<%BANNER%>

Metabolic Analysis, Environmental Factors, and a Transgenic Approach to Understanding Strawberry (Fragaria X Ananassa) Flavor

MISSING IMAGE

Material Information

Title:
Metabolic Analysis, Environmental Factors, and a Transgenic Approach to Understanding Strawberry (Fragaria X Ananassa) Flavor
Physical Description:
1 online resource (168 p.)
Language:
english
Creator:
Schwieterman, Michael L
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Plant Molecular and Cellular Biology
Committee Chair:
Clark, David G
Committee Members:
Folta, Kevin M
Kirst, Matias
Burkhardt, Robert Jeffrey

Subjects

Subjects / Keywords:
aroma -- flavor -- metabolomics -- postharvest -- psychophysics -- strawberry -- sweetness -- transgenic -- volatiles
Plant Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre:
Plant Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Fresh strawberries (Fragariax ananassa) are valued for their red color, juicy texture, distinct aroma,and sweet fruity flavor. To ensure continued consumption, flavor must be highin quality, but defining this complex trait has proven to be difficult. Thiswork presents a metabolite perspective on the perception, variation, andalteration of strawberry fruit flavor to increase consumer acceptability. In the primary study, genetic and environmentally inducedvariation among strawberry is exploited by simultaneously assaying fruit for:inventories of volatile compounds, sugars, and organic acids; physical measuresof titratable acidity, soluble solids content, and firmness; and consumerhedonic and sensory responses. Psychophysics analysis determines seasonaleffects and fruit attributes influencing hedonics and sensory perception ofstrawberry fruit. Seasonal progression negatively influences soluble solidscontent, primarily through sucrose, leading to decreased volatile content.These alterations are perceivable because sweetness intensity, flavorintensity, and texture liking significantly influence overall liking throughvariations in sugar concentrations, volatiles, and firmness. Specific aromavolatiles make contributions to perceived sweetness independent of fruit sugarconcentration. Volatiles that increase perception of sweetness without addingsugar will have far-reaching effects in food chemistry, and also providestargets for future breeding efforts of consumer defined traits. The biosynthesis of an underrepresented volatile in commercialgermplasm, methyl anthranilate, is the target of genetically engineering Petunia x hybrida ‘Mitchell Diploid’ and‘Strawberry Festival’. Expression of Zeamays ANTHRANILIC ACID METHYL TRANSFERASE 1.1 will hypothetically enhanceits aroma or flavor. Petunia flowerswith expression emit methyl anthranilate at levels similar to Fragaria vesca. Expression is confirmedin over twenty T0 lines of ‘Strawberry Festival’. Consumer panels assayingpetunia and strawberry with methyl anthranilate phenotype will assist inassaying this volatiles influence on perception. Metabolite inventory of diverse strawberry fruit coupledwith consumer panels identifies rare and important compounds associated withstrawberry flavor. Transgenic efforts will determine methyl anthranilateinfluence on consumers. Furthermore, exploration of environmental manipulationprovides some prospective technologies for altering strawberry volatileprofiles. Whether through breeding, transgenics, or environmental manipulationincreasing the flavor of strawberry will ensure the current trend of increasingconsumption of this highly nutritious food.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Michael L Schwieterman.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: Clark, David G.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0045940:00001

MISSING IMAGE

Material Information

Title:
Metabolic Analysis, Environmental Factors, and a Transgenic Approach to Understanding Strawberry (Fragaria X Ananassa) Flavor
Physical Description:
1 online resource (168 p.)
Language:
english
Creator:
Schwieterman, Michael L
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Plant Molecular and Cellular Biology
Committee Chair:
Clark, David G
Committee Members:
Folta, Kevin M
Kirst, Matias
Burkhardt, Robert Jeffrey

Subjects

Subjects / Keywords:
aroma -- flavor -- metabolomics -- postharvest -- psychophysics -- strawberry -- sweetness -- transgenic -- volatiles
Plant Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre:
Plant Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Fresh strawberries (Fragariax ananassa) are valued for their red color, juicy texture, distinct aroma,and sweet fruity flavor. To ensure continued consumption, flavor must be highin quality, but defining this complex trait has proven to be difficult. Thiswork presents a metabolite perspective on the perception, variation, andalteration of strawberry fruit flavor to increase consumer acceptability. In the primary study, genetic and environmentally inducedvariation among strawberry is exploited by simultaneously assaying fruit for:inventories of volatile compounds, sugars, and organic acids; physical measuresof titratable acidity, soluble solids content, and firmness; and consumerhedonic and sensory responses. Psychophysics analysis determines seasonaleffects and fruit attributes influencing hedonics and sensory perception ofstrawberry fruit. Seasonal progression negatively influences soluble solidscontent, primarily through sucrose, leading to decreased volatile content.These alterations are perceivable because sweetness intensity, flavorintensity, and texture liking significantly influence overall liking throughvariations in sugar concentrations, volatiles, and firmness. Specific aromavolatiles make contributions to perceived sweetness independent of fruit sugarconcentration. Volatiles that increase perception of sweetness without addingsugar will have far-reaching effects in food chemistry, and also providestargets for future breeding efforts of consumer defined traits. The biosynthesis of an underrepresented volatile in commercialgermplasm, methyl anthranilate, is the target of genetically engineering Petunia x hybrida ‘Mitchell Diploid’ and‘Strawberry Festival’. Expression of Zeamays ANTHRANILIC ACID METHYL TRANSFERASE 1.1 will hypothetically enhanceits aroma or flavor. Petunia flowerswith expression emit methyl anthranilate at levels similar to Fragaria vesca. Expression is confirmedin over twenty T0 lines of ‘Strawberry Festival’. Consumer panels assayingpetunia and strawberry with methyl anthranilate phenotype will assist inassaying this volatiles influence on perception. Metabolite inventory of diverse strawberry fruit coupledwith consumer panels identifies rare and important compounds associated withstrawberry flavor. Transgenic efforts will determine methyl anthranilateinfluence on consumers. Furthermore, exploration of environmental manipulationprovides some prospective technologies for altering strawberry volatileprofiles. Whether through breeding, transgenics, or environmental manipulationincreasing the flavor of strawberry will ensure the current trend of increasingconsumption of this highly nutritious food.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Michael L Schwieterman.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: Clark, David G.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0045940:00001


This item has the following downloads:


Full Text

PAGE 1

1 METABOLITE ANALYSIS, ENVIRONMENTAL FACTORS, AND A TRANSGENIC APPROACH TO UNDERSTANDING STRAWBERRY ( FRAGARIA X ANANASSA ) FLAVOR By MICHAEL LEE SCHWIETERMAN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Michael Lee Schwieterman

PAGE 3

3 To my family, friends, and colleagues

PAGE 4

4 ACKNOWLEDGMEN TS I thank my Ph.D. committee for their patience and guidance. Deepest appreciation to my advisor, Dr. David Clark, for providing direction, encouragement and sound advice when it was needed most, as well as, providing the freedom to pursue research in an unfamiliar system. I recognize Dr. Thomas Colquhoun for his continued dedication to my professional development and positive outlook throughout my Ph.D. education. Portions of this work are supported by grants from USDA Specialty Crop Block Grant. Graduate funding is provided by USDA National Needs Fellowship. Great gratitude is extended to Timothy Johnson, HHMI Undergraduate Scholar, and Yasmin Dweik, for assistance with screening transgenic lines for volatiles and transcript abundance and Elizabeth Jawors ki for assistance with Fragaria volatile analysis.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 10 ABSTRACT ................................ ................................ ................................ ................... 11 CHAPTER 1 INTRODUCTION AND LITERATURE REVIEW ................................ ..................... 13 Introduction ................................ ................................ ................................ ............. 13 Fruit Development and Regulation ................................ ................................ ......... 14 Strawberry Flavor ................................ ................................ ................................ ... 15 Methyl Anthranilate Biosynthesis ................................ ................................ ............ 19 Fragaria x ananassa ................................ ................................ ............................... 20 Perception and Integrati on of Flavor ................................ ................................ ....... 22 Research Objectives ................................ ................................ ............................... 24 Identifying Flavor Related Metabolite Targets Using Psychophysics ............... 25 Field and Postharvest Environment Factors Influencing Flavor Related Metabolites ................................ ................................ ................................ .... 25 A Transgenic Approach to Introduce F. vesca Volatile Compound in F. x ananassa ................................ ................................ ................................ ....... 25 2 STRAWBERRY FLAVOR: DIVERSE CHEMICAL COMPOSITIONS, A SEASONAL INFLUENCE, AND EFFECTS ON SENSORY PERCEPTION ........... 27 Background ................................ ................................ ................................ ............. 27 Results ................................ ................................ ................................ .................... 31 Progression of Harvest Season Affects Metabolic Content and Perceived Quality of Strawberry ................................ ................................ ..................... 31 Overall Liking is Subject to Ratings of Sweetness, Flavor, and Texture ........... 32 Texture Liking Correlates to Fruit Firmness ................................ ...................... 33 Sweetness Intensity is a Result of Sugar Content ................................ ............ 34 Sourness Intensity is Partially Explained by Titratable Acidity .......................... 35 Flavor Intensity is Influenced by Total and Specific Volatile Content ................ 36 Specific Volatiles Enhance Sweetness Intensity Independent of Sugars ......... 38 Discussion ................................ ................................ ................................ .............. 38 Materials and Methods ................................ ................................ ............................ 48 Plant Material ................................ ................................ ................................ ... 48 Volatile Analysis ................................ ................................ ............................... 49

PAGE 6

6 Sugars and Acids Quantification ................................ ................................ ...... 50 Firmness Determinatio n ................................ ................................ ................... 51 Sensory Analysis ................................ ................................ .............................. 51 Statistical Analysis ................................ ................................ ............................ 52 3 ENGINEERING O F THE AROMA FLAVOR VOLATILE METHYL ANTHRANILATE IN PETUNIA AND STRAWBERRY ................................ ........... 108 Background ................................ ................................ ................................ ........... 108 Results ................................ ................................ ................................ .................. 112 Methyl Anthranilate Content among Fragaria ................................ ................. 112 ZmAAMT1.1 Expression Analysis in Transgenic Plants ................................ 113 Overexpression construct and plant transformation ................................ 113 Petunia expression analysis ................................ ................................ ..... 114 Strawberry expression analy sis ................................ ............................... 115 ZmAAMT1.1 Volatile Analysis in Transgenic Plants ................................ ....... 115 Discussion ................................ ................................ ................................ ............ 116 Future Work ................................ ................................ ................................ .......... 121 Materials and Methods ................................ ................................ .......................... 122 Plant Material ................................ ................................ ................................ 122 Generation of Transgenic ZmAAMT1.1 Plants ................................ ............... 123 Overexpression construct ................................ ................................ ........ 123 Plant transformation and regeneration ................................ ..................... 124 RNA Isolation ................................ ................................ ................................ 124 Petunia ................................ ................................ ................................ ..... 124 Strawberry ................................ ................................ ................................ 125 Expression Analysis ................................ ................................ ....................... 125 Volatile Analysis ................................ ................................ ............................. 126 Statistical Analysis ................................ ................................ .......................... 128 4 EFFECTS OF ENHANCED LIGHT ENVIRONMENTS ON POSTHARVEST ................................ ...... 138 Background ................................ ................................ ................................ ........... 138 Results ................................ ................................ ................................ .................. 139 Postharvest Exposure to Narrow Bandwidth Light Alters Strawberry Volatile Content ................................ ................................ ................................ ........ 139 Red and Black Plastic Mulch ................................ ................................ .......... 140 Reflective light qualities from red and black mulch ................................ .. 140 Strawberry volatile profiles a re not consistently different between red and black mulch treatments ................................ ................................ .. 141 Consumers do not distinguish or prefer strawberry from red or black plastic mulch ................................ ................................ ......................... 141 Discussion ................................ ................................ ................................ ............ 142 Materials and Methods ................................ ................................ .......................... 144 Postharvest Narrow Bandwidth Light Treatment ................................ ............ 144 Red and Black Plastic Mulch Field Conditions ................................ ............... 145

PAGE 7

7 Flavor Panel ................................ ................................ ................................ ... 146 Volat ile Analysis ................................ ................................ ............................. 146 Statistical Analysis ................................ ................................ .......................... 148 LIST OF REFERENCES ................................ ................................ ............................. 157 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 168

PAGE 8

8 LIST OF TABLES Table page 2 1 Means of consumer, physical, and biochemical measures. ................................ 53 2 2 Standard errors of consumer, physical, and biochemical measures. .................. 70 2 3 Fruit attribute bivariate fit to harvest week. ................................ ......................... 87 2 4 Fruit attribute bivariate fir to consumer measure. ................................ ............... 89 2 5 Multiple regression for identification of sweetness enhancing volatiles. ............. 95 2 6 Index of CAS registry number, chemical name, and formula. ............................. 97 4 1 Photosynthetically active, red, and far red radiation reflected by selec tive reflective mulch. ................................ ................................ ................................ 149 4 2 Consumer panels do not perceive differences between red and black plastic mulch grown strawberries. ................................ ................................ ................ 150 4 3 Volatile analysis does not detect consistent differences between red and black plastic mulch grown strawberries. ................................ ........................... 151

PAGE 9

9 LIST OF FIGURES Figure page 2 1. Cluster analysis of strawberry samples and quantified metabolites. ................... 100 2 2. Season environmental c onditions. ................................ ................................ ...... 102 2 3. Individual sugars and to tal volatiles regressed against season progression. ...... 103 2 4. Regression of hedonic and sensory measures to physical and chemical fruit attributes. ................................ ................................ ................................ .......... 105 2 5. Volatile chemical s tructure s ................................ ................................ ............... 107 3 1. Alternative methyl anthranilate biosynthetic pathways in Zea mays and Vitis labrusca. ................................ ................................ ................................ .......... 129 3 2. Identification of methyl anthranilate in Fragaria. ................................ ................... 130 3 3. Methyl anthranilate content among various lines of Fragaria species. ................. 131 3 4. Binary vector for stable transformation of petunia and strawberry with ZmAAMT1.1. ................................ ................................ ................................ ... 132 3 5. ZmAAMT1.1 transcript abundance in overexpressing P etunia x hybrida cv. ................................ ................................ ............................... 133 3 6. ZmAAMT1.1 transcript abundance in overexpressing Petunia x hybrida cv. ................................ ................................ ............................... 134 3 7. Emission of methyl anthranilate from petunia flowers over expressing ZmAAMT1.1 ................................ ................................ ................................ .... 135 3 8. Identification of methyl anthranilate in petunia flower over expressing ZmAAMT1 .1. ................................ ................................ ................................ .... 136 3 9. ZmAAMT1.1 transcript abundance in overexpressing Fragaria x ananassa cv. ................................ ................................ ........................ 137 4 1. Spectror adiometer readings of the light qualities used in postharvest treatments. ................................ ................................ ................................ ........ 153 4 2. Effect of light treatments on selected volatile compounds in Fragaria x. ananassa ................................ ................................ .. 1 54 4 3. Spectrum of light reflected from red and black plastic mulch. .............................. 156

PAGE 10

10 LIST OF ABBREVIATIONS CDS Coding sequence CM CHORISMATE MUTASE C O A Coenzyme A DMF 3(2H) furanone, 4 methoxy 2,5 dimethyl F Fragaria FID Flame ionization detector GC Gas chromatograph G LMS General labeled magnitude scale LED Light emitting diode MS M ass spectrometer P NOS NOPALINE SYNTHASE promotor NOS T NOPALINE SYNTHASE r NPTII NEOMYCIN PHOSPHOTRAN SFERASE II P. Petunia PAR Photosynthetic active radiation P FMV 34S Figwort mosaic virus 34S promoter Q RT PCR Quantitative real time polymerase chain reaction SQ RT PCR Semi quantitative polymerase chain reaction SSC Soluble sol id s content TA Titratable acidity V L AMAT Vitis labrusca ANTHRANILOYL CoA:METHANOL ACYLTRANSFERASE Z M AAMT Zea mays ANTHRANILIC ACID METHYL TRANSFERASE

PAGE 11

11 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy METABOLITE ANALYSIS, ENVIRONMENTAL FACTORS, AND A TRANSGENIC APPROACH TO UNDERSTANDING STRAWBERRY ( FRAGARIA X ANANASSA ) FLAVOR By Michael Lee Schwieterman August 2013 Chair : David G. Clark Major: Plant Molecular and Cellular Biology Fresh strawberries ( Fragaria x ananassa) are valued for their red color, juicy texture, distinct aroma, and sweet fruity flavor. To ensure continued consumption, flavor must be high in quality, but defining this complex trait has proven to be difficult. This work presents a metabolite perspective on the perception, variation, and alteration of strawberry fruit flavor to increase consumer acceptability In the primary study, genetic and environmen tally induced variation among strawberry is exploited by simultaneously assaying fruit for: inventories of volatile compounds, sugars, and organic acids; physical measures of titratable acidity, soluble solids content, and firmness; and consumer hedonic an d sensory responses. Psychophysics analysis determin es seasonal effects and fruit attributes influencing hedonics and sensory perception of strawberry fruit Seasonal progression negative ly influence s soluble solids content primarily through sucrose, lea ding to decreased volatile content. These alterations are perceivable because sweetness intensity, flavor intensity, and texture liking significant ly influence overall liking through variations in sugar concentrations, volatile s and

PAGE 12

12 firmness. Specific aro ma volatiles make contributions to perceived sweetness independent of fruit sugar concentration. Volatiles that increase perception of sweetness without adding sugar will have far reaching effects in food chemistry, and also provide s targets for future bre eding efforts of consumer defined traits. The biosynthesis of a n underrepresented volatile in commercial germplasm methyl anthranilate, is the target of genetically engineering Petunia x hybrid a Expression of Zea mays A NTHRANILIC ACID METHYL TRANSFER ASE 1.1 will hypothetically enhance its aroma or flavor Petunia flowers with expression emit methyl anthranilate at levels similar to Fragaria vesca Expression is confirmed in over twenty T0 lines Consumer panels assaying petunia and strawberry with methyl anthranilate phenotype will assist in assaying this volatiles influence on perception. Metabolite inventory of diverse strawberry fruit coupled with consumer panels identifie s rare and i mportant compounds associated with strawberry flavor. Transgenic efforts will determine methyl anthranilate influence on consumers Furthermore, exploration of environmental manipulation provide s some prospective technologies for altering strawberry volati le profiles. Whether through breeding transgenics, or environmental manipulation increasing the flavor of strawberry will ensure the current trend of increasing consumption of this highly nutritious food.

PAGE 13

13 CHAPTER 1 INTRODUCTION AND LITERATURE REVIEW Int roduction Modern strawberry Fragaria x ananassa is the product of a recent anthropomorphic botanical hybridization of otherwise geogra phically isolated species H ybrid s of two octoploid species, male North American F. virginiana and female South American F. chiloensis began appearing in European gardens during the 18th century (Darrow, 1966) C omparison of genomic microsatellite markers among F. x ananassa cultivars and a geographically diverse collection of progenitors reveals t h is relatively young c rop species is founded on narrow genetic diversity (Chambers et al. 2013) yet is cultivated in most arable regions of the world at a level over 4.3 million metric tons of fruit annu ally (Hancock, 1999; UN, 2013) The genus Fragaria is distributed globally throughout temperate and tropical zones, with the most widespread distribution belonging to F. vesca Other F ragaria poss ess more geographically restricted distributions, most of which are within or bordering that of F. vesca. A specific example is that of South American F. chiloensis Also, the genus exhibit s a natural ploidy diversity ranging from diploid to decaploid (Folta and Davis, 2006; Hancock, 1999) The relatively small stature and herbaceous nature of strawbe rry strongly contradicts that of typical Rosaceae, but the perennial life cycle is mutual. The morphologically distinct aggregate accessory fruit of strawberry, in which the achenes are exposed on a swollen fleshy receptacle, has been a prize of domesticat ion for over two millennia (Hancock, 1999) Modern fully ripe fruit of F x ananassa is characterized by its large size, vibrant red color, reduced firmness, distinct aroma, and sweet fruity flavor (Brummell and

PAGE 14

14 Harpster, 2001; Hong and Wrolstad, 1990; Schieberle and Hofmann, 1997; Ulrich et al. 1997; Whitaker et al. 2011) Strawberry is also a rich source of phenolics vitamins, and minerals contributing to the nutri ti onal quality of the fruit and promoting human health throu gh antioxidant, anti inflammatory, antimicrobial, anti allergy, anti hypertensive and anticancer properties (Brown et al. 2012; Giampieri et al. 2013; Giampieri et al. 2012; Mikulic Petkovsek et al. 2012; Tulipan i et al. 2008) Ever increasing production and consumption of strawberry (UN, 2013) is driven by demand for high quali ty fruit, secondarily beneficial to our health, and facilitated by intensive modern horticulture and sophisticated breeding practices Fruit Development and Regulation Fertilization of the many ovary/ovule inflorescence of strawberry gives rise to the aggr egate fruit (Perkins Veazie, 1995) Here, the achenes (true fruit) are fixed on the epidermis the outermost layer of the swollen receptacl e (false fruit), also consisting of a cortex and internal pith (Suutarinen et al. 1998) Fruit development and ripening is coordinated and regulated with embryo formation and achene maturation most notably through achene localized auxin biosynthesis (Given et a l. 1988; Nitsch, 1950) The three stages of non climacteric, auxin dependent strawberry fruit development; division, expansion and ripening, involve gains in diameter and fresh weight D uring this transition c olor shifts from green to white to dark red i n about forty days after anthesis (Zhang et al. 2011a) Increasing auxin during division and expansion stages promotes growth, peaking prior to fruit whitening when achene s matur e. Decreased auxin content coincides with fruit maturation and ripening, thus auxin biosynthesis promotes fruit g rowth but inhibits ripening prior to achene maturation (Fait et al. 2008; Given et al. 1988)

PAGE 15

15 The dynamic state of fruit ripening is exemplified by the nearly 250 cDNAs with significan t differential expression (177 up, 70 down) in red compared to green fruit determined using a microarray of 1700 probes (Aharoni et al. 2000) A p hysical attribute of later ripening stages is the reduction of firmness D issolution of middle lamella which functio ns in cell to cell adhesion fruit Further, a transcript with 200 fold greater expression in ripening fruit compared to green POLYGALACTURONASE contributes to fruit sof tening by aiding in catalytic cell wall disassembly (Brummell and Harpster, 2001; Quesada et al. 2009; Trainotti et al. 1999) Other differentially expressed transcripts are related to primary and secondary metabo lism, and transcription of multiple ripening associated genes are initiated by reduced auxin (Aharoni et al. 2002; Aharoni and O'Connell, 2002; Castillejo et al. 2004; Manning, 1994, 1998) Transcriptional reconfi guration coordinates t he final shift for strawberry ripening This highly metabolically active process is visualized by the late accumulation of the predominant red pigment, pelargonidin 3 glucoside (Hoffmann et al. 2006) an anthocyanin synthesized from the primary metab olite phenylalanine (Fait et al. 2008) Of great metabolic interest in the final days of ripening is the accumulation of multiple sugars and organic acids, which culminat es with peak volatile emission s (Menager et al. 2004) Strawberry Flavor The sweet fruit y flavor and distinct aroma of a ripe strawberr y is the result of a multifaceted metabolite mixture of sugars, organic acids and volatile compounds, which are coordinated at ripening through genetic and environmental factors. Early work in tomato correlated fruit acceptability to sweetness and flavor which were also shown to be the result of sugar and volatile content (Baldwin et al. 199 8) Glucose, fructose and

PAGE 16

16 sucrose accumulate to high levels and account for over 7% of fresh berry weight (Menager et al. 2004) Citric acid and malic acid produce sour sensations at concentrations around two to three micromolar (Settle et al. 1986) and are two of the predominant organic acids in strawberry in which total content is o n the order of 50 millimolar (Mikulic Petkovsek et al. 2012) The p redominant classes of volatile compounds in ripe strawberry are esters, lactones, terpenes aldehydes and characteristic furanones (Menager et al. 2004; Olbricht et al. 2008) A comparison of strawberry volatile st udies underscores the complexity in defining strawberry aroma, as each source considers a highly variable subset of total volatiles (Hakala et al. 2002; Jetti et al. 2007; Olbricht et al. 2008; Schieberle and Hofm ann, 1997; Ulrich et al. 1997) Methods such as odor value, aroma extract dilution analysis and GC olfactometry have been used to relate concentrations of volatiles in strawberry to perception through direct analysis or threshold determination (Zabetakis and Holden, 1997) These methodologies can be criticized for lack of physiological relevance as complex mixtures of volatiles are perceived entirely different than individual volatile s (Bartosh uk and Klee, 2013) These studies have identified butanoic acid, methyl ester (623 42 7); butanoic acid, ethyl ester (105 54 4); hexanoic acid, methyl ester (106 70 7); hexanoic acid, ethyl ester (123 66 0); 1,6 octadien 3 ol, 3,7 dimethyl (linalool) (78 70 6); butanoic acid, 2 methyl (116 53 0); and 2,5 dimethyl 4 methoxy 2,3 dihydrofuran 3 one (DMF) (4077 47 8 ) as integral to strawberry aroma volatiles (Hakala et al. 2002; Jetti et al. 2007; Olbricht et al. 20 08; Schieberle and Hofmann, 1997; Ulrich et al. 1997) Comparisons of consumer preference among a

PAGE 17

17 variety of fresh strawberries and volatile analysis has described less preferable varieties as possessing less esters, more decalactones and hexanoic acid (Ulrich et al. 1997) During ripening strawberry fruits become a nutrient sink and facilitate a metabolism resulting in the biochemical constituents of strawberry flavor. In developing strawberry a constant high sucrose sink strength (Basson et al. 2010) results in an active metabolism a ble to accumulate, synthesize, and spontaneously produce a diversity of primary and secondary metabolites (Fait et al. 2008) Transient transformation of strawberry fruit with a RNA interference construct targeting the pred ominant sucrose transporter responsible for sucrose accumulation results in arrested ripening D ecreased sucrose and abs c isic acid content measured in arrested fruit indicat e s sucrose as a molecular signal in ripening (Jia et al. 2013) The constant influx of sucrose is primary to all other aspects of fruit metabolism It is the source for alkanes, alcohols, aldehydes, ketones, esters, sugars, organic acids, fatty acids, furanones, amino acids, and anthocyanins all of which increase in concentration at one point in development or ripening (Fait et al. 2008; Zhang et al. 2011a) Many of t hese classes also represent precursors of volatile production, thus facilitating a flux through biosynthetic pathways for the synthesis of some of the 360 identified volatile compounds detected across Fragaria (Du et al. 2011b; Maarse, 1991) Within a single fruit, only a fraction of volatiles are emitted and even fewer contribute to perceived aroma. Functional genomic work has characterized strawberry enzymes responsible for the synthesis of several volatile c omponents of strawberry aroma. Q UINONE O XIDOREDUCTASE an enzyme with highly specialized function is characterized to be responsible for 3(2 H ) furanone, 4 hydroxy 2,5 dimethyl

PAGE 18

18 biosynthesis (Raab et al. 2006) This furanone is indicated t o be paramount to strawberry aroma, in that six of six panelist s detected an orthonasal and retronasal difference when absent in model juice (Schieberle and Hofmann, 1997) Also, this key aroma compound is a substrate of O METHYLTRANSFERASE activity to produce 3(2H) furanone, 4 methoxy 2,5 dimethyl (DMF) (Lavid et al. 2002) which is less defining of strawberry odor (Schieberle and Hofmann, 1997) T wo ALCOHOL ACYL TRANSFERASE S are characterized in commercial strawberry which accept a range of alcohols and acyl CoA substrates to produce a great diversity of esters, generally associated with fruit aroma. Also, the transcripts of these enzymes demonstrate fruit specific expression (Aharoni et al. 2000; Cumplido Laso et al. 2012) Linalool and nerolidol are terpenes associated with many fruit s and flow er s. Volatile analysis, enzymatic characterization, and molecular markers have confirmed the genetic and biochemical ability to produce these compounds arises from NEROLIDOL SYNTHASE 1 (NES1) Biosynthetic ability is conferred to commercial F. x ananassa a nd most hybrid progenitors, but not hexaploid, tetraploid, or diploid species (Aharoni et al. 2004; Chambers et al. 2012) Differences in the presence or absence of volatile compounds exist in commercial material compared to wild germplasm This variation in regards to flavor related metabolites is potentially a result of artificial selection prior or post hybridization. Domestication of F. chiloensis began at least 700 years prior to hybridization with F. virgini ana (Finn et al. 2013) All accessions of F. chiloensis (4 ) and F. x ananassa (112) analyzed contain a linalool producing NES1 allele that is absent in F. vesca materials. V olatile analysi s supports the allelic distribution across Fragaria species, particularly in

PAGE 19

19 commercial material (Chambers et al. 2012; Pyysalo et al. 1979) On the other hand methyl anthranilate is a common component of F. vesc a but relatively rare in F. x ananassa (Pyysalo et al. 1979; Ulrich et al. 2007) Determination of biochemical differences of strawberry aroma and correlated genetic elements can facilitate targeted approaches to alter flavor of commercial fruit. Methyl Anthranilate Biosynthesis Methyl anthranilate is an aromatic ester that is characteristic of Concord grape, Vitis labrusca It has been used as a food additive to impart such flavor for several decades The compou nd has been identified in F. x ananassa and F. vesca H owever, it is essentially lacking in fruit produced by commercial cultivars (Ulrich et al. 2007) Enzymes of alternative pathways capable of producing methyl anthranilate are characterized in Zea mays (Koellner et al. 2010) and Vitis labr usca (Wang and De Luca, 2005) where volatile biosynthesis arises under herbivory or fruit ripening, respectively. ANT HRANILOYL CoA:METHANOL ACYLTRANSFERASE of Vitis labrusca (VlAMAT) catalyzes an alcohol acyl transfer among anthraniloyl coenzyme A (anthraniloyl CoA) and methanol for methyl anthranilate biosynthesis. This ATP dependent reaction occurs in the grape where p rotein and methanol concentrations increase to relatively high levels in fruit following the onset of ripening (Wang a nd De Luca, 2005) Conversely, herbivory induced wound signaling results in up regulation of ANTHRANILIC ACID METHYL TRNASFER ASE 1.1 of Zea mays ( ZmAAMT1.1 ) and anthranilic acid, which serves as the substrate for the S adenosyl methionine dependent reacti on (Koellner et al. 2010) Previously characterized, F. x ananassa STRAWBERRY ALCOHOL ACYLTRANSFERASE (FaSAAT) or a homolog may be

PAGE 20

20 responsible for the production of methyl anthranilate endoge nously as its reactivity with methanol has been confirmed H owever anthraniloyl CoA was not tested as a substrate thus methyl anthranilate production by FaSAAT cannot be ruled out (Aharoni et al. 2000) A transgenic effort for methyl anthranilate biosynthesis in strawberry is attractive due to deficiency in commercial material, hypothetical lack of specificity for endogenous methyl anthranilate production and multiple elucidated pathways in other plant species. Also s table Agrobacterium transformation of strawberry is becoming routine with the first report in 1990 by Nehra (1990) despite long rege neration time and sensitivity to kanamycin antibiotic selection (Folta et al. 2006) Expedited assaying of gene function routinely relies on transient expression via Agrobacterium infiltration of fruit tissue (Hoffmann et al. 2006; Meng et al. 2009; Miyawaki et al. 2012) On the other ha nd, stable transformation is choice when developing materials tackling commercial interests of disease resistance (Chalavi et al. 2003; Schestibratov and Dolgov, 2005; Vellicce et al. 2006) fruit softening (Lee and Kim, 2011) fruit growth and development (Mezzetti et al. 2004) and aroma enhancement (Lunkenbein et al. 2006) The ease and existing infrastructure of vegetative propagation of strawberry is encouraging for the dissemination of transgenic commercial material. Fragaria x ananassa The allo octoploid genome of F x ananassa provides great diversity and adaptability for breeding efforts, but prevents use of lower ploidy material in t he development of new cultivars. Inbreeding depression increases with each generation of related cross in strawberry; however with stringent parent selection genetic gains comparable to unrelated crosses are achievable (Shaw, 1997) Introgression of F.

PAGE 21

21 chiloensis and F. virginiana is increasing and serves as a means of genetic diversity (Hancock et al. 2001; Smith et al. 2003) None t he les s, c ommercial cultivars are the result of seedling selection relying on vegetative propagation of daughter plants due to heter o zygosity of seedling progeny (Hancock, 1999; Whitaker et al. 2011) Following initial hybridization events in the 18 th century strawberry breeding remained a personal endeavor, until the United States Department of Agriculture began funding breeding efforts in Oregon Efforts were initially focused on quality traits for fresh and processed fruit, but disease resistance and abiotic tolerances soon became priorities (Darrow, 1966) I ntense breeding of strawberry has resulted in cultivars from a relatively limited group in the United States, including proprietary development by Watsonville, CA) and publically disseminated cultivars from the University of California at Davis and the University of Florida. Today another shift is occurring as a number of public and private entities, both domestic and abroad, are initiating breeding programs. This expansion is the result of efforts to develop region specific cultivars, as well as expanding targets for breeding including increase shelf life, mechanical harvestability, nutritional content, and flavor. A highly successful product of the Craig Chandler was This cultivar i s a first generation seedling selection was selected for its large, firm, coni cal shaped fruit of desirable red internal and exter nal color and excellent flavor (Chandler et al. 2000) predominant cultivar by acreage in the state of Florida and therefore an attractive system for fundamental an d applied work aimed at understanding flavor in the context

PAGE 22

22 in Florida and beyond makes it an attractive candidate for cultural, postharvest and transgenic manipulation to enha nce flavor. Perception and Integration of Flavor Flavor is the perceptual and hedonic response to the synthesis of sensory signals of taste, odor, and tactile sensation (Prescott, 2004) In the case of strawberry and other fruits, sensor y elicitation is the result of multiple direct interactions between plant and human: sugars and acids, pigments, turgor and structure, and volatile comp ounds which elicit the senses of taste, vision, tactile sensation, and olfaction, respectively, in the development of flavor (Causse et al. 2001; Christensen, 1983; Hall, 1968; Stommel et al. 2005) The senses of taste and olfaction directly sample the chemicals present in food, but striking distinctions must be made between the two systems. The basic taste qualities of sweet, sour, salty, and bitter are very limited in diversity compared to innumerable distinct o lfactory qualities N early 350 olfactory receptor genes were originally p utatively identified following sequencing of the human genome (Breslin, 2001; Zozulya et al. 2001) A more recent study using 1000 Genomes Pr oject identifies over 4,000 protein variants from 413 intact olfactory receptor loci, of which roughly 600 allelic variants per person are estimated (Olender et al. 2012) This person to person genetic variation is suggestive of a highly personalized olfactory system. Most importantly the distinction is between orthonasal and retronasal olfaction. Orthonasal olfaction is the result of smelling i.e. bringing odor in through the nose, while retronasal olfaction is elicited by odorants traveling from oral cavity or esophagus up to nasal cavity (Pierce and Halpern, 1996) Orthonasal olfaction introduce s volatile compounds

PAGE 23

23 to the nasal epithelium via inhalation, while retronasal olfaction is achieved during exhalation (Masaoka et al. 2010) Specifically, the path of odorants distinguishes the manner of interaction between consumer and potential food, with orthonasal contributing to aroma and retronasal to flavor. Integration of sensory stimuli relies on projection signals to various structures of the brain. Interestingly, portions of orthonasal (smell) and retronasal (flavor) olfaction project to different brain areas for processing (Small and Jones Gotman, 2001) while taste activation partly overlaps that of retronasal olfaction for integratio n to produce flavor (Small et al. 2004) C o activation of taste and retronasal olfaction but not orthonasal, is shown to elicit response s at otherwise independently sub threshold levels, exemplifying the ability of multiple sensory integration to intensify one another (Veldhuizen et al. 2010) Mechanical blockage of retronasal olfaction during tasting of solutions significantly reduces the ability to correctly identify solute, including sucrose (Masaoka et al. 2010) Combination of taste and retronasal olfaction results in a sensory system more adapt at analyzing the chemical content of food, but cross communication also facilitates manipulation of the system. The food industry knows of the intensification of volatile sensations by the addition of small amounts of sweeteners to solutions containing volatiles (SjStrM Loren and Cairncross Stanley, 1955) The ability of volatiles to enhance taste is also a known phenomenon (Lindemann, 2001) Enhancement of perceived sweetness is demonstrated by addition of volatil es amyl acetate (banana) (Burdach et al. 1984) and citral (Murphy and Cain, 1980) Multiple stud ies show the ability of strawberry aroma to intensify the sweetness of a sugar solution (Frank and Byram, 1988; Stevenson et al.

PAGE 24

24 1999) as well as pineapple, raspberry, passion fruit, lychee, and peach (Cliff and Noble, 1990; Stevenson et al. 1999) Also, sweetnes s enhancement has been achieved with vanilla (Lavin and Lawless, 1998) caramel (Prescott, 1999; Stevenson et al. 1999) and chocolate (Masaoka et al. 2010) indicating this phenomena is not only associated with fruit volatiles. Studies to determine perceptional differences when tomato is spiked with sug ars, acids, and volatiles indicates cross talk between taste and olfaction, in which volatiles impact perception of sweetness and vice versa (Baldwin et al. 2008) Individual volatile compounds have been implicated in tomato to intensify perceived sweetness independent of sugar content (Bartoshuk and Klee, 2013; Tieman et al. 2012) Diverse retronasal olfaction and fundamental taste sensory systems combine for flavor perception in cortical structures of the brain. Enhanced sensitivity and accuracy in discerning flavors arises from this cooperative effort, facilitating assessment of c hemical constitue nts of food via chemical senses. Multiple roles are potentially served, but foremost survival requires and avoiding the deleterious (Bresl in, 2001; Goff and Klee, 2006) Research Objectives The efforts of strawberry breeding, and other fruits and vegetables in genera l over the past half century have not been on quality traits such as taste, aroma or texture Breeder focus has been on visu al appeal, firmness for post harvest, and field traits such as yield and resistance (Ulrich et al. 2007) With flavor asso ciated traits difficult to quali fy and flavor as a whole at the discretion of a few breeders, present com mercial varieties likely fal l short of consumer preference

PAGE 25

25 Identifying F lavor R elated M etabolite T argets Using P sychophysics A massing dense flavor re levant metabolite data and corresponding consumer hedonic and sensory perceptual information of a diverse set of strawberry fruit allows for clarif ication of many factors contributing to strawberry flavor and consumer preference using a psychophysics appr oach Statistical analysis of detailed metabolite inventory of 54 unique strawberry samples coupled with consumer data of roughly 100 panelists per sample provides a means to define absolute targets in an otherwise amorphous phenotype. Field and P ostharves t E nvironment F actors Influencing F l avor Related M etabolites The breadth of genetic diversity assayed for metaboli te content is highly complimented by environmentally induced variation in strawberry fruit flavor related m etabolites. Integration of weather data with metabolic profiling allows for elucidating factors that are detrimental to sugar and volatile content, which are positive contributors to flavor. Specific postharvest light treatments indicate a potential t o influence volatile content on the shel f, while a pilot field experiment does not produce consistent effects. A Transgenic Approach to I ntroduce F. vesca Volatile C ompound in F. x ananassa An uncommon commercial strawberry volatile compound, methyl anthranilate, is the subject of an applied tra nsgenic effort. Emission of this volatile is known and preferred in many fruit and flowers including F. vesca therefore heterologous expression of ZmAAMT1.1 which is characterized to be highly specific for methyl cultivars flavor.

PAGE 26

26 The defining tenet of consumer assisted selection is the integration of consumers in the development of new cultivars. With sweetness and complex flavor being high priorities of strawberr y consumers (Colquhoun et al. 2012) it is critical to i dentify metabolites that are significantly imp actful up on consumer perception and environmental factors affecting them This work provides individual targets for breeding, fundamental science, and transgenic efforts to prod uce more flavorful strawberries using consumer assisted selection.

PAGE 27

27 CHAPTER 2 STRAWBERRY FLAVOR: DIVERSE CHEMICAL COMPOSITIONS, A SEASONAL INFLUENCE, AND EFFECTS ON SENSORY PERCEPTION Background Modern fully ripe strawberry ( F x ananassa ) fruit is characterized by its large size (MacKenzie et al. 2011) vibrant red color (Hong and Wrolstad, 1990) reduced fir mness (Brummell and Harpster, 2001) distinct aroma (Ulrich et al. 1997) and sweet fruity flavor (Schieberle and Hofmann, 1997) The three stages of non climacteric, auxin dependent strawberry fruit development; division, expansion and ripening, involve gains in diameter and fresh weight; during which color shifts from green to white to dark red in roughly forty days following anthesis (Zhang et al. 2011a) Ripening of strawberry fruit results in the accumulation of multiple sugars and organic acids, culminating with peak volatile emission (Menager et al. 2004) Flavor is the perceptual and hedonic response to the synthesis of senso ry signals of taste, odor, and tactile sensation (Prescott, 2004) The senses of taste and olfaction directly sample the chemicals pr esent in food; sugars, acids, and volatiles. These metabolites are primary sensory elicitors of taste and olfaction that attenuate the perception and hedonics of flavor. A consumer based survey indicated sweetness and complex flavor as consistent favorable (Colquhoun et al. 2012) Thus a ripe strawberry is m etabolically poised to elicit the greatest sensory and hedonic responses from consumers. During strawberry fruit development sucrose is continually imported from photosynthetic tissue. A consistently high sucrose invertase activity contributes to carbon si nk strength in all developmental stages of fruit (Basson et al. 2010) Delivered sucrose is hydrolyzed into glucose and fructose and these three carbohydrates

PAGE 28

28 constitute the major soluble sugars of ripe strawberries, a result of their continual accum ulation during fruit development (Fait et al. 2008) In fact, an approximately 150% increase in their sum during ripening has been observed (Basson et al. 2010; Menager et al. 2004) The influx of carbon initiates a complex network of primary and secondary metabolism specific to ripening strawberry fruit (Fait et al. 2008) The metabolic activity of ripening strawberry is visualized by the late accum ulation of the predominant red pigment, pelargonidin 3 glucoside (Hoffmann et al. 2006) an anthocyanin derived from the primary metabolite phenylalanine (Fait et al. 2008) The dynamics of fruit development are genetically driven as nearl y 15% of cDNAs probed using a microarray exhibit significant differential expression in red compared to green fruit (Aharoni et al. 2000) One up regulated gene, POLYGALACTURON ASE 1.1 contributes to fruit softening (Quesada et al. 2009) by aiding in catalytic cell wa ll disassembly (Trainotti et al. 1999) Reduction of firmness is also attributed to dissolution of middle lamella, which functions in cell to cell adhesion (Brummell and Harpster, 2001) Active shifts in transcript accumulation throughout ripening result in metabolic network reconfiguration altering the chemical and physical properties. Metabolic profiling indicates an accumulation of sugars, organic acids, and fatty acids as well as the consumption of amino acids during fruit development, which is likely accountable for increases of alkanes, alcohols, aldehydes, anth ocyanins, ketones, esters, and furanones during fruit ripening (Zhang et al. 2011a) Many of these chemical classes serve as precursors to volatile synthesis (Perez et al. 2002) thus facilitating a metabolic flux through biosynthetic pathways for increased and diverse

PAGE 29

29 volatile emissions in ripe strawberry fruit, predominantly furanones, acids, esters, lactones, and terpenes (Menager et al. 2004) Over 350 volatile compounds have been identified across Fragaria (Du et al. 2011b; Maarse, 1 991) however within a single fruit, far fewer compounds are detectable and even fewer contribute to aroma or flavor perception. A cross comparison of five previous studies which analyze strawberry volatiles depicts the lack of agreement in defining chemi cal constituents of strawberry aroma. Each source considers a highly variable subset of total volatiles, which are determined by signal intensity and/or human perception of isolated compounds (Hakala et al. 2002; Je tti et al. 2007; Olbricht et al. 2008; Schieberle and Hofmann, 1997; Ulrich et al. 1997) Mutual volatiles across studies include butanoic acid, methyl ester (623 42 7); butanoic acid, ethyl ester (105 54 4); hexanoic acid, methyl ester (106 70 7); hex anoic acid, ethyl ester (123 66 0); 1,6 octadien 3 ol, 3,7 dimethyl (linalool) (78 70 6); butanoic acid, 2 methyl (116 53 0); and DMF (4077 47 8), the current consensus of integral strawberry aroma compounds. Comparisons of consumer preference among a var iety of fresh strawberries and their volatile profiles describes less preferable varieties as possessing fewer esters, more decalactones and hexanoic acid (Ulrich et al. 1997) The breadth of volatile phenotypes previously reported highlights the diversity across strawberry genotypes and under scores the complexity of the aggregate trait of aroma and flavor. Annual horticulture of strawberry in Florida requires continual harvest of ripe fruit from late November through March. The mild winter production environment affects fruit quality as gradua lly increasing temperatures beginning in mid January result in a late

PAGE 30

30 season decline of soluble solids content (SSC) (MacKenzie et al. 2011) In fact increasing temperature is known to be responsible for increasing fruit maturation rate and decreasing SSC independent of flowering date (MacKenzie and Chandler, 2009) Previous work also identifies variability of SSC, as well as titratable acidity (TA) and multiple classes of volatile compounds across harvest dates (Jouquand et al. 2008) The complex fruit biochemistry, which is variably affected by genetic, environmental, and developmental factors, coupled with defining strawberry flavor cumbersome. Here we exploit the genetic and within season variability of fruit to provide as many unique strawberry experiences as possible to a large sample of consumers. Parallel assays of ripe strawberry samples quantify fruit traits of TA, pH, SSC, and fruit firmness, as well as the content of malic acid, citric acid, glucose, fructose, sucrose, and 81 volatile compounds. The contributions of the se attributes to fruit quality wa s deter mined by simultaneously evaluating samples for perceived sensory intensities of sourness, sweetness, and strawberry flavor, as well as the hedonic responses of texture and overall liking i.e. the pleasure derived from consuming a strawberry sample, by con sumer panelists during the 2011 and 2012 seasons in Florida. Data analyses determine progression of harvest season effects, gross variation of strawberry experiences, and factors influencing hedonics and sensory perception of strawberry fruit consumption u sing a psychophysics approach. Results suggestive of specific volatile compounds enhancing perceived sweetness has led to an application for patent (#13/869,132) with the United States Patent and Trademark Office.

PAGE 31

31 Results The inventory of 54 fully ripe uni que strawberry samples (35 cultivars, 12 harvests, two seasons) assayed for TA, pH, SSC, firmness, as well as the concentrations of malic acid, citric acid, glucose, fructose, sucrose, and quantity of 81 volatile compounds is reported ( Table 2 1 ). Cluster analysis of relative chemical composition of all samples and derived hierarchy of both cultivar and metabolite relatedness is displayed ( Figure 2 1 ). The vertical dendrogram ( Figure 2 1 ) demonstrates the lack of relatedness among volatile compound concentr ation through large distances of initials segments, as well as the high number of clusters. Slightly more structure was observed among the samples, horizontal dendrogram ( Figure 2 1 ), due to genetic or environmental effects. Progression of Harvest Season A ffects Metabolic Content and Perceived Quality of Strawberry Ranges of weather parameters are consistent between both 2011 and 2012 seasons, except for slightly more precipitation during late January of 2011 ( Figure 2 2 G, H). Solar radiation, minimum and maximum temperature all increase d gradually and show ed similar trends in both seasons ( Figure 2 2 A D). Relative humidity also, remain ed constant during and across seasons ( Figure 2 2 E, F). One manifestation of these environmental changes over a harvest s eason wa s the negative relationship between SSC and harvest week (R 2 = 0.444***) (p < 0.05*, 0.01**, 0.001***) ( Table 2 3 ). The sugars glucose, fructose, and sucrose were quantified, and their sum (total sugar) shows a strong positive correlation to SSC (R 2 = 0.733) (data not shown) and to harvest week (R 2 = 0.287***) ( Table 2 3 ). Biochemical differences as a result of harvest week include d a significant reduction in sucrose concentration (R 2 = 0.350***) ( Figure 2

PAGE 32

32 3 A). However, glucose (R 2 = 0.064) ( Figure 2 3 B) and fructose (R 2 = 0.041) ( Figure 2 3 C) did not show a significant change within season. Total volatile content decrease d as the seasons progress ed (R 2 = 0.338***) ( Figure 2 3 D). Also, a significant correlation was observed among total volatiles and sucrose (R 2 = 0.305***) ( Figure 2 3 E) but not glucose (R 2 = 0.005) (data not shown) or fructose (R 2 = 0.001) ( Figure 2 3 F). The simultaneous waning of SSC predominantly s ucrose, and volatiles wa s perceivable, as overall liking decreases as the season prog resses (R 2 = 0.422***) ( Figure 2 4 E). The hedonic response to strawberry samples wa s measured as overall liking using the hedonic general labeled magnitude scale (gLMS) that ranges from 100 to +100, i.e. least to most pleasurable experience (Bartoshuk et al. 2004; Bartoshuk et al. 2003; Bartoshuk et al. 2005; Tieman et al. 2012) The strawberry sample with the highest overall liking wa s from first harvest week in the second season (sn 2, w k 1), which elicit ed an overall liking of 36.6 ( Table 2 1 ). The lowest, a d at 13.3, while the sample set median wa s 23.5 ( Table 2 1 ). The benchmark sample contains 3.5 fold more sucrose and 27% more total volatiles than the least liked fruit ( Table 2 1 ), demonstrating the disparity between early and late harvest week fruit quality an d its effect on consumer preference Overall Liking is Subject to Ratings of Sweetness, Flavor, and Texture In order to elucidate factors contributing to a positive strawberry experience, overall liking of strawberry samples wa s fit against the hedonic measure of texture liking and the sensory intensities of sweetness, sourness, and strawberry flavor intensity ( Fig ure 2 4 A D). High correlation with significant fit exists for texture liking (R 2 = 0.490***) ( Figure 2 4 A), sweetness intensity (R 2 = 0.742***) ( Figure 2 4 B), and

PAGE 33

33 strawberry flavor intensity (R 2 = 0.604***) ( Figure 2 4 D). However, sourness intensity show ed no correlation to overall liking (R 2 = 0.008) ( Figure 2 4 C). Texture liking ha d a significant influence on overall liking, and though increasing firmness contribute d to greater texture liking (R 2 = 0.358***) ( Figure 2 4 I), firmness d id not influence overa ll liking (R 2 = 0.034) ( Table 2 4 ). Sweetness intensity wa s the strongest driver of overall liking measured in this study. The correlation between total sugar and overall liking (R 2 = 0.488***) ( Figure 2 4 F) demonstrate d the aggregate sugar metabolites eff ect on hedonic response to strawberry fruit. Total sugar concentration account ed for nearly a majority of the observed overall liking variation but wa s far from a complete measure. Sourness intensity appears to have no influence on the hedonic response to strawberry fruit On the other hand, a limited range of perceivable sourness intensity may be underrepresenting the effect as fit of TA to overall liking wa s significant, even if minor (R 2 = 0.099*) ( Figure 2 4 G). Total volatiles wa s the second aggregate m etabolite measure having a significant enhancing effect on the overall liking of strawberry (R 2 = 0.179**) ( Figure 2 4 H). This wa s not surprising, as strawberry flavor intensity exhibits the second highest correlation to overall liking ( Figure 2 4 D). Textu re Liking Correlates to Fruit Firmness The upper limit for hedonics of texture wa s comparable to that of overall liking and was observed in (sn 1, wk 2) with an average of 35.7, d a ( Table 2 1 ). Firmness of samples wa s assayed by measuring the force required for a set penetration of the fruit, acting as a prox y for texture. The firmness of the fresh strawberry exhibited nearly a five

PAGE 34

34 1, wk 7) and 1.0 kg for (sn 1, wk 5) ( Table 2 1 ). Increasing force of penetration, i.e. increasing fi rm ness of berries, wa s positively correlated with texture liking, indicating a hedonic response to firmer fruit (R 2 = 0.358***) ( Figure 2 4 I). However, the texture liking rating for the two samples with greatest firmness is less than expected ( Figure 2 4 I) Sweetness Intensity is a Result of Sugar Content Perceived sweetness intensity was the greatest predictor of overall liking. In fact, the same samples scoring the highest and lowest for overall liking, (sn 1, wk 6), elicit ed the greatest (36.2) and least (14.59) intense sensations of sweetness ( Table 2 1 ). The early and late harvest week samples support ed the observ ed decline in perceived sweetness intensity across harvest weeks (R 2 = 0.471***) ( Table 2 3 ) which wa s also observable for multiple sugar measures ( Figure 2 3 A C). In the 54 samples assayed, the total sugar concentration ranged from 2.29 7.93%, a 3.5 fold difference ( Table 2 1 ). Glucose and fructose concentrations exhibit ed highly similar ra nges to each other, 0.66 2.48% and 0.75 2.61%, respectively ( Table 2 1 ), and near perfect correlation (R 2 = 0.984***) (data not shown) within a sample. However, the concentration of glucose or fructose wa s not predictive of sucrose concentration (R 2 = 0.011 and 0.004, respectively) (data not shown). Sucrose demonstrated a more dynamic state as its concentration dips as low as 0.16% and up to 2.84%, nearly a seventeen fold difference among all samples. Sucrose wa s the single metabolite with the most sig nificant contribution to overall liking (R 2 = 0.442***) ( Table 2 4 ). Individually, sucrose (R 2 = 0.445***) ( Figure 2 4 M), glucose (R 2 = 0.337***) ( Figure 2 4 N), and fructose (R 2 = 0.300***) ( Table 2 4 ) all

PAGE 35

35 significantly influence d the variation in sweetnes s intensity. However, total sugar actually only account ed for slightly more than two thirds of sweetness intensity variation (R 2 = 0.687***) ( Figure 2 4 L) likely a result of covariation of glucose and fructose. Interestingly, the total volatile content of a sample correlate d positively with sweetness intensity, potentially accounting for up to 13.9%** of variation in sweetness intensity ( Figure 2 4 O). Sourness Intensity is Partially Explained by Titratable Acidity 1, wk 6) led to the lowest maximum consumer response of 24.6 ( Table 2 1 ). This same sample rate d as the lowest in terms of overall liking and sweetness ( Table 2 1 ). Acidity of strawberry fruit wa s assayed using measures of pH, TA, citric acid and malic ac id. The pH of strawberry samples ranged from 3.35 to 4.12, while TA ranges from 0.44% to 1.05%. The rang e of malic acid across samples wa s 0.078% to 0.338% while citric acid ranged from 0.441% to 1.080% ( Table 2 1 ). TA ha d the greatest correlation to sourn ess intensity (R 2 = 0.314***) ( Figure 2 4 P), even compared to pH (R 2 = 0.118*), malic acid (R 2 = 0.189**) ( Figure 2 4 Q), or citric acid (R 2 = 0.146**) (Fig.3R) concentration. Citric acid concentration in general is approximately three fold greater than mal ic acid and ha d a significant correlation to TA (R 2 = 0. 49***) (data not shown). There wa s no correlation of malic acid to TA (R 2 = 0.01) (data not shown). Citric acid did not show any significant correlation to overall liking (R 2 = 0.056) ( Table 2 4 ), pre sumably due to the minimal relationship among sourness intensity and overall liking (R 2 = 0.008) or limited range of sourness intensity ratings ( Figure 2 4 C).

