) and tobacco ( Nicotiana tabacum ) (Zhang et al., 2013 c ) Currently the Cas9/sgRNA system has rapid ly developed as another very promising method for genome engineering CRISPR/Cas9 has commenced a targeted genome editing revolution and is seen as a primary method to eliminating genetic diseases in both plants and animals, including humans (Jia and Wang, 2014; Ma et al., 2017). Indeed, in 2017 Ma et al., proved that in human embryos, correction of a pathogenic gene mutation was cured though they are skeptical to begin trials in a clinical setting. In nature, the CRISPR/Cas 9 system serves as a bacterial immune system of prokaryotes. The CRISPR locus contains the characteristic cluster of repeat sequences interspersed by spacer sequen ces These sequences arise as new genetic elements emanating from previous virus or plasmid DNA i nfections the bacteria population encountered During future infections when DNA from a virus or plasmid match es the

PAGE 88

88 previously encountered version in the CRI SPR, a defense response is mounted and the foreign DNA is excised from the bacterial genome ( Wiedenheft et al., 2012 ) Overview of the CRISPR/Cas9 S ystem The most widely used CRISPR/Cas9 system derives from the actual bacterial defense mechanisms in Strep tococcus pyogenes SF370, which has since been adapt ed for targeted genome engineering (Cong et al., 2013). This bacterial system is comp ri sed of proteins, such as Cas9, Cas1, Cas2, and the related coat protein 9 (COP9) signalosome 1 ( Csn1 ) as well as RNA molecules named, CRISPR RNA (crRNA) and trans activating CRISPR RNA (tracrRNA). In response to foreign nucleic acid which the bacteria activates its nuclease activity by transcribing tracrRNA to hybridize with a crRNA and subsequently complex with the Cas9 protein. The functional crRNA:tracrRNA:Cas9 complex then targets a protospacer or spacer region, upstream of a protospacer adjacent motif (PAM) The PAM sequence is necessary for target bi nding and the exact Streptococcus pyogenes Cas9). The crRNA consists of a 20 25 nucleotide sequence which is complementary to the protospacer sequence, whereby in the functional complex, which t hen binds to the targeted region to facilitate Cas9 mediated DNA cleavage. The CRISPR/Cas system has been subsequently simplified from a three molecule complex to a much easier two component system using the same Cas9 but with only one single guide RNA (s gRNA). The sgRNA is a fusion of the crRNA and tracrRNA elements and can bind to both the Cas9 and the spacer region (Hsu et al., 2013; Jia and Wang, 2014) Once the Cas9 sgRNA complex binds the target, the tracrRNA sequence of the sgRNA

PAGE 89

89 DNA. If the seed and target DNA sequences match, the gRNA will continue to anneal to at the proper location Cas9 will only cleave the targe t if sufficient homology exists between the gR NA spacer and target sequences, though off site targeting is of great concern ( Cradick et al., 2013; Fu et al., 2013). The function of the Cas9 is to serve as a nuclease by cutting the foreign DNA. T he wn natural genome editing pathways will repair DNA itself, leaving its genome intact, but hopefully by damaging the target so it can no longer create a functional product for the invading pathogen. To do this, Cas9 has two different endonuclease domains: R uvC and HNH. Once bound Cas9 undergoes a second conformational change upon target binding that positions the se nuclease domains to cleave on either strand of the target DNA. The end result of Cas9 mediated DNA cleavage is a known as a double strand break (DSB) within the target DNA approximately 3 of the PAM sequence. The resulting DSB is then repaired by one of two repair pathways: the efficient, error prone NHEJ pathway mentioned previously, and the less efficient, but more accurate Ho mology Directed Repair (HDR) pathway (Belhaj, et al., 2015) The NHEJ repair pathway is capable of rapidly repairing DSBs, but usually produces insertions or deletions (InDels) at the DSB. Th ough, it is likely produces negative results in nature, in resea rch settings, th is activity of NHEJ mediated DSB repair has important practical implications, because one CRISPR/Cas9 treatment on a population, can result in a diverse array of mutations In most cases, NHEJ gives rise to small InDels in the target DNA wh ich result in in frame amino acid deletions, insertions, or frameshift mutations leading to premature stop codons HDR repair is rarer, but it

PAGE 90

90 uses a template upon which the cell can make a more perfect repair (Belhaj et al., 2015) Ideally, the end result of the CRISPR nuclease activity is a loss of function mutation within the targeted gene; however, the effectiveness for this mutation does not always produce consistent phenotypes, as the repair is highly differential between cells in the same treatment. One method to improve target mutagenesis multiplexing, using CRISPR involve s using multiple sgRNAs each targeting a different sequence on the same gene, provided Expressing several s gRNA s present on the same plasmid ensures that a cell will express all of the desired s gRNAs and increases the likelihood that all desired genomic edits will be carried out by the CRISPR/ Cas9 system (Belhaj, et al. 2015) Current multiplex CRISPR systems enab le researchers to target anywhere from 2 to 10 genetic loci by cloning multiple gRNAs into a single plasmid. These multiplex gRNA vectors can conceivably be combined with any of the aforementioned Cas9 derivatives to not only knock out target genes, but act ivate o r repress target genes as well discussed below The Cas9/sgRNA system (herein referred to as the aforementioned CRISPR/Cas9 system) is very simple and affordable. Whereas both ZFNs and TALENs require significant amounts of design for each DNA targe t, the Cas9/sgRNA system requires changes only in the sgRNA sequence for target specificity rather than manipulating the Cas9 protein. Cas9/sgRNA technology has been successfully used for genome editing in rice (Mia et al., 2013), tomato (Brooks, et al. 20 14), and Arabidopsis (Feng et al., 2014).

PAGE 91

91 Recently, Jia and Wang (2014), used the CRISPR/Cas9 system to induce genetic modification into sweet orange ( C. sinensis ). As previously discussed, citrus is the most economically important and extensively grown f ruit tree crop in the world and the genetic improvement of citrus is limited by the slow growth and long maturation cycles. Thus, it is important to build upon their research of the CRISPR/Cas9 system in citrus in order to create other new technologies usi ng CRISPR/Cas9, especially with regard to breeding in traits in a significantly short amount of time, due to the costly and devastating effect of HLB. In this chapter, a modified CRISPR/Cas9 system is introduced in citrus as a method to shortening citrus m aturation times by inducing citrus to flower on demand. In order to convey the importance of this new method, an a lternative use of CRISPR/Cas9 is discussed, citrus flowering mechanisms are described in detail, the cloning and design of the CRISPR/Cas9 sys tem will be explained, and the results will show that reduction in flowering times is possible. Transcriptional Regulation of Target Genes Using CRISPR/Cas9 The CRISPR/Cas system is a potent and flexible tool for genome editing. Since the Cas9 protein has the ability to bind target DNA and cleave the DNA it is possible to mutate the Cas9 protein and allow researchers to study the effects of differential gene expression By mutating both RuvC and HNH nuclease domains Cas9 can be rendered in active by four point mutations D10A, D839A, H840A and N863A, resulting in a Cas9m4 molecule that is functionally unable to cleave target DNA yet retains the ability to bind to target DNA based on the gRNA targeting sequence (Mali et al., 2013) By u sing the nuclease f ree Cas9 m4 and targeting the Cas9m4 sgRNA complex to transcriptional start sites, the genes targeted could be repressed or activated, much like a light switch (Mali et al., 2013) Furthermore, this system can be enhanced with

PAGE 92

92 transcriptional repre ssors or activators, and targeted to promoter region results providing a clear transcription al repression or activation of downstream target genes. It is this simple activation or repression has the most importance in the regulation of citrus genes, especially with regard to citrus flowering. In general, in the subtropical climate of Florida, flowering occurs when the plant reaches maturity and the days get cooler Flowering is induced by a set of genes, described at length in the following section, most notably th e Flowering Locus T (FT) genes in citrus. However, simply transforming citrus with a constitutive promoter (i.e. 2016). Therefore, using a molecular switch of a ctivating or repressing flowering genes in order to induce early flowering in whole plants would be an extreme boon to the citrus industry and could eliminate the need for regulation and extensive tissue culture protocols just by producing hardier and dis ease resistant plants much faster. Physiology of Flowering in Citrus In order to investigate this potential method the overall floral induction process should first examined. Upon exiting juvenility, when the weather is cooler (usually) citrus F T 3 is induced. This is in contrast to the low basal levels of this gene in citrus. In Arabidopsis FT gene s have functions that promote flowering, the typical meristem structure regulators from the Terminal Flower (TFL) gene family has delays flowering and kee ps the plant meristem prolific In many other plant species, FT homologues have been demonstrated to play a role in flowering as well (Pin and Nilsson, 2012) ( Liljegren et al., 1999) The citrus TFL is nearly 65% identical to and a homolog of in Arabidopsi s T FL and like its counterpart is also a repressor of flowering and inhibits

PAGE 93

93 flowering when overexpressed and increases flowering when down regulated or knocked out in Arabidopsis thaliana (Pilliteri et al., 2004) Thi s chapter present s a method to modify the expression of, Terminal Flower 1 (TFL), in order to reduce juvenility. Using Cas9m4, fused to a repressor domain, we intend ed to directly target specific sequences in the TFL promoter region s in order to decrease juvenility times without th e use of a transgene insertion that is deemed unfavorable. To this end, w e cloned multiple Cas9m4 fusion constructs, with activators and repressors, adaptable to any gene system in citrus with the right sgRNA sequences. We also designed several TFL sgRNA c onstructs designed specifically to target TFL promoter regions with a high density of transcriptional regulators Finally, we designed a quantitative real time PCR assay in which we can actually measure the change in transcript levels of TFL and other rela ted flowering genes. Materials and Methods Plant M aterials C. x sinensis ( C. x paradisi /Macf. ) sour orange ( C. x aurantium ), L.) Raf) and a trifoliate relative early flowering phenotype, ( Eremocitrus glauca x Poncirus trifoliata ). Specific trees and ages are given when presented in the results. Plasmid C onstruction pCAMBIA 2201 Cas9m4 and derivatives The plasmid pCAMBIA 2201 w as obtained through CAMBIA labs (Canberra, Australia) (Figure 2 1) To insert the Cas9m4 gene sequence s, the promoter and

PAGE 94

9 4 terminator sequences, and the activator (VP16) or repressor (KRAB) the MCS site was exploited using restriction digestion. To generate the most important plasmid pCAMBIA 2201 FMV: : Cas9m4 NLS:KRAB::35ST and the othe r Cas9m4 plasmids, we next obtained a plasmid containing Cas9m4 with NLS from Addgene (Mali et al., 2013) (Figure 4 1) and the pUC118 FMV Pol y 2 1 generously given by V. Febres (Figure 4 2) Next was the design of each of primers. DNA sequences for all primers used i n this study are provided in Table 4 1. The first step toward the completed plasmid was to put the Fig Mosaic Virus (FMV) promoter, the 35S (constitutive ) terminator from Cauliflower Mosaic Virus, along with an additional MCS in between, with different restriction sites. The sequence was amplified by PCR using the primers, SJ15 and SJ16 (Table 4 1). These primers contained sequences for restriction sites f or KpnI and XbaI resprectively to be present in the PCR product. Once the product was purified, pCAMBIA 2201 and the PCR product were double digested with KpnI and XbaI (New England BioLabs Ipswich, Massachussetts, USA ). Once the restriction digestion was purified, DNA ligase was added to create the new plasmid. The MCS in pUC118 Poly 2 1 allowed another double restriction digestion. First, the Cas9m4 plasmid was PCR amplified using primers SJ17 and SJ18 which would produce products with both ApaI and SpeI restriction sites (Table 4 1) A restriction digestion was performed using ApaI and SpeI on both the PCR profuct and the new plasmid containing the FMV promoter and 35S terminator. Then a ligase reaction was performed and pCAMBIA 2201 FMV::Cas9m4::35St (F igure 4 3A) was created.

