The NADPH Oxidase-Mediated Oxidative Stress Signaling, Resistance, Pathogenicity and Development in Alternaria Alternata...

MISSING IMAGE

Material Information

Title:
The NADPH Oxidase-Mediated Oxidative Stress Signaling, Resistance, Pathogenicity and Development in Alternaria Alternata of Citrus
Physical Description:
1 online resource (137 p.)
Language:
english
Creator:
Yang, Siwyling
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Plant Pathology
Committee Chair:
CHUNG,KUANG REN
Committee Co-Chair:
JONES,JEFFREY B
Committee Members:
ROLLINS,JEFFREY A
ALTPETER,FREDY

Subjects

Subjects / Keywords:
alternaria-alternata -- development -- nadph-oxidase -- nox -- pathogenicity -- ros -- ros-detoxification -- signaling
Plant Pathology -- Dissertations, Academic -- UF
Genre:
Plant Pathology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
The necrotrophic fungus Alternaria alternata causes brown spot disease in many citrus cultivars. This pathogen produces a host-selective toxin that kills host cells prior to colonization and acquires nutrients from dead cells. A. alternata infection in citrus leaves induces rapid lipid peroxidation and accumulation of hydrogen peroxide. A. alternata has evolved an effective reactive oxygen species (ROS) detoxification system to successfully colonize within the oxidative environment of necrotic tissues. Fungal NADPH oxidase complex (Nox), which has been implicated in the production of low-level ROS, contains mainly NoxA, NoxB (gp91-phox homologs) and NoxR (p67-phox homolog). This dissertation research determines the developmental and pathological functions of Nox in the tangerine pathotype of A. alternata. Each of the AaNoxA, AaNoxB and AaNoxR genes was cloned and disrupted independently or in combination, revealing that all three Nox components are required for the accumulation of cellular ROS. Nox mutants also displayed an increased sensitivity to hydrogen peroxide and various oxidants and reduced fungal virulence, implicating a critical role of AaNox in oxidative stress tolerance during host invasion. A fungal strain carrying a NoxA NoxB or a NoxA NoxR double mutation was more sensitive to the test compounds than the strain mutated at a single gene. The expression of both YAP1 and HOG1 genes, whose products are involved in resistance to ROS, was down-regulated in fungi carrying defective NoxA, NoxB or NoxR. The requirement of Nox in ROS resistance was demonstrated further by characterizing an AaGPx gene encoding a putative glutathione peroxidase. AaGPx plays a role in oxidative stress resistance and virulence and its expression is coordinately regulated by NOX, YAP1 and HOG1. This dissertation research also demonstrates that Nox, likely interconnecting with the FUS3 MAP kinase- and the cAMP-dependent protein kinase A (PKA)-mediated pathways, plays a central role in vegetative growth and conidia formation. Interestingly, only AaNoxB, but not AaNoxA, has a role in the accumulation of chitin, the maintenance of cell wall integrity and the sensitivity to fungicides. These novel phenotypes have not been identified in any fungus. Overall, this study reveals that AaNox is one of the key regulators for ROS production and for signaling transductions leading to proper fungal development, as well as fungal virulence and cellular resistance to ROS; and that the ability of ROS-detoxification mediated by interconnected pathways is absolutely required for A. alternata survival and pathogenesis.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Siwyling Yang.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: CHUNG,KUANG REN.
Local:
Co-adviser: JONES,JEFFREY B.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0046084:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 THE NADPH OXIDASE MEDIATED OXIDATIVE STRESS SIGNALING RESISTANCE PATHOGENICITY AND DEVELOPMENT IN Alternaria alternata OF CITRUS By SIWY LING YANG A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLO RIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Siwy Ling Yang

PAGE 3

3 To my parents

PAGE 4

4 ACKNOWLEDGMENTS Many people deserve special reco gnition for their contribution throughout my graduate studies. First, I would like to express my heart felt gratitude to Dr. Kuang Ren Chung, the chair of my supervisory committee, for his intellectual guidance and constant support toward my success. I grat efully thank him for his faith in me, and for his encouragement, patience and sharing of his expertise and brilliant ideas during every stages of this project. I also express my deepest appreciation to Dr. K. R. Chung and Mrs. Chung for their consistent ca re and support, helping me to acclimatize at Lake Alfred from the very first day of my arrival. I would also like to extend my gratitude to Drs. Jeffrey Rollins, Jeffrey Jones and Fredy Altpeter, members of my committee, for their valuable suggestions and useful advice Special thanks to Dr. Kou Cheng Peng, my former MS adviser in Taiwan, for his mental support and continuous inspiration I want to dedicate a special gratitude to my boyfriend, Hanchao Zhao, for his company, understanding and encouragement. I am also thankful to my lovely friends in Lake Alfred, Gainesville and Taiwan Ch ia Wei Liu, Pi Yun Liu and Hsieh Ch in Tsai, Shizuko Okusa Jack Chen, Laura Waldo, Hong Ling Er, Xiaofei Liang, for their unconditional help, support and lively company duri ng my graduate years, making my research life more enjoyable. It is a great pleasure to thank my former lab mates and everyone at CREC, Lake Alfred and Plant Pathology Department, Gainesville, for their valuable help and assistance. For those not mentioned who had contributed to my success, I offer my sincere gratitude. L ast and most importantly, I express my greatest appreciation to my beloved family. To my parents Hoong Yang and Yek Ying Goh, who raised me to be responsible

PAGE 5

5 and independent, and taught m e to value education, for all their love, emotional and financial support; to my brothers and sisters, for taking good care of our parents during the past years and supporting my dream with patience. Without their loving support and encouragement, I would not be where I am today.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 LIST OF AB BREVIATIONS ................................ ................................ ........................... 12 ABSTRACT ................................ ................................ ................................ ................... 14 CHAPTER 1 LITERATURE REVIEW ................................ ................................ .......................... 16 Introd uction of Alternaria alternata (Fr.) Keissler ................................ .................... 16 Taxonomy and Geographical Distribution ................................ ......................... 16 H ost Range and D isease S ymptom s ................................ ................................ 16 Host Selective Toxins ................................ ................................ ....................... 17 Life Cycle ................................ ................................ ................................ .......... 18 The Biology of Reactive Oxy gen Species ................................ ............................... 19 Generation of Reactive Oxygen Species ................................ .......................... 19 ROS Scavenging ................................ ................................ .............................. 20 ROS in Cellular Development ................................ ................................ ........... 22 Fungal NADPH Oxidase System ................................ ................................ ...... 23 Oxidative Stress Signaling ................................ ................................ ................ 26 Research Overview ................................ ................................ ................................ 27 2 GENERATION OF REACTIVE OXYGEN SPECIES BY NADPH OXIDASES IN Alternaria alternata OF CITRUS ................................ ................................ ............. 33 Introduction ................................ ................................ ................................ ............. 33 Materials and Methods ................................ ................................ ............................ 35 Fungal Strains and Cultures Conditions ................................ ........................... 35 Molecular Cloning and Sequence Analysis ................................ ...................... 35 Construction of Split Maker Fragments for Targeted Gene Disruption ............. 36 Preparations of Protoplasts and Fungal Transformation ................................ .. 37 Manipulation of Nucleic Acids ................................ ................................ ........... 38 Detectio n and Quantification of ROS ................................ ................................ 39 Nucleotide Sequences ................................ ................................ ..................... 40 Result ................................ ................................ ................................ ...................... 41 Characterization of NoxA NoxB and NoxR homologs from A alternata .......... 41 Targeted Disruption of NoxA NoxB and NoxR in A. alternata .......................... 41 The NADPH Oxidases contribute to the ROS Production ................................ 43 Discussion ................................ ................................ ................................ .............. 45

PAGE 7

7 3 NADPH OXIDASES ARE REQUIRED FOR OXIDATIVE STRESS RES ISTANCE AND FULL VIRULENCE IN THE CITRUS FUNGUS Alternaria alternata ................................ ................................ ................................ .................. 59 Introduction ................................ ................................ ................................ ............. 59 Materials and Methods ................................ ................................ ............................ 62 Fungal Strains and Culture Conditions ................................ ............................. 62 Creation and Identification of Double Mutants ................................ .................. 62 Manipulation of Nucleic Acids ................................ ................................ ........... 63 Sensitivity Test ................................ ................................ ................................ 63 Virulence Test ................................ ................................ ................................ .. 63 Result ................................ ................................ ................................ ...................... 64 Generation of Nox Double Mutants ................................ ................................ .. 64 Nox contributes to Oxidative and Nitrosative Stress Resistance ...................... 64 Expression of Nox Genes is responsive to Oxidative and Nitrosative Stress ... 66 Nox regulates the YAP1 Transcription Factor and t he HOG1 MAP Kinase ...... 66 Expression of AaAP1 ................................ ................................ ....................... 67 Nox Mutants Appear to be Unable to Penetrate Citrus Leaves ........................ 67 Discussion ................................ ................................ ................................ .............. 68 4 THE INVOLVEMENT OF NADPH OXIDASES IN DEVELOPMENTAL AND PHYSIOLOGICAL PROCESSES OF Alternaria alternata ................................ ...... 81 Introduction ................................ ................................ ................................ ............. 81 Materials and Methods ................................ ................................ ............................ 83 Fungal Strains and Chemical Sensitivity Tests ................................ ................. 83 Isolation and Quantification of Conidia ................................ ............................. 84 Extraction and Quantification of Fungal Chitin ................................ .................. 84 Manipulation of Nucleic Acids ................................ ................................ ........... 85 Protein Purification and Western Blot Analysis ................................ ................. 85 Results ................................ ................................ ................................ .................... 86 Nox is involved in Conidia Formation ................................ ............................... 86 NoxB Plays a Negative Role in Cell Wall Integrity and Fungicides Sensitivity .. 87 Gene Expression ................................ ................................ .............................. 88 AaNoxB Negatively Regulates Phosphorylation of AaFUS3 ............................ 88 Di scussion ................................ ................................ ................................ .............. 89 5 GLUTATHIONE PEROXIDASE MEDIATED OXIDATIVE STRESS RESISTANCE IS REGULATED BY NADPH OXIDASE IN Alternaria alternata .... 101 Introduction ................................ ................................ ................................ ........... 101 Materials and Methods ................................ ................................ .......................... 103 Fungal Strains and Chemical Sensitivity Tests ................................ ............... 103 Molecular Cloning and Sequence Analysis ................................ .................... 103 AaGPx Gene Inactivation ................................ ................................ ............... 103 Miscellaneous ................................ ................................ ................................ 104 Results ................................ ................................ ................................ .................. 104

PAGE 8

8 Cloning and Characterization of AaGPx ................................ ......................... 104 Targeted Disrup tion of AaGPx ................................ ................................ ........ 105 AaGPx Is Required for Conidia Formation and Fungal Virulence ................... 105 AaGPx Contributes to Resistance to Oxidative Stress ................................ ... 106 AaGPx Is Involved in Chitin Biosynthesis ................................ ....................... 106 Expression of AaGPx Is Regulated by NOX, YAP1 and HOG1 ...................... 106 Discussion ................................ ................................ ................................ ............ 107 APPENDIX A GENOTYPE OF Alternaria alternata STRAINS ................................ .................... 118 B PRI MER SEQUENCE ................................ ................................ ........................... 119 LIST OF REFERENCES ................................ ................................ ............................. 121 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 137

PAGE 9

9 LIST OF TABLES Table page 1 1 Host selective toxins in Alternaria alternata ................................ ........................ 29 1 2 Functions of fungal Nox complexes ................................ ................................ .... 30 3 1 Pathogenicity assayed on detached Minneola or calamondin leaves ................. 80 5 1 A. alternata GPx is highly similar to other GPx/HYR1 homologs of fungi and y east ................................ ................................ ................................ ................. 117 A 1 Genotypes of Alternaria alternata strains used in this study ............................. 118 B 1 Sequence of oligonucleotide primers used in this study ................................ ... 119

PAGE 10

10 LIST OF FIGURES Figure page 1 1 A lternaria brown spot on tangerine leaves and fruits. ................................ ......... 31 1 2 Generation of ROS from ground state oxygen ................................ .................... 31 1 3 ROS detoxification mechanisms ................................ ................................ ......... 32 2 1 Alignment of amino acids among fungal NADPH oxidases NoxA and Nox1 ...... 49 2 2 Alignment and comparison of the deduced amino acid sequences of NoxA and NoxB of Alternaria alternata ................................ ................................ ......... 50 2 3 Alignment of the deduced amino acid sequence of the Alternaria alternata NoxR with the Epichlo festucae EfNoxR, Botrytis cinerea BcNoxR and human Hsp67 phox ................................ ................................ ............................... 51 2 4 Targeted disruption of AaNoxA in Alternaria alternata ................................ ........ 52 2 5 Targeted disruption of NoxB gene in Alternaria alternata using a split marker approach ................................ ................................ ................................ ............ 53 2 6 Targeted disruption of NoxR in Alternaria alternata using a split marker approach ................................ ................................ ................................ ............ 54 2 7 NoxA, NoxB and NoxR are required for the accumulation of cellular H 2 O 2 ....... 55 2 8 Quantitative analysis of H 2 O 2. ................................ ................................ ............. 56 2 9 Accumulation and detection of superoxide within the hyphae of t he wild type strain (WT), the AaNoxA muta nts (DN2 and DN6) and the rescued strain (CpA16) ................................ ................................ ................................ .............. 57 2 10 Detection of ROS within Alternaria alternata hyphae staining with the fluorescent probe H 2 DCF DA ................................ ................................ ............... 58 3 1 Targeted disruption of AaNoxA in a fungal strain lacking NoxB (DB5) or NoxR (DR2) of Alternaria alternata using a split marker approach. .................... 73 3 2 Sensitivity assays of the wild type (WT), the strains carrying a single deletion of NoxA NoxB or NoxR the genetically complementation (CpA16, CpB24 and CpR40), and the double mutation NoxA NoxB (noxAB) and NoxA NoxR (noxAR) st rains of Alternaria alternata ................................ ................................ 74 3 3 Sensitivity assays of the wild type (WT), the strains carrying a single deletion of NoxA NoxB or NoxR of A. alternata ................................ ............................... 75

PAGE 11

11 3 4 Images of RNA gel blotting. ................................ ................................ ................ 76 3 5 Images of RNA blotting. ................................ ................................ ...................... 77 3 6 RNA gel blotting indica tes the expression of AaAP 1 ................................ .......... 78 3 7 Pathogenicity of the NoxA NoxB and NoxR mutants of A. alternata assayed on unwounded or pre wounded calamondin or Minneola leaves ........................ 79 4 1 Reduced pigmentation and conidiation in NoxA mutant of A. alternata .............. 94 4 2 Conidia produced by the wild type strain (WT), the strains lacking Aa NoxB and the complementation strain CpB24 of A. alternata ................................ ...... 95 4 3 Conidia produced by the wild type strain (WT), the strains lacking AaNoxR and the complementation strain CpR40 of A. alternata ................................ ...... 96 4 4 Sensitivity assays of the strains carrying a single Nox gene mutation (noxA, noxB and noxR), the corresponding rescued strains (CpA16, CpB24 and CpR40) and the NoxA NoxB (noxAB) and N oxA NoxR (noxAR) double mutant strains of A. alternata ................................ ................................ .............. 97 4 5 Quantification of chitin in the cell wall ................................ ................................ 98 4 6 Images of RNA b lotting ................................ ................................ ....................... 99 4 7 Immunological detection of the AaFUS3 protein in A. alternata ........................ 100 5 1 Functional domains of AaGPx identified in the tangerine pathotype of A. alternata ................................ ................................ ................................ ........... 110 5 2 Targeted disruption of AaGPx in Alternaria alternata ................................ ....... 111 5 3 Reduced pigmenta tion and conidiation observed in the GPx mutants of A. alternata ................................ ................................ ................................ ........... 112 5 4 AaGPx mutants displayed a reduced virulence ................................ ................ 113 5 5 A ssays for chemical sensitivity of the wild type (WT), two AaGPx mutants (10 and 22) and a complementation strain Cp16 of A. alternata ............................. 114 5 6 Quantification of chitin in the cell wall obtaine d from the wild type (WT), the strains carrying GPx gene mutation (GPx10 and GPx22) and the genetically rescued strain CpGPx16 of A. alternata ................................ ........................... 115 5 7 Images of RNA blotting ................................ ................................ ..................... 1 16

PAGE 12

12 LIST OF ABBREVIATIONS CaCl 2 Calcium chloride Ca(NO 3 ) 2 4H 2 O Calcium nitrate 4 hydrate CFW Calcofluor white CR Congo red DAB diaminobenzidine DNA Deoxyribonucleic acid dpi day post inoculation FAD Flavin adenine dinucleotide H 2 O 2 Hy drogen peroxide HCl Hydrochloric acid HDA Hydroxylamine hydrochloride HP Hematoporphyrin HST Host selective toxin HYG Hygromycin phosphotransferase gene INA 2,6 d ichloroisonicotinic acid KH 2 PO 4 Monopotassium phosphate MgSO 4 7H 2 O Magnesium sulfate heptahydr ate MAPK M itogen activated protein kinase MND Menadione min minute NaCl Sodium chloride Na 2 HPO 4 Sodium phosphate dibasic NADPH Nicotinamide adenine dinucleotide phosphate Nox NADPH oxidase

PAGE 13

13 N Arg N itro arginine methyl ester ORF O pen reading frame PDA P otato dextrose agar PEG P olyethylene glycol 3350 RB R ose Bengal RMM Regeneration medium RNA Ribonucleic acid ROS Reactive oxygen species SDS Sodium dodecyl sulfate SNP S odium nitroprusside SOD Superoxide dismutase Sur Sulfonylurea resistance gene tBH tert butyl hydroperoxide

PAGE 14

14 Abstract of Dissertation Prese nted to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy THE NADPH OXIDASE MEDIATED OXIDATIVE STRESS SIGNALING RESISTANCE, PATHOGENICITY AND DEVELOPMENT IN Alternaria alternata OF CITRUS By Siwy Ling Yang December 2013 Chair: Kuang Ren Chung Major: Plant Pathology The necrotrophic fun gus Alternaria alternata causes brown spot disease in many citrus cultivars. This pathogen produces a host selective toxin that kills host cells prior to colonization and acquires nutrients from dead cells. A. alternata infection of citrus leaves induces rapid lipid peroxidation and accumulation of hydrogen peroxide ( H 2 O 2 ). A. alte rnata has evolved an effective reactive oxygen species ( ROS ) detoxification system to successfully colonize within the oxidative environment of necrotic tissues. Fungal NADPH oxidase complex (Nox), which has been implicated in the production of low level R OS, contains mainly NoxA, NoxB (gp91 phox homologs) and NoxR (p67 phox homolog) T his dissertation research determines the developmental and pathological functions of Nox in the tangerine pathotype of A. alternata Each of the AaNoxA AaNoxB and AaNoxR genes was cloned and disrupted independently or in combination, revealing that all three Nox components are required for the accumulation of cellular ROS Nox mutants also displayed increased sensitivity to H 2 O 2 and various oxidants as well as reduced fungal vi rulence, implicating a critical role of AaNox in oxidative stress tolerance during host invasion. A fungal strain carrying a NoxA NoxB or a NoxA Nox R double mutation was more sensitive to the test compounds than the strain mutated at a

PAGE 15

15 single gene. The exp ression of both YAP1 and HOG1 gene s, whose products are involved in resistance to ROS, was down regulated in fungi carrying defective NoxA NoxB or NoxR The requirement of Nox in ROS resistance was demonstrated further by characterizing a n AaGPx gene enco ding a putative glutathione peroxidase AaGPx plays a role in oxidative stress resistance and virulence and its expression is coordinately regulated by N OX Y AP 1 and H OG 1. This research also demonstrates that Nox likely interconnecting with the FUS3 MAP k inase and the cAMP dependent protein kinase A (PKA) mediated pathways, plays a central role in vegetative growth and conidia formation Interestingly, only Aa NoxB but not Aa NoxA has a role in the accumulation of chitin, the maintenance of cell wall inte grity and the sensitivity to fungicide s T h ese novel phenotype s ha ve not been identified in any fungus. Overall, this study reveals that AaNox is one of the key regulators for ROS production and for signaling transductions leading to proper fungal developm ent, as well as fungal virulence and cellular resistance to ROS ; and that t he ability of ROS detoxification mediated by interconnected pathways is absolutely required for A. alternata survival and pathogenesis

PAGE 16

16 CHAPTER 1 LITERATURE REVIEW Introduction of Alternaria alternata (Fr.) Keissler Taxonomy and Geographical Distribution Alternaria brown spot of citrus is caused by t he necrotrophic fungus Alternaria alternat a (Fr.) Keissler The disease was first described on Em peror Mandarin in Australia in 1903 (C obb, 1903). The causal pathogen was identified as Alternaria citri Ellis & Pierce (Kiely, 1964; Pegg, 1966) and later reclassified to A. alternata (Simmons, 1967; Kohmoto et al., 1979). A. alternata is classified in the Kingdom Fungi, Phylum Ascomycota, Cl ass Dothideomycetes, Subclass Pleosporomycetidae, Order Pleosporales, and Family Pleosporaceae. Citrus brown spot was first reported in Florida on Dancy tangerine in 1976 (Whiteside, 1976). The disease is also known in many citrus growing areas of South Af rica, Israel, Turkey, Colombia, Spain, Italy, Brazil, Argentina, and Peru (Timmer et al., 2003; Peres and Timmer, 2006) H ost Range and D isease S ymptom s On citrus, Alternaria species cause four distinct diseases Alternaria black rot of fruit, Alternaria brown spot of tangerine, Alternaria leaf spot of rough lemon and Mancha foliar on Mexican lime. Alternaria black rot is caused by Alternaria citri Ellis & Pierce. This disease causing internal decay is a common post harvest disease worldwide. A. citri does not produce host selective toxin (HST). This pathogen i nfects at the stylar or stem end of the fruit and causes an internal discoloration of the fruit core A. citri infects citrus fruit through wounds or natural crack and endopolygalacturonase produced b y A. citri is essential for symptom development (Isshiki et al., 2001; Katoh et al., 2006) Mancha foliar is caused by A. limicola (Palm and Civerolo, 1994) A. limicola

PAGE 17

17 does not produce HST and primarily affects Mexican lime [ Citrus aurantifolia ( Christm. et Panz ) Swingle ] It produces small, reddish brown lesions on leaves that are surrounded by chlorotic halos. Small raised lesions are produced on fruit, but the symptoms disappear as the fruit grows (Akimitsu et al., 2003). Alternaria brown spot of tange rine and leaf spot of rough lemon are caused by two different pathotypes of A. alternata that produce distinct HST (Kohmoto et al., 1979; Kohmoto et al., 1991). On young leaves, lesions first appear as brown to black spots surrounded by yellow halos within 24 hours after infection (Fig. 1 1). Lesio ns usually continue to expand with circular or irregular chlorosis due to cell death caused by the toxin (Kohmoto et al., 1993). Chlorosis and necrosis often occur along the veins as the toxin is translocated thro ugh the vascular system. Young shoots are also infected and produc e brown lesions. Shoot infection and abscission of affected leaves could result in twig dieback. Young fruit is susceptible to A. alternata infection soon after petal fall. Severely infected fruit sometimes abscise, resulting in yield loss (Timmer et al., 2000). Symptoms on mature fruit vary from small, dark specks to large, sunken lesions. The rough lemon pathotype affect s rough lemon ( Citrus jambhiri Lush) and Rangpur lime ( Citrus x limonia Osbeck ) (Timmer et al., 2003). Symptoms on fruit induced by the rough lemon pathotype are relatively smaller than those produced by the tangerine pathotype (Timmer et al., 2003) Both tangerine and rough lemon pathotypes of A. alternata are similar in mor phology, but can be differentiated by host preference, toxin production and genetic analysis (Peever et al., 1999; Akimitsu et al., 2003) Host Selective Toxins Host selective toxins produced by A. alternata are essential for fungal pathogenesis (Gardner e t al., 1986; Kohmoto et al., 1993) and are important

PAGE 18

18 determinants of host range (Kohmoto et al., 1991; Walton, 1996). T here are seven known pathogenic variants (pathotypes) of A. alternata. Each pathotype produces a unique HST that is selectively toxic to limited plant species or cultivars within a species (Table 1 1) (Nishimura and Kohmoto, 1983; Kohmoto et al., 1991; Ito et al., 2004) The tangerine pathotype produces ACT ( A. citri toxin) that is toxic to tangerine ( C reticulata Blanco) and grapefruit ( C paradisi Macfad.), as well as hybrids from grapefruit and tangerine or tangerine and sweet orange ( C sinensis (L.) Osbeck). AC T containing a core 9,10 epoxy 8 hydroxy 9 methyl decatrienoic acid structure primarily disrupts plasma membrane and causes rap id electrolyte leakage (Kohmoto et al., 1993). T he rough lemon pathotype produces ACRL toxin that is toxic to rough lemon ( C jambhiri Lush) and Rangpur lime ( C x limonia Osbeck). ACRL affects the functions of mitochondria, causing metabolite leakage, unc oupling of oxidative phosphorylation and changes in membrane potentials (Akimitsu et al., 1989; Otani et al., 1995). ACRL is not toxic to tangerines, grapefruit and their hybrids. Life Cycle A alternata has no known sexual stage. Sporulation is affected b y e nvironmental stimuli (e.g. light, oxygen, nutrition and stress) (Rotem, 1994). Formation of conidia (asexual spore) is essential for dispersing fungal inoculum and for initiatin g Alternaria diseases o n citrus. Conidia have thick and melanized cell wall s and can tolerate unfavorable environmental conditions. Conidia produced on affected citrus leaves and fruit are dispersed by rain or wind. Under favorable conditions (e.g. high humidity, optimum temperature 25 30 C ), A. alternata germinates in 1 3 hour to form penetration hyphae on susceptible cultivars (Akimitsu et al., 2003). A. alternata could penetrate

