Characterization of the Effect of Prorenin and Prorenin Receptor on Ocular Inflammation

MISSING IMAGE

Material Information

Title:
Characterization of the Effect of Prorenin and Prorenin Receptor on Ocular Inflammation
Physical Description:
1 online resource (115 p.)
Language:
english
Creator:
Wang, Yunyang
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Master's ( M.S.P.)
Degree Grantor:
University of Florida
Degree Disciplines:
Pharmaceutical Sciences, Pharmacodynamics
Committee Chair:
PERIS,JOANNA
Committee Co-Chair:
LI,QIUHONG
Committee Members:
KATOVICH,MICHAEL J
ROWLAND,NEIL E
KRAUSE,ERIC

Subjects

Subjects / Keywords:
cytokine -- hrp -- inflammation -- ocular -- prorenin -- prr -- ras
Pharmacodynamics -- Dissertations, Academic -- UF
Genre:
Pharmaceutical Sciences thesis, M.S.P.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Increasing evidence suggests that local tissue renin-angiotensin system (RAS) hyperactivity, resulting in increased angiotensin II (Ang II) level contributes to increased vascular inflammation and oxidative stress in many conditions including ocular diseases. Recent studies have shown that receptor-bound prorenin, which is highly elevated in vitreous of many ocular diseases, may be the major pathway for local Ang II production. Prorenin binding to the prorenin receptor (PRR) also activates signaling events contributing tissue damage independent of Ang II action. The purpose of the present study was to investigate the role of prorenin and PRR in ocular inflammation and whether the inflammation is caused via Ang II-dependent and/or independent pathways using both in vitro and in vivo systems. Cultured human Müller cells were incubated with human recombinant prorenin (100nM) in the presence or absence of RAS blockers ACE inhibitor (ACEi) captopril, AT1Rinhibitor (AT1Ri) losartan, PRR siRNA and the PRR antagonist HRP. Proinflammatory cytokines IL-1a, IL-6, TGF-ß, TNF-a and the RAS genes ACE, ACE 2, AT1R,angiotensinogen, PRR, and MAS receptor were analyzed by real time RT-PCR. The role of HRP in ocular inflammation was also investigated in vivo in endotoxin-induced uveitis (EIU) mouse model by intravitreal injection of AAV vector expressing HRP. Ocular inflammation was assessed by counting infiltrating inflammatory cells in the eyes from H&E stained sections and RT-PCR analysis of inflammatory cytokines.  Prorenin stimulated increased cytokine expression in cultured human Müller cells (> 10 fold increase for IL-1a, IL-6; and > 1 fold increase for TGF-ß, TNF-a) was almost completely blocked by PRR siRNA or HRP, suggesting involvement of PRR. Losartan treatment also blocked prorenin stimulated increase of cytokine expression, suggesting that prorenin stimulated cytokine expression is largely mediated by Ang II-dependent pathway. Intraocular delivery of AAV-HRP significantly reduced LPS induced infiltration of inflammatory cells and the expression of inflammatory cytokines in mouse eyes.  These results suggested that elevated prorenin might contribute to ocular diseases by stimulating proinflammatory cytokine expression; this effect is mediated via  the interaction with PRR and is largely Ang II-dependent.  The study also suggests the potential use of HRP as a therapeutic agent to reduce ocular inflammation.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Yunyang Wang.
Thesis:
Thesis (M.S.P.)--University of Florida, 2014.
Local:
Adviser: PERIS,JOANNA.
Local:
Co-adviser: LI,QIUHONG.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2014
System ID:
UFE0046381:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 C HARACTERIZATION OF THE E FFECT OF P RORENIN AND P RORENIN R ECEPTOR ON O CULAR I NFLAMMATION By YUNYANG WANG A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE IN PHARMACY UNIVERSITY OF FLORIDA 2014

PAGE 2

2 2014 Yunyang Wang

PAGE 3

3 To my dear mom Shuhua Liu and dear dad Jinghua Wang

PAGE 4

4 ACKNOWLEDGMENTS I thank my advisor, Dr. Qiuhong Li, and my co advisor, Dr. Joanna Peris, and all my other committee members including Dr. Katovich, Dr. Krause, and Dr. Rowland for their kindly guidance in my thesis project. I thank my lab members who helped me to complete the experiments, including Dr. Amrisha Verma, Dr. Ping Zhu, Dr. Pollob Shil, and Dr. Tuhina Prasad. I also thank my parents for their support over the years.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF FIGURES ................................ ................................ ................................ .......... 8 LIST OF ABBREVIATION S ................................ ................................ ............................. 9 ABSTRACT ................................ ................................ ................................ ................... 12 CHAPTER IN VITRO EXPERIMENT ON CULTURED MULLER CELLS ................................ ........ 14 1.1 Introduction ................................ ................................ ................................ ... 14 1.2 Rationale and Hypothesis ................................ ................................ ............. 18 1.3 Materials and Methods ................................ ................................ .................. 19 1. 3.1 Cell Culture ................................ ................................ .............................. 19 1.3.2 The Extraction of Total RNA ................................ ................................ .... 19 1.3.3 Real Time PCR ................................ ................................ ....................... 20 1.3.4 Optimization of PRR siRNA Treatment in Cultured Mller Cells .............. 21 1.3.5 Treatment Groups of Mller Cells ................................ ............................ 22 1.3.6 Calculation of the Treatment Compound Concen trations ........................ 23 1.3.6.1 AT1R inhibitor losartan ................................ ................................ ... 23 1.3.6.2 ACE inhibitor captopril ................................ ................................ .... 23 1.3.6.3 Prorenin and HRP ................................ ................................ .......... 23 1.3. 7 Data Analysis ................................ ................................ .......................... 24 1.4 Results ................................ ................................ ................................ .......... 24 1.4.1 Two Way ANOVA Results of the Gene Expression Data ........................ 24 1.4.2 Effects of Prorenin on Cytokine Expression in Cultured Human Mller Cells ................................ ................................ ................................ .............. 25 1.4.3 The Expression of the Prorenin Receptor (PRR) in Mller Cells and the Effect o f PRR siRNA ................................ ................................ ............... 25 1.4.4 Effects of RAS Blockers on Prorenin Stimulated Cytokine Release in Cultured Human Mller Cells ................................ ................................ ........ 26 1.4.5 Effects of PRR Knockdown and Blocking Prorenin PRR Interaction with HRP on Prorenin Stimulated Cytokine Release ................................ ..... 27 1.4.6 Effects of the Combination Blockade with RAS Blockers and PRR siRNA/HRP on Prorenin Stimulated Cytokine Release ................................ 29 1.4.7 Effects of Prorenin Treatment on RAS Gene Expression in Cultured Human Mller Cells ................................ ................................ ....................... 30 1.4.8 Effects of RAS Blockers on RAS Gene Expression in Prorenin Treated Mller Cells ................................ ................................ ...................... 30 1.4.9 Effects of PRR Knockdown and Blocking Prorenin PRR Interaction with HRP on RAS Gene Expression in Prorenin Treated Mller Cells .......... 31

PAGE 6

6 1.4.10 Effects of the Combination of Losartan plus PRR siRNA/HRP on RAS Related Gene Expression in Prorenin Treated Mller Cells ................. 33 1.4.11 Effects of the Treatments on the Expression Ratios of ACE/ACE 2 and AT1R/MAS Receptor in Mller Cells ................................ ...................... 34 1.5 Discussion ................................ ................................ ................................ ..... 35 IN VIVO CHARACTERIZATION OF THE EFFECTS OF HRP IN ANIMAL MODELS OF OCULAR INFLAMMATION ................................ ................................ ............... 74 2.1 Introduction ................................ ................................ ................................ ... 74 2.2 Rationale and Hypothesis ................................ ................................ ............. 75 2.3 Materials and Methods ................................ ................................ .................. 77 2.3.1 Animal Treatment Groups ................................ ................................ ....... 77 2.3.2 Intravitreal Injection of AAV Vectors ................................ ........................ 77 2.3.3 EIU Induction ................................ ................................ ........................... 78 2.3.4 H&E Staining of Eye Sections ................................ ................................ 78 2.3.5 Immunohistochemical Staining of Eye Sections ................................ ...... 79 2.3.6 Quantification of the Infiltrating Inflammatory Cells in the Mouse Eyes ... 80 2.3.7 Retinal Total RNA Isolation and RT PCR Analysis ................................ .. 80 2.3.8 Statistical Analysis ................................ ................................ ................... 81 2. 4 Results ................................ ................................ ................................ .......... 81 2.4.1 Effects of HRP Expressed from Intravitreally Delivered AAV Vector on Infiltrating Inflammatory Cells in Mouse Eyes ................................ ................ 81 2.4.2 Effects of Intravitreal Injection of AAV HRP Vector on Intraocular CD11b Positive Cells ................................ ................................ .................... 82 2.4.3 Effect of HRP AAV Vector Intravitreal Injection on Intraocular CD45 Positive Cells ................................ ................................ ................................ 83 2.4.4 Real Time RT PCR Analysis of Inflammatory Cytokines in Mouse Eyes ................................ ................................ ................................ .............. 83 2.5 Discussion ................................ ................................ ................................ ..... 84 SUMMARY AND FUTURE RESEARCH ................................ ................................ ..... 106 LIST OF REFERENCES ................................ ................................ ............................. 110 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 115

PAGE 7

7 LIST OF TABLES Table page 1 1 The treatment design of the siRNA pilot experiment. ................................ ......... 42 1 2 The treatment design of the in vitro experiment. ................................ ................. 43 1 3 The expression of proinflammatory cytokines in Mller cells .............................. 44 1 4 The expression of RAS genes in Mller cells in different treatment groups ........ 48 1 5 Primers used for real time PCR analysis in the in vitro studies .......................... 54 1 6 Analysis of variance table of gene expression data in the in vitro experim ent .... 55 2 1 The tre atment groups of animal studies ................................ ............................. 90 2 2 The expression of proinflammatory cy tokines in mouse eyes ............................ 91 2 3 Primers used for real time PCR analysis in animal studies ................................ 94

PAGE 8

8 LIST OF FIGURES Figure page 1 1 Immunofluorescent staining of PRR in cultured Mller cells ............................... 65 1 2 The treatment timeline of Mller cell experiment ................................ ................ 66 1 3 The mRNA expression level after PRR siRNA treatment ................................ ... 67 1 4 Fold change in the expression levels of cytokine mRNA in Mller cells ............. 68 1 5 Fold change in the expression levels of RAS gene mRNA in Mller cells .......... 70 2 1 The map of AAV vectors ................................ ................................ ..................... 95 2 2 The treatment timeline of the animal experiment ................................ ................ 96 2 3 The H&E staining of the eye sections of mice ................................ .................... 97 2 4 The CD11b staining of t he eye sections of mice ................................ ................. 98 2 5 The CD45 staining of the eye sections of mice ................................ ................... 99 2 6 Infiltrating inflammatory cell counting in mouse eyes ................................ ........ 100 2 7 Fold change in the retinal expressi on of proinflammatory cytokines ................. 103 2 8 Between group comparisons in the retinal expression of proinflammatory cytokines ................................ ................................ ................................ .......... 105

PAGE 9

9 LIST OF ABBREVIATIONS AAV Rev Ang I Adeno associated virus reverse angiotensin I AAV HRP Adeno associated virus handle region peptide ACE Angiotensin converting enzyme ACE 2 Angiotensin converting enzyme 2 ACEi ACE inhibitor Ang 1 7 Angiotensin 1 7 Ang II Angiotensin II ANOVA Analysis of variance AT1R A ngiotensin II receptor type 1 AT1Ri AT1R inhibitor AT2R A ngiotensin II receptor type 2 ATPase A denylpyrophosphatase BCIP 5 bromo 4 chloro 3' indolyphosphate BSA B ovine serum albumin CBA C actin CD11b C luster of differentiation molecule 11 b CD45 C luste r of differentiation molecule 45 cDNA C omplementary DNA EIU Endotoxin induced uveitis ERK E xtracellular signal regulated kinase MAPK M itogen activated protein kinase ERG Electroretinography FITC Fluorescein isothiocyanate GFP G reen fluorescent protein

PAGE 10

10 H&E H ematoxylin and eosin HRP Handle region peptide IL 1 I nterleukin 1 IL 6 I nterleukin 6 ITR I nverted terminal repeat Kcat First order rate constant Kd Dissociation constant Km Michaelis constan t LPS Lipopolysaccharide M Molar MAP Mitogen activated protein MAPK Mitogen activated protein kinases MAS Ang iotensin 1 7 receptor mRNA Messenger RNA NBT N itro blue tetrazolium NF Nuclear factor kappa light chain enhancer of activated B cell nm Nanometer nM N anomolar PBS Phosphate buffered s aline PCR P olymerase chain reaction PRR Prorenin/renin receptor RAS Renin angiotensin system RNA Ribonucleic acid RNase Ribonuclease RPE R etinal pigmented epithelial

PAGE 11

11 RT PCR Reverse transcription polymerase chain reaction siRNA Small interfering RNA SP Signal peptide SV40 Simian virus 40 TGF Transforming growth factor beta TNF Tumor necrosis factor alpha Micrometer M Micromolar L Microliter

PAGE 12

12 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science CHARACTERIZATION OF THE EFFECT OF PRORENIN AND PRORENIN RECEPTOR ON OCULAR INFLAMMATION By Yunyang Wang May 201 4 Chair: Joanna Peris Cochair: Qiuhong Li Major: Pharmac eutical Sciences Increasing evidence suggest s that local tissue r enin a ngiotensin s ystem ( RAS ) hyperactivity result ing in increased a ngiotensin II (Ang II) level contributes to increased vascular inflammation and oxidative stress in many conditions including ocular diseases. Recent studies have show n that receptor bound prorenin, which is highly elevated in vitreous of many ocular diseases, may be the major pathway for local Ang II production. Pror enin binding to the prorenin receptor (PRR) also activates signaling events co ntributing tissue damage independent of Ang II action. The purpose of the present study was to investigate the role of prorenin and PRR in ocular inflammation and whether the inf lammation is caused via Ang II dependent and/or independent pathway s using both in vitro and in vivo systems Cultured human M ller cells were incubated with human recombinant prorenin (100nM) in the presence or absence of RAS blockers [ACE inhibitor (ACE i) captopril, AT1R inhibitor (AT1Ri) losartan, PRR siRNA and the PRR antago nist HRP ]. Pro inflammatory cytokines IL 6, TGF and the RAS genes ACE, ACE 2, AT1R angiotensin ogen PRR, and MAS receptor were analyzed by real time RT PCR.

PAGE 13

13 The role of HRP in ocular inflammation was also investigated in vivo in endotoxin induced uveitis (EIU) mouse model by intravitreal injection of AAV vector expressing HRP. Ocular inflammation was assessed by counting infi ltrating inflammatory cells in the eyes from H&E stained sections and RT PCR analysis of inflammatory cytokines Prorenin stimulated increased cytokine expression in cultured human M ller cells (> 10 fold increase for IL 6; and > 1 f old increase fo r TGF was alm ost completely blocked by PRR siRNA or HRP, suggesting involvement of PRR. Losartan treatment also blocked prorenin stimulated increase of cytokine expression, suggesting that prorenin stimulated cytokine expression is largely mediat ed by Ang II dependent pathway. Intraocular delivery of AAV HRP significantly reduced LPS induced infiltration of inflammatory cells and the expression of inflammatory cytokines in mouse eyes. T hese results suggest ed that elevated prorenin might contribu te to ocu lar diseases by stimulating pro inflammatory cytokine expression; this effect is mediated via the interaction with PRR and is largely Ang II dep endent. The study also suggest s the potential use of HRP as a therapeutic agent to reduce ocular inflam mation.

