<%BANNER%>

Generation of DNA Aptamers for Lung Cancer Studies

MISSING IMAGE

Material Information

Title:
Generation of DNA Aptamers for Lung Cancer Studies
Physical Description:
1 online resource (182 p.)
Language:
english
Creator:
Jimenez, Elizabeth
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Chemistry
Committee Chair:
Tan, Weihong
Committee Members:
Horenstein, Nicole Alana
Cao, Yunwei Charles
Fanucci, Gail E
Schultz, Gregory Scott

Subjects

Subjects / Keywords:
aptamers -- cancer -- cell-selex -- lung
Chemistry -- Dissertations, Academic -- UF
Genre:
Chemistry thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
The overall objective of this proposal is to develop a strategy for the detection and isolation of circulating tumor cells(CTC's) from peripheral blood of lung cancer patients. We will generate a panel of aptamers for both subgroups of lung cancer NSCLC and SCLC. It is expected that, these molecular probes will have the potential to be developed into diagnostic/prognostic tools or therapeutic and/or imaging probes for this cancer type. The strategy of using SELEX (Systematic evolution of ligands by exponential enrichment) has well been established in the Tan’s lab of the University of Florida, who developed the novel method known as cell-based SELEX. We believe that aptamers generated against lung cancer will have the affinity and specificity to recognize malignant cells circulating in the blood of lung cancer patients. These aptamers will be conjugate to magnetic nanoparticles (MNPs) to allow CTC's isolation from the matrix.  My mentor, Dr. Weihong Tan has the expertise,leadership, and necessary motivation and has demonstrated his supervisory role in previous projects. In addition the lab has most of the necessary facilities required for successful completion of this project.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Elizabeth Jimenez.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: Tan, Weihong.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0045913:00001

MISSING IMAGE

Material Information

Title:
Generation of DNA Aptamers for Lung Cancer Studies
Physical Description:
1 online resource (182 p.)
Language:
english
Creator:
Jimenez, Elizabeth
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Chemistry
Committee Chair:
Tan, Weihong
Committee Members:
Horenstein, Nicole Alana
Cao, Yunwei Charles
Fanucci, Gail E
Schultz, Gregory Scott

Subjects

Subjects / Keywords:
aptamers -- cancer -- cell-selex -- lung
Chemistry -- Dissertations, Academic -- UF
Genre:
Chemistry thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
The overall objective of this proposal is to develop a strategy for the detection and isolation of circulating tumor cells(CTC's) from peripheral blood of lung cancer patients. We will generate a panel of aptamers for both subgroups of lung cancer NSCLC and SCLC. It is expected that, these molecular probes will have the potential to be developed into diagnostic/prognostic tools or therapeutic and/or imaging probes for this cancer type. The strategy of using SELEX (Systematic evolution of ligands by exponential enrichment) has well been established in the Tan’s lab of the University of Florida, who developed the novel method known as cell-based SELEX. We believe that aptamers generated against lung cancer will have the affinity and specificity to recognize malignant cells circulating in the blood of lung cancer patients. These aptamers will be conjugate to magnetic nanoparticles (MNPs) to allow CTC's isolation from the matrix.  My mentor, Dr. Weihong Tan has the expertise,leadership, and necessary motivation and has demonstrated his supervisory role in previous projects. In addition the lab has most of the necessary facilities required for successful completion of this project.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Elizabeth Jimenez.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: Tan, Weihong.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0045913:00001


This item has the following downloads:


Full Text

PAGE 1

1 GENERATION OF DNA APTAMERS FOR LUNG CANCER STUDIES By ELIZAB E TH JIM NEZ A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Elizabeth Jim nez

PAGE 3

3 To God, my family and my loving husband

PAGE 4

4 ACKNOWLEDGMENTS I would like to deeply thank my advisor Dr. Weihong Tan at the department of chemistry department at the University of Florida for encouraging me to think harder and for his support to become the best scientist I could be. I would like to express my gratitude to my co advisor Dr. Priya Gopalan from the College of M ed icine at the University of Florida for her support and clinical knowledge and for letting me discover the translation and importance of my work. Sincere g ratitude goes to my early mentors especially Dr. Maria Corena Mcleod, Dr. Paul Linser and Dr Fumihito Ono for their patience and guidance. I would like to thank my committee members Dr. Nicole A Horenstein, Dr. Gail Fanucci, Dr. Gregory Schultz, and Dr. Charles Cao as well as Dr. Kathryn Williams for their guidance and advice during my PhD studies and t he preparation of this manuscript. Also I would like to express my gratitude to the United States of America and the University of Florida for allowing me to achieve my goal of completing my postgraduate studies at this prestigious institution. Special th anks go to Dr. Kwame Sefah, and Dr Dalia L pez Coln for sharing their expertise and for their incredible friendship. Specia l thanks also goes to Andrs Gordillo, Trinh Thu Le, Dr. David Reisman and Dr. Stefanie Marquez for their invaluable experimental help. I would like to thank my second family Tan lab past, current members and closest friend s for their friendship, support and their invaluable input and guidance, especially Dr. William Chen, Dr. Jennifer Martin, Dr. Tahir Bayr ac, Dr. Basri Gulbakan, Dr. Dimitry Van S imaeys, Dr. Meghan Altman, Dr. Xilin Xiao, Dr. Ying Pu, Steven Dolbier, Guizhi Zhu, Isma il Ocsoy, Emir Yasun, Husseyin Erdal, Tao Chen, Cuichen Sam Wu Liqin Zhang, Diane Turek, Carole Champagnac Ben Airline, as well as my dearest girls Carolina Ceballos, Xiangling Xiong Sena Cansiz, and Dalia Lpez

PAGE 5

5 for your sincere friendship hospitality and for sharing all the memorable moments throughout these years. I would like to thank my husband Oscar Bola os for his love, care and support during this journey. I also thank m y m other Olga L D az, my father Jorge H Jimnez, my sister and Brother Angelica M. L pez and E dwin A. Jimnez for their love, encouragement and support during my PhD studies, as well as, m y grandmothers Yolanda Daz and Ana Hurtado for their love and prayers. Also, owe much gratitude to the rest of my family and friends in Colombia for their incredible support Finally, I want to thank God for showing me in his humorous and sometimes non understandable way the path that I should follow, and for giving me the strength to overcome the difficult times.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ .......... 10 LIST OF FIGURES ................................ ................................ ................................ ........ 11 LIST OF ABBREVIATIONS ................................ ................................ ........................... 14 ABSTRACT ................................ ................................ ................................ ................... 18 CHAPTER 1 INTRODUCTI ON ................................ ................................ ................................ .... 20 Cancer ................................ ................................ ................................ .................... 20 Lung Cancer ................................ ................................ ................................ ........... 20 Non Small Cell L ung Carcinoma ................................ ................................ ...... 21 Adenocarcinoma ................................ ................................ ........................ 21 Squamous cell carcinoma ................................ ................................ .......... 22 Large cell carcinoma ................................ ................................ .................. 22 Small Cell Lung Carcinoma ................................ ................................ .............. 23 Diagnosis in Lun g C ancer ................................ ................................ ...................... 23 Tissue Diagnosis ................................ ................................ .............................. 23 Sputum cytology ................................ ................................ ........................ 24 Bronchoscopy ................................ ................................ ............................ 24 Mediastinoscopy ................................ ................................ ........................ 24 Transthoracic needle biopsy ................................ ................................ ...... 24 Thoracoscopy ................................ ................................ ............................ 24 Thoracotomy ................................ ................................ .............................. 25 Imaging Diagnosi s ................................ ................................ ............................ 25 Treatments for Lung Cancer ................................ ................................ ................... 25 Surgery ................................ ................................ ................................ ............. 26 Chemotherapy ................................ ................................ ................................ .. 26 Radiation Therapy ................................ ................................ ............................ 27 Metastasis ................................ ................................ ................................ ............... 28 Biomarkers in Lung Cancer ................................ ................................ .................... 29 Membrane Proteins ................................ ................................ ................................ 30 Notable Membrane Proteins in Cancer. ................................ ................................ .. 31 Aptamers ................................ ................................ ................................ ................ 31 Sistematic Evolution of Ligands .by Exponential Enrichment (SELEX) ................... 33 Cell SELEX ................................ ................................ ................................ ............. 34 Overview of dissertation ................................ ................................ .......................... 34 2 SE LECTION AND CHARACTERIZATION OF DNA APTAMERS AGAINST ADENOCARCINOMA OF THE LUNG ................................ ................................ .... 46

PAGE 7

7 Introduction: Lung Adenocarcinoma ................................ ................................ ....... 46 Results and Discussion ................................ ................................ ........................... 47 Cell based Selection for Adenocarcinoma ................................ ........................ 47 Characterization of Aptamers ................................ ................................ ........... 48 Dissociation Constants (K s) ................................ ................................ ............ 49 Binding Studies at Different Temperatures ................................ ....................... 50 Binding Studies Under Fixed Conditions ................................ .......................... 51 Proteinase effect on Aptamer Binding ................................ .............................. 52 Concluding Remarks ................................ ................................ ............................... 52 Material and Methods ................................ ................................ ............................. 52 Library Design ................................ ................................ ................................ .. 52 Instrumentation and Reagents ................................ ................................ ......... 53 Cell Culture and Buffers ................................ ................................ ................... 53 In vitro Selection ................................ ................................ ............................... 54 Flow Cytometric Analysis ................................ ................................ ................. 55 454 Sequencing and Analysis ................................ ................................ .......... 55 Binding Assays ................................ ................................ ................................ 56 Binding Assays with Fixed Cells ................................ ................................ ....... 56 Selectivity and Specificity Assays ................................ ................................ ..... 56 Temperature Effect on Aptamer Binding ................................ .......................... 56 Determination of the Dissociation Constant ................................ ...................... 57 Trypsin and Proteinase K treatment ................................ ................................ 57 3 VALIDATION OF LUNG CANCER APTAMERS IN LUNG CANCER CELL LINES AND CLINICAL SAMPLES ................................ ................................ .......... 71 Introduction ................................ ................................ ................................ ............. 71 Results and Disc ussion ................................ ................................ ........................... 72 Concluding Remarks ................................ ................................ ............................... 78 Material and Methods ................................ ................................ ............................. 78 Instrumentation and Reagents ................................ ................................ ......... 78 Cell Culture and Buffers ................................ ................................ ................... 79 Flow Cytometric Analysis ................................ ................................ ................. 79 Binding Assays ................................ ................................ ................................ 79 4 DETECTION OF CTCs USING APTAMERS IN NSCLC and SCLC ....................... 92 Introduction ................................ ................................ ................................ ............. 92 Results and Disc ussion ................................ ................................ ........................... 93 Expression of EpCAM in NSCLC Cell Lines ................................ ........................... 93 Aptamers Binding with Blood Derived Cells ................................ ............................ 94 H1650 or H358 as Model Cell Line for CTCs Detection in NSCLC ......................... 94 Microscopy Images of Captured Spiked Cells ................................ ........................ 95 Capturing Efficiency of Aptamer MNP Complex ................................ ..................... 96 Concluding Remarks ................................ ................................ ............................... 97 Detection of CTCs in SCLC ................................ ................................ .................... 97 EpCAM Expression in SCLC Cell Lines ................................ ........................... 97

PAGE 8

8 CD56 Expression in SCLC Cell Lines ................................ .............................. 97 H1836 as Model Cell Line for CTC Detection in SCLC ................................ ........... 98 Optimization of Conditions for CTC Detection ................................ ........................ 98 Background Optimization ................................ ................................ ........................ 98 Detection of CTCs Using High Count Number ................................ ........................ 99 Detection of CTCs Using a Representative Number of Cel ls ................................ 100 Contribution of Dead Cells to Aptamer Background ................................ ............. 101 Detection of CTC in Blood Samples ................................ ................................ ..... 102 Limit of Detection ................................ ................................ ................................ .. 102 Detectio n of CTCs in Metastatic SCLC Patients ................................ ................... 103 Concluding Remarks ................................ ................................ ............................. 104 Material and Methods ................................ ................................ ........................... 105 Instrumentation and Reagents ................................ ................................ ....... 105 Cell Culture and Buffers ................................ ................................ ................. 105 Flow Cytometric Analysis ................................ ................................ ............... 106 Binding Assays with Antibodies ................................ ................................ ...... 106 Binding Assays with Aptamers ................................ ................................ ....... 106 Preparation of Freshly BC from Whole Blood ................................ ................. 107 Spiked H1836 Cells in Blood ................................ ................................ .......... 107 Labeling of CTCs for Magnetic Separation ................................ ..................... 107 Labeling of CTCs for its Detection Using FACS Sorter ................................ .. 108 5 ............................. 137 Introduction: Biomarker ................................ ................................ ......................... 137 Results and Discussion ................................ ................................ ......................... 138 Elucidation of the Target Protein for Aptamer DOV4 ................................ ............ 138 Subcellular Fractionation to Reduce Background Proteins ................................ ... 139 Aptamer Crosslinking to its Target ................................ ................................ ........ 140 Discrimination of Significant Proteins ................................ ................................ .... 141 Skin cells ................................ ................................ ................................ ........ 142 Mytochondrial Proteins ................................ ................................ ................... 143 Cyto solic Proteins ................................ ................................ ........................... 143 Cytoplasmic Proteins ................................ ................................ ...................... 143 Membrane Proteins ................................ ................................ ........................ 144 Conclusions ................................ ................................ ................................ .......... 144 Materials and Methods ................................ ................................ .......................... 145 Instru mentation and Reagents ................................ ................................ ....... 145 Cell Culture and Buffers ................................ ................................ ................. 146 Aptamer Binding ................................ ................................ ............................. 146 H23 Crosslinking with its Target ................................ ................................ ..... 146 Extraction of H23 Proteins ................................ ................................ .............. 147 Subcellular Fractionation of H23 Cells ................................ ........................... 147 Aptamer Target Purification for Protein Identification ................................ ..... 147 Digestion of the Protein Band Prior MS Analysis ................................ ............ 148 6 CONCLUSIONS AND FUTURE DIRECTIONS ................................ .................... 157

PAGE 9

9 Conclusions ................................ ................................ ................................ .......... 157 Future Directions ................................ ................................ ................................ .. 160 APPENDIX SYNTHESIS APTAMER RADIOACTIVE ISOMER DRUG CONJUGATE FOR SCLC TREATMENT ................................ ................................ ................................ ........ 162 LIST OF REFERENCES ................................ ................................ ............................. 166 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 182

PAGE 10

10 LIST OF TABLES Table page 2 1. Aptamer sequences and their dissociation constant (Kd s ) aptamers and pool % ................................ ................................ ................................ ........................ 49 2 2. Binding of Adenocarcinoma aptamers with other cancer cell lines ..................... 50 3 1. Adenocarcinoma cell lines profiled with the panel of lung cancer aptamers. ...... 76 3 2. Small cell lung carcinoma cell lines profiled with the panel of lung cancer aptamers. ................................ ................................ ................................ ........... 77

PAGE 11

11 LIST OF FIGURES Figure page 1 1 Cancer incidence and mortality worldwide in 2008.. ................................ ........... 36 1 2. Leading New Cancer Cases and Deaths 2013 Estimates ............................... 37 1 3. Lower respiratory tract: solid adenocarcinoma with mucin production. ............... 38 1 4. Squamo us cell carcinoma of the lung. ................................ .............................. 39 1 5. Lower respiratory tract: large cell carcinoma . ................................ .................... 40 1 6. Histopathology image of small cell carcinoma of the l ung. ................................ 41 1 7. Lung cancer staging. Primary Tumor (T) and Metastasis (M) ............................. 42 1 8 Lung cancer staging. Regional Lymph node (N) ................................ ................. 43 1 9. Global Market for aptamers 2008 2014. ................................ ............................. 44 1 10. Schematic representation of cell based SELEX methodology ........................... 45 2 1. Progress of cell SELEX methodology.. ................................ ............................... 58 2 2. Characterization of selected aptamers.. ................................ ............................. 59 2 3. Apparent dissociation constants (kds) for selected aptamers. ........................... 61 2 4. Aptamer binding at physiological conditions and room temperature. .. ............... 64 2 5. Control experiment for fixed treated cells.. ................................ ......................... 66 2 6. Binding assays after fixation with 10% formalin.. ................................ ................ 67 2 7. Binding assays after proteinases treatment.. ................................ ...................... 69 3 1. Binding assays of lung cancer aptamers with normal bronchial cell line HBE 135 E6E7. ................................ ................................ ................................ ........... 81 3 2. Binding of lung cancer aptamers after fixation with 4% paraformaldehyde.. ...... 82 3 3. Profiling of cell line H2087 ADC with the lung cancer aptamer panel: ................ 83 3 4. Profiling of SQC cell lines: A) H520, B) H226, and C) LUDLU 1. ....................... 84 3 5. Profiling of LCC cell lines: A) H460, B) H661. ................................ ..................... 87

PAGE 12

12 3 6. Profiling of cell line H2679 SCLC with the lung cancer aptamer panel: .............. 89 3 7. Immunohistochemistry of formalin fixed artificial tissues.. ................................ .. 90 3 8. Immunohisto chemistry of FFPE artificial tissues. Aptamers ............................... 91 4 1. EpCAM expression in NSCLC cell lines.. ................................ ......................... 109 4 2. Aptamer binding with blood derived cells. ................................ ....................... 110 4 3. Scheme of proposed methodology for the detection of CTCs in NSCLC. ........ 111 4 4. Captured CTCs by direct and i ndirect methodologies.. ................................ .... 112 4 5. Transmittance light images of captured spiked cells. ................................ ....... 113 4 6. Fluorescence microscopy of captured H1650 (40x). ................................ ........ 114 4 7. Capturing efficiency of the aptamer MNP based approach. ............................. 115 4 8. EpCAM expression in SCLC cell lin es. ................................ ............................. 116 4 9. CD56 expression in SCLC cell lines. ................................ ............................... 118 4 10. H1836 profiling with lung cancer aptamers.. ................................ ..................... 120 4 11. Scheme of proposed methodology for the detection of CTCs in SCLC. ........... 121 4 12. Difference in flow cytometry reading of CTCs spiked either at the beginning or the end of the methodology. ................................ ................................ ......... 122 4 13. Optimization of the dye use for the conjugation to aptamers. ........................... 123 4 14. Background analysis of cocktail aptamers and Ab with freshly extracted buffy coat using flow cytometry.. ................................ ................................ ............... 124 4 15. Detectio n of 250K spiked cells in blood ................................ ............................ 125 4 16. Detection of CTCs in blood.. ................................ ................................ ............. 126 4 17. Background during CTCs detection.. ................................ ................................ 127 4 18. BC cells only stained with Ab C D56, aptamer cocktail and 7 AAD ................... 128 4 19. Elimination of background cells in channel APC and CTCs detection using 250k cells.. ................................ ................................ ................................ ........ 129 4 20. Determination of the LOD for CTC detection. ................................ ................... 130

PAGE 13

13 4 21. Detection of CTCs in patient sample 483.. ................................ ....................... 132 4 22. Detection of CTCs in patient sample 728.. ................................ ....................... 133 4 23. Detection of CTCs in patient sample 829.. ................................ ....................... 134 4 24. Detection of CTCs in patient sample 766.. ................................ ....................... 135 4 25. Detection of CTCs in patient sample 071.. ................................ ....................... 136 5 1. Methodology proposed for the elucidation of the aptamer DOV4. .................... 149 5 2. SDS PAGE gel corresponding to the analysis of aptamer DOV4 in adenocarcinoma H23 cells. ................................ ................................ ............ 150 5 3. Aptamer DOV 4 binding after treatment of CAOV3 ovarian cancer cells with 0.1mg/mL and 0.5mg/mL of proteinase K. ................................ ........................ 151 5 4. SDS PAGE gel corresponding to the analysis of proteins captured with aptamers DOV 4 and random DNA after treatment with proteinase K. ............ 152 5 5. Mechanism of formaldehyde crosslinking between a DNA base and an amine residue from a nearby protein. ................................ ................................ .......... 153 5 6. Formaldehyde induced crosslink between cytosine and lysine. ........................ 154 5 7. SDS PAGE gel corresponding to the analysis of captured proteins by aptamer DOV4 in H23 cells. ................................ ................................ ............. 155 5 8. Mass spectral analysis of proteins captured by aptamer DOV 4 in H23 cells.. 156 A 1 Step by step synthesis of DOTA Aptamer conjugate. ................................ ...... 163 A 2. Purification of DOTA aptamer conjugate by HPLC. The peak corresponding to 12 17minutes was collec ted as it represents the conjugate. ........................ 164 A 3 Flow cytometry analysis of DOTA conjugate with cell lines A549 and HBE 135.. ................................ ................................ ................................ ................. 165 A 4 Internalization of aptamer conjugate in lung cancer cell line A549. .................. 165

PAGE 14

14 LIST OF ABBREVIATIONS 2D PAGE Two dimension polyacrylamide gel electrophoresis Ab Antibody ADC Adenocarcinoma AJCC American Joint Committee on Cancer ATCC American Type Cell Culture APC Allophycocyanin BB Binding buffer bp base pair CA 125 Cancer Antigen 125 CEA Carcinoembryonic Antigen ChIP Chromatin ImmunoPrecipitation CSC Cancer Stem Cells CTC Circulating Tumor Cells CT Scans Computerized Tomography Scans CTSI Clinical and Translational Science Institute CYFRA21 1 Cytokeratin 19 Fragment DNA Deoxyribonucleic Acid EDTA Ethylenediaminetetraacetic Acid EMT Epithelial to Mesenchymal Transition EGF Epidermal growth factor EpCAM Epithelial Cell Adhesion Molecule FACS Fluore scence assisted cell sorting FBS Fetal bovine serum FDA Food and Drug Administration

PAGE 15

15 FFPE Formalin Fixed Paraffin Embedded FITC Fluorescein isothiocyanate FNA Fine Needle Aspiration g g force GAPDH Glyceraldehyde 3 phosphate dehydrogenase GDP Gro ss Domestic Product GPCR G Protein Coupled Receptor HEPES 4 (2 hydroxyethyl) 1 piperazineethanesulfonic acid HPLC High Performance Liquid Chromatography IARC International Agency for Research on Cancer IASLC International Association for the Study of Lu ng Cancer KRAS v Ki ras2 Kirsten Rat Sarcoma Viral oncogene homolog LCC Large Cell Carcinoma LOD Limit of Detection MA Massachusetts MID Middle Identification Code MNP Magnetic Nanoparticles MS Mass spectrometry NK Natural Killer NSE Neuron Specific Enolase NSCLC Non Small Cell Lung Cancer nt nucleotide NHS N Hydroxysuccinimide PBMC Peripheral Blood Mononuclear Cells PBS Phosphate Buffer Solution

PAGE 16

16 PCR Polymerase Chain Reaction PDGF Plateted derived growth factor PE Phycoerythri n PE Cy5.5 Phycoerythrin cyanine derivative 5.5 PEG Polyethylene Glycol PMSF PhenylMethaneSulfonylFluoride ProGRP ProGgastrin Releasing Peptide PTK7 Protein Tyrosin Kinase 7 Qpcr Quantitative polymerase chain reaction RBC Red Blood Cells RNA Ribonu cleic Acid rpm revolution per minute SCLC Small Cell Lung Cancer SDS PAGE Sodium dodecyl sulphate polyacrylamide gel electrophoresis SELEX Systematic evolution of ligands by exponential enrichment siRNA Small interfering RNA ssDNA Single stranded deoxyribonucleic acid ssRNA Single stranded ribonucleic acid SCC Squamous Cell Carcinoma SOP Standard Operational Procedures TNM Tumor Node Metastasis TP53 Tumor Protein p53 VALSG VEGF Vasc ular endothelial growth factor VOC Volatile organic compounds

PAGE 17

17 WB Washing Buffer WBC White Blood Cells WHO World Health Organization

PAGE 18

18 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy GENERATION OF DNA APTAMERS FOR LUNG CANCER STUDIES By Elizabeth Jimnez August 2013 Chair: Weihong Tan Major: Chemistry Lung cancer is a very deadly disease and the number one cause of cancer related deaths worldwide. I t is divided in two main groups Small cell lung carcinoma ( SCLC ) and Non small cell lung carcinoma ( NSCLC ) which is further classified into adenocarcinoma, squamous cell carcinoma and large cell carcinoma. Lung cancer is normally detected a t stage III and stage IV with poor five year survival rate. Due to the lack of specific symptoms lung cancer can be misin terpreted as other respiratory infections due to an inefficient diagnosis c apability T he subgroups in lung cancer are clinically differently and their response to treatments relies on the accurate classification in a particular subgroup. To address this issue, this dissertation investigated the use of aptamers as alternatives to antibodies for the diagnosis and accurate classification of lung cancer. Aptamers are short single stranded synthetic nucleic acids either DNA or RNA capable of recognizing and binding their target s with high selectivity and specificity. Using c ell based SELEX as meth odology a panel of 6 aptamers was generated for the holistic study of lung cancer. The generated aptamers possess apparent dissociation constant s

PAGE 19

19 in the nanomolar range, an indispensable feature in the biomedical application of these molecular probes. Fu rthermore, these aptamers were validated against a pool of lung cancer cell lines corresponding to all subgroups. Aptamers HCH3, S1 and EJ4 showed affinity for the majority of cell lines tested. Simultaneously, these aptamers were probed with formalin fixe d and formalin fixed paraffin embedded cell based model tissues. All aptamers tested were capable of recognizing and detecting their targets under these conditions. In addition, aptamers were utilized as recognition molecules on an aptamer based strategy f or the detection and enumeration of circulating tumor cells in vitro and in vivo The developed assay was able to detect as few as ~ 50 cells in 7.5mL of blood. PAGE gel an d MS analysis, two proteins emerged as potential targets: Annexin A2 and desmoplakin related proteins.