PAGE 36

36 Flavor Intensity is Influenced by Total and Specific Volatile Content In this study, strawberry f lavor intensity accounts for the retronasal olfaction component of chemical senses, which compliments sourness and sweetness intensities contribution to taste. The ove rall highest sensory intensity wa s 37.5 for strawberry flavor of (s n 2, wk 1), which also rate d highest for overall liking and sweetness intensity. Opposite this, FL 05 85 (sn 1, wk 6) deliver ed the least intense strawberry flavor experience with a score of 19.4. Total volatiles in (sn 2, wk 1) wa s over 50% greater than in FL 05 85 and seven more volatiles compounds are detected ( Table 2 1 ). Total volatiles within a sample contribute to strawberry flavor intensity (R 2 = 0.167**)( Figure 2 4 T), but it wa s not simply the sum of volatile constituents tha t explain the effect. For instance, the maximum total volatile content detected within a sample, 27.3 g 1 gFW 1 hr 1 did not result in the greatest flavor intensity (30.5) and the minimum, 8.5 g 1 gFW 1 hr 1 from (sn 2, wk 9), did not rate as the least flavorful (25.8) ( Table 2 1 ). The chemical diversity of the resources analyzed allow ed for the identification of 81 volatile compounds from fresh strawberry fruit ( Figure 2 5 ). The majority of compounds are lipid de rived esters, while lipid derived aldehydes account for the majority of volatile mass. Terpenes, furans, and ketones were also represented in the headspace of strawberry. Forty three of the eighty one volatile compounds were not detected ( 0.06 n g 1 gFW 1 hr 1 ) in at least one sample i.e. 38 volatiles were measured in all samples and appear to be constant in the genetic resources analyzed ( Table 2 1 ). No cultivar has detectable amounts of all 81 volatiles. Samples of ( proprietary cultivar of commercial entity, identity withheld) and FL 06 38 were lacking detectable amounts of just one compound,

PAGE 37

37 benzoic acid, 2 amino methyl ester (134 20 3) (methyl anthranilate) which wa s 1 ( Table 2 1 wa s qualitatively the most deficient sample, lacking detectable amounts of 19 of 81 compounds, had the second lowest amount of total volatiles, and a flavor intensity of 24.8 ( Table 2 1 ). methylbutyl ester (60415 61 4), wa s not detectable in eight samples, and significantly correlate d to flavor intensity (R 2 = 0.233***) ( Table 2 4 ), despite maximum mass of only 11.5 n g 1 gFW 1 hr 1 ( Table 2 1 ). Interestingly, the most abundant ester, butanoic acid, methyl ester wa s measured at over 7 g 1 gFW 1 hr 1 from PROPRIETARY 2 (sn 1, wk 3) and ha d less correlation to flavor (R 2 = 0.097*) ( Figure 2 4 V) than buta noic acid, 1 methylbutyl ester. Hexanoic acid, ethyl ester exhibits over 200 fold difference across samples, ha d no bearing on sensory perception ( Table 2 4 ). Likewise, hexanal (66 25 1) wa s t he second most abundant individual compound, an aldehyde detecte d in all samples, exceed ed 11 g 1 gFW 1 hr 1 ( Table 2 1 ), and did not have a significant correlation to flavor intensity (R 2 = 0.016)( Table 2 4 ). Conversely, t wo minor level aldehydes demonstrate d a disparity in effect: 1576 87 0 is enhancing toward flavor intensity (R 2 = 0.239**) ( Figure 2 4 U), while pentanal (110 62 3) was the only compound that negatively correlates to flavor (R 2 = 0.079*) ( Figure 2 4 W). The significant contribution of the terpenes 1,6,10 dodecatrien 3 ol, 3,7,11 trimethyl (6 E ) (40716 66 3) and 1,6 octadien 3 ol, 3,7 dimethyl to flavor intensity positively correlate d with their increasing concentration (R 2 = 0.112* and R2 = 0.074*, respectively) ( Table 2 4 ), as well as, the level of a characteristic strawberry furan, DMF (R 2 = 0.108*) ( Table 2 3 ). In total, thirty volatiles diverse in structure and

PAGE 38

38 degree of presence were fou 0.05). Specific Volatiles Enhance Sweetness Intensity Independent of Sugars Multiple regressions of individual volatile compounds against pe rceived intensity of sweetness wa s performed independent of either glucose, fructose, or sucrose concentration ( Table 2 5 ). Twenty four volatile compounds show ed significant fructose concentration, twenty two of which were mutual between the two monosaccharides. Twenty volatiles were found to enhance sweetness intensity independent of sucrose concentration; only six of these volatiles were shared with those independent of glucose and fructose: 1 penten 3 one (1629 58 9); 2(3 H ) fur anone, dihydro 5 octyl (2305 05 7); butanoic acid, pentyl ester (540 18 1); butanoic acid, hexyl ester (2639 63 6); acetic acid, hexyl ester (142 92 7); and butanoic acid, 1 methylbutyl ester. Only three compounds were found to be negatively related to sw eetness independent of at least one of the sugars: octanoic acid, ethyl ester (106 32 1) exclusively independent of glucose; 2 pentanone, 4 methyl (108 10 1) mutually independent of glucose and fructose; and 2 buten 1 ol, 3 methyl 1 acetate (1191 16 8) exclusively independent of sucrose. Discussion Exploitation of genetic diversity and environmental variation allows for a wide range of consumer hedonic and sensory responses. A nearly three fold difference in overall liking of strawberry is observable wit hin all samples. The highest and lowest rating samples are week six in the first season; two cultivars that are grown under the same conditions, but

PAGE 39

39 product of separate breeding progra ms and from opposite ends of the harvest season. The cultivars in this study represent a large proportion of commercial strawberry acreage in North America, breeding selections, and European cultivars. A genetic collection to enhance the range of diversity for flavors and chemical constituents. Despite the perennial life cycle of strawberry much commercial production uses annual methods, which in sub tropical Florida allows for continual harvest of ripe fruit from late November through March. In general, pr ogression of harvest of non determinant, non climacteric fruit throughout a season results in decreased overall liking, attributed to perceivable differences in fruit quality ( Figure 2 4 E). Increasing texture liking, sweetness intensity, and strawberry fla vor intensity significantly increase overall liking, while sourness intensity is not clear ( Figure 2 4 A D). Therefore, overall liking is the cumulative measure of the experience from eating a strawberry fruit. Integration and synthesis of response to senso ry signals of taste, olfaction, and tactile sensation constitute an eating experience (Prescott, 2004) and drive overall liking. The senses of taste and olfaction sample the chemicals present in food like sugars, acids, and volatile chemical compounds. These elicitors attenuate the perception and hedonics of food (Fujimaru and Lim, 2013; Lindemann 2001) Ratings of strawberry fruit are correlated to specific chemical or physical attributes, especially sweetness and flavor intensity, the two greatest drivers of overall liking. Much work has been done to measure sugars and volatile compounds in str awberry fruit in attempt of understanding sweetness and flavor, and these aims are in line with consumer demand. A consumer survey using 36 attributes of strawberry

PAGE 40

40 the ideal strawberry experience (Colquhoun et al. 2012) Using the same gLMS scales employed in the curre nt study, means for ideal strawberry and tomato (Tieman et al. 2012) overall liking, sourness intensity, and flavor intensity are similar. Ideal flavor evoked the highest mean sensory intensity for both, 45 on an i ntensity scale of 0 100, exemplifying its importance to the consumer. Interestingly, a large disparity for ideal sweetness intensity is found; 42 and 33 for strawberry and tomato, respectively. Ideal sweetness intensity is much greater in strawberry, poten tially due to differences in consumption. Strawberry is often consumed fresh and is a delicacy or dessert fruit, while tomato is savory and often an ingredient in complex recipes. Therefore, the desire for sweetness is much greater in strawberry. The over all liking of strawberry fruit is significantly related to texture liking ( Figure 2 4 A), and increasing fruit firmness accounts for more than a third of increasing texture liking ( Figure 2 4 I). The five fold variation in firmness can be attributed to varia tion in fruit development or softening ( Table 2 1 ). Strawberry fruit development consists of division, expansion, and ripening (Zhang et al. 2011a) Developmentally regulated, ripening associated fruit softening is multifaceted (Quesada et al. 2009) including catalytic cell wall disassembly (Trainotti et al. 1999) and dissolution of cell to cell adhesion (Brummell and Har pster, 2001) The relationship between texture liking and firmness does not appear entirely linear, because the two firmest samples are close to average texture liking ( Figure 2 4 I). Excessively firm fruits may be perceived as under ripe while those with less firmness may be considered over ripe; affecting texture liking. Fruit can progress through ripening, from under to over ripe, in ten days (Zhang et al.

PAGE 41

41 2011a) exemplifying the narrow window in which multiple facets of fruit quality must synchronize. Despit e a moderate range of intensity, perceived sourness has little to no bearing on overall liking ( Figure 2 4 C). Just over 30% of sourness intensity variation can be accounted for by positive correlation with TA. The concentrations of citric acid and malic a cid metabolites are likely additive toward the effect of TA on sourness intensity, and in fact both organic acids have significant correlations to TA (data not shown). Despite a lack of influence by sourness intensity on overall liking which may be a resu lt of limited intensity range metabolites of sourness have a critical role in fruit biochemistry, as increased TA shows a significant minor correlation with overall liking ( Table 2 4 ) and correlates significantly with SSC (data not shown). This co lineari ty is due to accumulation of sugars and subsequent biosynthesis of organic acids during ripening of fruit (Fait et al. 2008; Menager et al. 2004; Zhang et al. 2011a) Citric acid is the predominant organic acid i n ripe fruit (Mikulic Petkovsek et al. 2012) and its concentration is fairly stable during ripening. Also, it is known to act as an intermediate between imported sucrose and fatty acid bi osynthesis (Fait et al. 2008) which may facilitate enhancement of overall liking. The consumer rating of sweetness intensity is the primary factor contributing to overall liking, and sweetness is the component of taste pe rception facilitating the detection of sugars. Sugars are simple carbohydrates, a readily available form of energy, and the degree of correlation among sweetness and overall liking is due to hedonic effect (Lindemann, 2001) Variation in sweetness intensity is best explained by sug ar content ( Figure 2 4 L) and SSC. More commonly SSC is used to estimate sugar

PAGE 42

42 concentration a valid indicator of sweetness in strawberry (Jouquand et al. 2008; Whitaker et al. 2011) Previous quantification of in dividual sugars within a strawberry identifies sucrose, glucose, and fructose as the predominant soluble solids (Basson et al. 2010; Menager et al. 2004; Mikulic Petkovsek et al. 2012; Whitaker et al. 2011) Suc rose concentration more than any other measure, is responsible for the most variation in SSC, sweetness intensity and overall liking ( Table 2 4 ). Metabolites contributing to perceived sweetness intensity have the greatest influence on the overall hedoni cs of strawberry. A significant decrease in sweetness intensity occurs during the seasons, and unfortunately overall liking decreases as well. The extended harvest season of strawberry has an effect on fruit quality ( Figure 2 4 E) likely due to environmenta l changes ( Figure 2 2 ) or plant maturity. These factors are likely causative of the observable decrease in sweetness intensity as the season progresses ( Table 2 3 ). SSC, the best predictor of sweetness intensity, decreases during the season as the plant is subjected to increasing temperatures ( Table 2 3 ), which likely alters whole plant physiology and more specifically fruit biochemistry during development and ripening, affecting fruit quality. Development of fruit under elevated temperature increases fruit maturation rate and decreases SSC independent of flowering date i.e. plant maturity (MacKenzie and Chandler, 2009; MacKenzie et al. 2011) A significant and strong decrease in sucrose and a lack of change in gluco se and fructose indicates sucrose as the waning constituent of SSC within a season ( Figure 2 3 A C). Sucrose concentration has greatest variability among the three sugars and shows no significant relationship to glucose or fructose concentration. However, a near perfect statistical relationship observed between glucose and fructose is likely due to

PAGE 43

43 their biosynthetic association. During strawberry fruit development sucrose is continually translocated from photosynthetic tissue, while a consistently high sucr ose invertase activity in fruit hydrolyzes sucrose into glucose and fructose, maintaining sink strength of fruit (Basson et al. 2010) and in turn feed biosynthetic pathways (Fait et al. 2008) Increased maturation ra te hastens fruit development, potentially decreasing cumulative period sucrose is imported to fruit, and inhibiting sucrose accumulation to affect other fruit quality attributes. Total volatile content has an indirect dependence on sucrose concentration ( F igure 2 3 E), and a decrease in total volatiles is observed as the seasons progress ( Figure 2 3 D). Generation of glucose and fructose initiates a complex network of primary and secondary metabolism specific to ripening strawberry fruit, in which sucrose is principal and limiting to the strawberry fruit biosynthetic pathways (Fait et al. 2008) The primary metabolite classes of fatty acids and amino acids are derived from sucrose in a fruit specific metabolism and their concen trations decrease in the final stage of ripening (Fait et al. 2008) The culmination of ripening coincides with peak concentration of volatile secondary metabolites (Menager et al. 2004) and upregulation of associated biosynthetic genes (Cumplido Laso et al. 2012) Influence of harvest date on headspace of fresh strawberry fruit is known (Pelayo Zaldivar et al. 2005; Watson et al. 2002) One hypothesis, increased volatile content is dependent on more free sucrose, i.e. a larger imported reserve, facilitating greater flux through primary and secondary metabo lism. Glucose and fructose concentrations are tightly correlated, show less variation, less seasonal influence, and lack of correlation to sucrose, indicative of tighter biochemical regulation.

PAGE 44

44 Strawberry flavor intensity is the second greatest determinant of overall liking ( Figure 2 4 D) and accounts for perception of volatile compounds through retronasal olfaction. A significant positive relationship exists among total volatile content and the flavor intensity for a given sample, however, total volatile co ntent is not entirely explanatory of flavor intensity. The maximum rating for strawberry flavor intensity by (sn 2, wk1) is the greatest consumer response evoked within this study ( Table 2 1 ), highlighting the significance of sensory perception of aroma. However, this sample only has slightly more than 60% of total volatile mass of the greatest sample. The extent of volatile phenotype diversity is great enough across strawberry fruit to not only be discerned but be preferred. Within th e genetic resources of F. x ananassa analyzed in this study 81 compounds are reproducibly detected, but not one cultivar has detectable amounts of all compounds. Accumulation of sugars, organic acids, and fatty acids, as well as the consumption of amino ac ids occurs during ripening (Zhang et al. 2011a) Many of these chemical classes serve as precursors to volatile synthesis (Perez et al. 2002) thus fac ilitating a flux through biosynthetic pathways for increased and diverse volatile emissions in ripe strawberry fruit, characterized by acids, aldehydes, esters, furanones, lactones, and terpenes (Jetti et al. 2007; Menager et al. 2004) Over 350 volatile compounds are identified across Fragaria (Du et al. 2011b; Maarse, 1991) The concentrations of individual volatile compounds within fruit can have a significant influence on flavor intensity, but which volatiles are determinant of flavor has a lack of agreement

PAGE 45

45 Previous determination of flavor relevance relied on approaches in which importance of volatiles is based on analytical signal intensity and/or human perception of single isolated volatile compound via orthona sal olfaction (Hakala et al. 2002; Jetti et al. 2007; Olbricht et al. 2008; Schieberle and Hofmann, 1997; Ulrich et al. 1997) negating the complex system of strawberry fruit or actual flavor relevant retronasal olfaction. Of the forty six volatile compounds cited as relevant to strawberry flavor in five studies (Hakala et al. 2002; Jetti et al. 2007; Olbricht et al. 2008; Schieberle and Hofmann, 1997; Ulrich et al. 199 7) only seven are common to at least three of the studies, exemplifying the lack of agreement in defining flavor relevant constituents. This agreement includes butanoic acid, methyl ester; butanoic acid, ethyl ester; hexanoic acid, methyl ester; hexanoic acid, ethyl ester; 1,6 Octadien 3 ol, 3,7 dimethyl (linalool) ; butanoic acid, 2 methyl ; and DMF all of which are quantified in this report. These compounds exhibit adequate variability in fruit samples to discern dose dependent effect on flavor intensi ty. However, only 1,6 Octadien 3 ol (linalool) 3,7 dimethyl ; butanoic acid, ethyl ester; butanoic acid, methyl ester; and DMF show significant positive correlation with flavor intensity ( Table 2 4 ). These compounds that are found to influence flavor inte nsity represent diverse classes, terpenoid alcohol, two esters, and a furan, respectively, while the three compounds not fitting to flavor are all esters. With esters accounting for the majority of chemical compounds detected in strawberry it is possible t hat too much emphasis is placed on the chemical class for flavor, or that in a complex mixture less are perceivable than when smelled individually. These volatiles may have no bearing on strawberry flavor, but have been targets due to quantity, threshold r atios, or simply identity.

PAGE 46

46 Over one third of volatiles in this study significantly correlate with strawberry flavor intensity, potentially enhancing perception of a complex and highly variable volatile mixture ( Table 2 4 ), seventeen of which are not of pre vious strawberry flavor focus. Two of these unrecognized compounds, 1 hexanol (111 71 7) and butanoic acid, 3 methyl butyl ester (109 19 3), are present in the most flavorful strawberry sample but undetected in the least flavorful ( Table 2 1 ). This pair of compounds as well as pentanoic acid, ethyl ester (539 82 2) and butanoic acid, 3 methyl octyl ester (7786 58 5), also present/absent in the most/least flavorful, have relatively minor amounts but show evidence of enhancing perceived sweetness intensit y independent of individual sugars. Volatiles with r elatively low concentration s are indicated as new impactful components of strawberry flavor. Thirty eight volatile compounds are observed to significantly enhance the perceived intensity of sweetness; twe nty two mutually independent of glucose and fructose, fourteen uniquely independent of sucrose, and six compounds mutually independent of all three sugar s : 1 penten 3 one; 2(3 H ) furanone, dihydro 5 octyl dodecalactone) ; butanoic acid, pentyl ester; butanoic acid, hexyl ester; acetic acid, hexyl ester; and butanoic acid, 1 methylbutyl ester ( Table 2 5 ). In tomato, similar analysis of a volatile subset identifies three compounds enhancing sweetness inten sity independent of fructose: geranial; 1 butanol, 3 methyl (123 51 3); and butanal, 2 methyl (96 17 3) (Tieman et al. 2012) These compounds are not identified in the current study, therefore the effect cannot b e confirmed in a second system. Botanically, tomato is considered a true fruit and demonstrates climacteric ripening, while strawberry fruit is non climacteric and considered an aggregate accessory fruit. The developmental

PAGE 47

47 origin of the flesh that is consu med is divergent, exhibiting unique biochemistries, but the observance of volatile compounds potentially enhancing perceived sweetness appears to be widespread in fruit. Orthonasal (smell) and retronasal (flavor) olfaction each project to different brain a reas for processing (Small and Jones Gotman, 2001) and taste projects to the same brain area as retronasal olfaction for integration to produce flavor (Small et al. 2004) This integration has a remarkable consequence: taste and retronasal olfaction can intensify one another. The food industry knows of the intensification of volatile sensations by the a ddition of small amounts of sweeteners to solutions containing volatiles (S jStrM Loren and Cairncross Stanley, 1955) The ability of volatiles to enhance taste is also a phenomena (Burdach et al. 1984; Lindemann, 2001; Murphy et al. 1977) and one study shows the ability of strawberry aroma to intensify the sweetness of a sugar solution (Frank and Byram, 1988) The results here narrow the previous effect of enhanced sweetness by strawberry aroma, a variable mixture, to individual compounds in the fruit. These volatiles are not present at the highest amou nts in fruits and most are not targets of flavor analysis. Also, a majority appear to be associated with lipid metabolism, like many other volatiles quantified in this work, yet their presence or increased concentration has an enhancing effect on perceive d sweetness independent of sugars. Technically, sweetness is a facet of taste (Lindemann, 2001) Therefore a means to convey sweetness via volatiles can serve as an attractant to seed dispersers of wild strawberry, or perhaps it is a result of artificial selection (Aharoni et al. 2004) to enhance a limited sugar capacity in commercial fruit.

PAGE 48

48 Strawberry fruit ripening results in softening of flesh, peak volatile emission, and accumulation of sugars. This highly coordinated process results in fruit with strong liking due primarily to texture, flavor, and sweetness. However, cultivar, environmental conditions, and their interactions influence fruit attributes, altering the composition of strawberry. This diversity allows for a gamut of experiences such tha t the hedonics and intensities of these sensations can vary greatly. The importance of sucrose to sweetness intensity is evident, and the correlation of total volatiles to sucrose highlights the dependence of secondary metabolism to primary metabolism. Ind ividual volatiles correlate to strawberry flavor intensity, helping to better define distinct, perceptually impactful compounds from the larger mixture of the fruit. The dependence of liking on sweetness and strawberry flavor is undermined by environmental pressures that reduce sucrose and total volatile content. A cultivar that exhibits minimal seasonal environmental influence presents itself as a breeding ideotype, as maintenance of sucrose concentration may alleviate loss of overall liking. Selection for increased concentrations of volatile compounds that act independently of sugars to enhance sweetness can serve as an alternate approach. The volatiles described herein are sampled mainly from current commercial cultivars and are therefore feasible target s for varietal improvement in the short term, whereas future studies will be necessary to identify sweet enhancing volatiles not already present in elite germplasm. Materials and Methods Plant Material Thirty five strawberry cultivars and selections were g rown during the 2010 2011 and 2011 2012 winter seasons according to current commercial practices for annual strawberry plasticulture in Florida (MacKenzie et al. 2011; Santos et al. 2012) The

PAGE 49

49 cultivars were chose n to represent a large proportion of commercial strawberry acreage in North America from both public and private breeding programs. Additional breeding selections and European cultivars were added to enhance the range of diversity for flavors and chemical constituents. Fully ripe fruit by commercial standards (Strand, 2008) was harvested from three to five cultivars on Monday mornings, delivered to the respective laboratories, and stored at 4C in the dark overnight for simultaneous analysis of fresh strawberry fruit volatiles, firmness, and sensory analysis on Tuesdays; as well as sample preparation for later sugar and acid m easurements. Six harvests in both seasons allows for the complete analysis of fifty four samples. Weather d ata was obtained from the Balm, FL station of the Florida Automated Weather Network (http://fawn.ifas.ufl.edu). Daily maximum and minimum temperature recording height was 60 cm, and daily average relative humidity, rain, and solar radiation were recording at 2 m. Volatile Analysis At least 100 grams or seven berries of each sample were removed from 4C dark overnight storage prior to volatile collectio n. Samples were homogenized in a blender prior to splitting into three 15 gram replicates for immediate capturing of volatile emissions and the remainder frozen in N 2 (l) and stored at 80C for later sugar and acid quantification. A two hour collection in a dynamic headspace volatile collection system (Underwood et al. 2005) allow ed for concentration of emitted volatiles on HaySep 80 100 porous polymer adsorbent (Hayes Seperations Inc., Bandera, TX, USA). Elution fro m polymer wa s described by Schmelz et al. (Schmelz et al. 2003) Quantifica tion of volatiles in an elution was performed on an Agilent 7890A Series gas chromatograph (GC) (carrier gas; He at 3.99 mL min 1 ; splitless injector,

PAGE 50

50 temperature 220C, injection volume 2 l) equipped with a DB 5 column ((5% Phenyl) methylpolysiloxane, 30 m length 250 m i.d. 1 m film thickness; Agilent Technologies, Santa Clara, CA, USA). Oven temperature was progra mmed from 40C (0.5 min hold) at 5C min 1 to 250C (4 min hold). Signals were captured with a flame ionization detector ( FID ) at 280C. Peaks from FID signal were integrated manually with Chemstation B.04.01 software (Agilent Technologies, Santa Clara, CA ). Volatile emission s (ng 1 gFW 1 h 1 ) were calculated based on individual peak area relative to sample elution standard peak area. GC Mass Spectrometry (MS) analysis of elutions was performed on an Agilent 6890N GC in tandem with an Agilent 5975 MS (Agilen t Technologies, Santa Clara, CA, USA) and retention times were compared with authentic standards (Sigma Aldrich, St Louis, MO, USA) for volatile identification (Schmelz et al. 2001) Chemical Abstract Services (CAS) registry numbers were used to query SciFinder substances dat abase for associated chemical name and molecular formula presented in Table 2 6 Sugars and Acids Quantification Titratable acidity, pH, and SSC were averaged from four replicates of the supernatant of centrifuged thawed homogenates (Whitaker et al. 2011) An appropriate dilution of the supernatant from a separate homogenate (centrifugation of 1.5 ml at 16,000 x g for 20 minutes) was instructions) for quantification of citric acid, L malic acid, D glucose, D fructose, and sucrose (CAT# 10 139 076 035, CAT# 10 139 068 035, and CAT# 10 716 260 035; R Biopharm, Darmstadt, Germany) with absorbance measured at 365 nm on an Epoch Microplate Spectrophotometer (BioTek, Winooksi, VT, USA). Metabolite average concentration (mg 100gFW 1 ) was determined from two to six technical replicat es per

PAGE 51

51 pooled sample. Derived sucrose concentrations via D glucose and D fructose were mathematically pooled. Firmness Determination Firmness of the strawberries was determined as the resistance of the fruit to penetration (7 mm depth) at its equator with a TA.XTPlus Texture Analyzer (Texture Technologies Corp., Scarsdale, NY, USA/Stable Micro Systems, Godalming, Surrey, UK). The Texture Analyzer was equipped with a 50 kg load cell and an 8 mm diameter convex tip probe. Whole fruit was punctured on the side to 7 mm down from the epidermis at a test speed of 2 mm/sec; a flap cut off the opposite side provides stability. Maximum force in kg for eight fruit was averaged and reported as a measure of firmness. Sensory Analysis All consumer panels were approved by the University of Florida Institutional Review Board. Over the course of two years 166 recruited strawberry consumers (58 male, 108 female) evaluate d strawberry cultivars. Ages of panelist ranged from 18 to 71, with a median age of 24. Panelists self cla ssified themselves as 98 White or Caucasian, 11 Black or African American, 1 Native American, Alaska Native or Aleutian, 41 Asian/Pacific Islander, and 15 Other. An average of 106 (range of 98 113) panelists evaluated between three and five cultivars per s ession (Tieman et al. 2012) Fresh, fully ripe strawberry fruit was removed from overnight 4C dark storage and allowed to warm to room temperature prior to sensory analysis. Each panelist was given one to two whol e strawberries for evaluation, depending on cultivar availability. Panelist bit each sample, chew ed and swallow ed it. Ratings for overall liking and texture liking we re scaled on hedonic gLMS in the context of all pleasure/displeasure experiences.

PAGE 52

52 Perceiv ed intensity of sweetness, sourness, and strawberry flavor are scaled in context of all sensory experiences using sensory gLMS (Bartoshuk et al. 2004; Bartoshuk et al. 2003; Bartoshuk et al. 2005; Tieman et al. 2 012) Scales were employed to mediate valid comparisons across subjects and sessions. Statistical Analysis Means and standard errors for consumer, physical, and metabolite measurements were determined from all replicates using JMP (Version 8, SAS Institut e Inc., Cary, NC, USA). Bivariate analysis among individual measurements of samples allow ed for linear fit, which include d summary of fit, analysis of variance, t test, and correlation analysis for density ellipse. Two way Ward hierarchical cluster analysi s of all metabolite concent rations and strawberry samples wa s accomplished in JMP. Amounts of individual volatile compounds were Corp., Armonk, NY, USA). This is done individually for each of the three sugars : glucose, fructose or sucrose to identify which compounds have an effect on sweetness intensity (positive or negative) independent of each of the sugars. For p volatile makes a contribution to perceived sweetness that is independent of the sugar tested.

PAGE 53

53 Table 2 1. Means of consumer, physical, and biochemical measures. HIGH 36.58 35.71 36.15 24.58 37.54 LOW 13.25 5.79 14.59 9.77 19.41 MEDIAN 23.52 25.29 22.19 18.32 25.78 FOLD DIFFERENCE 3 6 2 3 2 CULTIVAR HARVEST HARVEST DATE OVERALL LIKING TEXTURE LIKING SWEETNESS INTENSITY SOURNESS INTENSITY STRAWBERRY FLAVOR INTENSITY 100 to +100 100 to +100 0 to +100 0 to +100 0 to +100 PROPRIETARY 1 2011 2 1/24/2011 30.75 24.89 27.72 14.68 30.58 CAMAROSA 2011 2 1/24/2011 26.34 26.39 23.66 21.24 30.05 FESTIVAL 2011 2 1/24/2011 36.10 35.71 30.34 17.87 24.27 MARA DES BOIS 2011 2 1/24/2011 22.49 13.00 27.58 15.87 28.61 R ADIANCE 2011 2 1/24/2011 28.20 30.39 24.57 18.39 28.27 PROPRIETARY 2 2011 3 1/31/2011 31.85 24.61 31.01 17.27 33.48 CAMAROSA 2011 3 1/31/2011 27.76 27.73 24.76 19.07 29.50 SWEET CHARLIE 2011 3 1/31/2011 31.08 26.73 29.35 15.71 32.20 TREASURE 20 11 3 1/31/2011 28.77 27.63 25.10 17.23 28.09 WINTER DAWN 2011 3 1/31/2011 26.05 25.60 20.68 19.46 25.40 PROPRIETARY 3 2011 4 2/7/2011 21.30 14.69 22.22 19.51 27.79 CAMINO REAL 2011 4 2/7/2011 14.06 13.95 16.16 19.77 23.41 FESTIVAL 2011 4 2/7/ 2011 20.31 23.85 18.51 18.99 23.58 WINTERSTAR 2011 5 2/14/2011 28.42 28.32 24.87 15.39 27.18 FESTIVAL 2011 5 2/14/2011 24.99 26.48 22.60 21.23 29.37 RADIANCE 2011 5 2/14/2011 20.98 26.83 19.83 18.69 25.58 PROPRIETARY 4 2011 5 2/14/2011 28.98 19 .83 28.13 19.73 32.21 FL 05 85 2011 6 2/21/2011 19.46 23.85 17.87 11.50 19.41 ELYANA 2011 6 2/21/2011 23.50 27.14 22.77 12.09 24.70 FESTIVAL 2011 6 2/21/2011 22.53 25.30 19.75 13.81 23.98 RED MERLIN 2011 6 2/21/2011 13.25 21.49 14.59 24.58 23.9 5 SAN ANDREAS 2011 6 2/21/2011 19.39 26.59 18.25 21.68 25.37 ALBION 2011 7 2/28/2011 25.49 25.79 21.69 22.88 29.93 CHARLOTTE 2011 7 2/28/2011 13.87 8.66 20.16 9.77 19.72 FESTIVAL 2011 7 2/28/2011 17.35 23.78 15.94 15.88 20.36 MARA DES BOIS 201 1 7 2/28/2011 15.05 5.79 24.99 12.10 24.82 MONTERREY 2011 7 2/28/2011 14.51 19.64 18.15 19.95 25.72 ALBION 2012 1 1/16/2012 34.22 32.85 33.98 16.41 36.70 FESTIVAL 2012 1 1/16/2012 36.58 34.79 36.15 18.24 37.54 MOJAVE 2012 1 1/16/2012 30.14 25 .71 32.79 16.74 33.21 PROPRIETARY 3 2012 1 1/16/2012 28.32 20.47 30.89 15.38 31.96 CHANDLER 2012 4 2/6/2012 16.44 15.69 19.13 22.38 24.78 FESTIVAL 2012 4 2/6/2012 25.66 26.88 24.43 19.97 29.90 FL 09 127 2012 4 2/6/2012 24.40 25.28 23.40 17.62 2 7.53 TREASURE 2012 4 2/6/2012 28.49 28.62 26.02 18.67 29.79 WINTER DAWN 2012 4 2/6/2012 23.09 24.11 21.33 19.98 26.47 PROPRIETARY 5 2012 5 2/13/2012 26.91 25.38 24.98 16.78 27.15 ALBION 2012 5 2/13/2012 29.02 26.66 25.42 19.83 30.03 FESTIVAL 2 012 5 2/13/2012 22.16 22.76 21.25 16.41 24.49 RUBYGEM 2012 5 2/13/2012 22.22 25.70 21.19 15.42 24.86 CAMINO REAL 2012 6 2/20/2012 23.54 24.51 21.34 16.98 25.49 DARSELECT 2012 6 2/20/2012 29.15 20.67 28.15 18.21 30.88 FESTIVAL 2012 6 2/20/2012 23.09 24.31 22.15 17.93 25.15 SWEET ANNE 2012 6 2/20/2012 24.19 27.04 24.11 21.68 28.63 BENICIA 2012 7 2/27/2012 20.00 26.06 19.00 19.66 24.28 FESTIVAL 2012 7 2/27/2012 20.85 24.62 18.85 16.90 22.08 FL 06 38 2012 7 2/27/2012 27.50 27.97 23.37 17.22 26.95 PORTOLA 2012 7 2/27/2012 23.12 27.10 19.40 20.23 24.77 VENTANA 2012 7 2/27/2012 18.10 25.69 15.53 20.72 22.08 PROPRIETARY 6 2012 9 3/12/2012 16.63 15.93 18.28 20.26 22.70 EVIE 2 2012 9 3/12/2012 18.99 18.59 20.09 18.40 23.96 FESTIV AL 2012 9 3/12/2012 20.99 21.11 20.95 13.84 22.41 GALLETA 2012 9 3/12/2012 15.57 15.62 18.76 22.49 24.79 SWEET ANNE 2012 9 3/12/2012 23.80 25.05 20.43 22.57 25.83

PAGE 54

54 Table 2 1. Continued. HIGH 1.01 12.25 4.12 1.05 LOW 0.21 4.45 3.35 0.44 MEDI AN 0.51 7.13 3.69 0.83 FOLD DIFFERENCE 5 3 1 2 CULTIVAR HARVEST FORCE SSC pH TA kg % % PROPRIETARY 1 2011 2 0.51 9.15 3.73 0.74 CAMAROSA 2011 2 0.48 7.43 3.47 0.89 FESTIVAL 2011 2 0.83 8.50 3.63 0.72 MARA DES BOIS 2011 2 0.50 10.1 3 3.43 0.85 RADIANCE 2011 2 0.65 7.83 3.57 0.79 PROPRIETARY 2 2011 3 0.45 8.95 3.53 0.83 CAMAROSA 2011 3 0.64 8.45 3.55 0.85 SWEET CHARLIE 2011 3 0.52 8.98 3.77 0.67 TREASURE 2011 3 0.81 9.15 3.65 0.77 WINTER DAWN 2011 3 0.63 7.65 3.41 0. 85 PROPRIETARY 3 2011 4 0.35 7.43 3.53 0.76 CAMINO REAL 2011 4 0.32 4.45 3.55 0.61 FESTIVAL 2011 4 0.61 6.05 3.71 0.60 WINTERSTAR 2011 5 0.81 6.30 3.58 0.58 FESTIVAL 2011 5 1.01 7.58 3.41 0.74 RADIANCE 2011 5 0.97 5.70 3.48 0.64 PROPRIET ARY 4 2011 5 0.47 8.80 3.41 0.96 FL 05 85 2011 6 0.70 6.50 3.82 0.53 ELYANA 2011 6 0.81 7.13 3.72 0.57 FESTIVAL 2011 6 0.73 7.03 3.72 0.59 RED MERLIN 2011 6 0.83 7.15 3.43 0.79 SAN ANDREAS 2011 6 0.80 7.45 3.61 0.77 ALBION 2011 7 0.45 6 .23 3.51 0.85 CHARLOTTE 2011 7 0.34 6.60 3.89 0.44 FESTIVAL 2011 7 0.72 5.43 3.64 0.50 MARA DES BOIS 2011 7 0.21 7.03 3.64 0.61 MONTERREY 2011 7 0.50 6.60 3.57 0.76 ALBION 2012 1 0.75 12.25 3.90 0.97 FESTIVAL 2012 1 0.63 9.50 3.85 0.90 M OJAVE 2012 1 0.35 10.18 3.86 0.95 PROPRIETARY 3 2012 1 0.48 9.73 3.83 0.92 CHANDLER 2012 4 0.30 6.40 3.68 0.96 FESTIVAL 2012 4 0.52 7.60 4.00 0.85 FL 09 127 2012 4 0.59 6.88 4.01 0.83 TREASURE 2012 4 0.46 7.68 4.03 0.84 WINTER DAWN 2012 4 0.47 7.53 3.86 0.99 PROPRIETARY 5 2012 5 0.46 6.53 3.91 0.82 ALBION 2012 5 0.43 7.25 4.04 0.98 FESTIVAL 2012 5 0.54 6.48 3.93 0.95 RUBYGEM 2012 5 0.66 6.58 4.12 0.64 CAMINO REAL 2012 6 0.45 7.28 3.89 0.92 DARSELECT 2012 6 0.33 9.78 4.1 1 0.96 FESTIVAL 2012 6 0.40 7.40 3.97 0.86 SWEET ANNE 2012 6 0.43 BENICIA 2012 7 0.55 6.03 3.77 0.86 FESTIVAL 2012 7 0.49 6.20 3.88 0.80 FL 06 38 2012 7 0.55 6.28 3.82 0.75 PORTOLA 2012 7 0.70 5.78 3.69 0.92 VENTANA 2012 7 0.60 6 .40 3.95 0.90 PROPRIETARY 6 2012 9 0.32 6.50 3.45 0.74 EVIE 2 2012 9 0.39 6.38 3.43 0.83 FESTIVAL 2012 9 0.53 6.65 3.54 0.64 GALLETA 2012 9 0.49 7.08 3.35 1.05 SWEET ANNE 2012 9 0.49 6.10 3.35 0.85

PAGE 55

55 Table 2 1. Continued. HIGH 338.20 108 0.33 7933.01 2481.98 2610.85 2840.18 LOW 78.02 440.98 2292.12 656.04 746.84 167.73 MEDIAN 220.27 744.26 4316.91 1541.08 1723.42 1020.84 FOLD DIFFERENCE 4 2 3 4 3 17 CULTIVAR HARVEST MALIC ACID CITRIC ACID TOTAL SUGAR GLUCOSE FRUCTOSE SUCROSE m g 1 100gFW 1 mg 1 100gFW 1 mg 1 100gFW 1 mg 1 100gFW 1 mg 1 100gFW 1 mg 1 100gFW 1 6915 15 7 77 92 9 50 99 7 57 48 7 57 50 1 PROPRIETARY 1 2011 2 104 766 5191 1879 1998 1314 CAMAROSA 2011 2 211 879 4306 1313 1456 1538 FESTIVAL 2011 2 338 639 5169 19 03 2048 1218 MARA DES BOIS 2011 2 146 834 5515 1730 1967 1818 RADIANCE 2011 2 246 721 4137 656 747 2734 PROPRIETARY 2 2011 3 158 956 6167 1781 2041 2345 CAMAROSA 2011 3 271 833 5058 1345 1498 2216 SWEET CHARLIE 2011 3 190 713 6470 2352 2435 1683 TREASURE 2011 3 271 610 4377 1464 1520 1392 WINTER DAWN 2011 3 252 775 4731 1265 1479 1986 PROPRIETARY 3 2011 4 161 844 4269 1657 1821 791 CAMINO REAL 2011 4 187 525 2292 911 1068 314 FESTIVAL 2011 4 259 515 3316 1391 1538 387 WINTERST AR 2011 5 264 557 4233 1374 1518 1342 FESTIVAL 2011 5 266 631 4327 1544 1705 1079 RADIANCE 2011 5 273 579 3436 1060 1224 1152 PROPRIETARY 4 2011 5 259 834 5363 1462 1615 2286 FL 05 85 2011 6 182 510 2945 1179 1324 442 ELYANA 2011 6 197 607 4496 1904 2169 424 FESTIVAL 2011 6 244 515 3615 1449 1647 519 RED MERLIN 2011 6 229 784 4079 1649 1880 549 SAN ANDREAS 2011 6 237 721 4275 1502 1719 1055 ALBION 2011 7 241 867 3440 1166 1343 931 CHARLOTTE 2011 7 143 520 4294 1896 2230 168 FESTIVAL 2011 7 255 441 2747 1127 1311 309 MARA DES BOIS 2011 7 78 795 3932 1539 1788 605 MONTERREY 2011 7 282 677 3320 1316 1500 504 ALBION 2012 1 219 1007 7933 2482 2611 2840 FESTIVAL 2012 1 281 680 6417 2187 2327 1902 MOJAVE 2012 1 156 862 5647 1978 2141 1528 PROPRIETARY 3 2012 1 144 1025 5828 1964 2150 1714 CHANDLER 2012 4 225 743 4018 1403 1512 1102 FESTIVAL 2012 4 215 561 4389 2013 2189 187 FL 09 127 2012 4 201 602 4970 2171 2313 486 TREASURE 2012 4 253 662 4771 1598 17 28 1444 WINTER DAWN 2012 4 221 716 3736 1170 1407 1159 PROPRIETARY 5 2012 5 132 756 4537 1497 1642 1398 ALBION 2012 5 207 820 4900 1535 1676 1688 FESTIVAL 2012 5 261 721 4272 1560 1728 983 RUBYGEM 2012 5 130 743 4432 1804 1971 657 CAMINO RE AL 2012 6 174 764 5361 2202 2319 840 DARSELECT 2012 6 179 964 6290 2405 2580 1306 FESTIVAL 2012 6 225 790 4229 1807 1973 450 SWEET ANNE 2012 6 252 1080 4184 1582 1767 834 BENICIA 2012 7 225 746 4037 1548 1711 778 FESTIVAL 2012 7 202 725 44 88 1775 1969 744 FL 06 38 2012 7 229 708 4968 1859 2017 1091 PORTOLA 2012 7 186 866 3381 1265 1428 687 VENTANA 2012 7 241 811 3139 1198 1339 601 PROPRIETARY 6 2012 9 181 834 4766 1485 1701 1580 EVIE 2 2012 9 142 838 3603 1271 1472 859 FESTI VAL 2012 9 182 513 3680 1517 1740 424 GALLETA 2012 9 259 961 4658 1735 1937 987 SWEET ANNE 2012 9 201 870 3456 1282 1463 712

PAGE 56

56 Table 2 1. Continued. HIGH 27346.49 9.93 41.24 285.21 115.86 38.30 LOW 8450.24 0.00 0.00 16.80 17.43 0.00 MEDIAN 14572.86 3.20 15.34 98.36 46.99 5.68 FOLD DIFFERENCE 3 17 7 CULTIVAR HARVEST TOTAL VOLATILES 75 85 4 616 25 1 1629 58 9 96 22 0 110 62 3 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 alcohol alco hol ketone ketone aldehyde PROPRIETARY 1 2011 2 21815.10 6.96 41.24 179.33 95.96 10.87 CAMAROSA 2011 2 27346.49 7.13 30.29 225.30 81.56 13.84 FESTIVAL 2011 2 19097.63 5.85 12.67 242.82 77.29 38.30 MARA DES BOIS 2011 2 17849.45 5.14 10.54 194.51 71.36 2.27 RADIANCE 2011 2 22308.92 8.05 13.94 202.66 73.78 11.81 PROPRIETARY 2 2011 3 24751.16 4.40 15.29 140.46 32.32 1.40 CAMAROSA 2011 3 24867.98 8.05 19.41 168.15 64.90 5.51 SWEET CHARLIE 2011 3 21335.50 5.32 19.04 229.19 55.66 1.10 TREA SURE 2011 3 27216.45 9.93 17.29 266.09 83.88 1.31 WINTER DAWN 2011 3 22171.05 5.43 18.71 119.71 52.64 3.33 PROPRIETARY 3 2011 4 22791.16 8.71 22.22 150.99 115.86 8.56 CAMINO REAL 2011 4 16476.30 6.04 25.66 95.42 53.72 0.57 FESTIVAL 2011 4 273 07.21 8.22 12.68 89.56 67.11 24.28 WINTERSTAR 2011 5 10049.72 3.32 9.68 48.13 30.02 3.95 FESTIVAL 2011 5 11866.30 2.13 15.59 59.40 42.88 13.92 RADIANCE 2011 5 11272.72 2.12 6.33 54.62 28.61 15.06 PROPRIETARY 4 2011 5 22279.55 0.48 22.43 249.57 67.72 1.33 FL 05 85 2011 6 11009.50 2.99 16.19 49.51 38.20 16.84 ELYANA 2011 6 11815.52 4.50 4.93 78.80 37.39 13.28 FESTIVAL 2011 6 14477.44 5.44 8.33 73.41 44.96 36.26 RED MERLIN 2011 6 13225.95 5.79 25.70 70.43 53.34 9.57 SAN ANDREAS 2011 6 12730.17 4.05 12.79 84.07 36.08 6.94 ALBION 2011 7 13917.02 3.68 17.27 56.84 60.08 0.94 CHARLOTTE 2011 7 15476.18 2.51 24.09 22.75 56.44 0.97 FESTIVAL 2011 7 11545.36 2.54 6.47 54.11 42.49 28.77 MARA DES BOIS 2011 7 12273.36 2.85 6.08 16.80 4 4.40 7.76 MONTERREY 2011 7 12809.80 4.31 10.29 31.57 33.43 0.97 ALBION 2012 1 22574.65 1.28 30.45 285.21 60.16 0.86 FESTIVAL 2012 1 16842.97 2.54 22.81 127.22 45.34 10.28 MOJAVE 2012 1 16822.84 1.54 24.83 178.58 47.28 6.21 PROPRIETARY 3 2012 1 14131.48 2.89 19.12 152.65 37.17 0.99 CHANDLER 2012 4 8893.20 0.00 0.00 72.32 55.09 0.00 FESTIVAL 2012 4 12239.27 6.76 8.94 169.03 49.64 17.63 FL 09 127 2012 4 11132.31 3.99 11.26 124.77 40.68 3.03 TREASURE 2012 4 17250.72 4.75 17.36 169.34 60.87 0.76 WINTER DAWN 2012 4 19884.41 4.88 13.48 123.57 35.94 7.94 PROPRIETARY 5 2012 5 9295.73 1.73 23.17 73.39 45.18 1.33 ALBION 2012 5 19223.80 2.42 17.20 165.96 56.03 1.09 FESTIVAL 2012 5 11526.96 2.38 12.33 92.75 45.20 13.01 RUBYGEM 2012 5 11491.14 2.18 9.69 88.93 32.68 6.87 CAMINO REAL 2012 6 16381.25 4.37 21.96 124.47 74.08 1.28 DARSELECT 2012 6 12942.55 3.52 13.89 95.15 61.92 10.81 FESTIVAL 2012 6 15924.67 3.03 13.51 123.50 58.09 19.21 SWEET ANNE 2012 6 11265.22 3.09 18.6 3 97.14 57.22 0.94 BENICIA 2012 7 12018.85 4.92 18.17 126.58 48.57 2.43 FESTIVAL 2012 7 17138.67 1.65 16.80 137.48 45.84 15.87 FL 06 38 2012 7 16576.73 2.34 8.49 99.57 41.34 5.86 PORTOLA 2012 7 9347.88 2.97 12.93 84.00 46.70 0.92 VENTANA 2012 7 12049.29 2.34 14.90 86.79 42.35 6.89 PROPRIETARY 6 2012 9 16025.99 2.43 18.24 107.74 36.96 0.73 EVIE 2 2012 9 10796.23 2.86 13.59 32.40 26.15 2.97 FESTIVAL 2012 9 8976.61 2.22 8.39 40.63 22.96 9.45 GALLETA 2012 9 14668.29 2.27 15.38 96.12 3 2.99 0.79 SWEET ANNE 2012 9 8450.24 1.18 7.39 35.24 17.43 0.42

PAGE 57

57 Table 2 1. Continued. HIGH 0.93 85.37 12.25 7359.57 81.41 8.69 LOW 0.00 0.09 0.46 846.65 0.09 0.00 MEDIAN 0.37 6.26 3.06 2430.27 5.22 0.00 FOLD DIFFERENCE 972 27 9 901 CULTI VAR HARVEST 1534 08 3 105 37 3 109 60 4 623 42 7 591 78 6 108 10 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ketone ester ester ester ketone ketone PROPRIETARY 1 2011 2 0.53 1.81 1.83 3437.73 5.08 0. 00 CAMAROSA 2011 2 0.61 4.55 5.39 3938.54 3.75 0.00 FESTIVAL 2011 2 0.61 26.83 1.63 2946.22 6.74 0.00 MARA DES BOIS 2011 2 0.44 7.17 3.84 1829.32 6.24 0.00 RADIANCE 2011 2 0.32 0.99 2.62 2093.93 4.44 0.00 PROPRIETARY 2 2011 3 0.42 3.25 1.14 7359.57 81.41 0.00 CAMAROSA 2011 3 0.84 6.24 4.08 3092.47 6.75 0.00 SWEET CHARLIE 2011 3 0.36 1.59 0.99 2821.39 19.94 0.00 TREASURE 2011 3 0.93 0.09 0.73 1569.55 20.85 0.00 WINTER DAWN 2011 3 0.44 0.83 1.24 2390.40 4.32 0.00 PROPRIETARY 3 2011 4 0.55 15.53 10.02 3205.64 12.35 0.00 CAMINO REAL 2011 4 0.66 3.43 1.91 2360.98 3.78 0.00 FESTIVAL 2011 4 0.32 51.55 3.51 4615.03 4.70 0.00 WINTERSTAR 2011 5 0.00 9.23 4.45 1530.58 6.86 0.00 FESTIVAL 2011 5 0.00 4.15 2.08 2272.42 6.17 0.00 RADIANCE 2011 5 0.00 6.76 5.50 1341.81 4.94 0.00 PROPRIETARY 4 2011 5 0.27 7.22 2.15 6785.81 57.94 0.00 FL 05 85 2011 6 0.29 0.92 1.35 2200.23 0.77 0.00 ELYANA 2011 6 0.45 1.30 0.51 1421.77 9.32 0.00 FESTIVAL 2011 6 0.31 12.14 1.54 3299.73 1. 34 0.00 RED MERLIN 2011 6 0.49 0.73 1.01 1458.22 0.09 0.00 SAN ANDREAS 2011 6 0.33 1.85 1.57 2394.10 0.73 0.00 ALBION 2011 7 0.51 3.96 5.49 3152.61 2.44 0.00 CHARLOTTE 2011 7 0.68 3.16 5.37 2692.37 0.69 0.00 FESTIVAL 2011 7 0.30 17.27 2.21 2 086.02 0.72 0.00 MARA DES BOIS 2011 7 0.36 30.38 6.69 2145.67 0.16 0.00 MONTERREY 2011 7 0.40 9.68 8.76 2820.74 1.11 0.00 ALBION 2012 1 0.43 1.37 0.46 5282.14 17.61 0.00 FESTIVAL 2012 1 0.33 10.39 2.26 3598.18 3.83 0.00 MOJAVE 2012 1 0.34 5. 51 3.11 2466.44 9.28 3.01 PROPRIETARY 3 2012 1 0.47 3.73 1.66 1867.96 19.82 0.00 CHANDLER 2012 4 0.00 13.19 2.45 1632.05 25.54 0.00 FESTIVAL 2012 4 0.52 85.37 4.05 2345.75 4.16 8.28 FL 09 127 2012 4 0.56 7.01 3.68 2258.78 11.27 8.69 TREASURE 2 012 4 0.46 6.29 7.97 2835.56 27.56 4.59 WINTER DAWN 2012 4 0.30 9.99 5.08 3286.53 3.75 7.24 PROPRIETARY 5 2012 5 0.63 8.31 5.44 1015.51 4.39 0.00 ALBION 2012 5 0.39 12.04 12.25 4113.08 22.53 3.00 FESTIVAL 2012 5 0.38 13.57 4.07 2934.78 3.68 2 .31 RUBYGEM 2012 5 0.36 5.00 9.65 1490.23 4.94 7.61 CAMINO REAL 2012 6 0.33 6.12 3.84 3523.27 8.22 4.74 DARSELECT 2012 6 0.35 15.98 7.32 2364.50 4.40 3.79 FESTIVAL 2012 6 0.37 4.04 2.94 4106.50 5.37 3.28 SWEET ANNE 2012 6 0.35 2.00 3.01 1057 .63 17.98 0.00 BENICIA 2012 7 0.49 7.05 7.95 846.65 27.36 0.00 FESTIVAL 2012 7 0.45 14.91 1.97 5497.45 4.31 6.00 FL 06 38 2012 7 0.50 36.13 4.49 3388.37 8.82 5.46 PORTOLA 2012 7 0.39 2.45 2.09 906.65 4.63 0.00 VENTANA 2012 7 0.30 3.16 3.25 1 621.23 10.34 0.00 PROPRIETARY 6 2012 9 0.34 16.80 6.10 4699.23 9.97 4.16 EVIE 2 2012 9 0.30 6.92 8.10 1637.05 3.07 0.00 FESTIVAL 2012 9 0.20 11.82 2.17 3000.85 2.87 4.13 GALLETA 2012 9 0.35 1.96 2.25 3583.31 8.68 6.12 SWEET ANNE 2012 9 0.00 0.35 1.15 1509.83 7.67 0.00

