Determining Resistance Levels and Mechanisms in Rhipicephalus Sanguineus (Latreille) to Acaricides Used to Treat Domesti...

MISSING IMAGE

Material Information

Title:
Determining Resistance Levels and Mechanisms in Rhipicephalus Sanguineus (Latreille) to Acaricides Used to Treat Domestic Animals and Residential Environments
Physical Description:
1 online resource (216 p.)
Language:
english
Creator:
Eiden, Amanda L
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Entomology and Nematology
Committee Chair:
KAUFMAN,PHILLIP EDWARD
Committee Co-Chair:
OI,FAITH M
Committee Members:
ALLAN,SANDRA A
BLOOMQUIST,JEFFREY R
DARK,MICHAEL JAMES

Subjects

Subjects / Keywords:
acaricides -- pesticide -- resistance -- rhipicephalus -- sanguineus -- synergists -- ticks
Entomology and Nematology -- Dissertations, Academic -- UF
Genre:
Entomology and Nematology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
aFrom September 2010 until October 2013 studies were conducted to evaluate the presence and levels of resistance to permethrin and fipronil in Rhipicephalus sanguineus (Latreille), the brown dog tick.  Permethrin is a commonly used acaricide for tick control on domestic animals and in residential environments and fipronil for on-animal treatment.  Field-collected ticks from kennels and residential facilities were challenged with technical grade permethrin and fipronil to create dose response curves, which were compared to a susceptible strain.  Permethrin resistance was screened in seven populations, all of which were resistant with a resistance ratio greater than 10.  Fipronil was tested on four populations, which were found to be tolerant, with resistance ratios below 3.8.  This is first documentation of R. sanguineus permethrin resistance and fipronil tolerance in the United States. An acaricide-susceptible R. sanguineus strain was used to develop a discriminating concentration, which is a single acaricide concentration that can quickly and affordably diagnose resistance in newly encountered field populations.  The discriminating concentration, 2x LC99, was used to screen field-collected tick strains.  Permethrin resistance of up to 53-fold was found in Florida collected populations.  Fipronil discriminating concentrations were lower, with tolerance found at 2-fold the susceptible strain. Resistant R. sanguineus were evaluated for acaricide resistance mechanisms.  Synergists evaluated included those that inhibit esterase, cytochrome P450, and glutathione-S-transferase activity.  Esterase was the most prominent metabolic resistance mechanism in permethrin resistant ticks.  Cytochrome P450 activity was determined to play a likely role in permethrin resistance.  Glutathione-S-transferase inhibition yielded the smallest levels of change in mortality, suggesting this mechanism was not amplified in the resistant ticks.  None of the experiments demonstrated high levels of change in mortality when synergists were combined with fipronil.  Using gel electrophoresis, esterase activity was further confirmed as a mechanism for permethrin resistance.  Twelve permethrin-resistant strains were tested and increased esterase activity was confirmed in eight strains.  These results will be used to guide future brown dog tick control management plans.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Amanda L Eiden.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: KAUFMAN,PHILLIP EDWARD.
Local:
Co-adviser: OI,FAITH M.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-06-30

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0046257:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 DETERMINING RESISTAN CE LEVELS AND MECHAN ISMS IN RHIPICEPHALUS SANGUINEUS (LATREILLE) TO ACARICIDE S USED TO TREAT DOMEST IC ANIMALS AND RESIDENT IAL ENVIRONMENTS By AMANDA L. EIDEN A DISSERTATION PRESENTED TO THE GRADUATE SCHO OL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Amanda L. Eiden

PAGE 3

3 To my family and friends, I am forever gr a teful for your support

PAGE 4

4 ACKNOWLEDGMENTS I would like to gratefully acknowledge the f unding provided from the USDA, NIFA (formerly CSREES ) Southern Region Integrated Pest Management grants program and tship Program for stipend and tuition support that allowed me to pursue a Ph.D. in Entomology. I would like to thank my major advisors, Dr. Phillip Kaufman and Dr. Faith Oi. They have always had their door open to provide advice and wisdom that helped me to grow as a student. They demonstrated great patience and provided the assistance I needed to develop the necessary skills to work in a laboratory research environment. During m y time here they have provided m e with many opportunities to present my res earch and have helped me network with future colleagues in entomology. I want to thank the additional members of my committee, Dr. Michael Dark, Dr. and assistance w ith the molecular aspects of my research. He always had the door open to answer my questions and help me troubleshoot problems. Dr. Sandra Allan provided great advice to help me to be able to work with and rear my tick colonies. Without her advice, I pr obably would have ended up with ticks crawling all over me! Dr. Jeffrey Bloomquist was always available to help provide assistance and help me think through toxicology based concepts. His advice helped me to more efficiently design some of my research ex periments. I would like to thank all past and present members of the Veterinary Entomology Laboratory that were always willing to lend a helping hand or around to make me laugh when I needed a moments break. Thank you Dr. Emma Weeks, Dr. Jimmy Pitzer, Loi s Wood, Chris Holderman, Tim Davis, Lucas Carnohan, Karen Prine, Jeff Hertz, Bobby

PAGE 5

5 Aldridge, Mark Halvorsen, Corie Ritchie, and Jonathan Bremer. Additionally, I want to express my gratitude for all of the faculty, staff, and fellow graduate students in th e Entomology and Nematology Department that been part of my graduate experience. I would like to make a special mention for Dr. Jennifer Gillett Kaufman for teaching me how to pay attention to detail. I also would like to thank Dr. Salvador Gezan for his assistance with my statistical analysis. I would like to extend thanks to the University of Florida Animal Care Services for their assistance in my project. Glenn Cawthorne for providing me with the susceptible tick colony and for offering advice when I had trouble rearing my own colonies. Without the help of the public and pest control operators this project would not have been possible. I appreciate all of their efforts for collecting and sending me the ticks that allowed me to complete my research. Dr. Tim Lysyk who also provided advice with tick rearing, which allowed me conduct my research with the ticks I received. Toni Finally the unrelenting support of my family and friends d eserves special recognition during my graduate student adventure. They were always there to support me during the challenging times. When I would fall off the planet because I was overwhelmed with work they were always there when I came back around. Als o, last but not least, thank you kitties for providing me with company throughout this experience and not being destructive when I was gone for 12 hours a day trying to complete my work.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TA BLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 LIST OF ABBREVIATIONS ................................ ................................ ........................... 1 3 ABSTRACT ................................ ................................ ................................ ................... 14 CHAPTER 1 LITERATURE REVIEW OF THE BROWN DOG TICK RHIPICEPHALUS SANGUINEUS (LATREILLE) ................................ ................................ .................. 16 Taxonomy ................................ ................................ ................................ ............... 16 Life History ................................ ................................ ................................ .............. 18 Pathogen Transmission ................................ ................................ .......................... 21 Host Immunity ................................ ................................ ................................ ......... 25 Biological Control ................................ ................................ ................................ .... 27 Chemical Control ................................ ................................ ................................ .... 30 On Animal Control ................................ ................................ ............................ 30 Residential and Kennel Facility Control ................................ ............................ 34 Permethrin ................................ ................................ ................................ .............. 38 Fipronil ................................ ................................ ................................ .................... 41 Forms of Resistance ................................ ................................ ............................... 46 Acaricide Resistance Testing ................................ ................................ .................. 48 Research Objectives ................................ ................................ ............................... 49 2 DETERMINE PRESENCE AND LEVEL OF RHIPICEPHALUS SANGUINEUS (LATREILLE) RESISTANCE TO PERMETHRIN AND FIPRONIL USING THE FAO LARVAL PACKET TEST. ................................ ................................ ............... 51 Introduction ................................ ................................ ................................ ............. 51 Materials and Methods ................................ ................................ ............................ 54 Ticks ................................ ................................ ................................ ................. 54 Susceptible brown dog ticks ................................ ................................ ....... 54 Field collected brown dog ticks ................................ ................................ .. 54 Tick Rearing ................................ ................................ ................................ ..... 56 Bioassays ................................ ................................ ................................ ......... 56 Statistics ................................ ................................ ................................ ........... 59 Results ................................ ................................ ................................ .................... 59 Discussion ................................ ................................ ................................ .............. 61

PAGE 7

7 3 DISCRIMINATING CONCE NTRATION DEVELOPMENT FOR PERMETHRIN AND FIPRONIL RESISTA NCE IN BROWN DOG TIC KS ................................ ....... 85 Introduction ................................ ................................ ................................ ............. 85 Materials and Methods ................................ ................................ ............................ 87 Ticks ................................ ................................ ................................ ................. 87 Susceptible brown dog ticks ................................ ................................ ....... 87 Field collected brown dog ticks ................................ ................................ .. 88 Tick Rearing ................................ ................................ ................................ ..... 88 Bioassay ................................ ................................ ................................ ........... 89 Resistance Evaluation ................................ ................................ ...................... 90 Data Analysis ................................ ................................ ................................ ... 91 Results ................................ ................................ ................................ .................... 92 Discriminating Concentration ................................ ................................ ............ 92 Permethrin Discriminating Concentration Experiments ................................ .... 92 F ipronil Discriminating Concentration Experiments ................................ .......... 93 Discussion ................................ ................................ ................................ .............. 94 4 DETERMINATION OF MET ABOLIC AND TARGET SI TE RESISTANCE MECHAN ISM IN PYRETHROID AN D FIPRONIL RESISTANT BROWN DOG TICKS ................................ ................................ ................................ ................... 109 Introduction ................................ ................................ ................................ ........... 109 Materials and Methods ................................ ................................ .......................... 113 Ticks ................................ ................................ ................................ ............... 113 Synergist Bioassays ................................ ................................ ....................... 114 Gel Electrophoresis ................................ ................................ ........................ 116 Polymerase Chain Reaction ................................ ................................ ........... 120 Tick preparation ................................ ................................ ....................... 120 DNA isolation ................................ ................................ ........................... 120 DNA amplification ................................ ................................ .................... 121 DNA primers ................................ ................................ ............................ 122 Statistics ................................ ................................ ................................ ......... 125 Results ................................ ................................ ................................ .................. 125 Discussion ................................ ................................ ................................ ............ 130 5 IMPLICATIONS AND FUT URE DIRECTIONS FOR RHIPICEPHALUS SANGUINEUS (LATREI LLE) CONTROL AND RES EARCH ................................ 159 APPENDIX A TICK STRAIN COLLECTION AND HISTORY ................................ ...................... 169 B INSTITUTIONAL ANIMAL CARE AND USE COMMITT EE DO CUMENTS .......... 174 C TICK REARING INSTRUCTIONS ................................ ................................ ........ 176 Tick Cage Construction ................................ ................................ ......................... 176

PAGE 8

8 Tick Host Preparation ................................ ................................ ........................... 177 Tick Feeding ................................ ................................ ................................ ......... 178 Larvae ................................ ................................ ................................ ............ 178 Nym phs ................................ ................................ ................................ .......... 180 Adults ................................ ................................ ................................ ............. 180 Free Release Tick Feeding ................................ ................................ ................... 181 D PRIMERS USED IN SODIUM AND CHLORIDE CHANNEL TARGET SITE MUTATION EVALUATION ................................ ................................ ................... 189 LIST OF REFERENCES ................................ ................................ ............................. 194 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 215

PAGE 9

9 LIST OF TABLES Table page 2 1 Toxicity of permethrin to brown dog tick, Rhipicephalus sanguineus (Latreille), populations collected from residential homes and dog k ennels in Florida and Texas ................................ ................................ ............................... 74 2 2 Toxicity of fipronil to brown dog tick, Rhipicephalus sanguineus (Latreille), populations collected from residential homes and d og kennels in Florida and Texas ................................ ................................ ................................ .................. 75 3 1 Acaricide exposure in field collected Rhipicephalus sanguineus (Latreille) as reported by pet owners or kennel operators. ................................ .................... 104 3 2 Lethal concentration (LC) values of permethrin and the discriminating concentration 2x LC 99 using Logit analysis for susceptible Rhipicephalus sanguineus (Latreille) purchased from Ecto Services, INC .............................. 105 3 3 Lethal concentration (LC) values of fipronil and the discriminating concentration 2x LC 99 using Probit analysis for susceptible Rhipicephalus sanguineus (Latreille) purchased from Ecto Services, INC .............................. 106 4 1 Evaluation of synergists with permethrin or fipronil conducted on Rhipicephalus sanguineus (Latreille) larvae collected from four Florida and one Texas county, using the larval packet test method ................................ .... 142 A 1 Colony history of susceptible Rhipicephalus sanguineus (Latreille) obtained from Ecto Services, INC, North Carolina. ................................ ......................... 169 A 2 Acaricide treatment history of br own dog ticks submitted to the University of Florida for acaricide resistance evaluation. ................................ ...................... 170 D 1 Primers designed to evaluate sodium and chloride channel mutations in Rhipicepahlus sanguineus (L atreille) ................................ ................................ 189

PAGE 10

10 LIST OF FIGURES Figure page 2 1 Drying device for acaricide treated filter papers for the larval packet tes t ........... 76 2 2 Apparatus and procedures used in resistance profiling of permethrin and fipronil to field collected strains of Rhipicephalus sanguineus (Latreille), using the larval packet test ................................ ................................ ........................... 77 2 3 Humidifying incubator for larval packet test 24 hour holding period ................... 78 2 4 Mortality assessment after 24 hours ................................ ................................ ... 79 2 5 Mean percentage survival of Rhipicephalus sanguineus (Latreille) field collected strains and a suspeptible strain exposed to four permethrin concentrations using the Food and Agriculture Organization larval packet test 80 2 6 Percent survival for the Gilchrist F2 strain of Rhipicephalus sanguineus (Latreille), when challenged again different concentrations of permethrin using the Food and Agriculture Organization larval packe t test. ......................... 81 2 7 The percent survival of Rhipicephalus sanguineus (Latreille) at various permethrin concentrations in the Palm Beach 2 strain between generations .... 82 2 8 Mean percentage survival of Rhipicephalus sanguineus (Latreille) field collected strains and a susptible strain exposed to four fipronil concentrations using the Food and Agriculture Organization larval packet test .......................... 83 2 9 Comparison of permethrin and fipronil resistance ratios in different field collected strains of Rhipicephalus sanguineus (Latreille). ................................ .. 84 3 1 Mean percentage survival of Rhipicephalus sanguineus (Latreille) strains in Florida exposed to the discriminating concentration of permethrin at 1, 5, 16, and 53 times the LC99 value (0.19% concentration) ................................ ....... 107 3 2 Mean percentage survival of six Florida Rhipicephalus sanguineus (Latreille) strains exposed to fipronil at the LC90, LC99 (0.15% concentration), 2x LC99 (the discriminating concentration), 4x LC99 ................................ .................... 108 4 1 Broward strain of larval Rhipicephalus sanguineus (Latreille) tested with 2% synergists added at a constant rate to varied concentrations of permethrin ..... 143 4 2 Gilchrist F2 strain of larval Rhipicephalus sanguineus (Latreille) tested with 2% synergists added at a constant rate to varied concentrations of permethrin ................................ ................................ ................................ ....... 144

PAGE 11

11 4 3 Palm Beach 2 F2 st rain of larval Rhipicephalus sanguineus (Latreille) tested with 2% synergists added at a constant rate to varied concentrations of permethrin ................................ ................................ ................................ ....... 145 4 4 Sarasota 2 strain of larval Rhipicephalus sanguineus (Latreille) tested with 2% synergists added at a constant rate to v aried concentrations of permethrin ................................ ................................ ................................ ....... 146 4 5 Tick mortality responses for the Gilchrist, FL F2 and Webb, TX F2 Rhipicephalus sanguineus (Latreille) strains tested using permethrin alone or in combination with 2% triphenyl phosphate or 2% piperonyl butoxide ........... 147 4 6 Broward strain of larval Rhipicephalus sanguineus (Latreille) tested with 2% synergists added at a constant rate to varied concentrations of fipronil .......... 148 4 7 Gilchrist F2 strain of larval Rhipicephalus sanguineus (Latreille) tested with 2% synergists added at a constant rate to varied concentrations of fipronil .... 149 4 8 Sarasota 2 strain of larval Rhipicephalus sanguineus (Latreille) tested with 2% synergists added at a constant rate to varied concentrations of fipr onil .... 150 4 9 naphtyl acetate activity, esterase staining gel comparing esterase activity of a Rhipicephalus sanguineus (Latreille) susceptible and resistant strain ....... 151 4 10 Eight permethrin resistant Rhipicephalus sanguineus (Latreille) strains and the permethrin susceptible R. sanguineus strain evaluated for esterase activity using an esterase staining gel ................................ ............................. 152 4 11 Polymerase chain reaction assay to detect a point mutations in the sodium channel S6 transmembrane segment of domain III comparing two strains of Rhipicephalus microplus (Canestrini) ................................ .............................. 153 4 12 Cloned sequences of three amplification sites in the sodium channel gene from Rhipicephalus sanguineus (Latreille) ................................ ....................... 154 4 13 Amplification of the Rdl GABA receptor subunit in the chloride channel for Drosophila melanogaster Meigen ................................ ................................ .... 155 4 14 Sanger sequence of the Rdl GABA receptor subunit in the chloride channel for Drosophila melanogaster Meigen demonstrating alaline substituted by serine (A302S) ................................ ................................ ................................ .. 1 56 4 15 Sanger sequence of the Rdl GABA receptor subunit in the chloride channel for Drosophila melanogaster Meigen demonstrating valine substituted by isoleucine (V283I) ................................ ................................ ............................ 157

PAGE 12

12 4 16 Sanger sequence of the Rdl GABA receptor subunit in the chloride channel for Drosophila melanogaster Mei gen demonstrating a conflict between the susceptible and resistant strain that did not result in an amino acid change ... 158 C 1 Partially constructed tick feedin g chamber ................................ ...................... 184 C 2 Demonstration of m esh pieces being secured to the plastic po rtion of the feeding chamber ................................ ................................ .............................. 185 C 3 Tick feeding chamber assembled with mesh screening that has been glued to the bottom ................................ ................................ ................................ .... 186 C 4 The lid for the plastic feeding chamber ................................ ............................ 187 C 5 A ssembled tick feeding chamber ................................ ................................ ..... 188

PAGE 13

13 LIST OF ABBREVIATIONS AI Active ingredient CDC Center for Disease Control DEM Diethyl maleate DNA Deoxyribonucleic acid EDTA Ethylenediaminetetraacetic acid FAO Food and Agriculture Organization GABA Gamma aminobutyric acid GST Glutathione S transferase KCl Potassium chloride LC Lethal concentration LD Lethal dose LPT Larval packet test MSF Mediterranean spotted fever PBO Piperonyl butoxide PPM Parts per million RR Resistance ratio RMSP Rocky M ountain spotted fever SR Synergist ra tio TCE Trichloroethylene TPP Triphenyl phosphate

PAGE 14

14 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy DETERMINING RESISTANCE LEVELS AN D MECHANISMS IN RHIPICEPHALUS SANGUINEUS (LATREILLE) TO ACARI CIDE S USED TO TREAT DOMEST IC ANIMALS AND RESIDENT IAL ENVIRONMENTS By Amanda L Eiden December 2013 Chair: Phillip Kaufman Co chair: Faith Oi Major: Entomology and Nematology From September 2010 until October 2013 studies were conducted to evaluate the presence and levels of resistance to permethrin and fipronil in Rhipicephalus sanguineus (Latreille), the brown dog tick. Permethrin is a commonly used acaricide for tick cont rol on domestic animals and in residential environments and fipronil for on animal treatment. Field collected ticks from kennels and residential facilities were challenged with technical grade permethrin and fipronil to create dose response curves, which were compared to a susceptible strain. Permethrin resistance was screened in seven populations, all of which were resistant with a resistance ratio greater than 10. Fipronil was tested on four populations, which were found to be tolerant, with resistance ratios below 3.8. This is first documentation of R. sanguineus permethrin resistance and fipronil tolerance in the United States. An acaricide susceptible R. sanguineus strain was used to develop a discriminating concentration, which is a single acaricid e concentration that can quickly and affordably diagnose resistance in newly encountered field populations. The discriminating concentration 2x LC 99 was used to screen field collected tick strains.

PAGE 15

15 P ermethrin resistance of up to 53 fold was found in Fl orida collected populations. Fipronil discriminating concentrations were lower, with tolerance found at 2 fold the susceptible strain. Resistant R. sanguineus were evaluated for acaricide resistance mechanisms. Synergists evaluated included those that in hibit esterase, c ytochrome P450, and glutathione S transferase activity. Esterase was the most prominent metabolic resistance mechanism in permethrin resistant ticks. Cytochrome P450 activity was determined to play a likely role in perm ethrin resistance. Glutathione S transferase inhibition yielded the smallest levels of change in mortality, suggesting this mechanism was not amplified in the resistant ticks. N one of the experiments demonstrated high levels of change in mortality when synergists were com bined with fipronil. Using gel electrophoresis, esterase activity was further confirmed as a mechanism for permethrin resistance. Twelve permethrin resistant strains were tested and increased esterase activity was confirmed in eight strains. These resul ts will be used to guide future brown dog tick control management plans.

PAGE 16

16 CHAPTER 1 LITERATURE REVIEW OF THE BROWN DOG TICK RHIPICEPHALUS SANGUINEUS (LATREILLE) The brown dog tick, Rhipicephalus sanguineus (Latreille), is found worldwide as a common ectop arasite of dogs, Canis lupus L (Goddard 1989). It is taxonomically classified in: Kingdom: Animalia, Phylum: Arthropoda, Subphylum: Chelicerata, Class: Arachnida, Order: Ixodidae, Family: Amblyommidae, Subfamily: Rhipicephalinae, Tribe: Rhipicephalini (E l Sayed 2012). Taxonomy The order Ixodidae consists of hard ticks that are characterized by the presence of an anal groove, a scutum and ticks pass through only one nymphal instar. Ixodidae feed on a broad range of hosts including reptiles, birds, and m ammals and have an extensive geographic range from tropic al to temperate zones (Klompen et al. 1996). Ixodidae currently has 702 described species within 14 genera including Rhipicephalus (Guglielmone et al 2010). Guglielmone et al. (2010) placed 82 spe cies within the genus Rhipicephalus This genus is found worldwide and can be characterized by a hexagonal basis capitul i (Nicholson et al. 2009). Several species of medical and veterinary importance are classified under Rhipicephalus including the spec ies R. sanguineus, Rhipicephalus appendiculatus Neumann and Rhipicephalus bursa (Canestrini and Fazago) and the five tick species that were formally classified under Boophilus Former Boophilus ticks include Rhipicephalus annulatus (Say, 1821), Rhipicep halus decoloratus Koc h Rhipicephalus geigyi Aeschlimann and Morel, Rhipicephalus kohlsi (Hoogstraal and Kaiser), and Rhipicephalus microplus (Canestrini) (Guglielmone et al. 2010).

PAGE 17

17 Boophilus has been reclassified with Rhipicephalus as a paraphyletic gro up (Murrell and Barker 2003). Murrell et al. (200 3) used the significant similarities between the genera in the 12S rRNA mitochondrial and the cytochrome c oxidase subunit I gene sequences as a basis for reclassification Alternatively, Beati and Keirans (2001) suggest that Boophilus is a monophyletic group that arose out of Rhipicephalus However, biogeographical distribution and morphological characteristics provide additional supporting evidence for classifying Boophilus and Rhipicephalus in the same genus (Murrell and Barker 2003). Differences between former Boophilus and Rhipicephalus ticks include biological parameters such as that Boophilus ticks are one host ticks where as Rhipicephalus are mostly three host ticks, with a few two host tick species (Murrell and Barker 2003). The relatedness of these former tick genera is important to understand because most of the comparative research in my dissertation with R. sanguineus has been completed with R. microplus Within Rhipicephalus, R. sanguineus rec ently has been genetically compared to assess potential speciation due to morphological, biological, and genetic variations found in populations from different regions (Oliveira et al. 2005, S zab et al. 2005) Moraes Filho et al. (2011) used mitochondria l 16S rDNA from R. sanguineus collected in di fferent regions of the world in their assessment of speciation. Authors found that New World R. sanguineus can be separated into two species and there may be a species unique to Old World regions as well Nom enclature to distinguish these different species has not been determined to date Rhipicephalus sanguineus crossbreeding experiments were conducted to evaluate the reproductive success of populations from different parts of the world. Levin

PAGE 18

18 et al. (2012 ) mated populations of R. sanguineus from North America, the Mediterranean, and Africa. When the African cohort was mated with the North American or Mediterranean cohorts the resultant progeny were infertile. The North American and Mediterranean populati ons were able to be mated without impacting the fecundity of the offspring (Levin et al. 2012). This suggests a speciation event between the African and both the North American and Mediterranean populations. Lui et al. (2013) compared the mitochondria l g enome of R. sanguineus fro m China and the United States. Authors reported an 11.23% difference in the sequences, suggesting these populations of ticks are closely related species rather than the same species. Life History Dogs are the preferred host fo r R. sanguineus but cases of human parasitism have been documented (Goddard 1989, Demma et al. 2005). Rhipicephalus sanguineus is a three host tick that can complete its entire life cycle indoors and due to this capability, it may infest homes (Demma et al. 2005, Dantas Torres et al. 2006). Pesticide resistance in tick populations has increased the difficulty of controlling R. sanguineus infestations (Miller et al. 2001). Due to the small size of the brown dog tick an i nfestation may go undetected for extended periods of time. Fem ale brown dog ticks have been known to oviposit up to 4,000 eggs under laboratory conditions (K och 1982). Reproduction rates of this magnitude can lead to a severe infestation i n a residential environment. Additionally, brow n dog ticks spend 94 to 97% of their time off the host, often within cracks and crevices, further confounding detection (Needham and Teel 1991). Although humans are not the preferred host, human attachment by R. sanguineus has been documented (Goddard 1989 Demma et al. 2005). R hipicephalus

PAGE 19

19 sanguineus also has been documented to feed on small mammals including rodents under various conditions (Rhodes and Norment 1979). Nelson (1969 ) demonstrated that R. sanguineus has a decreased preference for feeding on human hosts when compared to dogs and guinea pigs. When R. sanguineus were placed on humans, 5% or fewer remained attached after 24 h ours whereas 20% or more remained attached to dogs and guinea pigs demonstrating a preference for nonhuman hosts (Nel son 1969). Several more recent studies have indicated that some strains of R. sanguineus may be developing a greater affinity for human feeding When surveying Air Force bases in Texas and Oklahoma between May 1986 and September 1988, Goddard (1989) docum ented nine cases of human parasitism by brown dog ticks. Goddard suggested the ticks were adapting to humans as hosts based on the increased number of cases documented during his study, compared to the number of historically reported cases. A surveillanc e study conducted by Carpenter et al. (1990) documented nine additional cases of human parasitism by brown dog ticks with the majority occurring in the same geographical region in which Goddard (1989) conducted his surveillance. In addition to the human a ssisted brown dog tick range expansion that has occurred over the centuries the climate change hypothesis predicts changes in their distribution range (Gray et al. 2009). Currently the brown dog tick is rarely found in temperate regions but has been kno wn to establish short term populations because it can live indoors and will thrive anywhere that is heated (Gray et al. 2009) In laboratory studies, brown dog ticks had the greatest longevity at 10 C but temperatures <10 C were not well tolerated (Sweatm an 1967). Engorge females were incapable of C Dantas Torres et al. (2010) found brown dog tick eggs held at 8 C

PAGE 20

20 we re unable to survive. It is predicted that an average climatic temperature increase of 2 to 3 C would promote long term establishment in temperate zon es (Gray et al. 2009) The optimal conditions for brown dog tick reproduction and survival varies. Srivastava and Varma (1964) reported 99% survival of brown dog tick eggs at 25C and 100% RH when compared to 80% survival at 29C and 80% RH. At higher temperature s, eggs hatched more quickly and time to larva l molt was reduced, but survival for unfed larvae decreased from four months at 25 C and 100% RH to two months at 29 C and 80% RH N ymphs required a blood meal around 4 d ays after emergence and had increased feeding rates on rabbits compared to guinea pigs. Adult unf ed females and males held at 25 C and 80% RH were able to survive unfed for 7 months and 4 months, respectively. D ata were not given for survival at 29 C Mated a dult females held at 25 C began feeding 7 d ays after molting and dropped off the host within 7 to 15 days (Srivastava and Varma 1964). Male brown dog ticks require a blood meal before they can reach sexual maturity and respond to female attractant hormones (Kiszewski et al. 200 1). The male brown dog tick also requires a blood meal between multiple mating opportunities and will stay on a host where it will mate multiple times with female s are present. When females are not present on a host, males have been shown to switch hosts increasing the probability of pathogen transmission (Little et al. 2007). The presence of tick feeding on a host may attract other ticks. Guanine, a pheromone present in tick excrement, has been found to induce aggregation, regardless of the concentrati on p resent (Yoder et al. 2013). Tick attraction was greatest under 33% RH, which is within the humidity range of a typical home.

PAGE 21

21 Pathogen T ransmission The brown dog tick has been shown to vector several canine pathogens, including Babesia spp. Ricketts ia spp. and Ehrlichia spp. and may be involved in the transmission of Leishmania chagasi (Murphy et al. 1998, Coutinho et al. 2005, Demma et al. 2005 health, occurrence of Ehrlichi a canis and Rickettsia rickettsii in humans suggests that these pathogens are zoonotic and that the tick may pose a risk to humans (Maeda et al. 1987, Perez et al. 1996, Demma et al. 2005). Multiple pathogens can exist simultaneously in dogs, but such a c ircumstance would be less likely to occur in humans, as they infrequently are parasitized by multiple ticks and multiple tick species (Breitschwerdt et al. 1998 Kordick et al. 1999). Babesia spp. are protozoan parasites that include species that cause spe cies specific forms of babesiosis in many mammalian species. Symptoms of babesiosis in dogs may include fever, weakness, lethargy, jaundice, red or orange urine, anemia, anorexia, and organ failure (Reviewed by Wulan s ari et al. 2003). In immunocompromise d animals the symptoms are generally more severe. In Sudan, a prevalence survey of 78 dogs was conducted wherein 44 dogs were found infes ted with R. sanguineus (Oyamada et al. 2005) Five dogs tested positive for B abesia canis rossi and two dogs with Bab esia canis vogeli In humans, the general symptoms of babesiosis include fever, chills, body aches, anorexia, nausea, and headache (Meer Scherrer et al. 2004 CDC 2013 ). Babesiosis can cause more severe complications in people with compromised immune sys tems. However, few cases of Babesia canis h ave been documented in humans.

PAGE 22

22 Rocky Mountain spotted fever (RMSF) is a medically important disease caused by the bacteria, Rickettsia rickettsii. Although R. sanguineus is not the primary vector, R. rickettsi i can be transmitted to humans by the brown dog tick (Demma et al. 2005). Clinical symptoms in humans may include fever, vomiting, nausea, headache, myalgia, and loss of appetite, arthralgia, rash, and possible gastrointestinal symptoms. Around 2,000 cas es of RMSF were reported in 2010 in the United States (CDC 2013) A few RMSF outbreaks have been linked to R. sanguineus One research study identified 16 human cases in Arizona that likely were likely the result of feeding by the brown dog tick (Demma et al. 2005). Patients in all confirmed RMSF cases reported contact with R. sanguineus with one patient having an actively feeding tick still attached. Researchers culture d the pathogen from R. sanguineus confirming the presence of R. rickettsii Followi ng the identification of the outbreak, a pathogen prevalence study of ticks in Arizona was conducted using a sample population of dogs and found five of 20 brown dog ticks harboring rickettsial DNA (Eremeeva et al. 2006). Vector competency studies are sti ll needed to in order to verify transmission. Internationally R. sanguineus vectors the bacteria Rickettsia conorii that causes Mediterranean spotted fever (MSF), also known as boutonneuse fever (Segura Porta et al. 1998). Mediterranean spotted fever o ccurs throughout Europe, Asia, and Africa (Mumcuoglu et al. 1993). The distribution of R. sanguineus has expanded to northern regions of Europe, including the Netherlands, increasing the range of clinical cases observed (Beugnet and Marie 2009). Prevalen ce surveys in southwest Spain have found R. sanguineus to be a vector of Rickettsia massiliae which is believed to cause symptoms similar to MSF (Marquez et al. 2008). In southeastern Spain, S egura Porta

PAGE 23

23 (1998) sampled serum from 150 asymptomatic human p atients and found that 12 had been exposed to MSF, likely due to feeding by R. sanguineus In parts of Israel up to 7% of dog owners tested positive for MSF, with 90% of dogs seropositive for Rickettsia (Mumcuoglu et al. 1993). These case reports demonst rate the importance of R. sanguineus as a pathogen vector. Surveillance studies conducted by Goddard (1989) and Carpenter et al. (1990) found that more cases of human parasitism by R. sanguineus occurred in children than in adults. Factors contributing t o differences in parasitism rates could include children having aware ness of the tick feeding or that children may come into closer contact with ticks due to behavioral differences and closer interaction with animals Because children have less developed immune systems, there is a greater concern for pathogens causing more severe illness. Ehrlichiosis is a disease, caused by several species of bacteria which can be vectored by R. sanguineus as well as several other tick species Under experimental con ditions brown dog tick nymphs a cquired Ehrlichia canis and successfully transmitted the pathogen to a second host as adult males, thus demonstrating transstadial transmission (Bremer et al. 2005) The brown dog tick also was able to transmit E. canis intr astadially under experimental conditions where males acquired the pathogen from one host and were subsequently introduced to a second host whereupon they transmitted the pathogen This study documented a variation in symptoms from canines that were inocu lated via syringe with E canis over those exposed from tick feeding. The symptoms of the canines that contracted the pathogen from the ticks were

PAGE 24

24 less severe than the symptoms experienced by the canines that were inoculated (Bremer et al. 2005). Ndip et al. (2007) conducted a study in Cameroon to determine if R. sanguineus could transmit E. canis, Ehrlichia ewingii, and Ehrlichia chaffeensis They collected 92 brown dog ticks from a survey of 1 04 dogs, of which 51 dogs presented with R. sanguineus It w as determined that 30 % of these ticks harbored ehrlichial DNA, including all three species. Two of these positive ticks were co infected with two Ehrlichia species. Of the dogs infested with R. sanguineus E. canis was the predominant pathogen with 15 do gs two ticks were positive for E. ewingii while all of the dogs were negative for E. chaffeensis (Ndip et al. 2007) Dogs have been documented as a likely reservoir for several species of ehrlichiosis (Ristic et al. 1988, Unver et al. 2001, Liddell et a l. 2003). Brown dog tick t ransmission of Ehr lich i a spp. is becoming more frequently reported in human populations (CDC 2013 ). Symptoms that are seen in humans include fever, chills, headache, myalgia, diarrhea, and sensitivity to l ight in some human pati ents (CDC 2013 ). Typically human infections of Ehrlichia spp. are vectored by the lone star tick Amblyomma americanum (L. ) but R. sanguineus has been found to harbor E. canis and E. ewingii (Murphy et al. 1998). However, the vector competence of the brown dog tick for E. ewingii has not been determined. Ehrlichia ewingii and E. chaffeensis are the two Ehrlichia that most frequently impact human populations while h uman infections with E. canis have been documented, but only rarely (Maeda et al. 1987, Perez et al. 1996). In human populations E. chaffeensis was identified duri al.1991)

PAGE 25

25 and E. ewingii E. ewingii in Missouri (Buller et al. 1999). Surveillance data collected by the Centers for Disease Control and Prevention have shown a rise in human ehrlichiosis cases in the United States from 100 to over 700 between the years 1999 to 2010 (CDC 2013 ) I t is possible that zoonotic transmission is a contributing factor to the rapid rise in the frequency of human cases as proposed with the rickettsial pathogens. Additionally, improved serological testing methods and i ncreased awareness may aid in indentifying cases, thereby generating higher prevalence data. Therefore, it is important to reduce the potential risk of pathogen transmission to dogs by R. sanguineus through monitoring and controlling their populations. Prolonged tick feeding increases the likelihood of pathogen transfer to potential hosts. Piesman et al. (1987) c ompared exposure time on a host with B orrelia burgdorferi transmission by Ixodes scapularis Say and found that while 92% of rodents became infected with B. burgdorferi after 72 h ours of tick attachment, only 7% pathogen transmission occurred in hosts when ticks were removed 24 h ours after initial contact. Therefore, feral or outdoor dogs could potentially harbor multiple pathogens if prompt physical removal of ticks or treatment with an acaricide is not performed. Host Immunity Some h osts that are subject to multiple feedings by ticks have been documented to elicit an immune response Trager (1939) found a decrease in the number of American dog tick, Dermacentor variabilis (Say), larvae that were fully engorged after feeding on a guinea pig with previous tick feeding exposure. Additionally, the immune response from the host was non specific and provided some protection against other tick species. Ferreira and Silva (1998) found that guinea pigs developed a protective

PAGE 26

26 immune response to tick feeding after consecutive feedings from R. sanguineus However, mice and dogs did not have the same protective immune reaction. Ali and Sweatman (1966) found that increased estrogen levels in laboratory mice provided protection against brown dog tick larvae. They al so determined that increased cortisone levels lead to increased larval attachment rates. Cortisone, a steroid hormone, reduces the immune system response, possibly allowing ticks to host feed for a longer time period. Ali and Sweatman (1966) also found t hat larval brown dog ticks that were fed on immature male mice had a greater number of engorged ticks and higher rates of survival than those fed on older mice and female mice. Male mice that were treated with estrogen became more resistant to tick attach ment, indicating female hormones may provide some protection against tick feeding. Other vertebrate hosts have been documented to develop an immunity to tick feeding after a blood meal has been taken. Randolph (1979) compared the success of larval and n ymphal Ixodes triangulicepts Birula, feeding capability on their natural hosts Apodemus sylaticus L., (wood mouse), and laboratory reared mice. The laboratory reared mice developed an immunity and ticks failed to attach after exposure to approximately 10 ticks. In comparison, ticks feeding on A. sylvaticus did not demonstrate a change in tick survival or attachment was observed, suggesting the lack of an immune response (Randolph 1979). Canine vaccine development has been hampered by the lack of an immune response exhibited by dogs following multiple exposures to R. sanguineus Dogs were inoculated with brown dog tick concentrated crude proteins using three subcutaneous injections at 15 day intervals (Bechara et al. 1994). Dogs did not demonstrate any le vel

PAGE 27

27 of resistance to R. sanguineus feeding and introduced ticks did not show any change in reproductive and feeding performance. Later studies isolated gut extract proteins and inoculated dogs using the same immunization schedule as the previous study (Sz ab and Bechara 1997). Gut extract immunizations yielded some decrease in tick engorgement and fecundity when paired with a proper adjuvant. Jittapalapong et al. (2000) inoculated dogs with R. sanguineus salivary gland or midgut immunizations three times at 21 day intervals. With their formulation they found a decrease in feeding and engorgement with salivary gland extracts and a decrease in fecundity factors from midgut extract immunizations. Rodrguez Mallon et al. (2012) used a novel R. sanguineus pr otein that was formulated in a vaccine and tested it on rabbits. They found that ticks that fed on vaccinated rabbits demonstrated a decrease in the size of molting larvae and nymphs, as well as reduced reproductive success. Continued studies on novel pr oteins and vaccine development are ongoing. Biological Control Several species of entomopathogenic fungi have been evaluated as biological control agents for ticks. This group of fungi effectively penetrates the arthropod cuticle and does not require inge stion. The enzymes that break down the cuticle are produced less than 24 h ou r s after initial contact and perform similarly with insects and tick s ( St. Leger et al. 1986). Cuticle breakdown is initiated by esterases and the proteolytic complexes such as p rotease, aminopepidase, and carboxypeptidase, followed by chitinases. Mortality is caused by cuticular penetration that damages the tick exoskeleton and the hyphal bodies spread throughout the arthropod body (Hajek and St. Leger 1994 ).