PAGE 20

20 CHAPTER 1 INTRODUCTION Cancer Cancer is the general name for a group many diseases in which a group of abnormal cells proliferate without control and multiplies in an autonomous fashion invading adjacent parts of the body and spreading to other organs 1 Cancer is caused by abnormalities in the genetic material caused by a series of changes which can be provoked by different risk factors such as: advanced age, growing older, tobacco 2 sunlight 3 ionization radiation 4 certain chemical, viruses 5 bacteria 6 hormones 7 alcohol 8 and poor diet 9 Other genetic abnormalities are acquired during the normal process of DNA repli cation, and these unrepaired errors are inher ited and present in every cell of the body thereby increasing the probability of developing the disease. C anc er has become a public health problem worldwide. Globally t he overall cost of cancer was $ 895 billi on in 2008 while in the United Stated alone its economic impact rose to 1.73 percent of its GDP 10 Cancer is the leading cause of disease related death worldwide accounting for 13% of all deaths worldwide followed by heart disease and stroke. In 2008, an estimated of 12.7 million new cases were reported, and the burden of cancer will increase to 22 million new cases by 2030. Breast, prostate, pancreatic, and lung cancers account for more than half of all cancer deaths [Figure 1 1] 10 In addition t o its physical effects cancer can emotionally impact patients and relatives with mixed feelings of fear, uncertainty, sadness and stress 11 Lung Cancer L ung cancer is the leading type of cancer for both male s and female s and is estimated to rank second among new cases 1 [Figure 1 2] A number of factors can

PAGE 21

21 increase the risk of an individual to develop lung cancer. Smoking is by far t he leading risk for lung cancer; about 90% of cancer cases result from tobacco use 12 T he disease is not selective and can affect both smokers and non smokers equally In fact, nearly 3,000 non smokers die every year from lung cancer. Other factors such exposure to radon gas 13 asbestos, and occupational chemical s 14 as well as others lung disease s have been identified as lung carcinogens. Other non variable risks include genetics gender age, and race 15 The vast majority of lung neopla sms (abnormal tissue masses) are carcinomas ( m alignancies that arise from epithelial cells 16 ), which are divided into two classes based on morphological assessment of the stained histological samples: n on small cell lung carcinoma s (NSCLC) and small cell lung carcinoma s (SCLC) 17 Non Small Cell Lung Carcinoma NSCLC which is the most com mon lung cancer type (8 5 % of all lung cancer cases ) is the slow growing, more passive cancer type, while SCLC (15 % of all lung cancer cases ) is more aggressive. NSCLC are further classified into three different subtypes: adenocarcinomas (ADC), s quamous cell carcinoma (SCC), and large cell carcinoma s (LCL). Compared to other cancer types, lung neoplasms are highly heterogeneous, with tumors displaying more than one subtype as a common feature 18 Adenocarcinoma ADC is the most common subtype o f lung cancer in most countries, and it accounts for 40% of NSCLC It arises from the small bronchi, bronchioles or alveolar epithelial cells and usually is located in the periphery of the lungs with a characteristic

PAGE 22

22 glandular pattern. [Figure 1 3]. Th e se tumors tend to be found in a confined area, and therefore, they respond to chemotherapy, and tumor resection 19 Although ADC is t he subtype least related with tobacco consumption it is most frequently observe d subtype among smokers 20 21 Compelling evidence suggest s that lung cancer in individual who have never smoke is a neoplasm with different pathologic and epidemiologic characteristics compared to pulmonary adenocarcinomas linked to smoking 22 Lung adenoca rcinoma in never smokers is more commo n in women than men 23 24 As the most common histological subtype, ADC s are fu rther clas sified as: bronchioalvela r (BAC), papillary, acinar, or solid according to the 2004 classification by the World Health Organization ( WHO ) 25 Clinically, resected specimens that display more than one histological pattern have demonstrated the urgent need for a new classification sy stem due to the heterogeneity of mixed adenocarcinomas in whic h the predominant subtype prioritize s the classification 26 27 Mixed subtype lung tumors usually show more aggressive clinical action than those with single histology 28 Squamous cell carcinoma Lung SCC accounts for about 20 30% of NSCLC and it is the histological subtype directly associated with smoking 29 Typically, SCC tumors are central, arising in the large bronchi. This histological subgroup responds well to chemotherapy and it is well characterize by keratinization and pearl formation 30 [ Figure 1 4 ] Large cell carcinoma LCA accounts for about 10% of NSCLC and it is characterized by a poorly differentiate d ADC, SCC, SCLC fe atures. Typically, differenti ating features include the large size of

PAGE 23

23 the anaplastic cells, the lack of chromatin pattern, and the ratio of cytoplasm to nucleus 31 [ Figure 1 5 ] Small Cell L ung Carcinoma Small cell lung carcinoma is the other his tology subgroup in lung cancer, representing 15% of all lung cancer cases worldwide 18 This disease is commonly present in elderly current and past heavy smokers, and its risk increases substantially with tobacco consumption13. As in 90% of all lung cancer cases, SCLC has an epithelial origin 32 consi sting of small cells with fine nuclear chr omatin and unnoticeable nuclei 18 [ Figure 1 6 ] SCLC usually starts in the bronchi close to the center of the chest. It is considered more aggressive compared to NSCLC because of the rapid spread throughout the body at early stage 33 Therefore, surgical removal of the tumor with surgery rarely cures the disease. Diagnosis in Lun g Cancer Early diagnosis of cancer can improve dramatically its prognosis. In the absence of a particular test diagnosis relies on the primary care. As with any disease, p hysical examination constitutes a critical part of the di agnostic process (t he majority of lung neoplasms are discovered by chance when x ray images are used as part of the treatment of other ailments 34 Several techniques are available for accurate diagnosis as d escribed below Tissue Diagnosis The most effective method to diagnose the presence of cancer is microscopy e xamination of suspected tissue Different techniques that fall into this category are presented below.

PAGE 24

24 Sputum cytology Sputum cytology is the least invasive method to detect lung cancer 35 and involves examination of mucous collected by coughing in to a container. This technology is especially useful in patients with central tumors such SCLC and SCC, and its sensitivity in detecting lung cancer depends on the number of samples 36 However, the accuracy of this methodology has not been summarized due to the variability in the collection and analysis of the sample. Bronchoscopy Bronchoscopy is the most common biopsy technique when lung cancer is suspected. It involves the insertion of a bronc hoscope into the large airways of the lungs. This technique is particularly useful in tumors developed in the bronchial tree and central tumors 37 Mediastinoscopy Mediastinoscopy is a surgical procedure in which an endoscope is inserted through a small incision in the neck into the chest, specifically in the central area called the mediastinum. This tech nique plays an important role in tumor stagi ng, especially from centrally located tumors 38 Transthoracic n eedle biopsy Also known as fine needle aspiration (FNA) biopsy, this method is used for patients with tumors located in the periph eral area of the lung, hardly reached by bronchoscopy. During the procedure a needle is inserted into the mass tumor to extract cell s for subsequent staining and visualization under the microscope. Thoracoscopy In t horacoscopy another invasive medical pr ocedure, an endoscope in inserted

PAGE 25

25 into the chest. The advantage of this technique over those previous ly describe d is the possibility of obtaining pleural effusion within the sample 39 Thoracotomy Thoracotomy represents the last surgical resource as diagnostic technique to sample a susp ected tumor when previously described methods are unsuccessful. This procedure is performed under anesthesia, and the chest is open to expose the lungs. It is mostly employed for treatment to deep organs such as the heart, esophagus and thoracic aorta 40 Imaging Diagnosis In the recent years, imaging has been the leading technology in cancer diagnosis and tumor staging. Although imaging provides information about the presence of a tumor, its malignancy is determined only after analysis u nder microscope. Below is a list of available imaging techniques employed in lung cancer diagnosis. Magnetic Resonance Imaging Scans (MRI scans) Computerized Tomography scans (CT Scans) Chest X ray Position Emission Tomography (PET scans) Treatments for Lu ng C ancer The management of lung cancer depends crucially on the histol ogical classification and the tumor staging, based on the tumor node metastasis staging system TNM [ Figure 1 7 and Figure 1 8 ] 41 which was updated by the American Joint Committee on Cancer (AJCC) in 2007. As previously mentioned, lung cancer is divide d histologically in to NSCLC ( which is further divide into subtypes ) and SCLC. Since the tion Lung S tudy Group (VALSG) has defined the

PAGE 26

26 staging for SCLC as limited or extensive stage. L imited stage SCLC refers to disease restricted to the thorax, while in extensive stage SCLC, the disease is distributed outside the thorax, including other pleu ral and pericardial conditions 42 On the other hand, t he TNM system has always defined the staging classification. Recently, the International Association for the Study of Lung Cancer (IASLC) suggested the modification for the SCLC staging after a review of 109 SCLC patients and observation of more efficient prognostic differentiation between the two staging systems 43 In general, the treatment of lung cancer involves a variety of approach es, including chemotherapy, surgery, and radiation therapy. Surgery Resection is the standard surgical procedure for NSCLC stages I & II and can be used alone or in combination with chemotherapy. Ideal candidates for surgery are c onsidered based on the stage and the overall health condition. Lobectomy, which refers to the excision of the lobe of the lung is the main procedure performed on the se patients. For stage IIIA the option of surgery depends of the location of the tumor, and for IIIB, the option of surgery relies on the evidence of lymph node metastasis 44 [ Figure 1 7 ] For SCLC patients surgery is a remote option for treatment, as it is applicable to only 10% of that population Chemotherapy Chemotherapy refers to the use of drugs orally or via intraveno us injection to kill cancer cells. It plays an important role for treatment of both SCLC and NSCLC. This type of treatment can be used alone as the main treatment, as adjuvant therapy simultaneously with radiation therapy and after surgery, and also as neo adjuvant

PAGE 27

27 therapy before surgery to aid in reduction of the tumor. The most common chemotherapy drugs use d in lung cancer treatment are: Cisplatin, Carboplatin, Doxetacel (Taxotere), Paclitaxel (Taxol), Gemcitabine (Gemzar), Vinorelbine (Navelbine ), Ir inotecan (Camptosar), Etoposide (VP 16), Vinblastine, Pemetrexed (Alimta). Chemotherapy is usually administered as a combination of two or more drugs. However single drug chemotherapy is use in the elderly and in patient s with compromised health status If a combination of drugs is chosen as first line therapy, either Cisplatin or Carboplatin is predetermined in the gi ven therapy in a combination of the other previously mentioned drugs A second line therapy with single drug is suggested after the prim ary treatment effects cease 45 46 These chemotherapy drugs target constantly dividing cells, but unfortunately healthy cells present in the intestine, mouth and hair follicles are also in co nstant division, thus becoming targets for those chemotherapy drugs. Therefore, side effects are exp ected when these drugs are used, m ost common ly hair loss, mouth sore s constipation, and fatigue. Radiation T herapy Radiation therapy employs high energy ra ys or particles to kill cancer cells. It is recommended for patients with early stage lung cancer who are not suitable candidates for surgery 47 Radiation can be used as main treatment (with or without chemotherapy), before surgery to help shrink the tumor and after su rgery to eliminate small clusters of tumor cells that were missed. There are two main types of radiation therapy: external beam and int ernal (Brachytherapy). Special considerations prior the beginning of treatment include dosage frequency of the treatment, a nd beam angle The side effects are similar to those developed after chemotherapy 47 These therapies have their best

PAGE 28

28 prognostic rates when administer ed in the earlier stage s of the disease, but unfortunately lung cancer is often discovered at late stage or in the worst case when metastasis have occurred. Metastasis Although m etastasis is the true cause of cancer associated deaths, the process is not well understood. Generally, the term refers to the spreading of the primary tumor f rom one organ to another. Chaffer and Weinberg 48 suggest tha t this process can be divided in to two main events: (i) p hysical translocation of a cancer cell from the primary tumor to the microenvironment of the surrounding distant organ followed by (ii) colonization. Recentl y, many scientific discussion s relating to this topic have led to different hypothesis ranging from a genetic theory 49 to an implicit single cell marker differentiation 50 The process starts with the rupture of the basal lamina through the invasion of the extracell ular matrix. This is fo llowed by the intravasation event in which the tumor cells enter the bloo d and lymph vessels and proceed to circulate throughout the body. Once the tumor cell has settled in a distant organ, it begins its proliferation (i.e. coloniz ation) and form s a metastasis. Two different classes of disseminated cells are thought to play an important role in metastasis: cancer stem cells (CSC) and circulating tumor cells (CTC). CSC theory started to gain popularity around 2003 and since then, nu merous studies have demonstrated the existence of those cells in different solid tumors 51 CSC share similar features with normal stem cells (NSC), and h ave the ability to self renew and to generate a diverse progeny. Recently, efforts have aimed to identify molecular markers that would differentiate CSC from NCSC and their potential s as therapeutic target s The role of CSC in metastasis can be explained by the stem like features acquired by the

PAGE 29

29 tumor cells at the time of dissociation from the primary tumor, more precisely i n the epithelial to mesenchymal transition (EMT). CTCs are disseminated cells from the edges of the tumor that are carried away into t he bloodstream or lymphatic system. These cells can remain as single cells in the blood stream, later cluster ing together and colonizing a new organ 52 This topic will be address ed in subsequent chapters. Biomarkers in Lung C ancer The search for biomark ers is imperative, especially for early diagnos is and prognosis. M utation s in g enes such KRAS and TP53 were extensively studied after the advent of next generation sequencing 53 However, these studies have led to controversial results and their use as potential biomarker s has been inconsistent 54 Other molecules studied as biomarkers include th e protein present in serum (carcinoembryonic antigen (CEA), and cytokeratin 19 fragme nt (CYFRA) for NSCLC and neuron specific enolase (NSE), and progestin releasing peptide (ProGRP) for SCLC ), but only a few have shown potential to be use d in clinical settings because of s pecificity and sensitivity requirements 55 A recent study of Non metastatic 23 protein NM23 H2 in 95 frozen tumor samples indicate d that the protein was expressed selectively in lung ADC, but there is no correlation wit h staging or metastatic potential 56 One limitation in the process of identifying new biomarkers is the lack of physical samples in most cases. As me ntioned previously, most lung cancer cases are diagn osed at later stage when surg ery is not suitable, thus restricting tissue acquisition. Recently, a new direction has focused on searching for future biomarke rs in more non invasive samples, such as the breath, sputum, and pleural effusions In these methods volatile organ ic compounds (VOC) and cells directly expelled/extracted from the tumor

PAGE 30

30 microenvironment of the lungs can provide useful information about their origin. Other type s of molecules released into most body fluids are cir culating free microRNA (miRNA), single stranded RNA o nly 21 25 nucleotides in length that can act as oncogenes or tumor s uppressor genes. They are less susceptible to nuclease degradation than DNA and are thus more stable in the body and its fluids. M i cro RNAs are well regulated, but the lack of internal mi RNA co ntrol molecules has limited their potential use as biomarkers 57 Membrane P roteins Membrane proteins play a crucial role in in all cells by m ediating cellular communication and nutrient transport. Comprising about 30% of all proteins membrane proteins have become target s for the development of new therapeutic drugs. In fact, clinically most of the prescribed drugs target membr ane proteins such as ion channels and G protein coupled receptors. Despite being the most targeted of proteins they are not well understood due to their dual hydrophobic hydrophilic nature and their limited solubilization in aqueous solution making the m difficult to crystallize 58 Recent efforts in proteomic technologies have generated protein datasets proteome s esentative proteins for several diseases including cancer 59 Two dimensional polyacrylamide gel electrophoresis (2D PAGE) and mass spectrometry (MS) are key technologies and multiple potential lung cancer biomarker candidates have been identified using these techniques. Comparative studies by Planque et al using cell lines for ea ch histology group were analyzed for common protein s in lung cancer and proteins innate to each subtype. Five secreted proteins were identified and preliminarily validated in the seru m of lung cancer patients as potential biomarkers 60 61 ADAM 17, osteoprotegerin, pentraxin 3, follistatin, and tumor

PAGE 31

31 necrosis factor receptor superfamily member 1A. Following the comparison principle between healthy/cancer patients, different studies have been carried out 62, 63 64 65 Notable M embrane Proteins in C ancer In cancer, membrane proteins also regulat e key cell processes such as cell adhesion, migration, invasion, apoptosis, angiogenesis and tumorigenesis. The most common growth factors related to several cancers are epidermal growth factor (EGF) 66 vascular endothelial growth factor (VEGF) 67 and plateted derived growth factor (PDGF) 68 These have become the molecula r protein target s for most of the current therapies in cancer. As previously mentioned, membrane proteins continue to serve a s a focal point towards the development of new therapeutics, and the identification of new biomarkers with the potential to be tra nslating into clinical settings in an important research area Aptamers Recently, a novel type of molecules has emerged for the study of membrane proteins. About two decades ago, aptamers ( ) were discovered simultaneously by two independent research groups : Ellington & Szostak 69 and Tuerk & Gold 70 in 1990. Aptame rs are short single strande d synthetic DNA or RNA probes capable of recognizing and binding to their targets with high selectivity and specificity. The molecular recognition is based on non covalent interactions such van der Waals forces, hydrogen bonds an d hydrophobic interactions 71 Since their discovery, aptamers have been generated for a variety of target s, including, small organic molecules 72 me tal ions 73 proteins 74 75 carbohydrates, toxins 76 77 and transcription factors 78 as well as whole cells 79 80 81 viruses 82 83 bacteria 84 85 and a s inhibitors of protein funtions 86 87

PAGE 32

32 Aptamers were developed using the Systematic Evolution of Ligand by Exponential enrichment method. These synthetic oligonucleotides bind with specificity similar to that of antibodies and are usually refer red to as their counterpart s, but i n contrast to antibodies, aptamers have shown no or extremely low immunogenicity 88 This pivotal characteri stic enables biological and medical applications, especially in vivo investigation using these probes 89 Aptamers have been popularized as an alternative to antibodies in different fields including imaging 90 91 drug delivery 92, 92 and particularly in analytical detection 93 94 95 A ptamers are inexpensive, and their production does not require an animal model. These synthetic oligonucleotides can be easily modified to solve limitations in current biomedical applications. For example, p olyethylene glycol (PEG lated) aptam ers have the ability to undergo cellular uptake and to resist rapid enzyme degradation when lock ed nucleic acids are used 96 In addition, these probes are small in size and their sequences generally do not surpass 100 base pairs (bp). Consequently, aptamers demonstrated better tissue penetration compared to anitbodies 97 The a ptamer market is a growing industry as many selected aptamers have reached clinical trials and some are already been commercialized. In 2004, Macugen, an anti VEGF inhibit or, became the first aptamer approved by the Food and Drug Administration (FDA) for W et Age R elated Macular Degeneration 98 (AMD), and o ther aptamers are currently in clinical trials 99 100 Predictions estimated aptamer value a t $10 million in 2009 and its gr owth is projected to reach 1.2 billion in 2014 101 making aptamers one of the fastest g rowing markets in therapeutics [ Figure 1 9 ]

PAGE 33

33 S istematic Evolution of Ligands .by Exponential Enrichment (SELEX) SELEX technology generally speaking involves an iterative process fro m which aptamers are generated [ Figure 1 10 ] T he components, and critical steps involved in SELEX are: Primer s election Perhaps this is the most important step during this process, identification of a unique set of primers to ensure proper amplification during the selection p rocess. Generally primers are around 18bp in length and should be analyzed on nucleic acid software to eliminate primer dimers and self priming. When the SELEX process is carried out with living organism s such a mammalian cells, viruses and bacteria, the c andidate set of prime rs should be screened using the program blanstn against the corresponding genome to avoid unwanted amplification of genes from the host. Library generation Typically an aptamer library consists of 10 14 10 16 random sequences generated t hrough an automated process by solid phase chemistry 102 Previously, sequences utili zed for selection contain around 80 100bp but later this number has been reduced to 50bp (Unpublished data) in order to reduce costs without compromising quality. The randomized region is flanked on ends by the set of primers that will allow amplification of the sequences. Partition ing The p artitioning step is crucial step in the entire selection process as the randomized sequences b egin to display affinity for the target. During this step the sequences with the greatest affinity (lowest dissociation constant, K d ) will be separate d

PAGE 34

34 from the pool (library) of sequences for further amplification. The stringency of t his process increase s as the SELEX process progressed. Amplification by Polymerase Chain Reaction (PCR) During the entire selection process approximately 270 PCR reaction s will be performed, assuming 18 rounds of enrichment with 15 PCR cycles per round. However, there are some intrinsic problems with this technology It is well known that DNA polymerases are not 100% faithful to the growing DNA strand. Therefore, it is exp ected that the enriched library in the final round will contain point mutations in several sequences. In add ition, truncated sequences may be also present within the enriched library as short sequences have a higher chance to be amplified. Cell SELEX To select aptamers for whole cells a negative control is usually included either as a normal cell line or different cancer cell line. Cell SELEX begins with the binding event between the initial ly synthesized library and the target cells, unbound and weakly bound sequences are washed off. Boun d sequences are collected and (i f negative selection is to be performed) are incubated with the negative cells. This time the, unbound sequences are collected and further PCR amplified. Then, dsDNA is converted to ssDN A and a new round starts. This process is continued until the initial library is enriched with sequences that bind to the cancer cell but no to the control cell. Once enrichmen t has been achieved, the pool is sequenced and analyzed using alignment programs to identify conserved sequences 103 Overview of dissertation The research data presented in this dissertation demonstrate how aptamers s elected against lung cancer can be utilized in clinical settings. Chapter 2 describes the

PAGE 35

35 selection process of selecting for lung cancer. Chapter 3 demonstrates the pote ntial of apt amers to be used clinical ly as probes for diagnostic purposes and histological subtyping. Chapter 4 demonstrates the applicability of aptamers in targeting and d etection of disseminated cancer cell s in blood and chapter 5 outlines a proposed methodology t target. The concluding chapter recapitulates the significance of cell SELEX technol ogy and its translation into clinical settings.

