Archaeal E1- and Ubiquitin-Like Proteins

MISSING IMAGE

Material Information

Title:
Archaeal E1- and Ubiquitin-Like Proteins Regulation and Roles in Sulfur Mobilization and Protein Modification in Haloferax volcanii
Physical Description:
1 online resource (201 p.)
Language:
english
Creator:
Chavarria, Nikita E
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Microbiology and Cell Science
Committee Chair:
MAUPIN,JULIE A
Committee Co-Chair:
ROMEO,TONY
Committee Members:
SHANMUGAM,KEELNATHAM T
LORCA,GRACIELA L
BROCCHIERI,LUCIANO

Subjects

Subjects / Keywords:
archaea -- modification -- protein -- regulation -- ubiquitin
Microbiology and Cell Science -- Dissertations, Academic -- UF
Genre:
Microbiology and Cell Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
The regulation and biological roles of ubiquitin-like proteins termed small archaeal modifier proteins (SAMP1/2/3) and the E1-like activating enzyme in sulfur mobilization and protein conjugation are not well characterized in archaea. This study sought to characterize the mode in which SAMPs are regulated at the transcript level by environmental signals in the halophilic archaeon, Haloferax volcanii. This work provides evidence that samp gene neighbors are conserved in many haloarchaea, samp transcripts are leaderless and have extended 3’-untranslated regions, samp1 and samp3 transcript levels are inducible by dimethyl sulfoxide, and samp transcripts may be regulated at the posttranscriptional level during varying growth conditions. This study also sought to identify and characterize proteins important for 2-thiolation of tRNAs with a uridine in the wobble position and to determine whether SAMP1/2/3, UbaA, and a THI4 protein homolog are important for thiamine biosynthesis in Hfx. volcanii. This work also provides evidence that an Ncs6/Tuc1 homolog, NcsA, is essential for maintaining cellular pools of thiolated tRNALysUUU and optimal growth at elevated temperature in complex medium. In addition, NcsA was found to associate with UbaA and SAMP2 based on mass spectrometry (MS) analysis of purified protein fractions. UbaA mediates covalent and non-covalent associations of NcsA with SAMP2 and NcsA Lys204 is isopeptide linked to SAMP2. NcsA was also found to be covalently modified by poly-SAMP2 chains. Additional proteins identified by MS-analyses to be associated with NcsA included homologs of the proteasome activating nucleotidase A/1 (PAN-A/1, HVO_0850), and an archaeal cleavage and polyadenylation specificity factor 1 (aCPSF1, HVO_0874). NcsA also forms a complex with aCPSF1. To further investigate SAMP-mediated sulfur mobilization relating to thiamine biosynthesis, a triple SAMP1/2/3 deletion and a UbaA deletion strain were found to not display thiamine auxotrophy. However,deletion of a putative thiazole biosynthetic gene, hvo_0665, and site-directed mutagenesis of a conserved catalytic cysteine, Cys165, expressed in the hvo_0665 mutant displayed partial thiamine auxotrophy. Taken together, these results provide evidence of samp regulation, the involvement of SAMP2, UbaA, and NcsA in 2-thiouridine formation, and also present the first characterization of a THI4 homolog in haloarchaea.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Nikita E Chavarria.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: MAUPIN,JULIE A.
Local:
Co-adviser: ROMEO,TONY.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0046209:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 ARCHAE A L E1 AND UBIQUITIN LIKE PROTEINS: REGULATION AND ROLES IN SULFUR MOBILIZATION AND PROTEIN MODIFICATION IN Haloferax volcanii By NIKITA ELIZABETH CHAVARRIA A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVE RSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Nikita Elizabeth Chavarria

PAGE 3

3 To my husband, Enmanuel Chavarria, who has b een my rock and avid supporter, and to my parents Raulston Nembhard and Heather Nembhard, for th eir continued love and steadfast support

PAGE 4

4 ACKNOWLEDGMENTS First and foremost, I acknowledge God, my heaven ly Father, for continual strength steadfastness love, and guidance through all life experiences. Without Him, nothing in my life would be possible. I also express great appreciation and thankfulness for my committee chair, Dr. Julie A. Maupin Furlow. Under her tutelage, I gained a greater understandi ng of the attributes a scientist must possess in order to be successful. I also thank my committee members, Dr. K.T. Shanmugam, Dr. Tony Romeo, Dr. Graciela Lo rca, and Dr. Luciano Brocchieri for their guidance and excellent advice during my graduate studi es. I especially thank Dr. K.T. Shanmugam for taking the time to discuss graduate school and external funding opportunities with me as an undergraduate and also for helping me secure my position as an undergraduate and graduate researcher with Dr. Maupin F urlow. For this, I am grateful. I also express a very spe cial and resounding thanks to past and current lab members who have cultivated such a superb research environment. Specifically, I would like to acknowledge Hugo Miranda and Dr. Laurence Prunetti for being extremely supportive, lending scientific advice, and for having an excellent sense of humor. I would also like to acknowledge undergraduate students I have had the privilege of mentoring. Specifically, I acknowledge Desir Javier for her help with RNA extraction s, Dina Elbanna, for her assistance with plasmid construction, and Stephen McHugh, for h elp with generating the deletion of a thiamine biosynthetic gene. I would al so like to thank our collaborato rs at Yale University, Dr. Dieter S ll, Dr. Ma rkus Englert, and Dr. Dan Su, for running the tRNA thiolation assays. I also would like to acknowledge the night Doctoral Fellowship and the Office of Graduate

PAGE 5

5 Minority Programs for my graduate fellowship and for also establishi ng and fostering a strong support network for minority graduate students at the University of Florida. I extend deep gratitude to my parents, Rev. Dr. Raulston and Heather Nembhard, who taught me that an education humility, and faith are all necessary com ponents for survival. Finally I would like to thank my husband, Enmanuel Chavarria, my rock and my world, for his constant love, support, and understanding throughout the years. I would like to thank him for always, unhesitatingly, lending a shoulder to le an on and especially for accompanying me for weekend runs to the lab, for overnight growth curve readings, and also bringing lunch and dinner when necessary.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 LIST OF ABBREVIATIONS ................................ ................................ ........................... 12 ABSTRACT ................................ ................................ ................................ ................... 16 CHAPTER 1 LITERATURE REVIEW ................................ ................................ .......................... 18 Introduction ................................ ................................ ................................ ............. 18 An Overview of the Ubiquitin System ................................ ................................ ...... 18 Discovery of Ubiquitin ................................ ................................ ....................... 19 Ubiquitin Structure ................................ ................................ ............................ 19 Ubiquitin Conjugation a nd Deconjugation ................................ ........................ 21 Non Proteolytic Roles of Ubiquitin ................................ ................................ .... 23 Regulation of Ubiquitin Gene Expression ................................ ......................... 25 Ubiquitin Like Proteins (UBLs) ................................ ................................ ................ 28 Prokaryotic Ubiquitin Like Protein (Pup) ................................ ........................... 29 Small Ubiquit in Like Modifier (SUMO) ................................ .............................. 30 Ubiquitin Related Modifier (Urm1) ................................ ................................ .... 31 UBLs and Their Involvement in Sulfur Chemistry ................................ ................... 32 Molybdenum Cofactor Biosynthesis ................................ ................................ 35 Thiamine Biosynthesis ................................ ................................ ...................... 37 Thionucleside Bio synthesis ................................ ................................ .............. 39 Ubiquitin like Proteins in Archaea ................................ ................................ ........... 45 SAMP Conjugation and Deconjugation ................................ ............................ 46 Proteins Modified by SAMPs ................................ ................................ ............ 48 Involvement of SAMPs in Sulfur Mobilization ................................ ................... 49 Project Rationale and Desi gn ................................ ................................ ................. 51 2 METHODS AND MATERIALS ................................ ................................ ................ 57 Chemicals, Media, and Strains ................................ ................................ ............... 57 Chemicals and Reagents ................................ ................................ ................. 57 Strains, Media and Plasmids ................................ ................................ ............ 58 DNA Procedures ................................ ................................ ................................ ..... 61 DNA Purification and Electrophoresis ................................ .............................. 61 Polymerase Chain Reaction (PCR) ................................ ................................ .. 61 Cloning ................................ ................................ ................................ ............. 62

PAGE 7

7 Site Directed Mutagenesis ................................ ................................ ............... 63 Generation of Hfx. volcanii THI4 Deletion Strain ................................ .............. 63 Southern Blo t Analysis ................................ ................................ ..................... 64 RNA Procedures ................................ ................................ ................................ ..... 66 Total RNA Isolation ................................ ................................ .......................... 66 RT (q) PC R, RT PCR ................................ ................................ ....................... 67 Northern Blot Analysis ................................ ................................ ...................... 68 Mapping Transcript Ends ................................ ................................ .................. 69 RNA Fold Prediction ................................ ................................ ......................... 70 Assay for tRNA Thiolation ................................ ................................ ................ 70 Protein Procedures ................................ ................................ ................................ 71 Bioinformatics ................................ ................................ ................................ ... 71 Fold Recognition and 3D Structural Modeling ................................ .................. 72 Galactosidase Assay ................................ ............. 72 Desampylation (HvJAMM1) Assay ................................ ................................ ... 73 Protein Purification ................................ ................................ ........................... 74 Protein Quantification ................................ ................................ ....................... 75 Mass Spectrometry ................................ ................................ .......................... 75 Immunoblotting ................................ ................................ ................................ 76 3 TRANS CRIPT ANALYSIS OF THE UBIQUITIN LIKE SAMPYLATION SYSTEM GENES OF Hfx. volcanii ................................ ................................ ......................... 88 Introduction ................................ ................................ ................................ ............. 88 Results and Discussion ................................ ................................ ........................... 91 SAMP Genomic Context is Conserved Among Many Haloarchaea ................. 91 SAMP1 and SAMP3 Transcripts are Induced by DMSO ................................ .. 95 UTRs .................... 96 SAMP Gene Transcripts may be Regulated at the Post Transcriptional Level During Certai n Growth Conditions and Environmental Stress ........... 101 Different nitrogen sources ................................ ................................ ........ 101 Heat shock ................................ ................................ ............................... 103 Cold shock ................................ ................................ ............................... 105 DMSO respiration versus oxygen respiration and aerobic growth in the presence of DMSO ................................ ................................ ............... 106 Conclusion ................................ ................................ ................................ ............ 108 4 Ncs6/Tuc1 HOMOLOG (NcsA) IS REQUIRED FOR tRNA Lys UUU THIOLATION AND IS ASSOCIATED WITH UBIQUITIN PROTEASOME AND RNA PROCESSING SYSTEM HOMOLOGS IN ARCHAEA ................................ ......... 127 Introduction ................................ ................................ ................................ ........... 127 Results and Discussion ................................ ................................ ......................... 129 NcsA and its Haloarchaeal Orth ologs Form a Distinct Subgroup within the tRNA Thiolase Active Site Residues. ................................ .......................... 129

PAGE 8

8 NcsA is Necessary for Thio Modification of Lysine tRNA with a Wobble Uridine ................................ ................................ ................................ ......... 130 NcsA is Necessary for Growth at Elevated Temperatures .............................. 131 UbaA Mediates Covalent and Non Covalent Associations of NcsA with SAMP2 ................................ ................................ ................................ ........ 132 NcsA Lys204 is Isopeptide Linked to SAMP2 ................................ ................. 137 NcsA is Covalently Modified by Poly S AMP2 Chains ................................ ..... 137 NcsA is Associated with Homologs of Ubiquitin Proteasome and RNA Processing/Translation Systems Based on MS/MS ................................ .... 138 NcsA is Associated with UbaA and PAN A/1 Based on Immunoblotting ........ 139 NcsA and aCPSF1 Form a Complex ................................ .............................. 139 Conclusion ................................ ................................ ................................ ............ 141 5 A THI4 HOMOLOG IS REQUIRED FOR THIAMINE BIOSYNTHESIS IN Hfx. volcanii ................................ ................................ ................................ .................. 160 Introduction ................................ ................................ ................................ ........... 160 Results and Discussion ................................ ................................ ......................... 161 Haloarchaea and Other Select Archaea have THI4 Homologs with a Conserved Active Site Cysteine. ................................ ................................ 161 Deletion of the THI4 and Mutation of the Putative Catalytic Cysteine Conferred a Partial Auxotrophic Requirement for Thiamine in Haloferax volcanii ................................ ................................ ................................ ....... 163 A SAMP Triple Dele tion Strain Does Not Display Thiamine Auxotrophy ........ 166 Conclusion ................................ ................................ ................................ ............ 166 6 SUMMARY AND CONCLUSIONS ................................ ................................ ........ 175 Summary and Findings ................................ ................................ ......................... 175 Future Directions ................................ ................................ ................................ .. 178 LIST OF REFERENCES ................................ ................................ ............................. 180 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 201

PAGE 9

9 LIST OF TABLES Table page 2 1 Strains and plasmids used in Chapter 3. ................................ ............................ 78 2 2 Primers used in Chapter 3. ................................ ................................ ................. 79 2 3 Strains and plasmids used in Chapter 4. ................................ ............................ 84 2 4 Primers used in Chapter 4. ................................ ................................ ................. 85 2 5 Strains and plasmids used in Chapter 5. ................................ ............................ 86 2 6 Primers used in Chapter 5. ................................ ................................ ................. 87 4 1 NcsA co purified proteins identified by LC MS/MS. ................................ .......... 157

PAGE 10

10 LIST OF FIGURES Figure page 1 1 The ubiquitin conjugation mechanism in eukaryotes. ................................ ......... 54 1 2 2 thiouridine biosynthesis in Saccharomyces cerevisiae Arabidopsis thaliana and Thermus thermophilus ................................ ................................ 55 1 3 SAMP conjugation and sulfur transfer ................................ ............................... 56 3 1 The samp1 genomic context is conserved in many haloarchaea. .................... 110 3 2 The samp2 genomic context is conserved in many haloarchaea. .................... 111 3 3 The samp3 genomic context is conserved in many haloarchaea.. ................... 112 3 4 The samp1 gene generates transcript with trkA2 a putative K + channeling homolog ................................ ................................ ................................ ........... 113 3 5 The samp2 gene generates transcript with gnat a putative G CN5 rel ated N acetyltransferase ................................ ................................ ............................. 114 3 6 The samp3 gene generates transcript with hvo_2178 a st ructurally related MoaD protein ................................ ................................ ................................ ... 115 3 7 Detection of samp1 and samp3 transcripts by Northern blot analysis when cells ar e grown in the presence of DMSO ................................ ........................ 116 3 8 mRNA sequence of samp1/2/3 transcr ends .............. 117 3 9 The samp2 and samp3 UTRs possess multiple putative stemloop structures. ................................ ................................ ................................ ......... 119 3 10 The samp1 and samp2 transcripts may be regulated at the post transcriptional level when cells are grown with alanine as the nitrogen source. ................................ ................................ ................................ .............. 121 3 11 The samp1 transcripts are induced by heat shock (60 C) and this effect is transi ent. ................................ ................................ ................................ ........... 122 3 12 The samp and ubaA putative promoter activity is similar during cold shock versus 42 C. ................................ ................................ ................................ .... 124 3 13 The samp and ubaA putative promoter activity is similar during oxygen versus DMSO respiration ................................ ................................ ................ 125 3 14 The samp3 putative promoter activity is similar in the presence versus absence of DMSO during oxygen resp iration. ................................ .................. 126

PAGE 11

11 4 1 Dendrogram analysis of NcsA (ANH) superfamily from archaea, eukaryotes and bacteria. ............................. 146 4 2 3D structural model of Hfx. volcanii NcsA. ................................ ....................... 147 4 3 Multiple amino acid sequence alignment of HVO_0580 with tRNA thio modification (GO: 0034227) ................................ ................................ ............. 148 4 4 Southern blot analysis of ( ) ................................ ................ 149 4 5 HVO_0580 (NcsA) is required for thiolation of tRNA Lys UUU .. ............................. 150 4 6 The strain displays similar growth as H26 (WT) at opt imum gro wth temperature (42 C) ................................ ................................ ......................... 151 4 7 NcsA is required for growth at an elevated temperature (50 C) ...................... 152 4 8 NcsA is covalently assoc iated with SAMP2 thr ough a UbaA dependent mechanism ................................ ................................ ................................ ...... 153 4 9 HvJAMM1 (desampylase) collapses NcsA modified forms and SAMP2 conjugates. ................................ ................................ ................................ ....... 154 4 10 NcsA is modified on Lys204. ................................ ................................ ............ 155 4 11 SAMP2 is associated in apparent poly SAMP2 chains on NcsA. ..................... 156 4 12 UbaA an d PAN A/1 proteins detected in NcsA StrepII purified fractions. ......... 158 4 13 NcsA forms a complex with an archaeal CPSF1 homolog. .............................. 159 5 1 Multiple amino acid sequence alignment of HVO_0665 to eukaryotic THI4 enzymes and archaeal MJ0601 and TK0434 annotated as ribose 1, 5 bisphosphate isomerases ................................ ................................ ................ 168 5 2 Dendrogram analysi s of the THI4 family (IPR002922) including protein members from archaea and select euka ryotes ................................ ................. 169 5 3 3D Structural models of archaeal THI4 family proteins compared to the x ray crystal struct ure of N. crassa THI4p (PDB:3jsk ) ................................ ............... 170 5 4 HvTHI4 gene and its deletion by a markerless pop in/pop out methodology as described in the Materials and Methods section. ................................ ......... 171 5 5 Hvo_0665 (HvTHI4) is associated with thiamine biosynthesis. ......................... 172 5 6 THI4 C165A protein is synthesized to similar levels as wild type THI4. ................ 173 5 7 A samp triple deletion strain does not display thiamine auxotrophy.. ............... 174

PAGE 12

12 LIST OF ABBREVIATIONS A 260 Absorbance at 260 nm A 280 Absorbance at 280 nm A 405 Absorban ce at 405 nm A 595 Absorbance at 595 nm AP Alkaline phosphatase APM [(N acryloylamino) phenyl] mercuric chloride AMP Adenosine monophosphate ATP Adenosine triphosphate ATCC American type culture collection BLAST Basic local alignment search tool Bp Base pair C Carboxyl C Degrees Celsius CAS N ucleocytoplasmic shuttling factor cellular apoptosis susceptibility protein CDP Disodium 2 chloro 5 (4 methoxyspiro {1, 2 dioxetane chloro) tricycle [3.3.1.1 3,7 ]decan} 4 yl) 1 phenyl phosphate CFU Colony forming units CID Collision induced dissociation CPSF Cleavage and polyadenylation specificity f actor CSPD Disodium 3 (4 methoxyspiro {1, 2 di oxetane 3, 2' (5' chloro) tricycle [3.3.1.1 3,7 ]decan} 4 yl) phenyl phosphate C T Threshold count Da Dalton DEPC D ie thylpyrocarbonate

PAGE 13

13 DIG 11 dUTP 2' deoxyuridine 5' triphosphate coupled by an 11 atom spacer to digoxigenin DMSO Dimet h yl sulfoxide DNA Deoxyribonucleic acid DTT Dithiothreitol DUB Deubiquitinating enzyme EDTA Ethylenediaminetetraacetic acid FOA 5 Fluoroorot ic acid Gly Glycine Glu Glutamate HEPES 2 [4 (2 hydroxyethyl) piperazin 1 yl] ethanesulfonic acid HPLC High performance liquid chromatography h Hour IAA iodoacetamide Kd Binding dissociation constant kDa Kilodalton LB Luria Bertani medium LC Liquid chromat ography Lys Lysine M Molar 1 ) MES 2 N morpholinoethanesulfonic acid m g Milligram g Microgram M Micromolar 1 ) min Minutes ml Milliliter

PAGE 14

14 mM Millimolar 1 ) MOPS 3 (N Morpholino) propanesulfonic acid, 4 Morpholinepropanesulf onic acid MS Mass spectrometry MS/MS (MS 2 ) Tandem mass spectrometry N Amino nm Nanometer nt Nucleotide Nv Novobiocin OD Optical Densitiy ONPG o nitrophenyl D galactopyranoside ORF Open reading frame PAN Proteasome activating nucleotidase PAGE Polyacryla mide gel electrophoresis PCR Polymerase chain reaction PDB Protein Data Bank PNK Polynucleotide kinase Pup Prokaryotic ubiquitin like protein PVDF Polyvinyldiflouride RT ( q ) PCR Quantitative reverse transcriptase polymerase chain reaction RBS Ribosomal bin ding site rRNA Ribosomal RNA RNA Ribonucleic acid RPM Revolutions per minute RT Reverse transcriptase SAMP Small archaeal modifier protein

PAGE 15

15 sec Seconds SD Standard deviation SDM Site directed mutagenesis SDS Sodium dodecyl sulfate sRNA small RNA SSC Saline sodium citrate SUMO Small ubiquitin like modifier TAP Tobacco acid pyrophosphatase TBP TATA binding protein TBS Tris buffered saline TBST Tris buffered saline with Tween 20 TFB Transcription factor B Tris N tris (hydroxylmethyl) aminomethane tRNA Transfer RNA U Enzyme activity unit 1 (mg protein) 1 ] Ub Ubiquitin UbaA E1 like activating enzyme of archaea UBL Ubiquitin like URM Ubiquitin related modifier UTR Untranslated region UV Ultraviolet V Volt vol Volume YPC Yeast peptone casamino acids medium

PAGE 16

16 Abstract of Dissertation P resented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ARCHAE A L E1 AND UBIQUITIN LIKE PROTEINS: REGULATION AND ROLES IN SULFUR MOBILIZATION AND PROTEIN MODIFICATION IN Haloferax volcanii By Nikita E. Chavarria December 2013 Chair: Julie A Maupin Furlow Major: Microbiology and Cell Science The regulation and biological roles of ubiquitin like proteins termed small archaeal modifier proteins (SAMP1/2/ 3) and the E1 like activating enzyme in sulfur mobilization and protein conjugation a re not well characterized in archaea. This study sought to characterize the mode in which SAMPs are regulated at the transcript level by environmental signals in the halop hilic archaeon, Haloferax volcanii This work provides evidence that samp gene neighbors are conser ved in many haloarchaea samp transcripts are leaderless and have extended untranslated regions, samp1 and samp3 transcript levels are inducible by dimeth yl sulf oxide and samp transcripts may be regulated at the posttranscriptional level during varying growth conditions. This study also sought to identify and characterize proteins important for 2 thiolation of tRNAs with a uridine in the wobble position an d to determine whether SAMP1/2/3 UbaA, and a THI4 protein homolog are impo rtant for thiamine biosynthesis in Hfx. volcanii This work also provides evidence that a n Ncs6 /Tuc1 homol og, NcsA is essential for maintaining cellular pools of thiolated tRNA Lys U UU and optimal growth at elevated tem perature in complex medium In addition, NcsA was found to associate with UbaA and SAMP2

PAGE 17

17 based on mass spectrometry (MS) analysis of purified protein fractions UbaA mediates covalent and non covalent associations of Nc sA with SAMP2 and NcsA Lys204 is isopeptide linked to SAMP2. NcsA was also found to be covalently modified by poly SAMP2 chains Additional proteins identified by MS analyses to be associated with NcsA included homologs of the proteasome activating nucleot idase A /1 (PAN A / 1 HVO_0850), and an archaeal cleavage and polyadenylation specificity factor 1 ( aCPSF 1 HVO_0874). NcsA also forms a complex with aCPSF1. To further investigate SAMP mediated sulfur mobiliza tion relating to thiamine biosynthesis a triple SAMP1/2/3 deletion and a UbaA deletion strain were found to not display thiamin e auxotrophy H owever, deletion of a putative thiazole biosynthetic gene, hvo_0665 and site directed mutagenesis of a conserved catalytic cysteine, Cys165, expressed in hvo_0665 displayed partial thiamin e aux o troph y Taken together, these results provide evidence of samp regulation, the involvement of SAMP2, UbaA, and NcsA in 2 thiouri dine formation, and also present the first characterization of a THI4 homolog in haloar chaea.

PAGE 18

18 CHAPTER 1 LITERATURE REVIEW Introduction This literature review is designed to present the most current knowledge of ubiquitin (Ub) and ubiquitin like proteins (Ubls) including their participation in protein conjugation and sulfur mobilization. Thi s review also serves to highlight the enzymes mediating Ub/Ubl protein conjugation and Ubl sulfur transfer in tRNA thiolation, molybdenum cofactor biosynthesis, and thiamine biosynthesis among the three evolutionary lineages. The review will also emphasize current knowledge of regulatory roles of ubiquitin as well as regulation of the ubiquitin gene itself in response to environmental stresses. An Overview of the Ubiquitin System Degradation of misfolded/aberrant proteins and short lived regulatory proteins in eukaryotic organisms is carried out by the ubiquitin system. In this system, proteins are targeted by a small 76 amino acid protein, ubiquitin, which forms a covalent attachment to target proteins. The ubiquitin modified proteins are often degraded by the proteasome, a multicatalytic proteinase complex characterized by its ability to hydrolyze proteins in an ATP dependent manner (Ciechanover et al., 1978). The process of covalently attaching ubiquitin to target proteins is mediat ed by a multi cascade of enzymes Ubiquitin mediated degradation of regulatory proteins plays important roles in the regulation of many processes, including cell cycle progression, signal transduction, transcriptional and translational regulation, endocytosis, and DNA damage repa ir (Hochstrasser, 2009; Shukla et al., 2009). Abnormalities in ubiquitin mediated processes have been shown to cause pathological conditions, including

PAGE 19

19 Angelman syndrome, Von Hipp el Lindau syndrome, and cancer (Glickman and Ciechanover, 2002). Discovery of Ubiquitin Ubiquitin was discovered in 1975 by Goldstein (Goldstein et al., 1975). Ubiquitin was first thought to be a thymus hormone as it was isolated from the thymus (Goldstein et al., 1975). Ubiquitin gained its name as it was later found to be ubiquitously present in all tissues (Groothuis et al., 2006). The functions of ubiquitin remained unclear until studies evolved from the laboratory of Hershko (Hershko et al., 1980; Hers hko et al., 1983; Hershko et al., 1984; Hershko and Heller, 1985; Hershko et al., 1991). Protein turnover and s elective protein degradation were well studied up to this point in history; however, the underlying mechanism of how the process occurs of select ing specific proteins for degradation was largely unknown. In order to elucidate a possible mechanism, a biochemical stud y was performed in a cell free system from reticulocytes involving the use of fractionation reconstitution assays of an ATP dependent proteolytic system (Ciechanover et al., 1978). From this study the role of ubiquitin as a protein modifier was deduced (Ciechanover et al., 1978). Ubiquitin was found to be conjugated to proteins that were substrates of the ATP dependent proteolytic syste m. Thus, Ciechanover et al. (1978) proposed that ligation of ubiquitin to a target protein within the cell sealed its fate for degradation by an ATP dependent protease. Ubiquitin Structure T he crystal structure of ubiquitin shows a globular protein with a protruding C terminus (Vijay Kumar et al., 1987). The C terminus of ubiquitin is involved in covalent

PAGE 20

20 bond formation with the lysine epsilon amino group of target proteins and is highly conser ved among eukaryotes (Ciechanover et al., 1978; Vijay Kumar et a l., 1987). Ubiquitin has a pronounced hydrophobic core, and a majority of the protein is involved in hydrogen bonding interactions which maintain the secondary structure of the protein. The hydrophobic side chains, Leu8, Ile44, and Val70, are exposed on th e surface (Vijay Kumar et al., 1987) and are functionally important for targeting diverse proteins for degradation by the proteasome (Beal et al., 1996). Ubiquitin also has a mixed alpha/beta structure and five beta strands yielding a signature beta grasp fold (Vijay Kumar et al., 1987). The beta grasp fold signature has been adapted to a broad spectrum of functions including a scaffold for differen t enzymatic activities and as a region of binding Fe S clusters for specific protein protein interactions (Ho chstrasser, 2009). The beta sheet provides an exposed surface for different interacting proteins (Dikic et al., 2009). The alpha helices of ubiquitin are packed against one side of the beta sheet leaving the other face of the protein exposed (Vijay Kumar e t al., 1987). Interactions between the alpha helices and the beta sheets and the hydrop hobic interactions are found throughout the beta grasp fold (Vijay Kumar et al., 1987). On the surface of ubiquitin, there are seven lysine residues, K6, K11, K27, K29 K33, K48, K63. The lysine residues serve as site s for protein conjugation (Jentsch, 1992). Based on the crystal structure of ubiquitin three lysines, K6, K33, and K63 are solvent exposed whereas the other four lysines, K11, K27, K29, and K48 are involve d in hydrogen bonding or creating salt bridges (Vijay Kumar et al., 1987).

PAGE 21

21 Ubiquitin Conjugation and Deconjugation The carboxyl terminus of ubiquitin is important in mediating the process of protein conjugation (Picka rt, 2001). The carboxyl terminus posse sses a diglycine motif highly conserved amongst all eukaryotic proteins (Pickart, 2001) In eukaryotic organisms, ubiquitin genes are encoded as fusions to proteins important for ribosome bio genesis Ubquitin fusions are cleaved to release free ubiquitin ( Ozkaynak et al., 1987). Ubiquitin therefore must first be processed by hydrolases in order to expose its carboxyl terminal residue In order for mature ubiquitin to conjugate to target proteins, a multi enzyme cascade occurs (Figure 1 1) (Ciechanover et a l., 1978; Ciechanover et al., 1982; Hershko et al., 1980). An E1 or ubiquitin activating enzyme must first activate the carboxyl terminus of ubiquitin. In this reaction, the E1 enzyme adenylates the carboxyl terminus of ubiquitin on the glycine residue usi ng ATP and then forms a high energy thioester bond with the glycine residue and an active site cysteine of E1. Ubiquitin is then transferred to another enzyme, the ubiquitin conjugating enzyme or E2, and forms a thioester intermediate with a specific cyste ine residue of E2. Ubiquitin is often additionally transferred to an E3 enzyme, or ubiquitin ligating enzyme, which links ubiquitin via an isopeptide bond with the epsilon amino group of the target protein. E3 enzymes confer specificity and selectivity for target substrates (Figure 1 1) (Ciechanover et al., 1978; Ciechanover et al., 1982; Hershko et al., 1980). E1 activating enzymes catalyze the downstream ubiquitination reactions. Each E1 enzyme dimer carries two modified forms of ubiquitin; one molecule of adenylated ubiquitin and the other ubiquitin moiety as a thiol ester to the E1 active site cysteine. E1 efficiently binds MgATP and converts it to AMP and PPi (Haas and Rose, 1982). ATP

PAGE 22

22 binding to E1 mediates a conformational change allowing the enzyme to bind tighter to ubiquitin (Haas and Rose, 1982; Pickart, 2001). The tight binding of ubiquitin to E1 allows for transfer of activated ubiquitin to E2 enzymes. A limited number of E2 enzymes exist among humans and yeast and these enzymes have a highly conserved ubiquitin conjugating (UBC) domain (Pickart, 2001). The UBC domain contains the catalytic cysteine residue which is important for E2 mediated thioester formation with activated ubiquitin. Some E2 enzymes have N or C terminal extensions where in teraction with diverse substrates occurs and mainly reflects affinity for free E1 (subnanomolar K d ) and free ubiquitin (subnanomolar K d ); however the affinity of E2 enzy mes for E1 loaded with the adenylated ubiquitin and ubiquitin thiol ester is (nanomolar K d values) higher than free E1 and free ubiquitin (Hershko et al., 1983; Haas et al., 1988; Miura et al., 1999). Multiple types of E3 enzymes are synthesized in a euka ryotic cell, and these enzymes mediate not only the binding of ubiquitin to its specific substrate but also ligate ubiquitin to other ubiquitin molecules via isopeptide linkages in a process known as polyubiquitination (Hershko et al., 1985; Pickart, 2001) E3 enzymes can be divided into two major groups which are defined by the presence of either a HECT or a RING domain. Most E3 enzymes with RING domains activate E2 enzymes and mediate ubiquitin transfer from the E2 to the E3. The primary amino acid sequen ce of the RING domain consists of histidine and cysteine residues w ith spacing that allows for coordination of two zinc ions (Pickart, 2001). RING domains act as molecular scaffolds to bring proteins near each other (Borden et al., 2000). E3 enzymes with m odified RING

PAGE 23

23 domains named U boxes are also functional in ubiquitation (Koegl et al., 1999). The U box lacks the metal chelating residues of the RING domain, but it functions similarly to the RING finger in mediating the ubiquitation of target substrates ( Koegl et al., 1999). By contrast to RING domains, E3s with HECT domains contain a conserved cysteine residue needed for thioester formation with ubiquitin and, thus, act as chemical catalysts (Pickart, 2001; Borden et al., 2000). Ubiquitin is recycled afte r it has been conjugated to its target substrate through the process of deconjugation. Deconjugation involves deubiquitinating enzymes (DUBs) which hydrolyze peptide bonds C terminal to ubiquitin (Hochstrasser, 2009). DUBs participate in producing mature, monomeric ubiquitin by releasing ubiquitin domains that are fused to ribosomal proteins or fused as linear polyubiquitin domain proteins during translation. These proteases also recycle ubiquitin that may have been trapped by the reaction of nucleophiles w ith thioester intermediates of E1, E2, and E3 enzymes (Hochstrasser, 200 9; Katz et al., 2010). Human DUBs are classified to five families : JAB1/MPN/Mov34 metalloenzyme (JAMM) domain zinc dependent metalloprotease family, the ubiquitin C terminal hydrolases the Josephin domain which acts as cysteine proteases, the ovarian tumor based on homology to the ovarian tumor gene, and the ubiquitin specific protease (Nijman et al., 2005). In these DUB families, a common thread is their mode of action. Binding of ubi quitin to DUBs induces a conformational change in the a ctive site of DUB which allows the DUB to hydrolyze the carboxyl terminus of ubiquitin (Nijman et al., 2005). Non Proteolytic Roles of Ubiquitin The ubiquitin pathway has been implicated in regulating a variety of biological processes. In addition to acting as a signal for proteasome mediated degradation,

PAGE 24

24 ubiquitin also regulates other processes independent of proteolysis (Hochstrasser, 2009). As mentioned prior, ubiquitin has seven lysine residues. Ub iquitin can be conjugate d to other ubiquitin molecules to form polyubiquitin chains on specific lysines. Polyubiquitin chains linked through K48 usually target proteins for degradation by the proteasome; however, polyubiquitin chains as well as monoubiquit in can serve as signals for non degradative roles (Hochstrasser, 2009). Examples of biological processes which are regulated by ubiquitination are protein kinase activation, autophagy, DNA repair, transcription, and translation (Hochstrasser, 2009; Shukla et al., 2009). The NF B signaling pathway, a family of transcription factors, requires protein kinase activation in order to regulate gene expression during challenges to the immune system. NF B is sequestered by binding of inhibitory proteins of the I B protein family (Aberle et al., 1997). When the immune system is challenged, a large kinase protein complex, IKK, phosphorylates the I B inhibitory prote ins triggering polyubiquitination of I B by an E3 complex (Skaug et al., 2009). Polyubiquitinated I B is degraded by the proteasome, thus, allowing NF B to regulate gene expression (Skaug et al., 2009). Although in part, the regulation of NF B is dependent on degradation of I B, the activation of the IKK complex relies on polyubiquitination through K63 o f ubiquitin (Skaug et al., 2009). DNA damage repair is also regulated by ubiquitination (Jackson and Durocher, 2013). DNA damage may be induced by endogenous factors such as reactive oxygen species which are byproducts of normal metabolic fun ctions (Zhou and Elledge, 2000) Exogenous factors, such as UV irradiation or thermal disruption, also contribute to DNA

PAGE 25

25 damage (Sinha and Hder, 2002). These factors typically lead to double stranded DNA breaks (Zhou and Elledge, 2000; Sinha and Hder, 2002). Ubiquit ination of histone H2A and other proteins associated with chromatin allows for recruitment of a specific RING finger ubiquitin ligase, BRCA1 which is essential for repairing DNA breaks by homologous recombination (Kim et al., 2007), as well as a tumor supp ressor p53 binding protein 1, which repairs DNA breaks by non homologous end joining, to the site of the DNA break (Ward et al., 2003; Jackson and Durocher, 2013). Ubiquitination also plays a role in activation of transcription factors. In Saccaromyces ce revisiae Met4, a transcription factor which binds promoters to induce transcription of genes when cells are deprived of methionine, is regulated by an inhibitory F box protein which has an E3 domain (Ouni et al., 2010, Ouni et al., 2011). Under conditions of excess methionine, the F box protein is inactivated by ubiquitination, thus, preventing reconstitution of an active Met4 (Ouni et al., 2011). Ubiquitin also alters the transcription activation domains of transcription factors. For example, a study of t ranscriptional activities and half lives of Gal4 DNA binding domains fused to transcription activation domains demonstrated that the transcription factor activation domains were highly ubiquitinated and degraded by the proteasome (Salghetti et al., 2001). Many transcription factors are also positively regulated by mono ubiquitination (Conaway et al., 2002). An example of such is the transcription factor p53, which during cellular stress, is stabilized by mono ubiquitination (Conaway et al., 2002). Regulati on of Ubiquitin Gene Expression Studies of ubiquitin in some eukaryotes have demonstrated regulation of ubiquitin at the transcript level (Finley et al., 1987; McGrath et al., 1991; Muller Taubenberger et al., 1988). Regulation of ubiquitin can be observe d at the transcript