PAGE 19

19 through stomata or natural wounds without the formation of appressoria. Fungal hyphae proliferate in the substomatal cavities (Rotem, 1994) The B io logy of Reactive Oxygen Species All aerobic organisms generate reactive oxygen species (ROS), including superoxide (O 2 ), hydrogen peroxide (H 2 O 2 ) and hydroxyl radicals (OH ), as inevitable byproducts of normal metabolism (Apel and Hirt, 2004) ROS, partially reduced oxygen species are highly toxic to cells and indiscriminately damage DNA, proteins, lipids carbohydrates and other cell components (Heller and Tudzynski, 2011). ROS are harmful, but cells are able to mitigate by producing ROS scavenging enzymes, such as superoxide dismutases (SOD), catalases and peroxidases. ROS not only play a vital role in cellular defense against pathogen attack but also serve as signaling molecules for cellular development and differentiation (Orozco Cardenas et al., 2001; B rown and Griendling, 2009). ROS also play an important role in the plant microbe interactions. Recognition of a non defined by a rapid increase of ROS production and other defense respon ses (Auh and Murphy, 1995). However, the production of ROS by plants ma y have different effects towards pathogens with different lifestyles (biotrophs vs. necrotrophs). To successfully colonize a host plant and survive in harsh environments, necrotrophic f ungi have evolved sophisticated mechanisms for cellular protection against the toxicity of ROS G eneration of Reactive Oxygen Species Ground state oxygen c an be converted to toxic ROS either by energy transfer or by electron transfer reactions (Fig. 1 2). Formation of singlet oxygen ( 1 O 2 ) resul ts from energy transfer, whereas sequential electron transfers between reducing agents lead to

PAGE 20

20 the production of the highly reactive O 2 H 2 O 2 and OH O 2 and H 2 O 2 may react with each other and generate highly reac tive hydroxyl radicals and hydroxyl anions (OH ) via the Haber Weiss reaction (Kehrer, 2000) or with transition metals (e.g. iron and copper) via the Fenton reaction (Halliwell and Gutteridge, 1992). ROS are often produced as by products of various metabol ic pathways in mitochondria, peroxisomes and chloroplasts of plants. ROS can be generated by enzymatic and non enzymatic systems. In the presence of reducing agents, O 2 can be generated by nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (Beda rd and Krause, 2007), peroxidase (Bolwell et al., 2002; Bindschedler et al., 2006) xanthine oxidase (Harrison, 2002), oxalate oxidase (Hu et al., 2003), superoxide dismutase (SOD) (Auh and Murphy, 1995), or amine oxidase (Cona et al., 2006). In addition, many photo activated perylenequinone pigments produced by many plant associated fungi are capable of producing toxic ROS upon exposure to light (Daub et al., 2013). ROS Scavenging All cells have evolved effective mechanisms, both enzymatic and non enzymati c, to cope with the toxicity of ROS. SOD catalases, peroxiredoxins and peroxidases, such as glutathione peroxidase (GPx) have long been known to have catalytic ROS scavenging abilities (Fig. 1 3) SOD are able to dismutate O 2 into H 2 O 2 and O 2 acting as the first line of ROS detoxification Catalases, peroxiredoxins and peroxidases detoxify H 2 O 2 Non enzymatic antioxidants, such as glutathione ascorbic acid, flavonoids, alkaloids and carotenoids are capable of detoxifying ROS (Jamieson, 1998). Glutathio ne L glutamyl L cysteinyl glycine) containing a redox active sulfhydryl group is the predominant non protein thiol compound present in nearly all living organism s (Meister and Anderson, 1983). GSH is required for maintaining cellular redox

PAGE 21

21 state, whic h could affect the protein thiol/disulfide equilibrium (Grant et al., 1996a; Grant et al., 1996b ; Emri et al., 1997; Dickinson and Forman, 2002). GPx reduces peroxides by oxidising two reduced GSH to form an oxidized glutathione disulfide (GSSG) (Fig. 1 3) Oxidized GSSG can be recycled to GSH by glutathione reductase (GR) coupling with NADPH as an electron donor (Blokhina et al., 2003). Cellular redox status is maintained by the GSH/GSSG ratio (Schafer and Buettner, 2001). When the GSH/GSSG ratio decreases cells are under oxidative stress. In addition, GSH is capable of reducing disulfide bonds in proteins and detoxifying xenobiotics by serving as an electron donor (Apel and Hirt, 2004; Wu et al., 2004). In plant microbe interactions, the roles of ROS may vary depending on the lifestyle of the pathogen and the physiological conditions of the host (Heller and Tudzynski, 2011). The YAP1 redox responsive transcription factor homologous to mammalian AP 1 (activating protein 1) is one of the most important deter minants of oxidative stress response in the budding yeast Saccharomyces cerevisiae (Toone et al., 1998; Delaunay et al., 2002; Toledano et al., 2004). In the biotrophic fungus Ustilago maydis YAP1 regulates a number of genes involved in ROS detoxification and is required for full virulence (Molina and Kahmann, 2007). Similarly, YAP1 of the hemibiotrophic fungus Magnaporthe oryzae is involved in oxidative stress responses and is critical for pathogenicity (Guo et al., 2011). However, YAP1 mediated ROS detox ification is not essential for virulence in the necrotrophic fungi Botrytis cinerea and Cochliobolus heterostrophus (Lev et al., 2005; Temme and Tudzynski, 2009). I n the tangerine pathotype of A. alternata the YAP1 transcriptional regulator, AaAP1, a HOG1 mitogen activated protein kinase (MAPK) homolog, AaHOG1, and a SKN7 response

PAGE 22

22 regulator have been shown to be required for ROS resistance and pathogenicity/virulence (Lin et al., 2009; Lin and Chung, 2010; Chen et al., 2012). In addition, A. alternata NPS6 a fungal nonribosomal peptide synthetase analog is involved in siderophore mediated iron acquisition and ROS resistance and is a virulence factor (Chen et al., 2013). Those studies implicate the importance of effective ROS detoxification in the successfu l pathogenesis of A. alternata (Chung, 2012). ROS in Cellular Development ROS also play an important role in cell differentiation (Wojtaszek, 1997; Bartosz, 2009). Under normal growth conditions, cells maintain low level ROS by bal ancing between their gene ration and scavenging. Cells initiate differentiation in response to a transient increase of ROS (Moye Rowley, 2003). Assays by spontaneous oxygen dependent chemiluminescence indicate that the levels of ROS are elevated during conidia development in Neuros pora crassa (Hansberg et al., 1993). The social amoeba Dictyostelium discoideum produces and secret e s O 2 during the transition from single cell to multicellular form in response to a heat labile factor (Bloomfield and Pears, 2003). In response to heat st ress, the multicellular green algae Volvox carteri initiates sexual reproduction due to an increased cellular ROS level (Nedelcu et al., 2004). To avoid damages, cells must equip ROS scavenging systems during development. The genes encoding antioxidant enz ymes are often up regulated during developmental processes in fungi (Aguirre et al., 2005). In Colletotrichum graminicol a a manganese SOD coding gene is up regulated during spore development (Fang et al., 2002). C opper zinc SOD activity is elevated during transition from yeast to hyphae in C. albicans (Martchenko et al., 2004). Aspergillus nidulans and N crassa have several catalase coding genes that are differentially expressed in different cellular compartments or cell types (Kawasaki

PAGE 23

23 and Aguirre, 2001; Michan et al., 2002). A s nidulans and N crassa catalase coding genes are induced by oxidative stress and up regulated at the initiation of conidiation. Exogenous application of water soluble antioxidants reduces cellular ROS level and suppresses conidia formation in N crassa (Hansberg et al., 1993). Moreover, an N crassa catalase 3 null mutant shows increased sensitivity t o oxidative stress, accompan ied by increased protein oxidation, carotene synthesis, hyphal adhesion and conidiation (Michan et al., 2003). Mutational inactivation of the N crassa copper zinc SOD coding gene ( sod 1 ) increases carotene levels and affects the polarity of perithecia (Yoshida and Hasunuma, 2004) Fungal NADPH Oxidase System The NADPH oxidase (Nox) transfers electrons from NADPH to oxygen molecules via two electron carriers, flavin adenine dinucleotide (FAD) and two independent hemes, resulting in the production of O 2 (Vignais, 2002) Nox is widely distributed in animals, plants and fungi. NOX is required for oxidative bur st defense response in mammalian phagocytes (mainly neutrophils and macrophages) (Babior, 1999; Cross and Segal, 2004). The phagocyte Nox is a multiunit enzyme composed of a catalytic subunit gp91 phox (also known as Nox2), an adaptor protein p22 phox three cytosolic regulatory subunits p67 phox p47 phox and p40 phox and the small GTPase Rac2 (Diebold and Bokoch, 2001; Lambeth, 2004). In resting cells, p67 phox p47 phox and p40 phox form a complex in the cytosol. gp91 phox and p22 phox form a heterodimeric flavoh emoprotein, known as a cytochrome b 558 and are localized in the cell membrane. All gp91 phox homologs analyzed to date hav e the six transmembrane domains and putative FAD and NADPH binding domains in the cytoplasmic C terminus (Takemoto et al., 2007).

PAGE 24

24 Plant s contain NADPH oxidases homologous to gp91 phox designated respiratory burst oxidase homologs (Rboh). Rbohs are required for ROS accumulation in response to pathogen invasion (Torres et al., 2002; Yoshioka et al., 2003; Torres et al., 2005). Rboh is invol ved in the regulation of root hair growth through activation of Ca 2+ channels (Foreman et al., 2003). In addition, Rboh interplaying with abscisic acid mediated signaling pathways is involved in the regulation of stomatal closure, seed germination and root elongation (Kwak et al., 2003). Some fungi and algae also possess gp91 phox homologs (Herve et al., 2006; Takemoto et al., 2007). However, Nox gene homologs are not found in Schizosaccharomyces pombe Ustilago maydis and Rhizopus oryzae Many filamentous fungi such as Aspergillus spp. have only one copy of Nox homolog; others including Podospora anserina and Fusarium solani have multiple Nox homologs (Takemoto et al., 2007). A Nox ortholog, Yno1p/Aim14p, was recently characterized to be required for extr amitochondrial generation of ROS, apoptosis and formation of actin cable s in S cerevisiae (Rinnerthaler et al., 2012). Filamentous fungi have three NADPH oxidase subfamilies NoxA, NoxB and NoxC. Both NoxA and NoxB are ortholog to the gp91 phox NoxB is s tructurally similar to NoxA but c ontains an additional 40 amino acids in the N terminus. NoxC has an additional 170 250 amino acids in the N terminus. NoxC contains a putative calcium binding EF hand motif, commonly found in human Nox5 and the plant Rboh ( Takemoto et al., 2007). Fungal Nox complexes are involved in a wide range of physiological and developmental functions (Table 1 2). NoxA (Nox1) homologs play a critical role in the development of sexual fruiting bodies in A s nidulans (Lara Ortiz et al., 2 003), P

PAGE 25

25 anserin a (Malagnac et al., 2004) and N crassa (Cano Dominguez et al., 2008) NoxB (Nox2) homologs are required for ascospore germination in P. anserin a and N. crassa (Malagnac et al., 2004; Cano Dominguez et al., 2008). T he f ungal endophyte, Epic hlo festucae lacking NoxA but n ot Nox B is highly pathogenic, producing excessive hyphal branching and showing unregulated growth within its plant host (ryegrass, Lolium perenne ) (Tanaka et al., 2006). Nox system is required for pathogenicity in many phyt opathogenic fungi. Both N oxA and N oxB are required for sclerotial differentiation and pathogenicity in the necrotrophic fungus B cinerea A m utant impaired for BcnoxA has full penetration ability compared to wild type but colonizes host tissue slowly. The BcnoxB mutant shows impaired function of appressoria and delayed formation of primary lesions The BcnoxR mutant forms wild type appressoria but fails to penetrate host tissue. However, a B. cinerea mutant lacking NoxA or NoxB does not reduce ROS accumula tion, suggesting the presence of an alternative source of ROS production during plant infection (Segmuller et al., 2008) Deletion of N ox1 or N ox2 in M oryzae yielded fungal strains that are unable to form appressorium and are non pathogenic to rice (Egan et al., 2007). In Sclerotinia sclerotiorum Ssnox1 silenced mutant shows significant reduction in virulence and sclerotia development, whereas Ssnox2 silenced mutant remains fully pathogenic even though the mutant fails to form sclerotia (Kim et al., 2011 ). Little is known about how the Nox complex is regulated in fungi. Fungal NoxR is analogous with the mammalian p67 phox The E. festucae NoxR is required for the expression of NoxA within the host plant Inactivation of NoxR in E. festucae yielded fungal s trains with reduce d H 2 O 2 production becom ing highly pathogenic to its host

PAGE 26

26 plant (Takemoto et al., 2006; Tanaka et al., 2006). Yeast two hybrid and co immunoprecipitation assays have demonstrated that RacA (mammalian Rac2 homolog) and two polarity proteins Bem1 and Cdc24, physically interact with NoxR (Takemoto et al., 2006; Takemoto et al., 2011). NoxR homolog is also required for activation of both BcnoxA and BcnoxB in B. cinerea (Segmuller et al., 2008). Similarly, the N. crassa NOR 1 ( NoxR homolog ) is required for the expression of both Nox 1 and Nox 2 during discrete developmental stages (Cano Dominguez et al., 2008). MAPK signaling also impacts ROS production in fungi. In A s nidulans SakA ( a HOG1 homolog) suppresses the expression of the NoxA gene ( Lara Ortiz et al., 2003) In B. cinerea BcSak1 has no effect on expression of B cnoxA and B cnoxB However, MAP K Bmp3, a homolog of yeast Slt2 involve d in the cell wall integrity pathway suppresses B cnoxB expression but up regulate s B cnoxA (Segmuller et al. 2008). In P. anserina nuclear localization of PaMpk1 (Slt2 homolog) is dependent on PaNox1 (Kicka et al., 2006) Oxidative Stress Signaling ROS play an important signaling role in development and adaptation processes in animals, plants and fungi (Thon e t al., 2007; Van Norman et al., 2011; Kennedy et al., 2012). Among ROS, H 2 O 2 is relatively less toxic, more stable and able to pass freely through the plasma membrane. In S. cerevisiae Y AP 1 a leucine zipper (bZIP) containing protein is responsible for tr anscriptional activation of genes involved in ROS detoxification as well as drug and heavy metal resistance. YAP1 has two highly conserved Cys rich domains (CRDs), which are critical for resistance to oxidative stress and for appropriate nuclear localizati on (Kuge et al., 1997; Coleman et al., 1999; Delaunay et al., 2000). YAP1 is localiz ed in the cytoplasm under no n stress conditions.

PAGE 27

27 Low level H 2 O 2 induces oxidation of a glutathione peroxidase like protein (Gpx3/ HYR1 ) that subsequently oxidizes the Cys re sidues, resulting in the formation of disulfide bonds and a conformation al change of YAP1. The modified YAP1 is no longer recognized by the Crm1 nuclear export e r, thus resulting in nucle ar localization of YAP1 (Kuge et al., 1997; Kuge et al., 1998; Delauna y et al., 2000). In the tangerine pathotype of A. alternata t he expression of AaAP1 is responsive to H 2 O 2 menadione and tert butyl hydroperoxide. Upon exposure to H 2 O 2 AaAP1::sGFP is localized in the nucleus. Inactivation of the A. alternata AP1 gene re sulted in fungal mutants that are hypersensitive to several oxidants and are non pathogenic. Moreover, AaAP1 mutants show reduced antioxidant activities including catalase, superoxide dismutase, glutathione peroxidase, glutathione reductase and glutathion e S transferase (Lin et al., 2011). Co application of AaAP1 mutants with the NADPH oxidase inhibitor apocynin or diphenylene iodonium partially restored pathogenicity of the mutants. These results suggest that the AaAP1 mediated effective detoxification of ROS is required for successful colonization of citrus by A. alternat a Research Overview The major goal of this research is to determine the biological functions of the Nox in A alternata This dissertation research has three major objectives: (1) to cha racterize and determine the function of Nox components (NoxA, NoxB and NoxR) in ROS generation; (2) to investigate the molecular mechanism underlying Nox m ediated oxidative stress signal ing, ROS detoxification and virulence; and (3) to understand the roles of Nox in developmental and physiological processes. To achieve these objectives, reverse genetics approaches were applied in the tangerine pathotype of A. alternata Fungal strain s impaired for each of the Nox genes

PAGE 28

28 were created by targeted gene disrupti on and analyzed by histochemical staining and biochemical assays (Chapter 2). Nox mutants are hypersens it i ve to various oxidants and display reduced virulence on detached citrus leaves, confirming further the critical role of ROS detoxification for the pat hogenicity of A. alternata on citrus (Chapter 3). Nox was found to be required for the expression of the Y AP 1 and H OG 1 genes, establishing a direct connection among Nox, YAP1 and HOG1 MAPK. Moreover, Nox plays a central role in vegetative growth, conidia f ormation and cell wall integrity (Chapter 4). Lastly, a GPx gene encoding a putative glutathione peroxidase was inactivated in the tangerine pathotype of A. alternata GPx was found to be required for ROS resistance and fungal virulence (Chapter 5). Northe rn blot analysis revealed that the expression of GPx is regulated by YAP1, HOG1, and NOX, indicating that the glutathione system also play s an important role in the regulation of redox homeostasis and oxidative resistance in A. alternata

PAGE 29

29 Table 1 1. Host selective toxins in Alternaria alternata Pathotype of A. alternata Host Disease Toxin Target site Reference Apple pathotype Apple Alternaria blotch of apple AM toxin Chloroplast and plasma membrane (Okuno et al., 1974; Kohmoto et al., 1976) Japanese pea r pathotype Japanese pear Black spot of Japanese pear AK toxin Plasma membrane (Nakashima et al., 1982) Strawberry pathotype Strawberry Alternaria black spot of strawberry AF toxin Plasma membrane (Nakatsuka et al., 1986) Tomato pathotype Tomato Stem can ker of tomato AL toxin Mi t ochondria (Gilchrist and Grogan, 1976) Tobacco pathotype Tobacco Brown spot of tobacco AT toxin Mitochondria (Mikami et al., 1971) Tangerine pathotype Tangerine and their hybrids Brown spot of tangerines ACT toxin Plasma membran e (Kohmoto et al., 1979) Rough lemon pathotype Rough lemon and Rangpur lime Leaf spot of rough lemon ACRL toxin Mitochondria (Gardner et al., 1986)

PAGE 30

30 Table 1 2 Functions of fungal Nox complexes Nutritional mode Fungal species Nox components Functions Reference Saprophyte Aspergillus nidulans NoxA Sexual fruiting body (Cleistothecia) development, localization of ROS at hyphal tips (Lara Ortiz et al., 2003; Semighini and Harris, 2008) Saprophyte Podospora anserina Nox1 Nox2 Nox3 NoxR Sexual fruiting b ody (Perithecia) formation, cellulose degradation, hyphal interference Ascospore germination, cellulose degradation No obvious function (play minor role, if any) Regulation of Nox1 and Nox2 ( Malagnac et al., 2004; Silar, 2005; Brun et al., 2009) Saprophyt e Neurospora crassa Nox1 Nox2 NOR1 Perithecia formation, asexual development, normal hyphal growth Ascospore germination Regulation of Nox1 and Nox2 ( Cano Dominguez et al., 2008) Saprophyte Saccharomyces c erevisiae Yno1 Extramitochondrial ROS generation, apoptosis, regulation of the actin cytoskeleton (Rinnerthaler et al., 2012) Hemi biotroph Magnaporthe oryzae Nox1 Nox2 Nox3 Pathogenicity, a ppressoria formation/penetration Pathogenicity, a ppressoria formation/penetration No obvious function ( Egan et al., 2007; Tudzynski et al., 2012) Necrotroph Botrytis cinerea NoxA NoxB NoxR Virulence (l esion development ) sclerotia formation, conidial anastomosis tubes formation Penetration, virulence, sclerotia formation Regulation of NoxA and NoxB ( Segmuller et al., 2008; Roca et al., 2012; Siegmund et al., 2013) Necrotroph Sclerotinia scleroti orum Nox1 Nox2 Virulence, sclerotia development, oxalate secretion Sclerotia development (Kim et al., 2011) Biotroph Claviceps purpurea Nox1 Nox2 Virulence, conidia germinati on sclerotia formation Balanced infection, mutant is hypervirulent (Giesbert et al., 2008; Tudzynski et al., 2012) Endophyte Epichlo festucae NoxA NoxB NoxR Maintain mutualistic interaction with ryegrass host No obvious function Regulation of NoxA ( Take moto et al., 2006; Tanaka et al., 2006; Tanaka et al., 2008)

PAGE 31

31 Figure 1 1 A lternaria brown spot caused by A. alternata on tangerine leaves and fruits Figure 1 2 Generation of ROS from ground state oxygen (O 2 ) by ener gy transfer or by sequential electron transfer

PAGE 32

32 Figure 1 3. ROS detoxification mechanisms. Superoxide is dismutated by superoxide dismutase (SOD). Hydrogen peroxide is decomposed by catalases (CAT), peroxiredoxins (Prx) and glutathione peroxidase (GPx). Glutathione reductase (GR) recycles the oxidized glutathione (GSSG) back to reduced glutathione (GSH) at the expense of NADPH.

PAGE 33

33 CHAPTER 2 GENERATION OF REACTIVE OXYGEN SPECIES BY NADPH OXIDASES IN Alternaria alternata OF CITRUS Introduction The tangerine pathotype of A alternata causes brown spots on citrus leaves and fruit. This necrotrophic fungal pathogen produces a unique host selective ACT toxin to kill host cells prior to invasion and acquires nutrients solely from dead tissues (Akimitsu et al., 200 3). In addition to ACT toxin, the effective scavenging or detoxification of H 2 O 2 and other ROS also is critical for fungal survival in the host plant. The colonization of A. alternata in the leaves of citrus induces rapid lipid peroxidation, increased accu mulation of H 2 O 2 and cell death (Lin et al., 2009, 2011). A. alternata may have evolved sophisticated mechanisms for cellular protection against the toxicity of plant derived ROS. Apart from ACT toxin, recent studies have demonstrated that the ability to a lleviate ROS via the YAP1 transcription regulator, the HOG1 mitogen activated protein kinase, and the SKN7 regulator is required for A. alternata pathogenicity/virulence in citrus (Chen et al., 2012; Lin et al., 2009, 2011; Lin and Chung, 2010). However, t he cellular mechanisms by which Y AP1 SKN7 or HOG1 is responsible for H 2 O 2 tolerance and fungal pathogenesis remain largely unresolved. Both the beneficial and detrimental effects of ROS have been known in animals, plants and fungi (Apel and Hirt, 2004; Ag uirre et al., 2005). In mammalian phagocytes, NADPH oxidase (Nox) produces ROS, which are involved in defense responses and cellular differentiation (Babior et al., 2002; Lambeth, 2004). In phagocytic cells, Nox transfers electron from NADPH to an oxygen m olecule, leading to the generation of superoxide (O 2 ) O 2 is then converted to H 2 O 2

PAGE 34

34 subunit oxidase, composed of two catalytic subunits gp91 phox and p22 phox and multiple regulatory components, Rac, p67 phox p47 phox and p40 phox Both gp91 phox and p22 phox are localized in the membrane, whereas all regulatory components are localized in the cytosol. In addition to a primary contribution to defense responses the Nox complex plays a role in cell proliferation, apoptosis and hormone responses in animals (Lambeth, 2004; Lardy et al., 2005). Plants also contain Nox enzymes, designated res piratory burst oxidase homolog s (Rboh), which are involved in a wide range of physiological processes (Simon Plas et al., 2002; Foreman et al., 2003) and in the ROS generation in response to pathogen attack (Keller et al., 1998; Torres et al., 2002). Some fungi also contain Nox homologs (NoxA, NoxB and NoxC). NoxA and NoxB are an alogous to th e mammalian gp91 phox whereas NoxC, containing a calcium binding EF hand motif, is similar to the mammalian Nox5 and the plant Rboh enzymes (Takemoto et al., 2007). NoxA and NoxB are structurally similar. Both oxidases contain a n FAD binding d omain, a n NADPH binding domain and six transmembrane domains NoxB has an extension of approximately 40 amino acids in the N terminus. NoxA and NoxB are commonly found in fungi, whereas NoxC is present only in few fungal species (Takemoto et al., 2007). Th e regulatory subunit p67 phox homolog designated NoxR, is also found in fungi (Takemoto et al., 2006). The roles of NoxA (Nox1), NoxB (Nox2) and NoxC in cell differentiation, pathogenicity/virulence or cellulose degradation have been determined by genetic analysis in diverse fungal species (Lara Ortiz et al., 2003; Malagnac et al., 2004; Tanaka et al., 2006; Egan et al., 2007; Cano Dominguez et al., 2008; Giesbert et al., 2008; Scott and Eaton, 2008; Segmuller et al., 2008; Semighini