PAGE 58

58 Table 2 1. Continued. HIGH 84.64 92.80 20.17 6.10 8.54 278.06 LOW 8.74 9.58 0.51 0.00 0.00 5.81 MEDIAN 31.50 33.06 2.33 0.29 1.71 30.42 FOLD DIFFERENCE 10 10 39 48 CULTIVAR HARVEST 1576 87 0 1576 86 9 623 43 8 7 1 41 0 1576 95 0 556 24 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 aldehyde ketone ester alcohol alcohol ester PROPRIETARY 1 2011 2 64.62 78.26 2.29 0.00 1.39 67.02 CAMAROSA 2011 2 73.97 79.63 7. 74 0.00 3.00 60.52 FESTIVAL 2011 2 70.39 68.79 0.51 2.53 2.08 37.85 MARA DES BOIS 2011 2 38.78 54.19 3.05 0.05 1.92 5.92 RADIANCE 2011 2 69.95 70.06 8.11 0.00 3.18 14.88 PROPRIETARY 2 2011 3 78.60 65.21 5.96 0.00 1.84 278.06 CAMAROSA 2011 3 84.45 83.49 4.52 0.08 3.82 40.17 SWEET CHARLIE 2011 3 83.44 76.64 3.55 0.00 0.00 38.92 TREASURE 2011 3 84.64 92.80 1.88 0.00 1.15 52.65 WINTER DAWN 2011 3 61.61 58.78 3.68 0.28 4.39 13.53 PROPRIETARY 3 2011 4 52.73 78.50 3.75 1.96 1.05 227.94 CAMINO REAL 2011 4 36.84 34.19 5.73 0.48 0.98 13.51 FESTIVAL 2011 4 50.18 28.94 1.24 0.53 2.60 36.82 WINTERSTAR 2011 5 23.16 12.17 1.27 0.00 0.60 37.20 FESTIVAL 2011 5 24.28 18.28 1.01 0.00 1.55 9.70 RADIANCE 2011 5 31.53 14.50 7.43 0.10 0.69 10.57 PROPRIETARY 4 2011 5 53.67 67.09 5.23 0.55 0.78 93.07 FL 05 85 2011 6 18.63 19.59 0.80 0.00 0.00 7.83 ELYANA 2011 6 28.59 22.24 0.81 0.00 0.58 28.04 FESTIVAL 2011 6 26.05 22.17 0.82 0.00 0.62 16.59 RED MERLIN 2011 6 27.83 30.33 1.37 0 .00 0.83 5.81 SAN ANDREAS 2011 6 27.68 26.12 0.89 0.00 0.14 9.56 ALBION 2011 7 23.52 26.38 7.71 0.39 0.00 37.70 CHARLOTTE 2011 7 12.17 15.75 20.17 2.30 0.00 249.23 FESTIVAL 2011 7 21.77 19.00 0.91 0.00 0.00 15.11 MARA DES BOIS 2011 7 8.74 9. 58 7.44 0.00 0.00 11.96 MONTERREY 2011 7 18.24 13.37 4.28 0.15 0.00 46.02 ALBION 2012 1 42.60 39.14 2.63 2.42 0.00 52.19 FESTIVAL 2012 1 45.86 38.23 2.07 2.08 1.88 5.82 MOJAVE 2012 1 46.72 38.37 0.75 2.49 4.11 24.61 PROPRIETARY 3 2012 1 48.0 4 56.50 2.28 3.49 6.08 118.31 CHANDLER 2012 4 14.25 14.46 1.48 1.81 0.00 31.30 FESTIVAL 2012 4 34.40 38.15 0.78 0.24 3.81 6.84 FL 09 127 2012 4 22.75 24.14 2.37 0.00 5.34 23.09 TREASURE 2012 4 38.09 45.42 2.51 0.00 1.71 41.09 WINTER DAWN 2012 4 35.87 32.17 4.82 0.00 3.63 26.29 PROPRIETARY 5 2012 5 20.95 23.26 6.98 6.10 4.85 68.34 ALBION 2012 5 38.89 41.84 5.46 0.69 0.00 31.52 FESTIVAL 2012 5 33.58 32.70 1.33 0.31 7.32 8.55 RUBYGEM 2012 5 31.02 24.67 2.72 0.61 1.60 10.32 CAMINO RE AL 2012 6 38.54 33.73 2.13 2.19 4.37 12.57 DARSELECT 2012 6 31.10 34.71 2.25 2.73 0.00 106.70 FESTIVAL 2012 6 41.77 40.98 0.97 2.40 1.71 15.45 SWEET ANNE 2012 6 26.02 34.44 0.65 2.90 1.49 20.57 BENICIA 2012 7 31.46 38.14 1.16 3.66 3.53 37.61 FESTIVAL 2012 7 40.58 40.70 1.15 2.14 4.04 16.74 FL 06 38 2012 7 28.41 30.56 2.98 2.76 1.72 46.76 PORTOLA 2012 7 24.38 27.04 3.48 2.96 2.21 26.48 VENTANA 2012 7 22.81 27.23 2.77 1.90 2.69 82.27 PROPRIETARY 6 2012 9 29.63 33.41 12.01 0.80 1.9 7 55.48 EVIE 2 2012 9 12.07 12.40 3.55 0.88 2.71 91.64 FESTIVAL 2012 9 15.38 14.13 1.21 0.21 2.96 21.41 GALLETA 2012 9 24.28 27.34 1.66 0.09 8.54 40.76 SWEET ANNE 2012 9 10.30 12.47 1.42 0.16 1.20 29.53

PAGE 59

5 9 Table 2 1. Continued. HIGH 5.59 110 .34 11063.45 409.81 19.44 23.52 LOW 0.00 15.83 1072.17 5.76 1.24 0.40 MEDIAN 1.67 37.72 2025.28 41.46 4.18 3.05 FOLD DIFFERENCE 7 10 71 16 58 CULTIVAR HARVEST 589 38 8 105 54 4 66 25 1 123 86 4 624 24 8 29674 47 3 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ketone ester aldehyde ester ester ester/alcohol PROPRIETARY 1 2011 2 1.83 110.34 1968.29 21.02 7.10 3.32 CAMAROSA 2011 2 0.76 81.38 6487.68 117.21 3.47 2.22 FESTIVAL 2011 2 2.65 50.73 3557.99 61.96 8.25 2.90 MARA DES BOIS 2011 2 0.57 54.34 2189.85 88.98 2.78 0.40 RADIANCE 2011 2 0.49 55.42 2830.28 38.56 6.00 1.38 PROPRIETARY 2 2011 3 2.08 72.34 2235.46 223.79 8.81 19.83 CAMAROSA 2011 3 1.36 74.73 3096.11 151.16 3.50 2.79 SW EET CHARLIE 2011 3 1.69 65.95 3242.15 41.22 8.66 2.03 TREASURE 2011 3 1.65 41.17 5076.19 148.51 1.35 4.99 WINTER DAWN 2011 3 1.54 58.02 2783.71 41.49 7.19 3.41 PROPRIETARY 3 2011 4 1.64 58.66 3252.41 45.78 4.12 4.17 CAMINO REAL 2011 4 2.98 67 .98 1990.17 62.46 1.83 3.05 FESTIVAL 2011 4 3.50 58.22 11063.45 48.47 15.63 3.18 WINTERSTAR 2011 5 1.93 36.76 1357.23 32.35 4.93 1.84 FESTIVAL 2011 5 2.03 52.35 1177.82 12.03 5.84 4.84 RADIANCE 2011 5 1.65 36.20 1355.03 11.65 5.14 1.64 PROPRIE TARY 4 2011 5 3.78 51.65 2460.07 100.84 7.78 23.52 FL 05 85 2011 6 0.77 38.42 1335.24 16.88 3.60 1.89 ELYANA 2011 6 0.71 27.79 1697.01 125.28 8.61 0.46 FESTIVAL 2011 6 0.77 27.39 2417.33 15.42 10.18 2.67 RED MERLIN 2011 6 3.01 44.16 1428.52 5 .76 2.78 1.28 SAN ANDREAS 2011 6 0.91 30.97 2132.07 56.15 2.93 2.75 ALBION 2011 7 0.22 37.58 1821.58 41.43 1.71 5.54 CHARLOTTE 2011 7 0.21 42.06 2065.13 25.67 1.24 2.45 FESTIVAL 2011 7 0.42 38.02 1860.14 8.18 10.28 3.05 MARA DES BOIS 2011 7 0.44 20.80 2687.64 52.54 3.18 0.79 MONTERREY 2011 7 0.57 31.73 1814.15 220.76 2.07 4.01 ALBION 2012 1 2.12 37.27 3184.80 409.81 3.65 7.20 FESTIVAL 2012 1 1.40 40.51 2808.47 37.47 7.29 10.51 MOJAVE 2012 1 3.88 41.01 2629.55 187.78 6.08 5.64 PRO PRIETARY 3 2012 1 1.98 52.62 1535.05 14.32 4.49 3.28 CHANDLER 2012 4 0.00 15.83 1147.02 86.61 3.85 4.31 FESTIVAL 2012 4 1.11 30.83 2550.02 30.00 7.41 7.24 FL 09 127 2012 4 0.92 25.16 1783.23 81.55 3.58 1.70 TREASURE 2012 4 1.85 31.76 3463.96 99.09 2.18 4.99 WINTER DAWN 2012 4 1.60 33.38 7116.18 29.42 9.09 10.55 PROPRIETARY 5 2012 5 1.04 34.88 1072.17 6.53 2.05 2.45 ALBION 2012 5 3.34 25.09 4951.49 363.88 3.62 12.46 FESTIVAL 2012 5 2.52 36.49 1813.61 41.12 6.99 8.83 RUBYGEM 2012 5 2.25 37.88 1787.67 51.62 4.24 1.26 CAMINO REAL 2012 6 5.59 42.43 1745.53 249.11 4.03 9.53 DARSELECT 2012 6 3.44 29.37 1709.95 94.53 7.74 2.20 FESTIVAL 2012 6 2.68 38.93 2200.20 34.84 9.19 9.93 SWEET ANNE 2012 6 3.31 35.49 1414.31 14.63 1.59 1 .91 BENICIA 2012 7 2.67 33.13 2034.26 30.35 2.17 0.93 FESTIVAL 2012 7 1.44 31.66 2488.31 28.35 19.44 16.18 FL 06 38 2012 7 0.80 23.04 4253.17 74.97 8.20 3.98 PORTOLA 2012 7 2.25 37.86 1136.90 13.07 2.96 2.42 VENTANA 2012 7 2.10 36.30 1465.00 8.78 2.84 2.52 PROPRIETARY 6 2012 9 1.56 39.94 2016.30 22.01 7.95 17.24 EVIE 2 2012 9 3.00 35.18 1542.68 62.24 2.92 1.83 FESTIVAL 2012 9 1.64 21.54 1323.32 11.83 12.99 5.91 GALLETA 2012 9 3.89 29.33 1767.37 59.57 2.80 2.80 SWEET ANNE 2012 9 1.94 25.54 1153.26 12.57 1.75 0.94

PAGE 60

60 Table 2 1. Continued. HIGH 57.10 378.13 53.35 196.93 18382.28 343.94 LOW 0.00 1.59 0.00 17.27 3794.92 0.00 MEDIAN 1.44 57.32 17.77 40.80 7674.66 52.96 FOLD DIFFERENCE 237 11 5 CULTIVAR HARVEST 96 04 8 638 11 9 116 53 0 7452 79 1 6728 26 3 928 95 0 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ketone ester ester ester aldehyde alcohol PROPRIETARY 1 2011 2 3.53 41.97 45.90 77.04 14335.48 92.25 CAMAROSA 2011 2 1.68 30.25 30.03 47.41 15185.47 78.48 FESTIVAL 2011 2 2.20 118.88 37.91 52.20 10600.45 9.02 MARA DES BOIS 2011 2 0.56 11.69 24.73 57.68 12230.43 126.08 RADIANCE 2011 2 1.51 75.65 39.49 87.29 15085.78 61.45 PROPRIETARY 2 2011 3 16.03 2 06.43 48.14 86.63 12931.96 2.18 CAMAROSA 2011 3 2.29 39.34 42.56 86.60 16752.16 49.50 SWEET CHARLIE 2011 3 10.51 35.48 37.92 101.23 11893.28 0.93 TREASURE 2011 3 6.89 281.63 44.88 107.55 18382.28 29.13 WINTER DAWN 2011 3 0.00 68.75 37.09 83.33 15661.83 71.96 PROPRIETARY 3 2011 4 3.95 42.51 53.35 88.85 13505.17 120.68 CAMINO REAL 2011 4 0.72 24.16 16.39 32.07 10723.21 81.37 FESTIVAL 2011 4 1.44 68.20 18.34 101.79 9615.52 7.37 WINTERSTAR 2011 5 2.63 41.69 21.80 46.72 5950.65 38.79 FES TIVAL 2011 5 1.03 24.69 15.50 31.94 7458.72 62.14 RADIANCE 2011 5 0.45 32.38 25.94 196.93 7258.31 29.59 PROPRIETARY 4 2011 5 3.69 122.82 34.18 70.83 10623.73 62.34 FL 05 85 2011 6 1.55 44.35 29.89 48.80 6670.12 62.99 ELYANA 2011 6 1.23 67.71 16.46 61.71 6379.28 0.00 FESTIVAL 2011 6 0.79 78.32 17.34 39.96 7562.82 9.99 RED MERLIN 2011 6 0.50 18.79 20.54 37.44 9479.61 124.13 SAN ANDREAS 2011 6 0.58 145.41 13.53 32.41 6926.46 30.73 ALBION 2011 7 0.00 77.97 1.73 57.55 7974.22 29.04 CHA RLOTTE 2011 7 0.00 25.47 0.90 73.71 9785.12 45.12 FESTIVAL 2011 7 0.00 47.69 40.71 29.66 6793.29 7.10 MARA DES BOIS 2011 7 0.00 18.25 17.06 47.31 6226.18 21.80 MONTERREY 2011 7 1.44 151.12 26.91 41.23 6568.59 10.41 ALBION 2012 1 0.00 378.13 0 .00 49.12 9284.85 51.62 FESTIVAL 2012 1 0.00 72.25 31.48 30.28 8842.99 41.84 MOJAVE 2012 1 2.39 116.93 0.00 44.42 9099.23 22.29 PROPRIETARY 3 2012 1 1.45 25.61 0.00 43.21 9279.66 21.62 CHANDLER 2012 4 57.10 16.80 0.00 18.62 3794.92 192.46 FEST IVAL 2012 4 1.15 83.83 26.84 29.68 5682.02 68.17 FL 09 127 2012 4 1.32 76.41 10.43 24.94 4505.45 141.04 TREASURE 2012 4 5.05 148.23 27.36 42.91 8905.78 65.42 WINTER DAWN 2012 4 0.60 82.02 51.73 29.56 7942.89 40.06 PROPRIETARY 5 2012 5 0.58 1. 59 2.51 30.68 6107.65 125.08 ALBION 2012 5 1.30 131.19 9.34 32.39 7047.18 39.00 FESTIVAL 2012 5 0.69 35.09 0.00 21.13 5568.16 54.29 RUBYGEM 2012 5 1.01 28.61 15.82 34.85 6866.30 88.57 CAMINO REAL 2012 6 2.27 90.14 5.21 29.27 8227.17 343.94 DAR SELECT 2012 6 3.33 53.48 2.40 21.39 5078.91 199.40 FESTIVAL 2012 6 1.42 95.80 18.20 29.11 7786.50 80.28 SWEET ANNE 2012 6 2.73 31.91 0.00 34.24 6743.07 202.27 BENICIA 2012 7 4.47 28.82 0.00 41.19 7511.25 90.63 FESTIVAL 2012 7 1.53 110.91 34.4 9 28.58 7174.23 46.44 FL 06 38 2012 7 1.49 95.51 19.15 32.62 5635.20 29.72 PORTOLA 2012 7 2.74 22.42 2.54 32.99 6446.74 70.78 VENTANA 2012 7 4.00 20.85 7.94 43.56 7835.52 95.77 PROPRIETARY 6 2012 9 1.47 61.53 5.60 38.31 7167.81 41.61 EVIE 2 20 12 9 0.60 13.66 0.55 29.31 6490.12 58.24 FESTIVAL 2012 9 0.42 61.16 13.69 17.27 3810.95 24.98 GALLETA 2012 9 0.93 61.72 18.29 40.42 7798.82 79.02 SWEET ANNE 2012 9 1.74 40.88 0.00 22.51 4795.75 30.21

PAGE 61

61 Table 2 1. Continued. HIGH 640.91 119.2 2 106.05 130.12 24.21 18.47 LOW 0.87 1.51 0.00 0.00 0.00 0.00 MEDIAN 25.49 17.37 14.72 8.47 2.32 4.06 FOLD DIFFERENCE 734 79 CULTIVAR HARVEST 111 27 3 123 92 2 624 41 9 110 43 0 2432 51 1 105 66 8 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 h r 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 alcohol ester ester ketone ketone ester PROPRIETARY 1 2011 2 9.11 9.75 37.36 9.54 3.18 1.06 CAMAROSA 2011 2 9.09 13.09 44.21 6.52 5.51 2.81 FESTIVAL 2011 2 2.26 2.62 5.74 14.89 18.72 10.74 MARA DES BOIS 2011 2 14.36 2.70 5.14 7.73 1.17 6.39 RADIANCE 2011 2 10.71 24.34 44.81 18.59 2.35 2.46 PROPRIETARY 2 2011 3 1.44 43.48 5.96 19.82 3.28 2.07 CAMAROSA 2011 3 7.84 9.45 28.73 12.78 8.03 5.22 SWEET CHARLIE 2011 3 9.64 6.98 4.40 130.12 0 .00 3.45 TREASURE 2011 3 6.43 12.30 14.65 43.93 0.00 4.06 WINTER DAWN 2011 3 9.30 4.33 8.79 3.99 0.79 2.31 PROPRIETARY 3 2011 4 34.87 119.22 81.96 7.59 4.26 2.63 CAMINO REAL 2011 4 30.08 6.75 9.21 1.98 0.00 0.53 FESTIVAL 2011 4 7.79 2.77 8.8 3 6.26 12.01 7.61 WINTERSTAR 2011 5 23.12 10.35 18.40 4.04 0.00 7.34 FESTIVAL 2011 5 20.92 4.61 10.92 3.92 2.10 3.28 RADIANCE 2011 5 26.48 7.32 13.58 5.60 1.68 4.48 PROPRIETARY 4 2011 5 37.24 18.30 11.52 6.00 0.00 2.12 FL 05 85 2011 6 16.56 5.82 0.00 3.66 1.92 1.18 ELYANA 2011 6 5.18 19.43 5.21 19.90 2.68 2.40 FESTIVAL 2011 6 3.15 6.91 0.00 19.22 0.00 4.07 RED MERLIN 2011 6 51.99 1.51 17.53 1.42 0.00 0.00 SAN ANDREAS 2011 6 0.87 14.24 25.41 4.41 0.91 4.42 ALBION 2011 7 39.47 21 .04 22.86 1.54 0.56 1.61 CHARLOTTE 2011 7 52.15 55.52 10.44 0.00 3.15 0.00 FESTIVAL 2011 7 7.25 4.86 9.07 0.38 5.51 2.02 MARA DES BOIS 2011 7 29.18 8.81 7.36 0.51 2.94 6.53 MONTERREY 2011 7 20.52 25.30 106.05 1.90 0.53 3.90 ALBION 2012 1 45. 45 12.53 3.34 21.56 0.44 4.57 FESTIVAL 2012 1 28.56 6.77 7.29 6.08 7.63 11.41 MOJAVE 2012 1 31.51 17.83 9.45 25.96 0.07 5.99 PROPRIETARY 3 2012 1 27.14 29.70 15.82 3.90 2.12 0.00 CHANDLER 2012 4 640.91 70.63 37.55 8.35 0.00 5.75 FESTIVAL 2012 4 31.73 18.12 13.62 15.73 20.02 8.67 FL 09 127 2012 4 94.68 28.80 19.00 40.87 1.18 9.99 TREASURE 2012 4 45.06 42.31 30.94 49.17 4.63 11.36 WINTER DAWN 2012 4 16.40 22.80 21.51 23.76 0.33 5.67 PROPRIETARY 5 2012 5 62.48 32.81 7.45 6.71 2.55 1. 07 ALBION 2012 5 19.46 39.82 16.87 21.29 1.83 18.47 FESTIVAL 2012 5 44.71 14.72 12.89 7.41 7.73 8.18 RUBYGEM 2012 5 30.28 20.33 18.43 26.20 2.28 8.87 CAMINO REAL 2012 6 305.02 43.57 26.48 36.58 10.02 7.75 DARSELECT 2012 6 156.00 65.91 25.44 31.19 9.20 9.79 FESTIVAL 2012 6 24.65 10.18 20.16 13.58 24.21 7.96 SWEET ANNE 2012 6 103.18 31.91 21.50 12.75 3.51 2.77 BENICIA 2012 7 49.89 50.04 17.87 8.60 1.77 4.03 FESTIVAL 2012 7 18.20 10.35 14.22 9.75 24.04 7.39 FL 06 38 2012 7 18.85 2 8.26 15.98 15.06 8.08 10.63 PORTOLA 2012 7 33.47 16.91 16.44 6.16 2.07 1.49 VENTANA 2012 7 42.06 36.12 26.96 12.71 2.79 1.98 PROPRIETARY 6 2012 9 16.78 22.10 10.68 12.49 1.76 3.46 EVIE 2 2012 9 30.52 58.37 14.78 6.49 2.95 3.68 FESTIVAL 2012 9 9.77 8.38 9.84 2.06 9.80 5.19 GALLETA 2012 9 26.33 16.01 10.89 12.47 3.45 7.97 SWEET ANNE 2012 9 15.95 23.61 15.38 4.26 1.63 1.35

PAGE 62

62 Table 2 1. Continued. HIGH 20.14 8.63 9.74 34.43 749.40 2.71 LOW 0.00 0.00 1.47 0.00 18.26 0.00 MEDIAN 2.54 3.16 4.38 2.79 190.28 0.40 FOLD DIFFERENCE 7 41 CULTIVAR HARVEST 539 82 2 111 71 7 628 63 7 1191 16 8 106 70 7 55514 48 2 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ester aldehyde ester ester ester ester PROPRIETARY 1 2011 2 0.00 4.23 3.94 2.54 517.87 0.00 CAMAROSA 2011 2 2.57 6.47 5.22 12.84 168.57 0.00 FESTIVAL 2011 2 6.12 4.32 4.14 0.60 191.30 0.00 MARA DES BOIS 2011 2 2.12 3.18 4.73 1.08 211.46 0.00 RADIANCE 2011 2 3.21 5.15 4.36 21.68 230.46 0.00 PROPRIETARY 2 2011 3 0.00 4.33 4.10 0.00 182.53 0.64 CAMAROSA 2011 3 2.59 6.70 8.16 7.85 177.26 1.17 SWEET CHARLIE 2011 3 1.76 4.95 4.92 0.00 579.41 0.28 TREASURE 2011 3 2.59 8.63 4.57 1.81 39.38 0.66 WINTER DAWN 2011 3 1.11 4.85 4.21 0.00 181.28 0.32 PROPRIETARY 3 2011 4 9.21 2.97 9.74 29.55 506.71 0.64 CAMINO REAL 2011 4 0.00 0.77 4.23 3.50 150.10 0.49 FESTIVAL 2011 4 2.71 1.20 6.64 0.94 601.98 0.16 WINTERSTAR 2011 5 0.36 0.00 4.07 11.72 319.32 0.38 FESTI VAL 2011 5 0.14 0.63 3.43 1.48 247.67 0.19 RADIANCE 2011 5 0.00 0.33 4.42 11.16 184.38 0.27 PROPRIETARY 4 2011 5 0.69 2.88 5.72 3.34 378.92 0.27 FL 05 85 2011 6 0.00 0.00 2.22 1.24 177.86 0.04 ELYANA 2011 6 0.89 0.95 6.03 2.47 352.17 0.22 FE STIVAL 2011 6 1.85 0.15 3.86 0.00 287.17 0.11 RED MERLIN 2011 6 0.00 0.81 3.18 6.79 141.67 0.28 SAN ANDREAS 2011 6 0.39 0.44 3.12 17.54 167.24 0.11 ALBION 2011 7 2.66 1.10 2.73 8.36 56.88 0.71 CHARLOTTE 2011 7 0.00 1.43 3.02 7.78 18.26 0.60 FESTIVAL 2011 7 2.04 1.21 3.71 1.56 170.82 0.93 MARA DES BOIS 2011 7 1.41 1.05 4.22 4.08 240.92 1.15 MONTERREY 2011 7 0.23 0.59 3.83 34.43 55.08 2.44 ALBION 2012 1 6.79 7.65 5.60 1.04 189.25 0.42 FESTIVAL 2012 1 3.83 2.87 2.60 1.76 232.02 0.4 2 MOJAVE 2012 1 4.63 4.20 6.57 2.23 238.63 0.46 PROPRIETARY 3 2012 1 0.00 1.70 3.25 2.87 314.38 0.00 CHANDLER 2012 4 6.36 0.00 5.35 11.86 292.32 2.71 FESTIVAL 2012 4 20.14 4.82 4.61 1.78 180.57 0.60 FL 09 127 2012 4 15.20 3.48 4.31 6.10 374. 19 0.58 TREASURE 2012 4 5.65 7.85 5.04 6.91 99.88 0.97 WINTER DAWN 2012 4 3.31 4.49 6.54 4.52 188.53 0.74 PROPRIETARY 5 2012 5 1.70 2.07 4.40 0.65 128.06 1.07 ALBION 2012 5 5.24 5.89 8.66 4.74 228.08 1.34 FESTIVAL 2012 5 3.35 3.17 4.87 1.42 230.09 0.50 RUBYGEM 2012 5 2.52 4.80 4.56 6.54 229.35 0.68 CAMINO REAL 2012 6 6.03 7.48 6.92 1.71 175.99 0.67 DARSELECT 2012 6 5.47 5.80 6.21 4.45 636.03 0.55 FESTIVAL 2012 6 5.89 5.28 5.45 3.02 348.91 0.44 SWEET ANNE 2012 6 2.91 4.03 3.15 1 .53 174.94 0.46 BENICIA 2012 7 3.16 2.06 1.80 4.66 67.54 0.29 FESTIVAL 2012 7 7.76 3.46 5.75 2.42 485.44 0.25 FL 06 38 2012 7 11.27 4.85 5.47 2.71 614.15 0.38 PORTOLA 2012 7 1.10 2.92 1.99 8.54 117.55 0.33 VENTANA 2012 7 1.48 3.15 2.97 13.61 164.55 0.18 PROPRIETARY 6 2012 9 5.21 3.56 5.66 3.48 749.40 0.98 EVIE 2 2012 9 1.62 2.64 3.40 2.46 167.41 0.36 FESTIVAL 2012 9 2.93 1.05 4.97 1.18 235.34 0.00 GALLETA 2012 9 1.27 4.01 3.07 0.82 144.95 0.39 SWEET ANNE 2012 9 0.31 1.96 1.47 2 .32 101.93 0.00

PAGE 63

63 Table 2 1. Continued. HIGH 6.87 1123.40 726.88 15.43 257.91 108.16 LOW 0.28 0.00 3.59 0.83 5.68 3.22 MEDIAN 2.65 24.74 70.87 5.08 35.84 18.64 FOLD DIFFERENCE 25 202 19 45 34 CULTIVAR HARVEST 110 93 0 109 21 7 123 66 0 124 13 0 142 92 7 2497 18 9 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ketone ester ester aldehyde ester ester PROPRIETARY 1 2011 2 4.09 6.22 7.97 9.90 45.64 29.13 CAMAROSA 2011 2 3.10 29.58 9.92 9.99 69. 96 79.21 FESTIVAL 2011 2 5.35 132.50 125.58 4.92 52.94 16.30 MARA DES BOIS 2011 2 4.01 72.56 103.95 9.56 67.35 54.68 RADIANCE 2011 2 4.66 13.61 5.73 6.45 46.21 17.64 PROPRIETARY 2 2011 3 2.16 184.68 21.92 4.26 57.68 5.26 CAMAROSA 2011 3 4.82 82.90 34.95 11.54 76.65 17.42 SWEET CHARLIE 2011 3 6.87 46.30 80.13 9.32 72.09 5.60 TREASURE 2011 3 5.16 211.28 16.96 8.05 59.48 6.67 WINTER DAWN 2011 3 3.41 7.54 22.10 3.95 30.73 13.87 PROPRIETARY 3 2011 4 6.06 3.57 148.57 5.69 39.10 24.51 C AMINO REAL 2011 4 0.86 23.70 48.17 4.60 32.03 9.52 FESTIVAL 2011 4 3.57 61.45 162.29 3.00 35.01 3.98 WINTERSTAR 2011 5 0.97 22.95 133.45 3.37 33.59 25.97 FESTIVAL 2011 5 1.53 10.87 37.28 2.55 14.04 9.23 RADIANCE 2011 5 2.86 4.59 31.31 2.41 23 .01 24.78 PROPRIETARY 4 2011 5 3.11 222.92 164.62 8.87 46.56 23.62 FL 05 85 2011 6 0.77 5.05 12.41 3.57 16.86 19.32 ELYANA 2011 6 1.33 132.18 75.36 2.66 109.46 5.94 FESTIVAL 2011 6 1.68 38.21 96.71 4.64 25.58 16.58 RED MERLIN 2011 6 0.28 0.0 0 4.79 3.78 16.14 35.49 SAN ANDREAS 2011 6 1.34 23.64 73.49 2.03 28.01 12.68 ALBION 2011 7 1.06 15.39 14.48 2.58 16.58 20.08 CHARLOTTE 2011 7 0.39 0.66 3.59 7.31 21.39 35.79 FESTIVAL 2011 7 1.59 8.76 80.61 0.83 13.84 13.77 MARA DES BOIS 2011 7 1.05 51.57 295.46 4.55 32.49 23.27 MONTERREY 2011 7 1.40 55.74 26.33 7.79 104.68 50.34 ALBION 2012 1 3.53 1123.40 49.89 5.17 199.02 11.15 FESTIVAL 2012 1 2.49 57.18 169.83 4.07 31.69 14.33 MOJAVE 2012 1 1.33 154.43 83.49 4.98 257.91 33.53 P ROPRIETARY 3 2012 1 1.54 0.00 26.63 3.17 12.46 8.46 CHANDLER 2012 4 3.73 24.68 19.38 6.85 78.72 35.84 FESTIVAL 2012 4 5.05 45.17 137.24 4.08 21.52 4.00 FL 09 127 2012 4 2.65 149.77 208.16 4.76 113.53 12.46 TREASURE 2012 4 2.65 77.25 322.38 6. 17 77.52 10.99 WINTER DAWN 2012 4 1.87 4.05 280.32 6.10 69.31 17.19 PROPRIETARY 5 2012 5 2.55 0.00 55.45 8.31 23.48 27.35 ALBION 2012 5 5.12 121.60 369.10 8.16 90.75 58.32 FESTIVAL 2012 5 2.99 17.64 68.25 4.41 22.63 13.67 RUBYGEM 2012 5 3.43 16.65 19.26 5.78 32.27 19.21 CAMINO REAL 2012 6 2.74 176.93 90.81 9.88 95.76 34.36 DARSELECT 2012 6 3.70 31.04 300.87 15.43 206.81 74.77 FESTIVAL 2012 6 3.85 80.27 103.95 7.18 36.66 42.17 SWEET ANNE 2012 6 4.08 6.84 74.49 11.22 45.04 108.16 B ENICIA 2012 7 2.93 8.67 88.83 8.24 39.25 71.59 FESTIVAL 2012 7 2.59 64.12 187.23 4.76 33.82 26.46 FL 06 38 2012 7 2.97 99.72 726.88 6.26 76.37 20.62 PORTOLA 2012 7 1.46 0.80 60.21 3.44 15.41 18.08 VENTANA 2012 7 0.58 0.00 34.29 3.77 18.52 36. 37 PROPRIETARY 6 2012 9 2.37 24.79 350.70 12.25 20.91 24.32 EVIE 2 2012 9 1.25 22.57 43.48 5.70 29.09 4.82 FESTIVAL 2012 9 1.87 19.02 52.54 1.61 8.42 3.22 GALLETA 2012 9 3.04 88.84 62.31 6.66 37.24 8.68 SWEET ANNE 2012 9 2.02 7.92 17.87 2.14 5.68 3.47

PAGE 64

64 Table 2 1. Continued. HIGH 11.52 22.42 18.23 20.36 6.53 13.43 LOW 0.00 0.00 0.00 0.00 0.00 0.15 MEDIAN 0.31 4.45 2.56 1.63 2.28 2.50 FOLD DIFFERENCE 91 CULTIVAR HARVEST 60415 61 4 104 76 7 2311 46 8 109 19 3 2548 87 0 540 18 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ester alcohol ester ester aldehyde ester PROPRIETARY 1 2011 2 0.53 4.53 0.00 0.79 2.17 1.67 CAMAROSA 2011 2 0.00 1.38 0.00 1.23 3.22 1.63 FESTIVAL 2 011 2 1.31 11.70 0.33 1.63 3.91 2.56 MARA DES BOIS 2011 2 0.10 1.91 0.03 2.07 2.15 2.21 RADIANCE 2011 2 0.14 12.21 0.00 0.40 3.64 1.60 PROPRIETARY 2 2011 3 1.60 4.26 2.03 20.36 1.91 11.15 CAMAROSA 2011 3 0.15 3.14 0.45 2.82 4.47 2.67 SWEET C HARLIE 2011 3 1.15 10.25 2.60 1.99 4.78 2.74 TREASURE 2011 3 1.15 6.23 0.00 6.15 6.53 7.55 WINTER DAWN 2011 3 0.47 4.77 0.00 1.60 4.77 1.10 PROPRIETARY 3 2011 4 0.35 2.00 5.06 0.50 2.67 0.83 CAMINO REAL 2011 4 0.00 0.00 7.27 0.00 0.91 0.19 F ESTIVAL 2011 4 0.00 7.53 2.32 0.00 0.89 0.69 WINTERSTAR 2011 5 0.00 8.88 0.00 0.00 0.42 1.89 FESTIVAL 2011 5 0.00 3.41 0.00 0.00 0.41 1.03 RADIANCE 2011 5 0.00 4.20 0.00 0.00 0.40 0.15 PROPRIETARY 4 2011 5 1.34 5.41 5.28 2.09 1.75 13.43 FL 0 5 85 2011 6 0.26 3.35 0.46 0.00 0.50 0.43 ELYANA 2011 6 0.27 22.42 2.51 11.87 0.35 5.80 FESTIVAL 2011 6 0.24 8.24 1.30 0.00 0.49 1.07 RED MERLIN 2011 6 0.52 2.52 0.00 0.00 0.59 0.39 SAN ANDREAS 2011 6 0.31 12.90 1.56 0.00 0.70 1.09 ALBION 20 11 7 0.02 1.13 0.44 0.00 1.22 1.45 CHARLOTTE 2011 7 0.15 0.20 0.01 0.00 0.38 0.28 FESTIVAL 2011 7 0.22 0.00 0.00 0.00 0.66 0.28 MARA DES BOIS 2011 7 0.00 2.16 0.00 0.00 0.35 1.81 MONTERREY 2011 7 0.12 3.69 1.72 1.06 0.45 1.21 ALBION 2012 1 11.52 18.50 18.17 15.65 2.45 12.32 FESTIVAL 2012 1 1.89 6.57 7.21 1.23 2.19 4.81 MOJAVE 2012 1 1.83 12.54 12.07 3.87 1.94 5.12 PROPRIETARY 3 2012 1 0.10 1.95 2.51 0.79 2.36 0.97 CHANDLER 2012 4 0.00 4.86 5.20 1.94 0.00 0.24 FESTIVAL 2012 4 1.26 7.46 7.27 1.56 2.64 3.81 FL 09 127 2012 4 1.13 11.33 11.65 3.48 2.20 6.39 TREASURE 2012 4 0.91 6.30 7.51 4.95 4.40 9.49 WINTER DAWN 2012 4 0.55 5.07 6.15 2.42 3.66 3.41 PROPRIETARY 5 2012 5 0.27 1.20 1.85 1.99 3.00 2.44 ALBION 2012 5 0. 94 7.46 6.77 7.26 3.65 5.74 FESTIVAL 2012 5 0.16 2.79 3.16 1.23 2.97 3.08 RUBYGEM 2012 5 0.61 3.46 2.97 1.54 2.41 2.89 CAMINO REAL 2012 6 1.20 4.36 4.93 2.43 2.18 5.25 DARSELECT 2012 6 0.56 10.86 11.55 6.35 3.11 7.25 FESTIVAL 2012 6 1.06 8.6 1 9.71 2.80 3.82 5.11 SWEET ANNE 2012 6 0.31 4.08 4.90 2.50 3.14 4.05 BENICIA 2012 7 0.23 2.15 3.34 2.55 4.36 4.48 FESTIVAL 2012 7 0.69 10.91 10.75 1.62 3.28 3.86 FL 06 38 2012 7 0.79 17.63 18.23 6.27 5.46 10.22 PORTOLA 2012 7 0.10 9.68 1.97 1.76 3.50 2.04 VENTANA 2012 7 0.11 0.74 2.27 1.84 3.37 2.41 PROPRIETARY 6 2012 9 0.55 6.67 6.48 1.74 3.05 4.88 EVIE 2 2012 9 0.14 1.81 2.69 4.11 1.91 4.32 FESTIVAL 2012 9 0.38 4.34 3.88 0.25 1.65 1.26 GALLETA 2012 9 0.52 2.33 2.99 5.55 3.54 4.73 SWEET ANNE 2012 9 0.10 1.98 2.62 1.16 1.77 2.26

PAGE 65

65 Table 2 1. Continued. HIGH 42.14 107.78 53.62 12.98 482.77 40.01 LOW 0.00 1.54 0.00 0.13 21.64 1.31 MEDIAN 9.41 14.36 0.82 1.92 81.74 5.66 FOLD DIFFERENCE 70 102 22 30 CULTIVAR HARVE ST 4077 47 8 20664 46 4 821 55 6 5989 33 3 78 70 6 124 19 6 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 furan aldehyde ketone furan alcohol aldehyde PROPRIETARY 1 2011 2 12.78 29.87 0.11 3.81 137.57 22 .11 CAMAROSA 2011 2 17.54 14.62 0.66 1.63 51.87 18.85 FESTIVAL 2011 2 19.87 37.83 1.43 3.16 75.99 19.24 MARA DES BOIS 2011 2 17.84 17.40 1.07 1.32 28.59 12.59 RADIANCE 2011 2 26.97 9.60 0.41 3.58 306.04 40.01 PROPRIETARY 2 2011 3 16.90 32.79 2.18 1.80 31.65 11.72 CAMAROSA 2011 3 23.65 23.72 2.30 1.13 79.98 20.75 SWEET CHARLIE 2011 3 28.96 26.38 9.77 4.42 161.57 32.69 TREASURE 2011 3 42.14 37.23 8.28 1.29 65.37 17.61 WINTER DAWN 2011 3 20.93 7.30 0.57 0.92 54.87 8.35 PROPRIETARY 3 2011 4 10.54 107.78 0.00 2.48 322.88 13.77 CAMINO REAL 2011 4 3.31 10.08 0.00 1.73 286.33 10.30 FESTIVAL 2011 4 7.91 23.99 0.00 1.68 71.60 7.05 WINTERSTAR 2011 5 1.26 2.50 0.00 0.78 32.98 2.12 FESTIVAL 2011 5 2.03 2.17 0.00 2.40 59.36 2.10 RADIANCE 2011 5 3.05 2.13 0.00 0.23 150.10 4.63 PROPRIETARY 4 2011 5 13.58 31.50 0.00 3.71 84.37 8.34 FL 05 85 2011 6 2.92 8.75 0.00 0.76 52.49 2.43 ELYANA 2011 6 5.86 12.72 0.28 0.28 62.28 4.67 FESTIVAL 2011 6 4.32 11.44 0.00 0.46 43.26 2.62 RED MERLIN 2011 6 3.73 3.25 0.00 2.11 40.05 2.28 SAN ANDREAS 2011 6 7.67 29.67 0.00 1.39 137.52 3.64 ALBION 2011 7 5.27 3.65 0.00 1.07 168.45 3.63 CHARLOTTE 2011 7 4.46 13.69 0.00 1.67 34.07 3.20 FESTIVAL 2011 7 2.70 5.25 0.00 0.88 30.15 1. 31 MARA DES BOIS 2011 7 4.22 9.85 0.00 0.13 21.64 2.85 MONTERREY 2011 7 16.37 40.26 0.00 1.51 133.91 5.54 ALBION 2012 1 9.73 22.76 5.45 12.98 423.84 11.40 FESTIVAL 2012 1 7.08 12.05 2.52 3.63 104.29 5.26 MOJAVE 2012 1 7.95 3.34 2.94 3.22 63. 18 5.66 PROPRIETARY 3 2012 1 9.67 8.86 0.24 7.00 240.74 5.66 CHANDLER 2012 4 0.00 19.73 0.00 1.56 35.92 4.09 FESTIVAL 2012 4 14.54 29.45 0.00 1.72 56.24 6.46 FL 09 127 2012 4 11.81 40.36 53.62 1.37 67.05 5.48 TREASURE 2012 4 16.01 33.65 11.3 9 1.88 67.90 8.36 WINTER DAWN 2012 4 13.35 4.56 25.43 1.13 51.47 5.20 PROPRIETARY 5 2012 5 9.29 11.72 3.61 2.27 112.00 4.44 ALBION 2012 5 18.44 14.10 8.28 8.69 400.74 7.71 FESTIVAL 2012 5 8.71 4.75 1.81 3.28 83.51 4.40 RUBYGEM 2012 5 6.13 11 .73 5.31 3.64 97.91 4.73 CAMINO REAL 2012 6 8.16 24.39 4.96 6.59 244.74 11.06 DARSELECT 2012 6 26.02 69.41 8.77 5.87 153.20 9.67 FESTIVAL 2012 6 13.06 23.72 4.68 4.89 90.93 9.72 SWEET ANNE 2012 6 7.61 21.36 1.81 7.21 482.77 14.43 BENICIA 2012 7 15.11 8.58 5.87 3.65 330.32 6.09 FESTIVAL 2012 7 13.33 13.74 3.41 1.96 99.14 5.59 FL 06 38 2012 7 23.82 56.32 5.40 2.90 222.58 5.48 PORTOLA 2012 7 9.49 1.89 0.08 2.27 27.05 3.52 VENTANA 2012 7 9.32 1.54 1.05 4.40 86.68 6.13 PROPRIETARY 6 2 012 9 8.31 25.05 2.14 0.85 79.76 6.73 EVIE 2 2012 9 5.86 19.66 0.99 1.71 69.84 3.64 FESTIVAL 2012 9 3.28 6.69 0.00 0.94 24.57 1.34 GALLETA 2012 9 21.08 47.33 1.96 2.47 218.27 6.18 SWEET ANNE 2012 9 7.41 21.61 0.00 7.17 295.85 4.04

PAGE 66

66 Table 2 1. Continued. HIGH 6.80 36.07 72.87 22.46 13.66 117.92 LOW 1.06 1.29 0.00 0.00 0.00 0.49 MEDIAN 2.78 8.54 6.96 3.75 0.82 10.26 FOLD DIFFERENCE 6 28 239 CULTIVAR HARVEST 103 09 3 140 11 4 2639 63 6 53398 83 7 106 32 1 112 14 1 ng 1 gFW 1 h r 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ester ester ester ester ester ester PROPRIETARY 1 2011 2 4.51 7.40 2.54 2.84 0.13 11.65 CAMAROSA 2011 2 2.87 7.66 6.98 7.08 0.16 21.13 FESTIVAL 2011 2 3.29 6.81 21.4 9 16.38 1.21 11.03 MARA DES BOIS 2011 2 4.50 8.83 21.27 15.48 0.80 19.38 RADIANCE 2011 2 3.41 11.79 8.25 4.27 0.23 5.46 PROPRIETARY 2 2011 3 4.42 12.94 12.80 7.12 0.39 10.35 CAMAROSA 2011 3 3.96 15.69 12.79 3.99 0.62 34.07 SWEET CHARLIE 2011 3 3.44 25.45 17.14 3.60 1.26 28.47 TREASURE 2011 3 2.04 11.17 29.51 9.74 0.26 9.99 WINTER DAWN 2011 3 2.49 8.65 2.03 1.34 0.33 4.41 PROPRIETARY 3 2011 4 6.06 25.91 1.01 0.62 4.63 20.99 CAMINO REAL 2011 4 4.26 36.07 3.94 1.06 0.82 20.04 FESTIV AL 2011 4 3.84 6.47 11.68 5.12 2.07 17.37 WINTERSTAR 2011 5 2.94 10.12 7.39 3.65 1.29 10.17 FESTIVAL 2011 5 2.28 4.03 3.72 2.90 0.41 2.89 RADIANCE 2011 5 2.41 8.77 2.56 3.60 0.28 1.24 PROPRIETARY 4 2011 5 3.26 24.68 28.61 11.18 1.69 8.78 FL 05 85 2011 6 2.58 3.56 0.95 1.61 0.07 3.02 ELYANA 2011 6 2.50 19.10 0.00 1.00 1.21 103.40 FESTIVAL 2011 6 3.28 4.86 10.50 10.41 0.63 5.39 RED MERLIN 2011 6 2.07 6.98 0.63 1.24 0.13 0.49 SAN ANDREAS 2011 6 2.37 9.74 3.48 0.87 0.65 1.25 ALBION 2011 7 1.44 5.62 1.43 1.55 0.35 2.62 CHARLOTTE 2011 7 1.68 2.93 0.90 1.71 0.11 1.15 FESTIVAL 2011 7 1.68 3.57 2.31 2.28 0.68 2.49 MARA DES BOIS 2011 7 3.05 4.13 12.55 5.77 6.07 22.76 MONTERREY 2011 7 3.33 30.29 6.93 2.81 0.62 67.70 ALBION 2 012 1 1.91 7.51 72.87 6.97 0.15 30.97 FESTIVAL 2012 1 1.93 3.57 8.17 8.39 1.06 6.29 MOJAVE 2012 1 2.19 15.81 42.52 6.27 0.51 80.78 PROPRIETARY 3 2012 1 1.84 4.24 0.12 0.00 0.25 3.93 CHANDLER 2012 4 3.56 24.18 11.30 4.21 0.00 27.23 FESTIVAL 2 012 4 2.51 4.69 9.36 5.43 0.00 4.85 FL 09 127 2012 4 2.78 9.04 30.03 5.84 8.93 33.80 TREASURE 2012 4 2.63 8.43 13.65 4.71 5.39 16.21 WINTER DAWN 2012 4 2.55 8.94 1.67 0.68 6.25 10.41 PROPRIETARY 5 2012 5 2.41 9.79 0.60 1.20 0.00 2.93 ALBION 2012 5 2.96 15.31 9.56 4.68 4.31 41.16 FESTIVAL 2012 5 1.71 3.92 5.40 4.30 0.00 2.70 RUBYGEM 2012 5 1.83 5.61 3.16 3.26 0.00 13.94 CAMINO REAL 2012 6 3.32 26.05 30.87 12.77 2.93 29.70 DARSELECT 2012 6 3.57 8.36 26.13 10.14 8.35 117.92 FESTIV AL 2012 6 3.18 4.63 12.22 22.46 4.80 11.58 SWEET ANNE 2012 6 2.78 6.13 2.39 3.86 4.12 7.78 BENICIA 2012 7 2.99 32.97 2.82 2.86 4.39 8.61 FESTIVAL 2012 7 1.86 4.42 11.81 12.66 5.25 9.94 FL 06 38 2012 7 2.10 19.64 22.97 5.08 13.66 28.08 PORTOL A 2012 7 2.17 1.79 1.18 0.85 6.16 8.62 VENTANA 2012 7 1.06 21.96 1.13 1.42 2.32 3.62 PROPRIETARY 6 2012 9 6.80 12.26 6.93 3.02 9.47 13.97 EVIE 2 2012 9 5.20 10.43 4.18 0.78 0.95 13.53 FESTIVAL 2012 9 2.31 1.29 3.00 2.26 0.82 1.75 GALLETA 201 2 9 4.11 2.97 11.96 4.40 1.79 6.70 SWEET ANNE 2012 9 3.42 4.24 2.02 0.61 1.70 3.25

PAGE 67

67 Table 2 1. Continued. HIGH 52.26 6.93 4.74 397.54 13.27 28.72 LOW 0.06 0.00 0.00 0.00 0.00 0.00 MEDIAN 4.95 1.67 0.00 21.75 1.10 1.33 FOLD DIFFERENCE 875 CULTIVAR HARVEST 564 94 3 3913 81 3 134 20 3 110 39 4 110 38 3 29811 50 5 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 aldehyde aldehyde ester ester ester ester PROPRIETARY 1 2011 2 3.33 5.23 0 .00 11.79 0.00 5.59 CAMAROSA 2011 2 3.66 4.22 0.00 27.44 0.00 7.58 FESTIVAL 2011 2 4.22 3.58 0.00 50.97 6.02 0.59 MARA DES BOIS 2011 2 10.95 2.72 0.00 33.50 1.22 1.11 RADIANCE 2011 2 52.26 2.71 0.00 6.10 0.00 0.54 PROPRIETARY 2 2011 3 8.12 4 .23 0.00 34.71 0.00 2.00 CAMAROSA 2011 3 9.20 6.93 0.00 60.22 0.00 11.73 SWEET CHARLIE 2011 3 10.97 3.42 0.00 59.74 3.99 3.58 TREASURE 2011 3 10.54 5.50 0.00 53.49 0.00 2.87 WINTER DAWN 2011 3 2.19 1.95 0.00 3.37 0.00 0.61 PROPRIETARY 3 2011 4 0.78 3.53 0.00 4.28 0.00 1.74 CAMINO REAL 2011 4 0.84 1.31 0.00 24.94 0.00 2.53 FESTIVAL 2011 4 4.07 2.24 0.00 41.00 3.63 3.15 WINTERSTAR 2011 5 4.94 0.47 0.00 11.29 0.64 0.66 FESTIVAL 2011 5 0.17 0.65 0.00 4.84 0.40 0.74 RADIANCE 2011 5 5.12 0.78 0.00 1.17 0.37 0.80 PROPRIETARY 4 2011 5 9.67 3.96 0.00 48.33 1.60 0.65 FL 05 85 2011 6 0.64 0.79 0.00 3.64 2.38 1.17 ELYANA 2011 6 1.52 1.15 0.00 397.54 2.93 5.24 FESTIVAL 2011 6 1.47 1.02 0.00 21.95 5.77 1.35 RED MERLIN 2011 6 3. 84 0.91 0.00 0.21 0.00 0.56 SAN ANDREAS 2011 6 0.06 0.55 0.00 7.00 1.64 0.26 ALBION 2011 7 8.36 0.51 0.00 1.69 0.00 0.46 CHARLOTTE 2011 7 3.84 0.67 1.46 0.00 0.00 0.40 FESTIVAL 2011 7 2.44 0.60 0.00 4.43 0.97 1.32 MARA DES BOIS 2011 7 4.30 1 .42 4.74 28.14 2.30 1.73 MONTERREY 2011 7 0.62 1.08 0.00 46.32 0.45 28.72 ALBION 2012 1 6.70 1.49 0.00 263.31 13.27 2.56 FESTIVAL 2012 1 4.95 1.70 0.00 17.42 1.71 0.70 MOJAVE 2012 1 7.34 2.02 0.00 234.85 1.99 10.78 PROPRIETARY 3 2012 1 2.45 1.63 0.00 3.46 0.00 0.28 CHANDLER 2012 4 7.61 0.00 0.00 61.48 0.00 17.51 FESTIVAL 2012 4 6.77 2.35 0.00 31.08 7.18 1.72 FL 09 127 2012 4 17.13 1.84 0.00 94.26 3.87 3.33 TREASURE 2012 4 8.39 2.95 0.00 35.23 1.29 3.63 WINTER DAWN 2012 4 4.20 0 .70 0.00 4.73 0.69 0.00 PROPRIETARY 5 2012 5 7.75 1.80 0.00 0.63 0.00 0.00 ALBION 2012 5 13.97 1.70 0.00 36.23 4.45 3.43 FESTIVAL 2012 5 3.00 1.78 0.00 6.15 0.97 0.88 RUBYGEM 2012 5 7.10 2.19 0.00 22.67 1.71 2.07 CAMINO REAL 2012 6 6.58 1.06 0.00 95.34 2.58 1.63 DARSELECT 2012 6 3.75 2.02 0.00 100.59 1.55 19.94 FESTIVAL 2012 6 6.02 2.93 0.00 23.30 5.14 0.89 SWEET ANNE 2012 6 4.40 1.28 0.00 8.95 4.14 0.65 BENICIA 2012 7 12.14 1.26 0.00 5.09 0.84 0.00 FESTIVAL 2012 7 6.79 2.06 0. 00 19.59 3.97 0.93 FL 06 38 2012 7 10.22 1.88 0.00 55.04 6.14 1.79 PORTOLA 2012 7 2.74 1.20 0.00 4.51 0.24 2.12 VENTANA 2012 7 6.36 1.30 0.00 1.90 0.00 0.00 PROPRIETARY 6 2012 9 4.01 2.24 0.00 16.72 2.24 0.76 EVIE 2 2012 9 5.97 1.37 0.00 21. 55 0.00 2.51 FESTIVAL 2012 9 2.29 0.72 0.00 6.94 2.48 1.11 GALLETA 2012 9 13.64 0.68 0.00 37.60 0.00 2.73 SWEET ANNE 2012 9 2.76 0.45 0.00 4.33 8.38 0.73

PAGE 68

68 Table 2 1. Continued. HIGH 191.41 6.17 346.93 5.57 12.77 12.92 LOW 0.00 0.00 0.00 0.0 0 2.30 0.00 MEDIAN 2.28 0.81 5.73 0.70 5.74 2.49 FOLD DIFFERENCE 6 CULTIVAR HARVEST 7786 58 5 15111 96 3 706 14 9 10522 34 6 5881 17 4 128 37 0 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 e ster ester furan ester hydrocarbon PROPRIETARY 1 2011 2 4.53 0.85 0.68 0.44 9.73 0.67 CAMAROSA 2011 2 6.93 0.56 0.96 0.59 7.49 1.09 FESTIVAL 2011 2 1.17 1.93 0.60 1.51 8.54 2.27 MARA DES BOIS 2011 2 6.72 4.69 0.94 0.42 8.68 0.36 RADIANCE 2011 2 0.34 0.65 115.37 0.68 9.88 2.43 PROPRIETARY 2 2011 3 24.85 0.06 0.00 1.36 11.41 0.82 CAMAROSA 2011 3 16.29 2.80 1.57 1.14 10.85 2.21 SWEET CHARLIE 2011 3 15.07 4.29 313.79 1.33 12.77 5.49 TREASURE 2011 3 10.66 0.61 5.79 1.64 9.70 1.33 WIN TER DAWN 2011 3 0.24 0.96 1.02 0.27 7.42 1.71 PROPRIETARY 3 2011 4 8.02 1.01 3.11 0.38 9.60 0.98 CAMINO REAL 2011 4 1.80 1.00 21.12 0.61 9.23 1.22 FESTIVAL 2011 4 1.61 6.17 0.40 1.78 10.03 3.01 WINTERSTAR 2011 5 0.64 1.64 20.02 0.57 5.25 1.03 FESTIVAL 2011 5 0.00 1.73 5.78 0.32 5.90 1.41 RADIANCE 2011 5 0.00 1.42 33.22 0.57 6.43 3.08 PROPRIETARY 4 2011 5 1.56 0.79 0.73 2.11 5.36 0.57 FL 05 85 2011 6 0.00 2.79 0.45 0.59 2.93 0.63 ELYANA 2011 6 60.26 2.25 46.44 5.57 4.56 0.70 FES TIVAL 2011 6 0.90 3.21 0.84 1.53 5.00 1.63 RED MERLIN 2011 6 0.00 0.34 6.79 0.00 2.30 0.00 SAN ANDREAS 2011 6 0.18 0.23 83.49 0.51 3.63 1.47 ALBION 2011 7 1.13 0.41 6.56 0.24 3.99 2.54 CHARLOTTE 2011 7 0.49 0.41 0.37 0.00 3.89 0.00 FESTIVAL 2011 7 0.42 2.07 0.00 0.29 3.30 1.09 MARA DES BOIS 2011 7 4.34 2.49 0.00 0.56 3.40 0.00 MONTERREY 2011 7 13.36 1.00 0.00 0.40 5.11 2.04 ALBION 2012 1 22.86 1.24 346.93 4.53 7.67 8.11 FESTIVAL 2012 1 1.05 1.07 2.62 1.23 6.13 8.09 MOJAVE 2012 1 60.69 0.60 191.40 2.35 3.91 0.00 PROPRIETARY 3 2012 1 0.94 0.48 1.68 0.00 3.04 1.54 CHANDLER 2012 4 37.20 0.00 78.79 2.89 9.81 12.92 FESTIVAL 2012 4 2.75 1.44 2.62 2.22 8.36 9.62 FL 09 127 2012 4 30.92 0.97 147.96 2.35 7.21 9.66 TREASURE 2 012 4 15.68 0.98 5.18 1.32 6.34 3.64 WINTER DAWN 2012 4 0.00 0.50 1.67 0.42 7.76 7.92 PROPRIETARY 5 2012 5 2.45 0.65 5.68 0.00 3.36 9.46 ALBION 2012 5 14.25 0.74 148.43 1.42 7.26 11.56 FESTIVAL 2012 5 0.98 0.69 1.24 0.67 3.89 8.09 RUBYGEM 20 12 5 4.63 0.79 38.39 1.26 4.08 8.35 CAMINO REAL 2012 6 6.41 0.82 84.65 2.68 5.73 9.55 DARSELECT 2012 6 191.41 0.44 292.66 1.32 5.90 8.18 FESTIVAL 2012 6 2.03 0.87 1.81 1.57 6.35 9.80 SWEET ANNE 2012 6 4.57 0.57 49.75 0.48 5.31 8.71 BENICIA 2 012 7 5.29 0.74 39.34 0.00 4.40 6.02 FESTIVAL 2012 7 1.09 0.79 1.36 1.05 5.74 5.50 FL 06 38 2012 7 18.44 0.66 150.70 2.24 5.80 5.01 PORTOLA 2012 7 2.10 0.41 1.42 0.00 3.90 1.86 VENTANA 2012 7 0.58 0.38 9.54 0.00 3.67 0.63 PROPRIETARY 6 2012 9 1.23 0.61 37.57 2.17 4.48 9.08 EVIE 2 2012 9 34.44 0.27 33.27 0.99 4.03 7.36 FESTIVAL 2012 9 0.88 1.07 0.81 0.72 3.48 2.63 GALLETA 2012 9 14.06 0.79 25.34 1.06 5.49 6.97 SWEET ANNE 2012 9 1.41 0.90 32.10 0.65 5.66 3.19

