Molecular Recognition of Bacteria and Cancer Cells Using Ssdna Aptamers

MISSING IMAGE

Material Information

Title:
Molecular Recognition of Bacteria and Cancer Cells Using Ssdna Aptamers
Physical Description:
1 online resource (128 p.)
Language:
english
Creator:
Turek, Diane
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Chemistry
Committee Chair:
TAN,WEIHONG
Committee Co-Chair:
HORENSTEIN,NICOLE ALANA
Committee Members:
FANUCCI,GAIL E
WAGENER,KENNETH B
SMITH,BEN W
OSTROV,DAVID A

Subjects

Subjects / Keywords:
aptamer -- cancer -- mrsa
Chemistry -- Dissertations, Academic -- UF
Genre:
Chemistry thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Methicillin-resistant Staphylococcus aureus (MRSA) is any strain of Staphylococcus aureus that has developed resistance to beta-lactam antibiotics, including the penicillins and the cephalosporins. Once confined to hospital settings, MRSA can now be contracted in community settings as well.Although many new antibiotics against MRSA are in phase II and III clinical trials, a tool that would enable the recognition of MRSA through its membrane structure could lead to new therapeutic approaches to eradicate the MRSA superbug, either without the use of antibiotics or with a strain-specific antibiotic. Therefore, since the aptamer molecule has shown outstanding target-specific binding, this study presents four MRSA strain-specific aptamers that can be easily modified as molecular probes for bioanalysis or antibiotics-free therapy. The Cell-SELEX technology was used to develop target-specific aptamers. Binding studies of those aptamers were performed by flow cytometry on a panel of clinical strains and preliminary investigation of their use after chemical modifications using AuNP was also carried until no binding of the aptamers was observed after time. Cancer is commonly refered as the disease of our century. While budgets of billions dollars are granted toward cancer research, very little improvment is observed through cancer statistics reports. Liver cancer, which usually occurs on liver suffering of cirrhosis, shows a very low survival rate.The hepatocellular carcinoma is the most common liver cancer and the proteinGPC3 is over-expressed on cancer patients. For that reason, GPC3 is susceptible to be a good candidate for early cancer detection or diagnosis. We used anhGPC3-overexpressed mouse cancer cell line (IMEA) to study aptamer generation specific to GPC3. Out of this study, no aptamers were found to be specific to the protein raising the question of the stability and the quality of such cell lines. Finally another cancer cell line, the ovarian cancer cells TOV21G, for which aptamers had been developed in the past from our research group, was used to study the cytoxicity of the Gold-nanorods through thermoactivation. Results of such study showed that the aptamer TOV6-gold-nanorod complex was able to internalize in the ovarian cancer cell and showed cytotoxicity after thermoactivation by laser.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Diane Turek.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: TAN,WEIHONG.
Local:
Co-adviser: HORENSTEIN,NICOLE ALANA.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-06-30

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0046165:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 MOLECULAR RE COGNITION OF BACTERI A AND CANCER CELLS USING ss DNA APTAMERS By DIANE TUREK A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Diane Turek

PAGE 3

3 To Matthieu and to my Family

PAGE 4

4 ACKNOWLEDGMENTS I give a special thank s to my advisor Dr. Weihong Tan who gave me his support and encouragement throughout my time in his res earch group at the University of Florida. I would also like to thank Dr. Kenneth Wagener who always found the right words to encourage me and guided me to make the right choices for my career. I would like to than k Dr Kenneth Sloan, who passed me his crit ical eye and passion for scientific inquiry I also would like to recognize Dr Judith Johnson, Moham med Rashid, Dr Marco Salemi, and David Nolan whose assistance was irrepla ceable in the bacteria project; and I would like to thank Dr Chen Liu, Le Trinh and Dr. Williams Puszyk who help ed me considerably on the liver project. In addition, I appreciate the patience and support from Dr. James Leonard and Dr. Dimitri Van Simaeys whom took the time to mentor me respectively in Dr Wagener and Dr ch group: their help and friendship have been invaluable during my grad uate school experience. I am deeply grateful for the many discussions and friendships cultivated with all group members and lab mates especially Dr. Kwame Sefah, Sena Cansiz, Dr. Eliza beth Jimenez, Dr. Dalia Lopez Colon, Dr. Meghan Dr. Xiangling Xiong, Dr. Guizhi Zhu Carole Champanhac, Liqin Zhang Danny Chang I Ting Teng, Stephanie Weisberg, Benjamin Arline, Emir Yasun Ismail Ocsoy and my dear Dr Pamela Havre Dr Kathr yn Williams and Lori Clark have been exceptionally helpful as well. I wish to recogni ze my committee members Dr Nicole Horenstein, Dr Gail Fanucci Dr David Ostrov and Dr Ben jamin Smith who have been critical of my work and help ed me become a better scie ntist.

PAGE 5

5 support. My parents Leopold and Rosita Turek and my sister Claire will always be my biggest inspiration and their love carries me to go forward. My deepest thank goes t o Matthieu who amazed me by staying so strong and loving th r oughout these years apart; I could not have done it without him (love you Matthieu!) M y amazing friends : Chlo, Antoine Marie, Carole, Gaelle, Joel, Brian, Frances, Melissa, Stacey, David Whitney, Mike, Hridis Kostas, Erica, Veronica, Chris and Xen othon aka Xenomon, always found the right words to push me forward. For all this support, I am eternally grateful.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 LIST OF ABBREVIATIONS ................................ ................................ ........................... 12 ABSTRACT ................................ ................................ ................................ ................... 15 CHAPTER 1 GENERAL INTRODUCTION AND BACKGROUND ................................ ............... 17 Methic illin Resistant Staphylococcus Aureus ................................ .......................... 17 History and Identification ................................ ................................ .................. 17 Epidemiology and Resistance ................................ ................................ .......... 17 Pathology, Risk Factors and Treatment ................................ ........................... 20 Cancer ................................ ................................ ................................ .................... 21 Liver Cancer ................................ ................................ ................................ ..... 23 Glypican 3 and Hepatocellular Carcinoma ................................ ....................... 24 Ovarian Cancer ................................ ................................ ................................ 25 Molecular Recognition ................................ ................................ ............................ 26 Aptamers ................................ ................................ ................................ .......... 26 Aptamers vs Antibodies ................................ ................................ .................... 26 Cell SELEX Method ................................ ................................ ......................... 28 Applications of Aptamers ................................ ................................ .................. 29 Overview of the Dissertation ................................ ................................ ................... 30 2 SELECTIO N ON METHICILLIN RESISTANT STAPHYLOCOCCUS AUREUS AND GENERATION OF APTAMERS ................................ ................................ ..... 40 Introduction ................................ ................................ ................................ ............. 40 Materials and Methods ................................ ................................ ............................ 41 Instrumentation, Reagents and Buffers ................................ ............................ 41 Bacteria Strains and Growth ................................ ................................ ............. 41 Growth Curve Determination ................................ ................................ ............ 43 SELEX Library and Primers ................................ ................................ .............. 43 Chemical Synthesis of the Random Library and Other DNA Sequences with the ABI 3400 DNA Synthesizer ................................ ................................ ..... 44 DNA Deprotection ................................ ................................ ............................ 45 HPLC Preparation and Purification ................................ ................................ ... 45 Optimization of PCR Conditions for the SELEX Procedure .............................. 46 Gel Electrophoresis ................................ ................................ .......................... 47

PAGE 7

7 In Vitro Cell SELEX P rocedure ................................ ................................ ........ 47 DNA Purification ................................ ................................ ............................... 49 Monitoring of the Binding Through Flow Cytometry ................................ .......... 50 Results and Discussion ................................ ................................ ........................... 50 Bacteria Growth Study ................................ ................................ ...................... 50 Optimization of PCR Conditions ................................ ................................ ....... 51 Cell SELEX Selection ................................ ................................ ....................... 52 Conclusion ................................ ................................ ................................ .............. 55 3 CLINICAL SAMPLE RECOGNITION BY MRSA APTAMERS AND VIZUALIZATION OF THE BACTERIA APTAMER BINDING ................................ .. 65 Introduction ................................ ................................ ................................ ............. 65 Materials and Methods ................................ ................................ ............................ 65 Instrumentation, Reagents and Buffers ................................ ............................ 65 Bacteria Strains and Growth ................................ ................................ ............. 66 Binding Studies using Flow Cyt ometry ................................ ............................. 66 Aptamer Gold Nanoparticle Coupling Reaction ................................ ................ 67 TEM Visualization of MRSA Aptamers via Gold Nanoparticles ........................ 68 Aptamer Binding Assays using Clinical Bacteria Strains ................................ .. 68 Transmission Electron Microscopy (TEM) Analysis ................................ .......... 69 MRSA Aptamer Binding after Time and Troubleshooting Tests ....................... 70 Is it Possible that Staphylococcus aureus Bacterium Changes over Time to the Point that the Bact erium Loses the Proteins Recognized by the Aptamers? ................................ ................................ ................................ ..... 73 Conclusion ................................ ................................ ................................ .............. 74 4 Mouse Liver cell selection targeting glypican 3 ................................ ....................... 86 Introduction ................................ ................................ ................................ ............. 86 Materials and Methods ................................ ................................ ............................ 87 Instrumentation, Reagents and Buffers ................................ ............................ 87 Cell Lines and Cell Culture Conditions ................................ ............................. 88 Cell SELEX Library and Conditions ................................ ................................ .. 88 Potential Aptamers Binding Assays ................................ ................................ .. 89 Fluorescence Activated Cell Sorting (FACS) ................................ .................... 90 Results and Discuss ion ................................ ................................ ........................... 90 Cell SELEX on IMEA Cells ................................ ................................ ............... 90 Sequencing and Binding Assays ................................ ................................ ...... 91 Conclusion ................................ ................................ ................................ .............. 94 5 THERMOACTIVA TION OF GOLD NANOPARTICLES ON OVARIAN CANCER 103 Introduction ................................ ................................ ................................ ........... 103 Materials and Methods ................................ ................................ .......................... 103 Instrumentation, Buffers and Reagents ................................ .......................... 103 Cell Lines and Cell Culture Condit ions ................................ ........................... 104

PAGE 8

8 Aptamer Synthesis and Purification ................................ ................................ 104 Gold Nanorod Aptamer Conjugate ................................ ................................ 105 Binding Assays ................................ ................................ ............................... 106 Confocal Assays ................................ ................................ ............................. 106 Cytotoxicity Assays and Cell Viability Determination ................................ ...... 107 Results and Discussion ................................ ................................ ......................... 107 Conjugated Aptamer AuNR Binding Study ................................ ..................... 107 Internal ization Study ................................ ................................ ....................... 108 Thermoactivation of the Gold Nanorods and Cytotoxicity Assays .................. 109 Conclusion ................................ ................................ ................................ ............ 110 6 CONCLUSIONS AND FUTURE WORK ................................ ............................... 114 LIST OF REFERENCES ................................ ................................ ............................. 117 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 128

PAGE 9

9 LIST OF TABLES Table page 1 1 Major etiological factors responsible for hepatocarcinogenesis. ......................... 38 1 2 Description of the various stages of ovarian cancer. ................................ .......... 38 1 3 Comparison between aptamers and antibodies. ................................ ................. 39 2 1 Preparation of the PCR tubes for the optimization of PCR conditions. ............... 63 2 2 Number of bacteria cells used for each round of selection and incubation times. ................................ ................................ ................................ .................. 63 2 3 Summary of progression of MRSA selection. ................................ ..................... 63 2 4 Quantitative representation of the different homologous families and MRSA aptamer sequences. ................................ ................................ ........................... 64 2 5 Apparent dissociation constants (Kd) of the four aptamers recognizing MRSA bacteria. ................................ ................................ ................................ .............. 64 3 1 Relative binding of the selected aptamers to various clini cal cell lines. .............. 85 3 2 Aptamer sequences developped by Cao et al ................................ .................... 85 4 1 Summary of progression of the IMEA cell selection. ................................ ........ 101 4 2 Ten common 10 base extended Multiplex Identifier (MID) used for sequencing. ................................ ................................ ................................ ...... 101 4 3 Potential aptamer sequences selected from Analysis 1 of the Ion Torrent data. ................................ ................................ ................................ ................. 102 4 4 Potential aptamer sequences selected from Analysis 2 of the Ion Torrent data. ................................ ................................ ................................ ................. 102 4 5 Summary of progression of the selection using the cell sorter. ........................ 102

PAGE 10

10 LIST OF FIGURES Figure page 1 1 Scanning electron micrograph of Staphylococcus aureus ................................ 32 1 2 Summary of the main resistance developed by the Staphylococcus aureus after antibiotic use. ................................ ................................ ............................. 32 1 3 MRSA Resistan ce mechanism. ................................ ................................ .......... 33 1 4 Estimated new cancer cases and deaths in the US from 2005 to 2013. ............. 34 1 5 Schematic re presentation of DNA s trands. ................................ ......................... 34 1 6 Estimated new liver cancer cases and deaths in the US from 2005 to 2013 ..... 35 1 7 Comparative pattern of expression of Glypican 3 gene in adjacent to tumor, HCC, normal liver and hepatoblastoma cells. ................................ ..................... 35 1 8 Estimated new ovarian cancer cases and deaths in the US from 2005 to 2013. ................................ ................................ ................................ .................. 36 1 9 Schematic representation of molecular recogn ition by an aptamer. ................... 36 1 10 Schematic summary of the cell based aptamer selection technique, cell SE LEX. ................................ ................................ ................................ ............... 37 2 1 ABI 3400 DNA Synthesizer. ................................ ................................ ............... 57 2 2 Example of PCR optimization and gel analysi s after Round 5 of selection ........ 57 2 3 Growth curves of the bac teria used in the selection. ................................ .......... 58 2 4 Flow cytometry analysis near the end of the s election. ................................ ...... 59 2 5 Comparison of the binding res ults of Library 15. ................................ ................ 59 2 6 Flow cytometry histograms of relevant aptamer candidates for MRSA ............. 61 2 7 SigmaPlot binding curve of the aptamer DTMRSA4 used for the Kd value determination. ................................ ................................ ................................ ..... 62 3 1 Schematic of the flow cytometry instrumentat ion. ................................ ............... 76 3 2 Flow cytometry mechanis m. ................................ ................................ ............... 77 3 3 Aptamer recognition monitored by flow cytometry. ................................ ............. 80

PAGE 11

11 3 4 TEM visualization of MRSA bacteria with AuNPs ................................ .............. 81 3 5 Flow cytometry assay for the binding of aptamers w ith bacteria. ........................ 82 3 6 Binding assays monitored by flow cytometry of the aptamers developed by MRSA bacteria ATCC 43300. ................................ .. 83 3 7 ers, DTMRSA1 aptamer and APT SEB1 aptamers on clinical MRSA and S. aureus strains. ................................ ............. 84 4.1 Scheme of a generalized cell sorting flow cytometer. ................................ ......... 96 4 2 Enrichment observed for pools 5 to 7 on both positive and negative cel l lines .. 97 4 3 Specific enrichment observed through flow cytometry at the end of the selection ................................ ................................ ................................ ............ 97 4 4 Binding observed from the selection pool 19; cells only and random library (Library 0) are used as controls. ................................ ................................ ......... 98 4 5 Example o f sequence alignment using library 19 (MID2). ................................ .. 98 4 6 Binding assay in duplicate of 6 potential aptamer candidates with flow cytome try using 3 cell lines. ................................ ................................ ................ 99 4 7 Example of theshold setting on the flo w cell sorter for IMEA cells. ................... 100 4 8 Binding assay of the pools obtained with the flow sorter in comparison with the las ................................ ................................ ... 100 5 1 Structure of the MTS and its Formazan product. ................................ .............. 111 5 2 Binding assays o n TOV21G cells. ................................ ................................ .... 111 5 3 Bin ding assay on HuH7 cells. ................................ ................................ ........... 112 5 4 Internalization study on TOV21G cells ................................ ............................ 112 5 5 Scheme of the NIR laser experiment. ................................ ............................... 113 5 6 Viability of the TOV21G ovarian cancer cells after thermal activation of the gold nanorods. ................................ ................................ ................................ .. 113

PAGE 12

12 LIST OF ABBREVIATIONS A Adenine AMA A mmonium h ydroxide: methylamine ( 50:50 ) ATCC American type culture collection Au NP Gold nanoparticle Au NR Gold nanorod BB B inding buffer BSA B ovine serum albumin C Cytosine CA Cancer antigen CDS Coding sequenc e CGRC Cancer and Genetics Research Center CPG C ontrolled pore glass CTAB Cetyltrimetylammonium bromide DI D eionized DMEM DNA D eoxyribonucleic acid DNA se D e oxyribonuclease dNTP D eoxyribonucleotide triphosphate dsDNA D ouble s tranded DNA E. faecalis Enterococcus faecalis ELAA Enzyme linked aptamer assay ELISA Enzyme linked immunosorbent assay ELONA Enzyme linked oligonucleotide assay FACS F luorescence activated cell sorting

PAGE 13

13 FBS F etal bovine serum FDA Food and Drug Administra tion FITC F luorescein isothiocyanate G Guanine GPC3 Glypican 3 GS Glutamine synthetase hGPC3 Human glypican 3 HPLC H igh performance liquid chromatography HSP Heat stock protein ICBR Interdisciplinary Center for Biotechnology Research IDT Integrated DNA Tec hnologies MAFFT Mulyiple alignment program fror amino acid or nucleotide sequences MES 2 (N morpholino) ethanesulfonic acid buffer MID M ultiplex identifier sequence MRSA Methicillin resistant Staphylococcus aureus MSSA Methicillin sensitive Staphylococcus aureus OCCA Ovarian clear cell adenocarcinoma NCBI National Center for Biotechnology Information NIR Near infrared NP N anoparticle NR Nanorod nt N ucleotide PBS P hosphate buffered saline PBP Penicillin binding protein

PAGE 14

14 PCR P olymerase chain reaction SA Staph ylococcus aureus SDS PAGE Sodium dodecyl sulfate polyacrilamide gel electrophoresis SELEX S ystematic evolution of ligands by exponential enrichment SI S upplemental information ssDNA S ingle stranded DNA T Thymine TBE T ris borate EDTA buffer TCEP Tris (2 car boxyethyl) phosphine TEAA Triethylamine Acetate TVU Transvaginal ultrasound UF University of Florida UV U ltraviolet WB W ashing buffer

PAGE 15

15 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfill ment of the Requirements for the Degree of Doctor of Philosophy MOLECULAR RE COGNITION OF BACTERIA AND CANCER CELLS USING ssDNA APTAMERS By Diane Turek December 2013 Chair: Weihong Tan Major: Chemistry Methicillin resistant Staphylococcus aureus ( MRSA ) is any strain of Staphylococcus aureus that has developed resistance to beta lactam antibiotics, including the penicillins and the cephalosporins. Once confined to hospital settings, MRSA can now be contracted in community settings as well. Although many n ew antibiotics against MRSA are in phase II and III clinical trials, a tool that would enable the recognition of MRSA through its membrane structure could lead to new therapeutic approaches to eradicate the MRSA superbug, either without the use of antibiot ics or with a strain specific antibiotic. Therefore, since the aptamer molecule has shown outstanding targ et specific binding, this study presents the generation of four MRSA strain specific aptame rs that can be easily modified as molecular probes for bioa nalysi s or antibiotics free therapy. The Cell SELEX technology was used to develop target specific aptamers. Binding studies of those aptamers were performed by flow cytometry o n a panel of clinical strains and p reliminary investigation of their use after chemical modifications using AuNP was also carried out until no more binding of t he aptamers was observed over time.