PAGE 35

35 and Harris, 2008). Howe ver, inactivation of NoxC in Podospora anserina and Magnaporthe oryzae did not show discernible phenotypes (Brun et al., 2009; Tudzynski et al., 2012). Gene inactivation of fungal Nox homologs often leads to the reduced production of H 2 O 2 in many fungi. No x enzymes are conserved but their actual roles in physiology and development may vary among fungal species. In order to understand the biological roles of Nox for the generation and detoxification of H 2 O 2 in A. alternata I isolated and characterized NoxA NoxB and NoxR genes. Analyses of targeted gene disruption mutants reveal that all three Nox components are required for ROS production. Materials and Methods Fungal Strains and Cultures Conditions The wild type EV MIL31 strain of A alternata (Fr.) Keissl er (Table A 1) used in this study was single spore isolated from diseased leaves of Minneola tangelo, a hybrid between Duncan grapefruit ( C paradisi Macfad.) and Dancy tangerine ( C reticulata Blanco) in Florida. Fungal strains were cultured on potato dex trose agar (PDA; Difco, Sparks, MD USA ) at 28 C. For DNA and RNA purification, fungal strains were grown on agar medium covered with a layer of sterile cellophane. Conidia were harvested by flooding with sterile water followed by low speed centrifugation (3,000 g ) from fungal cultures grown on PDA under constant fluorescent light for 3 to 4 days. Unless otherwise indicated, all chemicals used in this study were purchased from Sigma Aldrich Fluka ( St. Louis, MO, USA ) Molecular Cloning and Sequence Analy sis All oligonucleotide primers used in this study are compiled in Table B 1 A 0.7 kb NoxA gene fragment was amplified from genomic DNA of A. alternata by PCR with two

PAGE 36

36 degenerate primers NOXf1 and NOXr1 as reported by Giesbert and colleagues (Giesbert et al., 2008) The entire NoxA regions were amplified by PCR from a library of A. alternata The chromosome library was constructed from genomic DNA cleaved with four different restriction enzymes ( Dra I, Eco RI, Pvu I and Stu I) and ligated to adaptors using the Universal GenomeWalker kit (BD Biosciences, San Jose, CA USA ). A 2.8 kb DNA fragment containing the entire NoxB untranslated region s was amplified by PCR with the primers NoxB pro1F an d NoxB TAG from genomic DNA of A. alternata An A a lternata NoxR gene fragment (0.4 kb) was amplified by PCR with two degenerate primers p67f1 and p67r1 as reported by Takemoto and colleagues (Takemoto et al., 2006). The full length NoxR gene was obtained by PCR from the genome walking library. Similarity searches were performed at the National Center for Biotechnology Information using the BLAST network service. ORF and exon/intron positions were deduced from comparisons of genomic and cDNA sequences or p redicted using Softberry gene finding software (http://www.softberry.com) Amino acid sequences were aligned by BioEdit using CLUSTALW ( http://www.mbio.ncsu.edu/bioedit/bioedit.html ). Construction of Split Maker Fragments for Targeted Gene D isruption NoxA gene was disrupted in the EV MIL31 strain using a split marker approach as previously described (You et al., 2009; Yang and Chung, 2012). A HYG gene encoding a phosphotransferase under control of the Aspergillus nidulans trpC promoter (P) and terminator (T ) and conferring hygromycin resistance was used as a dominant selectable marker. Two truncated fragments, PHY and YGT, overlapping within the HYG gene, were amplified by PCR with the primers M13R and hyg3 and the primers NoxA fragment was ampl ified with the primers

PAGE 37

37 NoxA pro2F and NoxA:M13R and fused with the PHY fragment (Fig. 2 4 NoxA fragment was amplified with the primers M13F:NoxA and NoxA TAA and fused with the YGT fragment. The underlined sequence in the pr imers NoxA:M13R and M13F:NoxA ( Table B 1 ) represents the oligonucleotides that are completely complementary to the sequence of the primers M13R and M13F, respectively. Similar approaches were performed to disrupt NoxB gene (Fig. 2 5 ). A 2.1 kb fusion fragment (0.9 + 1.2 kb) was amplified by two round PCR with the primers NoxB 3F, NoxB:M13R, M13R and hyg3. A 2.5 ( 0.7 + 1.8 kb) was amplified with the primers hyg4, M13F, M13F:NoxB and NoxB TAG. T wo split marker fragme nts were generated to disrupt NoxR gene (Fig. 2 6 NoxR::PHY fusion fragment ( 0. 7 +1.2 kb ) was amplified by primers NoxR pro2F, NoxR:M13R, M13R and hyg3. kb) was amplified with the primers hyg4, M13F, M13F:NoxR and N oxR tail. Genetic complementation was performed by co transforming a functional Nox gene under control of its endogenous promoter with the pCB1532 plasmid, carrying the Magnaporthe grisea acetolactate synthase gene ( Sur ) cassette, which confers resistance to sulfonylurea (Sweigard et al., 1997). A functional NoxA gene cassette was amplified by PCR with the primers NoxA pro1F and NoxA TAA. A NoxB cassette was amplified with the primers NoxB 2F and NoxB TAG. A NoxR cassette was amplified with the primers NoxR pro2F and NoxR tail. Preparations of Protoplasts and Fungal Transformation For protoplast isolation, fungal isolates were grown in 50 mL potato dextrose broth (PDB, Difco, Sparks, MD USA ) for 4 days, ground in a sterile blender, mixed with 200 mL fresh P DB, and grown for additional 12 18 hours. Fungal mycelia were collected

PAGE 38

38 by centrifugation at 6,500 g at 4 C and washed twice with a solution containing 1 M NaCl and 10 mM CaCl 2 The resulting fungal mycelia were resuspended in osmotic buffer ( 10 mM Na 2 H PO 4 pH 5.8, 20 mM CaCl 2 1.2 M NaCl ) containing a mixture of cell wall degrading enzymes [5 mg/mL driselase (InterSpex, San Mateo, CA), 8 mg/mL D glucanase (InterSpex), 850 u nits/mL glucuronidase type H2, 81.25 units/mL lyticase ] with gentle shake ( < 1 00 rpm) for 2 hours. F ungal protoplasts were harvested by centrifugation at 3,000 g at 4 C and washed by sterile STC solution (1.5 M sorbitol, 10 mM CaCl 2 10 mM Tris HCl, pH 7.5) (Chung et al., 2002) Protoplasts were dissolved in four parts of STC and one part 50% polyethylene glycol 3350 (PEG) and used directly for fungal transformation or stored at 80 C. Fungal transformation was performed by a CaCl 2 and PEG mediated method to introduce split marker fragments (10 protoplasts (1 10 6 /mL) prepared from the wild type or other recipient strains as appropriate. Fungal transformants wer e regenerated and selected at 28 C on regeneration medium (RMM) containing 1 mg/mL Ca(NO 3 ) 2 4 H 2 O, 0.2 mg/mL KH 2 PO 4 0.25 mg/mL MgSO 4 7H 2 O, 0.15 mg/mL NaCl, 1% glucose and 1 M sucrose, amended Calbiochem, La Jolla, CA, USA ( Chem Service, West Chester, PA, USA ) Successful integration of HYG within the targeted gene was exami ned by PCR with multiple sets of primers and by Northern blot hybridization with a NOX gene specific probe. Manipulation of Nucleic Acid s Fungal DNA was isolated using a DNeasy Plant kit (Qiagen, Valencia, CA USA ). RNA was purified with Trizol reagent (Mo lecular Research Center, Cincinnati, OH), treated with DNase, and used to synthesize the first strand of cDNA using the

PAGE 39

39 SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA USA ). Double stranded cDNA was amplified by PCR with gene PCR amplicons were sequenced at Eton Bioscience (Research Triangle Park, NC USA ). Escherichia coli Plasmid was pu rified using a Quickclean miniprep kit (G enScript, Piscataway, NJ, USA). Standard molecular procedures were followed for electrophoresis and Northern blot hybridization (Sambrook and Russell, 2001) RNA was blotted onto a nylon membrane and hybridized to a digoxigenin (DIG) 11 dUTP (Roche Applied Science Indianapolis, IN, USA ) labeled DNA probe. Probes were amplified and labeled by PCR with gene specific primers. A CSPD chemifluorescent (Roche Applied Science Indianapolis, IN, USA ) was used as a substrate for alkaline phosphatase in an immunolog ical assay to detect the probe Detection and Quantification of ROS The content of intracellular H 2 O 2 of A. alternat diaminobenzidine (DAB) staining assay (Torres et al., 2002). Fungal strains were grown on PDA for 5 days, st ained with 5 mM DAB for 12 18 hours, and examined with a Leitz Laborlux phase contrast microscope (Leica Microsystems, Exton, PA, USA). The reaction of DAB with H 2 O 2 produced a deep brown polymerization product. Peroxides were further quantified on the bas is of the oxidation of ferrous (Fe 2+ ) to ferric (Fe 3+ ) ions, which reacted with xylenol orange under acidic condition, producing a purple substance with an absorbance between 540 nm and 620 nm (Jiang et al., 1990; Nourooz Zadeh et al., 1994). To quantify i ntracellular H 2 O 2 fungal isolates were grown on a layer of cellophane overlaid on CM agar plates for 3 days. Mycelia were scraped off, ground with liquid nitrogen, and soaked in 3 mL of 100 mM phosphate buffer (pH 7.0). Protein

PAGE 40

40 samples (50 ammonium ferrous (II) sulphate, 25 mM sulphuric acid, 100 mM sorbitol and 125 mM xylenol orange, and incubated at room temperature for 15 min. The amounts of H 2 O 2 in the solution were determin ed spectrophotometrically by measuring the absorbance at 595 nm. The extracellular H 2 O 2 was assayed by measuring an increase in absorbance at 240 nm (Aebi, 1984). Fungal isolates were cultured in liquid CM for 3 days and the amounts of H 2 O 2 in the medium w ere measured spectrophotometrically over time. The concentration of H 2 O 2 was calculated by referring to a standard curve that was established using authentic H 2 O 2 (Fisher Scientific, Pittsburgh, PA, USA). Superoxide was detected by staining the fungal hyph ae with nitroblue tetrazolium (NBT) (Shinogi et al., 2003). Accumulation of intracellular ROS was also evaluated by the dichlorodihydrofluorescein diacetate (H 2 DCFDA) fluorescent prob e (Molecular probes, Eugene, OR, USA). H 2 DCFDA is commonly used to detect the cellular production of H 2 O 2 hydroxyl radicals and nitric oxide (Possel et al., 1997). This cell permeable ROS indicator is non fluorescent until acetate groups are removed ( H 2 DCF ) when exposed to ROS. Fungal hyphae were stained with 2.5 H 2 DCFDA for 20 min and examined with a Leitz Laborlux phase contrast microscope. Nucleotide Sequences Sequence data reported in this study have been deposited in the GenBank/EMBL Data Libraries under Accession No.: JN900389 (NoxA), JX136700 (NoxB) and JX207 117 (NoxR).

PAGE 41

41 Result s Characterization of NoxA NoxB and NoxR homologs from A alternata The A. alternata NoxA gene ( AaNoxA ) contains an 1810 bp ORF interrupted by three small introns (50, 52 and 55 bp). The AaNoxA gene product has 550 amino acids, displayin g 72% 93% identity and 84% 96 % similarity to a number of Nox homologs (NoxA or Nox1) or hypothetical proteins of fungi (Fig. 2 1). The A. alternata NoxB gene ( AaNoxB ) gene has an 1840 bp ORF interrupted by three introns (48, 47 and 59 bp). The AaNoxB polyp eptide contains 561 amino acids, showing strong similarity to many NADPH oxidases of fungi. AaNoxB is most similar (97% similarity and 94% identity) to the NADPH oxidase 5 of Pyrenophora tritici repentis (accession number XP_001936616). Alignment and compa rison of the deduced amino acid sequences revealed that AaNoxA bears some resemblances to AaNoxB showing 34.9% identity and 52.4% similarity (Fig. 2 2). Both AaNoxA and AaNoxB have a n FAD binding domain, a NADPH binding domain and six transmembrane domains The A. alternata NoxR gene ( AaNoxR ) has an 1811 bp ORF, interrupted by three introns (62, 54 and 53 bp), which encode s 546 amino acids. The deduced amino acid sequence of AaNoxR displays strong similarity to the Epichlo festucae EfNoxR, the Botrytis cin erea BcNoxR and the human Hsp67 phox (Fig. 2 3). AaNoxR has an N terminal tetratricopeptide repeat (TPR) domain and a putative Nox activation domain, commonly found in the mammalian p67 phox and fungal NoxR like family. Targeted Disruption of NoxA NoxB and NoxR in A. alternata The AaNoxA gene was interrupted by transforming two DNA fragments 4A) i nto protoplasts of the wild type strain (EV MIL31) of A. alternat a Of five fungal transformants selected from medium

PAGE 42

42 con taining hygromycin, two (DN2 and DN6 ) displayed reduced growth by 1 2 % in relation to the EV MIL31 strain and were examined further by PCR with different primer sets (Fig. 2 4B). A 1.7 kb fragment was amplified from genomic DNA of DN2 and DN6 strains using the primers NoxA ATG and Hyg3. An expected 2.5 kb fragment was also obtained by PCR with the primers Hyg4 and NoxA TAA. No DNA fragments were amplified from genomic DNA of the wild type strain with these primer sets. Northern blot analysis (Fig. 2 4C) indi cated that hybridization of total RNA prepared from the wild type strain with a n AaNoxA specific probe identified an expected 1.8 kb transcript. The 1.8 kb AaNoxA transcript was absent in both DN2 and DN6 strains, confirming the successful inactivation of AaNoxA in A. alternata Two overlapping DNA fragments ( HYG ) were generated (Fig. 2 5A) and transformed directly into protoplasts of the EV MIL31 strain to disrupt AaNoxB Of 30 transformants recovered from medium containing hygromycin, two strains (DB5 and DB6) displayed reduced gro wth by 11% and increased sensitivity to H 2 O 2 PCR diagnosis (Fig. 2 5B) with the primers NoxB 1F and NoxB tag identified an expected 1.0 kb fragment from wild type strain. In contrast, an expected 3.4 kb fragment was amplified from DNA purified from DB5 an d DB6. Using the primers NoxB pro2F and Hyg3, a 2.9 kb fragment was amplified from genomic DNA of DB5 and DB6. Likewise, an expected 2.5 kb fragment was amplified from DNA of DB5 and DB6 with the primers Hyg4 and NoxB tag. No fragment was amplified from th e wild type strain using these primer sets. Northern blot hybridization of fungal RNA to an AaNoxB specific probe identified a 1.8 kb transcript from the wild type, but not from DB5 and DB6 strains (Fig. 2 5C). Truncated transcripts (<1 kb) were detected i n RNA purified

PAGE 43

43 from the putative mutant strains, confirming the successful disruption of AaNoxB in A. alternata The AaNoxR gene was interrupted by introducing two DNA fragments MIL31 strain (F ig. 2 6A). In total, 39 transformants were recovered from hygromycin containing medium, tested for H 2 O 2 sensitivity and examined by PCR using different primer pairs (Fig. 2 6B). Two strains (DR2 and DR5) displaying wild type growth on PDA, but an elevated sensitivity to H 2 O 2 had an expected HYG integration at the AaNoxR site. An expected 1.8 kb fragment was amplified from wild type with the primers NoxR ATG and NoxR tail. In contrast, an expected 3.8 kb fragment was amplified from DNA purified from both DR2 and DR5. Northern blot hybridization of total RNA prepared from the wild type strain and two putative AaNoxR disruptants with an AaNoxR specific probe revealed that the 1.7 kb transcript of AaNoxR was detected in wild type strain (Fig. 2 6C). In contrast, a truncated transcript (about 1 kb) was detected in DR2 and DR5 strains, confirming the successful disruption of AaNoxR in A. alternata T he genetically complemen ted fungal strains CpA16, CpB24 and CpR40 displaying wild type growth on PDA plates or displa ying wild type resistance to H 2 O 2 were identified by transforming a wild type copy of AaNoxA AaNoxB and AaNoxR into protoplasts prepared from the DN2, DB5 and DR2 mutants, respectively. The NADPH Oxidases C ontribute to the ROS Production Accumulation of H 2 O 2 within fungal hyphae was examined by staining with 3,3 diaminobenzidine (DAB). H 2 O 2 induced polymerization of DAB, resulting in a dark brown pigmentation. The H 2 O 2 levels, based on the intensity of pigmentation, were much higher within incipient hypha e of the wild type strain than those seen for AaNoxA

PAGE 44

44 mutants (DN2, DN6), AaNoxB mutants (DB5 and DB6) or AaNoxR mutants (DR2 and DR5) (Fig. 2 7) Hyphae of the genetically complemented strains CpA16, CpB24 and CpR40 were stained dark brown, indicating rest oration of H 2 O 2 accumulation within hyphae Quantitative analysis revealed a reduced accumulation of H 2 O 2 within fungal hyphae of AaNoxA mutants (DN2 and DN6) relative to the wild type (Fig. 2 8A). The genetically rescued strain CpA16 accumulated intracell ular H 2 O 2 at level similar to that of the wild type. The amount of H 2 O 2 secreted into the medium by the Aa NoxA mutants was lower than that produced by the wild type (Fig. 2 8B). The complementation strain CpA16 accumulated extracellular H 2 O 2 at level that resem ble d the wild type. Cellular superoxide anions were detected by nitroblue tetrazolium (NBT). NBT, when reduced by superoxide, precipitated as a dark blue, water insoluble formazan. The staining of fungal hyphae with NBT indicated that the Aa NoxA mutan ts (DN2 and DN6) seemingly produced less superoxide than the wild type (Fig. 2 9). Microscopic examination revealed that the dark precipitate observed within the hyphae of wild type (WT) has higher intensity than those of the DN2 and DN6 mutants. Hyphae of the AaNoxA complementation strain (CpA16) were stained dark blue by NBT. The accumulation of ROS within fungal hyphae was examined further with the H 2 DCFDA f luorescent prob e. Based on fluorescent intensity, ROS accumulated within incipient hyphae of the w ild type and the rescued (CpA16) strains were apparently higher than those of AaNoxA mutants (DN2 and DN6) (Fig. 2 10). The AaNoxA mutants emitted fainter fluorescence, which diffused along the hyphal cytoplasm. These results confirm that NADPH oxidases pl ay an important role in ROS generation in A. alternata

PAGE 45

45 Discussion The phagocytic Nox system of mammalian is a multi enzyme complex that is responsible for ROS generation. I report here the cloning and characterization of the A. alternata NoxA and NoxB gen es, homologous to the mammalian gp91 phox and the A. alternata NoxR gene homologous to the mammalian p67 phox Genetic analyses of fungal mutants defective for each of the Nox genes revealed that three Nox components are required for the accumulation of ROS, consistent with the findings with the Nox complex in animals and plants. AaNoxA and AaNoxB contain six transmembrane spanning domains and cytosolic FAD/NADPH binding domains, which are commonly found in fungal NADPH oxidases. Compared with NoxA, all funga l NoxB homologs have an extra 40 50 amino acids in the N termini with no known function (Takemo to et al., 2007). However, as with other fungal Noxs, no putative calcium binding EF hand motif has been found in these AaNox and AaNoxB proteins. The A. alterna ta NoxA and NoxB were independently inactivated with the split marker approach using two DNA fragments overlapping within the selection marker. Fungal strains carrying a disrupted copy of AaNoxA or AaNoxB displayed slightly reduced growth compared with the wild type progenitor. Further analyses using PCR with different primer sets and Northern blotting confirm the successful integration of the HYG marker gene within the AaNox genes. Compared to yeasts, genetic transformation and targeted disruption or repla cement i n filamentous fungi c an be problematic due to high frequency of ectopic integrations and low efficiency of homologous recombination (Pratt and Aramayo, 2002). Integration of foreign genes in filamentous fungi is a rather rare process presumably inf luenced by a nonhomologous end joining (NHEJ) mechanism (Ninomiya et al., 2004).

PAGE 46

46 The split marker recombination strategy, using truncated DNA fragments overlapping within the selectable marker gene, was originally developed for rapid gene deletions and gap repair cloning in yeast (Fairhead et al., 1996), and later was successfully applied to diverse filamentous fungi (Kuck and Hoff, 2010). Several studies from different fungal species have revealed that the split marker approach increases the frequency of h omologous recombination while decreases ectopic integration (Catlett et al., 2003; Jeong et al., 2007; You et al., 2009). This approach has been shown to increase the frequency of targeted gene disruption and homologous integration to as high as 100% in th e tangerine pathotype of A. alternata (Lin et al., 2009; Lin and Chung, 2010; Lin et al., 2010; Wang et al., 2010; Yago et al., 2011). NADPH oxidases have been studied in various fungal species (Tudzynski et al., 2012). Fungal Noxs have been characterized to be required for ROS production in fungi, including As. nidulans E. festucae and S. sclerotiorum (Lara Ortiz et al., 2003; Tanaka et al., 2006; Kim et al., 2011). In this chapter, I assess the potential role for Nox in the formation of ROS based on in situ detection of H 2 O 2 and superoxide using different staining methods and comparison of wild type and Nox disrupted mutants of A. alternata. The results clearly show that Nox is a key generator of ROS in the tangerine pathotype of A. alternata because mut ational inactivation of each of the Nox components resulted in fungi that accumulate lower ROS compared to wild type. Surprisingly deletion of a NoxA homolog in P. anserina and M. grisea increases ROS production (Malagnac et al., 2004; Egan et al., 2007), suggesting the presence of an alternative source for ROS generation that is up regulated as a consequence of the loss

PAGE 47

47 of Nox genes (Egan et al., 2007). In B. cinerea, Nox homologs appear to play no role in ROS production (Segmuller et al., 2008). Although two p67 phox family members, p67 phox and NOXA1, are found in mammalian genomes (Lambeth, 2004), only a single NoxR is identified in filamentous fungi (Takemoto et al., 2006). As with all p67 phox homologs, A. alternata NoxR contains four tetratricopeptide r epeats (TPR) and a putative Nox activation domain (Fig. 2 3). In contrast, AaNoxR has no Scr homolog 3 (SH3) and PB1 domains commonly found in the human p67 phox SH3 and PB1 domains interact, respectively, with p47 phox and p40 phox (Lambeth, 2004). The abs ence of these domains implicat ed in the protein protein interaction in fungal NoxR suggests that filamentous fungi likely have no p47 phox and p40 phox homologs (Takemoto et al., 2007). However, fungal NoxR contains a different type of PB1 domain in the C te rminus (Noda et al., 2003). This finding indicates that the regulatory partners involved in the activation of fungal NoxR are different from those of p67 phox (Takemoto et al., 2006) NoxR has been shown to be required for the activation of NoxA and NoxB in A s n idulans E. festucae N. crassa P. anserina and B. cinerea (Cano Dominguez et al., 2008; Segmuller et al., 2008; Semighini and Harris, 2008; Tanaka et al., 2008; Brun et al., 2009). However, I found that the A. alternata NoxR does not impact the exp ression of NoxB but negatively regulates NoxA (see Chapter 3 for details). Although Nox components ar e well conserved in fungi that possess them, the ir true roles in the regulation of physiological and developmental processes may vary considerably in diff erent species. In the present studies, mutational inactivation of NoxA NoxB or NoxR in A. alternata resulted in fungal strains that are impaired for ROS accumulation. The phenotypes could be fully restored in each of the

PAGE 48

48 mutants by re introducing a functi onal copy of the gene into the respective mutant, strongly indicating that Nox enzymes are one of the key ROS generators in A. alternata

PAGE 49

49 Figure 2 1. Alignment of fungal NADPH oxidases NoxA and Nox1. Con served amino acids are shaded. Alignment was carried out by BioEdit using CLUSTALW.

PAGE 50

50 Figure 2 2. Alignment and comparison of the deduced amino acid sequences of NoxA and NoxB of Alternaria alternata Conserved amino acids are shaded. Four conserved histidine residues potent ially for haem binding are indicated by asterisks. Six putative transmembrane domains are underlined. Putative FAD and NADPH binding domains are also indicated.

PAGE 51

51 Figure 2 3. Alignment of the deduced amino acid sequence of the Alternaria alternata NoxR with the Epichlo festucae EfNoxR, Botrytis cinerea BcNoxR and human Hsp67 phox Conserved amino acids are shaded. Proline rich (P rich), Src homology 3 (SH3) and Phox1 and Bem1 (PB1) domains of human p67 phox are boxed. Four tetratricopeptide repeats (TPR) and a putative Nox activation domain are also indicated.

PAGE 52

52 Figure 2 4. Targeted disruption of AaNoxA in Alternaria alternata (A) Schematic illustration of a split marker strategy for disruption of AaNoxA by inserting a hygromy cin phosphotransferase gene ( HYG ) under the control of the Aspergillus nidulans trpC promoter (P) and terminator (T). Oligonucleotide primers used to amplify each fragment are also indicated. (B) Image of DNA fragments amplified from genomic DNA of differe nt fungal strains with the primers indicated. (C) Image of an RNA gel blot, probed with a DIG labeled AaNoxA showing a 1.8 kb transcript from the wild type strain (WT) but not from two AaNoxA disruption mutants (DN2 and DN6). Ribosomal RNA stained with et hidium bromide shows relative loading of the RNA samples.

PAGE 53

53 Figure 2 5. Targeted disruption of NoxB gene in Alternaria alternata using a split marker approach. (A) Schematic depiction of the generation of truncated, but overlapp ing, hygromycin phosphotransferase gene ( HYG ) under the control of the Aspergillus nidulans trpC promoter (P) and terminator (T), and gene disruption within AaNoxB Oligonucleotide primers used to amplify each fragment are also indicated. (B) Image of DNA fragments amplified from genomic DNA of different fungal strains with the primers indicated. The primer NoxB pro2F sequence is not present in the split marker fragment. (C) RNA gel blotting probed with a DIG labeled AaNoxB showing a 1.8 kb transcript fro m the wild type strain (WT) but not from two AaNoxB disruption mutants (DB5 and DB6). The lower panel shows ribosomal RNA as loading controls.

