Mocecular Engineering of DNA-based Systems for Intelligent Therapy

MISSING IMAGE

Material Information

Title:
Mocecular Engineering of DNA-based Systems for Intelligent Therapy
Physical Description:
1 online resource (153 p.)
Language:
english
Creator:
Han, Da
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Chemistry
Committee Chair:
TAN,WEIHONG
Committee Co-Chair:
CAO,YUNWEI CHARLES
Committee Members:
BUTCHER,REBECCA ANN
POLFER,NICOLAS CAMILLE
SCHULTZ,GREGORY SCOTT

Subjects

Subjects / Keywords:
aptamer -- circuit -- dna -- nanostructure -- therapy -- thrombin
Chemistry -- Dissertations, Academic -- UF
Genre:
Chemistry thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Nucleic acids, as biological macromolecules essential for life, are greatly involved in transferring, encoding and expressing genetic information across generations, as well as in regulating biological reactions. As an effective way to explore unique and versatile functions of nucleic acids, molecular engineering focus on understanding the physical behavior of nucleic acids under different conditions and the possible chemical modifications. The central theme of this thesis is to develop “smart” DNA systems for intelligent therapy on the molecular level via molecular engineering method.  In the second chapter, I presented a novel strategy of designing an aptamer-based DNA nanocircuit capable of the selective recognition of cancer cells, controllable activation of photosensitizer and amplification of photodynamic therapeutic effect. The aptamers can selectively recognition target cancer cells and bind to the specific proteins on cell membrane. Then the overhanging catalyst sequence on aptamer can trigger a toehold-mediated catalytic strand displacement to activate photosensitizer and achieve amplified therapeutic effect. The specific binding-induced activation allows the DNA circuit to distinguish diseased cells from healthy cells, reducing damage to nearby healthy cells. Moreover, the catalytic amplification reaction will only take place close to the target cancer cells, resulting in a high local concentration of singlet oxygen to selectively kill the target cells. The principle employed in this study demonstrated the feasibility of assembling a DNA circuit on cell membranes and could further broaden the utility of DNA circuits for applications in biology, biotechnology, and biomedicine. In the third chapter, I demonstrated the use of azobenzene-incorporated DNA as a control agent to precisely monitor three-dimensional DNA nanostructures. The shape of DNA tetrahedron can be controlled by alternate irradiations with different wavelengths of light, thus enabling the application for intelligent drug deliver manipulated by photons. In the fourth chapter, I described the first logical circuit based on DNA-protein interactions with accurate threshold control, enabling autonomous, self-sustained and programmable manipulation of protein activity in vitro. Similar circuits made previously were based primarily on DNA hybridization and strand displacement reactions. This new design uses the diverse nucleic acid interactions with proteins. The circuit can precisely sense the local enzymatic environment, such as the concentration of thrombin, and when it is excessively high, a coagulation inhibitor is automatically released by a concentration-adjusted circuit module. To demonstrate the programmable and autonomous modulation, a molecular circuit with different threshold concentrations of thrombin was tested as a proof of principle. In the future, owing to tunable regulation, design modularity and target specificity, this prototype could lead to the development of novel DNA biochemical circuits to control the delivery of aptamer-based drugs in smart and personalized medicine, providing a more efficient and safer therapeutic strategy. In the final chapter, I designed and constructed an artificial DNA biomimetic network for vertebrate acquired immune system. Vertebrate acquired immune system composed of dynamic networks of biochemical reactions displays extremely complex functional behaviors which can be simplified as specific recognition, antigen tolerance, immune response as well as long-term memory. We have reproduced such functions by the rational design of dynamic reaction networks based on DNA biochemistry. Rather than enrolling cellular components as the real acquired immune system does in vivo, we use DNA and enzyme as simplified and artificial analogs to mimic their systematic response to specific molecular stimuli in vitro. Building on the successful implementation of each step, our results show patterns that follow the macroscopic behaviors of vertebrate acquired immune system. Our approach thus provides rational and simplified bottom-up construction strategies to design biomimicry formed by complex reaction networks.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Da Han.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: TAN,WEIHONG.
Local:
Co-adviser: CAO,YUNWEI CHARLES.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-06-30

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0046125:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 MOL ECULAR ENGINEERING OF DNA BASED SYSTEM S FOR INTELLIGENT THERAPY By DA HAN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Da Han

PAGE 3

3 To my family and friends

PAGE 4

4 ACKNOWLEDGMENTS It has been an amazing journey for me as a graduate student in Tan group in the past 5 years. This journey was full of happiness, determination, sweat and difficulties, will remember forever. First, I wan t to express my most tremendous gratitude to my advisor, Dr. Weihong Tan. As a student of his I was given a lot of freedom to do the research that I had interest in and comforted with great encouragement when confronting difficulties. He teaches me a lot on how to think, read and write, which have improved my performance as a chemist. Meanwhile, the way he treats other people and life has also benefited and inspired me a lot. I believe those experiences will be a great fortune in my future life. I also wa nt to thank my committee members Dr. Nicolas C. Polfer, Dr. Rebecca A. Butcher, Dr. Y. Charles Cao, and Dr. Gregory Schultz for their valuable advice, support, and encouragement. In addition, I also express my gratitude to Dr. Kathryn R. Williams for her h elp on manuscript writing and review. Only with the great support from the people in Tan group, this dissertation can be successfully completed. I want to thank Dr. Yan Chen, Dr. Jin Huang, Dr. Zhi Zhu and Dr. Quan Yuan for their guidance on involving me into my research. I also appreciate the help from Dr. Kwame Sefah Dr. Tao Zhang, Dr. Xiangling Xiong, Dr. Ibrahim Shukoor Dr. Basri Gulbakan Dr. Tao Chen, Dr. Lu Peng, Dr. Guizhi Zhu, Dr. Elizabeth Jimenez and Dr. Mingxu You on scientific discussion and instrumental training. Also, I thank the useful and interesting suggestions from other Tan group members including Ismail Ocsoy Yunfei Zhang, Cuichen Wu, Sena Cansiz Diane Turek Emir Yasun Liqin

PAGE 5

5 Zhang, Cheng Cui, Lipin g Qiu and Carole Champanhac Each of them has made my journey enjoyable and pleasant Finally, I deeply indebted my parents and would like to express my greatest respect to them. Without their support, encouragement and love, I cannot complete anything. S o I want to dedicate this dissertation and show my love to them; my heart always goes with them.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 ABSTRACT ................................ ................................ ................................ ................... 13 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 16 ................................ ............. 16 Structures and Chemical Synthesis of Nucleic A cids ................................ ....... 17 Functional Nucleic Acids: Aptamers ................................ ................................ 19 Photocontrollable DNA Nanostructures ................................ ................................ .. 21 DNA Nanostructures ................................ ................................ ........................ 21 Azobenzene and Azobenzene Incorporated DNA ................................ ............ 23 DNA Based Logical Devices ................................ ................................ ................... 24 Overvi ew of DNA based Computation ................................ .............................. 24 Construction of DNA Circuit: Toehold Mediated Strand Displacement ............. 25 DNA based Circuit for Analytical and Biomedical Applications ......................... 27 DNA based Biomimicry ................................ ................................ .................... 28 2 MOLECULAR ENGINEERING OF A CELL SURFACE APTAMER CIRCUIT FOR TARGETED AND AMPLIFIED PHOTODYNAMIC CANCER THERAPY ....... 39 Significance and Background ................................ ................................ ................. 39 Experimental Materials and Methods ................................ ................................ ...... 43 Cell Culture ................................ ................................ ................................ ....... 43 Ce6 Modified DNA Synthesis ................................ ................................ ........... 43 DNA Pu rification ................................ ................................ ............................... 44 Fluorescence Kinetics of DNA Hairpin Circuit in Buffer ................................ .... 44 Test of Fluorescence Response and SOG of DNA Hairpin Circuit ................... 45 Test of SOG Response of DNA Hairpin Circuit to Cancer Cells ....................... 46 Flow Cytometric Analysis ................................ ................................ ................. 46 Confocal Imaging of Cells Bound with Aptamer ................................ ............... 47 Cytotoxicity Study ................................ ................................ ............................. 47 Results and Discussion ................................ ................................ ........................... 48 Signal Amplification Effect of Aptamer Circuit in Buffer ................................ .... 48 Selective Recognition Ability of the Aptamer Circuit ................................ ......... 50 Singlet Ox ygen Amount with Different Cancer Cells ................................ ........ 51 Selective Cytotoxicity Effect to Cancer Cells ................................ .................... 51 Conclusions ................................ ................................ ................................ ............ 52

PAGE 7

7 3 MOLECULAR ENGINEERING OF PHOTORESPONSIVE THREE DIMENSIONAL DNA NANOSTRUCTURES FOR INTELLIGENT DRUG DELIVERY SIGNIFICANCE AND BACKGROUND ................................ ................ 61 Experimental Materials and Methods ................................ ................................ ...... 63 Chemicals and Regents ................................ ................................ ................... 63 Synthesis of DNA Sequences ................................ ................................ .......... 63 Synthesis of BF PS DNA ................................ ................................ .................. 64 Assembly o f DNA Tetrahedral Nanostructures ................................ ................. 64 Native Polyacrylamide Gel Electrophoresis (PAGE) for Structural Characterization ................................ ................................ ............................ 65 Phosphorothioate DNA Tetrahedron Assembled with Gold Nanoparticles ....... 65 FRET Measurement of Structure Change in Response to UV and Visible Irradiation ................................ ................................ ................................ ...... 66 AFM and TEM Measurements ................................ ................................ .......... 66 Results and Discussion ................................ ................................ ........................... 67 Construction and Optimization of DNA Tetrahedral Nanostructure .................. 67 Structural Confirmation of DNA Tetrahedral Nanostructure .............................. 67 Characterization of DNA tetrahedral struct ure with photocontrollability ............ 68 Conclusions ................................ ................................ ................................ ............ 70 4 MOLECULAR ENGINEERING OF A DNA LOGICAL CIRCUIT FOR PROGRAMMABLE AND AUTONOMOUS REGULATION OF PROTEIN ACTIVITY ................................ ................................ ................................ ................ 76 Significance and Background ................................ ................................ ................. 76 Experimental Materials and Methods ................................ ................................ ...... 81 DNA Synthesis ................................ ................................ ................................ 81 DNA Purification ................................ ................................ ............................... 82 Quantitative Ana lysis of Released DNA input Strands Triggered by Thrombin ................................ ................................ ................................ ....... 82 Validation of Signal Transduction by Fluorescence ................................ .......... 83 Thrombin Catalytic Activity Assay ................................ ................................ .... 84 Results and Discussion ................................ ................................ ........................... 85 DNA Aptamer Circuit Design ................................ ................................ ............ 85 Validation of Signal Transduction in Each Module ................................ ........... 86 Performance of Entire Circuit with Thrombin as Input ................................ ...... 88 Programmable and Autonomous Protein Regulation by Aptamer Circuit ......... 88 Theoretical calculations of circuit performance ................................ ................. 92 Conclusions ................................ ................................ ................................ ............ 97 5 MOLECULAR ENGINEERING OF A DNA ENZYME CASCADE NETWORK FOR ACQUIRED IMMUNE SYSTEM MIMICRY ................................ ................... 112 Significance and Background ................................ ................................ ............... 112 Experimental Materials and Methods ................................ ................................ .... 113 DNA Synthesis ................................ ................................ ............................... 113

PAGE 8

8 DNA Purification ................................ ................................ ............................. 114 Preparation of Circular Template DNA (CP) ................................ ................... 114 Validation of Signal Transduction in Each step and the Entire System by Fluorescence ................................ ................................ ............................... 115 Results and Discussion ................................ ................................ ......................... 115 System Design and Construction ................................ ................................ ... 115 Validation of Signal Transduction in Each Module ................................ ......... 119 Performance of the Entire System with Pathogen Input ................................ 123 Conclusions ................................ ................................ ................................ .......... 125 6 FUTURE DIRECTIONS AND CONCLUSIONS ................................ .................... 136 Conclusions ................................ ................................ ................................ .......... 136 Future Directions ................................ ................................ ................................ .. 139 LIST OF REFERENCES ................................ ................................ ............................. 141 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 153

PAGE 9

9 LIST OF TABLES Table page 2 1 Sequence of oligonucleotides used in this chapter. LNA bases are indicated by bold and underscores. ................................ ................................ ................... 54 3 1 DNA sequences used for tetrahedron assembly ................................ ................ 72 4 1 Sequences of molecular circuit f or spectrofluorimetry studies. ........................... 99 4 2 Sequences of molecular circuit for chromogenic peptide substrate hydrolysis monitoring ................................ ................................ ................................ ......... 100 5 1 Sequences used in the AIS mimicry system ................................ ..................... 126

PAGE 10

10 LIST OF FIGURES Figure page 1 1 Chemical structure of nucleic acids and nucleosides. ................................ ........ 30 1 2 ................................ ... 31 1 3 Chemical structure of DNA phosphoramidite. ................................ ..................... 32 1 4 Automated oligonucleotide synthesis based on pho sphoramidite chemistry. ..... 33 1 5 Scheme of Systematic Evolution of Ligands by EXponential enrichment (SELEX). ................................ ................................ ................................ ............ 34 1 6 A) Illustration of some DNA titles. 61 B) Schematic folding of DNA origami.. ....... 35 1 7 Scheme of the reversible hybridization/dehybridization of an azobenzene incorporated DNA duplex. ................................ ................................ .................. 36 1 8 A) Scheme of toehold mediated displacement reaction. B) Scheme of toehold exchange displacement reaction. ................................ .......................... 37 1 9 Example of functional nucleic acid based circuit for biological and biomedical applications ................................ ................................ ................................ ......... 38 2 1 Illustration of DNA aptamer circuit on cell membrane... ................................ ...... 55 2 2 Image of the PAGE gel proving the catalytic effect of C sequence. .................... 56 2 3 Signal amplification effect of the aptamer circuit in buffer... ................................ 57 2 4 Fluorescence kinetics describing the leakage reaction of A 1 A 2 and R 12 in the Flu o buffer.. ................................ ................................ ................................ ........ 58 2 5 Fluorescence spectra of mixtures containing 100 nM A 1 100 nM A 2 and 150 nM Ce6 modified R 12 with different concen trations of TDO5 C in buffer. ........... 58 2 6 Demonstration of the selective recognition ability of the aptamer circuit.. .......... 59 2 7 SOSG fluorescence of DNA circuit (A 1 A 2 and R 12 ) incubated with buffer, TDO5 C labeled CCEF CEM cells (control) and TDO5 C labeled Ramos cells (target).. ................................ ................................ ................................ ...... 60 2 8 Cell viability result using MTS assay.. ................................ ................................ 60 3 1 Design of p hotocontrollable DNA nanostructure using azobenzenes.. ............... 73

PAGE 11

11 3 2 A) Native polyacrylamide gel electrophoresis (6%) analysis of different azo incorporated tetrahedral structures at 4 C. B) AFM image of T 10Azo structures recorded with 10nm tips.. ................................ ................................ ... 74 3 3 Fluorescencent characterization of DNA tetrahedral structure with photocontrollability ................................ ................................ ............................. 74 3 4 Illustration of gold nanoparticle (AuNP) assembly on three vertices of the variational triangular faces of tetrahedra by a phosphorothioate anchor and a short bifunctional fastener (BF).. ................................ ................................ ......... 75 3 5 TEM images of AuNPs assembled on three vertices of the variational triangular face of tetrahedra.. ................................ ................................ ............. 75 4 1 Working Scheme of molecular circuit.. ................................ ............................. 101 4 2 Reaction pathways of DNA input and Output (O) with the aid of Fuel (F). The design follows the procedure described by Qian and Winfree. 51 ...................... 102 4 3 Absorbance of chromogenic peptide hydrolysis product vs. time for different concentrations of thrombin.. ................................ ................................ ............. 103 4 4 A) Absorbance change of chromogenic hydrolysis product as a function of time with 300 nM thrombin preincubated with 150 nM, 300 nM, 600 nM and 15. B) Absorbance cha nge of chromogenic hydrolysis product as 15 and TA 29. ................................ ................................ ................................ ............... 103 4 5 Absorbance of chromogenic peptide hydrolysis product as a function of time in the presence of different thrombin concentrations with the aptamer circuit.. 104 4 6 Fluorescence kinetics of FRET based A I duplex (100 nM) in the presence of 0 nM, 200 nM, and 500 nM thrombin. ................................ ............................... 104 4 7 Validation of the signal transduction in the Input Converto r module.. ............... 105 4 8 Fluorescence calibration curve for d ifferent concentrations of FAM labeled TA 29.. ................................ ................................ ................................ .............. 105 4 9 Validation of the signal transduction in the Threshold Controller and Inhibitor Generator modules.. ................................ ................................ ......................... 106 4 10 Fluorescence output versus DNA input concentration plot.. ............................. 107 4 11 Fluorescence output versus thrombin concentration plot with two preset threshold values (concentration of Tmb) at 100 nM and 200 nM.. .................... 108 4 12 Inhibitory effects of different concentrations of TA 15 and TA 29 on thrombin. 109

PAGE 12

12 4 13 Absorbance changes of chromogenic peptide substrate for different thrombin concentrations using the design in Figure 4 1. ................................ ................. 109 4 14 Working scheme of Inhibitor Generator 2.. ................................ ....................... 110 4 15 different thrombin concentrations with and without circuit. B) V obs of the enzymatic reaction upon different thrombin concentrations with and without circuit. ................................ ................................ ................................ ............... 110 4 16 A). Plot of theoretical [DNA input] vs. time. B). Plot of theoretical [Tmb TA15] vs. time. ................................ ................................ ................................ ............ 111 4 17 A) Plot of [DNA input] vs. for different values, where a is the concentration ratio of [Tmb] and [A input] vs. Here, input] was calculated by using ([DNA input] a=4 ) ([DNA input] a=0.5 ). C) The zoom in plot of (B). ................................ ................................ ...... 111 5 1 Working principle of AIS biomimicry system.. ................................ ................... 127 5 2 The proposed entropy driven catalytic pathway. 49 ................................ ........... 128 5 3 Fluorescence studies of the reaction priority between steps 1 and 2, as well as the catalytic effect of TM on the reaction of BM and P 0 .. ............................. 129 5 4 Fluorescence kinetics of the system with different P 0 additions.. ...................... 129 5 5 Analysis by PAGE (10% native gel) of the reaction pathway in step 1 and 2.. 130 5 6 A) Scheme of primer assisted RCA reaction and plot of fluorescence restoration versus different concentrations of primer 12a. B) Scheme of the design of mismatch points on PG and result of fluorescence e nhancement fold versus different concentrations of ssDNA PI and Phi29.. .......................... 131 5 7 Scheme of the primer initiated RCA product cut by SsPI restriction enzyme and their analysis by PAGE (8% denatured gel at 4 C). ................................ ... 132 5 8 Experimental results of the entire system with pathogen input.. ....................... 133 5 9 Gel analysis by PAGE (8% denatured gel) for the entire AIS mimicry system with SsPI restriction enzyme.. ................................ ................................ ........... 134 5 10 Analysis by PAGE (8% denatured gel) of the preparation of circular template (CP). ................................ ................................ ................................ ................. 135

PAGE 13

13 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy MOL ECULAR ENGINEERING OF DNA BASED SYSTEM S FOR INTELLIGENT THERAPY By Da Han December 2013 Chair: Weihon g Tan Major: Chemistry Nucleic acids, as biological macromolecules essential for life, play major roles in transferring, encoding and expressing genetic information across generations, as well as in regulating biological reactions. As an effective way to explore unique and versatile functions of nucleic acids molecular engineering focus es on understanding the physical behavior of nucleic acids under different conditions and the effects of possible chemical modifications The central theme of this thesis is to develop intelligent therapy on the molecular level via molecular engineerin g method s In the first phase of the research an aptamer based DNA nanocircuit was designed for the selective recognition of cancer cells, controllable activation of a photosensitizer and amplification of the photodynamic therapeutic effect. The apta mers can selectively recognize target cancer cells and bind to the specific proteins on the cell membrane. Then the overhanging catalyst sequence on the aptamer trigger s a toehold mediated catalytic strand displacement to activate the photosensitizer and produ ce reactive singlet oxygen The specific binding induced activation allows the DNA circuit to distinguish diseased cells from healthy cells, reducing damage to nearby healthy cells. Moreover, the catalytic amplification reaction take s place close to the target

PAGE 14

14 cancer cells, resulting in a high local concentration of singlet oxygen to selectively kill the target cells. The principle employed in this study demonstrated the feasibility of assembling a DNA circuit on cell membranes and cou ld further broaden the utility of DNA circuits for applications in biology, biotechnology, and biomedicine. In the second project azobenzene incorporated DNA was used as a control agent to precisely monitor three dimensional DNA nanostructures. The shape of a DNA tetrahedron can be controlled by alternate irradiations with different wavelengths of light thus enabling the future application for intelligent drug deliver y manipulated by photo n s The third project involved de s cribing the first logical circuit based on DNA protein interactions with accurate threshold control, enabling autonomous, self sustained and programmable manipulation of protein activity in vitro Previous designs were based primarily on DNA hybridization and strand displacement reactions Th e new design uses diverse nucleic acid interactions with proteins. The circuit can precisely sense the local enzymatic environment, such as the concentration of thrombin, and when it is excessively high, a coagulation inhibitor is automatically release d by a concentration adjusted circuit module. To demonstrate the programmable and autonomous modulation, a molecular circuit with different threshold concentrations of thrombin was tested as a proof of principle. In the future, the advantages of tunable re gulation, design modularity and target specificity of this prototype could lead to the development of novel DNA biochemical circuits to control the delivery of aptamer based drugs in smart and personalized medicine, providing a more efficient and safer the rapeutic strategy. Finally an artificial DNA biomimetic network was developed for vertebrate acquired immune s ystem The dynamic networks o f biochemical reactions display

PAGE 15

15 extremely complex functional behaviors which can be classified as specific recogniti on, ant igen tolerance, immune response, and long term memory. We have reproduced such functions by the rational design of dynamic reaction networks based on DNA biochemistry. Rather than enrolling cellular components as in the real acquired immune system i n vivo we use d DNA and enzyme s as simplified and artificial analogs to mimic their systematic response to specific molecular stimuli in vitro Building on the successful implementation of each step, our results show patterns that follow the macroscopic be haviors of vertebrate acquired immune system. This approach provides rational and simplified bottom up construction strate gies to design complex biomimietic reaction networks.

PAGE 16

16 CHAPTER 1 INTRODUCTION Nucleic Acids and the rt of M olecular E ngineering Battling diseases has been a never ending task in human history. Current studies reveal that many diseases are char acterized by abnormal behavior on the molecular level, such as deviant gene expression. The key to the effective and successful treatment of disease is the development of intelligent diagnostic and therapeutic methods including specific recognition of targets, precise control of drug release with temporal and spatial resolution, and effectiv e inhibition of drug side effects. Molecular tools that can specifically recognize disease related biomarkers, and then efficiently regulate abnormal functions of targets will greatly facilitate the development of intelligent therapy. Among many potential molecular tools, functional nucleic acid tools hold great promise in a variety of diagnostic and therapeutic applications. Functional n ucleic acid probes, such as molecular beacon biosensors, 1 2 and molecular targeting ligands, 3 have shown to be sensitive and selective in recognizing disease related biomarkers. In addition, nucleic acid nanotechnology has been developed by employing DNA and RNA as basic building blocks for designing various nanostruc tures and nanocircuits which may be used for material, biological and medical applications 4 5 The investigation of the physical behavior s of nucleic acid s under different conditions as well as their possible chemical properties, are critical factors in the development of new functions. Conseque ntly, these studies have given ri se to a nucleic acid T his dissertation focu s es on engineering nucleic acids into molecular tools for intelligent diagnosis and therapy of diseases.