PAGE 26

26 level during stress such as heat shock and starvation and ubiquitin mRNA is characterized as an overall stress induced transcript (Muller Taubenberger et al., 1988). Increase of ubiquitin transcript is beneficial to a cell during stre ss in order to maintain an adequate amount of ubiquitin for balanced cell function (Han na et al., 2007; Simon et al. 1999). In part, ubiquitin is regulated at the level of transcription in eukaryotes such as Saccharomyces cerevisiae In S cerevisiae th ere are 4 ubiquitin genes UBI1 UBI2 UBI3 and UBI4 (Ozkaynak et al., 1987). UBI1 UBI2 and UBI3 encode N terminal ubiquitin domains fused to proteins required for ribosome biogenesis, whereas UBI4 encodes tandem spacerless repeats of ubiquitin, thus, te rmed polyubiquitin (Ozkaynak et al., 1987). Although all ubiquitin genes are essential for mitotic growth in eukaryotes, UBI4 is the only gene transcriptionally induced by stress (Finley et al., 1987; Ozkaynak et al., 1987). UBI4 transcripts are differenti ally expressed upon environmental stresses such as heat shock, exposure t o DNA damaging reagents ( nitroquinoline 1 oxid e and methyl methane sulphonate), nutrient starvation, and cadmium (Finley et al., 1987). Stress untranslated region of UBI4 are necessary for ubiquitin transcription du ring heat shock (Simon et al. 1999). Transcriptional activators bind stress responsive elements and induce transcription of UBI4 during heat shock; thus, an accumulation of transcr ipt is observed (Simon et al. 1999). The complexity of regul ation of ubiquitin synthesis indicate s a need for the cell to control ubiquitin levels for cellular homeostasis. In addition to yeast, ubiquitin transcripts have also been well stu died in other euk aryotes Increased ubiquitin transcript levels are observed in chicken embryo

PAGE 27

27 fibroblasts upon heat shock (Bond and Schlesinger, 1985). In Dictyostelium a soil dwelling amoeba, ubiquitin transcripts are also induced in the presence of cadmium, cycloheximi de (an inhibitor of protein synthesis), heat and cold shock (Muller Taubenberger et al., 1988). These stresses are hypothesized to damage cellular proteins, and protein modification by ubiquitination of these unfolded or aberrant proteins may mediate thei r degrad ation by the proteasome. T his stress induced increase in ubiquitin transcripts may also be indicative of the rapid protein turnover needed during stress conditions. The regulation of the ubiquitin proteasome pathway is understood not only in the c ontext of ubiquitin transcripts but also in the context of deubiquitinating enzymes. In S. cerevisiae Ubp6, a proteasome associated deubiquitinating enzyme aids in the maturation of the regulatory particle of the proteasome (Sakata et al., 2011) and also cleaves ubiquitin from target substrates, thus, saving ubiquitin from proteasomal mediated degradation (Hanna et al., 2007). Ubp6 protein levels are induced in the absence or deficiency of ubiquitin, therefore, enhancing loading of the proteasomes by Ubp6 and as a result modulating proteasome function (Hanna et al., 2007). In a ubp6 deletion mutant, ubiquitin is not recycled, thus, inhibiting the proteasome function and inducing both proteasome protein levels and ubiquitin stress (Hanna et al., 2007). There fore, Ubp6 has a role in both the homeostatic balance of ubiquitin and regulation of the proteasome (Hanna et al., 2007). Recent literature focuses on ubiquitin gene expression in higher ordered eukaryotes, such as humans and rats, due to malfunctioning of the ubiquitin proteasome system. Microarray and quantitative reverse transcriptase PCR studies

PAGE 28

28 indicate differential expression of ubiquitin transcript in individuals with cancer (Kok et tal muscle (Garciamartinez et al., 1995) and schizophrenic disorders (Middleton et al., 2002). Increased ubiquitin transcripts are also observed in skeletal muscle of malignant tumor bearing rats (Llovera et al., 1994). Ubiquitin transcript levels have no t been correlated with the encoded protein levels in any of the preceding stress studies. Ubiquitin Like Proteins (UBLs) Ubiquitin like proteins (UBLs) have been identified among all evolutionary lineages and are distinct from, but evolutionarily related to, ubiquitin (Hochstrasser, 2009). Most UBLs possess a diglycine motif at the carboxyl terminus of the protein and also adopt the signature grasp fold (Hochstrasser, 2009; Schulman and Harper, 2009). One exception to these common features is the prokary otic ubiquitin like protein (Pup), which is intrinsically disordered and is conjugated to proteins via carboxylate amine ligases (independent of E1, E2 and E3 type enzymes) (Pearce et al., 2008). UBLs ca n act as signals for proteasome mediated degradation or participate in non proteolytic processes by utilizing a multienzyme E1 E2 E3 catalytic cascade similar to ubiquitin protein conjugation (Hochstrasser, 2009). Most UBLs require a limited number of E2 and E3 enzymes since they have fewer substrates than ubiquitin (van der Veen and Ploegh, 2012). UBLs can also form mono or poly UBL chains similar to ubiquitin which may serve as a signal for proteasome mediated degradation of the target substrate or non degradative roles (Hochstrasser, 2009). UBLs were di scovered a few decades ago following the discovery of ubiquitin in 1975. Due to improvements in sequence and structure comparison methodology and mechanistic studies of cofactor biosynthesis, certain UBLs of mycobacteria and archaea are found to be analogo us to

PAGE 29

29 the ubiquitin conjugation and activation system from eukaryotes (van der Veen and Ploegh, 2012). However, E2 and E3 enzymes are not conserved in bacteria and archaea with demonstrated UBL conjugation systems (van der Veen and Ploegh, 2012). Prokaryo tic Ubiquitin Like Protein (Pup) Prokaryotic ubiquitin like proteins (Pup) were recently identified in Mycobacterium tuberculosis (Pearce et al., 2008) Prior to the discovery of Pup, there existed no prior identification of a ubiquitin like protein modif ication pathway in prokaryotes. Conjugation of Pup, or pupylation, is characterized from in vitro and in vivo studies of this system in M. tuberculosis M. smegmatis and Corynebacterium glutamicum (Pearce et al., 2008; Burns et al., 2009; Striebel et al., 2009; Ozcelik et al., 2012) Pupylation functionally resembles ubiquitination; however, the enzymes mediating this process are functionally related to carboxylate amine ligases (Burns and Darwin, 2010). Proteins of the carboxylate amine ligase family gene rate amide linkages by ligating amine groups with carboxylates (Sutter et al., 2010). Pupylation is mediated by the action of two enzymes from this protein family, PafA (proteasome accessory factor A) and Dop (deamidase of Pup) (Burns and Darwin, 2010) Pa fA ligates Pup to a lysine residue of the target protein. However, prior to this ligation Pup must first be deamidated by the deamidase Dop. The glutamine residue which resides at the carboxyl terminus of Pup is deamidated to glutamine by Dop, and PafA for ms an isopeptide bond between Pup and the epsilon amino group of the target protein (Burns et al., 2010; Imkamp et al., 2010). Pupylated proteins are delivered to the proteasom e for degradation, requiring hydrolysis of ATP to ADP (Burns and Darwin, 2010). In mycobacteria, the pup gene is encoded adjacent to the 20S proteaso mal subunit genes and is preceded by the dop gene (Burns and Darwin, 2010; Barandun et

PAGE 30

30 al., 2012). The pafA gene is encoded downstream of the 20S proteasomal subunit genes (Burns and Dar win, 2010; Barandun et al., 2012). Similar to ubiquitin, pupylation is also reversible in the presence of a depupylase enzyme which specifically cleaves isopeptide bonds (Imkamp et al., 2010). The direct physiological importance of the Pup proteasome syste m is a novel area of research. Proteomic studies reveal that there are approximately 700 pupylated proteins and that these target proteins participate in a variety of biological functions with the majority involved in lipid metabolism (Watrous et al., 2010 ; Poulsen et al., 2010; Festa et al., 2010). A direct connection between the Pup proteasome pathway and pathogenicity in Mycobacterium tuberculosis has not yet been determined although transcriptional analysis in strains deficient of the Pup proteasome p athway displayed differential gene expr ession of regulons involved in zinc and copper homeostasis (Festa et al., 2010). Copper and zinc homeostasis may be important in maintaining virulence during infection (Festa et al., 2011). Small Ubiquitin Like Modifi er (SUMO) SUMO is a UBL found in eukaryotes, such as S. cerevisiae which contains one type of SUMO (SUMO 1), and humans and plants which encode numerous isoforms of SUMO (SUMO 1, SUMO 2, SUMO 3, SUMO 4) (Muller et al., 2001). SUMO regulates a variety of c ell ular processes such as maintenance of genome integrity, regulating the cell cycle, subcellular transport, and transcription (Hickey et al., 2012). All SUMO isoforms are further processed at their carboxyl terminus to reveal a diglycine motif. SUMO conju gates to target proteins via an E1 E2 E3 multiple enzymatic cascade similar to ubiquitin. This process is referred to as sumoylation. In the presence of ATP, SUMO is activated by a heterodimeric E1 like enzyme SAE1/SAE2, which forms an acyl adenylate inter mediate and a thioester bond with a conserved cysteine of SAE2

PAGE 31

31 (Destorro et al., 1999). SUMO is then transferred to Ubc9, an E2 like enzyme (Okuma et al., 1999). At this point in the enzymatic cascade, Ubc9 directly ligates SUMO to the epsilon amino group of the target protein, thus, forming a covalent linkage (Destorro et al., 1999). Many target proteins of SUMO contain SUMO interacting motifs which are phosphorylated amino acids which interact with SUMO (Kerscher, 2007).Often several lysine residues on a target protein are modified by SUMO, and isopeptide linkages with SUMO itself are found to take place in a process known as polysumoylation (Saitoh et al., 2000; Tatham et al., 2001). Sumoylation is also reversible in the presence of cysteine proteases, te rmed ubiquitin like protein specific protease 1 and 2 (Ulp1 and Ulp2) which cleave the isopeptide bond between SUMO and the targ et protein (Li and Hochstrasser 1999; Mukhopadhyay and Dasso, 2007). Ulp1 also cleaves the carboxyl terminus of SUMO 1 to gene rate mature SUMO 1. Ubiquitin Related Modifier (Urm1) Urm1 was discovered in yeast through sequence comparison with the small subunit, MoaD, of bacterial molybdopterin synthase and a thiamine biosynthetic protein, ThiS (Furukawa et al., 2000). All three proteins (Urm1, MoaD and ThiS) possess a C terminal diglycine motif and grasp fold similar to ubiquitin (Petroski et al., 2011). Urm1 homologs of approximately 99 to 101 amino acids in length are relatively conserved in humans, plants and yeast (Pedrioli et al., 2008). Structural studies of yeast Urm1 reveal the signature grasp fold similar to ubiquitin (Xu et al., 2006; Yu and Zhou, 2008). Two hybrid screens using yeast Urm1 as bait allowed for the elucidation of the Urm1 activating enzyme, Uba4 (Furuk awa et al., 2000). In the yeast system, Uba4 is demonstrated to adenylate Urm1 and form an acyl adenylate intermediate with AMP, similar to other E1s (Furukawa et al., 2000; Schmitz et al, 2008). In addition, a distinct

PAGE 32

32 acyl disulfide bond is formed betwee n Uba4 and Urm1 (Furukawa et al., 2000; Schmitz et al, 2008). Urm1 is attached to protein targets by a Uba4 dependent process (see below for details on protein modification). E2 or E3 equivalents for the Urm1 conjugation system have not yet been identified Urm1 is a protein modifier which conjugates to a variety of proteins. Urm1 was first believed to conjugate to only one target substrate, a peroxiredoxin, Ahp1 (Goehring et al., 2003 a ). However, proteomic data have identified additional substrates of Urm 1 including a nucleocytoplasmic shuttling factor cellular apoptosis susceptibility protein (CAS) (Van der Veen et al., 2011). Urmylation of CAS and other target substrates are induced by oxidative stress. In the presence of oxidizing agents such as diamide and hydrogen peroxide, Urm1 protein conjugates increase (Van der Veen et al., 2011). A urm1 deletion mutant displays sensitivity to environmental stresses (Van der Veen et al., 2011), and Urm1 is required for tRNA thiolation in yeast (Schlieker et al., 20 08). The importance of Urm 1 in sulfur mobilization is discussed in det ail in the following sections. UBLs and Their Involvement in Sulfur Chemistry Sulfur is an important element for all living organisms and is used in the biosynthesis of a variety of mo lecules (Kessler et al., 2006). Due to the multivalent nature of sulfur lending to its propensity to form rings of sulfur, living organisms cannot assimilate sulfur for biomolecule biosynthetic processes, such as thionucleoside or lipoic acid biosynthesis, in a non reduced form (Le Faou et al, 1990). Sulfur must be in a reduced or activated form, whether a sulfide (S 2 ) or persulfide (R S SH), in order for it to be beneficial to organisms (Le Faou et al 1990, Kessler et al., 2006). In its reduced form, su lfur can be incorporated into cysteine which serves as the core of many sulfur compounds (Le Faou et al 1990). Activated sulfur is used in a range of biological

PAGE 33

33 processes such as lipoic acid biosynthesis, iron sulfur cluster formation, biotin biosynthesi s, thiamine and molybdenum cofactor biosynthesis, as well as thionucleoside biosynthesis (Le Faou et al., 1990; Begley et al., 1999; Marquet, 2001; Kessler et al., 2006). Persulfidic sulfur is a low molecular weight labile compound which in many cases deco mposes to a thiol and elemental sulfur (Kessler et al., 2006). One group of enzymes responsible for generating a persulfide is termed cysteine phosphate (PLP) dependent enzymes that convert L cysteine to L alanine and sulfane sulfur via the formation of a protein bound cysteine persulfide intermediate on a conserved cysteine residue (Mihara and Esaki, 2002; Kessler et al., 2006). The earliest known bacterial cysteine desulfurase NifS, was characterized in Azotobacter vinelandii (Zheng et al., 1993). NifS was proposed to provide the sulfur needed to form the metalloclusters of nitrogenase, the enzyme used by some microorganisms to fix atmospheric nitrogen gas (Zheng et al., 1993) Further biochemical analysis of NifS elucidated a conserved cysteine residue in the carboxyl terminal domain of the protein a lysine residue of NifS (Zheng et al., 199 3; Zheng et al., 1994). Mechanistically, NifS binds cysteine inducing a conformational change and attacks the cysteine sulfur to generate the persulfide leaving alanine bound to the pyridoxal phosphate (Cupp Vickery et al., 2003). Another cysteine desulfu rase identified in A. vinelandii is IscS (Zheng et al., 1993; Zheng et al., 1994). The iscS gene is encoded upstream of the iscU, iscA, hscB, hscA and fdx operon, and is important in iron sulfur cluster formation and is also

PAGE 34

34 conserved amongst a variety of organisms (Zheng et al., 1988). Homologs of IscS and associated proteins have been identified in Escherichia coli Haemophilus influenzae Pseudomonas aeruginosa, and Saccharomyces cerevisiae (Mihara and Esaki, 2002). IscU is a scaffold protein for iron su lfur cluster assembly which accepts sulfur from IscA (Ding et al., 2005). HscB and HscA are specialized chaperones, and Fdx is a [2Fe 2S] ferredoxin with a role in redox chemistry (Johnson et al., 2005). Biochemical studies of IscS in E. coli have not onl y implicated IscS in iron sulfur biosynthesis, but also in the biosynthesis of thionucleosides (Mueller et al., 1998; Lauhon, 2002) and thiamin (Webb et al., 1997). A third cysteine desulfurase biochemically characterized in E. coli (Ollagnier de Choude ns et al., 2003; Outten et al., 200 3), as well as other bacteria and archaea is SufS ( Tirupati et al., 2004; Zafrilla et al., 2010) In E. coli SufS is transcribed in an operon with additional suf (sulfur utilization) components, sufA, sufB, sufC, sufD an d sufE (Outten et al., 2003). SufS activates sulfur from cysteine to generate a SufE based persulfide (Outten et al., 2003). In the presence of the SufBCDE complex, SufS cysteine desulfurase activity is also enhanced (Outten et al., 2003). The SUF system i s implicated in iron sulfur cluster formation and this was identified from phenotypic analyses of suf gene deletion mutants in E. coli (Nachin et al., 2001; Outten et al., 2004). In particular, induction of soxS transcript levels during oxidative stress is delayed due to destabilization of the [2Fe 2S] SoxR transcription factor in a sufC mutant (Nachin et al., 2001). Likewise, the enzyme activities of certain oxygen sensitive iron sulfur proteins are decreased during oxidative stress in a sufC mutant (Nachi n et al., 2003). Deletion of sufS and sufD results in reduced growth during iron starvation (Outten et

PAGE 35

35 al., 2004), while deletion of isc and suf operons results in lethality to cells that is overcome by overexpression of the suf operon in strains lacking isc components (Takahashi and Tokumoto, 2002). Taken together, the SUF system, at least in E. coli is necessary for sulfur metabolism during stress. Molybdenum Cofactor Biosynthesis Molybdenum is an essential trace element for living organisms (Schwarz e t al., 2009). Molybdenum itself is not active and therefore useless to organisms unless it is complexed by a scaffold such as the pterin based molybdenum cofactor (MoCo) (Mendel and Schwarz, 2011). MoCo, a labile and oxygen sensitive cofactor, forms part of the active centers of molybdoenzymes with the exception of bacterial nitrogenase which requires the iron sulfur cluster based iron Mo cofactor (Mendel and Schwarz, 2011). There are over 50 MoCo dependent enzymes, the majority found in bacteria and seve n identified in eukaryotes (Mendel, 2013). Some yeast genomes, such as S. cerevisiae and Schizomyces pombe do not encode for proteins of the MoCo biosynthetic pathway (Magalon et al., 2011; Hille et al., 2011). Based on genome sequence, m ethanogens, haloa rchaeal, and hy perthermophilic archaea encode for molybdoenzymes ( Johnson et al., 1993; Chan et al., 1995; Mller and DasSarma, 2005; Humbard et al., 2010; Miranda et al., 2011).Studies of tungstoenzymes, aldehyde ferredoxin oxidoreductase and formaldehyd e ferredoxin oxidoreductase in two hyperthemorphilic archaeons, Pyrococcus furiosus and Thermococcus litoralis revealed the presence of the metal containing pterin in each enzyme (Johnson et al., 1993; Chan et al, 1995). These results provided the first b iochemical and structural evidence of metal binding pterins in archaea. Furthermore, methanogens and haloarchaeal genomes such as Halobacterium salinarum and Haloferax volcanii encode

PAGE 36

36 molybdoenzymes, such as DMSO reductase and nitrogenase which require Mo Co or Fe MoCo for catalytic activity (Mller and DasSarma, 2005; Miranda et al., 2011). Molybdoenzymes participate in redox chemistry by transferring two electrons thus altering the transition state of molybdenum (Mendel and Schwarz, 2011). The MoCo bios ynthetic pathway requires several steps in order to generate mature MoCo (Schwarz and Mendel, 2006). The first step of MoCo biosynthesis is the conversion of guanosine triphosphate (GTP) to cyclic pyranopterin monophosphate (cPMP), previously termed precur sor Z in the presence of MoaA and MoaC of E. coli Cnx2 and Cnx3 of plants, and MOCS1A and MOCS1B of humans (Mendel, 2013). In E coli The cPMP is converted to a metal containing pterin with the aid of a heterotetrameric complex of two large subunits (Moa E) and two small subunits (MoaD). Molybdopterin synthase requires the transfer of sulfur prior to catalysis of cPMP to the metal binding pterin (Mendel, 2013). In bacteria, a MoeB enzyme is necessary for activity of molybdopterin synthase (Mendel, 2013). M oeB, homologous to E1 enzymes which adenylate ubiquitin, adenylates its target substrate, MoaD (small subunit), in the presence of ATP (Rudolph et al., 2001; Mendel, 2013). MoaD has a diglycine motif, similar to ubiquitin and ubiquitin like proteins, at it s carboxyl terminus (Gutzke et al., 2001; Mendel, 2013). Due to homology of MoCo biosynthesis to u biquitination, ubiquitin protein conjugation may have evolved from the MoCo biosynthesis pathway (Lake et al., 2 001; Mendel and Schwarz, 2011). Cysteine desul furases or rhodanese prote ins with loaded persulfides cleave the acyl adenylate of MoaD thus forming a thiocarboxylate (Gutzke et al., 2001; Mendel, 2013). The M oaE protein (large subunit) incorporates the sulfur of two MoaD thiocarboxylates into cPMP al lowing for the formation of metal

PAGE 37

37 containing pterin (Mendel, 2013). The metal containing pterin is adenylated thus facilitating insertion of molybdate into the dithiolene group of MPT forming active MoCo (Mendel, 2013). As mentioned earlier, archaeal gen omes encode for molybdoenzymes such as dimetyhlsulfoxide oxidoreducatases. Most of these enzymes function as terminal reductases under anaerobic conditions where their respective cofactors serve as terminal electron acceptors in respiratory metabolism (Zha ng et al., 2011) Members of t his family of proteins bind Mo molybdopterin guanine nucleotide (MGD) cofactor (Romao, 2009; Hille et al., 2011; Mendel, 2013). A majority of these enzymes function as terminal electron acceptors during anaerobic conditions wh ere the pterin based cofactor serves as a terminal electron cofactor (Rothery et al., 2012). Thiamine Biosynthesis Thiamine is a water soluble vitamin which has three phosphate derivatives including the thiamine phosphate esters: monophosphate (TMP), diph osphate (TDP), and triphosphate (TTP). Thiamine pyrophosphate (TPP) is an essential cofactor in virtually all living systems (Jurgenson et al., 2009). TPP is the most characterized derivative as it is used by key enzymes of glycolysis, the pentose phosphat e pathway, the citric acid cycle (TCA), amino acid biosynthesis, and the non mevalonate pathway of isoprenoid biosynthesis (Pohl et al., 2004) A majority of prokaryotes, plants, and fungi synthesize TPP de novo (Jurgenson et al., 2009), whereas mammals and other vertebrates require this cofactor in their diet in the form of vitamin B 1 (thiamine) (Singleton and Martin, 2001). Thiamine consists of a sulfur containing thiazole moiety linked to a pyrimidine moiety, with the moieties synthesized separately and coupled to form thiamine (Jurgenson et al., 2009).

PAGE 38

38 Thiazole biosynthesis in E. coli is well characterized and involves a complex chain of oxidative condensation reactions that use 1 deoxy D xylulose 5 phosphate, glycine (or tyrosine) and a sulfur source (Jurgenson et al., 2009) The source of sulfur for thiamine biosynthesis is thought to be cysteine, and sulfur is incorporated into the thiazole ring by a series of enzyme mediated sulfur transfer steps that incl ude ThiS, ThiF and IscS (NifS) (Jurgenson et al., 2009). In this process, ThiS is adenylated at its carboxyl terminus by ThiF (similar to various E1 and E1 like proteins) in a mechanism analogous to the activation of ubiquitin (Jurgenson et al., 2009). Thi S is homolog ous with Urm1 and MoaD and shares the distinct beta grasp fold with ubiquitin (Hochstrasser, 2009). The adenylated ThiS is converted to a thiocarboxy at its carboxyl terminus by sulfur transfer from ThiI and a cysteine desulfurase ( e.g ., IscS, NifS) (Jurgenson et al., 2009). Sulfur is donated from the thiocarboxy C terminus of ThiS during formation of the thiazole ring by thiazole synthase (ThiG) (Jurgenson et al., 2009). Molecular details of thiazole biosynthesis in eukaryotes are only recentl y revealed. Based on a study of S. cerevisiae a gene product (THI4) is important in the biosynthesis of the thiazole ring (Praekelt et al., 1994). THI4 homologs are highly conserved among plants and fungi. S. cerevisiae THI4 is reported as a suicide enzym e in the formation of the thiazole moiety of thiamine based on in vitro assay (Chatterjee et al., 2011). In a single turnover reaction, THI4 Cys205 serves as the source of sulfur, and NAD + serves as the five carbon chain in thiazole formation. Archaeal thi azole biosynthesis is poorly understood. Many archaea encode homologs of the S. cerevisiae THI4 that are annotated as ribose 1,5 bisphosphate

PAGE 39

39 isomerase based on the functional characterization of these homologs from the methanogens Methanocaldococcus (Meth anococcus) jannaschii and Methanosarcina acetivorans (Finn and Tabita, 2004). While a THI4 homolog from M. acetivorans is active in catalytic conversion of 5 phospho D ribose 1 pyrophosphate (PRPP) to ribulose 1,5 bisphosphate in recombinant E. coli extra cts, the THI4 homolog of Pyrococcus kodokaraensis is not active under similar conditions (Finn and Tabita, 2004; Sato et al., 2007 ; Aono et al., 2012 ). In addition to THI4 homologs, archaea have homologs of ThiS, cysteine desulfurase, ThiI, ThiF and ThiG p rotein families suggesting an incomplete pathway of thiazole biosynthesis related to bacteria (Falb et al., 2008). The pathway of thiazole biosynthesis in archaea, however, remains to be determined. Thionucleside Biosynthesis The im portance of persulfides can be understood in the context of thionucleoside biosynthesis. More than 100 RNA modifications exist amongst all evolutionary lineages (Limbach et al., 1994; Dunin Horkawicz et al., 2006). RNA modifications allow for chemical diversity among the four mon omeric bases (adenosine, guanosine, uridine, and cytidine) and these modified RNAs include ribosomal ribonucleic acid or rRNA, transfer ribonucleic acid or tRNA, messenger ribonucleic acid or mRNA, and small noncoding RNA. The most heavily post transcript ionally modified RNA is tRNA, which is responsible for codon recognition by the anticodon loop and accuracy and efficiency in decoding the anticodon. Approximately thirty percent of tRNAs are modified at sixty positions (Gustilo et al., 2007).The function of tRNA depends on interactions with other translation dependent components such as translation initiation factors, translation elongation factors, mRNAs, aminoacyl tRNA sythetases, ribosomes, as well as peptidyl tRNA hydrolases (Frank et al., 2005). Typic ally tRNA modifications occur on

PAGE 40

40 nucleosides located in the wobble position (Agris et al., 2007). Some modifications assist in stabilizing the tRNA structure and can facilitate tRNA folding into its characteristic secondary cloverleaf and tertiary L shape structures (Agris, 1996; Bjrk, 1992; Helm, 2006). Aminoacylation of tRN A is an important step in protein synthesis which ensures fidelity of translation. Some aminoacyl tRNA synthetases recognize tRNA based on specific modifications, thus, lending to the importance of tRNA modifications during aminoacylation (Gustilo et al., 2007; Madore et al., 1999; Sylvers et al., 1993). Unmodified tRNAs are susceptible to being mischarged by noncognate aminoacyl tRNA synthetases (Li et al., 2008; Lipman et al., 2002). In bacteria eukaryotes, and archaea, an important tRNA modification step which occurs on the anticodon loop is thiomodification (Limbach et al., 1994; Dunin Horkawicz et al., 2006). Thiomodification involves the incorporation of sulfur into tRNA for bios ynthesis of thionucleosides. In E. coli two specific thiomodifications (2 thiouridine and 4 thiouridine modification) were among the first modified nucleosides discovered and have been well studied ( Ajitkumar and Cherayil, 1988; Rogers et al., 1995). A uridine derivative with a thiol group on C 4 has the greatest abundance among thionucleosides in E. coli tRNAs and, thus, is termed 4 thiouridine (Ajitkumar and Cherayil, 1988). In vivo studies of 4 thiouridine biosynthesis in E. coli (Abrell et al., 1971; Ajitkumar and Cherayil, 1988) and Salmonella enterica (Martinez Gomez et al., 2011) have uncovered parallels between enzymes necessary for thionucleoside biosynthesis and thiamine biosynthesis. 4 thiouridine biosynthesis is mediated by the cysteine desulf urase IscS and the thiamine biosynthetic enzyme ThiI (Lauhon and Kambampati, 1999; Kambampati and Lauhon, 2000; Martinez Gomez et al., 2011). IscS

PAGE 41

41 activates sulfur and incorporates persulfidic sulfur into tRNA adenylated by ThiI (Abrell et al., 1971; Lipse tt, 1978; Kambampati and Lauhon, 1999; Lauhon and Kambampati, 2000). After liberation of sulfur from cysteine, resulting in persulfide formation at the active site of IscS, the persulfide is transferred to ThiI (Kambampati and Lauhon, 2000). ThiI has the a ffinity to bind ATP and unmodified tRNA (Lauhon et al., 2004). Upon ATP hydrolysis, forming AMP and PP i in which ATP is bound by the PP loop motif of ThiI, uridine of tRNA is activated by adenlyation, thus preparing tRNA for sulfur insertion (Palenchar et al., 2000). The sulfur is delivered to the tRNA by loss of a sulfur atom of the persulfide on the cysteine residue of the rhodanese like domain of ThiI (Kambampati and Lauhon, 1999). Therefore, a disulfide bond is formed between the cysteine residue on th e PP loop motif of ThiI and the cysteine residue of the rhodanese like domain (Palenchar et al., 2000). Endogenous reducing agents are capable of cleaving the disulfide bond to release AMP, PP i and modified tRNA (Mueller, 2006). A study to elucidate the physiological importance of 4 thiouridine biosynthesis thiouridine biosynthesis, in E. coli is important for protection of cells from near ultraviolet (Kramer et al., 198 8). Exposure of E. coli mutants lacking 4 thiouridine to near ultraviolet over time resulted in cell death in comparison to the wild type strain which withstood ultraviolet for a longer period of time before death (Kramer et al., 1988). Furthermore, prote ins necessary for resistance to near ultraviolet were not induced as ppGpp and pppGpp are proposed to be generated by tRNA aminoacyl synthetases in reponse to cross linking of 4 thiouridine in tRNA by near ultraviolet (Kramer et al.,

PAGE 42

42 1988). This suggests t hat a function of 4 thiouridine may be to protect cells from death when exposed to near ultraviolet. In the archaeal tRNA, 4 thiouridine has been found in Thermoproteus neutrophilus (Edmonds et al., 1991) as well as in many methanogenic archaea (McCloseky et al., 2001). Mechanistically, not much is known concerning the enzymes needed to generate 4 thiouridine. The source of sulfur in archaea is unclear. Unlike E. coli which produces a large pool of cysteine and has easily recognizable cysteine desulfurases methanogenic archaea and those archaea which require the presence of sulfur for survival, such as the Sulfolobales, do not generate such large pools of cysteine and instead, utilize a tRNA dependent pathway to synthesize cysteine or utilize sulfide for f ormation of iron sulfur clusters (Liu et al., 2012; Liu e t al., 2010; Liu et al., 2005). Also, many archaeal genomes encode for ThiI homologs however, a majority of archaeal ThiI proteins lack the rhodanese like domain (Liu et al., 2012). In a study condu cted in the methanogen, Methanococcus maripaludis several important discoveries were made: i) the ThiI homolog was found to be necessary for 4 thiouridine biosynthesis and not important for thiamine biosynthesis, ii) two conserved active site cysteine res idues located within the PP loop domain of ThiI were found to be important for persulfide generation and to form a disulfide linkage and iii) sodium sulfide was demonstrated to serve as a sulfur donor for 4 thiouridine biosynthesis in vitro (Liu et al., 20 12). These results indicate significant differences in tRNA modification between E. coli and the methanogen M. maripaludis First, ThiI is not needed for thiamine biosynthesis in M. maripaludis but is necessary for thiamine biosynthesis in E. coli ( Jurgens on et al., 2009 ) Secondly, although the methanogen ThiI lacks a rho danese

PAGE 43

43 domain, the enzyme still is capable of forming a disulfide bond and adenylating tRNA. Thirdly, sodium sulfide can serve as the sulfur source for 4 thiouridine biosynthesis by the me thanogen ThiI, whereas E. coli ThiI utilizes sulfur from cysteine derived IscS persulfide ( Kambampati and Lauhon, 2000 ) In many organisms, tRNA specific for lysine, glutamate, and glutamine contain 2 thiouridine at the wobble position of the anticodon. T he enzymes involved in mediating 2 thiouridine biosynthesis have been studied in bacteria (Rogers et al., 1995), and some only recently identified in yeast (Bjrk et al., 2007) and archaea (McCloskey et al., 2001). From the enzymes identified thus far, two major pathways for 2 thiouridine biosynthesis have evolved. The first pathway for 2 thiouridine biosynthesis utilizes persulfidic chemistry. E. coli for example, employs the use of a cysteine desulfurase, IscS, to generate a persulfide and transfer the activated persulfide to a set of persulfidic carriers, TusABCDE complex, before sulfur is incorporated into tRNA via an ATP dependent enzyme, MnmA (Ikeuchi et al., 2006). In this pathway, the cysteine desulfurase removes sulfur from cysteine, thereby activ ating sulfur as a protein bound persulfide for transfer to a cysteine residue of TusA (Ikeuchi et al., 2006). TusA relays activated sulfur to TusD of the TusBCD complex with the help of TusE, which accepts the sulfur from TusD and transfers it to MnmA (Ike uchi et al., 2006). Similar to ThiI which is important for 4 thiouridine biosynthesis, MnmA also has a PP loop motif in its active site which recognizes and a denylates tRNA mediating sulfur incorporation into tRNA (Ikeuchi et al., 2006).

PAGE 44

44 The second major p athway of 2 thiouridine biosynthesis has been elucidated in the thermophilic bacterium Thermus thermophilus (Shigi et al., 2006; Shigi et al., 2008) and in eukaryotes such as S. cerevisiae (Nakai et al., 2008; Noma et al., 2009; Schlieker et al., 2008; van der Veen et al., 2011) and A. thaliana (Nakai et al., 2012 ). This pathway of 2 thiouruidine biosynthesis involves enzymes common to urmylation (Figure 1 2). In this pathway, UBLs are first activated by an E1 like enzyme to receive activated sulfur from a cysteine desulfurase (Nakai et al., 2008). As a result, a thiocarboxyated intermediate is generated, thus, providing the sulfur to be incorporated into tRNA (Schlieker et al., 2008). Prior to sulfur incorporation into tRNA, the tRNA is adenylated by an enz yme belonging to the N type ATP pyrophosphatase superfamily that has conserved PP loop motifs for binding ATP and zinc finger motifs for recognizing tRNA (Nakai et al., 2008). In T. thermophilus and S. cerevisiae TtuB and Urm1 are the UBLs that are import ant for 2 thiouridine biosynthesis, TtuC and Uba4 are the E1 like enzymes that activate the UBLs, and TtuA and Ncs6/Ncs2 are the N type pyrophosphatase homologs that adenylate the tRNA, respectively (Shigi et al., 2006; Nakai et a l., 2008; Shigi et al., 20 08). These UBLs and E1 like enzymes are also important for protein conjugation (Figure 1 2). Mutant analyses of genes encoding proteins for 2 thiolation of tRNA reveal stress sensitive phenotypes in eukaryotes and T. thermophilus Deletion mutants of urm1 p ncs6p and ncs2p in S. cerevisiae and S. pombe render cells more sensitive to oxidative stress and high temperatures (Goehring et al., 2003 b ; Dewez et al., 2008). Also, deletion mutants of T. thermophilus ttuB and ttuA display a high temperature sensiti ve phenotype (Shigi et al., 2006). Taken together, these results suggest that the

PAGE 45

45 presence of 2 thiouridine is important for growth at high temperatures and protects the organisms from oxidative stress. It has been demonstrated that in the presence of an o xidizing agent, tRNA is dethiolated thus losing its potential to be aminoacylated by an amino acyl tRNA synthetase (Kuimelis et al., 1994; Nawrot et al., 2011; Sochacka, 2001). Oxidation favors the replacement of sulfur with hydrogen or oxygen. Therefore, when 2 thiouridines are oxidized, the resulting products are uridine and an unidentified oxidized product (Nawrot et al., 2011). A study conducted in T. thermophilus also emphasizes the importance of 2 thiouridine modified tRNA for survival at higher tempe ratures (Watanabe et al., 1976). 2 thiolation of tRNA is important due to the steric OH group of tRNA (Watanabe et al., 1976). This steric repulsion facilitates the rigidity of the tRNA structure thus stab ilizing the anticodon structure and raising its melting temperature, conferring ribosome binding ability to tRNA and improving reading frame maintenance (Watanabe et al., 1976; Horie et al., 1985). Ubiquitin like P roteins in Archaea Ubiquitin like proteins (UBLs) are conserved throughout the domain archaea and are termed small archaeal modifier proteins (SAMPs) (Humbard et al., 2010; Makarova and Koonin, 2010). SAMPs were recently identified in the haloarchaeon Haloferax volcanii in 2010 by searching the de duced proteome for small proteins which terminated in a diglycine motif and had a predicted beta grasp fold structure (Humbard et al., 2010). Three SAMPs have been identified and characterized thus far, SAMP1, SAMP2, and SAMP3 and are implicated in post tr anslational modification (Humbard et al., 2010; Miranda et al., 2 011; Miranda et al., 2013 ). Prior to their discovery as protein modifiers, SAMPs were presumed to function only in sulfur transfer based on their analogy to

PAGE 46

46 bacterial sulfur transfer systems. All three SAMPs share a distinct beta grasp fold with ubiquitin and other UBLs and possess a diglycine motif at their carboxyl terminus. The crystal structure of SAMP1 draws parallels with the tertiary structure of the bacterial MoaD, which is the small s ubunit of molybdopterin synthase (Jeong et al., 2011). Both SAMP1 and SAMP2 possess hydrophobic regions (Jeong et al., 2011) similar to ubiquitin which are speculated to function as a scaffold for different enzymatic activities to occur and for mediating s pecific protein protein interactions (Maupin Furlow, 2013). SAMP Conjugation and Deconjugation The process of covalent attachment of SAMPs to protein targets is termed sampylation. Similar to ubiquitination, urmylation, and sumoylation, sampylation requir es the presence of an E1 like enzyme to mediate protein modification. SAMP1, SAMP2, and SAMP3 require the ubiquitin activating E1 enzyme homolog of archaea UbaA for protein conjugation (Miranda et al., 2 011; Miranda et al., 2013 ). UbaA presumably forms a t hioester intermediate with SAMPs, similar to the thioester bond formed between ubiquitin and E1 (Figure 1 3). Sampylation was first studied using N terminal Flag tag fusions to SAMPs and protein conjugates were followed by immunoblot with Flag antibody (Hu mbard et al., 2010; Miranda et al., 2 011; Miranda et al., 2013 ). In a ubaA deletion mutant, protein conjugates are no longer observed indicating that this particular enzyme is required for protein conjugation of SAMPs (Miranda et al., 2011; Miranda et al., 2013 ). E2 conjugating and E3 ligating enzyme homologs are not predicted in the genome of Hfx. volcanii and most other archaea. While UBL protein conjugation is predicted to proceed by use of an E1 E2 E3 type cascade in the uncultivated crenarchaeon Caldia rchaeum subterraneum based on metagenomics (Nunoura et al., 2011), this mode of protein conjugation is not

PAGE 47

47 considered to be widespread among archaea (Maupin Furlow, 2013). Instead Hfx. volcanii uses an E1 (UbaA) dependent, E2 E3 independent mechanism of U BL protein conjugation to form an isopeptide bond between the carboxyl terminus of the SAMPs and the epsilon amino group of target proteins (Humbard et al., 2010). Formation of this isopeptide bond was evidenced by mass spectrometry analysis of tryptic dig ests of SAMP protein conjugates enriched from Hfx. volcanii (Humbard et al., 2010). If an isopeptide bond is formed between the C terminal carboxylate of SAMPs and an amino e after trypsin treatment if a lysine residue is positioned immediately before the diglycine residues (Humbard et al., 2010). The native deduced amino acid sequence of SAMP2 has a lysine residue preceding the diglycine motif, however, for SAMP1, site direc ted mutagenesis was performed to mutagenize a serine residue preceding the diglycine ). Sampylation is a reversible process in which SAMPs are cleaved from target s ubstrates, presumably in an effort to recycle the SAMPs and maintain cellular homeostasis (Figure 1 3). The Hfx. volcanii genome encodes homologs of isopeptidases and eukaryotic deubiquitinating enzymes belonging to the JAB1/MPN/MOV34 metalloenzyme subfami ly (Hepowit et al., 2012). HvJAMM1 of Hfx.volcanii was recently characterized as a functional desampylating enzyme (Hepowit et al., 2012). HvJAMM1 cleaves proteins that have been modified by SAMPs and has the capacity to cleave SAMP1/SAMP2 linear linked o r isopeptide linked proteins (Hepowit et al., 2012). Site directed mutagenesis in conjunction with metal content analysis and structural modeling indicates HvJAMM1 is a metalloenzyme requiring Zn 2+

PAGE 48

48 for its activity and likely regulates the available free S AMP pool for protein modification (Hepowit et al., 2012). This model for desampylation is in analogy to the deubiquitinating enzyme, Ubp6, which regulates free pools of ubiquitin in eukaryotic cells (Hanna et al., 2007). Proteins Modified by SAMPs SAMPs mo dify a wide range of proteins in archaea. By mass spectrometry, SAMPs in Hfx. volcanii are identified to associate with proteins involved in transcription, translation, metabolism, stress response, and proteins necessary for the biosynthesis of sulfur cont aining biomolecules (Humbard et al., 2010). Associations to stress related proteins include peroxiredoxin/ thioredoxin type proteins as well as a methionine S sulfoxide reductase, an enzyme that catalyzes the reversible oxidation reduction of methionine su lfoxide. Differential SAMP1, SAMP2, and SAMP3 protein conjugation patterns are also observed contingent with growth conditions. For example, during growth on complex or minimal media supplemented with dimethyl sulfoxide, SAMP1, SAMP2, and SAMP3 protein con jugates accumulate regardless of oxygen availability (Miranda et al., 2 011; Miranda et al., 2013 ). During nitrogen limitation, the protein conjugation pattern of SAMP1 and SAMP2 are also distinct (Humbard et al., 2010). In protea somal gene deletion mutants PAN A /1 outer rings of the proteasome of Hfx. volcanii SAMP 1 protein conjugates accumulate while SA MP2 protein conjugates decrease during growth on glycerol minimal medium supplemented with alanine (Humbard et al., 2010). Both pan A /1 and the subunit deletion mutants are stress sensitive; more specifically they are sensitive to nitrogen limitation, heat shock, hypo osmotic stress, and L canavanine stress (Zhou et al., 2008).

