Kinetic and genetic analysis of early photomorphogenic interaction in the model plant Arabidopsis thaliana

MISSING IMAGE

Material Information

Title:
Kinetic and genetic analysis of early photomorphogenic interaction in the model plant Arabidopsis thaliana
Physical Description:
1 online resource (130 p.)
Language:
english
Creator:
Wang, Yihai
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Plant Molecular and Cellular Biology
Committee Chair:
Folta, Kevin M
Committee Members:
Koch, Karen E
Rollins, Jeffrey A
Hauser, Bernard A
Cao, Yunwei Charles

Subjects

Subjects / Keywords:
arabidopsis -- auxin -- ecotype -- light -- photomorphogenesis -- photoreceptor
Plant Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre:
Plant Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Work presented here seek to add resolution to light-signaling models by describing how specific wavelengths of light are sensed and integrated. Hypotheses tested in this work concentrate on two areas: 1) how green light (GL)interacts with known photosensory systems and 2) identifying the signaling components for GL transduction. Many of the GL effects described oppose the typical light responses, but the underlying mechanisms are poorly understood. The work here investigated the interaction between GL and red light (RL) or far-red light (FrL) in the regulation of early photomorphogenesis. The results demonstrate an attenuation effect of GL on RL/FrL-induced hypocotyl-growth-inhibition. Unexpectedly, this GL effect is not observed when the blue light (BL) receptor phot1or its interacting component, NPH3,is absent. Careful re-examination of this response under conditions of dim BL and RL/FrL regenerated the negation effects on RL/FrL, indicating that the GL negation of RL/FrL response is actually a dim BL effect from a small amount of Arabidopsis thaliana, Knox-10, which may contain genetic variations in the GL signaling pathway. Knox-10 displayed a greatly reduced, GL-stimulated hypocotyl-elongation-response. The same genotype also howed atypical, directional hypocotyl growth (i.e.,a lack of hypocotyl-randomization-response HRR) under RL. Linkage mapping results indicate that the HRR phenotype co-segregates with several molecular markers on chromosome one. In addition, Knox-10 also showed increased hyponastic growth under certain light conditions during early vegetative growth. Collectively, results presented in this work expand the knowledge of light signaling models by investigating how specific wavelengths of light are sensed, transduced, and integrated. This information expands what we know about light signaling models and may be applicable to future agricultural practices.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Yihai Wang.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: Folta, Kevin M.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-02-28

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0045833:00001


This item is only available as the following downloads:


Full Text

PAGE 1

KINETIC AND GENETIC ANALYSIS OF EARLY PHOTOMORPHOGENIC INTERACTION IN THE MODEL PLANT ARABIDOPSIS THALIANA By YIHAI WANG A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013 1

PAGE 2

2013 Yihai Wang 2

PAGE 3

To my lovely wife, Wenjing, for her sweet push, my parents and sister, for their undemanding love! 3

PAGE 4

ACKNOWLEDGMENTS I sincerely thank all the Folta lab members, present and past, for their kind help and friendship. Especially, I would like to thank Maureen Clancy for her assistance in obtaining reagents and lab supplies, as well as providing fascinati ng disserts during lab meetings. I thank Mithu Chatterjee, Asha Brunings and Hernn Rosli for their guidance on experimental methods and discussions on research questions. I thank Tingting Zhang for her knowledge in green light and growing Arabidopsis I thank Alan Chambers for the interesting conversations covering many aspects of American life. I thank the members of my committee, which included Karen Koch, Kevin Folta, Bernard Hauser, Jeffrey Rollins, and Y. Charles Cao for their invaluable input and advice. Special thanks go to my coauthors, including Stefanie Maruhnich, Melissa Mageroy with whom I am looking forward to collaborating in the future. I also would like to express my appreciations to the PMCB students, faculties, and staff for their fr iendship, insights, and assistance during the past years. My deepest appreciation goes to my family, who has always given love and support to me along these years, including my parents, Shurong, Shiquan, Ping, and Hechuan, my sister and her husband, Yuefei and Aichun Ma, and my lovely wife, Wenjing. In the end, I would like to thank my advisor and friend, Kevin Folta, for years of guidance on my research, writing, and presentation, and for being a good model of mentor and scientist. 4

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF TABLES ............................................................................................................ 8 LIST OF FIGURES .......................................................................................................... 9 LIST OF ABBREVIATIONS ........................................................................................... 11 ABSTRACT ................................................................................................................... 13 CHAPTER 1 LITERATURE REVIEW .......................................................................................... 15 Plant Photoreceptors and their Responses to GL ................................................... 15 GL in the Regulation of Plant Growth and Development ......................................... 22 Seed Dormancy and Germination .................................................................... 22 Seedlings Establishment .................................................................................. 23 Vegetative Growth ............................................................................................ 24 Shade Avoidance ............................................................................................. 25 Flowering .......................................................................................................... 26 Anthocyanin Accumulation ............................................................................... 27 Stomatal Opening ............................................................................................. 28 Gene Expression .............................................................................................. 28 Arabidopsis Natural Variations in Light Signaling Transduction .............................. 29 2 INVESTIGATION OF T HE INTERACTIONS BETWEEN BLUEGREEN LIGHT AND RL/FrL DURING EARLY PHOTOMORPHOGENESIS ................................... 31 Introduction ............................................................................................................. 31 Results .................................................................................................................... 33 GL Attenuates RLMediated Stem Growth Inhibition ........................................ 33 Genetic Analysis of the GL Opposition of RL Response .................................. 34 The GL Opposition to RL Stem Response does not Affect other phy Responses .................................................................................................... 35 GL also Reverses Early FrLInduced Stem Growth Inhibition .......................... 36 GL Negation of FrL Stem Response also Requires phot1 and NPH3 .............. 37 GL Negation of RL Stem Response can be Phenocopied by Supplementation of Dim BL ........................................................................... 37 Discussion .............................................................................................................. 38 GL and Phytochrome in the Regulation of Photomorphogenic Responses ...... 38 Phototropin 1 and its Negation Effect on RL/FrL .............................................. 40 Materials and Methods ............................................................................................ 41 Plant Materials .................................................................................................. 41 5

PAGE 6

Light Sources and Treatments ......................................................................... 41 Hypocotyl Elongation Assays ........................................................................... 42 Quantitative RT PC R Analysis ......................................................................... 42 Accession Numbers ......................................................................................... 43 3 MECHANISMS OF PHOT1 MEDIATED BL ATTENUATION OF RL EFFECTS ..... 53 Introduction ............................................................................................................. 53 Results .................................................................................................................... 55 The Roles of cry in phot1Mediated BL Attenuation of RLInduced Stem Inhibition ........................................................................................................ 55 BL Adjusts phy Induced Hook Opening Process .............................................. 56 The Roles of cry and phot1 in the BLMediated Adjustment of Hook Opening Response ....................................................................................... 57 The phot1 Adjustment of RLInduced Stem Inhibition and Hook Opening Requires Normal Auxin Transport ................................................................. 58 Genet ic Tests of Auxin Transporter M utants for BL Attenuation of RL Response ...................................................................................................... 59 The phot1Attenuation Response to RL Functions Normally in Single pks Mutant Backgrounds ..................................................................................... 60 Discussion .............................................................................................................. 60 Adjustment of phy Mediated Photomorphogenic Programs by phot1 ............... 60 Auxin Transport and its Possible Involvement in the phot1 Action ................... 62 PKS Proteins and the Oppositional BL Response ............................................ 65 Materials and Methods ............................................................................................ 66 Plant Materials .................................................................................................. 66 Light Sources and Treatments ......................................................................... 66 Long term Hypocotyl Length Measurement ...................................................... 66 Chlorophyll Extraction and Measurement ......................................................... 67 Time course Hypocotyl Growth and Hook Opening Kinetic s ............................ 67 Statistical Analysis ............................................................................................ 68 4 DISCOVERY OF CANDIDATE GL SIGNALING COMPONENT FROM ARABIDOPSIS NATURAL ACCESSIONS ............................................................. 75 Introduction ............................................................................................................. 75 Results .................................................................................................................... 78 Response of Natural Arabidopsis Accessions to GL ........................................ 78 RL Induced Hypocotyl Randomization Response (HRR) is Defective in Knox 10 Ecotype ........................................................................................... 78 Hyposensitivity of Knox 10 to Changes in RL FluenceRate ............................ 79 Map Location of the RLInduced HRR Gene .................................................... 80 Increased Hyponastic Growth in Knox 10 Ecotype .......................................... 80 Knox 10 Responds Normally to RL at the Level of Transcriptional Regulation of ShadeInduced Marker Genes ................................................ 82 Relationships between the Defective RL Induced HRR and the Increased Hyponastic Growth ........................................................................................ 82 6

PAGE 7

Examination of Amyloplasts ............................................................................. 83 Discussion .............................................................................................................. 83 Arabidopsis Natural Variations and GL Response ........................................... 83 Impaired HRR in Knox 10 Accession ............................................................... 84 Hyposensitivity to RL Fluence Rate Changes and Increased Hyponastic Growth ........................................................................................................... 86 RL Induced HRR and Increased Hyponastic Growth ....................................... 88 Materi als and Methods ............................................................................................ 91 Plant Materials .................................................................................................. 91 GL Stimulated Hypocotyl Elongation Screening Assay .................................... 91 End Point Hypocotyl Length and Curvature Measurements ............................. 92 Mapping of the RLInduced HRR Gene ............................................................ 92 Hyponastic Growth Measurement .................................................................... 93 RNA Extraction and Quantitative RT PCR Analysis ......................................... 93 Iodine Staining of Endodermal Amyloplasts ..................................................... 94 Statistical Analysis ............................................................................................ 95 5 CONCLUSIONS AND FUTURE DIRECTIONS .................................................... 109 LIST OF REFERENCES ............................................................................................. 113 BIOGRAPHICAL SKETCH .......................................................................................... 130 7

PAGE 8

LIST OF TABLES Table page 2 1 Primers us ed in qRT PCR assay in Chapter 2 ................................................... 44 4 1 Statistical analysis of hypocotyl growth rate between different accessions and Col0 in response to GL treatment ...................................................................... 96 4 2 SSLP markers used in Chapter 4 ....................................................................... 97 4 3 Candidate map location of the RLinduced HRR gene ....................................... 99 4 4 P rimers used in qRT PCR assay in Chapter 4 ................................................. 100 8

PAGE 9

LIST OF FIGURES Figure page 2 1 GL attenuates RLinduced stem inhibition. ......................................................... 45 2 2 GL opposition effect on RL requires phot1 and NPH3 ........................................ 46 2 3 The GL opposition to RL stem responses does not affect the expression of RL early induced marker genes ......................................................................... 47 2 4 GL negates FrL induced stem inhibition in short term analyses ......................... 48 2 5 GL opposition to FrL stem response als o requires phot1 ................................... 49 2 6 BL negates RL stem inhibition through phot1 ..................................................... 50 2 7 BL attenuates FrL induced stem inhibition through phot1 .................................. 51 2 8 Simplified diagram of light regulated hypocotyl growth during early photomorphogenesis .......................................................................................... 52 3 1 BL fluencerate response tests of the BL attenuation of RLhypocotyl response in wildtype and cry mutant backgrounds ............................................ 69 3 2 BL delays phy induced hook opening ................................................................. 70 3 3 BL attenuation of RL/FrLinduced hook opening is absent in the phot1 mutant 71 3 4 Normal auxin transport is required for the dim BL effect ..................................... 72 3 5 Genetic tests of the dim bluereversal of RL hypocotyl response in auxin transporter mutants. ........................................................................................... 73 3 6 The blue attenuation to RL hypocotyl response functions normally in single pks mutant backgrounds. ................................................................................... 74 4 1 Initial response of the GLstimulatedhypocotyl growth in Arabidopsis ecotypes. .......................................................................................................... 101 4 2 Knox 10 is defective in the RLinduced hypocotyl randomization response ..... 102 4 3 Knox 10 is hyposensitive to changes in RL fluence rate .................................. 103 4 4 Hypocotyl randomizationcurvature distribution in Knox 10 x Col 0 F1 and F2 plants treated with continuous RL for 3 days ............................................... 104 4 5 Knox 10 plants (first to third true l eaf stage) showed increased hyponastic growth ............................................................................................................... 105 9

PAGE 10

4 6 Relative transcript levels of shadeinduced marker genes in Col 0 and Knox 10 plants in response to different light treatments ............................................ 106 4 7 Genetic relationships between RLinduced hypocotyl randomizationresponse (HRR) and increasedhyponastic growth .......................................... 107 4 8 The RL regu lated amyloplast development is normal in Knox 10 ecotype ....... 108 10

PAGE 11

LIST OF ABBREVIATIONS Micrometer Micromolar Arabidopsis Arabidopsis thaliana BL Blue light cm Centimeter CRY Cryptochrome apoprotein cry Cryptochrome holoprotein (with chromophore covalently attached to apoprotein) d Days FAD Flavin adenine nucleotide FMN Flavin mono nucleotide FrL Far red light g Grams GL Green light h Hours HRR Hypocotyl randomizationresponse LED Light emitting diode LOV Light oxygenvoltage min Minutes NPA 1 N Naphthylphthalamic acid PAR Photosynthetically active radiation Pfr Far red absorbing phytochrome PHOT Phototropin apoprotein phot Phototropin holoprotein PHR P hotolyasehomologous region 11

PAGE 12

PHY Phytochrome apoprotein phy Phytochrome holoprotein P/L Petiole: leaf ratio Pr Red absorbing phytochrome qPCR Quatitative polymerase chain reaction RL Red light R/FR Red to far red ratio s Second SSLP Simple sequence length polymorphism SAS Shade avoidance syndrome UV Ultraviolet 12

PAGE 13

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillm ent of the Requirements for the Degree of Doctor of Philosophy KINETIC AND GENETIC ANALYSIS OF EARLY PHOTOMORPHOGENIC INTERACTION IN THE MODEL PLANT ARABIDOPSIS THALIANA By Yihai Wang August 2013 Chair: Kevin Folta Major: Plant Molecular and Cellular B iology Work presented here seeks to add resolution to light signaling models by describing how specific wavelengths of light are sensed and integrated. Hypotheses tested in this work concentrate on two areas: 1) how green light ( GL ) interacts with known photosensory systems and 2) identifying the signaling components for GL transduction. Many of the GL effects described oppose the typical light responses, but the underlying mechanisms are poorly understood. The work here investigated the interaction between GL and red light (RL) or far red light (FrL) in the regulation of early photomorphogenesis. The results demonstrate an attenuation effect of GL on RL/FrL induced hypocotyl growth inhibition. Unexpectedly, t his GL effect is not observed when the blue ligh t (BL) receptor phot1 or its interacting component NPH3 is absent. Careful re examination of this response under conditions of dim BL and RL/FrL re generated the negation effects on RL/FrL, indicating that the GL negation of RL/FrL response is actually a dim BL effect from a small amount of <500 nm light present in green LED light source. Results also demonstrate that dim BL delays apical hook opening through the action of phot1. These phot1mediated dim BL effects likely require coordinated action of the plant hormone, auxin. R esults uncover a particular situation where BL postpones 13

PAGE 14

RL/FrL guided photomorphogenesis. Physiologically, the phot1ajustment of RL/FrL responses may enable an emerging seedling to better utilize its limited resources in reaching a better photosynthetically favorable position. Work presented here also describes a natural accession of Arabidopsis thaliana, Knox 10, which may contain genetic variations in the GL signaling pathway. Knox 10 displayed a greatly reduced, GL stimulated hypocotyl elongationresponse. The same genotype also showed atypical directional hypocotyl growth (i.e., a lack of hypocotyl randomizationresponse [HRR]) under RL Linkage mapping results indicate that the HRR phenotype cosegregates with several molecular markers on chromosome one. In addition, Knox 10 also showed increased hyponastic growth under certain light conditions during early vegetative growth. Collectively, results presented in this work expand the knowledge of light signaling models by investigating how specific wavelengths of light are sensed, transduced, and integrated. This information expands what we know about light signaling models and may be applicable to future agricultural practices. 14

PAGE 15

1CHAPTER 1 LITERATURE REVIEW Plants are sessile org anisms. Their physiological and morphological plasticity are greatly influenced by ambient light signals. Finely tuned light regulated plant growth and development (photomorphogenesis) are achieved by the orchestrated actions of multiple photosensing syst ems. The genetic basis as well as the molecular mechanisms of the signaling transductions for ultraviolet B (UV B, 280 315 nm), ultraviolet A (UV A, 315 400 nm), blue (400500 nm), and red/far red light (600800 nm) have been described in a great detail in the past decades. However, our knowledge of green light (GL) in the regulation of plant growth and development is relatively limited. The molecular basis for the sparsely documented GL responses is even less understood. The lack of understanding of this w aveband prevent s us utilizing or designing lighting conditions for modern agricultural practices or develops a comprehensive understanding of plant light sensing systems. Plant P hotoreceptors and their R esponses to GL Plant photoreceptors share the common structural arrangement of a photonabsorbing chromophore covalently or noncovalently bound to an apoprotein ( Mglich e t al., 2010) In Arabidopsis thaliana (hereafter Arabidopsis ) photoreceptor apoproteins are abbreviated in uppercase format, such as PHY (phytochrome), CRY (cryptochrome), and PHOT (phototropin). The holoproteins (apoprotein attached with chromophore) a re designated with lowercase, for instance, phy, cry, and phot ( Quail et 1 The GL in the Regulation of Plant Growth and Development section in Chapter 1 has been published in American Journal of Botany. The following is the citation information: "Wang, Yihai, and Kevin M. Folta. Contributions of green light to plant growth and development. American journal of botany 100.1 (2013): 7078." Reprinted with permission from American Journal of Botany. 15

PAGE 16

al., 1994 ; Lin et al. ; Briggs et al., 2001) The discovery of plant photoreceptors was boosted by the use of genetic mutants in the model plant Arabidopsis thaliana (hereafter Arabidopsis ) during the 1980s to 1990s. The phytochrome (phy) fam ily (phyA phyE) mainly absorbs red and far red wavebands through its chromophore phytochromobilin ( Franklin and Quail, 2010) The term of phytochrome, referring to plant and color in Greek, was originally proposed by Dr. Warren Butler, according to Dr. Harry Borthwick. Although the first purification of phytochrome pigment from plant was made in the 1959 by Butlers group, the characteristics of the photoconvertibility of this pigment in response to RL/FrL light has been described by Borthwick in 1952 ( Borthwick et al., 1952; Butler et al., 1959) In the 1980s, Maarten Koornneef descr ibed several light mutants in his seminal work, Genetic Control of Light inhibited Hypocotyl Elongation in Arabidopsis thaliana (L.) Heynh ( Koornneef, Rolff, and Spruit, 1980 ) One of those mutants, hy3 which is insensitive to RL was later shown to be deficient in phyB ( Somers et al., 1991) Two years later, a new class of long hypocotyl mutant hy8 which is insensitive to FrL wa s found to be deficient in phyA ( Parks and Quail, 1993) Based on light stability, phytochromes can be divided into two groups, the Type I light labile phytochrome and the Type II light stable phytochrome s ( Chen, Chory, and Fankhauser, 2004) The phyA receptor is the only Type I phytochrome and is most abunda nt in etiolated seedlings ( Clough and Vierstra, 1997) By contrast, the phyB t hrough phyE receptors are relatively light stable ( Sharrock and Clack, 2002; Franklin and Quail, 2010) Functional phytochromes require the formation of homodimers or heterodimers, however, heterodimers between phyA and phyB E has not yet been found ( Sharrock and Clack, 2004; Clack et al., 2009) Phytochromes exist in plants with 16

PAGE 17

two forms, the Pr (redlight absorbing) inactive form with a maximum absorption peak at 670 nm, and the Pfr (far red absorbing) active form with the absorption peak near 730 nm ( Rockwell, Su, and Lagarias, 2006) These two forms are in a dynamic photoequilibrium depending on red to far red ratios from ambient light environment. The absorption of RL leads to the activation and translocation of Pfr form phytochromes from cytosol into the nucleus ( Huq, Al Sady, and Quail, 2003) T ranslocation of phyA into the nucleus requires the presence of FAR REDELONGATED HYPOCOTYL 1 (FHY1) and FHY1 LIKE ( FHL) ( Rsler, Klein, and Zeidler, 2007) Inside the nucleus, phytochromes interact with PHYTOCHROME INTERACTING FACTORS (PIFs, bHLH transcription factor) where they mediate the degradation of PIFs, and release the suppressi on of photomorphogenesis related gene expression ( Bae and Choi, 2008 ) Phytochromes regulate many aspects of plant growth and development, such as seed germination, hypocotyl growth rate inhibi tion, chloroplast development, hook opening, shade avoidance, and flowering time ( Smith, 1995 ; Chen, Chory, and Fankhauser, 2004; Franklin and Quail, 2010) These physiological changes often are accompanied by the adjustment of gene expression ( Tepperman et al., 2001; Tepperman et al., 2004; Tepperman, Hwang, and Quail, 2006) Cryptochromes (cry), phototropins (phot), and other Light Oxygen Voltage ( LOV ) domain proteins are blue and UV A light sensors ( Kami et al., 2010) Arabidopsis has three cryptochromes (cry1, cry2, and cry3), two phototropins (phot1 and phot2), and three other LOV domain proteins (ZTL, FKF1, and LKP2). The identification of cryptochromes started with analysis of genetic mutants. The gene responsible for the BL insensitive phenotype in the hy4 mutant described in Koornneefs paper was cloned 17

PAGE 18

and sequenced in 1993 by Ahmad and Cashmore. The gene was redesignated CRY1 ( Koornneef, Rolff, and Spruit, 1980; Ahmad and Cashmore, 1993; Lin et al., 1995) The structure of this photoreceptor is related to that of DNA photolyases, but the DNA repair activity is not observed ( Lin and Shalitin, 2003 ; Chen, Chory, and Fankhauser, 2004) The N terminal of this protein contains a photolyasehom ologous region (PHR) domain that binds to its chromophore flavin adenine dinucleotide (FAD) ( Lin et al., 1995 ; Liu et al., 2011) The cry2 receptor is thought to be mostly nuclear localized, while cry1 can be found in both the cytosol and the nucleus ( Lin and Shalitin, 2003; Yu et al., 2007 ; Yu et al., 2009) Upon BL irradiation, cry ptochromes are phosphorylated to their active form and initiate photomorphogenic programs ( Shalitin et al., 2002; Shalitin et al., 2003) There are two major pathways for cryptochromes to control gene expression. One is through the bluelight dependent interac tions with the transcription factor CRYPTOCHROME INTERACTING BASIC HELIX LOOP HELIX ( CIB ) which regulates photomorphogenesis and flowering related gene expression. The other is through the suppression of CONSTITUTIVELY PHOTOMORPHOGENIC 1( C OP1 ) E3 ligase activity. COP1 targets transcription factors, like LONG HYPOCOTYL 5 ( HY5, basic leucine z ipper transcription factor) and CONSTANS ( CO ) which are important for deetiolation and flowering initiation process, respectively ( Liu et al., 2011) The plant phototropic response was described as early as the 1880s by Charles and Francis Darwin in the seminal work, The Power of Movements in Plants ( Holland, Roberts, and Liscum, 2009) However, until the1990s, the photosensing molecule initiating this response remained undefined. The use of an Arabidopsis mutant with an i mpaired phototropic response by Winslow Briggss group finally led to the molecular 18

PAGE 19

identification and characterization of the PHOT1 / NONPHOTOTROPIC HYP O COTYL ( NPH1 ) gene as a BL receptor governing phototropic response ( Liscum and Briggs, 1995; Huala et al., 1997; Christie et al., 1998; Christie et al., 1999) The phototropins contain two LOV domains (LOV1 and LOV2) at the N ter minus that noncovalently bind to a flavin mononucleotide ( FMN ) chromophore ( Christie et al., 1999 ) Although similar in structure, it has been demonstrated that only the LOV2 domain is essential for phototropism. The LOV1 domain seems to be a suppressor for LOV2domainmediated kinase activity ( Kimura and Kagawa, 2006) Later studies on phot1 and phot2 demonstrated their roles in regulating chloroplast movements ( Kagawa et al., 2001; Sakai et al., 2001) stomatal opening ( Kinoshita et al., 20 01 ) rapid inhibition of hypocotyl growth ( Folta and Spalding, 2001a ; Folta et al., 2003a) and regulation o f mRNA transcript stability ( Folta and Kaufman, 2003) Phototropins are plasmamembrane associated proteins but t he functional nature of this association is still unclear ( Christie, 2007 ) BL irradiation leads to the dissociation of phototropins from the plasma membrane and localization to the cytosol or Golgi apparatus ( Sakamoto and Briggs, 2002; Kong et al., 2006) Two phototropin interacting components, NON PHOTOTROPIC HYPOCOTYL 3 (NPH3) and ROOT PHOTOTROPISM 2 ( RPT2 ) have been shown to be essential for hypocotyl and root phototropism, respectively ( Motchoulski and Liscum, 1999; Sakai et al., 2000) Both proteins consist of a BTB/POZ domain at the N terminus that serves as a critical motif for proteinprotein interactions ( Kimura and Kagawa, 2006) Other LOV domain family proteins, like ZEITLUPE ( ZTL ) FLAVIN BINDING KELCH REPEAT F BOX ( FKF) and LOV KELCH REPEAT PROTEIN 2 ( LKP2 ) all 19

