Rab Protein Expression Reduces Dimer/Oligomer Alpha-Synuclein and Facilitates Degradation

MISSING IMAGE

Material Information

Title:
Rab Protein Expression Reduces Dimer/Oligomer Alpha-Synuclein and Facilitates Degradation
Physical Description:
1 online resource (30 p.)
Language:
english
Creator:
Herring, Amanda
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Master's ( M.S.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Medicine
Committee Chair:
MCFARLAND,NIKOLAUS R
Committee Co-Chair:
LEWIS,JADA M
Committee Members:
BORCHELT,DAVID R

Subjects

Subjects / Keywords:
neurodegeneration -- parkinson -- rab -- synuclein
Medicine -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
The protein alpha-synuclein (a-Syn) is implicated in the etiology and pathogenesis of Parkinson’s disease. Elevated levels of a-Syn can cause detrimental effects to cellular homeostasis, including deficits in mitochondrial maintenance and vesicle trafficking, such as ER-Golgi transport, depletion of reserve vesicle pool and reduced synaptic vesicle response. Recent data suggests that the trafficking deficits caused by a-Syn may be due to an interaction with Rab proteins. Rab proteins are small GTPases critical for membrane transport, including intracellular trafficking and neurotransmitter release. In several PD animal models, over expression of murine Rab1 and human Rabs 3A and 8A can ameliorate the trafficking deficits caused by a-Syn over expression. However, it is unknown whether this rescue is due to Rab protein interaction with the oligomeric forms of a-Syn thought to be the more toxic species in disease pathogenesis. To assay for the effects of these Rabs on oligomeric a-Syn, we utilized a previously-established bi-luminescent protein complementation in which fusion of Gaussia luciferase hemi-constructs to a-Syn results in an active luciferase enzyme upon a-Syn dimerization/oligomerization, allowing for direct quantification of these a-Syn species. Supplementing this assay with size-exclusion chromatography and native immunoblot, we tested the effects of mRab1, Rab3A, and Rab8A to reduce the level of a-Syn oligomers. While Rab3A had no effect on reducing a-Syn oligomers, overexpression of mRab1 and Rab8A reduced the level of both intracellular and secreted a-Syn oligomers. Furthermore, Rab8A facilitated the degradation of a-Syn, reducing the level of both oligomeric and total a-Syn. Together, these data provide evidence that 1) toxic oligomeric a-Syn interferes with specific Rab pathways over others and that, 2) Rab8A, which has not been identified as a Rab involved in protein degradation, may have a previously unknown function upon increased a-Syn burden. Whether this new role affects normal Rab8A functioning remains to be seen.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Amanda Herring.
Thesis:
Thesis (M.S.)--University of Florida, 2013.
Local:
Adviser: MCFARLAND,NIKOLAUS R.
Local:
Co-adviser: LEWIS,JADA M.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-06-30

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0046392:00001


This item is only available as the following downloads:


Full Text

PAGE 1

RAB PROTEIN EXPRESSION REDUCES DIMER/OLIGOMER ALPHA SYNUCLEIN AND FACILITATES DEGRADATION By AMANDA HERRING A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2013

PAGE 2

2013 Amanda Herring

PAGE 3

To my future children, for all the times you complain about having to write a page long book report

PAGE 4

4 ACKNOWLEDGMENTS I thank my family, friends, and most of all, my awesome boss who has had to deal with me for the past three years.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ ............... 4 LIST OF FIGURES ................................ ................................ ................................ ........................ 6 ABSTRACT ................................ ................................ ................................ ................................ .... 7 CHAPTER 1 SYNUCLEIN ................................ ................................ ................................ .. 9 Introduction ................................ ................................ ................................ ............................. 9 Mate rials and Methods ................................ ................................ ................................ ........ 12 Plasmids and Antibodies ................................ ................................ ............................. 12 Cell Culture and Transfections ................................ ................................ ................... 13 Gaussia Luciferase Protein Complementation and MTS Assays ......................... 13 Size Exclusion Chromatography (SEC) to Separate Monomeric and Syn ................................ ................................ ................................ ....... 14 Western Blot Analysis ................................ ................................ ................................ .. 15 Statistical Analysis ................................ ................................ ................................ ........ 16 2 RESULTS ................................ ................................ ................................ .............................. 17 Syn Oligomers ................................ ............................. 17 Rab8 Syn ................................ ................................ .......... 19 3 DISCUSSION ................................ ................................ ................................ ....................... 21 LIST OF REFERENCES ................................ ................................ ................................ ............ 27 BIOGRAPHICAL SKETCH ................................ ................................ ................................ ........ 30

PAGE 6

6 LIST OF FIGURES Figure page Figure 1 1. Syn oligomers. ................................ ......... 25 Figure 1 2 Syn degradation. ................................ ......................... 26