PAGE 16

16 Cancer is commonly refer r ed to as the disease of our century. While budgets of billions dollars are granted toward cancer rese arch, very li ttle improv e ment is ob served statistically Liver cancer, which usually occurs on liver suffering of cirrhosis, shows a very low survival rate. The hepatocellular carcinoma is the most common liver cancer and the protein GPC3 is over expressed on cancer pa tients. For that r eason, GPC3 is a good candidate for early cancer detection or diagnosis. We used an hGPC3 overexpressed mouse cancer cell line (IMEA) to study aptamer generation specific to GPC3. In this study, no aptamers were found to be specific to th e protein ; this raises question s about the stability and the quality of such cell lin es. Finally another cancer cell line, the ovarian cancer cells TOV21G, for which aptamers had been developed in the past from our research group, was used to study the cy to toxicity of the g old nanorods through thermoactiv ation. Results of this study showed that the aptamer TOV6 gold nanorod complex was able to internalize in the ovarian cancer cell and showed cytotox icity after thermoactivation through a n NIR laser beam

PAGE 17

17 CHAPTER 1 GENERAL INTRODUCTION AND BACKGROUND In this chapter, three main research topic background s will be presented : 1) the Methicillin resistant Staphylococcus aureus bacteria; 2) c ancer, in general and more specifically liver and ovarian cancers ; and 3) molecular recognition, with an emphasis on the SELEX technique used in our laboratory. Methicillin R esistant Staphylococcus A ureus History and I dentification Staphylococcus is a bact eria that grows in grape like cluster of cells [Figure 1 1 ] and was first discovered by Pasteur and Koch in 1877 78 from furuncle pus and osteomyelitis 1 A f ew years later, in 1881 82, Ogston put together a detailed study of Staphylococcus 2 and Rosenbach was able to isolate those bact eria and produce pure cultures 3 Staphylococcus aureus was nam ed this way because of its gold color from the Latin Still in 1884 Gram succe e ded in detecting bacteria using a coloration method from gen ti an violet: Staphylococcus was then classified under the Gram positive bacteria 4 In contrast with Gram negative bacteria that may h ave a peptidoglycan layer between two cell membranes the outer cell layer of Gram positive bacteria is constituted of a thick layer of peptidoglycan that is able to retain the crystal violet stain. Epidemiology and Resistance S. aureus is a commensal bact eria, harmlessly carried in the nose or on the skin of about 33% of the population 5 T hree profil e s of nasal carrier are distinguished: approximately 20% of healthy individuals are permanent carriers 60% are intermittent

PAGE 18

18 carriers, and 20% are non carriers 6 Those prof il e s can change overtime and the mechanism induced in nasal carriage is still not well understood. P ermanent carriers have a high bacterial density and by such a high risk of infection 7 Studies have shown than most permanent carriers are colonized by the same S. aureus strain whereas intermittent carriers are colonized at different time by different strains 8 No genetical characteristics have yet been identified to explain the development of intermittent or permanent st rains. Infectious diseases are one of the leading causes of death, particularly Staphylococcus aureus infections, with mortality rates exceeding 80%. From 1944 1954, it was common to combat strains of S. aureus using penicillin R esistance against it began to develop. In 1959, methicillin was introduced, allowing survival rates to rise to a level similar to those seen when penicillin was first introduced 9 However, not long after its introduction, the first methicillin resi stant strain was documented 10 While the incidence of Methicillin resistant Staphylococcus aureus (MRSA) has formerly been confined to hospital settings, it has recently been observed in the community at large. C ases of communi ty associated MRSA infections were first reported in the late 1980s and early 1990s. Not long after the first introduction of methicillin as a treatment for bacteri al infections, resistant strains against this antibiotic were described 10 Similar resistance against other antibiotics has been repor ted 11 This resistance can be transmitted among different bacteria (inter or intra species), indicating that proper use of antibiotics is vital to preventing the emergence of resis tance. This has been hard to accomplish as antibiotics are, and have been, misused or overused 11 As a result, several so MRSA [ Fig ure 1 2 ] By its

PAGE 19

19 own heterogeneity, MRSA can make eradication difficult, as some bacteria show multidrug resistance. The latest estimations of the occurrence of this pathogen are staggering, rising to epidemic proportions in h ospitals where, by an estimate provided by the European Antimicrobial Resistance Surveillance System, 40 60% of all infections were caused by S. aureus in the US and the UK 12,13 MRSA the lactam family originates from primary, or intrinsic, and secon dary lactam drug resistance. Primary lactam drug resistance is caused by lactamases, an enzyme that breaks down the lactam ring, ma king the molecule ineffective. Secondary drug re sistance arises from the altered expression of membrane bound peni cillin binding proteins (PBPs) as well as the alteration of cell wall permeability to lactams PBPs which are coded by the mecA gene, are involved in the synthesis of the cell wall or, mo re precisely, t he synthesis of peptidoglycan. In non resistant S. aureus lactams irreversibly inactivate these enzymes such that cell wall formation is hampered, leading to lower viability of the bacteria by susceptibility to osmotic pressure. MRSA ho wever, has developed PBPs with a lower affinity towards lactams, e.g., PBP2a. This lower affinity towards lactams renders the antibiotics less effective 12,14,15 [ Figure 1 3 ] Staphylococcus aureus developed res istance toward glycopeptides, the most common being vancomycin, by a thickening of the bacterial membrane. Indeed, glycopeptides target the D ala D ala residue of the peptidoglycan, when facing a thicker membrane, the glycopeptides get trapped in superfici al membrane layer and cannot reach the cytoplasmic membrane where the peptidoglycans are synthesized 16 The

PAGE 20

20 genetic reason of that resistance is not well understood but it does not involve the gene mec A 17 Pathology, R isk F actors and T reatment MRSA is difficult to treat because of its resistance towards lactams, i.e., methicillin and penicillin, a class of antibiotics that inhibit the construction of the cell wall of gram positive bacteria, suc h as Staphylococcus aureus 9,15,18,19 Examples of m ode of transmission s are by contact with nasal carriers, from draining lesions, by ingestion of food containing staphylococcal enterot oxin, and from mother to neona te dur ing delivery. Most risk factors come from ca theter i ntravenous toxicomania and dermal wounds 20 22 Suppurative infections are characterized by several phases: bacterial proliferation, invasion, tissue destru ction local or systemic inflammation Virulence factors involved are surface proteins that start the tissue coloni zation and factors that inhibit phagocytosis 21 Staphylococcus aureus binds to cells and extracellular matrix collagen thanks to surface associat collagen binding protein (Cna) fibrinogen binding protein (ClfA), fibronectin binding protein (FnBP), and elastin binding protein (EbpS) 23,24 Res istance to phagocytosis occurs by formation of a biofilm and intracellular penetration of S. aureus 25,26 MRSA bacteria synthesize their virulence factors in two phases. At the beginning of the bacteria growth, genes coding for adhesins are activated. Later on, genes coding for toxins get activated. This sequential activation is regulated by a virulence regulation system named agr (accessory gene regulator) 27,28 The agr system triggers a stage mechanism, the quorum sensing: it codes for a peptide that is secreted in the extracellular space and its accumulation acts as a signal on the cellular density that triggers the agr s ystem 29

PAGE 21

2 1 Treatments of Staphylococcal infections can be done locally by draining a boil for instance, but also include antibiotic therapy and symptomatic treatment of visceral failure 30 The antiobiotic therapy against M ethicillin sensitive S taphyloccocus aureus (MSSA) lie s on the use of lactam based antibiotics usually coupled with an aminoside. In the case of allergies, fluoroquinolones, synergistines, and lincosamides are the alternative treatment s chosen. Failure of the treatment is usually due to the virulence of the strain, deeper secondary infectious point, or insufficient posology 31 Cancer According to the American Cancer Society, the estimated number of new cancer cases in the US for 2013 is 1,660,290 and 580,350 deaths are expected from those diagnosed can cers 32 As it can be observed in Figure 1 4, and recalling the constant increase of US population, neither the number of new cancer cases n or cancer death s seem to reduce over time despite billions of dollars invested in cancer re search. Understanding the differences between a cancer cell and a healthy cell is essential and begins with th e understanding of cell growth. A healthy adult cell has an asymetrical growth 33,34 Under normal conditions, one mother cell going under mit osis generates two daughter cells: the first one is a generative cell similar to its mother cell which will be able to go under mitosis as well and the second one is a labor cell with a specific function in the body and a limited time of life. Statistica lly, cells might develop in the wrong way in our body, showing mutations that are the consequence of external factor s or internal mistakes. Our immune system detects those m alignant cells and forces them to die Nevertheless, it is known since 1961 that ea ch stem cell is limited to 70 divisions (mitosis) : 50 divisions are used to get to adult maturation of the organism and 20 more are able to replace cells for the rest of

PAGE 22

22 our life 35 Once this reserve is used, the cell line disappear s Contrary to what one could think, cancer cell s are frequently apprearing while cancerization remains exceptio nal. Cancerization is a hyperplasia that happens to compensa te the reduction of normal cells that become unable to fulfill their function. In o th er words, if a cell line cannot fulfill their function, the immune system does not kill the mutant cells in order to compensate the loss in cells and the need to fulfill a particular function 36 G rowth of cancer cell s is different from the healthy cell s : one mother cancer cell divide s in to two similar cells that are both able to go through mitosis with no time limit Unlike healthy cell s that maintain their cellular mass, cancer growth follow s an exponential curve 37,38 One explanation for the difference in growth between healthy cells and cancer cells is explained by Dr Beljanski. He showed that the fundamental difference bet ween t he DNA of healthy cells and malignant cells li es i n their secondary structure : the double helix of cancer cells shows permanent relaxation of the two strands whereas healthy DNA shows only temporary or local strand relaxation to allow replication or gene expression 39 [ Figure 1 5] Dr Hanahan and Dr Weinberg c laimed that c ancer has six distinctive abilities : growth signal self sufficiency, insensitivity to growth signal inhibitors, capacity to avoid apoptosis, capacity to replicate in definit ely, angiogenesis induction and the capacity to form metastasis 40 Then in 2011, they added two more properties of cancer cells : the deregulation of the energetic cellular metabolism and the ability to avoid destruction by the immune system 40 Our body contains two categories of genes that allow cancer to grow : oncogenes and tumor suppressor genes. When someone has cancer, they have a higher level of oncogenes switched on wi th a higher level of tumor suppressor genes

PAGE 23

23 switched off A f ew decades ago, Dr Burzinsky showed that specific peptides, called anti neo plastons, present in healthy in dividual s are responsi ble to turn the tumor suppressor genes on and the oncogenes off pr eventing the cells from becoming cancerous 41 Wh ile urine analyse s of healthy individual s show s the presence of those peptides, similar ana lyses of cancer patients do es not. Liver C ancer Cases of liver cancers have increased considerably in the past 20 years. According to the American Cancer Society, 30,640 diagnosed cases of liver primary cancer (2 2,720 male cases and 7920 female cases) are estimated in 2013 for the US [ Figure 1 6 ] 21,670 death cases are expected for that disease (14,890 males and 6,780 females). It is the 5 th most common cause of cancer death for men and the 9 th for women 32 Liver can show the formation of different type s of neoplasms : hepatocellular carcinoma (HCC), hepatoblastoma, haemangiosarcoma and cholangiocarcinoma. HCC is the most common and correspond to 83% of all liver cancers. Etiology and cellu lar alteration leading to HCC are relatively understood by the scientific community but molecular mechanisms of the hepatocarcinogenesis are not which explain s the difficulties encountered to find a treatment. M ost frequently, malignant liver tumors are s econdary tumors (all cancer with the exception of neurocancer are abl e to metastasize in the liver). The most common primary maligna n t tumor is the hepatocell ular carcinoma, which will be of our int erest in one of our studies. HCC appears in most cases o n liver suffering of cirrhosis and viral cirrhosis, whe ther it is alcohol related or not. Cirrhosis due to chronic liver disease like

PAGE 24

24 t he hemochromatosis or the alpha antotrypsin deficience is likely to develop a HCC. In Asia and Africa, where the B virus co ntamination happens general l y during the pregnancy HCC appears on young adults. In Europe and the US, HCC essentially appears on B or C virus cirrhosis or alcoholic cirrhosis after the age of 50, predominantly on men. Common etiologic al factors responsi bl e for hepatocarcinogenesis are summarized in Table 1 1. Since the hepatocarcinoma is generally detected late, the understanding of molecular events initiating the transformation of healthy liver cells into cancer cells is poor. The American Association for the Study of Liver Disease (AASLD) recommends an echography every 6 months to monitor the evolution of the liver state 42 Glypican 3 and Hepatocellular Carcinoma Recently, studies have shown that t he protein Glypican 3 (GPC3) is over expressed in HCC while the y are not present in healthy cells 43 [ Figure 1 7 ] That observation confer s great potential to G PC3 for liver cancer diagnosis, by immunohistochemistry, at an early stage of the disease. Glypicans are part of the heparan sulfate proteoglycan family susceptible to bind to the outter plasmic membrane by a glycosyl phosphatidyl inositol (GPI) anchor. Gl ypicans regulates the cell response to proteins BMP (Bone Morphogenic Proteins) and to IGF 2 (Insulin like Growth Factor 2). Both proteins are involved in cellu lar division and different iation 44 There are different type s of glypicans but all of them have 20 to 50% homology in their sequence They are able to stabilize the i nteraction between a ligand and its receptor by electrostatic interactions through their HS chains. They can trap extracellular ligands and contro l their diffusion. They play a role on growth factors signalization and transport ; more particularly, they pla y a negative regulatory role in hepatocyte proliferation 45 It is

PAGE 25

25 im portant to note that glypican s 3 are found to be over expressed in well differentiated hepatocellular carcinoma 46 H epatic adenoma have different morphological behaviour that play a role in determining the risk of maligna n cy. Hepatic tumors are classified in different groups and the absence of makers such as glypican 3 or HSP 70 allows the distinction between these tumors and HCC 47 Alpha fetoprotein is a well established serum marker for HCC. However, it has low sensitivity (25% to 30%) where GPC3 imm unore activity has reported a sensitivit y of 77% and specifi ci ty of 96% in the diagnosis of small HCC 48 Best results are found with the combination of several markers of maligna n cy (GPC3, HSP70 and GS) where the specifi ci ty is found to be 100%. Ovarian Cancer Accordi ng to the American Cancer Society, ovarian cancer is the ninth most common cancer among women. 22,240 women are expected to be diagnos ed for new cancer cases in 2013 in the US and 14,230 will die from ovarian cancer [ Figu re 1 8 ] 32 Ovarian cancer is a cancerous growth arising from the ovary. They can originate from three different type of cell: surface epithelium that are cells covering the lining of the ovari es; germ cells that are destin ed to for m eggs; and stromal cell that release hormones. Epithedial ovarian cancers are the most common type of maligna n cy, accounting for more than 80% of the ovarian cancer s 49 The stage of the ova rian cancer can be determined during surgery and are described in Table 1 2 50 Symptoms that could indicate ovarian disease include bloating, pelvic or abdominal pain, difficulty e ating and frequent urination, which can go unnoticed until the cancer has made serious progress. At early stages, the long term survival rate is a pproximately 90% 51,52 Transvaginal ultrasound (TVU) and serum biomar ker testing are used for

PAGE 26

26 e arly detection 53 : the cancer antigen 125 (CA 125) is a transmembrane glycoprotein that is highly expr essed in epithelial ovarian cancers. Since this protein appears elevated in other gynecological conditions, the CA 125 is mostly used to monitor the ovarian cancer prog r ession 54,55 or coupled with the TVU. Molecular Recognition Aptamers For a very long time, nucleic acids were ascribed only one function: carrying genetic information that encodes proteins. Wi th more exploration and underst anding of molecular mechanisms of genetics, the search of other functions appear ed possible. Aptamers, from the Latin short single stranded oligonucleotides that shows specific bind ing to a target. They are able to form stable three dimens ional structures in aqueous solution. The binding betw een the aptam er and the target is based on molecular recognition: each aptamer has a unique tertiary binding structure and will interact with the target through Van der Waals forces, electrostatic forces and hydrogen bonds [ Figure 1 9 ] 56 58 For cost purposes, aptamers are ideally made the smallest possible, e ither by a short length of primer s and random sequence or by further optimization after the cell SELEX process. They are generally under 100 nucleotides. Targets can range from small molecules, tissues, proteins to a whole organism and the binding affinity is in the micro or picomolar scale. The affinity is quantified th rough the dissociation constant K d A small value of this parameter represents a high affinity of the apta mer. Aptamer s vs A ntibodies Aptamers and antibodies have similar high specificity a nd affinity for their targets. A f ew important characteristics make the aptamers a particular interesting tool for in

PAGE 27

27 vivo application s Firstly, a ptamers can be synthesize d chemically, for a relatively low price in a reproducible way allowing chemical modifications (addition, deletion or substitution) 59 61 Secondly and contrary to antibodies, in vivo use of aptamers do not target x enoreactions from the immune system 62 64 Thirdly, aptamers are smaller than antibodies and for that reason are able to easily penetrate into tissues. The main disadvantage of aptamers development through cell SELEX is that it is done on an entire cell, which does not give information on the target identification. Nevertheless, the outcome of a selection is in most case s, the generation of different aptamers abl e to bind the same target. The ability to get several a ptamers for t h e same target reduces the occu r rence of false pos i tive or false negative during detections. Aptamers are used for analytical purposes in E LISA type assays, ELONA or ELAA, where studies have shown they are able to replace or give similar resul ts as antibodies 65 68 T he possib ility of generating aptamers w hen antibodies are not necessari ly availab le is an excellent tool which has been shown with the aptamer SELH2A, able to recognize the antigen H2A for wh ich no antibody is commercially available 69 The other method fo r which aptamers are used is flow cytometry. In this method that is used for clinical diagnosis, particles can be distinguished based on their color, structure and size. The use of aptamers can replace the most commonly used antibodies. Indeed, it is easy to detect fluorescent aptamers once linked to their target and the affinity of the aptamer to its target remains the same whether there is addition of a fluorophore. Aptamers are of a great advantage in immune s ystem cells analysis. Indeed, th ose cells have receptors of anti bodies Fc region on their surface, which can

PAGE 28

28 generate interferences. The use of aptamers prevents that problem. A brief comparison between aptamers and antibodies is presented in Table 1 3 70 72 Cell SELEX M ethod The identification of oligonucleotide aptamers is performed using the SELEX systematic evolution of ligands by exponential enrichment method. This strategy is a n in vitro aptamer selection t hat was developed in 1990 by Gold and Sz ostak 73,74 It begins with the elaboration of a random library framed by two primers, one on the end region and one on end region. 10 13 to 10 15 different random motifs are then used to begin a selection. The pool of random sequences is incubated with both the target and a counter target: for instance, if the target is a specific cell line, then the counter target wi ll be another cell lin e which we do not want the sequences to bind to. All sequences binding to the counter target are eliminated after each r ound and the sequences binding to the target are amplified by polymerase chain reaction. The new pool obtained is then used for the next round [ Figure 1 10 ]. Each round of SELEX allows the random pool to enrich with binding sequences and removes the non binding sequences 7 5 Typically, up to 20 to 25 rounds are performed for an entire selection. The evolution of the selection is monitored by flow cytometry, where the binding of the pool can be assessed. Some conditions make the selection process more successful. On one han d, the target n eeds to be present in a sufficie nt amount and in a highest purity possible in order to minimize enrichment of non specific oligonicleotide and by such, increase the selectivity of the aptamers. On the other hand, some characteristics of the target itself facilitate the selection process: plan groups (aromatic groups for instance), positive

