Citrus Canker Requires Targeting of a Susceptibility Gene by Specific TAL Effectors Present in Xanthomonas Citri

MISSING IMAGE

Material Information

Title:
Citrus Canker Requires Targeting of a Susceptibility Gene by Specific TAL Effectors Present in Xanthomonas Citri
Physical Description:
1 online resource (163 p.)
Language:
english
Creator:
Hu, Yang
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Plant Pathology
Committee Chair:
Jones, Jeffrey B
Committee Members:
Graham, James H, Jr
Song, Wen-Yuan
Wang, Nian

Subjects

Subjects / Keywords:
canker -- citrus -- cslob1 -- ptha4 -- tale -- xanthomonas
Plant Pathology -- Dissertations, Academic -- UF
Genre:
Plant Pathology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Citrus canker is a devastating disease that infects many citrus varieties and causes huge economic loss. The causal agents are members of a complex of distinct yet related strains of Xanthomonas. X. citri subsp. citri strain Xcc306 harbors four members of the type III transcription activator like (TAL) effector gene family, one of which (pthA4) is required for pustule formation. Transcriptional profiles were compared between citrus leaves tissue infected with Xcc306 and with the pthA4-defective strain Xcc306deltapthA4, it revealed that a considerable number of genes involved in cell wall modification, DNA packaging, and cell division functions were up-regulated by PthA4-mediated infections, while the down-regulated genes were enriched in photosynthesis and various plant defense associated categories. Two genes, CsLOB1 and CsN3-1, which were induced in a PthA4-dependent manner, contain predicted effector binding elements (EBE) of PthA4 in their respective promoters. CsLOB1 is a member of the lateral organ boundaries (LOB) domain gene family of transcription factor, and CsN3-1 is a homolog of the sugar transporter and disease susceptibility gene family of rice. PthA4 was shown to drive expression of CsLOB1 and CsN3-1 promoter reporter gene fusions when co-expressed in citrus or in N.benthamiana. Artificially designed TAL effectors (dTALes) specifically directed to sequences in the CsLOB1 promoter region, but not the CsN3-1 promoter,promoted pustule formation and higher bacterial leaf populations. Fouradditional distinct TAL effector genes, pthAw, pthA*, pthB and pthC, also restored pustule formation and directed the expressionof CsLOB1, while pthB and pthC unlike pthAw, pthA* did not promote expression of CsN3-1. PthAw and PthA* share the same EBE as PthA4, while EBEs of PthB and PthC in CsLOB1 promoter were found to be located 6 bp upstream of EBEPthA4.The results indicated that diverse citrus canker-inciting species of Xanthomonas exploit TAL effectors target a single disease susceptibility gene in the host by altering the expression of this otherwise developmentally regulated gene. The discovery of TAL effectors common target in citrus provides new approaches to control citrus canker.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Yang Hu.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: Jones, Jeffrey B.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-02-28

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0045824:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 CITRUS CANKER REQUIRES TARGETING OF A SUSCEPTIBILITY GENE BY SPECIFIC TAL EFFECTORS PRESENT IN XANTHOMONAS CITRI By YANG HU A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLME NT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Yang Hu

PAGE 3

3 To my parents for their unconditional love and support

PAGE 4

4 ACKNOWLEDGMENTS First I would like to ex press my deepest gratitude to my supervisory Dr. Jeffrey B. Jones. He is my mentor and also my friend; he taught me research skill way of thinking and scientific knowledge. He is insightful and easy communicated to offer me excellent ideas and solve vario us difficultie s I met in the research. H is sense of humor and encouragement helped me relieving the stress In addition, he is so responsible to assist me in the writing process. And I am very grateful to my co chair Dr. Nian Wang for guidance ; he generous ly funded me to accomplish my Ph.D I am also thankful to Dr. Nian Wang Dr. Wen Y uan Song and Dr. James H. Graham for serving on my committee ; their acade mic achievements and expertise helped me a lot. I would like to acknowledge the collaboration from D r. Frank F. White, he helped to devise the ideas and proofread the manuscript. I would like to give my special thanks to Jerry Minsavage for technical help, valuable suggestion s and lab supplies ordering during the experiments, also to Dr. Robert Stall for taking care of the plant materials. I am very appreciated to Dr. Becky Bart and Dr. Brian J Staskawicz for Southern Blot experiment, and to Dr. B ing Yang for the design and synthesis of artificial TALEs. ting a harmonious lab atmosphere and a relaxed working environment they kindly gave me a lot of assistances I am very grateful to Qing Yan and Hongg e Jia for providing the strains and dTALes. I also would like to show my appreciation to all faculty and s taff in Plant Pathology Department. I want to thank all my friends accompanying me in Gainesville. Lastly but most importantly, I warmly thank my loved parents and sister in China for their encouragement and unconditional supports throughout my doctoral s tudy

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 12 ABSTRACT ................................ ................................ ................................ ................... 14 CHAPTER 1 GENERAL INTRODUCTION ................................ ................................ .................. 16 Citrus Canker Disease ................................ ................................ ............................ 16 Overview of Citrus Canker ................................ ................................ ................ 16 Causal Agents of Citrus Canker ................................ ................................ ....... 17 Symptoms and Control of Citrus Canker ................................ .......................... 18 General Principles of Bacterial Pathogen and Plant Host Interaction ..................... 18 Type III Secr etion System ................................ ................................ ................ 18 Characteristics of Type III Effectors Especially That from Xanthomonas ......... 19 Plant Molecular Responses to the Invas ion of Bacterial Pathogens ................. 21 Goals and Objectives of This Study ................................ ................................ ........ 21 2 MUTAGENESIS ANALYSIS OF PTHA HOMOLOGY GENES IN XCC306 ............ 24 Background Information ................................ ................................ .......................... 24 Results ................................ ................................ ................................ .................... 28 Construct of pthAs Deletion Mutants from Xcc306 ................................ ........... 28 Pathogenicity Test of the Mutant Strains ................................ .......................... 28 Materials and Methods ................................ ................................ ............................ 29 Plant Material, Bacterial Strains, and Plasmids ................................ ................ 29 Mutagenesis of pthAs in Xcc306 ................................ ................................ ...... 30 Bacterial Inocu lation and Growth Assay in planta ................................ ............ 31 Discussion ................................ ................................ ................................ .............. 31 3 TRANSCRIPTION PROFILLING OF SWEET ORANGE IN RESPONSE TO PTHA4 MEDIATED INFE CTION ................................ ................................ ............ 40 Background Information ................................ ................................ .......................... 40 The Expression of Citrus Host Genes Responding to Xcc Infections ............... 40 Transcriptional Responses of Citrus to Infection with Other Pathogenic Bacteria ................................ ................................ ................................ ......... 42 Bacterial Effectors Mediated Gene Expressions in planta ................................ 43

PAGE 6

6 Results ................................ ................................ ................................ .................... 45 Microarray Analyses Overview ................................ ................................ ......... 45 Up Regulated Genes at 48 hpi Bas ed on WT versus MU Infection .................. 47 Down Regulated Genes at 48 hpi Based on WT versus MU ............................ 51 Comparison of Down Regulated and Up Regu lated Genes Distribution at 48 hpi WT versus MU ................................ ................................ .................... 53 Characterization of DE Genes Following Inoculation of WT Relative to MU at 6 hpi and 120 hpi ................................ ................................ ....................... 56 Reprogramming of Gene Expressions between Different Time Post Inoculations ................................ ................................ ................................ ... 59 Materials and Methods ................................ ................................ ............................ 63 Microa rray Experiment and Analyses ................................ ............................... 63 Quantitative Reverse Transcription PCR Analyses ................................ .......... 64 Categorization of DE Genes ................................ ................................ ............. 64 Discussion ................................ ................................ ................................ .............. 65 Cell Wall Associated Genes ................................ ................................ ............. 66 Cytochrome P450 Family ................................ ................................ ................. 67 Transcriptional Regulator ................................ ................................ ................. 68 Plant Hormone Metabolism and Signal Transduction ................................ ....... 71 Photosynthesis ................................ ................................ ................................ 74 Plant Defense Components ................................ ................................ .............. 75 Categories Associated with Basal Defense ................................ ...................... 77 Binding ................................ ................................ ................................ ............. 78 Other Important Categories ................................ ................................ .............. 79 Molecular Events at Early Time of Infection and From Earlier Time to Later Time ................................ ................................ ................................ .............. 80 4 IDENTIFICATION AND CHARACTERIZATION OF PTHA4 TARGET GENE IN CITRUS ................................ ................................ ................................ ................ 104 Background Information ................................ ................................ ........................ 104 TAL Effectors are the Pathogenicity and Avirulence Determinant .................. 104 Secondary Structure Hallmarks of TAL Effectors ................................ ........... 106 TAL Effectors Directly and Specifically Recognize Plant Host Genes ............ 107 Traits of TAL Effector Target Genes in Plants ................................ ................ 110 Target Discovery and Gene Engineering by Exploiting Features of TALE ..... 112 Results ................................ ................................ ................................ .................. 114 Experiments Outline ................................ ................................ ....................... 114 CsLOB1 and CsN3 1 are Candidate Targets of TAL Effectors PthA4 ............ 114 CsLOB1 and CsN3 1 Promoters Dir ect TAL Effector Dependent Expression 115 Artificial dTALes Targeting CsLOB1 Induce Pustule Formation ..................... 117 CsLOB1 is Target of Al ternate TAL Effectors Involved in Citrus Canker ........ 118 Materials and Methods ................................ ................................ .......................... 119 PthA4 Target Gene Search ................................ ................................ ............ 119 GUS Reporter and Gene Overexpression Construction ................................ 119 Glucuronidase (GUS) Assays ................................ ................................ ..... 120 Discussion ................................ ................................ ................................ ............ 121

PAGE 7

7 CsLOB1 is a Citrus Susceptibility Gene Targeted by Diverse TAL Effectors .. 121 Functional Characteristics of LOB Domain Family and CsLOB1 .................... 123 Possible Roles of CsN3 1 and More Genes That May Be Involved in TALE Targeting ................................ ................................ ................................ ..... 125 5 CONCLUDING REM ARKS AND FUTURE PERSPECTIVES ............................... 139 LIST OF REFERENCES ................................ ................................ ............................. 143 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 163

PAGE 8

8 LIST OF TABLE S Table page 1 1 Reaction of a ll known citrus canker causing x anthomonad strains on four different Citrus species ................................ ................................ ....................... 23 2 1 List of bacterial strains and plasmids used in the study ................................ ...... 34 2 2 List of primers name, the corresponding sequences and purposes .................... 35 3 1 Categories with expression significantly changed ( P value<0.05) and corresponding DE probesets number by the infection of wild type Xcc306 relative to by mutant Xcc306 pthA4 at 48 hpi generated by MapMan software ................................ ................................ ................................ .............. 82 3 2 Significantly altered GO terms (FDR<0.05) according to gene expression and contained DE genes number upon the comparison between wild type a nd mutant infection at 6 hpi, 48 hpi and 120 hpi through Singular Enrichment Analysis ................................ ................................ ................................ .............. 83 3 3 Significantly changed categories in expression ( P value<0.05) and contained DE probesets number by t he infection of wild type Xcc306 relative to by mutant Xcc306 pthA4 at 6 hpi and 120 hpi generated by MapMan software .... 86 3 4 Categories with significantly changed in expression ( P value<0.05) and contained DE probesets number through the comparisons of d ifferent time after infiltration of wild type Xcc306 or mutant Xcc306 pthA4 generated by MapMan software ................................ ................................ ............................... 87 3 5 Significantly DE genes enriched GO terms (FDR<0.05) according to the comparison of different hours post infiltration of wild type or mutant through Singular Enrichment Analysis ................................ ................................ ............. 90 4 1 Known TAL effector targets in various plants and their characteristics ............. 127 4 2 Thirty most highly up regulated genes in sweet orange by PthA4 mediated infection ................................ ................................ ................................ ............ 128

PAGE 9

9 LIST OF FIGURES Figure page 2 1 Confirmation of the mutants by PCR and Southern Bl ot ................................ ..... 37 2 2 Knocking out of pthA4 resulted in loss of pathogenicity in sweet orange and grapefruit. ................................ ................................ ................................ ........... 37 2 3 Bacterial growth curves in sweet orange and grapefruit for wild type Xcc306 and mutant Xcc306 pthA4 ................................ ................................ ................ 38 2 4 Mutagenesis process for pthAs gene deletion. ................................ ................... 39 3 1 Quantitative RT PCR validation of selected up regulated genes in Microarray analysis. ................................ ................................ ................................ ............. 94 3 2 Pie chart demonstrating the proportions of the functional categories formed from MapMan that contain up regulated genes by infection of Xcc306 relative to mutan t Xcc306 pthA4 at 48 hpi. ................................ ................................ .... 94 3 3 Pie chart showing the proportions of the second level GO terms formed from BLAST2GO that contain the up regulated genes by infection of Xcc306 relative to mutant Xcc3 06 pthA4 at 48 hpi ................................ ......................... 95 3 4 Some of over represented and under represented categories in up regulated gene sets by infection of Xcc306 relative to mutant Xcc306 pthA4 at 48 hpi in Singular Enric hment Analysis (FDR<0.05). ................................ .................... 96 3 5 Pie chart demonstrating the proportions of the functional categories formed from MapMan that contain down regulated genes by infection of Xcc306 relative to m utant Xcc306 pthA4 at 48 hpi. ................................ ........................ 97 3 6 Pie chart showing the proportions of the second level GO terms formed from BLAST2GO that contain the down regulated genes by infection of Xcc306 relative to mutant Xcc 306 pthA4 at 48 hpi ................................ ......................... 98 3 7 Categories that significantly contain more percentage of down regulated genes considering 48 hpi WT versus MU than their proportions out of total categories calculat ed by Singular Enrichment Analysis (FDR<0.05) ................. 99 3 8 Comparison of up regulated and down regulated genes number regarding 48 hpi WT versus MU in some categories basing on the categorization by MapMan. ................................ ................................ ................................ .......... 100 3 9 Pie chart demonstrating the proportions of the functional categories formed from MapMan that contain DE genes by infection of Xcc306 relative to mutant Xcc306 pthA4 at 6 hpi and 120 h. ................................ ....................... 101

PAGE 10

10 3 10 Venn diagram showing the number of up regulated or down regulated genes commonly modulated at 6 hpi, 48 hpi and 120 hpi following Xcc306 inoculation relativ e to Xcc306 pthA4 inoculation. ................................ ............ 102 3 11 Venn diagram showing the number of overlapped DE genes between several sets of comparisons. ................................ ................................ ......................... 102 3 12 Contrastive visualization of up regulated genes (red squares) and down regulated genes (blue squares) in respect to 48 hpi versus 6 hpi following the challenge of both mutant Xcc306 pthA4 (A) and wild type Xcc306 (B) formed by MapMan software ................................ ................................ ....................... 103 4 1 Structure features of a typical TAL effector and the DNA binding specificity .... 1 29 4 2 Phylogeny of LOB domain (LBD) fam ily from Citrus sinensis Solanum lycopersicum and Arabidopsis thaliana ................................ .......................... 130 4 3 CsN3 1 and CsLOB1 were up regulated in sweet orange following challenge with wild type Xcc306 compared to Xcc3 06 ................................ ......... 130 4 4 Promoter constructs used in the GUS transient expression assay. .................. 131 4 5 PthA4 Drives CsN3 1 and CsLOB1 promote r expression of uidA reporter gene ................................ ................................ ................................ ................. 131 4 6 PthA4 induced the CsLOB1 and CsN3 1 promoter in Nicotiana benthamiana ................................ ................................ ................................ .... 132 4 7 The R VDs of artificial designed TALEs (dTALes) and their targeting EBE sequences ................................ ................................ ................................ ........ 132 4 8 Examination of the correctness of dTALes in qRT PCR and GUS assay. ........ 133 4 9 pthA4 inoculation in sweet orange. ................................ ................................ ................................ ............. 133 4 10 In planta pthA4 mutant (square) and the corresponding complem ented strains. ................................ ................................ ..................... 134 4 11 PthA4 and its homologies are critical for pustule formation on sweet orange. .. 134 4 12 The relative expre ssion of CsN3 1 and CsLOB1 induced by several TAL effectors differed in different citrus species. Black column indicates the expression of CsN3 1 gene, and white column indicates expression of CsLOB1 gene ................................ ................................ ................................ .. 135 4 13 pthA4 derivative strains in planta ..................... 135

PAGE 11

11 4 14 EBE of PthB and PthC in CsLOB1 promoter is located six bases upstream of EBE PthA4 ................................ ................................ ................................ ........... 136 4 15 PthAw activated the CsLOB1 and CsN3 1 promoter in Nicotiana benthamiana ................................ ................................ ................................ .... 137 4 16 CsLOB1 is considered to be associated with cell wa ll metabolism. .................. 138

PAGE 12

12 LIST OF ABBREVIATIONS AD Activation domain BA Brassinosteroids b HLH B asic helix loop helix cfu C olony forming units DE GENES Differentially expressed gene dTALes designed TAL effectors EBEs Effector Bin ding Elements ET Ethylene ETI Effector triggered immunity ETS Effector triggered susceptibility GA Gibberellin acid GUS G lucuronidases GO Gene ontology hpi (dpi) H ours (days) post inoculation hrp HR and pathogenicity HR Hypersensitive response JA Jasmonate s MU pthA4 deletion mutant of Xcc306, Xcc306 NLS nuclear localization signal PR Pathogenesis related PTI PAMP trigger ed immunity q RT PCR Quantitative R eal T ime PCR R GENE Resistance gene RVD R epeat variable diresidue

PAGE 13

13 S GENE Susceptible gene SA Salicylic acid SEA Singular Enrichment Analysis TA L Transcription activator like TALEs TAL effectors TALEN TAL effector nuclease TF Transcription factor v s. Versus WT Wild type Xcc306 X cc X anthomonas. citri ssp. citri X fa X anthomonas fuscans ssp aurantifolii

PAGE 14

14 Abstract of Dissertation Presented to th e Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CITRUS CANKER REQUIRES TARGETING OF A SUSCEPTIBILITY GENE BY SPECIFIC TAL EFFECTORS PRESENT IN XANTHOMONAS CIT RI By Yang Hu August 2013 Chair: Jeffrey B. Jones Major: Plant Pathology Citrus canker is a devastating disease that infects many citrus varieties and cause s huge economic loss. The causal agents are members of a complex of distinct yet related strains of Xanthomonas X citri subsp. citri strain Xcc306 harbors four members of the type III transcription activator like (TAL) effector gene family, one of which ( pthA4 ) is r equired for pustule formation. Transcriptional profiles were compared between citrus leaves tissue infected with Xcc306 and with the pthA4 defective strain Xcc306 pthA4 it reveal ed that a considerable number of genes involved in cell wall modification, DNA packaging, and cell division functions were up regulated by PthA4 mediated infectio ns, while the down regulated genes were enriched in photosynthesis and various plant defense associated categories T wo genes CsLOB1 and CsN3 1 which were induced in a PthA4 dependent manner contain predicted effector binding elements (EBE ) of PthA4 in the ir respective promoters. CsLOB1 is a member of the lateral organ boundaries (LOB) domain gene family of transcription factor and CsN3 1 is a homolog of the sugar transporter and disease susceptibility gene family of rice PthA4 was shown to drive expre ssion of CsLOB1 and CsN3 1 promoter reporter gene fusions when co expressed in citrus or in N. benthamiana Artificially designed TAL

PAGE 15

15 effectors (dTALes) specifically directed to sequences in the CsLOB1 promoter region, but not the CsN3 1 promoter, promoted pustule formation and higher bacterial leaf populations. Four additional distinct TAL effector genes, pthAw pthA*, pthB and pthC also restored pustule formation and directed the expression of CsLOB1 while pthB and pthC unlike pthAw, pthA did not promo te expression of CsN3 1 PthAw and PthA* share the same EBE as PthA4, while EBEs of PthB and PthC in CsLOB1 promoter were found to be located 6 bp upstream of EBE PthA4 The results indi cate d that diverse citrus canker inciting species of Xanthomonas exploi t TAL effectors target a singl e disease susceptibility gene in the host by altering the expression of this otherwise developmentally regulated gene The discovery of TAL effectors co mmon target in citrus provides new approach es to control citrus canker.

PAGE 16

16 CHAPTER 1 GENERAL INTRODUC TION Citrus Canker Disease Overview of Citrus Canker Citrus is one of the most valuable fruit crops shown to be the good source of vitamin C U.S. is the third largest citrus producer in the world. In 2010, the United States e xported and imported $2.9 billion and $3.7 billion worth of citrus fruit and products (Boriss and Huntrods, 2011) The c itrus industry is a major constituent of Flo accounted for 63 percent of the total U.S. citrus production in 2010 an d was valued at about $ 9 billion in 2007 2008 season (Boriss and Huntrods, 2011 ; Rahmani and Hodges, 2009) Citrus canker is a major threat to citrus growers especially in Florida. Citrus canker is a disease originally identified in So utheast Asia and no w is distribu ted worldwide. It is a major disease on citrus in Asia, Africa and the America s Citrus canker has caused huge economic damages, which is a significant threat to the citrus industry. The economic impact of citrus canker comes from the loss of citrus quality and productivity, the eradication program cost and most important ly the regulatory restrictions on the shipment of fruit. In Florida c itrus canker outbreaks and eradications program have occurred sporadically. F or example, the last extensi ve outbreak involving type A strains occurred from 1995 through 2006, triggering an, ultimately, unsuccessful eradication program that cost an estimated US $1 billion; in Brazil, up to 1998 over half a milli on canker contaminated trees have been destroy ed. Citrus canker affects all citrus species, while some species are more susceptible than others, with grapefruit ( C. paradise ) and key lime being ( C. aurantiifolia ) the most susceptible cultivars, while sweet orange ( C. sinensis ) is relatively tolerant (Gottwald et

PAGE 17

17 al., 2002) In another aspect, the ir vulnerabilities als o depend on the host range s of the invasive pathogens. Causal Agents of Citrus Canker There are two phylogenetically distinct species of Xanthomonas causing citru s canker, X citri ssp. citri (Xcc) and X. fuscans ssp aurantifolii (Xfa). E ach group contains several subgroups basd on host range (Brunings and Gabriel, 2003; Schaad et al., 2006) The most widespread species is Xcc wh ich is further distinguished in to A, A w and A* strains according to t heir host ranges. Type A strain of Xcc cause s disease on most species of citrus, whereas type A w and type A* strains are restricted to Key lime (Verniere et al., 1998; Sun et al., 2004) Studies showed that T3SS effector AvrGf1 was only present in all A w and some A* strains, which demonstrated that it may contribute to the exclusion of grapefruit from the A w or A* host strains (Rybak et al., 2009; Escalon et al., 2013) The second species Xfa is grouped into type B and type C, the diseases they cause are named as Canker B and Canker C Canker B was originally identified in Argentina which is only pres ent in Argentina, Paraguay, and Uruguay and is mostly restricted to lemon ( C. limon ) (Civerolo, 1984) whereas Canker C is limited to the state of So Paulo, Brazil with host range being restricted to key lime (Malavolta et al., 1984) The reasons for their host range limitations are still unknown, whereas an avirulence gene with homology to Avr Gf1 may be account for the incompatible response other undescribed variants of Xanthomonas may also exist that cause citrus canker The host range s of all these groups and their relat ive pathogenicities on different c i trus cultivars are shown in Table 1 1.

PAGE 18

18 Sympto ms and Control of Citrus Canker All of the above Xanthomonas strains generate very similar citru s canker symptoms. The pathogens infect citrus tissue through stomata and wounds while they are disseminated by w ind, rain, leaf miner and nursery plant On leaves, the symptom is leaf spot ; the young lesions are raised or have a pustule appearance on both surfaces These pustules will become corky with raised margin s and a sunken center. A characteristic symptom of the disease on leaves is the yellow halo that surrounds lesions. On stem s and fruit, the symptoms are raised corky les ions surrounded by water soaked margin s. I n heavily infected trees it causes defoliation and premature fruit drop. Nowadays, the managemen t and control of citrus canker are mainly through integrated approaches including windbreaks, eradication program s and copper based chemical control (Gramham et al 2004). General Principle s of Bacterial Pathogen and Plant Host Interaction Type III Secret ion System Bacterial plant pathogen s use various strategies to infe ct the host, and then interfere with the host cellular pathways to favor its growth and multiplication. Among these strategies, one of the most important ones is the type III secretion sys tem (T3SS). Most of the Gram negative plant pathogenic bacteria including x anthomonads cause disease by injecting a repertoire of effectors into plant cells via the T3SS. The T3SS is encoded by the hrp (HR and path ogenicity) gene cluster which consist s of more than 20 genes. It include the extracellular Hrp pilus as the key secretion apparatus which spans both bacterial and host membranes and serves as transport channels for secreting effector proteins into the host. The hrp genes that were conserved with their siblings in animal pathogens are also called hrc genes

PAGE 19

19 (hypersensitive response and conserved). hrp gene expression is regulated by diffusible signal molecules (DSFs), cyclic di GMP levels, regulator HrpG and HrpX, while the inactivation of hrp genes leads to the loss of pathogenicity and reduction of bacteria l survival (Bttner and Bonas, 2010) There are two types of T3SS, including the flagellar T3SS which secretes extracellular flagellum components and the translocation associated T3SS which secretes effector protein s Here, we focus on the latter one. The translocation of effectors into host pathogen interface is dependent on the assembly of the channel like translocon and the regulatory systems, which form a hierarchical process (Deane et al., 2010; Buttner, 2012) Characteristics o f Type III Effectors Especially That f rom Xanthomonas Type III effectors are delivered to suppress plant basal defense s damage plant cellular processes to fav or the pathogen growth and promote disease development. The number of effectors is vari able between different bacteria. W ithin P. syringae 62 effectors were identified while each strain encodes 20 30 effectors ( http://www.pseudomonas syringae.org/ ) (Studholme et al., 2009) Among them, t he most intensively studied effector is AvrPtoB, which contain s a kinase binding domain a nd a n E3 ubiquitin ligase domain; it suppresses PTI by targeting the receptor kinase FLS2 and co factor BAK1 (for flagellin) or by targeting CERK1 (for chitin) (Abramovitch et al., 2006; Gohre et al., 2008; Shan et al., 2008) I n Xanthomonas species there are about 64 known effectors ( http://www.xanthomonas.org ), but each individual Xanthomonas strain only secrete s a battery of about 15 or more effectors, most of which achieve a lot of functional redundancy and individually are dispensable but collectively indispensable and interchangeable (Hann and Rat hjen, 2010) In the case of Xcc A and Xcc A w both

PAGE 20

20 contain twenty four and thirty putative T3S effectors, respe ctively, while Xfa B and Xfa C, contain twenty seven and twenty six T3S effectors, respectively (Moreir a et al., 2010) Most sequenced Xanthomonas spp. encode a core set of nine type III effectors (XopR, AvrBs2, XopK, XopL, XopN, XopP, XopQ, XopX and XopZ) except X campestris pv. armoraciae which has only six known effectors and X albilineans which cont ains no identified effectors (Ryan et al., 2011) Several types of T3SS effectors in x anthomona d s have been shown to play im portant roles in pa thogenicity, localizing to mult iple compartments and manipulating the host for thei r benefit The collection of these T3SS effectors are designated as Xanthomonas outer protein s (Xop). I t has been determined that some of them have enzymatic function s that played important role s in the interaction with the host (Kay and Bonas, 2009) AvrBs2 in Xanthomonas campestris pv vesicatoria was the first T 3SS effector shown to enhance bacterial multiplication in the host tissue and contribute to virulence (Kearney and Staskawicz, 1990) After that, a lot of effectors in Xanthomonas were identified to support the virulence of t he bacteria (Ka y and Bonas, 2009) In X. campestris pv vesicatoria XopX promoted lesion development and restricted basal plant defense s in Nicotiana benthamiana (Metz et al., 2005) ; XopD was required for full v irulence and could suppress the expression of defense related genes by targeting and hydrolyzing SUMO proteins through its cysteine protease activity (Kim et al., 2008) ; t he Type III effector XopJ from X. campestris pv vesicatoria belongs to the SUMO peptidase s and was shown to inhibit cell wall associated defense response by affecting vesicle traff icking and protein secretion (Bartetzko et al., 2009) ; XopN was revealed to interact with a tomato a typical receptor like kinase (TARK1) to interfere with the defense process

PAGE 21

21 including callose deposition (Kim et al., 2009a) ; the expression of XopZ PXO99 in Xanthomonas oryzae pv. oryzae could interfere with host innate immunity (Song and Yang, 2010) Plant Molecular Responses to the Invasion of Bacterial Pathogens Generall y, plants respon d to pathogen infections by de ploying a complicate d innate immune s ystem. B asal disease resistance has been defined as the resistance activated by virulent pathogens on susceptible host, which include PAMP triggered immunity ( PTI ) and weak effector trigger ed immunity ( ETI ) triggered by weak recognition but exclude effector triggered susceptibility ( ETS ) (Chisholm et al., 2006; Jones and Dangl, 2006) The first phase occurs in the infection process and is referred to as PTI In PTI, transmembrane pattern recognition receptors (PRRs) in the plant sense microbial or pathogen associated molecula r patterns (MAMPs or PAMPs) such as bacterial flagellin or elongation factor (EF Tu) and halts the infection. In the second pha se, the pathogens can interfere with PTI by deploying virulence effectors, which results in ETS Then the effector might be specifically recognized by direct or indirect interaction with polymorphic NB LRR proteins encoded by R genes directly or indirectly resulting in ET I and disease resistance, and usually results in a hypersensitive response (HR) a t infection sites. Evolutionarily the pathogens acquire additional effectors or shed the recognized ones by natural selection to dodge the surveillance syste m and suppress ETI, but also the plants can acquire new R genes and trig ger ETI again. Goals and Objectives o f This Study In this study, all four pthA homology genes in Xcc306 were examined for their function in causing citrus canker. Until now, only pthA4 that is most similar to pthA was confirmed to be require d for patho geni city; however, the functions of the other effectors

PAGE 22

22 are still p oorly understood. I n order to dissect the genes and biological processes in citrus that are specifically affected by the delivery of bacterial TAL effector Pth A4 microarray analyses were carried out to monitor the differential expression of genes by comparing the infection of Xcc306 and pthA4 deficiency strain ; these genes were functionally categorized Given that no eviden ce is available relating to the time points in PthA4 activating gene expression in planta several time points after inoculation were s ampled for the microarray assay. This, may further provide solid evidence for identifying the genes and processes involv e d in disease development. So the compendium of citrus host transcripts and their dynamics that affected by Xcc306 infection especially by PthA4 mediated challe nge can be illustrated Most importantly, the genes specifically activated and targeted by TAL e f fector PthA4 will be identified based on the predicted and unique binding sequences in the gene promoter region. Collectively, by conducting this study, we aim to get insight into mechanisms of citrus susceptibility to Xcc306 and the most critical elements in citrus for disease initiation and devel opment that yet are largely unknown. I n one aspect, the discovery of the PthA4 target s and downstream elements will contribute as an addenda to the known mechanisms of TAL effector based susceptibility and a refer ence for further TAL effector research; in another aspect, it supplies great gene resources to engineer and generate transgenic plants controlling the citrus canker disease, from both the suppressed defense genes and the induced susceptible genes.