PAGE 14

14 CHAPTER 1 IN VITRO EXPERIMENT ON CULTURED MULLER CELLS 1.1 Introduction The role of the r enin a ngiotensin s ystem (RAS) on the regulation of body functio n has been widely studied. S ystematic RAS is important in maintaining normal body functions, including blood pressure and fluid balance. On the other hand, the imbalance of the system may lead to many pathological conditions, such as hypertension and hypertension related medical conditions. In th e classic view of the RAS the signaling cascade starts with the conversion of angiotensinogen into a ngiotensin I (Ang I) by renin released from the kidney s R enin is a catalytic enzyme that comes from the cleavage of the pro segment of prorenin by proteas es such as prohormone convertases and cathepsin B. Upon cleavage, the active enzyme is secreted by the kidney granular cells, and its secretion is regulated by blood pressure, sodium chloride concentration, and sympathetic nervous system activity ( 1 4 ) Those physiological changes modulate the release of renin through the regulation of intracellular cyclic AMP and calcium of the kidney j uxtaglomerular cells ( 5 ) When renin is released into circulation system, it becomes an active enzyme and catalyze s the reaction that cleaves angiotensinogen into A ng I ( 6 ) Since the renin catalyzed reaction is the rate limiting step in the process of Ang II formation, it plays a central role in the regulation of the RAS When Ang I is generated from angiotensinogen through renin cleavage the peptide is further converted to Ang II by the angiotensin converting enzyme (ACE) ( 7 ) The Ang II subsequently bind s both AT 1 R and AT 2 R and t hrough binding with A T1R Ang II exerts its major functions, including up regulation of bloo d pressure, inflammation, and oxidative stress ( 8 12 ) As a result, many clinical drugs have been developed to

PAGE 15

15 regulate the activity of the RAS includi ng captopril and losartan. C aptopril is an inhibitor of angiotensin converting enzyme (ACE), and losartan is a blocker of AT1R ( 13 14 ) Both drugs have been shown to be effective at blocking the Ang II mediated signaling p athway and a s a result, they are able to decrease blood pressure in hypertensive subjects ( 13 14 ) The other bioactive product, angiotensin 1 7 (Ang 1 7) is produced through the cleavage of Ang II The cleavage is catalyzed by another enzyme, ACE 2, and the peptide is able to bind with the MAS receptor and produce contrary effects, including the down regulation of blood pressure, inflammation, and oxidative stress ( 15 18 ) Among the broad range of biological functions of the RAS, we are particularly interested in the fact that the RAS is able to induce inflammatory response. Previous studies have shown that the R AS stimulate s inflamma t ory response by increasing vascular permeability, the expression of adhesion molecules and chemokines, and the number of infiltrating inflammatory cells ( 19 ) This increase in the inflammatory response is achieve d through the Ang II dependent pathway which involves the activat ion of the NF regulate s the expression of pro inflammatory cytokines ( 20 ) Besides systematic RAS, a local RAS also exist s in many tissues. There are many local functions of the RAS such as the regulation of local vascular system, aldosterone secretion, vascular tone, tissue inflammation, and heart remodeling ( 21 ) In many tissues, the pr o enzyme of re nin prorenin is expressed, but the role of prorenin was still unclear until the discovery of the prorenin receptor (PRR) by a French group in 2002 ( 22 ) In their study as well as some other later studies it has been found that

PAGE 16

16 prorenin is activated in a non proteolytic manner which is through the binding with PRR ( 22 ) The PRR is a 350 amino acid, single transmembrane protein that co precipitates with vacuolar ATPase ( 22 23 ) After binding with PRR, prorenin experiences conformational change, in which the pro segment unfolds from its active site ( 24 ) The exposure of th e a ctive site confers prorenin enzymatic activity that cleave s angiotensinogen into Ang I ( 24 ) As a result, the RAS is initiated, and Ang II is generated as a downstream product. T he inflammatory response of local tissue is subsequently triggered because of the Ang II stimulation The binding of prorenin also stimulates inflammatory response via Ang II independent direct receptor activation In the Ang II independent pathway prorenin binding to PRR activate s the extracellular signal regulated kinase ( ERK ) 1 /2 and the mitogen activated protein kinase (MAPK) ( 25 26 ) P ror enin is considered to be an important contributor to local inflammation due to the fact that protein is expressed in local tissues such as retina s and kidney s and also because that the expression leve l of prorenin is elevated in inflammatory conditions i ncluding diabetic retinopathy and diabetic nephropathy ( 27 28 ) The results all suggest a possible link between prorenin and the inflammatory response. Currently, there is no pharmacological drug available as PRR inhibitor T he only PRR inhibitor available is the so called handle region pept ide (HRP). HRP mimics the binding sequence of prorenin with PRR. Therefore the peptide is thought to be able to inhibit the binding of prorenin with its receptor ( 29 ) In previous studies, the treatment of HRP has been shown to be able to suppress the de velopment of inflammation in ocular tissues of the endotoxin induced uveitis (EIU) rats ( 29 ) However, there are other

PAGE 17

17 studies showing opposite results. In these studies, HRP did not have any blood pressure lowering effect as expected ( 30 ) Previous studies on prorenin show ed a possible relationship between ocular RAS and intra ocular inflammation ( 27 29 31 ) It has been found that prorenin level is higher in ocular fluid than in plasma, and is further elevated in plasma and ocular fluid in diabetic patients ( 27 31 ) A nimal studies have shown that prorenin inhibitor HRP block ed ocular inflammation in diabetic retinopathy and endotoxin induced uveitis in rats ( 28 29 ) As a result, prorenin activate s the renin angiotensin signaling pathway by binding with PRR, initiating a signaling cascade, which leads to inflammatory responses In the local RAS of retina s prorenin expression is increased in res ponse to certain pathological conditions, such as diabetic retinopathy, suggesting a possible link between prorenin and retinal inflammation. As mentioned previously, prorenin is able to bind with PRR, and the binding confers prorenin catalytic activity T herefore upon binding with PRR, prorenin convert s ang iotensinogen to Ang I, and t he Ang I is subsequently converted to Ang II by ACE ( 22 ) Through binding with A T1R Ang II is able to activate reactive oxygen species, NF kB, and the ERK/MAPK signaling pathway to generate an inflammatory response ( 19 ) P rorenin also induce s an inflammatory response independent of An g II. In the Ang II independent pathway, t he binding of prorenin with PRR activates the MAPK/ERK1/2 pathway, and the blockade of PRR with PRR siRNA prevents the phosphorylation of ERK1/2 independent of AT1R blockade ( 25 26 )

PAGE 18

18 1.2 Rationale and Hypothesis Previous studies have found that prorenin is a potential contributor of inflammation, and the proen zyme mediates the inflammation through both the Ang II dependent and independent pathway s ( 28 29 32 ) As a result, it is possible that prorenin also contribute s to ocular inflammation. Besides, our lab has also found that PRR is expressed on M ller cells ( Figure 1 1 ) Since M ller cells are a type of immune modulating glial cells in retina s it suggests prorenin is a potential mediator of ocular inflammation. We therefore hypothesize d that ( 1) elevated prorenin contribute s to ocular inflammation; (2) this effect is mediated by binding to its receptor PRR, and (3 ) binding of prorenin to PRR initiate s the inflammation response via Ang II dependent or Ang II independent signaling pathways T o test the hypothesis that prorenin stimulates inflammatory response s in M ller cells, the cells were trea ted with prorenin It was observed that prorenin treatment significantly increased the expression of IL 1 IL 6 TGF suggesting the treatment of prorenin was able to stimulate the expression of pro inflammatory cytokines. In order to test the pro inflammatory effect is mediated through PRR by activating the Ang II depende nt and/or independent pathway the cytokine stimulating effect of prorenin was examined in the presence of RAS blockers [ACE inh ibitor (ACEi) captopril, AT1R inhibitor (AT1Ri) losartan, PRR siRNA and the PRR antago nist HRP ]. PRR siRNA and HRP blocked both Ang II dependent and independent pathway s while captopril and losartan only blocked the Ang II dependent pathway It was observ ed that ACEi losartan blocked most of the cytokine stimulating

PAGE 19

19 effect of prorenin; suggesting the pro inflammatory effect of prorenin was mediated mainly through the Ang II dependent pathway 1.3 Materials and Methods 1.3. 1 Cell C ulture M ller cells we re used in the experiment. T he cells were plated in 24 well plate s with DMEM Dulbecco's Modified Eagle Medium ( DMEM ) (Thermo Fisher Scientific Waltham, MA ) containing 10% f etal bovine serum ( FBS ) (Thermo Fisher Scientific Waltham, MA ). When the cells grew t o 9 0% confluence, the serum medium w as replaced and the cells were treated with serum free medium for 2 hours before subsequent incubation s of other treatment reagents. 1.3. 2 The Extraction of Total RNA Cells were lysed by TRI zol reagents (Life Technologies Carlsbad, CA) followed by sonication C hloroform (1/5 volume of TRI zol ) was subsequently added. After vortex, the mixture was centrif uged at 13,20 0 rpm for 10 minutes and the top aqueous layer was transferred into a new tube and was mixe d ag ain using phenol chloroform. After another round of centrifugation at 132,000 rpm for 5 minutes, the top layer of the solution was transferred into another tube. RNA was then precipitated u s ing 3 M NaOAc and isopropyl alcohol T he mixture was kept in a 80 freezer overnight After the overnight freezing the solution was thawed and RNA pellets w ere formed in the bottom of tubes by centrifugation at 13,200 rpm for 30 minutes T he RNA pellet w as then air dried for 15 minutes. In the end, the RN A pellet s diss olved in RNa se free water and the RNA concentration s w ere determined using SmartSpec Plus s pectrophotometer The quantity of total RNA was measured by absorbance at 260 nm

PAGE 20

20 and t he quality of total RNA was evaluated by measur ing the A260/A280 ratio. A ratio greater than 1.8 indicate s high purity of the corresponding RNA sample 1.3.3 Real Time PCR R eal time PCR was performed to determine the mRNA expression levels of the genes of interest. The same amount (1 g) of total RNA was first used for cDNA synthesis in each sample, and an equal amount of cDNA was synthesized. After the cDNA synthesis, 2 L of cDNA was used as template for each PCR run. The iQ SYBR Green Supermix real time PCR kit ( BioRad Hercules, CA ) was used in order to quant ify the expression levels of the tested genes. For each run of PCR, 10 L of the Supermix, 2 L of cDNA template, 2 L of PCR primers, and 9 L of water were mixed together in one tube. The information of the primers used in the in vitro experiment could be fo und in Table 1 5 The PCR mixture was then transferred into a plastic 96 well plate, sealed with transparent plastic film, and placed onto a real time PCR machine. The machine was controlled by a computer program, which ran 40 amplification cycles under th e designated annealing temperature. The minimal number of cycles a sample took to achieve the threshold of detection indicated the abundance of cDNA of the gene at the beginning of the PCR reaction, which was determined by the mRNA level of the gene in the sample. As a result, the threshold cycle provided a good measurement of mRNA expression level s of the tested genes. The detailed calculation on gene expression level is described as bellows. If the threshold cycle of an examined gene was CT target and the threshold cycle of actin) was CT actin then fold change in expression level (normalized by the internal control gene and control treatment) of a certain targeted gene from a certain treatment group was determined by:

PAGE 21

21 F old Change = 2 target CT actin treatment control 1. 3. 4 Optimization of PRR siRNA T reatment in Cultured M ller Cells In this study, to optimize the PRR siRNA treatment condition in cultured human M ller cell s, the cells were divided into five different treatment groups to determine the optimal concentration and incubation time of the PRR siRNA. The ON Target plus PRR siRNA (Thermo Fisher Scientific Waltham, MA ) was added into cell culture medium according to the following treatment group design. The five treatment groups were ( 1) 30 nM PRR siRNA for 24 hours; ( 2) 30 nM PRR siRNA for 48 hours; ( 3) 100 nM PRR siRNA for 24 hours; ( 4) 100 nM PRR siRNA for 48 hours; and ( 5) control group without treatment (Table 1 1) The treatment concentrations and the incubation periods were When the ce lls grew to 70% confluence, serum medium w as replaced by Opti MEM I reduced serum medium (Life Technologies Carlsbad, CA ), an d the siRNA was added into the medium. After another 24 hour incubation with the siRNA the cells were lysed with TRI zol reagent (Life Technologies Carlsbad, CA ), and the RNA was extracted according to the RNA extraction protocol described above T he cDNA was synthesized using the New Enhanced Avian RT PCR Kit ( Sigma instruction and regular PCR was performed subsequently to amplify both actin and PRR. To quantify the PCR products, 5 L per sample of the PCR pr oducts were loaded onto 1% agarose gel. After running the gel at 130 mV for 30 minutes, the band intensities were quantified using densitometric analysis. To obtain the relative mRNA expression levels of PRR, the expression levels of PRR w ere normalized wi th actin mRNA expression levels.

PAGE 22

22 1.3. 5 Treatment G roups of M ller Cells In the in vitro study on M ller cells, t he cells were divided into 12 different treatment groups which were ( 1) control without treatment; ( 2) PRR siRNA; ( 3) control siRNA; ( 4) prorenin + PRR siRNA; ( 5) prorenin + control siRNA; ( 6) prorenin + PRR siRNA + losartan; ( 7) prorenin; ( 8) prorenin + HRP; ( 9) prorenin + losartan; ( 10) prorenin + captopril; ( 11) prorenin + HRP + losartan; ( 12) HRP ( Table 1 2 ). The t reatment s were repeated twice with two runs (2 replica tion s in each r un ) When the ce lls grew to 70% confluence, serum medium w as replaced by Opti MEM I reduced serum medium ( Life Technologies Carlsbad, CA ), and the ON Target plus PRR siRNA ( Thermo Fisher Scientific Waltham, MA ) or control siRNA ( Thermo Fisher Scientific Waltham, MA ) was added into the medium at a final concentration of 30 nM. After 24 hour incubation with the siRNA, the cells were incubated with serum free DMEM medium ( Thermo Fisher Scie ntific Waltham, MA ) for 2 hours. Following the serum starvation the cells were divided into twelve different treatment groups which received individual treat ments according to Table 1 2 After the 6 hour treatment, RNA was extracted following the TRI zol extraction method describ ed previously. The cDNA was subsequently synthesized. As the end point assays, the mRNA expression levels of several inflammat ory cytokines (IL 6, TGF 2, ACE, angiotensin ogen MAS receptor A T1R ) w ere determined using the iQ SYBR Green Supermix real time PCR kit (BioRad Hercules, CA ) following the manufacturer instruction

PAGE 23

23 1.3. 6 Calculation of the Treatment Compound Concentrations 1.3. 6 .1 AT1R inhibitor l osartan To block AT1R, losartan wa s used at a final concentration of 10 M The concentration was determined both according to previous studies ( 33 ) and the pharmacokinetics calculation. The Ki value for losartan is 10 nM on AT1R, and the Kd value of Ang II on AT1R is 0.13 nM ( 33 34 ) As a result, if 10 M of losartan is added, then the apparent Kd of Ang II is: Kd (apparent) = Kd (1 + [I] / Ki) = 0.13 nM (1 + 10,000nM / 10 nM ) = 130 nM. According to [AT1R] / [AT1R + Ang II] = Kd (apparen t) / [ Ang II], with apparent Kd increas ing from 0.13nM to 130 nM, the ratio of free AT1R versus Ang II occupied A T1R would reduce to 0.01% if 10 M losartan is added. 1.3. 6 .2 ACE inhibitor captopril The Ki value of captopril on ACE is from 1.7nM to 55 nM according to several different publications ( 35 37 ) The Kcat/Km of ACE on Ang I is 2.50 ( 38 ) If we take 20 nM as the Ki value and use 10 M of captopril, then the apparent Km is calculated as: Km (apparent) = Km (1 + [I] / Ki) = 51 Km Therefore, the reaction rate catalyzed by ACE is given by: V = (Kcat / Km (apparent)) [E] [S] = 0.02 (Kcat / Km) [E] [S] = 0.02 V 0 According to the calculations right above 10 M of captopril reduce s the ACE catalyzed reaction ( Ang II generation) speed to 2% of the original speed without captopril 1.3. 6 .3 Prorenin and HRP According to a previous study, the Kd of prorenin on PRR i s 1 .8 nM, the Ki of HRP on PRR is 6.6 nM ( 32 )