PAGE 28

28 Beauveria bassian a (Balsamo ) Vuillemin and Metarhizium ( anisopliae ) brunneum (Petch ) were evaluated as biological control agents for Rhipicephalus appendiculatus Neumann and Amblyomma variegatum (Fabricius) that were actively feeding on rabbits. Kaaya et al. (1996) found both fungal species resulted in 30% greater mortality in adults ticks. Adult ticks also demonstrated decreased fecundity, engorgement weight, egg mass, and egg eclosion rates (up to 99% under both field and laboratory conditions). In laboratory experimen ts, ticks were place in closed stockings around rabbit ears. A fter two days ears were sprayed with a spore suspension. Under field conditions naturally tick infested cattle were sprayed with a spore suspension under an ear sock. The exposure of adult R. appendiculatus to these fungal species resulted in 100% larval mortality out of 900 ticks 7 6 to 95% nymphal mortality with 600 ticks and 36 to 64% mortality out of 600 adult ticks Beauveria bassiana and M. brunneum were not impacted by exposure to org anophosphate acaricides for over 120 h ou r s therefore, chemical and biological control measures could be combined effectively. Although researchers did not indicate why the use of biological control was not commercialized, it was indicted that spores pers isted on cattle for one week and three weeks for B. bassiana and M. brunneum respectively. Zhioua et al. (1997) found M. brunneum significantly increased larval and adult mortality of I. scapularis A concentration of 10 6 fungal spores per mL resulted in significant rates of mortality. Gindin et al. (2001) found that M. brunneum was significantly more effective than B. bassiana in controlling the cattle tick. Metarhizium brunneum also effectively increased mortality in unfed and engorged larval, nymp h al and adult brown dog ticks (Samish et al. 2001).

PAGE 29

29 The formulation of entomopathogenic fungi can impa ct mortality levels. Kaaya and Hassan (2000) found oil based formulations of M. brunneum and B. bassiana were more effective in initiating adult tick morta lity than were aqueous formulations. Spraying the formulation s in the environment to control resting ticks can be more effective than host based control measures. T he efficacy and commercialization of entomopathogenic fungi depend on the development of e ffective formulations Mishra et al. (2013) evaluated the effectiveness B. bassiana formulated as bait, encapsulated, and emulsion on M. domestica They determined advanced emulsion and encapsulated formulas provided a fungal delivery system that cou ld b e effectively manufactured to provide persistent mortality. Entomopathogenic nematodes have been used under laboratory conditions against several species of ticks, including the brown dog tick (Kocan et al. 1998). The nematodes cause mortality and tissue destruction when ticks develop an infection from bacteria released by the nematode. Although some nematode species caused mortality in 30 to 100% of ticks, their application in natural settings may be limited due to specific environmental conditions requ ired to promote tick and nematode interactions. Moisture levels under laboratory conditions were critical for nematodes to be effective biological control agents, which would be difficult to ensure under field conditions (Kocan et al. 1998). Biological co ntrol agents that t arget ticks specifically will minimize the impact of mortality on other non target arthropods (Samish et al. 2004). However, biological control methods generally require more time to be effective. Efficacy is also highly dependent on e nvironmental conditions (Samish et al. 2004). Finally, home owners are

PAGE 30

30 generally resistant to the concept of releasing additional organism in their home to control the target pest. Chemical Control On Animal C ontrol Preventing and eliminating tick infesta tions frequently requires acaricide treatment. There are several commercially available products designed to control ticks on companion animals including collars, shampoos, sprays, and spot on treatments. Spot on treatments are individually packaged dose s of acaricide that are administered topically between the shoulder blades Some spot on treatments for companion animals include K9 Advantix II (Bayer Healthcare LLC, Animal Health Division Shawnee Mission, KS ) acti ve ingredient (AI) permethrin 44 % im idacloprid 8.8 % pyriproxyfen 0.44%, Frontline ( Merial, Duluth, GA ) AI fipronil 9.8% ; Certifect (Merial, Duluth, GA) AI fipronil 6.4%, ( S ) methoprene 5.8%, amitraz 7.6% ; Vectra 3D ( Ceva, Lenexa, KS ) AI dinotefuran 4.95%, pyriproxyfen 0.44%, permethrin 3 6 or 58% ; and Promeris ( Fort Dodge Animal Health, Overland Park KS ) AI metaflumizone 14.34%, amitraz 14.34%. Acaricide impregnated c ollars on the market include P reventic (Virbac, Carros, France) amitraz 9% and Seresto Shawnee Mission, KS ) f lumethrin 4.5%, imidacloprid 10% T he number of different acaricide active ingredients currently approved for use on companion animals is quite limited leading to repeated use of products with the same chemical class Mehlhorn et al. (2003) tested K9 A dvantix on Ixodes ricinus (L.) and determined that this product was repellent to ticks, reducing tick attachment in all life stages, in addition to the acaricidal activity of permethrin on directly exposed ticks. Effects were measured with both in vitro studies, in which hair samples were taken from treated dogs

PAGE 31

31 and placed in Petri dishes with ticks, and in vivo studies, in which adult ticks were placed on dogs previously treated with the K9 Advantix product. In both studies, mortality was assessed foll owing new tick placement at 7, 14, 21, and 28 days post treatment (Mehlhorn et al. 2003). Nearly all exposed ticks died or were paralyzed and did not recover within a 48 hour period after exposure to either treatment regimen. Frontline was tested as a po ur on formulation on cattle at concentrations of 0.25, 0.5, and 1% fipronil and the index of reproduction was measured on R. microplus (Davey et al. 1998). Fipronil was 100% effective in killing ticks for 8 weeks at the 1% concentration, but at 0.5% AI 1 00% protection lasted only 4 weeks (Davey et al. 1998). Bonneau et al. (2010) evaluated the efficacy of Frontline and Effipro (10% fipronil w t/vol) (Virbac, Carros, France) spot on treatments against I. ricinus infestations of dogs. Both products were effective within 48 hours of tick exposure, which is rapid enough to minimize transmission of Borrelia burgdorferi the pathogen that causes Lyme disease (Piesman and Dolan 2002). Both Effipro and Frontline provided > 90% protection against ticks for 5 weeks and 3 weeks, respectively (Bonneau et al. 2010). Brianti et al. (2010) evaluated the efficacy and the effects of water on Frontline Plus applications against all stages of R. sanguineus Twenty four dogs were treated according to manufacture recomm endations. Tick s were counted on 7, 14, 21, and 28 days post treatment. The ticks present were naturally infesting the dogs in an outdoor kennel. The mean tick load for the dogs prior to the study was approximately 150 per dog. In this study, one half of the treated dogs were washed with detergent free water on day 14, while the other dogs were not bathed. The efficacy of the product did not decrease following exposure to water and there was >90% protection against all life

PAGE 32

32 stages during the 4 week tri al peri od (Brianti et al. 2010). The effects of detergent were not evaluated. When K9 Advantix was compared with Frontline Plus as a protectant against R. sanguineus it was determined that the permethrin in K9 Advantix was a more effective repellent for ticks than the fipronil in Frontline Plus (Young et al. 2003). Additionally, Otranto et al. (2005) determined that the active ingredients in Frontline Plus fell below effective levels at 28 days resulting in only 72% tick mortality. K9 Advantix r esulted in 98% mortality at 28 day s post treatment, and was considered more effective at inducing mortality in larval and nymphal R. sanguineus Endris et al. (2000) also compared the efficacy of a 65% permethrin product (Defend Exspot Treatment for do gs, Merck, Whitehouse Station, NJ) and a 9.7% fipronil product (Frontline ) against I. ricinus The researchers found permethrin provided 87% mortality at 28 days post treatment, while fipronil provided no more th an 61% protection during the 41 day evalua tion. On dogs experimentally infested with I. ricinus spot on treatments containing 65% permethrin (Defend ) were compared against those containing selamectin (Revolution Pfizer Animal Health, New York, New York) (Endris et al. 2002 a ). Selamectin provi ded less than 10.9% repellency (percent live and dead ticks in the cage unat tached to the dog) compared to the 63 to 80% repellency provided by permethrin. No acaricidal effects were measured with the use of selamectin, but control mortal ity was measured at 90% with the use of 65% permethrin. Jernigan et al. (2000) evaluated the use of selamectin as a spot on treatment against R. sanguineus and D. variabilis on dogs and found effective control of experimentally introduced ticks increased when the

PAGE 33

33 spot on treatment was administered every two weeks. With bi monthly administration, 97 to 100% tick control for R. sanguineus and D. variablis was achieved; how ever, with once a month application s control dropped to 90% in some dogs when tick counts were complet ed 5 days post treatment. Greater than 95% tick control was achieved when treatment was applied for consecutive months, compared to treatment for one month alone that provided only 90% or greater tick mortality (Jernigan et al. 2000). Promeris (20 mg/kg dose metaflumizone and amitraz) efficacy studies on R. sanguineus demonstrated >90% tick control 35 days post treatment on dogs (Rugg and Hair 2007). Promeris was withdrawn from the market due to reports of pustular acantholytic dermatitis in dogs (Oberk irchner et al. 2011). Amitraz formulated in collars has demonstrated excellent control against R. sanguineus, I. ricinus, and Ixodes scapularus Say in dogs (Estrada Pea and Rme 2005). Thre e experimental groups were used: an untreated control collar, a 9 % amitraz collar, and a 9% amitraz and 0.5% pyriproxyfen collar, each applied as one collar per dog. Collars with amitraz alone provided 94 to 97% protection against R. sanguineus and 85 to 96% protection in tested Ixodes species. However, surviving fema le ticks were able to successfully oviposit. Collars impregnated with 9% amitraz and pyriproxyfen provided up to 95 to 98% protection against R. sanguineus and 86 to 95% protection in tested Ixodes species. However, in this case, females that survived an d oviposited did not produce viable eggs (Estrada Pea and Rme 2005). Amitraz also has been found to have increase d mortality against R. sanguineus when combined with fipronil (Prullage et al. 2011).

PAGE 34

34 Spinosad is naturally derived from the aerobic ferme ntation of the bacterial species Saccharopolyspora spinosa In a study evaluating systemic acaricide treatments, two dog groups were administered oral spinosad treatments containing either 50 or 100 mg/kg to determine efficacy against R. sanguineus. Tick numbers were reduced by 94 to 97% 24 hours post treatment. Control of ticks remained effective up to nine days post treatment and no difference in tick mortality was documented between the treatment and co ntrol group from 16 to 30 days (Snyder et al. 200 9). A few plant essential oils have been evaluated for R. sanguineus and R. microplus control, including oils derived from Drimys brasiliensis Miers, Chaemaecyparis nootakensis (D. Don) Spach, and Calea serrata Less (Ribeiro et al. 2008, 2011, Flor Weiler et al. 2011). All three plant derived essential oils were proven to be effective at causing mortality in larval tick populations in laboratory studies and may be the target of future research. To date no work has been published on the formulation of thes e essential oils for use in tick control and extracts have not been evaluated to determine how they will impact non pest arthropods Burridge et al. (2004) conducted efficacy testing comparing several acaricides against R. sanguineus using contact bioassa ys F ipronil provided the highest mortality followed by carbaryl, cyfluthrin, and permethrin. Pyrethrins had moderate effectiveness, and selamectin and chlorpyrifos killed the fewest R. sanguineus Residential and Kennel Facility Control Pyrethroids ar e used heavily for residential and on animal tick control. In the 1990s indoor pest control treatment reco mmendations included carbamates ( bendiocarb, carbaryl, and propoxur ) and organophosphates ( chlorpyriphos, diazinon, and malathion ) in addition to py rethroids (St. Au bin 1990 ) After enactment of the 1996

PAGE 35

35 Food Quality and Protection Act most carbamate and organophosphate insecticide u se was limited and pyrethroids became relied up on heavily (EPA 2013). Most labels of pyrethroid products include ind oor crack and crevice or spot treatment applications, greatly increasing the number of products that ticks could contact. If the treatment site area is listed on the label it is a legal application even if ection. However, s everal different pyrethroids have been formulated into products that include brown dog tick s specifically on the label Examples include, Onslaught microencapsulated insecticide (McLauglin Gormley King, Minneapolis, MN), AI esfenvalera te 6.4% which is labeled for brown dog tick control at an end use rate of 0.05%. Published research on esfenvalerate for tick control is unavailable, but studies have been conducted on resistance development in Leptinotarsa decemlineata (Say) the Colora do potato beetle. Huang et al. ( 1994) found a significant increase in LC 50 values after repeat applications during the potato growing season, indicating resistance selection. NyGuard Plus Flea & Tick Premise Spray (McLauglin Gormley King, Minneapolis, MN ), AI sumithrin 0.40%, and MGK 1.60%, a proprietary cytochrome P450 synergist, is used for indoor application to control brown dog ticks. Published resistance research on sumithrin based products for ticks limited. However, sumithrin is also labeled for use against the human head louse, Pediculus capitis (DeGeer), and resistance development has been documented (Picollo et al. 1998). Cy kick CS (Prescription treatment brand, BASF, St. Louis, MO) AI cyfluthrin 6.0%, is formulated for use at 0.05% or 0.10% Cyfluthin was evaluated for control of Ixodes ( scapularus ) dammini Spielman and A. americanum during a study that applied

PAGE 36

36 the product to 35 field plots at 0.41% (Solberg et al. 1992). Adult and nymph al populations were reduced up to 87% using a granula r formulation, two months post treatment and up to 100% two months post treatment, after liquid application. Cyfluthrin was evaluated in an I. scapularis a laboratory contact assay and demonstrated greater toxicity than esfenvalerate (Maupin and Piesman 1 994). Resistance to cyfluthrin has been found in Blattella germanica (L.) and Haematobia irritans (L.) (Cochran 1989, Farnsworth et al. 1997). Contact assays were completed in B. germanica to evaluate cyfluthrin resistance in 45 field collected strains w introduction to the marketplace (Cochran 1989). Of the 45 strains tested, one strain demonstrated a resistance ratio greater than three. Comparatively, four strains demonstrated resistance ratios greater than three fo r permethrin and fenvalerate. Although all three compounds are pyrethroids, the different chemical structures were suggested to cause variations in resistance. A survey evaluated 99 farms for cyfluthrin resistance in H. irritans using a disc riminating co ncentration and found 40% mean mortality (Farnsworth et al. 1997). In this study, resistance was confirmed for all pyrethroids tested, which included deltamethrin, cyhalothrin, cypermethrin, and flumethrin, but cyfluthrin produced the lowest mortality. K aufman et al. (2010) found permethrin and cyfluthrin resistance in five M. domestic populations collected from four Florida dairies. Two populations that were tested from the same farm, 22 months apart, demonstrated survival at higher concentrat ions of both permethrin and cyfluthrin during the latter collection date. Pest control operators have reported indoor brown dog tick treatment protocol s using indoor applications spraying or spot treatments with pyrethroid based products

PAGE 37

37 including but not limite d to Masterline Bifenthrin 7.9 AI bifenthrin 7.9% (0.02 to 0.06% label rate ; Univar Austin, TX), Kicker AI permethrin 6.0% (0.1% label rate) and piperonyl butoxide 60.0% (1.0% label rate) (Bayer Environmental Science, Research Triangle Park, NC) C B pyrethrins 0.5 % and piperonyl butoxide 4 .0 % (FMC Corperation, Agriculture Product Group, Philadelphia, PA), NyGuard Plus Flea & Tick Premise Spray AI d phenothrin 0.4 % N o ctyl bicycloheptene dicarboximide 1.6 % and pyriproxyfen 0.1 % (MGK Minne apolis, MN), ready to use, Prescription Treatment brand Ultracide AI pyriproxyfen 0.1 %, pyrethrins 0.05%, n o ctyl bicycloheptene dicarboximide 0.4% and permethrin 0.4% (Whitmire Micro Gen Research Laboratories, Inc., St. Louis, MO), and Precor 2000 Plu s, AI (S) methoprene 0.085%, permethrin 0.35%, phenothrin 0.3 % N octyl bicycloheptene dicarboximide 2.0% and piperonyl butoxide1.4%, ready to use, (Wellmark International, Schaumurg, IL). Many of these products are labeled to treat other indoor pests suc h as German cockroaches and fleas, which may lead to residual amounts of pesticides present in the home prior to treatment for brown dog ticks. Residual levels of pesticides may induce increased metabolic enzymes, in turn conferring resistance (Yu 2008). A study conducted by Stout et al. (2009) that surveyed 1 131 housing units throughout the United States to determine the frequency of residual pesticides present found that in 448 home, 88% had residual levels of permethrin present. Other pyrethroids wer e detected including but not limited to cypermethrin (46%, 480 homes), bifenthrin (33%, 466 homes), deltamethrin (27%, 469 homes), and sumithrin (22%, 468 homes). In addition, fipronil, which is not labeled for indoor spray applications, was found inside 40% of 478 homes although the amounts detected were low (St out et al.

PAGE 38

38 2009). Fipronil is labeled for flea and tick control in products for companion animals and also is used in baits and gels to control ants and cockroaches Products include Maxforce FC Magnum AI fipronil 0.05% (Bayer Environmental Science, Research Triangle Park, NC), COMBAT AI fipronil 0.03% (Combat Insect Control Systems, Scottsdale, AZ) and outdoor treatment for termites such as Termidor SC Termiticide/Insecticide, AI fipronil 9.1% (label use 0.06 to 0.125% ) ( BASF Corporation, Research Triangle Park, NC). These results demonstrate the ubiquity of pyrethroids and fipronil in the environment, which may lead to brown dog tick exposure to sublethal concentrations that may aid in re sistance selection. Stout et al. (2009 ) also found residual DDT levels present in 41% of 422 homes. DDT exposure has been linked to p yrethroid cross resistance (Scott and Matsumura 1981, Brengues 2003 ). B rown dog ticks have had many avenues of exposure to acaricides that could lead to pyrethroid resistance development because they can complete their entire life cycle indoors Permethrin Permethrin, which is found in many flea and tick treatment formulations, is a pyrethroid that acts on the sodium cha nnel causing neuroexcitation that eventually leads to death. Sublethal doses have been shown cause adverse effects in Amblyomma americanum (L.) by causing increases in gas exchange and water loss (Zheng et al. 2013). P ermethrin also works as an arthropo d repellent perhaps reducing exposure when arthropods avoid contact (Schreck et al. 1980, Endris et al. 2000, Mencke et al. 2003). However, in some species such as Hyalomma dromedarrii (Koch), the camel tick, permethrin has been shown to enhance feeding behavior and increase neurosecretory and salivary gland activity (Mohamed et al. 2000).

PAGE 39

39 In part, due to the widespread use of permethrin across a 30 year period many arthropods have demonstrated resistance including Musca domestica L., H. irritans Stomox ys calcitrans (L.), Anopheles gambiae Giles, and R. microplus (Scott and Georghiou 198 5 Mcdonald and Schmidt 1987, Cilek and Greene 1994, Chandre et al. 1999, Miller et al 2007 a ). Two strains of H. irritans that were selected for permethrin resistance demonstrated resistance ratios of up to 11,300 fold in comparison to the laboratory susceptible strain (Guerrero et al. 1997). Rhipicephalus bursa field collected popu lations expressed cypermethrin resistance up to 6.9 fold higher than the maximum dose us ed to treat ticks in the fie ld; levels which lead to control failures (Enayati et al. 2010). After two generations of high dose selection with permethrin, R. microplus demonstrated resistance rati os ranging from 9.5 to 263 fold the susceptible colony. Ad diti onally, one population of field collected R. sanguineus from a dog kennel facility in Panama exhibited a 65 fold resistance ratio. Resistance can be the result of decreased cuticular penetration, increased metabolic activity, and target site mutations (Scott 1990). Increased levels of esterase activity, which leads to metabolic de toxification of permethrin, have been found in resistant strains of R microplus and R. sanguineus (Miller et al. 2001, 2007 a ). Within other populations of R. microplus, metab olic resistance to permethrin has been conferred by increased levels of esterase and mixed function oxidase activity (cytochrome P450s) (Hernandez et al. 2002). Over expression of c ytochrome P450 also has been found to be an important detoxification mecha nism that confers permethrin resistance in Culex pipiens quinquefasciatus Say (Kasai et al. 1998) and B. germanica (Pridgeon et al. 2003) A permethrin and deltamethrin resistant B.

PAGE 40

40 germanica population demonstrated an increase in production of cytochrome P450 between each life stage. In permethrin resistant Sarcoptes scabiei De Geer increased levels of g lutathion e S transferase (GST) were determined to be the metabolic mechanism that conferred resistance (Mounsey et al. 2010). Additionally, in the aforem entioned resistant strain of R. bursa elevated levels of esterase, P450, and GST may have contributed to increased levels of resistance (Enayati et al. 2010). In addition to metabolic resistance to permethrin, target site mutations in the sodium channel ca n confer resistance. As reviewed by Rinkevich et al. (2013) over 30 pyrethroid resistance mutations in the sodium have been identified in various arthropods, indicating different evolutionary paths. Permethrin resistant Heliothis virescens (Fabricius), t he tobacco budworm, has a thymine to adenine DNA bas e pair substitution that results in a single amino acid change from leucine to histidine, which in turn confers resistance (Park and Taylor 1997). Haematobia irritans permethrin resistance has been linke d to two different point mutations (Guerrero et al. 1997). The first mutation resulted in a methionine to threonine amino acid substitution that provided up to a 68 fold increase in permethrin resistance. The second mutation found in the super resistant colonies with up to 11,300 fold resistance ratios was a leucine to phenylalanine substitution (Guerrero et al. 1997). Dong (1997) reported that B. germanica strains, which expressed knockdown resistance, had a single amino acid change from leucine to ph enylalanine in the para sodium channel gene and that this mutation was not found in susceptible strains. Pyrethroid resistance in Cimex lectularis L. conferred by a sodium channel target site mutation was evaluated across 17 states in a broad scale study (Zhu et al. 2010). Out of 93 populations tested, 78 possessed the

PAGE 41

41 pyrethroid resistance mutation. In R. microplus three point mutation s have been documented that are linked to pyrethroid resistance (Lovis et al. 2012). One mutation is found in the Doma in III of the sodium channel and two mutations in Domain II and all result in amino acid shifts Cross resistance to permethrin has been linked to previous exposure to DDT. Scott and Matsumura (1981) evaluated the effects of permethrin on a DDT resistant strain of B. germanica that had no permethrin exposure Using electrophysiological studies they determined the DDT resistant cock roaches demonstrated a decreased sensitivity to permethrin in comparison to the susceptible strain Aedes aegypti (L.) also has been shown to express cross resistance to permethrin from prior DDT exposure and the mechanism was due to a point mutation in the sodium channel (Bre ngues et al. 2003). Laboratory selected DDT resistant Anopheles stephensi Liston presented a decreased susceptibility to permethrin suggesting a cross resistance mechanism was present (Davari et al. 2007). Fipronil Fipronil is in the phenylpyrazole chemical family and is the active ingredient in Frontline a topical treatment registered in the United Sta tes in 1996 for companion anima ls to control ticks and fleas. Fipronil acts on gamma aminobutyric acid (GABA) gated chloride channels where it block s the flow of chloride ions, leading to neuroexcitation (Zhao et al. 2003). After over ten years of c ommer cial use, it is important to determine if fipronil resistance has developed in brown dog ticks, or fipronil containing products are retaining effectiveness Fipronil acts not only as an acaricide, but also has been shown to reduce fertility rates of R. sa nguineus (Oliveira et al. 2009). In this study, o ocytes were examined for damage after ticks were subjected to a 2

PAGE 42

42 min ute immersion assay in fipronil at concentrations of 1, 5, and 10 ppm. Fipronil concentrations of 1 ppm demonstrated damaging effects on cell cytoplasm and the plasmic membrane but most other cell structures were not affected. Treatment at 5 ppm lead to more significant damage to the cytoplasmic areas and 10 ppm of fipronil resulted in total cell destruction (Oliveira et al. 2009). Not only does fipronil impact reproduction rates but it was hypothesized by Pereira et al. (2009) that effects observed on salivary glands may reduce pathogen transmission. In their study, b rown dog tick salivary glands had increased apoptotic activity on bo th unfed and semi engorged female ticks when exposed to fipronil at 1, 5, and 10 ppm (Pereira et al. 2009). These two studies demonstrate specific physiological effects of fipronil on R. sanguineus that convey important benefits of this compound that exte nd beyond the acaricidal capabilities After many years of use, fipronil resistance has been documented in several arthropod species. In Uruguay, populations of R. microplus have demonstrated resistance to fipronil, with res istance ratios ranging from 3.3 to 3,635 (Castro Janer et al. 2010). The resistant tick populations had been treated 3 to 5 times a year with fipronil for 3 to 7 years. However, the highest resistance ratio was found in a population that received only seven treatments but may have be en exposed previously to fipronil used as a miticide. Interestingly, o ther populations that had lower resistance expression had received up to 18 treatments. Resistance also may be linked to cross resistance from dieldrin exposure. Additionally, resista nce to fipronil has been documented in B. germanica M. domestica and Chilo suppressalis (Walker) (Holbrook et al. 2003, Kristensen et al. 2004, Li et al. 2007).

PAGE 43

43 Brown dog tick populations, along with many other arthropods, have been exposed to various ac aricides/insecticides for decades, oftentimes to the point of selecting for resistant populations toward specific compounds. Many newer compounds that act on similar pathways to these older pesticides are subject to reduced activity when exposed to arthro pod populations with stable resistance mechanisms. Cross resistance to acaricides that were previously used for tick control may impact the effectiveness of products on the market today. An An. stephensi population that expressed dieldrin resistance w as shown to be cross resistan t to fipronil ( Kolaczinski and Curtis 2001). Brooke et al. (2000) found that dieldrin resistance was maintained in an Anopheles gambiae Giles population at high frequencies in the absence of selection pressures for several years and conferred cross resistance to fipronil Holbrook et al. (2003) reported that field collected, fipronil nave B. germanica demonstrated survival at 10x the LC 99 of the laboratory susceptible colony This resistance expression was attributed to cross r esistance that had developed from prior dieldrin exposure. R hipicephalus microplus was shown resistan t to dieldrin over 50 years ago (Stone and Haydock 1962). If dogs supporting dieldrin resistant brown dog tick strains were treated with fipronil the con trol measure may not be effective if this tick shares cross resistance similarities with the aforementioned insects. Although the dieldrin fipronil cross resistance issue has been observed acro ss many species, fipronil cross resistance has been shown with other pesticides. In C. suppressalis cross resistance to fipronil was believed to be due to prior exposure to abemectin (Li et al. 2007). Kristensen et al. (2004) evaluated cross resistance to fipronil in the house fly, M. domestica wherein fly strains that were resistant to

PAGE 44

44 hexachlorocyclohexane (lindane) were not killed by fipronil applications. Thereafter, these field collected house flies were found to be resistant (or tolerant) to fipronil without known prior exposure. Overall, the authors concluded that these house flies may have been resistant to fipronil due to either elevated metabolic detoxification or cross resistance at the target binding site and that the resistance was conferred by the lindane resistance mechanism (Kristensen et al. 2004). Target site mutatio ns associated with fipronil resistance have been reported in various arthropod species. Two genetic mutations were found in the GABA receptor of a laboratory selected fipronil resistant Drosophila simulans Sturtevant strain (Le Goff et al. 2005). Both mu tations occurred in the Rdl GABA subunit, the first being an alanine to glycine substitution in the M2 domain and the second a theonine to methionine mutation, which occurred in the C terminal end of the M3 segment Nakao et al. (2010) reported tha t fipronil resistant Sogatella fucifera Horvath the plant hopper, also ha d an The A302S Rdl mutation also has been found in resistant populations of B. germanica (Gondhalekar and Scharf 2012, Ang et al. 2013 ). Fipronil resistance is frequently linked to a target site mutation as opposed to the up regulation of a metabolic pathway Newborn Norway rat, Rattus norvegicus (Berkenhout) and Periplaneta americana (L ), neurons were used to measure the blocking ability of fipronil sulfone, a metabolite of fipronil, on the mammalian gamma aminobutyric acid (GABA) receptor and the insects GABA and glutamate receptors. Glutamate gated chloride ch annel receptors are not found in mammals. Fipronil sulfone was found to have greater binding affinity than the parent compound, fipronil, in mammalian GABA receptors (Zhao et al. 2005). In insect neurons, fipronil sulfone was

PAGE 45

45 as effective as fipronil at blocking GABA receptors and had greater binding affinity to glutamate receptors than fipronil. Zhao et al. (2005) concluded that because fipronil binds to two target sites and fipronil sulfone binds to three targets sites, development of target site resis tance may take longer to evolve when compared to compounds that have a single binding site. Additionally, fipronil metabolic resistance should occur less frequently due to the metabolite creating greater toxicity than the original compound In Ostrinia nu bilalis (Hbner), the European corn borer, fipronil is metabolized into fipronil sulfone through cytochrome P450 microsomal monooxygenases (Durham et al. 2002). This metabolic pathway generates increased toxicity of the parent compound. Toxicity levels o f fipronil metabolites were greater than fipronil for both C. suppressalis and S. inferens when tested on larvae (Fang et al. 2008). The high level of toxic effects observed in C. suppressalis is believed to be the result of increased metabolic activity producing higher amounts of fipronil sulfone. However, in a laboratory reared strain of C. suppressalis a 45 fold resistance to fipronil was reached after selecting for six generations (Huang et al. 2010). The relatively short time before this high level of resistance developed suggests that there was a heritable factor present that confer red resistance. Following the selection of a resistant strain, the effects of piperonyl butoxide (PBO) as a synergist demonstrated an increase in mortality in compariso n to the susceptible strain, which had a decrease in mortality (Huang et al. 2010). Bioassays were completed by adding PBO to the stock solution and applying it to thoracic region using a microapplicator. Therefore, in a fipronil resistant field populati on PBO may be a useful synergist ; however, if susceptible insects exist in sufficient numbers in the population, PBO could possibly make a treatment less effective

PAGE 46

46 Esterase activity may play a role in fipronil resistance in C. suppressalis and S. fucifera (Li et al. 2007, Tang et al. 2010). Although esterase does not metabolize fipronil, the use of TPP as a synergist may increase insecticide penetration or blocking of fipronil by sequestration (Scott 1990, Soderlund and Bloomquist 1990). G lutathione S tr ansferase (GST) is known to metabolize fipronil (Scharf et al. 2000). However, there is little evidence that GST metabolism increases resistance to fipronil. Kristensen et al. (2004) found increased GST levels in both fipronil susceptible and tolerant st rains of M. domestica and Li et al. (2007) found no significant differences in GST levels between susceptible and resistant strains of C. suppressalis Determining resistance mechanisms before they become problematic may assist in developing more effective pest management strategies that could delay the onset or severity of arthropod resistance. Physiological comp arisons on the effects of acar icides that act on simila r target sites within the arthropod nervous system can increase the understanding of how r esistance could develop and lead to proactive control efforts. ( Sayyed and Wright 2004). Forms of Resistance Resistance to acaricides and insecticides is not found in all populations of arthropods but resistance traits increase in frequency, as populations are subject to selection pressure over time. Rhipicephalus microplus i nheritance studies found that resistance due to the transformation of the sodium channel is passed to subsequent generations as a recessive trait (Aguilar Tipacam et al. 2008). Homoz ygous resistant (RR) and susceptible (SS) strains were bred and heterozygous (RS) progeny were intermediate in their resistance levels. In Plutella xylostella (L .), diamondback moths, Sayyed and Wright (2004) found fipronil resistance to be a recessive tr ait. Incomplete

PAGE 47

47 recessive (RS) moths presented lower levels of fipronil resistance as compared to those with complete recessive (SS) gene inheritance expressing high resistance levels When comparing reproductive fitness between cattle ticks that are resi stant or susceptible to organophosphate, pyrethroid, and formamidine insecticides, the most notable difference was within organophosphate resistant strains, which produced 30% fewer eggs than the susceptible strain (Davey et al. 2006). The reproductive fi tness in the pyrethroid and formamidine resistant strains did not significantly affect oviposition period, egg output, incubation period, and viability. It was predicted that under real world conditions in the absence of acaricide selective press ure, th e proportion of organophosphate resistant ticks in a population would eventuall y decrease due to fitness costs (Davey et al. 2006). Host resistance is increasingly recognized as a control measure for cattle production systems allowing for a reduction in c hemical control. Kongsuwan et al. (2010) found that cattle skin thickness and certain lipids and proteins provided effective barriers that prevented parasitism by the cattle tick. Louly et al. (2010 ) looked at host resistance by evaluating R. sanguineus infestations on tick resistant beagles and tick susceptible cocker spaniels. The cocker spaniels had five times the number of ticks present. Hair samples of both dog breeds were evaluated with an olfactometer to determine if R. sanguineus demonstrated pr eference between them. The olfactometer ruled out behaviors exhibited by the dogs that may have influenced tick choice. Their results documented that R. sanguineu s most often selected the susceptible host. Findings from these studies supported the idea that the brown dog tick utilized host

PAGE 48

48 based chemical attractants and may be repelled by chemical signals generated by more resistant dog breeds (Louly et al. 2010 ). A study was conducted to evaluate possible host resistance development following brown dog tick feeding on previously tick exposed beagles. Inokuma et al. (1997) found that the number of brown dog ticks attached to dogs previously exposed to tick feeding was significantly lower than the number of ticks that attached to unexposed individuals. W hen ticks were attached, there was no difference between size, feeding patterns, or reproductive variables of engorged females that fed on hosts that had or had not been previously infested (Inokuma et al. 1997). Acaricide Resistance T esting In order to determine if brown dog tick populations are resistant to acaricides, as has been demonstrated in several arthropods, bioassays must be completed. Acaricides resistance has been evaluated using several methods. Stone and Haydock (1962) developed the larva l packet test method that has since been adapted by the Food and Agriculture Organization (FAO) This method places approximately 100 larval ticks and into acaricide treated filter paper packets and assesses mortality after 24 hours. In some instances, t he larval packet test may require modifications to allow for screening of compounds with unique attributes. Miller et al. (2002) modified the larval packet test by using nylon instead of filter paper as the substrate to evaluate R. microplus resistance to amitraz because results were inconsistent Larval tick acaricide resistance experiments also can be conducted using the larval immersion test. This method involves submergence of ticks into an acaricide solution for 10 minutes, placement into an untreate d containment area, and assessment of mortality after 24 hours (Shaw 1966). The larval immersion test has not been

PAGE 49

49 approved for standardized use by the F AO Drummond et al. (1973) developed the adult immersion test using the similar principles. The adul t immersion test, which has been approved by the F AO serves as an alternative for rapid resistance analysis when financial resources are not available for obtaining larvae. In order to evaluate the metabolic resistance mechanisms previously d iscussed, inc luding glutathione S transferase, cytochrome P450, and esterase activity enzyme inhibitory synergists can be added to larval packet test acaricide solut ions (Miller et al. 1999). As review ed by Scott (1990), glutathione S transferase can be inhibited by diethyl maleate. Cytochrome P450 activity inhibitors include piperonyl butoxide and Sesamex, and esterase activity can be inhibited by adding triphenyl phosphate or S, S, S t ributyl phosphorotrithioate (DEF ). Research Objectives One research study on R. sanguineus resistance at a single location has been published and it was not completed in the United States. After numerous reports of difficult to control brown dog tick infestations, it is clear an evaluation of resistance and resistance mechanisms shou ld be completed. It is suspected that control failures are a result of resistance after years of selection pressure. Research was conducted to characterize the resistance status of Florida brown dog tick populations, which can help redefine tick control treatment plans. Field collected tick populations were used to evaluate resistance levels and look for resistance mechanisms. Laboratory reared susceptible ticks were used for comparison and to set a discriminating concentration that can be used to rapid ly screen for resistance in new field collected populations. The specific objectives include:

PAGE 50

50 1. Determine p resence and level of Rhipicephalus sanguineus resistance to permeth rin and fipronil using the FAO larval packet t est. 2. Develop discriminating concentra tion for permethrin and fipronil resistance in brown dog ticks 3. Determination of metabolic and target site resistance mechanism in pyrethroid and fipronil resistant brown dog ticks.

PAGE 51

51 CHAPTER 2 DETERMINE PRESENCE AND LEVEL OF RHIPICEPHALUS SANGUINEUS (LAT REILLE) RESISTANCE TO PERMETHRIN AND FIPRONIL USING THE FAO LARVAL PACKET TEST. Introduction The brown dog tick, Rhipicephalus sanguineus (Latreille), is a canine ectoparasite that can be considered structural pest s due to its ability to infest homes, a h igh reproductive rate leading to large numbers of ticks, and the ability to complete its life cycle indoors (Demma et al. 2005, Dantas Torres et al. 2006) Brown dog ticks have three blood feeding life stages: larva, nymph, and adult. A fully engorged ad ult female may oviposit up to 4,000 eggs (Koch 1 982). Brown dog ticks spend 94 to 97% of their lifespan off the host Due to their small size and cryptic behavior, indoor infestations can be difficult to detect, allowing populations to rapidly increase ( Needham and Teel 1991). Generally, infestations are discovered when ticks are observed crawling up walls and curtains (Lord 2001 ). There are several chemical control methods used to prevent or eliminate brown dog tick populations from both homes and domes tic dogs Products containing amitraz, fipronil, and permethrin a ppear in the largest number of acaricide formulations uses in the prevention and treatment of tick infestations on do gs Various acaricide formulations used for indoor pest control and topi cal treatments for pets have been reported by homeowners and kennel operators as failing to prevent or control R. sanguineus infestations (P. Kaufman, unpubl. data) C urrently there is no published documentation of the resistance levels in the brown dog tick to permethrin and fipronil in Florida.