PAGE 95

95 Finally to add the KRAB repressor and the VP16 activator, PCR amplification using SJ22 SJ23 and SJ25 SJ26 (respectively) using followed by double restriction digestion using NotI and SpeI produced the final plasmid products pCAMBI A 2201 FMV::Cas9m4 :KRAB ::35St and pCAMBIA 2201 FMV::Cas9m4 :VP16 were created. ::35St (Figure 4 3B, C). Construction of pIDT:SMART::AtU6p:sgRNA::Sp_term and insertion of sgRNAs For designing the plasmid containing the sgRNA, pIDT:SMART::AtU6p:sgRNA::Sp_ term was desi gned by V. Febres with the sole intent of cloning sgRNAs easily into a plasmid backbone that is highly modular. Once obtained, the rest of the procedure was aided by V. Febres but performed entirely by the author. To aid in construct ion of the sgRNA s, sequence data was obtained from Addgene, and then placed into Vector NTI, a sequence reading program. With these tools, sgRNA sites were found using web software CRISPR direct (Naito et al., 2015) and analyzed for optimal sites in the promoter r egion of TFL. T he TFL promoter region presented several options where sgRNAs could be used, so selected primers were compared to special promoter regions where protein binding of transcription factors occur. Five different sgRNA sites were selected and lab eled by their location of the promoter sequence (Table 4 2). To put the sgRNA sequences into the pIDT SMART plasmid, a double restriction digestion was performed using the pIDT SMART plasmid and the small designed oligonucleotides with restriction sites. T he digestions were ligated together and then the resulting plasmids were sent for sequencing to check for size (Figure 4 4 A ). The sequencing was performed instead of a gel, for accuracy and for convenience, because

PAGE 96

96 on a gel with a 5,000 kb product, adding only 20 25 base pairs, would not be readily visible. Once the pIDT sgRNA plasmids were completed. We then cloned them into pCAMBIA 2202 (Figure 2 1) since the Cas9m4 would be on pCAMBIA 2201 (Figure 2 1). This was completed using the same cloning method a s before, PCR amplification with restriction sites, followed by double restriction digestion and then ligation. In this case, sgEX F1 (Sph) and sgEX R2 (XbaI) were used as the primers, and Sph and XbaI were the restriction enzymes. Once the plasmid was com pleted, the genetic material was amplified using 2201 sgRNA F and 2201 sgRNA R and then sequenced to confirm (Figure 4 4B) A groinfiltration of Citrus Three different r ecombinant Agrobacterium (Agl1) cells containing the pCAMBIA 2201 FMV Cas9m4 35ST, the pIDT:SMART::AtU6p:sgRNA 968 ::Sp_term or pIDT:SMART::AtU6p:sgRNA 1129 ::Sp_term were c ultured in 10 ml YEP medium with appropriate antibiotics at 28C for 24 48 hours until the culture s reach ed an OD 600 1.0. T he bacteria l cultures werecentrifuged, and the pellet was washed once with a liquid media optimized for Agrobacterium mediated transient expression, known as AgroBest (Wu et al., 2014)) The susepesion was centrifuged once more and then suspended in approximately 10 mL AgroBest, to an OD. 600 = 0.8. Each of the cell lines were mixed and then collected in a syringe and infiltrated into the abaxial side of the citrus leaves, either grapefruit ( C. x paradisi ) or ( C.x aurantium) The extent of total inf iltration was marked with a permanent marker. Upon sample collection, once every 24 hours (unless otherwise noted), whole or partial leaves were removed and immediately wrapped into aluminum foil and preserved in liquid

PAGE 97

97 nitrogen. ce As a control, citrus lea ves were subjected to agroinfiltration in the absence of a Cas9m4 plasmid RNA Extraction Samples were collected as described below (see Plant Materials) and kept in liquid nitrogen during the experiment and stored in a 80 C freezer for no more than one week before purification of RNA. At least three different collection sites were combined to make about 100 200 mg of plant tissue and then ground to a fine powder using a mortar and pestle and liquid nitrogen. The powder was added to an approximate volume of 500 L. Next, 1.5mL off Trizol (Life Technologies, Carlsbad, California, USA) was added and shaken vigorously for about 30 seconds. Samples were centrifuged at 12,000 g for 10 minutes at 4 C and the upper phase was collected and placed into a fresh t ube and incubated at room temperature (RT, 23 24 C) for 5 minutes 0.3 mL of chloroform was added, and tubes shaken vigorously for 15 seconds, and then incubated at RT for 5 minutes To precipitate the RNA, the upper phase was collected and then 0.75mL of Isopropyl alcohol was added to the solution and shaken vigorously for 30 seconds. Samples were incubated for 10 minutes at RT then centrigued for 10 minutes at 12,000 g at 4C Following centrifugation, the supernatant was poured away and the RNA pellet w as washed with 1. mL of 75% ethanol and by vortexing. To pellet the RNA, the mixture was centrifuged at only 7,500 g for 5 minutes at 4C. The supernatant was poured away and then the pellet was dissolved into 30 L of RNase Free sterile water.

PAGE 98

98 RNA Purifi cation The crude RNA extraction was then further purified to laboratory relevance. RNA Germany). In brief, RNeasy Mini spin columns (QIAGEN, Hilden Germany), were used to bind the RNA, where it could be washed by various buffers, and treated with DNase to remove any other foreign debris from contaminating the RNA sample. The sample was then eluted into 30 L of RNase Free sterile water. Generation of cDNA After RNA purif action, cDNA was generated using a simple two step process. First the concentration of the RNA was read using a nanop spectrophotometer, and 1 g of each RNA sample was added to a solution of 5 M random decamers( Invitrogen, Thermo Fisher, Vilinius, Lithua nia ) and 2 mM dNTPs (0.5mM each) (Promega, Madison, Wisconsin) and water to a toal volume of 16 L. The mixtures were then incubates at 85 C for 2 minutes and quickly transferred to ice. Next, 1X 1st Strand Buffer, 100 U MMLV reverse transcriptase, (each from Invitrogen, Thermo Fisher, Vilinius, Lithuania), 40 U Rnase Inhibitor (Ambion, Foster City, California, USA) was added. The resulting solution was mixed by pipet for 30 seconds and then incubated at 42 C for 1 hour followed by 95 C for 10 minutes to create the cDNA Before use and storage, cDNA was diluted to 0.0025 g/ L for use in qRT PCR analyses. Quantitative R eal T ime PCR (qRT PCR) Using the StepOne Software (Fisher Scientific, Waltham, MA) an experimental and plate design was created The qRT PCR reaction mixtures used were Taqman Mast er Mix (2X) and Assay Mix (20X), and were kept on ice (or in the refrigerator when not immediately in use ). In addition the Assay Mix, which contains the probe, should be

PAGE 99

99 protected from light as much as possible. Using an electronic repetitive pipette 18 l of Reaction Mixed was applied to the bottom of each corresponding well. Using an electronic repetitive pipette 2 l of diluted cDNA (2 l of cDNA + 38 l of sterile ddH2O) was then applied to the corresponding wells. Next, the optical adhesive film was a fixed to the surface of the plate and mixed Centrifuge for 2 minutes at 2500 RPM. Place plate in the Real Time PCR machine and start assay. This assay will run like normal PCR, except there is an additional pro be with a flu o rophore. When this probe is amplified as a template, the fluorophore releases and the concentration of excited fluorophore is measured. This should be directly related to how many RNA transcripts of the gene were present at the time of liqui d nitrogen preservation. The output for the assay actually measures an RQ value, and this is calculated by comparing it to the control gene, 18 S a protein that is constitutive and has high transcript levels. By comparing the target gene with 18S, the alg orithm sets the control gene to 1.0 and then calculates the fold change difference of that gene relative to the this gene. Results and Discussion Establishment of Flowering Gene Baseline Levels In order to examine how much repression of TFL could actual ly help a citrus plant come out of juvenility and start to flower, a baseline level of TFL was first examined. To find the basal TFL expression experiments all four cultivars were used. Grapefruit, sweet orange, and sour orange trees were 1.5 years old. F or the early flowering trifoliate, plants were only 6 months old. All plants were grown in a

PAGE 100

100 greenhouse from germination on campus at the University of Florida, Gainesville, Florida, and though the trifoliate was grown in a psyllid proof facility. Three le aves were taken from three different plants and approximately 60 mg from each of leaf were combined together to make one sample. Once the samples were prepared and the cDNA was generated, qRT PCR was performed. The calculated RQ values are an aggregate of three different samples per species from 9 different plants per cultivar totaling 27 plants. This experiment was conducted twice, once in August and once in October, using the same plants. While each sample was compared to 18S in the qRT PCR assay, the da ta presented show (Figure 4 5). This was due to the fact that TFL levels were generally low in the leaves compared to 18S and presenting it this way allows the differences between each cultivar to be visualized better. The results in Figure 4 5 show that each cultivar has different levels of TFL and all are much higher than levels present in the citrus relative Carrizo. The results were also surprising due to the fact that the early flowering trifoliate had extremely h igh levels of TFL, even though these plants typically flower within the first 2 3 months after germination. Although it is initially surprising, the result can probably be explained by the amount of meristem activity needed to keep the plant growing past i ts early months identity afterward, the plant would likely die, immediately after fruiting. Comparison of Mature vs Juvenile Flowering Gene Levels In this experi ment, we wanted to see if TFL was actually complicit in the transition from juvenility into adulthood.