PAGE 49

49 Taken together, these results reveal that SAM Ps function to posttranslationally modify target proteins and are differentially regulated during certain growth conditions. Some modification sites for SAMP1 (Hepowit et al., 2012), SAMP2 (Humbard et al. 2010) and SAMP3 (Mir anda et al., 2013 ) have been ma pped to date. SAMP1 modification has been mapped to two lysine residues, Lys240 and Lys247, of a MoaE homolog in Hfx. volcanii (Hepowit et al., 2012). The modification sites of MoaE lie within the proposed catalytic site in the large subunit of molybdopter in synthase in E. coli (Rudolph et al., 2001 ; Maupin Furlow, 2013 ). Eleven sites of SAMP2 modification have been mapped to 9 proteins as indicated by the aforementioned mass spectrometry study (Humbard et al., 2010). The identification of SAMP2 isopeptide bonds on a specific residue, Lys58, of SAMP2 is indicative of possible poly SAMP2 chain formation (Humbard et al., 2010). This finding would be analogous to the propensity of ubiquitin to form polyubiquitin chains on lysine residues in eukaryotes (Hochstra sse r, 2009). SAMP3 modification sites were readily mapped to a total of 27 lysine residues on 23 proteins including MoaE (Miranda et al., 2013 ). Modification sites for MoaE were mapped to the same residues, K240 and K247, as S AMP1 (Miranda et al., 2013 ). Involvement of SAMPs in Sulfur Mobilization Comparative genomics has revealed a parallel between archaeal Ubl proteins and proteins necessary for sulfur mobilization (Iyer et al., 2006; Makarova and Koonin 2010 ). The role of SAMP1 and SAMP2 as protein mod ifiers and UbaA as the activating enzyme was elucidated in conjunction with their discovery in mediating essential sulfur transfer processes (Miranda et al., 2011). SAMP1 and SAMP2 are proposed to be required for the mobilization of sulfur for the biosynth esis of sulfur containing cofactors such as the pterin based molybden um cofactor (MoCo) and other molecules such as

PAGE 50

50 thiolated tRNA (Miranda et al., 20 11). When grown in complex medium a samp1 deletion mutant is unable to grow with dimethylsulfoxide (DMSO) as a terminal electron accep tor (Miranda et al., 2011). Dimethyl sulfoxide oxidoreductase requires the pterin based cofactor, MoCo, for catalytic activity. Deletion mutants of ubaA and the moaE homolog in Hfx. volcanii also display a growth deficiency for DMSO respiration suggesting a role for these proteins in MoCo biosynthesis. These deletion mutants in samp1 ubaA moaE genes al so have no detectable DMSO reductase activity compared to wild type cells, providing further evidence that these proteins are m ost likely necessary for the sulfur insertion steps to generate the pterin based cofactor (Miranda et al., 2011). Similar to Urm1 in S. cerevisiae and TtuB in T. thermophilus SAMP2 is also crucial for the thiolation of tRNAs (Miranda et al., 2011). By an alysis of urea polyacrylamide gels supplemented with (N acryloylamino) phenyl mercuric chloride (APM) and Northern blot analysis with a probe specific for lysine tRNAs with anticodon UUU (tRNA Lys UUU), tRNA isolated from samp2 and ubaA deletion mutants migr ated faster than tRNA isolated from wild type cells suggesting samp2 and ubaA are important for thiolation of tRNA and are necessary, more specifically, for 2 thiouridine biosynthesis (Miranda et al., 2011). Similar to SAMP1 and SAMP2, UbaA appears central to sulfur mobilization in both MoCo biosynthesis and tRNA thiolation (Miranda et al., 2011). Mercury, a soft metal was first used in studying the presence of sulfur in RNA by Igloi over twenty years ago (Igloi, 1988; Igloi and Kssel, 1985; Igloi and K ssel, 1987). Mercury forms a coordinate covalent bond with sulfur therefore retarding the migration

PAGE 51

51 of the sulfurated RNA in APM gels (Igloi and Kssel, 1985; Igloi and Kssel, 1987). APM gels are widely used in not only separating RNA based on the number of sulfur atoms incorporated but also for detecting the positions of thiol moieties on RNA (Igloi, 1988). Project Rationale and Design The objective of this study was three fold: i) to enhance the understanding of the mode in which SAMPs are regulated at the transcript level by environmental signals in the halophilic archaeon, Hfx. volcanii ii) to identify and characterize additional proteins important for 2 thiolation of tRNAs in Hfx. volcanii and iii) to determine whether SAMP1, SAMP2, SAMP3 UbaA, and a THI4 protein homolog are important for thiamine biosynthesis. Hfx. volcanii is a genetically tractable archaeon for which the genome sequence and a wide variety of tools for genetic manipulation are available (Soppa, 2011) Genomic, transcriptomic, tran slatomic, and proteomic tools have been developed for Hfx. volcanii ( Soppa, 2011) thus making this archaeon an ideal and suitable candidate to study gene regulation and proteins involved in sulfur mobilization. Although a gap between the transcriptional i nducibility of ubiquitin and UBLs in eukaryotes and prokaryotes exists, this study sought to bridge this informational gap to lend a greater understanding of UBL regulation in archa ea. The approach was to perform a comparative genomic analysis of samp homo logs in other haloarchaeons and to define the transcriptional units of samp1 samp2 samp3 and the E1 like activating enzyme ubaA by end point reverse transcriptase PCR, mapping transcriptional ends, and Northern blot analysi s. Once completed, the next app roach included monitoring transcript levels and transcription of samp1 samp2 samp3 and ubaA when Hfx.

PAGE 52

52 volcanii cells were exposed to environmental stress by means of quantitative reverse trans criptase PCR and transcription based reporter assays. The se cond objective of th is study was to identify and characterize proteins involved in sulfur mobilization 2 thiolation of tRNA s with uridine in the wobble position in Hfx. volcanii The proteins mediating 2 thiouridine biosynthesis are not well understood in archaea. Therefore, this project also aimed to identify additional proteins, separate from SAMP2 and UbaA, involved in sulfur incorp oration in tRNAs. The approach involved identifying proteins necessary for thiolation of tRNA by bioinformatics and APM gel analysis coupled with Northern blot analysis. Once identified, phenotypic analyses of gene deletion mutants during elevated temperatures were performed. In addition to these analyses, additional protein partners were sought by protein purification, mass sp ectrometry analysis, and immunoblotting From these analyses, a preliminary mode of 2 thiouridine biosynthesis in Hfx. volcanii is proposed The third objective was to determine whether the SAMPs UbaA, and a THI4 protein homolog are required for thiamine biosynthesis in Hfx. volcanii The approach involved determining whether strains deficient in SAMP1/2/3 and UbaA were important for growth in minimal medium in the presence and absence of thiamine. The next approach was to determine whether other proteins encoded in the Hfx. volcanii genome may be responsible for thiamine biosynthesis. A bioinformatics approach was used to identify a potential THI4 homolog and growth rates were assessed for an HvTHI4 (Hvo_0665) deficient strain, the plasmid encoded HvTHI4 c omplemented strain and a hvo_0665 mutant strain expressing a site directed change of a conserved putative

PAGE 53

53 catalytic cysteine residue (Cys165) when grown in minimal medium in the pre sence and absence of thiamine.

PAGE 54

54 Figure 1 1. The ubiquitin conjugation mechanism in eukaryotes. Ubiquitin is activated by an E1 enzyme in the presence of ATP. Adenylated ubiquitin is transferred to an E2 conjugating enzyme and forms a thioester bond with a cysteine of E2. In an a dditional transfer reaction, ubiquitin is passed to an E3 ligating enzyme which ligates ubiquitin to the epsilon amino group of a lysine residue. Ubiquitin conjugates are cleaved by deubiquitinating enzymes (DUBs) resulting in recycling of ubiquitin.

PAGE 55

55 Figure 1 2. 2 thiouridine biosynthesis in Saccharomyces cerevisiae Arabidopsis thaliana and Thermus thermophilus Urm1, Urm11, and TtuB are ubiquitin like proteins encoded in the genomes of Saccharomyces cerevisiae Arabidopsis thaliana and Thermus ther mophilus respectively. These proteins are activated in the presence of E1 like enzymes (Uba4p from S. cerevisiae Cnx5 from A. thaliana and TtuC from T. thermophilus ). An activated sulfur in the form of a persulfide presumably generates a thiocarboxylated intermediate with the ubiquitin like proteins. ATP pyrophatase family members (Ncs6/Ncs2 from S. cerevisiae and A. thaliana and TtuA from T. thermophilus ) then adenylate tRNA allowing the tRNA to accept sulfur from the ubiquitin like proteins.

PAGE 56

56 Figure 1 3. SAMP conjugation and sulfur transfer. SAMP1 and SAMP2 are presumably activated (adenylated and form a thioester intermediate) by the E1 like enzyme of archaea, UbaA. Once activated, SAMPs form an isopeptide bond with target substrates. Samy lation is reversible in the presence of the deubiquitinating enzyme, HvJAMM1. SAMP1 plays a role in generating the MoCo, and SAMP2 is necessary for tRNA thiolation. Adapted from Maupin Furlow, 2013.

PAGE 57

57 CHAPTER 2 METHODS AND MATERIALS Chemical s, Media, and Strains Chemicals and Reagents Biochemicals were purchased from Sigma Aldrich (St. Louis, MO) and other organic and inorganic chemicals were analytical grade from Fisher Scientific (Marietta GA) and Bio Rad Laboratories (Hercules, CA). Desa lted oligonucleotides were purchased from Integrated DNA Technologies (Coralville, IN). 2' Deoxyuridine 5' triphosphate coupled by an 11 atom spacer to digoxigenin (DIG 11 dUTP), alkaline phosphatase (AP) conjugated antibody raised against DIG, disodium 3 (4 methoxyspiro{1,2 dioxetane 3,2' (5' chloro) tricycle [3.3.1.1 3,7 ]decan} 4 yl) phenyl phosphate (CSPD) and other DIG related reagents were from Roche Molecular Biochemicals (Indianapolis, IN). Positively charged membranes for Northern blot were from Ambi on (Austin, TX). RNase inhibitor and the M MLV reverse transcriptase, RNase H Minus, Point Mutant were from Promega (Madison, WI). Tobacco Acid Pyrophosphatase (TAP) was purchased from Thermo Fischer Scientific (Waltham, MA). Phusion DNA polymerase, restri ction enzymes, T4 polynucleotide kinase, T4 DNA ligase and T4 RNA ligase were purchased from New England Biolabs (Ipswich, MA). Taq DNA polymerase was purchased from Bio Line (Taunton, MA). Hi Lo DNA standards were from Minnesota Molecular, Inc. (Minneapol protein molecular mass marker was purchased from Bio Rad Laboratories (Hercules, CA) and polyvinyl difluoride (PVDF) membranes for Western blot analyses were purchased from Amersham Biosciences (Piscataway, NJ). A garose for routine analysis of DNA was molecular biology grade from Bio Rad Laboratories (Hercules, CA).

PAGE 58

58 Strains, Media and Plasmids Strains, plasmids and primers u sed in this study are listed in Tables 2 1 through 2 6. E. coli TOP10 (Life Technologies, Carlsbad, CA ) was use d for routine recombinant DNA experiments and Hfx. volcanii strains were transformed (Cline et al., 1989) with plasmid DNA isolated from E. coli GM2163 (New England Biolabs). Liquid cultures were aerated with rotary shaking at 200 revolutions per minute (R PM). E. coli strains were grown at 37 C in Luria Bertani (LB) medium (Berta ni, 1951) supplemented with ml 1 ) as necessary, and Hfx. volcanii strains were grown at 42 C in different media including yeast extract peptone casamino acids (YPC) medium, American Type Culture Collection (ATCC) 974 and glycerol minima l medium (GMM) supplemented with 25 mM alanine or 5 mM ammonium chloride (NH 4 Cl) as previously described (Humbard et al. 2010). Medium formulae were according to the Halohandbook (Dyall Smith, 2008). Media were supplemented per liter with novobiocin (0.1 1 1 ), 5 fluoroorotic acid (5 1 ), 2% (wt/vol) glucose, and 100 mM dimethyl sulfoxide (DMSO) as needed. Uracil and 5 FOA were dissolved in 100% [volume (v)/v for 5 FOA or weight (w)/v for uracil] dimethyl sulfoxide (DMSO) at 50 mgml 1 prior to addition to the growth medium. Various stress response studies were performed and all stress stud ies were performed in triplicate. For inoculum, wild type Hfx. volcanii H26 cells from 80 C freezer stocks were streaked for i solation on solid medium (with medium indicated in each study) and grown at 42 C. Cells were inoculated from isolated colonies into 3 ml medium (in 13 x 100 mm culture tubes) and subcultured twice to log phase [ optical density at 600nm (OD 600 ) of 0.3 to 0.5] in 3 ml medium at 42 C were used as inoculum for all stress studies. For analysis of heat shock by quantitative reverse transcriptase

PAGE 59

59 PCR (RT (q) PCR), cells grown to log phase at 42 C in 3 ml ATCC 974 medium (13 x 100 mm culture tubes) were incubat ed in a water bath for 45 min at 60 C (heat shock) or 42C (control) with aeration (200 rpm). A triplicate sample of cells heat shocked at 60 C for 45 min were harvested (10 min, 6,000 x g 4 C) and another triplicate sample of cells were incubated at 60 C for 45 min and then returned to 42 C for a recovery period (20 min) prior to harvesting (10 min, 6,000 x g, 4 C). For a time course study of heat shock by RT (q)PCR, cells grown to log phase at 42 C in ATCC 974 medium were incubated in a 60 C water bath for 15, 30, 45, 60, 75, 90, and 105 min. For non heat shock controls, cells were incubated in a 42 C water bath for identical time points and harvested (10 min, 14,000 x g 4 C). For RT (q) PCR nitrogen limitation studies, cells were grown to log p hase (OD 600 of 0.3 to 0. 5) at 42 C in GMM supplemented with 5 mM ammonium chloride (nitrogen sufficient) or with 25 mM alanine (nitrogen insufficient) (3 ml medium in 13 x 100 mm culture tubes) and harvested (10 min, 14,000 x g ). For cold shock studies, c ells grown to log phase (in 3 ml medium at 42 C, 200 rpm) were incubated at 4 C for (cold shock) for 1.5 h and 42 C for 1.5 h (in water baths of indicated temperatures without agitation) and harvested (10 min, 14,000 x g ). For studies of respiration on DMSO, cells were twice grown aerobically on complex media to log phase (2 ml in 13 100 mm tubes, 200 rpm) and inoculated at 1% (vol/vol) for growth in 10 ml screw cap tubes on YPC supplemented with 100 mM DMSO and 2% (wt/vol) glucose Cells were then har vested (10 min, 14,000 x g ) for galactosidase assays. For galactosidase studies of oxygen respiration in the presence and absence of 100 mM DMSO, cells were grown (3 ml medium at 42 C in 13 x 100 mm tubes, 200 rpm) in triplicate in ATCC 974 and harvested (10 min, 14,000 x g ). For el evated

PAGE 60

60 temperature growth curves, Hfx. volcanii strains were grown in biological triplicate in ATCC974 complex medium to exponential phase (OD 600 of 0.3 to 0.5). Cultures (3 ml) were grown in 13 x 100 mm culture tubes at 42 C. After a set of three subcult ures at exponential phase (OD600 of 0.3 to 0.5) cells were inoculated at OD 600 of 0.03 into 20 ml ATCC 974 medium in 250 ml baffled flasks and incubated at 42C or 50C. OD 600 was then measured to follow growth over time. For cells grown at 42 C and 50 C, cells were re cultured at stationary phase (OD 600 of 2.5 to 3.0) to a starting OD 600 of 0.03 and OD 600 was measured over time. For spot dilutions, Hfx. volcanii strains were grown in biological triplicate in ATCC974 complex medium to exponential phase ( OD 600 of 0.3 to 0.5). Cultures (3 ml) were grown in 13 x 100 mm culture tubes at 42C. After a set of three subcultures at exponential phase, cells were diluted to 0.1 OD 600 and spotted (25 l) on ATCC 974 solid medium in 10 fold serial dilutions as indica ted above each plate. Plates were then incubated at 42C or 50C. All experiments were performed in triplicate and the mean S.D. was calculated. For thiamine growth curve studies, all strains were grown in 3 ml cultures in ATCC 974 overnight at 42 C. Ce lls were pelleted (15 min, 5,000 x g ) and washed with the appropriate glycerol minimal media with and without thiamine thrice to remove complex medium components and then subcultured with a starting OD 600 of 0.03. Cell pellets were suspended in 3 ml of app ropriate media and then subcultured again in 3 ml minimal medium. Finally cells were subcultured in 20 ml minimal medium with or without (0.8 gml 1 ) thiamine in 250 ml baffled flasks and incubated at 42 C. OD 600 was monitored over time and growth rates calculated. All experiments were performed in triplicate and the mean S.D. was calculated.

PAGE 61

61 DNA Procedures DNA Purification and Electrophoresis protocol (Qiagen) after restric tion endonuclease or T4 polynucleotide kinase (PNK) treatment. Plasmid purification from DNA agarose gel slices were also performed with from E. coli TOP10 or E.coli GM 2163 cells were extracted and purified by QIAprep spin miniprep kit (Qiagen). Hfx. volcanii genomic DNA was spooled from 5 ml cultures and was isolated as previously described in the Halohandbook (Dyall Smith, 2008). DNA was separated by electrophoresis us ing 0.8 % (wt/vol) or 2 % (wt/vol) agarose gels in 1 TAE electrophoresis buffer (40 mM Tris acetate, 2 mM EDTA, pH 8.5), stained with ethidium bromide at 0.5 g ml 1 and photographed with a Mini visionary imaging system (Fotodyne, Hartland, WI). Sizes of the DNA fragments were estimated using Hi Lo DNA molecular weight markers (Minnesota Molecular, Minneapolis, MN). Polymerase Chain Reaction (PCR) All double stranded PCR products were generated with primers listed in Tables 2 2, 2 4, and 2 6. For rapid PC R screening of transformants, generating DIG labeled probes for Northern and Southern blot analyses, RT PCR, RT (q) PCR, a nd mapping of transcript ends, (Bio Line). Phusion (New England Bio labs) and Herculase (Agilent Technologies) DNA polymerases were used to generate plasmid constructs listed in Tables 2 1, 2 3, and 2 following modification: 3% (v/v) DMS O was included and 0.1 mM dNTP mix was added to the standard DIG labeling reaction mixture which included 1 DIG dNTP (Roche

PAGE 62

62 Applied Science). PCRs were performed using an iCycler or GeneCycler (Bio Rad Laboratories). Cloning All plasmids generated by clon ing procedures are listed in Tables 2 1, 2 3, and 2 5. PCR product inserts, plasmid DNA, and genomic DNA were digested with NdeI, BlpI, Biolabs). Digested plasmids were Antarctic phosphatase treated (30 min, 37 C) followed by heat inactivation (65 C, 15 min) prior to purification by Minelute (Qiagen) and ligation with T4 DNA ligase (16 h, 16 C) (New England Biolabs). For blunt end cloning, Klenow polymerase was used to fill in overhangs according to rotocol (New England Biolabs). For co expression of N terminal Flag SAMP1 and C terminal NcsA StrepII g enes, the BamHI to BlpI fragment of pJAM2812 (encoding NcsA StrepII) was blunt end ligated into the BlpI site of pJAM947 (encoding Flag SAMP1) to generate plasmid pJAM2813. Similarly, for co expression plasmids of Flag SAMP2 and NcsA StrepII genes, the Bam HI to BlpI fragment of pJAM2812 was blunt end ligated into the BlpI site of pJAM949 (encoding Flag SAMP2) to generate pJAM2814. For co expression of Flag SAMP2 K58R, K64R variant and NcsA StrepII genes, the Bam HI to BlpI fragment of pJAM2812 was blunt end ligated into the BlpI site of pJAM1118 to generate pJAM2818. Correct gene orientation was confirmed by digestion with NdeI and Sanger DNA sequencing. Specificity of all PCR, RT PCR, and RT (q) PCR products, including DNA cloned into plasmids was confirmed by automated DNA sequencing using an Applied

PAGE 63

63 Biosystems model 3130 genetic analyzer (ICBR Genomics Div ision, University of Florida). Site Directed Mutagenesis Site directed mutagenesis (SDM) of hvo_0665 ( hvthi4 ) was performed using the QuikChange Site Di protocols with the following modification. An elongation time of 11 min was used for generation of a 10 kb product and 25 ul of the PCR reaction was used for transformation into E. coli XL Gol d competent cells (Stratagene). Restriction enzyme digest was carried out with DpnI (Stratagene). The primer pair used to generate the site directed change is listed in Table 2 6. Generation of Hfx. volcanii THI4 Deletion Strain For generation of a THI4p homolog (Hvo_0665) mutant, DNA fragments specific to the Hfx. volcanii genome were isolated by PCR using an iCycler (BioRad Laboratories). PCRs included Hfx. volcanii strain DS70 genomic DNA as a template with primer pairs listed in Table 2 6. Both Taq (B io Line) and Phusion (New England Biolabs) DNA polymerases were used with conditions according to the Manufacturer. DNA fragments were isolated by MinElute PCR purification (Qiagen, Valencia, CA) prior to treatment with restriction enzymes. For generation (pJAM2819), a 921 regions (500 bp each) were ligated into the BamHI to HindIII sites of pTA131. Plasmid pJAM2819 was used as template for inverse PCR to delete Hv o_0665 and generate plasmid pJAM2820, which was used for pyrE2 based pop in/pop out deletion of Hvo_0665 on the chromosome as previously described (Allers et al., 2004) DNA specific for Hvo_0665 coding sequence was cloned into the NdeI to BlpI sites of

PAGE 64

64 pJAM809 to generate plasmid pJAM2821 for expression of Hvo_0665 protein (named HvTHI4) with a C terminal StrepII tag. T he fidelity of all DNA plasmid constructs was verified by Sanger DNA Sequencing (Eton Bioscience, Inc. and UF ICBR DNA sequencing core). Southern Blot Analysis Hfx. volcanii parent H26 and the ( ) mutant strain genomic DNA were subjected to Southern blotting to confirm the gene deletion as described previously (Zhou et al., 2008). Briefly, Hfx. volcanii from 5 ml cultures by DNA spooling (Dyall Smith, 2008) and subjected to restriction digestion with PciI for DNA was separated on a 0.8% (w/v) agarose gel (20 V, 16 h) and transferred (16 h) to a positively charged nylon membrane through capillary action according to DNA was cross linked onto the membrane using a UV Stratalinker 2400 (Stratagene) and hybridized to a DIG labeled probe specific for the end of the target coding region (65 C, 16 h) as previously described (Rawls et al., 2010). Prim ers used for the construction of DIG labeled probes for Southern blot are included in Table 2 4. Hybridization species were detected by CSPD mediated chemiluminescence as recommended by the Manufacturer (Roche Applied Science) with the following modificati ons: an increase in stringency from 0.5X saline sodium citrate ( SSC) [1 SSC is 0.15 M NaCl with 0.015 M sodium citrate (pH 7.0)] supplemented with 0.1% (w/v) sodi um dodecyl sulfate (SDS) to 0.1 SSC supplemented with 0.1% (w/v) SDS was included in the was hing of the membranes at 65 C after hybridizations as needed. DIG labeled DNA molecular weight marker III

PAGE 65

65 (Roche Applied Science) was used and hybridization products were visualized by CSPD Construct ion of Plasmid Based Reporters A plasmid based beta galactosidase reporter system was used to measure transcriptional activity of putative promoter regions in Hfx. volcanii as previously described (Delmas et al., 2009). All plasmid constructs were extracte d from E. coli strains Top10 and GM2163 prior to transformation of Hfx. volcanii H26 strain. Putative promoter regions upstream of samp1 and samp2 were amplified by PCR with gene specific primers, carrying XbaI and NdeI restriction sites, from Hfx. volca nii genomic DNA and fused to a beta galactosidase encoding gene, bgaH from Haloferax lucentense to generate plasmids pJAM2801 ( samp1 putative promoter fused to bgaH ), pJAM2802 ( samp2 promoter fused to bgaH ), pJAM2803 ( samp3 putative promoter fused to bgaH ) and pJAM2804 ( ubaA putative promoter fused to bgaH ). Plasmid pJAM2678, which carries the open reading frame of bgaH fused to the rRNA P2 promoter of Halobacterium cutirubrum and pJAM2702, which carries bgaH fused to the putative promoter of kdgk2 (Rawls et al., 2010) of Hfx. volcanii were used as positive controls. Plasmid pJAM2714, which carries the coding region of bgaH with no promoter insert (the rRNA P2 promoter was removed) and no ribosomal binding site (RBS absent), was used as a negative control ( Rawls et al., 2010). Plasmid pJAM2715, which carries the coding regions of bgaH with no promoter (removal of the rRNA P2 promoter) but a ribosomal binding site present (RBS present), also served as a negative control (Rawls et al., 2010). Putative promoter regions were predicted as previously described (Schneider et al., 2006).

PAGE 66

66 RNA Procedures Total RNA Isolation For Northern blot analysis and APM gel analysis, total RNA was isolated from 37.5 ml of log phase culture of Hfx. volcanii H26 grown in ATCC 974 me dium alone, ATCC 974 supplemented with 100 mM DMSO and GMM with alanine as the nitrogen source supplemented with 15 mM DMSO (100 ml medium per 500 ml baffled flask; 42 C at 200 rpm). Cells were harvested (20 min, 6,000 x g ), and cell pellets were resuspen ded in 625 l lysis buffer (10 mM Tris HCl, pH 8.0, 10 mM NaCl, 1 mM trisodium citrate, 1.5% w/v sodium dodecyl sulfate) with the addition of 17.5 l diethylpyrocarbonate (DEPC). Cell lysate was incubated (10 min at 37 C followed by 10 min on ice). Sodium dodecyl sulfate (SDS) DNA protein aggregate was generated by addition of 312.5 l of saturated sodium chloride (40 grams sodium chloride per 100 ml DEPC treated water) followed by incubation (4 C, 15 min). Aggregates were removed by centrifugation (12,000 x g 20 min, 4 C). The supernatant was transferred to a fresh 1.8 ml Eppendorf tube and RNA was precipitated (2.5 vol, 95% (v/v) ethanol, 80 C) overnight. RNA pellet was recovered by centrifugation (13,000 x g 15 min, 4 C), washed in 70% (v/v) ethano l, air dried (5 min) and resuspended in 30 l DEPC treated water (0.1% v/v). RNA was further purified by extraction with equal volume of acidic phenol (pH 5.0): chloroform: isoamyl alcohol (25:24:1) followed by an additional chloroform: isoamyl alcohol (24 :1) extraction. RNA was precipitated in 0.25 M sodium with 70% (v/v) ethanol. The air treated water with a typical yield of 10 transcriptional start sites and for RT PCR and RT (q) PCR, was isolated from Hfx.

PAGE 67

67 volcanii H26 using RNeasy RNA purification columns (Qiagen) with the following modifications. Amplification grade DNase I (Sigma Aldri ch) was added at 3 units (U) per was omitted during the purification process (Babski et al., 2011). RNA concentration was determined by absorbance at 260nm (A 260 ) using a Bio Rad SmartSpec 3000 instrument and a Nanovue Plus Spectrometer instrument (GE Healthcare Life Sciences, Uppsala, Sweden). RNA integrity was determined by 0.8% (w/v) agarose gel electrophoresis. RT (q) PCR, RT PCR Primers used for RT (q) PCR and RT PCR are summarized in Table 2 2. RT (q) PCR was performed using Hfx. volcanii total RNA as temp late, primers, iQSYBR Green Rad). Total RNA (0.1 transcribed to generate double stranded cDNA with random hexamer primers (25 C, 5 min; 42 C, 30 min; 85 C, 5 min) with the iScript cDNA synthesis kit Rad). Double stranded cDNA then served as template for RT (q) PCR with iQ SYBR Green Supermix cDNA synthesis kit (Bio Rad). This cDNA served as the template for PCR with iQ SYBR Green Su permix contents (Bio Rad) and primer pairs listed in Table 2 2 specific for the coding region of samp1 samp2 samp3 and ubaA All RT (q) PCR reactions were subject to 40 amplification cycles: denaturation at 95C for 30 sec, annealing for 1 min and elong ation at 72C using an iCycler (BioRad). For the controls, reactions were identical with the following exceptions: the sample was maintained on ice during the reverse transcription step to exclude genomic DNA contamination, and Hfx. volcanii genomic DNA pr epared as previously described (Dyall Smith, 2008) was used as a template to confirm primer pair

PAGE 68

68 function. For RT ( q) PCRs, relative quantitation for each transcript was according to methods previously described (Pfaffl, 2001). Transcript specific for the Hfx. volcanii ribosomal protein L10 gene ( ribL ) served as an internal control for data normalization based on a previous study (Brenneis et al., 2007). All assays were performed in biological triplicate with the means standard deviations (SD) calculated. For RT PCR analysis of operon organization, cDNA served as template for PCR with primers (Table 2 to ensure primer specificity. Northern Blot Analysis Total RNA h, 50 V) on a 1.2% agarose gel using formaldehyde 0.8% (wt/vol) agarose gels in 1 morpholinepropanesulfonic acid (MOPS) buffer (20 mM MOPS [pH 7.0], 5 mM sodium acetate, 1 mM EDTA) acc ording to standard procedures (Ausubel et al., 1987). RNA molecular mass standards labeled with digoxigenin (DIG 11 dUTP) (0.3 to 6.9 kb RNA ladder; Roche Molecular Biochemicals, Indianapolis, IN) were included. After three rinses (5 min) with DEPC treate d water, the formaldehyde gel was incubated (45 min) in 10 saline sodium citrate (SSC) (where 20 SSC stock of 3 M sodium chloride plus 0.3 M sodium citrate [pH 7.0] was diluted to 10 ). RNA was transferred to a BrightStar Plus nylon membrane (Ambion, Aus tin, TX) by upward capillary action overnight using 20 SSC, cross linked using a UV Stratalinker 2400 (Stratagene), and hybridized overnight at 50 C with DIG labeled double stranded DNA (dsDNA) probes specific for samp1 samp2 and samp3 genes. PCR for t he generation of the samp probes was performed with samp specific primers using the samp pre deletion plasmids as template. TaqDNA (Bio Line) polymerase was used according to the supplier's recommendations with the

PAGE 69

69 following modifications: 3% (vol/vol) DMS O was included, and the 1 DIG deoxyribonucleoside triphosphate mixture (Roche) was supplemented with mixed deoxynucleotides (New England Biolabs) to 0.1 mM. For hybridization, membranes with the cross linked RNA samples were equilibrated in DIG Easy Hyb s olution (Roche Applied Science) followed by incubation with 100 150 ng labeled probe in 10 ml DIG easy hyb (16 h, 50 C). Membranes were washed with 2 SSC with 0.1% (wt/vol) SDS (twice, 5 min each) and with 0.1 SSC with 0.1% (wt/vol) SDS (twice, 15 min e ach, at 50C). Hybridization products were detected by a chemiluminescent (CSPD*) digoxigenin immunoassay (Roche). Mapping Transcript Ends Total RNA (7g) from Hfx. volcanii H26 was treated with 10 U Tobacco Acid Pyrophosphatase (Fischer Scientific) and 30 U RNase Inhibitor (Promega) at 37 C for 1 hour. RNA sample was treated with an equal volume of acidic phenol (pH 5.0): chloroform: isoamyl alcohol (25:24:1) followed by chloroform: isoamyl alcohol (24:1). RNA was precipitated by addition of sodium acetat e (pH 5.0) to 0.25 M and two and resuspended in DEPC treated water. RNA was denatured (10 min, 65 C) and self ligated (1 h, 37 C) with 40 U T4 RNA ligase (New England Biola bs) with inclusion of 10 U RNase inhibitor (Promega) and 1 T4 ligase buffer in a 25 g total reaction volume. Self ligated RNA was purified by phenol/chloroform extraction as earlier described followed by denaturation (10 min, 65 C) and hybridization wit h 0.5 pm ol of samp 1, samp2 and samp3 gene specific primers listed in Table 2 2. First strand cDNA ligated mRNA ends in the presence of the M MLV reverse transcriptase, RNase H Minus, Point Mutan t (Promega)

PAGE 70

70 (N1/N2) was used with the first PCR reaction as template. The second nested PCR was designed to enhance specificity of amplification and eliminate potential fal se positive fragments of the first PCR reaction (Brenneis et al., 2007). TaqDNA polymerase was used according to the Manufacturer's protocol (Bio Line) with the following modification: 3% (vol/vol) DMSO was included. The PCR reaction product was gel extrac ted (Qiagen) and TOPO cloned into pCRII (Invitrogen) followed by Sanger sequencing and comparison to the Hfx. volcanii genome sequence (Brenneis et al., 2007). RNA Fold Prediction G values for RNA were predicted using Mfold version Invariable parameters were 42 C and 1 M NaCl concentration. Assay for tRNA Thiolation APM gel retardation analysis of tRNA was performed by collaborators Dr. Dieter Sll and Dr. Markus Englert, at Yale University was separated by electrophoresis using 12% urea APM per milliliter. RNA was transferred to a Hybond N+ nylon membrane (GE Healthcare) and immobilized by UV crosslinking prior to hybridization. The oligonucleotide probe (listed in Table 2 labeled 32 32 P] ATP removed by passage of the probe through a MicroSpin G 25 column (GE Healthcare). The membrane bound RNA was prehybridized in ULTRAhyb Oligo buffer (Ambion) for 30 min at 42 C before addition of the end labeled oligonucleotide (~10 6 cpm per millilit er).