PAGE 23

23 Tabl e 1 1. Reaction of all known citrus canker causing x anthomonad strains on four different Citrus species x anthomonad groups Relative pathogenicity in Sweet orange Grapefruit Key lime Lemon Xcc A ++ ++++ ++++ +++ Xcc A w /HR HR ++++ Xcc A* ++++ Xfa B + + ++++ +++ Xfa C HR HR ++++ HR +, weak citrus canker disease; ++++, strong citrus canker disease; no symptoms; HR, hypersensitive reaction

PAGE 24

24 CHAPT ER 2 MUTAGENESIS ANALYSIS OF PTHA HOMOLOGY GENES IN XCC306 Background Information Xanthomonas spp. use most of the general strategies as other bacterial pathogens to invade the citrus host As a result of sequencing the Xcc strain 306 genome (da Silva et al., 2002) mutagenesis and bioinformatics analysis r evealed many genes in Xanthomonas that are involved in the citrus canker disease development ; these include genes coding for type III secretion systems (T3SS), T3SS effectors, the quorum sensing system, extracellular polysaccharide s (EPS), lipopolysacchari de (LPS), and type II secretion systems (T2SS) (Brunings and Gabriel, 2003; Moreira et al., 2010; Yan and Wang, 2012) Some of the factors control the growth and multiplication of the bacterium in planta, some dete rmine the colonization and invasion into plant cells, and others interrupt the triggered plant defense systems. Type III secretion systems. Type III secretion systems (T3SS) were widely proven to be essential for the delivery of virulence factor s In T3SS, it showed that HrpG and HrpX regulons, which regulate all hypersensitive response and pathogenicity ( hrp ) genes, play ed significant roles in pathogenesis, since the mutations in the hrpG or hrpX genes in Xcc resulted in loss of pathog enicity on citrus (Laia et al., 2009; Figueiredo et al., 2011a; Guo et al., 2011) Some other T3SS genes, like hrpA hpaB hrcV and hrcN were also identified as important factors in symptom formation in these studies T3SS effector s A lot of T3SS effectors act as pathogenicity determinant which are required for promotion or suppression of canker disease development. The most important and widely studied one s are PthA and its h omologs (Brunings and Gabriel 2003), which belong to the A vrBs3/PthA family and were characterized as TAL effector s

PAGE 25

25 (transcription activator like) that were able to activate host gene expression Some of them have been shown to play critical roles in virulence. Maker exchange mutagenesis of pthA gene in Xcc resul ted in a complete loss of virulence on citrus (Swarup et al., 1991) E xogenous expression of pthA gene in other x anthomonads conferred the ability to elicit canker symptom s on citr us (Swarup et al., 1992) while transient expression of pthA inside the h ost cells was also sufficient for inducing citrus canker symptoms including hypertrophy, hype rplasia and cell death (Duan et al., 1999) The pthA homolog, hssB3.0 from Xcc strain KC21 was responsible for suppression o f virulence on Citrus grandis (Shiotani et al., 2007) In Xcc306, four pthA genes were described and determined to be located o n two distinct plasmids pXAC33 and pXAC64 (da Silva et al., 2002) ; however, using EZ Tn5 insertion mutagenesis based high throughput screening only pthA4 was shown to be important for the citrus canker happening, while the other homolog s, pthA1 pthA2 pthA3 were not identified by the screen to be involved in virulence of the pat hogen (Yan and Wang, 2012) Two additional T3SS effectors in Xcc306 and Xfa, XopA1 and XopE3, may al so play a special role in citrus canker (Hajri et al., 2009; Moreira et al., 2010) Two effectors named AvrXacE1 and AvrXacE2 from Xac99 1330 decreased plant tissue necrosis by interrupting different signaling path ways (Dunger et al., 2012) But the mechanism of how these effector s contribute to h ost bacterium interaction is still elusive. EPS and LPS. EPS and LP S have been shown to be the important virulence factor s for many bacterial pathogens. The opsX gene, which affects the biosynthesis of EPS and LPS, was reported to play a role in virulence on plant (Kingsley et al., 1993) The gum gene cluster is responsible for the xanthan biosynthesis and hence for

PAGE 26

26 virulence of many x anthomonads (Katzen et al., 1998) A mutant of gumB showed defective production of xan than and reduced disease symptom s in lemons (Rigano et al., 2007) gumD mutants displayed impaired epiphytic survival of t he bacteria although they remained pathogenic (Dunger et al., 2007) A knockout of the galU gene brought a reduction in EPS level and no symptoms in grapefruit (Guo et al., 2010) Furthermore, the wxacO and rfbC genes of Xcc encode proteins with a role in LPS biosynthesis and the following virulence (Li and Wang, 2011) In the high throughput screening of Xcc306, two gum genes ( gumF and gumK ) were shown to be involve d in virulence in grapefruit, since both the gum mutants reduced water soaking and bacterial cell densities. Wh wzt wzm rfbC and XAC3599 ) that are associated with LPS biosynthesis were identified to play critical roles in plant pathogen interactions (Yan and Wang, 2012) T ype II secretion systems. The bacterial T2SS has been shown to mediate the transportation of diverse molecules such as toxins and plant cell wall degrading enzymes inclu ding protease, amylase, pectate lyase, cellulase, and xylanase (Russel, 1998) which contribute to th e aggressiveness of the bacterium In Yan et al (Yan and Wang, 2012) screening, six T2SS related genes ( xpsD xpsM xpsN xpsE xpsF and xpsG ) were identified to potentially contribute to t he virulence of Xcc306, with mutations of these genes causing delayed symptom development in host plants. Quorum sensing system. Many bacteria use quorum sensing (QS) system to accomplish cell cell communicati on and coordinate certain behaviors base d on the cell density. In X. campestris pv. campestris the QS system is established by the production of diffusible signal fac tor (DSF), and DSF biosynthesis is modulated by two

PAGE 27

27 Rpf proteins, RpfF and RpfC, which form a two component system. QS system play s an important role in citrus canker pathogenicity possibly by regulating the production of EPS and extracellular enzymes, in cluding proteases and cellulases (He and Zhang, 2008) The mutation of quorum sensing sensor kinase gene rpfC abolished pathogenicity in grapefruit (Yan and Wang, 2012) Plant natriuretic peptide like protein. O nly Xcc but no other pathogenic bacterium has been shown to contain a plant natriuretic peptide like gene ( xacPNP ) (Gottig et al., 2008) PNP proteins are a class of extracellular, systemically mobile peptides that elicit a number of important plant responses in homeostasis and growth. The xacPNP deletion mutant resulted in more necrotic tissues, earlier bacterial cell death an d more pronounced decrease in photosynthetic prote ins than infected with the wild type strain which suggests that XacPNP enable s Xcc to modify host response in order to accommodate its lifestyle and create favorable reservoirs for its survival and further colonization (Garavaglia et al., 2010) Because of the uniqueness, xacPNP might be one of the genes contributing to a high level of virulence displayed by Xcc. Others Virulence factors Some other elements used by Xcc for the infect ion of citrus include: 1) adhesion proteins for the initial stage of infection process such as XacFhaB and XacFhaC (Gottig et al., 2009) ; 2) regulatory factors, e.g. dksA which encodes an expre ssion regulator of ribosomal RNA; and 3) transporters, i.e. ATP binding cassette (ABC) transporter system. As more complete genome sequences available for citrus canker causing bacteria, i.e., Xfa B and Xfa C strains (Moreira et al., 2010) Xcc A w strain 12879 (Jalan et al., 2013) through genome comparisons, the

PAGE 28

28 mecha nisms for virulence and host range of citrus canker causing bacteria will be further characterized basing on their different pathogenicities Here, we focus on the pthA homologs in Xcc306, to investigate their function in causing citrus ca n ker. Results C onstruct o f pthA s Deletion Mutants f rom Xcc306 To investigate the AvrBs3/PthA family genes from Xc c306 involved in citrus canker, the four copies of pthA genes were knocked out one by one by marker exchange with double crossover ; the created mutants were d esignated as Xcc306 pthA1 Xcc306 pthA2 Xcc306 pthA3 and Xcc306 pthA4 respectively. In addition, considering the high pro bability of reduced virulence for pthA4 deletion mutant, three double mutants Xcc306 pthA2 Xcc306 pthA3 Xcc306 pthA2 pthA3 and a triple mu tant, Xcc306 pthA2 pthA3 were also constructed to determine if pthA4 alone was sufficient for pustule formation Then the quadruple mutants Xcc306 4 pthA with all four of the pthAs deleted was created. The mutants were confirm ed using both PCR and Sou thern b lot, the mutants were shown to contain either shorter or missing bands ( Figure 2 1 A and B). Pathogenicity Test of t he Mutant Strains The mut ant strains were tested for the ability to produce pustule as well as the ability to grow in planta. In bot h sweet orange and grapefruit, only pthA4 deletion mutant Xcc306 pthA4 showed extraordinarily weaker pust ule formation than that by wild type Xcc306, while the mutant could be complemented back by the expression of pthA4 through the plasmid bearing pthA4 ( Figure 2 2 A and B) ; these results were in agreement with previou s observation in a high throughput v irulence deficient strains

PAGE 29

29 screening (Yan and Wang, 2012) Inter estingly, the triple mutant Xcc306 pthA2 pthA3 developed here showed no reduction in pustule forming ability ( Figure 2 2 ), indicating that only pthA4 was required and sufficient for pustule formation on cit rus. To assess the ability of Xcc306 pthA4 grow ing in planta, the bacterial gr owth dynamics were tested with two inoculum densities, 510 8 colony forming units (cfu) /ml and 510 5 cfu/ml, in both sweet orange and grapefruit. Intriguingly, no significant population differences were detected between Xcc306 and Xcc306 pthA4 in both swe et orange and grapefruit when inoculated at 510 8 cfu/ml ( Figure 2 3 A and B ). However, when the initial inoculum concentration was 510 5 cfu/ml, lower population s were observed for Xcc306 pthA4 than for Xcc306 after 4 dpi (days post inocul ation) in sweet o range, but in grapefruit, small differences were observed in cell densities between these two strains ( Figure 2 3 C and D ), which was in sharp contrast with previous reports that pthA mutant s showed extremely lower cell density than that of the wild type (Swarup et al., 1991; Yan and Wang, 2012) Materials and Methods Plant Material, Bacterial S trains, and Plasmids Plants of grapefruit ( C. paradise ), cultivar Duncan, sweet orange ( C. sinensis ), cultivar Valencia, an d Key lime ( C. aurantifolia ) were kept in a glasshouse in Gainesville, Florida T he temperature ranged between 25 and 30 C and a 12/12 h photoperiod. Before inoculation, the plants were pruned to stimulate new leaves. The leaves chosen for infiltration we re 14 21 days old fully expanded new leaves. The plants were kept in the growth room at 28 2 C with 16 h light and 40 60% humidity after the inoculation of bacteria The plasmids and bacterial strains used in this study are list in Table 2 1 Strains of Xanthomonas were grown at 28 C in nutrient agar (NA),

PAGE 30

30 Escherichia coli was grown at 37 C in lysogeny broth (LB). The antibiotics were used at the following concentration s : ampicillin, 100 g/ml; kanamycin, 50 g/ml; rifamycin SV, 100 g/ml; spectinomyci n, 100 g/ml, tetracycline 12.5 g/ml, gentamicin 10 g/ml and chloramphenicol, 30 g/ml. Mutagenesis of pthAs in Xcc306 To delete pthA genes from the genome DNA of Xcc306, pthA genes including about 600 bp flank sequences were amplified; t he four PCR rea ctions were run under the same touchdown protocol: 1 cycle of 4 minutes at 95 C; 15 cycles of 35 seconds at 95 C, 40 seconds per cycle starting at 68 C, decreasing setpoint temperature after cycle 2 by 1 C per cycle, and extension for 5 minutes at 72 C; 18 cycles of 35 seconds at 95 C, 40 seconds at 54 C and extension for 5 minutes at 72 C; and an additional extension for 10 minutes at 72 C. The central regions of the PCR products were deleted by Bam H I and self ligated (Figure 2 4) The deleted pthA genes fragments were excised with Apa I and Spe I from pGEMT clone f or ligation into suicide vector pOK1 Restriction enzymes, T4 DNA ligase, and Taq DNA polymerase (Promega, Madison, WI, USA) tr iparental (donor, recipient and helper) conjugation, the pthA knocked out strains we re produced as described by Huguet et al. ( (Huguet et al., 1998) with the mutations be ing pthA For the double, triple and quadruple mutants, single, double, and triple mutants were used as recipients respectively. The mutants were confirmed by PCR with single pthA specific primers and Southern blot with universal pthA probe. Th e Southern blot was accomplished by Dr. Becky Bart in the lab of Dr. Brian J. Staskawicz at the University of California Berkeley. The primers used were list in Table 2 2 For the

PAGE 31

31 complement, pthA4 gene containing the up stream and down stream sequence was amplified and ligated into the Xanthomonas expression vector pLARF3, the construction pLARF3:pthA4 was delivered into pthA through triparental conjugation. Bacterial Inoculation and G rowth A ssay in planta The bacteria were diluted to defined concentrations and infiltrated into leaf tissues using syringe with needle, and kept in growth chamber. For the population o f bacteria strains in citrus plants, one leaf disc with 1 cm 2 of the inoculated area was taken and macerated in sterile tap water, after serial dilution s 50 l were plated on NA medium and incubated a t 28 C for 3 days, the colony counts were calculate d to determine the internal population s This experiment was repeated three times. Discussion In this study, a critical pathogenicity d eterminant factor, PthA4, was identified via mutagenesis analyses and the pthA4 defective mutant had reduced pathogenicity in citrus species sweet orange and grapefruit. PthA4 was also found to be the only TAL effector in Xcc306 to be responsible for aggressiveness and disease development. Interestingly, t pthA4 which had reduced pathogenicity, was able to mu ltiply in planta at almost the same level as wild type when inoculated at high cell densities (5 10 8 cfu/ml) whereas population of the mutant was significantly lower 4 days after infiltration at the low er concentration of 5 10 5 cfu/ml in sweet orange while in grapefruit the differences were not obvious This pheno menon was dissimilar with what was previously reports conducted in grapefruit In the study conducted by Swarup et al. (Swarup et al., 1991), the pthA insertion mutant had a sharp decline in bacterial population as compared to wild type on grapefruit, but the complemented strain did not restore the bacterial growth ; the cell density of another pthA4 insertion mutant created

PAGE 32

32 by Yan et al. ( Yan and Wang, 2012 ) also showed 20 fold lower than that of wild type in grapefruit when inoculated at low concentration. One plausible explanation is that in the bacterial growths in planta relies on the status of host plant and surrounding environment factors when in the absence of PthA4 It is not surprisin g when regarding the non function in pathogenicity of the three pthA homology genes; it is very common for TAL effectors to have undescribed functions in other Xanthomonas strains. Nineteen TAL effectors have been identified in the X oryzae pv. oryzae str ain PXO99 A ; only four of them are associated with virulence or avirulence by activating S genes to induce disease or R genes to cause HR phenotype (Salzberg et al., 2008) A pthA4 homologue, avrTaw did not restore symptom of the pustule minus strain that originated from Xcc A w while pthAw did (Rybak et al., 2009) One reasonable explanation for the appearances of these redundant TAL effectors i s that they act as reservoir to evolutionally generate new TAL effector s for subverting plant defense and adaptation to new hosts through recombination or horizontal gene transfer. Another hypothesis is that they may contribute to the host range since the Xcc group A strains have wider host range than most of the other groups that contain less pthA homolog s but all of four pthA s from Xcc strain 3213 that resemble four pthAs in Xcc306 did not increase the host range of A* strain when they were conjugate d in to this A* strain (Al Saadi et al., 200 7) Recently, import in that mediate the transfer to nucleus were found to interact with PthAs. By yeast two hybrid screening of citrus cDNA library, PthA2 and PthA3 were reported to preferentially target a citru s cyclophilin ( Cyp), a tetratricopeptide domain containing thioredoxin ( TDX ), ubiquitin conjugating enzyme

PAGE 33

33 Uev and Ubc13, which were associated with protein folding, k63 linked ubiquitination transcription control and DNA damage repair (Domingues et al., 2010) The same group also discovered that PthA4 interact s with proteins in chroma tin remodeling and repair, gene regulation and mRNA stabilization/modification that involved in translational control and m RNA processing (de Souza et al., 2012) In the future, exploring the functions of these yet null TAL effectors in some processes rather than virulence by using the corresponding mutants will be an interesting research area.

PAGE 34

34 Table 2 1 List of bacterial strains and plasmids used in the study Strain or plasmid Relevant characteristics Source Strains X. citri subsp. citri Xcc306 Group A, wild type Rif r DPI a pthA1 pthA1 deletion mutant This study pthA2 pthA2 deletion mutant This study pthA3 pthA3 deletion mutant This study pthA4 pthA4 deletion mutant This study pthA1 pthA2 pthA3 pthA1, pthA2, pthA3 del etion mutant This study 4pthA pthA1 pthA2, pthA3, pthA4 deletion mutant This study pthA4 :PthA4 pthA4 Gm r This study pthA4 :Pthw pthA4 Gm r This study pthA4 : PthA* pthA4 Gm r This study pthA4 :PthB pthA4 Gm r This study pthA4 :PthC pthA4 Gm r This study pthA4 : dCsLOB Artificial TALE targeting CsLOB1 complem ent Xcc306 4pthA r This study pthA4 : dCsN3 Artificial TALE targeting CsN3 1 pthA4 Tetra r This study Escherichia coli F recA 80d lac Z M15 BRL b DH5 PIR Host for pOK1; Sp R oriR6K, K2 replicon (Huguet et al., 1998) Agrobacterium tumefaciens EHA105 Rif r Cm r LBA4404 Contain pAL4404 plasmid Plasmid pOK1 Suicide vector, SacB (Huguet et al., 1998) pRK2073 Sp r Tra + helper plasmid (Daniels et al., 1984) pBluescript KS(+) Phagemid, pUC derivative, Amp r Stratagene pLARF3, pLARF6 rlx + RK2 replicon, Tc r (Staskawicz et al., 1987) pUFR053 repW, Mob + + Par + Gm r (El Yacoubi et al., 2007) pBI101 Binary vector with uidA gene, Km r Clontech pUC118/35S pUC18 de rivative with 35S, Amp r G. Moore pCAMBIA2200 Binary vector, Cm r Cambia a DPI, Division of Plant Industry of the Florida Department of Agriculture and Consumer Services, Gainesville, FL, USA. b Brl, Bethesda Research Laboratories, Gaithersburg, MD Amp = ampicillin, Cm = chloramphenicol, Gm = gentamycin, Km = kanamycin, Sp = spectinomycin, Rif = rifamycin, Tc= Tetracycline

PAGE 35

35 Table 2 2 List of primers name, the corresponding sequences and purposes Primer Sequence Application pthA1F TGCCGCTTGCTGCAACAG AAG Amplification of pthA1 gene including up and down stream pthA1R TTGGCATCAGAGTGACGAACAC pthA2F CGAGACCCTATACCGCGAG Amplification of pthA2 gene including up and down stream pthA2R CTGGACATACCAGACACTCCA pthA3F GATCTGGCTGTCGGTAAAGCG Amplification o f pthA3 gene including up and down stream pthA3R CCCTCACGCAAGCCGCTAT pthA4F CACATAACGCGAGATTCCACG Amplification of pthA4 gene including up and down stream pthA4R TGCTTCAGTCCCTGATTGCC pthA4OEF CCGCTCGAGCGGATGGATCCCATTCGTTCG Amplification of pthA4 ge ne for over expression pthA4OER GGAAGATCTTCCCTGAGGCAATAGCTCCATCA 37210F TCCACCAACCGAACCATACA Real time PCR for CsLOB1 gene 37210R GGCACTTGCTTCATAGACCAT 3027F GTGAGCCTGAGAAACCATCG Real time PCR for CsN3 1 gene 3027R CCGTTGCCGTTAGCCATCT EF1aF GTAACC AAGTCTGCTGCCAAG Real time PCR for gene EF1aR GACCCAAACACCCAACACATT 37210PF CCCAAGCTTGGGAACCTTGACCTGGAATGG Amplification of CsLOB1 promoter 37210PR CGCGGATCCGCGGCGTGGAGAAGATTGAGA 3027PF CCCAAGCTTGGGTTGACGGACACCTCTTAA Amplification of CsN3 1 promoter 3027PR CGGGATCCCGTAGCATTTCC TGGCAACA 37210kpnF GGGGTACCCCTTAACTTTGTTTCAACTAAAGC Make EBE deleted CsLOB1 promoter CsLOB P D 37210kpnR GGGGTACCCCTATAGAGAAAGGAAAAGGC 3027kpnF GGGGTACCCCTTCTAGTCTGCTACCCACAA Make EBE deleted CsN3 1 promoter CsN3 P D 3027kpnR GGGGTACCCCGGGAATTCAAAGAAACTA AC 37210xhoF CCGCTCGAGCCTTAACTTTGTTTCAAC Making EBE mutated CsLOB1 promoter CsLOB P M1 37210xhoR CCGCTCGAGGGGTTTATATAGAGAAAG

PAGE 36

36 Table 2 2 Continued. Primer Sequence Application 3027xhoF CCGCTCGAGCTTCTAGTCTGCTACCCA Make EBE mutated CsN3 1 promoter CsN3 P M1 3027xhoR CCGCTCGAGCGGTTTATATAGGGAATTC 37210Hind F CCCAAGCTTGGGCTATATAAACCCCTTTTG Making truncated CsLOB1 promoter CsLOB P T 3027HindF CCCAAGCTTCCTATATAAACCGCTTTTG Making truncated CsN3 1 promoter CsN3 P T LOBPmut CCCAAGCTTGGGCTATATAAACCtCTTTTGCCT Making EBE mutated CsLOB1 promoter CsLOB P M2 LOBPmug CCCAAGCTTGGGCTATATAAACCggTTTTGCCT Making EBE mutated CsLOB1 promoter CsLOB P M3 LOBPig CCCAAGCTTGGGCTATATAAACCCCTTgTTGCC T Making EBE mutated CsLOB1 promoter CsLOB P ins 37210M5F TTCTCGAGATAAACCCCTTTTGC Mak mutated CsLOB1 promoter CsLOB P M5 37210M5R TACTCGAGAAAGGAAAAGGCAAG 37210OEF ACGCGTCGACATGGAATGCAAACACAAAAT Amplification of CsLOB1 gene for over expression 37210OER CCGCTCGAGATCATGTCCACAGAGGCTC 3027OEF CGCGTCGAC ATGGATATTGCACATTTCTTG Amplif ication of CsN3 1 gene for over expression 3027OER CCGCTCGAGTCAAACTTGTTCAACTAGAGCC 7877F ACAGATTCAGCACAGAAGAGTT Real time PCR for Cit.7877.1.S1_at 7877R GAAGCAAGGTCACCGTCAC 2392F CGTCAACCGTAAAAGCAGAA Real time PCR for Cit.2392.1.S1_at 2392R GAGATGA ACCCCTGTGATGAA 5370F CGTCCACAACAGCCAAATC Real time PCR for Cit.5370.1.S1_s_a t 5370R AGGCGTGCGATGAGAGATAC 39387F TGCTATTGGTGGAAGTGCTG Real time PCR for Cit.39387.1.S1_at 39387R CACTCTCTGGTGCATCCTCA

PAGE 37

37 A B Figure 2 1 Confirmation of the mutants by PCR and Southern Blot. A) PCR amplification of the genome DNA of mutants Xcc306 pthA1 Xcc306 pthA2 Xcc306 pthA3 Xcc306 pthA4 using the respective primers upstream an d downstream of the genes, wild type Xcc306 genome DNA was also amplified with these four primers. The marker indicates products size. B) Southern blot analysis of Xcc 306 pthA deletion mutants. The genome DNA was digested with BamH I and EcoR I, and the picture was taken after 120 min of exposure. Figure 2 2 Knocking out of pthA4 resulted in loss of pathogenicity in sweet orange and grapefruit. A) In sweet orange, the pthA4 deletion mutant caused drastically reduced pustule formation (middle), and can be complemented back (right). B) In grapefruit, the same situation as in A. C) The deletion of pthA1 pthA2 and pthA3 pthA1 pthA2 pthA3 (with pthA4 intact) did not affect the pustule formation in grapefruit. The leaves were photographed 5 days after inoculation

PAGE 38

38 A B C D dpi dpi Figure 2 3 Bacterial growth curves in sweet orange and grapefruit for wild type Xcc306 and mutant Xcc306 pthA4 A B) No differences in bacterial leaf population when the inoculum concentration was 5 10 8 cfu/ml for sweet orange (A) and grapefruit (B). C D) The leaves were infiltrated at concentration of 5 10 5 cfu/ml. In sweet orange, the bacterial grow th of the mutant was much lower than that of wild type from 4 dpi (days post inoculation) (C), while there was slight di fference between them in grapefruit (D). The population s were monitored at the time points indicated. Error bars represent standard deviations (SD). The experiment was repeated twice with similar results.

PAGE 39

39 Figure 2 4. Mutagenesis process for pthAs ge ne deletion. The pthA genes including left (L) and right (R) flanking sequence were amplified and digested with Bam H I. The deleted fragment was transferred to pOKI harboring spectinomycin (Spec) resistance gene and sucrose sensitive gene (SacB). The mutan t strains were generated by screening and double cross over.

PAGE 40

40 CHAPTER 3 TRANSCRIPTION PROFILLING OF SWEET ORANGE IN RESPONSE TO PTHA4 MEDIATED INFECTION Background Information After being attacked by pathogens, the expression of some plant host genes will be altered, probably as a result of defense or susceptibility interactions Here, some previous work on the reprogramming of plant transcri ptome triggered by pathogens is provided. The Expression of Citrus Host Genes Responding to Xcc Infection s Strategies to study citrus plant responses to Xanthomonas In comparison to the massive investigation of mechanisms employed by the bacterium relating to citrus canker disease develo pment, with respect to the hosts limited knowledge about plant host defen se responses are available An et al. (An and Mou, 2012) established a non host pathosystem involving Arabidopsis and Xanthomonas citri subsp. citri ( Xcc ) in orde r to identify defense genes activated by Xcc; they demonstrated that the SA signaling pathway may play a critical role in resistance to Xcc. Although no specific gene in citrus that responds to Xcc infection has been well characterized yet commercially av ailability of the citrus Genechip array (Martinez Godoy et al., 2008) has resulted in several studies with high throughput transcriptome profiling being conducted to exploit gene expression upon the invasion of Xcc or X. fuscans subsp. aurantifolii ( Xfa ). These results have helped to greatly expedite our efforts to understand the molecular mechanisms underlying pathogen infect ion processes and facilitate the elucidation of citrus defense response at the molecular le vel. A summary of t hese studies is discussed below.

PAGE 41

41 Transcriptional analysis of sweet orange following challenged with compatible and incompatible Xanthomonas Cernadas et al (Cernadas et al., 2008) survey ed the early molecular events leading to canker development by performing transcriptional analysis of sweet orange plants infected with the pathogens Xcc306 and Xfa C strain which elicit canker disease and HR respectively By using suppressive subtractive hybridization and microarray analysis, they observed significant changes in the expression of defense, cell wall, hormone, vesicle trafficking (such as syntaxins and PDR/ABC transporter etc.) transcriptional regulator and cell division genes in Xcc306 infected leaves relative to mock (water) inoculation from 6 hpi to 48 hpi Since Xfa C elicits an incompatible reaction in sweet orange, it triggered a mitogen activated protein kinase signaling pathway involvin g WRKY and ethylene responsive transcriptional factors known to activate downstream defense genes. Furthermore, the genes commonly regulated by Xcc306 and Xfa C were associated with basal defenses triggered by pathogen associated molecular patterns, includ ing those involved in reactive oxygen species production and lignification. Specially, they recognized a vesicle trafficking inhibitor, brefeldin A, which retarded canker symptom development. Genome wide molecular responses of citrus to Xanthomonas regard ing resistance and susceptible. To unravel the molecular mechanisms underlying the Xcc resistance and susceptible, Fu and Liu (Fu et al., 2012; Fu and Liu, 2013) conducted two studies to investigate the global gene transcriptional changes by comparing se veral citrus varieties after Xcc infection. One involved the canker resistant cultivar Meiwa kumquat ( Fortunella crassifolia ) and the second on e involved a canker resistant transgenic sweet orange produced via overex pressing a spermidine synthase, and the

PAGE 42

42 third one is a canker sensitive wild type sweet orange cultivar They showed that genes related to the cell wall and polysaccharide metabolism were induced in both canker resistant and sensitive species. Moreover, t he expression of the genes involved in response to biotic stimulus, defense r esponse, and cation binding was especially up regulated in kumquat in comparison to sweet orange. Notably, abundant photosynthesis related genes were significantly down regulated in sweet orange. They also discovered that genes in categories of stimulus response, cell wall, transcription factors, starch and sucrose metabolism, glutathione metabolism, biosynthesis of phenylpropanoids, and plant hormones play ed major roles in canker resistance, when compared the gene expression between the infection s of transgenic lines and wild type lines. Another study conducted by Khalaf et al (Khalaf et al., 2011) revea led compre hen sive gene expression involved in the incompatible interaction following inoculation of kumquat with Xcc. In their survey, most of the differentially expressed genes involved in defense mechanisms in kumquat were associated with an HR and incl u ded oxidative burst, protein degradation, and regulation of photosynthesis as well as the production of ROS that is associated with the oxidative burst. Transcriptional Responses of Citrus to Infection w ith Other Pathogenic Bacteria Expression of citrus g ene s subsequent to non host Xanthomonas inoculation. Through inoculation of citrus with the non host bacterium X. campestris pv. vesicatoria (Xcv), Daurelio et al (Daurelio et al., 2013) identified 58 genes encoding transcription factors including some from the stress associat ed families A P2 EREBP, bZIP, MYB and WRKY differentially regulated ; 10 of the 58 TFs were specifically over represented in citrus stress libraries which may be important factors in citrus disease defense.