PAGE 101

101 For comparison of mature meristems to juvenile stems, sour orange alone was used. In this experiment, three different branch meristems were collected fr om mature trees grown for 10 years in the orange grove on campus at the University of Florida, Gainesville, Florida and three different apical meristems were selected from juvenile trees at 1.5 years old. Approximately 40 mg of tissue from each leaf was us ed to make one sample. Each RQ value is an aggregate mean from four different samples, totaling 12 leaves from 24 different plants. The experiment was conducted twice in one week in the month of November. The results presented from the experiments are pres ented in Figure 4 6. The results indicate that TFL anf FT genes are approximately expressed at the same levels in mature plants, around 3 4 fold higher than the control 18S. In contrast, juvenile plants had roughly the same expression of FT genes as the ma ture plant, but the TFL expression levels averaged to be nearly 20 fold higher than that of the 18S gene. The difference in the RQ value from leaves to meristems of TFL expression, is not that surprising, since TFL is supposed to be expressed in the merist ems, however it was shocking that TFL expression levels in juvenile tissue were approximately 4 fold higher than the levels present in mature tissue (Figure 4 6). This result further confirmed that TFL could be an acting agent in citrus juvenility and that its expression, as in Arabdiopsis could limit the ability of FT3 to determine a floral identity in the meristem. Targeted Gene E xpression of TFL mediated by Cas9m4 to Induce Early Flowering To test the potential of the Cas9/sgRNA system to induce TFL gene expression in citrus, agroinfiltration was employed to deli ver the Cas9 m4 and sgRNA. For the Agroinfiltration experiments eighteen different grapefruit plants and eighteen different sour orange plants were grown in the greenhouse on campus at the

PAGE 102

102 Uni versity of Florida, Gainesville, Florida The plants were first pruned to produce uniform shoots and young, pliable leaves. Next they were first transferred to a 12 hour day/night cycle growth chamber set to 15 C until after the completion of the experimen t. Each plant was treated with the plasmid containing Agrobacterium (as described above), in all of their leaves. Samples were compiled from three different treatment sites from approximately 60 mg each. Three different samples were used in each run. At th e end of the experiment, leaves would still be on the plant that had been treated but not collected. For the controls, plants were inoculated with a mock treatment which contained a mixture of two different full length plasmids in Agrobacterium pCAMBIA 22 01 and pCAMBIA 2202 without Cas9m4, to make sure that any expression changes were not happening due to the stress of the leaf under attack from multiple bacteria, and were only happening in response to the Cas9m4 and sgRNA genes being present.. The experim ent was run four different times from October to February Specifically, pCAMBIA 2201 FMV:: Cas9 m4 :KRAB::35St and two TFL targeting sg RNA s were transformed into Agrobacterium (See Agroinfiltration of Citrus), and directly infiltrated into grapefruit lea f tissue on the abaxial side. Up to five days after agroinfiltration, total RNA was extrac ted from the treated leaf areas. The amount of RNA transcr ipts at the time of collection of TFL gene was compared to the FT3 at 5 different time points, across five d ays The results from the experiment are presented in Figure 4 7. As expected, the TFL expression decreased by 2 fold, in the first day and Cas9m4 levels, not previously endogenous in cit rus, rose to levels 4 5 fold higher than the endogenous control, 18S This result confirmed that both the sgRNA and Cas9 m4 worked, since the results were

PAGE 103

103 then compared to levels in the mock trial. After the first day though, on days 2 and 43, Cas9m4 levels were reduced, but still present, and TFL levels increased as expect ed. Following this, at Day 4 and 5, with Cas9m4 transcript levels all but gone, TFL levels again went back down. This was unexpected, but the fact was clear, that most of the work done by the CRISPR/Cas9m4 system, would be completed by Day 3 at the latest (Figure 4 7) The experiment with multiple cultivars and multiple days got quickly overloaded, and the test was simplified t o just two different cultivars over 48 hours. The same infiltration and collection method were kept the same. Additionally, the plan ts were still kept in the growth chamber at 15C. In this run, the data show that this procedure has unexpected results than previously intended (Figure 4 8). Before infiltration, samples were collected, and the control values were all similar to one anoth er gene for gene. After just 24 hours however, TFL in the experimental plants were reduced and Cas9m4 levels were present in abundance, as expected. However, FT3 levels were not static, by infiltrating into the leaves where FT3 is made, and TFL levels are minimal, the Cas9m4 system was actually able to increase the levels of FT3 nearly 60 fold. After two days, TFL increased well beyond its initial basal levels, Cas9m4 was still present and FT3 levels went even higher to nearly 100 fold. This finding made us wonder if a plant would actually flower early. While the effects were not visible, at least one plant was able to be phenotypically changed. Using this method, we were successfully able to obtain an early flower ing phenotype (Figure 4 9 ). Five weeks post agroinfiltration, a flower bud was spotted (Figure 4 9A ) and the flower was examined as it blossomed over the course of almost 6

PAGE 104

104 weeks (Figure 4 9B C) Once the flower opened (Figure 4 9C ), the pollen was evaluated for its viability, the flower was polli nated with its own pollen manually, and the flower set a fruit (Figure 4 9D ). The fruit did not mature or ripen and soon died, but nonetheless, this design shows that it is possible to enhance early flowering in varieties that usually have a long juvenilit y period such as sour orange. The findings suggest that the method of transiently expressing Agrobacterium plasmids loaded with a repressor and Cas9m4 and sgRNAs of a target gene can in fact induce a change in the gene expression of both the target gene a nd the target genes competitors, possibly removing a feedback mechanism. These changes could be significant enough to the plant to produce a visual phenotypic effect, but since it only occurred once in multiple trials across 36 different plants, the method likely requires more optimization. With respect to this body of work, the CRISPR/Cas9m4 transcriptional regulation method has proven successful, since it will not always be so evident that one gene could have such a significant effect on the whole plant.

PAGE 105

105 Tables Table 4 1 Primers used in this chapter Primer # Name Location Sequence SJ15 SJ15 FwdFMV P KpnI FMV Promoter aaaaaaggatccccctggcttgtggggaccagacaa SJ16 SJ16 Rev 35S T XbaI 35S Terminator tttttttctagaactggattttggttttaggaattagaaattt SJ17 S J17 Fwd Cas9m4 ApaI Cas9m4 Start Codon aaaaaagggcccaccatggacaagaagtactccattg SJ18 SJ18 Rev Cas9m4 NLS SpeI Cas9m4 NLS Stop Codon aaaaaaactagttcacaccttcctcttcttcttggggtc SJ19 SJ19 Rev Cas9m4 SpeI Cas9m4 end aaaaaaactagtgtctccaccgagctgagagaggtcg SJ20 SJ20 Fwd Cas9m4 VP64 NLS ApaI Cas9m4 VP64 Start Codon aaaaaagggcccaccatgcccaagaagaagaggaaggtg SJ21 SJ21 Rev Cas9m4 VP64 SpeI Cas9m4 VP64 Stop Codon aaaaaaactagttcacctagagttaatcagcatgtccagg SJ22 SJ22 Fwd VP16 SpeI VP16 activator start ttttttactagtc ctcccaccgatgttagcttgggcg SJ23 SJ23 Rev VP16/EcR NotI EcR Stop codon gatttcagcgcaagcggccgcttac SJ24 SJ24 Fwd EcR SpeI EcR Start Codon ttttttactagtatgcgtcccgaatgcgtcgtgcctg SJ25 SJ25 Fwd KRAB SpeI KRAB domain start ttttttactagtgtgaccttcaaggatgtatttgtggac SJ26 SJ26 Rev KRAB NotI KRAB domain end ttttttgcggccgcctagggctcttctcccttctccaac SJ27 SJ27 Fwd FMV P KpnI FMV Promoter ggtaccccctggcttgtggggaccagacaa SJ28 SJ28 Rev 35S T XbaI 35S Terminator tctagaactggattttggttttaggaattagaaattt

PAGE 106

106 4 1. Continued Prim er # Name Location Primer Sequence SJ30 SJ30 BsaI/HindIII MCS agcttgagaccaaggtctct SJ31 SJ31 FMV P KpnI FMV Promoter ggtaccccctgggcttgtggggac SJ32 SJ32 RV Cas9m4 5' bp 144 bp 168 gtcgaacaggagggcgccaatgagg SJ33 SJ33 FW Cas9m4 500 bp bp 3345 bp 3370 aaggaacagcgacaagctgatcgcac SJ34 SJ34 RV Cas9m4 500 bp 3827 bp 3853 cgaggatcactcttttggagaattcgc SJ35 SJ35 FW Cas9m4 3' bp 3858 bp 3884 cgctaacctcgataaggtgctttctgc SJ36 SJ36 35S T XbaI 35S Terminator aaaaaaacgcgtccaccatgcccaagaagaagaggaag SJ37 SJ37 Fw d Cas9m4 VP64 MluI bp 2 bp 27 aaaaaaactagtcctagagttaatcagcatgtccaggtc SJ38 SJ38 Rev Cas9m4 VP64 No Stop SpeI bp 4336 bp 4355 aaaaaaactagtaccgctggcctccaccttcct SJ39 SJ39 Rev Cas9m4 3'NLS SpeI bp 4168 bp 4188 taataaagtgttgacaagatccgataaagc sgEX F1 (S ph) bp 302 ggtctc c catgggagtgatcaaaagtcccacatcg sgEX R2 (XbaI) bp 563 ggtctc a ctagaatgcatcggtaatacggttatccac 2201 sgRNA F cgctcatgtgttgagcatataagaaacc 2201 sgRNA R acgacgttgtaaaacgacggccagtg

PAGE 107

107 Table 4 2. SgRNA o ligonucleotides and c onstructed p las mids Name Sequence Constructed Plasmid Name CsTFL_602 F GATT GTACTTGGGTCCCTTAGAAT AtU6p::CsTFL_602_sgRNA ::Sp_t CsTFL_602 R AAAC ATTCTAAGGGACCCAAGTAC CsTFL_786 F GATT TACTAAGATTTAAAAGAGTA AtU6p::CsTFL_786_sgRNA ::Sp_t CsTFL_786 R AAAC TACTCTTTTAAATCTTAGTA CsTFL_896 F GATT TATACTTGGGAGTTTACTAA AtU6p::CsTFL_896_sgRNA ::Sp_t CsTFL_896 R AAAC TTAGTAAACTCCCAAGTATA CsTFL_968 F GATT TGAGATGTATGTATAGAGGG AtU6p::CsTFL_968_sgRNA ::Sp_t CsTFL_968 R AAAC CCCTCTATACATACATCTCA CsTFL_1129 F GATT CACAGTTGTTTCAAAACCTA AtU 6p::CsTFL_1129_sgRNA ::Sp_t CsTFL_1129 R AAAC TAGGTTTTGAAACAACTGTG

PAGE 108

108 Figures Figure 4 1. Plasmid Cas9m4. The plasmid Cas9m4 was purchased off Addgene (Mali, et al., 2013). It contains the coding sequence for Cas9m4. A mutated Cas9 at four differe nt point to reduce fully hinder its nuclease activity. This gene is important for transcriptional regulation of genes.