PAGE 36

36 Figure 1 1. Cancer incidence and mort ality worldwide in 2008. ( A dapted from Ferlay J, Shin HR, Bray F, For man D, Mathers C and Parkin DM. GLOBOCAN 2008 v2.0, Cancer Incidence and Mortality Worldwide: IAR C Cancer Base No. 10 [Internet]. Lyon, France: International Agency for Research on Cancer; 2010. Available from: http://glo bocan.iarc.fr, accessed on 13/may/2013.

PAGE 37

37 Figure 1 2. Leading New Cancer Cases and Deaths 2013 Estimates Figure adapted from Cancer Facts and Figures, American Cancer Society, 2013.

PAGE 38

38 Figure 1 3. Lower respiratory tract: solid adenocarcinoma with mucin production. This poorly differentiated (solid) adenocarcinoma shows many cells with mucin vacuoles. Image and description are from The Armed Forces institute of Pathology (AFIP) PEIR Digital Library (Pathology image database). Image # 407843. This is a public domain image distributed under the creative commons attribution license, which permits unrestricted use, distribution, and reproduction in any medium. This file is licensed under the creative commons attribution share alike 3.0 unported license

PAGE 39

39 Figure 1 4. Squamous cell carcinoma of the lung. This image shows the presence of intracellular bridges which are one of the diagnostic criteria for squamous cell carcinoma. Image and description are from Yale Rosen. This is a public domain image distributed under the creative commons attri bution license, which permits unrestricted use, distribution, and reproduction in any medium. This file is licensed under the Creative C ommons A ttribution Share Alike 2 .0 Generic lice nse.

PAGE 40

40 Figure 1 5. Lower respiratory tract: large cell carcinoma A histological section shows a proliferation of atypical c ells along the alveolar walls. Image and description are from The Armed Forces institute of Pathology (AFIP) PEIR Digital Library (Pathology image database). Image # 408049. T his is a public domain image distributed under the creative commons attribution license, which permits unrestricted us e, distribution, and reproduction in any medium. This file is licensed under the creative commons attribution share alike 3.0 unported licens e.

PAGE 41

41 Figure 1 6 Histopathology image of small cell carcinoma of the lung. CT guided core needle biopsy. H&E stain. This is a public domain image distributed under the creative commons attribution license, which permits unrestricted use, distribution, and reproduction in any medium This file is licensed under the creative commons attribution share alike 3.0 unported license.

PAGE 42

42 Figure 1 7. Lung cancer staging. Primary Tumor (T) and Metastasis (M) Figure adapted from lung cancer staging, American Joint Committee on cancer 7 th edition, 2009. Reprinted with permission from AJCC.

PAGE 43

43 Figure 1 8 Lung cancer staging. Regional Lymph node (N) Figure adapted from lung cancer staging, American Joint Committee on cancer 7 th edition, 2009. Reprinted with permission from AJCC.

PAGE 44

44 Figure 1 9 Global Market for aptamers 2008 2014. Figure adapted from Nucleic Acid Aptamers for Diagnostics and Therapeutics: Global Markets, BCC Research, Wellesley, MA; March 2010. Reprinted with permission from BCC Research.

PAGE 45

45 Figure 1 10 Schematic representation of cell based SELEX methodology

PAGE 46

46 CHAPTER 2 SELECTION AND CHARACTERIZATION OF DNA APTAMERS AGAINST ADENOCARCINOMA OF THE LUNG Introduction: Lung Adenocarcinoma Lung adenoc arcino ma is the most prevalent type of lung cancer, accounting for approximately 30% of all lung cancer cases 1 Adenocarcinoma can occur in both smokers and non smo kers with an incidence of 30% and 70 % respectively. Lung adenocarcinoma originates in the periphery of the lungs, and as a result, the symptoms are manifested at the late stage of its development The growth rate is s low, and f rom its origination to metastatic cancer, this malignancy can be undetected T he main ris k factor for adenocarcinoma is smoking with 90% of all lung cancer cases 12 Overall, fewer than 10% of people with primary lung cancer survive five years after diag nosis. However, five year survival rates can be as high as 35 % to 40 % for those who have localized lung cancer removed in its early stages. Particular interest has arisen regarding the ADC subtype since it is the most common type of lung cancer amongst smokers and non smokers. Incidence rates are increasing in m ost countries, and has exceeded all other subtypes 10 Accurate classification and development of probes for early detection are the current challenges in lung cancer. Thus, g enerating aptamers that bind specifically to certain tumor markers on the lung cancer cell membrane will expan d the repertoire of probes, allowing the biology of disease to be studied at the molecular level. T hese probes can be utilized to detect specifically targeted cells based on molecular differences between normal and malignant cells, t hus, leading to important advances in understanding the biology of the disease and the investigation of potential cancer t herapies. This chapter describes the ce ll SELEX process using H23 ADC cell line as

PAGE 47

47 the positive cell line and Human Bronchial Epithelial HBE 135 E6/E7 as the negative pair The c haracterization of aptamers generated is also described Results and D iscussio n Cell based Selection for A denocarcinoma Since their discovery, aptamers have been generated against various targets, including proteins 73,74 peptides 104 and living cells 78 80 To isolate aptamers capable of differentiating lung adenocarcinoma cells from normal lung epithelial cells, we used the cell based SELEX strategy. H2 3 lung adenocarcinoma and HBE 135 E6/E7 normal epithelial lung were used as positive and negative cell lines, respectively. An initial ssDNA random library containing approximately 10 14 different sequences of 80 nucleotides (nt) was enriched by sequential binding with the target cells, elution and subsequent amplification by PCR for 18 rounds. These DNA sequences could recognize H23 cell surface membrane proteins which are potential markers for targeted therapy. In earlier rounds of the process, counter sel ection was introduced in order to remove possible sequences binding common proteins on both target and negative cell lines. This procedure was performed every other round throughout the selection. Sequences binding to target cells were eluted and PCR ampl ified, after which ssDNA was recovered and used to monitor the selection process by flow cytometry. Because the ssDNA pools were enriched with sequences specific for the target, an increase in fluorescence intensity was first noticed in round 12, indicatin g that those s equences showed better binding to the surface of H23 cells compared to the initial library. As the selection progressed, the fluorescence intensity of the subsequent pools gradually increased until a steady state in fluorescence intensity wa s observed in

PAGE 48

48 rounds 17 and 18 [ Figure 2 1 A ] indicating that maximum binding had been achieved. In contrast such enrichment was not observed when the enriched pools were tested against normal l ung epithelial cells [ Figure 2 1B ] implying that sequences co ntained in those pools were capable of distinguishing lung adenocarcinoma cells from normal lung epithelial cells. Therefore, pools 14, 16 and 18 were selected to be sequenced as aptamer candidates The sequencing process began with the construction of the 454 sequencing library by PCR addition of 454 ends of the enriched pools. To identify the pool for each sequence, a unique identification code (Middle Identification C ode, MID) was also PCR introduced to the 454 sequenci ng library. The insertion of primers in the enriched pools was confirmed by gel electrophoresis After 454 sequencing at the UF ICBR core, around 7,000 sequences were retrieved and analyzed. They were grouped on the basis of the MID corresponding to the sa me pool, and primers were removed by a Perl program. The sequences containing only the random region were then aligned using the online program MAFTT 6.0 105 and six aptamer families corresponding to the most abundant sequences were chosen as aptamer candidates. They were chemically synthesized, biotin end, purified by HPLC, and quantified. Characteri zation of A ptamers All aptamers displayed binding with H23 lung adenocarcinoma cells, while no significant binding was observed with the control cell line HBE 135 E6/E7, normal epithelial lung cel ls [ F igu re 2 2 ] These results indicate that successful negative selection had been carried out and that selected aptamers could distinguish between lung adenocarcinoma and normal lung epithelial cells, an outcome which confers these

PAGE 49

49 aptamers with the potential for use in lung cancer diagnosis, monitoring tumor progression and treatment, or other relevant applications. Dissociation Constants (K s ) cell line in the na nomolar range (45 250nM) (T able 2 1) and [F igure 2 3 ] Table 2 1.Aptamer sequences and their dissociation constant (Kd s ) aptamers and pool % Name Sequences K d (nM) % pool ADE1 70 5 4,7 ADE2 208 38 0,53 EJ2 45 5 7,3 EJ4 60 8 10,2 EJ5 TAC GGG CTG GAT CCA 122 11 0,71 EJ7 55 8 5,8 These results suggest that these aptamers will be widely applicable, as they tightly bind to their target. Further studies were carried out to characterize the selected aptamers. The binding was further tested against lung cancer cell lines, as well as o th er cell lines, including ovarian and colon cancer cell lines as shown in Table 2 2 Aptamers EJ2, EJ4 and ADE1 displayed some recognition towards one or more of the following cell lines: TOV21G, DLD1, and H460. In the case of DLD1, a colon adenocarcinoma cell line, it was interesting to see some recognition by the selected aptamers, suggesting that a possible common cell surface target is present in these two cell lines, since they belong to the same histological group.

PAGE 50

50 Table 2 2 Binding of Adenocarcinoma aptamers with other cancer cell lines Cell line Name ADE1 ADE2 EJ2 EJ4 EJ5 EJ7 H23 Lung Adenocarcinoma +++ +++ ++++ ++++ ++ +++ HBE 135 Normal lung bronchial cell _ _ _ A549 Lung Adenocarcinoma ++ _ ++ _ H460 Large cell carcinoma _ ++ ++ _ H520 Squamous cell carcinoma _ _ _ CAOV3 Ovary adenocarcinoma _ _ _ TOV21G Ovary clear cell carcinoma ++ ++ ++ _ DLD1 Colon adenocarcinoma _ +++ _ In a previous study in our lab, the target protein of Sgc8 aptamer was demonstrated to be PTK7 106 a pseudo kinase protein present in CEM cells (the target cell line for that selection), as well as other cancers, including ovary, lung, colon, breast and some leukemia cell lines, indicating that common proteins can be present as a result of cancer 107 Aptamers, EJ4 and ADE1 also showed particular specificity towards the lung adenocarcinoma cell line with significant increase in fluorescence intensity with respect to a random sequence, but not to normal lung c ells. These results suggest that these aptamers could be used for lung cancer studies Binding Studies at Different T emperatures Flexible binding of aptamers at different temperatures can expand their repertoire of applications. Since the selection was perf ormed at 4C, we performed binding assays As shown in this Figure 2 4 aptamers ADE1, ADE2, EJ2, EJ4 EJ5 and EJ7 conserved binding at 25C and 37C with fluorescence intensities similar to

PAGE 51

51 s particularly important in assays carried out under physiological conditions, such as those assessing in vivo applications. Binding Studies Under Fixed C onditions Cancer detection relies on the examination of tissue from biopsies, which are fixed under chemical conditions to preserve the integrity and antigenicity of tumor samples for later use. An important assay in cancer diagnosis is immunostaining, in which fres hly dissected tissues are fixed prior to treatment with probes, such as antibodies and aptamers, specifically for tumor markers. Previous studies have shown that aptamers are capable of labeling formalin fixed paraffin tissue (FFPE) after deparaffinization and antigen retrieval 108 To determine the bin ding capability of the selected aptamers under those conditions, cells were fixed with 10% formalin before i ncubation with labeled aptamers. As control for these experiments, two known aptamers for leukemia, Sgc8 and TD05, and their corresponding binding cell lines were used to show that the process of fixation does not produce any fluorescence signal. Therefore any fluorescence detected should be an indication of a binding event between the apta mers and its target. As shown in F igure 2 5 both controls retained their initial binding profile, indicating that no artificial increment in fluorescence intensity occurred as a result of the fixing conditions. Aptamers EJ2, EJ5, EJ7, ADE1, and ADE2 aptam ers maintained similar binding to t hat disp Figure 2 6 indicating that aptamers can bind to their targets even under fixed conditions. These results strongly suggest that selected aptamers have the potential to be used as recognition molecules in clinical samples.

PAGE 52

52 Proteinase effect on Aptamer B inding During cell selection, it is expected that aptamers interact specifically wi th the surfaces of target cells, and this behavior has been reported in several studies 79 ,80, 109 In our experiment, cells were treated with two enzymes, trypsin and proteinase K, for 3 and 10 minutes, washed with PBS, and then incubated with aptamers. All selected aptamers lost binding after treatment with both proteases [ Figure 2 7 ] For all experiments, the fluorescence intensity was significantly reduced; however, the signal corresponding to assays with proteina se decreased to background, indicating that the target protein was removed completely after treatment. C oncluding R emarks In conclusion, we have selected a panel of aptamers capable of distinguishing lung carcinoma from normal lung epithelial cells. These aptamers show ed high affinity towards the H23 cell line with apparent K d s in the nanomolar range, but no detectable affinity for normal lung epithelial cells. Aptamers also showed binding under physiological conditions, as well as after chemical fixation, suggesting that they can be applicable for in vivo experiments. Proteinase treatment indicated that all aptamers in this panel bind to proteins on the target cell surface. All these results suggest broad potential applications of selected aptamers due to their specificity for cancerous tissues but not for healthy cells. These aptamers can also be used as molecular probes in clinical samples, such as freshly extracted tumors and preserved histology specimens. Material and Methods Library Design The primers were design ed to satisfy the following characteristics: a minimum hairpin structure, similar melting temperature (T m ) and minimal base pairing. The

PAGE 53

53 primers and an 80 mer library were designed using the IDT Oligo Analyzer 3.1 software 110 The forward primer was labeled with Fluorescein Isothiocyanate (FITC) at end, and the reverse primer was labeled with Biotin end. The library consisted of a randomized 44 end by the FITC labeled end by the complementary unlabeled strand of the reverse primer. Instrumentation and R eagents Libraries and primers w ere synthesized using the 3400 DNA synthesizer (Applied Biosystems). All reagents for DNA synthesis were purchased from Glen Research. DNA sequences were purified by reverse d phase HPLC (Varian Prostar using a C18 column and acetonitrile/triethylammonium a cetate as the mobile phase ). PCR was performed on a Biorad Thermocycler and all reagents were purchased from Takara The monitoring of the selection process, binding assays, and determination of the dissociation constant s for the selected aptamers were pe rformed by flow cytometric analysis using a FACScan cytometer (BD Immunocytometry Systems). Cell Culture and Buffers A total of eight established ce ll lines was used in this project, all purchased from the American Tissue Culture Collection (ATCC). H23 (CR L 5800) a denocarcinoma NSCLC was chosen as the positive cell line, while the negative cell line chosen was HBE135 E6/E7 (CRL 2741) n ormal h uman b ronchial e pithelial cell s. The H23 cell line was maintained in RPMI 1640 (ATCC) culture medi um supplemented with 10% Fetal Bovine Serum (FBS heat inactivated) and 1% penicillin streptomycin. The normal bronchial lung cell line was maintained in a Keratin Serum Free Medium supplemented with 5 ng/m L human recombinant EGF, 0.05 mg/m L bovine pitui tary extract (Invitrogen),

PAGE 54

54 0.005 mg/mL insulin, and 500 ng/m L hydrocortisone ( Sigma Aldrich). Cells were incubated at 37C under 5% CO 2 atmosphere. Other cell lines used for the selectivity assay were the CAOV3 and TOV21G ovarian cancer cell lines, A549 lung ad enocarcinoma, H520 lung squamous cell carcinoma, H460 large cell lung carcinoma, and DLD1 colon adenocarcinoma, and all were maintained according to ATCC specifications. During selection, two buffers were used: Washing Buffer (WB) (glucose 0.45% w/v and Mg Cl2 5mM in PBS) and Binding Buffer (BB) (1 mg/mL tRNA and 1mg/mL BSA in WB). All previous reagents were purchased from Sigma Aldrich. In vitro Selection Because both cell lines used during the selection, a denocarcinoma and normal h uman b ronchial epithelial cells, are adherent cell lines, the selection was performed on cell monolayers. About 20nmol of the synthesized libra ry was dissolved in 700 L of binding buffer Before the process was initiated the DNA pool was denatured by heating at 95C for five min utes followed by rapid cooling on ice. This forced the DNA sequences to adopt the most favorab le secondary structures. T he DNA library was then incubated with approximately 3x10 6 target cells (H23) at 4C for 30 minutes. Subsequently, the cells were washe d 3 times with washing buffer to remove unbound sequences. Afterwards, the bound sequences were recovered by heating at 95C for 10 minutes and then centrifug ing at 14,000 rpm to remove cell debris The supernatant containing the DNA sequences was collected, and the selected pool was PCR amplified using FITC and biotin labeled primers. Then, the generation of single strand DNA (ssDNA) was achieved by incubation with str e ptavidin c oated sepharose beads, to bind to the biotinylated strand. Count er selection was carried out after observing some enrichment with the target cells. In order to select aptamers with

PAGE 55

55 high specificity and selectivit y, the stringency of the washes (number of washes, wash time, and volume of washing buffer ) was increased in subsequent rounds. The enrichment of the pools was monitored using flow cytometry, sequenced with 454 technology and analyzed for aptamer candidates. Flow Cytometric Analysis Flow cytometry was used to monitor the enrichment of ssDNA bound sequences wit hin the pools during the selection process, as we ll as to evaluate the binding affinity and specificity of the selected aptamers. The cultured cells were washed with WB before and after incubation with the FITC ssDNA pool or selected DNA sequences Fluores cence intensity was determined on a FACScan cytometer (BD Immunocytometry). 454 Sequencing and Analysis After 18 rounds of selection, e nriched pools 14, 16, and 18 were chosen for sequencing. The 454 specific primers and MID were PCR amplified and added t o each sequence contained in each pool, yielding a 125 bp product. The products were confirmed by gel electrophoresis, cleaned using a PCR purification kit (Qiagen), and submitted to the ICBR core at the University of Florida for analysis. A pproximately seven thousand sequences were retrieved and analyzed. First, sequences were grouped on the basis of their MID to determine the corresponding enriched pool. Second, primers and MID were removed by the Perl program in order to leave only the random portion o f the sequence for homology analysis with the MAFFT 6.0 program.

PAGE 56

56 Binding Assays Different f amilies of sequences retrieved from multiple sequence analyses were synthesized, biotin labeled end and tested for binding with the positive and negative cell line In addition, the binding selectivity of each candidate was determined by incubating a 250nM aptamer solution with 4 x 10 5 ta rget or counter cells for 30 minutes at 4C. Cells were washed twice with WB and incubated with streptavidin PE beads for 20 minutes at 4C. After washing, the cells were suspended in 200L WB. The fluorescence was determined with a FACScan cytometer by counting 3x10 4 events. A randomized 80 mer sequence was used as a control. Binding Assays with F ixed C ells T o determine the ability of the aptamers to bind to fixed cells, procedures similar to those described above were followed, with the exception of the initial treatment of the cells. Briefly, adherent H23 cells were detached from the dish by incubation with non enzymati c cell dissociation solution, and then fixed with 10% formalin solution for 15 min at 4C, washed, and suspended in binding buffer. Selectivity and Specificity Assays To determine the specificity of these aptamers different cell lines, including CAOV3, DLD1, A549, H520, H460, and TOV21G, were used in binding assays. Fluorescence intensity was measured in order to confirm binding. All experiments followed the flow cytometry experimental procedure described above. Temperature E ffect on A ptamer B inding The s election methodology would affect the binding between aptamer and the target cells, binding assays were

PAGE 57

57 Determination of the Dissociation C onstant The affinity of the aptamer and its target was evaluated by saturation assay. A sample containing 5x10 5 H23 cells was washed and incubated with different concentrations of aptamer until saturation was achieved. All binding assays were repeated three times, and the mean fluorescence intensity was calculated by subtracting the fluorescence intensity of a scra mbled sequence. Data were collected, and the dissociation constant (K d ) which describes the strength of binding was obtained by fitting to a single binding site saturation model using SigmaPlot 11.2v (Jandel, San Rafael, CA). Variabl e Definition Units nonspecific) sites/cell B m ax > 0 Maximum number of binding sites same as Y K d > 0 Strength of binding same as X Trypsin and Proteinase K treatment H 23 cells were washed twice with PBS and then incubated wit h 3 mL of either 0.05% proteinase activity. Cells were washed with WB and subsequently used for the binding assays described above.

PAGE 58

58 Figure 2 1. Progress of cell SELEX methodology. Binding assay of pools 11 18 with H23 (A B ) and p ools 15 18 with HBE135 E6/E7 Copyright 2012. Jimenez. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited

PAGE 59

59 Figure 2 2. Characteriza tion of selected aptamers. Flow cytometry assay for the binding of the aptamers ADE1, ADE2, EJ2, EJ5 and EJ7 with H23 (target cell line) and HBE135 E6/E7 (negative cell line). The green curve represents the background binding of a random sequence (library)

PAGE 60

60 Figure 2 2. Characterization of selected aptamers. Continued. Copyright 2012. Jimenez. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited

PAGE 61

61 Figure 2 3 Apparent dissociation constants (kds) for selected aptamers. Saturation binding curves for selected aptamers ADE1, ADE2, EJ2, EJ4, EJ5 and EJ7. Cells were incubated with different concentrations of the aptamer in triplicate. The mean fluorescence intensity of the unselected library was subtracted from the intensity for each co rresponding aptamer concentration

PAGE 62

62 Figure 2 3 Apparent dissociation constants (kds) for selected aptamers. Continued

PAGE 63

63 Figure 2 3 Apparent dissociation constants (kds) for selected aptamers. Continued Copyright 2012. Jimenez. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited

PAGE 64

64 Figure 2 4 Aptamer binding at physiological conditions and room temperature. Flow cytometry assay for the binding of the aptamers ADE1, DE2, EJ2, EJ4, EJ5, and EJ7 with H23 (target cell line) at 25C and physiological temperature (37C). Binding at 4C was used as the posi tive control. The green curve represents the background binding of a random sequence (library).

PAGE 65

65 Figure 2 4 Aptamer binding at physiological c onditions and room temperature. Continued Copyright 2012. Jimenez. This is an open access article distri buted under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited

PAGE 66

66 Figure 2 5 Control experiment for fixed treated cells. Binding assay of aptamer Sgc8 with (A) CEM (target) cells and (B) Ramos (control) cells before (left) and after (right) fixation, showing that no artificial fluorescence signal was produced. Copyright 2012. Jimenez. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited

PAGE 67

67 Figure 2 6 Binding assays after fixation with 10% formalin. Binding assay of aptamers with H23 (target) cells pre fixed with 10% formalin. Left columns show the binding of aptamer ADE1, ADE2, EJ2, EJ4, EJ5 and EJ7 with untreated cells at 4C. Right column shows the binding of the same aptamers EJ5 with fixed cells. The light green curve re presents the background binding of a random sequence (library).

PAGE 68

68 Figure 2 6 Binding assays after fixation with 10% formalin Continued Copyright 2012. Jimenez. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited

PAGE 69

69 Figure 2 7 Binding assays after proteinases treatment. Flow cytometry assay for aptamers ADE1 and ADE2, EJ5 and EJ7 after treatment with proteases; untreated cells were used as positive control. Left side shows cells treated with trypsin for 3 and 10 min prior binding with aptame rs ADE1 and ADE2, EJ5, and EJ7 respectively. Right side shows cells treated with proteinase K for 3 and 10 min prior binding with aptamers aptamers respectively.