PAGE 71

71 After hybridization at 42 C for 14 h, the membrane was washed twice with buffer consisting of 2 SSC and 0.5% SDS (for 30 min each time at 42 C). The blot was exposed to an imaging plate (FujiFilm) and scanned on a Molecular Dynamics Storm 860 Phosp hoimager (GE Healthcare). Protein Procedures Bioinformatics Hfx. volcanii Halorubrum lacusprofundi ATCC 49239 Halogeometricum borinquense DSM 11551 Haloarcula marismortui ATCC 43049 Natronomonas pharaonis DSM 2160, Halopiger xanaduensis SH 6 Natrinem a sp. J7 2 Haloterrigena turkmenica DSM 5511 Halobacterium sp. NRC 1 Halorhabdus utahensis DSM 12940 Halalkalicoccus jeotgali B3 gen ome sequences used in Chapter 3 were retrieved from the Microbial Genome Database ( Uchiyama 2003). Saccharomyces cerev isiae (ScNcs6, GI:50593215), Homo sapiens (HsNcs6, GI:74713747), Pyrococcus horikoshii (PH1680, GI:14591444; PH0300, GI: 14590222), Thermus thermophilus (TTHA0477 or TtuA, GI: 55980446), Salmonella typhimurium (StTtcA, GI:16764998) Escherichia coli (EcTtcA GI:85674916). and HVO_0580 of Hfx. volcanii (GI: 292654746) protein sequences used in Chapter 4 were retrieved from InterPro. Also, Saccharomyces cerevisiae ScTHI4 (sp:P32318), Arabidopsis thaliana AthTHI4 (gi:2501188), Thermotoga maritima TmarTHI4 (gi:12 230784), and archaeal protein sequences that cluster to the THI4p family (IPR002922) and used in Chapter 5 were retrieved from InterPro. Protein sequences were aligned using ClustalW (Larki n et al., 2007) Extensive gaps and N and C terminal extensions were removed from protein sequences prior to dendrogram construction. Pairwise comparisons were performed and mean genetic distance was evaluated using p distance with gaps analyzed using

PAGE 72

72 pa irwise deletion. The neighborhood joining tree that best fit distance data is depicted and was constructed using MEGA 4.0 (Tamura et al., 2007) Fold Recognition and 3D Structural Modeling Phyre2 (Protein Homology/AnalogY Recognition Engine 2) web based server (Bennett Lovsey et al., 2008; Kelley and Sternberg, 2009) was used for fold recognition and model building of HVO_0665, Tk0434 and Ma2851. In brief, the primary amino acid sequences were submitted to Phyre2 server using intensive mode. The Phyre2 threading server combined HHsearch for remote homology detection based on pairwise comparison of hidden Markov models (HMM) with ab initio and multiple template modeling. The library of known protein structures for comparison by Phyre2 was from the Protein Data Bank (PDB) and Structural Classification of Proteins (SCOP) databases. Chimera 1.7 (Pettersen et al., 2004) was used as an interface for interactive visualization and analysis of molecular 3D protein structures. Conserved active site residues were identified based on biochemi cal and structural analysis of THI4p of S. cerevisiae (PDB: 3FPZ) and Neurospora crassa (PDB: 3jsk, also named CyPBP37 protein). Galactosidase Assay galactosidase activ ity as previously described (Holmes and Dyall Smith, 2000). Cells grown in 3 ml of appropriate media were harvested at exponential growth phase (0.3 to 0.5 OD 600 ) by centrifugation (10 min, 6,000 x g room temperature). Cell pellets were washed in assay bu ffer (50 mM Tris HCl pH 7.2, 2.5 2 mercaptoethanol. Cells were lysed by 100. Cell debris was removed my

PAGE 73

73 centrifugation (10 min, 6,000 g, room temperature). Supernatant (20 l) was assayed in a 96 well plate format and 100 l reaction volume by addition of 70 l assay buffer and 10 l of 2.6 mM o nitrophenyl D galactosidase specific activity were monitore d at 25 C by an increase in absorbance at 405 nm (A 405 ) due to the liberation of o nitrophenol from ONPG using a BioTek Synergy HT plate reader. Non specific background values were based on reactions with no substrate (ONPG) added for each cell lysate tes ted. All experiments were performed in galactosidase activity is defined as the amount of enzyme catalyzing the hydrolysis of 1 mol from o nitrophenyl D galactopyrano side (ONPG) min with a molar extinction coefficient for o nitrophenol of 3300 M cm Protein concentration was estimated using the Bradford assay (Bio Rad Reagent) with bovine serum albumin as the standard. Desampylation (HvJAMM1) Assay Desampylation of SAMP protein conjugates was assayed with HvJAMM1 enzyme as previously described (Hepowit et al., 2012). Reactions included 5 mM HvJAMM1, 12 mM SAMP conjugates, and 500 mM ZnCl 2 in HEPES salt buffer (20 mM HEPES, 2 M NaCl, pH 7.5). Negative control s incl uded the addition of 50 mM EDTA to chelate the catalytic Zn 2+ ion of HvJAMM1. All reactions were incubated for 4 h at 50 C. Samples were boiled (15 min) in reducing SDS loading buffer and separated by 10% (w/v) SDS PAGE. Free and conjugated forms of Flag and StrepII tagged proteins were detected by Western blot.

PAGE 74

7 4 Protein Purification For protein purification, strains were grown to stationary phase in termi nal Strep II tagged ( Trp Ser His Pr o Gln Phe Glu Lys, StrepII) and N terminal Flag tagged (Asp Tyr Lys Asp Asp Asp Asp Lys Flag ). Strep tagged proteins were purified by StrepTactin chromatography from H26, H26 ncsA mutant strains (MH105, where ncsA i s hvo_0580 ), H26 samp2 (HM1042), and H26 ubaA (HM1052) that were transformed with plasmid pJAM2812 (expressing ncsA strepII ), pJAM2813 (expressing samp1 in tandem with ncsA strepII ), pJAM2814 (expressing samp2 in tandem with ncsA strepII ), pJAM2818 (exp ressing samp2 K58R, K64R in tandem with ncsA strepII ) and pJAM202c (vector control). Cells were harvested, washed once with ice chilled Tris Cell pellets were resuspended in Tris salt buffer ld type cells) and passed through a French Press (2000 psi) thrice Cell extract was obtained by g and 4 applied to a Strep Tactin column (Qiagen ) pre equilibrated in Tris salt buffer. The column was washed with Tris salt buffer, and proteins were eluted with Tris salt buffer desthiobiotin. Purified protein fractions were pooled and buffer exchanged by dialysis into Tris salt buffer overnight at 4 C with SnakeSkin dialysis tubing (3.5 kDa molecular weight cutoff) (Fisher Scientific). Strep Tactin purified proteins were applied to an Amicon Ultra 4 centrifugal filter unit with a 3 kDa molecular weight cutoff (Millipore) and centrifuged (40 min, 3000 x g 4 22R swinging bucket rotor (Beckman Coulter, Indianapolis IN) Purified proteins were stored

PAGE 75

75 at 4 C. For small scale protein purification, 50 ml cultures were grown to stationary phase in 250 ml Erlenm eyer baffled flasks, harvested by centrifugation (20 min, 5,000 x g 4 C), lysed in 20 ml Tris salt buffer by French Press, and purified by Strep Tactin chromatography as described above using 50 l Strep Tactin resin with one modification: proteins were eluted with Tris desthiobiotin. Protein Quantification Concentrations of protein in the cell lysates assayed for galactosidase activity were determined by the Bradford method (Bradford, 1976) according to Manufacturer protocols (Bio Rad). Purified protein concentrations were determined by BCA assay kit Rad) served as a standard for all protein concentration assays, and absorbance was determined in a 96 well plate format ( 200 l final volume per assay) using a BioTek Synergy HT microplate reader. Mass Spectrometry Protein fractions purified by Strep Tactin chromatography were boiled in SDS reducing buffer, separated by10 % SDS PAGE, and excised from protein bands of interest or retained in solution and submitted for mass spectrometry as indicated. Proteins bands of interest were visualized by staining in Bio Safe Coomassie (Bio Rad) and destaining in double deionized water according to Manufactur Rad). Proteins were prepared for MS by reduction in 45mM dithiothreitol (DTT), alkylation with 100 mM iodoacetamide (IAA) and digestion with trypsin Tryptic peptides were injected onto a capillary trap (LC Packings PepMap) and desalted for 5 min with 0.1% vol/vol formic acid at a flow rate of 3 l min 1 prior to loading onto an LC Packing

PAGE 76

76 C18 Pep Map nanoflow high performance liquid chromatography (HPLC) column. The elution gradient of the HPLC column started at 3% solvent A (0.1% vol/ vol formic acid, 3% vol/vol acetonitrile, and 96.9% v/v H 2 O), 97% solvent B (0.1% vol/vol formic acid, 96.9% vol/vol acetonitrile and 3% vol/vol H 2 O) and finished at 60% solvent A, 40% solvent B using a flow rate of 300 l min 1 for 30 min. LC MS/MS anal ysis of the eluting fractions was carried out on an LTQ Orbitrap XL mass spectrometer (ThermoFisher Scientific, West Palm Beach, FL). Full MS scans were acquired with a resolution of 60,000 in the Orbitrap from m/z 300 2000.The ten most intense ions were f ragmented by collision induced dissociation (CID). Raw data were analyzed using Mascot (Matrix Science, London, UK; version 2.2.2) against a Hfx. volcanii database and a target decoy database including the Hfx. volcanii proteome and reversed protein seque nces generated by Mascot was added during the search. Mascot was searched with a fragment ion mass tolerance of 0.8 Da and a parent ion tolerance of 15ppm. Iodoacetamide derivative of Cys was indicated as a fixed modification while deamidation of Asn and G ln and oxidation of Met were specified as variable modifications. Scaffold (Proteome Software Inc., Portland, OR) was used to validate MS/MS based peptide and protein identifications where protein probabilities were assigned by the Protein Prophet algorith m and peptide probabilities were assigned by the Peptide Prophet algorithm (Keller et al., 2002; Nesvizhskii et al., 2003). Immunoblotting Purified C terminally Strep tagged proteins from Hfx. volcanii were TCA precipitated in 4% (w/v) TCA, twice washed in ice chilled acetone, and boiled in SDS mercaptoethanol or 10 mM dithiothreitol) for 10 min. TCA

PAGE 77

77 precipitated proteins and cell lysate (5 g) were separated by 10% SDS PAGE with equal loading confirmed by staining with Bio Safe Coomassie. Proteins were transferred to Hybond P polyvinylidene fluoride (PVDF) membranes (Amersham) using 10 mM 2 N morpholinoethanesulfonic acid (MES) buffer at pH 6.0 with 10 % (v/v) methanol at 4C for 2.5 h at 90 V. T o confirm uniform transfer, p rote ins bound to membranes were stained with Ponceau S according to supplier (Boston Bioproducts). Membranes were blocked with 10 % (w/v) milk solution in Tris buffered saline (TBS) with agitation overnight at room temperature. Proteins were incubated with ant ibodies diluted in 10 % (w/v) milk in Tris buffered saline with 0.05 % Tween 20 (TBST). Flag tagged proteins were detected using alkaline phosphatase linked anti Flag M2 monoclonal antibody (Sigma) at a 1:5,000 dilution. StrepII tagged proteins were detect ed using rabbit anti StrepII polyclonal antibody (Genscript) at a 1:5,000 dilution and alkaline phosphatase linked goat anti rabbit IgG (H+L) antibody (SouthernBiotech) at a 1:10,000 dilution. Membranes were washed in TBST (3 x 15 min) after 1 h incubation of membrane with each antibody. Detection was completed by using chemiluminescence with CDP Star ray film (Hyperfilm; Amersham Biosciences).

PAGE 78

78 Table 2 1. Strains and plasmids used in Chapter 3. S train or plasmid Description Source or reference Strains: E. coli TOP10 F recA1 endA1 hsdR17 (r K m K + ) supE44 thi 1 gyrA relA1 Invitrogen E. coli GM2163 F ara 14 leuB6 fhuA31 lacY1 tsx78 glnV44 galK2 galT22 mcrA dcm 6 hisG4 rfbD1 rpsL136 dam13 : :Tn 9 xylA5 mtl 1 thi 1 mcrB1 hsdR2 New England Biolabs Hfx. volcanii DS70 wild type isolate DS2 cured of plasmid pHV2 (Wendoloski et al., 2001) Hfx. volcanii H26 DS70 pyrE2 (Allers et al., 2004) Plasmids: pJAM2678 pJAM2801 pJAM2802 pJAM2803 Ap r ; Nv r ; pJAM202 derived plasmid containing P2 rrnA bgaH from pTA102 pJAM2678 containing P samp1 118 bp bgaH pJAM2678 containing P samp2 110 bp bgaH pJAM2678 containing P samp3 292 bp bgaH (Rawls et al., 2011) This study This study This study pJAM2804 pJAM2678 containing P ubaA 118 bp bgaH This study

PAGE 79

79 Table 2 2. Primers used in Chapter 3. Primer Pair PCR Product/Description Primer Seque nces RT qPCR primer pairs: RT qPCR 2619 FW RT qPCR 2619 RV ~200 bp probe within samp1 ORF; used to quantify transcript levels of samp1 by RT qPCR GAGTGGAAGCTGTTCGCCGACCTCG 3' CGTCGTCACCGAACACCCGCGAT RT qPCR 0202 FW RT qPCR 0202 RV ~200 bp pro be within samp2 ORF; used to quantify transcript levels of samp2 by RT qPCR GACGACGACGGGACCTACGCGGAC CGGAGCACCTTCACGCGGTCGA RT qPCR 2177 FW RT qPCR 2177 RV ~200 bp probe within samp3 ORF; used to quantify transcript levels of samp3 by RT qPCR ACGCCTCCGCGTCCTCGCC GTGGACCACCTCGCGCCCGT RT qPCR 0558 FW RT qPCR 0558 RV ~200 bp probe within ubaA ORF; used to quantify transcript levels of ubaA by RT qPCR ATGACGCTCTCACTCGACGCCAC CCTGCCGCTGGAGGTTGCTC RT qPCR ribL FW RT qPCR r ibL RV ~200 bp probe within ribL ORF; used to quantify transcript levels of ribL by RT qPCR and served as the normalization gene for all RT qPCR work CCGGCGCCTGCTTGTTCTCGCG CCGAGGACTACCCCGTCCAGATTAGC

PAGE 80

80 Table 2 2 Continued Primer Pair PCR P roduct/Description Primer Sequences RT PCR primer pairs: samp1_trkA2 FW samp1_trkA2 RV end of samp1 end of trkA2 coding regions; used to determine if samp1 and trkA2 are transcriptionally linked ACGACCGTCGCACCCGAT CGAACAC CCGCGATTCGAGC trkA2_trkA1 FW trkA2_trkA1 RV end of trkA2 end of trkA1 coding regions; used to determine if trkA2 and trkA1 are transcriptionally linked CGTCCTCGCGGTCCGGCAC ACGAACGCGCCGACGACGAGG samp2_gcn5 FW samp2_ gcn5 RV end of gcn5 end of samp2 coding regions; used to determine if gcn5 and samp2 are transcriptionally linked GTGAAGGTGCTCCGCCTCATCAA CCTCGATATAGTCGCCGTCGAGCG samp3_2178 FW samp3_2178 RV end of samp3 and end of hvo_2178 coding regions; used to determine if samp3 and hvo_2178 are transcriptionally linked CTCATCGAGGACGGCGAG TCCTCGGTCTCGATGTCGA 2178_2179 FW 2178_2179 RV end of hvo_2178 and end of hvo_2179 coding regions; use d to determine if hvo_2178 and hvo_2179 are transcriptionally linked GACCTCGTCGAGCGGTTCG ACTCGAACCCCTGTGCGTACT

PAGE 81

81 Table 2 2. Continued Primer Pair PCR Product/Description Primer Sequences Primers for generating transcriptional reporter fusi ons: P samp1 118 bp FW P samp1 118 bp RV Putative samp1 promoter generated using genomic DNA as a template; includes XbaI and NdeI sites for cloning into pJAM2678 to generate pJAM2801. Promoter region includes 118 bp of genomic DNA upstream of the samp1 start codon ATCTAGAGTCTCTCGCAGTTCTGGCGTCCGAG ACTATACATATGCGCCGGTACACTCACCGACGC P samp2 110 bp FW P samp2 110 bp RV Putative samp2 promoter generated using genomic DNA as a template; includes XbaI and NdeI sites for cloning into pJAM2678 to gen erate pJAM2802. ATCTAGAATCCGTTGTACCGACCGCCC ACTATACATGCGCTCGTGGGTCGGG P samp3 292 bp FW P samp3 292 bp RV Putative samp3 promoter generated using genomic DNA as a template; includes XbaI and NdeI sites for cloning into pJAM2678 to generate pJ AM2803. Promoter region includes 229 bp of genomic DNA upstream of the samp3 start codon ATCTAGATCTGCCGGGTCGTTCG ACTATACATATGCCTTGTCGGCGTCCA

PAGE 82

82 Table 2 2. Continued Primer Pair PCR Product/Description Primer Sequences P ubaA 118 bp FW P ubaA 118 bp RV Putative ubaA promoter generated using genomic DNA as a template; includes XbaI and NdeI sites for cloning into pJAM2678 to generate pJAM2804. Promoter region includes 229 bp of genomic DNA upstream of the ubaA start codon ATCTAGAGTGGAC AAACACGCCCG GAGTGAGAGCGTCATATGCCGAGGTTGGCGTCG bgaH FW bgaH RV Primers used to amplify the bgaH, galactosidase encoding gene, ORF CAGCGACCATATGACAGTTGGTGTCTGCT TATGTAGCTCAGCTCACTCGGACGCGA Primers for mapping transcript ends: samp1 gsp Generates first strand cDNA specific for samp1 transcripts CACCGAACACCCGCGATTC samp1 P1 samp1 P2 untranslated regions (UTRs) of samp1 transcripts CGACGGCGAACTGTACGACCAC CCGGATGCGCCCCGAC samp1 N1 samp1 N2 ORF of samp2 GGAACGGCGAGGCGG CGTCGAGCGCGTCGC

PAGE 83

83 Tab le 2 2. Continued Primer Pair PCR Product/Description Primer Sequences samp2 GSP Generates first strand cDNA specific for samp2 transcripts TGAGGTCCACCGCCCG samp2 P1 samp2 P2 untranslated regions (UTRs) of sam p2 transcripts CCCACGAGGTGACCGCC CACGAGGTCCGCGTAGGTCC samp2 N1 samp2 N2 ORF of samp2 CTCGTCGACGGCCGCC GCGACCTCGCTGGTCTCCT samp3 GSP Generates first strand cDNA specific for samp3 transcripts CG CCGTCCTCGATGAGTC samp3 P1 samp3 P2 untranslated regions (UTRs) of samp3 transcripts GGTCAAGCCGCACGTGAACG CGTCGCGTCGTCGTCGA samp3 N1 samp3 N2 ORF of samp3 TGCTGAAAAACGGG CGC TAGATGGACTTCTGACCCACCAC

PAGE 84

84 Table 2 3. Strains and plasmids used in Chapter 4. Strain or plasmid Description Source or reference Strains: E. coli TOP10 F recA1 endA1 hsdR17 (r K m K + ) supE44 thi 1 gyrA relA1 Invitrogen E. coli GM2163 F ara 14 leuB6 fhuA31 lacY1 tsx78 glnV44 galK2 galT22 mcrA dcm 6 hisG4 rfbD1 rpsL136 dam13 ::Tn 9 xylA5 mtl 1 thi 1 mcrB1 hsdR2 New England Biolabs Hfx. volcanii DS70 wild type isolate DS2 cured of plasmid pHV2 ( Wendoloski et al., 2001) Hfx. volcanii H26 DS70 pyrE2 (Allers et al., 2004) MH105 HM1042 HM1052 Plasmids: pJAM947 pJAM949 pTA131 pJAM809 pJAM1118 H26 hvo_0580 ( ) H26 hvo_0202 ( ) H26 hvo_0558 ( ) Ap r ;Nv r ; pJAM202c carries P2rrna Flag hvo_2619 (Flag SAMP1) Ap r ;Nv r ; pJAM202c carries P2rrna Flag hvo_0202 (Flag SAMP2) Ap r ; pBluescript II carries P fdx pyrE2 with MCS Ap r ; Nv r ; pJAM202 carries P2rrnA hvo1862 Stre pII (KpnI site upstream of StrepII coding sequence) Ap r ;Nv r ; samp2 variant (Lys58 to Arg and Lys64 to Arg) carrying flag tag This study ( Miranda et al.,2011 ) ( Miranda et al.,2011 ) ( Humbard et al., 2010 ) ( Humbard et al., 2010 ) ( Allers et al., 2004 ) ( Humbar d et al., 2009 ) pJAM1910 Ap r ;Nv r ;Hvo_0580 500 bp flanking (deletion plasmid) ( Miranda, unpublished ) This study pJAM2812 Ap r ;Nv r ; hvo_0580 complement plasmid carrying strepII tag This study pJAM2813 pJAM2814 pJAM202c pJAM2818 Ap r ;Nv r ; samp1 in tand em with hvo_0580 carrying flag and strepII tag Ap r ;Nv r ; samp2 in tandem with hvo_0580 carrying flag and strepII tag Ap r ;Nv r ; Hfx. volcanii E.coli shuttle plasmid vector Ap r ;Nv r ; samp2 Lys58 to Arg and Lys64 to Arg SDM in tandem with hvo_0580 (ncsA) Thi s study This study ( Zhou et al., 2008 ) This study

PAGE 85

85 Table 2 4. Primers used in Chapter 4. Primer Pair PCR Product/Description Primer Sequences Hvo_0580 KpnI FW1 Hvo_0580 XhoI RV1 Used for generation of pre deletion plasmid with pTA131 and also for generation of DIG labeled probe for Southern blot TTGGTACCAGGAGGCGTTGCACACTTCGAGGTGGACCG 3' TCTCGAGCACTCCATTGCCGGTCGGTTGC Hvo_0580 Xho FW2 Hvo_0580 Xba RV2 Used for generation of pre deletion plasmid with pTA131 TCTCGAGGATAGAAGCGGTCTGAGCGGCTA CGGAA TTCTAGAGGAATCGCGAGCAACATCACCGAACGGCTGGA Hvo_0580 confirm FW 700bp Hvo_0580 confirm RV 700bp Anneals to 700bp upstream and downstream Hvo_0580 to confirm gene deletion CCGTCTCGGCATCGTCGTCC CATCACGCAGCCGTCCCTCA Hvo_0580 NdeI Hvo_ 0580 KpnI Used to generate pJAM2812 ( ncsA trans complement of ncsA ) CCGACCGTCATATGGAGTGCGACAAGTGCGG TTGGTACCGACCGCTTCTATCGACTCGATGAGTC tRNA Lys UUU probe P robe for detection of Hfx. volcanii tRNA Lys UUU CGGGCTGGGAGGGACTTGAACCCCC

PAGE 86

86 Table 2 5. Strains and plasmids used in Chapter 5. Strain or plasmid Description Source or reference Strains: E. coli Top10 F recA1 endA1 hsdR17 (r K m K + ) supE44 thi 1 gyrA relA1 Invitrogen E. coli GM2163 F ara 14 leuB6 fhuA31 lacY1 tsx78 glnV44 gal K2 galT22 mcrA dcm 6 hisG4 rfbD1 rpsL136 dam13 ::Tn 9 xylA5 mtl 1 thi 1 mcrB1 hsdR2 New England Biolabs Hfx. volcanii DS70 wild type isolate DS2 cured of plasmid pHV2 ( Wendoloski et al., 2001) H26 NC1101 HM1096 DS70 pyrE2 H26 ( ) H26 (Allers et al., 2004) This study (Miranda et al., 2011) Plasmids: pTA131 pJAM809 pJAM2819 pJAM2820 pJAM2821 pJAM202c pJAM2822 Ap r ; pBluescript II carries P fdx pyrE2 with MCS Ap r ; Nv r ; pJAM202 carries P2 rrnA hvo1862 StrepII (KpnI site upstream of StrepII coding sequence) Ap r ; pTA131 based pre deletion plasmid for hvo_0665 (HvTHI4) Apr; pTA131 based deletion plasmid for hvo_0665 (HvTHI4) Ap r ; Nv r ; pJAM202c carries P2 rrn hvo_0665 StrepII (HvTHI4 StrepII) Ap r ; Nv r ; Hfx. volcanii E.coli shuttle plasmid Ap r ; Nv r ; hvo_0665 StrepII Cys165 to Ala SDM (Allers et al., 2004) (Humbard et al., 2009) This study This study This study (Zhou et al., 2008) This study

PAGE 87

87 Table 2 6. Primers used in Chapter 5. Primer Pair PCR Product/Description Primer Sequences Hvo_0665 HindIII pre KO FW1 Hvo_0665 pre KO BamHI RV1 1.9 kb product includes hvo_0665 and 0.5 kb of the re gions flanking the gene; ligated into the HindIII to BamHI sites of pTA131 to generate pJAM2819 ATGAAGCTTAACGCGAGTCTCCTGTGGGCGCTCGG 3' ATTGGATCCGACGCGCGCACCTCGCCGTTC inverse inverse Used to generate the hvo_0665 deletion plasmid by inverse PCR using pJAM2819 as template TCCCGCGCCGGCCGACGACTGA TCCGTCGCGTCGGTGAAGCCGTCGAACGACAT Hvo_0665 700bp confirm FW (P3) Hvo_0665 700bp confirm RV (P4) Anneal 0.7 kb upstream and downstream hvo_0665 ; used to confirm strain GCTCGGCGGGGCGAACACG 3 GTGACCCACGAGACGACCCACGCG Hvo_0665 NdeI (P1) Hvo_0665 KpnI (P2) Used to screen for hvo_0665 strain and to generate pJAM2820 (for in trans complementation of hvo_0665 ) GGGCGGCATATGTCGTTCGACGGCTTCAC TTGGTACCGT CGTCGGCCGGCGC C165A THI4 FW C165A THI4 RV Used to generate the site directed mutation of C165A in HvTHI4 (Hvo_0665) CGCGAACTC ACG GCGGTCGACCCC ATC GATGGGGTCGACCGCCGTGAGTTC GCG

PAGE 88

88 CHAPTER 3 TRANSCRIPT ANALYSIS OF THE UBIQUITIN LIKE SAMPYLA TION SYSTEM GENES OF H fx. volcanii Introduction Archaea are one of the three evolutionary lineages of life. Archaea possess an overall genome organization similar to bacteria, but many of their molecular systems are similar to those of eukaryotes (Bell and Jackson, 1998). Archaeal RNA polymerases (RNAP) are similar to eukaryotic RNA polymerase II in both structure and function and are recruited by similar general transcription factors which are discussed later (Geiduschek and Ouhammouch, 2005). A notable di stinction of archaeal RNAP is that it lacks the C terminal extensions of the eukaryotic RNAPII that serve as a platform for complexes that mediate transcriptional activation, chromatin modification, transcriptional elongation and termination as well as co transcriptional RNA processing (Hirata et al., 2008). Although archaeal genomes do not encode for sigma factors as in bacterial genomes, archaea require basal factors for efficient promoter recognition (Bell and Jackson 2001; Geiduschek and Ouhammouch, 20 05). Archaea possess a transcription factor B (TFIIB in eukaryotes), and a TATA box which allows for binding of a TATA binding protein (TBP) for gene regulation (Geiduschek and Ouhammouch, 2005). More recently, an additional transcription factor, TFE, has been identified in archaea to facilitate TBP binding to the TATA box (Bell and Jackson, 2001). Hfx. volcanii possess multiple TFBs suggesting TFBs may recognize different BREs and, thus, regulate gene expression (Bell and Jackson, 2001). The mode of archae al transcription initiation is less complex compared to the transcription initiation of eukaryotes (Bell and Jackson, 1998; Bell and Jackson, 2001). In the archaea, TBP recognizes archaeal TATA box

PAGE 89

89 promoter elements and binds TFB (Bell and Jackson, 2001). TFB then recognizes the B recognition element (BRE), a site located immediately upstream of the TATA box (Bell and Jackson, 2001). RNAP is then recruited for transcription initiation (Geiduschek and Ouhammouch, 2005; Bell and Jackson, 2001). Although the basal transcriptional machinery of archaea and eukaryotes is related, archaeal gene regulation shares similarities wit h bacterial regulation. In the A rchaea, homologs of bacterial transcriptional activators and repressors bind at sites near the promoter t o interfere directly with transcription initiation (Bell and Jackson, 2001). An additional inherent mode of gene regulation among all three evolutionary lineages is regulation by small regulatory RNAs (sRNAs). sRNAs are largely considered to be posttranscr iptional regulators. In bacteria, these sRNAs are often encoded within intergenic regions and can be differentially expressed during environmental stress conditions (Kim and Gadd, 2008). Many of the bacterial sRNAs activate or repress translation (Kim and Gadd, 2008; Storz et al., 2011). In eukaryotes, RNA silencing is a mode of gene regulation mediated by sRNAs (Lu et al., 2005; Kim et al., 2009). Regulatory interactions are established based on nucleotide sequence base pairing between the sRNAs and their targets (Lu et al., 2005; Kim et al., 2009). Among the eukaryotic sRNAs are the small interfering RNAs, microRNAs, and Piwi interacting RNAs, which are distinguished from each other by their association with Argonaute family proteins (Lu et al., 2005; Kim et al., 2009). In archaea, only recently have sRNAs been identified and details concerning a mechanism of interaction between the sRNA and its target remain to be elucidated (Marchfelder et al., 2012). Two sRNA deletion

PAGE 90

90 mutants in Hfx. volcanii are sensiti ve to environmental stresses including heat shock and low salt conditions suggesting these sRNAs may be important in metabolism regulation (Straub et al., 2009). Taken all together, the archaeal mode of regulation is truly a hybrid of the eukaryotic machin ery and bacterial type regulation. Archaeal genomes encode for ubiquitin like proteins, three of which have been identified in Hfx. volcanii termed SAMP1, SAMP2, and SAMP3 (Humbard et al., 2 010; Miranda et al., 2013 ). As mentioned earlier, these three pr oteins require activation from an E1 like enzyme termed UbaA (Miranda et al., 2011). These small modifier proteins, similar to ubiquitin and other ubiquitin like proteins, posttranslationally modify target proteins within the cell, of which some of the mod ified proteins are stress related (Humbard et al., 2010). Ubiquitin encoded by eukaryotic genomes also modifies stress related proteins such as those involved in response to oxidative stress, aberrant cell signaling, and DNA damage (Grillari et al., 2010), and ubiquitin transcripts are stress induced (Finley et al., 1987; McGrath et al., 1991; Muller Taubenberger et al., 1988). Molecular mechanisms involved in the adaptation of archaeal cells to stress conditions involve transcription, translation, and prot ein recycling (Macario et al., 1999). SAMP1, SAMP2, and SAMP3 are covalently attached to target proteins involved in such mechanisms (Humbard et al, 2010; Miranda et al., 2013 ). A fundamental scientific gap exists in the regulatory network and regulation of Ub/Ubl proteins amongst the three major evolutionary lineages of life. Much literature is available concerning post translational modification by Ub/Ubl proteins and the mode in which Ub/Ubl protein regulates the transcription of genes, or translation o f target

PAGE 91

91 proteins. On the contrary, there is a gap in literature concerning the regulation or transcriptional organization of the actual Ub/Ubl proteins. To investigate the potential regulatory impact of the SAMPs and UbaA and to determine physiological c onditions during which the SAMPs and UbaA are regulated is important. The findings are anticipated to provide an insight into when the SAMPs may be needed for protein modification and/or sulfur transfer and also to enhance our understanding of the biologic al relevance of archaeal ubiquitin like proteins. The two aims of this study were to i) define the transcriptional units of samp genes and ii) determine whether samp and ubaA genes are regulated at the level of transcript and/or transcription during enviro nmental stress. Results and Discussion SAMP Geno mic Context is Conserved Among Many Haloarchaea One initial step to functionally characterize genomic sequences and gene networks is to determine operon organization. Genomic neighborhoo ds and co transcriptio n of genes within operons can provide insight into their role in cell physiology and biological pathways (Sneppen et al., 2010). The Microbial Genome Database (Uchiyama, 2003) was used for comparative analysis of samp gene homologs and gene neighbors among haloarchaea (Figures 3 1, 3 2 and 3 3). With this approach, results revealed samp1 samp2 and samp3 gene neighborhoods are conserved in many haloarchaea. The samp1 gene neighbors include putative trk genes which encode for K + regulators (Kraegeloh et al. 2005) (Figure 3 1). The Trk system will be discussed in further detail in the next section. Additional gene neighbors include a potassium channel like gene, pchA which also encodes for a put ative K + transporter and a gene

PAGE 92

92 encoding for a member of the un iversal stress protein family or uspA In E. coli the sensor kinase which regulates high affinity K + transport, KdpD, contains a UspA domain (Walderhaug et al., 1992). Interestingly, in some haloarchaea, the presence of uspA within the genomic context of the K + transporter genes suggests a regulatory role in K + channeling A putative histone acetyltransferase and glutamyl tRNA(Gln) amidotransferase subunit D are also conserved within the samp1 genomic context in some haloarchaea but not in Hfx. volcanii The samp2 genomic context is also conserved A putative GCN5 acetyltrasferase is adjacent to samp2 in many haloarchaea (Figure 3 2). Furthermore, a DNA replication factor A gene, rfcA appears to overlap the coding region of samp2 in Hfx. volcanii The rf cA overlap is also observed in other haloarchaea including Halalkalicoccus jeotgali B3 and Natronomonas pharaonis DSM 2160 suggesting a potential regulation of samp2 by a DNA replication factor or samp2 may regulate DNA rep lication in select haloarchaea. A dditionally, a putative phosphoglucomutase (potentially facilitates the interconversion of glucose 1 phosphate and glucose 6 phosphate) (Jagannathan and Luck, 1949) and a putative alanyl tRNA synthetase (Holley and Goldstein, 1959) are conserved within the genomic context of some haloarchaea. The samp3 genomic context is conserved among some haloarchaea including Hfx. volcanii Halorubrum lacusprofundi ATCC 49239 Halogeometricum borinquense DSM 11551 Haloarcula marismortui ATCC 43049 and Natronomonas pha raonis DSM 2160 however, a majority of samp3 gene neighbors encode hypothetical proteins (Figure 3 3). The samp3 genomic context is studied further in the proceeding sections.