PAGE 52

52 Pyrethroids are a class of pesticide that includes several active ingredients used to control indoor pests Pyrethroids act by disrupting the function of the sodium channel (Narahashi 1986). Permethrin has been registered for use in topical treatments applied to dogs for over 20 years (EPA 1996). It is inexpensive, available over the counter, and thus likely the most commonly used product on the market. Me h lhorn et al. (2003 ) in g 10% imidacloprid and 50% permethrin, provided protection to dogs from Ixodes ticks for up to 28 days. Haemaphysalis longicornis Neumann, a dog tick found in Japan, demonstrated avoidance behavior by not walking onto treated filter paper when exposed to 10% imidacloprid and 50% permethrin (Hagimori et al. 2005) Fipronil in the phenylpyrazole chemical class, is the active ingredient in Frontline a topical ly applied product registered for tick control on companion animals in the United States since 1996 Fipronil acts on the GABA gated chloride channel and blocks the flow of chloride ions leading to neuroexcitation (Zhao et al. 2003). A year long study in Africa documented that fipronil treatment provided a 96% protection against transmission of E hrlic hia canis a bacteria vectored by R. sanguineus (Davoust et al. 2003 ). Burridge et al. (2004) concluded fipronil was the most effective acar icide for controlling R. sanguineus when compared to carbaryl, cyfluthrin, chlorpyrifos, permethrin, pyrethrins, am itraz, and selamectin. In part, due to its widespread heavy use for 30 years as a general purpose insecticide, many pests have demonstrated resistance to permethrin including Musca domestica L., Haematobia irritans (L.), Stomoxys calcitrans (L.), Anoph eles gambiae Giles, and Rhipicephalus microplus (Canestrini) (Scott and Georghiou 198 5, Mcdonald

PAGE 53

53 and Schmidt 1987, Cilek and Greene 1994, Chandre et al. 1999, Miller et al 2007 a ). More specifically, permethrin has been used extensively in indoor pest con trol for decades, thereby exposing brown dog tick popula tions to this active ingredient F ipronil resistance has been documented in several arthropod species including Blattella germanica (L.), M domestica Chilo suppressalis (Walker) and R. microplus (H olbrook et al. 2003, Kristensen et al. 2004, Li et al. 2007 Castro Janer et al. 2010 ). Miller et al. (2001) reported lim ited fipronil resistance in a population of R. sanguineus in Panama that had previously demonstrated resistance to permethrin as well as DDT, coumaphos, and amitraz. However, that particular population of R. sanguineus had had a minimal level of exposure to fipronil prior to the Miller et al. (2001) study. Both permethrin and fipronil have been used extensively against fleas, including on animal prophylactic monthly treatments, increasin g the probability of exposure of brown dog ticks. Resistance to permethrin and fipronil is suspected in Florida brown dog ticks due to reports from homeowners and pest control companies citing repeate d unsuccessful acaricide applications targeting in home and dog kennel tick populations Many factors can contribute to an apparent lack of acaricide efficacy, including i mproper acaricide application pest reinfestation, improper post treatment animal h andling such as washing animals with shampoo tick acaricide resistance, or a combination of factors. Miller et al. (2001) reported that acaricide resistance in their subject tick population increased the difficulty of controlling R. sanguineus infestatio ns. A project was initiated to determine the permethrin and fipronil resistance status of brown dog tick populations obtained from across Florida residential and dog kennel operations because resistance data were not available for the United States

PAGE 54

54 Mate rials and Methods Ticks Susceptible brown dog ticks Acaricide susceptible brown dog ticks were obtained from Ecto Services, INC (Henderson, NC). The susceptible tick colony was established in March 2008, with new ticks introduced annually to improve g enetic diversity. Ticks used in this study were obtained through four shipments between January 2012 and April 2012. Appendix A contains information on the susceptible colony collection history. Susceptible strain larvae used in evaluations were purchas ed as needed in shi pments containing between 1,000 to 2,000 ticks from the same female. These larvae were held for 14 to 16 days post eclosion and challenged with permethrin and fipronil to provide baseline data. Field collected brown dog ticks Brown do g ticks evaluated for permethrin and fipronil susceptibility were collected from 29 residential homes and t wo commercial dog kennels in Florida and Texas. Under certain circumstances, submitted tick strains were not evaluated for resistance. These includ ed a submission with insufficient numbers of engorged females, females that died prior to ovipositing or produced eggs that did not hatch or adults could not be reared. All tick sources were self identified clientele who contacted the University of Flori da veterinary entomology program. Following a consultation with program personnel, clientele appearing to have sufficient brown dog tick populations were asked to collect and submit ticks. On three occasions, personnel from our program collected ti cks an d on six occasions, a pest control operator submitted ticks The remaining 20 strains were mailed to the University of Florida by clientele. Ticks received included blood fed females, flat males and females and on one occasion, bloodfed nymphs. In

PAGE 55

55 each case, clientele reported difficulty in eliminating tick infestations with the standard treatment regimens recommended by pest control companies. Whenever possible, a pesticide use history for both the dog(s) and the home/facility was taken at the time of tick submission (Appendix A ). If sufficient numbers (n larvae from the eggs that hatched were tested in the bioassay described below. All non engorged females and same strain males were bloodfed on a rabbit host to obtain eggs from that tick strain (UF IACUC Protocol 200802142 201102142, Appendix B ) All eggs oviposited by engorged ticks collected from the same residence were placed together in one container and gently mixed using a watercolor paint brush in order to improve genetic diversity during te sting. Eggs were weighed into vials of either 250 mg or 500 mg aliquots. Once larvae had emerg ed, containers were held for 14 to 16 days in the incubator described below where after larvae were placed into the acaricide bioassay. Nomenclature of tick str ains dictates that the larvae tested were the F1 of the collected blood fed females. However, three tick strains were submitted with both blood fed and flat adults. In these instances, eggs were collected from the blood fed ticks and challenged, while th e flat adults were fed on the rabbit host to obtain additional egg s. Additionally, eggs were reared and larvae were challenged with acaricides. Nomenclature used to separate these two sub strains are F1 and F1a from larvae that eclosed from bloodfed adul t female eggs that were oviposited upon arrival from collection site and flat adults that were bloodfed in the laboratory, respectively. In a few

PAGE 56

56 instances, the F1 and F1a generations were reared through adulthood and subsequently laid eggs. These larvae are referred to as the F2 generation. Tick R earing Brown dog tick strains were held at 25 1C, with a photoperiod of 12:12 (L:D). Relatively humidity was maintained by either a saturated solution of potassium nitrate salt (ScienceLab Inc, Houston, TX) and distilled water placed in glass holding chambers that maintained 92% RH (Winston and Bates 1960) or ticks were held in a sealed chamber (Sanpia) with four 500 mL containers of distilled water that maintained 85% RH. Each active life stage was fed on N ew Zealand white rabbits to obtain a blood m eal ( Appendix B ). For more complete rearing information and tick feeding chamber construction see Appendix C. Bioassays The FAO larval packet t est (LPT) developed for acaricide testing of tick populations was used to screen tick strains for acaricide resistance. The LPT was first described by Stone and Haydock (1962). This method has been used to determine resistance status in R. sanguineus and several strains of R. microplus (Miller et al. 2001, Sabatini et al. 2001, Castro Janer et al. 2009). Technical grade permethrin (98.8%, cis trans 40.1:58.7) (ChemService Inc., West Che ster, PA) and fipronil (98.3%) (ChemService Inc., West Chester, PA) were used separately to conduct the LPT. Acaricides were dissol ved into a solution of two parts trichloroethylene (TCE) (Sigma Aldrich, St. Louis, MO) and one part olive oil (Spectrum, Gardena, CA). For fipronil solutions, 1 mL of acetone was substituted for TCE to aid in the dissolving process. For both solutions, the technical grade ac aricide was placed in the flask, TCE was added to en sure proper acaricide breakdown then olive oil added as the final step.

PAGE 57

57 The solution was vortexed to ensure even acaricide distribution. The chemical solution was serially diluted in to a TCE and olive oil mixture that included 6 to 10 treatment concentrations, depending on the number of ticks available, and a non acaricide treated control. Serial dilution concentration differences ranged from 30% to 60% for permethrin and 40% to 50 % for fipr onil, depending on the predicted resistance level. Each dilution was used to produce two to four replicates provided sufficient numbers (250 mg of eggs) of larval ticks were available for testin g. Given the treatment history, t he highest dose o f the serial dilutions tested on all newly acquired tick strains ranged from 5% to 30% for permethrin and 0.1 to 1% for fipronil Permethrin evaluations were given priority and if sufficient ticks were available, fipronil susceptibility was evaluated. Fil ter papers (Whatman N o. 1 Maidston e, England) were cut into 7.6 x 8.9 cm pieces and 1 mL of a test dilution was applied to a paper The solvent only control filter papers were treated with a 2:1 TCE and olive oil solution Following dilution applicatio n, acaricide t reated and control filter papers were suspended from an aluminum restaurant ticket order holding bar (Alegacy Santa Fe Springs, CA) under a fume hood in a constant airflow for 2 h ours to allow the TCE to evaporate, leaving the acaricide and olive oil on the filter paper (Fig. 2 1) After the drying period each filter paper was folded in half Thereafter, the filter paper sides were (Fig. 2 2) Approximately 100 larval ticks were placed in each packet using a water color paint brush T he open end of the packet was secured with a third bulldog clip. Once assembled, t he packets were suspended on a metal r od and held in a humidified incubator at 25 1C, 92% RH, with a photoperiod of 12:12 (L:D) for 24 h ours (Fig. 2

PAGE 58

58 3). The humidifying incubator consisted of a 38 liter glass aquarium that was sealed with weather strip ping and a glass cover. Relative humidity was maintained by a potassium saturated nitrate salt solution on the bottom of the aquarium (Winston and Bates 1960) Following a 24 h our incubation period packets were removed and mortality was assessed by cou nting the number of live and dead ticks in each packet (Fig. 2 4) Dead ticks were characterized by lack of movement after being disturbed and appeared flat and desiccated. Moribund t icks that were on their dorsum and demonstrated leg movement but were i ncapable of locomo tion also were categorized as dead. Tick behavioral changes occurred after exposure to permethrin that should be considered when scoring mortality L ive ticks exposed to high doses of permethrin tended to present themselves in a non mo bile state. Their appear ance was similar to an untreated tick in that they did not have the desiccated and flattene d look of the dead ticks. Permethrin treated ticks in the quiescent state r emained inactive until they were disturbed, sometimes by breathi ng on them, but typically by probing or physical disruption. During experiments with fipronil, live ticks exposed to high doses occasionally required human breath to induce activity, but they did not enter the quiesc ent stage like the permethrin exposed t icks. Occasionally, t here was tick mortality due to ticks being crushed under the bulldog clips during the packet sealing process. Ticks that were found dead in areas of the filter paper that were indented by the clips were not included in the overall co unt. Larval ticks that survived high doses of an acaricide were place in an empty vial and stored at 80 C for later polymerase chain reaction (PCR) testing.

PAGE 59

59 Statistics The acaricide susceptible strain was used to generate complete permethrin and fipron il concentration response curves for all tick strains. Bioassay data from replications within a tick strain were pooled and analyzed by standard Probit analysis and all hypotheses were tested by the likelihood ratio test (Savin et al. 1977). Probit analysis was conducted using PoloPlus (LeOra Software Company Petaluma, CA) (LeOra 1997) Mortality regression models were generated for permethrin and fipronil. Res istance ratios (RR), based on the susceptible laboratory strain, were determined using the LC 50 and LC 90 values (Robertson and Preisler 1992). Resistance ratios were calculated as: LC x of resistant strain / LC x of susceptible strain to determine the level of resistance for each field strain. Strain susceptibility to an acaricide was considered significantly different when there was no overlap between the 95% confidence interval of each field strain and the laboratory susceptible strain at an LC 50 or LC 90 value. Tick with resistance ratios >10 were classified as resistant (Mota Sanchez et al. 2008). Results In total, 29 residential units and two dog kennels submitted ti cks for testing. Of these tick submissions, seven were assessed for permethrin resistance (Table 2 1, Fig s 2 5 2 6, 2 7 ) and four were assessed for fipronil resistance (Table 2 2, Fig. 2 7 ). When an insufficient number of doses were tested for statisti cal analysis due to low tick numbers, survival data were presented only in Figures demonstrating percent survival without statis tical analysis. The Gilchrist and Webb, TX strain had t wo tick generations

PAGE 60

60 that were tested for perme thrin resistance, while th e Palm Beach 2 strain had two generation s tested for fipronil resistance. All strains tested demonstrated permethrin resistance, with most of the strains exhibiting such high resistance levels that the mortality data did not fit the statistical model req uirements for accurate LC value generation (Table 2 1). Of the strains where an accurate LC value could be determined, the Palm Beach 2 submission resulted in the highest LC 50 and LC 90 values of 0.775% and 5.86%. This can be compared to the acaricide sus ceptible ticks that had a LC 50 of 0.027%, and the LC 90 of 0.051%. These values resulted in a RR 50 of 29 at the LC 50 (Table 2 1) Accurate LC values could not be calculated for the St. Jo hns, Gilchrist F1, Gilchrist F2 Palm Beach 2 F1a, Duval, Broward, a nd Sarasota 2 strains due to high tick survival at the highest permethrin levels tested of 5% and 10% (Fig. 2 5). Although specific LC values were not calculable, 28% survival w as observed in the Gilchrist F2 strain when challenged with a 30% permethrin c oncentration, indicating that this strain was highly resistant (Fig. 2 6) Although still highly resistant, the lowest RR was found in the Webb, TX strain with a F1 generation RR 50 of 26 and a F2 generation RR 50 of 29 The Palm Beach 2 strain had the lar gest difference in RRs within F1 generation testing with the F1 presenting with a RR 50 of 29 while F1a resistance ratio was unable to be calculated due to high survival at high levels of permethrin, but is estimated to be >300 (Fig. 2 7) Brown dog tick su sceptibility to fipronil was evaluated in four strains and compared against the acaricide susceptible tick strain (Table 2 2, Fig. 2 8 ). In the Palm Beach 2 strain sufficient ticks were submitted to evaluate two groups within the F1 and generation. All strains tested expressed tolerance against fipronil exposure with

PAGE 61

61 resistance ratios at the LC 50 and LC 90 below 3.8. The St. Johns strain had the highest LC 50 at 0.088%. However, the highest LC 90 value was observed in the Palm Beach 2 F1 strain at 0.174%. The LC 50 and LC 90 values of the susceptible strain are significantly lower than the LC 50 and LC 90 values of the St. Johns and Palm Beach 2 F1 strains. T he St. Johns strain RR 50 was the highest at 3.52, while the Collier 1 strain had the lowest RR 50 of 1 .72. The RR 90 for the Collier 1 strain was nearly equivalent to both Gilchrist and Palm Beach 2 F1a strains. Overall, resistance ratios for fipronil were much lower than what was found for permethrin (Fig. 2 9). All fipronil tested strains were consider ed tolerant, while permethrin resistance was high. Discussion This study provides the first laboratory confirmed permethrin resistance and fipronil tolerance data for brown dog ticks from the United States. The only other documented report of acaricide resistance in R. sanguineus was to permethrin, DDT, and coumaphos at the Corozal Army Veterinary Quarantine Center in Panama (Miller et al. 2001). The Panama brown dog tick resistant strain had an estimated LC 50 of 4.2% active ingredient. With the strain s tested in the United States that provided statistically accurate responses, the Palm Beach 2 F1 and Webb, TX F1 and F2 demonstrated lower levels of resistance (0.7%) in comparison to the Panama strain. However, the remaining six strains and Palm Beach 2 F1a strain had much higher estimated LC 50 values that could not be conclusively determined, but ranged from >8.9% to well over 30% permethrin concentrations. Many of the comparative tick resistance studies have been completed on R. microplus, which is a member of the same genus as brown dog ticks. Because of pestiferous relationship with cattle, it has been exposed to several classes of acaricides. Permethrin resistant R. microplus have demonstrated

PAGE 62

62 levels of resistance so elevated that LC values are unable to be det ermined because of high survival at the highest dose evaluated (30% active ingredient) (Miller et al. 1999), similar to what was demonstrated in the Gilchrist strain (Fig. 2 6) If the St. Johns tick strain had successfully sur vived through to the F2 generation, low mortality was predicted at the 30% permethrin co ncentration due to the < 2% mortality observed at the 10% permethrin concentration (Fig. 2 5). F or comparison, the Gilchrist F2 strain expressed 15% mortality at the 10 % permethrin concentration and 28% mortality was observed at the 30% permethrin concentration (Fig. 2 6) Additional tick strains showed low mortality at 10% permethrin concentrations including, Duval at 35%, Broward at 28%, and Sarasota 2 at 50% (Fig. 2 5) The most likely explanation for permethrin resistance development in these tick strains is exposure at the site of the tick infestation. The Duval, Gilchrist, and Sarasota 2 strain reported the use of store purchased permethrin home habitat treatmen ts. The Gilchrist, Sarasota 2, and Broward strain reported the permethrin exposure history from veterinary prescribed topical tick control products. Timing of applications differed, wherein the Gilchrist and Sarasota 2 had been using on animal pyrethroid products inconsistentl y for at least five years. T he Broward and Duval infestations reported on animal permethrin use for less than one year. Therefore, the high permethrin resistance levels expressed in the Broward and Duval strains either developed ra pidly in the home or were already present in the tick population when the ticks were introduced to the home. Given the slow life cycle of the brown dog tick, high resistance expression development in a single year due to in home acaricide applications see ms the less likely cause.

PAGE 63

63 Burridge et al. (2004) concluded that fipronil was highly effective for brown dog tick control Miller et al. (2001) reported fipronil susceptibility in a Panamanian brown dog tick population that demonstrated DDT, permethrin, c oumaphos and amitraz resistance. The four tick strains tested in our study had fipronil exposure history through companion animal topical treatments. The fifth strain was collected from a kennel with unknown, but potential exposure history. At the time that the Miller et al. (2001) study was published, fipronil had been registered for less then five years. The cost for fipronil use was considerably higher than permethrin as well, so the likelihood of fipronil use was low. Accordingly, increased, but st ill limited fipronil use would be expected at the time of the Burridge et al. (2004) publication. Fipronil use on companion animals is no longer under patent protection and comparatively inexpensive formulations are available. Thus, as the product is use d more, the likelihood for resistance in brown dog ticks is expected to increase. In comparison to the permethrin resistance reported in the current study, fipronil RR 50 values were relatively low ranging from 1.72 to 3.52 (Fig. 2 9) The St. Johns strain which expressed the greatest permethrin resistance, also had the highest fipronil LC 50 value (0.088% AI) among ticks evaluated with both active ingredients. Interestingly, this tick strain, which originated at a dog kennel, reportedly received topical s pot on treatments containing permethrin and not fipronil (Appendix A ). However, this was based on the regimen of the kennel operators for long term animal boarding, but dog acaricide treatment history was not available for short term boarded animals. The Gilchrist strain originated from a home with 19 dogs and had an exceedingly large brown dog tick population, which demonstrated resistance levels to

PAGE 64

64 permethrin and tolerance to fipronil. The ticks from this location had a treatment history of both permet hrin and fipronil topical spot on treatments, however, the owners reported inconsistent use of these products (Appendix A ). Although no published reports of fipronil resistance exist for the brown dog tick, i n Uruguay, populations of R. microplus have demo nstrated fipronil resistance, with res istance ratios ranging from 3.3 to 3,635 (Castro Janer et al. 2010). The resistant tick populations had been treated with fipronil which had been used in this situation for agriculture purposes for 3 to 7 years. How ever, the highest resistance ratio was found in a population that received only seven treatments, while other strains with lower resistance ratios had received up to 18 treatments. C yclodienes including dieldrin were historically used in agricultural set tings. Th e authors suggest that the rapid resistance development with this strain may have originated from a dieldrin cross resistance mechanism already present in R. microplus Cross resis tance between cyclodienes and fipronil has been documented in B. germanica (Holbrook et al. 2003 ). B rown dog ticks are not likely to have recent or regular exposure to dieldrin or other cyclodienes, because they are not currently approved for use in homes or on companion animals. Chlordane has been used for indo or tic k control (Mallis 1954) which may increase the likelihood of cross resistance as a mechanism of fipronil resistance. Bloomquist and Robinson (1999) detected fipronil tolerance in chlordane resistant B. germanica. F ipr onil has been formulated for use as a spot on treatment on companion animals since 1996, which has allowed ample time for resistance development in situations where it has been used aggressively. Given that fipronil is now marketed as a generic

PAGE 65

65 product, it is expected that R. sanguineus pop ulations will receive considerably more fipronil exposure, thus accelerating resistance expression. Between the F1 and F1a tick cohorts that were tested, the Palm Beach 2 strain expressed increased permethrin and fipronil resistance levels. These ticks we re collected 10 days after the home had been treated with esfenvalerate, Onslaught (McLaughlin Gormley King Compa ny, Minneapolis, MN) (Appendix A ). In addition to the pyrethroid application to the home, the dogs had been treated with Frontline Plus (Mer ial, Duluth, GA), which contains fipronil, within the previous 30 days. The Palm Beach 2 F1 larvae came from owner collected engorged females, which were likely exposed to both of these chemicals. The Palm Beach 2 F1a strain consisted of larvae produced from flat male and female ticks obtained in the same shipment as the blood fed females and subsequently blood fed and mated under laboratory conditions without exposure to acaricides. A third group of ticks (F2) were reared from F1a larvae through to adul thood, mated, bloodfed and the F2 resultant larvae were tested in the LPT. This process required one year to complete. It is unclear why the F1a and F2 generation had differential survival as compared to the F1 ticks when collection was from the same pop ulation, and no acaricide exposure or selection had occurred (Table 2 1, Appendix A ). Three populations of permethrin resistant cattle ticks found in Mexico demonstrated varying levels of resistance ranging from resistance ratios of 166 in one strain to gr eater than 1,000 fold in two other strains (Miller et al. 1999). High levels of variation in permethrin resistance were found within the different populations of R. sanguineus that were tested in the current study. The R. microplus strain with 166 fold

PAGE 66

66 r esistance was determined to have increased esterase and cytochrome P450 activity, leading to metabolic detoxification. The two strains with higher levels of resistance did not show any indication of metabolic resistance, and were later determined to have sodium channel point mutations (Miller et al. 1999, Guerrero et al. 2001). Based on those results, it is suspected that various mechanisms of permethrin resistance in R. sanguineus are present. Field collected permethrin resistant R. microplus from an in festation in the United States had a resistance ratio of 9.5 and following two generations of selection at 5.9% and 9.7% permethrin concentrations, the resistance ratio had increased to 263 (Miller et al. 2007a). This population was determined to have a t arget site mutation on the sodium channel and the gene frequency in the population increased after the high concentration selection (Miller et al. 2007a). Although permethrin resistant, this tick population was susceptible to coumaphos and amitraz and the tick was eliminated from the cattle ranch. Such an occurrence highlights the diversity of information that needs to be gathered in R. sanguineus by characterizing resistance and its resistance mechanisms. Some resistant brown dog tick strains had no hi story of exposure to acaricides from the collection site, indicating resistance must have evolved in the tick po pulations prior to their appearance in the home Brown dog ticks hav e an average of two to four generations per year in the field (Dantas Torre s 2008 ) T herefore resistant tick populations have been selected for through years of ongoing acaricide exposure. Georghiou and Taylor (1986) determined it typically requires 10 to 15 generations to select for resistance. Therefore, depending on field c onditions, brown dog ticks under selection pressure may develop resistance between 2.5 to 7.5 years.

PAGE 67

67 In ~ 1978 a survey was conducted in 958 Indiana homes to determine the frequency of pesticide use (Bennett et al. 1983). Of these homes 77% used pesticide s, 17% of which were pyrethroids, the most frequently used chemical class Historically chlorpyrif os (Dursban ) and pyrethroid s were heavily used for indoor control of cockroaches and ants (St. Aubin 1990). Since the Food Quality and Protection Act in 1996 (EPA 2013), the use of chlorpyrif os became restricted for indoor pest control and pesticide use has shifted toward pyrethroid applications (Goddard 2011) Pyreth roid resistant arthropods have been found to demonstra te cross resistance to several pyrethroids after being u nder selection pressure with a single pyrethroid A study evaluated 20 residences in Boston public housing facilities for pesticide presence using a 24 hour air sample and three wipe samples from ea ch home. Permethrin was detected in 38% and cypermethrin in 24% of the wipe samples. Of the 20 indoor air samples the pyrethroids tefluthrin and cyhalothrin were found in the greatest concentrations (Lu et al. 2013). In another study, r esidual permeth rin levels were found in 88% of 448 homes, and fipronil in 40% of 478 homes ( Stout et al. 2009). Brown dog tick populations that are newly i ntroduced to residential areas may be subjected to sublethal acaricide exposure prior to tick treatment protocol im plementation. Sublethal exposure may lead to the induction of metabolic mechanisms that can confer resistance. The exposure of DDT and cyclodienes leads to increased cytochrome P450 activity (Yu 2008), which has been found to confer resistance to pyrethr oids in R. microplus (Miller 2001 ).

PAGE 68

68 Acaricide exposure differences that result in differential selection pressure among tick strains is the most likely reason for the varied permethrin resistance levels observed in this study. However, resistance develo pment in arthropods, particularly to permethrin, has been conferred through a variety of resistance mechanisms. Additionally, as these ticks have limited non host dispersal capabilities, the likelihood of a unified mechanism shared across intermingling su b populations is unlikely. Cuticular penetration, increased metabolic activity leading to acaricide detoxification, and target site mutations all have been documented as different forms of resistance (Scott 1990). Additionally, permethrin is a repellent, therefore in field conditions ticks may avoid contact surfaces that have been treated ( Bissinger and Roe 2010). Forms of metabolic detoxification include increases in the production of cytochrome P450, esterase, and glutathione S transferase. Cytochrome P450 and esterase metabolic deto xification through the use of synergist s that blocks metabolic activity were evaluated in permethrin resistant R. sanguineus in Panama (Miller et al. 2001). In this instance, increased esterase activity was found to confer permethrin resistance in these ticks. To date, there has been no published research documenting metabolic resistance to fipronil in ticks, however, an examination of other arthropods provides insight as to possible resistance mechanisms. Although fiproni l is acaricidal in its parent form, cytochrome P450 has been found to metabolize fipronil into fipronil sulfone (Durham et al. 2002). The metabolite generated greater toxicity when compared to fipronil, making this metabolic route unlikely to produce resi stance (Zhao et al. 2005). Alternatively, increased esterase activity has been suggested to confer fipronil resistance in Chilo suppressalis (Walker) and Sogatella fucifera Horvath (Li et al. 2007,

PAGE 69

69 Tang et al. 2010). Although a mode of action was not sug gested, synergist use may increase pesticide penetration or molecule sequestration (Scott 1990, Suderland and Bloomquist 1990). The active target site of permethrin is on the neuron at the voltage sensitive sodium channel (Soderlund and Bloomquist 1989). No publications exist on the expression of a target site mutation for permethrin resistance in R. sanguine us However, three target site or point mutations that result in amino acid changes and thus permethrin binding site alterations are believed to co nfer permethrin resistance in R. microplus (He et al. 1999c, Morgan et al. 2009, Jonsson et al. 2010). Resistance due to point mutations also has been documented in numerous arthropods including Heliothis virescens (Fabricius) Blattella germanica (L.) a nd Aedes aegypti (L.) (Park and Taylor 1997, Dong 1997, Brengues et al. 2003). One or more point mutations could be present in permethrin resistant strains of R. sanguineus. The target site of fipronil is located on the gamma aminobutyric acid (GABA) ga ted chloride channel (Zhao et al. 2003). Point mutations that confer fipronil resistance have not been documented in any tick species. However, fipronil resistant Drosophila simulans Sturtevant and S. fucifera have been documented to have point mutations on the Rdl (resistance to dieldrin) GABA receptor in the chloride channel that are believed to be linked to resistance (Le Goff et al. 2005, Nakao et al. 2010). Due to limitations in available tick numbers, high dose laboratory selection for fipronil re sistance was unable to be completed. In future studies, laboratory dose selection of resistant ticks could help determine how quickly resistance can be selected for in a population. It also would be of value to understand how resistance develops

PAGE 70

70 with lab oratory selection as one could determine how quickly and to what levels resistance is expressed. While under fipronil selection, if tick strains develop onl y tolerance (resistance ratio < 10), but no t resistance (resistance ratios > 10), current products on the market that exceed tolerance concentrations should remain effective. Davey and George (1998) selected for permethrin resistance over five generations in a strain of R. microplus Resistance ratios increased from 5.4 fold to 20.9 fold the susceptible strain. Ticks from the resistance selected strain and the susceptible strain were placed on cattle and dipped in 0.057% AI permethrin, as recommended by the label. The susceptible tick has 99.2% mortality, however, the laboratory selected ticks had only 35.7% mortality (Davey and George 1998). If the acaricide dip in the previous study were to have been used at the labeled rate (0.057%) on dogs for R. sanguineus control, few ticks from the current study would succumb to the animal applied permethrin exp osure. There are few products sold for brown dog tick control with alternative active ingredients because, in addition to being effective for tick control, they must be veterinary approved for use on mammals. The currently approved active ingredients for tick control on dogs include permethrin, fipronil, amitraz, and flumethrin, which has been formulated for use in tick collars. The widespread permethrin and increasing fipronil resistance documented in this study narrows the product selection available fo r some tick populations. The high level of permethrin resistance detected herein may be due to permethrins ubiquity in commercially available products and that such high levels were observed may reflect in cross resistance to flumethrin, another pyrethroi d. Pyrethroid effectiveness may vary between insects and ticks due to variation in the binding site

PAGE 71

71 between ticks and insects was found at the pyrethroid binding site in the sodium channel using 3D model ing. Understanding variations in binding sites can aid in the production of more specific acaricides Although it is unclear how resistance develops in many populations, behaviors such as not following proper treatment schedules or using improper concent rations, as well as the lack of acaricide alternatives that lead to repeated acaricide use further pressures resistance selection in arthropod populations. Contributing factors may include off label pesticide applications when control is not achieved at a pproved doses. Such an a pproach invariably creates high dose selection pressure. In the case of on animal applications, oftentimes the products are delivered at low rates or washed from the pets resulting in low dose exposure and a failure to control tic ks leaving an end user who believes that resistance is occurring. Additionally, even well intentioned pet owners attempting to change acaricides may purchase different product brands not realizing that they are using the same active ingredient, thereby co ntributing to resistance selection. Many of the crack and crevice applications utilize pyrethroid based products with the same mode of action as the on animal permethrin based products, further exposing tick populations to increased selection pressure. F inally, many of the on animal products are under patent protections or are available only through veterinary clinics and cost many fold more than over the counter permethrin formulations, making consumer choice often based on economics, not best management practices. Through the recent availability of generic fipronil containing products, this bottlenec k may be opening. The extent of fipronil resistance is uncertain at this point.

PAGE 72

72 Heavy exposure to pyrethroids for many years in the home and through the us e of on animal products may have lead to the high levels of resistance presented in this study. In comparison, the labels of fipronil based products have not been used as long and no indoor applications are approved, which could explain the lack of resist ance, and only tolerance demonstrated in R. sanguineus. Cross resistance in resistant and tolerant strains also may be a result of previous selection pressure to DDT for sodium channel mutations and to chlordane for GABA gated chloride channel mutations. The knowledge of R. sanguineus resistance is important to help guide pest control operator best management practices, as they treat homes with brown dog tick infestations. If infestations are not responding to acaricide applications, resistance may be p resent and treatment protocols should be adjusted. Education of veterinarians is critical, in that veterinarians provide tick control plans for companion animals. It is quite common for veterinarians to preemptively place client dogs on tick preventative s without documentation of tick presence or even potential exposure. Such prophylactic treatment approaches violate the principle of integrated pest management, where one does not treat without the pest being present or historical evidence of reinfestatio n R esidential areas and facilities that house high numbers of dogs can be subject to repeated ineffective chemical control applications if resistant tick populations are present In addition to the cost of professional treatments, there is increased un necessary acaricide exposure, wasted resources, stress to the people surrounded by the infestation, stress and blood loss for the animal being exposed to ticks, increased risk of vector borne disease for humans and animals, and continued selection for resi stant tick populations. To prevent further resistance selection and effectively control

PAGE 73

73 resistant populations, different classes of acaricides should be used and rotated during treatment plans and dogs should only be treated when ticks are observed on ani mals or in the home.

PAGE 74

74 Table 2 1. Toxicity of permethrin to brown dog tick, Rhipicephalus sanguineus (Latreille) populations collected from residential homes and dog kennels in Florida and Texas as determined using the Food and Agriculture Organization larval packet test. Tick strain n a (r eplicates) LC 50 (95% CI) b LC 90 (95% CI) b RR 50 c,d RR 90 c,d Slope (SEM) 2 (df) Susceptible 5,240 (40) 0.027 (0.026 0.028) 0.051 (0.048 0.054) 4.64 (0.15) 55.4 (34) Broward g 1,945 (28) ND ND >600 >1,000 Duval g 1 ,442 (36) ND ND >5,000 >300,000 Gilchrist F1 f 2,209 (32) ND ND Gilchrist F2 4,302 (42) ND ND >2,000 >11,000 Palm Beach 2 F1 1,245 (24) 0.775 (0.646 0.929) 5.86 0 (4.384 8.451) 29 115 1.46 (0.08 ) 32.9 (22) Palm Beach 2 F1a 2,505 (32) ND ND >300 > 1,000 Sarasota 1 g 2,419 (24) ND ND >500 >900 St. Johns 1,760 (36) ND e ND Webb, TX F1 1,913 (21) 0.703 (0.569 0.843) 2.71 (2.190 3.567) 26 53 2.19 (0.11 ) 49.5 (16) Webb, TX F2 3,221 (36) 0.781 (0.721 0.845) 2.68 0 (2.38703.054) 29 53 2.39 (0.82) 40.6 (30) a n is defined as the total number of ticks used in the experimental run and replicates represents total number of packets b Values represent percentage of active ingredient (w/v) applied to tre ated filter papers 7.5 x 8.5 cm c Tick strains were c onsidered statistically different when the LC 95% confidence intervals (CI) from the field collected strains did not overlap with th e laboratory susceptible strain d Resistance ratios at LC 50 and LC 90 were calculated by dividing the respective LC 50 and LC 90 of each field strain by that of the susceptible strain ( Ecto Services, Inc.) e ND: Lethal concentration co uld not be determined due to <64% m ortality at high concentrations f Low mortality at all concentrations beginning at 5% A.I. No effect d etermined by chemical treatment g Low mortality at 10% active ingredient. Unable to obtain specific leve ls, but resistance demonstrated

PAGE 75

75 Table 2 2. Toxicity of fipronil to brown dog tick, Rhipicephalus sanguineus (Latreille) populations collected from residential hom es and dog kennels in Florida and Texas as determined using the Food and Agriculture Organization larval packet test. Tick strain n a (r eplicates) LC 50 (95% CI) b LC 90 (95% CI) b RR 50 c d RR 90 c d Slope (SEM) 2 (df) Susceptible 3,643 (27) 0.025 (0.024 0.026) 0 .046 (0.043 0.049) 4.84 (0.11 ) 63.6 (25) St. Johns 3,196 (36) 0.088 (0.084 0.091) 0.120 (0.114 0.126) 3.52 2.6 1 9.39 (0.47 ) 12.0 (30) Gilchrist F 1 e 2,408 (24) 0.054 (0.047 0.063) 0.124 (0.103 0.158) 2.16 2. 70 3.56 (0.13 ) 159 (22) Palm Beach 2 F 1 1,0 45 (18) 0.047 (0.028 0.076) 0.174 (0.102 0.471) 1.88 3.78 2.25 (0.12 ) 168 (14) Palm Beach 2 F1 a 2,346 (32) 0.062 (0.054 0.072) 0.151 (0.123 0.196) 2.48 3.28 3.30 (0.13 ) 118 (26) Palm Beach 2 F2 2,821 (32) 0.061 (0.054 0.070) 0.123 (0.105 0.154) 2.44 2.67 4.23 (0.16 ) 190 (26) Collier 1 828 (18) 0.043 (0.031 0.059) 0.124 (0.088 0.221) 1.72 2. 70 2.80 (0.18) 61.1 (14) a n is defined as the total number of ticks used per experiment and replicates represent the number of packets b Values represent percentage of active ingredient (w/v) applied to tre ated filter papers 7.5 x 8.5 cm c Resistant ratios were considered statistically different when the LC 95% confidence intervals (CI) from the field collected strains did not overlap with the susceptible strain d Resis tance ratios at LC 50 and LC 90 were calculated by dividing the LC 50 and LC 90 of the field strain divided by the susceptible strain (Ecto Services INC .)

PAGE 76

76 Figure 2 1. Left side: A) Drying device for acaricide treated filter papers. Designed to allow fo r airflow while preventing the filter papers from contacting each other. Right side: B) Larval packet suspension device, used to hold packets before transfer on the suspension rods to the humidifying incubator for the 24 hour holding period. Photo court esy of Amanda L. Eiden

PAGE 77

77 Figure 2 2. Apparatus and procedures used in resistance profiling of permethrin and fipronil to field collected strains of Rhipicephalus sanguineus (Latreille), using the larval packet test. A) After filter papers were treated with varying concentrations of acaricide, dried for two hours and approximately 100 larval ticks were placed within the filter paper. B) The packet was sealed using bulldog clips. C) Filter papers were suspended for 24 hours Photo courtesy of Amanda L. Eiden.

PAGE 78

78 Figure 2 3. Humidifying incubator for larval packet test. The temperature of 25 1 C maintained the relative humidity at 92% using a potassium nitrate saturated salt solution. Larval packets containing ticks were suspended in the chamber usi ng steel rods. The top of the glass holding chamber was coated with petroleum jelly to prevent tick escape in the event that a tick crawled out of improperly sealed packets. Photo courtesy of Amanda L. Eiden.

PAGE 79

79 Figure 2 4. After packets were suspended in a humidifying incubator for 24 hours, larval Rhipicephalus sanguineus (Latreille) mortality was assessed. Photo courtesy of Amanda L. Eiden.