PAGE 69

69 Table 2 1. Contin ued. HIGH 667.62 185.71 29.36 30.10 LOW 0.00 0.00 0.00 0.14 MEDIAN 46.90 6.38 1.46 4.66 FOLD DIFFERENCE 211 CULTIVAR HARVEST 40716 66 3 4887 30 3 5454 09 1 2305 05 7 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 alcohol e ster ester furan PROPRIETARY 1 2011 2 97.06 12.78 8.68 4.20 CAMAROSA 2011 2 26.75 9.98 4.82 5.42 FESTIVAL 2011 2 86.35 23.87 11.82 9.72 MARA DES BOIS 2011 2 9.85 8.74 1.46 5.54 RADIANCE 2011 2 308.02 20.59 19.16 7.73 PROPRIETARY 2 2011 3 5.12 2.20 0.85 2.43 CAMAROSA 2011 3 78.87 16.29 4.94 9.50 SWEET CHARLIE 2011 3 667.62 65.87 24.70 11.74 TREASURE 2011 3 34.85 8.92 1.62 30.10 WINTER DAWN 2011 3 159.43 0.00 0.00 6.49 PROPRIETARY 3 2011 4 74.18 4.33 0.00 16.59 CAMINO REAL 20 11 4 36.38 8.96 1.89 1.31 FESTIVAL 2011 4 96.42 20.83 3.04 9.09 WINTERSTAR 2011 5 30.80 5.61 0.85 1.60 FESTIVAL 2011 5 51.21 3.16 0.81 2.78 RADIANCE 2011 5 198.38 0.00 0.00 3.55 PROPRIETARY 4 2011 5 27.41 2.62 1.27 6.68 FL 05 85 2011 6 7.63 1.34 0.25 3.00 ELYANA 2011 6 30.63 185.71 29.36 1.93 FESTIVAL 2011 6 43.41 33.67 1.47 3.11 RED MERLIN 2011 6 0.00 0.00 0.00 0.27 SAN ANDREAS 2011 6 46.87 3.77 0.00 3.57 ALBION 2011 7 12.49 0.00 0.00 1.57 CHARLOTTE 2011 7 0.00 0.00 0. 00 0.83 FESTIVAL 2011 7 6.07 1.99 0.00 0.92 MARA DES BOIS 2011 7 0.88 7.36 1.55 1.43 MONTERREY 2011 7 3.32 8.36 3.97 0.14 ALBION 2012 1 214.55 36.92 12.37 28.69 FESTIVAL 2012 1 149.32 7.95 1.92 14.55 MOJAVE 2012 1 7.36 94.19 14.57 13.45 PROPRIETARY 3 2012 1 38.63 0.00 0.00 8.54 CHANDLER 2012 4 17.26 37.41 7.02 6.85 FESTIVAL 2012 4 141.27 11.47 1.50 9.55 FL 09 127 2012 4 159.47 36.55 8.65 4.99 TREASURE 2012 4 39.48 5.72 1.15 26.32 WINTER DAWN 2012 4 72.49 0.00 0.00 4.43 P ROPRIETARY 5 2012 5 26.46 0.00 0.00 1.54 ALBION 2012 5 213.01 11.52 2.14 16.53 FESTIVAL 2012 5 86.59 2.24 0.79 5.33 RUBYGEM 2012 5 113.35 8.64 1.86 2.29 CAMINO REAL 2012 6 52.50 15.73 6.48 4.50 DARSELECT 2012 6 138.07 119.27 5.83 10.60 FE STIVAL 2012 6 116.93 6.07 1.64 8.30 SWEET ANNE 2012 6 144.53 3.85 0.00 4.81 BENICIA 2012 7 82.87 1.30 0.00 1.37 FESTIVAL 2012 7 123.21 6.69 1.20 6.86 FL 06 38 2012 7 244.90 30.12 6.10 10.15 PORTOLA 2012 7 8.16 1.79 0.00 0.97 VENTANA 2012 7 13.54 0.00 0.00 1.49 PROPRIETARY 6 2012 9 10.59 3.28 0.96 3.16 EVIE 2 2012 9 18.05 7.59 1.57 6.93 FESTIVAL 2012 9 42.61 2.80 1.03 3.20 GALLETA 2012 9 46.93 3.75 2.09 2.01 SWEET ANNE 2012 9 89.97 2.20 0.42 3.75

PAGE 70

70 Table 2 2. Standard err or s of consumer, physical, and biochemical measures. CULTIVAR HARVEST HARVEST DATE OVERALL LIKING TEXTURE LIKING SWEETNESS INTENSITY SOURNESS INTENSITY STRAWBERRY FLAVOR INTENSITY 100 to +100 100 to +100 0 to +100 0 to +100 0 to +100 PROPRIETARY 1 2011 2 1/24/2011 2.51 2.63 2.05 1.64 2.15 CAMAROSA 2011 2 1/24/2011 2.63 2.61 1.85 1.74 2.15 FESTIVAL 2011 2 1/24/2011 2.39 2.38 2.17 1.73 2.28 MARA DES BOIS 2011 2 1/24/2011 2.39 2.49 2.11 1.36 2.08 RADIANCE 2011 2 1/24/20 11 2.29 2.29 2.04 1.71 2.05 PROPRIETARY 2 2011 3 1/31/2011 2.46 2.66 2.19 1.49 2.32 CAMAROSA 2011 3 1/31/2011 2.31 2.36 2.01 1.62 2.13 SWEET CHARLIE 2011 3 1/31/2011 2.54 2.72 2.16 1.63 2.31 TREASURE 2011 3 1/31/2011 2.57 2.61 2.07 1.69 2.08 W INTER DAWN 2011 3 1/31/2011 2.29 2.39 1.80 1.65 2.00 PROPRIETARY 3 2011 4 2/7/2011 2.47 2.89 1.98 1.84 2.14 CAMINO REAL 2011 4 2/7/2011 2.56 2.29 1.68 1.78 2.07 FESTIVAL 2011 4 2/7/2011 2.28 2.47 1.81 1.81 1.95 WINTERSTAR 2011 5 2/14/2011 2.7 4 2.61 2.09 1.42 2.07 FESTIVAL 2011 5 2/14/2011 2.46 2.47 1.92 1.75 2.13 RADIANCE 2011 5 2/14/2011 2.66 2.70 1.92 1.65 2.12 PROPRIETARY 4 2011 5 2/14/2011 2.54 2.32 2.21 1.66 2.27 FL 05 85 2011 6 2/21/2011 2.13 2.15 1.75 1.08 1.74 ELYANA 2011 6 2/21/2011 2.42 2.36 1.93 1.26 2.04 FESTIVAL 2011 6 2/21/2011 2.44 2.29 1.85 1.30 1.95 RED MERLIN 2011 6 2/21/2011 2.21 2.06 1.46 1.86 1.81 SAN ANDREAS 2011 6 2/21/2011 2.17 2.31 1.80 1.84 1.83 ALBION 2011 7 2/28/2011 2.48 2.51 2.11 1.63 2.1 7 CHARLOTTE 2011 7 2/28/2011 2.80 2.56 1.71 1.11 1.61 FESTIVAL 2011 7 2/28/2011 2.34 2.24 1.63 1.66 1.75 MARA DES BOIS 2011 7 2/28/2011 2.89 2.80 2.07 1.22 2.05 MONTERREY 2011 7 2/28/2011 2.86 2.43 1.89 1.65 2.13 ALBION 2012 1 1/16/2012 2.61 2.62 2.22 1.60 2.27 FESTIVAL 2012 1 1/16/2012 2.40 2.37 2.31 1.67 2.34 MOJAVE 2012 1 1/16/2012 2.51 2.63 2.33 1.55 2.23 PROPRIETARY 3 2012 1 1/16/2012 2.46 2.62 2.17 1.41 2.12 CHANDLER 2012 4 2/6/2012 2.21 2.44 1.87 1.88 1.93 FESTIVAL 2012 4 2/6/2012 2.58 2.48 2.25 1.68 2.35 FL 09 127 2012 4 2/6/2012 2.71 2.48 2.08 1.48 2.32 TREASURE 2012 4 2/6/2012 2.40 2.31 2.29 1.67 2.27 WINTER DAWN 2012 4 2/6/2012 2.16 2.53 1.84 1.70 1.97 PROPRIETARY 5 2012 5 2/13/2012 2.17 2.30 2.16 1.51 2.0 7 ALBION 2012 5 2/13/2012 2.57 2.37 2.16 1.75 2.19 FESTIVAL 2012 5 2/13/2012 2.45 2.50 1.91 1.32 1.88 RUBYGEM 2012 5 2/13/2012 2.62 2.56 2.11 1.50 2.19 CAMINO REAL 2012 6 2/20/2012 2.22 2.41 2.05 1.48 2.10 DARSELECT 2012 6 2/20/2012 2.65 2.6 4 2.36 1.80 2.24 FESTIVAL 2012 6 2/20/2012 2.39 2.43 2.03 1.76 2.15 SWEET ANNE 2012 6 2/20/2012 2.52 2.47 2.32 1.98 2.34 BENICIA 2012 7 2/27/2012 2.28 2.31 2.01 1.72 1.90 FESTIVAL 2012 7 2/27/2012 2.29 2.37 2.05 1.51 1.95 FL 06 38 2012 7 2/2 7/2012 2.37 2.26 2.01 1.53 1.99 PORTOLA 2012 7 2/27/2012 2.55 2.30 1.99 1.74 2.14 VENTANA 2012 7 2/27/2012 2.32 2.42 1.67 1.77 1.88 PROPRIETARY 6 2012 9 3/12/2012 2.39 2.42 2.02 1.85 2.14 EVIE 2 2012 9 3/12/2012 2.13 2.45 1.95 1.75 1.82 FESTIV AL 2012 9 3/12/2012 2.42 2.50 2.06 1.45 2.08 GALLETA 2012 9 3/12/2012 2.48 2.33 1.86 1.84 1.97 SWEET ANNE 2012 9 3/12/2012 2.09 2.10 1.91 1.76 2.01

PAGE 71

71 Table 2 2 Continued. CULTIVAR HARVEST SSC pH TA % % PROPRIETARY 1 2011 2 0.03 0.01 0.02 CAMAROSA 2011 2 0.03 0.01 0.01 FESTIVAL 2011 2 0.04 0.00 0.02 MARA DES BOIS 2011 2 0.03 0.03 0.02 RADIANCE 2011 2 0.05 0.01 0.01 PROPRIETARY 2 2011 3 0.03 0.02 0.01 CAMAROSA 2011 3 0.05 0.00 0.01 SWEET CHARLIE 20 11 3 0.05 0.01 0.00 TREASURE 2011 3 0.03 0.00 0.01 WINTER DAWN 2011 3 0.03 0.00 0.01 PROPRIETARY 3 2011 4 0.03 0.00 0.01 CAMINO REAL 2011 4 0.03 0.01 0.00 FESTIVAL 2011 4 0.03 0.00 0.02 WINTERSTAR 2011 5 0.00 0.00 0.01 FESTIVAL 2011 5 0.03 0.00 0.00 RADIANCE 2011 5 0.04 0.01 0.00 PROPRIETARY 4 2011 5 0.04 0.01 0.01 FL 05 85 2011 6 0.00 0.00 0.00 ELYANA 2011 6 0.03 0.00 0.01 FESTIVAL 2011 6 0.03 0.00 0.00 RED MERLIN 2011 6 0.09 0.00 0.02 SAN ANDREAS 201 1 6 0.03 0.00 0.01 ALBION 2011 7 0.05 0.00 0.01 CHARLOTTE 2011 7 0.04 0.01 0.00 FESTIVAL 2011 7 0.06 0.00 0.00 MARA DES BOIS 2011 7 0.03 0.00 0.00 MONTERREY 2011 7 0.04 0.00 0.01 ALBION 2012 1 0.05 0.00 0.02 FESTIVAL 2012 1 0 .00 0.00 0.01 MOJAVE 2012 1 0.03 0.00 0.02 PROPRIETARY 3 2012 1 0.05 0.00 0.02 CHANDLER 2012 4 0.00 0.01 0.01 FESTIVAL 2012 4 0.00 0.00 0.01 FL 09 127 2012 4 0.03 0.01 0.01 TREASURE 2012 4 0.03 0.00 0.00 WINTER DAWN 2012 4 0.03 0.01 0.01 PROPRIETARY 5 2012 5 0.03 0.01 0.01 ALBION 2012 5 0.05 0.00 0.01 FESTIVAL 2012 5 0.09 0.01 0.03 RUBYGEM 2012 5 0.03 0.01 0.01 CAMINO REAL 2012 6 0.03 0.01 0.02 DARSELECT 2012 6 0.03 0.00 0.00 FESTIVAL 2012 6 0.00 0.01 0.02 SWEET ANNE 2012 6 BENICIA 2012 7 0.03 0.01 0.01 FESTIVAL 2012 7 0.00 0.01 0.01 FL 06 38 2012 7 0.03 0.01 0.01 PORTOLA 2012 7 0.05 0.01 0.00 VENTANA 2012 7 0.04 0.01 0.02 PROPRIETARY 6 2012 9 0.00 0.00 0.02 EVIE 2 201 2 9 0.03 0.01 0.00 FESTIVAL 2012 9 0.05 0.00 0.00 GALLETA 2012 9 0.03 0.00 0.01 SWEET ANNE 2012 9 0.00 0.00 0.00

PAGE 72

72 Table 2 2 Continued. CULTIVAR HARVEST MALIC ACID CITRIC ACID TOTAL SUGAR GLUCOSE FRUCTOSE SUCROSE mg 1 100gFW 1 mg 1 100gFW 1 mg 1 100gFW 1 mg 1 100gFW 1 mg 1 100gFW 1 mg 1 100gFW 1 6915 15 7 77 92 9 50 99 7 57 48 7 57 50 1 PROPRIETARY 1 2011 2 2.01 11.48 15.33 5.94 39.17 CAMAROSA 2011 2 2.01 9.84 14.87 19.40 18.14 FESTIVAL 2011 2 2.01 3.28 15.60 14.09 20 .36 MARA DES BOIS 2011 2 4.42 11.48 12.19 12.34 23.51 RADIANCE 2011 2 1.41 9.84 26.40 6.17 77.84 PROPRIETARY 2 2011 3 2.21 14.75 46.71 32.92 84.59 CAMAROSA 2011 3 1.01 32.79 20.31 24.69 52.04 SWEET CHARLIE 2011 3 0.20 1.64 39.28 12.61 1 5.57 TREASURE 2011 3 4.83 0.00 14.33 8.42 39.49 WINTER DAWN 2011 3 0.80 11.48 26.40 47.32 40.15 PROPRIETARY 3 2011 4 1.81 11.48 28.44 55.55 88.63 CAMINO REAL 2011 4 2.82 13.11 8.48 8.81 15.41 FESTIVAL 2011 4 0.40 16.39 16.90 16.02 17.58 WINTERSTAR 2011 5 3.42 0.00 16.36 26.99 24.61 FESTIVAL 2011 5 1.61 18.03 14.48 12.99 24.33 RADIANCE 2011 5 11.26 11.48 8.12 10.29 22.15 PROPRIETARY 4 2011 5 0.40 1.64 11.77 17.87 40.84 FL 05 85 2011 6 2.21 24.59 12.04 4.95 15.85 ELYAN A 2011 6 2.01 13.11 14.14 16.63 28.02 FESTIVAL 2011 6 4.42 6.56 5.42 9.89 16.25 RED MERLIN 2011 6 3.02 6.56 8.46 14.84 26.77 SAN ANDREAS 2011 6 1.81 3.28 2.71 23.44 47.36 ALBION 2011 7 5.23 8.20 8.46 12.19 26.10 CHARLOTTE 2011 7 4.62 4.92 21.02 6.29 11.14 FESTIVAL 2011 7 1.61 21.31 10.16 14.40 16.32 MARA DES BOIS 2011 7 0.40 37.70 21.84 6.40 14.74 MONTERREY 2011 7 9.05 4.92 16.25 10.29 5.76 ALBION 2012 1 0.60 6.56 16.25 2.06 42.72 FESTIVAL 2012 1 2.21 1.64 2.03 18. 52 28.68 MOJAVE 2012 1 1.01 6.56 7.95 22.69 24.65 PROPRIETARY 3 2012 1 1.41 1.64 14.22 14.40 39.84 CHANDLER 2012 4 1.61 4.92 26.40 10.29 11.44 FESTIVAL 2012 4 1.01 0.00 10.55 18.63 8.47 FL 09 127 2012 4 2.61 8.20 14.22 4.11 8.91 TREASU RE 2012 4 0.80 0.00 2.03 4.11 22.04 WINTER DAWN 2012 4 2.41 4.92 16.25 12.34 4.99 PROPRIETARY 5 2012 5 2.01 4.92 10.16 8.23 17.43 ALBION 2012 5 0.20 3.28 4.98 9.26 24.58 FESTIVAL 2012 5 0.40 16.39 16.25 20.57 18.47 RUBYGEM 2012 5 0.20 4.92 16.25 24.69 19.65 CAMINO REAL 2012 6 1.21 6.56 21.75 37.05 37.73 DARSELECT 2012 6 0.80 0.00 36.56 41.15 48.27 FESTIVAL 2012 6 0.80 13.11 21.65 23.55 41.73 SWEET ANNE 2012 6 1.41 18.03 2.03 6.17 37.10 BENICIA 2012 7 0.20 11.48 19. 20 39.30 50.27 FESTIVAL 2012 7 0.60 13.11 8.12 30.86 28.89 FL 06 38 2012 7 1.61 0.00 22.15 28.92 62.91 PORTOLA 2012 7 1.41 6.56 30.47 37.03 15.98 VENTANA 2012 7 0.60 8.20 4.06 10.29 14.34 PROPRIETARY 6 2012 9 1.61 4.92 14.22 14.40 35.01 EVIE 2 2012 9 0.00 4.92 13.78 31.31 44.14 FESTIVAL 2012 9 0.00 4.92 8.85 19.11 27.48 GALLETA 2012 9 1.61 6.56 10.87 18.51 17.54 SWEET ANNE 2012 9 3.42 8.20 10.16 6.17 10.39

PAGE 73

73 Table 2 2 Continued. CULTIVAR HARVEST TOTAL VOLATILES 75 8 5 4 616 25 1 1629 58 9 96 22 0 110 62 3 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 PROPRIETARY 1 2011 2 1.62 2.34 13.73 9.56 0.88 CAMAROSA 2011 2 1.47 3.28 26.53 1.93 1.17 FE STIVAL 2011 2 1.21 3.20 8.34 6.83 5.42 MARA DES BOIS 2011 2 2.00 3.75 36.97 1.74 0.08 RADIANCE 2011 2 1.58 0.88 27.43 4.42 0.97 PROPRIETARY 2 2011 3 1.01 1.67 2.22 2.27 0.19 CAMAROSA 2011 3 1.03 0.35 22.50 3.10 1.55 SWEET CHARLIE 2011 3 0.54 3.64 46.05 7.66 0.39 TREASURE 2011 3 3.08 1.01 20.20 5.10 0.06 WINTER DAWN 2011 3 1.29 0.52 3.00 2.11 0.62 PROPRIETARY 3 2011 4 3.12 3.46 11.53 10.37 0.24 CAMINO REAL 2011 4 3.05 0.30 2.21 0.25 0.11 FESTIVAL 2011 4 3.82 1.06 4. 86 1.37 2.93 WINTERSTAR 2011 5 0.40 0.95 3.59 2.78 0.48 FESTIVAL 2011 5 1.22 0.54 0.98 2.04 1.15 RADIANCE 2011 5 0.55 1.22 2.93 2.62 0.83 PROPRIETARY 4 2011 5 0.47 1.57 13.28 4.58 0.16 FL 05 85 2011 6 0.69 1.04 2.32 2.12 0.92 ELYANA 20 11 6 1.37 0.35 1.82 0.32 5.86 FESTIVAL 2011 6 0.92 1.50 4.05 1.57 3.07 RED MERLIN 2011 6 1.44 3.76 5.51 5.16 0.56 SAN ANDREAS 2011 6 0.70 1.17 4.75 1.13 1.10 ALBION 2011 7 0.24 0.84 1.51 1.29 0.04 CHARLOTTE 2011 7 1.13 2.82 0.93 1.78 0.14 FESTIVAL 2011 7 0.64 1.35 4.74 2.33 1.41 MARA DES BOIS 2011 7 1.00 0.72 0.91 0.61 0.64 MONTERREY 2011 7 1.71 1.64 6.49 3.07 0.22 ALBION 2012 1 0.19 2.13 16.94 5.22 0.17 FESTIVAL 2012 1 1.88 2.57 6.93 1.64 2.26 MOJAVE 2012 1 1. 00 1.32 0.53 0.38 0.70 PROPRIETARY 3 2012 1 3.25 2.04 19.56 4.96 0.25 CHANDLER 2012 4 0.00 0.00 1.92 4.43 0.00 FESTIVAL 2012 4 0.55 0.25 7.89 2.29 2.73 FL 09 127 2012 4 0.49 1.41 19.82 5.36 0.63 TREASURE 2012 4 2.51 0.30 4.07 1.39 0.13 WINTER DAWN 2012 4 2.58 0.35 0.09 1.82 0.77 PROPRIETARY 5 2012 5 0.52 0.66 12.41 0.51 0.03 ALBION 2012 5 0.21 1.69 19.45 5.14 0.34 FESTIVAL 2012 5 0.37 1.75 16.31 6.48 3.33 RUBYGEM 2012 5 0.51 0.08 3.28 1.37 0.49 CAMINO REAL 2012 6 1.16 0.48 7.89 3.69 0.14 DARSELECT 2012 6 1.21 1.89 12.39 6.51 2.01 FESTIVAL 2012 6 0.81 2.31 22.55 3.47 4.49 SWEET ANNE 2012 6 0.92 0.44 4.35 1.55 0.09 BENICIA 2012 7 1.45 0.66 5.16 1.75 0.06 FESTIVAL 2012 7 0.38 2.16 11.94 3.80 3.17 FL 06 38 2012 7 0.45 0.38 8.69 1.90 1.72 PORTOLA 2012 7 0.74 0.21 7.90 3.19 0.21 VENTANA 2012 7 0.71 0.41 3.55 0.33 0.82 PROPRIETARY 6 2012 9 1.15 0.38 5.07 1.48 0.03 EVIE 2 2012 9 1.50 0.63 0.82 0.93 0.26 FESTIVAL 2012 9 1.68 2.17 2 1.16 7.33 2.75 GALLETA 2012 9 1.43 0.22 5.87 0.84 0.11 SWEET ANNE 2012 9 1.16 1.63 16.82 5.50 0.29

PAGE 74

74 Table 2 2 Continued. CULTIVAR HARVEST 1534 08 3 105 37 3 109 60 4 623 42 7 591 78 6 108 10 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 h r 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 PROPRIETARY 1 2011 2 0.01 0.20 0.17 369.92 0.61 0.00 CAMAROSA 2011 2 0.14 0.63 0.55 386.20 1.45 0.00 FESTIVAL 2011 2 0.14 3.27 0.33 344.43 1.86 0.00 MARA DES BOIS 2011 2 0.01 0. 52 0.28 127.52 0.85 0.00 RADIANCE 2011 2 0.08 0.28 0.23 57.50 0.20 0.00 PROPRIETARY 2 2011 3 0.01 0.15 0.33 465.89 4.76 0.00 CAMAROSA 2011 3 0.35 0.53 0.28 190.03 0.52 0.00 SWEET CHARLIE 2011 3 0.10 0.36 0.18 194.00 1.62 0.00 TREASURE 2011 3 0.14 0.08 0.13 112.55 1.43 0.00 WINTER DAWN 2011 3 0.04 0.05 0.07 50.54 0.89 0.00 PROPRIETARY 3 2011 4 0.13 2.59 1.51 518.04 1.44 0.00 CAMINO REAL 2011 4 0.00 0.21 0.17 92.89 0.28 0.00 FESTIVAL 2011 4 0.02 2.13 0.08 187.66 0.15 0.00 WINTERSTA R 2011 5 0.00 1.19 0.59 201.14 0.67 0.00 FESTIVAL 2011 5 0.00 0.64 0.22 354.33 0.26 0.00 RADIANCE 2011 5 0.00 0.80 0.65 142.67 0.91 0.00 PROPRIETARY 4 2011 5 0.13 0.55 0.06 441.51 3.63 0.00 FL 05 85 2011 6 0.02 0.11 0.19 293.84 0.17 0.00 ELY ANA 2011 6 0.15 0.12 0.08 127.47 0.32 0.00 FESTIVAL 2011 6 0.06 1.84 0.25 501.85 0.63 0.00 RED MERLIN 2011 6 0.11 0.25 0.25 171.57 0.14 0.00 SAN ANDREAS 2011 6 0.02 0.53 0.26 255.08 0.21 0.00 ALBION 2011 7 0.13 0.16 0.22 206.13 0.20 0.00 CHA RLOTTE 2011 7 0.17 0.20 0.06 107.74 0.20 0.00 FESTIVAL 2011 7 0.08 2.00 0.35 231.55 0.14 0.00 MARA DES BOIS 2011 7 0.03 3.38 0.54 241.50 0.09 0.00 MONTERREY 2011 7 0.11 0.86 0.63 228.15 0.32 0.00 ALBION 2012 1 0.05 0.12 0.12 245.82 0.78 0.00 FESTIVAL 2012 1 0.02 0.24 0.13 84.45 1.45 0.00 MOJAVE 2012 1 0.01 0.28 0.17 86.81 0.51 1.55 PROPRIETARY 3 2012 1 0.04 0.67 0.37 177.15 2.70 0.00 CHANDLER 2012 4 0.00 1.96 1.33 237.43 3.07 0.00 FESTIVAL 2012 4 0.28 4.92 0.38 96.01 0.31 0.79 FL 09 127 2012 4 0.12 1.57 0.83 414.77 1.97 1.58 TREASURE 2012 4 0.06 0.70 0.34 145.97 0.48 0.31 WINTER DAWN 2012 4 0.01 0.35 0.49 92.18 0.09 1.27 PROPRIETARY 5 2012 5 0.07 0.60 0.20 62.03 0.12 0.00 ALBION 2012 5 0.02 1.22 1.29 401.75 2.72 1. 53 FESTIVAL 2012 5 0.01 1.72 0.56 360.35 0.45 1.56 RUBYGEM 2012 5 0.02 0.29 0.48 42.94 0.09 0.39 CAMINO REAL 2012 6 0.01 0.51 0.34 188.61 0.55 1.23 DARSELECT 2012 6 0.03 1.73 0.93 233.00 0.89 1.90 FESTIVAL 2012 6 0.04 0.63 0.65 371.71 1.38 1 .68 SWEET ANNE 2012 6 0.02 0.12 0.10 71.88 1.16 0.00 BENICIA 2012 7 0.01 0.16 0.16 8.43 1.15 0.00 FESTIVAL 2012 7 0.06 1.82 0.41 650.70 1.03 0.75 FL 06 38 2012 7 0.05 1.86 0.53 171.42 0.52 0.57 PORTOLA 2012 7 0.06 0.14 0.07 42.50 0.53 0.00 VENTANA 2012 7 0.02 0.13 0.22 49.17 0.55 0.00 PROPRIETARY 6 2012 9 0.01 0.92 0.23 329.22 0.43 0.29 EVIE 2 2012 9 0.01 0.15 0.30 30.99 0.15 0.00 FESTIVAL 2012 9 0.10 4.01 1.32 854.75 1.34 2.63 GALLETA 2012 9 0.04 0.07 0.15 34.27 0.69 0.55 SWE ET ANNE 2012 9 0.00 0.51 0.68 376.54 3.04 0.00

PAGE 75

75 Table 2 2 Continued. CULTIVAR HARVEST 1576 87 0 1576 86 9 623 43 8 71 41 0 1576 95 0 556 24 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 PROPRIETARY 1 2011 2 2.01 1.23 0.14 0.00 0.16 7.03 CAMAROSA 2011 2 2.81 4.32 0.67 0.00 1.53 9.01 FESTIVAL 2011 2 5.40 6.19 0.08 1.84 0.55 6.93 MARA DES BOIS 2011 2 1.51 2.29 0.17 0.42 0.39 0.77 RADIANCE 2011 2 2.15 1.12 0.13 0.00 0. 20 0.17 PROPRIETARY 2 2011 3 5.28 4.55 0.33 0.00 0.81 15.14 CAMAROSA 2011 3 4.66 4.76 0.09 0.14 1.53 3.01 SWEET CHARLIE 2011 3 6.23 8.03 0.28 0.00 0.00 11.34 TREASURE 2011 3 6.02 7.03 0.25 0.00 0.32 2.17 WINTER DAWN 2011 3 7.29 5.47 0.25 0.4 6 1.57 3.09 PROPRIETARY 3 2011 4 3.98 7.59 0.34 0.15 0.12 42.17 CAMINO REAL 2011 4 0.02 0.57 0.02 0.10 0.98 0.63 FESTIVAL 2011 4 0.87 0.29 0.03 0.08 0.63 1.93 WINTERSTAR 2011 5 3.21 1.92 0.21 0.00 0.00 16.54 FESTIVAL 2011 5 0.35 0.21 0.08 0. 00 0.14 1.77 RADIANCE 2011 5 5.68 2.17 1.02 0.37 0.09 1.54 PROPRIETARY 4 2011 5 3.62 5.03 0.14 0.11 0.20 5.89 FL 05 85 2011 6 0.32 1.18 0.08 0.00 0.00 1.32 ELYANA 2011 6 1.72 0.77 0.09 0.00 0.13 2.68 FESTIVAL 2011 6 1.33 1.65 0.03 0.00 0.32 5.05 RED MERLIN 2011 6 2.07 2.76 0.08 0.00 0.18 0.68 SAN ANDREAS 2011 6 1.01 1.53 0.04 0.00 0.14 1.40 ALBION 2011 7 0.33 0.59 0.29 0.18 0.00 5.04 CHARLOTTE 2011 7 0.55 0.86 0.03 0.33 0.00 10.14 FESTIVAL 2011 7 1.38 1.50 0.10 0.00 0.00 1.85 MARA DES BOIS 2011 7 0.20 0.38 0.55 0.00 0.00 2.01 MONTERREY 2011 7 0.97 1.34 0.55 0.23 0.00 4.18 ALBION 2012 1 2.48 2.36 0.42 0.27 0.00 5.28 FESTIVAL 2012 1 0.98 1.09 1.19 0.53 1.88 0.10 MOJAVE 2012 1 1.27 1.21 0.04 0.05 1.07 1.36 PROPRIETA RY 3 2012 1 5.40 7.18 0.35 0.27 0.50 13.18 CHANDLER 2012 4 1.80 3.86 0.79 0.61 0.00 8.28 FESTIVAL 2012 4 1.11 1.28 0.13 0.25 0.39 0.36 FL 09 127 2012 4 4.93 2.60 0.54 0.00 1.65 5.85 TREASURE 2012 4 1.64 0.66 0.02 0.00 0.51 3.25 WINTER DAWN 2 012 4 2.34 0.59 0.06 0.00 1.09 0.40 PROPRIETARY 5 2012 5 0.24 0.32 0.29 0.35 0.08 5.29 ALBION 2012 5 5.37 5.00 0.65 0.08 0.00 3.61 FESTIVAL 2012 5 3.87 3.66 0.16 0.15 0.47 1.50 RUBYGEM 2012 5 1.05 0.68 0.14 0.04 0.67 0.20 CAMINO REAL 2012 6 4.57 2.25 0.21 0.38 2.42 0.58 DARSELECT 2012 6 3.84 3.60 0.14 0.24 0.00 8.99 FESTIVAL 2012 6 5.58 4.97 0.22 0.13 1.71 1.90 SWEET ANNE 2012 6 0.84 1.53 0.12 0.51 0.19 1.60 BENICIA 2012 7 1.82 2.40 0.16 0.21 0.41 0.27 FESTIVAL 2012 7 3.19 2. 93 0.16 0.33 0.20 2.10 FL 06 38 2012 7 1.02 1.40 0.04 0.77 0.16 2.97 PORTOLA 2012 7 0.25 0.35 0.21 0.58 0.57 1.45 VENTANA 2012 7 0.59 1.34 0.18 0.64 0.74 3.49 PROPRIETARY 6 2012 9 0.45 0.44 0.41 0.21 0.27 5.50 EVIE 2 2012 9 0.09 0.51 0.14 0. 15 0.53 2.62 FESTIVAL 2012 9 4.73 5.05 0.41 0.59 1.64 7.97 GALLETA 2012 9 0.63 1.09 0.06 0.02 1.83 0.67 SWEET ANNE 2012 9 2.63 3.71 0.18 0.12 0.35 7.81

PAGE 76

76 Table 2 2 Continued. CULTIVAR HARVEST 589 38 8 105 54 4 66 25 1 123 86 4 624 24 8 29 674 47 3 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 PROPRIETARY 1 2011 2 0.07 2.11 102.64 1.56 0.57 0.14 CAMAROSA 2011 2 0.13 24.34 4164.45 15.62 0.38 0.33 FESTIVAL 2011 2 0.43 4 .95 494.68 10.18 1.38 0.66 MARA DES BOIS 2011 2 0.10 4.01 155.67 7.12 0.22 0.08 RADIANCE 2011 2 0.13 4.50 42.08 1.21 0.16 0.19 PROPRIETARY 2 2011 3 0.24 5.31 95.52 8.96 0.30 2.22 CAMAROSA 2011 3 0.20 7.94 36.10 2.28 0.07 0.29 SWEET CHARLIE 201 1 3 0.38 7.46 257.72 3.17 0.58 0.15 TREASURE 2011 3 0.11 1.69 264.44 6.98 0.02 0.10 WINTER DAWN 2011 3 0.16 1.58 178.57 3.42 0.58 0.68 PROPRIETARY 3 2011 4 0.40 6.47 433.70 7.00 0.60 0.25 CAMINO REAL 2011 4 0.19 1.60 32.97 0.55 0.06 0.32 FES TIVAL 2011 4 0.19 2.47 8436.52 2.03 0.73 0.28 WINTERSTAR 2011 5 0.31 3.29 202.10 4.51 0.69 0.26 FESTIVAL 2011 5 0.07 6.11 116.74 1.55 0.79 0.16 RADIANCE 2011 5 0.25 7.42 215.95 1.73 0.74 0.26 PROPRIETARY 4 2011 5 0.28 7.41 138.27 6.00 0.46 0. 48 FL 05 85 2011 6 0.25 3.78 125.54 1.86 0.39 0.24 ELYANA 2011 6 0.13 0.75 44.55 7.30 0.45 0.24 FESTIVAL 2011 6 0.07 1.79 393.73 3.09 2.05 0.24 RED MERLIN 2011 6 0.29 6.56 102.96 0.67 0.37 0.23 SAN ANDREAS 2011 6 0.10 1.30 261.61 7.71 0.38 0 .60 ALBION 2011 7 0.08 4.30 97.95 2.77 0.15 0.71 CHARLOTTE 2011 7 0.08 1.46 34.54 0.87 0.08 0.41 FESTIVAL 2011 7 0.11 3.65 131.35 0.64 0.83 0.07 MARA DES BOIS 2011 7 0.08 2.30 667.84 7.42 0.42 0.08 MONTERREY 2011 7 0.13 4.18 117.92 14.94 0.1 5 0.19 ALBION 2012 1 0.21 2.06 233.23 29.42 0.31 0.79 FESTIVAL 2012 1 0.01 1.21 70.34 1.16 0.25 0.43 MOJAVE 2012 1 0.29 4.06 104.11 9.42 0.33 0.29 PROPRIETARY 3 2012 1 0.40 6.42 197.10 1.56 0.69 0.51 CHANDLER 2012 4 0.00 1.36 164.21 13.70 1. 39 0.14 FESTIVAL 2012 4 0.12 1.43 105.20 1.79 0.28 0.38 FL 09 127 2012 4 0.22 2.67 394.51 18.08 0.83 0.07 TREASURE 2012 4 0.27 3.92 187.47 5.56 0.11 0.16 WINTER DAWN 2012 4 0.15 1.19 5375.04 0.41 0.11 0.22 PROPRIETARY 5 2012 5 0.17 1.84 102. 93 0.54 0.14 0.08 ALBION 2012 5 0.62 1.63 510.40 38.49 0.38 0.91 FESTIVAL 2012 5 0.57 2.82 326.20 8.22 1.40 1.90 RUBYGEM 2012 5 0.07 2.30 66.96 2.53 0.13 0.09 CAMINO REAL 2012 6 0.25 2.88 115.46 17.76 0.34 0.67 DARSELECT 2012 6 0.40 0.95 153 .22 9.16 0.76 0.20 FESTIVAL 2012 6 0.56 2.57 284.38 4.58 1.25 1.20 SWEET ANNE 2012 6 0.20 2.87 83.60 1.05 0.09 0.07 BENICIA 2012 7 0.07 2.22 41.00 0.49 0.19 0.26 FESTIVAL 2012 7 0.31 3.83 269.03 3.32 2.35 1.47 FL 06 38 2012 7 0.08 1.75 252.1 2 5.42 0.59 0.19 PORTOLA 2012 7 0.16 2.70 21.76 0.36 0.14 0.03 VENTANA 2012 7 0.36 2.62 46.33 0.59 0.15 0.20 PROPRIETARY 6 2012 9 0.09 0.90 166.64 1.86 0.69 0.66 EVIE 2 2012 9 0.31 2.33 56.49 2.30 0.16 0.08 FESTIVAL 2012 9 0.77 4.01 447.52 4 .44 4.73 1.99 GALLETA 2012 9 0.34 3.36 58.88 1.40 0.05 0.19 SWEET ANNE 2012 9 0.44 4.25 294.99 3.22 0.16 0.27

PAGE 77

77 Table 2 2 Continued. CULTIVAR HARVEST 96 04 8 638 11 9 116 53 0 7452 79 1 6728 26 3 928 95 0 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 PROPRIETARY 1 2011 2 0.50 4.29 0.79 6.21 101.07 20.79 CAMAROSA 2011 2 0.10 3.54 15.48 14.86 1170.41 10.15 FESTIVAL 2011 2 0.50 19.69 7.33 14.89 1283.53 6.74 MARA DES BOIS 2011 2 0.04 0.70 3.27 3.30 527.75 26.88 RADIANCE 2011 2 0.28 1.61 1.74 2.57 217.87 1.87 PROPRIETARY 2 2011 3 3.44 0.30 0.69 6.53 655.72 1.87 CAMAROSA 2011 3 0.40 2.07 4.33 9.22 1075.55 21.54 SWEET CHARLIE 2011 3 1.26 1.44 12.44 10.87 1256.85 0.46 TREASURE 2011 3 0.54 5.90 3.71 5.87 990.69 3.37 WINTER DAWN 2011 3 0.00 7.75 1.30 9.80 1159.98 15.51 PROPRIETARY 3 2011 4 0.26 8.22 4.96 8.80 1122.30 4.08 CAMINO REAL 2011 4 0.02 0.40 2.87 2.73 306.18 5.36 FESTIVAL 2011 4 0.19 3.58 1.2 0 11.45 623.92 2.02 WINTERSTAR 2011 5 0.34 3.87 10.36 19.03 660.94 12.69 FESTIVAL 2011 5 0.17 4.09 1.92 2.17 147.31 6.13 RADIANCE 2011 5 0.22 4.74 5.58 168.45 1190.44 3.31 PROPRIETARY 4 2011 5 0.81 5.90 3.71 5.42 602.04 8.15 FL 05 85 2011 6 0.14 6.53 7.30 9.37 148.67 17.38 ELYANA 2011 6 0.26 2.17 3.56 5.92 340.10 0.00 FESTIVAL 2011 6 0.19 21.38 1.76 8.06 834.90 3.17 RED MERLIN 2011 6 0.24 2.98 2.73 5.23 751.42 30.71 SAN ANDREAS 2011 6 0.09 19.09 4.20 4.37 632.27 9.91 ALBION 2011 7 0.00 6.16 0.13 5.41 228.27 1.38 CHARLOTTE 2011 7 0.00 0.71 0.12 7.99 234.64 4.75 FESTIVAL 2011 7 0.00 4.11 6.69 2.81 436.15 1.04 MARA DES BOIS 2011 7 0.00 2.37 1.97 7.26 497.38 4.60 MONTERREY 2011 7 0.21 10.81 2.53 3.99 450.88 1.02 ALBION 2012 1 0.00 16.93 0.00 3.69 650.04 11.54 FESTIVAL 2012 1 0.00 5.39 17.28 3.17 127.96 3.73 MOJAVE 2012 1 0.15 5.21 0.00 1.84 317.88 1.99 PROPRIETARY 3 2012 1 0.34 0.28 0.00 7.11 1179.97 3.78 CHANDLER 2012 4 4.63 1.95 0.00 2.05 313.98 20.83 FE STIVAL 2012 4 0.11 2.10 1.81 0.38 42.93 3.84 FL 09 127 2012 4 0.08 13.43 5.47 4.88 710.27 34.69 TREASURE 2012 4 0.27 11.15 2.21 0.73 95.16 5.66 WINTER DAWN 2012 4 0.13 0.88 6.59 1.52 135.60 3.73 PROPRIETARY 5 2012 5 0.05 0.40 0.08 1.12 349.91 10.61 ALBION 2012 5 0.22 16.96 0.86 3.83 689.14 4.11 FESTIVAL 2012 5 0.34 12.14 0.00 3.52 1076.46 13.33 RUBYGEM 2012 5 0.13 0.42 1.96 0.94 242.88 7.92 CAMINO REAL 2012 6 0.06 5.84 5.38 2.78 655.05 26.22 DARSELECT 2012 6 0.47 5.62 3.79 2.10 503.36 25.46 FESTIVAL 2012 6 0.38 7.79 10.60 4.25 1053.76 13.59 SWEET ANNE 2012 6 0.08 2.70 0.00 1.25 233.43 11.00 BENICIA 2012 7 0.43 0.28 0.00 1.37 267.55 6.88 FESTIVAL 2012 7 0.16 11.52 8.80 1.86 547.27 9.69 FL 06 38 2012 7 0.13 8.51 9.22 3.04 401.75 2.81 PORTOLA 2012 7 0.08 4.07 4.52 1.03 81.71 5.48 VENTANA 2012 7 0.09 3.21 5.37 1.88 441.57 5.31 PROPRIETARY 6 2012 9 0.09 4.22 0.44 1.39 248.46 4.86 EVIE 2 2012 9 0.07 0.24 0.05 1.34 264.88 4.06 FESTIVAL 2012 9 0.42 24.96 13.6 9 6.15 1257.51 11.57 GALLETA 2012 9 0.11 1.60 2.54 2.11 321.16 10.08 SWEET ANNE 2012 9 0.34 12.62 0.00 5.93 1215.64 10.31

PAGE 78

78 Table 2 2 Continued. CULTIVAR HARVEST 111 27 3 123 92 2 624 41 9 110 43 0 2432 51 1 105 66 8 ng 1 gFW 1 hr 1 ng 1 gF W 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 PROPRIETARY 1 2011 2 1.27 1.27 3.64 1.22 0.58 0.07 CAMAROSA 2011 2 2.13 2.77 5.73 1.31 0.39 0.57 FESTIVAL 2011 2 1.04 0.51 0.44 3.63 3.54 2.14 MARA DES BOIS 20 11 2 5.17 0.04 0.25 1.02 0.16 0.52 RADIANCE 2011 2 1.56 2.69 0.56 0.46 0.03 0.08 PROPRIETARY 2 2011 3 0.96 2.28 0.28 2.20 0.19 0.64 CAMAROSA 2011 3 2.18 0.65 0.88 1.98 0.26 1.73 SWEET CHARLIE 2011 3 1.97 1.09 0.62 12.81 0.00 0.30 TREASURE 20 11 3 1.48 0.59 0.53 2.91 0.00 0.39 WINTER DAWN 2011 3 1.97 0.67 0.58 0.98 0.35 0.82 PROPRIETARY 3 2011 4 0.66 17.25 12.27 1.64 1.00 0.54 CAMINO REAL 2011 4 0.92 0.85 0.96 0.84 0.00 0.13 FESTIVAL 2011 4 2.02 0.31 0.65 1.20 0.61 0.43 WINTERSTA R 2011 5 1.47 1.23 2.20 0.97 0.00 1.06 FESTIVAL 2011 5 1.51 1.01 1.34 0.69 0.19 0.35 RADIANCE 2011 5 6.31 1.31 1.98 1.36 0.15 0.63 PROPRIETARY 4 2011 5 3.64 0.40 0.22 0.73 0.00 0.11 FL 05 85 2011 6 1.90 0.52 0.00 0.70 0.11 0.27 ELYANA 2011 6 1.14 0.80 0.23 1.15 0.21 0.24 FESTIVAL 2011 6 0.85 2.18 0.00 5.05 0.00 1.09 RED MERLIN 2011 6 9.82 0.28 2.80 0.60 0.00 0.00 SAN ANDREAS 2011 6 1.38 1.22 2.88 1.68 0.26 1.23 ALBION 2011 7 6.29 0.90 1.09 0.44 0.22 0.09 CHARLOTTE 2011 7 7.38 1.32 0.63 0.00 0.34 0.00 FESTIVAL 2011 7 2.41 0.61 1.20 0.91 0.30 0.08 MARA DES BOIS 2011 7 7.62 1.18 0.85 0.58 0.30 0.79 MONTERREY 2011 7 3.02 1.00 6.17 0.57 0.19 0.37 ALBION 2012 1 7.90 0.24 0.38 1.43 0.06 0.25 FESTIVAL 2012 1 11.74 1.45 0.39 0.13 0.59 0.56 MOJAVE 2012 1 3.79 0.75 0.57 0.81 0.04 0.31 PROPRIETARY 3 2012 1 1.55 3.54 2.10 1.74 0.38 0.00 CHANDLER 2012 4 92.26 12.81 8.18 1.96 0.00 1.08 FESTIVAL 2012 4 3.00 2.17 0.93 2.58 0.80 0.42 FL 09 127 2012 4 24.55 5.13 5.15 12.01 1.01 2.96 TREASURE 2012 4 3.96 1.77 1.36 1.11 0.32 0.35 WINTER DAWN 2012 4 1.85 1.17 0.73 6.43 0.07 0.13 PROPRIETARY 5 2012 5 2.13 2.32 0.39 0.67 0.12 0.13 ALBION 2012 5 6.79 4.91 2.27 3.83 0.47 2.34 FESTIVAL 2012 5 2.69 4.71 4.58 3.2 7 2.19 2.24 RUBYGEM 2012 5 3.44 0.89 0.61 1.70 0.12 0.50 CAMINO REAL 2012 6 24.49 2.35 1.36 5.87 4.68 2.15 DARSELECT 2012 6 22.34 6.46 1.80 6.52 2.43 1.70 FESTIVAL 2012 6 0.92 0.27 1.51 2.58 2.82 0.63 SWEET ANNE 2012 6 18.39 1.96 2.62 0.42 0 .58 0.04 BENICIA 2012 7 12.14 0.25 1.05 1.29 0.18 0.25 FESTIVAL 2012 7 1.46 0.93 1.23 1.92 3.33 1.07 FL 06 38 2012 7 2.86 2.08 1.51 2.27 0.71 0.95 PORTOLA 2012 7 12.33 1.25 0.52 0.30 0.12 0.14 VENTANA 2012 7 11.94 1.46 0.31 1.28 0.24 0.19 P ROPRIETARY 6 2012 9 0.60 0.57 0.47 0.38 0.06 0.34 EVIE 2 2012 9 1.55 2.43 1.31 0.44 0.19 0.07 FESTIVAL 2012 9 5.30 2.59 3.53 4.07 4.60 2.31 GALLETA 2012 9 1.42 0.61 0.20 1.64 0.59 0.63 SWEET ANNE 2012 9 1.80 7.69 4.50 3.29 0.66 0.35

PAGE 79

79 Table 2 2 Continued. CULTIVAR HARVEST 539 82 2 111 71 7 628 63 7 1191 16 8 106 70 7 55514 48 2 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 PROPRIETARY 1 2011 2 0.00 0.17 0.29 0.92 42. 41 0.00 CAMAROSA 2011 2 0.25 2.08 0.94 1.34 17.92 0.00 FESTIVAL 2011 2 1.25 1.16 1.19 0.19 34.27 0.00 MARA DES BOIS 2011 2 0.81 0.43 0.11 0.15 15.09 0.00 RADIANCE 2011 2 1.05 0.14 0.23 0.50 5.10 0.00 PROPRIETARY 2 2011 3 0.00 1.25 0.56 0.00 14.61 0.03 CAMAROSA 2011 3 1.15 1.07 1.74 0.48 4.43 0.06 SWEET CHARLIE 2011 3 0.61 1.31 0.41 0.00 35.53 0.14 TREASURE 2011 3 1.61 1.01 0.24 0.04 0.94 0.05 WINTER DAWN 2011 3 1.27 1.83 0.88 0.00 17.28 0.02 PROPRIETARY 3 2011 4 1.15 0.43 1.83 4.17 68.13 0.13 CAMINO REAL 2011 4 0.00 0.46 0.64 0.53 12.81 0.15 FESTIVAL 2011 4 0.27 0.37 0.51 0.06 28.39 0.19 WINTERSTAR 2011 5 0.15 0.00 0.47 0.69 30.98 0.11 FESTIVAL 2011 5 0.10 0.33 0.34 0.24 25.65 0.05 RADIANCE 2011 5 0.00 0.40 1.02 1 .71 24.67 0.06 PROPRIETARY 4 2011 5 0.06 0.21 0.61 0.20 19.75 0.08 FL 05 85 2011 6 0.00 0.00 0.23 0.12 17.80 0.08 ELYANA 2011 6 0.08 0.60 0.51 0.08 5.78 0.05 FESTIVAL 2011 6 0.74 1.02 0.98 0.00 67.81 0.18 RED MERLIN 2011 6 0.00 0.32 0.76 1.0 8 19.41 0.17 SAN ANDREAS 2011 6 0.53 0.83 0.33 2.10 25.71 0.12 ALBION 2011 7 0.49 0.43 0.44 0.53 5.00 0.17 CHARLOTTE 2011 7 0.00 0.29 0.57 0.07 0.59 0.27 FESTIVAL 2011 7 0.13 0.30 0.56 0.16 10.37 0.39 MARA DES BOIS 2011 7 0.25 0.29 0.70 0.31 25.28 0.31 MONTERREY 2011 7 0.24 0.42 0.73 1.98 3.45 0.20 ALBION 2012 1 0.42 0.85 0.53 0.16 7.90 0.06 FESTIVAL 2012 1 0.12 0.13 0.56 0.16 8.95 0.02 MOJAVE 2012 1 0.28 0.13 0.24 0.40 9.64 0.01 PROPRIETARY 3 2012 1 0.00 0.45 0.50 0.31 45.03 0 .00 CHANDLER 2012 4 5.16 0.00 0.79 1.59 46.13 0.30 FESTIVAL 2012 4 2.81 0.49 0.52 0.24 8.49 0.12 FL 09 127 2012 4 3.29 1.71 1.04 1.12 90.60 0.17 TREASURE 2012 4 0.44 0.37 0.36 0.17 7.61 0.05 WINTER DAWN 2012 4 0.30 0.21 0.42 0.42 4.69 0.23 PROPRIETARY 5 2012 5 0.14 0.18 0.29 0.13 12.01 0.12 ALBION 2012 5 0.76 1.16 1.33 0.49 27.63 0.22 FESTIVAL 2012 5 1.30 1.63 1.67 0.16 59.03 0.27 RUBYGEM 2012 5 0.22 0.57 0.26 0.31 5.45 0.02 CAMINO REAL 2012 6 1.14 2.39 1.00 0.21 13.25 0.10 DA RSELECT 2012 6 0.86 1.35 0.87 0.35 89.16 0.20 FESTIVAL 2012 6 1.50 0.59 0.30 0.28 46.55 0.08 SWEET ANNE 2012 6 0.31 0.22 0.32 0.28 12.04 0.07 BENICIA 2012 7 0.34 0.24 0.46 0.03 1.34 0.30 FESTIVAL 2012 7 1.15 0.37 0.43 0.25 62.24 0.34 FL 06 3 8 2012 7 0.83 0.66 0.67 0.36 57.18 0.07 PORTOLA 2012 7 0.23 0.35 0.41 0.18 6.87 0.12 VENTANA 2012 7 0.15 0.28 0.31 0.40 7.87 0.08 PROPRIETARY 6 2012 9 0.19 0.19 0.37 0.13 52.33 0.05 EVIE 2 2012 9 0.26 0.09 0.12 0.10 6.25 0.08 FESTIVAL 2012 9 1.58 1.64 2.31 0.12 93.13 0.00 GALLETA 2012 9 0.40 0.68 0.60 0.08 5.32 0.05 SWEET ANNE 2012 9 0.29 1.01 0.41 0.46 25.83 0.00