PAGE 7

7 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science RAB PROTEIN EXPRESSION REDUCES DIMER/OLIGOMER ALPHA SYNUCLEIN AND FACILITATES DEGRADATION By Amanda Herring December 2013 Chair: Nikolaus McFarland Major: Medical Science The protein alpha S yn) is implicated in the etiology and Syn can cause detrimental effects to cellular homeostasis, including deficits in mitochondrial maintenance and vesicle trafficking, such as ER Golgi transport, depletion of reserve vesicle pool and reduced synaptic vesicle response. Recent data suggests that the trafficking deficits Syn may be due to an interaction with Rab proteins. Rab proteins are small GTPases critical for membrane transport, incl uding intracellular trafficking and neurotransmitter release. In several PD animal models, overexpression of murine Rab1 Syn overexpression. However, it is unknown whether this re scue is due to Rab protein Syn thought to be the more toxic species in Syn, we utilized a previously established bi luminescent protein complementation in which fusion of Gaussia luciferase hemi Syn results in an active luciferase enzyme

PAGE 8

8 Syn species. Supplementing this assay with size exc lusion chromatography and native immunoblot, we tested the effects of mRab1, Rab3A, and Rab8A to reduce the level of Syn oligomers, overexpression of mRab1 and Rab8A reduced the level of both intrace llular and Syn, Syn. Together, these data provide Syn interferes with specific Rab pathways over others and that, 2) Rab8A, which has not been identified as a Rab involved in protein Syn burden. Whether this new role affects normal Rab8A functioning remains to be seen.

PAGE 9

9 CHAPTER 1 SYNUCLEIN Introduction disorder in the United States, affecting approximately one million individuals ( 1 ) Pathological hallmarks of PD include the progressive loss of midbrain dopaminergic neurons essential for the control of movement and the presence of Lewy bodies, or intracellular accumulations enriched with the protein alpha Synu Syn). The Syn as a potent factor in the pathophysiology of PD is evident from mutations in the SNCA Syn, as well as duplications and triplications in the SNCA locus, all of which are known to cause early ons et, familial forms of PD ( 2 ) Elevated levels of Syn have also been found in the blood plasma and cerebrospinal fluid of PD patients, and it is thought that trans synaptic transmission of Syn cause the spreading pathology and disease progression ( 3 7 ) Syn exists primarily as a natively unfolded monomer helical structure upon binding to lipid membranes ( 8 ) Although the exact physiological role of Syn may play a function in neurotransmitter release ( 9 12 ) Syn was originally identified as a presynaptic protein shown to associate with vesicles ( 11 ) Syn are grossly normal, but display functional deficits in activity dependent dopamine release in the nigro striatal system, significant impairments in synaptic response, and a depletion of the reserve vesicle pool upon repetitive neuronal stimulation ( 9 10 12 ) Syn has also been found to interact with the amino terminus of the SNARE protein synaptobrevin 2

PAGE 10

10 and to enhance SNARE complex assembly in vivo s Syn in modulating the SNARE complex at the presynaptic terminal ( 13 ) Furthermore, the neurodegenerative phenotype in transgenic mice lack involved in SNARE Syn ( 14 ) These studie s Syn is most likely involved in vesicle trafficking at the neuronal synapse. Syn levels have been shown to affect earlier stages of intracellular trafficking pathways, also ( 15 16 ) Syn in yeast causes ER stress and inhibits ER Golgi trafficking ( 15 ) Syn also promote the accumulation of small vesicle clusters at the peripheral ER and plasma membrane in a dose dependent manner ( 16 ) A genome wide screen of yeast open Syn toxicity to be those associated with early stages of membrane trafficking, includi ng ER Golgi COPII components, SNARE proteins, and of particular importance here Ypt1p, a Rab GTPase ( 15 ) Rab GTPases represent the largest class of RAS relat ed small GTPases, and are vital to maintaining efficient vesicle transport. It was demonstrated that Ypt1p and Rab1, the murine YPT1 ortholog and an early ER Golgi Rab, rescued dopaminergic cell Syn overexpression in several animal m odels of PD, including Drosophila and Caenorhabditis elegans ( 15 ) More importantly, Rab1 expression also Syn induced cell loss in mammalian dopaminer gic neurons ( 15 ) Following Syn toxicity in yeast and PD animal models, additional Rab proteins were Syn induced transport

PAGE 11

11 deficits and toxicity. Rab8A, the paralog to human Rab1A, localizes to post Golgi vesicles and has been shown to facilitate trafficking to the plasma membrane ( 17 ) Rab3A, a neuronal specific Rab, is enriched at the synaptic membrane and is involved in neurotransmitter release ( 18 19 ) In addition to Rab1, both Rab3A and Rab8A rescue Syn induced DA neuronal cell loss in C. elegans and rat primary neurons ( 1 6 ) Syn transgenic mice suggest that Syn ( 20 ) In several studies of the PD related disorders diffuse Lewy body disease and multiple system atrophy both Syn inclusions Rab3A was found to Syn in diseased brains but not in controls ( 21 22 ) Together, Syn can affect multiple transport pathways Syn interaction with Rab proteins. It is thought Syn is not the monomeric form or Syn similar to those found in the blood plasma and CSF of PD patients ( 3 4 23 24 ) In several PD model syst ems, Karpinar et al (2009) expressed mutant forms of Syn with varying Syn to form fibrils was correlated to a higher level of neurodegeneration ( 25 ) Although several Rab proteins have been shown to rescue the trafficking deficits caused by overexpression of Syn toxicity remains unclear. We hypothesized that the mechanism by which Rab proteins may amelio rate trafficking deficits is by reducing Syn.