PAGE 93

93 SAMP transcripts overlap in coding sequence with their gene neighbors To evalua te the operon organization of the Hfx. volcanii samp genes, an end point RT PCR approach was used with primers listed in Table 2 2 that were designed to adjacent gen e (Figures 3 4, 3 5 and 3 6). With this approach, all three samp genes were found to be associated with transcripts that had, at least, a portion of the coding sequence of an adjacent gene including: i) samp1 and trkA2 ii) trkA1 and trkA2 iii) samp2 and gnat ( hvo_0201 ), iv) samp3 and hvo_2178, and v) hvo_2178 and hvo_2129 (Figures 3 4, 3 5 and 3 6) TrkA1/2 are homologs of ligand gated K + channels, HVO_0201 is a member of the GCN5 related N acetyltransferase (GNAT) superfamily, and HVO_2178/9 are putative proteins of unknown function of which the former has a characteristic C terminal diglycine motif. The TrkA1/2 homologs that are associated with SAMP1 in Hfx. volcanii based on analysis by genomic context and RT PCR (Figures 3 1 and 3 4 ), are closely rel ated to ligand gated Trk K + channels characterized in halophilic organisms. In particular, the transcription and biochemical properties of the TrkA1/2 homologs TrkA, H and I of the bacterium Halomonas elongata have been examined (Kraegeloh et al., 2005). I n this extreme halophile, the trkA and trkH genes are demonstrated to be cotranscribed, and the Trk proteins form ATP dependent channels w hich transports K + from the surrounding medium resulting in the transient accumulation of K + as an osmoregulatory solu te to achieve an osmotic equilibrium (Kraegeloh et al., 2005). In the haloarchaeon Halobacterium sp. NRC1 the trk transcript levels are upregulated after osmotic shock suggesting these genes are associated with maintaining osmotic equilibrium (Coker et

PAGE 94

94 al ., 2007). However, these microarray studies of osmotically shocked cells show no differential regulation of the samp1 homolog transcript after osmotic shock compared to the several fold upregulation of trk transcripts during low salt conditions (Coker et a l., 2007). Thus, it is unclear whether samp1 is associated with osmotic shock similar to the putative trk genes in Hfx. volcanii. Based on end point RT PCR for samp2 a transcript is generated that overlaps coding sequence for samp2 and its downstream gen e neighbor, hvo_0201 a putative GCN5 related N acetyltrasferase (Figure 3 5). Acetyltransferases use acyl CoAs to acylate their cognate substrates including posttranslational modification of proteins by the covalent attachment of acetyl groups to the N amino group of the protein itself or the N amino groups of its lysine side chains (Sadoul et al., 2007). A significant body of data has confirmed that different acetylation dependent regulatory mechanisms govern protein ubiquitination and protein stabil ity (Glickman and Ciechanover, 2002). Protein acetyltrasferases in yeast that modify lysine residues at N terminal regions of proteins can target these proteins to degradation by the ubiquitin proteasome system (Glickman and Ciechanover, 2002; Sadoul et al ., 2007). Thus, in analogy to eukaryotic systems, our analysis of gene neighborhood and detection of transcript(s) with overlap in samp2 and gnat coding sequence suggests Hfx. volcanii has a coordinated mechanism to regulate protein acetylation and ubiquit in like sampylation. The gene neighbor of which samp3 generates a transcript, hvo_2178 (Figure 3 6) has no annotated function. HVO_2178 has a C terminal diglycine motif similar to SAMPs, and its 3D protein structure was modeled using Phyre 2 with 96.7% co nfidence and with 76% coverage to the C terminal domain of TTHA0151, which has an N

PAGE 95

95 terminal ubiquitin fold domain (data not shown). An N terminal epitope tagged variant of HVO_2178 does not form protein conjugates. Its role, however, in sulfur mobilizatio n has not been explored. In other haloarchaea genomes, this operon structure is conserved in which there is a diglycine motif present at the C terminus of the gene adjacent to the samp3 homolog (data not shown). The possible physiological relevance of a tr anscript with samp3 hvo_2178 coding sequence overlap is unclear. SAMP1 and SAMP3 Transcripts are Induced by DMSO For further insight into the potential operon organization of the samp genes, their transcripts were analyzed by Northern blotting. Total RNA, prepared from H26 wild type cells grown aerobically in the presence and absence of DMSO, was hybridized with DIG labeled probes specific for the samp1 3 coding sequences. The predominant samp1 transcript observed in cells grown in the presence of 100 mM DM SO was found to migrate in denaturing agarose gels at an estimated size of 1200 1300 nt s with a smaller, less abundant transcript at an estimated size of 450 550 nt s (Figure 3 7). These data are consistent with the end point RT PCR data (Figure 3 4) to ind icate samp1 generates a transcript with trkA2 coding sequence. However, the total region that spans the intergenic and coding sequences of the trkA2 to samp1 region is 1973 nt in length. Thus, the estimated size of the larger transcript (1200 1300 nt s ) rev eals that the samp1 UTR. However, the length of this transcript is too short to accommodate the entire samp1 and trkA2 coding sequences. The smaller transcript detected by Northern blot analysis using the samp1 specific probe may be a result of possible cleavage of the larger transcript or transcription initiation at two separate promoters. The samp1 transcripts were further explored later by mapping transcript ends. The predominant

PAGE 96

96 samp3 transcript in wild type cells grown in complex medium with DMSO was found to migrate at an approximate size of 400 500 nt s (Figure 3 7), and this is consistent with ends of the transcript which will be discussed in the later section. Transcripts specific for samp2 were not detected by this experimental approach and in the growth conditions tested suggesting that either samp2 transcripts are not abundant when grown aerobically in complex medium in the presence or a bsence of DMSO or the DIG labeled probe was not sensitive in detecting samp2 transcripts. UTRs ends of transcripts is used to identify not only where transcription init iation and termination occur but also enables the determination of the UTRs of transcripts and can be useful in identifying sites of transcript cleavage (Reiter et al., 1988). A recently developed method was used to determine transcri pt ends where, in brief, total RNA was isolated from wild type H26 monophosphates to ensure RNA circularization by an RNA ligase (Brenneis et al., 2007). Primers specific for the samp genes and reverse tran scriptase were used to generate the first strand of cDNA. A set regions of the open reading frame were also used. The PCR produ cts were TOPO cloned, and plasmid sequences were compared to the Hfx. volcanii genomic sequence. samp2 and samp3 transcripts were mapped from total RNA extracted from wild type cells grown with and without DMSO s upplementation, while samp1 transcript ends could only be mapped from total RNA

PAGE 97

97 extracted from wild type cells grown in the presence of DMSO (Figure 3 8, A, B and C). samp ATG UTR, leaving no space for a Shine Dalgarno sequence upstream of the start codon regardless of the growth conditions examined. Mapping the transcript ends facilitated our pr ediction of important promoter elements for the samp genes. Archaeal promoter elements typically include the transcription factor B renneis et al., 2007; Gregor and Pfeifer, 2005). The TATA box is generally centered at 27/ 28 bp from the transcriptional start site in archaea such as Hfx. volcanii (Brenneis et al., 2007; Gregor and Pfeifer, 2005). Thus, samp promoter elements were pred icted based on archaeal promoter consensus sequence combined with optimal spacing in relationship to the transcriptional start site, as predicted based on our RNA ligase mediated mapping ends (although RNase cleavage to generate the 5 end cannot be ruled out). Consensus motifs for BRE and the TATA box were identified to be centered approximately 27 bp upstream of the transcriptional/translational start sites of samp genes and are depicted in Figure 3 8, A, B and C. While both samp2 and samp3 promoter elements were identified within intergenic regions, the samp1 promoter was predicted to be located within the trkA2 open reading frame as both BRE and a TATA box promoter consensus sequence elements were centered 33 bp and 27 bp respectively upstream of the leaderless samp1 transcription start site (Figure 3 8A). Consistent with our findings, the majority of haloarchaeal transcriptional start sites mapped to date by this RNA ligase approach as well as primer extension and

PAGE 98

98 bioinformatic analys es are found to be leaderless (Tolstrup et al. 2000; Moll et al. 2002; Benelli et al. 2003; Brenneis et al. 2007). Haloarchaea efficiently translate leaderless transcripts by a mechanism thought to be initiated by an initiator Met tRNA that binds to the AU G at the beginning of the mRNA in the presence of additional translation initiation factors and large and small ribosomal subunits which are in association (Brenneis et al., 2007). At least 10 initiation factors have been identified in archaea, including a homologue of the eukaryal elongation factor 2 (eIF2) (Bell and Jackson, 1998; Kyrpides and Woese, 1998). Bacterial and eukaryotic leaderless transcripts use a similar mode of translation initiation in which transcripts bind undissociated ribosomes and ini tiator tRNA for translation initiation (Moll et al., 2002; Udagawa et al., 2004; Andreev et al., 2006; Brenneis et al., 2007). Thus, based on these results, all three samp transcripts most likely utilize a leaderless translation initiation strategy. The s amp specific transcripts UTRs of variable lengths UTRs of 5 nts for samp1 203 nts for samp2 and 219 nts for samp3 (Figure 3 UTRs (Brenneis ends that have been mapped to date are of UTRs are between 20 and 80 nts, and only seven UTRs extend beyond 100 nts (Brenneis et al., 2007). Furthermore, most of these previously UTRs previously mapped for Hfx. volcanii UTRs of the samp transcripts differed significantly in sequence with no apparent stretch of polyUs. Furthermore, the lengths of the samp UTR of samp1 at only 5 nts,

PAGE 99

99 while both samp2 and samp3 UTRs were much longer than the average at 203 and 219 nts, respecti vely. point RT PCR results for the samp transcripts, a number of insights were provided. First, the samp1 transcript of ~1,300 nt s (detected by Northern blot) that includes the trkA2 coding se quence (based on end point RT PCR coupled with gene organization) was not samp1 transcript of ~500 nt s detected by Northern blot most likely corresponds to the samp1 transcript identified by mappi ends, which would be 266 nts. The inability to detect the larger samp1 method, as no nested PCR product was detected greater than 400 bps that could be succe ssfully isolated from DNA agarose gels and TOPO cloned. An additional insight was that the samp2 UTR, which extends 203 nts beyond the translational stop codon, encompasses the majority of the adjacent hvo_0201 gene downstream of samp1 but does not spa n the entire coding sequence of this GNAT acetyltransferase gene UTR suggesting a site for transcription termination by such a motif does not occur for this samp2 transcript. Thus, samp2 transcripts a end by an RNase or use an alternative end of the transcripts which occur at hvo_0201 (Figure 3 8B). Interestingly, the samp3 UTR of 219 nts, also has no apparent polyU stretch and extends substantially into the adjacent downstream gene ( hvo_2178 ). Similarly to samp2

PAGE 100

100 terminates at a U c hvo_2178 coding sequence The open reading frames of the conserved hypothetical proteins nt downstream of HVO_2179 that may serve as a possible site of transcription termination. Furthermore, Northern blot analysis of samp3 transcripts indicated a transcript of 500 nt which is consistent with the deduced size of the samp3 transcript ese results reveal and support the end point RT PCR data indicating samp2 and samp3 generate a transcript with its downstream gene neighbors ( i.e ., hvo_0201 and hvo_2178 respectively) with the transcripts subject to possible post end pr mechanism of transcription termination. To further analyze these extended downstream regions of samp2 and samp3 Mfold 2.3 was used to identify putative stemloop structures. Prediction of secondary structure wi UTRs allows examination of potential transcription termination sites ( Mazumder et al., 2003 ). By this approach, multiple stemloop structures were predicted UTR of both samp2 and samp3 (Figure 3 9). The samp2 UTR has 3 predicted hai rpin regions stemming from positions 4 to 32, 41 to 137 and 141 to 203 (Figure 3 9A). Furthermore, five stemloop structures were predicted in the samp3 UTR at positions 4 to 22, 25 to 87, 88 to 122, 125 to 147, and 150 to 209 (Figure 3 9B). The structu re and sequence of the samp2 and samp3 putative stemloop structures are not conserved therefore a general mode of transcription termination is unclear. UTRs suggests an alternative mechan ism for samp transcription termination.

PAGE 101

101 SAMP Gene Transcripts may be Regulated at the Post Transcriptional Level During Certain Growth Conditions and Environmental Stress Different nitrogen sources Archaea are capable of utilizing both organic and inorga nic forms of nitrogen for cell growth (Cabello et al., 2004). Hfx. volcanii has a doubling time of 3.5 h when the inorganic form, ammonium chloride (NH 4 Cl), serves as the nitrogen donor compared to an organic nitrogen donor such as the amino acid alanine i n which the cells have doubling times from 9 to 23 h (Sabag Daigle, 2009). Ammonium chloride is thus considered a nitrogen sufficient source for growth of Hfx. volcanii and amino acids are considered to be nitrogen insufficient. Microarray data of Hfx. vol canii wild type cells grown in glycerol minimal medium in the presence of NH 4 Cl compared to alanine indicate significant differences in gene expression in the nitrogen assimilation pathway (Chavarria, unpublished). For example, the gene encoding the nitrog en regulatory protein PII is upregulated several fold when alanine serves as the nitrogen source as opposed to growth on NH 4 Cl where the nitrogen regulatory protein PII gene was not highly upregulated (Chavarria, unpublished). SAMP conjugate profiles and deletion mutants of proteasomal components are demonstrated to be significantly altered by growth on different nitrogen sources and during environmental stress respectively. During growth on alanine versus NH 4 Cl, the profile of SAMP1/2 protein conjugates w ere increased with alanine as the nitrogen source (Humbard et al., 2010 ). In addition, SAMP1/2 conjugates are altered during growth on glycerol minimal medium supplemented with alanine as the nitrogen source when wild type cells are compared to deletion mu tants of proteasome components (PAN A / pan A/1 and

PAGE 102

102 strains display reduced growth when alanine serves as the nitrogen source, are altered in their recovery from heat shock, and are sensitive to stresses including hypo osmotic shock a nd protein unfolding due to incorporation of the amino acid analogue L canavanine (Zhou et al., 2008). Since SAMP1/2 conjugates are altered by different nitrogen sources and this regulation appears linked to proteasome function, determining whether the sam p and ubaA gene expression was affected at the transcript level by growth in different nitrogen sources was important. To investigate the effect of nitrogen source on samp and ubaA gene expression at the transcript level, RT qPCR was performed. Wild type H 26 cells were grown in biological triplicate in glycerol minimal media supplemented with alanine or NH 4 Cl. Using this approach, an approximate 2.5 fold increase in the levels of samp1 and samp2 specific transcripts was observed when cells were grown in th e absence (with alanine as the nitrogen source) compared to the presence of ammonium (Figure 3 10A). In contrast, the levels of samp3 and ubaA specific transcripts remained unaltered by these conditions. Although transcript levels were increased for samp1 and samp2 transcripts, the approximate 2.5 fold transcript induction was modest. DNA sequence corresponding to 121 bp immediately upstream of the samp2 translation start site were fused to the start codon of the beta galactosidase gene, bgaH to assess samp 2 gene expression during growth with NH 4 Cl and alanine as a nitrogen source. In this construct, the samp2 promoter Figure 3 8 B ) were positioned 1 bp upstream of the bgaH translational start site, similarly to the native samp2

PAGE 103

103 that samp1 transcript is leaderless and likely transcribed from a promoter consensus sequence within the t rkA2 coding sequence as highlighted in Fig ure 3 8A However, at the time of this early study, the putative trkA1 promoter (upstream of samp1 ) was positioned 1 bp upstream of the bgaH translational start site and assessed for activity. Based on reporter as says, transcription from the putative samp2 and trkA1 promoters was not altered by nitrogen source (Figure 3 10A). The beta galactosidase specific activity during growth on NH 4 Cl and alanine was comparable at 97 11 and 76 9 Miller units for samp2 and 58 3.7 and 78 20 Miller units for trkA1 respectively. This result suggests that samp2 and trkA1 are not differentially regulated at the level of transcription by nitrogen source (Figure 3 10B). Thus, the increase in the level of samp2 transcripts observed by RT (q) PCR is indicative of post transcriptional regulation as the levels of transcription were not altered by nitrogen source. Heat shock Ubiquitin gene expression is heat shock inducible in eukar yotic organisms (Simon et al. 1999; Finley et al., 198 7; McGrath et al., 1991; Muller Taubenberger et al., 1988; Ovsenek and Heikkila, 1988). In Xenopus laevis ubiquitin mRNA is developmentally regulated in response to heat shock (Ovsenek and Heikkila, 1988). This accumulation of heat shock induced ubiquitin transcripts is proposed to be due to an increase in transcription and/or mRNA stability (Ovsenek and Heikkila, 1988). In addition to heat shock inducible ubiquitin in Xenopus laevis Dictyostelium discoideum a soil dwelling amoeba, also has accumulation of ubiquitin transcripts after heat shock with a decrease in these levels as cells recover from heat shock (Muller Taubenberger et al., 1988). This result suggested a negative feedback loop in which ubiquitin genes are inactivated by high concentrations of ubiquitin from excess production of ubiquitin

PAGE 104

104 during heat shock by an unidentified mechanism. This effect was also observed in S. cerevisiae where ubiquitin transcript levels increase during heat shock and decrease during a recovery period (Finley et al. 1987, Simon et al. 1999). To determine if samp and ubaA genes are differentially regulated at the transcript level by heat shock similar to ubiquitin of eukaryotic organisms, Hfx. volcanii wild type cells were subjected to a heat shock temperature of 6 0 C for 40 min. From previous heat shock studies of halophilic archaea, genes that encode for major regulatory functions such as chaperonins (Kuo et al., 1997) and heat shock transcription factors (Coker et al., 2007) are maximally expressed at the transc ript level after shift from 37 C and 42 C respectively to 60 C. Therefore, 60 C was selected as the temperature to study how heat shock may influence the transcript levels of samp and ubaA Transcripts were analyzed from cells exposed to heat shock and after a 20 min recovery period. Cells treated similarly, but not subjected to heat shock, were included as a negative control. RT ( q ) PCR was used to determ ine transcript levels. With this approach, transcript levels of samp1 and ubaA were found to be inc reased by heat shock, whereas the samp2/3 transcripts were not altered. In particular, samp1 and ubaA transcript levels were increased as a result of heat shock by approximately 2.3 and 1.7 fold, respectively (Figure 3 11A). In contrast, the samp2 and sam p3 transcript levels were altered less than 1 fold regardless of whether or not cells were exposed to heat shock (Figure 3 7A). After a 20 min recovery period at 42 C, the samp1 and ubaA transcripts were found to decrease from their peak levels during hea t shock suggesting a possible transitory effect of gene expression after heat shock,

PAGE 105

105 similarly to eukaryotic species where ubiquitin transcript levels are found to decrease during recovery from heat shock (McGra th et al., 1991; Simon et al. 1999). To furt her investigate the influence of heat shock on samp1 transcript levels, a time course analysis in which RNA was extracted from wild type H26 at different time points after shifting from 42 to 60C was performed. RT (q) PCR was used to detect samp1 transcri pt levels. By this approach, samp1 transcript levels were found to increase after the initial exposure to heat shock, reaching a peak increase of ~2.6 fold after 60 min and decreasing to nearly basal levels (only ~1.2 fold) after 105 min (Figure 3 11B). Th ese results suggest the samp1 transcript levels, although increased by heat shock, return to steady state to maintain cell homeostasis providing cells are viable at prolonged exposure at 60 C. Previous analysis of yeast ubiquitin transcript revealed an inc rease after heat shock however this effect was transient (McGra th et al., 1991; Simon et al. 1999). In yeast, monomeric ubiquitin levels slightly increase for a short period of time after heat shock and then decrease (McGrath et al., 1991). This effect wo uld therefore be consistent with the many ubiquitination reactions which occur during heat shock in yeast (McGrath et al., 1991). In addition to RT qPCR, beta galactosidase assays were to be used to study transcription from the putative samp1 promoter howe ver the BgaH enzyme is not thermostable (Figure 3 11C) at 60 C. Additionally, deletion mutant strains of samp2 and ubaA are sensitive to growth at an elevated temperature (50 C) suggesting both UbaA and SAMP2 functions are important during growth at eleva ted temperatures (Miranda et al., 2011). Cold shock Ubiquitin is a cold stress induced transcript in eukaryotes (Muller Taubenberger et al., 1988); thus, cold shock was used as a stress to study samp and ubaA gene

PAGE 106

106 expression. Hfx.volcanii cells bearing bgaH reporter fusions to promoter regions associated with samp2/3 ubaA and trkA1 (upstream of samp1 ) genes were subjected to cold shock at 4C for 1.5 h. Although cold shock response has not been studied in Hfx. volcanii 4C was chosen as the cold shock temperature A cold shock study has been performed in Halobacterium sp. NRC 1 where cells were grown at 15 C for cold shock whereas 42 C is the optimum temperature for growth of this organism (Coker et al., 2007). In this study, cold shock genes cspD1 an d cspD2 are upregulated during cold shock (Coker et al., 2007). Putative promoter reporter fusions revealed similar levels of transcription from samp and ubaA putative promoters during incubation at 4 C and 42 C (Figure 3 12) suggesting transcription leve ls are not altered by cold shock in Hfx. volcanii DMSO respiration versus oxygen respiration and aerobic growth in the presence of DMSO As an additional growth condition to assay for transcription from putative samp and ubaA promoters, transcription leve ls were investigated in rich media near optimal growth temperature (42 C) with either oxygen or DMSO as the terminal electron acceptor and also aerobically in the presence of DMSO. From a previous study (Miranda et al., 2011), SAMP2 protein conjugates inc reased when DMSO served as the terminal electron acceptor compared to oxygen. SAMP1 protein conjugate levels remained the same regardless of the terminal electron acceptor (Miranda et al., 2011). In an effort to determine whether the differential regulatio n of SAMP protein conjugates is consistent with transcriptional regulation, putative promoter regions were investigated using the aforementioned bgaH reporter assay. Cells bearing these putative promoter constructs were grown overnight in 10 ml screw cap t ubes on YPC supplemented with

PAGE 107

107 100 mM DMSO and 2% (wt/vol) glucose. The 10 ml screw cap tubes were filled to maximum volume to minimize the oxygen levels within the tube. Cultures were also grown aerobically with agitation in YPC supplemented with 2% (wt/vo l) glucose alone to maximize oxygen levels within the tube. During early logarithmic growth, cells were immediately lysed and BgaH specific activity was assessed. Transcription from samp and ubaA putative promoters, based on beta galactosidase activity, wa s similar regardless of the terminal electron acceptor (Figure 3 13) suggesting the increased SAMP2 protein conjugate levels when cells are grown with DMSO as the terminal electron acceptor is not at the level of transcriptional regulation therefore sugges ting post transcriptional regulation of samp2 during these growth conditions. Furthermore, it was noted earlier from Northern blot analysis that samp3 transcript levels are induced during oxygen respiration in the presence of DMSO. Therefore, to investigat e whether this induction is potentially regulated at the transcription level, samp2/3 putative promoters were used to assess promoter activity in complex medium in the presence and absence of DMSO (Figure 3 14). SAMP2 conjugate levels, similar to SAMP1 and SAMP3 conjugate levels, increased in the presence versus absen ce of DMSO aerobically (Miranda et al., 2013 ), therefore the samp2 putative promoter was also used in this study. Results revealed similar levels of both samp2 and samp3 promoter activity regar dless of DMSO supplementation in the growth medium suggesting increases in transcript levels and protein conjugate levels during growth with DMSO may be at the level of post transcriptional regulation. Together, these results suggest samp genes may be regu lated at the post transcriptional level during DMSO respiration in the case of samp2 and also during aerobic respiration for samp1/2/3 in the presence of DMSO.

PAGE 108

108 Although protein conjugate levels are increased during these conditions, transcription levels ar e unaltered. Conclusion This study reveals that all three samp gene neighb orhoods are conserved among ma ny haloarchaea and samp genes generate leaderless transcripts in which the mRNAs lack a 5' UTR and, hence, are missing canonical Shine Dalgarno sequ ences. Therefore, the start codon itself may serve as the most important signal for the translation initiation of these genes. The occurrence of leaderless transcripts in Hfx. volcanii is consistent with a majority of haloarchaea and some bacteria such as Actinobacteria and Deinococcus Thermus whose transcriptional start sites have been mapped (Brenneis et al., 2007; Zheng et al., 2011). Leaderless transcription has also been identified in well studied bacteria such as Escherichia coli but appears to be a stress induced function (Vesper et al., 2011), by contrast to organisms such as Hfx. volcanii where it is common. In addition to mapping transcriptional start sites, the samp UTRs, a common feature of the majority of ha ends have been mapped (Brenneis et al., 2007). However, in the case of the samp2 and samp3 the ORF of the downstream gene, gnat and hvo_2178 respectively. Northern blot analysi s of samp1 revealed two transcripts (in the range of 1200 1300 nts and 450 550 nts) and a single transcript of ~450 nts was detected for samp3 Overall, the results not only shed light on the organization of samp genes and samp transcripts in Hfx. volcanii but also add, in general, to the understanding of samp transcriptional units in haloarchaea.

PAGE 109

109 SAMP transcripts were also differentially expressed under varying conditions. The samp1 and samp2 transcripts were differentially regulated whereas samp3 and ub aA levels were not differentially regulated at the transcript level by growth on different nitrogen sources ( i.e ., NH 4 Cl and alanine). Putative promoter reporter fusion assays demonstrated similar levels of promoter activity during growth regardless of nit rogen source. Taken together, posttranscriptional regulation of samp1 and samp2 may occur during growth on different nitrogen sources. Also, samp1 transcripts were upregulated in a time dependent manner during heat shock. The samp1 transcript levels increa sed and then decreased during heat shock suggesting this phenomenon is transient in order to maintain steady state levels of samp1 during heat shock. Also, samp transcription levels remained the same during cold shock versus 42 C and respiration with oxyg en versus DMSO as the terminal electron acceptor during experimental conditions tested. Furthermore, although samp3 transcript levels are induced in the presence versus absence of DMSO during growth where oxygen served as the electron acceptor, samp3 trans cription levels remained the same suggesting posttranscriptional regulation. Taken together, these data suggest different modes of regulation for samp genes and during certain conditions tested, samp genes may be regulated at the posttranscriptional level. This is the first study of samp transcripts and regulation of samps and it provides a basis for further studying regulation of ubiquitin like proteins in archaea.

PAGE 110

110 Figure 3 1. The samp1 ge nomic context is conserved in many haloarchaea. Genes that are c onserved across multiple species are as follows: samp1 red, potassium transporter ( trkA1/2 lime green), universal stress protein A ( uspA dark green), potassium channeling A homolog ( pchA multicolored in pink, orange, yellow, and light blue), histone ac etyltransferase ( hat5 dark purple), glutamyl tRNA(Gln) amidotransferase subunit D ( asbA light purple) and genes encoding hypothetical proteins are cyan.

PAGE 111

111 Figure 3 2. The samp2 genomic context is conserved in many haloarchaea. Genes that are conserved across multiple species are as follows: samp2 red, GCN5 related N acetytrasferase ( gnat lime green), replication factor A (rfcA, dark blue), alanyl tRNA synthetase ( alaS1 pink), phosphomannomutase ( pmm burgundy/pool blue) and genes encoding hypothetica l proteins are cyan.

PAGE 112

112 Figure 3 3. The samp3 genomic context is conserved in many haloarchaea. Genes that are conserved across multiple species are as follows: samp3 red, hypothetical protein with diglycine motif ( hvo_2178 lime green), hypothetical pro tein often associated with HVO_2178 ( hvo_2179 orange), aldehyde oxidoreductase ( aor4 cyan/dark blue) and genes encoding hypothetical proteins are cyan.

PAGE 113

113 Figure 3 4. The samp1 gene generates transcript with trkA2 a putative K + channeling homolog. Thi s is a schematic representation of the samp1 genomic context and locations for primers to anneal for RT qPCR, end point RT PCR, and probe for Northern blot analysis. End point RT PCR reveals generation of a transcript (RT+) for trkA1 and trkA2 as well as s amp1 and trkA2 Genomic DNA (PCR) was used as a positive control and RNA without the reverse transcriptase step (RT ) was used as a negative control. Genes generating cotranscripts are in aqua and genes flanking this region are in gold.

PAGE 114

114 Figure 3 5. The samp2 gene generates transcript with gnat a putative GCN5 related N acetyltransferase. This is a schematic representation of the samp2 genomic context and locations for primers to anneal for RT qPCR, end point RT PCR, and probe for Northern blot analysis. End point RT PCR reveals generation of a transcript (RT+) ends of samp2 and gnat Genomic DNA (PCR) was used as a positive control and RNA without the reverse transcrip tase step (RT ) was used as a negative control. Genes generating cotranscripts are in aqua and genes flanking this region are in gold.

PAGE 115

115 Figure 3 6. The samp3 gene generates transcript with hvo_2178 a str ucturally related MoaD protein. This is a schematic representation of the samp3 genomic context and locations for primers to anneal for RT qPCR, end point RT PCR, and probe for Northern blot analysis. End point RT PCR reveals generation of a transcript (RT +) for samp3 and hvo_2178 as well as hvo_2178 and hvo_2179 Genomic DNA (PCR) was used as template for PCR and served as a positive control and RNA without the reverse transcriptase step (RT ) was used as a negative control. Genes generating cotranscripts are in aqua and genes flanking this region are in gold.

PAGE 116

116 Figure 3 7. Detection of samp1 and samp3 transcripts by Northern blot analysis when cells are grown in the presence of DMSO. Total RNA was isolated from Hfx. volcanii H26 wild type grown at 42C ( 200 rpm) in the absence of DMSO and the presence of 15mM and 100mM DMSO as indicated. Transcripts were analyzed by Northern blotting with DIG labeled probes specific for samp1 and samp3 as indicated. Transcript sizes are denoted for samp1 (~1290 nt and ~54 0 nt) and for samp3 (~450 nt). The markers (in thousands) of DIG labeled RNA molecular weight marker I are indicated on the left. The blot on the far left is representative for detection of samp transcripts with DIG labeled for samp1 samp2 and samp3

PAGE 117

117 A B Figure 3 8. mRNA sequence of samp1 /2/3 transcript s indicating ends. A) The ends of samp1 transcript and putative BRE and TATA regions and ends of samp2 transcript and predicted promoter elements (BRE and TATA ends of samp3 transcript and predicted promoter elements (BRE and TATA box in light purple). Open reading frames for samps (pink) and neighboring genes (lig ht green) are also highlighted.

PAGE 118

118 C Figure 3 8. Continued

PAGE 119

119 A Figure 3 9. The samp2 and samp3 UTRs possess multiple putative stemloop structures. The secondary structures are evidenced by the basepairing of UTR of samp2 (A) and samp3 (B).

PAGE 120

120 B Figure 3 9. Continued

PAGE 121

121 Figure 3 10. The samp1 and samp2 transcripts may be regulated at the post transcripti onal level when cells are grown with alanine as the nitrogen source. A) RT qPCR data of H26 wild type cells grown in glycerol minimal medium with alanine versus ammonium chloride as the nitrogen source. B) galactosidase enzyme activity assay of putative P trkA1 and P samp2 promoter as well as promoterless controls (RBS=ribosomal binding site) and the positive rRNA P2 control prepared from cells grown in glycerol minimal medium with alanine ( NH4Cl) versus ammonium chloride (+NH4Cl) as the nitrogen source. All experiments were performed in triplicate, and the means SD were calculated. A B

PAGE 122

122 Figure 3 11. The samp1 transcripts are induced by heat shoc k (60 C) and this effect is transient. A) RT qPCR data of H26 wild type cells exposed to heat shock at 60 C versus non heat shocked cells and cells exposed to heat shock conditions and given a recovery period for 20 minutes vs. non heat shocked cells. B) Time course analysis of samp1 transcript com pared to non heat shocked cells. All experiments were performed in triplicate, and the means SD were calculated.C) BgaH t h ermostability as a function of temperature. A B

PAGE 123

123 C Figure 3 11. Continued

PAGE 124

124 Figur e 3 12. The samp and ubaA putative promoter activity is similar during cold shock versus 42 C. galactosidase enzyme activity assay of putative promoters (P trkA1 P samp2, P samp3, P ubaA ) as well as promoterless controls (RBS=ribosomal binding site) and th e positive rRNA P2 control prepared from cells during cold shock (4 C) in light grey and from cells during growth at near optimal temperature (42 C) in dark grey. All experiments were performed in triplicate, and the means SD were calculated.

PAGE 125

125 Figure 3 13. The samp and ubaA putative promoter activity is similar during oxygen versus DMSO respiration. galactosidase enzyme activity assay of putative promoters (P trkA1 P samp2, P samp3, P ubaA ) as well as promoterless controls (RBS=ribosomal binding site) and the positive rRNA P2 control prepared from cells grown in complex medium (YPC) with 2% glucose in dark grey and from cells grown in YPC with 2% glucose supplemented with 100mM DMSO in light grey. Experiments were performed in triplicate, and the means SD were calculated.

PAGE 126

126 Figure 3 14. The samp3 putative promoter activity is similar in the presence versus absence of DMS galactosidase enzyme activity assay of putative promoters (P samp2 P samp3 ) as well as promoterless controls (RBS=ribosomal binding site) and the positive rRNA P2 control prepared from cells grown in complex medium (ATCC 974) as indicated by the light grey box and from cells grown in ATCC 974 supplemented with 100 mM DMSO. Experiments were performed in triplicate, and the means SD were calculated.

PAGE 127

127 CHAPTER 4 Ncs6/Tuc1 HOMOLOG (NcsA) IS REQUIRED FOR tRNA Lys UUU THIO LATION AND IS ASSOCIATED WITH UBIQUITIN PROTEASOME AND RNA PROCESSING SYSTEM HOMOLOGS IN ARCHAEA Introduction A wide variety of posttranscript ional modifications in RNA are widespread amongst all evolutionary lineages (Auffinger and Weshof, 1998; McCloske y et al., 2001). Over 100 modified RNA species have been identified to date (Rozenski et al., 1999). RNA modifications play critical roles in cell metabolic processes and RNA structural stability (Rozenski et al., 1999). In particular, modification of tRNA is important for proper codon anticodon base pairing and decoding (Bjork, 1992; Agris, 1996). One such tRNA modification is 2 thiomodification of tRNAs specific for lysine, glutamate, and glutamine (Rogers et al., 1995) which was recently reported in yeas t to enhance translational efficiency by increasing ribosomal A site binding and peptide bond formatio n in vitro (Rezgui et al.,2013) Ub/Ubl proteins conjugate to target proteins within the cell to mediate both proteolytic and non proteolytic modification s (Hochstrasser, 2009). In the eukaryote Sacchormyces cerevisiae the ubiquitin related modifier protein, Urm1, participates in both protein modification (Goehring et al., 2003 a Van der Veen et al., 2011) and is required for 2 thiouridine biosynthesis (Na kai et al., 2008; Schlieker et al., 2008; Leidel et al., 2009; Noma et al., 2009). Five proteins in yeast (Urm1, Uba4, TUM1, Ncs6, and Ncs2) have been identified by ribonucleome analysis as important proteins for 2 thiouridine biosynthesis (Noma et al., 2 009). It is proposed that Urm1p is first adenylated by the E1 like activating enzyme, Uba4. Once activated by Uba4, the C terminal diglycine of Urm1 is thiocarboxylated by a persulfide generated from cysteine

PAGE 128

128 desulfurases. The activated sulfur is then tran sferred to uridines in the wobble position of lysine, glutamate, and glutamine tRNAs that have been adenylated by Ncs6 (Noma et al., 2009). Ncs6 contains a P loop ATPase domain commonly found in tRNA modifying enzymes belonging to the N type ATP pyrophosph atase superfamily (Bjork et al., 2007; Dewez et al., 2008; Nakagawa et al., 2013). Ncs2, a protein partner of Ncs6, either enhances the binding of Ncs6 to tRNA or may facilitate 2 thiolation in another capacity (Dewez et al., 2008). This sulfur relay syste m and the use of ubiquitination chemistry to mediate such a system is also similar in Thermus thermophilus and Arabidopsis thaliana (Shigi et al., 2006; Shigi et al., 2008; Nakai et al., 2012 ). Sulfur is an essential element of life that is required for the synthesis of vitamins, biomolecules, amino acids, and cofactors (Kessler, 2006). The incorporation of sulfur into biomolecules in archaea is not well studied. The source of sulfur in archaea is unknown however, recently, in vitro studies suggests sulfi de can act as a sulfur donor for 4 thiouridine biosynthesis in Methanococcus maripaludis (Liu et al., 2012). The presence of 2 thiouridine biosynthesis in the haloarchaeon Haloferax volcanii has also been identified from our recent studies of UBL protein small archaeal modifier proteins (SAMPs). SAMP2 and the E1 like ubiquitin activating homolog, UbaA, are important in posttranslational protein modification and for thiolation of tRNA Lys UUU indicative of 2 thiouridine biosynthesis (Miranda et al., 2011). Here we report the characterization of Hfx. volcanii NcsA (HVO_0580; Ncs6/Tuc1 homolog). NcsA was found important for maintaining cellular pools of thiolated tRNA Lys UUU and growth at elevated temperatures. NcsA was covalently modified by apparent polySAMP 2 chains through a UbaA dependent mechanism and was non

PAGE 129

129 covalently associated with homologs of the eukaryotic ubiquitin proteasome and exosome systems. Taken together, our results suggest the archaeal Ncs6/Tuc1 homolog, NcsA, is important for 2 thiolation of wobble uridine tRNAs and is intimately linked with post translational systems including ubiquitin like protein modification, protein degradation and RNA processing. Results and Discussion NcsA and i ts H aloarchaeal O rthologs Form a Distinct Subgroup w ith in the Adenine N uperfamily and h ave Conserved tRNA Thiolase Active S ite R esidues. Hfx. volcanii hydrolase (ANH) superfamily (cd01993) and is predicted to be involved in tRNA thio modifi cation based on Gene Ontology annotation (GO:0034227) and sequence similarity to tRNA modification enzymes such as Ncs6/Tuc1. In this study, hierarchical clustering was used to further understand the relationship of NcsA (HVO_0580) to members of the ANH pr otein superfamily ( Figure 4 1 ). NcsA was found to form a tight cluster with uncharacterized ANH superfamily members from other haloarchaea. This haloarchaeal specific ANH cluster was related to eukaryotic Ncs6/Tuc1 and relatively distinct from the bacteria l and archaeal members that have been characterized including: Salmonella enterica serovar Typhimurium TtcA (Jager et al., 2004), Thermus thermophilus TtuA (Shigi et al., 2008; Shigi, 2012; Nakagawa et al., 2013), and Pyrococcus horikoshii Ph0300 (Nakagawa et al., 2013). These protein sequence relationships suggested new insight would be provided through biochemical and genetic study of Hfx. volcanii NcsA (HVO_0580).