PAGE 43

43 Transcriptional profiles of citrus in response to Candidatus L iberibacter asiaticus. The global gene expression of Citrus sinensis was also exploited following infection with the phloem limited bacterial pathogen Candidatus Liberibacter asiaticus (Las) which causes Huanglongbing (Kim et al., 2009b; Albrecht and Bowman, 2012; Zheng and Zhao, 2013) F ollowing inoculation, expression of genes associated with cell cycle, sugar metabolism, plant defense, phytohormone, photosynthesis transcriptional regulation transport and cell w all metabolism was observed to be affected by Las infection Bacterial Effectors Mediated Gene Expression s in planta Effector based gene expression in Arabidopsis by infection of Pseudomonas. Microarray is a high throughput and powerful technology for dec iphering the molecular response under different treatments, and an explosion of studies has focued on plant global gene expr essions as affected by compatible or incomp atible host pathogen interactions through the comparisons of inoculati on with pathogens a nd mocks; however, limited work had been done to examine plant genomic wide transcriptional responses specifically to the bacterial eff ectors which mediating the subv ert ing of basal defense responses. These studies will help to elucidate the genes involved in effector mediated susceptibility ( ETS ) as well as ETI. Truman et al (Truman et al., 2006) universally surveyed the genes specifically involved in type three effectors (TTEs) which orchestrate d basal defens e during compatible interaction s in Arabidopsis, by comparing the invasion of Pseudom onas syringae pv. tomato DC3000 (DC3000) with the TTEs delivery deficiency strain DC3000 hrp The differences in host gene expression between DC3000 and hrp challenges revealed that the TTEs strikingly suppressed the endomembrane targeted, and more speci fically, LRR receptor like

PAGE 44

44 kinase genes, pigment biosynthesis transcripts, genes involved in primary carbon metabolism in the plastid, genes associated with aromatic biosynthesis and phenylpropanoids, while MYB, NAC and AP2 transcription factor families we re over represented within the TTEs induced categories. In a proteomic study, Kaffarnik et al (Kaffarnik et al., 2009) indicated that effector proteins of the pathogen Pseudomonas syringae may manipulate host secretion. Induced suppressed and targeted genes in plant s by effectors in other examples Marois et al (Marois et al., 2002) conducted cDNA AFLP analysis of pepper gene expression through the comparison of the infections with X. campestris pv. vesicatoria st rain 85 10 AAD (ADD domain deletion mutant); 13 induced genes were identified, which included members of the auxin induced gene expansin gene, pectate lyases and a nth ocyanidin rhamnosyl transferase genes The expression of tomato genes was also monitored upon inoculation of isogenic X. campestris pv. vesicatoria ( Xcv ) strains differing only in the avrXv3 gene which elicit s a resistance response in tomato; 139 genes and 1,294 genes were observed to have significant changes in trans cript levels at 8 h and 12 h post inoculation respectively (Balaji et al., 2007) In particular multiple genes were characterized as be ing involved in effector mediated susceptibility or resistance. The AvrBs3/PthA proteins are distinguished in inducing plant target genes (more details in next chapter). The transformation with avrBs3/ pthA genes avrXa7 avrXa10 and apl1 abolished the HR in tobacco leaves elicited by Pseudomonas fluorescens resulting in the suppression of defense response related genes which included PAL ( Phenylalanine ammonia lyase) PR1 ( pathogenicity related 1), and RbohB ( NADPH oxidase gene)

PAGE 45

45 (Fujikawa et al., 2006) Two type III effectors from X. campestris pv. vesicatoria ( Xcv ) XopB and XopS, which contributed to increased disease symptom s and bacterial population, we re demonstrated to suppress the basal defense response acting downstream or independent of MAPK activation (Schulze et al., 2012) In plants, an astonishing number of components in PTI associated with receptor kinase in plasma membrane (like FLS2, BAK1, RIN4 and PBS1), chloroplast, vesicle trafficking, MAPK signaling, and nucleus were targeted by effectors; nevertheless most of them were identified through pr otein protein interaction approaches, and were determined to be substrates of the effectors and key modules in response to effectors by form ing a protein complex, although they were not necessarily affected in transcription level (Deslandes and Rivas, 2012; Feng and Zhou, 2012) However, the family of TAL effectors i ncluding PthA4 is an exception in that they directly target the promoter of host genes rather than th e translated proteins, and they fortify the genes a t the mRNA level. Results Microarray Analyses Overview To gain insight into the genes involved in PthA4 based plant susceptibility, one of the sweet orange citrus varieties, Valencia was inoculated wi th wild type Xcc306 (WT) and the less aggressive mutant Xcc306 pthA4 (MU). Infected leaf tissue was sampled at 6 hpi, 48 hpi and 120 hpi, and global transcriptome profiles were examined through microarray analysis upon comparing the infiltrated tissues of these near isogenic strains. The expression fold changes of expressed sequence tags (ESTs) in citrus genome GeneChip array from Affymetrix were evaluated, which contains 30,171 probesets representing up to 33,879 citrus transcripts. The annotations of those ESTs were obtained from HarvEST:Citrus software which was originally released by the

PAGE 46

46 USDA/CSREES Plant Genome program ; the sequences and annotation information of the probesets was also deposited in PLEXdb ( http://w ww.plexdb.org/modules/PD_probeset/annotation.php?genechip=Citrus ). The genes with expression fold change equal to or greater than 3.0 (log fold change of 1.58, adjusted P defective strain were cons idered as differentially expressed (DE) genes at a statistically significant level in this study In this study, we concentrated on the DE genes between infection of WT and MU at 48 hpi (48 hpi WT versus MU), which are supposed to be a demonstration of mol ecula r response to PthA4 mediated susceptibility. Quantitative reverse transcription PCR (q RT PCR) was conducted to verify the reliability of the microarray data with randomly selected gene specific primers. Through q RT PCR analysis the selected gene exp ression data at 48 hpi were in consistent with their expression in microarray to some extents as shown in Figure 3 1 which potentially validate the overall microarray results At 6 hpi and 120 hpi, the DE genes were also recorded to observe the dynamic s o f PthA4 specific response In addition, the genes that changed in mRNA level were further reported by comparing the gene expressions at different time points after WT or MU infiltration, which may reveal the molecular process of disease development. The DE genes were then assigned to different categories based on putative functions using three different programs, MapMan software (Thimm et al., 2004; Usadel et al., 2005) BLAST2GO software (Conesa et al., 2005) and the web based Singular Enrichment Analysis (SEA) tool in AgriGO program (Du et al., 2010)

PAGE 47

47 The microarray data showed that at 48 h after infiltration, a total of 1895 probe set s behaved as DE genes, and accounted for 4.35% of the total transcripts in the citrus GeneC hip. 1311 of those citrus gen es were up regulated following invasion of Xcc306 relative to that of Xcc306 pthA4 and they were regarded as genes induced by PthA4, while 584 genes were significantly suppressed by PthA4. Then they were functionally categorized according to their similar ity to genes with known function s in plants. Up Regulated Genes at 48 h pi Based on WT v ersus MU Infection MapMan analysis. Firstly, we found that t he highest up regulated genes were related to cell wall metabolism (pectate lyase, expansin, pectin methyles terase inhibitor, cellulase, polygalacturonase) through the blast of DE genes MapMan Wilcoxon Rank Sum Test was employed to classify the DE genes and calculate whether the probability that the DE genes assigned to a BIN or sub BIN (function category) was statistically different from all other BINs or sub BINs ( P value < 0.05), which gave an informative snapshot of citrus response to PthA4 mediated Xcc306 invasion. According to the test, the main significantly up regulated categories were related to cell wa ll, DNA synthesis/chromatin structure and protein synthesis ( Table 3 1 ) The PthA4 induced genes that related to cell wall mainly focus on cell wall degradation and modification ; in the category of DNA synthesis, primarily the histone related genes were si gnificantly induced. Moreover, the genes expressing ribosomal protein synthesis represented most of the up regulated genes that are involved in protein synthesis. However, s ome of the categories, such as phenylpropanoids and brassinosteroid metabolism, and bZIP transcription factor family members, did not contain large number s of up regulated genes although the category was significant ly induced ( Table 3 1 ) Although less

PAGE 48

48 signif icantly enriched, it is worth mention ing the presence of other bins that contain ed abundant and relatively high proportions up regulated genes ( have more than 10 elements P value >0.05). The proportion of each annotated category is displayed in Figure 3 2 These categories include lipid metabolism, hormone metabolism, stress, nucleot ide metabolism, miscellaneous enzyme families, transcription regulator, protein, signaling, cell, development and transport. The up regulated genes in lipid metabolism were almost evenly distributed into the sub BINs. The hormone metabolism category includ es auxin, brassinosteroid, and gibberellin related genes. The activated genes in category of transcriptional regulator mainly include the transcription factors WRKY domain family, Basic Helix Loop Helix (bHLH) family, bZIP transcription factor family, SET domain transcriptional regulator, and chromatin remodeling/assembly factors. In addition to protein synthesis, the induced genes that are involved in protein synthesis are also largely associated with posttranslational modification and ubiquitin degradatio n. The up regulated gen es in the signaling category were enriched in receptor kinases, calcium and G protein pathways. However, the functions of a large number o f up regulated genes (40.8%) were unassigned, and included no reliable homology to genes deposi ted in public databases or unknown functions. Classified by BLAST2GO software. To better understand the range of genes in response to PthA4 related invasion, Gene Ontology (GO) annotations using BLAST2GO software with tBLASTx (e value 10 6 ) were also performed to assign the DE genes to functional categories with respect to three Gene Ontology vocabularies, which included biological process, molecular function and cellular component. The software returned annotations for 519 sequences of t he up regulated genes (71.3%). The

PAGE 49

49 distribution of the GO functional terms revealed that in the secondary level of biological process, cellular process and metabolic process were the most represented ones, and the other categories included primary metaboli c process, regulation of cellular process, response to stress, DNA metabolic process, DNA replication, cellular biosynthetic process, oxidation reduction process, gene expression, cell wall organization and so on. In term of molecular function, binding and catalytic activity possessed a higher proportion of up regulated genes, which were further divided into categories of protein binding, ATP binding, DNA binding, cation binding, hydrolase activity, protein kinase activity, transferase activity and oxidored uctase activity. When the cellular component was concerned, most of the up regulated genes were enriched in cytoplasm, intracellular organelle, plasma membrane, nucleus, cell periphery, cell wall and plastid ( Figure 3 3 ) KEGG annotation. The biological in terpretation of the up regulated genes that encoded enzymes was further performed using Kyoto Encyclopedia of Genes and Genomes (KEGG) annotation by BLAST2GO. It showed that the most prevalent pathways involved were (from the most to the least relative and more than 5 genes affiliated) starch and sucrose metabolism, pentose and glucuronate interconversions, pyrimidine metabolism, galactose metabolism, purine metabolism, and amino sugar and nucleotide sugar metabolism, of which some were in consistent with b iological processes already shown by GO analyses. Singular Enrichment Analysis (SEA) test. The enrichment analysis was also carried out by using the Singular Enrichment Analysis (SEA) tool in AgriGO program. Some of the GO terms were shown to be remarkabl y enriched of up regula ted genes

PAGE 50

50 (FDR<0.05), with a higher percentage (input in the figure) than their overall percentage in the total EST (reference in the figure) which were defined as over represented categories, and were more inclined to be up regulat ed than other types ( Figure 3 4 ) Base d on biological process es these categories mainly concentrate on DNA (protein DNA complex assembly, DNA packaging, DNA replication), cell wall (cell wall organization and modification), and metabolism (carbohydrate, s ucrose and starch metabolic process), while some other processes also include microtubule based movement, protein polymerization and trichome differentiation. In contrast, at least two categories, regulation of transcription and catabolic process, ar e rega rded as under represented ; they contain a lower percentage of up regulated genes than their ove rall percentage. Concerning molecular function, the up regulated genes were enriched in pectate lyase activity, pectinesterase activity, DNA dependent ATPase act ivity, motor activity, copper ion binding and enzyme regulator activity. Among them, pectate lyase, pectinesterase and enzyme regulator activity are related to cell wall organization, while DNA dependent ATPase activity and motor activity are in paralogy w ith DNA related process and microtubule based movement respectively. Conversely, the transporter activity under represented the up regulated genes. When examining the cellular component, the up regulated genes primarily over represented in the categories o f cell wall, endomembrane system, cytoplasmic vesicle, cytoskeleton, extracellular region, protein DNA complex and membrane localization The chlorop last part was under represented In con clusion, these over represented categories are logically the ones th at play essential roles in response to PthA4 dependent citrus canker.

PAGE 51

51 Comparison of two categorization systems. Although distinct annotation systems were used (MapMan and gene ontology), some of the function categories were found to be involved in PthA4 m ediated canker disease de velopment by both programs, such as cell wall degradation and modification, DNA synthesis and chromatin structure, cell wall degradation enzymes and sugar metabolism. Down Regulated G enes at 48 h pi Based on WT v ersus MU The PthA4 dependent down regulated genes were also annotated and categorized using MapMan, BLAST2GO and AgriGO. Since these genes were suppressed in the susceptible reaction, we can reasonably consider most of them are involved in plant defense rather than disease d evelopment, or t hey are essential for the normal plant growth and development which were inhibited by the invasion of pathogens. MapMan analysis. In MapMan Wilcoxon Rank Sum Test, the process es relating to photosynthesis, development, stress related PR pr oteins and receptor kinases signaling were the significantly down regulated categories ( Table 3 1 ) As expected, they were associated with plant resistance response and plant growth, which were restricted by pathogen attack In addition, as was observed wi th up regulated genes, several BIN s contain a substantial number and portion of down regulated genes although they were not significantly altered; these include lipid metabolism, amino acid metabolism, secondary metabolism, hormone metabolism, miscellaneou s enzyme families, regulation of transcription, protein, minor CHO metabolism, and transport ( Figure 3 5 ) BLAST2GO analysis. In BLAST2GO analysis, 441 (75.5%) of the down regulated genes were annotated and categorize d into GO terms ( Figure 3 6 ) In

PAGE 52

52 biolog ical process, the largest classes in the secondary categories included metabolic process, cellular process, and response to stimulus were ; the higher level GO terms included oxidation reduction process, cellular biosynthesis process, response to light, def ense response, regulation of cellular process, and transport constituted the majority of down regulated categories. In terms of molecular function, the largest sets of down regulated genes were binding and catalytic activity, which were sorted into several major groups such as oxidoreductase activity, metal ion binding, electron carrier activity, endopeptidase inhibitor activity and others. In addition, for cellular component class, the major ity of down regulated genes code for proteins localized in cytopla smic part, followed by intracellular membrane bounded organelle, chloroplast and cell periphery. KEGG pathway analyses. Furthermore, through KEGG pathway analyses, the down regulated genes were predominately involved in pathways of flavonoid biosynthesis, phenylpropanoid biosynthesis, glycolysis / gluconeogenesis, phenylalanine metabolism, glycine, serine and threonine metabolism, tyrosine metabolism, tryptophan metabolism, isoquinoline alkaloid biosynthesis, galactose metabolism, alpha Linolenic acid meta bolism, phenylalanine, tyrosine and tryptophan biosynthesis and aminobenzoate degradation. Singular Enrichment Analysis (SEA) interpretation. By using SEA tool in AgriGO, the significant down regulated catego ries (FDR<0.05) were explored ( Figure 3 7 and Ta ble 3 2 ). With regard to biological process, it showed that the secondary metabolic process (include phenylpropanoid biosynthetic process), aromatic compound biosynthetic process (include L phenylalanine metabolic process), organic acid biosynthetic proces s (include monocarboxylic acid metaboli c process), amino acid

PAGE 53

53 metabolism lipid biosynthetic process, electron, peptide and carbohydrate transport were significantly repressed in PthA4 dependent Xcc306 infection. In molecular function, the over represented categories were primarily catalytic activity (enzymes include oxidoreductase, monoxygenase, lyase, UDP glycosyltransferase, glucosyltransferase), transport (especially sugar transmembrane transporter and symporter activity), binding (iron ion binding and heme binding) a nd enzyme inhibitor activity. With regard to cellular component, the down regulated genes were significantly concentrated in cell wall, photosystem, thylakoid and organelle subcompartment. From these classifications, it indicates that the ph otosynthesis related categories were interpreted as be ing significantly enriched for down regulate d genes, which is consistent with the MapMan annotation. However, the significantly down regulated metabolic process, transport and binding functions that app eared in AgriGo analysis were not show n to be significant in the MapMan test, although it is possible that overlaps exist between the functional categories in different annotation s ystems. On the other hand, the P value calculation method and significance cutoff may also contribute to the divergence, since MapMan analysis did not classified several categories as significan t altered ones, and contained lots of down regulated genes Comparison of Down Regulated and Up Regulated Genes Distribution at 48 hpi W T versus MU When comparing the categorization of up regulated genes and down regulated genes, it is not eworthy to extract the categories that contain sharp ly different number of these two type of genes If a category contain much more up regulated genes th an down regulated genes, we may come to the conclusion that this category is preferentially induced by PthA4 depede nt Xcc306, and vice versa. This hypothesis will

PAGE 54

54 help in more precisely interpret ing the overall functions of up regulated genes and down regu lated genes. Comparison of the categories of up regulated and down regulated genes sorted by MapMan. First, several up regulated genes were determined to participate in nucleotide metabolism, TCA, ATP synthesis, while none of the down regulated genes were involved, and conversely, some vitamin metabolism associated genes were suppressed but none were induced ( Figure 3 2 and 3 5). Intriguingly, some categories that were enriched for down regulated genes contained only limited numbers of up regulated items ( such as photosynthesis, secondary metabolism, hormone metabolism, biotic stress, cytochrome P450, transport, glucosyl and glucoron yl transferase), while there were also categories with a large number of up regulated genes that contain ed only few down regul ated elements (included cell wall, glucosidase and galactosidase, DNA, protein synthesis, nucleotide metabolism, G protein signaling and cell) ( Figure 3 8 A) The gene with differentiated expressions and their corresponding categories were also displayed in MapMan visualized pathway diagram, with red being up regulated and blue being down regulated ( Figure 3 8 B), an alternative but more graphi c and straightforward way to show the DE genes affiliation s Distribution of Sub BINs for down regulated genes that are different from for up regulated genes. Although the up regulated and down regulated genes were assigned to some common BIN s, they were largely distributed in different sub BIN s. Most of the down regulated genes involved in lipid metabolism process belo ng to lipid degradation related family; in amino acid metabolism, mainly the expression of amino acid synthesis related genes was inhibited; the secondary metabolism predominantly

PAGE 55

55 included isoprenoids, phenylpropanoids and flavonoids metabolism; in hormone metabolism, ethylene and jasmonate associated genes occupied a large portion ; cytochrome P450, UDP glucosyl and gluco ronyl transferases were dominant in miscellaneous enzyme category; no transcription factor families was prevailing in the RNA group; in pr otein, lots of suppressed genes were associated with posttranslational modification and protein degradation; and in transport, the sugar, ABC, and peptides transporter categories contain ed more down regulated genes than other sub BIN s. There were also 36. 8% of the down regulated genes with unassigned functions which did not show any similarity to proteins present in public databases ( Figure 3 5 ) Comparison of the categories between up r egulated and down regulated gene sets that are classified by BLAST2 GO. The distributions of the BLAST2GO generated categories for up regulated genes and down regulated genes were compared ( Figure 3 3 and 3 6 ). I ntriguingly, while the distribution pattern s of up and down regulated genes was very similar obviously more pr oportion of up regulated genes than down regulated genes involved in cellular organization or biogenesis, development process, structural molecular activity and binding than that of, and conversely, metabolic process, response to stimulus, immune system, t ransporter activity, electron carrier activity, enzyme regulator activity, catalytic activity and membrane contained more percentage of down regulated genes Particularly, the categories of cell proliferation and membrane enclosed lumen contained 35 up reg ulated genes while no down regulated genes was involved.

PAGE 56

56 Characterization of DE Genes Following Inoculation of WT Relative to MU at 6 hpi and 120 hpi Number of DE genes. The differential ly expressed genes with comparison of WT versus MU at both 6 hpi and 120 hpi were annotated and classified by using MapMan and AgriGo SEA. There were 29 genes and 913 genes up regulated at 6 hpi and 120 hpi respectively when comparing the expression level of wild type Xcc306 over mutant Xcc306 pthA 4 infection. In the meanti me, 233 and 1094 down regulated genes were observed at these two time points respectively. MapMan analysis. In MapMan study, when comparing the citrus gene expression s between the infection of wild type and mutant, very few categories showed a significan t difference at 6 hpi especially for up regulated ones while at 120 hpi, a large amount of genes as well as function al categories exhibited sign ificant expression changes ( Table 3 3 ) At 120 hpi, the significant up regulated categories included cell wall degradation and modification, lipids synthesis, auxin response, redox regulation, development and transport. Meanwhile, the significant down regulated categories were comprised of more categories including photosynthesis, cell wall, lipid metabolism, stres s, miscellaneous enzymes, regulation of transcription, protein, minor CHO metabolism, light signaling, cell, gl ycolysis and TCA transformation. When compared categories that showed significant expression changes upon WT vs. MU infiltration between 48 hpi a nd 120 hpi, only the cell wall, photosynthesis and stress were shared in both time points. The distinct DE categories between these two time points may account for the disease development and plant physiological development since the pustule formation sym ptoms are only visible after 4 days post infiltration

PAGE 57

57 Mercator analysis of the DE categories. The partitions of overall MapMan categories for the DE genes at 6 hpi and 120 hpi were carried out, considering the small number of genes up regulated at 6 hpi; only the genes down regulated at this time wer e sorted. At 6 hpi, when excluding the unassigned genes (39.5%), the highest percentage of down regulated genes were in the categories of transport (half ABC transporter), stress (biotic), signaling (primarily receptor kinase), miscellaneous enzyme s, RNA regulator and secondary metabolism (mainly Phenylpropanoids) ( Figure 3 9 A ). At 120 hpi, 43.5% of the up regulated genes and 38.6% of down regulated genes were not assigned to any of the categories. In respect to the percentages of each functional cate gory they were compared between up regulated and down regulated data sets ( Figure 3 9 B and C ). We noticed that cell wall, cell and DNA categories contained a large portion of up regulated genes while it in cluded few down regulated genes; in contrast, the proportions of photosynthesis and secondary metabolism were high in down regulated categories while they were drastically low in up regulated ones. Singular Enrichment Analysis (SEA) study. In AgriGO SEA analysis, t he categories that significantly enriched for DE genes were largely different when compared 6 hpi with that of 48 hpi and 120 hpi in respect to WT versus MU But multiple GO categories were significantly affected by PthA4 simultaneously at 48 hpi and 120 h pi ( Table 3 2 ). After 6 h of inoculation, no category was found to be significantly up regulated by PthA4. The defense related (such as innate immune response, defense response, programmed cell death, ubiquitin ligase activity), carbohydrate binding and FA D binding categories were found to be over represent ed in the down regulated genes only at 6 hpi, which indicated that the Xcc306 secreted effector repressed the plant

PAGE 58

58 basal defense a t an early time of the infection. The over re presented categories were th en compared between 6 hpi, 48 hpi and 120 hpi ( Table 3 2 ) The down regulated genes were significantly enriched in carboxylic acid biosynthetic process and heterocycle biosynthetic process at both 6 hpi and 48 hpi, but not at 120 hpi, while enriched in car boxylesterase activity only at 6 hpi and 120 hpi. Moreover, oxidoreductase activity and lyase activity categories were significantly down regulated at all three time points. Apart from these two classes, most of the DE genes had very close distribution pat terns at 48 hpi and 120 hpi. Uniquely, the categories of protein polymerization, cell wall modification, pectate lyase activity, chromosome, amino acid derivative biosynthetic, L phenylalanine metabolic process, electron transport, carbohydrate transport, peptidase inhibitor activity, UDP glycosyltransferase activity only over represented the DE genes at 48 hpi, while regulation of cell cycle, lipid localization, cell division, nuclear division, res ponse to gibberellin stimulus, hydrolase activity on glycos yl compounds heterocycle catabolic process protein chromophore linkage, transferase activity, transferring glycosyl groups and chloroplast cat egories specifically enriched for DE genes at 120 hpi. Commonly Differentially Expressed genes at three time po int. Then the DE genes at 6 hpi, 48 hpi and 120 hpi were also used to investigate for their overlapping through Venn diagram analysis N o gene was found to be up regulated by PthA4 based Xcc306 infection in all three of the time points. Interestingly, howe ver, 27 genes were down regulated at 6 hpi while up regulated at both 48 hpi and 120 hpi and had no explicit distributions to functional categories ( Figure 3 1 0A). Moreover, only 1 gene, Cit.57.1.S1_x_at which encodes a protease inhibitor protein was ide ntified to be down

PAGE 59

59 regulated at all three time points, ( Figure 3 1 0B) Unexpectedly, the amount and percentage of genes that were commonly regulated at 48 hpi and 120 hpi were not large, which may be due to a large number of genes involved in late disease development. These data indicated that gene expression in citrus displayed noticeable dif ferences towards early stage (6 hpi) and late stage (48 or 120 hpi) infection Reprogramming of Gene Expressions between Different Time Post Inoculations For the reas on that diversity of the DE genes at 6 hpi, 48 hpi and 120 hpi, the genome wide gene expressions in mRNA level were also compared between 6, 48 or 120 hpi for both wild type Xcc306 and mutant Xcc306 pthA4 The overlapping DE genes between WT and MU when c ompared 48 hpi and 6 hpi. The number of genes commonly changed in expression between distinct comparisons was shown in Venn diagram ( Figure 3 1 1 ). It revealed that 364 up regulated probe set s and 399 down regulated probe set s overlapped between wild type Xcc 306 and mutant Xcc306 pthA4 r egarding 48 hpi and 6 hpi, and were considered to be regulat ed by time or the environment rather than by PthA4 ( Figure 3 1 1A ) Categorization of DE genes at 48 hpi relative to 6 hpi infected by MU. After the inoculation of Xcc306 pthA4 964 probes ets were triggered and 902 were suppressed in relation to 48 hpi versus 6 hpi (fold change>3, adjusted P value <0.05). Following MapMan software test, 618 of the up regulated probe set s were assigned functions ( Table 3 4 ). The categories of lipid metabolism lignin biosynthesis, auxin responsive, biotic stress, heat stress, cytochrome P450, nitrile lyases, MYB related transcription factor family, protein (mainly posttranslational modification and E3 ubiquitin), cell division and development were significant l y induced ( P value <0.05). Other categories that contained most up regulated genes (more than 10 with p value >

PAGE 60

60 0.5) also include d photosynthesis, amino acid metabolism, secondary metabolism (predominantly isoprenoids and phenylpropanoids), hormone metabol ism (chiefly split into ABA, auxin and ethylene), redox regulation, UDP glucosyl and glucoronyl transferases, transcription factor, protein degradation, minor CHO metabolism, signaling, cell organism and transpor t. Meanwhile, the significant ly reduced expr ession categories at 48 hpi relative to 6 hpi primarily included cell wall, lipid transfer proteins, chalcones metabolism, auxin responsive, thiamine metabolism, PR proteins, drought/salt stress, redox regulation, DNA and protein, while the gene repression was furthermore substantially found in the categories such as lipid metabolism, amino acid metabolism (mainly amino acid synthesis), secondary metabolism (phenylpropanoids, flavonoide et al .), hormone metabolism (mainly auxin and ethylene), stress, cytoch rome P450, GDSL motif lipase, nitrile lyases, transcription factor (MYB domain family, Basic Helix Loop Helix family et al ), protein (postranslational modification, protein degradation),signaling (receptor kinases), cell (cell cycle and cell division) d evelopment and transport. Some of the categories were shown in a contrasting visualized diagram ( Figure 3 1 2A ). The red blocks represent up regulated while the blue ones represent down regulated, with the number of squares reflect ing the number of genes. W e can easily recognize that the categories of receptor kinase, G protein, cell wall, Flavonoids, peroxidase, phosphatases and ethylene contained much more down regulated genes, while more up regulated genes were associated with UDP Glycosyltransferases, ce ll division, dehydrogenase and ABA. Categorization of DE genes at 48 hpi relative to 6 hpi by WT T he wild type Xcc306 up regulated 1147 probes while 1119 probes were repressed at 48 hpi when

PAGE 61

61 compared to 6 hpi. Through the MapMan Wilcoxon Rank Sum analys is, the categories of cell wall degradation and modification, biotic stress, heat stress, nitrile lyase, MYB transcription factors, C2C2 like zinc finger family, DNA synthesis, ribosomal protein synthesis, signaling, G protein and transport were significan tly up regulated, while the cell wall modification, lipid transfer proteins, isoprenoids metabolism, thiamine metabolism, biotic stress (mainly PR protein), peroxidases, WRKY transcription factor family, RNA binding and light signaling were significantly d own regulated ( Table 3 4 ). Among them, cell wall degradation, cell wall modification, DNA synthesis and ribosomal protein synthesis were also significantly up regulated while PR protein related biotic stress was significantly down regulated in scenario of 48 hpi WT versus MU. The differentially expressed genes were also contrasting ly and visually shown in the MapMan Pathway diagram ( Figure 3 1 2B ) Remarkably more down regulated genes were involv ed in cytochrome P450, terpenes, flavonoids, phenylproanoids, p eroxidase, e thylene and JA than that of up regulated g enes; among them categories of peroxidase, e thylene were in line with what displayed in MU 48 hpi versus 6 hpi ( Figure 3 1 2A ). The categories containing extraordinarily more up regulated genes than down regulated genes include d classes of calcium, G protein, cell wall, cell cycle, cell division and a uxins. Singular Enrichment Analysis (SEA) study. Furthermore, the AgriGO SEA study was performed to interpret these time based comparisons ( Table 3 5 ). Afte r t his analysis, we primarily focused on the comparison s of WT 48 hpi versus 6 hpi and 48 hpi WT versus MU. It illustrated that t he significantly up regulated categories in both comparisons included starch metabolic process, sucrose metabolic process, DNA

PAGE 62

62 packaging, protein DNA complex assembly, DNA replication, plant type cell wall organization, DNA depende nt ATPase activity, copper ion binding, the localization in cell wall, membrane, cytoplasm vesicle, extracellular region cytoskeleton and protein DNA c omplex, while the common significantly down regulated categories included aromatic compound biosynthesis, lipid metabolic, electron transport, monooxygenase activity, oxidoreductase activity, peptidase inhibitor activity and heme binding. Characteristic o f DE genes when comparing 120 hpi and 48 hpi T he comparative analysis between 48 hpi and 120 hpi was conducted. At the first glance, the number of DE genes (both up regulated and down regulated) by both WT and MU with respect to this comparison was much s maller than 48 hpi versus 6 hpi comparison. The expression differentiatio n with infection of Xcc306 wild type between 48 hpi and 120 hpi was supposed to reflect both host and disease developments, which may be reinforced by the observation that categories of cell (cell cycle and division) and development were significantly up regulated as well as the significant down regulation of cell wall and lipid metabolism. Singular Enrichment Analysis (SEA) test of DE genes in comparison of 120 hpi and 48 hpi. Based on AgriGO SEA study following wild type Xcc306 infiltration, the categories of cell, development, chitin catabolic process, starch and sucrose metabolic, cellular nitrogen compound metabolic, microtubule base movement, mitosis, response to oxidative stres s, cell cycle, cell division, peroxidase activity, chitinase activity, peptidase inhibitor activity, heme binding were significantly up regulated at 120 hpi when comparing with that at 48 hpi, and the main significantly down regulated categories included c ell wall, lipid metabolism, biotic stress, oxidases, glucan metabolic

PAGE 63

63 process, lipid and peptide transport, response to auxin stimulus, developmental growth, monooxygenase activity and carboxylesterase activity ( Table 3 5 ) Materials and Methods Microarra y Experiment and Analyses Xcc306 wild type strain and Xcc306 mutant were used to inoculate sweet orange ( Citrus sinensis ) at the concentration of 5 X 10 8 cfu/ml using needle with syringe in a quarantine greenhouse facility at the Citrus Research and Education Center, Lake Alfred, FL The leaves were harvested 6, 48, 120 hours after inoculation for RNA isolation. T o allow stringent statistical data analysis t hree biological replicates were conducted and three technical replicates were pooled for each strain per time point. RNA extraction was performed by using RNeasy Plant Mini Kit (Qiagen, Valencia, CA), the quantity and quality of RNA were determined on a ND 8000 Nanodrop spectrophotometer (NanoDrop Technologies, Wilmington,DE). Microarray was conducted using Affymetrix array containing 33,000 Citrus spp. ge nes which is commercially available, labeling, hybridization, washing, scanning, and data analysis were performed at ICBR facility at University of Florida in Gainesville. Statistical tests were performed using BioConductor statistical software, open sourc e software based on the R programming language ( http://www.bioconductor.org/ ). Robust Multichip Analysis (RMA) approach was used for normalizing the raw data. Differential expression analysis was carried out usi ng a linear modeling approach and the empirical Bayes statistics as implemented in the Limma package. Differentially expressed genes only with a n adjusted P value (FDR) less than 0.05 were considered as differentially expressed genes at a statistically sig nificant level.