PAGE 80

80 Figure 2 5. Mean percentage survival of Rhipicephalus sanguineus (Latreille) field collected strains ex posed to four permethrin concentrations using the Food and Agriculture Organization larval packet test and the susceptible tick strain from Ecto Services, Inc, NC. Due to high mortality, susceptible tick mortality was measured only at lower the relatively concentrations of 1% and 0.15%. 10 5 1.25 0.15 0 10 20 30 40 50 60 70 80 90 100 % Survival Strain

PAGE 81

81 Figure 2 6. Percent survival for the Gilchrist F2 strain of Rhipicephalus sanguineus (Latreille), when challenged again different concentrations of permethrin using the Food and Agriculture Organization larval packet t est. 0 10 20 30 40 50 60 70 80 90 100 Control 1.1 1.6 2.4 3.4 4.9 7.0 10.0 15.0 30.0 % Survival % Concentration Gilchrist F2

PAGE 82

82 Figure 2 7. The percent survival of Rhipicephalus sanguineus (Latreille) at various permethrin concentrations in the Palm Beach 2 strain between generations. Acaricide testing was conducted using the Food and Agriculture Organization larval pa cket test. Higher levels of survival were demonstrated in the F2 generation. 0 10 20 30 40 50 60 70 80 90 100 % Survival % Concentration Palm Beach 2 F1 Palm Beach 2 F2

PAGE 83

83 Figure 2 8 Mean percentage survival of Rhipicephalus sanguineus (Latreille) field collected strains exposed to four fipronil concentrations using the Food and Agriculture O rganization larval packet test and the susceptible tick strain from Ecto Services, Inc, NC. 0.125 0.063 0.016 0.008 0 10 20 30 40 50 60 70 80 90 100 % Survival Strain

PAGE 84

84 Figur e 2 9 Comparison of permethrin and fipronil resistance ratios in different field collected strains of Rhipicephalus sanguineus (Latreille) from data colle cted using the Food and Agriculture Organization larval packet test. Resistance ratios were calculated using Probit analysis. 0 20 40 60 80 100 120 Resistance Ratio Strain Permethrin Fipronil RR50 RR90

PAGE 85

85 CHAPTER 3 DISCRIMINATING CONCE NTRATION DEVELOPMENT FOR PERMETHRIN AND FIPRONIL RESISTANCE IN BROWN DOG TICKS Introduction R e sistance to permethrin and fipronil is present at varied levels in different populations of brown dog ticks, Rhipicephalus sanguineus (Latreille) in Florida and Texas (Chapter 2) Prior to this work, published resistance data for R. sanguineus in the Unit resistance status can be determined using a diagnostic dose or concentration, depending upon the pesticide application technique used. Roush and Tabashnik (1990) described a di scriminating concentration as a single concentration of pesticide that will kill a large portion of the susceptible genotypes, while the resistant genotypes remain alive. It is used as a simple yes or no resistance detection assay. Discriminating concen tration methods have been used to rapidly determine the resistance status of several arthropods such as Tribolium castaneum (Herbst) Rhyzopertha dominica (F.), Heli coverpa armigers (Hbner), Musca domestica L. Rhipicephalus ( Boophilus ) microplus (Canestr ini) (Zettler and Cuperusi 1990, Forresters et al. 1993, Sabatini et al. 2001, Kaufman et al. 2001, Castro Janer et al. 2009). Sabatini et al. (2001) used the larval packet test with R. microplus to develop a discriminating concentration for the macrocycl ic lactone, cydectin. In their study, they determined the LC 99 using a Probit analysis calculation for an acaricide susceptible tick strain and the discriminating concentration was set at 2x LC 99 The use of discriminating concentrations can help predic t the effectiveness of currently sold tick control products. Permethrin and fipronil have been formulated into

PAGE 86

86 many different products and sold for R. sanguineus control. Commercially available products currently sold for use on dogs that contain permeth rin include, but are not limited to, the topical animal spot on treatments, K9 Advantix II ( Bayer Healthcare LLC, Animal Health Division Shawnee Mission, KS ) acti ve ingredient (AI) permethrin 44 % imidacloprid 8.8 % pyriproxyfen 0.44% and Vectra 3D ( Cev a Animal Health LLC Lenexa, KS ) AI dinotefuran 4 to 8%, pyriproxyfen 2 to 5 %, p ermethrin 35 to 45 % depending on size of the dog. Although many permethrin based product formulations are used for indoor residential application including Tengard (United P hosphorus, Inc., SFR (Control Solutions Incorporated, Pasadena, TX), which contain 36.8% permethrin, the end use labeled rate is often quite similar among products and typically is near 0.5% AI. These products are designed for professional use but may be purchased online. Shampoos for tick control include Sentry Pro Flea & Tick Shampoo (Sentry Pet Care Products, Inc., Omaha, NE), AI permethrin 0.10% piperonyl butoxide 0.50%, pyriproxyfen 0.01% In addition to permethrin containing products, several other pyrethroid class acaricides are sold, including products containing fenvalerate, lambda cyhalothrin and bifenthrin. Many of these formulations include the synergist piperonyl butoxide. Products currently re gistered for use on dogs that contain fipronil include, but are not limited to, topical treatments for companion animals such as Frontline ( Merial, Duluth, GA ) AI fipronil 9.8% and PetArmor (Fidopharm, Yardley, PA) AI fipronil 9.7%. On animal sprays sol d for tick control include Frontline Spray Treatment for Pets, AI fipronil 0.29% and Sentry FirpoGuard Flea & Tick Spray for Dogs & Cats, AI fipronil

PAGE 87

87 0.29%. Termidor Foam for indoor void treatments (BASF, St. Louis, MO), AI fipronil 9.1% is sold, but is not labeled for tick control. The development of a discriminating concentration allow s for a much simpler method to screen tick population samples from residential and kennel facilities with a single chemical concentration to determine if they are susce ptible or resistant. Additionally, if residents can supply several engorged female ticks, an evaluation of resistance could be conducted without the need to rear ticks. A discriminating concentration forms the basis for a n inexpensive and rapid resistanc e diagnostic technique that can be used to guide tick management plans for animal and environmental treatments In the currently study, t he discriminating concentration for brown dog ticks has been established for permethrin and fipronil and its appropria teness and suitability was evaluated with field collected brown dog ticks. Materials and Methods Ticks Susceptible brown dog ticks Ecto Services, INC (Henderson, NC) provided acaricide susceptible brown dog ticks from a colony that was established in Mar ch 2008. Appendix A contains detailed information on the susceptible colony collection history. Between January 2012 and April 2012 four shipments of tick eggs were received for testing and held in an incubator until hatching as described below. After h atching, larvae were challenged with permethrin and fipronil 14 to 16 days post eclosion to develop the LC 99 values later used to establish the respective discriminating concentrations.

PAGE 88

88 Field collected brown dog ticks Potentially resistant brown dog tick s used in these studies originated from pest control operators who encountered heavy infestations in residential homes, from residents who were struggling to control tick infestations in their homes, or by dog kennels operators. In total, ticks were recei ved from two commercial dog kennels in Florida an d Texas and 29 residential units in Florida. Table 3 1 contains a summary of permethrin and fipronil exposure, while Appendix A contains a more detailed acaricide exposure history. If feasible, an intervie w was conducted with the resident or kennel operator to gather acaricide use history for the submitted tick samples. Ticks received from each location were held separately and labeled as an individual strain based on the county of collection and the order in which they were received from that county. Larvae were tested from field collected engorged females when eggs from five or more ticks successfully hatched. Flat male and female ticks were laboratory reared as described below to sustain the colony and obtain larvae for bioassays. To maintain genetic diversity eggs from all ovipositing females within the same strain were mixed and divided for experimental use or rearing. Tick R earing New Zealand white rabbits were used as blood feeding hosts for all t ick life stages (UF IACUC Protocol 200802142 201102142 Appendix B) When off the host, brown dog tick strains were held at 25 1C, 92% RH, with a photoperiod of 12:12 (L:D). Detailed information regarding rearing and equipment construction are presen ted in Appendix C. Tick colonies that had different genertations that were tested are labeled as F1 for the first generation and F2 for the second generation that was reared in the laboratory.

PAGE 89

89 Bioassay Detailed methods for bioassays were described in deta il in Chapter 2 but briefly, permethrin and fipronil dose response curve s were generated for the acaricide susceptible brown dog tick s train using the Food and Agriculture Organization Larval Packet Test (LPT) (FAO 2004). In this test technical grade per methrin (98.8%, cis trans 40.1:58.7) (ChemService I nc ., West Chester, PA) or fipronil (93.8%) (ChemService I nc., West Chester, PA) was dissolved in a solution (w/v) composed of two parts trichloroethylene (TCE) (Sigma Aldrich, St. Louis, MO) to one part olive oil (Spectrum, Gardena, CA) The chemical mixture was serially diluted and filter papers (7. 5 x 8.5 cm) (Whatman N o. 1 Maidstone, England) were treated with 1 mL of solution then dried for two hours under a fume hood leaving the acaricide and oliv e oil on the filter paper. Control filter papers were treated with only TCE and olive oil at the same ratio. The highest concentrations were chosen to exceed the expected discriminating concentration based on levels that were established in R. microplus ( Miller, unpublished data, Miller et al. 2007b, Castro Janer et al. 2009). Susceptible ticks were initially evaluated using a range of permethrin and fipronil concentrations between 0.010 and 1% each of which was serially diluted with a concentration redu ction of 40% across 10 concentration s The filter paper s treated with only TCE and olive oil served as the untreated control. Three or four packets were treated at each concentration with approximate ly 100 tick larvae exposed per packet. Based on the re sults of the first experiment, the highest concentration was decreased from 1% to 0.36% for permethrin and 1% to 0.12% for fipronil in the second experiment. Herein, acaricides were serially diluted at 40% until 10 concentration s were generated The fina l two experiments were

PAGE 90

90 conducted with the same top concentration, but were serially diluted by 30% to refine tick response results. After the drying period, approximately 100 larval ticks that were 14 to 16 days post eclosion were placed in each filter pap er packet. Packets were constructed by folding the filter paper in half and clipping the sides together with Boston Number 2 2). After the ticks were placed in the packet, the open end was secured w ith a third bulldog clip. Assembled packets were held for 24 hours in a humidifying chamber at 25 1C, 92% RH, with a photoperiod of 12:12 (L:D) (Chapter 2, Fig. 2 3). Mortality was assessed after the 24 hour holding period. Ticks were counted and the numbers of live and dead ticks were recorded (Chapter 2, Fig. 2 4). Ticks were categorized as dead if they did not respond with a probe or to CO 2 from human breath. Moribund ticks that were unable to walk but demonstrated leg movement were categorized a s dead. Testing of t he dilution series was repeated on four occasions, each time representing another rep licate Four LPT s were conducted on different days due to eq uipment and space constraints. Each LPT served as a replicate, with newly mixed stock an d dilution solutions. Through these evaluations, the LC 99 of the pooled data was obtained. This value was the basis for generating the discriminating concentration, which was set at two fold the LC 99 of the acaricide susceptible tick strain. Resistance E valuation Field collected ticks were exposed separately using the aforementioned LPT procedures, to four concentration s of permethrin and fipronil i n order to screen for resistance. These concentration s were selected based upon both tick responses to ser ially diluted acaricides identified in Chapter 2 and pooled results from the susceptible

PAGE 91

91 tick strain experiments described above. Concentrations evaluated against field collected ticks were 1 5 16 and 53 times th e 2x LC 99 value. Provided the increas ed tick susceptibility to fipronil, two lower concentration screening values (LC 90 and LC 99 ) and two diagnostic concentrations (2x LC 99 and 4x LC 99 ) were used to evaluate responses of field collected ticks. These concentrations were based on survival data obtained in Chapter 2. The number of replicates and ticks per packet varied based upon the number of ticks obtained from field collections. Between two and four replicates for each concentration were completed, with between 30 and 100 ticks per packet. With the exception of one experiment, where 295 ticks were tested at three concentrations, no fewer than 500 larval ticks were used in any given experiment, with a maximum of 1,600 used for a full evaluation. Mortality was assessed at 24 hours using para meters described previously. Data A nalysis The LPT test data for the susceptible tick bioassays were entered into the PoloPlus (LeOra Software, Petaluma, CA) statistical software program for Logit analysis of permethrin LPT data and Probit analysis of fi pronil data (LeOra 1997) Different analyses (Probit or L ogit) were required in order to fit the models properly, as Probit and Logit provide with similar but not identical probability curves. Cont rol (Abbott 1925). Data were considered significant if the t ratio >1.96. The LC 50 LC 90, and LC 99 were obtained from the program output. The discriminating concentration was established as the 2x LC 99 value of the pooled acaricide susceptible tick strain response. Thereafter, all field strains were subject to the 2x LC 99 discriminating concentration for initial evaluation

PAGE 92

92 (Sabatini et al. 2001), with additional concentrations included as feasible to improve clarity in tick responses. Data were recorded a s percentage survival at each multiplier of the discriminating concentration. Results Discriminating Concentration To establish the LC 99 values for the permethrin bioassay, a total of 16,485 susceptible strain ticks 155 replicates, were tested while an ad ditional 17,085 ticks 138 replicates, were used in the fipronil bioassay. The permethrin LC 50 and LC 99 values for the pooled data of the acaricide susceptible strain were 0.027% and 0.083%, respectively (Table 3 2). Therefore, the calculated discriminat ing concentration (2x LC 99 ) was 0.19% using the pooled data from the four evaluations. The fipronil LC 50, LC 90 and LC 99 values for the acaricide susceptible strain were 0.023%, 0.044%, and 0.074%, respectively (Table 3 3). Using 2x LC 99 from the pooled s usceptible experiments, the discriminating concentration was set at 0.15%. Permethrin D iscriminating C oncentration E xperiments Brown dog ticks from 30 Florida locations and one Texas kennel were received Seven of the Florida strains that were obtained fr om five FL counties provided sufficient numbers of larvae to allow for permethrin resistance evaluation (Gilchrist F2 Palm Beach 2 F2 Palm Beach 3, Collier 2, Sarasota 1, Sarasota 2, and Broward) using the permethrin discriminating concentration evaluati on. The Gilchrist, Palm Beach 2, Sarasota 2, and Broward strains also were evaluated in Chapter 2. Newly acquired tick strains were screened for mortality with permethrin concentrations of 0.18, 0.9, 3 and 10%, that were representative of the 1x, 5x, 16x, and 53 x the diagnostic concentrations. All tick strains tested with permeth rin resulted in

PAGE 93

93 >89% survival at the discriminating concentration (Fig. 3 1). At the 5x discriminating concentration, survival ranged from 79 to >99%. Six of the seven tick stra ins were tested at the 53x discriminating concentration, and only the Palm Beach 3 strain had no survival. The Sarasota 1 tick strain was not tested at the 53x discriminating concentration due to a limited number of tick s Survival among the remaining ti ck strains ranged from 19% in the Collier 2 strain to 66% in the Broward strain. Fipronil Discriminating Concentration E xperiments Six tick strains from five Florida counties ( Gilchrist F2 Collier 2, Sarasota 1, Sarasota 2 Palm Beach 3, and Broward) were evaluated for fipronil resistance using the discriminating concentration evaluation. Among th ese strains, only the Gilchrist strain was evaluated in Chapter 2. Tested strains were selected based upon the availability of sufficient numbers of larval tick s. Based on results from the acaricide susceptible strain, the fipronil diagnostic concentration was set at 0.15%. However, the fipronil concentrations evaluated included two concentrations that were lower than the 1x discriminating concentration for fipr onil because preliminary screening of field strains indicated 100% mortality a 0.3% active ingredient (2x discriminating concentration). Therefore, the concentrations used were 0.04, 0.07, 0.15, and 0.30, which were representative of the LC 90 LC 99 2x LC 99 (1x discriminating concentration), and 4x LC 99 (2x discriminating concentration). In the susceptible strain, 15% survival was observed at the LC 90 of 0.04% (Fig 3 2). Survival in the field acquired strains ranged from 65 to 99% at this lowest concentr ation. At the diagnostic concentration there was no survival in the acaricide susceptible strain, but survival ranged from 0% in the Sarasota 2 strain to >95% in the Palm Beach 3 strain. Survival following fipronil exposure dropped considerably

PAGE 94

94 between t he 1 x and 2 x discriminating concentration At the 2x discriminating concentration the Palm Beach 3 and the Broward strains demonstrated 5% and 6% survival, respectively. Discussion The LPT method has been used to screen potentially resistant R. microplus populations against different acaricide classes (Miller et al. 2001, Sabatini et al. 2001, Castro Janer et al. 2009). Miller et al. (2007 a ) determined the discriminating concentration for R. microplus at 0.25% for permethrin (R. J. M. unpublished data). This test also was used in R. microplus to determine the discriminating concentration at 0.28% for macrocyclic lactones (Sabatini et al. 2001). The Cattle Fever Tick Research Laboratory in Edinburg, TX has been using discriminating dose tests since 1997 to screen R. microplus populations for acaricide resistance. Miller et al. (2007 a ) identified the first populations of permethrin resistant R. microplus in the United States using this screening tool. In our study, the discriminating concentration for pe rm ethrin was determined to be 0.19 %. Prior to this research, a discriminating concentration for permethrin or fipronil had not been published for R. sanguineus The advantage of using a discriminating concentration for ticks falls with the ability to coll ect eggs from the future submission of engorged female ticks. These emergent larvae can be categorized as susceptible or resistant with a single dose. This is important because the cost of rearing ticks is high and it is time consuming. Additionally, wh en an infestation is present it is important to provide guidance as quickly as possible and without excessive costs. The availability of a discriminating concentration allow s for a n inexpensive and rapid resistance diagnostic technique that can be used to guide tick management plans

PAGE 95

95 for animals and aid in the selection of environmental treatment options. My results for permethrin and fipronil discriminating concentration establishment for brown dog ticks allow s for a resistant:susceptible screening for fut ure tick submissions from residences and kennel facilities using a single chemical concentration The single concentration of 0.19% active ingredient will be used with permethrin and 0.15% active ingredient for fipronil. With the standardized use of larv al ticks, the typical client submission quantity of two to three engorged females would provide sufficient tick offspring numbers needed for this method. There were large ranges of susceptibility among the tested strains of R. sanguineus especially at t he highest concentrations. One would expect such differences given the relative lack of non host dispersal or mixing among these strains, as well as the diversity of pet owner driven management practices, creating disproportionate acaricide exposure. Amo ng permethrin tested field strains, the largest difference in survival was between the Broward an d Palm Beach 3 strains with 66% and 0% survival respectively, after exposure to 53x the discriminating concentration of permethrin (Fig. 3 1). Within the tick strains tested for fipronil resistance using the discriminating concentration, the Sarasota 2 strain was the most susceptible o f the field strains evaluated, although survival was only 2% higher at the LC 99 when compared to the susceptible strain (Fig. 3 2 ). Interpretation of the Sarasota 2 resistance screening results should be viewed with caution, as only 539 ticks were evaluated, the lowest number among all tested strains. The clientele who submitted the Sarasota 2 ticks reported the use of fipronil on their dogs through the use of a topical spot on treatment

PAGE 96

96 to the dog. However, the reporting individual claimed this product was ineffective for controlling their tick problem. Under these circumstances it is difficult to determine the cause of such a c ontrol failure. Often, inconsistent or improper product use or post application grooming practices may be occurring, which lead to decreased chemical exposure levels for the ticks. The Collier 2 strain also had <2% survival at 2x LC 99 and should be consid ered susceptible. However, at the LC 99 there was 70% survival, indicating these ticks were more tolerant to fipronil than the Sarasota 2 and susceptible strains (0 and 2.46%, respectively). No history of fipronil exposure was reported for the Collier 2 s train prior to tick submission. The pet owner for the Collier 2 strain reported that permethrin also had not been used indoors at the residence and had not been applied to the dog. Interestingly, this strain demonstrated high levels of permethrin resista nce, suggesting that selection had occur red prior to the infestation. The Sarasota 1 strain had a reported use of fipronil via spot on treatments on three dogs in the household. This strain demonstrated 67% survival at 2x LC 99 but no survival at 4x LC 99 (Fig. 3 2) Additionally, the home recently had been treated with the pyrethroids deltamethrin and lambda cyhalothrin as a crack and crevice application, which could have selected for permethrin resistance in this strain immediately prior to its submissio n (Table 3 1, Appendix A). Tick survival at the permethrin 16x discriminating concentration was 92%, suggesting a highly permethrin resistant tick population existed in the home. Unfortunately, sufficient numbers of ticks were not available to conduct th e 53x discriminating concentration assay.

PAGE 97

97 Additional testing methods other than the LPT have been used for discriminating concentration development including the larval immersion test developed by Shaw (1966), in which ticks were dipped into an acaricide solution. In the field, ticks are not typically submerged in to acarici des for treatment; therefore a treated surface contact assay may more accurately depict real world resistance expression in ticks Sabatini et al. (2001) compared the LPT and larval immersion assays using ma crocyclic lactone exposure to R. microplus In these tests the LPT had a discriminating concentration of 0.28%, while the immersion assay generated a discriminating concentration ranging from 0.0007 to 0.006%. The researchers det ermined that the LPT provided accurate and detailed results for resistance diagnosis although higher concentrations of acaricide were required in comparison to the larval immersion test. The adult immersion test, developed by Drummond et al. (1973), also has been used to evaluate resistance. The adult immersion test, much like the larval immersion test, utilizes a method of submerging ticks into a liquid acaricide. There are no data to document the differences in mortality between all three tick life sta ges to determine if their susceptibility changes when data are adjusted for body mass. The LPT and adult immersion test have been standardized and are accepted by the Food and Agriculture Organization for resistance screening in ticks, however, the larval immersion test is not an approved method (FAO 2004). All three described testing methods have been used to calculate the fipronil discriminating concentration for R. microplus. Castro Janer et al. (2009) found variation between all methods, including dif ferences between the larval and adult immersion tests, wherein a discriminating concentration at 7.64 ppm and 4.98 ppm were observed,

PAGE 98

98 respectively. This would indicate that larvae are less sensitive to fipronil than the adults. The LPT in their study, as expected, had a much higher estimated discriminating concentration at 2,366 ppm (0.23%), demonstrating a higher concentration of fipronil was required to obtain similar mortality levels with the two immersion tests. The same conclusion was found in Sabat ini et al. (2001) with macrocyclic lactones. Should the larval immersion test gain popularity and as data are published and methods standardized, lower amounts of an acaricide would be required in order to verify established resistance. This is especiall y important when evaluating experimental or patent protected acaricides, where availability and cost are prohibitive to widespread evaluation. Adult immersion tests have been used to generate permethrin and fipronil LC 50 values with semi engorged R. sangui neus (Roma et al. 2009, Oliveira et al. 2011). In these studies, the LC 50 was 2,062 ppm (0.20%) for permethrin and 9.647 ppm (0.0009%) for fipronil. There are few labels that include rates for dipping dogs into acaricide solutions; therefore, the closest comparison to a real world situation would be a tick shampoo. Undiluted Sentry Pro Flea & Tick Shampoo contains AI permethrin 0.10% piperonyl butoxide 0.50% pyriproxyfen 0.01% Piperonyl butoxide is a synergist that blocks cytochrome P450 activity ( Casida 1970). However, if cytochrome P450 activity is not the mechanism of resistance present in the tick population, it will not increase the effectiveness of permethrin. With the determined LC 50 of adult ticks at 0.20% using the adult immersion test, a diluted application of the shampoo to a pet, already maximized at 0.10% in the formulation, would not be effective in killing many ticks. Furthermore, at

PAGE 99

99 the supplied concentration of 0.10%, it is unlikely that tick exposed directly to the concentrated p roduct would die. The permethrin containing product Tengard has been labeled for use at a diluted level equivalent to deliver a 0.0626% AI concentration in a dip solution for dogs. Roma et al. (200 9) reported 26% tick mortalit y seven days following a 0 .10% permethrin adult immersion test using semi engorged females. Semi engorged females in Roma et al. (2009) did not demonstrate 100% mortality until immersion in 2.56% permethrin, which exceeds the label rate for permethrin dips used on companion anima ls. As demonstrated in the current study, various levels of permethrin resistance have been found in Florida and Texas brown dog tick populations. To put these resistance levels into perspective using expected performance with two consumer products sold today, application rates and expected tick mortality are presented. Most, if not all, permethrin containing products labeled for indoor crack and crevice applications have an upper limit of 0.5% concentrations, with retreatment intervals of 14 to 30 days For example, Tengard SFR are labeled for indoor crack and crevice applications at 0.5% Al or for use as a spray application directly to dogs at a higher rate of 0.6257% with 1 to 2 fluid ounces used per animal The environmen tal and on animal levels are ~3.5x below the discriminating concentration (0. 1 9% concentration) tested on the field collected brown dog tick strains that I evaluated. At the 5x level, an AI level slightly higher than that allowed by label instructions, al l tested ticks demonstrated 79 to 97% survival. Pet owners with ticks expressing permethrin resistance at these levels would likely experience a failure of the product.

PAGE 100

100 Frontline Spray Treatment for Pets, and Sentry FiproGuard Flea & Tick Spray for Dog s & Cats both have an AI of 0.29% fipronil. This level is equivalent to the 4x LC 99 that was tested. Mortality at this concentration was high in all field strains tested, with the Palm Beach 3 and Broward strains demonstrating approximately 5% survival. The remaining tested tick strains had <1% survival. This product remains effective according to the results of my study. However, as the levels of fipronil present on the dog diminish between application periods, ticks could be exposed to sub lethal con centrations. If products with different modes of action are not used, the repeated sub lethal exposure could lead to increased fipronil resistance levels, similar to what has been demonstrated in laboratory resistance selection studies (Miller et al. 1999 ). Having baseline data from susceptible and resistant populations is important in determining changes in resistance over time. Due to the difficulty in tracking where tick populations originated, it is difficult to determine how quickly resistance is evo lving or what resistance characteristics the strain had when it first arrived at the home. The Gilchrist F2 strain demonstrated resistance to both permethrin and fipronil. These ticks were collected from a home that had been battling an infestation for a t least three years. The resident reported using various acaricides for their companion animals including permethrin based products and fipronil spot on treatments, but admitted to inconsistent use. They had received professional pest control treatments with pyrethroid based products, but also had been inconsistent with following a treatment regimen. Under ideal conditions, the brown dog tick can complete an entire life cycle in 3 months (Goddard 1987). That would indicate, if resistance were selected f or at the Gilchrist F2

PAGE 101

101 strain location, this population may have evolved resistance to two different classes of chemicals in 12 generations. The Broward strain demonstrated high levels of permethrin resistance and the highest level of fipronil tolerance fr om all tested strains. This strain lacked exposure to A permethrin based topical spot on treatment was used on the dog during summer months, but had not been used for eigh t months prior to the documented infestation. There was no reported history of fipronil use. This resident submitted 240 engorged nymphs, collected over a two night period, indicating a heavy tick load on the five indoor dogs. The dogs had a history of regular groomer visits, which could have been a source of tick exposure. Given the treatment history of this strain, it suggests that the ticks were under selection pressure for permethrin and fipronil resistance prior the infestation at the Broward resid ence. Other field collected pesticide resistant arthropods lacking previous exposure history have been documented. Field collected B. germanica with no previous fipron il exposure history where resistant which was attributed to previous cyclodiene resista nce conferred by similar mechanisms (Holbrook et al. 2003). Historically, residential areas have been treated with pesticides that have now been found to confer cross resistance. Mallis (1954) recommended the use of DDT powder on dog s twice a week and pyr ethrum dip s with piperonyl butoxide. Indoor areas were also treated DDT or pyrethrum with piperonyl butoxide. Chlordane sprays and dusts also were used as limited spot treatments and approved for use on dogs and in kennel areas.

PAGE 102

102 Chlordane and DDT were used frequently for cockroach control (Mallis 1954) increasing the likelihood of residual pesticide in the residential environment Carpet samples were evaluated from nine homes in Jacksonville, FL, with two samples being collected from two homes, to test for residual pesticides (Whitmore et al. 1994). Dieldrin (mean 2.2 ul/g) was detected in 10 out of 11 carpet dust samples and DDT ( mean 1.2 ul/g) was detected in nine samples (out of 11) D ieldrin and chlordane have been found to confer cr oss resistance to fipronil (Holbrook et al. 2003 ) and DDT has been confirmed to confer cross resistance to permethrin (Brengues et al. 2003 ). For current control procedures, p est control operator protocols and recommendations in Goddard (2011) suggest ed two treatments o ver a one month period for brown dog tick control The first treatment should control active tick life stages, while the second serves to treat newly emerged larvae from egg hatch. Some home owners that have submitted brown dog tick samples to the Univer sity of Florida for resistance testing reported control failures after professional pest control applications of pyrethroid products in ad dition to on animal treatment. The S arsota 2 population, which demonstrated 56% survival at 53x the discriminating co ncentration of permethrin and 0% survival at the fipronil discriminating concentration were collected from a residence that used Front l i ne for on animal control and the home was professionally treated with several pyrethroid products (Appendix A) ; howeve r the home owner reported it took one year to control the infestation. Due to the challenges in determining the existing resistance status when an infestation began, as well as any prior acaricide exposure, further laboratory testing is necessary to det ermine the rapidity with which resistance can be selected. With the

PAGE 103

10 3 variation of susceptibility levels to permethrin and to a lesser extent, fipronil, it is believed different mechanisms that confer resistance have evolved and these mechanisms should be s tudied. Understanding these mechanisms can aid in the development and planning of effective control programs.

PAGE 104

104 Table 3 1. Acaricide exposure in field collected Rhipicephalus sanguineus (Latreille) as reported by pet owners or kennel operators. Strain Per methrin Fipronil Broward Sporadic on animal topical treatment 8 months prior to submission None Collier 2 None, but outdoor area had been treated, possibly with a pyrethroid None Gilchrist Inconsistent on animal topical treatment, nonspecified pyreth roids indoors Inconsistent on animal topical treatment Palm Beach 2 Indoor area treated with non permethrin pyrethroid On animal topical treatment Palm Beach 3 Unknown Unknown Sarasota 1 Indoor treatment with non permethrin pyrethroids On animal topica l treatment monthly for one year Sarasota 2 On animal topical treatment intermittently and indoor foggers On animal topical treatment monthly for two years

PAGE 105

105 Table 3 2 Lethal concentration (LC) values of permethrin and the discriminating concentration 2x LC 99 using Logit analysis for susceptible Rhipicephalus sanguineus (Latreille) purchased from Ecto Services, INC Test n a (r eplicates) LC 50 (95% CI) b LC 99 (95% CI) b Slope (SEM) 2 (df) Discriminating c oncentration b 1 4,098 ( 44 ) 0.028 (0.026 0.029) 0.0 99 (0.086 0.117) 8.31 (0.34) 61 (38) 0.20 2 4,308 ( 44 ) 0.025 (0.024 0.026) 0.082 (0.048 0.073) 8.98 (0.31) 53 (38) 0.16 3 5,240 ( 40 ) 0.027 (0.026 0.028) 0.098 (0.089 0.108) 8.20 (0.28) 39 (34) 0.20 4 2,839 ( 27 ) 0.027 (0.026 0.028) 0.087 (0.077 0.101) 9. 00 (0.36) 52 (22) 0.17 Pooled 16,485 ( 155 ) 0.027 (0.026 0.027) 0.093 (0.087 0.099) 8.42 (0.15) 230 (138) 0.19 a n represents total number of ticks tested per experiment and replicates represents the total number of packets b Values represent percentage of active ingredient (w/v) applied to tre ated filter papers 7.5 x 8.5 cm

PAGE 106

106 Table 3 3 Lethal concentration (LC) values of fipronil and the discriminating concentration 2x LC 99 using Probit analysis for susceptible Rhipicephalus sanguineus (Latreille) purchas ed from Ecto Services, INC. Test n a (r eplicates) LC 50 (95% CI) b LC 90 (95% CI) b LC 99 (95% CI) b Slope (SEM) 2 (df) Discriminating c oncentration a 1 4,213 ( 44 ) 0.020 (0.018 0.021) 0.038 (0.036 0.042) 0.067 (0.060 0.077) 4.30 (0.16) 58 (38) 0.13 2 4,089 ( 40 ) 0.024 (0.023 0.025) 0.041 (0.038 0.044) 0.063 (0.057 0.070) 5.55 (0.16) 67 (34) 0.13 3 3,642 ( 27 ) 0.024 (0.022 0.025) 0.047 (0.045 0.051) 0.084 (0.076 0.093) 4.22 (0.11) 55 (25) 0.17 4 5,141 ( 27 ) 0.024 (0.023 0.025) 0.046 (0.042 0.050) 0.076 (0.068 0.086) 4.68 (0.11) 82 (25) 0.15 Pooled 17,085 ( 138 ) 0.023 (0.023 0.024) 0.044 (0.042 0.046 ) 0.074 (0.069 0.08 1) 4.67 (0.06) 438 (128) 0.15 a n represents total number of ticks tested per experiment and replicates represents the total number of packets b Values represent percentage of active ingredient (w/v) applied to tre ated filter papers 7.5 x 8.5 cm

PAGE 107

107 Figu re 3 1. Mean percentage survival of Rhipicephalus sanguineus (Latreille) strains in Florida exposed to the discriminating concentration of permethrin at 1, 5, 16 and 53 times the LC 99 value (0.19 % concentration) using the Food and Agriculture Organizatio n larval packet test and an acaricide susceptible tick strain from Ecto S ervices INC NC. 53x 16x 5x 1x 0 10 20 30 40 50 60 70 80 90 100 % Survival Strain

PAGE 108

108 Figure 3 2. Mean percentage survival of six Florida Rhipicephalus sanguineus (Latreille) strains exposed to fipronil at the LC 90 LC 99 (0.15% concentration), 2x LC 99 (the discriminating concentration), 4x LC 99 using the Food and Agriculture Organization larval packet test and an acaricide susceptible tick strain from Ecto Services INC, NC. 4x LC99 2x LC99 LC99 LC90 0 10 20 30 40 50 60 70 80 90 100 % Survival Strain

PAGE 109

109 CHAPTER 4 DETERMINATION OF MET ABOLIC AND TARGET SI TE RESISTANCE MECHA NISM IN PYRETHROID AND FI PRONIL RESISTANT BRO WN DOG TICKS Introduction The brown dog tick, Rhipicephalus sanguineus (Latreille), is an arthropod pest that can be brought into a home by canine owners, where it is able to complete its life cycle (Lord 2001, Demma et al. 2005). In susceptible brown dog tick populations, permethrin was shown to provide long term protection against tick feeding (Endris et al. 2002b). Permethrin is a member of the pyrethroid class of acaricides that acts on the sodium channel c ausing neuroexcitation that eventually leads to tick death (Narahashi 1986). Permethrin is used for tick control in dogs as a topical spot on treatment, shampoo, and an on animal spray. It also is used as an in home treatment as a residual crack and crev ice spray that targets ticks as well as fleas, cockroaches, and bed bugs. However, with several formulations and a long history of use, permethrin resistance may emerge as demonstrated in R. sanguineus strains described in Chapters 2 and 3, as well as has been previously demonstrated in several strains of Rhipicephalus microplus (Canestrini) (Rosario Cruz et al. 2009, Morgan et al. 2009). Target site mutations and increase esterase activity both have been found to confer resistance. Fipronil is in the phe nylpyrazole family of chemicals and is the active ingredient in Frontline a topical treatment used on companion animals for tick and flea control since aminobutyric acid (GABA) gated chloride channels to block the flow of chloride ions, leading to neuroexcitation (Zhao et al. 2003). Fipronil resistance is frequently linked to a target site mutation. Metabolic resistance is unlikely because the metabolites of fipronil retain their toxicity (Zhao et al. 2005). Giv en

PAGE 110

110 the broad label use and frequent documentation of permethrin resistance, recent generic fipronil formulations sold at reduced prices, which many pet owners have begun to use, may increase fipronil resistance selection. Increased metabolic activity has b een implicated in arthropod pesticide resistance. Cytochrome P450, esterase, and glutathione S transferase (GST) are important metabolic enzymes found in all organisms. Cytochrome P450s are located within the endoplasmic reticulum and carry out oxidative reactions that confer pesticide resistance in arthropods (Feyereisen 2005, Yu 2008). Cytochrome P450s metabolize compounds by binding to an atom of oxygen from another molecule, which forms water (Berg et al. 1998). In arthropods, these enzymes catalyz e pesticide metabolism via hydroxylation, N demethylation, and O demethylation (Yu 2008). Cytochrome P450s also are important for activation of pro insecticides such as o rganophosphate s. Important activation reactions include epoxidation, sulfoxidation, and desulfuration Increased cytochrome P450 production has been found to occur through different physiological aberrations Amichot et al. (2004) found DDT resistant D. melanogaster that demonstrated elevated cytochrome P450 production due to a point m utation. Other genetic modifications that have been demonstrated to increase P450 production include gene over expression, which has been confirmed in D. melanogaster (Daborn et al. 2000). Over expression of the Cyp6g1 gene increased P450 production, con ferring DDT and neonicotinoid resistance, which fall under different chemical classes and modes of action. Esterase activity detoxifies molecules containing ester bonds. Carboxylesterase and phosphatase are important esterases for pesticide metabolism ( Yu 2008).