PAGE 17

17 Structures and Chemical Synthesis of Nucleic Acids Nucleic acids are biological macromolecules essential for life, including DNA (deoxyribonucleic ac id) and RNA (ribonucleic acid). The basic building block s of nucleic acids are called nucleotides, comprised of a pentose sugar ring (2 deoxyribose in DNA and ribose in RNA) a phosphate and a nucleobase ( purine or pyrimidine ) Different nucleotides are li nked to each other in an alternating chain to form an oligonucleotide (sugar phosphate backbone) through phosphodiester linkages (Fig.1 1) T he topological structure of DNA was first discovered by James Watson and Francis Crick in 1953. 6 In their models, two single stranded oligonucleides form an anti parallel duplex structure following the base complementary principle ( s rule ), in which specific base s interact with each other mainly through hydrogen bonds. (Fig.1 2) There are five types of natural bases to compose DNA and RNA sequences: adenine (abbreviated A), cytosine (C), guanine (G), thymine (T) only found in DNA, an d uracil (U) only found in RNA According to for DNA duplexes the hydrogen bond pairs are between G C and A T, while for RNA duplex es, the pairs are G C and A U. Noticeably, the sequence stability of DNA duplex is dependent on the DNA sequence length and the number and ratio of G C bas e pairs which have three hydrogen bonds to A T pairs (two hydrogen bonds) As important biological macromolecules nucleic acids mainly carry the functions of transfer ring and encoding genetic inform ation across generations Furthermore, they are also extremely important for regulation of biological reactions, as well as expression of numerous functional components. 7 Many advances in nucleic acid chemistry have advanced since 1992, when Beaucage developed an automated solid support system for synthesis of nucleic acid chains via phosphoramidite chemistry. 8 9 As shown in

PAGE 18

18 Fig.1 3 the phosphoramidites are composed of a base, a sugar ring and protection groups (di methoxytrityl (DMT), diisopropylamino, and 2 cyanoethyl). In addition, a solid support called CPG (controlled pore glass) is used to load the starting reactant phosphoramidite s. The basic procedure includes: (1) dichloroacetic acid (DCA) detritylation of D MT ( dimethoxytrityl ) protected phosphoramidite to for m hydroxyl group; (2) tetrazole activation to protonate the nitrogen of the incoming nucleotide and to form the phosphate linkage; (3) acetic anhydride and N methylimidazole capping to block the r emaining active hydroxyl group ; and finally (4) iodine oxidation to generate the phosphate ester bond (Fig.1 4) Other modifications, such as addition of fluorophores, quenchers, biotin etc, can be introduced into any desired position of an olig o nucleot ide, if they can be converted into a phospho r amidite derivative and is compatible with DNA synthesis process. To facilitate the synthesis yield and speed, nucleic acid synthesizer is mainly applied to implement the synthesis procedure. After many cycles of this synthesis, oligonucleotide s with pre designed sequences and lengths can be prepared However, due to incomplete reactions and limited chemical reaction yields, the products actually contain a mixture of multiple oligonucleotide species in different l ength s requiring off machine purification, which is usually carried out using high performance liquid chromatography (HPLC). Specifically, the nucleic acids tethered on the CPG are cleaved by reaction with weakly basic conditions (generally ammonium hydrox ide or a mixture with other additives) at a high temperature. The collected products can then be purified by HPLC with a typical mobile phase of acetonitrile and 0.1M triethylammonium (TEAA) water solution and a reverse d phase C 18 column. The purified nuc leic acid sample s are incubated with weak acid

PAGE 19

19 (generally 80% acetic acid) to remove the DMT group, and the concentration s are determined by measuring the absorbance at 260nm. Functional Nucleic Acids : Aptamers As discussed above b oth DNA and RNA particip ate in genetic storage and transfer. Moreover they can also be employed as enzymes (for catalysis) and receptors (for ligand binding). Increasingly, researchers are making interesting use of these molecules, now collectively called functional nucleic acid s. N atural functional nucleic acids include ribozymes, alloste ric ribozymes and riboswitches, while a rtif icial functional nucleic acids comprise aptamers, ribozymes and deoxyribozymes by in vitro selection Among the most intensively studied functional nucleic acids are aptamers single stranded oligonucleotides that fold into unique three dimensional structures, allowing them to bind specifically to a broad range of target molecules or even whole cells. They are isolated via an in vitro selection process named system atic evolution of ligands by exponential enrichment (SELEX) against various targets. 10 13 As mimics of antibodies, aptamers have some unique advantages such as high recognition specificity, excellent stability, reproducible synthesis and non toxicity, which make them novel molecular probes capable of replacing antibodies. Furthermore, the flexibility and programmability of aptamers provide researchers broad opportunities for molecular engineering, maki ng aptamers adaptive for more innovative applications, such as drug delivery, 14 signal transduction 15 and biosensing. 16 In the SELEX process, a target and perhaps a possibly negative control are chosen firstly Then a DNA/RNA library is designed to have a random sequence of 30 40 bases and two primer sequences flanked by 18 20 bases for polymerase chain

PAGE 20

20 reaction amplification (PCR). Because the DNA/RNA library contains 10 13 10 16 different DNA molecules, suitable aptamers will ultimately be selected from it. A typical selection cycle is shown in Figure 1 5. First, the library pool is incubated with the target, leading to the binding between the target molecules and specific porti ons of the li brary. After physically separating the strong binders from the remains of the pool the library can be further narrowed using only the high affinity sequences, which is the key concept of the entire SELEX process. As another important step, PC R is used to amplify the remaining eluted sequences after separation from the target. 17 Afterwards, the eluted ssDNA is considered as the enriched pool for the first round and used as library for the next round. To improve the selectivity of aptamers, c ounter selection is usually implemented by incubating the amplified sequences with the negative controls. In counter selection, the negative control is incubated with eluted sequences and only the unbound probes are collected and amplified by PCR. In this way, the nucleic acid sequences with unspecific binding can be removed. Herein, the concentration of targets, DNA, ionic strength, incubation time and temperature can be optimized to provide more stringent condition s to favor the selection of aptamers with high affinity. In most cases, the pool c an be highly enriched after 10 20 rounds of selection cycles. After sequencing the selected aptamers, it i s possible to re synthesize them and evaluate their binding affinities i.e. K d which are in the M to nM ra nge for useful aptamers. As a successful expansion of the SELEX technique, our group has developed a whole cell SELEX (Cell SELEX) strategy to generate panels of aptamers recognizing different types of cancer cells including acute lymphoblastic leukemia ( ALL) (T cell

PAGE 21

21 leukemia), 18 liver cancer, 19 acute myeloid leukemia (AML) leukemia, 20 l ung cancer, 21 22 ovarian cancer, 23 B cell lymphoma, 24 colorectal cancer, 25 and breast cancer 26 Cell SELEX provides a unique set of capabilies, such as obtaining aptamers that target specific cells without prior knowledge of the molecular differences between target and nontarget cells as well as simultaneous g eneration of a panel of aptamers, which may have different molecular targets. Cell SELEX has not only provided specific molecular probes for cancer diagnosis, but has also facilitated clinical therapy to identify new cancer drugs and tumor treatment. Photo controllable DNA Nanostructures DNA N anostructures The DNA molecule has appealing features for use in the field of nano assembly. First its minuscule size, with a diameter of about 2 nanometer s, matches the size requirement for nano assembly. Second the reversible, specific and stable hybridization betwe en complementary strands enable s the construction of robust building blocks with various pre designed shapes In addition, the possibility of predicting the hybridization behavior by computer programs facilitates programmable and autonomous structural design, thus greatly improving the assembly yield. The field of DNA nanostructures was pioneered in the 1980 s by Nadrian Seeman In his design, the basic building block is called a D NA title which is a DNA nanostructure having a number of sticky ends (pads) on its sides. (Fig.1 6A) Another of his structural concept is termed as DNA lattice which is a DNA nanostructure composed of a group of DNA tiles that are assembled together via hybridization of their pads. Generally the strands composing the DNA tiles are designed to have melting temperature s above those of the pads, ensuring that when the component DNA

PAGE 22

22 molecules are combined in solution, the DNA tiles assemble first, and only th en, as the solution is further cooled, do the tiles bind together via hybridization of their pads. Subsequently, w ith proper sticky ends design, these tiles were successfully self assembled into linear arrays, 27 2D lattices, 28 29 and DNA tubes. 30 Figure 1 5 shows some examples of different DNA nanostructures using DNA tiles as building blocks. Another significant method to prepare DNA nanostructures was developed by Rothemund in 2006. 31 His approach t makes use of a long strand e.g., from the genome of a viral phage) that has only weak secondary structure. (Fig. 1 6B) After the addition of a large number of relatively short ences complementary to certain sub sequences of the scaffold ssDNA, the long scaffold can be induce d to fold into a fully addressable 2D DNA nanostructure. This method allows for the construction of arbitrary patterns with computer assist ance including rec tangle s stars, smiley faces, maps and other 2D shapes. In addition, DNA origami provide s the opportunity to position molecules or objects with nanoscale precision, for use in nanoparticle assembly 32 and protein nanoarrays. 33 34 Other than 2D DNA nanostructures, 3D DNA nanostructures have also been investigated to provide more profound knowledge of the molecular structures of DNA. Shih et al. 35 first built a rigid DNA octahedron by folding a 1.7 kb s sDNA in the presence of five 40 mer helper strands Turberfield et al. and Mao et al developed a series of DNA 3D structures, including tetrahedra, dodecahedra, and buckyballs using a one pot annealing strategy 36 37 Other 3D DNA nanostructures with controllable shape or pattern change include a nanobox 38 with controllable lids and a nanobucket with

PAGE 23

23 intelligent covers. 39 These 3D DNA reconfigurable nanostructures, although still in their infancy, have great potential for use in drug delivery and tissue engineering. Azobenzene and Azobenzene Incorporated DNA Azobenzene is a chemical compound with two phenyl rings linked by a N=N double bond The most attractive feature of this molecule is p hoto isomerization, which can be induced by alternative exposure to light i rradiation with different energies (wavelength). 40 Specifically, t he azobenzene isomerizes from its planar trans form to the non planar cis form after UV light irradiation (300nm ~ 400nm), and back to the trans form after irradiation with visible light (400nm ~ 500nm). This process is completely reversible u nder UV and visible irradiation and can be used in triggering photo initiating or photo regulating processes The successful synthesis of an azobenzene phosphoramidite derivative has enabled the manufacture of azobenzene incorporated DNA molecules as well as photosensitive DNA nanostructures. 41 The mec hanism of this photo controlled DNA behavior has been shown to result from the isome rization of azobenzene moieties, which induces hybridization/dehybridization between complementary stands. 42 When the azobenzene incorporated DNA is irradi ated with visible light, the azobenzene moieties adopt the planar trans conf iguration and stabilize the hybridization by aromatic stacking interactions. When irradiated with UV light, the azobenzene moieties isomerize to the non planar cis conf iguration and disrupt the duplex structure by steric hindrance (Fig.1 6). Therefore, b y incorporating azobenzene moieties into DNA nano structures, shapes mediated by strand hybridization can be controlled by the

PAGE 24

24 interconversion of azobenzene moieties, allo wing the construction of photocontrollable DNA nano structures. 43 44 DNA B ased Logical Devices Overview of DNA based Computation S ilicon based computers h ave been intensively applied in a vast array of areas, because of the properties such as unprecedented computing power seamless coupling ability and incredible adaptability. However, the development of more powerful microprocessors is heading towards a barrier, due to the physical limitations of conventional silicon chips C ontinued progress will require miniaturization their components w hich may af fect the instrumental performance. 45 To address the challenge ahead, researchers have been pursuing the idea of constructing computers in which co mputations are performed by individual molecules, as they may allow the continuously exponential increase in performance and decrease in size for microprocessors. Nucleic acids have been found extremely effective for miniaturization of information storage, because only approximately 50 atoms are used for one bit of information. In addition, the easy chemical synthesis, combinatorial structures and Watson Crick co mplementarity principle provide sufficient theoretical and experimental basis for design of log ical devices Therefore, researchers have challenged themselves to use DNA or RNA to build logical devices for molecular computation. As early as 1994, Leonard Adleman used DNA to solve a computational problem. He encoded the Hamiltonian path problem into different ssDNA sequences and applied biotechnologies (such as Ligation, PCR, Sequencing) to decode the answers to the correct Hamiltonian path. 5

PAGE 25

25 However, subsequent p rogress in constructing molecular computing devices has been frustratingly slow. Scientists have demon strated t hat DNA based biocircuitry can perform logic gate operations, signal restoration, amplification, feedback, and cascading, all by distinct DNA strands 46 But the chief objective is still to emulate or mimic the digital logic found in typical circuit boa rds with computing power far from rivaling that of silicon computers on the execution of any algorithm. It has be come increasingly clear that the ability to interact with naturally occurring biomolecules, together with such unique properties as programmabi lity, nanometric size, and autonomous operation, can be used for practical application s of NA based logical devices. T h is has allowed biological properties to be interfaced to other materials and has opened a novel and exciting direction in biological and biomedical applications. Construction of DNA C ircuit : Toehold Mediated Strand Displacement A detailed understanding of nucleic acids including the specific connectivity of the nucleotides, the Watson Crick base pairing, and the double helical structure of the double stranded DNA (dsDNA) provides the theoretical basis f or constructing DNA based logical devices. To engineer complex logi cal modules from molecules, the stereotypical structures of these modules should include three component s corresponding to input, processor and output. In addition, specific mechanism should be employed t o allow the signal transfer through these elements. For DNA based devices, several common strategies to make circuit construction a predictive science are described One significant mechanism to construct a DNA based logical network is the toehold m ediated displacement reaction 47 i n which s dsDNA to displace one strand (output) of the dsDNA through binding to an overhang ing

PAGE 26

26 s sDNA region (toehold) of the dsDNA. As shown in Fig. 1 8A this reaction involves a three step process including toehold binding, branch migration and strand dissociation. Toehold binding occurs via the complementary sequences of the input ssDNA and the t oehold. The displacement rate can be adjusted by changing the toehold base numbers. Branch migration is a reversible process with the same binding sequences between the input and output, e xcept that, the rem ainder of each sequence can be freely designed, allowing the design diversity of a logical network. Although signal cascading by this classic toehold displacement reaction allows programmability of circuitry design, this methodology is feasible only for s imple circuits which allow initial information processing. One important reason is that the displacement reaction requires longer strand to displace shorter one, resulting decreasing sequence freedom for the downstream strands, thus lead ing to small amount of circuit layer assembly. In order to improve circuit complexity, people have developed toehold exchange displacement. (Fig 1 8B) The incoming single strand can plementary to the bottom str and. This can still allow the displacement reaction occur, but the displaced strand will also have a single strand toehold region that may initiate the backward displacement reaction. 48 This will result in a reversible DNA displacement reaction with the input and outp ut signals of the s ame sequence length. To drive the reaction in the forward direction a smart toehold exchange reaction has been developed in which a fuel strand with m uch higher concentration creates a catalytic cycle and allows the input sequence to be converted to outp ut without being consumed 49 The reaction described above is driven forward by the entropy of equilibration for entire circuits. With t his mechanism at hand,

PAGE 27

27 Q ian et al constructed DNA based logical circuit s with much highly complexity, including a neural network having 110 DNA strands that demonstrates associative memory capable of answering 81 possible questions, 50 as well as a 130 stra nded DNA computer capable of computing the square root of a 4 digit binary number. 51 DNA based Circuit for Analytical and Biomedical Applications Signal amplification is an important strategy in the development of molecular systems with increased responsiveness Recent advances in the field of nucleic acids have generated DNA based circuits, in which enzyme free signal amplification can be achieved by simple nucleic acid hybridization Compared to traditional enzyme based amplification, pure DNA based amplification ha s the advantages of robust adaptability flexible engineering and the feasibility for intracellular applications. Dirks and Pierce demonstrated an isothermal, enzyme free method for highly sensitive detection of a particular DNA strand. 52 The protocol made use of multiple copies of two distinct DNA hairpins that are initially stable without any cross hybridization. A ssDNA sequence is able to initiate hybridization between the two hairpins, allowing the cascade effect to occur comp letely and autonomously In addition, Z hang et al. developed a general methodology for designing amplification circuits with pure DNA molecules by using entropy driven catalytic reactions 53 S uch DNA logical circuits have applications to a variety of analytical procedures in which a l arger response (e.g., a cascade response) is needed as output in response to one of multiple molecular detection events. In addition to their analytical applicati ons r esearchers increasingly envision an important role for artificial DNA based circuits in biological engineering For example, DNA based circuits could be utilized as a type of servomechanism to manipulate the functions of biological molecules in vitro 54 and regulate gene expressions in vivo 55 Also

PAGE 28

28 as discussed above because of their roles in monitor ing biological reactions, functional nucleic acids provide excellent platforms to bridge nucleic acid based circuit s to other biological components (such as proteins and carbohydrates ). By involving functional nucleic acid components into a circuit, smart and flexible manipulation of their functions can be realized, thus extending the biological and biomedical applications of nucleic acid based circuit ry (Fig.1 9) DNA based B io mim i cry The design of artificial chemical alternatives that mimic living systems, especially in regard to complex self organizing systems, has been an effective means to elucidate biological process. Likewise natural systems also provide us w ith insight into the design and c onstruction of artificial mimicry system s For instance, inspired by the self construction of various nanostructures using molecular int eractions without external guidance However, to mimic complex natural system, many challenges need to be overcome, including controlling pr ogrammability and systemization as well as transferring high level biological codes into simple artificial modules and physical implementations. Another difficulty involves forming robust molecular structures and precisely controlling their temporal dynamics. As discussed above b uilding on the richness of DNA logical circuit construction, synthetic DNA based systems h ave been used to explore the possibilities of mimicking both simple and complex systems. For example, small scale in vitro circuits encoding elementary functions, such as counters 56 bistable memory, 57 or oscillations 58 have successfully been engineered. In addition, larger networks including mimicry of the neural network 50 a nd predator prey ecosystem s 59 60 continue to demonstrate the excellence of DNA bi ochemistry for

PAGE 29

29 biomimicry implementation. These successful investigations definitely will broaden the scope of using DNA to mimic complex natural system s for various applications.

PAGE 30

30 Figure 1 1 Chemical structure of nucleic acids and nucleosides

PAGE 31

31 F igure 1 2. S tructure of DNA duplex and scheme of

PAGE 32

32 Figure 1 3. Chemical structure of DNA phosphoramidite

PAGE 33

33 Figure 1 4. Automated oligonucleotide synthesis based on phosphoramidite chemistry

PAGE 34

34 Figure 1 5 Scheme of Systematic Evolution of Ligands by EXponential enrichment (SELEX)

PAGE 35

35 Figure 1 6. A) Illustration of some DNA titles. 61 B) Schematic folding of DNA origami Reprinted by permission from Paul Rothemund Folding DNA to create nanoscale shapes and patterns (Page 298, Figure 1 e), Nature 440, Page 297 302, 2006, Macmilla n Publishers Ltd, New York, USA.

PAGE 36

36 Figure 1 7. Scheme of the reversible hybridization/dehybridization of an azobenzene incorporated DNA duplex

PAGE 37

37 Figure 1 8. A) Scheme of toehold m ediated d isplacement reaction. B) Scheme of toehold exchange displacement reaction

PAGE 38

38 Figure 1 9. Example of functional nucleic acid based circuit for biological and biomedical applications

PAGE 39

39 CHAPTER 2 MOLECULAR ENGINEERING OF A CELL SURFACE A PTAMER CIRCUIT FOR TARGETED AND AMPLIFIED PHOTODYNAMIC CANCER THERAPY Significance and Background As a minimally invasive therapeutic modality, photodynamic therapy (PDT) is already greatly used in clinical treatment of cancers. PDT can destroy cancer cell s when light irradiates a photosensitizer (PS), generating reactive singlet oxygen ( 1 O 2 ). 62 Briefly, PDT involves a two step process, whereby a nontoxic PS is delivered to an organism and then activated by an appropriate light source. However, because the 1 O 2 has a limited lifetime and diffusion distance, efficient and reliable PDT depends on generating 1 O 2 with methods that offer the greatest selectivity. 63 PDT selectivity is usuall y controlled at two levels. The first level controls the spatial localization of PS reagents. This approach has been actively pursued by specifically delivering PS to the tumor site with regional light shining, which has effectively improved PDT selectivity and effici ency. 64 65 But the tendency to cause damage to surrounding normal tissues still exists. To achieve greater selectivity, a molecular activation layer is added to further control the specificity of the PS. At this level, the probe initially stays in the n ontoxic state and can only be activated when it interacts with its corresponding trigger at the tumor site. For example, we and others have developed activatable PDT methods which can be triggered by biomarkers, including membrane proteins 66 and extracellular proteases, 67 as well as cellular environments ( e.g. pH) 68 or other external stimuli, including artificial molecular switches. 69 71 Molecular activation allows the PS to distinguish diseased from healthy cells, thus greatly improving the selectivity of PDT.

PAGE 40

40 To achieve higher oncolytic efficacy in tumors, a sufficient dosage of drugs should be administered at the tumor site. However, greater selectivity is typically achieved by introducing multiple activation processes, but at the cost of decreasing the active drug amounts at the tumor site. For example, the triggers of activatable PDT are usually biomarkers pr esent inside or outside the cells. However, the limited amount of trigger elements in the disease cells coupled with low activation efficiency may dramatically decrease the activation and killing effects of the PS. Selective amplification would effectively solve this problem. Researchers have applied some enzymes, such as protease whose overexpression is correlated with specific diseases, to continually catalyze PS activation, thereby amplifying the PDT effects. 72 However, the application of enzymes is often limited by their microenvironment, including pH and temperature, in turn reducing the applications of enzyme activatable PDT. Thus, to achieve more robust PDT with selectivity and amplification effect, a suitab le medium is required that can both recognize the target cell and amplify the therapeutic effect. As carriers of genetic information with well regulated and predictable structures, nucleic acids are promising materials for signal amplification based on their nanometer size and programmability. Recent advances in the field of nucleic acids have generated nucleic acid based circuits, in which enzyme free signal amplification can be achieved by simple nucleic acid hybridization, such as hybridization chain reaction, 52 73 entropy triggered hybridization catalysis 49 and DNA hairpin fue l catalysis. 74 75 These methods show promise in amplifying PDT with such properties as high amplification efficiency, environmental robustness and ability to interact with other naturally occurring molecules. Meanwhile, the exploration and development of special single stranded

PAGE 41

41 oligonucleotides, well known as aptamers, 10 76 77 have extended the recognition c apabilities of nucleic acids from Watson Crick base pairing to interactions with various targets, such as small molecules, 78 proteins, 79 and cells, 80 secondary or tertiary structures. We recently dev eloped an effective method to generate aptamer based molecular probes for the specific recognition and targeting of cancer cells. 81 83 Therefore, by combining the recognition and amplification abilities of these oligonucleotide s, more efficient and specific PDT methods can be developed. In this chapter we report the design of an aptamer based DNA circuit capable of the selective recognition of cancer cells, controllable activation of PS and amplification of therapeutic effect. In particular, the amplification circuit motif comprises two DNA hairpins developed by Yin et al. 74 and Li et al. 75 I n principle, two DNA hairpin structures, A 1 and A 2 initially do not hybridize with each other because of the effective block created by complementary domains. However, in the presence of another ssDNA sequence, termed catalyst (C), A 1 and A 2 can form a sta ble duplex without consuming C. As shown in Figure 2 1, A 1 A 2 and C contain a few functional domains labeled in lowercase letters. Complementarity between lettered domains is denoted by an asterisk. Initially, C can hybridize with the exposed toehold doma in a of A 1 and gradually open the stem of A 1 to form intermediate A 1 C, but A 1 C has an exposed ssDNA domain c* able to hybridize with the exposed domain c in A 2 Hence, after hybridization of c and c*, the sequence dc*b*d will undergo branch migration and d isplace the C sequence (c*b*a*) to form the A 12 duplex. Importantly, the released C triggers further hybridizations of A 1 and A 2 in repeating cycles, thus providing the multiple trigger effect absent in previous models. In this example, C catalyzes the for mation of duplex A 12

PAGE 42

42 from A 1 and A 2 through a prescribed reaction pathway. The overall reaction is driven by a decrease in enthalpy resulting from the formation of A 12 with a greater number of base pairs. Selectivity is achieved by encoding the catalyst s equence C (a*b*c*) into an aptamer sequence (Apt C) that targets cancer cells. To avoid forming undesired secondary structures, 17 poly T bases are used to separate the aptamer sequence and C. Under these conditions, the aptamer part can bind to the recept or on the target cancer cell membrane with a tail (C) exposed for the catalytic hybridizations of A 1 and A 2 Thus, one aptamer binding event can induce multiple hybridization events between A 1 and A 2 to form dsDNA A 12 and the all important amplification s tep essentially derives from the catalytic reaction. To apply this cell catalyzed hairpin amplification circuit to PDT therapy, dsDNA sequences denoted as R 12 are employed to carry the photodynamic therapeutic reagents. Because of its high photosensitizing efficacy and low dark toxicity, Chlorin e6 (Ce6), a second generation and easily modifiable photosensitizer, is modified on ssDNA R 1 and a quencher, BHQ2, i s conjugated on ssDNA R 2 to quench the generation of 1 O 2 by Ce6 when no target cell is present. This design has several advantages. First, specific binding induced activation allows the DNA circuit to distinguish diseased cells from healthy cells, reducing damage to nearby healthy cells which otherwise might be destroyed during PDT with conventional photosensitizers. Second, since the circulatory system in vivo can flush away the unbound aptamers and the catalyst C with aptamer is only present on the targe t cell membrane, the catalytic reaction will only take place close to the target cancer cells, resulting in a high local concentration of 1 O 2 to

