Citation
The Effects and Mechanisms of Consuming Sulfur-Containing Dietary Supplements on Chronic Inflammation in Adults with Obesity

Material Information

Title:
The Effects and Mechanisms of Consuming Sulfur-Containing Dietary Supplements on Chronic Inflammation in Adults with Obesity
Creator:
Xu, Changjie
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (111 p.)

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Nutritional Sciences
Committee Chair:
MATHEWS,ANNE
Committee Co-Chair:
PERCIVAL,SUSAN S
Committee Members:
HENKEN,ROBIN J
WALLET,SHANNON MARGARET

Subjects

Subjects / Keywords:
garlic -- glutathione -- inflammation -- obesity
Nutritional Sciences -- Dissertations, Academic -- UF
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Nutritional Sciences thesis, Ph.D.

Notes

Abstract:
Obesity is global health issue. In the United States, more than one-third of adults are obese. Obesity induces chronic systemic inflammation and increasing obesity positively correlates with the concentration of inflammatory cytokines. Obesity-induced inflammation is recently considered a link between obesity and its related chronic diseases. Prevention or reduction of inflammation in adults with obesity may mitigate the associated negative health complications such as cardiovascular disease and some cancers. Increased oxidative stress in obesity plays a key role in the development of inflammation. Overproduced reactive oxygen species (ROS) stimulate the activation of nuclear factors such as NF-kB and activator protein (AP1), which can up-regulate the production of inflammatory cytokines. Glutathione (GSH), one of the most abundant ROS scavengers in the body, protects host immune cells from free radical assault. GSH is diminished with obesity. Daily consumption of dietary supplements that support GSH production may be a safe and acceptable mode of counteracting the chronic inflammation associated with obesity. The goal of this research was to evaluate the effects and mechanisms of sulfur-containing dietary supplements on chronic inflammation in adults with obesity. To achieve this goal, three independent studies were conducted, including two randomized placebo-controlled clinical trial and one cell culture based experiment. The dietary supplements tested in the clinical trials were Aged garlic extract (AGE) (Wakunaga of America Co.) and Setria GSH (Kyowa Hakko Bio Co.). Six weeks of AGE consumption (3.6 g/day) modulated immune cell distribution, attenuated increase of serum TNF-a (p = 0.04) and IL-6 (p = 0.05) concentrations and reduced blood LDL (p = 0.05) concentration in adults with obesity, indicating that the consumption of AGE can produce anti-inflammatory effects in adults with obesity. Similar the anti-inflammatory effects were not observed when adults consumed GSH (500 mg/day) for four months. Both AGE and GSH were used to pre-treat differentiated adipocyte cells (3T3-L1) prior to stimulation of inflammation with lipopolysaccharides (LPS). Pre-treatment with both AGE and GSH, decreased the expression of IL-6 in protein and at the mRNA level. AGE pre-treatment also increased the expression of adiponectin in the cells. Moreover, AGE and GSH pre-treatment inhibited activation of NF-kB and AP 1, two major nuclear factors that are associated with inflammation. Taken together, this series of experiments support the hypothesis that sulfur-containing supplements may reduce the inflammation in obesity. The in vitro study suggested that the anti-inflammatory effect is through the inhibition of the activation of NF-kB and MAKP pathways. This anti-inflammatory effect was only observed in the AGE clinical study, but not when participants were provided GSH. Further studies should be conducted to determine the optimal dose of unique sulfur-containing supplements for reducing obesity-induced inflammation. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (Ph.D.)--University of Florida, 2017.
Local:
Adviser: MATHEWS,ANNE.
Local:
Co-adviser: PERCIVAL,SUSAN S.
Statement of Responsibility:
by Changjie Xu.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
LD1780 2017 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

THE EFFECTS AND MECHANISMS OF CONSUMING SULFUR CONTAINING DIETARY SUPPLEMENTS ON CHRONIC INFLAMMATION IN ADULTS WITH OBESITY By CHANGJIE XU A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2017

PAGE 2

2017 Changjie Xu

PAGE 3

To my family

PAGE 4

4 ACKNOWLEDGMENTS First, I would like to express my sincerely appreciation to my major advisor, Dr. Anne E. Mathews, who generously offered me this fantastic opportunity of entering the PhD program in Nutritional sciences at the University of Florida. Over the past four years, Dr. Mathews has supported me and my research in all the ways possible. I have been so fortunate to have an advisor who gave me the freedom and encouragement to explore my research ideas. My heartfelt thanks to my co advisor, Dr. Susan S. Percival, who gave me great opportunity to work on the projects I am presenting here with her and gain research expe rience in the nutrition field in her laboratory. I sincerely t hank my other committee members, Dr. Bobbi Langkamp Henk en, Dr. Shannon M. Wallet who provided constant help and invaluable suggestions. They helped me achieve the level of knowledge that I pos sess today. I would like to express my deepest gratitude to my colleagues, Dr. Cheryl Rowe Dr. Xiaoshuang Dai, Camila Rodrigues, Brandon Eudy for their assistance and suggestions. I also truly thank all my other colleagues, Dr. Melissa Vilaro, Asee l El Zein, Megan D. Engel, Shannon L. Gordon, Daniel L. Staub, Xiaoyu Zhang for their help and friendship.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ ............... 4 LIST OF TABLES ................................ ................................ ................................ ........................... 8 LIST OF FIGURES ................................ ................................ ................................ ......................... 9 LIST OF ABBREV IATIONS ................................ ................................ ................................ ........ 10 A BSTRACT ................................ ................................ ................................ ................................ ... 12 CHAPTER 1 LITERATURE REVIEW ................................ ................................ ................................ ....... 14 Obesity Facts ................................ ................................ ................................ .......................... 14 Epidemiology of Obesity ................................ ................................ ................................ 14 Costs of Obesity ................................ ................................ ................................ .............. 14 Obesity Induced Inflammation ................................ ................................ ............................... 15 Inflammatory Mediators Involved in Obesity induced Inflammation ............................ 16 Cellular Mediators Involved in Obesity induced Inflammation ................................ ..... 17 Mechanisms of Inflammation in Obesity ................................ ................................ ............... 19 Oxidative Stress ................................ ................................ ................................ ............... 19 Adipokines ................................ ................................ ................................ ....................... 20 Endoplasmic Reticu lum Stress ................................ ................................ ........................ 21 Obesity Induced Inflammation and Obesity Related Diseases ................................ .............. 22 Type 2 Diabetes ................................ ................................ ................................ ............... 22 Cardiovascular Diseases (CVD) ................................ ................................ ...................... 23 Cancer ................................ ................................ ................................ .............................. 24 Strategies to Address Obesity i nduced Inflammation ................................ ............................ 25 Physical Activity ................................ ................................ ................................ ............. 25 Anti inflammatory Drugs ................................ ................................ ................................ 26 Diet ................................ ................................ ................................ ................................ .. 27 Summary ................................ ................................ ................................ ................................ 28 2 INTRODUCTION AND RESEARCH OBJECTIVES ................................ .......................... 31 Background ................................ ................................ ................................ ............................. 31 Objectives and Hypotheses ................................ ................................ ................................ ..... 32 Summary ................................ ................................ ................................ ................................ 33 3 AGED GARLIC EXTRACT SUPPLEMENTATION MODIFIES INFLAMMATION AND IMMUNITY OF ADULTS WITH OBESITY: A RANDOMIZED, DOUBLE BLIND, P LACEBO CONTROLLED CLINICAL TRIAL ................................ ................... 34

PAGE 6

6 Introduction ................................ ................................ ................................ ............................. 34 Study Design and Methods ................................ ................................ ................................ ..... 35 Participants and Study Design ................................ ................................ ......................... 35 Study Procedures ................................ ................................ ................................ ............. 36 Separation and Culture of PBMC ................................ ................................ .................... 38 Immune Cell Distribution within the Total PBMC Population ................................ ....... 38 Total GSH and C reactive Protein Concentrations Determination ................................ 39 Inflammatory Cytokine Determination ................................ ................................ ........... 39 Statistical Analysis ................................ ................................ ................................ .......... 39 Results ................................ ................................ ................................ ................................ ..... 40 Baseline Demographic Characteristics ................................ ................................ ............ 40 Intervention Compliance ................................ ................................ ................................ 40 Immune Cell Distribution ................................ ................................ ................................ 41 Mark ers of Inflammation ................................ ................................ ................................ 41 Clinical Parameters ................................ ................................ ................................ .......... 42 Discussion ................................ ................................ ................................ ............................... 42 AGE and Inflammatory Mediators During Obesity induced Inflammation ................... 43 AGE and Immune Cell Populations During Obesity induced Inflammation .................. 44 AGE and Risk Factors of Cardiovascular Diseases ................................ ........................ 45 Strength and Limitations ................................ ................................ ................................ 46 Summary ................................ ................................ ................................ ................................ 47 4 ORAL SUPPLEMENTATI ON WITH 500 mg GSH DOES NOT MODIFY OBESITY INDUCED INFLAMMATION IN OLDER ADULTS: A RANDOMIZED, DOUBLE BLIND, PLACEBO CONTROLLED CLINICAL TRIAL ................................ ................... 56 Introduction ................................ ................................ ................................ ............................. 56 Study Design and Methods ................................ ................................ ................................ ..... 57 Study Design and Participants ................................ ................................ ......................... 57 Sample Size Determination ................................ ................................ ............................. 57 Study Procedure ................................ ................................ ................................ ............... 58 Anthropometric and Biochemical Measurements ................................ ........................... 59 Separation and Culture of PBMC ................................ ................................ .................... 59 Immune Cell Distribution within the Total PBMC Population ................................ ....... 59 Total GSH ................................ ................................ ................................ ........................ 60 Inflammatory Cytokine Determination ................................ ................................ ........... 60 Statistical Analysis ................................ ................................ ................................ .......... 60 Results ................................ ................................ ................................ ................................ ..... 61 Baseline Participant Demographic Characteristics ................................ ......................... 61 Compliance ................................ ................................ ................................ ...................... 61 Immune Cell Distribution ................................ ................................ ................................ 61 Resp iratory Burst ................................ ................................ ................................ ............. 61 Markers of Inflammation ................................ ................................ ................................ 62 Clinical Parameters ................................ ................................ ................................ .......... 62 Discussion ................................ ................................ ................................ ............................... 62 GSH Supplementatio n and Intracellular GSH ................................ ................................ 62 GSH Supplementation and Immune Cell Populations ................................ .................... 63

PAGE 7

7 Strength and Limitations ................................ ................................ ................................ 64 Summary ................................ ................................ ................................ ................................ 64 5 AGED GARLIC EXTRAC T AND GSH REDUCE LPS INDUCED INFLAMMATION IN ADIPOCYTES THROUGH INHIBITING ACTIVATION OF NF ................................ ................................ ........................ 75 Introduction ................................ ................................ ................................ ............................. 75 Materials and Methods ................................ ................................ ................................ ........... 76 Aged Garlic Extract and GSH Solution Preparation ................................ ....................... 76 Cell Culture and Differentiation ................................ ................................ ...................... 77 Study Design ................................ ................................ ................................ ................... 77 Inflammatory Mediators Determination ................................ ................................ .......... 78 Total GSH Concentration Determination ................................ ................................ ........ 78 RNA Extraction and Quantitative Real time PCR ................................ .......................... 78 Immunoblotting ................................ ................................ ................................ ............... 78 Statistical Analysis ................................ ................................ ................................ .......... 80 Results ................................ ................................ ................................ ................................ ..... 80 Inflammatory Mediato rs Secreted by Differentiated 3T3 L1 Cells ................................ 80 mRNA Expression Levels of Cytokines in Differentiated 3T3 L1 Cells ........................ 80 Intracellular GSH Concentration ................................ ................................ ..................... 81 Expression Levels of AP1 and NF ................................ ................................ ............ 81 Discussion ................................ ................................ ................................ ............................... 81 AGE and GSH Prevented LPS induced Inflammation in 3T3 L1 Cells ......................... 81 AGE and GSH Inhibited Activation of NF ................................ ................ 82 Strengths and Limitations ................................ ................................ ................................ 83 Su mmary ................................ ................................ ................................ ................................ 83 6 CONCLUSIONS AND FUTURE WORK SUMMARY ................................ ....................... 9 2 Conclusions ................................ ................................ ................................ ............................. 92 Strengths and Limitations ................................ ................................ ................................ ....... 94 Fu ture Direction ................................ ................................ ................................ ...................... 95 LIST OF REFERENCES ................................ ................................ ................................ ............... 96 BIOGRAPHICAL SKETCH ................................ ................................ ................................ ....... 111

PAGE 8

8 LIST OF TABLES Table page 1 1 Inflammatory cytokines in obesity. ................................ ................................ .................... 29 3 1 Demographics and baseline clinical characteristics of study participants at baseline. ...... 48 3 2 Other characteristics of participants. ................................ ................................ .................. 49 3 3 Immune cell distri bution at baseline and completion of the study ................................ .... 50 3 4 Serum biomarkers at baseline and completion of the study ................................ .............. 51 3 5 Cytokine secreted by PBMC after 24 h stimulation of PHA L ................................ ......... 52 4 1 Demographics and baseline cl inical characteristics of study participants. ........................ 66 4 2 Self reported side effects, illnesses, and related behaviors of participants throughout the intervention period. ................................ ................................ ................................ ...... 67 5 1 Sequences of primers used for real time quantitative PCR. ................................ .............. 84

PAGE 9

9 LIST OF FIGURES Figure page 1 1 Prevalence of obese in the United States ................................ ................................ .......... 30 3 1 Overall flow of participants assessed for eligibility, enrolled in the AGE study, randomized to different treatments and analyzed statistically. ................................ .......... 54 3 2 Participant compliance.. ................................ ................................ ................................ ..... 55 4 1 Overall flow of participants assessed for eligibility, enrolled in the GSH study, randomized to different treatments and analyzed statistically. ................................ .......... 68 4 2 Participant compliance.. ................................ ................................ ................................ ..... 69 4 3 The percentage of immune cell populations in the total peripheral blood mononuclear cell among the 4 groups at baseline and the end of the study.. ................................ .......... 70 4 4 Respiratory burst assay was performed to quantify a respiratory burst response in neutrophils and monocytes by flow cytometry ................................ ................................ 71 4 5 Cytokines secreted by PBMC after 24 h stimulation with PHA L among the 4 groups at baseline and the end of the study. ................................ ................................ .................. 72 4 6 Blood clinical parameters among the 4 groups. ................................ ................................ 73 4 7 Anthropometric measurements among the 4 groups at ba seline and the end of the study ................................ ................................ ................................ ................................ .. 74 5 1 Free fatty acids induce inflammation in obesity ................................ ............................... 85 5 2 Concentrations of cytokines secreted by differentiated 3T3 L1 cells in cell culture medium ................................ ................................ ................................ ............................. 86 5 3 mRNA expression levels of Adip onectin, IL 6, TNF 1genes in differentiated 3T3 L1 cells. ................................ ................................ ............................... 87 5 4 Concentrations of intracellular GSH in differentiated 3T3 L1 cells ................................ 88 5 5 Expression of NF leus and cytosol of 3T3L1 cells ................................ ........... 89 5 6 Expression of activator protein 1 in nuc leus and cytosol of 3T3L1 cells ......................... 90 5 7 Potential mechanism by which AGE and GSH reduce s obesity induced inflammation ................................ ................................ ................................ ..................... 91

PAGE 10

10 LIST OF ABBREVIATIONS AGE Aged garlic extract ANOVA Analysis of variance AP1 Activator protein 1 ATF6 Activating transcription factor 6 ATMs Accumulation of adipose tissue macrophages BMI Body mass index CCR2 C C motif chemokine receptor 2 CHD Coronary artery diseases CRP C reactive protein CVD Cardiovascular diseases DHA Docosahexaenoic acid DMEM eIF4E Eukaryotic translation initiation factor 4E EPA Eicosapentaenoic acid ER Endoplasmic reticulum ERK E xtracellular signal regulated kinases FBS F etal bovine serum FFAs Free fatty acids GLU G lucose GSH Glutathione HDL H igh density lipoprotein cholesterol IL 6 Interleukin 6 IRS 1 I nsulin receptor substrate 1 JNK c Jun N terminal kinases

PAGE 11

11 LDL L ow density lipoprotein cholesterol LPS L ipopolysaccharide MAPK M itogen activated protein kinase MCP 1 M onocyte chemoattractant protein 1 MIF M acrophage migration inhibitory factor NF N uclear factor kappa light chai n enhancer of activated B cells NK cell Natural killer cell NKT cell Natural killer T cell non HDL N on high density lipoprotein cholesterol PBMC P eripheral blood mononuclear cells PERK P rotein kinase RNA like endoplasmic reticulum kinase PUFA P olyunsaturated fatty acids ROS R eactive oxygen species SAD S agittal abdominal diameter TC T otal cholesterol TCA cycle T ricarboxylic acid cycle TG T riglyceride Th cell T helper cell TLR4 Toll like receptor 4 TNF T umor necrosis factor alpha Treg cell R egulatory T cell UPR U nfolded protein response WC W aist circumference

PAGE 12

12 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy THE EFFECTS AND MECHANISMS OF CONSUMING SULFUR CONTAINING DIETARY SUPPLEMENTS O N CHRONIC INFLAMMATION IN ADULTS WITH OBESITY By Changjie Xu December 2017 Chair: Anne Mathews Major: Nutritional Sciences O besity is global health issue. In the United States, more than one third of adults are obese (1) O besity induces chronic systemic inflammation and increasing obesity positively correlates with the concentration of inflammatory cytokines (2, 3) Obesity induced inflammation is recently considered a l ink between obesity and it s related chronic diseases (4) Prevention or reduction of inflammation in adults with obesity may mitigate the associated negative health complications such as cardiovascular disease and some cancers Increased o xidative stress in obesity plays a ke y role in the development of inflammation. Over produced reactive oxygen species (ROS) stimulate the activation of nuclear factors such as NF and a ctiva tor p rotein ( AP1 ) which can up regulate the production of inflammatory cytokines (5) Glutathion e (GSH) one of the most abu ndant ROS scavenger s in the body protect s host immune cells from fre e radical assault GSH is diminished with obesity (6, 7) Daily consumption of dietary supplements that support GSH production may be a safe and acceptable mode of counteracting the chronic inflammation associated with obesity. The goal of this research was to evaluate the effects and mechanisms of sulfur containing dietary supplements on chronic inflammation in adults with obesity. To achieve this goal, three

PAGE 13

13 in dependent studies were conducted, including two randomized placebo controlled clinical trial and one cell culture based experiment. The dietary supplements tested in the clinical trials were Aged garlic extract ( AGE) ( Wakunaga of America Co. ) and Setria G SH ( Kyowa Hakko Bio Co. ). S ix weeks of AGE consumption (3.6 g/day) modulated immune cell distribution, attenuated increase of serum TNF (p = 0.04) and IL 6 (p = 0.05) concentrations and reduced blood LDL (p = 0.05) concentration in adults with obesity, i ndicating that the consumption of AGE can produce anti inflammatory effects in adults with obesity. Similar the anti inflammatory effects were not observed when adults consumed GSH (500 mg/day) for four months. Both AGE and GSH were used to pre treat diffe rentiated adipocyte cells (3T3 L1) prior to stimulation of inflammation with lipopolysaccharides (LPS). Pre treatment with both AGE and GSH, decreased the expression of IL 6 in protein and at the mRNA level. AGE pre treatment also increased the expression of adiponectin in the cells Moreover, AGE and GSH pre treatment inhibited activation of NF AP 1 two major nuclear factors that are associated with inflammation. Taken together, this series of experiments support the hypothesis that sulfur contai ning supplements may reduce the inflammation in obesity The in vitro study suggested that the anti inflammatory effect is through the inhibit ion of the activation of NF This anti inflammatory effect was only observed in the AGE clini cal study, but not when participants were provided GSH Further s tudies should be conducted to determine the optimal dose of unique sulfur containing supplements for reducing obesity induced inflammation.