PAGE 111

111 Pesticide toxicity may be reduced by esterases through enhanced detoxification and sequestration (Devonshire and Moores 1982). In the peach potato aphid, Myzus persicae Sulz, esterase sequestration conferred carbamate and organophosphate resist ance. Low levels of organophosphorus and carbamate hydrolysis were found using radiometric methods, but increased esterase was present. Field et al. (1988) found in broadly insecticide resistant M. persicae, resistance levels were correlated with the amo unt of increased gene amplification. Increased esterase activity due to a point mutation also has been found in permethrin resistant R. microplus (Hernandez et al. 2000). Glutathione S transferases have been found to detoxify numerous toxicants in arthr opods by conjugating glutathione with electrophilic substrates (Yu 1996, 2008). As reviewed by Sun et al. (2001), GST confers organophosphate resistance in several arthropods. Pesticide resistance conferred by increased GST activity may be the result of different physiological activities. Glutathione S transferase may bind to pesticides, which reduces pesticide toxicity by sequestration (Kostaropoulus et al. 2001). Sequestration was found in a deltamethrin resistant strain of Tenebrio monitor L., the ye llow mealworm. Additionally, increased GST gene amplification was found in organophosphate resistant M. domestica (Syvanen et al. 1996). As reviewed by Li et al. (2007), gene over expression also elevated GST levels in DDT and pyrethroid resistant Aedes aegypti L. The suppression of esterase, P450 and GST activity have been found in Rhipicephalus bursa (Canestrini and Fanzago) in Iran (En ayati et al. 2010). In addition to enhanced enzyme activity, r esistance to pyrethroids in arthropods has been

PAGE 112

112 docum ented from target site mutations occurring in the sodium channel. Pyrethroid resistance due to target site insensitivity and carboxylesterase mediated metabolism was documented in R. microplus in Mexico (Jamroz et al. 2000). Characterization of the targ et site mutations that confer resistance in R. microplus have been investigated in several studies. Guerrero et al. (2002a) found that resistant cattle ticks possess sodium channels having either a single mutation in populations that were resistant to up to 30% permethrin or two mutations in ticks that demonstrated even higher levels of resistance. Sodium channel mutations were found in both populations at the S6 transmembrane segment of domain III that lead to a phenylalanine to isoleucine amino acid sub stitution. The more highly resistant strain also had increased esterase activity (Guerrero et al. 2002 b ). In another R. microplus strain, a sodium channel mutation in the domain II S4 5 linker gene caused an amino acid substitution from leucine to isoleu cine in resistant strains (Morgan et al. 2009). Target site mutations have been found to confer resistance in various insect species but have not been documented in brown dog ticks Two genetic mutations were found in the GABA receptor of a laboratory selected fipronil resistant strain of Drosophila simulans Sturtevant (Le Goff et al. 2005). Both mutations occurred in the Rdl (resistance to dieldrin) GABA subunit, the first being an alanine to glycine substitution in the M2 domain and the second a th eonine to methionine mutation w hich occurred in the C terminal end of the M3 segment In the M2 domain, ffrench Constant et al. (1993) found a point mutation in the same location of Drosophila melanogaster Meigen that converted alanine to serine and conf erred high levels of resistance. Nakao

PAGE 113

113 et al. (2010) reported that fipronil resistant S ogatella furcifera (Horvth) ha d mutation in the GABA receptor. As demonstrated in Chapter s 2 and 3, various levels of permethrin resistance and fipronil toler ance were found in R. sanguineus In this chapter, t he metabolic mechanisms of resistance and target site mutations that previously have been found to confer resistance to permethrin and fipronil in other species were evaluated in the brown dog tick using synergist bioassays, protein gel electrophoresi s, and polymerase chain reaction (PCR). Materials and M ethods Ticks The larvae used were obtained either from field collected, engorged adult females or flat adults that were reared at the University of Flo rida (Appendix A, tick strain information; Appendix B, UF IACUC Protocol 200802142 ; 201102142, Appendix C, tick rearing protocol). Susceptible ticks were obtained from Ecto Services INC (Henderson, NC) for bioassay screening and gel electrophoresis. Tic ks were held in an incubator at 25 1C, 85% RH, with a photoperiod of 12:12. Five permethrin resistant field collected brown dog tick strains were utilized in permethrin synergist assays and three strains in fipronil synergist assays. Initially, a high dose acaricide selection process was to be used to select for a homozygous resistant genotype. The selection process included rearing ticks from strains that survived the highest treatment doses in toxicity bioassays. However, this selection process was n ot feasible due to poor tick survival in the laboratory. A portion of field collected larval ticks that were not previously exposed to acaricides in the laboratory and susceptible ticks were placed in a vial and preserved at

PAGE 114

114 80 C for gel electrophoresis In all, nine strains of ticks were preserved for gel electrophoresis evaluation. Protein extracted from a negative control strain of R. microplus, that did not exhibit increase esterase activity, was obtained from USDA ARS Cattle Fever Tick Research La boratory, Edinburg, TX for gel electrophoresis comparison. Larval ticks that survived acaricide doses exceeding 7% permethrin or 0.3% fipronil were placed in vials, labeled as high dose survivors, and held at 80 C for PCR testing. Twelve strains were pre served. Additionally, ticks that were untested with acaricides were preserved for comparison. Synergist Bioassays Metabolic resistance mechanisms were examined using synergists that block detoxification mechanisms. The following synergists were used to evaluate metabolic resistance and have been modeled after Miller et al. (2007b). Piperonyl butoxide (PBO) (Sigma Aldrich, St. Louis, MO) was used to examine cytochrome P450 inhibition. Diethyl maleate (DEM) (ChemService Inc. West Chester, PA) was used t o inhibit glutathione S transferase (GST). Triphenyl phosphate (TPP) (ChemService Inc., West Chester, PA) was used to determine the presence of esterase activity. The synergists were added at a constant rate during serial dilution procedure for the larv al packet test previously described in Chapter 2 (FAO 2004) The concentration of synergist used was determined by the results of an initial experiment that involved the se rial dilution of the synergist into a base solution of two parts trichloroethylene (TCE) and one part olive oil. A top dose of 5% for a synergist was used and serially diluted the lowest percentage at 0.14%. This range include d levels above and below 1%, which is

PAGE 115

115 used in synergist assays for R. microplus ( R. J. Miller unpublished data ) A diluti on rate of 30% and 40% was used during two experiments with each synergist. After testing various synergist levels a constant rate of 2% for each synergist was determined to cause sufficiently low mortality in R. sanguineus that it was used in further testing. An experiment was conducted using all three synergists in one solution to standardize the method. However, when all three synergists were combined high mortality was observed at all concentrations. The synergist screening assays consist ed of a small scale experiments for individual R. sanguineus strains Screening experiments for permethrin (98.8%, cis trans 40.1:58.7) (ChemService I nc ., West Chester, PA) consisted of the concentrations 10, 3, 0.9, and 0.18% active ingredient. If ins ufficient tick numbers were present the 10% concentration was removed from the experimental run. For fipronil (ChemService I nc., West Chester, PA) testing, 0.3, 0.15, 0.07, and 0.04% active ingredient concentrations were used. For both acaricides three to four replicates were completed for each concentration, based on available tick numbers. Separate stock solutions were made (w/v), using permethr in or fipronil Each acaricide was paired with a synergist that was added at a constant rate to all dilution s. There were six treatment combinations of acaricide (permethr in and fipronil) and synergist, PBO (v/v) TPP (w/v) DEM (v/v ) plus four controls. The f our control treatments were used with each run, one contained only TCE and olive oil, termed the solve nt, while the remaining three contained the solvent with one respective synergist. Serially diluted solutions were applied to filter papers (7. 5 x 8.5 cm) (Whatman N o. 1 Maidstone, England) at 1 mL of solution per paper. The filter papers were dried

PAGE 116

116 f or two hours under a fume hood allowing the TCE to evaporate. Dried filter papers were folded in half and the sides were clipped together with bulldog clips ( Chapter 2, Fig. 2 2). Larval ticks, 14 to 16 days post eclosion, were placed in each packet. A third clip was used to secure the open end. If tick numbers were available, ~100 ticks were used per packet, but in some cases fewer larval ticks were available. After tick placement, packets were held in an environmental chamber for 24 hours at 25 1C 92% RH, with a photoperiod of 12:12 (L:D) ( Chapter 2, Fig. 2 3). The packets were removed and mortality was assessed after 24 hours. Each packet was opened and the number of live and dead ticks were counted and recorded ( Chapter 2, Fig. 2 4). Tick mort ality was compared between each synergist exposed treatment and ticks exposed to acaricide alone to determine if metabolic resistance was present. If a decrease in mortality was observed in synergist containing packets, when compared to packets without a synergist, a replicated experiment using up to eight serial dilutions of these treatments was conducted to calculate a dose response curve If results from the bioassays indicated esterase derived resistance, native gel electrophoresis was u sed for confir mation Susceptible R. microplus and R. sanguineus tick protein was used as a control. Gel Electrophoresis The gel electrophoresis technique used to determine increased esterase activity in permethrin resistant R. sanguineus strains was adapted from Mille r et al. (2007b). From each of the nine tick strains tested 40 larvae that had not been exposed to acaricides since collection and were held at 80C were pulverized in a 1.5 mL microcentrifuge tube with a pre chilled pestle over dry ice. The susceptibl e strain of R.

PAGE 117

117 sanguineus (Ecto Services, INC .) and susceptible R. microplus (Deutch strain) that did not exhibit increase levels of esterase production were used for comparison. Pulverized larvae were homogenized with 100 L of a protein extraction buff er that was held at 4C. The buffer consisted of 100 L 0.1 M sodium phosphate buffer (pH 7.5), 25 L 20% TritonX 100 ( Sigma Aldrich St. Louis, MO ), 286 L 70% w/v sucrose, 2 L 0.5 M ethylenediaminetetraacetic acid (EDTA) pH 8 ( Thermo Fischer Scientifi c Inc., Waltham, MA ) solution and 588 L water. The EDTA solution was made by combining 18.6 g EDTA, 2.2 g sodium hydroxide pellets, and 80 L water. Nanopure water was used to make all solutions. The homogenate was centrifuged for 2 min utes at 14,000 rpm to separate tick protein from the rest of the homogenate. An aliquot of the supernatant (10 L ) was extracted from the microcentrifuge tube, above the pellet. The supernatant aliquot was combined with 10 L Novex Tris Glycine Native 2x Sample Buffer ( Life Technologies Carlsbad, CA ) into a 2 mL microcentrifuge tube and vortexed until a uniform purplish color was achieved. T he remaining supernatant was divided into 10 L aliquots and placed into multiple microcentrifuge tubes and stored at 20C to be used in later ex periments as needed Samples were loaded into a 4% acrylamide stacking gel with a 10% acrylamide separating gel (Bio Rad, Hercules, CA). The gel was placed into a clamp system and secured with glass plates to hold the running buffer in place as describe d below. Prior to initiating the experiment, the running buffer was placed in between the glass plates to assure the clamps were secure. A pipette was used to remove air bubbles and to ensure running buffer was present in all of the wells. Ten L of Kal stained standard (Bio Rad, Hercules, CA) was loaded into the far left lane to serve as a

PAGE 118

118 size reference. Ten L of the supernatant containing the loading buffer was then dispensed with a pipette into each well. The g el was run with a 1.0 m olar (M) Tris glycine running buffer prechilled to 4C on a Bio Rad Sub Cell GT Agrarose Gel (Bio Rad, Hercules, CA). The running buffer was made from100 mL of Bio Rad 10x Tris glycine buffer (Bio Rad, Hercules, CA), 200 mL methanol ( Thermo Fisher Scien tific, Waltham, MA >99.8% ) and 700 mL nanopure water. The ge l was run at 200 v, 40 mA at 4 C After running the gel, a gel knife was used to remove it from the casing. The gel was then placed into a glass container for staining. To visualize esterase activity the gel was incubated for 1 h our at 37C in 50 mL of the staining solution. The staining solution describ ed below consisted of Fast B lue BB salt ( Sigma Aldrich St. Louis, MO ) naphthyl acetate ( Sigma Aldrich St. Louis, MO ). Staining so lutions were made with a sodium phosphate buffer that was prepared first. Sodium phosphate monobasic ( Thermo Fisher Scientific, Waltham, MA ) and sodium phosphate dibasic ( Thermo Fisher Scientific, Waltham, MA ) were made into a 1 M solution with 120 g/ lite r of nanopure water (LabStar, Siemens, Munich, Germany) and 142 g/ liter of nanopure water, respectively. One liter of sodium phosphate buffer (pH 7.5) was made by adding 16 mL of sodium phosphate monobasic to 84 mL of sodium phosphate dibasic. A pH meter was used to confirm that the pH was 7.5. Adjustments were made as needed by adding 1 M hydrochloric acid to increase the acidity or 1 M sodium hydroxide to produce a more basic solution. A gel staining solution was produced by adding 200 mg of Fast B lu e BB salt to 200 mL of 0.1 M sodium phosphate buffer (pH 7.5). The solution was vortexed for one

PAGE 119

119 min ute then filtered using a Corning 250 mL Vacuum Filter (Corning Incorporated, Corning, NY ). naphthyl acetate (60 mg) was made into solution by the addi tion of 1 mL of acetone. The Fast B lue BB salt and naphthyl acetate solutions are light and temperature sensitive and their holding containers were wrapped in aluminum foil and held at 4C. Solutions for the protein assays were prepared in advance and held separately until they were ready for use. Before use, 50 mL blue fast salt was naphthyl acetate. The concentration of the final solution was 0.1 M sodium phosphate buffer, which contained 100 mg/ mL Fast B lue BB salt and 15 naphthyl acetate. Fast blue B B salt and naphthyl aceta te are highly toxic therefore, full PPE (lab coat, gloves, goggles, N95 mask) were worn and chemicals were mixed under the fume hood to prevent inhalation. In order to confirm esterase activity and its inhibition with triphenyl phosphate (TPP) a second inhibition gel assay was run with the same protein samples used in the standard staining procedure An inhibitory staining solution containing TPP was made. One gram of TPP was added to 10 mL of acetone then vortexed to produce the stock solution (3.3 x 10 4 M). The reafter, inhibitory staining solution was added to 50 mL Fast B lue BB salt naphthyl acetate. The gel was incubated at 37C on a rotator table (50 rpm ) ( Barnstead/LabLine Thermo Scientific, Walt ham, MA) for 15 minutes in the inhibitory staining solution containing 50 mL of 0.1 M sodium phosphate buffer and 0.33 mM TPP to test for esterase activity inhibition. After a 15 min ute holding period the inhibitory staining solution was remove d and t he standard staining solution ( 0.1 M sodium phosphate buffer, 100 mg/ mL Fast B lue

PAGE 120

120 BB salt, naphthyl acetate ) was added to the container with the gel. The gel box container was incubated on a rotator tabl e (50 rpm ) at 37C for 1 h our. The gel staining solution and the gel were added to a n airtight glass container under a fume h ood The glass container was covered by aluminum foil to prevent inactivation of the light sensitive solution. The inhibitory and non inhibitory gels were incubated at 37C f or 1 hour on a rotator table (50 rpm ) in order to keep the solution continuously movin g over the gel. After 1 h our the staining solution was poured into a hazardous waste container for disposal Thereafter, 50 mL of a destaining solution was added to the glass container The staining solution consisting of 400 mL of methanol, 100 mL of a cetic acid, and 500 mL of nanopure water. The gel with the destaining solution was pl aced on the rotator table (50 rpm ) for 1 h our at room temperature. After the gel was removed it was photographed on disposable plastic film and the gel was disposed of i n the hazardous waste bin, using good laboratory practice standards. Polymerase Chain Reaction Tick preparation When possible, ticks that survived the top two doses of acaricide from Chapter 2 larval packet test experiments were used for PCR testing In all cases, the l arval and adult ticks were preserved at 80 C Degradation of tick DNA to detect target site mutations occurs rapidly, so dead ticks were not held off dry ice for more than two to three min utes during PCR preparation DNA i solation Meth ods from Guerrero et al. (2001) or the QIAamp DNA Mini Kit (Venlo, Limburg) kit were used for DNA extraction. Extraction of DNA was completed on single larval ticks, pools of 10 and 20 larval ticks from the same strain, and single adult ticks.

PAGE 121

121 These lat ter extractions were utilized to obtain larger concentrations of DNA. Microcentrifuge tubes containing larval or adult ticks described earlier were placed on dry ice and the following procedures were conducted on dry ice Liquid nitrogen prechilled pestl es were used to pulverize larval ticks by grinding for 15 to 20 seconds. Tubes were briefly removed from the dry ice, and while keeping the pestle inside the tube 25 L of Perkin Elmer PCR reaction buffer II (DNA isolation buffer) was added. The DNA iso lation buffer was made in 10 mL batches by adding 1 667 L of 3 M KCl, 600 L of 1 M Tris Cl (pH 8.5), 400 L of 1 M Tris Cl (pH 8.0) and 7 333 L of nanopure water. Following the addition of the DNA isolation buffer, tick grinding was continued for an ad dition al 15 seconds or until the ticks were broken apart. The pestle was removed and discarded and tubes were returned to the dry ice. When each tick specimen preparation was completed contents were concentrated to the bottom of the tube using a table to p centrifuge for five seconds. Tubes were placed in a water bath, at 100 C, for five min utes then removed and cooled on ice for one minute Tubes were centri fuged at 14,000 rpm at 4C for five min utes to prepare samples for DNA amplification. DNA amplifi cation Amplification methods developed by Guerrero et al. (2001) were used and optimized as needed. Using this approach, 1 L of DNA from a single tick, 20 pmol of each primer (1 L), 12.5 L PCR Master mix (PCR Master, Roche Applied Science, Mannheim, Ge rmany), and 9.5 L PCR grade water, to achieve a 1x concentration, were added to a 0.5 mL microcentrifuge tube. The tubes were then placed into a CR conditions were optimized based on each set of primers used After DNA was

PAGE 122

122 processed, 1 L of a gel loading dye (DNA Gel Loading Buffer Loading Buffer (10x), 5 Prime, Gaitherburg, MD), 4 L, 1x Tris/Borate/EDTA (TBE), and 5 L of amplified DNA were mixed then dispensed onto an ag arose gel The gel was made by mixing 1x TBE with agarose, to achieve a 1 to 2.5% concentration, depending on PCR product size, then heated until agarose dissolved. GelRed (Phenix Research Products, Candler, NC) was added at rate of 1 L per 10 mL of agar ose and TBE solution, which varied based on the size of the gel box. Once agarose solution cooled to 55 C it was poured into the gel box to set for 30 minutes. Once the DNA product was loaded into the gel wells, the gel was run at 120 volts and photogra phed under UV light. DNA p rimers The Ixodes scapularis Say genome has been fully sequenced while several genes significant to this work have been sequenced for R. microplus Highly conserved sequenced portions of the two tick genome s served as a starting point to create PCR primers for the R. sanguine us sodium channel. All genetic sequences were obtained from GenBank. For sodium channel degenerate base pair primer design the following sequences were used, Ix. scapularis (XM_002407075), R. microplus (AF1 34216.2), and Varroa destructor Anderson and Trueman (AY259834.1). T he chloride channel portion of the glutamate receptor for R. sanguineus has been sequenced (GV659520.1) (GQ215235.1), and served as a positive control. Three regions that were targeted for sodium channel mutation detection were in Domain III in segment S6 and Domain II in the S4 5 linker region, which have been determined to confer resistance in R. microplus (He et al. 1999 b Morgan et al. 2009, Jonsson et al. 2010). Two programs were u sed to create the primers for the brown dog

PAGE 123

123 tick sodium channel locations that were predicted to have target site mutatio ns. The first approach used degenerate base pairs, wherein the sequences were aligned for Ix. scapularis, R. microplus, and V. destruc tor using Clustal Omega Multiple Sequence Alignment (EMBL EBI, Cambridgeshire, UK). Primers were selected based on highly conserved regions. The primers were designed using IDT OligoAnalyzer 3.1 (Integrated DNA Technologies, Coralville, IA). The secon d primer design method used either Ix. scapularis or R. microplus sequences. Primers were selected around Domain II and III of the sodium channel using Primer3 (Whitehead Institute for Biomedical Research, Cambridge, MA) after the degenerate primers were unsuccessful at producing a PCR product (Rozen and Skaletsky 1998). For a positive control susceptible (Fernandez) and resistant (San Felipe) R. microplus were obtained from the USDA ARS Cattle Fever Tick Research Laboratory, Edinburg, TX. Water was used for the negative control. For the resistant control ticks, killed R. microplus samples were obtained, while extracted DNA was provided for the susceptible control, both shipped on dry ice. The susceptible and resistant control R. microplus primers at th e mutation site in Domain III of the sodium channel can be found in Guerrero et al. (2001). Primers were designed to discriminate and replicate PCR products based the presence or absence of a target site mutation. Each PCR assay was conducted with a resi stant and susceptible strain for comparative purposes with the R. sanguineus samples. An additional primer was used that amplified the gene sequence that overlapped the mutation that should be present for both strains.

PAGE 124

124 Given the fipronil tolerance levels observed earlier, target site resistance was not evaluated in the chloride channel (Chapter 2 and 3) but should still be evaluated in further research However R. sanguineus putative glutamate gated chloride channel mRNA previously had been sequenced (GV 659520.1) (GQ215235.1). P rimers using both IDT OligoAnalyzer 3.1 and Primer3 were used to standardize the PCR protocol and develop a R. sanguineus positive control In the GABA gated chloride channel, several mutations confer fipronil resistance. The Rdl (resistance to dieldrin) GABA subunit in D. melanogaster, D simulans and the M2 subunit in Sogatella furcifera Horvth have been identified ( ffrench Constant et al. 1993, Le Goff et al. 2005, Nakao et al. 2010) Susceptible (Oregon R) and resistant ( Rdl 1675) D. melanogaster obtained from the University of Florida Emerging Pathogens Institute were used to serve as a model for detecting a point mutation that confers resistance to channel blocking convulsants and insecticides Primers used to cover th e point mutation region are published in Le Goff et al. (2005). Rhipicephalus sanguineus has not been yet evaluated using PCR in the GABA subunit. Optimization of PCR protocol was done for each set of primers. A list of primers can be found in Appendix D (Table D 1). The troubleshooting technique that was employed included using DNA extracted from eight tick strains using two extraction methods, from a single larva, pools of 10 and 20 larvae and single adults. Two different master mix products were us ed with three primer concentrations A 10 temperature gradient test was completed to determine the best annealing conditions using five different ticks to account for variation s in PCR products that were detected in early experiments. The PCR products w ere run o n agarose gels of varying agarose

PAGE 125

125 concentrations depending on targeted product size. If bands were present that corresponded to the expected product size, DNA extraction was conducted using QIAquick Gel Extraction Kit (Qiagen Venlo, Limburg). The extracted DNA concentration was measured using the Qubit CA). When proper DNA concentrations were not present for direct sequencing, the sample DNA was cloned using TOPO TA Cloning nd One Shot E. coli was cloned it was isolated using a Qiagen QuickLyse Minip rep Kit (Qiagen Venlo, Limburg). The isolated product was stored at 20 C. A gel was run with 5 L of i solated DNA to determine if the cloning process amplified the target DNA. If the gel determined the proper product size and a DNA concentration of 20 was available, the PCR product was sent for Sanger sequencing at University of Florida Interdiscipl inary Center for Biotechnology Research. Isolated DNA (15 L) was placed in a 1.5 mL microcentrifuge tube and transported on ice. Statistics The LC 50 was generated for the synergist and non synergist acaricide using Probit analysis, ( PoloPlus LeOra Sof tware, Petaluma, CA) (LeOra 1997) Synergist ratios were calculated ( LC 50 of strain not containing synergist / LC 50 of strain containing synergist) to determine the change in mortality. Results The greatest mortality increase for the Broward strain occurr ed following the ad dition of TPP to the permethrin exposed ticks (Fig. 4 1). Mortality was increased at all doses in which TPP was added; however, the greatest mortality increases occurred

PAGE 126

126 at the highest permethrin concentrations of 0.9 and 3%, where 100% mortality was recorded. In the Gilchrist F2 strain, the individual inclusion of each synergist to permethrin resulted in increased mortality (Fig. 4 2 ) but TPP had the greatest impact on increasing mortality (89% at 0.9% permethrin). A synergist ratio c ould not be calculated for this tick strain because data did not fit the Probit model due to low mortality at high concentrations for the permethrin treated ticks Permethrin plus TPP increase d mortality in the Palm Beach 2 strain at concentrations excee ding 0.9% but no difference was detected at lower concentrations (Fig. 4 3). Sarasota 2 strain permethrin plus TPP results were similar to the Broward and Gilchrist F2 strain, wherein mortality increased from 50 to 97% at all permethrin concentrations tes ted (Fig. 4 4). A concentration response experiment was conducted with the Gilchrist, FL and Webb, TX tick strains to assess the effects of adding TPP and PBO to permethrin. Although the data did not fit the Probit model, mortality was impacted by syner gist type, albeit quite differently between the two strains (Fig. 4 5). In the Webb, TX tick strain, mortality increased from 8% in the 0.15% permethrin alone treatment to 100% in the permethrin plus TPP treatment (Fig. 4 5), indicting esterase is an impo rtant mechanism of resistance. Mortality in the Broward strain increased two to three fold at the higher permethrin concentrations with the addition of PBO (Fig. 4 1). In the Gilchrist F2 strain the synergis t ratio could not be calculated due to low mo rtality at high concentrations with permethrin alone ; however mortality data indicate an increase d in mortality in all doses with the addition of PBO (Fig. 4 2). The Palm Beach 2 F2 strain demonstrated an increase in tick mortality at all permethrin conc entrations in which PBO was added

PAGE 127

127 (Fig. 4 3). There also was an increase mortality in the Sarsota 2 with >15% in the 0.9 and 3% permethrin plus PBO concentrations (Fig. 4 4). The Webb, TX F2 strain had a PBO synergist resistance ratio of 6.6 (Table 4 1). The effects of DEM slightly decreased mortality for the Broward strain from 2.5 and 4.5% at concentrations of 0.9 and 3% permethrin, respectively (Fig. 4 1). Diethyl maleate resulted in the smallest increase mortality (7 to 18%) among the three synergi sts in Gilchrist F2 ticks ( Fig. 4 2). The mortality increase was observed in the Palm Beach 2 F2 strain DEM in concentrations exceeding 0.18%, but less markedly than the effect of TPP and PBO ( Fig. 4 3). Similar results in the effect of synergists were observed in both the Broward and Gilchrist F2 strains, where the addition of synerg ists did not result in increased in tick mortality at 0.04 and 0.07% fipronil concentrations (Figs. 4 6 and 4 7). However, at 0.15% fi pronil, increased tick mortality was o bserved. In the Sarasota 2 tick strain TPP and PBO similarly increased mortality at 0.03% fip ronil to 18 and 8% respectively. The addition of DEM resulted in decreased fipronil toxicity at the 0.03 and 0.07% concentrations, when compared to fipronil alo ne (Fig. 4 8). A concentration response curve could not be calculated for most fipronil and synergist assays. The Gilchrist F2 strain fipronil and DEM resistance ratio was 0.57 at the LC 50 (Table 4 1). When mortality in the Sarasota 2 strain tick was co mpared between fipronil alone and 2% DEM with 0.07% fipronil there was a decrease in mortality from 100% to 55% (Fig. 4 7). The use of DEM also decreased mortality at 0.03% fipronil, althou gh not to full susceptibility

PAGE 128

128 Further evidence for i ncreased este rase activity was examined in eight field collected strains and compared to the acaricide susceptible tick strain using gel electrophoresis methods that exhibit esterase activity to naphthyl acetate. Five of the eight strains evaluated with gel electrop horesis also were tested for esterase activity using the synergist assays described previously. The three additional strains had high levels of resistance documented in previous experiments, with survival at 10% permethrin. Two bands of increased esteras e activity were demonstrated in all field collected strains, with the exception of the Marion strain (Figs. 4 9 and 4 10). As indicated by stained proteins on the gel the Broward and St. Johns strains demonstrated the greatest expression of increased est erase, followed by the Palm Beach 2 F2 strain. Elevated esterase activity also was present in Sarasota 2 and Gilchrist F2 strains and the least activity was observed in Collier 2 and Marion strains. The susceptible strain that served as the negative cont rol, demonstrated low levels of esterase activity. The addition of TPP greatly inhibited esterase activity in the top bands of all strains (Fig. 4 10). With the addition of TPP, a middle band was able to be visualized during the inhibition assay but appea red inhibited in all strains except St. Johns and Broward. The bottom band, which was less prominent in the gel stained without TPP, remained active in the Palm Beach 2 F2 Broward, and Collier 2 strains with the addition of TPP. The R. microplus acaric ide resistance PCR assay that was used to standardize the DNA extraction, demonstrated amplification of the predicted product size. Additionally, primers designed to discriminate susceptible and resistant genotypes

PAGE 129

129 presented bands accordingly (Fig. 4 11). The primer set designed to cover the entire gene, regardless of a target site mutation, was present in DNA from both strains. Sequencing was not completed due to a low yield of DNA after gel extraction. The original DNA concentration in the positive co ntrol ticks, which were extracted at the USDA ARS Cattle Fever Tick Research Laboratory, contained 19.6 ng/ L with an A260/A280 ratio of 2.294. The DNA that was extracted at University of Florida from larval ticks contained 55.0 ng/ L with an A260/A280 ra tio of 1.264. After DNA was amplified using select primers and extracted concentrations were <5 ng/ L. The primers designed to discrim inate target site mutation locations proved to be ineffective at amplifying R. sanguineus DNA for the targeted region. In the glutamate gated chloride channel th at was used as a positive control, R. sanguineus pri mers did not amplify DNA of correct product size. The sodium channel experiments that used degenerate primers and primers based individually off I. scapularis an d R. microplus sequences also were unsuccessful at amplifying target DNA In total, 41 primer sets were evaluated. Bands were present in several experiments; however, the size of the band did not correspond with the expected product size. When bands tha t corresponded to the desired product size were observed, they were extracted and sent for Sanger sequencing (Fig. 4 12). The returned sequence was tick DNA but did not correspond with the desired replication sites. Primers designed to detect the Rdl mu tation in the GABA gated chloride channel in D. melanogaster were effective at replicating the target DNA (Fig. 4 13) and the DNA was sent for Sanger sequencing. The first two products sequenced were from a single wild type and a single Rdl resistant fly. The mutation was not detected in the resistant

PAGE 130

130 strain during the first sequencing attempt. The following two samples that were sequences contain pools of five resistant flies. Three mutations were detected. The first mutation location corresponded to the M2 region that was found in and ffrench Constant et al. (1993) (Fig. 4 14). Analysis using CLC Genomics Workbench 4.9 (CLC bio A QIAGEN company, Cambridge, MA) determined two prominent peaks are presented in the sequencing data, indicating two differ ent base pairs in the populations. One base pair from the pooled sequences was a guanine, which is found in the susceptible strain, while the others was a thymine that confers an amino acid change from an alanine to a serine (A302 S ) The second mutation was in the first base pair of the amino acid sequence and resulted in the replacement of valine with isoleucine (V283I) (Fig. 4 15). The third mutation altered the third base pair in the amino acid sequence, but did not result in an amino acid change (Fig 4 16). Discussion Determining resistance mechanisms is important to help formulate brown dog tick control treatment plans. For example, many, but not all, pyrethroid products are formulated with the synergist PBO. Knowing if cytochrome P450 activity co nfers resistance is, therefore, important to anticipate the effectiveness of the PBO additive. Metabolic resistance mechanisms were found in several of the permethrin resistant and fipronil tolerant brown dog ticks evaluated in this study. Increased este rase, cytochrome P450 and glutathione S transferase metabolic mechanisms evaluated in the current study may be simultaneously up regulated, as has been found to occur in Sarcoptes scabiei (L. ) (Pasay et al. 2009). In several tick strains, two or more mech anisms were present. In the Gilchrist F2 strain, inhibition of all three resistance mechanisms increased mortality at all concentrations of permethrin tested (Fig. 4 2).

PAGE 131

131 Inhibition of both esterase and cytochrome P450 activity increased mortality at all permethrin concentrations in the Broward strain and at 3 and 10% permethrin in the Palm Beach 2 F2 strain. The results demonstrated that in all tested permethrin resistant strains of brown dog ticks cytochrome P450 was implicated as a resistance mechanis m; however susceptibility was not completely restored by the additional of synergists Additional studies should be completed that implement other synergists in order to evaluate other possible isozymes that could be conferring resistance. Pimprikar and Georghiou (1979) found variations in cytochrome P450 inhibition with the use of sesamex versus PBO. Resistant results in this chapter also could indicate other resistance mechanisms are present because the inhibition of one metabolic enzyme seldom restored full acaricide susceptibility Scott and Georgiou (1986) determined that in pyrethroid resistant M. domestica, cytochrome P450 provided 32 fold increase in resistance but the resistance mechanisms that conferred >6,000 fold resistance included a target s ite mutation and reduced cuticular penetration. In that strain of resistant M. domestica, high levels of P450 reductase and cytochrome b 5 were present. The greatest increase in permethrin synergist induced mortality was found in the R. sanguineus bioass ays that included TPP, which inhibits esterase activity. An increase in mortality following the addition of a synergist indicates that the mechanism blocked was conferring resistance. Gel electrophoresis methods also confirmed the presence of increased e sterase activity in the Broward, Gilchrist F2 Palm Beach 2 F2 Sarasota 2, and Webb TX F2 strains. In the synergist screening assays the Webb, TX strain demonstrated the greatest increase in mortality with the inhibition of esterase, but

PAGE 132

132 expressed lower levels of esterase with gel electrophoresis than the other resistant strains in this study. The Collier 2 strain, which was unable to be screened with synergists due to insufficient tick numbers, demonstrated slightly less activity in the top band (Fig 4 9 ); however in previous studies (Chapter 3), presented 20% survival at 10% permethrin. Our assays did not detect esterase activity in the Marion tick strain. However, this tick sample may have been compromised due to tick samples thawing during processin g. Permethrin resistance due to increased esterase activity also was found in various strains of the closely related cattle tick, R. microplus using similar TPP synergist bioassay and gel electrophoresis experiments (Miller et al. 1999). High esterase a ctivity has been demonstrated as the sole source of permethrin resistance in R. microplus (Pruett et al. 2002), but also has been found in conjunction with target site mutations (Rosario Cruz et al. 2009). Increased esterase activity also has been demonst rated to be absent in the presence of high levels of resistance where only target site mutations conferred resistance (Miller et al. 2007b). It is possible that only target site mutations may be present in the Collier 2 tick strain. Mortality for the Webb TX F2 strain was near 100% for all concentrations of permethrin when TPP was added, negating my ability to calculate a synergist ratio and indicating that upregulation of esterase activity was an important mechanism for conferring permethrin resistance. Changes in mortality from the Sarasota 2 strain were not observed at 0.18% permethrin, while the other strains tested demonstrated up to 50% increased mortality at this concentration. These widely divergent results suggest that TPP mechanisms are not wid ely distributed among tick populations. There are no commercially available esterase inhibitors on the market, making field comparisons

PAGE 133

133 impractical. The development of esterase inhibitors would be advantageous for brown dog tick management. In the pres ent study, GST activity was not a major cause of resistance in comparison to cytochrome P450 and esterase activity based upon, the lack of increased mortality when it was inhibited with a synergist. However, in the Gilchrist F2 and Palm Beach 2 F2 permeth rin resistant strains, inhibited GST activity restored some level of susceptibility. Pyrethroid resistance via GST binding, resulting in sequestration has been documented in T. molitor (Kostaropoulos et al. 2001). Sequestration may be occurring in those brown dog tick strains demonstrating increased mortality with GST inhibition. In the Sarasota 2 strain, which was determined to be susceptible to fipronil, the inhibition of GST activity resulted in decreased mortality. Fipronil has been documented to b e metabolized by GST and cytochrome P450 in the western corn rootworm, Diabrotica virgifera virgifera LeConte (Scharf et al. 2000). Three additional fipronil metabolites were detected in GST in vitro metabolic studies that are believed to be the result of dehalogenization. Li et al. (2007) did not find a significant difference in GST levels in fipronil susceptible and resistant strains of Chilo suppressalis Walker, suggesting an alternate fipronil resistance mechanism. It is unclear why a decrease in fip ronil mortality was found in the Sarasota 2 strain when GST activity was inhibited. The increase in mortality in the Broward and Gilchrist F2 could be a result of increased acaricide penetration with the addition of a synergist. In brown dog ticks there was an increase in mortality with the inhibition of cytochrome P450 in permethrin

PAGE 134

134 the Broward and Gilchrist F2 strains a t 0.15% fipronil. Cytochrome P450 synergist inhibition assays resulted in variation between fipronil tolerant and susceptible C. suppressalis (Huang et al. 2010). Tolerant strains demonstrated increased mortality with cytochrome P450 inhibition, while n o difference was demonstrated in the susceptible strain. The exposure to fipronil and PBO decreased susceptible strain mortality, which authors suggested was due to decreased fipronil to fipronil sulfone conversion, whereas the increase in mortality in th e susceptible strain was hypothesized to be related to increased cuticle penetration. More rapid penetration may decrease the time required for efficient detoxification. Sun and Johnson (1972) found evidence of increased cuticular transport of pesticides with the use of certain synergists. In M. domesica organochlorine, organophosphorus, and carbamate susceptibility were evaluated using four synergists in both injection and topical applications. Results determined that Thanite and kerosene increased ca rbamate mortality due to increased penetration. Engorged ticks could be used to conduct injection studies, to evaluate the effects of the synergist penetration. Additional synergist assays with brown dog ticks should be completed using both flat and engo rged ticks to determine if cuticle expansion may impact susceptibility. Fipronil metabolized cytochrome P450 into fipronil sulfone in D. virgifera (Scharf et al. 2000) and in the Eastern corn borer, Ostrinia nubilalis Hbner (Durham et al. 2002). Fiproni l sulfone was documented to have increased toxicity compared to fipronil, indicating cytochrome P450 detoxification is unlikely to play a role in fipronil resistance (Zhao et al. 2005, Fang et al. 2008). The increase in mortality could be the result of th e

PAGE 135

135 toxicity from the original compound and metabolite. However, increased mortality was demonstrated with the addition of all three synergists at 0.15% fipronil, which could suggest dehalogenization or increased cuticle penetration. A decrease in B. germa nica mortality for six strains, including susceptible and resistant strains was documented when fipronil was synergized by PBO and S,S, S tributylphosphorotrithioate (DEF), an esterase inhibitor (Ang et al. 2013). Howev er, Gondhalekar and Scharf (2012 ) fo und that PBO increase d mortality in a fipronil resistant B. germanica strain while decreasing mortality in the susceptible strain. T hese v ariation s indicate the evolution of different resistance mechanism s in independent populations. Tang et al. (2010) suggested that increased GST and esterase activity may be implicated in laboratory selected fipronil resistant strains of the planthopper, Sogatella furcifera ( Horvth) using synergist studies No change in mortality was documented with cytochrome P450 i nhibition synergist assays; however increased P450 levels were detected in the fipronil resistant population with enzyme assays. Although all three metabolic mechanisms were present, it was suggested that they may not be the cause of fipronil resistance a nd that target site mutation studies should be completed (Tang et al. 2010). The physiological mechanisms in S. furcifera that would result in decreased mortality with the presence of the fipronil metabolite, fipronil sulfone, were unclear. My permethrin resistance synergist studies suggest that commercially available treatments such as Sentry Pro Flea & Tick Shampoo for dogs (Sentry Pet Care Products, Inc., Omaha, NE) that is formulated with AI 0.10% permethrin, 0.50% piperonyl butoxide, 0.01% pyriproxyf McLaughlin Gormley King

PAGE 136

136 Company, Minneapolis, MN) label rate 0.5% AI permethrin and PBO, would be ineffective in controlling resistant tick populations. The AI rates of the formulated products fall below the levels required to signif icantly increase mortality in the tested tick strains. Experiments in the present study used 2% PBO with the closest concentration to compare to this product at 0.18% permethrin. Among the tested strains, all except the Webb, TX strain (10%), had <1% mor tality with 0.18% permethrin alone (Figs. 4 1 to 4 5). The addition of PBO increased mortality to levels between 4% and 25%. With these resistant tick strains, Sentry Pro Flea & Tick Shampoo would not be effective at killing many ticks. Comparisons usi ng topical applications of permethrin and PBO to dogs is challenging as the surface area of dogs, including fur, is quite variable. Although many formulations include permethrin concentrations as high as 44%, the volume applied is small and the dispersed concentration becomes smaller on a per cm 2 basis. In addition to metabolic resistance, target site mutations have been found to confer resistance in numerous arthropod species, including R. microplus (Jamroz et al. 2000) The results presented for the PCR work completed in the current study for R. microplus that detected a sodium channel mutation in domain III (S6 subunit) are consistent with Guerrero et al. (2001), who developed the resistance diagnostic method. Susceptible Rhipicephalus microplus positi ve control DNA extracted at the USDA ARS Cattle Fever Tick Research Laboratory, and the resistant R. microplus positive control DNA that was extracted at University of Florida both resulted in faint bands (Fig. 4 11). After gel extraction the DNA concentr ation from the desired band decreased to levels so low that it was undetectable. It is unclear why, with a detectable band, the DNA

PAGE 137

137 extraction process that was designed to concentrate existing DNA was completely unsuccessful. This process was repeated se veral times with up to 50 L of DNA run in each gel well. Regardless of variation, concentrations of DNA were consistently low. The PCR reactions conducted during this project using R. sanguineus were not successfully completed. Several incorrectly sized PCR products were generated and sequenced products that were extracted from bands of the correct size did not correspond with the target sequence. It is unclear why the brown dog tick sodium channel sequences for the two domain II and one domain III site s could not be amplified considering the myriad of protocol alterations that were attempted. The degenerate primers that were designed for the sodium channel based on the I. scapularis, R. microplus, and V. destructor sequences could have been too dissimi lar to the sequences in R. sanguineus. However, this also occurred for the glutamate gated chloride channel, a gene that has been sequenced for R. sanguineus and for that reason was targeted as a positive control. Interestingly, there are two sequences in Genbank labeled as a complete coding sequence for brown dog tick, the first containing 1,907 bp (GQ215234.1) and the second containing 2,400 bp (GP441809.1), however, these sequences do not align. Sequence GQ215235.1 has almost no similarity with any s equences, with the highest match at 2% in I. scapularis (Altschul et al. 1990). Sequence GP441809.1 had 40% alignment with R. microplus and 48% alignment with I. scapularis Primers designed from both sequences did not produce products at the targeted pr oduct size. The lack of alignment demonstrated with the glutamate gated chloride channel could have been the reason there was a lack of amplification with degenerate base

PAGE 138

138 pairs, even though they were designed around highly conserved regions. Attempts to optimize the PCR conditions included utilizing temperature variations, two different types of master mix, different concentrations of DNA (10, 20, 50, 100, 150 ng/ L), various primer concentrations (10 pmole a nd 100 pmole), and combinations of different amplification cycles, all of which did not result in site specific amplification. Interestingly, the DNA extraction method provided positive results for R. microplus and PCR amplification did occur for 33 of 41 primer sets with either extractio n method, but not in the correct region. Lack of amplification is not thought to be a result of improper extraction methods but it could be a factor. The detection of the Rdl mutation in D. melanogaster yielded the same results published in ffrench Cons tant et al. (1993). The mutation was not uniformly found in the resistant population The amino acid from the susceptible strain also was detected. The lack of current insecticide selective pressure may have resulted in the survival of both genotypes in the laboratory colony. In future studies, PCR could be used to rapidly detect multiple point mutations, as has been done with R. microplus A multiplex PCR was developed by Lovis et al. (2012) to simultaneously evaluate the known sodium channel point mu tations in R. microplus There are two mutations in Domain II and one in Domain III. Tick strains from Brazil, Argentina, South Africa, Mexico, and Australia were tested to evaluate the presence of resistance (Lovis et al. 2012). The resistant ticks fro m Mexico were found to have the sodium channel target site mutation located in Domain III on S6 segment which was not found outside of Mexican populations The S6 mutation was linked to high er resistance levels in comparison to ticks with the two Domain II mutations. The

PAGE 139

139 L641 Domain II mutation, originally found in Australia, was not found in the Mexican strains but was present in resistant populations collected from Brazil, Argentina, and South Africa. The G72V Domain II mutation was only found in res istant ticks from Australia (Lovis et al. 2012). Molecular technique should be designed for rapid resistance detection assays. A high throughput Rdl mutation selection assay was developed for Ctenocephalides felis (Bouch ) (Dabo rn et al. 2004). A PCR Res triction Endonuclease analysis p roduced different products sizes that were used to differentiate between g enotypes and a TaqMan diagnostic assay was designed to distinguish between genotypes with fluorescent dye Both techniques discriminate d between resi stant, susceptible and heterogeneous populations (Daborn et al. 2004). In order to successfully complete molecular research, improved methods of DNA extraction should be evaluated. Studies have evaluated extraction methods where the Qiamp DNA extracti on kit resulted in 77% of the samples being successfully amplified (Halos et al. 2004). With the use of a steel micro bead shaker to crush ticks, 100% of the samples provided positive amplification; however, this was not used for this study because produc ing product was not the greatest challenge, but it could become more important in further research. Ixodid DNA has been found to be vulnerable to degradation (Hill and Gutierrez 2003). The target genes from this study may be susceptible to degradation and their deterioration during DNA extraction could have caused the lack of amplification. Studies are needed to determine the causes of rapid degradation in order to develop improved extraction methods.