PAGE 24

24 If 100 nM is used, the ratio of unoccupied receptor v ersus occupied receptor is: [PRR] / [prorenin + PRR] = Kd / [prorenin] = 1.8 nM / 100 nM = 0.0018 This means that 99.8% of the PRR is occupied by prorenin Moreover, if 10M HRP is used, then the apparent Kd value of prorenin on PRR changes to: Kd (apparent) = Kd (1 + [I] / Ki) = 1.8 nM (1 + 10 ,000nM / 6.6 nM ) = 2 ,729 nM. The ratio of un occupied receptor v ersu s occupied receptor is then given by : [PRR] / [prorenin + PRR] = Kd (apparent) / [prorenin] = 2,729 nM / 100 nM = 0.035 This means only 3.5% of the PRR is occupied by PRR ; other bindings are blocked by the 10M HRP. 1.3.7 Data Analysis The real time RT PCR data were first analyzed individuall y (by genes) using two way analysis of variance ( ANOVA ) In the AVOVA test, the treatments is one factor and the batch of treatment is the other factor. F urther between group comparison was conducted to compare changes on expression level s of the genes between every two different treatment groups least significant difference ( LSD ) For the sta tistical test the critical p value is set at 0.05. 1.4 Results 1.4. 1 Two Way ANOVA Result s of the Gene Expression Data T he two way ANOVA test ing results for all the cytokines and RAS genes are listed in Table 1 6 with F and p values for the two main effects (treatment, run) and their interaction (treatment*run). For the main effects, the treatment effect refers to the variance coming from the diff erent treatments, and the run effect refers to the variance

PAGE 25

25 coming from different batches of treatments. The same treatment was repeated twice in each batch (run) of treatments, and there are two batches (runs) in the entire in vitro experiment. It was fou nd that according to the reported F values and p values, the main effects were often significant or close to being significant. However, no significant interaction effect was observed. As a result, the interaction effects were excluded for the further betw een group comparison. 1.4. 2 Effect s of P rorenin on Cytokine Expression in Cultured H uman M ller Cells To test the hypothe sis that prorenin is able to increase the expression of pro inflammatory cytokines; M ller c ells were treated with prorenin and th e mRN A expression levels of IL 1 6, TGF 6 hours after the prorenin treatment were examined. The result showed that the prorenin treatment significantly increase d the mRN A expression of several key pro inflammatory cytokines in M ller cells, including IL 1 (by 12 fold s ) IL 6 (by 10 fold s ) TGF 1 fold ) and TNF (by 2 folds ) (Figure 1 4). However, the prorenin treatment failed to stimulate a significant increase in the expression of TGF (Figure 1 4 ) These results su ggest the treatment of prorenin was able to increase the expression of certain cytokines in cultured M ller cells. 1.4. 3 The E xpression of the P rorenin R eceptor (PRR ) in M ller Cells and the Effect of PRR siRNA Previous studies completed by our lab have shown that the PRR is expressed on the surface of M ller cells ( Figure 1 1 ), and as a result, the possible functions mediated through the receptor are expected to be blocked by the treatment of the PRR siRNA. The purpose of this experiment is to establish an optimal treatment condition, so that the expression of PRR in cultured M ller cells could be decreas ed In this experiment,

PAGE 26

26 the cells were treated with different concentration s (100nM or 30 nM) of PRR siRNA for 24 hours or 48 hours and t he result of the PRR expression on M ller cells is shown as in Figure 1 3 It was observed that c omparing with the control M ller cells, PRR mRNA expression decreased in both 30nM and 100 nM PRR siRNA treated M ller cells. In both treatment groups, the 24 hour treatment of the siRNA decreased the mRNA expression level of PRR by about 75%, and the 48 hour s of treatment decreased the expression level of PRR by about 85% ( Figure 1 3 ). This result show ed that the 24 hour s of 30 nM PRR siRNA treatment effectively decrease d the ex pression level of PRR in M ller cells. Based on the result the 24 hour treatment of 30 nM PRR siRNA is sufficient to serve the purpose of knocking down the expression of PRR As a result, the treatment described above was used in our subsequent in vitro e xperiment to block the synthesis of PRR 1.4. 4 Effects of RAS Blockers on Prorenin Stimulated Cytokine Release in Cultured H uman M ller C ells AT1R i losartan and ACEi captopril were al so used to test if the prorenin stimulated cytokine release was mediated via Ang II dependent pathway. The comparison between the prorenin treated group and the losartan + prorenin treated group demonstrat ed that the losartan + prorenin treated group had a significantly lower expression of IL 1 IL 6 TGF F than the group treated only with prorenin (by 90% 72%, 54%, 75%, respectively) (Figure 1 4 ) The treatment of ACE i captopril also significantly block ed the overexpression of IL 1 TGF d by prorenin by 72% 55%, 67%, respectively ; bu t failed to decrease the expression of IL 6 significantly ( Figure 1 4 ) Further comparison b etween the control group and the captopril + prorenin group confirmed the result, with the cap topril + prorenin group

PAGE 27

27 having IL 1 TGF expression level not significantly different from the control group but the expression level of IL 6 was significantly higher in the captopril + prorenin group (by 2 fold s ) than in the control group (Figure 1 4 ). The comparison b etween the control group and the prorenin + losartan group showed th at the expression levels of IL 1 IL 6, TGF were not significantly di fferent between the two groups (Figure 1 4 ). Together, these results indicated Ang II ne stimulating effect. 1.4. 5 Effects of PRR Knockdown and Blocking Prorenin PRR Interaction with HRP on Prorenin Stimulated Cytokine Release According to previous studies, PRR siRNA was able to knock down the expression level of PRR mRNA by 75% (Figure 1 2 ) and HRP was a n antagonist of PRR. As a result, both of them reduce d prorenin PRR interaction. By treating M ller cells with prorenin + PRR siRNA or prorenin + HRP, we can check if prorenin PRR s pro inflammatory effe ct. Since both PRR siRNA and HRP reduced prorenin PRR interaction, the treatments should inhibit both the Ang II dependent and independent pathway s activat ed by prorenin. Therefore, by comparing the cytokine inhibiting effect between HRP/PRR siRNA and RAS blockers, we can determine if the Ang II independent pathway is also stimulating effect. The comparison between the prorenin treated gro up and the prorenin + PRR siRNA treated group show ed that pro inflamm atory effect was partially blocked by PRR siRNA treatment ( Figure 1 4 ). Comparing to the prorenin group, t he t reatment of 30 nM PRR siRNA + prorenin significantly decrease d the expression of IL 1 TGF by 95 % 51% and 69%, respectively ( Figure 1 4 ) However, the

PAGE 28

2 8 expression levels of IL 6 were not significantly d iffe rent between the prorenin group and the PRR siRNA + prorenin group (Figure 1 4). Comparing to the control group, the PRR siRNA + prorenin group had a significant higher expression lev el of IL 6 (by 55%), while the expression levels of IL between the two groups (Figure 1 4). On the other hand, t he control siRNA + prorenin treatment did not alter any of the cytokine expression level a nd no significant difference on the cytokine expression was observed between the control siRNA + prorenin group and the prorenin group ( Figure 1 4 ) The group treated only with HRP had a significantly lower expression level of IL 1 TGF ( by 85 % 68% and 75%, respectively) than the prorenin treated group while the expression level of IL 6 are not significantly different between the two groups. T he HRP treated group also had similar expression levels of IL TGF as the control group while the IL 6 expression level in the HRP group was significantly higher than the control group (by 3 folds) ( Figure 1 4 ) The comparison between the HRP + prorenin group and the prorenin group showed that the HRP treatment significantly reduce d t he prorenin induced expression of IL 1 ( by 83 % ) IL 6 ( by 94 % ), TGF ( Figure 1 4 ) The comparison between the control group and the HRP + prorenin group also indicated that the HRP treatment was able to reduce the prorenin sti mulated expression IL 1 IL 6, TGF and TNF down to the control levels Together, thes e results demonstrate d that the treatment of HRP inhibit stimulating effect completely. Therefore, PRR stimulating effect.

PAGE 29

29 1.4. 6 Effects of the Combination Blockade with RAS Blockers and PRR siRNA / HRP on Prorenin Stimulated Cytokine Release Finally, to study if the pro inflammatory effect of prorenin was mediated through the Ang II in dependent pathway, M ller cells were treated with a combination of prorenin + losartan + PRR siRNA or prorenin + losartan + HRP. By examin ing the cytokine reducing effects of PRR siRNA and HRP in the pr esence of losartan, we could determine whether the Ang II independent pathway was involved in the cytokine stimulating effect of prorenin. The comparison between the prorenin treated group and the prorenin + losartan + PRR siRNA treated group show ed that the t reatment of losartan + PRR siRNA significant ly inhibited the prorenin stimulated expression of IL 1 (by 95% ) IL 6 (by 83% ) TGF T he treatment of losartan + HRP + prorenin on the other hand, also resulted in sig nificantly lower expression levels of IL 1 (by 95% ) IL 6 (by 96% ) TGF than the prorenin group ( Figure 1 4 ) The comparison between the control group and the prorenin + PRR siRNA + losartan group show ed that the expression of IL 1 IL 6, TGF in the prorenin + PRR siRNA + losartan group w as reduced to the control level s (Figure 1 4 ) The treatment of prorenin + HRP + losartan, on the other hand, also reduced the expr ession of 1L 1 IL 6 TGF down to the control group level s (Figure 1 4 ), suggesting the effect of prorenin on cytokine expression was totally blocked by the treatment of HRP + losartan and PRR siRNA + losartan However, since the cytokine inducing effect of prorenin wa s mostly blocked by AT1Ri losartan, there was no statistical evidence showing that the treatment of PRR siRNA/HRP + losartan worked better than losartan on blocking the cytokine stimulating effect of prorenin. As a result,

PAGE 30

30 although there was a trend that t he combination treatments had more cytokine inhibiting effect than the losartan treatment, the contribution of Ang II independent pathway to the stimulating effect was uncertain. 1.4. 7 Effect s of Prorenin T reatment on RAS Gene Expression in Cultured H uman M ller Cells Since the RA S is an important regulator of the inflammatory response, the prorenin treatment may modulate the production of pro inflammatory cytokines by altering the expression level s of RAS components T heref ore, t he effect of prorenin treatment on the expression of RAS gene expression in M ller cells was also investigated. T o test the effect of prorenin on RAS gene expression, M ller cells were treated with prorenin, and the expression levels of ACE, ACE 2, AT1R angiotensin ogen PRR and the MAS receptor were exami ned in the experiment using real time RT PCR method. T he comparison between the control group and the prorenin treated group demonstrate d that prorenin treatment o n M ller cells significantly increased the expression of most of the RAS genes, including ACE 2 (by 1.3 fold) AT1R (by 3 fold s ) angiotensinogen (by 32%), PRR (by 6 fold s ) and the MAS receptor (by 1.6 fold s ) (Figure 1 5). However, the increase in ACE expression was not significant ( Figure 1 5 ) 1.4. 8 Effects of RAS Bloc kers on RAS Gene Expression in Prorenin Treated M ller Cells M ller cells were also treated with ACEi captopril (ACE inhibitor) or AT1Ri losartan in addition to prorenin, as an attempt to test if the Ang II signalin g pathway was involved in the prorenin induced RAS gene expression. It was observed that t he t reatment of losartan significantly lowered the prorenin induced e xpression of A T1R by 73% ACE 2 by 58 % and angiotensinogen by 17% (Figure 1 5). However, no signi ficant

PAGE 31

31 difference was observed between the prorenin + losartan group and the prorenin group over the expression levels of ACE, PRR or the MAS receptor. T he treatment of captopril also significant ly block ed the prorenin induced increase in the AT1R expression by 61% and angiotensinogen by 27% (Figure 1 5 ) However, comparing to the prorenin treated group, captopril + prorenin group did not have significantly different expression levels of ACE ACE 2, PRR or the MAS receptor (Figure 1 5 ) The compari son between the control group and the prorenin + captopril group showed tha t the expression levels of ACE 2 PRR and the MAS receptor we re significantly higher (by 53%, 5 folds and 91%, respectively) in the prorenin + captopril group than in the control gr oup. However, t he expression levels of ACE, AT1R and angiotensinogen were not significantly different between the prorenin + captop ril group and the control group (Figure 1 5 ). This result suggested the treatment of captopril completely inhibited the prore nin induced expression of AT1R an d angiotensinogen The treatment of prorenin + losartan, on the other hand, had significantly higher expression levels of only PRR ( 7 folds higher) and the MAS receptor ( 1.4 folds higher) than the control group (Figure 1 5 ) ; with the expression levels of ACE, ACE 2, angiotensinogen and AT1R not significantly different from the control group As a result, the overexpression of ACE 2, angiotensinogen and AT1R induced by prorenin was totally blocked by losartan. 1.4.9 Effects o f PRR Knockdown and Blocking Prorenin PRR Interaction with HRP o n RAS Gene Expression i n Prorenin Treated M ller Cells P revious result of pro renin treatment showed that prorenin was able to increase the expression of most of the tested RAS genes. To furthe r study whether prorenin PRR interaction was required for regulation on RAS gene expression, M ller cells

PAGE 32

32 were treated with PRR siRNA or HRP in addition to prorenin, and the mRNA expr ession levels of the same RAS genes were examined. T he compar ison between the PRR siRNA + prorenin group and the prorenin group showed that the expression levels of ACE 2, AT1R angiotensinogen and PRR w ere significantly lower (by 57%, 79%, 25%, 99% and 30%, respectively) in the PRR siRNA + prorenin group than in the porenin group (Figure 1 5 ). However the expression levels of ACE and the MAS receptor were not significantly different between the PRR siRNA + prorenin group and the prorenin group. T he RAS gene expression levels were not significantly different betwe en the control siRNA + prorenin group and the prorenin only group (Figure 1 5 ). In the group treated with on ly HRP, the expression levels of ACE, ACE 2, angiotensinogen, AT1R, PRR, and MAS receptor in the HRP group were all significantly lower (by 67%, 46% 46%, 61%, 77% and 56%, respectively) than prorenin group (Figure 1 5 ). The treatment of HRP in addition to prorenin, on the other hand, significantly reduced the expression level s of ACE 2 (by 59%) AT1R (by 78%) angiotensinogen (by 48%), PRR (by 76%) a nd the MAS receptor (by 52%) stimulated by prorenin (Figure 1 5 ) However, the expression levels of ACE were not significantly different between the HRP + prorenin group and the prorenin group (Figure 1 5 ) A further comparison between the control group and the prorenin + PRR siRNA showed that the expression levels of ACE, ACE 2, AT1R, angiotensinogen, PRR and MAS receptor were not significantly different between the two groups. A nother comparison between the control group and the prorenin + HRP group demonstrate d that the expression levels of angiotensinogen were significantly lower (by 31%) in the prorenin + HRP group than in thecontrol group. Moreover, the expression levels of ACE,

PAGE 33

33 ACE 2, AT1R, PRR and MAS receptor were not significantly different between the two groups. This result suggested HRP had a n inhibitive effect on all the overexpressed RAS genes induced by prorenin. Together, these results indicated prorenin PRR interaction was required for proreni 1.4.10 Effect s of the C ombination of Losartan plus PRR siRNA / HRP on RAS Related Gene Expression in Prorenin Treated M ller Cells In order to test if the Ang II independent pathway was involved in mediating effect on RAS gene expression M ller cells were also treated with PRR siRNA + losartan + prorenin or HRP + losartan + prorenin. T he comparison between the prorenin treatment and the PRR siRNA + losartan + prorenin treatment demonstrate d that the PRR siRNA + losartan + prorenin treated group had significantly lower expression levels of ACE 2 (by 58%) AT1R (by 78%) angiotensinogen (by 39%), PRR (by 97%) and the MAS r eceptor (by 69%) than the prorenin only group ( Figure 1 5 ). However, t he expression levels of ACE and angiotensinogen were not significantly different between the two groups. T he treatment of HRP + losartan + prorenin also significantly blocked the prorenin induced over expression of ACE (by 74%), ACE 2 (by 82%) AT1R (by 90%) angiotensinogen (b y 47%), PRR (by 94%) and the MAS receptor (by 81%) ( Figure 1 5 ) The above results indicate d that the combination treatment s of PRR siRNA + losartan and HRP + losartan were both able to decrease the expression of most of the RAS genes induced by prorenin Moreover, t he expression levels of ACE 2, AT1R, angiotensinogen, PRR and the MAS receptor were not significantly different between the PRR siRNA + losartan + prorenin group and the control group (Figure 1 5 ). The treatment of HRP + losartan + prorenin, on the other hand, led to significantly lower expression levels of ACE 2 and