PAGE 64

64 Quantitative Reverse Transcription PCR Analyses The leaves were sampled 48 h after syringe infiltration (5 X 10 8 cfu/ml), the total RNA was extracted by using TRIzol Reagent (Ambion, Carlsbab, CA) following the he RNA was subjected to DNase I treatment and first strand cDNA synthesis by using the ProtoScript AMV First Strand cDNA Synthesis Kit (NEB, Ipswich, MA), two step real time PCR was performed using RealMasterMix SYBR Rox (5 PRIME, Gaitherburg, MD, USA). Th e gene specific primer sequences are listed in Table 3 2 The elongation factor gene was used as endogenous control. The 2 method was used for relative quantification. Categorization of DE G enes For MapMan analysis, the microarray data of each comparison with log2 fold change value and FDR value was loaded into the software, a fi lter with FDR<0.05 was set, the pathways were visualized in the context of built in Citrus_AFFY mapping. The data with only DE genes the corresponding log2 fold change value was also loaded, and a Wilcoxon rank sum test implemented in MapMan was used to ex tract the item number in each BIN and return BIN whose gene members exhibited a significantly different regu lation compared to all other BIN s by P value calculation. Gene ontology (GO) term and Kyoto Encyclopedia of Genes and Genomes (KEGG) annotation wer e perfo rmed to classify the function s of DE genes using Blast2GO software The high throughput sequences of the DE genes were gotten from Get Sequence tool in PLEXdb basing on Affymetrix IDs ( h ttp://www.plexdb.org/modules/tools/get_seq.php ). The putative functions were assigned through blasting, mapping annotation and InterProScan functional labeling. GO terms for each of the three main group (biological process, molecular function, and

PAGE 65

65 cellula r component) were obtained by using the combined graphs function of the software with default parameters. The KEGG analysis were performed by using the KEGG annotating function of the program. To analyze GO term e nrichment of DE gene s, SEA was performed on line through agriGO program, a GO analysis tool kit for the agricultural community ( http://bioinfo.cau.edu.cn/agriGO ) Briefly, the DE gene probe ID s were first uploaded into the agriGO, and the Citrus Affym etrix Genome Array was selected as the reference, s tatistical P values were calculated using the Fisher method, and multiple test adjustment using the Yekutieli (FDR under dependency) method. The Venn diagrams were generated by using a n online program Draw Venn Diagram ( http://bioinformatics.psb.ugent.be/webtools/Venn/ ). Discussion In this chapter, the reprograming of transcription al profiles in sweet orange was scrutinized after the infiltr ation of wild type Xcc306 and a pthA4 deletion mutant at three time point. Despite the entire Citrus Sinensis transcriptome cannot be fully represented by the citrus transcripts on the array, and the possibility of post translation modification as well as technical and statistical issues, the microarray with the GeneC hip is still the most effective tool to explore the citrus global gene expression although it is only a descriptive rather than a validation approach Without the presence of effector PthA4, t he bacteria l strain pthA4 was not able to conquer th e plant basal defense response Here, I focused on the outstanding DE genes and functional categories that were affected by infection of Xcc306 at 48 hpi relative to both infection of pthA4 at 48 hpi a nd infection of Xcc306 at 6 hpi. T hese two comparisons were considered to reflect the molecular response of plant vuln erability

PAGE 66

66 Cell Wall Associated Genes According to the MapMan function categorization, 43 cell wall related genes were signif icantly up regulated in 48 hpi WT versus MU ( Table 3 1 ), which is the BIN containing the largest number of up regulated elements. Plant cell wall is the first physical barrier for invasion by bacterial p athogens in which the bacteria employ multiple strat egies to break and traverse the cell wall. Most of the strategies are through enzymatical activity, either by secreting cell wall degra ding proteins (CWDPs) or promoting plant cell wall remodeling enzyme genes expression. The plant cell wall appositions pa pillae which are comp osed of callose, phenolics (such as lignin), hydroxyproline rich glycoproteins (e.g. expansins), cell wall polymers including pectin and xyloglucans (Underwood, 201 2) The plants CWDPs which include polygalacturonases (PGs) pectate lyases (PELs), pectin acetylesterase (PAE), expansin etc. can modify the composition and structure of wall polysaccharides, causing the disassembly of the cell wall and the increase of susceptibility, while cellulose synthase, xyloglucan specific endoglucanase inhibitor protein (XEGIP) and pectin methylesterase inhibitor (PMEI) might enhance disease resistance (Juge, 2006; Cantu et al., 2008; Enri que et al., 2011) RNAi silencing of a callose synthase gene CalS1 made citrus plant more susceptible to Xcc306 (Enrique et al., 2011) In another aspect chitinase, endo 1, 4 1, 3 glucanase, which are involved in the degradation of pathogen cell wall major components such as chitin, glucan, glucosidases and peroxidase (Escamilla Trevino et al., 2006) can inhibit the invasion of bacterial and improve plant immunity (Wan et al., 2008) According to the function al categories of the up regulated genes at 48 hpi and 120 hpi in WT vs. MU as well as that in WT 48 hpi vs. 6 hpi ( Table 3 1 4) most of the cell wall related genes are associated

PAGE 67

67 with cell wall disassembly components like pectate lyase, cellulase, expansin, endoxyloglucan transferase, PME Moreover, in the class of enzyme s (direct to KEGG and Miscellaneous enzymes family), we also found that high quantity of the up regulated genes express ed cell wall degradation related enzyme. As indicated above, a large amount of the highest up regulated genes are cell wall degr adation related, which indicats that overcomi ng the plant cell wall is very crucial for the establishments of pathogen colonization. In another aspect, it also indicate s that PthA4 may direct the disorganization of plant cell by target the genes which act as cell wall metabolism regulator. Cytochrom e P450 F amily Plant cytochrome P450 (CYP) is a group of heme containing monooxygenases, which was reported to play paramount roles in the synthesis of plant defense compounds that served as toxi c inhibitors against bacterial and fungal, such as monoterpene indole alkaloids that inhibit microtubule formation and cell division and DIMBOA that inhibits protease and oxidative enzymes in bacteria or fungi (Schuler and Werck Reichhart, 2003) Twelve hours post invasion of Xanthomonas arboricola pv. pruni the down regulation of CYP genes was the most pronounced transcriptional ch ange in peach leaves (Socquet Juglard et al., 2013) CYP genes in pepper and citrus were also found to be involved in defense responses against microbial pathogens in transcriptome analysis (Khalaf et al., 2007; Hwang and Hwang, 2010; Fu et al., 2012) In this study, the CYP and monoox ygenase activities were remarkably suppress ed by the Xcc306 when either compared to pthA4 defici ency mutant or compared to earlier response ( Table 3 2 2 5, Figure 3 8 2 7 ) In the comparison between WT 48 hpi and 6 hpi, 32 genes encoding cytochrome P450 were down regulated, while 25 and 35 CYP

PAGE 68

68 genes were down regulated at 48 hpi and 120 hpi respectively in WT vs. MU. Furthermore, from the GO enrichment analysis, monooxygenase activity was significantly repressed in all these three comparisons that associ ated with susceptible response, and the KEGG pathway analyses also showed that a large amount of monooxygenases involved metabolic pathways were down regulated. Interestingly, in the comparison of MU 48 hpi against 6 hpi, which was the possible indicator o f defense response, the cytochrome P450 category was also significantly up regulated ( Table 3 4 ) Transcription al R egulator Another important category of the DE genes is the transcription factor family which has always been widely reported to play signif icant roles in plant susceptibility and defense. The transcription factors are always associated with hormone signal transduction; for example, AP2/ERF transcription factor s are associated with JA and ET signal transduction while SA signal transduction inv olves mostly WRKY and bZIP groups (Van Verk et al., 2009) AP2/ERF transcription factors. In this study, most of the DE genes coding AP2/ERF domain transcription factor s were repressed in the susceptible reactio ns, such as in WT 48 hpi vs. 6 hpi, 48 hpi WT vs. MU 48 and in 120 hpi W T vs. MU 120 hpi, 7, 3 and 4 of the down regulated genes belonged to AP2/ERF transcription factor in these comparisons respectively, which was also one of the transcription factor categories that contain largest number of down regulated genes, indicating t hat it may be associated with the plant basal defense. AP2/ERF genes are members of ethylene response factor (ERF) subgroup of AP2 transcription factor family that specifically bind with GCC box. It was also previously suggested that AP2/ERF transcription factor family played

PAGE 69

69 important roles in dis ease resistance by involving several hormone signaling transductions (such as ethylene, jasmonic acid and salicylic acid) and coordinately integrating these pathways (Gutte rson and Reuber, 2004; Xu et al., 2011) Overexpression of the genes encoding AP2/ERF type transcription factor increase tolerances against pathogen attack in tobacco (Park et al., 2001; Zhang et al., 2009) MYB domain and related transcription factors. From this study, MYB related transcription factor genes are either up regulated or down regulated, in 48 h pi vs. 6 hpi by both WT and MU which may demonstrated that they involved plant development and ETI. In Arab idopsis, MYB transcription factors are also key agent s in reg ulatory networks controlling responses to pathogen attack, which may be attribute d to their regulation of defence related primary and secondary metabolite s (like flavonoid) (Dubos et al., 2010) AtMYB30 is an activator of HR in response against bacterial pathogens through the regulatio n of very long chain fatty acid synthesis (Raffaele et al., 2008) AtMYB96 induced disease resistance response by promoting SA biosynthesis (Seo and Park, 2010) WRKY domain transcription factors. The WRKY TFs are one of the most notable families implicated in coping with pathogen attack. They act in a complex defense response network as both pos iti ve and negative regulators, and are involved in both PTI and ETI (Eulgem and Somssich, 2007; Rushton et al., 2010) At WRKY52 works as a recessive R protein conferring resistance toward the bacterial wilt Ralstonia solanacearum (Deslandes et al., 2002) ; AtWRKY70 acts at a convergence between SA and JA dependent defense pathways to render both basal and R gene mediated defense (Li et al., 2006; Knoth e t al., 2007) ; AtWRKY72 contribute s to basal immunity

PAGE 70

70 as well as gene for gene resistance (Bhattarai et al., 2010) ; AtWRKY7 and A t WRKY11/AtWRKY17 contribute d negatively to basal resistance toward a P. syringae virulent strain (Journot Catalino et al., 2006; Kim et al., 2006) In other plant species, the WRKY genes also have vital function s in response to pathogens (Pandey and Somssich, 2009) Particularly, in citrus WRKY genes were the largest class of transcription factors differentially expressed in non host response s elicited by X. campestris pv. vesicatoria (Daurelio et al., 2013) I n this st udy, the DE genes that encode WRKY TFs are minor; however 4 wrky genes we re induced at 120 hpi with respect to WT vs. MU. T hree of them were also induced at 48 hpi vs. 6 hpi by WT, which may work as positive regulator for ETS while negative for defense in late stage s Meanwhile, five totally different wrky genes were inhibited by WT considering 48 hpi vs. 6 hpi but not in WT vs. MU; they probably played constructive roles in early plant defense response s or negative role s in ETI triggered by other effectors Family of bHLH transcription factors. The MYC family of transcription factors consists of basic helix loop helix (b HLH) proteins, although they mainly function in control of anthocyanin biosynthesis, plant cell proliferation, phytochrome signaling. T hey are also found to be involved in defense against pathogens (Kazan and Manners, 2013) AtMYC2 negat ivel y regulates the expression of defense related genes through JA pathways (Lorenzo et al., 2004) and it is r equired for the attenuation of Microbe Associated Molecu lar Patterns (MAMPs) activated d efenses trigger ed by Flg22 (Millet et al., 2010) In pepper, a cell size regulator and hypertrophy contributo r, upa20 which is induced and targeted by effector AvrBs3, encodes a bHLH transcription factor (Kay et al., 2007) Here, the expressions of three genes and five genes (two shared) encoding

PAGE 71

71 bHLH transcription factor was promoted in the comparisons of 48 hpi WT versus MU and WT 48 hpi versus 6 hpi respectively, which demonstrate d that this group of genes likely act ing as positive regulator in PthA4 mediate d susceptibility in citrus. Other factors in regulation of transcription Apart from the transcription factors discussed above, the basic leucine zipper domain (bZIP) transcription factor family also serve s as positive or negative regulator in plant path ogen interaction responses (Alves et al., 2013) In this study, two bZIP family genes were induced in 48 hpi WT versus MU and WT 48 hpi versus 6 h pi respectively, while five of this type were induced in MU 48 hpi versus 6 hpi. In addition the regulations at the chromosomal level also participate d in plant defense. The chromatin modification always happened at the PR 1 and PDF1.2 promoter, which in turn changed the plant defense status. This indicates that chromatin structure plays important roles in pathogen responses (Van Verk et al., 2009) Two probesets, Cit.6327.1.s1_at and Cit.23227.1.s1_at, which are involved in chromatin remodeling, were activated in both 48 hpi WT versu s MU and WT 48 hpi versus 6 hpi, indicating their roles in stimulating plant susceptibility. Plant Hormone Metabolism a nd Signal Transduction Plant hormones play crucial roles in plant s responding to a wide range of biotic stresses (Bari and Jones, 2009; Robert Seilaniantz et al., 2011; Meldau et al., 2012) In this study, the up regulated genes in comparisons of WT versus MU and 48 hpi versus 6 hpi by WT in hormone metabolism are mainly related to auxin and gibber ellin (GA) while the down regulated genes associated with horm one were primarily assigned to ethylene and j asmonate O verall, the number and percent of the down regulated genes involved in hormon e metabolism were more than those of up regulat ed genes ( Fig ure 3 2 3 5, and 3 8 A)

PAGE 72

72 Auxin It has been demonstrated that auxin is involved in the attenuation of defence responses in plants, and the pathogen infection s cause expression changes of the auxin signaling genes (Bari and Jones, 2009) It was revealed that abundant auxin related genes were repress ed in SA mediated systemic acquired resistance (SAR), which included auxin responsive SAUR (small auxin up RNA) genes and Aux/IAA family genes; the exogenous auxin application promoted the development of Pst DC3000 disease development and pathogen growth, which proved that auxin might down regulate host defence responses (Wang et al., 2007) It was also shown that blocking of auxin signaling restricted P. syringae growth and enh anced bacterial disease resistance, wh ich implicated that auxin plays a role in disease susceptibility (Navarro et al., 2006) In pepper, five AvrBs3 induced genes were identified to be homologous to members of a f amily of auxin induced genes, the SAUR family, which may play a role in cell enlargement (Marois et al. 2002) In peach leaves, two genes belonging to the auxin transport family and SAUR like auxin responsive family were suppressed at 12 hpi following the challenge by the invasive pathogen X. arboricola pv. pruni (Socquet Juglard et al., 2013) In citrus, a great number of Aux/IAA related genes were similarly down regulated by both compatible strain Xcc306 and incompatible strain Xfa C (Cernadas et al., 2008) In our study, the auxin metabolism or auxin responsive genes were also shown to promote plant susceptibility, given that the number of up regulated genes greatly exceed down regulated genes in this group in both 48 hpi WT versus MU and WT 48 hpi versus 6 hpi ( Figure 3 1 2B). Gibberellin There is also evidence suggesting that GA signaling components play critical roles in plant disease susceptibility or resistance. By stimulating degradation

PAGE 73

73 of the grow th repressor DELLA protein GA lead s to increased SA promoting resistance to biotrophs and susceptibility to nectrotrophs pathogens through the modulation of reactive oxygen species ( ROS ) levels in plants since the exogenous usage of GA resulte d in enhanc ed resistance to Pst DC3000 and susceptibility to A. brassicicola in Arabidopsis (Achard et al., 2006) However, the mechanism how GA functions i n the defence or susceptibility responses to pathogen is largely unkn own G ibberellic acid stimulated Arabidopsis (GASA) hom ologues, involved in GA biosynthesis and cell organization, were strongly induced by Xcc306 and Las in both this study and previous stu dies (Cernadas et al., 20 08; Albrecht and Bowman, 2012) The expression of variou s citrus cell remodeling enzyme gene s including cellulases pectinesterases, expansin and galactosyltransferase that are induced in Xcc306 infection were rapidly and commonly affected by auxin and g ibbe rellin. Interesting ly exogenous addition of auxin to infected plants promoted citrus canker development whereas an inhibitor of gibberellin synthesis significantly hindere d the auxin induced transcription and the appearance of canker lesions demonstr ating that crosstalk may control citrus plant cell division and expansion triggered by Xcc (Cernadas and Benedetti, 2009) Four GA related genes were up regulated in 48 hpi WT versus MU and WT 48 hpi versus 6 hpi while only one was down regulated in the scenario ( Figure 3 8 B ). This demonstrated that GA associated genes preferentially attenuate d disease defense response Ethylene and Jasmonate Ethylene (ET) is a principal modulator in relation to a plants reaction to microbial p athogen attack. ET biosynthesis is activated by challenge with pathogens and in turn induces antimicrobial related genes as well as defence related genes through a cascade of signaling pathways including AP2/ERF and

PAGE 74

74 EIN3/EIL type transcription factors, sug gesting that the role of ET (synthesis and signal ing ) might be more associated with disease resistance than susceptibility in host pathogen interactions (Broekaert et al., 2006) ET biosynthes is and perception promote defens e response in citrus fruit against the fungus Penicillium digitatum infection (Marcos et al., 2005) Jasmonates (JA) modul ate defens e against necrotrophic pathogens through the coronatine insensitive 1 (COI1) F box protein (Sheard et al., 2010) The concentration of JA was shown to increase in pathogen infection sites (Lorenzo and Solano, 2005) From Figure 3 8 B and Figure 3 1 2B, we can clearly observe the expressi on patterns of ET and JA were co nverse with that or GA or auxin. I n other words, they conta ined many more down regulated genes than up r egulated genes considering both 48 hpi WT versus MU and WT 48 hpi versus 6 hpi indicating their positive roles in plant disease defense which is in agreement with previous reports ( Broekaert et al., 2006) Others. Other plant hormones, such as salicylic acid (SA) and brassinosteroids (BA s) and their signaling were also broadly reported to be involved i n the modulation of plant defense response. However, very few DE genes were fall into these two classes. One explanation for the SA category not being identified in this study is th at these genes are generally involved in system ic resistance. Photosynthesis Notably, the photosynthesis category was tre mendously down regulated following infiltration with Xcc306 relative to that with hpi and 120 hpi as well as in the scenar io with WT infection at 48 hpi versus at 6 hp i ( Table 3 1 2 3, Figure 3 5 2 8 A, 2 9C). The expression of global photosynthesis related genes were well documented to be repressed upon pathogen assault in

PAGE 75

75 previous studies (Zou et al., 2005; Bonfig et al., 2006; Bilgin et al., 2010; Fu et al., 2012) The regulatory sets of the photosynthesis genes al so include genes coding for electron transport, ATP synthase and carbon metabolism some of which were also shown to be down reg ulated ( Table 3 3 2 5, Figure 3 7 A) The decreased rate of photosynthesis was associated with an early increase in cell wall in vertase activity, which cleave d sucrose in the apoplast into hexoses (glucose and fructose), leading to an accumulation of hexoses (Swarbrick et al., 2006; Berger et al., 2007) ; this was in agreement with the induc tion of sucrose metabolism related genes. Most of the down regulated photosynthesis gene products target to the chloroplast and thylakoid. The reduction of photosynthesis proteins is regarded as the adaptive consequences of pathogen attack rather than a co ntributor to plant vulnerability, since it also uniformly happened following other biotic or abiotic stresses (such as drought, salinity and temperature) Photosynth ate is the energy source for both the plant and pathogen. After attack, the plant require s the investment of energy supply from the photosynthetic pathway to be redirected to defense machinery supporting plant fitness Plant Defense Components Plant defense components were defined as the plant defense response indictors, the secondary meta bolis m products that prevent pathogen invasion. PR proteins. Accumulating evidences has shown that the plant PR (pathogenesis related) proteins were antimicrobial compounds and played critical roles in plant defense rather than in pathogenesis (Ryals et al., 1996; Sels et al., 2008; Fu and Dong, 2013) ; they are generally considered as markers for defense response to biotic stimulus The expressions of PR 1 (unknown functions), PR 2 1, 3 glucanase) and PR 5 (encoding a thaumatin like protein), were induced during the

PAGE 76

76 onset of salicylic acid mediated systemic acquired resistance (SAR), acting as readouts of SAR. Proteinase inhibitors (PIs), member of the PR6 family, play e ssential roles in plant defense re sponse against pathogens by compromising the ir ability (Solomon et al., 1999; Sels et al., 2008) The expression of most putative PR gene families in C. sinensis leaves were suppre ssed following infection of Citrus leprosis virus (CiLV), while few were induced, although the patterns varied in the response of different pathogens as well as different citrus species (Campos et al., 2007; Khalaf et al., 2011) From the transcriptional profiles in the comparison of WT and MU infection at 48 hpi and the comparison of 48 hpi vs. 6 hpi by WT infection, the PR protein category, which contained abundant repressed genes, was significantly down regulated ( Table 3 1 2 4). Phenylpropanoids and PAL. Another group of defense related compounds is phenylpropanoids, which func tion as antimicrobial compounds. These are well known for play ing important roles in resistance to pathogen attack (Dixon et al., 2002) Phenylpropanoid derivative s include lignin, ligna ns, coumarins and flavonoids. Phenylalanine ammonia lyase (PAL) is the key branch point enzyme for the biosynthesis of phenylpropanoids f rom phenylalanine, and is widely known to be induced upon pathogen attack (Dixon and Paiva, 1995) The biosynthesis of flavonoids complex requires multiple enzymes including chalcone synthase (CHS), cytochrome P450 monooxygenases etc., and flavonoid pathway genes in several species were activated in defence response s elicited by different pathogens (Naoumkina et al., 2010) In our study, a considerable number of genes that are involved in phenylpropanoids metabolism (especially lignin biosynthesis) were down regulated in all three comparisons of WT 48 hpi vs. 6 hpi, 48 hpi WT vs. MU and 120 hpi WT vs. MU (20, 21

PAGE 77

77 and 28 genes involved respectively) ( Table 3 2 ) In addition, the category of phenylpropanoid biosynthetic process es was significantly down regulated at both 4 8 hpi and 120 hpi wh en compared to the wild type and mutant inoculation. Also, the KEGG pathway analysis also show ed the remarkably down regulation of flavonoid biosynthesis and phenylpropanoid biosynthesis pathways at 48 hpi. Categories Associa ted w ith B asal Defense Protein ubiquitination (especially by E3 ubiquitin ligase ) and degradation has been implicated in plant defense response either accomplished by PTI (PAMPs triggered immunity) or ETI (effector triggered immunity) (Yang et al., 2006b; Trujillo et al., 2008) The plant employ an intricate ubiquitin proteasome system to recognize and degrade the foreign effector molecules (Craig et al., 2009) To interfere with plant immunity, bacterial effectors need to destro y some key fact ors in this system. The silencing of genes encoding cellular ubiquitin which involved the proteasomal protein degradation pathway, induce extreme susceptibility of the transformed barley ( Hordeum vulgare ) towards the host fungus pathogen Bl umeria graminis f. sp hordei that cause powd ery mildew (Dong et al., 2006) I n the presence of PthA4, many genes that participate in ubiquitin degr adation were up regulated Receptor like kinases (RLKs) which are critical for the recognition of pathogen associated molecular patterns (PAMPs) like bacterial flagellin and elongation factor (EF Tu), are involved in basal defense and trigger ing plant immunity response. To date, typically almost all confirmed RLKs that contain a non arginine aspartate (non RD) kinase motif are involved in the recognition of multiple conserved microbial signatures and confer broad spectrum resistance (Schwessinger and Ronald, 2012) The receptor kinase class is extremely over repre sented in the type I II effector suppressed data sets

PAGE 78

78 (Truman et al., 2006) A receptor like kinase protein, XA21 in rice ( Oryza sativa ), was revealed to confer gene for gene resistance to X. oryzae pv oryzae the causal agent of bacterial blight, through interacting with an E3 ubiquitin ligase XB3 (XA21 binding p rotein 3) (Wang et al., 2006) From Figure 3 8 B and Figure 3 1 2, although a sub stantial number of DE genes was assigned to receptor kinases category, the number of up regulated genes and do wn regulated genes included did not greatly differ B inding Binding is a n important category in respect to molecular function. By comparing of 48 hpi WT versus MU, the binding group contained a large number of DE genes, while the percentage of up regul ated genes involved in binding was much higher than that of down regulated genes ( Figure 3 3 2 6). In more detail, the up regulated genes were mainly enriched in copper ion binding, while the down regulated genes were primarily enriched in heme binding ( T able 3 2 ). Copper ion binding. C opper is an important agent in growth of Xanthomonas spp. I t diminishes their population on leaf surface s whi le copper based bactericides have been an effective control measure for citrus canker (Graham et al., 2004) X. oryzae pv oryzae (Xoo) strain PXO99 uses the suscept ibility protein Xa13 cooperatively with two other proteins, COPT1 and COPT5 to remov e copper from leaf surface and promote its multiplication and spread; the modulation of copper redistribution was proposed as a mechanism for bacterial virulence (Yuan et al., 2010) Copper ion binding activity may be a part of copper redistribution to protect the plant from bacterial invasion or sponsor the colonization of bacteria In three comparison s WT 48 hpi versu s 6 hpi, 48 hpi WT versus MU and 120 hp i WT versus MU, the class of cop per ion binding was significantly up regulated in SEA test ( Table 3 2 Table 3 5 )

PAGE 79

79 ATP binding. ATP binding cassette ( ABC ) transporter s are pathogen induced (few repressed) and required fo r re sistance responses to pathogens. T hey direct the transport of plant metabolites out of the local cell in order to restrict the pathogen in the apoplast (Wanke and Kolukisaoglu, 2010) Arabidopsis ABC trans porter AtPEN3 /PEN8, contributes to non host resistance to B. graminis and Phytophthora infestans by halting fungal penetration (Stein et al., 2006) ATP binding category was f ound to be significantly up regulate d at 48 hpi by WT relative to 6 hpi. Other bindings. Heme binding may be involved in cytochrome P450 activities (Li et al., 2008) Limited knowledge about the relevance of zin c and other cation ion binding to pathogen attack is ava ilable and remains to be determined. Other Important Categories Lipid metabolism. Lipids are basic components of plant cell membranes and provide fundamental energy for metabolic activities L ipid metabolism was regarded as an important pathway in plant s responding to pathogens (Sha h, 2005) JA, one of the best studied signal molecules shown to be critical in the plant response to disease, is a lipid derived metabolite. One of the lipid component fatty acids (FAs), work as source of reserve energy and, are mainly considered to play passive roles in plant pathogen defense while their breakdown products are able to induce defense response (Kachroo and Kachroo, 2009) Overexpression of Arabidopsis gene ACBP3 which serves critical roles in lipid metabolism, enhanced plant resistance to Pseudomonas syringe pv tomato DC3000 (Xiao and Chye, 2011) In this study, the lipid biosynthetic process and in particular FA synthesis was significantly down regulated in 48 hpi and 120 hpi WT versus MU. This is an indication that these type of genes may be beneficial to plant defense ( Table 3 2 Figure 3 7 ).

PAGE 80

80 UDP glycosyl transferases UDP glycosyl transferases (UGTs) belong to the family of glycosyltransferases that catalyze the transfer of nucleotide diphosphate activated sugars to secondary metabolites, leading to glycosylation (Vogt and Jones, 2000) UGTs play important and positive roles in plant pathogen interactions. Two glycosyltransferase genes UGT73B3 and UGT73B5 in Arabidopsis were notably induced following infection of Pseudomonas syr ingae pv tomato, while the mutation of these two genes exhibited decreased resistance to this pathogen (Langlois Meurinne et al., 2005) This category was also down regulated by WT relative to MU a t 48 hpi ( Table 3 2 ). Cell cycle and division. In strong accordance with the hypertrophy and hyperplasia of the cells caused by Xcc306, the expression of cell cycle, development and cell division related genes were altered preferential ly in response to wi ld type Xcc306 than to pthA4 deletion mutant. The ribosomal protein biosynthesis process was regarded to correlate with cell division. Nucleosome assembly protein (NAP1) is involved in cell cycle control, which promotes cell proliferation and cell expansi on during Arabidopsis leaf development (Galichet and Gruissem, 2006) The cytoskeleton proteins, microtubule associ ated proteins, were considered to be involved in progression of cytokinesis These categories were up regulated in 48 hpi and 120 hpi in respect to WT versus MU ( Table 3 1 2 2, Figure 3 4 ). Molecular Events at Early Time of Infection and From Earlier Time to Later Time At 6 hpi, very few genes were up regulated when comparison were made between WT and MU infection; otherwise, lots of genes were down regulated. Astonishingly, f rom SEA categorization the down regulated genes were significantly assigned to c ategories potentially associated with plant defense, given that apart from

PAGE 81

81 the well studied gene classes (like innate immune response, programmed cell death, ubiquitin ligase ), most of the other categories were also observed to be repressed at 48 hpi and 120 hpi ( Table 3 2 ). This demonstrated that PthA4 protein molecules were delivered as early as 6 hours after infiltration to assa ult plant basal defense system but the more complicate d pathogenic systems to incite ETS were not established yet at this time point

PAGE 82

82 Table 3 1 C ategories with expression significantly changed ( P value<0.05) and corresponding DE probesets number by the infection of wild type Xcc306 relative to by mutant Xcc306 pthA4 at 48 hpi generated by MapMan software Functional categories Elements number P value 48 hpi WT vs. MU up regulated 727 Cell wall cell wall degradation cell wall modification 43 11 15 5.0 10 6 3.9 10 5 1.7 10 6 Secondary metabolism phenylpropanoids 3 8.0 10 3 Hormone metabolism brassinosteroid 2 3.4 10 2 Beta 1,3 glucan hydrolases 5 3.5 10 2 bZIP transcription factor family 4 4.3 10 2 DNA synthesis/chromatin structure 31 1.2 10 4 Protein synthesis R ibosomal protein synthesis 15 14 4.0 10 3 9.1 10 3 Signaling in sugar and nutrient physiology 2 4.0 10 2 48 hpi WT vs. MU down regulated 584 Photosynthesis 24 4.4 10 4 Light reaction 1 9 1.0 10 3 Stress stress biotic S tress biotic PR proteins 37 30 25 1.1 10 8 4.9 10 10 2.6 10 11 Protein postranslational modification in Kinase 3 3.8 10 2 Signaling receptor kinases R ecept or kinases DUF 26 8 3 1.1 10 2 8.6 10 3 Development 14 3.0 10 2

PAGE 83

83 Table 3 2 Significantly altered GO terms (FDR<0.05) according to gene expression and contained DE genes number upon the comparison between wild type and mutant infectio n at 6 hpi, 48 hpi and 120 hpi through Singular Enrichment Analysis Enrichment terms 6 hpi WT vs. MU down ( 190) 48 hpi WT vs. MU up (5 90) 48 hpi WT vs. MU down (479) 120 hpi WT vs. MU up ( 724) 120 hpi WT vs. MU down (893) Biological process Innate immune response (9) Protein DNA complex assembly (10) Secondary metabolic process (35) Protein DNA complex assembly (8) Secondary metabolic process (45) Programmed cell death (6) DNA packaging (11) Aromatic compound biosynthetic process (31) DNA packaging (8) Aromatic compound biosynthetic process (23) Defence response to bacterium (6) DNA replication (17) Monocarboxylic acid metabolic process (26) DNA replication (15) Monocarboxylic acid metabolic process (38) Protein polymerization (5) Cellular amino aci d derivative biosynthetic (27) Regulation of cell cycle (8) Reproductive process in a multicellular organism (5) Microtubule based movement (11) Phenylpropanoid biosynthetic process (18) Microtubule based movement (19) Phenylpropanoid biosynthetic proce ss (23) Carboxylic acid biosynthetic process (12) Plant type cell wall organization (12) Carboxylic acid biosynthetic process (26) Plant type cell wall organization (8) Protein chromophore linkage (5) Cell wall modification (5) Lipid biosynthetic proc ess (19) Lipid localization (5) Lipid metabolic process (44) Heterocycle biosynthetic process (7) Carbohydrate metabolic process (43) Heterocycle biosynthetic process (14) Heterocycle catabolic process (6) Photosynthesis (33) Sucrose metabolic process (14) L phenylalanine metabolic process (11) Sucrose metabolic process (25)

PAGE 84

84 Table 3 2. Continued. Enrichment terms 6 hpi WT vs. MU down ( 190) 48 hpi WT vs. MU up (5 90) 48 hpi WT vs. MU down (479) 120 hpi WT vs. MU up ( 724) 120 hpi WT vs. MU down (893 ) Biological process Starch metabolic process (14) Electron transport (26) Starch metabolic process (25) Carbohydrate transport (7) Cell division (14) Nuclear division (7) Response to gibberellin stimulus (9) Molecular function Car boxylestera se activity (8) Copper ion binding (8) Peptidase inhibitor activity (9) Copper ion binding (11) Carboxylesterase activity (22) Oxidoreductas e activity (30) Enzyme regulator a Ctivity (14) Oxidoreductase activity (53) Enzyme inhibitor activity (13) Oxidoreductase activity (91) Carbohydrate binding (6) Pectate lyase activity (5) Monooxygenase activity (17) Hydrolase activity on glycosyl compounds (28) Monooxygenase activity (26) Ubiquitin protein ligase activity (5) Pectinesteras e acti vity (7) UDP glycosyltransferase activity (14) Pectinesterase activity (9) Transferase activity, transferring glycosyl groups (30) FAD binding (6) DNA dependent atpase activity (6) Iron ion binding heme binding (11) DNA dependent atpase activity (7) Heme binding (20) Lyase activity (9) Motor activity (6) Lyase activity (22) Microtubule motor activity (5) Lyase activity (29) Sugar transmembrane transporter activity (6) Transferase activity, transferring acyl groups and amino acyl groups (18)

PAGE 85

85 Table 3 2 Continued Enrichment terms 6 hpi WT vs. MU down ( 190) 48 hpi WT vs. MU up (5 90) 48 hpi WT vs. MU down (479) 120 hpi WT vs. MU up ( 724) 120 hpi WT vs. MU down (893) Molecular function Oxidosqualene cyclase activity (5) Cellular component Ubiqui tin ligase complex (5) Endomembrane system (38) Thylakoid (24) Endomembrane system (50) Thylakoid (71) Cell wall (7) Anchored to membrane (8) Organelle subcompartment (16) Anchored to membrane (11) Organelle subcompartment (34) Cell wall (15) Cell wal l (18) Cell wall (19) Integral to membrane (54) Extracellular region (24) Photosystem (6) Extracellular region (23) Photosystem (20) Cytoplasmic vesicle (56) Cytoplasmic vesicle (69) Chloroplast (95) Cytoskeleton (19) Cytoskeleton (22) Prote in DNA complex (8) Protein DNA complex (6) Chromosome (11) Note: up and down represent up regulated and down regulated upon the corresponding comparisons.