PAGE 109

109 Figure 4 2. Plasmid pUC118 FMV Poly 2 1. This plasmid is used to insert the FMV promoter and the 35S terminator into the plant o ptimized reporter plasmid pCAMBIA 2201 while also containg a MCS for additional cloning

PAGE 110

110 A B C Figure 4 3. Cas9m4 plasmids. Graphical representations of sequenced cloned products of Cas9m4. Each sequence was obtained from the ICBR at the Univer sity of Florida using pCAMBIA 2201 specific primers and Cas9m4 internal primers A). pCAMBIA 2201 FMV::Cas9m4::35St. This is used to repress target genes, though not meant to be as effective as Cas9m4:KRAb fusion pictured in B. B) pCAMBIA 2201 FMV::Cas9m4 :KRAB ::35St a much more efficient repressor than just Cas9m4. C) An activator version, pCAMBIA 2201 FMV::Cas9m4 :VP16 ::35St

PAGE 111

111 A B Figure 4 4 Cloning and c onfirmation of sgRNA insertions. A) Sequenced data aligned to confirm the insertion of the pro per sgRNAs, since the insertions would be too small to evaluate on a gel, and no further restriction sites were inserted. B ) Schematic diagram of pIDT:SMART::AtU6p:sgRNA::Sp_term indicating the promoter, terminator, and ampicillin resistance locations.

PAGE 112

112 Figure 4 5 Basal e xpression of TFL in j uvenile c itrus l eaves. Citrus leaves from 1 year old juvenile plants were collected and harvested for RNA. RNA was used to generate cDNA, and the resulting cDNA was used in qRT PCR experiment s Here the basal l evels of expression are presented r (Citrus sinensis x Citrus trifoliata ). Samples are aggregates from three different sites. Numerical data are averaged together across three different runs. Error bars represent the standard e rror of the mean.

PAGE 113

113 Figure 4 6. Comparison of flowering genes in mature plants vs juvenile plants. Mature meristems (10 y/o) and juvenile meristems (1.5 y/o) were collected and RNA were extracted. cDNA preparation was conducted. Then the qRT PCR was run. TFL (Terminal Flower), FT (Flowering Locus T).

PAGE 114

114 Figure 4 7 Transient expression of a Cas9 repressor and two flowering target genes Leaf tissue of grapefruit ( C. x paradisi ) was inoculated with the plasmids, pCAMBIA 2201 Cas9m4:KRAB and At U6p::CsTFL_968_sgRNA::Sp_term together with AtU6p::CsTFL_1129 _sgRNA ::Sp_term, according to the protocol presented in the metgods. Samples were collected once each day over 5 days RNA was extracted and purified from infiltrated sections and subsequently ge nerated into cDNA. Each sample ran was compiled from 3 different infiltrated sites. The graph presents the data from two aggregate qRT PCR runs averaged to the mean. Error bars represent standard error of the mean.

PAGE 115

115 Figure 4 8. Relative expression of Cas9m4, FT3 and TFl after repression. A time course trial showing the relative expression of flowerinf genes in response to Cas9m4 and two sgRNAs designed to repress TFL. KRAB 9 11 is the experimental group and used pCAMBIA 2201 FMV::Cas9m4: KRAB ::35St, pCAMBIA 2202 AtU6p::CsTFL_ 9 68_sgRNA::Sp_term and pCAMBIA 2202 AtU6p::CsTFL_ 11 29 _sgRNA::Sp_term Where the control is the mock treatment of pCAMBIA 2201 and pCAMBIA 2202.

PAGE 116

116 A B C D Figure 4 9 Flower development from a young (18 months) sour orange ( C itrus aurantium ). The leaves of the plant were agroinfiltrated with Cas9m4 and TFL sgRNAs 968 and 1129 as described in the methods and incubated at 15 C. Leaf samples were taken at 1 5 days post infiltration and the plants were placed back into the gr eenhouse. One plant flowered early and produced viable pollen and even set fruit before dying. A) 4 weeks post infiltration. B) Puffy white flower; 5 weeks after infiltration C) Open flower; five weeks and two days post infiltration. D) Fruit set; 7 weeks post infiltration

PAGE 117

117 CHAPTER 5 CONCLUSIONS The work presented in the previous chapters represents the attempts to bring citrus breeding into the 21 st century, in order to help the citrus industry survive an onslaught of pathogen vectors, most notably HLB. I n doing so, we have shown that CPPs, nanoparticles, and a modified CRISPR/Cas9 were shown to be highly effective. Citrus faces an immediate challenge from the pathogen HLB. Genetic resistance is thought to be the solution the problem, yet even if genetic di sease resistance was conferred into a GM plant line, it would be extremely costly to market and require legal proceedings. In lieu of these problems, we propose that cell penetrating peptides could have a profound change in the perceptions of GM plants. CP Ps have a variety of applications and proposed functional mechanisms. Regardless of the actual translocation method, the central role of the original CPP, Tat, is to penetrate the cell membrane and allow proteins and nucleic acids to be administered into a host cell, in order to promote the transcription of foreign DNA (Faingold et al. 2012). This unique function has been reproduced using synthetic peptides and subsequently can deliver many types of cargo in all types of cells. Each proposed mechanism for the action of CPPs is likely to occur in all cells simultaneously but in varying amounts depending on the CPP, cargo and environmental conditions. It is our hope that the novel function of CPPs can be applied to many applications, and we will specifically examine their use in developing a more efficient transformation protocol in citrus that will be more readily available to the public

PAGE 118

118 It is our belief that woody specialty crops, like citrus, will require the development of an innovative method to investiga te their genetics of disease resistance and determine how to improve them is necessary. As citrus researchers from the University of Florida, the Moore lab is dedicated to leading the new wave of citrus biotechnology for genetic disease resistance. Our pre liminary research is promising that our primary objective of achieving stable disease resistant plants could be successful. If we develop a CPP transformation method for citrus, the payoffs will be substantial and far reaching. The first individuals to ben efit would be plant biologists, who already work on genetic improvement of citrus, but improved varieties of citrus would further benefit citrus producers, processors and ultimately, the consumers.

PAGE 119

119 LIST OF REFERENCES Adler, A.J., Fasman, G.D. and Blout, E.R. (1963). Base catalyzed Formation of Cyclic Compounds from Poly benzyl L aspartate and Poly benzyl L glutamate. J. Am. Chem. Soc. 85: 90 97. Alarcn, C.H., Pennadam, S., and Alexander, C. (2005). Stimuli responsive polymers for biomedical applic ations. Chemical Society Reviews. 34: 276 285. Alford, D.D., Wheeler, A., and Pettigrew, C.A. (1994). Biodegradation of thermally synthesized polyaspartate. Journal of Polymers and the Environment. 2: 225 236. Alvarez, S., Rohrig, E., Sols, D., and Thomas M.H. (2016). Citrus greening disease (Huanglongbing) in Florida: economic impact, management and the potential for biological control. Agricultural Research. 5: 109 118. APHIS. 2016. Citrus Diseases. Animal and Plant Health Inspection Service Retrieved from: https://www.aphis.usda.gov/aphis/resources/pests diseases/save our citrus/soc citrus diseases Atwell, B.J., Kriedemann, P.E., and Turnbull C.G.N. (1999). Plants in action: adaptation in nature, performance in cultivation. Macmillan Education Australi a, South Yarra, Victoria. Search. Bain, J.M. (1958). Morphological, anatomical, and physiological changes in the developing fruit of the Valencia orange, Citrus sinensis (L) Osbeck. Australian Journal of Botany. 6: 1 23. Baligar, V.C., Fageria, N.K., and H e, Z.L. (2001). Nutrient efficiency in plants. Commun. Soil Sci. Plant Anal. 32: 921 950. Batool, A., Iftikhar, Y., Mughal, S., Khan, M., Jaskani, M., Abbas, M., and Khan, I. (2007). Citrus greening disease a major cause of citrus decline in the world a re view. Hort. Sci.(Prague). 34: 159 166. Bartz, R., Fan, H., Zhang, J., Innocent, N., Cherrin C., and Beck S.C. (2011). Effective siRNA delivery and target mRNA degradation using an amphipathic peptide to facilitate pH dependent endosomal escape. Biochem J. 435: 475 487 Belhaj, K., Chaparro Garcia, A., Kamoun, S., Patron, N.J., and Nekrasov, V. (2015). Editing plant genomes with CRISPR/Cas9. Current opinion in biotechnology. 32: 76 84. Bent, A. (2006). Arabidopsis thaliana floral dip transformation method M ethods Mol Biol. 343: 87 103.