PAGE 43

43 selectively kill the target cells. Third, traditional aptamer based PDT has suffered from the drawback of insuf ficient killing effects from the 1:1 binding induced singlet oxygen generation (SOG). While, in this new design, by incorporating the catalyst sequences of the hairpin amplification circuit on cell membranes, numerous binding induced SOG events can be real ized on each cell membrane. In addition, the uncatalyzed background of the circuit is nearly undetectable, resulting in fewer side effects to other healthy cells. Finally, to our best knowledge, this is the first design using the target cancer cell as the trigger to drive the DNA hybridizations. As such, this method may provide a universal strategy for signal amplification on cell membranes. Experimental Materials and Methods Cell Culture Ramos (CRL 1596, B cell line, human Burkitt's lymphoma) and CCRF CEM (CCL 119, T cell line, human acute lymphoblastic leukemia) were cultured in RPMI 1640 medium (American Type Culture Collection) with 10% fetal bovine serum (FBS, Invitrogen, Carlsbad, CA, USA) and 0.5 mg/mL penicillin streptomycin (American Type Culture C ollection) at 37C under a 5% CO 2 atmosphere. Cells were washed before and after incubation with washing buffer [4.5 g/L glucose and 5 mM MgCl 2 in Dulbecco's PBS with calcium chloride and magnesium chloride (Sigma Aldrich)]. Binding buffer used for selecti on was prepared by adding yeast tRNA (0.1 mg/mL; Sigma Aldrich) and BSA (1 mg/mL; Fisher Scientific) to the wash buffer to reduce background binding. Ce6 Modified DNA S ynthesis end using the s ynthesis protocol specified by the company. After removing the MMT protection group amino of the sequence on machine, the CPG beads were washed with

PAGE 44

44 acetonitrile (ACN) 10 times and dried with nitrogen for off machine coupling of Ce6. Each Ce6 mol ecule has three carboxyl groups for conjugation with the amino group. To improve the coupling efficiency and reduce the multiple coupling products, the amount was mixed with dicyclohexylcarbodiimide (DCC, Sigma Aldrich, Inc.) and N hydroxysuccinimide (NHS, Sigma Aldrich, Inc.) and Dimethylformamide (DMF) for the activation reaction with 1 hr stirring. The coupling react ion was performed with vigorous stirring overnight, followed by washing with ACN. Then the DNA product was purified by HPLC. DNA Purification Native PAGE was applied to purify the A 1 A 2 hairpin strands to remove excess strands and avoid undesired system l eakage. A 1 and A 2 were annealed at TAE Mg buffer (40 mM Tris Acetate EDTA, pH 8.0, 12.5 mM Mg(Ac) 2 ) and cooled to room temperature. Native PAGE gels (12%) in 1 TAE Mg buffer were run at 110 V for 90 minutes at 4C and stained with GelRed stain solution (Biotium, Inc., Hayward, CA). Only the sharp bands were cut from the gels, chopped into small pieces, and soaked in 1 TAE Mg 2+ buffer for 24 hr. The buffer was extracted and concentrated with centrifugal filter devices ( Millipore, Billerica, MA). Finally, the purified DNA sequences were quantified by UV spectrometry and kept in buffer for future use. Fluorescence Kinetics of DNA Hairpin Circuit in B uffer All fluorescence measurements were performed using a Fluorolog (Jobi n Yvon 1 A 2 were separately refolded

PAGE 45

45 in the Fluo buffer (20mM Tris, pH 7.5; 140mM NaCl; 5mM KCl). This and other refolding reactions involved heating to 90C for 1 min, followed by slowly decreasing the temperature to 25C at a rate of 0.1C s 1 After purification by gel electrophoresis, the R 1 R 2 in Fluo buffer An excess of R 2 ensures efficient quenching of R 1 but does not interfere with the readout of A 1 and A 2 A mixture of 100 nM A 1 100 nM A 2 and 150 nM R 12 was prepared in 1Fluo buffer. The fluorescence at 518 nm was monitored at 25 C after adding different amounts of TDO5 C. To evaluate the amplification effect of the circuit, a 1:1 displacement reaction was performed under the same conditions by mixing 1 1 and A 2 in 1Fluo buffer and heating to 90C for 3 minutes, followed by slowly decreasing the temperature to 25 C to form the stable duplex A 12 A 150 nM sample of R 12 was incubated in 1Fluo buffer, followed by adding different concentrations of A 12 and monitoring the fluorescence. Test of Fluorescence Response and SOG of DNA Hairpin C ircuit For these experiments, Ce6 modifed R 1 and BHQ2 modified R 2 were used to form duplex R 12 To study the Ce6 fluorescence response to different concentrations of TDO5 C, 100 nM A 1 100 nM A 2 and 150 nM R 12 were mixed in 1Fluo buffer. The excitation wavelength was set at 404 nm with emission scanned from 600 nm to 800 with 100 nM A 1 100 nM A 2 and 150 nM R 12 in 1Fluo buffer. To extend the lifetime of 1 O 2 and increase the sensitivity of SOG assay, all buffers and samples were prepared using deuterium oxide. The SOG was triggered by irradiation at 404 nm, the maximum

PAGE 46

46 absorption of Ce6, for 10 minutes. The SOSG fluorescence was obtained with excitation at 494 nm and emission from 500 nm to 600 nm. Test of SOG Response of DNA Hairpin Circuit to Cancer Cells 310 5 of Ramos and CCRF buffer separ ately. Fifty pmol of nonlabeled TDO5 C were added and incubated for 30 minutes. After washing the cells twice with washing buffer, the two different cell types 1 100 nM A 2 and 150 nM R 12 were incu bated with cells for 1 hr. To extend the lifetime of 1 O 2 and increase the sensitivity of SOG assay, all buffers and samples were prepared using deuterium oxide. Two micromolar SOSG sensors were added to the cell medium, and SOG was triggered by irradiation at 404 nm, the maximum absorption of Ce6, for 10 minutes. The fluorescence was monitored at 2 5 C with the excitation wavelength at 494 nm and emission from 500 nm to 600 nm. Flow Cytometric Analysis In flow cytometry tubes, 250 nM Biotin labeled TDO5 or TDO5 C was incubated with 310 5 Ramos or CCRF minutes. The cells were washed twice with 1 mL of washing buffer, centrifuged at 1300 (1:400) Streptavidin conjugated PE dye was incubated with the cells for another 20 minutes and washed twice using washing buffer. The cells were analyzed on a FACScan Flow Cytometer by counting 30,000 events. The PE labeled unselected ssDNA library was use d as a negative control.

PAGE 47

47 Confocal Imaging of Cells Bound with Aptamer For confocal imaging, the Ramos and CCEF CEM cells were incubated with 50 pmol of TAMRA labeled TDO5 for 30 min. The cells were wa shed twice with 1 mL of washing buffer, centrifuged at microliters of cell suspension bound with TAMRA labeled TDO5 C were dropped on a thin glass slide placed above a 60 objecti ve on the confocal microscope. Imaging of the cells was performed on an Olympus FV500 IX81 confocal microscope. A 5 mW, 543 nm He Ne laser was the excitation source for TAMRA throughout the experiments. The objective used for imaging was a PLAPO60XO3PH 60 oil immersion objective with a numerical aperture of 1.40 (Olympus). Cytotoxicity Study The cytotoxicity study was performed using the CellTiter 96 Aqueous One Solution cell proliferation assay (MTS) for Ramos and CCRF CEM cell lines in a 96 well 1 2 modified R 12 ; group 3, cells incubated with the same amount of A 1 A 2 and R 12 preannealed A 12 modified R 12 For group 5, the cells w ere incubated with TDO5 C conjugates for 30 min at 4C, followed by centrifugation at 1300 rpm for 3 min to remove the unbound DNA. Then probes in the same amount as that of group 2 were added. All groups of cells were suspended in cell medium (No FBS) and then irradiated with white light on ice for 3 hr. After irradiation, the cells were incubated in a CO 2 incubator for 36 hr. Finally, a 6

PAGE 48

48 RPMI 1640 medium solution was added to each well and incubated at 37 C fo r 2 h. The absorbance value at 490 nm was determined by a VersaMax microplate reader (Molecular Devices, Inc., Sunnyvale, CA). Results and Discussion Signal Amplification E ffect of Aptamer C ircuit in Buffer To demonstrate the effectiveness of the C (a*b*c*) in catalyzing the A 1 and A 2 hybridization, native gel electrophoresis was used. As shown in Figure 2 2, without C, A 1 and A 2 can be present stably without hybridization. However, when C is added, A 1 and A 2 hybridize with each other to form A 12 wit h a yield even higher than that achieved by annealing of A 1 and A 2 To further study the amplification efficiency of the hairpin circuit, a FRET based dsDNA R 12 was designed with a stable fluorophore (FAM R 1 ) and quencher (DABCYL R 2 ) pair. To improve the t hermostability and anti enzymatic digestion ability of the R 12 duplex, we incorporated 4 LNA (Locked nucleic acid) nucleotides into FAM labeled R 1 84 C was linked to an aptamer sequence TDO5, 81 which targets acute lymphoblastic leukemia B cells (K d =74.7 nM) via a poly T linker. Thus, TDO5 C was used as catalyst to initiate the A 1 /A 2 hybridization, and the fluorescence was monit ored. In the presence of different concentrations of TDO5 C (0 20 nM), dramatic signal enhancement was observed (Fig. 2 3A), indicating the effective catalytic effect of TDO5 C. In addition, the signals approached a maximum in 2 hr, indicating rapid kineti cs of the catalytic hybridization. We also studied the fluorescence kinetics of the 1:1 displacement reaction (Fig. 2 3B). In particular, A 12 was prepared by annealing equal concentrations of A 1 and A 2 in advance. Then, different concentrations of A 12 wer e added to displace R 12 in buffer

PAGE 49

49 solution. In Figure 2 3C, the fluorescence enhancement ratio ( ) between catalytic amplification circuit (1:n) and displacement reaction (1:1) is 8 fold at the target concentration of 20 nM after a bout 2 hr, indicating high amplification efficiency of this circuit. For therapeutic applications with the DNA circuit, A 1 A 2 and R 12 will be present together in the deactivated forms around cells, and small leakage hybridizations may occur. Therefore, we tested the leakage hybridization rate by measuring the fluorescence of buffer solution containing A 1 A 2 and R without TDO5 C for 8 hr (Fig. 2 4). Although a small leakage did occur, the result indicated that the second order rate constant of uncatalyzed reaction could be estimated to be <10 M 1 s 1 which is almost negligible for PDT applications. Next, the photosensitizer Ce6 was conjugated to the ssDNA R 1 and the BHQ 2 quencher was modified with ssDNA R 2 Because of the close proximity between Ce6 and BHQ 2, up to 95% quenching efficiency of Ce6 was observed by our previous studies. 85 Herein, the DNA hairpin circuit had significant fluorescence enhancement upon the addition of different concentrations of TDO5 C. This was illustrated by the Ce6 fluorescence which increased up to 10 fold with 20 nM TDO5 C in buffer (Fig. 2 5). To evaluate the effect of different concentrations of TDO5 C on the amount of 1 O 2 generat ed by Ce6 modified R 1 singlet oxygen sensor green (SOSG) was added, and its fluorescence enhancement was measured before and after irradiation at 404 nm. As shown in Figure 2 3D, SOSG fluorescence increased 3 fold with the introduction of 20 nM TDO5 C in the span of 1 hr, indicating that SOG could be mediated by TDO5 C.

PAGE 50

50 Selective R ecognition Ability of the Aptamer Circuit For proof of concept, a leukemia cell line was chosen as the target. Compared with solid tumor cells, leukemia cells are widespread in the circulatory system and are surrounded by normal blood cells. Under these circumstances, any nonspecific cytotoxin would also destroy the normal blood cells. Therefore, a therapeutic method which can selectively recognize and kill the target leukemia ce lls is highly desirable. As mentioned above, aptamer TDO5, which binds to the cancer cell membrane protein IgM with high affinity and selectivity, was used in our study with target cancer cell Ramos (acute lymphoblastic leukemia B cells) and negative contr ol cell CCRF CEM (acute lymphoblastic leukemia T cells). Therefore, if TDO5 C is present, it recognizes the target cancer cells and, importantly, also catalyzes the DNA hairpin hybridization to trigger SOG around cells. First, the selective binding of TDO5 C to Ramos cells was demonstrated by flow cytometry, as shown in Figure 2 6 A and B. Herein, aptamer TDO5 was used as positive control. Compared with TDO5, TDO5 C showed almost equally strong binding affinity to Ramos cells at 4C, indicating that the cel l membranes were partially covered by TDO5 C. However, both TDO5 and TDO5 C exhibited weak affinity to the control CCRF CEM cells, as evidenced by only small fluorescence peak shifts. In addition, to confirm that TDO5 C was bound to the cell membrane surfa ce without internalization, confocal microscopy images were taken with TMR labeled TDO5 C incubated with Ramos and CCRF CEM cells (Fig. 2 6 C and D). Since only the cell membrane surface was labeled with fluorescence, the strong binding and low uptake effi ciency of TDO5 C makes it suitable for the catalysis of the hairpin circuit in close proximity to the target cancer cells.

PAGE 51

51 Singlet O xygen Amount with Different Cancer Cells To determine whether the amplification effect of TDO5 C remains active on the cell membrane, SOG was evaluated by incubating TDO5 C labeled cells with the circuit (A 1 A 2 and R 12 ) in PBS buffer, followed by adding SOSG sensor and monitoring the fluorescence. As shown in Figure 2 7, obvious SOSG fluorescence enhancement was observed when incubating the circuit with TDO5 C labeled target cells (Ramos), which can be attributed to the catalytic effect of TDO5 C on the target cell membranes. As a control, the SOG triggered by TDO5 C labeled CCRF CEM cells was studied. Little SOSG fluorescence enhancement was observed compared to the circuit only (A 1 A 2 and R 12 ), indicating that the selective binding of TDO5 C can induce selective SOG. Selective Cytotoxicity Effect to Cancer C ells Cell destruction by PDT was studied by irradiation with white light. As indicated by the SOSG studies, 1 O 2 is produced after the binding of TDO5 C with Ramos followed by the hybridization reaction of A 1 and A 2 to form A 12 and the displacement of R 1 from R 1 2 by A 12 Therefore, the phototoxicity of the cell surface circuit to cancer cells was studied by MTS [3 (4,5 dimethylthiazol 2 yl) 5 (3 carboxymethoxyphenyl) 2 (4 sulfophenyl) 2H tetrazolium] assay. After 3 hr of light irradiation, the target cells (Ramos ) and the control cells (CCRF CEM) were cultured for 36 hr before evaluating cell viability with MTS reagent. Figure 2 8 shows the MTS data expressed as the mean viability (standard deviation). The statistical differences were assessed by Student's t test. When A 1 A 2 and R 12 were combined with nonlabeled cells and irradiated with white light, very little damage was observed to either target or control cells (cell viability of around 85%). These data are consistent with the previous SOG resulting from the w eak leakage hybridizations of A 1 and A 2 However, when 100 nM free C was incubated

PAGE 52

52 with both cell lines, no statistical difference was evident (P > 0.30), and both cell types showed low cell viabilities of about 50%. Herein, because the free C sequence di d not selectively recognize target cells, it catalyzed the amplification reaction without selectivity and caused relatively equal cell death for both target cells and control cells. On the other hand, when each of the cell lines was first incubated with TD O5 C, rinsed, and then incubated with A 1 A 2 and R 12 high phototoxicity was observed for the target Ramos cells (45%), compared to 80% for the control cells (CCEF CEM) with P < 0.02, indicating that TDO5 C can catalyze the hairpin circuit on specific cell membranes. In addition, we also found that the statistical toxicity difference between (A 1 +A 2 + C+ R 12 ) group and (A 1 +A 2 + TDO5 C+ R 12 ) group is evident (P < 0.001) for CEM cells, but not for Ramos cells (P > 0.3) as the consequence of catalytic selectivi ty of TDO5 C. Finally, to compare the cytotoxicity of our method with the 1:1 displacement method, we incubated the preannealed A 12 (1 M) and R 12 with cells and found a much higher cell viability of 79% for both cell lines. Under these conditions, the 1:1 displacement method did not show any selectivity to the two cell lines based on the lack of recognition element (P > 0.30). These comparisons demonstrate the selective and amplified therapeutic effect of our method. Conclusions In conclusion, our results demonstrate the feasibility of assembling a DNA circuit on cell membranes to achieve amplified and targeted photodynamic therapy. The DNA circuit, composed of four functional modules (A 1 A 2 R 12 and TDO5 C) totally made of DNA, can greatly amplify the sin glet oxygen generation and selectively kill cancer cells. In particular, the DNA hairpin amplification circuit can be catalyzed by specifically designed nucleic acid sequences. Many nucleic acids, including messenger RNA,

PAGE 53

53 microRNAs and small interfering RN As, are important biomarkers for various diseases. 86 88 If sequences for these biomolecules are available, the amplification hairpin DNA circuit can be designed to perform other biological and biomedical functions inside targeted disease cells with effectiv e delivery methods. Second, increasing numbers of aptamers have been developed to target the membranes of a variety of cancer cell lines, thus establishing the universality of this DNA hairpin circuit for targeted and amplified therapy. Finally, as an appl ication of DNA circuit to biological cells, the prototype DNA circuit demonstrated here has the potential to enhance DNA technology with new insights and will broaden the utility of DNA circuits for applications in biology, biotechnology, and biomedicine.

PAGE 54

54 Table 2 1. Sequence of oligo nucleotides used in this chapter. LNA bases are indicated by bold and underscores. Sequence s (5 3 ) C (c*b*a*) CGACATCTAACCTAGC TCACTGAC A 1 (abcd*c*b*e*) GTCAGTGAGCTAGGTTAGATGTCGCCATGTGTAGACGAC ATCTAACCTAGC ACTTGTCATAGAGCAC A 2 (cdc*b*d*) AGATGTCGTCTACACATGGCGACATCTAACCTAGC CCAT GTGTAGA R 1 (eb) R 1 LNA (eb) R 2 (b) TDO5 TDO5 C Ce6 (FAM) GTGCTCTATGACAAGT GCTAGGTT Ce6 (FAM) G T GC T C T A T GACAAGT GCTAGGTT ACTTGTCATAGAGCAC BHQ2 (DABCYL) AACACCGTGGAGGATAGTTCGGTGGCTGTTCAGGGTCTC CTCCCGGTG CGACATCTAACCTAGCTCACTGACTTTTTTTTTTTTTTTTT AACACCGTGG AGGATAGTTCGGTGGCTG TTCAGGGTCTC C TCCCG GTG

PAGE 55

55 Figure 2 1. Illustration of DNA aptamer circuit on cell membrane. A). Scheme of the circuit without catalyst. B). Scheme of the circuit on cell membrane. The circuit involves two individual steps. In the catalytic step, target cell labeled with Apt C catalyzes DNA hairpins A 1 and A 2 to form duplex A 12 In the therapeutic step, A 12 can open duplex R 12 and displace quencher labeled single strand R 2 to form A 12 R 1 Subsequently, Ce6 labeled R 1 generates singlet oxygen ( 1 O 2 ) to kill cancer c ells by irradiation at 404 nm. C). Scheme of detailed reaction of DNA hairpins A 1 and A 2 catalyzed by C sequence. Different domains are labeled with different colors. All x doma ins are complementary to x*.

PAGE 56

56 Figure 2 2 Image of the PAGE gel proving the catalytic effect of C sequence.

PAGE 57

57 Figure 2 3 Signal amplification effect of the aptamer circuit in buffer. A). Kinetics of DNA circuit containing A 1 A 2 and R 12 with different concentrations of TDO5 C (fluorescence intensities corresponding to F 1:n ) monitored by FAM fluorescence. The colored lines represent 0, 0.1 nM, 1 nM, 5 nM, 10 nM and 20 nM of TDO5 C respectively. B). Kinetics of dsDNA R 12 with different co ncentrations of A 12 (fluorescence intensities corresponding to F 1:1 ) monitored by FAM fluorescence. The colored lines represent 0, 0.1 nM, 1 nM, 5 nM, 10 nM and 20 nM of A 12 respectively. C). Comparison of the fluorescence enhancement fold of the catalyti c DNA circuit and 1:1 displacement. The calculation is based on the equation Fold = (F 1:n B)/(F 1:1 B), where fold is the fluorescence enhancement ratio of 1:n method to 1:1 method, B is the background fluorescence. The fluorescence intensities at 6000 s ar e used to plot against different target concentrations. Each bar presents the mean and standard deviation derived from th ree independent experiments. D). The SOSG signal plotted as the function of TDO5 C concentration. The SOG was triggered by irradiation at 404 nm, the maximum absorption of Ce6, for 10 minutes. The SOSG fluorescence was obtained with excitation at 494 nm and emission from 500 nm to 600 nm. Each bar presents the mean and standard deviation derived from three independent experiments.

PAGE 58

58 Fig ure 2 4. Fluorescence kinetics describing the leakage reaction of A 1 A 2 and R 12 in the Fluo buffer. The data were normalized to the initial fluorescence intensity of the circuit. Figure 2 5 Fluorescence spectra of mixtures containing 100 nM A 1 100 nM A 2 and 150 nM Ce6 modified R 12 with different concentrations of TDO5 C in buffer.

PAGE 59

59 Figure 2 6. Demonstration of the selective recognition ability of the aptamer circuit. A ) and B ) Flow cytometry results of FAM labeled TDO5 C binding with Ramos and CC RF CEM. Aptamer TDO5 was used as positive control to show the maximum binding affinity. Cells: 200 k/sample; aptamer concentration: 250 nM. C ) and D ) Confocal imaging of Ramos cells and CCRF CEM cells incubated with 250 nM TMR modified TDO5 C at 4C. Fluo rescence image (left). Overlap of optical image and fluorescence image (right). The scale bar is 10 m.

PAGE 60

60 Figure 2 7 SOSG fluorescence of DNA circuit (A 1 A 2 and R 12 ) incubated with buffer, TDO5 C labeled CCEF CEM cells (control) and TDO5 C labeled Ramos cells (target). Each bar presents the mean and standard deviation derived from ex =494 nm and em =532 nm). Fig ure 2 8 Cell viability result using MTS assay. The in vitro cytotoxicity was measured after 36 hr of incubation in cell medium with 3 hr of white light irradiation. Cells: 500k/sample. Each bar presents the mean and standard deviation derived from three independent experiments. P values were calculated by Student' s t test: ns, nonsignificance: P > 0.30 and for P < 0.02, n = 3.