PAGE 12

12 Syn oligomer formation, we utilized a protein complementation assay developed by fusion of the N or C terminal fragment of Gaussia luciferase (hemi constructs) to full length wild Syn ( 26 ) Co expression of both hemi constructs and subsequent dimer/oligomerization Syn results in reconstitution of an active luciferase enzyme that can be quantitatively Syn oligomers, as measured by changes in luciferase activity and high molecul ar weight (HMW) native protein, are reduced by expression of either mRab1 or Rab8A. Syn. Although we did not Syn shown in previous studies combined with the data presented here suggests that the Syn may provide a useful therapeutic target in future. Materials and Methods Plasmids and Antibodies Fusion constru Syn Syn hGLuc2 (S2) was generated by Syn into NotI/ClaI sites of humanized Gaussia luciferase and were kindly provided by Dr. Pamela McLean (Mayo Clinic, Jacksonville, FL; ref. 13). pcDNA mRab1, pcDNA Rab3A, and pcDNA R ab8A were kindly provided by Dr. Susan Lindquist (Massachusetts Institute of Technology, Cambridge Massachusetts). FLAG mRab1, FLAG Rab3A, and FLAG Rab8A were generated by subcloning the sequence GGATTACAAGGATGACGACGAT to the amino terminus of pcDNA Rab co nstructs. Antibodies were as follows: Millipore rabbit anti Syn (1:2000), BD Transduction

PAGE 13

13 Laboratories mouse anti Syn (1:5000), Sigma mouse anti FLAG M2 (1:500), Sigma mouse anti actin (1:100,000). Cell Culture and T ransfections Human H4 neuroglioma cells (HTB 148; American Type Culture Collection) were grown in Opti MEM + GlutaMAX media (Life Technologies) containing 5% Fetal Bovine Serum and antibiotic (50U/mL penicillin, 50mg/mL streptomycin) in culture flasks under standard tissue culture conditions (37C u nder 5% CO 2 ). Cells were plated 24 h prior to transfection, and transiently transfected at 80 90% confluency with SuperFect conditioned medium (CM) experiments, media was coll ected 48 h post transfection. To eliminate floating cells, media was centrifuged prior to use for 2 min, 3000rpm, at RT and analyzed immediately for luciferase assays, or 5 min, 3000rpm, at RT and stored at 20C for size exclusion assays. For native and t Syn studies, cells were lysed 48 h post transfection in a non detergent lysis buffer (50mM Tris pH 7.4, 175mM NaCl, 5mM EDTA pH 8.0, protease inhibitor cocktail (Roche Applied Science). For cycloheximide studies, cells were transiently transfected i n a 6 well plate. 24 h post transfection, cycloheximide was added to new media at a final concentration of 3ug/mL. Cells were washed with PBS, lysed at indicated time points in RIPA buffer (50mM Tris pH 7.4, 150mM NaCl, 0.1% SDS, 0.5% Na deoxycholate, 1% T ritonX 100, 10mM N ethylmaleimide [Fisher], protease [Roche complete mini] and phosphatase [Fisher] inhibitor), and stored at 20C until all time points had been collected. Gaussia Luciferase P rotein Complementation and MTS A ssays To assay for changes in Syn, H4 cells were transiently transfected in 96 well plates with fusion constructs S1, S2 and either pcDNA control vector or the

PAGE 14

14 indicated FLAG Rab plasmid. 48 hours post transfection, culture medium was transferred to a new 96 well plate an d centrifuged as indicated above. Cells were washed with PBS and replaced with serum and phenol red free Opti MEM. Native coelenterazine (Nanolight), a cell permeable substrate of Gaussia luciferase, was resuspended in methanol to 1 mg/mL and dispensed to a final concentration of 20M onto live cells or CM by an automated plate reader, (Synergy HT, Bio Tek). The bioluminescent signal generated by protein complementation of the luciferase enzyme was integrated over 2 seconds before measurement at 480nm. Fo llowing luciferase assays, cell viability was measured using the CellTiter 96 AQ ueous One Solution Cell Proliferation Assay kit as per manufacture instructions. Briefly, media was removed following luciferase assay to a final volume of 100L/well. 20L MT S reagent was added and cells were incubated at 37C for 1 3 hours. Absorbance was measured at 490nm with a microplate reader (SynergyHT, Bio Tek). Control plasmid (pcDNA) was used to measure background luciferase signal and provide a baseline for cell via bility assays. Each condition was transfected in 8 replicates per plate, and data from a minimum of 3 plates was collected for statistical analysis. Size Exclusion Chromatography (SEC) to Separate Monomeric and O Syn SEC was performed as descr ibed previously ( 23 ) Syn oligomerization, 500L CM from H4 cells transfected with S1, S2, and pcDNA control or the indicated FLAG Rab w as thawed and filtered through an Ultrafree MC Centrifugal Filter (Millipore; PVDF 0.22m) for 4 min, 10,000 g at room temperature. 350L filtered