PAGE 34

34 angiotensinogen (by 30%) than the control group. This result suggest ed the combination treatment of HRP + losartan + prorenin was ve ry effective at blocking (Figure 1 5 ). In general, these results showed that HRP and PRR siRNA treatment were both able to inhibit the prorenin stimulated RAS gene expression in the presence of losartan. As a resu lt, the Ang II independent pathway played a major role in mediating prorenin induced RAS gene overexpression. 1.4.11 Effects of the Treatments on the Expression Ratios of ACE/ACE 2 and AT1R/MAS Receptor in M ller Cells Sin ce both the pro inflammatory Ang II AT1R and the anti inflammatory Ang 1 7 MAS receptor mediated signaling pathways were enhanced upon the treatment of prorenin, it is hard to determine the overall effect of the prorenin treatment on inflammation through ch anging RAS gene expression. T o eva luate the overall treatment effect of prorenin and the effects of RAS blockers [ ACEi captopril, AT1Ri losartan, PRR siRNA and the PRR antago nist HRP ] the expression ratios of ACE/ACE 2 and AT1R/MAS receptor were studied. It was observed that the expressi on ratio s of ACE/ACE 2 w ere not significantly different among the treatment groups (Figure 1 5 ), suggesting the treatment s did not have much effect on ACE/ACE 2 ratio. Comparing to the control group, t here was a two fold increase in the expression ratio of AT1R/Mas receptor in the prorenin treated group but statistical test failed to report a significant difference. However, both t he losartan + prorenin group and the losartan + HRP + prorenin group had significantly lower AT1R/MAS receptor ratios than the prorenin treated group (Figure 1 5 ), suggesting the treatment of losartan and losartan + HRP had more inhibitory effect on

PAGE 35

35 the AT1R mediated pathway than the MAS receptor mediated pathway. It was also observed that the prorenin + control siRNA group had a significant higher ratio of AT1R/MAS receptor (3 folds higher) than the control group. However, no significant difference among the other treatment groups was observed. 1.5 D iscussion In this study, M ller cells w ere treated with 100 nM of prorenin, and the expression level s of several key inflam matory cytokines, including IL 1 6, TGF and TNF ere examined. The result show ed that at 100 nM concentration, prorenin wa s able to increase the expres sion levels of IL 1 IL 6 TGF and TNF significantly A further tre atment of M ller cells with 100 nM prorenin plus AT1Ri losartan demonstrate d that the addition of the AT1R i significantly reduced the expression of IL 1 IL 6 TGF and TNF and the expression levels of these cytokines were not different between the losartan + prorenin group and the control group. This result suggest ed the treatment of AT1Ri blocked most of the cytokine stimulating effect of prorenin. A similar cytokine inhibiting effect of ACEi captopril was also observed I n the prorenin + captopril treated M ller cells, the expression level s of IL 1 TGF and TNF w ere significantly lower than the prorenin group but the expression levels of IL 6 were not significantly different between the two treatment groups It was also note d that the captopril + prorenin group had a significantly higher expression level of IL 6 than the control group, while the expression levels of IL TGF were not significantly diff erent between the control group and the prorenin + captopril group T ogether, these results suggest ed that the blockade of Ang II signaling pathway blocked most of regulating cytokine expression in M ller cells

PAGE 36

36 Therefore, the A ng II dependent pathway played a central role in mediating the cytokine stimulat ing effect of prorenin The treatment of M ller cells with HRP or PRR siRNA was also able to down reg ulate the expression of the cytokines stimulated by prorenin treatment The blockade (HRP) and knock ing down (PRR siRNA) of PRR both reduced the interaction of PRR with prorenin, so both treatments w ere able to reduce the intrace llular responses coming from the direct binding of prorenin with PRR and the indirect Ang II depen dent pathway. The treatment of HRP effectively reduced the expression levels of all the tested cytokines down to the control level, while the treatment of PRR siRNA significantly inhibited the prorenin induced expression of IL 1 TGF and TNF ; but not IL 6. stimulating effect completely; stimulating effect. This result suggested HRP worked better on suppressing the prorenin st imulated cytokine expression possibly because PRR siRNA was not able to reduce PRR expression completely Since HRP totally blocked the cytokine stimulating effect of prorenin, prorenin inducing effect. Finally, the treatment combination s HRP + losartan and PRR siRNA + losartan both significantly suppressed the expression of IL 1 IL 6 TGF and TNF induced by pror enin Comparing to the control untreated group, the treatment of HRP + losartan + prore nin and PRR siRNA + losartan + prorenin both reduced the expression levels of IL 1 6, TGF and TNF down to the control level. In other words, t he combination treatments

PAGE 37

37 stimul ating effect completely. Comparing to the losartan + prorenin group, there is a trend that the treatment of HRP + losartan and PRR siRNA + losartan provided additional cytokine inhibiting effect especially on IL 6 So t ogether, t hese results indicated HRP and PRR siRNA might be stimulating effect in the presence of losartan, suggesting HRP and PRR siRNA possibly suppressed prorenin stimulated cytokine expression through the Ang II in dependent pathway Therefore, this result indicat ed the Ang II in dependent pathway might also play a role i on inducing cytokine expression However, since the cytokine inhibiting effects of HRP and PRR siRNA in the presence of losartan failed to be statisticall y significant, the involvement of Ang II independent pathway in mediating prorenin induced cytokine expression is still not clear. It was also noticed in the experiment that the HRP treatment was more effective RNA treatment. A possible explanation for th is is th at PRR siRNA did not completely knock down the expression of PRR. I n the preliminary study, the 30nM PRR siRNA treatment for 24 hours only decreased the mRNA expre ssion of prorenin by about 75%. Depending on the protein turnover rate, the decrease in functional PRR could be even less than 75%. As a result, at least one fourth of the total PRR was still functioning, meaning the prorenin PRR interaction was not completely blocked. The 10 M of HRP treatment, on the other hand, could block more than 95% of the prorenin PRR binding according to previous calculations. Therefore it is not surpris ing that HRP was more effective than PRR siRNA. It was also observed that losartan worked better than captopril on bloc king cytokine stimulating effect. Since it is well known that patients taking ACE

PAGE 38

38 inhibitors have higher plasma renin level s ( 36 ) it is possible that in this experiment, the treatment of ACEi captopril also up regulated the expression of renin. With the overexpression of renin stimulated by captopril the Ang I I mediated pro inflammatory signaling pathway was enhanced. Theref ore, th e treatment of losartan had stronger anti inflammatory effect than the treatment of captopril. W e noted that not all the examined cytokines were equally elevated in response to the prorenin treatment. Among the cytokines tested, only IL 1 6 express ion levels w ere significantly increased by more than 10 folds following the prorenin treatment. For TNF only two folds, and the increase in TGF even smaller (by 1 fold). There could be an explanation for this. Among the examined cy tokines, IL 6 and TNF regulation, and the expression levels of them could rise rapidly and enormously during the initial phase of inflammatory response ( 39 ) As a result, huge increases in the expression of both IL and IL 6 and a relatively large increase in the expression of TNF were observed. However, the expression of TGF uring the repairing phase of inflammation ( 40 ) so the cytokine had the least amount of increase in its expression level The treatment of M ller cells with prorenin was also able to up regulate the expression of RAS components, including ACE 2, AT1R angiotensinogen, PRR and the MAS receptor. In the Ang II mediated s ignaling pathway, angiotensinogen is converted to Ang I by the prorenin that binds with PRR, and is further converted to Ang II by ACE ( 22 ) The Ang II eventually binds with AT1R to generate an inflammatory response ( 19 ) As a result, with t he up regulation of A T1R and PRR, the Ang II s ignaling

PAGE 39

39 pathway was enhanced, leading to an increase in inflammation The Ang 1 7 signaling pathway, on the other hand, depends upon the enzymatic activity of ACE 2 and the abundance of the MAS receptor. The ACE 2 first converts Ang II to Ang 1 7, and the Ang 1 7 further binds to MAS receptor to generate an anti inflammatory response. Since the prorenin treatment also increased the expression of both ACE 2 and MAS receptor, the Ang 1 7 pathway was also enhanced. Through regulating the RAS gene expression, the prorenin treatment not only increase d the Ang II signaling activity by up regulating AT1R and PRR expression ; but also enhanced the Ang 1 7 signaling pathway by increasing the expression of ACE 2 and MAS receptor. F urther treatment s of M ller cells with prorenin plus RAS inhibitors [ACE inhibitor (ACEi) captopril, AT1R inhibitor (AT1Ri) losartan, siRNA PRR and the PRR antago nist HRP ] showed that the effect of prorenin on M ller cell RAS gene expression wa s mediated both through the Ang II dependent and independent pathway s Among the treatment groups, the treatment of AT1Ri losartan significantly reduced the expression levels of A T1R ACE 2 and angiotensinogen stimulated by prorenin, s uggesting the prorenin induced increases in AT1R and ACE 2 expression was Ang II pathway dependent. When the prorenin PRR interaction was block ed by HRP, however, prorenin was not able to stimulate the overexpress ion of the RAS genes suggesting the prorenin PRR interaction was necessar y for stimulating effect on RAS gene expression Moreover, the treatment combinations of both HRP + losartan + prorenin and PRR siRNA + losartan + prorenin also decreased the expression of all the prorenin induced RAS genes. Since losartan only inhibited the overexpression of AT1R ACE 2 and angiotensinogen, this result indicated both HRP and PRR siRNA were able to

PAGE 40

40 decrease the other prorenin stimulated RAS gene overexpression in the presence of losartan. As a result, a mong the RAS genes examined in the experiment, the overexpression of AT1R ACE 2 and angiotensinogen was mediated by the Ang II dependent pathway, while the overexpression of the MAS receptor and PRR was mediated by the Ang II independent pathway Since the Ang II and the Ang 1 7 pa thways have contrary effect s o n the regulation of inflammation, the increase s in almost all the RAS gene expression ha d a mixed ef fect over the change of the pro inflammatory cytokine expression in th e prorenin treated M lle r cells. However, a further study i n the ratios of ACE/ACE 2 and AT1R/MAS receptor indicated that the treatment of prorenin raised AT1R/MAS receptor ratio from 1 to 3.2 while ACE/ACE 2 was relatively stable Therefore the treatment of prorenin caused more increas e in the expression of the genes involved in Ang II pathway than the genes involved in Ang 1 7 pathway indicating the overall treatment effect of prorenin on M ller cells was pro inflammatory. Comparing to the prorenin treatment, t he treatment s of losartan + prorenin and losartan + HRP + prorenin w ere able to down regulate AT1R/MAS receptor ratio suggesting these treatments inhibited ratio. T hese result s showed RAS inhibitor losartan was able to down regulate AT1R/MAS receptor ratio s o the blockade of the Ang II dependent pathway provided anti inflammatory effect by decreasing prorenin stimulated incr ease in AT1R/MAS receptor ratio. I n general, the treatment of prorenin had a pro inflammatory effect by up regu lating AT1R/MAS receptor; and the blockade of the Ang II dependent pathway provided anti inflammatory effect by down regulating AT1R/ MAS receptor.

PAGE 41

41 In conclusion, the results from the in vitro experiment indicated that prorenin was able to stimulate the exp ression of certain cytokines, including IL IL 6, TGF TNF in cultured M ller cells. Therefore, t he prorenin treatment had a pro inflammatory effect on the cells. Since M ller cells are immune active glial cells in retina s the result also suggest ed that prorenin was a possible contributor to retinal inflammation. Moreover, the cytokine stimulating effect of prorenin treatment was mostly blocked by AT1R block er losartan, suggesting the pro inflammatory effect of prorenin was largely mediated through the Ang II dependent pathway. The treatment of HRP blocked prorenin PRR interaction, which also decrease d the cytokine over expression indu ced by prorenin, indicating prorenin PRR interaction was necessary for the pro inflammatory effect of prorenin. Furthermore, in the presence of losartan, the HRP treated M ller cells showed a trend of decrease in the prorenin induced cytokine overexpression indicating the pro inf lammatory effect of prorenin might also be mediated thr ough the Ang II in dependent pathway The result of RAS gene expression also suggest ed a possi ble inflammatory effect. It was observed in the experiment that prorenin treatment was able to up regulate the expression of many RAS ge nes, including ACE 2, AT1R angiotensinogen, PRR and the MAS receptor. A further study on ACE/ACE 2 and AT1R/MAS receptor ratios indicated the treatment of prorenin had a pro inflammatory effect by up regulating AT1R/MAS receptor ratio and the blockade of the Ang II dependent pathway by losartan had anti inflammatory effect by down regulating AT1R/MAS receptor ratio to the control level

PAGE 42

42 Table 1 1 The treatment design of the siRNA pilot experiment Treatment # Reagents and concentration Treatment time 1 3 0 nM PRR siRNA 24 hours 2 30 nM PRR siRNA 48 hours 3 100 nM PRR siRNA 24 hours 4 100nM PRR siRNA 48 hours 5 None None

PAGE 43

43 Table 1 2 The treatment design of the in vitro experiment. Treatment # Prorenin (100 nM) PRR siRNA (30 nM) Control siRNA (30 nM) HRP (10 M) Losartan (10 M) Captopril (10 M) 1 2 + 3 + 4 + + 5 + + 6 + + + 7 + 8 + + 9 + + 10 + + 11 + + + 12 +

PAGE 44

44 Table 1 3. The expression of pro inflammatory cytokines in M ller cells in different treatment groups. With p < 0.05, g roups having the same letter under the are not significantly different Gene Treatment group Average level Standard error of the mean t grouping IL 1 Control 1 .00 0 .00 a IL 1 Prorenin 12.87 2.00 b IL 1 Control siRNA 0.61 0.0 3 a IL 1 Prorenin + control siRNA 11.1 6 2.1 8 b IL 1 PRR siRNA 0.6 6 0.03 a IL 1 Prorenin + PRR siRNA 1.36 0.17 a IL 1 HRP 1.9 6 0.2 6 a IL 1 Prorenin + HRP 2.15 0.3 1 a IL 1 Prorenin + captopril 3.5 5 0.80 a IL 1 Prorenin + losartan 1.2 9 0.14 a IL 1 Prorenin + PRR siRNA + losartan 0.69 0.1 2 a IL 1 Prorenin + HRP + losartan 0.6 1 0.14 a

PAGE 45

45 Table 1 3 Continued Gene Treatment group Average level Standard error of the mean t grouping IL 6 Control 1 .00 0 .00 c IL 6 Prorenin 11.1 4 0.9 7 a IL 6 Control siRNA 0.64 0.0 7 c IL 6 Prorenin + control siRNA 10.44 1.68 a, b IL 6 PRR siRNA 0.71 0.05 c IL 6 Prorenin + PRR siRNA 5.00 0.82 a, b, c IL 6 HRP 4.0 8 0.6 3 a, b IL 6 Prorenin + HRP 0.63 0.15 c IL 6 Prorenin + captopril 5.2 4 0.9 2 a IL 6 Prorenin + losartan 3.07 0.42 b, c IL 6 Prorenin + PRR siRNA + losartan 1.84 0.19 c IL 6 Prorenin + HRP + losartan 0.43 0.0 3 c