PAGE 86

86 Table 3 3 Significantly changed categories in expression ( P value<0.05) and contain ed DE probesets number by the infection of wild type Xcc306 relative to by mutant Xcc306 pthA4 at 6 hpi and 120 hpi generated by MapMan software Function categories Elements number P value 6 h WT vs. MU up regulated 29 (no significant category ) 6 h WT vs. MU down regulated 233 Auxin responsive 2 1.5 10 2 Acid and other phosphatases 3 9.5 10 3 120 h WT vs. MU up regulated 913 Cell wall 53 2.9 10 3 C ell wall degradation C ell wall modification 16 16 1.4 1 0 2 3.1 10 2 Glycolipid synthesis 3 3.8 10 2 FA synthesis 2 2.5 10 2 Auxin responsive 5 1.9 10 2 Redox regulation 6 6.4 10 3 Development 23 3.7 10 3 Transport 26 5.5 10 4 S ugar transporter M etabolite transporter 3 2 2.0 10 2 3.6 10 2 120 h WT vs. MU down regulated 1094 Photosynthesis L ightreaction 73 56 5.8 10 2 1.7 10 2 Cell wall C ell wall AGPs proteins C ell wall pec tin methyl esterase 31 4 3 2.9 10 3 1.5 10 2 1.5 10 2 Lipid metabolism FA synthesis L ipid transfer proteins 31 11 4 9.0 10 3 2.5 10 3 1.7 10 2 Stress 21 4.4 10 2 Redox. glutaredoxins 5 2.8 10 2 Miscellaneous enzymes L ipid transfer protein (LTP) GDSL motif lipase N itrile lyases 117 7 17 10 4.4 10 4 2.8 10 2 3.0 10 5 1.2 10 2 RNA R egulation of transcription TCP transcription factor AP2/ERF transcription factor Aux/IAA family 50 46 5 4 4 2.0 10 4 2.3 10 3 4.6 10 2 4.7 10 2 1.3 10 2 Protein P ostranslational modification 43 9 1.9 10 2 3.8 10 2 Mi nor CHO metabolism 14 4.4 10 2 Light signaling 7 8.9 10 3 Receptor kinase 18 4.9 10 2

PAGE 87

87 Table 3 3 Continued. Function categories Elements number P value Cell C ell organisation 17 9 3.0 10 3 8.8 10 3 Glycolysis 4 1.1 10 2 TCA transformation 3 3.3 10 2 Table 3 4 C ategories with s ignificantly changed in expression ( P value<0.05) and contained DE probesets number through the comparisons of different time after infiltration of wild type Xcc306 or mutan t Xcc306 pthA4 generated by MapMan software Function categories Elements number P value MU 48 hpi vs. 6 hpi up regulated 964 Lipid metabolism L ipid degradation 9 4 3.0 10 2 8.4 10 3 Lignin biosynthesis 4 2.6 10 2 Auxin responsive 4 5.6 10 3 Stress B iotic stress A biotic stress H eat stress 75 23 51 41 3.2 10 5 1.1 10 3 7.8 10 5 5.2 10 6 Nucleotide metabolism 2 4.1 10 3 Miscellaneous enzymes C ytochrome P450 N itrile lyases 95 22 7 1.5 10 2 2.3 10 2 3.1 10 2 MYB related transcription factor 7 3.2 10 3 C2C2 (Zn) like zinc finger family 5 1.2 10 3 DNA synthesis 3 4.0 10 2 Protein P ostranslational modification E3 ubiquitin 64 15 15 3.6 10 4 1.7 10 4 3.0 10 3 Cell division 5 2.3 10 3 Development 28 4.0 10 2 MU 48 hpi vs. 6 hpi down regulated 902 Cell wall precursor synthesis 4 3.0 1 0 2 Cell wall protein 5 2.8 10 2 Lipid transfer proteins 4 4.2 10 2 Secondary metabolism chalcones 6 1.2 10 2 Auxin responsive 7 3.0 10 2 V itamine metabolism thiamine 4 5.5 10 3 Starch degradation 2 3.1 10 2 PR proteins 4 5.0 10 2 Drought/salt stress 7 7.2 10 3 Redox regulation 7 3.5 10 3 DNA 5 4.4 10 2

PAGE 88

88 Table 3 4 Continued. Function categories Elements number P value P rotein 38 3.5 10 2 G protein signal 3 4. 7 10 2 WT 48 hpi vs. 6 hpi up regulated 1147 Cell wall C ell wall degradation C ell wall modification 38 13 16 7.5 10 10 1.5 10 4 3.1 10 8 Stress B iotic stress H eat stress 75 32 33 1.8 10 2 1.4 10 2 4.3 10 2 Nitrile lyases 8 5.2 10 3 MYB related transcription factor 6 1.2 10 2 C2C2 (Zn) like zinc figure family 5 3.4 10 2 DNA synthesis 28 2.9 10 5 Ribosomal protein synthesis 15 4.1 10 2 S ignaling G protein signaling 59 11 3.6 10 3 1.2 10 2 Transport S ulphate transport 51 3 1.7 10 3 2.5 10 3 WT 48 hpi vs. WT 6 hpi down regulated 1119 Cell wall modification 4 1.5 10 2 Lipid transfer prot eins 4 4.5 10 2 Lysophospholipases 6 1.2 10 2 Secondary metabolism isoprenoids 19 5.0 10 2 Secondary metabolism chalcones 6 1.4 10 2 Thiamine metabolism 7 2.1 10 2 Stress B iotic stress PR protein P roteinase inhibitors 53 32 23 17 1.2 10 3 7.5 10 3 1.4 10 3 5.8 10 4 Peroxidases 10 3.7 10 3 WRKY domain transcription factor family 5 4.6 10 3 RNA binding 6 1.3 10 3 Light signal ing 3 5.3 10 3 MU 120 h vs. MU 48 h up regulated 136 Oxidases 3 1.2 10 2 Receptor kinases 2 4.7 10 2 MU 120 h vs. MU 48 h down regulated 237 L ipid degradation 4 2.9 10 3 Jasmonate metabolism 2 2.5 10 2 Stress PR proteins P roteinase inhibitors 40 17 14 2.2 10 2 2.2 10 3 1.1 10 4 Cell organisation 3 2.7 10 2

PAGE 89

89 Table 3 4. Continued. Function categories Elements number P value WT 120 h vs. WT 48 h up regulated 468 Cell C ell cycle 27 9 1.9 10 2 1.2 10 2 Development L ate embryogenesis abundant 17 3 1.3 10 2 1.3 10 2 WT 120 h vs. WT 48 h down regulated 552 Cell wall C ell wall AGPs protein C ell wall modification C ell wall pectin methyl esterase 24 4 5 3 1.6 10 2 3.8 10 3 1.4 10 3 1.7 10 3 Lipid metabolism FA synthesis Phospholipid synthesis 18 9 3 5.3 10 4 2.7 10 3 3.0 10 2 Biotic stress 1 0 5.7 10 3 Oxidases 5 3.9 10 2 Cell 5 1.4 10 2 Calcium transport 3 4.5 10 2

PAGE 90

90 Table 3 5 Significantly DE genes enriched GO terms (FDR<0.05) according to the compari son of different hours post infiltratio n of wild type or mutant through Singular Enrichment Analysis Enrichmen t terms MU 48 hpi vs. 6 up MU 48 hpi vs. 6 hpi down WT 48 hpi vs. 6 h up WT 48 hpi vs. 6 hpi down MU 120 hpi vs. 48 hpi up MU 120 hpi vs. 48 hpi down WT 120 hpi vs. 48 hpi up WT 120 hpi vs. 48 hpi down Biological process Secondary metabolic process Chitin catabolic process Aromatic compound biosyntheti c process Chitin catabolic process Chitin and glucose catabolic process Starch metabolic process Starch metabolic process Starc h metabolic process Glucan metabolic process Carbohydrate metabolic process Sucrose metabolic process Sucrose metabolic process Starch metabolic process Cellular nitrogen compound metabolic process Flavonoid biosyntheti c process Cellular nitrogen c ompoun d metabolic process Flavonoid biosyntheti c process Cellular nitrogen compound metabolic process Phenylpropanoi d biosynthetic process Lipid metabolic process DNA packaging Lipid metabolic process Monooxygen ase activity Pigment metabolic pr ocess Heterocycl e biosyntheti c process Protein DNA complex assembly Electron transport Lipid transport

PAGE 91

91 Table 3 5. Continued. enrichment terms MU 48 hpi vs. 6 up MU 48 hpi vs. 6 hpi down WT 48 hpi vs. 6 h up WT 48 hpi vs. 6 hpi down MU 120 hpi vs. 48 hpi up MU 120 hpi vs. 48 hpi down WT 120 hpi vs. 48 hpi up WT 120 hpi vs. 48 hpi down Biological process Mannose, fructose, glyoxylate and inositol metabolic process Defence response, incompati ble interaction DNA dependent DNA replication Microtubule based movement Peptide transport Response to heat Response to heat Response to heat Mitosis Response to heat Response to inorganic substance Response to inorganic substance Response to chemical stimulus Response to oxidative stress Response to auxin stimulus Response to light intensity Plant type cell wall organization Cell cycle Developme ntal growth Cell division Cell division Cell wall macromolec ule catabolic process Cell wall macromolec ule catabolic process Molecular f unction Glucosyltrans ferase activity Pectate lyase activity Plant type cell wall organization Transcripti on factor activity UDP glycosyltr ansferase activity

PAGE 92

92 Table 3 5. Continued. enrichme nt terms MU 48 hpi vs. 6 up MU 48 hpi vs. 6 hpi down WT 48 hp i vs. 6 h up WT 48 hpi vs. 6 hpi down MU 120 hpi vs. 48 hpi up MU 120 hpi vs. 48 hpi down WT 120 hpi vs. 48 hpi up WT 120 hpi vs. 48 hpi down Molecular function Oxidoredu ctase activity Monooxyge nase activity DNA dependent atpase activity Monooxyge nase act ivity Oxidoreduc tase activity Dioxygena se activity Peroxidas e activity Monooxygen ase activity Chitinase activity Chitinase activity Oxidoreduc tase activity Hydro lyase activity Chitinase activity Carbohydr ate phosphata se activity Carboxylest erase ac tivity ATP binding Endopeptid ase inhibitor activity Endopepti dase inhibitor activity Endopepti dase inhibitor activity Endopeptida se inhibitor activity Chitin binding Heme binding Chitin binding Heme binding Heme binding Heme binding Carboxylest erase ac tivity Unfolded protein binding Carbohydra te binding Copper ion binding Ion binding Transmem brane transporter activity Water transmemb rane transporter activity Structural constituent of cell wall Structural constituent of cell wall Cellular co mpone nt N/A Cell wall Cell wall Cell wall N/A Cell wall Cell wall Anchored to membrane Anchored to membrane Endomembr ane system

PAGE 93

93 Table 3 5. Continued. enrichm ent terms MU 48 hpi vs. 6 up MU 48 hpi vs. 6 hpi down WT 48 hpi vs. 6 h up WT 48 hpi v s. 6 hpi down MU 120 hpi vs. 48 hpi up MU 120 hpi vs. 48 hpi down WT 120 hpi vs. 48 hpi up WT 120 hpi vs. 48 hpi down Cellular compon ent Cytoplasmic membrane bounded vesicle Cytoplasmi c membrane bounded vesicle Cytoplasm ic membrane bounded vesicle Cyt oplasmic membrane bounded vesicle Extracellul ar region Extracellul ar region Extracellular region Cytoskelet on Microtubul e cytoskelet on Protein DNA complex Note: up and down represent up regulated and down regulated upon the corresp onding comparisons.

PAGE 94

94 Figure 3 1 Quantitative RT PCR validation of selected up regulated genes in Microarray analysis. The sweet orange leave tissues were sampled 48 h after the infiltration of wild type Xcc306, Xcc306 pthA4 as well as the complement strain Xcc306 pthA4 :PthA4. Data represent the mean SD. The labels represent Affymetrix probe IDs Cit.3027.1.S1_s_at, Cit.37210.1.S1_at, Cit.2392.1.S1_at, Cit.39387.1.S1_at, Cit.5370.1.S1_s_at and Cit.7877.1.S1_at respecti vely. Figure 3 2 Pie chart demonstrating the proportions of the functional categories formed from MapMan that contain up regulated genes by infection of Xcc306 relative to mutant Xcc306 pthA4 enzym es such as cytochrome P450, invertase, protease inhibitor, glucan CHO metabolism, redox, glycolysis and fermentation. The genes with unassigned were eliminated.

PAGE 95

95 A B C Figure 3 3 Pie chart showing the proportions of the second level GO terms formed from BLAST2GO that contain the up regulated genes by infection of Xcc306 relative to mutant Xcc306 pthA4 at 48 hpi. The GO terms were divided from three large g roups, biological process (A), molecular function (B) and cellular component (C ). The number of up regulated genes in each category is also displayed.

PAGE 96

96 A B C Figure 3 4 Some of over represen ted and under represented categories in up regulated gene sets by infection of Xcc306 relative to mutant Xcc306 pthA4 at 48 hpi in Singular Enrichment Analysis (light black bar) represents the percentage out of total up regul ated genes, represented, and vice versa. The gene s were categorized based on biological process ( A ) molecular function (B ) and cellular component (C ).

PAGE 97

97 Figure 3 5 Pie chart demonstrating the proportions of the functional categories formed from MapMan that contain down regulated genes by infection of Xcc306 relative to mutant Xcc306 pthA4 includes various enzymes such as cytochrome P450, UDP glucosyl and includes major CHO metabo lism, redox, glycolysis and fermentation. The genes with unassigned were excluded.

PAGE 98

98 A B C Figure 3 6 Pie chart showing the proportions of the second level GO terms formed from BLAST2GO that contain the down regulated genes by infection of Xcc306 relat ive to mutant Xcc306 pthA4 at 48 hpi. The GO terms were divided from three large groups, biological process ( A ), molecular function ( B ) and cellular component ( C ). The number of down regulated genes in each category is also displayed.

PAGE 99

99 A B C Figure 3 7 Categories that si gnificantly contain more percentage of down regulated genes considering 48 hpi WT versus MU than their proportion s out of total categories calculated by Singular Enrichment Analysis (FDR<0.05). The reg ulated genes, total citrus ESTs number. The genes were categorized ba sed on biological process (A ) molecular function (B ) and cellular component (C ).

PAGE 100

100 A B Figure 3 8 Comp arison of up regulated and down regulated genes number regarding 48 hpi WT versus MU in some categories basing on the categorization by MapMan. A) Bar chart showing the categories with extraordinary different amount of up regulated genes (white bars) and d own regulated (black bars). B) The up regulated genes and down regulated genes assigned to some important categories are visualized by MapMan software. The scale with log2 fold change is shown.

PAGE 101

101 A B C Figure 3 9 Pie chart demonstrating the proportions of the functional categories formed from MapMan that contain DE genes by infection of Xcc306 relative to mutant Xcc306 pthA4 at 6 hpi and 120 h. A) Category partition of down regulated gene data set at 6 hpi. B) Percentages of each individual category reg arding up regulated genes number contained at 120 hpi. C) Percentages of each individual category in respect to down regulated genes number contained at cytochrome P450, peroxidases, UDP gl ucosyl and glucoronyl transferases, gluco galacto and mannosidase, protease inhibitor, nitrilase, oxidases and so on. The genes with unassigned were excluded.

PAGE 102

102 A B Figure 3 1 0 Venn diagram showing the number of up regulated or down regulated genes commonly modulated at 6 hpi, 48 hpi and 120 hpi following Xcc306 inoculation relative to Xcc306 pthA4 inoculation. A) Number of genes down regulated at 6 hpi (upper left) while up regulated at 48 hpi (upper right) and 120 hpi (lower). B) Number of overlap ping genes similarly up regulated (in black font) or down regulated (in red font) at all 6 hpi, 48 hpi and 120 hpi. The genes with fold change no less than 3 and adjust P value less than 0.05 were considered up or down regulated. A B Figure 3 1 1 Ve nn diagram showing the number of overlapped DE genes between several sets of comparisons. A) Number of genes equally up regulated (in black) or down regulated (in red) in 48 hpi versus 6 hpi consequent to wild type Xcc306 (right) and mutant Xcc306 pthA4 (left) inoculations. B) Number of genes similarly up regulated or down regulated in two comparisons, WT versus MU infection at 48 hpi (left) and 48 hpi versus 6 hpi following Xcc306 infiltration (right).

PAGE 103

103 A B Figure 3 12 Contrastive visualiza tion of up regulated genes (red squares) and down regulated genes (blue squares) in respect to 48 hpi versus 6 hpi following the challenge of both mutant Xcc306 pthA4 (A) and wild type Xcc306 (B) formed by MapMan software.

PAGE 104

104 CHAPTER 4 IDENTIFICATION AND CHARACTERIZATION OF PTHA4 TARGET GENE IN CITRUS Background Information The mechanism s for the recruitment of type III effectors to paralyze the plan t defense pathways and how these effectors a r e regulated in host context are far from understood yet. Howeve r, fortunately, the striking discovery of a type of transcriptio n activator like (TAL) effector (also TALEs) provides a relatively clear mechanism of how the effectors target and sabotage host plant, which is also the most extensive ly studied effectors in Xanthomonas TAL Effectors are the Pathogenicity a nd Avirulence Determinant TAL effectors distribution. The genes encoding TAL effector s are members of avrBs3/pthA gene family, and they are predomina nt ly present in most Xanthomonas genomes and in some R. solanacearum genomic DNA (Heuer et al., 2007; Boch and Bonas, 2010; Li et al., 2013a) After t he first functional identification of pthA gene (Swarup et al., 1991) until now, more than 100 AvrBs3/pthA family members from different Xanthomonas species and pathovars have been identified (deposited in Geneba nk). For most x anthomona d s although each contains multiple copies avrBs3/pthA family g ene, only a limited number of them have been found to be functional in contributing to major virulence determinants for the disease (Schornack et al., 2013) Also no avrBs3/pthA family genes have been described in some Xanthomonas species such as X. camperstris pv camperstris X. perforans and X. ca mperstris pv. musacerum (Moreira et al., 2004; Studholme et al., 2010; Potnis et al., 2011)

PAGE 105

105 TAL effector s in Xanthomonas citri For the citrus canker causing Xanthomonas most of the strains from Xcc type A have m ore than 3 copies of pthA genes, and the numbers of pthA gene in type A*, A W vary from 1 to 3 copies according to the strains (Lee et al., 2008) In Xcc strain K21, four avrBs3/pthA fam ily genes were identified to have very high similarity with pthA genes in strain 306 respectively. Among these four genes, hssB3.0 which is the most similar to pthA2 in strain 306 and evolves from a recombination event among the pthA hom ologs, specifically s uppressed virulence and induced a defense response i n C. grandis (cv. Otachibana), but had no function in citrus genotype such as C. sinensis A second gene pthA KC21 which corresponds to pthA4 in strain 306, had a role in eliciting hyperplastic canker sy mptom but not in water soaked lesion s ymptom formation on citrus plants (Shiotani et al., 2007) Five different Xanthomonas strains that cause citrus canker, A, A*, A w B and C, each contain s only one functional pthA homology termed pthA pthA* pthAw pthB pthC respectively, which confer typical canker disease symptom on citrus plants, but none determines the host range (Al Saadi et al., 2007) Mechanisms of TAL effectors in contributing to susceptibility and H R. The TAL effectors contribute to pathogenicity or HR various ways Some of the TAL effectors are able to suppr ess plant HR defense response. W hen transformed with avrBs3/pthA genes apl1 avrXa7 or avrXa10 Pseudomonas fluorescens compromised previously i ncited HR phenotype and the expression of tobacco HR related genes (Fujikawa et al., 2006) The TAL effector proteins so metimes also contributed to bacterial growth in the field. AvrBs3 from X. axonopodis pv. vesicatoria promoted the spread and enhanced fitness of the bacterium in the field (Wichmann and Bergelson,

PAGE 106

106 2004) The transcription factors in plant a were also demonstrated to be modulated by TAL effectors In rice, the induction o f two bZIP transcription factor gene s OsTFX1 and which mediate host susceptibility is dependent on TAL effectors PthXo6 and PthXo7 respectively (Sugio et al., 2007) The same TAL effector can also contribute to different function s in distinct plant cultivars. An AvrBs3 like effector AvrHah1 from X. gardneri was characterized to enhance virulence in the pepper cultivar ECW and also at the same time had avirulence activity to cause HR in pepper Bs3 containing line ECW 30R (Schornack et al., 2008) Secondary Structure Hallmarks o f TAL Effectors Generally in nature, a vrBs3/pthA products have nearly identical leucine rich tandem repeats of 33 35 (mostly 34) amino acids generally ranging from 12 up to 33 followed by a half repeat motif in their central portion, plus a leucine zipper re gion, three putative short nuclear localization signal sequences(NLS), an acidic transcriptional activation domain(AD) in the C t erminus and conserved N terminus for T3SS secretion and tra nslocation signals; i n particular the structure of a typical TALE, PthA4 was displayed here which contains 17.5 direct repeats as PthA (Brunings and Gabriel, 2003) ( Figure 4 1 A) In most cases, the NLS and AD domains are indispensable to the act ivities of this type of protein (Schornack et al., 2006) The importance of NLS domains was shown by nuclear localization of fusion proteins in onion bombardment experiments and g enetic studies, and was confirmed by mutagenesis experiments (Boch and Bonas, 2010) Yang et al (Yang et al., 2011) acquired transgenic sweet orange lines with citrus canker resistance by transforming pthA nls to the plant; this transformation interrupted the binding between NLS of PthA and the plant im protein, which demonstrated the importance of NLS domain in disease development.

PAGE 107

107 Furthermore, deletion of the AD can render the protein inactive and fail to trigger the target genes (Szurek et al., 2001; Rmer et al., 2007) Variation exist s between the central repeats primarily at residues 12 and 13, which are referred to as r epeat variable diresidues (RVD); the number and arrang ement of the repeat units varies between the TAL effectors, which may collectively contribute to their function al diversity, given that the N terminus and C terminus of them are highly conserved (Bogdanove et al., 2010) TAL Effectors Directly a nd Speci fically Recognize Plant Host Genes In contrast to most of the effectors achieving functional redundancy by een validated that TAL effector proteins can directly and specifically interact with the promoter of pla nt genes, with the binding sites being designated as EBEs (Effector Binding Elements) or UPT box (up regulated by TAL effectors) (Rmer et al., 2007; Hann et al., 2010) Through the interaction, the TAL effectors r egulate the transcription of plant susceptib le or resistant genes thus causing disease or hypersensitive reaction. G enes in plant targeted by TAL effectors. Recently, for example, it revealed that the repeat region of AvrBs3 directly bound to the promoter of a pepper transcription factor gene upa20 and induced its expression through the activation domain (Kay et al., 2007) The expression of a rice R gene Xa27 can be activated and cause HR after being challenged by bacteria harboring TAL effector AvrXa27 (Gu et al., 2005) Through microarray analyses a rice dominant susceptible gene Xa13 ( also known as Os8N3 ) was identified, whose transcription was activated by TAL effector PthXo1 from Xoo strain PXO99 through the dire ct binding with UPT PthXo1 box (Yang et al., 2006a; Rmer et al., 2010) Furthermore, one gene may be the target of several TAL effectors from multiple strains with the same or divergent EBEs in promoter. For exampl e, Bs3 and

PAGE 108

108 upa20 in pepper are the target s of TAL effector AvrBs3 from X. campestris pv vesicatoria and AvrHah1 from X. gardneri ; although they have 17.5 and 13.5 repeats, they contain similar RVDs so they may recognize common EBE sequences (Rmer et al., 2007; Schornack et al., 2008) Os11N3 in rice is recognized and activated by AvrXa7 and PthXo3 from X. oryzae pv oryzae PXO99 A while it is also the target of TalC from strain BAI3 of African X. oryzae pv oryza e (Antony et al., 2010; Yu et al., 2011) More UPT genes and UPT boxes are being described; Kay et al (Kay et al., 2009) identified another 11 new UPA (up regulated by Avr Bs3) genes in pepper that are induced by AvrBs3 effector, demonstrating that the UPA boxes are very conserved in pepper (TATATAAACCN2 3CC). Most of the UPT boxes are located approximately 40 80 bp upstream of the transcription start site; th ese boxes are sufficient for activation since their functionality is independent of promoter context (Rmer et al., 2009b) For different TAL effectors, they have corresponding variable UPT box with very high specificities, eve n an AvrBs3 UPA box (13 bp deletion) that cannot be recognized and activated by AvrBs3 (Kay et al., 2009) So obviously, the sequence o f the EBE or UPT box depends directly and specifically on the sequence of repeats in the TAL effectors, which is defined by both the number and order of repeat units (Herbers et al., 1992) TAL effector and DNA binding specificity Spectacularly, Moscou and Bogdanove (Moscou and Bogdanove, 2009) and Boch et. al (Boch et al., 2009) crack ed the code (called TALE code) of the interaction specificity between the RVD and EBE sequence both computationally and experimentally, with one RVD pairing to one

PAGE 109

109 specific nucleotide in the EB E, s ome repeat types are specific for a particular nucleotide whereas others recognize multiple nucleotides. A precedes the first repeat (termed repeat zero); the non RVD residues seem to have no impact or only a minor i mpact on the specificity. The one one RVD and DNA base s pecificity is shown in Figure 4 1 B RVDs and the predicted target DNA seq uence of PthA4 are exhibited in Figure 4 1 A The mutation, substitution or truncation of the UPT box can dramatically abolish t he binding activity between TAL effectors and the UPT PthXo6 UPT AvrXa7 and UPT PthXo1 boxes produced significantly reduced binding activity and inducibility that was mediated by corresponding TAL effectors (Rmer et al., 2010) Another experiment also showed that when mutated at terminal second, third or fourth nucleotide of UPT PthXo1 box, as terminal, the b inding between PthXo1 and UPT PthXo1 was not detected (Yuan et al., 2011) T he code also have lots of degen eracy, and the efficiencies of dif ferent RVDs are variable; HD and NN are st r ong RVDs while NI, NG, NH and NK are weak RVDs (Streubel et al., 2012) It has been postulated that the non optimal RVD DNA contributes more strongly than matchi ng RVD DNA to the overall interaction and these non matching combinations are length, number, position and context dependent (Scholze and Boch, 2010) For instanc e, deletion of the last three nucleotides of the predicted UPT AvrXa27 box can still trigger a hypersensitive response by AvrXa27 (Rmer et al., 2009a) ; it seems that sometimes the mismatch or om terminus may just cause t he reduction but not loss in binding activity Moreover, the TAL effector from R. solanacearum named RipTAL recognized DNA in similar manner as TALEs did, but its binding box is

PAGE 110

110 T, and in contrast to TALEs, its non RVD residues also considerably affect s the DNA bin ding activity (de Lange et al., 2013) So detecting the crystal st ructure of the TAL effector and the model of TALE EBE interact ion is necessary. Crystal structures of TALE DNA binding. It has been predicted that the AvrBs3 repeat domain st ructurally resembled tetratric o peptide repeat (TPR) protein which is a structural motif consisting of 3 16 tandem repeats of 34 aa residues and mediates protein protein interactions as well as assembly of multi protein complexes; they also showed high sim ilarity to pentatrico peptide repeat (PPR) proteins which carry 2 26 degenerated tandem 35 aa repeats or alternating 31 aa,36 aa repeats and mediate RNA binding; helices (Schornack et al., 2006; Murakami et al., 2010) Recently, the crystal structure of PthXo1 bound to its DNA target was determined using high throughput computational structure prediction and validat ed by heavy atom derivatization; each repeat fo rms a left helices bundle that expose s an RVD containing loop to the DNA and the repeats self associate to form a right handed superhelix wound around the DNA major groove (Mak et al., 2012) By testing a 15.5 repeat TALE, another group also reported t he similar crystal structu res with 12th residue stabilizing the RVD loop, and the 13th residue contact ing with a specific nucleotide base (Deng et al., 2012) But the overall tertiary structur e of the TALE DNA complex remains to be further determined. Traits o f TAL Effector Target Genes i n Plants As for the known plant host genes targeted by TAL effectors, in different plants and recognized by distinct TAL effectors, the targets have diverse functions in plant physiology and development other than susceptibility or resistance The characterized

PAGE 111

111 TAL effector targets are liste d in Table 4 1 For the R genes that are targeted and activated by TAL effectors, so called executor R gene, such as Bs3 from pepper and Xa27 from rice, they are distinct from most of the R genes which are transcribed constitutively and encode NB LRR prote ins; only one NBS LRR protein tomato Bs4 was reported to recognize TAL effectors such as AvrBs4 but is independent of DNA binding activity (Schornack et al., 2004; Gu et al., 2005; Rmer et al., 2007) In pepper, the R gene Bs3 and Bs3 E that is re cognized and mediated by AvrBs3 and (Rmer et al., 2007) ; another direct target of AvrBs3, so called upa20 encodes a bHLH family transcriptional factor that contains a basic helix loop helix domain, which ac t s as a regulator of cell enlargement (Kay et al., 2007) In rice, two susceptible ( S ) genes, OsSWEET11 / Os8N3 target of PthXo1, and OsSWEET14/Os11N3 target of AvrXa7, both belong to MtN3 gene family that encodes nodulin related proteins, which mediate sugar efflux to feed bacterial and promote the growth of the bacterial (Yang et al., 2006a; Antony et al., 2010; Chen et al., 2010) ; a second study also revealed that OsSWEET11 was a copper transporter to remove copper from xylem vessels and facilitate multipli cation and spread of Xoo (Yuan et al., 2010) ; another rice S gene with minor effect s on susceptibility TFX1 which is recognized and activated by Xoo TAL effector PthXo6, is a member of the basic region leucine zipper (bZIP) transcription factor family gene, while that is highly induced by PthXo7, is a small subunit of the tra nscription factor IIA (Sugio et al., 2007) In addition, a gene in pepper named upa16 that is the paralog of MtN3 family, was also induced by AvrBs3 (Kay et al., 2009) ; and one more rice MtN3 family gene member xa25 recessively mediated race

PAGE 112

112 PXO339 (Liu et al., 2011) ; these results demonstrate that the MtN3 family genes may be wide ly involve d in TAL effectors targeting and plant host pathogen interaction s for nutritional supply Target Discovery and Gene Engineering b y Exploiting Features o f TALE The e lucidation of the TALE code expedited further discovery of TAL effector target genes and opens the door to biological and biotechnological application by using artificial ly designed TALEs or EBEs (Bogdanove et al., 2010; Scholze and Boch, 2011; Doyle et al., 2013; Muoz Bodnar et al., 2013; Schornack et al., 2013) Target prediction. The TAL effector gene targets now can be identified through integration of transcriptional and computational approaches. Several TAL e ffector target prediction tools have been es tablished for easy deducting the presence of EBEs in gene promoter from RVD sequence s in TAL effectors (Doyle et al., 2012; Grau et al., 2013) ( https://tale nt.cac.cornell.edu/node/add/talef off http://galaxy2.informatik.uni halle.de:8976/ ). Romer et al (Rmer et al., 2010) successfully predicted and validated potential UPT boxes by employing the TALE code; the UPT boxes from the rice genes Xa13 OsTFX1 Os11N3 were identified to be targeted directly and specifically by the X. oryzae pv. oryzae TAL effec tors PthXo1, PthXo6, AvrXa7 respectively. In a proof of principle experiment, the resistance gene Bs4C as well as the EBE were identified from pepper in the presence of AvrBs4 by jointly using RNA seq and the TALE code (Strau et al., 2012) which was distinct from Bs4 in tomato; it also paves a less laborious avenue for isolating R genes from crop plants and to avoid the painstak ing positional cloning. Transcription al control in plant. After investigating specificity in the interaction between different TAL effectors and UPT box es of plant R genes, it is possible to

PAGE 113

113 engineer R genes to contain multiple UPT boxes in promoter and recognize diverse TAL effectors, thus producing a promoter trap and gain ing the potential to generate board spectrum and durable resistance. Romer et al (Rmer et al., 2009a) demonstrated that when three functionality and sequence distinct UPT boxes UPT Xa27 UPT AvrBs3 and UPT p16 were combined into one complex promote r, it could recognize all three TAL effectors and trigger HR By stacking six EBEs to the rice Xa27 gene, the executor R gene specificity was broaden to resistant to more diverse strains of X. oryzae (Hummel et al., 2012) Morbitzer et al (Morbitzer et al., 2010) used the TALE code in an opposite manner by designing TAL effectors that could activate the defined chromosomal genes. They generated a special TAL effector that m atched against a pre determined sequence in tomato Bs4 gene pro moter through the code when using AvrBs3 as a structural scaffold except for the RDV residues; this custom TAL effector was able to specifically target a nd activate the Bs4 gene expression both through co delivery into N. benthamiana leaves and endogenous activation in tomato. They also created two TAL effectors to target the promoters of two A. thaliana genes EGL3 and KNAT1 which acted as transcriptional activator s of the endogenous genes in planta Application in mammalian and genomic editing. Due to the clear and simplicity of TALE code, the TAL effectors have also been designed to recognize the target DNA sequences predicted by the TALE code in zebraf ish, yeast and mammalian cells. TAL effectors have been artificially designed for transcriptional manipulation of the genes from the mammalian genome when fusing the mammalian activation domain to TAL effector DNA binding domains (Miller et al., 2011; Zhang et al., 2011) In these two years, emerging papers in technology and application of ge nome engineering have

PAGE 114

114 been published on TALEN (TALE nuclease) that are created by tethering FOK I endonuclease domain into TAL effectors and results in efficient protein cleavage. Some most recent and excellent papers in this aspect are listed here (Sanjana et al., 2012; Gaj et al., 2013; Kim et al., 2013; Li and Yang, 2013; Schmid Burgk e t al., 2013; Sun and Zhao, 2013) Results Experiments O utline In this study, we elucidated the function of TAL effector PthA4 from Xcc as a pathogenicity cont ributor. Here, the candidate PthA4 target genes which may also behave as S gene were selected fro m the PthA4 dependent transcription profiles de s cribed in Chapter 2. The selection was based on three considerations, 1) high fold increase in expr essions at 48 hpi and 120 hpi with respect to WT versus MU; 2) presence of a candidate EBE predicted from RVD s of PthA4 in the promoter regions (Figure 4 1) ; 3) relatedness to known S genes and known TALE targets. The candidate genes were val idated and also subjected to complementation by artificially designed TAL effectors (dTALes) that were either optimized by the consensus TAL effector binding codes or targeted to novel promoter sequences Afterwards, another four different pthA4 homologies that determine pustule formation on citrus, pthAw, pthA*, pthB and pthC each of who m has different and unique repetitive central domain, were also tested for binding and activation abilities to the candidate genes. CsLOB1 and CsN3 1 are Candidate Targets of TAL E ffectors PthA4 From the microarray data, the genes showing significant higher (adjust P <0.01) expression levels i n tissue infiltrated with wild type Xcc306 in comparison to tissue infiltrated with pthA4 were selected as potential candidate host S genes The

PAGE 115

115 top 30 most highly up regulated genes were selected and the promoters were scanned for probable P thA4 binding elements ( Table 4 2 ). One gene that represented by two probeset s was identifie d In addition, a gene encoding member of MtN3 family was found to be highly induced in another microarray experiment conducted by Zhang et al. from Kansa State University (data not shown), which also contains a candidate EBE PthA4 These two genes were characteri zed further, although the latter one did not appear in the top up regulated gene sets from our microarray data The gene represented by probes Cit.37210.1.S1_at and Cit.35190.1.S1_at contained sequence very close to the can onical PthA4 binding element (EBE PthA4 ), which is located 92 bp upstream of predicted transcription start site basing on EST sequences This gene encod es a member of the lateral organ boundaries (LOB) domain family of transcription factors and was designat ed CsLOB1 The most closely related homologs are AtLBD1 and AtLBD11 of Arabidopsis ( Figure 4 2 ). Another gene, which is represented by Cit.3027.1.S1_s_at, contains a sequence close to canonical EBE PthA4 which starts 43 bp upstream of the potential transcri ption start site It represents a homolog to the TAL effectors targeted S genes OsSWEET11 and OsSWEET14 in rice, and was designated as CsN3 1 The expression of both genes was observed to b e elevated as determined by qRT PCR analysis of mRNA from tissue in fect ed either with Xcc306 pthA4 A time course of 12 h, 24 h, and 48 h after inoculation in sweet orange indicated that expression of both genes reached high levels by 24 hours after the infiltration ( Figure 4 3 ) CsLOB1 and CsN3 1 Promoters D irec t TAL Effector Dependent E xpression The respective promoters of CsN3 1 and CsLOB1 were fused to a uidA glucuronidase, GUS) reporter gene and expressed transiently by Agrobacterium