PAGE 29

29 charged gr oups and hydrogen dono r functional groups or hydrogen bond accept ors 76 78 Selections appear to be more challenging on hydrophobic or anionic targets. Applications of A ptamers Owing high selective binding prop erties, aptamers have the asset to be an excellent tool in nanotechnology. In the laboratory, aptamers have shown good results in different techniques. For protein purification, aptamers based Histidine specific columns present better results than the original metal ion affinity chromatography where the isolation of Hi stidine conjugated molecules is made possible because of the interaction of Histidine a nd nickel or cobalt ions from the column 79 For the same purp ose, aptamers have been used coupled with polymeric beads or magnetic nanoparticles 80 Two other standard techniques where aptamers are successfully used are western blot and flow cytometry In western blot r esearch, the use of aptamer s has been shown to be equally effective and even more sensitive than antibodi es 81 In flow cytometry, reversible labeling techniques h ave been develop allowing the label to be removed after sorting through flow cytometry 82 Such technique cou ld not be possible with antibodies without affecting the cell membrane proteins. In the medical field, the use of aptamers is promising. Besides quantitat ive evaluation, aptamers can serve as probes to image tumor cells. The ability of aptamer s to undergo conformational chan ge upon b inding makes it a good candidate as a fluorescent molecular beacon 83 Electrochemical sensors using aptamers have shown good results as well. They typically consist of an electrode coated with an aptamer which undergoes conformational change upon binding and affect the current flow through the system. Those measurable change s of electric current can be m onitored for analytical purposensen 84 Optical properties also play a role in cell specific detection

PAGE 30

30 u sing nanoparticle vehicles. For instance switch of color from pink to blue have been observed after aggregation of NP on cell surface 85 Radiolabeling is an a nalytical option to use with aptamer; late studies show the use of 99m Tc 86 and 6 4 Cu 87 Aptamer the rapeutic applications are extensively investigated. While most therapeutic methods used aptamers as inhibitors 88 drug delivery vehicle s using aptamer specificity show encouraging results 89 The use of micelles or liposomes as a means of transportation and the ability to get multifunctional nanoparticle conjugates are very promising for such application that f ocus on cell specificity 90 93 The current literature covering nanoparticle research seems to observe no cyto toxicity from gold nanoparticles Those toxicity conclusions are generally drawn after viability studies a nd do not enter into the details of mechanisms involved in the cell 94 Other studies on nanorod s show that the origin of cytotoxicity when handling nanorod s is due to free CTAB used in making the NR. High p urification of such vehicles and nanorod surface modifications can improve those results 95 Overview of the D issertation The research presented in this dissertation tackles different topics One of the projects involves working with the biosafety level 2 bacteria Methicillin resistant Staphylococcus aureus on which a selection was run in order to generate aptamers specifically binding to MRSA Those aptamers were further tested on clinical s amples obtained on site at Shands hospital, Un iversity of Florida. Beside s the bacteria selection, the Cell S ELEX method was used with the aim of generating aptamers on a genetically modified mouse cell line carrying the human protein and hepatocancer mar ker Glypican 3. The rational e for this selection was to counter two problems: the first one being that Cell SELEX is not a metho d that gives the

PAGE 31

31 opportunity to know the target of the aptamer on the surface of the cell. By using a cell modified by the only overexpression of the protein Glypican 3 and by using the wild cell as a counter cell, we were incre a sing ou r chances to develop an aptamer recognizing the glypican 3 protein. The second being that protein selection have been done using proteins on magneti c beads but the main problem encounter ed in this technique is that the protein, when expressed on the surf ace of the cell does not necessi rely fold in the exact same configuration and binding can be lost 80 Finally, the last project lies on using gold nano rod s bound to aptamers known to bind to ovarian cancer ce lls. Once exposed to the beam of a NIR laser, nanorods are thermoactivated and their cytotoxicity was assessed.

PAGE 32

32 Figure 1 1. Scanning electron micrograph of Staphylococcus aureus This image is in the public domain and thus free of any copyright restrict ions. Courtesy (PHIL). Figure 1 2. Summary of the main resistance developed by the Staphylococcus aureus after antibiotic use.

PAGE 33

33 A B C Figure 1 3. MRSA Resistance mechanism: A ) through lactamase; B) through an alteration of the PBP and C) through an alteration of the cell membrane.

PAGE 34

34 Figure 1 4. Estimated new cancer cases and deaths in the US from 2005 to 2013. The figure summarize s data from the American Cancer Society webs ite. Figure 1 5. Schematic representation of DNA strands. A) Normal DNA and B) Cancerous DNA.

PAGE 35

35 Figure 1 6 Estimated new liver cancer cases and deaths in the US from 2005 to 2013. The figure summari ze s data from the American Cancer Society website. Figure 1 7 Comparative pattern of expression of Glypican 3 gene in adjacent to tumor, HCC, normal liver and hepatoblastoma cells. Copyright 2006 American Association for the Study of Liver Diseases. Used under permission

PAGE 36

36 Figure 1 8 Estimated new ovarian cancer cases and deaths in the US from 2005 to 2013. The figure summarize data from the American Cancer Society website. Figure 1 9 Schematic representation of molecular recognition by an aptamer. Copyright 2013 Elsevier, USA. Used unde r permission

PAGE 37

37 Figure 1 10 Schematic summary of the cell based aptamer selection technique, cell SELEX 64 Copyright 2013 National Acade my of Sciences, USA. Used under permission

PAGE 38

38 Table 1 1. Major e tiological factors responsible for hepatocarcinogenesis. Risk Factors Outcome Hepatitis B (HBV) Hepatitis and cirrhosis Hepatitis C (HCV) Hepatitis and cirrhosis toxins Genotoxicity and cytotoxicity Alcohol consumption Alcoholic cirrhosis Table 1 2. Description of the various stages of ovarian cancer. Stage of ovarian cancer Description Stage I Growth of the cancer is limited to the ovary or ovaries. Stage IA Growth is limited to on e ovary and the tumor is confined to the inside of the ovary. There is no cancer on the outer surface of the ovary. There are no ascites present containing malignant cells. The capsule is intact. Stage IB Growth is limited to both ovaries without any tumo r on their outer surfaces. There are no ascites present containing malignant cells. The capsule is intact. Stage IC The tumor is classified as either Stage IA or IB and one or more of the following are present: (1) tumor is present on the outer surface of one or both ovaries; (2) the capsule has ruptured; and (3) there are ascites containing malignant cells or with positive peritoneal washings. Stage II Growth of the cancer involves one or both ovaries with pelvic extension. Stage IIA The cancer has exte nded to and/or involves the uterus or the fallopian tubes, or both. Stage IIB The cancer has extended to other pelvic organs. Stage IIC The tumor is classified as either Stage IIA or IIB and one or more of the following are present: (1) tumor is present on the outer surface of one or both ovaries; (2) the capsule has ruptured; and (3) there are ascites containing malignant cells or with positive peritoneal washings. Stage III Growth of the cancer involves one or both ovaries, and one or both of the follo wing are present: (1) the cancer has spread beyond the pelvis to the lining of the abdomen; and (2) the cancer has spread to lymph nodes. The tumor is limited to the true pelvis but with histologically proven malignant extension to the small bowel or oment um.

PAGE 39

39 Table 1 2. Continued. Stage of ovarian cancer Description Stage IIIA During the staging operation, the practitioner can see cancer involving one or both of the ovaries, but no cancer is grossly visible in the abdomen and it has not spread to lymph nodes. However, when biopsies are checked under a microscope, very small deposits of cancer are found in the abdominal peritoneal surfaces. Stage IIIB The tumor is in one or both ovaries, and deposits of cancer are present in the abdomen that are large en ough for the surgeon to see but not exceeding 2 cm in diameter. The cancer ha s not spread to the lymph nodes Stage IIIC The tumor is in one or both ovaries, and one or both of the following is present: (1) the cancer has spread to lymph nodes; and/or (2) the deposits of cancer exceed 2 cm in diameter and are found in the abdomen Stage IV This is the most advanced stage of ovarian cancer. Growth of the cancer involves one or both ovaries and distant metastases (spread of the cancer to organs located outs ide of the peritoneal cavity) have occurred. Finding ovarian cancer cells in pleural fluid (from the cavity which surrounds the lungs) is also evidence of stage IV disease. Copyright 2013 National Ovarian Cancer Coalition. Used under permission. Table 1 3 Comparison between aptamers and antibodies Parameter Antibodies Aptamers Production In vivo Long, expensive Difficult purification Immunogen targets Affinity changes from one batch to another In vitro Quick, low cost High standard p urification All type of targets Reproducibilty from one batch to another Stability Sensitive to temperature (irreversibility of the denaturation) Stable: transport at room temperature Chemical modifications Decrease or lost of affinity after modifica tions No change of affinity (control on the position of modification)

PAGE 40

40 CHAPTER 2 SELECTION ON METHICILLIN RESISTANT STAPHYLOCO CCUS AUREUS AND GENERATION OF APTAME RS Introduction As mentioned in the introduction, Staphylococcus aureus bacterial infection is a worldwide health concern. Not only are cases found in hospital environment s but also infected cases have been reported in the community 9,12,15,18 Those infections are trea ted using beta lactam drugs. N everthe l ess, with the increasing appeara nce of resistant strains, the most common being the methicillin resistant Staphylococcus aureus ( MRSA ), treatment can be challenging and post treatment outbreaks are reported in the global literature. Over the course of th e past two decades, mammalian cells have been the focus of most aptamer studies using the SELEX technique 54,64,96 Since Staphylococcal infections have shown a dramatic global inc rease over the last few decades 97 and since the Staphylococcus aureus bacterium is a superbug which has develop ed resistance to all d rugs generated so far 9,12,15,18 we proposed that an aptamer selectio n of MRSA would provide a useful tool to further investigate MRSA targeted applications. Indeed, a n aptamer, which is a single strand DNA, would offer molecular recognition and could easily be chemically modified if necessary The bacterial cell based sele ction of aptame rs described in this chapter was performed using the well established SELEX technique which is usually used on mammalian cells throughout several rounds of incubation 75 A good quality bacteria l culture is essential to the success of this technique as well as the level of gene expression of the bacteria since the recognition occurs on the membrane of the cell. This chapter describes the met hods used t o carry out the selection, generate aptamers and characterize their binding properties.

PAGE 41

41 Materials and M ethods Instrumentation Reagents and B uffers Bacteria l culture in broth was performed using the Forma Orbital Shaker Hepa filter from Therm o Electron Corporation. Centrifugations were run either in an Eppendorf Centrifuge 5810R 15 amp version or in an Eppendorf Centrifuge 5417R. DNA concentrations and OD600 were determined using a Biorad Smart Spec Plus spectrometer and electrophoresis gel s were read on the GE Image Quant 400. Then electrophoresis gels were cast and analyzed on a Biorad minisub cell GT. All PCR mixtures contained 50 mM KCl, 10 mM Tris HCl (pH 8.3), 1.5 mM MgCl 2 dNTPs (each at 2.5 mM), 0.5 M each primer, Hot start Taq DN A polymerase (5 units/L) (TaKaRa) and DNase free water Amplification was carried out on a BIO RAD thermocycler at 95C for 30 sec, 60.7C for 30 sec, and 72C for 30 sec, followed by the final extension for 3 min at 72C. Pool enrichment was monitored by flow cytometry analysis using a FACScan cytometer (BD Immunocytometry Systems). the binding buffer (4.5 g/L glucose, 5 mL MgCl 2 1.0 g/L bovine serum albumin and 100 mg/L tRNA) and the 90:10 H 2 O : PBS washing buffer Gel electrophoresis was prepared and run using TBE buffer: 1 X Tris/Borate/EDTA (TBE) buffer (Fisher Scientific Inc. ) Bacteria Strains and G rowth Methicillin resistant Staphylococcus aureus ( MRSA ), standard strain 43300, lot number 58228213 was purchased from ATCC, and a clinical strain of Enterococcus faecalis (E. faecalis) was obtained from the Emerging Pathogen s Institute at the University of Florida.

PAGE 42

42 MRSA was cultured at 37C in ATCC medium 18 Trypticase soy agar with additi on of 4mg/L of sterile methicillin in order to maintain the resistant structural property of the bacteria. E. faecalis was cultured at 37C in ATCC medium 260 Trypticase soy agar with defibrinated sheep blood and in the corresponding broth with no blood. T he MRSA bacteria l strain 43300 also designated F 182, is a clinical isolate from Kansas 98 T he E. faecalis strain donated by the Emerging Pathogen s Institute is a clinical isolate from Shands H ospital, University of Florida. The culture of MRSA required biosafety level II certification. Stock solutions of each cell line were prepared for th e selection study and aptamer characterization: a total of four solutions were made The best results were obtained by the following procedure. Cell lines were incubated overnight at 37C on their respective agar plate s The f olllowing day, a single colony from each plate was replated and incubated overnight at 37C; t hen 3 4 bacterial colonies were transferred from the agar plate to 15 mL Corning centrifuge tubes filled with 6 7 mL of the corresponding broth and incubated over night at 37C. From this stock, 3 drops of bacterial solution were transferred to another 15mL Corning centrifuge tube containing 4 mL of correspo nding broth and incubated for 3 4 hours These two batches of incubated cells ( MRSA and E. faecalis ) were sepa rately washed twice with P BS and fixed in 70:30 methanol: DNase free water. As a precaution to minimize clumping, DNase free water was added first, and cells were resuspended, followed by the corresponding volume of methanol. After 2 h of fixation at 4C, cells were stored in 10% PBS: DNase free water. Finally, OD600 was measured for each batch, and a mixture was prepared to obtain the lowest OD600

PAGE 43

43 measured out of the two batches In other words, a n equimolar mixture of the two time of growth (overnight and 3 4 h) was obtained Four stock solutions of each bacterium were used for the entire selection. For MRSA stock solution 1: OD600 = 2.08, 15 mL; stock solution 2: OD600 = 1.03, 22 mL; stock solution 3: OD600 = 1.73, 18.7 mL; stock solution 4: OD600 = 1. 58, 59.5 mL. For Enterococcus faecalis stock solution 1: OD600 = 1.18, 12.5 mL; stock solution 2: OD600 = 0.762, 17.5 mL; stock solution 3: OD600 = 2.49, 14 mL; stock solution 4: OD600 = 2.27, 66 mL. Growth Curve D etermination The growth curves of both MR SA and E. facecalis were determined over a period of 12 h. A sing le plate colony of each bacterium was culture d using the corresponding broth. Then a measurement of the absorbance was performed every hour for 12 hours. And finally the log (absorbance) vers us the time was plotted to obtain the growth curve SELEX Library and P rimers The library consisted of a 40 base randomized region flanked by primer regions, ATC CAG AGT GAC GCA GCA (N) 40 TGG ACA CGG TGG CTT AGT FITC, and the biotin : Forward primer ( sense): FAM ATC CAG AGT GAC GCA GCA Reverse primer (anti sense): Biotin ACT AAG CCA CCG TGT CCA FITC labeling enabled fluores cence monitoring during selection by flow cytometry while biotin was used for separation of the sense strand from the antisense strand after PCR amplification through streptavidin biotin interaction and subsequent alkaline denaturation. All oligonucleotid es were synthesized by standard phosphoramidite

PAGE 44

44 chemistry using an ABI 3400 DNA synthesizer (Applied Biosystems) and purified by reverse phase HPLC (Varian Prostar). Chemical Synthesis of the Random Library and O ther DNA S equences with the ABI 3400 DNA S yn thesizer In nature, DNA is synthesized by incorporation of nucleotides by the DNA Chemically, synthetic nucleic acids are synthesized by solid phase using phosphoramidite chemistr y in a DNA synthesizer [Figure 2 1 ]. P hosp horamidite chemistry allows the DNA synthesis to occur without the presence of any enzyme, which, in nature, uses the energy stored in the triphosphate bonds to catalyze the formation of a new phosphodiester bond between the bases. The synthesis occurs in as a solid support; it is a non swellable glass bead with narrow pore size distribution and high surface area. T he instance) of the sequence. Subsequent bases are introduced as phosphoramidites, on which all active groups are blocked by protecting groups. position is prot ected by a dimethoxytrityl group (DMT); the phosphate group is protected with a di isopropyl amine and a 2 cyanoethyl group ; and the base itself is protected by a benzoyl group. Each base addition occurs according to the following steps: first the DMT protecting group end is removed by reaction with the dichloroacetic acid hydroxyl g roup ; se cond the base to be added is activated with a tetrazole molecule for the coupling reaction; third the coupling occurs and forms the phosph ite linkage ; and finally, there is oxidation of the phosphite linkage into a more stable phosphate linkage.

PAGE 45

45 hydroxyl group is capped by reaction with an acetic anhyd ride molecule. The capping prevents the sequence to continue coupling with other bases that could form a sequence with a deletion. DNA D eprotection At the end of the DNA synthesis, t he newly synthesized DNA strand is still attached to the CPG bead end and protected at different level s : a 2 cyanoethyl group protects the free oxygen in the phosphate groups, a benzoyl group protect s the bases en d. Since the DM T groups are needed for the HPLC all other protecting group need ed to be removed. Each column of DNA was dried with air and the beads were transfered to a test tube for deprotection. They were incubated for 30 min at 65C with 2 3 mL of AMA O nce the solution was cooled t he supernatant was transfered to a centrifuge tube, leaving behind the CPG beads. Based on the supernatant volume, 1/10 volume of 3 M NaCl and 2.5 volume of cold ethanol were added. Th e solution was vortexed and frozen for 30 min for the DNA to precipitate. HPLC P reparation and P urification The high performance liquid chromatography was used to purify the DNA from the truncated DNA sequences present at the end of the synthesis. The DNA precipitate obtained after DNA d eprotec tion was centrifuged for 30 min at 4,000 rpm. The supernatant was discarded and the DNA was resuspended in 0.10 M TEAA. The solution was centrifuge d at 14,000 rpm for an additionnal 1 min to remove any CPG beads left from the precipitation step. This step is critical sin ce any remaining bead s could osbtruct the HPLC column. The purification was accomplished using a ProStar HPLC station (Varian CA) equiped with a C 18 reversed phase column (Econosil, 5 from Alltech

PAGE 46

46 (Deerfield, IL) On a reversed phase column, p olar compounds elute faster than non polar compounds. The separation was possible because full length DNA sequences contained a DMT group o n the end while truncated sequences had a n acetate group which is smaller an d more polar than the DMT group. For that reason, the full length DNA sequences interacted with the stationary phase for a longer time. The elution was achieved using a gradient elution with acetonitrile and 0.10 M triethylamine acetate in water. The chromato g raphy began at 100% TEAA which is an ionic solution It is important to note that DNA is ionic and therefore, it does n ot interact well with the stationary phase by itself. The DNA sequences are mad e neutral an d less polar by pairing the anionic phosphate linkages with triethylammonium cations. As the HPLC progressed, the percentage of acetonitrile is gradually increased until full elution of the sample. After purification, the sample was dried by centrifugal ev aporation. Then a final incubation with 80% acetic acid for 30 min was performed to remove the DMT protecting gr oup and speed vacuumed Finally, the DNA was resuspended in water and the absorbance of this stock solution was measured at 260 280 nm. The conc entration of DNA was calculated using the Beer Lambert law A= lc, where A is the absorbance of the DNA sample, DNA oligonucleotide, l is the light path of the cuvette and c is the sample concentration. Optimization of PC R C onditions for the SELEX P rocedure Polymerase chain reaction (PCR) is a technique used to increase the DNA concentration exponentially. It is divided in three stages: denaturation annealing and elongation In order to determine the annealing temperature t he optimization was performed using 8 samples: 6 containing the random library and 2 negative controls

PAGE 47

47 [Table 2 1 ] The temperature range for the random library was: 51.5C, 52.2C, 53.4C, 55.2C, 57.6C, 59.5C, 60.7C and 61.5C. The control tubes we re set at the lowest and highest temperatures. Gel E lectrophoresis PCR products can also be analyzed using agarose gel electrophoresis. During the selection process, this technique is used to analyze the PCR products from the cycle optimization and to det ermine the most efficient number of rounds. The PCR samples were loaded on a 3% agarose gel and the DNA was visualized using 0 .5 mg/mL ethinium bromide which fluoresces upon exposure to UV light. The 7x7 cm 2 3% agarose gel was pre pared by mixing 1.2 g aga rose and 40 mL of TBE buffer and melt ing the mixture was poured in a gel cast using an 8 we ll comb and allowed to cool before loading. Each mixture was loaded using 8 L of the PC R product or control, and 2 L of loading buffer (bromophenol blue and glycerol) A 25 bp ladder was used to estimate the size of the DNA The gel was run at constant voltage of 100 V for 23 min to move the negatively charged DNA toward the positive electr ode The resulting gel was analyzed under UV light. In V itro Cell SELEX P rocedure In this selection, MRSA standard strain 43300 was used as the target cell line and E faecalis was used for the counter selection For the first round all subsequent 10 7 cel ls were incubated with 22 nmol of nave ssDNA library dissolved in BB A ll other rounds were incubated with 25 pmol of the library obtained from the previous round. Before incubation, the DNA library was denatured at 95C for 5 min and quickly cooled on ic e for 10 min, allowing each sequence to form the most stable secondary structure.