PAGE 120

120 Bhattacharyya, A., Bhaumik, A., Rani, P.U., Mandal, S., and Epidi, T.T. (2010). Nano particles A recent approach to insect pest control. African Journal of Biotechnology. 9: 3489 3493. Blencowe, A., Tan, J.F., Goh, T.K., and Q iao, G.G. (2009). Core cross linked star polymers via controlled radical polymerisation. Polymer. 50: 5 32. Boch, J., Scholze, H., Schornack, S., Landgraf, A., Hahn, S., Kay, S., Lahaye, T., Nickstadt, A., and Bonas, U. (2009). Breaking the code of DNA bi nding specificity of TAL type III effectors. Science. 326: 1509 1512. Bond, J.E. and Roose, M.L. (1998). Agrobacterium Mediated Transformation of the Commercially Important Citrus Cultivar Washington Navel Orange. Plant Cell Reports. 18: 229 234 Bove, J. M. and Garnier, M. (2003). Phloem and xylem restricted plant pathogenic bacteria. Plant Science. 164: 423 438. Bove, J.M. (2006). Huanglongbing: a destructive, newly emerging, century old disease of citrus. J Plant Pathol 88: 7 37. Bov, J.M. (2014). Huangl ongbing or yellow shoot, a disease of Gondwanan origin: Will it destroy citrus worldwide? Phytoparasitica. 42: 579 583. Brooks, C., Nekrasov, V., Lippman, Z.B., and Van Eck, J. (2014). Efficient gene editing in tomato in the first generation using the clus tered regularly interspaced short palindromic repeats/CRISPR associated9 system. Plant physiology. 166: 1292 1297. Cao, H., Glazebrook, J., Clarke, J.D., Volko, S., and Dong, X. (1997). The Arabidopsis NPR1 gene that controls systemic acquired resistance e ncodes a novel protein containing ankyrin repeats. Cell. 88: 57 63. Casadei, M.A., Pitarresi, G., Calabrese, R., Paolicelli, P., and Giammona, G. (2008). Biodegradable and pH sensitive hydrogels for potential colon specific drug delivery: characterization a nd in vitro release studies. Biomacromolecules. 9: 43 49. Cermak, T., Doyle, E.L., Christian, M., Wang, L., Zhang, Y., Schmidt, C., Baller, J.A., Somia, N.V., Bogdanove, A.J., and Voytas, D.F. (2011). Efficient design and assembly of custom TALEN and other TAL effector based constructs for DNA targeting. Nucleic acids research. 39: e82 e82. Chen, C.P., Chou, J.C., Liu, B.R., Chang, M., and Lee, H.J. (2007). Transfection and expression of plasmid DNA in plant cells by an arginine rich intracellular delivery peptide without protoplast preparation. FEBS Lett. 581: 1891 1897.

PAGE 121

121 Chen, H., Xu, W., Chen, T., Yang, W., Hu, J., and Wang, C. (2005). Aggregation of biodegradable amphiphilic poly (succinimide co N propyl aspartamide) and poly (N dodecyl aspartamide co N pr opyl aspartamide) in aqueous medium and its preliminary drug released properties. Polymer. 46: 1821 1827. Chen, H.T., Neerman, M.F., Parrish, A.R., and Simanek, E.E. (2004). Cytotoxicity, hemolysis, and acute in vivo toxicity of dendrimers based on melamin e, candidate vehicles for drug delivery. J Am Chem Soc. 126: 10044 10048. Cheng, J., and Deming, T.J. (2012). Synthesis of Polypeptides by Ring Opening Amino Acid N Carboxyanhydrides. In Peptide Based Materials, T. Deming, ed. Berlin, H eidelberg: Springer Berlin Heidelberg. 1 26. Chinnamuthu, C., and Boopathi, P.M. (2009). Nanotechnology and agroecosystem. Madras Agric. J. 96: 17 31. Cho, H.Y., Averick, S.E., Paredes, E., Wegner, K., Averick, A., Jurga, S., Das, S.R., and Matyjaszewsk i, K. (2013). Star Polymers with a Cationic Core Prepared by ATRP for Cellular Nucleic Acids Delivery. Biomacromolecules. 14: 1262 1267.J. Liu, H. Duong, M. R. Whittaker, T. P. Davis and C. Boyer, Macromol. Rapid Commun., 2012, 33, 760 766. Chugh, A. and Eudes, F. (2007). Translocation and nuclear accumulation of monomer and dimer of HIV 1 Tat basic domain in triticale mesophyll protoplasts. BBA Biomembranes. 1768: 419 426. Chugh, A. and Eudes, F. (2008a). Studies of uptake of Cell penetrating peptides an d their cargoes in wheat immature embryos. FEBS Journal. 275: 2403 2414. Chugh, A ., and Eudes, F (2008b). Cellular uptake of cell penetrating peptides, pVEC and transportan in plants. Journal of Peptide Science. 14: 477 481. Chugh, A. and Eudes, F., an d Shim, Y. (2010). Cell penetrating peptides as nanocarriers for the delivery of macromolecules. IUBMB Life. 62: 183 193. Chugh, A., Amundsen, E., and Eudes, F. (2009). Translocation of cell penetrating peptides and delivery of their cargoes in triticale microspores. Plant Cell Reports. 28: 801 810. Chung, K. R. (2011). Elsino fawcettii and Elsino australis: the fungal pathogens causing citrus scab. Molecular Plant Pathology. 12: 123 135. Clough, S.J., and Bent, A.F. (1998). Floral dip: a simplified met hod for Agrobacterium mediated transformation of Arabidopsis thaliana. Plant J. 16: 735 743. Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W., and Marraffini, L.A. (2013). Multiplex genome engineering using CRISP R/Cas systems. Science. 339: 819 823.

PAGE 122

122 Cradick, T.J., Fine, E.J., Antico, C.J., and Bao, G. (2013). CRISPR/Cas9 systems globin and CCR5 genes have substantial off target activity. Nucleic acids research. 41: 9584 9592. Cuenca, J., Aleza, P., Garcia Lor, A., Ollitrault, P., and Navarro, L. (2016). Fine mapping for identification of Ci trus Alternaria Brown Spot candidate resistance genes and development of new SNP markers for marker assisted selection. Frontiers in Plant S cience. 7 : 01948 Cui, C., Xue, Y.N., Wu, M., Zhang, Y., Yu, P., Liu, L., Zhuo, R.X., and Huang, S.W. (2013). Poly(L aspartamide) based reduction sensitive micelles as nanocarriers to improve doxorubicin content in cell nuclei and to enhance antitumor activity. Macromol Biosci. 13: 1036 1047. Curtin, S.J., Anderson, J.E., Starker, C.G., Baltes, N.J., Mani, D., Voytas, D. F., and Stupar, R.M. (2013). Targeted mutagenesis for functional analysis of gene duplication in legumes. Legume Genomics: Methods and Protocols : 25 42. Curtolo, M., Cristofani Yaly, M., Gazaffi, R., Takita, M.A., Figueira, A., and Machado, M.A. (2017). QT L mapping for fruit quality in Citrus using DArTseq markers. BMC genomics. 18: 289. Darad, R., De, A.K. and Aiyar, A.S. (1983). Toxicity of nitrite and dimethylamine in rats. Toxicol. Lett. 17: 125 130. Deming, T.J. (1997). Facile synthesis of block copol ypeptides of defined architecture. Nature. 390: 386 389. Deming, T.J. (2007). Synthetic polypeptides for biomedical applications. Progress in Polymer Science. 32: 858 875. Dewdney, M., Schubert, T., Estes, M., and Peres, N. (2010). Citrus black spot. Citru s Ind. 91: 19 20. Dewdney, M.M. (2017). Citrus Scab. 2017 2018 Florida Citrus Production Guide. UF/IFAS Citrus Extension. 127 128 Dewdney, M.M., Schubert, T.S. Estes M.R. Roberts, P.D. and Peres N.A. (2017). Citrus Black Spot. 2017 2018 Florida Citrus Production Guide. UF/IFAS Citrus Extension. 121 125 Dom, G., Shaw Jackson, C., Matis, C., Bouffioux, O., Picard, J.J., Prochiantz, A., Brasseur, R., Mingeot Leclercq, M., and Rezsohazy, R. (2003). Cellular uptake of Antennapedia Penetratin peptides is a t wo step process in which phase transfer precedes a tryptophan dependent translocation. Nucleic Acids Research 31: 556 561.

PAGE 123

123 EC HFS. (2016). Plant Health: Emergency measures for the import of citrus fruit from several non EU countries European Commission Health and Food Safety. Eiriksdottir, E., Konate, K., Langel, U., Divita, G., and Deshayes, S. (2010). Secondary structure of cell penetrating peptides controls membrane interaction and insertion. BBA Biomembranes. 1798: 1119 1128. El Sayed, A., Futaki S. Harashima, H. (2009). Delivery of macromolecules using arginine rich cell penetrating peptides: ways to overcome endosomal entrapment. AAPS J. 11 :13 22. FAO. (2016). Citrus Fruit Statistics 2015. Food and Agriculture Organization of the United Nations. R ome, Italy. Febres, V.F., Fisher, L., Khalaf, A., Moore, G.A (2011). Citrus t ransformation: Challenges and p rospects. Genetic Transformation. DOI: 10.5772/24526 Febres, V.F., Lee, R.F., and Moore, G.A (2007). 14 Genetic Transformation of citrus for path ogen resistance. Citrus Genetics, Breeding and Biotechnology 287 305. Feng, Z., Mao, Y., Xu, N., Zhang, B., Wei, P., Yang, D. L., Wang, Z., Zhang, Z., Zheng, R., and Yang, L. (2014). Multigeneration analysis reveals the inheritance, specificity, and patte rns of CRISPR/Cas induced gene modifications in Arabidopsis. Proceedings of the National Academy of Sciences. 111: 4632 4637. Wydro, K. (2014). Natural vs synthetic auxin: Studies on the interactions between plant hormones and biolog ical membrane lipids. Environmental research. 133: 123 134. Fleischer, A., O'Neill, M.A., and Ehwald, R. (1999). The pore size of non graminaceous plant cell walls is rapidly decreased by borate ester cross linking of the pectic polysaccharide rhamnogalact uronan II. Plant Physiology. 121: 829 838. Fox, J.E., Gulledge, J., Engelhaupt, E., Burow, M.E., and McLachlan, J.A. (2007). Pesticides reduce symbiotic efficiency of nitrogen fixing rhizobia and host plants. Proc Natl Acad Sci U S A. 104: 10282 10287. Fra nkel, A.D. and Pabo, C.O. (1988). Cellular uptake of the tat protein from human immunodeficiency virus. Cell. 55: 1189 1193. Fretz, M., Jin, J., Conibere, R., Penning, N.A., Al Taei, S., Storm, G., Futaki, S., Takeuchi, T., Nakase, I., Jones, A.T. (2006). E ffects of Na+/H+ exchanger inhibitors on subcellular localisation of endocytic organelles and intracellular dynamics of protein transduction domains HIV TAT peptide and octaarginine. J Control Release. 116: 247 254.