PAGE 20

consist of the light sensing LOV domain and the proteolysis associated F box domain ( Mglich et al., 2010) Such structures enable these proteins to direct protein degradation in a light dependent manner. The biological function of ZTL is closely related to plant circadian clock control. ZTL targets a central circadian regulation oscillator protein TIMING OF CAB EXPRESSION 1 (TOC1) mediating its degradation ( Mas et al., 2003) The stability of the ZTL protein is enhanced by its direct interaction with GIGANTEA ( GI, a ke y determinant of plant flowering time). This GI ZTL interaction can be increased by threefold under BL ( Kim et al., 2007) GI is also transcriptionally regulated by the clock and the interaction of ZTL and GI might indirectly lead to the dissociation of TOC1 from ZTL ( Somers and Fujiwara, 2009) FKF1 is reported to be essential in generating diurnal CO tran script accumulation ( Imaizumi et al., 2003) The mechanism of its regulation partial ly relies on the degradation of CYCLING DOF FACTOR 1 ( CDF1, a CO transcription repressor), mediated by FKF1CDF1 interaction ( Imaizumi et al., 2005) LKP2 is a nuclear localized protein with similar function with ZTL in regulating TOC1 degradation ( Yasuhara et al., 2004; Baudry et al., 2010) UV RESISTANCE LOCUS 8 ( UVR8) is the UV B receptor that was molecularly characterized in 2011 ( Rizzini et al., 2011 ) Interestingly, the discovery of this gene dates back to 2002, where its mutation resulted in a hypersensitive UV B response due to the reduced expression of genes conferring UV protection ( Kliebenstein et al., 2002) The absorption of UV B is mediated by a tryptophan pyramid structure in UVR8 protein itself, rather than a bound chromophore ( Rizzini et al., 2011 ; Christie et al., 2012) Activ ation by UV B leads to the rapid monomerization of UVR8 dimers and monomeric 20

PAGE 21

UVR8 accumulation in the nucleus ( Kaiserli and Jenkins, 2007; Rizzini et al., 2011 ) In the nucleus, UVR8 binds to chromatin through histones and interacts with COP1 to initiate UV protection related gene expression ( Cloix and Jenkins, 2008; Favory et al., 2009; Christie et al., 2012) Meanwhile, UV B induced UVR8 monomerization is also reversible in vivo which constantly disrupts UVR8COP1 interaction ( Heijde and Ulm, 2013; Heilmann and Jenkins, 2013) It was shown that two UVR8interacting proteins REPRESSOR OF UVB PHOTOMORPHOGENESIS ( RUP1 and RUP2 ) were responsible for the redimerization process, mediating the regeneration of reactivatable UVR8 homodimers post UV B exposure ( Heijde and Ulm, 2013) The greenyellow portion of the spectrum also has been shown to contribute to plant development through esta blished red blue photosensing pathways as the known photoreceptors c an respond to green wavebands. For instance, phytochro me can be converted to the far red absorbing, biologically active form by exposure to GL GL establishes a phytochrome equilibrium favoring the active Pfr form ( Hartmann, 1967) and GL is sufficient to activate phy responses like the seed germination in Arabidopsis ( Shinomura et al., 1996) Cryptochromes exist in three interconvertable f lavin redox states, flavoquinone (FAD), flavosem iquinone (FAD ), and flavohydroquinone (FAD-). Upon excitation by BL the flavin chromophore is reduced to a sem iquinone FAD that can absorb light g reen and yellow light ( Banerjee et al., 2007) However FAD is the active form mediating cry response. Illumination with greenyellow light (56310 nm) results in the conversion of FAD to FADand inactivates cry ( B anerjee et al., 2007; Bouly et al., 2007) Similar inactivation of cry mediated responses by GL has been observed in an additional report ( Sellaro et al., 2010) However, there are green 21

PAGE 22

responses that cannot be accounted for geneticall y ( Folta, 2004; Dhingra et al., 2006; Zhang, Maruhnich, and Folta, 2011) They persist in null photoreceptor backgrounds and typically operate in the opposite direction of normal light responses. These lines of reasoning suggest that a yet to bedefined GL sensor that may mediate these responses. GL in the R egul ation of P lant G rowth and D evelopment The GL mediated plant responses have been described throughout the history of plant photobiology research. The following paragraphs are a summary of contemporary cases where GL effects have been documented. Examination of these examples may guide further inquiries into how GL may affect plant growth and develop hypothesis to test the underlining mechanisms. Seed D ormancy and G ermination Light is critical in conditioning seed dormancy release and subsequent germination. Different light wavebands produce various effects on this process. Different plant species exhibit ranging responses to blue and GL on dormancy release ( Goggin and Steadman, 2012) For some plant species, like ryegrass ( Lolium rigidum ), seed dormancy release is stimulated by dark stratification. Germination of most dormant seeds cannot be stimulated by light unless they are given a 20d dark s tratification treatment prior to the light exposure. Seeds stratified in FrL have a germination rate close to dark stratified seeds. However, seeds stratified in BL maintain dormancy regardless of the presence or absence of FrL light. Interestingly, GL act s similar ly to blue light to inhibit dormancy release in the absence of BL ( Goggin, Steadman, and Pow les, 2008) An action spectrum was devised for the response and showed that BL or GL mediated dormancy maintenance in ryegrass has three efficient peaks: 460, 510, 22

PAGE 23

and 550 nm ( Goggin and Steadman, 2012) Since the inhibition of dormancy release between 510 to 550 nm wavelengths is absent, they proposed that the GL effect at 550 nm was probably mediated by a novel photoreceptor other than cr yptochrome ( Goggin and Steadman, 2012) Seedlings E stablishment Plants adjust hypocotyl or stem elongation in response to ambient light con ditions. Typically, as the seedling emerges from the soil the elongation growth of Arabidopsis seedlings slows down rapidly, accompanied with the formation of photosynthetic apparatus. BL strongly inhibits stem elongation growth under highfluencerate illumination ( Folta and Spalding, 2001a; Ahmad et al., 2002) This effect is mainly mediated by phot and cry and maintained as long as the BL is present. RL and FrL reduce hypocotyl elongation acting principally through phyB and phyA, respectively. Computer aided image capture and analysis has revealed the precise timing of early elongation events, showing that blue, r ed and far red effects are observed within minutes of illumination ( Parks, Folta, and Spalding, 2001 ) The general rule is that light causes the developing seedling to cease rapid elongation and adopt a strategy of vegetative aerial growth in a sufficient light environment. However, the same imaging equipment captured an unusual trend in response to GL with comparable fluence rates used in safelights. When illuminated the seedling growth rate would not decrease. Instead, seedlings would grow faster than the dark rate, at times approaching 150% of the etiolated pace ( Folta, 2004) The response to GL was observed within minutes of illumination and reversed to the dark rate when the light was toggled off. The response persisted in all photoreceptor mutant backgrounds, suggesting that the response was either a redundant respo nse of several photoreceptor 23

PAGE 24

classes to dim GL or perhaps mediated by a novel receptor. The second explanation appears more attractive, as it was difficult to define how sensitive light sensors could be activated by GL yet drive responses that were oppos ite to normal light activation. The same study also showed that seedlings grown under dim (<4 mol/m2s) red and BL were shorter than those grown under the same conditions with supplemented GL A mechanism for this later phenomenon was shown in greater detail by another study ( Bouly et al., 2007) They reported that the addition of 563 nm GL led to a longer hypocotyl than white or BL basal controls, despite increasing the fluence rate of GL Here, addition of visible light resulted in plant responses consistent with a low light environment. Further examination of this GL counteraction effect in photoreceptor mutants suggested that the BL component was cry dependent, consistent with other studies ( Sellaro et al., 2010) The difference is that the strongest variations were observed under low light conditions, a conclusion not parallel to the results of Sellaro et al. (2010). Vegetative G rowth In the 1960s, Klein and co workers performed a series of studies on the effects of near ultraviolet and GL to plant growth. A common theme that emerged from these studies is that the green wavebands (510585nm) repress the growth of a wide range of or ganisms, including algae, fu ngi higher plants, and even plant cell cultures ( Klein, 1964; Klein, Edsall, and Gentile, 1965) These findings are consistent with Wents result s that show ed tomato seedlings reached higher dry weight under reduced G L conditions compared with white light control s ( Went, 19 57 ; Folta and Maruhnich, 2007) More recent data from Dougher and Bugbee also indicate that yellow light (580600 nm) reduces the dry mass of lettuce ( Dougher and Bugbee, 2001) However, other 24

PAGE 25

reports also provide different views regarding to GL effect on plant growth. NASA scientists conducted a series of experiments on plant growth in order to desig n an appropriate lighting system for space missions One interesting result from these studies was that when keeping the photosynthetic photon flux stable lettuce grown in red, blue, and green LED light condition had a larger leaf area and higher shoot f resh and dry weight than lettuce grown in redblue conditions alone ( Kim et al., 2004a, b ) Their interpretation of this result is that although RL and BL are more effective for photosynthesis in s everal reported crops, GL might penetrate plant leaves more efficiently than RL and BL and therefore may increase carbon fixation deep within the plant tissue ( Sun, Nishio, and Vogelmann, 1998; Nishio, 2000 ; Kim et al., 2004b; Terashima et al., 2009 ) Shade A voidance Phytochromes represent the principal mechanism plants use to adjust growth to a shaded environment. In such an environment, the red to far red ratio significantly drops. The c hange in red to far red ratio is readily detected by phytochromes and plants develop elongated stems and leaf petioles, as well as an increased leaf angle (relative to the horizontal orientation) accordingly. These responses are known collectively as Shade Avoidance Syndrome (SAS) ( Smith and Whitelam, 1997) In addition, plants in a shade environment also experience a reduction of BL intensity, which can also ind uce shadelike responses ( Ballar, Casal, and Kendrick, 1991; Ballar, Scopel, and Snchez, 1991; Pi erik et al., 2004; Keuskamp et al., 2011) Shadelike phenotypes have also been observed under conditions with sufficient BL and a high red/far red light ratio. Under the artificial shade of an elect ronic LED canopy, the relative amounts of blue, red and GL were indivi dually mixed, and induced shade responses that were GL dependent 25

PAGE 26

( Zhang, Maruhnich, and Folta, 2011) Genetic tests show that the GL mediated shade avoidance response persisted in phyA phyB cry1 and cry2 mutant backgrounds. The phot mutants were not tested because phot photoreceptors have a limited absorption in the green portion of the spectrum ( Kennis et al., 2003) and active phot receptors promote leaf expansion in low light environments ( Takemiya et al., 2005) The result observed here was exactly the opposite of phots function. The physiological and genetic evidence suggests that an alternative means of sensing GL may be responsible to this response. Another interesting finding from this report is that the induction of traditionally induced shade avoidance maker genes (such as HAT4 and PIL1 ) are not induced as they are in far red mediated shade avoidance responses in wildtype plants. The physiological response is consistent with far red action, yet the accompanying gene expression differences are not in concordance. Further examination of the shaderelated gene expression was performed in photoreceptor mutants and showed that shadeinduced increases in HAT4 and PIL1 transcripts are n ormal in the cry1 cry2 or cry1cry2 mutant backgrounds ( Zhang, Maruhnich, and Folta, 2011) These results indicate that cry receptors are ac tively repressing the gene expression changes that are associated with shade avoidance, uncoupling the morphological and molecular changes. The results also provide data that suggest cry receptors are actively responding to GL repressing shade responseas sociated gene expression. Flowering The transition from vegetative growth to floral development is greatly affected by light ( Guo et al., 1998; Mouradov, Cremer, and Coupland, 2002) Different wavebands of light exhibit distinct roles in the regulation of floral initiation. RL slows floral induction via the phyB receptor, while BL accelerates the induction mainly through the cry2 26

PAGE 27

receptor ( Guo et al., 1998; Valverde et al., 2004) As mentioned previously, GL can rev erse BL mediated stem growth inhibition by inactivating cry1. If a similar mechanism is at play, the cry2 receptor may also be GL sensitive, allowing it to be inactivated. The report from Banerjee et al. (2007) tested this hypothesis. They found that the t ime needed for BL treated Arabidopsis plants to flower was significantly delayed by addition of GL (56312 nm) under a short day photoperiod. Consistent with this outcome, the cry2 mediated induction of FLOWERING LOCUS T ( FT) transcript levels were also abolished by coirradiation with GL and the green effects were not observed in cry2 mutant background ( Banerjee et al., 2007) These results indicate that flowering is inactivated by alteration of the cry2 signaling state. However, in other plant spec ies, the flowering initiation is affected differently by GL in contrast to the afore mentioned scenario. The heading time of wheat does not seem to be affected by BL (400 500 nm), but plants grown in high fluence rate greenyellow light (500600 nm) requir e fewer days to reach 50% heading ( Kasajima et al., 2007) Analysis of inductive wavebands showed that 540 nm gave the strongest flowering stimulation effect ( Kasajima et al., 2008; Kasajima, Inoue, and Mahmud, 2009) Anthocyanin A ccumulation Anthocy anin biosynthesis is another BLdependent response tied to cry1 ( Ahmad, Lin, and Cashmore, 1995; Lin, Ahmad, and Cashmore, 1996) It is common i n plants and is well described in Arab idopsis lettuce, tomato, and rapeseed ( Ahmad, Lin, and Cashmore, 1995; Giliberto et al., 2005; Chatterjee, Sharma, and Khurana, 2006; Zhang and Folta, 2012 ) However, when GL (582 10 nm) is simultaneously delivered with BL anthocyanin accumulation is lower than with BL treatment alone ( Bouly et al., 27

PAGE 28

2007; Zhang and Folta, 2012) The extent of anthocyanin reduc tion depends on the fluence rate of GL delivered in concert with BL ( Zhang and Folta, 2012) Close examination of this response in Arabidopsis cry1 mutant indicates that it is a cry dependent GL response ( Bouly et al., 2007) This finding also points out the GL paradox as visible light increases with the supplementation of GL, the magnitude of light driven response decreases. Stomatal O pening BL stimulates the opening of stomata through the redundant actions of phot1 and phot2 BL receptors. This response has a typical action spectrum that peaks at 450 nm with two additional shoulders at 420 nm and 470 nm ( Karlsson, 1986 ; Kinoshita et al., 2001) Several reports have indicated that GL can reverse bluelight dependent stomatal opening or reduce stomatal conductance among several plant species, such as Vicia faba Arabidopsis thaliana, Nicotiana tabacum Pisum sativum and Lactuca sativa ( Frechilla et al., 2000; Talbott et al., 2002 ; Kim et al., 2004a) The action spectrum for the GL reversal effect matches well with that of BL activation but with a 90 nm shift towards red ( Frechilla et al., 2000) The extent of this GL reversal effect is dosedependent, with full negation achieved when GL fluence rate is twice that of BL ( Frechilla et al., 2000) Gene E xpression P hotoreceptors initiate many processes that culminate in changes of plant form and/or function, accompanied by a supporting set of gene expression alterations ( Tepperman et al., 2001; F olta et al., 2003b; Tepperman et al., 2004) During the transition from dark growth to light growth, the phyA receptor transduces environmental light information to the downstream genes, of which alm ost half are transcription factors 28

PAGE 29

(Tepperman, 2001; Tepperman, 2004). GL also induces transcriptional profile changes. Microarray analyses based on the early stem kinetics reported in Folta (2004) show that many of the transcripts upregulated by GL are t ypically induced by phytochromes. This observation is not surprising because phyA is extremely sensitive and abundant in the dark grown seedling. The curious finding is that a set of light induced plastid genes, including psaA psbD and rbcL were downreg ulated by a GL pulse relative to dark levels. The GLmediated downregulation of plastid gene transcripts accumulation is obvious within the fluence range of 100 to 104 mol/m2, and occurs within 15 min after the GL pulse. This response is GL specific since it was not observed under red, far red, blue, or red plus BL pulses. The time course and fluence response of this GL mediated plastid response correlated well with the greenlight stimulated hypocotyl response. The down regulation of plastid transcripts is normal in phyA phyB cry1 cry2 phot1, and phot2 mutant backgrounds, indicating that they are controlled by redundant photoreceptors function or possibly a novel receptor. Arabidopsis N atural V ariations in L ight S ignaling T ransduction Due to their se ssile nature, plants must adapt to the local environment once established. Natural genetic variation in Arabidopsis provides researchers with invaluable resources for discovering functional alleles, especially those that underlie adaptive responses. Arabidopsis has a geographically wide distribution. Functions of n early 100 genes have been identified from Arabidopsis and crop plants (rice, maize, etc.) by the use of naturally occurring variants ( AlonsoBlanco et al., 2009) Pioneer ing studies have also discovered al ternative photoreceptor alleles for PHYA ( Maloof et al., 2001) PHYB ( Filiault et al., 2008 ) PHYC ( Balasubramanian et al., 2006) PHYD ( Aukerman et al., 1997 ) and CRY2 ( El Assal et al., 2001) from natural Arabidopsis 29

PAGE 30

accessions. The detailed discussion about light sensing natural variants will be further addressed in the Chapter 4. The hypothesis for using natural variations for the GL study is that GL may confer some adaptive advantages in certain environments, but not in others. It is possible to find candidate Arabidopsis accessions with impaired or altered GL response by monitoring adaptive responses. In addition, the genetic resources for Arabidopsis provide another opportunity to test the relationship to genes identified and the GL response. The increased amount of genomic information released from Arabidopsis 1001 G enomes P roject empowers the capability and efficiency of photoreceptor and photoresponse research. Light responses to the environment are well understood in Arabidopsis and other systems. Although GL responses have been historically documented, little is know n about their precise ef fects or transduction mechanism. The goal of this work is to understand the integration of light signals during plant development and incorporate the roles of the GL portion of the spectrum into existing models. 30

PAGE 31

2CHAPTER 2 INVESTIGATION OF THE INTERACTIONS BETWEEN BLUEGREEN LIGHT AND RL/FrL DURING EARLY PHOTOMORPHOGENESIS Introduction The dark grown seedling undergoes a dramatic developmental shift as it transitions to the light environment. The emerging seedling monitors incident irr adiation for the pro per adjust ment of morphology metabolism and development to best fit the current environment. The relative quanta from various regions of the spectrum inform the seedling of time, place and proximity to neighbors. Ultraviolet, blue, red and far red light ( UV, BL, RL, FrL, respectively) each drive a suite of morphological, physiological, biochemical and molecular changes that prepare the juvenile plant for optimal growth in a given environment ( Chen, Chory, and Fankhauser, 2004; Kami et al., 2010 ) The events of early photomorphogenic development include conspicuous alterations in plant form, particularly a suppr ession of stem growth elongation ( Parks, Folta, and Spalding, 2001; Vandenbussche and Van Der Straeten, 2004) The rate of stem elongation is fast er in darkness, yet is rapidly and robustly suppressed by UV, BL, RL or FrL. Inhibition of hypocotyl growth rate is dependent upon several separate photosensing systems that coordinate downstream events with great precision. The genetic control of light mediated stem elongation has been greatly facilitated by the use of photomorphogenic mutants coupled with specialized computer assisted imaging ( Wang et al., 2009) allowing high resolution analyses of growth kinetics as plants adapt to the light environment. For example, in RL, stem growth inhibition is mediated by phyA for 2 The results in Chapter 2 have been published in Planta. The following is the citation information: "Wang, Yihai, et al. Phototropin 1 and cryptochrome action in response to green light in combination with other wavelengths. Planta 237.1 (2013): 225-2 37." Reprinted with permission from Springer Science and Business Media. 31

PAGE 32

the first 3 h, and then maintained by phyB thereafter ( Parks and Spalding, 1999) BL regulates hypocotyl growth through phot1 for the first 30 min of ir radiation ( Folta and Spalding, 2001a) followed by inhibition dependent on the actions of cry1, cry2 and phyA ( Folta and Spalding, 2001a; Folta and Spalding, 2001b) This second phase is antagonized by phyB. It is logical that the wavebands that best affect photosynthetic rate would be e ffective in promoting photomorphogenic development. The effects of GL on stem growth control have also been examined. In endpoint analyses, GL has been shown to negate BL effects on hypocotyl elongation through cry1 by reducing the redox state of crys fl avin chromophore ( Bouly et al., 2007) Examination of seedling growth during the first minutes and hours of photomorphogenic growth shows that GL induces a transient increase in stem growth rate. Illumination with constant GL in conjunction with RL and BL leads to a longer hypocotyl than that produced by RL or BL alone ( Folta, 2004) yet it has not d emonstrated if this effect was cry or phy dependent. The relationship between BL and GL was tested in Arabidopsis seedlings, and indicated that the BL/GL ratio controls stem growth via cryptochrome receptors in light conditions that mimic natural conditio ns ( Sellaro et al., 2010) While low GL illumination leads to an increase in stem growth rate during the initial stages of deetiolation, after several days the stem of a greenlight grown seedling is shorter than a comparable dark grown seedling ( Young, Liscum, and Hangarter, 1992 ; Goto, Yamamoto, and Watanabe, 1993) This discrepancy can almost certainly be attributed to greenlight activation of cry and phy during prolonged irradiation periods. However, the detailed information about how GL interacts with cryptochromes and phytochromes in the early transition from a dark grown to light grown environment has not been thoroughly 32

PAGE 33

described. Although it has been shown that GL can negate BLinduced stem growth inhibition in the endpoint assay, in the initial stages (minutes to hours), supplementation of GL to BL does not attenuate BLinduced stem inhibition, but instead enhances BL effects ( Wang et al., 2013 ) The interactions of GL and phytochrome during the initial stages of photomorphogenesis are even less understood Although in the dim RL b ackground, the stimulation effect of GL to hypocotyl elongation is enhanced, the development of GL response is independent of RL ( Folta, 2004) The purpose of this study is to examine how GL might interact with RL/FrL photosen sing system s throughout various time courses by monitoring the sensitive responses of the elongating hypocotyl in wildtype and mutant seedlings. Such study might help elucidate how GL modulates phy mediated responses under shaded environment. Results GL A ttenuates RL M ediated S tem G rowth I nhibition To test the interactions between GL and RL photosensing system s on early hypocotyl elongation, RL and GL coirradiation experiments were performed. As shown in Fig. 2 1 A the hypocotyl elongation rate in RL start ed to rapidly decrease after 45 min, reaching a constant reduced growth rate after 120 min (approximately 50% of dark growth rate). The addition of dim GL significantly attenuated RL induced stem growth inhibition. The maximum opposition of RL response by GL co irradiation during the threehour time course of the experiment was approximately 75% of the dark growth rate. The extent of the antagonizing effect by GL depended on the fluence rate of RL, but not GL itself under the fluence rates tested (Fig. 21 B C ). The increase in stem growth rate was reflected in longer hypocotyls aft er extended treatment periods. From 33

PAGE 34

4896 h significant differences in hypocotyl length were observed between RLtreated seedlings and those co illuminated with GL (Fig. 2 1 D ). Genetic A nalysis of the GL O pposition of RL R esp onse GL caused an increase in initial stem el ongation that mirrored the timeco urse of RL induced inhibition. The hypothesis was that the two actions were mediated by separate signaling systems, and not dir ectly through GL inactivation of the phy receptor. The GL negation of RL response could also be acting act through the cry receptor in a manner that is different from its activation by BL, or BL and GL in combinat ion, as in Zhang et al. (2011). Analysis of photosensory mutants allowed further exploration into this process. The GL opposition of RL induced inhibition was tested in phyA and phyB single mutant backgrounds. Under monochromic RL conditions the degree of stem growth rate inhibition in the steady inhibition stage of the phyA mutant was moderately reduced compared to wildtype, consistent with earlier reports ( Parks and Spalding, 1999) Initial, rapid inhibition (45min~120min) was impaired in the phyA mutant, yet long term inhibition (> 2h) was sustai ned through the action of phyB. In contrast to the phyA mutant, phyB mutants exhibited normal initialrapid inhibition (45min~120min), but showed less inhibition upon prolonged illumination. Although the RLinduced stem inhibition was partial ly impaired in the phyA or phyB mutants, the GL mediated attenuation effect persisted in both mutant backgrounds (Fig. 22 A B ). These data are consistent with other reports that early GL responses are not phytochrome driven ( Folta, 2004; Dhingra et al., 2006) GL can act directly on cryptochromes to affect plant responses ( Bouly et al., 2007; Sellaro et al., 2010; Zhang, Maruhnich, and Folta, 2011) C ryptochromes have also been shown to influence mRNA and protein accumulation even in response to RL 34