PAGE 140

140 Understanding acaricide resistance mechanisms is cri tical for successful tick management. Increased cytochrome P450 activity can be mitigated with synergists; however, as demonstrated in this study, esterase activity was more prominent for conferring permethrin resistance. It is unclear what provided incr eased tolerance to fipronil, as the synergists did not greatly increase mortality. Esterase was found to inefficiently hydrolyze organophosphates and carbamates, but pesticide sequestration conferred resistance in M. persicae (Devonshire and Moores 1982). Acaricide sequestration may be occurring in brown dog ticks, as the inhibition of esterase activity restored some level of susceptibility to fipronil in the Broward and Gilchrist F2 strains as well as all strains permethrin resistant strains. Additional ly, the evaluated synergists have been used for metabolic resistance evaluation in R. microplus for several years, but cuticular penetration has not been studied. In order for a synergist to block metabolic activity it must successfully penetrate the cuti cle. Future studies also should include a 24 hour synergist exposure period prior to acaricide application in order to determine if mortality is increased. Synergists may aid in increased the penetration of the acaricide. High dose selection for fipron il resistance would improve our understanding of the effect of synergists, as metabolic activity may increase along with the resistance level. Populations of ticks that demonstrate high levels of metabolic activity should be challenged with additional aca ricides in the laboratory to determine if enzymatic activity confers cross resistance. Control methods must be considered when increased detoxification confers resistance. Ticks with high esterase activity that has been induced by contact with permethrin may be able to metabolize other acaricides with

PAGE 141

141 ester linkage, including other pyrethroids and organophosphates (Yu 2008). Increased metabolic activity can confer resistance to acaricides that have different target sites but contain with structures in wh ich are able to be detoxified by increased metabolic activity. Increased cytochrome P450 activity in D. melagaster has been found to confer resistance to DDT, neonicotinoids, and insect growth regulators (Daborn et al. 2007). Information that identifies how best to rotate chemicals to delay resistance should be readily available to pest management professionals, so that selection of further resistance is delayed.

PAGE 142

142 Table 4 1. Evaluation of synergists with permethrin or fipronil conducted on Rhipicephalu s sanguineus (Latreille) larvae collected from four Florida and one Texas county, using the larval packet test method. Tick strain Treatment Number t ested (r eplicates) LC 50 (95% CI) a SR 50 b,c Slope (SEM) 2 (df) Broward Permethrin d 1,945 (28) ND C P ermethrin +TPP 1,641 (24) 0.229 (0.178 0.274) 3.88 (0.25 ) 87 (18) Gilchrist F1 Fipronil 2,408 (24) 0.054 (0.047 0.063) 3.56 (27.03) 158 (22) Fipronil+DEM 2,655 (32) 0.094 (0.089 0.099) 0.57 10.78 (0.69 ) 50 (26) Palm Beach 2 F2 Permethrin d 2,346 (32) ND C Permethrin +PBO 2,576 (27) 0.900 (0.796 1.021) 1.73 (0.06 ) 43 (22) Sarasota 2 Permethrin d 2,419 (32) ND C Permethrin +TPP 2,579 (32) 0.172 (0.150 0.193) 3.67 (0.22 ) 55 (26) Webb, TX F 2 Permethrin 3,221 (36) 0.833 (0.759 0.908) 2.58 (0.20 ) 32 (30) Permethrin +TPP 1,522 (21) ND C Permethrin +PBO 1,596 (21) 0.230 (0.198 0.266) 6.6 0 2.38 (0.14 ) 42 (16) a Values represent percentage of active ingredient (w/v) applied to treated filter papers 7.5 x 8.5 cm b Synergist ratios (S R) at LC 50 were calculated by dividing the LC 50 or the not synergist assay by the synergist assay c Data did not follow Probit model, but marked changes in mortality were observed d ND: Lethal concentration could not be determined due to low mortality at h igh concentrations e Unable to calculate with the Probit model due to high levels of heterogeneity

PAGE 143

143 Figure 4 1. Broward strain of larval Rhipicephalus sanguineus (Latreille) tested with 2% synergists added at a constant rate to varied concentrations of permethrin in a F ood and A griculture O rganization larval packet test to determine synergist effect on mortality. Controls were treated with trichloroethylene and olive oil alone and then combined with each synergist without the acaricide. 0 10 20 30 40 50 60 70 80 90 100 Control 0.18 0.9 3 % Mortality Permethrin Concentration Permethrin Permethrin and Triphenyl Phosphate Permethrin and Piperonyl Butoxide Permethin and Diethyl Maleate

PAGE 144

144 Figure 4 2 Gilchrist F2 strain of larval Rhipicephalus sanguineus (Latreille) tested with 2% synergists added at a constant rate to varied concentrations of permethrin in a F ood and A griculture O rganization larval packet test to determine synergist effect on m or t ality. Controls were treated with trichloroethylene and olive oil alone and then combined with each synergist without the acaricide. 0 10 20 30 40 50 60 70 80 90 100 Control 0.18 0.9 3 10 % Mortality Permethrin Concentration Permethrin Permethrin and Triphenyl Phosphate Permethrin and Piperonyl Butoxide Permethin and Diethyl Maleate

PAGE 145

145 Figure 4 3 Palm Beach 2 F2 strain of larval Rhipicephalus sanguineus (Latreille) tested with 2% synergists add ed at a constant rate to varied concentrations of permethrin in a F ood and A griculture O rganization larval packet test to determine synergist effect on mor t ality. Controls were treated with trichloroethylene and olive oil alone and then combined with each synergist without the acaricide. 0 10 20 30 40 50 60 70 80 90 100 Control 0.18 0.9 3 10 % Mortality Permethrin Concentration Permethrin Permethrin and Triphenyl Phosphate Permethrin and Piperonyl Butoxide Permethin and Diethyl Maleate

PAGE 146

146 Figure 4 4 Sarasota 2 strain of larval Rhipicephalus sanguineus (Latreille) tested with 2% synergists added at a constant rate to varied concentrations of permethrin in a F ood and A griculture O rganization larval p acket test to determine synergist effect on mor t ality. Controls were treated with trichloroethylene and olive oil alone and then combined with each synergist without the acaricide. 0 10 20 30 40 50 60 70 80 90 100 Control 0.18 0.9 3 % Mortality Permethrin Concentration Permethrin Permethrin and Triphenyl Phosphate Permethrin and Piperonyl Butoxide Permethin and Diethyl Maleate

PAGE 147

147 Figure 4 5. Tick mortality responses for the Gilchrist, FL F2 and W ebb, TX F2 Rhipicephalus sanguineus (Latreille) strains tested using the F ood and A griculture O rganization larval packet test evaluating permethrin alone or in combination with 2% triphenyl phosphate (TPP) or 2% piperonyl butoxide (PBO). 0 10 20 30 40 50 60 70 80 90 100 % Mortality Gilchrist F2 Webb, TX F2

PAGE 148

148 Figure 4 6 Broward strain of larval Rhipicephalus sanguineus (Latreille) tested with 2% synergists added at a constant rate to var ied c oncentrations of fipronil in a F ood and A griculture O rganization larval packet test to determine synergist effect on mor t ality. Con trols were treated with trichloroethylene and olive oil alone and then combined with each synergist without the acaricide. 0 10 20 30 40 50 60 70 80 90 100 Control 0.04 0.07 0.15 0.3 % Mortality Fipronil Concentration Fipronil Fipronil and Triphenyl Phosphate Fipronil and Piperonyl Butoxide Fipronil and Diethyl Maleate

PAGE 149

149 Figure 4 7 Gilchrist F2 strain of larval Rhipicephalus sanguineus (Latreille) tested with 2% synergists added at a constant rate to var ied con centrations of fipronil in a F ood and A griculture O rganization larval packet test to determine synergist effect on mor t ality. Controls were treated with trichloroethylene and olive oil alone and then combined with each synergist without the acaricide. 0 10 20 30 40 50 60 70 80 90 100 Control 0.03 0.07 0.15 0.3 % Mortality Fipronil Concentration Fipronil Fipronil and Triphenyl Phosphate Fipronil and Piperonyl Butoxide Fipronil and Diethyl Maleate

PAGE 150

150 Figure 4 8 Sarasota 2 strain of larval Rhipicephalus sanguineus (Latreille) tested with 2% synergists added at a constant rate to var ied con centrations of fipronil in a F ood and A griculture O rganization larval packet test to determi ne synergist effect on mor t ality. Controls were treated with trichloroethylene and olive oil alone and then combined with each synergist without the acaricide. 0 10 20 30 40 50 60 70 80 90 100 Control 0.03 0.07 0.15 0.3 % Mortality Fipronil Concentration Fipronil Fipronil and Triphenyl Phosphate Fipronil and Piperonyl Butoxide Fipronil and Diethyl Maleate

PAGE 151

151 Figure 4 9. naphtyl acetate activity, esterase staining gel comparing esterase activit y of a Rhipicephalus sanguineus (Latreille) susceptible and resistant strain (Collier 2). Two areas of increase activity are found in the resistant strain. Gel electrophoresis esterase staining comparing esterase bands in the susceptible versus the Colli er 2 permethrin resistant strain. Photo courtesy of Amanda L. Eiden.

PAGE 152

152 Figure 4 10. Eight permethrin resistant Rhipicephalus sanguineus (Latreille) strains and the permethrin susceptible R. sanguineus strain evaluated for esterase activity using an es terase staining gel to demonstrating activity to naphthyl acetate in R. sanguineus A) Esterase activity is inhibited by the addition of triphenyl phosphate where bands are light. B) Esterase activity is detected by indication of thick bands. Photo co urtesy of Amanda L. Eiden.

PAGE 153

153 Figure 4 11. Polymerase chain reaction assay to detect a point mutations in the sodium channel S6 transmembrane segment of domain III comparing two strains of Rhipicephalus microplus ( Canestrini ) Letters on the bottom r ow indicate genotype: susceptible (S), resistant (R), or both (B). Lanes 2 6 from the left were run with product of a single DNA extraction from a susceptible tick and lanes 7 11 were run with product of a single DNA extraction from a resistant tick. Lan es labeled S used primers that amplify DNA when a tick lacks a target site mutation that confers resistance to permethrin. Lanes labeled R used primers that amplify DNA in ticks that have the mutation present. Letter B was used for the two lanes that con tained amplification products that used primers that amplify the entire target site and should be present regardless of resistance status. The 100 bp plus ladder was used. Photo courtesy of Amanda L. Eiden.

PAGE 154

154 Figure 4 12. Cloned sequences of three a mplification sites in the sodium channel gene from Rhipicephalus sanguineus (Latreille) The product in lane three did not replicate well and is barely detectable. The remaining two bands had sufficient amplification, however, Sanger sequencing did not r eveal amplification at the desired site. The 1 kb plus ladder was used. Photo courtesy of Amanda L. Eiden.

PAGE 155

155 Figure 4 13. Amplification of the Rdl GABA receptor subunit in the chloride channel for Drosophila melanogaster Meigen. Desired product si ze was 268 base pairs. This product was sent for Sanger sequencing. The 100 bp plus ladder was used. Photo courtesy of Amanda L. Eiden.

PAGE 156

156 Figure 4 14. Sanger sequence of the Rdl GABA receptor subunit in the chloride channel for Drosophila melanogast er Meigen. The top row is the DNA susceptible or wild type sequence. The following rows contain the sequence for two groups of five pooled flies. The top line in each row contains the nucleic acid present and the bottom row indicated the amino acid. Th is graph shows a site mutation that was found to conflict between the susceptible and resistant strain that resulted in an amino acid change. Par t of the population has the same amino acid as the susceptible strain while some of the population the alaline was substituted by serine (A302S)

PAGE 157

157 Figure 4 15. Sanger sequence of the Rdl GABA receptor subunit in the chloride channel for Drosophila melanogaster Meigen. The top row is the DNA susceptible or wild type sequence. The following rows contain the s equence for two groups of five pooled flies. The top line in each row contains the nucleic acid present and the bottom row indicated the amino acid. This graph shows a site mutation that was found to conflict between the susceptible and resistant strain that resulted in an amino acid change from a valine to isoleucine (V283I)

PAGE 158

158 Figure 4 1 6 Sanger sequence of the Rdl GABA receptor subunit in the chloride channel for Drosophila melanogaster Meigen. The top row is the DNA susceptible or wild type se quence. The following rows contain the sequence for two groups of five pooled flies. The top line in each row contains the nucleic acid present and the bottom row indicated the amino acid. This graph shows a site mutation that was found to conflict betw een the susceptible and resistant strain that did not result in an amino acid change

PAGE 159

159 CHAPTER 5 IMPLICATIONS AND FUT URE DIRECTIONS FOR RHIPICEPHALUS SANGUI NEUS (LATREILLE) CONTROL AND RESEARCH Rhipicephalus sanguineus (Latreille), the brown dog tick, i s found worldwide as a veterinary pest that also inhabits and infests indoor areas (Demma et al. 2005). Chemical control methods are heavily relied up on to control brown dog ticks. Reports of control failures directed this research to determine if resist ance was occurring in tick popu lations across Florida. In order to confirm field reports of resistance tick samples were requested from any resident or dog kennel that contacted our program Typically, when tick samples are submitted, ticks must be rear ed on a mammal prior to resistance determination, a costly and time consuming process. As such, rapid resistance diagnostic methods needed to be developed to determine the presence of resistance in order to help guide control recommendations. For several types of pesticide resistance, if mechanisms conferring resistance can be determined, it is possible to restore some efficacy of the acaricide using synergists. For this reason, it is important to understand the mechanisms developed by ticks to survive a caricide exposure. In this study, permethrin resistant populations were documented in several locations across Florida and in one Texas site. However, only tolerance to fipronil was found in these tick populations. Prior to this study, the only published case of resistance in the brown dog tick was found in Panama (Miller et al. 2001). After determining the presence of resistance, the discriminating concentration was set for permethrin and fipronil. Characterization of these concentrations will be used for rapid and inexpensive resistance screening. Understanding prevalence of resistant populations is important, as it can be used to direct control purposes. Permethrin, a pyrethroid, is a commonly used acaricide for tick control on dogs as an

PAGE 160

160 on animal application as well used to treat tick habitat s In addition to permethrin, sev eral other pyrethroids, such as bifenthrin, sumithrin, and esfenvalerate, are used in dog tick control. Although they have different chemical structures, all are pyrethroids that act on the sodium channel ( Narahashi 1986, Bloomquist 1996). Target site mutations are a resistance mechanism that changes the molecule binding site and can render all pyrethroids ineffective, due to a common mode of action (Byford et al. 1985). Fi pronil also is used widely as an on animal treatment, but does not have a label that allows for indoor applications Some of the tick submitting homeowners experiencing brown dog tick infestations claimed that using fipronil on animal treatments, per manu factures label, were ineffective in controlling ticks on their dog. However, upon laboratory testing in this study, these tick populations demonstrated only tolerance or susceptibility. Fipronil tolerance, which was defined in this study as a resistance ratio (RR 50 ) < 10, was documented in the populations of ticks that were tested in this study. One of the fipronil susceptible populations was collected from a home that claimed to have been using monthly fipronil spot on treatments during the previous year The result that this cohort was susceptible to fipronil, despite being exposed per a year to on animal spot on treatments, may reflect the difference in use patterns between products that do not allow for indoor applications with those that do. In comp arison permethrin products, which have had broad indoor, outdoor and on animal label site applications for decades brown dog tick exposure has been considerably greater than fipronil given that the ticks spend greater than 90% of their life off the host (N eedham and Teel 1991)

PAGE 161

161 The technical grade acaricides that were evaluated and presented in this dissertation were based on the most frequently used active ingredients sold in veterinary formulations. In future studies, experiments utilizing commercial pro ducts could address differences in acaricides formulated for on animal use versus technical grade active ingredients. Testing commercial formulations can pose some challenges, s uch as achieving high concentrations to obtain a dose response curve, developi ng a proper control treatment because many products contain proprietary ingredients, and standardizing testing methods to account for the variation in the product components. Future studies should focus on the evaluation of additional acaricides, particul arly new chemistries. It would be important in order to gather baseline data on susceptibility and resistance potential prior to broad spectrum use. One such acaricide, amitraz, is marketed in multiple veterinary use products including Certifect (Merial Duluth, GA), a spot on animal treatment, and in the tick collar, Preventic (Virbac, Carros, France). Amitraz resistance has been demonstrated in Rhipicephalus microplus (Canestrini) (Li et al. 2004); therefore, it is possible amitraz resistance could b e selected for in the closely related brown dog ticks. Amitraz is an example of one acaricide that was challenging to test using the standard the larval packet test and required modifications from paper to nylon substrates and the use of formulated rather than technical grade acaricide Miller et al. (2002) modified the larval packet test to evaluate R. microplus resistance to amitraz because the standardized method was unable to discriminate between the susceptible or resistant ticks because high variabi lity. It was suggested that the nonporous nylon surface and stabilized amitraz improved the bioassay outcome.

PAGE 162

162 Additionally, evaluations of other pyrethroids against permethrin resistant R. sanguineus populations should be done to determine levels of resis tance for active ingredients other than permethrin. Rhipicephalus microplus was tested for resistance to flumethrin, deltamethrin, and cypermethrin susceptibility, which are synthetic pyrethroids commonly used for tick control on cattle (Rosario Cruz et a l. 2009). Out of 28 tested populations, researchers reported that one half of the populations were resistant to all three pyrethroids, however, resistance to one chemical did not guarantee resistance to all three chemicals (Rosario Cruz et al. 2009). The different chemical structures could result in the resistance variation. This is important to understand because of the wide range of pyrethroids used for residential treatment. Brown dog ticks spend only around 5% of their time on the host (Needham and Teel 1991); therefore greater exposure comes from pest control treatments to the environment and products other than permethrin may have been used. The high levels of permethrin resistance that were documented in this study could be related to a combinat ion of pyrethroid exposure from on animal treatments and environmental pest control applications. Evaluation of products formulated into shampoos and acaricidal on animal sprays could use adult and larval immersion tests. Permethrin is formulated into on animal sprays, spot on topicals, dips, and shampoos. For example, Sentry Pro Flea & Tick Shampoo (Sentry Pet Care Products, Inc., Omaha, NE) contains 0.10% permethrin. After the shampoo is diluted in water, it would be interesting to determine efficacy against susceptible and tolerant tick populations and then compare permethrin shampoo to the detergent alone. Alternatively, some kennels have a protocol based on anecdotal evidence, that shampooing dogs with detergent alone kill ticks. Studies

PAGE 163

163 should b e conducted to measure the efficacy of permethrin based shampoos after they have been diluted in water. The residents and facilities that tick populations were collected from often were unsure of their infestation source. P ioneer ticks were either alrea dy under resistance selection pressure, or selection could have occurred at the collection site. Each home can serve as a different tick population, as ticks remain relatively isolated due to limited mobility. The lack of migration and immigration can le ad to increased selection pressure for each population of ticks. There are no currently published brown dog tick research papers that evaluated the rate at which resistance evolves or how high resistance levels can reach with different resistance mechanis ms. As reviewed by Scott (199 0 ), resistance mechanisms include increased metabolic activity leading to detoxification, target site mutations, or reduced cuticular penetration. In addition to these mechanisms, behavioral resistance also has been documente d, in which the arthropod avoids pesticide exposure. For example, Blattella germanica (L.) has demonstrated behavioral resistance by avoiding insecticide baited traps (Silverman and Bieman 1993, Wang et al. 2004). Obtaining the complete genomic sequence o f the brown dog tick will aid in evaluating resistance mechanisms. During this project, several attempts to evaluate genetic mutations in the sodium and chloride channels that confer permethrin and fipronil resistance, respectively, were unsuccessful. In this study, the genetic sequences of Ixodes scapularis (Say) and R. microplus were used as proxies, but proved to be too dissimilar to the brown dog tick sequence to yield positive results.

PAGE 164

164 After sequencing, genetic variations between resistant and susc eptible ticks could be compared to identify sites that confer resistance. Upon determining resistance sites, a polymerase chain reaction (PCR) method could be constructed to differentiate susceptible and resistant genotypes similar to studies with R. micr oplus (Lovis et al. 2012). There have been three confirmed mutations in the sodium channel that confer pyrethroid resistance in R. microplus (He et al. 1999 c Morgan et al. 2009, Jonsson et al. 2010). These three mutation sites can be evaluated using one multiplex PCR (Lovis et al. 201 2 Results of these studies documented that the three mutations conferring resistance occurred in ticks from different regions of the world. Resistant populations of R. microplus that were screened from North America were unique in having a mutation in Domain III. Whereas, the L641 Domain II mutation was found in resistant populations collected from Brazil, Australia, Argentina, and South Africa. A third mutation site, G72V in Domain II, was found to confer pyrethroid res istance only in one Australian population (Lovis et al. 2012). In brown dog ticks, several mutations may be present but their distribution could vary worldwide. In addition to the molecular work that was completed to evaluate esterase activity in Chapter 4, cytochrome P450 levels could be estimated by using quantitative PCR methods. In permethrin resistant Helicoverpa armigera (Hbner), the Australian cotton bollworm, one out of eight cytochrome P450 genes was found to have double expression levels compa red to the susceptible strain (Pittendrigh et al. 1997). Increased levels of cytochrome P450 transcription also were found in DDT resistant Drosophila melanogaster Meigen using quantitative PCR methods (Daborn et al. 2002).

PAGE 165

165 Cuticular penetration experim ents might determine changes in structure that lead to increased levels of resistance. In H. armigera a delay in cuticular penetration of deltamethrin conferred resistance (Ahmad et al. 2006). Increased concentrations of protein and lipids in the cuticl e have been correlated with reduced DDT penetration in Heliothis virescens (F.) (Vinson and Law 1971). In addition to understanding physiological mechanisms of the brown dog tick, knowledge on ecology can be important for their management. Population dyn amics, such as annual reproduction cycles and population fluctuations, can be helpful for implementing control measures and determining how many developmental stages ticks will pass through annually. Areas that have high populations all year will require co ntinued monitoring There was a slight peak in calls and ticks submissions from community stakeholders between April to June and a lower rate of contacts from November to March. A seasonality study conducted to improve our understanding of brown dog ti ck population dynamics in Florida is needed. A study conducted on outdoor dogs at homes in rural and suburban areas by Koch (1982) in Oklahoma and Arkansas determined brown dog tick population peaks for different life stages, with larvae and nymphs peaki ng in July and September and adult populations peaking in April, July, and September. No ticks were found in Oklahoma during December. The study area covered large portions of Oklahoma and Arkansas, with variations in temperature and rainfall. Comparat ively, brown dog tick populations were collected from dogs that were brought to veterinary facilities in Cuernavaca City, Mexico (Cruz Vazquez and Garcia Vazquez 1999). Adult populations peaked from December to February and again in

PAGE 166

166 May to September. The highest numbers of nymphs were collected from March to July and again in November, which was slightly different than larvae, which peaked in March, June and October (Cruz Va z quez and Garcia Vazquez 1999). The average year round daily average temperatures ranged from 18 C in January to 23 C in May. August experienced the highest levels of rainfall with around 260 mm while December received around 5 mm of rain. In Mexico, population fluctuations were attributed more to rainfall than temperature, with high er populations collected during the wet season (Cruz Vazquez and Garcia Vazquez 1999). However, in Belo Horizonte, Brazil, the dry season was associated with higher brown dog tick infestation rates (Silveira et al. 2009). Florida has a wet and dry season and climate variation from temperate in the north to subtropical in the south. These factors most certainly impact brown dog tick life cycles, and should be studied to understand population dynamics. Because brown dog ticks can inhabit indoor and outdo or regions, populations can be maintained during less optimal climate conditions. It is important to understand the impact of the indoor life cycle in maintaining populations during cooler and dry conditions. Many people experiencing brown dog tick contr ol problems are unaware of the residents are often unaware that brown dog ticks are more likely to be introduced after exposure to kennel facilities, veterinarians, g roomers, or other dogs, rather than exposure in the outdoor environm ent. Animals should be inspected for ticks to prevent introduction into homes after they are exposed to areas where multiple dogs are present. A few of the homeowners that contacted the University of Florida for tick control advice denied that the ticks were residing indoors and repeatedly treated

PAGE 167

167 outdoor areas, despite R. sanguineus being positively identified. Suggested monitoring methods, such as lining doors with duct tape so homeown ers can help identify the location of pockets of congregating ticks and lead to focused eradication control efforts in the home, were explained to residents with many using this technique to protect dogs held in indoor crates. Rotating the acaricides use d for tick control can minimize resistance selection. This is particularly difficult for pet owners because spot on treatments are typically veterinarian prescribed and come packaged with sufficient applications for six months. The production of multi ch emical products might increase the longevity of currently approved compounds if they have different modes of action (Curtis 1985). Although superficially, it appears that several products used for veterinary control currentl y have multiple ingredients, ty pically only one active ingredient provides protection against ticks. As demonstrated in Chapter 4, synergists could increase product efficacy, especially with the inhibition of esterase activity. However, there are currently no esterase inhibitors appro ved for sale or use of dogs. If chemical companies work towards esterase inhibitor development that is approved for commercial use, synergized permethrin may be used to effectively control residential tick populations again. Challenges with adding synerg ists to pesticides include cost effectiveness, product registration, and producing a functional formulation that is stable (Raffa and Priester 1985). Additionally, the use of synergists must not cause increased risks to humans, companion animals, wildlife or the environment. Using cultural controls, such as steam cleaning, washing dog beds, and physical removal of ticks can help reduce tick burdens. Developing updated brown dog tick

PAGE 168

168 protocols for pest control operators to incorporate treating resistant populations can aid in reducing the duration of tick infestations. Homeowners receiving pest control treatment have claimed treatments were ineffective for tick control In order to decrease the burden of brown dog tick infestations and prolong the effe ctiveness of market acaricides, integrated pest management education must be provided by pest control operators and extension agents for home owners and kennel facilities. As a result of this research educational information has been shared with the commun ity. We have provided consultations for clientele that contacted the University of Florida and educational materials have been made available for brown dog tick control: https://pmu.ifas .ufl.edu/ In addition to using acaricides treatments, homeowners and kennel owners need to be responsible for preventing and controlling infestations. Diligent inspections for ticks, using steam cleaning, washing fabrics that may be harboring ticks, an d using the appropriate acaricidal treatment can help eliminate tick populations and prevent the development of resistance.

PAGE 169

169 APPENDIX A TICK STRAIN COLLECTION AND HISTORY Table A 1. Colony history of susceptible Rhipicephalus sanguineus (Latreille) obta ined from Ecto Services, INC, North Carolina. Source Date Introduced Professional Laboratory and Research Service March 2008 Professional Laboratory and Research Service November 2008 Professional Laboratory and Research Service October 2009 Profession al Laboratory and Research Service May 2010 Center for Disease Control April 2011 Sierra Research Labs November 2011

PAGE 170

170 Table A 2. Acaricide treatment history of brown dog ticks submitted to the University of Florida for acaricide resistance evaluatio n. Strain Submission d ate Animal t reatment Indoor t reatment Ticks s ubmitted Notes Broward 5/9/2012 Sporadic Advantix use during summer months. No treatment used 8 months prior to submission. None 226 engorged nymphs Five dogs Charlotte 10/19/2010 Advant ix : 3 years with monthly treatments Preventic collar 3 times None >20 engorged females Three dogs. Finding engorged females and larvae. Gained control with and professional pest control Collier 1 6/24/2011 Frontline for 1 year with monthly treatments None 17 engorged females 8 flat adult females 12 flat adult males Collier 2 2 /13/2012 None prior to collection None 12 adult flat females 14 adult flat males Yard was treated with unknown pesticide. Developed infestation 3 6 months before collecting ticks

PAGE 171

171 Table A 2. Continued Strain Submission Date Animal Treatment Indoor Trea tment Ticks Submitted Notes Duval 10/13/2010 Cedar oil Permethrin fogger, diatomaceous earth 70 engorged females >50 flat adult females and males 30 dogs Gilchrist 8/9/2011 Inconsistent history of spot on treatments containing permethrin and fipronil. Poor records kept, inconsistent use Was not conducting proper follow up treatments but pyrethroids had been used 68 engorged females 167 flat adults 19 dogs Marion 10/26/2010 Monthly Advantix for 3 years Frontline spray Hi yield garden spray (Volunta ry Purchasing Groups, Inc) (bifenthrin) not approved for use on companion animals Talstar bifenthrin, Cynoff Demon Suspend permethrin, Orthene 35 engorged females 5 to 10 engorged ticks a day in the house 10 to 50 ticks a day from the dog Palm B each 1 11/10/2010 Unknown Precor 2000 (permethrin / PBO) 41 engorged females Palm Beach 2 6/9/2011 History of Frontline Plus use. Unknown treatment regimen Collected 10 days post treatment with Onslaught 16 engorged females 136 flat adults 3 dogs

PAGE 172

172 Table A 2. Continued. Strain Submission Date Animal Treatment Indoor Treatment Ticks Submitted Notes Palm Beach 3 2/21/2012 Unknown Unknown 18 adult flat females 13 adult flat males Palm Beach 5 9/15/2010 Frontline Plus, Revolution, Advantix all u sed at different times during 3 years Preventic 3 y ea rs Unknown >15 engorged adult females 5 year problem 1 Dog Sarasota 1 6/19/2012 Frontline for 1 year Inside, Suspend (deltamethrin), Demand (lambda cyhalothrin), DeltaD ust boric acid, D iatomaceou s earth, unspecified insect growth regulators Onslaught Outside: Tempo ( cyfluthrin), Talstar (bifenth r in) 23 engorged females Adopted a dog from an animal shelter and notices the ticks afterwards

PAGE 173

173 Table A 2. Continued Strain Submission Date Anim al Treatment Indoor Treatment Ticks Submitted Notes Sarasota 2 4/3/2013 Advantix C ertifect and Frontine use history. Other source of permethrin use such as on animal sprays. Frontline used several years from 2010 2012 and on and off previous to tha t. Advantix : intermittent over the years. Permethrin fogs and history of self treating with professional grade treatment but did not recall products 32 engorged females 10 year infestation St. Johns 9/12/2011 Advantix for 5 years with monthly treatments Deltamethrin Kicker Precor 79 engorged females 44 adult flat males 36 adult flat females 4 nymphs Kennel facility. Noticed infestation 1.5 months before collection Webb, TX 3/25/2011 Prolate/Lintox HD ip. Not approved for use on companio n animals. Unknown >50 flat adults >40 engorged females Kennel facility

PAGE 174

174 APPENDIX B INSTITUTIONAL ANIMAL CARE AND USE COMMITT EE DOCUMENTS

PAGE 175

175

PAGE 176

176 APPENDIX C TICK REARING INSTRUCTIONS Tick Cage C onstruction In order to contain the brown dog ticks and mon itor tick attachment while on the host, a tick feeding cage was constructed that was adhered to the rabbit (Lysyk and Majak 2003). The cage was constructed by modifying the bottom portion of a screw topped plastic container (120 mL) with a diameter of 6 c m. To improve the fit of the container on the rabbit, curves were formed into the bottom of the container. The edges were then smoothed with sand paper (Fig. B 1). To create an area for secure attachment, two 13 x 13 cm squares of fiberglass mesh window screening were cut. The first piece of screen was cut into a circle resulting in a diameter that was 3.5 cm wider than the outside diameter of the plastic cage while leaving ~ 1 cm of overlap on the inside. The screen was secured to the bottom of the pl astic container using a hot melt glue gun. The second piece of mesh was cut into two semi circular pieces 13 x 6 cm ( Fig. B 2 ). These pieces were cut in this manner to form a downward curve in the screen that created a more curved fit for attachment to t he rabbit, as opposed to a flat screen surface. After the screen was secured, contact cement was applied to the mesh using a foam brush, until no open holes were visible between the two layers. The glued cages were left to dry overnight (Fig. B 3). In order to provide ventilation to the tick feeding cage, the cage lids were modified by cutting a 1.5 cm diameter hole in the lid using a cork borer that was heated over a Bunsen burner. A 2 x 2 cm piece of brass 80 woven wire mesh (Paragona Indianapolis IN) was used to cover the hole in the lid and was secured into place by

PAGE 177

177 melting screen into the plastic container lid creating a secure seal (Lysyk and Majak 2003) (Fig. B 4). PARAFILM (Sigma Saint Louis, MO) was pulled around the lid of the lid duri ng larval feeding as an extra precautionary measure (Fig. B 5). Tick H ost P reparation All life stages of brown dog ticks were collected at or accepted from residential homes or dog kenneling facilities. Tick strains from each location were held and reared as separate colonies only if 20 or more viable adults, with at least 10 females, were obtained. Tick rearing was conducted at the University of Florida. Ticks were placed into glass vial containers that were secured with cotton placed into the top. Tick s were held at 25 1C, with a photoperiod of 12:12 (L:D). Relative humidity was maintained through one of two methods. Either a saturated solution of potassium nitrate salt (ScienceLab, Inc, Houston, TX) and distilled water placed in glass holding cham bers that maintained 92% RH (Winston and Bates 1960) or ticks were held in a sealed chamber (Dry Parmer, Vernon Hills, IL) with containers of distilled water at 85% RH. Each active, brown dog tick life stage was fed on a ~4 kg New Zealand Whi te rabbit to obtain a blood meal (UF IACU C Protocol 200802142, 201102142 Appendix B ). In preparation of cage attachment, rabbits were anesthetized using isoflurane and their eyes were coated with petrolatum ophthalmic ointment (Puralube Vet Ointment, Ove rland Park, KS) to prevent them from drying out. A circular area of approximately 6 abdominal region between the front and hind legs. After the fur was removed with a vacuu m, an outline of the cage was drawn on the rabbit using a light colored non toxic

PAGE 178

178 marker, such as a highlighter or Sharpie in order to outline the location to place the adhesive used for attaching the cage. The tick cages were attached to the rabbit us ing Helmiprene contact cement (Helmitin, Toronto, Ontario) that was applied with a foam brush. To ensure a tight seal, the cement was applied to both the tick feeding cage and the area on the rabbit where the cage was designated to be secured. For the ra bbits comfort, a hairdryer was used on the cool heat setting to shorten contact cement drying time and limit the amount of time that the rabbit spent under anesthesia. Cotton balls were dabbed on the inside of the tick feeding chamber to remove excess con tact cement and to prevent ticks from getting caught in the adhesive. After the contact cement dried, ticks were placed into the tick feeding cage for up to two weeks, where they remained until feeding completion. During tick feeding the rearing room tem perature was held at 23 1C. A minimum of two weeks was provided between feedings on each rabbit and rabbits were used for no more than three feedings. Tick feeding chambers detached from rabbits between 14 and 21 days after attachment from degradation of the glue. Tic k F eeding Larvae Two methods of preparing larvae for feeding were used. When a sufficient number of eggs for acaricide testing were oviposited, 125 mg of eggs, which yielded approximately 2,500 larvae, were placed into a 1.5 mL microcen trifuge tube. The top of the microcentrifuge tube was removed and cotton was placed into the end to allow for ventilation and to prevent tick escape. Eggs were monitored for eclosion and held as larvae until they were 4 to 5 weeks post eclosion whereafte r they were introduced to rabbits for feeding.