PAGE 14

14 CHAPTER 1 LITERATURE REVIEW Obesity Facts Obesity is a serious worldwide health issue, especially in western countries. Recently, it has received considerable attention from health professionals and researchers. According to t he World Health Organ ization (WHO) obesity or excess adiposity, is defined as having a b ody mass index (BMI) greater than 30.0 kg/m 2 Epidemiology of O besity The overall prevalence of obesity has increased rapidly in the last few decades It more t population (11% of men and 15% of women) were obese compared with 4.8% of men and 7.9 % of women in 1980 (8) In the United States, according to reports from the Centers for Disease Control and Prevention, about 36.5 % of A merican adults were obese in 2 016 (1) The re is a significant increasing linear trend in prevalence of obesity among adults and youth from 1999 2000 through 2015 2016 (Figure 1 1 B ) In England, the prevalence of obesity among adults has increased from 15 % in 1993 to 2 6% in 2014 The rate of increase has slowed down since 2001, although the trend is still upwards (9) In China, the prevalence of age adjusted obesity in adults was 11 .3 % in 2011 (11.8% of men and 11.0% of women) compared with 2.88% of men and 4.5 % of women in 1991 (10) Although the prevalence is relatively low in China, it has increased dramatically in the last few years. C osts of O besity Excess adiposity harms health in many ways. It increases the risk of developing cardiovascular diseases, diabetes, cancers and some other chronic disease s Billions of dollars are spent on t reating obesity and obesity related conditions every year. There are t wo types of costs

PAGE 15

15 that are associated with the treatment of obesity and obes ity related conditions: direct costs and indirect costs. Direct costs are those from preventive diagnostic and therapeutic services Indirect costs are economic losses due to obesity related morbidity and mortality In United States, a nnual medical cost s related to obesity were $147 billion in 2008. And medical costs for people who are obese were $1,429 high er than those of normal weight (11) In England, e stimates of the direct costs for treating obesity and related conditions was £4.2 billion in 2007 (12) compar ed with £479.3 million in 1998 (13) T he indirect costs increased from £2.6 billion in 1998 (13) to £15.8 billion in 2007 (12) In Scotland, the total medical cost was estimated to be £600 million for obesity and £1.4 billion for overweight in 2007 2008 (14) The high prevalence o f obesity in the worldwide and t he costs associated with ob esity demonstrate the enormous global burden of obesity R esearchers are actively seeking was to better understand the physiological effects of obesity and how to reduce the negative impact excess adiposity has on health. A most recent area of focus is on understanding obesity induced inflammation. Obesity Induced Inflammation In 1993, Hotamisligil et al demonstrated that adipose tissue of obese mice expressed tumor necrosis factor alpha (TNF ice (15) Since then, plenty of researchers have focused on this area and have demonstrated that obesity is often associated with a state of chronic low grade inflammation, called o besity induced inflammation. The development and progress ion of t his chronic inflammation is a rather complicated process. It involves many molecular and cellular responses.

PAGE 16

16 Inflammatory M e diators I nvolved i n O b esity i nduced I nflammation It is well known that adipose tissue is one of the dominant sites in the body for production and release of cytokines. O ne of the major characteristics of obesity is the expansion of adipocytes. Thus, these expanded adipocytes e levate production of pro inflammatory cytokines and cause chronic systemic inflammation Significant changes in c ertain inflammatory markers have been ob served in obesity including C reactive protein (CRP), inflammatory cytokines and adipokines (Table 1 1) CRP is an acute phase protein synthesized by the liver. It increases rapidly in response to inflammation. Thus, it is usually used as a marker of inflammation. The serum concentration of CRP has been found positively correlated with obesity even in young adults (16) A systematic review (17) analyzed the association between obesity and CRP in a meta analysis of 51 cross sectional studies. Serum CRP was found to positively associate with obesity in various populations. However, this association was found to be stronger in women t han men, and in people from western count r ies compared with people from Asian countries. The reasons for these differences are not well understood. Following the elevation of CRP concentration in the body, macrophages and T cells will increase the secretion of i nflammatory cytokines during obesity induced inflammation Studies have shown that body fat ness, represented by both BMI and waist circumference (WC) is significantly correlated with serum concentrations of inflammatory cytokines (3, 18) There are two kinds of inflammatory cytokines, pro inflammatory cytokines and anti inflammatory cytokines. In obese individuals, concentrations of pro inflammatory cytokines, interleukin 6 ( IL 6 ) (19) and TNF (20) are significantly higher than those found in lean individuals. And serum

PAGE 17

17 concentrations of pro inflammatory cytokines are positively associated with weight, BMI, WC and hip circumference (3) Another type of inflammatory marker altered in obesity is a d ipokine s Adipokines are secreted by adipocyte s The two major adipokines discussed here are leptin and adiponectin. Compared with adipose tissue of lean adults, the concentration of leptin is greater in adipose tissue of obese adults, while the concentration of adiponectin is decreased. Leptin is an adipose derived hormone that plays an important role in regulating energy intake and expenditure It also regulates immu ne function by stimulating production of macrophages involving in activation of natural killer cell and inducing secretion of pro inflammatory cytokines (21, 22) In obesity, leptin is increased by as much as four fold compared with lean adults and this difference is especially noted in women (23, 24) Adiponectin is another adipose derived hormone, which is involved in regulating glucose and fatty acid metabolism. It is an anti inflammatory adipokine. There are at least two kinds of receptors for adiponectin, ADIPOR1 and ADIPOR2, on the cell surface. Compared with lean adults, adiponectin concentrations are decreased in adults with obesity (24) Yang et al investigated plasma adiponectin concentration in overweight and obese Asians and found that an inverse correlati on with BMI (25) Cellular M ediators Involved in Obesity induced I nflammation Besides the inflammatory mediators, a large number of cells are also involved in obesity induced inflammation. Adipocyte s, the predominant component of adipose tissue, are usually known to play roles in the metabolic pathway. Until recently, its role in inflammatory pathway was broadly studied and still not well understood. In an obese state not only do the adipocyte s increase in number and size to accumulate fat, they also secrete IL 6, monocyte chemoattractant protein

PAGE 18

18 (MCP 1) and adipokines. Curat et al. demonstrated that increased secretion of adipokines from mature human adipocytes promoted the infiltration and accumulation of macrophages in adipose tissue (26) leading to development of the low grade inflammation Release of those inflammatory mediators secreted by adip ocyte s into circulation also contribute to obesity induced inflammation. Accumulation of a dipose tissue macrophage s (ATM s ) plays a critical role in the development of obesity in duced inflammation. There are two types of macrophage phenotype s pro inflammatory M1 type and anti inflammatory M2 type. During obesity the predominant phenotype of ATMs switches from M2 to M1 (27) Fujis aka et al. observed that both the number of M1 macrophage and the ration of M1 to M2 increased in epididymal fat tissue of high fat diet induced obese mice (28) Macrophages from obese mice overexpress genes that are related with inflammation, including those encoding interleukin 6, TNF C motif chemokine receptor 2 (CCR2) w hereas macrophages from lean mice express more anti inflammatory genes such as i nterleukin 10 (27, 29) As obesity progresses, more M1 ATMs were recruited into adipose tissue, and secreted inflammatory cytokines which further promote obesity induced inflammation. Not only adipose tissue macrophage s but other innate immune cells are also impaired with the progress ion of obesity. Natural killer (NK) cells represent the first line of the immune system Studies have shown decreased circulating NK cells in obes ity (30, 31) However, when separated from metabolically unhealthy obese patients, NK cell counts in metabolically healthy obese subjects was not different from the lean subjects (31, 32) Neutrophils a member of the granulocytes family are clinically used as evidence of microbial infection. Talukdar et al. found that the number of neutrophils numbers increased in adipose tissue of HFD induced obesity mice

PAGE 19

19 (33) Those elevated neutrophils produce chemokines and cytokines, promoting macrophage infiltration into adipose tissue which may contribute to development of obesity induced inflammation T cells are related to obesity as well T cells that express the surface marker CD4 are T helper (Th) cells which are usually divided into two populations: the pro inflammatory Th1 cells and anti inflammatory Th2 cells. Another CD4+ population, regulatory T cells (Treg), can secrete anti inflammatory cytokine to sup press activation of the immune system and prevent autoimmune attack. In adipose tissue, Treg cells inhibit macrophage migration and promote M2 macrophage phenotype. T cells that express the surface marker CD8 are cytotoxic T cells, which secrete pro inflam matory cytokines. As obesity progresses cytotoxic T cells are activated in adipose tissue, leading to the recruitment and activation of ATMs (34 ) Infiltration of cytotoxic T cells into adipose tissue is also associated with the deletion of adipose Treg cells and increased activation of Th 1 cells (34, 35) T cells, a subset of T cell s TCRs were recently found to be increased in adipose tissue and may associated with obesity induced inflammation during obesity (36) Mechanisms of Inflammation in Obesity As mentioned above, the development of obesity induced inflammat ion is a complicated process. It involves many molecular and cellular responses. The exact mechanism of how the low grade inflammation is induced is not clear yet. S everal potential mechanisms have recently been proposed recently. Oxidative S tress Increased oxidative stress was observed in adults with obes ity (37) and there is a positive association between oxidative stress (8 epi PGF as a marker) and BMI (38) Under an obese

PAGE 20

20 condition, the excessive fat accumulation leads to increased generation of electron donors, oxidation of fatty acids and the oxidation of FFA derived acetyl CoA by the tricarboxylic acid ( TCA ) cycle. NADH and FADH2 are processed in the mitochondrial electron transport chain for electron donation to oxygen, finally leading to increased production of reactive oxygen species (ROS) and oxidative stress (39) ROS can then activate the tran scription factor nuclear factor k appa B ( NF ) signaling pathway (40) and mitogen activated protein kinase ( MAPK ) pathway (41) both of which play important roles in obesity induced inflammation. In obese individuals, the elevated ROS activate IKK complex which, in turn, phosphorylat polyubiquitinated, leading to its degradation by the proteasome and to translocation of the NF dimer to the nucleus (42, 43) and finally an increase in the expression of pro inflammatory genes Adipokines The increase of leptin and decrease of adiponectin plays an important role in the development o f obesity induced inflammation. The overexpressed leptin binds to its receptors and activates the canonical JAK STAT, extracellular signal regulated kinases ( ERK ) and Phosphoinositide 3 kinase signaling pathway by JAK mediated tyrosine phosphorylati on of the intracellular domain (44) which stimulates secretion of the pro inflammatory cytokines, including leukotriene B4, TNF, IL 1 and IL 6 (45, 46) It also indirectly activates eukaryotic translation initiation factor 4E (eIF4E) by inhibiting eIF4E Bind ing Protein 1. Activated eIF4E will induce perilipin 2 expression, lipid accumulation and foam cell formation in macrophages (44) F inally stimulates the production of pro inflammatory cytokines.

PAGE 21

21 In contrast to leptin, when adiponectin binds to its receptors, it suppresses production of pro inflamm atory factors, like TNF and interferon and induces secretion of anti inflammatory cytokines, like IL 10 and IL 1RA (47) by activation of AMP activated protein kinase and p38 MAPK It also activates peroxisome proliferator activated receptors (PPARs). PPARs in turn inhibit the transcriptional activation of pro inflammatory response genes (48) including TNF IL 6, cyclooxygenase 2, vascular cell adhesion molecule 1, inducible NO synthase and matrix metalloproteinase (49 51) Endoplasmic Reticulum S tress Another key contributor to obesity induced inflammation is endoplasmic reticulum (ER) stress, which is usually caused by the unfolde d protein response (UPR) (52) UPR is induced primarily by activation of three transmembrane proteins residing on the ER, protein kinase RNA like endoplasmic reticulum kinase (PERK), inositol requiring enzyme 1, and activating transcription factor 6 (ATF6). Those three pathways are ti ghtly connected with inflammatory signaling pathways. PERK activation can lead to enhanced NF can inhibit general protein translation by the phosphorylating alpha subunit of eukaryotic IKK and NF consequence is increased expression of the pro inflammatory genes in the downstream of NF and IL 6 (53) IRE 1 can upregulate the expression of pro inflammatory cytokines through their interaction with TN F receptor associated factor 2 which is required for TNF of c Jun N terminal kinases ( JNK ) and NF (54 56) AT F 6 has also been shown to increase NF (57)

PAGE 22

22 Neeraj et al. reported that the expression of ER stress markers genes, including HSPA5 , and EIF2AK3, and downstream chaperones was positively correlated with BMI and percent of body fat (58) The increased ER stress in obese individuals play s a crucial role in the development of obesity induced inflammation through activation of the NF pathway Obesity Induced Inflammation and Obesity Related Diseases It has been well accepted that overweight and obesity are related to many chronic diseases. Overweight and obesity have adverse metabolic effects on blood pressure, cholesterol, triglycerides and insulin sensitivity BMI is positively related to r isks of coronary heart diseas e ischemic stroke and type 2 diabetes mellitus. In addition, overweight and obesity also increases the risks of cancer of the breast, colon, gastric cardia pancreas kidney and gall bladder (59, 60) This chronic low grade inflammation is considered the key link between obesity and its related chronic diseases (4) Type 2 D iabetes One of the most common disease s associated with obesit y is type 2 diabetes. Type 2 diabetes is characterized by i nsulin resistance a condition in which insulin receptors on the s urface of cells can not recognize insulin, le ading to hyper glycemia It is well established t hat o besity induced inflammation plays a crucial role in the development of insulin resistance (61) As obesity progresses s ome pro inflammatory cytokines secreted by adipos e tissue likely contribute to the pathogenesis of insulin resistance (62) Those cytokines can inhibit insulin JNK, which phosphorylate serine residues of the insulin signaling pathway (63) In normal conditions, when insulin binds to its receptors, it will activate an insulin receptor substrate 1 (IRS 1), an essential medium in the

PAGE 23

23 insulin signaling cascade by tyrosine phosphorylation. This phosphorylation enables IRS 1 to recruit downstream proteins and develop a scaffolding network. One of these downstream proteins is HMS untamed protein (58) whi ch can activate PI3 kinases and finally reduce blood glucose concentration by stimulating translocation of glucose transport 4 (GLUT4) to the cell surface (64) In the insuli n resistant state, serine phosphorylation of IRS 1 will inhibit its action and stop its initial signaling (65) TNF rst inflammatory mediator linking insulin resistance with obesity (15) by inhibiting tyrosine kinase activity of insulin receptor s The serum concentration of TNF is much higher than those of normal weigh t adults (66) A mice study showed that d eletion of TNF the body from insulin resistance (67) Other cytokines secreted by obese adipose tissue that can interfere insulin signaling, are IL 1 (68) IL (69) IL 6 (69, 70) and macrophage migration inhibitory factor (MIF) (71) etc. Cardiovascular D isease s (CVD) Obesity has been identified as an independent risk factor for CVD including coronary heart diseases (CH D) stroke, heart failure, hypertensive heat diseases, etc. (72) Rimm et al. reported that men with a BMI of 25 to 28.9 kg/m 2 are 1.72 times more likely to have CHD than those with BMI less than 23.0 kg/m 2 (73) The risk increased to 2.61 times with a BMI of 29.0 to 32.9 kg/m 2 an d 3.44 times with a BMI of 33.0 or greater. The association of obesity and coronary heart disease is also observed among women (74) As among men, the risk of CH D is positively correlated with BMI, with 3.3 times higher risk with a BMI of 29 .0 kg/m 2 or greater (74) Kenchaiah et al. sh owed that obesity increased the risk of heart failure as well. In their study, the risk of heart failure doubled among obese subjects, with a hazard ratio of 2.12 for women and 1.90 for men (75)

PAGE 24

24 Atherosclerosis, the primary underlying cause of cardiovascular disease, was thought to be a mild lipid storage disease (76) Now, there is a better understanding of the mechanisms for atherosclerosis. Studies have shown that inflam mation is closely related to the development of atherosclerosis, from the initiation to the end stage thrombotic complications (77) In obese individuals, macrophages accumulate within the adipose tissue (78) leading to production of several pro inflammatory mediators including IL 1, IL 6 and TNF stress continues, it creates a pro inflammatory environment in the body. Stimulated by inflammatory cytokines, endothelial cells express adhesion molecules which allow leukocytes to adhere to the artery wall (79) and finally result in endothelial dysfunction which is r esponsible for the pathophysiological changes in subclinical atherosclerosis and CVD (80) Cancer Large numbers of studies have reported a positive relationship between obesity and cancers. Ma et al. systematically reviewed 54 prospective studies on obesity and risk of colorectal cancer and showed that the risk of colorectal ca ncer in obese subjects was 1.3 times more than those with normal weight (81) Chen et al. reported a positive association between excess body weight and primary liver cancer (82) In a systematic review of 14 cohort studies, BMI was also found positively asso ciated with pancreatic cancer with a risk ratio of 1.30 comparing subject s with BMI of 25 kg/m 2 or greater to those with BMI less than 25 kg/m 2 Chronic inflammation is critical for progression of tumor growth Inflammatory cytokines secreted during the ch ronic low grade inflammation in subjects with obesity can influence growth, mutation, proliferation, differentiation and movement of cells through DNA damage, angiogenesis and actions as growth factors (83) TNF one of the major mediators secreted during obesity was found to act as a tumor promoter via activation of NF (84) and

PAGE 25

25 to damage DNA by increasing reactive oxygen species levels (85) Jaiswal et al. treated three human cholangiocarcinoma cell line with a mixture of IL (86) Results showed tha t inflammatory cytokine induced production of inducible NO synthase (iNOS) and NO NO in turn damage d DNA directly and indirectly by inactivating DNA repair proteins. Inflammatory cytokines also inhibit tumor suppressor protein p53 activity Cells treated with MIF showed inhibition of p53 activity (87) leading to proliferation, differentiation and migration of tumor cells. In addition, s ome inflammatory cytokines act as growth factors for tumor cells. IL 6 is a growth factor for multiple myeloma cells (88) It sti mulates release of parathyroid hormone related protein from these cells, induces sec retion of TNF related activation induced cytokine (TRANCE) and finally leads to cell growth. Strategies to Address Obesity i nduced Inflammation As obesity induced inflammation many chronic diseases. I t is important to find appropriate strategies to address this problem. Physical A ctivity Regular and chronic physical activity is an effective method for addressing obesity induced inflammation. It can decrease production of inflammatory markers and increase anti inflammatory substances. Studies have shown that there is an inverse correlation between regular exercise and the serum concentrations of inflammatory biomarkers, such as CRP, IL 6, and TNF (89, 90) Starkie et al. reported that physical exercise was even able to inhibit endotoxin induced TNF (91) The anti inflammatory function of physical activity is not only represented by decreased secretion of pro inflammatory cytokines, but also increased expr ession of antioxidant and anti inflammatory mediators (92, 93) Kriketos et al. reported that 2 3 sessions of regular mo derate

PAGE 26

26 exercise could remarkably increase adiponectin concentration in serum (94) T his effect could be sustained up to 10 weeks. Those findings were supported by Simpson et al. who systematica lly reviewed 8 randomized controlled trials over ten years (95) In another study, subjects with type 2 diabetes enrolled in a 12 week aerobic training program demonstrated an up regulated expression of superoxide dismutase (SOD) and catalase (CAT), which are two important antioxidant enzymes in the body (96) Anti i nflammat ory D rug s Anti infl ammatory drugs are another choice Aspirin, one of the most common ly used anti inflammatory medications was found to improve blood glucose level in individuals with type 2 diabetes as early as 1901 (97) Kim (98) and Yuan (99) et al. demonstrated that aspirin also could improve insulin resistance and decrease inflammation. Hundal et al. supported those findings in a human study (100) Here, t hey provided participants with diabetes with high dose aspirin ( approximately 7g/day) for 2 weeks and observed a 25% reduction in fasting plasma glucose, 15% reduction in total cholesterol and C reactive protein, a 50% reduction in triglycerides, and a 30% reduction in insulin clearance. As described above, TNF inflammatory mediator linked with insulin resistance in obesity Therapeutic effect s of i ts antagonist on insulin resistance and diabetes were widely studied (101, 102) Bernstein et al. investigated effects of a TNF inflammation in obese patients with metabolic syndrome by providing etanercept (103) Reduced concentrations of C reactiv e protein IL 6 and fibrinogen, and increased concentrations of adiponectin were observed. And they concluded that the TNF inflammation by interrupting the inflammatory cascade that occurs in patients with abdominal obesity. Simi larly, Stanley et al. (104) showed that the prol onged inhibition of TNF

PAGE 27

27 glucose level and increased high molecular weight adiponectin in obese subjects. However, CRP and IL 6 were unchanged after treatment. Diet In the last few decades, many bioactive compounds derived from food such as EPA, DHA and resveratrol, etc. have been shown to have an anti inflammatory effect. Some of those compounds are used as a dietary supplement s and highly available in market s around the world The anti inflammatory effects of long chain 3 polyunsaturated fatty acids ( PUFA ) have been well accepted. In vitro, 3 PUFA can inhibit the activation of NF B and decrease endothelial chemokines, MCP 1 and IL 8 expression in cultured endothelial cells (105) This is supported by a report from Weldon et al. in which eicosapentaenoic acid (EPA) and docosahexaenoic acid ( DHA ) decrease d NF B activation and induce d an anti inflammatory profile in lipopolysaccharide stimulated human THP 1 macrophages. C ell s pretreated with EPA and DHA decreased TNF IL and IL 6 production compared with control cells (106) Similar results were also seen in vivo studies. X i et al. (107) fe d mice with a diet contain either 20% corn oil or 17% of fish oil and 3% corn oil. They found that fish oil suppressed NF activation and viral replication in the spleen and liver. 3 PUFA can reduce production of inflammatory cytokine s (108, 109) prostaglandin E 2 (110) and leukotriene B 4 (109) The anti inflammatory 3 PUFA ma y have an important potential for reducing obesity induced inflammation and improving insulin resistance. Resver a trol is another bioactive compound found in food, including grapes and blueberries Its anti inflammatory effects also have been broadly studied. Gomez zorita et al. reported that obese rats that r eceived resveratrol for 6 weeks had lower serum concentrations of TNF 1 and CRP (111) IL 6 protein expression in epidydimal adipose tissue was

PAGE 28

28 reduced by 40%. The activity of NF I n another study, mice with obesity induced by a high fat diet were given resveratrol for 13 weeks (112) As a result, those mice showed decreased oxidativ e stress, reduced plasma concentratio ns of IL 6 and TNF increased number of regulatory T cell in peripheral blood and spleen The r esveratrol supplement also inhibit ed macrophage infiltration in aortic tissue of db/db mice ( 113) which plays an important role in the development inflammation. Summary Obesity which is associated with a state of chronic inflammation has beco me a severe public health issue. O besity induced inflammation is considered the link between obesity and its related chronic disease s (4) Thus, it is important to find appropriate strategies to address the chronic inflammation during obesity.