PAGE 70

70 Figure 2 7 Binding assays after proteinases treatment Continued Copyright 2012. Jime nez. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited

PAGE 71

71 CHAPTER 3 VALIDATION OF LU NG CANCER APTAMERS IN LUNG CANCER CELL LINES AND CLINICAL SAMPLES Introduction Several types of specimens are available for conducting cancer research including animal models 111 112 fresh tumors or tumor derive d samples and cultured cell lines 113 114 The animal models developed for NSCLC and SCLC have primarily been generated by genetic modification of oncogenes allowing detailed study of initiation and progression of cancer 115 Fresh tum ors are ideal for the study of any type of cancer, but their availab ility to researchers is limited, and validation is required for the tumor to become an appropriate preclinical model. Cultured cell lines have been used in past decades ; and have contributed considerably to translational research in lung cancer as well as to the discovery of new anticancer drugs. Currently, there are more than 500 lung cancer derived cell lines available for rese arch 116 with possess many advantages such as indefinite replication, clonal selection, a nd opportunity to assess invasion and tumorigenicity studies to cite a few 117 Despite much criticism as to whether these cancer cell lin es resemble cancer in vitro due to lack of tumor architecture, genomic instability etc their genomic similarities to their parent tumor s making cultured cell lines very useful in cancer research 118 To date, the most common probes to study cultured cell lines are antibodies. However, as discu ssed previously aptamers can be use d as probes as well as their counterpart antibodies. Furthermore, a panel of aptamers can be used for surface marker profiling, to monitor lung cancer recurrence, and as a tool for NSCLC classification into different subgroups. Overall, the aptamer based a pproach with

PAGE 72

72 cultured cells will allow the understanding of different aspects of the disease, thereby offering the possibility of a holistic understanding of lung cancer from the onset This chapter describes profiling studies on aptamers selected for the different histological subtypes of lung cancer as well as staining of cancer slides from cultured cell lines Our expectations were to find aptamers that could profile specific groups especially those for which the classification scheme is still not accu rate 119 Results and Discussion With only about two decades since its discovery by Ellington and Szostak 68 aptamers have become an emergent class of molecules for use in analytical, nanotechnology as capture and delivery molecules 15 In the biomedical field, aptamers are also use d as the counterpart of antibodies in diagnostics, acting basically as molecular re cognition probes. However, the clinical application of aptamer s is still under investigation Previously has been demonstrated the use of aptamer for immunostaining of formalin fixed and paraffin embedded tissues (FFPE) 108 was described previously This dissertation provides further support for the clinical application of aptamers selected for lung cancer by cell SELEX in culture cell lines, artificial tissues and patient tissue samples. For this project, a panel of 12 different aptamers selected against lung cancer both NSCLC 109 120 and SCLC 121 were used. They were subjected to binding assays against a representative pool of lung cancer cell lines to identify the sequences with ubiquitous binding, independently of the ir histological subtype As preliminary data all aptamers were tested for binding against the normal human bronch ial epithelial cell line HBE135 E6/E7 and also under formalin fixed conditions The purpose was to exclude probes incapable of (1) differentiating a normal lung cell line from a lung cancer cell line, and (2) binding under fixed conditions as these two characteristics are

PAGE 73

73 essential for the application of aptamers in tissue patient samples. Both [F igures 3 1 and 3 2 ] showed the efficiency of all aptamers in fulfilling the specificity for lung cancer cell lines and the binding affinity with 10% pre fixed cells. Because l ung cancer is innately heterogeneous, it is difficult to find markers that can be applied to the entire field rather that to certain subtypes To address the binding of the lung cancer aptamers, a panel of cell lines representativ e of all the groups and subgroups in lung cancer was utilized to determine if there is any group of aptamers that can differentiate one group from another. [Figure 3 3] shows representative ADC cell lines that were profiled with aptamers generated in three different selections. Results demonstrated that aptamers S1, S6 and EJ4 are capable of binding most of the adenocarcinoma cell lines It is important to note that aptamer HCH03 was initially selected against H69 a SCLC cell line. Since the number of ADC and SCLC cell lines available surpasses the number of SQC and LCC cell lines tested, those will be presented at the end of this chapter Table 3 1, and 3 2 respectively One of the current challenges in lung cancer diagnosis is the effective classification of biopsies or any clinical sample that serve this purpose, specifically for accurate distinction between ADC and SQC 122 Three of the most frequently used NSCLC SQC cell lines in the literature have been used for this purpose shown in [ Figure 3 4 ] Unfortunately, there is no specific aptamer or set of aptamers that can specifically differentiate these two histological subtypes due to the molecular similarities in both subgroups. Therefore the search for a more specific marker continues. One approach to address this problem could be the use of a cell based selection with an SQC cell line as target and an ADC cell line for counter selection. In this manner a

PAGE 74

74 panel of several aptamers could be generated for the differentiation of these two similar histo logical subgroups. The next subgroup analyzed was NSCLC LCC; similarly two cell lines were used for this profiling, H460 and H661. Based on the molecular surface analysis, this group is distant from the NSCLC SQC and ADC, and most of the aptamers used di d not recognize this group [ Figure3 5]. These results suggest that the molecular signatures on the surfaces of LCC cells are different from those on ADC or SQC. The only aptamers that did not follow the above pattern was sgc8, which targets protein tyrosin e kinase 7 (PTK7). The last group analyzed was SCLC, with the majority of th e cell lines being suspension cells [Figure 3 6] shows th e aptamer profiling carried out. Aptamers HCH1, HCH3, HCH7 and HCH12 selected against cell line H69 previously in the tan group the majority of SCLC cell lines displaying specificity for this subgroup. However, aptamer S1 originally developed against A549 an ADC cell line also displayed some affinity towards several cell lines in this group. When all lung cancer cell line s were analyzed as a whole aptamers HCH3, S1 and EJ4 displayed binding among all of the analyzed groups and subgroups. Another aim was to determine the binding capability of these aptamers against formalin fixed and FFPE lung cancer tissue. A t issue mode l was re created by using a cell line as model. Both types of tissue samples were simulated and the results are shown in [F igure s 3 7 and 3 8 ]. Figure 3 8 shows the immunohistochemistry results of formalin fixed tissue using aptamers as recognition molecules. It is important to point out that no antigen retrieval was needed for the recognition of the target by the

PAGE 75

75 aptamers. Aptamers were able to recognize their target s in the fixed tissue and, when compared to the negative control (random DNA) it can be clearly seen that the staining is due to specific binding. Some aptamers like sgc8 showed stronger binding when compared to EJ4 or HCH3. These observations can be explained by t he amount of target expressed o n the surface s of the se cells. Figure 3 8 shows the results corresponding to the imm unohistochemistry of FFPE tissues. One feature that stands out is the intracellular staining of these aptamers when compared to fixed tissue. To address this issue, sampl es were pre incubated with salmon sperm DNA to saturate those DNA binding molecules present in the nucleus o f the cells. Unfortunately, after DNA blocking some nuclear staining was still observed. As the target of this aptamer is still unknown, it could be possible that the target could be also expressed intracellularly. The most notable example of this behavior is the target for nucleolin aptamer AS1411 which expressed not only on the surface of the cell but also in the nucleus 123 A fter both methodologies were performed one important observation was the lack of cell penetration of the aptamers during the staining of formalin fixed tissues. This behavior coul d be an advantage if only extracellular staining is desired, even if the target is also expressed inside the cell.

PAGE 76

76 Table 3 1. Adenocarcinoma cell lines profiled with the panel of lung cancer aptamers. Histological g roup Subtype Cell line NSCLC Adenocarcinoma H23 NSCLC Adenocarcinoma A549 NSCLC Adenosquamous H125 NSCLC Bronchioalvelar carcinoma H358 NSCLC Papillary adenocarcinoma H441 NSCLC Adenocarcinoma H1650 NSCLC Adenocarcinoma H2009 NSCLC Adenocarcinoma H2030 NSCLC Adenocarcinoma H2087 NSCLC Adenosquamous H2286 NSCLC Adenocarcinoma H738

PAGE 77

77 Table 3 2 Small cell lung carcinoma cell lines profiled with the panel of lung cancer aptamers. Histological group Cell line SCLC H249 SCLC H719 SCLC H69 SCLC H60 SCLC H82 SCLC H510 SCLC H446 SCLC H128 SCLC H1672 SCLC H128 SCLC H620 SCLC H446

PAGE 78

78 Concluding Remarks The validation of aptamers was carried out in this chapter by profiling the molecular surface of lung cancer cells in all classified groups. After analysis, it was determined that aptamers HCH3, S1 and EJ4 tend to recognize the majority of lung cancer cel l lines. When individual groups were analyzed, other aptamers displayed a role in differentiation. Analysis of NSCLC ADC cell lines showed aptamers S1, S6 and EJ4 as the major molecular probes in the analysis of the most abundant type o f lung cancer. Simil ar results were encounter ed when the NSCLC SQC subgroup was analyzed. Although only three cell lines were used for NSCLC SQC analysis there seem s to be no aptame r probe capable of differentiating ADC from SQC a current challenge in lung cancer work Larg e cell carcinoma proved to be the most contrastive subgroup from the NSCLC. No other aptamer than sgc8 seem s to displayed affinity for this particular subtype. In contrast, this could be observed as an advantage as any of the mentioned aptamers could be u sed to differentiate this subtype. Finally, for the SCLC group the previously HCH aptamer series seem to be specific for this lung cancer group. H owever, compared to its original H69 target cell line, stronger fluorescence intensity was observed when the H CH aptamers where prof iled with other SCLC cell lines. Material and Methods Instrumentation and Reagents Libraries and aptamers were synthesized using the 3400 DNA synthesizer (Applied Biosystems). All reagents for DNA synthesis were purchased from Glen R esearch. DNA sequences were purified by reverse d phase HPLC (Varian Prostar using C18 column and acetonitrile/triethylammonium acetate as the mobile phase ). The

PAGE 79

79 binding assays for the selected aptamers against different lung cancer cell lines were performed by flow cytometric analysis using a FACScan cytomet er (BD Immunocytometry Systems) and Accuri Cell Culture and Buffers A total of twenty seven established cell lines were used in this project, corresponding to both histological groups NSCLC and SCLC. The cell line s were maintained in RPMI 1640 (ATCC) culture medi um supplemented with 10% Fetal Bovine Serum (FBS heat inactivated) and 1% penicillin streptomycin. Cells were incubated at 37C under 5 % CO 2 atmosphere. Flow Cytometric Analysis Flow cytometry was used to monitor the enrichment of ssDNA bound sequences within the pools during the selection process, as we ll as to evaluate the binding affinity and specificity of the selected aptamers. The cultured cells were washed with WB before and after incubation with the FITC ssDNA pool or selected DNA sequences Fluorescence intensity was determined on a FACScan cytometer (BD Immunocytometry). Binding Assays Different f amilies of sequences retrieved from multiple sequence analyses were synthesized, biotin labeled end and tested for binding with the positive and negative cell line In addition, the binding selectivity of each candidate was determined by incubating a 250nM aptamer solution with 4 x 10 5 ta rget or counter cells for 30 minutes at 4C. Cells were washed twice with WB and incubated with streptavidin PE beads for 20 minutes at 4C. After washing, the cells were suspended in 200L WB.

PAGE 80

80 The fluorescence was determined with a FACScan cytometer by counting 3x10 4 events. A randomized 80 mer sequence was used as a control.

PAGE 81

81 Figure 3 1.Binding assays of lung cancer aptamers with normal bronchial cell line HBE 135 E6E7. Aptamers HCH3, HCH7, EJD5, EJD7, S1, DOV4, EJ4 and Sgc8 were su bjected to binding assay with normal cell line.

PAGE 82

82 Figure 3 2.Binding of lung cancer aptamers after fixation with 4% paraformaldehyde. Aptamers HCH3, HCH7, EJD5, EJD7, S1, DOV4, and Sgc8 were subjected to binding after chemical fixing treatment. Ap tamer TTA1 was used as negative control to show that fluorescence intensity does not increase due to fixation.

PAGE 83

83 Figure 3 3. Profiling of cell line H2087 ADC with the lung cancer aptamer panel: HCH1, HCH3, HCH7, HCH12, S1, S6, S11e, S15, ADE1, ADE2, EJ5, EJ7, Sgc8, DOV4, and EJ4 were subjected to binding assays using flow cytometry.

PAGE 84

84 Figure 3 4. Profiling of SQC cell lines: A) H520, B) H226, and C) LUDLU 1. Aptamers: HCH1, HCH3, HCH7, HCH12, S1, S6, S11e, S15, ADE1, ADE2, EJ5, EJ7, Sgc8, DOV4, and EJ4 were subjected to binding assays using flow cytometry

PAGE 85

85 Figure 3 4. Profiling of SQC cell lines: A) H520, B) H22 6, and C) LUDLU 1. Continued.

PAGE 86

86 Figure 3 4. Profiling of SQC cell lines: A) H520, B) H226, and C) LUDLU 1. Continued.

PAGE 87

87 Figure 3 5. Profiling of LCC cell lines: A) H460, B) H661. Aptamers: HCH1, HCH3, HCH7, HCH12, S1, S6, S11e, S15, ADE1, ADE2, EJ5, EJ7, Sgc8, DOV4, and EJ4 were subjected to binding assays using flow cytometry

PAGE 88

88 Figure 3 5. Profiling of LCC cell lines: A) H460, B) H661. Continued

PAGE 89

89 Figure 3 6. Profiling of cell line H2679 SCLC with the lung cancer aptamer panel: HCH1, HCH3, HCH7, HCH12, S1, S6, S11e, S15, ADE1, ADE2, EJ5, EJ7, Sgc8, DOV4, and EJ4 were subjected to binding assays using flow cytometry

PAGE 90

90 Library EJ4 DOV4 Figure 3 7 Immunohistochemistry of formalin fixed artificial tissues. Aptamers EJ4, DOV4, and Sgc8 were used as recognition molecules in artificial tissues produced with NSCLC ADC H23 cell lines.

PAGE 91

91 Figure 3 8 Immunohistochemistry of FFPE artificial tissues. Aptamers DOV4, EJ4, and Sgc8were used as recognition molecules in artificial tissues produced with SCLC NSCLC ADC H23 cell lines.

PAGE 92

92 CHAPTER 4 DETECTION OF CTCs USING APTAMERS IN NSCLC and SCLC Introduction During carcinogenesis, normal cells suffer mutation s that cause them to grow indefinitely and to invade surrounding tissues. As th e tumor develops, cells disseminate from the tumor can enter different biological f luids (sputum, urine, blood, etc.) through different mechanisms at the e arly stage of tumor development 124 These circulating tumor cells CTCs have signi ficant impact on the early detection of tumor. However, due to the trace amounts of them in the biological fluids, CTCs are very difficult to target Several studies have confirmed the present of tumor cells in the peripheral blood of many cancer patients 125 126 12 7 Therefore, the isolation of these cells has been proposed in order to gain more insight into the biology of cancer pathogenesis, as well as the different morphological changes during carcinogenesis. Unfortunately, due to the lack of specific markers, the identification and study of these cells have posed a great challenge. In the blood there are millions of blood derived cells especially red blood cells and lymphocytes which are the most abundant. In the early 2000 s several groups started to design different strategies to capture the se rare cells. Microfluidic channels 128 magsweeper designs 129 a nd magnetic separations 130 combined with specific antibodies demonstrated that CTC s can be captured in this complex mixture. Detection of CTCs relies on features that distinguish them from blood derive cells. For example, CTCs are generally larger in size when compared to RBC and WBC. CTCs as disseminated cells present features close to normal cells with membrane properties unlike blood cells. Finally, the molecular differences are perhaps the most exploited

PAGE 93

93 features in research. Different ma rkers such cytokeratins 19 131 and 20 132 present only in the cytoplasm of epithelial derived cells, but not in blood cells. T he most wide ly used is Epithelial Cell Adhesion Molecu le (EpCAM) 133 a nd this glyco protein represents perhaps the Holy Grain of CTC detection. Several studies had been developed using this molecule as the differenci ng factor with blood related cells. Despite many studies on this topic 134 135 136 t he only technology fo r the detection of CTC approved by the Food and Drug Administration (FDA) is CellSearch 137 for the detection of metastatic breast, colon and colorectal cancer. This chapter aims to generate an efficient and sensitive method for the detection of circulating tumor cells in peripheral blood samples of lung cancer patients using aptamer magnetic nanoparticle (MNP) conjugates to detect and co llect exfoliated tumor cells from the bloodstream. For CTC detection in SCLC aptamers in combination with flow cytometry will help us to detect and enumerate this population Results and D iscussion As previously mentioned, EpcAM is the molecule primarily used to differentiate epithelial cells from blood cells. Therefore the first step in our project was to profile different NSCLC and SCLC cell lines with EpCAM Antibody (Ab) Expression of EpCAM in NSCLC Cell L ines A total of seven cell lines were tested w ith EpCAM Ab. In this pool of cell lines, the four histological subgrou ps were included in order to provide a more general profiling within this subgroup. As shown in [ Figure 4 1 ] EpCAM glycoprotein is not widely express in the surface membrane of NSCLC ce ll lines. These results were surprising as this protein is a well known epithelial marker and as mentioned previously ~ 95% of lung cancers have epithelial origin. Therefore, the question that

PAGE 94

94 rose was Is EpCAM a good molecular marker for the detecti on of CTCs in lung cancer ? However, it was noticed that the histological subgroup ADC shows a more consistent expression patter n as a subtype when compared to NSCLC or lung cancer as a whole. and compared to literature in which resected ADC tissues were tested for EpCAM 138 Aptamers B inding with Blood Derived C ells Lacking knowledge of the s to apply our proposed methodology for the detection of CTCs in both SCLC and NSCLC, aptamers were tested with both RBCs and PBMCs. As for the Abs used in the methodology, it is well k nown that EpCAM is not express ed o n the membrane surface of RBCs or PBMCs. However, CD56 is express on Natural Killer (NK) cells a small percentage subpopulation of PBMCs 139 The histograms corresponding to the binding studies of aptamers and blood derived cells RBCs and PBM Cs are shown in [Figure 4 4] After corroboration of target s are not present in blood derived cells. Up to this point the presented data was necessary for both methodologies in order to determine the correct cell lines, Abs and screening of cells present in blood H1650 or H358 as Model Cell L ine for CTCs D etection in NSCLC As this project involves the application of previously selected aptamers for lung cancer as the recognition and detection reporting molecule s, ADC and SCLC cells were profiled with previously selected aptamers as shown in C hapter 3 of this dissertation. In simple words the cell line selected for NSCLC should be positive for both markers (EpCAM) and lung cancer aptamers. [Figure 4 3] represents the proposed methodology

PAGE 95

95 for the magnetic detection of CTCs using t he H1650 cell line as the lun g cancer model M ethodolo gy for the detection of CTC in NSCLC Indirect and direct methodologies were used. In the direct method the biotinylated aptamers are conjugated directly to MNP prior to incubation with the buffy coat containing spiked H1650 cells. For t he indire ct method th e biotinylated aptamers are incubated with the B C containing spiked H1650 cells followed by the addition of the MNP s In other words, in the direct method the streptavidin biotin chemistry occurs outside and prior to contact with the buffy coat. In th e indirect method, the chemistry streptavidin biotin chemistry occurs in situ in the BC. When both methodologies were carried out to detect CTCs in blood, different ou tcomes were observed [Figure 4 4 ]. The indirect method captured ap proximately 30 % more cells than the direct method. This behavior can be attributed to the flexible accessibility of aptamers t o bind with CTCs when incubated prior to the addition of MNPs. Two situations can affect the effective detection of CT C during the direct method ology: a s teric effect s and aggregation ca n occur between MNPs in solution, reducing the number of aptamer target binding events thus reducing capturing efficiency. After the observation of these preliminary results, the direct methodology was employed in subsequent experiments. M icroscopy Images of Captured Spiked C ells As previously described in the methodolog y scheme, p re labeled EpCAM H1650 cells were spiked in different ra tios when compared to the number of background cells present in BC. Spiked cells were isolated using an aptamer as a capturing molecule. [Figure 4 5 A & B ] shows commercially available MNPs and EpCAM labeled ADC H16 50 cells p rior spiking into BC [Figure 4 5 C] s hows H1650 cells captured by aptamers. These spiked cells are completely surrounded by complex MNPs that were

PAGE 96

96 non covalently linked to aptamers via streptavidin biotin chemistry at 4C. This che mistry is one of the most exploited and applied in biomedical applications due to its fl exibility in bindin g conditions, its high specificity and its non covalent bond, which is the strongest known 140 Also, aptamers and antibodies can be biotinylated performed to without compromising their binding ability. Because the spiked H1650 cell aptamer MNP are bound covalently, strong conditions are necessary to break that bond. Such conditions are harsh to cells and therefore could not be performed. Instead DNAse I treatment was able to cleave the aptamer (DNA) from the H1650 cells thus re leasing the cells without damage. This step was important as the captured cells needed to be confirmed by confocal microscopy for EpCAM expression in order to exclude them from PBMCs. C apturing Efficiency of Aptamer MNP C omplex Further experiments were c arried out using spiked cells in concentrations close to those reported by cell search for metastatic patients ( between 1 and 500 spiked cells in 7.5mL of blood ) The direct methodology was applied, and captured cells were excluded from PBMCs by EpCAM labe ling using fluorescence microscopy [Figure 4 7 ] shows the capturing efficiency when different numbers of CTCs were spiked into BC. As the number of spiked cells was decrease d in comparison to the number of background cells (PBMCs) the efficiency of our methodolog y decreased from 90% when 1 CTC was spiked in 200 PBMCs to 30% when 1 CTC was spiked into 20,000 PBMCs These results are in concordance with similar approaches report ed in the literature 126 127 As expected as the number of target cells decrease s when

PAGE 97

97 compared to background, the target efficiency is reduced and the number of non specific binding events decreases Concluding R emarks Based on the results presented, ap tamers previously selected using cell SELEX technologies can be translated into biomedical application such detection of exfoliated cells in blood. Currently, the only FDA approved methodology is CellSearch for metastatic breast, prostate and colorectal ca ncer. Lung cancer is still understudied in this field, and according to the results presented in this dissertation we hypothesize that this lack is due to the inconsistent expression of EpCAM in lung cancer in contrast to other cancers. We have overcome t his problem by using aptamers as the capturing molecule instead of EpCAM as reported in literature. EpCAM was used as a positive control marker to corroborate the identity of the captured cells. Detection of CTCs in SCLC EpCAM Expression in SCLC C ell L ine s Similarly to NSCLC, SCLC cell lines were profiled for EpCAM [ Figure 4 8 ] Again its expression level was non ubiquitous within this group. These results were also confirmed in the literature which showed the expression was variable in neuroendocrine lung tumors 141 Based on these results, t he search for a more universal marker within th e neuroendocrine SCLC group bega n. CD56 Expression in SCLC C ell L ines After a literature search, Neural Cell Adhesion molec ule (NCAM) seemed to be a good biomarker candidate 142 To validate this, a pool of SCLC cell lines was subjected to binding studies with NCAM Ab also known as CD56 Ab. In contrast, to the results for EpCAM, the expression was found in 95% of the cell lines tested [ Figure 4 9 ]

PAGE 98

98 H1836 as Model Cell Line for CTC D etection in SCLC As this project involves the application of previously selected aptamers for lung cancer a s the recognition and detection reporting molecule, SCLC cells lines were profiled with previously selected aptamers as shown in chapter 3 T he cell line selected for SCLC needed to be positive for both markers ( CD56) and lung cancer aptamers. H1836 was selected as the lung cancer model. As shown in [Figure 4 10 ], the chosen cell line has binding affinity with most of the aptamers against lung cancer selected in our laboratory. Once the SCLC cell line was chosen, the methodology pictured below was carried out using H1836 cells Optimization of Conditions for CTC D etection To start with the proposed methodology, a standardization procedure was carried out using a large quantity of cells. Two different spiking system were used, one before the analysis on the flow cytometer machine, and one at the very beginning of the blood preparation methodology. Two different re sults were observed [Figure 4.1 2 ] The CTC pattern is clearer w hen cells are labeled with bot h Aptamer and Ab separately than when labeling occurs in situ r evealing high background in t he FL 3 channel (aptamer labeling). In this particular case, since the CD56 Ab is FITC labeled, we chose PE.Cy5.5 dye to conjugate with the biotinylated aptamers in order to avoid compensation during analysis. Background Optimization To help determine the cause of high background, other dyes were used at concentrations similar to those used with PE.CY5.5 A ll flow cytometry results disp layed