PAGE 35

but t he cry driven hypocotyl growth responses have not been observed to be redsensitive ( Ahmad et al., 2002; Yang et al., 2008) Therefore, the GL opposition of RLinduced growth inhibition was tested in cry mutant backgrounds The results are presented in Fig. 22 C and indicate that GL reversal of RL response persists in cry1cry2 mutant background. Similarly, no role for phototropin (phot) receptors has been demonstrated in a RL response. For completeness, the GL opposition to RL was tested in phot mutants. While RL responses were normal in phot mutants, the GL reversal of RL response was not observed in the phot13 mutant background (Fig. 22 E ). This result was confirmed using the phot15 allele (data not shown) as well as the phot1phot2 double mutant (Fig. 22 F ). The GL effect was absent in all three mutant backgrounds. However, the GL opposition of the RL response was normal in phot21 mutant seedlings (Fig. 22 D ). Interestingly, RL mediated stem growth inhibition was also slightly impaired in the phot1phot2 doublemutant background. NPH3 is a key component mediating a subset of phot driven responses. Thus the GL opposition effect on RL was further tested in the nph36 mutant background. Consistent with the phot1 result, nph36 mutant seedlings failed to reverse the RL stem response under coirradiation conditions (Fig. 2 2 G ). Together, the data demonstrate that phot1, but not any other photoreceptors tested, is required for GL opposition to the RL response, and NPH3 is also required for this interaction. The GL O pposition to RL S tem R esponse d oes not A ffect other phy R esponses Phy mediated changes in gene expression during deetiolation have been well described ( Tepperman et al., 2001 ; Tepperman et al., 2004) It is therefore possible to test if the reversing effect of GL is restricted to growth responses in the hypocotyl, or perhaps affects a wider suite of phy mediated processes. The transcript levels of phy 35

PAGE 36

induced genes were monitored in response to RL and a combination of RL and GL. Transcript levels were assessed 140 min after the onset of illumination, the time point corresponding to the most pr onounced level of GL response. The results are presented in Fig. 2 3 A HY5 SPA1 PKS1 and LHY transcript levels were highly induced after 140 min of RL treatment. Comparable transcript accumulation levels were observed with GL co irradiation. No effect was observed even after increasing GL fluence rate. Two addit ional time points were tested to exclude the possibility that the GL effect on gene expression may not coincide directly with the timing of the stem growth response, yet no effect was observed (Fig. 23 B ). GL also R everses E arly FrL I nduced S tem G rowth I n hibition Unlike RL, the FrL induced stem growth inhibition during initial photomorphogenesis is solely mediated by the phyA receptor ( Parks and Spalding, 1999) To investigate the interactions between GL and FrL in the regulation of initial st em elongation, the stem growth kinetics of 2 d old etiolated seedlings were monitored. FrL caused rapid, stem growth rate inhibition after 45 min of irradiation, in agreement with the time point of RLinduced inhibition. However, the time course of maximum inhibition for FrL was found to be shortened and exhibited a greater amplitude, even at a relatively lower fluence rate (2.5 mol/m2s). GL (0.5 mol/m2s) co irradiation with FrL reversed the FrL effect (Fig. 24 A ). A higher (50 mol/m2s) FrL fluence rate could only be slightly reversed by GL (Fig. 24 B ). Examination of seedlings in long term endpoint experiments showed that the relative stem length in FrL (2.5 mol/m2s) was not affected by addition of GL (0.5 mol/m2s) (Fig. 2 4 C ). 36

PAGE 37

GL N egation of FrL S tem R esponse also R equires phot1 and NPH3 The photoreceptor mutants were tested for the GL reversal of the FrL response. As shown in Fig. 25 A FrL induced stem growth inhibition was absent in the phyA mutant background, consistent with reports that phyA medi ates the FrL stem response ( Parks and Spalding, 1999) Addition of GL to FrL did not significantly affect the growth kinetics in the phyA mutant. In the phyB mutant, the FrL induced stem inhibition was enhanced. GL partially reversed the FrL s tem response in phyB mutant seedlings (Fig. 2 5 B ). The cry1cry2 double mutant seedlings showed a normal FrL stem inhibition response, as well as the GL reversal effect (Fig. 25 C ). The phot2 mutant seedlings exhibited a slightly reduced FrL stem response and normal GL reversal effect (Fig. 25 D ). When tested in phot1, phot1phot2, and nph36 mutant seedlings, the FrL response was normal, but the GL effect was completely absent (Fig. 25 E F G ). GL N egation of RL S tem R esponse can be P henocopied by S uppleme ntation of D im BL The observation that GL acts through phot1 and its signaling component NPH3 to negate RL/FrL stem response was at first difficult to reconcile. Early GL stem growth promotion responses (those occurring within 1h) have been shown to be p hot1 independent ( Folta, 2004) Also, the chromophore bound LOV domain has been shown to have virtually no absorption above 500 nm ( Kennis et al., 2003) However it is important to test the formal hypothesis that the GL response shown here may be a r esponse to the slight amount of BL emitted by the green LED (peak 530 nm). To test this hypothesis seedling growth rate kinetics were monitored when coirradiated with dim BL (0.1 mol/m2s) and RL. The dim BL negated the RLinduced stem inhibition in thes e trials, and the response was more effective in reversing RL response than GL 37

PAGE 38

(Fig. 2 6 A ). Because the RL induced stem inhibition started as early as 45 min after light onset, it was of interest to test reciprocity, that is, if inhibition could be reversed by a brief BL pulse delivered at this time point with the same fluence as the longer, dim treatment. Seedlings were then grown under RL conditions as above, and then were treated with a 3 mol/m2s BL pulse for 6 min at 45 min time point. This brief pulse was sufficient to activate phototropins, but not cry mediated BL stem inhibition. The results in Fig. 26 B indicate that the BL pulse only caused a slight negation of RL stem response. This BL light response was tested in phot1 and nph3 mutant seedlings t o verify that it was a phot response. Again, phot1 and nph3 mutant seedlings failed to negate RL stem response under coirradiation conditions (Fig. 26 C D ). Parallel responses were observed in response to FrL (Fig. 2 7). D iscussion GL and P hytochrome in the R egulation of P hotomorphogenic R esponses GL responses in seedlings have been shown to oppose activities of other wavebands. Such GL responses have been hypothesized to be the basis of adaptive behaviors in developing seedlings that aid in acclimation to a specific light environment. Although much is known for blue, red, and far RL (BL, RL, and FrL) in the control of hypocotyl elongation during photomorphogenic development, the interactions between GL and the aforementioned photosensory systems are less well understood. Using high resolution imaging, photomorphogenic mutants, and narrow bandwidth illumination, such interactions may be understood in great er detail T he stem growth inhibition induced by RL or FrL was at least partially reversed by simulta neous illumination with low fluence rate GL (Figs. 2 1, 2 4). The GL effect was 38

PAGE 39

obvious after 120 min and produced enough reversal of RL induced inhibition to change end point stem lengths (Fig. 2 1 D ). Analysis of phy mediated gene expression shows that wh ile stem growth is reversible, RLdriven gene expression is not, suggesting that the GL effect is happening early in signaling and at the cellular level, and is not causing a direct reversal of phy or phy signaling (Fig. 23). Genetic analyses indicated t hat the early reversal persisted in cry and phy mutants, but did not persist in two alleles of phot1 mutants or the phot1phot2 double mutant (Figs. 22, 2 5). The phot2 mutant exhibited a wildtype response. The response was impaired in the nph3 mutant, a functional interacting partner of phot1 required for some aspects of phot1 signaling. The interactions between phot1 and phy systems have been described by several reports. For example, the amplitude of the phototropic response can be enhanced by pretreatm ent or coirradiation of RL ( Janoudi and Poff, 1992; Parks, Quail, and Hangarter, 1996; Janoudi et al., 1997) A brief RL pulse 2 h prior to BL illumination inhibited the translocation of plasmamembrane localized PHOT1 GFP to the cytosolic compartments ( Han et al., 2008) At first there were several interpretations for a phot mediated GL reversal of RL induced inhibition through a novel sensor but they involved com plicated models and assumptions to reconcile the unexpected result. However, one hypothesis remained to be testedthe reversal of RLmediated inhibition might be due to phot activation from a small amount of BL produced by the GLemitting diode. The possibility seemed unlikely because BL and phototropins inhibit stem elongation ( Folta and Spalding, 2001a) However, it was important to formally test the hypothesis. In a subsequent series of experiments low fluence rate BL was substituted for GL, and was shown to reverse the 39

PAGE 40

RL response, perfectly phenocopying the GL response (Fig. 26). These findings show that the GL reversal of the RL response was actually a low fluence rate BL r esponse revealed by a GL treatment A simplified model describing the interactions of different photosensory systems together with its mediating photoreceptors is proposed ( Fig. 2 8 ) Phototropin 1 and its N egation E ffect on RL/FrL The findings that phot1 actively responds to low fluence rates of BL t o negate the RL/FrL stem response were unexpected and add seedling growth promotion to the expanding list of roles for phototropin in plant tropic responses ( Christie, 2007) BL and phototropin stem growth responses have always been described as inhibitory, yet the data in this report show that under specific RL or FrL conditions the phototropins can promote elongation. Phototropins have been shown to drive expansion growth of leaves and increases in fresh weight in low light environments ( Takemiya et al., 2005) The effects observed in the current study may be related to phot activity after the developing seedling has committed to growth in a light environment and switched to optimization of organ expansion and position. This interpretation is consistent with the overarching roles for phototropins, as they tend to adjust para meters of plant form and content to optimize position of specific organs or organelles ( Spalding and Folta, 2005) It also is worth noting that the phot2 mutants respond normally, and nph3 mutants fail to respond, showing that the phot1driven stem promotion is phot2 independent and NPH3 dependent. The significance of these findings lies in adding another layer of understanding to photosensor interplay in low light environm ents. Coaction between GL and phy, cry and phot has revealed unexpected mechanisms of action that are separate from the proposed green sensor. This contrasts against unexplained GL actions in etiolated 40

PAGE 41

seedlings as well as in shadeavoidance responses ( Folta, 2004; Dhingra et al., 2006; Zhang, Maruhnich, and Folta, 2011) Coactivation of multiple sensory systems in developing seedlings shows that GL reverses cry mediated responses over the first several days and augments cry responses within minutes of illumination. Here we show that the response to GL is really j ust a response to BL, yet low fluence rates of BL that impart an uncharacteristic effect. M inor amounts of BL insufficient to activate cry activate phot1 and increase seedling growth in the presence of RL, consistent with what occurs in mature plants ( Takemiya et al., 2005) Here narrow bandwidth illumination, monitoring stem growth kinetics and p hotomorphogenic mutants provide additional resolution into light coaction during early photomorphogenic development. Materials and Methods Plant Materials The genotypes tested are identical to those previously assessed for responses to blue ( Folta and Spalding, 2001a; Folta and Spalding, 2001b) and green ( Folta, 2004) light: cry1 304, cry2 1 phot13 (nph13) phot1 5 (nph15) phot21 phyB 5, and nph36 Arabidopsis accession Columbia (Col 0) was used as the wildtype. Light Sources and T reatments Light treatments were generated using narrow bandwidth LED light supplied either by array s of 3 W LEDs (American Bright LED, Chino, CA USA) or Floralamp LED arrays (Light Emitting Computers, Victoria, BC Canada). The emission spectrum of all light sources is viewable online at ww w. Arabidopsis thaliana.com/lightsources Light composition was assessed using an Apogee spectroradiometer (Apogee Instruments, Inc., Logan, UT) and Spectra Whiz software ( StellarNet, Inc., Tampa, FL) 41

PAGE 42

Hypocotyl E longation A ssays For endpoint assays (249 6 h in light), Arabidopsis seeds were surfacesterilized briefly by immersion in 95% ethanol on blotting paper in a laminar flow hood. Upon drying, the seeds were distributed in Petri dishes on minimal media (1mM KCl and 1mM CaCl2) solidified with 1% Difco agar (Beckton, Dickinson and Co, Sparks, MD). The plates were covered in foil and then stratified for 4872 h at 4C. The seeds were then treated with 68 h of fluorescent white light (16 mol/m2s) at 23C to synchronize germination. Seedlings were grown in absolute darkness at 23C for 4048 h. Germinating seedlings were then moved under experimental light conditions without a photoperiod. At least 30 seedlings were measured per treatment in two to three independent experiments. Analysis of stem growth ki netics was performed by scanning p etri dishes of seedlings on a flatbed scanner, and then measuring seedlings at high magnification using ImageJ 1.44 ( http://imagej.nih.gov/ij/index.html ). The mean of 30 42 seedlings is reported for each light condition. For short term kinetic assays, Arabidopsis seeds were surfacesterilized and synchronized for germination as described above. Then, different experimental light treatments were applied to 23 d old etiola ted seedlings and images were acquired in a 5 min interval and analyzed according to the method described ( Wang et al., 2009) Quantitative RT PCR Analysis The 3 d old dark grown seedlings were treated with red or red plus GL at specified time points and harvested into liquid nitrogen. Total RNA was extracted by usi ng the Qiagen RNeasy Mini kit ( Qiagen Cat # 74904) according to the manufacturers protocol. 1 g RNA was reverse transcribed using the Improm II Reverse Transcriptase (Promega Inc., Madison, WI). Quantitative RT PCR was performed using the StepOne 42

PAGE 43

Plus s ystem (Applied Biosystems, USA) based on SYBR Green chemistry. All primers were designed by the Primer Express 2.0 software (Applied Biosystems, USA). UBC21 (AT5G25760) was used as the reference gene ( Czechowski et al., 2005) All primer sequences are listed in Table 2 1. The relative mRNA levels were calculated using the 2method ( Livak and Schmittgen, 2001) Accession Numbers Sequence data from this article can be found in the Arabidopsis Genome Initiative or GenBank/EMBL databases under the following acces sion numbers: UBC21 (AT5G25760), HY5 (AT5G11260), PKS1 (AT2G02950), SPA1 (AT2G46340), and LHY (AT1G01060). 43

PAGE 44

Table 2 1. Primers used in qRT PCR assay in Chapter 2 Primers Sequences (5' 3') qUBC21 5' TTAGAGATGCAGGCATCAAGAG qUBC21 3' AGGTTGCAAAGGATAAGGTTC A HY5 QF AGAGTTTCAGCTCAGCAAGCAA HY5 QR TCTGTTTTCCAACTCGCTCAAG PKS1 QF AGAAGCAGCATGAACAAGACACA PKS1 QR TGATCCTTCTTCGTGTTTCGAA SPA1 QF TGACTTTGAAGCAAACGTTTTTG SPA1 QR CGAACTTTTTTTCTCTTCTGGTCAT LHY QF AGCCAAGTTGGGAACATAAACAA LHY QR TTCCAATCGAAGCCTTTTG C 44

PAGE 45

Figure 2 1. GL attenuates RL induced stem inhibition 2 day old or 1day old etiolated Arabidopsis Col0 seedlings were tested for short term or long term stem growth kinetics, respectively. (A) The shor t term stem growth rate kinetics of seedlings in red (solid triangles) or red plus GL (open triangles) condition. R11.6= red, 11.6 mol/m2s, g0.5=green, 0.5 mol/m2s. Error bars represent S.E.M. (B) Increasing RL fluence rate to 50 mol/m2s (R50) reduced the GL opposition effect. Error b ars represent S.E.M. (C) The extent of the opposition effect on RL does not depend on GL fluence rates tested. Three time points (130 min, 140 min, and 150 min) were selected for the comparison. Error bars represent S.E.M. (D) The long term stem growth kinet ics of seedlings in red or red plus green conditions. Error bars represent S.E.M. Each experiment was performed at least twice with similar result s. (*, p <0.05) 45

PAGE 46

Figure 2 2 GL opposition effect on R L requires phot1 and NPH3. The GL negation effect on RL was further tested in (A)(G) phyA phyB cry1cry2 phot2 phot1, phot1phot2 and nph3 m utant backgrounds. In all panel the line with so lid triangles represents the growthrate kinetics of mutant seedlings in RL and the line with o pen triangles represents the growthrate kinetics of mutant seedlings in red plus GL Growth rate kinetics of wild type Col 0 seedlings in RL was included for comparison (dashed line). Error bars represent S.E.M. 46

PAGE 47

Figure 2 3 The GL opposition to RL stem responses does not affect the expression of RL early induced marker genes. (A) The expression of RL early induced marker genes were not affected by addition of three different fluence rates (0.5, 5, and 20 mol/m2s) of GL Time point 140min was chosen for this comparison. Transcript levels were normalized to dark (D) control seedlings (B) Time course comparison (30min, 1 hour, and 3hour) for the expression of marker genes in red (11.6 mol/m2s) a nd red plus green (0.5 mol/m2s) conditions. Error bars represent S E .M. of three technical replicates S ame experiment was performed twice with similar result. 47

PAGE 48

Figure 2 4 GL negates FrL induced stem inhibition in short term analys es (A) The short term, stem growth rate kinetics of seedlings in far red (solid triangles) or far red plus GL (open triangles) condition. Fr2.5=far red, 2.5 mol/m2s; g0.5=green, 0.5 mol/m2s. Error bars represent S.E.M. (B) Increasing FrL fluence rate to 50 mol/m2s (Fr50) largely reduced GL opposition effect s. Error bars represent S.E.M. (C) The longterm stem growth kinetics of seedlings in far red or far red plus GL condition. Hypocotyl length is displayed as percentage of that observed for the dar k grown seedlings. Error bars represent S.E.M. S ame experiment was performed at least twice with similar result. 48

PAGE 49

Figure 2 5 GL opposition to FrL stem response also requires phot1. The GL opposition to FrL was examined in (A)(G) phyA phyB cry1cry2 phot2 phot1 phot1phot2 and nph3 mutant backgrounds. In all panels, lines with solid triangles represent growth rate kinetics of mutant seedlings in FrL and lines with open triangles represent growthrate kinetics of mutant seedlings in far red plus GL Growth rate kinetics of wild type Col 0 seedlings in FrL was included for comparison (dashed line). Error bars represent S.E.M. (1 49

PAGE 50

Figure 2 6 BL negates RL stem inhibition through phot1. The BL negation effect on RL was examined in (A) continuous dim BL (0.1 mol/m2s) and (B) brief blue pulse (3 mol/m2s, 6 min) conditions. Genetic tests were performed in (C) phot1 and (D) nph3 mutant seedlings under coirradiation conditions. In all panels, line with solid triangles represents growth rate kinetics of seedlings in RL and lines with open circles represent growth rate kinetics of seedlings in red plus dim BL conditions. Lines with solid circles in (B) represent the growth rate kinetics in red plus blue pulse conditions. Growth rate kinetics of wildtype Col 0 seedlings in RL was included for comparison (dashed line) in (C) & (D). Error bars represent S.E.M. 50

PAGE 51

Figure 2 7 BL attenuates FrL induced stem inhibition through phot1. (A) The BL negation effect on responses to FrL w ere examined in continuous dim BL (0.1 mol/m2s) condition. (B) Genetic tests were performed in phot1 mutant seedlings un der coirradiation conditions. In all panels, lines with solid triangles represent growth rate kinetics of seedlings in FrL and lines with open circles represent growth rate kinetics of seedlings in far red plus dim BL conditions. Growth rate kinetics of wild type Col 0 seedlings in FrL were included for comparison (dashed line) in (B). Error bars represent S.E.M. 51

PAGE 52

Figure 2 8 Simplified diagram of light regulated hypocotyl growth during ear ly photomorphogenesis. The bluelight mediated stem growth inhibition requires the participation of multiple photoreceptor family members. The phyA, phot1, cry1, and cry2 are responsible for the early (minutes to hours) stem inhibition. However, in the long term (days), the phyA, phyB, cry1, and cry2 are the major receptors that mediate inhibition growth. The RL induced hypocotyl (stem) growth inhibition mainly act s through the phyA and phyB receptors. However, the phyA receptor is the major contributor mediating the far red induced stem growth inhibition. The GL alone promotes hypocotyl growth through an unknown receptor (s) during early stem growth. The GL a ntagonizes the bluelight induced stem growth inhibition by inactivating cry1 and cry2 receptors in the long term (96 h) but enhances inhibition in the short term (minutes to hours). Dim BL (0.1 mol/m2s) attenuates RL mediated stem inhibition in both early and long term stem growth through the phot1 receptor, but only negates FrL induced stem inhibition in early stem growth. Dashed lines with stop end represent the interactions between different monochromatic light. Horizontal dashed line crossed with the Time line separates early and long term stem growth as well as the receptors involved in each light condition. 52

PAGE 53

CHAPTER 3 MECHANISMS OF PHOT1 MEDIATED BL ATTENUATION OF RL EFFECT S Introduction When a seedling reaches light environment, the apical hook opens the cotyledon unfolds and the hypocotyl elongation slows down. Th e se developmental changes are characteristics of photomorphogenesis. Frequently the light environment is not optimal, such as under the shade of leaves or cover age by plant debris or other objects Developmental programs are adjusted when a plant moves from an optimal to suboptimal light environment The previous chapter described how GL could modulate RL/FrL responses under unfavorable light conditions during seedling establishment T he resul t s from that study uncovered a role for phot1 in attenuating phy mediated responses through dim BL components of green LED light. The mechanism of phot1reversal of RL/FrL stem responses under such conditions remains unclear. I nteractions between photorec eptors have been described extensively ( Ahmad and Cashmore, 1997; Casal and Mazzella, 1998; Parks, Cho, and Spalding, 1998; Mas et al., 2000; Folta and Spalding, 2001b; Folta and Spalding, 2001a; Folta et al., 2003a) For ex ample, the BLinduced hypocotyl growth inhibition consists of two stages: 1) the fast inhibition stage occurs within the first 30 min of BL onset and is mediated by phot1, and 2) the prolonged inhibition stage occurs next and is mediated by cry ( Parks, Cho, and Spalding, 1998; Folta and Spalding, 2001a; Folta et al., 2003a) However, phy receptors also play an important role in the cry mediated stem inhibition induced by BL, since cry function de pends o n phy ( Ahmad and Cashmore, 1997; Casal and Mazzella, 1998; Mas e t al., 2000 ; Folta and Spalding, 2001b) Similarly, the BL induced phototropic response probably involves the actions of at least six photoreceptors ( Casal, 53

PAGE 54

2000; Whippo and Hangarter, 2003) The degree of phot mediated phototropic bendi ng partially depends on the phy antagonizing effect on hypocotyl agravitropism ( Lariguet and Fankhauser, 2004 ; Rsler, Klein, and Zeidler, 2007; Kami et al., 2012 ) Additionally, cry receptors also w ork together with phot to modulate phototropism according to the fluencerate of BL ( Whippo and Hangarter, 2003) The fact that both phot1 and NPH3 are defective in the B L negation of phy mediated stem response but ar e normal in RL/FrL induced stem inhibition indicates the phototropism response is probably operating independently and overrides the phy response at the cellular level. If this is the case, the phot1negation of the phy respons e would be affected by factors that are important for phototropism. Auxin and its transport play an important role in hypocotyl elongation and plant tropic responses ( Lehman, Black, and Ecker, 1996; Jensen, Hangarter, and Estelle, 1998; Raz and Ecker, 1999; Co llett, Harberd, and Leyser, 2000 ; Vandenbussche et al., 2010; dnkov et al., 2010) The transport of auxin is mediated by influx and efflux transporter family proteins, such as the PIN FORMED ( PIN) family, the ATP binding cassette ( ABC ) family, and the AUXIN PERMEASE/LIKE AUX ( AUX1/LAX) family ( Kerr and Bennett, 2007 246 ; Zamalov et al., 2010) Several members of the aforementioned transporter families have been suggested to mediate phototropi c response or interact with its signaling components ( Christie et al., 2011; Ding et al., 2011; Haga and Sakai, 2012; Wan et al., 2012 ) I t is possible that some of these auxin transporters m ay me diate the phot1negation of phy responses. There is another formal alternative explanation for the phot1negation of phy stem response. A common genetic component connecti ng phot and phy signaling 54