PAGE 29

29 Table 1 1. Inflammatory cytokines in obesity. Cytokine Distribution Function Increased cytokines TNF Secreted by macrophages and WAT adipocytes Reduces insulin secretion and sensitivity. Stimulates lipolysis. IL 6 Predominantly expressed by WAT, around 35% Promotes glucose and lipid metabolism IL 1 Secreted mainly by adipocytes and macrophages Induces immune cells to infection site, thermogenesis IL 7 Expressed by stromal and vascular endothelial cells Stimulates the differentiation of hematopoietic stem cells IL 8 Secreted by adipocytes and macrophages Neutrophil chemotaxis MCP1 Secreted by WAT Reduces insulin sensitivity, increases macrophage infiltration during inflammation MIP1 Secreted by macrophages Recruits and activates polymorphonuclear leukocytes Decreased cytokines IL 10 Expressed by monocytes, macrophages, dendritic cells, B and T cells Inhibits pro inflammatory cytokines production Omentin Mainly secreted by WAT Improves glucose uptake in human adipocytes TNF 6: interleukin 6; IL 1: interleukin 1; IL 7: interleukin 7 ; IL 8: interleukin 8 ; MCP 1: Monocyte chemotactic protein 1; MIP1 inflammatory protein 1 10: interleukin 10. Adapted from Makki k et al., 2013 (114)

PAGE 30

30 Figure 1 1 Prevalence of obese in the United States. A: Prevalence of self reported obesity among American adults by state and territory in 2016 There is no state that has a prevalence of obesity less than 20%. More than 35% of adults in Arkansas, Alabama, Mississippi Louisiana and West Virginia were obese Twenty states had a prevalence between 30% and 35%, and 22 states between 25% and 30%. Adjust from https://www.cdc.gov/obesity/data/prevalence maps.html indicates Sample size <50 or B: Trends in obesity prevalence among adults aged 20 and over (age adjusted) and youth aged 2 19 years: Unite d States, 1999 2000 through 2015 201 6 (1) 1 Significant increasing linear t rend from 1999 2000 through 2015 2016

PAGE 31

31 CHAPTER 2 INTRODUCTION AND RESEARCH OBJECTIVES Background As stated previously, o besity has become a serious health issue all over the world, especially in Western countries. In the United States, more than one third of adults are obese (1) Obesity often comes wi th an increased risk of systemic inflammation that stems from the immune system (2, 3) When the immune system is chronically act ivated, a barrage of free radicals, oxidative products and inflammatory cytokines assault the human body, damaging cells and organs and increasing the risk for disease. If inflammation associated with obesity can be reduced, then fewer complications (e.g. diseases such as cardiovascular disease) might occur. Oxidative stress is an important component of inflammation. It stimulates the activation of mediator signaling molecules such as NF which can up regulate the production of inflammatory cytokines (5) GSH is central to redox defense in the body during oxidative stress protecting host immune cells from free radicals. Daily consumption of dietary supplements that support GSH production could po tentially be a method of counteracting the chronic inflammation associated with obesity. Two dietary supplements aged garlic extract (AGE) and GSH have been shown to r eplete GSH concentration in the body (115, 116) The potential subsequent effect of AGE and GSH on obesity induced inflammation has not yet been studied yet. T wo randomized double blind placebo controlled clinical trials were conducted to determine if supplementation with AGE or GSH modulate immune function and reduce inflammation in obese adults. Also, cell culture studies were conducted to understand the mechanistic process.

PAGE 32

32 Objectives and Hypothese s The overall goal of my research was to determine if and how sulfur containin g dietary supplements, AGE and Setria GSH reduce chronic inflammation in adults with obesity To ac hieve this goal, two randomized double blind placebo controlled human studies were conducted to determine these effects and an in vitro study was carried out to investigate the mechanisms. The specific aims are as follows: Specific aim 1 : To investigate if AGE supplementation will attenuate obesity induced inflammation. It is hypothesized that obese individuals consuming AGE supplement would show decreased pro inflammatory and increased anti inflammatory cytokine concentrations in serum and cell culture supernatant. This aim was accomplished in three steps: 1) Characterize inflammation in the obese study participants. 2) Determine if AGE supplementation alters the distribution and activation T cell and NK cells in obese participants. 3) Investigate if and how AGE changes the pattern of inflammatory cytokine expression and secretion in obese participants. Specific a im 2 : To investigate if consuming a GSH supplement will attenuate inflammation in older ad ults, with and without obesit y It is hypothesized that GSH supplementation would replenish GSH concentration and reduce inflammation in older obese adults. This aim was also accomplished in three steps:

PAGE 33

33 1) Characterize GSH status in older adults, with and without obesity. 2) Determine if oral GSH supplementation alters the distribution and activation T cell and NK cells in older adults with and without obesity. 3) Investigate if and how GSH changes the pattern of inflammatory cytokine synthesis and secretion in older adults with and without obesity. Specific aim 3 : To investigate the mechanism by which AGE and GSH exert their effects on obesity induced inflammation. It is hypothesized that the enhanced NF s dur ing obesity induced inflammation would be reduced by AGE and GSH treatment. Summary Due to the essential role of GSH in alleviating oxidative stress, which plays an important role in obesity induced inflammation, dietary supplements to support GSH production are a p otential method for counteracting inflammation associated with obesity. I t is hypothesized that AGE and Setria GSH would reduce the chronic inflammation in obese adults through a mechanism involving NF s

PAGE 34

34 CHAPTER 3 AGED GARLIC EXTRACT SUPPLEMENTATION MODIFIES INFLAMMATION AND IMMUNITY OF ADULTS WITH OBESITY: A RANDOMIZED, DOUBLE BLIND, PLACEBO CONTROLLED CLINICAL TRIAL Introduction Garlic has a long history of providing health benefit s which are a s cribed primarily to i ts organosulfur compounds Those bioactive compounds in garlic can be classified into two categories, gamma glutamylcysteines and cysteine s u lfoxides (62). After absorbed intact, gamma glutamylcysteines are hydrolyzed to S allylcysteine and S 1 propenylc ysteine (63) whereas c ysteine s u lfoxides are rapidly metabolized to allyl methyl sulfide, a volatile compound that accounts for the garlic odor (64). AGE is a form of garlic manufactured through extraction and a proprietary process of aging. After harvesting, the garlic is stored in an aqueous ethanol solution for up to 20 months. This converts the organosulfur compounds in garlic into milder and less odiferous compounds, mainly S allylcysteine. Numerous studies have demonstrated the health benefit s of AGE, such as neuroprotection, antihypertensive, and cholesterol lowering effects (117 121) AGE is also able to modulate immune function. Patients with advanced cancer administered with AGE (4 capsules containing 500 mg AGE, 727 mg crystalline cellulose and 11 mg sucrose fatty acid ester) for 6 months showed an increased in both the number and activity of NK cells (122) Tabari et al (123) administered AGE (100 mg/kg) to mice implanted with fibrosarcoma cells, intraperitoneally. As a result, mice that received AGE showed improved immune responses against their tumor. Th e immunity modulating function of AGE was also supported by a previous study (115) In that study, 120 healthy non obese adults were randomized to consume T and NK cells from participants who consumed

PAGE 35

35 AGE showed greater proliferation after stimulation, than those of participan ts who consumed the placebo. In addition, NK cells of those consuming AGE had more NKG2D, a marker of cell activation, which plays an important role in NK cell cytotoxicity (124) expressed on their surface. In the same study, a decrease in the secretion of inflammatory cytokines from cultured peripheral blood mononuclear cells (PBMC) was observed. The se findings suggest that AGE supplementation improved the natural killing capability of immune cells, while fewer inflammatory cytokines were being secreted. The purpose of this study was to extend the knowledge regarding AGE supplementation and its potent ial benefit of supporting immunity, by studying adults with obesity, many of whom also have concurrent systemic inflammation. The hypothes es of this study was that AGE supplementation would reduce obesity associated chronic inflammation in healthy, adults with obesity through a modulation of their immune system. In order to examine this, the percentage of specific populations of lymphocytes in the total PBMC population were assessed as well as concentrations of inflammatory cytokines in the serum, before a nd after the 6 week AGE intervention. T he effect of daily AGE supplementation on blood lipid was also evaluated. Study D esign and Methods Participants and Study D esign A total of 175 healthy adults with obesity who responded to public recruitment messages, were assessed for eligibility to participate in this double blind, randomized, placebo controlled clinical trial between July of 2014 and September of 2015. Of the 73 adults that met the inclusion criteria, 55 chose to enroll (Fig ure 3 1 ). All pa rticipant visits were conducted in the Clinical Nutrition Laboratory of the Food Science and Human Nutrition Building on University of Florida campus. Informed consent was obtained from all participants by trained personnel. This

PAGE 36

36 study was approved by the Institutional Review Board at the University of Florida and registered at ClinicalTrials.gov with the identifier code NCT01959646 The inclusion criteria for the study were: 25 65 years of age, WC >88 cm for women or >102 cm for men, BMI 2 be willing to discontinue other dietary supplements, and not be taking any medication for cardiovascular disease. In addition, those with blood pressure greater than 130/85 mmHg, metabolic syndrome, diabetes, arthritis, severe allergies or other immune disord ers were excluded from participating. Metabolic syndrome is defined as the presence of three or more of the following risk factors: WC >88 cm for women or >102 cm for (125) Sample Size D etermination To determine the minimum number of participants needed to detect a difference between the AGE and placebo groups in the primary outcome, T cell numbers, and secondary outcomes, inflammatory markers, a power analysis was conducted. With an alpha level of 0.05 T cells in peripheral blood of participants in the placebo group was 4.7% 2.7 and those in a previous intervention group averaged 9.9% 5.3, indicated that 15 individuals per group would be needed. To determine the number of participants needed per group to see a statistical reduction in CRP concentrati on from an average value of 3.0 mg/dL, an interquartile difference of 1.14 to 1.05 mg/dL w as applied Thirty two participants were needed for each gro up Study P rocedures To determine eligibility, height, weight, blood pressure and a finger prick blood sample were obtained. Eligible p articipants with similar BMI (difference of less than 3 kg/m 2 ) were

PAGE 37

37 matched as pairs and returned in the fasting state to the Clinical Nutrition Laboratory for a randomization visit. To ensure blinding of investigators and p articipants, capsules were supplied by Wakunaga of America Co., Ltd. (Mission Viejo, CA, USA), labeled as either A or B, and contained either AGE (0.6 g/capsule) or a placebo. A blind drawing was conducted by asking a participant to draw one out of two not es which were labeled as either A or B. If the participant was assigned to group A, the other of the pair would be assigned to group B. They were then given numbers from a randomization table provided by Wakunaga of America Co., Ltd Both participants and investigators were blinded to the intervention assignments. Venous b lood was drawn into heparinized vacuum tubes for PBMC isolation, and into serum collection tubes. Participants were given bottles of their assigned intervention, instructed to consume thre e capsules with food, twice a day for 6 weeks (3.6 g AGE/ day) and encouraged to continue their current dietary and exercise routines. After 3 weeks, participants returned bottles containing unused capsules and were given their second 3 week supply. After 6 weeks, p articipants again returned bottles containing unconsumed capsules for compliance assessment, underwent a second fasting blood draw, and completed a final questionnaire that asked about side effects experienced, consumption of other dietary supple ments and medications, any significant changes in diet or exercise, and which treatment they thought they had consumed. Anthropometric and Biochemical M easurements Height, weight, blood pressure, WC and sagittal abdominal diameter (SAD) were measured in privacy by trained researchers at the beginning and end of the intervention period. All measurements were conducted in duplicate as follows: a. height, in centimeters, using a sta diometer; b. weight, in kilograms, using a calibrated floor scale ; c. wais t circumference, in centimeters, measured at the top of the ileac crest using a tape measure; d. sagittal abdominal

PAGE 38

38 diameter, in centimeters, measured the external distance between the front of the abdomen and the small of the back at the iliac level line using an abdominal caliper. Blood was drawn from fasting subjects into heparinized vacuum tubes for PBMC isolation, and serum collection tubes. Blood b iochemical markers, including total cholesterol (TC), triglyceride (TG), low density lipoprotein cholest erol (LDL), high density lipoprotein cholesterol (HDL), non high density lipoprotein cholesterol (non HDL), and glucose (GLU), were determined using the Cholestech LDX Sy is an efficient and economical point of care te sting for cholesterol and related lipids, and blood glucose. Universal precautions such as hand washing, glove change, new lancet, etc. were utilized for every finger prick throughout the assessment. Separatio n and C ulture of PBMC To isolate PBMC, whole b lood was layered on Lympholyte H Cell Separation Media (Cedarlane Laboratories Ltd., Burlington, NC), as previously described (11). Isolated PBMC (1 10 6 ) were cultured in wells of a 24 well plate in RPMI 1640 (Cellgro; Mediatech, Herndon, VA) complete m edium (100,000 U/L penicillin; 100 mg/L streptomycin; 2 mmol/L L glutamine; 25 mmol/L HEPES), containing 10% fetal bovine serum (FBS), IL 2 (1 ng/mL), IL 15 (1 ng/mL), and PHA 2 environment at 37C. After 24 h, cell culture medium was collected for determination of inflammatory cytokine concentrations; cells were collected for measuring cell proliferation Immune Cell Distribution within the Total PBMC P opulation Flow cytometry was used to detect dif ferent types of immune cells in freshly isolated T cells (FITC 647 TCR), along with NK and NKT cells (FITC

PAGE 39

39 CD56). All antibodies were obtained from eBioscience, San Diego, CA. Cells were incubated paraformaldehyde, and run in a BD Accuri TM C6 Plus flow cytometer (Becton Dickinson, San Jose, CA) within 48 h Data wer e analyzed using FlowJo (version 10.1 ) analysis software (FlowJo, LLC., Ashland, OR). Results are presented as a percentage of the total lymphocyte population. Total GSH and C reactive P rotein Concentrations Determination Total intracellular GSH was measu red in 1 x 10 7 PBMC using a commercial GSH assay kit (Cayman, Ann Arbor, MI) according to kit directions. The CRP concentration in the serum was determined by ELISA using a human C Reactive Protein/CRP Quantikine ELISA Kit (R&D System Inc., Minneapolis, M N) according Inflammatory Cytokine Determination Concentrations of IL 6, TNF 6, TNF MIP 10 in supernatant cell culture medium were determined using a human cytokine multiplex immunoassay kit (Milliplex Map Kit, EMD Millipore Corp., Billerica, MA). The assays were performed following manufacturer directions. Statistical Analysis All statistical analyses were performed using SAS JMP, v10 (SAS Institute, Cary, NC). Descriptive statistics were used to show the demographic and anthropometric characteristics of participants. Independent t test was performed to compare the differences b etween the two groups at baseline. A one way analysis of covariance (ANCOVA) was conducted to analyze the differences in all parameters between the two groups at the end of the study while controlling

PAGE 40

40 for respective baseline values Categorical data were analyzed by using Chi squared test. Th ere were three participants with compliance of less than 80% Both, intent to treat analysi s and per protocol analysi s were performed. Significant differences were observed when those three participants were exclude d f rom the analysi s, but not intent to treat analysis Thus, data collected from those participants were not included Two additional subjects reported illnesses at the post intervention blood draw. Statistical analyses were performed both with and without th ose two participants and as no differences were observed, those data were included in all analyses. All data are presented as the mean SEM, with p < 0.05 considered significant. Results Baseline Demographic Characteristics S ubject demographics w e re examined for differences between those randomized to consume AGE or the placebo and found that the groups were comparable in age, gender distribution, anthropometric parameters and blood biochemical parameters, except for baseline TG concentration (Table 3 1). After 6 weeks of intervention, no changes were observed in blood pressure, body weight and other anthropometric measures. Self reported side effects, illnesses and related behaviors of participants throughout the study are found in Table 3 2 Although 1/3 participants from AGE group reported having side effects, all these participants still consumed the capsules as required. The primary symptom w as slight GI irritation. Intervention Compliance Based on pill counts, average compliance levels w ere 93.4% in the placebo group an d 92.2% in the AGE group (Figure 3 2 A). C ellular GSH concentrations were determined as an indirect measure for compliance. Although changes in total PBMC GSH concentrations from

PAGE 41

41 baseline were not significantly different ( p = 0.06), the concentration tended to increase in the AGE group and decrease in the placeb o group (Figure 3 2 B). Immune Cell Distribution Table 3 3 shows the proportions T, NKT and NK cells in the total PBMC population. At the end of the intervention period T cells in AGE group (p = 0.03) was significant ly higher, while the percentage of NKT cells was lower (p = 0.02) when compared with the placebo group while controlling for respective baseline measures The percentag e of NK cells remained the same Markers o f Inflammation Several serum markers of inflammation were examined before and after the intervention ( Table 3 4 ). In response to the intervention, significant differences were seen in IL 6 and TNF concentrations between the two groups. After the intervention, participants consuming AGE had lower s erum IL 6 (p = 0.04) concentration and lower serum TNF ), controlling for respective baseline values No significant differences i n CRP, leptin, and adiponectin were observed between the two groups in response to the intervention. The average concentration of CRP in the serum before the intervention was higher than normal in both the placebo (5.7 mg/dL) and AGE (4.4 mg/dL) groups. Af ter the intervention, the concentration of CRP was very similar to baseline. No significant differences were seen at either time point between the two groups (Figure 3 4 C). The m ean leptin concentration increased by 2.1 ng/mL in the placebo and by 0.8 ng/ mL in the AGE group. These changes were not significantly differ ent between the two groups (Figure 3 4 D). Adiponectin concentrations decreased in both groups, the placebo by 687.4 ng/mL and AGE by