PAGE 61

61 CHAPTER 3 MOLECULAR ENGINEERING OF PHOTORESPONSIVE THREE DIMENSIONAL DNA NANOSTRUCTURES FOR INTELLIGENT DRUG DELIVERY SIGNIFICANCE AND BACKGROUND DNA is a useful construction material for v arious nanostructures by virtue of the remarkable hybridization specificity between complementary strands. Research on DNA nanostructures has not only improved the understanding of fundamental problems in genetics, but has also generated interest in explor ing practical applications. 89 By using smart design, different static DNA nanostructures 90 91 have already been prepared. Recently, reconfigurable DNA nanostructures capable of three dimensional movement have attracted increasing interest because of their potential applications in intelligent drug delivery 92 and smart molecular sensing. 93 Active control of three dimensional movement for DNA structures is usually achieved by input of specific molecular signals, such as DNA strands, 47 94 enzymes 95 or protons 96 to trigger a change in the shape or size of the structure. However, a major shortco ming arises from those designs because the accumulated DNA output waste can quickly deteriorate device performance and ultimately bring it to a halt. 97 To overcome this problem, a r ecycled drive power input is highly desired. Compared with other input signals, photons have significant advantages, such as clean, permanently high efficiency and no waste accumulation. In addition, by using light, DNA nanostructures can be remotely contr olled, opening novel avenues in nanomedicine. Consequently, a photon regulated, shape changing DNA nanostructure would greatly contribute to applications in many fields of nanoscience. Azobenzene has proven to be an effective photo sensitive component beca use of its reversible stereo isomerization from t he trans to cis forms at 300 380 nm and from

PAGE 62

62 cis to trans at wavelengths >400 nm. 98 By incorporating azobenzene moieties into DNA double stranded structures, hybridization can be controlled by the interconversion of azobenzene between the planar trans and nonplanar cis forms, allowing the formation of photocontrollable DNA structures. 99 100 Here, we construct a photocontrollable, reconfigurable three dimensional DNA tetrahedral cage using azobenzene incorporated DNA. 101 103 By controlling the size of this cage, the release of encapsulated cargos (such as protein s or other m a cromolecules) can be triggered by light to produce a smart drug delivery system with precise t emporal and spatial resolutions. In addition, t he strategy of using azobenzene is universal and can be extended to any type of DNA nanostructure, providing new routes for manipulation of nanoscale shapes using photons. A previously reported method was used to construct robust DNA tetrahedral structures by assembly of appropriately designed oligonucleotide sequences. 6, 37 Inspired by the contraction and extension of a string, a hairpin structure was incorporated into the DNA tetrahedron. The hairpin can be opened and closed via hybridization and dehybridization, as shown in Figure 3 1 DNA sequences S1, S2, S3 and S4 form the contracted DNA tetrahedron with the hairpi n in the closed state. Strands S5 with incorporated azobenzene moieties can hybridize with the hairpin portion, allowing the control of open closed cycles of the hairpin structure by using UV and visible light. To achieve optimal photon control, four S5 se quences were designed, as shown in Figure 3 1 The smallest number of azo moieties is 7 (S5 7Azo), with azobenzene inserted every three bases. Sequences with azobenzenes every two bases (S5 9Azo) and every one base (S5 17Azo) were also synthesized. Conside ring that the

PAGE 63

63 distance of the azobenzene moieties from the sequence ends may influence hybridization efficiency, S5 10Azo was designed with a different azo moiety distance from the sequence ends compared to S5 9Azo. With UV irradiation, the azobenzene mole cules change to the nonplanar cis form separating strands S1 and S5, thus forcing the hairpin to form and finally converting the entire structure to the contracted state. On the other hand, when visible irradiation (>450nm) is applied, the azobenzene molec ules convert back to the planar trans form and rehybridize with strand S1 to open the hairpin and extend the DNA tetrahedron. In this way, the shape of the entire DNA three dimensional structure can be precisely controlled by photon irradiation. Experimental Materials and Methods Chemicals and Regents The chemicals for synthesis of the phosphoramidite monomer and reagents for DNA modification were purchased from ChemGene (MA). The CPG columns for DNA synthesis were purchased from Glen Research (VA ). The reagents for BIDBE, azobenzene phosphoramidite synthesis and gold nanoparticle synthesis were purchased from Sigma Aldrich (MO). Synthesis of DNA S equences The DNA sequences were synthesized on the ABI 3400 DNA synthesizer. The synthesis protocol manufacturers. Following on machine synthesis, the DNA products were deprotected and cleaved from CPG by incubating with 2.5 mL AMA (ammonium hydroxide/ Methylamine 50:50) for 17 hours at 40C in water bath. The cleaved DNA product was transferred into a 15 mL centrifuge tube and mixed with 250 L 3.0 M NaCl and 5.0 mL ethanol, after which the sample was placed into a freezer at 20 C for ethanol

PAGE 64

64 precipitation. Afterwards, the DNA product was spun at 4000 rpm under 3C for 20 minutes. The supernatant was removed, and the precipitated DNA product was dissolved in 500 L 0.2 M trithylamine acetate (TEAA Glen Research Corp.) for HPLC purification. The HPLC purification was performed with a cle aned Alltech C18 column on a Varian Prostar HPLC machine. The collected DNA product was dried and processed detritylation by dissolved and incubated in 200 L 80% acetic acid for 20 minutes. The detritylation DNA product was mixed with 400 L ethanol and d ried by a vacuum dryer. The DNA products were quantified and stored in DNA water for subsequent experiments. The detailed sequences information are described in Synthesis of BF PS DNA For the synthesis of BF PS DNA, the method reported by Lee et al. 104 was used. First, phosphorothioate modified DNA (PS DNA) was synthesized at a specific position on DNA strand 1 using sulfuration reagent (Glen Research). The ligand BIDBE was then synthesized by using the protocol reported by Luduena et al. 105 DNA, BIDBE solution, and Tris HC l buffer were incubated at 50C for 5 6h to form BIDBE DNA. The best ratio for BIDBE and DNA phosphorothioate sites was around 2 00:1. Then, to reduce the disulfide bond, 100uL 10uM BIDBE DNA solution, 1uL 50mM acetate buffer and 10uL 1mM TECP were mixed and incubated at room temperature for 2 hours. Gel filtration was used to remove the impurities. Assembly of DNA Tetrahedral Nano s tructures Assembly of contracted DNA tetrahedra: 10uL 10uM DNA strand S1, 10uL 10uM DNA strand S2, 10uL 10uM DNA strand S3, 10uL 10uM DNA strand S4, 10uL 150mM Tris HCl (pH=7.5), 10uL 150mM MgCl 2 and 40uL DNA water were mixed and annealed at 95C for 5min and cooled to room temperature in approximately 5 minutes.

PAGE 65

65 Assembly of extended DNA tetrahedra (no azobenzene incorporated): 10uL 10uM DNA strand S1, 10uL 10uM DNA strand S2, 10uL 10uM DNA strand S3, 10uL 10uM DNA strand S4, 10uL S5 cDNA (no azobenzenes), 10uL 150mM Tris HCl (pH=7.5), 10uL 150mM MgCl 2 and 40uL DNA water were mixed and annealed at 95C for 5 min and cooled to room temperature in approximately 5 minutes. Assembly of azobenzene incorporated DNA tetrahedra: 10uL 10uM DNA strand S1, 10uL 10uM DN A strand S2, 10uL 10uM DNA strand S3, 10uL 10uM DNA strand S4, 10uL DNA strand S5, 10uL 150mM Tris HCl, 10uL 150mM MgCl 2 and 30uL DNA water were mixed and annealed at 95C for 5min and cooled to room temperature in approximately 5 minutes. Tetrahedra were purified using PAGE gel. Native Polyacrylamide Gel E lectrophoresis (PAGE) for Structural Characterization Polyacrylamide solution (40%, 750uL) was diluted to 6% by adding 4.25mL 10mM TAE buffer containing 15mM MgCl 2 Fifty uL APS and 5uL TEMED were added t o the polyacrylamide solution to polymerize it. After loading 10uL 1uM DNA sample solutions, the gels were run on an electrophoresis unit (Biorad) at 4 o C using a constant voltage of 80 V for 90 minutes. After electrophoresis, the gels were stained with St ains All for 30 min and imaged using a digital camera. Phosphorothioate DNA Tetrahedron Assembled with Gold N anoparticles It has been reported that AuNPs are more stable when capped with phosphine reagent. 106 Therefore, in this step, 10mL 60nM gold nanoparticle solution was mixed with 2mg bis(para sulfonatophenyl) phenylphosphine dihydrate dipotassium salt (Strem Chemicals, Newburyport, MA) and shaken at 25 o C overnight. After precipitation and centrifugation, the supernatant was removed, and the AuNP precipitate was redispersed into w ater. After stabilization, AuNPs were assembled with the DNA tetrahedron to

PAGE 66

66 visualize the shape change of structures. Ten uL 100nM DNA tetrahedron solution was mixed with 50uL 60nM AuNPs and incubated overnight at room temperature. The best TEM images were obtained from the mixture solution containing the tetrahedra and AuNPs at a ratio of 1:3. FRET Measurement of Structure Change in Response to UV and Visible I rradiation exc =488nm at constant tem perature. After that, the light source in the fluorometer was used to irradiate the solution at 350nm for 3 min, and the fluorescence spectrum was obtained again immediately after the UV irradiation. Next, visible light (450nm) was applied to the structure s for another 3 min, and fluorescence spectrum of the solution was measured. Additional cycles with alternate UV and Visible irradiation were performed, and the fluorescence spectra were recorded. AFM and TEM M easurements AFM experiments were carried out o n a Nanoscope IIIa (Veeco, Santa Barbara, CA) using tapping mode in ambient air. The radius of curvature of silicone tip was about 10 nm. All topographic images were obtained with 512 x 512 pixels 2 at a scan rate of 1.5 Hz. After annealing strands S1, S2, S3, S4 and S5 10Azo under visible light, the structures were scanned by using AFM. The tetrahedra were expected to have one 10.5nm edge and five 7nm edges for the extended state, and based on the AFM image, the sizes and heights were consistent with the ca lculated values. Transmission electron microscopy (TEM) images were obtained on a Hitachi H 7000 NAR transmission electron microscope. For the extended structures, samples were dried on copper film under visible light. Then a parallel sample was irradiated at

PAGE 67

67 350nm until it was completely dry on the copper film. Afterwards, the samples were imaged by using TEM at a working voltage of 100 kV. Results and Discussion Construction and Optimization of DNA Tetrahedral N anostructure The sequence design for assembly of tetrahedral structure will mainly follow the method of Turberfield et al. 107 A stable and pure tetrahedral structure must be confirmed before further experimentation by consideration of two criteria. First, the hairpin that will be incorporated into the tetrahedron should be able to be opened and closed via DNA hybridization and dehybridization. Normally, a 5 base stem and 12 14 base loop is the optimum design for rapidly responsive molecular beacons. Therefore, we will incorporate a hairpin with a 5 base stem and a 12 base loop into the large structure. Meanwhile, the numbers of azobenzene moieties will be optimized to achieve superior photon controllability, as illustrated in Figure 3 1 The smallest number of azo moieties will be 7 (S5 7Azo), with azobenzene inse rted every three bases. Sequences with azobenzenes every two bases (S5 9Azo) and every one base (S5 17Azo) will also synthesized. Considering that the distance of the azobenzene moieties from the sequence ends may influence hybridization efficiency, S5 10A zo will be designed with a different azo moiety distance from the sequence ends compared to S5 9Azo. Structural Confirmation of DNA Tetrahedral N anostructure Native polyacrylamide gel electrophoresis (PAGE) and atomic force microscopy (AFM) were used to co nfirm the formation of azobenzene incorporated DNA tetrahedra. The gel result in Figure 3 2A shows that the azobenzene incorporated tetrahedral structures (from lanes 3 to 6) can form stable extended structures under visible irradiation compared with T1 (L ane 1) and T2 (Lane 2). T1 and T2 are contracted and

PAGE 68

68 extended tetrahedral structures without any azobenzene moieties. However, some contracted structures also appeared along with the extended forms, and they became more and more obvious as the number of az obenzene moieties increased, indicating that hybridization efficiency is affected by the azobenzene moieties. The four azo incorporated structures have slightly lower mobilities than T2 because the azo moieties increase the molecular weight of the structur es compared with T2. Thus, in the presence of azobenzene incorporated strands, the DNA tetrahedral structures can still be successfully constructed. AFM images were taken on a Nanoscope IIIa atomic force microscopy using the tapping mode in ambient air A fter annealing strands S1, S2, S3, S4 and S5 10Azo under visible light, the structures were scanned by AFM (Figure 3 2B ). The tetrahedra were expected to have one 10.5nm edge and five 7nm edges for the extended state, and based on the AFM images, the sizes and heights were consistent with the calculated values. Characterization of DNA tetrahedral structure with photocontrollability Fluorescence measurements were used to demonstrate the photo control of the Azo DNA tetrahedral structures. Fluorophores (FAM) and quenchers (Dabcyl) were incorporated on the two ends of the hairpins in S1. When the tetrahedron is in the contracted state, the fluorescence is quenched as a result of the close proximity of FAM and Dabcyl. When the hairpin is opened to form the exten ded structure, the fluorescence intensity should increase by the separation of fluorophore and quencher. Fluorescence signals of structures T1 and T2 were used to obtain the background and maximum signals, respectively. In Figure 3 3A when UV irradiation was applied to T 10Azo, the fluorescence intensity decreased because the dehybridization of azo

PAGE 69

69 incorporated S5 strands promoted the formation of hairpin structures. Different azobenzene incorporated structures were tested at 48C, an d their fluorescence signals were normalized based on the maximum signal of T2 (Figure 3 3B ). The results showed that tetrahedral structures containing a low percentage of azobenzenes (T Azo7) did not respond differentially to either UV or visible light, i ndicating that S5 did not dissociate effectively from the structures. On the other hand, structures possessing the maximum number of azobenzenes (e.g., T Azo17) showed poor hybridization between S5 and S1, even under visible irradiation. Based on these fin dings, we concluded that the structures containing 1 azobenzene between every two nucleotides in S5 (i.e., T Azo9 and T Azo10) give the best photon response efficiency and optimum structural stability. Figure 3 3C shows the fluorescence changes as the T 10 Azo structures extended and contracted with successive irradiation by UV (3 minutes) and visible light (3 minutes). The efficiency did not decrease, even after 10 open/closed iterations with no addition of extra oligonucleotides and no generation of waste strands. Therefore, this photon regulated DNA structure is stable and robust. Additionally, all the cycles were performed at 48C in order to have rapid dynamic response to the wavelength changes. Here, the melting temperatures of S5 10Azo and S1 in the ci s and trans configurations are 30.1C and 55.7 C respectively, and the photon fueled reconfigurable structures work most efficiently at around 45 55 o C The relatively high experimental temperature is the reason for the relatively high background signal. O verall, these results demonstrated successful, long lasting control of structural alternation with photon energy input. To visualize the structural changes when applying different wavelengths of light, gold nanoparticles were assembled with tetrahedral str uctures. Taking advantage of Au

PAGE 70

70 specific control on DNA strands by using phosphorothioate DNA and bifunctional linkers 104 gold nanoparticles (diameter of 3.5nm) were attached on the three vertices of the variati onal triangular face of the tetrahedral structures ( Figure 3 4 ). When the shapes of the tetrahedron change, the relative positions of particles on the vertices of the triangle change accordingly. This method allowed clear visualization of the movement of D NA structures triggered by light. In Figure 3 5A the sizes of extended structures matched well with the calculated values. The two isosceles edges are around 7nm, and the bottom edge is 11nm long. After UV irradiation, some tetrahedra converted to contrac ted structures, causing the bottom edges of triangles to shrink to 4nm, as shown in Figure 3 5B To remove the interference of random alignment of AuNPs, control experiments were also performed. For the DNA tetrahedral structures without any phosphorothioa te modification, no regular triangular structures were found on the TEM image ( Figure 3 5C ). These images were consistent with the fluorescence data and demonstrated the successful working mechanism of our photon regulated reconfigurable DNA nanostructures Conclusions In summary, we have successfully used azobenzenes to construct a tetrahedral DNA nanostructure controlled by photons. PAGE and AFM were utilized to confirm the existence of the tetrahedral DNA nanostructures. Fluorescence intensity changes, as well as AuNP assisted TEM measurements, demonstrated the phot on controllability. These results indicate that incorporation of azobenzene moieties into DNA strands allows control of three dimensional structure, in line with our previous report which demonstrated the control of a two dimensional DNA hairpin structure. 103 We believe that

PAGE 71

71 t his photo responsive nano cage will greatly facilitate the development of DNA structures as drug delivery platforms for intelligent therapy For example, o ne potential application is the utilization of the 3 D structural changes to trigger the release of cargos (such as proteins or other macromolecules) encapsulated in the DNA nanostructure, as a smart drug delivery system with precise temporal and spatial resolution.

PAGE 72

72 Table 3 1. DNA seque nces used for tetrahedron assembly S 1 GGT GAT AAA ACG TGT AGC AAG CTG TAA TCG ACT CTA Dabcyl GGC GGA AGA ACC CAC AAC CGC C FAM CGC TCA CTA CTA TGG CG S 2 AGG CAG TTG AGA CGA ACA TTC CTA AGT CTG AAA TTT ATC ACC CGC CAT AGT AGA CGT ATC ACC S3 CTT GCT ACA CGA TTC AGA CTT AGG AAT GTT CGA CAT GCG AGG GTC CAA TAC CGA CGA TTA CAG S4 ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATTTTT TTTTT S5 cDNA GCG GTT GTG GGT TCT TCC GC S5 7azo GXC GGX TTG XTG GXG TTX CTT XCC GXC S5 9 azo GCX GGX TTX GTX GGX GTX TCX TTX CCX GC S5 10 azo GXC GXG TXT GXT GXG GXT TXC TXT CXC GXC S5 1 7azo GCX GXG XTX TXG XTX GXG XGX TXT XCX TXT XCX CXG C X represents azobenzene moiety

PAGE 73

73 F igure 3 1. Design of p hotocontrollable DNA nanostructure using azobenzenes S1, S2, S3, S4 and S5 were mixed in the ratio of 1:1:1:1:1 to form the azo incorporated tetrahedral structures. Four S5 sequences were designed with different azobenzene moiety numbers. S5 7Azo, S5 9Azo, S5 10Azo and S5 17Azo contain 7, 9, 10 and 17 azob enzene moieties, respectively. A fluorophore and a quencher were incorporated at the ends of the hairpin to indicate structural movement.

PAGE 74

74 F igure 3 2. A) Native polyacrylamide gel electrophoresis (6%) analysis of different azo incorporated tetrahedral structures at 4 C. Lane 1 corresponds to the contracted tetrahedron without S5. Lane 2 is the extended tetrahedron with S5 cDNA (no azobenzenes). Lanes 3 6 are the bands of T 7Azo, T 9Azo, T 10Azo and T 17Azo, respectively. L: 50 bp ladder consisting of double strands of DNA with l ength increase in 50 bp steps. B) AFM image of T 10Azo structures recorded with 10nm tips. (Bar length: 100nm). F igure 3 3. Fluorescencent characterization of DNA tetrahedral structure with photocont rollability (A) Fluorescence measurement of T 10Azo labeled with FAM and D abcyl in response to UV irradiation. (B) .Fluorescence signal differences in response to UV irradiation for different azo incorporated tetrahedral structures. (C) Cycling of the clo sed open forms at 48C by repeated visible and UV irradiations

PAGE 75

75 Figure 3 4. Illustration of gold nanoparticle (AuNP) assembly on three vertices of the variational triangular faces of tetrahedra by a phosphorothioate anchor and a short bifunctional fastener (BF). AuNPs can be attached to the BF PS DNA sites to observe different triangular shapes under UV and visible irradiation. Figure 3 5. TEM images of AuNPs assembled on three vertices of the variational triangular face of tetrahedra. A) Befo re UV irradiation. B) After UV irradiation. C) Tetrahedra without any phosphorothioate modifications are shown as control.

PAGE 76

76 CHAPTER 4 MOLECULAR ENGINEERING OF A DNA LOGICAL CIRCUIT FOR PROGRAMMABLE AND AUTONOMOUS REGULATION OF PROTEIN ACTIVITY Significance and Background Nucleic acids, as carriers of genetic information with well regulated and predictable structures, are promising materials for the design and engineering of biochemical circuits. In particular, by emulating the digital logic foun d in typical circuit boards, recent reports demonstrated that DNA based biocircuitry could perform logic gate operations, signal restoration, amplification, feedback, and cascading, all by distinct DNA strands. 49 51 93 108 109 Recently, their ability to interact with naturally occurring biomolecules, together with such uniq ue properties as programmability, Boolean processing capability, nanometric size, and autonomous operation, has opened a novel and exciting direction in biological and biomedical applications. 110 115 Various circuits with single purpose or generic computing capability have been demonstrated using nucleic acid (NA) base pairing interactions. Examples include RNA based logic devices for processing cellular information 116 and quantitatively programming gene expressio n, 117 as well as a DNA based biocomputer for logical analysis of multiple mRNA to trigger corresponding cellular res ponse. 118 Such devices demonstrated the programmability and versatility of NA circuits for further development toward the goa l of logically analyzing a complex biological environment and precisely regulating the actuation of cel lular behaviors. While these NA based circuits are of great scientific interest, they are primarily based on nucleic acid hybridization and strand displa cement reactions between NA probes of different lengths. This has severely restricted circuit operation solely to genetic molecules.

PAGE 77

77 Inspired by these advances, but distinct from their operation at the level of gene expression by DNA hybridization, we sou ght to explore the interactions between NA and other molecules such as proteins in cell free logical circuit operation. There are two significant issues of interest: the first is to understand whether NA protein interactions can be programmably enrolled in molecular circuits; and the second is to apply the capability of the logic circuit to directly perform precise and smart manipulation of the function of proteins, which are often more important than genetic molecules because proteins are at the centers of homeostatic systems and the key regulators of an A major challenge for direct protein manipulation by DNA logic circuitry is to find a key component that can bridge nucleic acids with proteins without influencing the programmability a nd versatility of logic circuits. A common regulation paradigm used in previous reports is genetic regulation of protein expression, which requires sophisticated and cell wide coordination. 119 121 However, a special single stranded oligonucleotide, commonly known as an aptamer, has the potential to interact with proteins specifically and is thus explored and developed in this report as a simple and effective molecular circuit for mani pulation of protein functions and activities. Aptamers, obtained via an in vitro selection strategy called systematic evolution of ligands by exponential enrichment (SELEX), can extend the recognition capabilities of nucleic acids from Watson Crick base pa iring to interactions with various targets, such as small tertiary structure. 10 76 77 In addition, the affinity and speci ficity of an aptamer can be tuned through the selection process or by post selection sequence optimization in order

PAGE 78

78 to meet the specific performance requirements of a given application. Finally, some aptamers are not only able to recognize the target prote ins but can also regulate protein functions. 122 124 Such aptamers are regarded as potential drugs with protein regulation functions or drug carriers for many diseases and are already in the pipeline for clinical use, including PDGF and VEGF aptamers for controlling the age related macular degen eration, 125 126 demonstrating their reliability for biomedical applications. Since an aptamer is essentially a single stranded oligonucleotide, it is convenient in logic circuit design, just as previous NA based circuits. Aptamers can be directly used as building blocks to fabricate seamless logic based aptamer circuits with enhanced capabilities and an extended scope of applications, from simple DNA base pairing reactions to more complicated biomolecular reactions such as NA protein or NA small molecule interactions. As thrombin, which initiates blood coagulation processes by converting fibrinogen to fibrin, was chosen as our model target protein. Imbalances in thrombin levels can lead to a variety of functional disorders, even death. For examp le, thrombin excesses can result in life threatening blood clots in key organs. 127 Consequently, the design o f safe and effective anticoagulants would have a significant effect on clinical therapy. However, dosage control, where imprecision can lead to severe side effects, is a challenge for traditional anticoagulants. Therefore, inspired by the negative feedback loop concept of biological signaling pathways, in which a signal bias induces the expression of its own inhibitor, we designed a logic based molecular circuit that can precisely sense the local enzymatic environment (i.e., the concentration of thrombin in the present example) and smartly control its

PAGE 79

79 coagulation function by a concentration triggered threshold control module, which has the potential to provide a more efficient and safer therapeutic strategy. The operating principle of our molecular circuit f or protein regulation is schematically illustrated in Figure 4 1 A In general, a programmable and autonomous circuit with threshold control was constructed of three DNA modules: an Input Convertor that converts the protein input to DNA input for downstream cascade reactions; a Threshold Controller that sets the threshold concentration for the system to maintain regular protein activity; and an Inhibitor Generator that inhibits excessively high protein activity once it surpasses the threshold. This circuit c an intelligently sense the activity, i.e., the concentration, of protein, and initiate the inhibitory function through a threshold control loop when excessively high protein activity occurs. By setting the threshold value according to each practical situat ion, the circuit may be usable as a smart drug delivery system in the design of personalized medicine. To demonstrate such intelligent regulatory function with thrombin as a model, two anti thrombin aptamers are employed to build an aptamer circuit to smar tly control coagulation: a 29mer (TA 29) that binds to the heparin exosite without inhibitory function and a 15mer (TA 15) that binds to the fibrinogen exosite with strong inhibitory function. 128 129 In the detailed design (Fig. 4 1B ), the circuit includes a series of aptamer and DNA displacement reactions, in which a single stranded DNA (ssDNA) can be displaced from the initial duplex by an even stronger binder, either a protein molecule or a better matched DNA strand. 51 130 131 The circuit start s with the introduction of thrombin. In the Input Convertor, thrombin reacts with duplex Aptamer Input (A I), which contains TA 29 partially hybridized with a piece of ssDNA. This ssDNA, termed as DNA

PAGE 80

80 input is released from A I by competitive binding of t hrombin to TA 29, converting the protein input to DNA input for the following cascade reactions. The DNA input then enters the Threshold Controller module and rapidly reacts with duplex Threshold (T) via an exposed toehold to generate inert ssDNA Was te (W 1 ) without further reaction Through this bypass route, thrombin only binds with TA 29 and thus can still perform its normal catalytic function in blood coagulation. However, after T is depleted, the excess DNA input will continue to the Inhibitor Generator module, in which DNA Input reacts with duplex Output ( O ) via exposed toehold b* thereby triggering the amplification reaction of O with Fuel (F) i.e., signals that help to catalytically produce the output (Figure 4 2 ). The released product, whi ch is denoted as S ( ) with effective toehold t then cascades to duplex Generator (G) followed by the release of the Inhibitor TA 15 to inhibit thrombin coagulation. The sequential order of these reactions is precisely controlled by the differences i n thermodynamic stability, as well as reaction kinetics, between each component. In this system, stability is mainly determined by the length of exposed toehold. For instance, both T and O can react with DNA input but the reaction of DNA input with T is m ore favorable than its reaction with O based on the longer toehold of compared to O (b*) As a result, more thermodynamically stable duplex strands will be formed between the DNA input and T ( ). The difference in thermodynamic stability is also reflected in the reaction kinetics. In this case, the 10 nt toehold in T provides a displacement reaction rate about 100 times higher than that of the 5 nt toehold in O 130 As a result, Inhibitor Generator can only work when the Threshold Controller is completely consumed.