PAGE 54

54 Figure 2 6. Targeted disruption of NoxR in Alternaria alternata using a split marker approach. (A) Schematic i llustration of a split marker strategy for disruption of AaNoxR by inserting a hygromycin phosphotransferase gene ( HYG ) under the control of the Aspergillus nidulans trpC promoter (P) and terminator (T). Oligonucleotide primers used to amplify each fragmen t are also indicated. (B) Image of DNA fragments amplified from genomic DNA of fungi with the primers indicated. (C) Image of an RNA gel blotting, probed with a DIG labeled AaNoxR, showing a 1.7 kb transcript from the wild type strain (WT) but not from two AaNoxR disruption mutants (DR2 and DR5). Ribosomal RNA stained with ethidium bromide shows relative loading of the RNA samples.

PAGE 55

55 Figure 2 7. NoxA, NoxB and NoxR are required for the accumulation of cellular H 2 O 2 The wild ty pe EV MIL31 strain (WT), the strains lacking NoxA (DN2, DN6), the strains lacking NoxB (DB5, DB6), the strains lacking NoxR (DR2, DR5) and the corresponding rescued strains (CpA16, CpB24 and CpR40) of A. alternata were grown on PDA for 5 days, stained with diamino benzidine (DAB) solution for 12 to 18 h ours an d examined microscopically. Bar =

PAGE 56

56 Figure 2 8. Quantitative analysis of H 2 O 2. (A) Quantitative analysis of intracellular H 2 O 2 among the wild type (WT), two A aNoxA mutants (DN2 and DN6) and genetically complementation strain (CpA16) using a xylenol orange assay. tes t ( P that are significantly different from those of the wild type. (B) Quantitative analysis of extracellular H 2 O 2 in axenic culture by measuring the increase in absorbance at 240 nm. Complete medium was used as the mock control. Each column or points indicate the mean number of H 2 O 2 the standard deviation from two independent experime nts with at least three replicates.

PAGE 57

57 Figure 2 9. Accumulation and detection of superoxide within the hyphae of the wild type strain (WT), the AaNoxA muta nts (DN2 and DN6) and the rescued strain (CpA1 6). Fungal strains were grown on PDA for 6 days and stained with nitroblue tetrazolium (NBT). Top panels show the edge of fungal colonies after staining with NBT. Microscopic images of fungal hyphae tips showing the deposition of water insoluble formazan a fter staining with NBT. Bar = 20

PAGE 58

58 Figure 2 10. Detection of ROS within Alternaria alternata hyphae staining with the fluorescent probe H 2 DCFDA Fungal mycelium was collected from wild type (WT), the AaNoxA mutants (DN2 and DN6) and the genetically rescue d strain (CpA16) grown on PDA for 6 days, stained with H 2 DC FDA for 15 min, and examined with a microscope equipped with a 450 490 nm excitation filter and a 520 n m barrier filter. Bar = 20

PAGE 59

59 CHAPTER 3 NADPH OXIDASES ARE REQUIRED FOR OXIDATIVE STRESS RESISTANCE AND FULL VIRULENCE IN THE CITRUS FUNGUS Alternaria alternata Introduction The production of reactive oxygen species (ROS), including superoxide ( O 2 ), hydrogen peroxide (H 2 O 2 ) and hydroxyl radicals (OH ), are inevitable in all organisms with an aerobic lifestyle (Apel and Hirt, 2004). The ROS scavenging or detoxification systems are essential to maintain the reduced redox states within subcellular environment s and repair of ROS triggered damage These processes are absolutely required to ensure the fitness of organisms under aerobic conditions (Mittler, 2002). Even though highly toxic to cells, ROS can serve diverse roles in cellular defen s e and in the signaling transduction pathways controlling cell differentiation or development al modifi cations (Aguirre et al., 2005). Fungal pathogens of plants often encounter a wide range of potentially harmful environmental obstacles during the course of host colonization. Such environmental changes are often associated with an oxidative burst that resu lts in the production and accumulation of highly toxic ROS, which can lead to programmed cell death and is a characteristic feature of the hypersensitive reaction (HR) (Shetty et al., 2008) HR plays a key role in plant defense responses against saprophyti c microorganisms and noncompatible (avirulent) or biotrophic pathogens, yet it has a modest effect against necrotrophic phytopathogens (Mayer et al., 2001; Glazebrook, 2005; Rivas and Thomas, 2005; Unger et al., 2005; Walz et al., 2008) HR may actually en hance colonization by necrotrophic phytopathoge ns, as they acquire nutrients and energy primarily from dead cells (Divon and Fluhr, 2007). Because many necrotrophic pathogens are able to

PAGE 60

60 produce and secrete HSTs that kill host cells prior to colonization, leading to the accumulation of ROS, the pathogens must have evolved an effective means to suppress the toxicity of ROS, which would allow them to proliferate inside the host plant (Mayer et al., 2001; Glazebrook, 2005) The membrane bound NADPH oxidase (No x) is one of the key enz ymes for ROS production (Babior et al., 2002; Lambeth, 2004). It has been well accepted that ROS play critical roles in defense mechanism of animals and plants. ROS are required for establishing successful invasion and colonization of microbes in the ir hosts. In the rice blast pathogen M. grisea both Nox1 and Nox2 are crucial for appressorium assisted penetration to rice (Egan et al., 2007). In the necrotrophic fungus B. cinerea Nox2 regulates formation of an appressorium like stru cture and Nox1 is required for in planta growth (Segmuller et al., 2008). In S clerotinia scleroti orum Nox1 is associated with the production of oxalic acid, one of the primary virulence contributors in this necrotroph (Kim et al., 2011). Likewise, NoxA ho molog of the biotrophic pathogen C laviceps purpurea is required for full virulence in cereals (Giesbert et al., 2008). R ecent studies in the fungal endophyte Epichlo festuca e and its grass host revealed that ROS restricts fungal proliferation and thus, th e fungus maintains a mutualistic association with the host plant (Takemoto et al., 2006; Tanaka et al., 2006) Interestingly, Nox is necessary for normal tolerance to oxidative stress in B. cinerea and C. purpurea Increased sensitivity of Nox mutants of B cinerea and C. purpurea is in agreement with the gene expression patterns. This is a rather unexpected result since Nox is involved in ROS generation (Giesbert et al., 2008; Segmuller et al., 2008). Gene inactivation of fungal Nox homologs often leads to the reduced production of H 2 O 2 (Lara Ortiz et al., 2003;

PAGE 61

61 Takemoto et al., 2006; Cano Dominguez et al., 2008; Semighini and Harris, 2008; Kim et al., 2011). Similarly, I have demonstrated that the A. alternata Nox system is involved in ROS production i n Ch apter 2 Previous studies have also demonstrated the essential role of the A. alternata YAP1 gene, encoding a redox responsive YAP1 like transcription factor, for ROS detoxification and fungal pathogenicity (Lin et al., 2009; Yang et al., 2009). The A. alt ernata YAP1 regulates a number of enzymatic activities, including catalase, superoxide dismutase (SOD), glutathione S transferase, glutathione peroxidase, glutathione reductase and ligninolytic peroxidase (Lin et al., 2011). Thus the A. alternata YAP1 is r equired for the detoxification of H 2 O 2 and perhaps, other ROS. Further studies have revealed that a HOG1 mitogen activated protein (MAP) kinase and a SKN7 response regulator are also required for cellular resistance to oxidative stress and pathogenicity i n A. alternata (Lin and Chung, 2010; Chen et al., 2013). These results confirm further that A. alternata is able to detoxify or obviate the ROS mediated plant defen s e barriers to successfully establish disease. In order to understand further the mechanisms underlying oxidative stress resistance and to determine the role of Nox system in fungal virulence, I characterized the Nox components (NoxA, NoxB and NoxR) focusing on their roles for stress response and pathogenesis in the tangerine pathotype of A. alte rnata Genetic analyses revealed that Nox is absolutely required for resista nce to ROS and full virulence I also showed that the expression of the AaAP1 and AaHOG1 genes is regulated by Nox in A. alternata suggesting that Nox system is involved in sensin g and responding to ROS.

PAGE 62

62 Materials and Methods Fungal Strains and Culture Conditions The wild type EV MIL31 strain of Alternaria alternata (Fr.) Keissler and the genetically altered strains (Table A 1) Aa NoxA mutants (DN2, DN6), Aa NoxB mutants (DB5, DB6), Aa NoxR mutants (DR2, DR5) and the corresponding complementation strains (CpA16, CpB24 and CpR40) were generated from previous studies (Yang and Chung, 2012, 2013). Fungal mutants disrupted at the AaAP1 gene, encoding an oxidative stress responsive transcr iption activator and the AaHOG1 gene, encoding a HOG1 MAP kinase, were created in separate studies (Lin et al., 2009; Lin and Chung, 2010). Conidia were harvested by flooding with sterile water followed by low speed centrifugation (3,000 g ) from fungal c ultures grown on PDA under constant fluorescent light for 3 to 4 days For expression experiment in response to oxidative stress, fungal strains were grown on cellophane overlaid onto PDA for 2 days, shifted to PDA amended with different oxidants at approp riate concentration, and incubated for an additional 24 hours. RNA was isolated with Trizol reagent (Molecular Research Center, Cincinnati, OH, USA) and used for a Northern hybridization with NoxA NoxB NoxR YAP1 or HOG1 probes. Creation and Identificati on of Double Mutants Fungal strains mutated at NoxA NoxB or NoxA NoxR were created by transforming split SUR marker fragments fused with truncated NoxA into protoplasts prepared from a AaNoxB mutant (DB5) or a AaNoxR mutant (DR2). Two truncated fragments, SUr and sUR overlapping within the SUR gene, encoding a n acetolactate synthase that confers sulfonylurea resistance (Sweigard et al., 1997), were amplified by PCR with the primers sur1 pairing with surR and sur2 pairing with surF (Fig. 3 1).

PAGE 63

63 NoxA f ragment was ampl ified with the primers NoxA pro2F and NoxA: sur1 and fused with the SUr fragment NoxA fragment was amplified with the primers sur2 :NoxA and NoxA TAA and fused with the sUR fragment Fungal transformation using CaCl 2 and PEG was perfo rmed as described in Chapter 2. Transformants were recovered from medium PA, USA) and tested for elevated sensitivity to H 2 O 2 (Fisher Scientific, Pittsburgh, PA) compared to its progenitor. Successful integration of SUR gene within the targeted gene was examin ed by PCR with two sets of primers. Manipulation of Nucleic A cids Isolation of fungal genomic DNA and RNA, purification of plasmids and Northern blot analyses were performed as described in Chapter 2. Sensitivity Test Chemical sensitivity was conducted by transferring fungal hyphae/conidia as a toothpick point inoculation onto PDA medium amended with test compounds at appropriate concentration. Fungal radial growth was measured at 4 to 7 days. The growth difference of the disrupted mutants relative to that of the wild type grown on the same plate was calculated. The percentage change in growth, which could be positive or negative, was determined by dividing the relative difference of the growth by that of the wild type, followed by multiplication of 100. The significance of the treatments was test ( P ). Virulence T est Evaluation of fungal virulence was performed on detached calamondin ( Citrus mitis Blanco) or Minneola ( Citrus paradisi Macfad. x Citrus reticulata Blanco) leaves

PAGE 64

64 inoculated with conidial suspension (1x10 4 conidia/mL) or mycelial mas s. Conidial suspension (5 L) or mycelial mass (with agar removed ) was applied to detached citrus leaves and inc ubated in a moist chamber for 3 to 4 days for lesion development. Result s Generation of Nox Double Mutants Transforming split Sur marker fragmen ts fused with truncated NoxA into protoplasts prepared from DB5 and DR2 identified fungal strains NoxA NoxB and AB6) and NoxA NoxR successful integration of SUR within the NoxA locus (Fig. 3 1B). An expected 2.4 kb fragment was amplified from DNA of double mutants AB1, AB6, AR2 and AR3 with the p rimers surF and NoxA TAA. Likewise, an expected 3.4 kb fragment was amplified from DNA of AB1, AB6, AR2 and AR3 with the primers NoxA pro1F and surR. The primer NoxA pro1F sequence is not present w ithin the split marker fragment. No fragment was amplified from the wild type strain using these two primer sets. Nox C ontribute s to Oxidative and Nitrosative Stress Resistance Nox mutants grew slightly slower than the wild type strain. AaNoxA and AaNoxB mutants show ed reduced growth on PDA by 12% and 11% respect ively. AaNoxR mutant displayed no significant growth reduction compared to wild type strain. The double mutant strains ( noxAB and noxAR) showed reduced growth by approximately 20%. Growth reduction of the mutant greater than the respective baseline thresho ld was considered hypersensitive to the compounds tested. Mutational inactivation of Noxs in A. alternata resulted in an increase sensitivity to various ROS inducing compounds to varying degree s (Fig. 3 2). AaNoxA AaNoxB or AaNoxR mutants were hypersensit ive to H 2 O 2 Cumyl H 2 O 2 rose Bengal (RB), as well as superoxide generating agents

PAGE 65

65 diamide, menadione (MND) and potassium superoxide (KO 2 ) to varying degrees AaNoxA and AaNoxB single mutant strains were more sensitive than the AaNoxR mutant to H 2 O 2 AaNox B and AaNoxR mutant strains displayed greater sensitivity than the AaNoxA mutant to Cumyl H 2 O 2 AaNoxA and AaNoxR single mutant strains were more sensitive than AaNoxB to diamide. AaNoxB and AaNoxR mutant strains were less sensitive than AaNoxA to KO 2 All phenotypes seen in the AaNoxA AaNoxB and AaNoxR mut ant strains were fully or near fully restored, as seen in the genetically complementation CpA16, CpB24 and CpR40 strains, expressing a wild type copy of the corresponding genes. The NoxA NoxB and NoxA No xR double mutant strains displayed severe hypersensitivity to H 2 O 2 and RB compared with the sensitivity observed in the strains mutated at AaNoxA AaNoxB or AaNoxR alone. The NoxA NoxR but not NoxA NoxB double mutant strain displayed greater sensitivity t han AaN oxA or AaN oxR to C umyl H 2 O 2 and diamide. The NoxA NoxB and NoxA NoxR double mutants displayed MND and KO 2 sensitivity similar to the strains carrying a single gene mutation Nox mutants displayed high sensitivity to diamide, a compound that is well known to stimulate the formation of superoxide anion ( O 2 ) and nitric oxide ( ) (de Lamirande et al., 2009) Nox mutants were further tested for sensitivity to different nitrosative stress generating compounds. Sodium nitroprusside (SNP) and hydroxylamine hydrochloride (HDA) are capable of producing L arginine (Arg) is an NO synthase substrate and nitro arginine methyl ester (N Arg) is a synthase inhibitor (Rees et al., 1990; Cayatte et al., 1994) The A. alternata NoxA and NoxR mutants were moderately sensitive to SNP, H D A Arg and N Arg. AaNoxB mutant also displayed mo derate sensitivity to all of the tested compounds but Arg (Fig. 3 3).

PAGE 66

66 Expression of Nox Genes I s R esponsive to Oxidative and Nitrosative Stress Northern blot analyses were performed to assess the expression of the AaNoxA AaNoxB and AaNoxR genes in respons e to H 2 O 2 and other compounds related to oxidative stress in axenic cultures. The 1.8 kb AaNoxA gene transcript was barely detectable when the wild type strain was grown on PDA, but was elevated in the presence of H 2 O 2 KO 2 MND, tert butyl H 2 O 2 (t BHP) or h e m atoporphyrin (HP) (Fig. 3 4). Accumulation of the 1.8 kb AaNoxB transcript was detected abundantly when the fungus was grown on PDA, and was elevated to varying degrees when the fungus was shifted to medium supplemented with KO 2 t BHP or HP. AaNoxR wa s weakly expressed when the fungus was grown on PDA. The accumulation of the 1.7 kb AaNoxR gene transcript was apparently elevated in the wild type strain responding to KO 2 HP or t BHP. In contrast, H 2 O 2 and MND had a moderate effect on the expression of AaNoxB and AaNoxR Nox R egulate s the YAP1 Transcription Factor and the HOG1 MAP Kinase Northern blot analyses showed that the expression of both redox responsive transcription factor YAP1 and MAP kinase HOG1 genes was down regulated in the A. alternata st rains lacking NoxA NoxB or NoxR (Fig. 3 4). Re introduction of a functional copy of the Nox gene into the respective mutant restored the expression of the AaAP1 and AaHOG1 In contrast, there was no difference in the expression of the AaNoxA gene between the wild type, AaAP1 mutants and genetically rescued strain CpY, or between AaHOG1 mutants (Fig. 3 4C). Deletion of AaAP1 or AaHOG1 apparently promoted the expression of both AaNoxB and AaNoxR genes.

PAGE 67

67 Expression of AaAP1 Expression of the AaAP1 gene was inv estigated further in the wild type (WT) and AaNoxA mutant (DN2) strains in response to ROS generating compounds (Fig. 3 5). Northern blot analyses showed that the expression of AaAP1 was induced in the AaNoxA mutant in response to H 2 O 2 and other oxidative stress generating compounds (Fig. 3 5A). The increased level of the AaAP1 gene transcript in the wild type strain was much greater than that seen in the AaNoxA mutant in response to H 2 O 2 (Fig. 3 5B, C), further indicating that the activation of AaAP1 gene expression was partially regulated by Nox Nox Mutants Appear to be Unable to P enetrate Citrus Leaves Since the Aa NoxB single and NoxA Nox B double mutant strains did not produce any conidia, fungal pathogenicity was assayed by placing a mycelial mass (with agar removed) on calamondin leaves. Necrotic lesions induced by the wild type strain appeared at 2 to 4 days post inoculation (dpi). In contrast, the Aa NoxB single and NoxA Nox B double mutant strains did not produce visible lesions at 4 dpi ( Fig. 3 6B and Table 3 1). The Aa NoxB rescued strain (CpB24) produced necrotic lesions comparable with those induced by the wild type. Aa NoxB and NoxA Nox B mutant strains induced necrotic lesions similar to those produced by the wild type and the CpB24 strains on pre wo unded calamondin leaves Pathogenicity assays using a point inoculation method with conidial suspension r evealed that Aa NoxA mutant strains produced necrotic lesions on detached calamondin leaves at frequencies ranging from 76% to 81%. The lesions induced by the Aa NoxA type and the CpA16 strain re carrying a functional copy of Aa NoxA ( Fig. 3 6A ). In contrast, the

PAGE 68

68 Aa NoxR single and NoxA Nox R double mutant strains induced pinpoint or no visible lesions on det ached leaves inoculated with conidial suspension. The wild type and the genetically reverted CpR40 strains induced visible lesions at 3 dpi ( Fig. 3 6C ). When tested on pre wounded leaves, t he strains lacking Aa NoxA Aa NoxR or both induced necrotic lesions at frequencies and magnitudes similar to those of the wild type and the complementation strains at 2 dpi. Discussion In this c hapter, the roles of three Nox components ( NoxA NoxB and NoxR ) in relation to oxidative and nitrosative stress resistance as well as pathogenesis of A. alternata were investigated Using a loss of function mutation in each of these Nox genes, the requirement of NOX for resistance to oxidative/nitrosative stress and full virulence in the tangerine pathotype of A. alternata were demon strated Disruption of the AaNoxA AaNoxB or AaNoxR gene with a hygromycin resistance cassette yielded mutants that display ed plei o tropic phenotypes. The phenotypes associated with mutational inactivation of the Nox gene were fully restored in the respecti ve complementation strains (CpA16, CpB24 and CpR40), further confirming that the AaNoxA AaNoxB or AaNoxR disruption was indeed responsible for the observed phenotypes. The A. alternata Nox system is required for vegetative growth and cellular resistance t o ROS in axenic cultures. These deficiencies strongly resemble the phenotypes previously seen for the A. alternata ap1 null mutant defective at a YAP1 like transcription regulator and for the A. alternata hog1 mutant defective at a HOG1 like MAP kinase (Li n et al., 2009; Lin and Chung, 2010) Although Aa NoxA, Aa NoxB and AaNoxR are core components of the Nox system, each may have shared or unique

PAGE 69

69 functions in response to different environmental stimuli, because the degree of impairment varied considerably am ong individual Nox mutants. For example, AaNoxA and AaNoxB mutants display greater growth reduction and cellular sensitivity than the AaNoxR mutant to H 2 O 2 In contrast, AaNoxA and AaNoxR mutants are more sensitive to diamide than AaNoxB mutant. However, N oxA NoxB or NoxA NoxR double mutation strains display greater sensitivity to H 2 O 2 menadione (MND), diamide and rose Bengal (RB) than the single gene mutated strains, indicating an additive effect between Nox components. Likewise, BcNoxA and BcNoxB act add i tively for H 2 O 2 resistance in the necrotrophic fungal pathogen B. cinerea (Segmuller et al., 2008). A. alternata Nox mutants a re hypersensitive to menadione. Similar results have been observed in Cpnox1 mutant in C. purpurea (Giesbert et al., 2008). Howev er, BcNoxA and BcNoxB mutants of B. cinerea are sensitive to H 2 O 2 but not menadione (Segmuller et al., 2008). Expression of the AaNoxA AaNoxB and AaNoxR genes in A. alternata was up regulated in response to a number of ROS compounds, confirming further th e involvement of Nox enzymes in cellular resistance to ROS. Consistently, transcript levels of BcNoxA and Cpnox1 were also increased during oxidative stress mediated by H 2 O 2 (Giesbert et al., 2008; Segmuller et al., 2008). Moreover, disruption of AaNoxA A aNoxB or AaNoxR resulted in fungi showing an increased sensitivity to the donors (SNP and HDA), and the synthase substrate (L arginine) and inhibitor (nitro L arginine), implying a possible involvement of Nox system in the signaling pathways. T he important role of Nox in response to is further supported by the ob servations that the expression of AaNoxA was elevated by SNP, HAD and Arg. Expression of

PAGE 70

70 AaNoxA was almost undetectable in the wild type treated with an synthase inhibitor nitro L arginine Little is known about how the Nox complex is regulated in fungi. In mammalian systems, p38 MAP kinase (HOG1 homolog) has been shown to activate the Nox complex via phosphorylation of p47 phox and p67 phox (NoxR homolog) (Brown et al., 2004). Furt hermore, a p21 activated kinase (Pak) was also known to regulate the mammalian Nox complex (Martyn et al., 2005) Deletion of a Pak homolog in the ergot fungus C. purpurea repressed accumulation of the Nox1 gene transcript (Rolke and Tudzynski, 2008) In t he filamentous fungus Aspergillus nidulans expression of a NoxA homolog has been shown to be suppressed by SakA, a HOG1 MAP kinase homolog (Lara Ortiz et al., 2003). In the endophytic fungus E. festucae inactivation of a SakA homolog did not alter expres sion of NoxA or NoxR It was speculated that the interaction might occur at the post translational level (Eaton et al., 2008) Studies with Podospora anserina indicate that NoxA facilitates nuclear localization of the PaMpk1 MAP kinase (Malagnac et al., 20 04; Kicka et al., 2006). Experimental evidence derived from the present study reveals a regulatory expression of the AaAP1 and AaHOG1 genes by Nox in response to ROS and chemical stimuli, implying a close interaction between ROS production and resistance. Altho ugh impairment of AaAP1 or AaHOG1 has no impact on the expression of AaNoxA both AaAP1 and AaHOG1 repressed the expression of AaNoxB and AaNoxR This transcriptional feedback loop could avoid the excessive production of ROS. NoxR is homologous to the p67 phox regulatory subunit and presumably required for activation of NoxA and NoxB. NoxA have been shown to be regulated by NoxR in

PAGE 71

71 A s nidulans and E. festucae (Takemoto et al., 2006; Semighini and Harris, 2008) and both NoxA and NoxB are regulated by No xR i n N. crassa B. cinerea and P. anserina (Cano Dominguez et al., 2008; Segmuller et al., 2008; Brun et al., 2009) In this chapter, I found that Aa NoxR transcriptionally suppress es Aa NoxA because disruption of Aa NoxR resulted in an elevated expression of Aa NoxA but not Aa NoxB Unlike the findings with N. crassa B. cinerea and P. anserina (Cano Dominguez et al., 2008; Segmuller et al., 2008; Brun et al., 2009) the phenotypes seen for the AaNoxR single and the NoxA NoxB double mutation strains of A. al ternata were also very different indicating further that Aa NoxR may not directly regulates Aa NoxA and Aa NoxB It is surprising t hat the A. alternata NoxR has no impact on the expression of Aa NoxB but negatively regulates the expression of Aa NoxA In this context, regulation of the Nox system in response to environmental stimuli in A. alternata might be somewhat unique. It is noteworthy that some fungi, such as Rhizopus oryzae Yarrowia lipolytica and Phycomyces blakesleeanus have NoxR like proteins but l ack NoxA and NoxB homologs (Takemoto et al., 2007). Analysis of the deduced amino acids sequences of these NoxR like proteins revealed no Nox activation domain, implying that NoxR may have functions in addition to regulating the Nox system. A. alternata se cretes a host selective toxin to rapidly kill host cells prior to invasion and obtains nutrients exclusively from dead tissues. As a result of cell death, a considerable amount of H 2 O 2 was detected in the vicinity of the infection area (Lin et al., 2011). Hence, A. alternata must have evolved an effective ROS detoxification system to successfully colonize within the oxidative environment of necrotic tissues. The fungal YAP1 redox responsive transcriptional regulator and the HOG1 MAP kinase mediated

PAGE 72

72 signalin g pathways are absolutely required for A. alternata pathogenicity in citrus. AaAP1 and AaHOG1 mutants are impaired in both penetration and colonization stages (Lin et al., 2009; Yang et al., 2009; Lin and Chung, 2010). However, Nox mutated strains apparent ly are arrested in the penetration stage. Although AaNoxA AaNoxB or AaNoxR mutants cause significantly smaller or no lesions on unwounded citrus leaves, all mutants induced lesions, which are comparable to wild type on pre wounded leaves. Similarly, the B cinerea strains lacking BcNoxB or BcNoxR display deficiency in virulence due to their impairment of penetration on bean leaves (Segmuller e t al., 2008). In summary, it was demonstrated that a close interaction among the Nox system, the YAP1 redox respons ive transcription factor and the HOG1 MAP kinase mediated signaling pathway is critical for fungal resistance to ROS and pathogenesis in A. alternata This study underlines an important regulatory role of Nox enzymes in fungi.