PAGE 46

46 Table 1 3. Continued Gene Treatment group Average level Standard error of the mean t grouping TGF Control 1 .00 0 .00 b TGF Prorenin 2.17 0.1 8 a TGF Control siRNA 0.64 0.0 4 b TGF Prorenin + control siRNA 1.91 0.15 a TGF PRR siRNA 0.7 4 0.05 b TGF Prorenin + PRR siRNA 1.0 7 0.07 b TGF HRP 0. 70 0.04 b TGF Prorenin + HRP 1.04 0.1 6 b TGF Prorenin + captopril 0.9 7 0.0 4 b TGF Prorenin + losartan 1.00 0.10 b TGF Prorenin + PRR siRNA + losartan 0.83 0.10 b TGF Prorenin + HRP + losartan 0.5 4 0.05 b

PAGE 47

47 Table 1 3. Continued Gene Treatment group Average level Standard error of the mean t grouping TNF Control 1 .00 0 .00 b TNF Prorenin 2.9 3 0.46 a TNF Control siRNA 0.60 0.0 8 b TNF Prorenin + control siRNA 2.97 0.4 1 a TNF PRR siRNA 0. 60 0.04 b TNF Prorenin + PRR siRNA 0.90 0.06 b TNF HRP 0.66 0.08 b TNF Prorenin + HRP 0.54 0.0 7 b TNF Prorenin + captopril 0.9 6 0.13 b TNF Prorenin + losartan 0.7 2 0.0 7 b TNF Prorenin + PRR siRNA + losartan 0.46 0.0 5 b TNF Prorenin + HRP + losartan 0.68 0.1 2 b

PAGE 48

48 Table 1 4 The expression of RAS genes in M ller cells in different treatment groups. Groups having significantly different. Gene Treatment group Average level Standard error of the mean t grouping ACE Control 1 .00 0 .00 a, b, c ACE Prorenin 2.42 0.25 a ACE Control siRNA 1.74 0.2 6 a, b, c ACE Prorenin + control siRNA 2.2 3 0.32 a, b ACE PRR siRNA 1.7 3 0. 20 a, b, c ACE Prorenin + PRR siRNA 1.82 0.2 2 a, b, c ACE HRP 0.79 0.07 b, c ACE Prorenin + HRP 1.7 4 0.2 3 a, b, c ACE Prorenin + captopril 1.5 4 0.18 a, b, c ACE Prorenin + losartan 1.8 8 0.33 a, b, c ACE Prorenin + PRR siRNA + losartan 1.75 0.29 a, b, c ACE Prorenin + HRP + losartan 0.6 2 0.0 2 c

PAGE 49

49 Table 1 4 Continued Gene Treatment group Average level Standard error of the mean t grouping ACE 2 Control 1 .00 0 .00 b ACE 2 Prorenin 2.31 0.0 4 a ACE 2 Control siRNA 1.01 0.02 b ACE 2 Prorenin + control siRNA 2.28 0.0 9 a ACE 2 PRR siRNA 0.99 0.0 3 b ACE 2 Prorenin + PRR siRNA 1.0 6 0.04 b ACE 2 HRP 1.24 0.04 b ACE 2 Prorenin + HRP 0.95 0.03 b ACE 2 Prorenin + captopril 2.13 0.0 7 a ACE 2 Prorenin + losartan 0.9 6 0.02 b ACE 2 Prorenin + PRR siRNA + losartan 0.96 0.0 4 b ACE 2 Prorenin + HRP + losartan 0.41 0.0 1 c

PAGE 50

50 Table 1 4. Continued Gene Treatment group Average level Standard error of the mean t grouping AT1R Control 1 .00 0 .00 b AT1R Prorenin 4.18 0.23 a AT1R Control siRNA 1.06 0.01 b AT1R Prorenin + control siRNA 4.83 0.2 8 a AT1R PRR siRNA 0.8 9 0.0 6 b AT1R Prorenin + PRR siRNA 1.10 0.06 b AT1R HRP 1.62 0. 30 b AT1R Prorenin + HRP 0. 90 0.04 b AT1R Prorenin + captopril 1.65 0.27 b AT1R Prorenin + losartan 1.14 0.05 b AT1R Prorenin + PRR siRNA + losartan 0. 90 0.02 b AT1R Prorenin + HRP + losartan 0.4 3 0.0 7 b

PAGE 51

51 Table 1 4. Continued Gene Treatment group Average Standard error of the mean t grouping Angiotensinogen Control 1.00 0.00 b, c Angiotensinogen Prorenin 1.32 0.03 a Angiotensinogen Control siRNA 0.87 0.01 c, d Angiotensinogen Prorenin + control siRNA 1.12 0.03 a, b Angiotensinogen PRR siRNA 0.99 0.02 b, c Angiotensinogen Prorenin + PRR siRNA 0.98 0.04 b, c Angiotensinogen HRP 0.71 0.02 d Angiotensinogen Prorenin + HRP 0.69 0.03 d Angiotensinogen Prorenin + captopril 0.96 0.04 b, c Angiotensinogen Prorenin + losartan 1.09 0.02 b Angiotensinogen Prorenin + PRR siRNA + losartan 0.81 0.02 c, d Angiotensinogen Prorenin + HRP + losartan 0.70 0.02 d

PAGE 52

52 Table 1 4 Continued Gene Treatment group Average level Standard error of the mean t grouping Prorenin receptor Control 1 .00 0 .00 b Prorenin receptor Prorenin 6.8 2 0.22 a Prorenin receptor Control siRNA 1.30 0.0 2 b Prorenin receptor Prorenin + control siRNA 6.81 0.26 a Prorenin receptor PRR siRNA 0.04 0.00 b Prorenin receptor Prorenin + PRR siRNA 0.04 0.00 b Prorenin receptor HRP 1.5 4 0.30 b Prorenin receptor Prorenin + HRP 1.61 0. 50 b Prorenin receptor Prorenin + captopril 5.6 7 0.18 a Prorenin receptor Prorenin + losartan 7.59 0.49 a Prorenin receptor Prorenin + PRR siRNA + losartan 0.22 0.06 b Prorenin receptor Prorenin + HRP + losartan 0.4 1 0.08 b

PAGE 53

53 Table 1 4 Continued. Gene Treatment group Average level Standard error of the mean t grouping MAS receptor Control 1 .00 0 .00 b, c MAS receptor Prorenin 2. 60 0.09 a MAS receptor Control siRNA 0.86 0.0 8 b, c MAS receptor Prorenin + control siRNA 1.54 0.1 8 a, b, c MAS receptor PRR siRNA 0.7 6 0.09 c MAS receptor Prorenin + PRR siRNA 1.8 2 0.18 a, b, c MAS receptor HRP 1.1 5 0.15 b, c MAS receptor Prorenin + HRP 1.25 0.12 b, c MAS receptor Prorenin + captopril 1.9 1 0.1 4 a, b MAS receptor Prorenin + losartan 2.42 0.33 a MAS receptor Prorenin + PRR siRNA + losartan 0.81 0.1 0 b, c MAS receptor Prorenin + HRP + losartan 0.50 0.03 c

PAGE 54

54 Table 1 5 Primer s used for real t ime PCR analysis in the in vitro studies. Species Gene name Accession number Sequences Expected size Human actin forward NM_001101.3 5'GCAGGAGTATGACGAGTCCG3' 337 Human actin reverse 5'AGGGACTTCCTGTAACAATGC3' Human IL NG_008850.1 5'ATCAGTACCTCACGGCTGCT3' 188 Human IL 5'TGGGTATCTCAGGCATCTCC3' Human IL 6 forward XM_005249745.1 5'CACTCACCTCTTCAGAACGAAT3' 306 Human IL 6 reverse 5'TTTGTACTCATCTGCACAGCTC3' Human TGF NM_000660.5 5'GTTCAAGCAGAGTACACACAGC3' 115 Human TGF 5'GTATTTCTGGTACAGCTCCACG3' Human TNF NM_000594.3 5'ATCTACTCCCAGGTCCTCTTCAA3' 295 Human TNF 5'GCAATGATCCCAAAGTAGACCT3' Human ACE forward NM_152830.2 5'GAACTCCGCTCGCTCAGAAG 3' 302 Human ACE reverse 5'CCAGTGTTCCCATCCCAGTC 3' Human ACE 2 forward NM_021804.2 5'CCCGCATCTCTGTTCCATGT3' 713 Human ACE 2 reverse 5'GGCTGGTTAGGAGGTCCAAG3' Human AT1R forward NM_004835.4 5'CGGCTGCTCGAAGAACAATG 3' 229 Human AT1R reverse 5'ATAGCTGAAAACCGGCACGA 3' Human Angiotensinogen forward NM_000029.3 5' GCAGATAACAACCCCGGACA 3' 142 Human Angiotensinogen reverse 5' TGCAGGCTTCTACTGCTCAC 3' Human PRR forward XM_005272576.1 5'AGCTGGCAGGTTTGGATGAA3' 314 Human PRR reverse 5'CCAAGGCCAAGGCGATCATT3' Human MAS receptor forward NM_002377.2 5'AGCACCATCTTGGTCGTGAA3' 214 Human MAS receptor reverse 5'AAGGGTTGGCGCTACTGTTG3'

PAGE 55

55 Table 1 6. Analysis of variance table of gene expression data in the in vitro experiment. Gene Source of variance Degree of freedom Type III sum of squares Mean square F Value Pr > F IL Treatment 11 725.5448336 65.9586212 3.30 0.0076 IL Run 1 75.7792633 75.7792633 3.79 0.0638 IL Treatment*run 11 181.8592715 16.5326610 0.83 0.6157 IL Error 23 459.600498 19.982630

PAGE 56

56 Table 1 6. Continued Gene Source of variance Degree of freedom Type III sum of squares Mean square F Value Pr > F IL 6 Treatment 11 890.8238596 80.9839872 4.06 0.0025 IL 6 Run 1 230.8050192 230.8050192 11.56 0.0026 IL 6 Treatment*run 11 387.9627223 35.2693384 1.77 0.1233 IL 6 Error 22 439.284548 19.967479

PAGE 57

57 Table 1 6. Continued Gene Source of variance Degree of freedom Type III sum of squares Mean square F Value Pr > F TGF Treatment 11 10.86603517 0.98782138 2.43 0.0332 TGF Run 1 0.42622968 0.42622968 1.05 0.3157 TGF Treatment*run 11 1.29201347 0.11745577 0.29 0.9819 TGF Error 24 9.74075916 0.40586496

PAGE 58

58 Table 1 6. Continued Gene Source of variance Degree of freedom Type III sum of squares Mean square F Value Pr > F TNF Treatment 11 2506.999456 227.909041 2.07 0.0664 TNF Run 1 0.024342 0.024342 0.00 0.9883 TNF Treatment*run 11 627.844210 57.076746 0.52 0.8724 TNF Error 24 37.89159768 1.57881657

PAGE 59

59 Table 1 6. Continued Gene Source of variance Degree of freedom Type III sum of squares Mean square F Value Pr > F ACE Treatment 11 2506.999456 227.909041 2.07 0.0664 ACE Run 1 0.024342 0.024342 0.00 0.9883 ACE Treatment*run 11 627.844210 57.076746 0.52 0.8724 ACE Error 24 29.03245677 1.20968570

PAGE 60

60 Table 1 6. Continued Gene Source of variance Degree of freedom Type III sum of squares Mean square F Value Pr > F ACE 2 Treatment 11 16.60259251 1.50932659 30.50 <.0001 ACE 2 Run 1 0.54808961 0.54808961 11.08 0.0028 ACE 2 Treatment*run 11 0.41319642 0.03756331 0.76 0.6749 ACE 2 Error 24 1.18758171 0.04948257

PAGE 61

61 Table 1 6. Continued Gene Source of variance Degree of freedom Type III sum of squares Mean square F Value Pr > F AT1R Treatment 11 84.34659968 7.66787270 10.09 <.0001 AT1R Run 1 2.55077203 2.55077203 3.36 0.0793 AT1R Treatment*run 11 10.60322463 0.96392951 1.27 0.2995 AT1R Error 24 18.2347284 0.7597804

PAGE 62

62 Table 1 6. Continued Gene Source of variance Degree of freedom Type III sum of squares Mean square F Value Pr > F Angiotensinogen Treatment 11 1.47834210 0.13439474 4.79 0.0009 Angiotensinogen Run 1 0.01245588 0.01245588 0.44 0.5123 Angiotensinogen Treatment*run 11 0.10985452 0.00998677 0.36 0.9604 Angiotensinogen Error 22 0.61763983 0.02807454

PAGE 63

63 Table 1 6. Continued Gene Source of variance Degree of freedom Type III sum of squares Mean square F Value Pr > F PRR Treatment 11 389.5491600 35.4135600 20.97 <.0001 PRR Run 1 0.0001884 0.0001884 0.00 0.9917 PRR Treatment*run 11 35.3528938 3.2138994 1.90 0.0933 PRR Error 23 38.8437047 1.6888567

PAGE 64

64 Table 1 6. Continued Gene Source of variance Degree of freedom Type III sum of squares Mean square F Value Pr > F MAS receptor Treatment 11 17.31904314 1.57445847 3.61 0.0046 MAS receptor Run 1 5.00296111 5.00296111 11.47 0.0025 MAS receptor Treatment *run 11 10.34950338 0.94086394 2.16 0.0580 MAS receptor Error 23 10.03368563 0.43624720

PAGE 65

65 Figure 1 1 Immunofluorescent staining of PRR in cultured M ller cells The cell nuclei were stained with DAPI, and the PRR was first targeted by anti PRR antibody, and then labeled with florescent secondary antibody targeting the primary anti PRR

PAGE 66

66 Figure 1 2 The treatment timeline of M ller cell experiment The cells were plated and incubated with the treatment agents according to the timeline shown above. There were n = 4 replications per treatment.

PAGE 67

67 Figure 1 3 The mRNA expression level after PRR siRNA treatment. A is the gel picture taken under UV light. The lanes are (from left to right): 1 kb ladder, contr ol PRR; 24 hour 30 nM PRR siRNA treate d PRR; 24 hour 100 nM PRR siRNA treated PRR; 48 hour 30nM PRR; 48 hour 100 nM PRR; the rest lanes are the actin of the respective groups. B is the quantification of PRR mRNA expression fold change.