PAGE 42

42 647.9 ng/mL, but t he decreases were not statistically differen t between the two groups (Figure 3 4 E). Concentrations of cytokines (IL 6, TNF 10) secreted by stimulated PBMC cultured for 24 h were determined pre and post intervention. No differences from baseline values were observed in eith er group at either time point ( Table 3 5 ). Clinical Parameters After six week of supplementation, b lood LDL concentrations in response to the intervention differed between the AGE and placebo groups (p = 0.05) controlling for baseline LDL concentrations In the AGE group, the average LDL concentration was 118.0 28.4 which was higher than that in the placebo group ( 107.7 31.3 ). While there was an observed decrease of both TC and non HDL in the AGE group, differences between the AGE and control groups w ere not significant for either parameter ( TC, p = 0.07; non HDL p = 0.08). Although TG concentrations were different at baseline between the two groups, there were not differences in change in TG concentration between the two groups during the intervention period (p = 0.18). There were also no significant differences in the changes of HDL and GLU concentrations between the two groups ( Table 3 6 ). Discussion In this 6 week, double blind, randomized, placebo controlled clinical study, the effects of AGE supplementation on immune cells and markers of inflammation were assessed In adults with obesity, 6 weeks of AGE supplementation was able to modulate immune cell distribution and decrease serum concentrations of IL 6 and TNF factors that play important roles in the development of obesity induced inflammation. Moreover, blood LDL concentration which often

PAGE 43

43 increase s with obesity and is a major health concern (126) was significantly lower after AGE suppleme ntation. AGE and Inflammatory Media tors During Obesity i nduced Inflammatio n Adipocytes, the major cell type present in adipose tissue, can secrete IL 6, leptin, and adiponectin. In obesity, adipocytes tend to increase in both number and size, which results in excess adipokine secretion and a pro inflammatory environment in the adi pose tissue. I t is well established that conentrations of inflammatory mediators in the serum increase in obesity, and are positively correlated with BMI and WC (16, 23, 12 7) Confirming those findings, serum CRP, IL 6, TNF in the current study were all elevated at baseline, an indication of inflammation in the obese participants. After the intervention those consuming AGE had lower serum IL 6 and TNF that AGE supplementation might help to prevent the progress of inflammation No changes in serum CRP or leptin concentrations were observed Ver y few human studies have assessed the effect that consumption of AGE or garlic associated compounds might have on CRP. A study conducted by Zeb et al. (128) showed that the consumption of a capsule containing AGE and Coenzyme Q10 for 12 months significantly decreased CRP concentration compared with a placebo. Since the capsule contained both AGE and Coenzyme Q10, the authors were una ble to attribute the anti inflammatory effect they saw to either one of the compounds. In addition, the participants in that study were all male firefighters, a very distinct population. In another study, garlic powder (2.1 g/d) was consumed by overweight participants for three months and, as what was found in this study there were no significant differences in serum CRP concentrations between the groups after the intervention (129) The effect of AGE consumption on leptin has only been studied in animals thus far. Perez Torres et al. showed that rats with metabolic

PAGE 44

44 syndrome had elevated serum leptin concentrations and that AGE returned them to control concentrations (130) However, this benefit was not seen in this study. It may be due to the differences in metabolism between humans and rats. In the obese, concentration s of anti inflammatory mediators are reduc ed and are negativ ely corre lated with BMI (131) O ne of those anti inflammatory mediators a diponectin, is secreted by adipose tissue. Ryo et al. (132) show ed that adiponectin concentration is negatively associated with the clinical phenotype of metabolic syndrome. In a study conducted by Gmez Arbelez et al. (133) AGE supplementation improved adiponectin concentration in obese adults with metabolic syndrome. I n this study, where having metabolic syndrome was exclusionary, no change i n serum adiponectin concentration was observed in either group after the 6 week intervention All p articipants in this study had relatively high concentration s of adiponectin prior to the intervention with average baseline concentration s of mo re than double th e /mL in the Gmez Arbelez study. The differences in metabolic health and initial adiponectin concentrations of participants in the current study and in that of Gomez Arbelaez, may explain the variation in the adiponectin response to AGE Cytokines secreted by cultured PBMCs were also assessed, but found not to differ between treatments. The reason is not clear, however variability among participants was apparent. AGE and Immune C ell Populations During Obesity i nduced Inflammation Similar to changes in inflammatory mediators, alterations in immune cell population T cell populations because of the low grade chronic inflammation. Human obesity is associated with a redu T cells in the peripheral blood, and the number is negatively correlated to the severity of the

PAGE 45

45 obesity (134) T cells in adipose tissue (36) T cells in peripheral blood may be T cells was observed in the blood of the healthy obese adults enrolled in this study. T cells increase in adipose tissue, NKT cells are diminished from it (135) CD3 + CD56 + NKT cells are highly enriched in liver and adipose tissue, but rare in peripheral blood, around 2%. A t the start of intervention NKT cells comprised a much higher high proportion (6.7%) of that lymphocyte population, perhaps as a result of the migration o f those cells from adipose tissue into the circulation. After supplementation with AGE, the T cells and the inhibition of in crease in the percentage of NKT cells in the circulating blood of participants indicated that AGE s upplementation had modulated their immunity. Since the participants in our study were healthy obese adults, no changes in NK cell numbers were observed consistent with results from previous studies (31, 32) AGE and Risk Factors o f Cardiovascular Diseases The cardiovascular benefits of AGE supplementation, including the anti hypertensive and cholesterol lowering effects, have been illustrated in numerous studies. Ried et al. demonstrated that AGE was effective in lowering blood pressure in patients with unc ontrolled hypertension (117) In that study, participants were asked to consume 0.96 g/day of AGE for 12 weeks, or a placebo, and blood pressure was measured at baseline, 4, 8 and 12 weeks. Participants with uncontrolled hypertension in the AGE group experienced a decrease in systolic blood pressure throughout the 12 week intervention period. In this study, all participants started with blood pressure levels of less than 130/85 mmHg, which perhaps explains why no anti hypertensive effects were observed

PAGE 46

46 As early as 1996, Steiner et al. showed that daily consumption of 7.2 g of AGE for 6 months had beneficial effects on the lipid profile of moderately hypercholesterolemic participants, with decreases in TC (7.0%) and LDL (4.6%) concentrations (136) Yeh et al. demonstrated a cholesterol lowering effect of AGE using both human and animal studies (121) In the human study, 36 hypercholesterolemic participants, with an average BMI of 25.5 kg/m 2 were asked to consume 7.2 g of AGE per day for 5 months. After the intervention, the concentration of TC had decreased by 7% and the co ncentration of LDL cholesterol had decreased by 10%. Similar results were observed in their animal study, where AGE supplementation lowered total cholesterol concentration by 15%. LDL concentration in participants that consumed AGE decreased by 5.2% in thi s study There was also a trend for TC and non HDL concentrations to decrease, indicating that AGE did improve the lipid profile of adults with obesity. Although the LDL decrease that was observed in this study was not as pronounced as that of earlier studies, this could be due to the shorter intervention period. Strength and L imitations This study has several strengths. To our knowledge, this is the first report that evaluates the effect of AGE supplementation on immune cell populations in adults with obesity induced inflammation. As obesity affects more than 600 million adults worldwide (137) identifying successful interventions to moderate the negative effects of obesity, like systemic inflammation and associated chronic diseases such as CVD, are imperative. Here, not only the response of immune cell populations was investigated but also inflammatory mediators. Participants were asked to maintain their usual diet and activity patterns, so body weight remained unchanged throughout the intervention period and was not a confounding factor. A limitation of interpreting the findings from this and previous work regarding AGE supplementation is the variance in AGE

PAGE 47

47 dose and participant characteristics. Participants in the intervention group of this study consumed 3.6 g/day of AGE for 6 weeks and were obese, without metabolic syndrome. Other investigations discussed here provided doses ranging from 0.96 g/day to adults with uncontrolled hypertension to 7.2 g/day for adults with hypercholesterole mia. Furthermore, the length of the intervention periods differs significantly among the studies. A s the intervention lasted only 6 weeks in t his study it is hard to evaluate the long term effects of AGE supplementation on inflammation and immune function in adults with obesity,. The other studies had AGE intervention periods that ranged from 12 weeks to 6 months. Given these limitations, additional immunity studies w ith longer intervention periods are warranted to determine the long term benefits of AGE consumption on the immune health of adults with obesity. Summary In summary, the changes in immune cells and inflammatory mediators show that the consumption of AGE c an produce an anti inflammatory effect in adults with obesity. However the mechanism by which AGE exerts its effect on obesity induced inflammation is still not clear. One potential mechanism may involve hydrogen sulfide (H 2 S), a recently discovered secon d messenger shown to prevent the activation of the NF attenuates the production of pro inflammatory cytokines (138, 139) The organosulfur compounds in aged garlic extract, such as SAC, have been suggested as H 2 S mediators by increasing its endogenous production (140, 141) which may drive the suppression of obesity induced inflammation. F uture studies focus ing on determining the mechanism by which AGE affects obesity induced inflammation were suggested to increase the understanding of the potential health benefits of AGE consumption.

PAGE 48

48 Table 3 1. Demographics and baseline clinical characteristics of study participants at baseline Total Placebo AGE P value Demographics n 48 24 24 N/A Age (y) 42.4 2.1 45.7 2.5 45.9 2.4 0.33 Gender ( n %) 0.76 Male 15 (31.3%) 8 (33.3%) 7 (29.2%) Female 33 (6 8. 7%) 17 (66.7%) 16 (70.8%) Blood Pressure SBP (mmHg) 121 2 122 2 121 2 0.91 DBP (mmHg) 84 2 86 3 81 2 0.17 Weight (kg) 104.0 2.8 104.1 3.5 103.8 4.3 0.94 BMI (kg/m 2 ) 36.4 0.9 36.3 1.2 36.5 1.3 0.90 WC (cm) 113.6 1.9 114.0 2.7 113.2 2.8 0.85 SAD (cm) 25.4 0.5 25.4 0.5 25.4 0.9 0.99 Clinical TC (mg/dL) 185.4 4.9 188.1 6.6 183.4 7.7 0.59 TG (mg/dL) 103.5 5.2 114.0 7.5 91.6 6.2 0.03 HDL (mg/dL) 54.3 2.4 51.9 3.1 55.8 3.4 0.42 Non HDL (mg/dL) 131.2 4.7 135.9 6.1 127.6 7.2 0.31 LDL (mg/dL) 113.4 4.5 113.1 6.0 113.9 7.1 0.93 GLU (mg/dL) 97.8 3.0 95.9 2.0 99.7 5.7 0.53 CRP (mg/dL) 5.1 0.6 4.4 0.8 5.7 0.9 0.28 Data are presented as mean SEM. Independent T test was performed to compare the differences between the two groups at baseline. SBP: systolic blood pressure; DBP: diastolic blood pressure; BMI: body mass index; WC: waist circumference; SAD: sagittal abdominal diameter; TC: total cholest erol; HDL: high density lipoprotein cholesterol; LDL: low density lipoprotein cholesterol; non HDL: non high density lipoprotein cholesterol; GLU: glucose; CRP: C reactive protein.

PAGE 49

49 Table 3 2 Other characteristics of participants Questions Placebo (n= 26) AGE (n=24) P value During the study, did you experience any side effect(s) ? 0.06 Yes 3 (11.5%) 8 (33.3%) No 23 (88.5%) 16 (66.7%) During the study, did you take a medication, any dietary supplement? 0.73 Yes 11 (42.3%) 9 (37.5%) No 15 (57.7) 15 (62.5%) During the study did your diet or exercise habits change? 0.44 Yes 4 (15.4%) 2 (8.3%) No 22 (84.6%) 22 (91.7%) Were you sick during either one of the / blood draws? 0.60 Yes 2 (7.7%) 1 (4.2%) No 24 (92.3%) 23 (95.8) Do you have allergies? 0.67 Yes 7 (26.9%) 5 (21.8%) No 19 (73.1%) 18 (78.2) Did you have a flu shot this season? 0.92 Yes 9 (34.6%) 8 (33.3%) No 17 (65.4%) 16 (66.7%) Hand washing and hygiene practices 0.16 Excellent 13 (50.0%) 7 (29.2%) Very good 11 (42.3%) 11 (45.8%) Good 2 (7.7%) 6 (25.0%) One participant didn't complete the final questionnaire. A chai squared test was performed to compare differences between the two groups.

PAGE 50

50 Table 3 3 Immune cell distribution at baseline and completion of the study Placebo AGE Baseline Week 6 Baseline Week 6 1.7 0.2 1.6 0.2 1.2 0.2 1.8 0.2 NKT% 7.5 1.1 8.7 1.3 6.5 1.2 6.5 1.1 NK% 14.1 1.2 15.1 1.4 13.3 1.2 12.6 1.1 Data are presented as the mean SD. A one way ANCOVA was performed to compared proportion of l, NKT cell and NK cell in the total PBMC between the two groups on controlling for respective baseline measures. NK: natural killer. Indicates statistically significan t difference s between the two groups at Week 6 on controlling for respective baseline values p<0.05.

PAGE 51

51 Table 3 4. Serum biomarkers at baseline and completion of the study Placebo AGE Baseline Week 6 Baseline Week 6 CRP (mg/dL) 4.4 0.8 6.2 1.4 5.7 0.9 6.5 1.1 IL 6 (pg/mL) 3.0 0.5 3.8 0.9 2.8 0.5 2.8 0.5 TNF a (pg/mL) 3.9 0.4 4.2 0.4 3.9 0.4 3.9 0.3 Leptin (ng/mL) 27.5 2.3 29.6 2.4 26.1 2.7 26.9 3.1 14.2 2.5 13.5 1.4 13.7 1.7 13.1 1.7 Data are presented as the mean SD. A one way ANCOVA was performed to compared all inflammatory mediators between the two groups on controlling for respective baseline measures. CRP: C reactive protein; IL 6: interleukin 6; TNF a: tum or necrosis factor alpha Indicates statistically significant difference s between the two groups at Week 6 on controlling for respective baseline values p<0.05.

PAGE 52

52 Table 3 5 Cytokine secreted by PBMC after 24 h stimulation of PHA L Placebo AGE Baseline Week 6 Baseline Week 6 IL 6 (pg/mL ) 5799.384.3 6971.4276.8 6082.7229.6 6687.5283.2 IL 10 (pg/mL ) 761.299.8 1452.9207.5 804.5110.0 868.689.0 MIP 1 (pg/mL ) 6544.567.7 6899.7133.0 6631.2128.5 6653.4184.1 TNF ) 1550.2214.8 2416.8334.7 1390.8192.3 1869.0255.8 Data are presented as the mean SD. A one way ANCOVA was performed to compared differences between the two groups on controlling for respective baseline measures. IL 6: interleukin 6; IL 10: interleukin 10; MIP alpha : TNF a: t umor necrosis factor alpha.

PAGE 53

53 Table 3 6 Blood lipids and glucose of participants at the baseline and completion of the study Placebo AGE Baseline Week 6 Baseline Week 6 TC (mg/dL ) TG (mg/dL) HDL (mg/dL) non HDL (mg/dL) LDL (mg/dL) GLU (mg/dL) Data are presented as the mean SD. A one way ANCOVA was performed to compared clinical characteristics between the two groups on controlling for respective baseline measures. TC: total cholesterol; TG: triglycerides; HDL: high density lipoprotein cholesterol; non HDL: non high density lipoprotein cholesterol; LDL: low density lipoprotein cholesterol; GLU: glucose. Indicates statistically significant difference s between the two groups at Week 6 on controlling for respective baseline values p<0.05.

PAGE 54

54 Figure 3 1 Overall flow of participants assessed for eligibility, enrolled in the AGE study, randomized to different treatments and analyzed statistically.

PAGE 55

55 Figure 3 2 Participant compliance. A: Percentage of aged garlic extract (AGE) and placebo capsules consumed by participants during the 6 week study. B: Change from baseline of GSH concentrations in 1 10 7 peripheral blood mononuclear cells (PBMC) Intracellular GSH tended to increase in AGE group, but did not reach statistical significance.

PAGE 56

56 CHAPTER 4 ORAL SUPPLEMENTATION WITH 500 mg GSH DOES NOT MODIFY OBESITY INDUCED INFLAMMATION IN OLDER ADULTS : A RANDOMIZED, DOUBLE BLIND, PLACEBO CONTROLLED CLINICAL TRIAL Introduction GSH is a tripeptide, which can eliminate ROS through directly reacting or the reaction is catalyzed by three members of GSH peroxidase family and peroxiredoxin 6 (142) I ntracellular GSH is reduced in aged individuals (143) The most important consequence of a low GSH concentration is compromised immune function. The human immune system requires GSH for two reasons (144) Since the immune system produces free radicals to kill pathogens, GSH can protect host immune cells with its an tioxidant mechanism. Lymphocytes, cells of the immune system, are dependent on adequate GSH level; T cell proliferation and cytotoxic NK cell activity are functions that are impaired under low GSH conditions (145, 146) On the other hand, all forms of GSH are also diminished in individuals with obesity (6) which might link to the development of obesity ind uced inflammation, leading to obesity associated chronic diseases. ROS plays an important role in the development of inflammation through activating NF B and MAPK activation (5, 147) which can up regulate the production of inflammatory cytokines. Without enough GSH to eliminate extra ROS produced in the body, those pathways are chronically activated and constantly promote secretion of inflammatory cytokines and chemokines. Thus, old er adults with obesity are at higher risk of obesity related complications. If the G SH concentration in this population can be replenished, the obesity induced inflammation may be reduced. The first step, replenishment of GSH with oral supplementation, was demonstrated successfully in a randomized controlled trial conducted by Richie et a l. (116) Here, oral suppleme ntation with GSH can increase GSH concentration in plasma, red blood cell and

PAGE 57

57 lymphocytes. The purpose of this randomized double blind placebo controlled study is to test the hypothesis that consuming a GSH supplementation for 4 months will improve immune function and decrease the low grade inflammation in old er adults with obesity. The supplement used in this study is Setria GSH which is a highly absorbable form of L GSH supplement produced through using a proprietary fermentation process. Study Design and Methods Study Design and Participants This is a secondary analysis of p articipants that were enrolled in the GSH study (Oral GSH Supplementation in Older Healthy Adults and its Effect on the Number of Healthy Days Experienced during Four Months of Supplementation Compared to Placebo). A total of 315 healthy older adults were assessed for eligibility to participate in this double bl ind, randomized, placebo controlled clinical trial between December of 2015 and June of 2016. Of the 124 adults that met the inclusion criteria, 114 agreed to participa te and received allocation (Figure 4 1 ). All participant visits were conducted in the Cl inical Nutrition Laboratory of the Food Science and Human Nutrition Building on University of Florida campus. This study was approved by the Institutional Review Board at the University of Florida The inclusion criteria for the study were: 50 75 years o f age, had at least one cold in the past year, be willing to discontinue using dietary supplements and probiotics. Individuals with a compromised immune system, including diabetes, arthritis, HIV/AIDS, severe allergies, hepatitis, cancer and autoimmunity w ere excluded. Sample S ize D etermination To determine the minimum number of participants needed to detect a difference between the GSH and placebo groups in primary outcome, healthy days experienced during the flu

PAGE 58

58 season, a power analysis was conducted. Ba sed on an expected difference of 0.7 healthy days experienced during the flu season, 56 individuals per group would be needed with an alpha level of 0.05 and a power of 0.80. Study P rocedure Eligible participants were scheduled a visit to the Clinical Nut rition Laboratory to obtain their consent for participation, undergo anthropometric and blood pressure measurements and complete two dietary screener questionnaires. Then, participants were asked to return for a blood draw and receive their randomization b envelope. Venous b lood was drawn into heparinized vacuum tubes for PBMC isolation, and into serum collection tubes. Participants were then given bottles of their assigned intervention, instructed to c onsume 2 capsules with food every morning for 4 months (500mg/day) and encouraged to continue their current dietary and exercise routines. To ensure blinding of investigators and participants, capsules were supplied by Kyowa Hakko Bio Co., Ltd (T okyo, Japan ), labeled as either A or B, and contained either Setria GSH (250mg/capsule) or a placebo. After 2 months, participants returned bottles containing unused capsul es and were given their second 2 month supply. Participants were also asked to complete a one page questionnaire. After 4 months, p articipants again returned bottles containing unconsumed capsules for compliance assessment, underwent a second fasting blood draw, and completed two dietary screener questionnaires and a final questionnaire that a sked about side effects experienced, consumption of other dietary supplements and medications, any significant changes in diet or exercise, and which treatment they thought they had consumed.