PAGE 73

73 Figure 3 1. Targeted disr uption of AaNoxA in a fungal strain lacking NoxB (DB5) or NoxR (DR2) of Alternaria alternata using a split marker approach. (A) Schematic depiction of the generation of truncated, but overlapping, sulphonylurea resistance gene ( SUR ), and gene disruption wi thin AaNoxA P rimers used to amplify each fragment are indicated. (B) Image of DNA fragments ampl The primer NoxA pro1F sequence is not located within the split marker fragment. Fragment patterns indicate successful disruption at the AaNoxA locus. Fungal strains AB1 and AB6 carry impaired NoxA and NoxB genes; strains AR2 and AR3 carry impaired NoxA and NoxR gene s.

PAGE 74

74 Figure 3 2. Sensitivity assays of the wild type (WT), the strains carrying a single deletion of NoxA NoxB or NoxR the genetically complementation (CpA16, CpB24 and CpR40), and the double mutation NoxA NoxB (noxAB) and NoxA NoxR (noxAR) strains of Alternaria alternata Two independent mutant strains of each type were used for the assays. Fungi were grown on PDA amended with the test compounds. Radial growth was measured at 3 6 days. The percentage change in radial growth was calculated as the percentage of growth of the deletion mutants in relation to the wild type grown on the same plate. A negative percentage change indicates growth reduction in relation to the wild type. The mutan t was considered to be hypersensitive to the test compounds when the percentage change in growth reduction was greater than that measured in untreated PDA. The data presented are the mean and standard error of two independent mutants with at least two repl icates of two experiments (n = 8). For each test compound, means indicated by the same P 0.05. RB, rose B engal; MND, menadione

PAGE 75

75 Figure 3 3. Sensitivity assays of the wild t ype (WT), the strains carrying a single deletion of NoxA NoxB or NoxR of A. alternata Two independent mutant strains of each type were used for the assays. Fungi were grown on PDA amended with the test compounds. Radial growth was measured at 3 6 days. T he percentage change in radial growth was calculated as the percentage of growth of the deletion mutants in relation to the wild type grown on the same plate. A negative percentage change indicates growth reduction in relation to the wild type. The mutant was considered to be hypersensitive to the test compounds when the percentage change in growth reduction was greater than that measured in untreated PDA. The data presented are the mean and standard error of two independent mutants with at least two replic ates of two experiments (n = 8). For each test compound, means indicated by the same letter within a test compound are not s P 0.05. Arg, L arginine; H D A hydroxylam ine hydrochloride; SNP Sodium nitroprusside; N Arg, nitro arginine methyl ester.

PAGE 76

76 Figure 3 4. Images of RNA gel blotting. (A) Northern blot ana lyses showing the expression of the NoxA NoxB and NoxR genes in response to ROS. (B) Northern blot analyses for the expression of NoxA gene in response to nitrosative stress related compounds. T he mock controls were grown on PDA only.

PAGE 77

77 Figure 3 5. Images of RNA blotting. Fungal RNA purified from the wild type (WT), NoxA mutants (A2, A6), NoxB mutants (B5, B6) and NoxR mutants (R2, R5), as well as the respective genetically complementation strains (CpA16, CpB24 and CpR40), wa s electrophoresed in a formaldehyde containing gel, blotted and hybridized with an AaAP1 (A) or AaHOG1 (B) gene probe. (C) Fungal RNA purified from WT, two AaAP1 mutants and its complementation strain (CpY), as well as two AaHOG1 mutants was hybridized to a NoxA NoxB or NoxR gene probe. (D) Total RNA purified from WT, NoxR mutants and its rescued strain (CpR40) was hybridized to a NoxA or NoxB probe. Gels staining with ethidium bromide indicate relative loading of the RNA samples. The sizes of the hybridiz ation bands are indicated in kilobase pairs (kb ).

PAGE 78

78 Figure 3 6. RNA gel blotting indicates the expression of AaAP 1 (A, B) The Alternaria alternata NoxA mutant (DN2) was grown on cellophane overlaid onto PDA for 2 days, shifted to PDA containing H 2 O 2 (1 or 3 mM), KO 2 (0.5 mg/mL), tert butyl hydroperoxide (t BHP, 0.0 5%), menadione (MND, 1 mM) or h ematoporphyrin (HP, 50 mM), and incubated for an additional 24 h. Fungal RNA was hybridized with an AaAP1 gene probe. (C) Total RNA was purified from the wild ty pe (WT) grown on PDA or H 2 O 2 and hybridized with an AaAP1 probe. Gels staining with ethidium bromide indicate relative loading of the RNA samples. The sizes of the hybridization bands are indicated in kilobase pairs (kb ).

PAGE 79

79 Figure 3 7 Pathogenicity of the NoxA NoxB and NoxR mutants of A. alternata assayed on unwounded or pre wounded calamondin or Minneola leaves. Conidia suspension or mycelial mass of NoxA mutants (A2, A6), NoxB mutants (B5, B6) and NoxR mutants (R2, R5), as well as the respective gen etically complementation strains (CpA16, CpB24 and CpR40) was inoculated on detached citrus leaves. Inoculation of wild type (WT) strain served as control. The mock controls were treated with water on ly. Photographs were taken at 2 to 4 days after inoculat ion.

PAGE 80

80 Table 3 1. Pathogenicity assayed on detached Minneola or calamondin leaves inoculated with the wild type and the genetically modified strains of Alternaria alternata suspension (10 4 conidia/mL) in each of the spots. The inoculated leaves were incubated in a mist chamber for lesion development. The number of n ecrotic lesions and the total number of inoculated spots on leaves are to the right and left of the slash (/), respectively. Except for double mutant strains, all strains were tested at least twice. The mock control was treated with water only. Lesions i nduced by NoxA mutant were significantly smaller (by ~40%) than those induced by the wild type. NoxA disruption and NoxA rescued strains were tested on Minneola leaves. Other strains were tested on calamondin leaves. Fungal Strain Genotype Inoculum Disease incidence (%) Unwounded Wounded Mock H 2 O 0/26 (0) 0/15 EV MIL31 Wild type Mycelial mass 32/32 (100) 17/17 DB5 NoxB disruption 0/22 (0) 11/11 DB6 0/22 (0) 11/11 AB1 NoxA NoxB double disruption 0/11 (0) 10/10 AB6 0/11 (0) 10/10 CpB24 NoxB rescued 21/22 (95.5) 11/11 Mock H 2 O 0/24 (0) 0/12 EV MIL31 Conidia 63/63 (100) 20/20 DN2 NoxA disrupt ion 32/42 (76.2 ) 20/20 DN6 39/48 (81.3) 20/20 CpA16 NoxA rescued 40/45 (88.9) 16/16 DR2 NoxR disruption 5/27 (18.5) 24/24 DR5 6/27 (22.2) 24/24 AR2 NoxA NoxR double disruption 3/44 (6.8) 10/10 AR3 3/44 (6.8) 10/10 CpR40 NoxR rescued 27/2 7 20/20

PAGE 81

81 CHAPTER 4 THE INVOLVEMENT OF NADPH O XIDASES IN DEVELOPMENTAL AND PHYSIOLOGICAL PROCESSES OF Alternaria alternata Introduction Reactive oxygen species (ROS) play important roles in cellular signaling in different aerobic organisms ranging from bacteria to mammalian cells (Mittler et al., 2011 ). The non toxic, steady state level of ROS in cells is maintained by a complex interplay between the ROS producing pathways and the ROS scavenging mechanisms. Through highly regulated networks, cells are able to generate and accumulate ROS in specific com partments (Lambeth, 2004; Mittler et al., 2004; Mittler et al., 2011). ROS are produced by NADPH oxidase (Nox) in animals, plants and some fungi. Nox plays a critical role in numerous biological processes (Brown and Griendling, 2009; Aguirre and Lambeth, 2 010). Plant NADPH oxidases, so called respiratory burst oxidase homologs (RBOH), are involved in regulating a myriad of developmental processes. These include polarized cell expansion of root hair, pollen tube growth, cell wall lignification as well as see d ripening and germination (Foreman et al., 2003; Potocky et al., 2007; Hamann et al., 2009; Muller et al., 2009). In filamentous fungi, Nox was first shown to be required for cleistothecia development in Aspergillus nidulans (Lara Ortiz et al., 2003). Nox A (Nox1) plays an essential role in perithecia development and NoxB (Nox2) is required for ascospore germination in both Podospora anserina and Neurospora crassa (Malagnac et al., 2004; Cano Dominguez et al., 2008). Moreover, NoxA mediated ROS production i s involved in the regulation of apical dominance in hyphal tips in A s nidulans (Semighini and Harris, 2008). Nox genes of P. anserina are involved in the degradation of cellulose by regulating the formation of needle like hyphae (Brun et al., 2009). In Bo trytis cinerea S

PAGE 82

82 sclerotiorum and Claviceps purpurea NoxA and NoxB are required for sclerotia formation (Giesbert et al., 2008; Segmuller et al., 2008; Kim et al., 2011). In the rice blast pathogen Magnaporthe oryzae Nox enzymes are required for appre s soria formation (Egan et al., 2007). The maintenance of cell wall integrity is essential in plants and fungi during growth, morphogenesis and exposure to diverse environmental stresses (Levin, 2005; Ringli, 2010; Seifert and Blaukopf, 2010). Cells change t he physical structure and chemical composition of cell wall, and orchestra te cellular metabolism to maintain the integrity of the cell wall (Hamann et al., 2009; Levin, 2011). In Arabidopsis, RBOH generated ROS along with jasmonic acid (JA) and Ca 2+ sign aling mechanisms are involved in maintaining plant cell wall integrity (Hamann et al., 2009; Denness et al., 2011; Hamann and Denness, 2011). In M. oryzae Nox1, but not Nox2, is required for cel l wall biosynthesis and remodel ing during appressorium format ion (Egan et al., 2007). The tangerine pathotype of Alternaria alternata has no known sexual cycle. Environmental stimuli such as light, oxygen and nutrition increase sporulation (Rotem, 1994). The formation and dispersal of conidia are essential for the c ompletion of the life cycle, as well as the onset of Alternaria brown spot in citrus. Previous studies have demonstrated that conidia formation is positively regulated by the G protein controlled cAMP level, as well as by the FUS3 and SLT2 mitogen activate d protein kinases (MAPK) mediated signaling pathways in A. alternata (Lin et al., 2010; Wang et al., 2010; Yago et al., 2011). The G protein/cAMP dependent protein kinase A (PKA) is important for conidiation in filamentous fungi (Bolker, 1998). The PKA com plex, containing two regulatory and two catalytic subunits, forms an inactive tetramer when the cellular cAMP

PAGE 83

83 levels are low. Elevated cAMP levels activate PKA by separating the catalytic subunits from the regulatory subunits, resulting in the activation o f downstream enzymes or transcriptional regulator by phosphorylation (Gerits et al., 2008). Recent studies conducted in our lab revealed that PKA negatively regulates conidiation in A. alternata Inactivation of the PKA catalytic subunit gene ( PKA cat ) resu lted in no detectable PKA activity and hyperconidiation (Tsai et al., 2013). Fungal mutants lacking a PKA regulatory subunit gene ( PKA reg ) produced detectable PKA activity but no mature conidia. The objective of this study is to determine the role of Nox e nzymes in morphogenesis and conidiation in A. alternata I provide genetic evidence to define the central role of N ox A, N ox B and N ox R in the development of conidia. I also show a novel role of NoxB in cell wall integrity and fungicide sensitivity. The resu lts highlight a dramatic flexibility and uniqueness of NOX components in developmental and physiological processes in the tangerine pathotype of A. alternata Materials and Methods Fungal Strains and Chemical Sensitivity Tests Alternaria alternata (Fr.) Ke issler strains used in this study and their genotypes are given in Table A 1 The genetically altered strains Aa NoxA mutants (DN2, DN6), Aa NoxB mutants (DB5, DB6), Aa NoxR mutants (DR2, DR5) and the corresponding complementation strains (CpA16, CpB24 and CpR40) as well as the double mutant NoxA NoxB (noxAB1 and AB6) and NoxA NoxR (noxAR2 and AR3) strains were generated from previous studies (Chapter 2 and 3). Fungal mutants disrupted at the gene encoding a MAPK ( AaFUS3 ) a cAMP dependent protein kinase A (PKA) catalytic subunit ( AaPKA cat ) or a PKA regulatory subunit ( AaPKA reg ) were created in separate

PAGE 84

84 studies ( Lin et al., 2010; Tsai et al., 2013). Assays for chemical sensitivity to cell wall targeting compounds, sodium dodecyl sul f ate (SDS), calcofluor white (CFW) and Congo red (CR), as well as fungicides vinclozolin and fludioxonil, were conducted by transferri ng fungal hyphae/conidia as a tooth pick point inoculation onto PDA containing the test chemicals at appropriate concentrations. Fungal radial growth was measured from 3 to 6 days. The percentage change in growth of the disrupted mutants relative to that o f the wild type grown on the same plate was calculated. The significance of the treatment was determined by analysis of variance and the treatment means were separated by T u k e test ( P ). Isolation and Quantification of Conidia Conidia were harvested by flooding with sterile water and low speed centrifugation (3,000 g ) from fungal cultures grown on PDA under constant fluorescent light for 3 to 4 days The concentration of conidia was determined with the aid of a haemocytometer. Conidial morphology was examined using a L eitz Laborlux phase contrast mi croscope (Leica Microsystems, Exton, PA, U.S.A.). Extraction and Quantification of Fungal Chitin Fungal mycelium was ground in liquid nitrogen, mixed with 500 wall extraction buffer (50 mM Tris mercaptoethanol, 1 mM EDTA), and boiled at 100 C for 15 min (Selvaggini et al., 2004). Cell wall pellets were collected by centrifugation at 8 000 g for 10 min washed three times wit h distilled water, and dried completely in 60 C oven. Cell wall material ( 5 10 mg) was resuspended in 200 f or at least 4 h ours Sample was then dried completely in 60 C oven C hitin was determined and quantified by measuring the glucosamine released from

PAGE 85

85 chitin after hydrolysis using p dimethylaminobenzaldehyde as a chromogen. Crude extracts of fungal cell wall (100 L ) were mixed with equal volume of 1.5 M Na 2 CO 3 dissolved in 4 % (v/v) acetylacetone and heated at 100 C for 20 min. Samples were mixed with 700 p dimethylaminobenzaldehyde dissolved in 5.8 M HCl, and 50% ethanol) and measured spectrophotometrically for absorbance at 520 nm. The quantity of glucosamine was calculated by reference to a regressi on line established using pure glucosamine as a standard The significance of the treatment was determined by analysis of variance and P ). Manipulation of Nucleic Acids Isolation of fungal RNA and Northern blot analyses were performed as described in Chapter 2. Protein Purification and Western Blot Analysis Western blot analysis was performed to determine if mutational inactivation of AaNoxB will affect the phosphorylation of AaFUS3. Fungal isolates were grown on liquid complete medium (CM) for 3 days (Chung, 2003). Total proteins were extracted from fungal mycelium in a buffer containing 10 mM Tris HCl (pH7.5), 150 mM NaCl, 5mM EDTA, 10 mM NaN 3 and 1% Triton X 100, followed by centrifugation at 10, 000 g for 15 min at 4 C Protein concentrations were determined by a protein assay kit (Bio Rad, Hercules, CA). The protein samples were denatured in 2x SDS sample buffer heated at 100 C for 10 min. Proteins were electrophoresed in a 12% SDS polyacryla mide gel set at 25 mA for 60 90 min. Proteins were electroblotted onto a nitrocellulose membrane (Bio Rad, Hercules, CA) and incubated with 1:1000 dilutions of rabbit anti phosphate p44/42 MAP kinase antibody or FUS3 (y 40) rabbit polyclonal antibody. The anti rabbit

PAGE 86

86 IgG antibody conjugated horseradish peroxidase (HRP) at a 1:2000 dilution was used as a secondary antibody. All antibodies used in this study were purchased from Cell Signaling Technology (Boston, MA). Detection of the HRP was performed using L umiGLO (Signaling Technology, Boston, MA) as a chemofluorescent substrate. Results Nox I s I nvolved in Conidia Formation Compared with the wild type strain grown on PDA in the light, AaNoxA mutant (DN2 and DN6) and AaNoxR mutant (DR2 and DR5) formed light b rown colonies and AaNoxB mutant (DB5 and DB6) accumulated little or no pigmentation (Fig. 4 1A, 4 2A and 4 3A). Quantitative analysis of conidia formation revealed that AaNoxA mutants were reduced in conidiation by 49% (Fig. 4 1B). Light microscopy analysi s revealed that the wild type strain grown on PDA often formed multicellular, elliptical and melanized conidia with both vertical and transverse septae. In contrast, AaNoxA mutant produced light colored conidia with less distinct septae (Fig. 4 1C). The co mplementation strain CpA16 produced wild type levels of conidia with both vertical and transverse septae and dark pigmentation. AaNoxB mutants failed to produce any conidia. Pigmentation and conidiation were restored to wild type levels in the complementat ion strain CpB24 (Fig. 4 2B and C). AaNoxR mutants reduced conidiation by 90%. Conidia produced by AaNoxR mutants were similar to those produced by wild type. The complementation strain CpR40 produced wild type levels of conidia (Fig. 4 3B and C). Mutation al inactivation of AaNoxA or AaNoxR did not affect conidial germination. The NoxA NoxB double mutant strain did not produce any conidia. The NoxA NoxR double mutant strain produced conidia at levels similar to the AaNoxR mutant.

PAGE 87

87 NoxB Plays a Negative Role in Cell Wall Integrity and Fungicide Sensitivity Fungi were tested for sensitivity to cell wall targeting compounds, including SDS, calcofluor white (CFW) and Congo red (CR). The wild type strains were reduced in radial growth by 35% 40% when grown on medi um amended with 0.01% SDS. Fungal strains impaired for each of the Nox genes displayed an increased sensitivity to SDS (Fig. 4 4A). The complementation strains (CpA16, CpB24 and CpR40) displayed wild type level sensitivity to SDS. The NoxA NoxB (noxAB) and the NoxA NoxR (noxAR) double mutant strains were more sensitive to SDS than the single gene mutant strains. The wild type strain of A. alternata displayed reduced radial growth by 34% 40% when grown on medium amended with 100 M CFW or 6 0 M CR. Surprisin gly, AaNoxB and noxAB mutant strains showed increased resistance to CFW and CR compared with the wild type (Fig. 4 4A). In contrast, mutant strains lacking NoxA NoxR or both displayed slightly increased growt h in the presence of CFW, but had elevated sens itivity to CR, when compared with the wild type. The complementation strains (CpA16, CpB24 and CpR40) displayed sensitivity to CFW and CR at levels not signif icantly different from the wild type. The wild type strain of A. alternata displayed reduced radia l growth by 26% 32% and 38% 44% when grown on medium amended with 10 g/mL vinclozolin and 0.1 g/mL fludioxonil fungicides, respectively. T he complementation strains (CpA16, CpB24 and CpR40) displayed wild type level sensitivity to these fungicides, where as AaNoxB and noxAB mutant strains were insensitive to them (Fig. 4 4B). Disruption of AaNoxA or AaNoxR had a lesser effect on fungicide resistance. Fungal strains lacking NoxA NoxR or both displayed slightly increased resistance to vinclozolin compared w ith the same strains grown on untreated PDA. On PDA amended with fludioxonil, AaNoxR, AaNoxB

PAGE 88

88 and noxAB mutant strains displayed significantly increased resistance (a positive percentage change) compared with the wild type. Quantitative assays revealed that fungal strains carrying defective NoxB or NoxA NoxB had significantly higher chitin content compared to the levels measured in the wild type and other Nox disrupted strains (Fig. 4 5). The chitin level detected in the complementation strain CpB24 was not significantly different from that of wild type. The NoxA or NoxR disru ptants had lower chitin content than the wild type and the CpR40 complementation strains. Gene Expression Northern blot analyses were performed to determine possible interplays at transc riptional levels among NoxB FUS3 PKA cat and PKA reg (Fig.4 6A). The results indicated that accumulation of the FUS3 and PKA reg gene transcripts was elevated in the NoxB mutant. Inactivation of NoxB had little or no effect on the expression of PKA cat The complementation strain CpB24 displayed wild type expression of both FUS3 and PKA reg Inactivation of FUS3 reduced the level of NoxB and PKA cat gene transcripts and had no effect on the expression of the PKA reg (Fig.4 6B). Deletion of PKA cat or PKA reg appar ently reduced the expression of NoxB gene (Fig.4 6C, D). The accumulation of the FUS3 and PKA reg gene transcripts was not affected in the PKA cat mutants. However, inactivation of PKA reg promoted the expression of both FUS3 and PKA cat genes. AaNoxB Negative ly Regulates Phosphorylation of AaFUS3 The phosphate p44/42 MAP kinase monoclonal antibody detected faint bands in the protein samples prepared from the wild type strain and the NoxB complementation strain CpB24 of A. alternata (Fig.4 7). Phosphorylation o f AaFUS3 was elevated in fungal strains lacking AaNoxB The intensity of band detected by the phosphate p44/42

PAGE 89

89 MAPK antibody was apparently stronger in the protein sample prepared from the NoxB mutants. The anti FUS3 antibody detecte d protein bands represe nting total AaFUS in each sample. Discussion In this c hapter, I investigated the roles of Nox components (NoxA, NoxB and NoxR) in developmental and physiological functions of A. alternata Fungal strains impaired for AaNoxA AaNoxB or AaNoxR reduced growth slight ly compared with the wild type progenitor and formed light brown colonies on PDA. Nox plays no role in hypha l branching. Reduction in growth was observed in Nox mutants of B. cinerea and N. crassa (Cano Dominguez et al., 2008; Segmuller et al., 2008 ), but not in the rice blast pathogen M. oryzae The M. oryzae Nox1 mutants grow slightly faster than wild type and Nox2 mutants exhibit wild type growth rate (Egan et al., 2007). Nox1 mutants of P. anserina and M. oryzae produce lightly pigmented hyphae ( Malagnac et al., 2004; Egan et al., 2007) In addition to radial growth and pigmentation A. alternata Nox is required for conidiation. Similarly, disruption of either Nox1 or NoxR in N. crassa impacts conidia production. M. oryzae mutant impaired for both NoxA and NoxB displays a dramatic reduction in conidiogenesis. However, mutational inactivation of Nox genes in B. cinerea Nox2 in N. crassa and Nox1 or Nox2 in M. oryzae has little or no effect on conidia formation (Egan et al., 2007; Cano Dominguez et al., 2008; Segmuller et al., 2008). Moreover, N. crassa Nox1 M. oryzae Nox2 and Epichlo festucae NoxA mutants are all defective for the formation of aerial hyphae (Egan et al., 2007; Cano Dominguez et al., 2008). In contrast, the Nox gene product plays n o role in vegetative growth in A s nidulans (Lara Ortiz et al., 2003). These divergent phenotypes

PAGE 90

90 suggest that the well conserved Nox enzymes may have varying impacts on vegetative growth and development in different fungi. AaNoxA, AaNoxB and AaNoxR may in dependently and cooperatively interact with other yet unidentified components during different developmental stages or under different environmental conditions. As shown in this study, A. alternata NoxB but not NoxA has a unique role in cell wall integri ty and fungicide sensitivity. Similarly, M. oryzae Nox1 is involved in cell wall biochemistry (Egan et al., 2007). Calcofluor white (CFW) preferentially binds to polysaccharides containing 1,4 linked D glucopyranosyl units and alters the assembly of chitin microfibrils in fungi (Elorza et al ., 1983) Both AaNoxB and NoxA NoxB mutants have higher chitin content than the wild type and the complementation strain CpB24. The results suggest a negative regulatory role of AaNoxB in cell wall integrity. This novel phenotype has not been identified to my knowledge in other fung i Previous studies have revealed that mutational inactivation of the A. alternata SLT2 MAPK causes reduced accumulation of chitin (Yago et al., 2011). AaNoxB and NoxA NoxB mutants, as well as fungal strains lacking the gene encoding a class III histidine kinase ( HSK1 ), a response regulator ( SKN7 ) or a HOG1 MAP kinase all exhibit elevated resistance to fungicides vinclozolin and fludioxonil in varying degrees (Lin and Chung, 2010; Chen et al., 2 012). These results imply a possible interplay between these different signaling elements in the context of cell wall integrity and fungicide sensitivity. The association of Nox with fungicide sensitivity to my knowledge, has not been demonstrated in fung i. In the cereal pathogen Fusarium graminearum elevated accumulation of H 2 O 2 was observed after the application of a triazole fungicide prothioconazole that is acting as an inhibitor of ergosterol biosynthesis in fungi

PAGE 91

91 (Audenaert et al., 2010). It will be of interest to determine whether or not AaNoxB is a target of vinclozolin and fludioxonil fungicides in the future. The Nox derived ROS contributes to diverse developmental processes in many organisms. In mammalian cell s, Nox is required for reconstructin g the cytoskeleton organization (Brown and Griendling, 2009). In Caenorhabditis elegans Nox generated ROS are required for tyrosine cross linking within the cuticular extracellular matrix (Edens et al., 2001). H 2 O 2 causes the rapid cross linking of cell w all structural proteins, leading to a strengthened cell wall in soybean (Brisson et al., 1994; Lamb and Dixon, 1997). NoxA derived ROS have also been suggested to be involved in cell wall cross linking during cleistothecia formation (Lara Ortiz et al., 200 3). Recent studies with M. oryzae and S cerevisiae provide novel insights into the molecular mechanisms of how Nox mediates fungal differentiation. In M. oryzae Nox is required for the differentiation of penetration peg at the base of appressoria by remo deling the F actin cytoskeleton and initiating the polarized growth from the appresso r ium (Dagdas et al., 2012; Ryder et al., 2013). Nox2/NoxR complex is involved in septin mediated F actin assembly at the appressorium pore. The Nox1 mediated production of ROS is required for oxidative cross linking of cell wall proteins and polarized growth. In S cerevisiae a newly identified Nox homolog, YNO1 is also involved in the formation of actin cable (Rinnerthaler et al., 2012). Whether or not A. alternata Nox p lays a role in cytoskeleton reorientation or polarized growth remains to be determined. Formation of conidia in fungi is tightly regulated process, which is often modulated by different signaling pathways in a given species. Studies with A. alternata have revealed that G protein, cAMP dependent PKA, FUS3 MAPK and SLT2 MAPK

PAGE 92

92 signaling pathways are all required for conidia formation. Fungal strains impaired for FUS3 gene fail to produce mature conidia (Lin and Chung, 2010). SLT2 mutants produce fewer but sligh tly larger conidia with fewer transverse septae (Yago et al., 2011). coding gene) mutants reduce conidiation (Wang et al., 2010). PKA cat mutants produce abundant conidia and PKA reg mutants produce no mature conidia (Tsai et al., 2013). The present study indicates that the A. alternata strain s lacking Nox are also defective in conidia production. Nox and its ability to produce ROS apparently play a crucial role in conidia formation. NoxB is likely the primary determinant for the initiatio n of conidiation because inactivation of NoxB completely blocked the formation. Impairment of NoxA or NoxR also resulted in a severe reduction in conidia formation. These findings suggest that conidia formation is governed by a complex and intertwined regu latory network, where NOX appears to play a central role in A. alternata Based on the observed phenotypes derived from previous and present studies, a regulatory network involved in conidia formation in A. alternata is proposed. Upon exposure to light or upon receiving signal cues from environmental stimuli, the activated G protein elevates the cellular level of cAMP, which in turns binds to PKA and triggers disassociation of the PKA tetramer by separating the catalytic subunits from the regulatory subuni ts The released catalytic subunits are capable of activating downstream enzymes or transcriptional regulators. The expression of AaNoxB is apparently down regulated in fungal strains lacking PKA catalytic subunits. However, NoxB has little effect on the e xpression of PKA coding genes, indicating that PKA is epistatic to N ox B Moreover, the expression of AaNoxB was activated by FUS3

PAGE 93

93 Expression of Nox genes has been shown to be regulated by SLT2 and FUS3/KSS1 in other fungi (Cano Dominguez et al., 2008; Seg muller et al., 2008). Intriguingly, expression of FUS3 gene and phosphorylation of FUS3 MAPK were elevated in the AaNoxB mutant background. Fungal cells might be compensating for the absence of NoxB by elevating expression of its partner genes. Both FUS3 and PKA reg may play a role in conidia maturation. The AaFUS3 or PKA reg deficient mutants never produce fully developed conidia, instead produce highly melanized segments, with distinct septae that often expanded into globular swellings and occur in chains (Lin et al., 2010; Tsai et al., 2013). Interconnected regulation between the MAPK and cAMP/PKA signaling pathways have also been implicated in governing conidia germination in B. cinerea (Doehlemann et al., 2006), appressorium formation in M. oryzae (Xu a nd Hamer, 1996) and sclerotium formation in S. sclerotiorum (Chen and Dickman, 2005).