PAGE 130

130 We next determined whether Hfx. volcanii NcsA had conserved active site residues common to ANH superfamily members using Phyre2 based homology modeling and multiple amino acid sequence alignment (Figure 4 2 and Figure 4 3). NcsA was predicted to have conserved 3D structural fold and residues common to Ncs6 and TtuA proteins of the TtcA family g roup II including the five C X 2 [C/H] motifs and the PP motif (P loop like motif in a widespread ATP pyrophosphatase domain; SGGXDS, where X is any amino acid residue) (Jager et al., 2004; Bork and Koonin, 1994; Bjrk et al., 2007; Nakagawa et al., 2013). Based on recent study of TtuA by in vivo site directed mutagenesis and x ray crystallography, the first and second C X 2 [C/H] motifs form an N terminal zinc finger (ZnF1), the third C X 2 C forms the putative catalytic active site and the C terminal zinc fi nger (ZnF2) is formed by the fourth and fifth C X 2 C motifs (Nakagawa et al., 2013). Thus, Hfx. volcanii NcsA is predicted to have conserved residues of the cysteine rich and PP motifs that mediate the binding, adenylation and thiolation of tRNA. NcsA is Necessary for Thio Modification of Lysine tRNA with a Wobble U ridine N ext a genetic approach was used to investigate the role of NcsA in the thiolation of tRNA. An Hfx. volcanii strain with a markerless deletion of the ncsA ( hvo_0580 ) gene and its trans c omplement (that expressed NscA with a C terminal StrepII tag, NcsA StrepII) were generated from parent strain H26 and confirmed by Southern blotting and DNA sequence analyses ( Figure 4 4 ) Total RNA was purified from these strains and analyzed for thiolati on of wobble uridine tRNA by use of APM gel electrophoresis coupled with Northern blotting using a probe specific for tRNA Lys UUU (Fig ure 4 5 ). The tRNA Lys UUU probe was chosen based on the presence of uridine nucleoside in the wobble position of the anticod on specific for lysine tRNAs. By this

PAGE 131

131 experimental approach, a fraction of tRNA Lys UUU in the parent and trans complement strains was found to be thio modified ( Figure 4 5 lanes 1 and 3). By contrast, only non thiolated tRNA Lys UUU was detected in the mutant strain ( Figure 4 5 lane 2). Taken together, these results revealed NcsA is required for the thiomodification of the wobble uridine of tRNAs specific for lysine, similarly to what has been previously observed for the ubiquitin fold SAMP2 and E 1 like UbaA (Miranda et al., 2011). Thus, UbaA, SAMP and NcsA may function like the eukaryotic Uba4, Urm1 and Ncs6 in the thiol modification of wobble uridine tRNAs including those specific for lysine (tRNA Lys UUU ), glutamate (tRNA Glu UUC ) and glutamine (tRN A Gln UUG ). NcsA is Necessary for Growth at Elevated Temperatures N ext NcsA was examined to determine whether it is necessary for optimal growth at elevated temperature similar to SAMP2 and UbaA (Miranda et al., 2011). Hfx. volcanii mutant and its trans complement were compared to H26 parent and mutant for growth at 50 for all conditions to growth at 42 growth of Hfx volcanii Hfx. volcanii strains were found to have comparable growth rates and cell yield under all conditions tested (Fig ure 4 6 ). By contrast, when cells were grown at 42 transferred to 50 a slow growth phenotype was detected for the and mutant strains when compared to the parent and ncsA trans complement (Fig ure 4 7 A). To examine whether this slow growth phenotype may be attributed to suppressor mutation(s), the four Hfx. vol canii medium, and monitored for growth at 50 Figure 4 7 B). By this experimental approach, the and mutant strains were found to display no detectable

PAGE 132

132 growth at 50 growth and cell yield detected for the parent and trans complement strains ( Figure 4 7 B). Similar results were observed by rich medium agar plate assay ( Figure 4 7 C). Thus, the slow growth phenotype of the and strains was not due to a suppress or mutation but instead is likely due to cellular component(s) present in the 42 initial batch culture at 50 term growth at this elevated temperature. The phenotypic characteri zation of the mutant provides evidence that NcsA is needed for growth at high temperature. Many thiolase enzymes of the ANH superfamily are demonstrated to be important for growth at elevated temperatures including TtuA from Thermus thermophilus (Shi gi et al., 2006) and Ctu1/Ncs6/Tuc1 from Schizosaccharomyces pombe (Dewez et al., 2008). Based on recent work demonstrating the importance of wobble uridine thiolation in structuring the anticodon for efficient and accurate recognition of cognate and wobbl e codons (Vendeix et al., 2012), we speculate that the thermosensitive phenotype of the mutant is due to the lack of 2 thiomodification that would otherwise promote efficient translation and tRNA structural stability. UbaA Mediates Covalent and Non Covalent Associations of NcsA with SAMP2 In an effort to further understand the previous MS based detection of NcsA and its association with SAMP2 (Humbard et al., 2010), NcsA pull down assays were used to determine potential protein partners. The trans complemented mutant, which expresses NcsA StrepII, was used for pull down of NcsA by StrepII affinity chromatography. Additional strains that co expressed NcsA StrepII with N terminal Flag tagged (Flag ) SAMP1 and SAMP2 proteins were also analyzed. Flag SAMP1

PAGE 133

133 served as a negative control, as SAMP1 was not predicted to interact with NcsA ba sed on our previous analysis by mass spectrometry (Humbard et al., 2010) and Northern blotting of APM gels which revealed SAMP1 was not necessary for thiolation of tRNA Lys UUU (Miranda et al., 2011). An empty vector control, pJAM202c, was used to identify n on specific proteins which may have co purified from the mutant by StrepII affinity chromatography. NcsA was found to purify with protein partners and as multiple NcsA isoforms by the StrepII pull down approach. Analysis of the NcsA pull down fracti ons by Coomassie staining (Figure 4 8 A, upper) of proteins separated by reducing SDS PAGE revealed purification of a predominant protein migrating at ~36 kDa, which was likely NcsA StrepII based on its anhydrous mass of 37.4 kDa. Additional protein bands w ere also detected in the NcsA StrepII purified fractions that were not detected in the empty vector control suggesting protein partners may have co purified with NcsA ( Figure 4 8 A, lane 1). The NscA pull down fractions were further examined by immunoblotti ng with antibodies raised against the StrepII and Flag tags ( Figure 4 8 as indicated). From this experimental approach, NcsA was detected at ~ 36 kDa by anti StrepII ( Figure 4 8 A). However, additional bands of higher molecular mass were also detected by anti StrepII that were not found in the vector control suggesting the presence of covalently modified forms of NcsA that are resistant to boiling in reducing SDS buffer ( Figure 4 8 A). To further investigate this possibility, the NcsA pull down fractions we re probed with an anti Flag antibody as both SAMP1 and SAMP2 were Flag tagged proteins ( Figure 4 8 A). From this analysis, Flag SAMP1 did not appear to co purify with NcsA. By contrast, SAMP2 was readily detected in NcsA pull down fractions and appeared to be

PAGE 134

134 associated in a free form (20 kDa band based on previous studies) (Humbard et al., 2010; Miranda et al., 2011) and as protein conjugates (migrating at 60 250 kDa). Based on these results, it is suggest ed that NcsA is associated with SAMP2 through covale nt and non covalent bonds. Furthermore, SAMP2 protein conjugates that are distinct from SAMP2 modified NcsA also appear to be enriched in these fractions based on comparison of the protein banding pattern in the >50 kDa region by anti StrepII and anti Flag immunoblotting (Fig. 4A, lane 3). N ext experiments were performed to determine if SAMP2 encoded from the genome was covalently bound to NcsA and whether this modification required the E1 like activating enzyme, UbaA. In brief, the NcsA StrepII pull down experiments were performed in H26 (wild type), and backgrounds and the fractions were analyzed by anti StrepII immunoblot ( Figure 4 8 B). When purified from wild type cells, NcsA was detected as a predominant band o f ~36 kDa (consistent with i ts anhydrous mass) as well as associated in putative covalent protein conjugates of 50 125 kDa ( Figure 4 8 B, lane 1). By contrast, NcsA was only detected as an ~36 kDa band when purified from the and strains, providing evidence that SAMP2 and UbaA are required for the modified forms of NcsA that are detected by this assay. As an additional measure to verify that UbaA is needed for NcsA modification, Flag SAMP2 and NcsA StrepII were co expressed in wild type and and analyzed by anti StrepI I and anti Flag immunoblot ( Figure 4 8 C). By anti StrepII immunoblot, both unmodified and modified forms of NcsA were observed in the wild type background ( Figure4 8 C, lane 1). However, the modified forms of NcsA were not detected in the mutant strai n ( Figure 4 8 C, lane 2), suggesting and consistent with earlier

PAGE 135

135 experiments that UbaA is important in mediating NcsA modification. By anti Flag immunoblot, the conjugate and free forms of SAMP2 were detected in the wild type background (Figure 4 8 C, lane 3 ). However, the banding pattern was reduced in the background (Figure 4 8 C, lane 4) again suggesting the importance of UbaA in mediating conjugation of SAMP2 to NcsA. Free SAMP2 levels (migrating at ~20 kDa) were also dramatically reduced in the background when compared to wild type (Figure4 8 C lane 4 versus 3). It is suggest ed that UbaA is needed for SAMP2 activation as an acyl adenylate followed by SAMP2 thiocarboxylation through a sulfur relay system. These UbaA mediated modifications to the C terminus of SAMP2 may precede the non covalent b inding of SAMP2 to NcsA and would be reflected as reduced binding of SAMP2 to NcsA in strains that lack UbaA. Alternatively, SAMP2 is not synthesized or expressed at high levels when cells are deficient of UbaA; however, this does not appear to be the case based on our previous analysis of Flag SAMP2 expression in a strains (Miranda et al., 2011). Another interesting observation, from the anti Flag immunoblotting results, was the detection of an ~60 kDa band that appeared covalently associated with SA MP2 and was present in NcsA pull down fractions of the mutant strain (Figure 4 8 C, lane 4) but not the empty vector control (data not shown). This SAMP2 conjugate was not NcsA StrepII and would be the first report of such a putative SAMP2 conju gate formed independent of UbaA in Hfx. volcanii or other archaea. To further investigate the SAMP2 modified forms of NcsA, the NcsA protein fractions purified from the mutant strain expressing Flag SAMP2 and NcsA StrepII were treated with the desamp ylating enzyme, HvJAMM1, and analyzed by

PAGE 136

136 immunoblotting. HvJAMM1 is a Zn 2+ dependent metalloenzyme of the JAB1/MPN+/MOV34 superfamily that hydrolyzes covalent bonds between SAMPs and their target substrates (Hepowit et al., 2012). Based on anti StrepII imm unoblotting, HvJAMM1 was found to hydrolyze the SAMP2 36 kDa form of NcsA ( Figure 4 9 A, lane 3). As negative controls, NcsA fractions were incubated without HvJAMM1 or alternatively the metal chelator, EDTA, was ad ded to the reactions to chelate the Zn 2+ needed for HvJAMM1 activity. In these control reactions ( Figure 4 9 A, lanes 1 and 2), the covalently modified forms of NcsA were still detected. The identical protein fractions were subject to anti Flag immunoblot, and the results revealed that SAMP2 conjugate levels were significantly reduced in the presence of HvJAMM1 metalloprotease ( Figure 4 9 B lane 3) but not in control reactions ( Figure 4 9 B, lanes 1 and 2). Interestingly, analysis of the samples by anti Flag Flag bands between 50 kDa and 75 kDa that remained after treatment of NcsA fractions with HvJAMM1 (Fig ure 4 9 B, lane 3) that were consistent with proteins detected in the NcsA fractions purified from co exp ressing NcsA StrepII with Flag SAMP2 (Fig ure. 4 9 B, lanes 6 7). The bands in this region from NcsA StrepII purified fractions from the background were not hydrolyzed by HvJAMM1 suggesting these unidentified protein(s) are modified covalently by bonds that are distinct from the bonds formed by UbaA that are hydrolyzed by HvJAMM1. Overall, analysis of NcsA pull down fractions by HvJAMM1 provides further evidence that NcsA is covalently bound to SAMP2 and suggests NcsA modification may, in part, be regul ated by HvJAMM1 activity.

PAGE 137

137 NcsA Lys204 is I s opeptide Linked to SAMP2 With evidence that NcsA is modified by SAMP2 through a UbaA dependent mechanism, we next sought to determine whether the covalent linkage was an isopeptide bond and to identify the site of modification. Thus, NcsA StrepII purified proteins were subjected to trypsin digest and analyzed in liquid and in gel slices by Orbitrap liquid chromatography (LC) tandem MS (MS/MS). This approach has been previously used to map modification sites of SAMP 2 (Humbard et al., 2010). Based on MS analysis, an increase of +114 kDa, indicating the presence of a diglycine footprint, was observed on Lys204 of NcsA ( Figure 4 10 ). This NscA SAMP2 isopeptide linkage was uniquely identified in the MS/MS spectral analys is of NcsA StrepII purified samples and was not detected in the vector alone control. NcsA is Covalently Modified by Poly SAMP2 Chains Ub/Ubl proteins are susceptible to chain formation on target substrates, thus, serving as a signal in proteasomal mediat ed degradation or other regulatory roles within the cell (Hochstrasser, 2009). Lys58 linked SAMP2 chains have been identified in Hfx. volcanii (Humbard et al., 2010). However, it is not known whether or not these chains are anchored to protein targets. Fur thermore, SAMP2 has a second lysine residue (Lys 64) that may serve as a site for chain formation and would not have been identified by the trypsin based mass spectrometry approach used by Humbard et al. (2010). In an effort to determine whether NcsA is mo dified by poly SAMP2 chains, NcsA StrepII was co expressed with a Flag SAMP2 variant devoid of lysine residues (K58R and K64R, named K>R) in wild type, and backgrounds. NcsA was subjected to StrepII pull down assays and probed with anti Flag (Fig ure 4 11 A ) and anti StrepII ( Figure 4 9 B) antibodies. With this approach, similarly to SAMP2, the SAMP2 K>R

PAGE 138

138 variant was found functional in formati on of protein conjugates ( Figure 4 11 A). However, only a single modified form of NcsA (~50 kDa) was detected when the SAMP2 K>R variant was expressed in the background compared to expression of SAMP2 ( Figure 4 11 A, lane 5 versus 2). This result prov ides evidence that poly SAMP2 chains are anchored on NcsA and that these chains do not form when SAMP2 lysines are modified to arginine residues. The physiological role of poly SAMP2 chain formation on NcsA is unclear. However, consistent with the diverse roles of protein polyubiquitination, poly SAMP2 chains are speculated to target NcsA for proteasome mediated degradation or other roles in the cell such as altering its activity in 2 thiouridine formation and/or protein protein interactions. NcsA is Associ ated with H omologs of Ubiquitin Proteasome and RNA Processing/Translation Systems Based on MS/MS In an effort to identify protein partners of NcsA, NcsA StrepII purified proteins were subjected to trypsin digest and analyzed in liquid fractions and in gel slices by Orbitrap LC MS/MS. Samples included NcsA StrepII purified from the mutant strain in the presence and absence of co expression with Flag SAMP1 and SAMP2 as well as an empty vector control. By this approach, NcsA was found to co purify with five proteins with >95% probability that had MS coverage >25% and high spectr al counts (Table 4 1). NcsA protein partners included UbaA, SAMP2 and the proteasome activating nucleotidase A/1 (PAN A/1), which are all ubiquitin proteasome system homologs. NcsA was also found associated with RNA processing/translation system homologs i ncluding: i) HVO_0359 annotated as a translation elongation factor aEF (aEF 1a) and ii) HVO_0874 of the aCPSF1 (archaeal cleavage and polyadenylation CASP ribonuclease family of proteins (Dominski et

PAGE 139

139 al., 2013). Of the SAMPs, only SAMP2 was identified i n the NcsA fractions. We note that SAMP1 and SAMP3 can be readily detected in protein samples by a trypsin based MS approach (Humbard et al., 2010; Miranda et al., 2013) and that our earlier described immunoblotting results are consistent with this result which demonstrate NcsA association with SAMP2 and not SAMP1 ( Figure 4 8 A). Together the MS analysis reveals NcsA specifically associates with SAMP2 and not SAMP1/3 and that NcsA is also associated with a network of protein homologs including those of the ubiquitin proteasome and RNA translation/processing systems. NcsA is A s sociated with UbaA and PAN A/1 Based on I mmunoblotting To further analyze NcsA protein partners, an immunoblotting approach was used to probe NcsA pull down fractions with polyclonal a ntibodies raised against UbaA (this study) and PAN A/1 (Reuter et al., 2004). We note that our earlier discussed results (Fig ure 4 8 ) revealed the importance of UbaA in mediating the covalent and non covalent association of NcsA with SAMP2. Fractions analy zed by immunoblotting with polyclonal antibody raised against UbaA (Fig ure 4 12 ) revealed the presence of UbaA (~36 kDa) in NcsA pull down fractions from wild type but not mutant or empty vector control strains ( Figure 4 12 A). Likewise, PAN A/1 of ~5 0 kDa was readily detected in NcsA pull down fractions by immunoblotting with anti PAN A/1 polyclonal antibody but not in fractions isolated from the empty vector control ( Figure 4 12 B). Thus, NcsA is associated with UbaA and PAN A/1 homologs of ubiquitiny lation and proteasome systems, respectively. NcsA and aCPSF1 Form a C omplex To further investigate the physical association of NcsA and aCPSF1 deemed from MS analysis, the Hfx. volcanii aCPSF1 homolog (HVO_0874) was N terminally

PAGE 140

140 Flag tagged and expressed w ith and without NcsA StrepII in a mutant background. When aCPSF1 was expressed alone, a protein band of ~100 kDa was Flag immunoblot that migrated similarly (although larger) than the Flag aCPSF1 theoretical mass of 73.2 kDa (Fig ure 4 13 A, lane 3). By contrast, multiple aCPSF1 bands of 50 200 kDa were detected when NcsA was included in the expression strain ( Figure 4 13 A, lane 4), suggesting that, when NcsA is present in the cell, the aCPSF1 undergoes covalent modi fications that increase and decrease in its molecular mass (the latter most likely due to proteolytic cleavage). Production of NcsA was confirmed by anti StrepII immunoblotting of cell lysate in the cells expressing NcsA alone and in tandem with aCPSF1 ( Figure 4 13 A, lower panel). We note that the SAMP2 NcsA isoforms are not detected by this i mmuno blot of cell lysate (Figure 4 13 A, lanes 2 and 4) but are detected when NscA StrepII is enriched by pull down from mutant strains (Figure 4 8 A). To determine if NcsA co purifies with aCPSF1, NcsA StrepII pull down was performed. StrepTactin chromatography is fully suited for maintaining the integrity of non covalent complexes of halophilic protei ns in buffers supplemented with 2 M salt, while anti Flag affinity chromatography is not compatible with these high salt buffers. Salt is required for complex integrity and activity for a wide variety of haloarchaeal proteins, including those of Hfx. volca nii such as 20S proteasomes, chaperonins, and PAN A/1 particles (Wilson et al., 2000; Large et al, 2002; Prunetti et al., unpublished), and correlates well with the intracellular environment of haloarchaea where K+ is a prominent ion (between 1.9 and 5.5 M ) (Prez Fillol and Rodrguez Valera, 1986). Results of the NscA StrepII pull down experiment revealed the presence of an aCPSF1

PAGE 141

141 band of ~100 kDa that co purified with NcsA in the background; whereas, this band was not present in strains devoid of Nc sA ( Figure 4 13 B) suggesting NcsA and aCPSF1 are interacting protein partners (Fig ure 4 13 ). Interestingly, while co expression of NcsA with aCPSF1 appeared to promote the generation of multiple isoforms of aCPSF1 from 50 200 kDa ( Figure 4 13 A lane 4), th e aCPSF1 isoform that co purified with NcsA was only the ~100 kDa form ( Figure 4 13 B, lane 3). Likewise, NcsA that co purified with aCPSF1 migrated at ~ 37 kDa ( Figure 4 13 B lane 3) consistent with the form of NcsA that is not covalently attached to SAMP2 Further analysis of the NscA pull down fractions by Coomassie blue stain revealed aCPSF1 is the major protein band associated with NcsA when co expressed in an mutant strain ( Figure 4 13 C). Conclusion Here it is demonstrate d that tRNA thiolase ho mologs such as NcsA are widespread in haloarchaea and are needed for thiolation of tRNA Lys UUU in Hfx. volcanii superfamily of tRNA thiolases with conserved residues important for AT P binding (PP motif) and RNA recognition (Zn finger motifs). NcsA was a member of a clade of ANH protein homologs of haloarchaea that was distinct, yet related, to other members of the ANH superfamily including characterized tRNA thiolases of bacteria (Ttc A and TtuA) and eukaryotes (Ncs6/Tuc1). Based on analysis of an Hfx. volcanii mutant, we found NcsA to be required for thiolated tRNA Lys UUU and growth at high temperature. Many thiolase enzymes of the ANH superfamily are demonstrated to be important for growth at elevated temperatures including T. thermophilus TtuA (Shigi et a l., 2006) and Schizosaccharomyces pombe Ctu1/Ncs6/Tuc1 (Dewez et al., 2008). Based on recent

PAGE 142

142 work demonstrating the importance of wobble uridine thiolation in structuring the anticodon for efficient and accurate recognition of cognate and wobble codons (Ve ndeix et al., 2012), we speculate that the thermosensitive phenotype of the mutant is due to the lack of 2 thiomodification that would otherwise promote efficient translation and tRNA structural stability. Overall, we suggest that NcsA and its close homologs are important for 2 thiolation of tRNAs with wobble uridine, includ ing those specific for lysine (tRNA Lys UUU ), glutamate (tRNA Glu UUC ), and glutamine (tRNA Gln UUG ) in diverse haloarchaea. NcsA was found to be covalently modified at Lys204 by isopeptide linked chains of the ubiquitin like SAMP2, through a mechanism that req uired the ubiquitin activating E1 enzyme homolog UbaA. While polySAMP chains were previously described for SAMP2 and SAMP3 (Humbard et al., 2010; Miranda et al. 2013), it was unclear whether these chains were anchored to protein targets. NcsA is the first example in prokaryotes of a protein target that is isopeptide linked to polymeric chains of a ubiquitin like protein modifier. Another important point is that the NcsA related tRNA thiolase TtuA of T. thermophilus was recently demonstrated to be covalently modified at multiple lysine residues (including those at positions 137, 226 and 229; highlighted in Fig ure 4 3 ) through isopeptide linkage to the ubiquitin like protein modifier TtuB (Shigi, 2012). While two of these lysine residues (Lys226 and Lys229) ar e unique to the T. thermophilus TtuA, the third (Lys137) is conserved with P. horikoshii Ph0300 and is found within a residues proposed to function in catalysis of tRNA thiol ation suggesting the ubiquitin like

PAGE 143

143 modification of Lys137 alters TtuA enzyme activity (Nakagawa et al. 2013). However, TtuA Lys137 is not conserved with NcsA or Tuc1/Ncs6 homologs. Evidence is also provided that NcsA associates non covalently with homolog s of ubiquitin proteasome (UbaA, SAMP2 and PAN A/1), translation (aEF processing (aCPSF1) systems. Our discovery of UbaA, SAMP2 and NcsA interactions are consistent with the proposed mechanism of sulfur transfer to tRNA and analogous to the pro tein protein interactions detected for Uba4, Urm1, and Ncs6 proteins by MS analysis and yeast two hybrid study (Leidel et al., 2009). The finding that SAMP2 associates with NcsA non covalently preferentially in a strain with UbaA activity suggests adenylat ion and thiolation of SAMP2 by UbaA precedes the non covalent binding of SAMP2 to NcsA. The association of NcsA with aEF tRNA thiolation pathway based on the need for this translation elongation factor to deliver aminoacyl tRNAs to the ribosome, where the tRNAs are presumably 2 thiolated prior to association with aEF of NcsA association with PAN A/1 and aCPSF1 is less clear than the other protein partners identified in this study. The close association of SAMP2 and UbaA with sulfur mobilization and protein modification may account for the binding of NcsA to the PAN A/1 AAA ATPase homolog of the 26S proteasome Rpt1 6 subunits. Whether the PAN A/1 associates to catalyze n on proteolytic protein remodeling and/or proteasome mediated proteolysis of NcsA is not known. Interestingly, the aCPSF1 protein expressed in cells with NcsA is found in high and low molecular mass forms that are not evident in the mutant suggesting NcsA promotes the post translational modification of aCPSF. Whether the archaeal ubiquitin proteasome system homologs (UbaA, SAMP2

PAGE 144

144 and PAN A/1) associate with NcsA to promote the covalent modification and proteolysis of aCPSF1 remai ns to be determined. We note that strains expressing aCPSF1 in trans in strains display poor growth and are unstable (data not shown) suggesting the post translational modification of the in trans aCPSF1 is important to cell function. Interestingly, only the 100 kDa form of aCPSF1 co purified with NcsA, while the other forms did not co purify. These results suggest aCPSF1 is modified by post translational mechanism from its anhydrous 73.2 kDa to a 100 kDa species that has high affinity for NcsA or to other forms of 50 200 kDa that have low affinity for NcsA. NcsA interaction with aCPSF1 belonging to the CASP family is the first identification of a tRNA thiolase enzyme associating with a putative RNA cleavage CASP family which are found amongst all three evolutionary lineages, notably the cleavage and polyadeny lation specificity factor (CPSF), are involved in RNA processing where cleavage of 3' ends of newly synthesized pre messenger RNA (pre mRNA) during transcription occurs (Aravind, CASP protein in Methanothermobacter thermautotrophi cus was recently characterized as a metalloenzyme which binds RNA at U rich regions CASP protein was hypothesized to act as a nuclease which degrades mRNA of proteins which may be targeted to the proteasome for proteasome media ted degradation and may potentially serve as a means for RNA turnover in archaea (Koonin et al., 2001; Silva et al., 2011). More recently, the Pyrococcus abyssi homolog Pab aCPSF1 has been demonstrated to have a RNA endoribonucleolytic activity that prefer entially cleaves at single stranded CA dinucleotides and a 5' 3' exoribonucleolytic activit y that acts on 5' monophosphate substrates ( Phung et al.,

PAGE 145

145 2013) The CASP protein of Hfx. volcanii has not been characterized at the physiological or biochemical level and mRNA p olyadenylation is not detected in this haloarchaeon under standard growth conditions ( Portnoy et al., 2005; Brenneis et al., 2007) The genome o f Hfx. volcanii does encode for RNaseZ which enzymatically end suggesting aCPSF1 is not needed for this type of tRNA cleavage activity (Schierling et al., 2002). NcsA is likely to possesses the innate ability to adenylat e, and it is possible aCPSF1 may be modified by NcsA for regulating aCPSF1 activity. Further studies will include understanding and characterizing the NcsA aCPSF1 interaction. Taken all together, these results provide the first characterization and evidenc e of a tRNA thiolase enzyme in archaea, which is modified by the sampylation system and is important for mediating 2 thiouridine formation in haloarchaea.

PAGE 146

146 Figure 4 1 hydrolase (ANH) superfamily from archaea, eukaryotes and bacteria. NcsA (HVO_0580) and close haloarchaeal homologs were found to group into a distinct clade based on cluster analysis. Shown is a tree drawn to scale, with branch lengths in the same units as those of the e volutionary distances used to infer the phylogenetic tree. Proteins related to NcsA were selected for dendrogram analysis using the microbial genome database (MGDB; with MGDB protein sequence numbers in parenthesis) (Uchiyama et al., 2010). Protein sequenc es were aligned by ClustalW (Larkin et al., 2007) and alignments were v isualized in the graphic view of BioEdit v7.2.0 (Hall, 1999). Protein sequences with unique N and C terminal tails were trimmed and their evolutionary history was inferred using the Ne ighbor Joining method (Saitou and Nei, 1987). The evolutionary distances were computed in MEGA5 (Tamura et al., 2011) using the p distance method (Nei and Kumar, 2000) and are in units of the number of amino acid differences per site.

PAGE 147

147 Figure 4 2 3D structural model of Hfx. volcanii NcsA. The 3D model of NcsA sheets (blue) highlighted. Conserved PP motif (P loop), Zn finger (ZnF1 and ZnF2) and cataly tic cysteine residues (disulfide bond forming) as well as the SAMP2 modified Lys204 are indicated. Phyre2 (Protein Homology/AnalogY Recognition Engine 2) web based server (Bennett Lovsey et al., 2008; Kelly and Sternberg, 2009) was used for the fold recogn ition and model building. In brief, the primary amino acid sequence of NcsA (HVO_0580) was submitted to the Phyre2 threading server using intensive mode, thus, combining HHsearch for remote homology detection based on pairwise comparison of hidden Markov m odels (HMM) with ab initio and multiple template modeling. The library of known protein structures for comparison by Phyre2 was from the Protein Data Bank (PDB) and Structural Classification of Proteins (SCOP) databases. Chimera 1.7 (Pettersen et al., 2004 ) was used as an interface for interactive visualization and analysis of the 3D structure modeled at >90% accuracy.

PAGE 148

148 Figure 4 3 Multiple amino acid sequence alignment of HVO_0580 with tRNA thio modific ation (GO: 0034227) Proteins included NcsA/Tuc1 homologs of Saccharomyces cerevisiae (GI:50593215) Homo sapiens (GI:74713747), Pyrococcus horikoshii (GI:14591444 and 14590222) Thermus thermophilus HB8 (GI: 55980446), Salmonella typhimurium (GI:16764998 ), and Escherichia coli (GI:85674916). Conserved residues are highlighted in red including residues of the ATP pyrophosphatase signature PP motif (SGGXDS) involved in ATP binding (Bork and Koonin, 1994) as well as motifs CXXC and GHXXDD (which act to recog nize RNA) present in the TtcA protein family (Jager et al., 2004). Zinc fingers are highlighted in blue boxes, modified lysine residues are in red boxes, and conserved catalytic cysteine residues are indicated by a star. Furthermore, conserved structural e lements are highlighted with blue arrows ( helices).

PAGE 149

149 Figure 4 4 Southern blot analysis of ( ). Southern blot confirm markerless deletion of hvo_0580 in the mutant strain. 2' Deoxyuridine 5' triphosphate coupled by an 11 ato m spacer to digoxigenin (DIG 11 dUTP) was used to label the dsDNA probes used for Southern blot as previously described (Rawls et al., 2010) and molecular masses (kb) are indicated to the right of the figure for both wild type and mutant strain. The DIG la beled molecular weight marker is also indicated to the left.

PAGE 150

150 Figure 4 5 HVO_0580 (NcsA) is required for thiolation of tRNA Lys UUU Total RNA was isolated as described in t he Materials and Methods section from H26 (wild type), and complemented with hvo_0580 gene in trans as indicated. Total RNA was electrophoresed in a 12% urea was then hybridized with a probe complementary to tRNA Lys UUU Thiolated tRNA Lys UUU mig rates slower than non thiolated tRNA Lys UUU as indicated.

PAGE 151

151 Figure 4 6 The strain displays similar growth as H26 (WT) at optimum growth temperature (42 C). NcsA is required for growth at an elevated temperature (50C). Hfx. volcanii strains were grown in 13 x 100 mm culture tubes and incubated at 42 C with shaking (200 rpm). Af ter a set of three subcultures, cells were inoculated at 0.02 OD600 into 20 ml ATCC 974 medium in 250 ml baffled flasks and incubated at indicated temperatures. A) Cells cultured from logarithmic phase cells from 42 C and inoculated into fresh ATCC 974 me dium for growth at 42 C. B) Cells cultured from stationary phase cells from 42C and inoculated into fresh ATCC 974 medium for growth at 42C. C) Cells cultured from stationary phase cells from 50C and inoculated into fresh ATCC 974 medium for growth at 42C. Optical density was measured to follow growth over time and experiments were performed in triplicate and the mean standard deviation (SD) was calculated. D) For spot dilutions, Hfx. volcanii strains, as indicated, were diluted to 0.1 OD 600 and spot plated on ATCC 974 medium in serial dilutions as indicated above each plate. Plat es were then incubated at 42 C.

PAGE 152

152 Figure 4 7 NcsA is required for growth at an elevated temperature (50 C). Hfx. volcanii strains (H26, WT), , and complemented with NcsA) were grown in 13 x 100 mm culture tubes and incubated at 42 C with agitation (200 rpm). After a set of three subcultures, cells were inoculated at 0.02 OD 600 into 20 ml ATCC 974 medium in 250 ml baff led flasks and incubated at indicated temperatures. A) Cells cultured from logarithmic phase from 42 C and inoculated at 0.02 OD 600 into fresh ATCC 974 medium for growth at 50 C. B) Cells cultured from stationary phase cells from 50 C and inoculated at 0.02 OD 600 into fresh ATCC 974 medium for growth at 50 C. C) Cell cultures, as indicated above each plate, were diluted to 0.1 OD 600 and spot plated on ATCC 974 solid agar plates in serial dilutions as indicated. Plates were then incubated at 50 C.

PAGE 153

153 Figur e 4 8 NcsA is covalently associated with SAMP2 through a UbaA dependent mechanism. A) NcsA StrepII affinity purified fractions purified from strains expressing NscA StrepII with and with out Flag SAMP1/2 proteins were separated by reducing SDS StrepII and StrepII immunoblot of NcsA StrepII purified from H26 (WT, parent), and Flag immunoblot of NcsA StrepII purified from H26 (WT, parent) and strains co expressing Flag SAMP2. Molecular weight markers are indicated to the left of each blot.

PAGE 154

154 Figur e 4 9 HvJAMM1 ( d esampylase) collapses NcsA modified forms and SAMP2 conjugates. Assay conditions with HvJAMM1 and immunoblotting with StrepII and Flag antibodies (as indicated) are described in Methods. A) StrepII immunoblot of N csA StrepII fractions purified from strains as indicated. B) Flag immun oblot of NcsA StrepII fractions purified from A and as indicated. H26 (WT, parent) expressing Flag SAMP2 served as a control substrate for assay of HvJAMM1 activity. M olecular weight markers are indicated to the left of each blot.

PAGE 155

155 Figure 4 10 NcsA is modified on Lys204. T he NcsA StrepII purified fractions were digested with trypsin and analyzed by an LTQ Orbitrap mass spectrometer The MS/MS spectrum shows Gly Gly modified Lys204 in peptide HFDASIG DFEK The precursor mass, b ion series and y11 ion are evidence for the modification identified on the peptide.

PAGE 156

156 Figure 4 11 SAMP2 i s associated in apparent po ly SAMP2 chains on NcsA. A) Flag and B) StrepII immunoblot s of NcsA StrepII fractions purified from H26 (WT, parent) , and strains expressing NcsA StrepII, Flag SAMP2 and/or Flag SAMP2 K>R variant as indicated. C oomassie blue stain (CB stain) to indicate equal loading is indicated below the blot. Molecular weight markers are indicated to the left of each blot

PAGE 157

157 Table 4 1. NcsA co purified proteins identified by LC MS/MS. Orf no (c al. kDa) a Homolog Protein description Average Coverage Average Spectral Count HVO_0580 (36 kDa) Ncs6/Tuc1/TtuA N type ATP pyrophosphatase 75 % 334.4 HVO_0558 (29 kDa) E1 like protein Ubiquitin activating enzyme 29% 9 HVO_0202 (7 kDa) Ubiquitin like prote in SAMP2, conserved hypothetical protein 42% 37.5 HVO_0850 (46 kDa) PAN A 1 Proteasome activating nucleotidase A 46% 42 HVO_0874 (72 kDa) aCPSF mRNA 3 end processing factor homolog 65% 64 HVO_0359 (46 kDa) Translation elongation factor EF 1alpha (GTPase) Translation elongation factor aEF 1 alpha subunit 51% 43 a MS identified proteins with coverage above 25% are reported according to the Hfx. volcanii gene locus tag from the National Center for Biotechnology Information and were unique to samples prepared from strain ncsA expressing the FLAG tagged SAMP1 in tandem with StrepII tagged NcsA, FLAG tagged SAMP2 in tandem with StrepII tagged NcsA, or StrepII tagged NcsA alone compared to the vector alone. cal kDa, molecular mass estimated from deduced polypept ide based on genome sequence in parenthesis.

PAGE 158

158 Figure 4 12 UbaA and PAN A/1 proteins detected in NcsA StrepII purified fractions. UbaA and PAN A /1 are detected in NcsA StrepII purified fractions A) P oly clonal UbaA and B) PAN A /1 antibodies were used to det ect the presence of UbaA and PAN A /1 proteins in NcsA StrepII purified samples as indicated by immunoblot. M olecular weight markers are indicated to the left of each blot

PAGE 159

159 Fig ure 4 13 NcsA forms a complex with a n archaeal CPSF 1 homolog. A) Cell lysate and B) StrepII purified fractions of an mutant expressing NcsA StrepII and/or Flag Flag and StrepII antibodies as indicated. C) Coom assie blue (CB) stain of StrepII purified fractions as indicated. Molecular weight markers are indicated to the left of each blot

PAGE 160

160 CHAPTER 5 A THI4 HOMOLOG IS REQUIRED FOR THIAMINE BIOSYNTHESIS IN Hfx. volcanii Introduction Thiamine pyrophosphate (TPP) is a biologically active form of thiamine (vitamin B1) and an essential cofactor synthesized by diverse de novo pathways in many prokaryotes and some eukaryotes (plants and fungi) (Jurgenson et al., 2009) Thiamine biosynthetic pathways are poorly un derstood in Archaea with most harboring homologs of the yeast thiamine thiazole synthase (THI4p) that lack the conserved cysteine residue used for sulfur donation to the thiazole ring by a THI4p like suicide mechanism and instead are associated with the isomerization of D ribose 1,5 bisphospha te (Finn and Tabita, 2004) Based on a study of Saccharomyces cerevisiae one gene product (THI4p) appears central to the biosynthesis of the thiazole ring (Praekelt et al., 1994). S. cerevisiae THI4p is highly conse rved among plants and fungi and functions as a suicide enzyme in the formation of the thiazole moiety of thiamine (Chatterjee et al., 2011). In a single turnover reaction, THI4p Cys205 serves as the source of sulfur and NAD + serves as the five carbon chain in thiazole formation (Chatterjee et al., 2011) Archaeal thiazole biosynthesis is poorly understood. The majority of Archaea harbor protein homologs with structural folds similar to the bacterial ThiS (ubiquitin like SAMPs) and ThiF (ThiF/MoeB/E1 like Ub aA) used to mobilize sulfur to thiamine ( Makarova and Koonin, 2010 ) Most archaea also have homologs that cluster to the THI4p protein family (IPR002922), but lack the conserved cysteine residue of the yeast THI4p that is required for sulfur transfer in fo rmation of the thiazole ring. Instead archaeal THI4p homologs are shown to function as ribose 1, 5 bisphosphate (R15P)

PAGE 161

161 isomerases in the conversion (or salvage) of nucleoside monophosphates to 3 phosphoglycerate based on the functional characterization of Thermococcus ( Pyrococcus ) kodokaraensis Tk0434 (Aono et al., 2012; Sato et al., 2007). Furthermore, the Methanosarcina acetivorans THI4p homolog (Ma2851) is required for conversion of 5 phospho D ribose 1 py rophosphate (PRPP) to ribulose 1 5 bisphosphate in recombinant E. coli extracts (Finn and Tabita, 2004). In this study, it is report ed that THI4p homologs with conserved catalytic cysteine residues are widespread in halophilic archaea and provide evidence that links these archaeal THI4p proteins to thi amine biosynthesis. Deletion of the THI4p gene homolog ( hvo_0665 ) of the halophilic archaeon Hfx. volcanii was found to confer a partial auxotrophic requirement for thiamine and hvo_0665 mutants expressing the site directed change of the putative conserve d catalytic cysteine, C ys165, also displayed partial thiamine auxotrophy Overall, our results provide a new insight that archaeal homologs of the THI4p family (IPR002922) with conserved cysteine residues are important in thiamine biosynthesis. Thus, halop hilic archaea use an apparent chimeric pathway with a yeast THI4 homolog for synthesis of the thiazole ring and bacteria enzyme homologs for synthes is of the pyrimidine moiety (HMP P, hydroxymethylpyrimidine phosphate) of thiamine. Results and Discussion H aloarchaea and Other Select A rchaea h ave THI4 H omologs with a C onserved Active S ite C ysteine. To further understand the molecular mechanisms used by archaea to synthesize the thiazole ring of thiamine, archaeal members of the THI4 family (IPR002922) were compared to Saccharomyces cerevisiae ScTHI4p and other THI4

PAGE 162

162 homologs by multiple amino acid sequence alignment ( Figure 5 1 ) and cluster analysis ( Figure 5 2 ). Based on these comparisons, the majority of archaeal THI4 homologs (like those of bacteria such as Thermotoga maritima ) were found to have a conserved homologs included the Mj0601, Ma2851 and Tk0434 proteins previously examined for their ability (or lack thereof ) to convert 5 phospho D ribose 1 pyrophosphate (PRPP) to ribulose 1,5 bisphosphate or function as a R15P isomerase (Finn and Tabita, 2004; Sato et al., 2007) (Aono et al., 2012) ScTHI4p Cys205 residue is highly conserved among eukaryal THI4 homologs, required for THI4 activity, and proposed to be used as a sulfur donor in an iron mediated sulfur transfer reaction to form the thiazole ring, based on MS based detection of a dehydroalanine residue at this position after a single turnover reaction (Chatterjee et al., 2011) Since the majority of archaeal THI4 homologs lack the conserved active site cysteine, these e nzymes are not predicted to use a eukaryal type mechanism of thiazole biosynthesis. However, a subset of archaeal homologs displayed not only an overall amino acid sequence similarity to ScTHI4, but also harbored a cysteine residue analogous to the ScTHI4 active site Cys205. For example, the Hfx. volcanii THI4 homolog (Hvo_0665, named HvTHI4) had the conserved active site cysteine (HvTHI4 Cys165) and was 31 % identical to ScTHI4 with a query coverage of 92% and E value of 3e 26 by BLAST analysis. Archaeal T HI4 homologs with the conserved active site cysteine residue were found to cluster and included homologs of all haloarchaea and Thaumarchaeota examined as well as the crenarchaeote Aeropyrum pernix Examples of archaea with two THI4 homologs (one with a co nserved active site cysteine residue and one with a conserved histidine

PAGE 163

163 residue) were also detected in others, including Pyrococcus sp. strain NA2, P. yayanosii strain CH1 and Methanobacterium sp. strains AL 21 and SWAN 1. To further compare THI4 family proteins, the 3D stuctures of HVO_0665, Tk0434 and Ma2851 were predicted by Phyre2 based fold recognition and model building (see Methods for details). The resulting 3D models were overlaid with the x ray crystal structures of THI4p of S. cerevisiae (PDB: 3FPZ) and N. crassa (PDB: 3jsk) (Fig ure 5 3 ) to identify structurally conserved active sit e residues using Chimera 1.7 (Pettersen et al., 2004 ). Conserved active site residues were based on analogy to residues identified to be important in a biochemical an d structural study of ScTHI4p (Chatterjee et al., 2011 ) and in binding adenosine diphosphate 5 (beta ethyl) 4 methyl t hiazole 2 carboxylic acid (AHZ) in the atomic structure of N. crassa THI4p (PDB: 3jsk). From this analysis, all three archaeal THI4 homolo gs were found to have close structural similarity to th e yeast and fungal enzymes (Figure 5 3 A, B and C ). However, only HVO_0665 (not Tk0434 or Ma2851) was found to have residues analogous to those bound to AHZ in the atomic structure of N. crassa THI4p as well as the conserved catalytic cysteine of ScTHI4p required for sulfur mobilization to the thiazole ring (Fig ure 5 1 ). Deletion of the THI4 and Mutation of the Putative Catalytic Cysteine Conferred a P artial Auxotrophic R equirement for T hiamine in Hal oferax volcanii To further understand the molecular mechanisms used by Archaea with predicted ThiS/ThiF and THI4 type pathways to synthesize the thiazole ring of thiamine, Hfx. volcanii was chosen as a model organism and mutant strains were generated fo r examining growth on thiamine minus medium. Hfx. volcanii has the metabolic capacity for thiamine biosynthesis based on its ability to grow on minimal

PAGE 164

164 medium in the absence of an exogenous source of thiamine ( Dyall Smith, 2009; Pribat et al., 2011 ) Furth ermore, Hfx. volcan ii is demonstrated to synthesize key metabolic enzymes that are TPP dependent including the 2 oxoacid ( ketoacid): ferredoxin oxidoreductases used in the oxidative decarboxylation of pyruvate and 2 oxoglutarate ( Kerscher and Oes terhelt, 1981 ) and three 2 oxoacid dehydrogenases used under nitrate respirative conditions ( van Ooyen and Soppa, 2007 ) To examine the ThiS/ThiF and THI4 type pathways in thiazole biosynthesis, HVO_0558 ( ubaA ) and HVO_0665 ( thi4 ) were chosen as target s to examine how the deletion of these genes would impact growth of Hfx. volcanii on thiamine minus medium. The role of UbaA in thiamine metabolism is not known. UbaA is the only Hfx. volcanii DS2 protein of the UBA/THIF type NAD/FAD binding fold (IPR00059 4) family and is shown through gene deletion and trans complementation (Miranda et al., 2011) to be required for thiolation of tRNA Lys UUU DMSO reductase activity (presumably due to the inability to mobilize sulfur to form the molybdenum cofactor based act ive site) and sampylation (the conjugation of ubiquitin like SAMPs to protein targets). A (HVO_0665) mutant strain (NC1011) was generated for this study ( Figure 5 4 ) by a pyrE based pop in/pop out strategy similarly to the strain (HM1052) (Miranda et al., 2011) Once generated, the and mutant strains were compared to the ir parent strain H26 for aerobic growth on glycerol minimal medium with and without thiamine ( Figure 5 5A ). Strains were grown in complex ATCC974 medium to log phase, washed thrice with the appropriate minimal media with and without thiamine to remove trac e nutrients from the complex medium, and subcultured to a starting OD 600 of 0.03.