PAGE 59

59 Anthropometric and Biochemical M easurements Height, weight, blood pressure, WC and SAD were measured in privacy by trained researchers at the beginning and end of the intervention period. All measurements were taken in duplicate as described previously. Blood was drawn from fasting subjects into heparinized vacuum tubes for PBMC isolation, and serum collection tubes. Blood biochemical markers, including TC TG LDL HDL non HDL and GLU were determined using the Cholestech glove c hange, and new lancet, etc. were utilized for every finger prick throughout the assessment. Separation and C ulture of PBMC To isolate PBMC, whole blood was layered on Lympholyte H Cell Separation Media (Cedarlane Laboratories Ltd., Burlington, NC, USA), as previously described (10). Isolated PBMC (1 10 6 ) were cultured in wells of 24 well plates in RPMI 1640 (Cellgro; Mediatech, Herndon, VA, USA) complete medium (100 U/mL penicillin; 100 g/mL streptomycin; 2 mM L glutamine; 25mM HEPES), containing 10% autologous serum, IL 2 (1 ng/mL), IL 15 (1 2 environment at 37C. After 24 h, cell culture medium was collected for determination of infl ammatory cytokine concentrations. Immune Cell D ist ribution within the Total PBMC P opulation Flow cytometry was used to detect different types of immune cells in freshly isolated T cells (PE Cy 7 CD3, PE TCR), and NK and NKT cells (PE Cy 7 antibodies were obtained from eBioscience, San Diego, CA, USA. Cells were incubated with

PAGE 60

60 paraformaldehyde, and run through a BD Accuri TM C6 Plus flow cytometer (Becton Dickinson, San Jose, CA, USA) within 48 hours. Data were analyzed using FlowJo (version 10.1 ) analysis software (FlowJo, LLC., Ashland, OR, USA). Results are presented as a per centage of the total lymphocyte population. Total GSH Total intracellular GSH was measured in 1 x 10 7 PBMC using a commercial GSH assay kit (Cayman, Ann Arbor, MI, USA) following kit directions. Inflammatory Cytokine Deter mination IL 6, TNF and IL 10 in supernatant cell culture medium were determined using human cytokine multiplex immunoassay kits (Milliplex Map Kit, EMD Millipore Corp., Statistical Analysis All statistical analyses were performed using SAS JMP, v10 (SAS Institute, Cary, NC, USA). For this analysis, participants with obesity were separated from those without. Thus, all participants were divided into four groups, non obese control group (NC), obese control group (OC), non obese GSH group (NG) and obese GSH group (OG). Descriptive statistics were used to show the demographic and anthropometric characteristics of participants. One way analysis of variance ( ANOVA ) and Student Newman Keuls multiple comparison post hoc tests were used to analyze the differences of changes in all parameters from baseline, calculated as post minus pre intervention, among the four groups. There were four participants with compliance of less than 80%. Statistical analys es were performed both with and without those four data sets and, as

PAGE 61

61 no differences were observed, those data were included in all analyses. All data are presented as the mean SEM, with p < 0.05 considered significant. Results Baseline Participant Demog raphic Characteristics Participant demographic characteristics w e re examined for differences among the four groups. NC and NG, OC and OG groups were comparable in age, gender distribution, anthropometric parameters and blood biochemical parameters, except for baseline TG concentration respectively (Table 4 1 ). Each group had reported similar rate of side effects, alle rgies, changes in exercise and diet and flu shot, etc. during the intervention period (Table 4 2 ). Compliance Based on pill counts, average compliance levels were 9 8.1% in NC group, 95% in OC group, 95.2% in NG group and 94.5% in OG group. (Figure 4 2 A). I ntracellular GSH concentrations in PBMC was determined as an indirect measure for compliance. However, not significant differences were observed among the four groups after the 4 month intervention, or within each group at different time point (Fig 4 2 B). Immune Cell Distribution T he average T, NKT and NK cells in the total PBMC population before and after the intervention among the four groups were not different ( Figure 4 3 ) Respiratory B urst A r espiratory burst assay was run to determine the functional re sponse of neutrophils. T he stimulation index ( ratio of reactive oxidants released by neutrophils with PMA stimulation to that without PMA stimulation ) was not different ( Figure 4 4 )

PAGE 62

62 Markers of I nflammation Concentrations of cy tokines (IL 6, TNF 10) secreted by stimulated PBMC cultured for 24 h were determined pre and post intervention. No differences from baseline values were observed in either group ( Figure 4 5 ). Clinical P arameters As expected, participants with obesity showed a high blood TG and GLU concen t r ation and low blood HDL concentration at baseline. However, those clinical parameters stayed the same after the 4 month intervention (figure 4 6 ). Discussion In this 4 month, double blind, randomized, placebo controlled clinical study, the effects of GSH supplementation on immune cells and markers of inflammation in older adults with or without obesity w e re determined As a result, 6 months of 500mg GSH supplementation did not increase intracellular GSH concentration. No intervention effects were observed on immune cell distribution, inflammatory cytokines secreted by PBMC after 24 h stimulation with PHA L, neutrophils respiratory b urst and clinical parameters. GSH Supplementation and I ntra cellular GSH A randomized controlled study conducted by Richie et al showed that oral GSH supplementation increased body stores of GSH (116) The authors provided participants with 250 mg or 1000 mg Setria GSH per day or placebo. As a result, participants taking 1000 mg per day showed an increase of total GSH in lymphocytes after 1 month of intervention Both t otal GSH in p lasma and lymphocytes inc reased after 3 month of administration However, n o changes w ere observed among participants who were provided with 250 mg GSH. In the current study, participants took 500 mg GSH for 4 months. At the end of study, GSH concentration in PBMC

PAGE 63

63 stayed the same The possible reason for the lack of change in intracellular GSH is that the dosage of 500 mg may not be enoug h, a s showed by Richie that low dose of GSH had no effect on the body stores of GSH. Another possible reason for the absence of change is GSH concetration is the differences in characteristics of participants between these two studies T he participants were older adults with half of which were obese. As mentioned previous ly both aging and obesity are related to reduced intracellular GSH concentration Oral supplementation of GSH may not be able t o correct the low GSH status in those population. GSH S upplementation and Immune Cell Populations Advanced age is associated with a decline of the functional capacity of the immune system. This likely contributes to the increased susceptibility to and se verity of infectious, cancerous, and autoimmune diseases, which characterize the elderly population. In the innate immune system, w ith increasing age, cells of the number of Langerhans cells in the skin and plasmacytoid dendritic cells declines, while the number of NK cells increases (148 150) The number of neutrophils does not change but their phagocytic function is impaired (151) An interesting change in m acrophage s is that t hey secrete less cytokines including TNF 6 in response to TLR 1/2 (15 2) In the adaptive immune system, the number of B lymphocytes is reduced because of the impaired ability to produce new B cells by hematopoietic stem cells (153) Also, the ability of B cells to produce antibodies is affected by the aging process (154) Similar to B cells, the total number of T cells is also reduced (155) However, increased expression of NK marker CD56+ has been seen in T cells, mainly CD8+ T cells, in older adult (156) T he absolute numb ers and percentages of total circulating T lymphocy tes have been shown to decrease in older adults

PAGE 64

64 (157, 158) Also, their ability to proliferate in r esponse to different stimuli such as isopentenyl pyrophosphate are impaired during aging Researchers have pointed out that the decline in number and reduction in ability to proliferate of T cells in the elderly is due to proneness to apoptosis (159) As discussed in previous chapter obesity also has detrimental impacts on immune system. The participants in the current study were older adult s with most of which are overweight. The immune system in those population may be impaired Supplementation with 500 mg GSH for 4 months may not be adequate to result in any predicted changes in this population. In addit ion, this is a secondary analysi s of participants that were recruited in the GSH study. The study was not powered to see differ ences among the four groups. Under power might be another potential cause for the lack of treatment response. Strength and L imitations To my knowledge, this is the first randomized clinical study that evaluates the effect of GSH supplementation on immune cell populations in older adults with or without obesity. Here, not only the response of immune cell populations was investigated but also neutrophil respiratory burst, inflammatory mediators secreted by PBMC One limitation of t his study is that only one dosage of GSH was used. It is hard to determine if a higher dosage w ould show any effects or not. Summary In summary, this 4 month double blind clinical study showed that supplementation of 500 mg GSH was not able to corr ect the low GSH concentration in P BMC and to modulate immune cell population in older adults. No anti inflammatory effect s were observed. However

PAGE 65

65 a higher dosage of G SH may show different results. S ince ROS plays an important role in the progression of inflammation (160) GSH as a major scavenger of ROS should be able to reduce inflammation. S studies using a higher dosage and /or younger adult s with obesity were sugge sted to investigate the effects of oral GSH supplementation on obesity induced inflammation.

PAGE 66

66 Table 4 1 Demographics and baseline clinical characteristics of study participants Total NC OC NG OG P value n 102 26 24 25 27 N/A Age (y) 59.5 0.6 59.5 1.3 60.7 1.3 59.3 1.2 58.5 1.1 0.63 Gender ( n %) 0.79 Male 41 (40.2%) 10 (38.5%) 11 (45.8%) 11 (44.0%) 9 (33.3%) Female 61 (59.8%) 16 (61.5%) 14 (54.2%) 14 (56.0%) 18 (66.7%) Blood Pressure SBP (mmHg) 130.4 1.6 123.0 3.7 136.0 2.0 126.6 3.3 136.0 3.1 0.01 DBP (mmHg) 79.3 1.0 72.5 1.9 86.0 1.5 76.1 2.0 82.9 1.7 0.00 Weight (kg) 84.0 2.1 66.9 2.1 99.3 3.3 70.3 2.4 99.6 3.3 0.00 BMI (kg/m 2 ) 29.5 0.6 24.2 0.5 34.0 0.8 24.4 0.7 35.4 0.9 0.00 WC (cm) 102.3 1.7 89.5 1.6 113.5 3.8 92.2 1.7 114.2 2.3 0.00 SAD (cm) 22.1 0.4 18.7 0.4 22.1 0.4 22.1 0.4 25.4 0.9 0.00 TC (mg/dL) 192.5 3.9 195.6 6.5 189.0 9.1 193.0 7.6 192.0 8.1 0.95 TG (mg/dL) 116.0 7.0 104.2 11.7 154.0 19.7 87.2 9.3 121.7 11.2 0.01 HDL (mg/dL) 56.7 1.7 61.2 2.8 50.3 3.7 63.3 3.9 51.5 2.5 0.01 Non HDL (mg/dL) 136.1 3.9 131.4 6.8 139.0 9.1 132.3 8.2 141.7 7.6 0.74 LDL (mg/dL) 118.5 4.2 114.7 7.2 114.4 8.7 129.9 9.8 118.1 7.8 0.61 GLU (mg/dL) 83.4 1.4 77.7 2.6 90.1 3.3 79.8 2.2 86.0 2.5 0.01 Data are presented as the mean SEM. A one way ANOVA was performed to compared difference among the four groups at the baseline. P values indicated that there were statistical differences among the four groups. SBP: systolic blood pressure; DBP: diastolic blood pressure; BMI: body mass index; WC: waist circumference; SAD: sagittal abdominal diameter; TC: total cholesterol; TG: triglycerides; HDL: high density lipoprotein cholesterol; non HDL: non high density lipoprotein cholesterol; LDL: low density lipoprotein cholesterol; GLU: glucose; CRP: C reactive protein. NC: non obese control group; OC: obese control group; NG: non obese GSH group; OG: obese GSH group.

PAGE 67

67 Table 4 2 Self reported side effects, illnesses, and related behaviors of participants throughout the intervention per iod Questions NC (n=26) OC (n=24) NG (n=24) OG (n=27) P value During the study, did you experience any side effect(s)? 0.88 Yes 2 (7.7%) 3 (12.5%) 3 (12.5%) 2 (7.4%) No 24 (92.3%) 21 (87.5%) 21 (87.5%) 25 (92.6%) During the study, did you take two study capsules every day? 0.27 Yes 25 (96.2%) 19 (79.2%) 22 (91.7%) 23 (85.2%) No 1 (3.8%) 5 (20.8%) 2 (8.3%) 4 (14.8%) During the study, have there been any changes in your diet or exercise habits? 0.90 Yes 6 (23.1%) 4 (16.7%) 4 (16.7%) 6 (26.7%) No 20 (76.9%) 20 (83.3) 20 (83.3) 21 (77.8%) Which capsules do you think you have been taking during this study? 0.50 GSH 14 (53.8%) 9 (37.5%) 14 (58.3%) 14 (51.9%) Placebo 12 (46.2%) 15 (62.5%) 10 (41.7%) 13 (48.1%) During the study, have you suffered from any allergies? 0.64 Yes 10 (38.5%) 8 (33.3%) 8 (33.3%) 7 (25.9%%) No 16 (61.5%) 16 (66.7%) 16 (66.7%) 20 (74.1%) Have you received the flu shot this season? 0.45 Yes 13 (50%) 10 (41.7%) 11 (45.8%) 17 (63.0%) No 13 (50%) 14 (58.3%) 13 (54.2%) 10 (37.0%) One participant did not complete the final questionnaire. NC: non obese control group; OC: obese control group; NG: non obese GSH group; OG: obese GSH group.

PAGE 68

68 Figure 4 1. Overall flow of participants assessed for eligibility, enrolled in the GSH study, randomized to different treatments and analyzed statistically

PAGE 69

69 Figure 4 2. Participant compliance. A: Percentage Setria GSH and placebo capsules consumed by participants during the 4 month study. B: GSH concentrations in 1 10 7 peripheral blood mononuclear cells (PBMC) among the four groups at baseline and the end of the study. NC: non obese control group; OC: obese control gro up; NG: non obese GSH group; OG: obese GSH group

PAGE 70

70 Figure 4 3. The percentage of immune cell populations in the total peripheral blood mononuclear cell among the 4 groups at baseline and the end of the study. NC: non obese control group; OC: obese control group; NG: non obese GSH group; OG: obese GSH group

PAGE 71

71 Figure 4 4. Respiratory burst assay was performed to quantify a respiratory burst response in neutrophils and monocytes by flow cytometry NC: non obese control group; OC: obese control group; NG: non obese GSH group; OG: obese GSH group.

PAGE 72

72 Figure 4 5. Cytokines secreted by PBMC after 24 h stimulation with PHA L among the 4 groups at baseline and the end of the study. NC: non obese control gr oup; OC: obese control group; NG: non obese GSH group; OG: obese GSH group; IL 6: interleukin 6; IL 10: interleukin 10; MIP a: tumor necrosis factor alpha

PAGE 73

73 Figure 4 6. Blood clinical parameters among the 4 groups at baseline and the end of the study. NC: non obese control group; OC: obese control group; NG: non obese GSH group; OG: obese GSH group. TC: total cholesterol; HDL: high density lipoprotein cholesterol; LDL: low density lipoprotein cholester ol; TG: triglyceride; non HDL: non high density lipoprotein cholesterol; GLU: glucose

PAGE 74

74 Figure 4 7. Anthropometric measurements among the 4 groups at baseline and the end of the study. NC: non obese control group; OC: obese control group; NG: non obe se GSH group; OG: obese GSH group

PAGE 75

75 CHAPTER 5 AGED GARLIC EXTRACT AND GSH REDUCE LPS INDUCED INFLAMMATION IN ADIPOCYTES THROUGH INHIBITING ACTIVATION OF NF B AND MAPK PATHWAY S Introduction Obesity remains a global health concern as it is a major risk factor for many metabolic diseases, including, type 2 diabetes, cardiovascular diseases and certain cancers (161) Recently, a chr onic low grade i nflammation in obesity, also called obesity induced inflammation, has been considered the link between obesity and obesity associated metabolic disease s (4) The cause of this obesity induced in flammation is not clear yet. E levated circulating free fatty acids (FFA s ) often found in in obesity (162) may play a role in the development of obesity induced inflammation. Evidence showed that FFA can activate the pro inflammatory NF pathway, resulting in increase d release of pro inflammatory cytokines, such as TNF IL6 and MCP 1 (163) T he possible mechanism s by which FFA s induce the chronic inflammation are displayed in Figure 5 1 As lipids accumulate in the body during obesity, FFA concentration increases in plasma This in turn induces activation of NADPH oxidase and increases production of ROS through the Toll like receptor 4 (TLR4) on the surface of cells (164, 165) ROS is a group of chemically reactive molecules derived from molecular oxygen including hydrogen peroxide (H 2 O 2 ) superoxide anion (O ) hydroxyl radical ( OH ) and singlet oxygen ( 1 O 2 ) etc. These molecules are metabolic by products generated in cells in small amount s and cleared by antioxidants When the production exceeds antioxidants capacity, it will impair normal cell structures, and may activate unexp ected signaling pathways In 1991, Schreck et al had demonstrated that H 2 O 2 can activate NF by directly adding H 2 O 2 into the cell culture media (166) Later studies showed that NF

PAGE 76

76 mechanisms in different cell type s (167 169) requi r ed for translo cation of NF (170) ROS can also activate the MAPK signaling pathway in which the three major well studied pathways are the ERK JNK and p38 kinase pathway s (171 173) Although those kinases are activated through different cascades their phosphor ylated forms activate AP1 another nuclear translational factor AP 1 is usually in the form of heterodimer of c Fos and c Jun proteins. Activation of AP 1 lead s to an increase in the expression of pro inflammatory cytokines. Given the important role that ROS plays in the development of inflammation and the results observed from the human st udies t his in vitr o study was conducted to investigate potential mechanisms underlying the anti inflammatory effects of AGE and GSH in obese or overweight adults. To elucidate this mechanism, 3T3 L1 adipocytes were used It is hypothesized that pretreatme nt of 3T3 L1 adipocytes with AGE or GSH would reduce LPS induced activation of the NF signaling pathway Materials and Methods Aged Garlic E xtract and GSH Solution Preparation A stock solution of AGE (100 mg/mL ) was prepared by dissolving a 1000mg AGE caplet (Wakunaga of America, CA, USA) overnight in 10 mL HCl at pH = 2.0 The digest ed solution was then centrifuge d at 14,000 rpm for 20mins Supernatants were collected and adjusted to a pH of 7.4 using 1M NaOH The stock solution of AGE was then sterilized using a 0.2 syringe filter and stored at 80C.