PAGE 48

48 Each round was performed with the counter selection first with an incubation of 1 hour in an orbital shaker at 4C. The counter selection is used strategically in the SELEX t echnique to remove non specific binding. In this particular example, sequences binding to MRSA cells are put aside and amplified whereas sequences binding to E. faecalis (the counter cell line) are removed from the pool. The supernatant containing the unbo und DNA sequence was then incubated with the positive cell line for 30 min in the same conditions. The pellet obtained was then washed two or three times, depending on the round with the strin gency of the washes increased to 3 washes with 1 mL of WB for 3 m in. After centrifugation, the pellet was re suspended in DNase free water, denatured at 95C for 15 min and centrifuged at 14,000 rpm for 2 min. The supernatant containing the ssDNA was recovered and amplified by PCR using FITC and biotin labeled primers to increase the number of copies of individual sequences. Two preparative PCR s were per formed at the end of each round using the lates t enriched pool as the template. T he first was used to optimize the number of rounds using 6 PCR tubes and 1 for negative control; and t he second PCR amplified the pool usi ng the optimum number of rounds on 1 mL of PCR solution (10 tubes) The optimum round was determined by anal ysis of the gel electrophoresis [Figure 2 2 ]. As showed in Figure 2 2 a mplifications were carrie d out with an initial denaturation for 3 min at 95C, followed by the PCR round including 30 sec at 95C, 30 sec at 60.7 C, and 30 sec at 72C and ended by fin al extension for 3 min at 72C PCR tubes were selectively remove d from round s 14 to 24 for furt her analysis by gel electrophoresis. The optimum cycle was representated by the brightest single band of the agarose gel, which is 24 cycles in this example

PAGE 49

49 The sense s sDNA strands obtained after the preparative PCR were separated from the biotinylated a ntisense ssDNA by streptavidin coated Sepharose beads (GE Healthcare Bioscience). The ssDNA was elute d from the beads by melting in 0.2 M NaOH The resulting solution was desalted using a NAP5 co lumn dried and resuspended in BB to a concentration of 250 n M. The purification steps are detailed below The selection process was repeated until the level of enrichment, monitored by flow cytometry, reached a plateau. Once the plateau was reached, pools of interest were su bmitt ed for sequencing using both the 454 and Ion Torrent technique s DNA P urification As mentioned in the section above, dsDNA is obtained after the PCR amplification and the ssDNA FITC labeled needs to be separated from the Biotin labeled ssDNA in order to be used in the SELEX protocol. This p urification wa s performed by affinity chromatography. The column mounted at the tip of a syringe wa Streptavidin beads (Streptavidin Sepharose, GE Healthcare) and washed with 250 PBS. The amplified sample wa s then passed through the column 3 times to make sure the pool stayed on the beads by Biotin Streptavidin interaction and pr imers were removed by washing Then NaOH was added to dissolve the DNA and collect the FITC single strand. Finally the filtrate was passed through a desalting column. The column was washed with 15 mL DI water and after the nd the filtrate was collected. After t he DNA concentration of the pool was measured spectrophotometrically at 260 280 nm and the appropriate volume of binding buffer for storage at 250 nM or 500 nM was added.

PAGE 50

50 Monitoring of the Binding Through Flow C ytometry Binding assays were used for three purposes: (1) to monitor the progre ssion of the selection; (2) to assess the potential aptamer candidates ; and (3) to determine their apparent dissocia tion constant s Binding assays to monitor the selection and to assess the potential aptamers followed a protocol based on the target cells, here MRSA (10 7 cells), which were incubated at 4C for 30 min with binding buffer and with 250 nM of either enriched library FITC labeled or FI TC labeled aptamers to monitor the selection or to assess potential aptamers respectively In the case of the apparent dissociation constant determination, the incubati on at 4C was performed using a panel of concentrations of the aptamer. The fluorescence intensity was determined by FACScan cytometry (BD Immunocytometry Systems) by counting 60,000 events for binding assays and 30,000 for Kd determination. Details about the flow cytometry mechanism of action are given in chapter 3. The intensity for cells only with random library (Library 0) was used as the background signal. The specific binding was obtained by subtracting the mean background intensity from the mean fluo rescence intensity of the cells plus aptamers. The equilibrium dissociation constant (Kd) was obtained by fitting a plot of the specific binding intensity (Y) versus the aptamer concentration (X) to the equation Y = Bmax X/(Kd+X), using SigmaPlot (Jandel, San Rafael, CA). Results and D iscussion Bacteria Growth S tudy As stated i n the chapter introduction, a good quality bacteria l culture and appreciable gene expression level are essential for the success of a cell selection.

PAGE 51

51 While the resistant genes of MRS A bacteria are maintained by inclu ding the Methicillin antibiotic in its culture agar or broth, it is important to note that MRSA bacteria synthesize their virulence factors in two phases. At the b eginning of bacteria l growth also known as the exponential or logarithmic phase genes coding for adhesins are activated. Later genes coding for toxins are activated. This sequen tial activation is regulated by a virulence regulation system named agr (accessory gene regulator) 27,28 To make sure cultural batches would contained both types of virulence factors, growth curve s of both MRSA and E. faecalis were determined [ Figure 2 3 ]. Based on the MRSA growth curve [Figure 2 3A] the beginning of the exponential phase was det ermined to be around 3 h and the end of growth was about 8h. In order to make sure that all virulence genes were expressed, the stock solution mixture of growth was chosen to be a n equimolar mixture of the 3 4 h and overnight (12 h) growths. E. faecalis a common gut bacterium, was considered to be a good fit as a counter selection because of its Gram positive structure similar to MRSA To ensure that bacteria were alive before fixation with methanol, neith er bacteri um was cultured longer than 12 h. Opt imi zation of PCR C onditions During the PCR process, there is a risk of getting primers at the wrong position The higher annealing temperature increases the likelihood that the primers will bind to their expected priming positions. For that reason, the anneal ing temperature of the primers used throughout the selection process was optimized to be the highest for efficient amplification with minimal non specific binding in the desired temperature range.

PAGE 52

52 The PCR was run between 51.5C and 61.5C and the PCR prod ucts were compared by gel electrophoresis Since the likelyhood of the primers to bind with their expected priming region increases at high temperature, the optimal annealing temperature was determined to be 60.7C. Cell SELEX S election In order to select aptamers binding to MRSA a random library of ssDNA was subjected to sequential binding with the object ive of selecting those sequences from the pool having high binding affinity to surface markers on the target MR SA bacte rium Counter selection using the Gram positive commensal bacterium Enterococcus faecalis was performed on each round. This step was necessary to eliminate sequences binding to common surface markers, and at the same time, to enrich specific markers on the target bacterium. Both negative a nd positive cell lines were fixed with methanol before being used in the selection process. Four stock solutions of each fixed bacterium were prepared, as explained in the Section. The fi rst stock solution was used for round s 1 to 1 1; the second for round s 12 to 14; the third for round s 15 to 17 ; the fo u rth was used for binding assays The eluted pool of each round was amplified by PCR and monitored by flow cytometry. Since the pools were enriched throughout different rounds with seq uence binding MRSA an increase in fluorescent signal was observed. The flow cytometry analysis of enrichment of the libraries and the binding assays with individual aptamers were performed on batch four. At the end of the 14th round of selection, a signif icant increase of specific pool enrichment was observed [Figure 2 4] After 15 rounds, a plateau was rea ched, and the selection was continued until round 17 to maximize homology within binding sequence families The summary of progression of the sel ection is presented in Table s 2 2 and 2 4

PAGE 53

53 As observed in F igure 2 4 the last libraries of the sele ction showed specific binding to the targeted cell line MRSA Since those results were obtained using fixed solution s of both MRSA and E. faecalis w e further inve stigated whether the enriched pools generated from fixed cells could also bind to live MRSA cells ( The selection was performed on fixed cells rather than live cells for safety reasons since MRSA is a biosafety level II hazard) In order to verify whether methanol had an adverse effect on the binding of the enriched pools, we compared the binding of fixed cells with that of live cells [Figure 2 5 ] As can be observed in Figure 2 5 the binding was maintained when using live cells, demonstrating l ittle perm anent adverse effect o n the structure of the membrane proteins of the bacteria. After successful enrichment, selection pools 15 and 17 were chosen and prepared for sequencing. Pool 15 represents the point at which enrichment started a plateau observable by flow cytometry, and pool 17 is the end of the plateau. Sequencing was performed with the Ion Torrent TM sequencing platform using a different MID per pool. MIDs, or multiplex identifiers adaptors, are added as a tail to the primerof the sequences by PCR am plification. This technique allowed the identification of the pool analyzed once the detail of the sequences was generated. In our case 2 pools were analyzed (pool 15 and 17) and 600,000 sequences were identified In analyzing the data, the 40 nt random r egions were aligned using the MAFTT alignment program. The alignment generated several different homologous families, and representative sequences were identified using the MAFTT and mfold oligo analyzer software programs. Putative DNA aptamers were then s ynthesized, labeled

PAGE 54

54 with FAM, purified by HPLC and quantified. Binding assays were performed for each sequence on MRSA cells and Enterococcus faecalis cells to determine the relevant aptamer sequences. Initially, we chose all candidates showing observable binding to the target MRSA in comparison with the unselected library as a control. Positive sequences were further screened with Enterococcus faecalis to select those aptamers showing specific binding to MRSA All flow cytometry data were obtained with u nlabeled cells and random library (Library 0) as the negative control. As shown in Figure 2 6 four of those sequences showed specific binding to MRS A D etail s about the sequence s of the aptamers generated against MRSA are listed in Table 2 4 with their c orresponding percentage in the overall pool sequenced It is interesting to note that even though the initial random library contained a 76mer s the aptamers generated varied slightly in length most probably due to some modifications during the amplifica tion pr ocess such as loss or substitution of nucleotides During the sequencing analysis, one tends to select for the more abundant sequences. Based o n the results shown in Table 2 4 it is interesting to note that e ven though it is the most obvious strate gy, the aptamer structure itself is just as meaningful based on its binding properties. This is demonstrated with DTMRSA4 which represents only 0.32 % of the total sequences, yet shows similar binding affinity as DTMRSA2, which is the most abundant aptame r sequence. The dissociation constant, usually denoted Kd, is used as an indicator of the affinity of a biomolecular interaction (smaller Kd indicates higher affinity) In our case, we are interested in knowing the affinity between the aptamer and its tar geted

PAGE 55

55 bacterium i.e. how tightly an aptamer binds to its apt amer target. The dissociation constants were obtained by measuring the aptamer target binding at 4C with increasing concentration s of the aptamer, to produce a saturation binding curve as shown in Figure 2 7 After the curve was obtained, the SigmaPlot software was used to obtain the value of the apparent dissociation constant Kd Based on the Kd values obtained Table 2 5 we believe that these affinities are sufficient for MRSA detection assa ys. Indeed, a pparent dissociation constants have been studied for aptamers chosen by cell SELEX on other bacteria 99,100 and values typically ranged between 30 and 250 nM, similar to those observed here. Conclusion Methicillin resistant Staphylococcus aureus is a bacterium that is resistant to many antibiotics. In the community, most MRSA infections are found to be skin infections. In medical facilities, MRSA infections cause bloodstream life threatening infections, surgical site infections and pneumonia Finding new means to fight against those infections is an emergency. This study demonstrat ed the possibil i ty of using the SELEX technique on fi xed bacteria cells to develop aptamers binding to MRSA with the same bind ing results on live bacteria l cells. Four aptamers were generated after 17 rounds of selection to recogni ze the bacteria l membrane with Kd constants varying between 9 0 and 200 nM. Since the smaller the Kd the tighter the binding, DTMRSA4 is the aptamer sh ow ing the best bindi ng properties with a Kd of 95 nM The ab ility to selectively bind to whole cells presents a potential clinical use of the selected aptamers as nanocarriers for the identification of antibiotic re sistant cell lines in patients. The successful development of an assay that can differentiate the resistance of

PAGE 56

56 S taphylococcus aureus colonies could facilitate the search for a more effective treatment and management of the disease Finally, research development based on aptamers would offer a cheaper alternative to the use of antibodies and would offer larger possibilities of chemical modifications within the aptamers.

PAGE 57

57 Figure 2 1. ABI 3400 DNA Synthesizer. A B Figure 2 2. Example of PCR op timization and gel analysis after Round 5 of selection. A) Optimized PCR cycles conditions, here 24 PCR rounds are used B) Gel electrophoresis analysis: L : 25 bp ladder; 14 24 : rounds analyzed ; and C: negative control.

PAGE 58

58 A B Figure 2 3 Growth curves of the bacteria used in the selection A) MRSA 43300 strain B) E. faecalis clinical strain.

PAGE 59

59 A B Figure 2 4. Flow cytometry analysis near the end of the selection. A) Targeted cell line MRSA B) Counter cell line Enterococcus faecalis A B Figure 2 5. Comparison of the binding results of Libra ry 15. A) On fixed MRSA cells, B) On live MRSA cells. Accepted to the World Journal of Translational Medicine, written by Turek D., Van Simaeys D., Johnson J., Ocsoy I., Tan W. for future publication

PAGE 60

60 A B

PAGE 61

61 C D Figure 2 6. Flow cytometry histograms of relevant aptamer candidates for MRSA A) Aptamer DTMRSA1, B) Aptamer DTMRSA2, C) Aptamer DTMRSA3 and D) Aptamer DTMRSA4. Accepted to the World Journal of Translational Medicine, written by Turek D., Van Simaeys D., Johnson J., Ocsoy I., Tan W., for future publication.

PAGE 62

62 Figure 2 7. SigmaPlot b inding curve of the aptamer DTMRSA4 used for the Kd value determination. Accepted to the World Journal of Translational Medicine, written by Turek D., Van Simaeys D., Johnson J., Ocsoy I., Tan W., for future publicat ion.

PAGE 63

63 Table 2 1. Preparation of the PCR tubes for the optimization of PCR conditions. Random Library PCR Tubes Control PCR Tubes 33.35 L DNase free water 5 L 10X PCR Buffer 4 L dNTP (2.5 mM) 2.5 L Primers (10 M) 0.15 L Taq polymerase 5 L Random Li brary 33.35 L DNase free water 5 L 10X PCR Buffer 4 L dNTP (2.5 mM) 2.5 L Primers (10 M) 0.15 L Taq polymerase 5 L DNase free water Table 2 2. Number of bacteria cells used for each round of selection and incubation time s Cell line Number of cel ls Incubation time MRSA 43300 10 8 30 min Enterococcus faecalis 0.5 x 10 8 1 hour Table 2 3. Summary of progression of MRSA selection. Rounds Negative selection round Number of washes, time, volume of WB PCR amplification cycles Volume of eluted DNA at 250 nM 1 No 2, 2 min, 2 L 22 L 2 Yes 2, 30 s, 300 L 28 L 3 Yes 3, 30 s, 300 L 20 L 4 Yes 3, 2 min, 1000 L 20 L 5 Yes 3, 2 min, 1000 L 24 L 6 Yes 3, 3 min, 1000 L 22 L 7 Yes 3, 3 min, 1000 L 22 L 8 Yes 3, 3 min, 10 00 L 12 L 9 Yes 3, 3 min, 1000 L 22 L 10 Yes 3, 3 min, 1000 L 20 L 11 No 3, 3 min, 1000 L 12 L 12 Yes 3, 3 min, 1000 L 18 L 13 Yes 3, 3 min, 1000 L 16 L 14 Yes 3, 3 min, 1000 L 18 L 15 Yes 3, 3 min, 1000 L 16 L 16 Yes 3, 3 min, 1000 L 16 L 17 Yes 3, 3 min, 1000 L 16 L

PAGE 64

64 Table 2 4. Quantitative representation of the different homologous families and MRSA aptamer sequences. Accepted to the World Journal of Translational M edicine, written by Turek D., Van Simaeys D., Johnson J., Ocsoy I., Tan W., for future publication. Name of the aptamer Percent of total sequences Sequence DTMRSA1 2.57 % ATCCAGACGTGACGCAGC (N) 38 TGGACACGGTGGCTTAGTA (N) 38 =ATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCT GTG DTMRSA2 33.74 % ATCCAGAGTGACGCAGCA (N) 36 TGGACACGGTGGCTTA (N) 36 =CGACACGTTAGGTTGGTTAGGTTGGTTAGTTTCTTG DTMRSA3 10.05 % ATCCAGAGTGACGCAGCA (N) 40 TGGACACGGTGGCTTAGTA (N) 40 =GTAGATGGTTTGGTTGGTGTGGTTTCCTACTGATGTTGGG DTMRSA4 0.32 % ATCCAGAGTGACGCAGCA (N) 39 TGTGGACACGGTGGCTTA (N) 39 =TTATGGGGTGTGGTGGGGGGTTAATGCGTTGGTTATCCG Table 2 5. Apparent dissociation constants (Kd) of the four aptamers recognizing MRSA bacteria. Accepted to the World Journal of Translational Medicine, written by Turek D., Van Sima eys D., Johnson J., Ocsoy I., Tan W., for future publication. Name of the aptamer Kd (nM) DTMRSA1 1.6 0.5 x 10 2 DTMRSA2 2.0 0.6 x 10 2 DTMRSA3 1.3 0.5 x 10 2 DTMRSA4 9.5 2 x 10 1

PAGE 65

65 CHAPTER 3 CLINICAL SAMPLE RECOGNITION BY MRSA APTAMERS AND VIS UALIZ ATION OF THE BACTERIA APTAMER BINDING Introduction Staphylococcus aureus has always been a stumbling block f or anti microbial chemotherapy and has survived all the therapeutic reagents that have been develo ped in the past 50 years. How this bacteriu m is able to develop the expression of a number of resistance and/or virulence determinants has been a major concern. The latest estimate s of the occurrence MRSA are staggering, rising to epidemic proportions in hospitals where, by an estimate provided by the European Antimicrobial Resistance Surveillance System, 40 60 % of all infections were caused by S. aureus in the U.S. and UK 14,101 The erosion of the effectivenes of lactam antibiotics since their fi rst use i s particularly worrisome, and t he ability of the MRSA membrane to structurally change through time in order to survive is a characteristic that increases its lethality and decreases its controllability 9,97 Consequently, the binding ability of t he four aptamers generated against MRSA 43300 was compared in the context of different clinical MRSA strains, as well as clinical Staphylococcus aureus and Enterococcus faecalis strains Those aptamers were also coupled with gold nanoparticles (Au NP) probes and used for visualizat ion by transmission electron microscopy ( TEM ) The ability of MRSA bacteria to change over time in order to survive and counter all medications develop ed to eradicate it is highlight ed in the d iscussion of this chapter. Materials and M ethods Instrumentatio n, Reagents and B uffers Bacteria l culture in broth was performed using the Forma Orbital Shaker Hepa filter from Thermo Electron Corporation. Centrifugations were run in either the