PAGE 81

81 An additional concern is the need for sufficient concentration of O to produce an adequate response. To ensure this reaction, an entropy driven amplification strategy is introduced via the Fuel strand in the Inhibitor Generator DNA input can transform free Fuel into output without being consumed, accord ing to the reactions shown in the Figure 4 2 51 Thus, a small amount of DNA input can trigger the release of a large amount of inhibitor (TA 15). Furthermore, to avoid undesired leaking reactions, the lengths of certain strands were shortened (e.g., is shorter than d ). Overall, by precisely a nd smartly programming the major duplex elements A I T O and G in the three modules, the aptamer circuit can work through an autonomous threshold control loop to generate Inhibitor TA 15 and intelligently regulate the activity of thrombin according to th e preset threshold concentration. Experimental Materials and Methods DNA S ynthesis The DNA sequences were synthesized on the ABI 3400 DNA synthesizer. The manufacturers Following on machine synthesis, the DNA products were deprotected and cleaved from CPG by incubating with 2.5 mL AMA (ammonium hydroxide/Methylamine 50:50) for 17 hours at 40C in water bath. The cleaved DNA product was transferred into a 15 mL centrifug e tube and mixed with 250 L 3.0 M NaCl and 5.0 mL ethanol, after which the sample was placed into a freezer at 20 C for ethanol precipitation. Afterwards, the DNA product was spun at 4000 rpm under 3C for 20 minutes. The supernatant was removed, and the precipitated DNA product was dissolved in 500 L 0.2 M trithylamine acetate (TEAA Glen Research Corp.) for HPLC purification. The HPLC purification was performed with a cleaned Alltech C18 column on

PAGE 82

82 a Varian Prostar HPLC machine. The collected DNA product was dried and processed detritylation by dissolved and incubated in 200 L 80% acetic acid for 20 minutes. The detritylation DNA product was mixed with 400 L ethanol and dried by a vacuum dryer. The DNA products were quantified and stored in DNA water for subsequent experiments. The detailed sequences information are described in supporting information (Table 4 1 and Table 4 2 ). DNA P urification Native PAGE was applied to purify the Aptamer Input, Threshold, Output and Generator duplex strands to remove excess strands and avoid undesired system leakage. The ssDNA components of A I T O and G were annealed at conc entrations of around 50 M in 1 TAE Mg buffer (40 mM Tris Acetate EDTA, pH 8.0, 12.5 mM Mg(Ac) 2 ). Native PAGE gels (12%) in 1 TAE Mg buffer were run at 110 V for 90 minutes at 4C and stained with GelRed stain solution (Biotium, CA). Only the sharp bands were cut from the gels, chopped into small pieces, and soaked in 1 TAE Mg buffer for 24 hours. After soaking out most DNA molecules from the gel pieces, the solutions were extracted and concentrated with centrifugal filter devices (Millipore, MA). Finall y, the DNA duplex sequences were quantified by UV spectrometry and kept in buffer for future use. Quantitative Analysis of Released DNA input Strands Triggered by T hrombin A 100 L sample of 100 nM A I probes was placed in thrombin buffer containing 1 TAE with 100 mM NaCl, 12.5 mM MgCl 2 10 mM KCl, and 1 mM CaCl 2 Different amounts of thrombin were incubated with the probes, and the fluorescence was monitored. To quantify the released DNA input 1 mL of 500 nM FAM TA 29 and 1 mL of

PAGE 83

83 500 nM DABCYL DNA input were annealed in thrombin buffer to make the FRET A I duplex solution. Then A I duplex was purified with gel electrophoresis. Different concentrations of thrombin (0 500 nM) and 100 nM purified A I were mixed and diluted to 100 L in thrombin buffer. Fluorescence was tested after incubation for 3 hours by using Fluorolog (Jobin Yvon Horiba). In the experiment of making calibration curve, different concentrations of FAM labeled TA 29 (0 100 nM) were prepared in 100 L thrombin buffer solution, and the fluorescence was measured after 3 hours. Validati on of Signal Transduction by F luorescence When the signal transduction process in the Inhibitor Generator module was tested, O (100 nM), G (150 nM) and F (200 nM) were mixed in 1 TAE Mg buffer to the total volume of 100 L, and the fluorescence was monitored in the absence and presence of 100 nM DNA input. The fluorescence intensities of the system with different concentrations of DNA input under the same condition were also measured. When the signal transduction process in the Threshold Controller module was tested, 40 nM T was added to the solution described above, and fluorescence was monitored with the concentrations of DNA input at 0, 40 nM, 50 nM, 60 nM, 100 nM and 200 nM. When thrombin was used as input, the buffer was changed to thrombin buffer. Different concentrations of thrombin (0 500 nM) were first incubated with A I for 1 hour. Then O (100 nM), G (150 nM), F (200 nM) and T (20 nM or 35 nM) and thrombin buffer were mixed to the total volume of 100 L. Fluorescence intensities were tested after incubation for 3 hours at room temperature.

PAGE 84

84 Thrombin Catalytic Activity A ssay The hydrolysis experiment of Ala Gly Arg p nitroanilide diacetate (Sigma Aldrich) was carried out in thrombin buffer. First, 1 L thrombin was taken from 10 M stock solution, diluted to 196 L, and incubated at room temperature for 10 minutes (50 nM). Then 4 L of 0.5 mM chromogenic peptide substrate Ala Gly Arg p ni troanilide diacetate) was mixed with the thrombin solution to make the final concentration of 10 at 405 nm by using Cary 100 spectrometry (Varian) with 200 L macro cuvett e. The rates for different thrombin concentrations were tested in the same way (Figure 4 3 ). When testing the inhibition effect of TA 15 to thrombin, thrombin was incubated with different concentrations of TA 15 and TA 29 in buffer for 1 hour. Then chromog enic peptide substrate was added, and the absorbance was monitored at 405 nm (Fig. 4 4 ). The hydrolysis rate of thrombin with the aptamer circuit was determined in the thrombin buffer containing 1 TAE with 100 mM NaCl, 12.5 mM MgCl 2 10 mM KCl, and 1 mM Ca Cl 2 At the threshold of 100 nM (thrombin concentration), a 20 L sample of 1 M A I was incubated with 2 L of 10 M thrombin in thrombin buffer for 3 hours. Then, 20 L of 8 M A G and F 20 L of 200 nM T and 20 L of 1 M O were added, and the total volume of solution was made to 196 L with thrombin buffer. The mixture was incubated at room temperature for 6 hours. At the threshold of 200 nM (thrombin concentration), the volume of T was changed to 35 L, and all other conditions were kept constant. T hen 4 L of 0.5 mM chromogenic peptide substrate (Final concentration: 10 M) was added, and the hydrolysis rate was determined by monitoring the absorbance of

PAGE 85

85 mixtures at 405 nm at room temperature. The rates for different thrombin concentrations were tes ted in a sim ilar way (Fig. 4 5 ). Results and Discussion DNA Aptamer Circuit D esign To design the DNA aptamer circuit, the sequences of two anti thrombin aptamers, TA 15 and TA 29, were used as the core sequences. All DNA strands in the circuit consist of recognition domains (13 17 nt) and toehold domains (5 10 nt), and these domains are functionally independent. The toehold domains were used to initiate the subsequent branch migration reactions. Normally, a 5 nt toehold can reach a displacement rate of 10 6 M 1 s 1 which is fast enough for the reactions in the entire system There are two independent 5 nt toehold domains in this circuit, termed b* and t* Toehold b* was designed based on the sequence of TA 29, and toehold t* is a universal sequence for all other displacement reactions. To differentiate the displacement react ion rates in the Threshold Controller and the Inhibitor Generator modules, a 10 nt long toehold ( ) was used for T In the Input convertor module, the A I duplex was designed based on the sequence of anti thrombin aptamer TA 29. To effectively cover t he 5 nt toehold recognition domain b and rapidly sense thrombin, two T bases were added to the TA 29 aptamer sequence, and the complementary base pair number between TA 29 and DNA Input is 12. Based on the fluorescence kinetics results (Fig. 4 6 ), rapid fl uorescence restorations were found with the addition of 200nM and 500 nM thrombin, demonstrating that A I duplex can be efficiently dehybridized by thrombin. The recognition domains for branch migration in the O and T duplexes consist of 15 nt ssDNA seque nces which are rich in A and T bases. To avoid undesired crosstalk,

PAGE 86

86 51 The recognition domain in G was designed with a 13 nt ssDNA which was 2 nt shorter than TA 15. This 13 nt ssDNA does not bind with thrombin, but it ca n effectively displace TA 15 from the G duplex, allowing the circuit to perform its function normally. The basic principle of designing Fuel and followed the specifica tions reported by Qian et al 51 The sequences of Fuel and should be designed based on the sequences of the O an d A duplexes. The detailed mechanism of the entropy driven reactions triggered by Fuel is described in Figure 4 2 Validation of S ign al Transduction in Each Module To ensure proper operation of the entire circuit, the signal transduction in each module wa s validated separately. The function of the Input Convertor is to transform the protein signal to a DNA signal for compatibility. Unlike DNA hybridization, the quantitative binding relationship between protein and aptamer depends on the K d of the aptamer a nd cannot be simply regarded as a 1:1 ratio. Thus, a quantitative relationship needs to be established in order to set an appropriate threshold value for subsequent reactions. Motivated by the design of FRET based aptamer biosensors, 85 132 a fluorophore (FAM) in the TA 29 strand and a quencher (DABCYL) in the DNA input strand were coupled to quantify the released DNA input triggered by thrombin (Figure 4 7A ). The fluorescence enhancement generated by the dehybridization of duplex A I was measured after addition of different conc entrations of thrombin (Figure 4 7B ). The result ing calibration curve (Figure 4 8 ) established th e quantitative relationship between thrombin and released DNA input as shown in Figure 4 7C This allowed the quantity of

PAGE 87

8 7 DNA input generated from thrombin for subsequent reactions to be determined precisely. Next, the performance of the Inhibitor Generat or was veri fied by labeling G duplex with a fluorophore and quencher FRET pair. As a result, when TA 15 is released from G the fluorescence intensity of the sy stem is restored. For this modu lar test, DNA input was directly applied as input to activate th e Inhibitor Generator. Before testing, all duplex compo nents were purified using gel electrophoresis to remove excess strands in order to avoid undesired system leakage. Then, O (100 nM), G (150 nM) and F (200 nM) were mixed in the buffer, and the fluores cence was monitored in the absence and presence of 100 nM DNA input, as shown in Figure 4 9A With out DNA input, the Inhibitor Generator is stable for hours. Upon the introduction of DNA input, an obvious fluorescence enhancement can be observed, indicati ng that the Inhibitor Generator module functions correctly and effectively. In addition, different concentrations of DNA input were tested, showing a nonlinear fluorescence restoration with elevated concentration of DNA input (Figure 4 10 ). The results demonstrate that the DNA cascade reactions can be driven forward with the catalytic effect of Fuel thus generating a large amount of TA 15 with a low concentration of DNA input By integrating the Threshold Controller with the Inhibitor Gen erator a sequential reaction order with a sharp threshold value was expected. A threshold concentration of 40 nM was set in the Threshold Controlle r by adding 40 nM purified T duplex. The FRET based G in the Inhibitor Generator was still applied as a repo rter to visualize the signal readout. A series of different concentrations of DNA input were introduced to verify the efficacy of threshold suppression in the presence of both modules. The

PAGE 88

88 fluorescence kinetics experiments (Figure 4 9B ) exhibited fluoresce nce restoration starting from DNA input concentration of 50 nM, and the input versus fluorescence plot (Figure 4 9C ) clearly revealed a sharp threshold value at 40 nM, demonstrating the successful construction of a molecular circuit with precise threshold control. Performance of E ntire Circuit with Thrombin as Input After confirming the proper function of each component, we further tested the performance of the entire circuit with thrombin as input by fluorescence readout from the FRET based G According t o the previous DNA input quantitative results (Figure 4 7C ), the concentration of T was set at either 20 nM or 35 nM, corresponding to the concentrations of DNA input generated by 100 nM and 200 nM thrombin, respectively. When the concentration of thrombin is below the threshold value, only the Threshold Controller is functioning with no fluorescence enhancement. However, once the thrombin concentration exceeds the threshold value, depletion of the Threshold Controller and activation of the Inhibitor Genera tor occur, thus increasing the fluorescence intensity. In Figure 4 11 the fluorescence restoration started at thrombin concentrations of 100 nM and 200 nM for the circuit with two different threshold concentrations, respectively, confirming that the circu it can function as designed and release TA 15 only when the thrombin concentration exceeds the predetermined threshold value. Programmable and Autonomous Protein R egulation by Aptamer Circuit The concentrations of free thrombin observed in situ range from less than 1 nM to greater than 100 500 nM. 133 134 The local concentration of thrombin can even exceed 500 nM wi th the inducement of some thrombin generating drugs. These high levels of thrombin cannot be removed from the body in a short time, thus leading to severe blood

PAGE 89

89 clotting. Therefore, a predetermined threshold value, above which the thrombin inhibition drug works, can effectively avoid excessively high thrombin activity, while, at the same time, maintaining regular coagulation function. To demonstrate that our circuit can realize such manipulation of thrombin function, a commercially available chromogenic pep tide, Ala Gly Arg p nitroanilide diacetate, was chosen as the thrombin substrate. The catalytic activity of thrombin can be determined from the hydrolysis rate of the substrate by monitoring the absorbance of hydrolysis product p nitroanilide at 405 nm. 135 137 recorded as the evaluation i ndex of thrombin catalytic activity. The influence of the two aptamers, TA 15 and TA 29, on the catalytic function of thrombin was first inve stigated. The results (Fig. 4 5 and 4 12 ) confirmed that TA 15 can inhibit the coagulation function of thrombin, wh ile TA 29 has no inhibitory effect on thrombin. As a result of sub of TA 15 to thrombin (Figure 4 12 ), at least 2 fold excess TA 15 is required to obtain more than 50% inhibition effect. In order to generate sufficient signal molecules for downstream reactions, the concentration of O may need to be elevated. However, in this scenario, O would be present at much higher concentration than T possibly leading to failure of the Threshold Controlle r caused by the increased displacement reaction rate in the Inhibition Generator Our initial attempt to adapt the strategy of Figure 4 1 exhibited continuous inhibitory effect on thrombin catalytic activity without any threshold control (Fig. 4 13 ). To sol ve this problem, a modified Inhibition Generator module was designed. Because of the modularity of the aptamer circuit, this modified Inhibition Generator module could simply replace the previous Inhibition Generator module without affecting the other two functional modules.

PAGE 90

90 As shown in Figure 4 14 a duplex component, termed Amplifier ( A ) with its own catalytic strand was engineered and incorporated into the module to delay the amplification process for one step. In this case, O can be kept at its r egular concentration to generate ssDNA cth in the presence of DNA input Then, the ssDNA cth displaces A with the help of though an entropy driven amplification cycle and releases a large amount of strand, thus generating sufficient TA 15 for su bsequent inhibition. Since A has no sequence similarity with T it can be present at high concentration without influencing the effective signal transduction in the Threshold Controller For instance, the concentration of A in the following regulation reac tions was set at 800 nM, which is 20 times higher than that of T Thus, the strategy of the amplification delay step is to maintain the correct reaction order between the Threshold Controller and the Inhibition Generator while producing sufficient TA 15 t o perform the inhibition function. To demonstrate the function of the circuit with threshold control of blood coagulation in the presence of excessively high thrombin concentrations, two parallel threshold concentrations of 100 nM and 200 nM were tested. B elow the threshold value, the system should perform the normal coagulation function of thrombin alone. Once the thrombin concentration exceeds the threshold value, inhibition is actuated with the release of TA 15, and the hydrolysis rate of the substrate i s attenuated (monitored by absorbance a t 405 nm, as shown in Fig. 4 5 minutes for different thrombin concentrat ions are summarized in Figure 4 15A Without thrombin concentrations. In

PAGE 91

91 kept increasing with increasing thrombin concentration, showing similar behavior to that of thrombin alone. However, once the threshold val ue had been exceeded, the activity of redundant thrombin was effectively inhibited, resulting in a nearly constant, or slightly be observed exactly at our preset thresh old value. Using the 200 nM threshold as an example (green line in Fig. 15A ), the green line is nearly identical to the purple line of thrombin alone below 200 nM thrombin input, indicating that the thrombin works freely at this stage. However, in the abse nce of the circuit, when the thrombin concentration Otherwise, in the presence of the molecular circuit, it rose only slightly (28.6%), exhibiting a 5 fold difference in activi ty for the excess portion. A similar trend was observed for a threshold of 100 nM, although the inhibition capability was slightly weaker at higher thrombin concentrations. This is probably caused by the greater total concentration of thrombin needed for i nhibition with a lower threshold value, as well as the limited amount of inhibitor the circuit can generate. This problem could be circumvented by presetting with a higher concentration of the Inhibitor Generator module. In addition, we further investigat ed the initial reaction rates ( V obs ) of this enzymatic reaction. The V obs calculated from the slope of the initial linear portion of the absorbance kinetics also exhi bited consistent results (Fig. 4 15B ). These data strongly demonstrated that effective inhibition starts when the threshold is exceeded and only acts on redundant enzymes, confirming the smart inhibitory function of this molecular circuit.

PAGE 92

92 Theoretical c alculation s of circuit performance For rational engineering of an effective molecular cir cuit, it is important to derive kinetic reaction equations and competitive equilibrium expressions to better understand and predict system behavior. Therefore, we analyzed the reactions in our circuit, which are summarized below. The designed reactions inc lude Eq. 4 1, reversible binding reactions between thrombin and A I ; Eq. 4 2, irreversible thresholding strand displacement reactions with fast k T associated with 11 nucleotide extended toeholds; Eq. 4 3, reversible outputting strand displacement reactions with slow forward and backward k O associated with 5 nucleotide toeholds, which can be driven forward by a Fuel strand; Eq. 4 4, irreversible inhibitor generation strand displacement reactions with forward k G associated with 5 nucleotide toeholds; and, fin ally, Eq. 4 5, inhibition reactions between TA15 and thrombin. Herein, Eq. 4 1 and Eq. 4 5 are individual reactions which do not influence each other. The elementary steps may be written as: Based on the theoretical calculations shown in the supporting information as an independent reaction, Eq. 4 1 can reach the equilibruim within 30 minutes ( Fig. 4 16 A), which correlates with the practical experiment results ( Fig. 4 6), indicating that reaction 1 occurs relatively rapidly. Reaction 4 5 can reach equil ibruim even more rapidly than reaction 1, with t 1/2 of 250 s based on our simple kinetic predictions ( Fig. 4 17 B). For Eqs. 4 2, 4 3 and 4 4, as studied by Qian and Winfree, 51 k T = 210 6 M 1 s 1 with

PAGE 93

93 the toehold length of 11 nt; k O k G 10 4 M 1 s 1 with the toehold length of 5 nt. The reaction kinetics can be simulated using the built in numerical integration algorithms. 138 After the simulation, we found that Eqs. 4 2, 4 3 and 4 4 achieve equilibruim in 4 5 hours, which is much slower than reactions 1 and 5. Thus, Eqs. 4 2, 4 3 and 4 4 based on DNA strand displacement are the rate limiting steps of the system. For practical applications of the circuit to control the coagulation function of thrombin, a rapid response to the thrombin concentration fluctuation is necessary To improve system response, it is necessary to accelatrate Eqs. 4 2, 4 3 and 4 4 Optimized sequence design may be considered, such as increasing the toehold numbers of O and G in Eqs. 4 3 and 4 4, respectively. But this needs to be balanced with the sen sitivity of threshold control. A better solution would be to assemble the circuit modules on a scaffold, where DNA species can intereact without diffusion, and the local concentration of DNA strands can be increased.

PAGE 94

94 In addition, the rela tively insensitive response of Eq. 4 1 to thrombin decreased the effectiveness of the threshold control in the entire circuit. Further mathematical calculations were performed and revealed that the intrinsic limitation for DNA input generation is the equilibruim constant K e q of Eq. 4 1 To address an important design question regarding obtaining sufficient DNA input DNA input ] generation upon different concentrations of DNA input ] triggered by high concentration of thrombin (with a=4, for example, where a is the ratio of [Tmb] and [ A I ]) and low concentration of thrombin (a=0.5) with varying K eq (Fig. 4 17B and 4 17 C). DNA input ] with varying K eq reveals a clearly defined local maximum ( K eq DNA input ] values for which the difference between the high thrombin concentration and low thrombin concentration is optimal. To further lower the threshold control for thrombin concentration, a rea ction with higher K eq is desired, and this is related to the binding affinity of the aptamer to thrombin, as well as the dissociation of the A I duplex. Therefore, a better aptamer with higher affinity to thrombin would lower the threshold control concentr ation in our circuit. Another possible solution is to reduce the base pair numbers in the A I duplex for easier release of DNA input upon target aptamer binding. But the functional domain on DNA input still needs to be effectively blocked in the A I duplex to avoid undesired leaky reactions. To study the reaction kinetics of these reactions, we have set the original concentration for Tmb, T O G and A I as 300 nM, 40 nM, 100 nM, 150 nM and 100 nM, respectively. The chemi cal kinetics rate equation for Eq. 4 1 is: (4 6 )

PAGE 95

95 At any given moment in this reaction, we know that [Tmb TA29] = [ DNA input ], [Tmb] = 300 nM [ DNA input ] and [ A I ] =100 nM [ DNA input ]. Therefore, Eq. 4 6 can be converted as: (4 7 ) Integration of Eq. 4 7 gives the integrated form of the rate equation. The equili brium constant of Eq. 4 1 was obtained as K eq (Fig. 4 7C ). Assuming that k 1 4 and k 1 5 integration of Eq. 4 7 gives: (4 8 ) It is important to note that Eq. 4 3 is driven forward by entropic factors, because a small amount of DNA input can catalyze the release of a large amount of S Therefore, the concentration of S is only dependent on th e concentration of O Because Eq. 4 4 is irreversible and the concentration of G is higher than O the concentration of TA15 is directly correlated to the amount of O To simplify the model, we assume O duplex can be completely consumed to generate TA15. T herefore, in this case, we can assume [TA15] is the same as the starting concentration of 100 nM and that [thrombin] is 300 nM. If we focus on Eq. 4 5, the chemi cal kinetics rate equation for Eq. 4 5 is: (4 9 ) At any given mo ment in this reaction, we know that [TA 15] = [Tmb] 200 nM and [Tmb TA15] = 300 nM [Tmb]. Therefore, Eq. 4 9 can be rewritten as: (4 10 )

PAGE 96

96 Integration of Eq. 4 10 gives the integrated form of the rate equation. Here we know that 132 and assuming that k 2 3 M 1 s 1 139 then k 2 = 410 4 s 1 Substitu tion of these values into Eq. 4 10 gives the final equation as: = (4 11 ) The predicted reaction kinetics of Eq. 4 1 and Eq. 4 5 are plotted in Fig ure 4 17 As indicated in the Eq. 4 1, t he initial concentrations of A I and Tmb are set to [ A I ]= and [Tmb]= ac where a is the ratio of [Tmb] and [ A I ]. The equilibrium concentration of Tmb TA29 ([Tmb TA29] ) is x The value of x must satisfy the equilibrium constant equation : Where The exact expression for x (the equalibruim concentration of Tmb TA29) as a function of (reaction equilibruim constant between A I and Tmb), ac (initial concentration of Tmb) and a (concentration ratio of [Tmb] and [ A I ]) is given by the following equation. Herein, since the equilibruim concentration of DNA input ([ DNA input ]) is equal to the equilibruim concentration of Tmb TA29. Therefore, (4 12 ) Herein we fixed [ A I ]= c = 100 nM. Figure 4 18A shows plots of [ DNA input ] vs for different a values To check the maximum [ DNA input ] with different a values, one example was calculated. Here we take a=4 and a=0.5, repectively. Then

PAGE 97

97 (4 13 ) Under this condition, when [ DNA input ] achieves the maximum value, as shown in Figure 4 17 B and C. Conclusions Design of smart protein manipulation methods with such capabilities as specific recognition of target proteins, precise and autonomous control of protein function, and effective suppression of hyp eractive enzymatic effects is an important step towards personalized and intelligent disease treatment. 140 In this study, we have successfully designed a threshold control molecular circuit and a chieved autonomous, self sustained and programmable manipulation of the catalytic activity of thrombin. This is the first molecular logic circuit based on direct NA protein interactions for the manipulation of protein activities. Based on the flexible modu larity, each module can work relatively independently, while their coordinated operation drives the entire circuit properly. By simply replacing or adding new modules, other functions may be feasible. Compared with circuits based totally on base pairing, 52 118 141 the introduction of an aptamer provides a direct molecular bridge linking DN A with proteins and enzymatic reactions, enabling precise sensing of the local enzymatic environment and smart regulation in situ Moreover, as a variety of aptamers are either available or can be obtained through SELEX to bind a broad range of targets wit h tunable binding ability, the aptamer circuit developed here can be used as a powerful tool for constructing ligand controlled regulation systems tailored to respond to specific targets in defined

PAGE 98

98 situations. Although, in its current state, the circuit wo rks only in the test tube, it can be combined with advanced DNA nanotechnology for further in vivo experiments. For instance, all these modules can be molded onto a DNA scaffold, such as DNA origami, 142 143 to build a complete system and facilitate the coordinated operation. Given th e tunable regulation, design modularity and target specificity, the prototype aptamer circuit demonstrated here has the potential to enhance DNA technology with new insights and will broaden the utility of DNA circuits for applications in biology, biotechn ology, and biomedicine.