PAGE 77

77 A stock solution of GSH (10 mM) was prepared by dissolving GSH (Sigma St. Louis, MO ) in deionized water. The solution was also sterilized using a 0.2 micron syringe filter and stored at 8 0C. Cell Culture and D ifferentiation 3T3 L1 mouse fibroblast cells were obtained from the American Type Culture Collection (ATCC Rockville, MD ) cultured in (DMEM) (Cellgro, Manassas, VA) containing 4.5 g/L glucose and 584 mg/L L glutamine (Cellgro, Manassas, VA), supplemented with 10% calf serum (Hyclone, Logan, UT) and Penicillin (100 U/mL ) / Streptomycin (100 g/mL ) (Sigma, St. Louis, MO), and incubated at 37C in 5% CO 2 /95% humidified a ir The m edium was changed every 48 h until the cells reach ed confluence. Then, c ells were plated into wells of a 24 (2 x 10 4 per well) or 6 well plate (8 x 10 4 per well). Two days after confluence, differentiation of 3T3 L1 preadipocytes was initiated by using DMEM supplemented with 10% fetal bovine serum (FBS), 1. 5 g/mL insulin, 0.5 m M 3 is obutyl 1 methylxanthine and 1 M dexamethasone (differentiation medium I) for 48 h. The medium was then replaced with differentiation medium II (DMEM supplemented with 10% FBS, 1. 5 g/mL insulin) and changed every other day until the adipocytes were fully differentiated Study D esign Mature 3T3 L1 cells were pretreated with dif ferent doses of AGE (0, 2, 4, 6 and 8 mg/mL) or GSH (0, 0.5, 1, 2 and 4 m M) for 24 h, followed by 1h incubation with lipopolysaccharide (LPS) Cells were then kept in the fresh growth medium for 24 h. Supernatant were collected and stored at 80 C for determining the concentration of IL 6, TNF 1 and adiponectin

PAGE 78

78 Based on results fr om the dose response step matured 3T3 L1 cells were pretreated with the optimum dose of AGE (4mg/mL ) or GSH (1mM) for 24 h, followed by 1h incubation with LPS. Then cells were harvested for determining expression of cytokine genes by real time PCR and expression of protein s in NF signaling pathway s by western blot. Inflammatory Mediators Determ ination Multiplex immunoassay s (Luminex) were used to determine concentrations of IL 6, TNF 1 and adiponectin in cell culture supernatant. Total GSH Concentration De termination Total intracellular GSH was measured colorimetrically from 3T3 L1 cell homogenates using a commercial GSH assay kit (Cayman, Ann Arbor, MI, USA) following kit directions. RNA Extraction and Quantitative Real time PCR Cells were collected and lysed in 1mL cold RNAzol RT lysis buffer (Molecular Researc h Center, Inc., Cincinnati, OH) For analysi s cell lysates were centrifuged at 12,000 g for 5 min at 4C A nd residual lipids were removed. RNA was then isolated protocol. cDNA was synthesized using a high capacity reverse transcription kit (Applied Biosystems, Foster City, CA), and RT qPCR was performed using SYBR S elect Master Mix (Applied Biosystems, Foster City, CA) following ma curve method was used for quantitation of results. mRNA concentrations were standardized to the housekeeping gene RPL13a. Primers were designed using the NCBI Primer BLAST tool and obtained from Eur ofins Genomics, Lo uisville, KY. The sequences are shown in Table 5 1 Immunoblotting N uclear and cytoplasmic fraction of p65 were determined to investigate potential effects of AGE and GSH on the NF B pathway by western blot. N uclear and cytoplasmic fraction of

PAGE 79

79 AP1 were assessed to investigate effects of AGE and GSH on the MAPK pathway by western blot. To obtain nuclear and cytoplasmic protein from 3T3 L1 adipocytes, cells were collected from wells and centrifuged (1000 rpm, 10 min, 4C). C ell pe llets were resuspend ed L hypotonic lysis buffer L 1 Triton X was added. C ell lysate s were then centrifuged at 3 000 rpm for 10 min at 4C Supernatant was collected as cytoplasmic fraction and stored at 80C. Pellets were resu L RIPA lysis buffer and sonicated on ice for 5 sec. Nuclear suspension was incubated on ice for 30 min with vortex at 10 min intervals and then centrifuged at 14, 000 g at for 30 min at 4C. The supernatant was collected and 80C. T otal protein concentrations determined by the Bradford method. Cellular protein (40 g) from each sample was dissolved in SDS running buffer, boiled at 70C for 10 min, and loaded, in duplicate, onto a 12% Bis Tris gel (Thermo Fisher Scientific) for electr ophoresis. The gel was transferred onto a nitrocellulose membrane (Bio Rad, Hercules, CA) and blocked for 1 h in TBST blocking buffer (tris buffered saline, 0.01% Tween 20, pH 7.4) with 5% BSA Blocked membranes were washed and probed for p65, c Fos protei n (1:1000) (Cell Signaling Technologies, Danvers, MA) at 4C overnight. Following incubation with the primary antibody, membranes were washed and prob ed with anti rabbit IgG HRP (1:5 000) (Cell Signaling Technologies) for 1 h at room temperature. As loading control s lamin B1 for nuclear protein (1:5000) (ABclonal Science, Inc., Woburn, MA) and tubulin for plasmatic protein (1:5000) (Sigma) were used as the primary antibody on stripped membranes, followed by anti rabbit IgG HRP (1:5000) and goat anti mouse IgG HRP (1:5000) (Cell Signaling Technologies) for 1 h at room temperature Membrane bound antibodies were detected using an electrochemiluminescent

PAGE 80

80 detection reagent ( Bio Rad Laboratories, Inc., Hercules, CA ). Relative protein expression was determined b y densitometric analysi s (Alphaview, San Jose, CA). Statistical Analysi s All data are presented as mean S D with P<0.05 considered significant. Statistical analyses were performed using SAS JMP, v10 (SAS Institute, Cary, NC, USA). Differences in cytokine secretion, intracellular GSH concentration, and gene and protein expression levels among groups were determined by one way ANOVA with a p ost hoc LSD test Results Inflammatory Mediators Secreted b y Differentiated 3T3 L1 Cells Figure 5 2 shows concentration s of adiponectin, IL 6, MCP 1 and TNF secreted by 3T3 L1 cells at 24 h after exposure to 100ng/mL LPS LPS stimulation inhibited secretion of adiponectin, and induced secretion of IL 6 and MCP 1 and by differentiated 3T3 L1 cells. Pretreatment with AGE prevented the inhibition of LPS on adiponectin secretion but not GSH (F igure 5 2 A) As the dose of AGE increased the concentrations of adiponectin in the medium increased. Moderate dosages of AGE and GSH decreased IL 6 conce ntration compared to the positive control ( Figure 5 2 B). Pretreatment with AGE and GSH had no impact on MCP 1 secretion. (Figure 5 2 C). A v ery low concentration of TNF 3T3 L1 cells, even after LPS stimulation. mRNA Expression Levels of Cytokines i n Differentiated 3T3 L1 Cells Consist ent with protein expression ( cytokine and chemokine concentrations in medium) Real time PCR results showed that mRNA expression levels of adiponectin decreased, while IL 6 and MCP 1 i ncreased in response to LPS treatment. Expression levels of TNF increased (Figure 5 3 ).

PAGE 81

81 Compared with a positive control, AGE treatment but not GSH increased mRNA expression of adiponectin even higher than the negative control Both AGE and GSH reduced mRNA expression of IL 6 in comparison with cells treated with LPS only Pretreatment of AGE and GSH showed no effect on TNF Intracellular GSH C oncentration T he concentration of intracellular GSH was also examined LPS treatment induced the depletion of GSH in 3T3 L1 cells. GSH pre treatment prevented the decline of intracellu lar GSH, but not AGE (Figure 5 4 ). Expression L evels of AP1 and NF Expression of nuclear and cytoplasmic portion of AP1 and NF was determined by western blotting (Figure 5 5 and Figure 5 6 ). Cells pretreated with AGE and GSH inhibited LPS induced translocation of NF from the cytosol to the nucleus Discussion In this in vitro study, the effects and mechanisms of AGE and GSH on LPS induced inflammation in 3T3 L1 cells was assessed After pre treated with AGE and GSH for 24 h, 3T3 L1 cell decreased expression of IL 6 at both protein and mRNA level. Pretreatment with AGE also increased a diponectin secretion. Moreover, I demonstrated that this anti inflammatory effect of AGE and GSH was initiated by inhibiting activation of AP1 and NF AGE and GSH Prevented LPS induced I nflammation in 3T3 L1 C ells F irst ly, the anti inflammatory effects of AGE and GSH were examined As expected based on the results from the human study, AGE decreased IL 6 expression at both protein and mRNA level in 3T3 L1 cells stimu lated with LPS However, a decrease of TNF in the human study. One possible explanation is that the most TNF is secreted by activated

PAGE 82

82 macrophages in adipose tissue (174) Consistent with this, very little TNF w as secreted by differentiated 3T3 L1 cell s in this study. The concentrations of TNF n the medium were less 0.1 pg/mL ev en after LPS stimulation. Unexpected ly the mRNA e xpression levels of TNF i ncreased by 10 fold relative to control. One possible reason can be post transcriptional modification s which inhibited the translation of TNF may be utilization of TNF TNF plays multiple role s in adipocyte s including lipid metabolism, mediating insulin resistance regulating leptin production and regulating biosynthesis of plasminogen activator inhibitor (175) indicating that TNF s AGE also increased expression of adiponectin in 3T3 L1 cells. This is consistent with results from a double blind, randomized controlled trial conducted by Go mez Arbelaez et al (133) T he authors reported that AGE supplementation in creased plasma adiponectin levels in patients with metabolic syndrome although this increase of adiponectin was not observed in AGE human study due to the different characteristics of the participants AGE and GSH I nhibited A ctivation of NF and AP1 NF are the two major signaling pathways that are associated with obesity induced inflammation (176) NF was first discovered in 1986 (177) and is considered a proinflammatory signaling pathway (178) During obesity, overproduced ROS activate s NF and induce s expression of proinflammatory cytokines. GSH the most abundant endogenous scavenger of ROS i n the body, can inhibit NF (179) Liao et al. (1 80) reported that GSH also suppressed NF leading to inhibition of p65 nuclear translocation The current study evaluated the effect of two dietary supplements, AGE and GSH which could replenish GSH in the body, through NF pathways. As expected the ratio of NF in the nucleus to NF the cytosol was smaller in

PAGE 83

83 cells pretreated w ith AGE and GSH compared with those treated with LPS only indicating that fewer NF MAPK pathway is another major pathway that is associated with inflammatory responses (181) including t hree major groups of MAPK cascades, ERK1/2, JNK and p38. Studies showed that ROS could also activate the MAPK pathway (171 173) AP1, a family of transcriptional factors involved in MAPK pathway, is activated and translocated from the cytos ol to the nucleus when MAPK pathway is activated Like NF pretreatment of AGE and GSH also inhibited the translocation of AP1 from the cytosol to the nucleus Strengths and Limitations This study has certain strengths. This work extends my understanding of mechanisms observed from the human clinical studies To my knowledge, this is the first study to investigate the effect s and mechanism s of AGE and GSH on the chronic inflammation in ob esity There are also some limitations. A single cell line model was used in this study The conditions were different from those in individuals with obesity. A co culture cell model is suggested to use in the future. O nly the transcriptional factors from the NF were assessed This study did not demonstrated how AGE and GSH infl uenced the upstream activities of these pathways Summary In summary, t his in vitro study demonstrated an anti inflammatory effect of AGE and GSH The anti inflammatory effect was initiated through inhibition of the NF signaling pathways. The potential mechanism by which AGE and GSH modulate obesity induced inflammation is displayed in Figure 5 7.

PAGE 84

84 Table 5 1 Sequences of primers used for real time quantitative PCR Gene name Product size (bp) Tm Adiponectin F TCTGACGACACCAAAAGGGC R ACGTCATCTTCGGCATGACT 87 60 Il 6 F GTCCTTCCTACCCCAATTTCCA R TGGTCTTGGTCCTTAGCCAC 79 60 Tnf F ATGGCCCAGACCCTCACA R TTGCTACGACGTGGGCTACA 73 60 Mcp 1 F CCACAACCACCTCAAGCACT R AGGCATCACAGTCCGAGTCA 75 60

PAGE 85

85 Figure 5 1. Free fatty acids induce inflammation in obesity During obesity, the elevated FFA in the body induces production of ROS in the cell through TLR4. The accumulation of ROS in the cell activates NF and MAPKs signaling pathways inducing expression of inflammatory genes

PAGE 86

86 Figure 5 2. Concentrations of cytokines secreted by differentiated 3T3 L1 cells in cell culture medium. F ull differentiated, cells were pretreated with different dosage of AGE or GSH for 24 h and stimulated with 100ng/mL of LPS for 1 h. Cells were then kept in fresh growth medium for 24 h after LPS treatment. Data are presented as the mean SD

PAGE 87

87 Figure 5 3. mRNA expression levels of Adiponectin, IL 6, TNF 1genes in differentiated 3T3 L1 cells. F ull y differentiat ed cells were pretreated with 4 mg/mL AGE or 1 mM GSH for 24 h and stimulated with 100ng/mL of LPS for 1 h. Data are presented as the mean SD

PAGE 88

88 Figure 5 4. Concentrations of intracellular GSH in differentiated 3T3 L1 cells. F ully differentiated cells were pretreated with 4 mg/mL AGE or 1 mM GSH for 24 h and stimulated with 100 ng/mL of LPS for 1 h. Data are presented as the mean SD

PAGE 89

89 Figure 5 5. Expression of NF F ully differentiated cells were pretreated with 4 mg/mL AGE or 1 mM GSH for 24 h and stimulated with 100 ng/mL of LPS for 1 h. Data are presented as the mean SD

PAGE 90

90 Figure 5 6. Expression of activator protein 1 in nucleus and cytosol of 3T3L1 cells F ully differentiated cells were pretreated with 4 mg/mL AGE or 1 mM GSH for 24 h and stimulated with 100 ng/mL of LPS for 1 h. Data are presented as the mean SD

PAGE 91

91 F igure 5 7. Potential mechanism by which AGE and GSH reduces obesity induced inflammation AGE and GSH supplementation replenishes intracellular GSH concentration. The elevated GSH eliminates ROS that are accumulated in the cell during obesity through redox reaction and inhibits activation of NF pathways.

PAGE 92

92 CHAPT ER 6 CONCLUS IONS AND FUTURE WORK SUMMARY Conclusions This research project focused on investigating the effects and mechanisms of consuming sulfur containing dietary supplements on chronic inflammation in adults with obesity The rationales behind this project are as follow. Patients with obesity are often in a chronic state of low grade obesity induced inflammation. Recently, this chronic inflammation is considered a link between obesity and its related chronic diseases (4) Thus, if the inflammation in obesity was attenuated fewer complications might appear. T he key is to understand how this obesity induced inflammation occurs. The mechanisms are not clear yet. One potential origin is oxidative stress. In obesity, the elevated free fatty acid can induce production of ROS in cells by activating NADPH oxidase thr ough TLRs. GSH, the most abunda n t endogenous scavenger of ROS, is diminished in subjects with obesity (6, 7) Any strategies to replenish GSH level in the body may help to attenuate obesity induced inflammation. Given this understanding I hypothesized that consuming sulfur containing supplements would reduc e obesity induced inflammation and conducted two randomized placebo controlled clinical trial and one cell culture based experiment. The dietary supplements used are Aged Garlic E xtract (AGE) ( Wakunaga of America Co. ) and Setria GSH ( Kyowa Hakko Bio Co. ). In the human studies, six weeks of AGE (3.6 g/day) consumption modulated immune cell distribution decreased serum TNF (p = 0.04) and IL 6 (p = 0.05) concentration s and reduced blood LDL (p = 0.05) concentration in adults with obesity indicating that the consumption of AGE can produce anti inflammatory effect s in adults with obesity. In c ontras t, four months of GSH (500mg/day) consumption did not show anti inflammatory effects. The reasons can be

PAGE 93

93 insufficient dose of GSH, characteristics of participants, and under power ed statistics in the GSH study In addition, AGE also contains many other compounds including S methyl cysterine, S ethyl cysteine and S propyl cysteine and F 4 protein fraction which may counteract the inflammation through cascades other than GSH In the in vitro study, both AGE and GSH were used to pre treat differentiated adipocyte (3T3 L1) prior to stimulation of inflammation with LPS. Cells pre tre ated with AGE and GSH decreased the expression of IL 6 at both protein and mRNA level. In addition, AGE pre treatment also increased the expression of adiponectin. My further studies investigated the two major inflammatory signaling pathways AGE and GSH p re treatment inhibited translocation of NF the cytosol to the nucleus, both of which are two major transcriptional factors involved in the inflammatory signaling pathways The in vitro confirmed the anti inflammatory effect of AGE observed in the human study However, there are certain inconsistences between the human studies and the in vitro study. Unlike the AGE study, AGE pretreatment also increased expression of adiponectin in 3T3 L1 cells. The possible reason is because the participants in the human study were adults with obesity but metabolically healthy Ryo et al. demonstrated a negative association between a diponectin concentration and the clinical phenotype of metabolic syndrome (132) In a double blind, randomized contr olled trial conducted by Gomez Arbelaez et al. (133) AGE supplementation increased plasma adiponectin levels in patients with m etabolic syndrome In addition, a decrease of TNF was only seen in the human study. One possible explanation is that the most TNF is secreted by activated macrophages in adipose tissue (174) Consistent with this, very little TNF was secreted by differentiated 3T3 L1 cells in this study. Different from the single cell model, many other cells are involved i n adipose tissue, including macrophages which secret TNF The

PAGE 94

94 in vitro study also demonstrated an anti inflammatory effect of GSH which was not observed in the GSH study The insufficient dosage of GSH, the characteristics of the participants and the un derpowered statistics may account for the lack of responses in the human study. In sum mary these data suggest ed that AGE and GSH can reduce the chronic inflammation in obesity by inhibiting activation of N F although the anti inflammatory effects of GSH were not seen in the human study. T he take home message of this project is that c onsuming sulfur containing dietary supplements which support GSH production in the body may be a n effective mode to prevent the chronic low grade inflammation in obesity, therefore may reduce the risks of obesity related chronic disease Further studies should be conducted to determine optimal doses of sulfur containing dietary supplements for reducing obesity induced inflammation Strength s and Limitation s This project has several strengths. First, this project consists of both human clinical tr i a ls and in vitro studies examining both the clinical and mechanistic effects of AGE and GSH The human studies showed the anti inflammatory effects. The in vitro study confirmed those effects and extended the findings from the human studies. To my knowledge, this is the first project that investigated the effects and mechanism s of consuming sulfur containing dietary supplemen t on obesity induced inflammation. There are also certain limitations. In the AGE study, participants were instructed to take the dietary supplement for only six weeks. It is hard to evaluate the long term effects of AGE on obesity induced inflammation. In addition, only one dosage of AGE was provided for the participants which limited the appropriateness of comparison of results from the AGE study with those from previous studies, due to the variation in AGE doses. Similarly, different doses

PAGE 95

95 should be t ested in the GSH study In the in vitro study, a single cell line model was used The conditions were different from those in individuals with obesity. Moreover, only the transcriptional factors from the NF were examined This study did not demonstrated how AGE and GSH influenced these pathways in the up stream. Future Direction The human study on AGE indicated an anti inflammatory effect of AGE on obesity induced inflammation suggesting that AGE might be used as a sup porting strategy to address the social economic burden of obesity Future studies should be conducted to evaluate the long term effect of AGE supplementation. Also studies combin e AGE supplementation and weight management strategies are suggested to condu ct in the future. Although, the GSH study failed to d emonstrate the effect of GSH on the chronic inflammation in obesity. Given to the findings from the in vitro study and the roles that GSH played in the development of obesity induced inflammation a higher dose of GSH might support the anti inflammatory effect of GSH Results from t he in vitro study suggested that AGE and GSH prevented the progression through inhibiting activation of NF Due to lack of information about how AGE and GSH aff ect NF these two pathways. Also, a co culture cell model was suggested to mimic the complicated environment in the adipose tissue during obesity.

PAGE 96

96 LIST OF REFERENCES 1. Hales MC, Carroll DM, Fryar DC, and Ogden LC. Prevalence of obesity among adults and yo uth: United States, 2015 2016. NCHS data brief. 2017(288):1 8. 2. Aronson D, Bartha P, Zinder O, Kerner A, Markiewicz W, Avizohar O, et al. Obesity is the majo r determinant of elevated C reactive protein in subjects with the metabolic syndrome. International Journal of Obesity. 2004;28(5):674 9. 3. Park HS, Park JY, Yu R. Relationship of obesity and visceral adiposity with serum concentrations of CRP, TNF alpha and IL 6. Diabetes Research and Clinical Practice. 2005;69(1):29 35. 4. Saltiel AR, Olefsky JM. Inflammatory mechanisms linking obesity and metabolic disease. Journal of Clinical Investigation. 2017;127(1):1 4. 5. Buelna Chontal M, Zazueta C. Redox activat ion of Nrf2 & NF kappa B: A double end sword? Cellular Signalling. 2013;25(12):2548 57. 6. Pastore A, Ciampalini P, Tozzi G, Pecorelli L, Passarelli C, Bertini E, et al. All glutathione forms are depleted in blood of obese and type 1 diabetic children. Ped iatric Diabetes. 2012;13(3):272 7. 7. Sastre J, Pallardo FV, Llopis J, Furukawa T, Vina JR, Vina J. Glutathione depletion by hyperphagia induced obesity. Life Sciences. 1989;45(2):183 7. 8. WHO. Fact sheets: Obesity and overweight 2016 [Available from: http://www.who.int/mediacentre/factsheets/fs311/en/ 9. HSCIC. Statistics on Obesity, Physical Activity and Diet England, 2016. 2016. p. 1 40. 10. Mi Y J, Zhang B, Wang H J, Yan J, Han W, Z hao J, et al. Prevalen ce and secular trends in obesity among Chinese a dults, 1991 2011. American Journal of Preventive Medicine. 2015;49(5):661 9. 11. Finkelstein EA, Trogdon JG, Cohen JW, Dietz W. Annual medical spending attributable to obesity: payer an d service specific estimate s. Health Affairs. 2009;28(5):W822 W31. 12. Butland B, Jebb S, Kopelman P, McPherson K, Thomas S, Mardell J, et al. Foresight. Tackling obesities: future choices. Project report. Foresight Tackling obesities: future choices Proje ct report. 2007:155 pp. pp. 13. Bourn J. Tackling Obesity in England. London: National Audit Office; 2001. 14. Nicola Sturgeon RM. Prev enting overweight and obesity in Scotland: A Route Map Towards Healthy Weight. Edinburgh: The Scottish Government; 2010.