PAGE 15

15 CM was injected into a Superose 6 10/300 GL gel filtration column (GE Healthcare) and eluted with PBS at a fl ow rate of 0.4mL/min. 200L fractions were collected into microtubes (Fisher), and 100L of each fraction was transferred to a 96 well plate and analyzed for Gaussia luciferase protein complementation, as described above. Syn ol igomerization, cells from the same CM samples were scraped down, washed once with PBS, and mechanically sheered by passage through a 1mL 27 gauge needle in 170L of a non detergent lysis buffer (50mM Tris pH 7.4, 175mM NaCl, 5mM EDTA pH 8.0, protease inhib itor cocktail (Roche Applied Science). Lysates were spun at 13,000 rpm for 10 min at 4C and stored at 20C. For SEC, lysates were thawed and filtered through an Ultrafree MC Centrifugal Filter (Millipore; PVDF 0.22m) for 4 min, 10,000 g at room temperat ure. 140uL of filtered cell lysate was used for SEC under the same conditions as the CM and analyzed for protein complementation. Western Blot A nalysis Syn experiments were subjected to NuPAGE 4 12% Bis tris SDS PAGE electrophoresis (Life Sciences) followed by western blot analysis with antibodies described above. Protein bands were visualized by the EC L method (Amersham) or by the Odyssey system (Licor) using IR700/800 secondary antibodies (Rockland). Native western blot was performed under non denaturing conditions using NativePAGE 4 16% Tris glycine gels (Life Sciences) following manufacturer instruct ions.

PAGE 16

16 Statistical Analysis Statistical analyses were carried out using Prism 5.0 (GraphPad). One way analysis of hoc. Values in the figures are expressed as means SEM.

PAGE 17

17 CHAPTER 2 RESULTS mRab1 and Syn O ligomers Expression of mRab1, Rab3A, and Rab8A has been shown to ameliorate toxicity Syn overexpression in several PD animal models, including worms, flies, and rat midbrain dop aminergic neurons ( 15 16 ) It has also been Syn may interact with Rab proteins in disease providing a potential Syn can impair vesicle transport ( 21 22 ) Howeve r, it is unknown whether Rab proteins can interact with different cytoplasmic Syn, including small oligomeric forms that are thought to play a primary role Syn oligomerization, we utilized a protein complementation assay employing the bioluminescent protein Gaussia luciferase ( 26 ) In this model, two halves of the Gaussia luciferase enzy me are fused in frame to full length, wild Syn. Co expression of Syn hGLuc1 (S1) and Syn hGLuc2 (S2), but not S1 or S2 with either of the hGLuc hemi constructs alone, Syn dimer/oligomer for mation ( 26 ) This highly sensitive, quantitative assay can be used in both live cells and Syn. We used transient transfecti Syn dimer/oligomer formation in the presence mRab1 (a murine homolog of the human Rab1A), Rab3A, and Rab8A. We expressed either S1 or S2 constructs with a control plasmid (EGFP) to determine the backgro und levels of the assay. To take into account cell death caused by the transfection process, we performed an MTS assay immediately following luciferase assay. The luciferase levels were then normalized to live cells and

PAGE 18

18 are shown as the percent reduction i n luciferase activity compared to the model condition (S1/S2 with EGFP) (Fig. 1A). After 2 d, expression of S1 or S2 constructs alone with control plasmid resulted in minimal luciferase signal (Fig. 1A). Co expression of either mRab1 or Rab8A caused a sign ificant reduction in luciferase activity (mRab1, 49%; Rab8A, 74%; n=4, p<.001) compared to control EGFP plasmid. Previous studies Syn induced toxicity ( 16 ) ; however we did not detect any change in luciferase activity in the presence of Rab3A. Syn luciferase signal by Rab proteins Syn into smaller molecular weight forms. Previou s characterization of the S1/S2 model has shown that co expression of S1/S2 in H4 Syn under Syn oligomers ( 26 ) Our data is consistent with this, and expression of S1, S2, or S1/S2 together results in a HMW Syn ranging from 146kDa to over 700kDa (Fig. 1B, lane 1). Native PAGE of wild Syn demonstrates a similar HMW smear and confirms that wild Syn behaves in a similar manner under our transfection conditions (Fig. 1B, lane 7). Using Native and SDS Syn immunoblot, we saw no Syn wi th co expression of mRab1 and Rab3A, but a significant Syn was observed with Rab8A (Figure 1 1 B, lane 6). Contrary to Syn to smaller MW forms, but due to a reduction Syn as shown when run under denaturing conditions.