PAGE 99

99 Table 4 1. Sequences of molecular circuit for spectrofluorimetry studies Sequence s (5 3 ) TA 29 FAM FAM TTAGTCCGTGGTAGGGCAGGTTGGGGTGACT DNA input DABCYL CAAAAAAAAAACACAACCACGGACTAAA(DABCYL) AAAAA TA 29 TTAGTCCGTGGTAGGGCAGGTTGGGGTGACT DNA input (cba) Threshold2 (c) Output 1(b*c*t*) Fuel (etc) Generator 1 (t*f*) Generator2(TA 15 DABCYL) TA 15 CAAAAAAAAAACACA ACCACGGACTAAAAAAAA AGTCCGTGGTTGTGTTTTTTTTTTG CAAAAAAAAAACAC A GTGGTTGTGTTTTTTTTTTGAGATG TTGGTGTGGTTGGCATCTCAAAAAAAAAACACA ACATATCAATTCA TCTCA AAAAAAAAACACA TGAGA TGCCAACCACACCAACC FAM C TCCCG GTG DABCYL GGTTGGTGTGGTTGGCA GGTTGGTGTGGTTGGCA

PAGE 100

100 Table 4 2 Sequences of molecular circuit for chromogenic peptide substrate hydrolysis monitoring Sequence s (5 3 ) TA 29 TTAGTCCGTGGTAGGGCAGGTTGGGGTGACT DNA input (cba) Threshold2 (c) Output 1(b*c*t*) Amplifier 1(t*h*t*) Amplifier 2 Generator 1 (t*f*) Generator2(TA 15 ) CAAAAAAAAAACACA ACCACGGACTAAAAAAAA AGTCCGTGGTTGTGTTTTTTTTTTG CAAAAAAAAAACACA GTGGTTGTGTTTTTTTTTTGAGATG TTGGTGTGGTTGGCATCTCAAAAAAAAAACACA ACATATCAATTCA TCTCA AAAAAAAAACACA TGAGA TTGGTGTGGTTGGCATCTCAAAACAAAACCTCA CACTCATCCTTTACATCTCAAAACAAAACCTCA TGAGATGCCAACCACACCAA GGTTGGTGTGGTTGGCA

PAGE 101

101 Figure 4 1 Working Scheme of molecular circuit. A ) Diagram illustrating circuitry. The circuit consists of three modules, Input Convertor Threshold Controller and Inhibitor Generator which can be programmed with threshold control for smart manipulation of pro tein activity. B ) Working scheme for molecular circuit, driven by a series of DNA displacement reactions. Colored lines indicate DNA strands with different domains. TA 29 and TA 15 are two thrombin aptamers with different functions, including recognition and inhibition, r espectively. All x domains are complementary to x*; b* and t* are short toehold domains with 5 nt; a* b* is a long toehold domain with 10 nt; c* and d* are recognition domains with 15 nt. A I T O and G are initially present as duplex components, along wi th ssDNA Fuel

PAGE 102

102 Figure 4 2. Reaction pathways of DNA input and Output (O) with the aid of Fuel (F) The design follows the procedure d escribed by Qian and Winfree. 51

PAGE 103

103 Figure 4 3. Absorbance of chromogenic peptide hydrolysis product vs. time for different concentrations of thrombin. C peptide Figure 4 4. A) Absorbance change of chromogenic hydrolysis product as a function of time with 300 nM thrombin preincubated with 150 nM, 30 0 nM, 600 nM and 15. B) Absor bance change of chromogenic hydrolysis product as a 15 and TA 29.

PAGE 104

104 Figure 4 5. Absorbance of chromogenic peptide hydrolysis product as a function of time in the presence of different thro mbin concentrat ions with the aptamer circuit. A) Threshold ( T ) Tmb = 100 nM. B) Threshold ( T ) Tmb = 200 nM. Here, the Inhibitor Generator 2 module was coupled with the other two modules. Figure 4 6. Fluorescence kinetics of FRET based A I duplex (100 nM) in the presence of 0 nM, 200 nM, and 500 nM thrombin.

PAGE 105

105 Figure 4 7. Validation of the signal transduction in the Input Converto r module A ) Scheme of FRET based thrombin sensor in the Input Convertor module. Quencher labeled DNA input and fluorophore labeled TA 29 can be dehybridized by t hrombin. B ) Plot of the fluorescence restoration of 100 nM A I with differen t concentrations of thrombin. C ) Relationship between different concentrations of thrombin and released DNA input The conce ntration of A I is 100 nM. Figure 4 8. Fluorescence calibration curve for different concentrations of FAM labeled TA 29. The linear range is 0 100 nM. The relationship of fluorescence intensity versus the concentration of FAM labeled TA 29 was determine d as follows: Fluorescence = 19981 + 21511[TA 29], where R 2 =0.9877.

PAGE 106

106 Figure 4 9. Validation of the signal transduction in the Threshold Controller and Inhibitor Generator module s. A ) Fluorescence kinetics studies of the signal transduction process in the Inhibitor Generator module. O G and F were mixed with concentrations of 100 nM, 150 nM and 200 nM, respectively. Then 0 and 100 nM DNA input were added to the mixture, and the fluor escence signal was monitored at 25C. B ) Fluorescence kinetics study of the signal transduction of the Threshold Controller together with the Inhibitor Generator T O G and F were mixed with concentrations of 40 nM, 100 nM, 150 nM and 200 nM, respectivel y. ssDNA DNA input was added at different concentrations (0 nM, 40 nM, 50 nM, 60 nM, 100 nM and 200 nM), and the ex em (518 nm). C ) Plot of output final fluorescence intensity versus concentration of DNA input

PAGE 107

107 Figure 4 10. Fluorescence output versus DNA input concentration plot. The final fluorescence was normalized to the maximum completion level. These results indicate that 20 nM of DNA input can release around 80% of TA 15 from G duplex.

PAGE 108

108 Figure 4 11. Fluorescence output versus thrombin concentration plot with two preset threshold values (concentration of Tmb) at 100 nM and 200 nM. Purified A I O G and F were mixed at the concentrations of 100 nM, 100 nM, 150 nM and 200 nM, respectively. ex (488 nm) em (518 nm) at 25C. The final fluorescence was normalized to the maximum completion level.

PAGE 109

109 Figure 4 12 Inhibitory effects of different concentrations of TA 15 and TA 29 on thrombin. The concentra tions of thrombin and chromogenic peptide substrate are 300 nM and 10 M, respectively. Figure 4 13 Absorbance changes of chromogenic peptide substrate for different thrombin concentrations using the design in Figure 4 1. Here, the Inhibitor Generator module was coupled with the other two modules.

PAGE 110

110 Figure 4 14 Working scheme of Inhibitor Generator 2 Duplex A and the strand were designed to delay the amplification process for one step. Figure 4 1 5 A peptide substrate upon different thrombin concentrat ions with and without circuit. B ) V obs of the enzymatic reaction upon different thrombin concentrations with and without circuit. Purified A I O A G and F were mixed at concentrations of 100 nM, 100 nM, 800 nM, 800 nM and 800 nM, respectively. T was set at either 20 nM or 35 nM for circuits with two different threshold values.

PAGE 111

111 Figure 4 16 A). Plot of theoretical [ DNA input ] vs. time. B). Plot of theoretical [Tmb TA15] vs. time. Figure 4 17 A) Plot of [ DNA input ] vs. for different values, where a is the concentration ratio of [Tmb] and [ A I ]. B) Plot of DNA input ] vs. Here, DNA input ] was calculated by using ([ DNA input ] a=4 ) ([ DNA input ] a=0.5 ). C) The zoom in plot of (B).

PAGE 112

112 CHAPTER 5 MOLECULAR ENGINEERING OF A DNA ENZYME CASCADE NETWORK FOR ACQUIRED IMMUNE SYSTEM MIMICRY Significance and Background Acquired, or adaptive, immune system (AIS) is controlled by an intricate network of chemical reactions and cellular communications. Macroscopically, AIS displays behaviors including pattern recognition, antigen tolerance, pathog en elimination and memory formation. 144 Aiming at further understanding their detailed regulatory biological processes which are expected to reveal the underlying design rules through a bottom up approach, people are looking for suitable hardware to implement the complex reaction networks. Until now, a fully implemented bottom up AIS biomimicry system still lacks experimental demonstration. Difficulties include controlling programmability and systematicness, as well as transferring the high level biological codes into simple artificial modules and physic al implementations. Another difficulty involves forming robust molecular structures and precisely controlling their temporal dynamics. As a carrier of genetic information with well regulated and predictable structures, DNA offers an excellent platform for the design of reaction networks with arbitrary topologies and high programmability. 145 146 Building on the richness of DNA computing 51 54 and DNA enzyme manipulation, 147 148 synthetic DNA based systems have been used to explo re the possibilities of mimicking both simple and complex systems. For example, small scale in vitro circuits encoding elementary functions, such as cascades 149 bistable memory 150 151 or oscillations 58 have successfully been engineered. In addition, larger networks including mimicry of the neural network 50 and predator prey ecosystem 59 60 continued to confirm the excellence of DNA biochemistry for biomimicry implementation. To further expand the engineering capability of DNA

PAGE 113

113 molecules for building a comp lex biological network, we rationally designed a simple, but effective, experimental approach for the biomimicry of the vertebrate Acquired Immune System (AIS) and analyzed its robust dynamic behaviors. Our results suggest that DNA strand displacement casc ades, 152 coupled with DNA enzyme interactions, 153 could be used as components to build a general strategy for mimicking complex biological systems, thus driving the future d evelopment of biomimicry. Experimental Materials and Methods DNA S ynthesis The DNA sequences were synthesized on the ABI 3400 DNA synthesizer. The manufacturers. Following on machine synthesis, the DNA products were deprotected and cleaved from CPG by incubating with 2.5 mL AMA (ammonium hydroxide/Methylamine 50:50) for 17 hours at 40C in water bath. The cleaved DNA product was transferred into a 15 mL centrifuge tube and mixed with 250 L 3.0 M NaCl and 5.0 mL ethanol, after which the sample w as placed into a freezer at 20 C for ethanol precipitation. Afterwards, the DNA product was spun at 4000 rpm under 3C for 20 minutes. The supernatant was removed, and the precipitated DNA product was dissolved in 500 L 0.2 M trithylamine acetate (TEAA Glen Research Corp.) for HPLC purification. The HPLC purification was performed with a cleaned Alltech C18 column on a Varian Prostar HPLC machine. The collected DNA product was dried and processed detritylation by dissolved and incubated in 200 L 80% ace tic acid for 20 minutes. The detritylation DNA product was mixed with 400 L ethanol and dried by a vacuum dryer. The DNA products were quantified and stored in DNA water for

PAGE 114

114 subsequent experiments. The detailed sequences information are described in sup po rting information (Table 5 1). DNA P urification Native PAGE was applied to purify the AM BM and PG duplex strands to remove excess strands and avoid undesired system leakage. The ssDNA components of AM BM and PG were annealed at concentrations of around 50 M in 1 TAE Mg buffer (20 mM Tris Acetate EDTA, pH 7.5, 12.5 mM Mg(Ac) 2 ). Native PAGE gels (10%) in 1 TAE Mg buffer were run at 100 V for 90 minutes at 4C and stained with Gel Red stain solution (Biotium, CA). Only the sharp bands were cut from the gels, chopped into small pieces, and soaked in 1 TAE Mg buffer for 24 hours. After soaking out most DNA molecules from the gel pieces, the solutions were extracted and concentrated with centrifugal filter devices (Mi llipore, MA). Finally, the DNA duplex sequences were quantified by UV spectrometry and kept in buffer for future use. Preparation of Circular T emplate DNA (CP) A 7.2 L sample of 20 M CP (with phosphate group on its 5 prime end ) was placed in 4 L CircL igase II 10X Reaction Buffer containing 330 mM Tris acetate (pH 7.5), 0.66 M KAc, 5 mM Dithiothreitol ( DTT ) and 2.5mM MnCl 2 Afterwards, 2.8 L CircLigase II (Epicentre, WI) was mixed with the buffer and diluted to 40 L with water. The mixture was incubat ed at 60 C for 3 hours. Then 20U Exonuclease I and 200 U Exonuclease III (New England Biotech, MA) were added to the mixture and incubated at 37 C for 1 hour. The enzyme was denatured by heating up the solution to 90 C for 20 minutes. Finally, the produc t CP was purified by denatured PAGE and desalted with NAP 5 columns (Fig.5 10)

PAGE 115

115 Validation of Signal Transduction in E ach step an d the Entire System by Fluorescence When the reaction priority between the Step 1 and Step 2 was tested, purified AM (80 nM), BM (100 nM) and PG (with FAM and DAB, 100 nM) were mixed in 1 TAE Mg buffer to the total volume of 100 L, and the fluorescence was monitored in different concentrations of P 0 ( Fig. 5 4 ) Fluorescence intensities were tested after incubation for 1 hours at room temperature. When the signal transduction in the entire system was tested by fluorescence, purified AM ( 8 0 nM), BM (10 0 nM), PG (No FAM or DAB, 100 nM), 50 nM CP and 500 nM MB R we re incubated in 1 TAE Mg buffer. The fluorescence kinetics was started when different amounts of P 0 were added to the solution. To check the fluorescence kinetics of the system with the second time exposure to P 0 50 nM P 0 was firstly added to the buffer c ontaining purified AM (100 nM), BM (80 nM), PG (No FAM or DAB,100 nM) and 50 nM CP Then another 150 nM P 0 together with 500 nM MB R were mixed together in the solution simultaneously. Electrophoresis Analysis of the System by Agarose G el A 10 L system w ith purified AM (200 nM), BM (200 nM), PG (200 nM), CP (50 nM) Phi29, (0.5U/ L) and dNTP (250 M) was chosen for this experiment. The reaction was carried out in 1 RCA buffer (50 mM Tris HCl,10 mM MgCl 2 10 mM (NH 4 ) 2 SO 4 and 4 mM DTT) with different amount of P 0 input at 30 C for 3 hours. Agarose gel was run at 4 C for 1 hours under the voltage of 100V. Results and Discussion System Design and C onstruction The host innate immune system is the first line of defense against invading pathogens, but its effect is nonspecific and short lived. In contrast, the acquired immune

PAGE 116

116 system consists of very specialized cells and processes to eliminate pathogenic colonization. This mainly involves B and T cells, but also the production of antibo dies and complement system, which helps antibodies and phagocytic cells eliminate invading pathogens from the body. More specifically, the acquired immune system presentation, mainly with the help of antigen presenting cells (APC). Afterwards, the response signal is transferred to T cells which can be differentiated to some subcategories, including helper T cells (positive) and suppressor T cells (negative). The mutual stimulation of positive and negative T cells controls the tolerance level of adaptive immunity. However, once the threshold is overcome and tolerance is exceeded, the system moves to the second phase. The dominant existence of helper T cells will transfer the signal to B cells, which are tailored to quickly release antibody and eliminate specific pat hogens. Apart from immune response of antibody to antigen, the system will next develop a memory effect in the third phase. Here, particular memory B faster immune response w ith subsequent exposure to the system. To mimic such a complex system, we designed a DNA Enzyme hybrid system consisting of four individual DNA duplex components and two enzymes (Fig. 5 1, species in the shadow box) able to respond to incoming pathogen inp ut (ssDNA or ssRNA) autonomously and programmably. When no pathogen is present, the system is maintained in a steady, balanced state by effective blocking of the functional domains in

PAGE 117

117 each component. However, when challenged by pathogenic input, these func tional domains are activated in a series of steps designed to mimic the three phases of adaptive immunity, as described above. From an engineering perspective, the first step is based on strand displacement, which allows a new sequence to be released by so me initiator strands, thus exhibiting complex computational and information processing abilities for the construction of specific chemical reaction networks. 74 In our case, a specific ssDNA pathogen input ( P 0 ), can be recognized by the DNA duplex AM (stands for A PC cell M imicry) in step 1 or BM (stands for B cell M imicry) in step 2 through DNA displacement reaction, in which a single stranded DNA (ssDNA) can be displaced from the initial duplex by an even stronger binder, normally a better matched DNA strand. Specifically, P 0 comprises of two ssDNA domains with one taken from Bacillus anthracis genome ( P ) and another designed (domain 2 3 4) for controlling downstream reactions. The reaction priority of P 0 to AM and BM is controlled through the lengths of their corresponding toeholds. Herein, we designed a 10 nt toehold in AM with the displacement reaction rate k of 10 6 and a 0 nt toehold in BM with k value of 10 3 for initial pathogen binding. 48 49 As AM is depleted by displacement, one of the displaced products ssDNA TM (stands for T helper cell M imicry) accumulates as can be used as a catalyst to increase the reaction rate between P 0 and BM accumulation exceeds the threshold control ability of AM P 0 can displace BM with the help of TM and release ssDNA PI (stands for p rimer i nitiator), which then undergoes another step of DNA displacement with duplex PG (stands for

PAGE 118

118 p rimer g enerator), producing ssDNA 12a to become, in turn, the primer for DNA polymerase catalyzed rolling circle amplification (RCA), a well established isothermal process that can rapidly synthesize multiple copies of desire ssDNA. 154 155 Here, we incorporated two Bacillus anthracis genomic sequence fragments ( P ) in the circular template ( CP ) for RCA, resulting in rapid generation of the complementary sequences of pathogen ( antibody P* ) in the presence of Phi29 DNA Polymerase, the replicative polymerase from the Bacillus subtilis phage phi29, and deoxyribonucleotide triphosphate (dNTP). Using such enzymatic amplification, this system can quickly generate multiple c opies of P* strands that can mimic the fast and specific antibody generation produced by B cells. Because the RCA product is dependent on its primer concentration, we can control the antibody P* amount by monitoring the upstream reactions that release prim er 12a In the last step, the active pathogen (domain P ) exists in three infectious statuses, including original pathogen P 0 and displacement reaction products P 1 and P 2 (shown in the red dotted rectangular in Fig. 5 1B ). With the large amount of antibody P* in the system, P domain in P 0 P 1 and P 2 can form stable duplex regions PP* Because of the presence of restriction enzyme SsPI, extracted from an E. coli strain that carries the cloned and modified (Y98F) SspI gene from Sphaerotilus species, the duple x PP* This step is used to mimic the process by which the adaptive immune response eliminates pathogens after the formation of antibody antigen complex from the b ody. In addition, since the ssDNA TM is remained in the system from the first exposure to pathogen, it can catalyze the P 0 and BM displacement to release primer 12a quickly,

PAGE 119

119 thus triggering a faster RCA reaction for the next exposure to the same pathogen s equence. This reaction is based on a mechanism called entropy driven behavior, in which the entropy change of reaction system is positive (Fig. 5 2 ) Without TM the displacement rate between P 0 and BM is sl ow by the effective blocking of active domains on BM However, in the presence of TM BM can bind with TM through its 4 nt toehold (domain 5*) and then displace ssDNA W 1 ( 34 ), resulting in a new toehold binding region (domain 3*) for the hybridization betw een P 0 and BM Under these conditions, the BM and P 0 hybridization reaction is driven forward thermodynamically by the entropic gain of the liberated molecules. This mechanism promises the system to form memory effect for specific pathogen input through leaving TM as memory B cells in the system. In additi on, the specificity of this AIS mimicry system is mainly dependent on the sequence design of circular template CP as well as the choice of restriction enzyme. Here, because of the encoding of Bacillus anthracis genomic sequence fragments ( P ) in CP the gen erated RCA product ( antibody P* ) is only able to recognize pathogen with P thus providing the first layer of systematic selectivity. The second layer selectivity is added through the specific sequence digestion requirement of the restriction enzyme SsPI. In other words, even if unspecific binding between other pathogen and antibody P* happens, the pathogen sequence cannot be cut by the restriction enzyme SsPI. Therefore, with such designs, our AIS mimicry system possesses the character of specific immune r esponse in the real AIS. Validation of Signal Transduction in Each M odule To ensure proper operation of the entire network, signal transduction at each step was validated separately. First, AM primarily binds with P 0 whereas delays the

PAGE 120

120 reaction with BM du e to the short toehold region on BM Therefore, a FRET based method was used to study the reaction order of P 0 with AM and BM A fluorophore (FAM) and quencher (DABCYL) pair was coupled in the PG duplex to indicate the released amount of 12a strand that served as a primer for RCA reaction. Fluorescence restoration only occurs if the threshold level of AM is exceeded, and the reaction proceeds to step two, i.e., immune response, based on displacement reactions that can release the quencher lab eled primer 12a strand. Therefore, in the presence of 80 nM AM 100 nM BM and 100nM fluorophore quencher labeled PG different concentrations of P 0 (from 0 nM to 150 nM) were introduced to the system with fluorescence monitoring at 517 nm. As shown in Figu re 5 3A the fluorescence restoration exhibited a sharp upturn at the P 0 concentration of 80 nM, indicating that the reaction between P 0 and BM had begun at the depletion point of AM In other words, the threshold value of AM to P 0 is adjustable by changin g the concentration of AM To further confirm this result, fluorescence kinetics of the above system was monitored (Fig.5 3B) Initially, 80 nM AM 100 nM B M and 100 nM PG and a small amount of P 0 (30 nM) was added. Because of the excess amount of AM and its reaction priority to P 0 by the requirements of step 1, slow fluorescence restoration kinetics was discovered. However, when more P 0 (30 nM each time ) was continuously added to the system, a sharp increase was seen in the fluorescence kinetics, indicating that the reaction proceeds to step 2. Different threshold values were also tested by changing the concentrations of AM and BM (Fig. 5 4 ). Gel electr ophoresis was also used to indicate the order of reactions (Fig. 5 5 ). All assays confirmed the effective thresholding function of AM to the reaction

PAGE 121

121 between BM with P 0 Another significant function of AM is to produce catalytic ssDNA TM to facilitate P 0 to BM hybridization. As demonstrated by Zhang et al 19 the addition of catalyzing TM can accelerate the hybridization reaction between P 0 and BM by two to four orders of magnitude. Therefore, to prove the catalytic effect of TM we continued to use our FRET based reporting model, as described above. Accordingly, 100 nM BM 80 nM AM and 100 nM FAM DAB labeled PG were incubated in buffer. Afterwards, 150 nM P 0 were added to the system. It should be noted that we used an excess amount of P 0 to AM in order to overcome the threshold value. Thus, excess P 0 as well as catalyzing TM generated as a result of the reaction between P 0 and AM in step 1, form an entropy catalytic reacti on that can quickly restore the fluorescence of the system. As a comparison, the same concentration of P 0 was directly added to a solution with 100 nM BM and 100 nM FAM DAB labeled PG As shown in Figure 5 3C measurements of the fluorescence kinetics of the catalyzed reaction exhibited over 500 fold acceleration in contrast to that of the uncatalyzed. 49 156 Thus, the released TM can serve as memory mimicry in the system to memorize specific pathogen, resulting a stronger and faster immune response for the next exposure. After confirming the reaction priority between step 1 and 2, we studied the enzymatic amplification process in step 2, host immune response. As an efficient isothermal enzyme based amplification, rolling circle amplification (RCA) provides us with an excellent way to specifically produce a large amount of desire d DNA product in a short time. Therefore, we applied RCA to mimic the generation of antibody in our

PAGE 122

122 network. By encoding the active pathogen sequence P in the circular template ( CP ) for RCA, DNA polymerase Phi29 could specifically elongate the primer of 12 a end. To demonstrate that the concentration of RCA product is dependent on the amount of primer 12a different concentrations of ssDNA 12a were incubated with 30 nM CP 0.5 U/L Phi29 and 250 M dNTP in RCA buffer. To perform this experiment, we designed a DNA molecular beacon ( MB R ) to report the amount of RCA product fluorescently by using pathogen Bacillus anthracis genomic sequence P as its loop. MB R can be opened by the RCA products ( antibody P* ), thereby exhibiting fluorescence restorati on that represents different amounts of antibody P* Figure 3a shows the resultant fluorescence curve establishing the quantitative relationship between antibody P* and released primer 12a This allowed the quantity of antibody P* generated from enzymatic amplification for hybridization with domain P in P 0 P 1 and P 2 to be determined by the upstream reactions (step 1 and step 2). end of any end of each DNA component, 157 158 except primer 12a because 12a is a primer for RCA and should not be initially blocked. However, a problem could arise under these circumstances in that the toehold of PG duplex might be sealed when initially incubated with Phi 29. To solve this problem, we des end of primer 12a These mismatched PG duplexes labeled by FRET pairs (FAM DABCYL) w ere then incubated with 0.1 U/L or 1 U/L Phi 29 for 1 hour. Afterwards, different amounts of ssDNA PI (upstream displacement strand ) were added to the system to explore fluorescence restoration. If the toehold of PG is sealed by Phi29, results will

PAGE 123

123 show that the displacement reaction between PI and PG are negligible, leading to low fluorescenc e recovery. As shown in Figure 5 6A 2 mismatched bases provided the best anti elongation effect by showing the greatest fluorescence restoration. We did not test 3 or more mismatches in PG because the increasing instability of PG might have caused greater signal leaks in the system. As a t radeoff against too much elongation, but too little stability, we chose 2 mismatch bases in PG duplex for the implementation of our system. To mimic the final pathogen elimination process of AIS (step 3), we designed a restriction enzyme based step to spe the hybridization of P domain with the P* domain in antibody P* creates an SsPI restriction site. In this way, P could be specifically cut into a fragment with the base numbers of 56 (Major band). 159 As shown in Figure 5 7 a sharp band, corresponding to the fragment, was found on the gel image, in dicating that the infectious pathogen part P had been successfully digested by the enzyme and lost its infection activity. Performance of the E ntire System with Pathogen Input After confirming the proper function of each step, we further tested the perform ance of entire system with the same pathogen input from Bacillus anthracis genome. First, 200 nM AM 200 nM BM 200 nM PG 50 nM CP 500 nM MB R 0.5 U/ L Phi29 and 250 M dNTP were mixed in the reaction buffer. To check the tolerance of AIS biomimicry, a small amount of P 0 (100 nM) was then added to the system, and fluorescence was monitored in real time. It can be observed from Figure 5 8A that the fluorescence kinetics is similar to that without P 0 confirming that the system is not activated to produc e antibody P* when the amount of pathogen is under the level of immune tolerance (i.e., threshold). However, when another 250 nM P 0 were added to

PAGE 124

124 the system to mimic the second exposure to the same pathogen, the fluorescence restoration showed much faster kinetics behavior, indicating that the production of a large amount of antibody P* and successful trigger of immune response. In addition, the fas ter response in the second time exposure also confirmed the memory effect of this system for specific pathogen. To further characterize the entire system, we used gel electrophoresis to analyze the fina l product. As shown in Figure 5 8B only one sharp hi gh molecular weight band can be seen with the pathogen amount over the tolerance level (100nM +250 nM), which is consistent with the previous fluorescence result. To study the binding between pathogen and antibody in step 3 we modified P 0 with a fluoropho re (FAM). After the generation of antibody P* the binding between P domain and P* domain was confirmed to be present, as a high molecular weight band could be seen in the FITC imaging channel (Fig. 5 8C ). With further addition of more FAM labeled P 0 (from 1 time to 250 times excess) to the system, the hybridization between P and generated antibody P* was still observed. For instance, as shown in lane 3 of Figure 5 8C 2 M more excess P 0 can be almost completely bound by the originally generated antibody P indicating that the capacity of AIS mimicry is sufficient to quench excess pathogen due to the rolling cycle amplification reaction. Finally, we incubated SsPI restriction enzyme (2U/L) together with all other components (200 nM AM 200 nM BM 200 nM P G 50 nM CP 0.5 U/ L Phi29 and 250 M dNTP). After introducing excess concentration of FAM labeled P 0 (500 nM) that overcome the immune tolerance of the system, one major fragment band (56 nt) was discovered under the FITC channel, leading to the

PAGE 125

125 conclus ion that the pathogen was successfully digested by our AIS mimicry system (Fig. 5 8D, Fig. 5 9 ). As discussed before, the specificity of the system mainly depends on the restriction enzyme and sequence of CP To further confirm this AIS mimicry is specifi c for pathogen Bacillus anthracis we challenge it by introducing a piece of FAM labeled severe acute respiratory syndrome coronavirus genomic DNA ( SARS ) in pathogen input ( P SARS ). Since there is no hybridization between P SARS and generated antibody P* o nly specific for pathogen Bacillus anthracis no obvious high molecular weight fluorescent band appeared with either small or large amount of P SARS under FITC channel, indicating the specificity of this biomimicry system (Fig. 5 8E ). Conclusions Building on the rich knowledge of DNA and DNA enzyme cascade reaction, we successfully erected an artificial DNA biomimicry network for AIS and also experimentally demonstrate its dynamic behaviors to emulate the real AIS. This is the first artificial mole cular system based on DNA DNA and DNA protein interactions for mimicking the vertebrate host adaptive immune system. On a fundamental level, our approach provided a general design principle by using DNA for mimicking the naturally occurring system, includi ng modularity, parameter sensitivity and kinetics from bottom up. A more practical aspect of such artificial mimicry system, which reproduces some of the essential features of biological networks, may include the driving force for biological and biomedical applications regarding the potential of reaction networks, such as the guide for the search for an HIV vaccine. 160 Finally, the molecular programming strategy reported here could impact the development of powerful autonomous biocompu ters or theranostic nanodevices.