PAGE 55

pathways might mediate this response, such as the proteins in the PHYTOCHROME KINASE SUBSTRATE ( PKS) family. This protein family has been shown to participate in the phy signaling pathway, as well as in regulating plant tropic re sponses in various tissues and developmental stages. Those proteins (PKS1, PKS2, PKS4) are plasma membrane associated and they physically interact with phy, phot, and NPH3 ( Fankhauser et al., 1999; Lariguet et al., 2003; Lariguet et al., 2006; Boccalandro et al., 2008; Schepens et al., 2008; de Carbonnel et al., 2010 ; Demarsy et al., 2012) It has been speculated that PKS proteins might serve as the molecular link between phy and phot mediated responses ( Lariguet et al., 2006; Demarsy et al., 2012) In addition, since the phot1attenuation of the phy mediated stem response described in Chapter 2 was only examined under very low BL (0.1 mol/m2s) conditions, it is not known how it may be affected at higher fluencerates where phot1 has been shown to mediate stem growth inhibitory responses ( Folta and Spalding, 2001a) Meanwhile, higher BL fluencerates also a ctivate cry receptors How cry may affect phot1mediated negationresponse to phy under low and highBL conditions will be tested Results The R ole s of cry in phot1 M ediated BL A ttenuation of RLI nduced S tem I nhibition Previous data show that dim BL atten uated RL/FrL induced hypocotyl growth inhibition through phot1 and its interacting component NPH3 (Chapter 2) In the current study, the effect of different BL fluence rates in the negation of the RL stem growth response was further examined. A fluence ra te of 1.5 mol/m2s w as still able to negate RL stem growth inhibition, but the amplitude of this attenuation was significantly reduced compared to that at 0.1 mol/m2s (Fig. 3 1 A ). Increasing the BL fluence rate to 55

PAGE 56

10 mol/m2s enhanced the RLinduced stem inhibition. Meanwhile, the phot1mediated fast (within 30 min of BL onset) stem growth inhibition was greater in amplitude with the increase of BL fluence rate ( Folta and Spalding 2001a) In the long term endpoint assay, the seedlings grown in monochromic RL conditions showed less stem inhibition than those grown in RL with addition of different fluence rates of BL (Fig. 31 B ), indicati ng that the BLnegation of RL induced stem inhibition only exists for several hours. However, cry receptors are also active under BL. To define the roles of cry in the BL negation of the RL stem response, same short and long term stem growth responses were tested in cry1 cry2 and cry1cry2 mutant backgrounds. In the short term assay, both cry1 and cry2 mutant seedlings exhibited a higher hypocotyl growth rate than wildtype seedlings under RL plus high BL (10 mol/m2s) conditions. The cry1cry2 mutant seedlings even showed a higher growth rate under RL plus high BL conditions than wildtype seedlings grown in RL (Fig. 31 C ). In the endpoint assay, cry1 mutant seedlings showed less hypocotyl growth inhibition than wildtype seedlings under RL plus high BL conditions. The cry1 seedlings showed incre ased inhibition when BL was added to RL (Fig. 3 1 D ). On the contrary, cry2 seedlings showed the same levels of inhibition as wildtype seedlings under RL plus high BL conditions T he increased inhibition induced by supplementing dim BL to RL was absent in cry2 seedlings (Fig. 31 D ). BL A djusts phy I nduced H ook O pening P rocess RL not only inhibits hypocotyl elongation growth, it also stimulates apical hook opening and chlorophyll biosynthesis. To test whether BL can affect other RLinduced early photomorphogenic responses, the apical hook opening kinetics and chlorophyll content were ex amined under RL and RL plus dim BL conditions. Interestingly, addition 56

PAGE 57

of dim BL to the background of RL delays the hook opening process. Seedlings treated with RL for 180 mi n have an average hook angle of 67.6 (9.5) degrees. However, when dim BL (0.1 mol/m2s) was co irradiated with RL, the hook angle was only 28.1 (6.3) degrees (Fig. 32 A ). Eventually, the apical hook was fully opened with no visible differences in both ex perimental light conditions after 24 h irradiation ( data not shown). Similarly, the FrL induced hook opening was also delayed by supplementation of dim BL in the short term but not long term experiments (Fig. 32 B ). Increasing BL fluence rate to 1.5 mol/m2s did not significantly change the effect on hook opening. However, 2s) did accelerate the RL induced apical hook opening (Fig. 32 C ), which is consistent with the report that both wavebands are inductive for the apical hook opening during the deetiolation process ( Liscum and Hangarter, 1993b) On the other hand, the chlorophyll accumulation kinetics were also measured and compared between the RL and RL plus dim BL treated se edlings, with no significant differences observed (Fig. 32 D ). The R oles of cry and phot1 in the BLM ediated A dju stment of H ook O pening R esponse The phot1 receptor and BL have been shown to n egat e RL/FrL induced hypocotyl inhibition ( Wang et al., 2013) I t is of interest to test whether this delayed hook o pening response is also phot1 mediated. Fig. 3 3 A and B showed that no significant differences in the hook opening kinetics were observed between RL/FrL and RL/FrL plus dim BL treated phot1 mutant seedlings The nph3 mutant seedlings were also subjected to this test, but it was difficult to obtain a robust RLinduced hook opening response for this mutant ( Fig. 3 3 C ) In addition, the enhanced RLinduced hook 57

PAGE 58

2s) was largely impaired in cry1 and cry1cry2 mutant seedlings (Fig. 3 3 D ). The phot1 A djustment of RL I nduced S tem I nhibition and H ook O pening R equires N ormal A uxin T ransport The role of auxin in the regulation of cell differentiation, cell elongation, and maintenance of the apical hook structure has been well documented ( Lehman, Black, and Ecker, 1996; Jensen, Hangarter, and Estelle, 1998; Raz and Ecker, 1999; Collett, Harberd, and Leyser, 2000; Vandenbussche et al., 2010; dnkov et al., 2010) The evidence that BL under very low fluencerate conditions can att enuate or delay RLinduced stem growth inhibition and apical hook opening lead to the speculation that auxin might serve as the mediator of this response. To test this possibility a synthetic aux in transport inhibitor, 1 N Naphthylphthalamic acid ( NPA ), was supplemented in to the minimal media and the response was measured. The basic experiment was a doseresponse test under identical light treatments. The results showed that at an NPA concentration of 0.5 M the absolute hypocotyl growth rate kinetics were similar between t reated and untreatedseedlings under RL. However, the BLantagoni sm effect on RL was largely impaired (Fig. 34 A ). When the NPA concentration was increased to 1 M, this BLnegationeffect on RL was fully eliminated al though the RLinduced hypocotyl grow th inhibition was slightly enhanced (Fig. 34 B ). In terms of hook opening kinetics, NPA delay ed the response to RL at two different concentrations (1 and 5 M) in our short term assays (Fig. 3 4 C D ). N evertheless, the delayed apical hook opening by dim BL to RL was completely abolished at the NPA concentration of 5 M. 58

PAGE 59

Genetic T ests of A uxin T ransporter M utants for BL A ttenuation of RL R esponse The directional flow of auxin from cell to cell is partly mediated by auxin transporters. These transporters fac ilitate transport of auxin molecules into (influx carriers) and out of (efflux carriers) a cell in response to external signals (like light) or internal signals (such as other phytohormones) Some of these transporters, such as PINs, ABC transporters, and AUX/LAX transporters have been implicated in tropism responses ( Friml et al., 2002; Stone et al., 2008; Christie et al., 2011; Ding et al., 2011 ; Rakusov et al., 2011; Haga and Sakai, 2012) To test the hypothesis that one or several of these transporters are involved in the BLnegation of the RL response, several PIN transporter mutants ( pin1, pin3 pin4 and pin7), one ABC transporter mutant ( abcb19/pgp 19 ), and one auxin influx transporter mutant ( aux1 ) were examined for the BL negation of the RL hypocotyl response based on their hook/hypocotyl expression patterns ( Stone et al., 2008; Wu et al., 2010 ; dnkov et al., 2010) T ransporter mutants tested maintained a normal or near normal ability to counteract RL inhibition with BL Specifically, pin1, pin3 and pin7 mutant seedlings responded to RL or RL plus dim BL like wild type seedlings (Fig. 35 A B D ). The pin4 mutant seedlings showed a slight reduction in the amplitude of the BL n egation of RLinduced hypocotyl inhibition (Fig. 3 5 C ). The abcb19 mutant seedlings were tested at a higher RL fluence rate (50 mol/m2s) in order to obtain a robust RLstem inhibition. Similarly, the degr ee of BL attenuation of RL stem response in abcb19 was not significantly different from wild type seedlings (Fig. 35 E ). Interestingly the aux1 mutant seedlings treated with BL and RL also showed a n partly impaired BL negationeffect on RL, with a hypocotyl growth rate kinetics overlapped with that of RL treated wildtype seedl ings (Fig. 3 5 F ), 59

PAGE 60

al though the RLinduced hypocotyl inhibition was also slightly enhanced in this background The phot1 A ttenuationR esponse to RL F unctions N ormally in S ingle pks M utant B ackgrounds The PKS proteins have been reported to serve as signali ng component s in both the phy signaling pathway and phototropism. It is therefore reasonable to test the role of PKS pr oteins in the phot1mediated opposition to RL induced growth inhibition. In order to obtain a robust RL stem inhibition response, a higher fluence rate of RL (50 mol/m2s) was used. All pks single mutants ( pks1 pks2 pks4 ) showed similar hypocotyl growth rate kinetics under these RL condit ions. However, when dim BL was added, they responded as wild type in the BL suppression of RL stem inh ibition response (Fig. 36 A B C ). D iscussion Adjustment of phy M ediated P hotomorphogenic P rograms by phot1 In the developing seedling light guides early morphological and physiological changes, e.g. hypocotyl growth inhibition, apical hook opening, chlo roplast formation, and cotyledon unfolding Th e se developmental changes are mediated by multiple signaling systems that are initiated by specific photoreceptors. The phy receptor family (phyA E) mainly responds to RL and FrL wavebands. In the initial stage of RL induced hypocotyl growth inhibition phyA mediates the fast growth inhibition response which happens within 13 h after RL onset ( Parks and Spalding, 1999 ; Wang et al., 2013) The phyB receptor redundantly mediates this fast response, but contributes to a greater extent in maintaining this inhibition over subsequent days. Supplement al BL in an RL back ground activates two additional photosenory systems, the cry and the phot. The 60

PAGE 61

cry mediated BL response generally accelerates/enhances the process of RLinduced early photomorphogenic events (Fig. 31 A B ; Fig. 3 2 C ). Such cry effects are most robust under high (>10 mol/m2s) BL fluence rates. Test s of cry mutants for the enhanced stem inhibition and accelerated hook opening responses suggest that cry1 and cr y2 redundantly mediate the response, yet only cry1 plays the major role in stimulating the hook opening (Fig. 3 1 C D ; Fig. 3 3 C ). This observation is in disagreement with an earlier report that suggests cry1 does not affect hook opening kinetics under high fluence rate BL irradiation ( Wang et al., 2009) Since the experiments from this study were performed under RL and BL coirradiation conditions, it is possible that the activation of phy receptors might modulate cry functions in response to BL. Such phy and cry interactions have been reported in several studies ( Ahmad and Cashmore, 1997 ; Casal and Mazzella, 1998; Mas et al., 2000) The phot mediated BL response is more intriguing. The phot receptor induces the primary hyp ocotyl growth inhibition response to BL irradiation, but then switches roles to do the opposite when RL is applied (Fig. 3 1 A ; Fig. 3 2 A B ) The effect of BL to slow RL mediated hypocotyl growth inhibition and apical hook opening likely represents a n adaptive response. A young seedling actively detects the ambient light for the proper allocation of its limited energy reserve L ow BL may signal an unfavorable light environment in the early stages of photomorphogenesis leading to more elongated growth BL s ignals do not operate strictly through phototropins U nder low flunce rate BL conditions the cry2 receptor can also be activated. The result s from genetic tests of hypocotyl growth in cry mutants suggest that cry2 suppresses the phot1 mediated 61

PAGE 62

reversal of RL response over days (Fig. 3 1 D ). These observations indicate the intricate interplay between photoreceptor families in adjusting plant growth and development into the new light environment. An important aspect of these experiments is that they were conducted under narrow bandwidth illumination conditions that were intended to isolate specific receptor contributions U nder low light environment s in natural settings GL may also be enriched especially under the shade of leaves GL has been shown to inacti vate cry function in long term illumination conditions ( Banerjee et al., 2007; Bouly et al., 2007; Sellaro et al., 2010) thus GL m ight help to maintain the phot1negation of the RL stem response in the prolonged irradiation conditions. However, why the cry2 or cry1cry2 mutant seedlings did not show longer hypocotyl under dim BL plus RL conditions than that under RL alone is not clear One possibl e explanation is that the phot1negation effect is only transi ent ( a duration of hours) and phy might dilute this effect in the long term o r perhaps, a yet to be ident ified GL signaling p athway provides additional stem growth promotion under low light environments ( Folta, 2004; Wang et al., 2013) Auxin T ransport and its P ossible I nvolvement in the phot1 A ction Auxin regulates cell differentiation, growth and tropic response ( Lehman, Black, and Ecker, 1996; Raz and Ecker, 1999; Vandenbussche et al., 2010 ; dnkov et al., 2010) Disruption of auxin transport by the auxin transport inhibitor NPA suppresses both phototropic and gravitropic responses ( Jensen, Hangarter, and Estelle, 1998; Friml et al., 2002; Nagashima, Uehara, and Sakai, 2008) Meanwhile, the maintenance of an apical hook structure requires the presence of an auxin gradient at the concave side of the hook. Application of NPA eliminates this auxin gradient and stimulates hook opening of dark grown seedlings ( Wu et al., 2010 ) Additionally, the hypocotyl elongation of light 62

PAGE 63

grown Arabidopsis seedlings requires auxin transport ( Jensen, Hangarter, and Estelle, 1998) The evidence that NPA can suppress both BLmediated repression of RL induced hypocotyl growth inhibition and hook opening indicates a possible role for auxin transport in these responses (Fig.3 4) RL not only regulates auxin biosynthesis, but also affects the transport, content, and distribution of auxin ( Nagashima et al., 2008) The phot1me d i ated adjustment of RLinduced hypocotyl and hook responses is not likely mediated by phot1antagonizing phy regulated transcription (C hapter 2 Fig. 2 3) Instead, this response may be a result of phot1 modulation of auxintransporter localization and activity. Consistent with the latter scenario, phot1 and its signal transducer NPH3 modify the cellular distribution of PIN3 and PIN2 in the hypocotyl and root, respectively ( Ding et al., 2011 ; Wan et al., 2012) Mutation of the PIN3 gene reduces the hypocotyl curvature towards continuous unilateral white light illumination ( Friml et al., 2002; Ding et al., 2011) However, a recent study suggests that PIN3 and PIN7 mediate the pulseinduced first positive phototropic response, but not the continuous light induced, second positive phototropic response when the seedlings were placed vertically on the media ( Haga and Sakai, 2012) M utations in ABCB19 lead to abnormal localization of the PIN1 transporter and t he mislocalization of PIN 1 transporter ultimately enhances hypocotyl phototropism ( Noh et al., 2003) Furthermore, phot1 can inhibit ABCB19 activity by direct phosphorylation of this protein in a HeLa cell system. Reduction of ABCB19 transport er activity suppresses basipetal auxin transport, resulting in more auxin channeled in lateral directions through PIN3, depending on direction of light exposure ( Christie et al., 2011) In the present study, pin1 pin3 pin7, and abcb19 showed normal BL driven 63

PAGE 64

opposition of RL hypocotyl growth inhibition Only pin4 showed slight reductions in the amplitude of this attenuation (Fig. 3 6) This result agrees with Hagas findings, but it is also possible that multiple PIN and ABCB transporters act redundantly to mediate this response. The aux1 mutant was originally discovered as a root agravitropic mutant, and its role in unilateral BLinduced hypocotyl phototropism wa s subtle when NPH4/ARF7 was functional ( Bennett et al., 1996; Marchant et al., 1999 ; Stone et al., 2008) However, AUX1 does mediate the recovered phototropism response in the conditional aphototropic mutant nph4/arf7 background when RL is co irradiated with BL ( S tone et al., 2008) Meanwhile, AUX1 has also been suggested to facilitate auxin transport from the source (leaf) to the sink (root) in Arabidopsis seedlings ( Marchant et al., 2002) Another explanation is that the attenuated RLinduced hyp ocotyl growth inhibition was due to the altered auxin transport from shoot to downward sections through the action of AUX1. Furthermore, AUX1 only represents one possible pathway to load auxin into a cell. Passive auxin diffusion and other AUX/LAX family m embers may contribute additional loading capacities ( Yang et al., 2006) If all of these factors are tak en into account, it may explain why BL opposition of the RL induced inhibition response was only partly abrogated in aux1 mutant background. A n alternative explanation for this result is that the impai red B L response is a result of the slightl y enhanced RLinduced hypocotyl growth inhibition in the aux1 mutant itself. BL may not be able to fully attenuate the enhanced RL inhibition under such a scenario. It should be noted that in this study the light treatm ents were provided from vertical direction in parallel to seedling growth, so the seedling was growing toward the light source. L ight direction guides photoreceptor activation and the cellular 64

PAGE 65

distribution and activities of auxin transporters. C onsidering the localization of AUX1, it may be possible that AUX1 has an important role in mediating longitudinal growth, and what was witnessed in this series of experiments is essentially phototropism guiding the plant upward in the presence of BL signals PKS P rot eins and the Oppositional BL R espo nse Several studies have postulated that the PKS proteins might serve as a molecular link between phy and phot mediated responses ( Lariguet et al., 2006 ; Demarsy et al., 2012) Therefore, it was important to test the hypothesis that the BL reversal of RL hypocotyl growth inhibition is mediated by one or more of the PKS protei ns The r esults from systematic analysis of pks mutants reveal ed no significant differences compar ed to wild type seedlings. Although these data do not provide any supp ort for the proposed hypothesis they do not exclude the possibility that multiple PKS p roteins might redundantly participate in this response. This possibility may be tested in the future using multiple PKS muta tions in a common background. The significance of this study lies in that it uncovers how BL may adjust RL/FrL responses, here regul ating the apical hook opening during initial photomorphogenesis when light conditions are unfavorable. This response is once again mediated by phot1, and appears to require the modulation of auxin transport and distribution in hook/hypocotyl sections of a seedling. Physiologically, this small modulation of plant developmental programs may be a meaningful part of early development, maintaining the apical hook through the soil until sufficient light is sensed. 65

PAGE 66

Materials and Methods Plant Materials The Arabi dopsis photoreceptor mutants tested in this study are identical to those previously assessed ( Folta, 2004) : cry1 304 cry2 1 phot13 ( nph13 ). The nph3 6 mutant seeds were obtained from Dr. Mannie Liscum. The pks1 1 pks2 1 a nd pks4 1 single mutant seeds were obtained from Dr. Christian Fankhauser. The pin3 5 (CS9364), pin43 (CS9368), and pin7 2 (CS9366) were ordered from the Arabidopsis Biological Resource Center (ABRC) at Ohio State University (Columbus, OH). The abcb193 m utant seeds were provided by Dr. Edgar Spalding. The pin1 (CS86744) and aux17 (CS3074) mutant seeds are gifts from Dr. Bala Rathinasabapathi. All genotypes tested in this study are in Columbia (Col 0) background, which was used as wildtype. Light Source s and T reatments Light treatments were generated using narrow bandwidth LED light supplied by custom LED arrays (Light Emitting Computers, Victoria, BC Canada). The peak wavelengths of BL, RL, and FrL are 470, 630, and 720 nm. The emission spectrum of all light sources is viewable online at www. Arabidopsis thaliana.com/lightsources Light fluence rates were measured using a LI COR LI 250 photometer with a PAR sensor (LI COR, Lincoln, NE). Longterm H ypocotyl L ength M easurem ent For endpoint assays (2496 h in light), Arabidopsis seeds were surfacesterilized briefly by immersion in 95% ethanol on blotting paper in a laminar flow hood. Upon drying, the seeds were distributed in Petri dishes on mi nimal media (1mM KCl and 1mM CaCl2) solidified with 1% Difco agar (Beckton, Dickinson and Co, Sparks, MD). The plates were covered in foil and then stratified for 4872 h at 4C. The seeds were then 66

PAGE 67

treated with 68 h of fluorescent white light (16 mol/m2s) at 23C to synchronize germination. Seedlings were grown in absolute darkness at 23C for 4048 h. Germinating seedlings were then moved under experimental light conditions without a photoperiod. At least 30 seedlings were measured per treatment in two to three independent experiments. Analysis of stem growth kinetics was performed by scanning Petri dishes of seedlings on a flatbed scanner, and then measuring seedlings at high magnification using ImageJ 1.44 ( http://imagej.nih.gov/ij/index.html ). The mean of 30 42 seedlings is report ed for each light condition. Chlorophyll Extraction and Measurement The Arabidopsis seedlings were grown on half strength MS medium in a 4cm petri dish for 3 days, and then treated with RL or RL plus BL. Seedlings were harvested at specific time points and weighted. Then, seedlings were transferred into 1 mL DMF in a 1.5 mL tube and let sit for at least 2 hours in the dark. The absorbance of each tube at 647nm and 664nm were measured using a SmartSpec 3000 spectrophotometer (BioRad Laboratories, Hercules, CA). The Chlorophyll concentration was calculated according to the method described ( Porra, Thompson, and Kriedem ann, 1989) Three biological replicates (three petri dishes for each light condition) were included for this experiment. Time c ourse H ypocotyl G rowth and H ook O pening K inetics For the timecourse assays of hypocotyl growth and hook opening kinetics Ar abidopsis seeds were surfacesterilized and synchronized for germination as described above. Then, different experimental light treatments were applied to 23 day old etiolated seedlings and images were acquired in a 5min interval and analyzed according t o the method described ( Wang et al., 2009) For the auxin transport inhibition 67

PAGE 68

experiments, the minimal media were supplemented with NPA (SigmaAldrich Cat # 33371) at different concentrations. Germinating seedlings grown on minimal media without NPA were transferred onto the NPA containing media. Then, a 4060 min incubation time in darkness was given to seedlings to absorb NPA before light experiments. In all time course experiments, at least 8 seedlings were assayed. Statistical A nalysis Means of replicates from long term hypocotyl growth assays were subjected to statistical analysis of one way ANOVA by the multiple range Tukey Kramer test ( p Pro 10.0 statistical package (SAS Institute). 68

PAGE 69

Figure 3 1. BL fluence rate response t ests of the BLattenuation of RL hypocotyl response in wild type and cry mutant backgrounds (A) Increasing BL f luencerate reduced the extent of BL negation of RL stem response in the timecourse assay. R11.6= RL, 11.6 mol/m2s, B0.1=BL, 0.1 mol/m2s, B1.5= BL, 1.5 mol/m2s, B10=BL, 10 mol/m2s. Error bars represent S.E.M. (B) Long term (2 days) RL and BL coirradiation reduced th e hypoc otyl length compared to the RL treated seedlings alone. (C) The hypocotyl growth inhibition enhanced by adding 10 mol/m2s of BL to RL was partially mediated by cry1 and cry2. (D) The cry2 alone repressed the hypocotyl elongation under dim BL (0.15 mol/m2s ) conditions in the long term assay; cry1 and cry2 redundantly suppressed the hypocotyl elongation under higher BL (10 mol/m2s) conditions. Different letters in ( B ) and ( D ) represent statistically different means ( p < 0.05). 69

PAGE 70

Figure 3 2 BL delay s phy induced hook opening. (A) RL stimulates apical hook opening (dark circles), addition o f dim BL delays RLinduced hook opening (open circles); (B) Fr L promotes apical hook ope ning (dark circles), dim BL also delays FrLinduced hook opening (open circl es); (C) Increasing BL fluence rate to 1 mol/m2s still attenuates RL induced hook opening (light gray circles), but 10 mol/m2s BL enhanced RLinduced hook opening; (D) RL and RL plus dim BLtreated seedlings have comparable chlorophyll accumulation kinetics. 70

PAGE 71

Figure 3 3 BL attenuation of RL/FrL induced hook opening is absent in the phot1 mutant. (A, B) The dim BL attenuation of RL/FrLinduced hook opening was absent in the phot1 mutant background. Dark circles: RL alone; open circles: RL plus dim B L. Inset: RL or RL plus BL treated seedlings at the beginning ( 60 min relative to light onset) and the end (180 min) of one representative short term experiment; (C) BL attenuatio n of RL hook response in nph3 mutant background; (D) The enhanced RLinduced hook opening by higher fluencerate BL was normal in the cry2 (gray circles) mutant, but was partially impaired in cry1 (open circles) and cry1cry2 (dark circles) mutants. 71