PAGE 80

80 Table 2 2 Continued. CULTIVAR HARVEST 110 93 0 109 21 7 123 66 0 124 13 0 142 92 7 2497 18 9 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 PROPRIETARY 1 2011 2 0.17 0.74 1.19 0.95 4.35 5.48 CAMAROSA 2011 2 0.31 4.40 1.30 1.29 3.08 21.55 FESTIVAL 2011 2 1.37 24.63 24.02 1.97 8.74 2.72 MARA D ES BOIS 2011 2 0.14 5.26 7.20 1.50 3.58 3.20 RADIANCE 2011 2 0.49 1.13 0.71 0.76 0.39 0.44 PROPRIETARY 2 2011 3 0.76 21.67 2.65 1.05 6.61 0.53 CAMAROSA 2011 3 0.51 2.75 2.03 0.80 2.76 3.39 SWEET CHARLIE 2011 3 1.10 4.29 7.72 1.90 7.85 0.81 T REASURE 2011 3 0.21 8.11 1.07 0.48 3.01 0.19 WINTER DAWN 2011 3 0.73 1.03 2.80 0.89 4.25 3.21 PROPRIETARY 3 2011 4 0.13 0.56 20.18 0.85 3.45 3.36 CAMINO REAL 2011 4 0.12 1.86 3.46 0.69 1.87 0.83 FESTIVAL 2011 4 0.35 2.89 7.88 0.43 2.57 0.07 WINTERSTAR 2011 5 0.14 2.12 12.82 0.41 2.51 5.63 FESTIVAL 2011 5 0.12 1.39 4.07 0.21 0.64 0.63 RADIANCE 2011 5 0.70 0.90 3.48 0.54 2.08 4.23 PROPRIETARY 4 2011 5 0.41 11.14 8.86 0.68 1.48 2.39 FL 05 85 2011 6 0.09 0.60 1.69 0.76 2.50 5.99 EL YANA 2011 6 0.13 6.82 4.43 0.93 5.69 0.37 FESTIVAL 2011 6 0.09 8.17 19.54 1.28 4.70 2.08 RED MERLIN 2011 6 0.30 0.00 0.62 0.91 3.33 10.05 SAN ANDREAS 2011 6 0.49 3.85 13.44 0.78 3.38 4.37 ALBION 2011 7 0.33 1.17 1.07 0.58 1.02 1.09 CHARLOTTE 2011 7 0.12 0.43 0.67 0.43 3.27 8.36 FESTIVAL 2011 7 0.23 0.23 3.55 0.41 0.67 0.43 MARA DES BOIS 2011 7 0.02 4.75 23.84 0.76 3.37 5.57 MONTERREY 2011 7 0.09 2.99 1.94 1.13 9.03 13.18 ALBION 2012 1 0.23 56.32 3.85 0.44 10.32 0.58 FESTIVAL 20 12 1 0.04 2.42 8.01 0.30 2.01 0.45 MOJAVE 2012 1 0.15 6.48 3.31 0.14 8.90 1.30 PROPRIETARY 3 2012 1 0.40 0.00 5.48 0.82 1.65 1.07 CHANDLER 2012 4 1.63 4.17 70.50 0.18 13.83 2.34 FESTIVAL 2012 4 0.28 2.61 113.08 0.68 12.93 0.41 FL 09 127 2012 4 0.52 36.65 79.44 1.55 39.13 0.79 TREASURE 2012 4 0.05 4.73 164.53 0.28 6.77 0.32 WINTER DAWN 2012 4 0.18 0.64 229.81 1.24 28.93 0.54 PROPRIETARY 5 2012 5 0.21 0.00 50.68 0.82 6.18 3.46 ALBION 2012 5 0.60 15.13 50.49 1.54 14.86 11.44 FESTI VAL 2012 5 0.76 5.05 42.23 1.76 8.00 3.28 RUBYGEM 2012 5 0.11 0.48 15.27 0.27 2.23 0.73 CAMINO REAL 2012 6 0.24 13.36 14.54 0.95 4.10 2.90 DARSELECT 2012 6 0.65 4.65 18.09 2.66 31.01 11.08 FESTIVAL 2012 6 0.63 10.28 11.53 1.18 4.04 12.83 SWE ET ANNE 2012 6 0.53 0.59 45.78 1.15 7.09 23.22 BENICIA 2012 7 0.44 0.40 17.72 0.25 0.63 7.70 FESTIVAL 2012 7 0.32 8.38 17.22 0.99 4.03 2.91 FL 06 38 2012 7 0.38 9.69 91.73 1.03 9.45 1.67 PORTOLA 2012 7 0.09 0.36 35.31 0.26 2.68 0.76 VENTANA 2012 7 0.03 0.00 3.85 0.27 0.33 1.48 PROPRIETARY 6 2012 9 0.05 1.58 20.25 0.17 0.69 0.58 EVIE 2 2012 9 0.13 0.81 2.11 0.45 1.41 0.66 FESTIVAL 2012 9 0.67 7.79 26.84 1.75 4.03 0.85 GALLETA 2012 9 0.13 3.28 10.28 0.36 1.40 1.25 SWEET ANNE 2012 9 0.60 1.97 6.43 1.36 1.75 1.24

PAGE 81

81 Table 2 2 Continued. CULTIVAR HARVEST 60415 61 4 104 76 7 2311 46 8 109 19 3 2548 87 0 540 18 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 PR OPRIETARY 1 2011 2 0.02 0.44 0.00 0.08 0.19 0.18 CAMAROSA 2011 2 0.00 0.46 0.00 0.38 0.14 0.37 FESTIVAL 2011 2 0.45 2.54 0.54 0.62 0.75 0.81 MARA DES BOIS 2011 2 0.06 0.27 0.33 0.27 0.43 0.27 RADIANCE 2011 2 0.14 0.25 0.00 0.53 0.77 0.22 PR OPRIETARY 2 2011 3 0.26 0.81 0.83 3.10 0.91 1.72 CAMAROSA 2011 3 0.03 0.26 0.58 0.58 0.37 0.50 SWEET CHARLIE 2011 3 0.10 1.39 0.41 0.42 0.70 0.66 TREASURE 2011 3 0.04 0.28 0.00 0.49 0.72 0.37 WINTER DAWN 2011 3 0.20 1.01 0.00 0.39 0.60 0.31 PROPRIETARY 3 2011 4 0.30 1.23 1.27 0.69 0.69 0.09 CAMINO REAL 2011 4 0.00 0.00 0.73 0.00 0.12 0.33 FESTIVAL 2011 4 0.00 0.87 0.20 0.00 0.07 0.22 WINTERSTAR 2011 5 0.00 0.63 0.00 0.00 0.05 0.23 FESTIVAL 2011 5 0.00 0.22 0.00 0.00 0.04 0.16 R ADIANCE 2011 5 0.00 0.36 0.00 0.00 0.09 0.09 PROPRIETARY 4 2011 5 0.21 0.20 1.02 0.60 0.53 1.03 FL 05 85 2011 6 0.09 0.39 0.29 0.00 0.15 0.18 ELYANA 2011 6 0.03 2.22 0.66 0.91 0.04 0.54 FESTIVAL 2011 6 0.08 2.03 0.15 0.00 0.04 0.28 RED MERLI N 2011 6 0.12 1.60 0.00 0.00 0.07 0.21 SAN ANDREAS 2011 6 0.26 2.54 0.38 0.00 0.08 0.49 ALBION 2011 7 0.03 0.52 0.13 0.00 0.23 0.35 CHARLOTTE 2011 7 0.06 0.07 0.45 0.00 0.06 0.03 FESTIVAL 2011 7 0.05 0.00 0.00 0.00 0.12 0.22 MARA DES BOIS 20 11 7 0.00 0.27 0.00 0.00 0.06 0.29 MONTERREY 2011 7 0.08 0.33 0.21 0.33 0.11 0.04 ALBION 2012 1 0.55 0.61 1.07 1.02 0.26 0.98 FESTIVAL 2012 1 0.12 0.23 0.41 0.21 0.19 0.34 MOJAVE 2012 1 0.26 0.78 0.66 0.19 0.20 0.36 PROPRIETARY 3 2012 1 0. 19 0.59 0.48 0.23 0.56 0.26 CHANDLER 2012 4 0.00 0.77 1.40 0.60 0.00 1.07 FESTIVAL 2012 4 0.08 0.12 0.29 0.20 0.22 0.26 FL 09 127 2012 4 0.46 3.18 3.09 1.17 0.65 2.03 TREASURE 2012 4 0.21 0.37 0.37 0.13 0.27 0.45 WINTER DAWN 2012 4 0.13 0.24 0.09 0.32 0.25 0.23 PROPRIETARY 5 2012 5 0.24 0.22 0.21 0.12 0.22 0.37 ALBION 2012 5 0.56 1.07 1.22 1.39 0.47 0.71 FESTIVAL 2012 5 0.37 1.07 1.19 0.33 0.60 0.49 RUBYGEM 2012 5 0.09 0.14 0.14 0.19 0.16 0.32 CAMINO REAL 2012 6 0.06 0.40 0.68 0.51 0.44 0.80 DARSELECT 2012 6 0.12 1.78 1.75 0.92 0.40 1.16 FESTIVAL 2012 6 0.26 1.12 1.68 0.21 0.51 0.79 SWEET ANNE 2012 6 0.07 0.40 0.22 0.16 0.08 0.22 BENICIA 2012 7 0.06 0.14 0.32 0.17 0.22 0.06 FESTIVAL 2012 7 0.12 1.46 2.00 0.40 0.35 0.55 FL 06 38 2012 7 0.15 1.74 1.95 0.70 0.59 1.16 PORTOLA 2012 7 0.06 8.78 0.12 0.06 0.15 0.13 VENTANA 2012 7 0.03 0.21 0.04 0.21 0.13 0.20 PROPRIETARY 6 2012 9 0.07 0.43 0.89 0.31 0.43 0.46 EVIE 2 2012 9 0.02 0.26 0.21 0.22 0.02 0.17 FES TIVAL 2012 9 0.45 2.49 2.55 0.63 0.77 1.36 GALLETA 2012 9 0.07 0.31 0.42 0.41 0.22 0.48 SWEET ANNE 2012 9 0.15 0.97 1.23 0.55 0.57 0.88

PAGE 82

82 Table 2 2 Continued. CULTIVAR HARVEST 4077 47 8 20664 46 4 821 55 6 5989 33 3 78 70 6 124 19 6 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 PROPRIETARY 1 2011 2 1.24 1.10 0.30 0.43 5.05 1.58 CAMAROSA 2011 2 1.83 1.98 1.01 0.67 6.97 3.82 FESTIVAL 2011 2 3.87 6.71 1.24 1.45 13.84 7.9 2 MARA DES BOIS 2011 2 5.64 7.27 0.71 0.45 3.21 0.77 RADIANCE 2011 2 2.40 0.85 0.14 0.69 8.26 6.76 PROPRIETARY 2 2011 3 4.81 6.21 0.75 0.30 6.31 2.07 CAMAROSA 2011 3 2.61 2.91 0.77 0.32 7.51 0.50 SWEET CHARLIE 2011 3 5.78 6.26 2.52 1.68 32.8 0 10.51 TREASURE 2011 3 5.22 0.82 0.88 0.19 5.85 2.04 WINTER DAWN 2011 3 3.47 2.95 0.70 0.31 9.43 2.27 PROPRIETARY 3 2011 4 2.02 5.76 0.00 0.49 16.75 1.36 CAMINO REAL 2011 4 0.61 3.14 0.00 0.74 24.74 2.30 FESTIVAL 2011 4 1.21 1.70 0.00 0.30 0.78 0.65 WINTERSTAR 2011 5 0.41 0.38 0.00 0.04 3.14 0.53 FESTIVAL 2011 5 0.24 1.07 0.00 0.41 5.04 0.36 RADIANCE 2011 5 0.46 0.99 0.00 0.15 17.25 0.48 PROPRIETARY 4 2011 5 0.49 0.63 0.00 0.19 5.62 1.11 FL 05 85 2011 6 0.86 1.85 0.00 0.10 4.5 8 0.78 ELYANA 2011 6 1.89 1.81 0.51 0.27 10.60 1.81 FESTIVAL 2011 6 0.39 2.23 0.00 0.38 5.85 0.85 RED MERLIN 2011 6 0.79 1.03 0.00 0.32 4.69 0.49 SAN ANDREAS 2011 6 0.85 5.29 0.00 0.55 17.29 1.18 ALBION 2011 7 0.32 1.00 0.00 0.26 6.34 0.43 CHARLOTTE 2011 7 1.24 1.97 0.00 0.34 3.50 0.49 FESTIVAL 2011 7 0.61 1.74 0.00 0.17 4.46 0.40 MARA DES BOIS 2011 7 0.25 1.85 0.00 0.38 2.78 0.22 MONTERREY 2011 7 2.48 2.07 0.00 0.19 10.27 0.35 ALBION 2012 1 1.63 0.55 0.61 0.73 15.67 0.86 FEST IVAL 2012 1 0.23 0.50 0.45 0.24 0.57 0.51 MOJAVE 2012 1 0.66 0.69 0.57 0.10 1.90 0.35 PROPRIETARY 3 2012 1 1.94 2.68 0.72 1.79 40.69 2.95 CHANDLER 2012 4 0.00 1.74 0.00 0.65 5.11 1.43 FESTIVAL 2012 4 1.46 0.59 0.00 0.12 0.90 0.18 FL 09 127 2 012 4 1.04 6.62 24.14 0.99 11.98 1.33 TREASURE 2012 4 1.16 0.52 6.32 0.15 1.37 0.19 WINTER DAWN 2012 4 0.50 0.07 23.60 0.14 1.05 0.37 PROPRIETARY 5 2012 5 0.51 0.16 1.60 0.17 2.51 0.16 ALBION 2012 5 2.62 2.30 5.42 1.01 45.20 1.38 FESTIVAL 20 12 5 2.28 1.63 2.83 0.72 21.82 1.42 RUBYGEM 2012 5 0.32 0.21 1.05 0.11 2.04 0.45 CAMINO REAL 2012 6 0.75 3.80 2.32 1.08 21.67 1.10 DARSELECT 2012 6 4.00 10.28 0.14 0.89 23.49 1.10 FESTIVAL 2012 6 2.87 3.52 0.66 1.12 12.24 1.90 SWEET ANNE 201 2 6 0.36 0.97 3.81 0.18 13.29 2.99 BENICIA 2012 7 1.41 1.12 3.23 0.18 19.18 0.22 FESTIVAL 2012 7 1.33 2.18 1.77 0.37 8.86 0.80 FL 06 38 2012 7 4.67 3.17 1.59 0.31 18.49 0.88 PORTOLA 2012 7 0.16 0.40 1.64 0.22 1.59 0.13 VENTANA 2012 7 0.37 0.39 1.72 0.59 4.59 1.38 PROPRIETARY 6 2012 9 0.20 0.32 0.53 0.16 1.19 0.31 EVIE 2 2012 9 0.95 1.56 0.41 0.25 3.32 0.34 FESTIVAL 2012 9 1.68 4.44 0.00 0.55 10.58 1.64 GALLETA 2012 9 1.83 3.22 0.69 0.21 10.60 1.17 SWEET ANNE 2012 9 2.21 6.96 0.00 2.51 76.16 1.87

PAGE 83

83 Table 2 2 Continued. CULTIVAR HARVEST 103 09 3 140 11 4 2639 63 6 53398 83 7 106 32 1 112 14 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 PROPRIETARY 1 201 1 2 0.21 0.26 0.10 0.35 0.05 0.87 CAMAROSA 2011 2 0.58 1.11 0.55 0.80 0.02 3.18 FESTIVAL 2011 2 0.46 1.89 3.15 4.98 0.34 2.67 MARA DES BOIS 2011 2 0.28 0.68 0.22 1.05 0.01 1.03 RADIANCE 2011 2 0.10 0.07 0.65 0.22 0.07 0.45 PROPRIETARY 2 2011 3 0.80 2.80 1.98 0.73 0.09 1.53 CAMAROSA 2011 3 0.30 1.69 1.02 0.51 0.13 2.90 SWEET CHARLIE 2011 3 0.53 5.54 3.23 0.46 0.23 4.92 TREASURE 2011 3 0.05 1.51 2.99 0.70 0.09 0.86 WINTER DAWN 2011 3 0.49 2.21 0.32 0.27 0.05 0.49 PROPRIETARY 3 20 11 4 0.63 0.84 0.13 0.08 0.42 1.65 CAMINO REAL 2011 4 0.58 2.91 0.35 0.18 0.18 2.09 FESTIVAL 2011 4 0.33 0.30 1.10 0.14 0.09 1.09 WINTERSTAR 2011 5 0.31 0.95 0.53 0.34 0.12 1.43 FESTIVAL 2011 5 0.17 0.73 0.25 0.31 0.05 0.15 RADIANCE 2011 5 0.21 1.43 0.30 0.42 0.02 0.48 PROPRIETARY 4 2011 5 0.23 1.69 2.82 0.81 0.17 0.99 FL 05 85 2011 6 0.04 0.51 0.15 0.41 0.03 0.36 ELYANA 2011 6 0.19 3.56 0.00 0.22 0.29 16.97 FESTIVAL 2011 6 0.20 0.80 1.59 0.56 0.15 0.75 RED MERLIN 2011 6 0.24 1.21 0.12 0.15 0.02 0.21 SAN ANDREAS 2011 6 0.32 1.96 0.70 0.24 0.12 0.26 ALBION 2011 7 0.18 0.62 0.09 0.13 0.06 0.32 CHARLOTTE 2011 7 0.06 0.37 0.07 0.07 0.13 0.17 FESTIVAL 2011 7 0.03 0.90 0.15 0.07 0.14 0.03 MARA DES BOIS 2011 7 0.38 0.4 9 0.59 0.93 0.17 1.05 MONTERREY 2011 7 0.09 1.50 0.14 0.06 0.10 3.06 ALBION 2012 1 0.14 0.20 3.06 0.39 0.25 1.75 FESTIVAL 2012 1 0.12 0.25 0.34 0.44 0.24 0.58 MOJAVE 2012 1 0.08 0.54 2.39 0.47 0.20 4.85 PROPRIETARY 3 2012 1 0.16 1.62 0.12 0. 00 0.21 0.64 CHANDLER 2012 4 0.77 3.57 1.44 0.11 0.00 5.14 FESTIVAL 2012 4 0.39 0.24 0.94 0.31 0.00 4.32 FL 09 127 2012 4 0.59 1.24 4.69 0.63 8.31 11.26 TREASURE 2012 4 0.18 0.60 0.26 0.38 3.35 6.88 WINTER DAWN 2012 4 0.51 0.16 0.54 0.37 11. 86 9.93 PROPRIETARY 5 2012 5 0.35 0.44 0.06 0.10 0.00 1.79 ALBION 2012 5 1.16 2.12 1.12 0.35 2.43 5.30 FESTIVAL 2012 5 0.96 1.37 1.24 1.16 0.00 2.05 RUBYGEM 2012 5 0.31 0.22 0.14 0.14 0.00 0.79 CAMINO REAL 2012 6 0.16 2.50 1.84 1.43 1.69 1.6 3 DARSELECT 2012 6 0.80 5.08 4.18 1.42 0.98 15.49 FESTIVAL 2012 6 0.59 0.93 2.16 6.45 2.55 3.07 SWEET ANNE 2012 6 0.20 0.29 0.31 0.58 4.39 4.06 BENICIA 2012 7 0.37 2.30 0.12 0.18 1.18 1.71 FESTIVAL 2012 7 0.26 0.59 0.86 1.47 1.75 1.12 FL 06 38 2012 7 0.56 1.86 1.68 0.05 4.83 6.28 PORTOLA 2012 7 0.51 0.23 0.05 0.07 5.57 3.71 VENTANA 2012 7 0.45 1.79 0.04 0.14 1.55 2.47 PROPRIETARY 6 2012 9 0.39 0.32 0.49 0.23 0.34 0.33 EVIE 2 2012 9 0.13 0.36 0.19 0.04 0.34 0.99 FESTIVAL 2012 9 0.55 1.56 0.76 0.75 1.59 2.46 GALLETA 2012 9 0.76 0.60 0.37 0.43 1.70 2.61 SWEET ANNE 2012 9 3.42 4.24 2.02 0.61 1.70 3.25

PAGE 84

84 Table 2 2 Continued. CULTIVAR HARVEST 564 94 3 3913 81 3 134 20 3 110 39 4 110 38 3 29811 50 5 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 PROPRIETARY 1 2011 2 0.48 0.09 0.00 1.14 0.00 0.55 CAMAROSA 2011 2 0.80 0.34 0.00 3.75 0.00 1.15 FESTIVAL 2011 2 1.48 0.63 0.00 9.77 0.59 0.08 MARA DES BOIS 2011 2 0.77 0.07 0.00 1.43 0.11 0.14 RADIANCE 2011 2 1.15 0.39 0.00 0.73 0.00 0.03 PROPRIETARY 2 2011 3 1.68 0.85 0.00 5.71 0.00 0.61 CAMAROSA 2011 3 1.29 0.92 0.00 9.09 0.00 1.84 SWEET CHARLIE 2011 3 2.57 0.58 0.00 10.25 0.89 0.74 TREA SURE 2011 3 1.11 0.48 0.00 7.17 0.00 0.66 WINTER DAWN 2011 3 0.82 0.41 0.00 0.37 0.00 0.13 PROPRIETARY 3 2011 4 0.75 0.19 0.00 0.20 0.00 0.24 CAMINO REAL 2011 4 0.49 0.19 0.00 1.95 0.00 0.18 FESTIVAL 2011 4 0.93 0.11 0.00 2.25 0.49 0.21 WINT ERSTAR 2011 5 0.46 0.15 0.00 2.09 0.13 0.08 FESTIVAL 2011 5 0.38 0.06 0.00 0.51 0.16 0.06 RADIANCE 2011 5 0.12 0.09 0.00 0.10 0.03 0.12 PROPRIETARY 4 2011 5 1.90 0.45 0.00 5.75 0.09 0.04 FL 05 85 2011 6 0.40 0.11 0.00 0.08 0.42 0.12 ELYANA 2 011 6 0.68 0.28 0.00 72.84 0.72 1.09 FESTIVAL 2011 6 0.65 0.14 0.00 2.95 0.76 0.08 RED MERLIN 2011 6 0.66 0.10 0.00 0.11 0.00 0.13 SAN ANDREAS 2011 6 0.55 0.09 0.00 0.52 0.18 0.01 ALBION 2011 7 2.91 0.04 0.00 0.45 0.00 0.05 CHARLOTTE 2011 7 0.54 0.11 0.31 0.00 0.00 0.03 FESTIVAL 2011 7 0.22 0.11 0.00 0.22 0.18 0.10 MARA DES BOIS 2011 7 0.58 0.06 0.72 1.35 0.45 0.03 MONTERREY 2011 7 0.09 0.04 0.00 2.38 0.13 1.83 ALBION 2012 1 0.45 0.04 0.00 10.53 0.31 0.19 FESTIVAL 2012 1 0.16 0.26 0.00 3.26 0.10 0.13 MOJAVE 2012 1 0.15 0.21 0.00 17.01 0.31 0.74 PROPRIETARY 3 2012 1 0.33 0.21 0.00 0.64 0.00 0.14 CHANDLER 2012 4 0.94 0.00 0.00 7.29 0.00 1.79 FESTIVAL 2012 4 0.25 0.18 0.00 2.09 0.45 0.15 FL 09 127 2012 4 3.06 0.45 0.00 15.98 1.28 0.81 TREASURE 2012 4 0.99 0.16 0.00 0.47 0.29 0.07 WINTER DAWN 2012 4 0.40 0.08 0.00 0.74 0.75 0.00 PROPRIETARY 5 2012 5 0.72 0.10 0.00 0.26 0.00 0.00 ALBION 2012 5 0.99 0.12 0.00 3.71 0.40 0.40 FESTIVAL 2012 5 1.22 0.38 0.00 1.42 0.42 0.14 RUBYGEM 2012 5 0.61 0.13 0.00 0.86 0.47 0.12 CAMINO REAL 2012 6 1.31 0.08 0.00 5.59 0.14 0.13 DARSELECT 2012 6 0.84 0.52 0.00 14.71 0.38 2.63 FESTIVAL 2012 6 1.00 0.49 0.00 2.63 0.48 0.17 SWEET ANNE 2012 6 0.19 0.26 0.00 0.29 0.35 0.10 BENICIA 2012 7 1.52 0.25 0.00 0.34 0.10 0.00 FESTIVAL 2012 7 0.58 0.12 0.00 1.09 0.23 0.12 FL 06 38 2012 7 1.36 0.19 0.00 2.16 0.50 0.21 PORTOLA 2012 7 0.28 0.11 0.00 0.54 0.24 0.23 VENTANA 2012 7 0.16 0.14 0.00 0.06 0.00 0.00 PR OPRIETARY 6 2012 9 0.25 0.21 0.00 0.77 0.25 0.11 EVIE 2 2012 9 0.84 0.08 0.00 2.42 0.00 0.21 FESTIVAL 2012 9 2.40 0.40 0.00 2.23 0.84 0.34 GALLETA 2012 9 1.40 0.12 0.00 1.18 0.00 0.15 SWEET ANNE 2012 9 1.19 0.20 0.00 1.09 2.16 0.13

PAGE 85

85 Table 2 2 Continued. CULTIVAR HARVEST 7786 58 5 15111 96 3 706 14 9 10522 34 6 5881 17 4 128 37 0 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 PROPRIETARY 1 2011 2 0.46 0.09 0.04 0.05 1. 84 0.08 CAMAROSA 2011 2 1.09 0.16 0.34 0.10 1.44 0.13 FESTIVAL 2011 2 0.25 0.31 0.04 0.29 1.87 0.31 MARA DES BOIS 2011 2 0.40 0.20 0.08 0.13 0.88 0.12 RADIANCE 2011 2 0.05 0.11 2.08 0.23 0.42 0.20 PROPRIETARY 2 2011 3 4.44 0.02 0.00 0.38 2.3 3 0.32 CAMAROSA 2011 3 2.89 0.35 0.27 0.07 2.81 0.35 SWEET CHARLIE 2011 3 2.66 0.72 58.21 0.09 2.93 0.87 TREASURE 2011 3 1.58 0.17 0.57 0.43 2.93 0.04 WINTER DAWN 2011 3 0.13 0.22 0.28 0.01 1.29 0.11 PROPRIETARY 3 2011 4 0.52 0.12 0.42 0.06 0.55 0.08 CAMINO REAL 2011 4 0.15 0.26 1.49 0.14 0.94 0.21 FESTIVAL 2011 4 0.12 0.21 0.20 0.06 0.56 0.07 WINTERSTAR 2011 5 0.04 0.09 1.67 0.11 0.24 0.05 FESTIVAL 2011 5 0.00 0.11 0.63 0.07 0.56 0.06 RADIANCE 2011 5 0.00 0.10 3.89 0.04 0.52 0 .44 PROPRIETARY 4 2011 5 0.24 0.10 0.03 0.26 1.10 0.09 FL 05 85 2011 6 0.00 0.19 0.06 0.05 0.44 0.16 ELYANA 2011 6 11.17 0.41 7.71 0.90 1.02 0.14 FESTIVAL 2011 6 0.04 0.31 0.26 0.20 0.90 0.21 RED MERLIN 2011 6 0.00 0.13 1.14 0.00 0.32 0.00 SAN ANDREAS 2011 6 0.18 0.14 11.84 0.06 0.97 0.03 ALBION 2011 7 0.14 0.06 0.48 0.01 0.45 0.10 CHARLOTTE 2011 7 0.03 0.01 0.12 0.00 0.29 0.00 FESTIVAL 2011 7 0.07 0.30 0.00 0.02 0.28 0.08 MARA DES BOIS 2011 7 0.05 0.20 0.00 0.06 0.31 0.00 MON TERREY 2011 7 0.91 0.03 0.00 0.03 0.21 0.17 ALBION 2012 1 1.17 0.13 10.49 0.17 0.16 0.61 FESTIVAL 2012 1 0.20 0.04 0.40 0.02 0.09 0.89 MOJAVE 2012 1 4.30 0.01 3.13 0.11 0.56 0.00 PROPRIETARY 3 2012 1 0.28 0.03 0.20 0.00 0.43 2.01 CHANDLER 20 12 4 3.69 0.00 6.46 0.25 1.43 1.59 FESTIVAL 2012 4 0.10 0.05 0.17 0.07 0.15 0.65 FL 09 127 2012 4 5.04 0.09 16.87 0.33 1.13 1.47 TREASURE 2012 4 0.30 0.08 0.17 0.13 0.30 0.18 WINTER DAWN 2012 4 0.00 0.07 0.12 0.00 0.29 0.44 PROPRIETARY 5 201 2 5 0.09 0.05 0.23 0.00 0.04 0.45 ALBION 2012 5 1.60 0.06 18.44 0.06 0.95 1.89 FESTIVAL 2012 5 0.14 0.15 0.56 0.09 1.15 3.78 RUBYGEM 2012 5 0.17 0.06 0.76 0.14 0.05 0.30 CAMINO REAL 2012 6 0.46 0.05 7.53 0.19 0.63 2.05 DARSELECT 2012 6 24. 77 0.07 37.59 0.11 1.05 2.43 FESTIVAL 2012 6 0.24 0.09 0.17 0.27 0.88 1.84 SWEET ANNE 2012 6 0.14 0.05 2.15 0.08 0.20 0.70 BENICIA 2012 7 0.28 0.05 2.63 0.00 0.42 2.08 FESTIVAL 2012 7 0.11 0.04 0.19 0.08 0.60 1.88 FL 06 38 2012 7 0.82 0.07 1 2.91 0.14 0.46 2.36 PORTOLA 2012 7 0.13 0.05 0.11 0.00 0.25 1.13 VENTANA 2012 7 0.17 0.04 0.51 0.00 0.14 0.91 PROPRIETARY 6 2012 9 0.16 0.04 0.62 0.08 0.59 0.78 EVIE 2 2012 9 3.84 0.14 0.85 0.10 0.21 1.14 FESTIVAL 2012 9 0.25 0.33 0.45 0.23 1.24 3.38 GALLETA 2012 9 0.42 0.07 2.00 0.10 0.44 0.94 SWEET ANNE 2012 9 0.37 0.20 8.74 0.13 1.39 2.39

PAGE 86

86 Table 2 2 Continued. CULTIVAR HARVEST 40716 66 3 4887 30 3 5454 09 1 2305 05 7 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 ng 1 gFW 1 hr 1 PROPRIETARY 1 2011 2 13.53 0.55 0.40 0.53 CAMAROSA 2011 2 3.15 1.96 0.82 0.51 FESTIVAL 2011 2 10.95 2.51 0.98 1.18 MARA DES BOIS 2011 2 0.50 0.71 0.36 0.40 RADIANCE 2011 2 1.11 1.08 0.81 0.14 PROPRIETARY 2 2011 3 0.70 0 .31 0.20 0.65 CAMAROSA 2011 3 10.66 2.38 1.39 0.98 SWEET CHARLIE 2011 3 145.11 15.86 10.01 2.63 TREASURE 2011 3 3.66 1.50 0.24 2.66 WINTER DAWN 2011 3 31.29 0.00 0.00 1.48 PROPRIETARY 3 2011 4 4.80 0.14 0.00 1.77 CAMINO REAL 2011 4 3.16 0 .88 0.24 0.12 FESTIVAL 2011 4 3.19 1.11 0.06 0.16 WINTERSTAR 2011 5 4.98 0.62 0.11 0.28 FESTIVAL 2011 5 7.73 0.26 0.14 0.45 RADIANCE 2011 5 52.91 0.00 0.00 1.15 PROPRIETARY 4 2011 5 0.81 0.26 0.13 0.35 FL 05 85 2011 6 2.01 0.30 0.15 0.57 ELYANA 2011 6 3.53 32.68 4.93 0.56 FESTIVAL 2011 6 12.81 26.69 0.29 0.79 RED MERLIN 2011 6 0.00 0.00 0.00 0.02 SAN ANDREAS 2011 6 2.99 1.87 0.00 0.60 ALBION 2011 7 1.60 0.00 0.00 0.19 CHARLOTTE 2011 7 0.00 0.00 0.00 0.18 FESTIVAL 2011 7 2.23 0.25 0.00 0.14 MARA DES BOIS 2011 7 0.34 0.13 0.21 0.15 MONTERREY 2011 7 1.60 0.84 0.48 0.05 ALBION 2012 1 8.54 1.04 0.52 1.41 FESTIVAL 2012 1 19.39 0.75 0.50 1.68 MOJAVE 2012 1 0.34 5.17 0.86 1.15 PROPRIETARY 3 2012 1 6.30 0.00 0. 00 1.37 CHANDLER 2012 4 1.77 2.16 0.23 1.70 FESTIVAL 2012 4 3.46 0.47 0.02 0.22 FL 09 127 2012 4 19.31 4.64 1.14 0.58 TREASURE 2012 4 2.83 0.91 0.29 2.22 WINTER DAWN 2012 4 1.75 0.00 0.00 0.11 PROPRIETARY 5 2012 5 1.12 0.00 0.00 0.39 ALB ION 2012 5 34.32 1.23 0.20 2.14 FESTIVAL 2012 5 20.89 0.78 0.23 1.10 RUBYGEM 2012 5 2.79 0.19 0.29 0.28 CAMINO REAL 2012 6 4.89 2.42 0.89 0.38 DARSELECT 2012 6 14.62 15.57 0.73 1.49 FESTIVAL 2012 6 15.13 0.74 0.25 1.33 SWEET ANNE 2012 6 5.06 0.07 0.00 0.30 BENICIA 2012 7 7.92 0.23 0.00 0.34 FESTIVAL 2012 7 10.79 0.20 0.26 0.47 FL 06 38 2012 7 24.58 2.12 0.52 1.21 PORTOLA 2012 7 0.43 0.22 0.00 0.21 VENTANA 2012 7 0.92 0.00 0.00 0.11 PROPRIETARY 6 2012 9 0.61 0.01 0.05 0. 16 EVIE 2 2012 9 0.92 0.62 0.10 0.20 FESTIVAL 2012 9 14.75 1.10 0.28 1.09 GALLETA 2012 9 3.21 0.19 0.16 0.30 SWEET ANNE 2012 9 26.45 1.18 0.25 1.06

PAGE 87

87 Table 2 3. Fruit attribute bivariate fit to harvest week. X Y R 2 CORR COEFF p VALUE n MEAN X STD DEV X MEAN Y STD DEV Y WEEK 1629 58 9 0.489 0.699 0.000 54 5.0 2.2 117.9 65.9 WEEK 1576 87 0 0.485 0.697 0.000 54 5.0 2.2 37.5 20.1 WEEK SWEETNESS INTENSITY 0.471 0.686 0.000 54 5.0 2.2 23.0 4.8 WEEK SSC 0.444 0.666 0.000 54 5.0 2.2 7.4 1.4 WEEK STRAWBERRY FLAVOR INTENSITY 0.430 0.656 0.000 54 5.0 2.2 26.9 3.9 WEEK OVERALL LIKING 0.422 0.650 0.000 54 5.0 2.2 23.8 5.7 WEEK 1576 86 9 0.402 0.634 0.000 54 5.0 2.2 37.8 21.7 WEEK SUCROSE 0.350 0.592 0.000 54 5.0 2.2 1112.6 646.5 WEEK 6728 26 3 0.348 0.590 0.000 54 5.0 2.2 8666.5 3359.7 WEEK TOTAL VOLATILES 0.338 0.581 0.000 54 5.0 2.2 15814.0 5238.5 WEEK 5881 17 4 0.315 0.561 0.000 54 5.0 2.2 6.2 2.5 WEEK 105 54 4 0.294 0.542 0.000 54 5.0 2.2 42.0 17.1 WEEK TOTAL SUGAR 0.287 0.536 0.000 54 5.0 2.2 4473.9 1037.2 WEEK 124 19 6 0.264 0.513 0.000 54 5.0 2.2 8.5 7.5 WEEK 3913 81 3 0.252 0.502 0.000 54 5.0 2.2 1.9 1.4 WEEK 96 22 0 0.242 0.492 0.000 54 5.0 2.2 51.2 18.6 WEEK 2305 05 7 0.240 0.490 0.000 54 5.0 2.2 6.7 6.7 WEEK 110 93 0 0.179 0.423 0.001 54 5.0 2.2 2.7 1.5 WEEK 616 25 1 0.158 0.398 0.003 54 5.0 2.2 15.9 7.3 WEEK 75 85 4 0.148 0.385 0.004 54 5.0 2.2 3.9 2.2 WEEK 2639 63 6 0.141 0.375 0.005 54 5.0 2.2 10.8 13.0 WEEK 116 53 0 0.139 0.372 0.006 54 5.0 2.2 19.7 1 6.0 WEEK 142 92 7 0.137 0.370 0.006 54 5.0 2.2 53.5 49.7 WEEK 111 71 7 0.134 0.366 0.006 54 5.0 2.2 3.2 2.3 WEEK TEXTURE LIKING 0.132 0.364 0.007 54 5.0 2.2 23.8 5.7 WEEK L* int 0.127 0.357 0.008 54 5.0 2.2 54.9 5.8 WEEK 60415 61 4 0.118 0.343 0. 011 54 5.0 2.2 0.7 1.6 WEEK 5454 09 1 0.112 0.335 0.013 54 5.0 2.2 3.7 6.2 WEEK 66 25 1 0.106 0.325 0.017 54 5.0 2.2 2545.9 1722.0 WEEK 106 32 1 0.101 0.317 0.019 54 5.0 2.2 2.2 3.0 WEEK 7452 79 1 0.098 0.312 0.021 54 5.0 2.2 50.0 31.0 WEEK 109 21 7 0.097 0.311 0.022 54 5.0 2.2 72.1 157.2 WEEK 4077 47 8 0.089 0.298 0.028 54 5.0 2.2 11.7 8.3 WEEK 123 86 4 0.087 0.296 0.030 54 5.0 2.2 73.5 85.0 WEEK 1534 08 3 0.082 0.286 0.036 54 5.0 2.2 0.4 0.2 WEEK 638 11 9 0.078 0.280 0.041 54 5.0 2.2 72.7 67.2 WEEK 628 63 7 0.071 0.266 0.052 54 5.0 2.2 4.6 1.7 WEEK A* ext 0.070 0.265 0.053 54 5.0 2.2 36.4 3.1 WEEK 40716 66 3 0.069 0.262 0.055 54 5.0 2.2 84.3 107.5 WEEK GLUCOSE 0.064 0.254 0.064 54 5.0 2.2 1594.6 378.2 WEEK 110 43 0 0.060 0.244 0. 075 54 5.0 2.2 14.8 19.6 WEEK 53398 83 7 0.050 0.223 0.105 54 5.0 2.2 5.0 4.6 WEEK 110 39 4 0.049 0.222 0.107 54 5.0 2.2 40.8 70.0 WEEK 109 60 4 0.044 0.210 0.128 54 5.0 2.2 3.8 2.7 WEEK 564 94 3 0.043 0.208 0.132 54 5.0 2.2 6.5 7.4 WEEK 591 78 6 0 .043 0.207 0.134 54 5.0 2.2 10.3 13.9 WEEK FRUCTOSE 0.041 0.203 0.141 54 5.0 2.2 1766.7 381.5 WEEK TA 0.041 0.201 0.144 54 5.0 2.2 0.8 0.1 WEEK 706 14 9 0.040 0.200 0.146 54 5.0 2.2 44.5 81.1 WEEK 5989 33 3 0.040 0.199 0.149 54 5.0 2.2 2.8 2.4 WE EK 104 76 7 0.038 0.195 0.158 54 5.0 2.2 6.0 4.9 WEEK 2548 87 0 0.036 0.191 0.167 54 5.0 2.2 2.4 1.5 WEEK 15111 96 3 0.030 0.173 0.212 54 5.0 2.2 1.2 1.2 WEEK 109 19 3 0.029 0.171 0.217 54 5.0 2.2 2.7 3.8 WEEK pH 0.029 0.169 0.221 54 5.0 2.2 3.7 0 .2 WEEK 108 10 1 0.028 0.167 0.228 54 5.0 2.2 1.5 2.6 WEEK 10522 34 6 0.025 0.159 0.252 54 5.0 2.2 1.1 1.1 WEEK L* ext 0.025 0.158 0.255 54 5.0 2.2 33.6 2.6 WEEK A* int 0.024 0.156 0.261 54 5.0 2.2 28.8 7.6 WEEK 134 20 3 0.024 0.156 0.261 54 5.0 2.2 0.1 0.7 WEEK 123 66 0 0.021 0.146 0.292 54 5.0 2.2 108.2 128.0 WEEK 623 42 7 0.019 0.139 0.316 54 5.0 2.2 2780.2 1376.8 WEEK FORCE 0.019 0.139 0.316 54 5.0 2.2 0.6 0.2 WEEK 4887 30 3 0.019 0.138 0.319 54 5.0 2.2 16.9 32.5 WEEK 123 92 2 0.018 0.132 0.340 54 5.0 2.2 23.0 21.5 WEEK 96 04 8 0.016 0.127 0.359 54 5.0 2.2 3.1 8.0 WEEK 821 55 6 0.015 0.123 0.374 54 5.0 2.2 3.5 8.2 WEEK 539 82 2 0.012 0.111 0.425 54 5.0 2.2 3.3 3.9 WEEK 540 18 1 0.012 0.108 0.435 54 5.0 2.2 3.5 3.2 WEEK 128 37 0 0. 010 0.099 0.475 54 5.0 2.2 4.1 3.7 WEEK 55514 48 2 0.009 0.097 0.485 54 5.0 2.2 0.5 0.5 WEEK 124 13 0 0.009 0.096 0.491 54 5.0 2.2 5.9 3.0 WEEK 112 14 1 0.009 0.095 0.495 54 5.0 2.2 18.3 24.0 WEEK CITRIC ACID 0.009 0.094 0.499 54 5.0 2.2 741.0 147.2 WEEK SOURNESS INTENSITY 0.009 0.093 0.505 54 5.0 2.2 18.1 3.1 WEEK 623 43 8 0.008 0.090 0.518 54 5.0 2.2 3.4 3.4 WEEK 105 66 8 0.008 0.088 0.528 54 5.0 2.2 5.0 3.7 WEEK B* int 0.007 0.084 0.544 54 5.0 2.2 25.8 4.5 WEEK 110 62 3 0.005 0.074 0.597 54 5.0 2.2 7.9 8.9 WEEK 1576 95 0 0.005 0.072 0.604 54 5.0 2.2 2.1 2.0 WEEK B* ext 0.005 0.070 0.613 54 5.0 2.2 19.0 3.3 WEEK 2311 46 8 0.004 0.066 0.637 54 5.0 2.2 3.9 4.4 WEEK MALIC ACID 0.004 0.065 0.641 54 5.0 2.2 212.4 51.6 WEEK 29811 50 5 0.00 4 0.064 0.643 54 5.0 2.2 3.2 5.3 WEEK 103 09 3 0.003 0.057 0.680 54 5.0 2.2 3.0 1.1 WEEK 140 11 4 0.003 0.054 0.700 54 5.0 2.2 11.1 8.6 WEEK 2432 51 1 0.002 0.048 0.729 54 5.0 2.2 4.4 5.8 WEEK 556 24 1 0.002 0.044 0.752 54 5.0 2.2 46.6 57.0

PAGE 88

88 Table 2 3 Continued. X Y R 2 CORR COEFF p VALUE n MEAN X STD DEV X MEAN Y STD DEV Y WEEK 78 70 6 0.001 0.038 0.787 54 5.0 2.2 128.8 113.0 WEEK 589 38 8 0.001 0.036 0.798 54 5.0 2.2 1.9 1.2 WEEK 2497 18 9 0.001 0.033 0.815 54 5.0 2.2 24.9 21.5 WEEK 1191 16 8 0.001 0.029 0.837 54 5.0 2.2 5.5 7.0 WEEK 928 95 0 0.001 0.028 0.838 54 5.0 2.2 66.8 61.7 WEEK 106 70 7 0.001 0.027 0.845 54 5.0 2.2 252.7 164.0 WEEK 71 41 0 0.001 0.026 0.854 54 5.0 2.2 1.0 1.3 WEEK 20664 46 4 0.000 0.020 0.887 54 5.0 2.2 20.6 19. 0 WEEK 7786 58 5 0.000 0.019 0.890 54 5.0 2.2 12.2 28.4 WEEK 29674 47 3 0.000 0.019 0.892 54 5.0 2.2 5.0 5.0 WEEK 110 38 3 0.000 0.019 0.893 54 5.0 2.2 2.0 2.6 WEEK 105 37 3 0.000 0.017 0.903 54 5.0 2.2 10.1 14.1 WEEK 624 41 9 0.000 0.010 0.945 54 5.0 2.2 18.9 18.1 WEEK 624 24 8 0.000 0.007 0.960 54 5.0 2.2 5.6 3.7 WEEK 111 27 3 0.000 0.004 0.976 54 5.0 2.2 45.5 94.6 Note: Regression of harvest week during season (X) on panel responses and metabolite concentration (Y). Coefficient of determinat ion (R 2 ), correlation coefficient, p value, sample size (n), mean and standard deviation of X and Y derived from bivariate fit in JMP 8.

PAGE 89

89 Table 2 4. Fruit attribute bivariate fir to consumer measure. X Y R 2 CORR COEFF p VALUE n MEAN X STD DEV X MEAN Y ST D DEV Y TOTAL SUGAR OVERALL LIKING 0.489 0.699 0.000 54 4473.9 1037.2 23.8 5.7 SSC OVERALL LIKING 0.457 0.676 0.000 54 7.4 1.4 23.8 5.7 SUCROSE OVERALL LIKING 0.442 0.665 0.000 54 1112.6 646.5 23.8 5.7 1629 58 9 OVERALL LIKING 0.437 0.661 0.000 54 117. 9 65.9 23.8 5.7 1576 87 0 OVERALL LIKING 0.371 0.609 0.000 54 37.5 20.1 23.8 5.7 2305 05 7 OVERALL LIKING 0.310 0.557 0.000 54 6.7 6.7 23.8 5.7 1576 86 9 OVERALL LIKING 0.301 0.549 0.000 54 37.8 21.7 23.8 5.7 111 71 7 OVERALL LIKING 0.288 0.537 0.000 5 4 3.2 2.3 23.8 5.7 540 18 1 OVERALL LIKING 0.244 0.494 0.000 54 3.5 3.2 23.8 5.7 3913 81 3 OVERALL LIKING 0.241 0.491 0.000 54 1.9 1.4 23.8 5.7 110 93 0 OVERALL LIKING 0.228 0.477 0.000 54 2.7 1.5 23.8 5.7 2639 63 6 OVERALL LIKING 0.200 0.447 0.001 54 10.8 13.0 23.8 5.7 124 19 6 OVERALL LIKING 0.196 0.443 0.001 54 8.5 7.5 23.8 5.7 2548 87 0 OVERALL LIKING 0.191 0.437 0.001 54 2.4 1.5 23.8 5.7 4077 47 8 OVERALL LIKING 0.189 0.434 0.001 54 11.7 8.3 23.8 5.7 104 76 7 OVERALL LIKING 0.187 0.432 0.001 54 6.0 4.9 23.8 5.7 TOTAL VOLATILES OVERALL LIKING 0.179 0.424 0.001 54 15814.0 5238.5 23.8 5.7 638 11 9 OVERALL LIKING 0.179 0.423 0.001 54 72.7 67.2 23.8 5.7 60415 61 4 OVERALL LIKING 0.177 0.421 0.002 54 0.7 1.6 23.8 5.7 GLUCOSE OVERALL LIKING 0.175 0 .419 0.002 54 1594.6 378.2 23.8 5.7 5989 33 3 OVERALL LIKING 0.168 0.410 0.002 54 2.8 2.4 23.8 5.7 40716 66 3 OVERALL LIKING 0.164 0.405 0.002 54 84.3 107.5 23.8 5.7 5881 17 4 OVERALL LIKING 0.157 0.397 0.003 54 6.2 2.5 23.8 5.7 109 19 3 OVERALL LIKING 0.154 0.392 0.003 54 2.7 3.8 23.8 5.7 L* int OVERALL LIKING 0.147 0.384 0.004 54 54.9 5.8 23.8 5.7 109 21 7 OVERALL LIKING 0.143 0.378 0.005 54 72.1 157.2 23.8 5.7 142 92 7 OVERALL LIKING 0.138 0.371 0.006 54 53.5 49.7 23.8 5.7 110 43 0 OVERALL LIKING 0.137 0.370 0.006 54 14.8 19.6 23.8 5.7 FRUCTOSE OVERALL LIKING 0.129 0.359 0.008 54 1766.7 381.5 23.8 5.7 5454 09 1 OVERALL LIKING 0.125 0.353 0.009 54 3.7 6.2 23.8 5.7 706 14 9 OVERALL LIKING 0.122 0.349 0.010 54 44.5 81.1 23.8 5.7 591 78 6 OVERALL LIKING 0.118 0.343 0.011 54 10.3 13.9 23.8 5.7 123 86 4 OVERALL LIKING 0.108 0.329 0.015 54 73.5 85.0 23.8 5.7 6728 26 3 OVERALL LIKING 0.108 0.329 0.015 54 8666.5 3359.7 23.8 5.7 53398 83 7 OVERALL LIKING 0.106 0.325 0.016 54 5.0 4.6 23.8 5.7 A* int O VERALL LIKING 0.105 0.324 0.017 54 28.8 7.6 23.8 5.7 TA OVERALL LIKING 0.099 0.314 0.021 54 0.8 0.1 23.8 5.7 110 38 3 OVERALL LIKING 0.094 0.307 0.024 54 2.0 2.6 23.8 5.7 105 66 8 OVERALL LIKING 0.094 0.306 0.024 54 5.0 3.7 23.8 5.7 105 54 4 OVERALL L IKING 0.088 0.297 0.029 54 42.0 17.1 23.8 5.7 616 25 1 OVERALL LIKING 0.082 0.286 0.036 54 15.9 7.3 23.8 5.7 96 22 0 OVERALL LIKING 0.079 0.280 0.040 54 51.2 18.6 23.8 5.7 134 20 3 OVERALL LIKING 0.076 0.276 0.043 54 0.1 0.7 23.8 5.7 10522 34 6 OVERAL L LIKING 0.076 0.276 0.044 54 1.1 1.1 23.8 5.7 623 42 7 OVERALL LIKING 0.075 0.275 0.045 54 2780.2 1376.8 23.8 5.7 1191 16 8 OVERALL LIKING 0.072 0.268 0.050 54 5.5 7.0 23.8 5.7 110 39 4 OVERALL LIKING 0.067 0.258 0.059 54 40.8 70.0 23.8 5.7 55514 48 2 OVERALL LIKING 0.065 0.254 0.064 54 0.5 0.5 23.8 5.7 2311 46 8 OVERALL LIKING 0.061 0.247 0.072 54 3.9 4.4 23.8 5.7 B* int OVERALL LIKING 0.059 0.242 0.078 54 25.8 4.5 23.8 5.7 116 53 0 OVERALL LIKING 0.058 0.240 0.080 54 19.7 16.0 23.8 5.7 CITRIC ACID OVERALL LIKING 0.056 0.237 0.084 54 741.0 147.2 23.8 5.7 pH OVERALL LIKING 0.053 0.231 0.094 54 3.7 0.2 23.8 5.7 29674 47 3 OVERALL LIKING 0.051 0.226 0.100 54 5.0 5.0 23.8 5.7 4887 30 3 OVERALL LIKING 0.051 0.226 0.101 54 16.9 32.5 23.8 5.7 564 9 4 3 OVERALL LIKING 0.047 0.218 0.114 54 6.5 7.4 23.8 5.7 623 43 8 OVERALL LIKING 0.041 0.203 0.142 54 3.4 3.4 23.8 5.7 539 82 2 OVERALL LIKING 0.039 0.196 0.155 54 3.3 3.9 23.8 5.7 66 25 1 OVERALL LIKING 0.035 0.187 0.175 54 2545.9 1722.0 23.8 5.7 628 63 7 OVERALL LIKING 0.035 0.187 0.177 54 4.6 1.7 23.8 5.7 FORCE OVERALL LIKING 0.034 0.185 0.181 54 0.6 0.2 23.8 5.7 7786 58 5 OVERALL LIKING 0.033 0.182 0.188 54 12.2 28.4 23.8 5.7 A* ext OVERALL LIKING 0.033 0.182 0.189 54 36.4 3.1 23.8 5.7 71 41 0 OVERALL LIKING 0.029 0.172 0.215 54 1.0 1.3 23.8 5.7 624 41 9 OVERALL LIKING 0.028 0.168 0.225 54 18.9 18.1 23.8 5.7 109 60 4 OVERALL LIKING 0.027 0.166 0.231 54 3.8 2.7 23.8 5.7 MALIC ACID OVERALL LIKING 0.027 0.165 0.234 54 212.4 51.6 23.8 5.7 111 27 3 OVERALL LIKING 0.027 0.164 0.236 54 45.5 94.6 23.8 5.7 124 13 0 OVERALL LIKING 0.024 0.154 0.267 54 5.9 3.0 23.8 5.7 78 70 6 OVERALL LIKING 0.023 0.153 0.270 54 128.8 113.0 23.8 5.7 821 55 6 OVERALL LIKING 0.022 0.148 0.286 54 3.5 8.2 23.8 5.7 62 4 24 8 OVERALL LIKING 0.022 0.147 0.289 54 5.6 3.7 23.8 5.7 7452 79 1 OVERALL LIKING 0.022 0.147 0.289 54 50.0 31.0 23.8 5.7 106 70 7 OVERALL LIKING 0.021 0.145 0.296 54 252.7 164.0 23.8 5.7 112 14 1 OVERALL LIKING 0.021 0.144 0.298 54 18.3 24.0 23.8 5. 7 1534 08 3 OVERALL LIKING 0.018 0.135 0.332 54 0.4 0.2 23.8 5.7 20664 46 4 OVERALL LIKING 0.018 0.133 0.339 54 20.6 19.0 23.8 5.7 589 38 8 OVERALL LIKING 0.018 0.133 0.340 54 1.9 1.2 23.8 5.7 123 66 0 OVERALL LIKING 0.017 0.132 0.341 54 108.2 128.0 23 .8 5.7 2432 51 1 OVERALL LIKING 0.016 0.127 0.360 54 4.4 5.8 23.8 5.7 75 85 4 OVERALL LIKING 0.014 0.119 0.390 54 3.9 2.2 23.8 5.7 928 95 0 OVERALL LIKING 0.012 0.111 0.422 54 66.8 61.7 23.8 5.7 140 11 4 OVERALL LIKING 0.012 0.111 0.423 54 11.1 8.6 2 3.8 5.7 103 09 3 OVERALL LIKING 0.011 0.106 0.446 54 3.0 1.1 23.8 5.7 123 92 2 OVERALL LIKING 0.010 0.099 0.475 54 23.0 21.5 23.8 5.7 B* ext OVERALL LIKING 0.009 0.095 0.492 54 19.0 3.3 23.8 5.7 128 37 0 OVERALL LIKING 0.007 0.086 0.536 54 4.1 3.7 2 3.8 5.7 2497 18 9 OVERALL LIKING 0.006 0.075 0.590 54 24.9 21.5 23.8 5.7