PAGE 165

165 Growth was monitored by measuring OD 600 over 60 h and doubling times calculated With this approach, the mutant strain displayed reduced growth (doubling time of 10 hr per generation ) in comparison to the parent and strains (doubling time of 5 hr per generation ). Howev er, the overall cell yield was comparable with the mutant reaching an OD 60 0 of 1.3 while the and parent H26 were at an OD 600 of 1.6 Based on these results, Hfx. volcanii appears to use THI4 and not a ThiS/ThiF type mechanism for sulfur incorporation into the thiazole ring. The next question asked whether the bradytrophic (partial auxotrophic) requirement of thiamine for the mutant strain was due to absence of thi4 (and not a distal effect) and whether the conserved cysteine residue (Cys165) of HvThi4 was required for its activity. To answer these questions, the mutant strain was transformed with plasmids encoding wild type and Cys165Ala variant StrepII tagged forms of HvThi4, and the transformed strains were compared to and parent H26 for growth on thiamine minus medium (Figure 5 5B ). With this approach, g rowth of the mutant strain trans complemented with a wild type copy of thi4 was found similar to the parent H26 revealing the partial thiamine autotrophy is due to the absence of thi4 and not a distal effect of the deletion of this gene. Addition of the C terminal StrepII tag had no apparent impact on this trans complementation suggesting HvThi4 StrepII is active In contrast to HvThi4, the gene encoding the HvThi4 Cys165Ala variant was unable to complement the mutat ion. Western blotting against the C terminal StrepII tag of HvT hi4 confirmed that the native and Cys165Ala forms of HvThi4 were produced at similar levels (32 kDa) (Figure 5 6) in the cell suggesting that the differences in complementation are not due to HvThi4 protein levels. Togethe r, these

PAGE 166

166 results are consistent with the possibility that the conserved active site cystein e (Cys165) is required for HvT hi 4 activity. A SAMP Triple Deletion Strain Does Not Display Thiamine Aux o trophy In order to determine whether a SAMP1/2/3 deletion d oes not display thiamine auxotrophy similar to UbaA H26 (wild type) and a samp triple mutant ( ) were monitored for growth in minimal medium in the presence and absence of thiamine For growth in minimal media wi th thiamine supplementa tion, the wild type strain displayed a two fold increase in growth rate comp ared to the samp triple deletion strain (Figure 5 7 A ). Identical strains were te sted for growth in minimal medium without thiamine supplementation and the overall growth pattern is similar to growth with thiamine (Figure 5 7 B ) suggesting the samp triple deletion is not a thiamine auxotroph and the samp ylation system is not involved in thiamine biosynthesis It is unclear why the samp triple d eletion do es not grow similar to the wild type whether grown in minimal medium in the presence or absence of thiamine. H owever thi s reduced growth may be due to missing nutritional component s excluding thiamine, in the minimal medium necessary for the mutant to display wi ld type level of growth Conclusion Evidence is provided that THI4 protein family members with a conserved catalytic cysteine residue essential for thiazole synthesis in yeast THI4p are found in t he Archaea and are widespread among the halophilic Archaea. Our results also demonst rate that the THI4p homolog (HVO_0665 or HvTHI4) of Hfx. volcanii is required for optimal growth on thiamine minus medium whereas SAMP1/2/3 and UbaA are not necessary Furthermore, these results provide evidence that Cys165 is most likely the catalytic res idue which mediates sulfur mobilization to the thiazole ring in those

PAGE 167

167 archaeons with this conserved cysteine residue. Based on THI4 protein homology, pairwise comparison, and the reduced growth phenotype of the Hfx. volcanii mutant strain in minimal media lacking thiamine, it appears HvTHI4 plays a critical role in thiazole biosynthesis and is proposed to act as a suicide thiamine thiazole syntha se in this halophlic archaeon similar to yeast THI4 The partial thiamine au xotrophic phenotype of the Hfx. volcanii is observed in other organisms in which thiamine biosynthetic genes have been deleted including Bacillus subtilis Salmonella typhimurium and S. cerevisiae Deletion of a B. subtilis thiL gene which encodes for a thiamine monophosphate kinase resulted in mutants that were thiamine bradytroph s similar to thiL mutants of S. t yphimurium and E. coli ( Schyns et al., 2005 ) Due to the leaky thiamin e auxotroph phenotype, B. subtilis is proposed to have two pathways to produce T PP. A thiM insertion mutant in S. typhimurium is also a thiamin e bradytroph where expression of thiD which encodes for h ydroxymethylpyrimidine phosphate kinase (HMP P kinase ), is reduced thus allowing for leaky excretion of HMP (Peterson and Downs, 1997). Similarly, i n S. cerevisiae mutants of thiD are also thiamin e bradytrophs ( Llorente et al., 1999). Although the is a partial thiamine auxotroph, the presence of other uncharacterized thiamine biosynthetic enzymes in Hfx. volcanii may compensate for the loss of HvTHI4.

PAGE 168

1 68 Figure 5 1. Multiple amino acid sequence alignment of HVO_0665 to eukaryotic THI4 enzymes and archaeal MJ0601 and TK0434 annotated as ribose 1 5 bisphosphate isomeras es. Proteins included Hfx. volcanii HVO_0665 (gi: 292654829), Saccharomyces cerevisiae ScTHI4 (gi:1323242, trimmed N terminal a mino a cids 1 34 for alignment), Arabidopsis thaliana AtTHI4 (gi: 332009156, trimmed N terminal a mino a cids 1 52 for alignment), T hermotoga maritima TmTHI4 (gi: 499079529), Methanosarcina acetivorans Ma2851 (gi: 20091675) and Thermococcus kodakarensis Tk0434 (gi:57640369). ScTHI4 Cys205 implicated in serving as a sulfur donating residue in thiamine biosynthesis (Chatterjee et al., 2011) is indicated ( ).

PAGE 169

169 Figure 5 2. Dendrogram analysis of the THI4 family (IPR002922) including protein members from archaea and select eukaryotes. Hfx. volcanii HVO_0665 or M. acetivorans Ma2851 (sp: Q8TM19), M. ja nnaschii Mj0601 (sp:Q58018) and T. kodakarensis Tk0434 (sp:Q5JD25) implicated as ribose 1,5 bisphosphate isomerases are indicated by *. S. cerevisiae ScTHI4 (sp: P32318) and A. thaliana AtTHI4 (sp: Q38814) implicated in thiamine biosynthesis are indicated by Archaeal THI4 homologs that have conserved residue to ScTHI4 Cys205 active site are shaded in grey and include uncharacterized ORFs from halophilic archaea, Thaumarchaeota, Aeropyrum, select methanogens and select pyrococci. UniProtKB/Swiss Prot nu mbers are included. Three letter abbreviations proposed by the Subcommittee on the taxonomy of the family Halobacteriaceae are used.

PAGE 170

170 Figure 5 3. 3D Structural models of archaeal THI4 family proteins compared to the x r ay crystal structure of N. crassa THI4p (PDB:3jsk). Proteins are represented in ribbon diagram including HVO_0665 (dark blue), Ma2851 (cyan), Tk0434 (purple) and N. crassa THI4p (tan), with the latter in octameric (A) and monomeric (B) configuration. The c onserved catalytic cysteine residue of the fungal THI4p (Cys232) essential for thiamine biosynthesis is in the sulfur minus 2,3 didehydroalanine (DHA) form is structurally analogous to the HVO_0655 Cys165 as indicated in pink (B and C). In panel C, conserv ed active site residues are highlighted in association with adenosine diphosphate 5 (beta ethyl) 4 methyl thiazole 2 carboxylic acid (AHZ). For clarity in panel B, N and C terminal tail extensions are hidden including a mino a cid residues 1 9 and 298 307 of HVO_0665 and a mino a cid residues 35 57 of 3jsk

PAGE 171

171 Figure 5 4. HvTHI4 gene and its deletion by a markerless pop in/pop out methodology as described in the Materials and Methods section. A. Schematic repres entation of the Hfx. volcanii DS2 thi4 (HVO_0665) gene on the genome with primer pairs (P1/P2 and P3/P4) used to screen for the thi4 gene deletion by PCR indicated. B. PCR products generated for the ( ) mutant and parent (H26, w t) strains using primer pairs P5/P6 and P7/P8 as indicated.

PAGE 172

172 Figure 5 5. Hvo_0665 (HvTHI4) is associated with thiamine biosynthesis. Growth of Hfx. volcanii parent (H26, triang HvTHI4 C165A mutant (diamonds), HVO_0665 complemented in trans ( dash ) UbaA (squares in panel A ), and vector alone (squares in panel B) strains were grown in GMM supplemented with (closed symbols) and without ( open symbols) thiamine as indicated and described in the Materials and Methods. Expe riments were performed in duplicate and the mean standard deviation (SD) was calculated.

PAGE 173

173 Figure 5 6. THI4 C165A protein is synthesized to similar levels as wild type THI4. Cell lysate of Hfx. volcanii thi4 expressing indicated plasmids in trans were boiled in SDS reducing buffer and probed with anti Strep antibody. Molecular weight markers are indicated to the left of the blot.

PAGE 174

174 Figure 5 7 A samp triple deletion strai n does not display thiamine auxotrophy. Growth of Hfx. volcanii parent (H26, closed circles ) and the samp triple deletion ( open circles ) strains were grown in GMM s upp lemented with (A ) and without (B ) thia mine as described in the Mate rials and Methods. Experiments were performed in triplicate and the mean standard deviation (SD) was calculated.

PAGE 175

175 CHAPTER 6 SUMMARY AND CONCLUSIONS Summary and Findings The regulation and biological roles of SAMP1/2/3 and UbaA in sulfur mobilization an d protein conjugation are not well understood in archaea. The goals of this study were threefold. First the purpose of this study was to enhance our understanding of the mode in which SAMPs are regulated at the transcript level by environmental sig nals and growth conditions in Hfx. volcanii Second this study also sought to identify and characterize additional proteins important in sulfur mobilization for 2 thiouridine formation in haloarchaea and third to determine whe ther SAMPs and a THI4 protein homolo g are important for sulfur transfer in thiamine biosynthesis. This study revealed several important aspects of samp transcripts and regulation. A ll three samp gene neighborhoods are conserved among many haloarchaea and samp genes generate leaderless trans cripts in which the mRNAs lack a 5' UTR The samp1 transcript UTR ( 5 nts ) whereas both samp2 and samp3 transcripts UTR ( 203 and 219 nts respectively) which has multiple predicted stemloop structures. Based on ou r results we propose that all three samp transcripts most likely utilize a leaderless translation initiation stra tegy and the presence of diverse secondary structure within samp2 and samp3 UTRs suggests an alternative mechanism for samp transcription te rmination. Furthermore, samp1 and samp3 transcripts are induced during aerobic growth in the presence of DMSO where samp1 appears to generate two transcripts, indicating possible processing of the samp1 transcript, and samp3 generates a single transcript. Furthermore, putative promoter activity of samp3 during aerobic growth in the presence or absence of DMSO was

PAGE 176

176 similar indicating possible posttranscriptional regulation of samp3 at least, during this condition since samp3 transcripts are induced during gr owth with DMSO supplementation In addition to aerobic growth in the presence or absence of DMSO, samp1 and samp2 transcripts increased at modest levels during growth in minimimal media where alanine versus ammonium chloride served as the nitrogen source Putative promoter activity revealed that both trkA1 (putative samp1 promoter) and samp2 transcription levels remained the same during identical growth conditions The samp1 transcript also increased during heat shock and this phenomenon is transient and co nsistent with the increase then decrease of ubiquitin transcript in Dictyostelium discoideum and S. cerevisiae ( M uller Taubenberger et al., 1988; Simon et al., 1999 ). Putative promoter activities for trkA1 samp2 samp3 and ubaA were also similar during co ld shock and growth in complex medium where oxygen or DMSO served as the terminal electron acceptor. Taken together, these data suggest different modes of regulation for samp genes and during certain conditions tested, samp genes may be regulated at the po sttranscriptional level. This is the first study of samp regulation at the tr anscript level and it provides a basis for further stud ies on the regulation of ubiquitin like proteins in the A rchaea. This study also revealed the identification and characteriz ation of a thiolase enzyme in haloarchaea, NcsA. NcsA was found to be important for sulfur mobilization for 2 thiolation of wobble uridine o f lysine tRNAs and most likely glutamate and glutamine tRNAs. Furthermore, NcsA is required for growth at elevated t emperatures (50 C) similar to SAMP2 and UbaA (Miranda et al., 2011) and consistent with other members o f the ANH superfamily TtuB from Thermus thermophilus (Shigi et al., 2006)

PAGE 177

177 and Ctu1 from Schizosaccharomyces pombe (Dewez et al., 2008) UbaA mediates c ovalent and non covalent associations of NcsA with SAMP2 and NcsA was also found to be covalently modified on Lys204 by SAMP2. NcsA was also covalently modified by poly SAMP2 chains. Poly SAMP2 chains are speculated to target NcsA for proteasomal mediated degradation as a means of protein quality control. Alternatively, the covalent attachment of poly SAMP2 chains on NcsA may promote protein protein interactions or modify NcsA for its role in 2 thiouridine formation. MS analyses of purified fractions reveal ed NcsA to associate with UbaA and SAMP2 cons istent with results from immunoblotting Additional proteins identified by MS analyses to be associated with NcsA included homologs of the proteasome activating nucleotidase A /1 (PAN A / 1 HVO_0850), and an archa eal cleavage and polyadenylation specificity factor 1 ( aCPSF 1 HVO_0874). NcsA was also found to complex with aCPSF1. This is the first identification of a tRNA thiolase enzyme associating with a putative RNA cleavage enzyme in archaea. Taken together, the se results provide the first characterization and evidence of a tRNA thiolase enzyme which is modified by samp ylation and mediates 2 thiouridine formation in haloarchaea. This study also examined the possible role of SAMP s on sulfur mobilization in thiamin e biosynthesis and identification of a thiamine biosynthetic gene, HvTHI4 in haloarchaea. A samp triple deletion was assessed for thiamine auxotrophy by growth in the absence versus pre sence of thiamine. However, the samp triple deletion mutant did not exh ibit thiamine aux o trophy when compared to the wild type strain Interestingly, a deletion of a putative thiazole biosynthetic gene, H v THI4 and a site directed change of a conserved residue, Cys165, expressed in HvTHI4 was bra dytrophic for thiamine in

PAGE 178

178 mini mal medium suggesting it is important for sulfur mobilization in thiamine biosynthesis and Cys165 is mediating sulfur mobilization to the thiazole ring Taken all together, this study provides a basis for furthe r stud ies on regulation of archaeal ubiquitin like proteins and its relation to environmental stress and also their roles in sulfur mobilization in archaea. Additionally, this study provides new insight into thiolase enzymes mediating 2 thiouridine biosynt hesis and also enzymes which may mediate thiamine biosynthesis in archaea. Future Directions Ubiquitin like proteins were only recently identified in arch aea (Humbard et al., 2010) T herefore future studies identifying a precise mechanism for regulation o f samp genes will be important in understanding their physiological roles within the cell. Also future studies on determining a mechanism of transcription termination for samp transcripts will also be useful in giving further insight into whether the vary ing lengths of samp UTRs are indicative of a new mechanism of transcription termination in haloarchaea. Furth er studies into the role of samp ylation in sulfur mobilization are also important. Future studies will include determining the source of sulfur in haloarchaea and also indentifying the enzyme which activates sulfur into a persulfidic form for 2 thiouridine formation. Also, further studies will be focused on understanding the importance of NcsA modification and also genetically and biochemically s tudying the importance of NcsA associated proteins such as the archaeal CPSF 1 and PAN A / 1 Furthermore, A rchaea also encode for enzymes relevant to thiamine biosynthesis including bacterial ThiI, ThiG, and ThiF homologs. It is still to be determined whethe r these archaeal proteins are functionally related to their bacterial counterparts.

PAGE 179

179 Biochemical characterization and other approaches including high performance liquid chromatography, nuclear magnetic resonance coupled with MS analyses of HvTHI4 will be u seful in determining whether this enzyme is functionally related to THI4 of eukaryotes and whether HvTHI4 associates with thiamine related prote ins or thiamine related metabolites within the cell.

PAGE 180

180 LIST OF REFERENCES Aberle H., Bauer A., Stappert J., K ispert A., and Kemler R. (1997). catenin is a target for th e ubiquitin proteasome pathway. EMBO J. 16 3797 3804. Abrell, J.W., Kaufman, E.E., and Lipsett, M. N. (1971). The biosynthesis of 4 thiouridylate. J. Biol. Chem. 246 294 301. Agris, P.F. (1 996). The importance of being modified: roles of modified nucleosides and Mg 2+ in RNA struct ure and function. Prog. Nucleic Acid Res. Mol. Biol. 53 79 129. the genome: 40 year s of modification. J. Mol. Biol. 366 1 13. Ajitkumar P. and Cherayil J. ( 1988 ) Thionucleosides in transfer ribonucleic acid: diversity, structure, biosynthesis, and function. Microbiol. Rev. 52 103 113. Andreev D E Terenin I M Dunaevsky Y E Dmitriev S E and Shatsky I N (2006) A leaderless mRNA can bind to mammalian 80S ribosomes and direct polypeptide synthesis in the absence of translation initiation factors. Mol Cell Biol 26 3164 3169. Aono, R., Sato, T., Yano, A., Yoshida, S., Nishitani, Y., Miki, K., Imanaka, T., and Atomi, H. (2012). Enzymatic characterization of AMP phosphorylase and ribose 1, 5 bisphosphate isomerase functioning in an archaeal AMP metabolic pathway. J Bacteriol. 194 6847 6855. Aravind L. ( 1999 ) An evolut ionary classification of the metallo beta lactamase f old proteins. In Silico Biol. 1 69 91. Auffinger, P., and Westhof E. ( 1998 ) Location and distribution of modified nucleotides in tRNA In H. Grosjean and R. Benne (ed.), Modification and editing of R NA, ASM Press, Washington, D.C. Ausubel, F.M., Brent R., Kingston R.E., Moore D.D., Seidman J.G., Smith J.A., and Struhl K. (1987) Current protocols in molecular b iology, Greene Publishing Associates/Wiley Interscience, New York. Babski J Tjaden B Voss B Jellen Ritter A Marchfelder A Hess W R and Soppa J (2011) Bioinformatic prediction and experimental verification of sRNAs in the haloarchaeon Haloferax volcanii RNA Biol 8 806 816 Barandun J Delley C L and Weber Ban E. (2 012). The pupylation pathway and its role in mycobacteria BMC Biol. 10 95 Beal, R., Deveraux, Q., Xia, G., Rechsteiner, M., and Pickart, C. ( 1996 ) Surface hydrophobic residues of multiubiquitin chains essential for proteolytic targeting. Proc. Natl. A cad. Sci. U.S.A. 93 861 866.

PAGE 181

181 Begley, T.P., Xi, J., Kinsland, C., Taylor, S., and McLafferty, F. (1999). The enzymology of sulfur activation during thiamine and biotin biosynthesis. Curr. Opin. Chem. Biol. 3 623 629. Bell, S. D. and Jackson, S. P. (1998) Transcription and translation in Archaea: a mosaic of eukaryal and bacterial features. Trends Microbiol 6 222 22 8. Benelli, D., Maone, E., and Londei, P. (2003). Two different mechanisms for ribosome/mRNA interaction in archaeal translation initiation. Mol Microbiol. 50 635 643. Bennett Lovsey, R.M., Herbert, A.D., Sternberg, M.J., and Kelley, L.A. (2008). Exploring the extremes of sequence/structure space with ensemble fold recognition in the program Phyre. Proteins 70 611 625. Bertani, G. (1951). Studies on lysogenesis. I. The mode of phage liberation by lysogenic Escherichia coli J. Bacteriol. 62 293 300. Bjrk G.R. (1992). The role of modified nucleosides in tRNA i nteractions. Transfer RNA in protein s ynthesis. CRC Press, Boca Raton, Florida. Bjrk G R Huang B Persson O P and Bystrm A S (2007) A conserved modified wobble nucleoside (mcm 5 s 2 U) in lysyl tRNA is required for viability in yeast. RNA 13 1245 1255. Bond U. and Schlesinger M. J. ( 1985 ) Ubiquitin is a heat shock prot ein in chicken embryo fibroblasts. Mol. Cell. Biol. 5 949 956. Borden K L B (2000) RING domains: master builders of mole cular scaffolds? J Mol Biol. 295 1103 1112. Bork, P. and Koonin, E.V. (1994). A P loop like motif in a widespread ATP pyrophosp hatase domain: implications for the evolution of sequence motifs and enzyme activity. Proteins 20 347 355. Brenneis, M., Hering O., Lange C., and Soppa J. ( 2007 ) Experimental characterization of cis acting elements important for translation and transcr iption in ha lophilic archaea. PLoS Genet. 3 e229. Burns K E Cerda Maira F A Wang T Li H Bishai W R and Darwin K .H. (2010). Depupylation of prokaryotic ubiquitin like protein from mycobacterial pr oteasome substrates. Mol. C el l 39 821 827 Burns K. E. and Darwin K. H. (2010) Pupylation: a signal for proteasomal degradation in M ycobacterium tuberculosis Subcell. Biochem. 54 149 157

PAGE 182

182 Burns, K. E., Liu, W. T., Boshoff, H. I. M., Dorrestein, P. C. and Barry, C. E. (2009) Proteasomal pro tein degradation in Mycobacteria is dependent upon a prokaryotic ubiquitin like protein. J Biol Chem 284 3069 3075 Cabello P Roldn M D and Moreno Vivin C. ( 2004 ) Nitrate reduction and the nitrogen cyc le in archaea. Microbiology 150 3527 35 46 Chatterjee A., Abeydeera, N.D., Bale, S., Pai, P.J., Dorrestein, P.C., Russell, D.H., Ealick, S.E., and Begley, T.P. (2011). Saccharomyces cerevisiae THI4p is a suicide thiamine thiazole synthase. Nature 478 542 546. Ciechanover, A., Elias, S., Hel ler, H., and Hershko, A. ( 1982 ) purification of ubiquitin activating enzyme. J. Biol. Chem. 257 2537 2542. Cie chanover A Hod Y ., and Hershko A. (1978). A heat stable polypeptide component of an ATP dependent proteolytic system from reticulocytes. Biochem Biophys Res Commun 81 1100 1105. Cline, S.W., Lam, W.L., Charlebois, R.L., Schalkwyk, L.C., and Doolittle, W.F. (1989). Transformation methods for halophilic archaebacteria. Can. J. Microbiol. 35 148 152. Coker J A DasSarma P Kumar J Mller J A and DasSarma S. (2007) Transcri ptional profiling of the model a rchaeon Halobacterium sp. NRC 1: responses to changes in salinity an d temperature. Saline Systems 3 1746 1756. Conaway R.C., Brower C.S., and Conawa y J.W. (2002). Emerging roles of ubiquitin in transcription regulation. Science 296 1254 1258. Cupp Vickery, J.R., Urbina, H., and Vickery, L.E. (2003). Crystal structure of IscS, a cysteine desulfurase from Escherichia coli J. Mol. Biol. 330 1049 105 9. Delmas, S., Shunburne, L., Ngo, H.P., and Allers, T. (2009). Mre11 Rad50 promotes rapid repair of DNA damage in the polyploid archaeon Haloferax volcanii by restraining homologous recombination. PLoS Genet. 5 e1000552. Desterro J M., Rodriguez M.S. Kemp G.D., and Hay R.T. (1999) Identification of the enzyme required for activation of the small ubiquitin like protein SUMO 1. J. Biol. Chem. 274 10618 10624. Dewez M Bauer F Dieu M Raes M Vandenhaute J and Hermand D. (2008). The co nserved wobble uridine tRNA thiolase Ctu1 Ctu2 is required to maintain genome integr ity. Proc. Natl. Acad. Sci. U S A 105 5459 5464. Dikic I Wakatsuki S and Walters K J ( 2009 ) Ubiquitin binding domains from structures to functions. Nat Rev Mo l Cell Biol 10 659 671.

PAGE 183

183 Ding H., Harrison K. and Lu J. (2005). Thioredoxin reductase system mediates iron binding in IscA and iron delivery for the ironsulfur cluster assembly in IscU. J. Biol. Chem. 280 30432 30437. Dominski, Z., Carpousis, A.J ., and Clouet d'Orval, B. (2013) Orval B. Emergence of The CASP ribonucleases: Highly conserved and ubiquitous metallo enzymes involved in mRNA maturation and degradation. Bioch. Biophys. Acta. 1829 532 551. Duke D C Moran L B Kalaitzakis M E Deprez M and Dexter D T (2006) Transcriptome analysis reveals link between proteasomal and mitochondrial pathways in Parki nson's disease. Neurogenetics 7 139 148. Dunin Horkawicz S Czerwoniec A Gajda M J Feder M Grosjean H and Bujnic ki J M. (2006). MODOMICS: a database of RNA modification pa thways. Nucl. Acids Res. 34 D145 D149. Dyall Smith, M. (2008). The Halohandbook: protocols for halobacterial genetics. http://www.haloarchaea.com/resources/halohandbook/Halohandbook_2008_v7.pdf Edmonds C. G., Crain P. F., Gupta R., Hashizume T., Hocart C. H., Kowalak J. A., Pomerantz S. C., Stetter K.O., and McCloskey, J. A. (1991) Post transcriptional modification of tRNA in thermophilic archaea (Archaebacteria). J. Bacteriol. 173 3138 31 48 Falb M Muller K Konigsmaier L Oberwinkler T Horn P von Gronau S Gonzalez O Pfeiffer F Bornberg Bauer, E., Oesterhelt, D (2008) Metabolism of halop hilic archaea. Extremophiles 12 177 196. Festa R A McAllister F Pearce M J Mintseris J Burns K E Gygi S P and Darwin K .H. (2010). Prokaryotic ubiquitin like protein (Pup) proteome of Mycobacterium tuberculosis [ corrected]. PLoS O ne 5 e8589. Festa R A Jones M B Butler Wu S Sinsimer D Gerads R ., Bish ai W R Peterson S N and Darwin K H. (2011) A novel copper responsive regulon in Mycobacterium tuberculosis Mol Microbiol 79 133 148. Finn, M.W and Tabita, F.R. (2004). Modified pathway to synthesize ribulose 1, 5 bisphosp hate in methanogenic archaea. J. Bacteriol 186 6360 6366. Finley D zkaynak E and Varshavsky A. (1987) The yeast polyubiquitin gene is essential for resistance to high temperatures, starv ation, and other stresses. Cell 48 1035 1046 Frank, J., Sangupta, J., Gao, H ., Li, W., Valle, M., Zavialov, A., and Ehrenberg, M. (2005). The role of tRNA as a molecular spring in decoding, accommodation, and peptidyl transfer. FEBS Lett. 579 959 962.

PAGE 184

184 Furukawa K Mizushima N Noda T and Ohsumi Y (2000) A protein conjug ation system in yeast with homology to biosynthetic enzyme reaction of prokaryotes. J Biol Chem. 275 7462 7465 Garciamartinez C Llovera M Agell N Lopezsoriano F J and Argiles J M. (1995) Ubiquitin gene expression in skeletal muscle is in creased during s epsis: Invol vement of TNF ot IL 1. Biochem. Biophys. Res. Commun. 26 839 844 Geiduschek E .P. and Ouhammouch M. (2005). Archaeal transcription and its regulators. Mol. Microbiol. 56 1397 1407. Glickman M. H., and Ciechanover A. (2002) The ubiquitin proteasome proteolytic pathway: destruction for the sake of construction. Physiol. Rev. 82 373 428 Goehring A S Rivers D M ., and Sprague G F Jr. (2003) a Attachment of the ubiquitin related protein Urm1p to the antioxidant protein Ahp1p. Eukaryot Cell 2 930 936 Goehring A S Rivers D M and Sprague G F (2003) b Urmylation: a ubiquitin like pathway that functions during invasive growth and b udding in yeast. Mol Biol Cell. 14 4329 4341. Goldstein, G., Scheid M., Hammerling U., Boyse, E.A., Sch lesinger D.H., and Niall H.D. ( 1975 ) Isolation of a polypeptide that has lymphocyte differentiating properties and is probably represented universally in living cells. Proc. Natl. Acad. Sci. U.S.A. 72 11 15. Grlich D Prehn S Laskey R A and H artmann E (1994). Isolation of a protein that is essential for the first step of nucle ar protein import. Cell 79 767 7 78. Gregor, D., and Pfeifer, F. ( 2005 ) In vivo analyses of constitutive and regulated promoters in halop hilic archaea. Microbiology 1 51 25 33. Grillari, J., Grillari Voglauer, R., and Jansen Durr, P. (2010). Post translational modification of cellular proteins by ubiquitin and ubiquitin like molecules: role in cellular senescence and aging. Adv. Exp. Med. Biol. 694 172 196. Groothui s T. A., Dantuma N. P., Neefjes J., and Salomons F. A. (2006) Ubiquitin crosstalk connecting cellular processes. Cell Div. 1 21 Gustilo E.M., Dubois D.Y., Lapointe J., and Agris P.F. (2007). E. coli glutamyltRNA synthetase is inhibited by anticodo n stem loop domains and a minihelix. RNA Biol. 4 85 92.

PAGE 185

185 Gutzke G., Fischer B., Mendel R. R., and Schwarz G. (2001) Thiocarboxylation of molybdopterin synthase provides evidence for the mechanism of dithiolene formation in metal binding pterins. J. B iol. Chem. 276 36268 36274 Haas A L Bright P M and Jackson V E ( 1988) Functional diversity among putative E2 isozymes in the mechanism of ubiquitin histone ligation. J Biol Chem 263 13268 13275. Haas A.L., and Rose I.A. (1982). The mecha nism of ubiquitin activating enzyme. A kinetic and equilibrium analysis J. Biol. Chem. 257 10329 103 37 Hall, T. (1999). BioEdit: a user friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41 95 98. Hanna, J., Meides, A., Zhang, D.P., and Finley, D. (2007). A ubiquitin stress response induces altered proteasome composition. Cell 129 747 759. Helm M. (2006). Post transcriptional nucleotide modification and alternative folding of RNA. Nucl. Acids Res. 34 721 7 33. Hepowit N.L., Uthandi S., Miranda H.V., Toniutti M., Prunetti L., Olivarez O., De Vera I.M., Fanucci G.E., Chen S., and Maupin Furlow J.A. (2012). Archaeal JAB1/MPN/MOV34 metalloenzyme (HvJAMM1) cleaves ubiquitin like sma ll archaeal modifier proteins (SAMPs) from protein conjugates. Mol. Microbiol. 86 971 987. Hershko, A., Ciechanover, A., Heller, H., Haas, A.L., and Rose, I.A. (1980). Proposed role of ATP in protein breakdown: Conjugation of protein with multiple chains of the polypeptide of ATP dependent proteolysis. Proc. Natl. Acad. Sci. U.S.A. 77 1783 1786. Hershko, A. and Heller, H. ( 1985 ) Occurrence of a polyubiquitin structure in ubiquitin protein conjugates. Biochem. Biophys. Res. Commun. 128 1079 1086. Hers hko, A., Heller, H., Elias, S., and Ciechanover, A. ( 1983 ) Components of ubiquitin protein ligase system. Resolution, affinity purification, and role in protein breakdown. J. Biol. Chem. 258 8206 8214. Hershko, A., Leshinsky, E., Ganoth, D., and Heller, H. ( 1984 ) ATP dependent degradation of ubiquitin protein conjugates. Proc. Natl. Acad. Sci. U.S.A. 81 1619 1623. Hickey C. M., Wils on N. R., and Hochstrasser M. (2012). Function and regulation of SUMO proteases. Nat Rev Mol Cell Biol 13 755 766 Hille, R., Nishino, T., and Bittner, F. (2011). Molybdenum enzymes in higher organisms. Coord. Chem. Rev. 255 1179 1205.

PAGE 186

186 Hirata A Klein B J and Murakami K S. (2008). The X ray crystal structure of RNA polymerase from archaea. Nature 451 851 854 Hochstrasser, M. (2009). Origin and function of ubiquitin like proteins. Nature 458 422 429. Holley, R W and Goldstein, J (1959). An alanine dependent, ribonuclease inhibited conversion of adenosine 5' phosphate to adenosine triphosphate. II. Recons truction of the system from purified components. J. Biol. Chem. 234 1765 176 8. Holmes, M.L. and Dyall Smith, M.L. (2000). Sequence and expression of a halobacterial beta galactosidase gene. Mol. Microbiol. 36 114 122. Horie N Hara Yokoyama M Yoko yama S Watanabe K Kuchino Y Nishimura S and Miyazawa T. (1985). Two tRNAIle1 species from an extreme thermophile, Thermus thermophilus HB8: effect of 2 thiolation of ribothymidine on the thermo stability of tRNA. Biochemistry 24 5711 5715. H umbard, M. A., Miranda H. V., Lim J.M., Krause D. J., Pritz J. R., Zhou G., Chen, S. Wells L., and Maupin Furlow J. A. (2010) Ubiquitin like small archaeal modifier proteins (SAMPs) in Haloferax volcanii Nature 463 54 60 Igloi G L. (1988). Interact ion of tRNAs and of phosphorothioate substituted nucleic acids with an organomercurial. Probing the chemical environment of thiolated residues by affinity electrophoresis. Biochemistry 27 3842 384 9. Igloi G.L. and Kssel H. (1985). Affinity electropho resis for monitoring terminal phosphorylation and the presence of queuosine in RNA. Application of polyacrylamide containing a covalently bound boronic acid. Nucl. Acids Res. 13 6881 6898. Igloi G.L. and Kssel H. (1987). The use of boronate affinity e lectrophoresis gels for studying both ends of RNA. Methods Enzymol. 155 433 448. Ikeuchi Y Shigi N Kato J Nishimura A and Suzuki T (2006) Mechanistic insights into sulfur relay by multiple sulfur mediators involved in thiouridine b iosynthe sis at tRN A w ob ble p ositions. Mol. Cell 21 97 108. Imkamp F Striebel F Sutter M Ozcelik D Zimmermann N Sander P ., and Weber Ban E. (2010). Dop functions as a depupylase in the prokaryotic ubiquitin like modification pathway. EMBO Rep. 11 791 797. Iyer L M Burroughs A M Aravind L (2006) The prokaryotic antecedents of the ubiquitin signaling system and the early evolution of ubiquitin like beta grasp domains. Genome Biol. 7 R60.