PAGE 99

99 some background but no t as high as the results for samples using PE. CY5.5 Allophycocyanin (APC) dye was chosen [Figure 4 13 ] as it is observed on channel 4 and therefore there is no signal overlap between channels and no compensation is necessary. In independent experiments carried out in the lab by other members the same observation was noticed, suggesting that the protein albumin, which is highly present in blood, has affinity for PE.CY5.5 A fter the best fluorophore was de termined the trial experiments were carried out to determine if the aptamers or the antibodies used for this methodology were feasible by subjecting them to binding assays with extracted BC. Res ults can be seen in [Figure 4 14 ] in which the percentage of background in the FITC channel and the APC channel for the aptamers and antibodies was less than 1% except for aptamers HCH3, HCH7 and DOV4 with background of approximately 4%. The later value is still considered small when compared to the entire population within the buffy coat. Thus, after these results it was determined that the level of background was ac ceptable for further experiments. Detection of CTCs Using High Count N umber After most of the parameters were optimized, t he first goal was to determine whether spiked cancer cells would be seen as a different population from blood d erived cell s by flow cytometry As shown in [Figure 4 1 5 ] the population of spiked H1836 can be clearly seen and differentiate from blood derived cells in the BC. These spiked cells showed high percentage of labeling with CD56Ab. In contrast the aptamer cocktail labeling is not as high as with Ab. In other wor ds the aptamer labelin g is not 100% efficient Based on these results it was hypothesized that due to the high content

PAGE 100

100 nu mber of PBMCs in the buffy coat prevented the aptamer solution from reaching saturation during binding assays. To solve this issue th e concentration of aptamer in solution was increased from 250nM to 500nM. (It is important to note, that during regular binding assay s for H1836 cells with lung cancer aptamers the labeling efficiency was never 100% ) Detection of CTCs U sing a R epresenta tive Number of C ells As previously mentioned, SCLC is a more aggressive disease when compared to the NSCLC subgroup. Therefore a high tumor burden is expected in patients with metastatic SCLC. Based on this premise, further experiments were carried out con taining 500 and 250 spiked cells in whole blood before treatment. [Figure 4 16 ] shows the different populations and gates that were set when trying to detect a small number of spiked cells. Figure 4 16 A and Figure 4 16 B show the behavior of BC with no lab eling molecules, and buffy coat labeled with CD56 Ab. As mentioned previously, some NK cells are present in PBMCs and are positive for CD56. Therefore, a small subset population is expected to shift towards the FITC channel. In that particular dot plot a t hreshold was set to determine intrinsic fluorescence signal expected when cells are incubated with NCAM Ab. Figures 4 17 C and D show BC containing 500 spiked H1836 cells ( ( CTCs) when conjugated to t he respective control for Ab(C) or apt amer cocktail (D). In figure 4 16 Isotype IGg1 and random DNA Spiked cells (shown in blue) did not produce a signal in either of the two channels ( FITC or APC ) In contrast, when the same set of cells was labeled with CD56 and aptamer cockta il, the spiked population shifted completely to the APC channel, and partially to the FITC channel. F r o m these results we confirmed that the increase in

PAGE 101

101 aptamer concentration from 250nM to 500nM solved the problem of labeling with aptamer, suggesting an op timization f or the concentration of aptamer s in future experiments. During Ab optimization another issue was encounter ed Several repeats showed high background of cells i n APC channel population circled and arrowed [Figure 4 17 ]. Contribution of D ead Cel ls to Aptamer B ackground When reviewing the methodology used and all the steps during the spiking experiments, it was noted that the background problem was not obser ved during optimization, and the differences in obtaining the working sample (BC) for those two set of experiments were considered For the starting optimization BC was obtained using freshly isolated blood from healthy donors. As for the spiking experiments, one the objectives was to mimic as much as possible the sample s to be acquired from th e Clinical and Translational Science Institute (CTSI) reposito ry at the University of Florida. The CTSI blood samples were immediate ly process ed and stored at 80C until required for analysis. Therefore, it was hypothesize that the dead population could b e cells that do not survive during the freezing and/ or thawing process. These observations were addressed when using high number of spiked cells. The population can be distinguished, but it could be due to the numbers of spiked cells. However, it was uncer tain whether the background would have an effect on determined the desired population when a small number of cells were to be spiked. One quick way compatible with our methodology to prove the hypothesis was to include in the labeling with 7 Aminoactinomyc in D (7 AAD) fluorescence molecule before flow cytometry analysis. [Figure 4 18 ] shows how 7 AAD molecule labeled some population confirming that dead cells were responsible for the background observed in previous figure.

PAGE 102

102 Detection of CTC in B lood S amples After troubleshooting with dead cells, the spiking experiments using sample mimicking of metastatic patient samples were begun. The dot plot using a high number of spiked cells served as positive control for the followi ng experiments. [Figure 4 19 ] panel A & B shows no backgrou nd for Ab and aptamer cocktail, s u ggesting that, changes in the methodology alleviate the flaws observed earlier in this chapter. Panel C shows BC with 200,000 spiked cells labeled with both Ab and aptamer and completely differentiat e and isolated in gate P4 in figure 4 19 In panel D the same reading was performed, but random DNA was used as a negative control. No cells were spotted on gate P4, confirming that the shift in fluorescence intensity for both channels FITC and APC was du e to the presence of the particular targets in the membranes of spiked cancer cells, but not in the BC cells. Limit of Detection Further experiments were carried out to determine the limit of detection using FACS. A series of dilutions with spiked c ells was analyzed A set containing 5 samples ( 250, 125, 64, and 32 spiked cells in buffy coat) was tested in triplicate and lowest detected values were reported. [Figure 4 2 0 ] presents the histograms the analysis corresponding to each one of the groups tested . As observed in [F igure 4 20 ] CTCs were able to be detected in each of the dilution series tested. However, the percentage of detection was not consistent throu ghout the analysis of the set. I n panel A, when 250 cells were spiked a total of 230 cells were collected by the sorter corresponding to 92% of the total spiked population. Panel B represents the analysis of 125 spiked cells ; a total of 73 cells were r ecovered

PAGE 103

103 corresponding to 58% of the total spiked population. For panels C & D an equal amount of cells was detected independent of the number of cells spiked ; 13 cells were detected when either 64 or 32 cells were spiked in BC corresponding to 20% and 40% respectively. These results showed ambiguit ies and no direct correlation between the number of spiked cells and the number of cells retrieved. Taken together, the presented results suggest that the LOD for CTCs in BC using FASC is approximately 60 cells. To date, there is only one recent report of using aptamers for the detection of CTCs. In thi s work, Shen et al coated a microfluidic device through which the spiked blood travel ed 143 In our work, it was imperative to show the potential of using aptamers to detect a few spiked cells mixed with millions of PBMCs Our results further reinforce the importance of the high specificity of aptamers. Perhaps, while numerous reports continued are publishe d, the need to find a biomarker common to these CTCs continued to be essential to further improve cancer treatment and prognosis 144 Detection of CTCs in Metastatic SCLC P atients One year from the approval of IRB 634 2011 the CTSI at the University of Florida consent and start collecting blood from metastatic patients. As reminder, SCLC represents approximately 15% of all lung cancer cases. A total of 10 samples were acquired at the time of analysis. Five samples corresponded to metastatic patient samples prior chemotherapy treatment. The other five were obtained after chemotherapy treatment. After optimization and troubleshooting of the proposed method ology, it was decided the only the set of samples corresponding to the group before chemotherapy will be analyzed. Depending of the results accomplished with this group, the next set would be analyzed. [ F igures 4 21 to 4 25 ] show the results.

PAGE 104

104 As it can be observed in the analysis of the patient samples, some of the provided BC separate by the CTSI show a high number of dead cells making the application of the proposed methodology challenging. Overall, i n the five patient samples analyzed our technology was able to detect and enumerated at least 1CTCs in 7.5mL of blood from metastatic patient samples. It was expected to detect similar number of CTCs as all the patient samples corresponded to metastatic stage prior chemotherapy. In contrast, the number of CTC s detected correlated with the quality of the sample; in poor quality samples the number of CTCs cells detected was very low compared to the samples with good quality. Further analysis is required on those cells detected in Q1 or Q4 as the efficiency of th e labeling could n ot have been 100% efficient, corroboration with cytokeratins and DAPI can be used to determine if any CTCs was missed during the enumeration process Concluding R emarks These results showed that aptamers are molecules capable of performi ng tasks in the biomedical field. Th ey enable d the specific isolation of spiked CTCs cells in blood with minimum treatment, indicating the potential of using oligonucleotides in a n automated methodology that could become part of a routine cancer follow up in the progression cancer therapies. The limit of detection was as low as 60 cells in 7.5 mL of blood. Furthermore this principle could be applied to a less complex sample such a liquid biopsy or sputum in which the number of background cells is decreas ed.

PAGE 105

105 Material and Methods Instrumentation and R eagents Libraries and aptamers were synthesized using the 3400 DNA synthesizer (Applied Biosystems). All reagents for DNA synthesis were purchased from Glen Research. DNA sequences were purified by reverse d phase HPLC (Varian Prostar using C18 column and acetonitrile/triethylammonium acetate as the mobile phase ). The binding assays for the selected aptamers against different lung cancer cell lines were performed by flow cytometric analysis using a FACScan cy tomet er and Accuri (BD Imm unocytometry Systems). Cell Culture and Buffers A total of two established cell lines was used in this project, H1650 and 1836, which were kindly provided by Dr. Frederick Kaye at the University of Florida. Cell lines were maintai ned in RPMI 1640 (ATCC) culture medi um supplemented with 10% Fetal Bovine Serum (FBS heat inactivated) and 1% penicillin streptomycin. Cells were incubated at 37C under 5% CO 2 atmosphere. All previous reagents were purchased from Sigma Aldrich. To detach cells from the culture plate, non enzymatic cell dissociation buffer was used, and the washing steps with (WB) containing 4.5 g/L MgCl2 (PBS Sigma). Binding buffer (BB) used f or aptamer binding was prepared by adding yeast tRNA (0.1 mg/mL, Sigma) and BSA (1 mg/mL, Fisher) to the washing buffer to reduce non specific binding. All other reagents were purchased from sigma aldrich.

PAGE 106

106 Flow Cytometric Analysis Flow cytometry was used to monitor the enrichment of ssDNA bound sequences within the pools during the selection process, as we ll as to evaluate the binding affinity and specificity of the selected aptamers. The cultured cells were washed with WB before and after incubation with the FITC ssDNA pool or selected DNA sequences Fluorescence intensity was d etermined on a FACScan or Accuri (BD Immunocytometry) cytometer Binding Assays with A ntibodies EpCAM and CD56 FITC antibodies were purchase d from BD Biosciences and tested for binding with the target cells H1650 and H1836. In addition, the binding selectivity of each Ab was determined by incubating 20L of Ab solution with 4 x 10 5 ta rget cells for 60 minutes at 4C. Cells were washed twice wi th PBS and suspended in 200L PBS The fluorescence was determined with a FACScan or accuri cytometer by counting 3x10 4 events. Isotype IgG1 FITC was used as a control. Binding Assays with A ptamers Different f amilies of sequences retrieved from multiple s equence analyses were synthesized, biotin labeled end and tested for binding with the target cells H1650 and H1836. In addition, the binding selectivity of each aptamer was determined by incubating a 250nM aptamer solution with 4 x 10 5 ta rget or counter cells for 30 minutes at 4C. Cells were washed twice with WB and incubated with streptavidin PE beads for 20 minutes at 4C. After washing, the cells were suspended in 200L WB. The fluorescence was determined with a FACScan cytometer by co unting 3x10 4 events. A randomized 80 mer sequence was used as a control.

PAGE 107

107 Preparation of Freshly BC from Whole B lood Blood from healthy donors was purchased from Life South Gainesville Florida. Upon arrival, fresh blood was subjected to differential centri fugation using Histopaque 1 077 (sigma). A 5mL aliquot of solution histopaque was placed int o a 15mL conical centrifuge, 7mL of freshly acquired blood was place onto the histopaque layer and centrifuged at 400g for 30 minutes. After centrifugation three diff erent layers were observed: top layer containing plasma and blood proteins, middle layer containing buffy and bottom layer RBCs. The plasma layer was carefully removed and the BC layer was placed on a 15mL centrifuge tube and 3mL of PBS was added to wash the extracted layer and the tube was centrifuge d at 250g for 10 minutes. Supernatant was aspirated and the pellet was suspended in PBS buffer. Spiked H1836 Cells in B lood The same procedure was followed when different number of cells were sp iked in blood before treatment. Cells were harvested and count ed before each experiment. A specific number of cells was added to blood Blood was transferred to a 15mL conical centrifuge tube and 7mL of RBCs cell s, which had previously being lysed using red blood lysis buffer (S igma) was added and incubated on ice for 10min. Then the mixture was centrifuged at 4,000rpm for 10min. The supernatant contain ing lysed RBCs was removed. The RBC removal process was repeated twice to ensure that the minimum number of RBCs was present in the BC. In the final step BC was suspended in PBS for future use. Labeling of CTCs for M agnetic S eparation After the BC con taining spiked cells were isolated (above procedure) they were subjected to with labeling with Ab and aptamer cocktail. BC was washed twice with WB

PAGE 108

108 and incubated with either Isotype IGg1 or Ab EpCAM for 1 hour at 4C. After incubation cells were washed twice and incubated with either random DNA (library) or aptamer cocktail for 30min at 4C. After the la beling steps, Streptavidin coated magnetic beads were incubated with BC containing spiked cells for 1 hour at 4C. Then the mixed sample was place d on a magnetic stand for 10 min and washed three t imes to ensure specific capture Captured CTCs were treated with DNAse I for 30 min at 37C. Released cells were examined using a fluorescence microscopy to corroborate EpCAM labeling. Labeling of CTCs for i ts D etection U sing FAC S S orter After BC containing spiked cells, were is olated (above procedure) they were subjected to labeling with Ab and aptamer cocktail. BC was washed twice with WB and incubated with either Isotype IGg1 or Ab CD56 for 1 hour at 4C. After incubation cells were washed twice and incubated with either random DNA (library) or aptamer cockta il for 30min at 4C. Similarly, labeled BC was washed twice with WB and incubated with streptavidin conjugated APC for 20 min at 4C. After the labeling steps, cells were analyzed using a FACS and sorter based on dual labeling. As a final step 2L of 7AA D was incubated to each sample before flow cytome try

PAGE 109

109 Figure 4 1 EpCAM expression in NSCLC cell lines. Cell lines from histologic subtypes ADC, SQC, and LCC were used for the binding assays. H23, A549, H1650, H358 correspond to ADC, H520 SQC and H4 60 LCC.

PAGE 110

110 Figure 4 2 Aptamer binding with blood derived cells. Aptamers HCH3, HCH12, sgc8 and DOV4 were tested with RBCs and PBMCs

PAGE 111

111 Figure 4 3. Scheme of proposed methodology for the detection of CTCs in NSCLC using blood from healthy donors as a model: H1650 cells were spiked into blood followed by the lysis of RBCs, leaving only PBMCs. This complex mixture is referred as the Buffy Coat (BC). Ap tamers were conjugated separately with magnetic nanoparticles (MNP) coated with streptavidin protein via the biotin chemistry. H1650 and aptamer MNP complex were added too the BC, and the mixture was subjected to magnetic force, in which cells attached to aptamers MNP spiked cells were separated from BC. To release captured CTCs treatment with DNAse I was performed.

PAGE 112

112 Figure 4 4. Captured CTCs by direct and indirect methodologies. Initially 30K, 50K and 100K were spiked into blood to determine the best methodology.

PAGE 113

113 Figure 4 5. Transmittance light images of captured spiked cells. A) Image of commercial MNPs (63x). B) Image of EpCAM labeled cells prior spiking. C) Images of capt ured H1650 cells.

PAGE 114

114 Figure 4 6. Fluorescence microscopy of captured H1650 (40x).

PAGE 115

115 Figure 4 7. Capturing efficiency of the aptamer MNP based approach. Different number of cancer cells was spiked into buffy coat at different concentrations with respect to the number of background cells.

PAGE 116

116 Figure 4 8 EpCAM expression in SCLC cell lines Cell lines H446, H128, H2679, H1836, H60, H372, H1607, H1672, and H2347 from the SCLC subgroup were tested for EpCAM Ab.

PAGE 117

117 Figure 4 8 EpCAM expression in SCLC cell lines. Continued

PAGE 118

118 Figure 4 9 CD56 expression in SCLC cell lines. H60, H128, H249 H1836, H60, H372, H620, H1672, H738, and H446 cell lines were tested for NCAM Ab.

PAGE 119

119 Figure 4 9 CD56 expression in SCLC cell lines. Continued

PAGE 120

120 Figure 4 10 H1836 profiling with lung cancer aptamers. Cell lines H1836 was profiled with aptamers SCLC HCH1, 3, 7 & 12 and NSCLC S1, S6, S11e, S15, ADE1 & ADE2.

PAGE 121

121 Figure 4 11. Scheme of proposed methodology for the detection of CTCs in SCLC. Blood from healthy donors will used as a model: Different amou nts of H1836 cells were spiked into blood followed by the lysis of RBCs after PBMCs. This complex mixture is referred as Buffy Coat (BC). EpCAM Ab and aptamers were incubated, fluorescence for both signal molecules were detected and isolated using a FASCAN sorter machine. Isolated cells were labeled with Abs to corroborate their cancerous status.

PAGE 122

122 Figure 4 12. Difference in flow cytometry reading of CTCs spiked either at the beginning or the end of the methodology.

PAGE 123

123 Figure 4 13. Optimization of the dye use for the conjugation to aptamers. Dyes PE.Cy5.5 and APC were tested with freshly extract buffy coat to determine their innate background.

PAGE 124

124 Figure 4 14. Background analysis of cocktail aptamers and Ab with freshly extracted buffy coat usin g flow cytometry. Isotype IGg1, Ab CD56, random library, and aptamers HCH3, HCH7, sgc8 and DOV4 were tested.

PAGE 125

125 Figure 4 15. Detection of 250K spiked cells in blood. H1836 cell line was spiked in BC and stained with Ab and cocktail aptamers for subseque nt flow cytometric analysis. Quadrant was set based on the fluorescence intensity of BC with CD56 and random library.

PAGE 126

126 Figure 4 16 Detection of CTCs in blood. 500 cells corresponding to H1836 cell line were incubated with BC. A) Shows BC cell only. B) Shows BC cells stained with Ab CD56. C) BC containing CTCs stained with Ab CD56 and rand om DNA. D) BC containing CTCs with CD56 and cocktail aptamers.

PAGE 127

127 Figure 4 17. Background during CTCs detection. Dot plot on the right shows a high number of background cells in the APC channel.

PAGE 128

128 Figure 4 18. BC cells only stained with Ab CD56, aptamer cocktail and 7 AAD. Both dot plot shows live (grey population) and dead (orange population) cells present during analysis.

PAGE 129

129 Figure 4 19. Elimination of background cells in channel APC and CTCs detection using 250k cells. A) BC cells stained with Ab CD56. B) BC cells stained with aptamer cocktail. C) BC containing CTCs aptamer cocktail. D) BC containing CTCs stained with random DNA (library).

PAGE 130

130 Figure 4 20. Determination of the LOD for CTC detection. A) Detection of CTCs using 250 spiked cells in BC. B) Detection of CTCs using 125 spiked cells in BC. C) Detection of CTCs using 64 spiked cells in BC. D) Detection of CTCs using 32 spiked cells in BC.

PAGE 131

131 Figure 4 20. Determination of the LOD for CTC detection. Continued

PAGE 132

132 Figure 4 21. Detection of CTCs in patient sample 483. Number is red on each quadrant correspond to the number of cells red in a 7.5mL of blood.

PAGE 133

133 Figure 4 22. Detection of CTCs in patient sample 728. Number is red on each quadrant correspond to the number of cells red in a 7.5mL of blood.

PAGE 134

134 Figure 4 23. Detection of CTCs in patient sample 829. Number is red on each quadrant correspond to the number of cells red in a 7.5mL of blood.

PAGE 135

135 Figure 4 24. Detection of CTCs in patient sample 766. Number is red on each quadrant correspond to the number of cells red in a 7.5mL of blo od.

PAGE 136

136 Figure 4 25. Detection of CTCs in patient sample 071. Number is red on each quadrant correspond to the number of cells red in a 7.5mL of blood.

PAGE 137

137 CHAPTER 5 Introduction : Biomarker A biomarkers is defined as laboratory measurement that reflects the activity of a disease process 145 Currently, proteomics is the most widely used technique for the discovery of new proteins in cancer. The recent adv ancements are directly related to the improvements in mass spectrometry its complementary technique 146 In the tan group c ell SELEX is a pow erful technology use d to study of a part icular cancer type with the ultimate goal to use those selected aptamer s to identify potential biomark er s useful in cancer detection/treatment Cell SELEX has the distinctive advantage of not requiring previous knowledge abou this application 147 To date, the tan group has elucidated only two targets: proteinase kinase 7 (pTK7) and i mmunoglo buling M (IgM) 106 148 PTK7 initially was found on leukemia cells, but later it was found to be over ex pressed in different cancer cell lines 149 150 In addition, sgc8 the a ptamer that targets protein PTK7 is the most studied aptamer 151 152 153 s uggesting that potential biomarkers can be discovered using cell SELEX as methodology. As described in the introductory chapter of this dissertation, cell SELEX has been used as the methodology for the development of aptamers against adenocarcinoma. In addition, aptamers previously selected for other lung cancer subtypes were also studied. This chapter will describe a methodology development for the eluc idation of an aptamers as the capturing detection molecule. [Figure 5 1] outlines the proposed methodology for the elucidation

PAGE 138

138 After cell lysis, the proteins are captured by biotinylated aptamer. After washing and separation using streptavidin coated magnetic beads the mixture was separated by SDS PAGE and submitted for mass spectral analysis. Results and D iscussion As mentioned above the targets for only two aptamers have been identifie d so far in the tan group With the urgent necessity of di scovering the target proteins of aptamers obtained by cell SELEX, a group of several students were challenged to develop methods for target elucidation. For this dissertation, aptamer DOV4 was chosen because its target is expressed on a large va riety of lung cancer cell lines but not on normal bronchial lung cells Elucidation of the Target Protein for A ptamer DOV4 Aptamer DOV4 was originally selected using cell SELEX technolo gy against adenocarcinom a of the ovary CAOV3 cell line. However, based on the profiling with lung cancer cells and normal human bronchial cell lines describe d in c hapter 3 the target of DOV4 is also expressed in several other cancer cell lines but not in normal cells making this aptamer suitable for future applications. As shown in the first step in Figure 5 1 the biotinylated aptamer serves as t he binding /capturing molecule. [Figure 5 2] show s the SDS PAGE gel when aptam ers and random DNA (library) were subjected to the methodology pictured in F igure 5 1. There is not difference between the protein captured by the library and that captured by DOV4 In other words, the aptamer lacks specificit y in the task of capturing its target molecule. T hese observations called for a ch ange in the process of extracting the target proteins In addition, a closer look at the characterization of DOV4 revealed that its target seems to be resistant to the digestion of proteases trypsin and proteinase K The

PAGE 139

139 cell cytometry data in [ Figure 5 3] 154 show that the fluorescence intensity increased when cells were treated for 30min with proteinase K, indicating that the target be come s more (ie, more exposed) after digestion Subcellular Fractionation to Reduce B ackground P roteins After these observations, it was hypothesized that the binding molecule for aptamer DOV4 could be a hig hly glycosylated protein as those are normally non susceptible to proteases treatment Therefore, a digestion step was included at the beginning of methodology to reduce the number of non necessary proteins in the already complex mixture. In addition to th e digestion by proteinase K, a subcellular fractionation was also implemented in the methodology. D uring this step the proteins contained in different compartments in the cell were separated using a sucrose gradient and high centrifugation speed. After se paration, only membrane proteins were retained and incubated with aptamer DOV4. A fter making these alterations to the methodology and separation by SDS PAGE, the results shown in [Figure 5 4] were observed. The number of background proteins was highly reduced when compared to the initial SDS PAGE gel [Figure 5 2] However, the protein capturing by the aptamer did not show specific proteins when compared with random DNA. The amounts of proteins capture d in lanes 2 and 3 of F igure 5 4 are similar, demonstrating that even though the number of background proteins was removed, DOV 4 still did not show specificity.