PAGE 68

68 Figure 1 4 F old change in the expression level s of cytokine mRNA i n M ller cells due to different treatments The expression levels of A). IL 1 B). IL 6, C). TGF and D). TNF mRNA after the treatments on M ller cells were examined T he groups with are significantly different from the control group and the groups with # are significan tly different from the prorenin group ( p < 0.05)

PAGE 69

69 Figure 1 4 Continued

PAGE 70

70 Figure 1 5 F old change in the expression level s of RAS gene mRNA in M ller cells due to different treatments. The examined RAS genes include A). ACE, B). ACE 2, C). AT1R D). angiotensin ogen E). PRR F). the MAS receptor G). ACE/ACE 2 ratio, and G) PRR/MAS receptor ratio The groups with are significantly different from the control group, and the groups with # are significantly different from the prorenin group (p < 0.05)

PAGE 71

71 Figure 1 5. Continued

PAGE 72

72 Figure 1 5. Continued

PAGE 73

73 Figure 1 5. Continued

PAGE 74

74 CHAPTER 2 IN VIVO C HARACTERIZATION OF THE EFFECTS OF HRP IN ANIMAL MODELS OF OCULAR INFLAMMATION 2.1 Introduction As discussed previously, the prorenin mediated signaling pathway is possibly involved in the regulation of local tissue inflammation. A number of studies have reported that prorenin receptor mediated signa ling pathway contributes to diabetic retinopathy a nd diabetic nephropathy by enhancing inflammation ( 28 41 ) In diabetic retinopathy, an incr ease in the prorenin express ion is observed in retina s and the blockade of PRR leads to a significant decrease in retinal adherent leukocytes ( 28 ) The PRR blockage also results in a suppression of diabetic induced VEGF and ICAM 1 expression ( 28 ) It was also observed in the same study that AT1R defici ent diabetic mice treated with PRR antagonist showed decrease d retinal inflammation ( 28 ) These results suggest the involvement of the Ang II independent pathway in the regulation of retinal inflammation. In dia betes induced nephropathy PRR expression is increased in the kidneys of the diabetic rats, and the increase in the cytokines is blocked by the administration of PRR antagonist suggesting the prorenin signaling pathway is a mediator of renal inflammation through regulating cytokine expression in kidney s ( 41 ) Another study by Satofuka et al has show n that prorenin is also a contributor of the endotoxin induced uveitis (EIU) in rats ( 29 ) I n endotoxin treated rat eyes, retinal vessels are strongly positive for total prorenin, prorenin receptor, and activated prorenin ( 29 ) It was also noted that the systemic treatment of PRR antagonist HRP through intraperitoneal in jection significantly suppressed the expression of ICAM 1, CCL2/MCP 1 and IL 6 induced in EIU ( 29 )

PAGE 75

75 In the above mentioned studies, HRP was used as PRR antagonist Since HRP mimics the binding sequence of prorenin with PRR, it competitively inhibits the prorenin PRR interaction. So far, many in vivo experiments have confirmed that HRP successful l y reduce s inflammation in both diabetic retinopathy and EIU eye s indicating HRP is an effective PRR antagonist However, in an other previous studies it is found that although HRP is effective in suppressing retinal inflammation through the retinal vascul ar system, it also induce s injury with increased p ERK1/2 immunolabeling in retinal neurons and glia leading to a worsened ERG ( 42 ) In general, several studies have shown that the prorenin mediated signaling is hyper active in retinal and kidney inflammation and HRP is able to decrease the inflammation ( 28 29 41 ) Since PRR antagonist HRP is still able to suppress retinal inflammation in the absence of AT1R, the Ang II independent pathway is involved in prorenin mediated signaling ( 28 29 41 ) However, because the HRP treatment also causes i njury in retinal neurons and glia the role of HRP in ocular inflammation is still controversial ( 42 ) 2.2 Rationale and Hypothesis Our previous data on human M ller cells (retinal glial cells) showed that the treatment of HRP was able to block cytokine expression stimulated by prorenin, suggesting HRP had anti inflammatory effect on retinal glial cells. Previous studies completed by other groups have also demonstrated that prorenin is a contrib utor of ocular inflammation in the cases of both diabetic retinopathy and endotoxin induced uveitis. By binding with PRR, prorenin is activated non proteolytic ally, and the blockade of PRR has been shown to suppress the inflammatio s n ( 28 29 41 ) Since in all these previous studies, HRP was systematically injected it is unclear whether the anti

PAGE 76

76 inflammatory effect of HRP treatment is mediated systematically or locally. Because the systematically delivered HRP may not be able to cross the blood retinal barrier, or may not be concentrated enough at the level of local ocular tissues, the effect of HRP could be mediated systematically instead of l ocally. Moreover since the treatment of HRP also has side effect s on retinal neurons, the effect of HRP is still controversial ( 42 ) To investigate the real effect of HRP and whether the effect is med iated locally or systematically, we hypothesize d that the treatment of HRP is able to reduce ocular inflammation and the anti inflammatory effect of HRP is mediated locally To test the hypothesis, animals were treated with intravitreal injections of AAV HRP vector to express the HRP peptide, or an AAV control vector, followed by another injection of l ipopolysaccharide ( LPS ) to induce ocular inflammation The intravitreal administration of LPS creates an acute inflammation model called endotoxin induced uveitis (EIU) In EIU model, ocular inflammation peaks 24 hours after injection and a break down of blood retinal barrier is observed ( 43 ) Although it is an acute model, the underlying molecular and cellular mechanisms for inflammatory responses are common for many other ocular disease s with inflammatory components ( 43 45 ) In a number of human cases of ocular inflammation, the inflammation is al so caused by LPS produced by infected gram negative bacteria. Therefore, in both animal EIU model and h uman ocular inflammation cases, LPS stimulates immune response in uveas, causing uveitis ( 43 45 ) As a result, study of EIU provides useful insight into the causes and mechanisms of ocular inflammation in human cases. The severity of the inflammations was evaluated using infiltrati ng inflammatory cells counting, and real time RT PCR on certain cytokines was performed to study the mechanism of the inflammation.

PAGE 77

77 2.3 Materials and Methods 2.3.1 Animal Treatment Groups Two month old male C 57 BL / 6 mice were used in the animal studies. The animals were divided into six treatment groups according to Table 2 1 T he mice received two separate intravitreal injections, as illustrated in Figure 2 1. At the beginning of the experiment, t he mice recei ved an initial intravitreal injection of 10 9 copies/eye of either AAV HRP viral vector ( Figure 2 2 ) or the same amount of AAV Rev Ang I vector ( Figure 2 2 ) as controls. A fter the 3 week time period, 25 ng /eye of LPS was intravitreally administra ted to creat e an acute ocular inflammation model called endotoxin induced uveitis (EIU). The treatments were done on both eyes, and all the mice were sacrificed 24 hours after the LPS treatment. The eyes were collected and analyzed for signs of inflammation 2.3.2 Intravitreal Injection of AAV Vectors Both the AAV HRP vector and the AAV Rev Ang I vector (control vector) were derived from the triple t yrosine mutant ( Y444, 500, 730F) AAV2 vector. Both vectors start with a actin (CBA) promoter, followed by a coding region encoding a signal peptide (SP) sequence, a green fluorescent protein ( GFP ) sequence and a n HRP (or reversed Ang I ) s equence. There is also a cleavage site between GFP sequence and HRP (or reversed Ang I ) sequence. In the end of the vector, t here is a poly A tail (Figure 2 1). In the previous characterizations, following the intravitreal injection, the vector is not only able to transduce a variety of retinal cell types including photorec eptors, retinal pigment epithelial cells and ganglion c ells; but also eff ectively infect s cells of the inner retin a ( 46 ) The vector is also considered to be efficient, since the funduscopically detectable GFP fluorescence becomes intense and uniform only 3

PAGE 78

78 week s post injection, suggesting a fast and widespread expression of the encoded GFP gene ( 46 ) To complete the intravitreal injection, an inje ction needle was first inserted into the vitreous chamber of the eyes. After insertion, 1 L of the solution was pumped into the vitreous chamber of the eye. To complete the injection of the viral vectors, the vectors were firstly diluted with PBS solution to a final concentration of 10 9 copies/L and 1 L of the solution was injected into each eye for the transfection. In order to let the encoded sequence fully express ed in the ocular tissue, a 3 week waiting period was given after the intravitreal injectio n. 2.3.3 EIU Induction EIU model is a rodent model of uveitis. The model provides a useful tool to study human ocular inflammation, since the inflammation is relevant to clinical situations in both the causes and the symptoms ( 43 45 ) In the EIU model in this study, the inflammation was successfully induced by an int rav itreal injec tion of 25 ng LPS i nto mouse eyes. The LPS was dissolved in sterile saline at a final concentration of 25 ng/L and 1 L of the LPS solution was intravitreally administrated into each mouse eye using the same protocol as the viral vector injection described previously. Ocular i nflammation was characterized with an increase in both the number of infiltrating inflammatory cells and the pro inflammatory cytokine expression in the LPS treated mouse eyes. Twenty four hours after injection, the inflammation reached its peak level, at which time the mice were sacrificed and the eyes were collected for further investigation. 2.3.4 H & E Staining of Eye Sections The whole eye s were sectioned at a thickness of 12 by hematoxylin and eosin (H & E). Th e H & E staining helps to visualize the amount of infiltr ating inflammatory cells in eyes, which is an indicator of the severity of ocular

PAGE 79

79 inflammation. To complete the H & E staining eye sections were first washed three times with PBS for 10 min utes each. Th e sections were then immersed with hematoxylin staining solution for 30 seconds, and then excessive staining solution was washed away by PBS. Finally, the slides were covered with coverslip and ready for further analysis. 2.3.5 Immunohistochemical Staining of Eye Sections The 12 expressed on their surface s This immunohistochemical staining could help to categorize the infiltrating inflammatory cells. To complete the immunohistalchemical staining eye sections were first covered with 1% triton for 10 min utes and then were washed three times with PBS for 10 min utes each. Before the primary antibody incubation, the sections were first treated with 5% BSA ( in PBS ) for 30 minutes to block un specific bindings. After the blocking step, the sections were immersed with the primary antibodies CD11 b FITC (or CD45 FITC) at a 1:200 dilution with 1% BSA in PBS overnight. The sections were then washed 3 times with PBS to rem ove free primary antibodies. FITC AP, were then added at a 1:200 dilution to completely cover the sections. After a 2 hour incubation with the secondary antibody, the antibody solution was replaced by 0.1 M Tris / 0.1 M NaCl buffer with pH 9.5 to equilibrate After equilibrating the sections twice with the buffer, a solution of N BT/BCIP (1:40 dilution) and levamisole (1:80 dilution) was prepared using 0.1 M Tris/ 0.1 M NaC l buffer (pH 9.5) as the dilution buffer. The solution was then used to immerse the sect ions for 8 minutes. After the immersion, the slides were washed with PBS again and covered with glass coverslip.

PAGE 80

80 2.3.6 Quantification of the Infiltrating Inflammatory C ells in the Mouse E yes The positively stained infiltrating inflammatory cells in both an terior and posterior chamber were quantified under the 20 X microscope. In order to have comparable samples across groups, seven sections were chosen from each eye. To get the sections, an eye was equally spaced into seven parts after excluding the unusabl e parts on both ends, and one section was taken from each of the seven parts. When there were too many infiltrating inflammatory cells t o count in one single field of an eye, pictures of the section were taken and stored. The infiltrating cells were then c ounted un der the amplified pictures. C ounted cells were marked so they were not mistakenly counted again. Since a previous study has found the eye size ( measured by axis length) of C57BL/6 mice of the same age and gender do not vary significantly ( 47 ) and the processing procedure s may also induce stretching or shrinking on samples in the experiment, the total number of the infiltrating inflammatory cells were not normalized by the area of the eye. 2.3.7 Retinal T otal RNA I solation and RT PCR A nalysis E yes were collected from the mice, and the corneas were cut off from the attached tissues. The remaining eye tissues were then submerged in TRI zol solution and grinded by a plastic pestle. After the grinding, the ti ssue was further homogen ized through sonication, and total RNA was extracted using the TRI zol method as previously mentioned, and the expression level of IL 1 IL 6 and TNF real time RT PCR following the method described previously The primer information of IL IL 6 and TNF could be found in Table 2 3 Th e choice of cytokines w as made according to two previous studies that both demonstrate the expression levels of the cytokines are elevated in EIU eyes ( 48 49 )

PAGE 81

81 2.3.8 Statistical Analysis The (LSD) test s w ere performed on both the infiltrating i nflammatory cell counting data and the cytokine expression data The comparison was done by comparing the expression levels of IL IL 6 and TNF (separately) across all the groups of treatment The amount of infiltrating inflammatory cells in the anter ior chamber and posterior chamber among the treatment groups was also compared separately. Finally, multiple comparisons on the total number of infiltrating inflammatory cells, CD11b positive infiltrating inflammatory cells, and CD45 positive infiltrating inflammatory cells were done individually. For all the tests in the in vivo part, a critical p value of 0.05 was used 2.4 Results 2.4.1 Effect s of HRP E xpressed from Intravitreally D elivered AAV V ector on Infiltrating Inflammatory Cells in Mouse E yes In order to ev aluate the possible role of prorenin PRR interaction in the development of the LPS induced ocular inflammation, the AAV HRP vector or the AAV control vector was intravitreally injected int o mouse eyes. A waiting period of three weeks was given, so the expression of the coded genes became intense and widespread. Three weeks after the intravitreal injection of AAV vectors the mice received another intravitreal LPS injection to induce an intraocular inflammation. The mice were sacrificed 24 hours a fter LPS injection. The eyes were then collected and fixed in 5% PFA overnight. After the fixation, eyes were embedded in embedding medium and were sectioned. The sections were H & E stained and the infiltrating inflammatory cells in both anterior and poste rior chambers were counted separately The counting result showed that no infiltrating inflammatory cell were observed in the

PAGE 82

82 non LPS treated groups (Figure 2 6, A B and C ). T here was a significant difference over the numbers of infiltrating inflammatory cells between the AAV HRP vector + LPS and the AAV control vector + LPS treated eyes in both anterior and posterior chambers In both anterior and posterior chambers, the AAV control + LPS group had three fold higher amount of infiltrating inflammatory cells than the AAV HRP + LPS group so the total amount of infiltrating inflammatory cells was also three fold higher in the AAV control group than in the AAV HRP group (Figure 2 6 A B and C ). The result s uggest ed the pre treat ment of the AAV HRP vector effectively suppress ed the ocular inflammation induced by LPS. 2.4.2 Effect s of I ntravitreal I njection of AAV HRP V ector on Intraocular CD11b Positive Cells CD11b is an integrin family member that is expressed primarily on innate immune cells, including monocytes, neutrophils, natural killer cell s, granulocytes and macrophages. As a result, the staining helps to categorize the type s of the infiltrating inflammatory cells. CD11b positive cells naturally exist in retina s as retinal microglial cells and macrophage cells, but there are no CD11b positive cells in the vitreous cavity or anterior segment of the eye under normal conditions. Intravitreal injection of LPS induced the infiltration of CD11b positive i nflammatory cells into bot h vitreous cavity and anterior segment of the eye. As a re sult, the quantification of CD11b positive cells not only helps to evaluate the severity of the inflammation among groups, but also identifies the type s of infiltrating cells. The result showed tha t t here were no CD 11b positive cells in the vitreous of non LPS treated eyes And among the LPS treated groups, the group treated with AAV HRP vector prior to the LPS injection had a significantly lower (56% less) amount of CD 11b

PAGE 83

83 positive infiltrating inflammatory cells than the AAV control vector + LPS group (Figure 2 4 ) This result confirms that the LPS treatment was able to induce the infiltration of CD11b positive cells, and the AAV HRP treatment significantly decreased the number of CD11b positive cells (Figure 2 6 D ). 2.4.3 Effect of HRP AAV V ector I ntravitreal I njection on Intraocular CD45 Positive Cells CD45 cell marker is a tyrosine phosphatase also known as leukocyte common antigen The cell marker is expressed on all nucleated hematopoietic cells and it plays a central role in the immune cell development and i mmune response. As a result, CD45 staining also helps to evaluate the number and identify the type of the infiltrating inflammatory cells In normal eyes, CD45 positive cells are found in retina s as microglial cells and dendritic cells but are not found in vitreous cavity or anterior segment. However, in the LPS treated eyes, large amounts of infiltrating CD45 positive cells were observed in both vitreous cavity and anterior segment of the eyes. Among the LPS treated groups, the AAV HRP vector pre treat ed eyes had a significantly lower (by 48%) number of CD45 positive infiltrating inflammatory cells than the AAV control vector pre treated eyes (Figure 2 5 Figure 2 6 E ) The result sugges ted the LPS treatment led to infiltration of CD45 positive cells, and the AAV HRP treatment effectively prevented the infiltration. 2.4.4 Real Time RT PCR Analysis of I nflammatory C ytokines in M ouse Eye s Previously, the in vitro experime nt on M ller cells showed the treatment of prorenin was able to cause inflammation by up regulat ing cytokine expressions, and the pro inflammatory effect of prorenin treatment was inhibited by HRP Other previous studies also showed that systematic injectio n of HRP was effective in suppressing