PAGE 66

66 Eppendorf Centrifuge 5810R 15 amp version or the Eppendorf Centrifuge 54 17R. DNA concentrations and OD600 were determined using a Biorad Smart Spec Plus spectrometer. Aptamer binding was monitored by flow cytometry analysis using a FACScan cytometer (BD Immunocytometry Systems). e (PB S) was u sed to prepare a 90:10 H 2 O: PBS washing buffer and the binding buffer (4.5 g/L glucose, 5 mL MgCl 2 1.0 g/L bovine serum albumin and 100 mg/L tRNA). Bacteria Strains and G rowth For all binding tests, bacteria were used in their live state. Clinical MRSA b acteria were kindly provided Institute (EPI) at UF The bacteria will be called MRSA 2, MRSA 4, MRSA 6 and MRSA 7 in this document. Clinical Staphylococcus aureus and Enterococcus faecalis were kind ly provided by Dr Judith Johnson from the Emerging Pathogens Institute (EPI) at UF. They will be called S. aureus 164 S. aureus 165, S. aureus 16 6 and E. faecalis 43, E. faecalis 44, E. faecalis 45. All clinical samples came from patie nts from Shands Hosp ital at UF. A n equimolar mixture of overnight culture and 2 3h culture of those bacteria strains were prepared to make sure all virulence gene s were expressed during the bindin g. Binding Studies using Flow C ytometry All binding assays of this study were mo nitored by flow cytometry on the FACScan flow cytometer (B ecton D ickinson Immunocytometry Systems) [Figure 3 1] In this technique, a nalyses are performed by passing thousand s of cells per second through a laser beam and capturing the light that emerges fr om each cell as it passes Particles between 0.5 and 40 m can be detected using three different fluorescence channels or

PAGE 67

67 wavelengths: 525 nm (FL1) 575 nm (FL2) and 620 nm (FL3) S pecific data such as cell size, complexity and health can be detected and analyzed by the accompanying software. Cells are hydrodynamically focused by using a sheath solution that compresses the stream of cells to roughly one cell in diameter [Figure 3 2 A ] Since the aptamers synthesized carry a fluorophore (FITC or Biotin fut her bound to PE cy 5.5), the greater the number of cells bound to aptamers after incubation, the higher the detector output All clinical cell lines were incubated with 250 nM aptamers at 4C for 30 min and washed twice with 10 % PBS solution before flow analysis. The more shifted to the right the fluorescence histogramm the more aptamer s are binding to the cell. The software FlowJo was used to process flow cytometry data and translated into histogramms. Aptamer Gold Nanoparticle Coupling R eaction Aptame rs DTMRSA1, DTMRSA2, DTMRSA3 and DTMRSA4 were synthesiz ed with a 5 thiol modification in our laboratory u sin g the ABI 3400 Synthesizer Ismail Ocsoy from our nanoparticle subdivision research group, provided the gold nanoparticles (Au NP) for this experi ment E ach MRSA aptamers ( final concentration ) was diluted and incubated with 1 mL of Au NP (7.2 nM) PBS buffer (pH 7.5) was added to the AuNP aptamer solution and incubated for another 12 hours. T he conjugate AuNP aptamer was purified by rinsing with PBS and centrifuging at 9600 g for 10 min. This process was repeated twice The final product was dispersed in DI water and stored at 4C prior being used for binding assays in the TEM visualization study.

PAGE 68

68 TEM V isualiza tion of MRSA A ptamer s via Gold N anoparticles MRSA bacteria were dispersed in 1 mL of PBS (pH 7.5) after methanol fixation and concentrations of the bacteria in their stock solution were determined by measuring the absorbance at 600 nm (1 OD600= 10 8 cells/m L). MRSA cells (10 7 ) from the stock solution Aptamer AuNP conjugates (7.2 nM/mL) and i ncubated for one hour with gent le shaking (130 rpm) at room temperature. At the end of the incubation, unbound nanoparticles were removed with w ater (300 by repeated centrifugat ion (3,000 rpm, 8 min, 3 times). After analysis liquot s of the nanoparticle conjugated bacteria were allowed to settle on the grid for 20 s and were then blotted using a filter paper (Wha tman #4), undistur bing the system. The grids were stained with 1 % uranyl acetate for 30 s to provide contrast for the cell membrane. TEM a ssays were performed after incubation s of cells only, AuNPs only, sgc8 AuNPs only (sgc8 is a random aptamer) and DTMRSA AuNP conjugate s. Note that the centrifugation speed applied to obtain these results was low (3,000 rpm), compared to the usual speed applied when using Au NPs (10,000 rpm). This made it easier to observe the NPs up on target binding since they were collected with the cell pellet, whereas nonbinding NPs observed in the control tend ed to remain in the discarded supernatant. Results and D iscussion Aptamer Binding Assays using Clinical Bacteria S trains After the selection was performed on MRSA bacteria cells, it seemed relevan t and interesting to check the binding of the four aptamers generated on clinical strains. Staphylococcus aureus infection being a very common nosocomial disease 101 we were able to obtain those clinical samples in sito with Shands Hospital Gainesville It was

PAGE 69

69 decided based on the clinical samples obtained to verify the recognition of the aptamers on four strains of MRSA three strains of S. aureus and three strains of E. faecalis bacteria [Figure 3 3 A, B and C ] Methicillin resistant Staphylococcus aureus ( MRSA ), Staphylococcus aureus ( SA or S. aureus ) and Enterococcus aureus ( E. faecalis ) are all gram positive bacteria. Based on their morphological similarit ies, common binding can be expected by the commonality of proteins a mong the strains, whereas other proteins are more spe cific to each type of bacterium A summary of the binding study is presented in the following ta ble [Table 3 1]. T he selected aptamers bound to all clinical MRSA strains tested, suggesting that the proteins targeted by those apt a mers are common for the different MRSA strains. DTMRSA1 and DTMRSA3 show the best specificity and therefore appear to be th e best candidates for MRSA treatment inves tigation, DTMRSA1 being the better one of the two, while DTMRSA2 and DTMRSA4 bind to all three types of bacteria. Transmis sion Electron Microscopy (TEM) A nalysis The four aptamers DTMRSA1 to DTMRSA 4 collectively r epresent a powerful tool to study the membrane structure of MRSA as well as to develop potential treatment modalities to combat this pathogen. As an empirical example of such use, we performed a study to visualize the binding sites of MRSA aptamers on the bacteria l external membrane. T o accomplish this, MRSA aptamers were conjugated to gold nanoparticles (AuNPs) for visualization of target binding via transmission electron microscopy (TEM) [Figure 3 4]. thiol modified, t o the gold nanoparticles was possible because thiols efficiently bind to gold surfaces 102

PAGE 70

70 Although f low cytometry is one of the best tools to measure the abundance of a membrane protein on cells 103 t he introduction of a nanoparticle aptamer conjugate detectable by TEM instead of a dye could be a valuable adjunct to complement the information obtained from the expression of aptamer targets on the bacteria. This technique allows the visualization of both the binding site of aptamers upon target binding and the structure of the cell wall 104 106 No binding between MRSA and bare gold or a random aptamer (Sgc8) conjugated to gold nanoparticles was observed. However DTMRSA2 AuNP conjugates were attached to the surface of MRSA as detected by TEM. With this successful visualization of the aptamers on MRSA cells, we showed that the adduction of nanoparticles on the aptamers did n ot change their binding properties Since nanoparticles have unique properties of their own 107,108 we believe this approach can be further extended, depending on the choice of nanoparticles to study the morphology of the bacteria, as well as detect and/or eradicate them MRSA Aptamer Binding after Time and Troubleshooting T ests Approximately one year after the MRSA selection began (a few months after the aptamers were generated ) the use of those aptamers in biolog ical applications was to be studied. In that particular case, the intent of the study was to examine their sensitivity under a mixed population of bacteria F or that purpose, aptamer s were synthesize d with biotin modification. Nevertheless, when those aptamer s were tested with live MRSA cells using the PE cy 5.5 dye no binding was observed. Following that observation the following troubleshooting experiments and tests were performed: 1. Binding assays with the b iotin labeled aptamers were repeated. Results were the same: no binding was observed.

PAGE 71

71 2. The biotin labeled aptam ers were resynthesized and the aptamer binding w as tested by flow cytometry on live MRSA cells No binding was observed under those conditions. 3. The aptamer stock solution used during the selection was then checked. The flow histogram obtained from this study showed no binding either. 4. The same binding assays were performed on new cells from ATCC (same strain: 43300) and binding was not observed A fter obtaining these results, work by other researchers came to our attention. From those results, previous observations raised our attention. I n 2009, the group of Dr Ninsheng Shao at the Beijing Institute of Basic Medical Sciences, Beijing (China) genera ted aptamers against Staphylococcus aureus Figure 3 5 99 While working on the MRSA selection and to determine if Cao et al. had, indeed, previously develo ped viable aptamer candidates for the recognition of MRSA cells we tested their binding with our commercial strain. As shown in the flow data, those aptamers showed no binding with the resistant strain Figure 3 6 These results were interesting and some how surprising because one could assume that some proteins must be common to both the non resistant and the resistant Staphylococcus aureus and the chance of select ing aptamers binding to those common proteins is high. T hese observations made three years after publica tion of Staphylococcus aureus aptamer study alone with the results obtained in our MRSA selection, raised a serious question. C ould it be possible that the MRSA bacterium changes over time to the point that the bacterium loses the prot eins recognized by these aptamers ? While we will try to answer that question a bit further more troubleshooting binding assays were performed on MRSA and Staphylococcus aureus clinical strains: MRSA 2, MRSA 6, SA 164 and SA 165 For those test s new 250 nM

PAGE 72

72 aptamers were prepared; DTMRSA1 aptamer from our own selection was synthesized by the I ntegrated DNA Technologies (I DT ) company the largest supplier of customed nucleic acids, as well as APT SEB1 aptamer which was developed by DeGrasse 109 against the Staphylococcus aureus E nterotoxin B Figure 3 7 : GGTATTGAGGGTCGCATCCACTGGTCGTTGTTGTCTGTTGTCTGTTATG TTG selection against the Enterotoxin B was performed using the protein directly on a magnetic bead support in order t o control the target of the selection. Unfortunately, no binding assay of the aptamer APT SEB1 was performed on whole MRSA cells which means that binding to MR SA was not proven. The se results show that there is no clear binding with any of these aptamers. The aptamers developed by S. aureus show no binding on clinical S. aureus or MRSA Our aptamers selected against MRSA show no binding aft er time and APT SEB1 develop against the Enterotoxin B protein does not show binding on the whole cell either S. aureus or MRSA The main issue with the se results is that the intended positive control APT SEB1 which was recently selected, does not bind t o MRSA cells S ince the binding of this aptamer to whole cell s was not verified by DeGrasse, t here is no previous proof of success of such binding. In fact, one can assume tha t the folding of a protein bound to a magnetic bead may be different than the ter tiary structure of the same protein on the outer membrane of a cell. That difference in folding could modify the interaction and recognition of the aptamer to the protein targeted. After performing these experiments, we returned to our original question.

PAGE 73

73 Is it P ossible that Staphylococcus aureus Bacterium Changes over T im e to the Point that the B acterium L oses the P roteins R ecognized by the A ptamers ? The best way to answer that question would be to perform a comparison of the genome analysis of the commer cial MRSA cells from ATCC used to carry out the selection to the genome analysis of the same strain after lost of the binding properties. A f ully automated sequencing instrument became commercially available in 1987 (Applie d BioSystem, ABI 370). T he MRSA s train 43300 was clinically isolated in 1986, and at that time ATCC did not perform a genome analysis. Only the translation elongation fact or Tu (tuf) gene and partial CDS are available on the NCBI database (GenBank: AF298796) The scientific literature ho wever contain s considerable information on the history of the disease As any other bacterium S. aureus simple constitutive gene expression is strongly dependent upon the growth of the culture 110 For that reason, in this research, the bacte ria were always tested as a mixture of different growth s The emergence of resistant S. aureus strains occured in the early 1950s with the notorious penicillin resistant S. aureus known as phage type 80/81 111 In 1961 just one year after the launch of methicillin S. aureus was not eradicated and instead more resistan t clones appeared worldwide 112 In addition to the appeara nce of s trains resistant to all agents that had been developed to eradi cate this bacterium the hospital acquired (HA) MRSA evolved in to the community ac q uired (CA) MRSA few decades later. While the origins of major MRSA clones are still poorly understood, studie s showed that MRSAs were descended from a single ancestral S. aureus strain that acquired the gene mecA 113 Other MRSA strains are divergent, implying that mecA had

PAGE 74

74 been transferred between S. aureus lineages 114,115 New strains of MRS A are reported in the news and in the literature o n a regular basis around the world showing the ability of this superbug to be an extraordinarily adaptable pathogen 116 In our particular case, if the aptamers bound to a protein common to the different MRSA cells tested, a structural modification of the target could explain the loss of recogn ition by the aptamers from this study, as well as those selected by Cao et al. and by DeGrasse. Concl usion The clinical study of aptamer recognition showed that t he selected aptamers bound to all clinical MRSA strains tested, suggesting that the proteins t argeted by those apt a mers are common for the different MRSA strains. DTMRSA1 and DTMRSA3 show ed the best specificity, with DTMRSA1 being the be tter of the tw o, while DTMRSA2 and DTMRSA4 boun d to all three types of bacteria: MRSA Staphylococcus aureus and Enterococcus faecalis Further investigation on the apt amers showed that conjugation to gold nan oparticles did not affect the binding which was visualized by transmission electron microscopy. After time, the aptamers generated showed n o binding with the b acteria. The observed r esults and the evolution history of the S taphylococcus A ureus superbug suggest that the aptamers may have been specific to a common target and that the tested bacteria morphology changed over time. How these highly adaptable bacteria can orchestrate the expression of a variable number of resistance and virulence determinants is a major concern and still a mystery. The Staphylococcus aureus bacterium represent a paradigm in its ability to accomodate antibiotic resistance

PAGE 75

75 determinants a nd to produce an incredible panel of virulence determinants making these pathogens among the most infectious diseases in humans.

PAGE 76

76 Figure 3 1. Schematic of the flow cytometry instrumentation. Copyright 2013 Life Technologies Corporation. Used under pe rmission.

PAGE 77

77 A B Figure 3 2. Flow cytometry mechanism. A) Light scatter of the laser beam, B) Convers ion of the fluorescence intensity into voltage. Copyright 2013 Life Technologies Corporation. Used under permission.

PAGE 78

78 A

PAGE 79

79 B

PAGE 80

80 C Figure 3 3. Aptame r recognition monitored by flow cytometry. A) MRSA cells, B) S. aureus cells, C) E. faecalis cells.

PAGE 81

81 A B C D Figure 3 4. TEM visualization of MRSA bacteria with AuNPs. A) MRSA bacteria only, B) MRSA bacteria with bare AuNPs, C) MRSA bacteria with r andom aptamer coupled with AuNPs, and D) MRSA bacteria with DTMRSA2 coupled with AuNPs.

PAGE 82

82 Figure 3 5. Flow cytometry assay for the binding of aptamers with bacteria. The different color curves represent different strains of bacteria 2009 Cao X., Li S., Chen L., Ding H., Xu H., Huang Y., Li J., Liu N., Cao W., Zhu Y., Shen B. and Shao N. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non Commercial License

PAGE 83

83 Figure 3 6. Binding assays monitored by flow cytometry of the aptamers developed by MRSA bacteria ATCC 43300. In each graph, cells only are in black, random library is in red and the aptamer in the left over color.

PAGE 84

84 Figure 3 DTMRSA1 aptamer and APT SEB1 aptamers on clinical MRSA and S. aureus strains.

PAGE 85

85 Table 3 1. Relative binding of the selected aptamers to various clinical cell lines. R esults were obtained with the clinical strains of MRSA Staphylococcus aureus and Enterococcu s faecalis bacteria. ( ) no binding; (+) 0 25%; (++) 25 50%; (+++) 50 75%; (++++) 75 100%. Accepted to the World Journal of Translational Medicine, written by Turek D., Van Simaeys D., Johnson J., Ocsoy I., Tan W., for future publication. Clinical Strains DTMRSA1 DTMRSA2 DTMRSA3 DTMRSA4 MRSA 2 +++ ++++ +++ ++++ MRSA 4 +++ +++ +++ ++++ MRSA 6 ++++ ++++ +++ ++++ MRSA 7 +++ ++++ +++ ++++ S. aureus 164 ++++ + +++ S. aureus 165 ++++ + +++ S. aureus 166 ++++ + +++ E. faecalis 43 ++++ + +++ E. fae calis 44 ++++ + ++ E. faecalis 45 ++++ + +++ Table 3 2. Aptamer sequences developped by Cao et al. 99 Name of the Aptamer Detail of the Sequence SA2 0 GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT SA23 GGGCTGGCCAGATCAGACCCCGGATGATCATCCTTGTGAGAACCA SA31 TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA SA34 CACAGTCACTCAGACGGCCGCTATTGTTGCCAGATTGCCTTTGGC SA43 TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT 2009 Cao X., Li S., Chen L., Ding H., Xu H., Huang Y., Li J., Liu N., Cao W., Zhu Y., Shen B. and Shao N. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non Commercial License

PAGE 86

86 CHAPTER 4 MOUSE LIVER CELL SELECTION TARGETING GLYPICAN 3 Introduction The li ver is the largest internal organ and the largest human gland. It is a complex, multipu rpose, indispensable organ. Its major role is to deal with nutrient product of food digestion and detoxifying harmful s ubstances absorbed via the intestine 117 In part because liver cancer is diagnosed at a late age, 62 years old o n average the survival rate is extremel y low 118 One of the reasons is that in most cases, liver cancers are primary cancers whic h means that they originate fr om the liver itself instead of metastasis. Moreover, h epatocellular carcinoma (HCC), which is the most common cancer, very frequently occurs in conjuction with chronic liver disease s suc h as hepatitis B or C, and cirrhosis 119 Primary carcinoma of the liver, incl uding HCC, is the third most common cancer related death, with more than 500,000 new cases diagnosed per year in the world 120 Glypican 3 (GPC3) is a protein upregulated in most hepatocellular carcinoma e (HCC) GPC3 a membran e associated heparan sulfate proteoglycan, shows a great pote n tial in the early detection of HCC since they are absent in healthy liver tissue. In previous studies targeting three types of cancers, hepatocellular carcinoma (HCC), intrahepati c cholangiocarcinoma and combined hepacellular (ICC) and cholangiocarcinoma (CHC), results of GPC3 expression in liver suggested that GPC3 is a biomarker that is sensitiv e and specific to well different iated HCC 47,12 1 Improved s ensitivity and specificity toward malignanc y are observed w hen additional markers are used for detection ; alpha fetoprotein (AFP) is the most commonly used marker for this purpose 122

PAGE 87

87 In this chapter, we aimed to develop aptamer s specific to Glypican 3 using the cell SELEX technique. Selection s on whole cells do not usually permit us to know the target becaus e the entire membrane of the cell is targeted 75 In this study, we used human GPC3 transfected cells to have an over expression of the protein targeted. Resu lts of th e selection and investigation on the aptamer candidates are presented in this study. Materials and M ethods Instrumentation, Reagents and B uffers buffer (4.5 g/L glucose and 5 mL MgCl2 at 1M) and binding buffer (4.5 g/L glucose, 5 mL MgCl2, 1.0 g/L bovine serum albumin and 100 mg/L tRNA). Gel electrophoresis was prepared and run using TBE buffer: 1 X Tris/Borate/EDTA (TBE) buffer (Fisher Scientific Inc., Pittsburg, PA) The t rypsin EDTA 1X used for cell digestion during cell culture came from Cellgro and t he non enzymatic cell dissociation solution (1X) Bioreagent from Sigma was used for cell digestion before any flow cytometry experiments. All oligonucleotides were synthesize d by standard phosphoroamidite chemistry using a 3400 DNA synthesizer (Applied Biosystems) and were purified by reversed phase HPLC (Varian Prostar). All PCR mixtures were prepared using 50 mM KCl, 10 mM Tris HCl at pH 8.3, 2.0 mM MgCl 2 2.5 mM dNTPs, 0.5 mM of each primers (Biotin and FITC) and 5 units/mL of Hot Start Taq DNA polymerase (TaKaRa). PCR was run on a Biorad T h ermocycler Electrophoresis gels were cast and run on a Biorad minisub cell GT and read on a GE Image Quant 400.