PAGE 140

140 Aptamer Crosslinking to its T arget To address the specificity issue it was proposed to form a chemical crosslink the between the aptamer and its target using the well known fixative formaldehyde 155 This small molecule, CH 2 O, molecule has b ee n used widely in histology to preserve tumors and as cross linker in the Chromatin Immunoprecipitation (ChIP) assay 156 This molecule can covalently link a DNA base with an amin e residue from a protein in great proximity to the DNA, as shown in [Figure 5 5 ]. Figure [5 6] shows the final covalent bond between a cytosine base and a lysine residue To summarize the new steps included in th e methodology : a protein digestion step was included to further expose the target to bind to the aptamer ; (presumably a highly glycosylated protein) a subcellular fractionation using sucrose was also included in the methodology to avoid non specific bindin g, especially to those DNA binding proteins pres ent in the nucleus of the cells; and a crosslinking chemical reaction between DNA and its target was carried out using for maldehyde. During the latter step, it was imperative to use freshly prepared methanol free formaldehyde as it was nec essary to avoid permeation of the membrane therefore internalization of the aptamer. Troubleshooting and many optimizations were necessary to achieve the desire results. There were numerous non specific bands corresponding to proteins binding to random library when incubated with H23 cells, with much fewer distinct bands present only on the lane corresponding to the interaction of aptamer DOV 4 and H23 cells. The important bands were finally identified after several SDS PAGE g el separations. In addition, using this methodology a specific band was corroborated by presence in two different and separate experiments. [Figure 5 6] shows gels for t wo different

PAGE 141

141 experiments run in parallel. The arrowed band is present in the two aptame r bands and it is absence in the n egative control, thus verifying the specificity and the reproducibility of the methodology present in this chapter. The band was excise d from the gel and sent for MS analysis by the Reinh old laboratory at the University of New Hampshire. Their specialty is research in glycosylated proteins and with experience in (i) development and differentiation, (ii) cell adhesion and inflammation, (iii) cancer and metastasis, and (iv) host pathogen interactions in infection diseases 157 Two different methods were employed for the extraction of proteins present in the band o ne with aqueous solution, the other with a 50:50 mixture aqueous/organic mixture. Both extractions were carried out in parallel, followed by trypsin digestion. The digest were examined using MS and the results were analyzed using the protein database s Mas cot and Swissprot. Only the proteins present in both analyses were considered as t rue hit s, whereas proteins present in only one of the extractions were considered as artifacts Both results are summarized in Table 5 1 with true hits high lighted After th e analysis performed by the Reinhold group th e results were sent to UF for further analysis. The protein identificat ion results after MS analysis is listed in Figure 5 8. As me ntioned previously, only t he highlighted proteins were considered as they appear in th e analysis of both extractions Based on the probability given by the mascot program p roteins with score s greater than 56 are considered as significant ( p<0.05). Discrimination of S ignificant P roteins As previously shown, the aptamer DOV4 used in this project targets a molecule present in the membrane of H23 cells. Therefore, our first step of discrimi nation is cellular localization ; more specifically the protein must be present in the cell membrane

PAGE 142

142 Proteins were analyzed based on th e ir mascot score in a descending order, as the number decreased the chances of that protein being random increase d For each protein, a basic literature search was used to determine the location and the role of the protein in the cells. It is important to note that in addition to the membrane, candidates may also m ight be expressed elsewhere in other parts of the cell. The most notable example of the target of nucleolin aptamer, which is present not only of the surface of the membrane, but also in the nucl eous 123 One protein recognized by the analysis was h emoglobin, which is found primarily in the RBCs and not on epithelial cells. In this case we believe that somehow during either the resolution of the p rotein by SDS PAGE gel or the preparati on for MS analysis, there was blood related contamination of the sample. Another protein present in the list, and directly related to blood components is serum albumin which is further discussed below Skin cells In MS protein analysis, some of the major contaminants are keratins, proteins present in the skin. During this analysis filaggrin was one of the proteins that could potentially be th e aptamer DOV 4 target. Filaggrin is an associate protein that binds to the keratin intermediate filaments 158

PAGE 143

143 Also c aspas e 14 which is a me mber of the caspase family of enzymes that play a pivotal role in apoptosis was observed, but caspase 14 is limited to epidermal keratinocytes where its role is probably cell death of keratinocytes and in skin barrier formation 159 160 Mytochondrial P roteins During the an alysis, the metalloprotein arginase 1 was also one of the results. Arginase 1 catalyzes the hydrol y sis conversion of arginine to ornithine and urea. T his enzyme has also been described as potential immonohistochemistry marker in hepatocelular tumors 161 Cytosolic P roteins Only one protein present in the cytosol of cells was listed as potential target of DOV4 aptamer. Glyceraldehyde 3 phosphate dehydrogenase (GAPDH) which plays an important role in glycolysis. R ecently, however, some functions not related to glycolysis have been studied relating to its overexpression in some types of cancer 162 Cytoplasmic P roteins Also serum albumin, a prote in which is te mporaly present in the cyoplasm before being secreted into the plasma 163 was also found with high mascot scores ( 652 for extraction R1 and 531 for extraction R2 ) This is an example of a non specific protein being pulled out by the aptamer or a contaminant during protein preparation prior analysis. Another cytoplasmic protein found was apoli poprotein A I which is in charge of lipid trafficking through the membrane s of cells 164

PAGE 144

144 Membrane P roteins This is perhaps the most important group of candidates for the target. In this category four protein s were listed after the analysis: a nnexin A 2 desmoglein I, junction plakoglo bin and desmoplakin. Annexin A 2 is a calcium dependent peripheral membrane protein that plays a pivotal role in membrane organization and in endocytic pathways 165 Several cancers have shown high levels of this protein ; its roles are related to metastasis, apoptosis, angiogenesis and tumor invasion. Annexin A 2 and its binding molecule plasmin play an important role in cell invasion, migration, and cell adhesion 166 The sec ond group of proteins desmoglein I, Jun c ti on plakoglobin and desmoplakin, play an important role in the formation of desmosomes and are expressed in tissue exposed to high mechanical stress. Generally these desmosomes are involved in the events of cell adhesion in epithelial cells 167 The role of desmosomes has been suggested in carcino genesis as the y intervene with the regulatio n of cell proliferation and differentiation 168 Recent stu dies have implicated desmosomes as potential tumor supressors in lung cancer via the catenin signling pathway 169 Conclusions In this chapter the major challenge was the development of a novel or improved method for the identification of the aptamer DOV 4, which is non su sceptible to protease treatment During the optimization phase small changes were made to obtain the desire d results, a more specific binding for the aptamer DOV 4 when compared to a randomized DNA oligonucleotide. Subcellular fractionation was the resource employed to eliminate non specific binding from nuclear proteins a cellular which include many DNA bindin g molecules, to strengthen and fix the binding event between the aptamer

PAGE 145

145 and its target the cross linking molecule formaldehyde was use d. The combination of these strategies aided in the identification of candidates proteins. As mentioned previously, th e combination of SDS PAGE separation with MS analysis demonstrated its power in the identification of potentia l proteins important during carcino genesis. After MS analysis a list of proteins was analyzed and discriminate d primarily but no t entirely by thei r cellular localization s As expected keratin related proteins which are contaminants in this type of analysis were ruled out. Furthermore, cytoplasmic proteins such as apolipoprotein A I, h emoglobulin, and serum albumin were also present with high mas cot scores during the analysis. Cytosolic and mitochondrial proteins were also observed in the analysis, but when compared to the basic methodology previously used in the Tan lab the percentage decrease d dramatically. Finally, s everal membrane proteins rem ained as the potential targets: desmoplakin, desmoglein,and plakoglobin all self related proteins in the formation of desmosomes and Annexin A 2, a peripheral membrane protein that plays a role in membrane organization. Materials and M ethods Instrumenta tion and Reagents Biotin modified a ptamer DOV4 ( ACTCAACGAACGCTGTGGAGGGCATCA GATTAGGATCTATAGGTTCGGACATCGTGAGGACCAGGAGAG CA library (N80 ) were synthesized by standard phosphoroamidite chemistry using a 3400 DNA synthesizer (Applied Biosystems) and purified by reverse d phase HPLC (Varian Prostar using a C18 column and acetonitrile/triethylammonium acetate as the mobile phase ). The streptavidin coated magnetic nanoparticles ( Dynabeads M 280

PAGE 146

146 Streptavidin ) were obtained from Invitr ogen Transmembrane protein extracti on reagent was purchased from (F ive photon Biochemicals). Cell Culture and Buffers The H23 cell line was purchased from American Type Cell Culture and maintained in RPMI 1640 (ATCC) culture medi um supplemented with 10% Fet al Bovine Serum (FBS heat inactivated) and 1% penicillin streptomycin. Cells were incubated at 37C under 5% CO 2 atmosphere. All chemicals used in the buffers were purchased from Sigma, unless otherwise specified. To detach cells from the culture plate, no n enzymatic cell dissociation buffer was used, and the washing buffer (WB) contained 4.5 g/L glucose and 5 mM MgCl 2 2 and MgCl 2 (PBS Sigma). Binding buffer (BB) used for aptamer binding was prepared by ad ding yeast tRNA (0.1 mg/mL, Sigma) and BSA (1 mg/mL, Fisher) to the washing buffer to reduce non specific binding. Fractionation buffer used f or the separation of proteins was composed of 250mM sucrose, 20mM HEPES, and protease inhibitors at 10x general inhibitor and phenylmethanesulfonylfluoride ( PMSF ) at 1mM. Aptamer B inding H23 cells were washed twice, detached using non enzymatic cell dissociation buffer, and incubated with a 250nM solution of biotinylated aptamer DOV4 at 4C for 30 min. H23 Crosslinking with its T arget Once cells were bound to aptamer DOV 4, the next step was to cro sslink that protein aptamer interaction with 4% formaldehyde methanol free solution for 20 min at 4C.

PAGE 147

147 Extraction of H23 P roteins The H23 cells were washed twice using WB, and incubated with transmembrane protein reagent containing 10x protease inhibitor and 200nM PSMF inhibitor. Incubation was performed at 4C to limit endocy tosis for 2 hours with mixing every 15 min to homogenize the s ample. The m ixture was centrifuged at maximum speed for a few seconds to pellet cell debris. The s upernatant containing proteins in H23 was collected and suspended in fractionation buffer and subjected to subcellular fractionation. Subcellular F ractionatio n of H23 C ells S upernatant from the previous step was centrifuged at 4,000 rpm for 30 minutes in or der to remove nuclear proteins and leave cytosolic and membrane proteins. To further separate these proteins a sucrose cushion centrifugation was performed a s follows: 20% and 70% sucrose solutions were prepared and the supernatant from previous step was placed carefully on top of the sucrose cushion and centrifuged at 25,000 rpm for 1 hour at 4C. The plasma membrane proteins appeared as a diffuse band at the interface between the two sucrose solutions. With an insulin syringe the band was carefully removed and further centrifuged at 35,000 rpm to pellet the membrane proteins. In order to have a visual band approximately 100 million cells were used. Aptamer Target Purification for Protein Identification After subcellular protein separation, the membrane proteins were incubated overnight with 200uL of streptavidin coated magnetic beads. The beads were then washed to remove non specific binding species and pla ce d on a magnet for 30 min. Proteins were recover ed by eluting with Laemmli sample buffer and heated at 60C for 30min. Rec overed proteins were resolved by SDS PAGE gel.

PAGE 148

148 Digestion of the P rote in Band Prior MS A nalysis On the SDS PAGE gel, the specific band present for aptamer DOV 4 was cut and sent out for MS analysis at the University of New Hampshire in Dr. Vernon Reinhold lab. Two simultaneous t extractions methods were performed, one with aqueous mixture the other with 50:50 aqueous: or ganic mixture to extract the proteins from the gel. Extracted proteins were subjected to trypsin digestion and processes on a HPLC MS/MS (High resolution orbitrap MS). Analyzed proteins were processed using Mascot searching engine and Swissprot.

PAGE 149

149 Figure 5 1. Methodology proposed for the elucidation of the aptamer DOV4.

PAGE 150

150 Figure 5 2. SDS PAGE gel corresponding to the analysis of aptamer DOV4 in adenocarcinoma H23 cells. 1) Corresponds to the protein marker. 2) Proteins captured with the biotinylated aptamer DOV4. 3) Proteins captured with the biotinylated random DNA (library) negative control.

PAGE 151

151 Figure 5 3. Aptamer DOV 4 binding after treatment of CAOV3 ovarian cancer cells with 0.1mg/mL and 0.5mg/mL of proteinase K. Copyright 2011 Lopez Colon 151

PAGE 152

152 Figure 5 4. SDS PAGE gel corresponding to the analysis of proteins captured with aptamers DOV 4 and random DNA after treatment with proteinase K. 1) protein marker. 2) Proteins captured with the biotinylated random DNA (library negative control). 3) Proteins captured with the biotinylated aptamer DOV4.

PAGE 153

153 Figure 5 5. Mechanism of formaldehyde crosslinking between a DNA base and an amine residue from a nearby protein.

PAGE 154

154 Figure 5 6. Formaldehyde induced crosslink between cytosine and lysine.

PAGE 155

155 Figure 5 7. SDS PAGE gel corresponding to the analysis of captured proteins by aptamer DOV4 in H23 cells. 1) Corresponds to the protein marker. 2) Proteins captured with the biotinylated random DNA (li brary) negative control. 3) Proteins captured with the biotinylated aptamer DOV4.

PAGE 156

156 Figure 5 8 Mass spectral analysis of proteins captured by aptamer DOV 4 in H23 cells. Highlighted proteins are considered true hits based on MS analysis.

PAGE 157

157 CHAPTER 6 CONCLUSIONS AND FUTURE DIRECTIONS Conclusions In this dissertation cell SELEX methodology was utilized for the generation of a panel of aptamers capable of distinguishing the most common type of lung cancer (ADC) from normal bronch ial cells. These aptamers displayed apparent dissociation constant s in the nanomolar range, an important consideration in the use of aptamer s in biological and biomedical applications. Furthermore these aptamers not only displayed binding to the target sel ection cell line, but also to other cancer types such as colon cancer and ovarian cancer At this point it is important to recognize the incredible value of cell SELEX which is a blind methodology that can generate specific aptamer s towards a specific marker independently of the source tissue or cell line. In addition, some protein s involved in carcinogenesis can be common to different cancer types Thus aptamers that bind to more than one type of cancer can be important for the iden tification of potential biomarkers One of the questions was to determine whether the select ed aptamers can potentially be used in clinical samples. The selected aptamers were testing for binding in conditions similar to those present in clinical settings such as the reaction conditions for fixation with paraformaldehyde. The selected aptamers were able to bind before and after fixation with affinity similar to that displayed in re gular cell SELEX conditions. T his particular assay demonstrated one of the advantages of a ptamers over antibodies, as aptamers do not need the antigen retrieval step to achieve binding to the target cells. The tan group is a pioneer in the cell SELEX technology, and different selections have been carried out f or different types of cancer. To date, three different selections

PAGE 158

158 have been performed for lung cancer, one for SCLC and two for NSCLC. The next step in this project was to profile these aptamers against a panel of lung cancer cell lines in order to select the aptamers that would recognize the majority of lung ca ncer cells lines, as well as to identify aptamers that are selective for a histological subtype, in particular those that represent an immediate challenge in clinic settings After characterization and molecular profi ling the aptamers were use as detection and capturing molecule s for circulating tumor cells in blood. In this project two different strategies were employed for the same purpose : a magnetic separation and a cell sorter. To be comparable to literature repo rts in the isolation of CTCs it was initially intended to use the antibody EpCAM in both methods. H owever, after molecular profiling it was determined that EpCAM was not ubiquitously expressed in lung cancer cells, but only in ~50% on the histological su btype ADC. These findings indicated the lung cancer research has been limited in the past. To detect CTCs in NSCLC, the Ab EpCAM was used to corroborate the identity magnetic isolated cells from blood. As detection molecules aptamer HCH3 and S1 were used for the recognition of cancer cell in blood. Likewise, aptamers HCH3, HCH12, sgc8 and DOV4 were used as detection molecule s in combination with antibody CD 56 to double label cells for isolation and sort ing by FACS. The LOD for both methodologies was simi lar, with ~ 50 CTCs for the magnetic separation method and ~60 CTCs using cell sorting. Also the background number of cells increased as the number of spiked cells was reduced. After optimization of the cell sorting methodology, 5 clinical blood samples fr om metastatic SCLC patient s prior to chemotherapy were analyzed, and o ur methodology was able to detect CTCs in all five samples However,

PAGE 159

159 during sample processing by the CTSI at the University of Florida in samples 843 and 076 showed a high number of dea d cells. These results were due to the improper manner of storing the isolated buffy coat that I obtained 1 year previously Also, d uring the first trimester of the clinical trial we learned that the compound DMSO was not part of the standard operational procedures (SOP). As expected, the samples with high count s of live cells provided the best and anticipated results for a high CTC count in metastatic lung cancer patient samples. As SCLC is the most aggressive typ e of lung cancer, a high burden of cells c irculating in the peripheral blood at the time of collection was expected In the last part of this dissertation, the aptamer DOV4 was selected for target elucidation because its target molecule is highly expressed in the majority of lung cancer cell lines with no detectable response by flow cytometric analys is in normal bronchial cells. T wo major obstacles were confronted during the elucidation: the large a mount of non specific binding proteins and the poor stability of the binding event between the aptame r and its target. To address these issues, an initial step of subcellular fracti onation was included to isolate only membrane proteins and to reduce the number of cytosolic and DN A binding proteins present from the nucleus. The interaction between the apta mer and its target was fixed by using the DNA protein crosslinking molecule formaldehyde. After optimization and MS analysis by the Reinhold group at the University of New Hampshire, a list of candidate proteins was obtained f or further analysis. Proteins were discriminated based on subcellular localization and focusing on membrane proteins, because t he target of aptamer DOV4 as the aptamer target is found primarily

PAGE 160

160 in the membrane s of lung cancer cells H23 and CAOV3 the cell line from which this aptamer w as selected. K eratins and skin related proteins were also found in the potential target list, because they are common contaminants in MS. Some cytosolic, cytoplasmic, and mitochondrial proteins were also present on the list suggest ing the subcellular fra ctionation step was not 100% efficient. Finally, two membrane proteins Annexin A2 and desmoplakin related protein s involved in the formation of desmosomes constitute t he two potential targets for aptamer DOV4 T hese results demonstrate that cell SELEX te chnology is an innovative and powerful methodology for the holistic approach and understanding of a particular disease, in this case lung cancer without prior knowledge of a target. Initially the aptamers are selected against the target tissue cell line, and subsequently th e se aptamers can then be utilized as affinity and capturing molecules for the investigation of that disease. Furthermore, reducing the number of potential targets could lead to the identification of biomarkers for several cancers, as most of the proteins important in angiogenesis and tumorigenesis are conserved in several cancer types. Future Directions The next step in this work is to further test the selected aptamers in formalin fixed paraffin embedded FFPE samples which may yie ld valuable information for the study of human cancer. These experi ments would confirm the feasibility of translation ability of the cell based selected aptamers for clinical use. Furthermore, rather than competing with antibodies aptamers and antibodies could be used in combination to produce a more solid determination of the histological lung cancer subtype thereby providing knowledge for a more appropriate treatment for lung cancer patients.

PAGE 161

161 In the detection of CTCs project, additional research is nee ded to analyze the se background c ells that were non specifically captured by the aptamer. Perhaps, a size exclusion experiment could determine if some CTCs present in the clinical samples are indeed cancer cells but do not possess either one the markers us ed for their isolation. Some research has shown that some lung canc er patient samples lack common molecular markers. Another possible ex periment could be to label the non specific ally captured cells with other common markers for SCLC that were not employed in the proposed strategy. Finally, in the elucidation of the aptamer DOV4 target the next step will be to obtain antibodies against those targets to perform a competition study between the aptamer and antibody. This experiment could indicate if the aptamer and antibody share the same binding site. Alternatively, 1) a cell line lacking of either one of the potential targets can be subjected to binding assay with the aptamer ; or 2) a cell line can be genetically modified to express these targe ts and verify their binding by flow cytometric analysis.

PAGE 162

162 APPENDIX A SYNTHESIS APTAMER RADIOACTIVE ISOMER DRUG CONJUGATE FOR SCLC TREATMENT The problem that clinicians face when treating lung cancer is the fact that SCLC is almost always advanced beyond th e point where curative therapy can be pursued. This occurs because conventional radiation therapy can be only applied to specific regions (in this case, the central chest ) which are not possible when the cancer has spread beyond the confines of the chest. Intervention can improve significantly especially for advanced staged disease if we are able to target and kill distant metastatic cells, but unfortunately there are no specific markers that can confidently been used without affecting normal cells. The fle xibility of manipulating nucleic acids without significantly affecting its activity makes aptamers suitable in many diagnostic and therapeutic application platforms. For instance, aptamers have been employed in immunoprecipitation (oligonucleotide precipit ation) assays, western blot analyses, enzyme linked immunosorbent assay (ELISA) like formats, and flow cytometry assays. Treatment of SCLC is much more effective if the chemotherapy is combined with radiation therapy concurrently. The ability to selectivel y kill cancer cells without affecting the surrounding normal cells is a significant component in designing any targeted therapeutic intervention. This will require very selective molecular probes that target markers on the cancer cells but that are not fou nd on the normal cells. Such probes should also not be sticky to cell surfaces in order to minimize the side effects. Therefore, the availability of SCLC specific aptamers will help us design specific targeted therapies. To achieve this, we propose to conj ugate SCLC specific aptamers to radioisotopes (90Y, 135I) and the drug cisplatin and simultaneou sly deliver this entire conjugate SCLC cells.

PAGE 163

163 The goal of this aim was to develop conjugation chemistry to link SCLC aptamers with radioactive isotopes currentl y in nuclear medicine and cancer treatments such as Iodine 131, Ph ophorus 32, Lead 212, Yttrium 90 170 and/or actinium 225 and test these conjugates as possible probes for radiotherapy. Results and Discussion To synthesize aptamer radioactive isomer drug, we employed carboxyl amino chemistry for the conjugation of aptamers to DOTA. Similar procedure was utilized to conjugate random sequence to DOTA. This is shown schematically in [Figure A1] The conjugate was purified by HPLC [Figure A2] Figure A 1 Step by ste p synthesis of DOTA Aptamer conjugate. The success of the reaction was confirmed by HPLC, and compared to compound with similar structure previously reported in the literature. To purify the reaction, desalting columns with molecular weight cut off of 30KD a was used, and buffer exchange, 1M NaHCO 3 to 10mM.

PAGE 164

164 Once the conjugated was successfully synthesized and purified, we proceeded to test this compound with lung cancer cell line A549 and normal lung cells HBE135 E6/E7 by flow cytometry analysis (Figure A3 ) Figure A 2. Purification of DOTA aptamer conjugate by HPLC The peak corresponding to 12 17minutes was collected as it represents the conjugate. Since the ultimate goal is use this conjugate to deliver radionuclide to cancer cells, we assessed if the conjugate can be internalized into cancer cells. In our previous studies, aptamers alone or in conjugate with other reagents have been demonstrated to be able to internalize into target cancer cells. The internalization of the aptamer conjugate was analyzed by confocal microscopy as shown [Figure A 4 ] the aptamer conjugate internalized into target cells, and a prerequisite for further use of the conjugate.