PAGE 84

84 inflammation ( 28 29 41 ) Therefore, to study the underlying mechanism of AAV anti inflammatory effect, real time RT PCR was also performed on homogenized mouse eyes to quantify the changes in the cytokine (IL 1 6 and TNF The R T PCR result showed t he treatment of AAV HRP ve ctor prior to LPS injection significantly reduced the expression of TNF while the decrease in IL and IL 6 was not significant (Figure 2 8 A ) In addition the e xpression levels of IL IL 6 and TNF HRP + LPS was not significantly different from the cytokine levels in the AAV control vector + saline group (Figure 2 8 B ). 2.5 D iscussion In our animal studies, H & E st aining of the eye se ctions showed that the LPS treat ment induced infiltration of inflammatory cells. Moreover, a mong the LPS treated groups, the group pre treated with AAV HRP vector ha d the smallest quantity of infiltrating inflammatory cells in both anterior and posterior c hambers A similar result was also observed in the quantification of CD 11b and CD45 positively stained infiltrating inflammatory cells which means the AAV HRP treatment prior to the LPS treatment significantly suppressed the infiltration of both CD 11b and CD45 positive inflammatory cells, suggesting the AAV HRP pre treatment was effective at preventing the infiltration of both types of infiltrating inflammatory cells. Since CD11b is the marker for innate immune cells ( monocytes, granulocytes, macrophages, and natural killer cells ), and the CD45 is the marker for all the leukocytes, these results indicated the AAV HRP treatment suppressed infiltration of both innate immune cells and total leukocytes. Since the number of infiltrating inflammatory cell s directly reflects the severity of inflammation, the counting result show ed that the treatment of LPS greatly induced ocular inflammation, and the pre treatment of AAV HRP vector effectively prevented the

PAGE 85

85 inflammation stimulated by LPS Since HRP is a PRR a ntagonist the anti inflammatory effect of the vector is possibly mediated through its blockade of prorenin PRR interaction. In the real time PCR result, the expression levels of several cytokines in the eye tissue were test ed The cytokines examined in th e study were IL 1 IL 6, and TNF beca use significant increases in the se cytokines were observed in previous studies on EIU eyes ( 48 49 ) It was found in the studies that the levels of the inflammatory cytokines in the uvea were significantly higher 24 hours after the EIU, and declined 48 hours after treatment ( 48 ) This time dependent expression of IL 1 IL 6, and TNF is consistent with their identity as acute pha se cytokines. Several other studies have also f ound that IL 1 and TNF appear to be key regulators of LPS induced effects, since the treatment of the cells with the antibodies of those cytokines diminish es proinflammatory effect ( 50 51 ) As a result, we examined the expressio n of the same cytokines in our in vivo study of the EIU mice. In our experiment, increases in ocular IL 6 and TNF were also observed following L PS treatment. However, due to small sample size, the increase in IL 1 expression was not significant. The inc rease in the acute phase cytokines suggested that an acute ocular inflammation was successfully developed 24 hours after the LPS injectio n, which is consistent with the infiltrating inflammatory cytokine results mentioned above. Furthermore, the injection of AAV HRP vector prior to t he LPS treatment significantly suppresses the LPS stimulated expression of TNF B esides a trend of decrease in the expression levels of IL 1 and IL 6 was also observed, suggesting a possible protectiv e effect of HRP against the pro inflammatory effect of LPS. This result

PAGE 86

86 is consistent with our in vitro da t a in which the treatment of HRP on M ller cells significan t reduced the expression of pro inflammatory cytokines induced by prorenin. A similar result was also reporte d in a previous study completed by Satofuka et al, in which the intraperitonea l injection of HRP suppresse d the EIU in rats by reducing cytokine expression. Since HRP is a PRR antagonist the result indicated the treatment of HRP might be able reduced cytokine ex pression by blocking prorenin PRR interaction and the decrease in cytokine expression was likely to further lead to a decrease in ocular inflammation. In general, the result from the infiltrating inflammatory cell counting suggested the intravitreal trea tment of AAV H RP vector was effective at preventing ocular inflammation induced by LPS. The AAV HRP vector treatment was most likely to prevent the LPS induced ocular inflammation in the animals by blocking PRR prorenin interaction and cytokine production Th e result from our animal study further confirmed the anti inflammatory effect of HRP. In several previous studies, similar anti inflammatory effect of HRP was also observed It has been found that the prorenin level is elevated in the ocular fluid o f diabetic retinopathy patients ( 27 ) In another animal study, it has been noted that the expression lev el of prorenin is significantly increased in the retina of diabetic mice ( 28 ) These results suggest a possible link between prorenin mediated signaling and ocular inflammation. Furt her studies have demonstrate d that a systematic administration of PRR antagonist HRP on both diabetic retinopathy mice and EIU mice effectively suppresses the ocular inflammation ( 28 ) Together, these results indicate that prorenin cont ributes to ocular inflammation, and a systematic administration of HRP prevents the

PAGE 87

87 inflammation. However, it is still not clear whether the anti inflammatory effect of HRP is mediated locally, because the HRP might not be able to cross the blood retinal barrier and become concentrated in local eye tissue s In our study, to test if the anti inflammatory effect of HRP is mediated locally HRP wa s intravitreally administrated into the eyes in the form of viral vector. As a result, the vector transfected local eye tissues and HRP wa s produced locally, so the anti inflammatory effect of HRP observed in this experiment was mediated locally. P revious studies have also show n possible m echanism pro inflammatory effect. It was observed that the systematic treatment of HRP was effective in suppressing cytokine expression in EIU retina s suggesting HRP was able to suppress retinal inflamm at ion by reducing pro inflammatory cytokine expression ( 29 ) In our study, the local expression of HRP also caused a significant decrease in the expression of TNF 6 in the local eye tissue. This result indicated t he treatment of HRP was most likely to suppress ocular inflammation in a similar manner by reduci ng the expression of pro inflammatory cytokines. Therefore our study further confirmed that the treatment of HRP was able to suppress ocular inflammation possi bly by decreasing cytokine expression, and the anti inflammatory effect of HRP was mediated locally However, i n a separate study, c hronic HRP treatment d id not affect blood pressure cardiac hypertrophy or renal damage in renovascular hypertensive rats ( 30 ) This result indicates the HRP treatment is not able to decrease Ang II production systematically. In ou r study as well as several other studies; however, HRP treatment effectively suppressed ocular inflammation ( 28 29 ) iveness in

PAGE 88

88 the hypertensive rat model c ould be explained by the fact that Ang II could still be produced through classic RAS pathway, which involves renin as the converting enzyme in the first step of the reaction instead of activated prorenin. In other words, Ang II was therefore the hypertensive effect of RAS was still obser ved in the presence of PRR antagonist In ocular inflammation however, prorenin was a major contributor to the inflammation both through the Ang II dependent and independent pathways ( 28 29 ) Since HRP treatment blocks both pathways, it is able to suppress the ocular inflammation effectively In another previous study, it was noticed that HRP ha d differential effects on retinal neurons and vascular system The study has show n that the in an oxygen induced retinopathy rat model, the i ntraperitoneal injection of HRP provides antiangiogenic and anti inflammatory effects through the retinal vascular system ( 42 ) However, in retinal neurons and glia HRP also induce s injury with increased p ERK1/2 immunolabeling and a worsened ERG Th es e results suggest that although HRP is able to suppress inflammation, it also has side effects that may damage retinal neurons and glia ( 42 ) Therefore, in addition to the beneficial, anti inflammatory effects, we should pay attention to the deleterious effects of HRP treatment on retinal neurons as well. In conclusion, our animal study results suggested the treatment of HRP was able to suppress ocular inflammation, and the anti inflammatory effect of HRP was mediated locally instead of s ystematically. The cytokine expression data also indicated that HRP decreased ocular inflammation most likely by inhibiting pro inflammatory cytokine expression. However, although HRP provides beneficial, anti inflammatory effect against ocular inflammation it may also cause retinal neuron injury according to

PAGE 89

89 previous studies ( 42 ) As a result, further studies are needed to examine the effect of local administration of HRP on retinal neurons.

PAGE 90

90 Table 2 1 The treatment group s of animal studies. Group # Treatment # of animals to be used per group 1 AAV control vector + LPS 6 in total. 3 eyes for infiltration cell counting, 7 eyes for real time RT PCR, and 2 eyes for paraffin section. 2 AAV control vector + Saline 3 in total. 3 eyes for infiltration cell counting, 3 eyes for real time RT PCR. 3 AAV HRP vector + LPS 6 in total. 3 eyes for infiltration cell counting, 7 eyes for real time RT PCR, and 2 eyes for paraffin section. 4 AAV HRP vector + Saline 3 in total. 3 eyes for infiltration cell counting, 3 eyes for real time RT PCR. 5 LPS only 5 in total. 2 eyes for infiltration cell counting, 6 eyes for real time RT PCR, and 2 eyes for paraffin section. 6 No treatment control 2 in total. 2 eyes for infiltration cell counting, 2 eyes for real time RT PCR.

PAGE 91

91 Table 2 2 The expression of pro inflammatory cytokines in mouse eyes in different treatment groups. With p = 0.05, g roups having the same letter under the Gene Treatment group Average level Standard error of the mean t grouping IL 1 No treatment c ontrol 1.00 0.0 7 c IL 1 AAV c ontrol v ector + saline 2.07 0.41 b, c IL 1 AAV HRP v ector + saline 2.21 0.7 5 b, c IL 1 AAV control v ector + LPS 11.03 3.3 4 a IL 1 AAV HRP v ector + LPS 3.5 7 0.50 a, b, c IL 1 LPS 9.0 4 1.4 1 a, b

PAGE 92

92 Table 2 2. Continued Gene Treatment group Average level Standard error of the mean t grouping IL 6 No treatment control 1.00 0.0 6 b IL 6 AAV control vector + saline 2.07 0.38 b IL 6 AAV HRP vector + saline 2.20 0.7 3 b IL 6 AAV control vector + LPS 14.07 2.87 a, b IL 6 AAV HRP vector + LPS 3.5 9 0.85 b IL 6 LPS 26.82 7.98 a

PAGE 93

93 Table 2 2. Continued Gene Treatment group Average level Standard error of the mean t grouping TNF No treatment control 1.00 0.07 b TNF AAV control vector + saline 2.1 7 0.34 b TNF AAV HRP vector + saline 2.1 1 0.72 b TNF AAV control vector + LPS 13.42 2.2 7 a, b TNF AAV HRP vector + LPS 3.2 9 0.5 3 b TNF LPS 7.68 1. 70 a

PAGE 94

94 Table 2 3 Primers used for real t ime PCR analysis in animal studies. Species Gene name Accession number Sequences Expected sizes Mouse actin forward X03672 5' AGCAGATGTGGATCAGCAAG 3' 527 actin reverse 5' ACAGAAGCAATGCTGTCACC 3' Mouse IL NM_008361.3 5' AAAGCCTCGTGCTGTCGGACC 3' 200 IL 5' CAGCTGCAGGGTGGGTGTGC 3' Mouse IL 6 forward Mm00446190_m1 5' ATGCTGGTGACAACCACGGCC 3' 597 IL 6 reverse 5' AGGCATAACGCACTAGGTTTGC CG 3' Mouse TNF NM_013693.2 5' AGGCGCCACATCTCCCTCCA 3' 503 TNF 5' CGGTGTGGGTGAGGAGCACG 3'

PAGE 95

95 Figure 2 1 The map of AAV vector s expressing either the handle region peptide (HRP) (A) or the reversed Ang I (B) The HRP or the reversed Ang I is expressed as part of GFP fusion protein, and is separated by a furin cleavage site, such that the peptide will be cleaved from GFP upon secretion directed by the signal peptide (SP).

PAGE 96

96 Figure 2 2 The treatment timeline of the animal experiment The animals received an initial intravitreal injection of AAV HRP or control viral vector at day 0, and received a second intravitreal injection of LPS 3 weeks later. Twenty four hours after the second injection, animals were sacrificed and the eyes were collected for further analysis.

PAGE 97

97 Figure 2 3 The H & E staining of the eye sections of mice from the treatment groups of A ). AAV control vector + LPS group; B ). AAV HRP vector + LPS group; C ). LPS group. Abbreviations: L: lens; S: sclera; C: choroid; R: retina; V C : vitreou s cavity. The red arrow s point to the positively stained infiltrating inflammatory cells in the vitreous cavity

PAGE 98

98 Figure 2 4 The CD 11b st aining of the eye sections of mice from the treatment groups of A). no treatment control group; B). AAV control vector + saline group; C). AAV HRP vector + saline group; D). AAV control vector + LPS group; E). AAV HRP vector + LPS group; F). LPS group. Abb reviations: L: lens; S: sclera; C: choroid; R: retina; V C : vitreous cavity The red arrow s point t o the CD 11b positively stained infiltrating inflammatory cells in the vitreous cavity

PAGE 99

99 Figure 2 5 The CD 45 staining of the eye sections of mice from th e treatment groups of A). no treatment control group; B). AAV control vector + saline group; C). AAV HRP vector + saline group; D). AAV control vector + LPS group; E). AAV HRP vector + LPS group; F). LPS group. Abbreviations: L: lens; S: sclera; C: choroid ; R: retina; V C : vitreous cavity The red arrow s point to the CD 45 positively stained infiltrating inflammatory cells in the vitreous cavity

PAGE 100

100 Figure 2 6. Infiltrating inflammatory cell counting in mouse eyes after different treatments. A). Infiltrating inflammatory cells in anterior chamber s B). Infiltrating inflammatory cells in posterior chamber s C). T otal Infiltrating inflammatory cells. D). Total CD11b positive infiltrating inflammatory cells. E). Total CD45 positive infiltrating infla mmatory cells. Given p < 0.05, group s with the same sign are not significantly different.

PAGE 101

101 Figure 2 6 Continued

PAGE 102

102 Figure 2 6 Continued

PAGE 103

103 Figure 2 7 F old change in the retinal expression of pro inflammatory cytokines A). IL 1 B). IL 6, and C). TNF of mouse eyes after different treatments G iven p = 0.05, g roups containing the same sign are not significantly different.

PAGE 104

104 Figure 2 7 Continued.

PAGE 105

105 Figure 2 8 Between group comparisons in the retinal expression of pro inflammatory cytokine s IL 1 IL 6, and TNF of mouse eyes after different treatments. A). Comparison between AAV control vector + LPS group and AAV HRP + LPS group on cytokine expression. B). Comparison between AAV control vector + saline group and AAV HRP + LPS group on cyt okine expression. p < 0.05.