PAGE 19

19 Syn, we used size exclusion chromatography to measure the luciferase activity eluted from 1mL fractions of either cell lysate or culture medium. In cell lysate extracted under non denaturing conditions, Syn. The peak seen at fraction 15 corresponds to an approximate molecular weight of about 440kDa, similar to the Syn seen in the Native immunoblot. In conditioned Syn dimer and small oligomers of approximately 30kDa to 67kDa and is also significantly reduced by mRab1 and Rab8A, but no t Rab3A (Figure 1 1 C). Contrary to our hypothesis, however, Syn containing fractions of both cell lysate and media Syn (Figure 1 1 A and C) and Rab Syn (Figure 1 1 Syn oligomerization. R ab8A Facilitates D Syn Syn by Rab8A suggests that Rab8A may facilitate Syn. To f irst rule out a transcriptional effect, we used PCR analysis of mRNA extracted from H4 cells co Syn (both S1/S2 and untagged wild Syn) and either EGFP or Rab8A. We found no changes in the expression Syn mRNA, indicating Syn is most likely post translational ( Figure 1 2 A, B). To determine whether Rab8A facilitates post Syn, we used cycloheximide, which interferes with translational elongation, to block new pro tein synthesis following transfection of H4 cells with S1/S2 and either control plasmid (pcDNA) or Rab8A. 24 hours post transfection, cycloheximide (3uM final concentration)

PAGE 20

20 was added to the cells and lysates were collected over a 48 hour period. As expect ed, Syn when co transfected with Rab8A in cell lysa te collected at Time 0 (Figure 1 2 Syn is significantly enhanced in the prese nce of Rab8A but not control plasmid (Figure 1 2 C). To rule out a possible effect of the luciferase portion of the protein, we performed identical experiments with wild Syn with similar results (data not shown).

PAGE 21

21 CHAPTER 3 DISCUSSION Rab proteins Syn overexpression in several PD animal models ( 15 16 ) We hypothesized that one Syn Syn dimer/oligomerization, we tested our hypothesis using mRab1, Rab3A, and Rab8A. In a bioluminescent protein complementation assay (PCA) utilizing co Syn luciferase hemi constructs, we found that mRab1 and Rab8A (but not Rab3A) cause a significant reduction in luciferase signal, with Rab8A decreasing luciferase activity by almost 75%. We further characterized this using size exclusion chromatography to identify whether the reduction in luciferase activity corresponded to a decrease in high molecular weight Syn. We found that, in agreement with our luciferase assay, both mR ab1 and Rab8A (but Syn eluted from SEC fractions in both cell lysate and conditioned media, suggesting that mRab1 and Rab8A have an effect on Syn dimer/oligomer formation. In contrast to our hypothesis however, we did not see a Syn, suggesting that although mRab1 and Rab8A may affect dimer/oligomer formation, they are not reduced into smaller molecular weight forms. Of novel importance, we found that in addition to a decrease in luciferase sig nal by Rab8A in the PCA and SEC assays Syn dimer/oligomers Syn. This was not due to Syn (both S1/S2 and wtSyn ) mRNA expression in the presence of Rab8A. To determine whether Rab8A might have

PAGE 22

22 a post Syn, we used cycloheximide to block translation and Syn. At 24 h post transfection there is already a marke Syn expression in the presence of Rab8A (Fig 1, lanes 1 and 5). Syn degradation, we found a significant Syn degradation in the presence of Rab8A. This is most likely not Syn by Rab8A following transfection, as we have Syn as well as luciferase signal with or without the presence of Rab8A at 12 h post transfection, suggesting that the effects of Rab8A o n Syn reaches a certain level (unpublished observation). However, the mechanism by which this occurs and whether Syn with Rab8A still remains to be seen. We have demonstrated that although all three of the Rab proteins used in this study have previously been shown to reduce the toxicity and transport deficits caused Syn are markedly d ifferent. One potential reason for this may be due to the different pathways in which each of the Rabs are involved. Rab3A, a neuronal specific Rab, localizes to synaptic vesicles and most likely plays a role in vesicle release ( 27 ) One of the known effector proteins of Rab3A is rabphilin 3A, a synaptic vesicle Ca 2+ /phospholipid binding protein ( 28 ) Rabphilin 3A, which assists in synaptic targeting, depends on Rab3A for normal function. Immunoprecipitation studies of Rab Syn interactions in diffuse Lewy body disease, a PD related di Syn inclusions, demonstrated that in control cases, rabphilin is pulled down with Rab3A ( 22 ) However, in diseased brains, Syn ( 22 )