PAGE 90

90 Table 2 4. Continued. X Y R 2 CORR COEFF p VALUE n MEAN X STD DEV X MEAN Y STD DEV Y 556 24 1 OVERALL LIKING 0.004 0.065 0.638 54 46.6 57.0 23.8 5.7 29811 50 5 OVERALL LIKING 0. 004 0.062 0.658 54 3.2 5.3 23.8 5.7 110 62 3 OVERALL LIKING 0.003 0.057 0.680 54 7.9 8.9 23.8 5.7 96 04 8 OVERALL LIKING 0.003 0.052 0.711 54 3.1 8.0 23.8 5.7 1576 95 0 OVERALL LIKING 0.002 0.040 0.773 54 2.1 2.0 23.8 5.7 106 32 1 OVERALL LIKING 0.00 1 0.032 0.817 54 2.2 3.0 23.8 5.7 108 10 1 OVERALL LIKING 0.001 0.023 0.870 54 1.5 2.6 23.8 5.7 15111 96 3 OVERALL LIKING 0.000 0.018 0.897 54 1.2 1.2 23.8 5.7 105 37 3 OVERALL LIKING 0.000 0.009 0.946 54 10.1 14.1 23.8 5.7 L* ext OVERALL LIKING 0.0 00 0.004 0.976 54 33.6 2.6 23.8 5.7 FORCE TEXTURE LIKING 0.358 0.598 0.000 54 0.6 0.2 23.8 5.7 MALIC ACID TEXTURE LIKING 0.282 0.531 0.000 54 212.4 51.6 23.8 5.7 134 20 3 TEXTURE LIKING 0.277 0.526 0.000 54 0.1 0.7 23.8 5.7 104 76 7 TEXTURE LIKING 0.2 31 0.480 0.000 54 6.0 4.9 23.8 5.7 623 43 8 TEXTURE LIKING 0.179 0.423 0.001 54 3.4 3.4 23.8 5.7 1629 58 9 TEXTURE LIKING 0.151 0.388 0.004 54 117.9 65.9 23.8 5.7 103 09 3 TEXTURE LIKING 0.145 0.381 0.004 54 3.0 1.1 23.8 5.7 1576 87 0 TEXTURE LIKING 0.145 0.381 0.005 54 37.5 20.1 23.8 5.7 638 11 9 TEXTURE LIKING 0.141 0.375 0.005 54 72.7 67.2 23.8 5.7 40716 66 3 TEXTURE LIKING 0.132 0.364 0.007 54 84.3 107.5 23.8 5.7 2548 87 0 TEXTURE LIKING 0.129 0.360 0.008 54 2.4 1.5 23.8 5.7 111 71 7 TEXTURE L IKING 0.122 0.349 0.010 54 3.2 2.3 23.8 5.7 110 38 3 TEXTURE LIKING 0.117 0.342 0.011 54 2.0 2.6 23.8 5.7 2305 05 7 TEXTURE LIKING 0.116 0.341 0.012 54 6.7 6.7 23.8 5.7 60415 61 4 TEXTURE LIKING 0.104 0.322 0.018 54 0.7 1.6 23.8 5.7 SUCROSE TEXTURE LIK ING 0.102 0.320 0.018 54 1112.6 646.5 23.8 5.7 556 24 1 TEXTURE LIKING 0.097 0.312 0.022 54 46.6 57.0 23.8 5.7 123 92 2 TEXTURE LIKING 0.090 0.300 0.027 54 23.0 21.5 23.8 5.7 5454 09 1 TEXTURE LIKING 0.080 0.282 0.039 54 3.7 6.2 23.8 5.7 5989 33 3 TE XTURE LIKING 0.078 0.280 0.040 54 2.8 2.4 23.8 5.7 110 62 3 TEXTURE LIKING 0.076 0.276 0.043 54 7.9 8.9 23.8 5.7 55514 48 2 TEXTURE LIKING 0.076 0.275 0.044 54 0.5 0.5 23.8 5.7 109 21 7 TEXTURE LIKING 0.067 0.260 0.058 54 72.1 157.2 23.8 5.7 TOTAL SUG AR TEXTURE LIKING 0.067 0.260 0.058 54 4473.9 1037.2 23.8 5.7 124 19 6 TEXTURE LIKING 0.065 0.256 0.062 54 8.5 7.5 23.8 5.7 110 93 0 TEXTURE LIKING 0.065 0.256 0.062 54 2.7 1.5 23.8 5.7 540 18 1 TEXTURE LIKING 0.063 0.251 0.068 54 3.5 3.2 23.8 5.7 105 66 8 TEXTURE LIKING 0.062 0.250 0.068 54 5.0 3.7 23.8 5.7 110 43 0 TEXTURE LIKING 0.062 0.249 0.070 54 14.8 19.6 23.8 5.7 109 60 4 TEXTURE LIKING 0.059 0.244 0.076 54 3.8 2.7 23.8 5.7 1576 86 9 TEXTURE LIKING 0.058 0.241 0.079 54 37.8 21.7 23.8 5.7 40 77 47 8 TEXTURE LIKING 0.058 0.241 0.080 54 11.7 8.3 23.8 5.7 pH TEXTURE LIKING 0.056 0.237 0.084 54 3.7 0.2 23.8 5.7 SSC TEXTURE LIKING 0.055 0.234 0.089 54 7.4 1.4 23.8 5.7 10522 34 6 TEXTURE LIKING 0.048 0.218 0.113 54 1.1 1.1 23.8 5.7 109 19 3 TEXT URE LIKING 0.045 0.213 0.123 54 2.7 3.8 23.8 5.7 706 14 9 TEXTURE LIKING 0.044 0.210 0.128 54 44.5 81.1 23.8 5.7 2639 63 6 TEXTURE LIKING 0.040 0.200 0.147 54 10.8 13.0 23.8 5.7 111 27 3 TEXTURE LIKING 0.039 0.199 0.150 54 45.5 94.6 23.8 5.7 2432 51 1 TEXTURE LIKING 0.035 0.187 0.176 54 4.4 5.8 23.8 5.7 564 94 3 TEXTURE LIKING 0.035 0.186 0.177 54 6.5 7.4 23.8 5.7 110 39 4 TEXTURE LIKING 0.034 0.184 0.183 54 40.8 70.0 23.8 5.7 3913 81 3 TEXTURE LIKING 0.034 0.184 0.183 54 1.9 1.4 23.8 5.7 539 82 2 TEXTURE LIKING 0.030 0.173 0.212 54 3.3 3.9 23.8 5.7 624 24 8 TEXTURE LIKING 0.028 0.168 0.226 54 5.6 3.7 23.8 5.7 116 53 0 TEXTURE LIKING 0.026 0.163 0.240 54 19.7 16.0 23.8 5.7 TA TEXTURE LIKING 0.026 0.161 0.244 54 0.8 0.1 23.8 5.7 123 86 4 TEXTURE LIKING 0.026 0.160 0.247 54 73.5 85.0 23.8 5.7 TOTAL VOLATILES TEXTURE LIKING 0.025 0.158 0.254 54 15814.0 5238.5 23.8 5.7 5881 17 4 TEXTURE LIKING 0.025 0.157 0.256 54 6.2 2.5 23.8 5.7 66 25 1 TEXTURE LIKING 0.023 0.153 0.269 54 2545.9 1722.0 23.8 5.7 78 70 6 TEXTURE LIKING 0.023 0.152 0.272 54 128.8 113.0 23.8 5.7 124 13 0 TEXTURE LIKING 0.023 0.152 0.273 54 5.9 3.0 23.8 5.7 142 92 7 TEXTURE LIKING 0.023 0.151 0.274 54 53.5 49.7 23.8 5.7 2311 46 8 TEXTURE LIKING 0.023 0.151 0.276 54 3.9 4.4 23.8 5 .7 928 95 0 TEXTURE LIKING 0.020 0.143 0.302 54 66.8 61.7 23.8 5.7 96 04 8 TEXTURE LIKING 0.019 0.138 0.319 54 3.1 8.0 23.8 5.7 20664 46 4 TEXTURE LIKING 0.019 0.137 0.324 54 20.6 19.0 23.8 5.7 821 55 6 TEXTURE LIKING 0.018 0.135 0.329 54 3.5 8.2 23 .8 5.7 53398 83 7 TEXTURE LIKING 0.018 0.133 0.338 54 5.0 4.6 23.8 5.7 29811 50 5 TEXTURE LIKING 0.017 0.131 0.346 54 3.2 5.3 23.8 5.7 128 37 0 TEXTURE LIKING 0.017 0.129 0.352 54 4.1 3.7 23.8 5.7 140 11 4 TEXTURE LIKING 0.016 0.127 0.359 54 11.1 8.6 23.8 5.7 4887 30 3 TEXTURE LIKING 0.016 0.126 0.363 54 16.9 32.5 23.8 5.7 75 85 4 TEXTURE LIKING 0.015 0.124 0.371 54 3.9 2.2 23.8 5.7 L* ext TEXTURE LIKING 0.015 0.123 0.377 54 33.6 2.6 23.8 5.7 1191 16 8 TEXTURE LIKING 0.015 0.121 0.385 54 5.5 7.0 23.8 5.7 GLUCOSE TEXTURE LIKING 0.013 0.115 0.408 54 1594.6 378.2 23.8 5.7 B* ext TEXTURE LIKING 0.013 0.113 0.417 54 19.0 3.3 23.8 5.7 624 41 9 TEXTURE LIKING 0.012 0.111 0.424 54 18.9 18.1 23.8 5.7 6728 26 3 TEXTURE LIKING 0.012 0.108 0.435 54 866 6.5 3359.7 23.8 5.7 A* ext TEXTURE LIKING 0.010 0.099 0.475 54 36.4 3.1 23.8 5.7 2497 18 9 TEXTURE LIKING 0.008 0.092 0.508 54 24.9 21.5 23.8 5.7 71 41 0 TEXTURE LIKING 0.008 0.087 0.530 54 1.0 1.3 23.8 5.7 589 38 8 TEXTURE LIKING 0.007 0.087 0.534 54 1.9 1.2 23.8 5.7 106 32 1 TEXTURE LIKING 0.007 0.085 0.542 54 2.2 3.0 23.8 5.7 616 25 1 TEXTURE LIKING 0.007 0.082 0.555 54 15.9 7.3 23.8 5.7 106 70 7 TEXTURE LIKING 0.006 0.076 0.587 54 252.7 164.0 23.8 5.7

PAGE 91

91 Table 2 4. Continued. X Y R 2 CORR COEFF p VALUE n MEAN X STD DEV X MEAN Y STD DEV Y B* int TEXTURE LIKING 0.006 0.075 0.588 54 25.8 4.5 23.8 5.7 7452 79 1 TEXTURE LIKING 0.005 0.072 0.607 54 50.0 31.0 23.8 5.7 105 54 4 TEXTURE LIKING 0.005 0.068 0.626 54 42.0 17.1 23.8 5.7 A* int TEXTURE L IKING 0.004 0.060 0.666 54 28.8 7.6 23.8 5.7 628 63 7 TEXTURE LIKING 0.003 0.055 0.693 54 4.6 1.7 23.8 5.7 591 78 6 TEXTURE LIKING 0.003 0.054 0.700 54 10.3 13.9 23.8 5.7 7786 58 5 TEXTURE LIKING 0.003 0.052 0.707 54 12.2 28.4 23.8 5.7 FRUCTOSE TEXT URE LIKING 0.002 0.050 0.720 54 1766.7 381.5 23.8 5.7 1576 95 0 TEXTURE LIKING 0.002 0.047 0.736 54 2.1 2.0 23.8 5.7 CITRIC ACID TEXTURE LIKING 0.002 0.047 0.736 54 741.0 147.2 23.8 5.7 112 14 1 TEXTURE LIKING 0.001 0.028 0.843 54 18.3 24.0 23.8 5.7 105 37 3 TEXTURE LIKING 0.001 0.026 0.851 54 10.1 14.1 23.8 5.7 29674 47 3 TEXTURE LIKING 0.001 0.023 0.867 54 5.0 5.0 23.8 5.7 108 10 1 TEXTURE LIKING 0.001 0.023 0.869 54 1.5 2.6 23.8 5.7 15111 96 3 TEXTURE LIKING 0.000 0.022 0.875 54 1.2 1.2 23.8 5 .7 623 42 7 TEXTURE LIKING 0.000 0.017 0.905 54 2780.2 1376.8 23.8 5.7 96 22 0 TEXTURE LIKING 0.000 0.015 0.915 54 51.2 18.6 23.8 5.7 L* int TEXTURE LIKING 0.000 0.014 0.919 54 54.9 5.8 23.8 5.7 123 66 0 TEXTURE LIKING 0.000 0.007 0.957 54 108.2 128. 0 23.8 5.7 1534 08 3 TEXTURE LIKING 0.000 0.002 0.988 54 0.4 0.2 23.8 5.7 SSC SWEETNESS INTENSITY 0.690 0.831 0.000 54 7.4 1.4 23.0 4.8 TOTAL SUGAR SWEETNESS INTENSITY 0.687 0.829 0.000 54 4473.9 1037.2 23.0 4.8 SUCROSE SWEETNESS INTENSITY 0.445 0.667 0.000 54 1112.6 646.5 23.0 4.8 1629 58 9 SWEETNESS INTENSITY 0.377 0.614 0.000 54 117.9 65.9 23.0 4.8 GLUCOSE SWEETNESS INTENSITY 0.338 0.581 0.000 54 1594.6 378.2 23.0 4.8 FRUCTOSE SWEETNESS INTENSITY 0.300 0.548 0.000 54 1766.7 381.5 23.0 4.8 2639 63 6 SWEETNESS INTENSITY 0.296 0.544 0.000 54 10.8 13.0 23.0 4.8 2305 05 7 SWEETNESS INTENSITY 0.295 0.543 0.000 54 6.7 6.7 23.0 4.8 540 18 1 SWEETNESS INTENSITY 0.254 0.504 0.000 54 3.5 3.2 23.0 4.8 1576 87 0 SWEETNESS INTENSITY 0.242 0.492 0.000 54 37.5 20.1 23.0 4.8 142 92 7 SWEETNESS INTENSITY 0.239 0.489 0.000 54 53.5 49.7 23.0 4.8 60415 61 4 SWEETNESS INTENSITY 0.233 0.482 0.000 54 0.7 1.6 23.0 4.8 1576 86 9 SWEETNESS INTENSITY 0.217 0.466 0.000 54 37.8 21.7 23.0 4.8 109 21 7 SWEETNESS INTENSITY 0.198 0.445 0.001 54 72.1 157.2 23.0 4.8 111 71 7 SWEETNESS INTENSITY 0.195 0.441 0.001 54 3.2 2.3 23.0 4.8 3913 81 3 SWEETNESS INTENSITY 0.192 0.438 0.001 54 1.9 1.4 23.0 4.8 L* int SWEETNESS INTENSITY 0.187 0.432 0.001 54 54.9 5.8 23.0 4.8 109 19 3 S WEETNESS INTENSITY 0.184 0.429 0.001 54 2.7 3.8 23.0 4.8 5989 33 3 SWEETNESS INTENSITY 0.171 0.414 0.002 54 2.8 2.4 23.0 4.8 123 86 4 SWEETNESS INTENSITY 0.158 0.397 0.003 54 73.5 85.0 23.0 4.8 706 14 9 SWEETNESS INTENSITY 0.151 0.388 0.004 54 44.5 81.1 23.0 4.8 638 11 9 SWEETNESS INTENSITY 0.151 0.388 0.004 54 72.7 67.2 23.0 4.8 110 93 0 SWEETNESS INTENSITY 0.151 0.388 0.004 54 2.7 1.5 23.0 4.8 591 78 6 SWEETNESS INTENSITY 0.144 0.379 0.005 54 10.3 13.9 23.0 4.8 A* int SWEETNESS INTENSITY 0.139 0.3 73 0.005 54 28.8 7.6 23.0 4.8 TOTAL VOLATILES SWEETNESS INTENSITY 0.139 0.373 0.005 54 15814.0 5238.5 23.0 4.8 124 19 6 SWEETNESS INTENSITY 0.139 0.372 0.006 54 8.5 7.5 23.0 4.8 5454 09 1 SWEETNESS INTENSITY 0.132 0.363 0.007 54 3.7 6.2 23.0 4.8 CITRIC ACID SWEETNESS INTENSITY 0.124 0.353 0.009 54 741.0 147.2 23.0 4.8 110 39 4 SWEETNESS INTENSITY 0.123 0.351 0.009 54 40.8 70.0 23.0 4.8 53398 83 7 SWEETNESS INTENSITY 0.123 0.351 0.009 54 5.0 4.6 23.0 4.8 104 76 7 SWEETNESS INTENSITY 0.118 0.343 0.011 54 6.0 4.9 23.0 4.8 5881 17 4 SWEETNESS INTENSITY 0.112 0.334 0.014 54 6.2 2.5 23.0 4.8 4077 47 8 SWEETNESS INTENSITY 0.109 0.330 0.015 54 11.7 8.3 23.0 4.8 110 43 0 SWEETNESS INTENSITY 0.106 0.326 0.016 54 14.8 19.6 23.0 4.8 TA SWEETNESS INTENSITY 0.0 94 0.307 0.024 54 0.8 0.1 23.0 4.8 616 25 1 SWEETNESS INTENSITY 0.094 0.307 0.024 54 15.9 7.3 23.0 4.8 10522 34 6 SWEETNESS INTENSITY 0.092 0.304 0.026 54 1.1 1.1 23.0 4.8 40716 66 3 SWEETNESS INTENSITY 0.092 0.303 0.026 54 84.3 107.5 23.0 4.8 623 42 7 SWEETNESS INTENSITY 0.085 0.292 0.032 54 2780.2 1376.8 23.0 4.8 2311 46 8 SWEETNESS INTENSITY 0.085 0.291 0.033 54 3.9 4.4 23.0 4.8 6728 26 3 SWEETNESS INTENSITY 0.078 0.278 0.041 54 8666.5 3359.7 23.0 4.8 105 66 8 SWEETNESS INTENSITY 0.077 0.278 0.042 54 5.0 3.7 23.0 4.8 B* int SWEETNESS INTENSITY 0.075 0.275 0.044 54 25.8 4.5 23.0 4.8 4887 30 3 SWEETNESS INTENSITY 0.075 0.274 0.045 54 16.9 32.5 23.0 4.8 110 38 3 SWEETNESS INTENSITY 0.070 0.264 0.054 54 2.0 2.6 23.0 4.8 7786 58 5 SWEETNESS INTENSI TY 0.069 0.262 0.056 54 12.2 28.4 23.0 4.8 112 14 1 SWEETNESS INTENSITY 0.066 0.257 0.061 54 18.3 24.0 23.0 4.8 2548 87 0 SWEETNESS INTENSITY 0.064 0.253 0.064 54 2.4 1.5 23.0 4.8 96 22 0 SWEETNESS INTENSITY 0.063 0.250 0.068 54 51.2 18.6 23.0 4.8 1191 16 8 SWEETNESS INTENSITY 0.063 0.250 0.068 54 5.5 7.0 23.0 4.8 105 54 4 SWEETNESS INTENSITY 0.062 0.249 0.069 54 42.0 17.1 23.0 4.8 124 13 0 SWEETNESS INTENSITY 0.053 0.231 0.093 54 5.9 3.0 23.0 4.8 29674 47 3 SWEETNESS INTENSITY 0.051 0.226 0.101 54 5.0 5.0 23.0 4.8 pH SWEETNESS INTENSITY 0.048 0.220 0.110 54 3.7 0.2 23.0 4.8 71 41 0 SWEETNESS INTENSITY 0.045 0.213 0.122 54 1.0 1.3 23.0 4.8 628 63 7 SWEETNESS INTENSITY 0.040 0.199 0.149 54 4.6 1.7 23.0 4.8 556 24 1 SWEETNESS INTENSITY 0.039 0.198 0.151 54 46.6 57.0 23.0 4.8 564 94 3 SWEETNESS INTENSITY 0.030 0.173 0.211 54 6.5 7.4 23.0 4.8 20664 46 4 SWEETNESS INTENSITY 0.029 0.171 0.215 54 20.6 19.0 23.0 4.8 624 41 9 SWEETNESS INTENSITY 0.026 0.162 0.243 54 18.9 18.1 23.0 4.8 539 82 2 SWEETNE SS INTENSITY 0.025 0.158 0.255 54 3.3 3.9 23.0 4.8 1534 08 3 SWEETNESS INTENSITY 0.021 0.146 0.292 54 0.4 0.2 23.0 4.8 106 70 7 SWEETNESS INTENSITY 0.020 0.142 0.307 54 252.7 164.0 23.0 4.8 B* ext SWEETNESS INTENSITY 0.019 0.137 0.324 54 19.0 3.3 23.0 4.8 116 53 0 SWEETNESS INTENSITY 0.018 0.133 0.339 54 19.7 16.0 23.0 4.8 A* ext SWEETNESS INTENSITY 0.017 0.130 0.348 54 36.4 3.1 23.0 4.8 78 70 6 SWEETNESS INTENSITY 0.017 0.130 0.350 54 128.8 113.0 23.0 4.8

PAGE 92

92 Table 2 4. Continued. X Y R 2 CORR COEFF p VALUE n MEAN X STD DEV X MEAN Y STD DEV Y 123 66 0 SWEETNESS INTENSITY 0.017 0.129 0.352 54 108.2 128.0 23.0 4.8 55514 48 2 SWEETNESS INTENSITY 0.014 0.120 0.387 54 0.5 0.5 23.0 4.8 7452 79 1 SWEETNESS INTENSITY 0.013 0.116 0.405 54 50.0 31.0 23.0 4.8 821 55 6 SWEETNESS INTENSITY 0.013 0.113 0.416 54 3.5 8.2 23.0 4.8 66 25 1 SWEETNESS INTENSITY 0.011 0.104 0.455 54 2545.9 1722.0 23.0 4.8 928 95 0 SWEETNESS INTENSITY 0.010 0.101 0.468 54 66.8 61.7 23.0 4.8 589 38 8 SWEETNESS INTENSITY 0.009 0.097 0 .484 54 1.9 1.2 23.0 4.8 110 62 3 SWEETNESS INTENSITY 0.009 0.095 0.496 54 7.9 8.9 23.0 4.8 109 60 4 SWEETNESS INTENSITY 0.009 0.095 0.496 54 3.8 2.7 23.0 4.8 111 27 3 SWEETNESS INTENSITY 0.009 0.094 0.501 54 45.5 94.6 23.0 4.8 140 11 4 SWEETNESS IN TENSITY 0.009 0.093 0.501 54 11.1 8.6 23.0 4.8 MALIC ACID SWEETNESS INTENSITY 0.009 0.093 0.506 54 212.4 51.6 23.0 4.8 FORCE SWEETNESS INTENSITY 0.005 0.074 0.594 54 0.6 0.2 23.0 4.8 128 37 0 SWEETNESS INTENSITY 0.004 0.061 0.664 54 4.1 3.7 23.0 4.8 106 32 1 SWEETNESS INTENSITY 0.003 0.055 0.694 54 2.2 3.0 23.0 4.8 623 43 8 SWEETNESS INTENSITY 0.003 0.050 0.718 54 3.4 3.4 23.0 4.8 108 10 1 SWEETNESS INTENSITY 0.002 0.050 0.721 54 1.5 2.6 23.0 4.8 29811 50 5 SWEETNESS INTENSITY 0.002 0.048 0.728 54 3.2 5.3 23.0 4.8 15111 96 3 SWEETNESS INTENSITY 0.002 0.048 0.731 54 1.2 1.2 23.0 4.8 2432 51 1 SWEETNESS INTENSITY 0.002 0.041 0.770 54 4.4 5.8 23.0 4.8 624 24 8 SWEETNESS INTENSITY 0.002 0.039 0.779 54 5.6 3.7 23.0 4.8 134 20 3 SWEETNESS INTENSIT Y 0.001 0.030 0.827 54 0.1 0.7 23.0 4.8 1576 95 0 SWEETNESS INTENSITY 0.000 0.018 0.899 54 2.1 2.0 23.0 4.8 123 92 2 SWEETNESS INTENSITY 0.000 0.017 0.905 54 23.0 21.5 23.0 4.8 2497 18 9 SWEETNESS INTENSITY 0.000 0.012 0.934 54 24.9 21.5 23.0 4.8 L* ext SWEETNESS INTENSITY 0.000 0.010 0.943 54 33.6 2.6 23.0 4.8 103 09 3 SWEETNESS INTENSITY 0.000 0.007 0.960 54 3.0 1.1 23.0 4.8 105 37 3 SWEETNESS INTENSITY 0.000 0.005 0.973 54 10.1 14.1 23.0 4.8 75 85 4 SWEETNESS INTENSITY 0.000 0.001 0.995 54 3.9 2.2 23.0 4.8 96 04 8 SWEETNESS INTENSITY 0.000 0.001 0.996 54 3.1 8.0 23.0 4.8 TA SOURNESS INTENSITY 0.314 0.561 0.000 54 0.8 0.1 18.1 3.1 MALIC ACID SOURNESS INTENSITY 0.189 0.435 0.001 54 212.4 51.6 18.1 3.1 CITRIC ACID SOURNESS INTENSITY 0.146 0.3 82 0.004 54 741.0 147.2 18.1 3.1 134 20 3 SOURNESS INTENSITY 0.137 0.370 0.006 54 0.1 0.7 18.1 3.1 pH SOURNESS INTENSITY 0.118 0.344 0.011 54 3.7 0.2 18.1 3.1 15111 96 3 SOURNESS INTENSITY 0.106 0.325 0.016 54 1.2 1.2 18.1 3.1 624 41 9 SOURNESS INTE NSITY 0.097 0.311 0.022 54 18.9 18.1 18.1 3.1 FRUCTOSE SOURNESS INTENSITY 0.089 0.298 0.029 54 1766.7 381.5 18.1 3.1 GLUCOSE SOURNESS INTENSITY 0.075 0.274 0.045 54 1594.6 378.2 18.1 3.1 4887 30 3 SOURNESS INTENSITY 0.073 0.270 0.048 54 16.9 32.5 18. 1 3.1 1191 16 8 SOURNESS INTENSITY 0.068 0.261 0.056 54 5.5 7.0 18.1 3.1 78 70 6 SOURNESS INTENSITY 0.068 0.260 0.058 54 128.8 113.0 18.1 3.1 5454 09 1 SOURNESS INTENSITY 0.067 0.259 0.058 54 3.7 6.2 18.1 3.1 110 39 4 SOURNESS INTENSITY 0.066 0.257 0 .061 54 40.8 70.0 18.1 3.1 589 38 8 SOURNESS INTENSITY 0.062 0.248 0.070 54 1.9 1.2 18.1 3.1 624 24 8 SOURNESS INTENSITY 0.054 0.233 0.090 54 5.6 3.7 18.1 3.1 928 95 0 SOURNESS INTENSITY 0.050 0.223 0.106 54 66.8 61.7 18.1 3.1 128 37 0 SOURNESS INTENS ITY 0.049 0.221 0.108 54 4.1 3.7 18.1 3.1 110 62 3 SOURNESS INTENSITY 0.047 0.218 0.113 54 7.9 8.9 18.1 3.1 2497 18 9 SOURNESS INTENSITY 0.036 0.189 0.171 54 24.9 21.5 18.1 3.1 111 27 3 SOURNESS INTENSITY 0.036 0.189 0.172 54 45.5 94.6 18.1 3.1 96 04 8 SOURNESS INTENSITY 0.033 0.182 0.188 54 3.1 8.0 18.1 3.1 104 76 7 SOURNESS INTENSITY 0.032 0.178 0.198 54 6.0 4.9 18.1 3.1 10522 34 6 SOURNESS INTENSITY 0.031 0.177 0.201 54 1.1 1.1 18.1 3.1 140 11 4 SOURNESS INTENSITY 0.031 0.176 0.203 54 11.1 8.6 18.1 3.1 L* ext SOURNESS INTENSITY 0.030 0.172 0.212 54 33.6 2.6 18.1 3.1 556 24 1 SOURNESS INTENSITY 0.028 0.167 0.226 54 46.6 57.0 18.1 3.1 55514 48 2 SOURNESS INTENSITY 0.027 0.165 0.232 54 0.5 0.5 18.1 3.1 2548 87 0 SOURNESS INTENSITY 0.027 0.165 0.233 54 2.4 1.5 18.1 3.1 623 43 8 SOURNESS INTENSITY 0.024 0.154 0.267 54 3.4 3.4 18.1 3.1 TOTAL SUGAR SOURNESS INTENSITY 0.022 0.148 0.287 54 4473.9 1037.2 18.1 3.1 L* int SOURNESS INTENSITY 0.021 0.145 0.296 54 54.9 5.8 18.1 3.1 SSC SOURNESS INTE NSITY 0.020 0.142 0.305 54 7.4 1.4 18.1 3.1 112 14 1 SOURNESS INTENSITY 0.020 0.141 0.311 54 18.3 24.0 18.1 3.1 B* ext SOURNESS INTENSITY 0.020 0.140 0.312 54 19.0 3.3 18.1 3.1 B* int SOURNESS INTENSITY 0.020 0.140 0.314 54 25.8 4.5 18.1 3.1 103 09 3 SOURNESS INTENSITY 0.017 0.129 0.354 54 3.0 1.1 18.1 3.1 1534 08 3 SOURNESS INTENSITY 0.016 0.127 0.359 54 0.4 0.2 18.1 3.1 106 70 7 SOURNESS INTENSITY 0.016 0.125 0.366 54 252.7 164.0 18.1 3.1 110 43 0 SOURNESS INTENSITY 0.015 0.121 0.381 54 14.8 1 9.6 18.1 3.1 53398 83 7 SOURNESS INTENSITY 0.014 0.120 0.389 54 5.0 4.6 18.1 3.1 5989 33 3 SOURNESS INTENSITY 0.014 0.117 0.398 54 2.8 2.4 18.1 3.1 5881 17 4 SOURNESS INTENSITY 0.014 0.117 0.401 54 6.2 2.5 18.1 3.1 7452 79 1 SOURNESS INTENSITY 0.013 0.114 0.411 54 50.0 31.0 18.1 3.1 1576 95 0 SOURNESS INTENSITY 0.013 0.114 0.413 54 2.1 2.0 18.1 3.1 20664 46 4 SOURNESS INTENSITY 0.012 0.111 0.423 54 20.6 19.0 18.1 3.1 29811 50 5 SOURNESS INTENSITY 0.012 0.108 0.436 54 3.2 5.3 18.1 3.1 110 38 3 SOUR NESS INTENSITY 0.012 0.108 0.437 54 2.0 2.6 18.1 3.1 2639 63 6 SOURNESS INTENSITY 0.011 0.107 0.443 54 10.8 13.0 18.1 3.1 123 92 2 SOURNESS INTENSITY 0.011 0.105 0.450 54 23.0 21.5 18.1 3.1 109 21 7 SOURNESS INTENSITY 0.011 0.105 0.451 54 72.1 157.2 18.1 3.1 110 93 0 SOURNESS INTENSITY 0.011 0.105 0.452 54 2.7 1.5 18.1 3.1 29674 47 3 SOURNESS INTENSITY 0.011 0.104 0.454 54 5.0 5.0 18.1 3.1 SUCROSE SOURNESS INTENSITY 0.010 0.099 0.476 54 1112.6 646.5 18.1 3.1 4077 47 8 SOURNESS INTENSITY 0.009 0.09 2 0.507 54 11.7 8.3 18.1 3.1 539 82 2 SOURNESS INTENSITY 0.008 0.092 0.510 54 3.3 3.9 18.1 3.1 591 78 6 SOURNESS INTENSITY 0.008 0.091 0.514 54 10.3 13.9 18.1 3.1 A* int SOURNESS INTENSITY 0.008 0.088 0.525 54 28.8 7.6 18.1 3.1

PAGE 93

93 Table 2 4. Continued. X Y R 2 CORR COEFF p VALUE n MEAN X STD DEV X MEAN Y STD DEV Y 109 19 3 SOURNESS INTENSITY 0.007 0.086 0.537 54 2.7 3.8 18.1 3.1 60415 61 4 SOURNESS INTENSITY 0.007 0.084 0.545 54 0.7 1.6 18.1 3.1 142 92 7 SOURNESS INTENSITY 0.007 0.081 0.559 54 53.5 49.7 18.1 3.1 111 71 7 SOURNESS INTENSITY 0.006 0.075 0.589 54 3.2 2.3 18.1 3.1 106 32 1 SOURNESS INTENSITY 0.006 0.075 0.591 54 2.2 3.0 18.1 3.1 66 25 1 SOURNESS INTENSITY 0.005 0.072 0.605 54 2545.9 1722.0 18.1 3.1 564 94 3 SOURNESS INTENSITY 0.005 0 .072 0.606 54 6.5 7.4 18.1 3.1 116 53 0 SOURNESS INTENSITY 0.005 0.068 0.625 54 19.7 16.0 18.1 3.1 109 60 4 SOURNESS INTENSITY 0.005 0.068 0.626 54 3.8 2.7 18.1 3.1 2432 51 1 SOURNESS INTENSITY 0.004 0.064 0.644 54 4.4 5.8 18.1 3.1 1576 86 9 SOURNESS INTENSITY 0.004 0.064 0.645 54 37.8 21.7 18.1 3.1 124 13 0 SOURNESS INTENSITY 0.004 0.061 0.660 54 5.9 3.0 18.1 3.1 3913 81 3 SOURNESS INTENSITY 0.004 0.060 0.669 54 1.9 1.4 18.1 3.1 1629 58 9 SOURNESS INTENSITY 0.003 0.058 0.678 54 117.9 65.9 18.1 3. 1 628 63 7 SOURNESS INTENSITY 0.003 0.052 0.709 54 4.6 1.7 18.1 3.1 7786 58 5 SOURNESS INTENSITY 0.003 0.051 0.713 54 12.2 28.4 18.1 3.1 96 22 0 SOURNESS INTENSITY 0.002 0.050 0.721 54 51.2 18.6 18.1 3.1 616 25 1 SOURNESS INTENSITY 0.002 0.048 0.731 54 15.9 7.3 18.1 3.1 75 85 4 SOURNESS INTENSITY 0.002 0.047 0.737 54 3.9 2.2 18.1 3.1 706 14 9 SOURNESS INTENSITY 0.002 0.040 0.772 54 44.5 81.1 18.1 3.1 A* ext SOURNESS INTENSITY 0.002 0.040 0.774 54 36.4 3.1 18.1 3.1 2311 46 8 SOURNESS INTENSITY 0. 002 0.039 0.779 54 3.9 4.4 18.1 3.1 TOTAL VOLATILES SOURNESS INTENSITY 0.001 0.029 0.834 54 15814.0 5238.5 18.1 3.1 40716 66 3 SOURNESS INTENSITY 0.001 0.029 0.838 54 84.3 107.5 18.1 3.1 123 66 0 SOURNESS INTENSITY 0.001 0.027 0.849 54 108.2 128.0 18. 1 3.1 1576 87 0 SOURNESS INTENSITY 0.001 0.026 0.851 54 37.5 20.1 18.1 3.1 71 41 0 SOURNESS INTENSITY 0.001 0.025 0.855 54 1.0 1.3 18.1 3.1 124 19 6 SOURNESS INTENSITY 0.000 0.021 0.883 54 8.5 7.5 18.1 3.1 108 10 1 SOURNESS INTENSITY 0.000 0.020 0.886 54 1.5 2.6 18.1 3.1 638 11 9 SOURNESS INTENSITY 0.000 0.018 0.899 54 72.7 67.2 18.1 3.1 6728 26 3 SOURNESS INTENSITY 0.000 0.016 0.909 54 8666.5 3359.7 18.1 3.1 123 86 4 SOURNESS INTENSITY 0.000 0.016 0.910 54 73.5 85.0 18.1 3.1 105 66 8 SOURNESS IN TENSITY 0.000 0.011 0.938 54 5.0 3.7 18.1 3.1 105 54 4 SOURNESS INTENSITY 0.000 0.011 0.939 54 42.0 17.1 18.1 3.1 FORCE SOURNESS INTENSITY 0.000 0.008 0.953 54 0.6 0.2 18.1 3.1 540 18 1 SOURNESS INTENSITY 0.000 0.008 0.957 54 3.5 3.2 18.1 3.1 2305 05 7 SOURNESS INTENSITY 0.000 0.007 0.962 54 6.7 6.7 18.1 3.1 105 37 3 SOURNESS INTENSITY 0.000 0.006 0.964 54 10.1 14.1 18.1 3.1 623 42 7 SOURNESS INTENSITY 0.000 0.006 0.966 54 2780.2 1376.8 18.1 3.1 821 55 6 SOURNESS INTENSITY 0.000 0.001 0.997 54 3 .5 8.2 18.1 3.1 SSC STRAWBERRY FLAVOR INTENSITY 0.584 0.764 0.000 54 7.4 1.4 26.9 3.9 TOTAL SUGAR STRAWBERRY FLAVOR INTENSITY 0.569 0.755 0.000 54 4473.9 1037.2 26.9 3.9 SUCROSE STRAWBERRY FLAVOR INTENSITY 0.498 0.705 0.000 54 1112.6 646.5 26.9 3.9 162 9 58 9 STRAWBERRY FLAVOR INTENSITY 0.356 0.597 0.000 54 117.9 65.9 26.9 3.9 2305 05 7 STRAWBERRY FLAVOR INTENSITY 0.283 0.532 0.000 54 6.7 6.7 26.9 3.9 540 18 1 STRAWBERRY FLAVOR INTENSITY 0.260 0.509 0.000 54 3.5 3.2 26.9 3.9 TA STRAWBERRY FLAVOR INTEN SITY 0.256 0.506 0.000 54 0.8 0.1 26.9 3.9 1576 87 0 STRAWBERRY FLAVOR INTENSITY 0.239 0.488 0.000 54 37.5 20.1 26.9 3.9 2639 63 6 STRAWBERRY FLAVOR INTENSITY 0.235 0.485 0.000 54 10.8 13.0 26.9 3.9 CITRIC ACID STRAWBERRY FLAVOR INTENSITY 0.235 0.485 0. 000 54 741.0 147.2 26.9 3.9 60415 61 4 STRAWBERRY FLAVOR INTENSITY 0.233 0.482 0.000 54 0.7 1.6 26.9 3.9 142 92 7 STRAWBERRY FLAVOR INTENSITY 0.227 0.477 0.000 54 53.5 49.7 26.9 3.9 1576 86 9 STRAWBERRY FLAVOR INTENSITY 0.222 0.472 0.000 54 37.8 21.7 26 .9 3.9 5989 33 3 STRAWBERRY FLAVOR INTENSITY 0.208 0.456 0.001 54 2.8 2.4 26.9 3.9 GLUCOSE STRAWBERRY FLAVOR INTENSITY 0.205 0.453 0.001 54 1594.6 378.2 26.9 3.9 123 86 4 STRAWBERRY FLAVOR INTENSITY 0.205 0.453 0.001 54 73.5 85.0 26.9 3.9 111 71 7 STRA WBERRY FLAVOR INTENSITY 0.201 0.448 0.001 54 3.2 2.3 26.9 3.9 109 21 7 STRAWBERRY FLAVOR INTENSITY 0.194 0.440 0.001 54 72.1 157.2 26.9 3.9 591 78 6 STRAWBERRY FLAVOR INTENSITY 0.180 0.425 0.001 54 10.3 13.9 26.9 3.9 109 19 3 STRAWBERRY FLAVOR INTENSITY 0.179 0.424 0.001 54 2.7 3.8 26.9 3.9 706 14 9 STRAWBERRY FLAVOR INTENSITY 0.179 0.423 0.001 54 44.5 81.1 26.9 3.9 TOTAL VOLATILES STRAWBERRY FLAVOR INTENSITY 0.167 0.409 0.002 54 15814.0 5238.5 26.9 3.9 FRUCTOSE STRAWBERRY FLAVOR INTENSITY 0.166 0.407 0.002 54 1766.7 381.5 26.9 3.9 638 11 9 STRAWBERRY FLAVOR INTENSITY 0.164 0.405 0.002 54 72.7 67.2 26.9 3.9 3913 81 3 STRAWBERRY FLAVOR INTENSITY 0.158 0.398 0.003 54 1.9 1.4 26.9 3.9 616 25 1 STRAWBERRY FLAVOR INTENSITY 0.154 0.392 0.003 54 15.9 7.3 2 6.9 3.9 5881 17 4 STRAWBERRY FLAVOR INTENSITY 0.153 0.391 0.003 54 6.2 2.5 26.9 3.9 110 93 0 STRAWBERRY FLAVOR INTENSITY 0.137 0.370 0.006 54 2.7 1.5 26.9 3.9 124 19 6 STRAWBERRY FLAVOR INTENSITY 0.129 0.359 0.008 54 8.5 7.5 26.9 3.9 40716 66 3 STRAWBE RRY FLAVOR INTENSITY 0.112 0.335 0.013 54 84.3 107.5 26.9 3.9 L* int STRAWBERRY FLAVOR INTENSITY 0.109 0.330 0.015 54 54.9 5.8 26.9 3.9 4077 47 8 STRAWBERRY FLAVOR INTENSITY 0.108 0.328 0.015 54 11.7 8.3 26.9 3.9 2311 46 8 STRAWBERRY FLAVOR INTENSITY 0. 103 0.322 0.018 54 3.9 4.4 26.9 3.9 110 43 0 STRAWBERRY FLAVOR INTENSITY 0.101 0.318 0.019 54 14.8 19.6 26.9 3.9 623 42 7 STRAWBERRY FLAVOR INTENSITY 0.097 0.312 0.022 54 2780.2 1376.8 26.9 3.9 6728 26 3 STRAWBERRY FLAVOR INTENSITY 0.096 0.310 0.022 54 8666.5 3359.7 26.9 3.9 105 54 4 STRAWBERRY FLAVOR INTENSITY 0.089 0.299 0.028 54 42.0 17.1 26.9 3.9 A* int STRAWBERRY FLAVOR INTENSITY 0.087 0.295 0.030 54 28.8 7.6 26.9 3.9 110 62 3 STRAWBERRY FLAVOR INTENSITY 0.079 0.281 0.039 54 7.9 8.9 26.9 3.9 1 10 39 4 STRAWBERRY FLAVOR INTENSITY 0.079 0.281 0.040 54 40.8 70.0 26.9 3.9 78 70 6 STRAWBERRY FLAVOR INTENSITY 0.074 0.272 0.046 54 128.8 113.0 26.9 3.9 29674 47 3 STRAWBERRY FLAVOR INTENSITY 0.069 0.263 0.055 54 5.0 5.0 26.9 3.9 5454 09 1 STRAWBERRY F LAVOR INTENSITY 0.067 0.259 0.059 54 3.7 6.2 26.9 3.9 96 22 0 STRAWBERRY FLAVOR INTENSITY 0.066 0.258 0.060 54 51.2 18.6 26.9 3.9 104 76 7 STRAWBERRY FLAVOR INTENSITY 0.064 0.252 0.066 54 6.0 4.9 26.9 3.9 10522 34 6 STRAWBERRY FLAVOR INTENSITY 0.060 0.2 46 0.073 54 1.1 1.1 26.9 3.9 7786 58 5 STRAWBERRY FLAVOR INTENSITY 0.059 0.243 0.077 54 12.2 28.4 26.9 3.9 124 13 0 STRAWBERRY FLAVOR INTENSITY 0.057 0.239 0.081 54 5.9 3.0 26.9 3.9

PAGE 94

94 Table 2 4. Continued. X Y R 2 CORR COEFF p VALUE n MEAN X STD DEV X ME AN Y STD DEV Y 112 14 1 STRAWBERRY FLAVOR INTENSITY 0.056 0.237 0.084 54 18.3 24.0 26.9 3.9 2548 87 0 STRAWBERRY FLAVOR INTENSITY 0.056 0.236 0.086 54 2.4 1.5 26.9 3.9 628 63 7 STRAWBERRY FLAVOR INTENSITY 0.042 0.206 0.135 54 4.6 1.7 26.9 3.9 B* int ST RAWBERRY FLAVOR INTENSITY 0.039 0.198 0.152 54 25.8 4.5 26.9 3.9 105 66 8 STRAWBERRY FLAVOR INTENSITY 0.037 0.193 0.162 54 5.0 3.7 26.9 3.9 20664 46 4 STRAWBERRY FLAVOR INTENSITY 0.037 0.193 0.162 54 20.6 19.0 26.9 3.9 564 94 3 STRAWBERRY FLAVOR INTENS ITY 0.037 0.192 0.165 54 6.5 7.4 26.9 3.9 4887 30 3 STRAWBERRY FLAVOR INTENSITY 0.034 0.185 0.180 54 16.9 32.5 26.9 3.9 110 38 3 STRAWBERRY FLAVOR INTENSITY 0.031 0.176 0.204 54 2.0 2.6 26.9 3.9 53398 83 7 STRAWBERRY FLAVOR INTENSITY 0.029 0.172 0.215 5 4 5.0 4.6 26.9 3.9 539 82 2 STRAWBERRY FLAVOR INTENSITY 0.026 0.160 0.247 54 3.3 3.9 26.9 3.9 134 20 3 STRAWBERRY FLAVOR INTENSITY 0.021 0.145 0.295 54 0.1 0.7 26.9 3.9 29811 50 5 STRAWBERRY FLAVOR INTENSITY 0.020 0.143 0.303 54 3.2 5.3 26.9 3.9 556 2 4 1 STRAWBERRY FLAVOR INTENSITY 0.019 0.137 0.324 54 46.6 57.0 26.9 3.9 589 38 8 STRAWBERRY FLAVOR INTENSITY 0.018 0.136 0.328 54 1.9 1.2 26.9 3.9 821 55 6 STRAWBERRY FLAVOR INTENSITY 0.017 0.130 0.348 54 3.5 8.2 26.9 3.9 2432 51 1 STRAWBERRY FLAVOR INT ENSITY 0.017 0.129 0.351 54 4.4 5.8 26.9 3.9 7452 79 1 STRAWBERRY FLAVOR INTENSITY 0.016 0.125 0.369 54 50.0 31.0 26.9 3.9 66 25 1 STRAWBERRY FLAVOR INTENSITY 0.016 0.125 0.369 54 2545.9 1722.0 26.9 3.9 116 53 0 STRAWBERRY FLAVOR INTENSITY 0.015 0.122 0.379 54 19.7 16.0 26.9 3.9 128 37 0 STRAWBERRY FLAVOR INTENSITY 0.013 0.115 0.407 54 4.1 3.7 26.9 3.9 pH STRAWBERRY FLAVOR INTENSITY 0.010 0.102 0.464 54 3.7 0.2 26.9 3.9 B* ext STRAWBERRY FLAVOR INTENSITY 0.009 0.097 0.488 54 19.0 3.3 26.9 3.9 106 7 0 7 STRAWBERRY FLAVOR INTENSITY 0.009 0.096 0.491 54 252.7 164.0 26.9 3.9 624 24 8 STRAWBERRY FLAVOR INTENSITY 0.009 0.094 0.498 54 5.6 3.7 26.9 3.9 623 43 8 STRAWBERRY FLAVOR INTENSITY 0.008 0.088 0.529 54 3.4 3.4 26.9 3.9 1534 08 3 STRAWBERRY FLAVOR INTENSITY 0.007 0.086 0.535 54 0.4 0.2 26.9 3.9 71 41 0 STRAWBERRY FLAVOR INTENSITY 0.007 0.084 0.548 54 1.0 1.3 26.9 3.9 123 66 0 STRAWBERRY FLAVOR INTENSITY 0.006 0.078 0.576 54 108.2 128.0 26.9 3.9 A* ext STRAWBERRY FLAVOR INTENSITY 0.005 0.073 0.59 9 54 36.4 3.1 26.9 3.9 15111 96 3 STRAWBERRY FLAVOR INTENSITY 0.005 0.071 0.608 54 1.2 1.2 26.9 3.9 106 32 1 STRAWBERRY FLAVOR INTENSITY 0.005 0.070 0.616 54 2.2 3.0 26.9 3.9 1191 16 8 STRAWBERRY FLAVOR INTENSITY 0.004 0.064 0.646 54 5.5 7.0 26.9 3.9 75 85 4 STRAWBERRY FLAVOR INTENSITY 0.004 0.059 0.670 54 3.9 2.2 26.9 3.9 105 37 3 STRAWBERRY FLAVOR INTENSITY 0.002 0.049 0.723 54 10.1 14.1 26.9 3.9 108 10 1 STRAWBERRY FLAVOR INTENSITY 0.002 0.048 0.729 54 1.5 2.6 26.9 3.9 140 11 4 STRAWBERRY FLA VOR INTENSITY 0.002 0.048 0.729 54 11.1 8.6 26.9 3.9 FORCE STRAWBERRY FLAVOR INTENSITY 0.002 0.048 0.730 54 0.6 0.2 26.9 3.9 111 27 3 STRAWBERRY FLAVOR INTENSITY 0.002 0.045 0.744 54 45.5 94.6 26.9 3.9 2497 18 9 STRAWBERRY FLAVOR INTENSITY 0.002 0.045 0.746 54 24.9 21.5 26.9 3.9 624 41 9 STRAWBERRY FLAVOR INTENSITY 0.002 0.045 0.748 54 18.9 18.1 26.9 3.9 96 04 8 STRAWBERRY FLAVOR INTENSITY 0.002 0.040 0.776 54 3.1 8.0 26.9 3.9 109 60 4 STRAWBERRY FLAVOR INTENSITY 0.001 0.037 0.792 54 3.8 2.7 26.9 3 .9 L* ext STRAWBERRY FLAVOR INTENSITY 0.001 0.034 0.809 54 33.6 2.6 26.9 3.9 123 92 2 STRAWBERRY FLAVOR INTENSITY 0.001 0.032 0.819 54 23.0 21.5 26.9 3.9 55514 48 2 STRAWBERRY FLAVOR INTENSITY 0.000 0.020 0.884 54 0.5 0.5 26.9 3.9 MALIC ACID STRAWBERR Y FLAVOR INTENSITY 0.000 0.015 0.914 54 212.4 51.6 26.9 3.9 928 95 0 STRAWBERRY FLAVOR INTENSITY 0.000 0.010 0.943 54 66.8 61.7 26.9 3.9 103 09 3 STRAWBERRY FLAVOR INTENSITY 0.000 0.006 0.968 54 3.0 1.1 26.9 3.9 1576 95 0 STRAWBERRY FLAVOR INTENSITY 0. 000 0.003 0.983 54 2.1 2.0 26.9 3.9 Note: Regression of chemical and physical measures of fruit (X) and panel responses (Y). Coefficient of determination (R 2 ), correlation coefficient, p value, sample size (n), mean and standard deviation of X and Y deri ved from bivariate fit in JMP 8.