PAGE 106

106 CHAPTER 3 SUMMARY AND FUTURE RESEARCH In conclusion, the present study demonstrated that prorenin was able to up regulat e the expression of several pro inflammatory cytokines in cultured M ller cells, suggesting that proenzyme play ed a part in the development of ocular inflammation. By blocking the Ang II pathway using AT1Ri losartan the pro r proinflammatory effect was inhibited, suggesting the cytokine stimulating effect of prorenin was mediated largely through the Ang II dependent pathway The treatment of PRR antagonist HRP stimulating effect, indicating prorenin PRR M ller cells. In the presence of losartan, the HRP treatment generated a trend of decrease in the cytokine expression, so the Ang II independent pathway might also play a role in mediating stimulating effect. The animal study also demonstrated a bene ficial effect of the intravitreal AAV HRP treatment in suppressing ocular inflammation in mouse EIU model which confirmed that the anti inflammatory effect of AAV HRP was mediated locally The cytokine expression data in the animal study showed that the e xpression levels of TNF were decreased, and a trend of decrease in the expression of IL 1 and IL 6 was observed. This result indicated that the treatment of AAV HRP vector was most likely to suppress the inflammation by decreasing cytokine expression. P revious studies have suggest ed the involvement of both the Ang II depen dent pathway and i ndependent pathway s in ocular inflammation ( 29 ) which is consistent with our data. T he data pr ovides a poten tial therapeutic method for clinical treatment s of uveitis. By blocking the binding of PRR with HRP, the intraocular inflammation induced by LPS

PAGE 107

107 was significantly diminished. Since the in vitro experiment also suggested that the prorenin stimulation was responsible fo r the overexpression of the pro inflammatory cytokines in cultured M ller cells, and M lle r cells are retinal glial cells, it is possible that prorenin is also involved in the develo pment of other types of ocular inflammations, such as diabetic retinopathy. Therefore both HRP and AAV HRP vector have potential therapeutic effects on ocular inflammation. Since the pro inflammatory effect of prorenin was also mediated largely through the Ang II dependent pathway, Ang II dependent pathway blockers such as losartan are also expected to be helpful at suppressing ocular inflammations in clinical cases. The animal studies completed in this study showed that AAV HRP vector was able to suppress the ocular inflammation induced by LPS, but it is still unknown whether it is through the blockade of prorenin PRR interaction According to the in vitro experiment result HRP was able to reduce the pro inflammatory cytokine expression induced by prorenin, and several other previous studies have shown a possible relationship between PRR and the development of ocular inflammation. As a result, it is reasonable to hypothesize that the HRP was able to prevent the development of ocular inflammation by blocking the binding of prorenin with PRR and the subsequent signaling pathway in the ocular tissue. To test the hypothesis, a future experiment is being designed. In this future experiment, the animals will also be treated with AAV HRP vector and LPS, and we will expect the AAV HRP vector to prevent the ocular inflammation induced by LPS. To examine if the preventive effect of the vector is through the PRR mediated pathway, there would be another group with the treatment of PRR shRNA vector in addition to the AAV HRP vector and LPS treatment. For the

PAGE 108

108 en dpoint assays, the infiltrating inflammatory cell counting will be performed. The real time RT PCR could also be performed to check t he expression levels of the pro infla mmatory cytokines, including IL 1 IL 6, and TNF made betwee n the AAV HRP + LPS group and the AAV HRP + PRR shRNA + LPS group. If the hypothesis is true, we will expect that the AAV not be observed in the presence of PRR shRNA In addition due to the limitation of this study, the time proinflammatory effect is not quite clear. In this s tudy, the cytokine expression was examined only after 6 hours of treatment. The rationale of choosing this time point is based on preliminary studies completed by Mohan Ra i up, in which they examined the treatment effect of prorenin o n brain derived microglial cells 6 hours after the prorenin treatment. In their experiment, the treatment of prorenin was effective on stimulating a pro inflammatory response (dada unpublished), s o we adopted the same treatment schedule in our own experiment How ever, in future experiments, more time points should be chosen to examine cytokine expression levels after prorenin treatment, which will help us better understand th e time course of proren inflammatory effect. Another limitation of this study is th at the protein level s of the pro inflam matory cytokines were not examined. Since the cyto kine protein has the actual pro inflammatory effect, the changes in the protein level s are a more direct indication of inflammation. Therefore, further experiments measuring the protein levels after the prorenin treatment should also be completed.

PAGE 109

109 Another set of in vitro cell experiments will also be done on retinal pigmented epithelial (RPE) ce lls, and the treatment groups will be identical to the M ller treatment groups in the previous experiment. RPE cells are another major type of immune cells in the retina, and the unpublished result completed by our lab has shown that this type of cells als o has PRR expression. As a result, it is reasonable to hypothesize that the prorenin PRR mediated signaling pathway also takes place in the RPE cells, and the signaling pathway is causing the same proinflammatory effects on the cells with similar mechanism s. As a result, we can test the hypothesis by treating the RPE cells with prorenin, and compare the change in t he expression levels of the pro infla mmatory cytokines including IL 1 6, TGF and TNF expression leve l will also be examined, including ACE, ACE 2, angiotensin, AT1R, PRR, and MAS receptor. The expecte d result would be that both pro inflammatory cytokines and the RAS genes would be overexpressed in response to the prorenin treatment. The real time RT PCR r esult from other groups (prorenin plus RAS blockers) will suggest if the effect of prorenin treatment is through its direct binding with PRR or the indirect Ang II dependent pathway induced by the enzymatic activity of prorenin.

PAGE 110

110 LIST OF REFERENCES 1. Holmer S, Rinne B, Eckardt KU, Lehir M, Schricker K, Kaissling B, et al. Role of Renal Nerves for the Expression of Renin in Adult Rat Kidney. American Journal of Physiology. 1994;266(5):F738 F45. 2. Hubert C, Gasc JM, Berger S, Schutz G, Corvol P. Effects of mineralocorticoid receptor gene disruption on the components of the renin angiotensin system in 8 day old mice. Molecular Endocrinology. 1999;13(2):297 306. 3. Lee G, Makhanova N, Caron K, Lopez M LS, Gomez RA, Smithies O, et al. Homeostatic responses in the adrenal cortex to the absence of aldosterone in mice. Endocrinology. 2005;146(6):2650 6. 4. Kurtz L, Gerl M, Kriz W, Wagner C, Kurtz A. Replacement of connexin 40 by connexin 45 causes ectopic l ocalization of renin producing cells in the kidney but maintains in vivo control of renin gene expression. American Journal of Physiology Renal Physiology. 2009;297(2):F403 F9. 5. Klar J, Sandner P, Muller MWH, Kurtz A. Cyclic AMP stimulates renin gene tra nscription in juxtaglomerular cells. Pflugers Archiv European Journal of Physiology. 2002;444(3):335 44. 6. Hall JE, Guyton AC, Mizelle HL. Role of the Renin Angiotensin System in Control of Sodium Excretion and Arterial Pressure. Acta Physiologica Scandin avica. 1990;139:48 62. 7. Kokubu T, Ueda E, Joh T, Nishimura K. Purification and properties of angiotensin I converting enzyme in human lung and its role on the metabolism of vasoactive peptides in pulmonary circulation. Adv Exp Med Biol. 1979;120B:467 75. Epub 1979/01/01. 8. Dandona P, Dhindsa S, Ghanim H, Chaudhuri A. Angiotensin II and inflammation: the effect of angiotensin converting enzyme inhibition and angiotensin II receptor blockade. Journal of Human Hypertension. 2007;21(1):20 7. 9. Paravicini TM Touyz RM. Redox signaling in hypertension. Cardiovascular Research. 2006;71(2):247 58. 10. Shah SV, Baliga R, Rajapurkar M, Fonseca VA. Oxidants in chronic kidney disease. Journal of the American Society of Nephrology. 2007;18(1):16 28. 11. Inagami T. A memorial to Robert Tiegerstedt The centennial of renin discovery. Hypertension. 1998;32(6):953 7.

PAGE 111

111 12. Toyz RM, Berry C. Recent advances in angiotensin II signaling. Brazilian Journal of Medical and Biological Research. 2002;35(9):1001 15. 13. Atkinson AB Robertson JIS. Captopril in the Treatment of Clinical Hypertension and Cardiac Failure. Lancet. 1979;2(8147):836 9. 14. Fuchs B, Breithaupt Grogler K, Belz GG, Roll S, Malerczyk C, Herrmann V, et al. Comparative pharmacodynamics and pharmacokinetics of c andesartan and losartan in man. Journal of Pharmacy and Pharmacology. 2000;52(9):1075 83. 15. Liu C, Lv XH, Li HX, Cao X, Zhang F, Wang L, et al. Angiotensin (1 7) suppresses oxidative stress and improves glucose uptake via Mas receptor in adipocytes. Acta Diabetologica. 2012;49(4):291 9. 16. Benter IF, Diz DI, Ferrario CM. Cardiovascular Actions of Angiotensin(1 7). Peptides. 1993;14(4):679 84. 17. Benter IF, Ferrario CM, Morris M, Diz DI. Antihypertensive Actions of Angiotensin (1 7) in Spontaneously Hypertensive Rats. American Journal of Physiology Heart and Circulatory Physiology. 1995;269(1):H313 H9. 18. Souza LL, Costa Neto CM. Angiotensin (1 7) decreases LPS induced inflammatory response in macrophages. Journal of Cellular Physiology. 2012;227(5): 2117 22. 19. Suzuki Y, Ruiz Ortega M, Lorenzo O, Ruperez M, Esteban V, Egido J. Inflammation and angiotensin II. International Journal of Biochemistry & Cell Biology. 2003;35(6):881 900. 20. Sadoshima J. Cytokine actions of angiotensin II. Circulation Rese arch. 2000;86(12):1187 9. 21. Paul M, Mehr AP, Kreutz R. Physiology of local renin angiotensin systems. Physiological Reviews. 2006;86(3):747 803. 22. Nguyen G, Delarue F, Burckle C, Bouzhir L, Giller T, Sraer JD. Pivotal role of the renin/prorenin recepto r in angiotensin II production and cellular responses to renin. Journal of Clinical Investigation. 2002;109(11):1417 27. 23. Burckle C, Bader M. Prorenin and its ancient receptor. Hypertension. 2006;48(4):549 51. Epub 2006/08/31. 24. Suzuki F, Hayakawa M, Nakagawa T, Nasir UM, Ebihara A, Iwasawa A, et al. Human prorenin has "gate and handle" regions for its non proteolytic activation. J Biol Chem. 2003;278(25):22217 22. Epub 2003/04/10. 25. Feldt S, Batenburg WW, Mazak I, Maschke U, Wellner M, Kvakan H, et al. Prorenin and renin induced extracellular signal regulated kinase 1/2 activation in

PAGE 112

112 monocytes is not blocked by aliskiren or the handle region peptide. Hypertension. 2008;51(3):682 8. 26. Sakoda M, Ichihara A, Kaneshiro Y, Takemitsu T, Nakazato Y, Nabi AHMN, et al. (Pro)renin receptor mediated activation of mitogen activated protein kinases in human vascular smooth muscle cells. Hypertension Research. 2007;30(11):1139 46. 27. Danser AHJ, Vandendorpel MA, Deinum J, Derkx FHM, Franken AAM, Peperkamp E, et al. Renin, Prorenin, and Immunoreactive Renin in Vitreous Fluid from Eyes with and without Diabetic Retinopathy. Journal of Clinical Endocrinology & Metabolism. 1989;68(1):160 7. 28. Satofuka S, Ichihara A, Nagai N, Noda K, Ozawa Y, Fukamizu A, et al. (Pro )renin Receptor Mediated Signal Transduction and Tissue Renin Angiotensin System Contribute to Diabetes Induced Retinal Inflammation. Diabetes. 2009;58(7):1625 33. 29. Satofuka S, Ichihara A, Nagai N, Yamashiro K, Koto T, Shinoda H, et al. Suppression of o cular inflammation in endotoxin induced uveitis by inhibiting nonproteolytic activation of prorenin. Investigative Ophthalmology & Visual Science. 2006;47(6):2686 92. 30. Muller DN, Klanke B, Feldt S, Cordasic N, Hartner A, Schmieder RE, et al. (Pro) renin receptor peptide inhibitor "handle region" peptide does not affect hypertensive nephrosclerosis in Goldblatt rats. Hypertension. 2008;51(3):676 81. 31. Luetscher JA, Kraemer FB, Wilson DM, Schwartz HC, Bryerash M. Increased Plasma Inactive Renin in Diabet es Mellitus a Marker of Microvascular Complications. New England Journal of Medicine. 1985;312(22):1412 7. 32. Nurun NAHM, Uddin NM, Nakagawa T, Iwata H, Ichihara A, Inagami T, et al. Role of "handle" region of prorenin prosegment in the non proteolytic activation of prorenin by binding to membrane anchored (pro)renin receptor. Frontiers in Bioscience Landmark. 2007;12:4810 7. 33. Lanz TV, Ding ZQ, Ho PP, Luo JA, Agrawal AN, Srinagesh H, et al. Angiotensin II sustains brain inflammation in mice via TGF be ta. Journal of Clinical Investigation. 2010;120(8):2782 94. 34. Garcia Sainz JA, Martinez Alfaro M, Romero Avila MT, Gonzalez Espinosa C. Characterization of the AT1 angiotensin II receptor expressed in guinea pig liver. J Endocrinol. 1997;154(1):133 8. Ep ub 1997/07/01. 35. Gronhagenriska C, Fyhrquist F. Purification of Human Lung Angiotensin Converting Enzyme. Scandinavian Journal of Clinical & Laboratory Investigation. 1980;40(8):711 9.

PAGE 113

113 36. Junot C, Menard J, Gonzales MF, Michaud A, Corvol P, Ezan E. In v ivo assessment of captopril selectivity of angiotensin I converting enzyme inhibition: Differential inhibition of acetyl Ser Asp Lys Pro and angiotensin I hydrolysis. Journal of Pharmacology and Experimental Therapeutics. 1999;289(3):1257 61. 37. Van Dyck S, Novakova S, Van Schepdael A, Hoogmartens J. Inhibition study of angiotensin converting enzyme by capillary electrophoresis after enzymatic reaction at capillary inlet. Journal of Chromatography A. 2003;1013(1 2):149 56. 38. Michaud A, Williams TA, Chauv et MT, Corvol P. Substrate dependence of angiotensin I converting enzyme inhibition: Captopril displays a partial selectivity for inhibition of N acetyl seryl aspartyl lysyl proline hydrolysis compared with that of angiotensin I. Molecular Pharmacology. 19 97;51(6):1070 6. 39. Akira S, Hirano T, Taga T, Kishimoto T. Biology of Multifunctional Cytokines Il 6 and Related Molecules (Il 1 and Tnf). Faseb Journal. 1990;4(11):2860 7. 40. Yang L, Qiu CX, Ludlow A Ferguson MW, Brunner G. Active transforming growth factor beta in wound repair: determination using a new assay. Am J Pathol. 1999;154(1):105 11. Epub 1999/01/23. 41. Matavelli LC, Huang JQ, Siragy HM. (Pro)renin receptor contributes to diabetic nephropa thy by enhancing renal inflammation. Clinical and Experimental Pharmacology and Physiology. 2010;37(3):277 82. 42. Wilkinson Berka JL, Heine R, Tan G, Cooper ME, Hatzopoulos KM, Fletcher EL, et al. RILLKKMPSV Influences the Vasculature, Neurons and Glia, a nd (Pro)Renin Receptor Expression in the Retina. Hypertension. 2010;55(6):1454 U288. 43. Okumura A, Mochizuki M. Endotoxin Induced Uveitis in Rats Morphological and Biochemical Study. Japanese Journal of Ophthalmology. 1988;32(4):457 65. 44. Rosenbaum JT Mcdevitt HO, Guss RB, Egbert PR. Endotoxin Induced Uveitis in Rats as a Model for Human Disease. Nature. 1980;286(5773):611 3. 45. Okumura A, Mochizuki M, Nishi M, Herbort CP. Endotoxin Induced Uveitis (Eiu) in the Rat a Study of Inflammatory and Immun ological Mechanisms. International Ophthalmology. 1990;14(1):31 6. 46. Petrs Silva H, Dinculescu A, Li QH, Deng WT, Pang JJ, Min SH, et al. Novel Properties of Tyrosine mutant AAV2 Vectors in the Mouse Retina. Molecular Therapy. 2011;19(2):293 301. 47. Puk O, Dalke C, Favor J, de Angelis MH, Graw J. Variations of eye size parameters among different strains of mice. Mammalian Genome. 2006;17(8):851 7.

PAGE 114

114 48. de Vos AF, Klaren VN, Kijlstra A. Expression of multiple cytokines and IL 1RA in the uvea and retina during endotoxin induced uveitis in the rat. Invest Ophthalmol Vis Sci. 1994;35(11):3873 83. Epub 1994/10/01. 49. Shen DF, Buggage RR, Eng HC, Chang MA, Chan CC. Cytokine gene expression in different strains of mice with endotoxin induced uveitis (EIU). In vestigative Ophthalmology & Visual Science. 2000;41(4):S379 S. 50. Zanetti G, Heumann D, Gerain J, Kohler J, Abbet P, Barras C, et al. Cytokine production after intravenous or peritoneal gram negative bacterial challenge in mice. Comparative protective eff icacy of antibodies to tumor necrosis factor alpha and to lipopolysaccharide. J Immunol. 1992;148(6):1890 7. Epub 1992/03/15. 51. Beutler B, Milsark IW, Cerami AC. Passive immunization against cachectin/tumor necrosis factor protects mice from lethal effec t of endotoxin. Science. 1985;229(4716):869 71. Epub 1985/08/30.

PAGE 115

115 BIOGRAPHICAL SKETCH The candidate, Yunyang Wang, was born in Tieling, Liaoning province, China in 1986. He obtained his B.S. in pharmacy in Huazhong University of Science and Technology in China in 2009. After finishing the undergraduate study, he went to the University of Florida to study pharmaceutical science s and finished his graduate degree in the spring of 201 4