PAGE 97

97 15. Hotamisligil GS, Shargill NS, Spiegelman BM. Adipose expression of tumor necrosis factor alpha direct role in obesity linked insulin resistance. Science. 1993;259(5091):87 91. 16. Visser M, Bouter LM, McQuillan GM, Wener MH, Harris TB. Elevated C re active protein levels in overweight and obese adults. Jama Journal of the American Medical Association. 1999;282(22):2131 5. 17. Choi J, Joseph L, Pilote L. Obesity and C reactive protein in various populations: a systematic review and meta analysis. Obesi ty Reviews. 2013;14(3):232 44. 18. Festa A, D'Agostino R, Williams K, Karter AJ, Mayer Davis EJ, Tracy RP, et al. The relation of body fat mass and distribution to markers of chronic inflammation. International Journal of Obesity. 2001;25(10):1407 15. 19. Roytblat L, Rachinsky M, Fisher A, Greemberg L, Shapira Y, Doudevani A, et al. Raised interleukin 6 levels in obese patients. Obesity Research. 2000;8(9):673 5. 20. Hotamisligil GS, Arner P, Caro JF, Atkinson RL, Spiegelman BM. Increased adipose tissue exp ression of tumor necrosis factor alpha in human obesity and insulin resistance. Journal of Clinical Investigation. 1995;95(5):2409 15. 21. Marti A, Marcos A, Martinez JA. Obesity and immune function relationships. Obesity reviews : an official journal of t he International Association for the Study of Obesity. 2001;2(2):131 40. 22. Tilg H, Moschen AR. Adipocytokines: mediators linking adipose tissue, inflammation and immunity. Nature Reviews Immunology. 2006;6(10):772 83. 23. Considine RV, Sinha MK, Heiman M L, Kriauciunas A, Stephens TW, Nyce MR, et al. Serum immunoreactive leptin concentrations in normal weight and obese humans. New England Journal of Medicine. 1996;334(5):292 5. 24. Silha JV, Krsek M, Skrha JV, Sucharda P, Nyomba BLG, Murphy LJ. Plasma resi stin, adiponectin and leptin levels in lean and obese subjects: correlations with insulin resistance. European Journal of Endocrinology. 2003;149(4):331 5. 25. Yang WS, Lee WJ, Funahashi T, Tanaka S, Matsuzawa Y, Chao CL, et al. Plasma adiponectin levels i n overweight and obese Asians. Obesity Research. 2002;10(11):1104 10. 26. Curat CA, Miranville A, Sengenes C, Diehl M, Tonus C, Busse R, et al. From blood monocytes to adipose tissue resident macrophages Induction of diapedesis by human mature adipocytes Diabetes. 2004;53(5):1285 92. 27. Lumeng CN, Bodzin JL, Saltiel AR. Obesity induces a phenotypic switch in adipose tissue macrophage polarization. Journal of Clinical Investigation. 2007;117(1):175 84.

PAGE 98

98 28. Fujisaka S, Usui I, Bukhari A, Ikutani M, Oya T, Kanatani Y, et al. Regulatory Mechanisms for Adipose Tissue M1 and M2 Macrophages in Diet Induced Obese Mice. Diabetes. 2009;58(11):2574 82. 29. Lumeng CN, DeYoung SM, Bodzin JL, Saltiel AR. Increased inflammatory properties of adipose tissue macrophages recruited during diet induced obesity. Diabetes. 2007;56(1):16 23. 30. O'Shea D, Cawood TJ, O'Farrelly C, Lynch L. Natural killer cells in obesity: impaired function and increased susceptibility to the effects of cigarette sm oke. Plos One. 2010;5(1). 31. Lynch LA, O'Connell JM, Kwasnik AK, Cawood TJ, O'Farrelly C, O'Shea DB. Are natural killer cells protecting the metabolically healthy obese patient? Obesity. 2009;17(3):601 5. 32. Laue T, Wrann CD, Hoffmann Castendiek B, Pietsch D, Hbner L, Kielstein H. Altered NK cell function in obese healthy humans. BMC Obes. 2015;2:1. 33. Talukdar S, Oh DY, Bandyopadhyay G, Li DM, Xu JF, McNelis J, et al. Neutrophils mediate insulin resistance in mice fed a high fat diet through secreted elastase. Nature Medicine. 201 2;18(9):1407 +. 34. Nishimura S, Manabe I, Nagasaki M, Eto K, Yamashita H, Ohsugi M, et al. CD8(+) effector T cells contribute to macrophage recruitment and adipose tissue inflammation in obesity. Nature Medicine. 2009;15(8):914 U116. 35. Deiuliis J, Shah Z, Shah N, Needleman B, Mikami D, Narula V, et al. Visceral Adipose Inflammation in Obesity Is Associated with Critical Alterations in Tregulatory Cell Numbers. Plos One. 2011;6(1). 36. Mehta P, Nuotio Antar AM, Smith CW. gamma delta T cells promote inflam mation and insulin resistance during high fat diet induced obesity in mice. Journal of Leukocyte Biology. 2015;97(1):121 34. 37. Furukawa S, Fujita T, Shimabukuro M, Iwaki M, Yamada Y, Nakajima Y, et al. Increased oxidative stress in obesity and its impact on metabolic syndrome. Journal of Clinical Investigation. 2004;114(12):1752 61. 38. Keaney JF, Larson MG, Vasan RS, Wilson PWF, Lipinska I, Corey D, et al. Obesity and systemic oxidative stress Clinical correlates of oxidative stress in the Framingham S tudy. Arteriosclerosis Thrombosis and Vascular Biology. 2003;23(3):434 9. 39. Brownlee M. The pathobiology of diabetic complications A unifying mechanism. Diabetes. 2005;54(6):1615 25. 40. Gloire G, Legrand Poels S, Piette J. NF kappa B activation by rea ctive oxygen species: Fifteen years later. Biochemical Pharmacology. 2006;72(11):1493 505. 41. McCubrey JA, LaHair MM, Franklin RA. Reactive oxygen species induced activation of the MAP kinase signaling pathways. Antioxidants & Redox Signaling. 2006;8(9 10 ):1775 89.

PAGE 99

99 42. Israel A. The IKK co mplex, a central regul ator of NF kappa B a ctivation. Cold Spring Harbor Perspectives in Biology. 2010;2(3). 43. Lawrence T. The Nuclear Factor NF kappa B Pathway in Inflammation. Cold Spring Harbor Perspectives in Biology 2009;1(6). 44. Ando S, Catalano S. The multifactorial role of leptin in driving the breast cancer microenvironment. Nature Reviews Endocrinology. 2012;8(5):263 75. 45. Santos Alvarez J, Goberna R, Sanchez Margalet V. Human leptin stimulates proliferation and activation of human circulating monocytes. Cellular Immunology. 1999;194(1):6 11. 46. Zarkesh Esfahani H, Pockley AG, Wu ZD, Hellewell PG, Weetman AP, Ross RJM. Leptin indirectly activates human neutrophils via induction of TNF alpha. Journal of Immun ology. 2004;172(3):1809 14. 47. Wolf AM, Wolf D, Rumpold H, Enrich B, Tilg H. Adiponectin induces the anti inflammatory cytokines IL 10 and IL 1RA in human leukocytes. Biochemical and Biophysical Research Communications. 2004;323(2):630 5. 48. Yamaguchi N, Guillermo J, Argueta M, Masuhiro Y, Kagishita M, Nonaka K, et al. Adiponectin inhibits Toll like receptor family induced signaling. Febs Letters. 2005;579(30):6821 6. 49. Jackson SM, Parhami F, Xi XP, Berliner JA, Hsueh WA, Law RE, et al. Peroxisome proli ferator activated receptor activators target human endothelial cells to inhibit leukocyte endothelial cell interaction. Arteriosclerosis Thrombosis and Vascular Biology. 1999;19(9):2094 104. 50. Poynter ME, Daynes RA. Peroxisome proliferator activated rece ptor alpha activation modulates cellular redox status, represses nuclear factor kappa B signaling, and reduces inflammatory cytokine production in aging. Journal of Biological Chemistry. 1998;273(49):32833 41. 51. Takano H, Nagai T, Asakawa M, Toyozaki T, Oka T, Komuro I, et al. Peroxisome proliferator activated receptor activators inhibit lipopolysaccharide induced turner necrosis factor alpha expression in neonatal rat cardiac myocytes. Circulation Research. 2000;87(7):596 602. 52. Gregor MF, Hotamisligil GS. Inflammatory Mechanisms in Obesity. Annual Review of Immunology. 2011;29:415 45. 53. Deng J, Lu PD, Zhang YH, Scheuner D, Kaufman RJ, Sonenberg N, et al. Translational repression mediates activation of nuclear factor kappa B by phosphorylated translat ion initiation factor 2. Molecular and Cellular Biology. 2004;24(23):10161 8.

PAGE 100

100 54. Hu P, Han Z, Couvillon AD, Kaufman RJ, Exton JH. Autocrine tumor necrosis factor alpha links endoplasmic reticulum stress to the membrane death receptor pathway through IRE1 alpha mediated NF kappa B activation and down regulation of TRAF2 expression. Molecular and Cellular Biology. 2006;26(8):3071 84. 55. Urano F, Wang XZ, Bertolotti A, Zhang YH, Chung P, Harding HP, et al. Coupling of stress in the ER to activation of JNK p rotein kinases by transmembrane protein kinase IRE1. Science. 2000;287(5453):664 6. 56. Kaneko M, Niinuma Y, Nomura Y. Activation signal of nuclear factor kappa B in response to endoplasmic reticulum stress is transduced via IRE1 and tumor necrosis factor receptor associated factor 2. Biological & Pharmaceutical Bulletin. 2003;26(7):931 5. 57. Yamazaki H, Hiramatsu N, Hayakawa K, Tagawa Y, Okamura M, Ogata R, et al. Activation of the Akt NF kappa B Pathway by Subtilase Cytotoxin through the ATF6 Branch of t he Unfolded Protein Response. Journal of Immunology. 2009;183(2):1480 7. 58. Sharma NK, Das SK, Mondal AK, Hackney OG, Chu WS, Kern PA, et al. Endoplasmic reticulum stress markers are associated with obesity in nondiabetic subje cts. Journal of Clinical Endocrinology & Metabolism. 2008;93(11):4532 41. 59. WHO. The world health report 2002 Reducing risks, promoting healthy life. 2002. 60. Lauby Secretan B, Scoccianti C, Loomis D, Grosse Y, Bianchini F, Straif K, et al. Body fatness and can cer Viewpoin t of the IARC working gro up. New England Journal of Medicine. 2016;375(8):794 8. 61. Xu HY, Barnes GT, Yang Q, Tan Q, Yang DS, Chou CJ, et al. Chronic inflammation in fat plays a crucial role in the development of obesity related insulin resistance. Journa l of Clinical Investigation. 2003;112(12):1821 30. 62. Kahn SE. The relative contributions of insulin resistance and beta cell dysfunction to the pathophysiology of Type 2 diabetes. Diabetologia. 2003;46(1):3 19. 63. Gual P, Le Marchand Brustel Y, Tanti JF Positive and negative regulation of insulin signaling through IRS 1 phosphorylation. Biochimie. 2005;87(1):99 109. 64. Kanai F, Ito K, Todaka M, Hayashi H, Kamohara S, Ishii K, et al. Insulin stimulated GLUT 4 translocation is releva nt to the phosphorylation of IRA 1 and the activity of PI3 KINASE. Biochemical and Biophysical Research Communications. 1993;195(2):762 8. 65. Schenk S, Saberi M, Olefsky JM. Insulin sensitivity: modulation by nutrients and inflammation. Journal of Clinical Investig ation. 2008;118(9):2992 3002. 66. Kern PA, Saghizadeh M, Ong JM, Bosch RJ, Deem R, Simsolo RB. The expression of tumor necrosis factor in human adipose tissue regulation by obesity, weight loss, and relationship to lipoprotein lipase. Journal of Clinical Investigation. 1995;95(5):2111 9.

PAGE 101

101 67. Uysal KT, Wiesbrock SM, Marino MW, Hotamisligil GS. Protection from obesity induced insulin resistance in mice lacking TNF alpha function. Nature. 1997;389(6651):610 4. 68. He JY, Usui I, Ishizuka K, Kanatani Y, Hirat ani K, Iwata M, et al. Interleukin 1 alpha inhibits insulin signaling with phosphorylating insulin receptor substrate 1 on serine residues in 3T3 L1 adipocytes. Molecular Endocrinology. 2006;20(1):114 24. 69. Spranger J, Kroke A, Mohlig M, Hoffmann K, Berg mann MM, Ristow M, et al. Inflammatory cytokines and the risk to develop type 2 diabetes Results of the prospective population based European Prospective Investigation into Cancer and Nutrition (EPIC) Potsdam study. Diabetes. 2003;52(3):812 7. 70. Ruge T Lockton JA, Renstrom F, Lystig T, Sukonina V, Svensson MK, et al. Acute hyperinsulinemia raises plasma interleukin 6 in both nondiabetic and type 2 diabetes mellitus subjects, and this effect is inversely associated with body mass index. Metabolism Clini cal and Experimental. 2009;58(6):860 6. 71. Verschuren L, Kooistra T, Bernhagen J, Voshol PJ, Ouwens DM, van Erk M, et al. MIF Deficiency Reduces Chronic Inflammation in White Adipose Tissue and Impairs the Development of Insulin Resistance, Glucose Intole rance, and Associated Atherosclerotic Disease. Circulation Research. 2009;105(1):99 U275. 72. Hubert HB, Feinleib M, McNamara PM, Castelli WP. Obesity as an independent risk facto r for cardiovascular disease A 26 year follow up of participants in the fra mingham heart study. Circulation. 1983;67(5):968 77. 73. Rimm EB, Stampfer MJ, Giovannucci E, Ascherio A, Spiegelman D, Colditz GA, et al. Body size and fat distribution as predictors of coronary heart disease among middle aged and older us men. American J ournal of Epidemiology. 1995;141(12):1117 27. 74. Manson JAE, Colditz GA, Stampfer MJ, Willett WC, Rosner B, Monson RR, et al. A prospective study of obesity and risk of coronary heart disease in women New England Journal of Medicine. 1990;322(13):882 9. 75. Kenchaiah S, Evans JC, Levy D, Wilson PWF, Benjamin EJ, Larson MG, et al. Obesity and the risk of heart failure. New England Journal of Medicine. 2002;347(5):305 13. 76. Libby P. Inflammation and cardiovascular disease mechanisms. American Journal of C linical Nutrition. 2006;83(2):456S 60S. 77. Wang Z, Nakayama T. Inflammation, a Link between Obesity and Cardiovascular Disease. Mediators of Inflammation. 2010. 78. Weisberg SP, McCann D, Desai M, Rosenbaum M, Leibel RL, Ferrante AW. Obesity is associated with macrophage accumulation in adipose tissue. Journal of Clinical Investigation. 2003;112(12):1796 808.

PAGE 102

102 79. Cybulsky MI, Gimbrone MA. Endothelial expression of a mononuclear leukocyte adhesion molecule during atherogenesis. Science. 1991;251(4995):788 9 1. 80. Versari D, Daghini E, Virdis A, Ghiadoni L, Taddei S. Endothelia l dysfunction as a target for prevention of cardiovascular dise ase. Diabetes Care. 2009;32:S314 S21. 81. Ma YL, Yang YZ, Wang F, Zhang P, Shi CZ, Zou Y, et al. Obesity and risk of color ectal canc er: A systematic review of prospective st udies. Plos One. 2013;8(1). 82. Chen Y, Wang XL, Wang JH, Yan ZP, Luo JJ. Excess body weight and the risk of primary liver cancer: An updated meta analysis of prospective studies. European Journal of Cance r. 2012;48(14):2137 45. 83. Balkwill F, Mantovani A. Inflammation and cancer: back to Virchow? Lancet. 2001;357(9255):539 45. 84. Wu Y, Zhou BP. TNF alpha/NF kappa B/Snail pathway in cancer cell migration and invasion. British Journal of Cancer. 2010;102(4 ):639 44. 85. Yan B, Wang HL, Rabbani ZN, Zhao YL, Li WR, Yuan YQ, et al. Tumor necrosis factor alpha is a potent endogenous mutagen that promotes cellular transformation. Cancer Research. 2006;66(24):11565 70. 86. Jaiswal M, LaRusso NF, Burgart LJ, Gores GJ. Inflammatory cytokines induce DNA damage and inhibit DNA repair in cholangiocarcinoma cells by a nitric oxide dependent mechanism. Cancer Research. 2000;60(1):184 90. 87. Hudson JD, Shoaibi MA, Maestro R, Carnero A, Hannon GJ, Beach DH. A proinflammato ry cytokine inhibits p53 tumor suppressor activity. Journal of Experimental Medicine. 1999;190(10):1375 82. 88. Tricot G. New insights into role of microenvironment in multiple myeloma. Lancet. 2000;355(9200):248 50. 89. Kasapis C, Thompson PD. The effects of physical activity on serum C reactive protein and inflammatory markers A systematic review. Journal of the American College of Cardiology. 2005;45(10):1563 9. 90. Petersen AMW, Pedersen BK. The anti inflammatory effect of exercise. Journal of Applied Physiology. 2005;98(4):1154 62. 91. Starkie R, Ostrowski SR, Jauffred S, Febbraio M, Pedersen BK. Exercise and IL 6 infusion inhibit endotoxin induced TNF alpha production in humans. Faseb Journal. 2003;17(3):884 +. 92. Smith JK, Dykes R, Douglas JE, Kris hnaswamy G, Berk S. Long term exercise and atherogenic activity of blood mononuclear cells in persons at risk of developing ischemic heart disease. Jama Journal of the American Medical Association. 1999;281(18):1722 7.

PAGE 103

103 93. Meilhac O, Ramachandran S, Chiang K, Santanam N, Parthasarathy S. Role of arterial wall antioxidant defense in beneficial effects of exercise on atherosclerosis in mice. Arteriosclerosis Thrombosis and Vascular Biology. 2001;21(10):1681 8. 94. Kriketos AD, Gan SK, Poynten AM, Furler SM, C hisholm DJ, Campbell LV. Exercise increases adiponectin levels and insulin sensitivity in humans. Diabetes Care. 2004;27(2):629 30. 95. Simpson KA, Singh MAF. Effects of exercise on adiponectin: A systematic review. Obesity. 2008;16(2):241 56. 96. de Oliveira VN, Bessa A, Jorge M, Oliveira RJD, de Mello MT, De Agostini GG, et al. The effect of different training programs on antioxidant status, oxidative stress, and metabolic control in type 2 diabetes. Applied Physiology Nutrition and Metabolism Physio logie Appliquee Nutrition Et Metabolisme. 2012;37(2):334 44. 97. Williamson RT. On the treatment of glycosuria and diabetes mellitus with sodium salicylate. British Medical Journal. 1901;1901:760 2. 98. Kim JK, Kim YJ, Fillmore JJ, Chen Y, Moore I, Lee JS, et al. Prevention of fat induced insulin resistance by salicylate. Journal of Clinical Investigation. 2001;108(3):437 46. 99. Yuan MS, Konstantopoulos N, Lee JS, Hansen L, Li ZW, Karin M, et al. Reversal of obesity and diet induced insulin resistance wit h salicylates or targeted disruption of IKK beta. Science. 2001;293(5535):1673 7. 100. Hundal RS, Petersen KF, Mayerson AB, Randhawa PS, Inzucchi S, Shoelson SE, et al. Mechanism by which high dose aspirin improves glucose metabolism in type 2 diabetes. Jo urnal of Clinical Investigation. 2002;109(10):1321 6. 101. Dominguez H, Storgaard H, Rask Madsen C, Hermann TS, Ihlemann N, Nielsen DB, et al. Metabolic and vascular effects of tumor necrosis factor alpha blockade with etanercept in obese patients with typ e 2 diabetes. Journal of Vascular Research. 2005;42(6):517 25. 102. Ofei F, Hurel S, Newkirk J, Sopwith M, Taylor R. Effects of an engineered human anti TNF alpha antibody (CDP571) on insulin sensitivity and glycemic control in patients with NIDDM. Diabete s. 1996;45(7):881 5. 103. Bernstein LE, Berry J, Kim S, Canavan B, Grinspoon SK. Effects of etanercept in patients with the metabolic syndrome. Archives of Internal Medicine. 2006;166(8):902 8. 104. Stanley TL, Zanni MV, Johnsen S, Rasheed S, Makimura H, L ee H, et al. TNF alpha Antagonism with Etanercept Decreases Glucose and Increases the Proportion of High Molecular Weight Adiponectin in Obese Subjects with Features of the Metabolic Syndrome. Journal of Clinical Endocrinology & Metabolism. 2011;96(1):E146 E50.