PAGE 165

165 Figure A 3 Flow cytometry analysis of DOTA conjugate with cell line s A549 and HBE 135. Random sequence and specific aptamers were tested along with aptamer and random sequence conjugated to DOTA compound. B. Flow cytometry analysis of DOTA conjugate with normal lung cell line HBE135 E6/E7. Random s equence and specific aptamers were tested along with aptamer and random sequence conjugated to DOTA compound. Figure A 4 Internalization of aptamer conjugate in lung cancer cell line A549. Left panel (DOTA aptamer conjugated with Cy5) middle panel (lysosome dye) right panel (merge picture of previous two panels) this indicates that the conjugate could be internalized by cell line A549 through aptamer target mediated endocytosis

PAGE 166

166 LIST OF REFERENCES 1. Siegel, R.; Naishadham, D.; Jemal, A., Cancer statistics, 2013. Ca a Cancer Journal for Clinicians 2013 63, 11 30. 2. Samet, J. M., Tobacco smoking: the leading cause of preventable disease worldwide. Thoracic surgery clinics 2013 23, 103 12. 3. Liu, K.; Yu, D.; Cho, Y. Y.; Bode, A. M.; Ma, W.; Yao, K.; Li, S.; Li, J.; Bowden, G. T.; Dong, Z.; Dong, Z., Sunlight UV Induced Skin Cancer Relies upon Activation of the p38alpha Signaling Pathway. Cancer research 2013 7 3, 2181 8. 4. Jahan, Z.; Castelli, S.; Aversa, G.; Rufini, S.; Desideri, A.; Giovanetti, A., Role of human topoisomerase IB on ionizing radiation induced damage. Biochemical and Biophysical Research Communications 2013 432, 545 548. 5. Costantini, S.; Capone, F.; Maio, P.; Guerriero, E.; Colonna, G., Cancer biomarker profiling in patients with chronic hepatitis C virus, liver cirrhosis and hepatocellular carcinoma. Oncology reports 2013 29, 2163 8. 6. Orlando, A.; Russo, F., Intestinal microbiota probiotics and human gastrointestinal cancers. Journal of gastrointestinal cancer 2013 44, 121 31. 7. Clendenen, T. V.; Arslan, A. A.; Lokshin, A. E.; Liu, M.; Lundin, E.; Koenig, K. L.; Berrino, F.; Hallmans, G.; Idahl, A.; Krogh, V.; Lukanova, A.; Marrangoni, A.; Muti, P.; Nolen, B. M.; Ohlson, N.; Shore, R. E.; Sieri, S.; Zeleniuch Jacquotte, A., Circulating prolactin levels and risk of epithelial ovarian cancer. Cancer Causes & Control. 2013 24, 741 748. 8. Voelker, R., Even Low, Regular Alcohol Use Increases the Risk of Dying of Cancer. Jama Journal of the American Medical Association 2013 309, 970 970. 9. Amaral, P.; Miguel, R.; Mehdad, A.; Cruz, C.; Grillo, I. M.; Camilo, M.; Ravasco, P., Body fat and poor diet in breast cancer women. Nutri cion Hospitalaria 2010 25, 456 461. 10. Ferlay, J.; Shin, H. R.; Bray, F.; Forman, D.; Mathers, C.; Parkin, D. M., Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008 International Journal of Cancer 2010 127, 2893 2917. 11. Mosher, C. E. ; Champion, V. L.; Azzoli, C. G.; Hanna, N.; Jalal, S. I.; Fakiris, A. J.; Birdas, T. J.; Okereke, I. C.; Kesler, K. A.; Einhorn, L. H.; Monahan, P. O.; Ostroff, J. S., Economic and social changes among distressed family caregivers of lung cancer patients. Supportive Care in Cancer 2013 21, 819 826.

PAGE 167

167 12. Takahashi, H.; Ogata, H.; Nishigaki, R.; Broide, D. H.; Karin, M., Tobacco smoke and JNK1 dependent inflammation. Cancer Cell 2010 17, 89 97. 13. Lantz, P. M.; Mendez, D.; Philbert, M. A., Radon, Smoking, and Lung Cancer: The Need to Refocus Radon Control Policy. American Journal of Public Health 2013 103, 443 447. 14. Dresler, C., The changing epidemic of lung cancer and occupational and environmental risk factors. Thoracic surgery clinics 2013 23, 113 22. 15. Ankathil, R., Tobacco, genetic susceptibility and lung cancer. Tob. Use Insights 2010 3, 1 15. 16. Hanna, J. M.; Onaitis, M. W., Cell of origin of lung cancer. Journal of carcinogenesis 2013 12, 6 6. 17. Brambilla, E.; Travis, W. D.; Colby, T. V.; Corrin, B.; Shimosato, Y., The new World Health Organization classification of lung tumours. Eur Respir J 2001 18, 1059 68. 18. Cmara, A. G. d. l.; Lpez Encuentra, A.; Ferrando, P.; Bronc hogenic Carcinoma Cooperative Group of the Spanish Society of Pneumolody and Thoracic, S., Heterogeneity of Prognostic Profiles in Non Small Cell Lung Cancer: Too Many Variables but a Few Relevant. European Journal of Epidemiology 2005 20, 907 914. 19. Sun, S.; Schiller, J. H.; Gazdar, A. F., Lung cancer in never smokers a different disease. Nature Reviews Cancer 2007 7, 778 790. 20. Rudin, C. M.; Avila Tang, E.; Harris, C. C.; Herman, J. G.; Hirsch, F. R.; Pao, W.; Schwartz, A. G.; Vahakangas K. H.; Samet, J. M., Lung Cancer in Never Smokers: Molecular Profiles and Therapeutic Implications. Clinical Cancer Research 2009 15, 5646 5661. 21. Heigener, D. F., Non Small Cell Lung Cancer in Never Smokers: A New Disease Entity? Onkologie 2011 3 4, 202 207. 22. Alberg, A. J.; Wallace, K.; Silvestri, G. A.; Brock, M. V., Invited Commentary: The Etiology of Lung Cancer in Men Compared With Women. American Journal of Epidemiology 2013 177, 613 616.

PAGE 168

168 23. Nagy Mignotte, H.; Guillem, P.; Vesin, A.; Toffart, A. C.; Colonna, M.; Bonneterre, V.; Brichon, P. Y.; Brambilla, C.; Brambilla, E.; Lantuejoul, S.; Timsit, J. F.; Moro Sibilot, D.; Grenoble Univ, H., Primary lung adenocarcinoma: characteristics by smoking habit and sex. European Respiratory Journ al 2011 38, 1412 1419. 24. Gadgeel, S. M.; Ramalingam, S. S.; Kalemkerian, G. P., Treatment of Lung Cancer. Radiologic Clinics of North America 2012 50, 961 +. 25. Wells, J. M.; Mukhopadhyay S.; Mani, H., Application of the New Proposed Adenocarcinoma Classification A Reproducibility Study. Laboratory Investigation 2013 93, 469A 470A. 26. Austin, J. H. M.; Garg, K.; Aberle, D.; Yankelevitz, D.; Kuriyama, K.; Lee, H. J.; Brambilla, E.; T ravis, W. D., Radiologic Implications of the 2011 Classification of Adenocarcinoma of the Lung. Radiology 2013 266, 62 71. 27. Travis, W. D.; Brambilla, E.; Riely, G. J., New Pathologic Classification of Lung Cancer: Relevance for Clinical Practice and Clinical Trials. Journal of Clinical Oncology 2013 31, 992 1001. 28. Cakir, E.; Demirag, F.; Aydin, M.; Unsal, E., Clinicopathologic Features and Prognostic Significance of Lung Tumours with Mixed Histologic Patterns. Acta Chirurgica Belgica 2009 109, 489 493. 29. Travis, W. D., Pathology of Lung Cancer. Clinics in Chest Medicine 2011 32, 669 692. 30. Drilon, A.; Rekhtman, N.; Ladanyi, M.; Paik, P., Squamous cell carcinomas of the lung: emerging biology, controversies, and the promise of targeted t herapy. The Lancet Oncology 2012 13, e418 e426. 31. Barbareschi, M.; Cantaloni, C.; Del Vescovo, V.; Cavazza, A.; Monica, V.; Carella, R.; Rossi, G.; Morelli, L.; Cucino, A. ; Silvestri, M.; Tirone, G.; Pelosi, G.; Graziano, P.; Papotti, M.; Dalla Palma, P.; Doglioni, C.; Denti, M. A., Heterogeneity of Large Cell Carcinoma of the Lung An Immunophenotypic and miRNA Based Analysis. American Journal of Clinical Pathology 2011 136, 773 782. 32. Park, K. S.; Liang, M. C.; Raiser, D. M.; Zamponi, R.; Roach, R. R.; Curtis, S. J.; Walton, Z.; Schaffer, B. E.; Roake, C. M.; Zmoos, A. F.; Kriegel, C.; Wong, K. K.; Sage, J.; Kim, C. F., Characterization of the cell of origin for small cell lung cancer. Cell Cycle 2011 10, 2806 2815.

PAGE 169

169 33. Rossi, A.; Maione P.; Colantuoni, G.; Guerriero, C.; Ferrara, C.; Del Gaizo, F.; Nicolella, D.; Gridelli, C., Treatment of Small Cell Lung Cancer in the Elderly. The Oncologist 2005 10, 399 411. 34. Hamilton, W.; Sharp, D., Diagnosis of lung cancer in primary care: a structured review. Family Practice 2004 21, 605 611. 35. D'Urso, V.; Doneddu, V.; Marchesi, I.; Collodoro, A.; Pirina, P.; Giordano, A.; Bagella, L., Sputum analysis: Non invasive earl y lung cancer detection. Journal of Cellular Physiology 2013 228, 945 951. 36. Clarke, G. W.; Diamant, Z.; Greenaway, S. D.; Rainer, M.; Allen, E.; Gispert, J., Launching the BIOSPIT initiative: Harmonizing sputum outcomes in multicenter trials. Pulmona ry Pharmacology & Therapeutics 2013 26, 400 401. 37. McWilliams, A.; Shaipanich, T.; Lam, S., Fluorescence and navigational bronchoscopy. Thoracic surgery clinics 2013 23, 153 61. 38. Walles, T.; Friedel, G.; Stegherr, T.; Steger, V., Learning mediastinoscopy: the need for education, experience and modern techniques interdependency of the applied technique and surgeon's training level. Interactive Cardiovascular and Thoracic Surgery 2013 16, 450 454. 39. Detterbeck, F. C., Thoracoscopy: A Rea l Life Perspective. Clinics in Chest Medicine 2013 34, 93 +. 40. Tomaszek, S. C.; Wigle, D. A., Surgical Management of Lung Cancer. Seminars in Respiratory and Critical Care Medicine 2011 32, 69 77. 41. Wilson, G. D.; Paschoud, N.; Pavy, J. J.; Weber K.; Weber, P.; Dubray, B.; Coucke, P. A., Reproducibility of measurements of potential doubling time of tumour cells in the multicentre National Cancer Institute protocol T92 0045. British Journal of Cancer 1999 79, 323 332. 42. Kalemkerian, G. P.; Ga dgeel, S. M., Modern Staging of Small Cell Lung Cancer. Journal of the National Comprehensive Cancer Network 2013 11, 99 104. 43. Kalemkerian, G. P., Staging and imaging of small cell lung cancer. Cancer Imaging 2012 11, 253 258. 44. Whitson, B. A.; Groth, S. S.; Duval, S. J.; Swanson, S. J.; Maddaus, M. A., Surgery for Early Stage Non Small Cell Lung Cancer: A Systematic Review of the Video Assisted Thoracoscopic Surgery Versus Thoracotomy Approaches to Lobectomy. The Annals of Thoracic Surgery 2008 86, 2008 2018.

PAGE 170

170 45. Dimitroulis, J.; Stathopoulos, G. P., Evolution of non small cell lung cancer chemotherapy (Review). Oncology Reports 2005 13, 923 930. 46. Salama, J. K.; Vokes, E. E., New Radiotherapy and Chemoradiotherapy Approaches for Non Smal l Cell Lung Cancer. Journal of Clinical Oncology 2013 31, 1029 1038. 47. De Ruysscher, D.; Belderbos, J.; Reymen, B.; van Elmpt, W.; van Baardwijk, A.; Wanders, R.; Hoebers, F.; Vooijs, M.; Oellers, M.; Lambin, P., State of the Art Radiation Therapy for Lung Cancer 2012: A Glimpse of the Future. Clinical Lung Cancer 2013 14, 89 95. 48. Chaffer, C. L.; Weinberg, R. A., A Perspective on Cancer Cell Metastasis. Science 2011 331, 1559 1564. 49. Luo G. Q.; Li, J. H.; Wen, J. F.; Zhou, Y. H.; Hu, Y. B.; Zhou, J. H., Effect and mechanism of the Twist gene on invasion and metastasis of gastric carcinoma cells. World Journal of Gastroenterology 2008 14, 2487 2493. 50. Aokage, K.; Ishii, G.; Ohtaki, Y .; Yamaguchi, Y.; Hishida, T.; Yoshida, J.; Nishimura, M.; Nagai, K.; Ochiai, A., Dynamic molecular changes associated with epithelial mesenchymal transition and subsequent mesenchymal epithelial transition in the early phase of metastatic tumor formation. International Journal of Cancer 2011 128, 1585 1595. 51. Tirino, V.; Desiderio, V.; Paino, F.; De Rosa, A.; Papaccio, F.; La Noce, M.; Laino, L.; De Francesco, F.; Papaccio, G., Cancer stem cells in solid tumors: an overview and new approaches for thei r isolation and characterization. Faseb Journal. 2013 27, 13 24. 52. Williams, S. C. P., Circulating tumor cells. Proceedings of the National Academy of Sciences of the United States of America 2013 110, 4861 4861. 53. Karachaliou N.; Mayo, C.; Costa, C.; Magri, I.; Gimenez Capitan, A.; Angel Molina Vila, M.; Rosell, R., KRAS Mutations in Lung Cancer. Clinical Lung Cancer 2013 14, 205 214. 54. Guan, J. l.; Zhong, W. z.; An, S. j.; Yang, J. j.; Su, J.; Chen, Z. h.; Yan, H. h.; C hen, Z. y.; Huang, Z. m.; Zhang, X. c.; Nie, Q.; Wu, Y. l., KRAS Mutation in Patients with Lung Cancer: A Predictor for Poor Prognosis but Not for EGFR TKIs or Chemotherapy. Annals of Surgical Oncology 2013 20, 1381 1388. 55. Indovina, P.; Marcelli, E.; Maranta, P.; Tarro, G., Lung cancer proteomics: recent advances in biomarker discovery. International journal of proteomics 2011 2011, 726869 726869.

PAGE 171

171 56. Sato, Y.; Tsuchiya, B.; Urao, T.; Baba, H.; Shiku, H.; Kodama, T.; Kameya, T., Semiquantitative im munoblot analysis of nm23 H1 and H2 isoforms in adenocarcinomas of the lung: Prognostic significance. Pathology International 2000 50, 200 205. 57. Subramaniam, S.; Thakur, R. K.; Yadav, V. K.; Nanda, R.; Chowdhury, S.; Agrawal, A., Lung cancer biomarke rs: State of the art. Journal of carcinogenesis 2013 12, 3 3. 58. Carpenter, E. P.; Beis, K.; Cameron, A. D.; Iwata, S., Overcoming the challenges of membrane protein crystallography. Current Opinion in Structural Biology 2008 18, 581 586. 59. Goh, W W. B.; Lee, Y. H.; Ramdzan, Z. M.; Sergot, M. J.; Chung, M.; Wong, L., Proteomics signature profiling (PSP): a novel contextualization approach for cancer proteomics. Journal of proteome research 2012 11, 1571 81. 60. Planque, C.; Kulasingam V.; Smith, C. R.; Reckamp, K.; Goodglick, L.; Diamandis, E. P., Identification of five candidate lung cancer biomarkers by proteomics analysis of conditioned media of four lung cancer cell lines. Mol. Cell. Proteomics 2009 8, 2746 2758. 61. Guergova K uras, M.; Kurucz, I.; Hempel, W.; Tardieu, N.; Kadas, J.; Malderez Bloes, C.; Jullien, A.; Kieffer, Y.; Hincapie, M.; Guttman, A.; Csanky, E.; Dezso, B.; Karger, B. L.; Takacs, L., Discovery of Lung Cancer Biomarkers by Profiling the Plasma Proteome with M onoclonal Antibody Libraries. Molecular & Cellular Proteomics 2011 10. 62. Ha, E. S.; Choi, S.; In, K. H.; Lee, S. H.; Lee, E. J.; Lee, S. Y.; Kim, J. H.; Shin, C.; Shim, J. J.; Kang, K. H.; Phark, S.; Sul, D., Identification of proteins expressed diffe rently among surgically resected stage I lung adenocarcinomas. Clinical Biochemistry 2013 46, 369 377. 63. Sun, L.; Chen, L.; Sun, L.; Pan, J.; Yu, L.; Han, L.; Yang, Z.; Luo Y.; Ran, Y., Functional Screen for Secreted Proteins by Monoclonal Antibody Library and Identification of Mac 2 Binding Protein (Mac 2BP) as a Potential Therapeutic Target and Biomarker for Lung Cancer. Molecular & Cellular Proteomics 2013 12, 395 406. 64. Hongsachart, P.; Sinchaikul, S.; Phutrakul, S.; Wongkham, W.; Chen, S. T., Membrane Proteins Diferentially Expressed in Non small Cell Lung Cancer by Proteomic Analysis. International Conference on Applied Sci ence: Soupahanouvong University. 2011 ; pp 519 528. 65. Ostroff, R. M.; Bigbee, W. L.; Franklin, W.; Gold, L.; Mehan, M.; Miller, Y. E.; Pass, H. I.; Rom, W. N.; Siegfried, J. M.; Stewart, A.; Walker, J. J.; Weissfeld, J.

PAGE 172

172 L.; Williams, S.; Zichi, D.; Brody, E. N., Unlocking biomarker discovery: l arge scale application of aptamer proteomic technology for early detection of lung cancer. PloS one 2010 5, e15003 e15003. 66. Normanno, N.; De Luca, A.; Bianco, C.; Strizzi, L.; Mancino, M.; Maiello, M. R.; Carotenuto, A.; De Feo, G.; Caponigro, F.; Sa lomon, D. S., Epidermal growth factor receptor (EGFR) signaling in cancer. Gene 2006 366, 2 16. 67. Niers, T. M. H.; Richel, D. J.; Meijers, J. C. M.; Schlingemann, R. O., Vascular Endothelial Growth Factor in the Circulation in Cancer Patients May Not Be a Relevant Biomarker. PLoS ONE 2011 6, e19873. 68. Moreno, L.; Popov, S.; Jury, A.; Al Sarraj, S.; Jones, C.; Zacharoulis, S., Role of platelet derived growth factor receptor (PDGFR) over expression and angiogenesis in ependymoma. Journal of Neuro On cology 2013 111, 169 176. 69. Ellington, A. D.; Szostak, J. W., I n vitro selection of RNA molecules that bind specific ligands Nature 1990 346, 818 822. 70. Tuerk, C.; Gold, L., systematic evolution of ligands by exponential enrichment rna ligands to bacteriophage t4 DNA polymerase Science 1990 249, 505 510. 71. Long, S. B.; Long, M. B.; White, R. R.; Sullenger, B. A., Crystal structure of an RNA aptamer bound to thrombin. Rna a Publication of the Rna Society. 2008 14, 2504 2512. 72. Mei, H.; Bing, T.; Yang, X.; Qi, C.; Chang, T.; Liu, X.; Cao, Z.; Shangguan, D., Functional Group Specific Aptamers Indirectly Recognizing Compounds with Alkyl Amino Group. Analytical Chemistry 2012 84, 7323 7329. 73. Kim, B.; Jung, I. H.; Kang, M.; Shi m, H. K.; Woo, H. Y., Cationic Conjugated Polyelectrolytes Triggered Conformational Change of Molecular Beacon Aptamer for Highly Sensitive and Selective Potassium Ion Detection. Journal of the American Chemical Society 2012 134, 3133 3138. 74. Song, Y. ; Zhu, Z.; An, Y.; Zhang, W.; Zhang, H.; Liu, D.; Yu, C.; Duan, W.; Yang, C. J., Selection of DNA Aptamers against Epithelial Cell Adhesion Molecule for Cancer Cell Imaging and Circulating Tumor Cell Capture. Analytical Chemistry 2013 85, 4141 4149. 75. Wang, P.; Hatcher, K. L.; Bartz, J. C.; Chen, S. G.; Skinner, P.; Richt, J.; Liu, H.; Sreevatsan, S., Selection and characterization of DNA aptamers against PrPSc. E xperimental Biology and Medicine. 2011 236, 466 476. 76. Hu, P.; Liu, Z.; Tian, R.; Ren H.; Wang, X.; Lin, C.; Gong, S.; Meng, X.; Wang, G.; Zhou, Y.; Lu, S., Selection and Identification of a DNA Aptamer That Mimics

PAGE 173

173 Saxitoxin in Antibody Binding. Journal of Agricultural and Food Chemistry. 2013 61, 3533 3541. 77. Bruno, J. G.; Richarte A. M.; Carrillo, M. P.; Edge, A., An aptamer beacon responsive to botulinum toxins. Biosensors and Bioelectronics 2012 31, 240 243. 78. Wurster, S. E.; Maher, L. J., III, Selection and characterization of anti NF kappa B p65 RNA aptamers. RNA a Public ation of the RNA Society. 2008 14, 1037 1047. 79. Sefah, K.; Meng, L.; Lopez Colon, D.; Jimenez, E.; Liu, C.; Tan, W., DNA Aptamers as Molecular Probes for Colorectal Cancer Study. Plos One 2010, 5. 80. Bayrac, A. T.; Sefah, K.; Parekh, P.; Bayrac, C.; G ulbakan, B.; Oktem, H. A.; Tan, W., In Vitro Selection of DNA Aptamers to Glioblastoma Multiforme. Acs Chemical Neuroscience. 2011 2, 175 181. 81. Van Simaeys, D.; Lopez Colon, D.; Sefah, K.; Sutphen, R.; Jimenez, E.; Tan, W., Study of the molecular reco gnition of aptamers selected through ovarian cancer cell SELEX. PloS one 2010 5, e13770 e13770. 82. Wang, R.; Zhao, J.; Jiang, T.; Kwon, Y. M.; Lu, H.; Jiao, P.; Liao, M.; Li, Y., Selection and characterization of DNA aptamers for use in detection of av ian influenza virus H5N1. Journal of virological methods 2013 189, 362 9. 83. Parekh, P.; Tang, Z.; Turner, P. C.; Moyer, R. W.; Tan, W., Aptamers Recognizing Glycosylated Hemagglutinin Expressed on the Surface of Vaccinia Virus Infected Cells. Analytic al Chemistry. 2010 82, 8642 8649. 84. Kim, Y. S.; Song, M. Y.; Jurng, J.; Kim, B. C., Isolation and characterization of DNA aptamers against Escherichia coli using a bacterial cell systematic evolution of ligands by exponential enrichment approach. Analy tical Biochemistry 2013 436, 22 28. 85. Duan, N.; Wu, S.; Chen, X.; Huang, Y.; Xia, Y.; Ma, X.; Wang, Z., Selection and Characterization of Aptamers against Salmonella typhimurium Using Whole Bacterium Systemic Evolution of Ligands by Exponential Enrich ment (SELEX). Journal of Agricultural and Food Chemistry 2013 61, 3229 3234. 86. Marton, S.; Romero Lopez, C.; Berzal Herranz, A., RNA aptamer mediated interference of HCV replication by targeting the CRE 5BSL3.2 domain. Journal of Viral Hepatitis. 2013 20, 103 112. 87. Ramalingam, D.; Duclair, S.; Datta, S. A. K.; Ellington, A.; Rein, A.; Prasad, V. R., RNA Aptamers Directed to Human Immunodeficiency Virus Type 1 Gag

PAGE 174

174 Polyprotein Bind to the Matrix and Nucleocapsid Domains and Inhibit Virus Production. Journal of Virology. 2011 85, 305 314. 88. The Eyetech Study, G.; Guyer, D. R., Preclinical and phase 1A clinical evaluation of an anti VEGF pegylated aptamer (EYE001) for the treatment of exudative age related macular degeneration. Retina 2002 22, 143 152. 89. Cheng, C.; Chen, Y. H.; Lennox, K. A.; Behlke, M. A.; Davidson, B. L., In vivo SELEX for Identification of Brain penetrating Aptamers. Mol Ther Nucleic Acids 2013 2, e67. 90. Chen, T.; Wu, C. S.; Jimenez, E.; Zhu, Z.; Dajac, J. G.; You, M. ; Han, D.; Zhang, X.; Tan, W., DNA Micelle Flares for Intracellular mRNA Imaging and Gene Therapy. Angewandte Chemie International Edition 2013, 52, 2012 2016. 91. Zhang, C.; Ji, X.; Zhang, Y.; Zhou, G.; Ke, X.; Wang, H.; Tinnefeld P.; He, Z., One Pot Synthesized Aptamer Functionalized CdTe:Zn2+ Quantum Dots for Tumor Targeted Fluorescence Imaging in Vitro and in Vivo. Analytical Chemistry 2013 92. Zhu, G.; Zheng, J.; Song, E.; Donovan, M.; Zhang, K.; Liu, C.; Tan, W., Self asse mbled, aptamer tethered DNA nanotrains for targeted transport of molecular drugs in cancer theranostics. Proceedings of the National Academy of Sciences of the United States of America. 2013 110, 7998 8003. 93. Zhu, Z.; Wu, C.; Liu, H.; Zou, Y.; Zhang, X .; Kang, H.; Yang, C. J.; Tan, W., An Aptamer Cross Linked Hydrogel as a Colorimetric Platform for Visual Detection. Angewan dte Chemie International Edition. 2010 49, 1052 1056. 94. Ocsoy, I.; Gulbakan, B.; Shukoor, M. I.; Xiong, X.; Chen, T.; Powell, D. H.; Tan, W., Aptamer Conjugated Multifunctional Nanoflowers as a Platform for Targeting, Capture, and Detection in Laser Desorption Ionization Mass Spectrometry. Acs Nano 2013 7, 417 427. 95. Wang, H.; Donovan, M. J.; Meng, L.; Zhao, Z.; Kim, Y.; Ye, M .; Tan, W., DNAzyme Based Probes for Telomerase Detection in Early Stage Cancer Diagnosis. Chemistry a European Journal 2013 19, 4633 4639. 96. Crouzier, L.; Dubois, C.; Edwards, S. L.; Lauridsen, L. H.; Wengel, J.; Veedu, R. N., Efficient Reverse Trans cription Using Locked Nucleic Acid Nucleotides towards the Evolution of Nuclease Resistant RNA Aptamers. Plos One 2012 7. 97. Soontornworajit, B.; Wang, Y., Nucleic acid aptamers for clinical diagnosis: cell detection and molecular imaging. Analytical a nd Bioanalytical Chemistry 2011 399, 1591 1599.