PAGE 124

124 Fu, Y., Foden, J.A., Khayter, C., Maeder M.L., Reyon, D., Joung, J.K., and Sander, J.D. (2013). High frequency off target mutagenesis induced by CRISPR Cas nucleases in human cells. Nature biotechnology. 31: 822 826. Fu, Z.Q., Yan, S., Saleh, A., Wang, W., Ruble, J., Oka, N., Mohan, R., Spoel, S.H., Tada, Y., Zheng, N., Dong, X. (2012). NPR3 and NPR4 are receptors for the immune signal salicylic acid in plants. Nature. 486: 228 232. Futaki, S., Nakase, I., Tadokoro, A., Takeuchi, T., Jones, A.T (2007). Arginine rich peptides and their internaliz ation mechanisms. Biochem Soc Trans. 35: 784 787. Gabrielson, N.P., Lu, H., Yin, L., Li, D., Wang, F. and Cheng, J (2012). Reactive and Helical Polypeptide Template for Nonviral Gene Delivery. Angew. Chem., Int. Ed. 51: 1143 1147. Gao, W., Chan, J.M., and Farokhzad, O.C. (2010). pH responsive nanoparticles for drug delivery. Molecular pharmaceutics. 7: 1913 1920. Gmitter, F.G ., Deng, Z., and Chen, C (2007 a ). 13 Cloning and characterization of disease resistance genes Citrus Genetics, Breeding and Biotechnology 287 305 Gmitter, F.G., Grosser, J.W., Castle, W.S., and Moore, G.A. (2007 b ). 2 A Comprehensive c itrus genetic i mprovement p rogramme. Citrus Genetics, Breeding and Biotechnology 9 18. Gomez, D.A., and Carpena, R.O. (2014). Effe ct of 1 naphthaleneacetic acid on organic acid exudation by the roots of white lupin plants grown under phosphorus deficient conditions. Journal of plant physiology. 171: 1354 1361. Gonz a lez, C.A., Sala, N., and Rokkas, T (2013). Gastric cancer: epidemiol ogic aspects. Helicobacter. 18: 34 38. Gonzalez Melendi, P., Fernandez Pacheco, R., Coronado, M., Corredor, E., Testillano, P., Risueno, M., Marquina, C., Ibarra, M., Rubiales, D., and Perez de Luque, A. (2007). Nanoparticles as smart treatment delivery s ystems in plants: assessment of different techniques of microscopy for their visualization in plant tissues. Annals of botany. 101: 187 195. Gottwald, T.R., Graham, J.H., and Schubert, J.S. (2002). Citrus canker: The pathogen and its impact. Plant Health P rogress. Gottwald, T.R., and Irey, M. (2007). Post hurricane analysis of citrus canker II: Predictive model estimation of disease spread and area potentially impacted by various eradication protocols following catastrophic weather events. Plant Health Prog ress. 10

PAGE 125

125 Green, M. and Loewenstein, P.M (1988). Autonomous functional domains of chemically synthesized human immunodeficiency virus TAT trans activator protein. Cell. 55: 1179 1188. Greenspan, P., and Fowler, S.D. (1985). Spectrofluorometric studies of t he lipid probe, Nile red. J Lipid Res. 26: 781 789. Gu, X., Wang, J., Liu, X., Zhao, D., Wang, Y., Gao, H., and Wu, G. (2013). Temperature responsive drug delivery systems based on polyaspartamides with isopropylamine pendant groups. Soft Matter. 9: 7267 7 273. Guo, W. and Grosser, J.W. (2005). Somatic hybrid vigor in Citrus: Direct evidence from protoplast fusion of an embryogenic callus line with a transgenic mesophyll parent expressing the GFP gene. Plant Science. 168: 1541 1545. Guo, W., Duan, Y., Olivar es Fuster, O., Wu, Z., Arias, C.R., Burns, J.K., Grosser, J.W. (2005). Protoplast transformation and regeneration of transgenic Valencia sweet orange plants containing a juice quality related pectin methylesterase gene. Plant Cell Rep. 24: 482 486 Guo, X.F ., Zhou, Y., Tu, F.Q., Xiong, X.J., Wang, H., and Zhang, H.S. (2011). Determination of phytohormones in plant samples based on the precolumn fluorescent derivatization with 1, 3, 5, 7 tetramethyl 8 aminozide difluoroboradiaza s indacene by HPLC for routine use. Journal of separation science. 34: 789 795. Gyarmati, B., Vajna, B., Nemethy, A., Laszlo, K., and Szilagyi, A. (2013). Redox and pH responsive cysteamine modified poly(aspartic acid) showing a reversible sol gel transition. Macromol Biosci. 13: 633 640. Han, S. Y., and Kim, Y. A. (2004). Recent development of peptide coupling reagents in organic synthesis. Tetrahedron. 60: 2447 2467. Hill, M.R., MacKrell, E.J., Forsthoefel, C.P., Jensen, S.P., Chen, M., Moore, G.A., He, Z.L. and Sumerlin, B.S. (2015) Biodegradable and pH responsive nanoparticles designed for site specific delivery in agriculture. Biomacromolecules. 16: 1276 1282. Hodges, A., and Spreen, T. (2012). Economic impacts of citrus greening (HLB) in Florida, 2006/07 2010/11. Electronic Data Information Source (EDIS) FE903 (Gainseville, FL: University o f Florida). Hoshino, Y., Koide, H., Furuya, K., Haberaecker, W.W., 3rd, Lee, S.H., Kodama, T., Kanazawa, H., Oku, N., and Shea, K.J. (2012). The rational design of a synthetic polymer nanopartic le that neutralizes a toxic peptide in vivo. Proc Natl Acad Sci U S A. 109: 33 38.

PAGE 126

126 Huang, Y., Tang, Z., Zhang, X., Yu, H., Sun, H., Pang, X., and Chen, X. (2013). pH triggered charge reversal polypeptide nanoparticles for cisplatin delivery: preparation an d in vitro evaluation. Biomacromolecules. 14: 2023 2032. Iglesias, D.J., Cercs, M., Colmenero Flores, J.M., Naranjo, M.A., Ros, G., Carrera, E., Ruiz Rivero, O., Lliso, I., Morillon, R., and Tadeo, F.R. (2007). Physiology of citrus fruiting. Brazilian Jo urnal of Plant Physiology. 19: 333 362. Jeong, J.H., Cha, C., Kaczmarowski, A., Haan, J., Oh, S., and Kong, H. (2012). Polyaspartamide vesicle induced by metallic nanoparticles. Soft matter. 8: 2237 2242. Kang, H.S., Kim, S.R.Y.J., Han, S. and Chang, I. (2 001) Effects of grafted alkyl groups on aggregation behavior of amphiphilic poly(aspartic acid). Langmuir. 17: 7501 7506. Kausik, R., Srivastava, A., Korevaar, P.A., Stucky, G., Waite, J.H., and Han, S. (2009). Local Water Dynamics in Coacervated Polyelec trolytes Monitored through Dynamic Nuclear Polarization Enhanced 1H NMR. Macromolecules. 42: 7404 7412. Klug A (2010). "The discovery of zinc fingers and their applications in gene regulation and genome manipulation". Annual Review of Biochemistry. 79: 2 13 31. Koyama, H., Toda, T., and Hara, T. (2001). Brief exposure to low pH stress causes irreversible damage to the growing root in Arabidopsis thaliana: pectin Ca interaction may play an important role in proton rhizotoxicity. Journal of Experimental Botany. 52: 361 368. Kricheldorf, H.R., Lossow, C.V., Lomadze, N., and Schw arz, G. (2008). Cyclic amino acid N carboxyanhydrides. Journal of Polymer Science Part A: Polymer Chemistry. 46: 4012 4020. Koltunow, A.M., Soltys, K., Nito, N., and McClure, S. (1995). Anther, ovule, seed, and n ucellar embryo development in Citrus sinensis cv. Valencia. Canadian Journal of Botany. 73: 1567 1582. Kumar, A. (2012). Polyaspartic acid a versatile green chemical. Chem Sci Rev Lett. 1: 162 167. Ladanyia, M. (2010). Citrus fruit: biolo gy, technology and evaluation. Academic press Lai, M.H., Jeong, J.H., DeVolder, R.J., Brockman, C., Schroeder, C., and Kong, H. (2012). Ellipsoidal Polyaspartamide Polymersomes with Enhanced Cell Targeting Ability. Advanced functional materials. 22: 3239 3246.

PAGE 127

127 Lai, M. H., Lee, S., Smith, C.E., Kim, K., and Kong, H. (2014). Tailoring polymersome bilayer permeability improves enhanced permeability and retention effect for bioimaging. ACS applied mat erials & interfaces. 6: 10821 10829. Lakshmanan, M., Kodama, Y., Yoshizumi, T., Sudesh, K., and Numata, K. (2013). Rapid and Efficient Gene Delivery into Plant Cells Using Designed Peptide Carriers. Biomacromolecules. 14: 10 16. Langel, U. (2007). Handbook of Cell Penetrating Peptides, Second Edition. Boca Raton London New York CRC ISBN: 0849350905 Lapienis, G. (2009). Star shaped polymers having PEO arms. Progress in Polymer Science. 34: 852 892. Lee, M., Jeong, J., and Kim, D. (2015). Intracellular Uptake and pH Dependent Release of Doxorubicin from the Self Assembled Micelles Based on Amphiphilic Polyaspartamide Graft Copolymers. Biomacromolecules. 16: 136 144. Lenman, M.M., Lewis, A., and Gani, D. (1997). Synthesis of fused 1, 2, 5 triazepine 1, 5 diones and some N 2 and N 3 substituted derivatives: potential conformational mimetics for cis peptidyl prolinamides1. Journal of the Chemical Society, Perkin Transactions 1 : 2297 2312. Li, T., Liu, B., Spalding, M.H., Weeks, D.P., and Yang, B. (2012). High effi ciency TALEN based gene editing produces disease resistant rice. Nature biotechnology. 30: 390 392. Liljegren, S.J., Gustafson Brown, C., Pinyopich, A., Ditta, G.S., and Yanofsky, M.F. (1999). Interactions among APETALA1, LEAFY, and TERMINAL FLOWER1 specif y meristem fate. The Plant Cell. 11: 1007 1018. Liu, Y., Heying, E., Tanumihardjo, S.A. (2012). History, global distribution, and nutritional importance of citrus fruits. Comprehensive Reviews in Food Science and Food Safety. 11: 530 545. Lu, C., Li, B., Liu, N., Wu, G., Gao, H., and Ma, J. (2014 a ). A hydrazone crosslinked zwitterionic polypeptide nanogel as a platform for controlled drug delivery. RSC Advances. 4: 50301 50311. Lu, C., Wang, X., Wu, G., Wang, J., Wang, Y., Gao, H., and Ma, J. (2014 b ). An i aspartic acid) derivatives for localized drug delivery. Journal of Biomedical Materials Research Part A. 102: 628 638. Lu, H., Wang, J., Song, Z., Yin, L., Zhang, Y., Tang, H., Tu, C., Lin, Y., and Che ng, J. (2014 c ). Recent advances in amino acid N carboxyanhydrides and synthetic polypeptides: chemistry, self assembly and biological applications. Chem. Comm. 50: 139 155.