PAGE 94

94 Figure 4 1. Reduced pigmentation and conidiation in NoxA mutant of A. alternata (A) Morphological appearance of the wild type (WT) and tw o NoxA mutants (DN2 and DN6) grown on PDA. (B) Quantitative analysis of conidia produced by the WT, NoxA mutants and the genetically reverted strain CpA16. (C) Images of conidia under light microscope. NoxA mutants produce light colored conidia with less d istinct septae. Only representative replicates are shown. Bar = 20 M

PAGE 95

95 Figure 4 2. Conidia produced by the wild type strain (WT), the strains lacking AaNoxB and the complementation strain CpB24 of A. alternata (A) Conidiatio n was evaluated by growing the wild type (WT), two NoxB mutants ( noxB5 and noxB6 ) and a complementation strain CpB24 on PDA plates in the light for 3 days. (B) Quantification of conidia. Each column represents the mean number of conidia the standard devi ation from two independent experiments, with at least three replicates. (C) Images of conidia. NoxB mutants fail to produce conidia. Only representative replicates are shown. Bar = 20 M

PAGE 96

96 Figure 4 3. Conidia produced by the w ild type strain (WT), the strains lacking AaNoxR and the complementation strain CpR40 of A. alternata. (A) Conidiation was evaluated by growing the wild type (WT), two NoxR mutants ( noxR2 and noxR5 ) and a complementation strain CpR40 on PDA plates in the l ight for 3 days. (B) Quantification of conidia. Each column represents the mean number of conidia the standard deviation from two independent experiments, with at least three replicates. (C) Images of conidia. Only representative replicates are shown. Ba r = 20 M

PAGE 97

97 Figure 4 4. Sensitivity assays of the A. alternata strains carrying a single Nox gene mutation (noxA, noxB and noxR), the corresponding rescued strains (CpA16, CpB24 and CpR40) and the NoxA NoxB (noxAB) and NoxA No xR (noxAR) double mutant strains to the (A) cell wall targeting compounds sodium dodecyl sulphate (SDS), calcofluor white (CFW) and Congo red (CR), as well as (B) vinclozolin and fludioxonil fungicides. Fungal strains were grown on PDA amended with or with out chemicals for 3 to 6 days. The percentage change in radial growth was calculated as the percentage of growth of th e genetically modified fungal strains in relation to the wild type grown on the same plate. T he data presented are the means and standard errors of two independent mutant s with at least two replicates of two independent experiments ( n = 8). For each test compound, means indicated by the same letter within a test compound are not significantly different from one another, P )

PAGE 98

98 Figure 4 5. Quantification of chitin in the cell wall obtained from the wild type (WT), the strains carrying single Nox gene mutation (noxA, noxB and noxR), the rescued strains (CpA16, CpB24 and CpR40) and the NoxA NoxB (noxAB) and NoxA NoxR ( noxAR) double mutant strains of A. alternata Means indicated by the same letter are not significantly different from one another, P )

PAGE 99

99 Figure 4 6. Images of RNA blotting. Fungal RNA was purified from the wild type of A. alternata (WT), (A) from the NoxB mutants (B5, B6), the NoxB rescued strain (CpB24), (B) from the FUS3 mutants (D1, D2) and the FUS3 rescued strain (CpF), (C) from the PKA cat mutants (Cd3, Cd19) and the PKA cat rescued strain (Cp31), and (D ) from the PKA reg mutants (Rd2, Rd7) and the PKA reg rescued strain (Cp5) of A. alternata RNA was electrophoresed, blotted and hybridized to gene specific probes as indicated.

PAGE 100

100 Figure 4 7. Immunological detection of the AaFUS 3 protein in A. alternata Fungal proteins were purified from wild type (WT), two AaNoxB mutants (B5 and B6) and the genetic ally rescued strain (CpB24) grown on complete medium (CM) for 3 days. Proteins were fractionated in a denaturing 12% SDS polyacrylam ide gel, electroblotted onto a nitrocellulose membrane, and probed with anti phospho p44/42 monoclonal or anti FUS3 polyclonal antibody.

PAGE 101

101 CHAPTER 5 GLUTATHIONE PEROXIDASE MEDIATED OXIDATIVE STRESS RESISTANCE IS REGULATED BY NADPH OXIDASE IN Alternaria alt ernata Introduction All cells have effective mechanisms to protect themselves against toxic reactive oxygen species ( ROS ) Studies with A. alternata have demonstrated that both YAP1 and HOG1 are essential for cellular resistance to oxidative stress induced by H 2 O 2 and several superoxide generating compounds (KO 2 menadione and diamide) and for pathogenicity in citrus (Lin et al., 2009; Lin and Chung, 2010). In earlier chapters it was demonstrated that Nox plays a dual role in ROS production and resistanc e a nd that Nox regulates the expression of YAP1 and HOG1 in A. alternata Thus, A. alternata has evolved sophisticated mechanisms for cellular protection against the toxicity of ROS. The A. alternata YAP1 is invo l ved in detoxification of H 2 O 2 and perhaps othe r oxidants through the regulation of catalase, superoxide dismutase (SOD), glutathione S transferase, glutathione peroxidase (GPx), glutathione reductase and ligninolytic peroxidase (Lin et al., 2011) The results suggest that the glutathione system might play an important role in the regulation of redox homeostasis and oxidative resistance in A. alternata In eukaryotic cells, glutathione (GSH) dependent GPx is one of the primary defen s es against the toxicity of peroxides. The tripeptide g lutathione ( L g l utamyl L cysteinyl glycine ) containing a free sulfhydryl group is an electron donor for GPx, which catalyzes reduction of H 2 O 2 to water. GSH is concomitantly oxidized to glutathione disulfide (GSSG), which is then recycled back to GSH by glutathione reduc t a se using NADPH as an electron donor (Meister and Anderson, 1983). Cells need to maintain a highly reduced environment; cells are under oxidative stress as the ratio of GSH to

PAGE 102

102 GSSG decreases (Schafer and Buettner, 2001; Blokhina et al., 2003). The budding yeast S cerevisiae has three GPx genes ( GPx1 GPx2 and GPx3 ) homologous to mammalian GPx (Inoue et al., 1999). Unlike its counterpart in mammalian, the yeast GPx lacks selenium in the active sites (Mullenbach et al., 1987). The S cerevisiae GPx3 also te rmed Sc HYR1 (hydrogen peroxide resistance), is constitutively expressed regardless of the presence of oxidants. In contrast, GPx1 is induced by glucose depletion and GPx2 is induced by H 2 O 2 and tert butyl hydroperoxide in a YAP1 dependent manner. The GPx3 mutant is hypersensitive to peroxides, whereas GPx1 and GPx2 single mutants and GPx1 GPx2 double mutants do not show obvious phenotypes. GPx3 functions as redox transmitter for YAP1. In the presence of peroxides, ScHYR1/GPx3 is oxidized at Cys 36 to form a cysteine sulfenic acid ( SOH), which then forms an intermolecular disulfide bond with Cys 598 of Y AP 1 The activated YAP1 subsequently triggers expression of the genes required for resistance to oxidative stress. YAP1 has also been known to regulate cellu lar ROS homeostasis and the synthesis of gluthathione (Inoue et al., 1999; Delaunay et al., 2002). In the human pathogenic fungus C ryptococcus neoformans GPx1 and GPx2 are required for resistance to peroxides but play no role in virulence (Missall et al., 2005). In the rice blast pathogen M oryzae a yeast GPx3/HYR1 homolog is required for H 2 O 2 resistance in vitro and in planta and plays a role in fungal virulence (Huang et al., 2011). In this c hapter, a HYR1/GPx3 gene homolo g designated AaGPx ( A a lter nata glutathione peroxidase ) was characterized in order to understand further the molecular mechanisms involved in cellular response to oxidative stress in the tangerine pathotype of A. alternata G enetic evidence is provided to define the central role of AaGPx in the

PAGE 103

103 development of conidia, resistance to peroxides and virulence. These s tudies also reveal that AaGPx plays a negative role in chitin accumulation. This phenotype has not been previously identified in any f ungus to my knowledge Expression of Aa GPx is coordinately regulated by NADPH oxidase, YAP1 and HOG1. The results derived from this dissertation research further support the important role of ROS detoxification during A. alternata pathogenesis in citrus. Materials and Methods Fungal Strains and Chemical Sensitivity Tests Fungal strains and their genotypes used in this study are given in Table A 1 The wild type EV MIL31 strain of A alternata and t he genetically altered strains altered in Nox components have been described in Chapter s 2 and 3. F ungal mutants impaired for the AaAP1 or the AaHOG1 gene were created in separate studies (Lin et al., 2009; Lin and Chung, 2010). Fungal strains were grown on PDA at 28 C. Assays for chemical sensitivity were performed as described in Chapter 3. Molecul ar Cloning and Sequence Analysis All oligonucleotide primers used in this study are compiled in Table B 1 A 2.2 kb DNA fragment containing the entire AaGPx untranslated region s was amplified from genomic DNA of A. alternata by PCR wi th primers GPx 1F and GPx 1R. Bioinformatics using on line software were carried out as described in Chapter 2. AaGPx sequence can be retrieved from the GenBank/EMBL Data Libraries under Accession No. ACY73852. AaGPx Gene Inactivation AaGPx gene was disru pted in the wild type EV MIL31 strain as described in Chapter 2 Split marker fragments were jointed and amplified by two round PCR. A 2.1

PAGE 104

104 GPx ::PHY fusion fragment (0.9 + 1.2 kb) was amplified with the primers GPx 1F M13R :GPx M13R and hyg3. A 2. 7 kb GPx ::YGT fusion fragment ( 0.9 + 1.8 kb) was amplified with the primers hyg4, M13F, M13F: GPx and GPx 1R (Fig. 5 2A ). Preparation and transformation of fungal protoplasts were conducted as previously described (Chung et al., 2002). Transformants recovered from hygromycin containing medium were tested for H 2 O 2 sensitivity and analyzed by PCR and Northern blotting. A GPx gene specific probe used for Northern blotting was labeled with DIG and amplified by PCR with the primers GPx 2F and GPx 2R. A functional G Px gene under control of its endogenous promoter were amplified with the primers GPx 1F and GPx 1R and co transformed into protoplasts prepared from an AaGPx mutant with the pCB1532 plasmid for genetic complementation. Miscellaneous Procedures used for i solation of fungal genomic DNA and RNA, purification of plasmids, Northern blot analyses, quantification of conidia and chitin as well as assays for fungal virulence were performed as described in the previous chapters. The significant differences compared with wild type were determined by student t test ( P 0.05 ). Results Cloning and Characterization of AaGPx Sequence analysis revealed that the A. alternata GPx gene ( AaGPx ) contains a 669 bp ORF interrupted by two introns (58 and 104 bp) and encodes 168 a mino acids. AaGPx contains a glutathione peroxidase active site ( GKvVLVvNTaSkCGfT ; a.a. 27 42 ) and a glutathione peroxidase signature ( IGFPCNQF ; a.a. 68 7 3 ) (Fig. 5 1A). BlastP search and alignment using CLUSTALW revealed these domains are highly conserved

PAGE 105

105 among filamentous fungi (Fig. 5 1B). AaGPx is most similar to the GPx1 of Pyrenophora tritici repentis (96% similarity and 92% identity). AaGPx displays strong similarity to GPx or HYR1 homologs of filamentous fungi and yeasts ( 74 to 92%) (Table 5 1). AaG Px contains three conserved cysteines, in which two of them Cys39 and Cys88 correspond to Cys36 and Cys82 in the active sites of yeast HYR1. T argeted Disruption of AaGPx Transformation of two truncated but overlapping HYG fragments (Fig. 5 2A) into protopl asts of A. alternata recovered 36 transformants from medium containing hygromycin. Two strains (GPx10 and GPx22) displayed reduced growth by 12% 16% on PDA and increased sensitivity to H 2 O 2 PCR diagnosis (Fig. 5 2B) with multiple sets of primers confirmed targeted disruption of AaGPx in the genome of A. alternata Hybridization of fungal RNA to an AaGPx specific probe identified a 0.5 kb AaGPx gene transcript from the wild type, but not from GPx10 and GPx22 strains (Fig. 5 2C), indicat ing that the two tran sformants are AaGPx null mutants. Aa GPx Is R equired for Conidia Formation and Fungal V irulence The w ild type formed heavily melanized colonies and AaGPx mutants formed light brown colonies when grown on PDA in the light (Fig. 5 3A ). AaGPx mutants were redu ced in conidiation by 98% (Fig. 5 3B ). AaGPx mutants produced less melaniz ed conidia compared to the wild type (Fig. 5 3C ). Introduction and expression of a functional copy of AaGPx in a mutant fully restored conidiation. The wild type strain of A. alterna ta induced necrotic lesions on all inoculated spots (100%) at 3 days after inoculation (Fig. 5 4A ). A aGPx mutants produced lesions on detached citrus leaves at frequencies ranging from 64% to 82%. The lesions induced by the AaGPx mutants were significantly smaller than those induced by the wild type

PAGE 106

106 (Fig. 5 4B ). T he genetically complemented strain CpGPx16 induced necrotic lesions on calamondin leaves at frequencies and magnitudes simil ar to those induced by the wild type AaGPx C ontributes to Resistance to Oxidative S tress A. alternata GPx mutants exhibited reduced growth on PDA by 14 5 % relative to the wild type (Fig. 5 5). They were highly sensitive to the oxidants H 2 O 2 Cumyl H 2 O 2 tert butyl hydroperoxide (tBH), and the superoxide generating compounds menadione (MND) and potassium superoxide (KO 2 ). AaGPx mutants also displayed increased sensitivity to diamide, as well as the singlet oxygen generating compounds hematoporphyrin (HP) and rose Bengal (RB). The p henotypes were fully restored in the CpGPx16 strain. Aa GPx Is I nvolved in C hitin B iosynthesis The wild type strain exhibited reduced growth by 36 to 50% on medium amended with calcofluor white ( CFW) or C ongo red (CR) (Fig. 5 5 ). B oth GPx10 and GPx22 mutants were moderately sensitive to SDS, but displ ayed increased resistance to CFW anf CR. The genetically rescued strain CpGPx16 displayed sensitivity to SDS, CFW or CR at levels similar to that of wild type. Fungal strains defective for GPx had significantly higher chitin content compared with the level s me asured in the wild type (Fig. 5 6 ). T he chitin content detected in the genetically rescued strain CpGPx16 was not significan tly different from that of wild type. Expres sion of AaGPx Is R egulated by NOX, YAP1 and HOG1 The expression of AaGPx was nearly abolished in the NoxA mutants (Fig. 5 7A ). Expression of the AaGPx gene transcript was down regulated in fungal strains lacking NoxB or NoxR as well as in double mutant strains NoxA NoxB or NoxA NoxR Re

PAGE 107

107 introduction of a functional copy of the Nox gene i nto the respective single mutation strain restored the expression of the AaGPx Similarly, Yap1 or Hog1 mutants had reduced levels of the AaGPx gene transcript, compared with the levels detected in the wild type and the complementation CpY strain (Fig. 5 7 B ). There was no difference in the expression of the Yap1 gene among the wild type, the GPx mutant and the complementation strain (Fig. 5 7C ). Discussion In this c hapte r, a glutathione peroxidase homolog, AaGPx was functionally characterized in the tanger ine pathotype of A. alternata Through analyses of a loss of function mutation in AaGPx gene, it was demonstrated that the AaGPx is required for resistance to oxidative stress and full virulence. AaGPx contains a glutathione peroxidase active site and a gl utathione peroxidase signature, conserved domains commonly found in glutathione dependent peroxidase homologs of fungi. Two cysteines Cys39 and Cys88 found in AaGPx are likely essential for H 2 O 2 detoxification as demonstrated in the yeast ScHYR1 (Delauna y et al., 2002; Zhang et al., 2008). The Cys36 residue in ScHYR1 has been shown to be required for YAP1 oxidation and Cys82 essential for peroxidase activity (Inoue et al., 1999). The yeast ScHYR1 is primarily responsible for H 2 O 2 and tBH resistance. AaGPx appears to be required for cellular resistance to a broad range of oxidants including H 2 O 2 organic peroxides (Cumyl H 2 O 2 and tBH), superoxide generating compounds (MND, KO 2 and diamide), as well as singlet oxygen generating compounds (HP and RB). The C neoformans GPx1 mutant is sensitive to tBH and GPx2 mutant displays sensitivity to Cumyl H 2 O 2 However, the C. neoformans strain impaired for GPx1, GPx2

PAGE 108

108 or both displays wild type sensitivity to H 2 O 2 (Missall et al., 2005). These results suggest that th e conserved GPx homologs have divergent roles in different fungi. AaGPx mutant is hypersensitive to ROS and produces smaller lesions on citrus leaves, confirming that effective ROS scavenging function is required for pathogenesis of A. alternata MoHYR1 me diated resistance to ROS is also required for full virulence in M. oryzae (Huang et al., 2011). In contrast, both GPx1 and GPx2 of C. neoformans are dispensable for virulence in mice (Missall et al., 2005). The expression of the AaGPx gene is co regulated by AaNOX, AaAP1 and AaHOG1. In S. cerevisiae only expression of the GPx2 gene is regulated by YAP1 (Inoue et al., 1999). However, deletion of MoHYR1 in M. oryzae down regulates YAP1 (Huang et al., 2011). Inactivation of GPx YAP1 or HOG1 in A. alternata r esults in fungal strains that are hypersensitive for ROS but defective in virulence at varying degrees. AaAP1 and AaHOG1 mutants are almost non pathogenic to citrus. AaGPx mutant is reduced in virulence, producing fewer and smaller lesions than wild type w hen inoculated onto citrus leaves. Similar results were observed in M. oryzae in which the MoAP1 mutant is severely defective in pathogenicity whereas the MoHYR1 mutant is reduced in virulence on both barley and rice (Guo et al., 2011; Huang et al., 2011) A. alternata mutant strains impaired for AaGPx or AaNoxB show similar phenotypes in terms of conidiation and resistance to cell wall targeting compounds CFW and CR. In addition, both GPx and Aa NoxB mutants accumulate higher chitin content than wild type, suggesting that AaGPx and AaNoxB play a negative role in cell wall integrity. In contrast, the M. oryzae MoHYR1 plays little or no role in fungal

PAGE 109

109 development, as the MoHYR1 mutants show wild type growth, conidiation, and format ion of germ tube s and appres sor ia (Huang et al., 2011). In conclusion, NOX is one of key regulators in the production of ROS and for signa l transductions leading to proper conidiation, fungal virulence, and cellular resistance to ROS and multidrug in A. alternata These regulatory fu nctions of AaNox conferring ROS resistance are likely governed partially by activati ng the AaAP1, AaHOG1 and AaGPx genes. Maintaining ROS homeostasis in cells is critical for many physiological and developmental processes. T he ability of ROS detoxification mediated by the redox responsive transcription regulator Y AP 1, the H OG 1 MAP kinase, the NADPH oxida s e and the GPx is absolutely required for A. alternata survival and pathogenesis. Lastly, a complex regulatory network involving NOX, G protein, cAMP depend ent protein kinase A, FUS3 MAP kinase and/or GPx is required for proper fungal development.

PAGE 110

110 Figure 5 1. Functional domains of AaGPx identified in the tangerine pathotype of A. alternata (A) AaGPx contains two glutathione peroxidase domains commonly f ound in the GPx/HYR1 of fungi and yeasts. (B) Alignment of the deduced amino acid sequence of AaGPx with other GPx/HYR1 homologs. Co nserved amino acids are shaded. Alignment was obtained by BioEdit using CLUSTALW. Conserved glutathione peroxidase active si te and signature domains are boxed. Asterisks indicate conserved cysteine residues.

PAGE 111

111 Figure 5 2. Targeted disruption of AaGPx in Alternaria alternata (A) Schematic illustration of a split marker strategy for disruption of AaGPx by inserting a hygromyci n phosphotransferase gene ( HYG ) under control of the Aspergillus nidulans trpC promoter and terminator. Oligonucleotide primers used to amplify each fragment are also indicated. (B) Image of DNA fragments amplified from genomic DNA of different fungal stra ins with the primers indicated. (C) Image of an RNA gel blotting, probed with a DIG labeled AaGPx showing a 0.5 kb transcript from the wild type strain (WT) but not from two AaGPx disruption mutants (GPx10 and GPx22). Ribosomal RNA stained with ethidium b romide shows relative loading of the RNA samples.

PAGE 112

112 Figure 5 3. Reduced pigmentation and conidiation observed in the GPx mutants of A. alternata (A) Conidiation wa s evaluated by growing the wild type (WT), two GPx mutants (GPx10, GPx22) and a complement ation strain CpGPx16 on PDA plates in the light for 3 days. (B) Quantification of conidia. Each column represents the mean number of conidia the standard deviation from two independent experiments, with at least three replicates. (C) Images of conidia. G Px mutants produced less melanized conidia compared to the wild type and CpGPx16. Only represent ative replicates are shown. Bar = 20 M

PAGE 113

113 Figure 5 4. AaGPx mutants displayed reduced virulence. (A) Fungal pathogenicity was assayed on detached calamondi n leaves inoculated with 5 L of conidial suspension (10 4 conidia /mL) prepared from A. alternata wild type (WT), GPx disrupted mutants (GPx10 and GPx22) and complementation strain CpGPx16. The mock control was treated with water only. Photos were taken 3 days after inoculation. Only some representative replicates are shown. (B) Quantification of the mean size of necrotic lesions induced by wild type, GPx mutants and CpGPx16 strain. Asterisks indicate a significant difference as determined by a test, P D isease incidence, defined by the number of inoculated leaf spots developing necrotic lesions relative to the total number of spots inoculated, is also indicated.

PAGE 114

114 Figure 5 5. Assays for c hemical sensitivity of the wild type (WT), two A aGPx mutants (10 and 22) and a complementation strain Cp16 of A. alternata Mutational inactivation of AaGPx resulted in fungal strains that display hypersensitivity to oxidants and increased resistance to cell wall targeting compounds. Sensitivity (percen tage growth reduction) or resistance (percentage growth increase) was calculated as cumulative percentage of growth of WT and AaGPx mutants grown on the same plate. Re introduction and expression of a functional copy of AaGPx in the GPx10 mutant resulted i n CpGPx16 strain with restored phenotypes. All tests were repeated at least twice with multiple replicates of each treatment. Only representative replicates are shown. tBH, tert butyl hydroperoxide ; MND, menadione; HP, h ematoporphyrin ; RB, rose Bengal; SDS sodium dodecyl sul f ate; CFW, calcofluor white; CR, C ongo red.