PAGE 116

116 mediated transfer. Truncated promoters and altered versions in the predicted EBEs were also tested in co inoculation assays with Xcc 306 in citrus leaves ( Figure 4 4 ). The wild type promoter fragment of CsN3 1 directed GUS activity when co inoculated with the wild type strain Xcc306 and the complemented st rain Xcc306 pthA4:pthA4 while no GUS activity was detected w hen co infiltrated with strain Xcc306 pthA4 ( Figure 4 5 A ; CsN3Pwt). Co inoculations with the truncated, substituted, and deleted versions of CsN3 1 promoter and Xcc306 resulted in little to no GUS activity ( Figure 4 5 A CsN3PT, CsN3PM1, and CsN3PD, respectively). At the same time, wild type truncated and substituted versions of CsLOB1 promoter were activated at the same level by Xcc306 ( Figure 4 4 and 4 5A CsLOBPT and CsLOBPM1). The deletion within the pre dicted EBE and TATA box of CsLOB1 ( Figure 4 5 A CsLOBPD) resulted in the loss of PthA4 mediated expression ( Figure 4 5 A ). As a control, t he promoter of another highly up regulated gene Cit.7877.1.S1_at was not able to be stimulated by PthA4 ( Table 4 2 ; Fig ure 4 5 A column C). The results for the alterations to changed CsN3 1 and CsLOB1 promoters indicated that, though remarkably similar, the promoters of the respective genes with respect to the candidate EBEs have minor but important differences. The candid ate EBE PthA4 for CsLOB1 is thought to be contained within the region of the TATA box, based on the results with the truncated version CsLOBPT ( Figure 4 4 construct 8). Additional base substitutions and insertions were created within the truncated version of CsLOB1 and tested to further corroborate the function of this region as an EBE Pth4 ( Figure 4 4 constructs 8 12). Promoter variant CsLOBPM3, which has a substitution of GG for CC at 8th and 9th positions in the EBE had a severe effect on PthA4 dependent

PAGE 117

117 promoter activity, while the substitution of T (CsLOBP M2 ) for C only at position 8 had little effect on activity ( Figure 4 5 B constructs 9 11). A single nucleotide insertion at position 11 (CsLOBPins) in EBE PthA4 resulted in loss of GUS activity ( Figure 4 5 B ). The Agrobacterium tumefaciens mediated transient ectopic expression of pthA4 was also able to activate the same CsLOB1 or CsN3 1 promoter patterns in N. benthamiana respectively ( Figure 4 6 ). Artificial dTALes T argeting CsLOB1 Induce Pustule F orma tion Artificial dTALe genes with pthA4 as a backbone sequence were designed with repeats specifically targeting unique sequences within promoters of CsN3 1 and CsLOB1 respectively, using optimized RVD residues. The genes were designated dCsLOB1.1 dCsLO B1.2 dCsN3 1.1 and dCsN3 1.2 pthA4 and tested for activity on citrus leaves. Among them, dCsLOB1.1 and dCsN3 1.1 were dCsLOB1.2 and dCsN3 1.2 were cre Florida. Their RVDs in the repeats sequences and locations of the targeting DNA were shown in Figure 4 7 The va lidi ty of these dTALes were first assessed by qRT PCR and GUS assay. pthA4 with either dCsL OB1.1 or dCsLOB1.2 induced CsLOB1 expression, but did not induce CsN3 1 pthA4 with dCsN3 1.1 or dCsN3 1.2 induced the expression of CsN3 1 but not CsLOB1 expression ( Figure 4 8 A ). In parallel, the Xcc306 pthA4 with the individual dTALe genes were tested for the ability to induce the promoter uidA reporter genes by quantitative transient GUS assays in sweet orange, only dCsLOB1.1 and dCsN3 1.1 were correctly examined by us pthA4 harboring dCsLOB1.1 directed expression of CsLOB1 promoter but not CsN3 1 promoter, and, conversely, pthA4 harboring dCsN3 1.1 drove expression from

PAGE 118

118 the CsN3 1 promoter and not the CsLOB1 promoter fusions in citrus leaves ( Figure 4 8 B ). The dTALe pthA4 were infiltrated into sweet orange to determine what effect the artificial effectors would have on the disease phenotype. Only inoculations strains of Xcc306 pthA4 with either dTALe targeting CsLOB1 resulted in pustule formation ( Figure 4 9 A and B ) although in low inoculum con centration (510 5 cfu/ml) the symptom was not fully restored as PthA4 did (Figure 4 9C) In addition, in cell density assay, t he bacterial leaf populations were significantly higher in sweet orange leaves inoculated with Xcc306 pthA4:dCsLOB1.1 when compar ed to Xcc306 pthA4 but lower than Xcc306 pthA4 : pthA4 by 9 dpi ( Figure 4 10 ). CsLOB1 is Target of Alternate TAL Effectors Involved in Citrus C anker The TAL effectors genes pthAw pthA* pthB and pthC which were previously shown to be associated with pu stule formation (Al Saadi et al., 2007) were tested for the ability to induce pustule formation in Xcc306 pthA4 The four genes, similar to pthA4 could confer pustule formation in Xcc306 pthA4 ( Figure 4 11 ) And the pthA4 with each respect ive gene were inocula ted on three hosts, sweet orange, grapefruit, and key lime to assess the ability to induce CsLOB1 and CsN3 1 PthA4, PthAw and PthA* led to induction of both CsN3 1 and CsLOB1 in the three species while PthB and PthC could only direct the expression of Cs LOB1 but not CsN3 1 in all three species ( Figure 4 12 ). Bacterial leaf popu lations of pthA4: pthB in sweet orange were the same as pthA4: pthA4 and higher than the mutant pthA4 by nine days after infiltration ( Figure 4 13 ) The predicted EBEs of PthB and PthC were supposed to be the same and located six bases upstream of EBE PthA4 and t he predicted EBEs of PthAw and PthA* appeared to be located at the same position as that of PthA4 ( Figure 4 14 A) pthA4: pthB and

PAGE 119

119 pthA4:pthC strains could only direct expression of the wild type CsLOB 1 promoter but not the truncated versions, which are missing three bases of the p redicted EBEs for PthB and PthC, PthB and PthC also did not activate the CsN3 1 promoter fused reporter gene ( Figure 4 4 and 3 14B) Moreover, the inducibility feature of PthAw was also inspe cted in N. benthamiana through Agrobacterium mediated transient ectopic expression of pthA w (35S drove), it revealed that the pattern was analogous to that by PthA4 shown in Figure 4 6 ( Figure 4 15 ). Materials and M ethods PthA4 Target Gene Search Thirty t op highest up regulated genes by Xcc306 relative to Xcc306 pthA4 at 48 hpi from microarray described in Chapter 3 were selected. The 1000 bp upstream of CDS (coding DNA sequences) of these gene were obtained from phytozome ( http://www.phytozome.org/citrus.php ) and the regions were scanned by Target Finder using RVD sequence of PthA4 (Doyle et al., 2012) GUS Reporte r a nd Gene Overexpression Construction Sequences about 600 bp upstream of CsN3 1 and CsLOB1 CDS were amplified from sweet orang e genome DNA, promoter derivative fragments were obtained by amplification with different primers ( listed in Table 2 2 ). The promoter fragments were digested with BamH I and Hind III to fuse with uidA gene in pBI101 vector. The constructions were transform ed into Agrobacterium strain EHA101. To overexpress pthA4 and pthAw the amplified genes were inserted after 35S promoter and before 35S terminator in vector pUC118/35S polylinker when digested with Apa I and Xho I, then these constructions were cut with H ind III and Xba I to ligate into pCAMBIA2200, the constructions were introduced into Agrobacterium strain LBA4404.

PAGE 120

120 Glucuronidase (GUS) A ssays For transient GUS expression in citrus plant, A. tumefaciens was cultivated at 28 C in YEP plates and the Agrobacterium suspended in solution containing 10 mM MgCl2, 10 mM MES (pH 5.6) and 100 uM acetosyringone with concentra tion OD600 = 0.8 was infiltrated into sweet orange, after 5 hours, the Xanthomonas with concentration of OD600 0.3 was infiltrated at the same area. After 5 days, the GUS activities were measured (Figueiredo et al., 2011b) For the transient expression in Nicotiana benthamiana two Agrobacterium suspensions were mixed at ratio of 1:1, and the GUS assay was preformed 3 days after infiltration. For quantitative GUS assay, one leaf disc (1 cm diameter) was grounded wit h 400 l GUS extraction buffer (50 mM NaPO 4 (PH 7.0), 1 mM Na 2 EDTA, 0.1% SDS, 0.1% Triton X 100, 10 mM DTT). After spin at 4 C for 15 min in top speed, 25 l of the supernatant was mixed with 225 l GUS assay buffer (GUS extraction buffer supplied with 0. 44 mg/ml 4 D glucuronide), and kept in 37 C for 1 hour, the reaction was stopped with 0.2 M Na 2 CO 3 Measurement was done in a plate reader (CytoFluor II) at 360 nm (excitation) and 460 nm (emission) with 4 methyl umbelliferon (MU) di lutions as standard. The protein quantification was performed by Bradford assay (BioRad, Hercules, CA). For qualitative GUS assay, one fresh leaf disc was put into GUS staining buffer (50 mM NaPO 4 PH 7.0, 0.1% Triton X 100, 10 mM EDTA, 1 mM K 3 Fe(CN) 6 1 mM K 4 Fe(CN) 6 0.5 mg/ml X gluc) and incubated at 37 C overnight, the discs were destained in ethanol. Bacterial growth assay and qRT PCR processes were described in previous Chapters.

PAGE 121

121 Discussion CsLOB1 is a Citrus Susceptibility Gene Targeted by Diverse T AL Effectors In this study, w e demonstrated that pustule formation of citrus bacteria l canker results from the co option of a single host S gene CsLOB1 via PthA4 and its homologs. Although PthA was not tested specifically, the effector has almost the same predicted target site as PthA4 (Boch et al., 2009) Recently, a gene encoding LOB domain protein was also computationally predicted to be the most promising target of PthA4 through a promoterome wide search (Grau et al., 2013) Alternate TAL effectors PthAw, PthA*, PthB, PthC from genetically diverse Xanthomonas strains that cause citrus canker were able to restore the ability to produce typical pustules to the pthA4 strain; through qRT PCR all four PthA4 variants were also determined to induce and target the same gene ( Figure 4 12 ) Citrus canker occurs across a variety of citrus species, and CsLOB1 is present and activated by TAL effectors in s weet orange, grapefruit and Mexican lime ( Figure 4 12 ); the obvious differential activation levels may attribute to minor sequence changes in the promoter EBE region. All the variants of PthA and the particular species were compatible with CsLOB1 induction and pustule formation, possibly reflecting that the genes have converged to the same target. To further substantiate this conclusion, dTALes targeted to unique or optimal binding sites in promoter region were constructed and found to induce CsLOB1 and res tore pustule formation when expressed in bacteria ( Figure 4 9 B ). In gus reporter assay, the variants of PthA except PthA* strongly drove the CsLOB1 promoter expression (Figure 3 14B) which also support ed the hypothesis that CsLOB1 was targeted and activat ed by these TAL effectors The poor activation by PthA* may be account ed for by the low specificity thus low affinity of EBE with CsLOB1 promoter (5 bases mismatch, Figure 4 14 A);

PAGE 122

122 according to the symptom s P thA* also did not fully restore pustule formatio n to normal phenotype ( Figure 4 11 ); but interestingly PthA* induced CsLOB1 expression at almost the same level as others did ( Figure 4 12 ) Although no evidence was obtained in this study, the CsLOB1 gene may represent adaptations to avoid or compensate for host induced resistance genes or changes in CsLOB1 promoter sequences in as yet unidentified species or cultivars of citrus just as Os8N3 which is the allele of recessive R gene xa13 and only differ s in EBE PthXo1 region (Yang et al., 2006a) The predicted EBEs in CsLOB1 promoter match the various TAL effectors and meet the general prediction requirements of known EBEs targeted by other TALes, and, for the most part, the results of experimental tests of EBE function for CsLOB1 were consistent with predictions. The elements are located approximately 100 bp upstream of typical EBEs (Grau et al., 2013) PthA4, PthAw, and PthA* share the same predicted EBE in CsLOB1 promoter, although the respective RVDs differ ( Figure 4 14 A ). The truncated version of the target site, which e liminated the natural upstream sequences in CsLOB1 was functional both in citrus and Nicotiana ( Figure 4 5 and 4 6 ). Changes in the respective TATAA boxes for CsLOB1 and CsN3 1 eliminated expression ( Figure 4 4 CsLOBPD) as might be expected for the pred icted TATAA boxes for eac h gene. The substitution in the proximal half of the binding site (CC) had severe effects for PthA4 mediated expression compared to changes in the distal sequence of TTT (CsLOBPM3 and CsLOBPM1) ; considering only slightly reduced activity by replacing C to T at the same position (CsLOB P M2), the damage of the TATAA box by the replacements for both CsLOBPM2 and CsLOBPM3 were exclude; and two bases substitution in extreme

PAGE 123

123 terminal also abolish ed the expression (CsLOBPM5). Furtherm ore, a single base insertion, which throws the distal part out of register, also eliminated effector mediated expression for CsLOB 1 ( CsLOBPins, Figure 4 4 ). The start of the predicted EBEs for PthB and PthC is 6 bp upstream of the EBE PthA4 and is similar t o the Os11N3 promoter in rice in which EBE PthXo3 is 2 bp in front of EBE AvrXa7 (Antony et al., 2010) In addition to the loss of function due to the truncation of the promoter after the start of the predicted sites for PthB and PthC, a single base change (T to C) in the second nucleotide of CsN3 1 candidate EBE PthB/C entirely disrupted the induction of reporter gene ( Figure 4 14 ). terminal part of EBE played pivotal role in binding an d activating, whi ch was in agreement with what was reported previously (Yuan et al., 2011) Functional Characteristics of LOB Domain Family and CsLOB1 The lateral organ boundaries (LOB) proteins are plant specific and they are defined as containing LOB domain, which is composed of a conserved Cys repeat motif (CX 2 CX 6 CX 3 C) required for DNA binding, an invariant glycine residue, and a coiled coil Leu zipper like motif (LX 6 LX 3 LX 6 L) that functions in protein protein interactions (Shuai et al., 2002) Based on their nuclear localization the LOB proteins constitute a class of transcription factors, which recognize a 6 bp consensus DNA motif and are capable of interacting with the basic helix loop helix (bHLH) family proteins bHLH048 (Husbands et al., 2007) One of th e targets of TAL effector AvrBs3 in pepper is upa20 an auxin responsive gene and encodes bHLH family protein (Kay et al., 2007) ; the interaction between CsLOB1 and CsbHLH may be a n important mechanism in disease development. Previous studies revealed that LOB domain proteins are involved in the regu lation of plant lateral organ development, anthocyanin and nitrogen metabolism and

PAGE 124

124 are responsive to phytohormones and environmental stimuli such as auxin, cytokinin, gibberellin, brassinosteroid and salinity or glucose (Majer and Hochholdinger, 2011; Gendron et al., 2012) One member of the LOB domain family, AtLBD18, was reported to bind with the promoter of EXPANSIN14 a gene involved in cell wall loosening (Kim and Lee, 2013) Recently, an Arabidopsis LOB family protein LBD20 was identified as a susceptibility gene in resp onse to fungal pathogen Fusarium oxysporum and functioned in the jasmonate signaling pathway (Thatcher et al., 2012b) LBD20 is induced by F. oxysporum, and overexpression of LBD20 was correlated with increased sus ceptibility to F. oxysporum and reduced the expression of JA regulated genes VEGETATIVE STORAGE PROTEIN2 ( VSP2 ) and THIONIN2.1 ( Thi2.1 ). Other LOB domain fa mily genes were also detected as being responsive to fungal and root pathogens from public Arabidops is array data (Thatcher et al., 2012a) Based on the transcription profile results, a high proportion of host genes in which expression is associated with CsLOB1 expression during citrus canker disease are genes associated with cell wall metabolism ( Figure 4 16 A) W e postulated that CsLOB1 expression was associated with expression of cell wall related enzyme genes In order to verify this hypothesis, a select group of induced genes related to expansion and wall metabolism were chosen from the most highly induced genes during infection by Xcc306 and tested for induction by qRT PCR in the presence of dCsLOB1.1 which induced CsLOB1 expansin, and cellulose were found to be up regulated in sweet orange in a similar pattern as CsLOB1 expression ( Figure 4 16 B). So CsLOB1 expression is related to numerous cell wall related proteins indicating a function in cell expansion in some otherwise normal developmental

PAGE 125

125 process. To gain further insight into the roles of CsLOB1 more in vivo or in vitro experiments need to be conducted for confirm ing its binding with TAL effectors or other plant protein; transgenic citrus lines that over express and silence this gene need to be generated; another major task is to identify downstream targets of CsLOB 1 protein with the help of the consensus cis element. Possible R oles of CsN3 1 and More Genes That May Be Involved in TALE T argeting The results for the candidate EBEs in CsN3 1 were more complex ; n o evidence was found supporting a function for the SWEET gene CsN3 1 in citrus canker CsN3 1 showed TAL effector dependent expression for PthA4, PthAw, and PthA*. Only the longer promoter construct supported TALE mediated induction. T runcation of the CsN3 1 promoter to include only the TATAA box region and distal portion could not support expression either in citrus or Nicotiana At the same time, a similar change in the distal TTT sequence of EBE site A also resulted in loss of expres sion in transient assays ( Figure 4 5 and 4 6 ). However, the naturally occurring effectors PthB and PthC induce CsLOB1 and not CsN3 1 and pustule development and enhanced bacterial leaf populations were only observed with dTALes targeting CsLOB1 Binding t o the CsN3 1 promoter may, therefore, be weak, and expression may be due to multiple binding sites including ones upstream or more complex interactions. In evolutionary terms CsN3 1 falls into Clade I in the phylogenetic tree as classified by Chen et al. (Chen et al., 2010) differing from the disease susceptibility genes SWEET11 & 14 of rice which are in Clade III This may indicate that the function of CsN3 1 is independent of sucrose transport but more related to glucose transport

PAGE 126

126 Nonetheless, o n the one hand, full complementation of bacterial growth and pustule formation following inoculation with lo w inoculum concentrations in citrus leaves was not attained with the dTALe dCsLOB1.1 despite the apparent robust expression of CsLOB1 (Figure 4 10 and 4 9B ) The question remains as to whether expression of CsN3 1 or other host genes represent a more complex virulenc e adapta tion on the part of the bacterium or TAL effector mediate d expression of CsN3 1 is inconsequential. The naturally derived effector PthB did complement both pustule formation and bacterial growth lending support to the hypothesis that CsN3 1 is not involved in citrus canker Further analysis would be required to determine if, possibly, another member of the SWEET family is induced by PthB. In bacterial blight or rice, a yet uncharacterized SWEET gene conferred susceptibility to the Xoo strains harbor ing the corresponding dTALes (Li et al., 2013b) Here, the possibility exists that a single effector may have evolved to capture command of multiple host genes for optimal pathogenicity. However, further understanding o f dTALe construction and natural TAL effector function will be required to draw stronger conclusions.

PAGE 127

127 Table 4 1 Known TAL effector targets in various plants and their characteristics TAL effector Plant target Characteristic Description Reference Xcv AvrBs3 Bs3 (pepper) R gene flavin monooxygenases Common UPA box (Rmer et al., 2007) upa20 (pepper) bHLH TF family (Kay et al., 2007) upa16 (pepper) MtN3 family (Kay et al., 2009) Xcv AvrBs3 Bs3 E (pepper) Bs3 derivative with 13 bp deletion at UPA box (Kay et al., 2009) Xg AvrHah1 Bs3 (pepper) R gene, flavin monooxygenase s Probably same EBE as Bs3 and upa20 (Schornack et al., 2008) upa20 (pepper) bHLH TF family (Schornack et al., 2008) Xoo PthXo1 xa13 (rice) Recessive R gene Differ only in promoter region (Chu et al., 2004) Os8N3 or OsSWEET11 (rice) S gene, MtN3 family, sugar transpo rt (Yang et al., 2006a) Xoo AvrXa7 Os11N3 or OsSWEET14 (rice) S gene, MtN3 family, sugar transport (Antony et al., 2010) Xoo PthXo3 (Antony et al., 2010) Xoo TalC (Chen et al., 2010) Xoo AvrXa27 Xa27 (rice) R gene, no homology (Gu et al., 2005) Xoo PthXo6 OsTFX1 (rice) bZIP TF family (Sugio et al., 2007) Xoo PthXo7 (rice) Subunit of transcription factor IIA (Sugio et al., 2007) Xcv AvrBs4 Bs4 (tomato) NBS LRR R gene Non nuclear localization (Schornack et al., 2004) Bs4C (pepper) R gene, no homology (Strau et al., 2012) Xcv, Xanthomonas campestris pv. vesicatoria; Xg, Xanthomonas gardneri; Xoo, Xanthomonas oryzae pv. oryzae TF, transcr iption factor EBE, effector binding element; UPA, up regulated by AvrBs3

PAGE 128

128 Table 4 2 Thirty most highly up regulated genes in sweet orange by PthA4 mediated infection Probe ID Log2 FC DNA EBE PthA4 Annotation Cit.39387.1.S1_at 7.874 N/A No Pectate lyase Cit.7877.1.S1_at 7.849 CX667721 No Cytokinin induced message Cit.5370.1.S1_s_at 7.719 CX642883 No pectin methylesterase inhibitor family Cit.20041.1.S1_at 7.709 CB250345 No N/A Cit.2392.1.S1_at 7.251 CF831790 No Acidic cellulase Cit.28626.1.S1_s_at 7. 124 CV710534 No Beta expansin 6 Cit.3554.1.S1_s_at 7.016 CX663293 No Cellulase Cit.35754.1.S1_at 6.682 CB250305 No Polygalacturonase like protein Cit.12550.1.S1_at 6.615 CD574246 No Arabinogalactan protein Cit.37210.1.S1_at 6.592 BQ623314 YES Lateral organ boundaries (LOB) domain family Cit.20509.1.S1_at 6.56 CX644808 No Probable pectate lyase P18 precursor Cit.29007.1.S1_at 6.528 CX637545 No Gibberellin regulated protein GASA5 precursor Cit.24058.1.S1_s_at 6.436 CD575611 No N/A Cit.35768.1.S1_s_a t 6.346 CB250380 No GASA5 like protein Cit.14250.1.S1_at 6.325 CV713259 No Acid phosphatase Cit.11144.1.S1_s_at 6.316 CX053912 No Cytosolic factor family protein Cit.9528.1.S1_x_at 6.304 CX641267 No Beta expansin 2 precursor Cit.17853.1.S1_s_at 6.17 CK 933446 No Pectate lyase family protein Cit.11147.1.S1_s_at 6.053 CX674752 No Cytosolic factor like protein Cit.30858.1.S1_at 6.047 CF505371 No Expansin Cit.25433.1.S1_s_at 6.006 CX665604 No N/A Cit.32260.1.S1_at 5.985 CX289947 No Ubiquitin like protein Cit.35190.1.S1_at 1 5.875 CK932995 Yes LOB domain containing protein Cit.19605.1.S1_at 5.842 CK939040 No Calcium ATPase Cit.2949.1.S1_s_at 5.819 CN182557 No Xyloglucan endo 1,4 beta D glucanase Cit.17852.1.S1_s_at 5.809 CX294019 No N/A Cit.14005.1.S1 _at 5.775 CV710432 No Expansin Cit.10482.1.S1_s_at 5.762 CX664720 No N/A Cit.6493.1.S1_at 5.756 CX069721 No N/A Cit.3027.1.S1_s_at 2 2.504 CX048987 Yes Nodulin MtN 3 family protein 1 represents the same gene as Cit.37210.1.S1_at; 2 not in the top 30 mo st up regulated gene sets, but contains EBE PthA4 FC, expression fold change at 48 hpi in comparison of Xcc306 infection and Xcc306 infection.

PAGE 129

129 A B Figure 4 1 Structure features of a typical TAL effector and the DNA binding specificity. A) The functional domains that constitute TALEs and the predicted EBE exemplified by PthA4. The repeat domain is preceded by a 0 th repeat, and a representative repeat containing 34 amino acid was dis played. The RVDs of each repeat and their matching bases were s hown in different color. TS, translocation signal; LZ, leucine zippers ; NLS, nuclear localization signal ; AD, activation domain; RVD, repeat variable di residue. B) The most frequent RVDs and their one or several DNA bases preference. N* means missing of 1 3 th amino acid. The RVDs and DNA bases are given as single letter abbreviation Amino acids: H histidine D aspartic acid/aspartate N asparagine I isoleucine, G glycin, S serine K lysine. Bases: C cytosine, A adenine, T thymine G guanine

PAGE 130

130 Figure 4 2 Phylogeny of LOB domain (LBD) family from Citrus sinensis Solanum lycopersicum and Arabidopsis thaliana Five LBD family proteins from each of these three species which have highest similarity with CsLOB1 were chosen, also three LBD with identified functions was selected (AtLBD18, AtLBD20, MdLBD11). The phylogenetic tree was constructed using the neighbor joining method with MEGA5.1 software. The numbers at the branches are bootstrap values for 1000 repeats. The scale bar represents 0.1 substitutions per sequence position. Figure 4 3 CsN3 1 and CsLOB1 were up regulated in sweet orange following challenge with wild type Xcc306 compared to Xcc306 The expression level of CsN3 1 and CsLOB1 reached peak levels at 24 h ours post inoculation of Xcc306 Data represent the mean SD; different lowercase Tukey test.

PAGE 131

131 Figur e 4 4 Promoter constructs used in the GUS transient expression assay. The predicted EBEs deletion in represent truncated The base mutations are in lowercase letter. The fragments were fused to the ATG of the uidA coding sequence. A B Figure 4 5 PthA4 Drives CsN3 1 and CsLOB1 promoter expression of uidA reporter gene. GUS array was measured for the inducibility of CsN3 1 and CsLO B1 promoter by Xcc306 and its derivat ive strains in sweet orange. A) The co infiltration of Xcc306 or its derivative strains and A. tumefaciens carrying CsN3 1 CsLOB1 promoter constructs fused with gus from Figure 4 4 B) Co inoculation of Xcc306 thA4 with the promoter constructs 8 12 in Figure 4 4 Xanthomonas were inoculated 5 hours after the delivery of A. tumefaciens containing the GUS reporter constructs as indicated in Figure 4 4 indicate with PthA4 and without PthA4 respectively, a represents Xcc306 pthA4 Column C indicates the promoter of another PthA4 up regulated probe Cit.7877.1.S1_at fused with uidA gene. The GUS activity was tested 5 days after inoculation. SD values are three technical replicates of one experiment, repeated twice with similar results.

PAGE 132

132 Figure 4 6 PthA4 induce d the CsLOB1 and CsN3 1 promoter in Nicotiana benthamiana The pthA4 gene coding sequen ce was put downstream of CaMv35S promoter in binary v ector and transformed into A. tumefaciens then was co delivered with GUS reporter constructs (see Figure 4 4 ) into N benthamiana The GUS assay was conducted 3 days after the inoculation. Leaf discs were stained with X Gluc (5 bromo 4 chloro 3 indolyl b D glucuronide). Error bars indicate SD. Figure 4 7 The RVDs of artificial designed TALEs (dTALes) and their targeting EBE sequences. The dTALes targeting either gene have two versions. dCsN3 1.1 targets the same position as predicted EBE PthA4 in CsN3 1 promoter but with longer sequence, while dCsN3 1.2 targets at 13 bp upstream of predicted EBE PthA4 The sequences targeted by dCsLOB1.1 are located 33 bp downstream of predicted EBE PthA4 in CsLOB1 promoter while dCsLOB1.2 is the optimized dTALe for EBE Pt hA4 in CsLOB1 promoter (exact match).

PAGE 133

133 A B Figure 4 8 Examination of the correctness of dTALes in qRT PCR and GUS assay. A) Artificial dTALes induce the expression of their corresponding ge nes. The d TALes shown in Figure 3 7 were delivered into Xcc306 thA4 and qRT PCR was conducted 48 h after the inoculation. B) Quantitative GUS assay using dCsN3 1.1 and dCsLOB1.1 complementing Xcc306 strains. The Agrobacterium and Xanthomonas were co infiltrated into sweet orange, and the assay was conducted at 5 days after the infiltrations. Black column indicates A. tumefaciens with CsLOBPwt: uidA construct gray column indicates A. tumefaciens with CsN3Pwt: uidA construct. T he P thA4 complementing strain was used as positive control. Data represent the mean SD with three replic ates A B C Figure 4 9 Phenotype of d TALes complemented pthA4 inoculation in sweet orange. A) Description of the pustule symptom mediated by several TAL pthA4 without PthA4, and the other TAL pthA4 visib B C ) The symptom s after infiltration of dTALes complement ed strains a, P thA4 pthA4 ; c, dCsLOB1.1 ; d, dCsN3 1.1 The strains were inoculated at the concentration of 510 8 (B) or 510 5 (C) and the leaf was photographed at 5 days or 10 days af ter the infiltration. The pictures were not shown for dCsLOB1.2 and dCsN3 1.2.

PAGE 134

134 Figure 4 10 In planta pthA4 mutant (square) and the corresponding pthA4 and pthA4 : dCsN3 1.1 showed significantly poorer bacterial growth when compared with pthA4 : pthA4 pthA4: dCsLOB1.1, while the bacterial pthA4: dCsLOB1.1 was lower than that of pthA4 : pthA4. Sweet orange leaves we re inoculated at the concentration of 510 5 cfu /ml, the population was monitored at the time points indicated. Error bars represent standard deviations (SD). The experiment was repeated twice with similar results. Significanc e between strains was assessed at final time point at a P value <0.01 by using Tukey Kramer HSD test for post ANOVA analysis. Figure 4 11 PthA4 and its homolog s are critical for pustule formation on sweet orange. The pthA4 pthA4 was complemented with TAL effectors PthA4, PthAw, PthA*, PthB and PthC respectively, the symptoms cause by these complementing strains were showed. The inoculation concentration was 510 8 cfu/ml.

PAGE 135

135 Figure 4 12 The relative expression of CsN3 1 and CsLOB1 induced by several TAL effectors differed in different citrus species. Black column indicates the expression of CsN3 1 gene, and white column indicates expression of CsLOB1 gene. RNA was prepared 48 hours post inoculation. The expression level of CsLOB1 in grapefruit and key lime was lower than that in sweet orange after inoculation, PthB and PthC did not induce CsN3 1 in all three species. Data represent the mean SD with three replications. Figure 4 13 Bacterial dyn pthA4 derivative strains in planta The pthA4 : pthB pthA4 : pthA4 have higher population than the mutant after 9 dpi. Sweet orange leaves were inoculated at the concentration of 510 5 cfu/ml. Error bars represent st andard deviations (SD). The experiment was repeated twice with similar results. Different analysis and Tukey test.

PAGE 136

136 A B Figure 4 14 EBE of PthB and PthC in CsLOB1 promoter i s located six bases upstream of EBE PthA4 A) Comparison of predicted optimized EBEs of PthA4, PthAw, PthA*, PthB, PthC (based on the TAL E code) and the corresponding nucleotide sequence s in CsLOB1 and CsN3 1 promoters. Mismatches between predicted EBE and the CsN3 1 promoter are indicated in bold font, mismatches between predicted EBE and the CsLOB1 promoter are indicated in gray highlight. B) GUS transient assay on sweet orange with the co inoculation of Xcc306 or its complemented strains and A. tumefacien s harboring GUS constructs listing in Figure 4 4 The black, white and gray columns represent A. tumefaciens carrying CsLOBPT, CsLOBPwt, CsN3Pwt GUS reporter constructs respectively. Data represent the mean SD with three technical replicates of one exper iment, repeated twice with similar results. Columns with the same lowercase letters do not differ from each other at the significance level of P < 0.05 using the Tukey test.

PAGE 137

137 Figure 4 15 PthAw activated the CsLOB1 and CsN3 1 promoter in Nicotiana benth amiana The pthA w gene coding sequen ce was put after CaMv35S promoter in binary vector and transformed into A. tumefaciens then was co delivered with GUS reporter constructs (see Figure 4 4 ) into N benthamiana The GUS assay was conducted 3 days after th e inoculation. Leaf discs were stained with X Gluc (5 bromo 4 chloro 3 indolyl b D glucuronide). Error bars indicate SD.