PAGE 23

23 Syn and Rab3A, and rabphilin is certainly not the only Rab3A effector, it does suggest that in a disease state Syn can have abnormal interactions with Rab3A that might cause a disruption in Syn overexpression in PD animal models, we have shown that with transient transfection of Syn oligomers ( 16 ) It is possible that the rescue in toxicity may be due more to compensation mechanism for Rab3A rather Syn level. While Rab3A is localized to the synapse, Rab1 and Rab8A play roles early in the vesicle transport pathway. Rab1 and Rab8A are localized to the ER Golgi and trans Golgi network, respectively ( 2 9 30 ) Syn causes deficits in ER Golgi transport which can be rescued by Rab1 ( 15 ) Additionally, both Rab1 and Rab8A can rescue dopaminergic cell loss in several different PD animal models ( 15 16 ) Syn oligomers. Recently, Winslow et al Syn overexpression Syn overexpression and knockdown of Rab1 A impaired early steps in the initiation of autophagosome synthesis ( 31 ) The Syn overexpression could be rescued by Rab1A, although the authors did not show whether this effect resulted in a decrease of Syn. Syn degradation remains controvers ial, and both the ubiquitin proteasome system and the autophagy lysosome pathway have

PAGE 24

24 been implicated ( 32 36 ) However, as Rab8A was able to reduce high molecula r weight Syn oligomers, it is unlikely that the ubiquitin proteasome system is involved. A recent study by Ejlerskov et al Syn in the Syn to the plasma membrane and Syn ( 33 ) This was proposed to be due to unconventional secretion by exophagy, a process in which autopha gosomal machinery is re directed to the plasma membrane typically under conditions of cell starvation. Syn in the presence of S Syn is known to cause a higher level of toxicity in the cell; it is possible that under transient Syn burden, such as that shown in our model, Rab8A directs Syn oligomers to the autophagy lysosomal pathway for degradation. Then, under conditions of cell stress, Rab8A may be re Syn to the plasma membrane ( 33 ) In conclusion, we hav e demonstrated that three Rab proteins, all of which have Syn toxicity and trafficking deficits in various PD models, have Syn. The most important result of this study was a previously un Syn. Future studies will aim at identifying which degradation pathway is involved and whether this is correlated to a rescue in membrane trafficking and toxicity.

PAGE 25

25 Figure 1 1 mRab1 and Rab Syn oligomers. A ) H4 cells transiently transfected with S1/S2 and mRab1, Rab3A, and Rab8A were assayed for luciferase activity 48 h post transfection. Intact cells displayed a 49% reduction in luciferase activity when co transfected with mRab 1 and a 79% reduction when co transfected with Rab8A. n = 4, F = 46.56, P < 0.001. B ) Native and SDS PAGE Western blot showing changes in high molecular Syn. C ) Luciferase activity in SEC fractions of S1/S2 cell lysate and conditioned me dia co transfected with control (EGFP), mRab1, Rab3A, or Rab8A.

PAGE 26

26 Figure 1 2. Syn degradation. A ) PCR of mRNA extracted from H4 cells transiently transfected with S1/S2 or wild Syn and Rab8A or control EGFP plasmid. Moc k cells were exposed to transfection reagent only, and a combination of wtSyn and Rab8A plasmid were used as a positive control. B ) Quantification of PCR in ( A) reveals no change in mRNA Syn when co transfected with Rab8A. C ) Westen blot sh Syn expression levels following exposure to cycloheximide 24 h after transfection with control (pcDNA) or Rab8A. D ) Relative quantification of Syn expression level shown in ( C Syn expression at 12, 24, and 48 h following cycloheximide treatment in S1/S2 cells co transfected with Rab8A compared to pcDNA. P > 0.05, two tailed t test.