PAGE 126

126 Table 5 1. Sequences used in the AIS mimicry system Sequence s (5 3 ) P 0 GGATTATTGTTAAATATTGATAAGGATAACATTTCTCCAAC TAACTTACGTCCCTCATTCAATACCCTACG InvT P 0 FAM GGATTATTGTTAAATATTGATAAGGATAACATTTCTCCAAC TAACTTACGTCCCTCATTCAATACCCTACG FAM InvT P SARS ATAATACTGCGTCTTGGTTCACAGCAACATTTCTCCAACT AACTTACGTCCCT CATTCAATACCCTACG InvT AM 1 TM BM 1 BM 2 or PI BM 3 or W1 PG 1 PG 1 DAB PG 1 DAB 1mis PG 1 DAB 2mis PG 2 PG 2 FAM MB R CP AGACGTAGGGTATTGAATGAGGGATGTAA InvT CATTCAATACCCTACGTCTCCA InvT TGGAGACGTAGGGTATTGAATGAGGGACGTAAGTTAGTT GGAGAAATGTT InvT CCACTCTACCATAACATT TCTCCAACTAACTTACGT InvT CCCTCATTCAATACCCTACG InvT TGGAGAGTTGTTATGGTAGAGTGG TGGAGAGTTGTTATGGTAGAGTGG DAB TGGAGAGATGTTATGGTAGAGTGG DAB TGGAGAAATGTTATGGTAGAGTGG DAB CCACTCTACCATAACA CA FAM CCACTCTACCATAACACA FAM CCGAGGGATTTTTTTTTTTGGATCTCGG DAB PhosGTAGAGTGGGGATTATTGTTAAATATTGATAAGGATT TTTTTTTTTGGATTATTGTTAAATATTGATAAGGATTGTGTT ATG

PAGE 127

127 Figure 5 1. Working princ iple of AIS biomimicry system. A ) Diagram illustrating system. The system consists of three steps: Recognition & Tolerance, Immune Response and Killing & Memory, which can be programmed by autonomous immunomimicking response with pathogen ( P 0 ) input. B ) Working scheme for AIS m imicry system, driven by a series of DNA displacement and DNA enzyme reactions. Colored lines indicate DNA strands with different domains. All x domains are complementary to x*; P 0 is the pathogen sequence which possesses infection ability in ssDNA form. AM BM and PG are initially present as duplex components, along with circular DNA template CT and two functional enzymes of Phi29 polymerase and SsPI restriction enzyme.

PAGE 128

128 Figure 5 2 The proposed entropy driven catalytic pathway. 49 TM first bind with BM through a 4 nt toehold region (domain 5), and form intermediate I 1 and ssDNA W 1 (34). P 0 can bind with I 1 by a newly formed 4 nt toehold (domain 3) and displace TM and ssDNA PI (12). The hybridization reaction is driven forward thermodynamically by the entropic gain of the liberated molecules.

PAGE 129

129 Figure 5 3 Fluorescence studies of the reaction prior ity between steps 1 and 2, as well as the catalytic effect of TM on the reaction of BM and P 0 A) Plot of fluorescence restoration of the system with 80 nM AM, 100 nM BM and 100nM FAM / DAB labeled PG with different concentrations of P 0 B) Kinetics experime nts of the system with 80 nM AM, 100 nM BM and 100 nM FAM / DAB labeled PG. 30 nM P 0 were added to the buffer separately at each time point C) Kinetics experiments to study the catalytic effect of TM. The black curve represents background kinetics with 80 n M AM, 100 nM BM, 100nM FAM / DAB labeled PG and no P 0 The red curve shows the uncatalyzed reaction kinetics with 100 nM BM, 100 nM FAM / DAB labeled PG and 150 nM P 0 The blue curve exhibits the catalyzed reaction kinetics with 80 nM AM, 100 nM BM, 100nM FAM / DAB labeled PG and 150 nM P 0 Experiments were performed at 25C in 50 mM Tris HCl buffer containing 10 mM MgCl 2 Figure 5 4 Fluorescence kinetics of the system with different P 0 additions. 3 0 nM P 0 was added to the buffer with 5 0 nM AM, 5 0 nM BM and 5 0 nM PG separately in each time

PAGE 130

130 Figure 5 5. Analysis by PAGE (10% native gel) of the reaction pathway in step 1 and 2. Here, to fully separate DNA bands with similar molecular weight, P 0 sequence was modified by eliminating the Bacillus anthracis geno mic sequence part ( P : 28 bp). The products and their base numbers are indicated on right.

PAGE 131

131 Figure 5 6 A) Scheme of primer assisted RCA reaction and plot of fluorescence restoration versus different concentrations of primer 12a B) Scheme of the design of mismatch points on PG and result of fluorescence enhancement fold versus different concentrations of ssDNA PI and Phi29. Experiments were performed at 25C in 15mM Tris HCl buffer containing 12.5 mM MgCl 2 10mM (NH 4 ) 2 SO 4 and 4mM DTT.

PAGE 132

132 Figure 5 7 Scheme of the primer initiated RCA product cut by SsPI restriction enzyme and their analysis by PAGE (8% denatured gel at 4 C). Gel image was taken under FITC channel. Lane 1: RCA product + 1 M FAM labeled P SARS+2U/L SsPI. Lane 2: R CA product + 1 M FAM labeled P 0 +2U/L SsPI. Lane3: FAM labeled P 0

PAGE 133

133 Figure 5 8 Experimental results of the entire system with pathogen input A) Fluorescence kinetics of the antibody P* generation with different concentrations of P 0 B) Analysis of the antibody P* generation by agarose gel (1.5%). L: 100 bp ladder. The ima ge was taken under EB channel. C) Analysis of the capacity of the system by agarose gel (1%). 200 nM AM, 200 nM BM, 200 nM PG, 50 nM CP, 0.5 U/ L Phi29 and 250 M dNTP were mixed in t he reaction buffer followed by adding 350 nM FAM labeled P 0 and incubated for 1 hour. Afterwards, different amounts of P 0 were added to mixture to test the binding capacity of the system for excess P 0 Lane 1: mixture +200 nM FAM labeled P 0 lane 2: mixtur e +1 M FAM labeled P 0 lane 3: mixture +2 M FAM labeled P 0 lane 4: mixture +5 M FAM labeled P 0 lane 5: P 0 only. D) Analysis of the reactions in the entire system by agarose gel (1%). M = mixture of 200 nM AM, 200 nM BM, 200 nM PG, 50 nM CP, 0.5 U/ L Phi29 and 250 M dNTP. Incubation time = 1 hour. Lane 1: M+0 nM FAM labeled P 0 lane 2: M+100nM FAM labeled P 0 lane 3: M+500nM FAM labeled P 0 lane 4: M+300nM FAM labeled P 0 lane 5: M+100nM FAM labeled P 0 + 2U/L SsPI, lane 6: M+500nM FAM labeled P 0 + 2U/L SsPI, L: 1kb ladder. E) Agarose gel analysis of the system specificity (1.5%). The image was taken under FITC channel. FITC channel: EX=488nm, EM=512nm. EB channel: EX=488nm, EM=623nm.

PAGE 134

134 Figure 5 9. Gel analysis by PAGE (8% denatured gel) for the entire AIS mimicry system with SsPI restriction enzyme. Gel image was taken under FITC channel. M = mixture of 200 nM AM, 200 nM BM, 200 nM PG, 50 nM CP, 0.5 U/ L Phi29 and 250 M dNTP. Lane 1: FAM labeled P 0 Lane 2: M + 1 M FAM labeled P 0 + 2U/L SsPI for 2 hours. Lane3: M + 1 M FAM labeled P 0 + 2U/L SsPI for 15 minutes. Lane 4: M only. Lane 5: 200 nM primer 12a+ 50 nM CP + 0.5 U/ L Phi29 and 250 M dNTP+1 M FAM labeled P 0 +2U/L SsPI for 2 hours.

PAGE 135

135 Figure 5 10 Analysis by PAGE (8% denatured gel) of the preparation of circular template ( CP ). Lane1: After ligation. Lane 2: Before ligation.

PAGE 136

136 CHAPTER 6 FUTURE DIRECTIONS AND CONCLUSIONS Conclusions therapy on the molecular level via molecular engineering. Specifically, to qualify as recognition of disease related biomarkers for sensitive diagnosis and signal amplification for effective therapy; 2) precise control of drug release with temporal and spatial resolution for effective therapy; 3) inhibition of drug side effects for rapid recovery; and 4) autonomous and programmable implementation with self computation. To accomplish these objectives, DNA based functional tools hold the greatest promise, due to their stability, programmability, and regulation of biological reactions. Therefore, this thesis has focused on engineering DNA molecules into smart molecular tools for intelligent therapeutic appli cations from the following four directions: 1) DNA aptamer based system for accurate cancer cell identification and amplified cancer photo dynamic therapy; 2) photo controllable DNA nanostructure platform for smart drug delivery; 3) DNA circuit for self re gulatory inhibition of drug side effects; and 4) DNA based system for acquired immune system mimicry. Chapter 2 demonstrated a DNA aptamer based system for accurate identification of specific cancer cells and amplified photo dynamic therapy of cancers. Th e DNA circuit used in this strategy, composed of four functional modules (A 1 A 2 R 12 and TDO5 C) totally made of DNA, can greatly amplify the singlet oxygen generation and selectively kill cancer cells. In particular, the DNA hairpin amplification circuit can be catalyzed by specifically designed nucleic acid sequences. Many nucleic acids,

PAGE 137

137 including messenger RNA, microRNAs and small interfering RNAs, are important biomarkers for various diseases. If sequences for these biomolecules become available, the a mplification hairpin DNA circuit can be designed to perform other biological and biomedical functions inside targeted disease cells with effective delivery methods. Second, increasing numbers of aptamers have been developed to target the membranes of a var iety of cancer cell lines, thus establishing the universality of this DNA hairpin circuit for targeted and amplified therapy. Finally, as an application of DNA circuitry to biological cells, the prototype DNA circuit demonstrated here has the potential to enhance DNA technology with new insights and will broaden the utility of DNA circuits for applications in biology, biotechnology, and biomedicine. The third chapter described a photoresponsive three dimensional DNA nanostructure which can be used for smar t drug delivery. DNA nanostructures capable of delivery of target molecules have attracted increasing interest because of their potential applications in biomedical and bioanalytical fields, such as drug delivery and molecular sensing. Compared to other na nomaterials, DNA is environmentally friendly, highly programmable and controllable. Therefore, it can be engineered into smart molecular delivery systems with precise temporal and spatial control on drug release, thus leading to the development of intellig ent therapy. This research effort has been focused on the construction of a photoresponsive three dimensional DNA drug delivery system. The working principle involves photoisomerization of azobenzene incorporated DNA, wherein different wavelengths of light (UV and visible) can change the structure of the azobenzene compound and, hence, the shape of the DNA. This malleability is important to the design of this drug delivery system, because the trapping and release

PAGE 138

138 of drug molecules can be controlled by light Consequently, we have demonstrated that the utilization of light irradiation to control the shape of a DNA 3D nanostructure, thus enabling the release of cargos encapsulated inside this dynamic DNA nanostructure, as a smart drug delivery system with prec ise temporal and spatial resolution. The fourth chapter reports a DNA based logical circuit for self regulatory inhibition of protein activity, which in turn can be used to autonomously control drug side effects. Effective inhibition of drug side effects is another significant issue in intelligent behavior, proteins usually are the regulation targets of various drugs. Thrombin is a multifunctional protease that involved in a series of enzymatic and cellular reactions in the regulation of homeostasis. Impaired or overwhelming of thrombin formation can lead to various diseases. Normally impaired thrombin function is repaired by providing thrombin analogs or thrombin induced drugs intravenously. However, precise dosage control of these drugs for individual patients has always been a difficult issue for physicians, as the unsuitable usage of these drugs may lead to severe side effects, such as blood clotting or even thrombosis Therefore, to effectively inhibit the side effects of the thrombin generating drugs and maintain the activity of thrombin at a constant level, a self regulatory DNA logic circuit based on DNA protein interactions was designed. This innovative design all ows accurate threshold control, as well as autonomous, self sustained and programmable manipulation of thrombin activity in vitro. This circuit can precisely sense the local enzymatic environment, specifically, the concentration of thrombin, and when it is excessively high, a coagulation inhibitor, i.e., a DNA anti thrombin aptamer, is automatically released by a concentration adjusted

PAGE 139

139 circuit module. This prototype could lead to the development of novel DNA biochemical circuits to control the delivery of a ptamer based drugs in smart and personalized medicine, providing a more efficient and safer therapeutic strategy. In the fifth chapter, for the first time, an artificial DNA biomimetic network was designed and constructed for vertebrate Adaptive Immune Sy stem based on DNA DNA and DNA protein interactions. When tested experimentally, the new network demonstrated its ability to mimic the dynamics of the vertebrate Adaptive Immune System. This strategy provides a general design principle by using DNA to mimic a naturally occurring system, including modularity, parameter sensitivity and kinetics from bottom up. This model will also allow us to gain more insight into real reaction networks with concomitant translational applications, e.g., in the case of AIS, p erhaps the search for an HIV vaccine. Future Directions The successful completion of this dissertation research has demonstrated the potential of DNA molecular engineering in designing novel intelligent diagnostic and therapeutic systems. Building on this foundation, future research will expand the capability o f those systems for further bioanalytical and biomedical applications. First, because of the complexity of cancer cell development, accurate identification of cancer subtypes is extremely significant for the successful treatment of cancers. Some sequence s pecific DNA aptamer probes can effectively accomplish such target specific recognition of cancer cells. However, single aptamer recognition has not been sufficiently effective at identifying cancers in individual patients, due to the multiplicity of cancer biomarkers present on single cancer cells. In other words, some cancer subtypes express the same biomarker and cannot be identified by a single aptamer.

PAGE 140

140 Therefore, engineering a DNA aptamer based system that integrates multiple aptamer recognition and inf ormation processing ability could solve this problem, thus effectively decreasing the possibility of false diagnosis. As a continuation of the work described in Chapter 2, a biaptameric system will be constructed to determine whether a cancer cell represe nts a specific cell line or a specific state. The cancer cells will exhibit fluorescence only when both of the two biomarkers are present, thereby improving the diagnosis accuracy. In addition, to identify the cancer cells more sensitively, an amplificatio n strategy will be introduced via DNA molecular engineering. The ultimate goal of this project is applying this DNA As a follow up to the photo responsive 3D DNA nanostructur e described in Chapter 3, this nanocage will be used to trap drug molecules and construct an intelligent delivery drug platform. To test this idea, rhodamine molecules will be encapsulated as a model cargo inside the DNA nanocage. In accordance with the wo rking principle, under UV light, the rhodamine will be trapped inside the DNA cages, but under visible irradiation, they will be released. Afterwards, an anticancer drug molecule, doxorubicin, will be used with this platform for intelligent cancer therapy. The threshold controlled DNA nanocircuit described in Chapter 4 achieved autonomous, self sustained and programmable manipulation of the catalytic activity of thrombin. However, the circuit works only in the test tube in its current state. Future plans in clude molding the individual DNA strands onto a DNA scaffold to build a complete system and facilitate the coordinated operation in vivo If that goal is achieved, this system can be used as an anticoagulation drug for thrombosis related diseases.

PAGE 141

141 LIST O F REFERENCES 1. Tyagi, S. & Kramer, F.R. Molecular beacons: Probes that fluoresce upon hybridization. Nature Biotechnology 14 303 308 (1996). 2. Li, J.J., Fang, X., Schuster, S.M. & Tan, W. Molecular Beacons: A Novel Approach to Detect P rotein DNA Interactions. Angew Chem Int Ed Engl 39 1049 1052 (2000). 3. Shangguan, D., Cao, Z., Meng, L., Mallikaratchy, P. et al. Cell specific aptamer probes for membrane protein elucidation in cancer cells. J Proteome Res 7 2133 2139 (2008). 4. Seem an, N.C. DNA in a material world. Nature 421 427 431 (2003). 5. Adleman, L.M. Molecular Computation of Solutions to Combinatorial Problems. Science 266 1021 1024 (1994). 6. Watson, J.D. & Crick, F.H. Molecular structure of nucleic acids; a structure for deoxyribose nucleic acid. Nature 171 737 738 (1953). 7. Arnott, S. Principles of Nucleic Acid Structure Saenger,W. Nature 312 174 174 (1984). 8. Beaucage, S.L. & Iyer, R.P. Advances in the Synthesis of Oligonucleotides by the Phosphoramidite Approach. Tetrahedron 48 2223 2311 (1992). 9. Beaucage, S.L. & Iyer, R.P. The Synthesis of Modified Oligonucleotides by the Phosphoramidite Approach and Their Applications. T etrahedron 49 6123 6194 (1993). 10. Ellington, A.D. & Szostak, J.W. In vitro selection of RNA molecules that bind specific ligands. Nature 346 818 822 (1990). 11. Hermann, T. & Patel, D.J. Adaptive recognition by nucleic acid aptamers. Science 287 820 8 25 (2000). 12. Tuerk, C. & Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249 505 510 (1990). 13. Shangguan, D., Li, Y., Tang, Z., Cao, Z.C. et al. Aptamers evolved from live cel ls as effective molecular probes for cancer study. Proc Natl Acad Sci U S A 103 11838 11843 (2006). 14. Wang, K., You, M., Chen, Y., Han, D. et al. Self assembly of a bifunctional DNA carrier for drug delivery. Angew Chem Int Ed Engl 50 6098 6101.

PAGE 142

142 15. Ch o, E.J., Yang, L., Levy, M. & Ellington, A.D. Using a deoxyribozyme ligase and rolling circle amplification to detect a non nucleic acid analyte, ATP. J Am Chem Soc 127 2022 2023 (2005). 16. Yang, C.J., Jockusch, S., Vicens, M., Turro, N.J. & Tan, W. Ligh t switching excimer probes for rapid protein monitoring in complex biological fluids. Proc Natl Acad Sci U S A 102 17278 17283 (2005). 17. Saiki, R.K., Scharf, S., Faloona, F., Mullis, K.B. et al. Enzymatic amplification of beta globin genomic sequences a nd restriction site analysis for diagnosis of sickle cell anemia. Science 230 1350 1354 (1985). 18. Shangguan, D., Li, Y., Tang, Z., Cao, Z. et al. Aptamers evolved from live cells as effective molecular probes for cancer study. Proceedings of the Nationa l Academy of Sciences of the United States of America 103 11838 11843 (2006). 19. Shangguan, D., Meng, L., Cao, Z.C., Xiao, Z. et al. Identification of liver cancer specific aptamers using whole live cells. Anal Chem 80 721 728 (2008). 20. Sefah, K., Tan g, Z., Shangguan, D., Chen, H. et al. Molecular recognition of acute myeloid leukemia using aptamers. Leukemia 23 235 244 (2009). 21. Chen, H.W., Medley, C.D., Sefah, K., Shangguan, D. et al. Molecular recognition of small cell lung cancer cells using aptamers. Chemmedchem 3 991 1001 (2008). 22. Zhao, Z., Xu, L., Shi, X., Tan, W. et al. Recognition of subtype non small cell lung cancer by DNA aptamers selected from living cells. Analyst 134 1808 1814 (2009). 23. Simaeys, D.V., Lpez Coln, D., Sefah, K., Sutphen, R. et al. Study of the Molecular Recognition of Aptamers Selected through Ovarian Cancer Cell SELEX. Plos One 5 (2010). 24. M allikaratchy, P., Tang, Z., Kwame, S., Meng, L. et al. Aptamer Directly Evolved from Live Cells Recognizes Membrane Bound Immunoglobin Heavy Mu Chain in Burkitt's Lymphoma Cells. Molecular & Cellular Proteomics 6 2230 2238 (2007). 25. Sefah, K., Meng, L., Lopez Colon, D., Jimenez, E. et al. DNA Aptamers as Molecular Probes for Colorectal Cancer Study. Plos One 5 (2010). 26. Zhang, K., Sefah, K., Tang, L., Zhao, Z. et al. A Novel Aptamer Developed for Breast Cancer Cell Internalization. Chemmedchem 7 79 84 (2012). 27. Liu, Y., Lin, C.X., Li, H.Y. & Yan, H. Protein nanoarrays Aptamer directed self assembly of protein arrays on a DNA nanostructure. Angew Chem Int Edit 44 4333 4338 (2005).