PAGE 95

95 Table 2 5. Multiple regression for identification of sweetness enhancing volatiles. CAS # FRUCTOSE t RATIO FRUCTOSE p VALUE SUCROSE t RATIO SUCROSE p VALUE GLUCOSE t RATIO GLUCOSE p VALUE 1629 58 9 5.097 0 2.41 0.02 4.696 0 1576 87 0 4.566 0 1.024 0.311 4.301 0 1576 86 9 4.16 0 0.935 0.354 3.915 0 2305 05 7 3.933 0 2.784 0.008 3.549 0.001 3913 81 3 3.694 0.001 1.411 0.164 3.494 0.001 124 19 6 3.696 0.001 0.226 0.822 3.4 02 0.001 6728 26 3 3.349 0.002 0.816 0.418 3.314 0.002 591 78 6 2.807 0.007 0.767 0.447 2.788 0.007 5881 17 4 2.894 0.006 0.608 0.546 2.662 0.01 540 18 1 2.71 0.009 2.292 0.026 2.515 0.015 2639 63 6 2.865 0.006 2.892 0.006 2.512 0.015 105 54 4 2.533 0.014 0.034 0.973 2.493 0.016 564 94 3 2.588 0.013 1.322 0.192 2.455 0.018 111 71 7 2.599 0.012 1.342 0.186 2.283 0.027 4077 47 8 2.414 0.019 0.299 0.766 2.185 0.034 110 93 0 2.527 0. 015 1.43 0.159 2.165 0.035 638 11 9 2.311 0.025 1.256 0.215 2.14 0.037 142 92 7 2.346 0.023 2.943 0.005 2.096 0.041 60415 61 4 2.309 0.025 2.119 0.039 2.062 0.044 116 53 0 2.01 0.05 0.286 0.776 2.035 0.047 123 86 4 2.179 0.034 1.147 0.257 2.008 0.05 7452 79 1 1.959 0.056 0.785 0.436 1.993 0.052 109 21 7 2.181 0.034 1.65 0.105 1.961 0.055 109 19 3 2.005 0.05 1.662 0.103 1.954 0.056 616 25 1 1.773 0.082 0.795 0.43 1.628 0.11 5454 0 9 1 1.804 0.077 2.085 0.042 1.579 0.12 96 22 0 1.82 0.075 0.912 0.366 1.576 0.121 5989 33 3 1.869 0.067 1.953 0.056 1.561 0.125 2548 87 0 1.76 0.084 0.067 0.947 1.509 0.138 623 42 7 1.455 0.152 0.419 0.677 1.452 0.153 29674 4 7 3 1.339 0.187 0.035 0.972 1.362 0.179 53398 83 7 1.482 0.144 2.556 0.014 1.283 0.205 40716 66 3 1.521 0.134 1 0.322 1.202 0.235 66 25 1 1.229 0.225 0.21 0.835 1.178 0.244 104 76 7 1.189 0.24 2.046 0.046 0.982 0.331 556 24 1 0.732 0.468 0.972 0.336 0.88 0.383 706 14 9 1.247 0.218 1.65 0.105 0.879 0.384 110 39 4 0.96 0.341 2.645 0.011 0.814 0.419 628 63 7 0.882 0.382 0.427 0.671 0.749 0.457 78 70 6 0.872 0.387 0.1 0.921 0.7 0.487 124 13 0 0.871 0.388 0.169 0.866 0.685 0.497 75 85 4 0.736 0.465 0.306 0.761 0.667 0.508 110 43 0 1.054 0.297 1.899 0.063 0.657 0.514 105 66 8 0.88 0.383 2.421 0.019 0.638 0.526 623 43 8 0.248 0.805 1.396 0.169 0.54 0.592 1534 08 3 0.488 0.628 1.035 0.305 0.429 0.67 71 41 0 0.448 0.656 1.938 0.058 0.296 0.769 10522 34 6 0.536 0.594 2.049 0.046 0.288 0.775 112 14 1 0.413 0.681 2.292 0.026 0.284 0.777 4887 30 3 0.392 0.697 2.71 0.009 0.254 0.801 7786 58 5 0. 362 0.718 2.027 0.048 0.227 0.821 103 09 3 0.172 0.864 1.053 0.297 0.21 0.835 134 20 3 0.009 0.993 1.386 0.172 0.2 0.842 15111 96 3 0.23 0.819 0.927 0.358 0.192 0.849 110 38 3 0.281 0.78 2.621 0.012 0.055 0.956 96 04 8 0.1 42 0.887 0.646 0.521 0.002 0.998 123 66 0 0.066 0.948 1.064 0.292 0.001 0.999 2311 46 8 0.238 0.813 2.211 0.032 0.058 0.954 29811 50 5 0.016 0.987 0.358 0.722 0.098 0.922 1576 95 0 0.186 0.853 0.304 0.762 0.231 0.819 2 497 18 9 0.313 0.756 0.056 0.955 0.331 0.742

PAGE 96

96 Table 2 5. Continued. CAS # FRUCTOSE t RATIO FRUCTOSE p VALUE SUCROSE t RATIO SUCROSE p VALUE GLUCOSE t RATIO GLUCOSE p VALUE 20664 46 4 0.17 0.865 1.383 0.173 0.395 0.694 624 24 8 0. 406 0.686 0.662 0.511 0.416 0.679 589 38 8 0.217 0.829 0.592 0.557 0.427 0.671 109 60 4 0.491 0.626 0.224 0.823 0.454 0.652 821 55 6 0.267 0.791 1.192 0.239 0.467 0.642 624 41 9 0.433 0.667 1.323 0.192 0.494 0.624 1 40 11 4 0.361 0.72 1.357 0.181 0.513 0.61 1191 16 8 0.581 0.564 2.268 0.028 0.529 0.599 106 70 7 0.321 0.75 0.802 0.426 0.531 0.598 110 62 3 0.572 0.57 0.997 0.323 0.568 0.573 105 37 3 0.623 0.536 1.964 0.055 0.674 0.503 55514 48 2 0.644 0.523 0.889 0.378 0.675 0.502 123 92 2 0.725 0.472 0.108 0.914 0.771 0.444 539 82 2 0.48 0.633 2.273 0.027 0.802 0.426 2432 51 1 0.956 0.344 2.033 0.047 1.092 0.28 128 37 0 0.856 0.396 0.482 0. 632 1.17 0.247 111 27 3 1.253 0.216 0.542 0.59 1.481 0.145 928 95 0 1.842 0.071 0.516 0.608 1.521 0.134 108 10 1 2.185 0.034 0.898 0.374 2.138 0.037 106 32 1 1.436 0.157 0.193 0.848 2.36 0.022 Note: Individual vola tile compound concentrations are regressed against perceived sweetness intensity independent of effect from glucose, fructose, or sucrose, separately. Thirty compounds (asterisk) were found to enhance intensity of sweetness independent of at least one of t h e three sugars. Six compounds were found to Analysis conducted

PAGE 97

97 Table 2 6. Index of CAS registry number, chemical name, and formul a. CAS Registry Number Chemical Name Formula 75 85 4 2 Butanol, 2 methyl C 5 H 12 O 616 25 1 1 Penten 3 ol C 5 H 10 O 1629 58 9 1 Penten 3 one C 5 H 8 O 96 22 0 3 Pentanone C 5 H 10 O 110 62 3 Pentanal C 5 H 10 O 1534 08 3 Ethanethioic acid, S methyl ester ( 9CI) C 3 H 6 O S 105 37 3 Propanoic acid, ethyl ester C 5 H 10 O 2 109 60 4 Acetic acid, propyl ester C 5 H 10 O 2 623 42 7 Butanoic acid, methyl ester C 5 H 10 O 2 591 78 6 2 Hexanone C 6 H 12 O 108 10 1 2 Pentanone, 4 methyl C 6 H 12 O 1576 87 0 2 Pentenal, (2 E ) C 5 H 8 O 1576 86 9 2 Pentenal, (2 Z ) C 5 H 8 O 623 43 8 2 Butenoic acid, methyl ester, (2 E ) C 5 H 8 O 2 71 41 0 1 Pentanol C 5 H 12 O 1576 95 0 2 Penten 1 ol, (2 Z ) C 5 H 10 O 556 24 1 Butanoic acid, 3 methyl methyl ester C 6 H 12 O 2 589 38 8 3 Hexanone C 6 H 12 O 105 54 4 Butanoic acid, ethyl ester C 6 H 12 O 2 66 25 1 Hexanal C 6 H 12 O 123 86 4 Acetic acid, butyl ester C 6 H 12 O 2 624 24 8 Pentanoic acid, methyl ester C 6 H 12 O 2 29674 47 3 Butanoic acid, 2 hydroxy methyl ester C 5 H 10 O 3 96 04 8 2,3 Heptaned ione C 7 H 12 O 2 638 11 9 Butanoic acid, 1 methylethyl ester C 7 H 14 O 2 116 53 0 Butanoic acid, 2 methyl C 5 H 10 O 2 7452 79 1 Butanoic acid, 2 methyl ethyl ester C 7 H 14 O 2 6728 26 3 2 Hexenal, (2 E ) C 6 H 10 O 928 95 0 2 Hexen 1 ol, (2 E ) C 6 H 12 O 111 2 7 3 Heptanal C 7 H 14 O 123 92 2 1 Butanol, 3 methyl 1 acetate C 7 H 14 O 2 624 41 9 1 Butanol, 2 methyl 1 acetate C 7 H 14 O 2 110 43 0 2 Heptanone C 7 H 14 O 2432 51 1 Butanethioic acid, S methyl ester C 5 H 10 O S 105 66 8 Butanoic acid, propyl ester C 7 H 1 4 O 2 539 82 2 Pentanoic acid, ethyl ester C 7 H 14 O 2 111 71 7 1 Hexanol C 6 H 14 O 628 63 7 Acetic acid, pentyl ester C 7 H 14 O 2 1191 16 8 2 Buten 1 ol, 3 methyl 1 acetate C 7 H 12 O 2 106 70 7 Hexanoic acid, methyl ester C 7 H 14 O 2 55514 48 2 2 Butenoic a cid, 2 methyl ethyl ester C 7 H 12 O 2 110 93 0 5 Hepten 2 one, 6 methyl C 8 H 14 O 109 21 7 Butanoic acid, butyl ester C 8 H 16 O 2 123 66 0 Hexanoic acid, ethyl ester C 8 H 16 O 2 124 13 0 Octanal C 8 H 16 O 142 92 7 Acetic acid, hexyl ester C 8 H 16 O 2 2497 1 8 9 2 Hexen 1 ol, 1 acetate, (2 E ) C 8 H 14 O 2 60415 61 4 Butanoic acid, 1 methylbutyl ester C 9 H 18 O 2 104 76 7 1 Hexanol, 2 ethyl C 8 H 18 O 2311 46 8 Hexanoic acid, 1 methylethyl ester C 9 H 18 O 2

PAGE 98

98 Table 2 6. Continued. CAS Registry Number Chemical Name Formula 109 19 3 Butanoic acid, 3 methyl butyl ester C 9 H 18 O 2 2548 87 0 2 Octenal, (2 E ) C 8 H 14 O 540 18 1 Butanoic acid, pentyl ester C 9 H 18 O 2 4077 47 8 3(2 H ) Furanone, 4 methoxy 2,5 dimethyl C 7 H 10 O 3 20664 46 4 2 Octenal, (2 Z ) C 8 H 14 O 821 5 5 6 2 Nonanone C 9 H 18 O 5989 33 3 2 Furanmethanol, 5 ethenyltetrahydro trimethyl (2 R ,5 S ) rel C 10 H 18 O 2 78 70 6 1,6 Octadien 3 ol, 3,7 dimethyl C 10 H 18 O 124 19 6 Nonanal C 9 H 18 O 103 09 3 Acetic acid, 2 ethylhexyl ester C 10 H 20 O 2 140 11 4 Acetic acid, phenylmethyl ester C 9 H 10 O 2 2639 63 6 Butanoic acid, hexyl ester C 10 H 20 O 2 53398 83 7 Butanoic acid, (2 E ) 2 hexen 1 yl ester C 10 H 18 O 2 106 32 1 Octanoic acid, ethyl ester C 10 H 20 O 2 112 14 1 Acetic acid, octyl ester C 10 H 20 O 2 564 94 3 Bicyclo[3.1.1]hept 2 ene 2 carboxaldehyde, 6,6 dimethyl C 10 H 14 O 3913 81 3 2 Decenal, (2 E ) C 10 H 18 O 134 20 3 Benzoic acid, 2 amino methyl ester C 8 H 9 N O 2 110 39 4 Butanoic acid, octyl ester C 12 H 24 O 2 110 38 3 Decanoic acid, ethyl ester C 12 H 24 O 2 29811 50 5 Butanoic acid, 2 methyl octyl ester C 13 H 26 O 2 7786 58 5 Butanoic acid, 3 methyl octyl ester C 13 H 26 O 2 15111 96 3 1 Cyclohexene 1 methanol, 4 (1 methylethenyl) 1 acetate C 12 H 18 O 2 706 14 9 2(3 H ) Furanone, 5 hexyldihydro C 10 H 18 O 2 10522 34 6 Propanoic acid, 2 methyl nonyl ester C 13 H 26 O 2 5881 17 4 Octane, 3 ethyl C 10 H 22 128 37 0 Phenol, 2,6 bis(1,1 dimethylethyl) 4 methyl C 15 H 24 O 40716 66 3 1,6,10 Dodecatrien 3 ol, 3,7,11 trimethyl (6 E ) C 15 H 26 O 4887 30 3 Hexanoi c acid, octyl ester C 14 H 28 O 2 5454 09 1 Butanoic acid, decyl ester C 14 H 28 O 2 2305 05 7 2(3 H ) Furanone, dihydro 5 octyl C 12 H 22 O 2 Note: Chemical Abstract Services (CAS) registry numbers were used to query SciFinder substances database for associated chemical name and molecular formula. Listed in order of increasing retention time.

PAGE 99

99

PAGE 100

100 Figure 2 1. Cluster analysis of strawberry samples and quantified metabolites. Two way Ward cluster analysis of strawberry samples (diagonal bottom) and quantified sin gle metabolites (right) with overall liking score of sample (top) constructed using JMP 8. Standardization of metabolite concentration is by row mean and standard deviation, with high values represented as red, average as green, and low as blue. The hierar chy and distance of segments within the vertical dendrogram indicates relatedness of concentration across samples for single metabolites. Structure of the horizontal dendrogram indicates relatedness of all metabolite concentrations among individual samples

PAGE 101

101

PAGE 102

102 Figure 2 2. Season Environmental Conditions. Daily maximum and minimum temperatures (A and B), daily average solar radiation (C and D), daily average relative humidity (E and F), and daily total rain fall (G and H) during the 2011 (A, C, E, and G) a nd 2012 (B, D, F, and H) seasons. Data for Balm, FL obtained from Florida Automated Weather Network ( http://fawn.ifas.ufl.edu ). Data spans three weeks prior to first harvest through last harvest of each season with individual harvests indicated by dotted vertical line and harvest week number. Dashed horizontal lines represent means of environmental measures. Solid lines are the bivariate fit of environmental measure across season. Coefficients of determination (R 2 ) a nd p value of fit is listed above individual scatterplots and are calculated using bivariate fit in J MP.

PAGE 103

103 Figure 2 3 Individual sugars and total volatiles regressed against season progression. Regressi on of sucrose (A), glucose (B), fructose (C), and total volatiles (D) by harvest week during the seasons. Total volatile concentration is regressed against sucrose (E) and fructose (F). Sucrose (A) and total volatiles (D) demonstrate a significant negative fit to harvest week, unlike glucose (B) and fruc tose (C). A strong relati onship between total volatile e mission and sucrose concentration is found (E) that is not observed between total volatiles and glucose (data not shown) and fructose (F). Coefficient of determination (R 2 ) and p value of fit is liste d above individual scatterplots and is calculated using bivariate fit in JMP 8. Dashed line represents mean of independent variable, solid line represents linear fit, dashed/dotted ellipse indicates 95% confidence range of data, and asterisk denotes signi

PAGE 104

104

PAGE 105

105 Figure 2 4 Regression of hedonic and sensory measures to physical and chemical fruit attributes. Hedonic overall liking is regressed against hedonic texture liking (A), sweetness intensity (B), sourness intensity (C), and stra wberry flavor intensity (D). Overall liking is fitted to harvest week (E), total sugars (F), titratable acidity (G), and total volatiles (H). Texture liking is examined against puncture force (I) and harvest week (J), and forces is examined against harvest week (K). Sweetness intensity is regressed against total sugars (L), sucrose (M), glucose (N), and total volatiles (O). Intensity of sourness is fitted to titratable acidity (P), malic acid (Q), citric acid (R), and total sugars (S). Strawberry flavor int ensity is regressed by total volatiles (T) and select single volatile compounds 1576 87 0 (U), 623 42 7 (V), and 110 62 3 (W).Coefficient of determination (R 2 ) and p value of fit is listed above individual scatterplots and is calculated using bivariate fit in JMP 8. Dashed line represents mean of independent variable, solid line represents linear fit, dashed/dotted ellipse indicates 95% confidence range of data, and asterisk denotes significant fit

PAGE 106

106

PAGE 107

107 Figure 2 5. Volatile Chemical Structure. Chemical structure of volatile compounds quantified in strawberry. Sorted by increasing retention time (left to right, top row to bottom row) and identified by CAS #.

PAGE 108

108 CHAPTER 3 ENGINEERING OF THE AROMA FLAVOR VOLATILE METHYL ANTHRANILATE IN PETUNIA AND STRAWBERRY Background Methyl anthranilate is a distinguishing constituent of volatile mixtures emitted or synthesized by diverse plant species. Emission of methyl anthranilate originates in multiple plant structures, often alluding to the biological role within that plant species. The biosynthesis in reproductive structures is well known, as methyl anthranilate is a characteristic component of the headspace of Citrus and jasmine flower ( Jasminum s a m b ac ) (Edris et al. 2008; Najman, 1993) Vitis labrusca ) (Massa et al. 2008) wild strawberry ( F. vesca ) (Ulrich et al. 1997) Its effectiveness as a bee attractant facilitates pollination in floral structures (Najman, 1993) while its potential antimicrobial and antifungal capacities in essential oil of Retama raetam suggest a role in promoting survivability of flowers and fruits (Edziri et al. 2010) Emission from developing fruit may prevent premature foraging as methyl anthranilate is a potent irritant to starlings ( Sturnus vulgaris ) and is avoided whether in air or water (Stevens and Clark, 1998) The leaves of Zea mays are known to emit methyl anthranilate upon herbivory (Turlings and Benrey, 1998) and it is shown to be an indirect defense mechanism for attraction of parasitic w asps that require specific herbivores for oviposition (Turlings et al. 2005) With respect to humans, flowers and fruits possessing methyl anthranilate are regarded as having favorable aromas and flavors. Also, it was use d as one of the first artificial flavors. As with most plant volatiles, methyl anthranilate presents a means for the plant to interact with other biological entities through chemical emission and sensory mecha nisms

PAGE 109

109 Methyl anthranilate constitutes nine percent of volatile content in the juice of Vitis labrusca ). This dominance makes these grapes one of the richest biological sources of met hyl anthranilate. A cyltransferase activity capable o f p roducing methyl anthranilate was identified in crude protein extracts of ripe grape mesocarp ( Figure 3 1 ). This activity wa s dependent upon precursor anthaniloyl CoA and methanol Accumulation of anthranilic acid and methyl anthranilate peaked at approxima tely 40 M as grapes reached full maturity and the c oncentration of methanol also increas e d during the ripening of grape furt her supporting this biosynthesic mechanism (Wang and De Luca, 2005) Purified protein of ANTHRANILOYL CoA:METHANOL ACYLTRANSFERASE (VlAM AT) was digested, sequenced and the transcript subsequently cloned (Wang and De Luca, 2005) Characterization of recombinant and native protein indicates a higher affinity and catalytic rate of VlAMAT for anthraniloyl CoA and m ethanol than structurally similar ben zoyl CoA and benzyl alcohol. H owever the greatest in vitro activity of recombinant protein is with anthraniloyl CoA and benzyl alcohol as substrates and relatively small amounts of benzyl alcohol is present in grape. V lAMAT transcript abundance increases with the progression of ripening as does anthranilic acid, VlAMAT prot ein activity and thus methyl anthranilate in Concord grape varieties. Conversely, in Vitis vinifera penultimate precursor, protein, and product a re not detectable (Wang and De Luca, 2005) T his first instance of tissue specific methyl anthranilate biosynthesis i s due to a ripening paradigm and enzymatic specificity of VlAMAT. As a result, biosynthesis results in a significant concentration of methyl anthranilate, contributing to

PAGE 110

110 A second instance of tissue specific methyl anthran ilate biosynthesis is induced in herbivory damaged leaves of Zea mays (Koellner et al. 2010) Three paralogs of ANTHRANILIC ACID MET HYL TRANSFERASE ( Z m AAMT ) were cloned. W ithin thirty minutes following Spodoptera larvae herbivory jasmonic acid signaling up regulate d ZmAAMT1 .1 and ZmAAMT3 M ethyl anthranil ate is detectable in the leaves after 30 minutes but emission from the tissue does not occur until two hours after feeding. Crude protein e xtract from herbivory damaged leaves, but not control leaves, is capable of producing methyl anthranilate. The extract exhibits a m ethyl transferase activity that is highest with S adenosyl methion ine and anthranilic acid for the synthesis of methyl anthra nilate ( Figure 3 1) Crude extracts confirm biosynthesis of methyl anthranilate is in response to herbivory. However, that alone does not distinguish which of the two upregulated paralogs is responsible for the majority of m ethyl anthranilate biosynthesis. R ecombinant protein s of ZmAAMT1.1, 1.2, 2, and 3 show the highest relative activity with anthranilic acid B enzoic acid as substrate reaches a quarter of anthranilic acid activity fo r ZmAAMT3 while ZmAAMT1.1 has only three percent relative activity Foll owing h erbivory anthranilic acid increases by 12 fold to a conc entration of 0.12 nmol 1 gFW 1 A K m of over 2 mM for anthranilic acid is limiting to the ZmAAMT3 ra te of reaction and excludes it as the major contributor to induced methyl anthranilate produc tion. The 641 M K m of ZmAAMT1.1 is at least three orders of magnitude greater than the whole leaf anthranilic acid levels (Koellner et al. 2010) which is not optimal. Anthranilic acid is an intermediate of tryptophan biosynthesis, which occurs in the chloroplast. S ubcellular compartmentalization of anthranilic acid pr oduced by ANTHRANILATE SYNTHASE, which is localized to the chloroplast (Bohlmann et al.

PAGE 111

111 1996) can provide the enrich ed environment necessary for efficient methyl anthranilate bi osynthesis. Col ocalization of protein and substrate is one means of ensuring enzymatic specificity in vivo Another mechanism of specificity is derived from the protein structure as it can be exclusive to certain substrates. Comparison of homologs in Zea mays and other species as well as site directed mutagenesis indicates substrate specificity for anthranilic acid over salicylic acid is conferred by tyrosine 246 (Tyr 246 to Trp), while benzoic acid is excluded by glutamine 167 (Gln 167 to His) (Koellner et al. 2010) Two specific amino acid residues result in highly specific activity of ZmAAMT1.1 for anthranilic acid compared to benzoic acid or sal ic y lic acid which is preferred by other membe rs of the SABATH gene family (Koo et al. 2007) Methyl anthranilate is absent from a vast majority of commercial cultivars of strawberry Comparison of whole fruit and GC olfactometry of methyl anthranilate containing F. vesca to deficient F. x ananassa imparte like orthonasal and retronasal characteristic (Ulrich et al. 2007) The sole transgenic ef fort to alter strawberry aroma in literature focused on an endogenous O METHYLTRANSFERASE responsible for S adenosyl methionine dependent methylation of 3(2 H ) furanone, 4 hydroxy 2,5 dimethyl to DMF (Lunkenbein et al. 2006) Up and down regulation of volatile synthesis is observed using sense and antisense constructs of O METHYLTRANSFERASE This work attempts to introduce methyl anthranilate into the deficient, yet commercially viable cultivar ZmAAMT1.1 Over expression of tomato ( Solanum lycopersicum ) PHENYLACETALDEHYDE REDUCTASE in Petunia x hybrid a

PAGE 112

112 increased 2 phenylethanol floral emission by ten fold (Tieman et al. 2007) For this reason, ZmAAMT1.1 is also transformed into petunia as an established pipeline for efficiently generating and analyzing altered volatile phenotypes exist s The methyl transferase of Zea mays is preferred over alcohol acyltranserase mecha nism of Vitis labrusca mainly for its direct methylation of the primary metabolite anthranilic acid, while the ZmAAMT1.1 paralog is selected due to its high er specificity. Results Methyl Anthranilate C ontent among Fragaria In order to understand the exte nt of genetic variability for methyl anthranilate synthesi s in Fragaria methyl anthranilate had to be identified using a GC coupled to an electron impact mass spectrometer (GC MS). Fragaria volatile collection sa mples were run on the GC MS followed by a di lution of analytical standard methyl anthranilate. Mass spectra corresponding to the retention time of the analytical standard from Fragaria samples were compared to one another, methyl anthranilate standard, and National Institute of Standards and Technol ogy (NIST) mass reference spectra ( Figure 3 2). NIST reference (Figure 3 2.A), methyl anthranilate standard ( Figure 3 2.B), and F. vesca ed characteristic ions 119, 151, 92, and 65 in decreasing relative abun dance. However, none of these particular ions were detected in F. x ananassa The content of methyl anthranilate was quantified in 17 cultivars of four Fragaria species using GC FID to ascertain the biological variation : nine dipl oid F. vesca cultivars, two hexaploid F moschata, one octoploid F virginiana, and five octoploid F x ananassa ( Figure 3 3 ) The mean content of each cultivar was from a minimum of five biological replicat e s from at least two harvest dates.

PAGE 113

113 Within F. ves ca there were eight cultivars with an average content of less than 10 ng 1 gFW 1 hr 1 1 gFW 1 hr 1 had a mean methyl anthranilate emission of 28.77 ng 1 gFW 1 hr 1 bu t large variance of the mean was due to phenotypic variation from harvest to harvest. F. moschata, a hexaploid species, exhibit ed the highest mean methyl anthranilate emission quantified in this study a t 52.62 and 38.64 ng 1 gFW 1 hr 1 respectively. The volatile emission from was nearly two fold greater than the highest F. vesca accession F. virginiana was one of the progenitor species to modern F. x ananassa and the F. virginiana did not produce any detectable amounts of methyl anthranilate. The same was observed for four of five F. x ananassa the only octoploid in which methyl anthranilate was detected However, it was not detectable at all points within a season and therefore had the lowest mean content of the twelve cultivars in which methyl anthranilate was measured. A range of methyl anthranilate emission was observed across Fragaria accession with a strong correlation to species. Reliable and appreciable emission in diploid and hexaploid material is for all practical purposes isolated from introgression into octoploid due to genetic architecture. ZmAAMT1.1 Expression Analysis in Transgenic Plants Overexpression construct and plant transformation The coding sequence (CDS) of Zea mays ANTHRANILIC ACID MET HYL TRANSFER ASE 1.1 ( ZmAAMT1.1 ) was cloned into a Gateway entry vector, pDONR222, and subsequently recombined with a destination vector, pHK DEST OE, which generated a binary plant e xpression vector, pEXP ZmAAMT1.1 ( Figure 3 4 ) for transformation of P. x hybrid a F. x ananassa awberry

PAGE 114

114 ZmAAMT1.1 CDS is under the control of figwort mosaic virus 34S (pFMV 34S ) promoter and Agrobacterium N OPALINE SYNTHASE ). Also within the transfer DNA bord ers of the binary vector is the NEOMYCIN PHOSPOTRANSFERASE II ( NPTII ) CDS which confers kanamycin resistance in transformed plants. Following transformation with pEXP ZmAAMT1.1 itchell were regenerated in the presence of kanamycin. Petunia e xpression a nalysis To determine penetrance of the ZmAAMT1.1 step semi quantitati ve reverse transcription polymerase chain reaction ( sqRT PCR ) was used to first generate g ene specific complimentary DNA from isolated total RNA of each T0 line which was then amplified in the same reaction Visualization of ZmAAMT1.1 sqRT PCR products aft er thirty cycles of amplification allow ed for distinguishing differences in transcript abundance among transgenic lines. Thirty eight lines were screened for sqRT PCR transcript abundance of ZmAAMT1.1 and scored by comparing electrophoresis band intensity among one another and referencing sqRT PCR of endogenous 18S a consistent control for RNA loading ( Figure 3 5) All but three lines exhibited expression of ZmAAMT1.1 ( transgenic lines13, 23, and 38 ) while three lines exhibited very low, three low, twelve average, nine high, and eight very high relative expression. A ZmAAMT1.1 sqRT PCR product was not visible in the transgenic background P x hybrid a the specificity for amplification of the transgene. Six transgenic lin es were chosen for quantitative real time PCR (qRT PCR) to measure relative transcript based off initial semi quantitative results ( Figure 3 6 )

PAGE 115

115 ZmAAMT1.1 transcript was quantified relative to PhFBP7 using comparative Ct method The greatest expression was found in line 1 and 45, while 7, 13, 16, and 38 exhibit ed moderate expression, and as expected no amplification was detected in wild type Strawberry e xpression a nalysis Transcript abundance was also determined in pEXP ZmAAMT1.1 transfo rmed F. x ananassa sqRT PCR loading control sqRT PCR of endogenous 18S exhibits modest variability from sample to sample and was taken into account when scoring ZmAAMT1.1 expression ( Figure 3 9 ) Two transgenic lines were scored as very low expression, four lines as low, ten as moderate, four as high, and three as very high. The highest expression was likely found in ZmAAMT1.1 OE 3 and therefore the best candidate for emission of greatest amount methyl anthranilate. Purified pEXP ZmAAMT1.1 was used as a positive amplification control and exhibits very efficient amplification, while the negative amplification control water ddi not amplify, as expected. ZmAAMT 1.1 Volatile Analysis in Transgenic Pla nts Volatile compounds emitted from transgenic ZmAAMT 1.1 OE and non transgenic were collected and quantified to determine if methyl anthranilate phenotype was present. Mean methyl anthranilate content from two biologi cal replicates is depicted in Figure 3 7. No methyl anthranilate was s (5, 11, 13, 14, 44, and 45) using GC. Thirteen transgenic lines had detectable amount s less than 10 ng 1 gFW 1 hr 1 while four lines had methyl anthranilate content greater than 10 ng 1 gFW 1 hr 1 The highest content was found in ZmAAMT 1.1 OE 1 with a mean of

PAGE 116

116 41.98 ng 1 gFW 1 hr 1 GC MS analysis of ZmAAMT 1.1 and analytical standard confirmed introduction of a novel petunia volatile compound, methyl anthranilate, by presence of four predominant ions (119, 151, 92, and 65 determined from analytical standard and NIST) in transgenic lines, but not wild type ( F igure 3 8). to be accomplished. Regeneration of F. x ananassa longer than that of P. x hybrid a short day photo period flower summer. Volatile analysis of transgenic strawberry for presence of methyl anthranilate will be conducted as fruit makes itself available. Discussion T he emission of methyl anthranilate from various F. vesca and F. moschata accessions is confirmed using MS and analytical standards. Previously, F. moschata cv fold greater emission of methyl anthranilate than F. vesca ssp. v e sca f. alba (Ulrich et al. ) Similar results are observed with different F. vesca and F. moschata accessions used in this work. The highest level of methyl anthranilate emission from F. moschata in excess of 50 ng 1 gFW 1 hr 1 overshadows the majority of F. vesca approximately 5 10 ng 1 gFW 1 hr 1 The only octoploid accession to emit detectable levels of methyl anthranilate is F. x ananassa is undetected in four commercial cultivars. These results underscore the lack of potential impactful volatile compound in commercial mater ial, but the pervasive emission in lower ploidy m aterial justifies engineering efforts to understand methyl anthranilate effect on aroma and flavor of Petunia

PAGE 117

117 The overexpression of heterologous Z. mays ANTHRANILIC ACID METHYL TRANSFERASE is successful at introducing emission in to otherwise deficient P. x hybrid a he use of Agrobacterium for the generation of transgenic petunia is an effective method, especially when taking advantage of kanamycin resistance for positive selection during plantlet regenerati on (Jorgensen et al. 1996) This is evident in the fact that all but three T0 petunias had detecta ble levels of expression, while eight lines exhibited very high expression of ZmAAMT1.1 using sqRT PCR methods. Expression or unspecific amplification is not detected ll which validates the methods of the transgene transcript abundance assay. Greater resolution of transcript level is achieved using qPCR on a subset of transgenic lines. Lines 45 and 1 ha ve high semi quantitative levels and demonstrate approxima tely 20 and 30 fold greater expression respectively, than line 38, all of which is estimated to have low to average expression using semi s no expression. The much greater magnitude of expression in line 1 is otherwise under estimated if not for the qRT PCR methods. Despite detection of expression in 35 of 38 lines, the emission of methyl anthranilate i s only detectable in flowers from 18 of 24 lines analyzed. Exclusion of enzyme from substrate or li mitations in substrate flux can potentially account for this observed discrepancy. Estimated expression in these deficient lines is far from the highest and more often than not at the lowest end of detection. A caveat however is line 45 which exhibited se cond highest relative transcript abundance in q RT PCR analysis, but has no detectable levels of methyl anthranilate. Conversely line 1 demonstrate s the greatest level of methyl anthranilate emission, just under 30 ng 1 gFW 1 hr 1 and the

PAGE 118

118 greatest relative expression in q RT PCR. Lines 13 and 16 have similar expression levels; however 13 has no detectable methyl anthranilate while 16 emit s over 10 ng 1 gFW 1 hr 1 The efficiency of generating petunia with transgene expression is greater than actual detectable phenotype and relative expression level does not always coordinate with emission levels of methyl anthranilate. These discrepancies are quite common with petunia transgenics (David G. Clark, personal communication). Transcript and volatile screening of n umerous ZmAAMT1.1 found transgenic line 1 to have the greatest transcript and methyl anthranilate expression, successfully introducing a heterologous enzyme for the production of a novel volatile compound. After norm alizing f or mass, the headspace emission of flowers from thirteen lines of transgenic petunia is within the range of most F. vesca fruit assayed. Of special interest is t ransgenic petunia ZmAAMT1.1 OE 1 with emission measured at just under 30 ng 1 gFW 1 hr 1 This quantity is on par with F. vesca which emits roughly three fold more methyl anthranilate than the rest of F. vesca cultivars. Given the success in petunia, anticipation is high that the to be determined methyl anthranilate cont F. vesca in which the volatile is believed to impart favorable aroma and flavor (Ulrich et al. 2007) The transformation of strawberry is not as inherently simple as that of petunia, but can be an effective method when taking advantage of kanamycin resistance for positive selection during plantlet regeneration (Folta et al. 2006) A range in relative expression is observed in a ll regenera ted strawberry demonstrated expression of ZmAAMT1.1 using sqRT PCR The greatest expression is observed in line 3, while line

PAGE 119

119 5 has the lowest relative intensity. Observable discrepancies between transcript and volatile emission in petunia requires a volat alone high levels of emission. Successful engineering of methyl anthranilate biosynthesis likely requires appropriate targeting of Z mAAMT1.1 to subcellular compartment containing appropriate substrate, anth ranilic acid. Anthranilic acid is the direct product of ANTHRANILATE SYNTHASE which enzymatically cleaves a pyruvate moiety from chorismate (Bohlmann et al. 1996) an intermediate reaction of tryptophan biosynthesis The entirety of t his necessary pathway occurs exclusively in the chloroplast (Mano and Nemoto, 2012) therefore transgenes need to localize s there. Web based chloroplast transit peptide prediction of ZmAAMT1.1 using ChloroP gives a weak probability of 0.446 at amino acid residu e 56 (Emanuelsson et al. 1999) Also, a s mall N terminal helix from residue 24 to 47 is predicted by Predict Protein (Rost et al. 2004) and SWISS MODEL (Arnold et al. 2006) This is a characteristic motif for some chloroplast transit peptides (Bruce, 2000) however exact defining constitue nts are still poorly understood (Li and Chiu, 2010) The detection of methyl anthranilate in transgenic petunia and previously reported compartmentalization of tryptophan biosynthesis, including intermediate anthranilic acid suggests successful targeting of ZmAAMT1.1 to the plasti d Chemical supplier Material Safety Data Sheet lists physical properties of methyl anthranilate which are interesting given its role as an emitted volatile. An astonish ing low vapor pressure of 3.6 Pascal and a melting point of 24 C are not conducive to high volatility A lag of over an hour between detection in tissue versus headspace is

PAGE 120

120 observed in herbivory damaged Zea mays leaves (Koellner et al. 2010) perhaps requiring concentration t o build or requiring extra time for diffusion. The hypothesized chloroplast localized biosynthesis would require at a minimum the volatile compound to traverse three lipid bilayer membrane s Plastid formation occurs early in petunia corolla development, be fore degrading at anthesis, coinciding with maximum endogenous floral emission (Colquhoun et al. 2010b) possibly freeing otherwise membrane constrained methyl anthranilate. Headspace methyl anthranilate of petunia will contribute directly t o the floral fragrance perceived through orthonasal olfaction. Conversely, internal methyl anthranilate could potentially contribute to retronasal o lfaction detection while consuming strawberry fruit. Comparison of internal and emitted volatiles will provi de insights into the relationship between emitted and pooled methyl anthranilate which may influence orthonasal and retronasal olfaction perception. Petunia emission of methyl anthranilate at levels comparable to F. vesca is attained by over expression o f ZmAAMT1.1 successfully producing a previously unreported volatile in petunia and potentially altering floral fragrance. Previously, alteration of endogenous petunia volatiles greatly affected pollinator/herbivore interaction (Kessler et al. ) Introduction of a novel petunia floral volatile could have similar effects in nature, but human perception is of more immediate interest. The widespread presence of methyl anthranilate in flavoring and aroma of natural and synthetic products suggests a positive response to transgenic petunia would be observed in consumer fragrance panels These results are also promising for efforts to engineer methyl anthranilate the event of methyl anthranilate phenotype multiple

PAGE 121

121 consequences are po ssible. The emission of methyl anthranilate may serve as an avian repellent, reducing loss of ripe fruit to birds. Also, the ability to attract parasitic wasps can alleviate herbivory pressure. In regards to postharvest, the presence of methyl anthranilate in fruit may result in less microbial and fungal gr owth leading to prolonged shelf life. The primary question however is whether flavor or aroma of methyl anthranilate, a sweet, floral component of F. vesca. Future Work Ultimately, it must be known if consumer perception is altered by the presence of methyl anthranilate in Seed of T1 ZmAAMT1.1 OE petunia will be sown, an individual of high emission selected, propagated, and grown out in a climate controlled glasshouse. Flowers will be harvested for a consumer panel triangle test to ascertain a difference and/or preference of petunia fragrance with or without methyl anthranilate, and to see if humans perceive t hem as positive. Screening of T0 ZmAAMT1.1 multiple lines with capabilities of producing methyl anthranilate. Once identified, the appropriate line will need to be propagated and grown out in climate cont rolled glasshouse for consumer flavor panels. Internal Review Board approval and consumer written consent for the consumption of transgenic material will be obtained. C onsumers will directly compare wild containing transgenic line to discern any perceptual differences in overall liking, sweetness intensity and flavor intensity.

PAGE 122

122 More fundamenta l work could involve crossing homozygous petunia lines of ZmAAMT1.1 OE x CHORISMATE MUTASE RNAi (CM) CHORISMATE MU TASE competes with ANTHRANILATE SYNTHASE for substrate, diverting it from tryptophan biosynthesis to phenylpropanoid biosynthesis (Colquhoun et al. 2010a) Hypothetically, increased flux through tryptophan biosynthesis will allow greater methyl anthranilate biosynthesis. M et abolite analysis will rely on aqueous supernatant from centrifuged flower tissue. Solid phase extraction will aid in sample pr eparation prior to analysis on high pressure liquid chroma tograph coupled to triple quadru pole MS Multiple reaction monitoring mo de will allow for quantification of MS/MS product ions, particularly of chorismate, anthranilic acid, methyl anthranilate, and tryptophan. Comparison of these ZmAAMT1.1 OE CM RNAi and ZmAAMT1.1 OE x CM RNAi coul d provide insights on metabolic flux at key nodes of aromatic amino acid synthesis in plants. Materials and Methods Plant Material Inbred P. x hybrid a M itchell D iploid plants were the wild type control and background for transformation in all petunia exper iments (Mitchell et al. 1980) while commercially available F. x ananassa was the wild type control a nd background for transformation of strawberry experiments. All petunia were grown in glass greenhouses (Dexter et al. 2007) Wild were grown in glass greenhouses and watere d daily with Verti Gro hydroponic fertilizer (0.6 grams per liter 8 12 32 with trace elements and 2% magnesium) and supplemented with calcium nitrate (0.3 g per liter 15 0 0). Material s of

PAGE 123

123 Figure 3 3 were grown in Citra FL according to current commercial practices for annual strawberry plasticulture in Florida (Whitaker et al 2011) (Santos et al. 2012) Generation of Transgenic ZmAAMT 1.1 Plants Overexpression construct A pUC57 vector containing the synthes ized CDS of ZmAAMT1.1 (Koellner et al. 2010) was ob tained from GenScript. Use of Gateway Cloning (Invitrogen) for the generation of entry vector requires a two step amplification scheme to incorporate recombination site adapters to CDS of ZmAAMT1.1 The first step used Phusion (Finnzymes) recombinant polymerase to amplif y the CDS with partial attB adapters ( forward primer AAAAAGCAGGCTTCATGCCG ATGAGAATCGAGCGTGAT and reverse primer 5 AGAAAGCTGGGTCTCACACA TGAATTATTGCTTTCTC ) The second amplification use d the first product as a template and completes the recombination sites using attB primers ( forward primer GGGGACAAGTTTGTACAAAAAAGCAGGC and 5 GGGGACCACTTTGTACAAGAAAGCT GGGT ). BP Clonase catalyze d a recombination reaction between polyethylene glycol purified attB PCR product and attP pDONR222 vector for site directed recombination of ZmAAMT1.1 CDS for lethal ccdB CDS to generate pENTR ZmAAMT1.1 Mach1 E. coli trans formation with BP Clonase reaction was selectively screen ed for NPTII containing pENTR ZmAAMT on LB agar plates containing kanamycin. Digestion and Sanger sequencing confirmed recombination and identity of ZmAAMT1.1 LR Clonase catalyzed recombination be tween attL containing pENTR ZmAAMT1.1 and attR contain pHK DEST OE for site directed recombination of ZmAAMT1.1 CDS for lethal ccdB CDS to generate pEXP ZmAAMT1.1

PAGE 124

124 The binary expression vector ultimately for plant transformation places ZmAAMT1.1 under the control of pFMV 34S (Richins et al. 1987) and nosT The r ecombination product was transformed into Mach1 E. coli ccdB lethality selected against unreacted pHK DEST OE and undesired recombination products, while streptomycin LB agar plates select ed for p EXP ZmAAMT1.1 OE which contains the aadA1 resistance gene. Colonies were qualified via digestion of both vector and insert of pEXP ZmAAMT1.1 as well as amplifying ac ross recombination site from pFMV 34S into ZmAAMT1.1 Plant transformation and regeneration Fifty independent p EXP ZmAAMT1.1 OE Mitchell Diploid petunia were generated using Agrobacterium mediated transformation of sterile leaf disc and subsequent plan tlet regeneration (Jo rgensen et al. 1996) Twenty five independent p EXP ZmAAMT1.1 OE were generated using Agrobacterium mediated transformation of sterilized leaf and petiole segments and subsequent plantlet regeneration (Folta et al. 2006) Kanamycin resistance conferred by presence of NPTII within T DNA of pEXP ZmAAMT1.1 al lows for initial screening of plantlets. T0 petunia were self pollinated to maintain transgenic events through seed daughter plants due to heter o zygosity of octoploid background RNA Isolation Petunia Developmental stage six petunia flower buds are tagged two days prior to harvest of stage eight fully expanded flowers (Colquhoun et al. 2010b) At 16:00 flowers were excised from the plant at the peduncle and frozen immediately in liquid nitrogen Whole flower was then ground in liquid nitrogen. Total RNA was extracted

PAGE 125

125 from approximately 500 mg of tissue according to Verdonk et al., (2003) and reconstituted in 50 l DEPC treated water. Residual DNA was digested with TURBO DNase (Ambion Inc.) and RNeasy Mini Spin Column (QIAGEN) removes carry over metabolites prior to downstream applications. Strawberry Young expanding leaf tissue was harvest ed at 16 :00 and frozen immediately in liquid nitrogen. Leaf tissue was then ground in liquid nitrogen. Total RNA was extracted from approximately 100 mg of tissue using 1 ml phenol extraction solution consisting of Tris pH 6.7 +/ 0.2 saturated phenol, 0.1% SDS (w/v), 0.32 M NaOAc, and 0.01M EDTA and 0.4 ml DEPC treated water (Ghawana et al. 2 011) Ten seconds of vortex was followed by 5 minute incubation, which was followed by the addition of 0.2 ml chloroform. Five seconds of vortex 5 minutes of incubation and centrifugation at 16,000 rcf allow ed for the separation of approximately 0.5 ml aqueous phase which was transferred to a new 1.5 ml E ppendorf tube. Nucleic acids were precipitated in 0.3 ml isopropanol and centrifuged for 5 minutes following 5 seconds of vortex and 10 minutes of incubation. Pellet was washed i n 70% ethanol, dried and reconstituted in 50 l DEPC treated water. TURBO DNase (Ambion Inc.) treatment digest ed residual DNA and RNeasy Mini Spin Column (QIAGEN) remove d carry over metabolites prior to downstream applications. E x pression Analysis Abundance of ZmAAMT1.1 transcrip t in all viable transgenic events of petunia and strawberry was estimated via sqRT PCR using One Step RT PCR kit (QIAGEN Co. ) with 50 ng total RNA ( ZmAAMT1.1 forward primer AGGCACCAGAGCAACTGAAG and reverse primer 5

PAGE 126

126 CACCAGACACGAGTTCCTCA ) P x hybrid a and F x ananassa 18 S were amplified ( Ph 18 S forward primer TTAGCAGGCTGAGGTCTCGT and 5 AGCGGATGTTGCTTTTAGGA ; Fa 18s ACCGTAGTAATTCTAGAGCT and 5 CCACTATCCTACCATCGAAA ) from all petunia and strawberry samples, re spectively, to visualize RNA loading concentration and to act as a positive control for reverse transcription and amplification. Sub saturation amplification of 18S wa s achieved at 22 and 18 cycles, while ZmAAMT1.1 requires 30 and 37 cycles for Petunia and Fragaria respectively. No template ( H 2 O) control s were used in all reactions. Products of sqRT PCR were analyzed under ultraviolet light following electrophoresis on 1% agarose gel with 0.5 ug 1 ml 1 ethidium bromide. Ct Quantitative qRT PCR was performed and analyzed using a time PCR system (Applied Biosystems, Foster City, CA). Power SYBR Green PCR (Applied Biosystems, Foster City, CA) was used to amplify and detect the products according to the m Gene specificity is confirmed through analysis of melt curve. Volatile Analysis Developmental stage 8 petunia flowers were excised at the peduncle at 18:00 for an immediate one hour volatile collection Each sample comprised of two flowers from a single line with at least two biological replicates of each line. Ripe glass greenhouse grown F. x ananassa were harvested at 16 :00 and then kept at 4C until 9:00 the following morning at which time they were prepared f or a two hour volatil e collection. Each sample comprised of 15 grams of quartered and diced berries from a single line with technical replicat ion as possible.

PAGE 127

127 Ripe field grown F vesca were harvest ed at 9:00 in Citra, FL and kept on ice for transport to Gainesville, FL for imm ediate two hour volatile collection. Each sample comprised of approximately 15 grams of whole fruit, 5 10 berries from a single genotype with two to three biological replicates per cultivar per harvest. Reported average volatile content was pooled from at least two harvests. Volatile collection apparatus was a dynamic headspace system in which e mitted volatiles are concentrated on HaySep 80 100 porous polymer adsorbent (Hayes Separations Inc.) (Underwood et al. 2005) a nd then eluted as described by Schmelz (Schmelz et al. 2003) Quantification of volatiles in an elution was performed on an Agilent 7890A Series G C (carrier gas; He at 3.99 mL min 1 ; splitless inj ector, temperature 220C, injection volume 2 l) equipped with a DB 5 column ((5% Phenyl) methylpolysiloxane, 30 m length 250 m i.d. 1 m film thickness; Agilent Technologies, Santa Cl ara, CA, USA). Oven temperature was programmed from 40C (0.5 min hold) at 5C min 1 to 250C (4 min hold). Signals were captured with a FID at 280C. Peaks from FID signal were integrated manually with Chemstation B.04.01 software (Agilent Technologies, Santa Clara, CA). Volatile emission s (ng 1 gFW 1 h 1 ) w ere calculat ed based on individual peak area relative to sample elution standard peak area. GC Mass Spectrometry (MS) analysis of elutions were performed on an Agilent 6890N GC in tandem with an Agilent 5975 MS (Agilent Technologies, Santa Clara, CA, USA) and retentio n times were compared with authentic standards (Sigma Aldrich, St Louis, MO, USA) for volatile identification (Schmelz et al. 2001)

PAGE 128

128 Statistical Analysis Histograms constructed in JMP 8.0 (SAS Institute Inc.) and depict mean volatile content per line /cultivar including standar d error bars.

PAGE 129

129 Figure 3 1. Alternative m ethyl anthranilate biosynthetic pathways in Zea mays and Vitis labrusca. ATP dependent ligation of CoA to anthranilic acid provid es substrate for Vitis labrusca ANTHRANILOYL CoA:METHANOL ACYLTRANSFERASE (VlAMAT) which catalyzes the methanol dependent acyl transfer to create methyl anthranilate. Conversely, Zea mays ANTHRANILIC ACID METHYL TRANSFERASE (ZmAAMT) directly synthesizes methyl anthranilate upon methyl donation by S adenosyl methionine. Chloroplast compa rtmentalized tryptophan biosynthesis is depicted for relation to primary metabolism.

PAGE 130

130 Figure 3 2. Identification of methyl anthranilate in Fragaria GC MS electron ionization spectra at retention time of 29.2 minutes for methyl anthranilate analytical s tandard (B), Fragaria vesca (C), and Fragaria x ananassa Presence of ions 119, 151, 92, and 65 (listed in decreasing relative abundance) in National Institu te of Standards and Technology m ass reference spectra (A) (C) confirms the presence of methyl anthranilate, however absence of ions in (D) indicates a lack of detectable productio n.

PAGE 131

131 Figure 3 3 Methyl anthranilate content among various lines of Fragaria species. Histograms depict average content and standard error of methyl anthranilate from at least five biological replicates across a minimum of two harvests. Diploid (2x) Frag aria vesca cultivars emit approximately 5 10 ng 1 gFW 1 h 1 , which emits 28.77 ng 1 gFW 1 h 1 In octoploid (8X) Fragaria x ananassa m ethyl anthranilate is only but not any commercially relevant m aterial. Emissions from both hexaploid (6x) Fragaria moschata cultivars are the highest measured fold higher content than most Fragaria vesca accessions assayed Analysis conducted in JMP.

PAGE 132

132 Figure 3 4 Binar y vector for stable transformation of petunia and strawberry with ZmAAMT1.1 T DNA r egion within left (LB) and right borders (RB) is stably integrated into host plants. Expression of NPTII confers resistance to kanamycin selection during plantlet regenerat ion and is regulated by Agrobacterium NOPALINE SYNTHASE (NOSt) Figwort mosaic virus 34S promoter (pFMV 34S ) and NOSt constitutively regulate transcription of ZmAAMT1.1 coding sequence. Protein translated from transcrip t will have enzymatic capability of synthesizing methyl anthranilate from anthranilic acid. Forward and reverse primers 1075 and 1076 are used in expression analysis of transgenic and wild type Petunia x hybrid a Fragaria x ananassa In silico vector constructed in VectorNTI.

PAGE 133

133 Figure 3 5. ZmAAMT1.1 transcript abundance in overexpressing Petunia x hybrida cv. Mitchell Diploid ZmAAMT1 .1 transcript abundance in total RNA of T0 stage eight flower t issue to determine high expressing lines. Expected product of 156bp reached sub saturation and differential amplification across T0 using a one step RT PCR at 3 0 cycles. The transformation plasmid, pEXP ZmAAMT1.1 is used for an amplification control and n o amplification Mitchell Diploid step RT PCR of 18S ribosomal RNA is used as a loading control for gene specific reaction. Lines 13, 23, and 38 had no observable expression while three lines exhibited very low three low, twelve average, nine high, and eight very high relative expression.

PAGE 134

134 Figure 3 6 ZmAAMT1.1 transcript abundance in overexpressing Petunia x hybrida cv. Mitchell Diploid Quantitative r eal t ime PCR was used determine relative abundance o f ZmAAMT1.1 transcript in over expressing lines method relative to line 38 Line 1 exhibits the greatest expression by far, followed by 45. Lines 7, 13, 16, and 38 demonstrate moderate expression, and wild xpress ZmAAMT1.1 (ND not detected) Results compiled using StepOne. ND ND

PAGE 135

135 Figure 3 7. Emission of methyl anthranilate from petunia flower s over expressing ZmAAMT1.1 Eluents of solid phase captured headspace of T0 ZmAAMT1.1 OE Petunia x hybrid a FID for quantification of volatile compounds. Methyl anthranilate, chromatograph signal at 30.54 minutes, is not detected in wild lines. A range of emission is quantified in various transg enic events, most notably ZmAAMT1.1 OE 1 with an emission of 29.5 ng 1 gFW 1 h 1 Means and standard errors calculated from two biological replicates of two flowers for each transgenic line and wild type using JMP 8

PAGE 136

136 Figure 3 8 Identification of methy l anthranilate in petunia flower over expressing ZmAAMT1.1 GC/MS electron ionization spectra at retention time of 29.2 minutes for methyl anthranilate analytical standard (B), Petunia x hybrid a cv. ZmAAMT1.1 OE 1 captured volatiles (C), and non 92, and 65 (listed in decreasing relative abundance) in National Institu te of Standards and Technology m ass reference spectra (A), analytical standard (B), and ZmAAMT 1.1 OE 1 (C) confirms the presence of methyl anthranilate, of detectable production.

PAGE 137

137 Figure 3 9 ZmAAMT1.1 transcript abundance in overexpressing Fragaria x ananassa Screening of ZmAAMT1 .1 transcript abundance in total RNA of T0 leaf tissue to determine high expressing lines. Expected product of 156bp reached sub saturat ion and differential amplification across T0 using a one step RT PCR at 37 cycles. The tran sformation plasmid, pEXP ZmAAMT1.1 is used for an amplification control and no amplification step RT PCR of 18S ribosomal RNA is used as a loading control for gene specific reaction. All li nes display at least minor amplification and highest estimated expression when taking into account 18S control is in line ZmAAMT1.1 OE 3.

PAGE 138

138 CHAPTER 4 EFFECT S OF ENHANCED LIGHT ENVIRONMENTS ON POSTHARVEST VOLATILE Backgroun d The development of plants and specific tissues is the result of an interaction among intrinsic genetic potentials and external environmental factors. A particularly important environmental factor to plant development is light. In fact, a suit of photorec eptors exist to sense and transduce information concerning light quality. Characterization of pathways in Arabidopsis describe how signals are transduced to ultimately influence numerous aspects of growth and development (Chen et al. 2004) The susceptibility of strawberry fruit development and ripening to environmental differences has become evident in regard to temperature in chapter 2 of this dissertation as well in other studies (MacKe nzie et al. 2011; Watson et al. 2002) The content of specific sugars and general SSC is sensitiv e to variations in temperature and can affect other metabolites including volatile compounds. Also, variation in light quantity and quality during developme nt has been shown to influence volatile content of ripe strawberry (Kasperbauer et al. 2001; Watson et al. 2002) Previous work in North Carolina comparing the effects of red and black plastic mulch on strawberry fruit indicates significant increases in 12 of 19 aroma compounds, likely due to increased red and far red light reflected to developing fruit (Kasperbauer et al. 2001) Red mulch work it weight and total yield compared to black reflective mulch (El Yazied and Mady, 2012) However, mixed results are observed in regard to yield at multiple locations within Florida using cv. (Locascio et al. 2005) The phenomena of volatile profiles changing in response to environmental conditions led to exploring the effect of narrow bandwidth

PAGE 139

139 postharvest light and in field selective reflective mulch to alt er volatile content in strawberry. Two pilot experiments were conducted to gain an understanding of the effects of light quality on strawberry volatile synthesis. The use of narrow bandwidth light in a postharvest system to alter volatile profiles of fruit s and flowers is explored in a published work with Postharvest Biology and Technology Light Modulation of Volatile Organic Compounds from Petunia Flowers and Select Fruits (Colquhoun et al. 2013) Also, an a pplication for patent (#61/794,406) has been submitted to the United States Patent and Trademark Office for technology associated with this work. Wit hin this work light treatments are shown to specifically change the content of individual volatiles but not all volatile s in strawberry. These specific instances and literature support encouraged development of a field scale application to alter light environmen t through the use of plastic mulches with different reflective properties. Results Postharvest Exposure to Narrow B and width Light Alters Strawberry Volatile Content Volatile emissions from strawberry f ruits contain a large array of compounds (Du et al. 2011a; Maarse, 1991) A focused subset of volatile compounds is presented here s ome of which contribute to strawberry sensory perception. These include : 2 hexn 1 ol, (2E) (928 95 0); hexanoic acid (142 62 1); butanoic acid, 1 methylethyl ester (638 11 9); and linalool (78 70 6). Mature strawberry fruit was har vested in the morning and chilled at 4 C overnight in dark conditions before being exposed to 8 hours of narrow bandwidth l ight of the blue, red, or far red spectrum ( Figure 4 2) as well as controls of white fluorescent light and darkness Volatile analysis immediately follow ed treatment to

PAGE 140

140 identify light conditions capable of altering content of specific volatiles. All forms of light, including white control, decreased the content of 2 h exen 1 ol, (2E) compared to dark ( Figure 4 2A). Far red light treatment selectively increased hexanoic acid ( Figure 4 2B) compared to all other treatments. Blue light decreased b utanoic acid, 1 methylethyl ester ( Figure 4 2C) while negligibly affected in other treatments. Certain compounds, such as linalool are not affected by light treatments ( Figure 4 2D). The effect of light treatments on these selected volatile compounds in Fragaria x. ana nassa cv. validates treatment specificity for altering volatile content. Red and Black Plastic Mulch Reflective light qualities from red and black mulch Light reflected from red and black plastic mulch was measured at 15 cm above rais reflected 8.5% more of direct photosynthetic active radiation (PAR, 400 700nm) back up to plant canopy than black mulch ( Table 4 1)( Figure 4 3A). The majority of this reflected radi ation difference was that of red light (600 700nm), but also a 7% gain in far red light (700 800nm) was observed to be reflected from red mulch ( Figure 4 3B). Therefore the ratio of red to far red light reflected from red mulch is nearly identical to direc t sunlight. Black mulch exhibited a variable difference of red: far red depending on age of mulch, but the reflected radiation was only 1 2% of direct sunlight ( Table 4 1)( Figure 4 3C). Therefore, increased radiation was observed over red mulch, but an enh anced spectrum in regard to the red to far red ratio was not observed.