PAGE 72

Figure 3 4 Normal auxin transport is required for the dim BL effect. The BLn egation of RL induced hypocotyl growth inhibition is partially suppressed by 0.5 M NPA ( A ) and fully suppressed by 1 M NPA ( B ). The RL induced hook opening was delayed when tested on NPA containing medium at two different concentrations: 1 M NPA ( C ) an d 5 M NPA ( D ). However, the BLattenuation of RLinduced hook opening was abolished when treated with 5 M NPA. In panel s (A ) & ( B) open triangles represent the absolute hypocotyl growth rate under RL (11.6 mol/m2s) conditions; dark triangles represent the hypocotyl growth rate under RL plus dim BL (0.1mol/m2s) conditions. In panel s (C) & (D), open circles represent the hook opening kinetics under RL conditions; dark circles represent the hook opening kinetics under RL plus dim BL conditions. Wildtype Col0 in response to RL (dotted line) and RL plus dim BL (gray line) without NPA treatment were included for comparison in all panels. 72

PAGE 73

Figure 3 5 Genetic tests of t he dim bluereversal of RL hypocotyl response in auxin transporter mutants. The dim B L negation of RLinduced hypocotyl growth inhibition response was tested in pin1 ( A ), pin3 ( B ), pin4 ( C ), pin7 ( D ), abcb19 ( E ), and aux1 ( F ). In all panels, open triangles represent the hypocotyl growth rate under RL (11.6 or 50 mol/m2s) conditions; dark triangles represent the hypocotyl growth rate under RL plus dim BL (0.1mol/m2s) conditions. Wild type Col 0 in response to RL (dotted line) and RL plus dim BL (gray line with error bars) were included for comparison. 73

PAGE 74

Figure 3 6 The blue attenuatio n to RL hypocotyl response functions normally in single pks mutant backgrounds. The dim BL negation of RLinduced hypocotyl growth inhibition response was normal in pks1 ( A ), pks2 ( B ), and pks4 ( C ) mutant backgrounds. In all panels, open triangles represent the hypocotyl growth rate under RL (50 mol/m2s) conditions; dark triangles represent the hypocotyl growthrate under RL plus dim BL (0.1 mol/m2s) conditions. Wildtype Col 0 in response to RL (dotted line) and RL plus dim BL (gray line with error bars) were included for comparison. 74

PAGE 75

CHAPTER 4 DISCOVERY OF CANDIDATE GL SIGNALING COMPONENT FROM ARABIDOPSIS NATURAL ACCESSIONS Introduction Arabidopsis has a broad geographic distribution in the world. It has been naturalized many places in the Northern hem isphere, from the Eurasian continent to North America ( AlonsoBlanco and Koornneef, 2000) The adaptability to various climates is impressive Arabidopsis is found from 68N (North Scandinavia) to 0 (mountains of Tanzania and Kenya) latitudinally, which is much wider than its naturally distributed relatives in the Brassicaceae family ( Koornneef, AlonsoBlanco, and Vreugdenhil, 2004) The wide geographic distribution of this species embraces substantial differences in growth habitats. Thus, the phenotypic variations displayed among naturally occurring accessions might be able t o reflect the genetic adaptations to certain environmental conditions ( AlonsoBlanco and Koornneef, 2000) While previous chapters detailed the characterization of GL responses that ultimately led to the identification of nonGL f indings, this chapter centers on a genetic approach to identify GLsignaling components. The hypothesis for this study is that among the naturally occurring accessions, there are genotypes that are not sensitive to GL due to the genetic alternations in GL signaling genes. Such genetic variations may confer adaptive advantages in specific growth environments. In the past decades natural genetic variation in wild accessions has led to the identification of signaling components responsible for the phenotypic variation. For instance, a single amino acid change from a conserved methionine to a threonine at position 548 in PHYA from the Lm 2 accession (collected from wheat field of France, 48N) reduced its FrL sensitivity approximately 100fold compared to Col 0 ( Maloof et 75

PAGE 76

al., 2001) Similarly, dominant gainof function alle le of CRY2 in the Cvi background was shown to be mutation methionine to valine at position 367. The mutation led to enhanced CRY2 stability and an early flowering phenotype under short photoperiods ( El Assal et al., 2001) It is difficult to generate helpful hypotheses about the physiological and ecological relevance of these genetic variations, since they were limited to single acces sions in their original habitat ( Filiault et al., 2008 ) However, it should be not ed that both variations, instead of disrupting the overall function, only affect a subset of protein functions of these two photoreceptors. In addition, the lost of function of PHYD allele is present in the Wassilewskija (Ws) natural accession and i ts fun ctional redundancy with PHYB indicates it is not essential in some natural environments ( Aukerman et al., 1997) Thus, i t seems that the pleiotropic nature of photoreceptor proteins favors changes in the photoreceptor outputs rather than disrupting the overall function ( Maloof et al., 2001) P hotoreceptors are more likely to be the common target for natural selection. Allelic variations that change photoreceptor activities are commonly found among naturally occurring variants ( Balasubramanian et al., 2006; Filiault et al., 2008 ) Assessment of PHYC haplotypes among more than 220 Arabidopsis strains illustrated that the Col0 PHYC is more active at the northern latitudes. Interaction between FRIGIDA ( FRI a vernalization control gene) and PHYC X latitude explain s 10% of the variation in short day f lowering conditions Here a PHYC allele contributes to the late flowering phenotype of FRI positive accessions in northern latitudes ( Balasubramanian et al., 2006) Another study examined PHYB sequences from 33 Arabidopsis thaliana and Arabidopsis lyrata individual accessions, and found 14 nonsynonymous 76

PAGE 77

polymorphisms. All of these 14 polymorphism sites fall outside the f unctionally important GAF and PHY domains. One of them, I143L, associated with variations in RL response ( Filiault et al., 2008) The aforementioned naturally occurring photorecept or variations support the hypothesis that natural ly occurring mutations confer changes in plant behaviors that change sensitivity to the light environment. These findings indicate that variation in ecotypes could be a resource for gene discovery and structure function analysis. The same ecotypes may harbor alterations that affect responses to GL. GL modulates several aspects o f plant growth and development. This GL signaling pathway together with its regulated responses might confer adaptive advantages under certain light environments. Because GL has been shown to alter seedling development, flowering time and shadeavoidance responses, variation in phenotypes under GL may lead to discovery of genes playing a role in GL signaling or response. This chapter evaluates GL responses in various Arabidopsis ecotypes. A forward genetic approach of mutagenized seedlings is not feasible because phenotypes are subtle or could be obscured by effects of the cry sem iquinone. Scoring GLinduced shadeavoidance phenotypes is difficult because many light signals affect the response In addition, many loci are known to contribute to leaf inclination and hyponastic responses so screens would reveal many false positives The same limitations apply to the natural variants, and it is impract ical to use these GLbased assays to screen ecotypes. Instead, the original assay used to identify the GL response was used to monitor seedling stem growth response when adapting to the new light environment s. 77

PAGE 78

Results Response of N atural Arabidopsis A ccessions to GL To identify potential GLsignaling components, forty two Arabidopsis natural accessions were tested for the GLstimulated hypocotyl elongationresponse. In t he typical GL response, hypocotyl growth rate increases after 20 min of GL and reaches i ts maximum between 30 min to 45 min ( Folta, 2004) Among those tested accessions, 38 accessions showed this canonical GL stimulated hypocotyl growth response (Fig. 41 A represented by An1) F our accessions exhibited reduced G L response or no response (Fig.4 1 B represented by Knox 10). A summary of the initial screening results shows the normalized growth rate were 30 min after exposure to GL. Data from various accessions were compared with the growth rate of Col 0 ecotype under both dark and GL treatment conditions (Table 41). Th ese data showed that the Knox 10, Fab4, Eden1, and Lov 1 accessions displayed a significantly lower growth rate ( p value <0.05) than GL treated Col 0 seedlings In fact, their response was most simi lar to the growth rate of dark grown Col0 seedlings. However, only Knox 10 showed a consistent defect in growth when measured in subsequent generations RL I nduced H ypocotyl R andomization R esponse (HRR) is Defective in Knox 10 E cotype Although Knox 10 s howed a significant reduction in the GLstem response, it is possible that the observed phenotype may be due to genetic variations in known photosensing systems. To test if Knox 10 has a normal response to other light wavelengths, endpoint hypocotyl elongation assay s were conducted under BL, GL, RL, and FrL. The growth of Knox 10 under these light conditions was not distinguishable from Col0 (Fig. 4 2 A ). 78

PAGE 79

However, one additional phenotypic variation of this accession was observed when it was treated in c ontinuous RL for days. Typically, Arabidopsis seedlings grown under RL conditions do not grow upright. In stead, they grow in a relatively randomized fashion relative to the gravitational vector ( seedlings grow near ly flat or bending on horizontal plates ) ( Liscum and Hangarter, 1993a; Robson and Smith, 1996) This randomized growth is referred to as the hypocotyl randomizationresponse (HRR) Knox 10 exhibits a defective RLinduced HRR (Fig. 4 2 B C ). When 1 d old Col0 and Knox 10 seedlings were grown in continuous RL for three days, the percentage o f seedlings with a hypocotyl curvature (relative to vertical) between 040 degrees was around 28% for Col 0 and 88% for Knox 10 (Fig. 42 D ). Furthermore, when the hypocotyl curvatures of 4d old dark grown seedlings were measured, Knox 10 also showed less HRR than Col0 seedlings (Fig. 42 E ). Hyposensitivity of Knox 10 to Changes in RLF luence R ate Since Knox 10 showed impairment HRR, the fluence rate dependence of this response was examined. The 2 d old dark grown Knox 10 and Col 0 seedlings were treated w ith RL at three fluence rates (1, 10, and 80 mol/m2s), and then hypocotyl length and curvature were measured at the end of the 24h experiment. Increasing RL fluence rate from 1 to 80 mol/m2s significantly reduced the relative hypocotyl length of Col0 s eedlings from 82.7% (1.6%) to 71.2% (1.4%) (Fig. 43 A ). However, the relative hypocotyl length of Knox 10 seedlings did not significantly differ at these two RL fluence rates (80.0 1.8% and 76.5 2.0%, respectively). Knox 10 exhibited the HRR at lower f luence rates, yet the HRR was significantly reduced with the increase of higher fluences of RL in Col0 seedlings. Fluence rate had n o e ffect on hypocotyl curvature in Knox 10 seedlings (Fig. 43 B ). 79

PAGE 80

Map L ocation of the RLI nduced HRR G ene To identify the gene (s) responsible for the RLinduced HRR, the Col 0 ecotype was crossed into Knox 10 ecotype, and F1 seeds were harvested and tested for the RL induced HRR. The HRR was examined in F1 seedlings The progeny displayed an intermediate or quantitative phen otype, as the response scored was HRR or no HRR. Seedlings exhibited a range of phenotypes. T he relative frequency of seedlings could be grouped into several HRR classes (0 degree to 180 degrees, at 20degree interval s) between the angles observed in Col0 and Knox 10 (Fig. 44 A B ). In the F2 se gregation population, hypocotyl curvature distributions in response to RL showed the similar pattern as in the F1 seedlings (Fig. 44 C D ), and the segregation ratio did not follow Mendalian segregation. To locate the causal gene responsible for the defective HRR in Knox 10 ecotype, F2 seedlings that showed an up right or near upright growing phenotype were selected as the mapping population. The result from rough mapping using S imple S equence L ength P olymorphism (S SLP) markers showed that several markers located on the lower arm of chromosome one displayed a bias ed segregation towards the Knox 10 genotype. These markers include nga280, NF5I14, nga111, and nga692, which cover about 8 Mb of genomic region (Table 43 ). The causal gene is likely to be located within this genetic interval. Increased H yponastic G rowth in Knox 10 E cotype During the early stages of vegetative growth (from first to fourth pair of true leaves), Knox 10 displayed an increase in hyponastic growt h (i.e. elongated stem, petiole, and reduced petiole angle) compared to the Col0 ecotype (Fig. 45 A ). Typically, plants develop such growth behaviors in response to dense canopies/shade, 80

PAGE 81

elevated temperatures, or immersion in water ( Cox et al., 2003; Vandenbussche et al., 2005; Koini et al., 2009 ) The hyponastic growth behaviors induced by shading signals are collectively referred as shade avoidance syndrome (SAS) ( Smith and Whitelam, 1997; Franklin, 2008) I n shaded envir onment s the light spectrum is FrLand GLenriched, as well as BLreduced, all of which can independently induce SAS ( Franklin, 2008; Keuskamp et al., 2011; Zhang, Maruhnich, and Folta, 2011) The defect in RL induced HRR and the hyposensitivity to RL fluence rate changes might be connected with the increased hyponastic growth in Knox 10 ecotype. The hypothesis is that the altered function of this downstream component leads to abnormal responses to RL that ultimately affects its responsiveness to R: FR ratio changes. To further test this hypothesis, three l ight combinations were designed: a) B30G30 (blue and green light 30 mol/m2s each); b) R10B30G30 (adding 10 mol/m2s red light to B30G30); c) R10B25G25 (keeping the same photosynthetically active radiation [ PAR ] in (a) by reducing blue and green to 25 mol/m2s each). The r esults showed that plants grown in blue and green light conditions (B30G30) developed typical shade avoidance responses in both Col 0 and Knox 10 ecotypes. There were no significant differences in the petiole angles between these two eco types, but Knox 10 plants showed a significantly higher petiole: leaf ratio (P/L) than Col0 plants (Fig. 45 B C D ). Additional RL ( R10 B30G30 ) significantly reduced the P/L ratio in both ecotypes. Still, Knox 10 plants showed a higher P/L ratio than Col0 plants grown with B30G30 (Fig. 4 5 C ) Although the petiole angles were increased under R10B30G30 in Col 0 plants they were not significantly different from B30G30treated plants (Fig. 45 B D ). When keeping the same PAR, Col 0 plants grown with 81

PAGE 82

R10B25G2 5 exhibited attenuated shade avoidance responses with significantly increased petiole angles and decreased P/L when compared to the B30G30treated plants. The enhanced attenuation of SAS was not observed in Knox 10 plants treated under these same conditio ns (Fig. 4 5 B C D ). Knox 10 R esponds N ormally to RL at the L evel of T ranscriptional R egulation of S hade I nduced M arker G enes To test whether this increased hyponastic growth was a defect in the light detection or light response, the relative transcript levels of several shadeinduced marker genes were examined in these two ecotypes. M arker genes include those that accompany with shade avoidance response: PIL1 HFR1 and ATHB2 ( Carabelli et al., 1996; Salter, Franklin, and Whitelam, 2003; Sessa et al., 2005) Supplementation of RL significantly reduced the transcript levels of ATHB2 and HFR1 genes in both Col 0 and Knox 10 plants. PIL1 transcript levels w ere not affected (Fig. 4 6 ). While Knox 10 showed increased hyponastic growth than Col 0 plants, the transcript levels of these three marker genes did not significantly diff er between these two ecotypes under the tested light combination s. Relationships between the D efective RL I nduced HRR and the I ncreased H yponastic G rowth The reduced HRR and increased hyponastic growth in Knox 10 raises a fundamental question: what is the connection between these two traits. These two traits seem to allow plants to grow more upright and taller so that they might outcompete neighbors Does one common genetic component controls these two phenotypes? To test this hypothesis the HRR phenotype was assessed in the F2 segregation population. Seedlings that showed upright or flat hypocotyl curvatures were selected and grouped into F2 UP (up right F2 seedlings) and F2DOWN (flat F2 seedlings). A fter 82

PAGE 83

8 10 d of recovery, seedlings w ere moved to light chambers with the same light combinations (B30G30, R10B30G30, and R10B25G25) and treated for 9 d Petiole angles and P/L ratio were compared. Surpris ingly, the petiole angles of F2UP and F2 DOWN plants were all similar to Knox 10 plan ts (more upward) in all three light conditions (Fig. 47 A ). Meanwhile, all F2 UP and F2 DOWN plants showed higher P/L (more elongated petioles) under R10B25G25 light condition s (Fig. 4 7 B ) than that of Col 0 plants grown under the same conditions. Further more, the F2UP plants showed increased P/L than F2 DOWN plants only under R10B30G30 conditions (Fig. 47 B ). In summary, co segregation was not observed between the defective HRR seedlings and increased hyponastic growth. Examination of Amyloplasts Conver sion of etioplasts to amyloplasts is pot entially behind the Col 0 HRR. This hypothesis was tested by I2K I staining dark grown and RLgrown seedlings from both ecotypes. No significant differences were observed in the conversion process between Col0 and K nox 10 seedlings (Fig. 48 ). After 24 h RL treatment, both accessions showed greatly reduced amyloplasts in the hypocotyls. D iscussion Arabidopsis N atural V ariations and GL R esponse The original rational e of this study was to identify signaling components of GL using Arabidopsis natural variations. Arabidopsis grows a cross a wide latitudinal range in the world which makes it very suitable for adaptive traits analysis ( Koornneef, AlonsoBlanco, and Vreugdenhil, 2004) GL affects many plant responses that oppose the effects of other wavelengths, especially under low light environment s This feature may 83

PAGE 84

confer adaptive advantages in a specific light environment, but not others. The hypothesis is that the genetic variations in GLsignaling p roteins may lead to abnormal GL responses in naturally occurring variants. Such variations might be neutral or positiv e to the overall fitness Using hypocotyl growth rate imaging 42 Arabidopsis accessions were tested for GL stimulated growth (Table 41). Four accessions showed reduced or no GL response in the original screen. However, only Knox 10 consistently showed the reduced GL response that was transmitted to its progeny Since seed size, age, maturity and the environmental conditions (light, photoperiod, temperature, nutrient, etc.) during seed maturation can all influence the subsequent seedling development ( Leishman and Westoby, 1994; Rice and Dyer, 2001; Luzuriag a, Escudero, and Prez Garca, 2006 ) it is likely that some of the putative candidate accessions were affected by nongenetic effects. Impaired HRR in Knox 10 A ccession Knox 10 and Col 0 showed phenotypically similar responses in many other light condi tions. R elative hypocotyl length was comparable between Col 0 and Knox 10 indicat ing that the overall light signal transduction network is intact and functional for Knox 10 (Fig. 42 A ). Kno x 10 displayed a defective RL induced HRR (Fig. 4 2 B, C, D ) suggest ing that a specific phy mediated response is affected by the genetic variation. The Knox 10 gene controlling this response is probably positioned downstream of this particular pathway and may be essential for upright hypocotyl growth, since the 4d dark gr own Knox 10 seedlings also displayed less HRR than Col 0 seedlings (Fig. 42 E ). One possibility is that this component is a regulator of HRR, and the phy receptors 84

PAGE 85

are probably targeting this component under RL/FrL, antagonizing or enhancing its function. Alternatively, the reduced HRR could simply result from a n alternation in a structural gene that controls cell differentiation or growth in the dark grown seedling that is revealed by RL treatment The mechanism of phytochromeinduced HRR remains poorly understood. However, the PHYTOCHROME INTERACTING FACTORS (PIFs) have been reported to play an essential role in the hypocotyl position relative to gravity in RL Four l ossof function PIFs ( PIF 1 PIF3 PIF4 and PIF5 ) confer HRR even in darkness ( Shin et al., 2009) S edimentable amyloplasts in the shoot/hypocotyl have been proposed to function in the gravity sensing ( Morita and Tasaka, 2004) and PIFs have been d emonstrated to repress conversion of amyloplast to etioplast ( Stephenson, Fankhauser, and Terry, 2009) In the follow u p study, the authors hypothesized tha t phy might disrupt hypocotyl gravi tropism by degrading PIFs. The results from their study supported this hypothesis, showing that the pif1pif3pif4pif5 quadruple mutants did not contain amyloplasts but still exhibit HRR even in darkness Endodermis specific expression of PIF1 in the quadruple mutant background restored both the amyloplast phenotype and hypocotyl growth against gravity ( Kim et al., 2011) In the present study, the amyloplast to etioplast conversion was also examined in Knox 10 accession by I2KI staining of dark grown and RLgrown seedlings. No significant differences were observed in the conversion process between Col0 and Knox 10 seedlings (Fig. 48 ). After 24 h RL treatment, both accessions showed greatly reduced amyloplasts in the hypocotyls. Despite this the gravitropic and phototropic responses are normal in the Knox 10 accession (data not shown). 85

PAGE 86

These results indicate that the lack of a RL induced HRR in Knox 10 is not likely caused by defects in the sensing or response to gravity by the hypocotyl but instead by a component linking phy signaling and the gravity sensing/response. Such components have been described in several studies. One such component i s PHYTOCHROME KINASE SUBSTRATE4 (PKS4), which has been suggested to modulate RL induced HRR. Mutation or overexpression of PKS4 in Arabidopsis seedlings resulted in reduced or enhanced HRR ( Schepens et al., 2008) Another component is GRAVITROPIC IN THE LIGHT (GIL1). Mutation of GIL1 gene led to a redu ced HRR ( Allen et al., 2006) Nonetheless how these two components mediate the RLinduced HRR remains unclear Since both genes are located on chromosome 5 and our rough mapping position is on chromosome 1 ( T able 43 ), these two genes are not likely underlying the Knox 10 phenotype. However, they could be the additional loci that contribut e to the reduced HRR in Knox 10 as a quantitative trait Hyposensitivity to RL F luence R ate C hanges and I ncreased H yponastic G rowth The Knox 10 accession was less responsiv e to RL fluence rate changes in terms of the hypocotyl elongation and HRR (Fig. 4 3) One possible explanation for this result is that gen etic variation in this response controls cell differentia tion and/or elongation growth Candidate components include signaling or response pathway s for auxin, or even modulators of auxin transport and distribution. RL might integrate with auxin signaling response, or transport through the action of such a component. Disruption of the functions of this component abolished the connections between RL and auxin in this particular response. Alternatively, this component may contribute a physical constraint for cell differentia tion or elongation but the normal gravitropic and phototropic res ponses of Knox 10 seedlings do not seem to support such an explanation. The 86

PAGE 87

increased hyponastic growth in Knox 10 during early vegetative development represents another pote ntially adaptive trait that may be physiologically relevant for this accession in its natural habitat. The elongated stems and petioles might enable juvenile plants to out compete n eighboring plants or adapt to light poor environments. Plants in frequently flooded environments are expected to develop elongated petioles/internodes at a higher frequency than do those in rarely flooded places ( Bailey Serres and Voesenek, 20 08) The same suite of morphological changes that a plant employed in response to flood stress is called the low oxygen escape syndrome (LOES). Signals that can induce LOES include gaseous plant hormone ethylene, as well as the signals associated with c hanged rate of photosynthesis and/ or reduced levels of carbohydrates ( Evans et al., 1994; Lynn and Waldren, 2001, 2002; Mommer et al., 2005) Plants in supraoptimal temperature conditions also develop hyponastic growth phenotypes ( van Zanten et al., 2009) Arabidopsis ecotypes that originated from lower latitudes have more erect leaf angles than that of ecotypes from northern latitudes ( Hopkins, Schmitt, and Stinchcombe, 2008) An s udden increase in temperature from 22 C to 28 C induces leaf inclination and petiole elongation in Arabidopsis plants This high temperatureinduced hyponastic growth is genetically controlled by PHYTOCHROME INTERACTING FACTOR4 ( PIF4 ) ( Koini et al., 2009) The molecular mechanism for the increased hyponastic growth in Knox 10 plants is unclear One possibility is that the hyposensi tivity of Knox10 to RL fluencerate changes might contribute to this trait. Since l ow red: far red ratio perceived by phy is one of the mechanisms that could induce hyponastic growth, a signaling component downstream of this pathway might be altered in Knox 10, which leads to the 87

PAGE 88

hyposensitivity to red: far red ratio changes. If this is the case, the hyposensitivity to red: far red ratio changes might explain why supplementation of RL to the background of B30G30 or B25G25 only attenuated the shade avoidance phenotypes in Col 0, but has minimum effects in Knox 10 (Fig. 4 5) However, exami nation of the transcript levels of shadeinduced marker genes under three light combination conditions did not reveal any significant differences between Col 0 and Knox 10 plants (Fig. 46) This result suggests that Knox 10 can respond to RL normally in t he early steps of phy mediated shade avoidance pathway, at least at the transcriptional level of those shadeassociated genes. In this study there is an uncharacteristic disassociation between the shadeinduced genes and the morphological changes observed. GL induced SAS produces plants with increased hyponastic growth and the transcri pt levels of the shadeinduced marker genes are actively repressed by the cry1 and cry2 receptors ( Zhang, Maruhnich, and Folta, 2011) The results observed here suggest that Knox 10 may possess variations in the response to shade with respect to coincident gene expression, consistent with the observations that a discrete set of light responses are affected in the Knox 10 background. RL I nduced HRR and I ncreased H yponastic G rowth The RL induced HRR and the increased hyponastic growth in Knox 10 were tested for co segregation to determine if they were governed by common genes. T he result s from this test were in conclusive yet suggested that these traits were not genetically linked. All of the F2 plants from the Knox 10 x Col 0 cross showed reduced petiole angles (more upward) as did Knox 10 plants under B30G30, R10B30G30, and R10B25G25 light conditions (Fig. 4 7 A ) The petiole: leaf ratio (P/L) of F2UP and 88