PAGE 27

27 LIST OF REFERENCES 1. Dorsey, E. R., Constantinescu, R., Thompson, J. P., Biglan, K. M., Holloway, R. G., K ieburtz, K., Marshall, F. J., Ravina, B. M., Schifitto, G., Siderowf, A., and Tanner, C. M. (2007) Projected number of people with Parkinson disease in the most populous nations, 2005 through 2030. Neurology 68 384 386 2. Hardy, J., Lewis, P., Revesz, T., Lees, A., and Paisan Ruiz, C. (2009) The genetics of Parkinson's syndromes: a critical review. Curr Opin Genet Dev 19 254 265 3. Bruggink, K. A., Kuiperij, H. B., Ekholm Pettersson, F., and Verbeek, M. M. (2011) Detection of elevated levels of alpha synu clein oligomers in CSF from patients with Parkinson disease. Neurology 77 510; author reply 510 511 4. El Agnaf, O. M., Salem, S. A., Paleologou, K. E., Cooper, L. J., Fullwood, N. J., Gibson, M. J., Curran, M. D., Court, J. A., Mann, D. M., Ikeda, S., Co okson, M. R., Hardy, J., and Allsop, D. (2003) Alpha synuclein implicated in Parkinson's disease is present in extracellular biological fluids, including human plasma. FASEB J 17 1945 1947 5. Desplats, P., Lee, H. J., Bae, E. J., Patrick, C., Rockenstein, E., Crews, L., Spencer, B., Masliah, E., and Lee, S. J. (2009) Inclusion formation and neuronal cell death through neuron to neuron transmission of alpha synuclein. Proc Natl Acad Sci U S A 106 13010 13015 6. Luk, K. C., Kehm, V. M., Zhang, B., O'Brien, P., Trojanowski, J. Q., and Lee, V. M. (2012) Intracerebral inoculation of pathological alpha synuclein initiates a rapidly progressive neurodegenerative alpha synucleinopathy in mice. J Exp Med 209 975 986 7. Lee, S. J., Desplats, P., Lee, H. J., Spencer B., and Masliah, E. (2012) Cell to cell transmission of alpha synuclein aggregates. Methods Mol Biol 849 347 359 8. Davidson, W. S., Jonas, A., Clayton, D. F., and George, J. M. (1998) Stabilization of alpha synuclein secondary structure upon binding to synthetic membranes. J Biol Chem 273 9443 9449 9. Murphy, D. D., Rueter, S. M., Trojanowski, J. Q., and Lee, V. M. (2000) Synucleins are developmentally expressed, and alpha synuclein regulates the size of the presynaptic vesicular pool in primary hippoc ampal neurons. J Neurosci 20 3214 3220 10. Abeliovich, A., Schmitz, Y., Farinas, I., Choi Lundberg, D., Ho, W. H., Castillo, P. E., Shinsky, N., Verdugo, J. M., Armanini, M., Ryan, A., Hynes, M., Phillips, H., Sulzer, D., and Rosenthal, A. (2000) Mice lac king alpha synuclein display functional deficits in the nigrostriatal dopamine system. Neuron 25 239 252 11. Iwai, A., Masliah, E., Yoshimoto, M., Ge, N., Flanagan, L., de Silva, H. A., Kittel, A., and Saitoh, T. (1995) The precursor protein of non A beta component of Alzheimer's disease amyloid is a presynaptic protein of the central nervous system. Neuron 14 467 475 12. Cabin, D. E., Shimazu, K., Murphy, D., Cole, N. B., Gottschalk, W., McIlwain, K. L., Orrison, B., Chen, A., Ellis, C. E., Paylor, R., L u, B., and Nussbaum, R. L. (2002) Synaptic vesicle depletion correlates with attenuated synaptic responses to prolonged repetitive stimulation in mice lacking alpha synuclein. J Neurosci 22 8797 8807

PAGE 28

28 13. Burre, J., Sharma, M., Tsetsenis, T., Buchman, V., Etherton, M. R., and Sudhof, T. C. (2010) Alpha synuclein promotes SNARE complex assembly in vivo and in vitro. Science 329 1663 1667 14. Chandra, S., Gallardo, G., Fernandez Chacon, R., Schluter, O. M., and Sudhof, T. C. (2005) Alpha synuclein cooperates with CSPalpha in preventing neurodegeneration. Cell 123 383 396 15. Cooper, A. A., Gitler, A. D., Cashikar, A., Haynes, C. M., Hill, K. J., Bhullar, B., Liu, K., Xu, K., Strathearn, K. E., Liu, F., Cao, S., Caldwell, K. A., Caldwell, G. A., Marsischky, G ., Kolodner, R. D., Labaer, J., Rochet, J. C., Bonini, N. M., and Lindquist, S. (2006) Alpha synuclein blocks ER Golgi traffic and Rab1 rescues neuron loss in Parkinson's models. Science 313 324 328 16. Gitler, A. D., Bevis, B. J., Shorter, J., Strathearn K. E., Hamamichi, S., Su, L. J., Caldwell, K. A., Caldwell, G. A., Rochet, J. C., McCaffery, J. M., Barlowe, C., and Lindquist, S. (2008) The Parkinson's disease protein alpha synuclein disrupts cellular Rab homeostasis. Proc Natl Acad Sci U S A 105 145 150 17. Hutagalung, A. H., and Novick, P. J. (2011) Role of Rab GTPases in membrane traffic and cell physiology. Physiol Rev 91 119 149 18. Geppert, M., Bolshakov, V. Y., Siegelbaum, S. A., Takei, K., De Camilli, P., Hammer, R. E., and Sudhof, T. C. (199 4) The role of Rab3A in neurotransmitter release. Nature 369 493 497 19. Geppert, M., Goda, Y., Stevens, C. F., and Sudhof, T. C. (1997) The small GTP binding protein Rab3A regulates a late step in synaptic vesicle fusion. Nature 387 810 814 20. Dalfo, E ., Gomez Isla, T., Rosa, J. L., Nieto Bodelon, M., Cuadrado Tejedor, M., Barrachina, M., Ambrosio, S., and Ferrer, I. (2004) Abnormal alpha synuclein interactions with Rab proteins in alpha synuclein A30P transgenic mice. J Neuropathol Exp Neurol 63 302 3 13 21. Dalfo, E., and Ferrer, I. (2005) Alpha synuclein binding to rab3a in multiple system atrophy. Neurosci Lett 380 170 175 22. Dalfo, E., Barrachina, M., Rosa, J. L., Ambrosio, S., and Ferrer, I. (2004) Abnormal alpha synuclein interactions with rab3a and rabphilin in diffuse Lewy body disease. Neurobiol Dis 16 92 97 23. Danzer, K. M., Ruf, W. P., Putcha, P., Joyner, D., Hashimoto, T., Glabe, C., Hyman, B. T., and McLean, P. J. (2011) Heat shock protein 70 modulates toxic extracellular alpha synuclein oligomers and rescues trans synaptic toxicity. FASEB J 25 326 336 24. Winner, B., Jappelli, R., Maji, S. K., Desplats, P. A., Boyer, L., Aigner, S., Hetzer, C., Loher, T., Vilar, M., Campioni, S., Tzitzilonis, C., Soragni, A., Jessberger, S., Mira, H., C onsiglio, A., Pham, E., Masliah, E., Gage, F. H., and Riek, R. (2011) In vivo demonstration that alpha synuclein oligomers are toxic. Proc Natl Acad Sci U S A 108 4194 4199 25. Karpinar, D. P., Balija, M. B., Kugler, S., Opazo, F., Rezaei Ghaleh, N., Wend er, N., Kim, H. Y., Taschenberger, G., Falkenburger, B. H., Heise, H., Kumar, A., Riedel, D., Fichtner, L., Voigt, A., Braus, G. H., Giller, K., Becker, S., Herzig, A., Baldus, M., Jackle, H., Eimer, S., Schulz, J. B., Griesinger, C., and Zweckstetter,