PAGE 187

187 Jackson S P and Durocher D. (2013). Regulation of DNA damage responses by ubiquitin and SUMO. Mol. Cell 49 795 807 Jagannathan, V. and Luck, J M (1949). Phosphog lucomutase; mechanism of action. J. B iol. Chem. 179 569 575. Jger, G., Leipuviene, R., Pollard, M.G., Qian, Q., and Bjrk, G.R. (2004) The conserved Cys X1 X2 Cys motif present in the TtcA protein is required for the thiolation of cytidine in position 32 of tRNA from Salmonella enterica serovar Typhimurium. J. Bacteriol. 186 750 757. Jentsch S. (1992). The u biquitin conjugation syste m. Annu Rev Genet 26 179 207. Jeong, Y. J., Jeon g, B. C., and Song, H. K. (2011). Crystal structure of ubiquitin like small archaeal modifier protein 1 (SAMP1) from Haloferax volcanii Biochem. Biophys. Res. Commun. 405 112 117 Johnson D Dean D R Smith A D and Johnson M K (2005) Structure, function, and formation of biological iron sulfur clusters. Annu Rev Biochem 74 247 281. Jurgenson, C.T., Begley, T.P., and Ealick, S.E. (2009). The structural and biochemical foundations of thiamin b iosynthesis. Annu. Rev. Biochem. 78 569 603. Kambampati, R. and Lauhon, C. T. (1999). IscS is a sulfurtransferase for the in vitro biosynthesis of 4 thiouridine in Escherichia coli tRNA. Biochemistry 38 16561 16568. Katz, E.J., Isasa, M., and Crosas, B. (2010). A new map to understand deubiquitination. Biochem. Soc. Trans. 38 21 28. Keller, A., Nesvizhskii, A.I., Kolker, E. and Aebersold, R. (2002). Empirical statistical model to estimate the accuracy of peptide identifications made by MS/MS and databa se search. Anal. Chem. 74 5383 5392. Kelley, L.A., and Sternberg, M.J. (2009). Protein structure prediction on the Web: a case study using the Phyre server. Nat Protoc 4 363 371. Kerscher, O. (2007) SUMO junction through SUMO interacting motifs. EMBO Rep. 8 550 555. Kessler D. ( 2006 ) Enzymatic activation of sulfur for incorporation into biomolecules in proka ryotes. FEMS Microbiol. Rev. 30 825 840. Kim H., Chen J., and Yu X. (2007) Ubiquitin binding prote in RAP80 mediates BRCA1 dependent DNA damage response. Science 316 1202 1205.

PAGE 188

188 Kim, B. and Gadd G. (2008) Bacterial Physiology and Metabolism (New York: Cambridge University Press ). Kim V N Han J and Siomi M C (2009) Biogenesis of small RNAs in animals. Nat Rev Mol Cell Biol 10 126 139. Kok K., Hofstra R., Pilz A., Van den, B. A., Terpstra P., Buys C. H., and Carritt B. ( 1993 ) A gene in the chromosomal region 3p21 with greatly reduced expression in lung cancer is similar to the gene f or ubiquitin activating e nzyme Proc. Natl. Acad. Sci. U.S. A. 90 6071 6075 Kowalak, J.A., Dalluge, J.J., McCloskey, J.A., and Stetter, K.O. (1994). The role of posttranscriptional modification in stabilization of transfer RNA from hyperthermophiles. Bioc hemistry 33 7869 7876. Kraegeloh A Amendt B and Jrg Kunte H (2005) Potassium transport in a halophilic member of the bacteria domain: identification and characterization of the K+ uptake systems trkH and t rkI from Halomonas elongata DSM 2581T J Bacteriol. 187 1036 1043 Kramer G F Baker J C and Ames B N (1988). Near UV stress in Salmonella typhimurium : 4 Thiouridine in tRNA, ppGpp, and ApppGpp as components of an adapt ive response. J. Bacteriol. 170 2344 2351. Kyrpides, N.C. and Woes e, C.R. (1998) Archaeal translation initiation revisited: The subunit families. Proc Natl Acad Sci U S A 95 3726 3730. Kuimelis R.G. and Nambiar K.P. (1994). Synthesis of oligodeoxynucleo tides containing 2 thiopyrimidine residues new protection scheme. Nucl. Acids Res. 22 1429 1436. Kutay U., Bischoff F.R., Kostka S., Kraft R., and Gorlich D. (1997). Export of importin alpha from the nucleus is mediated by a specific nuclear transpo rt factor. Cell 90 1061 1071. Lake M W Wuebbens M M Rajagopalan K V and Schindelin H. ( 2001 ). Mechanism of ubiquitin activation revealed by the structure of a bacterial MoeB MoaD comp lex. Nature 414 325 3 29 Large, A. T., Kovacs, E. and Lund P. A. (2002). Properties of the chaperonin complex from the halophilic archaeon Haloferax volcanii FEBS Lett. 532 309 312 Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A., McWilliam, H., Valentin, F., Wallace, I. M., Wilm, A., Lopez, R., Thompson, J. D., Gibson, T. J., and Higgins, D. G. (2007). Clustal W and Clustal X version 2.0. Bioinformatics 23 2947 2948.

PAGE 189

189 Lauhon C T (2002) Requirement for IscS in biosynthesis of all t hionucleosides in Escherichia coli J Bacteriol 184 6820 6829. Lauhon C T Erwin W M Ton G N. ( 2004 ) Substrate specificity for 4 thiouridine modification in Escherichia coli J. Biol. Chem. 279 23022 23029. Lauhon, C.T. and Kambampati, R. (2000). The iscS gene in Escherichia coli is required for the biosynthesis of 4 thiouridine, thiamin, and NAD. J. Biol. Chem. 275 20096 20103. Le Faou, A., Rajagopal B.S., Daniels L., and Fauque G ( 1990 ) Thiosulfate, polythionates and elemental sulfur assimilation and reduction in the bacteria l world. FEMS Microbiol. Rev. 6 351 381. Leidel S Pedrioli P G Bucher T Brost R Costanzo M Schmidt A Aebersold R Boone C Hofmann K and Peter M. (2009) Ubiquitin related modifier Urm1 acts as a sulphur carrier in thiolation of euka ry otic transfer RNA. Nature 458 228 232. Li, S. J. and Hochstrasser, M. (1999) A new protease required for cell cycle progression in yeast. Nature 398 246 251. Limbach P A Crain P F and McCloskey J A (1994). Summary: the modified nucleosides of R NA. Nucl. Acids Res. 22 2183 2196 Li W., Agirrezabala X., Lei J., Bouakaz L., Brunelle J.L., Ortiz Meoz R.F., Green R., Sanyal S., Ehrenberg M., and Frank J. (2008). Recognition of aminoacyl tRNA: a common molecular mechanism revealed by cryo E M. EMBO J. 27 3322 33 31. Lipman R.S., Wang J., Sowers K.R., and Hou Y.M. (2002) Prevention of misaminoacylation of a dual specificity aminoacyl tRNA synthetase. J Mol Biol. 315 943 94 9. Lipsett, M. N. (1978). Enzymes producing 4 thiouridine in E scherichia coli tRNA: approximate chromosomal locations of the genes and enzyme activities in a 4 thiouridine deficient mutant. J. Bacteriol. 135, 993 997. Liu, Y., Beer, L. L., and Whitman, W. B. (2012). Sulfur metabolism in archaea reveals novel process es. Environ. Microbiol. 14 2632 44. Liu, Y., Sieprawska Lupa, M. Whitman, W.B., and White, R. H. (2010). Cysteine is not the sulfur source for iron sulfur cluster and methionine biosynthesis in the methanogenic archaeon Methanococcus maripaludis J. Bio l. Chem. 285 31923 31929. Liu Y Zhu X Nakamura A Orlando R Sll D and Whitman W B (2012). Biosynthesis of 4 thiouridine in tRNA in the methanogenic archaeon Methanococcus maripaludis J Biol Chem. 287 36683 366 92.

PAGE 190

190 Llorente, B., Fairh ead, C., and Dujon, B. (1999). Genetic redundancy and gene fusion in Saccharomyces cerevisiae : functional characterization of a three member gene family involved in the thiamine biosynthetic pathway. Mol Microbiol 32 1140 1152. Llovera M., Garcia Martinez C., Agell N., Marzabal M., Lopez Soriano F. J., and Argiles, J. M. (1994). Ubiquitin gene expression is increased in skeletal muscle of tumour bearing rats. FEBS Lett. 338 311 318. Lu C Tej S S Luo S Haudens child C D Meyers B.C., and Green, P.J. (2005) Elucidation of the small RNA component of the transcriptome. Science 309 1567 1569. Madore E., Florentz C., Gieg R., Sekine S., Yokoyama S., and Lapointe J. (1999). Effect of modified nucleotides o n Escherichia coli tRNAGlu structure and on its aminoacylation by glutamyl tRNA synthetase. Predominant and distinct roles of the mnm5 and s2 modifications of U34. Eur J Biochem. 266 1128 11 35. Magalon, A., Fedor, J. G., Walburger, A., and Weiner, J.H. (2011). Molybdenum enzymes i n bacteria and their maturation. Coord. Chem. Rev. 255 1159 1178. Makarova K. S. and Koonin, E. V. (2010) Archaeal ubiquitin like proteins: functional versatility and putative ancestral involvement in tRNA modification reveal ed by compar ative genomic analysis. Archaea 710303 Marchfelder A Fischer S Brendel J Stoll B Maier L K Jager D Prasse D Plagens A Schmitz R A and Randau L (2012) Small RNAs for defence and regulati on in Archaea. Extremophil es 16 685 696 Marquet, A. (2001). Enzymology of carbon sulfur bond formation. Curr. Opin. Chem. Biol. 5 541 549. Martinez Gomez N C Palmer L D Vivas E Roach P L and Downs D M. ( 2011 ) The rhodanese domain of ThiI is both necessary and suf ficient for synthesis of the thiazole moiety of thiamine in Salmonella enterica J. Bacteriol. 193 4582 4587. Maupin Furlow J.A. (2013). Ubiquitin like proteins and their roles in archaea. Trends Microbiol. 21 31 3 8 Mazumder B Seshadri V and Fo x P L (2003) T UTR: The ends specify the means. Trends Biochem Sci 28 91 98. McCloskey J. A., Graham D. E., Zhou S., Crain P. F., Ibba M., Konisky J., Sll D., and Olsen G. J. (2001) Post transcriptional modification in archaeal tRNAs. Identities and phylogenetic relations of nucleotides from mesophilic and hyperthermophilic Methanococcales. Nucl. Acids Res. 29 4699 4706

PAGE 191

191 McGrath, J.P., Jentsch S., and Varshavsky A. (1991) UBA 1: an essential yeast gene encoding ubiquitin acti vating enzyme. EMBO J. 10 227 236. Mendel, R.R. (2013). The Molybdenum Cofactor J Biol Chem. 288 13165 13172. Mendel, R. R. and Schwarz, G. (2011). Molybdenum cofactor biosynthesis in plants and humans. Coord. Chem. Rev. 255 1145 1158 Middleton F A Mirnics K Pierri J N Lewis D A and Levitt P. (2002) Gene expression profiling reveals alterations of specific metabolic pathways in s chizophrenia. J. Neurosci. 22 2718 2729 Mihara, H. and Esaki, N. (2002). Bacterial cysteine desulfuras es: their function and mechanisms. Appl. Microbiol. Biotechnol. 60 12 23. Miranda, H.V., Antelmann, H., Hepowit, N., Chavarria, N.E., Krause, D.J., Pritz, J.R., Bsell, K., Becher, D., Humbard, M.A., Brocchieri, L., and Maupin Furlow, J.A. (2013). Archae al ubiquitin like SAMP3 is isopeptide linked to proteins by a UbaA dependent mechanism. Mol. Cell. Proteomics. ( in press ) Miranda H.V., Nembhard N., Su D., Hepowit N., Krause D.J., Pritz J.R., Phillips C., Soll D., and Maupin Furlow J.A. (2011). E1 and ubiquitin like proteins provide a direct link between protein conjugation and sulfur transfer in archaea. Proc. Natl. Acad. Sci. U S A 108 4417 4422. Miura T., Klaus W., Gsell B., Miyamoto C, and Senn H. (1999). Characterization of the bind ing interface between ubiquitin and class I human ubiquitin conjugating enzyme 2b by multidimensional heteronuclear NMR spectroscopy in solution. J. Mol. Biol. 290 213 2 28. Moll, I., Grill, S., Gualerzi, C.O., and Blasi, U. (2002). Leaderless mRNAs in ba cteria: Surprises in ribosomal recruitment and translational control. Mol Microbiol. 43 239 246. Morris K V (2008) RNA mediated transcriptional gene silencing in human cells. Curr Top Microbiol Immunol 320 211 224. Mueller, E.G. (2006). Traffick ing in persulfides: delivering sulfur in biosynthetic pathways. Nat. Chem. Biol. 2 185 194. Mueller E G., Buck C.J., Palenchar P.M., Barnhart L.E., and Paulson J.L. ( 1998 ) Identification of a gene involved in the generation of 4 thiouridine in tRNA Nucl. Acids Res. 26 2606 2610. Mukhopadhyay D. and Dasso, M. (2007) Modification in reverse: the SUMO proteases. Trends Biochem. Sci. 32, 286 295.

PAGE 192

192 Muller S Hoege C Pyrowolakis G and Jentsch S. (2001). SUMO, mysterious cousin. N at Rev Mol Cell Biol 2 202 210. Muller Taubenberger A., Hagmann J., Noegel A., Gerisch G. ( 1988 ) Ubiquitin gene expression in Dictyostelium is induced by heat and cold shock, cadmium, and inhibitors of protein synthesis. J Cell Sci 90 51 58 Nachin L ., Hassouni E., Loiseau L Expert D, and Barras F. (2001). SoxR dependent response to oxidative stress and virulence of Erwinia chrysanthemi : the key role of SufC, an orphan ABC ATPase Mol Microbiol. 39 960 972. Nachin L., Loiseau L., Expert D., and Barras F. (2003). SufC : an unorthodox cytoplasmic ABC/ATPase required for [Fe S] biogenesis under oxidative stress. EMBO J. 22 427 437. Nakagawa H Kuratani M Goto Ito S Ito T Katsura K Terada T Shirouzu M Sekine S Shigi N and Yokoyama S. (2013). Crystallographic and mutational studies on the tRNA thiouridine synthetase TtuA. Proteins 81 1232 12 44 Nakai Y., Harada A., Hashiguchi Y., Nakai M., and Hayashi H. (2012). Arabidopsis molybdopterin biosynthesi s protein Cnx5 collaborates with the ubiquitin like protein Urm11 in the thio modification of tRNA. J. Biol. Chem. 287 30874 308 84. Nakai Y., Nakai M., and Hayashi H. (2008). Thio modification of yeast cytosolic tRNA requires a ubiquitin related syste m that resembles bacterial sulfur transfer systems. J. Biol. Chem. 283 27469 27476. Nawrot B Sochacka E and Duchler M. (2011). tRNA structural and functional changes induced by oxidative stress. Cell. Mol. Life Sci 68 4023 4032. Nei, M., and Ku mar, S. (2000). Molecular Evolution and Phylogenetics, Oxford University Press, New York Nesvizhskii A.I., Keller, A., Kolker, E. and Aebersold, R. (2003). A statistical model for identifying proteins by tandem mass spectrometry. Anal Chem 75 4646 46 58 Nijman S.M., Luna Vargas M.P., Velds A., Brummelkamp T.R., Dirac A.M., and Sixma T.K. (2005) A genomic and functional inventory of deu biquitinating enzymes. Cell 123 773 786. Nieuwlandt D T Palmer, J.R., Armbruster, D.W., Kuo, Y.P., Oda, W and Dan iels, C. J. (1995). Archaea: A Laboratory Manual (Cold Spring Harbor Labor atory Press, Plainview, NY)

PAGE 193

193 Noma A Sakaguchi Y and Suzuki T (2009) Mechanistic characterization of the sulfur relay system for eukaryotic 2 thiouridine biogenesis a t tRNA wobble posit ions. Nucl. Acids Res. 37 1335 1352. Nunoura T., Takaki Y., Kakuta J., Nishi S., Sugahara J., Kazama H., Chee G.J., Hattori M., Kanai A., and Atomi H. (2011). Insights into the evolution of Archaea and eukaryotic protein modi fier systems revealed by the genome of a novel archaeal group. Nucl. Acids Res. 39 3204 3223. Okuma T., Honda R., Ichikawa G., Tsumagari N., and Yasuda H. (1999) In vitro SUMO 1 modification requires two enzymatic steps, E1 and E2. Biochem. Biophys Res. Commun. 254 693 698. Ouni I., Flick K., and Kaiser P. ( 2010 ). A transcriptional activator is part of an SCF ubiquitin ligase to control degradation of its cofactors. Mol. Cell 40 954 964. Ouni I Flick K and Kaiser P. (2011). Ubiquitin and transcription: The SCF/Met4 pathway, a (protein ) complex issu e. Tran scription 2 135 139. Outten F W Wood M J ., Mun oz M and Storz G. (2003) The SufE protein and the SufBCD complex enhance SufS cysteine desulfurase activity as part of a sulfur transfer pathway for Fe S cluster assembly in Escherichia coli J Biol Chem 278 45713 45719. Outten F W Djaman O and Storz G (2004) A suf operon requirement for Fe S cluster assembly during iron starvation in Escherichia coli. Mol Microbiol 52 861 872. Ozcelik D., Barandun J., Schmitz N., Sutter M., Guth E., Damberger F.F., Allain F.H., Ban N., and Weber Ban E. (2012). Structures of Pup ligase PafA and depupylase Dop from the prokaryotic ubiquitin like modification pathway. Nat. Commun. 3 1014. Ozkaynak E., Finley D., Solomon M.J., and Varshavsky A. (1987).The yeast ubiquitin genes: a family of natural gene fusions. EMBO J. 6 1429 1439. Palenchar P M Buck C J Cheng H Larson T J Mueller E G. ( 2000 ) Evidence that ThiI, an enzyme shared between thiamin and 4 thiouridine biosynthesis, may be a sulfurtransferase that proceeds through a persulfide i ntermediate. J. Biol. Chem. 275 8283 8286. Pearce M. J., Mintseris J., Ferreyra J., Gygi S. P., and Darwin K. H. (2008) Ubiquitin like protein involved in the proteasome pathway of Myc obacterium tuberculosis Science 322 1104 1107. Pedrioli, P.G., Lei del, S., and Hofmann, K. (2008). Urm1 at the crossroad of modifications EMBO Rep. 9 1196 1202.

PAGE 194

194 Prez Fillol, M. and Rodrguez Valera, F. (1986). Potassium ion accumulation in cells of different halobacteria. Microbiologia 2 73 80. Petersen L A and Downs D M. ( 1997 ) Identification and characterization of an operon in Salmonella typhimurium involved in thiamine biosynthesis. J. Bacteriol. 179 4894 4900. Petroski, M. D., Salvesen, G. S., and Wolf, D. A. (2011). Urm1 couples sulfur transfer to ubiquitin like protein function in oxidative stress. Pr oc. Natl. Acad. Sci. U.S.A. 108 1749 Pettersen, E.F., Goddard, T.D., Huang, C.C., Couch, G.S., Greenblatt, D.M., Meng, E.C., and Ferrin T.E. (2004). UCSF Chimera -a visualization system for exploratory research and analysis. J Comput Chem 25 1605 1612. Pfaffl, M.W. (2001). A new mathematical model for relative quantification in real time RT PCR. Nucl. Acids Res. 29 e45. Phung, D.K ., Rinaldi, D., Langendijk Genevaux, P.S., Quentin, Y., Carpousis, A.J., and Clouet CASP ribonucleases of the aCPSF1 family are orthologs of the eukaryal CPSF 73 factor. Nucleic Acids Res. 41 1091 1103. Pickart C.M. (2001). Mechan isms underlying ubiquitination, Annu. Rev. Biochem. 70 503 533 Pohl, M., Sprenger, G.A., and Muller, M. (2004). A new perspective on thiamine catalysis. Curr Opin Biotechnol. 15 335 342. Portnoy V Evguenieva Hackenberg E Klein F Walt er P Lorentzen E Klug G and Schuster G. (2005). RNA polyadenylation in Archaea: not observed in Haloferax while the exosome polynuc leotidylates RNA in Sulfolobus. EMBO reports 6 1188 1193. Poulsen C Akhter Y Jeon A H Schmitt Ulms G Meyer H E Stefanski A Stuhler K Wilmanns M and Song Y H (2010). Proteome wide identification of mycobacterial pupylation targets. Mol. Syst. Biol. 6 386. Praekelt, U.M ., Byrne, K.L., and Meacock, P.A. (1994). Regulation of THI4 (MOL1), a t hiamine biosynthetic gene of Saccharomyces cerevisiae Yeast 10 481 490. Rawls K.S., Martin J H. and Maupin Furlow J.A. ( 2011 ) Activity and transcriptional regulation of bacterial protein like glycerol 3 phosphate dehydrogenase of the haloarchaea i n Haloferax volcanii J. Bacteriol. 193 4469 4476. Reiter W D Palm P and Zillig W (1988) Analysis of transcription in the archaebacterium Sulfolobus indicates that archaebacterial promoters are homologous to euka ryotic pol II promoters. Nucl. Ac ids Res 16 1 19.

PAGE 195

195 Reuter, C.J,. Kaczowka, and S.J., Maupin Furlow, J.A. (2004). Differential regulation of the PanA and PanB proteasome activating nucleotidase and 20S proteasomal proteins of the haloarchaeon Haloferax volcanii J. Bacteriol. 186 7763 7 772. Rezgui V A Tyagi K Ranjan N Konevega A L Mittelstaet J Rodnina M V Peter M and Pedrioli P G (2013). tRNA tKUUU, tQUUG, and tEUUC wobble position modifications fine tune protein translation by promoting ribosome A site binding. Proc Natl Acad Sci U S .A. 110 12289 122 94 Robinson, J. L., Pyzyna B., Atrasz R.G., Henderson C.A., Morrill K.L., Burd A.M., Desoucy E., Fogleman III R.E., Naylor J.B., Steele S.M., Elliott D.R., Leyva K.J., and Shand R.F. ( 2005 ) Growth kinetic s of extre mely halophilic archaea (family Halobacteriaceae) as revealed by Arr henius plots. J. Bacteriol. 187 923 929 Rogers K.C., Crescenzo A.T., and Soll D. (1995). Aminoacylation of transfer RNAs with 2 thiouridine derivatives in the wobble positi on of the anticodon. Biochimie 77 66 74. Rothery R A Stein B Solomonson M Kirk M L Weiner J H. (2012). Pyranopterin conformation defines the function of molybdenum and tungsten enzymes. Proc Natl Acad Sci U S A 109 14773 1477 8 Rozens ki, J., Crain P.F., and McCloskey J.A ( 1999 ) The RNA modification database: 199 9 update. Nucl. Acids Res. 27 196 197. Rudolph M.J., Wuebbens M.M., Rajagopalan K.V., and Schindelin H. (2001). Crystal structure of molybdopterin synthase and its evo lutionary relationship to ubiquitin act ivation. Nat. Struct. Biol. 8 42 46. Sadoul K Boyault C Pabion M and Khochbin C. (2007) Regulation of protein turnover by acetyltransferases a nd deacetylases. Biochimie 90 306 3 12 Sabag Daigle A. (200 7). Nitrogen metabolism of the h aloarchaeon Haloferax volcanii (Ohio State University ). Saitoh H. and Hinchey J. (2000). Functional heterogeneity of small ubiquitin related protein modifiers SUMO 1 versus SUMO 2/3. J Biol Chem 275 6252 6258. Sakata E., Stengel F., Fukunaga K., Zhou M., Saeki Y., Frster F., Baumeister W., Tanaka K., and Robinson C. V. (2011) The catalytic activity of Ubp6 enhances maturation of the proteasomal regulatory particle. Mol. Cell 42 637 649 Saitou, N., and Ne i, M. (1987). The neighbor joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4 406 425.

PAGE 196

196 Salghetti S.E., Caudy A.A., Chenoweth J.G., and Tansey W.P. (2001). Regulation of transcriptional activation domain function by ubiquitin. Science 293 1651 165 3. Sato, T., Atomi, H., and Imanaka, T. (2007). Archaeal type III RuBisCOs function in a pathway for AMP metabolism. Science 315 1003 1006. Sauerwald, A., Zhu, W., Major, T. A., Roy, H., Palioura, S., Jahn, D., Whitman, W. B., Yates, J. R., 3rd, Ibba, M., and Sll, D. (2005). RNA dependent cysteine biosynthesis in archaea. Science 307 1969 1972. Schierling, K., Rosch, S., Ru pprecht, R., Schiffer, S., and Marchfelder, A. (2002). tRNA karyotic features: the RNase Z from Haloferax volcanii. J. Mol. Biol. 316 895 902. Schlieker, C.D., Van der Veen, A.G., Damon, J.R., Spooner, E., and Ploegh, H.L. (2008). A functional proteomics approach links the ubiquitin related modifier Urm1 to a tRNA modification pathway. Proc. Natl. Acad. Sci. U S A 105 18255 18260. Schyns, G., Potot S., Geng Y., Barbosa T.M., Henriques A., and Perkins J.B ( 2005 ) Isolation and characterization of new thiamine deregulated mutants of Bacillus subtilis J. Bac teriol. 187 8127 8136. Schmitz J., Chowdhury M.M., Hanzelmann P., Nimtz M., Lee E.Y., Schindelin H., and Leimkuhler S. (2008). The sulfurtransferase activity of Uba4 presents a link between ubiquitin like protein conjugation and activation of sulf ur carrier proteins. Biochemistry 47 6479 6489. Schulman B A and Harper J .W. ( 2009 ) Ubiquitin like protein activation by E1 enzymes: the apex for downstream signalling pathways. Nat. Rev. Mol. Cell B iol. 10 319 31 Schwarz, G. and Mendel, R.R. (200 6). Molybdenum cofactor biosynthesis and molybdenum enzymes. Annu. Rev. Plant Biol. 57 623 647. Schwarz, G., Mendel, R.R., and Ribbe, M.W. (2009). Molybdenum cofactors, enzymes and pathways. Nature 460 839 847. Shigi, N. (2012). Posttranslational modif ication of cellular proteins by a ubiquitin like protein in bacteria. J. Biol. Chem. 287 17568 17577. Shigi N., Sakaguchi Y., Asai S., Suzuki T., and Watanabe K. (2008). Common thiolation mechanism in the biosynthesis of tRNA thiouridine and sulphur containing cofactors. EMBO J. 7 3267 3278.

PAGE 197

197 Shigi N Sakaguchi Y Suzuki T and Watanabe K. (2006). Identification of two tRNA thiolation genes required for cell growth at extremely high temperatures. J Biol Chem. 281 14296 14306. Shukla A Chaurasia P and Bhaumik S R (2009) Histone methylation and ubiquitination with their cross talk and roles in gene expression and stability. Cell Mol Life Sci 66 1419 1433. Silva A P Chechik M Byrne R T Waterman D G Ng C L Dodson E J Koonin E V Antson A A and Smits C. (2011). Structure and activity of a novel archaeal beta CASP protein with N te rminal KH domains. Structure 19 622 632. Simon J R Treger J M and McEntee K. (1999) Multiple independent regulatory path ways control UBI4 expression after heat shock in Saccharomyces cerevisiae Mol. Microbiol. 31 823 832 Singleton, C.K. and Martin, P.R. (2001). Molecular m echanisms of thiamine utilization. Curr Mol Med 1 197 207. Sinha, R.P. and Hader, D.P. (2002). UV induced DNA damage and repair: a review. Photochem. Photobiol. Sci. 1 225 236. Skaug B Jiang X and Chen Z J (2009) The role of ubiquitin in NF kappaB regulator y pathways. Annu. Rev. Biochem. 78 769 796. Sneppen K Pedersen S Krishna S Dodd I and Semsey S. (2010) Economy of operon formation: c otranscription minimizes shortfall in protein complexes. mBio 1 177 2 10. Sochacka E (2001) Efficient assessment of modified nucleoside stability under conditions of automated oligonuc leotide synthesis: characterization of the oxidation and oxidative desulfurization of 2 thiouridine. Nucleos. Nucleot. Nucl. 20 1871 1879 Soppa, J. (2011). Functional genomic and advanced genetic studies reveal novel insights into the metabolism, regula tion, and biology of Haloferax volcanii Archaea ID: 602408 Storz G Vogel J and Wassarman K M (2011) Regulation by small RNAs in bacteria: expan ding frontiers. Mol. Cell 43 880 891. Straub J Brenneis M Jellen Ritter A Heyer R Sopp a J and Marchfelder A. (2009). Small RNAs in haloarchaea: identification, differential expression and biol ogical function. RNA Biol. 6 281 292.

PAGE 198

198 Striebel F., Imkamp F., Sutter M., Steiner M., Mamedov A., and Weber Ban E. (2009). Bacterial ubiqu itin like modifier Pup is deamidated and conjugated to substrates by distinct but homologous enzymes. Nat. Struct. Mol. Biol. 16 647 651. Sutter M Damberger F F Imkamp F Allain F H and Weber Ban E (2010). Prokaryotic ubiquitin like protein (Pup) is coupled to substrates via the side chain of its C terminal glutama te. J. Am. Chem. Soc. 132 5610 5612. Sylvers L. A., Rogers, Shimizu K.C., Ohtsuka M. and Sll, D. (1993) Prevention of mis aminoacylation of a dual specificity aminoacyl tRN A synthetase. Biochemistry 32 3836 3841. Takahashi Y. and Tokumoto U. (2002). A third bacterial system for the assembly of iron sulfur clusters with homologs in archaea and plastids. J Biol Chem 277 28380 28383. Tamura, K., Peterson, D., Peterson N., Stecher, G., Nei, M., and Kumar, S. (2011). MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28 2731 2739. Tatham M H Jaffray E Vaughan O A Des terro J M Botting C H Naismith J H and Hay R T. (2001). Polymeric chains of SUMO 2 and SUMO 3 are conjugated to protein substrates by SAE1/SAE2 and Ubc9. J Biol Chem 276 35368 35374. Tirupati, B., Vey, J. L., Drennan C. L., and Bollinger, J. M. ( 2004) Kinetic and structural characterization of Slr0077/SufS, the essential cysteine desulfurase from Synechocystis sp. PCC 6803 Biochemistry 43 12210 12219 Tolstrup, N., Sensen, C.W., Garrett, R.A., and Clausen, I.G. (2000). Two different and highly organized mechanisms of translation initiation in the archaeon Sulfolobus solfataricus Extremophiles 4 175 179. Tomikawa, C., Ohira, T., Inoue, Y., Kawamura, T., Yamagishi, A., Suzuki, T. and Hori, H. (2013). Distinct tRNA modifications in the thermo acidophilic archaeon, Thermoplasma acidophilum FEBS Lett. 587 3575 3580. Uchiyama I (2003) MBGD: microbial genome database f or comparative analysis. Nucl. Acids Res 31 58 62. Uchiyama, I., Higuchi, T., and Kawai, M. (2010). MBGD update 2010 : toward a comprehensive resource for exploring mic robial genome diversity. Nucl. Acids Res 38 D361 365

PAGE 199

199 Udagawa T Shimizu Y and Ueda T (2004) Evidence for the translation initiation of leaderless mRNAs by the intact 70 S ribosome without its d issociation into subunits in eubacteria. J Biol Chem 279 8539 8546. V an der Veen A.G. and Ploegh H.L. (2012). Ubiquitin like proteins. Annu. Rev. Biochem. 81 323 357. Va n der Veen A.G., Schorpp K Schlieker C Buti L Damon, J R Spooner E Ploegh H L ., and Jentsch S. (2011) Role of the ubiquitin like protein Urm1 as a noncanonical lysine directed protein modifier. Proc. Natl Acad Sci. U S A 108 1763 1770 B., Malkiewicz, A. and Agris, P.F. (2012) Human tRNA(Lys3)(UUU) is pre structured by natural modifications for cognate and wobble codon binding through keto enol tauto merism. J. Mol. Biol. 416 467 485. Vesper O Amitai S Belitsky M Byrgazov K Kaberdina A C Engelberg Kulka H and Moll I. (2011) Selective translation of leaderless mRNAs by specialized ribosomes generated by MazF in Escherichia coli Ce ll 147 147 157. Vijay Kumar S., Bugg C.E., and Cook W.J. (1987). Structure of ubiquitin refined at 1.8 A resolution. J. Mol. Biol. 194 531 544. Walderhaug, M.O., Polarek, J.W., Voelkner, P., Daniel, J.M., Hesse, J.E., Altendorf, K., and Epstein, W. (1992). KdpD and KdpE, proteins that control expression of the kdpABC operon, are members of the two component sensor effector class of regulators. J. Bacteriol. 174 2152 2159. Wang C., Xi J., Begley T.P., and Nicholson L.K. (2001). Solution structur e of ThiS and implications for the evolutionary roots of ubiquitin Nat. Struct. Biol. 8 47 51. Ward I.M., Minn K., V an Deursen J., and Chen J. (2003). p53 Binding protein 53BP1 is required for DNA damage responses and tumor suppression in mice. Mol. C ell Biol. 23 2556 2563. Watanabe K., Shinma M., Oshima T., and Nishimura S. (1985). Heat induced stability of tRNA from an extreme thermophile, Thermus thermophilus. Biochem. Biophys. Res. Commun. 72 1137 1144. Watrous J., Burns K., Liu W T., P atel A. Hook V., Bafna V., Barry C.E., 3rd, Bark, S., and Dorrestein P.C. (2010). Mol. bioSyst. 6 376 385.

PAGE 200

200 Webb E.,Class K., and Downs D.M. (1997). Characterization of thiI, a new gene involved in thiaz ole biosynthesis in Salmonella typhimurium J. Bacteriol. 179 4399 4402 Wendoloski, D., Ferrer, C., and Dyall Smith, M.L. (2001) A new simvastatin (mevinolin) resistance marker from Haloarcula hispanica and a new Haloferax volcanii strain cured of plas mid pHV2. Microbiology 147 959 964. Wilson, H.L., Ou, M.S., Aldrich, H.C., and Maupin Furlow,J. (2000). Biochemical and physical properties of the Methanococcus jannaschii 20S proteasome and PAN, a homolog of the ATPase (Rpt) subunits of the eucaryal 26S proteasome. J. Bacteriol. 182 1680 1692. Xu J Zhang J Wang L Zhou J Huang H Wu J Zhong Y and Shi Y (2006) Solution structure of Urm1 and its implica tions for the origin of protein modifiers. Proc Natl Acad Sci U S A 103 116 25 11630. Yu J and Zhou C Z (2008) Crystal structure of the dimeric Urm1 from the yeast Saccharomyces cerevisiae Proteins 71 1050 1055. Zafrilla, B., Martnez Espinosa, R.M., Esclapez, J., Prez Pomares, F., and Bonete, M.J: (2010). SufS protein from Haloferax volcanii involved in Fe S cluster assembly in haloarchaea. Biochim. Biophys. Acta 1804 1476 1482. Zheng, L., Cash, V.L., Flint, D .H., and Dean, D.R. (1998). Assembly of iron sulfur clusters. Identification of an iscSUA hscBA fdx gene cluster from Azotobacter vinelandii J. Biol. Chem. 273 13264 13272. Zheng L White R H Cash V L and Dean, D.R. (1994). Mechanism for the desu lfurization of L cysteine catalyzed by the nifS gene product. Biochemistry 3 3 4714 4720. Zheng L White R H Ca sh V.L., Jack R.F. and Dean D.R. (1993). Cysteine desulfurase activity indicates a role for NIFS in metallocluster biosynth esis. Proc Nat l Acad Sci U S A 90 2754 2758. Zhou B B Elledge and S J (2000). The DNA damage response: putting che ckpoints in perspective. Nature 408 433 439. Zhou G Kowalczyk D Humbard M A Rohatgi S and Maupin Furlow J A. (2008). Proteasomal c omponents required for cell growth and stress responses in the haloarchaeon Haloferax volcanii J Bacteriol. 190 8096 8 105 Zuker M (2003) Mfold web server for nucleic acid folding and h ybridization prediction. Nucl. Acids Res 31 3406 3415.

PAGE 201

201 BIOGRA PHICAL SKETCH Nikita Elizabeth Chavarria was born in Mandeville, Jamaica West Indies to Reverend Dr. Raulston Bruce Nembhard and Heather Yvonne Nembhard. At the age of ten, Nikita and her family moved to Orlando, Florida where she graduated from Dr. Philli ps High School as a Valedicto rian. In 2005, Nikita received the Florida Bright Futures Scholarship to attend the University of Florida and graduated with a Bachelor of Science degree, Cum Laude in m icrobiology and c ell s cience in 2009. During some of her time as an undergraduate, Nikita performed research as a volunteer in Dr. Julie Maupin In 2009, Nikita received the McK night Doctoral Fellowship in pursuance of her doctoral degree from the Florida Education Fund. During her time as a research and several travel grants to attend academic conferences. On February 2, 2013 in Winter Park, Florida, Nikita married Enmanuel An tonio Chavarria who received h is doc toral degree in h ealth and h uman p erformance at the University of Florida Upon completion of her doctoral studies, Nikita will continue research through postdoctoral training at the National Institutes of Health in Bethesda, Maryland.