PAGE 89

DOWN plants was difficult to interpret. However, the general trend is the F2UP plants seem to have larger P/L compared to Col 0 plants at the two RL supplementation conditions. The F2DOWN plants only showed larger P/L than Col 0 plants under R10B25G25 condition in which the increased hyponastic growth was most pronounced between Knox 10 and Col 0 plants (Fig. 4 7 B ) One explanation for this result is that the increased hyponastic growth is not linked with the defective RLinduced HRR. The increased P/L in F2 plants compared with that of Col 0 plants may be due to the Mendelian segregation of a second gene controlling hyponastic growth. Thus, the mean P/L from t he F2 plants would be larger than Col 0 but smaller than Knox 10 plants. However, the petioleangle result seems to conflict with such an explanation, since all F2 plants showed similar petiole angles to Knox 10 plants. The alternative explanation for this result is that the increased hyponastic growth in F2 plants might be due to the effects from the Knox 10 genetic background Such hypothes es could be tested by reciprocal cross es in future studies. On the other hand, the early response to GL and the HRR are highly correlated. The Knox 10 plants show a diminished response to GL and to RL, but the data indicate that these are not simply phy responses, a result supported by gene expressions analysis. The data indicate that the defect leading to both responses is downstream, at the level of cellular response to light. Both responses are likely affected by GL or RL independently, as two signals ultimately affect an elongation response. A second interpretation is that the GL and RL responses are both mediated by the hypothetical GL receptor, which could have substantial absorbance in the red portion of the spectrum. 89

PAGE 90

The phy mediated HRR may be physiologically significant for early seedling growth and development. Seedlings emerging from soil encounter changing lo w light environments, such as when covered by dense canopies, shaded by neighboring plants, buried by plant debris or even germinated under water In some of th e se light environments t he reduction of BL could amplify the action of phy mediatedHRR, thus e nhancing its antagoni stic effect on hypocotyl gravitropism and rendering more robust hypocotyl/stem phototropism ( Lariguet and Fankhauser, 2004) In addition the enrichment of far red and GL promotes hypocotyl/stem elongation growth to escape from adverse light environments ( Vandenbussche et al., 2005; Zhang, Maruhnich, and Folta, 2011) Impairment in the phy mediated HRR has been proposed to confer a fitness disadvantage in seedling emergence and survival ( Allen et al., 2006) Whether such a defect would hinder the early establishment of Knox 10 seedlings is an interesting question to be investigated in future studies However, the increased hyponastic grow th in Knox 10 plants during early development may also be physiologically relevant In the early stage of se edling growth and development, Knox 10 plants exhibit longer stems and smaller cotyledon angles compared with Col 0 plants under l ow light conditions (Fig.4 2 A ). Such increased hyponastic growth persisted at least to the stage of fourth pair of true leaves. This phenotypic variation might compensate for the defective phy mediated HRR if the latter do affect the fitness of Knox 10. Since the phototropi c response of Knox 10 is normal, the increased hypocotyl gr owth might enhance the likelihood that the emerging seedlings would reach optimal light and/or oxygen as quickly as possible. 90

PAGE 91

These data provide a stepping off point to analyze additional genes in the genetic interval defined, as well as perform highthroughput sequencing to identify the causal genes in these responses. The use of a natural accession provides insight into a number of altered light responses. It will now be of interest to identify t he genes affected. Materials and Methods Plant Materials A set of 96 Arabidopsis natural accessions (Stock #: CS22660) were ordered from the Arabidopsis Biological Resource Center (ABRC) at Ohio State University (Columbus, OH). GL S timulated Hypocotyl Elongation Screening A ssay Seeds of individual accessions were germinated as described previously. 2d old seedlings (approximately 2 3 mm, the stage exhibiting the most robust and rapid hypocotyl elongation) were transferred to 1% Difco agar plate oriented v ertically in front of a CCD camera (EDC1000N; Electrim Corp., Princeton, NJ, USA) with a close focus lens (K52 274; Edmund Scientific, Barrington, NJ, USA). A nonphotomorphogenic infrared light source was placed behind the seedlings to allow visualization of seedlings during the dark period. Digital images were taken at 5min interval for 1 h in the dark to establish the dark growth rate, and at 5 min interval for 1h after GL illumination. GL was supplied by a Floralamp LED arrays (Light Emitting Computers Victoria, BC Canada) at a fluence rate of 0.2~0.5 mol/m2s. A custom software application, written in the Lab View environment (National Instruments, Austin, TX, USA) were used to calculate growth rate data from the series of digital images ( Folta, 2004) 91

PAGE 92

EndP oint H ypocotyl L ength and C urvature M easurements Seed germination and growth conditions were the same as described in previous Chapters. Analysis of hypocotyl length and curvature was performed by scanning petri dishes of seedlings on a flatbed scanner covered with black cloth, and then measured seedlings at high magnification using ImageJ 1.44 software (http://imagej.nih.gov/ij/index.html). The hypocotyl length in response to different wavebands was normalized to the mean hypocotyl length of dark grown seedlings of each accession. The mean of 3040 seedlings is reported for each light condition. The hypocotyl curvature was defined as the angle between hypocotyl orientation and vertical position. Same experiment was performed at least twice. Mapping of the RLI nduced HRR G ene Col0 plant was crossed into Knox 10 plant under a binocular microscope. F2 segregation population was screen for the RL induced HRR under continuous RL (8 mol/m2s) conditions for 4 days. Individual F2 seedlings with upright hypocotyl orientation were selected and transferred into soil for later DNA extraction. Selected F2 plants were maintained in growth chamber under white light (6080 mol/m2s, 16h light/8h dark) conditions with a constant temperat ure at 21 C. Genomic DNAs were extracted from the third pair of true leaves using SDS (Sodium Dodecyl Sulfate) method as described ( Edwards, Johnstone, and Thompson, 1991) Briefly, leaf samples (approximately 1 cm2) were transferred into 2.0 mL Eppendorf tubes, then each tube was added with one metal bead and 500 L extraction buffer (200 mM Tris HCl [pH 8.0], 25 mM EDTA [pH 8. 0], 250 mM NaCl, 0.5% SDS). Leaf tissues were then homogenized on a shaker (Mini Beadbeater, BioSpec) at maximum speed for 1 min. After centrifugation, about 400 L supernatant was transferred into a fresh 1.5 mL 92

PAGE 93

Eppendorf tube. Then, 400 L isopropanol we re added into each tube and mixed immediately. After leaving it at room temperature for 2 min, samples were centrifuged at full speed for 5 min. Then, supernatant was removed and the pellet was washed with 500 L 70% ethanol. The pellet was dried gently and dissolved in ddH2O. Sequencing information and chromosome locations of SSLP markers were obtained from the ABRC website (Table 42 ). PCR reactions were performed on a thermocycler (Mastercycler pro S, Eppendorf) with the following program: 94C 1 min, 35x (94C 15 s; 55C 15 s; 72C 30 s ), 72C 5 min, hold at 10C. 3% 3.5% agorose gel was used to obtain a good resolution of the SSLP bands. Hyponastic G rowth M easurement 9 d old Col 0 and Knox 10 plants grown under white light (36 mol/m2s, 16h light/8h dark) were transferred to different light chambers and treated for another 9 days with regular watering. Then, whole plants were carefully removed from the soil, the petiole angles of the second pair of true leaves were recorded by a digital camera, and then the leaves were flattened on the adhesive side of black electrical tape and covered with plastic film. Then, leaf samples were scanned at 600dpi resolution on a standard flatbed scanner and measured using ImageJ 1.44 software ( http://imagej.nih.gov/ij/index.html ) for the leaf and petiole length. RNA E xtraction and Q uantitative RT PCR A nalysis The aboveground tissues (40~60 mg) of young plant treated with different light combinations were harvested into l iquid nitrogen at the same time of the day for each repeated experiment. Total RNA was extracted by using the Qiagen RNeasy Mini kit (Qiagen Cat # 74904) according to the manufacturers protocol. Resulting RNA was treated with DNase I (Fermentas Cat # EN05 21), and cleaned with Qiagen RNeasy Mini 93

PAGE 94

kit. The cDNA was synthesized from 0.5 g cleaned RNA using the Improm II Reverse Transcriptase (Promega Inc., Madison, WI). Quantitative RT PCR was performed using the StepOne Plus system (Applied Biosystems, USA) based on SYBR Green chemistry. Three biological replicates (individual plants) were analyzed for each light treatment per each ecotype, and for each of these replicates, reactions were performed ROX (ABM, each genespecific primer (Table 4s were designed by the Primer Express 2.0 software (Applied Biosystems, USA). YLS8 ( At5g08290) was used as the reference gene ( Czechowski et al., 2005) The relative mRNA levels were calculated using the 2method ( Livak and Schmittgen, 2001) Iodine Staining of Endodermal Amyloplasts Endodermal amyloplasts of Knox 10 and Col 0 seedlings that treated with RL or dark were visualized by iodine staining according to method described ( Kim et al., 2011) Briefly, seedlings were fixed in FAA (5% Formaldehyde, 45%Ethanol, 5% Acetic acid) solution for 24 h in dark at 4 C. Then after fixation, seedlings were ri nsed in 50% (v/v) ethanol once and stained in Lugol solution (Sigma Cat # 32922) for 2 min. Seedlings were destained in 1:1:1 trichloroacetic acid: phenol: lactic acid for 1 min and carefully mounted on slides with a drop of destaining solution for the l ight microscopic observation (Nikon AZ100, Japan). Images were taken and analyzed by NIS Elements Imaging Software (Nikon). 94

PAGE 95

Statistical A nalysis Means of replicates from long term hypocotyl growth assays were subjected to statistical analysis of one way AN OVA by multiplerange Tukey Kramer test ( p using the JMPPro 10.0 statistical package (SAS Institute). 95

PAGE 96

Table 4 1. Statistical analysis of hypocotyl growth rate between different accessions and Col 0 in response to GL treatment Ecotypes # of seedli ngs Mean growth rate* S.E. Two tail p value ** Two tail p value *** Ecotypes # of seedlings Mean growth rate* S.E. Two tail p value ** Two tail p value *** Col 0 ( Dark ) 15 0.973 0.059 0.001 UII2 5 6 1.231 0.249 0.266 0.166 Col 0 20 1.532 0.125 0.001 B il 7 5 1.678 0.12 0.582 0.000 Knox 10 36 1.154 0.069 0.006 0.116 Lov 1 6 0.863 0.082 0.009 0.318 Pu2 23 6 1.206 0.123 0.187 0.069 Var2 1 6 1.21 0.096 0.186 0.048 Mrk 0 6 1.714 0.184 0.475 0.000 Omo2 3 6 1.788 0.276 0.356 0.000 Mt 0 5 1.55 0.183 0.949 0 .001 C24 12 1.251 0.086 0.118 0.011 Rss 10 6 1.224 0.147 0.218 0.069 Kondara 6 1.395 0.1 0.511 0.001 Gu 0 5 1.334 0.084 0.449 0.005 Lov 5 6 1.361 0.156 0.491 0.009 HR 10 6 1.369 0.164 0.514 0.010 W.s 6 1.711 0.318 0.536 0.003 An 1 10 1.513 0.082 0.917 0.000 Tul 0 12 1.257 0.202 0.228 0.151 Sq 8 5 1.344 0.081 0.472 0.005 S96 12 1.231 0.103 0.105 0.031 Mz 0 6 1.654 0.116 0.616 0.000 Col 3 5 1.324 0.106 0.429 0.009 Br 0 5 1.225 0.103 0.246 0.048 Nossen 6 1.6 0.263 0.804 0.003 Wei 0 6 1.189 0.126 0.166 0.094 Col prl 9 1.507 0.193 0.914 0.004 Nd 0 13 1.44 0.207 0.689 0.029 Gre 0 6 1.309 0.148 0.369 0.019 Pro 0 6 1.382 0.2 0.560 0.016 Ler 6 1.957 0.371 0.171 0.001 Tamm 27 12 1.217 0.089 0.084 0.026 Kend L 6 1.529 0.227 0.992 0.004 Fab 4 12 0.908 0.09 0 0.001 0.539 Vi 0 9 1.334 0.089 0.322 0.002 Kas 2 6 1.415 0.198 0.649 0.010 Be 4 1.327 0.126 0.484 0.016 Nd 1 6 1.151 0.13 0.127 0.166 Djion 6 1.8 0.197 0.300 0.000 Eden 1 6 0.825 0.098 0.006 0.202 Muhlen 6 1.686 0.187 0.546 0.000 Fab 2 6 1.411 0.172 0.631 0.006 RLD 6 2.01 0.473 0.170 0.003 *: Hypocotyl growth rate was normalized to that in dark **: Student t test was conducted between ecotype and GLtreated Col0 ***: Student t test was conducted between ecotype and Dark treated Col 0 For simplicity, the hypocotyl growth rate at the time point 30min after GL was onset was selected for this comparison. However, the pattern of growth rate kinetics were also taking into account when determine whether it was truly a candidate accession. 96

PAGE 97

Table 4 2 S SLP markers used in Chapter 4 Chromosome SSLP marker Sequence Col 0 (bp) Knox 10 (bp) Map position (bp) 1 nga63 AACCAAGGCACAGAAGCG 111 89 3551000 ACCCAAGTGATCGCCACC 1 F21J9 83201 CAGATTTCTTGCCAAGTTTCATC 189 <189 8655241 GAGACGAAGAAGATGGAT TCTG 1 nga280 CTGATCTCACGGACAATAGTGC 105 85 20873698 GGCTCCATAAAAAGTGCACC 1 NF5I14 GGCATCACAGTTCTGATTCC 196 >196 24370345 CTGCCTGAAATTGTCGAAAC 1 nga111 TGTTTTTTAGGACAAATGGCG 130 >130 27353212 CTCCAGTTGGAAGCTAAAGGG 1 nga692 AGCGTTTAGCTCAACCCTAGG 119 <119 28836552 TTTAGAGAGAGAGAGCGCGG 2 nga1145 CCTTCACATCCAAAACCCAC 213 <213 683626 GCACATACCCACAACCAGAA 2 CIW3 GAAACTCAATGAAATCCACTT 230 >230 6402846 TGAACTTGTTGTGAGCTTTGA 2 nga361 AAAG AGATGAGAATTTGGAC 114 <114 13222414 ACATATCAATATATTAAAGTAGC 2 AthBIO2b TGACCTCCTCTTCCATGGAG 141 >141 18012804 TTAACAGAAACCCAAAGCTTTC 3 nga162 CATGCAATTTGCATCTGAGG 107 89 4608277 CTCTGTCACTCTTTTCCTCTGG 3 CIW11 CCCCGAGTTGAG GTATT 179 >179 9774308 GAAGAAATTCCTAAAGCATTC 3 CIW20 CATCGGCCTGAGTCAACT absent 200 20762868 CACCATAGCTTCTTCCTTTCTT 3 nga6 TGGATTTCTTCCTCTCTTCAC 143 >143 23031050 ATGGAGAAGCTTACACTGATC 4 CIW5 GGTTAAAAATTAGGGTTACGA 164 144 737954 AGATTTACGTGGAAGCAA 4 CIW6 CTCGTAGTGCACTTTCATCA 162 >162 7892624 CACATGGTTAGGGAAACAATA 4 CIW7 AATTTGGAGATTAGCTGGAAT 130 <130 11524350 CCATGTTGATGATAAGCACAA 97

PAGE 98

Table 42. Continued. Chromosome SSLP marker Sequenc e Col 0 (bp) Knox 10 (bp) Map position (bp) 4 nga1139 TAGCCGGATGAGTTGGTACC 114 <114 16444151 TTTTTCCTTGTGTTGCATTCC 5 nga225 GAAATCCAAATCCCAGAGAGG 119 absent 1507103 TCTCCCCACTAGTTTTGTGTCC 5 nga139 AGAGCTACCAGATCCGATGG 174 <174 8428 133 GGTTTCGTTTCACTATCCAGG 5 phyC CTCAGAGAATTCCCAGAAAAATCT 207 >207 14007897 AAACTCGAGAGTTTTGTCTAGATC 5 CIW9 CAGACGTATCAAATGACAAATG 166 <166 17044001 GACTACTGCTCAAACTATTCGG 5 EG7F2 GCATAGAATTTGACGATAACGAGC one band two b ands 24626811 (CAPS marker) GATCTGTGTAGGACTACGAGAC 98

PAGE 99

Table 4 3 Candidate map location of the RL induced HRR gene SSLP marker chromosome AGI map (nuc_sequence) segregation ratio nga280 1 20873698 20873802 bp 5:37:18 NF5I14 1 24370345 24370540 bp 4:35:20 nga111 1 27353212 27353339 bp 3:33:24 nga692 1 28836552 28836670 bp 4:34:21 : Represents the ratio of marker(Col 0) : marker(Col 0&Knox 10) : marker(Knox 10) 99

PAGE 100

Table 44 Primers used in qRT PCR assay in Chapter 4 Primers Seq uences (5' 3') qUBC21 5' TTAGAGATGCAGGCATCAAGAG qUBC21 3' AGGTTGCAAAGGATAAGGTTCA qYLS8 5' ATGAGACCTGTATGCAGATGG A qYLS8 3' ATGACCGTAGAAGGATCGTAC A ATHB2 QF TGAGCCCACCCACTACTTTGA ATHB2 QR CGGGACCGACACGTGTTC PIL1 QF TGGGTGCAGCAGCAACAC PIL1 QR CCGGTTG CTTGAACATTCATAG HFR1 QF ACCACATGCTGACGGCAAT HFR1 QR ATCATGTGATTCGCCGGATT 100

PAGE 101

Figure 4 1. Initial response of the GL stimulated hypocotyl growth in Arabidopsis ecotypes (A) Normal GL response ecotype An 1 (dark line, n=10). (B ) R educed GLresponse ec otype Knox 10 (dark line, n=36). Error bars represent S.E.M. G rowth rate kinetics of Col 0 seedlings in response to GL (gray line, n=20) and darkness (dash line, n=15) were included for comparison. 101

PAGE 102

Figure 4 2 Knox 10 is defective in the RL induced hypocotyl randomization response. (A) R elative (to dark control) hypocotyl length of Knox 1 0 seedlings in response to different light wavebands in the endpoint assays BL (blue light 10 mol/m2s), GL ( green light 10 mol/m2s), RL (red light 10 mol/m2s) FrL (farred light 4 mol/m2s). (B) 4 d old Col 0 (left) and Knox 10 (right) seedlings grown in continuous RL (10 mol/m2s). Petri dish was placed horizontally. (C) 4 d old Col0 (left), Ler (middle) and Knox 10 (right) seedlings grown in continuous RL (10 mol/m2s). Petri dish was placed vertically. The white line in the middle is the gridline of the petri dish. (D) R elative frequencies of hypocotyl curvature in response to continuous RL irradiation for Knox 10 and Col 0 seedlings. (E) 4 d old dark grow n Knox 10 seedlings showed less hypoc otyl randomization response compared to Col 0 (top panel). Means of at least 30 seedlings were report ed. Error bars represent S.E.M. (*, p <0.05, student T test) 102

PAGE 103

Figure 4 3 Knox 10 is hyposensitive to changes in RL fluence rate. ( A ) Hypocotyl curvatures of 2d old Col 0 and Knox 10 seedlings treated with continuous RL at different fluence rates for 24 h. (B) Relative (to dark control) hypocotyl length of 2 d old Col 0 and Knox 10 seedlings treated with continuous RL at different fluence rates for 24 h. Different letters represent statistically different means ( p < 0.05). 103

PAGE 104

Figure 4 4 Hypocotyl randomizationcurvature distribution in Knox 10 x Col 0 F1 and F2 plants treated with continuous RL for 3 days. (A) R epr esentative RLinduced hypocotyl randomization response in F1 seedlings; (B) H ypocotyl randomization curvature distribution of F1 seedlings (n=20); (C) R epr esentative RLinduced hypocotyl randomization response in F2 seedlings; (D) H ypocotyl randomizat ion curvature distr ibution of F2 seedlings (n=95) The white line in the middle of the bottom panel in (A, C) is the gridline of the petri dish. 104

PAGE 105

Figure 4 5 Knox 10 plants (first to third true leaf stage) showed increased hyponastic growth. (A) 9 d o ld Col 0 and Knox 10 plants grown in 36 mol/m2s white light conditions with long day photoperiod; (B) R epresentative Col 0 and Knox 10 plants grown at different light conditions after 9 days. B, G, and R represent blue, green, and red light, numbers repre sent the fluence rate used (mol/m2s). Scale bar: 1cm; (C) P etiole/leaf length ratio of Col 0 and Knox 10 plants under different light treatments (8 n 12) ; (D) P etiole angles of Col 0 and Knox 10 plants under different light treatments (4 n 6) Different l etters in ( C ) and ( D ) represent statistically different means ( p < 0.05) E rror bars represent S.E.M. Same experiment was performed at least twice with a similar result. 105

PAGE 106

Figure 4 6 Relative transcript levels of shadeinduced marker genes in Col 0 and Knox 10 plants in response to different light treatments. Error bars represent S.E.M of three individual plants Different letters represent statistically different means ( p < 0.05). 106

PAGE 107

Figure 4 7 Genetic relationships between RL induced hypocotyl ra ndomizationresponse (HRR) and increasedhyponastic growth. (A) P etiole angles of Col 0, Knox 10, F2UP ( upright seedlings in RL induced HRR), and F2DOWN ( flat seedlings in RL induced HRR) plants under different light treatments, n (B) P etiole/leaf l ength ratio of Col 0, Knox 10, F2UP, and F2 DOWN n 1 8. Different letters represent statistically different means ( p < 0.05) E rror bars represent S.E.M. 107

PAGE 108

Figure 4 8 The RL regulated amyloplast development is normal in Knox 10 ecotype. Representative I2KI staining patterns in the endodermis of dark grown and RL grown Col 0 and Knox 108

PAGE 109

CHAPTER 5 CONCLUSIONS AND FUTURE DIRECTIONS The s tudy of GL photobiology is a c hallenging endeavor One obstacle in this research is that multiple photosensory systems can be activated or inactivated by GL wavelengths. Thus, the interpretation of p henotypic responses to GL illumination becomes complicated and should be approached cau tiously Work presented in Chapter 2 demonstrated these challenges. The original rational e for that study was to examine the interactions between GL and RL/FrL in the regulation of early photomorphogenic events. By the use of highresolution imaging system such interactions could be illustrated with great precision for time and spatial position. At first, it was surprising to find that GL actually can suppress RL/FrLinduced hypocotyl inhibition. Before this study, reports have shown that GL can at tenuate the long term hypocotyl inhibition induced by low RL and BL coirradiation ( Folta, 2004) Later studies indicate that this effect was actually mediated by GL inactivation of cry receptors ( Bouly et al., 2007) The cry receptors serve as the GL: BL ratio sensor s to regulate plant growth and development in natural light environments ( Sellaro et al., 2010) The role of GL negation of the RLinduced stem inhibition has not been reported. This response is not likely mediated by inactivation of cry, since cry receptors have a limited role in the RLinduced stem inhibitio n. The genetic tests of this GL negation of RL stem response further excluded this possibility. The finding that phot1 is mediating this GL effect is unexpected, leading to a complicated situation that was difficult to interpret The simple explanation is that phot1 was actively responding to a small amount of BL from the l ower end spectrum of green LED light, and it was confirmed when GL was replaced by dim BL. This result finally solved the puzzle, but it also 109

PAGE 110

pinpoints another obstacle in GL photobiology research: the presence of small amounts of blue and yellow light from GL spectrum distribution. Development of better light source with narrow bandwidth would reduce this type of contamination and misinterpretation. BL has been always considered to inhibit hypocotyl growth and promote photomorphogenesis. Work presented i n Chapter s 2 and 3 demonstrated that it is not always the case. Under certain light conditions, such as RL/FrL with dim BL, BL can actually delay the photomorphogenic process induced by RL/FrL through the action of phot1 at least for hours (Fig. 2 1, 2 4, 3 2) In the long term (days), this attenuation is antagonized by cry and leading to a shorter hypocotyl in dim BL and RL than that in RL alone (Fig. 3 1 D ). One thing should be noticed is that the longer hypocotyl observed in GL and RL coirradiation comp ared to RL alone (Fig. 21) could not be regenerated by supplement ing of dim BL to RL, even in the cry2 or cry1cry2 mutant backgrounds. If the long term GL negation of RLinduced stem inhibition was simply a result of activation of phot1 and inactivation of cry by GL, we would expect the same result when it was tested with dim BL and RL in cry mutant background s. Thus, it seems to suggest other factors unique to GL might mediate this additional effect of hypocotyl elongation promotion. Under BL, those fact ors might not be activated. Such hypotheses need to be tested in future studies. The p lant hormone auxin has been shown to play important roles in plant tropism responses and stem elongation. Work presented in Chapter 3 demonstrates the possible involvement of auxin in the mediation of the BL suppression of RL induced hypocotyl inhibition and apical hook opening events (Fig. 34, 3 5 F ). The transport of 110