PAGE 141

141 Strawberry volatile profiles are not consistently different between red and black mulch treatments Fruit was harvested from three replicated plots of both black and red mulch treatment s for simultaneous consumer panel and volatile analysis. Fruit was harvested in the morning and stored at 4C overnight in the dark. Seventy two volatile compounds panels ( Tab le 4 3). Significant differences in volatile content for nine compounds was determined for January 18 th 2013, while only three varied significantly on February 13 th 2013 One of the volatiles that varied between treatme nts in January, hexanoic acid was shown to be enhanced using postharvest far red light treatments. However, the field effect was not reproducible, as none of the three volatiles significantly different between mulch treatments in February overlapped with those from January. Therefore, it c an be concluded that red plastic mulch does not alter the volatile profile of suggested by literature. Consume rs do not distinguish or prefer strawberry from red or black plast ic mulch The morning following harvest and simultaneous to volatile collections approximately 100 panelists consumed and rated multiple berries from each treatment for overall liking, texture liking, sweetness intensity, sourness intensity, and strawberr y flavor intensity. The experiment was conducted on January 18 th and February 13 th of 2013. No statistically significant differences were determined for any consumer rated measures, except for sourness intensity in February ( Table 4 2). Mean sourness inten sity of 13.7 and 15.7 for black and red was determined to be statistically significant

PAGE 142

142 in sourness intensity it was found that red plastic mulch did not impart any difference to overall liking, sweetness intensity, or flavor intensity compared to black mulch as hypothesized. Discussion A v ariable response of volatile compounds to distinct light treatments is potentially a result of photoreceptor mediated regulation of expression, stability, or activity of enzymes required for volatile synthesis. Hexanoic acid was selectively increased by narrow bandwidth far red light compared to all other treatments. This is potentially due to a phytochrome mediated response. On the other hand, butanoic acid, 1 methlethyl ester is decreased by blue light. Therefore perception of blue light by an appropriate photoreceptor, such as cryptochrome, may down regulate production of this volatile. Butanoic acid, 1 methylethyl ester has been previously reported to be associated with flavor (Hakala et al. 2002) as well as linalool (Jetti et al. 2007; Olbricht et al. ; Ulrich et al. 1997) Both of which were found to have significant correlations to flavor intensity in the study conducted in chapter 2 of this dissertation. Knowing the amount of a flavor volati le can be preferentially altered presents the potential to test its effect in an otherwise unaltered whole fruit. Despite first hand experience of altering volatile profiles of various fruits and flowers, including strawberry, using postharvest light treat ments, a similar effect could not be reproducibly measured in a field scale application. Red plastic mulch does exhibit an enhanced reflective spectrum compared to black plastic mulch. The red to far red ratio reflected from red mulch is similar to that of direct sunlight; therefore the only difference is a negligible increase in PAR. No detectable or reproducible significant differences are observed in both consumer panels and volatile analysis.

PAGE 143

143 The effect of colored mulch on volatile content is possibly de pendent upon genetic background, as response differences to light quality and quantity are known in strawberry, particularly in flower induction (Hancock, 1999) Previously described Also, in that experiment significant gains in glucose, fructose, and sucrose were attributed to red mulch verse black mulch (Kasperbauer et al. 2001) However, in this Previous w ork in Egypt using cultivar red and black plastic mulch describes significant differences in numerous growth parameters including fruit weight and yield. Soluble solid content was not significantly affected by the mulch treatment in Egypt (El Yazied and Mady, 2012) The previous lack of influence on soluble solid content potentially explains no consistent differences in volatile content measured in this work, as volatile content has been correlated to SSC. Differences in location and season are also potentially explanatory for lack of consistent volatile differences or consumer perception differences. Strawberry production in Florida occurs during the winter months when solar radiation reaching the soil surface has the greatest pr oportion of red and far red light. This is due to a lower angle of incidence and thus greater atmosphere the radiation must travel through. Egypt and Flor ida sit at the same latitudes, which may account f or the lack of red mulch inducing greater volatile c ontent. North Carolina production occurs in late spring to early summer when the angle of incidence of sunlight is lower, thus a decreased amount of red and far red light reaches the soil surface. Red mulch reflects more red and far red light compared to b lack plastic mulch. Therefore, in a solar environment with less red

PAGE 144

144 and far red light, such as May in North Carolina compared to January in Florida, the enhancements by red mulch may elicit a more pronounced effect. The manner in which fruits were assayed for volatile differences in the previous work in North Carolina (Kasperbauer et al. 2001) and this study is potentially explanatory of differences in effects observed. Kasperbauer harvested fruit in the late afternoon, following a full day of exposure to sunlight. Also, the fruit was f rozen immediately for later volatile analysis. Conversely, this work in Florida followed an approach more relevant to commercial fresh strawberry. Fruit was harvested in the mornings and stored at 4C in the dark overnight. It is possible the cold and/or d ark treatment negated any effects of the red mulch on volatile emission. If this is true, red mulch may present itself as a means to enhance flavor of frozen strawberry products, but the effects will not stand up to current postharvest practices of fresh s trawberry. Materials and Methods Postharvest Narrow B and width Light Treatment Fragaria x ananassa according to current commercial practices for annual strawberry plasticulture in Florida (MacKenzie et al. 2011; Santos et al. 2012) beginning in the F all of 2011 and continuing through the Winter of 2012 F ully ripe fruit by commercial standards (Strand, 2008) wa s harvested at 9:00 in the morning. Fruit was transported from Citra, FL to Gainesville, FL and stored at 4C in the dark overnight prior to light treatments and subsequent analysis of fresh str awberry fruit volatiles at 9:30 the following morning. Seven berries were selected based on uniformity of appearance per treatment, and were placed into clear plastic containers for each treatment. A dark treatment and four light treatments were tested: wh ite, blue, red, and far red (Fig ure 4 1).

PAGE 145

145 Monochromatic light treatments were generated using a light emitting diode (LED) platform (Zhang et al. 2011b) } In all cases, light treatments were 50 mol m 2 s 1 in sepa rate illumination chambers within an environmentally controlled and actively ventilated area (22C 1.5C). The light treatments were generated using the Flora Lamp LED arrays (Light Emitting Computers, Victoria, B.C.). The control treatment (white light) was generated by cool white fluorescent bulbs, while the dark treatments were performed in an identical light tight enclosure under the same ambient conditions. Fruit was treated for eight hours without photoperiod prior to volatile collection Spectrora diometer readings were obtained with a StellarNet device and visualized on SpectraWiz software (Stellar Net, Tampa, FL). Red and Black Plastic Mulch Field Conditions Two treatments were replicated in three blocks consisting of approximately 150 plants per treatment replicate at the University of Florida and Institute of Food and Agricultural Sciences Plant Science Research and Education Unit in Citra, Florida. Planting of bare root propagules occurred on October 18 th 2012 and transplant establishment is fa cilitated by ten days of overhead irrigation. Laying of Black and Red Selective Reflective Mulch ( Garden Trends, Inc. ) over existing black polyethylene occurred on November 5 th 2012. Spectroradiometer readings were obtained with a StellarNet device and vi sualized on SpectraWiz software (Stellar Net, Tampa, FL) Reflected light quality was measured at 15 cm above plastic mulch Harvests were conducted twice per week beginning December 18 th 2012 through March 14 th 2013 In which, f ully ripe fruit by commer cial standards (Strand, 2008) was harvested at 9:00 in the morning, weather permitting. Count and mass (kg) of marketable a nd cull was recorded for each replicated treatment in the field. Fruit was

PAGE 146

146 transported from Citra to Gainesville, FL and stored at 4C in the dark overnight in the event of simultaneous analysis of fresh strawberry fruit volatiles and/or sensory analysis t he following morning beginning at 9:30. Flavor Panel All consumer panels were approved by the University of Florida Institutional Review Board. One hundred panelists on January 18 th 2013 and 88 panelists on February 13 th 2013 evaluated strawberry fruit grown over red and black plastic mulch raised beds (Tieman et al. 2012) Fresh, fully ripe strawberry fruit was removed from overnight 4C dark storage and allowed to warm to room temperature prior to sensory anal ysis. Each panelist was given two to three whole strawberries for evaluation, depending on cultivar availability. Panelist bit each sample, chewed, and swallowed it. Ratings for overall liking and texture liking were scaled on hedonic gLMS in the context o f all pleasure/displeasure experiences. Perceived intensity of sweetness, sourness, and strawberry flavor are scaled in context of all sensory experiences using sensory gLMS (Bartoshuk et al. 2004; Bartoshuk et al. 2003; Bartoshuk et al. 2005; Tieman et al. 2012) Scales were employed to mediate valid comparisons across subjects and sessions. Volatile Analysis At least 100 grams or seven berries of each sample were removed from 4C dark overnight stor age or post harvest narrow bandwidth light treatment prior to volatile collection A single biological replicate technically replicated three times was used pe r postharvest light treatment. For plastic mulch experiment volatiles were collected in technical triplicates per three biological replicates of each treatment to achieve precise quantitative measurement of volatile compounds emitted from strawberry fruit. Samples

PAGE 147

147 were homogenized in a blender prior to splitting into three 15 gram technical replicates for immedia te capturing of volatile emissions and the remainder frozen in N 2 (l) and stored at 80C. A two hour collection in a dynamic headspace volatile collection system (Underwood et al. 2005) allowed for concentration of e mitted volatiles on HaySep 80 100 porous polymer adsorbent (Hayes Seperations Inc., Bandera, TX, USA). Elution from polymer was described by Schmelz et al. (Schmelz et al. 2003) Quantification of volatiles in an elution was performed on an Agilent 7890A Series gas chromatograph (GC) (carrier gas; He at 3.99 mL min 1 ; splitless injector, temperature 220C, injection volume 2 l) equipped with a DB 5 column ((5% Phenyl) methylpolysiloxane, 30 m le ngth 250 m i.d. 1 m film thickness; Agilent Technologies, Santa Clara, CA, USA). Oven temperature was programmed from 40C (0.5 min hold) at 5C min 1 to 250C (4 min hold). Signals were captured with a flame ionization detector (FID) at 280C. Peak s from FID signal were integrated manually with Chemstation B.04.01 software (Agilent Technologies, Santa Clara, CA). Volatile emission s (ng 1 gFW 1 h 1 ) were calculated based on individual peak area relative to sample elution standard peak area. GC Mass Sp ectrometry (MS) analysis of elutions was performed on an Agilent 6890N GC in tandem with an Agilent 5975 MS (Agilent Technologies, Santa Clara, CA, USA) and retention times were compared with authentic standards (Sigma Aldrich, St Louis, MO, USA) for volat ile identification (Sch melz et al. 2001) Chemical Abstract Services (CAS) registry numbers were used to query SciFinder substances database for associated chemical name and molecular formula presented in Table 2 6.

PAGE 148

148 Statistical Analysis One way ANOVA determined statistically significant differences between volatiles of postharvest narrow bandwidth light treatments, volatiles of plastic mulch significant differen ce test was conducted to separate mean s. All ana lyse s were conducted in JMP 8.

PAGE 149

149 Table 4 1. Photosynthetically active, red, and far red radiation reflected by selective reflective mulch. PAR (400 700 nm) Red (600 700 nm) Far red (700 800 nm) Red: Far red Unexposed Exposed Unexposed Expo sed Unexposed Exposed Unexposed Exposed Direct Sun mol 1 m 2 s 1 2324 853 754 1.1 % Direct PAR 100.0 63.7 32.4 Black Reflective mol 1 m 2 s 1 101 77 34 25 19 52 1.8 0.5 % Direct PAR 4.3 3.3 1.5 1.1 0.8 2.2 Red Reflective mol 1 m 2 s 1 298 238 200 146 193 194 1.0 0.8 % Direct PAR 12.8 10.3 8.6 6.3 8.3 8.3 Difference mol 1 m 2 s 1 197 162 165 122 174 141 0.9 0.9 (red black) % Direct PAR 8.5 7.0 7.1 5.2 7.5 6.1 Note: Radiation measured from unexposed mulch and 4 month exposed mulch on March 14th, 2013. Relative value is average of three replicates divided by direct PAR at time of measurement. Abs olute value is product of relative and general direct PAR of 2324 mol 1 m 2 s 1

PAGE 150

150 Table 4 2. C onsumer pa nels do not perceive differences between red and black plast ic mulch grown strawberries. Black Red Black verse Red Ideal n Mean Standard Deviation Mean Standard Deviation ANOVA p value Tukey's HSD Mean Standard Deviation 1/18/2013 Overall Liking 88 34.4 28.2 34.1 27.9 0.87 a, a Texture Liking 88 38.0 28.4 37.8 28.9 0.92 a, a Sweetness Intensity 88 28.7 23.4 28.9 24.1 0.93 a, a 41.2 26.1 Sourness Intensity 88 19.9 19.2 18.8 18.6 0.32 a, a 16.7 15.9 Strawberry Flavor Intensity 88 32.1 23.9 32.7 24.0 0.72 a, a 43.1 26.2 2/13 /2013 Overall Liking 100 37.3 27.6 36.6 28.3 0.66 a, a Texture Liking 100 35.9 26.9 34.4 27.0 0.24 a, a Sweetness Intensity 100 33.8 25.5 32.2 24.9 0.22 a, a 41.7 26.1 Sourness Intensity 100 13.7 14.5 15.8 16.1 0.02 b, a 16.5 15.5 Strawberry Flavo r Intensity 100 34.4 25.0 34.1 24.3 0.81 a, a 44.3 26.6 Note: Panels were conducted at two separate points of the season in which consumers rated overall liking, texture liking, sweetness intensity, sourness intensity, and strawberry flavor intensity of s trawberries grown over red or black plastic mulch. All attributes were statistically indistinguishable across treatments on both dates, except for sourness intensity being greater in the red treatment on February 13, 2013. One way ANOVA analysis conducted in JMP 8.

PAGE 151

151 Table 4 3 Volatile analys i s do es not detect consistent differences between red and black plast ic mulch grown strawberries. 1/18/2013 2/13/2013 Black Red Black Red Volatile CAS # n Mean St d Error Mean St d Error ANOVA p value Mean St d Er ror Mean St d Error ANOVA p value 616 25 1 9 17.99 1.18 22.27 1.18 0.021 29.97 0.99 29.09 0.99 0.533 1629 58 9 9 127.91 6.93 147.77 6.93 0.060 223.19 7.13 222.48 7.13 0.945 96 22 0 9 50.19 2.19 52.03 2.19 0.562 63.10 2.23 65.76 2.23 0.412 110 62 3 9 43.30 2.57 42.02 2.57 0.729 35.63 1.84 34.85 1.84 0.770 1534 08 3 9 0.27 0.03 0.33 0.03 0.226 0.44 0.03 0.40 0.03 0.405 105 37 3 9 1.04 0.17 0.47 0.17 0.032 16.96 4.95 12.16 4.95 0.503 109 60 4 9 0.49 0.04 0.41 0.04 0.197 0.94 0.18 0.59 0.18 0.184 6 23 42 7 9 3238.9 97.71 2667.3 97.71 0.001 2633.3 214.16 2541.5 214.16 0.766 591 78 6 9 5.94 0.21 5.00 0.21 0.005 4.50 0.24 4.82 0.24 0.357 1576 87 0 9 39.84 1.95 44.77 1.95 0.093 62.39 2.17 62.14 2.17 0.937 1576 86 9 9 34.39 1.48 38.62 1.48 0.060 56 .46 2.80 56.20 2.80 0.948 623 43 8 9 63.94 10.88 106.48 10.88 0.014 150.19 8.42 147.79 8.42 0.843 66 25 1 9 1466.3 54.45 1419.39 54.45 0.551 2450.9 151.42 2532.3 151.42 0.709 123 86 4 9 8.70 0.83 9.40 0.83 0.561 22.28 2.26 22.41 2.26 0.968 624 24 8 9 17.52 0.54 14.55 0.54 0.001 14.29 1.10 12.92 1.10 0.388 29674 47 3 9 8.41 0.44 7.77 0.44 0.319 8.70 0.59 8.23 0.59 0.582 96 04 8 9 0.61 0.09 0.43 0.09 0.164 0.64 0.06 0.76 0.06 0.191 638 11 9 9 102.16 5.79 108.00 5.79 0.486 139.18 5.09 119.62 5.09 0.015 116 53 0 9 31.94 1.64 30.38 1.64 0.510 28.32 2.35 26.86 2.35 0.667 7452 79 1 9 22.83 3.66 28.67 3.66 0.277 35.22 3.00 31.71 3.00 0.419 6728 26 3 9 6854.7 207.40 6911.7 207.40 0.849 7585.6 235.65 7614.1 235.65 0.933 928 95 0 9 67.18 5.42 79.5 1 5.42 0.127 111.01 12.49 104.99 12.49 0.738 111 27 3 9 33.38 2.17 39.14 2.17 0.079 48.49 7.59 40.53 7.59 0.469 123 92 2 9 2.81 0.15 2.74 0.15 0.720 5.18 0.29 5.20 0.29 0.962 624 41 9 9 3.27 0.28 3.26 0.28 0.989 4.55 0.30 3.93 0.30 0.158 110 43 0 9 4.31 0.26 4.05 0.26 0.491 12.65 1.07 14.91 1.07 0.156 2432 51 1 9 24.04 1.45 22.22 1.45 0.389 23.58 1.23 22.61 1.23 0.583 105 66 8 9 1.00 0.08 0.81 0.08 0.102 4.95 0.67 4.45 0.67 0.599 111 71 7 9 2.39 0.13 2.47 0.13 0.676 3.44 0.15 3.60 0.15 0.474 6 28 63 7 9 1.86 0.12 1.83 0.12 0.864 3.04 0.11 2.90 0.11 0.391 106 70 7 9 208.04 10.13 161.34 10.13 0.005 223.92 19.03 215.28 19.03 0.752 55514 48 2 9 1.98 0.13 2.23 0.13 0.206 1.96 0.08 1.61 0.08 0.007 539 90 2 9 8.42 0.43 8.44 0.43 0.976 17.46 0.80 17.26 0.80 0.859 142 62 1 9 133.59 18.17 267.15 18.17 0.000 376.20 23.86 355.03 23.86 0.539 110 93 0 9 2.68 0.11 2.78 0.11 0.541 4.12 0.19 4.14 0.19 0.944 109 21 7 9 30.49 4.60 38.86 4.60 0.216 117.60 9.42 114.99 9.42 0.847 123 66 0 9 9.61 0.99 5.61 0.99 0.011 73.44 16.72 71.10 16.72 0.922 124 13 0 9 4.41 0.22 4.31 0.22 0.768 5.64 0.26 5.80 0.26 0.670 142 92 7 9 14.79 0.76 15.00 0.76 0.847 27.12 1.77 28.09 1.77 0.703 2497 18 9 9 8.29 1.42 8.39 1.42 0.958 8.56 2.46 8.72 2.46 0.963 60415 61 4 9 0.64 0.07 0.81 0.07 0.098 1.61 0.10 1.44 0.10 0.228 104 76 7 9 7.98 0.49 8.45 0.49 0.506 14.55 0.27 12.51 0.27 0.000 2548 87 0 9 1.59 0.08 1.67 0.08 0.471 0.91 0.23 1.45 0.23 0.112 540 18 1 9 0.78 0.07 0.85 0.07 0.520 1.67 0.12 1.68 0.12 0.937 4077 47 8 9 3.58 0.31 3.81 0.31 0.611 7.56 0.92 6.50 0.92 0.427 20664 46 4 9 13.59 1.44 17.53 1.44 0.071 31.64 1.68 31.86 1.68 0.930 821 55 6 9 1.28 0.15 1.62 0.15 0.133 3.80 0.18 3.95 0.18 0.545 5989 33 3 9 2.10 0.13 2.01 0.13 0.629 3.68 0.22 4.09 0.22 0 .196

PAGE 152

152 Table 4 3. Continued 1/18/2013 2/13/2013 Black Red Black Red Volatile CAS # n Mean St d Error Mean St d Error ANOVA p value Mean St d Error Mean St d Error ANOVA p value 78 70 6 9 51.04 3.26 48.20 3.26 0.547 58.38 4.60 57.13 4.60 0.850 124 1 9 6 9 4.02 0.34 4.22 0.34 0.687 9.34 0.78 9.72 0.78 0.734 103 09 3 9 0.41 0.03 0.45 0.03 0.341 0.72 0.08 0.69 0.08 0.827 140 11 4 9 1.97 0.16 1.73 0.16 0.304 1.86 0.14 1.92 0.14 0.754 2639 63 6 9 13.35 0.96 14.00 0.96 0.640 35.51 2.50 34.74 2.50 0.83 0 53398 83 7 9 14.13 0.81 14.68 0.81 0.642 16.99 3.00 17.91 3.00 0.830 106 32 1 9 0.10 0.03 0.07 0.03 0.488 0.97 0.33 0.83 0.33 0.759 112 14 1 9 2.83 0.22 3.14 0.22 0.328 4.36 0.36 3.97 0.36 0.451 564 94 3 9 0.65 0.04 0.63 0.04 0.710 0.52 0.05 0.47 0.05 0.474 3913 81 3 9 1.92 0.14 2.25 0.14 0.123 3.70 0.19 3.84 0.19 0.605 110 39 4 9 24.75 5.80 37.41 5.80 0.142 54.39 2.99 52.74 2.99 0.701 110 38 3 9 4.37 0.50 4.81 0.50 0.549 10.50 0.72 10.01 0.72 0.632 29811 50 5 9 0.19 0.01 0.16 0.01 0.052 0 .30 0.04 0.30 0.04 0.970 7786 58 5 9 0.22 0.02 0.23 0.02 0.874 0.61 0.06 0.56 0.06 0.574 15111 96 3 9 0.23 0.04 0.35 0.04 0.061 0.76 0.06 0.83 0.06 0.465 706 14 9 9 2.52 0.58 0.94 0.58 0.073 2.12 0.15 1.94 0.15 0.393 10522 34 6 9 1.67 0.18 1.93 0.1 8 0.335 2.72 0.10 2.94 0.10 0.131 5881 17 4 9 1.21 0.09 1.07 0.09 0.265 1.67 0.08 1.72 0.08 0.634 128 37 0 9 0.36 0.02 0.35 0.02 0.782 0.58 0.06 0.58 0.06 0.971 40716 66 3 9 25.74 2.33 27.02 2.33 0.702 71.48 6.29 69.50 6.29 0.827 4887 30 3 9 1.82 0. 31 2.46 0.31 0.160 10.99 1.03 11.65 1.03 0.658 5454 09 1 9 0.76 0.11 1.02 0.11 0.119 3.58 0.40 3.88 0.40 0.600 2305 05 7 9 3.40 0.31 3.91 0.31 0.267 11.76 0.79 10.59 0.79 0.309 TOTAL 9 12889.1 4 383.80 12535.5 5 383.80 0.524 15004. 39 488.73 14933.7 5 488.7 3 0.920 Note: Volatiles were collected from fresh F. x ananassa simultaneously with consumer panels. One way ANOVA determined statistically significant differences of nine volatiles between treatments on January 18 th 2013 and th ree volatiles between treatments on February 13 th 2013. Significant values ( =0.05) are in bold. However, no volatile compounds showed consistent differences on both collections. One way ANOVA analysis conducted in JMP 8.

PAGE 153

153 Figure 4 1. Spectroradiomet er readings of the light qualities used in postharvest treatments All treatments represent the waveform generated at a fluence rate of 50 mol m 2 s 1 B = blue, R = red, FR = far red, HBW = half bandwidth.

PAGE 154

154 Figure 4 2. Effect of light treatments on selected volatile compounds in Fragaria x. ananassa 2 h exen 1 ol, (2E) (928 95 0) (A) compared to dark. Far red light treatment selectively increases hexanoic acid (142 62 1) (B) compared to all ot her treatments. Blue light decreases b utanoic acid, 1 methylethyl ester (638 11 9) (C) while negligibly affecting other treatments. Certain compounds, like linalool (78 70 6) are not affected by light treatments (D). Volatile collections were conducted mul tiple times with similar results observed. Volatile content is the average of three technical replicates. Error bars represent one standard error. Data analysis conducted in JMP 8.

PAGE 155

155 A B C D

PAGE 156

156 Figure 4 3. Spectrum of light reflected from red and black plas tic mulch C omparison of direct sunlight to light reflected from unexposed red and black mulch (A). Difference spectrum of light reflected from red and black of unexposed and exposed mulch (B). Comparison of light reflected from unexposed and exposed black (C) and red (D) plastic mulch. Reflected measurements recorded at 15 cm above plastic mulch. Data normalized by averag ing three replicates divid ing by direct PAR at time of measurement and multiplying by general direct PAR of 2324 mol 1 m 2 s 1

PAGE 157

157 LIST OF REFERENCES Aharoni A, Giri AP, Verstappen FWA, Bertea CM, Sevenier R, Sun ZK, Jongsma MA, Schwab W, Bouwmeester HJ 2004. Gain and loss of fruit flavor compounds produced by wild and cultivated strawberry species. Plant Cell 16 Ahar oni A, Keizer LCP, Bouwmeester HJ, Sun ZK, Alvarez Huerta M, Verhoeven HA, Blaas J, van Houwelingen A, De Vos RCH, van der Voet H, Jansen RC, Guis M, Mol J, Davis RW, Schena M, van Tunen AJ, O'Connell AP 2000. Identification of the SAAT gene involved in s trawberry flavor biogenesis by use of DNA microarrays. Plant Cell 12 Aharoni A, Keizer LCP, Van den Broeck HC, Blanco Portales R, Munoz Blanco J, Bois G, Smit P, De Vos RCH, O'Connell AP 2002. Novel insight into vascular, stress, and auxin dependent and independent gene expression programs in strawberry, a non climacteric fruit. Plant Physiology 129 1019 1031. Aharoni A, O'Connell AP 2002. Gene expression analysis of strawberry achene and receptacle maturation using DNA microarrays. Journal of Experime ntal Botany 53 2073 2087. Arnold K, Bordoli L, Kopp J, Schwede T 2006. The SWISS MODEL workspace: a web based environment for protein structure homology modelling. Bioinformatics 22 195 201. Baldwin EA, Goodner K, Plotto A 2008. Interaction of volatile s, sugars, and acids on perception of tomato aroma and flavor descriptors. Journal of Food Science 73 Baldwin EA, Scott JW, Einstein MA, Malundo TMM, Carr BT, Shewfelt RL, Tandon KS 1998. Relationship between sensory and instrumental analysis for tomato flavor. Journal of the American Society for Horticultural Science 123 Bartoshuk LM, Duffy V, Green BG, Hoffman HJ, Ko CW, Lucchina LA, Marks LE, Snyder DJ, Weiffenbach JM 2004. Valid across group comparisons with labeled scales: the gLMS versus magnitude matching. Physiology & Behavior 82 109 114. Bartoshuk LM, Duffy VB, Fast K, Green BG, Prutkin J, Snyder DJ 2003. Labeled scales (eg, category, Likert, VAS) and invalid across group comparisons: what we have learned from genetic variation in taste. Food Quality and Preference 14 125 138. Bartoshuk LM, Fast K, Snyder DJ 2005. Differences in our sensory Invalid comparisons with labeled scales. Current Directions in Psychological Science 14 122 125. Bartoshuk LM, Klee HJ 2013. Better Fruits and Vegetab les through Sensory Analysis. Current Biology 23 R374 R378.

PAGE 158

1 58 Basson CE, Groenewald JH, Kossmann J, Cronje C, Bauer R 2010. Sugar and acid related quality attributes and enzyme activities in strawberry fruits: Invertase is the main sucrose hydrolysing enzy me. Food Chemistry 121 Bohlmann J, Lins T, Martin W, Eilert U 1996. Anthranilate synthase from Ruta graveolens Duplicated AS alpha genes encode tryptophan sensitive and tryptophan insensitive isoenzymes specific to amino acid and alkaloid biosynthesis. Plant Physiology 111 507 514. Breslin PAS 2001. Human gustation and flavour. Flavour and Fragrance Journal 16 439 456. Brown EM, McDougall GJ, Stewart D, Pereira Caro G, Gonzalez Barrio R, Allsopp P, Magee P, Crozier A, Rowland I, Gill CIR 2012. Persi stence of Anticancer Activity in Berry Extracts after Simulated Gastrointestinal Digestion and Colonic Fermentation. Plos One 7 Bruce BD 2000. Chloroplast transit peptides: structure, function and evolution. Trends in Cell Biology 10 440 447. Brummell D A, Harpster MH 2001. Cell wall metabolism in fruit softening and quality and its manipulation in transgenic plants. Plant Molecular Biology 47 Burdach KJ, Kroeze JHA, Koster EP 1984. Nasal, Retronasal, and Gustatory Perception An Experimental Comparis on. Perception & Psychophysics 36 Castillejo C, de la Fuente JI, Iannetta P, Botella MA, Valpuesta V 2004. Pectin esterase gene family in strawberry fruit: study of FaPE1, a ripening specific isoform. Journal of Experimental Botany 55 909 918. Causse M, Saliba Colombani V, Lesschaeve I, Buret M 2001. Genetic analysis of organoleptic quality in fresh market tomato. 2. Mapping QTLs for sensory attributes. Theoretical and Applied Genetics 102 273 283. Chalavi V, Tabaeizadeh Z, Thibodeau P 2003. Enhanced resistance to Verticillium dahliae in transgenic strawberry plants expressing a Lycopersicon chilense chitinase gene. Journal of the American Society for Horticultural Science 128 747 753. Chambers A, Carle S, Njuguna W, Chamala S, Bassil N, Whitaker VM, Barbazuk WB, Folta KM 2013. A genome enabled, high throughput, and multiplexed fingerprinting platform for strawberry (Fragaria L.). Molecular Breeding 31 615 629. Chambers A, Whitaker VM, Gibbs B, Plotto A, Folta KM 2012. Detection of the linalool prod ucing NES1 variant across diverse strawberry (Fragaria spp.) accessions. Plant Breeding 131 Chandler CK, Legard DE, Dunigan DD, Crocker TE, Sims CA 2000. 'Strawberry Festival' strawberry. Hortscience 35

PAGE 159

159 Chen M, Chory J, Fankhauser C 2004. Light signal transduction in higher plants. Annual Review of Genetics 38 87 117. Christensen CM 1983. Effects of color on aroma, flavor and texture judgements of foods. Journal of Food Science 48 787 790. Cliff M, Noble AC 1990. Time intensity evaluation of sweetne ss and fruitiness and their interaction in a model solution. Journal of Food Science 55 Colquhoun T, Schwieterman M, Gilbert J, Jaworski E, Langer K, Jones C, Rushing G, Hunter T, Olmstead J, Clark D, Folta K 2013. Light modulation of volatile organic co mpounds from petunia flowers and select fruits. Postharvest Biology and Technology 86 37 44. Colquhoun TA, Levin LA, Moskowitz HR, Whitaker VM, Clark DG, Folta KM 2012. Framing the perfect strawberry: an exercise in consumer assisted selection of fruit c rops. Journal of Berry Research 2 45 61. Colquhoun TA, Schimmel BCJ, Kim JY, Reinhardt D, Cline K, Clark DG 2010a. A petunia chorismate mutase specialized for the production of floral volatiles. Plant Journal 61 145 155. Colquhoun TA, Verdonk JC, Schimm el BCJ, Tieman DM, Underwood BA, Clark DG 2010b. Petunia floral volatile benzenoid/phenylpropanoid genes are regulated in a similar manner. Phytochemistry 71 158 167. Cumplido Laso G, Medina Puche L, Moyano E, Hoffmann T, Sinz Q, Ring L, Studart Wittkows ki C, Luis Caballero J, Schwab W, Munoz Blanco J, Blanco Portales R 2012. The fruit ripening related gene FaAAT2 encodes an acyl transferase involved in strawberry aroma biogenesis. Journal of Experimental Botany 63 Darrow GM 1966. The Strawberry: Histo ry, Breeding, and Physiology Dexter R, Qualley A, Kish CM, Ma CJ, Koeduka T, Nagegowda DA, Dudareva N, Pichersky E, Clark D 2007. Characterization of a petunia acetyltransferase involved in the biosynthesis of the floral volatile isoeugenol. Plant Journa l 49 265 275. Du X, Song M, Rouseff R 2011a. Identification of New Strawberry Sulfur Volatiles and Changes during Maturation. Journal of Agricultural and Food Chemistry 59 1293 1300. Du XF, Plotto A, Baldwin E, Rouseff R 2011b. Evaluation of Volatiles from Two Subtropical Strawberry Cultivars Using GC Olfactometry, GC MS Odor Activity Values, and Sensory Analysis. Journal of Agricultural and Food Chemistry 59 12569 12577. Edris AE, Chizzola R, Franz C 2008. Isolation and characterization of the volati le aroma compounds from the concrete headspace and the absolute of Jasminum sambac (L.) Ait. (Oleaceae) flowers grown in Egypt. European Food Research and Technology 226 621 626.

PAGE 160

160 Edziri H, Mastouri M, Cheraif I, Aouni M 2010. Chemical composition and ant ibacterial, antifungal and antioxidant activities of the flower oil of Retama raetam (Forssk.) Webb from Tunisia. Natural Product Research 24 789 796. El Yazied AA, Mady MA 2012. Plastic mulch color and potassium foliar application affect growth and prod uctivity of strawberry ( Fragaria ananassa Duch). Journal of Applied Sciences Research Emanuelsson O, Nielsen H, Von Heijne G 1999. ChloroP, a neural network based method for predicting chloroplast transit peptides and their cleavage sites. Protein Sci ence 8 978 984. Fait A, Hanhineva K, Beleggia R, Dai N, Rogachev I, Nikiforova VJ, Fernie AR, Aharoni A 2008. Reconfiguration of the achene and receptacle metabolic networks during strawberry fruit development. Plant Physiology 148 Finn CE, Retamales JB Lobos GA, Hancock JF 2013. The Chilean Strawberry (Fragaria chiloensis): Over 1000 Years of Domestication. Hortscience 48 418 421. Folta KM, Davis TM 2006. Strawberry genes and genomics. Critical Reviews in Plant Sciences 25 399 415. Folta KM, Dhingr a A, Howard L, Stewart PJ, Chandler CK 2006. Characterization of LF9, an octoploid strawberry genotype selected for rapid regeneration and transformation. Planta 224 1058 1067. Frank RA, Byram J 1988. Taste smell interactions are tastant and odorant dep endent. Chemical Senses 13 Fujimaru T, Lim J 2013. Effects of Stimulus Intensity on Odor Enhancement by Taste. Chemosensory Perception 6 1 7. Ghawana S, Paul A, Kumar H, Kumar A, Singh H, Bhardwaj PK, Rani A, Singh RS, Raizada J, Singh K, Kumar S 2011. An RNA isolation system for plant tissues rich in secondary metabolites. BMC research notes 4 85 85. Giampieri F, Alvarez Suarez JM, Mazzoni L, Romandini S, Bompadre S, Diamanti J, Capocasa F, Mezzetti B, Quiles JL, Ferreiro MS, Tulipani S, Battino M 20 13. The potential impact of strawberry on human health. Natural Product Research 27 448 455. Giampieri F, Tulipani S, Alvarez Suarez JM, Quiles JL, Mezzetti B, Battino M 2012. The strawberry: Composition, nutritional quality, and impact on human health. Nutrition 28 Given NK, Venis MA, Grierson D 1988. Hormonal regulation of ripening in the strawberry, a non climacteric fruit. Planta 174 402 406.

PAGE 161

161 Goff SA, Klee HJ 2006. Plant volatile compounds: Sensory cues for health and nutritional value? Science 31 1 Hakala MA, Lapvetelainen AT, Kallio HP 2002. Volatile compounds of selected strawberry varieties analyzed by purge and trap headspace GC MS. Journal of Agricultural and Food Chemistry 50 Hall RL 1968. Flavor and flavoring seeking a concensus of defin ition. Food Technology 22 1496 &. Hancock JF 1999. Strawberries Hancock JF, Callow PW, Dale A, Luby JJ, Finn CE, Hokanson SC, Hummer KE 2001. From the Andes to the Rockies: Native strawberry collection and utilization. Hortscience 36 221 225. Hoffmann T, Kalinowski G, Schwab W 2006. RNAi induced silencing of gene expression in strawberry fruit (Fragaria x ananassa) by agroinfiltration: a rapid assay for gene function analysis. Plant Journal 48 Hong V, Wrolstad RE 1990. Use of HPLC separation photodi ode array detection for characterization of anthocyanins. Journal of Agricultural and Food Chemistry 38 Jetti RR, Yang E, Kurnianta A, Finn C, Qian MC 2007. Quantification of selected aroma active compounds in strawberries by headspace solid phase microe xtraction gas chromatography and correlation with sensory descriptive analysis. Journal of Food Science 72 Jia HF, Wang YH, Sun MZ, Li BB, Han Y, Zhao YX, Li XL, Ding N, Li C, Ji WL, Jia WS 2013. Sucrose functions as a signal involved in the regulation o f strawberry fruit development and ripening. New Phytologist 198 453 465. Jorgensen RA, Cluster PD, English J, Que QD, Napoli CA 1996. Chalcone synthase cosuppression phenotypes in petunia flowers: Comparison of sense vs antisense constructs and single c opy vs complex T DNA sequences. Plant Molecular Biology 31 957 973. Jouquand C, Chandler C, Plotto A, Goodner K 2008. A Sensory and Chemical Analysis of Fresh Strawberries Over Harvest Dates and Seasons Reveals Factors That Affect Eating Quality. Journal of the American Society for Horticultural Science 133 859 867. Kasperbauer MJ, Loughrin JH, Wang SY 2001. Light reflected from red mulch to ripening strawberries affects aroma, sugar and organic acid concentrations. Photochemistry and Photobiology 74 1 03 107.

PAGE 162

162 Kessler D, Diezel C, Clark DG, Colquhoun TA, Baldwin IT 2013. Petunia flowers solve the defence/apparency dilemma of pollinator attraction by deploying complex floral blends. Ecology Letters 16 299 306. Koellner TG, Lenk C, Zhao N, Seidl Adams I, Gershenzon J, Chen F, Degenhardt J 2010. Herbivore Induced SABATH Methyltransferases of Maize That Methylate Anthranilic Acid Using S Adenosyl L Methionine. Plant Physiology 153 1795 1807. Koo YJ, Kim MA, Kim EH, Song JT, Jung C, Moon JK, Kim JH, Seo HS Song SI, Kim JK, Lee JS, Cheong JJ, Do Choi Y 2007. Overexpression of salicylic acid carboxyl methyltransferase reduces salicylic acid mediated pathogen resistance in Arabidopsis thaliana. Plant Molecular Biology 64 1 15. Lavid N, Schwab W, Kafkas E, K och Dean M, Bar E, Larkov O, Ravid U, Lewinsohn E 2002. Aroma biosynthesis in strawberry: S adenosylmethionine : furaneol O methyltransferase activity in ripening fruits. Journal of Agricultural and Food Chemistry 50 Lavin JG, Lawless HT 1998. Effects o f color and odor on judgments of sweetness among children and adults. Food Quality and Preference 9 Lee YK, Kim I J 2011. Modulation of fruit softening by antisense suppression of endo beta 1,4 glucanase in strawberry. Molecular Breeding 27 375 383. Li H m, Chiu C C 2010. Protein Transport into Chloroplasts. Annual Review of Plant Biology, Vol 61 61 157 180. Lindemann B 2001. Receptors and transduction in taste. Nature 413 219 225. Locascio SJ, Gilreath JP, Olson S, Hutchinson CM, Chase CA 2005. Red and black mulch color affects production of Florida strawberries. Hortscience 40 69 71. Lunkenbein S, Salentijn EMJ, Coiner HA, Boone MJ, Krens FA, Schwab W 2006. Up and down regulation of Fragariaxananassa O methyltransferase: impacts on furanone and phenylpropanoid metabolism. Journal of Experimental Botany 57 2445 2453. Maarse H 1991. Volatile Compounds in Foods and Beverages MacKenzie SJ, Chandler CK 2009. The late season decline in strawberry fruit soluble solid content observed in Florida is c aused by rising temperatures. Acta Horticulturae MacKenzie SJ, Chandler CK, Hasing T, Whitaker VM 2011. The Role of Temperature in the Late season Decline in Soluble Solids Content of Strawberry Fruit in a Subtropical Production System. Hortscience 46 M anning K 1994. Changes in gene expression during strawberry fruit ripening and their regulation by auxin. Planta 194 62 68.

PAGE 163

163 Manning K 1998. Isolation of a set of ripening related genes from strawberry: their identification and possible relationship to f ruit quality traits. Planta 205 622 631. Mano Y, Nemoto K 2012. The pathway of auxin biosynthesis in plants. Journal of Experimental Botany 63 2853 2872. Masaoka Y, Satoh H, Akai L, Homma I 2010. Expiration: The moment we experience retronasal olfactio n in flavor. Neuroscience Letters 473 92 96. Massa MJ, Robacker DC, Patt J 2008. Identification of grape juice aroma volatiles and attractiveness to the Mexican fruit fly (Diptera : Tephritidae). Florida Entomologist 91 266 276. Menager I, Jost M, Auber t C 2004. Changes in physicochemical characteristics and volatile constituents of strawberry (cv. Cigaline) during maturation. Journal of Agricultural and Food Chemistry 52 Meng N, Liu Y, Sun L, Du A, Li H, Zhang Z, Meng N, Liu YX, Sun LR, Du AN, Li H, Z hang ZH 2009. Transformation of cells in strawberry fruit with injection of Agrobacterium. Journal of Shenyang Agricultural University 40 404 407. Mezzetti B, Landi L, Pandolfini T, Spena A 2004. The defH9 iaaM auxin synthesizing gene increases plant fe cundity and fruit production in strawberry and raspberry. Bmc Biotechnology 4 Mikulic Petkovsek M, Schmitzer V, Slatnar A, Stampar F, Veberic R 2012. Composition of Sugars, Organic Acids, and Total Phenolics in 25 Wild or Cultivated Berry Species. Journa l of Food Science 77 C1064 C1070. Mitchell AZ, Hanson MR, Skvirsky RC, Ausubel FM 1980. Anther culture of petunia genotypes with high frequency of callus, root, or plantlet formation. Zeitschrift Fur Pflanzenphysiologie 100 131 146. Miyawaki K, Fukuok a S, Kadomura Y, Hamaoka H, Mito T, Ohuchi H, Schwab W, Noji S 2012. Establishment of a novel system to elucidate the mechanisms underlying light induced ripening of strawberry fruit with an Agrobacterium mediated RNAi technique. Plant Biotechnology 29 2 71 277. Murphy C, Cain WS 1980. Taste and Olfaction Independence vs Interaction. Physiology & Behavior 24 Murphy C, Cain WS, Bartoshuk LM 1977. Mutual action of taste and olfaction. Sensory Processes 1 Najman D 1993. Chemical characterization of sce nt of Citrus flower ( Citrus sinensis L. c.v. Shamouti) compounds and their attractiveness to the honey bee ( Apis mellifera L.) workers. Thesis x + 51 pp.

PAGE 164

164 Nehra NS, Chibbar RN, Kartha KK, Datla RSS, Crosby WL, Stushnoff C 1990. Agrobacterium mediated tr ansformation of strawberry calli and recovery of transgenic plants. Plant Cell Reports 9 10 13. Nitsch JP 1950. Growth and morphogenesis of the strawberry as related to auxin. American Journal of Botany 37 211 215. Olbricht K, Grafe C, Weiss K, Ulrich D 2008. Inheritance of aroma compounds in a model population of Fragaria x ananassa Duch. Plant Breeding 127 Olender T, Waszak SM, Viavant M, Khen M, Ben Asher E, Reyes A, Nativ N, Wysocki CJ, Ge DL, Lancet D 2012. Personal receptor repertoires: olfactio n as a model. Bmc Genomics 13 16. Pelayo Zaldivar C, Ebeler SE, Kader AA 2005. Cultivar and harvest date effects on flavor and other quality attributes of California strawberries. Journal of Food Quality 28 Perez AG, Olias R, Luaces P, Sanz C 2002. Bio synthesis of strawberry aroma compounds through amino acid metabolism. Journal of Agricultural and Food Chemistry 50 Perkins Veazie P 1995. Growth and ripening of strawberry fruit. Horticultural Reviews 17 267 297. Pierce J, Halpern BP 1996. Orthonasal and retronasal odorant identification based upon vapor phase input from common substances. Chemical Senses 21 529 543. Prescott J 1999. Flavour as a psychological construct: implications for perceiving and measuring the sensory qualities of foods. Food Quality and Preference 10 Prescott JJ 2004. Psychological processes in flavour perception. Flavor perception Pyysalo T, Honkanen E, Hirvi T 1979. Volatiles of wild strawberries, Fragaria vesca L., compared to those of cultivated berries, Fragaria x ana nassa cv Senga Sengana. Journal of Agricultural and Food Chemistry 27 19 22. Quesada MA, Blanco Portales R, Pose S, Garcia Gago JA, Jimenez Bermudez S, Munoz Serrano A, Caballero JL, Pliego Alfaro F, Mercado JA, Munoz Blanco J 2009. Antisense Down Regula tion of the FaPG1 Gene Reveals an Unexpected Central Role for Polygalacturonase in Strawberry Fruit Softening. Plant Physiology 150 Raab T, Lopez Raez JA, Klein D, Caballero JL, Moyano E, Schwab W, Munoz Blanco J 2006. FaQR, required for the biosynthesis of the strawberry flavor compound 4 hydroxy 2,5 dimethyl 3(2H) furanone, encodes an enone oxidoreductase. Plant Cell 18 Richins RD, Scholthof HB, Shepherd RJ 1987. Sequence of figwort mosaic virus DNA (Caulimovirus group). Nucleic Acids Research 15 845 1 8466.

PAGE 165

165 Rost B, Yachdav G, Liu JF 2004. The PredictProtein server. Nucleic Acids Research 32 W321 W326. Santos BM, Peres NA, Price JF, Whitaker VM, Dittmar PJ, Olson SM, Smith SA 2012. Strawberry Production in Florida. Vegetable Production Handbook Vol HS710. Gainesville, FL: University of Florida Institute of Food and Agricultural Sciences Schestibratov KA, Dolgov SV 2005. Transgenic strawberry plants expressing a thaumatin II gene demonstrate enhanced resistance to Botrytis cinerea. Scientia Hortic ulturae 106 177 189. Schieberle P, Hofmann T 1997. Evaluation of the character impact odorants in fresh strawberry juice by quantitative measurements and sensory studies on model mixtures. Journal of Agricultural and Food Chemistry 45 Schmelz EA, Alborn HT, Banchio E, Tumlinson JH 2003. Quantitative relationships between induced jasmonic acid levels and volatile emission in Zea mays during Spodoptera exigua herbivory. Planta 216 665 673. Schmelz EA, Alborn HT, Tumlinson JH 2001. The influence of intac t plant and excised leaf bioassay designs on volicitin and jasmonic acid induced sesquiterpene volatile release in Zea mays. Planta 214 171 179. Settle RG, Meehan K, Williams GR, Doty RL, Sisley AC 1986. Chemosensory properties of sour tastants. Physiol ogy & Behavior 36 619 623. Shaw DV 1997. Trait mean depression for second generation inbred strawberry populations with and without parent selection. Theoretical and Applied Genetics 95 261 264. SjStrM Loren B, Cairncross Stanley E 1955. Role of Swee teners in Food Flavor. Use of Sugars and Other Carbohydrates in the Food Industry Vol. 12: American Chemical Society, 108 113. Small DM, Jones Gotman M 2001. Neural substrates of taste/smell interactions and flavour in the human brain. Vol. 26. Chemical Senses, 1034. Small DM, Voss J, Mak YE, Simmons KB, Parrish T, Gitelman D 2004. Experience dependent neural integration of taste and smell in the human brain. Journal of Neurophysiology 92 Smith BJ, Hokanson SC, Lewers KS, Maas JL, Hancock JF, Serce S 2 003. Evaluation of native strawberry germplasm for resistance to anthracnose. Phytopathology 93 S79 S80.

PAGE 166

166 Stevens GR, Clark L 1998. Bird repellents: development of avian specific tear gases for resolution of human wildlife conflicts. International Biodete rioration & Biodegradation 42 153 160. Stevenson RJ, Prescott J, Boakes RA 1999. Confusing tastes and smells: How odours can influence the perception of sweet and sour tastes. Chemical Senses 24 Stommel J, Abbott JA, Saftner RA, Camp MJ 2005. Sensory a nd objective quality attributes of beta carotene and lycopene rich tomato fruit. Journal of the American Society for Horticultural Science 130 244 251. Strand L 2008. Integrated pest management for strawberries : ANR Publications. Suutarinen J, Anakainen L, Autio K 1998. Comparison of light microscopy and spatially resolved Fourier transform infrared (FT IR) microscopy in the examination of cell wall components of strawberries. Food Science and Technology Lebensmittel Wissenschaft & Technologie 31 595 60 1. Tieman D, Bliss P, McIntyre LM, Blandon Ubeda A, Bies D, Odabasi AZ, Rodriguez GR, van der Knaap E, Taylor MG, Goulet C, Mageroy MH, Snyder DJ, Colquhoun T, Moskowitz H, Clark DG, Sims C, Bartoshuk L, Klee HJ 2012. The Chemical Interactions Underlying Tomato Flavor Preferences. Current Biology 22 1035 1039. Tieman DM, Loucas HM, Kim JY, Clark DG, Klee HJ 2007. Tomato phenylacetaldehyde reductases catalyze the last step in the synthesis of the aroma volatile 2 phenylethanol. Phytochemistry 68 2660 266 9. Trainotti L, Ferrarese L, Dalla Vecchia F, Rascio N, Casadoro G 1999. Two different endo beta 1,4 glucanases contribute to the softening of the strawberry fruits. Journal of Plant Physiology 154 Tulipani S, Mezzetti B, Capocasa F, Bompadre S, Beekwild er J, De Vos CHR, Capanoglu E, Bovy A, Battino M 2008. Antioxidants, phenolic compounds, and nutritional quality of different strawberry genotypes. Journal of Agricultural and Food Chemistry 56 Turlings TCJ, Benrey B 1998. Effects of plant metabolites o n the behavior and development of parasitic wasps. Ecoscience 5 321 333. Turlings TCJ, Jeanbourquin PM, Held M, Degen T 2005. Evaluating the induced odour emission of a Bt maize and its attractiveness to parasitic wasps. Transgenic Research 14 807 816. Ulrich D, Hoberg E, Rapp A, Kecke S 1997. Analysis of strawberry flavour discrimination of aroma types by quantification of volatile compounds. Zeitschrift Fur Lebensmittel Untersuchung Und Forschung a Food Research and Technology 205

PAGE 167

167 Ulrich D, Komes D Olbricht K, Hoberg E 2007. Diversity of aroma patterns in wild and cultivated Fragaria accessions. Genetic Resources and Crop Evolution 54 1185 1196. UN 2013. FAOSTAT. Vol. 2013. faostat3.fao.org: Food and Agricultural Organization of the United Natio ns. Underwood BA, Tieman DM, Shibuya K, Dexter RJ, Loucas HM, Simkin AJ, Sims CA, Schmelz EA, Klee HJ, Clark DG 2005. Ethylene regulated floral volatile synthesis in petunia corollas. Plant Physiology 138 255 266. Veldhuizen MG, Shepard TG, Wang MF, Marks LE 2010. Coactivation of Gustatory and Olfactory Signals in Flavor Perception. Chemical Senses 35 121 133. Vellicce GR, Ricci JCD, Hernandez L, Castagnaro AP 2006. Enhanced resistance to Botrytis cinerea mediate d by the transgenic expression of the chitinase gene ch5B in strawberry. Transgenic Research 15 57 68. Verdonk JC, de Vos CHR, Verhoeven HA, Haring MA, van Tunen AJ, Schuurink RC 2003. Regulation of floral scent production in petunia revealed by targeted metabolomics. Phytochemistry 62 997 1008. Wang J, De Luca V 2005. The biosynthesis and regulation of biosynthesis of Concord grape fruit esters, including 'foxy' methylanthranilate. Plant Journal 44 606 619. Watson R, Wright CJ, McBurney T, Taylor AJ, Linforth RST 2002. Influence of harvest date and light integral on the development of strawberry flavour compounds. Journal of Experimental Botany 53 Whitaker VM, Hasing T, Chandler CK, Plotto A, Baldwin E 2011. Historical Trends in Strawberry Fruit Qua lity Revealed by a Trial of University of Florida Cultivars and Advanced Selections. Hortscience 46 553 557. Zabetakis I, Holden MA 1997. Strawberry flavour: Analysis and biosynthesis. Journal of the Science of Food and Agriculture 74 Zhang J, Wang X, Y u O, Tang J, Gu X, Wan X, Fang C 2011a. Metabolic profiling of strawberry (Fragariaxananassa Duch.) during fruit development and maturation. Journal of Experimental Botany 62 Zhang T, Maruhnich SA, Folta KM 2011b. Green light induces shade avoidance sym ptoms. Plant Physiology 157 1528 1536. Zozulya S, Echeverri F, Nguyen T 2001. The human olfactory receptor repertoire. Genome Biology 2

PAGE 168

168 BIOGRAPHICAL SKETCH Michael Lee Schwieterman was born in Sidney, Ohio. He was raised by Nancy Louise Schwieterman and Dale Arthur Schwieterman along with one brother and three sisters, Ryan Joseph Schwieterman, Sarah Elizabeth (Schwieterman) Hunsche, Diane Marie Schwieterman, and Megan Rose Schwieterman. T hey resided on Schwiet Acres, a small family farm focused on ra ising corn, soy, and steers near Sebastian, Ohio. After graduating from Marion Local High School, Michael attended Miami University in Oxford, Ohio where he earned a Bachelor of Science in b otany and a Bachelor of Science in z oology while also earning two minors, molecular biology and n euroscience. Michael was engaged in mapping sensory and motor neuron integrative structures in rat with Dr. Donna R. Scarb or ough, before reconnecting with h is interest in plant science Michael develop ed a professional relati onship with his biotechnology professor and mentor Dr. Susan R. Barnum Her enthusiasm for biotechnology led Michael to participate in an undergraduate research internship at the University of Florida with Dr. David G. Clark of the Plant Molecular and Cell ular Biology (PMCB) graduate program. After graduating from Miami University, Michael returned to the University of Florida to pursue his Ph.D. with the PMCB. During his first year Michael completed research rotations with Dr. Harry J. Klee, Dr. Gary F. Pe ter, and Dr. Wilfred Vermerris before deciding on Dr. Clark as his Ph.D. advisor. Dr. Clark has provided invaluable advice and mentorship in plant physiology and genetics, the philosophy and practice of science, and professional development. It is through Dr. Clark where Michael realized his potential as well as developed a mature appreciation for plant science.