PAGE 128

128 Lux, C.G., Joshi Barr, S., Nguyen, T., Mahmoud, E., Schopf, E., Fomina, N., and Alm utairi, A. (2012). Biocompatible Polymeric Nanoparticles Degrade and Release Cargo in Response to Biologically Relevant Levels of Hydrogen Peroxide. Journal of the American Chemical Society 134: 15758 15764. Ma, D.X., Shi, N.Q., and Qi, X.R. (2011). Distin ct transduction modes of arginine rich cell penetrating peptides for cargo delivery into tumor cells. Int J Pharm. 419: 200 208. Ma, Y., Jiang, X., and Zhuo, R. (2013). Biodegradable and thermosensitive micelles of amphiphilic polyaspartamide derivatives c ontaining aromatic groups for drug delivery. Journal of Polymer Science Part A: Polymer Chemistry. 51: 3917 3924. Ma, H., Marti Gutierrez, N., Park, S. W., Wu, J., Lee, Y., Suzuki, K., Kos ki, A., Ji, D., Hayama, T., Ahmed, R. et al. (2017). Correction of a pathogenic gene mutation in human embryos. Nature. 548: 413 419. Main, D., Jung, S., et al. (2017). Citrus Genome Database. Mainlab Bioinformatics at Washington State University. www.citrusgenomedb.org Mali, P., Aach, J., Stranges, P.B., Esvelt, K.M., Mo osburner, M., Kosuri, S., Yang, L., and Church, G.M. (2013). CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nature biotechnology. 31: 833 838. Manthe, R.L., Foy, S.P., Krishnamurthy, N., Sharma, B., and Labhasetwar, V. (2010). Tumor Ablation and Nanotechnology. Molecular Pharmaceutics 7: 1880 1898. McClean, A.P.D., and Oberholzer, P.C. J. (1965). Greening disease of sweet orange: evidence that it is caused by a transmissible virus. Sou th African Journal of Agricultural Science 8: 253 276 McDaniel, J.R., Callahan D.J., and Chilkoti A. (2010). Drug delivery to solid tumors by elastin like polypeptides. Adv. Drug Delivery Rev. 62: 1456 1467. Mendoza Cozatl, D.G., Butko, E., Springer, F., Torpey, J.W., Komives, E.A., Kehr, J., and Schroeder, J.I. (2008). Identification of high levels of phytochelatins, glutathione and cadmium in the phloem sap of Brassica napus. A role for thiol peptides in the long d istance transport of cadmium and the effect of cadmium on iron translocation. The Plant Journal. 54: 249 259. Miao, J., Guo, D., Zhang, J., Huang, Q., Qin, G., Zhang, X., Wan, J., Gu, H., and Qu, L. J. (2013). Targeted mutagenesis in rice using CRISPR Cas system. Cell research. 23: 1233.

PAGE 129

129 Mishra, A., Lai, G.H., Schmidt, N.W., et al. (2011). Translocation of HIV TAT peptide and analogues induced by multiplexed membrane and cytoskeletal interactions. Proc Natl Acad Sci. 108: 16883 16888. Moon, J.R., Kim, B.S., and Kim, J. (2006). Preparation and properties of novel biodegradable hydrogel based on cationic polyaspartamide derivative. Bulletin Korean Chemical Society 27: 981. Moon, J.R., Kim, M.W., Kim, D., Jeong, J.H., and Kim, J. H. (2011). Synthesis and self a ssembly behavior of novel polyaspartamide derivatives for anti tumor drug delivery. Colloid and Polymer Science. 289: 63 71. Moore, G.A., Jacono, C.C., Neidigh, J.L., Lawrence, S.D., and Cline, K. (1992). Agrobacterium Mediated Transformation of Citrus Ste m Segments and Regeneration of Transgenic Plants. Plant Cell Reports. 115: 238 242 Moore, G.A., Rogers, K., Kamps, T., Pajon, M., Stover, J., J Febres, V., and Stover, E. (2016). R apid cycling plant breeding in citrus Moreau, M., Tian, M., and Klessig, D. F. (2012). Salicylic acid binds NPR3 and NPR4 to regulate NPR1 dependent defense responses. Cell Res. 22: 1631 1633 Morris, M.C., Vidal, P., Chaloin, L., Heitz, F., and Divita, G (1997). A new peptide vector for efficient delivery of oligonucleotides in to mammalian cells. Nucleic Acids Res. 25: 2730 2736 Moye, H.A., and Wheaton, T.A. (1979). Determination of naphthaleneacetic acid (NAA) in oranges, tangerines, and processed products: high performance liquid chromatography with fluorometric detection. Jou rnal of agricultural and food chemistry. 27: 291 294. Murthy, N., Campbell, J., Fausto, N., Hoffman, A.S., and Stayton, P.S. (2003). Design and synthesis of pH responsive polymeric carriers that target uptake and enhance the intracellular delivery of oligo nucleotides. Journal of Controlled Release. 89: 365 374. Naito Y Hino K Bono H and Ui Tei K. (2015) CRISPRdirect: software for designing CRISPR/Cas guide RNA with reduced off target sites. Bioinformatics 3 1: 1120 1123. Nakase, I., Tadokoro, A., Kawabata, N., Takeuchi, T., Katoh, H., Hiramoto, K., Negishi, M., Nomizu, M., Sugiura, Y., and Futaki, S. (2007). Interaction of arginine rich peptides with membrane associated proteoglycans is crucial for induction of actin organization and macropinocyto sis. Biochemistry 46: 492 501. Nakase, I., Takeuchi, T., Tanaka, G., and Futaki, S. (2008). Methodological and cellular aspects that govern the internalization mechanisms of arginine rich cell penetrating peptides. Adv Drug Deliv Rev 60: 598 607.

PAGE 130

130 Nakato, T ., Kusuno, A., and Kakuchi, T. (2000). Synthesis of poly (succinimide) by bulk polycondensation of L aspartic acid with an acid catalyst. Journal of Polymer Science Part A: Polymer Chemistry. 38: 117 122. Nakato, T., Yoshitake, M., Matsubara, K. and Tomida, M. (1998). Relationships between Structure and Properties of Poly(aspartic acid)s. Macromolecules. 31: 2107 2113. N e methy, A ., Solti, K., Kiss, L., Gyarmati, B., Deli, M.A., Cs a nyi, E., and Szil a gyi, A. (2013). pH and temperature responsive poly (aspartic acid) l poly (N isopropylacrylamide) conetwork hydrogel. European Polymer Journal. 49: 2392 2403. Nicolosi, E. (2007). 3 Origin and Taxonomy Citrus Genetics, Breeding and Biotechnology 19 43 Nishikawa, F. (2013). Regulation of Floral Induction in Citrus. Journal of the Japanese Society for Horticultural Science. 82: 283 292. NRC. (2010). Strategic p lanning for the Florida citrus industry: addressing citrus greening disease. National Research Council. The National Academies Press. Oliveira, M.L.P., Febres, V.J., Costa, M.G.C., Moore, G.A. and Otoni, W.C. (2008). "High efficiency Agrobacterium mediated transformation of citrus via sonication and vacuum infiltration." Plant Cell Reports 28: 387. Oliveira, M.L.P., Moore, G.A., Thomson, J.G., and Stover, E. (2015). Agrobacterium mediated transformation of Mexican lime (Citrus aurantifolia Swingle) using o ptimized systems for epicotyls and cotyledons. Advances in Bioscience and Biotechnology. 6: 12. Pal, S., Roy, S.G., and De, P. (2014). Synthesis via RAFT polymerization of thermo and pH responsive random copolymers containing cholic acid moieties and their self assembly in water. Polymer Chemistry. 5: 1275 1284. Penjor, T., Yamamoto, M., Uehara, M., Ide, M., Matsumoto, N., Matsumoto, R., et al (2013). Phylogenetic relationships of citrus and its relatives based on matK gene sequences. PLoS ONE 8: e62574. Perez de Luque, A., and Rubiales, D. (2009). Nanotechnology for parasitic plant control. Pest management science. 65: 540 545. Pillitteri, L.J., Lovatt, C.J., and Walling, L.L. (2004). Isolation and Characterization of a TERMINAL FLOWER Homolog an d Its Correlation with Juvenility in Citrus. Plant Physiology. 135: 1540 1551. Pin, P., and Nilsson, O. (2012). The multifaceted roles of FLOWERING LOCUS T in plant development. Plant, cell & environment. 35: 1742 1755.

PAGE 131

131 Puoci, F., Iemma, F., Spizzirri, U.G ., Cirillo, G., Curcio, M., Picci, N. (2008). Polymer in agriculture: a review. Am. J. Agric. Biol. Sci. 2008, 3: 299 314. Raun, W.R., and Johnson, G.V. (1999). Improving nitrogen use efficiency for cereal production. Agron. J. 91: 357 363 Regan, S.M., an d Moffatt, B.A. (1990). Cytochemical analysis of pollen development in wild type Arabidopsis and a male sterile mutant. The Plant Cell. 2: 877 889. Roweton, S., Huang, S., and Swift, G. (1997). Poly (aspartic acid): synthesis, biodegradation, and current a pplications. Journal of Polymers and the Environment. 5: 175 181. Schwarze, S.R., Ho, A., Vocero Akbani, A., and Dowdy, S.F. (1999). In vivo protein transduction: delivery of a biologically active protein into the mouse. Science 285: 1569 1572. Seo, K., an d Kim, D. (2006). Phase transition behavior of novel pH sensitive polyaspartamide derivatives grafted with 1 (3 aminopropyl)imidazole. Macromol Biosci. 6: 758 766. Shu, S., Zhang, X., Teng, D., Wang, Z., and Li, C. (2009). Polyelectrolyte nanoparticles bas ed on water soluble chitosan poly(L aspartic acid) polyethylene glycol for controlled protein release. Carbohydr Res. 344: 1197 1204. Shukla, V.K., Doyon, Y., Miller, J.C., DeKelver, R.C., Moehle, E.A., Worden, S.E., Mitchell, J.C., Arnold, N.L., Gopalan, S., and Meng, X. (2009). Precise genome modification in the crop species Zea mays using zinc finger nucleases. Nature. 459: 437. Song, J. and Bae, J. (2013). "Citrus fruit intake and breast cancer risk: a quantitative systematic review". Journal of Breast Cancer. 16: 72 76. Southwick S M ., and Davenport T L (1986) Characterization of water stress and low temperature effects on flower induction in Citrus. Plant Physiol. 81: 26 29 Stover, E., Stange, R.R., McCollum, T.G., Jaynes, J., Irey, M., and Mirkov E. (2013). Screening antimicrobial peptides in vitro for use in developing transgenic citrus resistant to Huanglongbing and citrus canker. Journal of the American Society for Horticultural Science. 138: 142 148. Sun, B., Li, W., and Wu, P. (2008). Innova tive spectral investigations on the thermal induced poly (aspartic acid). Polymer. 49: 2704 2708. Syers, J., Johnston, A., and Curtin, D. (2008). Efficiency of soil and fertilizer phosphorus use. FAO fertilizer and plant nutrition bulletin. 18