PAGE 111

auxin from cell to cell is partly mediated by its transporters. Those transporters functionally may over lap with each other depending on their expression patterns and cellular localization. The functional redundancies of these transporters may explain why there was no complete abolishment of the BL negation effect on RL in single transporter mutant backgroun ds. Tests in higher order transporter mutants may help to illustrate the roles of each transporter in the mediation of this BL effect. Utilization of genetic variation found in Arabidopsis ecotypes could provide an alternative path that mi ght lead to the discovery of GLsignaling components. GL affects many plant responses in a way that seems to be diametric to other photosensory systems (Chapter 1). Such effects may confer plants with an adaptive advantage in specific light environments. Test of the GLsti mulated stem response among naturally occurring variants may help identify candidates that are not properly responding to GL. Studies performed in Chapter 4 present one of such candidate, Knox 10. The Knox 10 accession responded to different wavebands phenotypically similar to Col0. However, it showed defective RLinduced h ypocotyl r andomizationresponse (HRR) besides the reduced GLresponse. Even in the dark grown conditions, Knox 10 seedlings still exhibited less HRR than Col0. These results indicate th at the reduced HRR in Knox 10 is actually not specific to RL. RL illumination seems to better present the defect in Knox 10 accession. Studies on the transcriptional regulation of shade induced marker genes further support such reasoning, because Knox 10 r esponded normally to the RL signal. The genetic variation causing this altered HRR response probably results from a gene that specifically controls u p right plant growth. The whole genome sequencing of the bulkedF2 segregates is currently underway. Meanwhi le, the transcriptional differences 111

PAGE 112

among Knox 10, Col 0, and the F3 plants (Knox 10 phenotype in the HRR test ) under dark and RL conditions are being generated through an RNA seq method. When t hese two methods are combined, we might be able to identify the candidate genes that are responsible for the defective GL response and reduced HRR response. The increasedhyponastic growth in Knox 10 plants may be eco physiologically significant. The elongated stem and petiole might increase the possibility that the emerging seedlings or juvenile plants would reach a better photosynthetic light condition as quickly as possible In addition, the increasedhypocotyl growth and normal phototropic response may compensate for the defective phy mediated HRR if the latter af fects the fitness of Knox 10 plants T he connections between th e reduced HRR and the increasedhyponastic growth in Knox 10 plants are of interest to investigate. However, the preliminary result of this test was inconclusive. All F2 plan ts showed Knox 10l ike petiole angles which are all smaller than that of Col 0 plants Since F2 plants are in Knox 10 genetic background, a reciprocal cross has been made to test whether this is resulted from the effects of genetic background. 112

PAGE 113

LIST OF REFERENCES AHMAD, M., and A. CASHMORE. 1993. HY4 gene of A. thaliana encodes a protein with characteristics of a blue light photoreceptor. Nature 366: 162. AHMAD, M., and A. R. CASHMORE. 1997. The bluelight receptor cryptochrome 1 shows functional dependence on phytochrome A or phytochrome B in Arabidopsis thaliana. The Plant Journal 11: 421427. AHMAD, M., N. GRANCHER, M. HEIL, R. C. BLACK, B. GIOVANI, P. GALLAND, and D. LARDEMER. 2002. Action spectrum for cryptochromedependent hypocotyl growth inhibit ion in Arabidopsis. Plant Physiology 129: 774785. AHMAD, M., C. LIN, and A. R. CASHMORE. 1995. Mutations throughout an Arabidopsis bluelight photoreceptor impair bluelight responsive anthocyanin accumulation and inhibition of hypocotyl elongation. The Plant Journal 8: 653658. ALLEN, T., P. J. INGLES, U. PRAEKELT, H. SMITH, and G. C. WHITELAM. 2006. Phytochromemediated agravitropism in Arabidopsis hypocotyls requires GIL1 and confers a fitness advantage. The Plant Journal 46: 641648. ALONSOBLANCO, C., M. AARTS, L. BENTSINK, J. KEURENTJES, M. REYMOND, D. VREUGDENHIL, and M. KOORNNEEF. 2009. What has natural variation taught us about pl ant development, physiology, and adaptation? The Plant Cell Online 21: 1877. ALONSOBLANCO, C., and M. KOORNNEEF. 2000. Naturally occurring variation in Arabidopsis: an underexploited resource for plant genetics. Trends in Plant Science 5: 2229. AUKERMAN, M. J., M. HIRSCHFELD, L. WESTER, M. WEAVER, T. CLACK, R. M. AMASINO, and R. A. SHARROCK. 1997. A deletion in the PHYD gene of the Arabidopsis Wassilewskija ecotype defines a role for phytochrome D in red/far red light sensing. The Plant Cell Online 9: 1317. BAE, G., and G. CHOI. 2008. Decoding of light signals by plant phytochromes and their interacting proteins. Annu. Rev. Plant Biol. 59: 281311. BAILEYSERRES, J., and L. VOESENEK. 2008. Flooding stress: acclimations and genetic diversity. Annu. Rev. Plant Biol. 59: 313 339. BALASUBRAMANIAN, S., S. SURESHKUMAR, M. AGRAWAL, T. P. MICHAEL, C. WESSINGER, J. N. MALOOF, R. CLARK, et al. 2006. The PHYTOCHROME C photoreceptor gene mediates natural variation in flowering and growth responses of Arabidopsis thalia na. Nat Genet 38: 711 715. 113

PAGE 114

BALLAR, C. L., J. J. CASAL, and R. E. KENDRICK. 1991. Responses of l ight g rown w ild t ype and l ong h ypocotyl m utant c ucumber seedlings to n atural and simulated shade l ight. Photochemistry and Photobiology 54: 819826. BALLAR, C. L., A. L. SCOPEL, and R. A. SNCHEZ. 1991. Photocontrol of stem elongation in plant neighbourhoods: effects of photon fluence rate under natural conditions of radiation. Plant, Cell & Environment 14: 5765. BANERJEE, R., E. SCHLEICHER, S. MEIER, R. M. VIA NA, R. POKORNY, M. AHMAD, R. BITTL, et al. 2007. The Signaling State of Arabidopsis Cryptochrome 2 Contains Flavin Semiquinone. Journal of Biological Chemistry 282: 1491614922. BAUDRY, A., S. ITO, Y. H. SONG, A. A. STRAIT, T. KIBA, S. LU, R. HENRIQUES, et al. 2010. F b ox p roteins FKF1 and LKP2 a ct in concert with ZEITLUPE to control Arabidopsis clock p rogression. The Plant Cell Online 22: 606622. BENNETT, M. J., A. MARCHANT, H. G. GREEN, S. T. MAY, S. P. WARD, P. A. MILLNER, A. R. WALKER, et al. 1996. Ara bidopsis AUX1 Gene: A p ermeasel ike r egulator of r oot g ravitropism. Science 273: 948950. BOCCALANDRO, H. E., S. N. DE SIMONE, A. BERGMANNHONSBERGER, I. SCHEPENS, C. FANKHAUSER, and J. J. CASAL. 2008. PHYTOCHROME KINASE SUBSTRATE1 regulates root phototropism and gravitropism. Plant Physiology 146: 108115. BORTHWICK, H. A., S. B. HENDRICKS, M. W. PARKER, E. H. TOOLE, and V. K. TOOLE. 1952. A reversible photoreaction controlling seed germination. Proceedings of the National Academy of Sciences 38: 662666. BOULY, J. P., E. SCHLEICHER, M. DIONISIOSESE, F. VANDENBUSSCHE, D. VAN DER STRAETEN, N. BAKRIM, S. MEIER, et al. 2007. Cryptochrome b lue l ight p hotoreceptors a re a ctivated through i nterconversion of f lavin r edox states. Journal of Biological Chemistry 282: 93839391. BRIGGS, W. R., C. F. BECK, A. R. CASHMORE, J. M. CHRISTIE, J. HUGHES, J. A. JARILLO, T. KAGAWA, et al. 2001. The p hototropin f amily of p hotoreceptors. The Plant Cell Online 13: 993997. BUTLER, W. L., K. NORRIS, H. SIEGELMAN, and S. HENDRICKS. 1959. Detection, assay, and preliminary purification of the pigment controlling photoresponsive development of plants. Proceedings of the National Academy of Sciences of the United States of America 45: 1703. CARABELLI, M., G. MORELLI, G. WHITELAM, and I. RUBERTI. 1996. Twilight zone and canopy shade induction of the Athb2 homeobox gene in green plants. Proceedings of the National Academy of Sciences of the United States of America 93: 3530. 114

PAGE 115

CASAL, J. J. 2000. Phytochromes, cryptochromes, phototropin: photoreceptor interactions in plants. Photochemistry and Photobiology 71: 1 11. CASAL, J. J., and M. A. MAZZELLA. 1998. Conditional Synergism between Cryptochrome 1 and Phytochrome B Is Shown by the Analysis of phyA, phyB, andhy4 Simple, Double, and Triple Mutants in Arabidopsis. Plant Physiology 118: 19. CHATTERJEE, M., P. SHARMA, and J. P. KHURANA. 2006. Cryptochrome 1 from Brassica napus is upregulated by blue light and controls hypocotyl/stem growth and anthocyanin accumulation. Plant Physiology 141: 617 4. CHEN, M., J. CHORY, and C. FANKHAUSER. 2004. Light signal transduction in higher plants. Annual Review of Genetics 38: 87. CHRISTIE, J. M. 2007. Phototropin bluelight receptors Annual Review of Plant Biology 58: 2145. CHRISTIE, J. M., A. S. ARVAI, K. J. BAXTER, M. HEILMANN, A. J. PRATT, A. O' HARA, S. M. KELLY, et al. 2012. Plant UVR8 photoreceptor senses UV B by tryptophanmediated disruption of cross dimer salt bridges. Science Signaling 335: 1492. CHRISTIE, J. M., P. REYMOND, G. K. POWELL, P. BERNAS CONI, A. A. RAIBEKAS, E. LISCUM, and W. R. BRIGGS. 1998. Arabidopsis NPH1: a flavoprotein with the properties of a photoreceptor for phototropism. Science 282: 1698 1701. CHRISTIE, J. M., M. SALOMON, K. NOZUE, M. WADA, and W. R. BRIGGS. 1999. LOV (light, o xygen, or voltage) domains of the bluelight photoreceptor phototropin (nph1): binding sites for the chromophore flavin mononucleotide. Proceedings of the National Academy of Sciences 96: 87798783. CHRISTIE, J. M., H. YANG, G. L. RICHTER, S. SULLIVAN, C. E. THOMSON, J. LIN, B. TITAPIWATANAKUN, et al. 2011. phot1 inhibition of ABCB19 primes lateral auxin fluxes in the shoot apex required for phototropism. PLoS biology 9: e1001076. CLACK, T., A. SHOKRY, M. MOFFET, P. LIU, M. FAUL, and R. A. SHARROCK. 2009. O bligate heterodimerization of Arabidopsis phytochromes C and E and interaction with the PIF3 Basic Helix LoopHelix transcription factor The Plant Cell Online 21: 786799. CLOIX, C., and G. I. JENKINS. 2008. Interaction of the Arabidopsis UV B specific si gnaling component UVR8 with chromatin. Molecular Plant 1: 118 128. CLOUGH, R., and R. VIERSTRA. 1997. Phytochrome degradation. Plant, Cell & Environment 20: 713 721. COLLETT, C. E., N. P. HARBERD, and O. LEYSER. 2000. Hormonal interactions in the control o f Arabidopsis hypocotyl elongation. Plant Physiology 124: 553562. 115

PAGE 116

COX, M. C., F. F. MILLENAAR, Y. E. D. J. VAN BERKEL, A. J. PEETERS, and L. A. VOESENEK. 2003. Plant Movement. Submergenceinduced petiole elongation in Rumex palustris depends on hyponastic growth Plant Physiology 132: 282291. CZECHOWSKI, T., M. STITT, T. ALTMANN, M. K. UDVARDI, and W. R. SCHEIBLE. 2005. Genomew ide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiology 139: 51 7. DE CARBONNEL, M., P. DAVIS, M. R. G. ROELFSEMA, S.-I. INOUE, I. SCHEPENS, P. LARIGUET, M. GEISLER, et al. 2010. The Arabidopsis PHYTOCHROME KINASE SUBSTRATE2 protein is a phototropin signaling element that regulates leaf flattening and leaf positioning Plant Physiology 152: 13911405. DEMARSY, E., I. SCHEPENS, K. OKAJIMA, M. HERSCH, S. BERGMANN, J. CHRISTIE, K.-I. SHIMAZAKI, et al. 2012. Phytochrome Kinase Substrate 4 is phosphorylated by the phototropin 1 photoreceptor. The EMBO Journal 31: 34573467. DHINGRA, A., D. H. BIES, K. R. LEHNER, and K. M. FOLTA. 2006. Green light adjusts the plastid transcriptome during early photomorphogenic development. Plant Physiology 142: 1256. DING, Z., C. S. GALVANAMPUDIA, E. DEMARSY, L. LANGOWSKI, J. KLEINEVEHN, Y. FAN, M. T. MORITA, et al. 2011. Light mediated polarization of the PIN3 auxin transporter for the phototropic response in Arabidopsis. Nat Cell Biol 13: 447452. DOUGHER, T. A. O., and B. BUGBEE. 2001. Evidence for yellow light suppression of lettuce growt h Photochemistry and Photobiology 73: 208212. EDWARDS, K., C. JOHNSTONE, and C. THOMPSON. 1991. A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Research 19: 1349. ELASSAL, S. E. D., C. ALONSOBLANCO, A. J. M. PEETERS, V. RAZ, and M. KOORNNEEF. 2001. A QTL for flowering time in Arabidopsis reveals a novel allele of CRY2. Nature genetics 29: 435 440. EVANS, J. R., S. CAEMMERER, B. A. SETCHELL, and G. S. HUDSON. 1994. The relationship between CO2 transfer c onductance and leaf anatomy in transgenic tobacco with a reduced content of Rubisco. Functional Plant Biology 21: 475495. FANKHAUSER, C., K.C. YEH, J. CLARK, H. ZHANG, T. D. ELICH, and J. CHORY. 1999. PKS1, a substrate phosphorylated by phytochrome that modulates light signaling in Arabidopsis. Science 284: 15391541. FAVORY, J. J., A. STEC, H. GRUBER, L. RIZZINI, A. ORAVECZ, M. FUNK, A. ALBERT, et al. 2009. Interaction of COP1 and UVR8 regulates UV B induced photomorphogenesis and stress acclimation in A rabidopsis. The EMBO Journal 28: 591601. 116

PAGE 117

FILIAULT, D. L., C. A. WESSINGER, J. R. DINNENY, J. LUTES, J. O. BOREVITZ, D. WEIGEL, J. CHORY, et al. 2008. Amino acid polymorphisms in Arabidopsis phytochrome B cause differential responses to light. Proceedings of the National Academy of Sciences 105: 3157 3162. FOLTA, K. 2004. Green light stimulates early stem elongation, antagonizing light mediated growth inhibition. Plant Physiology 135: 1407. FOLTA, K. M., and L. S. KAUFMAN. 2003. Phototropin 1 is required fo r high fluence bluelight mediated mRNA destabilization. Plant Molecular Biology 51: 609618. FOLTA, K. M., E. J. LIEG, T. DURHAM, and E. P. SPALDING. 2003a. Primary inhibition of hypocotyl growth and phototropism depend differently on phototropinmediated increases in cytoplasmic calcium induced by blue light Plant Physiology 133: 14641470. FOLTA, K., and S. MARUHNICH. 2007. Green light: a signal to slow down or stop. Journal of experimental botany FOLTA, K. M., and E. P. SPALDING. 2001a. Unexpected rol es for cryptochrome 2 and phototropin revealed by highresolution analysis of blue light mediated hypocotyl growth inhibition. The Plant Journal 26: 471478. FOLTA, K. M., and E. P. SPALDING. 2001b. Opposing roles of phytochrome A and phytochrome B in earl y cryptochrome mediated growth inhibition. The Plant Journal 28: 333340. FOLTA, K. M., M. A. PONTIN, G. KARLINNEUMANN, R. BOTTINI, and E. P. SPALDING. 2003b. Genomic and physiological studies of early cryptochrome 1 action demonstrate roles for auxin and gibberellin in the control of hypocotyl growth by blue light. The Plant Journal 36: 203214. FRANKLIN, K. A. 2008. Shade avoidance. New Phytologist 179: 930 944. FRANKLIN, K., and P. QUAIL. 2010. Phytochrome functions in Arabidopsis development. Journal of experimental botany 61: 11. FRECHILLA, S., L. D. TALBOTT, R. A. BOGOMOLNI, and E. ZEIGER. 2000. Reversal of blue light stimulated stomatal opening by green light. Plant and Cell Physiology 41: 171. FRIML, J., J. W, E. BENKOV, K. MENDGEN, and K. PALME. 2002. Lateral relocation of auxin efflux regulator PIN3 mediates tropism in Arabidopsis. Nature 415: 806. GILIBERTO, L., G. PERROTTA, P. PALLARA, J. L. WELLER, P. D. FRASER, P. M. BRAMLEY, A. FIORE, et al. 2 005. Manipulation of the blue light photoreceptor cryptochrome 2 in 117

PAGE 118

tomato affects vegetative development, flowering time, and fruit antioxidant content Plant Physiology 137: 199208. GOGGIN, D. E., and K. J. STEADMAN. 2012. Blue and green are frequently seen: Responses of seeds to short and midwavelength light. Seed Science Research 22: 2735. GOGGIN, D. E., K. J. STEADMAN, and S. B. POWLES. 2008. Green and blue light photoreceptors are involved in maintenance of dormancy in imbibed annual ryegrass (Loli um rigidum) seeds. New Phytologist 180: 8189. GOTO, N., K. T. YAMAMOTO, and M. WATANABE. 1993. Action spectra for inhibition of hypocotyl growth of wildtype plants and of the hy2 long hypocotyl mutant of Arabidopsis thaliana L. Photochemistry and Photobi ology 57: 867 871. GUO, H., H. YANG, T. C. MOCKLER, and C. LIN. 1998. Regulation of flowering time by Arabidopsis photoreceptors Science 279: 1360 1363. HAGA, K., and T. SAKAI. 2012. PIN auxin efflux carriers are necessary for pulseinduced but not continuous light induced phototropism in Arabidopsis. Plant Physiology 160: 763776. HAN, I.S., T.S. TSENG, W. EISINGER, and W. R. BRIGGS. 2008. Phytochrome A regulates the intracellular distribution of phototropin 1 green fluorescent protein in Arabidopsis thaliana. The Plant Cell Online 20: 28352847. HARTMANN, K. M. 1967. Phytochrome 730 (P fr), the effector of the high energy photomorphogenic reaction in the far red region. Naturwissenschaften 54: 544544. HEIJDE, M., and R. ULM. 2013. Reversion of the Arabidopsis UV B photoreceptor UVR8 to the homodimeric ground state. Proceedings of the National Academy of Sciences 110: 1113 1118. HEILMANN, M., and G. I. JENKINS. 2013. Rapid reversion from monomer to dimer regenerates the Ultraviolet B photoreceptor UV RE SISTANCE LOCUS8 in Intact Arabidopsis p lants. Plant Physiology 161: 547 555. HOLLAND, J. J., D. ROBERTS, and E. LISCUM. 2009. Understanding phototropism: from Darwin to today. Journal of experimental botany 60: 19691978. HOPKINS, R., J. SCHMITT, and J. R. STINCHCOMBE. 2008. A latitudinal cline and response to vernalization in leaf angle and morphology in Arabidopsis thaliana (Brassicaceae). New Phytologist 179: 155164. HUALA, E., P. W. OELLER, E. LISCUM, I.S. HAN, E. LARSEN, and W. R. BRIGGS. 1997. Arabi dopsis NPH1: a protein kinase with a putative redox sensing domain. Science 278: 2120 2123. 118

PAGE 119

HUQ, E., B. ALSADY, and P. H. QUAIL. 2003. Nuclear translocation of the photoreceptor phytochrome B is necessary for its biological function in seedling photomorphogenesis. The Plant Journal 35: 660664. IMAIZUMI, T., T. F. SCHULTZ, F. G. HARMON, L. A. HO, and S. A. KA Y. 2005. FKF1 F Box protein mediates cyclic degradation of a repressor of CONSTANS in Arabidopsis. Science 309: 293297. IMAIZUMI, T., H. G. TRAN, T. E. SWARTZ, W. R. BRIGGS, and S. A. KAY. 2003. FKF1 is essential for photoperiodic specific light signallin g in Arabidopsis. Nature 426: 302306. JANOUDI, A., W. R. GORDON, D. WAGNER, P. QUAIL, and K. L. POFF. 1997. Multiple phytochromes are involved in redlight induced enhancement of first positive phototropism in Arabidopsis thaliana. Plant Physiology 113: 9 75979. JANOUDI, A. K., and K. L. POFF. 1992. Action spectrum for enhancement of phototropism by Arabidopsis thaliana seedlings. Photochemistry and Photobiology 56: 655659. JENSEN, P. J., R. P. HANGARTER, and M. ESTELLE. 1998. Auxin transport is required for hypocotyl elongation in light grown but not dark grown Arabidopsis Plant Physiology 116: 455462. KAGAWA, T., T. SAKAI, N. SUETSUGU, K. OIKAWA, S. ISHIGURO, T. KATO, S. TABATA, et al. 2001. Arabidopsis NPL1: a phototropin homolog controlling the chlor oplast highlight avoidance response. Science 291: 2138. KAISERLI, E., and G. I. JENKINS. 2007. UV B promotes rapid nuclear translocation of the Arabidopsis UV B specific signaling component UVR8 and activates its function in the nucleus. The Plant Cell Online 19: 26622673. KAMI, C., M. HERSCH, M. TREVISAN, T. GENOUD, A. HILTBRUNNER, S. BERGMANN, and C. FANKHAUSER. 2012. Nuclear phytochrome A signaling promotes phototropism in Arabidopsis. The Plant Cell Online 24: 566576. KAMI, C., S. LORRAIN, P. HORNITS CHEK, and C. FANKHAUSER. 2010. Light regulated plant growth and development. Current Topics in Developmental Biology 91: 2966. KARLSSON, P. E. 1986. Blue light regulation of stomata in wheat seedlings. II. Action spectrum and search for action dichroism. Physiologia Plantarum 66: 207210. KASAJIMA, S. -Y. N. INOUE, and R. MAHMUD. 2009. Response spectrum for green light induced acceleration of heading in wheat cv. Norin 61. Plant production science 12: 5457. 119

PAGE 120

KASAJIMA, S. -Y. N. INOUE, R. MAHMUD, K. FUJITA, and M. KATO. 2007. Effect of light quality on developmental rate of wheat under continuous light at a constant temperature. Plant production science 10: 286 291. KASAJIMA, S. -Y. N. INOUE, R. MAHMUD, and M. KATO. 2008. Developmental responses of wheat cv. Norin 61 to fluence rate of green light. Plant production science 11: 7681. KENNIS, J. T., S. CROSSON, M. GAUDEN, I. H. VAN STOKKUM, K. MOFFAT, and R. VAN GRONDELLE. 2003. Primary reactions of the LOV2 domain of phototropin, a plant bluelight photoreceptor. Biochemistry 42: 33853392. KERR, I. D., and M. J. BENNETT. 2007. New insight into the biochemical mechanisms regulating auxin transport in plants. Biochemical Journal 401: 613. KEUSKAMP, D. H., R. SASIDHARAN, I. VOS, A. J. M. PEETERS, L. A. C. J. VOE SENEK, and R. PIERIK. 2011. Blue light mediated shade avoidance requires combined auxin and brassinosteroid action in Arabidopsis seedlings. The Plant Journal 67: 208 217 KIM, H. H., G. D. GOINS, R. M. WHEELER, and J. C. SAGER. 2004a. Stomatal conductance of lettuce grown under or exposed to different light qualities Annals of Botany 94: 691 697. KIM, H. H., G. D. GOINS, R. M. WHEELER, and J. C. SAGER. 2004a. 2004b. Greenlight supplementation for enhanced lettuce growth under redand bluelight emitting diodes HortScience 39: 16171622. KIM, K., J. SHIN, S. LEE, H. KWEON, J. MALOOF, and G. CHOI. 2011. Phytochromes inhibit hypocotyl negative gravitropism by regulating the development of endodermal amyloplasts through phytochromeinteracting factors. Proc eedings of the National Academy of Sciences 108: 1729. KIM, W. Y., S. FUJIWARA, S.S. SUH, J. KIM, Y. KIM, L. HAN, K. DAVID, et al. 2007. ZEITLUPE is a circadian photoreceptor stabilized by GIGANTEA in blue light. Nature 449: 356360. KIMURA, M., and T. KA GAWA. 2006. Phototropin and light signaling in phototropism. Current Opinion in Plant Biology 9: 503 508. KINOSHITA, T., M. DOI, N. SUETSUGU, T. KAGAWA, M. WADA, and K. SHIMAZAKI. 2001. Phot1 and phot2 mediate blue light regulation of stomatal opening. Nat ure 414: 656660. KLEIN, R. M. 1964. Repression of tissue culture growth by visible and near visible radiation. Plant Physiology 39: 536. KLEIN, R. M., P. C. EDSALL, and A. C. GENTILE. 1965. Effects of near ultraviolet and green radiations on plant growth. Plant Physiology 40: 903. 120