PAGE 88

88 Monitoring of the sele ction and of the aptamers candidates binding on the targeted cells was performed by flow cytometry using a FACScan cytometer (BD Immunocytometry Systems). Experiments using the flow sorting technique were carried out using the FACSAria IIU Special Order S ystem Cell Sorter (BD Biosciences). Cell Lines and Cell C ulture C onditions The wild mouse liver cancer cell line IMEA was obtained from the Department of Pathology at the University of Florida. Since the pr otein Glypican 3 was targeted, t he positive cell l ine was obtained by modification of the IMEA wild cell line ; this way the only difference between the positive and the negative cell line was the presence of the glypican 3 protein The same research group from the Department of Pathology transfected the I MEA wild canc er cell line wi th the human glypican 3 (hGPC3) using a 3.1 (Invitrogen). DMEM media was used with the addition of 10% FBS and 5% penicillin streptavidin antibiotic for the wild IMEA cell line. For the modified cell line hGPC3 IM EA, and i n order to maintain the transfected modification throughout the cell culture, the DMEM media was supplemented by 250 mg/m L G418 antibiotic which blocks polypeptide synthesis by inhibiting the elongation step if the cell does not contain the resis tant gene All cells were cultured in 5 % CO 2 atmosphere humidified incubator. Cell SELEX Library and C onditions For this selection, a shorter library was designed in comparison to the one used in the MRSA selection (Chapter 2). The main advantage of using a short library is that it is cheaper to synthesize. The design for such library has to be such that the length is important enough to generate different conformation s throughout the random part for cell recognition purposes but short enough to make it si gnificantly cheaper to

PAGE 89

89 sy nthesize. The library used was the following CGA CAC CTC CAG ACG C (N) 25 T CGT CCA CTG TGC CTC the reverse primer with biotin in order to monitor the selection through fl ow cytometry and obtain separation of dsDNA from the PCR into ssDNA using streptavidin columns. The s election was run using a typical SELEX technique up to 19 rounds 75 Each dish of cells was washed with both 1000 mL PBS and WB before use and incubations with each pool were done at 4C for 30 min with the positive cell line and 1 h with the negative cell line while the washing stringency was increas e througho ut the selection. Both incubation s of each DNA pool were done in plate directly to avoid disturb ing or modify ing the morphology of the cell by digesting them using non enzymatic buffer. After the temperature optimization of the random library, PCR amplific ations were carried out with cycles of 95C for 30 s, 56.7 C for 30 s and 72C for 30 s, and finalized by an extension step of 3 min at 72C. The selection progression was monitored by flow cytometry to observe the enrichment. Once the selection was over, final pools were submitted for Ion Torrent sequencing and aligned for analysis using MAFFT software. Potential Aptamers Binding A ssays The analyses of the Ion Torrent data led to a few sequence candidates. Those sequences were synthesized using the 3400 D NA Synthesizer (BD) and labeled with end. Binding ass ays were performed by incubating 250 nM of the sequence with BB and 300,000 cells at 4C for 30 min, followed by 2 washes with WB, and another incubation at 4C for 10 min with binding buffer containing the dye streptavidin PE Cy5.5 for the labeling of the cells. After washing the cells twice with WB, the binding of the sequences was monitored through flow cytometry at the appropriate

PAGE 90

90 reading channel, using cells on l y and random library biotin labeled as negative controls. The fluorescence was determined by counting 30,000 events. Fluorescence Activated Cell S orting (FACS) The last rounds of the selection (20 to 22 rounds) were done using the cell sorting technique FACS. This technique a llows obtaining cell subsets separated from the entire pool of cells. In our case, we were interested in collecting cells from the incubated positive cell line that showed a higher shift than the cell s only used as a control. 1 million cells were used for incubation at 4C with 250 nM library and 60,000 positive cells were isolated on each round. The cell sorting technique is performed in a system where cells are ejected into air in a stream of sheath fluid. While the stream breaks into droplets, the dista nce between the orifice that the stream begins and the break off into droplet depends on the orifice size, the pressure of the sheath fluid, the temperature and the viscosity of the fluid. The break up of the stream is stabilized by stationary wave of vibr ation of known frequency and amplitude applied to the stream. As soon as the cells are ejected, they pass through one or more laser beams and information about the cell is gathered. That critical step is when the cells can be independently charged and will carry a positive charge, a negative charge or remain uncharged. The sorting can then be done using charged plates where charged drops are attracted to the plate of opposite polarity and deflected into collection tubes 123 Figure 4 1 Results and D iscussion Cell SELEX on IMEA C ells As mentioned in the previous section, the selection was run on mouse liver cancer cells with the aim of getting aptamers specific to the glypican 3 protein. Indeed, plasmid

PAGE 91

91 modified IMEA cells were used t o have expression of GPC3 which is not present on the wild IMEA cell line. Human glypican 3 were over expressed on the positive cell line (hGPC3 IMEA) and the wild IMEA cell line was used for negative selection. Tr a n sfected cells contained both the GPC3 g ene and the neomycin resistance gene (neo) to be resistant to G418 antibiotic. By culturing positive cells with addition of G418 antibiotic in the media, we ensured that hGPC3 IMEA cells only were surviving. At the beginning of the selection, 20 pmol of li brary was used. The random library end. The selection showed a quick enrichment, starting from round 5 but at that stage, the pools also showed binding to the negative cells Without any change of conditions, t he negative binding seemed to reduce round after round Figure 4 2 Nevertheless, reduction of the negative binding seemed to reach a plateau after 10 rounds with no full disappearance In order to get better res ults, it was decided to perform ch selec tion at R ound 11 which lies in the pool to be incubated twice with the negative cell line, once before and once after the incubation with the positive cell line. This change of strategy showed successful results and specific enrichment was clear ly observed after 19 rounds of selection Figure 4 3 The detailed data of the selection up to round 19 is presented in T able 4.1. out. At the end of 19 rounds, an enrichm ent plateau was reached and any negative binding had disappeared. Sequencing and Binding Assays The cancer cell line HuH7 is a human cell line that naturally carries the protein glypican 3 124 ; on the contrary, HCO 2 is a cancer human cell line that does not carry the

PAGE 92

92 protein glypican 3 ( cell line developed by Dr Chen Liu at the University of Florida) Since the selection was performed on a mouse cell line transfected with the human glypican 3 gene, it was important to check the binding of the last pool on a human cell line in this case HuH7 that expresses the GPC3 gene and on a human cell line, in this case HCO 2 that does not The l ast pool of the s election showed a shift on HuH7 and no shift on HCO 2 Figure 4 4 Those results confirm ed the specificity of pool 19 on binding to a cell line with high expression of GPC3 and by extrapolation, a binding to the glypican 3 protein. Based o n those results, the last two pools generated, pool s 18 and 19 which are the pools with the most enrichment, were sent for sequencing analysis with the Ion Torrent technology provided at CGRC, University of Florida. In order to ensure sample identifica ti on following the sequencing, Multiplex Identifier (MID) adaptor s were used, MID1 for library 18 and MID2 for library 19 Table 4 2 125 After the sequencing, the primer regions and MIDs of each sequence were removed and the random region of the library was aligned to group the sequences into homologous families Figure 4 5 As a point of reference for l ater results MID2 row data gave us 1.2 million sequences. After analyzing the alig n ments obtained 6 sequences retained our attention and were sy nthesized for further screening Table 4 3 and Figure 4 6 As it can be observed in Figure 4 6, binding as say s of those sequences showed i ncon sistencies in the results obtained either with the positive or the negative cell lines. Besides inconsistencies in the results, it can be noted that even when binding was observed on the positive cell line, that binding sho wed no shift increase compared to the binding of the last pool of the selection ; an increase in the shift is usually expected when

PAGE 93

93 sequences are isolated and tested Out of those results, we concluded that those sequences were not good aptamer candidates a nd carried further analysis of the sequencing row data. The new sequences representing homologous fam ilies are presented in Table 4 4 Those results were compared to the ones fro m the former analysis, Table 4 3 and it was determined that the number of se quences obtained were in the same range or lower than in the 1 st analysis. The enrichment observed at the end of the selection was concluded to be too low to generate aptamer candidates for the glypican 3 protein. We decided to continue the selection fu rther with a flow sorter in order to get more enrichment of the pool and be able to generate and identify bigger families The main advantage of using a flow sorter is that it allowed us to isolate cells that showed a different binding in comparison to the random library Figure 4 7 By this means, only a reduced amount of cells is isolated, but the pool of sequences obtained at the end of each round is more specific to the target cell membrane. As it can be seen in Figure 4 7A, the threshold was set at th e end of the shift of the random library. The cells isolated from the pool were the ones over the th re shold and the only ones extracted, amplified and used in ord e r to get the DNA pool for the next round. Table 4 5 shows the details of the three rounds of selection done using the flow sorter. Since the flow sorter allowed us to control the threshold, no incubation of the pool with the negative cells was necessary. Indeed, only sequences showing a stronger binding than the random library were isolated Afte r three more rounds perfor med with the flow cell sorter, binding assays were carried out to check on the enrichment of the pools Figure 4 8 The binding results of the pools obtained using the flow sorter were

PAGE 94

94 compared to the last pool of the selection, Library 19, and no binding was observed. During the performance of a selection, it is not surprising to observe a shift back of the pools when conditions are modified, but the shift is usually recovered within two rounds This return did not occur in our c ase. The q uality of the cells was questio ned at that point and a mycoplasma testing was run. Both IMEA hGPC3 and IMEA cultural media showed a positive result to mycoplasma. M ycoplasma, from the Greek mykes (fungus) and plasma (formed) are a genus of bact eria that lack cell wall. They are common contaminants in cell culture and are not detected with a conventional microscope. Mycoplasmal cell culture contamination may induce cellular changes, including chromosome aberrations, modification s in metabolism an d cell gro wth. Any of those changes could impact the success of a cell selection and could explain diff ic ulties in both generating aptamers against GPC3 and get ting consistent results. Conclusion The cell SELEX technique had been used for a couple of decad e s to generate aptamers against cancer cells. While this technique is able to generate aptamers specific to a particular cell line, the main disadvantage of the cell selection lies on the fact that the target recognized by the aptamer remains unknown by th e end of the selection. In this particular selection, we countered that disadvantage by using an original mouse cell line, the IMEA wild cell line, as the counter cell line, and that same cell line modified by transfection of the human glypican 3 gene, the hGPC3 IMEA cell line, in order to have expression of the targeted protein, Glypican 3. In this chapter, the cell selection against liver cancer were performed in the conditions optimized in the SELEX protocol developed by our research laboratory 75 After 19 rounds of selection,

PAGE 95

95 too many families of sequences were obtained, with none large enough to be able to generate aptamers Results were sometimes i nconsis tent and changes of the protocol by the use of a flow sorter did not solve the problem. The cells used were found to be positive to mycoplasma testing. Contamination of the cells by mycoplasma might have had an impact on the growth and membrane structure o f the cells which could explain the results observed. Challenges in selecting aptamers against liver cancer cells were not isolated; attem pts to do so with other liver cell lines by our research laboratory failed in the past year Since glypican 3 shows g reat potenti al as a hepatocarcinoma marker; performing a protein selection, using magnetic beads for instance, could be another option to develop aptamer against this protein.

PAGE 96

96 Figure 4.1. Scheme of a generalized cell sorting flow cytometer. Particles a re introduced into a column of pressurized sheath fluid, emerge from the nozzle and pass through one or more laser beams. At this point, the cytometer gather s information about the fluorescence characteristic of the cell. The stream is charged when the cel l breaks into a drop and drops are separated based on their charge. Image provided courtesy of Abcam Inc. Image Copyright 2013 Abcam.

PAGE 97

97 A B Figure 4 2. Enrichment observed for pools 5 to 7 on both p ositive and negative cell lines. A) hGPC3 IMEA and B) W ild IMEA respectively. A decrease of negative binding is observed. A B Figure 4 3. Specific enrichment observed through flow cytometry at the end of the selection. A) Using the hGPC3 IMEA cell line and B) Using the wild IMEA cell line.

PAGE 98

98 A B Figure 4 4. Binding observed from the selection pool 19; cells only and random library (Library 0) are used as controls. A) On the HuH7 cell line and B) On the HCO 2 cell line. Figure 4 5. Example of sequence align ment using library 19 (MID2).

PAGE 99

99 A B C Figur e 4 6. B inding assay in duplicate of 6 potential aptamer candi dates with flow cytometry using 3 cell lines. A) HuH7; B) hGPC3 IMEA and C) Wild IMEA.

PAGE 100

100 A B Figure 4 7. Example of theshold setting on the flow cell sorter for IMEA cells. A) Binding of rando m library and B) Binding of the selection pool. Figure 4 8. Binding assay of the pools obtained with the flow sorter in comparison with

PAGE 101

101 Table 4 1. Summary of progression of the IMEA cell selection. Rounds Negativ e round Number of washes, time, volume of WB PCR amplification cycles Volume of eluted DNA at 250 nM 1 No 22 2 Yes 22 3 Yes 19 4 Yes 22 5 Yes 2 24 6 Yes 18 7 Yes 24 8 Yes 21 9 Yes 19 10 Yes 1 9 11 Yes x 2 2 1 12 Yes x 2 17 13 Yes x 2 22 14 Yes 13 15 Yes x 2 19 16 Yes x 2 22 17 Yes x 2 15 18 Yes x 2 19 19 Yes x 2 18 Table 4 2. Ten common 10 base extended Multiplex Identifier (MID) used for sequencing. Mutiplex Identifier Name Sequence MID 1 MID 2 MID 3 MID 4 MID 5 MID 6 MID 7 MID 8 MID 10 MID 11 ACGAGTGCGT ACGCTCGACA AGACGCACTC AGCACTGTAG ATCAGACACG ATATCGCGAG CGTGTCTCTA TCTCTATGCG TCTCTATGCG TGATACGTCT

PAGE 102

102 Table 4 3 Potential aptamer sequences selected from Analysis 1 of the Ion Torrent data. Potential Aptamer Sequences Sequence Counting CACCTCAGCCGTGTACTCCTGCCGT CAGACCTCACACACTGCT GCATGGGCCCAGCACTCCCTTCGGT CAACCCGGCCCAGTTCCC AACACCGACACCTCCAGACGC CAAGGAGTGGCAGCATCTATTCA 705 828 500 2,526 3,406 292 Table 4 4 Potential aptamer sequences selected from Analysis 2 of the Ion Torrent data. Potential Aptamer Sequences Sequence Counting ACCACTGCTCGTTCCCGCCTGTCGT ACCCCAGCTTCGGGACTCCTGCCGT CACCTCAGCCGTGTACTCCTGCCGT CCCGGAAACACTCATTCTCC CAAGAGGAGGTGGCGCAAGCATTAT CAGAGGTGGCGCCGAAAGCATTTAT GAGCTCCGACACCTCCA CAGACCTCACACACTGCTCCGTCGT CGAGGTGGCGC CCAGCATATATTAT 616 486 756 560 753 436 596 914 426 Table 4 5 Summary of progression of the selection using the cell sorter. Rounds Negative round Number of washes, time, volume of WB PCR amplification cycles Volume of eluted DNA at 250 nM 20 No, cell sorting 26 21 No, cell sorting 23 22 No, cell sorting 24

PAGE 103

103 CHAPTER 5 THERMOACTIVATION OF GOLD NANOROD ON OVARIAN C ANCER Introduction Ovarian cancer is the ninth most common c ancer among wom en, accounting for 14,000 lethal cases annually in the United States 32 The ovarian clear cell adenocarcinoma (OCCA) subtype among others shows very few early symptoms and poor response to standard treatments 49,126 128 In the medical field, t he most common serum biomarker used for ovarian cancer diagnosis and prognosis is the cancer antigen 125 (CA 125). However, not all ovarian cancer s express that protein and the sensitivi ty of this test is only of 48 % 129 This hi gh proportion of false posit i ve results is due to th e fact that some conditions like pregnancy or cirrhosis elevate the level of CA125. During cancer treatment, chemotherapy and radiotherapy are known for showing a lot of side effects. For that reason, the development of therapy with the use of aptamers tha t are able to selectively bind to targeted cells may offer the possibility of better treatment. In addition, t he use of nanoparticles bound to aptamers presents two main advantages: th ey are easily synthesized and show low toxicity 94 Gold nanorods present absorption at the near infrared (NIR) range which make them good cand idate s for photothermal therapy. In this chapter, we used gold nanorods (AuNR) coated with aptamers that specifically recognize and internalize into ovarian cancer cells. Their cytotoxicity was studie d after thermoactivation with a NIR laser beam. Material s and Methods Instrumentation, Buffers and R eagents BS) was used to wa sh the cells during experiments and to make binding buffer ( addition of 4.5 g/L glucose, 5 mL MgCl 2 1.0

PAGE 104

104 g/L bovine serum albumin and 100 mg/L tRNA ) Cetyltrimetylammonium bro mide and tris (2 carboxyethyl) phosphine (TCEP) were obtained from Sigma Aldrich. Thiol terminated methoxypoly (ethylene glycol) (mPEG SH, M W = 5000) was purchased from Nanocs. Counting o f c ells was performed using a microscope Olympus IX70 (x10) and a hemacytometer Reichert, 0.1 mm Deep, Bright Line used in couple with a cell counter from Fisher Scientific. For c onfocal studies, reading s were performed o n Leica CTR 6500, objective x63 and f or MTS assays; readings were done on the Microplate reader VERSAmax. For UV measurements, we used the Cary Bio 300 UV spectrometer (Varian, Walnut Creek, CA). In the cytotoxicity section, NIR laser beaming was performed at the Human Toxicity Department at the University of Florida on a NIR COHERENT Quattro. Cell L ines and Cell Culture C onditions The ovarian clear cell adenocarcinoma TOV21G and the hepatocarcinoma cell line HuH7 were used for the experiments. For all those cells, DMEM media supplemented with 5% Penicillin streptavidin and 10% FBS was used during the culture and DMEM media with no supplemental reagent was used during experiment to avoid any cleavage of DNA All cells were cultured in 5% CO 2 atmosphere humidified incubator. Aptamer Synthesis an d P urification The aptamer TOV6 was previously selected by our research group against the ovarian cancer cell line TOV21G 54 The original aptamer TOV6 : ATC CAG AGT GAC GCA GCA CGG CAC TCA CTC TTT GTT AAG TGG TCT GCT TCT TAA CCT TCA TCG ACA CGG TGG CTT AN was synthesized with bo th N=FITC and N=TAMRA dyes; t he modified TOV6: 5' SS (OCH 2 CH 2 ) 12 ATC CAG AGT GAC GCA GCA CGG