PAGE 104

104 105. Mishra A, Chaudhary A, Sethi S. Oxidized omega 3 fatty acids inhibit NF kappa B activation via a PPAR alpha dependent pathway. Arteriosclerosis Thrombosis and Vascular Biology. 2004;24(9):1621 7. 106. Weldon SM, Mullen AC, Loscher CE, Hurley LA, Roche HM. Docosahexaenoic acid induces an anti inflammatory profile in lipopolysaccharide stimulated human THP 1 macrophages more effectively than eicosapentaenoic acid. Journal of Nutritional Biochemistry. 2007;18(4):250 8. 107. Xi S, Cohen D, Barve S, C hen LH. Fish oil suppressed cytokines and nuclear factor kappaB induced by murine AIDS virus infection. Nutrition Research. 2001;21(6):865 78. 108. Caughey GE, Mantzioris E, Gibson RA, Cleland LG, James MJ. The effect on human tumor necrosis factor alpha a nd interleukin 1 beta production of diets enriched in n 3 fatty acids from vegetable oil or fish oil. American Journal of Clinical Nutrition. 1996;63(1):116 22. 109. Kelley DS, Taylor PC, Nelson GJ, Schmidt PC, Ferretti A, Erickson KL, et al. Docosahexaeno ic acid ingestion inhibits natural killer cell activity and production of inflammatory mediators in young healthy men. Lipids. 1999;34(4):317 24. 110. Trebble TM, Wootton SA, Miles EA, Mullee M, Arden NK, Ballinger AB, et al. Prostaglandin E 2 production a nd T cell function after fish oil supplementation: response to antioxidant cosupplementation. American Journal of Clinical Nutrition. 2003;78(3):376 82. 111. Gomez Zorita S, Fernandez Quintela A, Lasa A, Hijona E, Bujanda L, Portillo MP. Effects of resvera trol on obesity related inflammation markers in adipose tissue of genetically obese rats. Nutrition. 2013;29(11 12):1374 80. 112. Wang B, Sun J, Li XH, Zhou QQ, Bai J, Shi YH, et al. Resveratrol prevents suppression of regulatory T cell production, oxidati ve stress, and inflammation of mice prone or resistant to high fat diet induced obesity. Nutrition Research. 2013;33(11):971 81. 113. Guo R, Liu BX, Wang K, Zhou SP, Li WM, Xu YW. Resveratrol ameliorates diabetic vascular inflammation and macrophage infilt ration in db/db mice by inhibiting the NF kappa B pathway. Diabetes & Vascular Disease Research. 2014;11(2):92 102. 114. Makki K, Froguel P, Wolowczuk I. Adipose tissue in obesity related inflammation and insulin resistance: cells, cytokines, and chemokines. ISRN inflammation. 2013;2013:139239 115. Nantz MIP, Rowe CA, Muller CE, Creasy RA, Stanilka JM, Percival SS. Supplementation with aged garlic extract improves both NK and gamma delta T cell function and reduces the severity of cold and flu sy mptoms: A randomized, double blind, placebo controlled nutrition intervention. Clinical Nutrition. 2012;31(3):337 44. 116. Richie JP, Jr., Nichenametla S, Neidig W, Calcagnotto A, Haley JS, Schell TD, et al. Randomized controlled trial of oral glutathione supplementation on body stores of glutathione. European Journal of Nutrition. 2015;54(2):251 63.

PAGE 105

105 117. Ried K, Frank OR, Stocks NP. Aged garlic extract lowers blood pressure in patients with treated but uncontrolled hypertension: A randomised controlled tri al. Maturitas. 2010;67(2):144 50. 118. Ried K, Frank OR, Stocks NP. Aged garlic extract reduces blood pressure in hypertensives: a dose response trial. European Journal of Clinical Nutrition. 2013;67(1):64 70. 119. Aguilera P, Chanez Cardenas ME, Ortiz Pla ta A, Leon Aparicio D, Barrera D, Espinoza Rojo M, et al. Aged garlic extract delays the appearance of infarct area in a cerebral ischemia model, an effect likely conditioned by the cellular antioxidant systems. Phytomedicine. 2010;17(3 4):241 7. 120. Cemi l B, Gokce EC, Erdamar H, Karabork A, Onur O, Okcu AH, et al. Effects of the aged garlic extract on spinal cord injury model in rat. Ulusal Travma Ve Acil Cerrahi Dergisi Turkish Journal of Trauma & Emergency Surgery. 2012;18(6):463 8. 121. Yeh YY, Liu LJ. Cholesterol lowering effect of garlic extracts and organosulfur compounds: Human and animal studies. Journal of Nutrition. 2001;131(3):989S 93S. 122. Ishikawa H, Saeki T, Otani T, Suzuki T, Shimozuma K, Nishino H, et al. Aged garlic extract prevents a dec line of NK cell number and activity in patients with advanced cancer. Journal of Nutrition. 2006;136(3):816S 20S. 123. Tabari MA, Ebrahimpour S. Effect of aged garlic extract on immune responses to experimental fibrosarcoma tumor in BALB/c mice. Indian jou rnal of cancer. 2014;51(4):609 13. 124. Jamieson AM, Diefenbach A, McMahon CW, Xiong N, Carlyle JR, Raulet DH. The role of the NKG2D immunoreceptor in immune cell activation and natural killing. Immunity. 2002;17(1):19 29. 125. Alberti K, Eckel RH, Grundy SM, Zimmet PZ, Cleeman JI, Donato KA, et al. Harm onizing the Metabolic Syndrome a joint interim s tatement of the International Diabetes Federation Task Force on Epidemiology and Prevention; National Heart, Lung, and Blood Institute; American Heart Associat ion; World Heart Federation; International Atherosclerosis Society; and International Association for the Study of Obesity. Circulation. 2009;120(16):1640 5. 126. K esaniemi Y G rundy S. Increased low density lipoprotein production associated with obesity. Arteriosclerosis. 1983;3(2):170 7. 127. Kim CS, Park HS, Kawada T, Kim JH, Lim D, Hubbard NE, et al. Circulating levels of MCP 1 and IL 8 are elevated in human obese subjects and associated with obesity related parameters. International Journal of Obesity. 2006;30(9):1347 55. 12 8. Irfan Zeb NA, Khurram Nasir Jigar Kadakia Vahid Nabavi Larijani Ferdinand Flores, Dong Li and Matthew J Budoff. Aged garlic extract and coenzyme Q10 have favorable effect on inflammatory markers and coronary atherosclerosis p rogression: A randomized clinical trial. J Cardiovasc Dis Res. 2012;3(3):6.

PAGE 106

106 129. van Doorn MBA, Santo SME, Meijer P, Kamerling IM, Schoemaker RC, Dirsch V, et al. Effect of garlic powder on C reactive protein and plasma lipids in overweight and smoking sub jects. American Journal of Clinical Nutrition. 2006;84(6):1324 9. 130. Perez Torres I, Torres Narvaez JC, Pedraza Chaverri J, Rubio Ruiz ME, Diaz Diaz E, Del Valle Mondragon L, et al. Effect o f the aged garlic extract on cardiovascular function in metabolic syndrome rat s. Molecules. 2016;21(11). 131. Manigrasso MR, Ferroni P, Santilli F, Taraborelli T, Guagnano MT, Michetti N, et al. Association between circulating adiponectin and interleukin 10 levels in android obesity: Effects of weight loss. Jou rnal of Clinical Endocrinology & Metabolism. 2005;90(10):5876 9. 132. Ryo M, Nakamura T, Kihara S, Kumada M, Shibazaki S, Takahashi M, et al. Adiponectin as a biomarker of the metabolic syndrome. Circulation Journal. 2004;68(11):975 81. 133. Gomez Arbelaez D, Lahera V, Oubina P, Valero Munoz M, de las Her as N, Rodriguez Y, et al. Aged garlic e xtract improves adiponectin levels in subjects with metabolic syndrome: A double blind, placebo controlled, randomized, crossover study Mediators of Inflammation. 201 3. 134. Costanzo AE, Taylor KR, Dutt S, Han PP, Fujioka K, Jameson JM. Obesity impairs gamma delta T Cell h omeos tasis and antiviral function in h umans. Plos One. 2015;10(3). 135. Lynch L, O'Shea D, Winter DC, Geoghegan J, Doherty DG, O'Farrelly C. Invarian t NKT cells and CD1d(+) cells amass in human omentum and are depleted in patients with cancer and obesity. European Journal of Immunology. 2009;39(7):1893 901. 136. Steiner M, Khan AH, Holbert D, Lin RIS. A double blind crossover study in moderately hyperc holesterolemic men that compared the effect of aged garlic extract and placebo administration on blood lipids. American Journal of Clinical Nutrition. 1996;64(6):866 70. 137. Arroyo Johnson C, Mincey KD. Obesity epidemiology w orldwide. Gastroenterology Cli nics of North America. 2016;45(4):571 +. 138. Ha CZ, Tian SQ, Sun K, Wang DW, Lv JT, Wang YH. Hydrogen sulfide attenuates IL 1 beta induced inflammatory signaling and dysfunction of osteoarthritic chondrocytes. International Journal of Molecular Medicine. 2015;35(6):1657 66. 139. Rios ECS, Szczesny B, Soriano FG, Olah G, Szabo C. Hydrogen sulfide attenuates cytokine production through the modulation of chromatin remodeling. International Journal of Molecular Medicine. 2015;35(6):1741 6. 140. Gu X, Zhu YZ. T herapeutic applications of organosulfur compounds as novel hydrogen sulfide donors and/or mediators. Expert Rev Clin Pharmacol. 2011;4(1):123 33.

PAGE 107

107 141. Chuah SC, Moore PK, Zhu YZ. S allylcysteine mediates cardioprotection in an acute myocardial infarction r at model via a hydrogen sulfide mediated pathway. Am J Physiol Heart Circ Physiol. 2007;293(5):H2693 701. 142. Forman HJ, Zhang H, Rinna A. Glutathione: Overview of its protective roles, measurement, and biosynthesis. Molecular Aspects of Medicine. 2009;30(1 2):1 12. 143. Furukawa T, Meydani SN, Blumberg JB. Reversal of age associated decline in immune responsiveness by dietary glutathione supplementation in mice. Mechanisms of Ageing and Development. 1987;38(2):107 17. 144. Droge W, Breitkreutz R. G lutathione and immune function. Proceedings of the Nutrition Society. 2000;59(4):595 600. 145. Venketaraman V, Millman A, Salman M, Swaminathan S, Goetz M, Lardizabal A, et al. Glutathione levels and immune responses in tuberculosis patients. Microbial Pat hogenesis. 2008;44(3):255 61. 146. Morris D, Khurasany M, Nguyen T, Kim J, Guilford F, Mehta R, et al. Glutathione and infection. Biochimica Et Biophysica Acta General Subjects. 2013;1830(5):3329 49. 147. Kim HS, Ullevig SL, Zamora D, Lee CF, Asmis R. Redo x regulation of MAPK phosphatase 1 controls monocyte migration and macrophage recruitment. Proceedings of the National Academy of Sciences of the United States of America. 2012;109(41):E2803 E12. 148. Grewe M. Chronological ageing and photoageing of dendri tic cells. Clinical and Experimental Dermatology. 2001;26(7):608 12. 149. Jing Y, Shaheen E, Drake RR, Chen NY, Gravenstein S, Deng YP. Aging is associated with a numerical and functional decline in plasmacytoid dendritic cells, whereas myeloid dendritic c ells are relatively unaltered in human peripheral blood. Human Immunology. 2009;70(10):777 84. 150. Camous X, Pera A, Solana R, Larbi A. NK Cells in Healthy Aging and Age Associated Diseases. Journal of Biomedicine and Biotechnology. 2012. 151. Wenisch C, Patruta S, Daxbock F, Krause R, Horl W. Effect of age on human neutrophil function. Journal of Leukocyte Biology. 2000;67(1):40 5. 152. van Duin D, Mohanty S, Thomas V, Ginter S, Montgomery RR, Fikrig E, et al. Age associated defect in human TLR 1/2 functi on. Journal of Immunology. 2007;178(2):970 5. 153. Ademokun A, Wu YC, Dunn Walters D. The ageing B cell population: Composition and function. Biogerontology. 2010;11(2):125 37.

PAGE 108

108 154. Sasaki S, Sullivan M, Narvaez CF, Holmes TH, Furman D, Zheng NY, et al. L imited efficacy of inactivated influenza vaccine in elderly individuals is associated with decreased production of vaccine specific antibodies. Journal of Clinical Investigation. 2011;121(8):3109 19. 155. Nociari MM, Telford W, Russo C. Postthymic developm ent of CD28( )CD8(+) T cell subset: Age associated expansion and shift from memory to naive phenotype. Journal of Immunology. 1999;162(6):3327 35. 156. Lemster BH, Michel JJ, Montag DT, Paat JJ, Studenski SA, Newman AB, et al. Induction of CD56 and TCR ind ependent activation of T cells with aging. Journal of Immunology. 2008;180(3):1979 90. 157. Argentati K, Re F, Donnini A, Tucci MG, Franceschi C, Bartozzi B, et al. Numerical and functional alterations of circulating gamma delta T lymphocytes in aged peopl e and centenarians. Journal of Leukocyte Biology. 2002;72(1):65 71. 158. Michishita Y, Hirokawa M, Guo YM, Abe Y, Liu JJ, Ubukawa K, et al. Age associated alteration of gamma delta T cell repertoire and different profiles of activation induced death of V d elta 1 and V delta 2 T cells. International Journal of Hematology. 2011;94(3):230 40. 159. Colonna Romano G, Aquino A, Bulati M, Lio D, Candore G, Oddo G, et al. Impairment of gamma/delta T lymphocytes in elderly: implications for immuno senescence. Experi mental Gerontology. 2004;39(10):1439 46. 160. Mittal M, Siddiqui MR, Tran K, Reddy SP, Malik AB. Reactive Oxygen Species in Inflammation and Tissue Injury. Antioxidants & Redox Signaling. 2014;20(7):1126 67. 161. Pi Sunyer X. The Medical Risks of Obesity. Postgraduate Medicine. 2009;121(6):21 33. 162. Gordon ES. Non esterified fatty acids in the blood of obese and lean subjects. American Journal of Clinical Nutrition. 1960;8(5):740 7. 163. Boden G, She PX, Mozzoli M, Cheung P, Gumireddy K, Reddy P, et al. F ree fatty acids produce insulin resistance and activate the proinflammatory nuclear factor kappa B pathway in rat liver. Diabetes. 2005;54(12):3458 65. 164. Inoguchi T, Li P, Umeda F, Yu HY, Kakimoto M, Imamura M, et al. High glucose level and free fatty a cid stimulate reactive oxygen species production through protein kinase C dependent activation of NAD(P)H oxidase in cultured vascular cells. Diabetes. 2000;49(11):1939 45. 165. Lee IT, Shih RH, Lin CC, Chen JT, Yang CM. Role of TLR4/NADPH oxidase/ROS acti vated p38 MAPK in VCAM 1 expression induced by lipopolysaccharide in human renal mesangial cells. Cell Communication and Signaling. 2012;10.

PAGE 109

109 166. Schreck R, Rieber P, Baeuerle PA. Reactive oxygen intermediates as apparently widely used messengers in the ac tivation of the NF kappa B transcription factor and HIV 1. Embo Journal. 1991;10(8):2247 58. 167. Storz P, Doppler H, Toker A. Protein kinase C delta selectively regulates protein kinase D dependent activation of NF kappa B in oxidative stress signaling. M olecular and Cellular Biology. 2004;24(7):2614 26. 168. Storz P, Toker A. Protein kinase D mediates a stress induced NF kappa B activation and survival pathway. Embo Journal. 2003;22(1):109 20. 169. Beraud C, Henzel WJ, Baeuerle PA. Involvement of regulatory and catalytic subunits of phosphoinositide 3 kinase in NF kappa B activation. Proceedings of the National Academy of Sciences of the United States of America. 1999;96(2):429 34. 170. Fan CG, Li Q, Ross D, Engelhardt JF. Tyrosine phosphorylation of I kappa B alpha activates NF kappa B through a redox regulated and c Src dependent mechanism following hypoxia/reoxygenation. Journal of Biological Chemistry. 2003;278(3):2072 80. 171. Guyton KZ, Liu YS, Gorospe M, Xu QB, Holbrook NJ. Activation of mito gen activated protein kinase by H2O2 Role in cell survival following oxidant injury. Journal of Biological Chemistry. 1996;271(8):4138 42. 172. Griffith CE, Zhang WG, Wange RL. ZAP 70 dependent and independent activation of Erk in Jurkat T cells Diffe rences in signaling induced by H2O2 and CD3 cross linking. Journal of Biological Chemistry. 1998;273(17):10771 6. 173. Klotz LO, Pellieux C, Briviba K, Pierlot C, Aubry JM, Sies H. Mitogen activated protein kinase (p38 JNK ERK ) activation pattern indu ced by extracellular and intracellular singlet oxygen and UVA. European Journal of Biochemistry. 1999;260(3):917 22. 174. Cawthorn WP, Sethi JK. TNF alpha and adipocyte biology. Febs Letters. 2008;582(1):117 31. 175. Sethi JK, Hotamisligil GS. The role of TNF alpha in adipocyte metabolism. Seminars in Cell & Developmental Biology. 1999;10(1):19 29. 176. Sultana A, Cochran BJ, Tabet F, Patel M, Torres LC, Barter PJ, et al. Inhibition of inflammatory signaling pathways in 3T3 L1 adipocytes by apolipoprotein A I. Faseb Journal. 2016;30(6):2324 35. 177. Sen R, Baltimore D. Multiple nuclear factors interact with the immunoglobulin enhancer sequences. Cell. 1986;46(5):705 16. 178. Caamano J, Hunter CA. NF kappa B family of transcription factors: Central regulators of innate and adaptive immune functions. Clinical Microbiology Reviews. 2002;15(3):414 +.

PAGE 110

110 179. Holmgren A. Antioxidant Function of Thioredoxin and Glutaredoxin Systems. Antioxidants & Redox Signaling. 2000;2(4):811 U209. 180. Liao BC, Hsieh CW, Lin YC, Wu ng BS. The Glutaredoxin/Glutathione System Modulates NF kappa B Activity by Glutathionylation of p65 in Cinnamaldehyde Treated Endothelial Cells. Toxicological Sciences. 2010;116(1):151 63. 181. Hommes DW, Peppelenbosch MP, van Deventer SJH. Mitogen activa ted protein (MAP) kinase signal transduction pathways and novel anti inflammatory targets. Gut. 2003;52(1):144 51.

PAGE 111

111 BIOGRAPHICAL SKETCH Changjie (Henry) Xu was born in Anhui China. He attended Tianjin Medical University in August 2005, and earned his bachelor degree there in Sports Science in 2009 After graduation, Henry continued his graduate studies in Tianjin Medical University with a major in Nutrition and Food Hygiene During t hat time h e followed dietitians working in the clinical settings. Besides clinical practice, Henry was also interested in basic research. During his nephrotic syndrome with a rat model. In July 2012, he earned egree. At the meantime he was admitted to another master program in Biochemical and Biomedical sciences at the Chinese University of Hong Kong. After completion of his study in Hong Kong Henry started his PhD program in Nutritional Science at University of Florida. He worked with Dr. Anne Mathews and Dr. Susan S. Percival focusing on the clnical and mechanistic effects of consuming sulfur containing dietary supplements on obesity induced inflammation. Henry is graduating in the f all of 2017 to earn his do ctor ate degree in n utritional s cience from the College of Agricultural and Life Sciences.