PAGE 179

179 Larvae that survived acaricide resistance bioassay exposure were prepared for feeding using an alternative handling process. Larvae held in glass vials were aspirated from larval packet tests using a dispos able glass pipette attached to vacuum pump tubing. Fabric mesh prevented ticks from passing through the pipette into the vacuum pump tubing. Ticks were then anesthetized within the pipette with CO 2 gas by placing it over the disposable pipette and squeez ing shut the hose that was connected to the vacuum pump. Thereafter, the pipette was removed and the ticks that were caught in the mesh were placed into a 1.5 mL microcentrifuge tube that was promptly sealed with cotton. When introducing ticks to rabbit s, sticky backed Velcro was placed around the microcentrifuge tube and along a 1.5 cm portion on the inside of the tick feeding cage. Tick containing microcentrifuge tubes were placed on ice for one minute, then the cotton was removed from the tube and t he tube was attached to the inside of the tick feeding enclosure. The enclosure was sealed and the larvae were checked for engorgement following 7 days. The rabbit was checked twice daily to ensure it had not dislodged the cage. Engorged larvae were aspi rated from the tick feeding chamber using a 1/6 hp vacuum pump (Gast Manufacturing Corporation, Benton Harbor, MI). All larval ticks were removed from the rabbit immediately if the cage began to detach to decrease the number of escaped ticks. To reduce t he chance of tick escape into the environment the multi rabbit hutch holding rack was always placed over a soapy water moat. In case of cage detachment, individual rabbit hutches were placed over a moat of water that had the edges coated with petroleum je lly and rabbits were removed from their cage daily to

PAGE 180

180 be combed with a metal flea comb to locate ticks. Water moats were searched daily and ticks that were recovered were rinsed, dried, and placed back into the humidifying incubator with the other colony ticks of that strain. The humidifying incubator consisted of a sealed glass chamber (Sanpia), which contained four bowls of distilled water to maintain humidity. Engorged larval ticks were placed in glass vials that were fitted with cotton balls. Tick c ontaining vials were held in the previously described laboratory incubator and were not disturbed until molting was completed. Nymphs After their first molt, nymphs were held for approximately two weeks before their next feeding. To prepare nymphs for fee ding they were placed into a microcentrifuge tube on ice, using either soft forceps or a water color paint brush. Up to 700 nymphs were placed on a rabbit during each feeding session, however, due to a limited number of ticks acquired for tick colonies, t ypically 50 100 nymphs were place on the rabbit during each feeding. A single adult male was placed in the tick feeding cage with nymphs to improve nymphal attachment (Rechav and Nuttall 2000). Nymphal ticks were allowed access to the rabbit for two week s to allow feeding completion of ticks that failed to attach rapidly. Feeding chambers were checked daily and detached. Fed nymphs were removed from chambers using soft forceps and placed in glass vials fitted with cotton. Nymphs were held in the previo usly described incubator until they had completed their second molt. Adults Following the nymph to adult molt, ticks were held for 30 days prior to placement on a rabbit. A maximum of 30 adult ticks were placed into the tick feeding chamber attached to a rabbit during each feeding session. When possible, a ratio of 15 males

PAGE 181

181 and 15 females was used. Males were placed on the rabbit one day prior to placing the females. If tick mortality occurred during the first three days of the feeding cycle the dead ti cks were removed and replaced with live ticks. The adults were held in glass vials before feeding and chilled on ice prior to placement on the rabbit to minimize the chance of tick escape. Adult ticks were allowed host access over a period of two weeks. The females would attach to the host and take a partial blood meal. After females initiated feeding, blood fed males would mate with the females while they remained attached. After mating occurred, the female would complete her feeding cycle, becoming f ully engorged whereafter she would detach from the rabbit. Engorged females were removed from the tick feeding cage using soft forceps and placed in a glass Petri dish. They completed oviposition in standard environmental holding conditions. All live ma les remained inside the tick feeding cage until the last engorged female tick was removed or all remaining ticks were removed after 14 days. Free R elease Tick F eeding In the case of early cage detachment, ticks were allowed to remain on the rabbit to feed using a free release method. During the free release method, a soft Elizabethan direction. The E s afely feed without being removed by the rabbit during grooming, while still allowing for cecotrophy (ingestion of feces) by the rabbit, a requirement of the IACUC protocol Additionally, a 13 cm piece of tubular cotton stockinet was cut and placed around the cutting a slit at the top of the stockinet that was used to fasten the stockinet to the E collar. The stockinet provided additional protection for the ticks to minim ize tick removal

PAGE 182

182 due to rabbit grooming behaviors. Unattached ticks that were found outside the stockinet area during routine checks were placed under the stockinet, near the E collar. A water pan, with the rim coated in petroleum jelly, was placed under the rabbit hutch in order to capture engorged ticks that detached and dropped from the rabbit. Ticks retrieved from this pan were placed back on the rabbit if they were not engorged or put back into colony if they had completed feeding. For additional bi osecurity measures, the rabbit hutch holders remained over a large soapy water pan to a capture any ticks that may have escaped beyond the hutch water pan. Both pans were searched daily to retrieve ticks. This approach required sifting through fecal pell ets and discarded feed to retrieve the ticks. After searching was completed, the liquid waste was removed using a siphon and the solid waste was put into a sealable plastic bag then double bagged, in order to prevent the escape of unrecovered ticks. Engo rged ticks that were removed from the water pan were rinsed in a sieve (No. 120, 125 mm, Fisher, Mexico) and dried with paper towel. In the case of tick escape during larval free release feeding, additional measures were taken to con tain and retrieve the t icks. The waste collection pan under the rabbit hutch was filled half full with tap water to capture and hold any ticks that fell off the rabbit. To retrieve the fallen ticks, the water was removed from the pan using a siphon pump. The remaining content s were then poured through two different sieves. The first larger sieve was (No. 6, 3.35 mm, Fisher, Mexico) and the second smaller sieve was (No. 120, 125 mm, Fisher, Mexico). The larger sieve retained the large debris, such as hay and fecal pellets, wh ile the smaller mesh sieve retained larval ticks. As the contents of the pan were poured into the sieves the pan was rinsed with clean water to

PAGE 183

183 dislodge remaining ticks. Both sieves, while still stacked, were then rinsed with tap water. The sieves were separated and the debris and larger sieve was placed into a bucket with soapy water to kill any ticks that were not washed into the smaller sieve. The finer grade sieve was rinsed with tap water an additional time and the entire sieve was placed into a pl astic bin that was sealed. The lid of the plastic bin that contained the small mesh sieve had an opening with a fine screening that allowed the contents to dry, while preventing tick escape. After two days, or when the contents were dry, the ticks were c ollected and the debris was discarded. In comparison to the tick feeding cage method, the free release tick feeding technique yielded fewer successfully engorged ticks. This was likely due to the ticks being dislodged or eaten by the grooming rabbit and f ailure to locate ticks in the waste water pan.

PAGE 184

184 Figure C 1. Partially constructed tick feeding chamber. Edges were cut to have a contour fit on the rabbit and were smoothed with sandpaper. Photo courtesy of Amanda L. Eiden.

PAGE 185

185 Figure C 2. Mesh p ieces were secured to the plastic portion of the feeding chamber (Fig. B 1). A) The square piece on the left was glued along th e bottom contoured surface. B) The two pieces on the right were attached above the square piece, which allowed for the curves o n the square piece to fit flush against the rabbit. Photo courtesy of Amanda L. Eiden.

PAGE 186

186 Figure C 3. Tick feeding chamber assembled with mesh screening that has been glued to the bottom of a 6 cm diam plastic feeding chamber creating a surface used t o attach the chamber to the rabbit. Photo courtesy of Amanda L. Eiden.

PAGE 187

187 Figure C 4. The lid for the plastic feeding chamber was constructed using a cork borer to create a 3 cm hole and a hot melt glue gun to secure an 80 mesh brass screen into place Photo courtesy of Amanda L. Eiden.

PAGE 188

188 Figure C 5. Assembled tick feeding chamber. The yellow mesh was adhered to the shaved side of a rabbit. Photo courtesy of Amanda L. Eiden.

PAGE 189

189 APPENDIX D PRIMERS USED IN SODIUM AND CHLORIDE CHANNEL TARGET SIT E MUTATION EVALUATION Table D 1. Primers designed to evaluate sodium and chloride channel mutations in Rhipicepahlus sanguineus (Latreille). Primer ID a Sequence Orientation Range nt# b GenBank n umber c Sodium c hannel d omain II Ix NaD2a Fw ATTCACGCG AGAGTCCCTG Upstream 51 69 XM002407075.1 Ix NaD2a Rv AAGGCTCTAAGTACGCGGAA Downstream 694 713 XM002407075.1 Ix NaD2b Fw GCTGTTCCGGCCATTCAC Upstream 39 56 XM002407075.1 Ix NaD2b Rv GCTCTAAGTACGCGGAAGGT Downstream 691 710 XM002407075.1 Rm NaD2a Fw CGCGCTCTCCTTAATCGAAC Upstream 42 61 AF134216.2 Rm NaD2a Rv CAAGGCGAGGAAAAGGTTGA Downstream 467 486 AF134216.2 Deg NaD2 Fw ATYGTYGCRYTSTCSYTRMT C Upstream 2,535 2,556 XM002407075.1 Deg NaD2 Rv AHGCYCCRAACGARGASAG Downs tream 2,988 3,007 XM002407075.1 Sodium channel d omain III IX NaD3a Fw ACGCCATTGACTCAAGAGGA Upstream 4,468 4,488 XM002407075.1 IX NaD3a Rv ACACCATCGCCTGAAGTTTG Downstream 4,740 4,759 XM002407075.1 Ix NaD3b Fw CTGACATCATGGACAACGCC U pstream 4,454 4,473 XM002407075.1 Ix NaD3b Rv TCGCCTGAAGTTTGAATCGT Downstream 4,734 4,753 XM002407075.1 Rm NaD3a Fw GCGTGTGAAGCCAACAACTT Upstream 1,912 1,931 AF134216.2

PAGE 190

190 Table D 1. Continued Primer ID a Sequence Orientation Range nt# b GenB ank n umber c Rm NaD3a Rv TAGTGGTCGAGTGCCATGAC Downstream 2,389 2,408 AF134216.2 Rm NaD3b Fw AACAGAAAGGCGTGTGAAGC Upstream 1,903 1,922 AF134216.2 Rm NaD3b Rv TCGAGTGCCATGACTGTCA Downstream 2,384 2,402 AF134216.2 Deg NaD3 Fw AACAACTTY ACYTGGRAMAACCCYATG Upstream 4,359 4,386 XM002407075.1 Deg NaD3 Rv GGGTCGAACTGCTGCCAGAT C Downstream 5,567 5,588 XM002407075.1 Texas sodium channel d omain III primers from Guerrero et al. 2001 FG 221 TTATCTTCGGCTCCTTCT Wild type specifi c Sense 2,117 2,134 AF134216.2 FG 222 TTATCTTCGGCTCCTTCA Resistant specific Sense 2,117 2,134 AF134216.2 FG 223 GAATAGATTCAAGGTGAA Wild type specific antisense 2,134 2,151 AF134216.2 FG 224 GAATAGATTCAAGGTGAT Resistant specific antisen se 2,134 2,151 AF134216.2 FG 227 TTGTTCATTGAAATTGTCGA Downstream non diagnostic 2,081 2,098 AF134216.2 FG 228 CTAACATCTACATGTACC Upstream non specific 2,081 2,098 AF134216.2 Sodium channel domain II p rimers from Morgan et al. 2009 DB 01 1 GGAAAACCATCGGTGCTC Wild type specific Sense 173 190 AF134216.2

PAGE 191

191 Table D 1. Continued Primer ID a Sequence Orientation Range nt# b GenBank n umber c DB 012 GGAAAACCATCGGTGCTA Resistant specific Sense 173 190 AF134216.2 FG 447 GAACTTGTGTTTAC TTTCTTCGTAGT Downstream non diagnostic 266 291 AF134216.2 Entire sodium channel s equences Deg Na#1 Fw TTYGATTTYMTCATYGTYGC RYTSTCSYTRMTC Upstream 2,523 2,556 XM002407075.1 Deg Na#1 Fw GAYTTCATGCRYTCRTTSATGATYGTSTTYCG Upstream 2,823 2,8 55 XM002407075.1 Deg Na#3 Rv ATCTCGTAGTACATRTCGTARTCGTCGTC Downstream 5,541 5,570 XM002407075.1 Deg NA#4 Rv AAGATKGCGWAGATGAACAT SACVAGGAAMAG Downstream 5,216 5,184 XM002407075.1 Deg Na#2 Fw TGGTGYTGGCTMGACTTTGT CATCGTRCTSG Upstream 4,01 8 4,048 XM002407075.1 Entire c hloride channel primers Rs Cl #1 Fw CTCCTGCGTCTCTCCACTCGATGAAGACC Upstream 121 150 GV659520.1 Rs Cl #2 Fw CGCTCCCCCAATCCTGAGGTTCCTTCT Upstream 286 314 GV659520.1 Rs Cl #1 Rv TTTTCTGGCTGTGGCGATGACGATTCGAG Downstream 2,357 2,386 GV659520.1 Various glutamate gated chloride channel l ocations Rs ClGlu a Fw ACCTGGTGTTCAAGCGCGAGTTCAG Upstream 467 491 GQ215234.1 Rs ClGlu a Rv TTTGGATCGCGTGGGAAACCTGG Downstream 1,068 1,086 GQ215234.1

PAGE 192

192 Table D 1. Continued Primer ID a Sequence Orientation Range nt# b GenBank n umber c Rs ClGlu b Fw CATCATGCCCAACGTGCTTCTACGC Upstream 165 189 GQ215234.1 Rs ClGlu b Rv GTGGCGATGACGATTCGAGCGTG Downstream 1,369 1,391 GQ215234.1 Rs ClGlu c Fw CACTCCAC GGGAACGAGACC Upstream 432 452 GV659520.1 Rs ClGlu c Rv CACTGCTCTCTGAACGTCATTTGCACTGTG Downstream 984 1,014 GV659520.1 Rs ClGlu d Fw TCTAACGAGAAGGAGGAGCC Upstream 310 330 GV659520.1 Rs ClGlu e Fw TGGTGCTTTCATGTCCGATG Upstream 233 255 GQ215234.1 Rs ClGlu e Rv AGCTCCCATTTCCTCTGCTT Downstream 790 809 GQ215234.1 Rs ClGlu f Fw AAACTACGATCGAAGGGCCC Upstream 995 1,014 GQ215234.1 Rs ClGlu g Fw GACATCGTCGACCACAATGA Upstream 465 485 GV659520.1 Rs ClGlu h Fw CATCGTCGACCA CAATGAACT Upstream 467 488 GV659520.1 Rs ClGlu h Rv CCCATAGCTCACCATGACGATA Downstream 1,269 1,291 GV659520.1 Rs ClGlu i Fw ATCTGCTCTATCGTCATGGTG Upstream 283 303 GQ215234.1 Rs ClGlu i Rv TGTAGGAAACGGGAGGCAG Downstream 649 667 GQ215234. 1

PAGE 193

193 Table D 1. Continued. Primer ID a Sequence Orientation Range nt# b GenBank n umber c Rs ClGlu j Fw GCTCTATCGTCATGGTGAGC Upstream 287 306 GQ215234.1 Rs ClGlu j Rv TTGGTGTAGGAAACGGGAGG Downstream 652 671 GQ215234.1 Drosophila GABA gated Chlo ride Channel from Le Goff et al. 2005 GCCTGCGAAATTCAGTTCAGTTCGTGCG Upstream 2,421 2,438 NM_001274688.1 GGCAAAGACCATAACGAAGCATGTTCCC Downstream 2,651 2,678 NM_001274688.1 a Primer ID identifies organism in which the sequence was creat ed. Ix= Ixodes scapularis Rm= Rhipicephalus microplus Rs= Rhipicephalus sanguineus Deg= Sequences aligned from Ixodes scapularis, Rhipicephalus microplus and Varroa destructor Fw= Forward Rv= Reverse. Na= Sodium channel, CL= Chloride channel b Nucle otide number c GenBank sequence number used to determine nucleotide number

PAGE 194

194 LIST OF REFERENCES Abbott, W. S. 1925. A method of computing the effectiveness of an insecticide. J. Econ. Entomol. 18 : 265 267. Aguilar Tipacam G., R. J. Miller R. Hernnde z Ortiz R. I. Rodriguez Vivas C. Vsquez Pelez Z. Garca Vzquez F. Olvera Valencia and R. Rosario Cruz 2008. Inheritance of pyrethroid resistance and a sodium channel gene mutation in the cattle tick Boophilus microplus Parasitol. Res. 103: 633 639. Ahmad, M., I. Denholm, and R. H. Bromilow. 2006. Delayed cutic ular penetration and enhanced metabolism of deltamethrin in pyrethroid resistant strains of Helicoverpa armigera from China and Pakistan. Pest. Manag. Sci 62: 805 810. Ali, S. R, and G. K. Sweatman. 1966. Effect of age, sex, and hormone treatment of t he mouse on the level of infestation by Rhipicephalus sanguineus larvae. J. Parasitol. 52: 407 412. Altschul S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215 : 403 410. Amichot, M. S. Tars, A. Brun Barale, L. Arthaud, J. M. Bride, and J. B. Berg. 2004. Point mutations associated with insecticide resistance in the Drospophila cytochrome P450 Cyp6a2 enable DDT metabolism. Eur. J. Biochem. 271: 1250 1257. Anderson, B. E., J. E. Dawson, D. C. Jones, and K. H. Wilson. 1991. Ehrlichia chaffeensis a new species associated with human ehrlichiosis. J. Clin. Microbiol. 29: 2828 2842. Ang, L. H., W. A. Nazni, M. K. Kuah, A. C. Shu Chien, and C. Y. Lee. 2013. Detection of the A302S Rdl mutation in fipronil bait selected strains of the German cockroach (Dictyoptera: Blattellidae). J. Econ. Entomol. 106: 2167 2176. Beati, L., and J. E. Keirans. 2001. Analysis of the systematic relationships among ticks of the genera Rhipicephalus and Boophilus (Acari: Ixodidae) based on mitochondrial 12S ribosomal DNA gene sequences and morphological characters. J. Parasitol. 87: 32 48. Bechara, G. H., M. P. J. Szab, L. S. Mukai, and P. C. Rosa. 1994. Immunisation of dogs, hamsters and guinea pigs against Rhipicephalus sanguineus using crude unfed adult tick extracts. Vet. Parasitol. 52: 79 90. Bennett, G. W., E. S. Runstrom, and J. A. Wieland. 1983. Pesticide use in homes. Bul. ESA. 29: 31 40.

PAGE 195

195 Berg, J. B., R. Feyereisen, and M. Amicho t. 1998. Cytochrome P450 monooxygenases and insecticide resistance in insects. Philos. T. Roy. Soc. B. 353: 1701 1705. Beugnet, F., and J. Marie 2009. Emerging arthropod borne diseases of companion animals in Europe. Vet. Parasitol. 163: 298 305 Bissinger, B. W., and R. M. Roe. 2010. Tick repellents: past, present, and future. Pestic. Biochem. Physiol. 96: 63 79. Bloomquist, J. R. 1996. Ion channels as targets for insecticides. Annu. Rev. Entomol. 41: 163 190. Bloomquist, J. B and W. H. Robinson. 1999. Prevalence and magnitude of resistance to cyclodiene and phenylpyrazole insecticides in Blattella germanica and Drosophila melanogaster, pp. 27 34. In W. H. Robinson, F. Rettich, and G. W. Rambo [eds.], Proceedings of the 3 rd Internati onal Conference of Urban Pests. Grafickzvody Hronov, Czech Republic. Bonneau, S., S. Gupta, and M. C. Cadiergues. 2010. Comparative efficacy of two fipronil spot on formulations against experimental tick infestations ( Ixodes ricicnus ) in dogs. Parasi tol. Res. 107: 735 739. Breitschwerdt, E. B., B. C. Hegarty and S. I. Hancock 1998. Sequential evaluation of dogs naturally infected with Ehrlichia canis, Ehrlichia chaffeensis, Ehrlichia equi, Ehrlichia ewingii or Bartonella vinsonii J. Clin. Mic robio. 36: 2645 2651. Bremer, W. G., J. J. Schaefer, E. R. Wagner, S. A. Ewing, Y. Rikihisa, G. R. Needham, S. Jittapalapong, D. L. Moore, and R. W. Stich. 2005. Transstadial and intrastadial experimental transmission of Ehrlichia canis by male Rhipicep halus sanguineus Vet. Parasitol. 132: 95 105. Brengues, C., N. J. Hawkes, F. Chandre, L. Mccarroll, S. Duchon, P. Guillet, S. Manguin, J. C. Morgan, and J. Hemingway. 2003. Pyrethroid and DDT cross resistance in Aedes aegypti is correlated with novel mutations in the voltage gated sodium channel gene. Med. Vet. Entomol. 17: 87 94. Brianti, E., M. G. Pennisi, G. Brucato, A. L. Risitano, G. Gaglio, G. Lombardo, D. Malara, A. Fogliazza, and S. Giannetto. 2010. Efficacy of the fipronil 10% + ( S ) metho prene 9% combination against Rhipicephalus sanguineus in naturally infested dogs: Speed of kill, persistent efficacy on immature and adult stages and effect of water. Vet. Parasitol. 170: 96 103. Brooke, B. D., R. H. Hunt, and M. Coetzee. 2000. Resista nce to dieldrin + fipronil assorts with chromosome inversion 2La in the malaria vector Anopheles gambiae. Med. Vet. Entomol. 14: 190 194.

PAGE 196

196 Buller, R. S., M. Arens, S. P. Hmiel, C. D. Paddock, J. W. Sumner, Y. Rikihisa, A. Unver, M. Gaudreault Keener, F. A. Manian, A. M. Liddell, N. Schmulewitz, and G. A. Storch. 1999. Ehrlichia ewingii a newly recognized agent of human e hrlichiosis. N. Engl. J. Med. 341: 148 155. Burridge, M. J., L. A. Simmons, and S. A. Allan. 2004. Efficacy of acaricides for contr ol of four tick species of agricultural and public health significance in the United States. J. Agric. Urban Entomol. 20: 207 219. Byford, R. L. S. S. Quisenberry, T. C. Sparks, and J. A. Lockwood 1985. Spectrum of i nsectic ide cross resistance in pyr ethroid resistant p opulations of Haematobia irritans (Diptera: Muscidae) J. Econ. Entomol. 78: 768 773. Carpenter, T. L., M. C. McMeans, and C. P. McHugh. 1990. Additional instances of human parasitism by the brown dog tick (Acari: Ixodidae). J. Med. Ent omol 27: 1065 1066 Casida, J. E. 1970. Mixed function oxidase involvement in the biochemistry of insecticide synergists. J. Agr Food Chem 18: 753 772 Castro Janer, E., L. Rifran, J. Piaggio, A. Gil, R. J. Miller, and T. T. S. Schumaker. 2009 In vitro tests to establish LC 50 and discriminating concentrations for fipronil against Rhipicephalus ( Boophilus ) microplus (Acari: Ixodidae) and their standardization. Vet. Parasitol. 162: 120 128. Castro Janer, E., L. Rifran, P. Gonzlez, J Piaggi o, A. Gil, and T. T. S. Schumaker. 2010. Rhipicephalus ( Boophilus ) microplus (Acari: Ixodidae) resistance to fipronil in Uruguay evaluated by in vitro bioassays. Vet. Parasitol. 169: 172 177. (CDC) Center for Disease Control and Prevention. 2013. Tic kborne rickettsial diseases. http://www.cdc.gov/. Chandre, F., F. Darrier, L. Manga, M. Akogbeto, O. Faye, J. Mouchet, and P. Guillet. 1999. Status of pyrethroid resistance in Anopheles gambiae sensu lato. B. World Health Organ. 77: 230 234. Cilek, J. E., and G. L. Green e 1994. Stable fly (Diptera: Muscidae) insect resistance in Kansas cattle feedlots. J. Econ. Entomol. 87: 275 279. Cochran, D. G. 1989. Monitoring for insecticide resistance in field collecte d strains of the German cockroach (Dictyoptera: Blattellidae). J. Econ. Entomol. 82: 336 341. ffrench Constant, R. H., T. A. Rocheleau, J. C. Steichen, and A. E. Chalmers. 1993. A point mutation in a Drosophila GABA receptor confers insecticide resist ance. Nature. 363: 449 451.

PAGE 197

197 C outinho M. T. Z., L. L. Bueno, A. Sterzik, R. T. Fujiwara, J. R. Botelho, M. Maria, O. Genaro, and P. M. Linardi. 2005. Participation of Rhipicephalus sanguineus (Acari: Ixodidae) in the epidemiology of canine visceral lei shmaniasis Vet. Parasitol. 128: 149 155. Curtis, C. F. 1985. Theoretical models of the use of insecticide mixtures for the management of resistance. B. Entomol. Res. 75: 259 266. Daborn, P., C. McCart, D. Woods, and R. H. ffrench Constant. 2004. Detection of insecticide resistance associated mutations in cat flea Rdl by TaqMan allele specific amplification. Pestic. Biochem. Phys 79 : 25 30. Daborn, P. J., C. Lumb, A. Boey, W. Wong, R. H. ffrench Constant, and P. Batterham. 2007. Evaluating the insecticide resistance potential of eight Drosophila melanogaster cytochrome P450 genes by transgenic over expression. Insect Biochem. Mol. Biol. 37: 512 519. Daborn, P. J J. L. Yen, M. R. Bogwitz, G. Le Goff, E. Feil, S. Jeffers, N. Tijet, T. Perry, D. Heckel, P. Batterham, R. Feyereisen, T. G. Wilson, and R. H. ffrench Constant. 2002. A single P450 allele associated with insecticide resistance in Drosophila Science. 27: 2253 2256. Dantas Torres, F., L. A. Figueredo, and S. P. Brando Filho. 200 6. Rhipicephalus sanguineus (Acari: Ixodidae), the brown dog tick, parasitizing humans in Brazil. Rev. Soc. Bras. Med. Trop. 39: 64 67. Dantas Torres, F. A., A. Giannelli, L. A. Figueredo, and D. Otranto. 2010. Effects of prolonged exposure to low tem perature on eggs of the brown dog tick, Rhipicephalus sanguineus (Latreille, 1806) (Acari: Ixodidae). Vet. Parasitol. 171: 327 330. Davari, B., H. Vatandoost, M. A. Oshaghi, H. Ladonni, A. A. Enayati, M. Shaeghi, H. R. Basseri, Y. Rassi, and A. A. Hana fi Bojd. 2007. Selection of Anopheles stephensi with DDT and dieldrin and cross resistance spectrum to pyrethroids and fipronil. Pestic. Biochem. Phys. 89: 97 103. Davey, R. B., and J. E. George. 1998. In vitro and in vivo evaluations of a strain o f Boophilus microplus (Acari: Ixodidae) selected for resistance to permethrin. J. Med. Entomol. 35: 1013 1019. Davey, R. B., E. H. Ahrens, J. E. George, J. S. Hunter III, and P. Jeannin. 1998. Therapeutic and persistent efficacy of fipronil against Boo philus microplus (Acari: Ixodidae) on cattle. Vet. Parasitol. 74: 261 276. Davoust, B., J. L. Marie, S. Mercier, M. Boni, A. Vanderweghe, D. Parzy, and F. Beugnet. 2003. Assay of fipronil efficacy to prevent canine monocytic ehrlichiosis in endemic are as. Vet. Parasitol. 112: 91 100.

PAGE 198

198 Demma, L. J., M. S. Traeger, W. L. Nicholson, C. D. Paddock, D. M. Blau, M. E. Eremevva, G. A. Dasch, M. L. Levin, J. Singleton, S. R. Zaki, J. E. Cheek, D. L. Swerdlow, and J. H. McQuiston. 2005. Rocky Mountain Spotted Fever from an unexpected tick vector in Arizona. N. Engl. J. Med. 353: 587 594 Devonshire, A. L., and G. D. Moores. 1982. A carboxylesterase and broad substrate specificity causes organophosphorus, carbamate and pyrethroid resistance in peach potat o aphids ( Myzus persicae ). Pestic. Biochem. Phys. 18: 235 246. Dong, K. 1997. A single amino acid change in the para sodium channel protein is associated with knockdown resistance ( kdr ) to pyrethroid insecticides in German cockroach. Insect Biochem Molec. Biol. 27: 93 100. Drummond, R. O., S. F. Crust, J. L. Trevino, W. J. Gladney, and O. H. Graham. 1973 Boophilus annulatus and B decoloratus : laboratory tests of i nsectic ides. J. Econ. Entomol. 66: 130 133. Durham, E. W., B. D. Siegfried, and M. E. Scharf. 2002. In vivo and in vitro metabolism of fipronil by larvae of the European corn borer Ostrinia nubilalis Pest Manag. Sci. 58: 799 804. El Sayed, A. M. 2012. The Pherobase: d atabase o f pheromones and s emiochemicals. http://www.pherobase.com. Enayati, A. A., F. Asgarian, A. Amouei, M. Sharif, H. Mortazavi, H. Boujhmehrani, and J. Hemingway. 2010. Pyrethroid insecticide resistance in Rhipicephalus bursa (Acari: Ixodidae). Pest ic Bioch em. Phys 97: 243 248. Endris, R. G., M. D. Matthewson, D. Cooke, and D. Amodie. 2000. Repellency and efficacy of 65% permethrin and 9.7% fipronil against Ixodes ricinus Vet. Ther. 1: 159 168. Endris, R. G., D. Cooke, D. Amodie, D. L. Sweeney, and T. L. Katz. 2002a. Repellency and efficacy of 65% permethrin and selamectin spot on formulations against Ixodes ricinus ticks on dogs. Vet. Ther. 3: 64 71. Endris, R. G., R. Everett, J. Cunningham, T. L. Katz, and K Thompson. 2002 b Efficacy of two 65 % permethrin spot on formulations against canine infestations of Ctenocephalides felis and Rhipicephalus sanguineus Vet. Ther. 3: 326 333. (EPA) United States Environmental Protection Agency. 1996. New p esticide f act s heet. EPA, Washington DC. http://www.epa.gov/ Eremeeva, M. E., E. A. Bosserman, L. J. Demma, M. L. Zambrano, D. M. Blau, and G. A. Dasch 2006. Isolation and identification of Rickettsia massiliae from Rhipicephalus sanguineus ticks collected in A rizona Appl. Environ. Microbiol. 72: 5569 5577.

PAGE 199

199 Estrada Pea, A., and C. Rme. 2005. Efficacy of a collar impregnated with amitraz and pyriproxyfen for prevention of experimental tick infestations by Rhipicephalus sanguineus, Ixodes ricinus, and Ixode s scapularis in dogs. J. Am. Vet. Med. Assoc. 226: 221 224. Fang, Q., C. H. Huang, G. Y. Ye, H. W. Yao, J. A. Cheng, and Z. R. Akhatar. 2008. Differential fipronil susceptibility and metabolism in two rice stem borers from China. J. Econ. Entomol. 10 1: 1415 1420. (FAO) Food and Agriculture Organization. 2004. Resistance management and integrated parasite control in ruminants guidelines, module 1 ticks: acaricide resistance: diagnosis, management and prevention. Food and A griculture O rganization, A nimal P roduction and H ealth D ivision, Rome, pp. 53. Farnsworth, W. R., M. G. Collett, and I. S. Ridley. 1997. Field survey of insecticide resistance in Haematobia irritans exigua de Meijere. Aust. J. Entomol. 36: 257 261. Ferreira, B.R., and J. S. V. Silva. 199 8 Saliva of Rhipicephalus sanguineus tick impairs T cell proliferation and IFN gamma induced macrophage microbicidal activity. Vet. Immunol. Immunopathol. 64: 279 293. Field, L. M., A. L. Devonshire, and B. G. Forde. 1988. Molecular evide nce that insecticide resistance in peach potato aphids ( Myzus persicae Sulz.) results from amplification of an esterase gene. Biochem. J. 251: 309 312. Finney, D. J. 1971. Probit Analysis 3rd edition. Cambridge University Press, London, UK. Flor Wei ler, L. B., R. W. Behle, and K. C. Stafford III. 2011. Susceptibility of four tick species, Amblyomma americanum, Dermacentor variabilis, Ixodes scapularis, and Rhipicephalus sanguineus (Acari: Ixodidae), to nootkatone from essential oil of grapefruit. J. Med. Entomol. 48: 322 326. Forresters, N. W., M. Cahill, L. J. Bird, and J. K. Layland. 1993. Management of pyrethroid and endosulfan resistance in Helicoverpa armigera (Lepidoptera: Noctuidae) in Australia. B. Entomol. Res. Suppl. Ser. 1: 1 132. G eorghiou, G. P., and C. E. Taylor. 1986. Factors influencing the evolution of resistance pp.157 169. In Pesticide Resistance: Strategies and Tactics for Management. National Academy Press, Washington, DC. Gindin, G., M. Samish, E. Alekseev, and I. Gl azer. 2001. The susceptibility of Boophilus annulatus (Ixodidae) ticks to entomopathogenic fungi. Biocontol Sci. Techn. 11: 111 118. Goddard, J. 1987. Ticks of medic al importance occurring in the western h emisphere. Texas: USAF School of Aerospace M edicine pp. 1 139

PAGE 200

200 Goddard, J. 1989. Focus of human parasitism by the brown dog tick, Rhipicephalus sanguineus (Acari: Ixodidae ) J. Med. Entomol. 26: 628 629. Goddard, J 2011. Ectoparasites, part two: mites & ti cks, pp. 550 586. In Mallis (ed.), Handbook of Pest Control, 10 th ed., The Mallis Handbook Company, Richfield, OH. Gondhalekar, A. D., and M. E. Scharf. 2012. Mechanisms underlying fipronil resistance in a multiresistant field strain of the German cockroach (Blattodea: Blattellidae). J. Med. Entomol. 49: 122 131. Gray, J. S., H. Dautel, A. Estrada Pea, O. Kahl, and E. Lindgren. 2009. Effects of climate change on ticks and tick borne disease in Europe. Interdiscip. Perspect. Infect. Dis. doi:10.1155/2009/593232. Guerrero, F. D. R. B. Davey, and R. J. Miller. 2001. Use of an allele specific polymerase chain reaction assay to genotype pyrethroid resistant strains of Boophilus microplus (Acari: Ixodidae). J. Med. Entomol. 38: 44 50. Guerrero, F. D., A. Y. Li, and R. Hernandez. 200 2 a Molecular diagnosis of pyrethroid resistance in Mexican strains of Boophilus microplus (Acari: Ixodidae). J. Med. Entomol. 25: 770 776. Guerrero F. D., J. H. Pruett, and A. Y. Li. 2002b Molecular and biochemical diagnosis of esterase mediated pyr ethroid resistance in Mexican strain of Boophilus microplus (Acari: Ixodidae). Exp. App. Acarol. 28: 257 264. Guerrero, F. D., R. C. Jamroz, D. Kammlah, and S. E. Kunz. 1997. Toxicological and molecular biological characterization of pyrethroid resista nt horn f l ies, Haematobia irritans: identification of kdr and super kdr point mutations. Insect Biochem. Mol. Biol. 27: 745 755. Guglielomone, A. A., R. G. Robbins, D. A. Apanaskevich, T. N. Petney, A. Estrada Pea, I. G. Horak, R. Shao, and S. C. Baker. 2010. The Argasidae, Ixodidae and Nuttalliellidae (Acari: Ixodida) of the world: a list of valid species names. Zootaxa. 2528: 1 28. Hagimori, I., H. Machida, R. Goi, and N. Mencke. 2005. Efficacy of imidacloprid/permethrin and fipronil/( S ) methopr ene combinations against Haemaphysalis longicornis ticks evaluated under in vitro and in vivo conditions. Parasitol. Res. 97: S120 S126. Hajek, A. E., and R. J. St. Leger. 1994. Interactions between fungal pathogens and insect hosts. Annu. Rev. Ento mol. 39: 293 322. Halos, L., T. Jamal, L. Vial, R. Maillard, A. Suau, A. Le Menach, H. J. Boulouis, and M. Vayssier Taussat. 2004. Determination of an efficient and reliable method for DNA extraction from ticks Vet. Res. 35: 709 713.

PAGE 201

201 He, H., A. C. Chen, R. B. Davey, G. W. Ivie and J. E. George. 1999a Characterization and molecular cloning of a glutathione S transferase gene from the cattle tick, Boophilus microplus (Acari: Ixodidae). Insect Biochem. Mol. Biol. 29: 737 743. He, H., A. C. Chen, R. B. Davey, G. W. Ivie and J. E. George. 1999b Identification of a point mutation in the para type sodium channel gene from a pyrethroid resistant cattle tick. Biochem. Biophys. Res. Comm. 261: 558 561. He, H., A. C. Chen, R. B. Davey, G. W. Ivie, G G. Wagner and J. E. George. 1999c Sequence analysis of the knockdown resistance homologous region of the para type sodium channel gene from pyrethroid resistant Boophilus microplus (Acari: Ixodidae). J. Med. Entomol. 36: 539 543. Hernandez, R., F. D. Guerrero, J. E. George, and G. G. Wagner. 2002. Allele frequency and gene expression of a putative carboxylesterase encoding gene in a pyrethroid resistant strain of the tick Boophilus microplus Insect. Biochem. Mol. Biol. 32: 1009 1016. Hernandez, R., H. He, A. C. Chen, S. D. Waghela, I. G. Wayne, J. E. George, and G. G. Wagner. 2000. Identification of a point mutation in an esterase gene in different populations of the southern cattle tick. Insect. Biochem. Mol. Biol. 30: 969 977. Hill, C. A., and A. Gutierrez. 2003. A method for extraction and analysis of high quality genomic DNA from ixodid ticks Med. Vet. Entomol. 17: 224 227. Holbrook, G. L., J. L. Roebuck, C. B. Moore, M. G. Waldvogel, and C. Schal. 2003. Origin and extent of resist ance to fipronil in the German cockroach, Blattella germanica (L.) (Dictyoptera: Bla ttellidae). J. Econ. Entomol. 96: 1548 1558. Huang, H., S. Zane, M. C. Saunders, and R. Weisz. 1994. Field evaluation of insecticide application strategies on developme nt of insecticide resistance by Colorado potato beetle (Coleop tera: Chrysomelidae). J. Econ Entomol. 87: 847 857. Huang Q., Y. Deng, T. Zhan, and Y. He. 2010. Synergistic and antagonistic effects of piperonyl butoxide in fipronil susceptible and resi stant rice stem borers, Chilo suppressalis J. Insect Sci. 10: doi: 10.1673/031.010.14142 Inokuma, H., K. Tamura, and T. Onishi. 1997. Dogs develop resistance to Rhipicephalus sangu ineus Vet. Parasitol. 68: 295 297. Jamroz, R. C. F. D Guerrero, J. H Pruett, D. D. Oehler, and R. J. Miller. 2000. Molecular and biochemical survey of acaricide resistance mechanisms in larvae from Mexican strains of the southern cattle tick, Boo philus microplus J. Insect Physiol. 46: 685 695.