PAGE 121

KLIEBENSTEIN, D. J., J. E. LIM, L. G. LANDRY, and R. L. LAST. 2002. Arabidopsis UVR8 regulates ultraviolet B signal transduction and tolerance and contains sequence similarity to human regulator of chromatin condensation 1. Plant Physiology 130: 234243. KOINI, M. A., L. ALVEY, T. ALLEN, C. A. TILLEY, N. P. HARBERD, G. C. WHITELAM, and K. A. FRANKLIN. 2009. High temperaturemediated adaptations in plant architecture require the bHLH transcription factor PIF4. Current Biology 19: 408413. KONG, S. G., T. SUZUKI, K. TAMURA, N. MOCHIZUKI, I. HARA NISHIMURA, and A. NAGATANI. 2006. Blue light induced association of phototropin 2 with the Golgi apparatus. The Plant Journal 45: 9941005. KOORNNEEF, M., C. ALONSOBLANCO, and D. VREUGDENHIL. 2004. Naturally occurring genetic variation in A rabidopsis thaliana. Annual Review of Plant Biology 55: 141172. KOORNNEEF, M., E. ROLFF, and C. SPRUIT. 1980. Genetic control of light inhibited hypocotyl elongation in Arabidopsis thaliana (L.) Heynh. Zei tschrift fr pflanzenphysiologie 100: 147160. LARIGUET, P., H. E. BOCCALANDRO, J. M. ALONSO, J. R. ECKER, J. CHORY, J. J. CASAL, and C. FANKHAUSER. 2003. A growth regulatory loop that provides homeostasis to phytochrome A signaling The Plant Cell Online 15: 29662978. LARIGUET, P., and C. FANKHAUSER. 2004. Hypocotyl growth orientation in blue light is determined by phytochrome A inhibition of gravitropism and phototropin promotion of phototropism. The Plant Journal 40: 826834. LARIGUET, P., I. SCHEPENS, D. HODGSON, U. V. PEDMALE, M. TREVISAN, C. KAMI, M. DE CARBONNEL, et al. 2006. PHYTOCHROME KINASE SUBSTRATE 1 is a phototropin 1 binding protein required for phototropism. Proceedings of the National Academy of Sciences 103: 1013410139. LEHMAN, A., R. BLA CK, and J. R. ECKER. 1996. HOOKLESS1, an ethylene response gene, is required for differential cell elongation in the Arabidopsis hypocotyl. Cell 85: 183. LEISHMAN, M. R., and M. WESTOBY. 1994. The role of seed size in seedling establishment in dry soil conditions --experimental evidence from semi arid species. Journal of Ecology : 249258. LIN, C., M. AHMAD, and A. R. CASHMORE. 1996. Arabidopsis cryptochrome 1 is a soluble protein mediating blue light dependent regulation of plant growth and development. The Plant Journal 10: 893902. 121

PAGE 122

LIN, C., D. E. ROBERTSON, M. AHMAD, A. A. RAIBEKAS, M. S. JORNS, P. L. DUTTON, and A. R. CASHMORE. 1995. Association of flavin adenine dinucleotide with the Arabidopsis blue light receptor CRY1. Science 269: 968970. LIN, C., and D. SHALITIN. 2003. Cryptochrome structure and signal transduction. Annual Review of Plant Biology 54: 469496. LIN, C., H. YANG, H. GUO, T. MOCKLER, J. CHEN, and A. R. CASHMORE. 1998. Enhancement of blue light sensitivity of Arabidopsis seedlings by a blue light receptor cryptochrome 2. Proceedings of the National Academy of Sciences 95: 26862690. LISCUM, E., and W. R. BRIGGS. 1995. Mutations in the NPH1 locus of Arabidopsis disrupt the perception of phototropic stimuli The Plant Cell Online 7: 473485. LISCUM, E., and R. P. HANGARTER. 1993a. Genetic evidence that the redabsorbing form of phytochrome B modulates gravitropism in Arabidopsis thaliana. Plant Physiology 103: 15. LISCUM, E., and R. P. HANGARTER. 1993b. Light Stimulated Apical Hook Opening in Wild Type Arabidopsis thaliana Seedlings. Plant Physiology 101: 567572. LIU, H., B. LIU, C. ZHAO, M. PEPPER, and C. LIN. 2011. The action mechanisms of plant cryptochromes. Trends in Plant Science 16: 684691. LIVAK, K. J., and T. D. SCHMITTGEN. 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2 m ethod. M ethods 25: 402 408. LUZURIAGA, A., A. ESCUDERO, and F. PREZGARCA. 2006. Environmental maternal eff ects on seed morphology and germination in Sinapis arvensis (Cruciferae). Weed Research 46: 163174. LYNN, D., and S. WALDREN. 2001. Morphological variation in populations of Ranunculus repens from the temporary limestone lakes (turloughs) in the west of I reland. Annals of Botany 87: 917. LYNN, D., and S. WALDREN. 2002. Physiological variation in populations of Ranunculus repens L.(creeping buttercup) from the temporary limestone lakes (turloughs) in the west of Ireland. Annals of Botany 89: 707 714. MALOO F, J. N., J. O. BOREVITZ, T. DABI, J. LUTES, R. B. NEHRING, J. L. REDFERN, G. T. TRAINER, et al. 2001. Natural variation in light sensitivity of Arabidopsis. Nature genetics 29: 441 446. MARCHANT, A., R. BHALERAO, I. CASIMIRO, J. EKLF, P. J. CASERO, M. BE NNETT, and G. SANDBERG. 2002. AUX1 promotes lateral root formation by facilitating indole3 acetic acid distribution between sink and source tissues in the Arabidopsis seedling The Plant Cell Online 14: 589 597. 122

PAGE 123

MARCHANT, A., J. KARGUL, S. T. MAY, P. MULL ER, A. DELBARRE, C. PERROTRECHENMANN, and M. J. BENNETT. 1999. AUX1 regulates root gravitropism in Arabidopsis by facilitating auxin uptake within root apical tissues. The EMBO Journal 18: 20662073. MAS, P., P. F. DEVLIN, S. PANDA, and S. A. KAY. 2000. F unctional interaction of phytochrome B and cryptochrome 2. Nature 408: 207211. MAS, P., W. Y. KIM, D. E. SOMERS, and S. A. KAY. 2003. Targeted degradation of TOC1 by ZTL modulates circadian function in Arabidopsis thaliana. Nature 426: 567570. MGLICH, A ., X. YANG, R. A. AYERS, and K. MOFFAT. 2010. Structure and function of plant photoreceptors. Annual Review of Plant Biology 61: 21 47. MOMMER, L., H. DE KROON, R. PIERIK, G. M. BGEMANN, and E. J. W. VISSER. 2005. A functional comparison of acclimation to shade and submergence in two terrestrial plant species. New Phytologist 167: 197206. MORITA, M. T., and M. TASAKA. 2004. Gravity sensing and signaling. Current Opinion in Plant Biology 7: 712718. MOTCHOULSKI, A., and E. LISCUM. 1999. Arabidopsis NPH3: a NPH1 photoreceptor interacting protein essential for phototropism. Science Signaling 286: 961. MOURADOV, A., F. CREMER, and G. COUPLAND. 2002. Control of flowering time: interacting pathways as a basis for diversity. The Plant Cell Online 14: S111S130. NAGASHIMA, A., G. SUZUKI, Y. UEHARA, K. SAJI, T. FURUKAWA, T. KOSHIBA, M. SEKIMOTO, et al. 2008. Phytochromes and cryptochromes regulate the differential growth of Arabidopsis hypocotyls in both a PGP19dependent and a PGP19independent manner. The Plant Journal 53: 516529. NAGASHIMA, A., Y. UEHARA, and T. SAKAI. 2008. The ABC s ubfamily B a uxin t ransporter AtABCB19 is Involved in the i nhibitory e ffects of N 1 Naphthyphthalamic Acid on the p hototropic and g ravitropic r esponses of Arabidopsis h ypocotyls. Plan t and Cell Physiology 49: 12501255. NISHIO, J. N. 2000. Why are higher plants green? Evolution of the higher plant photosynthetic pigment complement. Plant, Cell & Environment 23: 539548. NOH, B., A. BANDYOPADHYAY, W. A. PEER, E. P. SPALDING, and A. S. MURPHY. 2003. Enhanced gravi and phototropism in plant mdr mutants mislocalizing the auxin efflux protein PIN1. Nature 423: 9991002. 123

PAGE 124

PARKS, B. M., M. H. CHO, and E. P. SPALDING. 1998. Two genetically separable phases of growth inhibition induced by blue li ght in Arabidopsis seedlings. Plant Physiology 118: 609615. PARKS, B. M., K. M. FOLTA, and E. P. SPALDING. 2001. Photocontrol of stem growth. Current Opinion in Plant Biology 4: 436 440. PARKS, B. M., and P. H. QUAIL. 1993. hy8, a new class of arabidopsis long hypocotyl mutants deficient in functional phytochrome A. The Plant Cell Online 5: 3948. PARKS, B. M., P. H. QUAIL, and R. P. HANGARTER. 1996. Phytochrome A regulates redlight induction of phototropic enhancement in Arabidopsis. Plant Physiology 110 : 155162. PARKS, B. M., and E. P. SPALDING. 1999. Sequential and coordinated action of phytochromes A and B during Arabidopsis stem growth revealed by kinetic analysis. Proceedings of the National Academy of Sciences of the United States of America 96: 14 142. PIERIK, R., G. C. WHITELAM, L. A. C. J. VOESENEK, H. DE KROON, and E. J. W. VISSER. 2004. Canopy studies on ethyleneinsensitive tobacco identify ethylene as a novel element in blue light and plant plant signalling. The Plant Journal 38: 310 319. PORR A, R. J., W. A. THOMPSON, and P. E. KRIEDEMANN. 1989. Determination of accurate extinction coefficients and simultaneous equations for assaying chlorophylls a and b extracted with four different solvents: verification of the concentration of chlorophyll st andards by atomic absorption spectroscopy. Biochimica et Biophysica Acta (BBA) Bioenergetics 975: 384394. QUAIL, P. H., W. R. BRIGGS, J. CHORY, R. P. HANGARTER, N. P. HARBERD, R. E. KENDRICK, M. KOORNNEEF, et al. 1994. Spotlight on p hytochrome n omenclat ure. The Plant Cell Online 6: 468471. RAKUSOV, H., J. GALLEGOBARTOLOM, M. VANSTRAELEN, H. S. ROBERT, D. ALABAD, M. A. BLZQUEZ, E. BENKOV, et al. 2011. Polarization of PIN3dependent auxin transport for hypocotyl gravitropic response in Arabidopsis t haliana. The Plant Journal : no no. RAZ, V., and J. R. ECKER. 1999. Regulation of differential growth in the apical hook of Arabidopsis. Development 126: 36613668. RICE, K. J., and A. R. DYER. 2001. Seed aging, delayed germination and reduced competitive ability in Bromus tectorum. Plant Ecology 155: 237243. RIZZINI, L., J.J. FAVORY, C. CLOIX, D. FAGGIONATO, A. O HARA, E. KAISERLI, R. BAUMEISTER, et al. 2011. Perception of UV B by the Arabidopsis UVR8 p rotein. Science 332: 103106. 124

PAGE 125

ROBSON, P. R. H., and H SMITH. 1996. Genetic and transgenic evidence that phytochromes A and B act to modulate the gravitropic orientation of Arabidopsis thaliana hypocotyls. Plant Physiology 110: 211. ROCKWELL, N. C., Y. S. SU, and J. C. LAGARIAS. 2006. Phytochome structure and signaling mechanisms Annual Review of Plant Biology 57: 837. RSLER, J., I. KLEIN, and M. ZEIDLER. 2007. Arabidopsis fhl/fhy1 double mutant reveals a distinct cytoplasmic action of phytochrome A. Proceedings of the National Academy of Sciences 104: 10737 10742. SAKAI, T., T. KAGAWA, M. KASAHARA, T. E. SWARTZ, J. M. CHRISTIE, W. R. BRIGGS, M. WADA, et al. 2001. Arabidopsis nph1 and npl1: blue light receptors that mediate both phototropism and chloroplast relocation. Proceedings of the National Academy of Sciences 98: 6969. SAKAI, T., T. WADA, S. ISHIGURO, and K. OKADA. 2000. RPT2: a signal transducer of the phototropic response in Arabidopsis. The Plant Cell Online 12: 225 236. SAKAMOTO, K., and W. R. BRIGGS. 2002. Cellular and subcellular localization of phototropin 1. The Plant Cell Online 14: 1723. SALTER, M. G., K. A. FRANKLIN, and G. C. WHITELAM. 2003. Gating of the rapid shadeavoidance response by the circadian clock in plants. Nature 426: 680683. SCHEPENS, I., H. E. BOCCALANDRO, C. KAMI, J. J. CASAL, and C. FANKHAUSER. 2008. PHYTOCHROME KINASE SUBSTRATE4 modulates phytochrome mediated control of hypocotyl growth orientation. Plant Physiology 147: 661671. SELLARO, R., M. CREPY, S. A. TRUPKIN, E. KARAYEKOV, A. S. BUCHOVSKY, C. ROSSI, and J. J. CASAL. 2010. Cryptochrome as a sensor of the blue/green ratio of natural radiation in Arabidopsis. Plant Physiology 154: 401409. SESSA, G., M. CARABELLI, M. SASSI, A. CIOLFI, M. POSSENTI, F. MITTEMPERGHER, J. BECKER, et al. 2005. A dynamic balance between gene activation and repression regulates the shade avoidance response in Arabidopsis. Genes & Development 19: 28112815. SHALITIN, D., H. YANG, T. C. MOCKLER, M. MAYMON, H. GUO, G. C. WHITELAM, and C. LIN. 2002. Regulation of Arabidopsis cryptochrome 2 by bluelight dependent phosphorylation. Nature 417: 763767. SHALITIN, D., X. YU, M. MAYMON, T. MOCKLER, and C. LIN. 2003. Blue light dependent in vivo and in vitro phosphorylation of Arabidopsis cryptochrome 1. The Plant Cell Online 15: 2421. SHARROCK, R. A., an d T. CLACK. 2002. Patterns of expression and normalized levels of the five Arabidopsis phytochromes Plant Physiology 130: 442456. 125

PAGE 126

SHARROCK, R. A., and T. CLACK. 2004. Heterodimerization of type II phytochromes in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America 101: 1150011505. SHIN, J., K. KIM, H. KANG, I. S. ZULFUGAROV, G. BAE, C. H. LEE, D. LEE, et al. 2009. Phytochromes promote seedling light responses by inhibiting four negatively acting phytochromeinteracting factors. Proceedings of the National Academy of Sciences 106: 7660 7665. SHINOMURA, T., A. NAGATANI, H. HANZAWA, M. KUBOTA, M. WATANABE, and M. FURUYA. 1996. Action spectra for phytochrome A and B specific photoinduction of seed germination in Arabidopsis thaliana. Proceedings of the National Academy of Sciences 93: 81298133. SMITH, H. 1995. Physiological and ecological function within the phytochrome family. Annual Review of Plant Biology 46: 289 315. SMITH, H., and G. WHITELAM. 1997. The shade avoi dance syndrome: multiple responses mediated by multiple phytochromes. Plant, Cell & Environment 20: 840844. SOMERS, D. E., and S. FUJIWARA. 2009. Thinking outside the F box: novel ligands for novel receptors. Trends in Plant Science 14: 206213. SOMERS, D E., R. A. SHARROCK, J. M. TEPPERMAN, and P. H. QUAIL. 1991. The hy3 long hypocotyl mutant of Arabidopsis is deficient in phytochrome B. The Plant Cell Online 3: 12631274. SPALDING, E., and K. FOLTA. 2005. Illuminating topics in plant photobiology. Plant Cell & Environment 28: 39 53. STEPHENSON, P. G., C. FANKHAUSER, and M. J. TERRY. 2009. PIF3 is a repressor of chloroplast development. Proceedings of the National Academy of Sciences 106: 76547659. STONE, B. B., E. L. STOWEEVANS, R. M. HARPER, R. B. CE LAYA, K. LJUNG, G. SANDBERG, and E. LISCUM. 2008. Disruptions in AUX1Dependent auxin influx alter hypocotyl phototropism in Arabidopsis. Molecular Plant 1: 129144. SUN, J., J. N. NISHIO, and T. C. VOGELMANN. 1998. Green light drives CO2 fixation deep wit hin leaves Plant and Cell Physiology 39: 10201026. TAKEMIYA, A., S.-I. INOUE, M. DOI, T. KINOSHITA, and K. -I. SHIMAZAKI. 2005. Phototropins promote plant growth in response to blue light in low light environments The Plant Cell Online 17: 11201127. TAL BOTT, L. D., G. NIKOLOVA, A. ORTIZ, I. SHMAYEVICH, and E. ZEIGER. 2002. Green light reversal of bluelight stimulated stomatal opening is found in a diversity of plant species. American journal of botany 89: 366. 126

PAGE 127

TEPPERMAN, J. M., M. E. HUDSON, R. KHANNA, T. ZHU, S. H. CHANG, X. WANG, and P. H. QUAIL. 2004. Expression profiling of phyB mutant demonstrates substantial contribution of other phytochromes to redlight regulated gene expression during seedling deetiolation. Plant Journal 38: 725739. TEPPERMAN, J. M., Y. S. HWANG, and P. H. QUAIL. 2006. phyA dominates in transduction of red light signals to rapidly responding genes at the initiation of Arabidopsis seedling deetiolation. Plant Journal 48: 728742. TEPPERMAN, J. M., T. ZHU, H. S. CHANG, X. WANG, and P. H. QUAIL. 2001. Multiple transcriptionfactor genes are early targets of phytochrome A signaling. Proceedings of the National Academy of Sciences of the United States of America 98: 94379442. TERASHIMA, I., T. FUJITA, T. INOUE, W. S. CHOW, and R. OGUCHI. 2009. Green Light drives leaf photosynthesis more efficiently than red light in strong white light: revisiting the enigmatic question of why leaves are green. Plant and Cell Physiology 50: 684 697. VALVERDE, F., A. MOURADOV, W. SOPPE, D. RAVENSCROFT, A. SAMACH, and G. COUPLAND. 2004. Photoreceptor r egulation of CONSTANS p rotein in p hotoperiodic f lowering. Science 303: 10031006. VAN ZANTEN, M., L. A. C. J. VOESENEK, A. J. M. PEETERS, and F. F. MILLENAAR. 2009. Hormoneand l ight m ediated r egulation o f heat induced differential petiole growth in Arabidopsis. Plant Physiology 151: 14461458. VANDENBUSSCHE, F., R. PIERIK, F. F. MILLENAAR, L. A. VOESENEK, and D. VAN DER STRAETEN. 2005. Reaching out of the shade. Current Opinion in Plant Biology 8: 462468 VANDENBUSSCHE, F., J. PETREK, P. DNKOV, K. HOYEROV, B. PEEK, V. RAZ, R. SWARUP, et al. 2010. The auxin influx carriers AUX1 and LAX3 are involved in auxinethylene interactions during apical hook development in Arabidopsis thaliana seedlings. Development 137: 597606. VANDENBUS SCHE, F., and D. VAN DER STRAETEN. 2004. Shaping the shoot: a circuitry that integrates multiple signals. Trends in Plant Science 9: 499506. WAN, Y., J. JASIK, L. WANG, H. HAO, D. VOLKMANN, D. MENZEL, S. MANCUSO, et al. 2012. The signal transducer NPH3 integrates the phototropin1 photosensor with PIN2based polar auxin transport in Arabidopsis root phototropism. The Plant Cell Online 24: 551565. WANG, L., I. V. UILECAN, A. H. ASSADI, C. A. KOZMIK, and E. P. SPALDING. 2009. HYPOTrace: image analysis software for measuring hypocotyl growth and shape demonstrated on Arabidopsis seedlings undergoing photomorphogenesis Plant Physiology 149: 16321637. 127

PAGE 128

WANG, Y., S. A. MARUHNICH, M. H. MAGEROY, J. R. JUSTICE, and K. M. FOLTA. 2013. Phototropin 1 and cryptochrome action in response to green light in combination with other wavelengths. Planta 237: 225237. WENT, F. W. 1957. The experimental control of plant growth. Chronica Botanica,Waltham, MA, USA WHIPPO, C. W., and R. P. HANGARTER. 2003. Second positive phototropism results from coordinated coaction of the phototropins and cryptochromes Plant Physiology 132: 14991507. WU, G., J. N. CAMERON, K. LJUNG, and E. P. SPALDING. 2010. A role for ABCB19 mediated polar auxin transport in seedling photomorphogenesis mediated by cryptochrome 1 and phytochrome B. The Plant Journal 62: 179191. YANG, Y., U. Z. HAMMES, C. G. TAYLOR, D. P. SCHACHTMAN, and E. NIELSEN. 2006. High a ffinity a uxin t ransport by the AUX1 i nflux carrier p rotein. Current Biology 16: 11231127. YANG, Y. J., Z. C. ZUO, X. Y. ZHAO, X. LI, J. KLEJNOT, Y. LI, P. CHEN, et al. 2008. Bluelight independent activity of Arabidopsis cryptochromes in the regulation of steady state levels of protein and mRNA expression. Molecular Plant 1: 167177. YASUHARA, M., S. MITSUI, H. HIRANO, R. TAKANABE, Y. TOKIOKA, N. IHARA, A. KOMATSU, et al. 2004. Identification of ASK and clock associated proteins as molecular partners of LKP2 (LOV kelch protein 2) in Arabidopsis. Journal of experimental botany 55: 20152027. YOUNG, J. C., E. LISCUM, and R. P. HANGARTER. 1992. Spectral dependence of light inhibited hypocotyl elongation in photomorphogenic mutants of Arabidopsis: evidence for a UV A photosensor. Planta 188: 106114. YU, X., J. KLEJNOT, X. ZHAO, D. SHALITIN, M. MAYMON, H. YAN G, J. LEE, et al. 2007. Arabidopsis cryptochrome 2 completes its posttranslational life cycle in the nucleus The Plant Cell Online 19: 31463156. YU, X., R. SAYEGH, M. MAYMON, K. WARPEHA, J. KLEJNOT, H. YANG, J. HUANG, et al. 2009. Formation of nuclear bo dies of Arabidopsis cry2 in response to blue light is associated with its blue light dependent degradation. The Plant Cell Online 21: 118130. DNKOV, P., J. PETREK, P. MARHAV, V. RAZ, F. VANDENBUSSCHE, Z. DING, K. SCHWARZEROV, et al. 2010. Role of PIN mediated auxin efflux in apical hook development of Arabidopsis thaliana. Development 137: 607617. ZAMALOV, E., A. S. MURPHY, H. YANG, K. HOYEROV, and P. HOEK. 2010. Auxin transporters why so many? Cold Spring Harbor perspectives in biology 2. 128

PAGE 129

ZHANG, T., and K. M. FOLTA. 2012. Green light signaling and adaptive response. Plant Signaling & Behavior 7: 75 78. ZHANG, T., S. A. MARUHNICH, a nd K. M. FOLTA. 2011. Green light induces shade avoidance symptoms. Plant Physiology 157: 15281536. 129

PAGE 130

BIOGRAPHICAL SKETCH Yihai Wang grew up in Xinglong County 90 miles away from the Capital Beijing, China. Before came to the University of Florida for hi s doctorate study, he earned his bachelors degree in Plant Pathology at Agricultural University of Hebei and masters degree in Transgenic Plant Biosafety at Chinese Academy of Agricultural Sciences. He joined the Plant Molecular and Cellular Biology prog ram in 2009. Under the guidance of Dr. Kevin Folta in the Department of Horticultural Sciences, he conducted his research on GL photobiology, focusing on the interactions between GL and other photosensory systems, and the identification of potential GL signaling component from Arabidopsis natural variations. He received his Ph.D. from the University of Florida in the summer of 2013. 130