PAGE 132

132 Tabatt, K., Kneuer, C., Sameti, M., Olbrich, C., Mller, R.H., Lehr, C. M., and Bakowsky, U. (2004). Transfection with different colloidal systems: comparison of solid lipid nanoparticles and liposomes. Journal of Controlled Release. 97: 321 332. Tarn, D., Ashley, C. E., Xue, M., Carnes, E.C., Zink, J.I., and Brinker, C.J. (2013). Mesoporous silica nanoparticle nanocarriers: biofunctionality and biocompatibility. Acc Chem Res. 46: 792 801. Theato, P., Sumerlin, B.S., O'Reilly, R.K., and Epps III, T.H. (2013). Stimuli r esponsive materials. Chemical Society Reviews. 42: 7055 7056. Thombre, S., and Sarwade, B. (2005). Macromol Sci Part A. Pure Appl Chem. 42: 1299. Thoren, P.E., Persson, D., Karlsson, M., and Norden, B. (2000). The antennapedia peptide penetratin translocat es across lipid bilayers the first direct observation. FEBS Lett. 482: 265 268. Kanes K Tisserat B Berhow M and Vandercook C (1992) Phenolic composition of various tissues of rutaceae species. Phytochemistry 32: 967 974. Tomida M., Nakato, T and Kuramochi, M. (1996). Novel method of synthesizing poly(succinimide) and its copolymeric derivatives by acid catalysed polycondensation of l aspartic acidPolymer. 37: 4435 4437. Trivedi, R., and Kompella, U.B. (2010). Nanomicellar formulations for su stained drug delivery: strategies and underlying principles. Nanomedicine. 5: 485 505. USDA. (2011). Citrus ID morphology: habit, twigs, leaves, flowers, fruits. Citrus ID Edition 2. United States Department of Agriculture. Retrieved from: http://idtools.o rg/id/citrus/citrusid/morphology.php USDA (2016). Florida Citrus Statistics 2014 2015. United States Department of Agriculture. National Agricultural Statistics Service, Southern Region, Florida Field Office. van Bel, A.J.E., and Hess, P.H. (2008). Hexos es as phloem transport sugars: the end of a dogma? Journal of Experimental Botany 59: 261 272. Velzquez, K., Agero, J., Vives, M. C., Aleza, P., Pina, J. A., Moreno, P., Navarro, L. and Guerri, J. (2016), Precocious flowering of juvenile citrus induced b y a viral vector based on Citrus leaf blotch virus: a new tool for genetics and breeding. Plant Biotechnol J. 14: 1976 1985. Vives, E., Richard, J.P., Rispal, C., and Lebleu, B. (2003). TAT peptide internalization: seeking the mechanism of entry. Curr Prot ein Pept Sci. 4: 125 132.

PAGE 133

133 Vreugdenhil, D., and Koot Gronsveld, E.A.M. (1989). Measurements of pH, sucrose and potassium ions in the phloem sap of castor bean (Ricinus communis) plants. Physiologia Plantarum 77: 385 388. Wadia, J.S. and Dowdy, S.F. (2005). Transmembrane delivery of protein and peptide drugs by TAT mediated transduction in the treatment of cancer. Adv Drug Deliv Rev. 57: 579 596. Walrant, A., Vogel, A., Correia, I., Lequin, O., Olausson, B.E., Desbat, B., Sagan, S., and Alves, I.D. (2012). Me mbrane interactions of two arginine rich peptides with different cell internalization capacities. Biochim Biophys Acta. 1818: 1755 1763. Wang, J., Lu, H., Kamat, R., Pingali, S.V., Urban, V.S., Cheng, J., and Lin, Y. (2011). Supramolecular polymerization f rom polypeptide grafted comb polymers. Journal of the American Chemical Society. 133: 12906 12909. Wang, T., Xu, Q., Wu, Y., Zeng, A., Li, M., and Gao, H. (2009). Quaternized chitosan (QCS)/poly (aspartic acid) nanoparticles as a protein drug delivery syst em. Carbohydr Res. 344: 908 914. Wang, X., Wu, G., Lu, C., Zhao, W., Wang, Y., Fan, Y., Gao, H., and Ma, J. (2012 a ). A novel delivery system of doxorubicin with high load and pH responsive release aspartic acid) derivative. European Journal of Pharmaceutical Sciences. 47: 256 264. Wang, Y., Hou, Y., Ruan, G., Pan, M., and Liu, T. ( 2003). Study on the polymerization of aspartic acid catalyzed by phosphoric acid. Journal of Macromolecular Science, Part A. 40: 293 307. Wang, Y., Xue, M., Wei, J., Li, C., Zhang, R., Cao, H., Yang, J., and Tan, T. (2012 b ). Novel solvent free synthesis an d modification of polyaspartic acid hydrogel. RSC advances. 2: 11592 11600. Weaver, C.L., LaRosa, J.M., Luo, X., and Cui, X.T. (2014). Electrically Controlled Drug Delivery from Graphene Oxide Nanocomposite Films. ACS Nano 8: 1834 1843. Wender, P.A., Mitch ell, D.J., Pattabiraman, K., Pelkey, E., Steinman L., and Rothbard, J. (2000). The design, synthesis, and evaluation of molecules that enable or enhance cellular uptake: peptoid molecular transporters. PNAS USA. 97: 13003 13008. Wiedenheft, B., Sternberg, S.H., and Doudna, J.A. (2012). RNA guided genetic silencing systems in bacteria and archaea. Nature. 482: 331.

PAGE 134

134 Wolk, S.K., Swift, G., Paik, Y.H., Yocom, K.M., Smith, R.L., and Simon, E.S. (1994). One and two dimensional nuclear magnetic resonance characte rization of poly (aspartic acid) prepared by thermal polymerization of L aspartic acid. Macromolecules. 27: 7613 7620. Wu, H. Y., Liu, K. H., Wang, Y. C., Wu, J. F., Chiu, W. L., Chen, C. Y., Wu, S. H., Sheen, J., and Lai, E. M. (2014). AGROBEST: an effici ent Agrobacterium mediated transient expression method for versatile gene function analyses in Arabidopsis seedlings. Plant Methods. 10: 19. Xiong, M. H., Bao, Y., Du, X. J., Tan, Z. B., Jiang, Q., Wang, H. X., Zhu, Y. H., and Wang, J. (2013). Differential Anticancer Drug Delivery with a Nanogel Sensitive to Bacteria Accumulated Tumor Artificial Environment. ACS Nano 7: 10636 10645. Xu, M., Zhao, Y., and Feng, M. (2012). Polyaspartamide derivative nanoparticles with tunable surface charge achieve highly eff icient cellular uptake and low cytotoxicity. Langmuir. 28: 11310 11318. Yang, H., Park, C.W., Woo, M., Kim, M., Jo, Y.M., Park, H.G. and Kim, J.H. (2010). HER2/neu antibody conjugated poly(amino acid) coated iron oxide Nanoparticles for breast cancer MR im aging. Biomacromolecules. 11: 2866 2872. Yang, J., Dong, C., Dong, Y., Liu, S., Pan, L., and Zhang, C. (2014). Logic nanoparticle beacon triggered by the binding induced effect of multiple inputs. ACS applied materials & interfaces. 6: 14486 14492. Yao, J. L., Wu, J.H., Gleave, A.P., and Morris, B.A.M. (1996). Transformation of Citrus Embryogenic Cells Using Particle Bombardment and Production of Transgenic Embryos. Plant Science. 113: 175 183. Zhang, G., Liu, J., Yang, Q., Zhuo, R., and Jiang, X. (2012). Di sulfide containing brushed polyethylenimine derivative synthesized by click chemistry for nonviral gene delivery. Bioconjug Chem. 23: 1290 1299. Zhang, C., Ma, J., Yang, J., Inaki Schlaberg, H., Liu, S., and Xu, J. (2013 a ). Nanoparticle aggregation logic computing controlled by DNA branch migration. Applied Physics Letters. 103: 093106. Zhang, J., Yuan, Z. F., Wang, Y., Chen, W. H., Luo, G. F., Cheng, S. X., Zhuo, R. X., and Zhang, X. Z. (2013 b ). Multifunctional Envelope Type Mesoporous Silica Nanoparticle s for Tumor Triggered Targeting Drug Delivery. Journal of the American Chemical Society 135: 5068 5073. Zhang, Y., Zhang, F., Li, X., Baller, J.A., Qi, Y., Starker, C.G., Bogdanove, A.J., and Voytas, D.F. (2013 c ). Transcription activator like effector nucl eases enable efficient plant genome engineering. Plant physiology. 161: 20 27.

PAGE 135

135 Zhang, Y., Cheng, Y.T., Qu, N., Zhao, Q., Bi, D., Li, X (2006). Negative regulation of defense responses in Arabidopsis by two NPR1 paralogs. Plant J. 48: 647 656. Ziemienowicz A., Shim, Y.S, Matsuoka, A., Eudes, F., Kovalchuk, I (2012). A novel method of transgene delivery into triticale plants using the Agrobacterium transferred DNA derived nano complex. Plant Physiol. 2012. 154: 1503 1513 Ziemienowicz, A., Tzfira, T., and H ohn, B. (2008). Mechanisms of T DNA integration. Agrobacterium: From Biology to Biotechnology. 11: 395 440

PAGE 136

136 BIOGRAPHICAL SKETCH Shaun Jensen was born in Charleston, South Carolina in July 1986 to Claude Emil Jensen III and Tammy Barry As an infant, hi s family moved to Florida. He and his family lived on the Gulf Coast of Florida, chiefly Sarasota, Florida and Indian Rocks Beach, Florida In 2004, h e graduated summa cum laude from Largo H igh S chool with honors Immediately after graduation, he attended the University of Florida In 2008, he obtained his B.S. in Biology with a minor in a nthropology After undergraduate studies, he worked in a water testing laboratory until he began graduate school in 2011 in the Plant Molecular and Cellular Biology Progr am. In March 2016, he married his wife, Molly Lahiff In 2017, he graduated with a Master of Science degree from the PMCB program and had his first child, a daughter.