PAGE 175

175 98. Gragoudas, E. S.; Adamis, A. P.; Cunningham, E. T.; Feinsod, M.; Guyer, D. R.; Neova, V. I. S. O., Pegaptanib for neovascular age related macular degeneration. New England Journal of Medicine 2004 351, 2805 2816. 99. Sundaram, P.; Kurniawan, H.; Byrne, M. E.; Wower, J., Therapeutic RNA aptamers in clinical trials. European Jou rnal of Pharmaceutical Sciences. 2013 48, 259 271. 100. Keefe, A. D.; Pai, S.; Ellington, A., Aptamers as therapeutics (vo l 9, pg 537, 2010). Nature Reviews Drug Discovery 2010 9. 101. Jackson, G. W. Nucleic Acid Aptamees for Diagnostics and Therapeutics: Global Markets ; BCC Research: Wellesley, MA, 2010 102. Lonnberg, H., Solid Phase Synthesis of Oligonucleotide Conjuga tes Useful for Delivery and Targeting of Potential Nucleic Acid Therapeutics. Bioconjugate Chemistry 2009 20, 1065 1094. 103. Ohuchi, S., Cell SELEX Technology. BioResearch open access 2012 1, 265 72. 104. Liu, M.; Tada, S.; Ito, M.; Abe, H.; Ito, Y ., In vitro selection of a photo responsive peptide aptamer using ribosome display. Chemical Communications 2012 48, 11871 11873. 105. Katoh, K.; Misawa, K.; Kuma K.; Miyata, T., MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research 2002 30, 3059 3066. 106. Shangguan, D.; Cao, Z.; Meng, L.; Mallikaratchy, P.; Sefah, K.; Wang, H.; Li, Y.; Tan, W., Cel l Specific Aptamer Probes for Membrane Protein Elucidation in Cancer Cells. J. Proteome Res. 2008 7, 2133 2139. 107. Karnezis, T.; Shayan, R.; Caesar, C.; Roufail, S.; Harris, N. C.; Ardipradja, K.; Zhang, Y. F.; Williams, S. P.; Farnsworth, R. H.; Chai, M. G.; Rupasinghe, T. W. T.; Tull, D. L.; Baldwin, M. E.; Sloan, E. K.; Fox, S. B.; Achen, M. G.; Stacker, S. A., VEGF D Promotes Tumor Metastasis by Regulating Prostaglandins Produced by the Collecting Lymphatic Endothelium. Cancer Cell 2012 21, 181 195. 108. Zeng, Z.; Zhang, P.; Zhao, N.; Sheehan, A. M.; Tung, C. H.; Chang, C. C.; Zu, Y., Using oligonucleotide aptamer probes for immunostaining of formalin fixed and paraffin embedded tissues. Modern Pathology 2010 23, 1553 1558. 109. Jimenez, E.; Sefah, K.; Lopez Colon, D.; Van Simaeys, D.; Chen, H. W.; Tockman, M. S.; Tan, W., Generation of Lung Adenocarcinoma DNA Aptamers for Cancer Studies. Plos One 2012 7.

PAGE 176

176 110. Olygoananlyzer 3.1 Integrated DNA Technologies (IDT). Available: http://www.i dtdna.com/analyzer/applications/oligoanalyzer. Accessed July 13th 2010 111. Ale, A.; Ermolayev, V.; Deliolanis, N. C.; Ntziachristos, V., Fluorescence background subtraction technique for hybrid fluorescence molecular tomography/x ray computed tomography imaging of a mouse model of early stage lung cancer. Journal of biomedical optics 2013 18, 56006 56006. 112. Dutt, A.; Wong, K. K., Mouse models of lung cancer. Clinical Cancer Research. 2006 12, 4396S 4402S. 113. Dangles Marie, V.; Pocard, M.; Richo n, S.; Weiswald, L. B.; Assayag, F.; Saulnier, P.; Judde, J. G.; Janneau, J. L.; Auger, N.; Validire, P.; Dutrillaux, B.; Praz, F.; Bellet, D.; Poupon, M. F., Establishment of human colon cancer cell lines from fresh tumors versus xenografts: Comparison of success rate and cell line features. Cancer Research 2007 67, 398 407. 114. Sharma, S. V.; Haber, D. A.; Settleman, J., Cell line based platforms to evaluate the therapeutic efficacy of candidate anticancer agents. Nat Rev Cancer 2010 10, 241 253. 1 15. Cui, Z. Y.; Ahn, J. S.; Lee, J. Y.; Kim, W. S.; Lim, H. Y.; Jeon, H. J.; Suh, S. W.; Kim, J. H.; Kong, W. H.; Kang, J. M.; Nam, D. H.; Park, K., Mouse orthotopic lung cancer model induced by PC14PE6. Cancer research and treatment : official journal of Korean Cancer Association 2006 38, 234 9. 116. Gazdar, A. F.; Girard, L.; Lockwood, W. W.; Lam, W. L.; Minna, J. D., Lung Cancer Cell Lines as Tools for Biomedical Discovery and Research. Journal of the National Cancer Institute 2010 102, 1310 1321. 117. Gazdar, A. F.; Gao, B.; Minna, J. D., Lung cancer cell lines: Useless artifacts or invaluable tools for medical science? Lung Cancer 2010 68, 309 318. 118. Wistuba, II; Bryant, D.; Behrens, C.; Milchgrub, S.; Virmani, A. K.; Ashfaq, R.; Minna J. D.; Gazdar, A. F., Comparison of features of human lung cancer cell lines and their corresponding tumors. Clinical Cancer Research 1999 5, 991 1000. 119. Ocque, R.; Tochigi, N.; Ohori, N. P.; Dacic, S., Usefulness of Immunohistochemical and Histoch emical Studies in the Classification of Lung Adenocarcinoma and Squamous Cell Carcinoma in Cytologic Specimens. American Journal of Clinical Pathology 2011 136, 81 87.

PAGE 177

177 120. Zhao, Z.; Xu, L.; Shi, X.; Tan, W.; Fang, X.; Shangguan, D., Recognition of subt ype non small cell lung cancer by DNA aptamers selected from living cells. Analyst 2009 134, 1808 14. 121. Chen, H. W.; Medley, C. D.; Sefah, K.; Shangguan, D.; Tang, Z.; Meng, L.; Smith, J. E.; Tan, W., Molecular recognition of small cell lung cancer c ells using aptamers. ChemMedChem 2008 3, 991 1001. 122. Kawase, A.; Yoshida, J.; Ishii, G.; Nakao, M.; Aokage, K.; Hishida, T.; Nishimura, M.; Nagai, K., Differences Between Squamous Cell Carcinoma and Adenocarcinoma of the Lung: Are Adenocarcinoma and Squamous Cell Carcinoma Prognostically Equal? Japanese Journal of Clinical Oncology 2012 42, 189 195. 123. Soundararajan, S.; Wang, L.; Sridharan, V.; Chen, W.; Courtenay Luck, N.; Jones, D.; Spicer, E. K.; Fernandes, D. J., Plasma Membrane Nucleolin Is a Receptor for the Anticancer Aptamer AS1411 in MV4 11 Leukemia Cells. Molecular Pharmacology 2009 76, 984 991. 124. Lacroix, J.; Becker, H. D.; Woerner, S. M.; Rittgen, W.; Drings, P.; Doeberitz, M. V., Sensitive detection of rare cancer cells in sput um and peripheral blood samples of patients with lung cancer by preproGRP specific RT PCR. International Journal of Cancer 2001 92, 1 8. 125. Banys, M.; Muller, V.; Melcher, C.; Aktas, B.; Kasimir Bauer, S.; Hagenbeck, C.; Hartkopf, A.; Fehm, T., Circul ating tumor cells in breast cancer. Clinica chimica acta; international journal of clinical chemistry 2013 423, 39 45. 126. Amato, R. J.; Melnikova, V.; Zhang, Y.; Liu, W.; Saxena, S.; Shah, P. K.; Jensen, B. T.; Torres, K. E.; Davis, D. W., Epithelial Cell Adhesion Molecule positive Circulating Tumor Cells as Predictive Biomarker in Patients With Prostate Cancer. Urology 2013 81, 1303 7. 127. Pesta, M.; Fichtl, J.; Kulda, V.; Topolcan, O.; Treska V., Monitoring of circulating tumor cells in patients undergoing surgery for hepatic metastases from colorectal cancer. Anticancer research 2013 33, 2239 43. 128. Kang, J. H.; Krause, S.; Tobin, H.; Mammoto, A.; Kanapathipillai, M.; Ingber, D. E., A c ombined micromagnetic microfluidic device for rapid capture and culture of rare circulating tumor cells. Lab on a Chip 2012 12, 2175 2181. 129. Powell, A. A.; Talasaz, A. A. H.; Mindrinos, M.; Carlson, R.; Pease, F. W.; Davis, R. W.; Jeffrey, S. S., Mag Sweeper: an automated system for high efficiency and specificity capture of live circulating tumor cells. Breast Cancer Research and Treatment 2007 106, S24 S24.

PAGE 178

178 130. Hoshino, K.; Huang, Y. Y.; Lane, N.; Huebschman, M.; Uhr, J. W.; Frenkel, E. P.; Zhang X., Microchip based immunomagnetic detection of circulating tumor cells. Lab on a Chip 2011 11, 3449 3457. 131. Saloustros, E.; Perraki, M.; Apostolaki, S.; Kallergi, G.; Xyrafas, A.; Kalbakis, K.; Agelaki, S.; Kalykaki, A.; Georgoulias, V.; Mavroudis D., Cytokeratin 19 mRNA positive circulating tumor cells during follow up of patients with operable breast cancer: prognostic relevance for late relapse. Breast Cancer Research 2011 13. 132. Wong, S. C. C.; Chan, C. M. L.; Ma, B. B. Y.; Hui E. P.; Ng, S. S. M.; Lai, P. B. S.; Cheung, M. T.; Lo, E. S. F.; Chan, A. K. C.; Lam, M. Y. Y.; Au, T. C. C.; Chan, A. T. C., Clinical Significance of Cytokeratin 20 Positive Circulating Tumor Cells Detected by a Refined Immunomagnetic Enrichment Assay i n Colorectal Cancer Patients. Clinical Cancer Research 2009 15, 1005 1012. 133. Lin, H. C.; Hsu, H. C.; Hsieh, C. H.; Wang, H. M.; Huang, C. Y.; Wu, M. H.; Tseng, C. P., A negative selection system PowerMag for effective leukocyte depletion and enhanced detection of EpCAM positive and negative circulating tumor cells. Clinica Chimica Acta 2013 419, 77 84. 134. Nedosekin, D. A.; Juratli, M. A.; Sarimollaoglu, M.; Moore, C. L.; Rusch, N. J.; Smeltzer, M. S.; Zharov, V. P.; Galanzha, E. I., Photoacoustic and photothermal detection of circulating tumor cells, bacteria and nanoparticles in cerebrospinal fluid in vivo and ex vivo. Journal of biophotonics 2013 6, 523 33. 135. Sakurai, F.; Fujiwara, T.; Mizuguchi H., Development of a Detection System for Circulating Tumor Cells in Peripheral Blood Using a Next Generation Conditionally replicating Adenovirus. Yakugaku Zasshi Journal of the Pharmaceutical Society of Japan 2013 133, 291 296. 136. Zebisch, M.; Koe lbl, A. C.; Schindlbeck, C.; Neugebauer, J.; Heublein, S.; Ilmer, M.; Rack, B.; Friese, K.; Jeschke, U.; Andergassen, U., Quantification of Breast Cancer Cells in Peripheral Blood Samples by Real Time RT PCR. Anticancer Research 2012 32, 5387 5391. 137. Pal, S. K.; Lau, C.; He, M.; Twardowski, P.; Wilson, T. G.; Kawachi, M. H.; Torres, A.; Carmichael, C.; Yen, Y.; Kortylewski, M.; Jones, J., Detecting circulating tumor cells (CTCs) in patients with high risk, localized prostate cancer using the CellSearc h platform. Journal of Clinical Oncology 2012 30. 138. Kim, Y.; Kim, H. S.; Cui, Z. Y.; Lee, H. S.; Ahn, J. S.; Park, C. K.; Park, K.; Ahn, M. J., Clinicopathological Implications of EpCAM Expression in Adenocarcinoma of the Lung. Anticancer Research 2 009 29, 1817 1822.

PAGE 179

179 139. Poli, A.; Michel, T.; Theresine, M.; Andres, E.; Hentges, F.; Zimmer, J., CD56(bright) natural killer (NK) cells: an important NK cell subset. Immunology 2009 126, 458 465. 140. Wilchek, M.; Bayer, E. A., T he avidin biotin comp lex in bioanalytical applications Analytical Biochemistry 1988 171, 1 32. 141. Khan, M. S.; Tsigani, T.; Rashid, M.; Rabouhans, J. S.; Yu, D.; Tu Vinh, L.; Caplin, M.; Meyer, T., Circulating Tumor Cells and EpCAM Expression in Neuroendocrine Tumors. Cl inical Cancer Research 2011 17, 337 345. 142. Kontogianni, K.; Nicholson, A. G.; Butcher, D.; Sheppard, M. N., CD56: a useful tool for the diagnosis of small cell lung carcinomas on biopsies with extensive crush artefact. Journal of Clinical Pathology 2005 58, 978 980. 143. Sheng, W.; Chen, T.; Katnath, R.; Xiong, X.; Tan, W.; Fan, Z. H., Aptamer Enabled Efficient Isolation of Cancer Cells from Whole Blood Using a Microfluidic Device. Analytical Chemistry 2012 84, 4199 4206. 144. Joosse, S. A.; Pantel, K., Biologic Challenges in the Detection of Circulating Tumor Cells. Cancer Research 2013 73, 8 11. 145. Katz, R., Biomarkers and surrogate markers: an FDA perspective. NeuroRx : the journal of the American Society for Experimental NeuroTherapeu tics 2004, 1, 189 95. 146. Paul, D.; Kumar, A.; Gajbhiye, A.; Santra, M. K.; Srikanth, R., Mass Spectrometry Based Proteomics in Molecular Diagnostics: Discovery of Cancer Biomarkers Using Tissue Culture. Biomed Research International 2013 147. Cibiel A.; Dupont, D. M.; Duncoge, F., Methods to Identify Aptamers against Cell Surface Biomarkers. Pharmaceuticals 2011 1216 1235. 148. Mallikaratchy, P.; Tang, Z.; Kwame, S.; Meng, L.; Shangguan, D.; Tan, W., Aptamer directly evolved from live cells recog nizes membrane bound immunoglobin heavy Mu chain in Burkitt's lymphoma cells. Mol. Cell. Proteomics 2007 6, 2230 2238. 149. Lin, Y.; Zhang, L. H.; Wang, X. H.; Xing, X. F.; Cheng, X. J.; Dong, B.; Hu, Y.; Du, H.; Li, Y. A.; Zhu, Y. B.; Ding, N.; Du, Y. X.; Li, J. Y.; Ji, J. F., PTK7 as a novel marker for favorable gastric cancer patient survival. Journal of Surgical Oncology 2012 106, 880 886. 150. Meng, L.; Sefah, K.; O'Donoghue, M. B.; Zhu, G.; Shangguan, D.; Noorali, A.; Chen, Y.; Zhou, L.; Tan, W. Silencing of PTK7 in Colon Cancer Cells: Caspase 10 Dependent Apoptosis via Mitochondrial Pathway. Plos One 2010 5.

PAGE 180

180 151. O'Donoghue, M. B.; Shi, X.; Fang, X.; Tan, W., Single molecule atomic force microscopy on live cells compares aptamer and antibody rupture forces. Analytical and Bioanalytical Chemistry 2012 402, 3205 3209. 152. Xiao, Z.; Shangguan, D.; Cao, Z.; Fang, X.; Tan, W., Cell specific internalization study of an aptamer from whole cell selection. Chemistry a European Journal 2008 14, 1769 1775. 153. Chen, Y.; Munteanu, A. C.; Huang, Y. F.; Phillips, J.; Zhu, Z.; Mavros, M.; Tan, W., Mapping Receptor Density on Live Cells by Using Fluorescence Correlation Spectroscopy. Chemistry a European Journal 2009 15, 5327 5336. 154. Lopez Colon D., Aptamer based detection and characterization of Ovarian Cancer University of Florida: [Gainesville, Fla, 2011 155. Srinivasan, M.; Sedmak, D.; Jewell, S., Effect of fixatives and tissue processing on the content and integrity of nucleic acids. Ame rican Journal of Pathology 2002 161, 1961 1971. 156. Bonocora, R. P.; Fitzgerald, D. M.; Stringer, A. M.; Wade, J. T., Non canonical protein DNA interactions identified by ChIP are not artifacts. Bmc Genomics 2013 14. 157. Maniatis, S.; Zhou, H.; Rei nhold, V., Rapid De O Glycosylation Concomitant with Peptide Labeling Using Microwave Radiation and an Alkyl Amine Base. Analytical Chemistry 2010 82, 2421 2425. 158. Sandilands, A.; Sutherland, C.; Irvine, A. D.; McLean, W. H. I., Filaggrin in the fron tline: role in skin barrier function and disease. Journal of Cell Science 2009 122, 1285 1294. 159. Rendl, M.; Ban, J.; Mrass, P.; Mayer, C.; Lengauer, B.; Eckhart, L.; Declerq, W.; Tschachler, E., Caspase 14 expression by epidermal keratinocytes is reg ulated by retinoids in a differentiation associated manner. Journal of Investigative Dermatology 2002 119, 1150 1155. 160. Hattori, K.; Date, A.; Tohyama, K.; Tamura, H., Evaluation of golden silk derived extract epidermal barrier markers, caspase 14 an d related genes in human skin equivalent models. Journal of Investigative Dermatology 2013 133, S119 S119. 161. Yan, B. C.; Gong, C.; Song, J.; Krausz, T.; Tretiakova, M.; Hyjek, E.; Al Ahmadie, H.; Alves V.; Xiao, S. Y.; Anders, R. A.; Hart, J. A., Arginase 1 A New Immunohistochemical Marker of Hepatocytes and Hepatocellular Neoplasms. American Journal of Surgical Pathology 2010 34, 1147 1154.

PAGE 181

181 162. Krasnov, G. S.; Dmitriev, A. A.; Snezhkina, A. V.; K udryavtseva, A. V., Deregulation of glycolysis in cancer: glyceraldehyde 3 phosphate dehydrogenase as a therapeutic target. Expert Opinion on Therapeutic Targets 2013 17, 681 693. 163. Fanali, G.; di Masi, A.; Trezza, V.; Marino, M.; Fasano, M.; Ascenzi P., Human serum albumin: From bench to bedside. Molecular Aspects of Medicine 2012 33, 209 290. 164. Umemoto, T.; Han, C. Y.; Mitra, P.; Averill, M. M.; Tang, C.; Goodspeed, L.; Omer, M.; Subramanian, S.; Wang, S.; Den Hartigh, L. J.; Wei, H.; Kim, E. J.; Kim, J.; O'Brien, K. D.; Chait, A., Apolipoprotein AI and High Density Lipoprotein Have Anti Inflammatory Effects on Adipocytes via Cholesterol Transporters ATP Binding Cassette A 1, ATP Binding Cassette G 1, and Scavenger Receptor B 1. Circulation Re search 2013 112, 1345 +. 165. Morel, E.; Gruenberg, J., The p11/S100A10 Light Chain of Annexin A2 Is Dispensable for Annexin A2 Association to Endosomes and Functions in Endosomal Transport. Plos One 2007 2. 166. Lokman, N. A.; Ween, M. P.; Oehler, M K.; Ricciardelli, C., The role of annexin A2 in tumorigenesis and cancer progression. Cancer microenvironment : official journal of the International Cancer Microenvironment Society 2011 4, 199 208. 167. Hobbs, R. P.; Green, K. J., Desmoplakin Regulat es Desmosome Hyperadhesion. Journal of Investigative Dermatology 2012 132, 482 485. 168. Chidgey, M.; Dawson, C., Desmosomes: a role in cancer? British Journal of Cancer 2007 96, 1783 1787. 169. Yang, L.; Chen, Y.; Cui, T.; Koensel, T.; Zhang, Q.; Al bring, K. F.; Huber, O.; Petersen, I., Desmoplakin acts as a tumor suppressor by inhibition of the Wnt/beta catenin signaling pathway in human lung cancer. Carcinogenesis 2012 33, 1863 1870. 170. Schleipman, A. R.; Gallagher, P. W.; Gerbaudo, V. H., Opt imizing Safety of Selective Internal Radiation Therapy (SIRT) of Hepatic Tumors with Y 90 Resin Microspheres: A Systematic Approach to Preparation and Radiometric Procedures. Health Physics 2009 96, S16 S21.

PAGE 182

182 BIOGRAPHICAL SKETCH Elizabeth Jimenez was born in Santiago de Cali Colombia to a working class family She earned her Bachelor of Science d egree in Chemistry at the Universidad del Valle in 2004 During her senior year she trav eled to the United States for a student e xchange program in the W hitney Laboratory for Marine Biosc ience She worked there three years before starting her PhD studies in Biochemistry at the University of Florida (2008) under the direction and guidance of Dr. Weihong Tan. Her graduate work focused on the development and clinical t ranslation of aptamers in lung c ancer. During summer of 2013 she completed her PhD studies and started a postdoctoral position at the University of Florida in the D epartment of Physiological Sciences