PAGE 105

105 CAC TCA CTC TTT GTT AAG TGG TCT GCT TCT TA A CCT TCA TCG ACA CGG TGG CTT AN N= TAMRA ; and two libraries were used depen ding on the dye for negative control : ATC CAG AGT GAC GCA GCA (N) 40 TGG ACA CGG TGG CTT AGT (FITC) and ATC CAG AGT GAC GCA GCA (N) 40 TGG ACA CGG TGG CTT AGT (TMR) where N represents A, T, C or G. All single strain DNA oligomers were synthesi zed using the ABI 3400 DNA/RNA synthesizer (Applied Biosystem). Controlled pore glasses (CPG) were used on either end for modifications. Upon completion, all ssDNA oligomers were transfer r ed to glass vials for deprotection using AMA at 65C fo r 30 min. After cool down, the supernatant was transfer r ed to plastic tubes and a mixture of 250 L 3M NaCl and 6 mL ethanol was added. DNA precipitated at 20C for 20 min and tubes were centrifugated at 4000 rpm for 30 min at 4C. Purification of the DN A samples was completed by HPLC and further purification with a desalting column. Gold N anorod Apt amer Conjugate Gold nanoro ds were synthesized with the procedure described in Yasun et al. 130 TOV6 aptamers were then immobilized on the surface of the nanorods. In order to tether on the surface of the gold nanorods, TOV6 aptamers were first modified with a d isulfide fun ctional group o n the 5 terminal SS TOV6) and these disulfide groups were cleaved to thiol groups. In the cleavage process, 0.1 mM disulfide modified TOV6 aptamer was incubated with 5 mM TCEP in 50 mM Tris/HCl buffer at pH 7.5 for 1 h at room temperature Further pur ification was perform ed by eluting small portions of TCEP /Aptamer mixture through a NAP 5 desalting column. The final concentration of those portions was calculated from absorbance measu rements using a UV

PAGE 106

106 spectrometer. 100 L of 1 n M of AuNR solution was centrifuged at 14,000 rpm at 25 C for 3 min and the supernatant was discarded. The precipitate was re suspended in 100 L of 2 mM CTAB. Once those preparations were ready 0.1 nM of AuNR was incubated with SH TO V6 aptamers anf 0.1 mM thiol PEG (M w =5000) in DNA grade water at room temperature for 12 h followed by centrifugation at 14,000 rpm at 25 C for 5 min to remove the supernatant that contained the unbound aptamers and SH PEG. The precipitate was re suspende d in 100 L of DNA grade water. Both of the TOV6 FITC and TOV6 TMR conjugated AuNRs were prepared the same way. Binding Assays All binding assays performed in this study were monitored through flow cytometry on the BD Acuri C6 Flow Cytometer For each sample, 300, 000 cells were incubated with the solution to test for 30 min. Aptamers were tested at a concentration of 250 nM at 4C for 30 min, incubated cells were washed twice with 10% PBS and 20,000 c ells were monitored with the flow cytometer on channel FL1 since the dye used was FITC. The software FlowJo was used to analyze data obtained from the flow cytometry. Confocal Assays For confocal e xperiments, good adhesion of cells was ensured by incubating 4 0,000 cells overnight at 37C w ith the corresponding media in glass bottom petri dishes Different concentrations of the aptamer TOV6 coupled with the Tamra chromophore (TOV6 TMR) were prepared to observe internalization of the aptamer and the optimum concentration was used to prepare the gold nanorod aptamer conjug ate (AuNR TOV6 TMR) All preparations were diluted in media for a final volume of 300 L and incubated for 8 h at 37C. Then, cells were washed with 1mL PBS twice and

PAGE 107

107 binding buffer was added for the confocal reading to keep cell s alive Reading of results was perf ormed on the Leica CTR 6500 with the x63 objective. Cytotoxicity Assays and C ell Viability Determination Cytotoxicity assays were performed in three steps: (1) the incubation of the cells with different concentration of TOV6 AuNR FITC; (2) the NIR laser beaming at 808 nm for 10 min of those sol utions; and (3) the MTS reading of tho se solutions. After laser beaming, cells were transfe r red in a 96 well plate and incubated for 48 h at 37C. Then cells we re prepared for the MTS reading. After centrigugation at 1300 rpm for 3 min, 75% of the supe rnatant was removed and a premix ed solutio n of medium without FBS or PS (100 L) with MTS solution (20 L) was added and incubated for 40 min at 37C before reading. MTS assays are used to determine the percentage of cell viability with a colorimetric method MTS Promega kit solutions are made of a mixture of MTS (3 (4,5 dimethylthiazol 2 yl) 5 (3 carboxymethoxyphenyl) 2 (4 sulfophenyl) 2H tetrazolium) and an electron coupling reagent, PMS (phenazine methosulfate). If cells are metabolic ally active their dehydrogenase enzymes will convert the MTS into soluble formazan Figure 5 1 Formazan, that shows an absorbance at 490 nm, can then be measured and is directly proportional to the number of living cells in culture 131 Results and Discussion Conjugated Aptamer AuNR Binding Study The ovarian cancer had been previously studied in our group and several aptamers had been generated against the cancer ovarian cell line TOV21G 54 The aptamer TOV6 was chosen for further application in this chapter. We were interested in binding the aptamer to a gold nanorod that could further be thermoac tivated by a NIR laser beam and determine its cytotoxicity.

PAGE 108

108 In this project design, the aptamer TOV6 was modified upon synthesis on both terminals of the single strand DNA terminal was synthesized with a disulfide terminal was synth esize d with either FITC or TAMRA dye The disulfide bond was used to coat the gold nanorods with TOV6 aptamers and the FITC and TAMRA dyes were used for binding assays and confocal studies respectively. One of the advantage s that aptamers are known for is to be able t o be chemically modified without losing binding with their target. In order to check on that particular feature in our design, we performed a binding assay with the flow cytometer of the aptamer alone incubated with TOV21G cells and of the apt amer mounted onto the nanorod. As it can be seen on Figure 5 2, both aptamers and AuNR aptamers showed binding compared to the random library. Those same aptamers were incubated and tested on HuH7 cells, which are liver cancer cells, and showed no binding, which confirmed the specificity of the aptamers toward the cell line targeted TOV21G Figure 5 3 Internalization Study Depending on the target of the aptamer, some of them get to be internalized into the cell. Indeed, if the aptamer binds to a target th at is able to go under an endocytosis pathway, then the aptamer can become intracellular. Since the cell SELEX process does not allow us to k now the target, and know their properties, we investigated the internalization through confocal studies. TOV6 aptam ers with TAMRA dye were used for that study as well as TOV6 AuNR Figure 5 4 The confoc al reading was performed after an 8h incubation of the aptamer or aptamer AuNR with the cells to ensure that the nanorod had the time to be internalized. Results showe d that w h ether TOV6 or TOV6 AuNR is conjugated to the TOV21G cell line, both do internalize. That property opens a

PAGE 109

109 very interesting feature for the thermoactivation of the nanorod, since the heating will come from the inside of the cells. Thermoactivation of the Gold Nanorods and Cytotoxicity Assays Photothermal therapy through the use of Gold Nanorods is an approach that has been pursued for the past few years and has the potential of being less aggressive than current chemotherapies 132 134 In our study, we were interested in determining the cytotoxicity of thermoactivation of internalized Gold nanorods. For that purpose, we prepared samples in quadruplet of TOV21G cells with the following solutions for a final vo lume of 400 L : Binding Buffer (Control) 0.1 M 0.2 M, 0.3 M, 0.4 M and 0.5 M AuNR TOV6 in binding buffer Half of those samples were subjected to an NIR laser beam (808 nm) for 10 min. The set up of this e xperiment is shown in Figure 5 5 Then all solutions were trans fer r ed into a 96 well plate and incubated for 48 h at 37C. The cytotoxicity was finally analyzed through an MTS assay, as described in the material and methods section, and the cell viability was determined with the results obtained wit h and without NIR l aser beaming Figure 5 6 Results show ed that the thermoactivation of the 0.1 M TOV6 AuNR solution trigger ed the apoptosis of half of the cells, and those results reached up to 65% of the cells with the 0.4 M (or higher) TOV6 AuNR solution. Cell only cont rols with and without laser applied and all AuNR TOV6 control samples without laser applied provided us useful data F irst, the incubation of go ld nanorods aptamer conjugate did not trigger apoptosis, and second applying a NIR laser beam for 10 min on liv e cells did not trigger apoptosis. With those two observations, we concluded that the internalization

PAGE 110

110 of AuNR TOV6 and its thermal activation with a NIR laser showed an important cytotoxicity on ovarian cancer cells. Conclusion The use of nanoparticles and nanorods in the medi cal field has been inv estigated for the past 10 years: t he 1 100 nm scale is of interest for t he biological applications. Nanotox icity of some nanomaterials has been studied and reviewed 135,136 and in this chapter, we were particularly interested in gold nanorod s Indeed, bulk gold is well k based compounds have been used clinically as anti inflammatory agents 137 As it was described in the sections above, gold nanorod s were synthesized and coated with TOV6 aptamers to allow specific recognition of the complex AuNR TOV6 towards the ovarian canc er cell line TOV21G. Those conjugates were internalized into the cells after 8 h of incubation an d photothermal properties of gold nanorod s were used to provoke the apoptosis of the cells. Results of the cytotoxi city assays demonstrated that 10 min of near infrared laser beaming was sufficient to trigger the apoptosis of half of the cells with low concentration of nanorods incubated (0.1 M) and up to 65% of the cells when higher concentration of nanorods were incubated (0.4 M and more). The coupling of both aptamer and gold nanorod technologies created a tool able to target a specific cell line and impact its viability through thermal activation.

PAGE 111

111 Figure 5 1. Structure of the MTS and its Formazan product. A B Figure 5 2 Binding assays on TOV21G cells A ) TOV6 Aptamer only; and B ) TOV6 Aptamer conjugated to Gold Nanorod s

PAGE 112

112 A B Figure 5 3 Binding assay on HuH7 cells. A) TOV6 Aptamer only; and B) TOV6 Aptamer conjugated to Gold Nanorods. A B Figure 5 4 Internalization study on TOV21G cells. A) Ap tamer TOV6 TMR and B) Conjugate TOV6 TMR AuNR.

PAGE 113

113 Figure 5 5 Scheme of the NIR laser experiment. Figure 5 6 Viability of the TOV21G ovarian cancer cells after thermal activation of the gold nanorods.

PAGE 114

114 CHAPTER 6 CONCLUSION S AND FUTURE WORK This materia l could be divided into two main topic s : the bacterial project focusing on Methicillin resistant Staphylococcus aureus and the cancer projects with the cell selection of liver cancer and the cytotoxicity study of Gold nanorods aptamer complexes on ovarian cancer cell by thermal activation. The project on MRSA aptamer generation proved the possibility of using the SELEX technique on fi xed bacteria cells to develop aptamers binding to MRSA that will show the same binding results on live bacteria cells. Four a ptamers were generated to recogni ze the bacteria membrane with Kd constants varying between 90 and 200 nM. Since the smallest the Kd, the tighter the binding, DTMRSA4 is the aptamer showing the best bindi ng properties with a Kd of 95 nM. abil ity to selectively bind around whole cells presents a potential clinical use of the selected aptamers as nanocarriers for the identification of antibiotic re sistant cell lines in patients. The successful development of an assay that can differentiate the r esistance of S taphylococcus aureus colonies could facilitate the search for a more effective treatment and management of the disease depending on the strain of the bacteria. The clinical study of the aptamer recognition showed that t he selected aptamers bo und to all clinical MRSA strains tested, suggesting that the proteins targeted by those apt a mers are common for the different MRSA strains. DTMRSA1 and DTMRSA3 show ed the best specificity, with DTMRSA1 being the better of the tw o, while DTMRSA2 and DTMRSA4 boun d to all three types of bacteria: MRSA Staphylococcus aureus and Enterococcus faecalis Further investigation on the aptamers showed that

PAGE 115

115 conjugation to gold nanoparticles to it did not affect the binding, which was visualized through transmission el ectron microscopy. After time, the aptamers generated showed no binding with the bacteria. The observed r esults and the evolution history of the S taphylococcus a ureus superbug suggest ed that the aptamers may have been specific to a common target and that t he tested bacteria morphology changed over time. How these highly adaptable bacteria can orchestrate the expression of a variable number of resistance and virulence determinants is a major concern and still a mystery. The Staphylococcus aureus bacterium re present s a paradigm in its ability to accom m odate antibiotic resistance determinants and to produce an incredible panel of virulence determinants making these pathogens among the most infectious diseases in humans. Further studies would expand the presen t work to an optimized shorter aptamer length and a better understanding of the aptamer target on the membrane of MRSA bacteria. The project on liver c ancer cells focused on generating aptamers against the membrane protein Glypican 3. The cell SELEX techn ique is able to generate aptamers specific to a particular cell line, but its main disadvantage lies i n the fact that the target recognized by the aptamer remains unknown by the end of the selection. In this selection, we countered that disadvantage by usi ng an original mouse cell line, the IMEA wild cell line, as the counter cell line, and that same cell line modified by transfection of the human glypican 3 gene, the hGPC3 IMEA cell line, in order to have expression of the targeted protein, Glypican 3. At the end of the selection, too many families of sequences were obtained, with none large enough to be able to generate

PAGE 116

116 aptamers. Contamination of the cells by mycoplasma might have had an impact on the growth and membrane structure of the cells, which could explain the results observed. In my opinion and since selection on liver cells have shown to be challenging in the past year for the group, further investigation on G lypican 3 should be taken with a different approach. A protein selection of Glypican 3 seems more appropriate and could be run using Nickel NTA (n itrilotriacetic acid ) magnetic beads. This technique could also be coupled with regular cell selection to ensure that sequences binding during the protein selection keep their binding properties on ce tested on whole cells. In the final project focusing on thermoactivation of gold nanorods on ova rian cancer cells AuNR TOV6 conjugate were tested on the TOV21G cell line. After internalization of those complexes into the cells and 10 min beaming with a near infrared laser, up to 65% cell apoptosis was observed. The coupling of both aptamer and gold nanorod technologies created a tool able to target a specific cell line and impact its viability through thermal activation. Further cyt otoxicity study of Go ld Nanorod Aptamer complexes should include a temperature study in order to check the temperature observed outside of the cell. Indeed, if the temperature increase spread too much outside the cell, denaturation of neighbor proteins could occur as a side ef fect.

PAGE 117

117 LIST OF REFERENCES 1. Pasteur, L. A propos de de int Louis pour pustule maligne. (1877). 2. Ogston, A. Micrococcus Poisoning. Journal of anatomy and physiology 17 24 58 (1882). 3. Rosenbach, F. Microorganismen bei den Wund Infections Krankheiten des ; Menschen, Wiesb ad en. (1884 ). 4. Fortschritte der Medizin 2. (1884). 5. Whitt DD, S.A. Bacterial Pathogenesis: A Molecular Approach (2002). 6. Kluytmans, J., vanBelkum, A. & Ve rbrugh, H. Nasal carriage of Staphylococcus aureus: Epidemiology, underlying mechanisms, and associated risks. Clinical Microbiology Reviews 10 505 & (1997). 7. VandenBergh, M.F.Q. & Verbrugh, H.A. Carriage of Staphylococcus aureus: Epidemiology and clin ical relevance. Journal of Laboratory and Clinical Medicine 133 525 534 (1999). 8. VandenBergh, M.F.Q. et al. Follow up of Staphylococcus aureus nasal carriage after 8 years: Redefining the persistent carrier state. Journal of Clinical Microbiology 37 3133 3140 (1999). 9. Dancer, S.J. The effect of antibiotics on methicillin resistant Staphylococcus aureus. Journal of Antimicrobial Chemotherapy 61 246 253 (2008). 10. Lane, W.R. Methicillin resistance in staphylococci. Med Jour Australia I 49 962 965 (1962). 11. S., L. The Antibiotic Paradox: How the Misuse of Antibiotics Destroys Their Curative Powers. ( Perseus Cambridge 2002). 12. Levy, S.B. & Marshall, B. Antibacterial resistance worldwide: causes, challenges and responses. Nature Medicine 10 S122 S129 (2004). 13. Anomymous. European Antimicrobial Resistance Surveillance System, EARSS Annual Report 2002. (2002). 14. Zapun, A., Macheboeuf, P. & Vernet, T. Penicillin Binding Proteins and beta Lactam Resistance. Antimicrobial Drug Resistance, V ol 1: Mechanisms of Drug Resistance 145 170 (2009).

PAGE 118

118 15. Mulligan, M.E. et al. Methicillin resistant Staphylococcus aureus A consensus review of the microbiology, pathogenesis, and epidemiology with implications for prevention and management American J ournal of Medicine 94 313 328 (1993). 16. Hiramatsu, K. Vancomycin resistant Staphylococcus aureus: a new model of antibiotic resistance. The Lancet infectious diseases 1 147 155 (2001). 17. Walsh, T.R. & Howe, R.A. The prevalence and mechanisms of van comycin resistance in Staphylococcus aureus. Annual R eview of Microbiology. Volume 56 657 675 (2002). 18. Walsh, C. Molecular mechanisms that confer antibacterial drug resistance. Nature 406 775 781 (2000). 19. Millar, B.C., Loughrey, A., Elborn, J.S. & Moore, J.E. Proposed definitions of community associated meticillin resistant Staphylococcus aureus (CA MRSA). Journal of Hospital Infection 67 109 113 (2007). 20. Gonzalez, C., Rubio, M., Romero Vivas, J., Gonzalez, M. & Picazo, J.J. Staphylococcus au reus bacteremic pneumonia: Differences between community and nosocomial acquisition. International Journal of Infectious Diseases 7 102 108 (2003). 21. Lowy, F.D. Medical progress Staphylococcus aureus infections. New England Journal of Medicine 339 5 20 532 (1998). 22. Weems, J.J. The many faces of Staphylococcus aureus infection Recognizing and managing its life threatening manifestations. Postgraduate Medicine 110 24 + (2001). 23. cliniq ue. 783 830 (ESKA, Paris, 2000). 24. Gomez, M.I. et al. Staphylococcus aureus protein A induces airway epithelial inflammatory responses by activating TNFR1. Nature Medicine 10 842 848 (2004). 25. Lowy, F.D. Antimicrobial resistance: the example of Staphylococcus aureus. Journal of Clinical Investigation 111 1265 1273 (2003). 26. Jones, T.F., Kellum, M.E., Porter, S.S., Bell, M. & Schaffner, W. An outbreak of community acquired foodborne illness due to methicillin resistant Staphylococcus aureus Clinical Infectious Diseases 33 1106 1106 (2001).