PAGE 115

115 Figure 5 6. Quantification of chitin in the c ell wall obtained from the wild type (WT), the strains carrying GPx gene mutation (GPx10 and GPx22) and the genetic ally rescued strain CpGPx16 of A. alternata Asterisks indicate significant difference compared with wild type by student t test, P 5

PAGE 116

116 Figure 5 7. Images of RNA blotting. (A) Expression of AaGPx in wild type (WT) and mutant strains impaired fo r NoxA NoxB or NoxR (B) Expression of AaGPx in the Yap1 mutants (Y1, Y2) the rescued strain CpY and in the Hog1 mutants (H1, H2). (C) Expression of Yap1 in WT and two AaGPx mutants (GPx10, GPx22) and genetic reverted strain Cp16. Fungal RNA, was electr ophoresed in formide containing gels, blotted to nylon membrane and hybridized with DIG labeled probe as indicated. Gels staining with ethidium bromide indicate relative loading of the RNA samples.

PAGE 117

117 Table 5 1. A. alternata GPx is highly similar to other GP x/HYR1 homologs of fungi and yeast ORGANISM Protein Accession Similarity (%) Identity (%) Alternaria alternata GPx ACY73852 100 100 Pyrenophora tritici repentis GPx 1 XP_001940175 96 92 Leptosphaeria maculans JN3 GPx XP_003842197 92 83 Aspergillus terre us NIH2624 GPx XP_001213339 86 74 Neurospora crassa OR74A HYR1 XP_957919 86 72 Botryotinia fuckeliana B05.10 GPx XP_001559367 85 68 Magnaporthe oryzae HYR1 XP_003711364 84 70 Sclerotinia sclerotiorum 1980 GPx XP_001598652 84 70 Epichlo festucae GPx A GC94642 82 73 Saccharomyces cerevisiae GPX3/HYR1 NP_012303 74 56 Homo sapiens GPx3 AAH13601 37 25

PAGE 118

118 APPENDIX A GENOTYPE OF Alternaria alternata STRAINS Table A 1. Genotypes of Alternaria alternata strains used in this study Strain Genotype WT Wild type of Alternaria alternata AaNoxA (DN2 and DN6) AaNoxA disruptant CpA16 AaNoxA complementation AaNoxB (DB5 and DB6) AaNoxB disruptant CpB24 AaNoxB complementation AaNoxR (DR2 and DR5) AaNoxR disruptant CpR40 AaNoxR complementation NoxA NoxB (NoxAB1 an d NoxAB6) NoxA NoxB double mutant NoxA NoxR (NoxAR2 and NoxAR3) NoxA NoxR double mutant Yap1 (Y1 and Y2) AaYap1 disruptant CpY AaYap1 complementation Hog1 (H1 and H2) AaHog1 disruptant AaFUS3 (D1 and D2) FUS3 MAP kinase mutant CpF FUS3 complementati on AaPKA cat (Cd3 and Cd19) cAMP dependent protein kinase A (PKA) catalytic subunit mutant Cp31 AaPKA cat complementation AaPKA reg (Rd2 and Rd7) cAMP dependent protein kinase A (PKA) regulatory subunit mutant Cp5 AaPKA reg complementation AaGPx (GPx10 an d GPx22) AaGPx disruptant CpGPx16 AaGPx complementation

PAGE 119

119 APPENDIX B PRIMER SEQUENCE Table B 1 Sequence of oligonucleotide primers used in this study Primer name Sequence Gene M13R AGCGGATAACAATTTCACACAGGA HYG M13F CGCCAGGGTTTTCCCAGTCACGAC HYG hyg3 GGATGCCTCCGCTCGAAGTA HYG hyg4 CGTTGCAAGACCTGCCTGAA HYG NOXf1 GAGACCTTYTGGTACACTCAYC NoxA NOXr1 GATYTCGTTCTCRAAGACGTC NoxA NoxA pro2F TGAGACGCTCTTCACACACTAGCTG NoxA NoxA:M13R TCCTGTGTGAAATTGTTATCCGCT GGCGGA CCTGCACACGTTCAACA HYG NoxA M13F:NoxA GTCGTGACTGGGAAAACCCTGGCG TCAAGTCGGTGACTTTACCCGC HYG NoxA NoxA TAA TTAGAAATGCTCCTTCCAGAACTTGA NoxA NoxA ATG ATGGGAGCAAGCGGAGGCAC NoxA NoxA:Sur1 CGGTGAATCCAGCCGGGAGATGTGGGGCACGGCGGACCTGCACACG TTCAACA Sur NoxA Sur2:NoxA GATTATTGCACGGGAATTGCATGCTCTCACGTTCAAGTCGGTGACTTTACCCG Sur NoxA S ur1 5 GTGCCCCACATCTCCCGGCTGGATTCACCG 3 Sur S ur2 5 ACGTGAGAGCATGCAATTCCCGTGCAATAATC 3 Sur S ur F 5 ACTCCCATGGCCGACGCTCT 3 Sur SurR 5 CGAAGCAACGTC GCCCTCAA 3 Sur NoxB 3F CGCGAGCGGTCAAGATGGC NoxB M13R:NoxB TCCTGTGTGAAATTGTTATCCGCT CGACATACCTGTCCAGCAC HYG NoxB M13F:NoxB GTCGTGACTGGGAAAACCCTGGCG GCG AGAAGGGTGAGAAGG HYG NoxB NoxB TAG CTAGAAGTTCTCCTTGCCCCATACG NoxB NoxB pro1F GGTGGGCTTGAATAGTCGCAAGC NoxB NoxB pro2F GCTCTGCCATTTCGCATGGC NoxB NoxB 1F GTACTGGATGTACGGTGGATTTGC NoxB NoxB 2F CATCCTCTTTCCAGTATGCAGGAAC NoxB NoxB 1R ATACCAGCACCACAGAGAACGGC NoxB p67f1 AGGARATHGARACNTGGGT NoxR p67 r1 TARCANAGACCNCGRTTRAA NoxR NoxR pro1F AGACCTCAAACGCCATCACTCG NoxR NoxR pro2F CCAACTGTGCCTTAATTCCCACAC NoxR

PAGE 120

120 Table B 1. Continued Primer name Sequence Gene M13R:NoxR TCCTGTGTGAAATTGTTATCCGCT AGTTTGAGACGCCCTGTTGG HYG NoxR M13F: NoxR GTCGTGACTGGGAAAACCCTGGCGGC GAGAAGGGTGAGAAGG HYG NoxR NoxR tail CGTTCGTAAATATGCGTGATGCTG NoxR NoxR ATG ATGTCTCTGAAGCAGGTGCGCTC NoxR GPx1F TGTATTGTCACCATTACCCGCCG GPx GPx2F CCCAGTTCGAGGGTCTGGAGA GPx GPx:M13R TCCTGT GTGAAATTGTTATCCGCT TCGAGGCGGTGTTTACGACGA HYG GPx M13F:GPx GTCGTGACTGGGAAAACCCTGGCGGCG GCCTCAAGCGCGTAAAGTGGAAC HYG GPx GPx1R GCTTCGTCGGCTGTCCTGAAGA GPx GPx2R CGCAATCATTCCAAACTCGCG GPx

PAGE 121

121 LIST OF REFERENCES Aebi, H. (1984). Catalase in vitro. Methods E nzymol 105 : 121 126. Aguirre, J., and Lambeth, J.D. (2010). Nox enzymes from fungus to fly to fish and what they tell us about Nox function in mammals. Free Radical Bio. Med. 49: 1342 1353. Aguirre, J., Rios Momberg, M., Hewitt, D., a nd Hansberg, W. (2005). Reactive oxygen species and development in microbial eukaryotes. Trends M icrobiol. 13: 111 118. Akimitsu, K., Kohmoto, K., Otani, H., and Nishimura, S. (1989). Host s pecific e ffects of t oxin from the r ough l emon p athotype of Altern aria alternata on m itochondria. Plant Physiol 89 : 925 931. Akimitsu, K.A., Peever, T.L., and Timmer, L.W. (2003). Molecular, e cological and evolutionary approaches to understanding Alternaria diseases of citrus. Mol Plant Pathol. 4: 435 446 Apel, K., and Hirt, H. (2004). R eactive o xygen s pecies : Metabolism, oxidative stress, and signal t ransduction. Annu. Rev. Plant Biol. 55: 373 399. Audenaert, K., Callewaert, E., Hofte, M., De Saeger, S., and Haesaert, G. (2010). Hydrogen peroxide induced by the fun gicide prothioconazole triggers deoxynivalenol (DON) production by Fusarium graminearum BMC M icrobiol 10: 112 125 Auh, C.K., and Murphy, T.M. (1995). Plasma m embrane r edox e nzyme i s i nvolved in the s ynthesis of O 2 and H 2 O 2 by p hytophthora e licitor s ti mulated r ose c ells. Plant Physiol 107 : 1241 1247. Babior, B.M. (1999). NADPH oxidase: A n update. Blood 93 : 1464 1476. Babior, B.M., Lambeth, J.D., and Nauseef, W. (2002). The neutrophil NADPH oxidase. Arch Biochem. Biophys. 397 : 342 344. Bartosz, G. ( 2009). Reactive oxygen species: D estroyers or messengers? Biochem P harmacol. 77 : 1303 1315. Bedard, K., and Krause, K.H. (2007). The NOX family of ROS generating NADPH oxidases: P hysiology and pathophysiolog y. Physiol. R ev. 87 : 245 313. Bindschedler, L. V., Dewdney, J., Blee, K.A., Stone, J.M., Asai, T., Plotnikov, J., Denoux, C., Hayes, T., Gerrish, C., Davies, D.R., Ausubel, F.M., and Bolwell, G.P. (2006). Peroxidase dependent apoplastic oxidative burst in Arabidopsis required for pathogen resistance. P lant J 47: 851 863.

PAGE 122

122 Blokhina, O., Virolainen, E., and Fagerstedt, K.V. (2003). Antioxidants, oxidative damage and oxygen depriv a tion stress: a review. Ann. B ot. 91: 179 194. Bloomfield, G., and Pears, C. (2003). Superoxide signalling required for multice llular development of Dictyostelium J Cell S ci. 116: 3387 3397. Bolker, M. (1998). Sex and crime: H eterotrimeric G proteins in fungal mating and pathogenesis. Fungal Genet Biol 25: 143 156. Bolwell, G.P., Bindschedler, L.V., Blee, K.A., Butt, V.S., D avies, D.R., Gardner, S.L., Gerrish, C., and Minibayeva, F. (2002). The apoplastic oxidative burst in response to biotic stress in plants: A three component system. J Exp. B ot. 53: 1367 1376. Brisson, L.F., Tenhaken, R., and Lamb, C. (1994). Function of o xidative c ross l inking of c ell w all s tructural p roteins in p lant d isease r esistance. Plant C ell 6: 1703 1712. Brown, D.I., and Griendling, K.K. (2009). Nox proteins in signal transduction. Free R adical B io. M ed. 47 : 1239 1253. Brown, G.E., Stewart, M.Q. Bissonnette, S.A., Elia, A.E., Wilker, E., and Yaffe, M.B. (2004). Distinct ligand dependent roles for p38 MAPK in priming and activation of th e neutrophil NADPH oxidase. J. Biol. C hem. 279: 27059 27068. Brun, S., Malagnac, F., Bidard, F., Lalucque, H., and Silar, P. (2009). Functions and regulation of the Nox family in the filamentous fungus Podospora anserina : A new role in cellulose degradation. Mol M icrobiol. 74: 480 496. Cano Dominguez, N., Alvarez Delfin, K., Hansberg, W., and Aguirre, J. (2008). NADPH oxidases NOX 1 and NOX 2 require the regulatory subunit NOR 1 to control cell differentiation and growth in Neurospora crassa Eukaryotic C ell 7: 1352 1361. Catlett, N.L., Lee, B.N., Yoder, O.C., and Turgeon, B.G. (2003). Split marker recombination for efficient targeted deletion of fungal genes. Fungal Genet Newsl 50 : 9 11. Cayatte, A.J., Palacino, J.J., Horten, K., and Cohen, R.A. (1994). Chronic inhibition of nitric oxide production accelerates neointima formation and impairs endothelial funct ion in hypercholesterolemic rabbits. Arterioscler Thromb 14: 753 759. Chen, C., and Dickman, M.B. (2005). cAMP blocks MAPK activation and sclerotial development via Rap 1 in a PKA independent manner in Sclerotinia sclerotiorum Mol. M icrobiol. 55: 299 3 11.

PAGE 123

123 Chen, L.H., Lin, C.H., and Chung, K.R. (2012). Roles for SKN7 response regulator in stress resistance, conidiation and virulence in the citrus pathogen Alternaria alternata Fungal Genet Biol 49: 802 813. Chen, L.H., Lin, C.H., and Chung, K.R. (2013 ). A nonribosomal peptide synthetase mediates siderophore production and virulence in the citrus fungal pathogen Alternaria alternata Mol Plant Pathol. 14: 497 505. Chung, K.R. (2003). Involvement of calcium/calmodulin signaling in cercosporin toxin bio synthesis by Cercospora nicotianae Appl. Environ. Microbiol 69: 1187 1196. Chung, K.R. (2012). Stress response and pathogenicity of the n ecrotrophic fungal pathogen Alternaria alternata Scientifica 2012 : 1 17. Chung, K.R., Shilts, T., Li, W., and Timm er, L.W. (2002). Engineering a genetic transformation system for Colletotrichum acutatum the causal fungus of lime anthracnose and postbloom fruit drop of citrus. FEMS Microbiol. Lett. 213, 33 39. Cobb, N.A. (1903). Letters on the diseases of plants Alt ernaria of the citrus tribe. Agricultural Gazette of New South Wales 14: 955 986. Coleman, S.T., Epping, E.A., Steggerda, S.M., and Moye Rowley, W.S. (1999). Yap1p activates gene transcription in an oxidant specific fashion. Mol Cell. Biol. 19: 8302 8313 Cona, A., Rea, G., Angelini, R., Federico, R., and Tavladoraki, P. (2006). Functions of amine oxidases in plant de velopment and defence. Trends Plant Sci. 11: 80 88. Cross, A.R., and Segal, A.W. (2004). The NADPH oxidase of professional phagocytes pro totype of the NOX electron tra nsport chain systems. Biochim. Biophys. A cta 1657: 1 22. Dagdas, Y.F., Yoshino, K., Dagdas, G., Ryder, L.S., Bielska, E., Steinberg, G., and Talbot, N.J. (2012). Septin mediated plant cell invasion by the rice blast fungus, M agnaporthe oryzae Science 336 : 1590 1595. Daub, M.E., Herrero, S., and Chung, K.R. (2013). Reactive o xygen s pecies in p lant p athogenesis: The r ole of p erylenequinone p hotosensitizers. Antioxid. Redox Sign. 1 9 : 970 989 de Lamirande, E., Lamothe, G., and Villemure, M. (2009). Control of superoxide and nitric oxide formation during human sperm capacitation. Free Radical Bio. Med. 46: 1420 1427.

PAGE 124

124 Delaunay, A., Isnard, A.D., and Toledano, M.B. (2000). H 2 O 2 sensing through oxidation of the Yap1 transcription factor. EMBO J. 19: 5157 5166. Delaunay, A., Pflieger, D., Barrault, M.B., Vinh, J., and Toledano, M.B. (2002). A thiol peroxidase is an H 2 O 2 receptor and redox transducer in gene activation. Cell 111: 471 481. Denness, L., McKenna, J.F., Segonzac, C., W ormit, A., Madhou, P., Bennett, M., Mansfield, J., Zipfel, C., and Hamann, T. (2011). Cell wall damage induced lignin biosynthesis is regulated by a reactive oxygen species and jasmonic acid dependent process in Arabidopsis. Plant Physiol 156: 1364 1374. Dickinson, D.A., and Forman, H.J. (2002). Cellular glutathione an d thiols metabolism. Biochem. Pharmacol. 64: 1019 1026. Diebold, B.A., and Bokoch, G.M. (2001). Molecular basis for Rac2 regulation of phagocyte NADPH oxidase. Nat. Immunol. 2: 211 215. D ivon, H.H., and Fluhr, R. (2007). Nutrition acquisition strategies during fu ngal infection of plants. FEMS Microbiol. Let t 266: 65 74. Doehlemann, G., Berndt, P., and Hahn, M. (2006). Different signalling pathways involving a G alpha protein, cAMP and a MAP kinase control germination of Botrytis cinerea conidia. Mol. Microbiol. 59: 821 835. Eaton, C.J., Jourdain, I., Foster, S.J., Hyams, J.S., and Scott, B. (2008). Functional analysis of a fungal endophyte stre ss activated MAP kinase. Curr. Genet. 53: 16 3 174. Edens, W.A., Sharling, L., Cheng, G., Shapira, R., Kinkade, J.M., Lee, T., Edens, H.A., Tang, X., Sullards, C., Flaherty, D.B., Benian, G.M., and Lambeth, J.D. (2001). Tyrosine cross linking of extracellular matrix is catalyzed by Duox, a multidoma in oxidase/peroxidase with homology to the phagocyte oxidase subunit gp91 phox J. Cell Biol. 154: 879 891. Egan, M.J., Wang, Z.Y., Jones, M.A., Smirnoff, N., and Talbot, N.J. (2007). Generation of reactive oxygen species by fungal NADPH oxidases is requir ed for rice blas t disease. Proc. Natl. Acad. Sci. US A 104: 11772 11777. Emri, T., Pocsi, I., and Szentirmai, A. (1997). Glutathione metabolism and protection against oxidative stress caused by peroxides in Penicillium chrysogenum Free Radical Bio. Med. 2 3: 809 814. Fairhead, C., Llorente, B., Denis, F., Soler, M., and Dujon, B. (1996). New vectors for combinatorial deletions in yeast chromosomes and for gap repair cloning using 'split marker' recombination. Yeast 12: 1439 1457.

PAGE 125

125 Fang, G.C., Hanau, R.M., a nd Vaillancourt, L.J. (2002). The SOD2 gene, encoding a manganese type superoxide dismutase, is up regulated during conidiogenesis in the plant pathogenic fungus Colletotrichum graminicola Fungal Genet Biol 36: 155 165. Foreman, J., Demidchik, V., Both well, J.H., Mylona, P., Miedema, H., Torres, M.A., Linstead, P., Costa, S., Brownlee, C., Jones, J.D., Davies, J.M., and Dolan, L. (2003). Reactive oxygen species produced by NADPH oxidase regulate plant cell growth. Nature 422: 442 446. Gardner, J.M., Ko no, Y., and Chandler, J.L. (1986). Bioassay and h ost s electivity of Alternaria Citri t oxins a ffecting r ough l emon and m andarins. Physiol. Mol. Plant Path ol 29: 293 304. Gerits, N., Kostenko, S., Shiryaev, A., Johannessen, M., and Moens, U. (2008). Relati ons between the mitogen activated protein kinase and the cAMP dependent protein kinase pathways: C om radeship and hostility. Cell. Signal. 20: 1592 1607. Giesbert, S., Schurg, T., Scheele, S., and Tudzynski, P. (2008). The NADPH oxidase Cpnox1 is required for full pathogenicity of the ergot fungus Claviceps purpurea Mol Plant Pathol 9: 317 327. Gilchrist, D.G., and Grogan, R.G. (1976). Production and n ature of a h ost s pecific t oxin from Alternaria a lternata f.sp. l ycopersici Phytopathology 66: 165 171. Glazebrook, J. (2005). Contrasting mechanisms of defense against biotrophic an d necrotrophic pathogens. Annu. Rev. Phytopathol. 43: 205 227. Grant, C.M., MacIver, F.H., and Dawes, I.W. (1996a). Glutathione is an essential metabolite required for resista nce to oxidative stress in the yeast Saccharomyces cerevisiae Curr. Genet. 29: 511 515. Grant, C.M., Collinson, L.P., Roe, J.H., and Dawes, I.W. (1996b). Yeast glutathione reductase is required for protection against oxidative stress and is a target gene for yAP 1 trans criptional regulation. Mol. Microbiol. 21: 171 179. Guo, M., Chen, Y., Du, Y., Dong, Y., Guo, W., Zhai, S., Zhang, H., Dong, S., Zhang, Z., Wang, Y., Wang, P., and Zheng, X. (2011). The bZIP transcription factor MoAP1 mediates the oxidativ e stress response and is critical for pathogenicity of the rice blast fungus Magnaporthe oryzae PLoS P athogens 7 : e1001302. Halliwell, B., and Gutteridge, J.M. (1992). Biologically relevant metal ion dependent hydroxyl radic al generation : An update. FEBS Lett. 307: 108 112.

PAGE 126

126 Hamann, T., and Denness, L. (2011). Cell wall integrity maintenance in plants: L essons to be learned from yeast? Plant Signal. B ehav. 6: 1706 1709. Hamann, T., Bennett, M., Mansfield, J., and Somerville, C. (2009). Identification of cell wall stress as a hexose dependent and osmosensitive regulator of plant responses. Plant J 57: 1015 1026. Hansberg, W., de Groot, H., and Sies, H. (1993). Reactive oxygen species associated with cell differentiation in Neurospora crassa Free Radical Bio. Med. 14: 287 293. Harrison, R. (2002). Structure and function of xanthine oxidoreductase: W here are we now? Free Radical Bio. M ed 33: 774 797. Heller, J., and Tudzynski, P. (2011). Reactive oxygen species in phytopathogenic fungi: S ignaling, de vel opment, and disease. Annu. Rev. Phytopathol. 49: 369 390. Herve, C., Tonon, T., Collen, J., Corre, E., and Boyen, C. (2006). NADPH oxidases in e ukaryotes: R ed algae provide new hints! Curr. Genet. 49: 190 204. Hu, X., Bidney, D.L., Yalpani, N., Duvick, J .P., Crasta, O., Folkerts, O., and Lu, G. (2003). Overexpression of a gene encoding hydrogen peroxide generating oxalate oxidase evokes defense responses in sunflower. Plant Physiol 133 : 170 181. Huang, K., Czymmek, K.J., Caplan, J.L., Sweigard, J.A., an d Donofrio, N.M. (2011). HYR1 mediated detoxification of reactive oxygen species is required for full virulence in the rice blast fungus. PLoS P athog 7 : e1001335. Inoue, Y., Matsuda, T., Sugiyama, K., Izawa, S., and Kimura, A. (1999). Genetic analysis of glutathione peroxidase in oxidative stress response of Saccharomyces cerevisiae J B iol Chem. 274: 27002 27009. Isshiki, A., Akimitsu, K., Yamamoto, M., and Yamamoto, H. (2001). Endopolygalacturonase is essential for citrus black rot caused by Alternar ia citri but not brown spot caused by Alternaria alternata Mol Plant Microbe Interact 14: 749 757. Ito, K., Tanaka, T., Hatta, R., Yamamoto, M., Akimitsu, K., and Tsuge, T. (2004). Dissection of the host range of the fungal plant pathogen Alternaria al ternata by modification of s econdary metabolism. Mol. Microbiol. 52: 399 411. Jamieson, D.J. (1998). Oxidative stress responses of the yeast Saccharomyces cerevisiae Yeast 14: 1511 1527.

PAGE 127

127 Jeong, J.S., Mitchell, T.K., and Dean, R.A. (2007). The Magnaporthe grisea snodprot1 homolog, MSP1, is required for virulence. FEMS Microbiol. Lett. 273: 157 165. Jiang, Z.Y., Woollard, A.C., and Wolff, S.P. (1990). Hydrogen peroxide production during experimental protein glycation. FEBS Lett. 268: 69 71. Katoh, H., Iss hiki, A., Masunaka, A., Yamamoto, H., and Akimitsu, K. (2006). A virulence reducing mutation in the postharvest citrus pathogen Alternaria citri Phytopathology 96: 934 940. Kawasaki, L., and Aguirre, J. (2001). Multiple catalase genes are differentially regulated in Aspergillus nidulans J. Bacteriol. 183: 1434 1440. Kehrer, J.P. (2000). The Haber Weiss reaction and mechanisms of toxicity. Toxicology 149: 43 50. Keller, T., Damude, H.G., Werner, D., Doerner, P., Dixon, R.A., and Lamb, C. (1998). A plant homolog of the neutrophil NADPH oxidase gp91 phox subunit gene encodes a plasma membrane protein with Ca 2+ binding motifs. Plant C ell 10: 255 266. Kennedy, K.A., Sandiford, S.D., Skerjanc, I.S., and Li, S.S. (2012). Reactive oxygen species and the neurona l fate. Cell Mol Life Sci 69 : 215 221. Kicka, S., Bonnet, C., Sobering, A.K., Ganesan, L.P., and Silar, P. (2006). A mitotically inheritable unit containing a MAP kinase module. Proc Natl Acad Sci USA 103: 13445 13450. Kiely, T.B. (1964). Brown sp ot o f Emperor mandarin. Agric Gaz of N S W 15 : 854 856. Kim, H.J., Chen, C., Kabbage, M., and Dickman, M.B. (2011). Identification and characterization of Sclerotinia sclerotiorum NADPH oxidases. Appl. Environ. Microbiol 77: 7721 7729. Kohmoto, K., Scheffer, R.P., and Whiteside, J.O. (1979). Host s elective t oxins from Alternaria c itri Phytopathology 69: 667 671. Kohmoto, K., Akimitsu, K., and Otani, H. (1991). Correlation of r esistance and s usceptibility of c itrus to Alternaria a lternata with s ens itivity to h ost s pecific t oxins. Phytopathology 81: 719 722. Kohmoto, K., Khan, I.D., Renbutsu, Y., Taniguchi, T., and Nishimura, S. (1976). Multiple h ost s pecific t oxins of Alternaria m ali and t heir e ffect on p ermeability of h ost c ells. Physiol. Plant Pa thol. 8: 141 153.