PAGE 143

143 28. LaBean, T.H., Yan, H., Kopatsch, J., Liu, F.R. et al. Constructi on, analysis, ligation, and self assembly of DNA triple crossover complexes. Journal of the American Chemical Society 122 1848 1860 (2000). 29. Winfree, E., Liu, F., Wenzler, L.A. & Seeman, N.C. Design and self assembly of two dimensional DNA crystals. Na ture 394 539 544 (1998). 30. Liu, D., Park, S.H., Reif, J.H. & LaBean, T.H. DNA nanotubes self assembled from triple crossover tiles as templates for conductive nanowires. P Natl Acad Sci USA 101 717 722 (2004). 31. Rothemund, P.W.K. Folding DNA to creat e nanoscale shapes and patterns. Nature 440 297 302 (2006). 32. Alivisatos, A.P., Johnsson, K.P., Peng, X.G., Wilson, T.E. et al. Organization of 'nanocrystal molecules' using DNA. Nature 382 609 611 (1996). 33. He, Y., Tian, Y., Ribbe, A.E. & Mao, C.D. Antibody nanoarrays with a pitch of similar to 20 nanometers. Journal of the American Chemical Society 128 12664 12665 (2006). 34. Sharma, J., Chhabra, R., Liu, Y., Ke, Y.G. & Yan, H. DNA templated self assembly of two dimensional and periodica l gold nanoparticle arrays. Angew Chem Int Edit 45 730 735 (2006). 35. Shih, W.M., Quispe, J.D. & Joyce, G.F. A 1.7 kilobase single stranded DNA that folds into a nanoscale octahedron. Nature 427 618 621 (2004). 36. He, Y., Ye, T., Su, M., Zhang, C. et al. Hierarchical self assembly of DNA into symmetric supramolecular polyhedra. Nature 452 198 U141 (2008). 37. Goodman, R.P., Schaap, I.A.T., Tardin, C.F., Erben, C.M. et al. Rapid chiral assembly of rigid DNA building blocks for molecular nanofabrication. Science 310 1661 1665 (2005). 38. Andersen, E.S., Dong, M., Nielsen, M.M., Jahn, K. et al. Self assembly of a nanoscale DNA box with a controllable lid. Nature 459 73 U75 (2009). 39. Douglas, S.M., Bachelet, I. & Ch urch, G.M. A Logic Gated Nanorobot for Targeted Transport of Molecular Payloads. Science 335 831 834 (2012). 40. Liu, Z.F., Hashimoto, K. & Fujishima, A. Photoelectrochemical Information Storage Using an Azobenzene Derivative. Nature 347 658 660 (1990). 41. Asanuma, H., Ito, T., Yoshida, T., Liang, X. & Komiyama, M. Photoregulation of the Formation and Dissociation of a DNA Duplex by Using the cis trans Isomerization of Azobenzene. Angew Chem Int Ed Engl 38 2393 2395 (1999).

PAGE 144

144 42. Liang, X., Asanuma, H., K ashida, H., Takasu, A. et al. NMR study on the photoresponsive DNA tethering an azobenzene. Assignment of the absolute configuration of two diastereomers and structure determination of their duplexes in the trans form. J Am Chem Soc 125 16408 16415 (2003) 43. Liang, X., Mochizuki, T. & Asanuma, H. A supra photoswitch involving sandwiched DNA base pairs and azobenzenes for light driven nanostructures and nanodevices. Small 5 1761 1768 (2009). 44. Kashida, H., Takatsu, T., Fujii, T., Sekiguchi, K. et al. I n stem molecular beacon containing a pseudo base pair of threoninol nucleotides for the removal of background emission. Angew Chem Int Ed Engl 48 7044 7047 (2009). 45. Ball, P. Chemistry meets computing. Nature 406 118 120 (2000). 46. Seelig, G., Solovei chik, D., Zhang, D.Y. & Winfree, E. Enzyme free nucleic acid logic circuits. Science 314 1585 1588 (2006). 47. Yurke, B., Turberfield, A.J., Mills, A.P., Simmel, F.C. & Neumann, J.L. A DNA fuelled molecular machine made of DNA. Nature 406 605 608 (2000). 48. Zhang, D.Y. & Winfree, E. Control of DNA Strand Displacement Kinetics Using Toehold Exchange. Journal of the American Chemical Society 131 17303 17314 (2009). 49. Zhang, D.Y., Turberfield, A.J., Yurke, B. & Winfree, E. Engineering entropy driven reactions and networks catalyzed by DNA. Science 318 1121 1125 (2007). 50. Qian, L., Winfree, E. & Bruck, J. Neural network computation with DNA strand displacement cascades. Nature 475 368 372 (2011). 51. Qian, L. & Winfree, E. Scaling Up Digital Circuit Computation with DNA Strand Displacement Cascades. Science 332 1196 1201 (2011). 52. Dirks, R.M. & Pierce, N.A. Triggered amplification by hybridization chain reaction. P Natl Acad Sci USA 101 15275 15278 (2004). 53. Zhang, D.Y., Turberfield, A.J., Yurke, B. & Winfree, E. Engineering entropy driven reactions and networks catalyzed by DNA. Science 318 1121 1125 (2007). 54. Han, D., Zhu, Z., Wu, C.C., Peng, L. et al. A Logical Molecular Circuit for Programmable and Autonomous Regulation of Protein Activity Using DNA Aptamer Protein Interactions. Journal of the American Chemical Society 134 20797 20804 (2012).

PAGE 145

145 55. Venkataraman, S., Dirks, R.M., Ueda, C.T. & Pierce, N.A. Selective cell death mediated by small conditi onal RNAs (Retracted article. See vol. 110, pg. 384, 2013). P Natl Acad Sci USA 107 16777 16782 (2010). 56. Friedland, A.E., Lu, T.K., Wang, X., Shi, D. et al. Synthetic Gene Networks That Count. Science 324 1199 1202 (2009). 57. Kramer, B.P., Viretta, A .U., El Baba, M.D., Aubel, D. et al. An engineered epigenetic transgene switch in mammalian cells. Nature Biotechnology 22 867 870 (2004). 58. Kim, J., White, K.S. & Winfree, E. Construction of an in vitro bistable circuit from synthetic transcriptional s witches. Molecular Systems Biology 2 (2006). 59. Fujii, T. & Rondelez, Y. Predator Prey Molecular Ecosystems. Acs Nano 7 27 34 (2013). 60. Padirac, A., Fujii, T., Estevez Torres, A. & Rondelez, Y. Spatial Waves in Synthetic Biochemical Networks. J Am Chem Soc (2013). 61. Fu, T.J. & Seeman, N.C. DNA Double Crossover Molecules. Biochemistry 32 3211 3220 (1993). 62. Dougherty, T.J., Gomer, C.J., Henderson, B.W., Jori, G. et al. Photodynamic therapy. J Natl Cancer Inst 90 889 905 (1998). 63. Bugaj, A.M. Targeted photodynamic therapy a promising strategy of tumor treatment. Photoch Photobio Sci 10 1097 1109 (2011). 64. Mallikaratchy, P., Tang, Z. & Tan, W. Cell specific aptamer photosensitizer conjugates as a molecular tool in photodynamic t herapy. ChemMedChem 3 425 428 (2008). 65. Yang, X., Huang, J., Wang, K., Li, W. et al. Angiogenin mediated photosensitizer aptamer conjugate for photodynamic therapy. ChemMedChem 6 1778 1780 (2011). 66. Wang, J., Zhu, G., You, M., Song, E. et al. Assembl y of aptamer switch probes and photosensitizer on gold nanorods for targeted photothermal and photodynamic cancer therapy. Acs Nano 6 5070 5077 (2012). 67. Zheng, G., Chen, J., Stefflova, K., Jarvi, M. et al. Photodynamic molecular beacon as an activatabl e photosensitizer based on protease controlled singlet oxygen quenching and activation. P Natl Acad Sci USA 104 8989 8994 (2007). 68. McDonnell, S.O., Hall, M.J., Allen, L.T., Byrne, A. et al. Supramolecular photonic therapeutic agents. Journal of the Ame rican Chemical Society 127 16360 16361 (2005).

PAGE 146

146 69. Tang, Z.W., Zhu, Z., Mallikaratchy, P., Yang, R.H. et al. Aptamer Target Binding Triggered Molecular Mediation of Singlet Oxygen Generation. Chem Asian J 5 783 786 (2010). 70. Zhu, Z., Tang, Z.W., Philli ps, J.A., Yang, R.H. et al. Regulation of singlet oxygen generation using single walled carbon nanotubes. Journal of the American Chemical Society 130 10856 + (2008). 71. Clo, E., Snyder, J.W., Voigt, N.V., Ogilby, P.R. & Gothelf, K.V. DNA programmed cont rol of photosensitized singlet oxygen production. Journal of the American Chemical Society 128 4200 4201 (2006). 72. Chen, J., Stefflova, K., Niedre, M.J., Wilson, B.C. et al. Protease triggered photosensitizing beacon based on singlet oxygen quenching an d activation. Journal of the American Chemical Society 126 11450 11451 (2004). 73. Huang, J., Wu, Y.R., Chen, Y., Zhu, Z. et al. Pyrene Excimer Probes Based on the Hybridization Chain Reaction for the Detection of Nucleic Acids in Complex Biological Fluid s. Angew Chem Int Edit 50 401 404 (2011). 74. Yin, P., Choi, H.M.T., Calvert, C.R. & Pierce, N.A. Programming biomolecular self assembly pathways. Nature 451 318 U314 (2008). 75. Li, B.L., Ellington, A.D. & Chen, X. Rational, modular adaptation of enzyme free DNA circuits to multiple detection methods. Nucleic Acids Research 39 (2011). 76. Tuerk, C. & Gold, L. Systematic Evolution of Ligands by Exponential Enrichment Rna Ligands to Bacteriophage T4 DNA Polymerase. Science 249 505 510 (1990). 77. Robertson, D.L. & Joyce, G.F. Selection in vitro of an RNA enzyme that specifically cleaves single stranded DNA. Nature 344 467 468 (1990). 78. Huizenga, D.E. & Szostak, J.W. A DNA Aptamer That Binds Adenosine and Atp. Biochemistry 34 656 665 (1995). 79. Bock, L.C., Griffin, L.C., Latham, J.A., Vermaas, E.H. & Toole, J.J. Selection of Single Stranded DNA Molecules That Bind and Inhibit Human Thrombin. Nature 355 564 566 (1992). 80. Shangguan, D., Li, Y., Tang, Z.W., Cao, Z.H.C. et al. Aptamers evolved fr om live cells as effective molecular probes for cancer study. P Natl Acad Sci USA 103 11838 11843 (2006). 81. Tang, Z.W., Shangguan, D., Wang, K.M., Shi, H. et al. Selection of aptamers for molecular recognition and characterization of cancer cells. Anal Chem 79 4900 4907 (2007).

PAGE 147

147 82. Sefah, K., Tang, Z.W., Shangguan, D.H., Chen, H. et al. Molecular recognition of acute myeloid leukemia using aptamers. Leukemia 23 235 244 (2009). 83. Shangguan, D.H., Meng, L., Cao, Z.H.C., Xiao, Z.Y. et al. Identification of liver cancer specific aptamers using whole live cells. Anal Chem 80 721 728 (2008). 84. Wang, L., Yang, C.J., Medley, C.D., Benner, S.A. & Tan, W. Locked nucleic acid molecular beacons. J Am Chem Soc 127 15664 15665 (2005). 85. Tang, Z., Mallikaratch y, P., Yang, R., Kim, Y. et al. Aptamer switch probe based on intramolecular displacement. J Am Chem Soc 130 11268 11269 (2008). 86. Kim, V.N. Small RNAs: classification, biogenesis, and function. Mol Cells 19 1 15 (2005). 87. Carthew, R.W. & Sontheimer, E.J. Origins and Mechanisms of miRNAs and siRNAs. Cell 136 642 655 (2009). 88. Venkataraman, S., Dirks, R.M., Ueda, C.T. & Pierce, N.A. Selective cell death mediated by small conditional RNAs. Proc Natl Acad Sci U S A 107 16777 16782 (2010). 89. Seeman, N.C. From genes to machines: DNA nanomechanical devices. Trends Biochem Sci 30 119 125 (2005). 90. Seeman, N.C. Nucleic Acid Junctions and Lattices. Journal of Theoretical Biology 99 237 247 (1982). 91. Malo, J., Mitchell, J.C., Venien Bryan, C., Harris, J.R. et al. Engineering a 2D protein DNA crystal. Angewandte Chemie International Edition 44 3057 3061 (2005). 92. Tanaka, F., Mochizuki, T., Liang, X.G., Asanuma, H. et al. Robust and Photocontrollable DNA Capsules Using Azobenzenes. Nano Letters 10 3560 3565 (2010). 93. Seelig, G., Soloveichik, D., Zhang, D.Y. & Winfree, E. Enzyme free nucleic acid logic circuits. Science 314 1585 1588 (2006). 94. Goodman, R.P., Heilemann, M., Doose, S., Erben, C.M. e t al. Reconfigurable, braced, three dimensional DNA nanostructures. Nature Nanotechnology 3 93 96 (2008). 95. Bath, J., Green, S.J. & Turberfield, A.J. A free running DNA motor powered by a nicking enzyme. Angewandte Chemie International Edition 44 4358 4361 (2005).

PAGE 148

148 96. Liu, D.S. & Balasubramanian, S. A proton fuelled DNA nanomachine. Angewandte Chemie International Edition 42 5734 5736 (2003). 97. Simmel, F.C. & Dittmer, W.U. DNA nanodevices. Small 1 284 299 (2005). 98. Kumar, G.S. & Neckers, D.C. Phot ochemistry of Azobenzene Containing Polymers. Chemical Reviews 89 1915 1925 (1989). 99. Asanuma, H., Ito, T., Yoshida, T., Liang, X.G. & Komiyama, M. Photoregulation of the formation and dissociation of a DNA duplex by using the cis trans isomerization of azobenzene. Angewandte Chemie International Edition 38 2393 2395 (1999). 100. Liang, X.G., Mochizuki, T. & Asanuma, H. A Supra photoswitch Involving Sandwiched DNA Base Pairs and Azobenzenes for Light Driven Nanostructures and Nanodevices. Small 5 1761 1768 (2009). 101. Asanuma, H., Liang, X., Nishioka, H., Matsunaga, D. et al. Synthesis of azobenzene tethered DNA for reversible photo regulation of DNA functions: hybridization and transcription. Nature Protocols 2 203 212 (2007). 102. Liang, X.G., Nishi oka, H., Takenaka, N. & Asanuma, H. A DNA nanomachine powered by light irradiation. Chembiochem 9 702 705 (2008). 103. Kang, H.Z., Liu, H.P., Phillips, J.A., Cao, Z.H. et al. Single DNA Molecule Nanomotor Regulated by Photons. Nano Lett 9 2690 2696 (2009). 104. Lee, J.H., Wernette, D.P., Yigit, M.V., Liu, J. et al. Site specific control of distances between gold nanoparticles using phosphorothioate anchors on DNA and a short bifunctional molecular fastener. Angew Chem Int Edit 46 9006 9010 (2007). 1 05. Luduena, R.F., Roach, M.C., Trcka, P.P. & Weintraub, S. N,N Bis(Alpha Iodoacetyl) 2,2' Dithiobis(Ethylamine), a Reversible Crosslinking Reagent for Protein Sulfhydryl Groups. Anal Biochem 117 76 80 (1981). 106. Deng, Z.X., Tian, Y., Lee, S.H., Ribbe, A.E. & Mao, C.D. DNA encoded self assembly of gold nanoparticles into one dimensional arrays. Angew Chem Int Edit 44 3582 3585 (2005). 107. Goodman, R.P., Berry, R.M. & Turberfield, A.J. The single step synthesis of a DNA tetrahedron. Chem Commun (Camb) 1372 1373 (2004). 108. Zhang, D.Y. & Winfree, E. Robustness and modularity properties of a non covalent DNA catalytic reaction. Nucleic Acids Research 38 4182 4197 (2010). 109. Ran, T., Kaplan, S. & Shapiro, E. Molecular implementation of simple logic pro grams. Nat Nanotechnol 4 642 648 (2009).

PAGE 149

149 110. Beisel, C.L., Bayer, T.S., Hoff, K.G. & Smolke, C.D. Model guided design of ligand regulated RNAi for programmable control of gene expression. Molecular Systems Biology 4 (2008). 111. Kolpashchikov, D.M. & Sto janovic, M.N. Boolean control of aptamer binding states. Journal of the American Chemical Society 127 11348 11351 (2005). 112. Stojanovic, M.N. & Kolpashchikov, D.M. Modular aptameric sensors. Journal of the American Chemical Society 126 9266 9270 (2004) 113. Benenson, Y., Gil, B., Ben Dor, U., Adar, R. & Shapiro, E. An autonomous molecular computer for logical control of gene expression. Nature 429 423 429 (2004). 114. Gil, B., Kahan Hanum, M., Skirtenko, N., Adar, R. & Shapiro, E. Detection of multipl e disease indicators by an autonomous biomolecular computer. Nano Lett 11 2989 2996 (2011). 115. Saghatelian, A., Volcker, N.H., Guckian, K.M., Lin, V.S. & Ghadiri, M.R. DNA based photonic logic gates: AND, NAND, and INHIBIT. J Am Chem Soc 125 346 347 (2 003). 116. Win, M.N. & Smolke, C.D. Higher order cellular information processing with synthetic RNA devices. Science 322 456 460 (2008). 117. Carothers, J.M., Goler, J.A., Juminaga, D. & Keasling, J.D. Model driven engineering of RNA devices to quantitatively program gene expression. Science 334 1716 1719 (2011). 118. Xie, Z., Wroblewska, L., Prochazka, L., Weiss, R. & Benenson, Y. Multi input RNAi based logic circuit for identification of specific cancer cells. Science 333 1307 1311 (2011). 119. Stricker, J., Cookson, S., Bennett, M.R., Mather, W.H. et al. A fast, robust and tunable synthetic gene oscillator. Nature 4 56 516 519 (2008). 120. Freeman, M. Feedback control of intercellular signalling in development. Nature 408 313 319 (2000). 121. Culler, S.J., Hoff, K.G. & Smolke, C.D. Reprogramming cellular behavior with RNA controllers responsive to endogenous protein s. Science 330 1251 1255 (2010). 122. Vuyisich, M. & Beal, P.A. Controlling protein activity with ligand regulated RNA aptamers. Chem Biol 9 907 913 (2002).

PAGE 150

150 123. Lee, J.H., Canny, M.D., De Erkenez, A., Krilleke, D. et al. A therapeutic aptamer inhibits a ngiogenesis by specifically targeting the heparin binding domain of VEGF165. Proc Natl Acad Sci U S A 102 18902 18907 (2005). 124. Green, L.S., Jellinek, D., Jenison, R., Ostman, A. et al. Inhibitory DNA ligands to platelet derived growth factor B chain. Biochemistry 35 14413 14424 (1996). 125. Lee, J.F., Stovall, G.M. & Ellington, A.D. Aptamer therapeutics advance. Curr Opin Chem Biol 10 282 289 (2006). 126. Ni, X., Castanares, M., Mukherjee, A. & Lupold, S.E. Nucleic acid aptamers: clinical application s and promising new horizons. Curr Med Chem 18 4206 4214 (2011). 127. Hirsh, J. Choice of low molecular weight heparins. Journal of Thrombosis and Haemostasis 1 598 599 (2003). 128. Bock, L.C., Griffin, L.C., Latham, J.A., Vermaas, E.H. & Toole, J.J. Sel ection of single stranded DNA molecules that bind and inhibit human thrombin. Nature 355 564 566 (1992). 129. Tasset, D.M., Kubik, M.F. & Steiner, W. Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. J Mol Biol 272 688 698 (1997). 130. Zhang, D.Y. & Winfree, E. Control of DNA strand displacement kinetics using toehold exchange. J Am Chem Soc 131 17303 17314 (2009). 131. Zhang, D.Y. & Seelig, G. Dynamic DNA nanotechnology using strand displacement reactions. Nat Chem 3 103 113 (2011). 132. Nutiu, R. & Li, Y. Structure switching signaling aptamers. J Am Chem Soc 125 4771 4778 (2003). 133. Wolberg, A.S. Thrombin generation and fibrin clot structure. Blood Rev 21 131 142 (2007). 134. Muller, J., Becher, T., Braunstein, J., Berdel P. et al. Profiling of active thrombin in human blood by supramolecular complexes. Angew Chem Int Ed Engl 50 6075 6078 (2011). 135. Ramjee, M.K. The use of fluorogenic substrates to monitor thrombin generation for the analysis of plasma and whole blood coagulation. Anal Biochem 277 11 18 (2000). 136. Shiang, Y.C., Hsu, C.L., Huang, C.C. & Chang, H.T. Gold nanoparticles presenting hybridized self assembled aptamers that exhibit enhanced inhibition of thrombin. Angew Chem Int Ed Engl 50 7660 7665 (2011).

PAGE 151

151 137. Hsu, C.L., Chang, H.T., Chen, C.T., Wei, S.C. et al. Highly efficient control of thrombin activity by multivalent nanoparticles. Chemistry 17 10994 11000 (2011). 138. Franco, E., Friedrichs, E., Kim, J., Jungmann, R. et al. Timing molecular motion a nd production with a synthetic transcriptional clock. Proc Natl Acad Sci U S A 108 E784 793 (2011). 139. Li, X., Shen, L., Zhang, D., Qi, H. et al. Electrochemical impedance spectroscopy for study of aptamer thrombin interfacial interactions. Biosens Bioe lectron 23 1624 1630 (2008). 140. Hood, L., Heath, J.R., Phelps, M.E. & Lin, B. Systems biology and new technologies enable predictive and preventative medicine. Science 306 640 643 (2004). 141. Choi, H.M., Chang, J.Y., Trinh le, A., Padilla, J.E. et al. Programmable in situ amplification for multiplexed imaging of mRNA expression. Nat Biotechnol 28 1208 1212 (2010). 142. Rothemund, P.W. Folding DNA to create nanoscale shapes and patterns. Nature 440 297 302 (2006). 143. Douglas, S.M., Dietz, H., Liedl, T., Hogberg, B. et al. Self assembly of DNA into nanoscale three dimensional shapes. Nature 459 414 418 (2009). 144. Bottomly, K. 1984: all idiotypes are equal, but some are more equal than others. Immunol Rev 79 45 61 (1984). 145. Krishnan, Y. & Simmel, F.C. Nucleic Acid Based Molecular Devices. Angew Chem Int Edit 50 3124 3156 (2011). 146. Simmel, F.C. Programming the Dynamics of Biochemical Reaction Networks. Acs Nano 7 6 10 (2013). 147. Johne, R., Muller, H., Rector, A., van Ranst, M. & Stev ens, H. Rolling circle amplification of viral DNA genomes using phi29 polymerase. Trends Microbiol 17 205 211 (2009). 148. Franco, E., Friedrichs, E., Kim, J., Jungmann, R. et al. Timing molecular motion and production with a synthetic transcriptional clo ck. P Natl Acad Sci USA 108 E784 E793 (2011). 149. Hooshangi, S., Thiberge, S. & Weiss, R. Ultrasensitivity and noise propagation in a synthetic transcriptional cascade. Proc Natl Acad Sci U S A 102 3581 3586 (2005).

PAGE 152

152 150. Lou, C., Liu, X., Ni, M., Huang, Y. et al. Synthesizing a novel genetic sequential logic circuit: a push on push off switch. Mol Syst Biol 6 350 (2010). 151. Padirac, A., Fujii, T. & Rondelez, Y. Bottom up construction of in vitro switchable memories. P Natl Acad Sci USA 109 E3212 E322 0 (2012). 152. Zhang, D.Y. & Seelig, G. Dynamic DNA nanotechnology using strand displacement reactions. Nat Chem 3 103 113 (2011). 153. Zhao, W.A., Ali, M.M., Brook, M.A. & Li, Y.F. Rolling circle amplification: Applications in nanotechnology and biodetec tion with functional nucleic acids. Angew Chem Int Edit 47 6330 6337 (2008). 154. Schweitzer, B., Wiltshire, S., Lambert, J., O'Malley, S. et al. Immunoassays with rolling circle DNA amplification: A versatile platform for ultrasensitive antigen detection P Natl Acad Sci USA 97 10113 10119 (2000). 155. Fire, A. & Xu, S.Q. Rolling Replication of Short DNA Circles. P Natl Acad Sci USA 92 4641 4645 (1995). 156. Chen, X. & Ellington, A.D. Shaping up nucleic acid computation. Curr Opin Biotech 21 392 400 (2 010). 157. Ortigao, J.F., Rosch, H., Selter, H., Frohlich, A. et al. Antisense effect of oligodeoxynucleotides with inverted terminal internucleotidic linkages: a minimal modification protecting against nucleolytic degradation. Antisense Res Dev 2 129 146 (1992). 158. Vandesande, J.H., Ramsing, N.B., Germann, M.W., Elhorst, W. et al. Parallel Stranded DNA. Science 241 551 557 (1988). 159. McManus, S.A. & Li, Y.F. Turning a Kinase Deoxyribozyme into a Sensor. Journal of the American Chemical Society 135 7181 7186 (2013). 160. Amara, R.R., Villinger, F., Altman, J.D., Lydy, S.L. et al. Control of a mucosal challenge and prevention of AIDS by a multiprotein DNA/MVA vaccine. Science 292 69 74 (2001).

PAGE 153

153 BIOGRAPHICAL SKETCH Da Han was born in Heilongjiang China. He spent his first 10 years in Qiqihaer Heilongjiang After elementary school education in 1998 he and his parents moved to a beautiful beach city Qinhuangdao in Hebei province. In 2005, he attend ed Xiamen University, where he obtained his B.S. degree in c hemistry in 2009 With the successful completion of all the necessary examinations for U.S. college graduate school application, he was accepted by Department of Chemistry in University of Florida in 2009 where he was mentored by Prof. Weihong Tan. His research interest during graduate study is to develop DNA based molecular system for intelligent therapy He received his Ph.D. in c hemistry from the University of Florida in the fall of 201 3.