PAGE 119

119 27. Bronner, S., Monteil, H. & Prevost, G. Regulation of virulence determinants in Staphylococcus aureus: complexity and applications. Fems Microbiology Reviews 28 183 200 (2004). 28. Dufour, P. et a l. Community acquired methicillin resistant Staphylococcus aureus infections in France: Emergence of a single clone that produces Panton Valentine leukocidin. Clinical Infectious Diseases 35 819 824 (2002). 29. Yarwood, J.M. & Schlievert, P.M. Quorum sen sing in Staphylococcus infections. Journal of Clinical Investigation 112 1620 1625 (2003). 30. Domart, Y. Therapeutic principles of staphylococcal infections Role and limitations of standard compounds. Annales Francaises D Anesthesie Et De Reanimation 21 392 398 (2002). 31. Wolff, M. The management of treatment failures for staphylococcal infections. Annales Francaises D Anesthesie Et De Reanimation 21 418 423 (2002). 32. American Cancer Society, Cancer Facts and Figures 2005 2013 Report. ( http://www.cancer.org) 33. Gonczy, P. Mechanisms of cell division: lessons from a nematode. M S Medecine Sciences 19 735 742 (2003). 34. Chartier, N.T., Hyenne, V. & Labbe, J. C. Mechanisms of asymmetric cell division: fr om model organisms to tumorigenesis. M S Medecine Sciences 26 251 257 (2010). 35. Hayflick, L. & Moorhead, P.S. Serial cultivation of human diploid cell strains Experimental Cell Research 25 585 & (1961). 36. Gernez, A. Le Cancer, Dynamique et Eradica tion. (1969). 37. Bru, A., Albertos, S., Subiza, J.L., Garcia Asenjo, J.L. & Bru, I. The universal dynamics of tumor growth. Biophysical Journal 85 2948 2961 (2003). 38. Demicheli, R. et al. An exponential Gompertzian description of lovo cell tumor gr owth from in vivo and in vitro data Cancer Research 49 6543 6546 (1989). 39. Beljanski, M. Experimental biology and medicine monographs on interdisciplinar topics Volume 8 The regulation of DNA replication and transcription: the role of trigger molecul es in normal and malignant gene expression X+189p. S. Karger: Basel, Switzerland; New York, N.Y., USA. Illus X+189P X+189P (1983). 40. Hanahan, D. & Weinberg, R.A. The hallmarks of cancer. Cell 100 57 70 (2000).

PAGE 120

120 41. Burzynski, S.R. Antineoplastons H istory of the research .1. Drugs under Experimental and Clinical Research 12 1 9 (1986). 42. Bruix, J. & Sherman, M. Management of Hepatocellular Carcinoma: An Update. Hepatology 53 1020 1022 (2011). 43. Luo, J. H. et al. Transcriptomic and genomic ana lysis of human hepatocellular carcinomas and hepatoblastomas. Hepatology 44 1012 1024 (2006). 44. Sasisekharan, R. Roles of heparan sulphate glycosaminoglycans in tumor biology. Glycobiology 12 642 642 (2002). 45. Liu, B. et al. Investigation of the R ole of Glypican 3 in Liver Regeneration and Hepatocyte Proliferation. Faseb Journal 24 (2010). 46. Komori, H., Nakatsura, T., Beppu, T., Nishimura, Y. & Baba, H. Possibilities of glypican 3 specific immunotherapy for hepatocellular carcinoma. Gan to kagak u ryoho. Cancer & chemotherapy 33 1742 1744 (2006). 47. Perez Rojas, J. et al. Immunophenotypic classification of 3 cases of hepatocellular adenoma. Differential diagnosis with focal nodular hyperplasia. Gastroenterologia Y Hepatologia 36 388 395 (2013 ). 48. Kojiro, M. et al. Pathologic Diagnosis of Early Hepatocellular Carcinoma: A Report of the International Consensus Group for Hepatocellular Neoplasia. Hepatology 49 658 664 (2009). 49. Williams, T.I. et al. Epithelial ovarian cancer: Disease eti ology, treatment, detection, and investigational gene, metabolite, and protein biomarkers. Journal of Proteome Research 6 2936 2962 (2007). 50. http://www.ovarian.org/types_and_stages.php 51. Colombo, N. et al. Ovarian cancer. Critical Reviews in Oncology Hematology 60 159 179 (2006). 52. Hennessy, B.T., Coleman, R.L. & Markman, M. Ovarian cancer. Lancet 374 1371 1382 (2009). 53. Goff, B. Development of an ovarian cancer symptom index: Po ssibilities for earlier detection Reply. Cancer 110 227 227 (2007). 54. Van Simaeys, D. et al. Study of the Molecular Recognition of Aptamers Selected through Ovarian Cancer Cell SELEX. Plos One 5 (2010).

PAGE 121

121 55. Karst, A.M. & Drapkin, R. Ovarian cancer p athogenesis: a model in evolution. Journal of oncology 2010 932371 (2010). 56. Patel, D.J. & Suri, A.K. Structure, recognition and discrimination in RNA aptamer complexes with cofactors, amino acids, drugs and aminoglycoside antibiotics. Journal of biote chnology 74 39 60 (2000). 57. Hermann, T. & Patel, D.J. Biochemistry Adaptive recognition by nucleic acid aptamers. Science 287 820 825 (2000). 58. Feigon, J., Dieckmann, T. & Smith, F.W. Aptamer structures from A to zeta. Chemistry & Biology 3 611 617 (1996). 59. Hoshika, S., Minakawa, N. & Matsuda, A. Synthesis and physical and physiological properties of 4 thioRNA: application to post modification of RNA aptamer toward NF kappa B. Nucleic Acids Research 32 3815 3825 (2004). 60. Virno, A. et al. A novel thrombin binding aptamer containing a G LNA residue. Bioorganic & Medicinal Chemistry 15 5710 5718 (2007). 61. Di Primo, C. et al. Systematic screening of LNA/2 O methyl chimeric derivatives of a TAR RNA aptamer. Febs Letters 581 771 774 (2007). 62. Proske, D., Blank, M., Buhmann, R. & Resch, A. Aptamers basic research, drug development, and clinical applications. Applied Microbiology and Biotechnology 69 367 374 (2005). 63. Hicke, B.J. et al. Tumor targeting by an aptamer. Journal o f Nuclear Medicine 47 668 678 (2006). 64. Shangguan, D. et al. Aptamers evolved from live cells as effective molecular probes for cancer study. Proceedings of the National Academy of Sciences of the United States of America 103 11838 11843 (2006). 65. Yang, X.B. et al. Immunofluorescence assay and flow cytometry selection of bead bound aptamers. Nucleic Acids Research 31 (2003). 66. Kawazoe, N., Ito, Y. & Imanishi, Y. Bioassay using a labeled oligonucleotide obtained by in vitro selection. Biotechnolo gy Progress 13 873 874 (1997). 67. Drolet, D.W., MoonMcDermott, L. & Romig, T.S. An enzyme linked oligonucleotide assay. Nature Biotechnology 14 1021 1025 (1996). 68. Rye, P.D. & Nustad, K. Immunomagnetic DNA aptamer assay. Biotechniques 30 290 + (200 1).

PAGE 122

122 69. Ramos, E. et al. A DNA aptamer population specifically detects Leishmania infantum H2A antigen. Laboratory Investigation 87 409 416 (2007). 70. Tombelli, S., Minunni, M., Luzi, E. & Mascini, M. New trends in nucleic acids based biosensors Flo rence, Italy, October 25 28, 2003. Analytical Letters 37 1037 1052 (2004). 71. Jayasena, S.D. Aptamers: An emerging class of molecules that rival antibodies in diagnostics. Clinical Chemistry 45 1628 1650 (1999). 72. Mairal, T. et al. Aptamers: molecu lar tools for analytical applications. Analytical and Bioanalytical Chemistry 390 989 1007 (2008). 73. Ellington, A.D. & Szostak, J.W. In vitro selection of RNA molecules that bind specific ligands Nature 346 818 822 (1990). 74. Tuerk C., Schneider, D. & Gold, L. Successes with Selex. Biological Chemistry Hoppe Seyler 372 771 771 (1991). 75. Sefah, K., Shangguan, D., Xiong, X., O'Donoghue, M.B. & Tan, W. Development of DNA aptamers using Cell SELEX. Nature Protocols 5 1169 1185 (20 10). 76. Stoltenburg, R., Reinemann, C. & Strehlitz, B. SELEX A (r)evolutionary method to generate high affinity nucleic acid ligands. Biomolecular Engineering 24 381 403 (2007). 77. Famulok, M. Oligonucleotide aptamers that recognize small molecules. C urrent Opinion in Structural Biology 9 324 329 (1999). 78. Wilson, D.S. & Szostak, J.W. In vitro selection of functional nucleic acids. Annual Review of Biochemistry 68 611 647 (1999). 79. Koekpinar, O., Walter, J. G., Shoham, Y., Stahl, F. & Scheper, T. Aptamer Based Downstream Processing of His Tagged Proteins Utilizing Magnetic Beads. Biotechnology and Bioengineering 108 2371 2379 (2011). 80. Murphy, M.B., Fuller, S.T., Richardson, P.M. & Doyle, S.A. An improved method for the in vitro evolution of aptamers and applications in protein detection and purification. Nucleic Acids Research 31 (2003). 81. Shin, S., Kim, I. H., Kang, W., Yang, J.K. & Hah, S.S. An alternative to Western blot analysis using RNA aptamer functionalized quantum dots. Bioorganic & Medicinal Chemistry Letters 20 3322 3325 (2010).

PAGE 123

123 82. Terazono, H., Yu, A., Soloviev, M. & Yasuda, K. Labelling of live cells using fluorescent aptamers: binding reversal with DNA nucleases. Journal of Nanobiotechnology 8 8 Article No.: 8 (2010). 83. Fang, X.H., Sen, A., Vicens, M. & Tan, W.H. Synthetic DNA aptamers to detect protein molecular variants in a high throughput fluorescence quenching assay. Chembiochem 4 829 834 (2003). 84. Swensen, J.S. et al. Continuous, Real Time Monitoring of Cocain e in Undiluted Blood Serum via a Microfluidic, Electrochemical Aptamer Based Sensor. Journal of the American Chemical Society 131 4262 4266 (2009). 85. Kang, H.S., Huh, Y.M., Kim, S. & Lee, D. k. Isolation of RNA Aptamers Targeting HER 2 overexpressing B reast Cancer Cells Using Cell SELEX. Bulletin of the Korean Chemical Society 30 1827 1831 (2009). 86. Da Rocha Gomes, S. et al. (99m)Tc MAG3 aptamer for imaging human tumors associated with high level of matrix metalloprotease 9. Bioconjugate chemistry 23 2192 2200 (2012). 87. Rockey, W.M. et al. Synthesis and radiolabeling of chelator RNA aptamer bioconjugates with copper 64 for targeted molecular imaging. Bioorganic & Medicinal Chemistry 19 4080 4090 (2011). 88. Esposito, C.L., Catuogno, S., de Fr anciscis, V. & Cerchia, L. New insight into clinical development of nucleic acid aptamers. Discovery medicine 11 487 496 (2011). 89. Cheng, J. et al. Formulation of functionalized PLGA PEG nanoparticles for in vivo targeted drug delivery. Biomaterials 2 8 869 876 (2007). 90. Wang, A.Z. et al. Superparamagnetic iron oxide nanoparticle aptamer bioconjugates for combined prostate cancer imaging and therapy. Chemmedchem 3 1311 1315 (2008). 91. Guo, Y. P., Guo, L. H., Yao, Y. b., Ning, C. Q. & Guo, Y. J. Magnetic mesoporous carbonated hydroxyapatite microspheres with hierarchical nanostructure for drug delivery systems. Chemical Communications 47 12215 12217 (2011). 92. Wu, Y., Sefah, K., Liu, H., Wang, R. & Tan, W. DNA aptamer micelle as an efficient de tection/delivery vehicle toward cancer cells. Proceedings of the National Academy of Sciences of the United States of America 107 5 10 (2010). 93. Kang, H., O'Donoghue, M.B., Liu, H. & Tan, W. A liposome based nanostructure for aptamer directed delivery. Chemical Communications 46 249 251 (2010).

PAGE 124

124 94. Rosi, N.L. et al. Oligonucleotide modified gold nanoparticles for intracellular gene regulation. Science 312 1027 1030 (2006). 95. Alkilany, A.M. et al. Cellular uptake and cytotoxicity of gold nanorods : Molecular origin of cytotoxicity and surface effects. Abstracts of Papers of the American Chemical Society 237 (2009). 96. Sefah, K. et al. Molecular recognition of acute myeloid leukemia using aptamers. Leukemia 23 235 244 (2009). 97. Chambers, H.F. & DeLeo, F.R. Waves of resistance: Staphylococcus aureus in the antibiotic era. Nature Reviews Microbiology 7 629 641 (2009). 98. http://atcc.org 99. Cao, X. et al. Combining use of a panel of ssDNA aptamers in the det ection of Staphylococcus aureus. Nucleic Acids Research 37 4621 4628 (2009). 100. Chen F, Z.X., Zhou J, Liu S, Liu J. Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage. Vol. 39 2157 2162 ( Mol. Bio. Rep ., 2012). 101. Tiemersma, E .W. et al. Geographical and time trends in proportion of methicillin resistant Staphylococcus aureus (MRSA) in Europe (1999 2001) reported through the European antimicrobial resistance surveillance system (EARSS). Abstracts of the Interscience Conference on Antimicrobial Agents and Chemotherapy 42 88 88 (2002). 102. Love, J.C., Estroff, L.A., Kriebel, J.K., Nuzzo, R.G. & Whitesides, G.M. Self assembled monolayers of thiolates on metals as a form of nanotechnology. Chemical Reviews 105 1103 1169 (2005). 103. Longobardi Givan, A. Flow Cytometry First Principles (2001). 104. Hayden, S.C. et al. Aggregation and Interaction of Cationic Nanoparticles on Bacterial Surfaces. Journal of the American Chemical Society 134 6920 6923 (2012). 105. Carrillo Carri on, C., Simonet, B.M. & Valcarcel, M. Colistin functionalised CdSe/ZnS quantum dots as fluorescent probe for the rapid detection of Escherichia coli. Biosensors & Bioelectronics 26 4368 4374 (2011). 106. Joo, J. et al. A facile and sensitive detection o f pathogenic bacteria using magnetic nanoparticles and optical nanocrystal probes. Analyst 137 3609 3612 (2012).

PAGE 125

125 107. Xiu, Z. m., Zhang, Q. b., Puppala, H.L., Colvin, V.L. & Alvarez, P.J.J. Negligible Particle Specific Antibacterial Activity of Silver Na noparticles. Nano Letters 12 4271 4275 (2012). 108. Lara, H.H., Ayala Nunez, N.V., Ixtepan Turrent, L.d.C. & Rodriguez Padilla, C. Bactericidal effect of silver nanoparticles against multidrug resistant bacteria. World Journal of Microbiology & Biotechno logy 26 615 621 (2010). 109. DeGrasse, J.A. A Single Stranded DNA Aptamer That Selectively Binds to Staphylococcus aureus Enterotoxin B. Plos One 7 (2012). 110. Klumpp, S., Zhang, Z. & Hwa, T. Growth Rate Dependent Global Effects on Gene Expression in Ba cteria. Cell 139 1366 1375 (2009). 111. Robinson, D.A. et al. Re emergence of early pandemic Staphylococcus aureus as a community acquired meticillin resistant clone. Lancet 365 1256 1258 (2005). 112. Jevons, M.P., Rolinson, G.N. & Knox, R. Celbenin r esistant Staphylococci. British Medical Journal 1 124 + (1961). 113. Kreiswirth, B. et al. Evidence for a clonal origin of Methicillin resistance in Staphylococcus aureus Science 259 227 230 (1993). 114. Musser, J.M. & Kapur, V. Clonal analysis of Me thicillin resistant Staphylococcus aureus strains from intercontinental sources association of the Mec gene with divergent phylogenetic lineages implies dissemination by horizontal transfer and recombination Journal of Clinical Microbiology 30 2058 206 3 (1992). 115. Fitzgerald, J.R., Sturdevant, D.E., Mackie, S.M., Gill, S.R. & Musser, J.M. Evolutionary genomics of Staphylococcus aureus: Insights into the origin of methicillin resistant strains and the toxic shock syndrome epidemic. Proceedings of the National Academy of Sciences of the United States of America 98 8821 8826 (2001). 116. http://www.mirror.co.uk/news/technology science/science/new d eadly mrsa strain way 663012 http://www.mirror.co.uk/news/technology science/science/new deadly mrsa strain way 663012 117. Kanel, G.a.K., J. Atl as of liver pathology (2010). 118. http://cancer.org 119. http://www.liverfoundation.org

PAGE 126

126 120. Raoul, J. L. Natural history of hepatocellular carcinoma and current trea tment options. Seminars in Nuclear Medicine 38 S13 S18 (2008). 121. Shirakawa, H. et al. Glypican 3 is a useful diagnostic marker for a component of hepatocellular carcinoma in human liver cancer. International Journal of Oncology 34 649 656 (2009). 1 22. Sawada, Y., Sakai, M., Yoshikawa, T., Ofuji, K. & Nakatsura, T. A glypican 3 derived peptide vaccine against hepatocellular carcinoma. Oncoimmunology 1 1448 1450 (2012). 123. Davies, D. Flow Cytometry: Principles and Applications 124. Miao, H. L. et al. Knockdown of GPC3 inhibits the proliferation of Huh7 hepatocellular carcinoma cells through down regulation of YAP. Journal of Cellular Biochemistry 114 625 631 (2013). 125. Roche. http://www.liv.ac.uk/media/livacuk/centreforgenomicresearch/The_GS_FLX_Titan ium_Chemistry_Extended_MID_Set.pdf 126. Crotzer, D.R. et al. Lack of effective systemic therapy for recurrent clear cell carcinoma of the ovary. Gynecologic Oncology 105 404 408 (2007). 127. Munkarah, A., Chatterjee, M. & Tainsky, M.A. Update on ovarian cancer screening. Current Opinion in Obstetrics & Gynecology 19 22 26 (2007). 128. Reynolds, E.A. & Moller, K.A. A review and an update on the screening of epithelial ovarian cancer. Current Problems in Cancer 30 203 232 (2006). 129. Haga, Y., Sakamoto, K., Egami, H., Yoshimura, R. & Akagi, M. Evaluayion of serum CA125 values in healthy individuals and pregnant wom en. American Journal of the Medical Sciences 292 25 29 (1986). 130. Yasun, E. et al. Enrichment and Detection of Rare Proteins with Aptamer Conjugated Gold Nanorods. Analytical Chemistry 84 6008 6015 (2012). 131. http://www.promega.com/products/cell health and metabolism/cell viability assays/celltiter 96 aqueous non_radioactive cell proli feration assay _mts_/ 132. Esposito, G. et al. Nanotechnology and vascular neurosurgery: an in vivo experimental study on microvessels repair using laser photoactivation of a nanostructured hyaluronan solder Journal of Biological Regulators and Homeos tatic Agents 26 447 456 (2012).

PAGE 127

127 133. de Freitas, L.F. et al. In vivo photothermal tumour ablation using gold nanorods. Laser Physics 23 (2013). 134. Ratto, F. et al. Photothermal effects in connective tissues mediated by laser activated gold nanorods. Nanomedicine Nanotechnology Biology and Medicine 5 143 151 (2009). 135. Colvin, V.L. The potential environmental impact of engineered nanomaterials (vol 21, pg 1166, 2003). Nature Biotechnology 22 760 760 (2004). 136. Lewinski, N., Colvin, V. & Drezek, R. Cytotoxicity of nanoparticles. Small 4 26 49 (2008). 137. Finkelstein, A.E. et al. A uranofin New oral gold compound for treatment of Rheumatoid Arthritis Annals of the Rheumatic Diseases 35 251 257 (1976).

PAGE 128

128 BIOGRAPHICAL SKETCH Diane Turek w as born in Pau, France. She studied chemical and physical engineering in Bordeaux, France, at the graduate school ENSCPB and obtained her Engineering M aster degree in 2009. One year befo re, in 2008, while completing her engineering Master she joined Dr Wa research on drug delivery using polymers and sunscreen chromophore modification s She obtained her Chemistry Master degree in 2011 and continued into a PhD in the biochemistry division She received her PhD in Ch emistry in 2013 under the tutorage of Dr Weihong Tan.