PAGE 138

138 A B Figure 4 16 CsLOB1 is considered to be associated with cell wall metabolism. A) Functional categories assignment of the ge nes induced in sweet orange by PthA4 using MapMan software Mercator analysis was performed using the genes in sweet orange with expression fold change more than 16 in Xcc306 vs. Xcc306 ( 108 eleme nts). B) Cell wall metabolism genes in sweet orange we pthA4: dCsLOB1.1 when compared with pthA4. The cell wall genes were selected from Table 4 2 only part of ID names were shown in label qRT PCR was conducted with gene specific primers at 48 h after the infiltration.

PAGE 139

139 CHAPTER 5 CONCLUDING REMARK S AND FUTURE PERSPECTIVES Citrus bacterial canker caused by X. citri is a devastating disease on citrus and is endemic in Florida as well as elsewhere worldwide I t is a major threat to the high valued citrus industry Although some fac tors have been described, the mechanism of how the bacterial pathogen attack s the citrus host and promote s disease development is still e lusive In this study, through mutagenesis analyses we identified PthA4 from Xcc306 acting as a major pathogenicity de terminant to citrus canker which belongs to the intensively studie d TAL effector family. The molecular responses of the citrus host plant to PthA4 mediated infection were investigated by microarray based comparison of wild type and pthA4 defective strain inoculations. G enes in the categories associated with cell wall degradation, modification or disassembly, cell cycle and division, auxin responsive protein synthesis and DNA synthesis or packaging were significantly up regulated, while genes in the categ ories of photosynthesis, cytochrome P450, PR proteins, UDP glycosyl transferases, phenylpropanoids metabolism, ET responsive, receptor kinases were remarkably down regulated by PthA4 dependent invasion. Among them, the induction of cell wall metabolism and cel l division genes was to help the bacterial multiplication, but the activation of DNA synthesis genes was not common in other genome wide transcriptional s tudies after pathogen infection. Further more, most of the categories that contained consi derable d own regulated genes were plant defens e associated, which indicates that PthA4 is associated with repression of plant defense pathways. The targets of PthA4 were identified by analyzing the upstream region of the most highly PthA4 induced genes by using EB E PthA4 sequence p redicted from

PAGE 140

140 deciphered TALE code as the bait Two candidate genes were captured ; one gene termed as CsLOB1 belongs to lateral organ boundaries (LOB) domain family ; and another one designated as CsN3 1 is a member of MtN3 family, which wa s previously reported to contain TAL effector targets. Through qRT PCR expression experiment s and gus reporter gene fusion assay, CsLOB1 or its promoter was strongly induced by PthA4, and CsN3 1 or its promoters was weakly activated by PthA4. In further GU S assay s, the base mutation in the TATAA box and terminal or displacement by insertion in the binding site of CsLOB 1 promoter completely abolish ed induc tion, while 3 bases substituted re am sequence truncation also did not affect the induction activity. These results indicate that the EBE in CsLOB1 promoter was crucial and sufficient for the gene activation. Moreover, all the mutations in the predicted EBE PthA4 or truncation to the promo ter of CsN3 1 resulted in loss of induction by PthA4. Interestingly, alternate TAL effectors in other strains that determine the cause of citrus canker also targeted and activated the CsLOB1 promoter; PthAw and PthA* seemed to share the same EBE with PthA4 while PthB and PthC targeted sequence was located 6 bp upstream. However, PthB and PthC did not drive the CsN3 1 promoter expression. In collateral experiment s the artificial synthesized TAL effectors (dTALes) that spec ifically and optimally target CsLO B1 promoter successfully activated CsLOB1 gene and restored the pustule formation was lost by pthA4 deletion mutant, while the dTALes targeting CsN3 1 gene did not complement the symptom s although they could induce the CsN3 1 gene expression. Collectively we consider CsLOB1 rather than CsN3 1 as a nov o susceptibility gene that is targeted by various TAL effectors. And this is the first time to

PAGE 141

141 demonstrate the member of LOB domain family as TAL effector target and susceptibility gene, while we also provide a notable example for one gene being targeted by several TAL effectors. Furthermore, in addition to the characterized functions of TAL effector target genes, which include d sugar transport ( SWEET gene) and cell enlargement ( upa20 bHLH gene) a novel plant susceptibility pathway was explored. As the draft genomic sequences for several citrus species became available (Gmitter et al., 2012; Ollitrault et al., 2012; Xu et al., 2012) the discovery of more potential TAL effector target genes and elements downstream of CsLOB1 will become easier. Until now, the outstanding targets especially the EBEs of TAL effector have been employed as effective tools to control the disease. By combining the natural EBEs of multiple T AL effectors from three distinct R genes or adding artificial EBEs of corresponding TAL effectors into one complex R gene promoter, the engineered R gene was induced by these effectors and conferred broader spectrum disease resistance (Rmer et al., 2009a; Hummel et al., 2012) But notably, it is likely that the EBEs coincidently overlap with endogenous cis regulatory elements, so the adding may cause unintended activation of R gene and result in plant aborted devel opment. Although no major R genes yet described in citrus, the well characterized avr gene a vrGf1 suggested the presence of potential R gene in grapefruit and sweet orange (Rybak et al., 2009) Alternatively, we may engineer the EBEs identified from CsLOB1 to drive the expression of a vrGf1 and transform into grapefruit or sweet orange, the AvrGf1 will be ectopically acti vated in plant when encounter s most of the canker causing x anthomona d s ; the encoded AvrGf1 protein can be recognized by the potential R protein and trigger HR. In addition, after the identification of S gene, we can silence this

PAGE 142

142 gene in plant to permanently s uppress its expression, thus confer ring reduced susceptibility to the strains containing the corresponding TAL effectors However, we need to guarantee that silenced genes do not have important housekeeping functions in plant The feasibility of this conception was already effectively appli ed in two separate studies (Yang et al., 2006a; Antony et al., 2010) In a recent report Li et al. (Li et al., 2012) mut ated the EBEs of Os11N3 in rice by TALEN based cleavage and gained transgenic rice lines conferring resistance to Xoo that contained TAL effectors AvrXa7 and PthXo3 This provide s a compelling approach to produce disease resistant plant s by modifying TAL e ffector targeted S genes. Furthermore, CsLOB1 i s definitely a good candidate for this approach since it is targeted by several TAL effectors, with only one single mutation being required to obtain broad spectrum resistance plant to control citrus canker ; h owever, one of the limitations is that it may not be the onl y target of those TAL effectors. W e also need to caution about the adverse effects in normal functions by the disruption of promoter Last but not least, it is possible to create a gene silencing construct that is driven by TAL effector targeted promoter ; when the strains containing the corresponding TAL effector attack, the targeted S gene will be silenced, but the same problem may happen to inactivation of its other functions so affects plant no rmal growth (Doyle et al., 2013)

PAGE 143

143 LIST OF REFERENCES Abramovitch, R.B., Janjusevic, R., Stebbins, C.E., and Martin, G.B. 2006. Type III effector AvrPtoB requir es intrinsic E3 ubiquitin ligase activity to suppress plant cell death and immunity. Proc Natl Acad Sci U S A 103:2851 2856. Achard, P., Cheng, H., De Grauwe, L., Decat, J., Schoutteten, H., Moritz, T., Van Der Straeten, D., Peng, J., and Harberd, N.P. 200 6. Integration of plant responses to environmentally activated phytohormonal signals. Pages 91 94 in: Science, United States. Al Saadi, A., Reddy, J.D., Duan, Y.P., Brunings, A.M., Yuan, Q., and Gabriel, D.W. 2007. All five host range variants of Xanthomon as citri carry one pthA homolog with 17.5 repeats that determines pathogenicity on citrus, but none determine host range variation. Mol Plant Microbe Interact 20:934 943. Albrecht, U., and Bowman, K.D. 2012. Transcriptional response of susceptible and tole rant citrus to infection with Candidatus Liberibacter asiaticus. Pages 118 130 in: Plant Sci, Published by Elsevier Ireland Ltd., Ireland. Alves, M.S., Dadalto, S.P., Goncalves, A.B., De Souza, G.B., Barros, V.A., and Fietto, L.G. 2013. Plant bZIP Transcri ption Factors Responsive to Pathogens: A Review. Int J Mol Sci 14:7815 7828. An, C., and Mou, Z. 2012. Non host defense response in a novel Arabidopsis Xanthomonas citri subsp. citri pathosystem. Page e31130 in: PLoS One, United States. Antony, G., Zhou, J ., Huang, S., Li, T., Liu, B., White, F., and Yang, B. 2010. Rice xa13 recessive resistance to bacterial blight is defeated by induction of the disease susceptibility gene Os 11N3 Plant Cell 22:3864 3876. Balaji, V., Gibly, A., Debbie, P., and Sessa, G. 2 007. Transcriptional analysis of the tomato resistance response triggered by recognition of the Xanthomonas type III effector AvrXv3. Funct Integr Genomics 7:305 316. Bari, R., and Jones, J.D. 2009. Role of plant hormones in plant defence responses. Plant Mol Biol 69:473 488. Bartetzko, V., Sonnewald, S., Vogel, F., Hartner, K., Stadler, R., Hammes, U.Z., and Bornke, F. 2009. The Xanthomonas campestris pv vesicatoria type III effector protein XopJ inhibits protein secretion: evidence for interference with cell wall associated defense responses. Mol Plant Microbe Interact 22:655 664. Berger, S., Sinha, A.K., and Roitsch, T. 2007. Plant physiology meets phytopathology: plant primary metabolism and plant pathogen interactions. J Exp Bot 58:4019 4026.

PAGE 144

144 Bhattarai K.K., Atamian, H.S., Kaloshian, I., and Eulgem, T. 2010. WRKY72 type transcription factors contribute to basal immunity in tomato and Arabidopsis as well as gene for gene resistance mediated by the tomato R gene Mi 1. Plant J 63:229 240. Bilgin, D.D., Za vala, J.A., Zhu, J., Clough, S.J., Ort, D.R., and DeLucia, E.H. 2010. Biotic stress globally downregulates photosynthesis genes. Plant Cell Environ 33:1597 1613. Boch, J., and Bonas, U. 2010. Xanthomonas AvrBs3 family type III effectors: discovery and func tion. Annu Rev Phytopathol 48:419 436. Boch, J., Scholze, H., Schornack, S., Landgraf, A., Hahn, S., Kay, S., Lahaye, T., Nickstadt, A., and Bonas, U. 2009. Breaking the code of DNA binding specificity of TAL type III effectors. Science 326:1509 1512. Bogd anove, A.J., Schornack, S., and Lahaye, T. 2010. TAL effectors: finding plant genes for disease and defense. Curr Opin Plant Biol 13:394 401. Bonfig, K.B., Schreiber, U., Gabler, A., Roitsch, T., and Berger, S. 2006. Infection with virulent and avirulent P syringae strains differentially affects photosynthesis and sink metabolism in Arabidopsis leaves. Planta 225:1 12. Boriss, H., and Huntrods, D. 2011. Commodity Profile: Citrus. Broekaert, W.F., Delaure, S.L., De Bolle, M.F., and Cammue, B.P. 2006. The rol e of ethylene in host pathogen interactions. Annu Rev Phytopathol 44:393 416. Brunings, A.M., and Gabriel, D.W. 2003. Xanthomonas citri: breaking the surface. Mol Plant Pathol 4:141 157. Buttner, D. 2012. Protein export according to schedule: architecture, assembly, and regulation of type III secretion systems from plant and animal pathogenic bacteria. Microbiol Mol Biol Rev 76:262 310. Bttner, D., and Bonas, U. 2010. Regulation and secretion of Xanthomonas virulence factors. FEMS Microbiol Rev 34:107 133 Campos, M.A., Rosa, D.D., Teixeira, J..C., Targon, M.L.P.N., Souza, A.A., Paiva, L.V., Stach Machado, D.R., and Machado, M.A. 2007. PR gene families of citrus: their organ specific biotic and abiotic inducible expression profiles based on ESTs approach. Genetics and Molecular Biology 30:917 930. Cantu, D., Vicente, A.R., Labavitch, J.M., Bennett, A.B., and Powell, A.L. 2008. Strangers in the matrix: plant cell walls and pathogen susceptibility. Trends Plant Sci 13:610 617.

PAGE 145

145 Cernadas, R.A., and Benedetti, C.E. 2009. Role of auxin and gibberellin in citrus canker development and in the transcriptional control of cell wall remodeling genes modulated by Xanthomonas axonopodis pv. citri. Plant Science 177:190 195. Cernadas, R.A., Camillo, L.R., and Benedetti, C .E. 2008. Transcriptional analysis of the sweet orange interaction with the citrus canker pathogens Xanthomonas axonopodis pv. citri and Xanthomonas axonopodis pv. aurantifolii Mol Plant Pathol 9:609 631. Chen, L.Q., Hou, B.H., Lalonde, S., Takanaga, H., Hartung, M.L., Qu, X.Q., Guo, W.J., Kim, J.G., Underwood, W., Chaudhuri, B., Chermak, D., Antony, G., White, F.F., Somerville, S.C., Mudgett, M.B., and Frommer, W.B. 2010. Sugar transporters for intercellular exchange and nutrition of pathogens. Nature 468 :527 532. Chisholm, S.T., Coaker, G., Day, B., and Staskawicz, B.J. 2006. Host microbe interactions: shaping the evolution of the plant immune response. Cell 124:803 814. Chu, Z., Ouyang, Y., Zhang, J., Yang, H., and Wang, S. 2004. Genome wide analysis of defense responsive genes in bacterial blight resistance of rice mediated by the recessive R gene xa13 Mol Genet Genomics 271:111 120. Civerolo, E. (1984). Bacterial canker disease of citrus ( Journal of the Rio Grande Valley Horticultural Society ), pp. 127 145. Conesa, A., Gotz, S., Garcia Gomez, J.M., Terol, J., Talon, M., and Robles, M. 2005. Blast2GO: a universal tool for annotation, visualization and analysis in functional genomic research Bioinformatics 21:3674 3676. Craig, A., Ewan, R., Mesmar, J., Gu dipati, V., and Sadanandom, A. 2009. E3 ubiquitin ligases and plant innate immunity. J Exp Bot 60:1123 1132. da Silva, A.C., Ferro, J.A., Reinach, F.C., Farah, C.S., Furlan, L.R., Quaggio, R.B., Monteiro Vitorello, C.B., Van Sluys, M.A., Almeida, N.F., Alv es, L.M., do Amaral, A.M., Bertolini, M.C., Camargo, L.E., Camarotte, G., Cannavan, F., Cardozo, J., Chambergo, F., Ciapina, L.P., Cicarelli, R.M., Coutinho, L.L., Cursino Santos, J.R., El Dorry, H., Faria, J.B., Ferreira, A.J., Ferreira, R.C., Ferro, M.I. Formighieri, E.F., Franco, M.C., Greggio, C.C., Gruber, A., Katsuyama, A.M., Kishi, L.T., Leite, R.P., Lemos, E.G., Lemos, M.V., Locali, E.C., Machado, M.A., Madeira, A.M., Martinez Rossi, N.M., Martins, E.C., Meidanis, J., Menck, C.F., Miyaki, C.Y., Moo n, D.H., Moreira, L.M., Novo, M.T., Okura, V.K., Oliveira, M.C., Oliveira, V.R., Pereira, H.A., Rossi, A., Sena, J.A., Silva, C., de Souza, R.F., Spinola, L.A., Takita, M.A., Tamura, R.E., Teixeira, E.C., Tezza, R.I., Trindade dos Santos, M., Truffi, D., T sai, S.M., White, F.F., Setubal, J.C., and Kitajima, J.P. 2002. Comparison of the genomes of two Xanthomonas pathogens with differing host specificities. Nature 417:459 463.

PAGE 146

146 Daniels, M.J., Barber, C.E., Turner, P.C., Sawczyc, M.K., Byrde, R.J., and Fieldin g, A.H. 1984. Cloning of genes involved in pathogenicity of Xanthomonas campestris pv. campestris using the broad host range cosmid pLAFR1. EMBO J 3:3323 3328. Daurelio, L.D., Romero, M.S., Petrocelli, S., Merelo, P., Cortadi, A.A., Talon, M., Tadeo, F.R., and Orellano, E.G. 2013. Characterization of Citrus sinensis transcription factors closely associated with the non host response to Xanthomonas campestris pv vesicatoria J Plant Physiol. de Lange, O., Schreiber, T., Schandry, N., Radeck, J., Braun, K.H. Koszinowski, J., Heuer, H., Strauss, A., and Lahaye, T. 2013. Breaking the DNA binding code of Ralstonia solanacearum TAL effectors provides new possibilities to generate plant resistance genes against bacterial wilt disease. New Phytol. de Souza, T.A., Soprano, A.S., de Lira, N.P., Quaresma, A.J., Pauletti, B.A., Paes Leme, A.F., and Benedetti, C.E. 2012. The TAL effector PthA4 interacts with nuclear factors involved in RNA dependent processes including a HMG protein that selectively binds poly(U) RNA. P LoS One 7:e32305. Deane, J., Abrusci, P., Johnson, S., and Lea, S. 2010. Timing is everything: the regulation of type III secretion. Cellular and Molecular Life Sciences 67:1065 1075. Deng, D., Yan, C., Pan, X., Mahfouz, M., Wang, J., Zhu, J.K., Shi, Y., a nd Yan, N. 2012. Structural basis for sequence specific recognition of DNA by TAL effectors. Science 335:720 723. Deslandes, L., and Rivas, S. 2012. Catch me if you can: bacterial effectors and plant targets. Trends Plant Sci 17:644 655. Deslandes, L., Oli vier, J., Theulieres, F., Hirsch, J., Feng, D.X., Bittner Eddy, P., Beynon, J., and Marco, Y. 2002. Resistance to Ralstonia solanacearum in Arabidopsis thaliana is conferred by the recessive RRS1 R gene, a member of a novel family of resistance genes. Proc Natl Acad Sci U S A 99:2404 2409. Dixon, R.A., and Paiva, N.L. 1995. Stress Induced Phenylpropanoid Metabolism. Plant Cell 7:1085 1097. Dixon, R.A., Achnine, L., Kota, P., Liu, C.J., Reddy, M.S., and Wang, L. 2002. The phenylpropanoid pathway and plant de fence a genomics perspective. Mol Plant Pathol 3:371 390. Domingues, M.N., De Souza, T.A., Cernadas, R.A., de Oliveira, M.L., Docena, C., Farah, C.S., and Benedetti, C.E. 2010. The Xanthomonas citri effector protein PthA interacts with citrus proteins invo lved in nuclear transport, protein folding and ubiquitination associated with DNA repair. Mol Plant Pathol 11:663 675.

PAGE 147

147 Dong, W., Nowara, D., and Schweizer, P. 2006. Protein polyubiquitination plays a role in basal host resistance of barley. Plant Cell 18:3 321 3331. Doyle, E.L., Stoddard, B.L., Voytas, D.F., and Bogdanove, A.J. 2013. TAL effectors: highly adaptable phytobacterial virulence factors and readily engineered DNA targeting proteins. Trends Cell Biol. Doyle, E.L., Booher, N.J., Standage, D.S., Voyt as, D.F., Brendel, V.P., Vandyk, J.K., and Bogdanove, A.J. 2012. TAL Effector Nucleotide Targeter (TALE NT) 2.0: tools for TAL effector design and target prediction. Nucleic Acids Res 40:W117 122. Du, Z., Zhou, X., Ling, Y., Zhang, Z., and Su, Z. 2010. agr iGO: a GO analysis toolkit for the agricultural community. Nucleic Acids Research 38:W64 W70. Duan, Y., Castaneda, A., Zhao, G., Erdos, G., and Gabriel, D. 1999. Expression of a single, host specific, bacterial pathogenicity gene in plant cells elicits div ision, enlargement, and cell death. Molecular Plant Microbe Interactions 12:556 560. Dubos, C., Stracke, R., Grotewold, E., Weisshaar, B., Martin, C., and Lepiniec, L. 2010. MYB transcription factors in Arabidopsis Trends Plant Sci 15:573 581. Dunger, G., Relling, V.M., Tondo, M.L., Barreras, M., Ielpi, L., Orellano, E.G., and Ottado, J. 2007. Xanthan is not essential for pathogenicity in citrus canker but contributes to Xanthomonas epiphytic survival. Arch Microbiol 188:127 135. Dunger, G., Garofalo, C.G. Gottig, N., Garavaglia, B.S., Rosa, M.C., Farah, C.S., Orellano, E.G., and Ottado, J. 2012. Analysis of three Xanthomonas axonopodis pv. citri effector proteins in pathogenicity and their interactions with host plant proteins. Mol Plant Pathol 13:865 876 El Yacoubi, B., Brunings, A.M., Yuan, Q., Shankar, S., and Gabriel, D.W. 2007. In planta horizontal transfer of a major pathogenicity effector gene. Appl Environ Microbiol 73:1612 1621. Enrique, R., Siciliano, F., Favaro, M.A., Gerhardt, N., Roeschlin, R ., Rigano, L., Sendin, L., Castagnaro, A., Vojnov, A., and Marano, M.R. 2011. Novel demonstration of RNAi in citrus reveals importance of citrus callose synthase in defence against Xanthomonas citri subsp. citri Plant Biotechnol J 9:394 407. Escalon, A., Javegny, S., Vernire, C., Nol, L.D., Vital, K., Poussier, S., Hajri, A., Boureau, T., Pruvost, O., Arlat, M., and Gagnevin, L. 2013. Variations in type III effector repertoires, pathological phenotypes and host range of Xanthomonas citri pv citri pathot ypes. Mol Plant Pathol. Escamilla Trevino, L.L., Chen, W., Card, M.L., Shih, M.C., Cheng, C.L., and Poulton, J.E. 2006. Arabidopsis thaliana beta Glucosidases BGLU45 and BGLU46 hydrolyse monolignol glucosides. Phytochemistry 67:1651 1660.

PAGE 148

148 Eulgem, T., and S omssich, I.E. 2007. Networks of WRKY transcription factors in defense signaling. Current Opinion in Plant Biology 10:366 371. Feng, F., and Zhou, J. M. 2012. Plant bacterial pathogen interactions mediated by type III effectors. Current Opinion in Plant Bio logy 15:469 476. Figueiredo, J., Minsavage, G., Graham, J., White, F., and Jones, J. 2011a. Mutational analysis of type III effector genes from Xanthomonas citri subsp. citri European Journal of Plant Pathology 130:339 347. Figueiredo, J.F., Rmer, P., La haye, T., Graham, J.H., White, F.F., and Jones, J.B. 2011b. Agrobacterium mediated transient expression in citrus leaves: a rapid tool for gene expression and functional gene assay. Plant Cell Rep 30:1339 1345. Fu, X.Z., and Liu, J.H. 2013. Transcriptional Profiling of Canker Resistant Transgenic Sweet Orange ( Citrus sinensis Osbeck) Constitutively Overexpressing a Spermidine Synthase Gene. Biomed Res Int 2013:918136. Fu, X.Z., Gong, X.Q., Zhang, Y.X., Wang, Y., and Liu, J.H. 2012. Different transcriptional response to Xanthomonas citri subsp. citri between kumquat and sweet orange with contrasting canker tolerance. PLoS One 7:e41790. Fu, Z.Q., and Dong, X. 2013. Systemic acquired resistance: turning local infection into global defense. Annu Rev Plant Biol 64:839 863. Fujikawa, T., Ishihara, H., Leach, J.E., and Tsuyumu, S. 2006. Suppression of defense response in plants by the avrBs3/p thA gene family of Xanthomonas spp. Mol Plant Microbe Interact 19:342 349. Gaj, T., Gersbach, C.A., and Barbas, C.F., 3rd. 2013. ZFN, TALEN, and CRISPR/Cas based methods for genome engineering. Trends Biotechnol. Galichet, A., and Gruissem, W. 2006. Develo pmentally controlled farnesylation modulates AtNAP1;1 function in cell proliferation and cell expansion during Arabidopsis leaf development. Plant Physiol 142:1412 1426. Garavaglia, B.S., Thomas, L., Gottig, N., Dunger, G., Garofalo, C.G., Daurelio, L.D., Ndimba, B., Orellano, E.G., Gehring, C., and Ottado, J. 2010. A eukaryotic acquired gene by a biotrophic phytopathogen allows prolonged survival on the host by counteracting the shut down of plant photosynthesis. PLoS One 5:e8950. Gendron, J.M., Liu, J.S., Fan, M., Bai, M.Y., Wenkel, S., Springer, P.S., Barton, M.K., and Wang, Z.Y. 2012. Brassinosteroids regulate organ boundary formation in the shoot apical meristem of Arabidopsis. Proc Natl Acad Sci U S A 109:21152 21157. Gmitter, F., Chen, C., Machado, M. de Souza, A., Ollitrault, P., Froehlicher, Y., and Shimizu, T. 2012. Citrus genomics. Tree Genetics & Genomes 8:611 626.

PAGE 149

1 49 Gohre, V., Spallek, T., Haweker, H., Mersmann, S., Mentzel, T., Boller, T., de Torres, M., Mansfield, J.W., and Robatzek, S. 2008. Pl ant pattern recognition receptor FLS2 is directed for degradation by the bacterial ubiquitin ligase AvrPtoB. Curr Biol 18:1824 1832. Gottig, N., Garavaglia, B.S., Garofalo, C.G., Orellano, E.G., and Ottado, J. 2009. A filamentous hemagglutinin like protein of Xanthomonas axonopodis pv. citri the phytopathogen responsible for citrus canker, is involved in bacterial virulence. PLoS One 4:e4358. Gottig, N., Garavaglia, B.S., Daurelio, L.D., Valentine, A., Gehring, C., Orellano, E.G., and Ottado, J. 2008. Xant homonas axonopodis pv. citri uses a plant natriuretic peptide like protein to modify host homeostasis. Pages 18631 18636 in: Proc Natl Acad Sci U S A, United States. Gottwald, T.R., Graham, J.H., and Tim, S. (2002). Citrus Canker: The Pathogen and Its Impa ct (Online. Plant Health Progress ). Graham, J.H., Gottwald, T.R., Cubero, J., and Achor, D.S. 2004. Xanthomonas axonopodis pv. citri : factors affecting successful eradication of citrus canker. Mol Plant Pathol 5:1 15. Grau, J., Wolf, A., Reschke, M., Bonas U., Posch, S., and Boch, J. 2013. Computational predictions provide insights into the biology of TAL effector target sites. PLoS Comput Biol 9:e1002962. Gu, K., Yang, B., Tian, D., Wu, L., Wang, D., Sreekala, C., Yang, F., Chu, Z., Wang, G.L., White, F.F ., and Yin, Z. 2005. R gene expression induced by a type III effector triggers disease resistance in rice. Nature 435:1122 1125. Guo, Y., Sagaram, U.S., Kim, J.S., and Wang, N. 2010. Requirement of the galU gene for polysaccharide production by and pathoge nicity and growth In Planta of Xanthomonas citri subsp. citri. Pages 2234 2242 in: Appl Environ Microbiol, United States. Guo, Y., Figueiredo, F., Jones, J., and Wang, N. 2011. HrpG and HrpX play global roles in coordinating different virulence traits of X anthomonas axonopodis pv. citri Mol Plant Microbe Interact 24:649 661. Gutterson, N., and Reuber, T.L. 2004. Regulation of disease resistance pathways by AP2/ERF transcription factors. Current Opinion in Plant Biology 7:465 471. Hajri, A., Brin, C., Hunau lt, G., Lardeux, F., Lemaire, C., Manceau, C., Boureau, T., and Poussier, S. 2009. A "repertoire for repertoire" hypothesis: repertoires of type three effectors are candidate determinants of host specificity in Xanthomonas PLoS One 4:e6632.

PAGE 150

150 Hann, D.R., an d Rathjen, J.P. 2010. The long and winding road: virulence effector proteins of plant pathogenic bacteria. Cell Mol Life Sci 67:3425 3434. Hann, D.R., Gimenez Ibanez, S., and Rathjen, J.P. 2010. Bacterial virulence effectors and their activities. Curr Opin Plant Biol 13:388 393. He, Y.W., and Zhang, L.H. 2008. Quorum sensing and virulence regulation in Xanthomonas campestris Pages 842 857 in: FEMS Microbiol Rev, England. Herbers, K., Conrads Strauch, J., and Bonas, U. 1992. Race specificity of plant resist ance to bacterial spot disease determined by repetitive motifs in a bacterial avirulence protein. Nature (London) 355:172 174. Heuer, H., Yin, Y.N., Xue, Q.Y., Smalla, K., and Guo, J.H. 2007. Repeat domain diversity of avrBs3 like genes in Ralstonia solana cearum strains and association with host preferences in the field. Appl Environ Microbiol 73:4379 4384. Huguet, E., Hahn, K., Wengelnik, K., and Bonas, U. 1998. hpaA mutants of Xanthomonas campestris pv vesicatoria are affected in pathogenicity but retain the ability to induce host specific hypersensitive reaction. Mol Microbiol 29:1379 1390. Hummel, A.W., Doyle, E.L., and Bogdanove, A.J. 2012. Addition of transcription activator like effector binding sites to a pathogen strain specific rice bacterial blig ht resistance gene makes it effective against additional strains and against bacterial leaf streak. New Phytol 195:883 893. Husbands, A., Bell, E.M., Shuai, B., Smith, H.M., and Springer, P.S. 2007. LATERAL ORGAN BOUNDARIES defines a new family of DNA bind ing transcription factors and can interact with specific bHLH proteins. Nucleic Acids Res 35:6663 6671. Hwang, I.S., and Hwang, B.K. 2010. Role of the pepper cytochrome P450 gene CaCYP450A in defense responses against microbial pathogens. Planta 232:1409 1 421. Jalan, N., Kumar, D., Yu, F., Jones, J.B., Graham, J.H., and Wang, N. 2013. Complete Genome Sequence of Xanthomonas citri subsp. citri Strain Aw12879, a Restricted Host Range Citrus Canker Causing Bacterium. Genome Announc 1. Jones, J.D., and Dangl, J .L. 2006. The plant immune system. Nature 444:323 329. Journot Catalino, N., Somssich, I.E., Roby, D., and Kroj, T. 2006. The transcription factors WRKY11 and WRKY17 act as negative regulators of basal resistance in Arabidopsis thaliana Plant Cell 18:3289 3302. Juge, N. 2006. Plant protein inhibitors of cell wall degrading enzymes. Trends Plant Sci 11:359 367.