PAGE 29

29 M. (2009) Pre fibrillar alpha synuclein variants with impaired beta structure increase neurotoxicity in Parkinson's disease models. EMBO J 28 3256 3268 26. Outeiro, T. F., Putcha, P., Tetzlaff, J. E., Spoelgen, R., Koker, M., Carvalho, F., Hyman, B. T., and McLean, P. J. (2008) Formation of toxic oligomeric alpha synuclein species in living cells. PLoS ONE 3 e1867 27. Pfeffer, S. R. (2012) Rab GTPase localization and Rab cascades in Golgi transport. Biochem Soc Trans 40 1373 1377 28. Li, C., Takei, K., Gepp ert, M., Daniell, L., Stenius, K., Chapman, E. R., Jahn, R., De Camilli, P., and Sudhof, T. C. (1994) Synaptic targeting of rabphilin 3A, a synaptic vesicle Ca2+/phospholipid binding protein, depends on rab3A/3C. Neuron 13 885 898 29. Sandoval, C. O., and Simmen, T. (2012) Rab proteins of the endoplasmic reticulum: functions and interactors. Biochem Soc Trans 40 1426 1432 30. Kelly, E. E., Horgan, C. P., Goud, B., and McCaffrey, M. W. (2012) The Rab family of proteins: 25 years on. Biochem Soc Trans 40 1 337 1347 31. Winslow, A. R., Chen, C. W., Corrochano, S., Acevedo Arozena, A., Gordon, D. E., Peden, A. A., Lichtenberg, M., Menzies, F. M., Ravikumar, B., Imarisio, S., Brown, S., O'Kane, C. J., and Rubinsztein, D. C. (2010) alpha Synuclein impairs macroa utophagy: implications for Parkinson's disease. J Cell Biol 190 1023 1037 32. Cuervo, A. M., Stefanis, L., Fredenburg, R., Lansbury, P. T., and Sulzer, D. (2004) Impaired degradation of mutant alpha synuclein by chaperone mediated autophagy. Science 305 1292 1295 33. Ejlerskov, P., Rasmussen, I., Nielsen, T. T., Bergstrom, A. L., Tohyama, Y., Jensen, P. H., and Vilhardt, F. (2013) Tubulin polymerization promoting protein (TPPP/p25alpha) promotes unconventional secretion of alpha synuclein through exophagy by impairing autophagosome lysosome fusion. J Biol Chem 288 17313 17335 34. Bennett, M. C., Bishop, J. F., Leng, Y., Chock, P. B., Chase, T. N., and Mouradian, M. M. (1999) Degradation of alpha synuclein by proteasome. J Biol Chem 274 33855 33858 35. To faris, G. K., Razzaq, A., Ghetti, B., Lilley, K. S., and Spillantini, M. G. (2003) Ubiquitination of alpha synuclein in Lewy bodies is a pathological event not associated with impairment of proteasome function. J Biol Chem 278 44405 44411 36. Shin, Y., Kl ucken, J., Patterson, C., Hyman, B. T., and McLean, P. J. (2005) The co chaperone carboxyl terminus of Hsp70 interacting protein (CHIP) mediates alpha synuclein degradation decisions between proteasomal and lysosomal pathways. J Biol Chem 280 23727 23734

PAGE 30

30 BIOGRAPHICAL SKETCH Amanda Herring began her education at the Un iversity of Sou th Florida as a chemistry major/ voice minor. After a year, she transferred to the Uni versity of North Florida where she compl eted her Bachelor of Science in b iology in 2009. During her undergraduate coursework, she started working at the Mayo Clinic Jacksonville as a research as fell i n love with research, and when she completed her undergraduate degree, she decided to pursue her Master of Me dical Science at the University of Florida in neuroscience.