PAGE 128

128 Kohmoto, K., Itoh, Y., Shimomura, N., Kondoh, Y., Otani, H., Kodama, M., Nishimura, S., and Nakatsuka, S. (1993). Isolation and b iological a ctivities of 2 h ost s pecific t oxins from the t angerine p athotype of Alternaria a lternata Phytopat hology 83: 495 502. Kuck, U., and Hoff, B. (2010). New tools for the genetic manipulati on of filamentous fungi. Appl. Microbiol. Biot. 86: 51 62. Kuge, S., Jones, N., and Nomoto, A. (1997). Regulation of yAP 1 nuclear localization in re sponse to oxidativ e stress. EMBO J. 16: 1710 1720. Kuge, S., Toda, T., Iizuka, N., and Nomoto, A. (1998). Crm1 (XpoI) dependent nuclear export of the budding yeast transcription factor yAP 1 is sensitive to oxidative stress. Genes Cells 3: 521 532. Kwak, J.M., Mori, I.C., Pei, Z.M., Leonhardt, N., Torres, M.A., Dangl, J.L., Bloom, R.E., Bodde, S., Jones, J.D., and Schroeder, J.I. (2003). NADPH oxidase AtrbohD and AtrbohF genes function in ROS dependent AB A signaling in Arabidopsis. EMBO J. 22: 2623 2633. Lamb, C., and Dix on, R.A. (1997). The o xidative b urst in p lant d isease r esistance. Ann u. R ev P lant P hysiol P lant M ol B iol 48 : 251 275. Lambeth, J.D. (2004). NOX enzymes and the biol ogy of reactive oxygen. Nature Rev. 4: 181 189. Lara Ortiz, T., Riveros Rosas, H., and Aguirre, J. (2003). Reactive oxygen species generated by microbial NADPH oxidase NoxA regulate sexual development in Aspergillus nidulans Mol. Microbiol. 50: 1241 1255. Lardy, B., Bof, M., Aubry, L., Paclet, M.H., Morel, F., Satre, M., and Klein, G. (20 05). NADPH oxidase homologs are required for normal cell differentiation and morphogenesis in Dictyostelium discoideum Biochim. Biophys. A cta 1744: 199 212. Lev, S., Hadar, R., Amedeo, P., Baker, S.E., Yoder, O.C., and Horwitz, B.A. (2005). Activation of an AP1 like transcription factor of the maize pathogen Cochliobolus heterostrophus in response to oxidative stress and plant signals. Eukaryotic C ell 4: 443 454. Levin, D.E. (2005). Cell wall integrity signaling in Saccharomyces cerevisiae Microbiol. Mo l. Biol. Rev. 69: 262 291 Levin, D.E. (2011). Regulation of c ell w all b iogenesis in Saccharomyces cerevisiae : The c ell w all i ntegrity s ignaling p athway. Genetics 189: 1145 1175.

PAGE 129

129 Lin, C.H., and Chung, K.R. (2010). Specialized and shared functions of the h istidine kinase and HOG1 MAP kinase mediated signaling pathways in Alternaria alternata a filamentous fungal pathogen of citrus. Fungal Genet Biol 47: 818 827. Lin, C.H., Yang, S.L., and Chung, K.R. (2009). The YAP1 homolog mediated oxidative stress t olerance is crucial for pathogenicity of the necrotrophic fungus Alternaria alternata in citrus. Mol Plant Microbe Interact 22: 942 952. Lin, C.H., Yang, S.L., and Chung, K.R. (2011). Cellular responses required for oxidative stress tolerance, colonizat ion, and lesion formation by the necrotrophic fungus Alternaria alternata in citrus. Curr. Microbio l. 62: 807 815. Lin, C.H., Yang, S.L., Wang, N.Y., and Chung, K.R. (2010). The FUS3 MAPK signaling pathway of the citrus pathogen Alternaria alternata funct ions independently or cooperatively with the fungal redox responsive AP1 regulator for diverse developmental, physiological and pathogenic processes. Fungal Genet Biol 47 : 381 391. Malagnac, F., Lalucque, H., Lepere, G., and Silar, P. (2004). Two NADPH oxidase isoforms are required for sexual reproduction and ascospore germination in the filamentous fungus Podospora anserina Fungal Genet Biol 41 : 982 997. Martchenko, M., Alarco, A.M., Harcus, D., and Whiteway, M. (2004). Superoxide dismutases in Cand ida albicans : transcriptional regulation and functional characterization of th e hyphal induced SOD5 gene. Mol. Biol. C ell 15: 456 467. Martyn, K.D., Kim, M.J., Quinn, M.T., Dinauer, M.C., and Knaus, U.G. (2005). p21 activated kinase (Pak) regulates NADPH oxidase activation in human neutrophils. Blood 106: 3962 3969. Mayer, A.M., Staples, R.C., and Gil ad, N.L. (2001). Mechanisms of survival of necrotrophic fungal plant pathogens in hosts expressing the hypersensitive response. Phytochemistry 58: 33 41. M eister, A., and Anderson, M.E. (1983). Glutath ione. Annu. Rev. Biochem. 52: 711 760. Michan, S., Lledias, F., and Hansberg, W. (2003). Asexual development is increased in Neurospora crassa cat 3 null mutant strains. Eukaryotic C ell 2: 798 808. Michan, S. Lledias, F., Baldwin, J.D., Natvig, D.O., and Hansberg, W. (2002). Regulation and oxidation of two large monofunctional catalases. Free Radical Bio. Med. 33: 521 532.

PAGE 130

130 Mikami, Y., Nishijim.Y, Iimura, H., Suzuki, A., and Tamura, S. (1971). Chemical s tudies on b rown s pot d isease of t obacco p lants. Part 1 Tenuazonic a cid as a v ivotoxin of Alternaria l ongipes Agr. Biol. Chem. 35: 611 618 Missall, T.A., Cherry Harris, J.F., and Lodge, J.K. (2005). Two glutathione peroxidases in the fungal pathogen Cryptococ cus neoformans are expressed in the presence of specific substrates. Microbiology 151: 2573 2581. Mittler, R. (2002). Oxidative stress, antioxidants a nd stress tolerance. Trends Plant Sci. 7: 405 410. Mittler, R., Vanderauwera, S., Gollery, M., and Van B reusegem, F. (2004). Reactive oxygen gen e network of plants. Trends Plant Sci. 9: 490 498. Mittler, R., Vanderauwera, S., Suzuki, N., Miller, G., Tognetti, V.B., Vandepoele, K., Gollery, M., Shulaev, V., and Van Breusegem, F. (2011). ROS signaling: T he n e w wave? Trends Plant Sci. 16: 300 309. Molina, L., and Kahmann, R. (2007). An Ustilago maydis gene involved in H 2 O 2 detoxification is required for virulence. Plant C ell 19: 2293 2309. Moye Rowley, W.S. (2003). Regulation of the transcriptional response t o oxidative stress in fungi: similarities and differences. Eukaryotic cell 2: 381 389. Mullenbach, G.T., Tabrizi, A., Irvine, B.D., Bell, G.I., and Hallewell, R.A. (1987). Sequence of a cDNA coding for human glutathione peroxidase confirms TGA encodes act ive site seleno cysteine. Nucleic Acids Res. 15: 5484. Muller, K., Carstens, A.C., Linkies, A., Torres, M.A., and Leubner Metzger, G. (2009). The NADPH oxidase AtrbohB plays a role in Arabi dopsis seed after ripening. New Phytol. 184: 885 897. Nakashima, T ., Ueno, T., and Fukami, H. (1982). Structure e lucidation of Ak t oxins, h ost s pecific p hytotoxic m etabolites p roduced by Alternaria k ikuchiana Tanaka. Tetrahedron Lett. 23: 4469 4472. Nakatsuka, S., Ueda, K., Goto, T., Yamamoto, M., Nishimura, S., and Koh moto, K. (1986). Structure of Af Toxin II o ne of the h ost s pecific t oxins p roduced by Alternaria a lternata s trawberry p athotype. Tetrahedron Lett. 27: 2753 2756. Nedelcu, A.M., Marcu, O., and Michod, R.E. (2004). Sex as a response to oxidative stress: a twofold increase in cellular reactive oxygen species activates sex g enes. Proc. R. Soc. B Biol. Sci. 271: 1591 1596.

PAGE 131

131 Ninomiya, Y., Suzuki, K., Ishii, C., and Inoue, H. (2004). Highly efficient gene replacements in Neurospora strains deficient for nonhomol ogous end joining. Proc Natl Acad Sci U SA 101: 12248 12253. Nishimura, S., and Kohmoto, K. (1983). Host s pecific t oxins and c hemical s tructures from Alternaria Species. Annu. Rev. Phytopathol. 21: 87 116. Noda, Y., Kohjima, M., Izaki, T., Ota, K., Yo shinaga, S., Inagaki, F., Ito, T., and Sumimoto, H. (2003). Molecular recognition in dimerization between PB1 domains. J. Biol. Chem. 278: 43516 43524. Nourooz Zadeh, J., Tajaddini Sarmadi, J., and Wolff, S.P. (1994). Measurement of plasma hydroperoxide c oncentrations by the ferrous oxidation xylenol orange assay in conjunction wit h triphenylphosphine. Anal. Biochem. 220: 403 409. Okuno, T., Ishita, Y., Sawai, K., and Matsumot.T. (1974). Cha racterization of Alternariolide h ost s pecific t oxin p roduced by Alternaria m ali Roberts. Chem Lett. 635 638. Orozco Cardenas, M.L., Narvaez Vasquez, J., and Ryan, C.A. (2001). Hydrogen peroxide acts as a second messenger for the induction of defense genes in tomato plants in response to wounding, sys temin, and methyl jasmonate. Plant C ell 13: 179 191. Otani, H., Kohmoto, K., and Kodama, M. (1995). Alternaria t oxins and t heir e ffects on h ost p lants. Can. J. Bot. 73: S453 S458. Palm, M.E., and Civerolo, E.L. (1994). Isolation, p athogenicity, and p artial h ost r ange of Alternaria l imicola c ausal a gent of Mancha f oliar d e l os Citricos in Mexico. Plant Dis 78: 879 883. Peever, T.L., Canihos, Y., Olsen, L., Ibanez, A., Liu, Y.C., and Timmer, L.W. (1999). Population g enetic s tructure and h ost s pecificity of Alternaria spp c ausing b rown s pot of m inneola t angelo and r ough l emon in Florida. Phytopathology 89: 851 860. Pegg, K.G. (1966). Studies of a strain of Alternaria citri Pierce, the causal agent of brown spot of Emperor mandarin. Queensland J Agr. Anim. Sci. 23: 14 18 Peres, N.A., and Timmer, L.W. (2006). Evaluation of the a lter r ater model for spray timing for control of Alternaria brown spot on Murcott t angor in Brazil. Crop Prot. 25: 454 460. Possel, H., Noack, H., Augustin, W., Keilhoff, G., and Wolf, G. (1997). 2,7 Dihydrodichlorofluorescein diacetate as a fluorescent marker for peroxynitrite formation. FEBS Lett. 416: 175 178.

PAGE 132

132 Potocky, M., Jones, M.A., Bezvoda, R., Smirnoff, N., and Zarsky, V. (2007). Reactive oxygen species produced by NADPH oxidase are invo lv ed in pollen tube growth. New Phytol. 174: 742 751. Pratt, R.J., and Aramayo, R. (2002). Improving the efficiency of gene replacements in Neurospora crassa : A first step towards a large scale functional genomics project. Fungal Genet Biol 37 : 56 71. Re es, D.D., Palmer, R.M., Schulz, R., Hodson, H.F., and Moncada, S. (1990). Characterization of three inhibitors of endothelial nitric oxide synthase in vitro and in vivo Brit. J. Pharmacol. 101: 746 752. Ringli, C. (2010). Monitoring the outside: C ell wal l sensing mechanisms. Plant Physiol 153: 1445 1452. Rinnerthaler, M., Buttner, S., Laun, P., Heeren, G., Felder, T.K., Klinger, H., Weinberger, M., Stolze, K., Grousl, T., Hasek, J., Benada, O., Frydlova, I., Klocker, A., Simon Nobbe, B., Jansko, B., Bre itenbach Koller, H., Eisenberg, T., Gourlay, C.W., Madeo, F., Burhans, W.C., and Breitenbach, M. (2012). Yno1p/Aim14p, a NADPH oxidase ortholog, controls extramitochondrial reactive oxygen species generation, apoptosis, and actin cable formation in yeast. Proc Natl Acad Sci USA 109: 8658 8663. Rivas, S., and Thomas, C.M. (2005). Molecular interactions between tomato and the leaf mold pathogen Cladosporium fulvum Annu. Rev. Phytopathol. 43: 395 436. Roca, M.G., Weichert, M., Siegmund, U., Tudzynski, P ., and Fleissner, A. (2012). Germling fusion via conidial anastomosis tubes in the grey mould Botrytis cinerea requires NADPH oxidase activity. Fungal Biol. 116: 379 387. Rolke, Y., and Tudzynski, P. (2008). The small GTPase Rac and the p21 activated kina se Cla4 in Claviceps purpurea : I nteraction and impact on polarity, development and patho genicity. Mol. Microbiol. 68: 405 423. Rotem, J. (1994). The Genus Alternaria : Biology, e pidemiology and p athogenicity. Am Phytopathol Soc 55 76 Ryder, L.S., Dagd as, Y.F., Mentlak, T.A., Kershaw, M.J., Thornton, C.R., Schuster, M., Chen, J., Wang, Z., and Talbot, N.J. (2013). NADPH oxidases regulate septin mediated cytoskeletal remodeling during plant infection by the rice blast fungus. Proc Natl Acad Sci USA 1 10: 3179 3184. Sambrook, J., and Russell, D.W. (2001). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press

PAGE 133

133 Schafer, F.Q., and Buettner, G.R. (2001). Redox environment of the cell as viewed through the redox state of the glutathion e disulfide/glutathione couple. Free R adical Bio. Med. 30 : 1191 1212. Scott, B., and Eaton, C.J. (2008). Role of reactive oxygen species in fungal ce llular differentiations. Curr. Opin. Microbiol. 11: 488 493. Segmuller, N., Kokkelink, L., Giesbert, S., Odinius, D., van Kan, J., and Tudzynski, P. (2008). NADPH oxidases are involved in differentiation and pathogenicity in Botrytis cinerea Mol Plant Microbe Interact 21 : 808 819. Seifert, G.J., and Blaukopf, C. (2010). Irritable walls: T he plant extracel lular matrix and signaling. Plant Physiol 153 : 467 478. Selvaggini, S., Munro, C.A., Paschoud, S., Sanglard, D., and Gow, N.A. (2004). Independent regulation of chitin synthase and chitinase activity in C andida albicans and Saccharomyces cerevisiae Micr obiology 150 : 921 928. Semighini, C.P., and Harris, S.D. (2008). Regulation of apical dominance in Aspergillus nidulans hyphae by reactive oxygen species. Genetics 179 : 1919 1932. Shetty, N.P., Jorgensen, H.J.L., Jensen, J.D., Collinge, D.B., and Shetty, H.S. (2008). Roles of reactive oxygen species in interactions betwee n plants and pathogens. Eur. J. Plant Pathol. 121: 267 280. Shinogi, T., Suzuki, T., Kurihara, T., Narusaka, Y., and Park, P. (2003). Microscopic detection of reactive oxygen species gen eration in the compatible and incompatible interactions of Alternaria alternata Japanese pear patho type and host plants. J. Gen. Plant Pathol. 69: 7 16. Siegmund, U., Heller, J., van Kann, J.A., and Tudzynski, P. (2013). The NADPH o xidase c omplexes in Bot rytis cinerea : Evidence for a c lose a ssociation with the ER and the t etraspanin Pls1. P L oS ONE 8 : e55879. Silar, P. (2005). Peroxide accumulation and cell death in filamentous fungi induced by contac t with a contestant. Myco. Res. 109: 137 149. Simmons, E.G. (1967). Typification of Alternaria Stemphylium and Ulocladium Mycologia 59: 67 92. Simon Plas, F., Elmayan, T., and Blein, J.P. (2002). The plasma membrane oxidase NtrbohD is responsible for AOS production in elicited tobacco cells. Plant J 31: 13 7 147.

PAGE 134

134 Sweigard, J.A., Chumley, F.C., Carroll, A.M., Farrall, L., and Valent, B. (1997). A series of vectors for fungal transformation. Fung. Genet. Newslett. 44 : 52 53. Takemoto, D., Tanaka, A., and Scott, B. (2006). A p67 p hox like regulator is recruite d to control hyphal branching in a fungal g rass mutualistic symbiosis. Plant C ell 18: 2807 2821. Takemoto, D., Tanaka, A., and Scott, B. (2007). NADPH oxidases in fungi: diverse roles of reactive oxygen species in fungal cellular differentiation. Fungal G enet Biol 44 : 1065 1076. Takemoto, D., Kamakura, S., Saikia, S., Becker, Y., Wrenn, R., Tanaka, A., Sumimoto, H., and Scott, B. (2011). Polarity proteins Bem1 and Cdc24 are components of the filamentous fungal NADPH oxidas e complex. Proc. Natl. Acad. Sc i. US A 108 : 2861 2866. Tanaka, A., Christensen, M.J., Takemoto, D., Park, P., and Scott, B. (2006). Reactive oxygen species play a role in regulating a fungus perennial ryegra ss mutualistic interaction. Plant C ell 18 : 1052 1066. Tanaka, A., Takemoto, D., Hyon, G.S., Park, P., and Scott, B. (2008). NoxA activation by the small GTPase RacA is required to maintain a mutualistic symbiotic association between Epich lo festucae and perennial ryegrass. Mol. Microbiol. 68: 1165 1178. Temme, N., and Tudzynski, P. (2009). Does B otrytis cinerea i gnore H 2 O 2 induced oxidative stress during infection? Characterization of B otrytis activator protein 1. Mol Plant Microbe Interact 22: 987 998. Thon, M., Al Abdallah, Q., Hortschansky, P., and Brakhage, A.A. (2007). The t hioredoxin system of the filamentous fungus Aspergillus nidulans : I mpact on development and oxidative stress response. J. Biol. Chem. 282: 27259 27269. Timmer, L.W., Peever, T.L., Solel, Z., and Akimitsu, K. (2003). Alternaria diseases of citrus nov el pat hosystems. Phytopathol. Mediterr. 42: 99 112. Timmer, L.W., Darhower, H.M., Zitko, S.E., Peever, T.L., Ibanez, A.M., and Bushong, P.M. (2000). Environmental factors affecting the severity of Alternaria brown spot of citrus and their potential use in timin g fungi cide applications. Plant Dis. 84: 638 643. Toledano, M.B., Delaunay, A., Monceau, L., and Tacnet, F. (2004). Microbial H 2 O 2 sensors as archetypical redo x signaling modules. Trends Biochem. Sci. 29: 351 357.

PAGE 135

135 Toone, W.M., Kuge, S., Samuels, M., Morg an, B.A., Toda, T., and Jones, N. (1998). Regulation of the fission yeast transcription factor Pap1 by oxidative stress: requirement for the nuclear export factor Crm1 (Exportin) and the stress activated MAP kinase Sty1/ Spc1. Gene. D ev. 12: 1453 1463. Tor res, M.A., Dangl, J.L., and Jones, J.D. (2002). Arabidopsis gp91 phox homologues AtrbohD and AtrbohF are required for accumulation of reactive oxygen intermediates in the plant defense response. Proc Natl Acad Sci USA 99: 517 522. Torres, M.A., Jones, J.D., and Dangl, J.L. (2005). Pathogen induced, NADPH oxidase derived reactive oxygen intermediates suppress spread of cell death in Arabidopsis thaliana Nature Genet. 37: 1130 1134. Tsai, H.C., Yang, S.L., and Chung, K.R. (2013). Cyclic AMP dependent pr otein kinase A negatively regulates conidia formation by the tangerine pathotype of Alternaria alternata World J. Microb. Biot. 29: 289 300. Tudzynski, P., Heller, J., and Siegmund, U. (2012). Reactive oxygen species generation in fungal devel opment and pathogenesis. Curr. Opin. Microbiol 15: 653 659. Unger, C., Kleta, S., Jandl, G., and von Tiedemann, A. (2005). Suppression of the defence related oxidative burst in bean leaf tissue and bean suspension cells by the necrotrophic pathogen Botrytis cinerea J. Phytopathol. 153: 15 26. Van Norman, J.M., Breakfield, N.W., and Benfey, P.N. (2011). Intercellular communicatio n during plant development. Plant C ell 23: 855 864. Vignais, P.V. (2002). The superoxide generating NADPH oxidase: S tructural aspects an d activation mechanism. Cell. Mol. Life Sci. 59: 1428 1459. Walton, J.D. (1996). Host selective toxin s: A gents of compatibility. Plant C ell 8: 1723 1733. Walz, A., Zingen Sell, I., Theisen, S., and Kortekamp, A. (2008). Reactive oxygen intermediates and o xalic acid in the pathogenesis of the necrotrophic fungus Sclerotinia sclerotiorum Eur. J. Plant Pathol. 120: 317 330. Wang, N.Y., Lin, C.H., and Chung, K.R. (2010). A G alpha subunit gene is essential for conidiation and potassium efflux but dispensable for pathogenicity of Alternaria alternata on citrus. Cur r. Genet. 56: 43 51. Whiteside, J.O. (1976). Newly r ecorded Alternaria i nduced b rown s pot d isease on Fancy t angerines in Florida. Plant Dis Rep 60: 326 329.

PAGE 136

136 Wojtaszek, P. (1997). Oxidative burst: A n early plant resp onse to pathogen infection. Bioch em. J. 322: 681 692. Wu, G., Fang, Y.Z., Yang, S., Lupton, J.R., and Turner, N.D. (2004). Glutathione metabolism and i ts implications for health. J. Nutr. 134: 489 492. Xu, J.R., and Hamer, J.E. (1996). MAP kinase and cAMP signaling regulate infection structure formation and pathogenic growth in the rice blast fungus Magnaporthe grisea Gene s Dev. 10: 2696 2706. Yago, J.I., Lin, C.H., and Chung, K.R. (2011). The SLT2 mitogen activated protein kinase med iated signalling pathway governs conidiation, morphogenesis, fungal virulence and production of toxin and melanin in the tangerine pathotype of Alternaria alternata Mol Plant Pathol. 12: 653 665. Yang, S.L., and Chung, K.R. (2012). The NADPH oxidase med iated production of hydrogen peroxide (H 2 O 2 ) and resistance to oxidative stress in the necrotrophic pathogen Alternaria alternata of citrus. Mol. Plant Pathol. 13: 900 914. Yang, S.L., and Chung, K.R. (2013). Similar and distinct roles of NADPH oxidase co mponents in the tangerine pathotype of Alternaria alternata Mol Plant Pathol 14 : 543 556. Yang, S.L., Lin, C.H., and Chung, K.R. (2009). Coordinate control of oxidative stress tolerance, vegetative growth, and fungal pathogenicity via the AP1 pathway i n the rough lemon pathotype of Alternaria alternata Physiol. Mol. Plant Pathol. 74: 100 110. Yoshida, Y., and Hasunuma, K. (2004). Reactive oxygen species affect photomorphogenesis in Neurospora crassa J. Biol. Chem. 279: 6986 6993. Yoshioka, H., Numat a, N., Nakajima, K., Katou, S., Kawakita, K., Rowland, O., Jones, J.D., and Doke, N. (2003). Nicotiana benthamiana gp91 phox homologs NbrbohA and NbrbohB participate in H 2 O 2 accumulation and resistance to Phytophthora infestans Plant C ell 15: 706 718. You B.J., Lee, M.H., and Chung, K.R. (2009). Gene specific disruption in the filamentous fungus Cercospora nicotianae using a split marker approach. Arch. Microbiol. 191: 615 622. Zhang, W.J., He, Y.X., Yang, Z., Yu, J., Chen, Y., and Zhou, C.Z. (2008). Cry stal structure of glutathione dependent phospholipid peroxidase Hyr1 from the yeast Saccharomyces cerevisiae Proteins 73: 1058 1062

PAGE 137

137 BIOGRAPHICAL SKETCH Siwy Ling Yang, daughter of Hoong Yang and Yek Ying Goh, was born in Kuala Lumpu r, Malaysia in 1982. Siwy Ling attended Chong Hwa Independent High School in Kuala Lumpur and graduated in 2000. She attended National Dong Hwa University at Hualien, Taiwan where she majored in Life Science and was awarded a Bachelor of Science degree in Jun e 2005 and a Master of Science in Biotechnology in Jan uary 2007. Siwy Ling began working as Associate researcher at Stone and Resource Industry Research and Development Center in Taiwan until May 2008. In Jun e 2008, she began working at the University o f Florida as a visiting scholar at the Citrus Research and Education Center. It was during her two years of work on fungal research when Siwy Ling decided to obtain a doctorate degree; in the Fall of 2010 she started her PhD program in the Plant Pathology Department. Under the guidance and support of Dr. Kuang Ren Chung, she conducted research on the molecular biology of the necrotrophic fungus Alternaria alternata a causal agent of Alternaria brown spot on citrus. Siwy Ling was awarded a Grinter Fellowshi p from 2010 to 2012 and a n A.S. Herlong Sr. Graduate Scholarship in 2013 during her graduate study. Siwy Ling plans to continue her research career in fungal biology after graduation.