PAGE 151

151 Kachroo, A., and Kachroo, P. 2009. Fatty Acid derived signals in plant defense. Annu Rev Phytopathol 47:153 176. Kaffarnik, F.A., Jones, A.M., Rathj en, J.P., and Peck, S.C. 2009. Effector proteins of the bacterial pathogen Pseudomonas syringae alter the extracellular proteome of the host plant, Arabidopsis thaliana. Mol Cell Proteomics 8:145 156. Katzen, F., Ferreiro, D.U., Oddo, C.G., Ielmini, M.V., Becker, A., Puhler, A., and Ielpi, L. 1998. Xanthomonas campestris pv. campestris gum mutants: effects on xanthan biosynthesis and plant virulence. J Bacteriol 180:1607 1617. Kay, S., and Bonas, U. 2009. How Xanthomonas type III effectors manipulate the ho st plant. Curr Opin Microbiol 12:37 43. Kay, S., Hahn, S., Marois, E., Hause, G., and Bonas, U. 2007. A bacterial effector acts as a plant transcription factor and induces a cell size regulator. Science 318:648 651. Kay, S., Hahn, S., Marois, E., Wieduwild R., and Bonas, U. 2009. Detailed analysis of the DNA recognition motifs of the Xanthomonas type III effectors AvrBs3 and AvrBs3Deltarep16. Plant J 59:859 871. Kazan, K., and Manners, J.M. 2013. MYC2: The Master in Action. Mol Plant 6:686 703. Kearney, B. and Staskawicz, B.J. 1990. Widespread distribution and fitness contribution of X anthomonas campestris avirulence gene avrBs2 Nature 346:385 386. Khalaf, A., Moore, G.A., Jones, J.B., and Gmitter Jr, F.G. 2007. New insights into the resistance of Nagami kumquat to canker disease. Physiological and Molecular Plant Pathology 71:240 250. Khalaf, A.A., Gmitter, F.G., Jr., Conesa, A., Dopazo, J., and Moore, G.A. 2011. Fortunella margarita transcriptional reprogramming triggered by Xanthomonas citri subsp. citr i Page 159 in: BMC Plant Biol, England. Kim, J., and Lee, H.W. 2013. Direct activation of EXPANSIN14 by LBD18 in the gene regulatory network of lateral root formation in Arabidopsis Plant Signal Behav 8. Kim, J.G., Taylor, K.W., Hotson, A., Keegan, M., S chmelz, E.A., and Mudgett, M.B. 2008. XopD SUMO protease affects host transcription, promotes pathogen growth, and delays symptom development in xanthomonas infected tomato leaves. Plant Cell 20:1915 1929. Kim, J.G., Li, X., Roden, J.A., Taylor, K.W., Aakr e, C.D., Su, B., Lalonde, S., Kirik, A., Chen, Y., Baranage, G., McLane, H., Martin, G.B., and Mudgett, M.B. 2009a. Xanthomonas T3S Effector XopN Suppresses PAMP Triggered Immunity and

PAGE 152

152 Interacts with a Tomato Atypical Receptor Like Kinase and TFT1. Plant C ell 21:1305 1323. Kim, J.S., Sagaram, U.S., Burns, J.K., Li, J.L., and Wang, N. 2009b. Response of sweet orange ( Citrus sinensis ) to Candidatus Liberibacter asiaticus' infection: microscopy and microarray analyses. Phytopathology 99:50 57. Kim, K.C., Fan, B., and Chen, Z. 2006. Pathogen induced Arabidopsis WRKY7 is a transcriptional repressor and enhances plant susceptibility to Pseudomonas syringae Plant Physiol 142:1180 1192. Kim, Y., Kweon, J., Kim, A., Chon, J.K., Yoo, J.Y., Kim, H.J., Kim, S., Lee, C ., Jeong, E., Chung, E., Kim, D., Lee, M.S., Go, E.M., Song, H.J., Kim, H., Cho, N., Bang, D., and Kim, J.S. 2013. A library of TAL effector nucleases spanning the human genome. Nat Biotechnol 31:251 258. Kingsley, M.T., Gabriel, D.W., Marlow, G.C., and Ro berts, P.D. 1993. The opsX locus of Xanthomonas campestris affects host range and biosynthesis of lipopolysaccharide and extracellular polysaccharide. J Bacteriol 175:5839 5850. Knoth, C., Ringler, J., Dangl, J.L., and Eulgem, T. 2007. Arabidopsis WRKY70 i s required for full RPP4 mediated disease resistance and basal defense against Hyaloperonospora parasitica. Mol Plant Microbe Interact 20:120 128. Laia, M.L., Moreira, L.M., Dezajacomo, J., Brigati, J.B., Ferreira, C.B., Ferro, M.I., Silva, A.C., Ferro, J. A., and Oliveira, J.C. 2009. New genes of Xanthomonas citri subsp. citri involved in pathogenesis and adaptation revealed by a transposon based mutant library. Page 12 in: BMC Microbiol, England. Langlois Meurinne, M., Gachon, C.M., and Saindrenan, P. 2005 Pathogen responsive expression of glycosyltransferase genes UGT73B3 and UGT73B5 is necessary for resistance to Pseudomonas syringae pv tomato in Arabidopsis Plant Physiol 139:1890 1901. Lee, S., Lee, J., Lee, D., and Lee, Y. 2008. Diversity of PthA gene of Xanthomonas strains causing citrus bacterial canker and its relationship with virulence. Plant Pathology Journal 24:357 360. Li, J., and Wang, N. 2011. The wxacO gene of Xanthomonas citri ssp. citri encodes a protein with a role in lipopolysaccharide b iosynthesis, biofilm formation, stress tolerance and virulence. Mol Plant Pathol 12:381 396. Li, J., Brader, G., Kariola, T., and Palva, E.T. 2006. WRKY70 modulates the selection of signaling pathways in plant defense. Plant J 46:477 491. Li, L., Chang, Z. Pan, Z., Fu, Z.Q., and Wang, X. 2008. Modes of heme binding and substrate access for cytochrome P450 CYP74A revealed by crystal structures of allene oxide synthase. Proc Natl Acad Sci U S A 105:13883 13888.

PAGE 153

153 Li, L., Atef, A., Piatek, A., Ali, Z., Piatek, M., Aouida, M., Sharakuu, A., Mahjoub, A., Wang, G., Khan, S., Fedoroff, N.V., Zhu, J.K., and Mahfouz, M.M. 2013a. Characterization and DNA Binding Specificities of Ralstonia TAL Like Effectors. Mol Plant. Li, T., and Yang, B. 2013. TAL effector nuclease ( TALEN) engineering. Methods Mol Biol 978:63 72. Li, T., Huang, S., Zhou, J., and Yang, B. 2013b. Designer TAL Effectors Induce Disease Susceptibility and Resistance to Xanthomonas oryzae pv. Oryzae in Rice. Mol Plant 6:781 789. Li, T., Liu, B., Spalding, M .H., Weeks, D.P., and Yang, B. 2012. High efficiency TALEN based gene editing produces disease resistant rice. Pages 390 392 in: Nat Biotechnol, United States. Liu, Q., Yuan, M., Zhou, Y., Li, X., Xiao, J., and Wang, S. 2011. A paralog of the MtN3/saliva f amily recessively confers race specific resistance to Xanthomonas oryzae in rice. Plant Cell Environ 34:1958 1969. Lorenzo, O., and Solano, R. 2005. Molecular players regulating the jasmonate signalling network. Curr Opin Plant Biol 8:532 540. Lorenzo, O., Chico, J.M., Snchez Serrano, J.J., and Solano, R. 2004. JASMONATE INSENSITIVE1 encodes a MYC transcription factor essential to discriminate between different jasmonate regulated defense responses in Arabidopsis Plant Cell 16:1938 1950. Majer, C., and Ho chholdinger, F. 2011. Defining the boundaries: structure and function of LOB domain proteins. Trends Plant Sci 16:47 52. Mak, A.N., Bradley, P., Cernadas, R.A., Bogdanove, A.J., and Stoddard, B.L. 2012. The Crystal Structure of TAL Effector PthXo1 Bound to Its DNA Target. Science. Malavolta, J.V., Yamashiro, T., Nogueira, E., and Feichtenberger, E. 1984. Distribuio do tipo C de Xanthomonas campestris pv. citri no Estado de So Paulo. Summa Phytopathologica 10:11. Marcos, J.F., Gonzalez Candelas, L., and Z acarias, L. 2005. Involvement of ethylene biosynthesis and perception in the susceptibility of citrus fruits to Penicillium digitatum infection and the accumulation of defence related mRNAs. J Exp Bot 56:2183 2193. Marois, E., Van den Ackerveken, G., and B onas, U. 2002. The xanthomonas type III effector protein AvrBs3 modulates plant gene expression and induces cell hypertrophy in the susceptible host. Mol Plant Microbe Interact 15:637 646.

PAGE 154

154 Martinez Godoy, M.A., Mauri, N., Juarez, J., Marques, M.C., Santiag o, J., Forment, J., and Gadea, J. 2008. A genome wide 20 K citrus microarray for gene expression analysis. Page 318 in: BMC Genomics, England. Meldau, S., Erb, M., and Baldwin, I.T. 2012. Defence on demand: mechanisms behind optimal defence patterns. Ann B ot 110:1503 1514. Metz, M., Dahlbeck, D., Morales, C.Q., Al Sady, B., Clark, E.T., and Staskawicz, B.J. 2005. The conserved Xanthomonas campestris pv. vesicatoria effector protein XopX is a virulence factor and suppresses host defense in Nicotiana benthami ana. Plant J 41:801 814. Miller, J.C., Tan, S., Qiao, G., Barlow, K.A., Wang, J., Xia, D.F., Meng, X., Paschon, D.E., Leung, E., Hinkley, S.J., Dulay, G.P., Hua, K.L., Ankoudinova, I., Cost, G.J., Urnov, F.D., Zhang, H.S., Holmes, M.C., Zhang, L., Gregory, P.D., and Rebar, E.J. 2011. A TALE nuclease architecture for efficient genome editing. Nat Biotechnol 29:143 148. Millet, Y.A., Danna, C.H., Clay, N.K., Songnuan, W., Simon, M.D., Werck Reichhart, D., and Ausubel, F.M. 2010. Innate immune responses activa ted in Arabidopsis roots by microbe associated molecular patterns. Plant Cell 22:973 990. Morbitzer, R., Rmer, P., Boch, J., and Lahaye, T. 2010. Regulation of selected genome loci using de novo engineered transcription activator like effector (TALE) type transcription factors. Proc Natl Acad Sci U S A 107:21617 21622. Moreira, L.M., de Souza, R.F., Almeida, N.F., Setubal, J.C., Oliveira, J.C., Furlan, L.R., Ferro, J.A., and da Silva, A.C. 2004. Comparative genomics analyses of citrus associated bacteria. Annu Rev Phytopathol 42:163 184. Moreira, L.M., Almeida, N.F., Potnis, N., Digiampietri, L.A., Adi, S.S., Bortolossi, J.C., da Silva, A.C., da Silva, A.M., de Moraes, F.E., de Oliveira, J.C., de Souza, R.F., Facincani, A.P., Ferraz, A.L., Ferro, M.I., Furl an, L.R., Gimenez, D.F., Jones, J.B., Kitajima, E.W., Laia, M.L., Leite, R.P., Nishiyama, M.Y., Rodrigues Neto, J., Nociti, L.A., Norman, D.J., Ostroski, E.H., Pereira, H.A., Staskawicz, B.J., Tezza, R.I., Ferro, J.A., Vinatzer, B.A., and Setubal, J.C. 201 0. Novel insights into the genomic basis of citrus canker based on the genome sequences of two strains of Xanthomonas fuscans subsp. aurantifolii BMC Genomics 11:238. Moscou, M.J., and Bogdanove, A.J. 2009. A simple cipher governs DNA recognition by TAL e ffectors. Science 326:1501. Murakami, M., Sforca, M., Neves, J., Paiva, J., Domingues, M., Pereira, A., Zeri, A., and Benedetti, C. 2010. The repeat domain of the type III effector protein PthA shows a TPR like structure and undergoes conformational change s upon DNA interaction. Proteins Structure Function and Bioinformatics 78:3386 3395.

PAGE 155

155 Muoz Bodnar, A., Bernal, A., Szurek, B., and Lpez, C.E. 2013. Tell me a tale of TALEs. Mol Biotechnol 53:228 235. Naoumkina, M.A., Zhao, Q., Gallego Giraldo, L., Dai, X. Zhao, P.X., and Dixon, R.A. 2010. Genome wide analysis of phenylpropanoid defence pathways. Mol Plant Pathol 11:829 846. Navarro, L., Dunoyer, P., Jay, F., Arnold, B., Dharmasiri, N., Estelle, M., Voinnet, O., and Jones, J.D. 2006. A plant miRNA contribu tes to antibacterial resistance by repressing auxin signaling. Pages 436 439 in: Science, United States. Ollitrault, P., Terol, J., Chen, C., Federici, C.T., Lotfy, S., Hippolyte, I., Ollitrault, F., Brard, A., Chauveau, A., Cuenca, J., Costantino, G., Ka car, Y., Mu, L., Garcia Lor, A., Froelicher, Y., Aleza, P., Boland, A., Billot, C., Navarro, L., Luro, F., Roose, M.L., Gmitter, F.G., Talon, M., and Brunel, D. 2012. A reference genetic map of C. clementina hort. ex Tan.; citrus evolution inferences from comparativ e mapping. BMC Genomics 13:593. Pandey, S.P., and Somssich, I.E. 2009. The role of WRKY transcription factors in plant immunity. Plant Physiol 150:1648 1655. Park, J.M., Park, C.J., Lee, S.B., Ham, B.K., Shin, R., and Paek, K.H. 2001. Overexpress ion of the tobacco Tsi1 gene encoding an EREBP/AP2 type transcription factor enhances resistance against pathogen attack and osmotic stress in tobacco. Plant Cell 13:1035 1046. Potnis, N., Krasileva, K., Chow, V., Almeida, N.F., Patil, P.B., Ryan, R.P., Sh arlach, M., Behlau, F., Dow, J.M., Momol, M., White, F.F., Preston, J.F., Vinatzer, B.A., Koebnik, R., Setubal, J.C., Norman, D.J., Staskawicz, B.J., and Jones, J.B. 2011. Comparative genomics reveals diversity among xanthomonads infecting tomato and peppe r. BMC Genomics 12:146. Raffaele, S., Vailleau, F., Leger, A., Joubes, J., Miersch, O., Huard, C., Blee, E., Mongrand, S., Domergue, F., and Roby, D. 2008. A MYB transcription factor regulates very long chain fatty acid biosynthesis for activation of the h ypersensitive cell death response in Arabidopsis. Plant Cell 20:752 767. Rahmani, M., and Hodges, A.W. 2009.Economic impact of the Florida citrus industry in 2007 2008. Rigano, L.A., Siciliano, F., Enrique, R., Sendin, L., Filippone, P., Torres, P.S., Ques ta, J., Dow, J.M., Castagnaro, A.P., Vojnov, A.A., and Marano, M.R. 2007. Biofilm formation, epiphytic fitness, and canker development in Xanthomonas axonopodis pv. citri Mol Plant Microbe Interact 20:1222 1230. Robert Seilaniantz, A., Grant, M., and Jone s, J.D. 2011. Hormone crosstalk in plant disease and defense: more than just jasmonate salicylate antagonism. Annu Rev Phytopathol 49:317 343.

PAGE 156

156 Rushton, P.J., Somssich, I.E., Ringler, P., and Shen, Q.J. 2010. WRKY transcription factors. Trends in Plant Scie nce 15:247 258. Russel, M. 1998. Macromolecular assembly and secretion across the bacterial cell envelope: type II protein secretion systems. Pages 485 499 in: J Mol Biol, England. Ryals, J.A., Neuenschwander, U.H., Willits, M.G., Molina, A., Steiner, H.Y. and Hunt, M.D. 1996. Systemic Acquired Resistance. Plant Cell 8:1809 1819. Ryan, R.P., Vorhlter, F.J., Potnis, N., Jones, J.B., Van Sluys, M.A., Bogdanove, A.J., and Dow, J.M. 2011. Pathogenomics of Xanthomonas : understanding bacterium plant interaction s. Nat Rev Microbiol 9:344 355. Rybak, M., Minsavage, G., Stall, R., and Jones, J. 2009. Identification of Xanthomonas citri ssp citri host specificity genes in a heterologous expression host. Molecular Plant Pathology 10:249 262. Rmer, P., Recht, S., and Lahaye, T. 2009a. A single plant resistance gene promoter engineered to recognize multiple TAL effectors from disparate pathogens. Proc Natl Acad Sci U S A 106:20526 20531. Rmer, P., Hahn, S., Jordan, T., Strauss, T., Bonas, U., and Lahaye, T. 2007. Plan t pathogen recognition mediated by promoter activation of the pepper Bs3 resistance gene. Science 318:645 648. Rmer, P., Strauss, T., Hahn, S., Scholze, H., Morbitzer, R., Grau, J., Bonas, U., and Lahaye, T. 2009b. Recognition of AvrBs3 like proteins is m ediated by specific binding to promoters of matching pepper Bs3 alleles. Plant Physiol 150:1697 1712. Rmer, P., Recht, S., Strauss, T., Elsaesser, J., Schornack, S., Boch, J., Wang, S., and Lahaye, T. 2010. Promoter elements of rice susceptibility genes a re bound and activated by specific TAL effectors from the bacterial blight pathogen, Xanthomonas oryzae pv. oryzae New Phytol 187:1048 1057. Salzberg, S.L., Sommer, D.D., Schatz, M.C., Phillippy, A.M., Rabinowicz, P.D., Tsuge, S., Furutani, A., Ochiai, H. Delcher, A.L., Kelley, D., Madupu, R., Puiu, D., Radune, D., Shumway, M., Trapnell, C., Aparna, G., Jha, G., Pandey, A., Patil, P.B., Ishihara, H., Meyer, D.F., Szurek, B., Verdier, V., Koebnik, R., Dow, J.M., Ryan, R.P., Hirata, H., Tsuyumu, S., Won Lee S., Seo, Y.S., Sriariyanum, M., Ronald, P.C., Sonti, R.V., Van Sluys, M.A., Leach, J.E., White, F.F., and Bogdanove, A.J. 2008. Genome sequence and rapid evolution of the rice pathogen Xanthomonas oryzae pv oryzae PXO99A. BMC Genomics 9:204. Sanjana, N. E., Cong, L., Zhou, Y., Cunniff, M.M., Feng, G., and Zhang, F. 2012. A transcription activator like effector toolbox for genome engineering. Nat Protoc 7:171 192.

PAGE 157

157 Schaad, N.W., Postnikova, E., Lacy, G., Sechler, A., Agarkova, I., Stromberg, P.E., Stromberg V.K., and Vidaver, A.K. 2006. Emended classification of xanthomonad pathogens on citrus. Syst Appl Microbiol 29:690 695. Schmid Burgk, J.L., Schmidt, T., Kaiser, V., Honing, K., and Hornung, V. 2013. A ligation independent cloning technique for high thro ughput assembly of transcription activator like effector genes. Nat Biotechnol 31:76 81. Scholze, H., and Boch, J. 2010. TAL effector DNA specificity. Virulence 1:428 432. Scholze, H., and Boch, J. 2011. TAL effectors are remote controls for gene activatio n. Curr Opin Microbiol 14:47 53. Schornack, S., Moscou, M.J., Ward, E.R., and Horvath, D.M. 2013. Engineering Plant Disease Resistance Based on TAL Effectors. Annu Rev Phytopathol. Schornack, S., Meyer, A., Rmer, P., Jordan, T., and Lahaye, T. 2006. Gene for gene mediated recognition of nuclear targeted AvrBs3 like bacterial effector proteins. J Plant Physiol 163:256 272. Schornack, S., Minsavage, G.V., Stall, R.E., Jones, J.B., and Lahaye, T. 2008. Characterization of AvrHah1, a novel AvrBs3 like effector from Xanthomonas gardneri with virulence and avirulence activity. New Phytol 179:546 556. Schornack, S., Ballvora, A., Gurlebeck, D., Peart, J., Baulcombe, D., Ganal, M., Baker, B., Bonas, U., and Lahaye, T. 2004. The tomato resistance protein Bs4 is a pr edicted non nuclear TIR NB LRR protein that mediates defense responses to severely truncated derivatives of AvrBs4 and overexpressed AvrBs3. Plant J 37:46 60. Schuler, M.A., and Werck Reichhart, D. 2003. Functional genomics of P450s. Annu Rev Plant Biol 54 :629 667. Schulze, S., Kay, S., Buttner, D., Egler, M., Eschen Lippold, L., Hause, G., Kruger, A., Lee, J., Muller, O., Scheel, D., Szczesny, R., Thieme, F., and Bonas, U. 2012. Analysis of new type III effectors from Xanthomonas uncovers XopB and XopS as suppressors of plant immunity. New Phytol 195:894 911. Schwessinger, B., and Ronald, P.C. 2012. Plant innate immunity: perception of conserved microbial signatures. Annu Rev Plant Biol 63:451 482. Sels, J., Mathys, J., De Coninck, B.M., Cammue, B.P., and D e Bolle, M.F. 2008. Plant pathogenesis related (PR) proteins: a focus on PR peptides. Plant Physiol Biochem 46:941 950. Seo, P.J., and Park, C.M. 2010. MYB96 mediated abscisic acid signals induce pathogen resistance response by promoting salicylic acid bio synthesis in Arabidopsis New Phytol 186:471 483.

PAGE 158

158 Shah, J. 2005. Lipids, lipases, and lipid modifying enzymes in plant disease resistance. Annu Rev Phytopathol 43:229 260. Shan, L., He, P., Li, J., Heese, A., Peck, S.C., Nurnberger, T., Martin, G.B., and S heen, J. 2008. Bacterial effectors target the common signaling partner BAK1 to disrupt multiple MAMP receptor signaling complexes and impede plant immunity. Cell Host Microbe 4:17 27. Sheard, L.B., Tan, X., Mao, H., Withers, J., Ben Nissan, G., Hinds, T.R. Kobayashi, Y., Hsu, F.F., Sharon, M., Browse, J., He, S.Y., Rizo, J., Howe, G.A., and Zheng, N. 2010. Jasmonate perception by inositol phosphate potentiated COI1 JAZ co receptor. Nature 468:400 405. Shiotani, H., Fujikawa, T., Ishihara, H., Tsuyumu, S., and Ozaki, K. 2007. A pthA homolog from Xanthomonas axonopodis pv. citri responsible for host specific suppression of virulence. J Bacteriol 189:3271 3279. Shuai, B., Reynaga Pea, C.G., and Springer, P.S. 2002. The lateral organ boundaries gene defines a novel, plant specific gene family. Plant Physiol 129:747 761. Socquet Juglard, D., Kamber, T., Pothier, J.F., Christen, D., Gessler, C., Duffy, B., and Patocchi, A. 2013. Comparative RNA seq analysis of early infected peach leaves by the invasive phytopath ogen Xanthomonas arboricola pv. pruni PLoS One 8:e54196. Solomon, M., Belenghi, B., Delledonne, M., Menachem, E., and Levine, A. 1999. The involvement of cysteine proteases and protease inhibitor genes in the regulation of programmed cell death in plants. Plant Cell 11:431 444. Song, C., and Yang, B. 2010. Mutagenesis of 18 type III effectors reveals virulence function of XopZ(PXO99) in Xanthomonas oryzae pv. oryzae Mol Plant Microbe Interact 23:893 902. Staskawicz, B., Dahlbeck, D., Keen, N., and Napoli, C. 1987. Molecular characterization of cloned avirulence genes from race 0 and race 1 of Pseudomonas syringae pv. glycinea J Bacteriol 169:5789 5794. Stein, M., Dittgen, J., Sanchez Rodriguez, C., Hou, B.H., Molina, A., Schulze Lefert, P., Lipka, V., and Somerville, S. 2006. Arabidopsis PEN3/PDR8, an ATP binding cassette transporter, contributes to nonhost resistance to inappropriate pathogens that enter by direct penetration. Plant Cell 18:731 746. Strau, T., van Poecke, R.M., Strau, A., Rmer, P., Min savage, G.V., Singh, S., Wolf, C., Kim, S., Lee, H.A., Yeom, S.I., Parniske, M., Stall, R.E., Jones, J.B., Choi, D., Prins, M., and Lahaye, T. 2012. RNA seq pinpoints a Xanthomonas TAL effector activated resistance gene in a large crop genome. Proc Natl Ac ad Sci U S A 109:19480 19485.

PAGE 159

159 Streubel, J., Blucher, C., Landgraf, A., and Boch, J. 2012. TAL effector RVD specificities and efficiencies. Pages 593 595 in: Nat Biotechnol, United States. Studholme, D.J., Ibanez, S.G., MacLean, D., Dangl, J.L., Chang, J.H. and Rathjen, J.P. 2009. A draft genome sequence and functional screen reveals the repertoire of type III secreted proteins of Pseudomonas syringae pathovar tabaci 11528. BMC Genomics 10:395. Studholme, D.J., Kemen, E., MacLean, D., Schornack, S., Aritua, V., Thwaites, R., Grant, M., Smith, J., and Jones, J.D. 2010. Genome wide sequencing data reveals virulence factors implicated in banana Xanthomonas wilt. FEMS Microbiol Lett 310:182 192. Sugio, A., Yang, B., Zhu, T., and White, F.F. 2007. Two type III ef fector genes of Xanthomonas oryzae pv. oryzae control the induction of the host genes OsTFIIAgamma1 and OsTFX1 during bacterial blight of rice. Proc Natl Acad Sci U S A 104:10720 10725. Sun, N., and Zhao, H. 2013. Transcription activator like effector nucl eases (TALENs): A highly efficient and versatile tool for genome editing. Biotechnol Bioeng 110:1811 1821. Sun, X., Stall, R., Jones, J., Cubero, J., Gottwald, T., Graham, J., Dixon, W., Schubert, T., Chaloux, P., Stromberg, V., Lacy, G., and Sutton, B. 20 04. Detection and characterization of a new strain of citrus canker bacteria from key Mexican lime and Alemow in South Florida. Plant Disease 88:1179 1188. Swarbrick, P.J., Schulze Lefert, P., and Scholes, J.D. 2006. Metabolic consequences of susceptibilit y and resistance (race specific and broad spectrum) in barley leaves challenged with powdery mildew. Plant Cell Environ 29:1061 1076. Swarup, S., Defeyter, R., Brlansky, R., and Gabriel, D. 1991. A pathogenicity locus from xanthomonas citri enables strains from several pathovars of xanthomonas campestris to elicit cankerlike lesions on citrus. Phytopathology 81:802 809. Swarup, S., Yang, Y., Kingsley, M.T., and Gabriel, D.W. 1992. An Xanthomonas citri pathogenicity gene, pthA, pleiotropically encodes gratui tous avirulence on nonhosts. Mol Plant Microbe Interact 5:204 213. Szurek, B., Marois, E., Bonas, U., and Van den Ackerveken, G. 2001. Eukaryotic features of the Xanthomonas type III effector AvrBs3: protein domains involved in transcriptional activation a nd the interaction with nuclear import receptors from pepper. Plant J 26:523 534. Thatcher, L.F., Kazan, K., and Manners, J.M. 2012a. Lateral organ boundaries domain transcription factors: New roles in plant defense. Plant Signal Behav 7:1702 1704.

PAGE 160

160 Thatche r, L.F., Powell, J.J., Aitken, E.A., Kazan, K., and Manners, J.M. 2012b. The lateral organ boundaries domain transcription factor LBD20 functions in Fusarium wilt Susceptibility and jasmonate signaling in Arabidopsis Plant Physiol 160:407 418. Thimm, O., Blasing, O., Gibon, Y., Nagel, A., Meyer, S., Kruger, P., Selbig, J., Muller, L.A., Rhee, S.Y., and Stitt, M. 2004. MAPMAN: a user driven tool to display genomics data sets onto diagrams of metabolic pathways and other biological processes. Plant J 37:914 939. Trujillo, M., Ichimura, K., Casais, C., and Shirasu, K. 2008. Negative regulation of PAMP triggered immunity by an E3 ubiquitin ligase triplet in Arabidopsis. Curr Biol 18:1396 1401. Truman, W., de Zabala, M.T., and Grant, M. 2006. Type III effectors orchestrate a complex interplay between transcriptional networks to modify basal defence responses during pathogenesis and resistance. Plant J 46:14 33. Underwood, W. 2012. The plant cell wall: a dynamic barrier against pathogen invasion. Front Plant Sci 3 :85. Usadel, B., Nagel, A., Thimm, O., Redestig, H., Blaesing, O.E., Palacios Rojas, N., Selbig, J., Hannemann, J., Piques, M.C., Steinhauser, D., Scheible, W.R., Gibon, Y., Morcuende, R., Weicht, D., Meyer, S., and Stitt, M. 2005. Extension of the visuali zation tool MapMan to allow statistical analysis of arrays, display of corresponding genes, and comparison with known responses. Plant Physiol 138:1195 1204. Van Verk, M., Gatz, C., Linthorst, H., and VanLoon, L. 2009. Transcriptional Regulation of Plant D efense Responses. Plant Innate Immunity 51:397 438. Verniere, C., Hartung, J., Pruvost, O., Civerolo, E., Alvarez, A., Maestri, P., and Luisetti, J. 1998. Characterization of phenotypically distinct strains of Xanthomonas axonopodis pv. citri from Southwes t Asia. European Journal of Plant Pathology 104:477 487. Vogt, T., and Jones, P. 2000. Glycosyltransferases in plant natural product synthesis: characterization of a supergene family. Trends Plant Sci 5:380 386. Wan, J., Zhang, X.C., and Stacey, G. 2008. C hitin signaling and plant disease resistance. Plant Signal Behav 3:831 833. Wang, D., Pajerowska Mukhtar, K., Culler, A.H., and Dong, X. 2007. Salicylic acid inhibits pathogen growth in plants through repression of the auxin signaling pathway. Pages 1784 1 790 in: Curr Biol, England. Wang, Y.S., Pi, L.Y., Chen, X., Chakrabarty, P.K., Jiang, J., De Leon, A.L., Liu, G.Z., Li, L., Benny, U., Oard, J., Ronald, P.C., and Song, W.Y. 2006. Rice XA21 binding

PAGE 161

161 protein 3 is a ubiquitin ligase required for full Xa21 med iated disease resistance. Plant Cell 18:3635 3646. Wanke, D., and Kolukisaoglu, H.U. 2010. An update on the ABCC transporter family in plants: many genes, many proteins, but how many functions? Plant Biol (Stuttg) 12 Suppl 1:15 25. Wichmann, G., and Bergel son, J. 2004. Effector genes of Xanthomonas axonopodis pv. vesicatoria promote transmission and enhance other fitness traits in the field. Genetics 166:693 706. Xiao, S., and Chye, M.L. 2011. Overexpression of Arabidopsis ACBP3 enhances NPR1 dependent plan t resistance to Pseudomonas syringe pv tomato DC3000. Plant Physiol 156:2069 2081. Xu, Q., Chen, L.L., Ruan, X., Chen, D., Zhu, A., Chen, C., Bertrand, D., Jiao, W.B., Hao, B.H., Lyon, M.P., Chen, J., Gao, S., Xing, F., Lan, H., Chang, J.W., Ge, X., Lei, Y ., Hu, Q., Miao, Y., Wang, L., Xiao, S., Biswas, M.K., Zeng, W., Guo, F., Cao, H., Yang, X., Xu, X.W., Cheng, Y.J., Xu, J., Liu, J.H., Luo, O.J., Tang, Z., Guo, W.W., Kuang, H., Zhang, H.Y., Roose, M.L., Nagarajan, N., Deng, X.X., and Ruan, Y. 2012. The dr aft genome of sweet orange (Citrus sinensis). Nat Genet 45:59 66. Xu, Z.S., Chen, M., Li, L.C., and Ma, Y.Z. 2011. Functions and application of the AP2/ERF transcription factor family in crop improvement. J Integr Plant Biol 53:570 585. Yan, Q., and Wang, N. 2012. High Throughput Screening and Analysis of Genes of Xanthomonas citri subsp. citri Involved in Citrus Canker Symptom Development. Mol Plant Microbe Interact 25:69 84. Yang, B., Sugio, A., and White, F.F. 2006a. Os8N3 is a host disease susceptibilit y gene for bacterial blight of rice. Proc Natl Acad Sci U S A 103:10503 10508. Yang, C.W., Gonzalez Lamothe, R., Ewan, R.A., Rowland, O., Yoshioka, H., Shenton, M., Ye, H., O'Donnell, E., Jones, J.D., and Sadanandom, A. 2006b. The E 3 ubiquitin ligase activ ity of A rabidopsis PLANT U BOX17 and its functional tobacco homolog ACRE276 are required for cell death and defense. Plant Cell 18:1084 1098. Yang, L., Hu, C., Li, N., Zhang, J., Yan, J., and Deng, Z. 2011. Transformation of sweet orange [ Citrus sinensis ( L.) Osbeck] with pthA nls for acquiring resistance to citrus canker disease. Plant Mol Biol 75:11 23. Yu, Y., Streubel, J., Balzergue, S., Champion, A., Boch, J., Koebnik, R., Feng, J., Verdier, V., and Szurek, B. 2011. Colonization of rice leaf blades by an African strain of Xanthomonas oryzae pv. oryzae depends on a new TAL effector that

PAGE 162

162 induces the rice nodulin 3 Os11N3 gene. Mol Plant Microbe Interact 24:1102 1113. Yuan, M., Chu, Z., Li, X., Xu, C., and Wang, S. 2010. The bacterial pathogen Xanthomonas oryzae overcomes rice defenses by regulating host copper redistribution. Plant Cell 22:3164 3176. Yuan, T., Li, X., Xiao, J., and Wang, S. 2011. Characterization of Xanthomonas oryzae responsive cis acting element in the promoter of rice race specific susc eptibility gene Xa13 Mol Plant 4:300 309. Zhang, F., Cong, L., Lodato, S., Kosuri, S., Church, G.M., and Arlotta, P. 2011. Efficient construction of sequence specific TAL effectors for modulating mammalian transcription. Nat Biotechnol 29:149 153. Zhang, G., Chen, M., Li, L., Xu, Z., Chen, X., Guo, J., and Ma, Y. 2009. Overexpression of the soybean GmERF3 gene, an AP2/ERF type transcription factor for increased tolerances to salt, drought, and diseases in transgenic tobacco. J Exp Bot 60:3781 3796. Zheng, Z.L., and Zhao, Y. 2013. Transcriptome comparison and gene coexpression network analysis provide a systems view of citrus response to Candidatus Liberibacter asiaticus' infection. BMC Genomics 14:27. Zou, J., Rodriguez Zas, S., Aldea, M., Li, M., Zhu, J., Gonzalez, D.O., Vodkin, L.O., DeLucia, E., and Clough, S.J. 2005. Expression profiling soybean response to Pseudomonas syringae reveals new defense related genes and rapid HR specific downregulation of photosynthesis. Mol Plant Microbe Interact 18:1161 11 74.

PAGE 163

163 BIOGRAPHICAL SKETCH Yang Hu was born in Xinyu, Jiangxi province, China in 1986. He obtained his plant p rotection from China Agricultural University in 2006. Then he got sc holarship to continue his study specialized in pla nt resistance genes to rice blast pathogen Magnaporthe grisea in Department of Plant P athology from the same university, and he acquired Master of Science in 2009. After that, in the same year, Hu was award ed research assistantship to pursue his doctoral s tudies in Department of Plant Pathology in University of Florida. During the Ph.D. period, he worked with Dr. Jeffrey B. Jones and focused on the mechanism of Xanthomonas virulence in causing citrus canker.