PAGE 202

202 Jernigan, A. D., T. L. McTier, C. Chieffo, C. A. Thomas, M. J. Krautmann, J. A. Hair, D. R. Young, C. Wang, and T. G. Rowan. 2000. Efficacy of selamectin against experimentally induced tick ( Rhipicepha lus sanguineus and Dermacentor variabilis ) infestations on dogs. Vet. Parasitol. 91: 359 375. Jittapalapong, S., R. W. Stich, J. C. Gordon, T. E. Wittum, and O. O. Barriga. 2000. Performance of female Rhipicephalus sanguineus (Acari: Ixodidae) fed on d ogs exposed to multiple infestations or immunization with tick salivary gland or midgut tissues. J. Med. Entomol. 37: 601 611. Jonsson, N. N., C. Cutulle, S. W. Corley, and J. M. Seddon. 2010. Identification of a mutation in the para sodium channel g ene of the cattle tick Rhipicephalus microplus associated with resistance to flumethri n but not to cypermethrin. Int. J. Parasitol. 40: 1659 1664. Kaaya, G. P., and S. Hassan. 2000. Entomogenous fungi as promising biopesticide for tick control. Exp. A ppl. Acarol. 24: 913 926. Kaaya, G. P ., E. N. Mwangi, and E. A. Ouna. 1996. Prospects for biological control of livestock t icks, Rhipicephalus appendiculatus and Amblyomma variegatum using the e ntomogenou s f ungi Beauveria bassiana and Metarhizium a ni sopliae J. Invert. Pathol. 67: 15 20. Kasai, S., and J. G. Scott. 2000. Overexpression of cytochrome P450 CYP6D1 is associated with monooxygenase mediated pyrethroid resistance in house flies from Georgia. Pestic. Biochem. Phys. 68: 34 41. Kasai, S., I. S. Weerashinghe, and T. Shono. 1998. P450 monooxygenases are an important mechanism of permethrin resistance in Culex quinquefasciatus Say larvae. Arch. Insect Biochem. 37: 47 56. Kaufman, P. E., J. G. Scott, and D. A. Rutz. 2001. Monitoring insecticide resistance in house flies (Diptera: Muscidae) from New York dairies. Pest Manag. Sci. 57: 514 521. Kaufman, P. E., S. C. Nunez, R. S. Mann, C. J. Geden, and M. E. Scharf. 2010. Nicotinoid and pyrethroid insecticide resistance in houseflies (Diptera: Muscidae) collected from Florida dairies. Pest Manag. Sci. 66: 290 294. Kiszewski, A. E., F. R. Matuschka, and A. Spielman. 2001. Mating strategies and spermiogenesis in ixodid ticks. Annu. Rev. Entomol. 46: 167 182. Klompen, J. S. H., W C. Black IV, J. E. Keirans, and J. H. Oliver Jr. 1996. Evolution of ticks. Annu. Rev. Entomol. 41: 141 161. Kocan, K. M., E. F. Blouin, M. S. Pidherney, P. L. Claypool, M. Samish, and I. Glazer. 1998. Entomopathogenic nematodes as a potential biolo gical control method for ticks. Ann. N. Y. Acad. Sci. 849: 355 364.

PAGE 203

203 Koch, H. G. 1982. Oviposition of the brown dog tick (Acari: Ixodidae) in the laboratory. Ann. Entomol. Soc. Am. 75: 583 586. Kolaczinski, J., and C. Curtis. 2001. Laboratory eval uation of fipronil, a phenylpyrazole insecticide, against adult Anopheles (Diptera: Culicidae) and investigation of its possible cross resistance with diledrin in Anopheles stephensi Pest Manag. Sci. 57: 41 45. Kongsuwan, K., P. Josh, M. L. Colgrave, N H. Bagnall, J. Gough, B. Burns, and R. Pearson. 2010. Activation of several key components of the epidermal differentiation pathway in cattle following infestation with the cattle tick, Rhipicephalus ( Boophilus ) microplus. Int. J. Parasitol. 40: 449 507. Kordick, S. K., E. B. Breitschwerdt, B. C. Hegarty, K. L. Southwick, C. M. Colitz, S. I. Hancock, J. M. Bradley, R. Rumbough, J. T. McPherson, and J. N. MacCormack 1999. Coinfection with multiple tick borne pathogens in a walker hound kennel in Nor th Carolina. J. Clin. Microbiol. 37: 2631 2638. Kostaropoulos, I., A. I. Papadopoulos, A. Metaxakis, E. Boukouvala, and E. Papadopoulou Mourkidou. 2001. Glutathione S transferase in the defence against pyrethroids in insects. Insect Biochem. Mol. Biol 31: 313 319. Kristensen, M., J. B. Jespersen, and M. Knorr. 2004. Cross resistance potential of fipronil in Musca domestica Pest Manag Sci. 60: 894 900. Le Goff, G., A. Hamon, J. B. Berg, and M. Amichot. 2005. Resistance to fipronil in Drosph ila simulans : i nfluence of two point mutations in the Rdl GABA receptor unit. J. Neurochem. 92: 1295 1301. LeOra Softw are. 199 7. Probit and logit analysis, version 1.0. LeOra Petaluma CA. Levin, M. L., E. Studer, L. Killmaster, G. Zemtsova, and K. Y. Mumcuoglu. 2012. Crossbreeding between different geographical populations of the brown dog tick, Rhipicephalus sanguineus (Acari: Ixodidae). Exp. Appl. Acarol. 58: 51 68. Li, A. Y., R. B. Davey, R. J. Miller, and J. E. George. 2004. Detection and characterization of amitraz resistance in the southern cattle tick, Boophilus microplus (Acari: Ixodidae). J. Med. Entomol. 41: 193 200. Li, X., M. A. Schuler, and M. R. Berenbaum. 2007. Molecular mechanisms of metabolic resistance to synthetic and nat ural xenobiotics. Annu. Rev. Entomol. 52: 231 253. Li, X., Q. Huang, J. Yuan, and Z. Tang. 2007. Fipronil resistance mechanisms in the rice stem borer Chilo suppressalis Walker. Pest ic Biochem. Phys 89: 169 174.

PAGE 204

204 Liddell, A. M., S. L. Stockham, M A. Scott, J. W. Sumner, C. D. Paddock, M. Gaudreault Keener, M. Q. Arens, and G. A. Storch. 2003. Predominance of Ehrlichia ewingii in Missouri dogs. J. Clin. M icrobiol. 41: 4617 4 622. Little, S. E., J. Hostetler, and K. M. Kocan. 2007. Movement of Rhipicephalus sanguineus adults between co housed dogs during active feeding. Vet. Parasitol 150: 139 145. Lord, C. L. 200 1 Brown dog tick, Rhipicephalus sanguineus Latreille (Arachnida: Acari: Ixodidae). University of Florida. IFAS. Entomology and Nematology Featured Creatures. http://entnemdept.ufl.edu/creatures/urban/medical/brown_dog_tick.htm Louly, C. C. B., S. F. Soares, D. N. Silvera, M. S. Guimares, and L. M. F. Borges. 2010. Differences in the behavior of Rhipicephalus sanguineus tested against resistant and susceptible dogs. Exp. Appl. Acarol. 51: 353 362. Lovis, L., F. D. Guerrero, R. J. Miller, D. M. Bodine, B. Betschart, and H. Sager. 2012 Distribution patterns of three sodium channel mutations associated with pyrethroid resis tance in Rhipicephalus ( Boophilus ) microplus populations from North and South America, South Africa and Australia. Int. J. Parasitol. 2: 216 224. Lu, C., G. Adamkiewicz, K. R. Attfield, M. Kapp, J. D. Spengler, L. Tao, and S. H. Xie. 2013. Household pesticide contamination from indoor pest control applications in urban low income public housing dwellings: a community based participatory research. Environ. Sci. Technol. 47: 2018 2025. Lui, G. H., F. Chen, Y. Z. Chen, H. C. Song, R. Q. Lin, D. H. Zhou and X. Q. Zhu. 2013. Complete mitochondrial genome sequence data provides genetic evidence that the brown dog tick Rhipicephalus sanguineus (Acari: Ixodidae) represents a species complex. Int. J. Biol. Sci. 9: 361 369. Lysyk, T. J., and W. Majak. 20 03. Increasing the paralyzing ability of a laboratory colony of Dermacentor andersoni Stiles. J. Med. Entomol. 40: 185 194. Maeda, K., R. C. Markowitz, R. C. Hawley, M. Ristic, D. Cox, and J. E. McDade. 1987. Human infection with Ehrlichia canis a le ukocytic rickettsia. N. Engl. J. Med. 316: 853 856. Mallis, A. 1954 Ticks, pp. 442 445 Handbook of Pest Control, 2 nd ed. Mac Nair Dorland Company, New York, NY Marquez, F. J., J. J. Rodriguez Liebana, R. C. Soriguer, M. A. Muniain, M. Bernabeu Wit tel, A. Caruz, and F. Conteras Chova. 2008. Spotted fever group Rick ettsia in brown dog ticks Rhipicephalus sanguineus in southwestern Spain. Parasitol. Res. 103: 119 122.

PAGE 205

205 Maupin, G. O., and J. Piesman. 1994. Acaricide susceptibility of i mmature Ixo des scapularis (Acari: Ixodidae) as determined by the disposable pipet m ethod. J. Med. Entomol. 31 : 319 321 Mcdonald, P. T, and C. D. Schmidt. 1987. Genetics of permethrin resistance in the horn fly (Diptera: Muscidae). J. Econ. Entomol. 80: 433 437 Meer Scherrer, L., M. Adelson, E. Mordechai, B. Lottaz, and R. Tilton. 2004. Babesia microti infection in Europe. Curr. Microbiol. 48: 435 437. Mehlhorn, H., G. Schmahl, N. Menche, and T. Bach. 2003. In vitro and in vivo studies on the effect of a combination containing 10% imidacloprid and 50% permethrin against Ixodes ricinus ticks. Parasitol. Res. 89: 323 325. Mencke, N., P. Volf, V. Volfova, and D. Stanneck. 2003. Repellent efficacy of a combination containing imidacloprid and permethrin aga inst sand flies ( Phlebotomus papatasi ) in dogs. Parasitol. Res. 90: S108 S111. Miller, R. J., R. B. Davey, and J. E. George. 1999. Characterization of pyrethroid resistance and susceptibility to coumaphos in Mexican Boophilus microplus (Acari: Ixodidae ). J. Med. Entomol. 36: 533 538. Miller, R. J., R. B. Davey, and J. E. George. 2002. Modification of the Food and Agriculture Organization larval packet test to measure amitraz susceptibility against Ixodidae. J. Med. Entomol. 39: 645 651. Miller, R. J., R. B. Davey, and J. E. George. 2007 a First report of permethrin resistant Boophilus microplus (Acari: Ixodidae) collected within the United States. J. Med. Entomol. 44: 308 315. Miller, R. J., J. A. Esparza Rentaria, H. Q. Martinez, and J. E. G eorge. 2007 b Characterization of permethrin resistant Boophilus microplus (Acari: Ixodidae) collected from the state of Coahuila, Mexico. J. Med. Entomol. 44 : 895 897. Miller, R. J., J. E. George, F. Guerrero, L. Carpenter, and J. B. Welch. 2001. Ch aracterization of acaricide resistance in Rhipicephalus sanguineus (Latreille) (Acari: Ixodidae) collected from the Corozal Army Veterinary Quarantine Center, Panama. J. Med. Entomol. 38: 298 302. Mishra, S., P. Kuman, and A. Malik. 2013. Preparation, characterization, and insecticidal activity evaluation of three different formulations of Beauveria bassiana against Musca domestica Parasitol. Res. 112: 3485 3495. Mohamed, F. S. A., M. M. Abbassy, Z. E. A. Drwish, G. E. Tetreault, A. S. Marzouk, M. A. Shoukry, D. J. Fryauff, and G. M. Beavers. 2000. Effects of permethrin on the salivary glands and neuroendocrine organs of unfed female Hyalomma ( Hyalomma ) dromedarii (Ixodoidea: Ixodidae). J. Med. Entomol. 37: 393 400.

PAGE 206

206 Moraes Filho, J., A. Marchili, F. A. Nieri Bastos, L. J. Richtzenhain, and M. B. Labruna. 2011. Genetic analysis of ticks belonging to the Rhipicephalus sanguineus group in Latin America. Acta. Trop. 117: 51 55. Morgan, J. A. T., S. W. Corley, L. A. Jackson, A. E. Lew Tabor, P. M. Moolhuijzen, and N. N. Jonsson. 2009. Identification of a mutation in the para sodium channel gene of the cattle tick Rhipicephalus ( Boophilus ) microplus associated with resistance to synthetic pyrethroid acaricides. J. Parasitol. 39: 775 779. Mota Sa nchez, D., M. E. Whalon, R. M. Hollingworth, and Q. Xue. 2008. Documentation of pesticide resistance in arthropods, pp.32 39. In M. E. Whalon, D. Mota Sanchez, and R. M. Hollingworth (eds.), Global pesticide resistance in arthropods. CAB International, Cambridge. Mounsey, K. E., C. J. Pasay, L. G. Arlian, M. S. Morgan, D. C. Holt, B. J. Currie, S. F. Walton, and J. S. McCarthy. 2010. Increased transcription of Glutathione S transferases in acaricide exposed scabies mites. Parasite. Vector doi: 10. 1186/1756 3305 3 43 Mumcuoglu, K. Y., K. Frish, B. Sarov, E. M anor, E. Gross, Z. Gat, and R. Galun. 1 993. Ecological studies on the brown dog tick Rhipicephalus sanguineus (Acari: Ixodidae) in southern Israel and its relationship to spotted fever group rickettsiae. J. Med. Entomol 30: 114 121. Murphy, G. L., S. A. Ewing, L. C. Whitworth, J. C. Fox, and A. A. Kocan. 1998. A molecular and serologic survey of Ehrlichia canis, E. chaffeensis, and E. ewingii in dogs and ticks from Oklahoma. Vet. Parasit ol. 79: 325 339. Murrell, A., and S. C. Barker. 2003. Synonymy of Boophilus Curtice, 1891 with Rhipicephalus Koch 1844 (Acari: Ixodidae). Syst. Parasitol. 56: 169 172. Murrell, A., N. J. H. Campbell, and S. C. Barker. 2002. Phylogenetic analyses of the Rhipicephanine ticks indicate that the genus Rhipicephalus is paraphyletic. Mol. Phylogen. Evol. 16: 1 7. Nakao, T., A. Naoi, N. Kawahara, and K. Hirase. 2010. Mutation of the GABA receptor associated with fipronil resistance in the whitebacke d plant hopper, Sogatella furcifera P estic. Biochem. Phys 97: 262 266. Narahashi, T. 1986. Toxins that modulate the sodium channel gating mechanism. Ann. N. Y. Acad. Sci. 479: 133 151. Ndip, L. M., R. N. Ndip, V. E. Ndive, J. A. Awuh, D. H. Walker, and J. W. McBride 2007. Ehrlichia species in Rhipicephalus sanguineus ticks in Cameroon. Vector Borne Zoonot. 7: 221 227. Needham, G. R., and P. D Teel. 1991. Off host physio logical ecology of ixodid ticks. Annu. Rev. Entomol. 36 : 659 681.

PAGE 207

207 Nelson, V. A. 1969. Human parasitism by the brown dog tick. J. Econ. Entomol. 62: 710 712. Nicholson, W. L., D. E. Sonenshine, R. S. Lane, and G. Uilenberg. 2009. Ticks (Ixodida) pp. 493 538. In G. R. Mullen and L. A. Durden 2 nd ed Medical and Veterin ar y Entomology. Elsevier Inc. San Diego, CA. Oberkirchner, U., K. E. Linder, S. Dunston, P. Bizikova, and T. Olivry. 2011. Metaflumizone amitraz (Promeris) associated pustular acantholytic dermatitis in 22 dogs: evidence suggests contact drug triggered pe mphigus foliace us. Vet. Dermatol. 22: 436 448. Oliveira, P. R., G. H. Bechara, S. E. Denardi, and M. A. Pizaono. 2011. Toxicity effect of the acaricide fipronil in semi engorged females of the tick Rhipicephalus sanguineus (Latreille, 1806) (Acari: Ixo didae): preliminary determination of the minimum lethal concentration and LC 50 Exp. Parasitol. 127: 418 422. Oliveira, P. R., G. H. Bechara, M. A. Morales, and M. I. Mathias. 2009. Action of the chemical agent fipronil on the reproductive process of s emi engorged females of the tick Rhipicephalus sanguineus (Latre ille, 1806), (Acari:Ixodidae) u ltrastructural evaluation of ovary cells. Food Chem. Toxicol. 47: 1255 1264. Oliveira, P. R., G. H. Bechara, S. E. Denardi, K. C. Saito, E. T. Nunes, M. P. Sz ab, and M. I. Mathias. 2005. Comparison of the external morphology of Rhipicephalus sanguineus (Latreille, 1806) (Acari: Ixodidae) ticks from Brazil and Argentina. Vet. Parasitol. 129: 139 147. Cabrera, A Turberg, L. M. Field, B. A. Wallace, and T. G. E. Davies. 2013. Predictive 3D modeling of the interactions of pyrethroids with the voltage gated sodium channels of ticks and mites. Pest Manag. Sci. doi: 10.1002/ps.3561. Otranto, D., R. P. Lia, C. Can tacessi, G. Galli, P. Paradies, E. Mallia, and G. Capelli. 2005. Efficacy of a combination of imidacloprid 10%/ permethrin 50% versus fipronil 10% / ( S ) methoprene 12%, against ticks in naturally infected dogs. Vet. Parasitol. 130: 293 304. Oyamada, M., B. Davoust, M. Boni, J. Dereure, B. Bucheton, A. Hammad, K. Itamoto, M. Okuda, and H. Inokuma. 2005. Detection of Babesia canis rossi, B. canis vogeli, and Hepatozoon canis in dogs in a village of Eastern Sudan by using a screening PCR and sequencing methodologies. Clin. Vaccine Immunol. 12: 1343 1346. Park, Y., and M. F. G. Taylor. 1997. A novel mutation L1029H in sodium channel gene hscp associated with pyrethroid resistance for Heliothis virescens (Lepidoptera: Noctuidae). Insect Biochem. Mol. Biol. 27: 9 13.

PAGE 208

208 Pasay, C., L. Arlian, M. Morgan, R. Gunning, L. Rossiter, D. Holt, S. Walton, S. Beckham, and J. McCarthy. 2009. The effect of insecticide synergists on the response of scabies mites to pyrethroid acaricides. Plos. Negl ect. Trop D 3 : e354. doi:10.1371/journal.pntd.0000354. Pereira, C. P. M, P. R. Oliveira, K. C. S. Furquim, G. H. Bechara, and M. I. Camargo Mathias. 2009. Effects of fipronil (active ingredient of Frontline ) on salivary gland cells of Rhipicephalus sanguineus female s (Latreille, 1806) (Acari: Ixodidae). Vet. Parasitol. 166: 124 130. Perez, M., Y. Rikihisa, and B. Wen. 1996. Ehrlichic i a canis like agent isolated from a m an in Ve nezuela: antigenic and genetic c haracterization. J. Clin. Microbiol. 34: 2133 2 1 39. P icollo, M. I., C. V. Vassena, A. A. Casadio, J. Massimo, and E. N. Zebra. 1998. Laboratory studies of susceptibility and resistance to i nsecticides in Pediculus capitis (Anoplura : Pediculidae) J. Med. Entomol. 35: 814 817. Piesman, J., and M. Dolan. 2002. Protection against Lyme disease spirochete transmission provided by prompt removal of nymphal Ixodes scapularis (Acari: Ixodidae). Parasitol. Res. 107: 735 739. Piesman, J., T. N. Mather, R. J. Sinsky, and R. Spielman 1987. Duration of tick a ttachment and Borrelia burgdoferi transmission. J. Clin. Microbiol. 25: 557 558. Pimprikar, G. D., and G. P. Georghiou. 1979. Mechanisms of resistance to diflubenzuron in the house fly Musca domestica (L.). Pestic. Biochem. Physiol. 12: 10 22. Pitte ndrigh, B., K. Aronstein, E. Zinkovsky, O. Andreev, B. Campbell, J. Daly, S. Trowell, and R. H. ffrench Constant. 1997. Cytochrome P450 genes from Helicoverpa armigera : e xpression in a pyrethroid suspceptible and resistant strain. Insect Biochem. Mol. Biol. 27: 507 512. Pridgeon, J. W., L. Zhang, and N. Liu. 2003. Over expression of CYP4G19 associated with a pyrethroid resistant strain of the German cockroach, Blattella germanica (L.) Gene 314 : 157 163 Pruett, J. H., F. D. Guerrero, and R. Hern andez. 2002. Isolation and i dentification of an esterase from a Mexican strain of Boophilus microplus (Acar i: Ixodidae). J. Econ. Entomol. 95: 1001 1006. Prullage, J. B., H. V. Tran, T. Timmons, J. Harriman, S. T. Chester, and K. Powell. 2011. The co mbined mode of action of fipronil and amitraz on the motility of Rhipicephalus sanguineus Vet. Parasitol. 179: 302 310. Raffa, K. F., and T. M. Priester. 1985. Synergists as research tools and control agents in agriculture. J. Agric. Entomol. 2: 27 45.

PAGE 209

209 R andolph S. E. 1979. Population regulation in ticks: the role of acquired resistance in natural and unnatural hosts. Parasitology. 79: 141 156. Rechav, Y., and P. A. Nuttall. 2000. The effect of male ticks on the feeding performance of immature stages of Rhipicephalus sanguineus and Amblyomma americanum (Acari: Ixodidae). Exp. Appl. Acarol. 24: 569 578. Rhodes, A. R., and B. R. Norment. 1979. Hosts of Rhipicephalus sanguineus (Acari: Ixodidae) in Northern Mississippi, USA. J. Med. Entomol. 16: 488 492. Ribeiro, V. L. S., V. Rolim, S. Bordignon, A. T. Henriques, G. G. Dorneles, R. P. Limberger, and G. von Poser. 2008. Chemical composition and larvicidal properties of the essential oils from Drimys brasiliensis Miers (Winteraceae) on the cat tle tick Rhipicephalus ( Boophilus ) microplus and the brown dog tick Rhipicephalus sanguineus. Parasitol. Res. 102: 531 535. Ribeiro, V. L. S., J. C. dos Santos, J. R. Martins, J. Schripsema, I. R. Siqueria, G. L. von Poser, and M. A. Apel. 2011. Acaric idal properties of the essential oil and precocene II obtained from Calea serrata (Asteraceae) on the cattle tick Rhipicephalus ( Boophilus ) microplus (Acari: Ixodidae). Vet. Parasitol. 179: 195 198. Rinkevich, F. D., Y. Du, and K. Dong. 2013. Diversity and convergence of sodium channel mutations involved in resistance to pyrethroids. Pestic. Biochem. Phys. 106: 93 100. Ristic, M., J. Dawson, C. J. Holland, and A. Jenny. 1988. Susceptibility of dogs to infection with Ehrlichia risticii causative a gent of equine monocytic ehrlichiosis (Potomac hor se fever). Am. J. Vet. Res. 49: 1 497 1500. Robertson, J. L., and H. K. Preisler. 1992. Pesticide bioassays with a rthropods CRC Press, Boca Raton, FL. Rodrguez Mallon, A., E. Fernndez P. E. Encinosa, Y B ell o, L Mndez Prez, L C Ruiz, D Prez, M Gonzlez, H Garay, O Reyes, L Mndez, and M P Estrada. 2012. A novel tick antigen shows high vaccine efficacy against the dog tick, Rhipicephalus sanguineus Vaccine 30 : 1782 1789. Roma, G. C., P. R. Oliveira, M. A. Pizano, and M. I. Camargo Mathias. 2009. Determination of LC 50 of permethrin acaricide in semi engorged females of the tick Rhipicephalus sanguineus (Latreille, 1806) (Acari: Ixodidae). Exp. Parasitol. 123: 269 272. Rosario Cruz, R., F. D. Guerrero, R. J. Miller, R. I. Rodriquez Vivas, M. Tijerina, D. I. Dominguez Garcia, R. Hernandez Ortiz, A. J. Cornel, R. D. McAbee, and M. A. Alonso Diaz. 2009. Molecular survey of pyrethroid resistance mechanisms in Mexican field populations of Rhipicephalus ( Boophilus ) microplus. Parasitol. Res. 105: 1145 1153.

PAGE 210

210 Roush, R. T., and B. E. Tabashnik. 1990. Pesticide resistance. Chapman & Hall, New York. Rozen, S. and H. J. Skaletsky. 1998. Primer3. http://www genome.wi.mit.edu/genome_software/other/primer3.html. Rugg, D., and J. A. Hair. 2007. Dose determination of a novel formulation of metaflumizone plus amitraz for control of cat fleas ( Ctenocephalides felis f elis ) and brown dog tick ( Rhipicephalus sanguineus ) on dogs. Vet. Parasitol. 150: 203 208. Sabatini, G. A., D. H. Kemp, S. Hughes, A. Nari, and J. Hansen. 2001. Test to determine LC 50 and discriminating doses for macrocyclic lactones against the cattle tick, Boophilus microplus Vet. Parasitol. 95: 53 62. Samish, M., H. Ginsberg, and I. Glazer. 2004. Biolog ical control of ticks. Parasitology. 129: 389 403. Samish, M., G. Gindin, E. Alekseev, and I. Glazer. 2001. Pathogenicity of entomopathogenic fungi to different developmental stages of Rhipicephalus sanguineus (Acari: Ixodidae). J. Parasitol. 87: 1355 1359. St. Aubin, F. E 1990. Mites and Ti cks, pp. 741 769. In Mallis (ed.), Handbook of Pest Control, 7 th ed. Franzak & Foster, Cleveland, OH St. Leger, R. J. A. K. Charnley, and R. M. Cooper. 1986. Cuticle degrading enzymes of entomopathogenic fungi: Mechanisms of interaction between pathogen enzymes and insect cuticle J. Invertebr. Pathol. 47: 295 302. Savin, N. E., J. L. Robertson, a nd R. M. Russel. 1977. A critical evaluation of bioassay in insecticide research: likelihood ratio tests of dose mortality regression. Bull. Entomol. Soc. Am. 23 : 257 261. Sayyed, A. H. and D. J. Wright. 2004. Fipronil resistance in the diamondback moth (Lepidoptera: Plutellidae): inheritance and number of genes involved. J. Econ. Entomol. 97: 2043 2050. Scharf, M. E., B. D. Siegfriend, L. J. Meinke, and L. D. Chandler. 2000. Fipronil metabolism, oxidative sulfone formation and toxicity among orga nophosphate and carbamate resistant and susceptible western corn rootworm populations. Pest Manag. Sci. 55: 757 766. Schreck, C. E., E. L. Snoddy, and G. A. Mount. 1980. Permethrin and repellents as clothing impregnants for protection from the lone star tick. J. Econ. Entomol. 73: 436 439.

PAGE 211

211 Scott, J. G. 1990. Investigating mechanisms of insecticide resistance: methods, strategies, and pitfalls, pp. 39 57. In R. T. To ush and B. E. Tabasnik (eds.), Pesticide resistance in arthropods. Chapman and Hall, New York. Scott, J. G., and G. P. Georghiou. 1985. Rapid development of high level permethrin resistance in a field collected strain of the house fly (Diptera: Muscid ae) under laboratory selection. J. Econ. Entomol. 78: 316 319. Scott, J. G., and G. P. Georghiou. 1986. Mechanisms responsible for high levels of permethrin resistance in the house fly. Pest Manag. Sci. 17: 195 206. Scott, J. G., and F. Matsumura. 1981. Characteristics of a DDT induced case of cross resistance to permethrin in Blattella germanica Pestic. Biochem. Phys. 16: 21 25. Segura Porta, F., G. Diestre Ortin, A. Ortuno Romero, I. Sanfeliu Sala, B. Font Creus, T. Munoz Espin, E. Mateu de Antonio, and J. Casala Fabrega 1998. Prevalence of antibodies to spotted fever group rickettsiae in human beings and dogs from an endemic area of Mediterranean spotted fever in Catalonia, Spain. European. J. Epidemiol. 14: 395 398. Shaw, R. D. 1966 Culture of an organophosphorus resistant strain of Boophilus microplus (Can.) and an assessment of its resistance spectrum. B Entomol. Res. 53 : 563 578. Silverman, J., and D. N. Bieman. 1993. Glucose aversion in the German cockroach, Blattella german ica J. Insect Physiol. 39: 925 933. Silveira, J. A. G., L. M. F. Passos, and M. F. B. Ribeiro. 2009. Population dynamics of Rhipicephalus sanguineus (Latrielle, 1806) in Belo Horizonte, Minas Gerais state, Brazil. Vet. Parasitol. 161: 270 275. Snyde r, D. E., L. R. Cruthers, and R. L. Slone 2009. Preliminary study on the acaricidal efficacy of spinosad administered orally to dogs infested with the brown dog tick, Rhipicephalus sanguineus (Latreille, 1806) (Acari: Ixodidae). Vet. Parasol. 166: 131 135. Soderlu nd, D. M., and J. R. Bloomquist. 1989. Neurotoxic actions of pyrethroid insecticides. Ann. Rev. Entomol. 34: 77 96. Solberg, V. B K. Neidhardt, M. R. Sardelis, F. J. Hoffmann, R. Stevenson, L. R. Boobar, and H. J. Harlan. 1992. Field evaluation of two formulations of cyfluthrin for control of Ixodes dammini and Ambylomma americanum (Acari: Ixodidae). J. Med. Entomol. 29: 634 638. Srivastava, S. C., and M. G. R. Varma. 1964. The culture of the tick Rhipicephalus sanguineus (Latreill e) (Ixodidae) in the laboratory. J. Med. Ent omol 1: 154 157.

PAGE 212

212 Stone, B. F., and K. P. Haydock. 1962. A method for measuring the acaricide susceptibility of the cattle tick Boophilus microplus (Can.). Bull. Entomol. Res. 78: 563 578. Stout II, D. M., K. D. Bradham, P. P. Egeghy, P. A. Jones, C. W. Croghan, P. A. Ashley, E. Pinzer, W. Friedman, M. C. Brinkman, M. G. Nishioka, and D. C. Cox. 2009. American healthy homes survey: a national study of residential pesticides measured from floor wipes. Env iron. Sci. Technol. 43: 4294 4300. Sun, Y. P., and E. R. Johnson. 1972. Quasi synergism and penetration of insecticides. J. Econ. Entomol. 65: 350 353. Sweatman, G. K. 1967. Physical and biological factors affecting the longevity and oviposition of engorged Rhipicephalus sanguineus female ticks. J. Parasitol. 53: 432 455. Syvanen, M., Z. Zhou, J. Wharton, C. Goldsbury, and A. Clark. 1996. Heterogeneity of the glutathione transferase genes encoding enzymes responsible for insecticide degradati on in the housefly. J. Mol. Evol. 43: 236 240. Szab, M. P., and G. H. Bechara. 1997. Immunisation of dogs and guinea pigs against Rhipicephalus sanguineus ticks using gut extract. Vet. Parasitol. 68: 283 294. Szab, M. P., A. J. Mangold, C. F. Joao, G. H. Bechara, and A. A. Guglielmone. 2005. Biological and DNA evidence of two dissimilar populations of the Rhipicephalus sanguineus tick group (Acari: Ixodidae) in South America. Vet. Parasitol. 130: 131 140. Tang, J., J. Li, Y. Shao, B. Yang, and Z Liu. 2010. Fipronil resistance in the whitebacked planthopper ( Sogatella furcifera ): possible resistance mechanisms and cross resistance. Pest Manag. Sci. 66: 121 125. Trager, W. 1939. Acquired immunity to t icks. J. Parasitol. 25 : 5 81. Unver, A., M. Perez, N. Orellana, H. Huang, and Y. Rikihisa. 2001. Molecular and antigenic comparison of Ehrlichia canis isolates from dogs, ticks, and a human in Venezuela. J. Clin. Microbiol. 39: 2788 2 792. Vazquez Cruz, C., and Garcia Vazquez. 1999. Seasona l distribution of Rhipicephalus sanguineus ticks (Acari: Ixodidae) on dogs in an urban area o f Morelos, Mexico. Exp. Appl. Acarol 23: 277 280. Vinson, B. S., and P. K. Law. 1971. Cuticular composition and DDT resistance in the tobacco bud worm. J. Ec on. Entomol. 64: 1388 1390.

PAGE 213

213 Wang, C., M. E. Scharf, and G. W. Bennet. 2004. Behavioral and physiological resistance of the German cockroach to gel baits (Blattodea: Blattellidae). J. Econ. Entomol. 97: 2067 2072. Wei, S. H., A. G. Clark, and M. Syvane n. 2001. Identification and cloning of a key insecticide metabolizing glutathione S transferase (MdGST 6A) from a hyper insecticide resistant strain of housefly Musca domestica. Insect Biochem. Mol. Biol. 31: 1145 1153. Whitmore, R. W., F. W. Immerma n, D. E. Camann, A. E. Bond, R. G. Lewis, and J. L. Schaum. 1994. Non occupational exposures to pesticides for residents of two U.S. cities. Arch. Environ. Contam. Toxicol. 26: 47 59. Winston, P. W., and D. H. Bates. 1960. Saturated solutions for t he control of humidity in biological research. Ecology. 41: 232 237. Wulansari, R., A. Wijaya, H. Ano, Y. Horii, T. Nasu, S. Yamane, and S. Makimura. 2003. Clindamycin in the treatment of Babesia gibsoni infections in dogs. J. Am. Anim. Hosp. Assoc. 39: 558 562. Yoder, J. A., A. J. Jajack, B. Z. Hedges, and J. B. Benoit. 2013. Off host aggregation in the non fed, female brown dog tick, Rhipicephalus sanguineus (Latreille), is induced by tick excreta and enhanced by low relative humidity. Med. Ve t. Entomol. 27: 209 215. Young, D. R., R. G. Arther, and W. L. Davis. 2003. Frontline Plus topical treatments to repel brown dog ticks ( Rhipicephalus sanguineus ) on dogs. Parasitol. Res. 90: S116 S118. Yu, S. J. 1996. Insect glutathione S transferase. Zool. Stud. 36: 9 19. Yu, S. J. 2008. The toxicology and biochemistry of insecticides. CRC Press, Boca Raton, FL. Zettler, L. J., and G. W. Cuperusi. 1990. Pesticide resistance in Triboluim castaneum (Coleoptera: Tenebrionidae) and Rhyzopertha dominica (Coleoptera: Bostrichidae) in wheat. J. Econ. Entomol. 83: 1677 1681. Zhao, X., V. L. Salgado, J. Z. Yeh, and T. Narahashi. 2003. Differential actions of fipronil and dieldrin insecticides on GABA gated chlorid e channels in cockroach neurons. J. Pharmacol. Exp. Ther. 306: 914 924. Zhao, X., J. Z. Yeh, V. L. Salgado, and T. Narahashi. 2005. Sulfone metabolite of fipronil blocks aminobutyric acid and glutamate activated chloride channels in mammalian and i nsect neurons. J. Pharmacol. Exp. Ther. 314: 363 373. Zheng, H., A. Y. Li, L. J. Fielden, J. Liu, J. Seshu, and A. A. Prez de Len. 2013. Effects of permethrin and amitraz on gas exchange and water loss in unfed adult

PAGE 214

214 females of Amblyomma americanum ( Acari: Ixodidae). Pestic. Biochem. Phys. In press. Zhioua, E., M. Browning, P. W. Johnson, H. S. Ginsberg, and R. A. LeBrun. 1997. Pathogenicity of the entomopathogenic fungus Metarhizium anisopliae (Deuteromycetes) to Ixodes scapularis (Acari: Ixo didae). J. Parasitol. 83: 815 818. Zhu, F., J. Wigginton, A. Romero, A. Moore, K. Ferguson, R. Palli, M. F. Potter, K. F. Haynes, and S. R. Palli. 2010. Widespread distribution of knockdown resistance mutations in the bed bug, Cimex lectularius (Hemipt era: Cimicidae), populations in the United States. Arch. Insect Biochem. 73: 245 257.

PAGE 215

215 BIOGRAPHICAL SKETCH Amanda Eiden was born and raised in Wisconsin. She received her undergraduate degree in b iology and Spanish from the University of Wisconsin Stev ens Point. During her undergraduate years she developed a passion for travel and an interest in the disproportionate levels of disease that were found in less developed parts of the world. This led her to enroll at the University of South Florida in Tamp a to pursue a Master in global communicable disease and infection control. During her program she was able to spend three months doing community outreach work in Panama. While completing her m a ster s degree she also worked full time f or the Department of Health, which gave her great exposure to different areas of public health. Amanda began her employment with the Department of Health as an Environmental Scientist Specialist then transferred to work as an Ep idemiologist At this time her interest had peaked within the field of vector borne disease ecology. After completing her m aster s degree she began the Ph D program in entomology a t the University of Florida. Her emphasis wa s on medical a nd veterinary ent on evaluating the presence and mechanisms of pesticide re sistance in brown dog ticks. Despite conducting research for the majority of her time at the University of Florida, Amanda developed her interest in extension. She took opportunities to interact with stakeholders and members of the public either through her project directly or during community outreaches. Towards the end of her Ph.D studies, Amanda found her overall interest was in ext ension and she took a class in agricultural e xtension that proved to her that this was the area she desired to pursue in her post Ph.D. career. Amanda think s that it is important to understand science, research, and how programs in health and agriculture function i n order to create a

PAGE 216

216 systems approach to problem solving. Her career goal is to work in project management for an international organization focusing on vector borne disease prevention.